Test Bank for Concepts of Genetics 4th Edition by Robert J. Brooker.

Test Bank for Concepts of Genetics 4th Edition by Robert J. Brooker beststudy284@gmail.com

Student name: 1)

The basic unit of heredity is the

A) B) C) D)

2)

.

individual gene macromolecule trait

A variation of a gene is called a(n)

.

A) species B) morph C) genome D) allele E) proteome

3)

Which of the following acts to accelerate chemical reactions in a cell?

A) B) C) D)

nucleic acids lipids carbohydrates enzymes

beststudy284@gmail.com

4)

The building blocks of DNA are

.

A) amino acids B) carbohydrates C) enzymes D) nucleotides E) lipids

5)

A cellular structure that contains genetic information is called a

A) B) C) D)

.

nucleotide genetic code chromosome nucleic acid

6) If a carbohydrate is going to be broken down for energy, which of the following molecules would be directly involved in the breakdown?

A) enzymes B) nucleotides C) microtubules D) lipids E) chromosomes

7)

RNA is formed by the process of

beststudy284@gmail.com

.

A) transcription B) translation C) both transcriptionand translation

8)

A characteristic that an organism displays is called

.

A) a gene B) a chromosome C) DNA D) geneexpression E) a trait

9) If a geneticist is studying the prevalence of a trait in a species, they are at the level of study.

A) B) C) D)

population organismal cellular molecular

10) The study of the processes of transcription and translation is at the biological organization.

beststudy284@gmail.com

level of

A) B) C) D)

11)

Genetic variation is ultimately based upon which of the following?

A) B) C) D)

12)

population organismal cellular molecular

morphological differences variations in nucleotide sequence of the DNA carbohydrate content of the cell translation

A species that contains two copies of each chromosome is called

.

A) a geneticmutation B) a morph C) haploid D) diploid E) alleles

13)

A diploid cell within an organism's body that is not a reproductive cell is _

beststudy284@gmail.com

.

A) a gamete B) a somatic cell C) an allele D) rare E) a sperm cell

14) In many organisms, one set of chromosomes comes from the maternal parent, while the other set comes from the paternal parent. Similar chromosomes in these sets are said to be .

A) morphs B) alleles C) haploid D) homologs E) physiologicaltraits

15)

In humans, gametes are different than other cells of the body in that they are

A) B) C) D)

16)

diploid haploid geneticmutations morphs

What is natural selection?

beststudy284@gmail.com

.

A) When nongenetically based traits are passed from one generation to the next B) A process that allows traits to remain the same over many generations C) A process in whichenvironmental constraints enable some phenotypes to be more successful than others D) When one phenotype is as successful as all other phenotypes

17) is the use of the information in gene sequences to synthesize functional proteins that affect cellular characteristics.

A) B) C) D)

18)

Loss-of-functionmutation Geneexpression The human genomeproject Proteomics

The differences in inherited traits among individuals in a population are called

A) B) C) D)

speciesvariation genetic mutations geneticvariation naturalselection

19) Three populations of an organism, each with drastically different external markings, but still members of the same species, would be called .

beststudy284@gmail.com

.

A) homologs B) mutants C) communities D) alleles E) morphs

20) Which one of the following is NOT one of the general classes of macromolecules that are necessary for cellular function?

A) nucleic acids B) proteins C) ions D) carbohydrates E) lipids

21)

The changes in the genetic makeup of a population over time is called

.

A) homologousrecombination B) model organismsstudies C) geneticcrosses D) biologicalevolution E) hypothesistesting

22)

Which of the following could be used to study the effects of drugs on gene expression?

beststudy284@gmail.com

A) B) C) D)

23)

Which of the following uses a genetic cross to determine patterns of inheritance?

A) B) C) D)

24)

population genetics transmission genetics molecular genetics quantitative genetics

population genetics transmission genetics molecular genetics evolutionary genetics

The traits of an individual organism can be influenced by both genes and the

A) B) C) D)

.

genome environment population size genetic variation within a population

25) Most cellular characteristics,such as structure and function, are the result ofthe synthesis and activity of different _ .

beststudy284@gmail.com

A) B) C) D)

26)

DNA carbohydrates lipids proteins

Genetics is an experimental, as opposed to theoretical, science because

A) B) C) scientists D)

.

hypotheses are tested byperformingexperiments hypotheses are tested by reviewing the literature to see what others have found no hypotheses are accepted or rejected unless they are voted on by a council of it does not rely on observations but only hypothesis testing experiments

27) Performing a mating of two plants, one with a known genotype and the other with an unknown genotype, to determine the genotype of the individual with the unknown genotype would be an example what type of science?

A) B) C) D)

discovery-based science hypothesis testing unethical experimentation an impossible experiment

28) What is the first step that both scientists and students perform to answer questions in genetics? beststudy284@gmail.com

A) B) C) D)

Gathering background information Reaching a conclusion Analyzing data Performing an experiment

29) Mice have 20 chromosomes in their sperm cells. How many chromosomes does a somatic cell from a mouse contain?

A) B) C) D)

20 40 10 80

30) Chronic myelogenous leukemia cells are characterized by the so-called Philadelphia chromosome, which contains part of chromosome 22 fused with chromosome 9. The Philadelphia chromosome is the result of a translocation, in which two chromosomes exchange material. The genetic variation found in chronic myelogenous leukemia is therefore due to

A) gene mutations.

B) major alterations in the structure of a chromosome.

C) variation in the total number of chromosomes.

31) You work in a lab. You engineer a mutant mouse that doesn't synthesize a protein important for breakdown of the sugar galactose and study the results. What type of geneticist are you?

beststudy284@gmail.com

A) B) C) D)

Transmission geneticist Molecular geneticist Population geneticist Proteome geneticist

32) Ball pythons of the same species can look very different from one another. In fact, there are at least 26 types of ball pythons, characterized by their color, eyes, and markings. The blueeyed leucistic ball python has blue eyes and white scales. The bumblebee ball python has black and yellow scales. The coral glow ball python has purple and orange scales. What term best describes these different types of pythons?

A) B) C) D)

Morphs Alleles Homologs Model organisms

33) You are a geneticist trying to understand why Tay-Sachs disease is more prevalent in Ashkenazi Jews compared to other groups of people. What level of biological organization are you studying?

A) B) C) D)

Molecular level Cellular level Organism level Population level

beststudy284@gmail.com

Answer Key Test name: Chapter 01 Test Bank

1) B 2) D 3) D 4) D 5) C 6) A 7) A 8) E 9) A 10) D 11) B 12) D beststudy284@gmail.com

13) B 14) D 15) B 16) C 17) B 18) C 19) E 20) C 21) D 22) C 23) B 24) B 25) D 26) A

beststudy284@gmail.com

27) B 28) A 29) B 30) B 31) B 32) A 33) D

beststudy284@gmail.com

Student name: 1)

Select traits associated with prokaryotic cells. Check all that apply.

A) B) C) D)

2)

Genetic information is contained within a nucleoid region.

Genetic material is organized as a single circular chromosome.

They have a cell wall surrounding their plasma membrane.

They have membrane-bound organelles in their cytoplasm.

Select the cells that are eukaryotic. Check all that apply.

A) bacteria B) fungi C) protists D) plants E) animals

3)

Select the phases that are part of interphase. Check all that apply.

A) B) C) D)

4)

G1 phase G2 phase S phase Metaphase

Select the characteristics that are true of restriction points. Check all that apply.

A) An example is the restriction point that occurs in the G1 phase.

B) In many cases, molecular changes must be present at this point for the cell to continue through the cell cycle.

C) Cells passing this point are committed to the next stage of the cell cycle.

D) Cells passing this point can reverse to an earlier phase of the cell cycle.

Version 1

1

stumerit@gmail.com

5)

Cytokinesis in animals occurs through the formation of a forms.

A) B) C) D)

6)

7)

.

structures thatcontain the genetic material membrane-boundcompartments of eukaryotic cells the region thatcontains the DNA in prokaryotic cells the outer, rigidcovering of a prokaryotic cell

A cytogeneticist would primarily do which of the following?

A) B) C) D)

8)

cleavage furrow; cell plate cell plate; cleavage furrow cleavage furrow; kinetochore kinetochore; cell plate

Organelles are

A) B) C) D)

, whereas in plants a

study the distribution of traits in a population study the evolutionary changes in a specific trait examine chromosomes using a karyotype determine the genetic sequence of a specific gene

A karyotype is a(n)

A) B) C) D)

Version 1

.

organelle ofeukaryotic cells stage of prophaseI in meiosis division of thecytoplasmic material following mitosis photographicrepresentation of the chromosomes of a cell

2

stumerit@gmail.com

9) During sexual reproduction, each parent contributes one set of chromosomes. Similar chromosomes from each parent are called .

A) B) C) D)

10)

Which of the following would contain genetic material that is 100% identical?

A) B) C) D)

11)

homologous chromosomes sister chromatids X and Y chromosomes All of these choicesare identical.

The location of a gene on a chromosome is called its

A) B) C) D)

12)

karyotypes sisterchromatids homologs sexchromosomes

karyotype allele locus homolog

Cell division in prokaryotic cells is called .

Version 1

.

, while in eukaryotic cells it is called

3

stumerit@gmail.com

A) B) C) D)

13)

binary fission; binary fission binary fission; mitosis mitosis; mitosis mitosis; binary fission

The process of binary fission is primarily used for asexual reproduction in

.

A) prokaryotes B) eukaryotes

14)

During this phase of the cell cycle, the sister chromatids are formed in eukaryotes.

A) G 1 phase B) G 2 phase C) S phase D) Prophase E) Cytokinesis

15)

Select the phase when chromosomes start to condense.

A) Metaphase B) Prometaphase C) Telophase D) Anaphase E) Prophase

16) cell.

Select the phase when sister chromatids separate and move towards opposite poles of the

Version 1

4

stumerit@gmail.com

A) Metaphase B) Prometaphase C) Telophase D) Anaphase E) Prophase

17)

Select the phase during which the centrosomes move to opposite poles of the cell.

A) Metaphase B) Prometaphase C) Telophase D) Anaphase E) Prophase

18)

Select the phase when the chromosomes line up in the center of the cell.

A) Metaphase B) Prometaphase C) Telophase D) Anaphase E) Prophase

19)

Select the phase when the nuclear membrane starts to disassociate.

A) Metaphase B) Prometaphase C) Telophase D) Anaphase E) Prophase

Version 1

5

stumerit@gmail.com

20)

Select the phase when the nuclear membrane re-forms around the chromosomes.

A) Metaphase B) Prometaphase C) Telophase D) Anaphase E) Prophase

21)

Select the phase when the microtubules of the mitotic spindle attach to the kinetochores.

A) Metaphase B) Prometaphase C) Telophase D) Anaphase E) Prophase

22) Select the phase when the separated sister chromatids are considered independent chromosomes.

A) Metaphase B) Prometaphase C) Telophase D) Anaphase E) Prophase

23)

Which of the following indicates the correct order of these events?

Version 1

6

stumerit@gmail.com

A) B) C) D)

24)

In animals, somatic cells are A) B) C) D)

25)

.

diploid; diploid diploid; haploid haploid; diploid haploid; haploid

isogamous heterogamous diploid haploid

The general purpose of the synaptonemal complex is to

A) B) C) D)

27)

and gametes are

If the gametes of an organism are different morphologically, they are said to be .

A) B) C) D)

26)

Anaphase -Telophase - Prophase - Prometaphase - Metaphase Telophase -Prometaphase - Prophase - Metaphase - Anaphase Metaphase -Prometaphase - Prophase - Anaphase - Telophase Prophase -Prometaphase - Metaphase - Anaphase - Telophase

.

provide a linkbetween homologous chromosomes in meiosis enable thereformation of the cell wall during cytokinesis separate thesister chromatids during anaphase independentlyassort the chromosomes during metaphase of meiosis

Which of the following occurs during leptotene of prophase I?

Version 1

7

stumerit@gmail.com

A) B) C) D)

28)

A bivalent contains how many sister chromatids?

A) B) C) D)

29)

The homologous chromosomes recognize one another by synapsis.

Crossing over occurs.

The replicated chromosomes condense.

The synaptonemal complex dissociates.

2 4 8 depends on the cell

When does crossing over occur?

A) During diplotene B) Prior to leptotene, when synapsis is complete C) Prior to pachytene, when synapsis is complete D) Prior to pachytene, before synapsis is complete E) Prior to leptotene, before synapsis is complete

30)

The bivalent structure forms during which of the following?

A) leptotene B) zygotene C) pachytene D) diplotene E) diakinesis

Version 1

8

stumerit@gmail.com

31)

Which of the following represents the correct order of events during prophase I?

A) B) C) D)

32)

Pachytene - diplotene - diakinesis - leptotene - zygotene Leptotene - zygotene - pachytene - diplotene - diakinesis Zygotene - leptotene - pachytene - diakinesis - diplotene Diplotene - pachytene - leptotene - diakinesis - zygotene

The physical structure that is formed when two chromatids cross over is called a(n) .

A) B) C) D)

synaptonemal complex bivalent karyotype chiasma

33) If an organism has five pairs of chromosomes, how many chromosomal combinations are possible at metaphase I of meiosis?

A) 5 2 B) 10 5 C) 5 10 D) 2 5

34)

The end result of meiosis in animals is

Version 1

.

9

stumerit@gmail.com

A) B) C) D)

35)

two diploidcells two haploidcells four diploidcells four haploidcells

The process of meiosis II is similar to that of

.

A) mitosis B) binaryfission C) meiosis I

36)

Oogenesis is a gametogenic process in which cells undergo .

to produce

A) binary fission; sperm cells B) mitosis; egg cells C) meiosis; egg cells D) meiosis; sperm cells E) mitosis; sperm cells

37) the

In plants, the haploid generation is called the .

A) B) C) D)

Version 1

and the diploid generation is called

sporophyte; spermatogenesis gametophyte; sporophyte sporophyte; gametophyte oogenesis; gametophyte

10

stumerit@gmail.com

38)

In plants, spore production occurs by

A) spermatogenesis B) meiosis C) mitosis D) binaryfission E) oogenesis

39)

A pollen grain in a plant represents the A) B) C) D)

40)

.

male gametophyte female gametophyte male sporophyte female sporophyte

Which type of microtubule is paired to its correct function?

A) polar microtubules - attach to the kinetochore B) aster microtubules - position the spindle apparatus C) kinetochore microtubules - separate the poles

41) During sexual reproduction, gametes are made that contain material as a somatic cell in the organism.

A) B) C) D)

Version 1

amount of genetic

twice the half the the same a quarter of the

11

stumerit@gmail.com

42)

Genes are physically located within A) B) C) D)

.

chromosomes centrosomes kinetochores microtubules

A diploid cell in G 1contains 5 pairs of chromosomes. During mitosis, how many 43) chromosomes will be lined up on the metaphase plate in this cell?

A) B) C) D)

5 10 15 20

44) A primary spermatocyte contains 8 total chromosomes. What will be the composition of the chromosomes in one of the secondary spermatocytes that results from this primary spermatocyte?

A) B) C) D)

8 unduplicated chromosomes 4 chromosomes, each containing 2 sister chromatids joined at the centromere 8 chromosomes, each containing 2 sister chromatids joined at the centromere 4 unduplicated chromosomes

45) A cell from an organism that has a diploid number of 6 chromosomes has 3 chromosomes lined up in the center the cell, each chromosome containing two joined sister chromatids. What phase of the cell cycle is this cell in?

Version 1

12

stumerit@gmail.com

A) B) C) D)

metaphase I of meiosis metaphase II of meiosis metaphase of mitosis telophase I of meiosis

46) A species has a diploid number of 36. If meiosis didn't occur, and gametes were produced by mitosis, each gamete would contain chromosomes, and a fertilized egg would contain chromosome.

A) 36; 72 B) 36; 36 C) 18; 36 D) 72; 144

47) What is the arrangement of chromosomes in an oocyte in a female mammal at birth if the species has a diploid number of 20? Hint: Recall which phase of the cell cycle oocytes are arrested at in a female animal prior to birth.

A) B) C) D)

Version 1

20 chromosomes, each with two sister chromatids 10 chromosomes, each with two sister chromatids 20 unduplicated chromosomes 10 unduplicated chromosomes

13

stumerit@gmail.com

Answer Key Test name: Chapter 02 Test Bank 1) [A, B, C] 2) [B, C, D, E] 3) [A, B, C] 4) [A, B, C] 5) A 6) B 7) C 8) D 9) C 10) B 11) C 12) B 13) A 14) C 15) E 16) D 17) B 18) A 19) E 20) C 21) B 22) D 23) D 24) B 25) B 26) A Version 1

14

stumerit@gmail.com

27) C 28) B 29) C 30) B 31) B 32) D 33) D 34) D 35) A 36) C 37) B 38) B 39) A 40) B 41) B 42) A 43) B 44) B 45) B 46) A 47) A

Version 1

15

stumerit@gmail.com

Student name:_ 1)

Which of the following traits were studied by Mendel? Check all that apply.

A) B) C) D) E)

2)

flower color seed color pod color pollen color plant height

Choose all statements that constitute key tenets of the chromosome theory of inheritance.

A) Chromosomes are copies of the genetic material that are used to make proteins and are then destroyed.

B) Chromosomes contain the genetic material.

C) Chromosomes are contributed by the maternal parent only.

D) Chromosomes are replicated and transmitted during inheritance and during development.

E) Most cells are diploid, with two copies of each chromosome.

F) Gametes contain two copies of each chromosome so there is a backup copy if one is damaged.

G) During gamete formation, chromosomes segregate independently.

H) Each parent contributes one complete set of chromosomes.

I) Certain chromosomes are linked together, so that genes that work together are transmitted together.

3) The use of crosses between different strains of pea plants was not the first attempt to explainheredity. The theory of pangenesis was first proposed by .

A) B) C) D) E)

Version 1

Aristotle Galen Mendel Hippocrates None of these choicesare correct.

1

stumerit@gmail.com

4) Mendel's data from single-factor crosses did not support a blending mechanism of inheritance. Which of the following is correct regarding the blending theory of inheritance?

A) B) C) D) E)

5)

It theorizedthat hereditary traits blended from one generation to the next.

It was possible for the blending to change the trait from one generation to the next.

It was supported by early research of tobacco plants by Joseph Kölreuter.

It was the prevailing theory of inheritance prior to Mendel.

All of these choicesare correct.

Mendel's work was rediscovered in 1900 by which of the following individual(s)?

A) B) C) D)

Carl Correns Erich von Tschermak Hugo de Vries All of these choicesare correct.

6) Which of the following characteristics made the pea plant Pisum sativum an ideal organism for Mendel's studies?

A) B) C) D)

It has the ability to self-fertilize.

It was possible to cross-fertilize one plant with another.

It has easily identifiable traits.

All of these choicesare correct.

7) The anthers represent the portion of the plant.

Version 1

portion of the plant; the ovules represent the

2

stumerit@gmail.com

A) B) C) D)

female; male male; female female; female male; male

8) When studying a genetic cross, the second generation following the initial cross is identified by which of the following?

A) B) C) D) E)

P generation F 1 generation F 2 generation F 3 generation P 3 generation

9) A true-breeding line of green pod pea plants is crossed with a true-breeding line of yellow pod plants. All of their offspring have green pods. From this information, it can be stated that the green color is to the yellow color.

A) B) C) D) E)

10)

recessive dominant subservient blended None of these choicesare correct.

What theory did Mendel's work with monohybrid crosses support?

A) B) C) D)

Version 1

blending theory of inheritance particulate theory of inheritance chromosomal theory of inheritance pangenesis

3

stumerit@gmail.com

11)

What resulted from Mendel's work with single-factor crosses?

A) B) C) D)

law of segregation law of independent assortment theory of natural selection law of biological evolution

12) When Mendel crossed two plants that were heterozygous for a single trait, what was the phenotypic ratio of their offspring?

A) 1:2:1 B) 9:3:3:1 C) 3:1 D) 7:4 E) Varied depending on the trait

13) When Mendel crossed two plants that were heterozygous for a single trait, what was the genotypic ratio of their offspring?

A) 1:2:1 B) 9:3:3:1 C) 3:1 D) 1:1 E) Varied depending on the trait

14)

An individual who has two identical alleles for a trait is said to be

Version 1

.

4

stumerit@gmail.com

A) B) C) D)

15)

The genetic composition of an individual is called its

A) B) C) D) E)

16)

Version 1

.

phenotype genotype dominance genes None of these choicesare correct.

An individual who has two different alleles for a trait is called

A) B) C) D) E)

.

phenotype genotype hybrid dominance None of these choicesare correct.

The observable characteristics of an organism are called its

A) B) C) D) E)

17)

homozygous heterozygous isozygous a variant

.

haploid homozygous heterozygous isozygous true-breeding

5

stumerit@gmail.com

18)

In a Punnett square diagram, the outside of the box represents the

A) B) C) D)

19)

.

diploidoffspring haploidoffspring diploidgametes haploidgametes

Mendel's work with two-factor crosses led directly to which of the following?

A) B) C) D) E)

chromosomal theory of inheritance particulate theory of inheritance law of segregation law of independent assortment theory of biological evolution

20) In a two-factor cross using Mendelian inheritance, if both parents are heterozygous for both traits, what will be the phenotypic ratio of their offspring?

A) 3:1 B) 1:2:1 C) 1:1 D) 9:3:3:1

21) If a Punnett square is used to visualize a three-factor cross between two parents that are both heterozygous for all three genes involved, how many boxes would be inside of the square?

Version 1

6

stumerit@gmail.com

A) B) C) D) E)

22)

In humans, patterns of inheritance are often studied using which of the following?

A) B) C) D)

23)

3 8 48 64 can't be determined

two-factor crosses production of true-breeding lines pedigree analysis self-fertilization

The chance that a future event will occur is called

A) B) C) D) E)

.

probability goodness offit degrees offreedom randomselection All of these choicesare correct.

24) A coin is flipped 100 times, with a result of 53 heads and 47 tails. The deviation between the observed numbers and the expected 50-50 results is called .

A) B) C) D) E)

Version 1

probability degrees offreedom goodness offit random samplingerror standarderror

7

stumerit@gmail.com

25) Which of the following would be used to determine the probability of three independent events in order?

A) B) C) D) E)

sum rule product rule chi square test binomial expansion random sampling error

26) A couple would like to know what the probability is that out of five children, three will be girls. This is solved using which of the following?

A) B) C) D) E)

sum rule product rule chi square test binomial expansion random sampling error

27) Recall that in pea plants, purple flower color is dominant and white is recessive. If two heterozygous plants are crossed, what is the probability that the first two offspring will have purple flowers?

A) 1/2 B) 1/4 C) 6/4 D) 9/16 E) 1/16

28) In a genetic cross, there are n classes of data. What would the degrees of freedom be for a chi square test on this data?

Version 1

8

stumerit@gmail.com

A) B) C) D) E)

n n+1 n-1 2 n+1 x( n) where x equals the number of individuals in the cross

29) The likelihood that the variation of observed data from expectations is due to random chance is called the .

A) B) C) D)

30)

P value goodness offit degrees offreedom empiricalapproach

In the biological sciences, the hypothesis is usually rejected if the P value is A) B) C) D) E)

.

greater than1 less than0.30 less than0.95 less than0.05 less than 1

31)

Mendel'sdata and the study of chromosomes and meiosis did not support the idea of , which is the belief that seeds are produced by all parts of the body and transmitted to the next generation.

Version 1

9

stumerit@gmail.com

A) B) C) D) E)

32) a

the chromosome theory of inheritance pangenesis the blending theory of inheritance the law of segregation the law of independent assortment

If two individuals with different distinct characteristics are mated, their offspring is called .

A) B) C) D) E)

strain true-breedingline gamete cross hybrid

33) If over several generations a character does not vary in a group of organisms, that group can be called a .

A) B) C) D) E)

heterozygote hybrid true-breedingline variant cross-fertilizedline

34) A cross in which a researcher investigates the patterns of inheritance of a single trait is called a .

Version 1

10

stumerit@gmail.com

A) B) C) D) E)

35)

monohybrid cross multi-factor cross two-factorcross cross-fertilization self-fertilization

A specific version of a gene is called a(n) A) B) C) D) E)

trait character gamete allele variant

36) In a genetic cross, the not found in the parental lines.

A) B) C) D)

37)

represent offspring with genetic combinations that were

P generation nonrecombinants parentals nonparentals

The study of family trees in humans is called a

A) B) C) D) E)

Version 1

.

analysis.

pedigree monohybrid factorial statistical probability

11

stumerit@gmail.com

38) Statistical analysis determines the expected from the original hypothesis.

A) B) C) D) E)

between observed data and what was

testcross degrees offreedom P values completehypothesis goodness offit

39) Mendel's law of independent assortment states that during the formation of haploid cells.

A) B) C) D)

randomly assort their

genes; alleles alleles; versions cells; mitochondria genes; nucleotides

40) Which situation below would violate the law of independent assortment, as understood

by Mendel?

A) A plant breeder is able to create a true-breeding line that combines the alleles for white flowers and wrinkled peas.

B) A mutant gene can prevent pod formation altogether, thus preventing expression of the round or wrinkled pea alleles.

C) A gene for petal color does not affect the expression of a gene for petal number.

D) A gene for leaf shape is linked to a gene for petal number nearby on the same chromosome, so their alleles usually segregate together.

E) Combining certain alleles of different genes results in a plant that grows poorly.

41)

What aspect of meiosis best explains Mendel's law of segregation?

Version 1

12

stumerit@gmail.com

A) B) C) D) E)

42)

selective removal of genetic information to create haploid gametes separation of homologous chromosomes during Meiosis I random alignment of different bivalents during Meiosis I transmission of genes together when they lie nearby on the same chromosome separation of identical alleles duringMeiosis II

What aspect of meiosis best explains Mendel's law of independent assortment?

A) B) C) D) E)

selective removal of genetic information to create haploid gametes separation of homologous chromosomes during Meiosis I random alignment of different bivalents during Meiosis I transmission of genes together when they lie nearby on the same chromosome separation of identical alleles duringMeiosis II

43) In a certain family pedigree, you observe that 7 of a couple's 12 children display a disease trait. In the subsequent generation, some of the children of affected individuals have the disease, but none of the children of two unaffected parents do. You conclude that the disease is caused by a allele.

A) B) C) D)

recessive dominant redundant wild-type

44) To determine the genotype of a pea plant with purple flowers it was crossed with a pea plant with white flowers. Half of the offspring exhibited the dominant purple flower while the other half had white flowers. What was the genotype of the parental pea plant with the purple flowers?

Version 1

13

stumerit@gmail.com

A) B) C) D)

heterozygous homozygous dominant homozygous recessive can’t be determined

45) Consider the pedigree shown. What can best explain the expression of the trait in individual IV-1?

©McGraw-Hill Education A) B) C) D) E)

Version 1

The trait is recessive, and both II-2 and III-3 were heterozygous carriers.

The trait is dominant, and both III-3 and III-4 were heterozygous.

The trait is dominant, and IV-1 received the allele from III-4.

The trait is recessive but only expressed in males.

The trait is recessive, and both II-1 and II-2 were heterozygous carriers.

14

stumerit@gmail.com

46) Consider a tree in which in thick trunk ( T) is dominant to a skinny trunk ( t), back bark ( B) is dominant to brown bark ( b) and round leaves ( R) are dominant to oval leaves ( r).

You cross a tree that is heterozygous for all three traits to a tree that is homozygous recessive for all three traits. Using the forked line method or the multiplication method, calculate what fraction of the offspring will have a thick trunk, black bark, and round leaves.

A) 1/4 B) 1/2 C) 1/8 D) 1/16

47) In a certain species of plants, red flowers ( R) are dominant to pink flowers ( r) and round leaves ( L) are dominant to oval leaves ( l). A plant with red flowers and round leaves is crossed to a plant with pink flowers and oval leaves. In the F 1 generation, all of the plants have red flowers, but half of the plants have round leaves and half have oval leaves. What can we conclude about the parental plant with red flowers and round leaves?

A) B) C) D) E)

The genotype of the plant with red flowers and round leaves is RRll. The genotype of the plant with red flowers and round leaves is RRLL. The genotype of the plant with red flowers and round leaves is RrLl. The genotype of the plant with red flowers and round leaves is RRLl. The genotype of the plant with red flowers and round leaves is RrLL.

48) Consider a bird in which a high-pitched song ( H) is dominant to a low-pitched song ( h). You cross two birds that are heterozygous for the gene for song pitch. Predict the genotypes and phenotypes of the offspring.

A) B) C) D)

Version 1

1/4 HH: 1/2 Hh: 1/4 hh;3/4 high-pitched song: 1/4 low-pitched song 1/2 HH: 1/2hh;1/2high-pitched song: 1/2low-pitched song 1/4 HH: 1/2 Hh: 1/4 hh;1/2 high-pitched song: 1/2low-pitched song All Hh; Allhigh-pitched song

15

stumerit@gmail.com

49) Mendel's work on inheritance had an immediate influence on the scientific community and theories of inheritance. ⊚ ⊚

true false

50) Differences in plant characteristics such as flower color or height are called variants or traits. ⊚ true ⊚ false

51)

The chi square test is used to prove that a hypothesis is correct. ⊚ true ⊚ false

Version 1

16

stumerit@gmail.com

Answer Key Test name: Chapter 03 Test Bank 1) [A, B, C, E] 2) [B, D, E, G, H] 3) D 4) E 5) D 6) D 7) B 8) C 9) B 10) B 11) A 12) C 13) A 14) A 15) B 16) A 17) C 18) D 19) D 20) D 21) D 22) C 23) A 24) D 25) B 26) D Version 1

17

stumerit@gmail.com

27) D 28) C 29) A 30) D 31) B 32) E 33) C 34) A 35) D 36) D 37) A 38) E 39) A 40) D 41) B 42) C 43) B 44) A 45) A 46) C 47) D 48) A 49) FALSE 50) TRUE 51) FALSE

Version 1

18

stumerit@gmail.com

Student name:_ 1) In which of the following organisms is the level of X chromosome expression altered in males?

A) B) C) D)

2)

mammals Drosophila C. elegans humans

Who originally identified a highly condensed structure in the interphase of nuclei?

A) Lyon B) Barr andBertram C) Ohno

3)

The product of the Xist gene is a(n)

A) B) C) D)

4)

.

protein RNA small molecule DNA

What gene is most responsible for X-inactivation?

A) B) C) D)

Version 1

Xic Xist TsiX Xce

1

stumerit@gmail.com

5)

How many Barr bodies would an individual with a XXY genotype possess?

A) 0 B) 1 C) 2

6)

The coat color of calico cats is a result of

A) B) C) D)

7)

maternalinheritance X-inactivation imprinting extra nuclearinheritance

The Lyon hypothesis attempts to explain the molecular mechanism of

A) B) C) D)

8)

.

.

X-inactivation genomicimprinting maternalinheritance extra nuclearinheritance

Dosage compensation offsets the problems associated with differences in the number of chromosomes in many species.

A) B) C) D)

Version 1

sex autosome somatic nuclear

2

stumerit@gmail.com

9) The genetic control of X-inactivation is governed by a short region on the X chromosome called the .

A) B) C) D)

10)

Y-inactivationcenter (Yic) condensationcenter X-inactivationcenter (Xic) X-initiationcenter

In humans, which sex is considered to be the heterogametic sex?

A) male B) female

11)

In a Z-W system, which is considered to be the homogametic sex?

A) males B) females

12) A male that is produced from an unfertilized haploid egg is an example of what type of sex determination system?

A) B) C) D)

Version 1

X-Y Z-W X-O haplo-diploid

3

stumerit@gmail.com

13) The first person to experimentally determine that a trait is located on a specific chromosome was .

A) B) C) D)

14)

If a gene is located on the X chromosome, but not the Y, it is said to be an example of .

A) B) C) D) E)

15)

Mendel Boveri and Sutton Weissman Morgan

autosomalinheritance sex-linkage reciprocalcross pseudoautosomalinheritance holandric

A testcross

A) is used todetermine if an organism that is displaying a recessive trait is heterozygousor homozygous for that trait.

B) results in the F2generation having a phenotypic ratio of 1/2 dominant to 1/2 recessive.

C) is used when anindividual with a dominant phenotype and unknown genotype is crossed to anindividual with a recessive phenotype.

D) results inoffspring that always display the recessive phenotype.

16)

Sex determination in humans and Drosophila is similar in the fact that

Version 1

4

stumerit@gmail.com

A) the ratio of Xchromosomes to sets of autosomes determines maleness or femaleness in both.

B) males in both willalways have one Y chromosome, whereas females will not have a Y chromosome.

C) females lack X chromosomes.

D) males have one X chromosome and females have two X chromosomes.

17)

An example of a mechanism in which sex is determined by environmental factors is

A) females are produced from fertilized eggs, whereas males are produced fromunfertilized eggs.

B) when the male cares for the eggs, all of the offspring will be male, whereasif the female cares for the eggs, all of the offspring will be female.

C) fertilized eggsincubated at one temperature produce males, whereas eggs incubated at adifferenttemperature produce females.

D) males will have a Y chromosome, whereas females will not have a Ychromosome.

18) A human individual has a karyotype that is XY but is phenotypically female. An explanation for this could be A) a deletion of the SRY gene on the Y chromosome, thus resulting in an female phenotype.

B) a translocation of the SRY gene to one of the X chromosomes has occurred, thus resulting in a female phenotype.

C) the SRY gene has been amplified 10 fold on the Y chromosome.

D) sex is determinedby genes located on autosomes, not sex chromosomes.

19) Brown spotting of the teeth in humans is caused by a dominant X-linked gene.If a man with normal teeth marries a woman with brown teeth who had a father with normal teeth, then of their daughters will have brown teeth.

Version 1

5

stumerit@gmail.com

A) 100% B) 50% C) 25% D) 0%

20) Red-green colorblindness is a X-linked recessive trait in humans. If a woman who is a carrier for red-green colorblindness marries a normal male, what percent of their sons will be colorblind?

A) 100% B) 50% C) 25% D) 0%

21)

Pseudoautosomal inheritance occurs when

A) a gene on anautosome is silenced by inactivation.

B) a gene on a Y chromosome has the same inheritance pattern as a gene on an X chromosome.

C) a gene on anautosome has the same inheritance pattern as a gene on a sex chromosome.

D) a gene on a sexchromosome has the same inheritance pattern as a gene on an autosome.

22) X-linked hypophosphatemia (XLH) is an X-linked dominant disease that results in weak or soft bones. A girl with XLH has a dad with XLH. Her mother does not have XLH. What is the probability that her sisters will have XLH? What about her brothers?

Version 1

6

stumerit@gmail.com

A) B) C) D) E)

All of her sisters and none of her brothers will have XLH. All of her brothers and none of her sisters will have XLH. 50% of her brothers and sisters will have XLH. None of her brothers or sisters will have XLH. All of her brothers and sisters will have XLH.

23) In certain birds, feather color is Z-linked, and green coloring is dominant to purple coloring. A purple feathered male mates with a green feathered female. Predict the phenotypic ratios in their offspring.

A) Half of the offspring will be green females and the other half will be purple males.

B) Half of the offspring will be purple females and the other half will be green males.

C) 1/4 of the progeny will be green females, 1/4 green males, 1/4 purple females, and 1/4 purple males.

D) All of the progeny will be green.

24) Glucose-6-phosphate dehydrogenase deficiency (G6PDD) is an X-linked recessive disease. What is the probability that the brother of a girl with G6PDD will also have G6PDD if their mother is unaffected.

A) 0% B) 25% C) 50% D) 100%

25) Flowering plants will produce flowers that are dioecious, meaning that the male and female parts are contained within the same flower. ⊚ ⊚

Version 1

true false

7

stumerit@gmail.com

26)

With rare exceptions, a calico cat is likely to be female. ⊚ true ⊚ false

Version 1

8

stumerit@gmail.com

Answer Key Test name: Chapter 04 Test Bank 1) B 2) B 3) B 4) B 5) B 6) B 7) A 8) A 9) C 10) A 11) A 12) D 13) D 14) B 15) C 16) D 17) C 18) A 19) B 20) B 21) D 22) A 23) B 24) C 25) FALSE 26) TRUE Version 1

9

stumerit@gmail.com

Version 1

10

stumerit@gmail.com

Student name:_ 1) Genes that are not required for survival, but are likely to be beneficial to the organism, are called .

A) B) C) D) E)

2)

Alleles that cause death in a certain temperature range are examples of A) B) C) D) E)

3)

essential genes lethal alleles semilethalalleles nonessentialgenes conditional lethalalleles

.

essential genes lethal alleles semilethalalleles nonessentialgenes conditional lethalalleles

The alleles that cause Huntington disease in humans are an example of

A) B) C) D) E)

.

essentialgenes lethal alleles semilethalalleles nonessentialgenes sex linked allele

4) A heterozygote possesses a phenotype that is intermediate between the homozygous dominant and homozygous recessive phenotypes. This is most likely an example of .

Version 1

1

stumerit@gmail.com

A) B) C) D)

lethal alleles incompletedominance gene dosage sex-influencedinheritance

5) In four-o'clock plants, red flower color is dominant to white flower color. However, heterozygous plants have a pink color. If a pink-flowered plant is crossed with a white-flowered plant, what will be the phenotypic ratios of their offspring?

A) B) C) D) E)

¼ red, ½ pink, ¼ white all pink all white ½ pink, ½ white ½ red, ½ pink

6) In rabbits, full coat color (C ) is the dominant trait. A second allele, chinchilla (c ch ), is recessive to full coat color. Himalayan coat color (ch ) is recessive to chinchilla and full coat colors, and albino (c ) is recessive to all coat colors. If two chinchilla rabbits mate, what coat color is not possible in their offspring?

A) B) C) D) E)

full coat color chinchilla coat color himalayan coat color albino coat color All coat colors are possible.

7) In human blood groups, the fact that an individual can have an AB blood type is an example of .

Version 1

2

stumerit@gmail.com

A) B) C) D) E)

incompletedominance incompletepenetrance sex-influencedtrait temperature-sensitive conditional allele codominance

8) An individual with type A blood and an individual with type B blood mate and have offspring. What blood type is not possible in their offspring?

A) B) C) D) E)

type O blood type A blood type B blood type AB blood All blood types are possible.

9) At the molecular level, type A and type B blood differ in which of the following characteristics?

A) B) C) D)

the antigens present on the surface of the red blood cells the type of sugar found in each type the antibodies that are generated against the other type of blood All of these choicesare correct.

10) For a certain trait, a heterozygous individual has a selective advantage over a homozygous dominant or homozygous recessive individual. This is called .

Version 1

3

stumerit@gmail.com

A) B) C) D) E)

11)

codominance incompletedominance overdominance incompletepenetrance multiple allelesystems

Sickle-cell disease in humans is an example of

A) B) C) D)

.

codominance incompletepenetrance heterozygote advantage sex-limited resistance

12) At the molecular level, which of the following best explains heterozygous advantage and overdominance?

A) A heterozygous individual can produce more varieties of homodimer proteins.

B) The alleles produce two different proteins with slightly different functions.

C) The proteins produced by the alleles may provide a broader range of environmental tolerance, such as temperature ranges.

D) Infectious organisms may recognize only a specific functional protein.

E) All of the answers are possibilities.

13)

Polydactyly in humans is an example of

Version 1

.

4

stumerit@gmail.com

A) B) C) D) E)

14)

If a geneticist describes a trait as being 70% penetrant, what would that mean?

A) B) C) D)

15)

The expression of the trait varies by individual.

It is lethal in 30% of the individuals who have the trait.

Only 70% of the individuals who have a particular genotypeexpress the trait.

The trait is present in 70% of the population.

The phenylketonuria phenotype in humans is an example of A) B) C) D) E)

16)

sex-limited inheritance incompletedominance incompletepenetrance codominance gene dosage

.

incompletepenetrance codominance anenvironmental-influenced trait incompletedominance All of these choicesare correct.

If an allele is dominant in one sex and recessive in another, it is an example of .

A) B) C) D)

Version 1

sex-limitedinheritance sex-influencedinheritance incompletedominance simple Mendelianinheritance

5

stumerit@gmail.com

17)

A paralog

A) B) C) D) E)

18)

is found forevery gene in mammals is only found onthe X but not the Y chromosome can explain thelack of phenotype for a gene knockout cannot bemutated has the same DNAsequence as the original duplicated gene

The interaction of two genes to produce a phenotype was first described by

A) B) C) D) E)

19)

.

Morgan and Bridges Mendel Darwin Bateson and Punnett None of these choicesare correct.

Epistasis is

A) B) C) D) E)

.

.

another term for overdominance when one gene canmask the expression of a second gene a trait that isonly expressed in one sex of the species when two dominantalleles can be expressed in the same individual None of these choicesare correct.

20) In a dihybrid cross of two heterozygous individuals, you expect a 9:3:3:1 phenotypic ratio in the offspring, but observe a ratio of 9:7. What is the most likely explanation?

Version 1

6

stumerit@gmail.com

A) B) C) D) E)

21)

codominance a sex-limited trait simple Mendelian inheritance incomplete penetrance epistatic interactions of the two genes

Which of the following is not correct concerning epistatic interactions?

A) They are often associated with enzymatic pathways.

B) They produce variations in the expected 9:3:3:1 ratio of a dihybrid cross.

C) They can result when a gene at one locus masks the expression of a gene at a different locus.

D) They always result in a 9:7 ratio of a dihybrid cross.

E) They are due to gene interactions.

22) When wild-type offspring are produced from a cross between parents that both display the same recessive phenotype, this illustrates the genetic phenomenon of .

A) B) C) D) E)

23)

simple recessivealleles incompletepenetrance complementation gene dosage a spontaneousmutation

The multiple effects of a single gene on the phenotype of an organism is called

Version 1

.

7

stumerit@gmail.com

A) B) C) D) E)

epistasis penetrance expressivity overdominance pleiotropy

24) A allele typically encodes a protein that is made in the proper amount and functions normally.

A) B) C) D) E)

25)

loss-of-function mutant wild-type gain-of-function lethal

In overdominance, the

A) B) C) D) E)

genotype is beneficial over the

genotypes.

heterozygous; homozygous homozygous; heterozygous homozygous dominant; homozygous recessive homozygous recessive; homozygous dominant incomplete dominant; codominant

26) In cattle, the scurs trait follows a sex-influenced pattern of inheritance.A heterozygous male has the phenotype and a heterozygous female has a phenotype.

Version 1

8

stumerit@gmail.com

A) B) C) D)

27) a(n)

scurs; scurs hornless; hornless hornless; scurs scurs; hornless

If a combination of two or more genes is required to produce a specific trait, it is called .

A) B) C) D) E)

overdominance simple Mendelian trait sex-influencedtrait sex-linkedtrait geneinteraction

28) Recall that scurs in cattle that exhibit sex-influenced inheritance. There are two alleles P Sc , which represents scurs being presentand ScA,which indicates scurs being absent. ScPis dominant in males and recessive in females. ScAis dominant in females and recessive in males.

From a mating between a heterozygous male with scurs and a heterozygous female without scurs, what proportion of male offspring will lack scurs (be hornless)?

A) 0% B) 25% C) 50% D) 75% E) 100%

29) An experiment in which plants with the same genotype are raised under conditions that differ in soil quality could evaluate .

Version 1

9

stumerit@gmail.com

A) B) C) D)

the norm of reaction overdominance genetic polymorphisms gene interactions

30) ©McGraw-Hill Education Epistasis occurs when the alleles of one gene mask the phenotypic effects of the alleles of another gene at a different locus. This phenomenon can be observed in the sweet pea, Lathyrus odoratus: ● C (one purple-color-producing) allele is dominant to c (white) ● P (another purple-color-producing) allele is dominant to p (white) ● cc or pp masks the P or C alleles, producing white color Determine the genotypic and phenotypic ratios of a cross between a purple and white sweet pea above.

A) 1 CcPP(purple) : 1 CCPp (purple) : 1 ccPP (white) : 1 ccPp(purple) B) 1 CCPP(purple) : 2 CCPp (purple) : 2 CcPP (purple) : 1 CCpp(white) : 4 CcPp (purple) : 2 Ccpp (white) : 1 ccPP(white) : 2 ccPp (white) : 1 ccpp (white) C) 1 CcPP (purple) : 1 CcPp (purple) : 1 ccPP (white) : 1 ccPp (white) D) 9 CCPP(purple) : 7 CCPp (purple) E) 9 CCPP (purple) : 3 CcPp (purple) : 3 ccPP (purple) : 1 ccpp (white)

31) You cross two dogs with an Irish spotting phenotype. Some of the progeny have the extreme-white phenotype. What were the genotypes of the parents?

Version 1

10

stumerit@gmail.com

A) B) C) D)

sIsw and swsw sIsIand swsw sIswand sI sw S+sI and sIsw

32) Hairlessness in dogs is inherited from a single dominant allele. Inheriting two dominant alleles is lethal for an embryo. Penelope, a hairless dog, mates with Arnold, a dog with hair. The probability Penelope will have hairless puppies is

A) B) C) D)

3/4 2/3 1/4 1/2

33) Several members of a family have polydactyly, and they differ in their numbers of extra fingers and toes. Yet, certain relatives who should have extra digits don't. An aunt has two children, a son with two extra fingers and a daughter with an extra toe. Also her father has an extra digit on each hand and foot. Polydactyly in this family is

A) B) C) D)

variably expressive and incompletely penetrant. invariably expressive and completely penetrant. pleiotropic. incompletely dominant.

34) A man who has normal hearing and a recessive deafness allele on chromosome 17 marries a woman who also has normal hearing and also has a recessive deafness allele, but this allele is on chromosome 3. The probability that their children will be deaf due to either of these mutated genes is closest to

Version 1

11

stumerit@gmail.com

A) 100%.

B) 50%.

C) 25%.

D) 0%.

35) New research indicates that male-pattern baldness is a sex-linked trait in humans because of mutations of an androgen receptor gene on the X chromosome. ⊚ true ⊚ false

36)

In an epistatic interaction, the genes must be located on the same chromosome. ⊚ ⊚

37)

Typically, a recessive allele increases the expression of a functional protein. ⊚ ⊚

38)

true false

Incomplete dominance is an example of blending of phenotypes, not genotypes. ⊚ ⊚

39)

true false

true false

Human blood groups are determined by antigens on the surface of red blood cells. ⊚ ⊚

Version 1

true false

12

stumerit@gmail.com

40) Incomplete penetrance indicates that individuals who possess a dominant trait always express the trait. ⊚ ⊚

41)

true false

Variable expressivity means that the phenotype of a trait can vary between individuals. ⊚ ⊚

true false

42) Paralogs are often functionally redundant and can compensate for the loss of either of the paralogs in a set. ⊚ ⊚

true false

43) Because loss-of-function alleles typically do not make a functional gene product, they usually follow the recessive allele inheritance pattern. ⊚ true ⊚ false

44) Because most lethal alleles are inheritedin a recessive manner, a cross between two heterozygous individuals could result in a 2:1 genotypic ratio in their surviving offspring. ⊚ true ⊚ false

Version 1

13

stumerit@gmail.com

Answer Key Test name: Chapter 05 Test Bank 1) D 2) E 3) B 4) B 5) D 6) A 7) E 8) E 9) D 10) C 11) C 12) E 13) C 14) C 15) C 16) B 17) C 18) D 19) B 20) E 21) D 22) C 23) E 24) C 25) A 26) D Version 1

14

stumerit@gmail.com

27) E 28) B 29) A 30) C 31) C 32) D 33) A 34) D 35) TRUE 36) FALSE 37) FALSE 38) TRUE 39) TRUE 40) FALSE 41) TRUE 42) TRUE 43) TRUE 44) TRUE

Version 1

15

stumerit@gmail.com

Student name:_ 1)

Where does erasure and imprinting occur?

A) B) C) D)

2)

Which of the following is primarily responsible for the maternal effect?

A) B) C) D)

3)

sperm cells oocytes nurse cells placenta

What controls the coiling of shells in snail offspring?

A) B) C) D)

4)

nurse cells sperm cells oocytes somatic cells

mother'sphenotype father'sphenotype mother'sgenotype father'sgenotype

What is the molecular mechanism for imprinting a gene?

A) B) C) D)

Version 1

acetylation nitration phosphorylation methylation

1

stumerit@gmail.com

5)

What disease is associated with imprinting?

A) Angelman Syndrome B) LHON C) Alzheimer's Disease

6)

Where is extranuclear DNA located in mammalian cells?

A) B) C) D)

7)

What type of inheritance is observed with extranuclear DNA? A) B) C) D)

8)

endoplasmic reticulum mitochondria ribosome plasma membrane

Mendelian inheritance Sex-linked inheritance Paternal inheritance Cytoplasmic inheritance

What is a disease associated with extranuclear inheritance?

A) B) C) D)

Version 1

Angelman syndrome Tay-Sachs disease LHON Muscular dystrophy

2

stumerit@gmail.com

9) from

Mitochondria are thought to have originated from .

A) B) C) D)

10)

Schimper and Wallin Haig and Schimper Wallin and Correns Haig and Correns

Monoallelic expression is associated with which of the following?

A) B) C) D)

12)

cyanobacteria; tobacco mosaic virus purple bacteria; single-celled fungi purple bacteria; cyanobacteria single-celled fungi; tobacco mosaic virus

Who is largely responsible for proposing the endosymbiosis theory?

A) B) C) D)

11)

, and chloroplasts likely arose

X-inactivation genomic imprinting maternal inheritance extranuclear inheritance

Which of the following is true regarding mt genomes?

A) B) C) D)

Version 1

They are approximately 17,000 bp in length in humans.

They are linear.

A single copy of the mt genome is found within the mitochondrial nucleus.

They have all the genes necessary for mitochondrial function.

3

stumerit@gmail.com

13) The inheritance of leaf pigmentation in the four-o'clock plant Mirabilis jalapa is an example of .

A) B) C) D)

14)

maternaleffect maternalinheritance epigenetic inheritance imprinting

In maternal effect, the

A) B) C) D) E)

of the mother determines the

of the offspring.

chloroplast;mitochondria phenotype;genotype genotype;phenotype phenotype; sex methylation;inheritance

15) What is the type of inheritance that is based on a reversible modification of genomic DNA that results in the alleles of only one parent being transcriptionally active?

A) B) C) D) E)

maternal epigenetic cytoplasmic extranuclear mitochondrial

16) The molecular explanation for imprinting in mammals involves differential various DNA regions.

Version 1

of

4

stumerit@gmail.com

A) B) C) D) E)

phosphorylation mutations endosymbiosis methylation heteroplasmy

17) The inheritance patterns of genetic material that is not contained in the nucleus of the cell is called .

A) B) C) D)

18)

Heteroplasmy is associated with inheritance patterns involving

A) B) C) D) E)

19)

extranuclearinheritance cytoplasmicinheritance maternaleffect both extranuclearinheritance and cytoplasmic inheritance

.

ribosomes maternaleffect genomicimprinting nuclear genes chloroplasts

Contribution of mitochondria by the sperm cell to the zygote is called A) B) C) D) E)

Version 1

heteroplasmy. paternal leakage. genomic imprinting. paternal effect. endosymbiosis.

5

stumerit@gmail.com

20)

Diseases associated with mitochondria mutations in humans are usually A) B) C) D) E)

21)

The symbiotic relationship where one organism lives inside another species is called A) B) C) D) E)

22)

endosymbiosis. genomic imprinting. cytoplasmic inheritance. heteroplasmy. exosymbiosis.

An example of genomic imprinting is

A) B) C) D) E)

23)

paternally inherited. imprinted. fatal. very common. degenerative.

Leber hereditary optic neuropathy. neurogenic muscleweakness. snail coiling inwater snails.

Igf2expression in mice. bicoid gene in Drosophila.

A nurse cell is a cell that

Version 1

6

stumerit@gmail.com

A) B) C) D) E)

24)

In genomic imprinting, erasure of DNA methylation occurs in the A) B) C) D)

25)

lacks chloroplasts and mitochondria. destroys defective oocytes during embryogenesis. surrounds an oocyte during oogenesis. will fix a mutation in another cell. can repair its own DNA mutations.

mitochondria. chloroplasts. somatic cells of the embryo. cells destined to become gametes.

How is a chloroplast genome similar to a prokaryotic genome?

A) B) C) D)

They are both circular.

They both code for all the proteins they need for functioning.

They are both linear.

There is only one chromosome per cell or chloroplast.

26) Which mating of four-o'clock plants would produce progeny that were either green, variegated, or white if the color variation is due to a mutation in a chloroplast gene?

A) B) C) D)

Version 1

green female x variegated male variegated female x green male white female x white male white female x green male

7

stumerit@gmail.com

27) R and r represent dominant and recessive alleles, respectively, for a gene that is imprinted. Imprinting of the allele occurs in the male and the allele is silenced when it is imprinted. Which mating would result in a ratio of 1:1 of dominant and recessive phenotypes in the offspring?

A) B) C) D)

rr female x Rr male RR female x rr male Rr female x Rr male rr female x RR male

28) G and g are dominant and recessive alleles, respectively, for a gene. If a mating of a gg female with a Gg male resulted in offspring that all have the recessive phenotype, this would most likely be an example of A) B) C) D)

a recessive lethal gene. a maternal effect gene. environmental influence on phenotype. imprinting which results in silencing of the maternal alleles.

29) What would be the genotype of the mother of a female snail that has a a shell with a left hand twist?

Dd genotype and

A) dd B) DD C) Dd D) Cannot tell since the shell twist phenotype of any offspring depends on the genotype of the father as well as the mother.

30) What is the genotype of the father for a snail that has the genotype Dd and has a left hand twist shell?

Version 1

8

stumerit@gmail.com

A) B) C) D)

dd Dd DD It cannot be determined.

31) If a snail that has a right hand twist and is DD is mated to a snail that has a left hand twist and is dd what is the expected ratio of progeny?

A) B) C) D)

3 left hand twist to 1 right hand twist 3 right handtwist to 1 left hand twist It depends on which parent snail is female and which is male.

1 left handtwist to 1 right hand twist

32) You are a geneticist studying a newly discovered genetic disorder. The disorder follows a pattern of maternal inheritance, and both male and female children are affected. Strangely, within a family, all the children are affected but to very different degrees. What could explain this variation?

A) The disorder is caused by a mitochondrial mutation and the variation is due to heteroplasmy.

B) The disorder is caused by a mitochondrial mutation and the variation is due to imprinting.

C) The disorder is caused by a nuclear mutation and the variation is due to maternal effect.

D) The disorder is caused by a nuclear mutation and the variation is due to Xchromosome inactivation.

33)

Both parents usually imprint the same gene. ⊚ ⊚

Version 1

true false 9

stumerit@gmail.com

34) mtDNA contains all of the genes necessary for the complete function of mitochondrial metabolism. ⊚ ⊚

true false

35) The symbiotic relationship of purple bacteria and cyanobacteria with eukaryotic cells was beneficial to both cell types. ⊚ ⊚

Version 1

true false

10

stumerit@gmail.com

Answer Key Test name: Chapter 06 Test Bank 1) [B, C] 2) C 3) C 4) D 5) A 6) B 7) D 8) C 9) C 10) A 11) B 12) A 13) B 14) C 15) B 16) D 17) D 18) E 19) B 20) E 21) A 22) D 23) C 24) D 25) A 26) B Version 1

11

stumerit@gmail.com

27) C 28) B 29) A 30) D 31) C 32) A 33) FALSE 34) FALSE 35) TRUE

Version 1

12

stumerit@gmail.com

Student name:_ 1)

Which of the following defines gene linkage?

A) Two or more genes that are physically connected on a chromosome.

B) Genes that are transmitted to the next generation as a group.

C) The process by which genetic information is exchanged between homologous chromosomes.

D) All of these choices are correct.

E) Both two or more genes that are physically connected on a chromosome and genes that are transmitted to the next generation as a group.

2) Assume that genes C and D are located on the same chromosome. On one chromosome alleles C and D are found, while the homolog contains alleles c and d. Which of the following would be an example of a recombination event?

A) alleles C and D together on one chromosome B) alleles c and d together on one chromosome C) alleles C and d together on one chromosome D) alleles c and D together on one chromosome E) both alleles C and d together on one chromosome and alleles c and D together on one chromosome

3) The first observational evidence that genes may be inherited together rather than by simple Mendelian inheritance was provided by .

A) B) C) D)

Version 1

Mendel Morgan and Bridges Bateson and Punnett Boveri and Sutton

1

stumerit@gmail.com

4) Experimental evidence that crossing over occurs between the X chromosomes of female Drosophila was provided by .

A) B) C) D)

Morgan Punnett Darwin Bateson

5) Which of the following statistical tests is used to determine if two genes are linked or assorting independently?

A) B) C) D)

sum rule binomial expansion product rule chi square test

6) In a chi square test to determine if two genes are linked or assorting independently, what is the default (null) hypothesis that is tested?

A) B) C) D)

The genes are linked to one another.

The genes are assorting independently.

The genes are located on the sex chromosomes.

No crossing over occurs.

7) The visual proof that chromosomes exchange pieces of information during crossing over was provided by .

Version 1

2

stumerit@gmail.com

A) B) C) D)

8)

Bateson and Punnett Morgan and Bridges Creighton and McClintock Watson and Crick

Twin spotting provides evidence of what genetic event?

A) B) C) D)

meiotic recombination mitotic recombination linkage mutation

9) An organism that contains patches of tissue that vary for a specific characteristic, such as a pigment, is an example of .

A) B) C) D)

linkage meiotic recombination mitotic recombination translocations

10) Which of the following are necessary characteristics of an organism in order to easily construct a genetic linkage map?

A) B) C) D)

Version 1

short generation times produces large numbers of offspring easily crossed All of these choices are correct.

3

stumerit@gmail.com

11)

Crossing over is more likely to occur between genes that are

on a chromosome.

A) close together B) far apart C) not

12) A testcross is always performed between the individual that is heterozygous for the genes to be mapped and an individual who is .

A) B) C) D)

heterozygous forthe genes homozygousdominant for the genes homozygousrecessive for the genes lacking thegenes

13) While mapping two genes in Drosophila, you observe 30 recombinants among 200 total offspring. What is the distance between these genes?

A) B) C) D)

14)

30 map units 6.67 map units 200 map units 15 map units

A map distance of 23.6 between two genes indicates which of the following?

A) B) C) D)

Version 1

The genes are 23.6 millimeters apart.

There are 23.6 other genes between the two genes of interest.

23.6% of the offspring exhibit recombination between the two genes.

23.6% of the offspring do not survive.

4

stumerit@gmail.com

15)

The individual who is credited with discovering genetic linkage in Drosophila is A) B) C) D)

.

Thomas Hunt Morgan Gregor Mendel Alfred Sturtevant Barbara McClintock

16) In a mapping experiment with three genes, which phenotype should occur most often in the F 2 offspring?

A) B) C) D)

parental phenotypes phenotypes of individuals with single crossover events phenotypes of individuals with double crossover events All of these choicesshould be equal in the F2 generation.

17) The middle gene of a three gene mapping experiment can be determined by examining the genotypes of which of the following?

A) B) C) D)

offspring that resemble the parents offspring that exhibit a single crossover event offspring that exhibit double crossover events None of these choices are correct.

18) Which of the following is not one of the properties of gene linkage that Morgan obtained from his experiments?

Version 1

5

stumerit@gmail.com

A) Genes that are on the same chromosome may be inherited together.

B) Crossing over exchanges pieces of chromosomes and creates new allele combinations.

C) The likelihood of crossing over occurring between two genes is dependent on the distance of the genes from one another.

D) Genes that are on the same chromosome are always transmitted together as a unit.

19) In humans, there are linkage group.

A) B) C) D)

autosomal linkage groups, plus an X and Y chromosome

23 46 22 92

20) Another name for a chromosome is a inherited together.

A) B) C) D)

21)

, since it contains genes that are often

linkage group crossing overgroup geneticrecombinant bivalent

Two genes that are located on the same chromosome are said to be A) B) C) D)

Version 1

.

linked recombinant parental-like nonparental-like

6

stumerit@gmail.com

22) Creighton and McClintock worked with as their model system to show that homologous chromosomes physically exchange genetic information during crossing over.

A) B) C) D)

fruit flies peas corn tobacco

23) In a mapping cross, you determine that the recombination frequency between theQ and P is 12% and betweenloci Q and L is 15%. If locus Q is in between loci P and L, then the recombination frequency between P and L should be approximately .

A) B) C) D)

3% 27% 50% 75%

24) The diploid garden pea plant has 14 chromosomes. The haploid fungus Neurospora crassa has 7 chromosomes. Neither organism has separate male and female individuals. Which of the following correctly identifies the number of linkage groups in each organism?

A) B) C) D)

Garden pea has 14 linkage groups, and Neurospora has 7.

Garden pea has 7 linkage groups, and Neurospora has 7.

Garden pea has 8 linkage groups, and Neurospora has 8.

Gardent pea has 15 linkage groups, and Neurospora has 8.

25) Suppose the genes for eye color and wing shape are both on the X chromosome (they are linked) and are known to be 68 map units apart. In a mating between a X w+m+X wm female and a X wmY male that produces 1000 progeny, how many recombinant progeny would you expect to observe?

Version 1

7

stumerit@gmail.com

A) B) C) D)

500 680 340 320

A Xw+m+Xwm female was mated to a XwmY male. Out of 1000 total F1 progeny there were 26) 230 flies that were otherwise wild type with white eyes and 240 flies that were otherwise wild type with miniature wings. What is the distance between the genes for eye color and wing length?

A) B) C) D)

27)

The process of recombination may rarely occur during mitosis. ⊚ ⊚

28)

true false

A genetic linkage map indicates the precise distance between two genes of interest. ⊚ ⊚

29)

47 map units 53 map units 23 map units 24 map units

true false

The rearrangement of alleles by the process of crossing over is called genetic linkage. ⊚ ⊚

Version 1

true false

8

stumerit@gmail.com

30) Map distance is the number of recombinant offspring divided by the total number of nonrecombinant offspring. ⊚ ⊚

true false

31) Following crossing over, chromosomes with genetic combinations that resemble the parents are called nonrecombinant. ⊚ true ⊚ false

32)

A map unit or centiMorgan is equal to a 10% recombination frequency. ⊚ true ⊚ false

33) Map distances above 50 are considered unreliable due to the occurrence of doublecrossovers between the genes. ⊚ ⊚

34)

true false

The locus is the physical place of a gene on a chromosome. ⊚ ⊚

Version 1

true false

9

stumerit@gmail.com

Answer Key Test name: Chapter 07 Test Bank 1) E 2) E 3) C 4) A 5) D 6) B 7) C 8) B 9) C 10) D 11) B 12) C 13) D 14) C 15) A 16) A 17) C 18) D 19) C 20) A 21) A 22) C 23) B 24) B 25) A 26) A Version 1

10

stumerit@gmail.com

27) TRUE 28) FALSE 29) FALSE 30) FALSE 31) TRUE 32) FALSE 33) TRUE 34) TRUE

Version 1

11

stumerit@gmail.com

Student name:_ 1)

Examples of euploidy include A) B) C) D) E)

2)

Select the pairs that correctly match an aneuploid condition to its genotype.

A) B) C) D) E)

3)

Edward syndrome - trisomy 18 Down syndrome - trisomy 21 Jacobs syndrome - XYY Turner syndrome - XXY Klinefelter - XO

Variations in chromosome structure are important for which of the following reason(s)?

A) B) C) D)

4)

diploidy. triploidy. tetraploidy. polyploidy. aneuploidy.

evolution of new species may result in the production of abnormal offspring may alter the phenotype of an organism All of these choices are correct.

Chromosomes may be identified based on which of the following characteristics?

Version 1

1

stumerit@gmail.com

A) B) C) D)

5)

Which of the following would have the shortest p arm of the chromosome?

A) B) C) D)

6)

acrocentric metacentric telocentric submetacentric

A loss of an internal portion of a chromosome is called a(n) A) B) C) D)

7)

location of the centromere banding patterns size of the chromosome All of these choices are correct.

.

reciprocaltranslocation terminaldeficiency interstitialdeletion geneduplication

What process is the cause of human genetic diseases such a cri-du-chatsyndrome?

A) B) C) D)

Version 1

translocation duplication deletion inversion

2

stumerit@gmail.com

8) Given the following sequence of genes on a chromosome, determine what change in chromosome structure occurred. The asterisk (*) indicates the centromere.

Before: A B C D * E F G H After: A C D * E F G H A) B) C) D)

terminal deletion interstitial deletion inversion gene duplication

9) Given the following sequence of genes on a chromosome, determine what change in chromosome structure occurred. The asterisk (*) indicates the centromere.

Before: A B C D * E F G H After: A B C D * E F E F G H A) B) C) D)

10)

What causes gene duplications?

A) B) C) D) E)

11)

terminal deletion interstitial deletion inversion gene duplication

the crossing over of misaligned chromosomes deletion of important genetic information reciprocal translocations position effect None of these choices are correct.

The production of gene families, such as the globin genes, is the result of

Version 1

.

3

stumerit@gmail.com

A) B) C) D) E)

inversions deficiencies geneduplications simpletranslocations None of these choices are correct.

12) Given the following sequence of genes on a chromosome, determine what change in chromosome structure occurred. The asterisk (*) indicates the centromere.

Before: A B C D * E F G H After: A B G F E * D C H A) B) C) D) E)

reciprocal translocation pericentric inversion paracentric inversion gene duplication None of the answers are correct.

13) Inversions detectable by light microscopy are contained within what percent of the human population?

A) B) C) D)

14)

less than 1% approximately 2% approximately 5% greater than 10%

Inversion loops can occur in which of the following?

Version 1

4

stumerit@gmail.com

A) B) C) D) E)

15)

paracentric inversions pericentric inversions gene duplications reciprocal translocations both paracentric inversions and pericentric inversions

An inversion heterozygote contains which of the following?

A) B) C) D)

two homologous chromosomes with inversions two normal chromosomes one normal chromosome and one chromosome with an inversion None of these choices are correct.

16) Which of the following generally has the least effect on the phenotype of the individual who carries it?

A) B) C) D)

17)

Robertsonian translocation unbalanced translocation balanced translocation All of these choicesare equally detrimental to the phenotype.

Robertsonian translocations usually occur between what types of chromosomes?

A) B) C) D)

Version 1

metacentric acrocentric telocentric submetacentric

5

stumerit@gmail.com

18)

A translocation cross may occur in an individual which has which of the following?

A) B) C) D)

19)

Which of the following expressions denotes a trisomic organism?

A) B) C) D)

20)

.

aneuploidy allopolyploidy autopolyploidy translocations

What are Klinefelter and Turner syndromes examples of?

A) B) C) D)

22)

3n 2n-1 2n+1 2n+2

Edward and Patau syndromes are examples of A) B) C) D)

21)

reciprocal translocation unbalanced translocation simple translocations All of these choices are correct.

sex chromosome aneuploidy autosomal aneuploidy reciprocal translocations paracentric inversions

Which human cells exhibit endopolyploidy?

Version 1

6

stumerit@gmail.com

A) B) C) D) E)

23)

The polytene chromosomes of Drosophila are an example of

A) B) C) D) E)

24)

.

aneuploidy polyploidy translocations inversionloops None of these choices are correct.

Which type of plant would usually be a seedless variety?

A) B) C) D)

25)

sex cells nerve cells all somatic cells liver cells red blood cells

aneuploid diploid triploid tetraploid

Which correctly describes mitotic nondisjunction?

A) B) C) D)

Version 1

It is a relatively rare event.

It results in the loss of chromosomes in some cells.

It usually does not affect all of the cells of the organism.

All of these choices are correct.

7

stumerit@gmail.com

26)

The failure of chromosomes to separate during anaphase is called

A) B) C) D)

.

synapsis maternaleffect epistasis nondisjunction

27) Which of the following describes an organism with two complete sets of chromosomes from two different species?

A) B) C) D)

28)

tetraploid aneuploid allodiploid allotetraploid

The term

A) B) C) D)

refers to genetic differences between members of the same species.

chromosomalvariation geneticvariation chromosomaldeletions polyploidy

29) The short arm of a chromosome is denoted by the letter letter .

A) B) C) D)

Version 1

and the long arm by the

p; q s; l q; p c; d

8

stumerit@gmail.com

30) A chromosome.

A) B) C) D)

31)

translocation occurs when a piece of one chromosome is attached to another

simple complex reciprocal balanced

is a drug that is used to experimentally produce polyploidy in organisms.

A) B) C) D)

Penicillin Colchicine Polymosca Karyocine

32) Genetic abnormalities that occur after fertilization may result in some tissues of the body differing in their genetic composition. This is called .

A) B) C) D)

mosaicism polyploidy polypheny genetic variation

33) If a disease is associated with copy number variation, that suggests that it is caused by the presence of

Version 1

9

stumerit@gmail.com

A) B) C) D)

34)

mRNA transcripts missing the translation STOP sequence. a much longer version of a gene. a duplicated or deleted copy of a gene. extra telomeres.

Describe endopolyploidy, and how it might benefit an organism.

A) Portions of the organism have extra copies of all chromosomes, for producing additional gene products.

B) The entire organism has extra copies of certain chromosomes, for producing additional gene products.

C) The entire organism has extra copies of all chromosomes, to act as backup in case of DNA damage.

D) Portions of the organism have extra copies of certain genes, for the functions of specialized cell types.

35)

Polytene chromosomes are A) chromosomes that lack telomeres.

B) chromosomes with high copy number variation.

C) backup copies of chromosomes that are kept segregated away from the functional

copies.

D) bundles of hundreds of copies of the same chromosome.

36) A phenotypically normal person is having fertility issues.They consult a geneticist.Their karyotype shows they have 45 chromosomes. Which of the following is the most likely cause of their chromosome abnormality?

Version 1

10

stumerit@gmail.com

A) B) C) D)

Inversion Partial deletion Balanced translocation Robertsoniantranslocation

37) In mammals, the majority of cardiomyocytes (cardiac muscle cells) undergo repeated DNA replication without cytokinesis as a part of normal development and in response to injury or heart attack. Many cardiomyocytes are tetraploid, and some cells have even higher DNA content. This variation in DNA content is an example of .

A) B) C) D)

alloploidy aneuploidy copy number variation endopolyploidy

38) Which of the following would produce the most euploid progeny, sperm cells that result from a nondisjunction following meiosis I or meiosis II? A) B) C) D)

Sperm that are produced following a non-disjunction event in meiosis II. Sperm that are produced following a non-disjunction event in meiosis I. Neither will produce any euploid progeny.

All progeny will be euploid with either non-disjunction event.

39) Trisomy 8 usually leads to the early miscarriage of a fetus. However, adult individuals have been found with cells that have three copies of chromosome 8 in them. How can this be?

A) B) C) D)

Version 1

The trisomic 8 adults likely have a mosaic region with trisomy 8.

The trisomic cells underwent complete nondisjunction.

The trisomic cells underwent a meiotic nondisjunction.

This individual must be triploid.

11

stumerit@gmail.com

40) In meiotic nondisjunction, meiotic products can be n+1, n-1, or n depending on when nondisjunction occurs. If non disjunction occurs in meiosis I, what is the outcome?

A) B) C) D)

Two trisomic and two monosomic products One trisomic and three monosomic products One trisomic, one monosomic, and two normal products None of these choices are correct.

41) A diploid organism has a total of 36 chromosomes. Assuming all possible chromosome combinations are viable, if a mutant tetraploid version of this organism was created how many chromosomes would it have? If a mutant version of the diploidorganism was monosomic for chromosome 9 how many chromosomes would it have?

A) 144; 35 B) 72; 35 C) 144; 37 D) 72; 37

42) Hemophilia A is an X-linked recessive blood clotting disorder. A normal man and a woman with hemophilia A have a child with Turner Syndrome (XO). This child does not have hemophilia. In whom did nondisjunction occur? In meiosis I or meiosis II? A) Woman; meiosis I B) Woman; meiosis II C) Man; meiosis I D) Man; meiosis II E) Woman; there is not enough information to tell if the nondisjunction happened in meiosis I or II

Version 1

12

stumerit@gmail.com

43) The salivary amylase gene (AMY1) is present in two diploid copies in chimpanzees.

Humans are known to have between 6-15 copies, an adaptation that is thought to be related to the high-starch diet of humans. This difference among humans is an example of .

A) B) C) D)

G banding copy number variation a simple translocation a reciprocal translocation

44) The common goldfish Carassius auratus has 100 chromosomes and is tetraploid. The goldfish therefore has sets of chromosomes containing chromosomes each.

A) B) C) D)

4; 25 2; 50 4; 100 1; 100

45) The African clawed frog ( Xenopus laevis) is an allotetraploid, likely as a result of an interspecies mating long ago, followed by a duplication of the entire genome. Xenopus laevis is fertile and has a normal life cycle. In contrast, mules, the allodiploid offspring of a male donkey and a female horse, are generally sterile. Why can Xenopus reproduce and mules cannot?

A) Frogs are less sensitive to multiple copies of the genome than mammals.

B) In allotetraploid organisms each chromosome has a chromosome to pair up with in meiosis, whereas in allodiploid organisms they do not.

C) The two frogs that interbred to form the Xenopus laevis must have been more closely genetically related than the donkey and horse are.

D) The mule must have a genetic mutation that prevents it from reproducing.

Version 1

13

stumerit@gmail.com

46) A wholphin is a rare hybrid animal born from mating a female bottlenose dolphin with a male false killer whale. Wholphins are diploid. Interestingly, wholphins are fertile. What can you conclude from the fact that wholphins are fertile?

A) B) C) D)

Wholphins are allotetraploid.

Dolphins and false killer whales likely have the same number of chromosomes.

Dolphins and false killer whales are actually the same species.

One of the parents must have been aneuploid.

47) The effects of a deficiency on an organism are dependent on the importance of the missing genetic material. ⊚ true ⊚ false

48) The majority of autosomal aneuploid conditions are lethal, but sex chromosome aneuploids are usually not lethal. ⊚ true ⊚ false

49)

Variations in a gene are called allelic variations. ⊚ ⊚

50)

true false

Inversions represent a change in the total genetic material of a chromosome. ⊚ true ⊚ false

51) Polyploid plants tend to produce less fruits and flowers, be smaller in size, and cannot adapt as well to extreme environmental conditions as normal varieties.

Version 1

14

stumerit@gmail.com

⊚ ⊚

true false

52) Due to the formation of an inversion loop, sections of DNA may either be duplicated or deleted. ⊚ true ⊚ false

53) Since no genetic material is lost or gained by an inversion, it will only influence phenotype if the breaks are within a gene or in important regulatory regions for a gene. ⊚ true ⊚ false

54)

Homologous genes within a species are called paralogs. ⊚ ⊚

55)

true false

The ends of chromosomes have areas of repeated DNA called centromeres. ⊚ ⊚

Version 1

true false

15

stumerit@gmail.com

Answer Key Test name: Chapter 08 Test Bank 1) [A, B, C, D] 2) [A, B, C] 3) D 4) D 5) C 6) C 7) C 8) B 9) D 10) A 11) C 12) B 13) B 14) E 15) C 16) C 17) B 18) A 19) C 20) A 21) A 22) D 23) B 24) C 25) D 26) D Version 1

16

stumerit@gmail.com

27) D 28) B 29) A 30) A 31) B 32) A 33) C 34) A 35) D 36) D 37) D 38) A 39) A 40) A 41) B 42) E 43) B 44) A 45) B 46) B 47) TRUE 48) TRUE 49) TRUE 50) FALSE 51) FALSE 52) TRUE 53) TRUE 54) TRUE 55) FALSE

Version 1

17

stumerit@gmail.com

Student name:_ 1)

DNA may be transferred between bacteria via A) B) C) D)

2)

conjugation. transformation. transduction. fission.

Which correctly describe the process of conjugation?

A) The cells must be in physical contact.

B) It requires bacteriophage as an intermediary.

C) It involves a sex pilus.

D) Only competent cells can participate.

E) Donor strains can convert non-donor strains into donor strains.

F) F- cells act as donors.

3)

Which correctly describes F factors?

A) B) C) D) E)

"F factor" is short for "fertility factor".

If present, that cell can act as a donor.

It consists of a single gene that is present on the chromosome.

All natural isolates of E. coli have it.

After it is transferred by conjugation, the recipient cell becomes F+.

4) During conjugation, one gene (A) is found to transfer to the recipient bacteria 26 minutes following the start of conjugation, while a second gene (M) is found to transfer 37 minutes following the start of conjugation. A third gene (T) transfers 45 minutes following the start of conjugation. Based on this information, which of the following is true?

Version 1

1

stumerit@gmail.com

A) B) C) D)

5)

Which of the following conditions must be correct for transformation to occur?

A) B) C) D) E)

6)

Genes A and M have a genetic distance of 11 minutes.

Genes A and T have a genetic distance of 19 minutes.

Genes M and T have a genetic distance of 18 minutes.

The order of the genes is A T M.

temperature ionic conditions nutrient balance F factor must be present bacteriophage strain

Horizontal gene transfer can include A) when a gene is acquired from another species.

B) when a gene is acquired directly from the parent.

C) when a gene is acquired by conjugation.

D) when a gene is acquired by transformation.

E) when a gene is acquired by transduction.

F) when a gene is lost from the genome.

7) You are in a lab and are planning to grow bacteria with the genotype met- bio- thr- leuthi+on agar plates. What amino acids or vitamins must you include on the plates in order for this bacteria to grow? Check all that apply.

Version 1

2

stumerit@gmail.com

A) B) C) D) E)

Methionine Biotin Threonine Leucine Thiamine

8) Among the plasmid types listed here, which two have the most direct relevance to human health?

A) B) C) D) E)

9)

F factors R factors Degradative plasmids Col-plasmids Virulence plasmids

Which of the following is NOT true regarding bacterial genetics?

A) Bacteria are usually haploid organisms.

B) Bacteria primarily reproduce asexually.

C) The patterns of inheritance in bacteria are studied using the same techniques as eukaryotic organisms.

D) DNA is transferred between individuals by either conjugation, transduction, or transformation.

10)

Which process uses a bacteriophage as an intermediary for the genetic information?

A) B) C) D)

Version 1

transformation transduction conjugation fission

3

stumerit@gmail.com

11) When a bacteria assimilates genetic material (DNA) directly from the environment, this is called A) B) C) D)

12)

transformation. transduction. conjugation. fission.

DNA transfer via a physical connection between two bacteria is known as A) B) C) D)

transformation. transduction. conjugation. fission.

13) This form of DNA transfer was first observed by Lederberg and Tatum (1946) in Escherichia coli.

A) B) C) D)

14)

transformation transduction conjugation fission

This form of DNA transfer uses a sex pilus to transfer the genetic material.

A) B) C) D)

Version 1

transformation transduction conjugation fission

4

stumerit@gmail.com

15)

Bacterial cells that can participate in A) B) C) D)

16)

are known as competent cells.

transformation transduction conjugation fission

What best describes a histidine, methionine auxotroph?

A) B) C) D) E)

It can synthesize only histidine and methionine.

It can use only histidine and methionine as sources of nutrition.

It cannot synthesize histidine or methionine It is killed by histidine and methionine.

It lacks proteins with histidine or methionine.

17) After two cells make contact via the conjugation bridge, the protein complex that initiates DNA transfer is called the A) B) C) D)

origin of transfer.

T DNA. relaxosome. nucleoprotein complex.

18) After conjugation, the enzyme that rejoins the ends of the linear DNA into a circular plasmid is called .

A) B) C) D)

Version 1

relaxosome relaxase F factor nucleoprotein

5

stumerit@gmail.com

19) The site on a plasmid that is cut, producing a single strand of DNA, to allow conjugation to occur is called the .

A) B) C) D)

20)

How do researchers interrupt the process of conjugation?

A) B) C) D)

21)

using tweezers using a microscope using a blender using a special gene

In experiments, interrupted mating may be used to A) B) C) D)

22)

origin oftransfer relaxase nucleoprotein T DNA

inhibit transduction. generate loss of function alleles. determine the relative position of genes. alter the genotype of the donor cell.

The units of genetic distance derived from bacterial conjugation studies are called A) B) C) D)

Version 1

.

seconds centimorgans recombinationunits minutes

6

stumerit@gmail.com

23)

Who was the first to discover the process of natural transformation?

A) B) C) D)

24)

Morgan Sturtevant Griffith Avery

What do competence factors do?

A) B) C) D)

allow the formation of a sex pilus promote bacteriophage binding for transduction allow DNA in the environment to bind to the cell surface inhibit genetic transfer between donor and recipient cells

25) A structure called a(n) conjugation.

A) B) C) D)

26)

allows the transfer of genetic information during

F factor plasmid sex pilus transformationbridge

A cell with an F factor integrated into the bacterial chromosome is called

.

A) Hfr B) F+ C) a conjugative plasmid

Version 1

7

stumerit@gmail.com

27)

Which does not require any recombination with the bacterial chromosome?

A) conjugation B) transduction C) transformation

28)

Loss of function mutations are easier to study in _

organisms, such as bacteria.

A) haploid B) diploid C) triploid

29)

Small circular pieces of DNA, separate from the bacterial chromosome, are called .

A) heteroduplexes B) plasmids C) relaxosomes

30) What is the most important result of horizontal gene transfer as it relates to human health?

A) It spreads antibiotic resistance in pathogenic bacteria.

B) It can explain the occurrence of nonheritable genetic diseases.

C) It can cause the disappearance of genes from the human genome, leading to disease.

D) It has been used successfully to treat dozens of diseases, by replacing damaged DNA in the cells of the patient.

Version 1

8

stumerit@gmail.com

31) DNA transfer by transduction depends on what occasional mistake that can occur during a phage lytic cycle?

A) B) C) D)

32)

A piece of host cell DNA is packaged into a phage.

A host cell protein is incorporated into a phage.

The host cell undergoes lysis before any new phages are produced.

The phage and bacterial genome fragments recombine.

How does a transducing phage directly contribute to DNA transfer between bacteria?

A) By injecting a fragment of the bacterial genome from a previous host into another bacterial cell B) By stimulating the formation of a sex pilus C) By injecting phage DNA into a living bacterial cell D) By incorporating DNA fragments from two different bacterial cells so that recombination can occur within the phage

33) In the experiment performed by Lederberg and Tatum bacteria of different genotypes had to be mixed together to obtain a genetic transfer. However, Davis performed the experiment in a slightly different manner by separating cells with a filter incapable of allowing bacteria to pass.

What possibility did the experiment by Davis exclude that could have occurred by the protocol used by Lederberg and Tatum?

A) Transformation B) Conjugation C) Transduction

Version 1

9

stumerit@gmail.com

34) What is the approximate distance in minutes between the argR and pyrB genes on the E. coli chromosome?

A) B) C) D)

Version 1

16 minutes 96 minutes 26 minutes 70 minutes

10

stumerit@gmail.com

35) If the origin of transfer was located directly to the right of the galE gene on this map of the E. coli chromosome, and gene transfer proceeded counterclockwise, how many minutes after the galE gene was transferred would the dnaB gene be transferred in an interrupted mating experiment?

A) B) C) D)

25 minutes 75 minutes 107 minutes 16 minutes

36) During a phage life cycle sometimes a phage is packaged carrying a portion of the host cell chromosome, which results in transduction. During conjugation, which plasmid can most directly be compared to the phage that carries a fragment of the host cell chromosome?

Version 1

11

stumerit@gmail.com

A) B) C) D)

F factor F ' factor R factor Col-plasmid

37) During transformation, if the extracellular endonuclease was not functioning properly, at which stage would transformation be halted?

A) B) C) D)

During heteroduplex repair During DNA transport into the cell During homologous recombination After DNA fragment binding to a cell surface receptor on the bacterium

38) You are performing transduction experiments using recipient bacteria that are auxotrophic for histidine, leucine, and tryptophan. You notice that following transduction, recombinant bacteria that are his+ are usually also trp+but that they are less likely to also be leu+. What can you conclude about this transduction experiment?

A) In the original phage genome, the genes for his+ and trp+ are close together.

B) In the donor bacterial genome, the genes for his+ and trp + are close together.

C) When these phages were made they took up two separate pieces of DNA, one containing his + and one containing trp+.

D) The donor bacterial genome was leu-.

39) In conjugation, the strand of DNA that is transferred from the donor cell to the recipient cell is single stranded. ⊚ true ⊚ false

Version 1

12

stumerit@gmail.com

40) The process of conjugation may introduce new genes into the recipient strain, altering its genotype. ⊚ ⊚

41)

true false

The direct movement of DNA between two bacteria is called genetic transfer. ⊚ ⊚

true false

42) During transformation, homologous recombination may occur if the sequence of the introduced DNA has no similarity to the host DNA. ⊚ ⊚

true false

43) During homologous recombination, areas of mismatched DNA form structures called a heteroduplex. ⊚ ⊚

44)

true false

A minute is the basic unit of map distance in bacteria. ⊚ ⊚

Version 1

true false

13

stumerit@gmail.com

45) An episome is a segment of bacterial DNA that can exist as a plasmid or be integrated into the bacterial chromosome. ⊚ ⊚

46)

true false

Competent cells are those used in studies of conjugation. ⊚ ⊚

Version 1

true false

14

stumerit@gmail.com

Answer Key Test name: Chapter 09 Test Bank 1) [A, B, C] 2) [A, C, E] 3) [A, B, E] 4) [A, B] 5) [A, B, C] 6) [A, C, D, E] 7) [A, B, C, D] 8) [B, E] 9) C 10) B 11) A 12) C 13) C 14) C 15) A 16) C 17) C 18) B 19) A 20) C 21) C 22) D 23) C 24) C 25) C 26) A Version 1

15

stumerit@gmail.com

27) A 28) A 29) B 30) A 31) A 32) A 33) A 34) C 35) A 36) B 37) D 38) B 39) TRUE 40) TRUE 41) TRUE 42) FALSE 43) TRUE 44) TRUE 45) TRUE 46) FALSE

Version 1

16

stumerit@gmail.com

Student name:__ 1) What was the outcome of the experiment that reconstituted two different strains of tobacco mosaic viruses that had different infection characteristics?

A) The differences in infection characteristics depended only on the RNA sequence of the virus strain.

B) The differences in infection characteristics depended onlythe protein coat.

C) The differences in infection characteristics depended on an RNA and protein coat interaction.

2)

Which virus uses reverse transcriptase in its reproductive cycle?

A) B) C) D)

3)

Which is a property of emerging viruses?

A) B) C) D)

4)

HIV Phage lambda Both of the viruses use reverse transcriptase Neither of the viruses use reverse transcriptase

May lead to a significant loss of human life Recent origin More likely to cause infection compared to other strains All of these

What is true in bothphageλ and HIV infections?

A) There can be a long latent period where no sign of infection, such as cell death, is detectable.

B) Cell lysis always occurs immediately after virus introduction.

C) Assembled viral particles are always found within the cell.

Version 1

1

stumerit@gmail.com

5) A bacteriophage that is physically integrated into the host chromosome is called a ___ __.

A) B) C) D)

heteroduplex envelope phage prophage plaque

6) A _______ uses the lytic cycle to begin the immediate manufacture of new phages in the host cells.

A) B) C) D)

virulent phage temperatephage bacteria eukaryoticcell

7) A _______ frequently integrates into the host genome, forming prophages and utilizing a lysogenic cycle to manufacture new phages.

A) B) C) D)

8)

virulent phage temperatephage bacteria eukaryoticcell

What is the genetic material in the parvovirus?

Version 1

2

stumerit@gmail.com

A) B) C) D)

9)

single-stranded DNA double-stranded DNA single-stranded RNA double-stranded RNA

What is the genetic material in the T4 bacteriophage?

A) B) C) D)

double-stranded DNA single-stranded DNA single-stranded RNA double-stranded RNA

10) If protein was the genetic material of TMV rather than RNA, what would be the result of the Fraenkel-Conrat/Singer experiments when using HR proteins and wild-type RNA? A) B) C) D)

HR type lesions, histidine and methionine in the capsid protein HR type lesions, no histidine and methionine in the capsid protein Wild type lesions, histidine and methionine in the capsid protein Wild type lesions, no histidine and methionine in the capsid protein

11) Azidothymidine (AZT) is an HIV drug. AZT is a reverse transcriptase inhibitor. That means AZT is only effective during the _____ _____ stage of the viral life cycle.

A) B) C) D)

Version 1

entry integration viral assembly release

3

stumerit@gmail.com

12) Vaccines have been very useful in preventing viral diseases.In fact, they have lead to the eradication of smallpox from the world's human population.Most vaccines result in the host producing antibodies (proteins that bind to specific amino acid sequences) that bind to specific viral proteins. What might be a reason why a vaccine for HIV has been so difficult to develop?

A) B) C) D)

The low mutation rate of HIV The fact that HIV genome is found as both DNA and RNA in a cell The high mutation rate of HIV The HIV virion is coated with cellular proteins

13) You perform an experiment like that performed by Fraenkel-Conrat and Singer on TMV. However, in the first step when the viruses are reconstituted, you decide to add RNase to your HR RNA and wild-type proteins. What will be the content of the newly made viral proteins after the reconstituted virus is placed on leaves?

A) The proteins will contain histidine and methionine.

B) The proteins will contain histidine and methionine, but not as much as HR proteins do.

C) The proteins will not contain histidine and methionine.

D) No new viral proteins will be made.

14) The HIV drug fostemsavir binds to the glycoprotein gp120, which is a viral envelope protein. Based on what you know about the lifecycle of HIV, with what step do you predict fostemsavir interferes?

A) attachment B) entry C) integration D) synthesis of viral components E) viral assembly F) release

Version 1

4

stumerit@gmail.com

15) Most biologists consider viruses to be living organisms, which are classified with bacteria. ⊚ ⊚

16)

true false

The genetic material of HIV is single-stranded RNA. ⊚ true ⊚ false

Version 1

5

stumerit@gmail.com

Answer Key Test name: Chapter 10 Test Bank 1) A 2) A 3) D 4) A 5) C 6) A 7) B 8) A 9) A 10) A 11) B 12) C 13) D 14) A 15) FALSE 16) TRUE

Version 1

6

stumerit@gmail.com

Student name:_ 1)

Select the statements that are true about the Hershey-Chase experiments.

A) B) C) D)

2)

All nucleotides contain (check all that apply) A) B) C) D)

3)

a phosphate group. a five carbon sugar. one of five nitrogenous bases. a six-carbon sugar.

What features of DNA were suggested by Rosalind Franklin's X-ray diffraction data?

A) B) C) D)

4)

They radioactively labeled the protein coat of the bacteriophage with 35S. They radioactively labeled the DNA of the bacteriophage with 32P. The results of the experiment indicated only the presence of 35S in the cell.

The results suggested that DNA was the genetic material.

It had a helical structure.

The helix had more than one strand.

The helix contained about 10 bases per turn.

The helices were antiparallel.

Select the ways in which an RNA strand differs from a DNA strand.

A) B) C) D)

Version 1

It contains ribose instead of deoxyribose.

It runs 6′ to 3′ instead of 5′ to 3′.

It is usually much shorter than chromosomalDNA. It contains uracil instead of thymine.

1

stumerit@gmail.com

5)

Select the criteria that all genetic material must meet.

A) B) C) D)

6)

It must contain the information necessary to construct the entire organism.

It must have no variation within a species.

It must be passed from parent to offspring.

It must be able to be copied.

Select the researchers that are correctly matched with their discovery.

A) Pauling provided information on secondary structure in biological molecules.

B) Franklin suggested that DNA was a helix with more than one strand and that there were about 10 bases per turn of the DNA. C) Watson and Crick collected a large amount of X-ray data on the structure of DNA. D) Chargaff demonstrated that the adenine and thymine bases and the cytosine and guanine bases interacted in some manner.

7)

Frederick Griffith is responsible for discovering what process?

A) B) C) D)

replication transmission transformation transduction

8) The fact that the type R and S strains of Streptococcus pneumoniae that Griffith worked with possessed small differences in capsule structure satisfies which of the following criteria for genetic material?

Version 1

2

stumerit@gmail.com

A) B) C) D)

9)

The individuals who determined that Griffith's transforming principle was DNA were .

A) B) C) D)

10)

Hershey and Chase Avery, Macleod, andMcCarty Watson and Crick Creighton and McClintock

The building blocks of DNA are called

A) B) C) D)

12)

Hershey and Chase Avery, Macleod, andMcCarty Watson and Crick Creighton and McClintock

These individuals determined that DNA was the genetic material in T2 phage.

A) B) C) D)

11)

transmission replication information variation

.

amino acids codons nucleotides alleles

DNA differs from RNA in which way?

Version 1

3

stumerit@gmail.com

A) B) C) D)

13)

Select the nitrogenous base found only in RNA. A) B) C) D) E)

14)

the structure of the nucleotide the five-carbon sugar it uses the size of the phosphate groups the number of bases attached to the sugar

cytosine guanine thymidine adenine uracil

The backbone of the DNA molecule is formed by

A) B) C) D)

.

peptide bonds ribose sugars nitrogenousbases phosphodiesterbonds

15) How is the directionality of a DNA moleculedescribed based on the orientation of sugar molecules within the strand?

A) B) C) D) E)

Version 1

left to right top to bottom 5′ to 3′ A to T or G to C All DNA molecules are different in their directionality.

4

stumerit@gmail.com

16) The individual(s) who used ball-and-stick models to identify the three-dimensional structure of proteins was .

A) B) C) D) E)

Franklin Watson and Crick Hershey and Chase Pauling Chargaff

17) The researcher(s) who initially used X-ray diffraction to gather information on the DNA molecule was .

A) B) C) D) E)

Franklin Watson and Crick Hershey and Chase Pauling Chargaff

18) According to Chargaff's rule, if the DNA of a species contains 20% adenine, what percent of guanine will it contain?

A) B) C) D)

19) were

20% 30% 50% 75%

The first group of researchers to correctly identify the double-helix structure of DNA .

Version 1

5

stumerit@gmail.com

A) B) C) D)

20) a(n)

McClintock and Franklin Hershey and Chase Pauling and Avery Watson and Crick

In a double-helix DNA strand, the adenine on one strand forms a hydrogen bond with on the other strand.

A) B) C) D)

adenine guanine thymine cytosine

21) How many bases are necessary to complete one complete twist (360 degrees) of a DNA double helix?

A) 5 B) 10 C) 100 D) 1000

22)

The fact that the two DNA strands are arranged in opposite orientations gives DNA its characteristics.

A) B) C) D)

Version 1

antiparallel complementary redundant water-soluble

6

stumerit@gmail.com

23)

One strand of DNA is 5′ - AGGCCTTA - 3′. What is the opposite strand?

A) B) C) D)

24)

What form of DNA is most common in living organisms?

A) B) C) D)

25)

5′ - AGGCCTTA - 3′ 5′ - TCCGGAAT - 3′ 3′ - AGGCCTTA - 5′ 3′ - TCCGGAAT - 5′

A DNA B DNA Z DNA R DNA

Which of the following is a left-handed DNA molecule?

A) B) C) D)

A DNA B DNA Z DNA R DNA

26) Avery, Macleod, and McCarty used the enzyme cell extracts.

to remove the proteins from the

A) protease B) DNase C) RNase

Version 1

7

stumerit@gmail.com

27) The experiments.

A) B) C) D)

28)

RNA DNA proteins carbohydrates

The purine bases are

A) B) C) D)

29)

was/were labeled using the radioisotope 32P in the Hershey-Chase

.

cytosine, thymine,and uracil adenine andguanine adenine andthymine cytosine andguanine

The pyrimidine bases are

A) B) C) D)

.

cytosine, thymine,and uracil adenine andguanine adenine andthymine cytosine andguanine

30) The idea that the adenine and thymine bases of the DNA interact in some manner was first proposed by .

Version 1

8

stumerit@gmail.com

A) B) C) D)

Watson andCrick Franklin Pauling Chargaff

31) Adenine and thymine form guanine form bonds.

A) B) C) D)

32)

hydrogen bonds between them, while cytosine and

2; 3 3; 4 3; 2 4; 3

The term nucleic acids is used to describe RNA and DNA because A) they are acidic molecules and have a net negative charge at neutral pH. B) they are acidic molecules and have a net positive charge at neutral pH. C) they are acidic molecules and have no charge at neutral pH.

33) Imagine Rosalind Franklin had performed X-ray diffraction on double-stranded RNA as well as double-stranded DNA. What would be a key difference that she would have observed between these two molecules?

A) DNA but not RNA forms a helical structure.

B) RNA forms a left-handed helix while DNA forms a right-handed helix.

C) A DNA helix contains about 10 bp per turn, whereas an RNA helix contains 11 to 12 bp per turn.

D) DNA double helices are parallel whereas RNA double helices are antiparallel.

Version 1

9

stumerit@gmail.com

34) Choose the RNA molecule that would be complementary to this DNA molecule: 5'TTAACCGG-3'.

A) B) C) D)

5'-UUAACCGG-3' 3'-AATTGGCC-5' 3'-AAUUGGCC-5' 5'-AAUUGGCC-3'

35) How many total hydrogen bonds would be found holding together the base pairs in a double stranded DNA molecule containing the following nucleotides: 5'-TAGCCCTT-3' 3'-ATCGGGAA-5' A) B) C) D)

36)

8 16 20 24

Which RNA structural pattern does NOTcontain single-stranded regions?

A) B) C) D)

Bulge loop Internal loop Multibranched junction Stem-loop

37) Select the feature that is incorrect about this DNA double strand: 5'-ATGCCCGGAAC-3' 5'-TACGGGCCTTG-3'

Version 1

10

stumerit@gmail.com

A) B) C) D)

Chargaff's rules are not observed.

The nucleotides are not base paired correctly.

The strands are not anti-parallel.

U should be used instead of T.

38) In the Hershey-Chase experiments, the protein coat of the bacteriophage was labeled with 32 the P radioisotope. ⊚ ⊚

39)

true false

A nucleoside consists of only a five-carbon sugar and a phosphate group. ⊚ ⊚

true false

40) A purine on one strand of the DNA is always paired with a pyrimidine on the other strand. ⊚ ⊚

true false

41) The helical shape of the DNA contains major and minor grooves, which assist in the regulation of gene expression. ⊚ ⊚

true false

42) The two DNA strands of a double helix can be described as antiparallel but uncomplementary.

Version 1

11

stumerit@gmail.com

⊚ ⊚

Version 1

true false

12

stumerit@gmail.com

Answer Key Test name: Chapter 11 Test Bank 1) [A, B, D] 2) [A, B, C] 3) [A, B, C] 4) [A, C, D] 5) [A, C, D] 6) [A, B, D] 7) C 8) D 9) B 10) A 11) C 12) B 13) E 14) D 15) C 16) D 17) A 18) B 19) D 20) C 21) B 22) A 23) D 24) B 25) C 26) A Version 1

13

stumerit@gmail.com

27) B 28) B 29) A 30) D 31) A 32) A 33) C 34) C 35) C 36) C 37) C 38) FALSE 39) FALSE 40) TRUE 41) TRUE 42) FALSE

Version 1

14

stumerit@gmail.com

Student name:__ 1)

What feature(s) may be found in insertion elements?

A) B) C) D) E)

inverted repeats reverse transcriptase gene antibiotic resistance gene transposase gene integrase gene

2) You wish to repeat the Noll experiment. However, after you run your gel for an appropriate amount of time, you are dismayed to find that all of the DNA is present at the very top of the agarose gel. What mistakes might have been made in your experiment? (Check all that apply.)

A) B) C) D)

3)

How many origins of replication are there in a bacterial chromosome?

A) B) C) D)

4)

You forgot to add DNase I to your DNA. You didn't sufficiently isolate your DNA from the attached proteins.

You forgot to stain the gel with ethidium bromide.

You added too much DNase I to your DNA.

0 1 2 More than two

Where is the bacterial chromosome located?

Version 1

1

stumerit@gmail.com

A) B) C) D)

5)

What is a mechanism of condensation shared by both prokaryotes and eukaryotes?

A) B) C) D)

6)

nucleosomes loop domains 30 nm fiber None of these choices are correct.

Topoisomerase I does which of the following?

A) B) C) D)

7)

nucleus nucleolus nucleoid nuclear envelope

relax negative supercoils relieve positive supercoils introduce negative supercoils More than one of these choices are correct.

Quinolones kill bacteria by what mechanism?

A) B) C) D)

Version 1

They inhibitDNA gyrase.

They inhibitDNA compaction.

They inhibitDNA replication.

All of these choices are correct.

2

stumerit@gmail.com

8) What is one reason why an amphibian, such as a salamander, might have a larger genome than a mammal, such as a chimpanzee?

A) B) C) D)

9)

Where do kinetochores attach to chromosomes?

A) B) C) D)

10)

telomeres specific genes on the chromosome centromeres They do not attach to DNA.

Which of the following is found at the end of a eukaryotic chromosome?

A) B) C) D)

11)

The amphibian is more complex than the mammal.

The amphibian has more structural genes than the mammal.

The amphibian has more repetitive sequences than the mammal.

The amphibian has more introns than the mammal.

telomeres centromeres kinetochores nucleoids

An Alu sequence is an example of what?

A) moderately repetitive element B) Unique sequences that are less frequent than moderately repetitive genes, but more frequent than other unique sequences.

C) highly repetitive DNA D) unique sequence DNA

Version 1

3

stumerit@gmail.com

12) The majority of the nonrepetitive genes in an organism are found in which of the following?

A) B) C) D)

13)

unique sequences moderately repetitive sequences highly repetitive sequences None of these choices are correct.

Unique sequences make up approximately what percent of the human genome?

A) 5% B) 25% C) 40% D) 80%

14)

How many types of histone proteins are there?

A) B) C) D)

15)

4 5 7 8

What types of amino acids are most responsible for the binding of DNA to histones?

Version 1

4

stumerit@gmail.com

A) B) C) D)

16)

hydrophobic amino acids polar amino acids positively charged amino acids negatively charged amino acids

About how many bases of DNA wrap around a histone complex?

A) <50 B) 146 C) 200 D) >1,000

17) Areas of the chromosome that are highly condensed and transcriptionally inactive are called ev: 02_04_2014_QC_44451 A) B) C) D)

18)

What is the firstlevel of chromosome compaction among the following choices?

A) B) C) D)

19)

euchromatin. superchromatin. heterochromatin. exons.

Loop domains 30 nm fibers Closer association of loop domains Nucleosomes

What is the highest level of chromosome condensation among the following choices?

Version 1

5

stumerit@gmail.com

A) B) C) D)

20)

Loop domain 30 nm fibers Double helix Nucleosome

What is a nucleosome composed of?

A) It is composed of 2 copies each of H2A, H2B, H3, and H4 and 1 copy of H1.

B) DNA wrapped twice around a histone octet and includes approximately 200 bases that are not associated with the histones.

C) Two copies each of H2A, H2B, H3, and H4.

D) Two turns of DNA wrapped around an octet core of histone proteins.

21) The DNA of a bacterial cell must be compacted about ________fold to fit within the confines of the cell.

A) 10 B) 100 C) 150 D) 1000 E) 1,000,000

22)

The zigzag modelisassociated with the ________ level of DNA organization.

A) B) C) D) E)

Version 1

histone 11nm fiber beads-on-a-string 30 nm fiber scaffoldprotein

6

stumerit@gmail.com

23)

A chromosome territory is defined as A) B) C) D)

a region in the nucleus that is occupied by a single chromosome. a region on a chromosome that is devoid of nucleosomes. a region on a chromosome that has no protein encoding genes. a region in the nucleus that may have several chromosomes.

24) The experiment by Noll, 1974, supported the observation that histones were regularly spaced on chromosomes because A) digestion with increased amounts of DNase I resulted in one or a few bands.

B) limited digestion with DNase I resulted in DNA fragments that differed in size by approximately 200 bp.

C) digestion with low or high amounts of DNase I resulted in a fragment that was found at the bottom of the gel.

D) a digestion performed with a moderate amount of DNase I gave results that were very similar to results obtained with higher amounts of DNase I.

25)

The correct order of compaction from least compacted to most compacted would be A) B) C) D)

26)

naked DNA, 30 nm fiber, nucleosome,loop, metaphase chromosome. naked DNA, loop, 30 nm fiber, nucleosome, metaphase chromosome. naked DNA, nucleosome, 30 nm fiber,loop, metaphase chromosome. naked DNA, metaphase chromosome,loop, 30 nm fiber, nucleosome.

The individual who first proposed the existence of transposable elements was ____.

Version 1

7

stumerit@gmail.com

A) B) C) D) E)

27)

Transposons that use an RNA intermediate for transposition are called ____ _.

A) B) C) D)

28)

R elements RNAi transposons retrotransposons reverse transposons

Which of the following enzymes is required for simple transposition?

A) B) C) D)

29)

Sturtevant Morgan McClintock Franklin Watson

Integrase Jumpase Splicase Transposase

Long-terminal repeats are unique to which group of transposons?

A) B) C) D)

Version 1

integrase simple transposons LTR retrotransposons non-LTR retrotransposons

8

stumerit@gmail.com

30) Which of the following is technically NOT part of the genetic information of a transposable element?

A) B) C) D)

31)

Which enzyme is unique to the retrotransposons?

A) B) C) D) E)

32)

insertion elements inverted repeats direct repeats transposase

reverse transcriptase reverse resolvase transposase integrase reverse integrase

Which statement is true concerning chromosome compaction during cell division?

A) B) C) D)

Loop domains are not anchored to the scaffolding proteins.

Overall chromosomal length is shortened.

Compaction results in increased transcriptional rates.

The 30 nm fibers are altered to 60 nm fibers.

33) A transposon is inserted into the sequence 5' GACTC 3'. Following simple transposition into this site, what sequences flank the transposon?

A) B) C) D)

Version 1

5' GACTC 3'; 5' GACTC 3' 5' GACTC 3'; 5' CTCAG 3' 5' CTCAG 3'; 5' GACTC 3' 5' CTCAG 3'; 5' CTCAG 3'

9

stumerit@gmail.com

34) You are studying a protein in the frog Xenopus laevis. This organism has a high percentage of transposable elements (TEs) in its genome. After several months of experiments, you start experiencing strange results. It appears that your protein is no longer being made! You look at the chromosomes from the cells where the protein is not being produced, and they all appear normal. You also sequence the coding region of your gene and it has a normal sequence.

What is the most likely explanation for your missing protein?

A) B) C) D)

A chromosomal breakage has occurred due to excision of a TE. A mutation has occurred due to incorrect excision of a TE from your gene.

A TE has inserted in the regulatory sequences for your gene, altering gene regulation.

Exon shuffling has occurred, and there is a new exon in your gene.

35) A double stranded stretch of eukaryotic DNA is 250,000 bp long. If the average linker is about 54 base pairs, how many nucleosomes would be present on this piece of DNA?

A) 1250 B) 4630 C) 1712 D) 200

36) A double stranded stretch of eukaryotic DNA is 4,000 bp long. If the average linker is about 54 base pairs, how many molecules of histone H3 would be present on this piece of DNA?

A) 20 B) 40 C) 74 D) 148

37)

The formation of what structure would be impaired if a cell was lacking CTCF proteins?

Version 1

10

stumerit@gmail.com

A) B) C) D)

Double helix Nucleosome 30-nm fiber Loop domains

38) During a retrotransposition event, 4 DNA copies of a retrotransposon are created. At the end of this event, how many total copies of the retrotransposon will be found in the genome?

A) 1 B) 4 C) 5 D) 8 E) 10

39) Consider a simple transposition event in a region of the genome where DNA replication is not actively occurring. At the end of the event how many copies of this transposon will be present in the genome?

A) B) C) D) present.

1 2 4 There is not enough information given to determine how many transposons will be

40) Human chromosome 3 is almost 200 million base pairs in length. How many origins of replication do you predict will be found on human chromosome 3?

Version 1

11

stumerit@gmail.com

A) 2,000 B) 1 C) 2 D) 200,000 E) 20,000

41) You are performing an experiment to identify chromosome territories in a species with 6 pairs of homologous chromosomes, plus two sex chromosomes. You use 7 different colored fluorescent molecules(one for each chromosome and one for the sex chromosome) and link each one to a probe that is highly conserved at the centromere of each chromosome in this species.

What will be the result of your experiment?

A) The chromosomes will all be marked but you won't be able to tell which chromosome is which.

B) You will be able to identify the location and identity of each chromosome territory.

C) The chromosomes will all be marked with the same color.

D) None of the probes will bind to the chromosomes.

42) One would expect heterochromatic regions of DNA to be more compacted than euchromatic regions. ⊚ ⊚

true false

43) Overwinding of the DNA decreases the number of turns in the double helix, and thus results in supercoils in the DNA. ⊚ true ⊚ false

Version 1

12

stumerit@gmail.com

44) To date, there are no indications that transposable elements offer a selective advantage to a species. ⊚ true ⊚ false

Version 1

13

stumerit@gmail.com

Answer Key Test name: Chapter 12 Test Bank 1) [A, D] 2) [A, B] 3) B 4) C 5) B 6) A 7) A 8) C 9) C 10) A 11) C 12) A 13) C 14) B 15) C 16) B 17) C 18) D 19) A 20) D 21) D 22) D 23) A 24) B 25) C 26) C Version 1

14

stumerit@gmail.com

27) C 28) D 29) C 30) C 31) A 32) B 33) A 34) C 35) A 36) B 37) D 38) C 39) A 40) A 41) A 42) TRUE 43) FALSE 44) FALSE

Version 1

15

stumerit@gmail.com

Student name:_ 1)

Select the statements that are true regarding the initiation of DNA replication in bacteria.

A) B) C) D)

2)

It involves a region of the DNA called oriC. Proteins bind to the DNA to begin separation of the strands.

The strands are initially separated at GC-rich regions of DNA. Following initial separation, DNA helicase enzymes continue to separate the strands.

Select the reasons that DNA synthesis occurs with a high degree of fidelity.

A) The hydrogen bonding between G and C or A and T is much more stable than between mismatched pairs.

B) The active site of DNA polymerase preferentially catalyzes the attachment of nucleotides when the correct bases are located in opposite strands.

C) DNA polymerase enzymatically removes mismatched nucleotides.

D) DNA polymerase has the ability to change the structure of the base in order to form the correct bond.

3)

Select the limitations of the DNA polymerases used for DNA replication.

A) DNA polymerase can attach new nucleotides only in the 5′ to 3′ direction.

B) DNA polymerases must begin synthesis using a primer or existing DNA strand.

C) DNA polymerases must have a template strand to copy from.

D) DNA polymerases can attach new nucleotides in the 3′ to 5′ direction only on the lagging strand.

4) Which of the following may account for the process of gene conversion? (Check all that apply)

Version 1

1

stumerit@gmail.com

A) B) C) D) E)

5)

DNA mismatch repair DNA gap repair DNA proofreading Telomerase errors Flap endonuclease

The purpose of DNA replication is to produce

A) B) C) D)

.

two daughter strands two parental strands two template strands four daughter strands

6) In the attachment of a nucleotide to a DNA strand, the cleavage of the dNTP into deoxyribonucleoside monophosphate and pyrophosphate is .

A) exergonic B) endergonic C) energy neutral

7) You are studying DNA replication in human cells. You discover a mutant cell line that can carry out DNA replication, but the final product contains both RNA and DNA fragments.

What enzyme is likely to be missing in this cell line?

A) B) C) D)

Version 1

flap endonuclease DNA ligase DNA polymerase I DNA helicase

2

stumerit@gmail.com

8) Which describes the mechanism of DNA replication in which both parental strands remain together following replication?

A) dispersive B) semiconservative C) conservative

9) Which describes the mechanism of DNA replication in which the newly made doublestranded DNA contains one parental strand and one daughter strand?

A) dispersive B) semiconservative C) conservative

10) The first generation of replication in the Meselson and Stahl experiment disproved which theory of replication?

A) B) C) D)

semiconservative conservative dispersive None—it took more than one generation to disprove the theory.

11) You have isolated what appears to be alien DNA. While studying its replication, you performed the exact experiment Meselson and Stahl did. After three generations, the DNA is subjected to a CsCl gradient and only one band appears. What type of replication does this DNA undergo?

Version 1

3

stumerit@gmail.com

A) semiconservative B) conservative C) dispersive

12)

How many origins of replication does a bacterial chromosome contain?

A) B) C) D)

13)

DNA helicase enzymes move in what direction along the DNA during DNA replication?

A) B) C) D)

14)

5′ to 3′ 3′ to 5′ They travel in both directions.

They remain stationary.

What enzyme relaxes supercoiling ahead of the replication fork?

A) B) C) D) E)

15)

0 1 10 Depends on the size of the DNA

DNA ligase DNA primase topoisomerase DNA polymerase I DNA polymerase III

Which enzyme manufactures a 10-12 base segment of RNA?

Version 1

4

stumerit@gmail.com

A) B) C) D) E)

16)

Which enzyme fills in small regions of DNA where the RNA primers were located?

A) B) C) D) E)

17)

DNA ligase DNA primase topoisomerase DNA polymerase I DNA polymerase III

Which enzyme is responsible for the majority of DNA synthesis during replication?

A) B) C) D) E)

18)

DNA ligase DNA primase topoisomerase DNA polymerase I DNA polymerase III

DNA ligase DNA primase topoisomerase DNA polymerase I DNA polymerase III

Which enzyme attaches adjacent Okazaki fragments, forming a continuous DNA strand?

A) B) C) D) E)

Version 1

DNA ligase DNA primase topoisomerase DNA polymerase I DNA polymerase III

5

stumerit@gmail.com

19)

Which enzyme synthesizes the lagging strand of the DNA? A) B) C) D) E)

20)

How many DNA polymerases are found in prokaryotes?

A) B) C) D)

21)

DNA ligase DNA primase Topoisomerase DNA polymerase I DNA polymerase III

5 7 9 12

DNA polymerases add new nucleotides in what direction?

A) 5′ to 3′ B) 3′ to 5′ C) both directions

22) You have discovered a strain of E. coli that grows very slowly—the generation time is nearly 12 hours compared to the normal 20-30 minutes. Upon further investigation, you find a mutation in a gene for one of the subunits of DNA polymerase III. What subunit is this mutation most likely to be in?

Version 1

6

stumerit@gmail.com

A) B) C) D)

23)

What is the purpose of Okazaki fragments?

A) B) C) D)

24)

To assist in the formation of the replication fork To allow DNA to be synthesized in the 5' to 3' direction on the leading strand To allow DNA to be synthesized in the 5′ to 3′ direction on the lagging strand To reform the double helix following replication

Which of the following is an example of a processive enzyme?

A) B) C) D)

25)

α β γ δ

DNA polymerase I DNA polymerase III DNA ligase Okazaki fragments

What functions are accomplished by the primosome?

A) tracking along DNA B) tracking along DNA, separating double-stranded DNA C) tracking along DNA, separating double-stranded DNA, synthesizing RNA primers D) tracking along DNA, separating double-stranded DNA, synthesizing RNA primers, adding nucleotides

Version 1

7

stumerit@gmail.com

26)

The proofreading of the DNA occurs in the

.

A) 5′ to 3′ direction B) 3′ to 5′ direction C) both directions

27)

In yeast, which of the following is similar to the oriC region of prokaryotes?

A) B) C) D)

centromeres ARS elements promoters telomeres

28) Based on their known functions, which of the enzymes in the following pairs play a similar role in prokaryotes and eukaryotes?

A) DNA pol I : DNA pol α B) DNA pol II : DNA pol β C) DNA pol III : DNA pol γ

29) DNA polymerase III carries out leading and lagging strand synthesis in prokaryotes. How many enzymes accomplish this task in eukaryotes (not counting primer creation)?

A) B) C) D)

Version 1

one two three four

8

stumerit@gmail.com

30)

DNA polymerases are unable to replicate what areas of the chromosome?

A) B) C) D)

31)

What process doesthe Holliday model help explain?

A) B) C) D)

32)

centromeres 3′ ends origins of replication 5′ ends

recombination between homologous chromosomes recombination between sister chromatids the creation of shortenedchromosomes replication initiation

Which recombination model involves formation of a D-loop?

A) double-stranded break model B) Holliday model C) single-stranded break model

33) In E. coli, which protein(s) are necessary for the cell to recognize double-stranded breaks and conduct recombination during meiosis?

A) B) C) D)

34)

RecG RecA RecBCD RuvABC

Which of the following best describes the function of the RecA protein in E. coli?

Version 1

9

stumerit@gmail.com

A) B) C) D)

Promotes strand invasion and D-loop formation in the double-stranded break model Recognizes double-stranded breaks in the DNA Involved in the initial formation of Holliday junctions Resolves Holliday junctions into separate chromosomes

35) If eukaryotic cells evolved such that lagging strand DNA synthesis could occur continuously (without the use of Okazaki fragments), what enzyme would likely no longer be needed for DNA replication?

A) B) C) D)

Flap endonuclease Helicase Primase Topoisomerase

36) You are in the lab trying to synthesize DNA in vitro. You are upset because the lab seems to be out of dNTPs (deoxynucleosidetriphosphates) but you find a tube of dNMPs(deoxynucleoside monophosphates) in the freezer. You add this to your replication reaction instead of dNTPs. Will your reaction work? Why or why not?

A) No, cleavage of dNTP drives the formation of the covalent bond between the nucleoside monophosphate and the growing DNA strand.

B) Yes, only the nucleoside monophosphate ultimately is incorporated into the growing DNA strand.

C) No, all three phosphates on the nucleoside triphosphateare incorporated into the growing DNA strand.

D) Yes, the formation of the covalent bond between the nucleoside monophosphate and the growing DNA strand is energetically favorable.

Version 1

10

stumerit@gmail.com

37) If the piece of partially double-stranded DNA below was added to a reaction mixture that contained DNA pol III and all the reaction components necessary to synthesize DNA, what would be the next base added?

5' AGCATGACGATCCAT 3' 3' ACTGCTAG 5' A) B) C) D)

38)

A G C T

Which answer would best represent the composition of double stranded DNA?

A) B) C) D)

20% A20% G30% C30% T 20% A20% G20% C40% T 30% A15% G15% C30% T 15% A25% G15% C35% T

39) Imagine you are able to watch DNA replication under a microscope in a mutant strain of bacteria. The parental strands appear to unwind and separate, but then they immediately join back together before any new DNA can be synthesized. What protein is missing or defective in this bacterial strain?

A) B) C) D) E)

Helicase Single-strand binding proteins Primase DNA polymerase Ligase

40) DNA polymerase III has the ability to begin synthesis of the new daughter strands immediately following the formation of the replication fork.

Version 1

11

stumerit@gmail.com

⊚ ⊚

true false

41) The Meselson-Stahl experiments used 35S radioisotopes to determine the mechanism of DNA replication. ⊚ ⊚

42)

The Meselson-Stahl experiments supported the model of dispersive DNA replication. ⊚ ⊚

43)

true false

true false

The origin of replication in bacteria is called oriC. ⊚ ⊚

true false

44) Replication usually begins in GC-rich regions due to the presence of only 2 hydrogen bonds between the bases. ⊚ true ⊚ false

45)

The movement of the replication fork in bacterial replication is unidirectional. ⊚ ⊚

Version 1

true false

12

stumerit@gmail.com

46) After the action of the helicase, single-stranded binding proteins keep the parental DNA strands from reforming a double helix. ⊚ true ⊚ false

47) The synthesis of the daughter strand of DNA occurs away from the replication fork in the leading strand. ⊚ ⊚

48)

true false

DNA polymerase III has an error in replication once every 100 million nucleotides. ⊚ ⊚

true false

49) The rate at which DNA polymerase III synthesizes a new strand of DNA is 300 nucleotides per minute. ⊚ true ⊚ false

50)

A primosome consists of a polymerase and a single-stranded binding protein. ⊚ ⊚

true false

51) The ability of the DNA polymerase to remove mismatched bases using exonuclease cleavage is called proofreading. ⊚ ⊚

Version 1

true false

13

stumerit@gmail.com

52) The problem of replicating the 3′ ends of chromosomes is solved by using the enzyme telomerase. ⊚ ⊚

true false

53) Recombination between sister chromatids produces new combinations of alleles that may be beneficial to the species. ⊚ true ⊚ false

54) A heteroduplex is a region within a DNA double helix that contains base mismatches that can lead to gene conversion. ⊚ ⊚

55)

true false

Homologous recombination that leads to genetic diversity occurs during meiosis II. ⊚ ⊚

Version 1

true false

14

stumerit@gmail.com

Answer Key Test name: Chapter 13 Test Bank 1) [A, B, D] 2) [A, B, C] 3) [A, B, C] 4) [A, B] 5) A 6) A 7) A 8) C 9) B 10) B 11) C 12) B 13) A 14) C 15) B 16) D 17) E 18) A 19) E 20) A 21) A 22) B 23) C 24) B 25) C 26) B Version 1

15

stumerit@gmail.com

27) B 28) B 29) B 30) B 31) A 32) A 33) C 34) A 35) A 36) A 37) D 38) C 39) B 40) FALSE 41) FALSE 42) FALSE 43) TRUE 44) FALSE 45) FALSE 46) TRUE 47) FALSE 48) TRUE 49) FALSE 50) FALSE 51) TRUE 52) TRUE 53) FALSE 54) TRUE 55) FALSE

Version 1

16

stumerit@gmail.com

Student name:_ 1)

In transcription, the closed complex consists of A) B) C) D)

2)

Select the eukaryotic regulatory elements.

A) B) C) D)

3)

enhancers silencers cis-acting elements Pribnow box

Select the components of the eukaryotic preinitiation complex.

A) B) C) D) E)

4)

RNA polymerase. transcription factors. double-stranded DNA. single-stranded DNA.

TFIID DNA TFIIB RNA polymerase II mediator

Select the stages of transcription.

A) B) C) D) E)

Version 1

initiation elongation termination translation replication

1

stumerit@gmail.com

5) You are studying transcription in two different unknown systems. Select the experimental questions you could test that would allow you to definitively determine if the system is eukaryotic or prokaryotic.

A) B) C) D) E)

Does transcription in the system require a promoter?

Does RNA capping occur?

Does RNA splicing occur, and if so is it self-splicing?

Does RNA tailing occur?

How many RNA polymerases are present?

6) What is the name of the site in eukaryotic DNA where general transcription factors associate?

A) B) C) D)

7)

promoter terminator silencer enhancer

Following transcription, the RNA has a complementary sequence to A) B) C) D)

regulatory sequences. termination sequences. the coding strand of DNA. the template strand of DNA.

8) Which of the following forms of RNA encodes the sequence of amino acids for a functional protein?

Version 1

2

stumerit@gmail.com

A) B) C) D) E)

9)

tRNA snRNA mRNA rRNA scRNA

In prokaryotes, a holoenzyme is formed when what is added to the core enzyme?

A) B) C) D) E)

Start codons b b' σ a

10) In eukaryotic organisms, a mutation in which of the following would result in a failure of the RNA polymerase to maintain an open complex?

A) B) C) D) E)

TFIIB TFIID TFIIE TFIIH TFIIF

11) In eukaryotic organisms, what protein allows RNA polymerase II to interact with transcription factors bound to enhancers or silencers?

A) B) C) D)

Version 1

mediator TFIIB TFIID sigma factors

3

stumerit@gmail.com

12) In eukaryotic organisms, a functional eukaryotic protein is typically made up of the information contained within what region of pre-mRNA? A) B) C) D)

13)

In eukaryotic organisms, what RNA modification is important for mRNA stability?

A) B) C) D) E)

14)

exons introns enhancers promoters

alternative splicing RNA editing base modification 3' polyA tailing processing

In eukaryotic organisms, what process is important for the initiation of translation?

A) B) C) D)

alternative splicing RNA editing 5' capping base modification

15) In eukaryotic organisms, the processing of the 45S rRNA into 5.8S, 18S, and 28S rRNA occurs where?

Version 1

4

stumerit@gmail.com

A) B) C) D) E)

16)

in the cytoplasm in the nucleolus in the endoplasmic reticulum in the Golgi body throughout the cell

RNA polymerase I in eukaryotes produces which type of RNA?

A) B) C) D)

snRNA tRNA 5S rRNA 18S rRNA

17) The consensus sequences in a prokaryotic promoter are 5'TTGACA3' and 5'TATAAT3' at -35 and -10, respectively. What sequence would be most easily recognized by σ factor?

A) B) C) D)

5'TTGAAA3' 5'TAAATT3' 5'TATATA3' 5'TTCAGA3'

18) Which subunit of the prokaryotic RNA polymerase carries out catalytic synthesis of RNA? A) B) C) D)

Version 1

alpha omega beta sigma

5

stumerit@gmail.com

19)

What region in eukaryotic genes contains the majority of regulatory elements?

A) 0 to 50 B) −50 to 0 C) −50 to −100 D) −100 to −150

20)

How many general transcription factors are needed for eukaryotic translation?

A) B) C) D)

21)

In eukaryotic organisms, what general transcription factor is a helicase?

A) B) C) D)

22)

3 4 5 6

TFIID TFIIH TFIIF TFIIB

Most eukaryotic genes are colinear.

A) True B) False C) It is unknown at this time.

Version 1

6

stumerit@gmail.com

23)

What enables the splicing of group I and II introns?

A) B) C) D)

24)

spliceosomes ribozymes snRNA poly-A tail

Both the rho-dependent and rho-independent mechanisms of termination

A) B) C) D)

end transcription immediately after the stop codon. involve a sequence rich with A-U base pairs. require a helicase to separate the DNA-RNA complex. involve the formation of a stem-loop structure.

25) What is the purpose of phosphorylating the carboxy terminal domain (CTD) of RNA Polymerase II? A) B) C) D)

26)

convert from the initiation to the elongation stage to aid in transcriptional initiation phosphorylate transcription factors allow transcription factors to bind the TATA box

In prokaryotic organisms, what structural motif is used by sigma factor to bind to DNA? A) B) C) D)

Version 1

zinc-finger helix-turn-helix leucine zipper homeodomain

7

stumerit@gmail.com

27)

In eukaryotic organisms, alternative splicing allows an organism to

.

A) produce several different proteins from a single gene.

B) produce only one protein from a gene.

C) produce nonfunctional variants of proteins from a gene

28) If a eukaryotic organism is missing the U5 snRNP, it will have trouble performing which step of splicing?

A) B) C) D)

29)

Binding of snRNPs to the 5' splice site Binding of snRNPs to the branch site Formation of the intron loop Exon degradation

Select the statement that is true regarding tRNA processing in E. coli.

A) B) C) D)

RNaseP acts as an endonuclease.

The recognition sequence of RNaseD is 3'CCA5'.

RNaseD acts as an endonuclease.

The action of RNaseP produces the correct 3' end of the mature tRNA.

30) In trying to distinguish between the two models of eukaryotic transcriptional termination, you identify a drug that specifically blocks exonuclease activity. When you add it at the appropriate time to an in vitro system that carries out all the stages of eukaryotic transcription, you find that transcription proceeds normally, but transcription doesn't terminate. This experiment provides support for which model of eukaryotic transcriptional termination?

A) B) C) D)

Version 1

Allosteric model Torpedo model Rho-dependent termination Rho-independent termination

8

stumerit@gmail.com

31)

Which modifications are typically found on eukaryotic mRNAs?

A) B) C) D)

Capping only Addition of poly A only Capping and poly-A addition Eukaryotic mRNAs are not modified before translation

32) A gene that undergoes rho-dependent termination has a mutation in the rut site. How will this influence transcriptional activity?

A) Transcription will terminate normally as Rho termination relies on the rut site to enhance termination; it is not essential for termination.

B) Transcription will stop immediately because RNA polymerase will sense there is a mutation.

C) Transcription will continue until another termination sequence is reached, either Rho-dependent or independent.

D) There will be no transcription initiation.

33) This pre-mRNA contains 8 exons and 7 introns. The splice sites surrounding exon 4 are not readily recognized by the splicesome. In addition, a splicing repressor prevents the recognition of the 3' splice site in exon 7. What exons will be present in the mature mRNA?

© McGraw-Hill Education

Version 1

9

stumerit@gmail.com

A) 1, 2, 3, 5, 6, 8 B) 1, 2, 3, 4, 5, 6, 7, 8 C) 1, 2, 3, 4, 5, 6, 8 D) 1, 2, 3, 5, 6, 7, 8 E) 1, 2, 3, 5, 6

34) You are working in a lab studying mRNAs from many different species. You need to distinguish between mRNAs in a mixed sample. You begin by having all of the mRNAs sequenced, including the mitochondrial mRNAs. You notice a high number of C to U conversions in the mitochondrial mRNAs from a certain portion of the sample. You conclude that this portion of the sample is from .

A) B) C) D) E)

mammals plants slime mold Drosophila Trypanosomes

35) A mutation occurs in one of the general transcription factors necessary for eukaryotic transcription. A pre-initiation complex forms, but the open complex does not form. Further, TFIIB, TFIIE, and TFIIH are not released from the DNA. The mutation is most likely in which general transcription factor?

A) B) C) D) E)

Version 1

TFIIB TFIID TFIIE TFIIF TFIIH

10

stumerit@gmail.com

36) You have an RNA molecule that contains introns. You wish to carry out an in vitro splicing reaction with this RNA and cellular extracts. You want to determine if splicing is occuring via self-splicing or through the spliceosome. What enzyme could you add to the reaction to make this determination?

A) B) C) D)

37)

A ribozyme is a catalytic protein that assists in the processing of tRNA. ⊚ ⊚

38)

Protease DNase RNase Lipase

true false

The unit of transcription at the molecular level is the gene. ⊚ ⊚

true false

39) The RNA polymerase forms a closed complex during the process of elongation during transcription. ⊚ ⊚

40)

true false

During translation, the mRNA is read in groups of nucleotides called quadrons. ⊚ ⊚

Version 1

true false

11

stumerit@gmail.com

41) The Pribnow box contains a CACAAC consensus sequence located in the −100 region of the promoter. ⊚ ⊚

42)

true false

Sigma factor belongs to a general group of proteins called the transcription factors. ⊚ ⊚

true false

43) The formation of an open complex usually forms in GC-rich regions of DNA due to the decreased number of hydrogen bonds. ⊚ true ⊚ false

44)

Basal transcription in eukaryotes involves the action of only the core promoter. ⊚ ⊚

true false

45) The process of RNA editing can alter the base sequence of the mRNA following transcription. ⊚ ⊚

46)

true false

The term ribozyme is given to catalytic RNA molecules.

Version 1

12

stumerit@gmail.com

⊚ ⊚

Version 1

true false

13

stumerit@gmail.com

Answer Key Test name: Chapter 14 Test Bank 1) [A, B, C] 2) [A, B, C] 3) [A, B, C, D] 4) [A, B, C] 5) [B, C, E] 6) A 7) D 8) C 9) D 10) C 11) A 12) A 13) D 14) C 15) B 16) D 17) A 18) C 19) C 20) C 21) B 22) B 23) B 24) D 25) A 26) B Version 1

14

stumerit@gmail.com

27) A 28) C 29) A 30) B 31) C 32) C 33) A 34) B 35) E 36) A 37) FALSE 38) TRUE 39) FALSE 40) FALSE 41) FALSE 42) TRUE 43) FALSE 44) TRUE 45) TRUE 46) TRUE

Version 1

15

stumerit@gmail.com

Student name: 1)

Which two things act together to terminate translation? (Choose two.)

A) Rho factor B) release factor C) Met codon D) filled P site E) stop codon F) nucleotide exchange factors

2) Based on our modern understanding, what revisions are necessary to the original onegene / one-enzyme hypothesis?

A) Alternative splicing allows one gene to encode multiple polypeptides.

B) Some genes encode RNAs, not enzymes.

C) Some genes encode lipids, not enzymes.

D) Some genes encode polypeptides that are not enzymes, such as structural proteins.

E) Proteins as functional units may be composed of several polypeptides, so genes may encode just one polypeptide within a larger protein.

F) Enzymes are not encoded by genes after all — they are constructed through separate biochemical processes.

3)

Which of the following are true regarding the experiments of Beadle and Tatum?

A) B) C) D)

They were able to create loss-of-function mutations in any enzyme they chose.

They used the mold Neurospora as a model organism.

They isolated strains that could not grow on minimal media.

They established the link between a gene and an enzyme or protein.

4) Mutations in the enzyme homogentisic acid oxidase are associated with alkaptonuria.

Select all characteristics of homogentisic acid oxidase.

Version 1

1

stumerit@gmail.com

A) Is encoded by a structural gene B) Assists other polypeptides with folding into the correct secondary structure C) Has primary, secondary, and tertiary structure D) Has an amino-terminal and a carboxyl-terminal end E) Has primary structure but not secondary structure F) Catalyzes a reaction in a metabolic pathway

5) Taking into account your knowledge of wobble rules, select all anticodons that can pair with the codon 5'-UAC-3'. (Check all that apply.)

A) 5'-AUG-3' B) 5'-IUA-3' C) 5'-AUA-3' D) 5'-GUA-3' E) 5'-GUI-3'

6)

Which of the following is NOT a stop codon?

Copyright © McGraw-Hill Education

Version 1

2

stumerit@gmail.com

A) B) C) D)

7)

UGA UUA UAG UAA

Francis Crick proposed the adaptor hypothesis, and later the adaptor was discovered to be .

A) siRNA B) amino acid C) tRNA D) mRNA E) micro RNA

8)

Which of the following codons is NOT degenerate to CUU?

Copyright © McGraw-Hill Education

Version 1

3

stumerit@gmail.com

A) CUC B) UUG C) CUA D) AUU E) UUA

9)

The primary structure of a protein refers to A) B) C) D)

10)

What level of protein structure is exemplified by α-helices and β-sheets?

A) B) C) D)

11)

regular repeating shapes, such as beta-sheets. the three-dimensional shape of the protein. the linear sequence of the amino acids. the interaction of two or more peptide chains.

primary structure secondary structure tertiary structure quaternary structure

Which molecule contains an anticodon?

A) DNA B) mRNA C) rRNA D) tRNA E) snRNA

Version 1

4

stumerit@gmail.com

12) What is the least number of tRNAs that can be used to recognize all of the codons of isoleucine, and what is/are the anticodon(s)? (In the answer choices, I = inosine.)

Copyright © McGraw-Hill Education A) B) C) D)

13)

one—5′IAU3′ one—5′UAU3′ two—5′GAU3′ and 5′UAU3′ two—5′AUA3′ and 5′UAI3′

What does eIF5 act to recruit during the initiation stage?

Version 1

5

stumerit@gmail.com

A) the mRNA B) the polypeptide C) the large ribosomal subunit D) termination GTPases E) the 7-methylguanosine cap

14)

A tRNA that has an amino acid attached is called

.

A) rRNA B) degenerate tRNA C) coding tRNA D) charged tRNA E) None of the answers are correct.

15) Kozak's rules for translation are similar to those for transcription in prokaryotes in that they both contain consensus sequences. In prokaryotes, the promoter consensus sequences are at −35 and −10. Where is the consensus sequence for translational initiation according to Kozak's rules?

A) −6 to +4 B) −12 to −2 C) +1 to +10 D) −35 to −10

16)

Which of the following would be considered an activated amino acid?

A) B) C) D)

Version 1

Amino acid · ATP · aminoacyl-tRNA synthetase Amino acid · aminoacyl-tRNA synthetase Amino acid · AMP · PPi Amino acid · AMP

6

stumerit@gmail.com

17)

What site on the ribosome is primarily responsible for holding the growing polypeptide?

A) A B) E C) P

18)

What site does the initiator tRNA bind to on the ribosome?

A) A B) E C) P

19)

What is responsible for binding the initiator tRNA in prokaryotes and eukaryotes?

A) B) C) D)

IF2 / eIF2 EF-Tu / eEF1α RF3 / eRF3 EF-G / eEF2

20) If translation begins at the first start codon and ends at the first in frame stop codon, how many amino acids are encoded by the following mRNA? 5′GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGA3′ A) B) C) D)

Version 1

8 9 10 11

7

stumerit@gmail.com

21)

Where are the ribosomal subunits assembled?

A) B) C) D)

22)

nucleus nucleoid nucleolus nuclear envelope

A tRNA's anticodon is 5′GGC3′. What amino acid is attached to it?

Copyright © McGraw-Hill Education A) B) C) D)

glycine proline alanine arginine

23) Which component of the ribosome is part of the peptidyl transferase in the 50S subunit and acts as a ribozyme to catalyze peptide bond formation?

Version 1

8

stumerit@gmail.com

A) 16S rRNA B) P site C) Shine-Dalgarno sequence D) snRNA E) aminoacyl-tRNA synthetase F) 23S rRNA

24) Which component of the ribosome is able to detect when the wrong tRNA has inserted into the A site?

A) 16S rRNA B) P site C) Shine-Dalgarno sequence D) snRNA E) aminoacyl-tRNA synthetase F) 23S rRNA

25)

The peptidyltransferase complex is a component of which of the following?

A) DNA B) tRNA C) The ribosome D) The growing polypeptide E) mRNA

26)

The C-terminus of a polypeptide always contains

Version 1

9

stumerit@gmail.com

A) a stop codon.

B) a carboxyl group.

C) an amino group.

D) carbon dioxide.

E) a stop amino acid.

F) Methionine.

27)

RF1 and RF2 are active during

A) B) C) D)

.

initiation elongation termination cotranslational import

28) In bacteria, the sequence that facilitates the binding of the mRNA to the ribosome is called the A) B) C) D)

Kozak sequence.

Shine-Dalgarno sequence. start sequence. rRNA sequence.

29) The scientist(s) studied patients who had defects in their ability to metabolize certain compounds, particularly the inherited disease alkaptonuria. He/They proposed that a relationship exists between the inheritance of the trait and the inheritance of a defective enzyme.

Version 1

10

stumerit@gmail.com

A) Garrod B) Nirenberg and Matthaei C) Khorana and colleagues D) Nirenberg and Leder E) Beadle and Tatum

30) The scientist(s) studied Neurospora mutants that were altered in their nutritional requirements and hypothesized that one gene encodes one enzyme.

A) Garrod B) Nirenberg and Matthaei C) Khorana and colleagues D) Nirenberg and Leder E) Beadle and Tatum

31) The scientist(s) created a cell-free translation system. An mRNA template was added to a number of tubes, each containing amino acids with a different one radiolabeled.

Radiation was measured from the precipitated protein, and this corresponded to the mRNA template that had been added. This was the first experiment that demonstrated the ability to synthesize polypeptides from synthetic mRNA, and revealed a relationship between the two.

A) Garrod B) Nirenberg and Matthaei C) Khorana and colleagues D) Nirenberg and Leder E) Beadle and Tatum

32) The scientist(s) developed a novel method to synthesize RNA. Short RNAs of 2 to 4 nucleotides were linked together to create a copolymer. The resulting peptide created after translation revealed the 3-letter code for the amino acids.

Version 1

11

stumerit@gmail.com

A) Garrod B) Nirenberg and Matthaei C) Khorana and colleagues D) Nirenberg and Leder E) Beadle and Tatum

33) The scientist(s) developed the triplet-binding assay. Samples containing ribosomes and a particular RNA triplet were exposed to charged tRNAs with different radiolabeled amino acids. Only the amino acid whose tRNA matched the triplet would bind the ribosome. The triplet-binding assay established relationships between particular triplet sequences and specific amino acids.

A) Garrod B) Nirenberg and Matthaei C) Khorana and colleagues D) Nirenberg and Leder E) Beadle and Tatum

Version 1

12

stumerit@gmail.com

34) You are studying the DNA of a person who you know has two defective copies of the gene that encodes phenylalanine hydroxylase. You are surprised to find that this person also carries two defective copies of the gene for homogentisic acid oxidase. What disease symptoms will this person exhibit? (Assume pathway intermediates are not available from sources outside the phenylalanine breakdown pathway.)

Version 1

13

stumerit@gmail.com

Version 1

14

stumerit@gmail.com

A) This person will exhibit symptoms of alkaptonuria.

B) This person will exhibit symptoms of tyrosinosis.

C) This person will exhibit symptoms of phenylketonuria.

D) This person will exhibit symptoms of alkaptonuria and phenylketonuria.

E) This person will be phenotypically normal.

35)

Copyright © McGraw-Hill Education You perform a cell-free translation experiment like Nirenberg and Matthaei. You start with 60% C and 40% A. What relative amount of radiolabeled proline do you expect in the translated polypeptides?

A) 36% B) 22% C) 14% D) 28%

Version 1

15

stumerit@gmail.com

36) What is the minimal number of tRNAs that can be used to recognize all of the codons for threonine?

Copyright © McGraw-Hill Education A) B) C) D)

Version 1

1 2 3 4

16

stumerit@gmail.com

37) Suppose you performed a triplet binding assay with the triplet 5′-UAA-3′. Among those listed below, whatradiolabeled amino acids do you expect to find bound to the filter?

Copyright © McGraw-Hill Education A) B) C) D)

38) than

Tyrosine Glycine Methionine None

A protein called actin consists of 376 amino acids. The mRNA for actin must be longer

A) B) C) D)

Version 1

125 nucleotides.

376 nucleotides.

1128 nucleotides.

3384 nucleotides.

17

stumerit@gmail.com

39) You perform a cell free translation experiment like Nirenberg and Matthaei, but you forget to write down what nucleotides you added to make the mRNA. You precipitate the translated polypeptides and measure the relative amount of radiolabeled amino acids incorporated into them. You get 25% proline, 25% threonine, 12.5% glutamine, 12.5% lysine, 12.5% asparagine, and 12.5% histidine. What nucleotides and in what % did you add to make the mRNA? A) Equal amounts of A, C, U, and G B) 50% C and 50% A C) 70% C and 30% A D) 50% C and 50% U E) 50% A and 50% G

40) The genetic code — the correspondence between codons and amino acids — is unique for each species of organism. ⊚ true ⊚ false

41)

All mature polypeptides contain a methionine at the N-terminus. ⊚ ⊚

42)

true false

61 different tRNAs are required for translation in vivo. ⊚ true ⊚ false

43) The first person to suggest that a connection exists between the function of a gene and the production of an enzyme was Archibald Garrod. ⊚ ⊚

Version 1

true false

18

stumerit@gmail.com

44)

The one-gene, one-enzyme hypothesis was first proposed by Beadle and Tatum. ⊚ ⊚

45)

true false

The wobble base is the second base of a codon. ⊚ true ⊚ false

46) Proteins that are composed of two or more polypeptides are said to have quaternary structure. ⊚ true ⊚ false

47)

The anticodon on the mRNA recognizes the codon on the tRNA. ⊚ ⊚

48)

true false

The enzyme that attaches free amino acids to the tRNA molecule is called tRNA attaches. ⊚ ⊚

true false

49) During elongation, the polypeptide is removed from the tRNA in the P site and transferred to the amino acid in the A site.

Version 1

19

stumerit@gmail.com

⊚ ⊚

50)

true false

Transcription and translation may occur simultaneously in prokaryotic cells. ⊚ ⊚

Version 1

true false

20

stumerit@gmail.com

Answer Key Test name: Chapter 15 Test Bank 1) [B, E] 2) [A, B, D, E] 3) [B, C, D] 4) [A, C, D, F] 5) [B, C, D] 6) B 7) C 8) D 9) C 10) B 11) D 12) A 13) C 14) D 15) A 16) D 17) C 18) C 19) A 20) A 21) C 22) C 23) F 24) A 25) C 26) B Version 1

21

stumerit@gmail.com

27) C 28) B 29) A 30) E 31) B 32) C 33) D 34) C 35) A 36) B 37) D 38) C 39) B 40) FALSE 41) FALSE 42) FALSE 43) TRUE 44) TRUE 45) FALSE 46) TRUE 47) FALSE 48) FALSE 49) TRUE 50) TRUE

Version 1

22

stumerit@gmail.com

Student name:_ 1) A gene is inducible and under negative control. Which of the following pairs will allow expression of this gene?

A) B) C) D)

2)

Regulation of gene expression may occur at which of the following levels?

A) B) C) D)

3)

transcription translation posttranslation All of the answers are correct.

How many promoters are in an operon?

A) B) C) D)

4)

activator + repressor activator + inhibitor repressor + inducer repressor + corepressor

1 2 3 It depends on how many genes there are in the operon.

Which of the following is found in an operon?

Version 1

1

stumerit@gmail.com

A) B) C) D) E)

5)

promoter terminator two or more genes operator All of the answers are correct.

Allosteric regulation is accomplished by A) B) C) D)

a small molecule that fits into an enzyme's active site. a large protein that blocks an enzyme's active site. a small molecule that fits into a site on the enzyme that is not the active site. a small molecule that covalently modifies a site on the enzyme that is not the active

site.

6)

What is the gene responsible for attenuation in the trp operon?

A) B) C) D)

7)

trpL trpR trpD trpC

What stem-loop conformations favor attenuation in the trp operon?

A) 1-2 B) 1-2 and 2-3 C) 2-3 D) 3-4

Version 1

2

stumerit@gmail.com

8) If CAP could not bind to its CAP site, then what would be the result? Assume lactose is present in each scenario.

A) B) C) D)

Transcription would be difficult to repress in the presence of glucose.

Transcription would be difficult to activate in the presence of glucose.

Transcription would be difficult to activate in the absence of glucose.

Transcription would be difficult to repress in the absence of glucose.

9) In Jacob, Monod, and Pardee's experiment, how many functional copies of lacI were there in the merozygote?

A) B) C) D)

0 1 2 3

10) In the Jacob Monod merozygote experiment, what was indicated by the presence of a yellow color when b-ONPG was added?

A) B) C) D)

11)

Expression of the lac operon is constitutive whether lacI is functional or not.

Beta-galactosidase was present.

The lac operon was completely turned off.

The researcher added too much b-ONPG.

CAP affects which operon(s)?

A) B) C) D)

Version 1

the lac operon the trp operon both the lac and the trp operon neither the lac nor the trp operon

3

stumerit@gmail.com

12) What would be the result if the U-rich sequence after the fourth stem loop in the trp operon was replaced by a UG-rich sequence?

A) B) C) D)

13)

Which of the following is not an example of translational regulation in prokaryotes?

A) B) C) D)

14)

Attenuation would occur if tryptophan was high.

Attenuation would occur if tryptophan is low.

Attenuation would not occur if tryptophan was high.

None of the answers are correct.

Sterically blocking the ribosome Phosphorylation of an enzyme Binding of antisense RNA to mRNA Altering the structure of the mRNA

Enzymes involved in metabolism are most likely regulated via A) B) C) D)

.

feedback inhibition acetylation methylation None of the answers are correct.

15) If a bacterium is placed in an environment that contains both glucose and lactose, the regulation of the lac operon will allow which nutrient to be processed first?

Version 1

4

stumerit@gmail.com

A) B) C) D)

16)

The regulation of protein function, not gene expression is called

A) B) C) D)

17)

regulation.

posttranslational transcriptional translational posttranscriptional

Translational regulatory proteins recognize specific areas of what molecule?

A) B) C) D) E)

18)

glucose lactose Both will be processed equally.

Neither will be processed in this environment.

tRNA Ribosome rRNA mRNA None of the answers are correct.

Antisense RNA does which of the following?

A) B) C) D)

Version 1

inhibits the formation of the open complex in transcription occupies the A and P sites of the ribosome binds to a complementary RNA and prevents its translation prevents the correct folding of a newly formed peptide

5

stumerit@gmail.com

19)

Riboswitches have been shown to affectregulation of A) B) C) D)

.

transcription and translation only transcription onlytranslation only RNA splicing

20) A deletion in an operon removes the terminator. How will that affect the transcript that is produced from the operon?

A) B) C) D) E)

The transcript will be produced and normal in length The transcript will be produced, but shorter than normal The transcript will be produced, but longer than normal The transcript will be produced, but will contain a deletion The transcript will not be produced

21) A deletion in an operon removes the promoter. How will that affect the transcript that is produced from the operon?

A) B) C) D) E)

The transcript will be produced and normal in length The transcript will be produced, but shorter than normal The transcript will be produced, but longer than normal The transcript will produced, but will contain a deletion The transcript will not be produced

22) In Jacob, Monod, and Pardee's experiment, what would have been the conclusion if all four tubes produced a yellow color when β-ONPG was added?

A) B) C) D)

Version 1

Expression of the lac operon is constitutive whether lacI is functional or not LacI provides the binding site for the repressor LacI encodes a diffusible repressor The researcher added too much β-ONPG

6

stumerit@gmail.com

23) A mutation in the lacI gene prevents the gene product from binding allolactose. What will the expression level of the operon be in the absence of lactose?

A) B) C) D)

No transcription Positive regulation Constitutively active Transcription will occur only in the presence of glucose

24) In a particular E. coli strain, a mutation in the thiMD operon results in improper formation of the stem loop secondary structure making it impossible to bind TPP. There are two enzymes encoded by the thiMD operon. How many of the enzymes encoded in the thiMD operon are translated?

A) B) C) D)

Two Zero Three One

25) If the Trp codons in the trpL gene were mutated to encode another amino acid, what would the result be?

A) B) C) D)

The trp operon would never be transcribed.

The trp operon would always be transcribed.

The trp operon would only be transcribed when tryptophan in the cell was low.

The trp operon would only be transcribed when tryptophan in the cell was high.

26) A riboswitch is an RNA molecule that can exist in two different conformations.

Conversion from one to another is due to the binding of a small molecule to the riboswitch. ⊚ true ⊚ false Version 1

7

stumerit@gmail.com

27)

In the lac operon, the operator is an example of a trans-effect genetic regulation. ⊚ true ⊚ false

28)

Constitutive genes are those that have constant levels of expression. ⊚ ⊚

29)

Negative transcriptional regulation is conducted by activator proteins. ⊚ ⊚

30)

true false

true false

Repressor proteins are responsible for negative transcriptional regulation. ⊚ ⊚

true false

31) The term enzyme adaptationis used to describe an enzyme that appears in a living cell following exposure to a specific substrate. ⊚ ⊚

32)

true false

In the lac operon, the operator site is recognized by an activator protein. ⊚ true ⊚ false

Version 1

8

stumerit@gmail.com

33)

cAMP is a small effector molecule. ⊚ true ⊚ false

34) The form of regulation that involves a physical change in the shape of an enzyme is called allosteric regulation. ⊚ ⊚

true false

35)

In the trp operon, tryptophan is a corepressor. ⊚ true ⊚ false

36)

In the E. coli riboswitch, mRNA gets translated when TPP is low. ⊚ true ⊚ false

37)

Because it stabilizes mRNA,antisense RNA enhances translation. ⊚ true ⊚ false

Version 1

9

stumerit@gmail.com

Answer Key Test name: Chapter 16 Test Bank 1) C 2) D 3) A 4) E 5) C 6) A 7) D 8) C 9) B 10) B 11) A 12) C 13) B 14) A 15) A 16) A 17) D 18) C 19) A 20) C 21) E 22) A 23) A 24) A 25) A 26) TRUE Version 1

10

stumerit@gmail.com

27) FALSE 28) TRUE 29) FALSE 30) TRUE 31) TRUE 32) FALSE 33) TRUE 34) TRUE 35) TRUE 36) TRUE 37) FALSE

Version 1

11

stumerit@gmail.com

Student name:_ 1) Feeding a specific diet to female mice may result in an increased proportion of pseudoagouti offspring if

A) the diet is low in folic acid and vitamin B 12.

B) the offspring carry the Avy allele.

C) the transposon at the Avy locus in the progeny is hypermethylated.

2)

Select all examples that are associated with expression of a single allele of a gene.

A) B) C) D)

3)

X-chromosome inactivation in female mammals Genomic imprinting Epigenetic modifications during cell differentiation Development of queen bees determined by exposure to royal jelly

How might heterochromatin silence the expression of genes? (Check all that apply.)

A) B) C) D)

Limiting the access of activators to the DNA Limiting the access of general transcription factors to the DNA Limiting the access of coactivators to the DNA Limiting the access of repressors to the DNA

4) Select the statements that are true about constitutive and facultative heterochromatin.

Check all that apply.

Version 1

1

stumerit@gmail.com

A) The formation of facultative heterochromatin is reversible, whereas constitutive heterochromatin is stable.

B) Facultative heterochromatin typically activates genes, whereas constitutive heterochromatin silences genes.

C) Facultative heterochromatin may be found at many discrete sites between the centromere and telomere, whereas constitutive heterochromatin is usually located near the centromere and at the telomeres.

D) Both constitutive and facultative heterochromatin contain repeat sequences.

5)

Where is the IRE located in the regulation of ferritin translation?

A) B) C) D)

5′ end of DNA 5′ end of mRNA 3′ end of DNA 3′ end of mRNA

6) What effect will a mutation in IRPthat prevents it from binding to iron have on an individual?

A) B) C) D)

Ferritin will not be made, so iron intake must be maximized.

There will be excess ferritin, so iron intake must be lowered.

Transferrin will not be made, so iron intake must be maximized.

There will be excess transferrin, so iron intake must be lowered.

7) What general transcription factor is most often affected by regulatory transcription factors?

Version 1

2

stumerit@gmail.com

A) B) C) D)

TFIIB TFIID TFIIE TFIIF

8) Regulatory transcription factors may influence gene expression in which of the following ways?

A) recruiting proteins to the promoter that enhance chromatin compaction B) by directly interacting with TFIII to inhibit its binding to the core promoter C) influencing the ability of the RNA polymerase to perform elongation D) directly recruiting RNA polymerase to the promoter without interacting with any other proteins

9)

Regulatory transcription factors may be regulated by A) B) C) D)

10)

phosphorylation. binding of carbohydrates. lipid modifications. sulfation.

Which of the following is incorrect regarding the glucocorticoid hormones?

A) B) C) D)

Version 1

They interact with receptors located in the plasma membrane of the cell.

After interacting with the receptor, they release HSP90.

The receptors form a homodimer that travels to the nucleus.

The homodimer interacts with GRE, activating transcription.

3

stumerit@gmail.com

11)

Acetylation of histones results in A) B) C) D)

12)

CpG islands are associated with which of the following?

A) B) C) D)

13)

nucleosome location DNA methylation steroid hormone activity termination of translation

Genomic imprinting is a result of A) B) C) D)

14)

formation of an open chromatin structure. removal of histones from the histone octamer. formation of a closed chromatin structure. termination of transcription.

nucleosome location. histone activation.

DNA methylation. serine to leucine changes in the genetic code.

What is a major difference between the general and regulatory transcription factors?

A) General transcription factors only regulate the housekeeping genes while regulatory transcription factors control all of the other genes.

B) General transcription factors are essential for any transcription for all genes while regulatory transcription factors regulate transcription of specific genes.

C) General transcription factors act as heterodimers while regulatory transcription factors act as monomers.

D) General transcription factors regulate basal genes while regulatory transcription factors control all of the other genes.

Version 1

4

stumerit@gmail.com

15)

Combinatorial factors include activators and repressors as well as

A) small effector molecules, proteins that alter the composition of nucleosomes, and DNA methylation.

B) small effector molecules, proteins that alter the composition of nucleosomes, DNA methylation, and basal transcription factors.

C) small effector molecules, proteins that alter the composition of nucleosomes, but not DNA methylation.

D) proteins that alter the composition of nucleosomes and DNA methylation, but not small effector molecules.

16)

Chromatin remodeling complexes alter nucleosomes, this occurs when

A) remodeling proteins bind to TFIID to promote or inhibit nucleosome formation.

B) complexes of ATP-dependent protein degrade histones and release the DNA from nucleosomes.

C) complexes of ATP-dependent proteins may reposition, evict, or change nucleosome composition.

D) remodeling proteins increase the supercoiling of the DNA, which can inhibit nucleosome formation.

17)

What are histone variants?

A) histone proteins that have slightly different amino acid sequences and have specialized functions B) histone proteins that have slightly different amino acid sequences but are found in nucleosomes throughout the chromosomes C) histone proteins that have been modified by acetylation D) histone proteins that have been modified by acetylation and phosphorylation

18)

What are some of the steps in eukaryotic transcriptional control?

Version 1

5

stumerit@gmail.com

A) A transcriptional repressor recruits nucleosome remodeling proteins that alter nucleosome positioning, modification, and composition. This allows for the formation of a closed chromatin complex, and binding of general transcription factors and RNA polymerase II. Histone cores remain on the gene as transcript elongation occurs.

B) A transcriptional repressor recruits general transcription factors and RNA polymerase II without affecting nucleosome positioning.

C) A transcriptional activator recruits nucleosome remodeling proteins that alter nucleosome positioning, modification and composition. This allows for the formation of an open chromatin complex, and binding of general transcription factors and RNA polymerase II. Finally, as transcription elongation occurs, histone cores are evicted from the DNA to allow the RNA polymerase to transcribe the gene.

D) A transcriptional activator recruits general transcription factors and RNA polymerase II. Finally, as transcription elongation occurs, histone cores remain with the DNA.

19)

One definition of epigenetics would be

A) the study of irreversible changes in DNA sequence.

B) the study of reversible mechanisms that lead to changes in gene expression that involve changes in DNA sequence.

C) the study of irreversible mechanisms that lead to changes in gene expression that do not involve changes in DNA sequence.

D) the study of reversible mechanisms that lead to changes in gene expression that do not involve changes in DNA sequence.

20)

What are some types of the molecular changes that underlie epigenetic gene regulation?

A) B) C) D)

21)

depurination of cytosine and thymidine residues DNA methylation and chromatin remodeling DNA methylation and depurination of cytosine residues depurination and chromatin remodeling.

One difference between developmental and environmental epigenetic changes is that

Version 1

6

stumerit@gmail.com

A) environmental epigenetic control is the result of developmental processes interacting with the environment.

B) developmental epigenetic control is a normal process that occurs in all offspring.

C) environmental epigenetic control is a normal process that occurs in all offspring.

D) the differences between the two lie in the mechanisms that each uses.

22)

What gene(s) is/are encoded in the Xic?

A) B) C) D)

23)

What genes appear to be controlled by the Xic?

A) B) C) D)

24)

Xce Xist Tsix Both the Tsix and Xist are genes are in the Xic region

Xist and Tsix Xist TsiX Xic

Expression of

A) B) C) D) E)

Version 1

would inhibit X-chromosome inactivation.

Xic Xist Tsix All of the answers are correct.

None of the answers are correct.

7

stumerit@gmail.com

25)

What gene is most responsible for X-chromosome inactivation?

A) B) C) D)

Xic Xist Tsix Xce

26) In imprinting of the Igf2 gene in mice, are the ICR and DMR methylatedon the maternal or paternal chromosome? Which chromosome expresses Igf2?

A) B) C) D)

27)

What is the molecular mechanism for imprinting a gene?

A) B) C) D)

28)

Paternal, paternal Paternal, maternal Maternal, paternal Maternal, maternal

Acetylation Nitration Phosphorylation Methylation

Most genes imprinted by methylation are silenced. What is one exception to this rule?

Version 1

8

stumerit@gmail.com

A) B) C) D)

29)

Epigenetic inheritance may occur at which of the following stages?

A) B) C) D)

30)

Oogenesis Spermatogenesis Embryogenesis All of the answers are correct.

The differentially methylated region (DMR) is associated with which of the following?

A) B) C) D) E)

31)

H19 Igf2 Xist Agouti

X-chromosome inactivation Genomic imprinting Polycomb group (PcG) proteins mRNA stability All of the answers are correct.

Which of the following is an example of epigenetic inheritance?

A) B) C) D)

Expression of the Igf2 gene based on methylation of the ICR and DMR regions Inheritance of flower color as studied by Mendel Control of mRNA stability by an RNA-binding protein Activation of transcription by a general transcription factor

Version 1

9

stumerit@gmail.com

32)

Which of the following are molecular mechanisms used in epigenetic gene regulation?

A) B) C) D)

33)

DNA methylation Covalent histone modification Chromatin remodeling All of the answers are correct.

Which of the following statements are correct?

A) Changes in gene expression based on environmental conditions are not considered normal while developmental changes are.

B) Environmental epigenetic changes can vary due to the exposure of the organism to different environmental conditions, while those programmed during development are the result of stimuli generated by the organism itself.

C) Environmental epigenetic gene regulation only occurs in reptiles and insects, while developmental epigenetic regulation occurs in all animals.

D) Environmental epigenetic gene regulation is typically reversible while developmental epigenetic gene regulation is typically not reversible.

34)

Which of the following is part of the process of X-chromosome inactivation?

A) Expression of Xist from both chromosomes at the start of the process B) Binding of multiple Xist transcripts to Xic on the X chromosome that will be inactivated C) Compaction of the active X chromosome into a Barr body D) Binding of Tsix transcripts to the X chromosome to be inactivated after the Xist transcripts binds to Xic

35) What is the difference between the trithorax (TrxG) and polycomb (PcG) complexes of proteins?

Version 1

10

stumerit@gmail.com

A) TrxG proteins methylate lysine 27 on histone H3 while PcG complexes methylate lysine 4 on H3 B) Methylation of lysine at position 4 on H3 results in silencing of gene expression C) TrxG complex proteins activate gene expression by methylating lysine 4 on H3, while PcG complex proteins repress gene expression by methylating lysine 27 on H3.

D) Methylation of H3 on lysine 27 can result in activation of transcription

36) In cancer cells, one allele of a tumor suppressor gene called p53 is frequently mutated so that the protein is inactive, not produced, or deleted. The other allele usually has a normal sequence and the promoter remains intact, but the gene is not expressed. Sequencing with sodium bisulfite modification of DNA can be used to detect which cytosines are methylated. If cancer cell DNA is sequenced, which of the following results would be expected?

A) Cytosines in or near the promoter region will be methylated B) Cytosines in or near the promoter will not be methylated C) Cytosines in the coding region will have an increased methylation D) There will be no differences in the methylation pattern of the promoter of p53 from a cancer cell and a normal cell

37) Gene methylation can be detected through the use of restriction endonucleases. Usually these are used in pairs where one enzyme will digest only unmethylated DNA in its recognition sequence while the other is insensitive to methylation. Which of the following statements is correct?

A) The enzyme that is insensitive to methylation serves as a control to make sure the inability of the other enzyme to digest DNA is not due to a mutation.

B) These are used in pairs because experiments have to be replicated and this one way of performing a replication of the experiment.

C) The experimental design is flawed because there should be a third enzyme that would serve as a positive control D) This experimental design is able to identify the number ofmethylated C residues in a particular region of DNA.

Version 1

11

stumerit@gmail.com

38) A common way of studying methylation in cells is to sequence DNA samples before and after modification with sodium bisulfite. The sodium bisulfite deaminates Cytosine residues, generating Uracil residues, therefore resulting in a change in the sequence as compared to the nonmodified DNA. Sodium bisulfite does not react with 5-methylcytosine so there will be no change in the sequence of those modified bases. When tumors are sequenced to study methylation patterns and epigenetic control, what would be the best control for sequencing using this technique?

A) Noncancerous tissue DNA from a different individual but from the same organ B) Liver DNA from the same individual that the cancer sample is from C) DNA from noncancerous tissue from the same individual in the same organ as the cancer D) A combination of DNA from liver, brain and muscle from the same individual that has the cancer

39) A queen bee is larger than the female worker bees in a hive. The queen develops functional ovaries that allow her to produce up to 2000 eggs a day. What determines which bees become queen bees?

A) B) C) D)

A single dominant allele of the Queen gene The larvae raised on a diet of royal jelly The larvae raised on a diet of pollen and nectar The egg that hatches first

40) Regions of chromatin that are more compact are called found in the nucleus.

A) B) C) D)

Version 1

; they are usually

heterochromatin; at the periphery euchromatin; centrally heterochromatin; centrally euchromatin; at the periphery

12

stumerit@gmail.com

41) Following mitosis, the two daughter cells usually have pattern of facultative heterochromatin and pattern of constitutive heterochromatin as was present in the mother cell.

A) B) C) D)

the same; the same the same; a different a different; the same a different; a different

42) Imagine all the histone H3 molecules in the cell have a mutation that changes their lysine-9 residue to an alanine. Assuming this cell could still live, what would be the result?

A) B) C) D)

The ability of the cell to form heterochromatin would be hindered.

The ability of the cell to form euchromatin would be hindered.

There would little effect because lysine and alanine are similar amino acids.

The ability of the cell to imprint genes would be hindered.

43) Which DNA sequence would also work in place ofthe following bi-directional enhancer?

5' GTTC 3' 3' CAAG 5' A) B) C) D)

5' GAAC 3'3' CTTG 5' 5' CTTG 3'3' GAAC 5' 5' CAAG 3'3' GTTC 5' 5' CTTC 3'3' GAAG 5'

44) What would be the result of a mutation in HSP90that prevented its binding to the glucocorticoid receptor?

Version 1

13

stumerit@gmail.com

A) B) C) D)

Glucocorticoid receptor could not form a dimer.

The nuclear localization signal would no longer function.

Expression of the regulated genes would become constitutive.

The hormone would not be able to bind to the glucocorticoid receptor.

45) A particular cell contains all of the standard histones but lacks several histone variants.

Which of the following MAY be true of this cell?

A) B) C) D) E)

The cell will be completely unable to remodel its chromatin.

The cell will have an enhanced ability to chemically modify its histones.

The cell will be unable to express any of its genes at all.

The cell will express different sets of genes than other cells in the same organism.

The cell will not be able to divide.

46) A particular gene has a mutation in its NFR that causes it to bind abnormally tightly to histones. What effect would you expect this mutation has on the expression of this gene?

A) The expression of the gene would be abnormally high.

B) The effect on gene expression is impossible to predict.

C) The gene would encode a different protein instead.

D) The expression of the gene would be abnormally low or absent.

E) The promoter of the gene will be constantly available to transcription factors and RNA polymerase.

47) The Avyallele of the Agoutigene involves the insertion of a transposable element upstream from the normal Agoutipromoter. The transposable element carries a promoter that causes the overexpression of the Agoutigene. Mice carrying this allele tend to have coat colors that are more yellow than mice that don’t have this transposable element. If pregnant female mice are fed a diet that contains chemicals that inhibit DNA methylation, how would you expect that this diet would affect the coat color of offspring carrying the A vyallele?

Version 1

14

stumerit@gmail.com

A) Their fur would be more yellow because theAgoutigene would tend to be over expressed.

B) Their fur would be more yellow because the Agoutigene would tend to be under expressed.

C) Their fur would be less yellow (darker brown) because theAgoutigene would tend to be over expressed.

D) Their fur would be less yellow (darker brown) because theAgoutigene would tend to be under expressed.

48) The Avyallele of the Agoutigene involves the insertion of a transposable element upstream from the normal Agoutipromoter. The transposable element carries a promoter that causes the overexpression of the Agoutigene. Mice carrying this allele tend to have coat colors that are more yellow than mice that don’t have this transposable element. If pregnant female mice are fed a diet that contains chemicals that increase DNA methylation, how would you expect that this diet would affect the coat color of offspring carrying the A vyallele?

A) Their fur would be less yellow (darker brown) because theAgoutigene would tend to be under expressed.

B) Their fur would be more yellow because the Agoutigene would tend to be over expressed.

C) Their fur would be more yellow because the Agoutigene would tend to be under expressed.

D) Their fur would be less yellow (darker brown) because theAgoutigene would tend to be over expressed.

49) In humans, a recent study has shown that maternal anxiety during pregnancy can diminish the methylation of the ICR located between the H19 and Igf2 genes of the embryo and fetus. How would this affect the expression of the maternal and paternal alleles of the Igf2 gene after the baby is born?

Version 1

15

stumerit@gmail.com

A) It would not affect the expression of the paternal allele, but the maternal allele would be overexpressed.

B) It would not affect the expression of the maternal allele, but the paternal allele would be overexpressed.

C) It would not affect the expression of the paternal allele, but the maternal allele would be inhibited.

D) It would not affect the expression of the maternal allele, but the paternal allele would be inhibited.

50) Activator proteins bind to silencer sequences and repressor proteins bind to enhancer sequences. ⊚ ⊚

true false

51) A repressor protein would enhance the ability of TFIID to bind to the TATA box of the promoter. ⊚ ⊚

true false

52) Steroid hormones are an example of an effectorwhich regulates regulatory transcription factor activity. ⊚ ⊚

true false

53) DNA that contains actively transcribed genes would most likely contain chromatin in the closed configuration. ⊚ ⊚ Version 1

true false 16

stumerit@gmail.com

54) Nucleosome location may be changed by a process called ATP-dependent chromatin remodeling. ⊚ ⊚

55)

true false

DNA methylation usually activates gene expression. ⊚ ⊚

true false

56)

The CpG islands upstream of housekeeping genes are unmethylated. ⊚ true ⊚ false

57)

Both parents usually imprint the same gene. ⊚ ⊚

58)

true false

Data suggests that the royal jelly fed to bee larvae causes inhibition of DNA methylation. ⊚ ⊚

true false

59) Vernalizationin Arabidopsis involves epigenetic changes ascold temperatures induce histone modifications that influence expression of genesfor germination or flowering in the spring when temperatures increase.

Version 1

17

stumerit@gmail.com

⊚ ⊚

60)

Covalent histone modification is sometimes involved in cell differentiation. ⊚ ⊚

61)

true false

true false

Expression of a gene can be impaired if its promoter ishypermethylated. ⊚ ⊚

Version 1

true false

18

stumerit@gmail.com

Answer Key Test name: Chapter 17 Test Bank 1) [B, C] 2) [A, B] 3) [A, B, C] 4) [A, C, D] 5) B 6) D 7) B 8) A 9) A 10) A 11) A 12) B 13) C 14) B 15) A 16) C 17) A 18) C 19) D 20) B 21) B 22) D 23) A 24) C 25) B 26) A Version 1

19

stumerit@gmail.com

27) D 28) B 29) D 30) B 31) A 32) D 33) B 34) B 35) C 36) A 37) A 38) C 39) B 40) A 41) A 42) A 43) A 44) C 45) D 46) D 47) A 48) A 49) D 50) FALSE 51) FALSE 52) TRUE 53) FALSE 54) TRUE 55) FALSE 56) TRUE Version 1

20

stumerit@gmail.com

57) FALSE 58) TRUE 59) TRUE 60) TRUE 61) TRUE

Version 1

21

stumerit@gmail.com

Student name:_ 1)

Select the four most common types of molecules to which ncRNAs bind.

A) Lipids B) Ions C) RNA D) Proteins E) Small molecules F) Water G) DNA

2)

Select functions that ncRNAs can perform. Choose all that apply.

A) Scaffold B) Guide C) Ribozyme D) Blocker E) Decoy F) Generation of cellular energy G) Alteration of protein function or stability

3) Select the ways in which modifications to the chromatin brought about by HOTAIR and associated proteinsare proposed to inhibit transcription.

A) Direct inhibition of RNA polymerase binding B) Formation of a double-stranded RNA structure between HOTAIR and the mRNA preventing translation C) Attraction of other chromatin-modifying enzymes D) Recruitment of repressors to the DNA

Version 1

1

stumerit@gmail.com

4) Select possible outcomes after RISC binds to an mRNA during RNA interference.

Choose all that apply.

A) B) C) D) E)

5)

Inhibition of translation without mRNA degradation Expulsion of the RISC-mRNA complex from the cell Cell death mRNA degradation Movement of theRISC-mRNA complex to a P-body

In order of their occurrence what are the steps in RNA interference?

A) Processing of RNA transcript by DGCR8, transport to cytoplasm, processing by Dicer, binding to RISC, binding to target mRNA B) Processing by Dicer, processing of RNA transcript by DGCR8, transport to cytoplasm, binding to RISC, binding to target mRNA C) Processing of RNA transcript by DGCR8, processing by Dicer, transport to cytoplasm, binding to RISC, binding to target mRNA D) Processing of RNA transcript by DGCR8, binding to RISC, transport to cytoplasm, processing by Dicer, binding to target mRNA

6) In an in vitro translation assay radioactive amino acids can be incorporated into proteins and the proteins separated from the unincorporated amino acids (higher counts per minute indicates more protein synthesis). Given the following data what are the conclusions that you would come to?

RNA added to reaction

Amount of radioactivity in protein in counts per minute

Insulin mRNA alone

10,000

Insulin mRNA with antisense insulin RNA

3,000

Insulin mRNA with antisense fibronectin RNA

11,000

No mRNA

150

Insulin mRNA with double-stranded insulin RNA

500

Version 1

2

stumerit@gmail.com

A) Double-stranded RNA is more efficient at inhibiting translation than antisense RNA B) Antisense RNA is more efficient at inhibiting translation than double-stranded RNA C) No conclusion about the efficiency of translation inhibition can be made as the positive and negative controls did not perform appropriately D) The experiment did not work since the antisense fibronectin did not have an effect on amino acid incorporation.

7) You are working in a lab that studies ncRNAs. You develop an assay to isolate ncRNAs and any associated molecules. You must then identify the molecules you have isolated. You find a molecule that is associated with an ncRNA that is not changed by protease, RNase, or DNase.

The associated molecule is most likely

A) B) C) D)

a small molecule. a protein. an mRNA. DNA.

8) A bacterial ncRNA called OxySregulates translation by binding to the ShineDalgarnosequence, which preventsribosome binding. What is the function of this ncRNA?

A) B) C) D)

9)

Blocker Decoy Ribozyme Scaffold

Ribozymes are RNA molecules with what type of activity?

Version 1

3

stumerit@gmail.com

A) B) C) D)

10)

Catalytic Binding Protease Decoy

An RNA molecule with catalytic activity is called a(n)

A) B) C) D)

ribozyme. ncRNA. snRNA miRNA.

11) Select the ncRNA that facilitates the binding of telomerase to the telomere and acts as a template for DNA replication.

A) B) C) D)

TERC snRNA SRP RNA XistRNA

12) SmY RNAs are a family of ncRNAsin nematodes that are thought to be involved in a special type of RNA splicing. Based on this function, SmY RNAsaremost likely members of which category of ncRNAs?

A) B) C) D)

Version 1

snRNA tRNA snoRNA siRNA

4

stumerit@gmail.com

13)

The ncRNAHOTAIR recruits what type of proteins to target genes?

A) B) C) D)

Histone-modifyingcomplexes Transcription factors RNA polymerase Histone acetyltransferase

14) With which injection did Mello and Fire observe the lowest amount of mex-3 probe staining?

A) Injected with double-stranded RNA B) Injected with mex-3 antisense RNA C) Uninjected

15) Consider the two key roles that have been identified for SRP RNA. You have isolated a mutant SRP RNA. This RNA is able to perform its role as a scaffold for SRP proteins, but has lost its other function. How will this affect translation of SRP-containing proteins?

A) B) C) D)

16)

Partially translated proteins will be stuck in the cytosol.

Partially translated proteins will be stuck in the ER lumen.

Partially translated proteins will be stuck in the nucleus.

Translation will proceed normally.

What is the make up of the bacterial and eukaryotic SRP, respectively?

Version 1

5

stumerit@gmail.com

A) B) C) D)

Bacterial: 1 ncRNA, 1 protein; Eukaryotic: 1 ncRNA, 6 proteins Bacterial: 1 ncRNA, 1 protein; Eukaryotic: 6ncRNAs, 1 protein Bacterial: 1 ncRNA, 6 proteins; Eukaryotic: 1 ncRNA, 6 proteins Bacterial: 6ncRNAs, 1 protein; Eukaryotic: 1 ncRNA, 1 protein

17) Into which gene of the CRISPR-Cas system are fragments of bacteriophage DNA inserted?

A) B) C) D) E)

18)

Crispr tracr Cas9 Cas1 Cas2

The CRISPR-Cas system in bacteria is most similar to what system in vertebrates?

A) B) C) D)

Immune system Circulatory system Nervous system Digestive system

19) Based on what you know about cartilage-hair hypoplasia, which strategy involving ncRNAsdo you anticipate would be useful in treating this disease?

A) B) C) D)

Version 1

A viral vector to restore a particular ncRNA Anti-ncRNA oligonucleotides Targeting of the ncRNA-processing machinery Use of DNA demethylating agents and histone deacetylase inhibitors

6

stumerit@gmail.com

20) You work in a lab that is studying PIWI proteins. You have isolated piRISCs and piRITSs from a cell. What would be one way to identify which complexes are piRISCs and which are piRITSs?

A) B) C) D)

21)

One of the proteins in the piRITS should have a nuclear localization signal.

One of the proteins in the piRITS should have nuclease activity.

One of the proteins in the piRITS should have acetylation activity.

One of the proteins in the piRITS should function as a transcription factor.

piRNA sequences are complimentary to

A) B) C) D)

mRNA from a transposable element. another RNA within the piRISC. the Crispr gene. bacteriophage DNA.

22) Abnormal levels of miRNAs are associated with nearly all forms of what type of human disease?

A) B) C) D)

23)

Neurological disorders Cancer Cardiovascular disease Gastrointestinal disease

What humandisease is associated with mutations in Drosha?

Version 1

7

stumerit@gmail.com

A) B) C) D)

Familial amyotrophic lateral sclerosis Alzheimer disease Heart arrhythmias Lung cancer

24) What is the name of the type of chemical modification on anti-miRNA oligonucleotides used to inhibit miRNA function that involves ribose sugars with an extra bridge connecting the 2′ oxygen and the 4′ carbon?

A) B) C) D)

25)

Locked nucleic acids Antagomirs Enoxacin RNaseMRP

What effect would disabling exportin 5 have on RNA interference?

A) B) C) D)

In the absence of exportin 5 activity, no RNA interference could occur.

RNA interference would be unaffected by the lack of exportin 5 function. siRNAs could still carry out RNA interference, but miRNAs would not be made. miRNAs could still carry out RNA interference, but siRNAs would not be made.

Version 1

8

stumerit@gmail.com

Answer Key Test name: Chapter 18 Test Bank 1) [C, D, E, G] 2) [A, B, C, D, E, G] 3) [A, C] 4) [A, D, E] 5) A 6) A 7) A 8) A 9) A 10) A 11) A 12) A 13) A 14) A 15) A 16) A 17) A 18) A 19) A 20) A 21) A 22) A 23) A 24) A 25) C

Version 1

9

stumerit@gmail.com

Student name: TRUE/FALSE - Write 'T' if the statement is true and 'F' if the statement is false.

1) Reverse mutations involve changing a wild-type allele to a mutant allele. ⊚ true ⊚ false

2) The Lederbergs developed theprocess of replica plating to test whether advantageous mutations arose in response to the selective agent or were naturally present in the population before selection. ⊚ ⊚

3)

The mutation rate would be the same for all genes in a given culture. ⊚ ⊚

4)

true false

Silent mutations are possible due to the degenerate nature of the genetic code. ⊚ ⊚

7)

true false

A heritable change in the genetic material is called a mutation. ⊚ ⊚

6)

true false

The Ames test may be used to determine if an agent is a mutagen. ⊚ ⊚

5)

true false

true false

Ethyl methanesulfonate (EMS) is an example of a deaminating agent.

Version 1

1

stumerit@gmail.com

⊚ ⊚

8)

true false

The most common genotype in a population is called the mutant genotype. ⊚ ⊚

true false

9) Breakpoints in chromosomes can lead to mutant phenotypes when they occur in the middle of a gene. ⊚ ⊚

true false

10) If an organism has a mutation in a gene that causes it to be sterile, a mutation in a second gene that restoresfertility is a suppressor mutation. ⊚ true ⊚ false

11) A mutation in a promoter region that causes the promoter sequence to more closely resemble the consensus sequence is called an up promoter mutation and decreases transcription. ⊚ true ⊚ false

12) TNRE repeats frequently result in the addition of extra histidine amino acids to the protein. ⊚ true ⊚ false

13)

Homologous recombination repair requires the presence of a sister chromatid. ⊚ true ⊚ false

Version 1

2

stumerit@gmail.com

14)

Somatic cells are those that give rise to sperm and egg cells. ⊚ ⊚

15)

true false

An individual that is a genetic mosaic would be the result of a germ cell mutation. ⊚ ⊚

true false

16) When guanine is oxidized into 8-oxoguanine, it will base pairwith adenine during DNA replication, causing a transversion mutation. ⊚ true ⊚ false

17)

Mutagens change the structure of DNA, which may lead to mutations. ⊚ true ⊚ false

CHECK ALL THE APPLY. Choose all options that best completes the statement or answers the question.

18) Which of the following are causesof spontaneous mutations?

A) depurination B) deamination C) UV light D) tautomeric shifts E) nitrogenous base oxidation F) base analogs

Version 1

3

stumerit@gmail.com

19) Consider the following DNA sequence, which codes for the first portionof a long proteinbeginning at the ATG (AUG in mRNA) start codon.

5' ATG CCC CGC AGTAGG GGG TGG AGA3' A mutation occurs changing this sequence to: 5'ATG CCC CGC AGTAGG GAG TGG AGA3' What type of mutation is this? (Check all that apply.)

A) Point mutation B) Transition C) Transversion D) Silent mutation E) Missense mutation F) Nonsense mutation G) Frameshift mutation

MULTIPLE CHOICE - Choose the one alternative that best completes the statement or answers the question.

20) In the following sequence of DNA, the italicized base has been mutated. What type of mutation is this?

5'- G A T C T C C G A A T T - 3'original strand 5'- G A T C T C C C A A T T - 3'mutated strand A) transition B) transversion C) neither

21) The wild-type eye color of Drosophila is red. A single-base mutation occurs that produces a white eye color. Which of the following is correct regarding this mutation?

A) B) C) D)

Version 1

It is an example of a mutation that alters protein function.

Individuals with white eyes are called reversions.

It would be an example of a silent mutation.

All of the answers are correct.

4

stumerit@gmail.com

22) If a point mutation increases the number of offspring an organism can produce, it would be called a mutation.

A) neutral B) lethal C) beneficial D) conditional E) deleterious

23)

Mutations that change the configuration of a protein at a specific temperature are called mutations.

A) B) C) D)

24)

Anticipation is associated with which of the following?

A) B) C) D)

25)

nonsense mutations up-promoter mutations intergenic suppressors TRNE mutations

Most trinucleotide repeat expansion repeats involve expansion of which of the following?

A) B) C) D)

26)

neutral beneficial deleterious conditional

GAA CAG ATG any codon containing three of the same bases

Translocations and inversions may cause which of the following?

Version 1

5

stumerit@gmail.com

A) B) C) D)

27)

TRNE anticipation position effect genome mutations

Which of the following is not an example of a cause of a spontaneous mutation?

A) DNA replication errors B) tautomeric shifts C) aberrant recombination D) UV light E) transposable elements

28) A translocation that moves a gene from an area of euchromatin to heterochromatin would typically cause in the expression of the gene.

A) a reduction B) an increase C) no change

29) The results of the replica plating experiments by the Lederbergs supported which of the following theories?

A) B) C) D)

30)

random mutation theory physiological adaptation theory both theories neither theory

Which of the following is correct regarding the rate of mutation?

Version 1

6

stumerit@gmail.com

A) B) C) D)

Rates of mutation per cell generation typically range from 10−5 to 10−9.

Mutation rates are consistent across species.

Mutation rates are not influenced by environmental conditions.

Mutation rates are constant.

31) After screening a colony of bacteria for a given gene, you discover 100 mutant colonies out of 3 million total colonies. What is the mutation rate for this gene in the population?

A) 1.0 x 10 5 B) 1.0 x 10 -5 C) 3.0 x 10 5 D) 3.3 x 10 -5

32)

The conversion of cytosine to uracil in DNA is an example of A) B) C) D)

33)

depurination tautomeric shifts deamination None of the answers are correct.

The complete loss of either a guanine or adenine from DNA is an example of

A) B) C) D)

34)

.

.

depurination tautomeric shifts deamination None of the answers are correct.

What is an example of a suppressor mutation?

Version 1

7

stumerit@gmail.com

A) an intragenic mutation that restores protein structure B) an intergenic mutation that increases the activity of a protein performing the same function as the mutated protein C) an intergenic mutation that alters a transcription factor to activate the expression of a compensating protein D) All of the answers are possible suppressor mutations.

35)

A temporary change in the structure of a nitrogenous base is called

A) B) C) D)

36)

.

depurination a tautomeric shift deamination None of the answers are correct.

Which environmental agent shown can induce mutations?

A) B) C) D)

UV radiation x-rays gamma rays All of the answers are correct.

37) Which of the following integrate into the double-helix of DNA, interfering with DNA replication?

A) B) C) D)

38)

EMS nitrous acid 5BU acridine dyes

Which of the following is an example of a base analog?

Version 1

8

stumerit@gmail.com

A) EMS B) nitrous acid C) 5BU D) nitrogen mustards E) acridine dyes

39)

What process repairs damage from UV radiation?

A) homologous recombination repair B) direct repair C) base excision repair D) mismatch repair E) nucleotide excision repair F) nonhomologous end joining (NHEJ)

40)

Which DNA repair process utilizes MutL, MutH, and MutS proteins in E. coli?

A) homologous recombination repair B) direct repair C) base excision repair D) mismatch repair E) nucleotide excision repair F) nonhomologous end joining (NHEJ)

41)

Which DNA repair process often leads to deletion in chromosome sequence?

A) homologous recombination repair B) direct repair C) base excision repair D) mismatch repair E) nucleotide excision repair F) nonhomologous end joining (NHEJ)

Version 1

9

stumerit@gmail.com

42)

Which DNA repair process identifies daughter strands by methylation?

A) homologous recombination repair B) direct repair C) base excision repair D) mismatch repair E) nucleotide excision repair F) nonhomologous end joining (NHEJ)

43)

How does position effect influence gene expression?

A) The movement of thegenetic material on the chromosome by inversions or translocations may place acoding sequence near a new regulatory region, thus activating the expression ofthe gene.

B) The movement of the gene may place it into a region that is highly condensed.

C) The movement of a gene may remove it from its normal promoter, thussilencing the gene.

D) All of the answers are correct.

44) In the nucleotide excision repair system, which of the following proteins is responsible for recognizing a thymine dimer to be repaired?

A) B) C) D)

UvrA/UvrB UvrC UvrD None of the answers are correct.

45) Which process is used to replicateDNA that containsdistortions due to unrepaired DNA damage?

Version 1

10

stumerit@gmail.com

A) B) C) D)

46)

Translesion synthesis Homologous recombination repair Nonhomologous end joining Nucleotide excision repair

What would be a set of anticipated results from a "Lederberg" experiment?

A) Total number of colonies on a plate: 1500 Total number of resistant colonies on replica plate with T1: 15 B) Total number of colonies on a plate: 1500Total number of resistant colonies on replica plate with T1: 1500 C) Total number of colonies on a plate: 500Total number of resistant colonies on replica plate with T1: 1500 D) Total number of colonies on a plate: 1500Total number of resistant colonies on replica plate with T1: 0

47) There is a spectrum of syndromes in humans known as Xeroderma pigmentosum. The individuals that have XD most commonly have mutations in their nucleotide excision DNA repair mechanisms that make them particularly susceptible to environmental mutagens such as UV light. Individuals have to be careful with how much sunlight they are exposed to since they have an extremely elevated chance for developing skin cancer. There have been several cell lines that have been established from XD patients that can be studied in tissue culture. In an experiment, several different cell lines of unknown origin were tested for their ability to undergo unscheduled DNA synthesis (UDS), an assay for DNA repair. In this essay, the amount of radioactive nucleotides that are incorporated into DNA after the cell sustains a mutagenic event are measured. The amount of radioactivity incorporated is measured by the number of counts per minute (CPM). Below is a table from such an experiment. Which cell line is most likely from XD patient(s)?

Cell line

CPM in UDS assay

CPM if no mutagenic event

A

2,500

2,750

B

300,000

5,000

C

45,000

25,000

D

275,000

50,000

Wild-type control

750,000

75,000

Version 1

11

stumerit@gmail.com

A) B) C) D)

A B C D

48) Beechdrops is a parasitic plant that cannot perform photosynthesis but relies on its host the Beech tree. However, beechdrops still retains many if not all of the genes for photosynthesis.

Snapdragons and gladiolas are common garden flowers that rely on their ability to perform photosynthesis. If you were to compare the gene sequences for these three plants for ribulose1,5-bisphosphate carboxylase/oxygenase (RuBisCO) a protein necessary for photosynthesis what would you predict?

A) The differences between gladiolas and snapdragons would most likely be silent mutations while those in beechdrops may be silent or missense B) Since these three plants are not highly related the sequences for RuBisCO would be very different between them C) The differences between gladiolas and snapdragons would most likely be in the second nucleotide of codons while beechdrops would have a higher number of mutations in the third nucleotide of the different codons D) The differences between gladiolas and snapdragons would most likely be missense mutations while those in beechdrops may be silent or missense

49)

Which types of mutations are least likely to be subjected to natural selection?

A) B) C) D)

Silent Missense Nonsense Insertion

50) Consider the following DNA sequence, which codes the first portionof a long proteinbeginning at the ATG (AUG in mRNA) start codon.

5' ATG CCC CGC AGTAGG GGG TGG AGA 3' Which of the mutatedsequences listed is most likely to be a deleterious mutation?

Version 1

12

stumerit@gmail.com

A) 5'ATG CCC CGC AGTAGG GAG TGG AGA3' B) 5'ATG CCC CGC AGTAGG GGG TGAAGA3' C) 5'ATG CCGCGC AGTAGG GGG TGGAGA3'

51) You are a doctor tasked with diagnosing a patient that comes to you with mental impairment. Upon performing genetic tests, you find he has approximately 300 repeats of GCC in one of his genes. His father and grandfather had similar mental impairment but were never diagnosed with a condition prior to their death. His grandmother, mother, and sisters are unaffected. What disease do you predict that this patient has?

A) SBMA B) HD C) SCA1 D) FRAXA E) FRAXE

Version 1

13

stumerit@gmail.com

Answer Key Test name: Chapter 19 Test Bank 1) FALSE 2) TRUE 3) FALSE 4) TRUE 5) TRUE 6) TRUE 7) FALSE 8) FALSE 9) TRUE 10) TRUE 11) FALSE 12) FALSE 13) TRUE 14) FALSE 15) FALSE 16) TRUE 17) TRUE 18) [A, B, D, E] 19) [A, B, E] 20) B 21) A 22) C 23) D 24) D 25) B 26) C Version 1

14

stumerit@gmail.com

27) D 28) A 29) A 30) A 31) D 32) C 33) A 34) D 35) B 36) D 37) D 38) C 39) E 40) D 41) F 42) D 43) D 44) A 45) A 46) A 47) A 48) A 49) A 50) B 51) E

Version 1

15

stumerit@gmail.com

Student name:_ 1)

Select items that describe a stage of a PCR reaction. Choose all that apply.

A) DNA is heated to a temperature that causes the strands to separate.

B) Primers bind to complementary sequences on the template DNA. C) DNA gyrase enzyme relieves the supercoiling ahead of the replication fork.

D) The DNA polymerase synthesizes a new strand of DNA that is complementary to the template DNA.

2)

Which of the following cells are pluripotent? (Check all that apply) A) neuronal cells B) embryonic stem cells C) epithelial cells D) red blood cells E) embryonic germ cells F) adult stem cells

3) Small circular pieces of bacterial DNA that are used as vectors in cloning experiments are called .

A) B) C) D)

4) a(n)

phages viruses plasmids chromosomes

A plasmid that contains separate origins of replication for two different species is called .

Version 1

1

stumerit@gmail.com

A) B) C) D)

R factor expression vector viral vector shuttle vector

5) Site-directed mutagenesis allows researchers to produce a mutation at a cloned DNA segment.

within a

A) specific site B) random site C) semilocalized site that can later be identified by sequencing

6) Select the technique that can be used to see how a specific mutation affects the expression of a gene and the function of a protein.

A) B) C) D)

7)

What is the origin of restriction endonucleases?

A) B) C) D)

8)

site-directed mutagenesis Western blotting real-time PCR DNA sequencing

They are part of DNA repair mechanisms in eukaryotic cells.

They are a defense mechanism against viruses in bacteria.

They are replication enzymes of yeast.

They are transposable elements of Drosophila.

Which of the following is an example of a palindromic DNA sequence?

Version 1

2

stumerit@gmail.com

A) B) C) D)

9)

DNA ligase is needed in a cloning experiment for what reason?

A) B) C) D)

10)

to proofread the vector for mistakes to covalently link the sugar-phosphate backbones of the two DNA fragments to allow the vector to enter into the cell to act as a selectable marker in the identification of cells that took up the vector

What do competent cells do?

A) B) C) D)

11)

5′ - ATCGAC - 3′3′ - TAGCAG - 5′ 5′ - ATCATC - 3′3′ - ATCATC - 5′ 5′ - GCCGCC - 3′3′ - CGGCGG - 5′ 5′ - CTGCAG - 3′3′ - GACGTC - 5′

resist transfection by a viral vector rejoin DNA strands without the aid of DNA ligase utilize transposons as a vector take up DNA from the external environment

Which of the following would contain both vector DNA and chromosomal DNA?

A) B) C) D)

Version 1

recircularized vector hybrid vector both vectors neither vector

3

stumerit@gmail.com

12) In a cloning experiment with chromosomal DNA, you use a vector that contains a lacZ gene as a selectable marker. If the competent cells are grown on X-Gal and IPTG, which colonies would contain cloned chromosomal DNA? A) B) C) D)

13)

cDNA is made using what as the starting material?

A) B) C) D)

14)

the white colonies the blue colonies half the total colonies none of the colonies

plasmid vectors viral DNA chromosomal DNA RNA

What is the purpose of RNaseH in the making of cDNA?

A) B) C) D)

It copies the RNA into a complementary DNA strand.

It reforms the sugar-phosphate backbone.

It generates short RNAs that are used as primers.

It proofreads the cDNA for errors.

15) Which of the following individual(s) developed the process of the polymerase chain reaction?

A) B) C) D)

Version 1

Watson and Crick McClintock Mullis Pauling

4

stumerit@gmail.com

16)

What occurs during the annealing stage of a PCR reaction?

A) B) C) D)

The DNA strands separate The DNA polymerase copies the template DNA. The primers bind to the template DNA. The reaction stops.

17) In the DNA sequence 5′ GCGCAAATTTCCCTATACCC 3′, you wish to use sitedirected mutagenesis to change the T at position 8 to a C. Select the primer that is likely to give you the best results.

A) 5′ GCGCAAACTTCCCTATACCC 3′ B) 5′ CGCGTTTGAAGGATATGGG 3′ C) 5′ GCGCAGGCCTCCCTATACCC 3′

18)

What is the purpose of RT(reverse transcriptase)-PCR? A) B) C) D)

19)

to conduct a PCR reaction without the use of primers to follow the amount of a specific PCR product in real-time to quantify RNA in a cell to nonspecifically amplify DNA

What is a DNA library?

A) B) C) D)

Version 1

a collection of vectors, each containing a fragment of the genome or DNA of interest a complete sequence of the genetic material in an organism an electronic file that may be used for additional genetic analysis a collection of mRNA from a given cell

5

stumerit@gmail.com

20)

A cDNA library differs from a genomic library in which way?

A) B) C) D)

It consists solely of RNA molecules.

It contains many copies of the gene of interest.

It contains only coding sequences, not introns.

It is typically 10-100 times the size of a DNA library.

21) Which procedure is used to identify a specific RNA within a mixture of many RNA molecules?

A) B) C) D)

Western blotting Northern blotting Southern blotting Eastern blotting

22) Which procedure is used to identify a specific protein within a mixture of many different protein molecules?

A) B) C) D)

23)

Western blotting Northern blotting Southern blotting Eastern blotting

Antibodies can be used as probes for which of the following techniques?

A) B) C) D)

Version 1

Western blotting Northern blotting Southern blotting Eastern blotting

6

stumerit@gmail.com

24)

Which technique is best suited to identify DNA-protein interactions?

A) B) C) D)

25)

Western blotting PCR electrophoretic mobility shift assay restriction enzyme analysis

Which technique uses dideoxynucleotides?

A) B) C) D)

RT-PCR DNA sequencing restriction digest gene cloning

26) The use of fluorescently-labeled dideoxynucleotides is a characteristic of what type of sequencing?

A) automated DNA sequencing B) base-specific DNA cleavage

27)

Detection of a product in real-time PCR depends on A) B) C) D)

Version 1

the separation of the reporter from the quencher. the reporter and quencher remaining in close proximity to each other. the reporter binding to the quencher.

Taq polymerase destroying the reporter.

7

stumerit@gmail.com

28) In real-time PCR, the initial template concentration is calculated using the of PCR.

phase

A) exponential B) linear C) plateau

29) You are performing a mobility shift assay with a protein complex that is composed of proteins A, B, C, & D, each of which can bind to the DNA of interest. You run the gel with the lanes as follows: Lane 1: Protein A + DNA Lane 2: Proteins A + B + DNA Lane 3: Proteins A + B + C + DNA Lane 4: Proteins A + B + C + D + DNA In which lane will the DNA run closest to the top of the gel?

A) B) C) D)

Lane 4 Lane 3 Lane 2 Lane 1

30) Although Dolly was only three years old, her chromosomes had the length of a 9- to 10year-old sheep. Which of the following best describes why this occurred?

A) The cell lines that created Dolly were aged prematurely in the lab and thus became longer.

B) Nonhomologous recombination occurred, which caused Dolly's chromosomes to shorten.

C) A mutation enhanced the rate of aging of Dolly's chromosomes.

D) Dolly was not a clone.

E) The telomeres of the somatic cells that Dolly originated from were already shortening.

Version 1

8

stumerit@gmail.com

31) Which of the following terms describes a cell that can form any other cell of the organism?

A) B) C) D)

32)

Hematopoietic stem cells are A) B) C) D)

33)

pluripotent totipotent unipotent All of the answers are correct.

.

pluripotent totipotent unipotent multipotent

Bone marrow transplants typically use what type of cells?

A) B) C) D)

embryonic stem cells embryonic germ cells hematopoietic stem cells None of the answers are correct.

34) The origins of which of the following cell types creates the least amount of ethical debate?

A) B) C) D)

Version 1

embryonic germ cells hematopoietic stem cells embryonic stem cells All of the answers are equal.

9

stumerit@gmail.com

35)

Which of the following is an example of a pluripotent cell?

A) B) C) D) E)

36)

embryonic stemcells red blood cells fetal heartcells umbilical cordblood nerve cells

What is a property of stem cells?

A) B) C) D)

They can differentiate into one or more specialized cell types.

They can form any tissue in the body.

They are only capable of one to two cell divisions.

They will only form hematopoietic cells.

37) A scientist does not have an antibody to detect the protein of interest, but wants to know if the gene is expressed at low levels. What technique could the researcher use to detect, but not quantify the expression of the gene of interest?

A) B) C) D)

Western Blotting Real-time PCR Cloning Reverse transcriptase PCR

38) A researcher is interested in whether or not a transcription factor binds to a specific site on a strand of DNA. However, the samples accidentally contain SDS. What will the electrophoretic mobility shift assay results show?

Version 1

10

stumerit@gmail.com

A) The protein will bind the DNA and retard the movement of the DNA through the gel.

B) The protein will not bind to the DNA and the movement of the DNA through the gel will not be affected.

C) The protein will bind the DNA and the movement of theDNA through the gel will not be affected.

D) The protein will not bind the DNA and the movement ofthe DNA through the gel will be affected.

39) You are using CRISPR-Cas technology to introduce a single nucleotide change in a gene of interest in living cells. You are designing your experiment. In which component of the reaction will you engineer the single nucleotide change?

A) B) C) D) E)

Donor DNA Spacer RNA Repeat RNA Linker RNA tracrRNA

40) You are sequencing the following DNA molecule 3'- GACTACCGAAATTAT -5'.

Assume the annealing primer binds immediately prior to this sequence. What nucleotide will be found closest to the bottom of the sequencing gel?

A) B) C) D)

G A C T

41) You are carrying out a sequencing reaction. You remember to add ddNTPs, but forget to add dNTPs. What will the outcome of your sequencing reaction be?

Version 1

11

stumerit@gmail.com

A) Sequencing will proceed normally.

B) No sequencing will take place at all.

C) Sequencing will begin, but will not be able to proceed past the first nucleotide because the ddNTPs cannot be used for chain extension.

D) Four fragments will be made corresponding to the first A, T, C, and G in the sequence, but after that no more fragments will be made.

42) Prior to the discovery of Taq polymerase, PCR could be carried out in a more laborious manner by adding a non-thermostable polymerase to each round of the reaction. In order for this reaction to work, when should the non-thermostable polymerase be added?

A) Before denaturation B) After primer annealing C) After primer extension

43) The restriction enzyme BamHI recognizes the sequence: 5'-G/GATCC-3' 3'-CCTAG/G-5' It cuts between the G and G as noted by the slashes. Following the digestion of chromosomal DNA and vector DNA with BamHI, let's suppose that one fragment of chromosomal DNA gets inserted into a vector. No DNA ligase has been added. If both of the sticky ends holding the chromosomal DNA fragment are binding to the sticky ends of the vector, what is holding the two pieces of DNA together?

A) B) C) D)

Version 1

10 hydrogen bonds 16 hydrogen bonds 20 hydrogen bonds 26 hydrogen bonds

12

stumerit@gmail.com

44) A primer used in dideoxy DNA sequencing is 20 nucleotides long and has the following sequence: 5'-GGATCCATGACTAGTCCGAC-3' A segment of DNA is cloned into a vector and then the vector DNA is denatured and subjected to dideoxy DNA sequencing. Below is the DNA sequence from a region of the vector. The primer-annealing site is shown in bold and underlined.

3'-CCCGATCGGCCTAGGTACTGATCAGGCTGAATGACT-5' Based on the sequence above, what would be the sizes of the bands (i.e. the number of nucleotides in each band) containing dideoxyT? A) 1, 2, and 5 B) 21, 22, and 25 C) 3 and 7 D) 23 and 27

45)

Restriction endonucleases recognize specific DNA sequences. ⊚ ⊚

true false

46) Since cDNA is made from RNA, it lacks introns and contains only the coding sequence for the functional protein. ⊚ ⊚

true false

47) The process of ligating DNA sequences into a vector and introducing the construct into a cell to create many copies is referred to as gene cloning. ⊚ ⊚

Version 1

true false

13

stumerit@gmail.com

48)

A vector is a small segment of DNA that a gene of interest is inserted into for cloning. ⊚ ⊚

true false

49) Molecular biologists use restriction enzymesto amplify a specific section ofDNA within the genome. ⊚ ⊚

50)

true false

The first organism ever cloned by researchers was Dolly the sheep in 1997. ⊚ true ⊚ false

51) The primary interest of genetic research into stem cells is the desire to clone a human being. ⊚ true ⊚ false

52)

Unipotent cells may differentiate into all other cell types of the body. ⊚ ⊚

53)

true false

An organism that can be regenerated from somatic cells is called multipotent. ⊚ true ⊚ false

Version 1

14

stumerit@gmail.com

Answer Key Test name: Chapter 20 Test Bank 1) [A, B, D] 2) [B, E] 3) C 4) D 5) A 6) A 7) B 8) D 9) B 10) D 11) B 12) A 13) D 14) C 15) C 16) C 17) A 18) C 19) A 20) C 21) B 22) A 23) A 24) C 25) B 26) A Version 1

15

stumerit@gmail.com

27) A 28) A 29) A 30) E 31) B 32) D 33) C 34) B 35) A 36) A 37) D 38) B 39) A 40) C 41) C 42) B 43) C 44) B 45) TRUE 46) TRUE 47) TRUE 48) TRUE 49) FALSE 50) FALSE 51) FALSE 52) FALSE 53) FALSE

Version 1

16

stumerit@gmail.com

Student name:_ 1)

Which might be used as a marker for linkage mapping? (Check all that apply.)

A) AFLP B) RFLP C) microsatellite D) FISH E) PCR F) SNP G) STS

2)

Which researcher(s) are using a metagenomic approach?

A) A medical researcher studies the DNA of mixed bacterial populations from the intestines of patients with different diseases.

B) A plant biologist sequences the genomes of broccoli, cauliflower, and other Brassica species to determine which genes are responsible for their different features.

C) A developmental geneticist clones the mutated gene from a Drosophila strain with disrupted wing development.

D) An environmental researcher sequences DNA from collections of microbes living in polluted coastal waters, which cannot be cultured in the lab.

E) A pharmaceutical developer screens through DNA found in soil samples for novel antibiotics.

3)

For what situation(s) would a metagenomics strategy be appropriate?

A) to study organisms that cannot be cultivated in the lab B) to thoroughly study the genome of a new model organism C) to ensure that an entire genome is sequenced D) to study multiple species that interact in the environment E) to determine whether a patient carries a disease-causing allele F) to do a broad survey of genes from different species in a certain habitat

Version 1

1

stumerit@gmail.com

4)

Select all advantages of RNA-Seq as compared to DNA microarrays.

A) B) C) D) E)

Better detection of transcripts present at low levels Identifies boundaries of introns and exons to determine splice variants More accurately quantifies the amount of each transcript Does not require isolation of RNA from the cell Does not require cDNA synthesis

5) A researcher isolates mRNA from healthy and diseased liver biopsies. Each mRNA sample is converted into cDNA and subjected to next-generation sequencing. Select all statements that describe this experiment and the possible results.

A) The researcher can identify transcripts that are more abundant in healthy liver than in diseased liver, which are candidate genes for further study.

B) The researcher can identify transcripts that are less abundant in healthy liver than in diseased liver, which are candidate genes for further study.

C) This is an RNA-Seq experiment.

D) This is a DNA microarray analysis.

E) Some genes' transcriptsmay be present in both samples but have different splice forms in healthy and diseased liver.

F) The intron sequences will be more abundant in the diseased liver samples.

G) The researcher should have combined the healthy and diseased mRNA samples before making cDNA, so that only one sample would need to be sequenced.

Version 1

2

stumerit@gmail.com

6) A woman has a child and wants to determine who the father of the child is. There are four possible fathers. This group of individuals is analyzed with regard to three different STSs: STS-1 is 215 bp and 199 bp, STS-2 is 144 bp and 122 bp, and STS-3 is 101 bp and 85 bp. The child (C), mother (M), and 4 potential fathers (D1-D4) show the following results. Select the individual(s) who are heterozygous for STS-3. (Check all that apply.)

A) C B) M C) D1 D) D2 E) D3 F) D4

7) Which of the following procedures best determines the relative order, but not precise location, of a series of genes on a chromosome?

A) B) C) D)

physical mapping cytogenetic mapping linkage mapping shotgun sequencing

8) uses the unique banding patterns of a chromosome to determine the general location of a gene.

Version 1

3

stumerit@gmail.com

A) B) C) D)

9)

What does physical mapping provide that the other types of genetic mapping do not?

A) B) C) D)

10)

cytogenetic mapping physical mapping linkage mapping sequencing

A site in the genome that varies between members of the population is said to be .

A) B) C) D)

12)

recombination distances between genes number of nucleotide base pairs between genes relationship of the gene to specific chromosomal banding patterns frequencies of alleles in a population

What is in situ hybridization used for?

A) B) C) D)

11)

Physical mapping Cytogenetic mapping Linkage mapping Shotgun sequencing

monomorphic polymorphic trimorphic neomorphic

If all members of a population have the identical DNA segment, it is said to be

Version 1

.

4

stumerit@gmail.com

A) B) C) D)

13)

monomorphic polymorphic trimorphic neomorphic

The most common microsatellite in humans is

.

A) (AT) 100 B) (CA) n C) (TG) n D) (CAT) n E) AUG

14) The method of sequencing in which DNA fragments to be sequenced are randomly generated from larger DNA fragments is

A) B) C) D)

15)

cytogeneticmapping. shotgun sequencing. southernblotting. dideoxyblotting.

The Human Genome Project was a

A) B) C) D)

Version 1

-year effort.

5 13 3 50

5

stumerit@gmail.com

16)

The human genome consists of approximately

base pairs of DNA.

A) 100,000 B) 1 million C) 1 billion D) 3 billion E) 2 trillion

17) Pyrosequencing is an example of a high-throughput, next-generation sequencing technology. What is a crucial detail of the procedure?

A) B) C) D)

including the enzyme luciferase mixing the solution of four nucleotides together in even amounts removing nucleotides from the target DNA one at a time using large wells to accommodate multiple beads

18) After a metagenomics researcher collects a mixed sample of DNA, what next step allows this DNA to be studied?

A) The DNA fragments are each ligated into a cloning vector to create a DNA library.

B) The pieces of DNA are ligated together into one complete "genome" so they can be sequenced.

C) The species responsible for each DNA are identified and individually cultured.

D) DNA is reconstructed into chromosomes by using the human genome as a scaffold.

19)

Gene chips are being used for which of the following purposes?

Version 1

6

stumerit@gmail.com

A) B) C) D) E)

to examine patterns of gene expression under various environmental conditions to establish levels of genetic variation to determine gene expression specific to certain cell types to identify species of bacteria All of these choices are possible.

20) In the screening of a DNA microarray, detection of a fluorescent signal from one of the genes indicates which of the following?

A) B) C) D)

The labeled cDNAhybridized to that particular gene.

The labeled cDNAdid not hybridize to that particular gene.

The experiment was not conducted correctly.

None of these choices are correct.

21) make it possible for researchers to study how an entire genome responds to an environmental stimuli.

A) B) C) D)

22)

Gene knockouts PCR reactions DNA microarrays Shotgun sequences

To identify novel DNA binding sites for a protein, it would be best to use A) B) C) D)

Version 1

.

pyrosequencing microsatellites chromatin immunoprecipitation ChIP-chip

7

stumerit@gmail.com

23)

Gene knockouts in mice can be useful because

A) they can be used to develop models of human disease.

B) they identify DNA binding proteins C) they limit mRNA production both from the knockout as well as the normal allele in diploids.

D) only genes that are actively transcribed in the embryo are susceptible to being knocked out.

24)

In shotgun sequencing, how is a complete sequence of a genome reconstructed?

A) The entire genome is directly sequenced chromosome by chromosome.

B) The genome is fragmented and sequences of each fragment are arranged so that overlapping regions are identified.

C) The sequences of a large number of individuals is obtained and “averaged” to obtain the complete sequence.

D) The position of each marker and gene are first mapped relative to regions for which the genomic sequence is not known.

25) The experimental process of determining the relative location of genes or other segments of DNA along individual chromosomes is called

A) B) C) D)

mapping. metagenomics.

DNA sequencing. proteomics.

26) An application of FISH technique, where multiple DNA probes are labeled with different fluorescent molecules that bind to a chromosome, is called . Using this technique, researchers can determine the sites of the DNA segments along the chromosome.

Version 1

8

stumerit@gmail.com

A) B) C) D)

27)

chromosome painting Giemsa staining pyrosequencing physical mapping

A complex collection of genes from a specific environmental sample is a A) B) C) D)

.

microgenome metagenome linkage map microarray

28) Which of the following samples would NOT be suitable for a metagenomics-based approach?

A) Water samples from different bodies of water with different temperatures, salinities, and acidities B) A soil sample from a farm where a new planting schedule has been implemented C) A water sample from an industrial site that has been contaminated with pollutants D) A fecal sample from a patient with irritable bowel syndrome E) A homogeneous population of skin cancer cells collected from a patient biopsy

29) You are sequencing the genome of the yeast S. cerevisiae, with a genome size of 12,100,100 bp, using shotgun sequencing. Your sequencer malfunctions when only 24,200,000 bp in total have been sequenced. How much of the genome should have been sequenced at this point?

Version 1

9

stumerit@gmail.com

A) 100% B) 0% C) 13.5% D) 86.5% E) 0.135% F) 0.865%

30) A woman has a child and wants to determine who the father of the child is. There are four possible fathers. This group of individuals is analyzed with regard to three different STSs: STS-1 is 215 bp and 199 bp, STS-2 is 144 bp and 122 bp, and STS-3 is 101 bp and 85 bp. The child (C), mother (M), and 4 potential fathers (D1-D4) show the following results. Which individual is the father of the child?

A) B) C) D)

D1 D2 D3 D4

31) You are carrying out a chromosome painting experiment. You have single-stranded DNAs that bind to 6 different regions of the X chromosome. You inadvertently label the DNA probes all with the same colored fluorescent molecule, which happens to be red in this experiment. What will be the result of your experiment?

Version 1

10

stumerit@gmail.com

A) B) sequence.

C) D) probes.

The DNA probes will be unable to bind.

The probes will bind, but you will not be able to tell which spot corresponds to which The entire X chromosome will be labeled red along its entire length.

The probes will bind normally, and you will still be able to distinguish between the

32) Imagine that when shotgun sequencing was initially used to sequence the H. influenzae genome, the sonicator didn't work. How would this affect the sequencing experiment?

A) Because the DNA fragments would be longer than what is usually carried by a plasmid DNA, no sequence would be obtained.

B) Because the DNA fragments would be longer than what is usually carried by a plasmid DNA, there would likely be sequences missing in the sequencing results due to difficulties with DNA replication.

C) Because the DNA fragments would be longer than what is usually carried by a plasmid DNA, sequencing would occur more quickly than usual.

D) Because the DNA fragments would be shorter than what is usually carried by a plasmid DNA, there would likely be sequences missing in the sequencing results due to difficulties with DNA replication.

E) Because the DNA fragments would be shorter than what is usually carried by a plasmid DNA, no sequence would be obtained.

F) Because the DNA fragments would be shorter than what is usually carried by a plasmid DNA, sequencing would occur more quickly than usual.

33)

One map unit of distance always corresponds to 106 base pairs. ⊚ true ⊚ false

34) A microsatellite marker may be used to predict the likelihood that an individual carries a trait for a specific disease.

Version 1

11

stumerit@gmail.com

⊚ ⊚

true false

35) Part of the Human Genome Project involved sequencing the genomes of model organisms, including bacteria and a plant. ⊚ true ⊚ false

36)

RFLP stands for restriction fragment linked position. ⊚ ⊚

37)

In a FISH procedure, the probe being used is labeled with a fluorescent tag. ⊚ ⊚

38)

true false

true false

cDNA uses chromosomal DNA as its template. ⊚ ⊚

true false

39) A small glass chip that contains thousands of microscopic pieces of DNA is called a DNA microarray. ⊚ ⊚

Version 1

true false

12

stumerit@gmail.com

40) to it.

The termgene knockout refers to a genealteration that inhibitsthe genes that are adjacent ⊚ ⊚

true false

41) Shotgun sequencing is precise enough to achieve a complete genomic sequence without the need for other mapping methods. ⊚ true ⊚ false

42) In sequencing by synthesis (SBS) methods, the sequence of a sample is directly determined as nucleotides are incorporated into a DNA strand by DNA polymerase. ⊚ true ⊚ false

Version 1

13

stumerit@gmail.com

Answer Key Test name: Chapter 21 Test Bank 1) [A, B, C, F, G] 2) [A, D, E] 3) [A, D, F] 4) [A, B, C] 5) [A, B, C, E] 6) [A, E, F] 7) C 8) B 9) B 10) A 11) B 12) A 13) B 14) B 15) B 16) D 17) A 18) A 19) E 20) A 21) C 22) D 23) A 24) B 25) A 26) A Version 1

14

stumerit@gmail.com

27) B 28) E 29) D 30) C 31) B 32) B 33) FALSE 34) TRUE 35) TRUE 36) FALSE 37) TRUE 38) FALSE 39) TRUE 40) FALSE 41) FALSE 42) TRUE

Version 1

15

stumerit@gmail.com

Student name:_ 1)

What can cause epigenetic changes? (Select all that apply.)

A) B) C) D)

2)

DNA methylation Histone acetylation Histone methylation Histone phosphorylation

What are the potential advantages for personalized medicine? (Select all that apply.)

A) More effective dosing B) Knowing which drugs will be the most effective C) Being able to classify cancers on the way the cells look under a microscope as opposed to their genetic makeup D) Treatment of patients based on their specific physiology

3) This pedigree involves a human disease that is inherited in a simple Mendelian manner.

Which pattern(s) of inheritance is consistent with this pedigree? Check all that apply.

A) B) C) D)

Autosomal recessive Autosomal dominant X-linked recessive X-linked dominant

4) Select the genetic changes that are associated with the development of colorectal cancer.

(Check all that apply.)

Version 1

1

stumerit@gmail.com

A) Loss of APC B) Activation of ras C) Loss of myc D) Loss of DCC E) Activation of NF1 F) Loss of p53

5)

Select the viruses that cause cancer in humans. Choose all that apply.

A) B) C) D) E)

6)

Rous sarcoma virus Hepatitis B virus Papillomavirus Hardy-Zuckerman-4 feline sarcoma virus Herpes virus

For a single-gene disorder, the concordance among monozygotic twins should be A) 0%.

B) 25%.

C) 50%.

D) 75%.

E) 100%.

7)

For a recessive single-gene disorder, the concordance among dizygotic twins should be A) 0%.

B) 25%.

C) 50%.

D) 75%.

E) 100%.

Version 1

2

stumerit@gmail.com

8) Which of the following would indicate that a disease has a genetic, rather than environmental, cause?

A) The disease has a specific age of onset.

B) The disease is cured by taking an antibiotic.

C) The disease occurs at the same rate in individuals that are exposed to a similar environment.

D) The disease occurs as frequently between close relatives as it does in unrelated individuals.

9) You are analyzing a human pedigree for a new disease and discover that the disease occurs with the same frequency in both sexes and that 25% of the children from two unaffected heterozygous parents have the disease. This disease is displaying inheritance.

A) B) C) D)

autosomalrecessive autosomaldominant sex-linkedrecessive sex-linkeddominant

10) Which of the following is typically associated with an autosomal recessive pattern of inheritance?

A) B) affected C) D)

Version 1

an affected offspring has one or more affected parents an affected individual with one affected parent will have 50% of its offspring two affected heterozygous individuals will have 25% of their offspring unaffected an affected offspring has two unaffected parents

3

stumerit@gmail.com

11) In the analysis of a family, you notice that males are more likely to contract a certain disease, and the daughters of affected males produce 50% of their sons affected with the disease.

This disease is displaying which of the following patterns of inheritance?

A) B) C) D)

X-linked recessive autosomal recessive autosomal dominant None of these choices are correct.

12) Which technique can be used at the earliest stage in a pregnancy to provide a sample for fetal genetic testing?

A) amniocentesis B) chorionic villus sampling C) Both chorionic villus sampling and amniocentesis are performed at the same stage in a pregnancy.

13)

The term that indicates that cancer has begun to migrate to other parts of the body is .

A) B) C) D) E)

malignant benign metastatic invasive clonal

14) A gene that promotes the development of cancer when it sustains a gain-of-function mutation is called a

Version 1

4

stumerit@gmail.com

A) B) C) D)

15)

An oncogene form of Ras would have which of the following characteristics?

A) B) C) D)

16)

decreased GTPase activity an increased number of copies in the cell decreased exchange of GDP for GTP increased GTPase activity

What are the general ways that tumor suppressors and oncogenes act?

A) B) C) D)

17)

housekeeping gene. tumor suppressor gene. proto-oncogene caretaker gene.

Tumor suppressors inhibit the cell cycle and oncogenes stimulate the cell cycle.

Oncogenes inhibit the cell cycle and tumor suppressors stimulate the cell cycle.

Both tumor suppressors and oncogenes stimulate the cell cycle.

Both tumor suppressors and oncogenes inhibit the cell cycle.

Caspases are active during which of the following?

A) B) C) D)

the normal cell cycle apoptosis viral integration DNA replication

18) The process of cells for genetic problems.

Version 1

removes amniotic fluid from a pregnant mother to examine fetal

5

stumerit@gmail.com

A) B) C) D)

19)

amniocentesis chorionic villussampling preimplantationgenetic diagnosis in vitrofertilization

Locus heterogeneity can cause difficulties in pedigree analysis since A) B) C) D)

the inheritance of only one gene is being analyzed. the inheritance of more than one gene is being analyzed. the cause of the disease may not have a genetic origin. the cause of the disease may have environmental as well as genetic origins.

20) The term that refers to the linkage of alleles or molecular markers along a single chromosome is A) B) C) D)

21)

loss of variation. association group. recombination group. haplotype.

What is the difference between genetic testing and genetic screening?

A) Genetic testing is concerned more with individuals and genetic screening is concerned with populations.

B) Genetic screening is concerned more with individuals and genetic testing is concerned with populations.

C) They use different tests and techniques to detect genetic mutations.

D) Genetic testing is concerned more with nonlethal syndromes and diseases, and genetic screening is concerned with lethal diseases and syndromes.

Version 1

6

stumerit@gmail.com

22) The term for the use of information about a person's genotype and other clinical data in order to select a medication is referred to as A) B) C) D)

23)

best medical practices. molecular profiling. personalized medicine. minimalized drug therapy.

An example of personalized medicine would be A) B) C) D)

treatment of an infection based on the drug resistance of the bacterium. treatment of diabetics with synthetic instead of natural insulin. determining the CYP2C9 alleles present to help set the patient's coumarin dose. performing an appendectomy on a patient with appendicitis.

24) What kind of mutation would be expected both within oncogenes and tumor suppressor genes that would result in gain-of-function or loss-of-function, respectively?

A) B) C) D)

25)

Missense Amplifications Silent Neutral

Epigenetics may play a role in cancer by

Version 1

7

stumerit@gmail.com

A) B) C) D)

causing a change in gene expression patterns. directly inducing inversion mutations. directly resulting in gene deletions. causing translocations.

26) Gene X can exist as a normal allele and also as a dominant mutant allele that causes a disease. You purify protein X from a homozygous normal individual and also from an individual that is homozygous for the mutant allele. You have an assay to determine the function of protein X. When you assay 1 mg of the purified protein from a normal homozygote, the activity is 100%.

When you mix together 0.5 mg of the normal protein and 0.5 mg of the mutant protein, the activity is 13%. Based on this experiment, what type of dominant mutant is this?

A) Gain of function B) Dominant negative C) Haploinsufficiency

27) How would a mutation that increases the rate of GTP hydrolysis by the Ras protein affect the EGF signaling pathway and how would it affect cell growth?

A) The signaling pathway would stay turned on and cell growth would be stimulated.

B) The signaling pathway would stay turned on and cell growth would be inhibited.

C) The signaling pathway would be turned off faster and cell growth would be stimulated.

D) The signaling pathway would be turned off faster and cell growth would be inhibited.

28)

The general function of the p53 protein could be described as

Version 1

8

stumerit@gmail.com

A) a negative regulator of cell division.

B) a positive regulator of cell division.

C) maintaining genome integrity.

29)

If the individuals in the picture above had a child, that child could have which haplotype listed (assuming no crossing over)?

A) B) C) D)

1A2A3A4A; 1B2B3A4B 1A2B3B4C; 1C2C3C4A 1A2B3C4A; 1C2C3B4C 1A2A3A4A; 1C2C3C4A

30) Tamoxifen is a medication used for treating cancer. Many women were found to have resistance to this drug, and research showed that women with a mutation in their CYP2D6 gene could not break down Tamoxifen. Therefore Tamoxifen was not a useful treatment for their cancer. Women can now be screened for this mutation, allowing clinicians to use a therapy that is effective for each woman. This type of treatment is an example of .

A) B) C) D)

Version 1

personalized medicine haplotype association studies loss of heterozygosity karyotyping

9

stumerit@gmail.com

31) Fourcancer patients are treated with an experimental drug.Patients #2 and #4 have an extremely serious adverse reaction to the drug.Another patient (#5) requests to enter the trial and you do not wish to treat this patient if there is any indication that the new patientwill have the same side effect.The haplotypes for the region where the allele that controls this sensitivity has been mapped and the haplotypes for this region for these patients aregiven below.Should you enter patient #5 into the trial?

1: 1A 2B 3C 4B/1A 2B 3A 4C 2: 1A 2C 3B 4B/1B 2A 3B 4A 3: 1B 2A 3A 4B/1C 2B 3A 4A 4: 1B 2C 3B 4B/1A 2B 3A 4C 5: 1A 2B 3A 4C/1B 2A 3B 4A A) No, # 5 shares the 1A haplotype with #2 and #4.

B) Yes, #5 shares no haplotype combinations with #2 and #4.

C) No, # 5 shares the 3B haplotype with #2 and #4.

D) Yes, since there are no shared haplotypes between #2 and #4 these haplotypes are not correlating with the drug sensitivity.

32)

Genome wide association studies are used

A) B) C) D)

.

to identify the mutation that causes a disease to identify single nucleotide polymorphisms that are near disease causing genes to find the total variation that occurs in human genomes to describe the number of alleles for a specific gene

33) You are working in a lab where you are studying a disease that isknown to be caused by a single nucleotide change, although the effect this change ultimately has on the protein's structure/function is unknown. You have DNA samples from multiple patients that you suspect of having this disease. What is the most efficient way to test the samples for the relevant mutation?

Version 1

10

stumerit@gmail.com

A) B) C) D)

Western blotting DNA sequencing Karyotyping Amniocentesis

34) In the United States, most newborns undergo a test for primary congenital hypothyroidism, a condition where people are unable to produce enough thyroid hormone. On a nationwide basis, this is an example of _.

A) B) C) D)

Version 1

genetic testing genetic screening amniocentesis preimplantation genetic diagnosis

11

stumerit@gmail.com

Answer Key Test name: Chapter 22 Test Bank 1) [A, B, C, D] 2) [A, B, D] 3) [A, B] 4) [A, B, D, F] 5) [B, C, E] 6) E 7) B 8) A 9) A 10) D 11) A 12) B 13) C 14) C 15) A 16) A 17) B 18) A 19) B 20) D 21) A 22) C 23) C 24) A 25) A 26) B Version 1

12

stumerit@gmail.com

27) D 28) C 29) D 30) A 31) B 32) B 33) B 34) B

Version 1

13

stumerit@gmail.com

Student name:_ 1) The term for a group of individuals from the same species that can interbreed with one another is A) B) C) D) E)

species. population. race. community. kingdom.

2) If a gene has more than one allele and each allele has a frequency that is less than 99%, then the gene is considered to be A) B) C) D)

monomorphic. polymorphic. biallelic. polyallelic.

3) In a given population of Drosophila, curly wings (c ) is recessive to the wild-type condition of straight wings (c+ ). You isolate a population of 35 curly winged flies, 70 flies that are heterozygous for straight wings, and 45 that are homozygous for straight wings. What is the total number of curly or straight wing alleles in this population?

A) 2 B) 150 C) 230 D) 300 E) None of thesechoices are correct

Version 1

1

stumerit@gmail.com

4) In a given population of Drosophila, curly wings (c ) is recessive to the wild-type condition of straight wings (c+ ). You isolate a population of 35 curly winged flies, 70 flies that are heterozygous for straight wings, and 45 that are homozygous for straight wings. What is the frequency of alleles in this population?

A) 35% c; 45% c+ B) 46.7% c; 53.3% c+ C) 50% c; 50% c+ D) 55% c; 45% c+ E) None of these choices are correct.

5)

The formula p

A) B) C) D) E)

6)

+ 2 pq + q

2

= 1 is associated with which of the following?

calculations of heterozygosity Hardy-Weinberg equilibrium calculations of recombination frequencies degrees of freedom None of these choices are correct.

In the equation p2 + 2pq + q2 = 1, what does the term 2pq represent?

A) B) C) D) E)

7)

2

the genotypic frequency of homozygous recessive individuals the genotypic frequency of homozygous dominant individuals the genotypic frequency of heterozygous individuals the sum of the phenotypic frequencies in the population None of these choices are correct.

Which of the following is NOT an assumption of the Hardy-Weinberg equation?

Version 1

2

stumerit@gmail.com

A) B) C) D) E)

8)

There is no migration into or out of the population.

Individuals of the population mate randomly.

The population size is very large.

Selection favorsthe dominant allele.

There is no mutation occurring in the population.

The term for the mating for two genetically unrelated individuals is A) B) C) D)

outbreeding. inbreeding. disassortative mating. assertive mating.

9) The probability that two alleles will be identical for a given gene in an individual because the alleles are from the same ancestor is estimated by A) B) C) D)

10)

the calculation of average heterozygosity. the Hardy-Weinberg equation. the inbreeding coefficient. the chi-square test.

Genetic drift has the greatest influence on allele frequencies for which population size?

A) B) C) D)

Version 1

small large Genetic drift has the same impact on both large and small populations.

Genetic drift has no effect on the allele frequencies.

3

stumerit@gmail.com

11) A natural disaster that resulted in the loss of genetic diversity in a population would be an example of a A) B) C) D)

founder effect. genetic drift. bottleneck effect. natural selection.

12) Migration of a random few individuals from one population to a new area to establish a new population is an example of A) B) C) D)

bottleneck effect. mutation. founder effect. selection.

13) Given the allele frequency for a gene in population A is 0.3 and the frequency for the same allele in population B is 0.5 and that 25 individuals from A migrate to and mate randomly with the 475 individuals in population B, what is the new allele frequency (PC) in the conglomerate?

A) 0.052 B) 0.2 C) 0.8 D) 0.49

14) Which of the following types of selection favors one extreme of a phenotypic distribution?

Version 1

4

stumerit@gmail.com

A) B) C) D)

disruptive selection stabilizing selection directional selection balancing selection

15) Which of the following types of selection creates two phenotypic classes from a single original distribution?

A) B) C) D)

16)

disruptive selection stabilizing selection directional selection balancing selection

Natural selection occurs when

A) individuals whose phenotypes are best suited forenvironmental conditions have higher reproductive success and contribute more alleles to the next generation.

B) humans breed certain individuals with the most desirable phenotypes.

C) individuals whose phenotypes are best suited forenvironmental conditions have lower reproductive success but live longer.

D) the genotype of an individual does not determine whether or not is has reproductive success.

17)

A SNP would best be described as A) B) C) D) E)

Version 1

a gene that comes in multiple different alleles. a balanced polymorphism system. a single nucleotide difference between two DNA sequences. the least frequent type of mutation.

None of these choices are correct.

5

stumerit@gmail.com

18)

Which type of selection would lead to two distinct phenotypes?

A) B) C) D) E)

stabilizing selection phenotype selection fitness selection disruptive selection directional selection

19) The prevalence of the allele for sickle cell anemia in some populations is an example of which of the following?

A) B) C) D) E)

20)

Which of the following is NOT an assumption of the Hardy-Weinberg equation?

A) B) C) D) E)

21)

heterogeneous environments balancing selection inverted selection non-Darwinian selection nonrandom mating

The population is large.

There is no migration into or out of the population.

There is no selection against a given genotype.

There is no mutation in the gene being studied.

There is nonrandom mating.

Microevolution is defined as

Version 1

6

stumerit@gmail.com

A) B) C) D)

changes in the gene pool from one generation to the next. changes in gene flow from one generation to the next. the ability of different genotypes to succeed in a particular environment. morphological changes that occur from one generation to the next.

22) The mechanism that results in a change in allele frequenciesdue to random processes is known as A) B) C) D)

genetic drift. natural selection. migration. nonrandom mating.

23) Calculate the inbreeding coefficient of an individual given an n of 4 (excluding the inbred offspring) with one common ancestor. The inbreeding of the common ancestor is unknown.

A) 25% B) 3.125% C) 6.25% D) 50%

24)

How does inbreeding affect the Hardy-Weinberg equilibrium?

A) B) C) D)

25)

It makes it more likely for the population to remain inHardy-Weinberg equilibrium.

It has no effect on the Hardy-Weinberg equilibrium.

It results in a higher level of either dominant or recessive homozygotes.

It results in a higher level of heterozygotes.

Horizontal gene transfer occurs

Version 1

7

stumerit@gmail.com

A) B) C) D)

within and between species of eukaryotes and prokaryotes. between prokaryotic species only. between eukaryotic species only. only from prokaryotes to eukaryotes.

26) If in a population the rate of mutation that converts the A allele to the a allele is 10-6 and the current frequency of the A allele is 0.75 and the a allele is 0.25, then the frequency of the A and a alleles in the next generation will be A) A: 0.75a: 0.25 B) A: 0.74999925a: 0.25000075 C) A: 0.75000075a: 0.24999925 D) A: 0.74a: 0.26

27)

Repetitive sequences are useful for DNA fingerprinting becausethey A) B) C) D)

are not inherited and so are unique to every individual. are unique to every individual and change from generation to generation. are inherited and can show significant variability between individuals. never undergo mutation.

28) If the allele frequency of the dominant allele is 0.4, what value is used for the term p2 in the equation p2+ 2pq + q2= 1?

A) 0.4 B) 0.2 C) 0.16 D) 16

Version 1

8

stumerit@gmail.com

29) If two individuals of a population, who vary in their phenotype, preferentially mate, it is called .

A) B) C) D)

Outbreeding Inbreeding Negative assortative mating Positive assortative mating

30) You are preparing to perform DNA fingerprinting by PCR for the first time. Select the reagent that would result in complications in the interpretation of your results.

A) B) C) D)

31)

Which term describes all the alleles of every gene in the population?

A) B) C) D)

32)

PCR primers that anneal to the repetitive region of the microsatellites PCR primers that anneal to regions flanking the microsatellites Human DNA Taq polymerase

conglomerate gene pool polymorphisms genotype frequency

Select the definition of genetic drift.

A) B) C) D)

Version 1

Changes in allele frequencies in a population due to random fluctuations Changes in allele frequencies in a population due to migration Changes in genotype frequencies in a population due to new mutations Changes in genome size in a species due to random mutations

9

stumerit@gmail.com

33) Consider a hypothetical gene B for which there are two alleles in the population. For every ten BB individuals that survive, six Bb individuals survive, and one bb individual survives.

What are the relative fitness values for each genotype?

A) wBB = 1.0; wBb = 0.6 ; wbb = 0.1 B) wBB = 100; wBb = 0.6 ; wbb = 0.01 C) wBB = 0.59; wBb = 0.35 ; wbb = 1.0 D) wB= 26; wb = 7

34) Given a population of 1,000 individuals what is the average number of generations it will take to fix a new mutation assuming no selection for or against the new mutation?

A) 100,000 B) 1,000 C) 4,000 D) 25,000

35) What is the probability of fixation of a gene in a population of 30 individuals (assume no selection for or against a mutation)?

A) 3.3% B) 3% C) 1.67% D) 0.167%

36) What is the frequency of an allele in a conglomerate population if 50 individuals from a population where the allele has a frequency of 0.6 migrates into a population of 450 individuals where the allele frequency is 0.3?

Version 1

10

stumerit@gmail.com

A) 0.3 B) 0.33 C) 0.9 D) 0.18

37)

By what process do new alleles arise?

A) B) C) D) E)

38)

Natural selection Mutation Nonrandom mating Genetic drift Migration

Most natural populations are in Hardy-Weinberg equilibrium. ⊚ true ⊚ false

39) A population with an allele for a gene that constitutes 99% of the alleles in the population means that the population is called monomorphic for that gene. ⊚ true ⊚ false

40)

At equilibrium the allelic and genotypic frequencies of a population change over time. ⊚ true ⊚ false

41)

The probability that a gene will be altered by a mutation is called the mutation rate.

Version 1

11

stumerit@gmail.com

⊚ ⊚

Version 1

true false

12

stumerit@gmail.com

Answer Key Test name: Chapter 23 Test Bank 1) B 2) B 3) D 4) B 5) B 6) C 7) D 8) A 9) C 10) A 11) C 12) C 13) D 14) C 15) A 16) A 17) C 18) D 19) B 20) E 21) A 22) A 23) C 24) C 25) A 26) B Version 1

13

stumerit@gmail.com

27) C 28) C 29) C 30) A 31) B 32) A 33) A 34) C 35) C 36) B 37) B 38) FALSE 39) TRUE 40) FALSE 41) TRUE

Version 1

14

stumerit@gmail.com

Student name:_ 1)

How do quantitative traits arise? (Check all that apply.)

A) the trait.

B) C) D)

2)

The trait is controlled only be a single gene and there is no environmental effect on The trait is polygenic.

The trait is controlled by a single gene and the environment.

The population is inbred with no environmental effect on the trait.

Which of the following is incorrect concerning quantitative traits?

A) B) C) D)

Individuals fall into distinct classes for comparison.

The phenotypic variation for the trait is continuous.

The frequency distribution follows a bell-shaped curve.

All of these choices are correct.

3) Which of the following best describes the degrees of freedom for the calculation of variance?

A) (n + 1) B) 2(n + 1) C) (n - 1)/n D) (n - 1)

4)

The square root of the variance is called the

Version 1

.

1

stumerit@gmail.com

A) B) C) D)

mean standarddeviation standarderror covariance

5) When analyzing two variables, the strength of the association between the variables is called the .

A) B) C) D)

6)

covariance standarddeviation correlationcoefficient variance

What must be true for a correlation coefficient to be calculated between two traits?

A) B) C) D)

The values for the traits must have been obtained from unbiased sampling.

The relationship between the two traits must be linear.

The traits must follow a normal distribution.

All of these choices are correct.

7) In calculations of the degrees of freedom for a correlation coefficient, what value does the degrees of freedom take?

A) (n - 1) B) (n - 2) C) (n - 1)/2 D) 2(n - 1)

Version 1

2

stumerit@gmail.com

8) After calculating a correlation coefficient, you discover that the value is not significant at the 5% level. What can be done that may result in a significant difference?

A) increase the sample size B) decrease the sample size C) Nothing, the value will remain the same regardless of sample size.

9)

Quantitative traits usually have which of the following characteristics?

A) B) C) D)

environmental influence polygenic basis continuous distribution All of these choices are correct.

10) QTL mapping determines the relationship between genes for quantitative traits and which of the following?

A) B) C) D)

11)

the centromere transposon sites structural genes molecular markers such as RFLPs

What must be true regarding the strains of organisms used to construct a QTL map?

A) they must differ for the quantitative trait B) they must differ for the molecular markers C) Both of these choices must be true.

Version 1

3

stumerit@gmail.com

In QTL mapping, the parental strains are crossed and the F 1 generation backcrossed to 12) which of the following?

A) B) C) D)

13)

the F2 generation the parental generation a strain that is homozygous recessive for all markers a wild-type organism

A heritability value of 0.997 indicates which of the following?

A) B) C) D) E)

The majority of the phenotypic variation has a genetic basis.

The majority of the phenotypic variation has an environmental basis.

The trait is polygenic.

There is a significant difference between the two strains.

None of these choices are correct.

14) For a quantitative trait, the total variance of the population is due to which of the following?

A) B) C) D)

15)

The amount of variance due to genetic factors only The amount of variance due to environmental factors only The difference between the variance attributed to genetic and environmental factors The sum of the genetic and environmental variances

Inbreeding reduces which of the following variances to near zero?

Version 1

4

stumerit@gmail.com

A) B) C) D)

16)

genetic variance environmental variance both variances neither variance

Heritability may be calculated as which of the following?

A) B) C) D) E)

the total variance minus environmental variance total variance minus genetic variance genetic variance divided by environmental variance genetic variance divided by total variance None of these choices are correct.

17) After several generations of artificial selective breeding, a plateau is reached where artificial selection is no longer effective. This is called the .

A) B) C) D)

realized limit realizedheritability selectioncoefficient selection limit

18) Which of the following steps is NOT used in conducting a backcross in order to map a QTL?

A) Two inbred strains that differ in a quantitative trait are crossed.

B) The F1 offspring are crossed with each other.

C) The F2 offspring contain different combinations of the parental chromosomes.

D) By using genetic markers, it is determined which parent each chromosome came from and thus genes are identified.

Version 1

5

stumerit@gmail.com

19) If the difference between the mean of the parents and the mean of the starting population is 1.0 and the difference between the mean of the offspring and the mean of the starting population is 0.45 then the realized heritability is

A) B) C) D)

1.45 2.22 0.45 0.55

20) Calculate the mean plant height, the variance and the standard deviation for 10 plants that have the following heights: 5 cm, 6 cm, 6 cm, 7 cm, 7 cm, 7 cm, 8 cm, 9 cm, 9 cm, and 10 cm.

A) B) C) D)

mean: 7.4 cm variance: 2.5 cm2 standard deviation: 1.6 cm mean: 7 cm variance: 3.5 cm2standard deviation: 1.9 cm mean: 7.4 cm variance: 2.5 cm2 standard deviation: 1.9 cm mean: 7.5 cm variance: 3.5 cm2standard deviation: 1.6 cm

21) Calculate the narrow sense heritability for a grandparent-grandchild relationship when the observed correlation coefficient is 0.2.

A) 0.8 B) 0.4 C) 1.25 D) 2.5

22) Calculate the narrow-sense heritability of height between aunts and nieces if the observed phenotypic correlation coefficient is 0.1.

Version 1

6

stumerit@gmail.com

A) 0.4 B) 2.5 C) 4 D) 0.25

23) A selective breeding program is trying to develop an agricultural plant with decreased stem length to aid in mechanical harvesting. The mean stem height of the population is 36 cm while the mean stem height of the parents is 30 cm and the mean stem height of the offspring is 33 cm. What is the realized heritability for stem height in this crop?

A) 0.5 B) 1 C) .33 D) 0

24) The heights of mothers and their female children are measured (in inches) with the following results Height of mother

Height of offspring at maturity

64

72

56

63

63

62

67

61

71

74

70

69

78

70

65

70

24.1)

Version 1

What is the mean height for the mothers and daughters?

7

stumerit@gmail.com

A) B) C) D)

24.2) A) B) C) D)

24.3) A) B) C) D)

Mothers: 66.75 inDaughters: 67.63 in Mothers: 65.75 inDaughters: 67.63 in Mothers: 66.75 inDaughters: 66.52 in Mothers: 65.67 inDaughters: 66.45 in

What is the variance for the mother's and daughter's heights?

Mothers: 42.21 in2Daughters: 24.27 in2 Mothers: 41.32 in2Daughters: 23.71 in2 Mothers: 43.78 in2Daughters: 24.27 in2 Mothers: 42.21 in2Daughters 23.78 in2

What is the standard deviation for the mother's and daughter's heights?

Mothers: 6.50 inDaughters: 4.93 in Mothers: 1781.68 inDaughters: 589.03 in Mothers: 42.21 inDaughters: 24.27 in Mothers: 5.50 inDaughters: 5.93 in

25) Heritability is the amount of genetic variation in a particular population and a particular environment. ⊚ ⊚

true false

26) Heritability values can be compared between populations if there is variation in the environmental conditions. ⊚ ⊚

Version 1

true false

8

stumerit@gmail.com

27)

A trait that varies measurably in a species is called a discontinuous trait. ⊚ true ⊚ false

28)

Traits that fall into discrete categories are called continuous traits. ⊚ ⊚

true false

29) Since quantitative traits are frequently associated with a number of genes and the environment, it is difficult to assign accurate phenotypic classes for a Punnett square diagram. ⊚ ⊚

true false

30) The sum of all of the values for a trait, divided by the total number of individuals, is called the standard deviation. ⊚ ⊚

true false

31) The variance is the sum of the standard deviation from the mean divided by the degrees of freedom. ⊚ true ⊚ false

32)

QTL stands for quantitative trait locus and may contain more than one gene.

Version 1

9

stumerit@gmail.com

⊚ ⊚

true false

33) The amount of phenotypic variation in a group that is due to genetic variation is called heritability. ⊚ ⊚

true false

34)

A population that is homozygous for a given allele is called monomorphic. ⊚ true ⊚ false

35)

Many organisms used in modern agriculture are a result of artificial selection. ⊚ ⊚

36)

The process of mating between genetically unrelated individuals is called inbreeding. ⊚ ⊚

37)

true false

true false

Realized heritability may be determined from artificial selection experiments. ⊚ true ⊚ false

38) If a completely inbred population shows phenotypic variance, then that variance is caused by environmental effects.

Version 1

10

stumerit@gmail.com

⊚ ⊚

Version 1

true false

11

stumerit@gmail.com

Answer Key Test name: Chapter 24 Test Bank 1) [B, C] 2) A 3) D 4) B 5) C 6) D 7) B 8) A 9) D 10) D 11) C 12) B 13) A 14) D 15) A 16) D 17) D 18) B 19) C 20) A 21) A 22) A 23) A 24) Section Break 24.1) A 24.2) A Version 1

12

stumerit@gmail.com

24.3) A 25) TRUE 26) FALSE 27) FALSE 28) FALSE 29) TRUE 30) FALSE 31) TRUE 32) TRUE 33) TRUE 34) TRUE 35) TRUE 36) FALSE 37) TRUE 38) TRUE

Version 1

13

stumerit@gmail.com