Skip to main content

AWT 2021 Technology Supplement

Page 1

1300 Piccard Drive, Suite LL 14 • Rockville, MD 20850

Fall 2021

Can Nonionic Surfactant Treatment Improve Heat Transfer and Lower Energy Use in Water Systems? Can a Biobased Additive Improve Performance and the Environmental Profile for Cooling Tower Formulations? Can EDTA/Thiosulfate Neutralize Copper/Silver Biocide Metal Toxicities in Samples When Testing Building Water for Legionella? Can a Novel Colloidal Adsorbent Material and Robust Separation Process Improve PFAS Removal? How DNA Sequencing Can Aid Integrated Microbiome Management in Water Systems

Published by


COVER Inside of a boiler room. Photo courtesy of iStockphoto.com.

Fall 2021

Technology Supplement 2021

Table of Contents 8 Can Nonionic Surfactant Treatment Improve Heat Transfer and Lower Energy Use in Water Systems?

Dale Edginton, Endo Enterprises (UK) Ltd., and Will Wilson, Pace Solutions According to the Environmental and Energy Study Institute, commercial and residential buildings account for 39% of all North American greenhouse gas emissions. Space heating represents the largest end-use in buildings, consuming more than 7 trillion Joules of energy in the United States alone. Hydronic systems are the most common space heating system used in the higher latitudes. The use of surfactant additives to improve heat transfer in hydronic systems has been heavily investigated over the past 30 years as part of passive heat transfer technology. This focus has initially been on the impact of additives on heat transfer in desalination due to the low stability of most surfactants. Recently, advancements in nonionic surfactant technology have created a new method to enhance hydronic heat transfer, improve energy efficiency, and lower greenhouse gas emissions.

16 Can a Biobased Additive Improve Performance and the Environmental Profile for Cooling Tower Formulations?

Frederyk Ngantung, Ph.D., and LoongYi Tan (Solugen Inc.) One of the defining themes of the 21st century is the impact of industrial activity on climate and the environment. The water treatment industry has been and will continue to be a leader in the movement toward mitigating environmental damage. The environmental profile of water treatment products has been improving from the days of chromate treatments to the metal- and phosphorus-free products that are gaining acceptance today. However, the challenge resides in finding materials and processes that are environmentally friendly and cost-effective without compromising performance. This article will examine various properties of water treatment actives produced by a novel chemoenzymatic process that address this challenge.

23 Can EDTA/Thiosulfate Neutralize Copper/Silver Biocide Metal Toxicities in Samples When Testing Building Water for Legionella?

Richard D. Miller, Ph.D., Environmental Safety Technologies, Inc. and School of Medicine at the University of Louisville; and Brandon Smith, Environmental Safety Technologies, Inc. Water samples collected for culture detection of Legionella generally have an added reducing agent, such as sodium thiosulfate, to neutralize chlorine or other halogen disinfectant residuals and prevent bactericidal action. However, disinfectant residuals in potable water from coppersilver (Cu/Ag) ionization secondary disinfection systems may require different sample preservation approaches to neutralize copper and silver disinfectant residuals. A comprehensive study by Resgalla et al. has shown that EDTA effectively removed metal toxicity of copper in water. This study evaluated the ability of EDTA/thiosulfate formulas to neutralize the metal toxicity of water from buildings that are using a Cu/Ag secondary disinfection system, without a toxic effect on any Legionella in the samples.

34 Can a Novel Colloidal Adsorbent Material and Robust Separation Process Improve PFAS Removal?

Terence K. Reid, David Holland, and Joseph Campanaro (Aqua-Aerobic Systems, Inc.), and Joseph Quinnan (Arcadis) A series of field tests was conducted using an innovative sorbent material to remove per- and polyfluoroalkyl substances (PFAS) from various water sources. Unit adsorption rates of the sorbent media were compared with measured and reported values for granular activated carbon (GAC) using similar breakthrough targets. The studies revealed that PFAS adsorption rates were as much as 500 to 1,000 times higher than those of GAC. The novel sorbent material was also more effective in removing smaller-chain PFAS compounds compared to GAC. This technical article reviews the elevated PFAS removal, reduced sorbent demand, and optimized replacement approach that result in significantly less operation and maintenance costs than a GAC system.

42 How DNA Sequencing Can Aid Integrated Microbiome Management in Water Systems

Alison Ling, Ph.D., P.E., Barr Engineering Co., and John Tillotson, M.S.C.E., WaterTrust Existing culture-based methods that are used to evaluate water system microbiology miss more than 99% of the microbes present. This is because less than 1% of microbe types can be grown in a lab using culture methods much of the industry relies on (1). Thanks to molecular methods, we have a better than ever understanding of the microbial world around us. By applying a combination of DNA-based methods, water systems can be characterized in a way that has previously been unavailable to industry in terms of how many and what types of microbes are present. 16S and 18S ribosomal ribonucleic acid (rRNA) qPCR, and amplicon sequencing can characterize nearly all the microbes in a system and approximate their quantity. 3 the ANALYST Technology Supplement 2021


1300 Piccard Drive, Suite LL 14 Rockville, MD 20850 (301) 740-1421 • (301) 990-9771 (fax) www.awt.org

2022 AWT Board of Directors President

Matt Jensen, CWT

Calendar of Events

Association Events 2022 Technical Training Seminars, West February 23–26, 2022 Hyatt Regency Lake Washington Seattle, Washington

President-Elect

Stephen C. Hallier, CWT

Secretary

Noah Baskin

2022 Technical Training Seminars, East

Treasurer

March 30–April 2, 2022 Cleveland Marriott Downtown at Key Tower Cleveland, Ohio

John D. Caloritis, CWT

Immediate Past President

Michael Bourgeois, CWT

Directors

2022 Business Owners Meeting

Lee Browne Mark Coldren, CWT Kyle Rossi, CWT Fred Shurtz

Ex-Officio Supplier Representative

September 20, 2022 Pan Pacific Vancouver Hotel Vancouver, Canada

Past Presidents

2022 Annual Convention & Exposition

Pam Simmons

Jack Altschuler John Baum, CWT R. Trace Blackmore, CWT, LEED AP Michael Bourgeois, CWT D.C. “Chuck” Brandvold, CWT Thomas Brandvold, CWT Brent W. Chettle, CWT Dennis Clayton Bernadette Combs, CWT, LEED AP Matt Copthorne, CWT James R. Datesh John E. Davies, CWT Jay Farmerie, CWT Gary Glenna Charles D. Hamrick Jr., CWT Joseph M. Hannigan Jr., CWT

Mark R. Juhl Brian Jutzi, CWT Bruce T. Ketrick Jr., CWT Bruce T. Ketrick Sr., CWT Ron Knestaut Robert D. Lee, CWT Mark T. Lewis, CWT Steven MacCarthy, CWT Anthony J. McNamara, CWT James Mulloy Alfred Nickels Scott W. Olson, CWT William E. Pearson II, CWT William C. Smith Marc Vermeulen, CWT David Wagenfuhr Casey Walton, B.Ch.E, CWT Larry A. Webb

Staff

Executive Director Heidi J. Zimmerman, CAE Deputy Executive Director Sara L. Wood, MBA, CAE Senior Member Services Manager Angela Pike Vice President, Meetings Grace L. Jan, CMP, CAE Meetings Planner Caroline Bentley Exhibits and Sponsorship Manager Brandon Lawrence Senior Director, Creative Services/Marketing Jennifer Olivares Marketing Coordinator Mary Claire Gordon Managing Editor Lynne Agoston Production Manager Maryia Alenchyk Director of Accounting Services Dawn Rosenfeld

The Analyst Staff

Publisher, Heidi J. Zimmerman, CAE Managing Editor, Lynne Agoston Production Manager, Maryia Alenchyk Technical Editor Michael Henley, mdhenleywater@gmail.com, (303) 745-3890 Advertising Sales Manager Carol Nettles, cnettles@awt.org

The Analyst is published quarterly as the official publication of the Association of Water Technologies. Copyright 2021 by the Association of Water Technologies. Materials may not be reproduced without written permission. Contents of the articles are the sole opinions of the author and do not necessarily express the policies and opinions of the publisher, editor or AWT. Authors are responsible for ensuring that the articles are properly released for classification and proprietary information. All advertising will be subject to publisher’s approval, and advertisers will agree to indemnify and relieve publisher of loss or claims resulting from advertising contents. Editorial material in the Analyst may be reproduced in whole or part with prior written permission. Request permission by writing to: Managing Editor, the Analyst, 1300 Piccard Drive, Suite LL 14, Rockville, MD 20850, USA. Annual subscription rate is $100 per year in the U.S. (4 issues). Please add $25 for Canada and Mexico. International subscriptions are $200 in U.S. funds.

September 21–24, 2022 Vancouver Convention Centre Vancouver, Canada

2023 Annual Convention & Exposition

October 4–7, 2023 Amway Grand Hotel and Grand Rapids Convention Center Grand Rapids, Michigan

Also, please note that the following AWT committees meet on a monthly basis. All times shown are Eastern Time. To become active in one of these committees, please contact us at (301) 740-1421. Second Tuesday of each month, 11:00 am – Legislative/Regulatory Committee
 Second Tuesday of each month, 2:30 pm – Convention Committee Second Wednesday of each month, 11:00 am – Business Resources Committee Second Friday of each month, 10:00 am – Special Projects Subcommittee
 Second Friday of each month, 11:00 am – Cooling Subcommittee
 Second Friday of each month, 2:00 pm – Pretreatment Subcommittee
 Third Monday of each month, 9:00 am – Certification Committee
 Third Monday of each month, 3:30 pm – Young Professionals Task Force Third Tuesday of each month, 3:00 pm – Education Committee
 Third Friday of each month, 9:00 am – Boiler Subcommittee
 Third Friday of each month, 10:00 am – Technical Committee Quarterly (call for meeting dates), 10:00 am – Wastewater Subcommittee

Other Industry Events

ASHRAE, AHR Expo, January 31–February 2, 2022, Las Vegas, Nevada BOMA, Winter Business Meeting, February 6–9, 2022, Washington, D.C. CTI, Annual Conference, February 6–10, 2022, Houston, Texas AMPP, Corrosion Risk Management Conference, March 6–10, 2022, San Antonio, Texas ACS, Spring National Meeting & Expo, March 20–27, 2022, San Diego, California WQA, Convention and Expo, April 6–8, 2022, Orlando, Florida AWWA, Annual Conference & Expo, June 12–15, 2022, San Antonio, Texas ASHRAE, Annual Conference, June 25–29, 2022, Toronto, Canada BOMA, International Conference and Expo, June 25–29, 2022, Nashville, Tennessee ASHE, Annual Convention & Expo., July 17–20, 2022, Boston, Massachusetts ACS, Fall National Meeting & Expo, August 21–25, 2022, Chicago, Illinois WEFTEC, Annual Exhibition and Conference, October 8–12, 2022, New Orleans, Louisiana IWC, Annual Conference, November 6–10, 2022, Orlando, Florida RETA, Annual Convention, November 7–10, 2022, Reno, Nevada

4 the ANALYST Technology Supplement 2021


President’s Message

By Matt Jensen, CWT

As we continue to deal with water quality and water scarcity issues, employing new technologies will be critical. In our industry, water treatment professionals must be up on the latest advances in our field. The articles in this Technology Supplement will cover some new advances in water technology, including nonionic surfactant treatment and novel developments in PFAS removal. This is great information for water treatment professionals. The articles offer you tips, advice, and knowledge that will help you and your businesses succeed. We hope you find this information helpful. As always, I welcome your feedback and can be reached at president@awt.org.

The Lost Art of Research and the Key to Water Technology Advancement It has been said that treatment technologies used in the water industry advance at a “glacial pace.” There is truth in that comment. While there have been changes in different monitoring systems because of advancements in computer and other microelectronic technologies, the basic framework of water treatment equipment has not changed much in recent decades. Of course, reverse osmosis (RO) membranes have evolved over the years, but the basic concept remains the same: pumps, pressure vessels, and RO elements. Likewise, ion exchange (IX) resins have been improved, and a variety of resins for specialty contaminant removal are now available, but the basic concepts around which the technology developed in the later 1930s and, in particular, the 1940s, still stand. In the case of RO and IX, today’s new equipment that packages the technologies sports some of the new automation technologies and nice packaging, but the inner workings have not changed much. The same observations can be made about other treatment methods—ultrafiltration, microfiltration, cartridge filters, activated carbon, chemical feed pumps, ultraviolet, and specialty treatment chemicals. But the truth is, these different treatment technologies still work well for treating water. The key is understanding that water treatment is as much an art as a science, and the professional water treater’s role is understanding the local water quality conditions and how best to employ the utensils available in the “treatment tool box.” That said, research and technology development are keys to the future of the water industry. While existing approaches can work well. There are external forces pushing the industry to find new methods for treating water and ways that better remove contaminants for the protection of human health, the environ-

By Mike Henley, MD Henley & Associates

ment, end-user requirements, and energy savings. Here are a few examples. •

Energy efficiency. This is a general term that encompasses making treatment more efficient so that it uses less power while achieving an equivalent water quality. One example is the effort to make RO more energy efficient, particularly in desalination plants.

•

Broadening contaminant removal capabilities and changing water treatment requirements. Here, part of the push is for treatment technologies capable of removing contaminants that present new or growing concerns to human health or the environment. Examples include perand polyfluoroalkyl substances (PFAS), lead, and arsenic.

•

Water conservation/reuse is not a universal driver, but particularly in arid and semi-arid regions, the need to use less water or to reuse or repurpose waste streams is impacting water treatment needs.

•

Regulatory changes also are impacting water treatment dynamics. This is particularly true when lawmakers pass legislation that focuses on changing treated water quality requirements for drinking water and wastewater effluent. Normally, the U.S. Environmental Protection Agency is then charged with enforcing new or updated laws, such as the Clean Water Act and Safe Drinking Water Act. Of course, regulatory changes can impact treatment protocols at drinking water and wastewater utilities, industrial plants, and other water users. But, it can also create demands for new products for use in homes and small commercial facilities. Examples include removal of contaminants such as nitrates/nitrites, PFAS, lead, and arsenic, among others.

5 the ANALYST Technology Supplement 2021


The Lost Art of Research and the Key to Water Technology Advancement

continued

Fall Supplement

3. Can EDTA/Thiosulfate Neutralize Copper/Silver Biocide Metal Toxicities in Samples When Testing Building Water for Legionella? Richard D. Miller, Ph.D., and Brandon Smith report on work to improve the accuracy of test samples from potable building water systems for the presence of Legionella and other microbials when copper-silver (Cu/Ag) ionization secondary disinfection is used.

All of these and other factors support the need for water treaters to keep abreast of new developments impacting the water business. In this Technology Supplement, we have technical articles on five timely areas in which the authors discuss the advancement of different aspects of water treatment. Here are brief introductions to those articles:

4. Can a Novel Colloidal Adsorbent Material and Robust Separation Process Improve PFAS Removal? Terence K. Reid, David Holland, Joseph Campanaro, and Joseph Quinnan examine whether a new sorbent material and associated treatment system will more effectively remove PFAS contaminants from water.

1. Can Nonionic Surfactant Treatment Improve Heat Transfer and Lower Energy Use in Water Systems? Dale Edginton and Will Wilson look at the use of a surfactant technology to improve heat transfer and conserve energy in hydronic HVAC systems. 2. Can a Biobased Additive Improve Performance and the Environmental Profile for Cooling Tower Formulations? Authors Frederyk Ngantung, Ph.D., and LoongYi Tan look at the development of a new chemoenzymatic process for making cooling water treatments that are more environmentally friendly.

5. How DNA Sequencing Can Aid Integrated Microbiome Management in Water Systems. Alison Ling, Ph.D., and John Tillotson examine DNA and similar testing approaches and how to take advantage of using methods for rapid responses on the presence of microbial contaminants when compared to traditional laboratory culture methods that can take multiple days or even weeks to yield their results.

People crafted solutions since 1976.

Custom Blender. super savvy. Our people blend solutions, not chemicals. We manufacture a broad line of proven products for treating any size of commercial or industrial boiler, cooling water, closed loop, airwasher, or wastewater systems. › Expert Technical Assistance › Biocide Sub-registrations Available › Private Labeling, Product Bulletin and SDS Services › Water, Deposits and Corrosion Coupon Analysis › PTSA Dye Trace Cooling Products

Request a FREE CONSULTATION before your next project

423.698.7777 | BrowneLabs.com 6 the ANALYST Technology Supplement 2021


Products available right away, when you need them most.

COOLING TOWER CONTROLLER Get simple, reliable and acccurate control of conductivity, pH, ORP and more.

TOROIDAL SENSOR Factory calibrated for the life of the probe and maintenance free to save you time and money.

PULSALINK COMMUNICATIONS Cloud managed controller with mobile access to live reports, settings and notifications anytime, anywhere.

MicroVision EX controllers make life simpler. Worry less about installation, programming and future maintenance. And do more through water conservation and lowering costs. With MicroVision EX, less equals more.

PULSAtron electronic metering pumps are reliable and accurate. The PULSAtron Series of pump features a premium construction with few moving parts and highly reliable electronics.

ROBUST Robust design keeps your pump operating for years with minimual maintenance.

SAFETY The accompanying bleed valve assembly ensures easy priming and leak free assurance.

Learn more at pulsatron.com or call 941-575-3880.

NSF 61 CERTIFIED Tested and Certified by WQA against NSF/ANSI 61 & 372. PVDF and PVC Degassing Head Pumps.


Can Nonionic Surfactant Treatment Improve Heat Transfer and Lower Energy Use in Water Systems? Dale Edginton, Endo Enterprises (UK) Ltd., and Will Wilson, Pace Solutions

Background

Hydronic systems are the most common space heating system used in the higher latitudes. The use of surfactant additives to improve heat transfer in hydronic systems has been heavily investigated over the past 30 years as part of passive heat transfer technology (2–6). This focus has initially been on the impact of additives on heat transfer in desalination due to the low stability of most surfactants.

According to the Environmental and Energy Study Institute (EESI), commercial and residential buildings account for 39% of all North American greenhouse gas (GHG) emissions. Space heating represents the largest end-use in buildings, consuming more than 7 trillion Joules of energy in the United States alone (1).

Recently, advancements in nonionic surfactant technology have created a new method to enhance hydronic heat transfer, improve energy efficiency, and lower GHG emissions. The water treatment significantly improves heat transfer and reduces hydronic system energy consumption by up to 15%. Utility providers are starting to recognize the energy saving impacts of nonionic surfactants with the creation of energy-efficiency rebates in the U.K., Ireland, and Canada.

As the consumer demand for energy increases, the impact on the environment and the need for energy conservation has increased efforts to develop new sources of energy as well as improve energy efficiency. Environmental experts have long identified commercial and residential buildings as a target for these conservation efforts.

8 the ANALYST Technology Supplement 2021


Introduction

The addition of surfactants results in the interfacial properties of the solution, such as surface tension (both dynamic and equilibrium surface tension), being lowered. Surfactants are generally known to reduce the surface tension of many solvents, especially water (surface tension of water, 𝛾=71.97𝑁/m at 25 ºC), even by the addition of minute (parts per million [ppm]) quantities of surfactants, yet not have a significant effect on other thermophysical properties of water. To be suitable for hydronic heating systems, the surfactant must possess the important properties affecting the ultimate efficiency of a boiler heating system (i.e., the heat flux, surface tension, solubility, concentration, and viscosity). Heat flux is directly related to the production of nucleation sites for enhanced heat transfer; thus, more stable heat fluxes attribute to the formation of more nucleation sites (2, 7). Surface tension, on the other hand, controls nucleation sites by bubble formation. Lowering of surface tension facilitates and speeds up bubble formation and influences the size of bubbles as well as the departure diameter (8, 9). Thus, additives must have a significantly lower surface tension than water, and to have a meaningful impact on enhancing the heat flux, the additive must also be effective at very low concentrations. High concentrations may adversely change the physical properties (i.e., increase viscosity) of the system, to the detriment of system efficiency. Significant increases in the heat transfer coefficient of the system have been reported with the addition of ionic surfactants, even at very low concentrations (7, 10, 11). Heat transfer efficiency of a system can be enhanced by choosing a suitable system that effectively wets the walls of the container and can provide very high heat transfer coefficients at low temperatures (12). Hetsroni, et al. (5, 13, 14) found a significant decrease in the bubble size and an increase in the heat transfer coefficient in saturated boiling of surfactant solutions during pool boiling experiments. They reported different behavior in the formation of bubbles in the absence and presence of a surfactant (Figure 1). Figure 1: Growth of steam bubble in (a) pure water and (b) surfactant 600pm solution on a flat surface in a liquid at saturated boiling (Reference 14).

Unfortunately, the environmental concerns surrounding several ionic surfactants studied for application in heat transfer systems rendered them unsuitable for use on large commercial scales due to toxicity and being nonbiodegradable. The focus has therefore been to obtain environmentally friendly and temperature-insensitive surfactants that are sustainable and recyclable. Several reports have identified improvements in heat transfer created in water boiler systems from a nonionic surfactant, “green chemicals,” as they are nontoxic at low concentrations and anticorrosive (6, 9, 14, 15). This solution is also less sensitive to temperature change compared to other widely available surfactants. In 2019, researchers from Tsinghua University (Beijing, China) and Brown University (Providence, Rhode Island) used a solvent (surfactant) to boost the capacity of a common water-based turbulent heat exchange system by 500%.

Chemical Analysis of Nonionic Surfactant

A chemical analysis was conducted by the University of West Scotland to quantify the nonionic surfactant constituent products, identify their thermal property changes, and log their impact on heat transfer efficiency (17). The surface tension was measured using a K11 Kruss Force tensiometer using a standard rod with a diameter of 2 millimeters (mm) and a length of 10 mm. The rod was immersed in the liquid to a depth of 2 mm with a surface detection speed of 10 millimeter per minute (mm/min). Five measurements were taken at 20 °C using a linear data acquisition mode, and the mean surface tension values were recorded (Table A) (17). Table A: Surface Tension of Nonionic Surfactant Solution Compared to Water and Pure UHQ Water Sample

Mean Surface Tension (mN/M)

Water (from tables)

71.97

Pure UHQ Water

71.85

Nonionic surfactant (dosed at 1% concentration)

28.99

The surface tension of the nonionic surfactant dosed at 1% can be seen to reduce the surface tension of water by more than 60%. Other surfactants were also tested as part of the service company’sA competitor analysis/product improvement, and none were able to reduce the surface tension beyond the nonionic surfactant product at low concentrations.

“The focus has therefore been to obtain environmentally friendly and temperatureinsensitive surfactants that are sustainable and recyclable.” 9 the ANALYST Technology Supplement 2021


Can Nonionic Surfactant Treatment Improve Heat Transfer and Lower Energy Use in Water Systems? continued

Corrosive Impact of Nonionic Surfactant on Water

Another analysis by LPD Lab Services looked at the change in surface tension of nonionic surfactant at different concentrations using the Wilhelmy plate method on a Data Physics DCAT 21 tensiometer (17). This showed that 1% is the critical micelle concentration that has the biggest impact on water surface tension (Table B) (18).

The anti-corrosive nature of nonionic surfactants was revealed in the International Journal of Electrochemical Science in 2011 (19). The specific effect of nonionic surfactants within hydronic heating systems has been thoroughly investigated by independent investigators.

Table B: Results of Surface Tension Measurements by LPD Lab Services Dilution %

Surface Tension 1 (mN/m)

Surface Tension 2 (mN/m)

Mean Surface Tension (mN/m)

100

28.7

28.9

28.8

10

28.8

28.7

28.8

2

27.6

27.4

27.5

1

27.1

27.1

27.1

0.5

30.4

29.5

29.9

0.2

35.7

34.6

35.1

Compatibility of Nonionic Surfactant With Common System Materials

Nonionic surfactant dosed water (1%) has been tested by Meadowhead Consultancy against hard/soft water using test protocols set out by the NSF International (formerly BuildCert Chemical Approval Scheme CIAS) for testing corrosion inhibitors and other hydronic additives (20). Conducted over 21 days, this laboratory evaluation looks at the pitting and corrosion rates of nonionic surfactants (compared with hard and soft water) in contact with aluminum, mild steel, stainless steel, brass, and copper. The hard water had a total hardness of 342 milligrams per liter (mg/L) calcium carbonate (CaCO3). The soft water had a total hardness of 36 mg/L CaCO3. This data is shown in Tables D and E.

Impact of Nonionic Surfactant

Dosed at 1%, a nonionic surfactant has minimal impact on the majority of water’s physical properties (Table C). Table C: Physical Properties of Water Using Nonionic Surfactant-Dosed Water (1%) and Glycol-Dosed Water (35%) Physical Property

Water

Nonionic Surfactant

Glycol

Density (g/cm3)

1

1.005

1.035

Viscosity (cP)

1

1.1

4.2

Table D: Comparison of Corrosion Rates of Nonionic Surfactants in Hard Water With Untreated Hard Water

Material

Weight Difference Surfactant

Corrosion Rate C Surfactant mm/ year

Weight Difference Untreated Hard Water

Corrosion Rate C Untreated Hard Water

Corrosion Limit mm/year

A

Mild Steel

DC 01

46.3

0.057

78.15

0.097

0.040

B

Copper

Cu CW024

0

0

11.37

0.012

0.005

C

Aluminum

AL6082

0

0

1.98

0.007

0.100

D

Brass

CW505L

0

0

22.29

0.025

0.005

E

Stainless Steel

1.4307

0

0

2.77

0.003

0.002

F

Balance

1.4307

0

0

2.74

0.003

0.002

Table E: Comparison of Corrosion Rates of Nonionic Surfactants in Soft Water With Untreated Soft Water

Material

Weight Difference Surfactant

Corrosion Rate C Surfactant mm/year

Weight Difference Untreated Soft Water

Corrosion Rate C Untreated Soft Water

Corrosion Limit mm/year

A

Mild Steel

DC 01

125.6

0.156

153.32

0.097

0.040

B

Copper

Cu CW024

0.1

0.001

10.54

0.012

0.005

C

Aluminum

AL6082

15.2

0.055

71.25

0.007

0.100

D

Brass

CW505L

2.9

0.003

18.55

0.025

0.005

E

Stainless Steel

1.4307

0

0

2.92

0.003

0.002

F

Balance

1.4307

0.6

0.0007

2.66

0.003

10 the ANALYST Technology Supplement 2021


Can Nonionic Surfactant Treatment Improve Heat Transfer and Lower Energy Use in Water Systems? continued

“A chemical analysis was conducted by the University of West Scotland to quantify the nonionic surfactant constituent products, identify their thermal property changes, and log their impact on heat transfer efficiency.”

Compatibility of Nonionic Surfactant With Corrosion Inhibitors The compatibility of nonionic surfactant with leading brand Molybdate (Fernox MB-1) and Nitrite (Corrshield MD4100) nonionic surfactant is not a replacement for traditional water treatment or corrosion inhibitors, but its nonionic nature does not negatively impact on the corrosion protection afforded by these chemistries (21, 22).

Compatibility of Nonionic Surfactant With Glycol Anti-Freeze Protection

Glycols are commonly used in the higher latitudes as ambient temperatures fall below freezing. The impact of a nonionic surfactant on propylene glycol’s freeze protection was analyzed by Maxim Chemical International (23). A glycol refractometer was used to compare freeze point protection before and after heating systems (Table F). Table F: Glycol Refractometer Readings, Before and After Heating and Freezing Cycles Room Temperature.

After Heating

After Freezing

Without surfactant

-21 ºC

-21 ºC

-24 ºC

With surfactant

-22 ºC

-21 ºC

-26 ºC

Sample

The sample with nonionic surfactant required slightly less energy to stay at a higher temperature. It also provided slightly better freeze protection than the sample without nonionic surfactant and did not freeze at the glycol’s designed temperature.

Case Study 1: Enertek International Ltd.

This investigative report was set up by ISO17025 test house Enertek International (24) to establish if adding a prescribed amount of surfactant to water of a typical boiler heating system can result in a reduction in gas consumed by the heating boiler. The rig used a new Bosch Greenstar 21i (condensing and modulating) gas combination boiler with two new standard double panel radiators situated inside a thermal chamber (itself within a thermally controlled lab) to establish a set ambient. The system was set up to maintain a thermostatic set temperature for 24 hours with interval data recorded on multiple flow and room/ unit temperatures. All equipment was calibrated to UKAS industry standards as shown in Table G.

Test 1: Water Only (system maintained at 27.5 °C) Test 2: Nonionic Surfactant Dosed (system maintained at 27.5 °C) Table G: Results from Enertek E3363 Report Variable

Test 1 (Water)

Test 2

Difference (%)

Ambient Temp (ºC)

27.5

27.5

--

Total gas consumption (m3)

5.41

4.59

15.2

Number boiler cycles

50

42

16

Average boiler flow temp (ºC)

49.56

49.54

0.03

Average boiler return temp (ºC)

38.81

36.80

5.47

Average ΔT (ºC)

10.75

12.75

15.64

Average boiler flue temp (ºC)

42.97

41.39

3.82

Average room ambient (ºC)

27.52

27.49

0.12

When operated under the test conditions, the addition of a nonionic surfactant solution to the heating system water resulted in a reduction on the gas consumed by the heating boiler of up to 15% within the 24-hour test period. The test showed that the control variables (boiler flow and room ambient temperature) were tightly controlled so the reduction in gas consumption was not at the expense of comfort conditions (energy efficiency over energy saving). The report showed an increase in the system delta T (ΔT) of 15.64% and a reduction in the boiler flue temperature as a result of a lower boiler return temperature (Figure 2). It is worth noting that both boilers’ return temperatures were well below the 55 °C dew point temperature required for condensing systems to recover latent heat. Analysis of the raw data (30-second intervals) showed that the boiler was firing for 14,520 seconds (16.8%) of the time with water and 12,090 seconds (14%) of the time with nonionic surfactant. It is also worth noting the reduction of cycles (16% from 50 to 42). The raw data showed that heat was being liberated from the radiators into the room at a higher rate, allowing the boiler to modulate down sooner, thus reducing overall run times. Based on this result, Enertek International has supplied a declaration of product performance to confirm the performance of a nonionic surfactant, which has proven to save up to 15% on closed-loop boiler heating systems.

Case Study 2: Novator Report

This report was conducted by the Scientific Product Centre ‘Novator’ Ltd. (25) to validate the claims of nonionic surfactant partners in the Ukraine. A small test rig (using a 2 kilowatt [kW] power strip and small double panel radiator) was set up with a room with set ambient temperature of 7 °C (Figure 3). 11 the ANALYST Technology Supplement 2021


Can Nonionic Surfactant Treatment Improve Heat Transfer and Lower Energy Use in Water Systems? continued

Figure 2: Change in boiler return temperature.

Measurements were made on the equipment of the research laboratory of the department “Methods and Devices for Quality Control and Product Certification” at Ivano-Frankivsk National Technical University of Oil and Gas. The radiator, in the experiment conditions and in the course of its normal work as a heating element in the premises, operates in the "heating-cooling" cycle modes. The room temperature is maintained constant, and the conditions of heat exchange between the outer surface of the radiator and the external environment (air in the laboratory) are immutable. This environment was deemed suitable enough to assume that the temperature on the outside of the radiator will depend only on the temperature of the coolant and the conditions of heat transfer from the coolant to the internal radiator surface. Figure 3: Test rig from Novator report.

By analyzing the rate of change in temperature on the outside of the radiator—if the heat exchange area is unchanged—it is possible to conclude that the nonionic surfactant additive influences the heat exchange between the heat carrier (water), the inside surface temperature of the radiator, and the heat transfer coefficient. The study showed the heating of the outside surface of the radiator was 4.7x10-3 °С 𝑠𝑒𝑐 faster once nonionic surfactant was installed.

The study also showed the cooling of the outside surface of the radiator was 1.76x10 −3°С 𝑠𝑒𝑐 faster once a nonionic surfactant was used. A nonionic surfactant allows the intensification of the heat exchange between the coolant and the air environment in the room where there is a radiator or other heating source. This means heat is transferred more effectively during the heating phase and during the cooling phase (when the boiler has modulated down). The latter supports the independent analysis from with longer periods between boiler runs due to an increase in heat loss from the radiator to maintain thermostatic desired ranges (25).

Energy Costs

The total consumption of electricity in the 10 cycles of the stand was calculated using an attached electrical meter. With the addition of the surfactant, the system consumed 18.28% less energy to run the 10 cycles.

Case Study 3: University of British Columbia

Nonionic surfactant was tested by the University of British Columbia (UBC) (26) to determine the improvement in the system 12 the ANALYST Technology Supplement 2021


Can Nonionic Surfactant Treatment Improve Heat Transfer and Lower Energy Use in Water Systems? continued

ΔT inside a secondary system on the university’s district heating network. The Horticulture Building within the UBC District Energy System (DES) is set up with 15-minute monitoring on flow/ return temperatures, internal comfort conditions, and external ambient air temperatures to allow the variable flow valve to open/close dependent on the demand and weather conditions. The aims of the test study were as follows: Hypothesis 1: Nonionic surfactant increases the ΔT of the secondary system. Null Hypothesis 1: There is no change (or reduction) in ΔT of the heating system. Hypothesis 2: The VF Valve (%) should be lower on average at comparable temperatures. Null Hypothesis 2: There is no change (or increase) in VF Valve % at comparable temperatures (Table H [15]). Table H: Comparison of System ΔTs at Known VF Valve Positions Valve Position %

Pre-Additive ΔT (ºC)

PostAdditive ΔT (ºC)

30

3.88

4.61

0.73

18.81%

40

4.97

5.86

0.89

17.95%

50

5.96

6.98

01.02

17.03%

60

6.85

7.95

1.10

16.02%

70

7.64

8.79

1.14

14.93%

80

8.34

9.48

1.14

13.72%

90

8.39

10.04

1.11

12.40%

100

9.42

10.45

1.03

10.93%

1.02

15.23%

Average

Difference ΔT (ºC)

Improvement in ΔT

A comparison of the 15-minute interval data in the time periods before/after the nonionic surfactant was installed shows a clear increase (on average of 15.23%) of the ΔT once nonionic surfactant was used. The average improvement in 1.02 °C was recorded.

Findings

Hypothesis 1 Validated: Nonionic surfactant improves system ΔT. During each 15-minute interval the external temperature is recorded and compared with the valve position. During any day, the VF valve will open and close during the individual boiler cycles. The combined averages of the time periods are shown in Table I (15).

Table I: Comparing Average VF Valve Position With Average External Temperature Baseline

Post-Install

Temperature (°C)

4.2

2.1

Average VFD Valve Position (%)

81.1

71.8

The average valve position in the post-nonionic surfactant period was smaller than the baseline period despite the ambient temperature being colder. Hypothesis 2 Validated: Nonionic surfactant reduces the average VF valve position. This is a reduction in the electrical workload of the pump to maintain the comfort conditions required in this district heating system.

Conclusion

Using a nonionic surfactant can reduce the surface tension of water by more than 60%, improving the wetted perimeter or thermal contact area. The larger heat transfer area improves the efficiency of heat transfer governed by the overall heat transfer calculation (Equation 1): Q = UAΔT

Eq. 1

Where: Q = Efficiency or rate of heat transfer U = Heat transfer coefficient A = Area ΔT = The difference in temperature between the room and the water. The result of the improved heat transfer is more optimal conditions for peak hydronic energy efficiency. Along with reducing heating consumption by up to 15%, a nonionic surfactant is also noted to be less corrosive than water, compatible with common system materials and market leading inhibitors. The additive has no impact on the freeze protection of commonly used glycols and has been verified by major boiler manufacturers. Most importantly, this chemistry is thermal stable, allowing for years of improved heat transfer and energy efficiency in hydronic HVAC systems. The growing use of nonionic surfactants by the energy efficiency community and utility companies will likely have an impact on the water treatment industry in the near future.

References

1. Lin, H.-W.; Wong, T. (2012). “An In-Depth Analysis of Space Heating Energy Use in Office Buildings,” in ACEEE Summer Study on Energy Efficiency in Buildings, pp. 3-225 to 3-237, accessible at https://aceee.org/files/proceedings/2012/data/papers/0193-000068.pdf.

2. Marto, P.J.; Lepere, V.J. (1982). “Pool Boiling Heat Transfer from Enhanced Surfaces to Dielectric Fluids,” Journal of Heat Transfer 104(2), pp. 292–299, doi: 10.1115/1.3245086. 3. Aveyard, R.; Binks, B.P.; Chen, J.; Esquena, J.; Fletcher, P.D.I.; Buscall, R.; Davies, S. (1998). “Surface and Colloid Chemistry of Systems Containing Pure Sugar Surfactant,” Langmuir 14(17), pp. 4699–4709, doi: 10.1021/la980519x.

13 the ANALYST Technology Supplement 2021


Can Nonionic Surfactant Treatment Improve Heat Transfer and Lower Energy Use in Water Systems? continued

4. Garofalakis, G.; Murray, B.S.; Sarney, D.B. (2000). “Surface Activity and Critical Aggregation Concentration of Pure Sugar Esters with Different Sugar Headgroups,” Journal of Colloid and Interface Science 229(2), pp. 391–398, doi: 10.1006/jcis.2000.7035.

5. Hetsroni, G.; Zakin, J.; Lin, Z.; Mosyak, A.; Pancallo, E.; Rozenblit, R. (2001). “The Effect of Surfactants on Bubble Growth, Wall Thermal Patterns and Heat Transfer in Pool Boiling,” International Journal of Heat and Mass Transfer 44(2), pp. 485–497, doi: 10.1016/s0017-9310(00)00099-5. 6. Cheng, L.; Mewes, D.; Luke, A. (2007). “Boiling Phenomena with Surfactants and Polymeric Additives: A State-of-the-Art Review,” International Journal of Heat and Mass Transfer 50(13-14), pp. 2744–2771, doi: 10.1016/j.ijheatmasstransfer.2006.11.016. 7. Tzan, Y.L.; Yang, Y.M. (1990). “Experimental Study of Surfactant Effects on Pool Boiling Heat Transfer’,” Journal of Heat Transfer 112(1), p. 207, doi: 10.1115/1.2910346. 8. Zhang, J.; Manglik, R.M. (2004). “Effect of Ethoxylation and Molecular Weight of Cationic Surfactants on Nucleate Boiling in Aqueous Solutions,” Journal of Heat Transfer 126(1), p. 34, doi:10.1115/1.1643755.

9. Elghanam, R.I.; Fawal, M.M.E.; Abdel Aziz, R.; Skr, M.H.; Hamza Khalifa, A. (2011). “Experimental Study of Nucleate Boiling Heat Transfer Enhancement by Using Surfactant,” Ain Shams Engineering Journal 2(3-4), pp. 195–209, doi: 10.1016/j.asej.2011.09.001. 10. Kandlikar, S.G.; Alves, L. (1999). “Effects of Surface Tension and Binary Diffusion on Pool Boiling of Dilute Solutions: An Experimental Assessment,” Journal of Heat Transfer 121(2), pp. 488–493, doi: 10.1115/1.2826008.

11. Wasekar, V.M.; Manglik, R.M. (2002). “The Influence of Additive Molecular Weight and Ionic Nature on the Pool Boiling Performance of Aqueous Surfactant Solutions,” International Journal of Heat and Mass Transfer 45(3), pp. 483–493, doi: 10.1016/s0017-9310(01)00174-0. 12. Bourdon, B.; Rioboo, R.; Marengo, M.; Gosselin, E.; De Coninck, J. (2012). “Influence of the Wettability on the Boiling Onset,” Langmuir 28(2), pp. 1618–1624, doi: 10.1021/la203636a.

13. Hetsroni, G.; Gurevich, M.; Mosyak, A.; Rozenblit, R.; Yarin, L.P. (2002). “Subcooled Boiling of Surfactant Solutions,” International Journal of Multiphase Flow 28(3), pp. 347–361, doi:10.1016/s0301-9322(01)00062-3.

14. Hetsroni, G.; Zakin, J.L.; Gurevich, M.; Mosyak, A.; Pogrebnyak, E.; Rozenblit, R. (2004). “Saturated Flow Boiling Heat Transfer of Environmentally Acceptable Surfactants,” International Journal of Multiphase Flow 30(7-8), pp. 717–734, doi: 10.1016/j.ijmultiphaseflow.2004.05.001. 15. Dikici, B.; Eno, E.; Compere, M. (2014). “Pool Boiling Enhancement with Environmentally Friendly Surfactant Additives,” Journal of Thermal Analysis and Calorimetry 116(3), pp. 1387–1394, doi: 10.1007/s10973-013-3634-x. 16. Wang, Z.; Mathai, V.; Sun, C. (2019). “Self-Sustained Biphasic Catalytic Particle Turbulence,” Nature Communications, 10, article no.: 3333, doi:10.1038/s41467-019-11221-w.

17. Yassen, M.; Saleemi, S.; Hursthouse, A.; McHugh, C.; Rateb, M. (2016). “EndoTherm for the Efficient Heat Transfer in Water Heating Systems,” Abstract, University of the West of Scotland, Paisley, Scotland.

18. Anwar, J.; Johnstone, W. (2015). “Surface Tension Measurements of a Heat Transfer Liquid at Different Dilutions,” Report Number: L70 - LPD Lab Services Ltd., Blackburn, Lancashire, UK. 19. Malik, M.A.; Hashim, M.A.; Nabi, F.; Thabaiti, S.A.; Al-Khan, Z. (2011). “Anti-Corrosion Ability of Surfactants: A Review,” International Journal of Electrochemical Science, 6, pp. 1927–1948.

20. Wilson, V. (2013). “A Study of the Corrosive Effect of EndoTherm Water Treatment Chemical on Various Metals and Compatibility with Rubbers Found within Central Heating Systems,” Meadowhead Consultancy Ltd., West Dunbartonshire, Scotland.

21. Munn, P (2014). “Corrosion Performance of EndoTherm Water Treatment with and without Fernox MB-1,” Report 0550, Midland Corrosion Services, Ltd., Debyshire, England.

22. Munn, P. (2015). “Performance of 0.25% v/v Corrshield 4100 and 1% v/v EndoTherm as Tested in Accordance to NSF CIAS Corrosion Test,” Report 0847, Midland Corrosion Services, Ltd., Derbyshire, England. 23. Lau, H.Y.; Moore, L. (2018). “Pace Propylene Glycol Comparison Testing – Report of Analysis,” Maxim Chemical International, Regina, Sakasuian, Canada. 24. Axon, S.J. (2014). “E3363 EndoTherm Solution Assessment,” Enertek International, Hull, UK.

25. Radysh, V.N. (2018). “Changes in the Physical and Chemical Properties of the Coolant, When Using the Energy-Saving Additive EndoTherm,” Novator. 26. Edginton, D. (2017). “Effects of EndoTherm on an Energy Transfer Station – UBC District Energy System,” University of British Columbia, Vancouver, British Columbia.

Endnote A

Endo Enterprises (UK) Ltd., based in Warrington, Cheshire, UK, is the water treatment service company mentioned in the text.

Dale Edginton is EndoTherm product manager and operations manager (North America) for Endo Enterprises (UK) Ltd., with a background in energy efficiency and sustainability from the University of Manchester. Over the past seven years, he has helped developed EndoTherm from its commercial launch to providing services globally running M&V pilots in more than 1,000 commercial and residential locations Mr. Edginton may be reached at dale.edginton@endoenterprises.com. Will Wilson manages the Sustainability Division of Pace Solutions and has overseen more than 100 measurement and verification studies using nonionic surfactants to improve hydronic HVAC efficiency. His focus is on educating solutions to improve building energy efficiency and emissions reductions. Mr. Wilson may be reached at will@pacesolutions.com.

14 the ANALYST Technology Supplement 2021


SUPPLIER OF THE YEAR

Private Label Blending Coast to Coast QualiChem offers nationwide blending for private label products, supplied from our plants located in Salem, Virginia and Verdi, Nevada. We are now better positioned to provide our customers with industry-recognized benefits and services coast to coast. Just one more way we are demonstrating how…

The Blender Matters 800.296.9102 | www.qualichem.com AN ISO 9001:2015 COMPANY

No Direct Sales Precision Manufacturing Formulatory Expertise Application Support Custom GHS-Compliant Labels and SDSs


Can a Biobased Additive Improve Performance and the Environmental Profile for Cooling Tower Formulations? Frederyk Ngantung, Ph.D., and LoongYi Tan (Solugen Inc.)

One of the defining themes of the 21st century is the impact of industrial activity on climate and the environment. The water treatment industry has been and will continue to be a leader in the movement toward mitigating environmental damage. The environmental profile of water treatment products has been improving from the days of chromate treatments to the metal- and phosphorus-free products that are gaining acceptance today. However, the challenge resides in finding materials and processes that are environmentally friendly and cost-effective without compromising performance. This article will examine various properties of water treatment actives produced by a novel chemoenzymatic process that address the mentioned challenge. This process is based on biochemical reactions observed in nature. It is carbon negative and produces a class of hydrophilic organic acids from sustainable feedstocks. This unique process allows the manufacturing of chemical building blocks that will support the development of effective cooling water formulations with better environmental profile.

Introduction

A specialty chemical manufacturerA has developed and is currently scaling up a differentiated chemoenzymatic technology

platform. This process uses enzymes and novel metal catalysts to produce organic acid products and hydrogen peroxide from sustainable and domestically produced biobased feedstocks. These building blocks have been designed to satisfy the need for greener technologies that have improved performance. The purpose of this article is to demonstrate how the use of a new class of biobased chemical (hydroxycitric acid [HCA] and hydrophilic dicarboxylic acid [HDA]) can address technical challenges such as the effects of trace metal ions (ferric [Fe3+] and cupric [Cu 2+]) in the control of calcium orthophosphates [CaPO4] scale, copper-induced pitting, and corrosion while allowing for the use of low-phosphorus water treatment programs that can have a reduced environmental impact.

Background Environmental Profile

Although the environmental profile of water treatment products has improved through the decades, today’s common water treatment products are not environmentally benign (1). While many of these products are addressing the need to control corrosion and scale formation, they typically include phospho 16 the ANALYST Technology Supplement 2021


rous, nitrogen, or heavy metals such as zinc or molybdenum. Phosphorus-based products can lead to eutrophication that accelerates the growth of algae and other plants that reduce the water quality for local drinking purposes as well as for recreational use in lakes and reservoirs. In the United States, eutrophication is estimated to lead to $2 billion dollars of damage annually (2).

Figure 1: Elemental composition of commonly used water treatment active ingredients.

To mitigate phosphorus-induced eutrophication, states such as Ohio, Oregon, and Pennsylvania have banned phosphate detergents and started to restrict phosphorus discharge limits from drinking water treatment plants (3). Zinc is commonly used as a cathodic corrosion inhibitor in systems. However, when zinc is discharged into waterways, it can form precipitates that cause respiratory issues in marine organisms (4). Because of this, zinc usage and discharge are strictly regulated by the U.S. Environmental Protection Agency (EPA). Azoles are commonly used as a corrosion inhibitor in systems with iron and copper metallurgies. While effective, azoles have unfavorable biodegradability and toxicity. Further, the performance of azoles is impacted by the presence of free copper and halogenated biocides (5).

The HCA and HDA molecules do not contribute nitrogen or phosphorous to the environment and reduce the need for triazoles, phosphonates, and polyacrylates in a water treatment formulation. Additionally, the HCA and HDA have a favorable life cycle analysis (6) for environmental gas emissions in comparison to conventional chemical processes. For every ton of HCA or HDA that is used in replacing HEDP, more than three tons of greenhouse gas equivalents are reduced (6).

Phosphates, azoles, and zinc contribute to harmful eutrophication or aquatic toxicity when discharged to lakes, rivers, and streams. The molecules manufactured by the product manufacturerA contain only carbon, hydrogen, and oxygen and no residual manufacturing impurities. This molecule comes in primarily two variations. Figure 1 illustrates the comparison of the two technologies (HCA and HDA) with other commonly used water treatment actives. Table A: Aquatic Toxicity of Commonly Used Phosphonates Toxicity Value (mg/L) ATMP

HEDP

EDTMP

HDTMP

DTPMP

Test

EC

NOEC

EC

NOEC

EC

NOEC

EC

NOEC

EC

NOEC

96 h LC-50

> 330

330

868

529

> 164

164

> 273

273

758

576

96 h LC-50

1,212

924

695

529

967

522

> 2,400

2,400

657

432

96 h LC-50

8,132

4,831

2,180

104

1,513

605

>954<1,670

954

5,377

2,125

96 h LC-50

> 330

330

368

151

> 164

164

> 273

273

> 180 < 252

180

96 h LC-50

160

­—

200

—

250

—

440

—

573

—

14 day LC-50

150

47

180

60

250

35

440

74

> 262

139

60 day chronic

< 47

> 23

—

—

—

—

—

—

< 34

> 26

48 h LC-50

11,000

7,040

8,910

3,925

7,320

1,956

4,660

1,803

9,910

7,589

96 h EC-50

7,870

4,575

1,770

104

1,436

605

942

537

4,849

2,125

96 h EC-50

201

95

89

< 52

67

55

212

< 161

156

56

48 h LC-50

297

125

527

400

510

250

574

125

242

125

28 day chronic

< 54

> 25

< 25

> 12

—

—

—

—

—

—

96 h EC-50

19.6

7.4

3

1.3

0.42

0.09

28

10.2

1.9

5.2

14 day EC-50

19.6

7.4

39.1

13.2

27.1

9.3

27

10.2

8.7

5.2

17 the ANALYST Technology Supplement 2021


Can a Biobased Additive Improve Performance and the Environmental Profile for Cooling Tower Formulations? continued

The chronic toxicity of aminotris (methylenephosphonic acid) (ATMP) and hydroxyethylidene diphosphonic acid (HEDP) to Daphnia magna is observed at concentrations approaching typical dosages. Most of the phosphonates are moderately acutely toxic. They biodegrade slowly but photodegrade relatively quickly (2). Their greatest toxicity is to algae and shellfish. Table A (2) displays data that show the toxicity of commonly used phosphonates in water treatment chemicals. Benzotriazole derivates bring concerns for their aquatic toxicity. Tolyltriazole has been given a label of H302, H315, H319, and H335 under the Globally Harmonized System of Classification and Labelling of Chemicals (GHS), indicating that this material is harmful to aquatic life with long-lasting effects and causes serious eye damage and respiratory irritation. Tolyltriazole reacts with halogen biocides to form various halogenated species that have even higher toxicity and persistence in the environment (7).

Complex Formation With Trace Ions

The HCA and HDA molecules form stable complexes with many of the metal cations commonly found in cooling water systems. Table B (8) shows some of the known stability constants of these complexes. The high affinity for Cu+2 and Fe+3 is particularly relevant because of the performance issues associated with those ions. This topic is explored in greater depth later in the article. Table B. Stability Constants of HCA and HDA Versus Other Chelating Agents Cation

HCA

HDA

Citric Acid

Na4EDTA

Ca+2

2

15

3

12

Cu

39

14

7

20

Fe+2

1

13

5

15

Fe

37

25

11

25

1

17

3

10

+2

+3

Mg+2

Stability and Chemical Compatibility With Biocides

Quaternary amine biocides are effective for biological control in cooling systems, particularly when algae control is an issue (9). Many of these biocides are precipitated and rendered ineffective by anionic polymers. HCA and HDA molecules are completely compatible with quaternary amine biocides. Furthermore, when comparing HCA and HDA with phosphonates, these molecules exhibit excellent stability in the presence of oxidizing biocides. PBTC (2-phosphonobutane-1,2,4,-tricarboxylic acid) is the only one stable in the presence of chlorine and bromine (2, 10).

Table C: HCA and HDA Compatibility with Common Biocides. Biocide ADBAC/DDAC (Quats) Glutaraldehyde Oxidizers (Chlorine, Bromine, etc.)

HCA/ HDA ✓ ✓

✓

Polymaleate

Polyacrylate

X

X

✓

✓

Phosphonate

✓

✓

✓ ✓ X

Effects of HCA and HDA

It is well-established in the literature that soluble ions can impact the performance of water treatment programs. Iron, particularly Fe+3, reduces the effectiveness of calcium phosphate inhibitors (11). The presence of soluble Cu+2 greatly increases corrosion of iron, aluminum, and galvanized steel through reductive plating and galvanic corrosion (12). Additionally, copper promotes the formation of soluble or insoluble compounds with the benzotriazoles. When they are complexed, the benzotriazoles are less able to function as corrosion inhibitors. Since copper ions are well-known oxidation catalysts, this complex formation is also likely to contribute to the oxidative decomposition of the soluble azoles. The following sections exhibit practical demonstrations of how the HCA and HDA’s high affinity to ferric iron and cupric copper can be useful in mitigating the challenges mentioned above.

Increase in Calcium Phosphate Inhibition

Since the industrywide adoption of “stabilized phosphate” corrosion inhibitor programs, effective inhibition of calcium phosphate by low-molecular-weight copolymers, terpolymers, and tetrapolymers has become an essential technology. It is well-established (1) that trace amounts of high valence cations, such as Fe+3, Al+3, and Mn+2, can limit that inhibition. The HCA and HDA molecules have high selectivity for the formation of soluble complexes with those ions. This property enables them to mitigate the poisoning of calcium phosphate inhibitors. An example of this property is shown in Figure 2.

“The presence of soluble Cu+2 greatly increases corrosion of iron, aluminum, and galvanized steel through reductive plating and galvanic corrosion.”

18 the ANALYST Technology Supplement 2021


Can a Biobased Additive Improve Performance and the Environmental Profile for Cooling Tower Formulations? continued

Figure 2: Mitigation of iron poisoning of calcium phosphate inhibitors.

The data in Figure 2 is based around the following parameters: Calcium: 480 parts per million (ppm) Phosphate: 10 ppm Zinc 2.5 ppm Temperature 85 °C Time: 24 hours Polymer dosage: 8 ppm active

Figure 3: HCA molecule significantly impedes copper-induced corrosion of carbon steel.

Test conditions for the data presented in Figure 3 were as follows: Temperature: 32 °C Water cut: 100% Brine: 3% NaCl pH: 8 Time: 24 hours TTA concentration: 4 ppm Figure 4: HCA effect on pitting prevention.

Reduction of Copper Induced Pitting in Carbon Steel

Cooling tower water is extremely corrosive to carbon steel equipment. Soluble copper leads to a higher carbon steel corrosion. The corrosivity depends on the process conditions, outside environment, and water treatment. HCA and HDA molecules are the building blocks for corrosion inhibitors that address the performance deficiencies of today’s formulations. HCA has corrosion inhibition properties on multiple metals. It forms stable complexes with metal ions that are used in corrosion inhibitor formulations. An additional benefit is the stabilization of harmful trace ions contained in source water or due to corrosion products. In a study (13) conducted by the supplier, A the addition of HCA significantly impedes copper-induced corrosion of carbon steel. In this same study, as seen in Figure 3, HCA reduced the copper-induced corrosion. Figure 4 shows the impact of HCA on metal pitting.

Enhancement of Triazole Corrosion Inhibition

A common practice is to use triazoles as corrosion inhibitors for iron and copper metallurgies. Both benzotriazole and tolyltriazole (TTA) corrosion inhibitors are used in copper or yellow metal corrosion inhibitor formulations. However, there are two downsides when working with triazoles: 1. The triazole family of intermediates are known to be reactive with halogenated biocides and can be deactivated via precipitation with soluble copper; and 2. There are environmental concerns due to their aquatic toxicity. The HCA molecules have high selectivity to soluble copper and allow for enhanced stabilization of this metal ion, addressing both challenges.

19 the ANALYST Technology Supplement 2021


Can a Biobased Additive Improve Performance and the Environmental Profile for Cooling Tower Formulations? continued

Figure 5: HCA controlling the effects of soluble copper and halogens.

Figure 6: HCA effect on TTA dosage.

Benefits of Using HCA and HDA Here are the test conditions around which Figure 5 is based: Temperature: 32 °C Water cut: 100% Brine: 3% NaCl Coupon material: Copper pH: 8 Time: 48 hr Cu concentration: 3 ppm HOBr concentration: 10 ppm Figure 5 shows the ability of HCA to mitigate the effects of soluble copper and halogens, improving the corrosion inhibition of the formulation. Figure 6 illustrates a four-fold reduction of TTA concentration while decreasing the corrosion rate (in mils per year [MPY]). As a result, adding HCA in the formulation can simultaneously boost performance and reduce environmental impacts from treatment products.

“As a result, adding HCA in the formulation can simultaneously boost performance and reduce environmental impacts from treatment products.”

The properties illustrated in the previous section indicate that HCA and HDA chemistries can provide a solution that allows the industry to develop differentiated water treatment formulations with enhanced performance and an improved environmental profile. Some of the main properties these molecules offer include: •

Inherent corrosion inhibition.

•

Ability to chelate harmful metal ions.

•

Ability to improve performance of scale inhibitors.

In the next section, a series of formulations will be tested to demonstrate the value of adding HCA to the following water treatment programs: 1. Alkaline all organic 2. Alkaline all organic, HEDP-free Please note that the following tests were performed at 40 °C using a C1018 electrode, constant air sparging, and a stir bar set at 200 revolutions per minute (RPM).

Alkaline “All-Organic” Formulations

Alkaline “all-organic” formulations are normally used in light-duty cooling systems with low-to-moderate corrosive conditions. These products are typically preferred when the customer does not want to use pH control. Table D examines all-organic formulations under test conditions.

20 the ANALYST Technology Supplement 2021


Can a Biobased Additive Improve Performance and the Environmental Profile for Cooling Tower Formulations? continued

Table D: “All-Organic” Formulation Testing Conditions

Table E. Non-HEDP All-Organic Formulation Testing Conditions

Additive ppm Active

All Organic

All Organic + HCA

All Organic + HCA

Additive ppm Active

All Organic

All Organic + HCA

All Organic + HCA

HEDP

6

3

3

HEDP

6

0

0

PBTC

6

3

3

PBTC

6

6

6

Acrylate Copolymer

10

5

5

Acrylate Copolymer

10

5

5

TTA

3

1.5

1.5

TTA

3

1.5

1.5

HCA

0

5

20

HCA

0

5

20

Water Composition

Water Composition Cations

Measurement

Cations

Mg/L

Ca

500 ppm

Ca

500 ppm

Mg

250 ppm

Mg

250 ppm

Alkalinity

400 ppm from Bicarb

Alkalinity

400 ppm from Bicarb

Cl/SO4

Counterions from CaCl2 and MgSO4

Cl/SO4

Counterions from CaCl2 and MgSO4

pH

8.8–9.0

pH

8.8–9.0

Figure 7: Mild steel corrosion results obtained from variations in the “all-organic” formulation.

Figure 8: Mild steel corrosion results from a modified “allorganic” formulation with HCA replacing HEDP.

HEDP is often included in “all-organic” formulations (see Figure 7). HEDP has a very high phosphorous content, is degraded by halogen biocides, and can precipitate as the calcium-HEDP compound under some conditions. The mild steel corrosion results shown in Figure 8 indicate that even with 50% reductions in phosphonate, polymer, and azole concentrations, mild steel corrosion rates are reduced by the addition of as little as 5 ppm of HCA.

The results show that replacing HEDP with 5 ppm of HCA provides equivalent mild steel corrosion inhibition as the original formula, whereas increasing the dosage of HCA to 20 ppm provides improved mild steel corrosion inhibition.

However, it contributes to the mild steel corrosion inhibition of the formulation. The following test was performed in a HEDP-free formulation with the mild steel corrosion inhibition bolstered by HCA. The results are shown in Table E.

Conclusions

Nontoxic HCA and HDA chemical intermediatesB provide unique functionality in water treatment systems by mitigating the effects of trace ferric iron and copper, enabling low-phosphorus programs and allowing formula optimization. Additional benefits of adding HCA and HDA in water treatment formulations include the following: •

Mitigation of galvanic corrosion due to copper plating on susceptible metals.

•

Enhancement of the activity of azoles, allowing reduced azole usage.

21 the ANALYST Technology Supplement 2021


Can a Biobased Additive Improve Performance and the Environmental Profile for Cooling Tower Formulations? continued

•

Improvement of copper inhibitive properties of the azoles in the presence of halogen biocides.

•

Functionality as an ingredient in low P, and low P-nonmetal formulations.

•

Improved performance and reduced phosphorous content in current water treatment programs.

References 1. Rey, S. (Oct. 21–Nov. 4, 2000). “Carbon Steel Corrosion Control in the Past Twenty Years and in the New Millennium,” technical paper presented at the Association of Water Technologies Annual Convention & Exposition, Honolulu, Hawaii.

2. Gledhill, W.E.; Feijtel, T.C.J. (1992). “Environmental Properties and Safety Assessment of Organic Phosphonates Used for Detergent and Water Treatment Applications,” essay in The Handbook of Environmental Chemistry, Vol. 3, Hutzinger, O. ed., Springer-Verlag, Berlin Heidelberg, Germany.

3. Litke, D. (1999). “Review of Phosphorus Control Measures in the United States and Their Effects on Water Quality,” U.S. Department of the Interior, U.S. Geological Survey, Washington, D.C. 4. Young, T. (April 3–5, 1991). “The Use of Zinc for Corrosion Control in Open Cooling Systems,” technical paper presented at the Association of Water Technologies Annual Convention & Exposition, San Antonio, Texas. 5. May, R.C.; Longchun, C.; Shao, F. (April 2002). “Second Generation, Halogen-Resistant Copper Corrosion Inhibitors,” Corrosion 2002, Denver, Colorado.

6. Life Cycle Associates (2021). “Comparative Life Cycle Analysis of Solugen’s BioChelateTM,” Life Cycle Associates, LLC, Portola Valley, California.

Frederyk Ngantung, Ph.D., is the vice president of product at Solugen Inc., where he leads a multidisciplinary team to develop carbon-negative products. He has more than 15 years of experience, including positions at a corporate venture capital firm and three biobased chemical startups. Before joining Solugen, Dr. Ngantung had commercialized Elevance’s biobased specialty chemicals into oilfield, flavors and fragrances, pharmaceuticals, agriculture, and HI&I applications. He completed his B.ChE. in chemical engineering from the University of Minnesota and earned his doctorate in chemical engineering from MIT at the age of 24. He can be contacted at frederyk@solugen.bio LoongYi Tan is the director of product at Solugen, where he works with biobased water treatment products. Mr. Tan received his B.S. in chemical engineering from the University of California, Berkeley. Before joining Solugen, Mr. Tan was a system engineer at Theranos and a production engineer at Dow Chemical Co. He can be reached at loongyi@solugen.bio. This paper was presented at the Association of Water Technologies Annual Convention & Exposition held in Providence, Rhode Island, September 22–25, 2021.

7. Ferguson, L.; Corsi, S.; Geis, S.; Anderson, G.; Joback, K.; Gold, H.; Mericas, D.; Devon, C. (2009). “Formulations for Aircraft and Airfield Deicing and Anti-Icing: Aquatic Toxicity and Biochemical Oxygen Demand,” National Academies of Science, Engineering, and Medicine, Washington, D.C., accessible at https://www.nap.edu/read/23325/chapter/1. 8. Smith, R.M.; Martell, A.E. (1989). Critical Stability Constants, Plenum Press, New York, New York. 9. Frayne, C. (Spring 2001). “The Selection and Application of Nonoxidizing Biocides for Cooling Water Systems,” The Analyst. Spring 2001, accessible at https://www.awt.org/pub/?id=015401ED-F59F-BB61-2DDD-B8D82CDF58A8.

10. Johnson, D.; Meier, D.; Fulks, K. (1987). “Factors Influencing the Decomposition of HEDP by Chlorine,” Proceedings of Corrosion ’87, pp. 24–30, National Association of Corrosion Engineers, Houston, Texas. 11. Shen, D.; Shcolnik, D.; Perkins, R.; Taylor, G.; Brown, M. (2012). “Evaluation of Scale Inhibitors in Marcellus High-Iron Waters,” essay in Oil and Gas Facilities, Society of Petroleum Engineers International, Richardson, Texas. 12. Fox, K.; Tate, C.; Treweek, G.; Trussell, R.R.; Bowers, A.E.; McDuire, M.; Newkirk, D. (1989). “Copper-Induced Corrosion of Galvanized Steel Pipe,” U.S. Environmental Protection Agency, Washington, D.C.

13. Su An, J.; Arceo, C. (2021). “HCA Role in the Reduction of Copper Induced Pitting in Carbon Steel,” Solugen Inc., Houston, Texas.

Endnotes A

B

The chemical manufacturing company referenced in the text is Solugen Inc., based in Houston, Texas. Solugen Inc., based in Houston, Texas, is the manufacturer of the HCA and HDA chemical intermediates referenced in the article text.

22 the ANALYST Technology Supplement 2021


Can EDTA/Thiosulfate Neutralize Copper/ Silver Biocide Metal Toxicities in Samples When Testing Building Water for Legionella? Richard D. Miller, Ph.D., Environmental Safety Technologies, Inc. and School of Medicine at the University of Louisville; and Brandon Smith, Environmental Safety Technologies, Inc.

Abstract

Water samples collected for culture detection of Legionella generally have an added reducing agent, such as sodium thiosulfate, to neutralize chlorine or other halogen disinfectant residuals and prevent bactericidal action from continuing during transit to the laboratory. However, disinfectant residuals in potable water from copper-silver (Cu/Ag) ionization secondary disinfection systems may require different sample preservation approaches to neutralize copper and silver disinfectant residuals. Metal-chelating agents such as ethylene-diamine-tetraacetate (EDTA) have been recommended for this purpose. A comprehensive study by Resgalla et al. (1) has shown that EDTA effectively removed metal toxicity of copper in water. Silver toxicity was not removed by EDTA but was removed by sodium thiosulfate (at concentrations used for dechlorination).

However, EDTA chelation of metals does have some antibacterial activity at high concentrations. Thus, the purpose of the present study was to evaluate the ability of EDTA/thiosulfate formulas to neutralize the metal toxicity of water from buildings that are using a Cu/Ag secondary disinfection system, without a toxic effect on any Legionella in the samples. The results of the current study have shown that, while 10X sodium thiosulfate had no toxicity for Legionella during a simulated 24-hour (hr) shipment to the lab, EDTA did have some modest toxicities for Legionella, although most noticeable at the higher EDTA concentration (10 milligrams per liter [mg/L]). The first field trial of EDTA (5 mg/mL) and thiosulfate showed that protection from Cu and Ag was achieved during the shipment to the lab and without any detectable toxicity from the EDTA. Most interestingly, the same level of protection from the Cu/Ag in the 23 the ANALYST Technology Supplement 2021


Can EDTA/Thiosulfate Neutralize Copper/Silver Biocide Metal Toxicities in Samples When Testing Building Water for Legionella?

samples was achieved with thiosulfate alone. We are proceeding with the hypothesis that thiosulfate alone (likely using 10X thiosulfate) will provide sufficient protection to Legionella in water samples from these Cu/Ag secondary disinfection systems, and without any toxicity to the Legionella. Additional field trials will be necessary for confirmation.

Introduction

It is common knowledge when taking water samples for microbiological testing that the bottles should contain a reducing agent if intended for the collection of water with residual chlorine or other halogens. Sodium thiosulfate (Na 2S3O3) at a final concentration of 100 milligrams per liter (mg/L) is a common and satisfactory dechlorination reagent that neutralizes any residual halogen and prevents bactericidal action from continuing during transit to the laboratory (2). This type of sample preservation is widely used when taking and shipping water samples for Legionella testing from both potable water sources (to neutralize the primary disinfectant residual chlorine) and cooling tower water (to neutralize any oxidizing biocides). Sodium thiosulfate will also preserve samples taken from building potable water with installed chlorine-based secondary disinfectant systems to control Legionella, such as chlorine dioxide or monochloramine. However, disinfectant residuals in potable water from copper-silver ionization secondary disinfection systems (see Figure 1) may require different sample preservation approaches in order to neutralize copper (Cu) and silver (Ag) ion disinfectant residuals. Figure 1 is an example of the use of copper-silver ionization for control of Legionella in building potable water systems. Under this approach, a direct current through copper and silver electrodes causes the release of positively charged bactericidal Cu and Ag ions into the water. Figure 1: An illustration of the use of copper-silver ionization such as would be used for Legionella control in building potable water systems. Source: Environmental Safety Technologies.

continued

“A comprehensive study has shown that EDTA effectively removed the metal toxicity of copper in water (for sea urchin embryo larvae).” Metal-chelating agents such as ethylene-diamine-tetraacetate (EDTA) have been suggested for this purpose (3, 4), and studies have confirmed that there is an increased recovery of Aeromonas, fecal streptococci, and coliforms in drinking water samples containing residual copper with the addition of 50 mg/ mL of disodium EDTA (4). A comprehensive study by Resgalla et al. (1) has shown that EDTA effectively removed the metal toxicity of copper (Cu 2+) in water (for sea urchin embryo larvae). However, silver (Ag1+) toxicity in this study was not removed by EDTA but was removed by sodium thiosulfate (at concentrations used for dechlorination). However, EDTA, especially tetrasodium EDTA, does have some recognized antimicrobial activity (5), as a result of its chelation of important divalent cations that, among other things, stabilize the cell wall and outer membrane of Gram-positive and Gram-negative bacteria, respectively. Therefore, the use of EDTA as a sample preservative may have limitations when preserving water samples for some microbiological testing.

Research Scope

The overall scope of this research involves four phases: Phase 1: Describe the scientific basis, guideline recommendations, and microbiological precedent for using EDTA and thiosulfate for addition to all Legionella samples containing copper and silver biocides. Phase 2: Examine the possible toxicities of EDTA and thiosulfate for Legionella during in vitro testing using different EDTA/ thiosulfate concentrations, pH, exposure times, and Legionella concentrations. Phase 3: Examine the in vitro effectiveness of EDTA and thiosulfate for removing metal toxicity for Legionella in laboratory studies using water with added copper and silver ions. Phase 4: Conduct field trials using the EDTA/thiosulfate additive in samples taken from building water systems with installed copper/silver ionization secondary disinfection systems for Legionella control and ship to our laboratory for Legionella testing as part of the validation process. Since this research is still in its early stages, the purpose of the current study was to cover the Phase 1 and Phase 2 strategies. In this article, we show our results to date regarding the toxicity of EDTA and sodium thiosulfate on Legionella at relevant col 24 the ANALYST Technology Supplement 2021


Can EDTA/Thiosulfate Neutralize Copper/Silver Biocide Metal Toxicities in Samples When Testing Building Water for Legionella?

ony forming units per milliliter (CFU/mL) concentrations and pH. Phase 3 and Phase 4 studies are in the early stages, with only one Phase 4 field trial having been carried out.

Materials and Methods

Legionella strain. Legionella pneumophila subsp. pneumophila serogroup 1 was obtained from the American Type Culture Collection (ATCC 33152). Preparation of the water-acclimated Legionella inocula. Small amounts of Legionella were removed from growing cultures on BCYE agar plates with a sterile swab and transferred into actual dechlorinated building water samples (potable water) that historically had contained Legionella. The water sample was analyzed via culture and Gram stain to verify that there was a typical heterotrophic bacterial population along with amoebae. This Legionella inoculum was incubated at 25 °C for 72 hours before being used directly in the EDTA/thiosulfate experiments. It was felt that the Legionella prepared in this fashion were better acclimated to water and should survive in the water controls better than those Legionella used directly off of BCYE agar plates. Thus, the water-acclimated Legionella should be more representative of naturally occurring environmental Legionella. Numbered inoculum preparations were prepared at various times with different building water samples containing different added Legionella concentrations. Water. Aside from the preparation of inocula, all other water used for preparing solutions and for experimental control conditions was ACS Reagent Grade Water (ASTM Type I, ASTM Type II) from Ricca Chemical Co., Arlington, Texas. EDTA. Ethylene-diamine-tetra-acetic acid dipotassium salt dihydrate, 99% was obtained from Alfa Aesar, Ward Hill, Massachusetts. Two different solutions of EDTA were prepared, each at a concentration of 10 mg/L in ACS Reagent Grade Water (ASTM Type I, ASTM Type II, Ricca Chemical Co., Arlington, Texas). The two solutions were adjusted to pH 6 and pH 7, respectively. For the Legionella exposure experiments, both EDTA solutions were used full strength (10 mg/L) as well as half-strength (5 mg/L).

continued

10X Thiosulfate (Na2S2O 3). Sodium thiosulfate was obtained from Research Products International, Mt. Prospect, Illinois, and was prepared in ACS Reagent Grade Water at a concentration of 1,000 mg/L. This concentration represents a 10-fold higher concentration than is traditionally used to dechlorinate water samples. There have been reports that 10X sodium thiosulfate will inactivate silver in water samples when testing for Legionella. Since EDTA does not neutralize silver toxicity but sodium thiosulfate does (per the Resgalla study) (2), sodium thiosulfate will be analyzed for this purpose, and the 10X sodium thiosulfate will be checked for toxicity in the current study. Experimental protocol. Legionella (0.1 mL of the acclimated inoculum preparation) was added to triplicate tubes of either fullstrength EDTA (10 mg/L) or half-strength EDTA (5 mg/L), each at pH 6.0 and pH 7.0, or 10X sodium thiosulfate (1,500 mg/L) or water (control). Samples from the water control were plated immediately on BCYE agar for the 0-hr sample results. All tubes were then incubated at 25 °C for 24, 48, and 72 hours, with 0.1 mL samples taken at each time point for plating on BCYE agar. Since most Legionella samples are shipped to the lab via overnight shipment for next-day processing, the 24-hr time point would be the most critical for assessing the relevance of EDTA toxicity toward Legionella for shipping samples. The complete set of experiments using this protocol was repeated five times, using a different inoculum preparation (with a different concentration of Legionella) each time.

Results

Very high Legionella inoculum concentrations. The first three experiments were in vitro studies to assess the toxicity of EDTA and sodium thiosulfate for Legionella, and they used the water-acclimated Legionella inoculum preparations #1, #2, and #3, respectively, which had very high concentrations of Legionella. All tubes at 0-hr had identical inoculation of 0.1 mL of the respective inoculum, achieving final concentrations of 105,000 CFU/mL (results in Table A), 141,000 CFU/mL (results in Table B), and 168,000 CFU/mL (results in Table C). While these concentrations of Legionella were higher than are typically found in most building water systems, they are relevant test concentrations for toxicity studies where the measurement of multiple log-kill results may be anticipated.

“Therefore, the use of EDTA as a sample preservative may have limitations when preserving water samples for some microbiological testing.”

25 the ANALYST Technology Supplement 2021


Test Your Water Well ® with MYRON L

TM


Compatible with Android and iOS Devices.

Conductivity, Resistivity, TDS, pH, ORP, Salinity, ISE, Flow, Pressure, +more with Touchscreen LCD


Can EDTA/Thiosulfate Neutralize Copper/Silver Biocide Metal Toxicities in Samples When Testing Building Water for Legionella?

continued

Table A: Survival of Legionella pneumophila in EDTA at pH 6.0 and pH 7.0 Sample

Legionella – 0-hr CFU/mL (control)

Legionella – 24 hr CFU/mL (fraction of control)

Legionella – 48 hr CFU/mL (fraction of control)

Legionella – 72 hr CFU/mL (fraction of control)

105,000

107,000 118,000 104,000 Ave = 109,600 (1.04)

98,000 112,000 113,000 Ave = 107,700 (1.03)

100,000 101,000 112,000 Ave = 104,300 (0.99)

EDTA 5 mg/L pH 6.0

105,000

104,000 106,000 109,000 Ave = 106,300 (1.01)

101,000 102,000 112,000 Ave = 105,000 (1.00)

88,000 96,000 100,000 Ave = 94,700 (0.90)

EDTA 10 mg/L pH 6.0

105,000

95,000 101,000 102,000 Ave = 99,300 (0.95)

88,000 99,000 107,000 Ave = 98,000 (0.93)

82,000 98,000 106,000 Ave = 95,000 (0.90)

EDTA 5 mg/L pH 7.0

105,000

97,000 104,000 108,000 Ave = 103,000 (0.98)

95,000 102,000 108,000 Ave = 101,700 (0.97)

99,000 99,000 105,000 Ave = 101,000 (0.96)

EDTA 10 mg/mL pH 7.0

105,000

125,000 137,000 138,000 Ave = 133,300 (1.27)

120,000 128,000 168,000 Ave = 138,600 (1.32)

116,000 121,000 168,000 Ave = 135,300 (1.29)

10X Thiosulfate 1,000 mg/L

105,000

115,000 118,000 121000 Ave = 118,000 (1.12)

110,000 119,000 121,000 Ave = 116,600 (1.11)

116,000 120,000 123,000 Ave = 119,600 (1.14)

Notes: *Sample had 10X thiosulfate and contained the water-acclimated inoculum preparation #1 with a very high Legionella concentration (105,000 CFU/mL). Ave = average variance extracted.

Table B: Survival of Legionella pneumophila in EDTA at pH 6.0 and pH 7.0* Sample

Legionella – 0-hr CFU/mL (control)

Legionella – 24 hr CFU/mL (fraction of control)

Legionella – 48 hr CFU/mL (fraction of control)

Legionella – 72 hr CFU/mL (fraction of control)

Water (Control)

168,000

179,000 170,000 168,000 Ave = 172,300 (1.03)

166,000 159,000 156,000 Ave = 160,300 (0.95)

160,000 178,000 176,000 Ave = 171,300 (1.02)

EDTA 5 mg/L pH 6.0

168,000

151,000 150,000 158,000 Ave = 153,000 (0.91)

131,000 142,000 128,000 Ave = 133,600 (0.80)

146,000 108,000 115,000 Ave = 123,000 (0.73)

EDTA 10 mg/L pH 6.0

168,000

109,000 115,000 121,000 Ave = 115,000 (0.68)

115,000 106,000 102,000 Ave = 107,700 (0.64)

108,000 101,000 96,000 Ave = 101,700 (0.61)

EDTA 5 mg/L pH 7.0

168,000

115,000 101,000 108,000 Ave = 108,000 (0.64)

114,000 96,000 105,000 Ave = 105,000 (0.63)

101,000 96,000 100,000 Ave = 99,000 (0.59)

EDTA 10 mg/L pH 7.0

168,000

146,000 138,000 145,000 Ave = 143,000 (0.85)

120,000 122,000 128,000 Ave = 123,000 (0.73)

128,000 119,000 123,000 Ave = 123,000 (0.73)

10X Thiosulfate 1,000 mg/L

168,000

115,000 118,000 121000 Ave = 118,000 (0.70)

115,000 119,000 121,000 Ave = 118,000 (0.70)

116,000 120,000 123,000 Ave = 120,000 (0.71)

Notes: *Sample contained 10X thiosulfate, using the water-acclimated inoculum preparation #2 that had a very high Legionella concentration (168,000 CFU/mL). Ave = average variance extracted.

28 the ANALYST Technology Supplement 2021


Can EDTA/Thiosulfate Neutralize Copper/Silver Biocide Metal Toxicities in Samples When Testing Building Water for Legionella?

continued

Table C: Survival of Legionella pneumophila in EDTA at pH 6.0 and pH 7.0* Sample

Legionella – 0-hr CFU/mL (control)

Legionella – 24 hr CFU/mL (fraction of control)

Legionella – 48 hr CFU/mL (fraction of control)

Legionella – 72 hr CFU/mL (fraction of control)

Water (Control)

141,000

137,000 149,000 137,000 Ave = 141,000 (1.00)

148,000 146,000 139,000 Ave = 144.300 (1.02)

129,000 129,000 145,000 Ave = 134,300 (0.95)

EDTA 5 mg/L pH 6.0

141,000

151,000 138,000 144,000 Ave = 144,300 (1.02)

166,000 131,000 112,000 Ave = 136,300 (0.97)

127,000 100,000 106,000 Ave = 111,000 (0.78)

6 EDTA 10 mg/L pH 6.0

141,000

158,000 128,000 128,000 Ave = 138,000 (0.98)

142,000 121,000 128,000 Ave = 130,300 (0.92)

128,000 116,000 119,000 Ave = 121,000 (0.86)

EDTA 5 mg/L pH 7.0

141,000

121,000 125,000 120,000 Ave = 122,000 (0.86)

128,000 124,000 124,000 Ave = 125,300 (0.90)

108,000 126,000 116,000 Ave = 116,600 (0.83)

100% EDTA pH 7.0

141,000

128,000 125,000 104,000 Ave = 119,000 (0.84)

128,000 120,000 92,000 Ave = 113,300 (0.80)

116,000 126,000 106000 Ave = 116,000 (0.82)

10X Thiosulfate 1,000 mg/L

141,000

104,000 102,000 119,000 Ave = 108,300 (0.77)

120,000 114,000 125,000 Ave = 119,700 (0.85)

106,000 103,000 116,000 Ave = 108,300 (0.77)

Notes: *Sample contained 10X thiosulfate, using the water-acclimated inoculum preparation #3, which had a very high Legionella concentration (141,000 CFU/mL). Ave = average variance extracted.

High Legionella inoculum concentration. The next experiment assessed the toxicity of EDTA and sodium thiosulfate for Legionella and used the water-acclimated Legionella inoculum preparation #4, which had a 10-fold lower concentration of Legionella compared to Experiments #1–3. All tubes at 0-hr in Experiment #4 had identical inoculation of 0.1 mL of the respective inoculum, achieving final concentrations of 15,200 CFU/mL (results are shown in Table D). This concentration of Legionella was still higher than is typically found in most building water systems. The water control tube and 10X thiosulfate tubes were both stable over 72 hours, and the EDTA still demonstrated modest toxicity to the Legionella, with the highest toxicity seen in the 100% EDTA, pH 6.0, with 34% loss of viability (66% of control) at 72-hr. However, the 100% EDTA at pH 7.0 had little toxicity (87% of control at 72-hr).

29 the ANALYST Technology Supplement 2021


Can EDTA/Thiosulfate Neutralize Copper/Silver Biocide Metal Toxicities in Samples When Testing Building Water for Legionella?

continued

Table D: Survival of Legionella pneumophila in EDTA at pH 6.0 and pH 7.0* Sample

Legionella – 0-hr CFU/mL (control)

Water (Control)

15,200

50% EDTA pH 6.0

Legionella – 24 hr CFU/mL (fraction of control)

Legionella – 48 hr CFU/mL (fraction of control)

Legionella – 72 hr CFU/mL (fraction of control)

13,800 14,200 14,700 Ave = 14,233 (0.94)

13,700 14,300 14,700 Ave = 14,200 (0.94)

12,900 17,000 13,200 Ave = 14,366 (0.95)

15,200

14,000 14,900 11,800 Ave = 13,600 (0.89)

12,900 13,700 14,300 Ave = 13,630 (0.89)

12,200 11,700 11,000 Ave = 11,633 (0.77)

100% EDTA pH 6.0

15,200

12,900 13,900 12,900 Ave = 13,200 (0.87)

12,300 11,700 11,500 Ave = 11,800 (0.78)

10,300 10,200 9,500 Ave = 10,000 (0.66)

50% EDTA pH 7.0

15,200

15,600 14,200 12,700 Ave = 14,200 (0.93)

14,300 12,700 12,100 Ave = 13,000 (0.86)

12,300 12,200 11,500 Ave = 12,000 (0.79)

100% EDTA pH 7.0

15,200

15,100 12,500 13.800 Ave = 13,800 (0.91)

14,400 13,600 15,100 Ave = 14,400 (0.95)

13,100 12,900 13,700 Ave = 13,200 (0.87)

10X Thiosulfate

15,200

15,200 16,000 15,100 Ave = 15,433 (1.02)

14,700 14,400 15,900 Ave = 15,000 (0.99)

14,500 14,400 14,900 Ave = 14,600 .96)

Notes: *Sample contains 10X thiosulfate, using the water-acclimated inoculum preparation #4, which had a high Legionella concentration (15,200 CFU/mL). Ave = average variance extracted.

Moderate Legionella inoculum concentration. The final two experiments used the most relevant concentrations of Legionella in terms of concentrations found in many Legionella samples. These experiments used Legionella inoculum preparations #5 and #6. All tubes at 0-hr in Experiments #5 and #6 had identical inoculation of 0.1 mL of the respective inoculum, achieving final concentrations of 300 CFU/mL (Table E) and 220 CFU/mL (Table F), respectively. The results showed that at these lower concentrations of Legionella, the water controls and 10X sodium thiosulfate tubes continued to demonstrate good stability over the 72-hour incubation period. And while there was still variability in the EDTA toxicities, there was an overall greater impact on the Legionella survival over time at these lower Legionella concentrations, with the EDTA toxicity clearly more evident at higher EDTA concentrations, and more evident at 72 hours. At pH 6.0, the Legionella 72-hr fraction of control when exposed to 5 mg/L and 10 mg/L EDTA were 0.47 and 0.25, respectively; while at pH 7, the values were 0.54 and 0.26, respectively.

30 the ANALYST Technology Supplement 2021


Can EDTA/Thiosulfate Neutralize Copper/Silver Biocide Metal Toxicities in Samples When Testing Building Water for Legionella?

continued

Table E. Survival of Legionella pneumophila in EDTA at pH 6.0 and pH 7.0* Sample

Legionella – 0-hr CFU/mL (control)

Legionella – 24 hr CFU/mL (fraction of control)

Legionella – 48 hr CFU/mL (fraction of control)

Legionella – 72 hr CFU/mL (fraction of control)

Water (Control)

300

300 280 280 Ave = 287 (0.95)

220 260 266 Ave = 248 (0,80)

220 248 251 Ave = 249 (0.83)

EDTA 5 mg/L pH 6.0

300

202 213 230 Ave = 215 (0.72)

189 184 172 Ave = 182 (0.61)

182 173 160 Ave = 172 (0.57)

EDTA 10 mg/L pH 6.0

300

116 145 146 Ave = 136 (0.49)

103 101 99 Ave = 101 (0.34)

98 93 84 Ave = 92 (0.31)

EDTA 5 mg/L pH 7.0

300

222 225 206 Ave = 218 (0.73)

200 211 200 Ave = 204 (0.68)

199 183 194 Ave = 192 (0.64)

EDTA 10 mg/L pH 7.0

300

202 213 293 Ave = 236 (0.79)

182 163 149 Ave = 165 (0.55)

105 101 98 Ave = 101 (0.34)

10X Thiosulfate

300

298 294 283 Ave = 294 (0.98)

292 291 300 Ave = 294 (0.98)

281 283 280 Ave = 281 (0.94)

Notes: *Sample contains 10X thiosulfate, using the water-acclimated inoculum preparation #5, which had a moderate Legionella concentration (300 CFU/mL). Ave = average variance extracted.

Table F: Survival of Legionella pneumophila in EDTA at pH 6.0 and pH 7.0* Sample

Legionella – 0-hr CFU/mL (control)

Legionella – 24 hr CFU/mL (fraction of control)

Legionella – 48 hr CFU/mL (fraction of control)

Legionella – 72 hr CFU/mL (fraction of control)

Water (Control)

220

230 220 210 Ave = 220 (1.00)

250 230 240 Ave = 240 (1.09)

250 190 220 Ave = 220 (1.00)

EDTA 5 mg/L pH 6.0

220

131 130 126 Ave = 129 (0.59)

101 106 114 Ave = 107 (0.49)

107 96 104 Ave = 102 (0.47)

EDTA 10 mg/L pH 6.0

220

111 109 104 Ave = 108 (0.49)

89 74 72 Ave = 78 (0.36)

67 46 51 Ave = 54 (0.25)

EDTA 5 mg/L pH 7.0

220

163 164 146 Ave = 157 (0.71)

151 126 140 Ave = 139 (0.63)

120 120 121 Ave = 120 (0.54)

EDTA 10 mg/L pH 7.0

220

122 124 111 Ave = 119 (0.54)

80 118 91 Ave = 96.3 (0.44)

66 55 48 Ave = 56 (0.26)

10X Thiosulfate

220

226 204 216 Ave = 215 (0.98)

217 211 202 Ave = 210 (0.95)

242 226 206 Ave = 225 (1.02)

Notes: *Sample contains 10X thiosulfate, using the water-acclimated inoculum preparation #6, which had a moderate Legionella concentration (220 CFU/mL). Ave = average variance extracted.

31 the ANALYST Technology Supplement 2021


Can EDTA/Thiosulfate Neutralize Copper/Silver Biocide Metal Toxicities in Samples When Testing Building Water for Legionella?

continued

“Thus, the biocidal impact of the Cu/Ag ions on Legionella in the water samples were either without effect on the Legionella during shipment or were neutralized entirely by the thiosulfate tablet.” Phase 4 field trial results with EDTA and thiosulfate. We have already carried out one field trial testing the EDTA/thiosulfate neutralization of Cu and Ag in building potable water with a Cu/Ag secondary disinfection system (data not shown). In this one study, there was actually no difference in the Legionella survival (presence/absence or CFU/mL counts) in split samples tested immediately (within one hour) or shipped overnight to the lab in bottles containing either a thiosulfate tablet alone or a thiosulfate tablet with added drops of EDTA (5 mg/ mL final concentration). Thus, the biocidal impact of the Cu/Ag ions on Legionella in the water samples was either without effect on the Legionella during shipment or was neutralized entirely by the thiosulfate tablet.

Discussion

It is clear from other studies using different bacteria or biological systems that EDTA and sodium thiosulfate can bind to and remove the toxicities of copper and silver from those biological systems (1, 4). Thus, the question to be answered in the current study was whether EDTA and 10X thiosulfate can safely carry out the neutralization of copper and silver without damaging the Legionella contained in a test sample. More specifically, can EDTA/thiosulfate carry out that Cu/Ag neutralization in samples taken from building water systems that have installed copper/silver ionization as a secondary disinfection system to control Legionella colonization, all without damaging the Legionella during shipment to the laboratory for Legionella validation testing? The results of the current study have shown that while 10X sodium thiosulfate (for silver removal) has no toxicity for Legionella during a simulated 24-hr shipment to the lab, EDTA does have some modest toxicities for Legionella under the same conditions. The EDTA toxicity was most noticeable with the lower Legionella concentrations (such as would be found in potable water samples from a building premise plumbing) and at the higher EDTA concentration (10 mg/L, compared to the 5 mg/L lower concentration). And while the EDTA removal of the copper toxicity during shipment would, on balance, be a favorable outcome for Legionella detection, there could there be an improvement of the EDTA use for copper removal. While we are proceeding with the Phase 3 and Phase 4 studies, we will also try the following:

1. Test the EDTA toxicity at pH 8 or 9. This was in the planning but had not yet been completed. The rationale is that Cu/ Ag ions do not work as well at alkaline pH, which has been seen with building water systems with high pH (e.g., pH 9), and where acidification of the potable water was required in order to restore the Legionella control (6). By using a high pH, we hope to use the pH to help control the copper killing of Legionella, allowing us to use a lower concentration of EDTA (i.e., 5 mg/L or lower) to complete the copper neutralization. 2. Test NTA (nitrilotriacetic acid) as an alternate copper chelator instead of EDTA, as was reported by Schets and Medema (7) for Aeromonas recovery. We envision a time in the near future where collection of building water samples for Legionella testing and validation of copper/silver secondary disinfection systems will include not only the routine sodium thiosulfate tablet in the bottle to neutralize both the chlorine and the silver biocide but also the addition of several drops of an EDTA solution for the purpose of binding and neutralizing the copper biocide during shipment to the lab. Or alternatively, as seen in our first Phase 4 Field Trial, thiosulfate alone may be sufficient to carry out the protection against both.

References

1. Resgalla, C.; Poleza, F.; Souza, R.C.; Maximo, M.V.; Radetski, C.M. (2012). “Evaluation of Effectiveness of EDTA and Sodium Thiosulfate in Removing Metal Toxicity Toward Sea Urchin Embryo-Larval Aapplying the TIE,” Chemosphere 89, pp. 102-107.

2. APHA-AWWA-WEF (2017). Standard Methods for the Examination of Water and Wastewater, 23rd ed. Baird, R.B.; Eaton, A.D.; Rice, E.W., eds., Section 9060, “Samples. A. Collection, 2. Dechlorination,” p. 9-36, American Public Health Association, American Water Works Association, Water Environment Federation, Washington, D.C.

3. APHA-AWWA-WEF (1999). Standard Methods for the Examination of Water and Wastewater, 20th ed., Clersceri, L.S.; Greenberg, A.E.; Eaton, A.D., eds., Section 2060, Samples. A. Collection, 2. Dechlorination, American Public Health Association, American Water Works Association, Water Environment Federation, Washington, D.C.

4. Versteegh, J.F.M.; Havelaar, A.H.; Hoekstra, A.C.; Visser, A. (1989). “Complexing of Copper in Drinking Water Samples to Enhance Recovery of Aeromonas and other Bacteria.” Journal of Applied Bacteriology, 67, pp. 561-566. 5. Finnegan, S.; Percival, S.L. (2015). “EDTA: An Antimicrobial and Antibiofilm Agent for Use in Wound Care.” Advances in Wound Care 4(7), pp. 415-421. 6. Lin, Y.E.; Vidac, R.D.; Stout, J.E.; Yu, V.L. (2002). “Negative Effect of pH on Biocidal Efficacy of Copper and Silver Ions in Controlling Legionella pneumophila,” Applied and Environmental Microbiology, 68, pp. 2711-2715.

7. Schets, F.M.; Medema, G.J. (1993). “Prevention of Toxicity of Metal Ions to Aeromonas and Other Bacteria in Drinking-Water Samples Using Nitrilotriacetic Acid (NTA) Instead of Ethylenediaminetetraacdeticacid (EDTA),” Letters in Applied Microbiology 16(2), pp. 75-76.

32 the ANALYST Technology Supplement 2021


Can EDTA/Thiosulfate Neutralize Copper/Silver Biocide Metal Toxicities in Samples When Testing Building Water for Legionella?

Richard D. Miller, Ph.D., is a founder (1993), president, and chief scientific officer at Environmental Safety Technologies, Inc. (EST) and also recently retired as a tenured teaching-research faculty member of infectious diseases microbiology (teaching medical students since 1977) in the School of Medicine at the University of Louisville. He served on the ASHRAE committees that developed the Legionella Guideline 12:2000, as well as the more recently published ANSI/ ASHRAE Standard 188-2015, Legionellosis: Risk Management for Building Water Systems. Through EST, and with his 44 years of experience working with Legionella, he provides environmental testing and risk assessments for Legionella in cooling towers and potable water nationwide. Dr. Miller may be reached at rmiller@ estechlab.com.

continued

Brandon “Smitty” Smith is the vice president of laboratory services at EST, having spent the last 16 years working with Dr. Miller to create and refine environmental testing. A graduate of the University of Louisville, he has served on AWT and CTI committees for more than a decade. He has comprehensive knowledge of healthcare pathogens, industry microbial corrosion, and diagnostic microbiology. Mr. Smith may be reached at bsmith@estechlab.com This article is based on a presentation given at the 2020 AWT Interactive Convention & Exposition, which was conducted September 29–October 2, 2020.

WEST February 23–26, 2022 • Hyatt Regency Lake Washington • Seattle, Washington EAST March 30–April 02, 2022 • Cleveland Marriott Downtown at Key Tower • Cleveland, Ohio

Categories

RO/Ultrafiltration  Sales Fundamentals and Applications Water Treatment  Wastewater Treatment

To learn more, scan the QR-code or go to https://bit.ly/3n9yyBT. 33 the ANALYST Technology Supplement 2021


Can a Novel Colloidal Adsorbent Material and Robust Separation Process Improve PFAS Removal? Terence K. Reid, David Holland, and Joseph Campanaro (Aqua-Aerobic Systems, Inc.), and Joseph Quinnan (Arcadis)

Background

A series of field tests was conducted using an innovative sorbent material to remove per- and polyfluoroalkyl substances (PFAS) from various water sources. Unit adsorption rates of the sorbent media were compared with measured and reported values for granular activated carbon (GAC) using similar breakthrough targets. The carbon-derived colloidal sorbent is held in a suspension to react with contaminated water and then recirculated through a separator that retains the sorbent while discharging clean water. The studies revealed that PFAS adsorption rates were as much as 500 to 1,000 times higher than those of GAC,

depending on the specific PFAS compound. The novel sorbent material was also more effective in removing smaller-chain PFAS compounds compared to GAC. Unlike GAC and ion exchange (IX) technologies, the adsorption/separation process (ASP) features automated sorbent replacement on timed intervals to optimize performance by minimizing potential co-contamination, biofouling, and scaling effects. This technical article reviews the elevated PFAS removal, reduced sorbent demand, and optimized replacement approach that result in significantly less operation and maintenance (O&M) costs than a GAC system. 34 the ANALYST Technology Supplement 2021


Introduction

PFAS represents a group of approximately 8,000 man-made compounds that have existed on our planet only in the last 80 years. As the name suggests, they are characterized by multiple carbon-fluorine (C-F) polar covalent bonds that are among the strongest of all chemical bonds. As a result, these compounds have exceptional stability and exhibit properties that have a wide array of commercial and industrial uses, most notably as fire-fighting foam, water repellants, and nonstick coatings. While their high chemical stability makes PFAS uniquely suited for applications that require product strength and longevity, it also makes them exceptionally difficult to break down. This resistance to chemical and biological oxidation, as well as their relatively low molecular weight and hydrophobic nature, allow them to spread freely and persistently within our environment, earning them the nickname “forever chemicals.” Global use of products containing PFAS has resulted in ubiquitous exposure to plants and animals. Studies have shown that small amounts of PFAS are in much of what we eat and drink, and that these compounds accumulate in our blood, liver, and kidneys without subsequent metabolism. To complicate matters, PFAS concentrations as low as 10 nanograms per liter (ng/L) (parts per trillion [ppt]) can cause high cholesterol in humans (1), and higher concentrations are suspected to cause much more serious health problems, such as kidney and testicular cancer, liver disease, thyroid problems, heart problems, and ulcerative colitis (2). The link between our food and the health risks of PFAS ingestion has garnered the attention and actions of organizations such as the Food and Drug Administration, the U.S. Environmental Protection Agency, the U.S. Department of Agriculture, the National Institutes of Health, the Centers for Disease Control and Prevention, and the U.S. Department of Defense, as well as local and state governments and national organizations. As awareness and understanding of PFAS emerge, so too are the acceleration and advancement of new treatment approaches. GAC is a commonly used PFAS adsorbent but is primarily effective on the longer, eight-carbon chained compounds, such as perfluorooctanesulfonic acid (PFOS) and perfluorooctanoic acid (PFOA). Limited capabilities removing short-chained PFAS and high disposal costs have driven the need for new, more effective solutions. A colloidal slurry of a carbon-based sorbent has demonstrated specific PFAS adsorption rates as much as 500 to 1,000 times higher than the most efficient GAC products when tested on the same PFAS-laden water source (3). The larger surface area and smaller diameter offer greater

penetration to internal micro- and mesopores, permitting high reductions in both long- and short-chained PFAS. A novel technology adaptationB employs a separator to generate a highly concentrated sorbent suspension and produce superior removals of broad-spectrum PFAS from water. Specific adsorption rates of 2 to 4 milligrams (mg) of quantifiable PFAS per gram (g) of sorbent were exhibited prior to breakthrough and were dependent on the water characteristics, slurry concentration, and PFAS species. A unique operational component shifts focus away from long intervals between replacements to more frequent, but smaller sorbent exchanges. As a colloidal suspension, the system can use automation to remove spent sorbent and replace it with new material without operator intervention. Accelerated adsorption kinetics and expedited replacement (in smaller amounts) greatly reduces the sorbent mass required for operation and improves options for treatment and disposal. The ASP’s rapid adsorption and higher loading capacity prior to breakthrough offers an improved PFAS removal solution for both drinking water and site remediation applications.

Methodology

Systematic testing from initial bench trials to long-term field studies was conducted to assess and optimize the performance of the ASP technology to remove PFAS on various water sources. This article examines the results from a series of independent testing, including these areas: 1. PFAS removal with co-contaminants 2. Contaminated drinking water 3. Brackish groundwater 4. Nanofiltration concentrate 5. Highly contaminated groundwater While the sizes and flows of the pilot units used at these sites differed, they all used production-level sorbent material and separation technologies. Such testing represents a critical difference compared to the conventional rapid, small-scale column testing (RSSCT) commonly used to project GAC performance. Further, the intentionally short replacement interval permits real-time testing to be completed within days or a few weeks without accelerating test conditions to reach breakthrough rapidly and artificially. A unique attribute of the ASP system is in its use of cross-flow to enhance contact between the pollutant and the sorbent material. The colloidal sorbent material has a Mohs hardness between 2 and 3, whereas the separator offers

“As awareness and understanding of PFAS emerge, so too are the acceleration and advancement of new treatment approaches.” 35 the ANALYST Technology Supplement 2021


Can a Novel Colloidal Adsorbent Material and Robust Separation Process Improve PFAS Removal? continued

a value greater than 9. As a result of cross-flow, the sorbent continually scours the separator’s surface, thereby limiting surface fouling without undue abrasion, resulting in extended run times. The general process flow is depicted in Figure 1. In certain applications, it may be necessary to remove sediment and other debris with pretreatment. The raw water is then mixed with the sorbent material in the sorption reactor before being separated from the main flow. Periodically, treated effluent is back-pulsed into the separator to dislodge solids and return them back to the sorption reactor. The exhausted sorbent is replaced with fresh material and thickened prior to disposal. Figure 1: ASP process flow diagram.

concentrations, and aggressively mixed for 45 minutes (min) prior to testing to produce levels ranging from 3,000 to 46,000 ng/L total PFAS. Adsorption competition with co-contaminants was facilitated by introducing a mixture of benzene, ethylbenzene, toluene, and xylene (BTEX) isomers and ethanol. Raw water samples were mixed and held in a 1 cubic meter (m3) (264 gallons [gal]) bulk liquid dosing tank and pumped directly to the sorption reactor for contact with the sorbent suspension. The PFAS was adsorbed onto the sorbent suspension, which was continuously recirculated through the separator. Treated water passed through the separator with the concentrated sorbent returned to the sorption tank. To prevent sorbent and other solids from building up on the separator surface, the separator was pulsed with clean effluent at 20 to 30 min intervals, with dislodged solids recycled to the sorption tank rather than discharging to waste. The process was facilitated with a small-scale, fully automated ASP system (Figure 2). Figure 2: Testing in the development company’s research center using a small-scale ASP system.

Figure key: 1. Influent strainer; 2. Cloth media filter; 3. Feed pump; 4. Adsorption reactor; 5. Recycle pump; 6. Separator; 7. Effluent tank; 8. Back-pulse pump; 9. Sorbent concentrator; 10. Supernatant pump; and 11. Waste container.

PFAS removal with co-contaminants. Subsequent to initial proof-of-concept testing in the lab, controlled testing of the automated system was conducted by the research/product development company.C The test used a matrix of PFAS-laden groundwater, spiked tap water, and domestic secondary clarified effluent (SCE) from a municipal wastewater treatment plant. Groundwater samples were retrieved from several military sites impacted with aqueous film-forming foams (AFFF) at varying PFAS strengths and total organic carbon (TOC) contents. Tap and SCE effluents were spiked using heptadecafluorooctanesulfonic acid potassium salt and heptadecafluorooctanesulfonic acid potassium salt (Sigma-Aldrich). The commercially available PFOS and PFOA were measured, introduced to the source to

“Systematic testing from initial bench trials to long-term field studies was conducted to assess and optimize the performance of the ASP technology to remove PFAS on various water sources.

Feed flows were matched to the effluent discharge rate by tying the feed and discharge flow meters with the pump speed through a proportional integral derivative (PID) control loop. Feed totes were monitored and replenished on a biweekly basis with PFAS 36 the ANALYST Technology Supplement 2021


Can a Novel Colloidal Adsorbent Material and Robust Separation Process Improve PFAS Removal? continued

spiking as necessary based on the specific test protocol. Composite feed samples were analyzed on each batch and combined with periodic effluent grab samples. Sorbent concentrations were measured prior to the start of the test and verified by sampling the sorption reactor at the tests’ conclusion. Cumulative treatment volumes were identified on effluent samples to permit tracking the PFAS application rate with the expected sorption rate (in micrograms per gram [µg/g] of PFAS sorbent).

Contaminated Drinking Water Testing

Further testing of the ASP technology was conducted in conjunction with a 7-month ongoing study to evaluate GAC products (4) in the removal of PFAS compounds from the same groundwater. The GAC products were tested in the pilot system for approximately 33,000 bed volumes, during which system effluent was monitored for PFAS breakthrough. Each of the four GAC columns in the system was operated with a surface loading rate of 6.1 meter per hour (m/hr) (2.5 gallons per minute per square foot [gpm/ft 2]) and an empty bed contact time of approximately 10 min. A series of tests were conducted using a fully automated ASP system to evaluate the system performance at various sorbent levels to quantify the specific adsorbance. Effluent samples were collected at specific time increments to identify the 10% breakthrough threshold point in a manner consistent with the GAC study. Two source waters were evaluated in the study. One source comprised groundwater collected from a nearby aquifer and had relatively low-PFAS concentrations (< 200 ng/L PFAS). This proved problematic, as the ASP system, unlike the GAC system tested in parallel, did not reach breakthrough within the defined test duration. A second source of groundwater was obtained from a holding tank at a nearby firefighting training area. This groundwater was diluted with dechlorinated tap water to produce a highly concentrated influent stream (>90,000 ng/L PFAS).

Brackish Groundwater

An extensive pilot study was commenced in January 2020 at the Brackish Groundwater National Desalination Research Facility (BGNDRF) in Alamogordo, New Mexico, using a nominal 200 liters per day (L/day) automated pilot unit shown in Figure 2. The overall objective of this testing was to characterize the PFAS adsorption rates to determine the ASP’s response to brackish groundwater. The ASP pilot unit was commissioned at the BGNDRF indoor test facility with feed supply drawn directly from Well #2. Due to the relatively low PFAS concentrations present in the groundwater (< 300 ng/L), the operating sorbent levels were reduced compared to prior testing on highPFAS waters. Of interest in this study was assessing the benefit of reduced sorbent and short replacement intervals on a brackish groundwater with elevated scaling potential. The system was left

to operate continuously with daily sampling (except on weekends) of the feed and filtrate for PFAS analysis. Six trials were conducted January 2020 through February 2021, each with a different combination of feed/discharge flows, recycle flows, detention times, and initial sorbent concentrations to determine the best combination for removing PFAS from the feedwater. Prior to testing, a sample of the source water (from Well #2) was taken and analyzed for pH, conductivity, and 12 different contaminants. Note that the total dissolved solids (TDS) and pH—5,900 mg/L and 8.1 Standard Units (SU), respectively—were rather high for groundwater when combined with a calcium level of 61 mg/L. The Langelier Saturation Index (LSI) was greater than 0.5, indicating that the influent had a high scaling potential. The influent TOC level (1.4 mg/L) was not unusual for groundwater, and there was no appreciable measurement of total suspended solids (TSS); therefore, solids buildup on the separator surface was unlikely.

Nanofiltration Concentrate

Two membrane technologies—nanofiltration (NF) and reverse osmosis (RO)—have been shown to provide a reliable means of removing the entire spectrum of PFAS compounds when compared with other technologies, such as GAC IX sorbent materials. However, a significant drawback of NF and RO technologies is the high volume of concentrated PFAS that must be disposed of. Depending on the nature of co-contaminants in reject water, GAC and IX technologies may be limited in their ability to reduce PFAS and minimize disposal requirements. As such, NF/RO technologies are often limited to only those applications where there is an ability to pipe the reject water to the publicly owned treatment works (POTW) or, in some cases, ocean discharge. In either case, ultimate disposal of the PFAS is often accomplished through dilution. Previous work has shown that the ASP approach has been effective on brackish groundwater with elevated TDS levels, specifically on PFOA. The sorbent testing also suggested that elevated adsorbent rates could be realized in the presence of certain comingled organic constituents. Testing was conducted on water collected from the reject stream of the existing NF system operated by the Colorado School of Mines (CSOM). The source water was drawn from the city of Denver’s drinking water supply but has been spiked with a commercially available AFFF source used by firefighters (Chemguard). The combined PFOA and PFOS level of about 124 µg/L (Table A, left column) represents the anticipated concentration from a membrane system treating groundwater having 10,000 to 20,000 ppt PFOA/PFOS levels and producing a reject stream that is 10 to 15% of the applied (treated) flow. Testing was performed to identify whether the ASP technology could significantly reduce the waste load from the NF system to a volume from 10 to 15% to less than 0.1% of the NF system’s hydraulic capacity. 37 the ANALYST Technology Supplement 2021


Can a Novel Colloidal Adsorbent Material and Robust Separation Process Improve PFAS Removal? continued

Highly Contaminated Groundwater

Current efforts underway to evaluate novel technology at the Horsham Air Guard Station and Willow Grove Naval Air Station (Horsham, Pennsylvania) suggests adsorption rates for the carbon-based sorbent material A may be significantly higher than reported for GAC (5, 6). These elevated adsorption rates were realized under significantly different influent PFAS levels and water quality conditions. As water characteristics are unique to each contamination site, the goal of this particular study was to evaluate the system performance on a groundwater with an exceptionally high PFAS content. To complete this, PFAS-contaminated groundwater collected from the former Wurtsmith Air Force Base (Iosco County, Michigan) was evaluated with the ASP technology. The average PFAS concentrations for this test are shown in the right column of Table A.

PFAS removal with co-contaminants. The primary objectives of this testing were to validate the ASP system’s functionality and performance and to quantify unit PFAS removals in the presence of co-contaminants. Testing was specifically designed to identify specific adsorption by spiking to sufficiently highPFAS levels and maintaining a low sorbent concentration using different detention times. As shown in Table B, a series of tests were conducted on spiked tap water ranging from 3,000 to 46,000 ng/L PFAS comprising mainly PFOA and PFOS. The system exhibited high adsorption rates from 600 to more than 4,000 µg/g at sorbent levels of only 100 to 500 mg/L. Table B: Proof of Concept Testing Results Measurement Type

Unit

Test Condition 1

2

3

4

Table A: Influent PFAS Composition for the NF Concentrate and Highly Contaminated Groundwater

Influent PFAS

ng/L

21,000

46,000

3,000

15,000

Effluent PFAS

ng/L

125

114

146

128

PFAS Compound

NF Reject Influent (ng/L)

AFFF Groundwater Influent (ng/L)

PFAS removal

%

99.4%

99.8%

95.1%

99.1%

PFBA

2,061

240

Sorbent concentration

mg/L

100

500

100

500

PFPeA

3,814

859

Specific adsorption

µg PFAS/g S 4,384

1,911

594

604

PFHxA

7,777

3,021

PFHpA

1,543

444

PFOA

10,295

5,030

PFNA

BDL

136

PFPrS

2,887

28

PFBS

7,196

123

PFPeS

5,820

244

PFHxS

37,037

10,093

PFHpS

3,300

540

PFOS

113,807

33,313

6:2 FTS

BDL

5,235

8:2 FTS

BDL

883

FOSA

BDL

1,892

FBSA

BDL

785

FHxSA

4,024

24,219

PFEtCHxS

1,428

135

Total

200,991

87,222

Note: BDL = below detectable limit

Results

The following presents a summary of independent testing conducted to characterize the ASP system’s performance.

Follow-up testing was conducted under similar conditions, as listed above, but additionally spiked with a mixture of benzene, ethylbenzene, toluene, and xylene isomers to a total BTEX concentration of 1,000 to 2,000 ng/L. In addition, the water was dosed to an 80 to 100 mg/L TOC level mainly consisting of ethanol. This testing was designed to evaluate the impact of co-contaminants on the PFAS removals. In this study, the sorbent concentration was the most important factor in withstanding the impact of co-contaminants. At a 100 mg/L sorbent level, PFAS adsorption remained high, but was about half of the values observed without BTEX and ethanol spiking. However, the testing at a 500 mg/L sorbent level realized sorbent rates of 94% of the testing without BTEX and ethanol. BTEX removal in these tests were also high, with the sorbent achieving 80 to 90% reductions.

Contaminated Drinking Water Treatment Results

The ASP pilot achieved much greater adsorption of per- and polyfluoroalkyl acids (PFAAs) than did the GAC system in the high-PFAS stream, as shown in Table C (4). The asterisk (*) indicates that a 10% breakthrough threshold was observed. Note that the ASP sorbent achieved 1,096, 129, and 482 times the adsorption of PFOS, PFOA, and total PFAS per gram of material compared to GAC. Even so, neither treatment achieved 10% PFOS breakthrough.

38 the ANALYST Technology Supplement 2021


Can a Novel Colloidal Adsorbent Material and Robust Separation Process Improve PFAS Removal? continued

Table C: Specific Adsorption Rates Treating Contaminated Drinking Water* PFOS

PFHxS

PFOA

PFHxA

PFHpA

PFPeA

PFBS

Sum PFAS

GAC

≥ 2.4

2.2*

0.86*

0.43*

0.0033*

0.12*

0.015*

6.2

ASP

≥ 2,630

121

111

95.9*

31.3*

3.28*

0.338*

2,990

*All measurements in µg PFAS/g sorbent material.

Brackish Groundwater Treatment

Figure 3 illustrates the ASP performance over the course of the study with respect to removal of PFOA and PFOS, where PFOA was the dominant PFAS species measured in Well 2. The system was able to meet the U.S. Environmental Protection Agency (EPA) health advisory limit (HAL) value (70 ng/L) to a PFOA/PFOS-specific loading (adsorption rate) of approximately 130 µg PFOA/PFOS per g sorbent in the sorption reactor. The benchmark breakthrough threshold (90% removal) was a bit lower at approximately 90 µg PFOA/PFOS per g sorbent while achieving an effluent of about 25 ng/L. For point of reference, the adsorption rate for GAC at breakthrough reported from previous work on this water was about 6 µg of combined PFOS and PFOA per g carbon and is plotted on the same chart (gray dotted line at the left side). Figure 3: Specific loading (adsorption rates) of combined PFOA and PFOS at BGNDRF.

Figure 4: Specific loading (adsorption rates) of PFOA at BGNDRF testing lab.

NF Concentrate Treatment Results

The ASP technology proved to be highly effective in removing PFAS from the concentrated NF reject water. Figure 5 shows breakthrough curves for the key compounds identified in the testing based on a 10% breakthrough threshold. The primary focus was on PFOA and PFOS removal, but also on the sum of the six compounds identified in the EPA’s Third Unregulated Contaminant Monitoring Rule (UCMR 3), which also included perfluorononanoic acid (PFNA), perfluorohexanesulfonic acid (PFHxS), perfluorobutanesulfonic acid (PFBS), and perfluorohexanesulfonic acid (PFHxS). The system was operated under the same design parameters expected under full-scale deployment. Figure 5: NF reject breakthrough curves for key compounds.

The BGNDRF pilot achieved much greater adsorption of PFOA than a GAC system had achieved during a previous test on the brackish groundwater. Figure 4 shows the specific loading (adsorption rates) for both the ASP and GAC systems. Despite the high TDS (5,900 mg/L), the PFOA removal remained high at approximately 70 µg/g.

“The carbon-based sorbent material’s removal capacity on a unit-mass basis was about 1.6 to 2.9 times greater than that observed with ion exchange resins, and 37 to 53 times greater than that of GAC.”

The test treatment technologyB of the NF reject water resulted in adsorption rates that exceeded preliminary estimates before the test. As such, the 12 g/L sorbent level was higher than necessary, as the system did not reach the targeted breakthrough condition for PFOS and combined PFOS and PFOA. 39 the ANALYST Technology Supplement 2021


Can a Novel Colloidal Adsorbent Material and Robust Separation Process Improve PFAS Removal? continued

The sorbent material exhibited a specific adsorbent rate of over 3,000 µg PFAS g/s while achieving greater than 90% removal. TOC represents a co-contaminant that can sometimes interfere with PFAS adsorption. The NF reject water contained an appreciable amount of TOC with a 23 mg/L average influent level. More importantly, the ASP system was able to remove from 64 to 89%, yielding an average effluent of 5.6 mg/L. While the NF technology effectively removes organics, it concentrates the TOC into the waste stream and was effectively removed by the carbon-based sorbent material.A As such, use of the PFAS removal technologyB on NF reject waste allows the ASP system’s effluent to be re-routed to the NF influent, thereby greatly reducing disposal costs for prospective treatment plants. For example, the waste sorbent that is expected to be produced reduces the overall system waste volumes from 10 to 15% to less than 0.05% of the raw water feed flow.

Contaminated Groundwater Treatment

The novel treatment system was highly effective in removing the UCMR 3 compounds from the groundwater at comparatively high adsorption rates. This study was particularly beneficial to benchmark the colloidal adsorbent material’s performance against IX and GAC, which had previously been studied on the same water. Using a common 10% breakthrough threshold, the relative adsorption rates for the three technologies are presented in Table D. Table D: Specific Adsorption for GAC, IX, and AquaPR-206 at Ce/Co = 0.1 Adsorption Capacity (µg PFAS/g Sorbent) Sorbent Type

PFOS

PFOA

Granular activated carbon

140

14

Ion exchange resin

4,700

180

Novel treatment

7,464

519

The carbon-based sorbent material’sB removal capacity on a unit-mass basis was about 1.6 to 2.9 times greater than that observed with ion exchange resins, and 37 to 53 times greater than that of GAC. The colloidal adsorbent was also able to achieve less than 70 ng/L effluent of each PFOS and PFOA from influent levels of 33,000 and 5,000 ng/L, respectively. The specific adsorption at the 70 ng/L condition was over 3,500 µg PFOS/g sorbent and 286 µg PFOA/g sorbent. While such comparisons are useful, the slurry form of the colloidal adsorbent offers flexibility not as readily available in the sorbents, which offer a fixed bulk density. For this testing, the slurry was operated below 12 g/L, but can be operated in a range from 1 to more than 40 g/L. This slurry form permits operational adjustments to provide more or less sorbent mass as desired to meet changing conditions.

Discussion

While all water sources demonstrated that the colloidal carbon-based sorbent A can achieve much higher adsorption rates than seen with GAC, the rates for the sorbent were very different at each site due to the presence of co-contaminants and other water quality characteristics. The highest rates were observed on the groundwater that was highly contaminated with AFFF compound. In this application, the water contained a high PFAS concentration but low levels of the organics, suspended solids, and other co-contaminants found in other feedwaters. Results were favorable, as there were very few compounds competing or interfering with the PFAS for the available active sites on and within the sorbent. The brackish groundwater at the BGNDRF facility had much lower concentrations of both PFAS and organics; however, the PFAS/TOC ratio was the lowest of all the sites. To complicate matters, the water had a high scaling potential, resulting in the buildup of calcium carbonate on the surface of the sorbent. Despite these conditions, ASP technology yielded similarly high adsorption when considering the BGNDRF well water primarily comprised PFOA (about 10 times higher than PFOS). Results from this testing were consistent with those from other tests, suggesting that the input of high TDS may have a minor effect on the ASP performance. The novel PFAS removal technologyB was able to achieve high unit removal rates of PFAS on the rejected concentrate from nanofiltration of drinking water. The benefit of the NF system is that it can remove virtually all PFAS compounds while maintaining a high (85 to 90%) recovery. Further, the PFAS compounds are rejected while salts are permitted to flow through the membrane and do not accumulate in the concentrate stream. However, a significant challenge with NF systems is that they will also concentrate co-contaminants such as total and dissolved organic carbon and suspended solids, which compete with PFAS removal in the sorbent and adsorptive treatments. The concentrated waste can be problematic to certain adsorptive technologies that aim for extended media replacement intervals, such as GAC and IX. Conversely, the novel PFAS removal treatment systemB features frequent, automatic and planned sorbent replacement to avoid scaling, biofouling, and other interferences presented by the co-contaminants. The ASP technology can then be used to treat and reduce reject streams to increase overall recoveries to >99%.

Conclusions

These studies demonstrated that the ASP sorbent can remove/ reduce a broad spectrum of PFAS compounds using a fraction of the media required by GAC and IX systems. The ASP sorption reactor design provided operational flexibility to maintain high sorbent concentrations as necessary to prolong carbon exhaustion or to target lower molecular weight PFAS compounds. 40 the ANALYST Technology Supplement 2021


Can a Novel Colloidal Adsorbent Material and Robust Separation Process Improve PFAS Removal? continued

In addition, the use of a robust separator permitted concentration of the sorbent to minimize waste volume. Specifically, the following conclusions can be drawn from the testing: •

Adsorption performance of the ASP sorbent has shown to be 100 to 2,000 times higher than GAC, depending on the PFAS compound.

•

The ASP sorbent outperformed GAC by a factor of 15 to 70 when treating brackish groundwater with 5,900 mg/L TDS and 250 to 300 ng/L PFOS/PFOA.

•

The sorbent will remove smaller-chain PFAS that GAC has little effect on, such as PFBS and PFHpA.

•

Lab testing using the ASP technology can provide scalable results that don’t require scale-up factors often associated with GAC RSSCT results.

•

Unlike GAC systems, the ASP system has automated sorbent replacement and adjustable system parameters that allow it to manage fouling by ensuring that fouling material never accumulates to the point of interfering with the sorbent performance.

References 1. Steenland, K.; Tinker, S.; Frisbee, S.; Ducatman, A.; Vaccarino, V. (Nov. 15, 2009). “Association of Perfluorooctanoic Acid and Perfluorooctane Sulfonate with Serum Lipids Among Adults Living Near a Chemical Plant,” American Journal of Epidemiology 170(10), pp. 1268–1278,

2. Mordock, J. (April 3, 2016). “Lawsuits Blame Illnesses, Deaths on Years of Toxic Pollution from West Virginia Plant,” Sunday News Journal, p. 1A. 3. Reid, T.; Campanaro, J.; Holland, D. (Nov. 8, 2020). “Novel Developments in PFAS Removal Utilizing Superfine Powdered Activated Carbon and Ceramic Membrane Microfiltration Technology,” International Water Conference 2020 virtual sessions, Paper No. 20-54, conference organizer: Engineer’s Society of Western Pennsylvania, Pittsburgh, Pennsylvania.

4. Murray, C.; Vatankhah, H.; McDonough, C.; Nickerson, A.; Hedtke,T.; Cath, T.Y.; Higgins, C.P.; Bellona, C.L. (2019). “Removal of Per- and Polyfluoroalkyl Substances Using Super-Fine Powder Activated Carbon and Ceramic Membrane Filtration,” Journal of Hazardous Materials, vol. 366, pp. 160-168,

5. Quinnan, J.,\ ; Reid, T. (Sept. 23, 2021). “PFAS Groundwater Treatment Using Sub-Micron Powdered Activated Carbon (SPAC) and Ceramic Membrane Filter System (CMF),” Strategic Environmental Research and Development Program/ Environmental Security Technology Certification Program (SERDP/ ESTCP) Webinar Series #140, U.S. Department of Defense, Washington, D.C., information available at http://serdp-estcp.org/Tools-and-Training/Webinar-Series. 6. Holland, D.; Quinnan, J.; Reid, T. (Oct. 18, 2021). “Novel Approach to PFAS Removal Using a Highly Adsorbent Material and Robust Separator Minimizes Usage and Waste Production,” Water Environment Federation 2021, Session 1428.

Endnotes A

B

C

The colloidal slurry of a carbon-based sorbent material noted in the text is known as AquaPR-206™, which is made by Aqua-Aerobics System Inc., Loves Park, Illinois.

The novel technology referred to in the article is known as the AquaPRS™ PFAS Removal System. It is made by Aqua-Aerobics Systems Inc., Loves Park, Illinois.

Terence Reid is the director of research and development for Aqua-Aerobic Systems Inc. He is responsible for overseeing activities focused on product enhancement and new product design and development in the areas of biological treatment, filtration, and membrane technologies. He holds several patents in activated sludge, filtration, and software control methods. Mr. Reid earned a bachelor’s degree in civil and environmental engineering from the University of Wisconsin-Madison and a master’s degree in product design and development from Northwestern University, He is a licensed professional engineer registered in the state of Illinois. Mr. Reid can be contacted at treid@aqua-aerobic.com. Dave Holland has 41 years in water and wastewater treatment consisting of design, sales, pilot testing, commissioning, and documentation of media filtration/separation, clarification, softening, deionization, micro/ultrafiltration, nanofiltration, reverse osmosis, and biological treatment. He has an associate degree in technical writing and is currently completing a bachelor’s degree in chemical engineering. Mr. Holland is on the board of directors for the American Membrane Technology Association and is a member of the American Water Works Association and the American Institute of Chemical Engineers. Mr. Holland can be reached at dholland@ aqua-aerobic.com. Joseph Campanaro is a senior R&D engineer at Aqua-Aerobic Systems Inc. with 20 years of experience in membrane filtration and related separations technologies, focusing on pilot testing and new product development. He holds a master’s degree in environmental engineering from NYU Polytechnic. Mr. Campanaro may be contacted at jcampanaro@aqua-aerobic.com. Joe Quinnan is a senior vice president with Arcadis in Novi, Michigan. He has more than 30 years of professional experience in environmental consulting and is co-author of the book Remediation Hydraulics (CRC Press, 2008). He is the technical lead for Arcadis’s PFAS programs for the DoD and North American director of emerging contaminants. Mr. Quinnan is currently leading ESTCP projects evaluating superfine powdered activated carbon and ceramic membrane filters (SPAC-CMF) to treat PFAS-impacted water and soil washing to treat PFAS source zones. He has both a master’s and a bachelor’s degree in geological engineering from Michigan Technological University.

Aqua-Aerobics Systems Inc. is the research/technology development company mentioned in the text.

41 the ANALYST Technology Supplement 2021


How DNA Sequencing Can Aid Integrated Microbiome Management in Water Systems Alison Ling, Ph.D., P.E., Barr Engineering Co., and John Tillotson, M.S.C.E., WaterTrust

42 the ANALYST Technology Supplement 2021


How DNA Sequencing Can Aid Integrated Microbiome Management in Water Systems

Background

Existing culture-based methods that are used to evaluate water system microbiology miss more than 99% of the microbes present. This is because less than 1% of microbe types can be grown in a lab using culture methods much of the industry relies on (1). Thanks to molecular methods, we have a better than ever understanding of the microbial world around us. By applying a combination of DNA-based methods, water systems can be characterized in a way that has previously been unavailable to industry in terms of how many and what types of microbes are present. 16S and 18S ribosomal ribonucleic acid (rRNA) qPCR, and amplicon sequencing can characterize nearly all the microbes in a system and approximate their quantity. These methods have response time and accuracy advantages over current culture-based microbiological monitoring methods. In addition, the cost and performance of DNA sequencing continues to improve and open expansive new opportunities for understanding the microbial world. We propose a framework where scientists, engineers, and operators within a facility or industry work together to develop and refine Key Performance Indices (KPIs) and operational decision-making tools based on knowledge gained through operational and microbiome data. If this Integrated Microbiome Management framework is knowledgeably applied across the industry, these tools have the potential to improve operations, reduce downtimes, decrease health risks, and save costs.

Introduction Problems in Water System Microbiology

Microbes, or microscopic organisms, are ubiquitous in both natural and built environments. While most microbes are harmless and sometimes even beneficial, uncontrolled microbial growth in many built water environments can lead to negative health and operational outcomes. The combined microbial community present within a specific location or system is called the “microbiome.” This article outlines limitations and opportunities for microbiome control in clean water systems, including both potable water building plumbing systems as well as cooling water systems. Biofilms develop in water systems where nutrients are available for growth. Key factors that support biofilm growth include nutrient and carbon availability, moderate-to-high temperatures, and stagnant flow conditions. While the specific issues presented by biofilms differ depending on the type of water system, improved understanding of the responsible microbiome can provide benefits across systems. In cooling water systems, significant air intake and water evaporation increase concentrations of carbon (i.e., microbe food) and nutrients (i.e., microbe vitamins and minerals) available for biofilm growth. Primary issues associated with cooling towers

continued

include legionellosis risk, biological fouling, loss of heat transfer efficiency, and microbial influenced corrosion. Microbially induced corrosion (MIC) can be a byproduct of biofilms, posing a risk to equipment and plant uptime. Legionellosis is a health risk posed by human pathogen Legionella pneumophila, which can impart disease if it makes it into the air and then into people’s lungs. The presence of biofilms and higher life forms like amoeba and protozoa exacerbate Legionella pneumophila’s ability to grow and persist in water systems. Potable water systems can be sourced from a large utility or privately from wells. Either way, water needs to remain safe to drink throughout the distribution system, including premise plumbing within specific properties. The widespread use of free chlorine or chloramine in U.S. potable water systems means that microbes growing in those systems tend to be chlorine resistant. These microbes include Legionella spp. and NTMs. Premise plumbing in particular presents microbiological complexities due to more intermittent use, low/no-flow areas, and lower or no disinfectant residual. As a result, the drinking water microbiome and its source biofilms often differ between private and premise plumbing controlled by a property owner and distribution systems controlled by a utility. Key issues associated with drinking water systems include microbial contamination, corrosion, and pathogen regrowth. Microbial contamination can occur after potable water has left the water utility but before it arrives at the user tap. It may include fecal contamination from sanitary lines, birds, wild animals, and/or agriculture and biological contamination from surface water intrusion. Corrosion is affected by many complex factors, including pipe material, water quality, nitrification, and historical as well as current operation. Pathogen regrowth, especially for opportunistic pathogens like Legionella spp. and non-tuberculous mycobacteria (NTM), is supported by general biofilm growth as well as stagnant-flow conditions that remove disinfectant residuals.

Current Methods to Measure and Address Microbial Problems

Current methods to measure and quantify microbiological problems in cooling water systems rely on culture-based methods that take days to weeks to grow and count targeted microbes in the lab. Heterotrophic plate count (HPC) is a culture method to measure general bacterial abundance but does not provide any information about what types of organisms are present. Specific culture analysis of Legionella spp. typically takes 14 days, and this delay can limit an operator’s ability to understand and control associated risks (2–4). More recently, some facilities have started using quantitative polymerase chain reaction (qPCR), which is a rapid test that specifically copies Legionella spp. deoxyribonucleic acid (DNA) containing the 16S rRNA (ribonucleic acid) gene and back-cal 43 the ANALYST Technology Supplement 2021


How DNA Sequencing Can Aid Integrated Microbiome Management in Water Systems

culates original concentrations from the amplified signal (2, 5, 6). This method yields more accurate results faster and can also measure both dead cells and viable but not culturable (VBNC) cells. VBNC cells are cells that can grow and multiply but do not grow well in the specific conditions specified by a culture method. Operators can use oxidizing and nonoxidizing biocides, either on a continuous or intermittent basis, to control microbial growth and biofilms (3, 7, 8).

continued

ing sequencing cost was about $1,000, or 100,000 times lower (9). This change has largely been due to advances in sequencing technology, which have spurred innovative microbial ecology techniques. The study of microbiomes in built environments like indoor air, water systems, and wastewater treatment has benefited from these changes. Less than 1% of microbe types can be grown in a lab using these culture methods on which much of the industry relies (1). Thanks to molecular methods, we have a better than ever understanding of the microbial world around us.

Potable water microbiome sampling typically focuses on culture of pathogens or pathogen indicators (e.g., fecal coliforms) or bulk microbiology measurements (e.g., HPC and BacT). Some commercial laboratory services provide culture tests for a wider range of bacterial pathogens that are of concern in premise plumbing water systems.

Bacteria and protozoa have significantly smaller genomes, which means you can garner lots of useful information about them from relatively fewer sequences than for human genomes. Several different categories of molecular methods have evolved to help elucidate the structure and function of microbiomes (10). The most appropriate method or combination of methods for a given application depends on the specific questions that require answers. Table A outlines these methods, what they are used for, and key limitations.

Molecular Methods

The cost of DNA sequencing and associated molecular biology methods has decreased astronomically over the past two decades. The cost of sequencing human genomes in 2001 was estimated at about $100 million dollars. In 2020, the estimat-

Table A: Summary of Molecular and DNA-Based Methods for Microbial Ecology Analysis Name

What It Measures

Method Description

What Questions It Answers

Limitations

Quantitative polymerase chain reaction (qPCR)

Targeted genes and targeted microbes

PCR amplification of DNA

Who is there and how much? What are they doing?

Needs to be targeted to one specific gene or microbe type. Need to know what you are looking for.

Phylogenetic microbiome profiling (16S/18S rRNA amplicon sequencing)

All 16S rDNA genes (targeted gene for all microbes)

DNA Sequencing

Who is there?

Doesn’t tell you what they are doing, limited to genus specificity. Targets bacteria/archaea or eukarya, not both. Doesn’t capture virus DNA.

Metagenomics

All DNA (untargeted)

DNA Sequencing

Who is there and what can they do?

More prone to errors, limited to family specificity.

Metatranscriptomics

All RNA (untargeted)

Reverse-transcription to DNA and DNA Sequencing

What are they doing?

RNA is short-lived and unstable, so it’s hard to get enough of it. Can be lots of noise from common but unimportant transcripts.

Metaproteomics

Proteins (targeted or untargeted)

Mass spectrometry

What are they doing?

Less developed, can’t read all proteins.

Metabolomics

Targeted chemical metabolites

Analytical chemistry methods

What are they doing?

Difficult to link compounds to microbes.

The two most common methods used in engineered systems are also the most affordable and simplest. Specific steps for both methods are diagrammed in Figure 1.

44 the ANALYST Technology Supplement 2021


How DNA Sequencing Can Aid Integrated Microbiome Management in Water Systems

continued

Figure 1: Pictorial summary of 16S/18S rRNA amplicon sequencing and qPCR

Sample Sample Collection Collection DNA DNA Extraction Extraction qPCR fluorescent amplification

rRNA gene PCR amplification GATTCGATTAC GACTTAATAC

GATTCGATTAC GACTTAATAC

AGTCGATTCGATACAGCTTCA AGCTTCAAGCTTCAAGCTTCA GGTACGACTTAATACCTTCAG AGCTTCAGCTTCAGCTTCAGC

Quantitation using standard

DNA sequencing

GATTCGATAC GACTTAATAC

Sequence data cleanup

GATTCGATAC GACTTAATAC

Pull phylogeny from database

.. .. .... .... . ... ... ... ..

= 100 gene copies/mL therefore = 10,000 gene copies/mL

Quantitative PCR (qPCR)

16S/18S rRNA amplicon sequencing and phylogenetic assignment qPCR is in wide use for measuring Legionella spp., Legionella pneumophila, and more recently, SARS COV-2, in built environments. You need to have a specific gene target in mind to conduct qPCR. In the case of Legionella analyses, you target a variant of the 16S rRNA gene that is very specific to the genus (Legionella spp.) or species (Legionella pneumophila) that you are looking for. You can also target specific genes. For example, you can target an iron-oxidizing gene to quantify microbes that may be involved in MIC. qPCR is highly effective at estimating quantities of targeted microbial types or genes and can now be done on site with fairly simple and affordable equipment. Phylogenetics describes the study of DNA to better understand how different types of life (which are mostly microbial!) are related to each other. This knowledge has supported development of methods that delineate specific microbial groups within a

given sample. 16S/18S rRNA amplicon sequencing is a microbiome fingerprinting method that can identify nearly all microbes in a system. Well-established methods typically read down to a genus level, but some newer sequencing platforms can sequence longer reads that enable species-level identification (11). For example, genus-level data means that you can identify how much of the community is Legionella spp., while species level data means you can identify how much is the Legionella pneumophila. However, it provides information on nearly all microbes present, not just ones that you specifically target. This makes the method unbiased to any previous theories about the microbiome and provides a clear picture of what types of microbes are present and who dominates. The 16S rRNA analysis provides data on bacteria and archaea (like Legionella spp., methanogens, and most pathogens), while 45 the ANALYST Technology Supplement 2021


How DNA Sequencing Can Aid Integrated Microbiome Management in Water Systems

continued

the 18S rRNA analysis provides data on eukarya (higher life forms like protozoa and fungi). This method does not provide quantitative information but can be paired with qPCR targeting the 16S and 18S rRNA gene to translate the microbial fingerprint into semiquantitative results that can be compared between samples and locations. In addition, microbial fingerprinting data provides insight into community diversity, which is an ecological indicator of community stability and complexity. An example outcome of microbiome analysis of cooling waters using 16S rRNA amplicon sequencing is shown in Figure 2. Figure 2: Example of microbiome results for cooling tower waters.

DNA sequencing for phylogenetics or metagenomics can be accomplished on a variety of different platforms. Current methods primarily use Illumina MiSeq and HiSeq technology, which require large sequencing machines in a laboratory setting and can only sequence DNA segments up to 300 to 600 base pairs (DNA letters) at a time. DNA sequencing and other powerful, modern molecular test methods are now becoming available in the form of smart handheld devices that can interface with a personal computer. These handheld DNA-sequencing devices are easily transportable and capable of basic DNA sequencing on site at the customer location, with results within one hour (1, 12). The Oxford Nanopore MinION portable sequencing platform can sequence longer reads than most established sequencing platforms, including the full 1,600 base pair 16S rRNA gene. This means that 16S rRNA amplicon sequencing with this platform could identify microbiome members down to the species level instead of just the genus level (11–13). This change has big implications for pathogen monitoring, as most pathogens cannot be detected by genus-level assays.

Previous use of DNA-based methods to understand water system microbiomes. Previous phylogenetic studies have found cooling tower systems dominated by biofilm formers like Sphingomonadaceae and Pseudomonadaceae (14–16). These systems also commonly contain opportunistic pathogens like non-tuberculous mycobacteria (NTM), which can cause respiratory disease in immunocompromised individuals (16); however, these studies have not been well integrated with plant engineering and operations to link the microbiome to operational outcomes. The microbiome of potable water distribution systems and premise plumbing is highly impacted by pipe material and other biofilm conditions, residual chlorine disinfectant, and water quality (17–19). NTMs and Legionella spp. are widespread, especially in areas that lay stagnant with minimal flow for extended periods of time (17, 18, 20). As with previous cooling water studies, these studies have used limited integration of engineering and operations knowledge and data. Collaborative DNA-based studies between scientists, design engineers, and water system operators have the potential to redefine our understanding of the microbiome and how we 46 the ANALYST Technology Supplement 2021


How DNA Sequencing Can Aid Integrated Microbiome Management in Water Systems

use that knowledge to make decisions and improve operations. One Midwestern city sampled eight potable distribution system locations on consecutive days and found significant amounts of human-associated bacteria in some locations. This finding spurred the city to inspect nearby facilities and find a lack of backflow preventers that was later addressed. That work demonstrated the ability of phylogenetic DNA technology to identify potential water system problems (21).

continued

nity complexity, with biofilms harboring more types of microbes than are typically free-floating (planktonic) in water systems.

Proposed Approach and Opportunity

Existing culture-based methods used to evaluate water system microbiology miss more than 99% of the microbes present. Water system engineers could leverage the abundance and community data provided by the combination of 16S/18S rRNA qPCR and amplicon sequencing to improve system understanding and, subsequently, response times and accuracy of response measures. Note: Forging a direct connection between microbiome data and operational decisions could reduce the costs associated with health risks, loss of heat transfer efficiency, equipment damage, and unplanned downtime. Figure 3 outlines an example of a study designed to manifest these improvements by developing a.) KPIs and b.) decision-making tools.

A recent study conducted by a service companyA used microbiome analysis to help troubleshoot MIC in a stainless-steel potable water system. Following disinfection of the system, total quantities of microbes decreased, but biodiversity remained high, suggesting that biofilms persist in the system through disinfection, and that the threat of MIC will persist unless the biofilms are mitigated. Microbial diversity data (i.e., how many types of microbes are present) provide insight into the commu-

Figure 3: Example framework for Integrated Microbiome Management: Developing meaningful operational outcomes from microbial community data.

Scoping KPIs

Decision Tools

Identify key performance indices (KPIs), based on operational outcomes related to the microbiome

Identify operational decision points and what factors impact what action to take

Data Collection

Analysis

Outcome

Collect microbial community and abundance data at targeted locations

Link KPIs to microbial community data based on reported and measured characteristics of different groups (e.g. slime forming, iron depositing, corrosive, fungi, algae).

Develop predictive relationships between microbial community and KPIs, and use KPI as performance benchmark

Link operational guidance to microbial community data based on what microbes are present under specific good or bad operational conditions.

Develop operator guidance tools to guide decision making based on microbiome measurements

Collect concurrent operational and water quality data

In this article, the authors have outlined some potential KPIs and decision-making tools that could be developed and refined for cooling water systems using microbiome data. This would include linking microbiome data to culture-based measurements for HPC and Legionella spp. Figure 4 shows an example dashboard for a biofilm control KPI.

47 the ANALYST Technology Supplement 2021


How DNA Sequencing Can Aid Integrated Microbiome Management in Water Systems

continued

Figure 4: Example of KPI dashboard and biofilm control.

120,000

Klebsiella

Bacillus

Pseudomonas

Sphingomonas

Candida

Trichoderma

Chlorella

Scenedesmus

Anacystis

Anabaena

Other algae

Total Amoeba

Total Protozoa

Biodiversity Index

5.0 4.5

100,000

4.0 3.5

80,000

3.0 2.5

60,000

2.0 40,000

BIODIVERSITY

SLIME FORMERS, PROTOZOA & AMOEBA

Biofilm Control

1.5 1.0

20,000

0.5

Sample ID Score Biofilm Slime Formers Potential Legionella Hosts Biodiversity

1

2

3

4

5

6

7

8

9

10

Good

Critical

Critical

Critical

Warning

Good

Critical

Critical

Warning

Good

5,100 1.5

42,100

54,000

73,510

23,500

215

595

845

70

2.9

3.3

3.5

3.1

2,100 1.5

44,000

73,510

23,500

490

1,085

70

3.3

4.0

1.7

2,100 1.0

Potential KPIs:

Potential Decision-Making Tools:

•

General biofilm KPI: Biofilm health is related to many specific microbes that form biofilms as well as high microbial diversity, which indicates a complex microbial community most likely to be present in biofilms.

•

•

Microbially induced corrosion KPI: Identify the types of MIC organisms present and target biocides to them, including microbes that cycle iron and sulfur.

•

Legionella KPI: If one can knock down or eliminate biofilms, Legionella has fewer places to grow. An effective Legionella KPI would predict growth opportunities by linking to levels of general biofilms as well as identified Legionella hosts.

Improved biocide guidance: Biocide selection guides, combined with knowledge of what microbes are present and how many, eliminate a lot of guesswork and allow a water treatment professional to select optimal biocides and biocontrol strategies. For even greater precision and cost effectiveness, data on which microbes survive in the presence of specific biocides can be used to develop biocide resistance charts, which can be used to select a biocide based on direct and comprehensive measurement of results.

•

Biofilm preventative maintenance guidance: Use the biofilm KPI to detect the presence and location of biofilms. Provide specifications on how to remove the biofilm from the water system and prevent it from returning in the most cost-effective and environmentally responsible manner based on specific types of biofilm organisms present.

The application and dissemination of any innovative technology will be met with technical hurdles. These anticipated roadblocks are outlined in Table B.

48 the ANALYST Technology Supplement 2021


How DNA Sequencing Can Aid Integrated Microbiome Management in Water Systems

continued

Table B: Potential Roadblocks to Integrated Microbiome Management and Recommended Mitigation Strategies Potential Roadblock

Issue Summary

Recommended Mitigation Strategy

Lack of industry standards for methods

Multiple valid methodologies exist for phylogenetic analysis. These variations can include primers, DNA sequencing platforms, sequence assembly, data cleanup, and phylogeny assignments.

Develop and publish standard methodology for 16S/18S rRNA analyses in the water and wastewater field.

Sample consistency

Microbial community can vary significantly between sites and times and depending on sample collection procedures.

Samples should be collected at a set location using a standard method each time.

Sample contamination

Because this method measures all microbes present, DNA contamination from the sampler’s hands or other surfaces can bias microbial community results.

Use DNA-free sample containers and clean nitrile gloves for each sample. Take care not to touch face or other items before sampling.

Sample hold times

DNA degrades quickly in water, and degradation rates vary by microbe. So, the microbial community you see could change from the actual community during storage.

Conduct qPCR on site if possible. Evaluate and vet DNA preservatives for sampling and shipping.

DNA sequencing depth

For microbial fingerprinting technologies to be effective, you need to sequence enough DNA segments to characterize more than 90–95% of the community.

Monitor number of community members observed (OTU count) and compare to estimated community size (Chao1) to estimate percent coverage.

Summary and Outlook

Normalization of environmental genomics data to one industry standard is critical for molecular methods to advance toward mainstream adoption in the water and wastewater industry. One of the barriers to commercial adoption of more real-time DNA sequencing devices and other rapid molecular test methods is the current lack of industry standards for environmental genomics data. If using a smart handheld device to support DNA sequencing needs in the field, it will need a pre-established framework for translating results to actionable decisions. This framework could be developed now using existing lab-based methods and the Integrated Microbiome Management process described in the article, which can then be applied in the future once more real-time sequencing methods are available. The authors believe the rapid rate of change in cost performance will continue to drive a rapid evolution toward smart handheld genomic devices and online DNA sensors. Different specialty service companiesB and other firms are likely to commercialize these types of mobile, onsite, near real-time DNA analysis solutions over the next few years. These developments represent a unique opportunity for water professionals to improve our collective understanding and control of water system microbiomes such as distributed and premise plumbing potable water systems and open recirculating cooling water systems. This could start with an industrywide survey of microbiome and operational data, followed by a collaborative study to develop and refine KPIs and decision-making tools. By combining microbiome data with operational knowledge and understanding, we have the opportunity to improve the protection of health and the environment in our work while cutting costs and improving service. In the process, water treatment businesses may also increase their appeal and attract future

employees who could become the next generation of water treatment innovators and leaders.

References

1. Santos, A.; van Aerle, R.; Barrientos, L.; Martinez-Urtaza, J. (2020). “Computational Methods for 16S Metabarcoding Studies Using Nanopore Sequencing Data,” Computational and Structural Biotechnology Journal, 18, pp. 296-305, accessible at https://doi.org/10.1016/j.csbj.2020.01.005. 2. Huchler, L.; Fraser, D. (Summer 2021). “Can Onsite qPCR Testing Improve Management of Legionella Infections From Cooling Towers?” The Analyst 28(3), pp. 8-18. 3. Bellavance, M. (2008). “Design Cooling Tower System to Reduce the Risks of Transmitting Legionnaires Disease,” Document 17-18, Cooling Technology Institute, Houston, Texas, available at www.coolingtechnology.org.

4. International Standards Organization (2017). “Water Quality—Enumeration of Legionella,” ISO/TS 11731:2017, accessible at https://www.iso.org/standard/61782.html. 5. International Standards Organization (2019). “Water Quality—Detection and Quantification of Legionella spp. and/or Legionella pneumophila by Concentration and Genic Amplification by Quantitative Polymerase Chain Reaction (qPCR),” ISO/TS 12869:2019, accessible at https://www.iso.org/standard/70756.html. 6. Ahmed, S.; Walker, D.; Mears, A.; Golovan, S.; Lem, P.; Harder, C. (Spring 2021). “Can Onsite qPCR Accurately Detect Legionella Contamination in Cooling Towers?” The Analyst 28(2), pp. 8–18.

7. IWA (2005). “Best Management Practice and Guidance Manual for Cooling Towers,” International Water Association, London, England, accessible at https://www.iwa-network.org/filemanageruploads/WQ_Compendium/ Database/Future_analysis/087.pdf.

8. Veil, J.A; Rice, J.K; Raivel, M.E.S. (1997). “Biocide Usage in Cooling Towers in the Electric Power and Petroleum Refining Industries,” Prepared for U.S. DEO under contract W-31-109-ENG-38, accessible at https://www.evs.anl.gov/ publications/doc/ANL-Biocide_Usage.pdf.

9. NIH (2020). “The Cost of Sequencing a Human Genome,” accessible at https:// www.genome.gov/about genomics/fact-sheets/Sequencing-Human-Genome-cost, accessed Aug. 18, 2021. 10. Zhang, X.; Li, L.; Butcher, J.; Zhang, X.; Li, L.; Butcher, J.; Stintzi, A.; Figeys, D. (2019). “Advancing Functional and Tanslational Microbiome Research Using Meta-omics Approaches,” Microbiome 7, 154 (2019). https://doi.org/10.1186/ s40168-019-0767-6. 11. Zhang, Y.; Liu, W.T. (2019). “The Application of Molecular Tools to Study the Drinking Water Microbiome— Current Understanding and Future Needs,” Critical Reviews in Environmental Science and Technology 49(13), pp. 1188-1235, DOI: 10.1080/10643389.2019.1571351.

49 the ANALYST Technology Supplement 2021


How DNA Sequencing Can Aid Integrated Microbiome Management in Water Systems

12. Nygaard, A.B.; Tunsjø, H.S.; Meisal, R.; Charnock, C. (2020). “A Preliminary Study on the Potential of Nanopore MinION and Illumina MiSeq 16S rRNA Gene Sequencing to Characterize Building-Dust Microbiomes,” Scientific Report, 10, article number 3209, accessible at https://doi.org/10.1038/ s41598-020-59771-0. 13. Matsuo, Y.; Komiya, S.; Yasumizu, Y.; Yasuoka, Y.; Mizushima, K.; Takagi, T.; Kryukov, K.; Fukuda, A.; Morimoto, Y.; Naito, Y.; Okada, H.; Bono, H.; Nakagawa, S.; Hirota, K. (2021). “Full-Length 16S rRNA Gene Amplicon Analysis of Human Gut Microbiota Using MinION™ Nanopore Sequencing Confers Species-Level Resolution,” BMC Microbiol 21, article number 35, accessible at https://doi.org/10.1186/s12866-021-02094-5.

14. Di Gregorio, L.; Tandoi, V.; Congestri, R.; Rossetti, S.; and Di Pippo, F. (2017). “Unravelling the Core Microbiome of Biofilms in Cooling Tower Systems,” Biofouling 33(10), pp. 793–806, accessible at http://DOI.org/10.1080/08927014 .2017.1367386. 15. Pinel, I.S.M.; Moed, D.H.; Vrouwenvelder, J.S.; van Loosdrecht, M.C.M. (2020). “Bacterial Community Dynamics and Disinfection Impact in Cooling Water Systems,” Water Research, 172, accessible at https://doi.org/10.1016/j. watres.2020.115505.

16. Tsao, H.F.; Scheikl, U.; Herbold, C.; Indra, A.; Walochnik, J; Horn, M. (2019). “The Cooling Tower Water Microbiota: Seasonal Dynamics and Co-occurrence of Bacterial and Protist Phylotypes,” Water Research, 159, pp. 464–479, https:// doi.org/10.1016/j.watres.2019.04.028.

17. Ji, P.; Parks, J.; Edwards, M.A.; Pruden, A. (2015). “Impact of Water Chemistry, Pipe Material and Stagnation on the Building Plumbing Microbiome,” PLoS ONE 10(10), e0141087, accessible at https://doi.org/10.1371/journal. pone.0141087.

18. Proctor, C.R.; Dai, D.; Edwards, M.A.; Pruden, A. (2017). “Interactive Effects of Temperature, Organic Carbon, and Pipe Material on Microbiota Composition and Legionella pneumophila in Hot Water Plumbing Systems,” Microbiome 5, article number 130, accessible at https://doi.org/10.1186/s40168-017-0348-5.

19. Cullom, A.C.; Martin, R.L.; Song, Y.; Williams, K.; Williams, A.; Pruden, A.; Edwards, M.A. (2020). “Critical Review: Propensity of Premise Plumbing Pipe Materials to Enhance or Diminish Growth of Legionella and Other Opportunistic Pathogens,” Pathogens 2020, 9, p. 957, accessible at https://doi. org/10.3390/pathogens9110957.

20. Blanc, S.M.; Pender, D.; Vinnard, C.; Gennaro, M.L.; Fahrenfeld; N.L. ( July 2021). “Mycobacteria in the Biofilm Microbiome of Private Well and Premise Plumbing,” Environmental Engineering Science, pp. 607–625, accessible at http:// doi.org/10.1089/ees.2020.0528. 21. Ghylin, T. (2014). “DNA-based Microbial Analysis Detects and Locates Potential Contamination in Distribution System.” Journal of the American Water Works Association 106(3), pp. 58–61.

Additional Sources

ANSI/ASHRAE (2021). “Legionellosis: Risk Management for Building Water Systems,” ANSI/ASHRAE Standard 188-2021, American Society of Heating, Refrigerating and Air-Conditioning Engineers, Atlanta, Georgia.

Bautista-de los Santos, Q.M.; Chavarria, K.A.; Nelson, K.L. (2019). “Understanding the Impacts of Intermittent Supply on the Drinking Water Microbiome,” Current Opinion in Biotechnology, 57, pp. 167–174, accessible at https://doi. org/10.1016/j.copbio.2019.04.003.

Bentham, R. (2000). “Routine Sampling and the Control of Legionella spp. in Cooling Tower Water Systems,” Current Microbiology, 41, pp. 271–275, accessible at https://doi.org/10.1007/s002840010133.

continued

Centers for Disease Control (2019). “Guidelines for Environmental Infection Control in Health-Care Facilities,” accessible at https://www.cdc.gov/infectioncontrol/pdf/guidelines/environmental-guidelines-P.pdf.

Ji, P.; Rhoads, W.J.; Edwards, M.A.; et al. (2018). “Effect of Heat Shock on Hot Water Plumbing Microbiota and Legionella pneumophila Control,” Microbiome 6, 30, accessible at https://doi.org/10.1186/s40168-018-0406-7. OSHA. “Legionellosis (Legionnaires’ Disease and Pontiac Fever),” accessible at https://www.osha.gov/legionnaires-disease/hazards (accessed Aug. 16, 2021).

Endnotes Water Detectives is a service company based in Downers Grove, Illinois, that is a part of WaterTrust. One aspect of the company’s business is to offer test methods for detecting the DNA of microorganisms.

A

B In the text, the authors are referring to Water Detectives and other companies that offer products and test methods to identify the DNA of target microbials.

Alison Ling, Ph.D., P.E., is an environmental engineer with Barr Engineering Co. in Minneapolis, Minnesota, and scientific a advisor at Microbe Detectives. At Barr, Dr. Ling is engaged in front-end design and troubleshooting for water and wastewater treatment projects. Her work includes process modeling, bench testing, and technical advising for clients in the power, mining, food and beverage, and municipal sectors. Dr. Ling holds a Ph.D. in civil engineering from the University of Colorado at Boulder, where she split her time between environmental engineering and microbial ecology lab groups. John Tillotson, MSCE, is the managing partner at Microbe Detectives and its environmental innovation consulting practice, WaterTrust. Over the past five years, Mr. Tillotson has been developing Microbe Detectives’ DNA sequencing services, with a specialization in water reclamation, biological nutrient removal, and anaerobic digestion in municipal and industrial systems. Prior to Microbe Detectives, he had more than 25 years of experience in water/ environment, data, and IoT, including 15 years in sales and marketing at Nalco/Suez and several years as the CMO of Phigenics. Mr. Tillotson holds an M.S. in civil engineering from Tufts University, a B.S. in geochemistry, and a Toxics Use Reduction Planner Certification from the Massachusetts Toxics Use Reduction Institute.

Advertising Index 6

Browne Laboratories, Inc.

15 QualiChem, Inc.

2

Environmental Safety Technologies

52 Special Pathogens Laboratory

26 Myron L Company 7

51 Walchem, IWAKI America Inc.

Pulsafeeder, Inc.

50 the ANALYST Technology Supplement 2021


NEW!

Intuitive Programming with Tap and Swipe on our NEW Color Touchscreen!

WiFi BACnet Graphing AUX DC Power Flexible Mix of Up to 12 Relays

Scan with your camera to learn more and view Launch Video!

walchem.com | 508.429.1110 | info@walchem.com


END THE LEGIONELLA

PARTY I N YO U R P IP E S Special Pathogens Laboratory gives you the Legionella expertise required to protect your clients’ water systems through total Legionella control—testing, water management, education, and certification training to become a professional Legionella Water Safety and Management Specialist.

Get the Legionella resources, tools and support you need from laboratory services to ASSE certification in one place: • Legionella and waterborne pathogens testing • Outbreak response • Legionella consulting services • LegiDoc water management plans • ASSE 12080 certification training

AWT Members Special Offer $200 discount on the next ASSE 12080 certification training. Use discount code: AWT-Discount 20% discount Puzzled by Legionella guidebook. Use discount code: AWT-Discount Learn more

specialpathogenslab.com/asse-12080-certification

• Guidebook: Puzzled by Legionella: A Guide to Understanding Detection, Prevention, and Water Management

THE LEGIONELLA EXPERTS ®

SpecialPathogensLab.com info@specialpathogenslab.com | 877-775-7284


Turn static files into dynamic content formats.

Create a flipbook