Issuu

PROFILES IN AN ANTON MEDIA GROUP SPECIAL SUPPLEMENT• AUGUST 511, 2020

The Post-COVID Job Outlook New School

Hybrid Learning St. Thomas Aquin Comes To as College

Need more information? We're here to help! Contact us at admissions@stac.edu or call (845)-398-4100.

217526 S

DON'T WAIT! Start your application through the Common Application which is now live at www.stac.edu/common-app

AUGUST 5 - 11, 2020 • PROFILES IN EDUCATION

WANT TO STAY CLOSE TO HOME? Come to St. Thomas Aquinas College

At St. Thomas Aquinas College you will earn a top-ranked education in a supportive and caring environment rich with empowering experiences—from research and internships to building homes in third-world countries. •

We have a dedicated team of faculty who will mentor you every step of the way.

•

We have a beautiful, safe, and vibrant campus environment.

•

We have student activities, clubs, and sports programs to ensure you feel welcome and engaged.

•

We have access to New York City, international travel, and community service to enhance your learning experience.

•

We have a proud history of caring for students like you—and an exciting future whereby, together, we will overcome the challenges we face today and develop you into our leaders of tomorrow—leaders with a genuine sense of purpose.

We encourage you to consider St. Thomas Aquinas College, whether you're starting your search or are starting the application process!

Please visit us at www.stac.edu/Education-Relief within 2 weeks to apply for special COVID-19 Relief scholarships amounting to at least $50,000 over 4 years. NYC Metropolitan Area (20 minutes from the heart of Manhattan) 125 Route 340 • Sparkill, NY 10976 • 845.398.4100 • WWW.STAC.EDU 217534 S

PROFILES IN EDUCATION • AUGUST 5 - 11, 2020

Advertorial

Kenneth D. Daly Takes Office as St. Thomas Aquinas College’s Ninth President

Commits to helping students navigate current societal challenges by providing access to affordable education to prepare them for college, community service, and career success.

Long Island resident Kenneth D. Daly, a mission-based educator and business leader assumed his position on July 1st, as the ninth President at St. Thomas Aquinas College (STAC) after a successful 30-year career in clean energy with National Grid and its predecessor companies, KeySpan and Brooklyn Union. He is a passionate educator and has chaired and served on the boards of several colleges while teaching in the classroom as an adjunct professor at St. Francis College since 1992. He served local New York communities, supporting students, and leading emergency response plans and now as the new President of St. Thomas Aquinas College, Ken Daly says, “I am committed to providing students with a very supportive and caring environment

— where inclusion, equity, and diversity are enhanced as part of our values—to help them navigate these challenging times. We have a dedicated team of faculty and administrators who will mentor the students every step of the way. We have a proud history of caring for our students and an exciting future whereby, together, we will overcome the societal challenges we currently face and develop each unique individual into our leaders of tomorrow— leaders who have a true sense of purpose.” St. Thomas Aquinas College is a vibrant, independent, four-year liberal arts college located in the NYC Metropolitan area, just 15 miles North of Manhattan, giving students quick access to learning, cultural, internship, and career opportunities in one of the world’s most exciting cities. STAC’s 60-acre campus provides a safe, welcoming place for students to study at the undergraduate and graduate level. The College offers more than 100 majors, minors, and specializations in the School of Arts and Sciences, the School of Business, and the School of Education. STAC also provides students with the opportunity to participate in college athletics at the Division II, varsity,

club, or intramural level. Freshman or transfer students alike become an integral part of a vibrant, active community of thinkers and doers, athletes and leaders, researchers and scholars. Maybe a student becomes a government president or editor of STAC’s college newspaper. Maybe a student studies at Oxford through the College’s Honors Program, builds houses in Nicaragua or lends a helping hand on South Dakota’s Pine Ridge Indian Reservation — the opportunities are limitless! Visit www.stac.edu to learn more or if you have specific questions contact the Admissions Office at 845-398-4100 or admissions@stac.edu STAC offers graduate programs in education, business and criminal justice. Students get more than a sense of accomplishment; they get to advance their career and earning power. The path to an MBA just got shorter! With the college’s new accelerated programs, you can complete your MBA in a little more than a year, no matter what your degree. For details, call the Dean, Professor Michael Murphy at 845-398-4118.

217537 M

AUGUST 5 - 11, 2020 • PROFILES IN EDUCATION

Roslyn Summer Camp Goes Virtual Students prep for college during the pandemic

BY CYNDI ZAWESKI

czaweski@antonmediagroup.com

daptation in a time of uncertainty has been a defining testament to our education system during the COVID-19 pandemic. The virus that swept the state — and continues to ravage the country — upended traditional classroom settings and educational institutions across the board, from summer camps to college campuses. Time and time again, educators have demonstrated their ability to pivot on a dime — and students are rising to meet the changing times. For the first time in its 54 year history, Summer Discovery Camp in Roslyn took its academic offerings online this year for a virtual experience dubbed Summer Discovery Online. With more than five decades of experience running residential pre-college programs, Summer Discovery is regarded for providing high school students with the opportunity to go to various prestigious colleges for twoto-four week sessions. Students take classes taught by college professors and experience the college campus life to gain college readiness. In light of COVID, the camp went fully online, offering students the chance to be part of virtual courses, virtual activities with students from around the world, and to be a part of exclusive college readiness workshops. This year the camp provided more than 25 pre-college courses at leading universities including UCLA, CU Boulder and UT Austin. Students immersed themselves in courses such as Ideagen Global Leaders Academy Powered by Microsoft; Business of Entertainment, Media and Sports; Advertising in the Digital Age; Issues in Economics and more. Despite the lack of in-person interaction, the students got a lot of the digital experience. “I am having a very good and enjoyable experience with Summer Discovery Online,” student Jude A. said, who participated in the Future Global Leaders Academy, presented globally by Microsoft. “Everything is so organized and easy to access and understand. I feel very comfortable in my class and it’s easy to talk and

discuss different topics. I thought it would be much more confusing getting to all my classes because I’ve never done something online like this before, but it was organized very well.” Prior to this summer, Summer Discover did not offer online education but was quick to transition to a digital platform in order to continue to provide students with a foundation for a competitive college application. The programs were designed to be engaging, as many struggled with online learning during the spring semester. There were no muted Zoom calls or self-guided through Youtube videos. The instructors developed content and projects to connect students virtually throughout the program. “The entire company worked together in teams to build a robust offering and create a positive and comprehensive online experience for students,” Liz Ringel, Summer Discover Chief Marketing Officer, said. “We

built a model that was truly interactive and have received an overwhelming positive response.” With college and career workshops, students also learned how to research their future college, improve public speaking skills and gain application tips. This year’s summer program welcomed students from across the United States, as well as internationally. “I think it’s a good way to get your mind ready for the future years,” student Julia R., who also partook in the online Ideagen Future Global Leaders Academy, said. “It’s never too early to start planning and discovering new college info. I have interacted with many students and learned about many things. It was definitely a good decision to keep me busy during quarantine” Looking ahead to 2021, Ringel said Summer Discovery plans to be back on campuses — but would consider offering online courses, especially during the spring and fall school breaks.

Summer Discovery Camp in Roslyn took its academic offerings online for the first time this year for a virtual experience dubbed Summer Discovery Online. (Photos courtesy of Summer Discovery Camp)

PROFILES IN EDUCATION • AUGUST 5 - 11, 2020

ADVERTORIAL

Island Drafting and Technical Institute — The College for Careers® Island Drafting and Technical Institute (IDTI) was founded in 1957, and is staffed by faculty members who have had professional and practical experience in the engineering, architectural, CADD (Computer Aided Drafting/ Design) and computer and electronics fields. The Institute is accredited by the Accrediting Commission of Career Schools and Colleges, and is authorized to confer two-year associate degrees by the New York State Board of Regents. The Institute’s aim is to graduate students who are well trained and technically qualified so that they may enter their chosen field or continue their education at the baccalaureate or higher level. Island Drafting and Technical Institute has over 50 years of leadership and experience in preparing Long Islanders for careers. By staying abreast of the latest developments in the industry, the Institute continues to provide the personal attention students need to succeed. IDTI began life as the brainchild of Joseph P. Di Liberto, a senior design engineer at Republic Aviation in Farmingdale. Working at Republic by day and teaching by night, he started the school, then known as Aircraft Trade School, with just eight students. “Mr. D,” as he was known, handled the admissions, administration, and teaching all himself, with help from his wife, Gloria. After several years, Di Liberto moved the school from its original home in Amityville, N.Y.,

to the location it has called home ever since — 128 Broadway in the Village of Amityville. In June 1959, the school incorporated and its name was changed to Island Drafting School. In March 1973, the name of the school was changed to its current form — Island Drafting and Technical Institute. IDTI was first accredited by the Accrediting Commission of the National Association of Trade and Technical Schools on January 21, 1967, being on the first list of schools ever accredited by NATTS. In February 1997, the school was authorized by the New York State Board of Regents to confer the Associate in Occupational Studies degree. Under this authorization, the Institute is approved to offer degree programs in computer aided drafting and design/mechanical and computer aided drafting and design/ architectural. In December 1997, the Institute was approved to offer degree programs in electronic and computer service technology.

president James G. Di Liberto has been a fixture at the Amityville campus since the 1970s. And, John G. Di Liberto, who joined the school in 2000, got his start at IDTI handing out leaflets back in the 1960s. In June of this year, Forbes magazine ranked IDTI number 12 on their list of the Top 30 Trade Schools in America. Despite the technological changes of the past half-century, particularly on Long Island, and as drafting tables give way to computers, and drafters move from drawing airplanes to designing buildings, IDTI has continued to provide educational and employment opportunities for its graduates through concentrated, highly structured programs of study that prepare students for careers. Island Drafting and Technical Institute — The College for Careers.®

IDTI also offers to industry, as well as to individual job holders, skills training to improve on-the-job capabilities. Programs can be customdesigned for particular companies, in addition to the extensive program offerings regularly available. Though Joseph Di Liberto passed away in 2002, IDTI’s mission has been carried on by the next generation: his two sons. Current school 214601 M

Island Drafting Technical Institute Island Drafting Technical Institute Island Drafting TechnicalTheTheTheTheInstitute College for Careers College for Careers College for Careers College for Careers ® ®® ® ®

We'll Take You From High School We'll Take You From High School We'll Take You From High School We'll To Take You From High School a Future In 15 Months To a Future In 15 Months To a Future In 15 Months To a Future In 15 Months Associate Degree Programs in: Associate Degree Programs in:

Associate Degree Programs in: Degree Programs in: in:- Architectural Associate Degree Programs Degree Programs • Associate Computer-Aided Drafting & Associate Degree Programs in: in:in: Associate Computer-Aided Drafting & Design Design --Architectural and Mechanical Degree Programs • •Associate Computer-Aided Drafting & Design Computer-Aided Drafting Design -Architectural Architectural Computer-Aided Drafting && Design -Architectural Architectural and Mechanical Computer-Aided Drafting & Design Architectural Mechanical Electronic and Computer Service Technology • ••Computer-Aided Drafting & Design Electronic Drafting &Service DesignTechnology - Technology Architectural andand Mechanical Computer-Aided Electronicand andComputer Computer Service Technology •Electronic and Computer Service Electronic and Computer Service Technology • Electronic andand Service Technology Electronic Computer Service Technology Electronic andComputer Computer Service Technology IDTI Offers: IDTI Offers: IDTI Offers: IDTI Offers: Offers: IDTI Offers: • IDTI Financial Aid Qualified Applicants IDTI Offers: IDTI Offers: Financial Aidfor for Qualified Applicants • •Financial Aid for Qualified Applicants Financial Aid for Qualified Applicants Financial for Qualified Applicants Financial Aid for Qualified Applicants Job Placement Assistance • ••Financial Aid for Qualified Applicants •Job Financial Aid for Qualified Applicants Placement Assistance Job Placement Services Placement Assistance Scholarships Job Job Placement Services • ••Job Placement Assistance Job Placement • Scholarships Scholarships Job Placement Services Scholarships Services • Scholarships Scholarships Scholarships

Scholarships

Accredited College, Accredited College, Accredited College, Accredited College, Accredited College, Accredited College, Accrediting Commission Accredited College, Accredited College, Accrediting Commission Accrediting Commission Accrediting Commission Accrediting Commission of Career Schools and Accrediting Commission Accrediting Commission Accrediting Commission of Career Schools ofofCareer Schools and Career Schools and of Career Schools Colleges of Technology of Career Schools and of Career Schools Colleges of Technology of Career Schools and Colleges Colleges of Technology and Colleges of Colleges Technology and Colleges

and Colleges

IDTI IDTI

® ®® ® ®

The College for Careers The College for Careers The College for Careers The College for Careers (631) 691-8733 www.idti.edu

214596 M

Located in the Village of Amityville, N.Y., at 128 Broadway Located Locatedin inthe theVillage Villageof ofAmityville, Amityville,N.Y., N.Y.,at at128 128Broadway Broadway (631) (631)691-8733 691-8733 www.idti.edu www.idti.edu Located in the Village of Amityville, N.Y., at 128 Broadway (631) 691-8733 www.idti.edu

AUGUST 5 - 11, 2020 • PROFILES IN EDUCATION

More than 4,200 students vied for the 24 admitted slots for the “tuition-free” NYU Long Island School of Medicine. (Courtesy of NYU)

Doctors In The House NYU Long Island School of Medicine welcomes med students with white coat ceremony

White Coat Ceremony is a right of passage for every soon-to-be doctor entering medical school. Even this year, coming on the heels of the unprecedented COVID-19 pandemic, the initiation was a profound milestone for the hardworking class of NYU Long Island School of Medicine. Last month, the institution hosted a White Coat Ceremony following all the social distancing safety precautions to mark the occasion. The recognition honored the graduation elite class. More than 4,200 students vied for the 24 admitted slots for the “tuition-free”, illustrating the unwavering dedication of these individuals entering the field of medicine during this challenging time. “Our students are entering this field with great solemnity and clarity of purpose, with the pandemic energizing them even more so to help advance medical care,” Steven Shelov, MD, Founding Dean and Chief Academic Officer, NYU Long Island School of Medicine, said. The school’s White Coat Ceremony included students reciting a version of the Hippocratic Oath acknowledging their commitment to serving humanity with honor, compassion and dignity. During the ceremony, each student donned a white medical coat in a ritual that could be seen by family and friends via Zoom. “Medicine is about lifelong

learning, and the path to becoming traditional four-year schools that a physician is not linear,” Robert I. tend to focus on specialty medicine. Grossman, MD, the Saul J. Farber “It’s an inspiring time to study Dean of NYU Grossman School medicine,” Andrew Hamilton, of Medicine and CEO of NYU President of New York University Langone Health, said. “To succeed said. “The past six months have givrequires enormous knowledge and en us all a renewed appreciation for understanding of diseases—and the the heroism of doctors and nurses, ability to rapidly adapt to evolvand ‘essential’ seems ing medical sciences. NYU too weak a word to Long Island School of describe the work that Medicine will provide we are training NYU our students with Long Island School of the capacity to Medicine students create a legacy of to perform. In significant acparticular, they Our students are complishment will be fulfilling entering this field in all of these a pressing need with great solemregards.” for primary care nity and clarity of NYU Long physicians in this purpose, with the Island School country.” pandemic enerof Medicine, Adapting to gizing them even which initiated the COVID-age more so to help its inaugural environment, the school year medical school advance medical last summer, has developed care is New York a hybrid curUniversity’s riculum for – Steven Shelov flagship medthe upcoming ical school on semester — a Long Island, situated on the campus combination of in-person and of NYU Winthrop Hospital. The tele-education that may serve as a school offers tuition-free scholarmicrocosm for how many colleges ships with an accelerated three-year will model their curriculum’s for the curriculum exclusively devoted to upcoming school year. training primary care physicians. “Our hybrid curriculum is unique The curriculum is concentrated on to medical schools, from the very internal and community medicine, outset integrating basic science with pediatrics, OB/GYN and general clinical experiences—a bench-tosurgery, and contrasts with more bedside approach where classroom

‘‘

’’

learning transfers directly to clinical cases,” Shelov said. As part of the hybrid model, tele-educational aspects will include weekly pre-recorded lectures by faculty, followed by twice-weekly, virtual Q&A sessions. For in-person classroom training, the school will adhere to the strictest of infection prevention protocols, allowing for critical learnings such as anatomy and the delivery of outpatient clinical care. Personal Protective Equipment (PPE) will be provided and utilized, including face shields as appropriate for up-close educational sessions. In-person learning sessions will be problem-based, with small groups of about eight students each pursuing medical case scenarios to collaboratively identify and diagnoses illnesses. Students will virtually research relevant medical issues on their own to contribute to in-person discussions. Incoming students come from all over the country with 17 from the Tri-State area — including three from Long Island —as well as from Colorado, Florida, Massachusetts, Minnesota and Virginia. They hail from top universities such as Brown, Columbia, Duke, Johns Hopkins and NYU, as well as schools in the CUNY/SUNY system such as City College of New York, Brooklyn College and Stony Brook. —Submitted by NYU School of Medicine

PROFILES IN EDUCATION • AUGUST 5 - 11, 2020

Advertorial

Sacred Heart Academy is an all-girls Catholic college preparatory school, rooted in the spirituality and tradition of the Sisters of St. Joseph. The all-girls environment provides unique learning opportunities that cultivate confidence and leadership skills, and encourage our students to “take the lead.” A Sacred Heart education focuses on all dimensions of human growth. As a School community, we are committed to live, learn and work with inclusive love and to bring about unity and reconciliation with God and with one another. Student achievement is the best indication of Sacred Heart Academy’s excellence. Over 90% of our graduates were awarded college scholarships in the areas of academics, athletics and the arts. Our athletic teams are consistently ranked among the best on Long Island and the United States, and our student-artists and dancers excel in local and national competitions. Our Bloomberg Finance Lab and state-of-the-art Science Research Lab prepare students for competitive opportunities. Above all, however, SHA students are critical thinkers who actively integrate their education into their lives and routinely find ways to make a difference through their commitment to community service and social justice.

Here are a few fast facts about Sacred Heart Academy:

• On average, 98% of Sacred Heart Academy graduates attend 4-year colleges. • Each Sacred Heart Academy student is required to complete at least 20 hours of community service annually. However, most students far exceed this, devoting up to 200 hours of their time each term to helping their neighbors. • Thanks to our exceptional 15:1 student-teacher ratio, combined with a faculty extraordinarily dedicated to our students’ success, Sacred Heart Academy students routinely surpass their state peers in standardized test scores and the majority earn Advanced Designation Regents Diplomas each year. For more information about Sacred Heart Academy, please visit www.sacredheartacademyli.org.

(516) 483-7383 | www.sacredheartacademyli.org 47 Cathedral Ave., Hempstead, New York 11550

217552 S

217553 M

AUGUST 5 - 11, 2020 • PROFILES IN EDUCATION

Conservation In The Age Of COVID-19 Study outlines why eco-initiatives should play a role in rebuilding BY CYNDI ZAWESKI

czaweski@antonmediagroup.com

ew Yorkers believe conservation efforts and eco-initiatives should be part of the post-pandemic rebuilding. That is according to recent research conducted by The Nature Conservancy, which surveyed voters representing the demographics across the state with encouraging results. In early June, the environmental policy and advocacy group began reflecting on the role nature could play in building the future in the age of COVID-19. To understand how public attitudes on environmental initiatives are being shaped by the pandemic, The Nature Conservancy and FM3, a public opinion research firm, polled likely voters from all demographics and party lines. The results: New Yorkers want action on eco-initiatives. Seventy percent of New York State voters surveyed believe that the pandemic recovery effort presents an opportunity to plan for future challenges, including climate change. The percentage of voters who believe that climate change will impact them personally is increasing. And, by a large margin, New Yorkers do not want to return to the past as it was. Quite the opposite — they want to create a much better future, according to the study. “People are thinking about these issues,” Jess Ottney, New York Policy Director at The Nature Conservancy, said. “Even during a time when so many people are suffering, New Yorkers really do care about these issues facing the state and the world. They want to build back a better future after this crisis.” What could that future look like? The Nature Conservancy tested a range of potential initiatives, and found that

voters are hopeful about the role that nature can play in these areas: Access To Parks & Beaches More than 90 percent of voters support making parks, open space and natural areas more accessible to New Yorkers statewide. This includes implementing more initiatives to promote equitable access to parks by directing funds toward low-income communities and communities of color, which disproportionately lack these resources. “During the pandemic, we have seen a record turnout at New York’s parks, beaches, [and] bays,” Ottney said. “We want to make sure they are accessible to everyone. The pandemic has put a bright light on the inequalities that exist in our society. There are a lot of open spaces and parks that are easily accessible for

An Education Where Children Thrive Under the Guidance of Great Teachers in an Environment that Stimulates Creativity and Individual Potential!

• A proven system celebrating over 100 years of practice, research and worldwide recognition • Our fully equipped spacious classrooms offer the most enriched curriculum available for 18 months - 6 years. • Fully afﬁliated with the American Montessori Society since 1998. • Early drop-off and extended day available.

354 Lakeville Road • Great Neck, NY • 516-466-8422 Visit our website: www.CMSGN.com 213402 S

some people, but not for all people. New Yorkers realize that and want to address that.” Clean Energy Job Creation Eighty-seven percent support restoring the jobs that have been lost in our clean energy industry and support creating new clean energy jobs. Voters also indicated that they liked the idea of creating jobs for young people aimed at reducing pollution, protecting land and water, and mitigating the risk of climate change. “There are really good paying and important jobs, such as installing solar farms and retrofitting buildings for efficiency so we can make sure the power we are using is not wasted,” she said. “Long Island has a huge opportunity with offshore wind, and all the related infrastructure that can generate jobs within that industry. These are investments we can make to have cleaner air and better job opportunities.” Action On Climate Change Ninety-two percent of voters also support investing in natural and man-made infrastructure to help protect New York against natural disasters, like severe flooding, storms, fires and floods. “One of the biggest issues that New Yorkers care about is climate change,” Ottney said. “The impacts on Long Island are significant so people on Long Island really care about protecting the environment.”

Reducing Vehicle Traffic Another proposal that garnered strong support, according to the study, is limiting vehicle traffic on some city streets to allow for play, exercise and outdoor dining — that proposal received 75 percent voter support statewide, not just in New York City. The Nature Conservancy said the initial findings give hope that — in a time when New Yorkers are very concerned about the economy and public health — they seem to value the role of nature in meeting the challenges. The organization is currently working with local, state and federal officials to make strides on these issues. “While the pandemic has interrupted life as we know it, New Yorkers are ready to act,” Ottney said. “As we are talking with policymakers and people in the community, we can see that New Yorkers want to work toward a sustainable future for kids and grandkids.”

Environmental Scholarship Available The Board of Directors of the Long Island Pine Barrens Society has announced the creation of an environmental scholarship in memory of the late Robin Hopkins Amper. Long Island students entering college this fall are eligible to apply for the $5,000 scholarship, regardless of where they attend college. The applicants must be pursuing education in environmental studies, sciences, ecology, sustainability, public policy or land and water protection. The scholarship is the result of a Matching Funds Challenge provided by the Rauch Foundation, the Greentree Foundation and others who have pledged donations by the public Applications for the scholarship are currently being accepted. The announcement of the winner will be made on Aug. 21. Applications can be obtained through the ICF’s Scholarship Portal at https://licf. org/about/scholarships/. —Submitted by the Long Island Pine Barrens Society

PROFILES IN EDUCATION • AUGUST 5 - 11, 2020

ADVERTORIAL

Molloy College

MOLLOY

READY FOR THE FALL

IS THE

RIGHT COLLEGE.

Molloy recently announced its plans for fall classes, including a combination of in-person, hybrid and online classes, with as much face-to-face instruction as allowed by both state and local officials.

that enable students to “live their story” and pursue their dreams. Graduate Programs Fuel Careers Molloy offers many graduate and doctoral programs that provide opportunities for students to further The College will have an increased enhance their career or take a new focus on safety, with temperature direction while pursuing a passion. The graduate kiosks in all “We are dedicated to programs include buildings, social providing our students with a variety of distancing in the best possible value. If you M.B.A. options, all areas of come to Molloy, you graduate programs in the campus with a job in your field at clinical mental (including a salary that’s significantly health counseling, classrooms), and higher than average.” criminal justice, face coverings — James Lentini music therapy, for everyone, to President, Molloy College speech-language name but a few pathology, of the new safety education and nursing. initiatives.

Molloy College Continues to Earn National Honors College-bound students and their parents are always looking for an academic environment that offers the best fit and best value for their tuition dollars. Last year Molloy was ranked the #18 “value added” college in the U.S. by The Wall Street Journal and was also ranked the #10 best value among Catholic colleges nationwide by College Values Online.

NOW.

What’s New

One of the nation’s top values in higher education, Molloy is close to home but far from ordinary.

Molloy, home to approximately 4,900 undergraduate and graduate students, recently opened its new facility at 50 Broadway in lower Manhattan. The space is the home of the nationally ranked Molloy/ CAP21 B.F.A. in musical theatre and also hosts other events. Additionally, last year Molloy opened its third residence hall.

With career-focused programs, real-world connections and personal guidance, we’re open and here for you – in person or online – for today’s challenges and tomorrow’s opportunities.

Molloy continues to expand its flexible learning options for many programs, so that students can take night, weekend, hybrid or online classes. Some of Molloy’s newer offerings include an online M.B.A., as well as a new degree completion program that allows returning students to A small student-to-faculty ratio complete their undergraduate (10:1) means that students are more degree. than a number to our professors, Visit molloy.edu to learn more. who provide input and guidance

MOLLOY COLLEGE. THE RIGHT CHOICE. RIGHT NOW. Apply Today: Molloy.edu/RightChoice

Visit molloy.edu to learn more.

217549 M

MOL883_RightNow_Anton_HP_4C_4.25x11.25.indd 1

217547 M

The College also continues to deliver high value, having recently announced a tuition freeze for the fall and spring semesters. This means that students will pay the same price for tuition as they did for Fall 2019.

RIGHT

7/31/20 9:29 AM

10A AUGUST 5 - 11, 2020 • PROFILES IN EDUCATION

ADVERTORIAL

Reinvent Your Path to Success

New York Tech is among the few universities emerging from the COVID-19 crisis stronger than ever. As the home of doers, makers, innovators, and healers, students can follow their path to a successful career in fields that address new market needs and challenges. Our technology-infused undergraduate and graduate programs transform students into nimble, solution-oriented professionals in fields including: data and computer science; architecture and design; biotechnology; electrical and mechanical engineering; nursing, medicine, and allied health; communications and digital arts; management; and more. Coursework in every degree program emphasizes realworld projects, critical creativity, and a growth mindset that challenges students to think big and reinvent the future. An Inspired Learning Environment Our faculty and staff are experts in their respective fields who know how to leverage technology and best-in-class teaching methods, whether holding classes on campus, remotely, or in a hybrid model. Nearly 9,000 students are enrolled at our campuses in Long Island and New York City, NY; Jonesboro, AR; and Vancouver, B.C. “We pride ourselves in meeting our students where they are and taking them where they want to go, while helping them grow as people, citizens, and professionals,” notes New York Tech President Henry C. “Hank” Foley, Ph.D. Our students are encouraged to develop their abilities through industry challenges, internships, and service projects. For example, digital film and television production students created a film in collaboration with JetBlue to highlight a local school for children with

special needs. Others worked with faculty on research on gene mutations, emotiondetecting computers, nanotechnology for disease diagnosis, and sustainable architecture and urban design projects; presenting at national conferences or publishing research in academic journals. Highly Ranked and Accredited Our academic programs are respected and valued by ranking organizations and accreditors because we deliver on our promise to provide an education that positions our graduates at the cutting edge of market needs and prepares them for an unpredictable economy. • We consistently appear in U.S. News & World Report’s top tier of Best Regional Universities (North) and rankings for best schools for veterans. • Our ranking in The Wall Street Journal/ Times Higher Education annual survey, which focuses on student success, has skyrocketed in recent years, and specialty organizations recognize our programs for online excellence and our graduates’ salary potential. • Educate to Career just ranked New York Tech as a Tier 1 College, based on affordability and the ability to offer quality in-classroom, online, and blended format education in the spring of 2020. Affordability and Scholarships We know that earning a college degree is a serious investment. Our tuition and fees are among the lowest private college tuitions in the New York metropolitan region. At the same time, we offer generous financial aid packages, with special scholarship programs for veterans; transfer students; alumni; and children of police, firefighters,

A Vibrant Community At New York Tech, diversity is represented by a community of individuals from a variety of racial, ethnic, religious, gender, gender presentation, sexuality, geographic, cultural, age, ability, and socioeconomic groups. We recognize the strength that stems from a diversity of perspectives, values, ideas, styles, approaches, experiences, and beliefs; and we aspire to continue to grow as a place that welcomes and encourages individuals of all backgrounds to contribute to, and become part of, our vibrant culture. USA Today has noted our top diversity rankings, and The Chronicle of Higher Education gave us high marks for income mobility. Delivering on our Career Promise While rankings and distinctions are testament to the university’s strengths, nothing reveals the value of a New York Tech degree better than our graduates’ careers. Our latest data show that 94% of graduates are employed or continuing their education within six months of graduation. Recent grads have taken jobs at BBC America, WarnerMedia/CNN, biotech startup Ovid Therapeutics, and architecture firm Kohn Pedersen Fox Associates. Others are starting graduate work at Albert Einstein College of Medicine and Georgia Tech. And in this global health crisis, graduates of NYIT College of Osteopathic Medicine (98% match rate) and NYIT School of Health Professions (licensure exam pass rates between 95100%) are eagerly moving into roles where they can do the most good. Imagine the steps you can take toward your ideal career by enrolling at New York Tech. Getting an education at a university with deep roots in New York— the global capital of finance, media, and culture—offers opportunities impossible to duplicate elsewhere. Local students are able to remain close to family and friends while enjoying the best of both worlds: staying connected with the people you’re closest to while pursuing social and personal growth at a university that provides exceptional networking, skill development, and job prospects. How do you want your life to look in two or four years? You may not have all the answers, but you can get started on a path to your best life. By pursuing a degree at New York Tech, you can gain competency in the field of your choice, make professional connections, and receive excellent returns on your hard work. Discover your next step at nyit.edu/anton.

217506 M

NEW YORK INSTITUTE OF TECHNOLOGY:

EMS, and K-12 teachers. Nearly 100% of our first-year students receive financial aid.

PROFILES IN EDUCATION • AUGUST 5 - 11, 2020 11A

Your Future Can’t Wait Our tech-infused, virtual, and in-person degrees offer a safe and affordable alternative for students who don’t want to delay their college careers.

90+ PROGRAMS

BACHELOR’S

DOCTORATE

for undergraduate, graduate, and transfer students.

LEARN MORE AT:

NYIT.EDU/ANTON

215482 S

MASTER’S

Financial Aid, Scholarships, and Rolling Admissions

12A AUGUST 5 - 11, 2020 • PROFILES IN EDUCATION

A Hybrid Approach

College courses will be a mix of in-person and online learning BY CYNDI ZAWESKI

czaweski@antonmediagroup.com

ducation in the age of COVID is nothing short of tricky. Thrust into a sudden online academic model, colleges across Long Island pivoted to continue their courses under unprecedented circumstances. “Before COVID, 90 percent of our learning was done in-person so it was a very big change,” Michael R. DiBartolomeo, Vice President for Enrollment Management at St. Thomas Aquinas College, said. “We left campus on March 13 and immediately switched to online learning and we had virtual hours available for the rest of the semester. We pivoted quickly. Since then, we have been able to take a breath to reassess moving forward.” St. Thomas Aquinas College will resume classes on Sept. 8. But it will look a lot different than previous years. The libraries and campus quad will remain largely empty as the school will be offering a hybrid approach to higher education — at least for the foreseeable future. DiBartolomeo said the college will begin by offering a mix of online Molloy College President Jim Lentini touring the campus, with rising senior and in-person classes, with faceJack Ryan. (Courtesy of Molloy College) to-face learning priority given to students of the arts and science, who require hands-on laboratory classes to graduate. All other classes will remain online, with the exception of freshman students who will be able to attend school on campus. “We want our first-year students to meet their faculty and make connections with all the proper social distancing in place,” he said. “We will reassess after a few weeks to see where we are at with the virus and the Department of Health. It will be a phased approach.” A phased approach is also being implemented at Molloy College in Rockville Centre and St. Joseph’s College, with campuses in Patchogue and Brooklyn. All of the colleges have spent the summer devising plans for a fully online learning experience winning option. classes, as well as conducting extenwhen COVID first swept New York St. Joseph’s College (SJC), which is sive in-depth cleaning and adding resuming classes on Sept. 9, will offer a campus-wide signage outlining safety in March. Since each school formed their own respective task forces to combination of remote, hybrid, in perprotocols. identify strategies for a fall reopening. son and online courses with roughly Similarly to St. Thomas Aquinas A combination of learning styles is the 20 to 30 percent of classes being held College, Molloy and SJC pivoted to

on-site to start. The remote option involves students meeting with faculty members and classmates at regularly scheduled times, typically using Zoom or a similar video conferencing platform, with the courses built

PROFILES IN EDUCATION • AUGUST 5 - 11, 2020 13A

On Campus Housing

around the Canvas learning management system. The hybrid option combines the remote option with an in person component. Students will come to campus for a class for half of the course sessions and the other half of instruction/interaction would take place remotely. An example of this would be for a class that normally

meets on Mondays and Wednesdays — with half of the classes coming to campus on Mondays and the other half coming on Wednesdays — with the remainder of the instruction/ interactions taking place remotely. Students taking a class with the in person option would come to campus in the same manner that they would during a normal semester. SJC will also offer a full complement of online courses. The difference between this option and the remote option is that these courses are offered in an “asynchronous” manner, meaning that class activities are not tied to a set schedule and that students and faculty would not be interacting with each other in real-time as they would with the remote option. Prior to the start of the semester, students will be provided with a schedule of classes that indicates which courses will be offered in which modalities. They will then have the opportunity to adjust their schedules accordingly. The college will be opening up in-person classes to students who require labs, as well as to the incoming freshman class. “One advantage is that we’ve now had several months to prepare for the fall semester,” Donald Boomgaarten, president of St. Joseph’s College, said. “We are optimistic about the year.” Molloy College, which begins

its semester on Sept. 8, will also be offering a combination of in-person, HyFlex/hybrid and online classes with about 25 percent of the student body returning for in-person classes. The start of classes marks the first fall semester of the college’s new president, Dr. James P. Lentini, who most recently served as Senior Vice President for Academic Affairs and Provost at Oakland University in Rochester Hills, Michigan. “Our plan offers the best of both worlds,” Lentini said. “We are very prepared for the fall semester. The faculty has been working on their remote delivery and taking extra training. We have also enhanced the technology so we’re ready to provide a high-quality experience whether we are in-person or remote.” Classes will be held in a variety of formats, including in person. Molloy’s Hybrid Flexible (HyFlex) model consists of online and face-to-face instruction in a flexible manner. The hybrid model will have some online meetings and some synchronous face-to-face meetings in a classroom (or in the case of a lab or clinical component, at off-site locations), at designated times. Online synchronous courses will be online with all or some of the meetings at a designated time. And, online asynchronous will be online and weekly participation is required but there is no established meeting time.

In addition to navigating course formatting, SJC, Molloy and St. Thomas are also reopening residence halls under new safety guidelines. “We will be de-densifying the residents’ halls so there are not too many people there at a time,” DiBartolomeo said. SJC’s St. George Towers in Brooklyn will offer student housing with roommates being designated as “family units.” New protocols that will be put into effect to combat the spread of coronavirus, including, but not limited to, mandatory face coverings in all buildings, contactless temperature checks and frequent sanitizing of high touch areas and disinfection of on-and off-campus college facilities. The Patchogue location doesn’t offer on-campus housing. Molloy will also welcome students to live on-campus in the college’s three residence halls in single and double rooms, eliminating triples to reduce the amount of student-to-student contact. Additionally, increased signage in all residence halls will address social distancing guidelines, face coverings in public spaces, and handwashing and disinfecting. Rooms will be vacated on Nov. 24, at the start of the Thanksgiving break, and room and board costs will be pro-rated to reflect this reduction of time in the residence halls. Both SJC and Molloy have implemented a school-wide tuition freeze for all current and incoming students. The freeze locks-in tuition at the previous school year’s rates. “I am excited to begin my first fall semester at Molloy,” Lentini said. “In addition to our emphasis on the safety of the Molloy community, I am also pleased that our tuition freeze means that students will not see any increase from our 2019 levels. This is an important step for our students and their families, given that many of them have been adversely impacted by the COVID-19 virus and the subsequent economic hardships.”

14A AUGUST 5 - 11, 2020 • PROFILES IN EDUCATION

Home To Stay

Why it pays for employers to let employees work from home BY CYNDI ZAWESKI czaweski@antonmediagroup.com

he way we work is changing. More pointedly, where we work is changing. Americans are working from home more now than at in any other moment in history. It has been an upward trend even before the coronavirus pandemic mandated stay-in-place orders. According to a recent Gallop poll, roughly 43 percent of workers conduct one or more functions of their job outside of the traditional office space. Since March, many non-essential workers have had the fortune of working from home for the first time. They’ve learned the benefits first-hand. There is no more hours-long commute. There is no wasted time getting sucked into mindless water cooler chatter while microwaving canned soup for lunch. There is no stuffy suit and tie. And remote employees are still getting their work done effectively. The cat is out of the bag, and employers need to face the fact that this is the new normal for workers who do not need to physically be at their job in order to perform it well. We’ve all had that one boss who believed that if they didn’t see you at your desk, you weren’t working. As author Olga Khazan points out in her recent Atlantic article, Work From Home Is Here to Stay, “Workers might resist being yanked back into offices after they’ve enjoyed the luxury of never changing out of their pajamas.” It is time to get on board. Don’t be the business owner who decided social media was a flash in the pan and is now scrambling to slap together a

company Facebook page to reach clients digitally during the pandemic. Smart potential job candidates know to steer clear of antiquated companies with woefully outdated business models. Here is why every business owner must consider implementing a work-fromhome policy.

Savings

There are many good reasons for employers to consider adopting a flexible schedule or work-fromhome policy, which I’ll go more in-depth into later, but let’s start with the bottom line: Money. Better profit margins are good for employers, employees and the economy. According to Global Workplace Analytics, U.S. companies could increase their bottom lines between $525 and $665 billion annually by allowing telework. This savings comes in the form of real estate, absenteeism, turnover and increased productivity. That equates to roughly $11,000 in savings each year per employee. The company’s recent research showed that during the pandemic, American employers are saving more than $30 billion per day by allowing employees to work remotely. It is not just employers who save. Remote employees save between $2,500 and $4,000 per year by working at home just half the time. Those figures are attributed to reduced costs for travel, parking and food.

Productivity

Prior to the pandemic, FlexJobs’ annual survey in 2019 showed that 65 percent of workers believed they’d be more productive if they could work from home. Those surveyed called out productivity suckers like commuting, chatty co-workers, office politics and inefficient meetings. Without these distractions, workers can get into the flow, a mental state of focused attention so intense that it does not allow us to have cognitive bandwidth left for anything else, as it is defined by Positive Psychology. For so many 9-to-5ers, the stress starts from the second the alarm jerks them out of bed. Then it is showering, picking out an outfit, getting dressed, getting little Johnny dressed in his favorite green shirt you can’t find anywhere; then it is out the door for an hour-long commute. By the time they get to their desk at 9 a.m., they are exhausted and overspent. It will be at least 45 minutes on Facebook before they reply to your email. At home, workers can maximize their time and energy, which results in higher performance. Instead of braving traffic, they are at their computers, getting a jump start on the day’s tasks before most get their daily Dunkin’ order. Khazan writes, “Anecdotal evidence indicates that people working remotely are currently working longer days.” Employers who were once hesitant to offer work from home policies are changing their tune because newly remote employees are proving

PROFILES IN EDUCATION • AUGUST 5 - 11, 2020 15A

that they can get their work done from anywhere, even under the most unpleasant circumstances.

Inclusivity

The benefits of employing a diverse staff can not be overstated. As outlined in the Forbes article, Why Workplace Diversity Is So Important, And Why It’s So Hard To Achieve, “a host of other highly credible researchers have shown, it makes your organization more effective, more successful and more profitable. Employing professionals of different races, genders, and sexual preferences make companies a magnet for original insights and out-of-the-box thinking. It makes the brand’s message accessible to a wider audience, and who couldn’t stand to relate to more customers? “Remote work enables companies to embrace diversity and inclusion by hiring people from different socioeconomic, geographic and cultural backgrounds and with different perspectives — which can be challenging to accomplish when recruiting is restricted to a certain specific locale that not everyone wants, or can afford, to live near,” writes author Emily Courtney in a recent FlexJobs piece entitled The Benefits of Working From Home: Why The Pandemic Isn’t the Only Reason to Work Remotely. Courtney makes an excellent and valuable point when it comes to easy ways businesses can support diverse communities — and reap the benefits of employing people with different

perspectives. She goes on to say that remote work provides opportunities to those with disabilities or family caregivers that require an alternative work schedule to accommodate a loved one’s doctor’s appointment. Remote work is also great for tapping into single parents who don’t have the luxury of childcare. Many qualified candidates are often overlooked if their lifestyle or circumstance doesn’t fall within the confines of the traditional onsite 9-to-5 gig. Don’t squander talent.

Sustainability

I am mathematically challenged, but even I can get this equation. Fewer people commuting = Fewer cars on the road = Reduced carbon footprint. In 2020, climate change must be addressed in corporate social responsibility policies. That can be accomplished by adopting work-fromhome policies. There is ample evidence of the negative impacts of global warming that this article will not detail, but I will share this, “Air pollution has dropped to unprecedented levels across the world as major cities and countries impose lockdown measures to curb the spread of the coronavirus,” reports CNBC. Just three months of working from home had a measurable impact on the environment. That is substantial. We often wonder how one person can help fix a global crisis like climate change. It took another global crisis, COVID-19,

to help answer that question.

Happier and Healthier Employees

If more money, increased productivity, a diverse workforce and a healthier planet weren’t good enough reasons to explore work from home policies, consider the people who work for you. • Pre-pandemic, Owl Labs surveyed 1,200 U.S. workers to compile its 2019 State of Remote Work report. There were a few key takes aways that should catch the eye of a modern employer, specifically in the areas of happiness, loyalty and retention. • 82 percent of respondents agree with the statement that working remotely would make them feel more trusted at work. • 80 percent of respondents agree that working remotely would make them feel like their employer cares. • 74 percent of survey respondents agree that the ability to work remotely would make them less likely to leave their employer. For many employers, it is time to read the writing on the wall. Post-COVID, many employees are not ready or willing to return to the 9-to-5 grind. The good news is that employers don’t need employees’ physical presence to run a highly effective business. Remote employees, or employees with the option for flexible schedules, are productive, less likely to jump ship, and happier, according to the research.

16A AUGUST 5 - 11, 2020 • PROFILES IN EDUCATION

Advertorial

Nassau Community College

Take Control of Your Education with an Affordable, High-Quality Education from NCC! personalized academic experience that lays the groundwork for a successful future.

With over 80 fields of study, 62-degree programs and 20 certificate programs Nassau Community College provides an opportunity for all students to take control and prepare themselves for a successful future.

Meet our NCC students: Bridget – My first day of classes I immediately was blown away. I was pleasantly surprised that the marketing language in the brochure was actually true – the student ratio in my class was ideal for learning, my professors were truly committed to my success and I found the curriculum challenging. Not just one of my professors but a number of them have really become a part of my life. They push me to challenge myself academically but also

NCC’s faculty to student ratio and highquality academic programs provides for a personalized academic experience. From the faculty, to the alumni, to the administrators our dedicated College community is committed to equitable educational access, completion, and post-completion success, which ultimately leads to credentials with economic value and jobs with impact that support the current and future job demands of our region and further. • Our Alumni provide opportunity for our students to obtain unique internships, develop mentor relationships, as well as explore exciting employment opportunities. • Our award-winning faculty encourage our students to explore academically, unlock their potential, and prepare themselves for the future by finding them exciting research opportunities and providing them with the encouragement and guidance they need to succeed. • Also, our Workforce Development program partners with major employers to provide training both to current students and alumni to ensure they are prepared for success in the workforce. Our students are not just an admissions number - they are our future. We encourage them to discover and explore academically, and unlock their fullpotential as we provide them with a

on a personal level. They encourage me to take on the challenging research and also take advantage of all the internship opportunities that are here and because of that I really feel like when I leave NCC I will be set for success.

Thank you NCC! Marcus – I got my start at NCC and it was there I truly developed a passion for healthcare and the determination to fulfill my dreams. That NCC mindset followed me through my educational career at Cornell University and Boston University School of Medicine and got me to wear I am today – my dream job in healthcare. Now they call me Dr. Marcus…. thank you NCC for teaching me that hard work, resiliency and support makes everything attainable! Cecilia – I attended one NCC admission event and I immediately felt the support of the NCC community to set me up for a successful academic future. Its academic programs are exceptional and at such a low cost - plus all of my credits are transferable to my 4-year institution. But it has really been the support of the NCC community that has made my experience here so great. I feel like there is always someone I can go to, whether it is my professor or someone in advisement when I have a problem or if I need to just discuss my academic journey after I leave here. There is always someone willing to help. I never feel alone and that matters to me.

Let Nassau Community College help you to take control of your future. Visit our virtual Admissions Office, attend an Admissions Info Session and Register Now - more information here: ncc.edu 217558 M

PROFILES IN EDUCATION • AUGUST 5 - 11, 2020 17A

Take control of your education. An affordable education at Nassau Community College is the best investment you can make for your future. • • • •

Affordable Tuition Flexible Class Schedules High Quality Education Transfer Credit Friendly

STAY CLOSE. STAY SAFE. SAVE MONEY.

THE FUTURE OF EDUCATION IS HERE EL FUTURO DE LA EDUCACIÓN ESTÁ AQUÍ LAVNI EDIKASYON AN SE ISIT LA

教育的未來就在這裡

217557 S

Apply Now at NCC.EDU

18A AUGUST 5 - 11, 2020 • PROFILES IN EDUCATION

Post-COVID Career Outlook Top career experts share their best job hunting tips BY CYNDI ZAWESKI

czaweski@antonmediagroup.com

Not since the great recession of 2008 have we seen the job market and economy backslide quite like now. COVID-19 swept the nation, upended regularly scheduled programming, leading to pay cuts and layoffs that impacted even the most competent of employees. Whether you’re a new grad or seasoned professional, part of adjusting — and thriving — in this “new normal” is positioning yourself as solid hire in the post-COVID job market. These career experts shared their foolproof tips to give you a competitive edge in your search.

Know Your Value Knowing your value is key to cutting through the fluff and ensuring your content leaves a positive and memorable mark on these hiring managers and recruiters. Show them you offer this value that they can use in this open requisition. Why is it open? What pains do they have because it’s open? Once you can hone in on that, you can start to massage in key-value- and accomplishments-based content that make your resume pop and motivate these decision-makers to invite you in on an interview. Most people have skills and experience that can transfer nicely to another industry or job, the key is knowing how those skills reasonably transfer, and what sort of value they bring to the prospective employer. Some common skills that immediately come to mind are: Cross-Functional Communications — For example, each day you talk with different people of different socio and economic backgrounds. Data Analysis — For example, each day you look at different options to consider which should be prioritized, not knowing that subconsciously you’re sorting data to determine value. Document Control — For example, each day you control your messaging, both physical (mail) or digital (social media, email), as well including where to put email attachments and stored information. Strategic Planning — For example, each day you strategically plan out both shortand long-term goals to drive personal and professional productivity. —Matthew Warzel, CPRW, President of MJW Career

Hone Your Personal Brand

“A personal brand is the creation of a focused, authentic and consistent perception of how you will add value, who you serve and why you’re unique. I recommend that every job seeker get very clear on what their ideal goal is before they start looking for a job in any environment, but especially in the time of COVID because the job market is so disrupted. With so many layoffs, there is more and more competition for job openings and in order to gain notice, it will be very important to be crystal clear about how you can uniquely add value for the roles you’re applying for. The better you can align your strengths, knowledge and experience with what is required for a role, the higher your chances of success. Some of the most important aspects of building a personal brand are focusing on: Authenticity—What’s important to you? It can be helpful to do a values

assessment to gain clarity on the relative importance of your values. Experience that supports your brand—How can you position the things you’ve done to support your vision for your career? (Think about work experience, classwork and volunteer work). Use your brand as a lens—When evaluating opportunities consider whether it fits with your personal brand and the story you’d like to tell about yourself. For example, you may choose to take a role at a lower salary if the values of the company align more closely with your own values than a role that pays more that doesn’t. —Terry McDougall, CEO/Career Coach at Terry B. McDougall Coaching and author of Winning the Game of Work: Career Happiness and Success on Your Own Terms

see CAREERS on page 20A

PROFILES IN EDUCATION • AUGUST 5 - 11, 2020 19A

A NYTIME

ON-DEMAND The DNA Learning Center offers exciting virtual camps for summer and beyond. Students entering 6th–12th grades receive a kit of materials and access to intructional videos to do activities at their own pace from home. Register anytime!

Virtual Forensic Detectives (entering grades 8–10)

CSI enthusiast? Experience forensics through a series of labs and activities in a more realistic fashion than portrayed on TV—it’s not just DNA!

Virtual Fun with DNA (entering grades 6–7)

Build an understanding of cell biology, genetics, microbiology, and biotechnology through hands-on experiments.

Virtual DNA Barcoding (entering grades 10–12, or 9 plus at least one high school biology course such as Living Environment)

Use DNA barcoding in this project-based camp to survey the biodiversity of an ecosystem or uncover food fraud.

Virtual World of Enzymes (entering grade 8, or Fun with DNA alumni entering grade 7)

Explore the use of enzymes in molecular biology and the food and health industries. CTGTTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATT-Virtual GACTCACCCATCACA ACCGCTATGTATTTC-Genome GTACATTACTGCCAG-Science CCACCATGAATATTGTACGGTACCATAAATACTTGACCACC (entering grades 10–12) TGTAGTACATA-

Use Nobel Prize-winning biochemical methods and bioinformatics tools to analyze the genetic components of living things.

(516)367-5170

217684 S

Enroll during any season at https:// summercamps.dnalc.org

20A AUGUST 5 - 11, 2020 • PROFILES IN EDUCATION

CAREERS from page 18A

Nail The Interview

Define Your Goals

In a COVID-19 and socially distanced world, virtually all interviews now happen by phone, FaceTime, Skype or Zoom. This applies to both the initial conversation all the way up to and including getting an offer. Here’s my number one tip to rock this process: Prepare for your phone interview as you would for a traditional in-person interview. Have your pitch ready and perfect, anticipate the tough interview questions and expect the unexpected like being pressed to provide compensation details. That’s the new normal. They don’t want to invest any unnecessary time or expense in cultivating a candidate if there is a gap in expectations; either yours or theirs. A phone interview also makes it easier for them to end the discussion if there is a lack of interest. The benefits: You can refer to your notes. Have them spread out and easy to access. Review them thoroughly to re-acquaint yourself with key themes and ideas and be sure you can read your handwriting. You can take notes, too. That’s great for sending an impressive follow-up.

Define success for yourself. Get out a piece of paper and make two columns: “Personal” on the left and “Business” on the right. Usually, there aren’t more than 3-5 bullet points under each column. It’s not a to-do list, it’s a vision of your next chunk of time. Filter out the noise of what others want for you and hone in on your own authentic self, your own dreams and desires and then break that down into baby steps. The norm is that developing a career takes time, so don’t get discouraged if you can’t get your dream job or role immediately. There is so much to be gained from the various steps along the climb. If the job you want doesn’t exist, create it. If you can create it, then you most likely are where you need to be. Finally, the number one thing job seekers can affect immediately is their attitude, so bringing your unique brand of you to the interview process. Shift first level listening to second level, which focuses on the meaning of the conversation for the other person. When you show that you can listen at higher levels, you exhibit a workplace competency that is expensive to develop through training.

—Roy Cohen, Career Counselor & Executive Coach, Author of The Wall Street Professional’s Survival Guide

—Katherine King, Founder and CEO of Invisible Culture, and the inventor of the Intelligence Quotient (IIQ) training method

Use Linkedin To Your Advantage

“Recruiters are looking for candidates on Linkedin. Linkedin is your best chance to be found by a headhunter, and it’s the most up-to-date place when it comes to open positions. If you are not on Linkedin, your chances of being contacted are slim to none. My best tip would be to do your research when it comes to keywords. Read 10-15 job descriptions you think you are a good match for. Identify the keywords and skills showcased and make

Foster Connections

I am a big fan of networking. Networking may sound old fashioned in these high tech days but it still works. Most of my business comes from networking. My rule is that you should network in person during the business day and do it online after hours. People do business with people they know, like and trust so you have to get out there to build your reputation online and off. Prospective customers and jobs can come from anyone anywhere anytime so you should always be on your best behavior and make a great lasting impression. I also recommend finding mentors. I have had great mentors and champions throughout my career. In my corporate life, I had bosses, senior women or alums from my alma maters who took me under their wings to help me advance and show me the ropes. Good people tend to travel together personally and professionally so finding smart and generous people who can connect you to other like-minded people who give more than take and share their wisdom always leads to great opportunities and adventures in my experience. —Paige Arnof-Fenn, Founder & CEO Mavens & Moguls

sure your profile includes them. It works because it feeds the algorithm, securing you a better ranking in the recruiter’s search results. From a job search point of view, the most important thing is to have a polished profile, and it should be recent. Always add, remove items on your profile, as more recent profiles get better ranking. —Gabor Fogarasi, Linkedin Expert

HEALTHY Pu blis hed b y LIVING An to n M ed ia Gro up KARL V. ANTON, JR. Publisher, 1984-2000 Angela Susan Anton Frank A. Virga Iris Picone Shari Egnasko Cyndi Zaweski Robin Carter Alex Nuñez Joy DiDonato Linda Baccoli

Editor and Publisher President Vice President of Operations Director of Sales Administration Editor, Special Sections Director of Production Creative Director Director of Circulation Director of Business Administration

Advertising Sales

Ally Deane, Sal Massa, Maria Pruyn, Jeryl Sletteland, Glenn Tretter

132 East Second Street, Mineola, NY 11501 advertising inquiries circulation inquiries editorial submissions

PROFILES IN EDUCATION • AUGUST 5 - 11, 2020 21A

Advertorial

Adelphi: The Full College Experience — Close to Home

Here are seven top reasons students choose Adelphi: 1.

Adelphi Is a U.S. News & World Report Best College.

95 Percent of Our Students Have Jobs or Are in Grad School Within Six Months of Graduation.

Our Academic Programs Produce Highly Paid Graduates.

87 Percent of Full-Time Undergraduate Students Receive Scholarships and Grants.

Small Classes Mean Personal Attention.

Adelphi Is a Recognized Leader in Diversity.

Adelphi Provides a Safe Environment.

Adelphi is committed to helping our students succeed—in the classroom and professionally. We’ve been highly awarded for our efforts: We earned five “bests” from U.S. News & World Report, ranked among the nation’s Best Colleges, Best Value Schools and Top Performers for Social Mobility. Our local students get world-class education within a vibrant community close to the comforts and convenience of home—not to mention saving on housing and transportation costs. Adelphi students are career-ready by the time they receive their diploma. We’re a Career Development College of Distinction, with a Prep for Success program that provides students with the knowledge, skills and internship experience employers are looking for. College Factual says that 20 of our academic programs produce graduates who are in the top 10 percent of highest-paid professionals in their field. According to a recent survey, the average annual base salary for Adelphi bachelor’s degree graduates is 25 percent higher than the national average. This year, Adelphi awarded more than $84 million in scholarships and grants to its full-time undergraduate students—10 percent more than last year. Adelphi doesn’t have enormous lecture halls. With small classes—an average of 21 students per class and a 10:1 student-to-faculty ratio—students learn from award-winning, dedicated professors who know them by name. It’s said that Adelphi is big enough to give you choices, small enough to feel like home.

Safety is our top concern during the coronavirus pandemic. We’re ready to reopen this fall in accordance with New York state protocols. We’ve rearranged campus spaces, reimagined dining and rethought everything—from housekeeping to health services—to keep our community safe. And we are fully prepared to respond to changing conditions. Our 24-hour Health Services Center and multiple-award-winning Department of Public Safety and Transportation have our community’s well-being in mind at all times.

Learn more Adelphi.edu/Anton

Stay near home and stay on track. Transfer to Adelphi. Come to the U.S. News & World Report Best College that’s right in your backyard. There’s still time to transfer for fall— and we make it easy, starting with virtual appointments with counselors that will give you all the information you need. Seamless application process Generous credit transfer policy Valuable scholarships and �inancial aid Award-winning career guidance The average base salary of 2018 graduates is

Successful career outcomes

Find out more at Adelphi.edu/Anton

25%

217550 M

higher

than the average base salary of new grads nationally.

217551 M

Adelphi has been nationally recognized for our commitment to diversity, equity and inclusion. Students of color, international students, LGBTQ+ students, neurodiverse students, those who are the first in their families to attend college, and many others will find a home here and have access to mentoring and support.

22A AUGUST 5 - 11, 2020 • PROFILES IN EDUCATION

How Military Skills Help A Career In Sales BY CHAD STORLIE

editorial@antonmediagroup.com

ales roles are some of the most difficult and the most rewarding of any position in any business. Sales roles whether in a major corporation, a small business, a food truck vendor, or on the floor of a retail shop require patience, skill, good nature, a deep understanding of the customer, and a daily willingness to go above and beyond to help the customer satisfy their shopping or information needs. A sales role requires you to educate, inform, negotiate, and conclude sales opportunities with a wide variety of different customers and to use different skill sets simultaneously to ensure a solution that meets both the customer’s needs and the needs of the sales organization. In short, sales roles are difficult but incredibly rewarding. There are several military skill sets that can make a sales role more enjoyable and more successful.

Be an Expert in Your Field & Have the Latest Corporate News

In the military, a great military leader not only sets the example in their own unit, but also helps other military units succeed. A salesperson is similar to a military leader because a salesperson needs to be a positive physical representation of all that a company is and aspires to be. By no means does a salesperson have to be perfect, but they need to be an expert in their industry. A salesperson needs to understand both their company’s products and services and how they help their customers excel in daily operations. One of the greatest benefits a salesperson performs is helping customers use the company’s products and services to deliver a better service for the customer’s. Another core attribute that translates from the military role to a sales role is bringing your customer’s intelligence on how to deliver better to their customers or what the customer’s competitors are doing. Expertise, industry intelligence, and dedication to the customer are common traits for both military professionalism and sales professionalism.

Be Honest, Conscientious, Respectful & Have Strong Follow Up

Naming the personal qualities of a solid military leader and a sales leader are startlingly similar. We both want to

be honest, respectful, conscientious and dedicated to our duty, and have a strong follow up on outstanding issues. In the military, we want our leaders to look out for our personal and professional well-being. In sales, we want the salesperson to look out for the well-being and success of their customers. There is no difference in leadership qualities between military leaders and salespeople. Each is ethical, honest and respectful of people and the organizations that they serve.

Listen, Take Notes and Display Initiative When Seeking Solutions

The best salespeople and military leaders are often quiet. They are quiet because they are seeking to understand, take notes, listen to what their customers want, and then taking the initiative to generate ideas and options that their organizations can successfully accomplish. A poor salesperson and military leader are loud, boastful, and talk a “solution” before they even fully understand the problem that they are trying to solve. Listening is an underrated skill and a highly appreciated quality

for both military and sales leaders. When someone listens, takes notes, ask questions, and then provides ideas for a solution based on what they heard, and not what they have done in the past, we know that person is there to help us find a solution, and not just to provide an “easy” answer. Adjust & React to New Priorities Quickly Adjusting to changes quickly is a quality that the military and salespeople both experience quite often. Priorities change due to changes in leadership, actions exhibited by competitors, changes in priorities, changes in strategies, changes in budget, other personnel changes, and different ideas about what the organization needs “today.” Change happens and disrupts plans for leaders in both the military and in sales. What great military and sales leaders do is to react quickly and comprehensively to the changes and deliver another proposal quickly that meets the needs and expectations for the customer’s new strategy to be successful. Staying with the “old” plan helps no one. Delivering a

new plan quickly that addresses the changes in strategy/budget/priorities helps everyone succeed.

Advocate for Your Customer to Create Loyalty

In the military and in business, loyalty is the best outcome for leaders. In the military, loyalty goes “down the line” from military leaders before it comes back up. Lower-ranking military personnel need to see, trust and experience loyalty from their leaders before they provide their loyalty in return. Likewise, for a salesperson and a business, customer loyalty provides the greatest financial rewards for a business and a company. If I create loyalty in a customer, then that customer trusts my products and services and I know that I need to be an incredibly strong internal advocate for that customer in my business organization. Loyalty to and from customers is some of the best personal and business outcomes that military and sales leaders can achieve.

Live A Healthy Lifestyle & Get Home Often

Military and sales positions are highly stressful. Military and sales positions are where the front line “winning” occurs. Sales and military leaders need to promote their own exercise, sleep, healthy diets and control their schedules as much as possible to be near family, friends and other personal support. It is critical to remember, that military units and corporations will never love you and, in fact, are designed to succeed when you leave. Maintaining a strong level of personal and mental fitness means that salespeople and military personnel will continue to have great lives when they leave their organizations and move onto other roles. Being a successful salesperson and a military leader is difficult and stressful. Consistently acting in the best interests of both organizations while being ethical, honest, creative and conscientious ensures a successful career as a military leader and as a sales leader. Chad Storlie is a retired US Army Special Forces officer, an Iraq combat veteran, and has 15 years of university teaching experience as an adjunct Professor of Marketing. He is a mid-level B2B marketing executive and a widely published author on leadership, logistics, marketing business, data, decision making, military and technology topics.

PROFILES IN EDUCATION • AUGUST 5 - 11, 2020 23A

WINNER

Award-Winning Journalism and Creativity Anton Media Group K of Long Island Awards* BANClub ILDPress W2020

PORT TON NEWS WASHING N GROUP PUBLICATIO AN ANTON MEDIA

• FALL 2019

OINT SANDS P S LANE, 12 HICK

Best Newspaper Frontpage Design – First Place - Editor Joe Wolkin and Designer Gail Flug for Syosset/Jericho Tribune Second Place - Managing Editor Jennifer Fauci and Designer Cathy Bongiorno for Long Island Weekly Third Place - Editor Joe Wolkin and Designer Cathy Bongiorno for Levittown Tribune

I N E M A G A Z

Best Sports Feature – First Place Mike Adams for Long Island Weekly “Mikey the Mighty”

TOflighRt THs tieEsAtoVthIA e first

Best Illustration – First Place Nancy Wernersbach for Long Island Weekly

Port’

16 TRAV

zed attention and Top Producer on

year out.

Y RICH IN HISTOR years 375

AN ANTO N MEDIA

23 - 29, ly.com OCTOBER LY LongIslandWeek

W Getianter way

Fright Night A monster takeover for a haunted Halloween

Best Magazine Cover Design – First Place Alex Nuñez for Port Washington News Magazine

/longisland

Best Travel Article – Second Place Kimberly Dijkstra for Long Island Weekly “Winter Getaway” elliman.com

Broke com Lic. Assoc. R. E. e.keat s@elliman. MAG GIE KE ATS 49.7598 | maggi

INFORMATION IS S ONLY. WHILE, THIS INFORMATION PURPOSE TO SQUARE FOOTAGE, ROOM COUNT, IS INTENDE D FOR G, BUT NOT LIMITED L PRESENT ED HEREIN ESTATE. ALL MATERIA ALL PROPERT Y INFORMATION, INCLUDIN OPPORTU NITY. S ELLIMAN REAL NOTICE. EQUAL HOUSING 7401 © 2019 DOUGLA WITHDRAWAL WITHOUT Y, ARCHITE CT OR ZONING EXPERT. STA, NY, 11746. 631.549. NS, CHANGES OR RD, HUNTING TON ERRORS, OMISSIO BY YOUR OWN ATTORNE NTED SUBJECT TO 110 WALT WHITMAN SHOULD BE VERIFIED CORRECT, IT IS REPRESE DISTRICT IN PROPERT Y LISTINGS BELIEVED TO BE S AND THE SCHOOL NUMBER OF BEDROOM

79 O: 516.944.28

Spen A look back at d a co shington ofzy Por weteWa kend in My stic, C onnec ticut

| M: 516.4

Best Column – Second Place Paul DiSclafani for Massapequa Observer “Long Island Living”

Best In-Depth Report/Series – Third Place Marco Schaden for Manhasset Press “Olive Hill” investigative series

les lef inns ly If yo wron Mysti come t in the worldwooden wh W. 20 Coog g staying at c, but you and book, u’d like to cu ab that, in oard the res . Visitors arealing be beat—an Blvd. Th Hilton Mystican’t the fir there are ple rl up with a its tor we st nty it’s a lite e location c, to the seats ne floor, includ of optionsgood 37 years-lo 80-year careeed whalesh lca ral aq ing xt to the on There ng voyage r, embarke ip Village uarium an stone’s thr n’t outdo one of the s. are ow d on d an Ol an alw d or fire de d ex a shor seapor ays Get To pits. t drive Mistick t and his kids, yohibits going different ac to the The Spraw uristic toric tiv day ex u could easilon. Especia ities seafarinhotel pays ho downtown. the riv led across in Mys lly plo y wi sp rin erf tic 19 ma th g end a Museum g all the Museu ront, the My acres on whole 1 utica heritage of ge to the 1na My Likew has to offer. stic Seap offers l decorative the area wi seum m is the large stic Seapor ort all in hours ise, you co expect the luxur touches an th will rec the country st maritime t explo uld sp ies d Get A guest from a Hilto you would Village ognize it as . Long Islan mu- Around ev ring the My end many su Ol rtistic For a indoo ites, a fitnesn—comfortab bent. MoRestoration d Bethpag ders incredible ery corner is stic Aquariu in Mys r by Stu truly uniqu m. anoth animals close-u re than with a na e site din pool, event s center, an le stand dio e er p utica 60 on sp 11 a.m Jeffrey P’a experience, tic ing at upon you’d likely encounter 19th-ce the properthistoric build l The Iro ace and on . outsi with ne demo or 2 p.m. for n on a Satur drop ns. plete wi ntury seafar y to make up ings you first wade of an aq ver happen nstratio a live gla day at uarium. ing him lk th n. an a in, ha It is ssb vil d an chandle be lag fri yo Wh studio d his team woamazing to lowing ry and rdashery, co e comsoft an endly belug u’ll see some en watch at a clam sh operage d rk 25 wh sm sq ack. , you’ll jus uishy like ales. They iley tion-pack Roosevelt in his open a martini ed minutes Ave. In the -air Next, t want to pe stuffed animlook al, as a we glass, P’an it takes to 15 acand he check out the t them. an make a and sh ll-oiled mach d his team 14B group ad straight to outdoor ex ap op of Afric ine hib the ing erateSEPTEMBER 25 - OCTO , us its, reaching penguin tools, all aro an Pe BER 1, 2019 as well ing torches un • ANTON SPO wings d their tan nguins love s. This as furna P’an unfathoma RTS to lik moves is an experie ble temperat ces You ca e the prop k, flapping the zoom ell n He na with an effor nced artist ures. above watch them er of a mo ir and rrates torboat. and als tle gli ss din co each ste as you surface o throu g abou nfide existen watch the ve p along the nce. where . The sea lio gh glass un t from BY MIKE ADAMS n madams@ant pieces—ce. The beau ssel emerge way aroun the ‘dogs of exhibit is neder the onmediagrou d playfu the oc int ty arb ran o p.com y ging fro of his fin ean’ sw to scu lly. Inside ish lpt im n a humid Satur tles, cra , you’ll fin the mi ures large m jewelry to ed day d an nd Mikey Brannigan, morning, to spen bs, starfish lots of fish, is happ . After the d small— vases , bo plu gold medalist, anda Paralympic by jellyf d several mi you name it. s tur- about y to answer demonstratio ggle his qu nu Pr ish the first n, ever runn All aro and bioflu tes mesmeri epare resemble process. So estions and he er 16A | und, the oresce talkthe 4-min with autism to break zed impress me of his WINTE nities oth nt ers ute mile barrier, re co ion an pie RTIM ran in the E! • NO which d interacti are photo op ral. shapes,seem to be ch ist painting ces opposite direction VEMB s, while lik annelin oceans teach about ve exhibits, portuER 20 P’an’s e a dripp g ab John Glenn High around the track at 208613 ma -26, 20 B Long Isl. Education conservation ny of School in Elwood. promine artwork is y Dali clock stract 19 al even fea . The world-class ntly at this cri and Sound exhibits ab of our Any tured the tical ec hig ou alone, save for the athlete was visit to trip to Mysti Mystic Aqua osystem hlight thr t the prese nce ea c riu his of sh ts we share m. coach Sonja ould inc gorgeou to can fin Robinson, who his . lud s shou your lovd one-of-a-ki studio where e a feedback as he navigated the loopted nd ed ones yo in and yo souvenirs for u retrograde for miles on end. urself.

LIW GROUP PUBL ICATION

$1.00 2019 Vol. 6, No. 39

NY, 11746. 631.549.74

its site full advantage of of histor y that takes to own a piece water dock and fetime oppor tunity sandy beach, deepIsland Sound with 5,000| Once-in-a-li far back from the above the Long S POINT | $8,99 a gated estate tucked is d today. Perched , ESTATE | SAND NT desire Sousa so HFRO es BEAC of John Philip with its balconies, es and updat the former home and outdoor living the amenities, featur bridges, Wildbank, res of both indoor two state-ofand offers all of City skyline and lize on the pleasu es a tennis court, of the New York views and capita , the estate includ captivating views to capture the water s to be in bloom strategically set s that seem alway house garden main a 138 ficent road with by magni Web# 3047 ing. Surrounded guest quarters. terrac room t 2-bed elegan with and veranda and 4-car garage , two generators the-ar t wine cellars

nown fo pizza r its world-c BY KI place lass aq kdijks MBERLY an pe tra@a ntonm DIJKST round. rfect week d New Engla uarium, Ho ediagr RA end de llyw Winter oup.co nd char m sti town, m, Mys ood-famou when is an especia nation for s Warm up tic, CT crowds Lo When lly ng , is th grea Islan Below by the fire yo ar in under-t u’re ready e fewer an t time to visit ders year- e Conn : Mystic Seap the courtya ecticut d of to he rd of the Of fice ort Mu these aw -radar desti get out of to f-season ra the seaside se of To Hilton wn tes ar urism um; right: na esome ) Mystic Mystic. (Ph The activiti tion like Mys for a few da e availabl ipyard Aquariu oto e. toric vesh ys, es and tic m (Photosource: Hil A Ro ssels is and collecti refresh , and don’ choose an Hi om s court ton Mystic storic impr on of t miss There ing resta with ) esy of out on Morga Landmark, essive. A Na hisa Vie quain are many ur an n, tional the Ch is the t B&Bs w ts. elegant ship ar on go in

/longisland

HUNTINGTO N STATION,

LONG ISLAND WEEK

lliman.com

WALT WHITMAN ROAD,

Best Infographic – First Place - Editor Dave Gil de Rubio and Designer Cathy Bongiorno for Garden City Life timeline Second Place - Editor Steve Mosco and Designer Cathy Bongiorno for Port Washington News

Best Humor Column – Third Place Paul DiSclafani for Massapequa Observer “My Stupid House”

LONG ISLAND WEEKLY

*Annual awards celebrate work performed in 2019 14

Syosset ~Jericho Tribune

SP OR TS

E S TA B L I S

FULL RUN

Mikey Brannigan celebrates at the 2016 Paral de Janeiro.

(Photo courtesy ympics in Rio of USOPC and

Mikey Mighty

SYOSS ETJER ICHOT

Vol.. 86, No. N 9

OIS Photos)

The

HED 195 8

RIBUN E.COM

FREE SUBSCRIPTION SEE INSIDE FOR DETAILSOFFER !

ERASE

OCTOBER 2 - 8, 2019

Brannigan is head ed to Dubai in November to compete in the 1,500-meter race at Para Athletics Chamthe 2019 World pionships. If he wins, he’ll beco me fending world chamthe three-time depion for the event PAGE and qualify for the 2020 Paralympi , the process. If Tokyo cs in goes well, he has THE a strong shot at of classwork or maki do To succeed in thoseng Paris in 2024. could run a perim well on a test, he famil foreig y n mem environments, Bran ber than a coach the school unde eter or two around nigan must adap , by her own admission r the t to countless unfam Brannigan’s great and teacher. That view supervision of a iliar the rest of the clan. the admission of far from overcomin est achievements, of getting to run is a crutch for athle stimuli. Routine She now rewa as g autism alike, so tes and people with left rd rather than a burden has nevera the Brannigans full time in lives with athletic glory, are obstacles or Robinson had him felt in the impa their East him, even as his Northport home has on people every ct he running backw former hobby . turned into the ards in the outer where. “If an athlete in domi most lane on that track “We got every waking mom nant force of his in Elwood to break to a facility, they a wheelchair comes kid David mail from the mom of this ent. any lingering relian build a ramp,” Edie in Wisconsin,” Edie “Running is freed ce on familiarity Bran nigan said. “The , om, Mike “This wasn’t a hard . kid’s obsessed with ” Brannigan y’s said. “It helps you “Sonja is Mikey’s mother, said. workout, but Mikey, so they relea it was a hard work starte se stress ramp d letting , but they won’t and makes you feel provide for Sonja bette go on walks. Then him run when they Robinson said. out mentally,” . about yourself and r. You feel good “You let her down on They won’t even town and starte , she went to the dependent on looki can really get the track when yourself. Running you believe in da he’s competing.” club. She did all handicap running really feeling that ng at the clock, so passion I love. I is a great sport, it’s a this rhythm and stayin don’t let the stress direct result of Mike work, but it’s a relaxed is hard g in my head.” get to do.” y.” The humble high Brannigan was school denied eligibility setting was a far MOSCO m to cry BY STEVE compete in the iagroup.co Mosco busy ntonmed the Olympian venu from NCAA for failin by Steve Jules, was smosco@a g Bear. Photos cise, so I le my wife, to meet their acade in Rio de Janeiro, e from White to myself whi ering herself with exerphysical mic er is Chili wontons a few hours bett d of requirements. But Brazil, where BY MIKE ADA like the serv June, I had Citi Field. She was ge in my own bran past he ntown MS This at it might seemring you, but press n Madam adamss@ant @anto clawed his way a nity to enga street corners in dow onmed maratho Brannigan senmediiagrou k. agroup.com ely igno choy (and to a ous an opportu running a activ bok as vari y how they worand on this bab ks. just is spot on Team USA. cured the gold standing naturally used over rice with r) for around five buc Great Neck South on, for this in food while ning. out b noodle soupsoup ting mor not ding lam wate —ea High that of han the that Despite everything of le vity the 1,500-mete School acti bott hearty Ask for soccer star Kristi is the story e yelling and r Jin you’ll believe d , a rich and na Garcia is one people insid ese cuisine. Sheng he just kept race three years Flushing. This One bite and fly, but they are calle t prepare for e you nostalgic for a of Long Island’s Chin in the test resource top girls varsity authentic et is an ace soup, only can pigsskin and luscious mea that will makdhood you never even winning. ago. Stre n lushing’s grea y its eating Mai soccer players. p fat, chil , noodle Eatery on dles are tedl ducks. Cris perfectly rendered Let’s Mikey is Brannigan, Mikey is undoub ts. Tightly red bean rolls had. The nooy magic look at one of Grea take a closer hole, with cakes and, my favorite,ghy flavored with the pigs of the t Neck’s top something of a long established establishmenon every Brannigan soft, chew are s just athletes. that are dou scallion pan ducks truly found pork buns and lamb addyard test case for his as a titan in the packed and neighborhood, the big, plump pond. Garcia has socce T20 as enough barn Add r T20 counterparts Paralympic field street in the range from as small h. blood. Her famil in her for to the brot gar rtment . aurants apa rest around the world io y a.m hails athletes with intell 9 stud from El in a Salvador, and her , the a dash of vine good the kitchen buildings with first truly world ing father Guillermo for disabilities, claim ectual end oil s op hot desc re -class was and rnou a defender on Befo ificati ed USPS Ident to multi-sh athlete to succe t of g way to cave men medal with a final the gold on State ment measure. national team for the country’s l on Page 6 into the base ppin corridors givind by one of New York, intellectual disab ed with an g Mal en wings years. seconds ahead time of 3:51.73, 5 ility. That status Honey chicker 28 the Gold Sho en, the halls inhabiteChinese populations comes with its fair of heav Garcia is a stalw at Corn waited for his sounsecond place. He 10 a.m. for noodle Main Street City’s largest ers know that they art and rough patch share of difficulties own Neck South, scori for Great es, most of which petitors to finish dly-beaten coml stop entrance off by more than from restaurant e real-deal Chinese e ng 17 goals left to be borne are , and made a point dumplings it is, your fina nture: while bited serv ther Pork ple here y to inha playi cou And by And Spic a is Robin have adve shaking each of g ng ive. of as an attacking son and the includin r to surv hing food rest of the Bran t go their Yoz Shanghai midfielder last a few ships, food in orde food stalls that it can nigan family. on your Flus Roosevelt Avenue. n estly, you can’ Brannigan is a sporthands. ful season. y r on Many of those rough pork. Care and of food stalls. Hon them, but the first sman at heart are so man experience. White Bea the door says they open of with smoky because his early ry d any patch Outsi savo fille ice, e ying Yoz on with es de t, are serv and finan of school, life made him so cial in nature. wrong , as thes be a dizz name of public The sign the righ let you in whe intimately famil that first bite taken fresh from the g stand on e of the best spicy abilities have netteGarcia’s your., but they’ll plin in the with the no. a.m find So, around to guide Without somebody 9 dum for iar with the sensa at you are d her invita should y. Just ask offers som ld ever dream Bran y pockets al minced pork with of being an outca tion tions to ply her Shanghai, here’s a plan a morning in Flushing stick they are read g order of 12 thingo out on his own nigan, he can’t reve skills at elite soccest. When he was gs you cou diagnosed with steamer and array of spices. academies acros r pork dumplin fiery chilies mix with self spendingty belly. 6—a gleamin ious pork wontons or training. The for competitions autis s ery an aromatic U.S. months old, docto m at just 18 in France, home the country and of eating. The a spicy, peanut butt with an emp skinned, glor red chili oil and Great Neck South Paralympic Com Olympic and to the defending with ut oil for palate as se soft, r . ’s glow Kristi The mittee (USOPC) pean you they should focus rs told his parents that a.m Worl na ies. tes Garci d Cup champions is one of the best exci . a 8:30 led vegg for his pays 8 ra.m . socce mouthful that founds it. appear as minced pick a waiting list for on getting him onto tion, basic needs during competiplayeLon of being in Long Island. rs on con g Islander kets might a group Despite being just best parts but they haven’t much as it sensual poc are bathed in the fires If you’re a One of the feeling that you are drove to come Growing up in North home. are ces are you gh they the Garcia has alrea a junior, to er in a port, Brannigan to paying for a guide. It’s whyaround nd chilies player’s fierce deter Flushing is like me, chan e might direct you got his first taste 9:30 a.m. lamb thou lone newcomalso, no , but the grou incendiary, as the best the or runner in his field to play for Stony dy committed hell Som mina . tly of of running as a ges tion stan hing to and d for con win and strength Flus ky than ing gara Brook University reward in elem many park e it’s so early room full of regulars— . Corner 28 ’re in the moo far more smo bold flavors leave an ofone empty high schoo practices at an two-time defen chara entary school. When of the ld you cter When you even sinc ding conference ’s above her considerab l track he would finish , re else wou your language get al lots, but the deep and r memory not soon champion wom That need for accom . a certain amou leicip one speaks lt Avenue is loud, busy dle soup, whe d Lamb Noodle skills mun ’re likely to you noo with on you the , ens nt ball. rint and socce calle ning e paniment has imp y ing the mor on Rooseve g, full of energy led Robinson to Garcia’s high schoo r team. go but a plac away and seemingl actual park y —Additional repor in become more of confusin to wear off. to and find an where to perfect in ever is Soup? Tucked luckyby a ting Gary Neville, prais l coach, it’s a bit hard explore Alec absolutely w exac Richtly t window on purpose, th the effort. Also, ed his nervous to hing, spot. I kno ante ed spot, ted hidden way. The fron wor you are too

F eature

Brannigan run towards Olymp s ic glory

2 HOURS in

n Downhtoinwg s Flu

Kristina Garc ia:

One food

Also Serving Wood bury, Brookville,

Muttontown

BDS

ick sprin

writer’s qu

Old Brookville and

A Closer Look

Voices for Tru th and Huma nity fights anti-Sem itic bigotr y

Tennis star he

lps lead Syos

(See page 3)

set varsity sq ua

M AY B E O VER, BUT

OUR STEL LAR SYOSS ET OFFIC E 317 Jackson Avenue O: 516.921.2262 elliman.com/lo ngislan

SERVICE

IS YEAR R OUND

ellima n.com

/longis land

it’s well whole roas go for a guar give so find but lined with than ken wings but rather ducks, chic lessen honey-glaze it away and ges of shiny with damn-near my own chan ad that they are pork inste parking, I’ll ding, crisp in blin clue a e ribs give you belly, spar : Where riddle form shoulder and even pig Roosevelt’s nst if you heads. Even ring, brushes agai rts (wink into orde cou r feel rushed basketball guaranteed now that youlocation, still ’re you wink). OK, lling a fulfi in a central on to end up with ted duck car is safely the rest of the way a go roas meal, like it’s time to your first snack. I’m dethe foot and find eatery that can be le soup from Lamb nood b Noodle Soup food big fan of any“hole in the wall,” and a infamous Lam en Mall. scribed as everywhere you turn Gold , stall in the in Flushing with a hole in it with there’s a wall

d (See page 10)

THE SUM MER

If Flus y shops in ial the tiny, dingmissing out on cruc y ese you’re sadl entic Chin pillars of auth ared by people cooking, prep ntained a mai for who have ion pass decades-long their cuisine. hing is accessiFlus Downtown of the Long Island 23 is an ble off exit All you need Expressway. and a willingness cash open mind, gs. thin to try new

198745 B

$1.00

AUGUST 5 - 11, 2020 • PROFILES IN EDUCATION

Life’s been interrupted. Your education doesn’t have to be.

There is a lot of uncertainty now, but you don’t have to be uncertain about your college education this Fall. Queensborough Community College is top-ranked, nearby, and offers a quality education you can count on. Our student support team is ready to cheer you on and guide you through more than 40 award-winning degree programs. Earn college credit that will get you where you want to go, whether you are starting at Queensborough, continuing with us, or visiting from another institution. Accessible, affordable and part of CUNY—the nation’s largest urban University—Queensborough Community College is a safe, solid and smart choice. Now, and for your future! All New York State residents are eligible for the in-state tuition rate. Apply or learn more at www.qcc.cuny.edu

217700 S