Test Bank For Microbiology An Evolving Science, 4th Edition by Joan L. Slonczewski, John W. Foster C

Test Bank For Microbiology-An Evolving Science, 4th Edition by Joan L. Slonczewski (Author), John W. Foster (Author)

Chapter 1-28 CHAPTER 1: Microbial Life: Origin and Discovery MULTIPLE CHOICE 1. Viruses are a. infectious agents that infect exclusively multicellular organisms. b. noncellular particles that take over the metabolism of a cell to generate more virus particles. c. pathogens that replicate in complex growth media. d. cellular particles that belong to the archaea domain. e. microbes that consist of lipid membrane–enclosed genomes.

ANS: B DIF: Easy REF: 1.1 OBJ: 1.1a Recall the definition of a microbe | 1.1b List examples of microbes MSC: Remembering 2. Analysis of DNA sequences reveals a. the ancient convergence of two cell types (i.e., prokaryotes and eukaryotes). b. that prokaryotes and eukaryotes evolved from a common ancestral cell. c. that bacteria share a common ancestor with archaea but not with eukarya. d. that prokaryotes are cells with a nucleus. e. that the genome of Haemophilus influenzae has about 2 billion base pairs.

ANS: B DIF: Easy REF: 1.1 OBJ: 1.1d Explain the implications of microbial genome sequencing MSC: Understanding 3. Which of these groups are considered to be microbes but NOT considered to be cells? a. viruses d. protists b. bacteria e. filamentous fungi c. archaea ANS: A DIF: Easy REF: 1.1 OBJ: 1.1a Recall the definition of a microbe | 1.1c Describe some problems with the definition of a microbe MSC: Understanding 4. A microbe is commonly defined as a ________ that requires a microscope to be seen. a. virus d. multicellular eukaryote b. bacterium e. living organism c. single-cellular prokaryote ANS: E DIF: Easy REF: 1.1 OBJ: 1.1a Recall the definition of a microbe

MSC: Remembering

5. Which one of the following statements regarding microbial cells is FALSE? a. Microbial cells acquire food, gain energy to build themselves, and respond to

environmental change. b. Most single-celled organisms require a microscope to render them visible, but some bacterial cells are large enough to be seen with naked eyes. c. Microbes function as individual entities. d. Many microbes form complex multicellular assemblages. e. Viruses are not considered microbial cells.

ANS: C DIF: Easy REF: 1.1 OBJ: 1.1a Recall the definition of a microbe

MSC: Understanding

6. Which of the following statements is FALSE? a. A genome is the total genetic information contained in an organism’s chromosomal DNA. b. If a microbe’s genome includes genes for nitrogenase, that microbe probably can fix nitrogen. c. By comparing DNA sequences of different organisms, we can figure out how closely related they are. d. Fred Sanger developed the first applicable DNA sequencing method. e. Fred Sanger completed the sequences of Haemophilus influenzae.

ANS: E DIF: Easy REF: 1.1 OBJ: 1.1d Explain the implications of microbial genome sequencing MSC: Remembering 7. The first cellular genomes to be sequenced were those of a. humans. d. prions. b. bacteria. e. fungi. c. viruses.

ANS: B DIF: Easy REF: 1.1 OBJ: 1.1d Explain the implications of microbial genome sequencing MSC: Remembering 8. The environment of early Earth may have contained all of the following EXCEPT a. ferrous iron. d. oxygen. b. methane. e. hydrogen gas. c. ammonia.

ANS: D DIF: Medium REF: Special Topic 1.1 OBJ: 1.1a Recall the definition of a microbe MSC: Remembering 9. The development of the theory of the ―RNA world‖ resulted from the discovery of a. archaea. d. ribozymes. b. prions. e. endosymbionts. c. bacteria.

ANS: D DIF: Medium REF: 1.6 OBJ: 1.6b Explain how studies on microbes fostered our knowledge of DNA function and enhanced DNA technology MSC: Remembering 10. What is the evidence that living cells existed on Earth up to 3.8 billion years ago? a. microfossils d. Martian folded rock formations b. 16S ribosomal RNA e. diatom shells c. Miller and Urey’s experiments ANS: A DIF: Medium REF: Special Topic 1.1 OBJ: 1.5a Explain why microbes can be challenging to classify taxonomically | 1.5b Outline how

microbial classification has changed over time

MSC: Remembering

11. What did van Leeuwenhoek discover using microscopic observations before and after drinking hot beverages? a. Heat did not kill microbes. b. Heat killed microbes. c. Heat did not kill algae. d. Caffeine in coffee killed microbes. e. The existence of spiral-shaped microbes.

ANS: B DIF: Medium REF: 1.2 OBJ: 1.2b Explain why the microscope is an important tool in the field of microbiology | 1.2c Identify the contributions of the following individuals: Nightingale, Hooke, van Leeuwenhoek, Pasteur, and Tyndall MSC: Analyzing 12. Tyndall’s spontaneous generation experiments occasionally failed due to a. nutrient chirality. d. lack of oxygen. b. dust. e. endospores. c. fermentation.

ANS: E DIF: Easy REF: 1.2 OBJ: 1.2d Compare and contrast Spallanzani’s, Pasteur’s, and Tyndall’s experiments that tested spontaneous generation MSC: Analyzing 13. The discovery of microbes occurred in the ________ century? a. seventeenth d. twentieth b. eighteenth e. twenty-first c. nineteenth ANS: C DIF: Easy REF: 1.2 OBJ: 1.2b Explain why the microscope is an important tool in the field of microbiology MSC: Remembering 14. Robert Koch won the Nobel Prize for his contribution to medical bacteriology regarding a. Escherichia coli. d. rabies. b. Bacillus subtilis. e. smallpox. c. Mycobacterium tuberculosis.

ANS: C DIF: Medium postulates MSC: Remembering

REF: 1.3

OBJ: 1.3b List Koch’s

15. How did European invaders to North America kill much of the native population? a. tuberculosis d. HIV b. leprosy e. bubonic plague c. smallpox ANS: C DIF: Medium REF: 1.2 OBJ: 1.2a List both positive and negative impacts that microbes have had on human history MSC: Understanding 16. Florence Nightingale a. is best known as the founder of professional nursing. b. was the first to use disinfectant to demonstrate the significance of aseptic technique. c. developed the pie chart of mortality data during the Crimean War.

d. performed the first controlled experiment on the chemical conversion of matter, known today as chemotherapy. e. argued that the environment of early Earth contained mainly reduced compounds.

ANS: A DIF: Easy REF: 1.2 OBJ: 1.2a List both positive and negative impacts that microbes have had on human history | 1.2c Identify the contributions of the following individuals: Nightingale, Hooke, van Leeuwenhoek, Pasteur, and Tyndall MSC: Remembering 17. Who developed the concept of medical statistics?

a. Francis Crick b. Florence Nightingale c. Edward Jenner

d. Louis Pasteur e. Alexander Fleming

ANS: B DIF: Easy REF: 1.2 OBJ: 1.2c Identify the contributions of the following individuals: Nightingale, Hooke, van Leeuwenhoek, Pasteur, and Tyndall MSC: Remembering 18. The first person to visualize individual microbial cells was a. Antonie van Leeuwenhoek. d. Lady Montagu. b. Robert Hooke. e. Edward Jenner. c. Louis Pasteur.

ANS: A DIF: Easy REF: 1.2 OBJ: 1.2c Identify the contributions of the following individuals: Nightingale, Hooke, van Leeuwenhoek, Pasteur, and Tyndall MSC: Remembering 19. Semmelweis and Lister noted that many of their patients’ deaths were due to a. fungi. d. pathogen transmission by doctors. b. Escherichia coli. e. Staphylococcus. c. chlorine.

ANS: D DIF: Medium REF: 1.3 OBJ: 1.3a Describe what constitutes a pure culture and how to obtain one

MSC: Understanding 20. What is the standard sterilization method for the controlled study of microbes? a. boiling d. autoclaving b. pasteurization e. irradiation c. filter sterilization ANS: D DIF: Medium REF: 1.2 OBJ: 1.2c Identify the contributions of the following individuals: Nightingale, Hooke, van Leeuwenhoek, Pasteur, and Tyndall MSC: Remembering 21. How does the Winogradsky column differ from Koch’s plate media? a. Koch’s media creates a gradient from oxygen-rich conditions at the surface to highly reduced conditions below. b. The Winogradsky column is used for culturing viruses. c. The Winogradsky column is used for growing extremophiles. d. The Winogradsky column uses the kinds of nutrients that feed humans. e. The bacteria that Winogradsky isolated can grow only on inorganic minerals.

ANS: E DIF: Easy REF: 1.4 OBJ: 1.4a List Winogradsky’s contributions to microbial culture technique | 1.4b Define what distinguishes lithotrophs from other organisms MSC: Understanding 22. Suppose Pasteur’s swan-necked flasks containing boiled broth became cloudy twenty-four hours after boiling. Which choice could best explain the turbidity or cloudiness in the broth without supporting spontaneous generation? a. Endospores in the broth survived boiling and grew after the broth cooled. b. Contaminating organisms in the broth killed by boiling became alive again after the broth cooled. c. Chemicals in the broth came together to form living organisms. d. The broth allowed light to pass through it with less interference after boiling. e. Solid material in the broth dissolved during boiling.

ANS: A DIF: Difficult REF: 1.2 OBJ: 1.2c Identify the contributions of the following individuals: Nightingale, Hooke, van Leeuwenhoek, Pasteur, and Tyndall | 1.2d Compare and contrast Spallanzani’s, Pasteur’s, and Tyndall’s experiments that tested spontaneous generation MSC: Applying 23. Which of the following is NOT considered to be an extremophilic condition for bacteria? a. high alkalinity d. high nutrients b. high salinity e. high temperature c. high acidity ANS: D DIF: Medium REF: 1.4 OBJ: 1.4c Explain the role of microbes in geochemical cycling, especially that of nitrogen MSC: Remembering 24. The use of agar as a more robust gelling agent in solid media was suggested by a. Robert Koch. d. Louis Pasteur. b. Ignaz Semmelweis. e. Richard Petri. c. Angelina Hesse.

ANS: C DIF: Easy REF: 1.3 OBJ: 1.3a Describe what constitutes a pure culture and how to obtain one | 1.3c Assess some of the practical obstacles in applying Koch’s postulates MSC: Remembering

25. It took the advent of the polymerase chain reaction to detect the presence of the causative agent for which disease? a. anthrax d. rabies b. tuberculosis e. smallpox c. AIDS ANS: C DIF: Difficult REF: 1.3 OBJ: 1.3c Assess some of the practical obstacles in applying Koch’s postulates | 1.3f Describe how viruses were discovered MSC: Understanding 26. The word ―vaccination‖ is derived from the Latin word vacca, which means a. inject. d. cow. b. smallpox. e. pustule. c. immunize.

ANS: D DIF: Easy REF: 1.3 OBJ: 1.3d Recall the contributions of various individuals to the discovery and implementation of vaccination | 1.3e Compare the roles of immunization, antiseptics, and antibiotics in human disease treatment and prevention MSC: Remembering 27. What was the basis for the original smallpox vaccine? a. chickenpox virus d. smallpox virus b. cowpox virus e. anthrax c. rabies virus ANS: B DIF: Medium REF: 1.3 OBJ: 1.3d Recall the contributions of various individuals to the discovery and implementation of vaccination MSC: Remembering 28. Penicillin was first used to save the lives of many people during which war? a. the U.S. Civil War d. World War I b. the Korean War e. World War II c. the Vietnam War ANS: E DIF: Easy REF: 1.3 OBJ: 1.3e Compare the roles of immunization, antiseptics, and antibiotics in human disease treatment and prevention MSC: Remembering 29. How do many animal endosymbionts grow?

a. on the surface of the host b. on low nutrients c. by reducing iron oxide

d. on inorganic minerals e. in biofilms

ANS: E DIF: Medium REF: 1.4 OBJ: 1.4d Compare the roles of animal endosymbionts and plant endosymbionts MSC: Remembering 30. All of the following are true about penicillin EXCEPT that it a. was discovered by Alexander Fleming. b. was an accidental discovery. c. is produced by a bacterium. d. was the first antibiotic used by humans. e. was purified by Florey and Chain.

ANS: C DIF: Difficult REF: 1.3 OBJ: 1.3e Compare the roles of immunization, antiseptics, and antibiotics in human disease treatment and prevention MSC: Remembering 31. Which of the following statements regarding viruses is FALSE? a. Most are too small to be seen by a light microscope. b. They are ―filterable agents‖ that can pass through porcelain filters that have a pore size that blocks microbes. c. Their genomes could be composed of DNA or RNA. d. They are smaller than plasmids and prions. e. Viral particles, when pure enough, can be crystallized.

ANS: D DIF: Medium REF: 1.3 OBJ: 1.3f Describe how viruses were discovered

MSC: Analyzing

32. You have isolated a bacterium that you believe to be the causative agent of a new disease in frogs.

How would you test the third of Koch’s postulates? a. Determine the shape of the bacterial cells. b. Inject the bacteria into a healthy frog. c. Isolate the bacterium from a sick frog. d. Show that the bacterium is not present in healthy frogs. e. Grow a pure culture of the bacterium outside the frog.

ANS: B postulates MSC: Applying

DIF: Difficult

REF: 1.3

OBJ: 1.3b List Koch’s

33. How did Sergei Winogradsky grow lithotrophs? a. enrichment culture d. endosymbiosis b. organic media e. chain of infection c. pure culture ANS: A DIF: Easy REF: 1.4 OBJ: 1.4a List Winogradsky’s contributions to microbial culture technique | 1.4b Define what distinguishes lithotrophs from other organisms MSC: Understanding 34. Organisms that live symbiotically inside a larger organism are known as a. organelles. d. endosymbionts. b. cyanobacteria. e. chloroplasts. c. mitochondria.

ANS: D DIF: Easy REF: 1.4 OBJ: 1.4d Compare the roles of animal endosymbionts and plant endosymbionts MSC: Remembering 35. Animal microbiomes are NOT significant in a. digesting plant fibers. b. bioluminescence. c. protection from pathogens.

d. converting ammonia to nitrate. e. providing nutrients to the host.

ANS: D DIF: Easy REF: 1.4 OBJ: 1.4d Compare the roles of animal endosymbionts and plant endosymbionts MSC: Applying 36. Carl Woese’s discovery replaced the classification scheme of five kingdoms with a scheme of three a. phyla. d. orders. b. domains. e. genera. c. classes.

ANS: B DIF: Easy REF: 1.5 OBJ: 1.5b Outline how microbial classification has changed over time | 1.5d Describe the importance of DNA sequencing in classification MSC: Remembering 37. The gene expression machinery of archaea is MOST similar to a. monera. d. eukaryotes. b. prokaryotes. e. mitochondria. c. bacteria.

ANS: D DIF: Medium REF: 1.5 OBJ: 1.5e Compare and contrast archaea, bacteria, and eukaryotes MSC: Understanding 38. In the three-domain model, the bacterial ancestor of mitochondria derives from ancient a. fungi. d. archaea. b. cyanobacteria. e. protists. c. respiring bacteria.

ANS: C DIF: Medium REF: 1.5 OBJ: 1.5c Appraise endosymbiosis as an explanation for mitochondria and chloroplasts MSC: Remembering 39. Which of the following organelles are thought to be of prokaryotic origin? a. chloroplast d. chloroplast and mitochondria b. mitochondria e. chloroplast and nucleus c. nucleus ANS: D DIF: Medium REF: 1.5 OBJ: 1.5c Appraise endosymbiosis as an explanation for mitochondria and chloroplasts MSC: Understanding 40. In the three-domain model, the bacterial ancestor of chloroplasts derives from ancient a. fungi. d. archaea. b. cyanobacteria. e. protists. c. proteobacteria.

ANS: B

DIF: Medium

REF: 1.5

OBJ: 1.5c Appraise endosymbiosis as an explanation for mitochondria and chloroplasts MSC: Remembering 41. Which commonly used microbial classification advancement led to the tree by Carl Woese in 1977?

a. comparative genomics b. microscopy c. X-ray diffraction

d. protein sequencing e. 16S rRNA sequencing

ANS: E DIF: Medium REF: 1.5 OBJ: 1.5b Outline how microbial classification has changed over time | 1.5d Describe the importance of DNA sequencing in classification MSC: Understanding 42. Electron microscopes use what to focus the beam of electrons? a. electromagnets d. X-ray diffraction b. a condenser lens e. glass c. light rays ANS: A DIF: Easy REF: 1.6 OBJ: 1.6a Describe the roles of the electron microscope and the ultracentrifuge in advancing our knowledge of cell structure and function MSC: Remembering 43. Peter Mitchell and Jennifer Moyle discovered the ________ theory in the 1960s. a. germplasm d. DNA synthesis b. evolution e. polymerase chain reaction c. chemiosmotic ANS: C DIF: Easy REF: 1.6 OBJ: 1.6a Describe the roles of the electron microscope and the ultracentrifuge in advancing our knowledge of cell structure and function MSC: Remembering 44. The X-ray diffraction studies by which of the following scientists concluded that DNA was a double helix? a. James Watson d. Maurice Wilkins b. Rosalind Franklin e. Kary Mullis c. Francis Crick

ANS: B DIF: Easy REF: 1.6 OBJ: 1.6a Describe the roles of the electron microscope and the ultracentrifuge in advancing our knowledge of cell structure and function MSC: Remembering 45. What feature of bacteria facilitated the DNA revolution in the 1970s? a. They are very small. d. All of their genes were known. b. They readily recombine DNA. e. They do not cause disease. c. They have very large genomes.

ANS: B DIF: Medium REF: 1.6 OBJ: 1.6b Explain how studies on microbes fostered our knowledge of DNA function and enhanced DNA technology MSC: Understanding 46. This scientist first discovered the process of transformation. a. Francis Crick d. Louis Pasteur b. Robert Koch e. Frederick Griffith c. Edward Jenner ANS: E DIF: Difficult REF: 1.6 OBJ: 1.6b Explain how studies on microbes fostered our knowledge of DNA function and enhanced DNA technology MSC: Remembering 47. Taq polymerase forms the basis of a technique for a. comparative genomics. d. DNA amplification. b. recombinant DNA. e. protein synthesis. c. X-ray diffraction.

ANS: D DIF: Easy REF: 1.6 OBJ: 1.6c State some uses of microbes in medicine and industry MSC: Understanding 48. In 1975, scientists held a conference at Asilomar to regulate and restrict the field of a. recombinant DNA. d. DNA amplification. b. comparative genomics. e. forensic microbiology. c. DNA sequencing.

ANS: A DIF: Medium REF: 1.6 OBJ: 1.6c State some uses of microbes in medicine and industry MSC: Understanding 49. The study of and cause of disease in humans, animals, and plants is called a. microbiology. d. epidemiology. b. phylogeny. e. forensics. c. genomics.

ANS: D DIF: Medium REF: 1.6 OBJ: 1.6c State some uses of microbes in medicine and industry MSC: Remembering 50. The ultracentrifuge is a high-speed centrifuge ideally suited for separating individual a. cellular proteins and nucleotides. d. secondary metabolites. b. microbial cells. e. base pairs. c. mold spores.

ANS: A

DIF: Medium

REF: 1.6

OBJ: 1.6a Describe the roles of the electron microscope and the ultracentrifuge in advancing our knowledge of cell structure and function MSC: Understanding SHORT ANSWER 1. What is the MOST recent evidence suggesting that all life on Earth shares a common ancestry?

ANS: Many genomes have now been sequenced, and those sequences are available in databases for comparison. This field is referred to as comparative genomics. Comparisons have revealed that there is a set of core genes shared by all organisms.

DIF: Difficult REF: 1.1 | 1.5 OBJ: 1.1d Explain the implications of microbial genome sequencing | 1.5b Outline how microbial classification has changed over time MSC: Analyzing 2. How are prokaryotes and eukaryotes different?

ANS: A prokaryote lacks a nucleus and membrane-bounded organelles, whereas a eukaryote has a nucleus and membrane-bounded organelles.

DIF: Easy REF: 1.1 | 1.5 MSC: Remembering

OBJ: 1.1a Recall the definition of a microbe

3. How do microbes help in the extraction of minerals?

ANS: Several lithotrophic bacteria help in the rapid oxidation of minerals, which generates strong acids that expedite the breakdown of mineral ore. Currently, approximately 20% of the world’s copper, as well as some uranium and zinc, is produced by bacterial leaching.

DIF: Medium REF: 1.2 OBJ: 1.2a List both positive and negative impacts that microbes have had on human history MSC: Applying 4. Antonie van Leeuwenhoek worked as a cloth draper, inspecting the quality of cloth. How did this lead to his interest in microscopy?

ANS: His work introduced him to magnifying lenses. He began the hobby of grinding lenses, ultimately making a microscope that enabled him to observe single-celled microbes.

DIF: Medium REF: 1.2 OBJ: 1.2c Identify the contributions of the following individuals: Nightingale, Hooke, van Leeuwenhoek, Pasteur, and Tyndall MSC: Understanding 5. What was the major complaint about Lazzaro Spallanzani’s experiment to disprove spontaneous generation, and how did Louis Pasteur’s swan-neck flasks overcome this?

ANS:

Spallanzani’s flasks were plugged so as not to let organisms accidentally enter the boiled medium.

Opponents argued that no growth was observed simply due to the lack of oxygen. Pasteur’s swan-neck flasks did not allow organisms to enter the flask but did allow oxygen to enter. Growth was still not observed.

DIF: Medium REF: 1.2 OBJ: 1.2c Identify the contributions of the following individuals: Nightingale, Hooke, van Leeuwenhoek, Pasteur, and Tyndall MSC: Evaluating 6. Describe the discoveries of Louis Pasteur while working with the French beer and wine manufacturers in assessing alcohol versus vinegar production during fermentation.

ANS: Previously, it was believed that the conversion of grapes and grain to wine and beer was a spontaneous chemical process. Pasteur discovered that this fermentation was caused by living yeast, which did not require oxygen for growth. He also discovered that when the grapes or grain are contaminated with bacteria instead of yeast, acetic acid is produced instead of alcohol.

DIF: Medium REF: 1.2 OBJ: 1.2c Identify the contributions of the following individuals: Nightingale, Hooke, van Leeuwenhoek, Pasteur, and Tyndall MSC: Understanding 7. Describe the effects of three microbial diseases that have significantly affected human populations throughout history.

ANS: Answers may vary. Some examples include bubonic plague, which killed one-third of Europe’s population in the fourteenth century; tuberculosis, which was common in the nineteenth century; AIDS, which affects many people today; and smallpox, which killed a large number of native North Americans.

DIF: Medium REF: 1.2 OBJ: 1.2a List both positive and negative impacts that microbes have had on human history | 1.2c Identify the contributions of the following individuals: Nightingale, Hooke, van Leeuwenhoek, Pasteur, and Tyndall MSC: Applying 8. Why did it take so long for humans to determine that microbes cause infectious diseases?

ANS: Microbes are too small to be seen with the naked eye, so until powerful-enough microscopes were invented, humans did not know that microbes existed. Even after humans were aware of the presence of microbes, they did not suspect them of causing disease until people such as Joseph Lister and Ignaz Semmelweis performed experiments that showed antiseptics decrease the incidence of infection.

DIF: Difficult REF: 1.2 | 1.3 OBJ: 1.2b Explain why the microscope is an important tool in the field of microbiology MSC: Understanding 9. Robert Koch’s postulates have not been used to prove HIV as the causative agent of AIDS. Why not?

ANS:

Answers may vary, but a major reason is that humans cannot be injected with HIV to see if they develop AIDS, and a suitable animal host doesn’t exist for testing.

DIF: Medium REF: 1.3 OBJ: 1.3c Assess some of the practical obstacles in applying Koch’s postulates MSC: Understanding 10. Define ―attenuation‖ and describe some mechanisms used to attenuate pathogens.

ANS: Attenuation results in a weakened organism that will not produce full-blown disease but will generate immunity. Answers for mechanisms may vary, but heat treatment or aging for various periods or natural attenuation in the host are mentioned in the chapter.

DIF: Medium REF: 1.3 OBJ: 1.3d Recall the contributions of various individuals to the discovery and implementation of vaccination | 1.3e Compare the roles of immunization, antiseptics, and antibiotics in human disease treatment and prevention MSC: Applying 11. What is the significance of the work of Ignaz Semmelweis and Joseph Lister?

ANS: They showed that use of antiseptics on doctors’ hands and medical instruments drastically reduced the mortality rate of hospital patients. They made these observations before Robert Koch’s germ theory of disease.

DIF: Medium REF: 1.3 OBJ: 1.3e Compare the roles of immunization, antiseptics, and antibiotics in human disease treatment and prevention MSC: Understanding 12. How would you use Robert Koch’s postulates to prove that a specific organism causes a new disease in mice?

ANS: See Figure 1.17 in the textbook: (1) The suspected organism is found in all diseased mice, but is absent from healthy mice.

(2) The suspected organism is isolated from the diseased mice and grown in pure culture.

(3) When the suspected organism is introduced into a healthy mouse, the same disease occurs.

(4) The same strain of microbe is obtained from the newly diseased mouse.

DIF: Difficult MSC: Applying

REF: 1.3

OBJ: 1.3b List Koch’s postulates

13. Explain why the organisms that were studied by Sergei Winogradsky could not be grown on Robert Koch’s plate media containing agar or gelatin.

ANS: The organisms studied by Winogradsky were lithotrophs, which feed solely on inorganic substances. Koch’s plate media contained organic nutrient sources, which may even be toxic to the organisms he was attempting to grow.

DIF: Medium REF: 1.4 OBJ: 1.4a List Winogradsky’s contributions to microbial culture technique

MSC: Analyzing 14. Is it true that only culturable bacteria contribute to ecology? Explain your answer.

ANS: No, this is not a true statement. It is estimated that barely 0.1% of microbial species can be cultured. The work of Winogradsky and later microbial ecologists showed that bacteria are necessary for geochemical cycling. Many of these organisms can’t be grown in pure culture on laboratory media but can be grown in enrichment culture such as a Winogradsky column.

DIF: Difficult REF: 1.4 OBJ: 1.4c Explain the role of microbes in geochemical cycling, especially that of nitrogen MSC: Analyzing 15. Define the term ―endosymbiont‖ and give an example of an endosymbiotic relationship found in nature.

ANS: An endosymbiont is an organism living symbiotically inside a larger organism. Examples may vary, but include the following: Rhizobium in a leguminous plant, bioluminescent bacteria in the light organs of fish and squid, and photosynthetic algae and coral.

DIF: Medium REF: 1.4 OBJ: 1.4d Compare the roles of animal endosymbionts and plant endosymbionts MSC: Applying 16. Give two reasons why microbes have been difficult to classify.

ANS: First, even with the use of light microscopes, only the basic shape of microbes can be determined, and many microbes have similar shapes even though they are very different in other ways. Second, microbes do not fit the classic definition of a species, which is a group of organisms that interbreed. Microbes typically reproduce asexually. When they do exchange genes, they may do so with distantly related species.

DIF: Medium REF: 1.5 OBJ: 1.5a Explain why microbes can be challenging to classify taxonomically MSC: Analyzing 17. Briefly explain the endosymbiosis theory and the evidence that supports it.

ANS: The endosymbiosis theory proposes that mitochondria and chloroplasts evolved from bacteria that were engulfed by pre-eukaryotic cells, and that over time these endosymbiotic prokaryotic cells lost the ability to survive outside of the host cell but were maintained as organelles. Evidence supporting the endosymbiosis theory includes the fact that mitochondria and chloroplasts possess circular DNA with similarity to modern bacteria.

DIF: Medium REF: 1.5 OBJ: 1.5c Appraise endosymbiosis as an explanation for mitochondria and chloroplasts MSC: Understanding 18. What were Rosalind Franklin’s contributions toward discovering the structure of DNA, and why wasn’t she one of the recipients of the Nobel Prize for this discovery?

ANS: She was an X-ray crystallographer who studied the structure of DNA. Her X-ray micrographs showed for the first time that DNA was a double helix. A colleague showed her micrographs to James Watson, who was also studying the structure of DNA. Watson and Francis Crick published their model of the structure of DNA in the journal Nature and denied that they had used Franklin’s micrographs. Franklin also died before the awarding of the prize.

DIF: Medium REF: 1.6 OBJ: 1.6a Describe the roles of the electron microscope and the ultracentrifuge in advancing our knowledge of cell structure and function MSC: Understanding 19. Briefly describe how the ultracentrifuge is used to determine the sizes of cellular macromolecules.

ANS: The ultracentrifuge uses centrifugal forces to separate cell components. Theodor Svedberg calculated that the particle sizes could be determined based on the rate of sedimentation of the particles in an ultracentrifuge.

DIF: Medium REF: 1.6 OBJ: 1.6a Describe the roles of the electron microscope and the ultracentrifuge in advancing our knowledge of cell structure and function MSC: Understanding 20. If you want to produce DNA polymerases like those used in polymerase chain reaction (PCR) for amplification of DNA, from which natural environment would you try to isolate the producers?

ANS: Since DNA polymerase in PCR must survive many rounds of cycling to near-boiling temperatures, the most conducive environment for finding DNA polymerase, such as the enzymes used in PCR reactions, would be searching for microbes in an environment where the temperature is extremely high.

DIF: Difficult REF: 1.6 OBJ: 1.6c State some uses of microbes in medicine and industry MSC: Applying

CHAPTER 2: Observing the Microbial Cell MULTIPLE CHOICE 1. Chlamydia trachomatis transmits infection to a new cell via a. a membrane vesicle. d. host membranes. b. elementary bodies. e. the human cell. c. amoeba.

ANS: B DIF: Easy REF: 2.Intro OBJ: 2.1d Identify the type(s) of microscopy needed to view a particular specimen MSC: Remembering 2. The part of the human eye that is MOST involved in resolving an image is the a. iris. d. retina. b. lens. e. cornea. c. optic nerve.

ANS: D DIF: Easy REF: 2.1 OBJ: 2.1a Explain how the structure of the human eye dictates the resolution of objects MSC: Remembering 3. A ball-shaped microbe is referred to as a a. bacillus. b. coccus. c. vibrio.

d. strepto. e. spirochete.

ANS: B DIF: Easy REF: 2.1 OBJ: 2.1c Describe and identify bacterial morphologies (e.g., bacilli, cocci, and spirochetes) MSC: Remembering 4. Resolution is the smallest distance by which two objects can be ________ and still be ________. a. magnified; seen d. distinguished; separated b. separated; distinguished e. magnified; distinguished c. magnified; separated ANS: B DIF: Medium REF: 2.1 OBJ: 2.1b Differentiate between resolution and detection 5. 400 nm is equivalent to a. 4.0  105 m. b. 4.0  106 m. c. 4.0  107 m.

MSC: Remembering

d. 4.0  108 m. e. 4.0  109 m.

ANS: C DIF: Medium REF: 2.1 OBJ: 2.1a Explain how the structure of the human eye dictates the resolution of objects MSC: Applying 6. Which of these series arranges microbes from smallest to largest? a. virus  bacterium  red blood cell  paramecium b. virus  red blood cell  bacterium  paramecium c. bacterium  virus  paramecium  red blood cell d. bacterium  virus  red blood cell  paramecium e. paramecium  red blood cell  bacterium  virus

ANS: A DIF: Difficult REF: 2.1 OBJ: 2.1c Describe and identify bacterial morphologies (e.g., bacilli, cocci, and spirochetes) MSC: Applying 7. What happens if the wavelength of radiation is larger than the object being viewed? a. absorption d. refraction b. scattering e. resolution c. no resolution ANS: C DIF: Easy REF: 2.2 OBJ: 2.2a Identify what conditions must exist for electromagnetic radiation to resolve an object from neighboring objects or the surrounding medium MSC: Remembering 8. Wavelength interference results in small observed objects (like bacteria) being surrounded by a. a capsule. d. a dark field. b. a membrane. e. a cell wall. c. concentric rings.

ANS: C DIF: Difficult REF: 2.2 OBJ: 2.2b Explain the properties of light MSC: Applying 9. What is the MOST important property that enables a lens to magnify an image? a. absorption d. refraction b. fluorescence e. scattering c. reflection ANS: D DIF: Easy REF: 2.2 OBJ: 2.2c Differentiate among absorption, reflection, refraction, and scattering MSC: Remembering 10. When two waves are out of phase by ________ wavelength, they produce destructive interference, canceling each other’s amplitude and resulting in contrast in the image. a. one-tenth of a d. one-half of a b. one-eighth of a e. one c. one-quarter of a ANS: D DIF: Difficult REF: 2.2 OBJ: 2.2d Explain how lenses magnify images

MSC: Understanding

11. Increasing the refractive index of the medium between the object and the objective lens increases a. refraction. d. resolution. b. reflection. e. wavelength. c. magnification.

ANS: D DIF: Difficult REF: 2.2 OBJ: 2.2d Explain how lenses magnify images

MSC: Understanding

12. If aqueous cytoplasm was submerged in a beaker of immersion oil, the slide would be a. undetectable. d. fluorescent. b. brighter than its surroundings. e. stained. c. darker than its surroundings.

ANS: A DIF: Medium REF: 2.2 OBJ: 2.2b Explain the properties of light MSC: Applying

13. What would happen if a lens had the same refractive index as air? a. Light would not pass through the lens. b. The image would be magnified more than with a glass lens. c. The image would be magnified, but the resolution would be less than with a glass lens. d. The image would be magnified, and the resolution would be greater than with a glass lens. e. The image would not be magnified.

ANS: E DIF: Medium REF: 2.2 OBJ: 2.2c Differentiate among absorption, reflection, refraction, and scattering MSC: Applying 14. The highest useful magnification for a light microscope is about a. 100X. d. 100,000X. b. 1,000X. e. 1,000,000X. c. 10,000X. ANS: C DIF: Easy REF: 2.3 OBJ: 2.3a State the factors that influence image quality in bright-field microscopy MSC: Applying 15. A(n) ________ acts to vary the diameter of the light column in a light microscope. a. condenser d. diaphragm b. objective e. lens c. ocular ANS: D DIF: Easy REF: 2.3 OBJ: 2.3c Explain the function of the components of a compound microscope MSC: Remembering 16. Which of these arranges the steps of the Gram stain into the correct order? a. iodine  crystal violet  decolorizer  safranin b. safranin  decolorizer  crystal violet  iodine c. crystal violet  decolorizer  iodine  safranin d. crystal violet  decolorizer  safranin  iodine e. crystal violet  iodine  decolorizer  safranin ANS: E DIF: Medium REF: 2.3 OBJ: 2.4g Explain how the structure of the bacterial cell wall relates to its Gram-stain status MSC: Remembering 17. Label the condenser in the figure below.

a. A b. B c. C

d. D e. E

ANS: C DIF: Easy REF: 2.3 OBJ: 2.3b Identify images obtained via scanning electron microscopy and transmission electron microscopy MSC: Remembering 18. Malachite green is commonly used to stain a. eukaryotic cells. b. Gram-negative cells. c. Gram-positive cells.

d. bacterial endospores. e. acid-fast cells.

ANS: D DIF: Easy REF: 2.3 OBJ: 2.4f Classify stains as simple or differential

MSC: Remembering

19. As lens strength increases, the light cone ________ and the lens must be ________ the object. a. narrows; nearer to d. widens; farther from b. narrows; farther from e. widens; touching c. widens; nearer to ANS: C DIF: Easy REF: 2.3 OBJ: 2.3a State the factors that influence image quality in bright-field microscopy MSC: Understanding 20. Staining helps to visualize bacteria by increasing the a. size of the cells. d. magnification of the image. b. motility of the cells. e. aberration of the image. c. contrast of the image.

ANS: C DIF: Easy REF: 2.3 OBJ: 2.4e Explain the advantages and disadvantages of fixing and staining specimens MSC: Remembering

21. One advantage of a wet mount is a. low contrast. b. that the organism is still. c. viewing in a natural state.

d. high contrast. e. that the sample does not overheat.

ANS: C DIF: Easy REF: 2.3 OBJ: 2.3d Describe the advantages and disadvantages of a wet mount MSC: Remembering 22. Which two components of the Gram stain form a complex that is retained by Gram-positive cells? a. crystal violet and iodine d. alcohol and safranin b. safranin and iodine e. alcohol and iodine c. crystal violet and safranin ANS: A DIF: Medium REF: 2.3 OBJ: 2.3g Explain how the structure of the bacterial cell wall relates to its Gram-stain status MSC: Understanding 23. Which of the following is best visualized using a negative stain? a. Gram-negative cell wall d. endospores b. acid-fast cell wall e. flagella c. capsule ANS: C DIF: Medium REF: 2.3 OBJ: 2.3g Explain how the structure of the bacterial cell wall relates to its Gram-stain status MSC: Understanding 24. Which of these numeric aperture and light combinations would give the best resolution? a. numeric aperture  0.8, wavelength  600 nm b. numeric aperture  0.8, wavelength  500 nm c. numeric aperture  1.0, wavelength  700 nm d. numeric aperture  1.0, wavelength  600 nm e. numeric aperture  0.8, wavelength  400 nm ANS: E DIF: Difficult REF: 2.3 OBJ: 2.3a State the factors that influence image quality in bright-field microscopy MSC: Applying 25. What is the total magnification of a light microscope when using a 25X ocular and 40X objective lens? a. 15X d. 1,000X b. 65X e. 1,200X c. 400X ANS: D DIF: Easy REF: 2.3 OBJ: 2.3c Explain the function of the components of a compound microscope MSC: Applying 26. What is the best explanation for a Gram-positive bacterium appearing pink after performing a Gram stain? a. The crystal violet was left on for too long. b. The iodine was left on for too long. c. The decolorizer was left on for too long. d. The safranin was left on for too long. e. The stain was properly performed.

ANS: C DIF: Difficult REF: 2.3 OBJ: 2.3g Explain how the structure of the bacterial cell wall relates to its Gram-stain status MSC: Analyzing 27. What is the best explanation for a Gram-negative bacterium appearing purple after performing a Gram stain? a. The safranin was not applied. b. The decolorizer was not applied. c. The iodine was not applied. d. The crystal violet was not applied. e. The stain was properly performed.

ANS: B DIF: Difficult REF: 2.3 OBJ: 2.3g Explain how the structure of the bacterial cell wall relates to its Gram-stain status MSC: Analyzing 28. Which type of microscopy is used to identify the 3-D structure of biofilms? a. phase-contrast d. bright-field b. dark-field e. confocal c. florescent ANS: E DIF: Easy REF: 2.4 OBJ: 2.4c Describe the advantages of super-resolution imaging MSC: Analyzing 29. Fluorescent microscopy that absorbs light at 260m would MOST likely fluoresce at a. 100 nm. d. 400 nm. b. 200 nm. e. 800 nm. c. 260 nm.

ANS: D DIF: Difficult REF: 2.4 OBJ: 2.4b Recall the factors that determine the cell specificity of a fluorophore MSC: Applying 30. What molecule is shown below?

a. GFP b. FM4-64 c. DNA

d. RNA e. DAPI

ANS: E DIF: Medium REF: 2.4 OBJ: 2.4b Recall the factors that determine the cell specificity of a fluorophore MSC: Applying 31. What happens to an electron when excited by light at the excitation wavelength? a. It remains in the same orbital. d. It emits a photon. b. It moves to a lower energy orbital. e. It is filtered. c. It moves to a higher energy orbital.

ANS: C DIF: Medium REF: 2.4 OBJ: 2.4a Differentiate between the excitation and emission wavelengths MSC: Understanding 32. Fluorescence microscopy using labeled antibodies is referred to as a. immunofluorescence. d. phase-contrast microscopy. b. autofluorescence. e. dark-field microscopy. c. confocal microscopy.

ANS: A DIF: Easy REF: 2.4 OBJ: 2.4b Recall the factors that determine the cell specificity of a fluorophore MSC: Understanding 33. Which of the following is an advantage of using chemical imaging microscopy? a. observing an organism in its living environment b. displaying plankton c. measuring pH within a cell d. showing distribution of chemicals in a cell e. pinpointing a protein location ANS: D

DIF: Medium

REF: 2.4

OBJ: 2.4d State the function of chemical imaging microscopy

MSC: Applying

34. Which of these techniques can be used to localize the DNA sequence at the origin of replication in a bacterial cell? a. fluorescence microscopy d. atomic force microscopy b. phase contrast e. cryo-EM c. X-ray diffraction ANS: A DIF: Easy REF: 2.4 OBJ: 2.4b Recall the factors that determine the cell specificity of a fluorophore MSC: Understanding 35. A useful application of dark-field optics is the study of bacterial a. motility. d. shape. b. surfaces. e. structure. c. interiors.

ANS: A DIF: Medium REF: 2.5 OBJ: 2.5a Describe under what conditions dark-field microscopy is the best choice for viewing specimens MSC: Remembering 36. Which of the following techniques are based upon wave interference? a. X-ray diffraction and phase contrast microscopy b. phase contrast and dark-field microscopy c. bright-field and dark-field microscopy d. X-ray diffraction and atomic force microscopy e. scanning and transmission electron microscopy ANS: A DIF: Medium REF: 2.5 OBJ: 2.5b Explain the principles behind phase-contrast microscopy MSC: Applying 37. In which type of microscopy do dust particles interfere the MOST? a. bright-field d. interference b. dark-field e. fluorescence c. phase-contrast ANS: B DIF: Easy REF: 2.5 OBJ: 2.5a Describe under what conditions dark-field microscopy is the best choice for viewing specimens MSC: Analyzing 38. Which type of microscopy gives a ―false 3-D image‖? a. Gram stain d. negative stain b. nuclear magnetic resonance e. differential interference contrast c. scanning electron ANS: E DIF: Easy REF: 2.5 OBJ: 2.5c State the types of images obtained with differential interference contrast microscopy MSC: Remembering 39. Which type of microscopy is used to view the internal structures of a specimen? a. light d. transmission electron b. atomic force e. confocal fluorescence c. scanning electron ANS: D

DIF: Easy

REF: 2.6

OBJ: 2.3b Identify images obtained via scanning electron microscopy and transmission electron microscopy MSC: Understanding 40. The knife used to cut embedded specimens for observation by transmission electron microscopy is called a a. crystallographer. d. polymer. b. microtome. e. scalpel. c. grid.

ANS: B DIF: Easy REF: 2.6 OBJ: 2.3b Identify images obtained via scanning electron microscopy and transmission electron microscopy MSC: Remembering 41. Atomic force microscopy measures ________ between a probe and an object to map the three-dimensional topography of a cell. a. hydrogen bonds d. pH changes b. covalent interactions e. magnetic interactions c. van der Waals forces ANS: C DIF: Easy REF: 2.6 OBJ: 2.6c Proposed applications for scanning probe microscopy MSC: Remembering 42. Which type of microscopy is particularly useful to study the surfaces of live bacteria? a. atomic force d. dark-field b. scanning electron e. bright-field c. transmission electron ANS: A DIF: Easy REF: 2.6 OBJ: 2.6c Proposed applications for scanning probe microscopy MSC: Applying 43. Transmission electron microscopy commonly has a resolution of ________ the highest resolution possible for light microscopy. a. 10X d. 10,000X b. 100X e. 1,000,000X c. 1,000X ANS: C DIF: Difficult REF: 2.6 OBJ: 2.6a Compare and contrast light microscopy and electron microscopy MSC: Applying 44. Which of the following would be MOST appropriate to visualize viral particles being assembled inside an infected bacterial cell? a. dark-field microscopy b. atomic force microscopy c. fluorescence microscopy d. scanning electron microscopy e. transmission electron microscopy ANS: E DIF: Medium REF: 2.3 OBJ: 2.3b Identify images obtained via scanning electron microscopy and transmission electron microscopy MSC: Understanding 45. Which of the following methods is used to generate the structure shown below?

a. scanning probe microscopy b. scanning electron microscopy c. transmission electron microscopy

d. confocal microscopy e. X-ray crystallography

ANS: E DIF: Easy REF: 2.6 OBJ: 2.6d State what kind of information is obtained from X-ray crystallography analysis MSC: Understanding 46. Cryo-electron microscopy (cryo-EM) is differentiated from transmission electron microscopy because it a. requires making thin slices of the sample to be viewed. b. does not require staining with heavy metals. c. may be used to view living tissues. d. uses a weaker electron beam. e. can provide a color image of the microbial cell.

ANS: B DIF: Easy REF: 2.6 OBJ: 2.6e Explain the theory of using cryo techniques in cryo-electron microscopy and cryocrystallography MSC: Analyzing 47. The digitally combined images of cryo-EM can achieve resolution comparable to that of a. scanning electron microscopy. b. transmission electron microscopy. c. interference microscopy. d. X-ray crystallography. e. dark-field microscopy.

ANS: D DIF: Difficult REF: 2.6 OBJ: 2.6e Explain the theory of using cryo techniques in cryo-electron microscopy and cryocrystallography MSC: Analyzing 48. Which of the following techniques can visualize bacteria without focusing electromagnetic radiation? a. cryo-electron microscopy d. atomic force microscopy

b. phase-contrast microscopy c. dark-field microscopy

e. X-ray diffraction

ANS: D DIF: Medium REF: 2.6 OBJ: 2.6c Proposed applications for scanning probe microscopy MSC: Analyzing 49. The spots recorded on film during X-ray diffraction analyses are due to a. artifacts. d. absorption. b. scattering. e. fluorescence. c. wave interference.

ANS: C DIF: Medium REF: 2.7 OBJ: 2.6d State what kind of information is obtained from X-ray crystallography analysis MSC: Understanding 50. Which of these techniques would provide the best resolution of an enzyme’s structure? a. scanning electron microscopy b. transmission electron microscopy c. cryo-EM d. X-ray diffraction analysis e. atomic force microscopy ANS: D DIF: Medium REF: 2.7 OBJ: 2.6d State what kind of information is obtained from X-ray crystallography analysis MSC: Understanding SHORT ANSWER 1. List and describe three common shapes of bacteria.

ANS: Bacilli (bacillus in the singular) are rod-shaped bacteria. Cocci (singular, coccus) are spherical-shaped bacteria. Spirochetes are tightly coiled spirals or corkscrew-shaped bacteria.

DIF: Easy REF: 2.1 OBJ: 2.1c Describe and identify bacterial morphologies (e.g., bacilli, cocci, and spirochetes) MSC: Remembering 2. Microbes were detected long before the invention of the microscope. How could this be?

ANS: Detection is the ability to observe the presence of an object, such as when we detect a group of bacteria in a culture tube or growing on a surface such as a food product. Even though we can detect the group, we cannot resolve individual cells without the magnification afforded by microscopes.

DIF: Easy REF: 2.1 OBJ: 2.1a Explain how the structure of the human eye dictates the resolution of objects MSC: Understanding 3. Are all bacilli Bacillus? Explain.

ANS:

No. Bacillus refers to a particular genus of organisms that are commonly found in the soil.

Although they are rod shaped, the members of this genus are not the only bacteria that have this cellular morphology. The term ―bacillus‖ refers to any rod-shaped microbe, which means that not all bacilli belong to the genus Bacillus.

DIF: Easy REF: 2.1 OBJ: 2.1c Describe and identify bacterial morphologies (e.g., bacilli, cocci, and spirochetes) MSC: Understanding 4. If your eyes had photoreceptors packed as closely as an eagle’s (about eight times greater than humans), would you be able to resolve a virus (100 nm in size) using a light microscope? Why or why not?

ANS: No. Although your resolving power would be much improved, the light microscope’s power will still be limited by the wavelengths of light that you can see (roughly 400 nm for human eyes).

Objects less than 400 nm cannot be resolved by light in the visible spectrum.

DIF: Medium REF: 2.1 OBJ: 2.1a Explain how the structure of the human eye dictates the resolution of objects MSC: Applying 5. Describe three conditions that are necessary for electromagnetic radiation to resolve an object.

ANS: There must be contrast between the object and its surroundings. The wavelength of the radiation must be equal to or smaller than the size of the object. The detector must have sufficient resolution for the given wavelength.

DIF: Easy REF: 2.2 OBJ: 2.2a Identify what conditions must exist for electromagnetic radiation to resolve an object from neighboring objects or the surrounding medium MSC: Remembering 6. List and briefly describe four ways that light interacts with objects.

ANS: (1) Absorption: light energy is absorbed by an object. (2) Reflection: a wavefront bounces off an object at an angle equal to its incident angle. (3) Refraction: light bends when it enters a substance that slows its speed. (4) Scattering: a wavefront interacts with an object of smaller dimensions than the wavelength.

DIF: Medium REF: 2.2 MSC: Remembering

OBJ: 2.2b Explain the properties of light

7. Compare and contrast a simple stain (like methylene blue) with the Gram stain. What information about a microbial sample can be collected with each?

ANS: Both staining procedures colorize bacterial cells, thereby increasing the sample’s contrast and improving resolution. A simple stain will color all microbial cells uniformly. This allows one to record the relative size, shape, and arrangement of any cells present. The Gram stain is a differential stain. In addition to size, shape, and arrangement, this procedure allows one to determine if the cells have a Gram-positive (purple) or Gram-negative (pink) cell wall structure.

DIF: Medium REF: 2.3 MSC: Understanding

OBJ: 2.3f Classify stains as simple or differential

8. List three different differential stains used in microbiology. What can be detected with each?

ANS: The most common differential stain is the Gram stain. This procedure allows one to distinguish between cells having one membrane (Gram-positive) and two membranes (Gram-negative).

Another common differential stain is the acid-fast stain. Carbolfuchsin stains the mycolic acid–containing acid-fast cells of the genus Mycobacterium. The endospore stain is a differential stain that stains endospores with malachite green. Negative staining and antibody staining are also included in the text.

DIF: Medium REF: 2.3 MSC: Understanding

OBJ: 2.3f Classify stains as simple or differential

9. What color are Gram-positive and Gram-negative cells when properly Gram stained? For each step of the Gram-stain procedure, predict the colors of a Gram-positive or Gram-negative cell if that step were omitted during staining. Explain your reasoning.

ANS: Properly Gram stained Gram-positive cells are purple and Gram-negative are pink.

(1) Skipping primary stain (crystal violet): Gram-positive and Gram-negative would both be pink.

No crystal violet–iodide complex would be formed in the Gram-positive wall. All cells would be decolorized and take on the color of safranin.

(2) Skipping mordant (iodine): Gram-positive and Gram-negative would both be pink. No crystal violet–iodine complex would be formed in the Gram-positive wall. All cells would be decolorized and take on the color of safranin.

(3) Skipping decolorizer (alcohol): Gram-positive and Gram-negative would both be purple. The crystal violet–iodine complex would remain in all cells. Although safranin still binds, the purple color is so much more intense that the pink of the safranin cannot be seen.

(4) Skipping secondary stain (safranin): Gram-positive cells would be purple. The Gram-negative cells would be colorless. The dye complex will be removed from the Gram-negative cells, but they will be difficult to see since the counterstain was not applied.

DIF: Medium REF: 2.3 OBJ: 2.3g Explain how the structure of the bacterial cell wall relates to its Gram-stain status MSC: Understanding 10. Why do some bacteria appear purple after being Gram stained, while others appear pink?

ANS: Gram-negative cells have a few layers of peptidoglycan cell wall and an outer lipopolysaccharide membrane. Gram-positive organisms have several layers of peptidoglycan and no outer membrane.

The multiple layers of peptidoglycan retain the crystal violet–iodine complex, so appear purple.

Gram-negative cells do not retain the crystal violet because there are few layers of peptidoglycan and the outer membrane is disrupted by the decolorizer.

DIF: Medium REF: 2.3 OBJ: 2.3g Explain how the structure of the bacterial cell wall relates to its Gram-stain status MSC: Understanding

11. Compare and contrast the radiation sources, lenses, and image-capturing devices used in light microscopy and transmission electron microscopy.

ANS: The radiation source for light microscopy is a light, whereas for electron microscopy it is an electron source or tungsten filament. The lenses in the light microscope are glass, whereas magnets are used in electron microscopy. The lenses have similar functions and are arranged in the same order in both types of microscopy. Light microscopy uses a condenser lens, whereas the lens in electron microscopy is called the projection lens. The image-capturing device for light is the human eye, or sometimes a camera. The image-capturing device for electron microscopy is a fluorescent screen.

DIF: Difficult REF: 2.3 | 2.6 OBJ: 2.3c Explain the function of the components of a compound microscope MSC: Understanding 12. Why are stains used in microscopy? Compare and contrast the stains used in light versus electron microscopy.

ANS: Stains are used to increase the contrast between an object and its surroundings, so as to make it visible. The stains used in light microscopy are usually charged and interact with different cellular components. Positively charged dyes bind to negatively charged cell surfaces. They also are colored, so they impart color to a cell or its components. The stains used for electron microscopy are heavy metals or salts, which increase the density of certain components, again increasing contrast. In electron microscopy, the image of the microbe is always black and white.

DIF: Difficult REF: 2.3 | 2.6 OBJ: 2.3e Explain the advantages and disadvantages of fixing and staining specimens MSC: Understanding 13. The figure below shows the Gram-staining process. Describe what is happening at step number 3 relative to bacterial cell walls.

ANS: Iodine is added and binds to Gram-positive cells with greater affinity than Gram-negative cells.

This is due to a greater concentration of peptidoglycan in the Gram-positive cell walls.

DIF: Easy REF: 2.3 OBJ: 2.4g Explain how the structure of the bacterial cell wall relates to its Gram-stain process MSC: Understanding 14. The figure below displays absorption and emission spectra for a fluorophore. Describe the difference between absorption and emission and how this is reflected in the figure.

ANS: The highest peak at a higher energy level is absorption. This is when the photon is absorbed by the electron. The lower peak represents emission, which is when the electron loses energy and drops to a lower orbital.

DIF: Easy REF: 2.4 OBJ: 2.4a Differentiate between the excitation and emission wavelengths MSC: Understanding 15. Define a fluorophore and give three examples of how it can be used to label cells.

ANS: A fluorophore is a fluorescent molecule that can be used to stain a specimen for observation with a fluorescence microscope. Some fluorophores, such as DAPI, have affinity for certain cell chemicals. Antibodies can be labeled with fluorescent dyes and reacted with specific targets in immuno- fluorescence. Short sequences of DNA attached to a fluorophore can be used to hybridize and label target DNA. DIF: Difficult REF: 2.4 OBJ: 2.4b Recall the factors that determine the cell specificity of a fluorophore MSC: Understanding 16. Using the figure below, explain how the visualization of molecules occurs through X-ray crystallography.

ANS: The X-ray beam focuses on a crystal and is rotated over all the angles and provides a diffraction pattern. The intensity of the diffraction is recorded; this pattern is analyzed using a model of individual molecules.

DIF: Difficult REF: 2.6 OBJ: 2.6d State what kind of information is obtained from X-ray crystallography analysis MSC: Applying 17. Most electron micrographs in microbiology textbooks are in color. Is this normal for an electron micrograph? Why or why not?

ANS: Electron micrographs are not naturally colored, as color is defined by visible light, not electrons.

The original image is produced when the electrons bombard a fluorescent screen. The resultant image is processed by a computer to appear as black and white with intensities in the entire range of grays in between. These images are later colorized using computer software (like Photoshop) to improve the aesthetics and provide additional information.

DIF: Difficult REF: 2.6 OBJ: 2.3b Identify images obtained via scanning electron microscopy and transmission electron microscopy MSC: Understanding 18. Give a few reasons why living organisms may not be observed by transmission electron microscopy (TEM) or scanning electron microscopy (SEM).

ANS: In TEM, the specimens are fixed and embedded into a polymer for sectioning. The specimen is then stained with heavy metal to increase contrast. In SEM, the entire organism is shadowed with heavy metal prior to observation. Most importantly, however, the entire optical column of the EM must be maintained under vacuum, and an electron beam would quickly destroy a living specimen.

DIF: Easy REF: 2.6 OBJ: 2.3b Identify images obtained via scanning electron microscopy and transmission electron

microscopy

MSC: Understanding

19. Describe three methods of sample preparation for electron microscopy. Which method would cause the fewest artifacts? Why? ANS: (1) Samples can be embedded in a polymer and cut into thin sections with a microtome, then coated with a heavy metal. (2) Samples can be sprayed onto a copper grid, then treated with a heavy metal. (3) Samples may be flash frozen for cryo-electron microscopy. Cryo-electron microscopy will cause the fewest artifacts. When using this technique, the cells are not fixed or artificially stained. Instead, the cells are flash frozen—leaving the cell components still hydrated and closest to their original state.

DIF: Medium REF: 2.6 OBJ: 2.6e Explain the theory of using cryo techniques in cryo-electron microscopy and cryocrystallography MSC: Understanding 20. Explain why components from thermophilic bacteria take less X-ray damage than other bacteria.

ANS: There is always unavoidable deterioration of specimens under the exposure of X-rays. However, thermophilic bacteria have more stable crystals than homologous crystals growing at moderate temperatures. Since the crystals are more stable, they can better withstand X-ray exposure.

DIF: Medium REF: 2.6 OBJ: 2.6e Explain the theory of using cryo techniques in cryo-electron microscopy and cryocrystallography MSC: Understanding

CHAPTER 3: Cell Structure and Function MULTIPLE CHOICE 1. E. coli and Sinorhizobium cell-surface proteins enable colonization of ________ and ________, respectively. a. the human intestinal epithelium; animal skin b. legume plants; the human intestinal epithelium c. the human intestinal epithelium; legume plants d. legume plants; animal skin e. cantaloupe; spinach ANS: C DIF: Medium REF: 3.1 OBJ: 3.1a Describe the components of the bacterial cell envelope MSC: Remembering 2. The capsule polysaccharides form a slippery mucous layer that inhibits a. diffusion. d. lysis. b. phagocytosis. e. osmosis. c. attachment.

ANS: B DIF: Easy REF: 3.3 OBJ: 3.3a Describe the structure and functions of the bacterial cell wall MSC: Remembering

3. We cannot see the molecules within a cell, but ________ and ________ analysis generate a remarkably detailed view. a. structural; genetic d. microscopy; subcellular b. microscopy; genetic e. chemical; genetic c. chemical; subcellular ANS: D DIF: Medium REF: 3.1 OBJ: 3.1a Describe the components of the bacterial cell envelope MSC: Remembering 4. The z-ring is a. made up of an actin-like polymer. b. involved in segregation of two to four nucleoids. c. controlled by a nutrient-dependent regulator. d. involved in replication but not cytokinesis. e. involved in preventing transcription of noncoding regions of DNA. ANS: C DIF: Difficult REF: 3.1 OBJ: 3.1a Describe the components of the bacterial cell envelope MSC: Analyzing 5. Polyamines are ________ charged when the pH is near neutral. a. not d. super b. negatively e. randomly c. positively ANS: C DIF: Medium REF: 3.1 OBJ: 3.1b Name the chemical components within a bacterial cell MSC: Remembering 6. The proteins embedded in a membrane require that region to be a. crystalline. d. negatively charged. b. hydrophobic. e. positively charged. c. flexible.

ANS: B DIF: Medium REF: 3.1 OBJ: 3.1b Name the chemical components within a bacterial cell MSC: Remembering 7. Mary Jane Osborn discovered that inner and outer membranes are different in density by using a. genetic analysis. d. protein synthesis. b. X-ray crystallography. e. fluorescent. c. ultracentrifugation.

ANS: C DIF: Easy REF: 3.1 OBJ: 3.1c Explain how lysis and ultracentrifugation contribute to cell fractionation MSC: Remembering 8. Cells must be broken open in order to then fractionate the components. Each of the following can be used in bacterial cell breakage EXCEPT a. French press. d. ultracentrifugation. b. lysozyme . e. ultrasonic vibration. c. mild detergent.

ANS: D DIF: Medium REF: 3.1 OBJ: 3.1c Explain how lysis and ultracentrifugation contribute to cell fractionation

MSC: Understanding 9. Some bacterial cells are inedible for humans because of the a. high ion content in the cytoplasm. b. high proportion of nucleic acids that humans degrade to the waste product uric acid. c. peptide-linked sugars in the cell wall cannot be digested. d. high uric acid content of the cytoplasm. e. high polyamine content, which is toxic.

ANS: B DIF: Difficult REF: 3.1 OBJ: 3.1b Name the chemical components within a bacterial cell MSC: Understanding 10. Which of these experiments would NOT be a reason to fractionate bacterial cells? a. to obtain membrane fractions to study transport proteins b. to purify ribosome subunits to study translation c. to obtain periplasmic proteins to study chaperons from that space d. to obtain cytoplasmic proteins such as FtsZ e. to study the growth rate of E. coli in the presence of lactose ANS: D DIF: Medium REF: 3.1 OBJ: 3.1d List some uses of cell fractionation

MSC: Applying

11. All of the statements about genetic analysis of cells complementing cell fractionation are true EXCEPT that it a. is used to identify which genes and proteins are involved in a process. b. can be used by identifying phenotypes under a microscope. c. can be used to identify the exact change in protein sequences giving a particular phenotype. d. has never been used to study FtsZ. e. can be used to study cell division.

ANS: D DIF: Difficult REF: 3.1 OBJ: 3.1e Compare cell fractionation to genetic analysis

MSC: Evaluating

12. The molecule shown below is ________ and may play a role in ________.

a. b. c. d.

phosphatidylethanolamine; heat response cardiolipin; heat response phosphatidylglycerol; heat response cardiolipin; starvation

e. phosphatidylglycerol; heat response ANS: D DIF: Medium REF: 3.2 OBJ: 3.2a Describe cell membrane structure

MSC: Understanding

13. Specific membrane components, particularly ________, determine which substances are transported across the membrane. a. phospholipids d. polysaccharides b. proteins e. leaflets c. ions ANS: B DIF: Easy REF: 3.2 OBJ: 3.2b List the functions of membrane proteins

MSC: Remembering

14. In the figure below, which of the four fatty acids adds fluidity to a membrane, and what type of bond allows this to happen?

a. A; saturated bond b. B; trans c. B; cis

d. C; cis e. D; double

ANS: D DIF: Medium REF: 3.2 OBJ: 3.2a Describe cell membrane structure

MSC: Applying

15. A medically important example of active transport is that of drug ________ proteins powered by the hydrogen ion gradient. a. efflux d. diffusion b. porin e. lysis c. membrane-permeant ANS: A DIF: Medium REF: 3.2 OBJ: 3.2c Differentiate among passive diffusion, passive transport, and active transport MSC: Remembering 16. Extreme thermophiles have ________ chains in their membrane in order to maintain membrane stability. a. lipoprotein d. terpenoid b. hopanoid e. cardiolipin c. cholesterol ANS: D DIF: Medium REF: 3.2 OBJ: 3.2a Describe cell membrane structure

MSC: Remembering

17. Which of the following types of molecules may passively diffuse across a membrane? a. an amino acid in a low pH environment b. a weak acid in a high pH environment c. a large polar molecule such as a sugar d. a small uncharged molecule such as water e. No molecules can diffuse across a membrane.

ANS: D DIF: Easy REF: 3.2 OBJ: 3.2c Differentiate among passive diffusion, passive transport, and active transport MSC: Applying 18. You are studying life-forms in extreme environments, and you have discovered a microorganism with cardiolipin, hopanoids, and ester linkages in the membrane. It also has teichoic acids, galactans, and phenolic glycolipids in the cell wall. In addition, it is a porin similar to OmpA. This microorganism is most likely related to a. eukaryotic cells. d. Gram-positive bacteria. b. archaea. e. Gram-negative bacteria. c. mycobacteria.

ANS: C DIF: Difficult REF: 3.2 | 3.3 OBJ: 3.2a Describe cell membrane structure | 3.3a Describe the structure and functions of the bacterial cell wall MSC: Analyzing 19. Which of the following reinforces and stiffens membranes in bacteria? a. hopanoids d. peptidoglycans b. polyamines e. lipids c. sterols ANS: A DIF: Easy REF: 3.2 OBJ: 3.2a Describe cell membrane structure

MSC: Understanding

20. You study a bacterium that grows in very low-nutrient aqueous environments. Which type of transport mechanism is required to deliver nutrients from these environments where they are at a lower concentration than inside the cell? a. aquaporins d. passive diffusion b. active transport e. Such bacteria cannot exist. c. facilitated diffusion ANS: B DIF: Difficult REF: 3.2 OBJ: 3.2c Differentiate among passive diffusion, passive transport, and active transport MSC: Analyzing 21. How can weak acids and weak bases cause pH stress to cells? a. Only weak acids can cause stress by diffusing across a membrane at low pH. b. Weak acids and weak bases do not cause stress. c. If a cell has transporters that are not well regulated, weak acids or weak bases can accumulate inside the cells and cause stress. d. At certain pHs, both weak acids or weak bases will be uncharged and thus are small uncharged molecules that can diffuse across a membrane and cause pH stress inside the cell. e. Weak bases will only cause pH stress at low pH. ANS: D DIF: Difficult REF: 3.2 OBJ: 3.2d Explain how membrane-permeant weak acids and bases cause pH stress MSC: Applying

22. Water can move across a membrane via passive diffusion but that movement is aided by a. aquaporins. d. ethanol2. b. ion transporters. e. weak acids and bases. c. active transport.

ANS: A DIF: Medium REF: 3.2 OBJ: 3.2c Differentiate among passive diffusion, passive transport, and active transport MSC: Remembering 23. Efflux pumps send antibiotics, such as the protein synthesis–inhibitor tetracycline, out of the bacterial cells, enabling them to grow in the presence of antibiotics. Which of the following therapeutic approaches will be LEAST effective? a. Switch to an antibiotic that is not a substrate of the efflux pump. b. Augment the treatment with an efflux inhibitor. c. Increase the concentration of tetracycline. d. Augment the treatment with an ATP synthase inhibitor. e. Add a second antibiotic to the therapy.

ANS: C DIF: Difficult REF: 3.2 OBJ: 3.2c Differentiate among passive diffusion, passive transport, and active transport MSC: Evaluating 24. Cell wall growth patterns of a variety of bacteria have been studied using fluorescently labeled D-amino acids. This approach has worked because a. fluorescent amino acids block further cell wall synthesis and thus provide a snapshot of the cell wall at a particular time. b. ribosomes cannot incorporate any fluorescence and thus cannot use fluorescent amino acids; it all goes to cell wall. c. vancomycin can block the incorporation of D-alanine into protein and thus force it into the cell wall. d. the labeled amino acids are D-amino acids, not L-amino acids.; thus, they only were incorporated into cell wall. e. This approach has not worked.

ANS: D DIF: Difficult REF: 3.2 OBJ: 3.3a Describe the structure and functions of the bacterial cell wall MSC: Evaluating 25. The bacterial cell wall of mycobacteria is highly hydrophobic due to presence of a. lipoproteins. d. polysaccharides. b. phenolic glycolipids. e. glycoproteins. c. phospholipids.

ANS: B DIF: Medium REF: 3.3 OBJ: 3.3b Compare the cell envelopes of firmicutes, proteobacteria, and mycobacteria MSC: Remembering 26. The lipopolysaccharide of the outer membrane is of medical importance because it acts as a(n) a. endotoxin. d. enterotoxin. b. exotoxin. e. antibiotic. c. toxoid.

ANS: A DIF: Easy REF: 3.3 OBJ: 3.3a Describe the structure and functions of the bacterial cell wall

MSC: Remembering 27. The ________ is the region between the cytoplasmic membrane and the outer membrane in Gram-negative cells. a. periplasm d. lipopolysaccharide b. cytoplasm e. S-layer c. lysozyme ANS: A DIF: Easy REF: 3.3 OBJ: 3.3a Describe the structure and functions of the bacterial cell wall MSC: Remembering 28. The structure shown below is found in the ________ of some bacteria and the larger molecules are connected by the ________ cross-link shown at the arrow.

a. cell wall; sugar b. cell membrane; peptide c. cell membrane; sugar

d. cell wall; peptide e. nucleoid membrane; peptide

ANS: D DIF: Medium REF: 3.3 OBJ: 3.3b Compare the cell envelopes of firmicutes, proteobacteria, and mycobacteria MSC: Understanding 29. All of the following are components of peptidoglycan EXCEPT a. N-acetylglucosamine. d. amino acids. b. N-acetylmuramic acid. e. peptide cross-links. c. lipopolysaccharide.

ANS: C DIF: Easy REF: 3.3 OBJ: 3.3b Compare the cell envelopes of firmicutes, proteobacteria, and mycobacteria MSC: Understanding 30. Which is NOT a component of a Gram-negative bacterium’s wall? a. peptidoglycan d. diaminopimelic acid b. teichoic acid e. MurNac c. N-acetylmuramic acid ANS: B DIF: Medium REF: 3.3 OBJ: 3.3b Compare the cell envelopes of firmicutes, proteobacteria, and mycobacteria MSC: Understanding

31. All of the following are true statements about bacterial S-layers EXCEPT that they a. are commonly found in Gram-positive cells as well as in archaea. b. are a crystalline layer consisting of protein or glycoprotein. c. present a formidable physical barrier to predators or parasites. d. are found in bacteria freshly isolated from natural sources. e. are found in bacteria isolated from laboratory cultures.

ANS: E DIF: Difficult REF: 3.3 OBJ: 3.3a Describe the structure and functions of the bacterial cell wall MSC: Understanding 32. One similarity between a Gram-negative cell envelope and that of mycobacteria is that mycobacteria have a. lipid A. d. S-layers. b. teichoic acids. e. ampicillin. c. a porin.

ANS: C DIF: Medium REF: 3.3 OBJ: 3.3b Compare the cell envelopes of firmicutes, proteobacteria, and mycobacteria MSC: Understanding 33. Lipopolysaccharides are found in a. all bacteria. b. Gram-positive bacteria. c. Gram-negative bacteria.

d. archaea. e. eukaryotes.

ANS: C DIF: Easy REF: 3.3 OBJ: 3.3a Describe the structure and functions of the bacterial cell wall MSC: Understanding 34. All of the following are true about prokaryotic outer membranes EXCEPT that they a. are lipid bilayers composed of identical phospholipids. b. are found only in Gram-negative bacteria. c. contain endotoxin. d. contain proteins involved in transport. e. contain lipopolysaccharide.

ANS: A DIF: Difficult REF: 3.3 OBJ: 3.3b Compare the cell envelopes of firmicutes, proteobacteria, and mycobacteria MSC: Understanding 35. Bacterial shape is determined by a. tubulin and actin. b. cell membrane. c. cytoskeleton.

d. S-layers. e. a protein called crescentin.

ANS: C DIF: Medium REF: 3.3 OBJ: 3.3c State the names and functions of the bacterial cytoskeleton proteins MSC: Understanding 36. All of the following are true for DNA-binding proteins EXCEPT that they a. can form protective crystalline structures around organized DNA. b. condense prokaryotic DNA. c. can act as regulators of gene expression.

d. determine the shape of the cell. e. help to keep cells viable for a longer duration of time.

ANS: D DIF: Medium REF: 3.4 OBJ: 3.4a Recall the structure of the bacterial nucleoid

MSC: Understanding

37. All of the following are true of supercoiling in chromosomal DNA EXCEPT that it a. doubles back and twists upon itself. b. facilitates RNA transcription. c. results in compaction. d. is generated by gyrase. e. is maintained by DNA-binding proteins.

ANS: B DIF: Difficult REF: 3.4 OBJ: 3.4a Recall the structure of the bacterial nucleoid

MSC: Understanding

38. A ________ is a term used to designate a single messenger RNA molecule being translated by multiple ribosomes. a. couple d. thylakoid b. periplasm e. polysome c. carboxysome ANS: E DIF: Easy REF: 3.4 OBJ: 3.4b Compare and contrast prokaryotes and eukaryotes with respect to DNA replication, transcription, and translation MSC: Understanding 39. Which of the following is true of Fts proteins? a. They form a ring in the area where cell division will occur. b. They aid in DNA replication. c. They are involved in peptidoglycan synthesis. d. They are involved in making proteins. e. They are important in transcription.

ANS: A DIF: Easy REF: 3.3 OBJ: 3.4c Describe bacterial cell division; include the replisome, cell expansion, and septation MSC: Understanding 40. The partition that results from the inward growth of the cell envelope from opposite directions is known as the a. divisome. d. colony. b. septum. e. Z-ring. c. wall.

ANS: B DIF: Easy REF: 3.4 OBJ: 3.4c Describe bacterial cell division; include the replisome, cell expansion, and septation MSC: Understanding 41. In order for septation to occur, which process must finish first? a. transcription and translation d. cell wall synthesis b. membrane synthesis e. synthesis of mreB c. DNA replication ANS: C DIF: Medium REF: 3.4 OBJ: 3.4c Describe bacterial cell division; include the replisome, cell expansion, and septation MSC: Understanding

42. Which of the following is FALSE regarding the polarity and aging of Caulobacter crescentus? a. The protein TipN is involved. b. The two poles of the cell are different. c. It contributes to a life cycle. d. It results in two cell types (i.e., stalked cell and swarmer). e. It results in two cell types, each with a monotrichous flagellum.

ANS: E DIF: Medium REF: 3.5 OBJ: 3.5a Describe the cell cycle and cell structure of the asymmetric Caulobacter crescentus MSC: Understanding 43. Which of the following is described as an attachment organelle that is a membrane-bound extension of the cytoplasm? a. pili d. stalks b. fimbriae e. flagella c. sex pili ANS: D DIF: Medium REF: 3.6 OBJ: 3.6a List some specialized structures that are only found in certain species MSC: Remembering 44. Which name refers to having flagella attached at one or both ends of the cell? a. peritrichous d. bitrichous b. lophotrichous e. flagellated c. monotrichous ANS: B DIF: Easy REF: 3.6 OBJ: 3.6b Recall the structures and functions of thylakoids, carboxysomes, storage granules, pili, stalks, nanotubes, and flagella MSC: Remembering 45. Directed movements toward or away from a chemical or physical signal are known as a. gliding. d. locomotion. b. flagellation. e. slime layer. c. chemotaxis.

ANS: C DIF: Easy REF: 3.6 OBJ: 3.6c Explain how chemoreceptors and magnetosomes direct flagellar motility MSC: Remembering 46. Light is harvested by protein complexes called a. thylakoids. d. storage granules. b. carboxysomes. e. magnetosomes. c. gas vesicles.

ANS: A DIF: Easy REF: 3.6 OBJ: 3.6b Recall the structures and functions of thylakoids, carboxysomes, storage granules, pili, stalks, nanotubes, and flagella MSC: Understanding 47. Which of the following materials is found in aquatic bacteria and used for positioning in the water column? a. gas vesicle d. glycogen b. sulfur e. magnetosome c. polyphosphate ANS: A DIF: Easy REF: 3.6 OBJ: 3.6b Recall the structures and functions of thylakoids, carboxysomes, storage granules, pili,

stalks, nanotubes, and flagella

MSC: Understanding

48. All of the following are used by prokaryotic cells for attaching to solid surfaces EXCEPT a. endospore. d. fimbriae. b. capsule. e. pili. c. stalks.

ANS: A DIF: Easy REF: 3.6 OBJ: 3.6b Recall the structures and functions of thylakoids, carboxysomes, storage granules, pili, stalks, nanotubes, and flagella MSC: Understanding 49. Which of the following statements about the prokaryotic flagella is INCORRECT? a. It is driven by the cell’s transmembrane proton current. b. It is embedded in the layers of the cell envelope. c. It is observed by electron microscopy. d. It moves with a whiplike motion. e. It is used for chemotaxis.

ANS: D DIF: Easy REF: 3.6 OBJ: 3.6b Recall the structures and functions of thylakoids, carboxysomes, storage granules, pili, stalks, nanotubes, and flagella MSC: Understanding 50. The bacterial flagellum is a helical protein filament whose ________ motor moves the cell in search of a more favorable environment. a. shaking d. whiplike b. vibrating e. propeller-like c. wavelike ANS: E DIF: Easy REF: 3.7 OBJ: 3.6c Explain how chemoreceptors and magnetosomes direct flagellar motility MSC: Understanding 51. With respect to the proteins involved in the polarity of Caulobacter, which of the following statements is FALSE? a. DivJ is a marker for stalk and is produced at an old pole where PodJ had previously been located. b. The stalk develops at a pole where PodJ is found. c. After cell division, TipN localizes at the new cell pole opposite the stalk. d. PodJ is a marker for flagella and interacts with TipN at the new pole. e. After elongation and prior to division, TipN localizes to the septum.

ANS: B DIF: Difficult REF: 3.5 OBJ: 3.5a Describe the cell cycle and cell structure of the asymmetric Caulobacter crescentus MSC: Analyzing 52. Polar aging of symmetrical bacteria such as E. coli plays a role in stress responses in which of the following ways? a. Antibiotics only affect older poles of stressed cells. b. Alternators and accelerators are better at responding to stress. c. Proteins damaged by stresses accumulate at old poles, thereby allowing new poles to continue growing. d. Newer poles are more resistant to acidity and heat. e. Newer poles produce flagella and can swim away from stress.

ANS: C

DIF: Difficult

REF: 3.5

OBJ: 3.5b Explain the causes and consequences of polar aging in apparently symmetrical bacteria MSC: Analyzing SHORT ANSWER 1. List and briefly describe four components of a typical bacterial cell.

ANS: Possible answers include the following: cytoplasm-gel-like network of proteins and macromolecules; cell membrane surrounds cytoplasm, made of phospholipids and hydrophobic proteins; cell wall surrounds cell membrane, rigid structure of polysaccharides and peptides; lipopolysaccharide membrane surrounds cell wall of Gram-negative cells, made of lipids and polysaccharides; capsule surrounds envelope of some organisms, made of polysaccharides, prevents phagocytosis; flagellum used for cell motility; nucleoid coiled chromosome not surrounded by membrane.

DIF: Medium REF: 3.1 OBJ: 3.1a Describe the components of the bacterial cell envelope | 3.1b Name the chemical components within a bacterial cell MSC: Remembering 2. Describe four ways cells can be broken open in order to isolate the cellular components.

ANS: Mild detergent lysis disrupts the cell membrane without denaturing cellular components.

Sonication is the use of high-frequency sound waves to disrupt cell membranes. Enzymes are proteins that can be used to break open cells. Mechanical disruption uses methods such as a French press to lyse cells.

DIF: Difficult REF: 3.1 OBJ: 3.1c Explain how lysis and ultracentrifugation contribute to cell fractionation MSC: Remembering 3. As proteins are found in various subcellular fractions, how could they be further analyzed?

ANS: A proteomic approach to knowing about these proteins would involve running gel electrophoresis on a particular fraction followed by digestion with trypsin and then mass spectroscopy. Identities of the proteins or fragments are determined based on comparison to databases.

DIF: Medium REF: 3.1 MSC: Remembering

OBJ: 3.1d List some uses of cell fractionation

4. Explain how a genetic approach can be used to understand cell division. Give an example.

ANS: First, genetic mutants are obtained that have various phenotypic variations in the cell division process, such as a loss of function. Then the defective protein can be determined. Once determined, further work can identify the exact mutation involved. For example, various mutations in ftsZ have been found that either fail to divide or form abnormal blebs. The exact amino acids changes are now known.

DIF: Difficult analysis

REF: 3.1

OBJ: 3.1e Compare cell fractionation to genetic

MSC: Applying 5. The periplasm in Gram-negative bacteria is filled with proteins. Describe the importance of these proteins.

ANS: The periplasm contains proteins involved in sugar transport into the cell. It also contains chaperones that may be involved in stress responses. In addition, the periplasm contains enzymes involved in making cell wall. Many of these are called penicillin-binding proteins (pbps) and are targets of antibiotics such as penicillin.

DIF: Difficult REF: 3.2 | 3.3 OBJ: 3.2b List the functions of membrane proteins | 3.3b Compare the cell envelopes of firmicutes, proteobacteria, and mycobacteria MSC: Understanding 6. Explain what happens when a cell comes into contact with water or ethanol. Why is 70% ethanol commonly used to treat wounds and surfaces?

ANS: Water can cross cell membranes by osmosis, but ethanol can dissolve both polar and nonpolar substances, thus harming the integrity of the membrane. In the presence of water, ethanol can denature proteins. The 70% ethanol disrupts the membrane sufficiently that the cells lyse.

DIF: Difficult REF: 3.2 OBJ: 3.2c Differentiate among passive diffusion, passive transport, and active transport MSC: Understanding 7. The permeability of weak acids and bases across a membrane has implications for pharmaceutical treatment of disease. Assuming equal effectiveness in the lab, what type of molecule would be best to treat a bacterium growing in stomach acid, and why?

ANS: An effective medicine that is a weak acid would be best because most of it would be uncharged in the stomach acid and thus more of it would be able to diffuse into the cell.

DIF: Medium REF: 3.2 OBJ: 3.2d Explain how membrane-permeant weak acids and bases cause pH stress MSC: Applying 8. Describe any two roles for membrane proteins.

ANS: Answers can include any of the following: membrane proteins are involved in transport of ions and nutrients across the membrane. They provide structural support for the cell by connecting different layers of the cell envelope or anchoring structures that extend from the cell, such as flagella. They also sense external signals such as presence of nutrients or toxins. They are involved in secretion of toxins, proteins, and molecules for communication.

DIF: Easy REF: 3.2 MSC: Understanding

OBJ: 3.2b List the functions of membrane proteins

9. Describe the types of molecules that can move through a membrane via passive diffusion.

ANS:

Small uncharged molecules such as water, oxygen, and carbon dioxide can move through a membrane via passive diffusion.

DIF: Easy REF: 3.2 OBJ: 3.2c Differentiate among passive diffusion, passive transport, and active transport MSC: Understanding 10. What unusual lipids are found in mycobacteria, and of what benefit are they to these bacteria?

ANS: Mycobacteria contain mycolic acids and phenolic glycolipids in their cell envelope. The mycolic acids are responsible for the acid-fastness of the bacteria, an important tool in identification. The bilayer formed by the mycolic acids, interleaved with the phenol derivatives, affords the organism a waxiness. This prevents phagocytosis by macrophages and also excludes many antibiotics.

DIF: Difficult REF: 3.3 OBJ: 3.3b Compare the cell envelopes of firmicutes, proteobacteria, and mycobacteria MSC: Understanding 11. Describe the Gram-negative cell envelope. Why are porins necessary in the outer membrane of Gram-negative cells?

ANS: Covering the cytoplasmic membrane is a thin layer of peptidoglycan. Over the peptidoglycan cell wall is an outer membrane that is a bilayer of phospholipids and lipopolysaccharide. There are proteins in the outer membrane called porins that are necessary for transporting substances such as nutrients across the membrane. Without the porins, very few substances could cross the outer membrane. The periplasm is between the outer and inner membranes and contains many enzymes.

DIF: Medium REF: 3.3 OBJ: 3.3b Compare the cell envelopes of firmicutes, proteobacteria, and mycobacteria MSC: Understanding 12. From your knowledge of Gram-positive and Gram-negative cell envelopes, why would penicillin be more effective in killing Gram-positive organisms than Gram-negative organisms?

ANS: Penicillin prevents cross-linking of peptidoglycan. Since Gram-positive organisms have many more layers of peptidoglycan than Gram-negative organisms, the penicillin can have a much larger effect. Also, Gram-negative organisms have an extra outer membrane that Gram-positive organisms do not have, and this membrane can prevent penicillin from entering the cell as easily.

DIF: Medium REF: 3.3 OBJ: 3.3b Compare the cell envelopes of firmicutes, proteobacteria, and mycobacteria MSC: Applying 13. Describe two mechanisms that archaea may use to enhance the heat stability of the membrane.

ANS: First of all, the archaea have ether linkages between the glycerol and fatty acids, rather than ester linkages. Secondly, terpenoid chains are found in many extreme thermophiles. These may cyclize and stiffen the membrane, making it more tolerant of heat.

DIF: Medium

REF: 3.2

OBJ: 3.2a Describe cell membrane structure

MSC: Applying 14. Describe how vancomycin affects the cell wall of Gram-positive bacteria. How have some cells developed resistance?

ANS: Gram-positive bacteria have a D-ala- D-ala dipeptide involved in cross-linking strands.

Vancomycin prevents the cross bridge from forming. Some cells have developed resistance by using lactic acid in the cross bridge, and thus, vancomycin no longer has an effect.

DIF: Medium REF: 3.3 OBJ: 3.3b Compare the cell envelopes of firmicutes, proteobacteria, and mycobacteria MSC: Understanding 15. Explain how bacteria can produce proteins more quickly than eukaryotes do.

ANS: Bacteria have no membrane around the nucleoid. This transcription and translation can be coupled with no need to transport the mRNA out of a nucleus.

DIF: Easy REF: 3.4 OBJ: 3.4b Compare and contrast prokaryotes and eukaryotes with respect to DNA replication, transcription, and translation MSC: Applying 16. Compare and contrast FtsZ and tubulin. Why do the similarities support evolution of prokaryotes and eukaryotes from a common ancestor?

ANS: FtsZ is a protein that forms a Z ring around the equator of a prokaryotic cell, where septation and division will take place. It is a homolog of tubulin, which is involved in mitosis in eukaryotes.

They are similar in that they are both involved in cell division. The major difference is that FtsZ is present in prokaryotes and tubulin is found in eukaryotes. Since they are homologs, they likely evolved from a common ancestral cell.

DIF: Difficult REF: 3.3 OBJ: 3.3c State the names and functions of the bacterial cytoskeleton proteins MSC: Understanding 17. Which age class of M. tuberculosis (age 1 or age 3) do you think would be more resistant to quinolones, which block gyrase that supercoils DNA? ANS: The polar-aging phenomenon of M. tuberculosis results in daughter cells that differ in growth rate.

Since gyrase plays an important role in DNA replication, the faster-growing accelerator cells (age 2 and age 3) will be more susceptible to quinolone-class antibiotics, which inhibit gyrase activity.

DIF: Medium REF: 3.5 OBJ: 3.5c Recall how some bacteria, such as actinomycetes, can reverse polar aging MSC: Evaluating 18. Explain how any two specialized structures are involved in bacterial photosynthesis.

ANS:

Thylakoids are structures of extensively folded membrane containing the photosynthetic pigments that maximize the collection of light energy. Carboxysomes contain enzyme Rubisco used in carbon fixation. Gas vesicles will aid aquatic bacteria, including a variety of phototrophs, to position themselves at the optimal point in the water column to collect light.

DIF: Medium REF: 3.6 OBJ: 3.6b Recall the structures and functions of thylakoids, carboxysomes, storage granules, pili, stalks, nanotubes, and flagella MSC: Understanding 19. Explain the movement of a bacterium possessing flagella away from a toxic chemical.

ANS: Counterclockwise spinning of the flagella causes the cell to swim a long distance in one direction.

Clockwise spinning causes the cell to tumble randomly. These motions are used together to result in a biased random walk that moves the cell in the overall direction away from the toxic chemical.

DIF: Medium REF: 3.6 OBJ: 3.6c Explain how chemoreceptors and magnetosomes direct flagellar motility MSC: Understanding 20. Penicillin-binding proteins (pbps) are proteins located in the periplasmic space in Gram-negative bacteria and are involved in synthesizing the cell wall. Thus, they are a target for antibiotics and are of interest to drug developers. Describe how one could obtain these pbps for further study.

ANS: After harvesting and washing cells, one would add sucrose to the cell suspension. This provides osmotic support. One would then add lysozyme to degrade the cell wall and obtain spheroplasts.

Once the spheroplasts are obtained, they are transferred to distilled water to osmotically shock the cells and thus release the contents, including pbps, into the extracellular medium. Other compartments such as the cytoplasm and membranes are removed by ultracentrifugation.

DIF: Difficult MSC: Applying

REF: 3.1

OBJ: 3.1d List some uses of cell fractionation

CHAPTER 4: Bacterial Culture, Growth, and Development MULTIPLE CHOICE 1. There is a constant struggle to survive in natural habitats because of a lack of a. food. d. oxygen. b. sunlight. e. minerals. c. water.

ANS: A DIF: Easy REF: 4.Intro OBJ: 4.1a Explain how limiting nutrient supplies limits bacterial growth MSC: Remembering 2. The most common form of chemical energy is contained in the high-energy phosphate bonds of a. water. d. CO2. b. glucose. e. NADH. c. ATP. ANS: C DIF: Easy REF: 4.1 OBJ: 4.1d Recall the forms in which cells store energy

MSC: Remembering

3. Which of the following can consume glucose and, in the absence of oxygen, break it down into ethanol and carbon dioxide gas? a. E. coli d. archaea b. phototrophs e. nitrogen fixers c. yeast ANS: C DIF: Medium REF: 4.Intro OBJ: 4.1a Explain how limiting nutrient supplies limits bacterial growth MSC: Remembering 4. The primary goal of biofilms is thought to be a. microbial communication. b. cell differentiation. c. to stay where food is abundant.

ANS: C DIF: Medium MSC: Understanding 5. Which of the following is a micronutrient? a. carbon b. nitrogen c. sulfur

d. to cause infection. e. environmental degradation.

REF: 4.5

OBJ: 4.5a Define biofilms

d. calcium e. zinc

ANS: E DIF: Medium REF: 4.1 OBJ: 4.1b Define essential nutrients, macronutrients, and micronutrients MSC: Remembering 6. Which of the following occurs when a sessile biofilm (or a part of it) begins to starve or experiences oxygen depletion? a. attachment d. dispersal b. quorum sensing e. biofilm maturation c. EPS production ANS: D DIF: Easy REF: 4.5 OBJ: 4.5c Describe the stages of biofilm development

MSC: Understanding

7. Which of the following are specific nutrients NOT required by other species? a. macronutrients d. trace elements b. micronutrients e. essential nutrients c. growth factors ANS: C DIF: Medium REF: 4.3 OBJ: 4.3c Explain why some microbes require growth factors for culture and why some cannot be grown in pure culture MSC: Understanding 8. All known microorganisms have a set of genes coding for ________, whose RNA sequences are highly conserved across the phylogenetic tree. a. ribosomes d. cell membranes b. chloroplasts e. cell walls c. enzymes ANS: A DIF: Medium REF: 4.3 OBJ: 4.3c Explain why some microbes require growth factors for culture and why some cannot be grown in pure culture MSC: Remembering

9. All of Earth’s life-forms are based on a. hydrogen. b. nitrogen. c. oxygen.

d. carbon. e. phosphorus.

ANS: D DIF: Easy REF: 4.1 OBJ: 4.1c Compare and contrast autotrophs, heterotrophs, chemotrophs, and phototrophs MSC: Remembering 10. Left on their own, heterotrophs would deplete the world of ________ sources and starve to death. a. usable nitrogen d. energy b. organic carbon e. oxygen c. water ANS: B DIF: Easy REF: 4.1 OBJ: 4.1c Compare and contrast autotrophs, heterotrophs, chemotrophs, and phototrophs MSC: Applying 11. Which of the following are responsible for the CO2-fixation component of the carbon cycle? a. heterotrophs d. chemotrophs b. symbionts e. organotrophs c. autotrophs ANS: C DIF: Easy REF: 4.1 OBJ: 4.1c Compare and contrast autotrophs, heterotrophs, chemotrophs, and phototrophs MSC: Understanding 12. Quorum sensing is triggered in biofilms when a. they form microcolonies. b. they are dispersing. c. antibiotics are applied to them. d. the population reaches a certain number. e. cells attach to a surface.

ANS: D DIF: Medium REF: 4.5 OBJ: 4.5d Recall the role of quorum sensing in biofilm development MSC: Understanding 13. A(n) ________ is an organism that lives in an intimate association with a second organism. a. commensal d. endospore b. parasite e. symbiont c. heterocyst ANS: E DIF: Easy REF: 4.1 OBJ: 4.1e Describe the nitrogen cycle including the roles of microbial nitrogen fixers, nitrifiers, and denitrifiers MSC: Remembering 14. The majority of nitrogen in soil and marine environments is fixed by a. free-living bacteria and archaea. d. biofilm organisms. b. symbionts. e. UV light. c. E. coli.

ANS: A DIF: Medium REF: 4.1 OBJ: 4.1e Describe the nitrogen cycle including the roles of microbial nitrogen fixers, nitrifiers, and denitrifiers MSC: Remembering

15. Why do some members of a biofilm community live deep within the biofilm? a. They are not flagellated. b. They produce fewer exopolysaccharides. c. They were the first organisms to initiate attachment. d. Antibiotics do not penetrate deep into biofilms. e. Oxygen does not penetrate deep into biofilms.

ANS: E DIF: Medium REF: 4.5 OBJ: 4.5c Describe the stages of biofilm development

MSC: Understanding

16. Which of the following prokaryotic transport systems does NOT require the use of cellular energy to bring compounds into the cells? a. facilitated diffusion d. group translocation b. ABC transport e. endocytosis c. siderophores ANS: A DIF: Medium REF: 4.2 OBJ: 4.2b Compare and contrast facilitated diffusion and active transport MSC: Understanding 17. A(n) ________ cell loses membrane integrity and cannot carry out the simple transport functions needed to sustain growth. a. depolarized d. heterocyst b. endospore e. dormant c. planktonic ANS: A DIF: Medium REF: 4.2 OBJ: 4.2b Compare and contrast facilitated diffusion and active transport MSC: Understanding 18. Which of the following proteins represents a coupled transport system where two molecules travel in the same direction? a. aquaporin d. porin b. symport e. diffusion transporters c. antiport ANS: B DIF: Medium REF: 4.2 OBJ: 4.2c Categorize different types of active transport

MSC: Remembering

19. Which of the following is NOT true about the substrate-binding protein (SBP) of the ABC transport system? a. It floats in the periplasm of Gram-negative cells. b. It is tethered to the cell surface in Gram-positive cells. c. It binds to the periplasmic face of the channel and releases the solute. d. It snags the appropriate solute. e. It is required for both the uptake and efflux systems.

ANS: E DIF: Difficult REF: 4.2 OBJ: 4.2c Categorize different types of active transport

MSC: Understanding

20. When the intracellular iron concentration is low, iron-scavenging molecules called ________ are produced. a. siderophores d. mycelia b. endospores e. quorum sensors c. heterocysts

ANS: A DIF: Easy REF: 4.2 OBJ: 4.2d Describe how microbes obtain iron

MSC: Understanding

21. Siderophore-iron complexes enter cells with the help of a. porins. d. ABC transporters. b. diffusion. e. efflux pumps. c. aquaporins.

ANS: D DIF: Medium REF: 4.2 OBJ: 4.2d Describe how microbes obtain iron

MSC: Remembering

22. Which of the following statements is FALSE about the E. coli phosphotransferase system (PTS)? a. Enzyme II components are specific to the substrates being transported. b. The substrate is phosphorylated during transport by PTS, making it different from the external substrate; thus, the substrate always travels down its concentration gradient. c. The phosphate group transferred to the sugar comes from phosphoenolpyruvate (PEP). d. The PTS transport requires energy in the form of ATP. e. The system has a modular design that accommodates different substrates.

ANS: D DIF: Difficult REF: 4.2 OBJ: 4.2c Categorize different types of active transport

MSC: Understanding

23. You have isolated a bacterium from the rumen of a cow and wish to know how it transports glucose into the cell. You perform an experiment that shows uptake of radioactively labeled glucose is equal when the organism is grown in media in the presence and absence of inhibitors of energy production. What is the mechanism of glucose transport in this cell? a. group translocation d. active transport b. diffusion e. endocytosis c. facilitated diffusion ANS: C DIF: Difficult REF: 4.2 OBJ: 4.2a Classify the ways that a cell achieves selective permeability across the cell membrane MSC: Applying 24. The most widely used solidifying agent is ________, which is derived from seaweed. a. agar d. cellulose b. gelatin e. glycogen c. starch ANS: A DIF: Easy REF: 4.3 OBJ: 4.3a Describe the different methods of obtaining single bacterial colonies MSC: Remembering 25. Which term refers to the condition in which a culture growth covers the entire agar surface? a. dilution streaking d. microcolony b. spread plate e. colony c. confluent ANS: C DIF: Easy REF: 4.3 OBJ: 4.3a Describe the different methods of obtaining single bacterial colonies MSC: Remembering 26. The best method to isolate single colonies is the ________ plate, and the best method to count colonies is the ________ plate. a. streak; pour d. complex; defined

b. pour; streak c. defined; complex

e. spread; streak

ANS: A DIF: Medium REF: 4.3 OBJ: 4.3a Describe the different methods of obtaining single bacterial colonies | 4.3d Compare and contrast different types of direct and indirect microbial counts MSC: Understanding 27. Metabolism of a microbe is best examined by growing the organism in a a. defined medium. d. pour plate. b. complex medium. e. cell culture. c. spread plate.

ANS: A DIF: Medium REF: 4.3 OBJ: 4.3b Differentiate among complex, synthetic, selective, and defined media MSC: Understanding 28. Cyanobacterial heterocysts function to fix atmospheric a. hydrogen sulfide. d. carbon dioxide. b. ammonia. e. nitrogen. c. oxygen.

ANS: E DIF: Easy REF: 4.6 OBJ: 4.6d State the structure and function of cyanobacterial heterocysts MSC: Remembering 29. Which of the following intercalates between DNA bases, causing dead cells to stain red under a fluorescence scope? a. propidium iodide d. crystal violet b. syto-9 e. safranin c. bile salt ANS: A DIF: Medium REF: 4.3 OBJ: 4.3d Compare and contrast different types of direct and indirect microbial counts MSC: Remembering 30. A problem with ________ of cell number is that dead cells also scatter light. a. direct microscopic counts d. pour plate counts b. viable counts e. optical density measurements c. spread plate counts ANS: E DIF: Medium REF: 4.3 OBJ: 4.3d Compare and contrast different types of direct and indirect microbial counts MSC: Understanding 31. Which of the following is the best technique for counting only viable cells? a. direct microscopic count d. chemostat b. spread plate e. dry weight measurements c. spectrophotometer ANS: B DIF: Medium REF: 4.3 OBJ: 4.3d Compare and contrast different types of direct and indirect microbial counts MSC: Understanding 32. Which forms are NOT made by Streptomyces? a. hyphae d. endospores b. germinating spores e. mycelia

c. filaments ANS: D DIF: Easy REF: 4.6 OBJ: 4.6a List the various kinds of differentiated cells that bacteria can produce MSC: Understanding 33. When the population doubles during each given unit of time, the growth is a. linear. d. geometric. b. semilogarithmic. e. arithmetic. c. exponential.

ANS: C DIF: Easy REF: 4.4 OBJ: 4.4a Compute the generation time, growth rate constant, or number of cells present given the appropriate starting information MSC: Understanding 34. Growth of most microorganisms occurs by a. budding. b. binary fission. c. replication.

d. conjugation. e. transformation.

ANS: B DIF: Easy REF: 4.4 OBJ: 4.4a Compute the generation time, growth rate constant, or number of cells present given the appropriate starting information MSC: Remembering 35. Bacteria divide at a constant time interval called the a. generation time. d. exponential rate. b. growth time. e. log phase. c. growth rate.

ANS: A DIF: Easy REF: 4.4 OBJ: 4.4a Compute the generation time, growth rate constant, or number of cells present given the appropriate starting information MSC: Understanding 36. The time between inoculation and the beginning of growth is usually called the ________ phase. a. lag d. stationary b. early log e. death c. late log ANS: A DIF: Easy REF: 4.4 OBJ: 4.4b List and describe the four stages of bacterial growth in batch culture MSC: Remembering 37. During which stage of bacterial growth is the culture growing exponentially?

a. lag phase b. log phase c. growth phase

d. stationary phase e. death phase

ANS: B DIF: Easy REF: 4.4 OBJ: 4.4b List and describe the four stages of bacterial growth in batch culture MSC: Remembering 38. Quorum sensing begins during which growth stage? a. lag d. stationary b. early log e. death c. late log ANS: C DIF: Medium REF: 4.4 OBJ: 4.4b List and describe the four stages of bacterial growth in batch culture MSC: Understanding 39. The figure below represents what type of differentiation?

a. heterocyst formation b. budding c. sporulation ANS: C DIF: Medium OBJ: 4.6c Describe spore formation

d. fruiting body formation e. filamentation REF: 4.6 MSC: Applying

40. What type of growth pattern is represented here: 5  103; 1  104; 2  104; 4  104; 8  104? a. linear d. generation b. exponential e. semilogarithmic c. lag ANS: B DIF: Easy REF: 4.4 OBJ: 4.4a Compute the generation time, growth rate constant, or number of cells present given the appropriate starting information MSC: Analyzing 41. The shortest lag period would most likely be observed in the transfer a. from complex medium to fresh complex medium. b. from complex medium to minimal medium. c. to a lower temperature. d. to a different pH. e. to a different salt concentration.

ANS: A DIF: Medium REF: 4.4 OBJ: 4.4b List and describe the four stages of bacterial growth in batch culture MSC: Understanding 42. In order to grow unculturable environmental microbes, Kim Lewis and colleagues derived the iChip. What is the purpose of this device?

a. b. c. d. e.

Antibiotics from the environment could pass into the chamber.

Gram-positive organisms could not pass the semipermeable membrane.

The semipermeable membranes let environmental organisms into the agar.

Organisms from the environment grew in the chamber.

Nutrients and growth factors made by organisms in the soil diffused into the chamber.

ANS: E DIF: Medium REF: Special Topic 4.1 OBJ: 4.2a Classify the ways that a cell achieves selective permeability across the cell membrane MSC: Understanding

43. You are measuring growth in a bacterial culture. The number of viable cells remains constant, and when you check the medium, you find that the carbon source has been used up. In which phase of growth is the culture? a. lag d. stationary b. early log e. death c. late log ANS: D DIF: Easy REF: 4.4 OBJ: 4.4b List and describe the four stages of bacterial growth in batch culture MSC: Understanding 44. A cafeteria worker who fails to wash his hands thoroughly and fails to wear gloves inoculates a quiche with 4 E. coli cells when he uses his finger to test whether it is done. By the time you purchase the quiche, there are 128 E. coli cells in it. How many generations did the cells go through? a. 4 d. 32 b. 5 e. 64 c. 8 ANS: B DIF: Medium REF: 4.4 OBJ: 4.4a Compute the generation time, growth rate constant, or number of cells present given the appropriate starting information MSC: Applying 45. What is the classic approach for finding new antibiotics? a. screening animals for secreted antimicrobial compounds b. harvesting them from individuals with immunity c. screening bacteria and fungi for secreted antimicrobial compounds d. harvesting them from sick individuals e. synthesizing them in the laboratory ANS: C DIF: Medium REF: Special Topic 4.1 OBJ: 4.3b Differentiate among complex, synthetic, selective, and defined media MSC: Understanding 46. Which of the following is true of all biofilms? a. They only contain a single species. b. The EPS are composed of proteins. c. Cells in the biofilm are dormant until the bacteria leave the biofilm. d. The EPS is secreted by the bacteria. e. It is a continuous monolayer surface deposit.

ANS: D DIF: Medium MSC: Understanding

REF: 4.5

OBJ: 4.5a Define biofilms

47. During biofilm formation, as more and more cells bind to the surface, they begin sending signals to each other in a process called a. quorum sensing. d. polysaccharides uptake. b. homoserine lactone sensing. e. density sensing. c. siderophore-iron acquisition.

ANS: A DIF: Easy REF: 4.5 OBJ: 4.5c Describe the stages of biofilm development 48. Which of the following genera does NOT undergo differentiation? a. Anabaena d. Escherichia

MSC: Understanding

b. Bacillus c. Clostridium

e. Streptomyces

ANS: D DIF: Easy REF: 4.6 OBJ: 4.6a List the various kinds of differentiated cells that bacteria can produce MSC: Understanding 49. Some bacteria form environmentally resistant dormant forms called a. endospores. d. hyphae. b. heterocysts. e. actinomycetes. c. colonies.

ANS: A DIF: Easy REF: 4.6 OBJ: 4.6b Recall the properties of spores

MSC: Remembering

50. How do some cyanobacteria fix nitrogen while growing aerobically? a. They do not, because nitrogenase is destroyed by oxygen. b. They use special cells called heterocysts that protect the enzyme. c. They use spores that protect the enzyme. d. They do it using no special structures or mechanisms. e. They live symbiotically with other organisms that protect the enzyme.

ANS: B DIF: Medium REF: 4.6 OBJ: 4.6d State the structure and function of cyanobacterial heterocysts MSC: Understanding SHORT ANSWER 1. How do scientists know of the existence of ―unculturable‖ organisms?

ANS: They know by using molecular biology tools such as PCR and gene sequencing. PCR is used to screen environmental samples for the presence of specific DNA sequences. Comparing DNA sequences of the PCR products with sequences of known organisms reveals insights into the physiology of undiscovered organisms and relationships with known organisms.

DIF: Medium REF: 4.3 OBJ: 4.3c Explain why some microbes require growth factors for culture and why some cannot be grown in pure culture MSC: Understanding 2. Why can’t most organisms use the nitrogen gas that is so prevalent in the atmosphere? How do these organisms acquire a usable form of nitrogen?

ANS: Nitrogen gas has triple bonds holding the two atoms together. These triple bonds are very stable and require a large amount of energy to break, and most organisms are unable to break the bonds.

Organisms that cannot use atmospheric nitrogen as a nitrogen source must rely on other organisms to fix the nitrogen into a usable form. Fixing nitrogen means converting it into ammonium ions that can be used by many types of organisms.

DIF: Medium REF: 4.1 OBJ: 4.1e Describe the nitrogen cycle including the roles of microbial nitrogen fixers, nitrifiers, and denitrifiers MSC: Understanding

3. What type of medium and conditions would you need to have in order to select for photoautotrophs?

ANS: Phototrophs can generate energy from absorption of light and autotrophs can use CO2 as their sole carbon source, so the medium would not need to contain an energy source or an organic carbon source. The lack of these substances would inhibit the growth of other types of organisms, resulting in a selection for photoautotrophs. The sample would need to be incubated near a light source.

DIF: Difficult REF: 4.1 OBJ: 4.1c Compare and contrast autotrophs, heterotrophs, chemotrophs, and phototrophs MSC: Evaluating 4. Compare and contrast the difference between electrogenic and electroneutral coupled transport and give an example of each.

ANS: Electrogenic coupled transport results in an unequal distribution of charge across the cell membrane. A good example is the lactose symporter, which brings the neutral lactose molecule in along with a proton.

Electroneutral coupled transport results in no net charge. An example of this is the sodium ion/proton antiporter.

DIF: Difficult transport MSC: Analyzing

REF: 4.2

OBJ: 4.2c Categorize different types of active

5. Compare and contrast the ABC transporters and group translocation in terms of energy requirements and concentration gradients.

ANS: Both forms of transport require energy. The ABC transporters utilize ATP, and group translocation actually begins the process with the expenditure of phosphoenolpyruvate (PEP).

ABC transporters bring a solute against the concentration gradient. The same cannot be said about the phosphotransferase system (PTS) because the solute is phosphorylated during the transfer.

DIF: Difficult transport MSC: Analyzing

REF: 4.2

OBJ: 4.2c Categorize different types of active

6. Why is iron so often a limiting nutrient, when it seems to be so abundant in the environment, and how can organisms overcome this problem?

ANS: Iron is usually not free in nature but locked up as Fe(OH)3, which is insoluble and unavailable to cells. Siderophores are molecules produced by some cells that have a very high affinity for soluble ferric iron. These molecules scavenge any small amount of soluble iron and transport it into the cell.

DIF: Medium REF: 4.2 MSC: Understanding

OBJ: 4.2d Describe how microbes obtain iron

7. Compare and contrast complex media, synthetic media, and enriched media.

ANS: Complex media contain things such as yeast extract or beef extract, making the exact composition of each chemical unknown. Their composition is thought to mimic the rich environments that some organisms may encounter in their natural environment.

Synthetic media are fully defined. They contain precise amounts of various salts, carbon, nitrogen, and energy sources. Some organisms need special additives to survive in these media.

Enriched media contain additional components such as blood that are required for the growth of fastidious organisms.

DIF: Difficult REF: 4.3 OBJ: 4.3b Differentiate among complex, synthetic, selective, and defined media MSC: Analyzing 8. When studying the metabolism of an organism, why is it better to grow organisms in a defined synthetic medium instead of a complex medium?

ANS: It is difficult to characterize an organism’s metabolism when it is growing in a complex medium because the organism is supplied with all of its needs, so it is impossible to determine which metabolic pathways the organism possesses. In a synthetic medium, various substances can be added to determine which ones the organism needs and which ones it can make.

DIF: Medium REF: 4.3 OBJ: 4.3b Differentiate among complex, synthetic, selective, and defined media MSC: Applying 9. MacConkey medium contains bile salts, crystal violet, lactose, and the pH indicator neutral red.

Some organisms can ferment lactose, producing acids as a by-product. Is this medium likely to be selective and/or differential? Explain.

ANS: Since MacConkey contains bile salts and crystal violet, it is selective for Gram-negative bacteria.

MacConkey is also differential for lactose fermentation. Some organisms ferment lactose to produce acids, which causes lactose-fermenting colonies to be red and nonfermenting colonies to be white.

DIF: Difficult REF: 4.3 OBJ: 4.3b Differentiate among complex, synthetic, selective, and defined media MSC: Applying 10. Define the terms ―viable‖ and ―viable but unculturable.‖ Why are so many environmental organisms believed to be viable but unculturable?

ANS: Viable means that the organism can replicate and form colonies on a plate, making it possible to grow the organism in a laboratory setting.

Viable but unculturable means that the cells appear to metabolize, but we cannot get them to replicate. It is possible that we just have not figured out how to culture them yet.

DIF: Difficult REF: 4.3 | Special Topic 4.1 OBJ: 4.3c Explain why some microbes require growth factors for culture and why some cannot be grown in pure culture MSC: Understanding

11. Using the figure below, explain the function of stages 2 and 3 in biofilm development and how they affect biofilm growth, function, and treatment.

ANS: The establishment of microcolonies triggers quorum sensing, which triggers the increased resistance of biofilms to antibiotics and to phagocytosis by white blood cells. The cells in a microcolony form a thick extracellular matrix of polysaccharide polymers and entrapped organic (DNA and proteins) and inorganic materials that tether cells and strengthen the biofilm, making them more resistant to antibiotics and physical removal.

DIF: Medium REF: 4.5 OBJ: 4.5b List some function of biofilms | 4.5c Describe the stages of biofilm development MSC: Understanding 12. If you determined the number of cells in a sample using viable plate counts and optical density measurements, why would the results from the two methods be so different?

ANS: Cell numbers from optical density measurements will be much higher than those from viable plate counts. Viable plate counts only count cells that are able to replicate to form colonies on the plates.

Some cells will not form colonies due to cell damage or inability to grow on the artificial culture media. Also, organisms that grow in chains or clusters will form a colony from several cells instead of just one. Finally, optical density measurements count both living and dead cells.

DIF: Difficult REF: 4.3 OBJ: 4.3d Compare and contrast different types of direct and indirect microbial counts MSC: Analyzing 13. Discuss some disadvantages of viable counts of microorganisms.

ANS: Colony counting will not reflect the size or growth stage of the cells. The results might also underestimate the number of living cells because some may be damaged and unable to divide, but are still alive. Also, some organisms grow in chains and clusters. If these are not dissociated prior to plating, you will get a false low count.

DIF: Medium REF: 4.3 OBJ: 4.3d Compare and contrast different types of direct and indirect microbial counts

MSC: Evaluating 14. Why does binary fission result in an exponential and not a linear growth rate?

ANS: Bacteria replicate by binary fission. In this process, one cell grows and divides, producing two daughter cells. Those two will each do the same, and so forth. That means that 1 becomes 2, 2 become 4, and 4 become 8. The relationship then becomes 2n, where n corresponds to the number of generations. It is 2n, since two daughters are formed from each cell. (A linear relationship would be 1 to 2, 2 to 3, 3 to 4, and so forth.)

DIF: Medium REF: 4.4 OBJ: 4.4a Compute the generation time, growth rate constant, or number of cells present given the appropriate starting information MSC: Understanding 15. Why does a microbe’s growth rate in its natural environment vary greatly from that in the laboratory? Give at least two reasons for this.

ANS: Answers will vary. A laboratory setting usually affords a very rich medium, and the organism is usually in pure culture and is not competing for nutrients.

In the natural environment, nutrient levels are most likely less. Other organisms may be competing more effectively for the nutrients. Also, some organisms may form waste products that are toxic to other organisms.

DIF: Difficult REF: 4.3 | 4.4 OBJ: 4.3c Explain why some microbes require growth factors for culture and why some cannot be grown in pure culture | 4.4b List and describe the four stages of bacterial growth in batch culture MSC: Analyzing 16. Describe the differences between batch culture and growth in a chemostat. What are the advantages of a chemostat?

ANS: Batch culture represents growth in a closed system. At some point, one or more essential nutrients will be depleted, or waste products will become insurmountable, both of which, of course, would lead to cessation of growth of the organism and eventually to cell death.

Chemostat growth regulates the flow of nutrients in and the collection of wastes out, so that growth may be maintained at the exponential stage. For industrial purposes, a chemostat is a plus when one is collecting a cellular product that is produced during exponential growth. It would be desirable to maintain the organism in conditions where it would produce the most product.

DIF: Difficult REF: 4.4 OBJ: 4.4c Compare and contrast batch culture and continuous culture MSC: Applying 17. During the stationary phase, E. coli reprograms itself. What does it do to protect itself?

ANS: It decreases its size so that less nutrient is required for maintenance. When it is under stress, it synthesizes various enzymes to protect itself. Some of these handle oxygen radicals, protect DNA and proteins, and increase the amount of cross-linking in peptidoglycan. All of these adaptations result in a stronger, more resistant cell.

DIF: Difficult REF: 4.4 OBJ: 4.4b List and describe the four stages of bacterial growth in batch culture MSC: Understanding 18. What are some specific problems that biofilms can cause in the medical field, and why are they so difficult to prevent and destroy?

ANS: Biofilms can grow in medical devices such as catheters and cause infections in patients. They cause damage to equipment such as ventilators. They can grow in lungs of cystic fibrosis patients or on medical transplants. As they grow, they form a thick polysaccharide matrix that increases antibiotic resistance within the biofilms and is difficult to remove with cleaning agents.

DIF: Medium MSC: Analyzing

REF: 4.5

OBJ: 4.5a Define biofilms

19. Why would an organism go through the process of sporulation? How might endospores cause problems in the food industry?

ANS: When nutrients are not as readily available, the starvation response of some organisms results in the formation of a dormant endospore. Because endospores are resistant to heat and desiccation, if foods are not properly sterilized, endospores could survive in the food, then germinate and cause food spoilage or food-borne illness.

DIF: Difficult REF: 4.6 OBJ: 4.6b Recall the properties of spores | 4.6c Describe spore formation MSC: Evaluating 20. How does Anabaena overcome the challenge of performing both photosynthesis and nitrogen fixation?

ANS: The autotrophic cyanobacteria Anabaena can generate oxygen by photosynthesis and fix nitrogen to make ammonia. This seems as if it would prevent nitrogen fixation since the nitrogenase required for nitrogen fixation is extremely sensitive to oxygen. The organism overcomes this by having every tenth cell differentiate from a photosynthetic cell to a heterocyst, which no longer fixes carbon dioxide or produces oxygen but rather develops a specialized envelope that limits oxygen access, allowing nitrogen fixation.

DIF: Medium REF: 4.6 OBJ: 4.6d State the structure and function of cyanobacterial heterocysts MSC: Understanding

CHAPTER 5: Environmental Influences and Control of Microbial Growth MULTIPLE CHOICE 1. Which of the following have evolved to grow in conditions extremely different from those optimal for humans? a. psychrophiles d. thermophiles b. extremophiles e. acidophiles

c. halophiles ANS: B DIF: Easy extremophile MSC: Remembering

REF: 5.1

OBJ: 5.1a Define

2. The membrane needs to remain ________ so that it can expand as cells grow larger and so that proteins needed for solute transport can be inserted into the membrane. a. rigid d. hypertonic b. warm e. polarized c. fluid ANS: C DIF: Easy REF: 5.2 OBJ: 5.2a Explain how temperature affects microbial physiology MSC: Understanding 3. The general result of the Arrhenius equation is that growth rate roughly doubles for every ________°C rise in temperature. a. 5 d. 20 b. 10 e. 25 c. 15 ANS: B DIF: Medium REF: 5.2 OBJ: 5.2a Explain how temperature affects microbial physiology | 5.2c Describe the relationship between growth rate and temperature MSC: Remembering 4. The fastest growth rate for a species occurs at temperatures where a cell’s ________ work most efficiently. a. lipids d. proteins b. membranes e. polysaccharides c. nucleic acids ANS: D DIF: Easy REF: 5.2 OBJ: 5.2a Explain how temperature affects microbial physiology MSC: Understanding 5. Human pathogens are a. halophilic. b. psychrophilic. c. mesophilic.

d. thermophilic. e. extreme thermophilic.

ANS: C DIF: Easy REF: 5.2 OBJ: 5.2b Define mesophiles, psychrophiles, thermophiles, and barophiles MSC: Remembering 6. Which of the following are prominent members of microbial communities beneath icebergs in the Arctic and Antarctic? a. barophiles d. thermophiles b. psychrophiles e. acidophiles c. mesophiles ANS: B DIF: Easy REF: 5.2 OBJ: 5.2b Define mesophiles, psychrophiles, thermophiles, and barophiles MSC: Understanding

7. Which of the following enzymes are stable in part because they contain relatively low amounts of the small amino acid glycine? a. psychrophilic d. halophilic b. acidophilic e. barophilic c. thermophilic ANS: C DIF: Medium REF: 5.2 OBJ: 5.2d Compare and contrast strategies used by mesophiles, psychrophiles, thermophiles, and barophiles to allow growth in their respective environments MSC: Understanding 8. Organisms that grow at temperatures as high as 121°C as well as high pressure are known as a. thermophiles. d. hyperpsychrophiles. b. extreme halophiles. e. hyperthermophiles. c. psychrophiles.

ANS: E DIF: Easy REF: 5.2 OBJ: 5.2b Define mesophiles, psychrophiles, thermophiles, and barophiles MSC: Remembering 9. All of the following are true about microbes and temperature EXCEPT a. microbes have mechanisms to control their temperature. b. temperature affects the average rate of molecular motion. c. changes in temperature affect membrane fluidity. d. changes in temperature affect transport. e. every organism has an optimum temperature for growth.

ANS: A DIF: Medium REF: 5.2 OBJ: 5.2d Compare and contrast strategies used by mesophiles, psychrophiles, thermophiles, and barophiles to allow growth in their respective environments MSC: Understanding 10. Psychrophiles favor the cold, since their membranes are more fluid at low temperature as a result of the high proportion of ________ present. a. saturated fatty acids d. transport proteins b. unsaturated fatty acids e. water c. lipopolysaccharides ANS: B DIF: Difficult REF: 5.2 OBJ: 5.2d Compare and contrast strategies used by mesophiles, psychrophiles, thermophiles, and barophiles to allow growth in their respective environments MSC: Understanding 11. Which of the following is NOT true about thermophiles? a. Their proteins contain less glycine. b. They have more unsaturated linear lipids in their membranes. c. They have chaperone proteins. d. Their genomes are packed with numerous DNA-binding proteins that stabilize DNA. e. They have special enzymes that function to tightly coil DNA. ANS: B DIF: Difficult REF: 5.2 OBJ: 5.2d Compare and contrast strategies used by mesophiles, psychrophiles, thermophiles, and barophiles to allow growth in their respective environments MSC: Understanding 12. Which of the conditions can be labeled as ―extreme‖? a. near-neutral pH d. a salt concentration of 0.9% b. 25°C e. pressure of 14 psi c. pressure of 400 atm

ANS: C DIF: Medium REF: 5.1 OBJ: 5.1b Explain what determines a microbe’s survival and growth in a particular environment MSC: Understanding 13. Which temperature is lethal to any mesophile? a. its optimum growth temperature b. its minimum growth temperature c. its maximum growth temperature d. refrigeration temperature e. autoclave temperature ANS: E DIF: Easy REF: 5.7 OBJ: 5.7c Recall some physical agents that kill microbes and explain how they work MSC: Remembering 14. Organisms adapted to grow at overwhelmingly high pressures are called a. psychrophiles. d. acidophiles. b. thermophiles. e. mesophiles. c. barophiles.

ANS: C DIF: Easy REF: 5.2 OBJ: 5.2b Define mesophiles, psychrophiles, thermophiles, and barophiles MSC: Remembering 15. Which of the following grows in the indicated pH range shown in the figure below?

a. psychrophiles b. mesophiles c. piezophiles

d. alkaliphiles e. acidophiles

ANS: D DIF: Easy REF: 5.4 OBJ: 5.4b Define neutralophile, acidophile, and alkaliphile

MSC: Understanding

16. Cyanobacterial blooms such as those shown in the figure below are typically due to human-caused

a. antibiotic resistance. b. warming. c. oxygenation.

d. salinity increase. e. eutrophication.

ANS: E DIF: Easy REF: 5.6 OBJ: 5.6b List examples of human influences on microbial ecosystems MSC: Remembering 17. One function of programmed cell death is to a. increase the pH of the local environment. b. release antibiotic resistance compounds. c. increase the solute concentration of a hypotonic solution. d. decrease the pH of the local environment. e. release nutrients that neighboring cells use to survive.

ANS: E DIF: Medium REF: 5.6 OBJ: 5.6a Describe microbial responses to starvation

MSC: Understanding

18. At the bottom of the ocean, hydrostatic pressure averages a crushing 400 atm (atmospheres) and can go as high as ________ atm. a. 700 d. 3,000 b. 1,000 e. 3,500 c. 1,500 ANS: B DIF: Medium REF: 5.2 OBJ: 5.2b Define mesophiles, psychrophiles, thermophiles, and barophiles MSC: Understanding 19. Most bacteria require water activity to be greater than a. 0.10. d. 0.91. b. 0.25. e. 1.0. c. 0.74.

ANS: D DIF: Medium REF: 5.3 OBJ: 5.3a Analyze the relationship between solutes and water activity MSC: Remembering 20. A measure of the number of solute molecules in solution and is inversely related to water activity is known as a. osmolarity. d. isotonic. b. hypertonic. e. d-value. c. hypotonic.

ANS: A DIF: Easy REF: 5.3 OBJ: 5.3b Define osmolarity and osmotic stress

MSC: Understanding

21. A ________ medium is one of higher osmolarity than the cell. a. hypertonic d. defined b. hypotonic e. complex c. isotonic ANS: A DIF: Medium REF: 5.3 OBJ: 5.3b Define osmolarity and osmotic stress

MSC: Remembering

22. Special channels for helping water move across the membrane quickly are called a. compatible solutes. d. mechanosensitive channels. b. osmolarity. e. chaperones. c. aquaporins.

ANS: C DIF: Easy REF: 5.3 OBJ: 5.3c Describe the mechanisms employed by microbes to protect against osmotic stress MSC: Remembering 23. Microbes accumulate ________ in the cell to prevent cell water loss in a hypertonic environment. a. water d. protons b. proteins e. compatible solutes c. sugars ANS: E DIF: Medium REF: 5.3 OBJ: 5.3c Describe the mechanisms employed by microbes to protect against osmotic stress MSC: Understanding 24. The proteins and cell components of halophiles have remarkably high intracellular levels of ________, which helps to maintain their cell structure. a. oxygen d. sodium b. potassium e. hydrogen c. calcium ANS: B DIF: Medium REF: 5.3 OBJ: 5.3d Identify the conditions required by halophiles for growth MSC: Remembering 25. What piece of equipment is represented by the following schematic diagram?

a. a membrane filtration device b. a pressure cooker c. an autoclave

d. a biological safety cabinet e. a food irradiation device

ANS: C DIF: Easy REF: 5.7 OBJ: 5.7c Recall some physical agents that kill microbes and explain how they work MSC: Understanding 26. Which of the following is true of microbes and their membranes? a. They are relatively permeable to protons. b. Protons can leak through directly when the difference in intracellular and extracellular pH is very high. c. Membrane-permeant organic acids can prevent the leakage of protons. d. They are able to change the pH optima of their enzymes. e. Acidophiles use Na+/H+ antiporters to remove internal protons.

ANS: B DIF: Difficult REF: 5.4 OBJ: 5.4a Explain how pH affects protein structure and microbial growth MSC: Understanding 27. Which of the following are commonly used to control microbial growth in foods? a. weak acids d. strong bases b. strong acids e. enzymes c. weak bases ANS: A DIF: Medium REF: 5.4 OBJ: 5.4a Explain how pH affects protein structure and microbial growth MSC: Understanding 28. Which of the following are often chemolithotrophs that oxidize reduced metals and generate strong acids, such as sulfuric acid? a. acidophiles d. mesophiles b. psychrophiles e. barophiles c. halophiles

ANS: A DIF: Easy REF: 5.4 OBJ: 5.4b Define neutralophile, acidophile, and alkaliphile

MSC: Remembering

29. Alkaliphiles use ________ force in addition to proton motive force to maintain pH. a. potassium motive d. magnesium motive b. sodium motive e. sulfur motive c. calcium motive ANS: B DIF: Medium REF: 5.4 OBJ: 5.4c Describe the mechanisms used by microbes to maintain pH homeostasis MSC: Understanding 30. E. coli tolerates a pH range from 2 to 9, which is a ________-fold difference in hydrogen ion concentration. a. 7 d. 10,000 b. 100 e. 10,000,000 c. 1,000 ANS: E DIF: Medium REF: 5.4 OBJ: 5.4a Explain how pH affects protein structure and microbial growth MSC: Understanding 31. A bacterium that thrives in your stomach is probably a(n) a. thermophile. d. acidophile. b. neutrophile. e. psychrophile. c. alkaliphile.

ANS: D DIF: Easy REF: 5.4 OBJ: 5.4b Define neutralophile, acidophile, and alkaliphile

MSC: Understanding

32. The use of oxygen as the terminal electron acceptor is called a. aerobic respiration. d. oxygenic photosynthesis. b. anaerobic respiration. e. carbon dioxide fixation. c. fermentation.

ANS: A DIF: Easy REF: 5.5 OBJ: 5.5b Define strict aerobe, aerotolerant anaerobe, facultative anaerobe, strict anaerobe, and microaerophile and identify the metabolic strategies available to each MSC: Understanding 33. Many ________ bacteria cause horrific human diseases, such as tetanus, botulism, and gangrene. a. aerobic d. halophilic b. anaerobic e. fermentative c. psychrophilic ANS: B DIF: Medium REF: 5.5 OBJ: 5.5b Define strict aerobe, aerotolerant anaerobe, facultative anaerobe, strict anaerobe, and microaerophile and identify the metabolic strategies available to each MSC: Remembering 34. Which category best describes E. coli? a. strict aerobe b. aerotolerant anaerobe c. facultative anaerobe ANS: C

DIF: Medium

d. microaerophile e. strict anaerobe REF: 5.5

OBJ: 5.5b Define strict aerobe, aerotolerant anaerobe, facultative anaerobe, strict anaerobe, and microaerophile and identify the metabolic strategies available to each MSC: Remembering 35. What is depicted in the following figure?

a. b. c. d. e.

Antibiotic production has inhibited bacterial growth.

A bacteriophage has preyed on the bacterial colonies.

Weak acid production has inhibited bacterial growth.

A biofilm has become resistant to disinfectants.

Starving cells have undergone programmed cell death.

ANS: A DIF: Medium REF: 5.7 OBJ: 5.7e Describe examples of biological control of microbes MSC: Analyzing 36. An organism that requires atmospheric oxygen levels for growth is a. aerobic. d. anaerobic. b. microaerophilic. e. facultative. c. aerotolerant.

ANS: A DIF: Easy REF: 5.5 OBJ: 5.5b Define strict aerobe, aerotolerant anaerobe, facultative anaerobe, strict anaerobe, and microaerophile and identify the metabolic strategies available to each MSC: Understanding 37. Which best describes microaerophiles? a. They require atmospheric oxygen levels to grow. b. They cannot grow in the presence of oxygen. c. They will use oxygen if it is present, but can grow even if oxygen is not present. d. They require a small oxygen concentration to grow. e. They can't use oxygen to grow, but oxygen won't kill them.

ANS: D DIF: Easy REF: 5.5 OBJ: 5.5b Define strict aerobe, aerotolerant anaerobe, facultative anaerobe, strict anaerobe, and microaerophile and identify the metabolic strategies available to each MSC: Understanding 38. An organism that grows in the circled region of the tube of medium containing thioglycolate shown below is probably a(n)

a. strict aerobe. b. facultative anaerobe. c. aerotolerant anaerobe.

d. microaerophile. e. strict anaerobe.

ANS: E DIF: Easy REF: 5.5 OBJ: 5.5b Define strict aerobe, aerotolerant anaerobe, facultative anaerobe, strict anaerobe, and microaerophile and identify the metabolic strategies available to each MSC: Understanding 39. An organism that grows at the top of a tube of medium containing thioglycolate is probably a(n) a. strict aerobe. d. microaerophile. b. facultative anaerobe. e. strict anaerobe. c. aerotolerant anaerobe.

ANS: A DIF: Easy REF: 5.5 OBJ: 5.5b Define strict aerobe, aerotolerant anaerobe, facultative anaerobe, strict anaerobe, and microaerophile and identify the metabolic strategies available to each MSC: Understanding 40. Which of the following is an important signaling molecule that controls global gene expression during starvation? a. cyclic AMP d. glucose b. ADP e. water c. ATP ANS: A DIF: Medium REF: 5.6 OBJ: 5.6a Describe microbial responses to starvation

MSC: Remembering

41. During the starvation response, only a limited number of organisms can a. retool transport systems for the uptake of different nutrients. b. form metabolically inactive endospores. c. protect against reactive oxygen species. d. protect against temperature extremes. e. protect against pH extremes.

ANS: B DIF: Medium REF: 5.6 OBJ: 5.6a Describe microbial responses to starvation

MSC: Understanding

42. Runoff from agricultural fields, lawns, and golf courses can cause an overgrowth of microbes due to a. eutrophication. d. antisepsis. b. starvation response. e. pasteurization. c. oligotrophy.

ANS: A DIF: Easy REF: 5.6 OBJ: 5.6b List examples of human influences on microbial ecosystems MSC: Understanding 43. The D-value of a bacterial culture heated to 100°C is the time it takes to kill ________% of the population. a. 99 d. 10 b. 90 e. 1 c. 50 ANS: B DIF: Medium REF: 5.7 OBJ: 5.7a Define sterilization, disinfection, antisepsis, and sanitation MSC: Remembering 44. Filtration of samples to remove microbial cells typically use micropore filters with pore sizes of a. 1.5 m. d. 150 m. b. 0.2 mm. e. 0.2 m. c. 0.1 nm.

ANS: E DIF: Medium REF: 5.7 OBJ: 5.7c Recall some physical agents that kill microbes and explain how they work MSC: Remembering 45. The conditions used in an autoclave may be reproduced at home in a. a rice cooker. d. a pressure cooker. b. a double-boiler. e. boiling water. c. a microwave.

ANS: D DIF: Easy REF: 5.7 OBJ: 5.7c Recall some physical agents that kill microbes and explain how they work MSC: Understanding 46. Deinococcus radiodurans resists extreme drought and radiation by what mechanism? a. biofilm formation d. endospore formation b. producing aquaporins e. repairing DNA damage c. producing multidrug efflux pumps ANS: E DIF: Medium REF: 5.7 OBJ: 5.7f Explain how some microbes resist germicidal agents MSC: Understanding 47. Disposable plasticware such as petri dishes can be sterilized using which of the following? a. ethylene oxide gas b. steam autoclave c. low-temperature, long-time pasteurization d. phenol e. 70% ethanol ANS: A DIF: Medium REF: 5.7 OBJ: 5.7d List some chemical agents that kill microbes and state factors that influence their

efficacy MSC: Understanding 48. A virus that infects bacteria is called a a. bacteriophage. b. viroid. c. spore.

d. probiotic. e. porin.

ANS: A DIF: Easy REF: 5.7 | Special Topic 5.1 OBJ: 5.7e Describe examples of biological control of microbes MSC: Remembering 49. Which of the following is NOT true concerning irradiation of foods? a. Food consumed by NASA astronauts is sterilized by irradiation. b. Foods become radioactive when irradiated. c. Viruses are resistant to doses approved for foods. d. A higher dose of radiation is necessary to kill microbes in frozen foods. e. It is effective in eliminating parasites and bacteria.

ANS: B DIF: Easy REF: 5.7 OBJ: 5.7c Recall some physical agents that kill microbes and explain how they work MSC: Understanding 50. A useful biocontrol alternative to antibiotics for treatment of biofilms that can potentially lead to chronic infections is a. phenolics. d. x-rays. b. high temperatures and pressures. e. bacteriophages. c. commercial disinfectants.

ANS: E DIF: Medium REF: 5.7 | Special Topic 5.1 OBJ: 5.7e Describe examples of biological control of microbes | 5.7f Explain how some microbes resist germicidal agents MSC: Understanding SHORT ANSWER 1. Why are thermophiles able to survive at temperatures that would quickly kill most mesophiles?

Describe at least three adaptations.

ANS: Thermophilic proteins are more stable due to low content of glycine residues, high number of hydrogen bonds within the protein, and large number of DNA-binding proteins compared to mesophiles. Thermophilic membranes contain more saturated fatty acids for stability.

Thermophilic DNA is tightly coiled by enzymes to make it more stable and less likely to denature.

DIF: Difficult REF: 5.2 OBJ: 5.2d Compare and contrast strategies used by mesophiles, psychrophiles, thermophiles, and barophiles to allow growth in their respective environments MSC: Understanding 2. How are some organisms able to survive temporary exposures to elevated temperatures?

ANS: Some organisms exhibit heat-shock response, which includes expression of genes for proteins that act as chaperones to stabilize proteins and enzymes that change membrane lipids to a more stable type.

DIF: Medium REF: 5.2 OBJ: 5.2a Explain how temperature affects microbial physiology MSC: Understanding 3. Why are many barophiles also psychrophiles, and how are the adaptations for barophiles and psychrophiles similar?

ANS: Barophiles are typically found on the ocean floor, where high pressures exist. The average temperature of the ocean floor is 2°C; as a result, organisms found here are also psychrophiles.

Both increased pressure and cold temperatures reduce membrane fluidity, so both types of organisms must have similar adaptations to keep their membranes fluid. The phospholipids have high levels of polyunsaturated fatty acids to keep membranes fluid.

DIF: Medium REF: 5.2 OBJ: 5.2b Define mesophiles, psychrophiles, thermophiles, and barophiles MSC: Analyzing 4. Describe three mechanisms organisms use to reduce osmotic stress.

ANS: Compatible solutes can be made or imported to increase intracellular osmolarity when cells are in hypertonic environments. Pressure-sensitive channels can allow solutes to escape when cells are in hypotonic environments. Water can cross the cell membrane either by diffusion or more quickly using aquaporins.

DIF: Medium REF: 5.3 OBJ: 5.3c Describe the mechanisms employed by microbes to protect against osmotic stress MSC: Understanding 5. Halophiles require high salt concentrations to survive. Describe a mechanism involving compatible solutes that has evolved to achieve low internal sodium ion concentrations.

ANS: Cells have symporter systems that will import sodium ions with other solutes. Halophiles have evolved to require high intracellular levels of potassium ions. In fact, ribosomes actually require high levels of potassium to maintain structural integrity and function. To achieve this, halophiles have a sodium/potassium antiport system. Sodium ions are pumped out of the cell so that the compatible solute, potassium ions, may be brought into the cell.

DIF: Medium REF: 5.3 OBJ: 5.3c Describe the mechanisms employed by microbes to protect against osmotic stress MSC: Understanding 6. What alkaliphile do pink flamingos eat, and how is it involved in making the flamingo pink?

ANS: The cyanobacterium Spirulina imparts a pinkish color to the soda lakes in Africa due to a high concentration of carotene in the organism. Spirulina is the major food source of the pink flamingo.

Digestive enzymes release the carotenes into the circulation, and they ultimately end up being deposited in the birds’ feathers. Flamingos would not be pink if their diet did not contain these high levels of carotene.

DIF: Medium REF: 5.4 OBJ: 5.4b Define neutralophile, acidophile, and alkaliphile

MSC: Remembering

7. How does pH affect proteins? Why do proteins have an optimum, minimum, and maximum pH at which they will function?

ANS: The charges on amino or carboxyl groups within a protein help form the intramolecular bonds that determine protein shape and protein activity. Because H+ concentration affects the protonation of these ionizable groups, altering pH can alter the charges on these groups, which changes protein structure and activity.

DIF: Medium REF: 5.4 OBJ: 5.4a Explain how pH affects protein structure and microbial growth MSC: Understanding 8. Describe one method that enables researchers to study extremophilic organisms that we cannot culture in the laboratory.

ANS: Answers may vary. Genome sequences present new opportunities for investigating these questions.

Bioinformatic analysis, which uses the DNA sequence of a gene to predict the function of its protein product, allows us to study the biology of organisms that we cannot culture.

Transcriptomic and proteomic techniques can examine all the gene and protein expression, respectively, that take place in bacteria as they adjust to changing environments such as temperature or pH. DIF: Medium REF: 5.1 OBJ: 5.1c Describe what approaches are used to study extremophiles MSC: Understanding 9. No one ever expected to find microbes thriving in our stomachs. What organism was found there, what problem does it cause, and how does it survive there?

ANS: The bacterium Helicobacter pylori thrives in this acidic environment. H. pylori is the causative agent of gastric ulcers. It tolerates this acidic environment by neutralizing its microenvironment. It has very potent ureases, which generate massive amounts of ammonia. This in turn neutralizes the acidic microenvironment, allowing it to survive and thrive.

DIF: Medium REF: 5.4 OBJ: 5.4c Describe the mechanisms used by microbes to maintain pH homeostasis MSC: Understanding 10. Give an example of a naturally occurring organic acid stress situation in the food industry. How does the food industry mimic this, and why?

ANS: In the yogurt-making process, lactobacilli produce lactic acid, acidifying the yogurt. This limits bacterial growth, leaving yogurt with plenty of food value. Manufacturers have added citric acid or sorbic acid to some foods to control microbial growth.

DIF: Difficult REF: 5.4 OBJ: 5.4c Describe the mechanisms used by microbes to maintain pH homeostasis

MSC: Understanding 11. Why is oxygen so dangerous for cells and how do cells deal with these problems?

ANS: Oxygen’s breakdown products are dangerously reactive. Substances such as superoxide radicals, hydrogen peroxide, and hydroxyl radicals are some of the damaging toxic oxygen products. They cause damage to DNA, RNA, proteins, and lipids. Organisms must either avoid oxygen or have ways to detoxify its breakdown products. Some organisms produce enzymes, such as superoxide dismutase, catalase, and peroxidase, to neutralize the toxic oxygen species.

DIF: Medium REF: 5.5 OBJ: 5.5a Describe the benefits and risks of oxygen | 5.5c Explain what determines the oxygen sensitivity of microbes MSC: Understanding 12. Briefly describe three techniques used to culture anaerobes in the laboratory.

ANS: Liquid media that contain reducing agents that eliminate dissolved oxygen can be used. Portions of the liquid below the surface will be free of oxygen and support anaerobic growth.

Agar media can be placed into anaerobic jars, which are sealed with chemicals that react with free oxygen, thus generating an anaerobic environment.

An anaerobic glove box is a sealed incubation chamber in which the atmosphere is free of oxygen.

DIF: Medium REF: 5.5 OBJ: 5.5b Define strict aerobe, aerotolerant anaerobe, facultative anaerobe, strict anaerobe, and microaerophile and identify the metabolic strategies available to each MSC: Understanding 13. Describe the studies with Salmonella that showed that in vitro conditions do not always model what happens in vivo (in this case in the phagocytic vacuole).

ANS: Protein profiles were obtained in vitro looking at the results of single stresses. Each of these single stresses was something that would occur in the vacuole compartment. It seemed logical to hypothesize that the profile in the vacuole might correspond to the additive profiles of the single stresses in vitro, but this was not found to be the case. These studies indicate that either unique conditions are present within the vacuole or that combinations of stresses evoke new cell responses.

DIF: Difficult MSC: Applying

REF: 5.6

OBJ: 5.6a Describe microbial responses to starvation

14. Why is moist heat more efficient at killing microbes than dry heat? How does an autoclave kill microbes so efficiently?

ANS: Moist heat is a more effective killer than dry heat because water penetrates the cells when moist heat is used. An autoclave uses moist heat under pressure to sterilize substances. The increased pressure allows the temperature to rise well above the normal boiling point of water. The standard autoclave conditions of 121°C at 15 psi for 20 minutes will sterilize substances.

DIF: Medium

REF: 5.7

OBJ: 5.7c Recall some physical agents that kill microbes and explain how they work MSC: Understanding 15. How is the phenol coefficient calculated? Why is phenol the standard for testing other disinfectants?

ANS: Because of its potency and its history, phenol is the benchmark against which other disinfectants are measured. The phenol coefficient test involves inoculating bacteria into dilutions of the test disinfectant. At timed intervals, samples are withdrawn from each dilution and inoculated into fresh broth. The phenol coefficient is based on the highest dilution of a disinfectant that will kill all of the bacteria after 10 minutes of exposure. This concentration is known as the maximum effective dilution. Dividing the reciprocal of the maximum effective dilution for the test agent by the reciprocal of the maximum effective dilution for phenol gives the phenol coefficient.

DIF: Difficult REF: 5.7 OBJ: 5.7d List some chemical agents that kill microbes and state factors that influence their efficacy MSC: Remembering 16. Why is death a logarithmic function and not an instantaneous event upon treatment?

ANS: For one thing, all cells in a population may not be at the same level of fitness. Some cells may be more susceptible than others. Another aspect is the probability of the treatment causing a lethal hit.

Cells contain many different proteins and genes. Hits to one may not be as deleterious as to another. Moreover, damage must accumulate. Only after enough molecules of an essential gene or protein have been affected in a cell will it die. For these reasons, the entire population does not die immediately upon treatment; instead, it will have an exponential demise.

DIF: Difficult REF: 5.7 OBJ: 5.7b Interpret a death curve to determine the D-value

MSC: Understanding

17. Why do some microorganisms produce antibiotics, and how do they avoid being harmed by the antibiotics they produce?

ANS: Answers will vary. Microbes make antibiotics as a defense against competitors for resources such as food. To avoid being killed, the organism that produces the antibiotic may lack the molecule being targeted by the antibiotic. The antibiotic producer may also modify its own receptors so the antibiotic doesn’t bind to the producer. Others may use enzymes to modify the antibiotic if it enters the cell.

DIF: Medium REF: 5.7 OBJ: 5.7e Describe examples of biological control of microbes MSC: Understanding 18. What is biocontrol? Describe two examples.

ANS: Answers will vary. Biocontrol is the use of one type of microbe to control another type. For example, probiotics are live microbes in food or supplements that are ingested to improve intestinal microbial balance. Yogurt is a specific example of a probiotic. Phage therapy is the use of viruses that kill bacteria to treat bacterial infections.

DIF: Medium REF: 5.7 | Special Topic 5.1 OBJ: 5.7e Describe examples of biological control of microbes MSC: Understanding 19. If a disinfectant is added to a culture containing 1  106 CFU per milliliter and the D-value of the disinfectant is 2 minutes, how many viable cells are left after 4 minutes of exposure?

ANS: The D-value is the time required to kill 90% of cells (that is, the time it takes for the viable cell count to drop by one log10 unit). Since in this case, the D-value is minutes, it means that after 2 minutes, the number of viable cells will be 1  105 CFU per milliliter and thus after 4 minutes of exposure, the number of viable cells would be 1  104 CFU per milliliter.

DIF: Difficult REF: 5.7 OBJ: 5.7b Interpret a death curve to determine the D-value

MSC: Applying

20. If you have a food sample contaminated with anthrax spores, which sterilization approach would make sure the sample is free of spores without compromising the quality of the food sample—autoclaving or irradiation? Why? ANS: Although both autoclaving and irradiation would provide a spore-free food sample at the end of the process, the autoclave’s high pressure and temperature might compromise important ingredients in the food sample. However, when the food sample is irradiated, water and other intracellular molecules absorb energy and form transient reactive chemicals that damage the DNA, and thereby destroy the spores without compromising the quality of the food sample.

DIF: Difficult REF: 5.7 OBJ: 5.7c Recall some physical agents that kill microbes and explain how they work MSC: Evaluating

CHAPTER 6: Viruses MULTIPLE CHOICE 1. All of the following are true about the measles virus EXCEPT that it a. is encased by an envelope of membrane. b. fuses with the host cell membrane during infection. c. has progeny that bud out of the host cell. d. generates a rash of red spots on the skin of infected patients. e. is never fatal.

ANS: E MSC: Applying

DIF: Easy

REF: 6.1

OBJ: 6.1a Define virus

2. Which of the following is a term for the observable destruction of cells as a result of viral lysis? a. tissue culture d. plaque b. lawn e. host c. soft agar ANS: D DIF: Easy MSC: Understanding

REF: 6.1

OBJ: 6.1a Define virus

3. What can be counted as representing individual infectious virions from a phage suspension? a. plaques d. proteomes b. viruses e. burst size c. genomes ANS: A DIF: Easy REF: 6.4 OBJ: 6.4b Recall examples of prophages or endogenous viruses contributing to host cell physiology MSC: Analyzing 4. Which of the following is INCORRECT about a virus? a. It may cause human pneumonia. b. It may be as large as some bacteria. c. It conducts DNA repair. d. It conducts protein folding by chaperones. e. It is a cellular particle.

ANS: E MSC: Applying

DIF: Medium

REF: 6.1

OBJ: 6.1a Define virus

5. What role do acute viruses play in their ecosystem? a. transfer genes across species b. act as predator or parasite c. evolve symbiotically with host d. act as a bioweapon e. act as a viral shunt ANS: B DIF: Easy REF: 6.1 OBJ: 6.1c List the roles viruses play in ecosystems

MSC: Applying

6. Which of the following is NOT one of the three forms a virus can assume? a. prion b. viral genome integrated within host DNA c. intracellular replication complex d. virion e. virus particle ANS: A DIF: Easy REF: 6.1 OBJ: 6.1b Describe the three forms a virus can assume

MSC: Applying

7. An icosahedral capsid is classified as having how many sides? a. 4 d. 10 b. 6 e. 20 c. 8 ANS: E DIF: Easy REF: 6.2 OBJ: 6.2b Identify ways virions can differ from each other

MSC: Analyzing

8. A polyhedron with 20 sides has identical ________ faces. a. helical d. triangular b. filamentous e. asymmetrical c. rectangular ANS: D DIF: Easy REF: 6.2 OBJ: 6.2b Identify ways virions can differ from each other

MSC: Understanding

9. Which infectious agent is identified by the nucleic acid genome being the entire infectious particle? a. viruses d. virions b. prions e. bacteria c. viroids ANS: C DIF: Medium REF: 6.2 OBJ: 6.2c Contrast virions, viroids, and prions

MSC: Analyzing

10. Some viral species may derive their ________ from intracellular membranes, such as the nuclear membrane or endoplasmic reticulum. a. capsid d. neck b. genome e. tail fibers c. envelope ANS: C DIF: Medium REF: 6.2 OBJ: 6.2b Identify ways virions can differ from each other

MSC: Remembering

11. Which structure of a virion protects it from degradation and enables it to be transmitted outside the host? a. capsule d. nucleus b. capsid e. spikes c. envelope ANS: B DIF: Easy REF: 6.2 OBJ: 6.2a State the functions of the structures that are present in all virions MSC: Understanding 12. What phages have been used to nucleate the growth of crystalline ―nanowires‖ for electronic devices? a. icosahedral d. filamentous b. complex e. viroid c. asymmetrical ANS: D DIF: Easy REF: 6.2 OBJ: 6.2b Identify ways virions can differ from each other

MSC: Applying

13. Filamentous viruses are classified in part by the pattern of capsid monomers, which form a ________ tube around the genome. a. icosahedral d. complex b. filamentous e. helical c. asymmetrical ANS: E DIF: Easy REF: 6.2 OBJ: 6.2b Identify ways virions can differ from each other

MSC: Analyzing

14. In bacteriophage T4, the DNA genome is contained in the head, and binding to the host is facilitated by attachment of the a. capsid. d. envelope. b. neck. e. tegument. c. tail fibers.

ANS: C DIF: Easy REF: 6.2 OBJ: 6.2b Identify ways virions can differ from each other

MSC: Remembering

15. The RNA genome of the potato spindle tuber viroid requires which type of modified host polymerase for replication? a. DNA-dependent DNA polymerase b. DNA-dependent RNA polymerase c. RNA-dependent DNA polymerase d. RNA-dependent RNA polymerase e. reverse transcriptase ANS: D DIF: Medium REF: 6.2 OBJ: 6.2b Identify ways virions can differ from each other

MSC: Applying

16. Which filamentous virus causes a fatal disease in humans and is also related to primates? a. HIV d. cowpox b. Ebola e. herpes virus c. smallpox ANS: B DIF: Easy REF: 6.2 OBJ: 6.2b Identify ways virions can differ from each other

MSC: Applying

17. What type of diseases are unique in that they can be transmitted by an infective protein that propagates conformational change of existing molecules without synthesizing entirely new infective molecules? a. viral d. virion b. viroid e. prion c. bacterial ANS: E DIF: Easy REF: 6.2 OBJ: 6.2c Contrast virions, viroids, and prions

MSC: Understanding

18. Large asymmetrical viruses are distinguished in that they a. have no envelope. d. have nucleic acids. b. are protein fragments. e. have many enzymes. c. have few enzymes.

ANS: E DIF: Medium REF: 6.3 OBJ: 6.3a Describe the diversity of viral genomes

MSC: Analyzing

19. All of the following criteria are used to classify viruses according to the International Committee on Taxonomy of Viruses EXCEPT a. genome composition. d. capsid symmetry. b. size of the virus particle. e. mutation rate. c. envelope.

ANS: E DIF: Medium REF: 6.3 OBJ: 6.3b List the criteria by which the International Committee on Taxonomy of Viruses (ICTV) classifies viruses MSC: Understanding 20. If something descended from a common ancestor, it is a. monomeric. d. monosyllabic. b. monophyletic. e. monolithic. c. monogrammed.

ANS: B DIF: Medium REF: 6.3 OBJ: 6.3d Compare and contrast genome and proteome analysis for viral phylogeny construction MSC: Understanding

21. Which of the following is an example of double-stranded RNA viruses? a. herpes viruses d. orthomixoviruses b. corona viruses e. hepadnaviruses c. retrovirus ANS: C DIF: Easy REF: 6.3 OBJ: 6.3c Categorize the genome composition and the route used to express messenger RNA (mRNA) in the Baltimore virus classification scheme MSC: Understanding 22. What viruses are classified by using the suffix viridae? a. genera d. orders b. families e. classes c. species ANS: B DIF: Medium REF: 6.3 OBJ: 6.3b List the criteria by which the International Committee on Taxonomy of Viruses (ICTV) classifies viruses MSC: Analyzing 23. Viruses may be classified by the ________ method. a. Annapolis d. Augusta b. Baltimore e. Portland c. Orono ANS: B DIF: Easy REF: 6.3 OBJ: 6.3c Categorize the genome composition and the route used to express messenger RNA (mRNA) in the Baltimore virus classification scheme MSC: Remembering 24. So far, the known mechanisms of replication and mRNA expression define how many fundamental groups of virus species? a. five d. eight b. six e. nine c. seven ANS: C DIF: Medium REF: 6.3 OBJ: 6.3c Categorize the genome composition and the route used to express messenger RNA (mRNA) in the Baltimore virus classification scheme MSC: Remembering 25. David Baltimore proposed that the primary distinction among classes of viruses was the ________ composition and the route used to express messenger RNA. a. genome d. tegument b. envelope e. neck c. capsid ANS: A DIF: Easy REF: 6.3 OBJ: 6.3c Categorize the genome composition and the route used to express messenger RNA (mRNA) in the Baltimore virus classification scheme MSC: Remembering 26. The genome of ________ ssRNA viruses can serve directly as mRNA. a. positive-sense () d. double-stranded b. negative-sense () e. prion c. all ANS: A DIF: Easy REF: 6.3 OBJ: 6.3a Describe the diversity of viral genomes

MSC: Remembering

27. A key factor in the evolution of killer strains of influenza is that they

a. only have eight genes. b. have an RNA genome. c. contain reverse transcriptase.

d. have a segmented genome. e. have a circular chromosome.

ANS: D DIF: Medium REF: 6.3 OBJ: 6.3c Categorize the genome composition and the route used to express messenger RNA (mRNA) in the Baltimore virus classification scheme MSC: Remembering 28. Which of the following is NOT true of the pararetroviruses? a. They have an RNA genome. b. They do not make a DNA intermediate. c. Some have a viral reverse transcriptase. d. Some use a host reverse transcriptase. e. They consist of human and plant pathogens.

ANS: A DIF: Medium REF: 6.3 OBJ: 6.3c Categorize the genome composition and the route used to express messenger RNA (mRNA) in the Baltimore virus classification scheme MSC: Remembering 29. Which of the following are genes of common ancestry in two genomes that share the same function? a. homologs d. orthologs b. open reading frames e. lysogenic c. proteomes ANS: D DIF: Difficult REF: 6.3 OBJ: 6.3d Compare and contrast genome and proteome analysis for viral phylogeny construction MSC: Remembering 30. The proteomic tree of bacteriophages is based on comprehensive analysis of viral a. DNAs. d. capsids. b. RNAs. e. host ranges. c. proteins.

ANS: C DIF: Easy REF: 6.3 OBJ: 6.3d Compare and contrast genome and proteome analysis for viral phylogeny construction MSC: Remembering 31. Proteomic analysis predicts seven major evolutionary categories of phage species with subgroups based on a. type of genetic material. d. transcriptional strategy. b. virion structure. e. replicase gene sequence. c. shared hosts.

ANS: C DIF: Medium REF: 6.3 OBJ: 6.3d Compare and contrast genome and proteome analysis for viral phylogeny construction MSC: Understanding 32. Which structure remains outside, attached to the cell surface, after the genome is inserted? a. an envelope d. a ghost b. a neck e. temperate c. tail fibers ANS: D DIF: Easy REF: 6.4 OBJ: 6.4a Distinguish the lytic, lysogenic, and slow-release viral cycles MSC: Understanding

33. Which of the following steps is NOT part of the life cycle of a lytic phage? a. Phage DNA is injected into the bacterial cell. b. The phage DNA integrates into the bacterial chromosome. c. Many copies of phage DNA are made. d. The phage DNA is transcribed, and the resulting mRNA is translated to make capsid proteins. e. All of the steps listed are part of the life cycle of a lytic phage.

ANS: B DIF: Difficult REF: 6.4 OBJ: 6.4a Distinguish the lytic, lysogenic, and slow-release viral cycles MSC: Applying 34. The number of virus particles released at lysis is referred to as a. the lytic number. d. the temperate number. b. burst size. e. the release number. c. the lysogenic number.

ANS: B DIF: Easy REF: 6.4 OBJ: 6.4b Recall examples of prophages or endogenous viruses contributing to host cell physiology MSC: Remembering 35. A(n) ________ phage may integrate its genome into that of the host cell. a. lytic d. asymmetrical b. temperate e. oncogenic c. viroid ANS: B DIF: Easy REF: 6.4 OBJ: 6.4a Distinguish the lytic, lysogenic, and slow-release viral cycles MSC: Remembering 36. The integrated phage genome is called a(n) a. temperate. b. lysogen. c. oncogene.

d. lytic. e. prophage.

ANS: E DIF: Easy REF: 6.4 OBJ: 6.4b Recall examples of prophages or endogenous viruses contributing to host cell physiology MSC: Remembering 37. CRISPR is a(n) a. bacterial gene. b. bacterial enzyme. c. bacterial immune system.

d. inactive viral RNA. e. cascade protein.

ANS: C DIF: Easy REF: 6.4 OBJ: 6.4c Explain how bacteria defend themselves against viruses MSC: Remembering 38. When a bacterial cell is infected, the virus protection coat a. enters the host cell with the viral genome. b. remains on the outside of the host cell. c. enters the host cell separately from the viral genome.

d. is released to attach to and inject another host cell. e. becomes part of the host cell membrane.

ANS: B DIF: Easy REF: 6.4 OBJ: 6.4b Recall examples of prophages or endogenous viruses contributing to host cell physiology MSC: Understanding 39. Hershey & Chase (1952) showed that the transmission of DNA by a bacteriophage to a host cell led to the production of progeny bacteriophages. What did this confirm? a. DNA is the hereditary material. b. Viruses can infect bacteria. c. Phage genomes can integrate into a bacterial genome. d. Phages inject their genome through the cell envelope. e. Various host molecules can serve as a phage receptor.

ANS: A DIF: Difficult REF: 6.4 OBJ: 6.4b Recall examples of prophages or endogenous viruses contributing to host cell physiology MSC: Understanding 40. Dysbiosis is the result of a. deterioration of health due to loss of bacteria. b. increase in health due to loss of bacteria. c. host bacterium undergoing a lytic cycle. d. host bacterium undergoing a lysogenic cycle. e. slow release.

ANS: A DIF: Difficult REF: 6.4 OBJ: 6.4d Describe the impact of bacteriophages in the human intestinal tract MSC: Understanding 41. Within a host, receptor molecules can also determine the ________, or tendency to infect a particular tissue type. a. tropism d. burst size b. host range e. plaque c. virulence ANS: A DIF: Easy REF: 6.5 OBJ: 6.5a Explain how animal viruses exhibit host and tissue tropism MSC: Remembering 42. The primary factor determining the life cycle of an animal virus is the physical form of the a. envelope. d. receptor. b. capsid. e. burst. c. genome.

ANS: C DIF: Difficult REF: 6.5 OBJ: 6.5c Compare and contrast animal virus replication cycles MSC: Analyzing 43. The proteins found in animals and plants that can recognize general signs of viral infections are a. RNA interference. d. surface receptors. b. interferons. e. antibodies. c. T-lymphocytes.

ANS: B DIF: Easy REF: 6.5 OBJ: 6.5e Describe animal and plant viral defenses

MSC: Remembering

44. Which virus is differentiated by being taken up by endocytosis? a. hepatitis C b. human immunodeficiency virus (HIV) c. gonorrhea d. syphilis e. chlamydia ANS: A DIF: Medium REF: 6.5 OBJ: 6.5b Categorize animal virus uncoating strategies

MSC: Analyzing

45. In contrast to animal viruses and bacteriophages, plant viruses infect cells by mechanisms that do NOT involve specific a. receptors. d. vectors. b. membranes. e. hosts. c. envelopes.

ANS: A DIF: Medium REF: 6.5 OBJ: 6.5d Recall how plant viruses enter a host cell and transmit to uninfected cells MSC: Analyzing 46. Which of the following is FALSE concerning HIV? a. It is the causative agent of AIDS. b. It makes a DNA copy of its RNA genome. c. Reverse transcriptase is translated from an early gene. d. The virion contains two copies of the HIV genome. e. The viral RNA is copied into double-stranded DNA. ANS: C DIF: Medium REF: 6.5 OBJ: 6.5f State the conditions that favor the emergence of viral pathogens MSC: Applying 47. Which is the period of time that is categorized by virtually undetectable virions inside the infected cell? a. eclipse d. burst b. latent e. lag c. rise ANS: A DIF: Easy REF: 6.6 OBJ: 6.6b Express what is happening during the different stages of a one-step growth curve of viral batch culture MSC: Analyzing 48. What is NOT a difficulty of culturing viruses? a. tropism for particular tissue b. tissue culture may not show organ property c. loss of virulence d. able to observe a large population e. need a double culture of host cell and viruses ANS: D DIF: Difficult REF: 6.6 OBJ: 6.6a Outline some of the difficulties involved in culturing viruses MSC: Applying

49. Tissue cultures are more feasible than whole animals for viral growth because they a. can develop vaccines. b. can test a multitude of chemical and antibiotic agents. c. are more time-consuming. d. are less expensive. e. are more expensive.

ANS: D DIF: Difficult REF: 6.6 OBJ: 6.6c Summarize the advantages and disadvantages of culturing animal viruses in tissue culture versus whole animals MSC: Applying 50. Who was distinguished for modifying tissue culture procedure for plaque assays? a. David Baltimore d. Paulo Verardi b. Renato Dulbecco e. Howard Temin c. Xinzheng Zhang ANS: B DIF: Difficult REF: 6.6 OBJ: 6.6d Recall what plaques are and explain how they are useful to microbiologists MSC: Analyzing SHORT ANSWER 1. What happens when marine algae overgrows?

ANS: They can generate a bloom that covers thousands of square kilometers. The pale clouds in the water are the reflected light from billions of calcite plates, or ―coccoliths,‖ that coat each algal cell.

Yet within a few days, this gigantic bloom is dissipated by viruses.

DIF: Difficult REF: 6.1 MSC: Understanding

OBJ: 6.1c List the roles viruses play in ecosystems

2. Discuss the role that marine viruses play in carbon balance.

ANS: The carbon cycle in a marine environment is usually described as grazers consuming phytoplankton and then being consumed by carnivores. One must realize that viral infection of each of these leads to lysis and the formation of detritus. This organic material is consumed by bacteria that respire, returning carbon dioxide to the atmosphere.

DIF: Medium REF: 6.1 MSC: Understanding

OBJ: 6.1c List the roles viruses play in ecosystems

3. Why are viruses not affected by antibiotics? Why are there so few antiviral drugs?

ANS: Viruses are not cellular entities. Common antibiotics disrupt cell wall synthesis or interact with ribosomes and disrupt the translation process. Viruses do not have either cell walls or ribosomes, so these antibiotics would be ineffective.

Viruses that infect humans commandeer the host cell to make more viruses. One cannot target the host machinery because then the host would be harmed. There are few viral targets that can be attacked without harming the host cell.

DIF: Difficult

REF: 6.1

OBJ: 6.1a Define virus

MSC: Understanding 4. What are prions and how do they cause disease?

ANS: Prions are aberrant forms of naturally occurring proteins that assume an abnormal conformation.

They cause disease by binding to normally folded proteins of the same type and altering their conformation. Harmful aggregates of these proteins cause cell death.

DIF: Medium REF: 6.2 MSC: Understanding

OBJ: 6.2c Contrast virions, viroids, and prions

5. What is the advantage of symmetry in viral particles?

ANS: Symmetry provides a way to form a package out of repeating protein units. This requires a small number of genes, since the same protein unit is repeated. Viral genomes are generally very small, so they have few genes. They can also devote more resources to copying their genome for viral replication if it takes few resources to make the capsid proteins.

DIF: Medium REF: 6.2 OBJ: 6.2b Identify ways virions can differ from each other

MSC: Applying

6. Identify the outer structure shown in the figure below. What is it composed of and how does it differ from the bacterial version?

ANS: The viral envelope is composed of the phospholipid portion of the membrane from the host cell from which it came and proteins encoded by the virus genome. The bacterial cell envelope refers to the layers outside of the cell membrane.

DIF: Medium REF: 6.2 OBJ: 6.2b Identify ways virions can differ from each other

MSC: Understanding

7. Compare and contrast the Baltimore classification of viruses to the proteomic analysis of bacteriophages. Which more accurately reflects the significant impact of phage evolution?

ANS:

The Baltimore classification divides the viruses into seven groups based on the genome of the virus and the route used to get to mRNA. Proteomic analysis is a comparison of the proteins encoded by the genomes. The proteomic tree also yields seven categories of phages. These categories, however, group the phages by host bacteria. Phages with different types of genomes may be grouped together. The proteomic tree analogy more truly reflects the evolutionary process.

Viruses that share a host have the ability to exchange genetic information.

DIF: Difficult REF: 6.3 OBJ: 6.3d Compare and contrast genome and proteome analysis for viral phylogeny construction MSC: Applying 8. Name the different types of receptors shown in the figure below.

ANS: Different types of receptors shown include the following: LPS, which is a lipid polysaccharide molecule; ompF molecules, which are transport channels; and TOLC, which is a bacteria membrane protein.

DIF: Difficult REF: 6.4 OBJ: 6.4c Explain how bacteria defend themselves against viruses MSC: Understanding 9. Some viruses require an RNA-dependent RNA polymerase. What does that mean? What would you call the host cell RNA polymerase (RNA pol)? What would you call reverse transcriptase (RTase)?

ANS:

An RNA-dependent RNA polymerase means that the polymerase requires an RNA template (RNA-dep) to synthesize RNA (RNA pol). The host cell RNA pol would be called a DNA-dependent RNA polymerase, since it requires a DNA template to synthesize RNA. RTase would be referred to as an RNA-dependent DNA polymerase since it utilizes an RNA template to synthesize DNA. DIF: Difficult REF: 6.3 OBJ: 6.3c Categorize the genome composition and the route used to express messenger RNA (mRNA) in the Baltimore virus classification scheme MSC: Applying 10. Why do many RNA viruses encode their own RNA-dependent RNA polymerase and package them in viral particles? How do we take advantage of these viral-specific polymerases?

ANS: Animal or bacterial cells lack RNA-dependent RNA polymerase and thus cannot replicate RNA regardless of whether they are single- or double-stranded RNA. The initial replication of viral RNA genomes must be accomplished by existing RNA-dependent RNA polymerase. Subsequent replication and/or transcription of viral RNA genome and mRNA could be accomplished by viral RNA-dependent RNA polymerase produced in the hosts.

These viral-specific polymerases could be the targets for antiviral therapies with lowered side effects. They could also be utilized for in vitro replication/amplification of RNA molecules.

DIF: Difficult REF: 6.3 OBJ: 6.3b List the criteria by which the International Committee on Taxonomy of Viruses (ICTV) classifies viruses MSC: Applying 11. Evaluate what determines which cycle a temperate phage will go through as shown in the figure below.

ANS:

Proteins bind DNA to repress viral replication genes during lysogeny. The switch to the lytic cycle can occur randomly or can be triggered by environmental stresses that damage the cell’s DNA. Events that threaten a cell’s survival can trigger the lytic cycle. If the host cells are growing well, the virus can continue to survive and be propagated as a prophage.

DIF: Difficult REF: 6.4 OBJ: 6.4a Distinguish the lytic, lysogenic, and slow-release viral cycles MSC: Evaluating 12. How can a virus be used to transfer genes from one bacterial cell to another?

ANS: In the process of transduction, a lysogenic phage is triggered to begin the lytic cycle. When this occurs, the viral DNA is excised from the host chromosome, and sometimes some of the host chromosome is excised with the viral DNA. A combination of viral DNA and host DNA can be packaged into a viral capsid, which then infects a new host and brings both viral and host DNA to the new host. In other cases, a viral infection causes host DNA to be cut into small pieces, and some of those pieces are accidentally packaged into viral capsids. This host DNA in the viral capsid can be transferred to a new host when the virus infects the new host.

DIF: Difficult REF: 6.4 OBJ: 6.4c Explain how bacteria defend themselves against viruses MSC: Applying 13. What determines the host range and tropism of a virus?

ANS: Viruses must attach to specific host cell receptors to cause infection. Only host cells with the specific receptors that a particular virus recognizes can be infected with that viral species.

Receptors may also only be found on specific tissues, meaning that the receptors also determine tropism, or which tissues can be infected.

DIF: Medium REF: 6.5 OBJ: 6.5a Explain how animal viruses exhibit host and tissue tropism MSC: Understanding 14. Explain the process shown in the figure below.

ANS: This is an adenovirus infecting a cell. The genome is docking into nuclear membrane. Then, it shows the uncoating of the dsDNA genome.

DIF: Difficult strategies MSC: Applying

REF: 6.5

OBJ: 6.5b Categorize animal virus uncoating

15. Define oncogenes and oncogenic viruses, and explain how they can be used in gene therapy.

ANS: Oncogenes are genes that, when expressed, cause uncontrolled proliferation of the infected cell and ultimately cancer. These oncogenes may be activated by viral transfer of host genes to abnormal chromosome locations. Alternatively, viruses may carry these oncogenes in their genome. Viruses that lead to oncogene expression are referred to as oncogenic viruses.

In gene therapy, a virus is used as a vehicle to transfer a functional copy of a gene to an individual to ―correct‖ a genetic defect.

DIF: Difficult REF: 6.5 OBJ: 6.5f State the conditions that favor the emergence of viral pathogens MSC: Applying 16. What is it necessary for bacteriophage and animal virus entry into a cell? How does that differ from plant viral entry?

ANS: There is a specific receptor on the host cell to which a bacteriophage or animal virus must bind to initiate viral entry into the host. There is no receptor involved in plant viral entry. It is instead gained by either contact with damaged tissues, transmission by an animal vector, or transmission through seed.

DIF: Medium REF: 6.5 MSC: Understanding

OBJ: 6.5e Describe animal and plant viral defenses

17. How is the technique displayed in the figure below used to count virions in a solution?

ANS: Dilutions of a solution containing an unknown number of viruses is diluted and then mixed with host cells. The mixture is added to soft agar and then poured onto a plate of solid medium. When the virions infect host cells, the host cells will lyse and release more virions to infect neighboring host cells. This cycle continues until a visible clearing, a plaque, can be seen within the lawn of bacteria. The plaques can be counted and multiplied by the dilution factor to determine plaque-forming units/ml.

DIF: Medium REF: 6.6 OBJ: 6.6d Recall what plaques are and explain how they are useful to microbiologists MSC: Applying 18. During the eclipse period of a viral infection, why are the virions undetectable in the growth medium?

ANS: The virions attach to cell-surface receptors and inject their DNA. Since all or most of the virions are attached to the host-cell receptors, there are few present in the growth medium.

DIF: Medium REF: 6.6 OBJ: 6.6a Outline some of the difficulties involved in culturing viruses MSC: Understanding 19. Why was the advent of tissue culture heralded as the end of the ―monkey era‖? What types of things are we able to do with it?

ANS:

Monkeys were being used to culture polio virus. This was very expensive and labor intensive, and it involved the use of many animals. Tissue culture affords us the option to avoid animal use. It has become the method of choice to test chemical and antibiotic reagents. It is also used to study animal and plant viruses and to develop vaccines and antiviral chemicals.

DIF: Medium REF: 6.6 OBJ: 6.6c Summarize the advantages and disadvantages of culturing animal viruses in tissue culture versus whole animals MSC: Applying 20. To count the number of viruses in a solution, one can perform a plaque assay. Describe how a plaque is generated in the case of a lytic virus and how a virus that does not lyse its host can be detected.

ANS: A plaque represents the area where one virus initially infected one cell. It looks like a clear zone on a lawn of uninfected cells. In the case of a lytic virus, the plaque appears because the cells lyse when the viruses are released. In the case of a nonlytic virus, the cells are not lysed, but when infected they contain components of the replicating virus. Fluorescent antibodies targeting specific viral proteins can react with the cells.

DIF: Medium REF: 6.6 OBJ: 6.6d Recall what plaques are and explain how they are useful to microbiologists MSC: Applying

CHAPTER 7: Genomes and Chromosomes MULTIPLE CHOICE 1. When preparing Escherichia coli cells for electron microscopy by osmotic disruption, their chromosome was released, revealing a length ________ as long as a single cell. a. 0.5X d. 100X b. 2X e. 1,500X c. 10X ANS: E DIF: Easy REF: 7.Intro OBJ: 7.2b Differentiate gene, operon, and regulon MSC:

Remembering

2. The entire genetic complement of DNA in a cell of a particular organism is called a. genome. d. metabolome. b. transcriptome. e. lipidome. c. proteome.

ANS: A DIF: Easy REF: 7.Intro OBJ: 7.1b Recall the functions of structural genes and DNA control elements MSC: Remembering 3. Gene transfer from parent to progeny is called a. expression. d. transformation. b. horizontal gene transfer. e. recombination. c. vertical gene transfer.

ANS: C DIF: Easy REF: 7.1 OBJ: 7.1a Distinguish vertical and horizontal gene transfer and describe two types of horizontal gene transfer MSC: Understanding

4. The movement of genetic material from one cell into another is called a. vertical gene transfer. d. transformation. b. horizontal gene transfer. e. expression. c. recombination.

ANS: B DIF: Easy REF: 7.2 OBJ: 7.2a List the ways genomes of prokaryotic species can differ from each other MSC: Understanding 5. The term ________ describes a polycistronic messenger RNA whose expression is under control of a promoter. a. enhancer d. amplicon b. regulon e. attenuator c. operon ANS: C DIF: Medium REF: 7.2 OBJ: 7.2b Differentiate gene, operon, and regulon MSC:

Remembering

6. The genome of the bacterium ________, the agent of Lyme disease, is not contained in a circular DNA molecule but rather in a linear chromosome and more than twenty plasmids. a. Escherichia albertii d. Borrelia burgdorferi b. Staphylococcus aureus e. Burkholderia cepacia c. Legionella pneumophila ANS: D DIF: Medium REF: 7.2 OBJ: 7.2a List the ways genomes of prokaryotic species can differ from each other MSC: Remembering 7. Some of the smallest cellular genomes identified thus far are those of a. Escherichia coli. d. Mycoplasma. b. Staphylococcus. e. Saccharomyces. c. Streptococcus.

ANS: D DIF: Easy REF: 7.2 OBJ: 7.2a List the ways genomes of prokaryotic species can differ from each other MSC: Remembering 8. The backbone of the DNA double helix allows the formation of major and minor ________ through which DNA-binding proteins interact with the bases without separating the strands. a. cohesive ends d. attractions b. grooves e. repulsions c. nicks ANS: B DIF: Medium REF: 7.2 OBJ: 7.2c Compare and contrast the structure of DNA and RNA MSC: Remembering 9. A collection of genes and operons whose expression is controlled by a single protein is called a(n) a. regulon. d. intron. b. monocistronic message. e. exon. c. polycistronic message.

ANS: A DIF: Difficult REF: 7.2 OBJ: 7.2b Differentiate gene, operon, and regulon MSC:

Remembering

10. Bacteria and archaea that grow at extreme pH or temperature possess which feature to protect their DNA from denaturation? a. pseudogenes d. major grooves b. Okazaki fragments e. minor grooves c. DNA-binding proteins ANS: C DIF: Medium REF: 7.2 OBJ: 7.2c Compare and contrast the structure of DNA and RNA MSC: Remembering 11. Which of the following is true in the DNA double helix? a. The strands are parallel. b. Phosphate groups are located at the 5'-ends of both strands. c. Adenine complements cytosine. d. Guanine complements thymine. e. Only major grooves can be formed.

ANS: B DIF: Easy REF: 7.2 OBJ: 7.2c Compare and contrast the structure of DNA and RNA MSC: Remembering 12. A nucleoid gently released from Escherichia coli appears as 30–100 tightly wound loops, each defined by anchoring a. histones. d. rho factors. b. histone-like proteins. e. sigma factors. c. transcription factors.

ANS: B DIF: Easy REF: 7.2 OBJ: 7.2d Explain how bacterial chromosomes are compacted to fit into the cell MSC: Remembering 13. The nucleoids of bacteria and most archaea, as well as the nuclear DNA of eukaryotes, are kept ________ supercoiled. a. positively d. loosely b. neutrally e. extra c. negatively ANS: C DIF: Easy REF: 7.2 OBJ: 7.2d Explain how bacterial chromosomes are compacted to fit into the cell MSC: Remembering 14. Supercoiling in bacteria is typically introduced by enzymes called a. gyrases. d. polymerases. b. helicases. e. endonucleases. c. ligases.

ANS: A DIF: Easy REF: 7.2 OBJ: 7.2d Explain how bacterial chromosomes are compacted to fit into the cell MSC: Remembering 15. The thermal stability of the helix is predominantly due to the ________ of the hydrophobic base pairs. a. attraction d. stacking b. binding e. redox potential c. repulsion and van der Waals forces

ANS: D DIF: Medium REF: 7.2 OBJ: 7.2c Compare and contrast the structure of DNA and RNA MSC: Understanding 16. Enzymes that modify the supercoiling of a DNA molecule are called a. ligases. d. topoisomerases. b. primases. e. acetylases. c. transferases.

ANS: D DIF: Medium REF: 7.2 OBJ: 7.2d Explain how bacterial chromosomes are compacted to fit into the cell MSC: Understanding 17. Hyperthermophilic archaea possess an unusual gyrase called ________, which introduces positive supercoils into the chromosome in order to protect the DNA from ________. a. reverse DNA gyrase; thermal denaturation b. DNA helicase; thermal denaturation c. topoisomerase I; gene overexpression d. DNA ligase; thermal denaturation e. reverse transcriptase; gene overexpression ANS: A DIF: Difficult REF: 7.2 OBJ: 7.2d Explain how bacterial chromosomes are compacted to fit into the cell MSC: Applying 18. In the figure below, which models DNA semiconservative replication, the numeral I points to ________, II points to ________, and III points to _______.

a. b. c. d. e.

origin of replication; new daughter strands; replication fork termination sequences; replication fork; new daughter strands replication fork; new daughter strands; origin new daughter strands; termination sequences; replication fork new daughter strands; origin; replication fork

ANS: E DIF: Difficult REF: 7.3 OBJ: 7.3a Outline the mechanism and regulation of bacterial chromosome replication MSC: Understanding 19. DNA and RNA polymerases can only synthesize in the ________ direction. a. forward d. reverse b. 3'-to-5' e. 5'-to-3' or 3'-to-5' c. 5'-to-3' ANS: C

DIF: Easy

REF: 7.3

OBJ: 7.3a Outline the mechanism and regulation of bacterial chromosome replication MSC: Understanding 20. During replication, the lagging strand is synthesized ________, while the leading strand can be synthesized ________. a. continuously; discontinuously d. 3'-to-5'; 5'-to-3' b. discontinuously; continuously e. quickly; slowly c. 5'-to-3'; 3'-to-5' ANS: B DIF: Medium REF: 7.3 OBJ: 7.3a Outline the mechanism and regulation of bacterial chromosome replication MSC: Understanding 21. Bacterial type II topoisomerases are the targets of antibiotics such as ________, which has been used to treat ________. a. ampicillin; urinary tract infections d. ciprofloxacin; anthrax pneumonia b. rifamycin; bacterial meningitis e. streyptomycin; tuberculosis c. tetracycline; Lyme disease ANS: D DIF: Difficult REF: 7.3 OBJ: 7.3b Identify the proteins involved in chromosome replication and separation MSC: Applying 22. When double-stranded DNA replicates, the newly made strand is related to its template strand because the two strands have a. identical sequences and are parallel to each other. b. complementary sequences and are parallel to each other. c. identical sequences and are antiparallel to each other. d. complementary sequences and are antiparallel to each other. e. identical sequences and are antiparallel to each other, except that U replaces T. ANS: D DIF: Medium REF: 7.3 OBJ: 7.3a Outline the mechanism and regulation of bacterial chromosome replication MSC: Understanding 23. In the figure below, which depicts the activation step in bacterial DNA replication, the letter Q points to ________, and the letters R and S point to ________, respectively.

a. b. c. d. e.

DnaA-ATP proteins; 9-mer repeats within oriC and 13-mer sequences Primase; oriC and 13-mer repeats SeqA protein; 13-mer repeats and 9-mer basepairs within oriC DamA methylase; 9-mer repeats within oriC and 13-mer repeats gyrase; 13-mer repeats and 9-mer sequences within oriC

ANS: A DIF: Difficult REF: 7.3 OBJ: 7.3b Identify the proteins involved in chromosome replication and separation MSC: Analyzing 24. The first steps in bacterial DNA replication are represented in the figure below, in which the letters T and U point to ________, respectively.

a. strand separation at GC-rich regions and binding of gyrase at oriC b. strand separation at the 13-mer repeats and binding of DnaA-ATP proteins at the 9-mer repeats c. strand separation at the 9-mer repeats and binding of DamA proteins at the 9-mer repeats d. strand separation at the 13-mer repeats and binding of SeqA proteins at the 9-mer repeats e. synthesis of RNA primer and binding of primase ANS: B DIF: Difficult REF: 7.3 OBJ: 7.3b Identify the proteins involved in chromosome replication and separation MSC: Analyzing 25. The sliding clamp is used to ________ and is loaded by ________. a. open the helix; clamp-loading complex b. open the helix; DNA polymerase III c. tether the DNA polymerase to the chromosome; clamp-loading complex d. tether the DNA polymerase to the chromosome; DNA polymerase I e. tether the polymerase to the chromosome; DNA primase ANS: C DIF: Medium REF: 7.3 OBJ: 7.3b Identify the proteins involved in chromosome replication and separation MSC: Understanding 26. The main replication DNA polymerase in E. coli is Pol III. What type of bonds do DNA polymerases form? a. aminoacyl-tRNA d. hydrogen b. peptide e. disulfide c. phosphodiester ANS: C DIF: Easy REF: 7.3 OBJ: 7.3b Identify the proteins involved in chromosome replication and separation MSC: Understanding 27. Errors during replication are corrected by the DNA proofreading activity intrinsic to DNA Pol a. I. d. IV. b. II. e. V. c. III.

ANS: C DIF: Easy REF: 7.3 OBJ: 7.3b Identify the proteins involved in chromosome replication and separation MSC: Understanding 28. What is the approximate size of Okazaki fragments in E. coli? a. 10 bp d. 1,000 bp b. 50 bp e. 10,000 bp c. 100 bp ANS: D DIF: Medium REF: 7.3 OBJ: 7.3a Outline the mechanism and regulation of bacterial chromosome replication MSC: Understanding 29. Which molecule is responsible for removing torsional stress during DNA replication? a. DNA primase d. DNA gyrase b. single-stranded binding proteins e. DNA ligase c. RNase H ANS: D DIF: Easy REF: 7.3 OBJ: 7.3b Identify the proteins involved in chromosome replication and separation MSC: Understanding 30. What region of the chromosome in E. coli is involved in the replication termination process? a. oriC d. att b. ter e. dif c. TATA box ANS: B DIF: Medium REF: 7.3 OBJ: 7.3a Outline the mechanism and regulation of bacterial chromosome replication MSC: Understanding 31. Besides the nucleoid, two other kinds of DNA molecules that may be present in the cytoplasm of a bacterial cell are ________ and the genomes of ________. a. bacteriophages; pseudogenes d. plasmids; introns b. introns; bacteriophages e. introns; exons c. plasmids; bacteriophages ANS: C DIF: Medium REF: 7.4 OBJ: 7.4a Describe the two ways plasmids can replicate 32. Plasmids are NOT a. found in archaea. b. found in bacteria. c. found in eukaryotes.

MSC: Remembering

d. supercoiled. e. usually circular.

ANS: D DIF: Easy REF: 7.4 OBJ: 7.4a Describe the two ways plasmids can replicate

MSC: Understanding

33. Which of the following is a process that involves cell-to-cell contact to move a plasmid from a donor cell to a recipient cell? a. transformation d. conjugation b. lysogeny e. lysis c. generalized transduction ANS: D DIF: Easy REF: 7.4 OBJ: 7.4c Outline the mechanisms that transmit plasmids between cells

MSC: Applying 34. Which of the following is NOT a mechanism by which plasmids increase the possibility of being present in the new generation of cells? a. They can be present at a high number so that some copies will end up in each new cell after cell division. b. They encode traits such as antibiotic resistance that are required for growth in some environments. c. They have an exponential amount of genes needed for replication. d. They participate in the physiological processes of the host cell. e. They carry host survival genes and self-preservation genes.

ANS: C DIF: Difficult REF: 7.4 OBJ: 7.4b Summarize the ways plasmids ensure inheritance

MSC: Applying

35. Eukaryotic chromosomes are ________, contained within a nucleus, and they contain DNA associated to a core of histone proteins called the ________. a. linear; proteasome d. circular; nucleosome b. linear; nucleosome e. circular; capsid c. circular; centromere ANS: B DIF: Easy REF: 7.5 OBJ: 7.5a Compare and contrast the genomes, DNA replication enzymes, and RNA polymerases of bacteria, archaea, and eukaryotes MSC: Understanding 36. Which of the following terms refers to gene duplications that have decayed into nonfunctional entities? a. introns d. pseudogenes b. contigs e. transposons c. orthologs ANS: D DIF: Medium REF: 7.5 OBJ: 7.5a Compare and contrast the genomes, DNA replication enzymes, and RNA polymerases of bacteria, archaea, and eukaryotes MSC: Remembering 37. Which of the following is an INCORRECT statement about pseudogenes? a. Portions of their DNA sequences are similar to those of genes with known functions. b. RNA can be transcribed from some pseudogenes, but the protein products will not have an obvious function. c. Pseudogenes are lost more quickly in bacteria because of their faster replication processes. d. Bacterial pseudogenes account for less of the genome than in eukaryotes. e. Pseudogenes have not been found in bacteria.

ANS: E DIF: Medium REF: 7.5 OBJ: 7.5a Compare and contrast the genomes, DNA replication enzymes, and RNA polymerases of bacteria, archaea, and eukaryotes MSC: Analyzing 38. Which of the following is an INCORRECT statement? a. Reproduction in archaea is predominantly asexual. b. RNA polymerase components of the archaeon Sulfolobus are homologous to those of eukaryotic RNA Pol II. c. All known archaea have a single circular chromosome and genes organized in operons. d. Archaeal DNA-packing proteins and ribosomal components closely resemble those of eukaryotes. e. Both archaeal and eukaryotic genomes encode metabolic pathways of methanogenesis.

ANS: E DIF: Medium REF: 7.5 OBJ: 7.5a Compare and contrast the genomes, DNA replication enzymes, and RNA polymerases of bacteria, archaea, and eukaryotes MSC: Analyzing 39. Which of the following is NOT true about histones? a. They are rich in arginine and lysine. b. They bind to negatively charged DNA. c. They are positively charged. d. They are used to control expression of bacterial operons. e. They form units with DNA called nucleosomes.

ANS: D DIF: Easy REF: 7.5 OBJ: 7.5a Compare and contrast the genomes, DNA replication enzymes, and RNA polymerases of bacteria, archaea, and eukaryotes MSC: Applying 40. ________ is an enzyme that may have evolved from ancient progenitor cells with an RNA genome, and it functions as a ________. a. Primase; helicase d. Telomerase; reverse transcriptase b. Primase; reverse transcriptase e. Telomerase; methylator and acetylator c. Telomerase; helicase ANS: D DIF: Medium REF: 7.5 OBJ: 7.5a Compare and contrast the genomes, DNA replication enzymes, and RNA polymerases of bacteria, archaea, and eukaryotes MSC: Applying 41. What role does lysozyme play when isolating DNA from bacterial cells? a. It degrades the lipids in the cell membranes. b. It breaks down the peptidoglycan cell wall. c. It hydrolyzes cytoplasmic proteins. d. It prevents DNA degradation after elution from DNA-binding columns. e. It degrades contaminating RNA. ANS: B DIF: Easy REF: 7.6 OBJ: 7.6a List the steps of bacterial chromosome isolation and purification MSC: Applying 42. The natural function of ________ is to cut the DNA of invading plasmids and phages at specific sequences. a. topoisomerases d. RNases b. restriction endonucleases e. gyrases c. ligases ANS: B DIF: Easy REF: 7.6 OBJ: 7.6b State the enzymatic activity, cellular role, and biotechnology applications of restriction endonucleases MSC: Analyzing 43. Agarose gel electrophoresis separates pieces of linear DNA based on a. size. d. degree of supercoiling. b. charge. e. extent of methylation. c. sequence.

ANS: A DIF: Easy REF: 7.6 OBJ: 7.6b State the enzymatic activity, cellular role, and biotechnology applications of restriction endonucleases MSC: Applying

44. The ability of cohesive ends of DNA from different organisms to ________ constitutes the basis of recombinant DNA technology. a. be methylated d. repel each other b. be specifically cut e. be sequenced c. form complementary base pairs ANS: C DIF: Easy REF: 7.6 OBJ: 7.6b State the enzymatic activity, cellular role, and biotechnology applications of restriction endonucleases MSC: Applying 45. In early cloning techniques, E. coli was ________ with the DNA of interest contained in a plasmid or phage vector. This cloned DNA could then be transferred to another organism using a ________. a. conjugated; contig b. conjugated; vector c. transformed; vector d. transformed; contig e. transformed; polymerase chain reaction ANS: C DIF: Medium REF: 7.6 OBJ: 7.6b State the enzymatic activity, cellular role, and biotechnology applications of restriction endonucleases MSC: Applying 46. Thermostable DNA polymerases are used in PCR because they a. bind DNA more efficiently than thermolabile DNA polymerases. b. do not have a proof-reading activity. c. are less expensive than E. coli DNA Pol III. d. can survive at the high temperatures used to denature DNA. e. are water soluble.

ANS: D DIF: Easy REF: 7.6 OBJ: 7.6b State the enzymatic activity, cellular role, and biotechnology applications of restriction endonucleases MSC: Applying 47. DNA sequencing by synthesis is a powerful contemporary technique that allows the generation of up to 600 gigabases (Gb) of sequence per run. Which process is part of sequencing by synthesis? a. The sequencing products are separated by polyacrylamide gel electrophoresis. b. [32P]-DNA fragments are developed using X-ray film or phosphoimaging. c. The release of pyrophosphate during the incorporation of dNTPs into a growing DNA chain is detected by a complex reaction system that emits light from oxyluciferin. d. About one thousand identical copies of each individual template DNA form a tight cluster (at the m-level) on the surface of a flow cell prior to sequencing. e. Whole large DNA molecules, such as plasmids or BACs, are used as templates.

ANS: D DIF: Difficult REF: 7.6 OBJ: 7.6b State the enzymatic activity, cellular role, and biotechnology applications of restriction endonucleases MSC: Applying 48. Many restriction enzymes recognize palindromic sequences on double-stranded DNA. Among the following, which is a palindromic sequence? a. 5'-GATTACCTAGG-3' d. 5'-CTAATGGATCC-3' 3'-CCTAGGTAATC-5' 3'-GATTACCTAGG-5' b. 5'-ATTACTTTA-3' e. 5'-GGATCC-3' 3'-TAATGAAAT-5' 3'-CCTAGG-5' c. 5'-GCCTAGGA-3'

3'-CGGATCCT-5' ANS: E DIF: Medium REF: 7.6 OBJ: 7.6b State the enzymatic activity, cellular role, and biotechnology applications of restriction endonucleases MSC: Understanding 49. Pieces of DNA that have been cut with restriction enzymes can anneal and then be covalently bonded using the enzyme a. DNA gyrase. d. RNA polymerase. b. DNA ligase. e. reverse transcriptase. c. DNA primase.

ANS: B DIF: Easy REF: 7.6 OBJ: 7.6b State the enzymatic activity, cellular role, and biotechnology applications of restriction endonucleases MSC: Applying 50. Which of the following are DNA chain–terminator molecules and were used in the original biochemical approach to DNA sequencing devised by Frederick Sanger in the 1970s? a. 2'-Deoxyribonucleotides b. 3'-Deoxyribonucleotides c. 2', 3'-Dideoxyribonucleotides d. 2'-Deoxyuridine and 2'-deoxyadenosine e. Uridine and adenosine ANS: C DIF: Medium REF: 7.6 OBJ: 7.6d Compare and contrast Sanger dideoxy sequencing and next-generation DNA sequencing MSC: Applying SHORT ANSWER 1. What is the main difference between structural genes and control sequences in bacteria? Cite examples for both.

ANS: A structural gene is a string of nucleotides that can be decoded by an enzyme to produce a functional RNA molecule. A structural gene usually produces an RNA molecule that in turn encodes a protein. A DNA control sequence regulates the expression of a structural gene. DNA control sequences do not encode RNA or protein.

DIF: Easy REF: 7.2 MSC: Understanding

OBJ: 7.2b Differentiate gene, operon, and regulon

2. What is horizontal gene transfer and how does it differ from vertical gene transfer? Is horizontal gene transfer limited to bacteria and archaea?

ANS: In vertical transfer, genetic information is passed from parents to progeny. In horizontal transfer, genetic information can move from one cell to another, not only in cells of the same species but across species. Horizontal (or lateral) gene transfer also occurs in plants and animals, although at a slower timescale, given the longer generational times of eukaryotic cells.

DIF: Medium REF: 7.1 OBJ: 7.2a List the ways genomes of prokaryotic species can differ from each other

MSC: Applying 3. Describe how the name of bacterial genes and their gene product are denoted.

ANS: Bacterial gene names usually consist of a three-letter abbreviation written in lowercase. The abbreviation of either the enzyme products name or a proteins function is used. The genes involved in tryptophan biosynthesis, for example, are referred to as trp genes. There is more than one gene, so they are referred to as trpA, trpB, and so on. The gene product is not italicized, and the first letter is capitalized. The product of the trpA gene is, therefore, TrpA. DIF: Medium REF: 7.1 OBJ: 7.2a List the ways genomes of prokaryotic species can differ from each other MSC: Applying 4. What are the similarities and differences between DNA and RNA? ANS: Similarities: They are both made of nucleotides held together by phosphodiester bonds. They both contain the nitrogenated bases adenine, guanine, and cytosine. Differences: DNA is synthesized as a double-strand helix; RNA is synthezised as a single-stranded molecule but some regions may acquire a double-stranded secondary structure. The sugar in RNA is ribose, whereas in DNA it is 2-deoxyribose; DNA has the nitrogenated base thymine; RNA has uracil.

DIF: Medium REF: 7.2 OBJ: 7.2c Compare and contrast the structure of DNA and RNA MSC: Applying 5. Refer to the figure below and describe the mechanism of action for type I topoisomerases.

ANS: Answers may vary, but basically should reflect the following: (1) A type I topoisomerase (e.g., E. coli topo I) cleaves one strand of a DNA double helix and grasps both ends of the break. (2) Using the intrinsic energy released by the break, the enzyme passes the intact strand through the break and relegates the cleaved strand. (3) As the double helix winds in the modified region, a negative supercoil is lost, thus relaxing a negative supercoiled DNA molecule.

DIF: Difficult REF: 7.2 OBJ: 7.2d Explain how bacterial chromosomes are compacted to fit into the cell MSC: Understanding 6. When gently released from an E. coli cell, the nucleoid was found to contain 30 to100 domain loops. How are these loops kept together, and what type of studies have demonstrated their independence?

ANS: Anchoring histone-like proteins determine the boundaries of the loops. Since the chromosome in E. coli is circular, the double helix within each loop remains supercoiled, albeit with different helical densities. Adding small amounts of a nuclease, single breakages (nicks) of the phosphodiester backbone can be introduced, relaxing a single loop.

DIF: Easy MSC: Applying

REF: 7.2

OBJ: 7.2b Differentiate gene, operon, and regulon

7. Use the figure below and describe the general mechanism of how supercoiling can be introduced in a double-stranded, circular DNA molecule. In this example, this DNA is about 300 bp.

ANS: An ATP-dependent topoisomerase II (e.g., gyrase) introduces double-strand break (1) while remaining covalently attached to the DNA open ends. The enzyme passes the intact DNA duplex through the break (2) and rejoins the cut strand (3), introducing a negative supercoil.

DIF: Medium REF: 7.2 OBJ: 7.2d Explain how bacterial chromosomes are compacted to fit into the cell MSC: Applying 8. The target of fluoroquinolone drugs is topoisomerase II. What is the mechanism of action of this antibiotic?

ANS: Fluoroquinolones do not block topoisomerase activity, per se, but rather stabilize the complex formed by the gyrase covalently bound to the DNA molecule. This complex establishes a physical barrier for the replication machinery, leading to the cells death.

DIF: Difficult REF: 7.3 OBJ: 7.3a Outline the mechanism and regulation of bacterial chromosome replication MSC: Applying 9. What determines the timing of DNA replication in Escherichia coli?

ANS:

DNA methylation, and thus the activities of proteins SeqA and DnaA, control the timing of replication. Initiation of replication is activated by the DnaA protein but inhibited by the SeqA protein. SeqA binds hemimethylated (newly replicated) origins and prevents another initiation event from starting too soon after replication. Once the new strand is methylated, the binding of SeqA decreases, allowing DnaA to bind. The replication initiator protein is DnaA. As the cell grows, the amount of DnaA rises and binds the origin. This increases melting of DNA at the oriC sequences, which initiates another replication cycle.

DIF: Difficult REF: 7.3 OBJ: 7.3b Identify the proteins involved in chromosome replication and separation MSC: Understanding 10. Describe the role of the two RNA polymerases that are involved in the early stages of bacterial DNA replication.

ANS: The first RNA polymerase is the so-called housekeeping RNA polymerase, which is responsible for most of the RNA synthesis in a cell. It transcribes a portion of the DNA at oriC to produce RNA that helps separate the two strands of DNA at the origin. The second RNA polymerase is called DNA primase (DnaG); this is the enzyme that synthesizes the short primers required for synthesis of Okazaki fragments.

DIF: Easy REF: 7.3 OBJ: 7.3b Identify the proteins involved in chromosome replication and separation MSC: Analyzing 11. Why is replication of the lagging DNA strand a problem, and how is this problem overcome?

ANS: DNA polymerase can only add nucleotides onto a 3-OH end of a growing DNA chain, so DNA must be synthesized in the 5-to-3 direction. The two strands of DNA are antiparallel; therefore, the leading strand can be easily replicated in the 5-to-3 direction toward the replication fork, but the lagging strand cannot be made in the 3-to-5 direction. The solution is to synthesize short discontinuous pieces of DNA called Okazaki fragments. The primase places a new RNA primer as the replication fork opens and the DNA polymerase can extend the primer by the addition of deoxyribonucleotides. As this process continues, the lagging strand ends up containing many short sections of RNA primer, which are removed by RNase H or DNA Pol I. The gap left by removal of the RNA primers is filled by DNA Pol I. DIF: Easy REF: 7.3 OBJ: 7.3a Outline the mechanism and regulation of bacterial chromosome replication MSC: Analyzing 12. Describe the functions of DNA Pol III. ANS: It is the main polymerizing enzyme for DNA replication, adding new nucleotides to the growing DNA chain and creating phosphodiester bonds. It has proofreading activity to find mispaired bases. It has exonuclease activity, which allows it to break phosphodiester bonds and remove mispaired bases.

DIF: Easy REF: 7.3 OBJ: 7.3b Identify the proteins involved in chromosome replication and separation

MSC: Analyzing 13. Use the figure below to describe the process of RNA primer elimination in the synthesis of the lagging strand. What are the names of the enzymes indicated by the numbers?

ANS: The lagging strand has RNA primers (closed rectangle) left behind after the DNA Pol III synthesizes the Okazaki fragments. Either RNase H, an enzyme specific to DNA-RNA hybrids (1) or DNA Pol I, with its 5' to 3' exonuclease activity, remove the RNA primers (open rectangle).

DNA Pol I (2) fills the gap left by the removal of the RNA primers by adding deoxyribonucleotides to the 3' end of the DNA lagging strand. A NAD-dependent DNA ligase (3) repairs the nick left by DNA Pol I, which cannot catalyze the joining of the newly synthesized DNA with the preexisting daughter strand, namely the Okazaki fragments.

DIF: Medium REF: 7.3 OBJ: 7.3b Identify the proteins involved in chromosome replication and separation MSC: Analyzing 14. In addition to primases and polymerases, name three other proteins required for initiation and elongation during replication. Describe their functions.

ANS: Any three of the following (except polymerase and primase) can be named: DnaA acts as an initiator of replication by recognizing the oriC sequence and melting DNA locally. DnaB, a helicase, is loaded onto the DNA via the action of DnaC, the helicase loader. Once loaded, the helicase recruits the primase. Once the DNA is opened and primed, the sliding clamp is loaded by the clamp loader. Two molecules of DNA Pol III are added at this time. The clamp loader loads these proteins and then the sliding clamp keeps the polymerase bound to the DNA. Once replication has been initiated, and in order to elongate, single-stranded binding proteins hold the single strands of DNA to prevent them from reannealing to each other. On the lagging strand, DNA ligase catalyzes the formation of the phosphodiester bond between the Okazaki fragments.

DIF: Medium

REF: 7.3

OBJ: 7.3b Identify the proteins involved in chromosome replication and separation MSC: Evaluating 15. How can plasmids ensure that they are passed on from one generation to the next?

ANS: Some plasmids are high-copy-number, meaning a cell may have 50–700 copies, and there is a high probability that both daughter cells will receive at least one copy. Low-copy-number plasmids may have partitioning systems to ensure both daughter cells receive copies. Some plasmids ensure their inheritance by carrying genes whose functions give the bacteria an advantage in certain environments, such as antibiotic resistance, and yet others rely on producing ―addiction modules,‖ ensuring that the bacterium retains the plasmids for its own survival.

DIF: Difficult REF: 7.4 OBJ: 7.4b Summarize the ways plasmids ensure inheritance

MSC: Analyzing

16. How are archaeal genomes and gene expression mechanisms similar to both bacterial and eukaryotic genomes?

ANS: Like bacteria, reproduction in archaea is primarily asexual. Archaea are true prokaryotes because their cells lack a nuclear membrane, but the structure of DNA-packing proteins, RNA polymerase, and ribosomal components more closely resemble those of eukaryotes.

DIF: Medium REF: 7.5 OBJ: 7.5a Compare and contrast the genomes, DNA replication enzymes, and RNA polymerases of bacteria, archaea, and eukaryotes MSC: Understanding 17. Describe three practical applications of the polymerase chain reaction (PCR) and possible pitfalls.

ANS: Answers will vary: One application is detecting the presence of a specific microbe, such as the pathogen E. coli O157:7 in a complex environment.

Forensic analysis of DNA in a crime scene may either contribute to a conviction or exonerate a suspect in a criminal case.

PCR-based DNA sequencing of individual human genomes is done as a standard medical test.

However, this has ethical implications and may bring about high hopes for discoveries and fears of misuse.

Human sequence information has been used in identifying specific types of tumors, contributing to predict the best drug to use for an individual patient.

DIF: Medium REF: 7.6 OBJ: 7.6c Outline the steps of PCR and state the purpose of PCR MSC: Applying 18. How does a restriction-modification system avoid the destruction of a bacteriums own genome while breaking down foreign DNA? ANS:

Bacterial cells have restriction enzymes that recognize specific sequences of DNA and make double-stranded breaks within these recognition sites. To prevent chopping its DNA into bits, a bacterial cell has a matching modification enzyme that will methylate the recognition sites for restriction enzymes they produce. The methylated DNA cannot be cleaved by these restriction enzymes. In all likelihood, a foreign bacterial DNA or bacteriophage will not have chemical modifications on their DNA similar to those of the host. The host cell does not destroy itself due to methylation, but any foreign DNA entering the cell that contains the specific recognition site and is not methylated will be cut by the restriction enzymes.

DIF: Difficult REF: 7.6 OBJ: 7.6b State the enzymatic activity, cellular role, and biotechnology applications of restriction endonucleases MSC: Evaluating 19. What is metagenomics? How have the methods of metagenomics allowed discovery of so many new species? How is it possible to know about these organisms without being able to grow them in a laboratory?

ANS: Metagenomics is the use of modern genomic techniques such as next-generation DNA sequencing to study microbial communities directly in their natural environments, without the need to culture the microbes in the laboratory. This is a breakthrough because it is estimated that at least 99% of microbial species cannot currently be cultivated in labs. The genes for 16S rRNA can be sequenced directly from environmental samples. This information can be used to determine how the unknown organisms are related to known species and to construct phylogenetic trees that include these organisms. Metagenomics can also be used to determine the metabolic capabilities of the unknown organisms.

DIF: Medium REF: 7.6 OBJ: 7.6e Define metagenomics and describe its applications

MSC: Evaluating

20. Cite three examples of the use of metagenomics in the advancement of our knowledge of microbiomes.

ANS: Answers may vary: One example is the discovery of new metabolic pathways established by members of a microbial community in which a product discarded by organisms in one species can be used by other members of the community.

Single-cell genomics (SCG) has led to the identification of the so-called ―microbial dark matter,‖ that is, undiscovered microbial groups in a microbiome and their particular genomes.

A particular example of SCG is the discovery of 20 major uncultured archaeal and bacterial lineages having the capacity for encoding 20,000 new hypothetical proteins and novel genes.

SCG has helped in identifying new candidate Bacteria and Archaea taxa at the level of phylum.

The discovery of Christensella minuta as the most highly inheritable microbe among identical twins and its more frequent presence in lean than obese subjects is an example.

DIF: Difficult REF: 7.6 OBJ: 7.6e Define metagenomics and describe its applications | 7.6f Decide what technique is best suited to answer a particular question MSC: Evaluating

CHAPTER 8: Transcription, Translation, and Bioinformatics MULTIPLE CHOICE

1. ________ RNA polymerase plus sigma factor together are called ________. a. Transcription; translation d. Core; holoenzyme b. Holoenzyme; core e. Ribosome; rRNA c. Translation; transcription ANS: D DIF: Easy REF: 8.1 OBJ: 8.1b Describe the structure and functions of the RNA polymerase holoenzyme components MSC: Remembering 2. The process of taking a DNA template and making a complementary RNA molecule is called a. transposition. d. translation. b. transertion. e. transcription. c. replication.

ANS: E DIF: Easy MSC: Remembering

REF: 8.1

OBJ: 8.1a Define transcription

3. The RpoD sigma-70 factor of E. coli recognizes promoters for a. stress-response genes. d. heat shock–induced genes. b. motility and chemotaxis genes. e. genes for nitrogen metabolism. c. ―housekeeping‖ genes.

ANS: C DIF: Medium REF: 8.1 OBJ: 8.1c Explain how sigma factors help control gene expression MSC: Remembering 4. Which of the following is NOT part of initiation of transcription? a. -10 and -35 sequences b. binding of RNA polymerase to the beginning of the gene c. melting of the helix d. binding of sigma factor to promoter followed by binding of core RNA polymerase e. base pairing of the first nucleotide of the RNA ANS: D DIF: Medium REF: 8.1 OBJ: 8.1b Describe the structure and functions of the RNA polymerase holoenzyme components MSC: Understanding 5. A consensus sequence of any genetic element is a. sequences that are rarely found in nature. b. the sequence with the most likely base (or bases) at each position. c. hairpins in RNA to slow down or stop transcription. d. sequences to which ribosomes bind. e. primer sequences used to initiate transcription.

ANS: B DIF: Easy REF: 8.2 OBJ: 8.2a Summarize what occurs in each of the three stages of transcription MSC: Applying 6. DNA-dependent ________ polymerase makes a copy of DNA that is then used for translation. The process carried out by this enzyme is called ________. a. RNA; transformation d. RNA; transcription b. protein; transcription e. protein; transposition c. DNA; transcription ANS: D

DIF: Easy

REF: 8.1

OBJ: 8.1a Define transcription

MSC: Remembering 7. A researcher is studying transcription and has added a chemical to a transcription experiment using both E. coli and mammalian cells. This chemical inhibits both systems. The chemical is most likely a. streptomycin. d. rifampin. b. rifamycin. e. actinomycin D. c. erythromycin.

ANS: E DIF: Medium REF: 8.2 OBJ: 8.2c Describe how antibiotics were used to probe RNA polymerase structure MSC: Analyzing 8. Molecules of sRNA do not encode proteins but are used to ________ the stability or translation of specific mRNAs into proteins. a. start d. speed up b. regulate e. slow down c. stop ANS: B DIF: Medium REF: 8.2 OBJ: 8.2b Recall the functions of the different RNA classes

MSC: Remembering

9. The average half-life for mRNA in a typical bacterium such as E. coli is a. 1–3 seconds. d. 1–3 hours. b. 10–30 seconds. e. 1–3 days. c. 1–3 minutes.

ANS: C DIF: Medium REF: 8.2 OBJ: 8.2d Explain how and why half-lives of RNA species vary within the cell MSC: Remembering 10. Which of the following is NOT true of initiation of transcription? a. The RNA polymerase holoenzyme binds. b. GTP hydrolysis catalyzes bubble formation. c. The promoter unwinds. d. The first rNTP is usually a purine. e. Position 1 marks the start of the gene.

ANS: B DIF: Difficult REF: 8.2 OBJ: 8.2a Summarize what occurs in each of the three stages of transcription MSC: Understanding 11. Using the genetic code shown below, find the correct start and stop codons. Which of the following peptides might this message code for?

5'-GAGUUAUGCACGGGUUCUAUGUGUAG-3' a. GLU-LEU-CYS-MET-GLY-SER-MET-CYS b. MET-GLY-SER-MET-CYS c. MET-HIS-GLY-PHE-TYR-VAL d. MET-CYS-ILE-LEU-GLY-THR-TYR e. ASP-VAL-TYR-LEU-GLY-TYR-VAL-LEU ANS: C DIF: Difficult REF: 8.3 OBJ: 8.3a Use the genetic code to translate an mRNA into protein MSC: Applying 12. In the absence of Rho, what can bring about transcription termination? a. stem and loop and stretches of uridines b. stem and loop only c. GC-rich region near the 3 terminus d. GC-rich region near the 3 terminus followed by four to eight uridines e. stem and loop followed by a GC-rich region ANS: D DIF: Medium REF: 8.2 OBJ: 8.2a Summarize what occurs in each of the three stages of transcription MSC: Understanding 13. Which drug intercalates into DNA and inhibits transcription in both prokaryotes and eukaryotes? a. streptomycin d. rifampin b. actinomycin D e. tetracycline c. chloramphenicol ANS: B DIF: Medium REF: 8.2 OBJ: 8.2c Describe how antibiotics were used to probe RNA polymerase structure MSC: Understanding

14. The figure below shows subunits of a structure in a bacterial cell. This structure is

a. a type I secretion system. b. RNA polymerase. c. a ribosome.

d. aminoacyl-tRNA synthetase. e. sigma factor and RNA polymerase.

ANS: C DIF: Easy REF: 8.3 OBJ: 8.3d Summarize what occurs during each of the three stages of translation MSC: Remembering 15. In the figure below, which label represents the Shine Delgarno site?

a. A b. B c. C

d. D e. –35

ANS: B DIF: Easy REF: 8.2 OBJ: 8.2a Summarize what occurs in each of the three stages of transcription MSC: Remembering 16. In the figure below, which label represents the promoter?

a. A b. B c. C

d. D e. –35

ANS: A DIF: Easy REF: 8.2 OBJ: 8.2a Summarize what occurs in each of the three stages of transcription MSC: Remembering 17. The unusual bases found in tRNA are poor substrates for a. proteases. d. ribozymes. b. polymerases. e. RNases. c. ribosomes.

ANS: E DIF: Easy REF: 8.3 OBJ: 8.2b Recall the functions of the different RNA classes

MSC: Remembering

18. Most tRNA molecules begin with a 5' ________ and all end with a 3' ________, to which the amino acids attach. a. phosphate; hydroxyl d. A; TTA b. C; GGA e. C; AAT

c. G; CCA ANS: C DIF: Medium REF: 8.3 OBJ: 8.3b Describe the structure and function of tRNAs

MSC: Remembering

19. During transcription of the ________ genes, normal, unmodified bases are incorporated, but specific enzymes modify some of these later. a. tRNA d. sRNA b. tmRNA e. catalytic RNA c. mRNA ANS: A DIF: Medium REF: 8.3 OBJ: 8.3c Explain how aminoacyl-tRNA synthetases charge tRNAs MSC: Remembering 20. Which of the following is normally read as a stop codon but encodes tryptophan in vertebrate mitochondria? a. AUG d. UGA b. UCA e. UAG c. UAC ANS: D DIF: Difficult REF: 8.3 OBJ: 8.3a Use the genetic code to translate an mRNA into protein MSC: Remembering 21. The charging of tRNAs is carried out by a set of enzymes called ________ synthetases. a. ribozymes d. proteases b. aminoacyl-tRNA e. polymerases c. peptidyl ANS: B DIF: Easy REF: 8.3 OBJ: 8.3c Explain how aminoacyl-tRNA synthetases charge tRNAs MSC: Remembering 22. Which of the following may serve as a molecular clock that measures the approximate time since two related species diverged? a. tRNA d. sRNA b. mRNA e. tmRNA c. rRNA ANS: C DIF: Easy REF: 8.3 OBJ: 8.3b Describe the structure and function of tRNAs

MSC: Remembering

23. After tmRNA releases an mRNA and aberrant polypeptide from a stuck ribosome, a. clpX tags the peptide for destruction. b. sspB tags the peptide for destruction. c. tmRNA then destroys the peptide. d. tmRNA ubiquitinates the peptide. e. sspB recognizes a proteolysis tag and delivers the peptide to clpX for degradation.

ANS: E DIF: Medium REF: 8.3 OBJ: 8.3f Outline how a bacterial cell deals with an mRNA lacking a stop codon MSC: Analyzing 24. A ________ mRNA is a single mRNA molecule that contains information from several contiguous genes.

a. cistronic b. transfer c. polygenic

d. ribosomal e. small

ANS: C DIF: Easy REF: 8.3 OBJ: 8.3d Summarize what occurs during each of the three stages of translation MSC: Remembering 25. Different ________ can bind simultaneously to the start of each gene within a polygenic mRNA. a. genes d. ribosomes b. proteins e. RNases c. polymerases ANS: D DIF: Easy REF: 8.3 OBJ: 8.3d Summarize what occurs during each of the three stages of translation MSC: Remembering 26. E. coli is being used to study various agents that inhibit protein synthesis. One agent binds the 23S rRNA of the 50S subunit and prevents peptide bond formation. No new proteins are produced. To which antibiotic is this agent likely related? a. chloramphenicol d. tetracycline b. streptomycin e. erythromycin c. puromycin ANS: A DIF: Medium REF: 8.3 OBJ: 8.3e List some antibiotics that poison translation

MSC: Analyzing

27. E. coli is being used in order to study various agents that inhibit protein synthesis. An agent will bind the 16S RNA of the 30S subunit and block aminoacyl tRNA from entering the ribosome. This agent is most likely related to a. chloramphenicol. d. tetracycline. b. streptomycin. e. erythromycin. c. puromycin.

ANS: D DIF: Medium REF: 8.3 OBJ: 8.3e List some antibiotics that poison translation

MSC: Analyzing

28. Which form of RNA has the task of unsticking stuck ribosomes? a. mRNA d. tmRNA b. rRNA e. tRNA c. sRNA ANS: D DIF: Easy REF: 8.3 OBJ: 8.2b Recall the functions of the different RNA classes

MSC: Remembering

29. Both codons and anticodons a. are part of tRNA. b. are sequences of DNA three nucleotides long. c. are identical RNA sequences. d. are complementary RNA sequences. e. interact with tmRNA in order to function.

ANS: D DIF: Easy REF: 8.3 OBJ: 8.3a Use the genetic code to translate an mRNA into protein MSC: Understanding

30. What does it mean to say that the genetic code is redundant? a. There is more than one kind of amino acid in proteins. b. More than one rRNA can bind to the ribosome at the same time. c. A codon is composed of more than one nucleotide. d. More than one codon can specify the same amino acid. e. All products of translation contain a certain minimum number of mistakes, called mutations.

ANS: D DIF: Easy REF: 8.3 OBJ: 8.3a Use the genetic code to translate an mRNA into protein MSC: Understanding 31. The importance of the stop codon UAG is that it a. tells the DNA polymerase to stop replicating the chromosome. b. tells the RNA polymerase to stop transcribing the chromosome. c. tells the tRNA to stop transcribing the DNA. d. tells the ribosome to stop translating the mRNA. e. signals the end of the operon.

ANS: D DIF: Medium REF: 8.3 OBJ: 8.3a Use the genetic code to translate an mRNA into protein MSC: Understanding 32. Which RNA species is a component of the 30S subunit of the ribosome? a. 5S RNA d. tRNA b. 16S RNA e. mRNA c. 23S RNA ANS: B DIF: Medium REF: 8.3 OBJ: 8.3b Describe the structure and function of tRNAs

MSC: Understanding

33. The significance of the Shine-Dalgarno sequence is that it is the site where a. RNA polymerase binds to begin transcription. b. a ribosome binds so that it can initiate translation. c. DNA polymerase binds to begin chromosome replication. d. the tRNA binds to the mRNA in translation. e. DNA polymerase begins synthesis of the Okazaki fragments on the lagging strand.

ANS: B DIF: Medium REF: 8.3 OBJ: 8.3d Summarize what occurs during each of the three stages of translation MSC: Understanding 34. The energy source utilized by the elongation factors EF-G and EF-Tu is a. proton motive force. d. phosphoenolpyruvate hydrolysis. b. ATP hydrolysis. e. No energy source is required. c. GTP hydrolysis.

ANS: C DIF: Medium REF: 8.3 OBJ: 8.3d Summarize what occurs during each of the three stages of translation MSC: Understanding 35. Which of the following are required for the termination of translation? a. sRNAs d. release factors b. degrons e. ubiquitins c. TolC proteins

ANS: D DIF: Easy REF: 8.3 OBJ: 8.3d Summarize what occurs during each of the three stages of translation MSC: Understanding 36. Resistance to the protein synthesis antibiotics can be carried out by all of the following EXCEPT a. the use of an acetyltransferase to destroy activity. b. immediate metabolization to gain ATP. c. efflux pumps to move it out of the cell. d. the use of phosphotransferases to chemically modify the antibiotic. e. mutations in genes for the bacterial target so antibiotics can no longer bind.

ANS: B DIF: Difficult REF: 8.3 OBJ: 8.3e List some antibiotics that poison translation

MSC: Understanding

37. The typical bacterial ribosome is composed of a. 16 RNAs and a variety of proteins. b. an 80S (30S  50S) component made of RNA and proteins. c. 80S subunits along with several RNAs and at least 50 proteins. d. two subunits made of three RNAs and at least 50 proteins. e. three subunits containing both RNA and proteins.

ANS: D DIF: Medium REF: 8.3 OBJ: 8.3a Use the genetic code to translate an mRNA into protein MSC: Applying 38. In the figure shown below, the RfaH protein is undergoing a change from ________ as a result of binding to ________.

a. b. c. d. e.

beta-sheet to alpha-helix; a promoter to initiate transcription alpha-helix to beta-sheet; a promoter to initiate translation beta-sheet to alpha-helix; RNAP and thus being able to bind ribosomal protein alpha-helix to beta-sheet; RNAP and thus being able to bind ribosomal protein beta-sheet to alpha-helix; RNAP to initiate translation

ANS: D DIF: Difficult REF: 8.Intro OBJ: 8.3d Summarize what occurs during each of the three stages of translation MSC: Analyzing 39. After ________, each polypeptide must be properly folded and placed at the correct cellular or extracellular location. a. replication d. degradation b. transcription e. conjugation c. translation

ANS: C DIF: Easy REF: 8.4 OBJ: 8.4a Recall some examples of post-translational protein processing MSC: Remembering 40. Post-translational modification to achieve function does NOT involve a. adenylation. d. removal of formylmethionine. b. phosphorylation. e. ubiquitination. c. acetylation.

ANS: E DIF: Medium REF: 8.4 OBJ: 8.4a Recall some examples of post-translational protein processing MSC: Understanding 41. Which of the following is NOT an example of a heat-shock protein? a. trigger factor d. Clp protease b. GroES e. DnaK c. GroEL ANS: D DIF: Medium REF: 8.4 OBJ: 8.4b Describe the structure and function of chaperone proteins MSC: Understanding 42. Increased levels of chaperones increase heat resistance of bacteria by a. destroying damaged proteins so the amino acids can be recycled. b. refolding proteins damaged by heat so they function again. c. secreting damaged proteins into the periplasm. d. labeling damaged proteins for destruction by clp proteases. e. adding N-formylmethionine to damaged proteins.

ANS: B DIF: Difficult REF: 8.4 OBJ: 8.4b Describe the structure and function of chaperone proteins MSC: Analyzing 43. Certain proteins in a bacterial cell are short-lived and are labeled with a leucine, phenylalanine, tryptophan, or tyrosine at the N-terminal end. These proteins are degraded by a. GroEL and GroES. d. Sec A. b. DnaK and DnaJ. e. ubiquitin. c. clpAP protease.

ANS: C DIF: Easy REF: 8.4 OBJ: 8.4c Identify the components involved in protein degradation and recall their roles in the process MSC: Understanding 44. Gram-negative microbes are surrounded by two layers of ________, between which lies ________. a. membrane; periplasm b. membrane; periplasmic space and lipopolysaccharide c. membrane; periplasmic space and peptidoglycan d. lipopolysaccharide; periplasmic space and peptidoglycan e. lipopolysaccharide; peptidoglycan ANS: C DIF: Easy REF: 8.5 OBJ: 8.5a List possible protein delivery locations in a bacterial cell MSC: Remembering 45. The general secretion complex known as the SecYEG translocon is found in the

a. nucleus. b. inner membrane. c. cell wall.

d. periplasmic space. e. outer membrane.

ANS: B DIF: Easy REF: 8.5 OBJ: 8.5b Describe the mechanisms that deliver proteins to the correct locations in a bacterial cell MSC: Remembering 46. The term ―________‖ is used to describe movement of a protein from one compartment to another. a. export d. transport b. import e. secretion c. translocation ANS: C DIF: Medium REF: 8.5 OBJ: 8.5b Describe the mechanisms that deliver proteins to the correct locations in a bacterial cell MSC: Remembering 47. SRP stands for ________, and it plays a role in ________. a. secretion recognition particle; refolding b. secretion ribosomal particle; refolding c. signal recognition particle; refolding d. secretion ribosomal particle; secretion e. signal recognition particle; secretion ANS: E DIF: Easy REF: 8.5 OBJ: 8.4b Describe the structure and function of chaperone proteins MSC: Remembering 48. The role of ExPortal in Streptococci is to a. serve as a secretion system and a chaperone. b. mark proteins for destruction. c. secrete proteins to the periplasm. d. anchor proteins in the cytoplasmic membrane. e. form –S-S- bonds needed for protein structure.

ANS: A DIF: Easy REF: 8.5 OBJ: 8.5b Describe the mechanisms that deliver proteins to the correct locations in a bacterial cell MSC: Understanding 49. Signal sequences are found where? a. in the 30S ribosomal subunit b. in the 50S ribosomal subunit c. at the N-terminal end of a protein

d. at the C-terminal end of a mRNA e. upstream of the promoter

ANS: C DIF: Medium REF: 8.5 OBJ: 8.5a List possible protein delivery locations in a bacterial cell MSC: Understanding 50. The figure below shows a diagram of a DNA and a process. This microorganism is a(n) ________, and the process being diagrammed is ________.

a. archaea; exon removal b. bacteria; splicing c. eukaryote; splicing

d. bacteria; exon removal e. eukaryote; exon removal

ANS: C DIF: Medium REF: 8.6 OBJ: 8.6a Explain why bioinformatics is a key tool for microbiologists MSC: Applying 51. Which of the following terms refers to an interdisciplinary field that uses computer programs to compare genes of different species? a. annotation d. sequence homology b. bioinformatics e. computer analysis c. open reading frames (ORFs) ANS: B DIF: Easy REF: 8.6 OBJ: 8.6a Explain why bioinformatics is a key tool for microbiologists MSC: Remembering 52. Genes that have arisen from a duplication within a species and have evolved to carry out different functions are referred to as a. homologs. d. homogenous. b. orthologs. e. synonymous. c. paralogs.

ANS: C DIF: Medium REF: 8.7 OBJ: 8.6c Distinguish among homologs, orthologs, and paralogs MSC: Remembering 53. How have bioinformatic approaches been helpful in designing growth media for intestinal bacteria such as Faecalibacterium prausnitzii? a. Genes encoding enzymes for fermentation and production of butyrate have been found. b. The genome is similar to other bacteria and thus the media for those other bacteria can now be used. c. Bioinformatics has indicated genes for metabolism of sugars that can now be added to the growth medium. d. Bioinformatics has revealed that this bacterium can make its own amino acids and thus they are not needed in the growth medium. e. Bioinformatics has revealed that biosynthetic genes for certain amino acids and vitamins are absent. Now these can be added to growth medium and the bacterium will grow.

ANS: E DIF: Medium REF: 8.6 OBJ: 8.6b Outline the annotation process; include how open reading frames (ORFs) are identified and assigned putative functions MSC: Evaluating

54. Beta-lactamases are proteins found in many bacteria that can degrade beta-lactam antibiotics such as ampicillin. Families of these proteins are coded by genes with similar sequences even though they are found in a variety of bacteria. These genes would be considered to be a. paralog. d. introns. b. orthologs. e. aligned sequences. c. open reading frames (ORFs).

ANS: B DIF: Easy REF: 8.6 OBJ: 8.6c Distinguish among homologs, orthologs, and paralogs MSC: Analyzing SHORT ANSWER 1. Describe how Marshal Nirenberg and Heinrich Matthaei utilized an E. coli cell lysate to figure out the genetic code.

ANS: Synthetic RNA molecules were synthesized and used in a cell-free lysate system. The synthetic RNAs were repeated sequences, for example, poly-U or poly-ACAC. The cell-free protein-synthesizing system synthesized polyphenylalanine from the poly-U template. Other templates were also used in order to which amino acids would be incorporated into a growing peptide chain.

DIF: Difficult REF: 8.3 OBJ: 8.3a Use the genetic code to translate an mRNA into protein MSC: Understanding 2. How do sigma factors in a bacterium such as E. coli regulate major physiological responses?

ANS: Any one species such as E. coli can make several different sigma factors that help RNA polymerase find the beginnings of different subsets of genes. One key sigma factor is rpoD or sigma 70. This sigma factor is involved in recognizing ―housekeeping‖ genes that are always needed. The different sigma factors help RNA polymerase recognize different classes of promoters and control genes involved in nitrogen metabolism, flagellar synthesis, heat, stress, starvation, sporulation, and other physiological responses. Organisms have protein sensors that monitor the environment. When necessary, they direct the cell to increase synthesis of the appropriate sigma factor. Accumulation of specialty sigma factors dislodge other sigma factors from RNA polymerase and redirect RNA polymerase to promoters for genes that can be used to solve the problem sensed by the protein sensors. The cell can control physiological responses by regulating when a specific sigma factor accumulates.

DIF: Difficult REF: 8.1 OBJ: 8.1c Explain how sigma factors help control gene expression MSC: Remembering 3. What are the functions of the different types of RNA molecules?

ANS:

mRNA encodes proteins. rRNA is a component of ribosomes. tRNA carries amino acids to the ribosome during translation. sRNA regulates the translation of mRNAs but does not code for tmRNA, has properties of tRNA and mRNA and unsticks ribosomes that are stuck thus freeing them for more protein synthesis. Catalytic RNA, also referred to as ribozymes, associates with some proteins to provide catalytic activity, an example being RNAse P. Catalytic RNA is also involved in some activity of the ribosome as well as in splicing.

DIF: Medium REF: 8.2 OBJ: 8.2b Recall the functions of the different RNA classes

MSC: Remembering

4. How does mRNA compare to the template and nontemplate DNA strand?

ANS: The mRNA is transcribed from the template strand. That means that the template strand is a reverse complement to the mRNA. The nontemplate strand, therefore, is identical to the mRNA, except that it contains Ts instead of Us. The nontemplate strand and the mRNA are both referred to as sense strands.

DIF: Medium REF: 8.2 OBJ: 8.2a Summarize what occurs in each of the three stages of transcription MSC: Understanding 5. Explain the process of transcription initiation.

ANS: RNA polymerase scans DNA for promoters by binding DNA loosely, then coming off. When RNA polymerase binds a promoter, the holoenzyme first forms a loosely bound closed complex with the DNA. The DNA unwinds a turn and becomes an open complex, to which RNA polymerase becomes tightly bound. RNA polymerase then begins complementary binding of ribonucleotides to the open DNA. DIF: Medium REF: 8.2 OBJ: 8.2a Summarize what occurs in each of the three stages of transcription MSC: Understanding 6. Explain the processes of Rho-dependent and Rho-independent termination of transcription.

ANS: Rho-dependent termination involves Rho binding to GC-rich regions after the translational stop on the mRNA. The mRNA wraps around Rho until Rho and RNA polymerase come into contact, causing termination of transcription.

As the name implies, Rho-independent termination does not involve Rho-protein. Instead, a region in the RNA after the translational stop contains a sequence that will base pair, forming a hairpin that is immediately followed by a poly-U sequence. A hairpin followed by a poly-U structure, behind the RNA pol, terminates transcription.

DIF: Medium REF: 8.2 OBJ: 8.2a Summarize what occurs in each of the three stages of transcription MSC: Understanding 7. Name two antibiotics that affect transcription and explain their mode of action.

ANS:

Rifamycin B inhibits transcription initiation by binding bacterial RNA polymerase and blocking RNA from leaving RNA polymerase. Actinomycin D intercalates between GC base pairs and mimics a DNA base, which blocks the elongation phase of transcription in both prokaryotes and eukaryotes. It is not selective for prokaryotes.

DIF: Medium REF: 8.2 OBJ: 8.2c Describe how antibiotics were used to probe RNA polymerase structure MSC: Understanding 8. Define ―half-life‖ in terms of mRNA. Biologically, why is it important that the half-life of mRNA be the shortest of the RNAs? What chemically leads to a longer half-life for tRNAs and rRNAs? ANS: The half-life of mRNA is the time it takes to degrade half of the molecules of a given mRNA. An mRNA should be present only when the product is necessary for the cell. You would not want it to be around for long periods. The tRNAs and rRNAs are the machinery necessary for translation, and they need to be maintained in the cell. They contain modified bases that are less susceptible to degradation by RNase.

DIF: Difficult REF: 8.2 OBJ: 8.2d Explain how and why half-lives of RNA species vary within the cell MSC: Applying 9. Where is the Shine-Dalgarno sequence located and what is it responsible for?

ANS: The Shine-Dalgarno sequence is found in the mRNA upstream of the translational start codon. It is a purine-rich consensus sequence that is complementary to the 3'-end of 16S rRNA in the 30S ribosomal subunit. This base pairing aligns the start codon precisely with the P-site in readiness for f-met tRNA binding.

DIF: Medium REF: 8.3 OBJ: 8.3d Summarize what occurs during each of the three stages of translation MSC: Remembering 10. Every mRNA has three possible reading frames. How does the ribosome find the correct reading frame?

ANS: Each mRNA has sequences upstream of the area that encodes the protein. This upstream leader RNA contains a purine-rich sequence located four to eight bases upstream of the start codon, called the ribosome-binding site. The sequence is complementary to a sequence at the 3' end of the 16S rRNA. Binding of mRNA to this sequence places the start codon in the ribosome P-site.

DIF: Medium REF: 8.3 OBJ: 8.3d Summarize what occurs during each of the three stages of translation MSC: Remembering 11. Since ribosomes do not translate to the end of the mRNA, what causes translation to end?

ANS:

A stop codon marks the end of the coding sequence. When a stop codon moves to the A-site, a release factor will enter the A-site and activate the peptidyl transferase, which cuts the bond holding the peptide to the tRNA in the P-site. An additional release factor and ribosome recycling factor help disassemble the ribosome.

DIF: Medium REF: 8.3 OBJ: 8.3d Summarize what occurs during each of the three stages of translation MSC: Remembering 12. Examine the DNA sequence shown below. How many possible reading frames does this piece of DNA have? Explain where they are. Which one can be used and how do you know?

5'-AGTCGATCGAACGGTCATCG-3' 3'-TCAGCTAGCTTGCCAGTAGC-5' ANS: There are six possible reading frames in this piece of DNA, three in each direction using one of the strands as a template. Codons are three bases wide and thus starting translation at each of the first three bases in the sequence will start a new reading frame. By the fourth base, the reading frame is back in frame with the first. Transcription does not start randomly and thus not all of the reading frames will be used for transcription. The reading frame that may be used is starting at the third base of the 5' end of the bottom strand as bolded below. This is the first base of a start codon, AUG in the mRNA. Credit may also be given for any alternate start codons a student may find.

5'-AGTCGATCGAACGGTCATCG-3' 3'-TCAGCTAGCTTGCCAGTAGC-5' DIF: Medium REF: 8.3 OBJ: 8.3a Use the genetic code to translate an mRNA into protein MSC: Analyzing 13. At times a ribosome may get stuck with an mRNA that has been damaged so that there is no stop codon. What happens to this ribosome to fix this problem?

ANS: A translation rescue molecule, tmRNA, is similar to a tRNA on one end. It carries an amino acid and enters the A-site, where a peptide bond forms between the stalled peptide and the amino acid on the tmRNA. Another part of the tmRNA is similar to mRNA and adds 10 amino acids, called a proteolysis tag, to the peptide. This tag has marked the peptide for destruction. The mRNA end of this tmRNA has displaced to old mRNA and has thus freed the ribosome.

DIF: Medium REF: 8.3 OBJ: 8.3f Outline how a bacterial cell deals with an mRNA lacking a stop codon MSC: Remembering 14. Name two antibiotics that affect translation and explain their modes of action.

ANS:

Possible answers include the following: Streptomycin binds to the A-site of the 30s subunit of the bacterial ribosome. It allows for mismatches in the codon and anti-codon, resulting in mistranslation. Tetracycline binds to the A-site and prevents aminoacyl-tRNA from binding to the A-site. Chloramphenicol binds to the 23s RNA of the 50s subunit, binding specifically to the peptidyl transferase portion and thus inhibiting peptide bond formation. Erythromycin binds to the exit channel of the 23s subunit of the 50s ribosome resulting in prevention of peptide bond formation. Other antibiotics include kasugamycin which prevent mRNA from binding to a ribosome, fusidic acid which targets EF-G and thus prevents translocation, or puromycin which has structural similarity to tRNA and thus can triack peptidyl transferase into activity without a tRNA bound.

DIF: Medium REF: 8.3 translation MSC: Understanding

OBJ: 8.3e List some antibiotics that poison

15. Where is fMet used as the N-terminal amino acid? What does that mean for the human immune response?

ANS: N-formylmethionine (fMet) is important during the course of an infection because fMet peptides are produced only by bacteria and mitochondria, not by archaea or by the cytoplasmic ribosomes of eukaryotes. Our white blood cells can detect low concentrations of fMet peptides (around 10–12 M) as a sign of invading bacteria or of necrotic (dying) host cells releasing mitochondria.

DIF: Difficult REF: 8.4 OBJ: 8.3d Summarize what occurs during each of the three stages of translation MSC: Remembering 16. Why is protein degradation necessary to maintain cellular health?

ANS: Many proteins are only needed at certain times. If they persisted in the cell, they would adversely affect the cell. Likewise, all proteins age over time and must be turned over to maintain adequate activity. Therefore, degradation regulates not only protein levels but which proteins are present at a given time. If a protein is damaged and becomes useless to the cell, it needs to be degraded. Its components may then be recycled in the cell.

DIF: Difficult REF: 8.4 OBJ: 8.4c Identify the components involved in protein degradation and recall their roles in the process MSC: Remembering 17. Explain how a type I secretion system works. Are the secreted proteins ever in periplasmic space?

ANS: A type I secretion system is comprised of an ABC transporter that couples to TolC. There are three components involved: an ATP-binding cassette, the ABC protein in the inner membrane, and periplasmic protein lashed to the inner membrane. They share the use of the channel protein, TolC, which keeps the protein that will be secreted from ever being inside the periplasmic space.

DIF: Medium REF: 8.5 OBJ: 8.5b Describe the mechanisms that deliver proteins to the correct locations in a bacterial cell MSC: Understanding

18. As a peptide is produced on a ribosome, describe two methods used to get the protein into its proper shape.

ANS: DnaJ and DnaK will bind and clamp down on the nascent protein and aid it in folding into its proper conformation. GroEL and GroES, on the other hand, form a stacked ring into which the protein can be placed. Cycles of ATP binding and hydrolysis cause conformational changes within the chamber that can reconfigure target proteins.

DIF: Easy REF: 8.4 OBJ: 8.4a Recall some examples of post-translational protein processing MSC: Understanding 19. How are folded and unfolded proteins moved from the cytoplasm to the periplasm?

ANS: The completed pre-secretion protein is then captured by a piloting protein called SecB, which unfolds the pre-secretion protein and delivers it to SecA, a protein peripherally associated with the membrane-spanning SecYEG translocon, which moves them into the periplasm where chaperones guide their folding. An alternative mechanism is the twin arginine translocase (TAT), which moves folded proteins from the cytoplasm to the periplasm. These proteins have a twin arginine motif sequence that is recognized by the TAT. Whereas Sec-dependent transport is ATP driven, the TAT system is powered by the proton motive force.

The SecB protein binds to unfolded proteins and brings them to the SecYEG translocon, which moves them into the periplasm where chaperones guide their folding. The twin arginine translocase (TAT) moves folded proteins from the cytoplasm to the periplasm. These proteins have a twin arginine motif sequence that is recognized by the TAT. Proton motive force supplies the energy for this.

DIF: Medium REF: 8.5 OBJ: 8.5b Describe the mechanisms that deliver proteins to the correct locations in a bacterial cell MSC: Remembering 20. A variety of online software tools are available to aid with analyzing DNA and protein sequences.

Name any three and explain what they can be used for.

ANS: Answers will vary. Any of the following are correct: 1) BLAST is used to compare a sequence of interest to other sequences or proteins in a sequence database. 2) Multiple sequence alignment, aligns sequences identified as homologous in a BLAST search. 3) KEGG is specific for biochemical pathways but can predict which pathways an organism has based on genes. 4) Motif search can search sequences for motifs such as ATP-binding motifs. 5) ExPASy contains many tools with a focus on its index of proteins. 6) Joint Genome Institute genome portal has compiled genome sequences of organisms including bacteria.

DIF: Medium REF: 8.6 OBJ: 8.6a Explain why bioinformatics is a key tool for microbiologists MSC: Understanding 21. What feature of eukaryotes makes annotation more difficult?

ANS:

Eukaryotic genes contain introns. Since there are few identifying sequences defining intron borders, sophisticated computer analysis is necessary. In prokaryotes, it is simpler to identify an ORF. DIF: Medium REF: 8.6 OBJ: 8.6b Outline the annotation process; include how open reading frames (ORFs) are identified and assigned putative functions MSC: Remembering 22. What does it mean to annotate a genome? Explain the goals.

ANS: Annotation is analogous to identifying separate sentences and words in an unknown language.

Annotating a DNA sequence is done with computers using the known rules of transcription and translation to identify the start and stop sites of potential genes. DNA sequences are then translated in silico to determine amino acid sequences. When a sequence appears to encode a protein, the DNA sequence is called an open reading frame (ORF).

DIF: Medium REF: 8.6 OBJ: 8.6b Outline the annotation process; include how open reading frames (ORFs) are identified and assigned putative functions MSC: Understanding

CHAPTER 9: Gene Transfer, Mutations, and Genome Evolution MULTIPLE CHOICE 1. Genomes are considered to be mosaic. Which of the following statements provides the LEAST support for this idea? a. E. coli can receive plasmids from other strains of Gram-negative bacteria. b. The archaeon Methanocaldococcus jannaschii has many proteins with sequence homology to proteins found in both bacteria and eukarya. c. Agrobacterium can transfer plasmids to plants. d. Genome sequencing and informatics has revealed a variety of homologous genes throughout the domains of life. e. Genes from Mesorhizobium loti have been found in other new species of Mesorhizobium.

ANS: A DIF: Difficult REF: 9.1 OBJ: 9.1a Explain how mosaic genomes develop

MSC: Applying

2. An example of vertical gene transfer is the a. development of many genetically diverse mesorhizobia via incorporation of a 500 kB segment from a mesorhizobium. b. uptake of beta-lactamase genes by Streptococcus pneumoniae. c. transfer of CRISPR spacers to daughter cells during cell division. d. transfer of a Ti plasmid from agrobacterium to a plant. e. transfer of conjugative plasmids from one strain to another.

ANS: C DIF: Medium REF: 9.1 OBJ: 9.1a Explain how mosaic genomes develop 3. Competence in Gram-positive organisms is induced by a. calcium and cold. b. electrical currents. c. competence factors made of peptides. d. presence of biofilm.

MSC: Applying

e. Competence is not induced in Gram-positive bacteria.

ANS: C DIF: Easy REF: 9.1 OBJ: 9.1b Define horizontal gene transfer and compare the three mechanisms that give rise to it MSC: Remembering 4. Consider a semipermeable membrane that allows molecules such as DNA and proteins to pass through to the other side. This membrane is not permeable to structures such as ribosomes, viruses, and cells. The following tubes are set up with membrane in between the two compartments in each tube.

Tube 1. Cells, both donors and recipients, on both sides of the membrane Tube 2. Bacteriophage on one side of the membrane and recipient cells on the other Tube 3. DNA on one side and recipient cells on the other side In which of these tubes would you see a genetic process, and what is the name of that process? a. Tube 1; conjugation d. Tube 3; transduction b. Tube 2; conjugation e. Tube 3; transformation c. Tube 3; conjugation ANS: E DIF: Difficult REF: 9.1 OBJ: 9.1b Define horizontal gene transfer and compare the three mechanisms that give rise to it MSC: Analyzing 5. Which of the following bacteria requires artificial assistance to become competent to take up DNA? a. Bacillus d. Neisseria b. E. coli e. Streptococcus c. Haemophilus ANS: B DIF: Easy REF: 9.1 OBJ: 9.1b Define horizontal gene transfer and compare the three mechanisms that give rise to it MSC: Remembering 6. In order to transfer, an F factor must have which of the following? a. oriV and its own DNA polymerase b. oriV and tra genes c. oriT and tra genes d. oriT and its own DNA polymerase e. oriT, tra genes, and its own DNA polymerase ANS: C DIF: Medium REF: 9.1 OBJ: 9.1b Define horizontal gene transfer and compare the three mechanisms that give rise to it MSC: Understanding 7. During conjugation, DNA pol ________ is used for replication beginning at ________. a. I; oriV d. II; oriT b. III; oriV e. III; oriT c. I; oriT ANS: E DIF: Difficult REF: 9.1 OBJ: 9.1b Define horizontal gene transfer and compare the three mechanisms that give rise to it MSC: Understanding 8. A derivative F plasmid that contains host DNA is called an ________ plasmid. a. F d. F'  b. F e. Hfr

c. F ANS: D DIF: Easy REF: 9.1 OBJ: 9.1b Define horizontal gene transfer and compare the three mechanisms that give rise to it MSC: Remembering 9. Agrobacterium can transfer DNA to ________ using its ________. a. E. coli; LINES d. plants; Ti plasmid b. E. coli; Ti plasmid e. plants; opines c. plants; LINES ANS: D DIF: Medium REF: 9.1 OBJ: 9.1b Define horizontal gene transfer and compare the three mechanisms that give rise to it MSC: Remembering 10. The process in which bacteriophages carry host DNA from one cell to another is known as a. conjugation. d. recombination. b. transformation. e. transduction. c. transposition.

ANS: E DIF: Easy REF: 9.1 OBJ: 9.1b Define horizontal gene transfer and compare the three mechanisms that give rise to it MSC: Remembering 11. Newly replicated, and consequently ________, DNA sequences are invisible to a restriction enzyme. a. mutated d. hemimethylated b. restricted e. single-stranded c. modified ANS: D DIF: Medium REF: 9.1 OBJ: 9.1c Describe the structure and function of DNA restriction and modification systems MSC: Remembering 12. In the figure shown below, the role of the –Me groups on the second sequence is that the methyl groups

a. b. c. d. e.

direct an enzyme to cut at those sequences. signal that the DNA is not foreign and thus it should not be cut. signal for a transposon to excise itself. signal for the sequence to be incorporated in CRISPR. serve as a sequence for specialized transduction.

ANS: B

DIF: Medium

REF: 9.1

OBJ: 9.1c Describe the structure and function of DNA restriction and modification systems MSC: Analyzing 13. A difference between type II restriction enzyme and type I or type III restriction enzymes is that a. type II enzymes require shorter recognition sequences. b. type II enzymes cut at the recognition sequence rather than elsewhere. c. type I and III cut palindromic sequences but type II does not. d. type I and III require different proteins for methylation and cutting. e. type II enzymes are found only in Gram-positive bacteria.

ANS: B DIF: Difficult REF: 9.1 OBJ: 9.1c Describe the structure and function of DNA restriction and modification systems MSC: Applying 14. The transformasome necessary for cell competency in Gram-positive bacteria is regulated using which of the following methods? a. an alternative sigma factor to transcribe the necessary genes b. a repressor protein to keep the genes turned off c. induction in the presence of fertility factors d. each gene has an attenuator e. use of a restriction-modification system ANS: A DIF: Medium REF: 9.1 OBJ: 9.1b Define horizontal gene transfer and compare the three mechanisms that give rise to it MSC: Understanding 15. During conjugation, the DNA passes through the ________, NOT the ________. a. membranes; pilus d. phage; pilus b. pilus; membranes e. F factor; phage c. pilus; phage ANS: A DIF: Medium REF: 9.1 OBJ: 9.1b Define horizontal gene transfer and compare the three mechanisms that give rise to it MSC: Understanding 16. The difference between generalized and specialized transduction is a. the size of the plasmids being moved. b. the size of the phages being used. c. that in generalized transduction, chromosomes are moved, whereas in specialized transduction, plasmids are moved. d. that in generalized transduction, any DNA can be moved, but with specialized transduction, only certain DNA near the phage site can be moved. e. There is no difference.

ANS: D DIF: Medium REF: 9.1 OBJ: 9.1b Define horizontal gene transfer and compare the three mechanisms that give rise to it MSC: Understanding 17. Bacteria have developed a ―Halt! Who goes there?‖ approach to gene exchange to prevent unrestricted incorporation of DNA into the cell. It is called ________ and ________. a. conjugation; recombination d. transduction; Hfr b. transformation; transposition e. mobilizable; F plasmid c. restriction; modification ANS: C

DIF: Easy

REF: 9.1

OBJ: 9.1c Describe the structure and function of DNA restriction and modification systems MSC: Understanding 18. The main components of CRISPR anatomy include a. methylation sites on palindromic sequences. b. int genes with att sites for homology. c. inverted repeats and genes encoding transposase. d. short direct repeats, spacers, and genes encoding cas proteins. e. cell surface receptors.

ANS: D DIF: Medium REF: 9.1 OBJ: 9.1d State the functions of the CRISPR system and explain how the system enacts these functions MSC: Understanding 19. CRISPR is considered an example of adaptive immunity in bacteria and archaea because it a. methylates host DNA and destroys invading DNA. b. requires host ―pac‖ sites in order to destroy invading DNA. c. minimizes damage from foreign DNA by using guide RNA similar to the invader and cas proteins to cleave the foreign DNA. d. prevents the production of cell surface receptors that allow phages to get into the cell. e. prevents archaeal DNA from infecting bacteria.

ANS: C DIF: Medium REF: 9.1 OBJ: 9.1d State the functions of the CRISPR system and explain how the systems enact these functions MSC: Applying 20. During generalized recombination, ________ proteins catalyze branch migration at crossovers called ________. a. RuvAB; Holliday junctions d. RecBCD; duplexes b. RuvAB; duplexes e. RecA; duplexes c. RecBCD; Holliday junctions ANS: A DIF: Medium REF: 9.2 OBJ: 9.2b Compare and contrast generalized recombination and site-specific recombination MSC: Understanding 21. Large regions of sequence homology are required when recombining DNA molecules by ________ recombination. a. general d. transposition b. site-specific e. reversion c. specialized ANS: A DIF: Easy REF: 9.2 OBJ: 9.2a Recall the possible fates of foreign DNA that enters a bacterial cell and factors that favor specific fates MSC: Remembering 22. In the figure below, which type(s) of mutation(s) is/are introducing frameshifts?

a. A and B b. C and D c. D and E

d. A, B, and C e. only D

ANS: B DIF: Medium REF: 9.3 OBJ: 9.3b Categorize different types of mutations

MSC: Analyzing

23. The reaction of cytosine, shown below, happens ________ and causes ________.

a. b. c. d. e.

spontaneously; pyrimidine dimers when irradiated; pyrimidine dimers when treated with acridine; pyrimidine dimers when irradiated; transition mutations spontaneously; transition mutations

ANS: E DIF: Medium REF: 9.3 OBJ: 9.3b Categorize different types of mutations 24. Phase variation is an example of a. conjugation. b. site-specific recombination. c. general recombination.

MSC: Analyzing

d. transposition. e. radiation resistance.

ANS: B DIF: Easy REF: 9.2 OBJ: 9.2b Compare and contrast generalized recombination and site-specific recombination MSC: Remembering 25. Which of the following mutagens does NOT cause point mutations? a. caffeine d. nitrites b. 5-bromouracil e. acridine dyes c. nitrosoguanidine ANS: E DIF: Medium REF: 9.3 OBJ: 9.3a Define mutation and explain how mutations arise

MSC: Remembering

26. Mutations that occur even in the absence of an added mutagen are known as ________ mutations. a. spontaneous d. nonsense b. silent e. frameshift c. missense ANS: A DIF: Easy REF: 9.3 OBJ: 9.3a Define mutation and explain how mutations arise

MSC: Remembering

27. Ames used his reversion test with Salmonella to screen compounds for a. virulence. d. antibiotics. b. pathogenicity. e. mutagenicity. c. toxicity.

ANS: E DIF: Easy REF: 9.3 OBJ: 9.3d Explain how the mutagenicity of a chemical is assessed with bacterial cultures MSC: Remembering 28. Knockout mutations can include ________ mutations and ________ mutations. a. gain of function; loss of function d. silent; nonsense b. gain of function; missense e. silent; missense c. frameshift; nonsense ANS: C DIF: Medium REF: 9.3 OBJ: 9.3b Categorize different types of mutations 29. Which of the following is NOT true of a pyrimidine dimer? a. It can be repaired by photoreactivation. b. The pyrimidines are base-paired one to another. c. It is produced by ultraviolet light. d. It blocks DNA replication.

MSC: Understanding

e. It blocks transcription.

ANS: B DIF: Medium REF: 9.3 OBJ: 9.3b Categorize different types of mutations

MSC: Understanding

30. Spontaneous mutations can be caused by a. tautomers having altered base pairings. b. acridine intercalating into DNA. c. UV causing pyrimidine dimers. d. 5-bromouracil. e. alkylating agents.

ANS: A DIF: Difficult REF: 9.3 OBJ: 9.3a Define mutation and explain how mutations arise

MSC: Understanding

31. In the figure shown below, the cause of the appearance of these bacterial colonies is ________ and is caused by ________.

a. b. c. d. e.

sectoring; liver homogenate pyrimidine dimers; ultraviolet light reversion mutations; rat liver homogenate frameshift mutations; high mutation rate sectoring; high mutation rate

ANS: E DIF: Medium REF: 9.3 OBJ: 9.3c Calculate mutation rate and mutation frequency

MSC: Understanding

32. Consider a culture of 1,000 cells. Each cell divides once to yield a total of 2,000 cells. A measurement of the mutation rate in this culture would be based on the total number of a. 2,000 cells. b. genes in the bacterium. c. generations, which in this case is one. d. cell divisions, which is 1,000. e. mutations found in that culture.

ANS: D DIF: Medium REF: 9.3 OBJ: 9.3c Calculate mutation rate and mutation frequency

MSC: Applying

33. Consider a culture of 10,000 cells that double to 20,000 cells. If measuring 100 mutations in the population, the mutation frequency would be a. 100 mutations / ~4,500 genes  0.022. b. 100 mutations / 1 generation  100.

c. 100 mutations / 20,000 cells  0.05. d. 100 mutations / 10,000 new cells  0.001. e. (100 / ~4,500 genes) / 10,000 new cells  0.0000022.

ANS: C DIF: Medium REF: 9.3 OBJ: 9.3c Calculate mutation rate and mutation frequency

MSC: Applying

34. The experiment outlined below is a/an ________ test. The role of the rat liver homogenate is to ________.

a. b. c. d. e.

pathogenicity; provide growth factors such as amino acids that the pathogen may require pathogenicity; chemically modify the test chemical Ames; control for spontaneous mutations Ames; provide growth factors such as amino acids that the pathogen may require Ames; chemically modify the test chemical

ANS: E DIF: Difficult REF: 9.3 OBJ: 9.3d Explain how the mutagenicity of a chemical is assessed with bacterial cultures MSC: Analyzing 35. After extensive DNA damage, special DNA polymerases are expressed that sacrifice replication ________ to rescue the damaged genome. a. initiation b. accuracy c. termination d. modification e. restriction

ANS: B DIF: Easy REF: 9.4 OBJ: 9.4a Compare DNA repair mechanisms, including mutations recognized, functions of proteins involved in repair, and accuracy of repair MSC: Remembering 36. Which of the following is the activator of the SOS response? a. RecA d. sulA b. LexA e. uvrA c. FtsZ ANS: A DIF: Medium REF: 9.4 OBJ: 9.4a Compare DNA repair mechanisms, including mutations recognized, functions of proteins involved in repair, and accuracy of repair MSC: Remembering 37. Numerous human genetic diseases are caused by mutations in homologs of bacterial a. transposons. d. polymerases. b. ligases. e. repair genes. c. integrases.

ANS: E DIF: Easy REF: 9.4 OBJ: 9.4a Compare DNA repair mechanisms, including mutations recognized, functions of proteins involved in repair, and accuracy of repair MSC: Remembering 38. Which of the following is NOT a feature of a transposon? a. ability to move around a genome b. presence of inverted repeats at each end c. the ability to transfer via a phage head d. genes coding for a transposase activity e. presence of antibiotic resistance genes ANS: C DIF: Medium REF: 9.5 OBJ: 9.5a Compare and contrast insertion sequences, transposons, and composite transposons MSC: Remembering 39. The process of moving a genetic element within or between DNA molecules is a. conjugation. d. transposition. b. transduction. e. reversion. c. transformation.

ANS: D DIF: Easy REF: 9.5 OBJ: 9.5a Compare and contrast insertion sequences, transposons, and composite transposons MSC: Remembering 40. Which of the following forms of transposition specifically describes the transfer of DNA from one cell to another? a. nonreplicative d. complex b. replicative e. conjugative c. composite ANS: E DIF: Easy REF: 9.5 OBJ: 9.5b Differentiate nonreplicative and replicative transposition MSC: Remembering 41. When a population is under threat, which of the following would spread? a. F plasmids d. conjugative transposons b. bacteriophage e. genome reductions

c. resistance plasmids ANS: D DIF: Medium REF: 9.5 OBJ: 9.5b Differentiate nonreplicative and replicative transposition MSC: Remembering 42. In the figure shown below, product A is the result of ________ and product B is the result of ________.

a. b. c. d. e.

vertical gene transfer; horizontal gene transfer nonreplicative transposition; replicative transposition nonhomologous recombination; homologous recombination missense mutation; nonsense mutation generalized transduction; specialized transduction

ANS: B DIF: Medium REF: 9.5 OBJ: 9.5b Differentiate nonreplicative and replicative transposition MSC: Analyzing 43. Approximately what percentage of the 4,288 open reading frames of E. coli have no known or annotated function? a. 10 d. 52 b. 14 e. 70 c. 24 ANS: C DIF: Difficult REF: 9.6 OBJ: 9.6a Recall the fundamental processes that contribute to genome restructuring MSC: Remembering 44. Approximately what percentage of the genome of E. coli O157:H7, which has been responsible for several outbreaks of food-borne disease, has been acquired from other species? a. 5 d. 40 b. 10 e. 50 c. 25 ANS: C DIF: Difficult REF: 9.6 OBJ: 9.6b Evaluate the evidence for horizontal gene transfer 45. Which of the following is NOT an example of a genomic island? a. pathogenicity islands in infectious organisms b. symbiosis islands in Mesorhizobium

MSC: Remembering

c. resistance islands in Staphylococcus d. transposition islands within bacteria e. metabolic islands within Salmonella ANS: D DIF: Difficult REF: 9.6 OBJ: 9.6a Recall the fundamental processes that contribute to genome restructuring MSC: Remembering 46. Which of the following is evidence of gene reduction? a. altered GC content d. genomic islands b. different codon usage e. transposons c. pseudogenes ANS: C DIF: Easy REF: 9.6 OBJ: 9.6c Describe how genome reduction occursMSC:

Remembering

47. Evolution toward pathogenicity may involve a. horizontal gene transfer. b. gene loss. c. gene acquisition. d. horizontal gene transfer and gene acquisition. e. horizontal gene transfer, gene loss, and gene acquisition.

ANS: E DIF: Medium REF: 9.6 OBJ: 9.6a Recall the fundamental processes that contribute to genome restructuring MSC: Understanding 48. Many infectious bacteria have regions of DNA coding for virulence factors. These regions are called a. transposases. d. F plasmids. b. pathogenicity islands. e. genome reductions. c. inverted repeats.

ANS: B DIF: Medium REF: 9.6 OBJ: 9.6b Evaluate the evidence for horizontal gene transfer

MSC: Understanding

49. The figure shown below diagrams a variety of genomic islands. What characteristics do these islands in the diagram share?

a. b. c. d. e.

They code for pathogenicity.

They are coded on transposons.

They have a GC content similar to the rest of the genome.

They encode type II secretion systems.

They have direct repeats and mostly insert near a tRNA gene.

ANS: E DIF: Medium REF: 9.6 OBJ: 9.6b Evaluate the evidence for horizontal gene transfer

MSC: Applying

50. Which of the following LEAST supports the idea of genome reduction? a. Pseudogenes found in some organisms are no longer expressed but have homology to functional genes in other species. b. Virulence factors are found on pathogenicity islands. c. Pathogenic shigellae lack major regions of genes that the closely related E. coli possesses. d. Bacteria no longer need ―pseudogenes‖ when growing in new environments. e. Over half of the genome of the obligate intracellular pathogen, Mycobacterium leprae, is composed of pseudogenes that are no longer needed.

ANS: B DIF: Difficult REF: 9.6 OBJ: 9.6c Describe how genome reduction occursMSC:

Evaluating

51. The following statements about superfamily proteins are true EXCEPT that a. ABC (ATP-binding cassette) transporters serve as an example. b. proteins with structural and functional similarity but low sequence homology may be considered superfamilies. c. superfamily proteins are encoded by genes found on superfamily islands. d. superfamily proteins are encoded by genes that have been duplicates and then mutated. e. proteins such as HSP70 that are found in all domains of life are examples.

ANS: C DIF: Difficult REF: 9.6 OBJ: 9.6d Explain how protein superfamilies form

MSC: Analyzing

52. Which of the following statements is LEAST supportive of the idea that genetic exchange between bacteria occurs in the human gastrointestinal tract? a. the high bacterial cell density in this environment b. the presence of mixed species and biofilms in this environment c. the presence of dead bacteria as a source of extracellular DNA for transformation d. the passage of antibiotic resistance genes from one bacterium to another within a patient e. the presence of pseudogenes in bacteria ANS: E DIF: Difficult REF: 9.6 OBJ: 9.6b Evaluate the evidence for horizontal gene transfer

MSC: Evaluating

SHORT ANSWER 1. Describe the process whereby DNA is transferred from Agrobacterium to plants.

ANS: First, phenolic compounds are released from wounds of damaged plants. These compounds then attract Agrobacterium. The bacteria migrate, attach, and subsequently transfer the Ti plasmid to plant cells. Eventually, they grow inside the resulting tumor and feed on opines produced by the plant.

DIF: Difficult REF: 9.1 OBJ: 9.1b Define horizontal gene transfer and compare the three mechanisms that give rise to it MSC: Analyzing 2. Describe the differences in the transformation process in Gram-positive and Gram-negative organisms.

ANS: Gram-positive organisms transform DNA using a transformasome complex in which the transformasome spans the cell envelope. The transformasome is composed of a binding protein to capture DNA in the environment and proteins that form a pore for uptake of the DNA. Gram-negative species transform without DNA competence factors. Gram-negative cells are either always competent or become competent when starved. Gram-negative cells use a type IV pilus assembly for transformation.

DIF: Difficult REF: 9.1 OBJ: 9.1b Define horizontal gene transfer and compare the three mechanisms that give rise to it MSC: Understanding 3. Is an Hfr cell also considered to be F? Why or why not?

ANS: An Hfr cell has the F plasmid integrated into the chromosome, which gives it the ability to transfer large portions of its chromosome to a recipient cell. In E. coli it takes approximately 100 minutes to transfer the entire chromosome. Since it takes so long, the integrated F factor is not usually transferred before the conjugation bridge breaks. The F factor is the last part of the Hfr chromosome that would be transferred to a recipient, so the recipient rarely becomes F since the mating pair usually breaks apart before the F factor is transferred.

DIF: Medium REF: 9.1 OBJ: 9.1b Define horizontal gene transfer and compare the three mechanisms that give rise to it MSC: Understanding 4. Phages that carry host DNA are called transducing particles. Describe how the Salmonella P22 phage accidentally packages host DNA. ANS: The Salmonella P22 phage replicates via the rolling-circle method, generating concatemers of its genome. A specific pac sequence identifies the ends of the genome, marking where the P22 DNA is to be cut for packaging. There are, however, sequences within the Salmonella genome that look like pac sites, so some host sequences mistakenly get packaged into P22 phage capsids. One percent of the phage population becomes these so-called transducing particles.

DIF: Medium REF: 9.1 OBJ: 9.1b Define horizontal gene transfer and compare the three mechanisms that give rise to it MSC: Understanding 5. CRISPR is viewed as the adaptive immune system of bacteria, yet restriction/modification systems also play roles in bacterial defense. Compare and contrast how both systems protect the host.

ANS: Restriction/modification systems are used to determine if any new DNA in the cell is foreign or safe. It does so by examining methylation patterns. DNA without the correct methylation pattern will be cut by restriction enzymes and destroyed. It represents a first line of defense against any invading DNA. Restriction/modification does allow for some beneficial DNA exchange, however.

CRIPSR will incorporate a piece of viral (or other) DNA as a spacer. A guide RNA is then produced that will, along with Cas proteins, bind to any homologous sequence of DNA and destroy it. Thus, CRISPR is providing immunity that is specific and adaptive.

DIF: Medium REF: 9.1 OBJ: 9.1c Describe the structure and function of DNA restriction and modification systems | 9.1d State the functions of the CRISPR system and explain how the system enacts these functions MSC: Analyzing 6. Why does a genetic experiment using recombination generally involve screening hundreds of millions of cells to find a few recombinants that form visible colonies?

ANS: The whole process of recombination is very random and typically of low efficiency. A bacterium first has to receive the appropriate piece of DNA, and then it must recombine the right portion of it to reap any benefit.

DIF: Difficult REF: 9.2 OBJ: 9.2a Recall the possible fates of foreign DNA that enters a bacterial cell and factors that

favor specific fates

MSC: Understanding

7. Compare and contrast general and site-specific recombination.

ANS: New pieces of DNA entering a cell, or DNA damaged by cellular and environmental processes, can be recombined into the genome (or repaired) in several ways. Generalized recombination can recombine many molecules of DNA anywhere in the genome, damaged or not, as long as they have considerable stretches of homology. It plays a role in the ―self-improvement‖ of the organism. On the other hand, site-specific recombination occurs at short specific sites that may have little homology but are specific. They do require a specific recombination enzyme for that particular spot in the DNA, rather than using general enzymes. They can contribute to survival by switching from one phenotype to another.

DIF: Medium REF: 9.2 OBJ: 9.2a Recall the possible fates of foreign DNA that enters a bacterial cell and factors that favor specific fates MSC: Analyzing 8. Distinguish between generalized and specialized transduction.

ANS: Both types of transduction use bacteriophage (phage) particles to move DNA from one strain of bacteria to another. Generalized transduction involves phage particles that make mistakes naturally as they package DNA. Thus, some low number of particles package DNA from anywhere in the genome. After lysis and release, the phage particles can invade another cell and transfer the packaged DNA. This process is nonspecific, as any DNA can be packaged. Specialized transduction, on the other hand, involves a prophage that is inserted at very specific areas of the chromosome. An example of this is lambda. The viral DNA inserts into the chromosome and exists as that prophage until it is perturbed in some way. When triggered, this prophage will be excised and start replicating and then packaging. When DNA is packaged, DNA from near the insertion site may also be packed as the packaging makes mistakes. Thus, the packaging is specific for DNA near the prophage insertion site.

DIF: Medium REF: 9.2 OBJ: 9.2a Recall the possible fates of foreign DNA that enters a bacterial cell and factors that favor specific fates MSC: Analyzing 9. Site-specific recombination is RecA independent and requires very short regions of homology between donor and target DNA. Describe an example in either E. coli or Salmonella.

ANS: The phage lambda system in E. coli involves site-specific recombination at the att sites within the phage and host chromosome. Lambda integrase is responsible for the recombinational event.

Salmonella undergoes phase variation by flipping a DNA cassette on its genome to change its flagellar type and evade the host immune response.

DIF: Difficult REF: 9.2 OBJ: 9.2b Compare and contrast generalized recombination and site-specific recombination MSC: Understanding 10. Describe the purpose of an Ames revision test and how it is performed.

ANS:

The Ames test can be used as a rapid initial screen to determine whether a substance is a possible carcinogen. This test uses a mutant of Salmonella enterica that is deficient in histidine biosynthesis, so it cannot grow on media that do not contain histidine. If a reversion mutation occurs in the his gene and restores the gene’s function, the organism will be able to grow on media without histidine. The concept behind the test is that if a chemical is able to mutate the his gene and cause a reversion mutation, then that chemical has the potential to affect any gene and cause mutations.

DIF: Medium REF: 9.3 OBJ: 9.3d Explain how the mutagenicity of a chemical is assessed with bacterial cultures MSC: Remembering 11. Why did Ames modify the test to incorporate treatment of the potential mutagen with rat liver extract?

ANS: The Ames test is used to determine if a compound is mutagenic. A Salmonella strain with a mutation resulting in a requirement for histidine in the growth medium is used. The strain is spread on a plate that does not contain histidine, and a disk that has been soaked in the compound of interest is placed on the plate surface. After a period of incubation, one looks for the appearance of colonies. These colonies arise when a mutation has alleviated the cell’s need for histidine in the growth medium. An increased number of colonies around the disk implies that the compound is a mutagen.

The human liver is the organ responsible for detoxification. Occasionally, it accidentally produces a mutagen enzymatically from a nonmutagenic compound. Treating a test compound with liver extracts during the Ames test mimics what might happen in our bodies.

DIF: Difficult REF: 9.3 OBJ: 9.3d Explain how the mutagenicity of a chemical is assessed with bacterial cultures MSC: Remembering 12. Describe a frameshift mutation in terms of insertions and deletions. Does an insertion always result in a frameshift mutation? Will an insertion always render the gene product nonfunctional?

ANS: The ribosome reads the message one codon at a time. If an insertion or deletion of nucleotides that is not a multiple of three occurs, a frameshift mutation will result. An insertion will always cause a frameshift unless the number of nucleotides inserted is a multiple of three. If an insertion did not cause a frameshift, it may or may not alter the activity of the gene product. This will depend on whether it disrupted the normal structure or function of the product.

DIF: Difficult REF: 9.3 MSC: Understanding

OBJ: 9.3b Categorize different types of mutations

13. Describe four of the informational classes of mutations.

ANS: Any four of the following are acceptable: Silent mutation—does not change the amino acid sequence of the protein Missense mutation—changes the amino acid sequence of the protein Loss-of-function mutation—decreases or eliminates the activity of a protein Gain-of-function mutation—causes new protein activity Nonsense mutation—changes an amino acid codon into a translation termination codon, which results in a truncated protein or knockout mutation that eliminates protein function completely

Frameshift mutation—alters the reading frame, which changes every codon from the point of the mutation; caused by insertions and deletions DIF: Medium MSC: Applying

REF: 9.3

OBJ: 9.3b Categorize different types of mutations

14. Describe four of the error-proof DNA repair mechanisms.

ANS: Any four of the following are acceptable: Methyl mismatch repair—Mut enzymes use methylation of parental strain to determine which strand is newly replicated and likely contains the mutation Photoreactivation—light-activated photolyase enzyme cleaves cyclobutane ring of pyrimidine dimers Nucleotide excision—Uvr enzymes excise a single-stranded section of damaged DNA, which is then filled by DNA polymerase I Base excision repair snips damaged bases from DNA—glycosylase enzymes cut damaged bases from the phosphodiester backbone, which results in an AP site; AP nucleases remove the damaged area, then DNA polymerase I synthesizes replacement strand Recombination repair—RecA and Uvr enzymes use the good DNA strand to replace a homologous damaged strand at a replication fork DIF: Medium REF: 9.4 OBJ: 9.4a Compare DNA repair mechanisms, including mutations recognized, functions of proteins involved in repair, and accuracy of repair MSC: Understanding 15. What is transcription-coupled repair and why is it important for the cell?

ANS: Transcriptionally active genes that are damaged need to be repaired. A cell unable to transcribe a gene due to recent DNA damage will be at an extreme disadvantage. The nucleotide excision repair mechanism is used. A protein recognizes a stalled RNA pol and UvrAB is hijacked to begin the repair process.

DIF: Difficult REF: 9.4 OBJ: 9.4a Compare DNA repair mechanisms, including mutations recognized, functions of proteins involved in repair, and accuracy of repair MSC: Understanding 16. Why is SOS repair considered to be an error-prone repair mechanism? Why would an organism use an error-prone mechanism?

ANS: SOS repair occurs after extensive DNA damage. RecA cleavage of LexA repressor allows production of DNA repair enzymes, including two error-prone DNA polymerases IV and V. They are error-prone because they lack proofreading activity. When they encounter an area of DNA damage, they will insert any available nucleotide in the damaged area. This leads to mutations, but gives the cell a chance to survive if the mutations are not lethal. This is a last, desperate effort to save the cell; it either must mutate or die.

DIF: Medium REF: 9.4 OBJ: 9.4a Compare DNA repair mechanisms, including mutations recognized, functions of proteins involved in repair, and accuracy of repair MSC: Understanding 17. What are the differences between replicative and nonreplicative transposition?

ANS: In nonreplicative transposition, the transposable element excises itself from one DNA molecule and integrates into another. In replicative transposition, the transposable element copies itself so a new DNA molecule has a copy and the original host also retains its copy.

DIF: Medium REF: 9.5 OBJ: 9.5b Differentiate nonreplicative and replicative transposition MSC: Remembering 18. Outline any three characteristics of the human gastrointestinal tract that makes it an ideal environment for genetic exchange.

ANS: Any of the following are acceptable: The gut has a high cell density, providing a large number of cells (live and dead) as sources of DNA for both conjugation and transformation, and for the opportunity for exchange.

The gut has high species diversity, including anaerobes, with high genetic diversity, allowing for exchanges in novel, diverse ways.

The gut has a high number of phages that can contribute to the exchange of DNA. The human diet may provide new and novel bacteria on a regular basis, allowing for changes in the populations present. Changes in diet further change the population via selection based on available nutrients.

The gut microbiota also possess a large number of antibiotic resistance genes that can be transferred and selected for when a patient is on such antibiotics.

DIF: Medium REF: 9.6 OBJ: 9.6a Recall the fundamental processes that contribute to genome restructuring MSC: Understanding 19. Define a pseudogene and what it is thought to represent.

ANS: A pseudogene is a gene that is somewhat homologous to a gene encoding a functional enzyme, but portions are missing, so the enzyme is nonfunctional. It is thought that at one time both the gene and pseudogene were needed, but once the pseudogene was no longer being selected, it no longer was imperative to repair it. It is seemingly in the process of being eliminated now that it is no longer necessary to the cell’s survival.

DIF: Medium REF: 9.6 OBJ: 9.6a Recall the fundamental processes that contribute to genome restructuring MSC: Remembering 20. Describe two processes that may happen during the evolution toward pathogenicity.

ANS: First, bacteria may gain pathogenicity islands of genes that code for virulence factors. Acquiring these genes would make the bacterium more pathogenic. Second, as a bacterium evolves as a pathogen, it may lose genes that it no longer needs in this particular host environment.

DIF: Medium REF: 9.6 OBJ: 9.6b Evaluate the evidence for horizontal gene transfer

CHAPTER 10: Molecular Regulation

MSC: Understanding

MULTIPLE CHOICE 1. ________ prevent transcription, whereas ________ stimulate transcription. a. Activators; repressors d. Regulators; repressors b. Inducers; corepressors e. Repressors; activators c. Corepressors; inducers ANS: E DIF: Easy REF: 10.2 OBJ: 10.2b Define an operon and explain why it assists gene regulation MSC: Remembering 2. A transmembrane sensor kinase protein senses an environmental condition outside ________ bacteria or in the periplasm of a(n) ________ bacteria. a. Gram-positive; Gram-negative d. prokaryotic; archaean b. Gram-negative; Gram-positive e. Gram-positive; acid-fast c. prokaryotic; eukaryotic ANS: A DIF: Easy REF: 10.1 OBJ: 10.1c Describe the mechanisms cells use to sense and respond to conditions within the cell and outside the cell membrane MSC: Remembering 3. Which form of control is the LEAST reversible and MOST drastic? a. posttranslational control d. translational control b. control of transcription e. mRNA stability c. alterations of DNA sequence ANS: C DIF: Easy REF: 10.1 OBJ: 10.1a Recall the various ways gene expression can be controlled, and assess the advantages and disadvantages of each MSC: Remembering 4. In some, but not all, instances, ________ molecules bind RNA transcripts and help or hinder degradation. a. tsRNA d. sRNA b. rRNA e. mRNA c. tRNA ANS: D DIF: Easy REF: 10.1 OBJ: 10.1a Recall the various ways gene expression can be controlled, and assess the advantages and disadvantages of each MSC: Remembering 5. A feature common to all control mechanisms is a. quorum sensing. b. phosphorylation cascades. c. the ability to sense that something inside or around the cell has changed. d. housekeeping enzymes. e. increased or decreased gene expression.

ANS: C DIF: Medium REF: 10.1 OBJ: 10.1a Recall the various ways gene expression can be controlled, and assess the advantages and disadvantages of each MSC: Understanding 6. In a two-component signal transduction system, a ________ is transferred from a sensor kinase to a ________ in response to an environmental signal. a. phosphate; sensor domain

b. c. d. e.

phosphate; sensor phosphatase phosphate; response regulator magnesium; sensor domain magnesium; response regulator

ANS: C DIF: Medium REF: 10.1 OBJ: 10.1c Describe the mechanisms cells use to sense and respond to conditions within the cell and outside the cell membrane MSC: Understanding 7. The figure below shows a regulatory being produced on the left. Based on the information in the figure, this protein must function in which of the following ways?

a. When glucose binds to it, the protein binds to the regulatory sequence and prevents transcription of the target gene. b. This protein must influence a hairpin sequence and thus fine tunes the operon. c. In the presence of the end product of the operon, this protein will bind to the regulatory region and acts as an activator. d. When a ligand is or is not bound, this protein may act as either an activator or repressor. e. This protein would not have an effect on transcription of the target gene.

ANS: D DIF: Difficult REF: 10.2 OBJ: 10.2b Define an operon and explain why it assists gene regulation MSC: Applying 8. One benefit of operons in bacteria is that they a. allow for alterations in DNA sequence by flipping promoters around. b. allow for coordinated gene expression of related genes on one mRNA controlled by one promoter. c. do not need ligands and regulatory proteins as single genes would. d. do not need any modification of the proteins after they are expressed. e. allow for the bacteria to utilize a wide variety of carbon sources.

ANS: B DIF: Medium REF: 10.2 OBJ: 10.2b Define an operon and explain why it assists gene regulation MSC: Applying 9. If a cell always needs a gene for housekeeping purposes, it is a. constitutive. d. derepressible. b. inducible. e. promotable. c. repressible.

ANS: A DIF: Easy REF: 10.2 OBJ: 10.2a Propose why some genes have regulated expression but others have constitutive expression MSC: Remembering

10. Which of the following is the favored carbon source of Escherichia coli? a. lactose d. glucose b. galactose e. fructose c. sucrose ANS: D DIF: Easy REF: 10.2 OBJ: 10.2c Summarize the mechanisms by which lactose and glucose control the transcription of the lac operon MSC: Remembering 11. Finding an inverted repeated sequence within 100–200 bases of a promoter suggests the presence of a ________ binding site. a. DNA d. ribosome b. transcriptional regulator e. corepressor c. RNA ANS: B DIF: Easy REF: 10.2 OBJ: 10.2a Propose why some genes have regulated expression but others have constitutive expression MSC: Remembering 12. How many of the gene products of the lactose operon are required for the utilization of lactose to occur? a. none d. three b. one e. four c. two ANS: C DIF: Easy REF: 10.2 OBJ: 10.2c Summarize the mechanisms by which lactose and glucose control the transcription of the lac operon MSC: Understanding 13. A bacterial growth curve is presented below. The curve represents ________ growth, which is caused by the ________.

a. b. c. d. e.

binary; addition of more growth media after the fulture reaches stationary phase diauxic; addition of more growth media after the fulture reaches stationary phase binary; addition of a needed vitamin after it runs out diauxic; addition of a needed vitamin after it runs out diauxic; growth on two carbon sources resulting in a lag after the preferred substrate is depleted; new genes are then induced and growth resumes

ANS: E DIF: Medium REF: 10.2 OBJ: 10.2c Summarize the mechanisms by which lactose and glucose control the transcription of the lac operon MSC: Analyzing

14. When an inducer is added to a medium containing an organism with a metabolic pathway controlled by a repressor, the inducer then a. combines with the repressor and activates the repressor. b. combines with the repressor and inactivates the repressor. c. combines with the substrate and blocks induction. d. combines with the substrate and activates induction. e. does not combine with, but functions as a chaperone molecule for, the enzyme-substrate complex.

ANS: B DIF: Medium REF: 10.2 OBJ: 10.2d Compare and contrast the LacI repressor protein to the AraC/XylS family regulators and the TrpR repressor MSC: Understanding 15. When both glucose and lactose are added to the growth medium, Escherichia coli will have a growth curve that a. does not change. b. grows slowly and then, halfway through, grows faster. c. grows, levels off, and then grows again. d. grows more slowly than with glucose alone. e. grows more quickly than with glucose alone.

ANS: C DIF: Medium REF: 10.2 OBJ: 10.2c Summarize the mechanisms by which lactose and glucose control the transcription of the lac operon MSC: Understanding 16. All of the following typically occur in the presence of high glucose and high lactose concentrations EXCEPT a. enzyme II glucose is unphosphorylated. b. cAMP concentrations are low. c. C-reactive protein levels in the cell are low. d. inhibition of LacY activity. e. lactose is kept out of the cell.

ANS: C DIF: Difficult REF: 10.2 OBJ: 10.2c Summarize the mechanisms by which lactose and glucose control the transcription of the lac operon MSC: Understanding 17. As diagrammed below, some amino acid biosynthetic operons have stem loop structures in the mRNA. These structures play a role in the regulation of the operon by which of the following mechanisms?

a. The leader sequence shown contains codons for the amino acid. When these are low, the

b. c. d.

e.

ribosome stalls, allowing a hairpin between the two middle regions to form so that the rest of the message can be translated.

A repressor protein made of that amino acid will bind to the region and prevent translation when large amounts of the amino acid are present.

In the presence of large amounts of the amino acid, the hairpin will wind around the amino acid and prevent further translation.

The uridine-rich region has codons for that amino acid; when present, this region will be a terminator region. The hairpins allow for an RNA to bind that then allows translation to occur.

Catabolite repressor protein can bind and prevent the hairpins from forming, thus allowing translation to occur.

ANS: A DIF: Difficult REF: 10.2 OBJ: 10.2d Compare and contrast the LacI repressor protein to the AraC/XylS family regulators and the TrpR repressor MSC: Analyzing 18. Binding of tryptophan to the ________ makes a holorepressor. a. aporepressor d. inducer b. corepressor e. activator c. repressor ANS: A DIF: Easy REF: 10.2 OBJ: 10.2d Compare and contrast the LacI repressor protein to the AraC/XylS family regulators and the TrpR repressor MSC: Remembering 19. The araBAD and araC genes are transcribed in the ________ direction with respect to each other. a. same d. left b. opposite e. right c. forward ANS: B DIF: Easy REF: 10.2 OBJ: 10.2d Compare and contrast the LacI repressor protein to the AraC/XylS family regulators and the TrpR repressor MSC: Remembering 20. Transcriptional attenuation is a common regulatory strategy used to control many operons that code for a. amino acid degradation. d. carbohydrate biosynthesis. b. amino acid biosynthesis. e. lipid degradation. c. carbohydrate degradation.

ANS: B DIF: Easy REF: 10.2 OBJ: 10.2e Use the tryptophan operon to explain the regulation of transcriptional attenuation MSC: Remembering 21. The stringent response relies on the production of a. pG. d. pGp. b. ppG. e. ppGpp. c. pppG. ANS: E DIF: Difficult REF: 10.2 OBJ: 10.2f Describe the stringent response, including its function, how it is triggered, and how it is enacted MSC: Remembering 22. How does the AraC regulatory protein turn on transcription in the presence of arabinose? a. With the addition of arabinose, AraC no longer dimerizes and will form a large loop by

b. c. d. e.

binding to araO and aria, and thus can interact with RNA polymerase to permit transcription.

The dimer will form a large loop by binding to araO and aria, and thus can interact with RNA polymerase to permit transcription.

With the addition, AraC no longer dimerizes and thus can interact with RNA polymerase to permit transcription.

It becomes less flexible, so that a monomer can bind to araI1 and araI2 and interact with RNA polymerase to permit transcription.

It becomes more flexible, so that the dimer can bind to araI1 and araI2 and interact with RNA polymerase to permit transcription.

ANS: E DIF: Difficult REF: 10.2 OBJ: 10.2d Compare and contrast the LacI repressor protein to the AraC/XylS family regulators and the TrpR repressor MSC: Understanding 23. Bacterial systems using an AraC/XylS-type regulator include ________ as regulated by ________. a. a type III secretion system in Pseudomonas; NitR b. a type III secretion system in Pseudomonas; ExsA c. a type III secretion system in Pseudomonas; YbtA d. virulence genes and cholera toxin in Vibrio; TxtR e. virulence genes and cholera toxin in Vibrio; ExsA ANS: B DIF: Medium REF: 10.2 OBJ: 10.2d Compare and contrast the LacI repressor protein to the AraC/XylS family regulators and the TrpR repressor MSC: Applying 24. The role of a leader sequence is to a. directly control transcription. b. determine whether transcription can proceed through the genes in the operon. c. determine whether RNA polymerase can bind. d. terminate transcription. e. direct the looping of the DNA that prevents transcription initiation.

ANS: B DIF: Medium REF: 10.2 OBJ: 10.2e Use the tryptophan operon to explain the regulation of transcriptional attenuation MSC: Applying 25. The stringent response involves all EXCEPT a. downregulation of rRNA synthesis. b. downregulation of tRNA synthesis. c. ATP. d. GTP. e. a lack of change in gene expression.

ANS: E DIF: Difficult REF: 10.2 OBJ: 10.2f Describe the stringent response, including its function, how it is triggered, and how it is enacted MSC: Applying 26. The little amount of sigma H that is made at 30C is ________ by the DnaK/GrpE/DnaJ chaperones. a. enhanced d. protected b. activated e. folded c. degraded ANS: C

DIF: Medium

REF: 10.3

OBJ: 10.3a Describe the different ways sigma factors can be regulated MSC: Remembering 27. When the forespore is first produced, about what percentage of the chromosome is actually inside it? a. 10 d. 40 b. 20 e. 50 c. 30 ANS: C DIF: Medium REF: 10.3 OBJ: 10.3a Describe the different ways sigma factors can be regulated MSC: Remembering 28. Which of the following is NOT true of sRNA genes? a. They have a ribosomal-binding site. b. They occur between genes. c. They share homology between related species. d. They can act as antisense RNAs. e. They play a role in regulating genes involved in oxidative stress, acid resistance, and quorum sensing.

ANS: A DIF: Medium REF: 10.3 OBJ: 10.3b Recall the different types of regulatory RNAs and illustrate their mechanism of action MSC: Remembering 29. Which genes always occur in intergenic regions? a. tRNA d. rRNA b. mRNA e. tsRNA c. sRNA ANS: C DIF: Easy REF: 10.3 OBJ: 10.3b Recall the different types of regulatory RNAs and illustrate their mechanism of action MSC: Remembering 30. Which of the following statements about riboswitches is true? a. They are found mainly at the 3' end of a mRNA. b. They are capable of binding to a ligand and activating transcription but do not repress transcription. c. They can control transcription but no translation. d. Ligands that can bind range from vitamins, amino acids, magnesium, and fluoride. e. They have no secondary structures involved in their control.

ANS: D DIF: Medium REF: 10.5 OBJ: 10.3c Name some factors that change riboswitch structure and state the functional consequence of the structural change MSC: Applying 31. What type of RNAs bind to complementary sequences of target transcripts and stimulate or prevent translation? a. ribosomal d. antisense b. transfer e. small c. messenger ANS: D DIF: Easy REF: 10.3 OBJ: 10.3b Recall the different types of regulatory RNAs and illustrate their mechanism of action MSC: Remembering

32. The regulatory activity of sRNA a. codes for a sigma factor. b. prevents CRP interaction with RNA polymerase, thereby blocking its access to the promoter. c. synthesizes ppGpp. d. targets mRNAs for degradation. e. creates an attenuator stem loop.

ANS: D DIF: Medium REF: 10.3 OBJ: 10.3b Recall the different types of regulatory RNAs and illustrate their mechanism of action MSC: Understanding 33. The best description of the initial step in the regulatory process shown below is

a. an sRNA is produced that can then be used to turn on genes. b. an sRNA is produced that can then be used to turn off genes. c. a sigma factor mRNA is transcribed and forms secondary structures at lower temperatures.

When heated, the structures melt and the mRNA for the heat shock sigma factor, rpoH, can be translated. d. The hairpins contain codons for a needed amino acid. When amino acid is lacking, the ribosome stalls and prevents its formation, thus allowing translation. e. The hairpins contain codons for needed amino acids. When amino acid is present, the ribosome stalls and prevents the formation of hairpins, thus allowing translation.

ANS: C DIF: Difficult REF: 10.3 OBJ: 10.3a Describe the different ways sigma factors can be regulated MSC: Analyzing 34. Some microbes use gene regulation to periodically change their appearance, in a process called a. sporulation. d. activation. b. attenuation. e. phase variation. c. regulation.

ANS: E DIF: Easy REF: 10.1 OBJ: 10.1b Explain why and how microbes undergo phase variation MSC: Remembering 35. The role of the Hin recombinase is to a. recombine specific segments of the DNA of Haemophilus influenzae. b. recombine specific segments of flagellin genes in Neisseria gonorrhoeae. c. recombine specific segments of MCP genes in Salmonella enterica. d. recombine specific segments of flagellin genes in Salmonella enterica. e. repair damage in DNA. ANS: D DIF: Medium REF: 10.1 OBJ: 10.1b Explain why and how microbes undergo phase variation MSC: Remembering 36. If the newly synthesized DNA strand slips back relative to the template strand, one copy of the repeated unit is ________ the growing strand.

a. inserted in b. deleted from c. folded over

d. folded under e. bound to

ANS: A DIF: Medium REF: 10.1 OBJ: 10.1a Recall the various ways gene expression can be controlled, and assess the advantages and disadvantages of each MSC: Remembering 37. Phase variation in Salmonella enterica involves a. gene inversion. d. sRNA. b. chemotaxis. e. slipped-strand mispairing. c. outer membrane proteins.

ANS: A DIF: Easy REF: 10.1 OBJ: 10.1b Explain why and how microbes undergo phase variation MSC: Understanding 38. The mechanism behind slipped-strand mispairing is that a. short repeats allow for slippage of the RNA polymerase during transcription of the affected genes. b. short repeats allow for slippage of DNA polymerase during replication, which leads to an out-of-frame reading sequence. c. an invertible promoter slips into different reading frames. d. the genes coding for lipopolysaccharide in Gram-negative bacteria can be slipped in and out of frame. e. short repeats slip and turn genes off, but they can never be turned back on.

ANS: B DIF: Medium REF: 10.1 OBJ: 10.1a Recall the various ways gene expression can be controlled, and assess the advantages and disadvantages of each MSC: Understanding 39. Which of the following is a second messenger that helps to regulate biofilm production? a. ppGpp d. cGMP b. ATP e. cdiGMP c. cAMP ANS: E DIF: Easy REF: 10.4 OBJ: 10.4d Identify second messengers and their roles in the cell MSC: Remembering 40. In the regulation of chemotaxis, proteins are modified in which of the following ways? a. phosphorylations b. methylation c. feedback inhibition d. phosphorylation and methylation e. feedback inhibition, phosphorylation, and methylation ANS: D DIF: Medium REF: 10.4 OBJ: 10.4b Define chemotaxis and summarize the molecular steps leading from chemoattractant to flagellar rotation | 10.4c Outline the role of methyl-accepting chemotaxis proteins in chemotaxis MSC: Understanding 41. Which of the following statements is true concerning the use of cyclic di-GMP as a second messenger? a. It activates the expression of flagellin genes and thus enhances motility.

b. c. d. e.

It is found in all microbes: bacteria, archaea, and eukaryotic microbes.

The action of diguanylate cyclase produces it.

It decreases in level as biofilm is produced.

Phosphodiesterase can convert GMP to cyclic di-GMP.

ANS: C DIF: Medium REF: 10.4 OBJ: 10.4d Identify second messengers and their roles in the cell MSC: Understanding 42. Integrated circuits are involved in all of the following EXCEPT a. controlling chemotactic activities of a cell. b. coupling the genetic and biochemical control of a metabolic pathway. c. timing the events of a developmental cycle. d. having an influence on nitrogen metabolism. e. specifically inverting the flagellin genes.

ANS: E DIF: Medium REF: 10.4 OBJ: 10.4a State the generic proteins of a two-component signal transduction system MSC: Applying 43. In terms of controlling chemotaxis, the proteins involved control chemotaxis in which way? a. They control which form of flagellin is expressed. b. They change the direction of the flagella from counterclockwise to clockwise and back. c. They promote longer ―tumbles‖ when a chemoattractant is present. d. They increase the phosphorylation of CheY so that there are more counterclockwise flagella. e. They respond to demethylation of methyl-accepting chemotaxis proteins to bring about longer runs.

ANS: B DIF: Difficult REF: 10.4 OBJ: 10.4b Define chemotaxis and summarize the molecular steps leading from chemoattractant to flagellar rotation MSC: Applying 44. With respect to quorum sensing, all of the following are true EXCEPT that it a. can be involved in cross-talk between species, including eukaryotes. b. can be involved in some pathogenesis and biofilm formation. c. has only one autoinduction system per species. d. is carried out with an autoinducer such as homoserine lactone. e. plays a role in some antibiotic production.

ANS: C DIF: Easy REF: 10.5 OBJ: 10.5a List the functions of quorum sensing systems

MSC: Understanding

45. Autoinducers regulate gene expression by a. accumulating inside the cell until enough is present to bind repressor proteins and stop transcription. b. accumulating inside the cell until enough is present to bind activator proteins and initiate transcription. c. interacting with small RNAs to either inhibit or enhance transcription. d. diffusing out of the cell and when a critical cell density is reached, moving back in and binding to a regulatory protein to initiate transcription. e. being synthesized after glucose is used up, thereby bypassing catabolite repression.

ANS: D DIF: Medium REF: 10.5 OBJ: 10.5b Summarize how quorum sensing systems produce effects

MSC: Analyzing 46. Many bacteria produce some type of homoserine lactone for quorum sensing, yet some Gram-positive bacteria will produce ________ for this same purpose. a. antibiotics d. cyclic di-GMP b. peptides e. ppGpp c. furanosyl borate diester ANS: B DIF: Medium REF: 10.5 OBJ: 10.5b Summarize how quorum sensing systems produce effects MSC: Remembering 47. A quorum-sensing gene system requires the accumulation of a secreted small molecule called a(n) a. autoinducer. d. inducer. b. activator. e. corepressor. c. repressor.

ANS: A DIF: Easy REF: 10.5 OBJ: 10.5a List the functions of quorum sensing systems

MSC: Remembering

48. All the cell’s expressed RNAs are collectively referred to as the cell’s a. genome. d. holoenzyme. b. transcriptome. e. ORF. c. proteome.

ANS: B DIF: Medium REF: 10.6 OBJ: 10.6a Define transcriptome and proteome

MSC: Remembering

49. Which molecule is used for hybridization to DNA bound on a DNA microarray? a. DNA d. cDNA b. RNA e. qDNA c. mRNA ANS: D DIF: Easy REF: 10.6 OBJ: 10.6a Define transcriptome and proteome

MSC: Remembering

50. The value of studying a transcriptome rather than a genome is that a. RNA is much easier to work with than DNA. b. using bacterial RNA eliminates the introns they all have. c. one can get a snapshot of what genes are expressed under some conditions but not others. d. a transcriptome is more related to the protein. e. deep sequencing can only be performed on RNA. ANS: C DIF: Medium REF: 10.6 OBJ: 10.6d Decide what kinds of research questions can be effectively answered with transcriptomic or proteomic approaches MSC: Applying 51. Which of the following describes the process of obtaining RNA sequence information? a. Proteins are isolated and mass spec is used. Once the proteins are known, the RNA that coded for them can be determined. b. RNA from a particular growth condition is isolated and converted to cDNA; DNA adapters are added, allowing high-throughput sequencing to be carried out. The genome position of the sequence obtained is then determined using computer software. c. A DNA microarray is used to find the RNA sequences expressed at that time. d. One examines the tRNA and rRNA in a given culture in order to study various

physiological conditions. e. One determines the RNA sequence of every gene in the genome and then determines if it is present in a given culture.

ANS: B DIF: Difficult REF: 10.6 OBJ: 10.6b Outline the steps to obtain transcriptomic data via the RNAseq method MSC: Evaluating 52. Which of the following is a technique used in studying the proteome of an organism? a. knowing the DNA sequence to predict the amino acid sequence b. predicting the protein sequence by using the mRNA sequence c. two-dimensional protein gels followed by mass spec of the proteins d. obtaining cDNA and then probing a DNA microarray e. digesting a cell extract with trypsin ANS: C DIF: Easy REF: 10.6 OBJ: 10.6c Describe the techniques that can be used to obtain proteomic data MSC: Understanding 53. The figure below diagrams a process used to study bacterial physiology. Which is the correct description of the steps shown?

a. Cells are lysed, two-dimensional gels are run, and then spots of protein are run through mass spec. Proteins’ peaks are identified. b. Cells are lysed, two-dimensional gels are run, isobaric tags are added to the proteins, and they are run through a mass spec. Proteins’ peaks are identified. c. Cells are lysed, two-dimensional gels are run, and proteins are digested with trypsin and run through a mass spec. Proteins’ peaks are identified.

d. Cells are lysed, proteins are digested with trypsin, and column is used followed by mass spec. Proteins’ peaks are identified. e. Cells are lysed, RNA is purified, cDNA is made, and sequencing is carried out.

ANS: D DIF: Difficult REF: 10.6 OBJ: 10.6c Describe the techniques that can be used to obtain proteomic data MSC: Analyzing SHORT ANSWER 1. Explain a way that organisms sense and respond to their environment.

ANS: Answers vary but could include the following: Two-component signal transduction systems allow organisms to sense and respond to their environment. Activation of a sensor kinase protein that spans the membrane results in a conformational change and self-phosphorylation. The phosphate is then passed to a response regulator in the cytoplasm that controls gene expression.

DIF: Medium REF: 10.1 OBJ: 10.1c Describe the mechanisms cells use to sense and respond to conditions within the cell and outside the cell membrane MSC: Understanding 2. Describe the function of prokaryotic activator proteins.

ANS: Most prokaryotic activators bind to activator sequences just upstream from their target genes. The function of an activator is to recruit RNAP to promoter regions to enhance transcription.

DIF: Medium REF: 10.2 OBJ: 10.2d Compare and contrast the LacI repressor protein to the AraC/XylS family regulators and the TrpR repressor MSC: Understanding 3. What is diauxic growth and why does it occur?

ANS: This type of growth occurs when an organism has a choice of two carbon sources, such as glucose and lactose. Catabolite repression causes the organism to first use the glucose, since the enzymes for metabolizing glucose are constitutively produced and it is the preferred carbon source. The lactose operon will be repressed until the glucose has been consumed. After the glucose is consumed, the lactose operon will no longer be repressed and the lactose can be metabolized.

DIF: Medium REF: 10.2 OBJ: 10.2c Summarize the mechanisms by which lactose and glucose control the transcription of the lac operon MSC: Remembering 4. Describe what happens to the lac operon in the presence of both lactose and glucose.

ANS: In the presence of both lactose and glucose, catabolite repression will occur, which will lower cAMP levels, inhibit lactose transport into the cell, and—via lack of cAMP-CRP complex—minimize transcription of the lac operon.

DIF: Medium

REF: 10.2

OBJ: 10.2c Summarize the mechanisms by which lactose and glucose control the transcription of the lac operon MSC: Remembering 5. Glucose transport into the cell brings about a phenomenon known as inducer exclusion.

Describe how this functions with respect to the lac operon.

ANS: In the presence of glucose, the PTS system will add phosphates from phosphoenolpyruvate (PEP) to glucose as it is transported across the cell membrane via a series of proteins. Thus, there is no phosphate left on enzyme II and lacY is inhibited. Without glucose present, these phosphorylations will not happen, enzyme II will be phosphorylated, and lacY will then be able to transport lactose into the cell.

DIF: Medium REF: 10.2 OBJ: 10.2c Summarize the mechanisms by which lactose and glucose control the transcription of the lac operon MSC: Remembering 6. The AraC regulator both activates and represses transcription of the genes involved in arabinose catabolism. How is this system more advantageous to a cell than a simpler repressor system like that used on the lac operon?

ANS: The repressor in the lac operon comes completely off the DNA in the presence of the inducer allolactose. Consequently, it will disperse in the cell, and random diffusion will be necessary for it to regain repression. There will therefore be a delay between induction and repression. The AraC regulator is simply shuttled back and forth on the DNA between the activator and repressor binding sites. This means that the delay between induction and repression will be short.

DIF: Medium REF: 10.2 OBJ: 10.2d Compare and contrast the LacI repressor protein to the AraC/XylS family regulators and the TrpR repressor MSC: Remembering 7. How is repression of biosynthetic pathways different than repression of a catabolic pathway? Why does repression of these two types of pathways work differently?

ANS: Repressors that control catabolic pathways usually bind the substrate for that pathway. Binding the substrate decreases the repressor’s affinity for the operator sequence. Increased concentration of the substrate removes the repressor from the operator and derepresses expression of the genes. This works well because the cell needs to make enzymes that enable it to use the substrate. For biosynthetic pathways that are controlled by repressors, the repressor binds the end product of the pathway to become active. When the substrate binds the repressor, the repressor affinity for the operator sequence is increased. As the substrate builds up to high levels, the cell will shut down the biosynthetic pathway so energy is not wasted.

DIF: Difficult REF: 10.2 OBJ: 10.2d Compare and contrast the LacI repressor protein to the AraC/XylS family regulators and the TrpR repressor MSC: Remembering 8. Explain how a repressor protein works with respect to a biosynthetic operon.

ANS:

When the end product of the biosynthetic operon is high, the cell does not need those enzymes.

Thus, the end product will bind to the inactive aporepressor and become an active repressor protein, which will shut down the transcription of the genes. As the end product gets low, there is not enough to bind to the aporepressor; thus, there will be no repression, and transcription of the needed genes will occur.

DIF: Medium REF: 10.2 OBJ: 10.2d Compare and contrast the LacI repressor protein to the AraC/XylS family regulators and the TrpR repressor MSC: Understanding 9. Explain the process of attenuation in regulating transcription of the tryptophan operon.

ANS: Attenuation is a process of transcription regulation in which translation of a leader peptide affects transcription of a downstream structural gene. When levels of tryptophan are high, the ribosome will translate through the trp codons but runs into a stop codon, causing it to stall. This stall causes the formation of a termination loop and the ribosome is released. This prevents a waste of energy in making an amino acid that is already present in high levels. When tryptophan levels are low, the ribosome will stall at trp codons and an anti-attenuator stem loop forms that prevents formation of the attenuator stem loop. This causes the polymerase and ribosome to continue and translate the trp structural genes.

DIF: Difficult REF: 10.3 OBJ: 10.2e Use the tryptophan operon to explain the regulation of transcriptional attenuation MSC: Understanding 10. The stringent response downregulates rRNA synthesis. Does it similarly downregulate ribosomal protein synthesis?

ANS: Ribosomal protein synthesis will also slow, but not due to ppGpp and the stringent response.

Ribosomal proteins have the ability to bind to their own mRNA, and when they do, translation is inhibited. Binding to their own mRNA only happens when rRNA concentrations drop, thereby increasing cytoplasmic levels of free ribosomal proteins. These ribosomal proteins bind to their mRNAs and effectively shut down translation.

DIF: Difficult REF: 10.2 OBJ: 10.2f Describe the stringent response, including its function, how it is triggered, and how it is enacted MSC: Understanding 11. How is sigma H degradation controlled by temperature, and why is this important to the cell?

ANS: At lower temperatures, chaperones bring sigma H to proteases for digestion, so levels stay low. At higher temperatures, chaperones are shuttled to the many heat-denatured proteins that are formed and away from sigma H, so sigma H levels are high. This is important because at higher temperatures, sigma H is needed to transcribe heat-shock genes.

DIF: Medium REF: 10.3 OBJ: 10.3a Describe the different ways sigma factors can be regulated MSC: Understanding 12. During the process of endospore formation, different sigma factors are active in the mother cell and forespore. How is this possible, and why is it important?

ANS: When the septum is formed and the forespore is first produced, only 30% of the chromosome is in the forespore. The rest of the chromosome slowly moves in over time. Temporary asymmetrical distribution of the chromosome results in activation of different sigma factors in each compartment. Sigma F is produced in the forespore and involved in the early stages of spore formation. Without the compartment-specific sigma factors, spore formation could not occur.

DIF: Difficult REF: 10.3 OBJ: 10.3a Describe the different ways sigma factors can be regulated MSC: Understanding 13. Explain how small, untranslated RNAs (sRNAs) regulate iron uptake and iron storage.

ANS: Answers will vary but may include the following: when iron levels are low, RyhB sRNA binds to its target sequence in mRNA, encoding succinate dehydrogenase. This binding targets the mRNA for degradation by RNase, thereby downregulating succinate dehydrogenase production and lessening iron utilization. When iron levels are high, the iron-gathering enterochelin gene and the ryhB gene encoding RyhB sRNA are both repressed by binding of the Fur repressor protein. The sucCDAB gene is expressed, and succinate dehydrogenase is made.

DIF: Difficult REF: 10.3 OBJ: 10.3b Recall the different types of regulatory RNAs and illustrate their mechanism of action MSC: Understanding 14. Explain how riboswitches can be compared to activator and repressor proteins. State an example.

ANS: Just as proteins fold into an active structure, so do RNAs fold into secondary structures. With proteins, these structures are able to bind to a variety of ligands and then bind to DNA and either inhibit or allow transcription. Riboswitches, located at the 5' end of a message, can also fold and bind ligands. In doing so, this structure will control either transcription or translation. One example involves fluoride, which is used to prevent dental caries. A fluoride riboswitch was found attached to certain genes that are normally inhibited by fluoride. Now the increase in fluoride will bring about an increase in translation of these genes with fluoride riboswitches.

DIF: Medium REF: 10.3 OBJ: 10.3c Name some factors that change riboswitch structure and state the functional consequence of the structural change MSC: Understanding 15. What does the gene inversion in Salmonella enterica accomplish with respect to its course of infection? Briefly describe how this mechanism works.

ANS: Changing its flagellar type enables the bacterium to evade the human immune response for a while longer. This mechanism involves an invertible element that contains a promoter sequence. The Salmonella has two flagellar types, H1 and H2. The gene encoding H2 is adjacent to a gene coding a repressor for H1 flagellin production. These genes are only transcribed when the invertible element is in the correct direction for the promoter to be situated properly and for the transcription of H2 flagellin and H1 flagellin repressor to occur. When the element flips, there is no promoter for the genes, and H2 flagellin and the H1 repressor are no longer produced. Without the H1 flagellin repressor, the cell can now make H1 flagellin. This mechanism ensures that only one type of flagellin will be present at any one time.

DIF: Difficult REF: 10.3 OBJ: 10.1a Recall the various ways gene expression can be controlled, and assess the advantages and disadvantages of each MSC: Understanding 16. What happens when strand slippage occurs on the template or the newly synthesized DNA strand?

How does Neisseria gonorrhoeae use slipped-strand mispairing to its advantage?

ANS: Strand slippage occurring on the template strand during DNA replication will cause one repeat to be deleted. If, however, the slippage occurs on the newly synthesized strand, one extra copy will be inserted into the growing strand. Neisseria gonorrhoeae slippage is possible due to a short repeat found in its genes for outer membrane proteins. A gene will be switched on or off by this slippage.

DIF: Difficult REF: 10.1 OBJ: 10.1a Recall the various ways gene expression can be controlled, and assess the advantages and disadvantages of each MSC: Understanding 17. Explain what happens to motility when a chemoattractant is added to bacterial cells.

ANS: In the presence of a chemoattractant, the MCP for that chemical will become methylated. This methylation will then inhibit CheA kinase activity, which results in lower CheY-P (via CheZ dephosphorylation) and then results in the counterclockwise turning of the flagella to give a ―run.‖ A longer run will aid the cell in moving toward the chemical.

DIF: Difficult REF: 10.4 OBJ: 10.4b Define chemotaxis and summarize the molecular steps leading from chemoattractant to flagellar rotation | 10.4c Outline the role of methyl-accepting chemotaxis proteins in chemotaxis MSC: Understanding 18. Explain the process of bioluminescence in Allivibrio fischeri. How is this an example of a mutualistic relationship?

ANS: Allivibrio fischeri is bioluminescent at high cell densities due to the accumulation of an autoinducer. At high cell levels and high autoinducer concentration, the autoinducer reenters the cell and binds LuxR, which activates transcription of the luciferase genes, and the cells become bioluminescent. This organism colonizes the light organ of the Hawaiian squid. The bacteria obtain shelter by living in the light organ. The squid camouflages itself using counterillumination when swimming at night, so it is safer from predators.

DIF: Difficult REF: 10.5 OBJ: 10.5b Summarize how quorum sensing systems produce effects MSC: Understanding 19. Quorum sensing plays a role in interspecies communications. Describe the relationship between green seaweed Enteromorpha and Vibrio anguillarum bacterial cells in biofilms, and explain how Escherichia coli was used to understand this interaction.

ANS:

Enteromorpha makes motile zoospores that search out V. anguillarum biofilms. The eukaryote is able to sense the acyl homoserine lactone that the bacteria produce. To prove this was the communication process, E. coli were engineered to produce the Vibrio-specific acyl homoserine lactone.

Enteromorpha zoospores were able to sense and attach to these engineered E. coli cells in a biofilm.

DIF: Difficult REF: 10.5 systems MSC: Understanding

OBJ: 10.5a List the functions of quorum sensing

20. Briefly explain two-dimensional gel electrophoresis. What is the procedure used to determine, and why are both dimensions necessary?

ANS: The proteome of a cell includes all of the cell’s expressed proteins. The proteome will change throughout a cell’s life and in response to varying environmental conditions. Two-dimensional gel electrophoresis is used to compare fluctuations in the proteome under different growth conditions.

The first dimension involves isoelectric focusing, which sorts proteins according to their charges or isoelectric points. The second dimension uses polyacrylamide gel electrophoresis to further separate proteins by their molecular weights.

DIF: Medium REF: 10.6 OBJ: 10.6c Describe the techniques that can be used to obtain proteomic data MSC: Understanding

CHAPTER 11: Viral Molecular Biology MULTIPLE CHOICE 1. Which of the following statements is FALSE regarding phage lambda as a temperate phage? a. The genome of phage lambda integrates into the genome of the host cell and becomes a prophage. b. The phage DNA replicates as an integrated prophage but does not produce phage particles. c. Lambda phage immediately kills its host after infection. d. The presence of the lambda prophage confers resistant to new infections by lambda. e. Incorporation of lambda phage DNA into the bacterial genome is called lysogeny.

ANS: C DIF: Easy REF: 11.1 OBJ: 11.1a Outline the experiments that led to the discovery of phage lambda MSC: Remembering 2. What is the cause for cloudy centers appearing in lambda plaques on an Escherichia coli confluent plate? a. A low multiplicity of infection prevents the appearance of large numbers of lysed cells. b. Cell debris forms a physical barrier between uninfected cells and virions. c. Compounds in agar or nutrient medium protect bacterial cells from infection. d. A large number of infected cells become resistant to bacteriophage infection. e. Some infected cells become lysogens and start growing up where the infection began.

ANS: E DIF: Easy REF: 11.1 OBJ: 11.1a Outline the experiments that led to the discovery of phage lambda MSC: Understanding

3. The lambda genome is replicated by a rolling circle mechanism. What is the end result after a round of replication? a. a single-stranded DNA that is immediately packaged in the phage head b. two molecules resulting from a step of circle-to-circle replication c. several circular molecules inserted into each other; the circles are cleaved at the cos sites and eventually relegated d. a concatemer (i.e., multiple genomes joined end to tail, which are cleaved at cos sites by a terminase), producing linear double-stranded DNA prior to packaging e. several Okazaki fragments that are subsequently ligated ANS: D DIF: Medium REF: 11.1 OBJ: 11.1b List the structures present in phage lambda and describe the function of each structure MSC: Understanding 4. The capsid of the bacteriophage lambda is composed of two types of protein subunits, namely, D and E, arranged in a(n)________ shape. a. icosahedral d. triclinic b. rhomboidal e. cubic c. pyramidal ANS: A DIF: Easy REF: 11.1 OBJ: 11.1b List the structures present in phage lambda and describe the function of each structure MSC: Remembering 5. Which of the following is FALSE regarding the establishment of lysogeny? a. Lambda phage DNA integrates as a prophage in the host genome at the att site by site-specific recombination. b. Rolling-circle replication generates multiple genomes in tandem, which are eventually cleaved by the enzyme terminase. c. Production of the repressor CI by the integrated prophage prevents superinfection by other lambda phages. d. A CI lambda repressor dimer binds to the major groove of a specific DNA sequence in the bacterial host, preventing the transcription of lytic promoters. e. Once integrated in the host’s DNA, gene expression from the prophage is limited to a few proteins, including the repressor C1.

ANS: B DIF: Difficult REF: 11.1 OBJ: 11.1c Categorize the E. coli host proteins required for phage lambda attachment and infection MSC: Understanding 6. Control proteins Cro and CII lead to lysis or lysogeny, respectively. What environmental signal in the host contributes to regulate the amount of CII by influencing the activity of the protease HflB? a. Mg2 ion concentrations d. nutrient concentrations b. temperature e. helper phages c. water availability ANS: D DIF: Easy REF: 11.1 OBJ: 11.1d Describe the molecular regulation of the switch from lysogenic to lytic growth MSC: Applying 7. The figure below shows a partial map (0 to about 22 kbp) of the lambda DNA genome. Which gene or gene set is mislabeled?

a. A–lysis/lysogeny switch b. B–head c. C–tail

d. D–tail tip e. E–tail fibers

ANS: A DIF: Difficult REF: 11.1 OBJ: 11.1b List the structures present in phage lambda and describe the function of each structure | 11.1d Describe the molecular regulation of the switch from lysogenic to lytic growth MSC: Understanding 8. The figure below shows a partial map of the lambda DNA genome (2348 kb). The early left and right operons as well as the late operon are indicated. Which gene or gene set is mislabeled?

a. A–integration to host chromosome b. B–lysis/lysogeny switch c. C–DNA replication

d. D–lysis e. E–terminase

ANS: E DIF: Difficult REF: 11.1 OBJ: 11.1b List the structures present in phage lambda and describe the function of each structure | 11.1d Describe the molecular regulation of the switch from lysogenic to lytic growth MSC: Understanding 9. Which host protein cleaves CI and triggers up to 100% lysis after lysogenic Escherichia coli cells are exposed to ultraviolet light? a. primase d. terminase b. DNA polymerase III e. Lon protease c. RecA ANS: C DIF: Medium REF: 11.1 OBJ: 11.1d Describe the molecular regulation of the switch from lysogenic to lytic growth MSC: Understanding 10. The genome of the influenza virus is best described as a. () strand segmented RNA. d. () strand single-piece RNA. b. () strand segmented RNA. e. double-stranded RNA. c. () strand single-piece RNA. ANS: A DIF: Easy REF: 11.2 OBJ: 11.2c Describe the structure, replication, packaging, and reassortment of the influenza virus genome MSC: Remembering 11. What vertebrate groups harbor influenza viruses capable of mutating into strains infective to humans? a. cattle and horses d. mice and rats b. swine and cattle e. canines and felines

c. birds and swine ANS: C DIF: Medium REF: 11.2 OBJ: 11.2a Explain why human viruses are difficult to study

MSC: Remembering

12. The figure below is a transmission electron microscopy image of an influenza A virion.

Hemagglutinin (HA) is one of the spike proteins. Which is the other spike protein on the envelope of influenza A?

a. nucleocapsid protein b. ion channel c. matrix protein

d. nuclear export protein e. neuraminidase

ANS: E DIF: Easy REF: 11.2 OBJ: 11.2b State the functions of influenza virus proteins

MSC: Understanding

13. The segmentation of the influenza genome is conducive to ________, which can be defined as the process by which two different viruses swap genome segments to form a new genome. a. recombination d. reassortment b. hybridization e. shuffling c. ligation ANS: D DIF: Easy REF: 11.2 OBJ: 11.2c Describe the structure, replication, packaging, and reassortment of the influenza virus genome MSC: Applying 14. The director of a laboratory in charge of making the flu vaccine for the upcoming season is planning her production strategy. She must consider the phenomenon of reassortment, in which a. two different viruses contribute genome segments to a reassorted genome that remains segmented. b. two different viruses contribute genetic material to form a recombinant molecule. c. genes within a genomic segment of a virus undergo a fast mutation rate in the presence of another virus. d. there is antigenetic shift. e. there is antigenetic drift.

ANS: A DIF: Medium REF: 11.2 OBJ: 11.2c Describe the structure, replication, packaging, and reassortment of the influenza virus genome MSC: Understanding 15. The term ―________‖ describes the mutation-caused emergence of multiple viral strains that present differing properties of replication, tissue tropism, and drug resistance within a single infected individual.

a. hybrid species b. candidatus species c. quasispecies

d. lethal species e. type species

ANS: C DIF: Easy REF: 11.2 OBJ: 11.2c Describe the structure, replication, packaging, and reassortment of the influenza virus genome MSC: Remembering 16. The neuraminidase inhibitor ________ is currently used to treat influenza infections. a. Pleconaril d. Acyclovir b. Tamiflu e. Vitravene c. Zidovudine ANS: B DIF: Easy REF: 11.2 OBJ: 11.2d List the host proteins required for influenza virus infection MSC: Applying 17. Influenza shows cyclic appearance of extremely virulent strains that may cause widespread infection with high mortality, such as that of 1918, which infected 20% of the world’s population and killed more people than World War I. What is this type of infection called? a. mutagenic d. pandemic b. endemic e. transgenic c. epidemic ANS: D DIF: Easy REF: 11.2 OBJ: 11.2e Summarize the factors that can make influenza viruses so virulent MSC: Remembering 18. Proteolysis of the influenza ________ produces a fusion peptide, which initially binds to a ________ glycoprotein on the host’s cell membrane that serves as a receptor. a. hemagglutinin; syalic acid b. neuraminidase; N-acetylglucosamine c. matrix; fucose d. nuclear-packaging protein; mannose e. nucleocapsid protein; glucosamine ANS: A DIF: Medium REF: 11.2 OBJ: 11.2d List the host proteins required for influenza virus infection MSC: Understanding 19. RNA synthesis of influenza virus is primed by 7-methylguanine fragments of host mRNA, obtained by a. telomerase activity. d. exocytosis. b. the rolling-circle mechanism. e. cap-snatching. c. endocytosis.

ANS: E DIF: Easy REF: 11.2 OBJ: 11.2c Describe the structure, replication, packaging, and reassortment of the influenza virus genome MSC: Remembering 20. The HIV genome can be characterized by all of the following EXCEPT a. 5'-―cap.‖ d. a DNA primer. b. 3'-poly A-―tail.‖ e. a coated nucleoprotein. c. a Lys-specific tRNA. ANS: D

DIF: Medium

REF: 11.3

OBJ: 11.3a Categorize types of retroviruses

MSC: Analyzing

21. Worldwide, HIV infects one in ________ adults. a. 20 d. 500 b. 50 e. 1,000 c. 100 ANS: C DIF: Easy REF: 11.3 OBJ: 11.3b Assess the therapeutic consequences of HIV’s high mutation rate MSC: Remembering 22. Which are the main open reading frames (ORFs) present in all retroviruses, including HIV? a. vif, vpi, vpu d. vif, pol, tat b. env, pol, gag e. tat, nef, vpu c. tat, nef, rev ANS: B DIF: Difficult REF: 11.3 OBJ: 11.3a Categorize types of retroviruses

MSC: Remembering

23. Which HIV protein is mismatched with its function? a. nef—virion component d. tat—transcription factor b. vpu—membrane protein e. env—envelope protein c. rev—reverse transcriptase ANS: C DIF: Medium REF: 11.3 OBJ: 11.3c Describe the structure of the HIV virion 24. The pol open reading frame of HIV encodes a. reverse transcriptase. b. integrase. c. protease.

MSC: Applying

d. gyrase. e. ligase.

ANS: D DIF: Easy REF: 11.3 OBJ: 11.3c Describe the structure of the HIV virion | 11.3e Summarize the HIV cycle, including attachment, host cell entry, genome replication and integration, and virion assembly and exit MSC: Understanding 25. The lymphocyte protein chemokine receptor 5 (CCR5) is involved in HIV. Functionally, CCR5 is a(n) a. antagonist. d. inhibitor. b. coreceptor. e. regulator. c. cofactor.

ANS: B DIF: Easy REF: 11.3 OBJ: 11.3c Describe the structure of the HIV virion

MSC: Applying

26. How many genomes does an HIV particle have and what is their biochemical nature? a. two RNA molecules b. eight RNA molecules c. a DNA/RNA hybrid d. a single RNA molecule e. a DNA molecule and a noncomplementary RNA molecule ANS: A DIF: Easy REF: 11.3 OBJ: 11.3c Describe the structure of the HIV virion

MSC: Remembering

27. The lack of ________ in some people makes them resistant to HIV infection. a. CD4 receptors on the macrophages b. CCR5 receptors on the macrophages c. T4 lymphocytes d. B-cell receptors e. nuclear factor kappa beta in the B cells ANS: B DIF: Medium REF: 11.3 OBJ: 11.3b Assess the therapeutic consequences of HIV’s high mutation rate MSC: Applying 28. Antiviral agents have been synthesized against specific processes of HIV. Which of the following is a mismatched pair? a. CCR5 blocking—maraviroc b. integrase inhibition—raltegravir c. reverse transcriptase inhibition—azidothymidine (AZT) d. Gag-Pol cleavage—protease inhibitors e. nef inhibition—oseltamivir ANS: E DIF: Medium REF: 11.3 OBJ: 11.3f Distinguish HIV drugs based on their molecular target MSC: Applying 29. Which of the following primers for nucleic acid replication is linked to the appropriate virus? a. M2 and poliovirus d. virus tRNA and herpes virus b. host caps and poliovirus e. host tRNA and HIV c. VPg and influenza virus ANS: E DIF: Easy REF: 11.3 OBJ: 11.3e Summarize the HIV cycle, including attachment, host cell entry, genome replication and integration, and virion assembly and exit MSC: Analyzing 30. Glycosylation and packaging of the HIV env proteins occur in the a. endoplasmic reticulum. d. Golgi. b. nucleus. e. cytoplasm. c. membrane.

ANS: D DIF: Medium REF: 11.3 OBJ: 11.3e Summarize the HIV cycle, including attachment, host cell entry, genome replication and integration, and virion assembly and exit MSC: Understanding 31. HIV-infected cells can fuse with neighboring cells, subsequently forming a giant multinucleate cell known as a a. transgene. d. tumor. b. syncytium. e. coenocyte. c. hypha.

ANS: B DIF: Easy REF: 11.3 OBJ: 11.3e Summarize the HIV cycle, including attachment, host cell entry, genome replication and integration, and virion assembly and exit MSC: Understanding 32. Cyclophilin A is a host protein that a. acts as a coreceptor for HIV. b. facilitates HIV entry into the nucleus. c. is incorporated in the HIV envelope.

d. inhibits HIV replication. e. cuts the polyprotein into subunits.

ANS: C DIF: Medium REF: 11.3 OBJ: 11.3e Summarize the HIV cycle, including attachment, host cell entry, genome replication and integration, and virion assembly and exit MSC: Understanding 33. The figure below shows the structures involved in attachment of HIV to a host cell. The protein gp120 is represented by the number ________; CCR5 is indicated by ________ and CD4 by ________.

a. 1; 2; 3 b. 2; 3; 4 c. 3; 1; 2

d. 4; 1; 2 e. 5; 3; 4

ANS: B DIF: Medium REF: 11.3 OBJ: 11.3e Summarize the HIV cycle, including attachment, host cell entry, genome replication and integration, and virion assembly and exit MSC: Applying 34. The figure below shows the process attachment of HIV to a host cell. Which step is blocked by the antiviral agent maraviroc?

a. 1, CD4 binding b. 1, CCR5 binding c. 2, formation of the fusion peptide

d. 3, release of gp120 e. 4, reverse transcriptase activity

ANS: B DIF: Medium REF: 11.3 OBJ: 11.3f Distinguish HIV drugs based on their molecular target MSC: Applying 35. The reverse transcriptase complex is a crucial enzyme for retroviruses. Which catalytic activity does reverse transcriptase have? a. RNA-dependent RNA synthesis b. RNA degradation via RNase H c. DNA-dependent DNA synthesis d. RNA-dependent DNA synthesis e. DNA-dependent RNA synthesis ANS: D DIF: Medium REF: 11.3 OBJ: 11.3e Summarize the HIV cycle, including attachment, host cell entry, genome replication and integration, and virion assembly and exit MSC: Applying 36. Integrated retroviral genomes that have accumulated mutations and can no longer generate virions are known as ________ retroviruses. a. lysogenic d. exogenous b. temperate e. endogenous c. virulent ANS: E DIF: Easy REF: 11.4 OBJ: 11.4a Categorize the types of ancient retroviral sequences present in the human genome MSC: Understanding 37. Retroelements are remains of retroviral genomes in various states of decay. Which of the following are NOT retroelements? a. Alu sequences d. Gene transfer vectors b. HERVs e. SINE c. LINE

ANS: D DIF: Easy REF: 11.4 OBJ: 11.4b State some contributions of ancient retroviral sequences to the human genome MSC: Understanding 38. Retroelements and transposons compose about what percentage of the sequence of the human genome. a. 8 d. 50 b. 25 e. 90 c. 33 ANS: D DIF: Easy REF: 11.4 OBJ: 11.4b State some contributions of ancient retroviral sequences to the human genome MSC: Understanding 39. Which of the following viral groups has been successfully utilized as vector in gene therapy? a. rhabdoviruses d. orthomyxoviruses b. parvoviruses e. bacteriophages c. lentiviruses ANS: C DIF: Medium REF: 11.4 OBJ: 11.4c Appraise the advantages and disadvantages of adenoviruses and lentiviruses as gene therapy vectors MSC: Applying 40. To decrease risks, viruses used for gene therapy are extensively engineered to incorporate safety features such as a. the presence of virulence genes. b. ensuring insertion in regions near oncogenes. c. pseudotyping to alter tissue specificity. d. alteration of the germ line. e. ensuring deletions in regions near oncogenes.

ANS: D DIF: Easy REF: 11.4 OBJ: 11.4d Outline the changes made to viruses to convert them into gene therapy vectors; state the reasoning behind the changes MSC: Analyzing 41. Which of the following is a mismatched pair? a. herpes simplex virus 2—genital lesions b. varicella-zoster virus—chickenpox, shingles c. papillomavirus—genital warts d. variola major virus—smallpox e. None of the examples are mismatched.

ANS: E DIF: Medium REF: 11.5 OBJ: 11.5a Link some human diseases with the causative DNA viruses MSC: Applying 42. Approximately 60%80% of Americans acquire herpes simplex, usually HSV-1, in epithelial lesions commonly known as a. chancres. d. shingles. b. pox. e. hives. c. cold sores.

ANS: C DIF: Easy REF: 11.5 OBJ: 11.5a Link some human diseases with the causative DNA viruses MSC: Remembering

43. The causative agent of chickenpox is a. herpes simplex virus 1. b. herpes simplex virus 2. c. varicella-zoster virus.

d. Epstein-Barr virus. e. HIV.

ANS: C DIF: Easy REF: 11.5 OBJ: 11.5a Link some human diseases with the causative DNA viruses MSC: Remembering 44. Herpes simplex virus 1 capsids receive a primary envelope from ________, whereas secondary enveloping uses ________. a. Golgi; the plasma membrane b. the outer nuclear membrane; endoplasmic reticulum c. vacuoles; lysosomes d. lysosomes; the plasma membrane e. endoplasmic reticulum; Golgi ANS: B DIF: Difficult REF: 11.5 OBJ: 11.5c Describe the structures of the herpes simplex virus virion and genome MSC: Analyzing 45. Replication of herpes viruses requires all of the following elements EXCEPT a. primase. d. ligase. b. helicase. e. viral DNA polymerase. c. single-strand DNA binding proteins.

ANS: D DIF: Easy REF: 11.5 OBJ: 11.5d Summarize the herpes simplex virus cycle; include attachment, host cell entry, genome replication, and lytic versus latent infection MSC: Understanding 46. What regulatory elements of herpes genes do NOT resemble those of eukaryotic genes? a. Each gene has a promoter with control sequences such as a TATA box. b. Genes are transcribed individually. c. Different gene classes have their own specific regulatory elements. d. tegument e. Genes are translated individually.

ANS: D DIF: Medium REF: 11.5 OBJ: 11.5c Describe the structures of the herpes simplex virus virion and genome MSC: Applying 47. Herpes simplex virus latent infections are seen more frequently in nerve cells, such as a. the trigeminal ganglion. d. the basal nuclei. b. the glia. e. astrocytes. c. multipolar neurons.

ANS: A DIF: Medium REF: 11.5 OBJ: 11.5a Link some human diseases with the causative DNA viruses MSC: Remembering 48. How does the herpes simplex virus genome reach the interior of an infected cell? a. The core particle partly uncoats after entering the cytoplasm. b. The intact viral capsid travels down a scaffold of microtubules to a nuclear pore.

c. The viral particle enters the cell by endocytosis and releases virion contents into the cytoplasm. d. The capsid remains outside the cell; the nucleic acid is threaded through a receptor in the membrane. e. DNA is forced into the capsid.

ANS: B DIF: Medium REF: 11.5 OBJ: 11.5d Summarize the herpes simplex virus cycle; include attachment, host cell entry, genome replication, and lytic versus latent infection MSC: Applying 49. Which type of virus has been successfully used in the treatment of diseases such as B-cell leukemia and adrenoleukodystrophy? a. lentivirus d. influenza virus b. adenovirus e. T4 c. poliovirus ANS: A DIF: Easy REF: 11.5 OBJ: 11.5e Identify a therapeutic use for engineered herpes simplex virus MSC: Remembering 50. Viruses that specifically infect and lyse tumor cells are called a. transfer vectors. d. lysogenic. b. temperate. e. oncolytic. c. lytic.

ANS: E DIF: Easy REF: 11.5 OBJ: 11.5e Identify a therapeutic use for engineered herpes simplex virus MSC: Applying SHORT ANSWER 1. After Dr. Esther Lederberg crossed a standard stock of Escherichia coli K-12 with UV-mutagenized cells of the same strain, she observed the formation of plaques, but only among the mutagenized colonies. What was the explanation for this phenomenon?

ANS: UV treatment led to the loss of the lambda prophage and the cells became unprotected against infection by lambda viral particles produced by the standard E. coli K-12. UV-treated, infected cells quickly lysed and spread the infection to the cells around them, eventually forming plaques.

DIF: Medium REF: 11.1 OBJ: 11.1d Describe the molecular regulation of the switch from lysogenic to lytic growth MSC: Understanding 2. What is the Escherichia coli protein used by bacteriophage lambda as a receptor? Why has this protein not been lost in the process of evolution?

ANS: Escherichia coli can feed off short-chain sugars produced by other bacteria in the colon through digestion of polysaccharides from plant materials.

These sugars enter E. coli cells through the maltose porin, a protein complex located in the outer membrane; this protein complex can be utilized as a receptor by lambda phages.

Given the importance of carbohydrate uptake in E. coli nutrition, the maltose porin has been conserved through evolution despite its potentially deleterious role as a lambda phage receptor.

DIF: Medium REF: 11.1 OBJ: 11.1c Categorize the E. coli host proteins required for phage lambda attachment and infection MSC: Understanding 3. How is lambda phage being used to fight the problem of antibiotic resistance in bacteria?

ANS: A lambda phage that can specifically eliminate antibiotic-resistant bacteria has been constructed.

The basis for this technique is phage-mediated delivery of a CRISPR-Cas defense mechanism that protects the antibiotic-sensitive host from phage lysis.

DIF: Medium REF: 11.1 OBJ: 11.1e State some applications of phage lambda to research MSC: Applying 4. The lysis/lysogeny switch has been used in synthetic biology applications that take advantage of the properties of the interaction between Cro and CI. Give two examples of such an application.

ANS: A minimal version of the CI/Cro switch has been engineered in bacteria to detect environmental signals, such as antibiotics, in the intestine. A cro-lacZ fusion may direct the formation of blue colonies on indicator plates. This only happens when another antibiotic-inducible construct, such as tetP-cro, produces Cro and turns CI expression off, leading to expression of the Cro-LacZ fusion protein. The blue colony phenotype recurs for several generations after removal of the antibiotic. ―Artificial cells,‖ consisting of on-chip DNA compartments, are being used to program protein expression cycles that establish metabolic networks of medical relevance. The networks are programed through Cro-regulated switches.

DIF: Difficult REF: 11.2 OBJ: 11.1e State some applications of phage lambda to research MSC: Applying 5. The segmented genome of influenza virus makes virus assembly problematic. Is there evidence that the assembly mechanism packages the eight unique segments correctly?

ANS: Combined cryo-electron microscopy images from sections of unstained frozen virus particles reveal links between specific ribonucleoprotein (RNP) complexes, resulting in a reproducible pattern of all eight genomic segments forming a bundle of sticks.

Confirmation of these interactions has been achieved by using fluorescence microscopy and various genetic constructs.

DIF: Medium REF: 11.2 OBJ: 11.2c Describe the structure, replication, packaging, and reassortment of the influenza virus genome MSC: Evaluating 6. Pigs function as ―mixing bowls‖ for avian, human, and swine influenza strains. What is the biochemical mechanism for this phenomenon?

ANS: The influenza virions use a glycoprotein whose polysaccharide moiety contains sialic acid and galactose. In birds, the sialic acid is bound to galactose in an alpha-2,3 bond, whereas in the upper respiratory system of humans the bond is alpha-2,6. Swine receptors contain both types of bonds; therefore, pigs can be infected by both human and avian strain, besides swine strains. As a result, swine may produce triple reassortants that may jump across species. Such was the case of the 2009 human outbreak of H1N1: H1 is produced from a classical pig strain, whereas N1 (and M) are from avian-like swine strains originated from reassortment events that took place decades ago.

DIF: Difficult REF: 11.2 OBJ: 11.2d List the host proteins required for influenza virus infection MSC: Evaluating 7. Use the figure below to describe the events leading to the fusion between influenza virus A and host membranes. What structures are indicated by the numbers?

ANS: Influenza virions enter the cell by endocytosis after binding sialic–acid-containing receptors (4). A host protease cleaves the carboxy terminal domain of hemagglutinin (2), leading to the formation of amino terminal hemagglutinin fusion peptides. The virus-harboring endosome fuses with a lysosome and its interior acidifies (5), contributing to conformational changes of the fusion peptides on the viral envelope (1); namely, the N-terminal regions of the fusion peptides protrude toward the vesicle membrane. This brings closer the envelope to the host’s cell membranes (3), leading to membrane fusion (lower panel) and subsequent release of the virion contents into the cytoplasm.

DIF: Difficult REF: 11.2 OBJ: 11.2c Describe the structure, replication, packaging, and reassortment of the influenza virus genome | 11.2d List the host proteins required for influenza virus infection MSC: Analyzing

8. Why do highly virulent strains of the influenza virus appear periodically? Give one example.

ANS: The influenza virus genome is organized into eight segments. Segments from different strains, coinfecting the same host, are reassorted to generate new strains. Coinfection can rapidly generate a new strain that evades host immune systems. Major epidemics have occurred due to reassortment from strains that evolved in ducks or swine that live in close proximity to humans. For example, the H1N1 2009 human outbreak resulted from a triple reassortant swine strain with segments from avian, swine, and human influenza strains: H1 (an hemagglutinin allele) is a classical swine strain, whereas N1 (a neuraminidase allele) is from an avian-like swine strain.

DIF: Medium REF: 11.2 OBJ: 11.2e Summarize the factors that can make influenza viruses so virulent MSC: Analyzing 9. Describe how priming for mRNA synthesis or template synthesis for viral progeny of influenza A virus differs from typical mRNA synthesis mechanisms.

ANS: To make a () strand mRNA, the RNA-dependent RNA polymerase utilizes a 7-methylguanine ―capped‖ fragment that is obtained by cleaving the host’s nuclear pre-mRNA. This is called ―cap-snatching.‖ The () strand mRNA molecules go back to the cytoplasm to be translated and the snatched cap is used to bind ribosomes.

Alternatively, the original () strand RNA in the nucleus directs the synthesis of () strand RNA without cap snatching. The newly made () strand RNA is then coated with nucleoprotein (NP) subunits assembled in the cytoplasm. This () strand serves as a template to produce the nucleic acid component in the viral progeny (i.e., () strand RNA).

DIF: Difficult REF: 11.2 OBJ: 11.2d List the host proteins required for influenza virus infection | 11.2e Summarize the factors that can make influenza viruses so virulent MSC: Understanding 10. Describe the replication process of the human immunodeficiency virus (HIV).

ANS: The HIV virion attaches to host cell CD4 receptor and its CCR5 coreceptor. The envelope fuses with the host membrane, releasing its core in the cytoplasm. The core partially opens, allowing reverse transcription of the RNA. The resulting double-stranded DNA enters the nucleus and integrates into a host chromosome. RNA transcripts, including a 5-cap and a 3-poly-A tail, are made by host RNA polymerase II. While some of these RNA transcripts serve as templates for translation of Gag and Gag-Pol precursors, others form RNA dimers for progeny virions, which are then packaged with an envelope derived from the host cell membrane. Env proteins are glycosylated and packaged at the Golgi, then exported to the cell membrane.

After the core particle assembles, it is coated with a membrane envelope and is released from host tetherins through the action of Vpu. As the virus buds, the PR protease cleaves the Gag-Pol peptide, forming mature Gag subunits and reverse transcriptase.

DIF: Difficult REF: 11.3 OBJ: 11.3e Summarize the HIV cycle, including attachment, host cell entry, genome replication and integration, and virion assembly and exit MSC: Understanding

11. Explain what happens in individuals infected with HIV who are homozygous for functional CCR5, heterozygous for a CCR5 deletion, or homozygous for a CCR5 deletion.

ANS: Individuals who are homozygous for wild type CCR5 will produce two copies of CCR5 per diploid genome; thus, HIV would be able to bind, and an infection would result. Those individuals who are heterozygous for a CCR5 deletion would produce a reduced number of CCR5 receptors and would show a delayed onset of AIDS. Individuals homozygous for a CCR5 deletion would not produce any CCR5 receptor and would not be affected by HIV. DIF: Medium REF: 11.3 OBJ: 11.3d Recall the biological origin of HIV and the history of its discovery | 11.3e Summarize the HIV cycle, including attachment, host cell entry, genome replication and integration, and virion assembly and exit MSC: Evaluating 12. What are retroelements and why do they exist within the human genome?

ANS: Retroelements are remnants of decaying retroviral genomes. They integrated into the human genome and then lost the ability to produce progeny and so became trapped within a cell.

Endogenous retroviruses contain all of the genomic elements of a retrovirus but never generate virions because they have lost this ability due to mutations. Retrotransposons have only some of the retroviral elements but maintain a reverse transcriptase and so can copy themselves to other locations.

DIF: Medium REF: 11.4 OBJ: 11.4a Categorize the types of ancient retroviral sequences present in the human genome MSC: Applying 13. Why is it advantageous to use lentivectors to treat diseases that affect nondividing cells?

ANS: Accessory protein Vpr allows lentiviruses to go through nuclear pores after being retrotranscribed to double-stranded DNA. Lentiviruses can be used to transfer genes into nondividing cells, such as neurons. This is a desirable feature for an effective retroviral vector; other retroviruses, such as those causing lymphoma, can only infect dividing cells because the nuclear membrane disappears only during mitosis, thus limiting their application.

DIF: Difficult REF: 11.4 OBJ: 11.4c Appraise the advantages and disadvantages of adenoviruses and lentiviruses as gene therapy vectors | 11.4d Outline the changes made to viruses to convert them into gene therapy vectors; state the reasoning behind the changes MSC: Applying 14. Describe the several features of lentivectors. What are their molecular sources?

ANS: A lentivirus such as HIV is engineered to contain a transgene, that is, a good copy of the gene that is needed by the patient. Viral genes that cause disease (such as the virulent factors vpr, vpu, nef, and vif) are eliminated from the lentivirus, leaving only those sequences involved in genome integration (LTR sequences R-U5), the start of gag (a packaging signal), and the infectivity-enhancing tract (PPT). The viral cell host range (tropism) is broadened by using an envelope protein from the vesicular stomatitis virus (VSV).

Genes necessary for production of the vector in cultured cells are provided in DNA helper plasmids; these include gag and pol. A copy of env comes from VSV. Gene expression from these plasmids is driven from promoters derived from cytomegalovirus (CMV) or respiratory syncytial virus (RSV).

DIF: Medium REF: 11.4 OBJ: 11.4d Outline the changes made to viruses to convert them into gene therapy vectors; state the reasoning behind the changes MSC: Applying 15. Compare and contrast the advantages and disadvantages of lentiviral vectors with respect to adenoviral vectors.

ANS: Adenoviral vectors are only temporarily functional. They circularize and replicate separately from the host chromosomes, thus avoiding the risks involved with permanent insertion in the genome of the host cell. Because the vectors are eventually lost, they must be frequently reapplied, which leads to exposure to immune responses that destroy them.

Lentivectors integrate in the chromosome, thus providing longer-lasting therapy. However, integration in the wrong chromosomal region is undesirable, for example, a sequence leading to oncogene activation. Designing the vector with specific promoter for the gene of interest helps in circumventing this problem.

DIF: Medium REF: 11.4 OBJ: 11.4c Appraise the advantages and disadvantages of adenoviruses and lentiviruses as gene therapy vectors | 11.4d Outline the changes made to viruses to convert them into gene therapy vectors; state the reasoning behind the changes MSC: Applying 16. Endogenous retroviruses (ERVs) express viral components, including reverse transcriptase, as part of the host cell normal functions. What role do ERVs play in mouse B-cell immune response to carbohydrate antigens?

ANS: B-cell antigen receptors are antibody-like molecules that specifically recognize carbohydrate antigens that might come from a pathogen. After an antigen binds the B-cell receptor, a signaling pathway is triggered, which culminates in B-cell proliferation and antibody production. This pathway involves the induction of an ERV sequence to produce retroviral RNA and reverse transcriptase that together, in turn, activate genes for antibody production.

DIF: Difficult REF: 11.4 OBJ: 11.4b State some contributions of ancient retroviral sequences to the human genome MSC: Analyzing 17. What types of infections are caused by herpes viruses? Describe the two possible types of replication processes that occur with the herpes viruses.

ANS: Two of the most common infections in the United States are caused by HSV-1 and HSV-2. HSV-1 causes epithelial lesions called cold sores, whereas HSV-2 is contracted through sexual contact and causes lesions in the reproductive tract.

Herpes virus genes can be classified according to the stage of the replication cycle when they are expressed: namely, immediate, early, and late. In this way, the virus only directs gene expression of products needed in a particular phase of infections. LAT genes are expressed for latent infection.

Viral particles infect cells of the oral or genital mucosa, followed by latent infection within neurons of the ganglia. The latent infection of the ganglia later causes new outbreaks, often triggered by stress or depression of the immune system. Progeny may travel down the dendrites to the epithelial cells causing the lytic type of infection and appearance of the lesions.

DIF: Medium REF: 11.5 OBJ: 11.5a Link some human diseases with the causative DNA viruses MSC: Analyzing 18. What is an oncolytic virus? Give an example.

ANS: Viruses that prefer to infect tumor cells are called oncolytic and can be used in treating cancer. An engineered form of herpes simplex virus 1 has been developed and approved in the United States for viriotherapy as an alternative in the treatment of patients with inoperable tumors.

T-VEC is the commercial name of an engineered form of herpes simplex virus 1 that has been approved for viriotherapy.

T-VEC-infected tumor cells release fragments that attract cells of the immune system, which eventually destroy the tumor. Once the immune system is activated, it recognizes metastatic tumorous cells that might have spread throughout the body.

DIF: Difficult REF: 11.5 OBJ: 11.5e Identify a therapeutic use for engineered herpes simplex virus MSC: Analyzing 19. What is the mechanism by which the viriotherapeutic agent T-VEC specifically kills hard-to-treat tumors?

ANS: T-VEC-infected tumor cells release fragments that attract cells of the immune system, which eventually destroy the tumor. Once the immune system is activated, it recognizes metastatic tumorous cells that might have spread throughout the body.

DIF: Difficult REF: 11.5 OBJ: 11.5e Identify a therapeutic use for engineered herpes simplex virus MSC: Analyzing 20. Sequences of endogenous retroviruses (HERVs) are remnants of retroviral infections. HERVs have accumulated over millions of years and comprise about 8% of the human genome. Briefly describe the evidence for the expression of HERV-K proteins and virus-like particles in the human embryo.

What are the implications of HERV-K products interacting with embryonic factors?

ANS: Antibody staining of HERV-K capsids reveal the presence of virus-like particles and Gag proteins in the blastocyst. This occurs when an embryonic regulator protein is expressed.

Major evolutionary phenomena such as placentation have been associated with regulatory functions performed by ERV sequences. The sequences of the most recently acquired retrovires, HERV-K, have retained protein-coding capabilities and may be able to evolve new functions as enhancers of gene expression in phenomena such as embryo developmental networks.

In addition, the presence of HERV-K particles may stimulate the embryo’s innate immune defenses as a mechanism against exogenous viral infections.

DIF: Difficult REF: 11.4 OBJ: 11.4b State some contributions of ancient retroviral sequences to the human genome

MSC: Evaluating

CHAPTER 12: Biotechniques and Synthetic Biology MULTIPLE CHOICE 1. A common approach to study a certain metabolic process is to isolate organisms defective in that particular process. These organisms are called a. agents. d. mutants. b. wild type. e. vectors. c. prototrophs.

ANS: D DIF: Easy REF: 12.1 OBJ: 12.1a Describe how mutants help researchers answer biological questions MSC: Remembering 2. What kind of mutation is produced by transposable elements? a. inversion d. substitution b. point e. transposition c. insertion ANS: C DIF: Easy REF: 12.1 OBJ: 12.1a Describe how mutants help researchers answer biological questions MSC: Remembering 3. Which answer choice INCORRECTLY labels the figure below?

a. b. c. d. e.

A—DNA primer B—transposon C—amplification of gene-transposon junction D—interface gene-transposon There is no incorrect label.

ANS: E DIF: Easy REF: 12.1 OBJ: 12.1b Outline the series of steps required to identify genes involved in a particular cell process MSC: Understanding 4. Annotation of sequences of transposon insertion sites in the chromosome of Escherichia coli O157:H7 cells that had lost their acid-resistance properties revealed four genes: two encoding isoforms of glutamate decarboxylase (GadA and GadB) and one encoding a glutamate/gamma-aminobutyric acid (GABA) antiporter. What does the fourth gene encode? a. a heat shock protein b. a possible regulator

c. a glutamate/GABA symporter d. a GABA uniporter e. a glutamate carrier protein ANS: B DIF: Easy REF: 12.1 OBJ: 12.1b Outline the series of steps required to identify genes involved in a particular cell process MSC: Remembering 5. Acid-resistant Escherichia coli cells counteract H in their cytoplasm through the combined action of two proteins: a decarboxylase enzyme and a. H channel. b. [H]-ATPase. c. GABA/glutamate antiporter. d. putative DNA-binding protein. e. putative antiporter.

ANS: C DIF: Easy REF: 12.1 OBJ: 12.1b Outline the series of steps required to identify genes involved in a particular cell process MSC: Remembering 6. Which answer choice INCORRECTLY labels the figure below?

a. b. c. d. e.

D indicates the CO2 entering the cell.

C points to GABA. A marks the GABA/glutamate antiporter.

D is the label for H entering the cell.

B points to glutamate.

ANS: D DIF: Easy REF: 12.1 OBJ: 12.1b Outline the series of steps required to identify genes involved in a particular cell process MSC: Understanding

7. The genes for proteins such as -galactosidase (lacZ) or green fluorescent protein (gfp) can be fused to the promoter of a gene of interest. Which of the following statements is NOT correct about gfp and lacZ? a. They are called reporter genes. b. The enzymatic activity of -galactosidase can be easily assayed. c. GFP is visualized by fluorescence microscopy. d. Both genes are of viral origin. e. The gfp gene is of eukaryotic origin, whereas lacZ is a bacterial gene.

ANS: D DIF: Easy REF: 12.1 OBJ: 12.1d Recall the attributes of a reporter gene

MSC: Understanding

8. The colorless molecule o-nitrophenyl galactoside (ONPG) can be used as an artificial substrate to assay -galactosidase in cell extracts of Escherichia coli in which lacZ is used as a reporter gene.

Which of the following statements is NOT true with respect to the use of ONPG? a. Hydrolysis of ONPG by -galactosidase produces yellow o-nitrophenol. b. o-nitrophenol can be measured with a spectrophotometer. c. Hydrolysis of ONPG by -galactosidase also releases colorless galactose. d. The o-nitrophenol moiety is blue and more suitable for use in solid media. e. The o-nitrophenol moiety is green and less suitable for use in solid media.

ANS: D DIF: Medium REF: 12.1 OBJ: 12.1d Recall the attributes of a reporter gene

MSC: Understanding

9. For a reporter protein to be synthesized, its gene must be fused in the proper codon reading frame with respect to the a. ribosome binding site. b. promoter of the gene of interest. c. vector origin of replication. d. target gene. e. vector’s antibiotic marker sequence.

ANS: D DIF: Medium REF: 12.2 OBJ: 12.1e Compare and contrast transcriptional fusion with translational fusion; include what they assess and how they are constructed MSC: Applying 10. What kind of gene expression controls are revealed by operon fusions? a. transcriptional b. translational c. both transcriptional and translational d. posttranslational e. pretranscriptional ANS: A DIF: Easy REF: 12.1 OBJ: 12.1e Compare and contrast transcriptional fusion with translational fusion; include what they assess and how they are constructed MSC: Applying 11. What type of reporter fusions can expose both transcriptional and translational controls? a. operon fusions b. gene fusions c. either operon fusions or gene fusions d. a fluorescent protein construct such as gfp, yfp, rfp, and so on e. lac operon ANS: B

DIF: Medium

REF: 12.1

OBJ: 12.1e Compare and contrast transcriptional fusion with translational fusion; include what they assess and how they are constructed MSC: Applying 12. Which of the following is correct regarding operon fusions? a. They expose both transcriptional and translational controls. b. Both target and reporter genes have their own promoter sequences. c. Both target and reporter genes have ribosome-binding sites. d. Only the reporter gene has a promoter. e. They produce a single transcript and a single hybrid reporter-target polypeptide.

ANS: C DIF: Medium REF: 12.1 OBJ: 12.1e Compare and contrast transcriptional fusion with translational fusion; include what they assess and how they are constructed MSC: Applying 13. What is the main indication that the figure below depicts a transcriptional (operon) fusion?

a. b. c. d. e.

A single mRNA is transcribed, from which two proteins are translated.

The reporter gene keeps its biological properties: in this case, fluorescence.

Transcription proceeds from a single promoter.

The target gene maintains its ribosomal binding site.

The reporter gene is inserted into the target gene in the proper codon-reading frame.

ANS: A DIF: Difficult REF: 12.1 OBJ: 12.1e Compare and contrast transcriptional fusion with translational fusion; include what they assess and how they are constructed MSC: Analyzing 14. Sigma B is a stress-induced transcription factor in Bacillus subtilis. Bacteria producing a sigma B-YFP fusion protein were exposed to constant energy stress, and fluorescence pulses emitted by individual cells were detected by time-lapse microscopy. Could this result have been obtained using a sigma B--gal fusion protein? a. Yes. Hydrolysis of X-Gal by -galactosidase produces a blue product detectable by eye. b. Yes. Hydrolysis of ONPG by -galactosidase in liquid medium produces an orange compound measurable by spectrophotometry. c. Yes. It depends on how well the reporter gene is inserted into the vector with respect to the position of the ribosome-binding site. d. No. Whereas YFP fluorescence can be carefully observed and measured by time-lapse

microscopy, -gal activity is measured as an average of the population as a whole. e. No; the product would not be detectable by eye.

ANS: D DIF: Medium REF: 12.1 OBJ: 12.1f Identify research questions that would need to be answered at the single-cell level instead of at the population level MSC: Applying 15. Gene fusions of a protein of interest and GFP, or its derivatives, can be used in all of the following EXCEPT a. studying protein targeting to organelles in eukaryotic cells. b. monitoring microbial protein movement inside infected eukaryotic cells. c. tracking viral protein movement inside or between infected eukaryotic cells. d. detecting interactions between microbial extracellular proteins and attachment surfaces. e. CRISPR-Cas9.

ANS: E DIF: Medium REF: 12.1 OBJ: 12.1f Identify research questions that would need to be answered at the single-cell level instead of at the population level MSC: Remembering 16. CRISPR-Cas9, a prokaryotic defense mechanism, is a powerful emerging tool in biotechnology for all of the following EXCEPT a. allowing the editing of defective genes in eukaryotic cells. b. introducing insertions, deletions, or sequence modifications into a given genome with CRISPR-Cas9. c. regulating gene expression in bacteria with CRISPRi, in which case Cas9 is no longer active as a nuclease. d. marking a defective gene with antibiotic resistance. e. disrupting latent HIV provirus in infected cells.

ANS: D DIF: Medium REF: 12.1 OBJ: 12.1f Identify research questions that would need to be answered at the single-cell level instead of at the population level MSC: Remembering 17. Which probing technique detects DNA immobilized on a membrane using labeled DNA fragments? a. northern blot b. southern blot c. western blot d. polyacrylamide gel electrophoresis in SDS e. isoelectrofocusing ANS: B DIF: Easy REF: 12.2 OBJ: 12.2a Differentiate northern blot, southern blot, and real-time PCR MSC: Remembering 18. His6–fusion-tagged proteins can be recovered from affinity chromatography columns because the histidine tag tightly binds to beads coated with ________ ions. The elution buffer contains ________, which has stronger affinity for these ions. a. copper; sulfate d. calcium; EGTA b. magnesium; EDTA e. nickel; imidazole c. iron; citrate ANS: E DIF: Medium REF: 12.3 OBJ: 12.1d Recall the attributes of a reporter gene

MSC: Remembering

19. Advantages in real-time PCR over regular, end-time PCR include all of the following EXCEPT a. initial amounts of template DNA can be quantified by the length of time it takes to detect PCR products. b. amplified DNA is quantified while the PCR is still taking place. c. earlier increments in fluorescence indicate larger amounts of template DNA in the original sample. d. real-time PCR uses GadX. e. real-time PCR can be used to quantify DNA or RNA in a sample.

ANS: D DIF: Easy REF: 12.2 OBJ: 12.2a Differentiate northern blot, southern blot, and real-time PCR MSC: Remembering 20. The phenomenon that allows a quencher dye to reduce the fluorescence of the reporter dye in real-time PCR techniques is called a. nuclear magnetic resonance. b. fluorescence resonance energy transfer (FRET). c. atomic force tunneling. d. magnetic resonance imaging. e. random nicking.

ANS: B DIF: Easy REF: 12.2 OBJ: 12.2a Differentiate northern blot, southern blot, and real-time PCR MSC: Remembering 21. A protein of interest can be specifically detected on western blots; this technique requires all of the following EXCEPT a. primary antibodies produced against the protein under study. b. an enzyme-tagged secondary antibody, directed against the primary antibody. c. an easily detectable product formed by the enzyme in the tagged secondary antibody. d. labeled DNA. e. antibodies to detect quantity and size of specific proteins in cell extracts.

ANS: D DIF: Easy REF: 12.2 OBJ: 12.2b Recall the purpose of a western blot and how it is performed MSC: Remembering 22. In the first stage of the western blot procedure, a technique known as SDS-PAGE is used to separate proteins according to their a. isoelectric points. b. quaternary structures. c. molecular weights. d. amino acid sequences. e. secondary structure compositions.

ANS: C DIF: Easy REF: 12.2 OBJ: 12.2b Recall the purpose of a western blot and how it is performed MSC: Understanding 23. The purpose of a DNA protection assay is to determine what nucleotide sequences directly interact with which macromolecules? a. DNA-binding proteins d. exonucleases b. rRNA e. tRNA c. endonucleases

ANS: A DIF: Medium REF: 12.2 OBJ: 12.2c Compare and contrast the electrophoretic mobility shift assay and the DNA protection assay MSC: Understanding 24. DNA protection assays identify specific nucleotide-protein contacts. What is the role of deoxyribonuclease (DNase) I treatment in footprint analysis? a. DNase I is used to break DNA previously bound to protein. b. Protein-bound DNA is protected from DNase I and it can be isolated and characterized. c. DNase I prepares protein-bound DNA for sequencing. d. DNase I is used to cleave Taq polymerase. e. DNase I synthesizes DNA from the upstream primer.

ANS: B DIF: Medium REF: 12.2 OBJ: 12.2c Compare and contrast the electrophoretic mobility shift assay and the DNA protection assay MSC: Understanding 25. In a DNA protection assay gel, it is necessary to run sequencing ladders of the putative protein-binding DNA region along with DNase I-treated samples in order to a. establish the position of the binding protein relative to the transcription start site. b. provide molecular weight markers. c. check that the gel running conditions are correct. d. check for nonspecific DNA degradation. e. check for specific DNA degradation.

ANS: A DIF: Medium REF: 12.2 OBJ: 12.2c Compare and contrast the electrophoretic mobility shift assay and the DNA protection assay MSC: Understanding 26. The figure below shows a gel with Escherichia coli DNA fragments separated by size. The marker lanes help to locate the transcription start following the promoter region of a gene encoding for glutamate decarboxylase (GadA). There are five lanes from an experiment in which varying amounts of the protein GadX were added to DNA prior to treatment with DNase I. What do the roman numeral boxes indicate?

a. change RNA to DNA. b. topoisomerases-binding regions c. thus not protected

d. translational start e. GADF-binding site

ANS: B DIF: Difficult REF: 12.2 OBJ: 12.2c Compare and contrast the electrophoretic mobility shift assay and the DNA protection assay MSC: Analyzing 27. Double-stranded DNA probes must be denatured when used in northern blot experiments to ensure that a. they are properly radioactively labeled or tagged with a dye. b. the DNA coding strand hybridizes to RNA on the membrane. c. both DNA strands bind the single-stranded RNA on the membrane. d. the RNA coding strand hybridizes to DNA on the membrane. e. an RNA strand binds to another RNA strand on the membrane.

ANS: B DIF: Easy REF: 12.2 OBJ: 12.2a Differentiate northern blot, southern blot, and real-time PCR MSC: Understanding 28. The migration of linear DNA molecules in agarose or polyacrylamide gels occurs at a rate that is a. independent of their size. b. directly proportional to their size. c. inversely proportional to their size. d. dependent on the AT content. e. dependent on the GC content.

ANS: C

DIF: Medium

REF: 12.2

OBJ: 12.2c Compare and contrast the electrophoretic mobility shift assay and the DNA protection assay MSC: Understanding 29. How is bacterial DNA cross-linked to putative binding proteins for chromatin immunoprecipitation (ChIP)? a. exposure to UV light b. treatment with formaldehyde c. treatment with heat d. reduction with dithiothreitol e. reduction with -mercaptoethanol ANS: B DIF: Easy REF: 12.3 OBJ: 12.3a Recall the purpose of ChIP-seq and describe how it is performed MSC: Remembering 30. Which of the following experimental procedures is NOT used in ChIP-seq? a. DNA-protein complexes are cross-linked. b. DNA is extracted and sheared. c. Bead-bound antibodies to transcription factors are used to precipitate transcription factors cross-linked with DNA. d. The bead-bound antibodies are precipitated using a secondary antibody. e. Transcription factors are released from DNA, amplified and identified by sequencing.

ANS: D DIF: Medium REF: 12.3 OBJ: 12.3a Recall the purpose of ChIP-seq and describe how it is performed MSC: Remembering 31. Real-time PCR can be used to quantify the original amount of RNA in a sample. What additional step must be accomplished in this particular application? a. the careful design of specific forward and reverse primers b. RNA must first be converted to cDNA. c. RNA must be denatured with formaldehyde to avoid secondary structures. d. the separation of mRNA from other RNA species e. DNA is converted to RNA. ANS: B DIF: Medium REF: 12.2 OBJ: 12.2a Differentiate northern blot, southern blot, and real-time PCR MSC: Understanding 32. An advantage of using fluorescent protein technology to track protein movements in cells and tissues is that a. intracellular GFP-protein fusions can be detected by fluorescence microscopy in vivo. b. a mobile protein can be tracked as it moves through organs or tissues. c. a fusion with a mutant protein might reveal incorrect localization or movement. d. it can identify the gene encoding prey protein. e. it can be used to detect protein–protein interactions.

ANS: A DIF: Easy REF: 12.3 OBJ: 12.3c Explain how a protein’s intracellular location or movement can be visualized MSC: Understanding 33. The applications of the yeast two-hybrid method include all of the following EXCEPT a. mapping protein–protein interactions in E. coli. b. identifying of physiologically significant protein–protein interactions as potential antibiotic targets.

c. finding unknown proteins (―prey‖) that interact with proteins of known functions (―bait‖). d. mapping protein–protein interactions in M. tuberculosis. e. the ability to probe interactions in vivo.

ANS: D DIF: Easy REF: 12.3 OBJ: 12.3b Define interactome and outline methods to map it

MSC: Remembering

34. In the yeast two-hybrid analysis technique, in vivo protein–protein interactions are explored. The ―bait‖ and ―prey‖ proteins are translationally fused to the cleaved activation and DNA-binding domains of the GAL4 transcription factor. What is the target gene of GAL4? a. lacZ d. lacY b. gadA/B e. lacA c. GAL1 ANS: C DIF: Easy REF: 12.3 OBJ: 12.3b Define interactome and outline methods to map it

MSC: Understanding

35. In a yeast two-hybrid analysis of several strains containing different prey/bait combinations, the screening of interacting proteins is done by growing cells on a medium containing X-Gal. White and blue colonies are observed after incubation. Which of the following statements is NOT true regarding blue/white selection in the yeast two-hybrid method? a. Blue colonies result from X-Gal hydrolyzed by the reporter enzyme -galactosidase. b. White colonies result from cells in which the prey and bait proteins do not interact. c. Galactose released from X-Gal hydrolysis does not contribute to a colony’s blue color. d. White colonies indicate that -galactosidase catalyzed the hydrolysis of X-Gal. e. Blue colonies are an indication that GAL4 activated transcription of GAL1-lacZ. ANS: D DIF: Medium REF: 12.3 OBJ: 12.3b Define interactome and outline methods to map it

MSC: Understanding

36. Genes coding for insecticidal peptides have been engineered into the genomes of some crops.

Which of these peptides are naturally produced by the bacterium? a. Bacillus thuringiensis d. Erwinia carotovora b. Agrobacterium tumefaciens e. Escherichia coli c. Anabaena variabilis ANS: A DIF: Easy REF: 12.4 OBJ: 12.4a List some examples of applied biotechnology

MSC: Remembering

37. Bacillus thuringiensis stores insecticidal proteins a. surrounding the spore. b. in the cytoplasm. c. as proteins crystallized in the parasporal body. d. as part of the spore. e. in the plasma membrane.

ANS: C DIF: Easy REF: 12.4 OBJ: 12.4a List some examples of applied biotechnology 38. Potential vaccine antigens made by transgenic plants include a. foot-and-mouth surface antigen. b. Norwalk virus glycoprotein. c. rabies virus glycoprotein. d. Entertoxin A subunit. e. Hepatitis A virus.

MSC: Understanding

ANS: C DIF: Easy REF: 12.4 OBJ: 12.4a List some examples of applied biotechnology

MSC: Remembering

39. Which technique is used to select novel enzymes or peptides produced through directed evolution? a. mutagenesis with transposons b. enzyme phage display c. multiplex PCR d. ethane methyl sulfonate mutagenesis e. directional cloning ANS: B DIF: Easy REF: 12.4 OBJ: 12.4b Describe what phage display is and recall some applications for it MSC: Understanding 40. The uses for phage display include all the following EXCEPT a. antibody fragments cloned from synthetic sources. b. the identification of high-affinity peptides that bind to attachment proteins of some eukaryotic viruses and effectively block viral infection. c. antibody fragments cloned from natural sources. d. collections of mutant enzymes to be tested for activity. e. directed evolution projects.

ANS: D DIF: Easy REF: 12.4 OBJ: 12.4b Describe what phage display is and recall some applications for it MSC: Remembering 41. Which kind of phage vectors are most frequently used in phage display technology? a. double-stranded DNA T-odd b. double-stranded DNA T-even c. filamentous single-stranded DNA phages d. lambda-based vectors e. alpha-based vectors ANS: C DIF: Easy REF: 12.4 OBJ: 12.4b Describe what phage display is and recall some applications for it MSC: Applying 42. What is the simplest definition of a genetic ―logic gate‖? a. a promoter (which interacts with input signals such as regulatory proteins) and a gene, which produces mRNA and protein (output signal) b. The interaction among proteins and specific DNA sequences modulate gene expression. c. the combination of genetic elements from different organisms to engineer a novel metabolic pathway or reproduce one in vivo d. determine whether a gfp gene is turned on or off e. bind inducer molecules and have an effect on gene expression ANS: A DIF: Medium REF: 12.5 OBJ: 12.5b Distinguish among different genetic logic gates and switches, and describe how they are built MSC: Applying 43. A ―buffer gate‖ in synthetic biology can best be described as a. a single repressor molecule (R1) that prevents the production of an output molecule (Pr1). b. alternate input molecules (I1 or I2) that drive the production of alternative proteins (Prn). c. a single input inducer molecule (I1) that leads to the production of a single product (Pr1). d. kill switches.

e. a potent DNA-damaging toxin.

ANS: C DIF: Medium REF: 12.5 OBJ: 12.5b Distinguish among different genetic logic gates and switches, and describe how they are built MSC: Analyzing 44. In the figure below, the labels for the genetic logic gates are missing. Which answer choice locates them correctly?

a. i) Buffer, ii) NOT, iii) OR b. i) NOT, ii) Buffer, iii) OR c. i) Buffer, ii) OR, iii) NOT

d. i) OR, ii) Buffer, iii) NOT e. i) NOT, ii) OR, iii) Buffer

ANS: C DIF: Medium REF: 12.5 OBJ: 12.5b Distinguish among different genetic logic gates and switches, and describe how they are built MSC: Analyzing 45. Potential applications of bacterial oscillator switches include all of the following EXCEPT the a. study of controlled interactions between two feedback genetic loops. b. design of bacterial genetic circuits to detect toxins. c. design of bacterial clocks. d. reduction of noise in biological circuits. e. reactivity to concentrations of specific molecules such as arabinose.

ANS: D DIF: Easy REF: 12.5 OBJ: 12.5b Distinguish among different genetic logic gates and switches, and describe how they are built MSC: Applying 46. Which of the following is correct regarding biological toggle switches? a. They can be thought of as two back-to-back OR gates. b. They can be described as straightforward ―buffer gates.‖ c. They consist of a single NOT gate. d. Two inducer signals are necessary to toggle the switch. e. They have two repressor genes whose products can repress each other’s transcription.

ANS: E DIF: Medium REF: 12.5 OBJ: 12.5b Distinguish among different genetic logic gates and switches, and describe how they are built MSC: Applying

47. The replacement of the genome of Mycoplasma capricolum with the modified genome of M. mycoides is considered to be a significant accomplishment because it a. demonstrates that genetic manipulation of recalcitrant organisms is impossible. b. opens the possibility to redesign prokaryotic genomic systems. c. enables gene editing of species. d. merges the genomes into a hybrid. e. creates a riboswitch board.

ANS: B DIF: Medium REF: 12.5 OBJ: 12.5e Appraise the contributions of BioBricks and complete genome transplants to synthetic biology MSC: Understanding 48. The role of kill switches in genetically engineered microorganisms is to a. serve as a fail-safe mechanism to timely kill the organisms after they have fulfilled their purpose. b. induce proliferation of reproduction to kill a host cell. c. destroy organisms that have a risk of biological contamination or invasion. d. block the translation of CcdB. e. elimiate toxins within the cell.

ANS: D DIF: Easy REF: 12.5 OBJ: 12.5b Distinguish among different genetic logic gates and switches, and describe how they are built MSC: Applying 49. The type of genes that encode proteins whose activity is easily assayed are a. deep sequencing genes. d. reporter genes. b. transcriptional fusions. e. translational fusions. c. operons.

ANS: D DIF: Medium REF: 12.1 OBJ: 12.1c Evaluate the merits of transcriptomic approaches verses reporter fusions for deciphering gene regulation MSC: Remembering 50. Existing biocontainment strategies employ natural auxotrophies that are not easily met in natural, or conditional suicide switches introduced into the organism’s genome. However, these mechanisms can be compromised through a. genetic mutation. d. logic gates. b. synthetic auxotrophy. e. genetic circuit. c. synthetic biology.

ANS: A DIF: Medium REF: 12.4 OBJ: 12.4c Justify the need for biocontainment strategies | 12.4d Differentiate among biocontainment strategies MSC: Understanding 51. Scientists have taken the genome of the bacterial species ________ and moved it to yeast. a. Mycobacterium leprosae d. Escherichia coli b. Mycobacterium tuberculosis e. Mycoplasma pneuomoniae c. Mycoplasma mycoides ANS: C DIF: Medium REF: 12.5 OBJ: 12.5c Design a genetic circuit to perform a specific task 52. Noise in synthetic biology is a result of the a. ara operon.

MSC: Remembering

b. c. d. e.

lac operon. dual-feedback oscillator. fluctuation of gene expression among single-cells in a population. oscillatory genetic circuit.

ANS: D DIF: Medium REF: 12.1 OBJ: 12.5d Explain how noise affects synthetic biology circuits and how researchers minimize the effects of noise MSC: Remembering SHORT ANSWER 1. In isolating acid-sensitive Escherichia coli using tetracycline-resistant transposons, why is it necessary to screen first for tetracycline resistance and then for acid sensitivity?

ANS: One screens first for tetracycline resistance to determine which colonies derive from cells in which the transposon has integrated into the chromosome. The resistant colonies are transferred to a microtiter plate, where they can be grown and maintained. A sample from each well is placed in wells containing medium at pH 2 and subsequently transferred to medium at a neutral pH. Cell survival indicates acid resistance. We wish to isolate acid-sensitive cells, those that would not grow at pH 2. That is the reason it is necessary to have cells to go back to the microtiter plates.

DIF: Easy REF: 12.1 OBJ: 12.1a Describe how mutants help researchers answer biological questions MSC: Understanding 2. Use the figure below to describe the model of acid resistance in Escherichia coli O157:H7. Make sure to identify the molecules involved using the letters on the figure.

ANS:

[1] Internal pH falls when E. coli cells are in a highly acidic medium, such as the stomach, where pH is 2 or lower. [2] The acidification of the bacterial cytoplasm, to pH 4–5, activates glutamate decarboxylase (GadA/B) activity. The enzyme removes a carboxyl group from glutamate (B) and replaces it with a cytoplasmic proton to form -aminobutyric acid (GABA; C). [3] Proton incorporation in GABA increases cytoplasmic pH but requires more glutamate, which enters the cell as GABA leaves through the GadC antiporter (A). The net effect is removal of H from the cell.

DIF: Medium REF: 12.1 OBJ: 12.1a Describe how mutants help researchers answer biological questions MSC: Analyzing 3. How do operon fusions reveal transcriptional control of a target gene?

ANS: Operon (transcriptional) fusions have a target gene that carries its own promoter and ribosome-binding site (RBS). The target gene has a promoterless reporter gene that also has an RBS. Transcription solely depends on the target gene’s promoter; hence, a single mRNA is produced. However, two peptides are independently produced, as a result of having two RBSs. Gene expression from this artificial single-promoter operon only reflects transcriptional control.

DIF: Medium REF: 12.1 OBJ: 12.1e Compare and contrast transcriptional fusion with translational fusion; include what they assess and how they are constructed MSC: Applying 4. What are translational fusions used for? How are they constructed?

ANS: Translational fusions are designed to expose both transcriptional and translational controls of a target gene. They possess a reporter gene that lacks a promoter and ribosome-binding site (RBS).

The reporter gene is spliced into the target gene, which has its own promoter and RBS; thus, mRNA production is directed by the target gene’s promoter, and the translation of a single hybrid peptide depends on the lone RBS carried by the target gene.

DIF: Medium REF: 12.1 OBJ: 12.1e Compare and contrast transcriptional fusion with translational fusion; include what they assess and how they are constructed MSC: Applying 5. Use the figure below to describe how the CRISPR-Cas9 editing tool is used in eukaryotic cells.

ANS: [1] The Streptococcus pyogenes Cas9 endonuclease can be used to knock out or replace genes in eukaryotic cells if it contains a single guide RNA (gRNA) fused to the tracer RNA, an activator of Cas9. Plasmids encoding genes for Cas9 and gRNA are introduced into eukaryotic cells. After production of Cas9 and assembly with gRNA, one of the target DNA strands binds the gRNA sequence. The DNA is cleaved and it may undergo alternate fates: either [2] the eukaryotic cell’s nonhomologous end-joining (NHEJ) system generates random deletions and frameshift mutations, de facto achieving knockouts, or [3] an alternative allele is provided (e.g., in a plasmid). DNA repair systems will replace the damaged gene with an alternative, undamaged allele.

DIF: Difficult REF: 12.1 OBJ: 12.1g State the tasks performed by the CRISPR-Cas9 system MSC: Applying 6. How were GadE and GadX demonstrated to be transcription factors for the gadA gene?

ANS: Footprint analysis can be used to find out what nucleotides in a DNA fragment directly interact with DNA-binding proteins. The principle is that the DNA region bound by protein is protected from endonuclease activity (e.g., DNase I). After disruption of the protein-DNA interactions, protected DNA fragments are electrophoretically separated in a gel along with protein-free DNA that had been treated with DNase I under the same conditions. A set of sequencing reactions help in localizing the transcriptional start site and nucleotides that directly bind the protein, as only one of the DNA strands is labeled and migrates to a position that matches one base of the sequencing reactions. Both GadE and GadX protect several regions upstream of the transcriptional start of gadA. DIF: Easy REF: 12.2 OBJ: 12.2c Compare and contrast the electrophoretic mobility shift assay and the DNA protection assay MSC: Analyzing 7. Both southern and northern blots involve the use of agarose gels. How do the types of agarose gels differ and why?

ANS: A typical, nondenaturing agarose gel is used to separate the DNA in preparation for a southern blot. For a northern blot, the RNA is fractionated by electrophoresis on an agarose-formaldehyde gel. The formaldehyde is present to keep the RNA denatured, thus preventing base pairing and secondary structures.

DIF: Easy REF: 12.2 OBJ: 12.2a Differentiate northern blot, southern blot, and real-time PCR MSC: Applying 8. Describe the difference between autoradiography and phosphor imaging.

ANS: In autoradiography, emissions from a radioactive compound are exposed to X-ray film, which is photographically developed. Phosphor imaging uses a screen that detects light or radioactivity and saves the images in digital format. Both detect emissions from either a membrane or gel.

DIF: Medium REF: 12.2 OBJ: 12.2a Differentiate northern blot, southern blot, and real-time PCR MSC: Applying 9. What is the principle of the electrophoretic mobility shift assay (EMSA)? What is its main application? Mention a possible limitation.

ANS: Migration rate of linear DNA molecules in agarose or polyacrylamide gel electrophoresis is inversely proportional to the molecule size. A protein tightly bound to a DNA fragment will restrain its movement, and as a result its position in a gel will be noticeably different with respect to that of protein-free DNA under the same conditions. This method does not reveal what specific nucleotides are responsible for the DNA-protein interaction, and foot-printing analysis may be necessary to confirm that the protein under study is indeed a transcriptional regulator.

DIF: Difficult REF: 12.2 OBJ: 12.2c Compare and contrast the electrophoretic mobility shift assay and the DNA protection assay MSC: Applying 10. Observe the figure below and discuss how a single northern blot can reveal differences in size and abundance of the E. coli acid-resistance gene gadA with respect to the gadBC operon and the inducible expression of these genes at low pH.

ANS: RNA extracted from cells grown at pH 7.7 and at 5.5 was separated in a denaturing agarose-formaldehyde gel along with molecular weight markers, then transferred to a nitrocellulose or nylon membrane and hybridized with a labeled DNA gadA/B probe. RNA from cells cultured at pH 5.5 shows bands corresponding to the individual gene gadA and the operon gadBC mRNA. These bands are more intense than those seen in RNA from the cultures grown at pH 7.7, thus confirming their induction under acidic conditions. From its position in the gel and its hybridization intensity, the gadA transcript is shorter and more abundant than that of the operon gadBC. DIF: Difficult REF: 12.2 OBJ: 12.2b Recall the purpose of a western blot and how it is performed MSC: Applying 11. Describe the use of a primary and secondary antibody in a western blot.

ANS: The primary antibody is directed against the protein of interest in the particular study. It is produced in a mammal—for example, a rabbit—and therefore will be called a rabbit antibody. The secondary antibody will be made in another mammalian species to recognize any type of rabbit antibody. It could be, for example, a goat-antirabbit antibody. Furthermore, it would have attached to it either a color-producing or chemiluminescence-producing enzyme so that we could ultimately visualize the position of the protein on a membrane to which the antibodies become bound.

DIF: Difficult REF: 12.2 OBJ: 12.2a Differentiate northern blot, southern blot, and real-time PCR MSC: Applying 12. What is the conceptual basis of the primer extension technique?

ANS: Given a translatable mRNA, the regions of the gene that are recognized and bound by transcription factors can be found by extending an mRNA-derived cDNA toward its 5'-end, upstream of the translational start codon. This is achieved by using reverse transcription with a primer designed for a region within the open reading frame of the cDNA near the 5'-end; that way the cDNA will include the previously unknown transcriptional start site and the transcription factor binding sites.

DIF: Difficult REF: 12.3 OBJ: 12.2c Compare and contrast the electrophoretic mobility shift assay and the DNA protection assay MSC: Applying 13. How can a protein be detected on a western blot?

ANS: A sample of the protein of interest is injected into a mammal in a certain species and, after a period of time, the animal’s serum is obtained. This primary antiserum contains antibodies (immunoglobulins G or IgGs), which are isolated and injected into another animal of a different species to elicit an immune response. This animal’s secondary antiserum contains specific antibodies against the first animal’s IgGs. The anti-IgG secondary antibodies thus produced can be tagged with an enzyme, such as horseradish peroxidase, that can use a color- or luminescence-producing substrate. Tag-free primary antibodies efficiently react with the protein of interest immobilized on the western blot. In turn, enzyme-tagged secondary antibodies bind primary IgGs, allowing detection by color or luminescence.

DIF: Difficult REF: 12.3 OBJ: 12.2b Recall the purpose of a western blot and how it is performed MSC: Analyzing 14. Briefly explain how real-time polymerase chain reaction (PCR) works.

ANS: Real-time PCR utilizes a reporter probe that has a reporter dye attached at its 5'-end and a quencher dye attached at its 3'-end. As long as the reporter probe remains intact, the quencher dye absorbs the energy emitted by the reporter dye, and therefore it is not detected. It is important that the reporter probe binds downstream from the primer. Real-time PCR identifies when Taq polymerase has synthesized DNA from the upstream promoter. The 5'3' exonuclease activity of Taq polymerase will cleave the reporter probe as DNA is synthesized. When the reporter dye is ―removed‖ from the quencher dye, fluorescence will be observed. Excess reporter probe is present in the reactions, which means that at each round of synthesis, more reporter probe will bind to newly synthesized template. Higher fluorescence indicates increased synthesis, corresponding to larger initial template levels.

DIF: Difficult REF: 12.2 OBJ: 12.2a Differentiate northern blot, southern blot, and real-time PCR MSC: Evaluating 15. Describe the whole-genome DNA-binding analysis using ChIP-on-chip technology.

ANS:

This technique is useful in determining all the in vivo binding sites for a protein in a given bacterial genome. It takes advantage of the existence of microarrays that contain amplified small DNA fragments representing the entire genome of a bacterium. A putative DNA-binding protein (e.g., a transcription factor) will be specifically bound to certain sequences. Other proteins will bind as well. Proteins are cross-linked to DNA inside the cell. The DNA is extracted and sheared to small pieces. The DNA fragments bound to the protein of interest are immunoprecipitated with bead-bound antibodies to the protein and collected. Coprecipitated DNA is separated from the protein by heating. Linkers are added to both ends of the released DNA, and PCR is used to amplify these DNA fragments with fluorescence-tagged primers designed to the linkers. The amplicons are hybridized to a microarray chip. Fluorescent spots on the chip will precisely indicate what genomic regions were originally bound to the protein and which genes it likely controls.

DIF: Difficult REF: 12.3 OBJ: 12.3a Recall the purpose of ChIP-seq and describe how it is performed MSC: Applying 16. Discuss possible disadvantages of the yeast two-hybrid system.

ANS: Because putative interacting proteins are overexpressed, results can be difficult to interpret. Weak in vivo interactions may be amplified to levels not seen under physiological conditions, whereas strong interactions may be underestimated.

DIF: Medium REF: 12.3 OBJ: 12.3b Define interactome and outline methods to map it

MSC: Applying

17. What is synthetic biology? Provide an example of its potential applications.

ANS: Synthetic biology is the conception and building of biological systems that do not exist in nature.

This is accomplished by creating chimeric gene circuits that result in novel gene expression patterns and biochemical pathways. At the present time, genetic switches offer realistic capabilities of bacterial-based computing and the potential to use these circuits in the detection of toxins, explosives, and other nocive chemicals.

DIF: Medium REF: 12.5 OBJ: 12.5a Define synthetic biology and state some applications MSC: Applying 18. How is the concept of ―logic gates‖ used in synthetic biology?

ANS: The principles of ―logic gates‖ derive from electrical engineering. In genetic circuits, regulatory proteins acting on promoters are the input signals, whereas the output signals consist of mRNA and protein biosynthesis. ―Buffer gates‖ refer to signal amplification, ―NOT gates‖ describe promoter expression, and ―OR gates‖ represent the involvement of several genes in a genetic circuit.

DIF: Medium REF: 12.5 OBJ: 12.5b Distinguish among different genetic logic gates and switches, and describe how they are built MSC: Applying 19. Explain the principle of riboswitches and switchboards, and provide examples of their application.

ANS: Gene-specific RNAs (riboswitches) have been engineered to control translation at will. The concept of riboswitches is based on the phenomenon of mRNA stability and translation regulated by small RNAs. Initially, a cis-repressed mRNA (crRNA) is made by linking a crRNA sequence to an output gene; the crRNA transcript displays a 5'-hairpin structure that covers the ribosome-binding site (RBS). A matching trans-activating (taRNA) is added to the system to allow base-pairing with the crRNA and exposing the RBS, thus leading to ribosome binding and translation. Applications of this technique include simultaneous regulation of several metabolic pathways via a set of linked riboswitches (a metabolic switchboard). Another important potential application is the development of kill switches, or fail-safe mechanisms, leading to the suicide of genetically modified organisms after they have fulfilled their function.

DIF: Difficult REF: 12.5 OBJ: 12.5b Distinguish among different genetic logic gates and switches, and describe how they are built MSC: Evaluating 20. The figure below depicts a ―kill switch‖ or suicide module designed to eliminate an organism at a predetermined point, namely once the microorganism’s function is accomplished. Explain how this kill switch can be regulated to prevent the untimely death of a microorganism harboring it.

ANS: CcdB is a powerful DNA damaging toxin. The ccdB gene was linked to the tetracycline-repressed promoter PLtetoO, which is repressed by the TetR protein. If tetracycline or an analog binds TetR, the protein is released from the ccdN promoter. CcdB is produced and the cell is killed. To prevent the organism from killing itself too early, translation of CcdB mRNA is blocked by a cis-repressed RNA (CR on the figure). A compensatory trans-activating RNA (TA on the figure), activated by arabinose, helps to expose the ribosomal binding site (RBS) contained in the crRNA-CcdB message. Both arabinose and tetracycline must be present concurrently for the cell to produce CcdB and kill itself. Practical uses of these switches are in the works with the idea of tying the repression of CcdB by an environmental contaminant. This way, after the organism destroys the contaminant, the kill switch will be turned on.

DIF: Difficult REF: 12.5 OBJ: 12.5b Distinguish among different genetic logic gates and switches, and describe how they are built MSC: Evaluating

CHAPTER 13: Energetics and Catabolism MULTIPLE CHOICE

1. Which of the following statements is NOT true regarding the electron donors in prokaryotic metabolism? a. The use of organic compounds as electron donors is known as organotrophy. b. Chemolithotrophy refers to the use of inorganic molecules as electron sources. c. Photolysis of water provides electrons to phototrophic organisms such as cyanobacteria. d. Electrons can be obtained from inorganic chemicals such as H2S. e. Oxygen can serve as an electron donor.

ANS: E DIF: Easy REF: 13.1 OBJ: 13.1b Categorize microbes based on how they acquire energy MSC: Remembering 2. Chemoorganotrophy is a term describing microorganisms that a. use preformed organic compounds as a source of electrons and obtain energy through fermentations or organic respiration. b. obtain electrons and H via photolysis of H2O or H2S, producing O2 or S2, respectively. c. perform photolysis of small organic molecules. d. use carbon dioxide as the carbon source. e. pull electrons off minerals to donate to electron transport systems.

ANS: A DIF: Difficult REF: 13.1 OBJ: 13.1b Categorize microbes based on how they acquire energy MSC: Understanding 3. A bacterium capable of producing methane and water from carbon dioxide and hydrogen performs a type of metabolism called ________ and, given its sources of electrons, it is a ________. a. methanogenesis; chemolithotroph b. respiration; heterotroph c. fermentation; chemoorganotroph d. carbon fixation; phototroph e. sulfur bacterium; chemolithotroph ANS: A DIF: Medium REF: 13.1 OBJ: 13.1b Categorize microbes based on how they acquire energy MSC: Understanding 4. The laws of thermodynamics indicate that systems tend to become less ordered and that ________, a measure of disorder or randomness of the universe, always increases. a. entropy d. molecular stability b. enthalpy e. activation energy c. Gibbs free energy ANS: A DIF: Easy REF: 13.1 OBJ: 13.1c Use the Gibbs free energy change to determine if a given metabolic reaction can supply a cell with energy MSC: Remembering 5. The Gibbs equation describes the relationship between the components of free energy change and can be generally expressed as a. G  G°  RT ln Keq. b. G  H  TS. c. ADP  Pi  ATP  H2O. d. K  T°C  273. e. G  2.303 RT log [C] [D] / [A] [B].

ANS: B

DIF: Easy

REF: 13.1

OBJ: 13.1c Use the Gibbs free energy change to determine if a given metabolic reaction can supply a cell with energy MSC: Remembering 6. Which of the following statements is FALSE with respect to heterotrophic organisms? a. They use preformed organic compounds for biosynthesis. b. Most organotrophs are also heterotrophs. c. Along with decomposers, they are ecologically defined as consumers. d. Some can generate methane as an end product. e. They utilize glycolysis and other pathways to generate energy.

ANS: D DIF: Medium REF: 13.1 OBJ: 13.1b Categorize microbes based on how they acquire energy MSC: Understanding 7. Hydrogen-generating reactions in Syntrophus and Syntrophomonas have G°' > 0. Can these organisms obtain energy from hydrogen formation? a. No, they cannot. b. No—they produce energy by breaking down molecules such as benzoate or butyrate. c. Yes—hydrogen-producing microorganisms coexist in syntrophy with H2-consuming bacteria. Utilization of H2 (G°'  0) drives the process forward. d. Yes, but only when oxygen is present. e. Yes—this happens in sewage but never in a laboratory setting.

ANS: C DIF: Difficult REF: 13.1 OBJ: 13.1a Define catabolism, energy, enthalpy, entropy, and syntrophy MSC: Analyzing 8. Using the table below, what is the best method for obtaining energy from catabolizing ethanol, and why?

a. the catabolism of ethanol without an oxidant, because the G is almost positive b. the oxidation of ethanol with as the oxidant is because of the large yield of energy released c. the oxidation of ethanol with oxygen, because the G is the largest negative number indicating the large yield of energy released. d. The oxidation of ethanol yields too little biomass to be catabolized. e. None—ethanol can only be catabolized syntrophically.

ANS: D

DIF: Difficult

REF: 13.1

OBJ: 13.1c Use the Gibbs free energy change to determine if a given metabolic reaction can supply a cell with energy MSC: Evaluating 9. In amphibolic pathways, enzymes do NOT a. function only in the biosynthetic direction. b. function only in the catabolic direction. c. function in both directions. d. carry out reactions that are otherwise thermodynamically impossible. e. have activity dependent on concentrations of reactants and products.

ANS: D DIF: Medium REF: 13.1 | 13.5 OBJ: 13.1c Use the Gibbs free energy change to determine if a given metabolic reaction can supply a cell with energy | 13.5g Define amphibolic reactions and describe their regulation MSC: Understanding 10. A metabolic process allowing for anaerobic degradation of benzoate to acetate is diagrammed below. This metabolism can happen because

a. benzoate contains a great deal of energy and ATP can be made. b. the catabolism of benzoate by the cell on the left produces hydrogen that is then used by the cell on the right to reduce sulfate. c. the catabolism of benzoate by the cell on the left produces hydrogen that is then used by a methanogen. d. the catabolism of benzoate to acetate releases so much energy that it overcomes the positive G of H2 production. e. the cell on the left swims away from the H2 that it produces in order to balance the thermodynamics.

ANS: B DIF: Difficult REF: 13.2 OBJ: 13.2c Express the relationship between DeltaG° and DeltaG; include the effect of changing concentrations of reactants and products MSC: Analyzing 11. In most environments, the nutrient concentrations outside the cell are lower than inside the cell. If the concentration gradient is NOT favorable, a microbial cell obtains nutrients through a. active, energy-dependent transport. d. forming biofilms. b. facilitated diffusion. e. simple diffusion.

c. swim and tumble.

ANS: A DIF: Easy REF: 13.2 OBJ: 13.2d Describe the relationship between energy and concentration gradients MSC: Remembering 12. When studying an enzymatic reaction, should one consider G, G0, or G0' when considering the thermodynamics of the reaction, and why? a. G0, because it considers standard conditions as well as biochemically relevant conditions such as the concentrations of substrates and products b. G0, because it considers standard conditions c. G, because it considers defined conditions such as pH d. G, because it considers concentrations of reactants as products. e. G0, because it considers entropy and enthalpy.

ANS: A DIF: Medium REF: 13.2 OBJ: 13.2a Recall the conditions required for the standard Gibbs free energy change, DeltaG°, and the biochemical Gibbs free energy change, DeltaG°’ MSC: Understanding 13. What technique can be used to determine entropy and enthalpy changes associated with biochemical reactions? a. nuclear magnetic resonance d. mass spectroscopy b. calorimetry e. measurement of light levels c. electron microscopy ANS: B DIF: Easy REF: 13.1 OBJ: 13.1c Use the Gibbs free energy change to determine if a given metabolic reaction can supply a cell with energy MSC: Understanding 14. Which of the following phenomena is sufficient to transport nutrients to cells that lack chemotactic motility? a. active, ATP-dependent transport d. quorum sensing b. diffusion e. biofilm formation c. turbulent flow ANS: B DIF: Easy REF: 13.2 OBJ: 13.2d Describe the relationship between energy and concentration gradients MSC: Understanding 15. Glycolytic reactions with a near-zero G°' can participate in the overall pathway of gluconeogenesis because they a. are irreversible. b. are reversible. c. contradict the laws of thermodynamics. d. have low energy of activation values. e. do not depend on concentrations of reactants and products.

ANS: B DIF: Medium REF: 13.2 OBJ: 13.2c Express the relationship between DeltaG° and DeltaG; include the effect of changing concentrations of reactants and products MSC: Understanding 16. The G for a reaction can be calculated by using G0 and adding in a. entropy, enthalpy, and the log of the ratio of reactants to products. b. entropy, enthalpy, pH, and the log of the ratio of the reactants to products. c. the gas constant, absolute temperature, and the log of the ratio of the reactants to products.

d. the log of the ratio of the reactants to products. e. the gas constant, absolute temperature, pH, and the log of the ratio of the reactants to products.

ANS: C DIF: Medium REF: 13.2 OBJ: 13.2c Express the relationship between DeltaG° and DeltaG; include the effect of changing concentrations of reactants and products MSC: Analyzing 17. In their work with soil bacteria, McInerney and colleagues have found microorganisms that display metabolic pathways with net G values as small as 20 kJ/mol. This is an example of a. the capacity of microorganisms to conquer a wide variety of environments. b. microorganisms contradicting the laws of thermodynamics. c. growth near thermodynamic equilibrium. d. growth that depends on the concentration of reactants but not products. e. enthalpic growth.

ANS: C DIF: Medium REF: 13.2 OBJ: 13.2b Calculate the DeltaG°' of a coupled reaction

MSC: Evaluating

18. The molecule shown below carries energy in the cell but it needs to be stabilized. It is a ________ molecule and is stabilized when it ________.

a. b. c. d. e.

NADPH; forms a cyclic molecule NADPH; complexes with Mg2 ATP; donates its electrons to a cytochrome ATP; complexes with Mg2 ATP; forms a cyclic molecule

ANS: D DIF: Difficult REF: 13.3 OBJ: 13.3c Compare and contrast ATP and NADH

MSC: Analyzing

19. In many bacteria, the electron carrier ________ is used for biosynthesis, whereas ________ feeds the electron transport system. a. NADPH; NADH d. chlorophyll; NADPH b. FADH2; NADPH e. pyruvate; acetyl-S-CoA c. NADH; acetyl-S-CoA ANS: A DIF: Easy REF: 13.3 OBJ: 13.3b Define energy carriers and provide examples

MSC: Remembering

20. All of the following are reasons to oxidize glucose in a series of steps EXCEPT to a. generate smaller amounts of energy in a controlled fashion and when needed. b. control the usage of energy in a cell by using more steps. c. minimize the release of heat with more small steps. d. control the catabolism versus biosynthetic aspects of oxidizing glucose via concentrations of reactants and end products.

e. increase the DG of the reaction.

ANS: E DIF: Medium REF: 13.1 OBJ: 13.3a Explain why glucose is oxidized in a series of steps instead of a single step MSC: Understanding 21. Which of the following is FALSE with respect to enzymes that use the reducing equivalents NADH and NADPH? a. Some enzymes only use NADH. b. Some enzymes only use NADPH. c. Some enzymes may use either NADPH or NADH. d. FADH2 can be used as a substitute. e. NADPH is more often used in biosynthesis.

ANS: D DIF: Easy REF: 13.3 OBJ: 13.3d Recall why metabolic reactions require enzymes

MSC: Remembering

22. The graph shown below diagrams the energy involved in the

a. difference in activation energy of a reaction with and without an inhibitor at an allosteric site. b. difference in the activation energy of a reaction with and without an enzyme. c. activation energy needed to initiate the Embden-Meyerhof pathway. d. difference in synthrophic reactions with and without a hydrogen utilizing partner. e. difference in activation energy with NADH versus NADPH. ANS: B DIF: Difficult REF: 13.3 OBJ: 13.3d Recall why metabolic reactions require enzymes

MSC: Evaluating

23. The base adenine forms from ________ in experiments simulating the origin of life on Earth. a. carbon dioxide and nitrate d. adenosine and PO4 b. ethanol and urea e. ribose and RNA c. methane and ammonia ANS: C DIF: Medium REF: 13.3 OBJ: 13.3b Define energy carriers and provide examples

MSC: Remembering

24. Hydrolysis of ATP with the release of pyrophosphate is the driving force of which of the following reactions? a. DNA and RNA synthesis b. peptide bond formation c. fatty acid synthesis d. transport across a membrane e. production of glucose-6-phosphate from glucose ANS: A DIF: Medium REF: 13.3 OBJ: 13.3b Define energy carriers and provide examples

MSC: Remembering

25. Not all enzymes are proteins; in some enzymes, the catalytic properties depend on a. DNA. d. lipids. b. RNA. e. terpenoids. c. polysaccharides.

ANS: B DIF: Medium REF: 13.3 OBJ: 13.3d Recall why metabolic reactions require enzymes

MSC: Remembering

26. Although ATP is the main energy carrier in living organisms, other molecules may also serve as energy carriers in metabolic reactions. Which of the following molecules does NOT carry energy? a. nucleotides such as GTP d. glucose b. phosphoenolpyruvate e. nucleotides such as CTP and UDP c. creatine phosphate ANS: D DIF: Medium REF: 13.3 OBJ: 13.3b Define energy carriers and provide examples

MSC: Understanding

27. The activity of the enzyme below is controlled in various ways using several of the binding sites shown. The two sites are the ________ site and the ________ site.

a. active; inhibitor b. catalytic; inhibitor

d. substrate; allosteric e. catalytic; allosteric

c. substrate; inhibitor ANS: E DIF: Medium REF: 13.3 OBJ: 13.3d Recall why metabolic reactions require enzymes

MSC: Analyzing

28. Which of the following is NOT correct with respect to the redox pair NAD/NADH? a. The nicotinamide ring is a relatively stable aromatic structure. b. The nicotinamide ring is a heteroaromatic because it has a noncarbon atom in position 4. c. The nicotinamide ring may accept two electrons at carbon 1, becoming a nonaromatic ring. d. The reduced, nonaromatic ring of NADH is at a higher energy than the aromatic ring of NAD. e. NADH can accept electrons from an electron transport system.

ANS: E DIF: Difficult REF: 13.3 OBJ: 13.3b Define energy carriers and provide examples

MSC: Analyzing

29. The enzyme pyruvate kinase catalyzes the conversion of phosphoenolpyruvate to pyruvate; the phosphate group is transferred to ADP to form ATP. This reaction is an example of a. ATP synthesis by substrate-level phosphorylation. b. the use of a proton concentration gradient by [H]-ATPases to synthesize ATP. c. ATP coupled to FADH2 oxidation. d. a P-Type ATPase activity. e. oxidative phosphorylation.

ANS: A DIF: Easy REF: 13.3 | 13.5 OBJ: 13.3c Compare and contrast ATP and NADH

MSC: Understanding

30. Which of the following pairs is mismatched? a. Embden-Meyerhof-Parnas pathway—2 ATP, 2 NADH b. Entner-Doudoroff pathway—1 ATP, 1 NADH, and 1 NADPH c. pentose phosphate pathway—1 ATP, 2 NADPH d. glyoxylate bypass—2 NADH, 1 FADH2 e. bacterial tricarboxylic acid cycle—3 NADH, 1 FADH2, 1 ATP ANS: D DIF: Medium REF: 13.5 OBJ: 13.5a Compare and contrast fermentation and respiration; include substrates, products, mode of ATP production, and ATP yield MSC: Understanding 31. The process of prioritized consumption of substrates is known as catabolite a. induction. d. repression. b. poisoning. e. attenutation. c. competition.

ANS: D DIF: Medium REF: 13.4 OBJ: 13.4a Compare and contrast carbohydrates, lipids, peptides, and aromatic molecules as substrates for microbial metabolism MSC: Understanding 32. Disparate animal groups, such as ruminants and humans, can digest a variety of plant fibers because they harbor cellulase-producing bacteria such as a. Staphylococcus aureus and Bacillus subtilis. b. Salmonella and Shigella. c. Escherichia coli and Enterococcus faecalis. d. Bacteroides and Ruminococcus. e. Escherichia chrysanthemi and Erwinia uredovora.

ANS: D DIF: Medium REF: 13.4 OBJ: 13.4a Compare and contrast carbohydrates, lipids, peptides, and aromatic molecules as substrates for microbial metabolism MSC: Analyzing 33. Fatty acids enter the TCA cycle after being degraded to what molecule? a. acetyl-phosphate d. citrate b. malonyl-S-CoA e. pyruvate c. acetyl-S-CoA ANS: C DIF: Easy REF: 13.4 OBJ: 13.4b Recall the major forms of catabolism.

MSC: Remembering

34. The figure shown below diagrams three pathways for the metabolism of glucose. Pathway ________ is most likely to be used for biosynthesis because it can be used to ________.

a. b. c. d. e.

1; generate glucose 2; make carbon backbones of many lengths 3; make carbon backbones of many lengths 1; make carbon backbones of many lengths 3; generate glucose

ANS: E DIF: Easy REF: 13.5 OBJ: 13.5b Name the three main catabolic routes from glucose to pyruvate MSC: Understanding 35. Glucose is activated by ________ phosphorylation(s) by ATP during the first stage of the Embden-Meyerhof-Parnas pathway. a. one d. four b. two e. Glucose is not phosphorylated. c. three ANS: B DIF: Easy REF: 13.5 OBJ: 13.5c Compare and contrast glycolysis (EMP pathway), the Entner-Doudoroff (ED) pathway, and the pentose phosphate pathway; include key intermediates and net products

MSC: Remembering 36. In glycolysis, dihydroxyacetone phosphate is isomerized to ________, which reenters the pathway. a. glucose 6-phosphate d. fructose 6-phosphate b. glyceraldehyde 3-phosphate e. pyruvate c. phosphoenolpyruvate ANS: B DIF: Easy REF: 13.5 OBJ: 13.5c Compare and contrast glycolysis (EMP pathway), the Entner-Doudoroff (ED) pathway, and the pentose phosphate pathway; include key intermediates and net products MSC: Remembering 37. Some intestinal bacteria, such as Escherichia coli, feed on ________ from mucus secretions using the Entner-Doudoroff pathway. a. gluconate d. 2-oxoglutarate b. glucose e. oxaloacetate c. pyruvate ANS: A DIF: Difficult REF: 13.5 OBJ: 13.5d Hypothesize under what conditions cells will favor the EMP, the ED, or the pentose phosphate pathway MSC: Remembering 38. Bacteria synthesize ribose for nucleotides using which pathway? a. Embden-Meyerhof-Parnas d. tricarboxylic acid cycle b. Entner-Doudoroff e. electron transport system c. pentose phosphate shunt ANS: C DIF: Easy REF: 13.5 OBJ: 13.5d Hypothesize under what conditions cells will favor the EMP, the ED, or the pentose phosphate pathway MSC: Remembering 39. Which of the following molecules is responsible for the distinctive flavor of Swiss cheese? a. lactate d. propionate b. glucose e. acetate c. galactose ANS: D DIF: Easy REF: 13.5 OBJ: 13.5f Identify some food and industrial applications of microbial fermentation MSC: Remembering 40. Which of the following is NOT an end product of fermentation? a. carbon dioxide d. butanol b. acetone e. propionate c. pyruvate ANS: C DIF: Medium REF: 13.5 OBJ: 13.5f Identify some food and industrial applications of microbial fermentation MSC: Understanding 41. The dye ________ turns ________ in the presence of acid products and is included in fermentation broth for some diagnostic tests. a. phenol red; yellow d. malachite green; blue b. aniline blue; green e. MacConkey; white c. ethidium bromide; pink ANS: A

DIF: Easy

REF: 13.5

OBJ: 13.5f Identify some food and industrial applications of microbial fermentation MSC: Understanding 42. The energy yield from fermentation is lower than from respiration because a. fermentation uses NAD, not NADP. b. respiration completely oxidizes glucose to CO2, resulting in greater generation of NADH and thus ATP. c. respiration uses the TCA cycle, which has many steps that directly produce ATP or GTP. d. fermentation shunts much of the carbon from glucose to biosynthesis. e. fermentation relies on the glyoxylate bypass, which bypasses ATP production.

ANS: B DIF: Medium REF: 13.5 OBJ: 13.5a Compare and contrast fermentation and respiration; include substrates, products, mode of ATP production, and ATP yield MSC: Analyzing 43. In the pentose phosphate shunt, glucose 6-phosphate is oxidized to 6-phosphogluconate, which is then decarboxylated to ribulose 5-phosphate. What is the main metabolic role of this pathway? a. production of ATP and NADH  H b. regeneration of NADP c. production of carbohydrates with three to seven carbon atoms, which can be utilized in biosynthesis d. production of pyruvate to feed the Krebs cycle e. oxidation of glucose to carbon dioxide ANS: C DIF: Medium REF: 13.5 OBJ: 13.5d Hypothesize under what conditions cells will favor the EMP, the ED, or the pentose phosphate pathway MSC: Applying 44. Clostridium acetobutylicum has been used to produce which solvents? a. acetate and butyrate d. formate and ethanol b. acetone and butanol e. propanol and mixed acids c. methanol and ethanol ANS: B DIF: Medium REF: 13.5 OBJ: 13.5f Identify some food and industrial applications of microbial fermentation MSC: Applying 45. Which of the following is evidence that the Entner-Doudoroff (ED) route might have evolved earlier than the Embden-Meyerhof-Parnas pathway (EMP)? a. ED involves a larger number of reactions and produces more energy and reducing equivalents with respect to EMP. b. 6-phosphogluconate is dehydrated to form pyruvate and glyceraldehyde 3-phosphate, which may then reenter the EMP pathway. c. ED involves fewer substrate-level phosphorylations and yields less energy and fewer reductants than EMP. d. They are both used to catabolize glucose. e. They both use ATP to phosphorylate glucose.

ANS: C DIF: Difficult REF: 13.5 OBJ: 13.5d Hypothesize under what conditions cells will favor the EMP, the ED, or the pentose phosphate pathway MSC: Analyzing 46. Some bacteria in the human gut microbiota primarily feed on glucose derivatives from mucus secretions. Which of the following is NOT correct with respect to ―mucus farming‖ by bacteria? a. Bacteroides thetaiotaomicron and other bacteria induce the colon to produce mucus.

b. Mucus-derived sugar acids are metabolized via the Entner-Doudoroff pathway. c. Sugar acids must be converted to 6-phosphogluconate in order to enter the Entner-Doudoroff pathway. d. The glucose derivatives are converted to glucose and degraded via the Embden-Meyerhof-Parnas pathway. e. This metabolism has been studied via genomics and genetic studies.

ANS: D DIF: Medium REF: 13.5 OBJ: 13.5d Hypothesize under what conditions cells will favor the EMP, the ED, or the pentose phosphate pathway MSC: Analyzing 47. Ethanolic fermentation is used in making beverages such as beer, wine, and pulque. It is carried out by yeast and a. lactobacillus. d. zymomonas. b. leuconostoc. e. clostridium. c. propionibacterium.

ANS: D DIF: Easy REF: 13.5 OBJ: 13.5e Distinguish among various types of fermentation (e.g., lactic acid, ethanolic, and mixed acid) MSC: Remembering 48. Which of the diagrammed molecules is a global signal of nutritional status?

a. pyruvate b. 2-oxoglutarate c. oxaloacetate

d. acetyl-CoA e. acetyl-P

ANS: E DIF: Easy REF: 13.6 OBJ: 13.6a Summarize the Krebs TCA cycle; include substrates, products, and key intermediates MSC: Understanding 49. Amino acids can be synthesized using which one of the molecules from the diagram below?

a. isocitrate b. succinyl-CoA c. oxaloacetate

d. 2-oxoglutarate e. fumarate

ANS: D DIF: Easy REF: 13.6 OBJ: 13.6b Recall the roles that the TCA cycle and the glyoxylate bypass play in cell metabolism MSC: Remembering 50. Pyruvate dehydrogenase complex connects glycolysis to respiration. Which is a correct mechanism for how the activity of this enzyme complex is regulated? a. There is no need to regulate this enzyme complex. b. The activity is inhibited by CoA and NAD+. c. Gene expression is repressed by carbon starvation and low oxygen levels. d. The activity is inhibited by citrate. e. The activity is enhanced by the presence of acetyl-CoA and NADH. ANS: C DIF: Difficult REF: 13.6 OBJ: 13.6c Describe the function and regulation of the pyruvate dehydrogenase complex MSC: Applying 51. ________ enters the tricarboxylic acid cycle by condensing with oxaloacetate to form ________. a. Succinoyl-S-CoA; fumarate d. Citrate; isocitrate b. Acetyl-S-CoA; citrate e. Acetyl phosphate; citrate c. Pyruvate; citrate ANS: B DIF: Easy REF: 13.6 OBJ: 13.6a Summarize the Krebs TCA cycle; include substrates, products, and key intermediates MSC: Remembering 52. The greatest amount of reduced coenzyme NADH  H is produced during which stage of aerobic respiration? a. glycolysis d. glyoxylate bypass b. pyruvate conversion to acetyl-S-CoA e. oxidative phosphorylation c. tricarboxylic acid cycle ANS: C

DIF: Easy

REF: 13.6

OBJ: 13.6a Summarize the Krebs TCA cycle; include substrates, products, and key intermediates MSC: Remembering 53. Pathways involving both anabolic and catabolic reactions are referred to as a. amphibolic. d. ambidextrous. b. amphipathic. e. syntrophibolic. c. ambivalent.

ANS: A DIF: Medium REF: 13.5 OBJ: 13.5g Define amphibolic reactions and describe their regulation MSC: Analyzing 54. Oxidative catabolism of benzoate and other aromatic compounds is catalyzed by a. 2-oxoglutarate:NADPH oxidoreductase. b. benzoyl-S-CoA reductase. c. specific dioxygenases. d. NADPH:ferredoxin oxidoreductase. e. catechol 2,3, monooxygenase.

ANS: C DIF: Medium REF: 13.7 OBJ: 13.6e Compare and contrast aerobic and anaerobic benzoate catabolism MSC: Understanding 55. All oxidative catabolism of toluene and other benzene derivatives proceeds through a. benzoyl-S-CoA. d. cis, cis-muconate. b. aniline. e. D-gluconate. c. catechols.

ANS: C DIF: Medium REF: 13.6 OBJ: 13.6e Compare and contrast aerobic and anaerobic benzoate catabolism MSC: Understanding 56. Species of Pseudomonas and Rhodococcus can degrade benzoate and other aromatic molecules, either aerobically or anaerobically. Which of the following is NOT correct regarding anaerobic degradation of aromatic molecules? a. It takes longer than aerobic degradation. b. It is critical because bacterial anaerobic habitats are more abundant than aerobic ones. c. Benzoate is activated to benzoyl-CoA prior to its degradation. d. It proceeds via production of catechols. e. The high initial investment of energy comes from either anaerobic phototrophy or anaerobic respiration.

ANS: D DIF: Easy REF: 13.6 OBJ: 13.6e Compare and contrast aerobic and anaerobic benzoate catabolism MSC: Analyzing 57. Each of the following was used to elucidate the TCA cycle EXCEPT a. using radiolabeled acetate to determine which carbons were oxidized to CO2 . b. the use of crude enzyme preparations from a variety of sources such as cucumber seeds and beef liver. c. adding a variety of short-chain fatty acids commonly found in cells to detect activity. d. the use of C14-labeled carbon compounds as a source of carbon under anoxic conditions. e. using C13 to determine which intermediates are enriched under various growth conditions.

ANS: D

DIF: Medium

REF: 13.6

OBJ: 13.6f Explain how isotopes are used in studies of metabolic pathways; provide specific examples MSC: Applying SHORT ANSWER 1. Define ―organotroph‖ and ―heterotroph.‖ Are these terms equivalent?

ANS: They are not equivalent, but similar. An organotroph uses preformed organic compounds to yield energy. A heterotroph uses preformed organic compounds for biosynthesis. Most organotrophs are also heterotrophs.

DIF: Easy REF: 13.Intro OBJ: 13.1a Define catabolism, energy, enthalpy, entropy, and syntrophy MSC: Analyzing 2. How can a technique such as calorimetry be used to measure G? ANS: The amount of heat released by a reaction or a set of reactions, either in vitro or in a living system, can be measured by a calorimeter. If the reactions are maintained at constant temperature, the release of heat gives a measure of H. If measurements are made at different temperatures, the entropic term—TS—can be estimated from heat-release dependence on temperature. From the Gibbs-Helmholtz equation, G  H TS. DIF: Difficult REF: 13.1 OBJ: 13.1c Use the Gibbs free energy change to determine if a given metabolic reaction can supply a cell with energy MSC: Applying 3. What are the differences among G, G°, and G°'?

ANS: G is the change in Gibbs free energy for a reaction under defined conditions. G° is the change in Gibbs free energy for a reaction at standard conditions of temperature (298 K) and pressure (1 atm), with all reactants and products at a concentration of 1M. G°' is similar to G°, with one other condition: that the reaction occurs at pH 7; this is commonly used in biochemistry.

DIF: Easy REF: 13.2 OBJ: 13.2a Recall the conditions required for the standard Gibbs free energy change, DeltaG°, and the biochemical Gibbs free energy change, DeltaG°’ MSC: Understanding 4. Why is magnesium an essential nutrient for all living cells?

ANS: Mg2 partly neutralizes the negative changes of the phosphates in ATP, thereby stabilizing the structure in solution. Generally, any enzyme that requires ATP actually requires Mg2-ATP. As such, it is an essential nutrient.

DIF: Easy REF: 13.3 examples MSC: Understanding

OBJ: 13.3b Define energy carriers and provide

5. All nucleotide triphosphates carry energy. Provide examples of reactions that are driven by the release of energy from GTP, CTP, and TTP. ANS: GTP is specifically used in the initiation and elongation processes of protein synthesis. All nucleotide triphosphates, ATP, GTP, CTP, and TTP, as well as their corresponding deoxynucleotide triphosphates, provide the energy for their own incorporation into RNA and DNA, respectively.

DIF: Medium REF: 13.3 examples MSC: Understanding

OBJ: 13.3b Define energy carriers and provide

6. What is the phosphotransferase system (PTS) and why is the advantage for a microbial cell to have a PTS? ANS: The PTS consists of several enzymes that couple the phosphorylation of sugar molecules, such as glucose or mannose, to their transport across the cell membrane. Enzymes involved in the PTS are important in determining which nutrients from the environment (or medium) certain microorganisms can import and catabolize.

DIF: Medium REF: 13.3 OBJ: 13.3d Recall why metabolic reactions require enzymes

MSC: Analyzing

7. What is substrate-level phosphorylation? Provide two examples from bacterial metabolism.

ANS: Phosphorylation of ADP at the substrate-level consists of the transfer of a phosphoryl group from a metabolic intermediate to form ATP. In glycolysis, substrate-level phosphorylation takes place when pyruvate kinase converts phosphoenolpyruvate and ADP to pyruvate and ATP. In the TCA cycle, ATP is formed when ADP is phosphorylated by succinyl-S-CoA synthetase during the conversion of succinyl-S-CoA to succinate and coenzyme A. DIF: Medium REF: 13.3 | 13.5 OBJ: 13.3b Define energy carriers and provide examples | 13.5a Compare and contrast fermentation and respiration; include substrates, products, mode of ATP production, and ATP yield MSC: Understanding 8. The catabolism of glucose is central to the overall hydrolysis of polysaccharides in an environment. Compare and contrast the analogous catabolism of polyaromatic compounds found in nature.

ANS: Polyaromatic compounds found in nature include lignin found in plants and polycyclic aromatic hydrocarbons found in petroleum. As these compounds are hydrolyzed, benzene is produced just as glucose is the product from polysaccharides. Benzene will be converted to benzoate and vanillin that are converted to acetyl-CoA and hydrolyzed further via the TCA cycle. Similarly, glucose is degraded to pyruvate, then to acetyl-CoA, and further hydrolyzed via the TCA cycle.

DIF: Medium REF: 13.4 OBJ: 13.4a Compare and contrast carbohydrates, lipids, peptides, and aromatic molecules as substrates for microbial metabolism MSC: Analyzing

9. Define the human metagenome. Describe an example to demonstrate the importance of the metagenome.

ANS: The human metagenome is composed of the human genome and the genomes of all the organisms in human gut microbiota. This is important because there are organisms present in our microbiota that we depend on to carry out reactions we cannot perform. Humans obtain some amino acids and vitamins from gut microorganisms. As such, to get a more complete picture of all the metabolic activities present in a human, the metagenome must be considered. Also, genes could be found in gut microbes that code for proteins that utilize the N-acetyl glucosamine, sialic acid and fucose found in breast milk (and not metabolized by humans). Studies with Bacteroides and Ruminococcus sp. serve as examples. Examples may vary but can include studies examining the genes involved in digesting a variety of xyloglucan from sources such as tomatoes versus lettuce.

DIF: Difficult REF: 13.4 OBJ: 13.4c Explain how genomic studies have contributed to our understanding of microbial catabolism MSC: Applying 10. Describe the Entner-Doudoroff (ED) pathway. What are the advantages to microorganisms that display the ED pathway?

ANS: Glucose is oxidized to the sugar acid 6-phosphogluconate, a central metabolite in the Entner-Doudoroff pathway. 6-Phosphogluconate may arise from other sources, such as the bacterial catabolism of intestinal mucus, and is further oxidized to 2-oxo-3-deoxy-6-phosphogluconate, which breaks down to the glycolysis intermediates glyceraldehyde and pyruvate. Microorganisms using ED produce only one ATP, half of that produced in glycolysis, but the electrons transferred are equivalent: one NADH  H and one NADPH  H are generated in ED. DIF: Medium REF: 13.5 OBJ: 13.5c Compare and contrast glycolysis (EMP pathway), the Entner-Doudoroff (ED) pathway, and the pentose phosphate pathway; include key intermediates and net products MSC: Understanding 11. The flavor and other properties of cheeses derive from the type of fermenting microorganisms used. How do the ―eyes‖ and the characteristic flavor of Swiss cheese originate?

ANS: Fermentation of milk sugars by Propionibacterium freudenreichii produces lactate, which is further oxidized to propionate and acetate. Fermentation also produces CO2, which makes the ―eyes‖ (holes). Other flavors come from succinate, which is formed by the reaction between lactate and two molecules of aspartate. This reaction releases CO2, which further increases the size and number of ―eyes.‖ DIF: Difficult REF: 13.5 OBJ: 13.5f Identify some food and industrial applications of microbial fermentation MSC: Understanding 12. What is mixed-acid fermentation? Provide examples of industrial uses of its products.

ANS:

Some enteric bacteria produce a series of mono- and dicarboxylic acids from pyruvate. Depending on the pH, the mixture may include succinate, lactate, acetate, or formate, plus ethanol, CO2, and H2. Regeneration of NAD and free coenzyme A also take place in the process. Some bacteria, such as Clostridium spp., possess the metabolic capability to synthesize isopropanol and butanol, which are valuable solvents. Lactic acid is part of the biochemical makeup of yogurt and cheeses.

Ethanol can be used as a solvent and is found in alcoholic beverages.

DIF: Difficult REF: 13.5 OBJ: 13.5e Distinguish among various types of fermentation (e.g., lactic acid, ethanolic, and mixed acid) MSC: Applying 13. Describe the diagnostic use of sorbitol MacConkey agar to test for the presence of E. coli O157:H7.

ANS: The sugar source in this medium is sorbitol. Also present in the medium is an indicator dye that turns red in the presence of acids. An organism that ferments sorbitol produces acids, and the colony will appear red. These plates are used to screen for E. coli O157:H7 because this strain, unlike most E. coli, is incapable of fermenting sorbitol. When grown on these plates, the colonies appear pale rather than red. The appearance of pale colonies indicates a high probability of E. coli O157:H7.

DIF: Medium REF: 13.5 OBJ: 13.5f Identify some food and industrial applications of microbial fermentation MSC: Applying 14. Escherichia coli degrades human waste in the colon using mixed-acid fermentation. Why is this a factor of concern in some medical procedures, such as colonoscopy?

ANS: Molecular hydrogen (H2) and CO2 are among the products of mixed-acid fermentation of the carbohydrate solution used to flush the colon. These gases can be used as energy sources for intestinal methanogenic microbes through the production of methane. However, excess H2 and CH4 may ignite during polyp removal by electrocauterization, thus causing the so-called colonic explosion.

DIF: Difficult REF: 13.5 OBJ: 13.5f Identify some food and industrial applications of microbial fermentation MSC: Applying 15. In the pentose phosphate shunt (PPS), sugars exchange short carbohydrate moieties to form carbohydrates with varying chain lengths. What metabolic mechanisms allow these exchanges to occur? What are the metabolic advantages of the PPS pathway?

ANS:

Pairs of sugars exchange portions of their molecules through specific enzymatic reactions, rendering new molecules without any loss of carbon. For example, the pentose ribose 5-phosphate and xylulose 5-phosphate react to form the C3 glyceraldehyde 3-phosphate and the C7 carbohydrate sedoheptulose 7-phosphate. In turn, these sugars may be converted to the C4 erythrose 4-phosphate and the C6 fructose 6-phosphate. Some PPS intermediates are anabolic precursors. For example, ribose 5-phosphate is used for nucleotide biosynthesis, and erythrose 4-phosphate is used for aromatic amino acids. The reducing equivalent NADPH is produced by several PPS reactions and used in biosynthesis. If pathway intermediates are not used in biosynthesis, they may be converted to fructose 6-phosphate and reenter glycolysis.

DIF: Difficult REF: 13.5 OBJ: 13.5c Compare and contrast glycolysis (EMP pathway), the Entner-Doudoroff (ED) pathway, and the pentose phosphate pathway; include key intermediates and net products MSC: Analyzing 16. Treponema pallidum, the causative agent of syphilis, was shown to be lacking a TCA cycle.

Explain the significance of this finding.

ANS: T. pallidum’s genome encodes key enzymes for glycolysis and fermentation, but not for the TCA cycle or electron transport. Although the genome also codes for transport proteins for sugars and amino acids, there are no genes that code for any enzymes involved in either the biosynthesis or breakdown of amino acids. T. pallidum, and other obligate pathogens, therefore must depend on its host’s metabolism to supply many fundamental and essential nutrients and transport them with the transport proteins.

DIF: Difficult REF: 13.6 OBJ: 13.6b Recall the roles that the TCA cycle and the glyoxylate bypass play in cell metabolism MSC: Remembering 17. Hans Krebs’s strategy to determine the biochemical intermediates involved in aerobic respiration was to use substrate molecules of varying lengths. What led Krebs to take this approach?

ANS: Many short-chain molecules with variable numbers of carboxyl groups were known to exist in the cells of aerobic organisms. Krebs tested carboxylic acids for their capacity to induce or stimulate respiration in different animal and plant tissues and analyzed their chemical structure relationships.

Feeding bacteria with 14C-radiolabeled acetate helped to determine what was the fate of carbons entering the TCA cycle and to confirm the reactions in the pathway.

DIF: Difficult REF: 13.6 OBJ: 13.6f Explain how isotopes are used in studies of metabolic pathways; provide specific examples MSC: Remembering 18. How does the efficiency of energy capture by ATP formation in bacterial tricarboxylic acid cycle compare with that of mitochondria?

ANS: Whereas mitochondria are enclosed in an intracellular environment that is relatively constant, bacteria must spend energy in adapting to ever-changing environments. Although less efficient in ATP production, bacteria spend energy to achieve flexibility through keeping stable ionic potentials during extreme changes in external pH and redox conditions.

DIF: Medium

REF: 13.6

OBJ: 13.6a Summarize the Krebs TCA cycle; include substrates, products, and key intermediates MSC: Analyzing 19. Soils and waters become contaminated with industrial aromatic compounds and efforts are made to use bacteria to clean up these areas. Describe the experiment and finding from phenanthrene metabolism in the Antarctic.

ANS: Soils from the Antarctic were incubated at a variety of temperatures. C14-labeled phenanthrene was added to the soils and a respirometer was used to collect C14-carbon dioxide. Metabolism was demonstrated in this fashion, and in fact, warmer temperatures yielded faster metabolism than lower temperatures that would be found in the Antarctic. These findings suggest that the organisms involved were psychrotrophs that could tolerate cold, not psychrophiles that thrived only in the cold.

DIF: Medium REF: 13.6 OBJ: 13.6f Explain how isotopes are used in studies of metabolic pathways; provide specific examples MSC: Understanding 20. What metabolic pathway does Mycobacterium tuberculosis use that allows it to grow slowly inside macrophages? What led to this discovery, and what practical application can further analysis of this pathway have?

ANS: Using 13C metabolic precursors to label infected cells, it was found that M. tuberculosis uses the glyoxylate bypass to catabolize lipids. The pathogen uses much of the carbon to produce sugars and amino acids for its own biosynthetic pathways. Enzymes of the glyoxylate pathway can be used as targets in the design of new antibiotics to treat tuberculosis.

DIF: Difficult REF: 13.6 OBJ: 13.6f Explain how isotopes are used in studies of metabolic pathways; provide specific examples MSC: Evaluating

CHAPTER 14: Electron Flow in Organotrophy, Lithotrophy, and Phototrophy MULTIPLE CHOICE 1. Which of the following substrates is an electron donor in organotrophy? a. Fe2 d. H2 b. succinate e. H2O c. NO2 ANS: B DIF: Easy REF: 14.1 OBJ: 14.1a Differentiate among the types of metabolism that use an ETS MSC: Remembering 2. What is lithotrophy? a. breakdown of molecules using light energy b. oxidation of organic electron donors to CO2 and H2O c. photolysis of H2S or H2O coupled to CO2 fixation d. oxidation of inorganic electron donors such as Fe2 using O2 or anaerobic electronic acceptors e. physical breakdown of food particles to facilitate ingestion

ANS: D DIF: Easy REF: 14.Intro OBJ: 14.1a Differentiate among the types of metabolism that use an ETS MSC: Remembering 3. Which of the reactions below is written in the direction ―electron acceptor a. ubiquinone d. Glucose ubiquinone b. e. c.

ANS: A DIF: Medium REF: 14.1 OBJ: 14.1b Recall the definitions of reduction and oxidation

electron donor‖?

MSC: Applying

4. Reduction potential is defined as a. the tendency for a compound to release H in solution. b. the tendency for a compound to release OH in solution. c. the tendency of a compound to accept electrons. d. the tendency of a compound to donate electrons. e. a synonym for chemical valence.

ANS: C DIF: Easy REF: 14.1 OBJ: 14.1b Recall the definitions of reduction and oxidation

MSC: Understanding

5. Which of the following is FALSE regarding the electron transfer system in mitochondria? a. The subunits of cytochrome c oxidoreductase (complex IV) are associated to eukaryotic proteins. b. Oxidation of NADH  H contributes to the formation of a larger p. c. The initial oxidoreductase, the NADH dehydrogenase (complex I), pumps more protons than the NDH-1 in Escherichia coli. d. The succinate dehydrogenase (complex II) contributes to p by pumping protons onto the intermembrane space. e. The ETS of some bacteria, such as Paracoccus denitrificans, are organized in a manner similar to that of mitochondria.

ANS: D DIF: Difficult REF: 14.1 OBJ: 14.1c Summarize the flow of energy in ETS systems

MSC: Understanding

6. Electron transport systems are embedded in all of the following membrane systems EXCEPT a. the mitochondrial inner membrane. b. thylakoids. c. the inner membrane of Gram-negative bacteria. d. the eukaryotic plasma membrane. e. the archaeal plasma membrane.

ANS: D DIF: Easy REF: 14.1 OBJ: 14.1c Summarize the flow of energy in ETS systems 7. Which of the following is NOT a redox pair? a. fumarate/succinate b. NADH  H/NAD c. H2S/H2O d. quinone/quinol (Q/QH2) e. FAD/FADH2 ANS: C

DIF: Easy

REF: 14.1

MSC: Understanding

OBJ: 14.1c Summarize the flow of energy in ETS systems

MSC: Understanding

8. In a redox reaction, the reduction potential E depends on the ratio of product concentrations ([C] and [D]) to reactant concentrations ([A] and [B]), as per equation E = E°' – 60 (mV/n) log [C][D]/[A][B]. What would be the effect of increasing the ratio of products to reactants by a factor of 10? a. No effect: E°' assumes 1-M concentrations of reactants and products. b. A change of –60 mV will not modify the estimate of E. c. The value of E will decrease by 60 mV, decreasing energy yield. d. The value of E will increase by 60 mV, increasing energy yield. e. The E°' term is unaffected by changes in concentrations of products or reactants.

ANS: C DIF: Medium REF: 14.1 OBJ: 14.1a Differentiate among the types of metabolism that use an ETS | 14.1d Express the relationship between the reduction potential and DG MSC: Analyzing 9. The following are cellular processes that can be directly powered by the proton motive force ( p), EXCEPT a. ATP biosynthesis from ADP and Pi. b. flagellar rotation. c. nutrient uptake. d. drug efflux in some pathogens. e. protein biosynthesis.

ANS: E DIF: Easy REF: 14.2 OBJ: 14.2a List cellular processes that the proton motive force can power MSC: Applying 10. How are drug efflux pumps spread among virulent bacterial strains? a. They are spread through generalized transduction. b. Their genes are contained in plasmids that are transmitted among bacterial cells. c. They are spread through conjugation between two virulent strains. d. They are spread through transformation with Hfr plasmids. e. DNA is released from bacterial cells previously infected with bacteriophages.

ANS: B DIF: Easy REF: 14.2 OBJ: 14.2a List cellular processes that the proton motive force can power MSC: Applying 11. The chemiosmotic theory states that the proton potential is composed of a. [ATP] and [ADP]+[Pi]. b. a pH gradient and [Na+] gradient. c. pH and pNa. d. pH and  e. a pH gradient and a [Ca2] wave.

ANS: D DIF: Easy REF: 14.2 OBJ: 14.2c Evaluate the experiments that tested the chemiosmotic theory MSC: Understanding 12. While testing the chemiosmotic theory across the domains of life, researchers prepared ―inside-out‖ vesicles from bacterial plasma membranes, mitochondrial internal membranes, and chloroplast thylakoids. An inside-out vesicle is a a. vesicle in which the F1 subunit of the proton-ATPase faces outward. b. membrane in which the hydrophobic tails of the phospholipids face outward.

c. cell that has been enzymatically stripped of its cell wall. d. preparation of outer membranes in Gram-negative bacteria, chloroplast envelopes, and mitochondria outer membranes. e. preparation from bacterial cytoplasm, chloroplast stroma, and mitochondrial matrix.

ANS: A DIF: Easy REF: 14.2 OBJ: 14.2c Evaluate the experiments that tested the chemiosmotic theory MSC: Applying 13. Which of the following is NOT true of 2,4-dinitrophenol (DNP)? a. It is an uncoupler. b. It can be used to measure pH. c. Unprotonated DNP can cross the membrane. d. Protonated DNP can cross the membrane. e. It dissipates the proton motive force.

ANS: B DIF: Easy REF: 14.2 OBJ: 14.2e Describe how uncouplers dissipate the proton motive force MSC: Applying 14. The molecule shown below, __________, is a cofactor for electron transport.

a. a cytochrome b. ubiquinone c. flavin mononucleotide

d. nicotine amide dinucleotide e. heme b

ANS: C DIF: Medium REF: 14.3 OBJ: 14.3a Describe the structure and function of cofactors

MSC: Remembering

15. The following groups or molecules are components of electron transport systems, EXCEPT a. heme b. b. [2Fe-2S] and [4Fe-4S] iron-sulfur clusters. c. quinones. d. flavin mononucleotide. e. acetyl-S-CoA. ANS: E DIF: Medium REF: 14.3 OBJ: 14.3a Describe the structure and function of cofactors

MSC: Remembering

16. Enzymes transferring electrons at the start of the ETS are referred to as __________, whereas enzymes transferring electrons to the terminal electron acceptor are designated as __________.

a. b. c. d. e.

dehydrogenases; oxidases oxidases; dehydrogenases sulfatases; nitrogenases permeases; proton pumps lyases; hydrolases

ANS: A DIF: Easy REF: 14.3 OBJ: 14.3c Explain how bacteria can use a diversity of initial electron donors and terminal electron acceptors MSC: Understanding 17. In cytochromes, the heme group plays a key role in acquiring and transferring electrons with a(n) __________ transition. a. Mg0/Mg2 d. Fe3/Fe2 0 2b. S /S e. Mn0/Mn2 c. Cu/Cu2 ANS: D DIF: Easy REF: 14.3 OBJ: 14.3a Describe the structure and function of cofactors

MSC: Understanding

18. Although embedded in the membrane as an ETS component, the enzyme __________ does not pump protons. a. pyruvate dehydrogenase b. 2-oxoglutarate dehydrogenase c. succinate dehydrogenase d. malate dehydrogenase e. glyceraldehyde dehydrogenase ANS: C DIF: Easy REF: 14.3 OBJ: 14.3b Compare and contrast the three minimum components of a respiratory ETS MSC: Remembering 19. Protons can have different fates in bacterial ETS. Which of the following processes does NOT affect the proton motive force ( p)? a. Protons are pumped across the membrane (H+) by oxidoreductase complexes. b. Protons are consumed from the cytoplasm by the quinone/quinol pool. c. Protons are released outside the membrane from the quinone/quinol pool. d. Protons are consumed by combining with terminal electron acceptors such as O2. e. Protons combining with O2, used as a terminal acceptor, compensate protons released by catabolic pathways.

ANS: E DIF: Difficult REF: 14.3 OBJ: 14.3c Explain how bacteria can use a diversity of initial electron donors and terminal electron acceptors MSC: Applying 20. Which of the following is FALSE regarding the ETS in Escherichia coli? a. NDH-1 is the main initial substrate oxydoreductase; NDH-2 is an alternative NADH dehydrogenase. b. It pumps 10–12 protons per NADH. c. It pumps 2–8 protons per NADH. d. The main terminal oxidase is the cytochrome bo quinol oxidase, which contains heme b, heme O3, and Cu. e. An alternative cytochrome bd quinol oxidase has a higher affinity for oxygen than other terminal oxidases and allows E. coli growth in low-O2 habitats.

ANS: B

DIF: Medium

REF: 14.3

OBJ: 14.3d Differentiate between the mitochondrial ETS and bacterial ETS MSC: Applying 21. The diagram below shows the structure of the universal FoF1 synthase. Which of the following FALSELY labels the figure?

a. i) Fo subunit b. ii) F1 subunit c. iii) catalytic subunit

d. iv) subunit a e. v) subunit b

ANS: C DIF: Easy REF: 14.3 OBJ: 14.3e Describe the structure and function of ATP synthase MSC: Applying 22. The Fo portion of Escherichia coli ATP synthase that rotates while translocating protons is a. the  drive shaft. b. subunits a and b. c. a ring of 8 to 15 c subunits. d. an - subunit. e. the catalytic active site.

ANS: C DIF: Medium REF: 14.3 OBJ: 14.3e Describe the structure and function of ATP synthase MSC: Understanding 23. Extreme halophilic archaea exclusively utilize which kind of ion gradient? a. H d. K  b. Na e. Mg2 c. Ca2 ANS: B

DIF: Easy

REF: 14.3

OBJ: 14.3e Describe the structure and function of ATP synthase MSC: Remembering 24. In anaerobic soils, some yeasts and filamentous fungi can reduce nitrate to nitrite and nitrite to a. ammonia (NH3). b. nitric oxide (NO). c. urea. d. nitrogen gas (N2). e. ammonium hydroxide (NH4OH).

ANS: B DIF: Medium REF: 14.4 OBJ: 14.4a Define anaerobic respiration, dissimilatory denitrification, and dissimilatory metal reduction MSC: Understanding 25. The reduction of U6 to U4 by Geobacter metallireducens is an example of a. assimilatory metal reduction. d. organotrophy. b. fermentation. e. lithotrophy. c. dissimilatory metal reduction.

ANS: C DIF: Easy REF: 14.4 OBJ: 14.4a Define anaerobic respiration, dissimilatory denitrification, and dissimilatory metal reduction MSC: Applying 26. Neisseria species use dissimilatory reduction of nitrate to ammonium. How can this reaction be used to distinguish Neisseria gonorrhoeae from other related species? a. N. gonorrhoeae will test negative for terminal NO reductase. b. N. gonorrhoeae will test positive for terminal NO reductase. c. All Neisseria species test negative for terminal NO reductase. d. All Neisseria species test positive for terminal NO reductase. e. None of the enzymes involved in dissimilatory reduction of nitrate are known from species of Neisseria.

ANS: A DIF: Medium REF: 14.4 OBJ: 14.4a Define anaerobic respiration, dissimilatory denitrification, and dissimilatory metal reduction MSC: Applying 27. Which of the following is NOT a terminal electron acceptor in anaerobic respirations? a. nitrate d. carbon dioxide b. nitrite e. sulfate c. hydrogen sulfide ANS: C DIF: Medium REF: 14.4 OBJ: 14.4b Identify molecules that can serve as terminal electron acceptors in anaerobic respiration MSC: Analyzing 28. Which of the following is FALSE with respect to the use of sulfate by marine archaeal and bacterial groups? a. Oxidized sulfur-containing molecules have redox potentials lower than those of the nitrogen series. b. Oxidized sulfur molecules such as sulfate and sulfite serve as electron acceptors. c. Sulfate and sulfite can receive electrons from hydrocarbons. d. Sulfate-reducing archaea and bacteria are widespread in the ocean. e. Sulfate is more abundant than chloride in the ocean.

ANS: E DIF: Difficult REF: 14.4 OBJ: 14.4e Justify the abundance of sulfate-reducing microbes in seawater MSC: Applying 29. Ferroplasma acidarmanus produces large amounts of sulfuric acid through a. oxidation of Cu with Cu(NO3)2. b. oxidation of FeS2 with Fe3 and H2O. c. oxidation of Fe3O2 with Fe2. d. oxidation of H2S with H2O. e. reduction of SO with H2.

ANS: B DIF: Medium REF: 14.5 OBJ: 14.5a Identify possible initial electron donors to an ETS in lithotrophy MSC: Remembering 30. Which species can be utilized in biomining because it oxidizes copper and iron sulfides? a. Geobacter metallireducens b. Sulfurospirillum barnesii c. Haloferax volcanii d. Acidithiobacillus ferrooxidans e. Bacillus subtilis ANS: D DIF: Easy REF: 14.5 OBJ: 14.5d State the environmental impacts of microbial sulfur and metal oxidation MSC: Applying 31. Sulfolobus species produce __________; as a result, their immediate environment has a pH __________. a. H2SO4; as low as 2 d. CH3COOH; of 4 b. H3PO4; as low as 3 e. HCOOH; of 3 c. HCl; of 1 ANS: A DIF: Easy REF: 14.5 OBJ: 14.5c Recall the environmental roles of nitrifiers and the anammox reaction MSC: Remembering 32. The anammox reaction consists of __________ and, as a consequence, __________. a. reduction of sulfate by ammonia; sulfur and nitrogen are incorporated into amino acids b. reduction of ammonium to form nitrite; plants can absorb nitrite c. anaerobic ammonium oxidation by nitrite; large amounts of N2 are released into the atmosphere d. reduction of ammonium by water; ammonium becomes ammonia e. reduction of N2 to ammonium; nitrogen atoms are incorporated into amino acids ANS: C DIF: Difficult REF: 14.5 OBJ: 14.5c Recall the environmental roles of nitrifiers and the anammox reaction MSC: Applying 33. Nitrifiers are bacteria a. that generate nitrites or nitrates. b. that convert N2 to NH3. c. capable of oxidizing NH3 using NO. d. capable of living in symbiosis in the roots of some plants. e. capable of using NH3 as an electron donor.

ANS: A DIF: Easy REF: 14.5 OBJ: 14.5c Recall the environmental roles of nitrifiers and the anammox reaction MSC: Remembering 34. Which of the following reactions is possible by reverse electron flow? a. reduction of Fe3 to Fe2 b. NADP reduction to NADPH c. protein biosynthesis d. reduction of oxygen by Fe2 to form H2O and Fe3 e. anammox ANS: B DIF: Medium REF: 14.5 OBJ: 14.5f Compare and contrast methanogenesis, methylotrophy, and methanotrophy MSC: Remembering 35. In dehalorespiration of chlorinated pollutants, the chlorine is removed and replaced by a. hydrogen. d. sulfur. b. oxygen. e. ammonia. c. nitrogen.

ANS: A DIF: Easy REF: 14.5 OBJ: 14.5f Compare and contrast methanogenesis, methylotrophy, and methanotrophy MSC: Analyzing 36. The figure below shows anaerobic corrosion of a piece of steel accelerated by the action of anaerobic microorganisms. What should be on label 2?

a. Elemental sulfur and iron directly react to produce FeS. b. Iron reduces c. Acid rain is produced: d. Acid rain is produced: e. Acid rain is produced: ANS: B DIF: Medium REF: 14.5 OBJ: 14.5d State the environmental impacts of microbial sulfur and metal oxidation MSC: Analyzing 37. Which of the following is FALSE regarding dehalorespiration?

a. b. c. d. e.

It is a type of hydrogenotrophy.

Cl can be removed from toxic compounds by dehalorespiration.

Nitrogen (N2) is a by-product of dehalorespiration.

Halogenated organic molecules serve as electron acceptors for H2.

Hydrogenotrophs can be used in bioremediation.

ANS: C DIF: Medium REF: 14.5 OBJ: 14.5f Compare and contrast methanogenesis, methylotrophy, and methanotrophy MSC: Analyzing 38. Which of the following is NOT correct about the process of methanogenesis? a. CO2 and H2O are weak electron acceptors, whereas CH4 and H2 are strong electron donors. b. CH4 synthesis from CO2 releases energy for growth. c. CH4 and water can be formed from CO2 and 4H2 from a hydrogen donor. d. Oxygen atoms in CO2 are reduced one at a time. e. Oxygen atoms in CO2 are reduced to water at the same time.

ANS: E DIF: Difficult REF: 14.5 OBJ: 14.5f Compare and contrast methanogenesis, methylotrophy, and methanotrophy MSC: Analyzing 39. In marine sediments, CO2 is reduced to CH4 by a. bacteria containing proteorhodopsin. b. oxygenic cyanobacteria. c. methanotrophic archaea. d. methanogenic archaea. e. nonpurple sulfur bacteria.

ANS: D DIF: Easy REF: 14.5 OBJ: 14.5f Compare and contrast methanogenesis, methylotrophy, and methanotrophy MSC: Understanding 40. What is the chromophore group in bacteriorhodopsin? a. tocopherol d. retinal b. -carotene e. chlorophyll c. folic acid ANS: D DIF: Easy REF: 14.6 OBJ: 14.6a Assess the importance of phototrophy in ecosystems MSC: Remembering 41. In purple bacteria, bacteriochlorophylls are supplemented by accessory pigments called a. antenna complexes. d. chlorophylls. b. bacteriorhodopsin. e. thylakoids. c. carotenoids.

ANS: C DIF: Easy REF: 14.6 OBJ: 14.6b Describe the structure and function of the cyanobacterial antenna complex and reaction center MSC: Remembering 42. Electron donors for anaerobic photosystem I in green sulfur bacteria and chloroflexi include the following, EXCEPT a. H2S. d. H2O. b. HS. e. Fe2. c. H2.

ANS: D DIF: Easy REF: 14.6 OBJ: 14.6e Differentiate among anaerobic photosystem I, anaerobic photosystem II, and the oxygenic Z pathway MSC: Remembering 43. In photosystem II of purple bacteria, electrons flow through cytochrome bc, coupled to pumping of protons and the proton potential drives synthesis of ATP. The cytochrome bc complex transfers the electrons back to bacteriochlorophyll P870. This type of ATP synthesis is called a. reverse electron flow. b. membrane potential. c. noncyclic photophosphorylation. d. cyclic photophosphorylation. e. proton motive force.

ANS: D DIF: Easy REF: 14.6 OBJ: 14.6e Differentiate among anaerobic photosystem I, anaerobic photosystem II, and the oxygenic Z pathway MSC: Remembering 44. In the Rhodospirillum rubrum photosystem II, bacteriochloropyll P870 can absorb weak infrared wavelengths in the __________ range. a. 600–650 d. 750–800 b. 650–700 e. 800–1,100 c. 700–750 ANS: E DIF: Easy REF: 14.6 OBJ: 14.6e Differentiate among anaerobic photosystem I, anaerobic photosystem II, and the oxygenic Z pathway MSC: Analyzing 45. Which of the following definitions is FALSE? a. Photosynthesis is hotolysis followed by CO2 fixation and biosynthesis. b. Photolysis is light absorption coupled to splitting of a molecule. c. Photophosphorylation is the reaction ADP  Pi  ATP catalyzed by photons. d. Photoexcitation is light absorption causing an electron to transfer to a higher energy state. e. Photoionization is light absorption that causes electron separation.

ANS: C DIF: Easy REF: 14.6 OBJ: 14.6d Compare and contrast the different classes of photopigments; include what organisms they are found in and their structures and functions MSC: Applying 46. The chlorophyll chromophore consists of a heteroaromatic ring complexed to a __________ ion. a. calcium d. manganese b. chloride e. potassium c. magnesium ANS: C DIF: Easy REF: 14.6 OBJ: 14.6d Compare and contrast the different classes of photopigments; include what organisms they are found in and their structures and functions MSC: Remembering 47. Cyanobacteria have __________-based photosynthesis and are the only __________-producing bacteria. a. H2S; S0 d. succinate; O2 b. Mg2; NO e. fumarate; O2 c. H2O; O2 ANS: C DIF: Medium REF: 14.6 OBJ: 14.6e Differentiate among anaerobic photosystem I, anaerobic photosystem II, and the

oxygenic Z pathway

MSC: Understanding

48. In oxygenic photosynthesis, __________ is the electron donor, whereas in anaerobic photosynthesis it can be succinate or __________. a. H2S; S0 d. H2O; H2S b. O2; H2 e. H2S; SO c. O2; H2O ANS: D DIF: Medium REF: 14.6 OBJ: 14.6e Differentiate among anaerobic photosystem I, anaerobic photosystem II, and the oxygenic Z pathway MSC: Understanding 49. The direction of the proton current in the chloroplast F1Fo ATP synthase during ATP synthesis is from a. stroma to cytoplasm. b. cytoplasm to stroma. c. lumen to stroma. d. stroma to lumen. e. one thylakoid to another through their lumen.

ANS: C DIF: Medium REF: 14.6 OBJ: 14.6e Differentiate among anaerobic photosystem I, anaerobic photosystem II, and the oxygenic Z pathway MSC: Understanding 50. The organism __________ is also known as ―the bacterium that eats everything.‖ It conducts photoheterotrophy and fixes nitrogen as ammonium while generating H2. It also produces ATP via cyclic photophosphorylation in photosystem II. a. Pseudochrobactrum saccharolyticum b. Nitrobacter winogradskyi c. Bradyrhizobium japonicum d. Rhodopseudomonas palustris e. Brucella pinnipedialis ANS: D DIF: Difficult REF: 14.6 OBJ: 14.6a Assess the importance of phototrophy in ecosystems MSC: Applying 51. Some respiratory bacteria, such as the nitrate oxidizer, nitospira, pack their ETS within intracytoplasmic pockets called a. insoluable particles. d. cristae. b. mitochondrial inner membrane. e. lamellae. c. inner membrane space.

ANS: E DIF: Medium REF: 14.1 OBJ: 14.1h Describe the function of membranes in an ETS

MSC: Remembering

52. Which organism can respire with uranium and remediate uranium-contaminated water? a. R. palustris d. Salmonella sp b. Shewanella sp e. Brucella sp c. G. metallireducens ANS: C DIF: Medium REF: 14.4 OBJ: 14.4d Explain how bacterial respiration can aid bioremediation MSC: Remembering

53. Phototrophy is a. photolysis. b. use of photoexcited electrons to power cell growth. c. chlorophyll photoexcitation. d. photoionization. e. a charge-separating photopigment.

ANS: B DIF: Easy REF: 14.6 OBJ: 14.6c Distinguish among photoexcitation, photoionization, photolysis, and photosynthesis MSC: Remembering SHORT ANSWER 1. How does Shewanella oneidensis donate electrons to oxidized minerals in marine sediments?

ANS: Shewanella oneidensis is a proteobacterium that can extend vesicles from its outer membranes.

Fluorescence microscopy studies, using a membrane-specific fluorophore, show that these vesicles grow into chains that can lengthen into narrow tubes or ―nanowires.‖ These ―nanowires‖ transport electrons from a distance to immobilized minerals such as iron, lead, and nitrate and use them as electron acceptors.

DIF: Medium REF: 14.1 OBJ: 14.1c Summarize the flow of energy in ETS systems

MSC: Applying

2. Standard reduction potentials (E°') and standard free energy change ( G°') are related by the equation G°' = –nFE°', where F is the Faraday’s constant and n is the number of electrons transferred from donor to acceptor. G°' has units of kJ/mol. Which of the following redox pairs will have the highest G°' value?

(1) E°' = +420 mV (2)

E°' = +440 mV

ANS: Although the standard reduction potentials are very close, the number of electrons transferred in the reduction of nitrite to ammonium is larger than in the reduction of nitrate to nitrite.

Computation of G°' for the reactions yields –81 and –255 kJ, respectively, since more electrons are transferred in reaction 2.

DIF: Difficult REF: 14.1 OBJ: 14.1d Express the relationship between the reduction potential and DG MSC: Understanding 3. Some Escherichia coli mutants can use nitrate (NO) as an electron acceptor under anaerobic conditions. A researcher wants to test the hypothesis that such a mutant obtained in a laboratory can obtain energy from succinate as an electron donor. Her proposed hypothesis is based on energy production from the redox pairs succinate/fumarate and nitrate/nitrite. Predict her calculations and determine if succinate oxidation to fumarate coupled to nitrite (NO) formation can yield some energy for growth as evidenced by an overall – G°' of the coupled reactions.

ANS:

The E°' values for the conversion of fumarate to succinate and nitrate to nitrite are +33 and +420 mV, respectively. From these E°' values, the standard free energy ( G°') is calculated as –6 and –81 kJ, respectively. With succinate as the electron donor, the first reaction must be written in the reverse direction, which affects its signs of E°' and G°'. Since nitrate is the electron acceptor, the second reaction is written as the nitrate to nitrite reduction. The overall reaction, including the values of E°' and G°', is:

succinate

fumarate + fumarate +

succinate

E°' –33 mV +420 mV +387 mV

G°' +6 kJ –81 kJ –75 kJ

Although somewhat low, this value of G°' will render some energy for cell growth. The nitrate-reducing E. coli strain can be expected to grow using succinate as an electron donor, albeit more slowly than a wild type control.

DIF: Difficult couples MSC: Evaluating

REF: 14.1

OBJ: 14.1e Calculate E°' and Delta G°' for redox

4. The figure below represents absorbance spectra of a cytochrome from the membrane of the archaeon Haloferax volcanii. The spectrum from the reduced form is represented by a continuous line and the oxidized form by a dashed line. Describe the differences between the spectra and which wavelength you would use to study the redox reactions of this cytochrome.

ANS: The reduced form of the cytochrome has two peaks: one in the blue region of the spectrum, at 440 nm, and another in the orange region, at 607 nm. After losing electrons during oxidation, the 440 nm peak shifts to a shorter wavelength and the peak at 607 nm disappears. Measuring absorbance at 440 nm (A440), while exposing the cells to different environments, would be a good indicator of the redox state of the cytochrome, as it reaches a maximum in the reduced form of cytochrome and it is drastically reduced in the oxidized form.

DIF: Medium REF: 14.1 OBJ: 14.1g State the role of cytochromes and oxidoreductases in an ETS MSC: Understanding 5. Use the figure below to describe Peter Mitchell’s chemiosmotic model for coupling the electron transfer system with ATP synthesis.

ANS: In 1961, Peter Mitchell proposed that the energy from the membrane-located electron transfer system (i) is used to pump protons (H+) across a biological membrane that separates two compartments (ii). Protons accumulate in one of the compartments (iii), for example, the extracellular medium, the chloroplast lumen, or the mitochondrial intermembrane space, generating a proton gradient ( pH) as well as a charge difference ( ), thus storing energy (proton motive force, p). The p exists everywhere in the membrane, as long as it remains sealed.

Protons can only return through specific transporters, namely the proton channel in the ubiquitous F1Fo ATPase (iv), and by doing so ATP is generated (v).

DIF: Difficult REF: 14.2 OBJ: 14.2b Explain how the proton motive force is produced 6. What factors may affect

MSC: Analyzing

p in metabolically active bacterial cells?

ANS: p depends on the membrane potential (and a proton gradient (pH). The relationship between p and its components and (pH) is approximately p   60pH. Other than H,  includes other ions such as K and Na. pH gradient can be affected by acid-generating metabolic pathways such as fermentations and environmental pH changes.

DIF: Easy REF: 14.2 OBJ: 14.2d Assess the contributions of DeltaChi and DeltapH to the proton motive force

MSC: Understanding 7. While testing the chemiosmotic theory, researchers prepared ―inside-out‖ vesicles from bacterial cells, mitochondrial internal membranes, and chloroplast thylakoids. In an inside-out vesicle, the F1 subunit of the proton-ATPase faces outward. Using the figure below, briefly discuss how the use of inside-out vesicles helped to study the relative contributions of the proton gradient ( pH) and the membrane potential ( ) to p.

ANS: (A) Inside-out vesicles are loaded with a buffer with a pH lower than that of the external buffer, which contains ADP and inorganic phosphate (Pi). ATP is synthesized by the proton-ATP synthase, thus demonstrating that a pH gradient across a sealed membrane can drive ATP synthesis. (B) Besides H, the electrical potential (includes charges on other ions such as Na and K, which are transported by membrane-located specific pumps or exchangers. In a particular experiment, researchers established an ion gradient by loading proton-containing vesicles with K.

Addition of the antibiotic ionophore valinomycin allowed the entry of K into the vesicles, adding positive charges, affecting the membrane potential () and driving out the protons through the F1Fo ATPase, which resulted in ATP synthesis.

DIF: Medium REF: 14.2 OBJ: 14.2d Assess the contributions of DeltaChi and DeltapH to the proton motive force MSC: Evaluating 8. Use the figure below to describe how an uncoupler functions. Can an uncoupler be used as an antibiotic to treat bacterial infections?

ANS:

An uncoupler can cross the membrane in either the protonated (AH) or deprotonated state (A). As a result, it can bring protons into the cell and dissipate the proton gradient. This effectively uncouples ATP synthesis and the electron transport system, hence the name. Because of their high toxicity to bacteria, uncouplers were actually considered for use as antibiotics. However, mitochondria in eukaryotic cells also need to maintain ion gradients and voltage potentials.

DIF: Medium REF: 14.2 OBJ: 14.2e Describe how uncouplers dissipate the proton motive force MSC: Understanding 9. Why and how is it that mitochondria have only a single electron transport system (ETS), unlike many bacteria?

ANS: Mitochondria have the advantage of existing in a relatively uniform environment. The mitochondria are protected from changes in their environment by their presence in the cytoplasm of the eukaryotic cell. They therefore have been able to persist with only one ETS system to maximize energy obtained from NADH and minimize heat loss. Bacteria, however, typically have to adjust to changes in nutrient resources and availability of terminal electron acceptors. Alternate bacterial ETSs provide greater flexibility and increased chances for survival.

DIF: Medium REF: 14.3 OBJ: 14.3d Differentiate between the mitochondrial ETS and bacterial ETS MSC: Understanding 10. Is the synthesis of ATP by the F1Fo ATPase reversible? If so, are there any examples?

ANS: Generation of ATP by the F1Fo ATPase is completely reversible: in the absence of a proton potential, a high concentration of ATP can drive Fo in reverse and protons flow back to generate a p. The intestinal Enterococcus faecalis, a Gram-positive bacterium, generates ATP mostly by fermentation and can operate the F1Fo ATPase in reverse, consuming ATP to generate a proton potential for nutrient uptake and ion transport.

DIF: Difficult REF: 14.3 OBJ: 14.3e Describe the structure and function of ATP synthase MSC: Understanding 11. The F1Fo ATP synthase is a remarkably complex enzyme, its subunit structure highly conserved across life domains. Is it possible to use this enzyme as an antibiotic target?

ANS: Differences among prokaryotic F1Fo ATPases can be explored in the design of drugs specific to particular versions of the enzyme. Molecules targeting F1Fo ATP have been designed; for example, the enzyme of Mycobacterium tuberculosis is inhibited specifically by bedaquiline, a novel antibiotic.

DIF: Medium REF: 14.3 OBJ: 14.3e Describe the structure and function of ATP synthase MSC: Applying 12. What is dissimilatory metal reduction? How is it different from assimilatory metal reduction? Is there application of the dissimilatory metal reduction phenomenon?

ANS: Dissimilatory metal reduction is an important type of anaerobic respiration that consists of the use of metal cations as terminal electron acceptors, for example, Mn4/Mn2. Reduced metals are extruded from the cell. In contrast, in assimilatory metal reduction, the cell incorporates minerals.

Metal-reducing bacteria such as Geobacter or Shewanella have been found to transfer electrons to metals or to neighboring bacteria when naturally present in biofilms. This phenomenon has been replicated to produce electricity in a microbial fuel cell where the fuel consists of organic molecules; the anode is a bacterial biofilm and the cathode is a section of the fuel cell where protons and the electrons coming from the anode reduce oxygen to water.

DIF: Medium REF: 14.4 OBJ: 14.4a Define anaerobic respiration, dissimilatory denitrification, and dissimilatory metal reduction MSC: Understanding 13. Use the figure below to describe Salmonella enterica respiration on tetrathionate. What is the advantage of using this anaerobic respiratory mechanism?

ANS: [i] Salmonella enterica invades epithelial cells of the intestinal tract and cause inflammation. [ii] White blood cells arrive to the site of inflammation and produce radical oxygen species (ROS). [iii] Salmonella cells catabolize amino acids and release H2S, which is converted to thiosulfate by ROS. [iv] Neutrophils arrive to the site of inflammation and convert thiosulfate to tetrathionate via ROS. [v] Salmonella uses tetrathionate as a terminal electron acceptor to its ETS to yield energy. [vi] This extra energy source allows S. enterica cells to outgrow the microbiota in the host’s gut and cause disease.

DIF: Medium REF: 14.4 OBJ: 14.4b Identify molecules that can serve as terminal electron acceptors in anaerobic respiration MSC: Analyzing 14. Use the figure below to describe how Acidithiobacillus ferrooxidans can utilize iron as an electron donor for ATP production. Discuss how other microbes benefit from or contribute to the process.

ANS:

Acidithiobacillus ferrooxidans bacteria oxidize Fe2 to Fe3 using cytochrome c2 (A) and a periplasm-located redox protein called rusticyanin (B), which in turn donates electrons to a series of cytochromes. The oxidation process occurs at pH between 1.5 and 2.5 and requires energy, which is obtained by using oxygen as an electron acceptor. Alternatively, some electrons from rusticyanin reduce the cytochrome bc1 complex, which in turn reduces a quinone pool. In this organism, the DpH drives reverse electron flow (C) through a NAD(P)H dehydrogenase complex (NDH) to produce NADH and NADPH (D) for biosynthesis. The NDH complex allows inward proton pumping. Proton passage through the ATP synthase leads to synthesis of ATP (E).

DIF: Medium REF: 14.3 OBJ: 14.5a Identify possible initial electron donors to an ETS in lithotrophy MSC: Applying 15. What are methanotrophs? What is their role in the global carbon cycle?

ANS: Methanotrophs are organisms that oxidize methane using oxygen or another inorganic compound as a terminal electron acceptor. Methanogens provide an abundance of methane, which can be harvested by methanotrophs. On the ocean floor, methane becomes trapped, and anaerobic methane oxidation plays a critical role in the global carbon cycle, removing submarine methane.

Previously, it was thought that methanotrophy was only associated with aerobic oxidation.

DIF: Difficult REF: 14.5 OBJ: 14.5f Compare and contrast methanogenesis, methylotrophy, and methanotrophy MSC: Applying 16. What is photoheterotrophy? Give examples of photoheterotrophic organisms.

ANS: The combination of light absorption to gain energy and heterotrophic use of organic molecules is called photoheterotrophy. Light capture does not replace catabolism for energy or heterotrophy for carbon sources, but it supplements them. Examples of photoheterotrophs include organisms with bacteriorhodopsin-bearing purple membranes, such as the haloarchaea Halobacterium salinarum.

Possible uses for this organism include bioremediation.

DIF: Difficult REF: 14.6 OBJ: 14.6a Assess the importance of phototrophy in ecosystems MSC: Applying 17. Explain what kind of reaction bacteriorhodopsin performs and what it accomplishes for the cell.

What is the name of the bacteriorhodopsin homologs, in what type of organisms were they identified, and what led to their discovery?

ANS: Bacteriorhodopsin absorbs light and goes through a photocycle involving excitation and relaxation and ultimately resulting in the pumping of one H. This generates a proton motive force that can be used for ATP synthesis. Bacteriorhodopsin was thought to be limited to extreme halophilic archaea. In 2005, several researchers collected samples of seawater from the Mediterranean and Red seas. A community genome analysis was performed, including analysis of unculturable bacteria. The genomes from 13% of the marine bacteria were found to contain bacteriorhodopsin homologs, which were termed proteorhodopsins. Thus, a sizable proportion of marine phototrophy can be attributed to proteorhodopsin-producing organisms.

DIF: Difficult REF: 14.6 OBJ: 14.6a Assess the importance of phototrophy in ecosystems MSC: Evaluating 18. How does bacteriorhodopsin couple photoexcitation with proton pumping? How is ATP synthesized in bacteriorhodopsin-containing organisms?

ANS: Bacteriorhodopsin is an integral membrane protein with seven -helices surrounding the chromophore retinal. The conjugated bonds of retinal absorb visible light, mostly in the green range, and upon photoexcitation, an electron in one of the double bonds is excited to a higher energy level. As the electron returns to the ground state, a trans double bond shifts to cis, altering the conformation of the entire protein, causing it to capture a proton from the cytoplasm. Reversion of retinal to the trans conformation causes the protein to release the proton outside of the cell. The proton gradient thus generated is used by an F1Fo ATPase to synthesize ATP. DIF: Difficult REF: 14.6 OBJ: 14.6a Assess the importance of phototrophy in ecosystems MSC: Analyzing 19. Describe the role of the thylakoids in purple bacteria and cyanobacteria. Why is it that pumping protons into the lumen is essentially equivalent to pumping protons out of the cell?

ANS: In bacteria, thylakoids are invaginations with much back folding of the membrane. The extended cell membrane surface area allows for more photoreceptors for light-gathering purposes, and the membrane itself separates two compartments to form a proton gradient. Thylakoids are connected by tubular extensions and have a single interior space, the lumen, separated from the cytoplasm.

The protons flow back from the lumen through the thylakoid-embedded F1Fo ATPase into the cytoplasm, generating ATP. The proton current and ATP motor face in the same direction with respect to FoF1 ATPases located on the plasma membrane.

DIF: Medium REF: 14.6 OBJ: 14.6b Describe the structure and function of the cyanobacterial antenna complex and reaction center MSC: Applying 20. How does photosystem I allow Chlorobium and other green sulfur bacteria to live near deep-sea vents?

ANS: Anaerobic photosystem I contains bacteriochlorophyll P840, which absorbs weak near-infrared light in the 750–850 nm range. This thermal radiation, produced by deep-sea thermal vents, is enough to drive photosynthesis by separation of hydrogen-associated electrons from H2S. DIF: Medium REF: 14.6 OBJ: 14.6d Compare and contrast the different classes of photopigments; include what organisms they are found in and their structures and functions MSC: Understanding

CHAPTER 15: Biosynthesis MULTIPLE CHOICE 1. All microorganisms require all of the following for biosynthetic purposes EXCEPT

a. phosphorous. b. reduction. c. energy.

d. carbon. e. nitrogen gas.

ANS: D DIF: Easy REF: 15.1 OBJ: 15.1b Recall what organisms require to perform biosynthesis MSC: Remembering 2. Which of the following molecules links glycolysis with the TCA cycle, and also serves as a precursor for many biosynthetic products? a. malate d. acetyl-CoA b. citrate e. succinate c. oxaloacetate ANS: D DIF: Easy REF: 15.1 OBJ: 15.1a Identify examples of anabolism

MSC: Remembering

3. An association between two Antarctic microorganisms is pictured below. It provides an interaction that supplies ________, made by the ________, to the ________.

a. b. c. d. e.

amino acids; diatom; bacterium fixed nitrogen; diatom; bacterium fixed nitrogen; bacterium; diatom vitamin B12; diatom; bacterium vitamin B12; bacterium; diatom

ANS: E DIF: Easy REF: 15.1 OBJ: 15.1c Explain how biosynthesis costs the cell energy and describe adaptations that minimize the energy costs MSC: Analyzing 4. What methods do microorganisms NOT use to minimize energy for biosynthesis? a. inhibiting or killing competitors by making antimicrobials b. loss of genes encoding enzymes for a nutrient that can be provided by the environment c. regulation of gene expression so that molecules are not made if available d. allosteric control of biosynthetic enzyme activity e. transport of ATP from the environment into the cell to drive biosynthesis ANS: E DIF: Difficult REF: 15.1 OBJ: 15.1c Explain how biosynthesis costs the cell energy and describe adaptations that minimize the energy costs MSC: Applying

5. Two strains of E. coli were developed, each of which overproduced an amino acid, either histidine or tryptophan. When grown together in medium with adequate amino acids, they grew but did not associate with each other. When these strains were grown together in medium without histidine and tryptophan, they grew and formed ________ in order to ________. a. carboxysomes; share the excess of the two amino acids b. carboxysomes; provide ATP to each other to make the missing amino acids c. nanotubes; share the excess of the two amino acids d. nanotubes; provide ATP to each other to make the missing amino acids e. heterocysts; share the excess of the two amino acids ANS: C DIF: Difficult REF: 15.1 OBJ: 15.1c Explain how biosynthesis costs the cell energy and describe adaptations that minimize the energy costs MSC: Evaluating 6. The Calvin cycle is essentially a. started by the oxygen capture by Rubisco. b. a reductive pentose phosphate cycle. c. the reductive, or reverse, tricarboxylic acid cycle. d. a pathway to synthesize fatty acids but not sugars. e. a pathway that is used only when light is present.

ANS: B DIF: Easy fixation MSC: Remembering

REF: 15.2

OBJ: 15.2a Define CO2

7. The ________ pathway is utilized for carbon fixation in chloroplasts and cyanobacteria. a. acetyl-CoA b. reverse tricarboxylic acid cycle c. 3-hydroxypropionate cycle d. reductive pentose phosphate cycle e. Krebs cycle ANS: D DIF: Easy REF: 15.2 OBJ: 15.2b Recall which organisms conduct the Calvin cycle

MSC: Remembering

8. Which of the following are unique in that they fix CO2 as their sole carbon source? a. organotrophs and iron oxidizers b. photoheterotrophs and chemiolithotrophs c. photoautotrophs and lithotrophs d. heterotrophs and methanogens e. methanogens and photoheterotrophs ANS: C DIF: Medium fixation MSC: Remembering

REF: 15.2

OBJ: 15.2a Define CO2

9. Cyanobacteria are believed to generate the majority of oxygen gas in Earth’s atmosphere. What allows them to produce oxygen? a. photosynthesis in which H2S is the electron source b. photosynthesis in which water photolysis produces H, e, and O2 c. bacteriorhodopsin-based photosynthesis d. being near the surface of a pond where more oxygen is available e. possession of a variety of chlorophylls to absorb a wide range of wavelengths of light ANS: B

DIF: Easy

REF: 15.2

OBJ: 15.2b Recall which organisms conduct the Calvin cycle

MSC: Remembering

10. Which technique did Melvin Calvin use to elucidate the intermediates of phototrophic carbon fixation in the chloroplasts of Chlorella? a. HPLC d. column chromatography b. gel electrophoresis e. mass spectroscopy c. paper chromatography ANS: C DIF: Easy REF: 15.2 OBJ: 15.2c Name the key research tools that enabled elucidation of the Calvin cycle MSC: Remembering 11. Which of the following statements is NOT true about Rubisco? a. It catalyzes the addition of CO2 to ribulose 1,5-bisphosphate. b. It is present in all organisms that use the Calvin cycle to fix CO2. c. It is found in the carboxysomes of autotrophic bacteria. d. All species contain the same number of large and small subunits. e. Its structure is highly conserved across bacterial groups and chloroplasts.

ANS: D DIF: Easy REF: 15.2 OBJ: 15.2d Outline the key steps of the Calvin cycle; where possible include relevant enzymes and substrates MSC: Remembering 12. The catalytic site of Rubisco is located in a. the large subunit. b. the small subunit. c. a cavity that forms between an LSU and an SSU. d. the chloroplast. e. the chlorosome.

ANS: A DIF: Easy REF: 15.2 OBJ: 15.2d Outline the key steps of the Calvin cycle; where possible include relevant enzymes and substrates MSC: Remembering 13. The structures marked with arrows in the photo below are ________ and are used to ________.

a. polyhydroxyalkanoates; sequester reactions using bicarbonate or carbon dioxide and Rubisco b. polyhydroxyalkanoates; store carbon for energy c. carboxysomes; store carbon for energy d. carboxysomes; sequester reactions using bicarbonate or carbon dioxide and Rubisco

e. heterocysts; sequester reactions using bicarbonate or carbon dioxide and Rubisco ANS: D DIF: Medium REF: 15.2 OBJ: 15.2e Describe the structure and function of carboxysomes MSC: Analyzing 14. What types of bacteria perform the reductive pentose phosphate cycle to fix CO2? a. cyanobacteria d. heterotrophs b. purple phototrophs e. methanogens c. lithotrophs ANS: D DIF: Medium REF: 15.3 OBJ: 15.3c Compare and contrast the reductive TCA cycle, the reductive acetyl-CoA pathway, and the 3-hydroxypropionate cycle; include organisms they are each found in, ATP demands, reducing agents, and key intermediates MSC: Remembering 15. Which of the following pathways is NOT a route for CO2 assimilation? a. reductive acetyl-CoA pathway b. gluconeogenesis pathway c. hydroxypropionate cycle d. reductive pentose phosphate cycle e. reverse TCA cycle ANS: B DIF: Medium fixation MSC: Understanding

REF: 15.2 | 15.3

OBJ: 15.2a Define CO2

16. Which of the following statements concerning glyceraldehyde-3-phosphate is FALSE? a. One G3P is produced by everything three turns of the cycle. b. Two molecules of G3P condense to form a six-carbon sugar. c. One more G3P condenses with a sugar to form a larger molecule used for biosynthesis. d. PGA is reduced to G3P after the PGA moves out of the carboxysome. e. G3P is reoxidized to carbon dioxide so that the cycle continues.

ANS: E DIF: Easy REF: 15.2 OBJ: 15.2g Identify the fates of glyceraldehyde 3-phosphate in the Calvin cycle MSC: Applying 17. How many turns of the Calvin cycle does it take to provide one molecule of glyceraldehyde-3-phosphate into the biosynthesis of glucose? a. 1 d. 6 b. 2 e. 5 c. 3 ANS: C DIF: Easy REF: 15.2 OBJ: 15.2d Outline the key steps of the Calvin cycle; where possible include relevant enzymes and substrates MSC: Understanding 18. The enzyme that carries out this reaction shown in the diagram below is ________, and the end product is ________.

a. b. c. d. e.

3-phosphoglycerate synthetase; added to another carbon dioxide 3-phosphoglycerate synthetase; reduced to glyceraldehyde-3-phosphate nitrogenase; reduced to glyceraldehyde-3-phosphate Rubisco; reduced to glyceraldehyde-3-phosphate Rubisco; added to another carbon dioxide

ANS: D DIF: Easy REF: 15.2 OBJ: 15.2d Outline the key steps of the Calvin cycle; where possible include relevant enzymes and substrates MSC: Analyzing 19. Rubisco catalyzes which of the following reactions? a. CO2  ribulose 1,5-bisphosphate 2,3-phosphoglycerate b. HCO3  acetyl-CoA malonyl-CoA  NADPH 3-hydroxypropionate c. d. Ribulose-1,5-bisphosphate Fructose- 1,6-bisphosphate e. 2-carboxy-3-ketoarabinitol-1,5-bisphosphate G3P ANS: A DIF: Medium REF: 15.2 OBJ: 15.2d Outline the key steps of the Calvin cycle; where possible include relevant enzymes and substrates MSC: Understanding 20. What is the most sensitive method to determine the presence of an isotope such as 14C in a sample? a. nuclear magnetic resonance (NMR) spectroscopy b. radioactive decay c. mass spectroscopy d. polymerase chain reaction e. high-performance liquid chromatography ANS: B DIF: Difficult REF: 15.2 OBJ: 15.2c Name the key research tools that enabled elucidation of the Calvin cycle MSC: Analyzing 21. The most ancient CO2 fixation pathway in methanogens is the a. reverse TCA cycle. d. reductive acetyl-CoA pathway. b. 3-hydroxypropionate cycle. e. Krebs cycle. c. Calvin cycle.

ANS: D DIF: Easy REF: 15.3 OBJ: 15.3b Name CO2 fixation reactions other than the Calvin cycle MSC: Remembering

22. The most ancient CO2 fixation pathway in anaerobic phototrophic bacteria and archaea is the a. reverse TCA cycle. d. reductive acetyl-CoA pathway. b. 3-hydroxypropionate cycle. e. glyoxylate bypass. c. Calvin cycle.

ANS: A DIF: Easy REF: 15.3 OBJ: 15.3b Name CO2 fixation reactions other than the Calvin cycle MSC: Remembering 23. The cell diagrammed below provides an overview of some regulation of the Calvin cycle. Which of the following is NOT involved in this regulation?

a. Several different transport mechanisms are used for CO2 and b. CO2 and are sequestered inside a carboxysome.

.

c. Rubisco is sequestered inside a carboxysome. d. Carbonic anhydrase is used to convert CO2 to and thus trap it. e. Proteins are used to block light and thus the light reactions.

ANS: E DIF: Medium REF: 15.2 OBJ: 15.2f Explain how the Calvin cycle is regulated

MSC: Analyzing

24. How does the reductive (reverse) TCA cycle participate in carbon fixation? a. Some of the TCA reactions occur in reverse, assimilating small amounts of CO2. b. CO2 assimilation uses up TCA intermediates for anabolic pathways. c. Reverse TCA regenerates succinyl-CoA, which may enter gluconeogenesis. d. A large amount of ATP is generated. e. All reactions take place in a carboxysome.

ANS: A DIF: Medium REF: 15.3 OBJ: 15.3c Compare and contrast the reductive TCA cycle, the reductive acetyl-CoA pathway, and the 3-hydroxypropionate cycle; include organisms they are each found in, ATP demands, reducing agents, and key intermediates MSC: Understanding 25. What kind of reaction is the formation of oxaloacetate from phosphoenolpyruvate? a. catabolic d. dehydrogenation b. anaplerotic e. co-factor induced c. decarboxylation ANS: B DIF: Medium REF: 15.3 OBJ: 15.3a Define and identify anaplerotic reactions

MSC: Understanding

26. In the reductive TCA cycle, four or five ATPs are used to produce one oxaloacetate. How many molecules of CO2 are fixed in this cycle?

a. two b. three c. four

d. five e. six

ANS: C DIF: Medium REF: 15.3 OBJ: 15.3c Compare and contrast the reductive TCA cycle, the reductive acetyl-CoA pathway, and the 3-hydroxypropionate cycle; include organisms they are each found in, ATP demands, reducing agents, and key intermediates MSC: Understanding 27. In anaplerotic reactions a. intermediates in a pathway are regenerated. b. nutrients are imported from the environment. c. molecules targeted for breakdown are salvaged for anabolism. d. the reactions are thermodynamically impossible. e. large amounts of ATP are generated.

ANS: A DIF: Medium REF: 15.3 OBJ: 15.3a Define and identify anaplerotic reactions

MSC: Understanding

28. Which of the following is the reducing agent in the saturation step of polyketide biosynthesis? a. NADH d. H2 b. NADPH e. O2 c. ferredoxin ANS: B DIF: Easy REF: 15.4 OBJ: 15.4d Compare and contrast fatty acid synthesis with polyketide antibiotic synthesis MSC: Remembering 29. Why do most fatty acids contain an even number of carbon atoms? a. The priming reaction involves condensation of the acetyl-CoA with ACP. b. A C3-intermediate (malonyl-CoA) is carboxylated during chain elongation to yield an even number of carbons. c. Fatty acid biosynthesis incorporates succinyl-CoA. d. Fatty acids do not have an even number of carbons. e. It is now easier to add double bonds.

ANS: A DIF: Medium REF: 15.4 OBJ: 15.4a Summarize why and how fatty acids can be constructed using a small number of different enzymes MSC: Remembering 30. Many of the antibiotics and other pharmaceutical agents isolated from Streptomyces species are a. amides. d. fatty acids. b. polyketides. e. lipids. c. thioesters.

ANS: B DIF: Medium REF: 15.4 OBJ: 15.4d Compare and contrast fatty acid synthesis with polyketide antibiotic synthesis MSC: Remembering 31. Which of the following is NOT correct about fatty acid biosynthesis? a. It involves successive condensations of malonyl-ACP. b. A dehydratase is used to generate an unsaturated bond. c. It is regulated by the stringent response of carbon starvation. d. NADPH is generally involved in hydrogenation. e. Many single-component enzymes are involved.

ANS: E DIF: Easy REF: 15.4 OBJ: 15.4b Recall the roles of acetyl-CoA carboxylase, acyl carrier protein, NADPH, and dehydratase in fatty acid synthesis MSC: Understanding 32. Which of the following is NOT correct regarding unsaturation in certain fatty acids? a. Temperature regulates fatty acid composition. b. The plasma membrane must maintain a certain degree of flexibility. c. Low temperature induces expression of fabA, which encodes a dehydratase enzyme. d. Low temperatures favor fewer unsaturated fatty acids. e. Temperature has no effect.

ANS: D DIF: Difficult REF: 15.4 OBJ: 15.4c Describe mechanisms of fatty acid synthesis regulation MSC: Understanding 33. Industrial nitrogen fixation is achieved through the Haber process a. in which N2 is reduced catalytically by H2 at ambient temperature. b. in which N2 is hydrogenated by CH4 at extreme temperature and pressure. c. in which nitrate and nitrite are chemically converted to NH at ambient temperature. d. which requires little energy. e. which is carried out by purified enzymes in a reactor.

ANS: B DIF: Medium REF: 15.5 OBJ: 15.5a Assess the ecological importance of microbial N2 fixation MSC: Remembering 34. Denitrification is the a. conversion of nitrate or nitrite to N2 by anaerobic respirers. b. oxidation of NH4 to nitrate or nitrite by lithotrophs. c. conversion of N2 to NH4. d. removal of nitro groups from organic molecules. e. removal of amino groups from organic molecules.

ANS: A DIF: Easy REF: 15.5 OBJ: 15.5a Assess the ecological importance of microbial N2 fixation MSC: Remembering 35. Which pair is NOT matched correctly? a. NtrC—regulates nitrogenase gene expression in response to NH4 concentration b. NtrB—phosphorylates NtrC when NH4 concentration is low c. NifL—forms a two-component signal transduction system with NtrC d. NifA—acts in concert with factor -54 e. NifHDKTY—components of nitrogenase ANS: C DIF: Medium REF: 15.5 OBJ: 15.5e Explain how and why nitrogen fixation is regulated MSC: Remembering 36. Gene expression of nitrogenase through NtrC is downregulated in high concentrations of a. carbon dioxide. d. ammonium. b. nitrogen. e. FeMo protein. c. nitrate.

ANS: D DIF: Medium REF: 15.5 OBJ: 15.5e Explain how and why nitrogen fixation is regulated

MSC: Remembering 37. Which of the following is NOT correct regarding nitrogen assimilation into biomass? a. Different oxidation states of nitrogen require different amounts of reducing energy. b. It is easy for living organisms to assimilate nitrogen due to its great stability. c. Nitrogen forms must be fully reduced to NH3. d. Only bacteria and archaea can assimilate elemental nitrogen. e. It is expensive, requiring reducing energy and ATP. ANS: B DIF: Medium REF: 15.5 OBJ: 15.5f List the forms of nitrogen available to microbes

MSC: Understanding

38. Biological nitrogen fixation is energetically expensive. Assuming that NADPH is used as the reducing equivalent, how many ATPs are used in the enzymatic conversion of N2 to NH3? a. 16 d. 64 b. 32 e. none; only GTP is used c. 48 ANS: A DIF: Medium REF: 15.5 OBJ: 15.5c Recall the structure, function, and mechanism of action of nitrogenase MSC: Understanding 39. In the mechanism of nitrogen reduction, ________ directly takes the place of the H2 in the FeMo subunit of the enzyme nitrogenase. a. NH3 d. H2N—NH2 b. N2 e. NADPH c. HN=NH ANS: B DIF: Medium REF: 15.5 OBJ: 15.5c Recall the structure, function, and mechanism of action of nitrogenase MSC: Understanding 40. The enzyme nitrogenase is inhibited by oxygen. Which of the following does NOT protect nitrogenase from oxygen? a. special thick-walled cells (heterocysts) in filamentous cyanobacteria, such as Anabaena b. special nitrogenase-protecting proteins in Azotobacter species c. temporal separation of nitrogen fixation (at night) and photosynthesis (during the day) in some species of cyanobacteria d. growth under aerobic conditions e. growth under anaerobic conditions ANS: D DIF: Medium REF: 15.5 OBJ: 15.5d Describe adaptations that protect nitrogenase from oxygen MSC: Understanding 41. Which of the following molecules CANNOT freely cross biological membranes? a. O2 d. N2 b. CO2 e. H2O c. NH4 ANS: C DIF: Easy REF: 15.5 OBJ: 15.5c Recall the structure, function, and mechanism of action of nitrogenase MSC: Remembering

42. Nitrogenase is diagrammed below. This particular enzyme is shown in the format just before it begins a cycle of nitrogen reduction. This goal is accomplished in four steps. What is the first step?

a. N2 gas binds to the active site on the FeMo protein. b. NADPH binds to the active site in order to reduce it prior to N2 binding. c. Two e  are transferred to the Fe protein and then to the FeMo protein, which are used to reduce H to H2 prior to N2 binding. d. The preexisitng NH4 is removed prior to N2 binding. e. Fe and Mo are bound to the active sites and then released prior to the next cycle.

ANS: C DIF: Difficult REF: 15.5 OBJ: 15.5c Recall the structure, function, and mechanism of action of nitrogenase MSC: Applying 43. The amino acid biosynthetic pathways are designated as families. The ________ family generates only one amino acid. a. aspartate d. aromatic b. serine e. histidine c. pyruvate ANS: E DIF: Medium REF: 15.6 OBJ: 15.6a Compare and contrast amino acid synthesis to fatty acid synthesis MSC: Understanding 44. The incorporation of NH4 into 2-oxoglutarate is the first step in nitrogen assimilation in bacterial cells. This reaction is catalyzed by the enzyme ________ and produces ________. a. glutamate dehydrogenase (GDH); glutamate b. glutamine synthase (GS); glutamine c. glutamate synthase (GOGAT); glutamate d. 2-oxoglutarate aminase (2-OA); glutamine e. 2-oxoglutarate dehydrogenase (2-ODH); glutamine ANS: A DIF: Medium REF: 15.6 OBJ: 15.6d Distinguish among glutamate dehydrogenase, glutamine synthetase, and glutamate synthase MSC: Understanding 45. Based on the number of enzymes involved in its biosynthesis, which of the following is the most complex amino acid specified by the genetic code? a. tryptophan d. leucine b. tyrosine e. isoleucine

c. phenylalanine ANS: A DIF: Easy REF: 15.6 OBJ: 15.6h Outline the biosynthesis of arginine, aromatic amino acids, and nonribosomal peptide antibiotics MSC: Understanding 46. Chorismate is used in a branched pathway to synthesize a. fatty acids. d. aromatic amino acids b. polyketide antibiotics e. tetrapyrroles c. purines and pyrimidines ANS: D DIF: Medium REF: 15.6 OBJ: 15.6h Outline the biosynthesis of arginine, aromatic amino acids, and nonribosomal peptide antibiotics MSC: Understanding 47. Which of the following does NOT serve as an intermediate in the biosynthesis of amino acids? a. citrate d. 3-phosphoglycerate b. 2-oxoglutarate e. pentose phosphate c. pyruvate ANS: A DIF: Easy REF: 15.6 OBJ: 15.6h Outline the biosynthesis of arginine, aromatic amino acids, and nonribosomal peptide antibiotics MSC: Remembering 48. Which amino acid is NOT one of the first amino acids produced by ancient cells? a. glutamate d. valine b. tyrosine e. asparate c. glycine ANS: B DIF: Easy REF: 15.6 OBJ: 15.6b Summarize the evidence showing that glutamate, aspartate, alanine, glycine, and valine were the first amino acids produced by ancient cells MSC: Remembering 49. Which molecules use 5-phosphoribosyl-1-pyrophosphate (PRPP) in their biosynthesis? a. amino acids d. tetrapyrrole b. nucleotides e. nonribosomal peptide antibiotics c. fatty acids ANS: B DIF: Easy REF: 15.6 OBJ: 15.6f Recall the role of 5-phosphoribosyl-1-pyrophosphate (PRPP) in nucleotide synthesis MSC: Understanding 50. Which of the following molecules provides a way to simultaneously assimilate one carbon atom and one nitrogen atom during purine biosynthesis? a. acetyl-CoA d. carbamoyl phosphate b. acetyl-ACP e. NADPH c. malonyl-ACP ANS: D DIF: Medium REF: 15.6 OBJ: 15.6g Compare and contrast purine biosynthesis to pyrimidine biosynthesis MSC: Analyzing 51. Which of the following is NOT correct regarding the biosynthesis of purines and pyrimidines? a. 5-phosphoribosyl-1-pyrophosphate (PRPP) is a precursor to both purines and pyrimidines. b. The pyrimidine ring is synthesized first and then linked to 5-phosphoribosyl-1-pyrophosphate.

c. The purine ring is built around the C1 of 5-phosphoribosyl-1-pyrophosphate. d. Both purines and pyrimidines use inosine monophosphate as a precursor. e. Both purines and pyrimidines are built by adding carbon components to ribose 5-phosphate.

ANS: D DIF: Difficult REF: 15.6 OBJ: 15.6g Compare and contrast purine biosynthesis to pyrimidine biosynthesis MSC: Analyzing 52. Which of the following drugs is a nonribosomal peptide antibiotic? a. erythromycin d. vancomycin b. penicillin e. ciprofloxacin c. tetracycline ANS: D DIF: Medium REF: 15.6 OBJ: 15.6h Outline the biosynthesis of arginine, aromatic amino acids, and nonribosomal peptide antibiotics MSC: Analyzing 53. Which of the following is NOT a tetrapyrrole? a. cytochrome d. tryptophan b. chlorophyll e. hemoglobin c. vitamin B12 ANS: D DIF: Medium REF: 15.6 OBJ: 15.6h Outline the biosynthesis of arginine, aromatic amino acids, and nonribosomal peptide antibiotics MSC: Remembering SHORT ANSWER 1. What technique was used to demonstrate that gene expression of the CO2-concentrating mechanism (CCM) transporters is induced by low levels of CO2? Briefly explain the basis of the technique.

ANS: The technique used was reverse transcriptase PCR (RT-PCR). In this technique, mRNA is isolated from cell populations before and after CO2 limitation. Using reverse transcriptase, the transcripts are converted to complementary DNA (cDNA), which is then amplified by PCR to generate enough DNA to visualize through simpler techniques, such as gel electrophoresis and northern blotting. The amounts of product are compared under each condition to see if induction occurred.

DIF: Medium REF: 15.2 OBJ: 15.2c Name the key research tools that enabled elucidation of the Calvin cycle MSC: Understanding 2. Briefly discuss how carbon molecules of different sizes can be made for biosynthesis. What else is needed and how is it obtained?

ANS: Molecules with varying numbers of carbons are made and used for biosynthesis during the rearrangements of these molecules in the pentose phosphate pathway and the Calvin cycle. These two pathways produce three-carbon, five-carbon, and six-carbon compounds that are rearranged to form molecules such as sedoheptulose-1,7-bisphosphate (seven carbon) and erythrose-4-phosphate (four carbon). Catabolism of some three carbon compounds produces acetyl-CoA with two carbons.

Energy is needed to carry out biosynthesis. This energy is usually in the form of ATP, oxidation of NADPH, or from ion gradients. In addition, reduction is needed to take a carbon compound (such as carbon dioxide) that is somewhat oxidized and reduce it to something that can be used for biosynthesis. A variety of essential elements such as phosphorous are also needed and transported in from the environment.

DIF: Easy REF: 15.1 | 15.2 OBJ: 15.1a Identify examples of anabolism | 15.2b Recall which organisms conduct the Calvin cycle MSC: Applying 3. It is thought that the Calvin cycle appeared after the divergence of the three domains of life. What supports this hypothesis?

ANS: The full Calvin cycle is only found in bacteria and organelles of bacterial origin. It is not found in archaea or the cytoplasm of eukaryotes. Also, the uniformity of the pathway across species, as opposed to the diversity of anaerobic pathways of carbon dioxide fixation, supports the hypothesis of late emergence.

DIF: Difficult REF: 15.2 OBJ: 15.2b Recall which organisms conduct the Calvin cycle

MSC: Analyzing

4. What techniques and technical advances allowed Melvin Calvin to study carbon fixation? Why did he choose the unicellular alga Chlorella?

ANS: Melvin Calvin and his group used 14C, which has a long half-life. Although found in nature, 14C is not abundant and must be produced in special facilities to be used in labeling of molecules for biological experiments. With the availability of 14C-labeled substrates to investigate CO2 fixation, Calvin used two-dimensional paper chromatography to separate the metabolites synthesized promptly after exposure of photosynthetic cells to . Using a unicellular organism that is easy to culture and harvest by centrifugation ensured the capture of the photosynthetic intermediates shortly after a pulse of and alcohol extraction.

DIF: Medium REF: 15.2 OBJ: 15.2c Name the key research tools that enabled elucidation of the Calvin cycle MSC: Analyzing 5. How does the reductive or reverse TCA cycle differ from the regular TCA cycle?

ANS: Most of the individual reactions of the TCA cycle are reversible, allowing the cycle to fix CO2 and to generate acetyl-CoA, instead of consuming it. Acetyl-CoA can proceed to gluconeogenesis via pyruvate; its acetyl moiety can enter diverse anabolic pathways. The three enzymes that are particular to the reverse TCA cycle are ATP-citrate lyase, which breaks down citrate to oxaloacetate and acetyl-CoA; 2-oxoglutarate:ferredoxin oxidoreductase, which synthesizes 2-oxoglutarate from succinyl-CoA and CO2; and fumarate reductase. The cycle uses 4–5 ATP molecules to fix 4 CO2, producing oxaloacetate. Reducing power comes from ferredoxin, NADH, and NADPH. DIF: Difficult REF: 15.3 OBJ: 15.3c Compare and contrast the reductive TCA cycle, the reductive acetyl-CoA pathway,

and the 3-hydroxypropionate cycle; include organisms they are each found in, ATP demands, reducing agents, and key intermediates MSC: Understanding 6. Describe the 3-hydroxypropionate cycle; give examples of microorganisms that use this CO2 fixation mechanism.

ANS: condenses with acetyl-CoA to form malonyl-CoA, which is reduced to 3-hydroxypropionate using NADPH. Another reduction and condensation with a second forms methylmalonyl-CoA, from which malyl-CoA is derived. Malyl-CoA releases glyoxylate and acetyl-CoA to restart the cycle. A third is captured by glyoxylate to form pyruvate, which enters sugar and amino acid biosynthetic pathways. Chloroflexus aurantiacus, a filamentous thermophile, and archaea, such as the thermoacidophile Acidianus brierleyi and the aerobic sulfur oxidizer Sulfolobus metallicus, utilize this cycle to assimilate carbon.

DIF: Difficult REF: 15.3 OBJ: 15.3c Compare and contrast the reductive TCA cycle, the reductive acetyl-CoA pathway, and the 3-hydroxypropionate cycle; include organisms they are each found in, ATP demands, reducing agents, and key intermediates MSC: Understanding 7. Briefly describe the reductive acetyl-CoA pathway. What is its relevance for methanogens?

ANS: The reductive acetyl-CoA pathway seems to be the most ancient CO2 fixation and biomass assimilation; for example, in methanogens, up to 5% of the CO2 they absorb is used in biosynthesis. It consists in the formation of an acetyl group using two CO2 molecules converging from two different pathways. Formate is produced by reduction of CO2 and transfer to tetrahydrofolate (THF), thus forming a C1 unit. The C1 unit is reduced to a methyl group, CH3.

In methanogens, methane is formed from this C1 unit for energy gain. The methyl group can be fixed into biomass after being transferred to a tetrapyrrole (called TB and related to vitamin B12).

The second CO2 molecule becomes via carbon dioxide dehydrogenase. is condensed with coenzyme A and the methyl group carried by TB to form acetyl-CoA. DIF: Difficult REF: 15.3 OBJ: 15.3c Compare and contrast the reductive TCA cycle, the reductive acetyl-CoA pathway, and the 3-hydroxypropionate cycle; include organisms they are each found in, ATP demands, reducing agents, and key intermediates MSC: Analyzing 8. How is fatty acid biosynthesis regulated in bacteria?

ANS: Because fatty acid biosynthesis consumes large amounts of energy, it must be tightly regulated and coupled with cytoplasm growth. Subunit AccB of the acetyl-CoA carboxylase represses the transcription of the accBC operon, and, as a consequence, initiation of fatty acid biosynthesis is limited by the amount of holoenzyme AccB-AccC present. Some environmental factors contribute to regulate the synthesis of fatty acids. For example, starvation for carbon sources blocks fatty acid biosynthesis through the ―stringent response,‖ which is mediated by the polyphosphorylated nucleotide ppGpp and temperature. Temperature influences fatty acid composition: in E. coli, low temperatures induce the expression of fabA, the gene that codes for the dehydratase involved in the production of unsaturated, less rigid fatty acids, resulting in a more flexible membrane.

DIF: Difficult

REF: 15.4

OBJ: 15.4c Describe mechanisms of fatty acid synthesis regulation MSC: Understanding 9. What are polyalkanoates, and what are bacterially produced polyalkanoates used for? Why are they of ecological and medical interest?

ANS: Polyalkanoates are polyesters that are used in bacteria as a form of energy storage; an example is polyhydroxybutyrate, which accumulates as granules in Legionella pneumophila. These microbially produced polymers are biodegradable, so they are being developed to make biodegradable plastics and reabsorbable surgical sutures.

DIF: Medium REF: 15.4 OBJ: 15.4c Describe mechanisms of fatty acid synthesis regulation MSC: Applying 10. Describe how modular enzymes function in polyketide biosynthesis. Why might this be of use medically?

ANS: Modular enzymes consist of multiple modules, each one adding similar but nonidentical components to a growing chain. In the case of polyketides, malonyl-ACP units are condensed.

Malonyl moieties contain unique R groups instead of a CO2. The R groups, which can be hydroxyls, amides, or aromatic rings, among others, determine the final identity of the polyketide; for example, in erythromycin all R groups are methyl groups. Understanding how polyketide biosynthesis occurs would lead to the bioengineering of new products, particularly new antibiotics.

DIF: Medium REF: 15.4 OBJ: 15.4d Compare and contrast fatty acid synthesis with polyketide antibiotic synthesis MSC: Applying 11. How do cyanobacteria benefit from their heterocysts attracting heterotrophic bacteria?

ANS: Some cyanobacterial heterocysts leak organic acids, which attract swarms of heterotrophic bacteria. The feeding heterotrophs deplete the surrounding oxygen produced by the photosynthetic cells, thereby improving conditions for nitrogen fixation.

DIF: Medium REF: 15.5 OBJ: 15.5d Describe adaptations that protect nitrogenase from oxygen MSC: Understanding 12. What is the health risk of having nitrates in drinking water? What conditions favor the accumulation of nitrates and nitrites in bodies of water?

ANS: In natural environments most nitrogen sources are subject to competition from dissimilatory metabolism. Fertilizers contain nitrogen as NH4, which can leach from agricultural soils to bodies of water where it can be oxidized to nitrate and nitrite by lithotrophs, a process known as nitrification. Nitrites can combine with hemoglobin, rendering it incapable of taking up oxygen.

When infants drink water with high nitrate content, they become ill with ―blue baby‖ syndrome, as nitrate becomes nitrite in the digestive system.

DIF: Difficult REF: 15.5 OBJ: 15.5a Assess the ecological importance of microbial N2 fixation MSC: Applying 13. The bacterial enzyme nitrogenase performs the reduction of N2 gas using a large amount of energy and reducing power. Describe the nitrogen reduction steps during nitrogenase activity and write the overall reaction.

ANS: Nitrogenase catalyzes four reduction cycles: the Fe-protein acquires electrons from an electron donor such as ferredoxin or flavodoxin, and it transfers them to the iron-molybdenum (FeMo) center. The FeMo protein binds two protons and reduces them to H2 gas; this step consumes four ATPs. N2 binds the enzyme, displacing H2 at the binding site. Hydrogen then leaves the enzyme.

Successive pairs of protons and electrons reduce nitrogen, with four ATPs spent each time:

DIF: Medium REF: 15.5 OBJ: 15.5c Recall the structure, function, and mechanism of action of nitrogenase MSC: Analyzing 14. How do ammonium and oxygen regulate the expression of nitrogen fixation genes?

ANS: An operon (nifHDKTY) encodes the nitrogenase enzyme and other proteins involved in nitrogen fixation. Ammonium availability regulates the expression of the nif operon through a nitrogen-starvation transcription factor (S-54) and a two-component signal transduction system (NtrB-NtrC). NtrC regulates nitrogenase expression in response to concentrations of the ammonium ion. At high ammonium concentrations, there is no activator bound to the promoter of nifHDKTY and no gene expression takes place. NtrB phosphorylates NtrC when ammonium concentrations are low. Phosphorylated NtrC binds the promoter of nifLA and proteins NifL and NifA are expressed. NifA and S-54 coactivate nifHDKTY and nitrogen fixation proteins are expressed. High concentrations of oxygen shut down expression of the nitrogenase through NifL, which binds NifA and prevents it from binding the nif promoter.

DIF: Difficult REF: 15.5 OBJ: 15.5e Explain how and why nitrogen fixation is regulated MSC: Analyzing 15. Briefly describe the biosynthetic pathway for arginine.

ANS: Arginine biosynthesis in bacteria is a complex process that involves about a dozen enzymes encoded in four to eight operons. Most of arginine components derive from aspartate and glutamate. An initial glutamate molecule condenses with acetyl-CoA to form acetylglutamate; aspartate and glutamate donate three amino groups to acetylglutamate; a transamination reaction with a second glutamate produces ornithine, which is also a precursor for polyamines. Ornithine reacts with carbamoyl phosphate to render citrulline and Pi; in turn, citrulline reacts with aspartic acid to form argininosuccinate, which, after releasing fumarate, becomes arginine.

DIF: Difficult REF: 15.6 OBJ: 15.6h Outline the biosynthesis of arginine, aromatic amino acids, and nonribosomal peptide antibiotics MSC: Understanding

16. What are nonribosomal peptide antibiotics? How are they synthesized?

ANS: Some microorganisms synthesize a large number of nonstandard amino acids, that is, amino acids not determined by the universal genetic code. For example, D-amino acids occur in the peptidoglycan cross-bridges. In particular, actinomycetes use both standard and nonstandard amino acids in the synthesis of secondary metabolites with antimicrobial activity. These amino acids are linked by peptide bonds whose synthesis is not mediated by ribosomes and form what are called nonribosomal peptide antibiotics. As other secondary metabolites in actinomycetes, nonribosomal peptides are synthesized by modular enzymes, which are analogous to polyketide biosynthetic enzymes. An example of this type of antibiotic is vancomycin, synthesized by Clostridium difficile.

DIF: Difficult REF: 15.6 OBJ: 15.6h Outline the biosynthesis of arginine, aromatic amino acids, and nonribosomal peptide antibiotics MSC: Applying 17. Briefly describe how NH4 is assimilated into biomass by bacteria.

ANS: The assimilable ammonium ion (NH4) is produced by nitrate fixation or by nitrate reduction, but it cannot easily penetrate the cell. The deprotonated form NH3 permeates freely through biological membranes, but it is toxic to the cell. At neutral pH, NH3 can be protonated to NH4. The ammonium ion must be immediately captured through the formation of key amino acids: first, glutamate dehydrogenase condenses NH4 with 2-oxoglutarate to form glutamate using NADPH. Glutamine synthase condenses a second NH4 with glutamate, thus forming glutamine with expense of one ATP. A third enzyme, glutamate synthase (also known as glutamine:2-oxoglutarate amidotransferase or GOGAT), converts glutamine and 2-oxoglutarate into two molecules of glutamate; variants of GOGAT use different reducing agents (NADH, NADPH, or ferredoxin).

DIF: Difficult REF: 15.6 OBJ: 15.6c Identify the problems associated with NH4+ assimilation MSC: Analyzing 18. Tryptophan is among the so-called essential amino acids for humans, as we cannot produce it ourselves. Briefly describe tryptophan biosynthesis in bacteria. Why is it so energetically expensive to synthesize this aromatic amino acid?

ANS: The glycolytic intermediates phosphoenolpyruvate and erythrose-4-phosphate initiate the pathway to synthesize chorismate, the common precursor of the aromatic amino acid family. Chorismate biosynthetic genes are encoded in a single operon, aroABCDEFGHKL. Three additional enzymatic steps are required to synthesize phenylalanine or tyrosine. The operon trpABCDE encodes the necessary enzymes to complete the synthesis of tryptophan, an aromatic amino acid. Expression of the trp operon is repressed by tryptophan itself via the tryptophan repressor and transcription attenuation. A total of at least 15 enzymes encoded by different genes are required to make tryptophan out of simple substrates.

DIF: Medium REF: 15.6 OBJ: 15.6h Outline the biosynthesis of arginine, aromatic amino acids, and nonribosomal peptide antibiotics MSC: Analyzing

19. Discuss evidence that supports the idea that glutamate, aspartate, alanine, glycine, and valine were the first amino acids produced by ancient cells.

ANS: These five amino acids are the amino acids that have been found in meteorites. Also, they have been found in simulations of early earth using methane, ammonia, and heat. They are made with fewer steps using intermediates from other metabolic pathways and are used to make the rest of the amino acids.

DIF: Medium REF: 15.6 OBJ: 15.6b Summarize the evidence showing that glutamate, aspartate, alanine, glycine, and valine were the first amino acids produced by ancient cells MSC: Understanding 20. Certain amino acids are more energetically expensive than others (tryptophan versus glutamate).

Thus, when proteins are moved to the cell surface, extended outside the surface, or secreted out of the cell, there is a potential harm. Why is this potentially harmful, and what adaptations do bacteria have for this potential loss? Give an example.

ANS: With more ―expensive‖ amino acids, more enzymes have been used to make those amino acids.

Thus, more energy was required. After exiting the cell for the outside, those amino acids are no longer available to be recycled into other proteins. They are now lost to the cell. Cells have adapted to this by preferentially using the ―less expensive‖ amino acids in proteins that are secreted or otherwise outside the cell. An example of this preference is seen with bacterial flagella.

The motor complex proteins found inside the cell contain ―expensive‖ amino acids, whereas the external flagella with proteins FlgE, FliC, and FlgM have less expensive amino acids in them.

DIF: Medium REF: 15.6 OBJ: 15.6b Summarize the evidence showing that glutamate, aspartate, alanine, glycine, and valine were the first amino acids produced by ancient cells MSC: Applying

CHAPTER 16: Food and Industrial Microbiology MULTIPLE CHOICE 1. What proportion of known species of mushrooms are poisonous? a. one-half d. 5% b. one-quarter e. 1% c. 10% ANS: E DIF: Easy REF: 16.1 OBJ: 16.1a Recall the types of microbes that are edible

MSC: Remembering

2. What are two types of mushrooms that are both cultures of Agaricus bisporus that are harvested at different stages? a. portobello and shiitake d. shiitake and truffle b. morel and truffle e. nori and morel c. button and portobello ANS: C DIF: Medium REF: 16.1 OBJ: 16.1a Recall the types of microbes that are edible

MSC: Remembering

3. Which of the following contains protein as high as 25% dry weight and are an excellent source of all the essential dietary amino acids?

a. algae b. bacteria c. mushrooms

d. yeast cells e. plants

ANS: C DIF: Easy REF: 16.1 OBJ: 16.1a Recall the types of microbes that are edible

MSC: Remembering

4. Which of the following is the source of alginate, an important food additive? a. kelp d. Agaricus bisporus b. the yeast Saccharomyces e. enoki c. shiitake ANS: A DIF: Medium REF: 16.1 OBJ: 16.1b Describe how nori is produced

MSC: Remembering

5. Nori used as a sushi wrap is produced by growing Porphyra, a ________, in tanks. a. green alga d. fungus b. red alga e. cyanobacterium c. brown alga ANS: B DIF: Easy REF: 16.1 OBJ: 16.1b Describe how nori is produced

MSC: Remembering

6. Few bacteria are edible as isolated organisms because of their high content of a. proteins. d. carbohydrates. b. nucleic acids. e. lipids. c. sugars.

ANS: B DIF: Easy REF: 16.1 OBJ: 16.1c Explain why most bacteria cannot be eaten

MSC: Understanding

7. Which of the following is classified as a form of single-celled protein? a. Porphyra d. Rhizopus b. Lentinula e. Macrocystis c. Spirulina ANS: C DIF: Easy OBJ: 16.1d Define single-celled protein

REF: 16.1 MSC: Applying

8. Production of traditionally fermented foods typically relies on ________ microbiota, whereas commercial fermentation generally relies on ________. a. soil; edible d. indigenous; starter cultures b. edible; indigenous e. indigenous; chemicals c. airborne; indigenous ANS: D DIF: Easy REF: 16.2 OBJ: 16.2a Recall the functions of food fermentation

MSC: Applying

9. Sauerkraut is primarily fermented with the bacterium ________ that uses a ________ type of fermentation. a. Lactobacillus; heterolactic d. Leuconostoc; homolactic b. Lactobacillus; homolactic e. Propionibacterium; heterolactic c. Leuconostoc; heterolactic ANS: C DIF: Medium REF: 16.2 OBJ: 16.2b Identify different types of fermented foods | 16.2c Compare various types of

fermentation; include the starting metabolite and the microbes involved MSC: Remembering 10. The ________ of milk proteins results in the formation of curds. a. filtration d. coagulation b. lyophilization e. radiation c. pasteurization ANS: D DIF: Easy REF: 16.3 OBJ: 16.3b Define cheese, curds, starter culture, and whey

MSC: Remembering

11. Which of the following microbes is responsible for the flavor of Camembert cheese? a. lactic acid bacteria d. Penicillium b. Propionibacterium e. Aspergillus c. Saccharomyces ANS: D DIF: Medium REF: 16.3 OBJ: 16.3c Compare and contrast the production steps of different cheese varieties MSC: Understanding 12. Mold ripening refers to the secondary ________ stage of cheese production. a. respiration d. bacterial b. curd e. fermentation c. contamination ANS: E DIF: Easy REF: 16.3 OBJ: 16.3c Compare and contrast the production steps of different cheese varieties MSC: Remembering 13. The flavors of ________ are generated by side products of fermentation, such as flavorful alcohols, esters, and sulfur compounds. a. cheese d. natto b. yogurt e. sauerkraut c. kimchi ANS: A DIF: Medium REF: 16.3 OBJ: 16.3c Compare and contrast the production steps of different cheese varieties MSC: Understanding 14. Tempeh, a staple food of Indonesia, is produced by an initial fermentation of soybeans with ________, followed by ________. a. lactic acid bacteria; Aspergillus oryzae b. lactic acid bacteria; Rhizopus oligosporus c. Propionibacterium spp.; Aspergillus oryzae d. Propionibacterium spp.; Leuconostoc mesenteroides e. Propionibacterium spp.; Rhizopus oligosporus ANS: B DIF: Easy REF: 16.3 OBJ: 16.3d Describe the benefits of soy fermentation

MSC: Remembering

15. Miso is a fermented Japanese condiment made primarily from ________, which is salted and fermented with ________ for two months. a. cabbage; Leuconostoc b. rice; Leuconostoc c. cabbage; Bacillus

d. cabbage; Aspergillus oryzae e. ground soy and rice; Aspergillus oryzae ANS: E DIF: Easy REF: 16.3 OBJ: 16.3d Describe the benefits of soy fermentation

MSC: Remembering

16. Which of the following food products is NOT produced by alkaline fermentation? a. natto d. pidan b. kimchi e. thousand-year eggs c. dawadawa ANS: B DIF: Easy REF: 16.3 OBJ: 16.3e Categorize foods that undergo acid fermentation versus alkaline fermentation MSC: Remembering 17. Alkaline fermentations raise pH through the catabolism of a. lipids. d. nucleic acids. b. proteins. e. starches. c. sugars.

ANS: B DIF: Easy REF: 16.3 OBJ: 16.3e Categorize foods that undergo acid fermentation versus alkaline fermentation.

MSC: Remembering 18. In the process of ________, NO standard starter culture is available. a. sourdough bread making d. cheese making b. yogurt making e. beer making c. chocolate production ANS: C DIF: Easy REF: 16.3 OBJ: 16.3f Outline the steps in cocoa bean fermentation

MSC: Remembering

19. What are the three stages in the fermentation of cocoa beans for chocolate (in order)? a. 1) Bacillus, 2) lactic acid bacteria, 3) yeasts b. 1) acetic acid bacteria, 2) yeasts, 3) lactic acid bacteria c. 1) yeasts, 2) lactic acid bacteria, 3) acetic acid bacteria d. 1) Leuconostoc, 2) Bacillus, 3) Rhizopus e. 1) Leuconostoc, 2) Bacillus, 3) yeasts ANS: C DIF: Medium REF: 16.3 OBJ: 16.3f Outline the steps in cocoa bean fermentation | 16.3g Recall the role of Bacillus species in fermentations MSC: Remembering 20. Within a mound of cocoa beans, ________ generates heat so that the mound temperature increases up to 50°C. a. indigenous fungi b. aerobic acetic acid bacteria c. Candida and Kloeckera yeasts d. Saccharomyces and other yeasts e. Lactobacillus species ANS: B DIF: Medium REF: 16.3 OBJ: 16.3f Outline the steps in cocoa bean fermentation

MSC: Understanding

21. Which of the following organisms or processes is NOT involved in the chocolate-making process? a. yeasts

b. c. d. e.

lactic acid bacteria acetic acid bacteria thermophilic bacteria both anaerobic and aerobic processes

ANS: D DIF: Difficult REF: 16.3 OBJ: 16.3f Outline the steps in cocoa bean fermentation

MSC: Understanding

22. Leavening of commercial bread dough is brought about by CO2 from ________ fermentation by ________. a. mixed; Propionibacterium species b. ethanolic; Oenococcus c. alkaline; Bacillus species d. ethanolic; Saccharomyces cerevisiae e. acid; lactic acid bacteria ANS: D DIF: Medium REF: 16.4 OBJ: 16.4b Compare and contrast production of different bread types; include the type of grain and fermenting organism MSC: Understanding 23. Alcohol dehydrogenase in the ________ detoxifies alcohol produced in the intestines. a. lungs d. pancreas b. liver e. spleen c. mouth ANS: B DIF: Easy REF: 16.4 OBJ: 16.4a Identify the chemical equation for ethanolic fermentation MSC: Understanding 24. A modest level of ethanol enters the human circulation naturally from ________, equivalent to a fraction of a drink per day. a. intestinal microbiota byproducts d. cell metabolism b. food e. the environment c. drink ANS: A DIF: Medium REF: 16.4 OBJ: 16.4a Identify the chemical equation for ethanolic fermentation MSC: Understanding 25. Ethanolic fermentation of ________ was important to early civilizations because it provided a drink free of waterborne pathogens. a. roots d. grain and fruit b. flowers and leaves e. stems and leaves c. leaves ANS: D DIF: Easy REF: 16.4 OBJ: 16.4b Compare and contrast production of different bread types; include the type of grain and fermenting organism MSC: Applying 26. Which of the following products of beer making and winemaking result in off-flavors? a. esters d. long-chain alcohols b. ethanol e. amino acids c. acetaldehyde ANS: C DIF: Difficult REF: 16.4 OBJ: 16.4d Compare and contrast wine production with beer and bread production

MSC: Understanding 27. The filtered mash in beer making is referred to as a. hops. d. malt. b. barley. e. wort. c. yeast extract.

ANS: E DIF: Medium REF: 16.4 OBJ: 16.4d Compare and contrast wine production with beer and bread production MSC: Understanding 28. In beer making, enzymatic activities during germination of barley produce the ________ used for fermentation. a. ethanol d. lactic acid b. maltose e. 2-oxo acids c. malic acid ANS: B DIF: Medium REF: 16.4 OBJ: 16.4c Outline the steps of beer production

MSC: Remembering

29. Brewer’s yeast, Saccharomyces cerevisiae, conducts ________ fermentation of maltose, a ________, which is produced by the action of amylases on starch. a. ethanolic; pectin b. lactic acid; lactone c. ethanolic; disaccharide d. mixed; fructose e. ethanolic; monosaccharide ANS: C DIF: Medium REF: 16.4 OBJ: 16.4d Compare and contrast wine production with beer and bread production MSC: Understanding 30. Wines are produced from fermentation of crushed grapes. What causes the either white or red color of wine? a. In white wine production, additional aging removes pigments by oxidation. b. To produce white wine, red pigments are chemically removed prior to bottling. c. Additional fermentation degrades the red pigments of red wine, rendering it white. d. To make white wine, grape skins are removed (pressing) before inoculation with yeast. e. Ultracentrifugation of red wine removes pigments, leading to rosé or white wines.

ANS: D DIF: Medium REF: 16.4 OBJ: 16.4d Compare and contrast wine production with beer and bread production MSC: Analyzing 31. The purpose of malolactic fermentation in the second stage of production of some wines is to a. impart wines with a fruity flavor. b. eliminate phenolics. c. eliminate acidity caused by malic acid. d. destroy acetaldehyde (off-flavor). e. produce esters (desirable flavors).

ANS: C DIF: Difficult REF: 16.4 OBJ: 16.4d Compare and contrast wine production with beer and bread production MSC: Analyzing

32. The most common food-borne cause of death in the United States is a. norovirus. d. Clostridium botulinum. b. Salmonella enterica. e. Escherichia coli O157:H7. c. Campylobacter sp.

ANS: B DIF: Easy REF: 16.5 OBJ: 16.5c Propose a likely microbial cause for each type of food spoilage MSC: Applying 33. Listeria is a(n) ________ organism, which means that it readily grows at refrigeration temperatures. a. neutrophilic d. autotrophic b. acidophilic e. psychrotrophic c. mesophilic ANS: E DIF: Easy REF: 16.5 OBJ: 16.5g Describe what distinguishes a pathogen from a spoilage organism MSC: Applying 34. The virulence genes of Salmonella are found in a genomic region referred to as pathogenicity a. islands. d. operons. b. plasmids. e. hotspots. c. groups.

ANS: A DIF: Easy REF: 16.5 OBJ: 16.5e Explain why different foods are subject to different types and rates of spoilage MSC: Understanding 35. Which of the following aids microbial growth? a. drying b. radiation c. addition of spices d. refrigeration e. warming the food to body temperature ANS: E DIF: Easy REF: 16.5 OBJ: 16.5g Describe what distinguishes a pathogen from a spoilage organism MSC: Remembering 36. Another term for freeze-drying is a. radiation. b. dehydration. c. filtration.

d. pasteurization. e. lyophilization.

ANS: E DIF: Easy REF: 16.5 OBJ: 16.5h Recall different means of food preservation and describe how they work MSC: Understanding 37. Until the recent invention of ________, all foods contained live microbes. a. steam-pressure sterilization d. freezing b. irradiation e. refrigeration c. lyophilization ANS: A DIF: Easy REF: 16.5 OBJ: 16.5h Recall different means of food preservation and describe how they work MSC: Understanding

38. Cinnamon and cloves contain a ________ derivative that is a potent microbial inhibitor. a. lipid d. bacterial b. nucleotide e. fungal c. benzene ANS: C DIF: Easy REF: 16.5 OBJ: 16.5g Describe what distinguishes a pathogen from a spoilage organism MSC: Understanding 39. Food spoilage can be brought about by all the following, EXCEPT a. chemical reactions with the environment, such as oxidation of lipids. b. meat tenderization. c. putrefaction of food by decomposition of protein and amino acids. d. action of bacterial fermentations to make food sours. e. conversion of sugar into starch in freshly picked corn.

ANS: B DIF: Easy REF: 16.5 OBJ: 16.5d Name a likely microbial cause for different types of food spoilage MSC: Understanding 40. Escherichia coli O157:H7 was first observed in fast-food hamburger meat. More recently, it has been associated with contamination of spinach and other vegetables. How did the spread of this strain from meat to vegetables happen? a. It picked up genes for plant virulence. b. Strain O157:H7 can grow as a plant endophyte. c. It has become a psychrotroph and can grow in refrigerated foods. d. It produces toxins that can survive on plant material. e. This bacterial strain has lost genes needed to grow in meat.

ANS: B DIF: Medium REF: 16.5 OBJ: 16.5c Propose a likely microbial cause for each type of food spoilage MSC: Understanding 41. The search for organisms with potential commercial application is called a. biopanning. b. bioprospecting. c. recombinant DNA technology. d. deep sequencing. e. metagenomics.

ANS: B DIF: Easy REF: 16.5 OBJ: 16.6a Define fermentation industry as well as bioprospecting MSC: Understanding 42. The following are desirable characteristics of an industrial strain, EXCEPT a. efficient gene transfer system. b. susceptibility to large DNA rearrangements. c. inexpensive growth and maintenance. d. safe, non-pathogenic. e. easy harvesting of product.

ANS: B DIF: Easy REF: 16.5 OBJ: 16.5e Explain why different foods are subject to different types and rates of spoilage MSC: Applying

43. Microorganisms are used in the production of many small molecules, such as amino acids, vitamins, and medicines. Which of the following is NOT produced by a bacterium? a. steroids d. penicillin b. L-lysine e. tetracycline c. vitamin B12 ANS: D DIF: Medium REF: 16.6 OBJ: 16.6d Identify commercial microbial products; state whether they are native or cloned products MSC: Understanding 44. Recombinant Escherichia coli is used in the production of the following EXCEPT a. interferon. d. insulin. b. CC10 lung development protein. e. antibodies. c. human growth hormone.

ANS: E DIF: Easy REF: 16.6 OBJ: 16.6d Identify commercial microbial products; state whether they are native or cloned products MSC: Understanding 45. What type of processing refers to steps in product recovery and purification? a. pasteurization d. downstream b. finishing e. lyophilization c. upstream ANS: D DIF: Easy REF: 16.6 OBJ: 16.6f Summarize upstream processing versus downstream processing steps in industrial fermentation MSC: Applying 46. All of the following are examples of the use of alginates derived from Macrocystis pyrifera, EXCEPT a. fermentation substrate for cheese production. b. textile printing agent. c. modeling material for dental applications. d. skin-safe life casting. e. ice cream thickener.

ANS: A DIF: Easy REF: 16.5 OBJ: 16.5d Name a likely microbial cause for different types of food spoilage MSC: Applying 47. The ________ gene products stimulate plasmid transfer from Agrobacterium to the host plant. a. Ti d. auxin synthesis b. promoter e. vir c. recombinant ANS: E DIF: Medium REF: 16.6 OBJ: 16.6d Identify commercial microbial products; state whether they are native or cloned products MSC: Understanding 48. Which of the following is NOT an example of a microbial enzyme used in industrial or commercial applications?

a. b. c. d. e.

cellulase—improvement of fabric’s appearance asparaginase—avoidance of acrylamide production rennin—cheese production lipase B—active in a wide range of temperatures protease—removal of food stains on clothes

ANS: C DIF: Easy REF: 16.5 OBJ: 16.5d Name a likely microbial cause for different types of food spoilage MSC: Applying 49. Use the figure below and find the INCORRECT statement regarding the development process for the antituberculosis compound SQ109.

a. The question mark (?) indicates to the general formula for 62,238 compounds made in a combinatorial library of ethambutol derivatives. b. The yellow highlighted portion of the molecules correspond to the ethambutol diamine core. c. All 63,238 diamine molecules in the combinatorial library were tested in tissue culture, activity in infected macrophages and in live animals. d. Out of 69 compounds showing the best activity against Mycobacterium tuberculosis, SQ109 had the greatest efficacy and fewer side effects. e. Out of 63,238 diamine molecules in the combinatorial library, 2,796 showed activity against Mycobacterium tuberculosis in vitro.

ANS: C DIF: Difficult REF: 16.5 OBJ: 16.5h Recall different means of food preservation and describe how they work MSC: Applying 50. Actinovate is a preparation of Streptomyces lydicus, an example of a microbe as product. Which of the following is NOT correct regarding Actinovate? a. It is used to suppress fungi causing seedling damping-off. b. Streptomyces lydicus produces a protein that is toxic to the larvae of several insect pests. c. It fends off fungal pathogens on leaves. d. Streptomyces lydicus feeds off plant exudates while secreting antimicrobial substances. e. It is used to eliminate root rot.

ANS: B DIF: Medium REF: 16.5 OBJ: 16.5h Recall different means of food preservation and describe how they work MSC: Applying 51. An acid or base serves as an effective preservative because a. pH change is likely to be reversed. b. pH change is unlikely to be reversed. c. animals and plants grow at high pH. d. animals and plants grow at low pH. e. animals and plants grow at extreme pH. ANS: B DIF: Medium REF: 16.3 OBJ: 16.3a State how acid and alkaline fermentation preserves food

MSC: Remembering 52. Another term for food contamination is a. rancid. b. putrefacation c. food poisoning.

d. food spoilage. e. putrefied.

ANS: C DIF: Medium REF: 16.5 OBJ: 16.5b Differentiate between food spoilage and food contamination, and differentiate between rancidity and putrefecation MSC: Remembering 53. An attribute of an industrial microbial strain is a. genetic stability and manipulation. b. expensive growth requirements. c. a low level of product expression. d. pathogenic strains. e. the cell is not easily breakable to liberate product.

ANS: A DIF: Medium REF: 16.6 OBJ: 16.6e List attributes of an industrial microbial strain

MSC: Remembering

SHORT ANSWER 1. Bacteria generally can’t be eaten as isolated organisms. Why is Spirulina an exception? What is Spirulina and what are its health benefits?

ANS: The DNA of Spirulina, a cyanobacterium, has a lower purine content than that in most bacteria.

Purine metabolism in humans leads to the production of uric acid. Humans lack the enzyme urate oxidase and therefore uric acid cannot be further catabolized. Uric acid can precipitate and result in tissue damage and conditions such as gout and kidney stones. Spirulina is rich in protein, vitamin B12, minerals, and antioxidants.

DIF: Medium MSC: Analyzing

REF: 16.1

OBJ: 16.1d Define single-celled protein

2. What are some of the purposes of food fermentation? Why have humans been making fermented foods for so long?

ANS: Foods are fermented to preserve the food. Some byproducts of microbial metabolism cause the food to be stable for longer periods. Fermentation also improves digestibility. Microbial action breaks down macromolecules and tenderizes some foods, making them easier for humans to digest.

It also adds nutrients, flavor, and vitamins. Humans initially fermented foods as a way of preserving them before refrigeration was readily available. It also provided drinks that were free of waterborne pathogens.

DIF: Medium MSC: Applying

REF: 16.2

OBJ: 16.2a Recall the functions of food fermentation

3. Use the figure below to describe four types of fermentation used in food preparation. Make sure to indicate what the Roman numerals indicate. Give an example of a product that is made from each type of fermentation.

ANS: Amino acids, product of protein hydrolysis, are the substrate for alkaline fermentation [i]; ammonia, a byproduct [ii], raises pH and prevents microbial growth. An example is dawadawa, a paste of fermented beans common in West Africa. [iii] Glucose is converted to pyruvic acid, which is then converted to lactic acid. Acetyl-CoA [iv], also a product of alkaline fermentation, may be used as a respiratory substrate or converted to acetic acid, widely used in pickling. Pyruvic acid is a precursor in many types of fermentation. In lactic acid fermentation, lactic acid is produced from pyruvate, as in cheeses. Propionic acid can be formed from lactic acid by further fermentation, as in Swiss cheese. Heterolactic fermentation (v) results in the production of lactic acid, ethanol, and carbon dioxide, as in sauerkraut. Ethanolic fermentation results in the production of ethanol and carbon dioxide, as in beer.

DIF: Difficult REF: 16.2 OBJ: 16.2a Recall the functions of food fermentation | 16.2c Compare various types of fermentation; include the starting metabolite and the microbes involved MSC: Applying 4. Why is it better nutritionally to ferment soybeans than to consume them without fermenting?

ANS: Soybeans contain substances that decrease their nutritional value. Phytate chelates minerals, such as iron, inhibit their absorption into the human intestine. Lectins may upset digestion and induce autoimmune diseases when consumed in large quantities. Protease inhibitors decrease the amount of protein that can be obtained from soy-based food. Fermentation breaks down the proteins in soybeans to more digestible peptides and amino acids. Fermentation can also generate vitamins.

DIF: Medium MSC: Analyzing

REF: 16.3

OBJ: 16.3d Describe the benefits of soy fermentation

5. Describe how the transportation of milk products by herders led to the formation of cheeses.

ANS: Out of necessity, the herders stored the collected milk in portable containers made from the stomachs of slaughtered animals. The presence of indigenous stomach flora, lactic acid–producing bacteria, and stomach enzymes aided in the coagulation of the milk into curds. The curds could be separated from the liquid whey, and both products could be eaten. The curds make a soft cheese that is high in protein content.

DIF: Medium REF: 16.3 OBJ: 16.3b Define cheese, curds, starter culture, and whey

MSC: Analyzing

6. Briefly describe the cheese-making process. Use the figure below to explain why different cheeses have different flavors.

ANS:

Milk is filtered and pasteurized, then starter culture is added. In all except soft cheeses, rennet or proteases are added to make a firmer curd. Curd is cut or ―cheddared,‖ then heat-treated and pressed into molds. The curd may be brined or inoculated with mold depending on the type of cheese. Different cheeses are produced using different bacteria and/or molds, that catabolize some amino acids and produce a variety of flavors and aromas. [i] Amines are formed by decarboxylation of amino acids; ammonia contributes to the aroma of cheeses such as brie and Camembert. [ii] Sulfur compounds, originating from methanethiol (CH3SH), confer cheddar cheese its flavor. [iii] Thioesters add to sulfur-containing odorants in some cheeses, as do [iv] alcohols and [v] esters.

DIF: Difficult REF: 16.3 OBJ: 16.3c Compare and contrast the production steps of different cheese varieties MSC: Evaluating 7. How is injera produced and why is it nutritionally better than quick-rising wheat breads?

ANS: Injera is an Ethiopian bread made from teff, a grain that contains no gluten so results in a flatbread.

The teff undergoes an extended fermentation, which results in a high microbial content and substantial source of vitamins, which does not occur in quick-rising breads. The fermentation lasts for three days and occurs due to a succession of different microbes.

DIF: Medium REF: 16.4 OBJ: 16.4b Compare and contrast production of different bread types; include the type of grain and fermenting organism MSC: Analyzing 8. The figure below represents microbial growth (CFUs/mL) during the very early stages of chocolate production. Use the numbers to describe the microbial succession involved in the complex fermentation of cocoa pulp.

ANS:

Cocoa beans are heaped in mounds upon plantain leaves, where they are fermented by indigenous microorganisms. [1] Citric acid in the pulp favors the growth of yeasts such as Candida, Kloeckera and Saccharomyces at pH about 3.6. Yeasts degrade pectin into glucose and fructose, liquefying the pulp. Fermentation products, including alcohol and mixed acids, kill the embryo which releases enzymes that will subsequently help in generating flavor molecules. [2] Lactic acid species, such as Lactobacillus plantarum, ferment sugars to lactate and acetate until fermentable substrates are consumed. [3] After two days, the beans are aerated by turning them over; aerobic acid bacteria, such as Acetobacter, oxidize ethanol and acids with release of heat (50°C). Oxidation of compounds such as polyphenols will generate chocolate color and contribute to flavor. [4] Bacillus spp. also contribute to the fermentation processes. After fermentation, pulp is drained, beans are dried and roasted and the cocoa mass is further processed to produce the many types of chocolate.

DIF: Difficult fermentation MSC: Evaluating

REF: 16.3

OBJ: 16.3f Outline the steps in cocoa bean

9. In the figure below, identify the carbohydrate substrate for fermentation in the production of beer and wine. Compare and contrast the desirable flavors and off-flavors that may come about during ethanolic fermentation in both cases.

ANS: In the production of beer, the starches from barley grains are hydrolyzed [A] to maltose and eventually to glucose [B], which then becomes the substrate for ethanolic fermentation.

Fermentation of fruits starts with glucose [B]. During the fermentation to ethanol, acetaldehyde is produced, some of which can be converted to diacetyl, which is an off-flavor especially in beer [C]. Small amounts of pyruvate can be converted to 2-oxo acids that may be converted to either amino acids or aldehydes, which contribute to off-flavors. Acetyl-CoA, from pyruvate, can be converted to fatty acids which can combine with long-chain alcohols to produce esters [D]. Esters generally give desirable flavors to beer and wine.

DIF: Difficult

REF: 16.4

OBJ: 16.4d Compare and contrast wine production with beer and bread production MSC: Analyzing 10. Describe the primary and secondary fermentations involved in winemaking.

ANS: The early stages of primary fermentation are dominated by indigenous yeasts, whereas the later stages are dominated by inoculated yeasts. The sediment of grape materials and yeast, the lees, is removed, and then the wine is placed in tanks or barrels. The secondary fermentation occurs here, with the addition of bacterial cultures that carry out malolactic fermentation.

Malate, which is found in grapes, is decarboxylated during malolactic fermentation by bacteria such as Oenococcus oeni, producing lactate and carbon dioxide. The decarboxylation provides two benefits: it decreases the acidity of the wine and removes malate, which could be a desirable food source for undesirable organisms that otherwise could be present and spoil the wines.

DIF: Difficult REF: 16.4 OBJ: 16.4d Compare and contrast wine production with beer and bread production MSC: Applying 11. Explain the difference between food spoilage and food poisoning.

ANS: Food spoilage refers to microbial changes that renders a product unhealthy or unsavory for consumption, for example, sour milk or putrefied meats due to fermentation and protein decomposition, respectively. Autoxidation of fats leads to rancidness.

Food poisoning refers to the presence of microbial pathogens that might cause gastrointestinal diseases or microbial products, such as toxins that could go unnoticed. Pathogens may outnumber our natural microbiota by using virulence factors, immunosuppression mechanisms, or antibiotic use.

DIF: Medium REF: 16.5 OBJ: 16.5a State the changes that occur in foods post harvest

MSC: Analyzing

12. Use the figure below to discuss how molecular tools are used in the investigation of pathogen-contaminated food. What does the figure represent? What is the overall conclusion of the analysis?

ANS:

Salmonella enterica is a common pathogen in the United States. This figure comes from a case in which the Centers for Disease Control traced an outbreak of salmonellosis to a contaminated peanut butter batch that had been already widely distributed. Using molecular genetic tools, bacterial samples from patients carrying the common Salmonella enterica serovar Typhimurium were compared with samples from two contaminated peanut butter jars. DNA from these three bacterial samples was extracted and digested with restriction endonucleases. The resulting fragments were separated by pulse field electrophoresis and compared. The band pattern from the patients’ isolates matched those from sample 1.

DIF: Difficult REF: 16.5 OBJ: 16.5e Explain why different foods are subject to different types and rates of spoilage MSC: Evaluating 13. What categories of foods may be spoiled by psychrotrophs? Why are these organisms a problem with fish?

ANS: Psychrotrophic microbes can play a role in the spoilage of any product that is refrigerated.

Psychrotrophs are mesophiles that can grow at refrigerator temperatures, so they can continue to destroy the foods even at the lower temperatures. Since fish tend to live in colder climes, their indigenous surface organisms tend to be psychrotrophic. This is one of the reasons why fish tends to spoil more rapidly than meat and poultry.

DIF: Medium REF: 16.5 OBJ: 16.5c Propose a likely microbial cause for each type of food spoilage MSC: Analyzing 14. Describe several physical means of food preservation.

ANS: Dehydration and freeze-drying: removal of water either by heat or by lyophilization. Refrigeration and freezing: refrigeration slows most microbial growth, while freezing stops the growth of most microbes until the food is thawed. Controlled or modified atmosphere: packing under a vacuum or storing with high carbon dioxide or low oxygen. Pasteurization: short exposure to moderate heat.

Canning: cooking food under pressure at a high enough temperature to destroy endospores.

Ionizing radiation: use of radiation to sterilize food.

DIF: Medium REF: 16.5 OBJ: 16.5h Recall different means of food preservation and describe how they work MSC: Applying 15. The graph below shows an experiment in which growth of aerobic bacteria in ground beef (CFUs/g) was measured at different refrigeration temperatures. Interpret the graph and explain what the dotted line represents.

ANS: The growth rate of total aerobic bacteria in ground beef declines at lower temperatures. The highest temperatures tested allow growth if the beef is left in the refrigeration long enough.

Refrigeration selects for psychrotrophic bacteria, such as Listeria, since they can outnumber other species unable to grow continuously at refrigeration temperatures. The dotted line represents the predicted level of spoilage. Freezing stops growth of most microbial species but preexisting contaminant strains survive when the food is thawed. Frozen meats should be fully thawed prior to cooking.

DIF: Medium REF: 16.5 OBJ: 16.5d Name a likely microbial cause for different types of food spoilage MSC: Applying 16. The strain Escherichia coli O157:H7 is pathogenic for humans. It was first identified in ground beef. What does an infection with it cause and do to humans? Why do you suppose infections are more prevalent in ground meat than on a steak?

ANS: The pathogen is found in the intestines and fecal matter of cows. On slaughtering, some of these materials can make their way to the carcass. The strain can grow as an endophyte and become a contaminant in salads or unpasteurized cider. Infection in humans usually results in severe, bloody diarrhea and abdominal cramps lasting 5–10 days. The organism produces Shiga toxin, which can result in kidney failure.

Infection comes predominantly from ground meat because the organism is present throughout the meat product. If it is cooked to ―well done,‖ the organism will be destroyed. Steaks or roasts will only have the organism on its surface, so it is much more readily destroyed during the cooking process.

DIF: Difficult REF: 16.5 OBJ: 16.5d Name a likely microbial cause for different types of food spoilage

MSC: Applying 17. What makes a company dealing with industrial microbiology a success?

ANS: A successful company will identify and develop a useful product. This will require isolating a microbe (prokaryotic or eukaryotic) to biosynthesize the product. This microbe may be a novel organism or an organism containing cloned gene(s). Once the product has been identified and produced, there is scale-up so that large quantities can be made. A successful company also develops a good business plan, including a marketing strategy. Safety issues should be addressed and efficacy testing performed, as required by governmental agencies.

DIF: Medium REF: 16.6 OBJ: 16.6c Recall the steps required for commercial success of an industrial microbiology product MSC: Applying 18. Describe some of the characteristics that industrial strains of microbes must possess.

ANS: Genetic properties: stability and facility of manipulation; they must reproduce reliably and have an effective gene transfer system so vectors can introduce genes of interest into its genome.

Inexpensive growth requirements: must grow on low-cost carbon sources with few special needs.

Safety: must not be pathogenic and must not produce toxic substances. High level of product expression: must have an efficient gene expression system to generate large quantities of the desired product. Ready harvesting of product: product must be secreted by the cell or cells must be easily breakable to release the product.

DIF: Difficult REF: 16.6 OBJ: 16.6e List attributes required of an industrial microbial strain MSC: Applying 19. With respect to an industrial process, what are upstream and downstream processing methods, and how do they differ?

ANS: Industrial processes involve large fermentation systems to grow the organisms that biosynthesize the product. Upstream processing involves all the steps prior to and including the use of the fermenter to grow the organism and produce the product—that is, choice of organism, choice of raw materials, production of the growth medium, growth of starter cultures, and monitoring of the parameters of the fermenter during growth. Downstream processing deals with the fermenter and its contents after growth—that is, separating cells from leftover medium, primary recovery of the product, followed by purification of the product and completion of finishing processes, such as crystallization or filtration, sterilizing and packaging.

DIF: Difficult REF: 16.6 OBJ: 16.6f Summarize upstream processing versus downstream processing steps in industrial fermentation MSC: Applying 20. Why is Agrobacterium used in genetic engineering of plants? Briefly explain the Agrobacterium expression system.

ANS:

Agrobacterium tumefasciens is a tumor-inducing plant pathogen that contains a plasmid called Ti. Agrobacterium directs the synthesis of non-protein amino acids, called opines, for its own metabolic needs, and the plant hormone auxin. Plasmid Ti contains a DNA region that can be transferred to a host plant and recombined into its chromosomes. For industrial use, recombinant strains of Agrobacterium include the desired recombinant genes but no tumor-inducing genes, so the gene of interest can be transferred to plants. The Ti plasmid of Agrobacterium has been split into two plasmids for the expression system. One plasmid contains the virulence (vir) operon, and the other contains the T-DNA ends but no tumor-inducing or opine biosynthesis genes. The gene of interest is cloned into the T-DNA component, between the T-DNA ends. When the two plasmids are transferred together, the vir gene products will induce transfer of the T-DNA containing the recombinant gene. The gene containing T-DNA will integrate into the plant genome, and the plant will then produce the desired gene product.

DIF: Difficult REF: 16.6 OBJ: 16.6g Decide which products should be produced in eukaryotic systems instead of prokaryotic systems MSC: Analyzing

CHAPTER 17: Origins and Evolution MULTIPLE CHOICE 1. Evidence for microbial life on Earth dates back to ________ ago. a. 14 gigayears d. 1.5 gigayears b. 5 gigayears e. 500 megayears c. 3.48 gigayears ANS: C DIF: Easy REF: 17.1 OBJ: 17.1a Identify the conditions required for the emergence of life MSC: Remembering 2. Which of the following is NOT correct regarding conditions for life on Earth? a. Generation of life requires continual input of energy. b. The main source of energy for life is nuclear fusion reactions within the sun. c. It depends on a temperature range permitting liquid water. d. Life requires elements that lead to the formation of organic molecules. e. Life requires a CO2-rich atmosphere.

ANS: E DIF: Easy REF: 17.1 OBJ: 17.1a Identify the conditions required for the emergence of life MSC: Understanding 3. What are stromatolites? a. fossil Nautilus shells formed by deposits of hydroxyapatite b. FeO in banded iron formations c. bulbous masses of layered CaCO3 accreted by microbial mats d. accumulations of fossil trilobites e. fossils from the Hadean eon ANS: C DIF: Easy REF: 17.1 OBJ: 17.1b Define stromatolites, biosignatures, and banded iron formations MSC: Understanding 4. Evidence of life left in the geological record is known as a. biosignatures. d. enzyme markers.

b. genetic markers. c. abiotic artifacts.

e. molecular weight markers.

ANS: A DIF: Easy REF: 17.1 OBJ: 17.1b Define stromatolites, biosignatures, and banded iron formations MSC: Understanding 5. The elements that formed initial microbial life originated from a. oceans. d. the sun. b. lightning. e. ozone. c. supernovas.

ANS: C DIF: Easy REF: 17.1 OBJ: 17.1d Summarize Earth’s elemental composition and outline how the elements were formed MSC: Remembering 6. The sum total of all life on Earth is called the a. lithosphere. b. mantle. c. core.

d. atmosphere. e. biosphere.

ANS: E DIF: Easy REF: 17.1 OBJ: 17.1c Outline the role of microbes in shaping Earth’s atmosphere and temperature MSC: Understanding 7. Which of the following is NOT correct about endolithic microorganisms? a. They have been found in mines as deep as 3 kilometers. b. Their discovery elicited interest in NASA scientists seeking life on Mars. c. They can grow in Earth’s core. d. The term ―endolithic‖ means living ―within rocks.‖ e. They metabolize by oxidizing e donors generated through decay of radioactive metals.

ANS: C DIF: Medium REF: 17.1 OBJ: 17.1c Outline the role of microbes in shaping Earth’s atmosphere and temperature MSC: Analyzing 8. Analyses of 13C % has revealed biosignatures in a. igneous rock. d. sedimentary rock. b. mantle rock. e. calcareous sand. c. carbonate rock.

ANS: D DIF: Medium REF: 17.1 OBJ: 17.1e Appraise the advantages and disadvantages of the various forms of geological evidence used in studying early life MSC: Understanding 9. Which label on the figure below is NOT correct?

a. A—oldest stromatolites b. B—chloroplasts and mitochondria c. C—colonial organism

d. D—filamentous cyanobacteria e. E—early eukaryotes

ANS: B DIF: Difficult REF: 17.1 OBJ: 17.1f Arrange temporally when certain biosignatures first appeared MSC: Applying 10. Fossil stromatolites and microfossils are used as evidence in studies of early life on Earth. What is a disadvantage of using these rock formations in these types of studies? a. Paleontologists have to dig deep into Earth’s crust to find them. b. Abiotic processes lead to the formation of stromatolite-like structures or objects that resemble microfossils. c. They must be destroyed in order to obtain samples for analysis. d. Their analysis requires expensive and inconvenient radioisotope detection. e. They are extremely fragile when exposed to air.

ANS: B DIF: Easy REF: 17.2 OBJ: 17.1e Appraise the advantages and disadvantages of the various forms of geological evidence used in studying early life MSC: Remembering 11. Which energy-production reactions were likely to have been present in the earliest cells? a. glycolysis, Entner-Doudoroff pathway, and Krebs cycle b. glycolysis, respiration, and bacteriochlorophyll-based photosynthesis c. respiration and chlorophyll-based photosynthesis in PSI and PSII d. oxidation-reduction, light-driven ion pumps, and methanogenesis e. chemiosmosis, substrate-level phosphorylation, and oxygenic photosynthesis ANS: D DIF: Medium REF: 17.2 OBJ: 17.2a Recall the types of energy-producing reactions likely available to the earliest cells MSC: Remembering

12. Which of the following did early methanogens use from the early atmosphere to generate energy? a. CO2 and H2 d. N2 and O3 b. H2O and O2 e. O2 and H2 c. CH4 and CO2 ANS: A DIF: Medium REF: 17.2 OBJ: 17.2a Recall the types of energy-producing reactions likely available to the earliest cells MSC: Remembering 13. Which of the following reactions suggests the plausibility for RNA chromosome replication in the RNA World model? a. Compared to DNA, synthesis and degradation of RNA require less energy. b. Uracil, a pyrimidine in RNA, is the precursor of thymine, used in the synthesis of DNA. c. Some ribozymes splice introns in mRNA. d. Some ribozymes catalyze synthesis of complementary strands of RNA. e. Peptide bond formation is catalyzed by ribosomal RNA. ANS: D DIF: Medium REF: 17.2 OBJ: 17.2a Recall the types of energy-producing reactions likely available to the earliest cells MSC: Applying 14. Oparin at Moscow University, Miller and Urey at the University of Chicago, and Juan Oró at the University of Houston performed experiments throughout the twentieth century to prove that a. organic macromolecules can arise from abiotic conditions. b. micelle formation generated the first membranes. c. RNA was the catalytic molecule of early Earth. d. TCA cycle generates amino acids. e. iron band formations were caused by photoferrotrophy.

ANS: A DIF: Easy REF: 17.2 OBJ: 17.2b Compare the three models for the origin of the first living cells MSC: Applying 15. Which of the following is a highly speculative issue about the early origin of life? a. Sufficient evidence exists that RNA might have been the first informational molecule. b. Amino acids could have originated by Krebs cycle acids complexed to a dinucleotide. c. Bacterial redox metabolism can be evidenced through 34S/32S ratios from 3.47 Gyr ago. d. Ancestors of methanogens using H2 and CO2 to make CH4 and H2O evolved early. e. Panspermia, life forms originated elsewhere, were seeded on Earth by meteorites.

ANS: E DIF: Medium REF: 17.2 OBJ: 17.2c State some unresolved questions about the origins of early life MSC: Analyzing 16. A clade could best be described as a a. random but neutral DNA mutation. b. hypothesis that early evolution happened faster than later evolution. c. group of related organisms producing a monophyletic group. d. hypothesis of how life began on Earth. e. group of genes unselected for in evolution.

ANS: C DIF: Easy OBJ: 17.3a Define clade and phylogeny

REF: 17.3 MSC: Understanding

17. The term ―________‖ indicates that the members of a clade share a common ancestor, one not shared by any group outside the clade. a. monogamy d. monoploid b. monophyletic group e. polyploid c. polyphyletic group ANS: B DIF: Easy OBJ: 17.3a Define clade and phylogeny

REF: 17.3 MSC: Understanding

18. The loss of genes encoding for unselected traits is known as a. random mutation. d. clade evolution. b. natural selection. e. random recombination. c. reductive evolution.

ANS: C DIF: Easy REF: 17.3 OBJ: 17.3b Describe the processes that lead to organismal divergence MSC: Remembering 19. A molecular clock is best defined as a. the information contained in DNA or protein sequences that shows changes over time. b. genes that under selective pressure show a higher rate in mutation frequencies. c. organisms in favorable environments that have greater offspring potential. d. the time between Earth’s formation and the beginnings of life in an RNA world. e. a monophyletic group of organisms that replicate in synchrony.

ANS: A DIF: Easy REF: 17.3 OBJ: 17.3c Assess the use of molecular clocks to date organismal divergence MSC: Remembering 20. Molecular clocks use genes that a. code for TCA cycle enzymes. b. are found primarily on plasmid DNA. c. are involved in transcription and translation. d. are acquired through transduction. e. encode enzymes for glycolysis.

ANS: C DIF: Medium REF: 17.3 OBJ: 17.3c Assess the use of molecular clocks to date organismal divergence MSC: Understanding 21. What trait do all cells on Earth NOT have in common? a. double-stranded DNA b. cell wall of varying composition c. universal gene code, common ancestral rRNAs, and elongation factors d. common ancestral functional domains in proteins e. cytoplasm, an aqueous compartment enclosed by a membrane ANS: B DIF: Easy REF: 17.3 OBJ: 17.3c Assess the use of molecular clocks to date organismal divergence | 17.3d Outline the steps required to construct a phylogenetic tree MSC: Understanding 22. Based on small subunit rRNA phylogeny studies, the current view is that there are ________ domains of life. a. two d. five b. three e. six

c. four ANS: B DIF: Easy REF: 17.3 OBJ: 17.3e Compare and contrast the features of bacteria, archaea, and eukarya MSC: Remembering 23. In the domains of life, archaea and eukarya differ from each other in that archaea ________ and eukarya ________. a. contain membrane-bound organelles; do not b. do not undergo methanogenesis; do c. do not contain membrane-bound organelles; do d. are pathogenic to humans; are never pathogenic e. have introns; do not ANS: C DIF: Medium REF: 17.3 OBJ: 17.3e Compare and contrast the features of bacteria, archaea, and eukarya MSC: Understanding 24. In the domains of life, archaea and bacteria differ from each other in that a. archaea contain membrane-bound organelles, bacteria do not. b. bacteria can be extreme thermophiles, archaea cannot. c. archaea contain ester-linked membrane fatty acids, bacteria do not. d. bacteria start protein production with formylmethionine, archaea do not. e. bacteria have introns, archaea do not.

ANS: D DIF: Medium REF: 17.3 OBJ: 17.3e Compare and contrast the features of bacteria, archaea, and eukarya MSC: Understanding 25. Horizontal gene transfer can occur by all of the following EXCEPT a. plasmid acquisition. d. transformation processes. b. transposable genetic elements. e. parent to offspring. c. bacteriophage infection.

ANS: E DIF: Easy REF: 17.3 OBJ: 17.3f Distinguish horizontal gene transfer and vertical gene transfer MSC: Remembering 26. Spikes in ________ content often indicate that a horizontal gene transfer has occurred in the genome. a. GC d. AT b. AC e. CU c. GT ANS: A DIF: Medium REF: 17.3 OBJ: 17.3f Distinguish horizontal gene transfer and vertical gene transfer MSC: Remembering 27. The figure below shows two ways to represent phylogenetic relationships using rRNA from several thermophiles from Obsidian Pool in Yellowstone National Park. The principal advantage to unrooted trees, when compared to rooted trees, is that they

a. b. c. d. e.

are more readable. are easier to draw. are more precise. indicate the position of a common ancestor. are more precise regarding mutation rates.

ANS: D DIF: Medium REF: 17.3 OBJ: 17.3d Outline the steps required to construct a phylogenetic tree MSC: Understanding 28. All of the following are examples of ―operational genes,‖ EXCEPT ________ genes. a. metabolic d. pathogenicity b. ribosomal RNA e. resistance c. stress response ANS: B DIF: Medium REF: 17.3 OBJ: 17.3f Distinguish horizontal gene transfer and vertical gene transfer MSC: Applying 29. Which of the following would be considered a gene product of an ―informational gene‖? a. Staphylococcus toxic shock toxin b. siderophore transport protein c. hexokinase enzyme for glycolysis d. Escherichia coli O157:H7 attachment pili e. 16S ribosomal RNA ANS: E DIF: Medium REF: 17.3 OBJ: 17.3f Distinguish horizontal gene transfer and vertical gene transfer MSC: Applying 30. Evidence in the study of adaptive evolution CANNOT be obtained from a. comparisons of gene sequences within a genome. b. comparisons of gene sequences between genomes. c. the study of microorganisms growing in strongly selective environments. d. sequencing a single genome several times (deep sequencing). e. experimental evolution.

ANS: D DIF: Easy REF: 17.4 OBJ: 17.4a Identify the conditions that lead to adaptive evolution MSC: Applying 31. Appearance of a new trait in experimental evolution consists of which three basic stages? a. fixing, staining, and decolorizing b. disabling gene expression, regulation, slow cell growth c. potentiation, actualization, and refinement d. gene amplification, purification, and subcloning e. restriction digestion, agarose gel electrophoresis, and staining

ANS: C DIF: Medium REF: 17.4 OBJ: 17.4b Analyze the different kinds of evidence that support adaptive evolution MSC: Understanding 32. In the study of rapid adaptive evolution through exposure to strongly selective environments, the energy cost to an organism that emerges as the fittest is that it is a. slowed by the demands of the stress response. b. slowed as a result of decreasing respiratory activities. c. slow growth as a result of impaired DNA replication. d. uncontrolled growth due to an inability to regulate mRNA translation. e. uncontrolled growth due to an inability to regulate binary fission.

ANS: A DIF: Medium REF: 17.4 OBJ: 17.4d Explain the relationship between organismal fitness and the environment MSC: Analyzing 33. During the Long-Term Evolution Experiment (LTEE), investigators found a Cit+ strain of Escherichia coli that allowed fast growth on citrate buffer after 33,000 generations. The ability to catabolize citrate evolved at this time through a. acquiring the ability to exploit new ecological niches. b. becoming pathogens. c. becoming dependant on a symbiotic partner’s resources. d. becoming pathogens and becoming dependent on a symbiotic partner’s resources. e. losing the ability to exploit new ecological niches.

ANS: D DIF: Difficult REF: 17.4 OBJ: 17.4d Explain the relationship between organismal fitness and the environment MSC: Applying 34. Which of the following is NOT used as a criterion to define a prokaryotic species? a. Phylogenetic relatedness is not a criterion. b. Members of different species cannot interbreed. c. The average nucleotide identity (ANI) of orthologs  95%. d. Organisms with 95% identity have a shared ecotype. e. SSU rRNA similarity  95%.

ANS: B DIF: Medium REF: 17.5 OBJ: 17.5a Explain why there is debate about how to define a bacterial species and state the criteria of the current working definition | 17.5b Justify the use of phylogenetic relatedness and shared ecotype in microbial classification MSC: Understanding 35. Taxonomy can be defined as the a. classifying of life forms into different categories with shared traits. b. recognition of the class of a given microbe isolated in pure culture. c. identification of a species in a sample or collection. d. recognition of different classes of life. e. testing of metabolic reactions to predict pathogenicity.

ANS: A DIF: Easy REF: 17.5 OBJ: 17.5a Explain why there is debate about how to define a bacterial species and state the criteria of the current working definition MSC: Remembering 36. Which branch of taxonomy deals with the sorting of life-forms into bins (categories) based on genetic relatedness and traits of the organisms? a. identification d. biogeography

b. classification c. nomenclature

e. ethnology

ANS: B DIF: Easy REF: 17.5 OBJ: 17.5a Explain why there is debate about how to define a bacterial species and state the criteria of the current working definition MSC: Remembering 37. The term ―pan-genome‖ can best be defined as a. the world DNA genomic databank. b. the sum total of all expected genes in all possible isolates of a given species. c. genomic islands found in pathogenic organisms. d. the entire genomic sequence of all known organisms. e. differences in RNA transcription between species.

ANS: B DIF: Easy REF: 17.5 OBJ: 17.5c Distinguish pan-genome and core genome

MSC: Understanding

38. Which of the following is the organizing body that sets the rules for naming a new prokaryotic species or taxa? a. Bergey’s Manual of Determinative Bacteriology b. the International Committee on Systematics of Prokaryotes c. the International Journal of Systematic and Evolutionary Microbiology d. the American Society for Microbiology e. the World Health Organization ANS: B DIF: Easy REF: 17.5 OBJ: 17.5d Organize taxonomic ranks and outline the steps in naming a new species MSC: Remembering 39. ―Incompletely described,‖ emerging organisms are on their way to be established as new species.

In the meantime, they can be designated as all of the following EXCEPT a(n) a. unclassified organism. d. type species. b. uncultured organism. e. candidate species. c. environmental sample ANS: D DIF: Easy REF: 17.5 OBJ: 17.5e List different types of emerging clades

MSC: Remembering

40. A dichotomous key is a a. battery of biochemical tests used to identify organisms in a particular taxon. b. detailed description of a taxon with diagnostic purposes. c. registered valid name for a specific taxon. d. comprehensive list of characteristics that define a taxonomic category. e. series of yes/no choices that successively narrows down a possible taxonomic category.

ANS: E DIF: Easy REF: 17.5 OBJ: 17.5f Compare and contrast a dichotomous key and a probabilistic indicator for microbial identification MSC: Applying 41. The following is correct about a probabilistic indicator for bacterial identification, EXCEPT that a. it requires a predefined database of known bacteria. b. numerous strains of each species in well-studied habitats must be isolated in pure culture and tested for a defined number of traits. c. it is based on yes/no choices that successively narrow down the identification of a taxon. d. it only works if the bacterial isolate coincides with a member of a predefined database.

e. fractions of positive results for certain traits are noted as the probability of obtaining a positive result.

ANS: C DIF: Easy REF: 17.5 OBJ: 17.5f Compare and contrast a dichotomous key and a probabilistic indicator for microbial identification MSC: Applying 42. The word ―symbiosis‖ is usually understood to mean ________, a relationship in which both partners benefit and may absolutely require each other. a. comensalism d. predation b. parasitism e. competition c. mutualism ANS: C DIF: Easy REF: 17.6 OBJ: 17.6a Distinguish various types of symbiotic relationships MSC: Understanding 43. Rhizobial bacteroids and their plant hosts have evolved to have what type of symbiotic relationship? a. mutualistic d. ammensal b. parasitic e. predatory c. commensal ANS: A DIF: Easy REF: 17.6 OBJ: 17.6b Identify examples of coevolution and endosymbiosis MSC: Understanding 44. The presence of cells of the alga Chorella growing within Paramecium bursaria is an example of a. ectosymbiosis. d. commensalism. b. intracellular endosymbiosis. e. competition. c. parasitism.

ANS: B DIF: Easy REF: 17.6 OBJ: 17.6a Distinguish various types of symbiotic relationships | 17.6b Identify examples of coevolution and endosymbiosis MSC: Understanding 45. The disease filariasis is caused by the ________, which harbors Wolbachia endosymbionts. a. flatworm Taenia solium d. bacterium Staphylococcus aureus b. ciliate protist Paramecium bursaria e. nematode Brugia malayi c. flagellate protist Guilladia theta ANS: E DIF: Medium REF: 17.6 OBJ: 17.6b Identify examples of coevolution and endosymbiosis MSC: Applying 46. Cyanobacterial endosymbionts in the protist ________retain cell walls and some metabolism, thus serving as a model for cyanobacterial uptake. a. Paramecium bursaria d. Glaucocystophyta sp. b. Paramecium aurelia e. Entamoeba hystolitica c. Cyanophora paradoxa ANS: D DIF: Easy REF: 17.6 OBJ: 17.6b Identify examples of coevolution and endosymbiosis MSC: Remembering 47. The most likely ancestor for today’s mitochondria according to the endosymbiotic model is a(n)

a. b. c. d. e.

species in the genus Bacillus. rickettsia. member of the clostridia. enterobacterium related to Escherichia coli. cyanobacterium.

ANS: B DIF: Medium REF: 17.6 OBJ: 17.6c Compare and contrast the origins of mitochondria and chloroplasts MSC: Understanding 48. Mitochondria maintained the essential genes ________ from the ancestral endosymbiont from which they evolved. a. NADH dehydrogenase, cytochrome oxidase, and ATP synthetase b. pyruvate dehydrogenase, citrate synthase, and fumarase c. hexokinase, phosphoglucose isomerase, and phosphofructokinase d. photosystem I and II and ATP synthetase e. catalase, superoxide dismutase, and peroxidase ANS: A DIF: Medium REF: 17.6 OBJ: 17.6b Identify examples of coevolution and endosymbiosis MSC: Understanding 49. The ancestral organism that gave rise to the modern-day chloroplast was a. rickettsia. d. a rhizobial bacteroid. b. a cyanobacterium. e. a methanogen. c. Wolbachia.

ANS: B DIF: Easy REF: 17.6 OBJ: 17.6c Compare and contrast the origins of mitochondria and chloroplasts MSC: Understanding 50. Human diseases caused by defective mitochondrial DNA include all of the following EXCEPT a. sickle cell anemia. d. Parkinson’s disease. b. forms of ataxia. e. chorea. c. dystonia.

ANS: A DIF: Medium REF: 17.6 OBJ: 17.6c Compare and contrast the origins of mitochondria and chloroplasts MSC: Applying SHORT ANSWER 1. Explain how banded iron formations could arise in the geologic record due to photoferrotrophy.

ANS: Photoferrotrophy is a form of anaerobic photosynthesis that uses reduced iron (Fe2+) as the electron donor. Fe2+ loses an electron (due to light energy) and is oxidized to Fe3+. Oxidized iron is insoluble and can form iron oxide (Fe2O3) precipitates when exposed to O2. Layers colored red by iron oxides and iron oxyhydroxides [FeOx(OH)y] then form in the geologic record.

DIF: Medium REF: 17.1 OBJ: 17.1b Define stromatolites, biosignatures, and banded iron formations MSC: Analyzing

2. Briefly discuss the types of geological evidence of early life and their advantages and limitations.

ANS: Stromatolites: Fossil microbial mats, which deposited CaCo3 or silica, date from the Archaean eon.

They resemble modern stromatolites, but some layered formations have been shown to be abiotic in origin.

Microfossils: Decaying early microbial cells filled in with CaCo3 or silica; their size and shapes resemble those of modern microbes, but some of these formations are the result of abiotic processes.

Isotope ratios: Microbes fix 12CO2 more readily than 13CO2. Isotope ratios are generated by specific biochemical reactions, their measurements are highly reproducible, and they can be used to calibrate phylogenies timelines. There is no absolute proof that a given isotope ratio was biologically generated.

Biosignatures: Certain organic molecules found in sedimentary rock are synthesized by specific bacterial groups. In oldest rocks, organic biosignatures have been eliminated by geological processes.

Oxidation state: Oxidation states of some metals such as Fe and U indicate the levels of atmospheric O2, providing evidence of oxygen-producing organisms. Abiotic oxidation is hard to rule out.

DIF: Medium REF: 17.1 OBJ: 17.1e Appraise the advantages and disadvantages of the various forms of geological evidence used in studying early life MSC: Analyzing 3. Analyze the figure below. If a  13C isotope analysis was performed on an unknown geological sample of sedimentary graphite and determined a negative  13C % value, would it be determined that life had existed in that sample or not, and why?

ANS: Life could have existed in the sample. A negative  13C % value signifies 13C depletion, likely resulting from past CO2-fixing autotrophic activity, namely from cyanobacterial photosynthesis.

The value for sedimentary graphite on the figure is comparable to those for contemporary samples containing carbon of organic origin (including microbially produced CO2 in soil) and very different from the  13C % in samples of abiotically produced CO2 in deep and shallow ocean and carbonate rock. A negative 13C % value is a valid biosignature.

DIF: Difficult

REF: 17.1

OBJ: 17.1e Appraise the advantages and disadvantages of the various forms of geological evidence used in studying early life MSC: Applying 4. Explain how studying the evolutionary rate of RNA viruses in comparison to DNA viruses can help explain the evolutionary rate in early Earth.

ANS: RNA viruses (such as HIV or influenza) mutate, evolve, and diverge much faster than DNA viruses. If early Earth was still an ―RNA world,‖ then the evolution rate during that time would have been faster due to the inherent instability and mutability of the RNA molecule. Once DNA was established as the primary information molecule, the evolutionary rate would have slowed down to speeds that we see in DNA-based genomes today.

DIF: Medium REF: 17.2 OBJ: 17.2c State some unresolved questions about the origins of early life MSC: Applying 5. How do membrane compartments spontaneously arise from the properties of fatty acid glycerol esters?

ANS: Jack Szostak demonstrated that membrane-like compartments can form spontaneously from fatty acid glycerol esters. These molecules are amphipathic; that is, they have both a hydrophobic portion (the fatty acid tails) and a hydrophilic one (the glycerol ester moiety). When suspended in water, these fatty acid derivatives form micelles, aggregates in which the hydrophobic portions associate in the interior and the hydrophilic portions remain in contact with water. Micelles may aggregate to form hollow vesicles, delimited by a membrane.

DIF: Difficult REF: 17.2 OBJ: 17.2b Compare the three models for the origin of the first living cells MSC: Analyzing 6. The figure below depicts a metabolist model for CO2 fixation as the basis for biosynthesis as proposed by Morowitz and Wächterhäuser. Discuss the pathway and determine what its outcome is.

ANS: Polymerization of CO2 and H2 could have originated simple organic molecules by catalysis with abiotic compounds such as FeS [A]. Other elements, such as S, could have been added by these compounds by similar catalytic mechanisms, leading to the synthesis of pyruvic acid [B] and the intermediates of the tricarboxylic acid (TCA) cycle [C]. The direct amination of TCA intermediates, such as oxalacetic acid [D], could have originated amino acids [E] in an analogous manner to enzyme-catalyzed transamination in today’s cells.

DIF: Difficult REF: 17.2 OBJ: 17.2a Recall the types of energy-producing reactions likely available to the earliest cells MSC: Applying 7. Refer to the figure below and briefly discuss the possible origin of the genetic code.

ANS:

An early pretranslation mechanism of amino acid biosynthesis preceded the functional link between amino acids and nucleotides. The figure above represents the mechanism proposed by Harold Morowitz and coworkers. Amino acids originated from intermediates of the tricarboxylic acid cycle (TCA) by amination [A] and modifications of the lateral R group [B]. The TCA intermediate would have been complexed to a dinucleotide. Synthesis of nucleotides has been demonstrated to occur from simpler molecules such as ammonia and hydrogen cyanide. The first two nucleotides of contemporary triplets in the genetic code could have evolved from the original dinucleotide. A vestige of this mechanism is the fact that some amino acids, synthesized from the same TCA intermediate by transamination, are specified by codons starting with the same nucleotide.

DIF: Difficult REF: 17.2 OBJ: 17.2c State some unresolved questions about the origins of early life MSC: Analyzing 8. Use the figure below to discuss how catalytic activity in enzyme proteins could have evolved from catalytic RNA.

ANS: During the RNA world, earliest cells would have possessed ribozymes [i] to perform catalytic activities. Ribozymes could have acquired protein subunits [ii], which eventually substituted for the RNA molecule and assumed most of its catalytic functions [iii]. Some enzymes, including contemporary ribozymes and ribosomal peptidyl transferases, depend on RNA for their catalytic activity. In other enzymes, remnants of the original RNA may persist as nucleotide cofactors such as NADH [iv].

DIF: Difficult REF: 17.2 OBJ: 17.2b Compare the three models for the origin of the first living cells MSC: Analyzing 9. Four unique sequences have been amplified using PCR of the SSU rRNA gene from four unknown microorganisms. Calculate the percent relatedness of each in comparison with the known sequence given to determine which strains are most phylogenetically related. What would a molecular, rectangular phylogenetic tree of divergence of the four sequences look like?

(1) AAATGTTGGGCTTCCGGCAGTAGTGAGTG (2) AAATGTTGGGATTCCGGAAGTAGTGAGTG (3) AAATGCTGGGCTTCCGGAAGTAGCGAGTG (4) AAATGATGGGCTTCCGGGAGCGAGTGCCC ANS: The sequences have 29 nucleotides. The first step is to align them to find homologies:

(1) AAATGTTGGGCTTCCGGCAGTAGTGAGTG 27/29 = 93% (2) AAATGTTGGGATTCCGGAAGTAGTGAGTG 26/29 = 90% (3) AAATGCTGGGCTTCCGGAAGTAGCGAGTG 24/29 = 83% (4) AAATGATGGGCTTCCGGGAG---CGAGTGCCC Unknowns 1 and 2 differ from the known strain by 2 nucleotides (27/29 = 93%). Unknowns 2 and 3 differ by 3 nucleotides (26/29 = 90%). Unknown 3 differs from unknown by 5 nucleotides (24/29 = 83%). The most phylogenetically related sample to 1 is 2, followed by 3. Sample 4 seems to be an outlier to 1, 2, and 3; all three have a lower divergence and seem to have originated from a common ancestor:

DIF: Difficult REF: 17.3 OBJ: 17.3d Outline the steps required to construct a phylogenetic tree MSC: Evaluating 10. Why and how is the gene for small subunit ribosomal RNA (SSU 16S rRNA) used to determine molecular phylogeny?

ANS: SSU rRNA gene sequences are widely used in phylogenetic studies because certain regions are highly conserved across all life forms. Researchers can develop primers to conserved sequences in the DNA that encodes the SSU rRNA. Through PCR, using the conserved primers, the amplified can be used for comparison and analyzed for divergence based on changes in nucleotide sequence.

The alignment of homologous sequences in divergent species or strains can help in determining the % relatedness, allowing for the creation of phylogenetic trees based on genetics.

DIF: Medium REF: 17.3 OBJ: 17.3c Assess the use of molecular clocks to date organismal divergence MSC: Applying 11. Discuss what horizontal gene transfer is. How does it occur and how might it obscure phylogenetic relationships among taxa?

ANS: The acquisition of a piece of DNA from another cell is called horizontal (or lateral) gene transfer, as opposed to the vertical transfer in parent-to-progeny heredity. DNA can be transferred horizontally by plasmids, transposable elements, or bacteriophages. In the laboratory, it can be accomplished through the process of transformation. Through evolutionary time, some species have acquired enough genes by horizontal transfer so as to obscure the monophyletic distinctions of a particular taxon. In 1999, Ford Doolittle redrew phylogenetic relationships, showing that phylogeny combines vertical and horizontal transfer. Perhaps organisms did not have a ―last common ancestor‖ but rather a ―last common community‖ that contributed to different components of our genetic ancestry.

DIF: Difficult REF: 17.3 OBJ: 17.3f Distinguish horizontal gene transfer and vertical gene transfer MSC: Applying 12. The Long-Term Evolution Experiment (LTEE) has been conducted by Richard Lenski at Michigan State University since 1988. The purpose of the experiment is to observe evolution in action in a laboratory environment. Use the figure below to explain what physiological adaptations allowed one of the Escherichia coli strains to grow to a much higher density after 33,000 generations.

ANS: Originally, twelve populations of Escherichia coli were founded from a single clone, and they have been transferred every 24 hours to fresh medium at a 1% dilution. The medium has low glucose content and a citrate buffer to facilitate use of iron. Every 500 generations, samples of each population are frozen for further study. After 33,000 generations, one of the twelve populations evolved a new phenotype: the ability to grow aerobically on citrate (Cit+), which allowed the cultures to become denser than other populations. Cit+ is a rare trait in E. coli, which means that the original mutants had to replicate enough before becoming the predominant strain in that population. Going back into the frozen clones record, Lenski and his group found that the evolution of the Cit+ phenotype had ―potentiated‖ by other mutations, such as the ability to grow on acetate, that occurred during the first 31,000 generation.

DIF: Difficult REF: 17.3 OBJ: 17.4d Explain the relationship between organismal fitness and the environment MSC: Evaluating 13. Use the figure below to describe the appearance of the Cit+ mutation in Escherichia coli during the Long-Term Evolution Experiment (LTEE).

ANS: After 33,000 generations in which twelve populations of Escherichia coli have been transferred daily onto media with low glucose and citrate buffer (1% dilutions), a mutant appeared that was able to utilize citrate (Cit+), initially evidenced by the production of denser cultures and a demonstrated ability to utilize citrate, which is rare among E. coli strains. The potentiation of citrate utilization had started around 31,000 generations and consisted in a mutation on citrate synthase gene, gltA, which conferred E. coli the ability to grow on acetate. The ability to grow on citrate was established by a tandem duplication of the citT-rnk region. CitT encodes a citrate/succinate antiporter, which is normally repressed by oxygen, and excretes succinate. The relocation of rnk upstream of the original copy of citT drives the expression of the antiporter even in the presence of oxygen, allowing the mutant strain to respire on citrate from the medium. The loss of succinate is compensated by the ability to utilize acetate, conferred by gltA. DIF: Difficult REF: 17.4 OBJ: 17.4d Explain the relationship between organismal fitness and the environment MSC: Evaluating 14. What criteria must be met in order to prove that two bacterial strains belong in the same species?

ANS: Similarity of the sequences of their SSU rRNA genes needs to be 95% or greater. Average nucleotide identity (ANI) of orthologs (i.e., genes of the same function) should be 95%, if whole genome sequences are available for the two species for full comparison. From the standpoint of shared ecotypes, two organisms can be assigned to the same species if they have an ANI  95%, share a common habitat and metabolism, or they cause the same disease, if they are pathogens.

DIF: Difficult REF: 17.5 OBJ: 17.5a Explain why there is debate about how to define a bacterial species and state the criteria of the current working definition MSC: Applying 15. Define the term ―metagenomics‖ and explain why growth in this field has led to an increase in SSU rRNA species designations.

ANS:

Metagenomics is the practice of sequencing multiple genomes collected from an environmental community at the same time. The community can be samples from any kind of habitat, either a lake, a sector of the ocean, or an animal’s digestive tract. A large number of unique SSU rRNA sequences are found through this approach, but they come from uncultured sources and reside in the databank as simply as unclassified/uncultured organisms or environmental samples; if there are some physiological characterization experiments beyond DNA sequence, the organism may attain the provisional status of candidate species.

DIF: Medium REF: 17.5 OBJ: 17.5b Justify the use of phylogenetic relatedness and shared ecotype in microbial classification MSC: Applying 16. Studies on the genome of Bacillus species have revealed that Bacillus anthracis has a ―closed‖ pan-genome, whereas Bacillus cereus has an open pan-genome. What does this mean, and why did these two species evolve in this manner?

ANS: The pan-genome is the core genome of a species, that is, genes present in all sequenced genomes of that species plus accessory genes, present in one or more sequenced isolates. ―Closed‖ pan-genomes refer to multiple isolates from a given species that have shown relatively few genetic changes, as seen in Bacillus anthracis. ―Open‖ pan-genomes designate multiple isolates of a given species that have revealed a relatively large number of genetic changes, as it happens in Bacillus cereus. The ecological niches of these two bacteria, both at present time and throughout evolution, have caused natural selection processes to produce higher divergence within Bacillus cereus than in Bacillus anthracis.

DIF: Difficult genome MSC: Applying

REF: 17.5

OBJ: 17.5c Distinguish pan-genome and core

17. Describe the intracellular endosymbiosis between algae of the genus Chlorella and Paramecium.

Why is this symbiosis considered reversible?

ANS: Chlorella cells are much smaller than those of paramecia. Paramecium harbors actively photosynthesizing Chlorella, thus obtaining nutrients from the algal cells, which in turn find shelter from predators and viruses. The symbiosis seems to be species specific and the algal population does not overgrow, so as not to kill the host. This endosymbiosis may be an indication of how the chloroplast ancestor began its intracellular existence. Chlorella is able to multiply outside the Paramecium, so the symbiosis is reversible.

DIF: Medium REF: 17.6 OBJ: 17.6a Distinguish various types of symbiotic relationships MSC: Applying 18. Why do bacterial antibiotics have a greater effect on diminishing the effects of nematode infection caused by Brugia malayi (the etiologic agent of filariasis) than current antinematode agents?

ANS:

Certain strains of Wolbachia grow in the filarial nematode Brugia malayi in a mutualistic relationship. Wolbachia requires the nematode’s cells for biosynthesis of all amino acids and most vitamins but provides the nematode with FADH2, purines, pyrimidines, and riboflavin. In addition, Wolbachia is required for nematode embryonic development. Wolbachia seems to be evolving into an organelle for its host. Current antinematode agents have shown limited efficacy in filariasis treatment; however, simple antibiotics, such as tetracycline, have shown greater efficacy. The antibiotics kill the symbiotic Wolbachia, reducing the worm’s reproduction and thereby clearing filarial infestation.

DIF: Difficult REF: 17.6 OBJ: 17.6a Distinguish various types of symbiotic relationships MSC: Analyzing 19. The figure below displays secondary symbiont alga Guillardia theta. Describe the process by which this relationship began.

ANS: Guillardia theta is a newly formed species that evolved by symbiogenesis of an alga and an ancestral protist. After being engulfed by the protist, the alga underwent extensive reductive evolution; it lost its mitochondrion, and its nucleus is now reduced to a nucleomorph; however, it kept its chloroplast. This new species is capable of both phototrophy and heterotrophy. To culture it in laboratory conditions, one may need to grow it in a medium containing organic compounds or under illumination in a minimal medium containing mineral salts.

DIF: Difficult REF: 17.6 OBJ: 17.6b Identify examples of coevolution and endosymbiosis MSC: Applying 20. How can plants be so efficient photosynthetically if the chloroplast genome has fewer genes when compared with free-living cyanobacteria?

ANS:

Chloroplast DNA encodes mainly essential proteins involved in its main function, photosynthesis: large subunit of Rubisco, photosystems I and II, chlorophyll-binding proteins, and the proton-ATP synthase, as well as gene expression components. Other genes involved in chloroplast metabolism have migrated to the nucleus, including the gene for Rubisco’s small subunit.

DIF: Difficult REF: 17.6 OBJ: 17.6c Compare and contrast the origins of mitochondria and chloroplasts MSC: Analyzing

CHAPTER 18: Bacterial Diversity MULTIPLE CHOICE 1. A bacterial phylum is a group of organisms that share a common ancestor that diverged early from other bacteria, based on a. small-subunit (16S) rRNA sequences. d. having 70S or 80S ribosomes. b. the presence of certain plasmids. e. the presence or absence of a cell wall. c. their genomic size.

ANS: A DIF: Easy REF: 18.1 OBJ: 18.1b Explain the basis for placing bacteria into different phyla MSC: Remembering 2. An ancient ________ is assumed to be in the same lineage as mitochondria. a. Rhizobium d. Rickettsia b. Mycoplasma e. cyanobacterium c. Clostridium ANS: D DIF: Easy REF: 18.1 | 18.4 OBJ: 18.1c List the major well-studied bacterial phyla | 18.4b Name several prominent proteobacterial species from each of the five classes and state their importance MSC: Remembering 3. Which of the following is NOT correct about microorganisms in the phylum Thermotogae? a. They are bacterial thermophiles. b. Archaeal genes have been transferred horizontally to them. c. They have mosaic genomes. d. They are bacteria with sheath-like outer structures. e. They are aerobic heterotrophs.

ANS: E DIF: Medium REF: 18.1 OBJ: 18.1d Recall traits of deep-branching thermophiles

MSC: Remembering

4. Bacteria are widely diverse in their cell structure, metabolism, and ecological adaptations, but share some major common traits. Which of the following statements is NOT true? a. They share common features in central apparatus for gene expression and translation. b. Bacterial gene expression mechanisms differ from those of the eukaryotes, which underlies the selective activity of many antibiotics. c. Some archaeal cell walls are composed of pseudopeptidoglycan and may have fundamentally different antibiotic sensitivity than bacteria. d. Mycoplasmas contain abnormal peptidoglycans and are thus not susceptible to antibiotics. e. In bacteria, variant forms of peptidoglycan distinguish different species.

ANS: D DIF: Medium REF: 18.1 OBJ: 18.1a State unique traits bacteria share that distinguish them from archaea and eukarya |

18.1b Explain the basis for placing bacteria into different phyla

MSC: Understanding

5. A trait that differentiates all Firmicutes from Actinobacteria is a. Gram stain character. d. pathogenicity. b. GC content. e. genome size. c. oxygen requirements.

ANS: B DIF: Medium REF: 18.1 OBJ: 18.1c List the major well-studied bacterial phyla

MSC: Understanding

6. Clades of microbes that are recently defined or characterized are referred to as a. hyperthermophiles. d. deep branching. b. archaea. e. emerging. c. phyla.

ANS: E DIF: Easy REF: 18.1 OBJ: 18.1b Explain the basis for placing bacteria into different phyla MSC: Remembering 7. Cyanobacteria are the only prokaryotes that use ________ to photolyze water to produce oxygen. a. photosystem I alone d. plastocyanin b. bacteriochlorophyll e. carboxyzomes c. both photosystems I and II ANS: C DIF: Medium REF: 18.2 OBJ: 18.2a Assess the ecological impacts of cyanobacteria | 18.2b List traits that all cyanobacteria share and traits that differ among species | 18.2c Compare and contrast cyanobacteria with other phototrophic bacteria MSC: Understanding 8. All of the following are mechanisms that provide an anoxic environment for nitrogen fixation in cyanobacteria EXCEPT a. formation of heterocysts. b. formation of chlorosomes. c. temporal separation of photosynthesis and nitrogen fixation. d. accumulation of large aggregates of cells. e. symbiotic associations with fungi or plants.

ANS: B DIF: Easy REF: 18.2 OBJ: 18.2d Recall the functions of thylakoids, carboxysomes, gas vesicles, heterocysts, hormogonia, and akinetes MSC: Remembering 9. Which of the following factors is NOT involved in initiation of spore formation in firmicutes? a. carbon starvation d. nitrogen starvation b. light limitation e. low pH c. phosphate starvation ANS: B DIF: Difficult REF: 18.3 OBJ: 18.3c Recall the function of endospores and which organisms produce them MSC: Understanding 10. Bacteria in the genera ________ produce durable endospores that remain viable for millennia. a. Carboxydothermus and Listeri d. Oscillatoria and Anabaena b. Lactobacillus and Streptococcus e. Rickettsia and Chromatium c. Bacillus and Clostridium ANS: C

DIF: Easy

REF: 18.3

OBJ: 18.3c Recall the function of endospores and which organisms produce them MSC: Remembering 11. Which of the following species of Bacillus produces a biological insecticide? a. B. subtilis d. B. thermophilus b. B. anthracis e. B. halodurans c. B. thuringiensis ANS: C DIF: Easy REF: 18.3 OBJ: 18.3d Outline the research and industrial importance of various firmicute species such as Bacillales, Clostridiales, and lactic acid bacteria MSC: Remembering 12. Which of the following is an extremophile? a. Bacillus alkalophilus b. Bacillus thuringiensis c. Bacillus subtilis

d. Clostridium botulinum e. Clostridium tetani

ANS: A DIF: Easy REF: 18.3 OBJ: 18.3a Compare and contrast firmicutes and actinobacteria; identify shared traits and differences MSC: Remembering 13. Cyanobacteria contain subcellular structures called carboxysomes that are rich in the enzyme ________ that fixes CO2. a. decarboxylase d. cellulase b. oxidase e. Rubisco c. urease ANS: E DIF: Medium REF: 18.2 OBJ: 18.2b List traits that all cyanobacteria share and traits that differ among species | 18.2d Recall the functions of thylakoids, carboxysomes, gas vesicles, heterocysts, hormogonia, and akinetes MSC: Understanding 14. Cyanobacteria participate in multilayered microbial mats with sulfur phototrophs. These other phototrophs absorb light if they lie below the cyanobacteria by a. growing anaerobically. b. producing phycocyanin. c. absorbing light at shorter wavelengths than cyanobacteria. d. absorbing light at longer wavelengths than cyanobacteria. e. absorbing UV irradiation.

ANS: D DIF: Medium REF: 18.2 | 18.4 OBJ: 18.2e Describe some of the symbiotic associations cyanobacteria form with other organisms | 18.4a Describe the types of energy-producing metabolic reactions present among proteobacteria MSC: Understanding 15. The firmicutes ________ are the only known phototrophs that produce endospores. a. actinomycetales d. heliobacteriaceae b. bacillales e. cyanobacteria c. clostridiales ANS: D DIF: Medium REF: 18.3 OBJ: 18.3a Compare and contrast firmicutes and actinobacteria; identify shared traits and differences MSC: Remembering

16. Which of the following is NOT a common cyanobacterial morphology? a. single-celled d. filamentous b. endospore e. akinete c. colonial ANS: B DIF: Medium REF: 18.2 OBJ: 18.2d Recall the functions of thylakoids, carboxysomes, gas vesicles, heterocysts, hormogonia, and akinetes MSC: Analyzing 17. Which of the following is NOT correct about the non-spore-forming firmicutes? a. This group includes lactic acid bacteria such as Lactococcus and Lactobacillus. b. They include the mycoplasmas, which possess cell walls made of pseudopeptidoglycan. c. Food spoilers such as Leuconostoc and Pediococcus belong to this group. d. They may have evolved from endospore-forming bacteria. e. Listeria species include enteric pathogens that contaminate cheese and sauerkraut.

ANS: B DIF: Medium REF: 18.3 OBJ: 18.3a Compare and contrast firmicutes and actinobacteria; identify shared traits and differences | 18.3e State a defining feature of mollicutes such as the mycoplasmas MSC: Understanding 18. In what environment does Savagella form filaments through the production of intracellular offspring? a. aquatic, high salinity environments d. mammalian skin tissue b. hydrothermal springs e. mammalian gut epithelium c. surgical wounds ANS: E DIF: Easy REF: Special Topic 18.1 | 18.3 OBJ: 18.3a Compare and contrast firmicutes and actinobacteria; identify shared traits and differences MSC: Remembering 19. The following figure represents the life cycle of which bacteria?

a. clostridiales b. verrucomicrobia c. Streptomyces

d. myxobacteria e. cyanobacteria

ANS: D DIF: Medium REF: 18.4 OBJ: 18.4b Name several prominent proteobacterial species from each of the five classes and state their importance MSC: Understanding

20. Dehalobacter restrictus conducts anaerobic respiration by a. reducing aromatic rings of lignin-derived compounds. b. donating electrons to Fe3+, converting it to Fe2+ in mine ores. c. donating electrons to Cl atoms, effectively performing dechlorination. d. donating electrons to NO3, yielding NO2. e. donating electrons to SO42, yielding HS.

ANS: C DIF: Medium REF: 18.3 OBJ: 18.3d Outline the research and industrial importance of various firmicute species such as Bacillales, Clostridiales, and lactic acid bacteria MSC: Understanding 21. Which of the following is NOT correct with respect to the mycoplasmas? a. They have lost their cell wall and the S-layer through reductive evolution. b. Their cells maintain their shape through a type of cytoskeleton. c. When cultured on agar, their colonies have a ―fried-egg‖ shape. d. They are parasites of all kinds of multicellular organisms. e. They have some of the largest bacterial genomes.

ANS: E DIF: Medium REF: 18.3 OBJ: 18.3e State a defining feature of mollicutes such as the mycoplasmas MSC: Remembering 22. The type of telomere pictured below is found in

a. rickettsias and mitochondria. b. cyanobacteria and chloroplasts. c. Streptomyces.

d. Planctomycetes. e. Deinococcus-Thermus.

ANS: C DIF: Medium REF: 18.3 OBJ: 18.3f Classify an organism based on its traits

MSC: Remembering

23. Which of the following is NOT correct with respect to the species of Frankia? a. It belongs to the phylum Actinobacteria. b. It can live as an endophyte in the roots of some vascular plants, where it fixes nitrogen. c. Some species can protect plants, such as wheat, from fungal infection. d. Some species can grow as saprophytes on dead leaf litter. e. Some species have been found to form spores.

ANS: E DIF: Difficult REF: 18.3 OBJ: 18.3h Describe the various morphologies of actinomycetes MSC: Remembering 24. Which of the following is pathogenic? a. Mycobacterium smegmatis b. Blastochloris viridis

d. Acidithibacillus ferrooxidans e. Neisseria gonorrhoeae

c. Leptospirillum spp.

ANS: E DIF: Medium REF: 18.4 OBJ: 18.4b Name several prominent proteobacterial species from each of the five classes and state their importance MSC: Remembering 25. Photoheterotrophs absorb light for energy, but do NOT typically a. produce endospores. b. generate biomass from carbohydrates. c. fix nitrogen. d. fix carbon dioxide. e. grow oligotrophically.

ANS: D DIF: Medium REF: 18.4 OBJ: 18.4a Describe the types of energy-producing metabolic reactions present among proteobacteria MSC: Understanding 26. Corynebacterium species have a particular type of cell division that can be described as a. ―half-snapping.‖ b. the formation of reticulate bodies. c. the formation of a forespore and a mother cell. d. stalking. e. ―live birth.‖ ANS: A DIF: Easy REF: 18.3 OBJ: 18.3h Describe the various morphologies of actinomycetes MSC: Remembering 27. Dehalobacter restrictus could be used in bioremediation because it a. respires by donating electrons to Cl atoms in tetrachloroethene, used in dry cleaning. b. is an anaerobe that quickly digests plastics in landfills. c. catabolizes aromatic compounds by reductive degradation. d. removes salt from salt marshes. e. is not applicable for use in bioremediation.

ANS: A DIF: Medium REF: 18.3 OBJ: 18.3d Outline the research and industrial importance of various firmicute species such as Bacillales, Clostridiales, and lactic acid bacteria MSC: Applying 28. Which feature, indicated in the following figure, do Chlorobi share with Chloroflexi and Chloracidobacterium thermophilum?

a. chlorosomes b. thylakoids c. halophily

d. endospores e. hormogonia

ANS: A DIF: Medium REF: 18.1 | 18.5 OBJ: 18.1d Recall traits of deep-branching thermophiles | 18.5c Recall the main attributes of each of the five major deep-branching Gram-negative phyla MSC: Understanding 29. Which of the following is NOT correct about the outer membrane of Gram-negative proteobacterial cell wall? a. It has receptor proteins and porins. b. In pathogens, lipopolysaccharide facilitates phagocytosis. c. Lipopolysaccharide is toxic when released by dying cells. d. It is a lipid bilayer membrane. e. Lipopolysaccharide is absent in the cytoplasmic membrane.

ANS: B DIF: Medium REF: 18.4 OBJ: 18.4c Recall the cell envelope structure of proteobacteria MSC: Remembering 30. Which phylum contains the purple bacteria? a. cyanobacteria b. proteobacteria c. actinobacteria

d. fusobacteria e. firmicutes

ANS: B DIF: Easy REF: 18.4 OBJ: 18.4a Describe the types of energy-producing metabolic reactions present among proteobacteria MSC: Remembering 31. Which of the following is NOT correct regarding rhizobia? a. Rhizobium, Bradyrhizobium, and Synorhizobium are among the genera comprising rhizobia. b. They may live freely in soil, but they prefer to establish symbioses with specific legumes. c. They form nodules in the roots to favor anaerobiosis and consequently nitrogen fixation. d. They provide the host with leghemoglobins, which help the plant hosts combat pathogens. e. Each species colonizes a particular host range for infection.

ANS: D DIF: Medium REF: 18.4 OBJ: 18.4d Provide specific examples of endosymbiotic proteobacteria MSC: Understanding 32. In sewage-treatment systems, nitrifiers such as ________ are used to decrease the reduced nitrogen content. a. Neisseria gonorrhoeae and N. meningitidis b. Thiobacillus spp. c. Nitrosomonas, Nitrosolobus, and Nitrosovibrio d. Escherichia spp. e. Helicobacter and Campylobacter ANS: C DIF: Easy REF: 18.4 OBJ: 18.4a Describe the types of energy-producing metabolic reactions present among proteobacteria | 18.4b Name several prominent proteobacterial species from each of the five classes and state their importance MSC: Understanding 33. Which gammaproteobacteria genera include species that oxidize H2S to S0? a. Escherichia and Enterobacter d. Proteus and Erwinia

b. Chromatium and Beggiatoa c. Klebsiella and Shigella

e. Rhodobacter and Nitrosomonas

ANS: B DIF: Medium REF: 18.4 OBJ: 18.4a Describe the types of energy-producing metabolic reactions present among proteobacteria | 18.4b Name several prominent proteobacterial species from each of the five classes and state their importance MSC: Remembering 34. Where do Chromatium cells store sulfur? a. in cytoplasmic granules b. in periplasmic granules c. in attached sulfur globules

d. in their immediate environment e. in cytoplasmic vacuoles

ANS: A DIF: Easy REF: 18.4 OBJ: 18.4b Name several prominent proteobacterial species from each of the five classes and state their importance MSC: Remembering 35. Which of the following is NOT correct about the sulfur lithotrophic genus Beggiatoa? a. It is a Gram-negative gammaproteobacterial genus. b. It oxidizes H2S to S0. c. It stores S0 in cytoplasmic granules. d. It stores polyhydroxybutyrate. e. It grows as extended filaments.

ANS: C DIF: Medium REF: 18.4 OBJ: 18.4a Describe the types of energy-producing metabolic reactions present among proteobacteria | 18.4b Name several prominent proteobacterial species from each of the five classes and state their importance MSC: Understanding 36. The following bacterial genera belong to the Enterobacteriaceae. In particular, the heavily flagellated ________ display swarming behavior prior to forming ________. a. Escherichia; colonies d. Caulbacter; stalks b. Proteus; biofilms e. Myxobacteria; fruiting bodies c. Pseudomonas; endospores ANS: B DIF: Difficult REF: 18.4 OBJ: 18.4b Name several prominent proteobacterial species from each of the five classes and state their importance MSC: Remembering 37. Pseudomonas aeruginosa may form ________ in the lungs of cystic fibrosis patients. a. sarcinae d. cysts b. filaments e. capsules c. biofilms ANS: C DIF: Easy REF: 18.4 OBJ: 18.4b Name several prominent proteobacterial species from each of the five classes and state their importance MSC: Remembering 38. Which of the following is NOT correct about myxobacteria? a. Myxobacterial fruiting bodies are similar to those of the eukaryotic slime molds. b. Under nutrient scarcity, their cells attract each other and form fruiting bodies. c. They are aquatic and live as commensals on fish scales. d. They lack flagella and move along surfaces using a form of motility called gliding. e. With up to 12.6 Mbp, their genomes are exceptionally large.

ANS: C

DIF: Medium

REF: 18.4

OBJ: 18.4b Name several prominent proteobacterial species from each of the five classes and state their importance MSC: Remembering 39. Bacteroidetes are important components of what ecosystem? a. Antarctic brine lakes d. the human gut b. the termite gut e. acid mines c. hydrothermal springs ANS: D DIF: Easy REF: 18.1 | 18.5 OBJ: 18.1e Name the five major deep-branching Gram-negative phyla | 18.5a Name the five major deep-branching Gram-negative phyla MSC: Remembering 40. Which phylum of deep-branching Gram-negative bacteria are often found in dental plaques? a. Aquificae d. Fusobacteria b. Proteobacteria e. Chlorobi c. Acidobacteria ANS: D DIF: Medium REF: 18.5 OBJ: 18.5b Compare the deep-branching Gram-negative phyla to the proteobacteria | 18.5c Recall the main attributes of each of the five major deep-branching Gram-negative phyla MSC: Understanding 41. Methylobacterium species are methylotrophs, which means that they a. can oxidize reduced single-carbon compounds. b. exclusively feed on methane. c. generate methane as a product of fermentation. d. perform bacteriochlorophyll-based photosynthesis. e. are classified as lithotrophs.

ANS: A DIF: Medium REF: 18.4 OBJ: 18.4a Describe the types of energy-producing metabolic reactions present among proteobacteria MSC: Understanding 42. Bacteria in the genus Nitrospira a. are Gram-negative, true lithotrophs or autotrophs. b. possess carboxysomes, where they fix carbon dioxide or carbonate. c. remove excess nitrite in aquatic ecosystems. d. form symbiotic associations with other bacteria. e. are generally found in freshwater or salt water.

ANS: D DIF: Medium REF: 18.5 OBJ: 18.5c Recall the main attributes of each of the five major deep-branching Gram-negative phyla MSC: Understanding 43. Which of the following is NOT a common feature in many spirochetes? a. tight spiral morphology d. periplasmic flagella b. heterotrophy e. rigid cell walls c. thick outer sheaths ANS: E DIF: Medium REF: 18.6 OBJ: 18.6a State traits shared by all spirochetes

MSC: Understanding

44. Treponema azotonutricium is known for its symbiotic association with a. phototrophs in microbial mats. d. protists in the termite gut.

b. corals. c. fungi in lichens.

ANS: D DIF: Medium OBJ: 18.6b Outline spirochete diversity

e. the mammal epithelium.

REF: 18.6 MSC: Remembering

45. Which genus within the spirochetes includes the causative agent of Lyme disease? a. Treponema d. Borrelia b. Holandina e. Spirochaeta c. Leptospira ANS: D DIF: Easy OBJ: 18.6b Outline spirochete diversity

REF: 18.6 MSC: Remembering

46. Which of the following have multipartite genomes? a. Borrelia spp. d. Chlamydia spp. b. Escherichia spp. e. Mycobacterium spp. c. Bacillus spp.

ANS: A DIF: Medium OBJ: 18.6b Outline spirochete diversity

REF: 18.6 MSC: Remembering

47. Which of the following statements is NOT correct regarding the life cycle of Chlamydia?

a. b. c. d. e.

Elementary bodies are taken up by the host cells via endocytosis.

Reticulate bodies differentiate from elementary bodies outside the host cell.

A reticulate body may persist in the host cell for long periods.

Reticulate bodies replicate and develop into elementary bodies.

Elementary bodies are metabolically inert with a compacted chromosome, resembling spores.

ANS: B DIF: Easy REF: 18.7 OBJ: 18.7b Summarize the life cycle of Chlamydiae

MSC: Remembering

48. The ________ lack cell walls and have a double membrane around the nucleoid; their tolerance for low concentrations of nutrients is called ________. a. Verrucomicrobia; ectosymbiosis b. Planctomycetes; oligotrophy c. Chlamydiae; endosymbiosis

d. Cyanobacteria; oligotrophy e. Firmicutes; piezophily ANS: B DIF: Medium REF: 18.7 OBJ: 18.7a Compare and contrast Chlamydiae, Planctomycetes, and Verrucomicrobia | 18.7c Describe the cell structures of Planctomycetes and Verrucomicrobia MSC: Understanding 49. Which is NOT a typical characteristic of Verrucomicrobia? a. They contain a cytoskeleton made from tubulin. b. They are oligotrophic. c. They are rarely cultured. d. They appear to have acquired genes through horizontal transfer from eukaryotes. e. They are obligate intracellular parasites.

ANS: E DIF: Medium REF: 18.7 OBJ: 18.7a Compare and contrast Chlamydiae, Planctomycetes, and Verrucomicrobia | 18.7c Describe the cell structures of Planctomycetes and Verrucomicrobia MSC: Remembering 50. Chlamydiae, Planctomycetes, and Verrucomicrobia share which of the following traits? a. oligotrophy b. intracellular compartmentalization c. phototrophy d. diminished or no cell walls e. endospore formation ANS: D DIF: Medium REF: 18.7 OBJ: 18.7a Compare and contrast Chlamydiae, Planctomycetes, and Verrucomicrobia MSC: Remembering 51. Some Gram-negative bacteria branch more deeply from the proteobacteria than the five Greek-lettered classes do from each other. Which phyla listed below is deep-branching Gram-negative? a. Thermotogo d. Protobacteria b. Aquifex e. Chlorobi c. Flavobacteria ANS: D DIF: Medium REF: 18.5 OBJ: 18.5b Compare the deep-branching Gram-negative phyla to the proteobacteria MSC: Remembering SHORT ANSWER 1. What distinguishes bacterial cell walls from those in archaea and eukarya?

ANS: Most bacterial cells possess a cell wall of peptidoglycan. Peptidoglycan is composed of disaccharide-peptide chains that can cross-link in three dimensions; key enzymes that build the peptide links are blocked by antibiotics such as penicillin and vancomycin. Some archaea possess analogous sugar-peptide structures called ―pseudopeptidoglycan,‖ but their structural details and antibiotic sensitivity differ fundamentally from those of bacterial peptidoglycan. Eukaryotes such as fungi and plants have cell walls of polysaccharides such as cellulose and chitin.

DIF: Medium REF: 18.1 OBJ: 18.1a State unique traits bacteria share that distinguish them from archaea and eukarya MSC: Remembering 2. Why is it that the deep-branching thermophiles may appear to have diverged from other bacteria earlier than they actually did?

ANS: These organisms tend to have a very high mutation rate, which may be due in part to high rates of horizontal transfer. Together these characteristics may have accelerated their molecular clock, making them appear to have diverged much earlier than they actually did.

DIF: Medium thermophiles MSC: Evaluating

REF: 18.1

OBJ: 18.1d Recall traits of deep-branching

3. Describe three mechanisms cyanobacteria use to provide an anoxic environment for the oxygen-sensitive, nitrogen-fixation enzyme nitrogenase.

ANS: Some cyanobacteria form specialized nitrogen-fixing cells called heterocysts that exclude oxygen.

Some temporally separate photosynthesis (daylight hours) and nitrogen fixation (nighttime).

Formation of large aggregates provides a central area sufficiently anaerobic to permit nitrogen fixation, while oxygenic photosynthesis can occur at the exterior. Some cyanobacteria have symbiotic relationships with microbes or plants that either consume oxygen or contribute to maintaining anoxic conditions.

DIF: Easy REF: 18.2 OBJ: 18.2d Recall the functions of thylakoids, carboxysomes, gas vesicles, heterocysts, hormogonia, and akinetes | 18.2e Describe some of the symbiotic associations cyanobacteria form with other organisms MSC: Understanding 4. Discuss the chemical nature of mycolic acids and some of the traits they confer to organisms that possess them.

ANS: Mycolic acids are a diverse class of sugar-linked fatty acids. The mycolic acids of Mycobacterium tuberculosis include some of the longest chains known, reaching up to 90 carbons. The thick, dense layer of acids forms a waxy coat that impedes the entry of nutrients through porins and thus limits growth rate, but it also protects the bacterium from host defenses and antibiotics. For this reason, to cure tuberculosis requires an exceptionally long course of antibiotic therapy.

DIF: Medium REF: 18.3 MSC: Understanding

OBJ: 18.3b List pathogenic firmicutes

5. Describe the photosynthetic machinery of cyanobacteria.

ANS:

Cyanobacteria commonly appear green because of the predominant blue and red absorption by chlorophylls a and b. Essentially the same chlorophylls are found in plant chloroplasts, which evolved from internalized cyanobacteria. Some cyanobacteria, however, appear red because of the accessory pigment phycoerythrin, which absorbs blue-green light in a range missed by cyanobacterial chlorophylls. Cyanobacteria are the only prokaryotes that use both photosystems I and II, photolyzing water to produce oxygen. Under anoxic conditions, most cyanobacteria can also photolyze hydrogen, reduced sulfur compounds, and organic compounds.

DIF: Easy REF: 18.2 OBJ: 18.2b List traits that all cyanobacteria share and traits that differ among species MSC: Understanding 6. In order to learn what makes proteins stable in thermophilic bacteria, how should the amino acids or motifs that are involved in conferring thermostability to proteins be explored?

ANS: Thermostability of proteins can be determined by comparing the protein sequences of a thermophile with those of a related mesophile. The thermophilic sequence shows specific patterns of amino acid residues that confer thermostability. Such amino acid substitutions provide useful information for industrial engineering of enzymes.

DIF: Difficult REF: 18.3 OBJ: 18.3d Outline the research and industrial importance of various firmicute species such as Bacillales, Clostridiales, and lactic acid bacteria MSC: Evaluating 7. What bacterial groups use actin as a means to leave their host cells? What advantage does this type of cellular invasion provide to intracellular pathogens?

ANS: Listeria uses the host cell’s actin to break out and invade new cells. The bacteria multiply as they travel through the host cytoplasm, generating ―tails‖ of actin. The actin tails eventually project the cells of Listeria out of the original host cell and enable it to penetrate a neighboring host cell. Some rickettsias propel themselves through the host cell by polymerizing cytoplasmic actin behind them.

The actin tails eventually project outward as filopodia, extensions of host cytoplasm and membrane that protect the bacteria from host defenses while enabling them to invade adjacent cells.

DIF: Difficult REF: 18.3 | 18.4 OBJ: 18.3b List pathogenic firmicutes | 18.4b Name several prominent proteobacterial species from each of the five classes and state their importance MSC: Understanding 8. What is photoheterotrophy? Provide two examples.

ANS: Photoheterotrophy is a form of heterotropy that is modestly supplemented by light-generated ATP. It appears in several important classes of the proteobacteria, pointing to a photoheterotroph as a common ancestor. There is evidence that photosystems can be horizontally transferred among proteobacteria. Phototrophy is present in the proteobacteria (the text gives specific examples in the alpha- and betaproteobacteria) as well as the acidobacterial species Chloracidobaccterium thermophilum, Chloroflexi, and heliobacteria.

DIF: Medium REF: 18.1 | 18.3 | 18.4 | 18.5 OBJ: 18.1d Recall traits of deep-branching thermophiles | 18.3a Compare and contrast firmicutes and actinobacteria; identify shared traits and differences | 18.4a Describe the types of

energy-producing metabolic reactions present among proteobacteria | 18.5c Recall the main attributes of each of the five major deep-branching Gram-negative phyla MSC: Understanding 9. Describe the lifestyle and development of Streptomyces mycelia.

ANS: When a Streptomyces spore germinates, it extends vegetative mycelia, branched filaments that grow into the substrate. Some of the filaments then grow upward into the air, where they develop into aerial mycelia. The aerial mycelia in some species grow in tightly coiled spirals. As the mycelial colony runs out of nutrients, older cells of the filament age and lyse, releasing nutrients that are absorbed by the younger cells. As mycelia mature, they fragment into smaller cells called exospores (also called arthrospores). Exospores are vegetative cells, not dormant like Bacillus endospores. The exospores separate and are dispersed by the wind, enabling them to colonize a new location.

DIF: Difficult REF: 18.3 OBJ: 18.3h Describe the various morphologies of actinomycetes MSC: Understanding 10. What are oligotrophs? Provide two examples of oligotrophic bacteria.

ANS: Oligotrophs are organisms adapted to extremely low nutrient concentrations. Many aquatic and soil heterotrophs are oligotrophs, such as Caulobacter species. Some oligotrophs may have unusual shapes to enhance nutrient uptake such as the star-like cell aggregates of Seliberia stellata.

Planctomycetes are also oligotrophs, growing in aquatic, marine, and saline environments. Finally, most Verruco- microbia are oligotrophs, growing heterotrophically in low-salt habitats.

DIF: Medium REF: 18.4 | 18.7 OBJ: 18.4a Describe the types of energy-producing metabolic reactions present among proteobacteria | 18.7a Compare and contrast Chlamydiae, Planctomycetes, and Verrucomicrobia MSC: Understanding 11. After reading the news of an E. coli threat in the community, your family and friends ask you, ―Is E. coli a pathogen?‖ What would you answer?

ANS: Some strains of E. coli grow normally in the human intestine, feeding on our mucous secretions and producing vitamins, such as vitamin K. They may grow in symbiosis with anaerobic fermenters such as Bacteroides species, which release short-chain sugars that E. coli digests. But other strains, such as E. coli O157:H7, cause serious illness. A large proportion of the world’s children die of E. coli– related intestinal illness before the age of five. So, some strains are pathogenic, but others are not.

DIF: Medium REF: 18.4 OBJ: 18.4b Name several prominent proteobacterial species from each of the five classes and state their importance MSC: Understanding 12. The epsilonproteobacterium Helicobacter pylori is the cause of gastritis and stomach ulcers. What mechanism allows it to survive the acidic conditions of the mammalian stomach?

ANS:

H. pylori and related species grow primarily on the stomach epithelium, at about pH 6, which is less acidic than the gastric contents (pH 2–4). The bacteria bury themselves in the epithelial layer and neutralize their acidic surroundings by making urease enzyme, which converts urea to ammonia and carbon dioxide.

DIF: Medium REF: 18.4 OBJ: 18.4b Name several prominent proteobacterial species from each of the five classes and state their importance MSC: Understanding 13. How could nitrifiers be utilized in treatment of wastewater?

ANS: Nitrifiers oxidize ammonia to nitrite or nitrite to nitrate, thus decreasing the reduced nitrogen content of sewage.

DIF: Medium REF: 18.4 OBJ: 18.4b Name several prominent proteobacterial species from each of the five classes and state their importance MSC: Applying 14. How do Bacteroides fragilis and B. thetaiotaomicron contribute to 15% of human caloric intake?

Are there other benefits provided by these microbes to human health? Are they potentially pathogenic?

ANS: Their main source of energy is fermentation of a wide range of sugar derivatives from plant material, compounds that are indigestible by humans and potentially toxic. Bacteroides bacteria convert these substances into simple sugars and fermentation acids, some of which are absorbed by the intestinal epithelium. They break down potential toxins in plant foods, and they can also remove side chains from bile acids, enabling them to return to the hepatic circulation. If the intestine is wounded (as during a surgical procedure), Bacteroides species can escape the colon and invade surrounding tissues, where they can form anaerobic abscesses that are often impenetrable to antibiotics.

DIF: Difficult REF: 18.5 OBJ: 18.5c Recall the main attributes of each of the five major deep-branching Gram-negative phyla MSC: Understanding 15. Describe the metabolic characteristics of Chlorobium species.

ANS: Chlorobi are strict photolithotrophs, using PS I to split electrons from H2, H2S, or other reduced sulfur compounds. During the oxidation of sulfide, Chlorobium species deposit elemental sulfur extracellularly, forming attached sulfur globules. The chlorophyll reaction centers of Chlorobium are contained within chlorosomes associated with the cytoplasmic membrane, similar to chlorosomes of the deep-branching phylum Chloroflexi. The photopigment of Chlorobium is predominantly BChl c, which absorbs in the blue (460 nm) and near-infrared (750 nm), thus reflecting the middle range, brownish green.

DIF: Medium REF: 18.5 OBJ: 18.5c Recall the main attributes of each of the five major deep-branching Gram-negative phyla MSC: Understanding

16. What is unique about the genome of Borrelia species?

ANS: Borrelia species have multipartite genomes. Each species possesses a linear main chromosome of less than a million base pairs, plus a number of linear and circular plasmids. The reason for this unusual fragmentation of Borrelia genomes is unknown.

DIF: Medium REF: 18.6 MSC: Remembering

OBJ: 18.6b Outline spirochete diversity

17. Outline the process illustrated in the following figure.

ANS: Some clostridiales, such as members of the genera Metabacterium (shown in the figure) and Epulopiscium, have eliminated binary fission and duplicate through a form of ―live birth.‖ Endospores ingested from feces germinate in the upper intestine but rarely undergo binary fission.

Instead, the growing cell forms forespores at both poles. The forespores multiply within the mother cell to form several endospores, which ultimately emerge in ―live birth‖ from the mother cell, which then disintegrates.

DIF: Difficult REF: 18.3 OBJ: 18.3c Recall the function of endospores and which organisms produce them MSC: Analyzing 18. Describe the unique way in which spirochetes can be isolated from other environmental species.

What makes this possible?

ANS: The corkscrew motion of the cell body during spirochete motility turns out to have a physical advantage in highly viscous environments, such as human mucous secretions or agar culture medium. Few nonspirochetes can swim through agar at standard culture concentrations (1.5% agar); thus, growth within agar provides a way to isolate anaerobic spirochetes from environmental sources. When an environmental sample is inoculated into agar, other bacteria grow and concentrate at the injection point, whereas spirochetes migrate outward in a ―veil‖ through the agar.

DIF: Medium MSC: Applying

REF: 18.6

OBJ: 18.6c Summarize spirochete motility

19. Compare and contrast the double membrane found in Planctomycetes versus that found in the eukaryotic nucleus.

ANS: In the planctomycetes, a double membrane surrounds the entire nucleoid, analogous to the double membrane surrounding the eukaryotic nucleus—a remarkable example of independent analogous evolution between bacteria and the eukaryotes. The actual function of the nucleoid-surrounding membrane varies with different species; for example, in anammox planctomycetes, a single membrane enclosing the nucleoid contains the complexes conducting the anammox reaction.

DIF: Easy REF: 18.7 OBJ: 18.7c Describe the cell structures of Planctomycetes and Verrucomicrobia MSC: Understanding 20. Describe the cell wall of Verrucomicrobia. How could these organisms have acquired this trait?

ANS: Verrucomicrobia have peptidoglycan cell walls, but their shape is dominated by wart-like projections. The wart-like cytoskeleton appears to contain tubulin, a cytoskeletal protein previously believed to exist only in eukaryotes. Genes encoding tubulin were found in the partly sequenced genome of Prosthecobacter dejongeii, a free-living member of Verrucomicrobia. The genes appear so similar to those of eukaryotes that they must have undergone horizontal transfer from a eukaryotic genome.

DIF: Medium REF: 18.7 OBJ: 18.7c Describe the cell structures of Planctomycetes and Verrucomicrobia MSC: Understanding

CHAPTER 19: Archaeal Diversity MULTIPLE CHOICE 1. Members of order ________ in the human gut may couple with methanogens to provide the hydrogen gas for methanogenesis. a. Desulfurococcales d. Rhizobiales b. Thermococcales e. Enterobacteriales c. Clostridiales ANS: C DIF: Difficult REF: Special Topic 19.1 OBJ: 19.4c List the habitats, pH, and growth temperature ranges possible for methanogens MSC: Understanding 2. Which of the following is unique to archaea? a. pseudopeptidoglycan b. S-layers c. supercoiled DNA d. infection by double-stranded DNA viruses e. methanotrophs ANS: A DIF: Easy REF: 19.1 OBJ: 19.1a List traits shared by all archaea as well as unique archaeal traits that are not found in other domains of life | 19.1b Describe the structure of the archaeal cell envelope MSC: Remembering

3. ________-branched chains increase membrane stability. a. Isoprenoid d. Diether b. Ester e. Phospholipid c. Ether ANS: A DIF: Easy REF: 19.1 OBJ: 19.1b Describe the structure of the archaeal cell envelope MSC: Understanding 4. What causes the black color emitted from black smokers? a. ammonia dissolution d. elemental sulfur precipitation b. steep temperature gradients e. denitrification c. iron sulfide precipitation ANS: C DIF: Easy REF: 19.2 OBJ: 19.2a Recall the features of hot springs and geysers that impact the growth of microbes MSC: Understanding 5. Why do most hyperthermophiles tend to be anaerobic? a. Heated water dissolves high concentrations of sulfides and other reduced minerals. b. The pH of high temperature water prohibits aerobic respiration. c. All hyperthermophilic environments are deep beneath the sea. d. At higher temperatures, the oxygen concentration of water declines. e. Methanogenesis can only be performed anaerobically.

ANS: D DIF: Medium REF: 19.2 OBJ: 19.2a Recall the features of hot springs and geysers that impact the growth of microbes MSC: Understanding 6. What novel adaptation would you expect undersea vent archaea to have versus archaea growing at a similar temperature in terrestrial hot springs? a. barophily d. pseudopeptidoglycan b. thermophily e. positively supercoiled genome c. bacteriorhodopsin phototrophy ANS: A DIF: Difficult REF: 19.2 OBJ: 19.2d Predict which species of organisms could be found in particular environments MSC: Evaluating 7. The energy-yielding process of ________ occurs only in the archaea. a. fermentation d. methanogenesis b. sulfur oxidation e. anaerobic respiration c. hydrogen oxidation ANS: D DIF: Easy REF: 19.1 OBJ: 19.1a List traits shared by all archaea as well as unique archaeal traits that are not found in other domains of life | 19.1c Distinguish the types of metabolism found in archaea MSC: Remembering 8. Some hyperthermophilic archaea contain genomes with positive supercoiling generated by ________, which protect DNA from melting at high temperatures. a. helicase d. reductase b. polymerase e. reverse gyrase c. primase

ANS: E DIF: Easy REF: 19.1 OBJ: 19.1d Compare and contrast genome structure and regulation in archaea with those in bacteria and eukarya MSC: Understanding 9. Archaeosine is a guanosine analog found in archaeal a. rRNA. d. msRNA. b. mRNA. e. tRNA. c. DNA. ANS: E DIF: Easy REF: 19.1 OBJ: 19.1a List traits shared by all archaea as well as unique archaeal traits that are not found in other domains of life | 19.1d Compare and contrast genome structure and regulation in archaea with those in bacteria and eukarya MSC: Understanding 10. Pyrodictium species grow as networks interconnected by glycoprotein tubules called

a. cannulae. b. pili. c. fimbriae.

d. flagella. e. actin filaments.

ANS: A DIF: Medium REF: 19.2 OBJ: 19.2e List adaptations that favor growth in particular environments MSC: Remembering 11. The Haloarchaea, extreme ________, are the only form of life to grow in concentrated brine. a. thermophiles d. halophiles b. psychrophiles e. acidophiles c. methanophiles ANS: D DIF: Easy REF: 19.1 OBJ: 19.1a List traits shared by all archaea as well as unique archaeal traits that are not found in other domains of life MSC: Remembering 12. Which archaea uses light energy to drive a retinal-based ion pup to establish a proton potential? a. all archaea d. Haloarchaea b. hyperthermophilic Crenarchaeota e. Sulfolobales c. Methanobacteriales ANS: D DIF: Medium REF: 19.1 OBJ: 19.1c Distinguish the types of metabolism found in archaea MSC: Understanding 13. With respect to pH, the ________ show the widest range of any clade.

a. crenarchaeotes b. euryarchaeotes c. Ancient Archaeal Group

d. nanoarchaeotes e. methanogens

ANS: B DIF: Medium REF: 19.1 OBJ: 19.1e Name the three major phyla within the archaeal domain MSC: Understanding 14. The ________ have/has such divergent SSU rRNA that its/their sequence fails to amplify with ―standard‖ PCR primers. a. Crenarchaeota d. Ancient Archaeal Group b. Euryarchaeota e. Haloarchaea c. Thaumarchaeota ANS: D DIF: Easy REF: 19.1 OBJ: 19.1e Name the three major phyla within the archaeal domain | 19.1f Explain why archaeal phylogeny is challenging to piece together MSC: Understanding 15. The Sulfolobales includes species that respire by oxidizing a. sulfate. d. methane. b. carbon dioxide. e. sulfur. c. ammonia.

ANS: E DIF: Medium REF: 19.2 OBJ: 19.2d Predict which species of organisms could be found in particular environments MSC: Understanding 16. All types of methanogenesis are poisoned by ________ and therefore require extreme ________. a. carbon dioxide; aerobiosis d. pressure; vacuum b. oxygen; anaerobiosis e. high salinity; freshwater c. heat; cold ANS: B DIF: Medium REF: 19.4 OBJ: 19.4b Compare and contrast different types of methanogenesis MSC: Understanding 17. The coupling of energy-spending electron transfer via CO2 reduction to an energy-yielding electron transfer via CoM-S-S-CoB reduction is called a. autotrophy. d. electron bifurcation. b. thermophily. e. methanotrophy. c. methanogenesis.

ANS: D DIF: Medium REF: 19.4 OBJ: 19.4b Compare and contrast different types of methanogenesis MSC: Understanding 18. Which organism has a periplasmic space containing membrane vesicles? a. Desulfurococcus sp. d. Methanothermus sp. b. Ignicoccus sp. e. Pyrodictium sp. c. Methanosarcina sp.

ANS: B DIF: Medium REF: 19.2 OBJ: 19.2b Describe the cell structure and metabolism of Desulfurococcales species MSC: Remembering 19. Which of the following is a glycerol diphytanyl diether containing a six-membered cyclic ring?

a. Crenarchaeol b. Euryarchaeol c. Nanoarchaeol

d. Korarchaeol e. Methanoarchaeol

ANS: A DIF: Medium REF: 19.3 OBJ: 19.3a Compare and contrast Thaumarchaeota and Crenarchaeota MSC: Remembering 20. Which of the following species is aerobic? a. Aeropyrum b. Thermococci c. Thermosphera

d. Pyrococcus e. Sulfolobus

ANS: A DIF: Medium REF: 19.2 OBJ: 19.2b Describe the cell structure and metabolism of Desulfurococcales species | 19.2d Predict which species of organisms could be found in particular environments MSC: Remembering 21. Which of the following Crenarchaeota grows as disks linked by cannulae? a. Aeropyrum pernix d. Thermosphaera aggregans b. Desulfurococcus mobilis e. Pyrodictium brockii c. Ignicoccus islandicus ANS: E DIF: Medium REF: 19.2 OBJ: 19.2c Outline the challenges associated with collecting and culturing microbes from black smoker habitats MSC: Remembering 22. Sulfolobus species are referred to as double ________, meaning they require high temperature and high acidity simultaneously. a. extremophiles d. hyperthermophiles b. thermophiles e. thermoacidophiles c. acidophiles ANS: A DIF: Easy REF: 19.2 OBJ: 19.2e List adaptations that favor growth in particular environments MSC: Understanding 23. The Sulfolobus species maintains an internal pH ________ that of its habitat. a. equivalent to b. higher than c. lower than d. variable enough that it cannot be measured against e. not determined to be different to ANS: B DIF: Easy REF: 19.2 OBJ: 19.2e List adaptations that favor growth in particular environments MSC: Understanding 24. Species of ________ secrete toxins deadly to other strains of the same genus. a. Sulfolobus d. Methanococcus b. Halobacterium e. Thermoplasma c. Nanoarchaeum ANS: A DIF: Medium REF: 19.2 OBJ: 19.2e List adaptations that favor growth in particular environments MSC: Remembering

25. The exceptionally small cell in the image shown below is an obligate symbiont to another archaeon and a member of the genus

a. Archaeoglobus. b. Ignicoccus. c. Pyrococcus.

d. Ferroplasma. e. Nanoarchaeum.

ANS: E DIF: Medium REF: 19.6 OBJ: 19.6a Compare and contrast extremophilic Euryarchaeota to other Euryarchaeota and to Crenarchaeota MSC: Understanding 26. The thaumarcheal ammonia oxidizers contribute to the global cycling of a. phosphorus. d. oxygen. b. nitrogen. e. hydrogen. c. sulfur.

ANS: B DIF: Easy REF: 19.3 OBJ: 19.3b Evaluate the importance of Thaumarchaeota in the global nitrogen cycle MSC: Understanding 27. Nitrosopumilus maritimus is able to oxidize a. nitrate. b. ammonia. c. sulfide.

d. sulfate. e. methane.

ANS: B DIF: Medium REF: 19.3 OBJ: 19.3b Evaluate the importance of Thaumarchaeota in the global nitrogen cycle MSC: Remembering 28. Methanogenesis includes a unique pathway of carbon fixation, called the carbon monoxide ________ pathway, because the key enzyme can fix CO as well as CO2. a. gyrase d. reductase b. helicase e. dismutase c. polymerase ANS: D DIF: Medium REF: 19.1 | 19.4 OBJ: 19.1c Distinguish the types of metabolism found in archaea | 19.4b Compare and contrast different types of methanogenesis MSC: Understanding 29. Methanogens are classified within how many major orders? a. one d. four

b. two c. three

e. five

ANS: E DIF: Medium REF: 19.4 OBJ: 19.4a Propose two explanations for why methanogens appear in several deeply branching clades of Euryarchaeota | 19.4b Compare and contrast different types of methanogenesis MSC: Remembering 30. In wastewater, the bacteria are packed together by filamentous ________ to form sludge.

a. halophiles b. thermophiles c. methanogens

d. psychrophiles e. acidophiles

ANS: C DIF: Easy REF: 19.4 OBJ: 19.4c List the habitats, pH, and growth temperature ranges possible for methanogens | 19.4d Recall the cell shapes and cell wall structures found in methanogens MSC: Remembering 31. The major environmental location of methanogens is a. landfills. d. anaerobic wetlands soil. b. ruminant digestive tracts. e. marine floor sediment. c. human digestive tracts.

ANS: D DIF: Easy REF: 19.4 OBJ: 19.4c List the habitats, pH, and growth temperature ranges possible for methanogens MSC: Understanding 32. Bovine ________ not only make a significant contribution to global methane, but also divert carbon from meat production. a. halophiles d. thermophiles b. acidophiles e. methanogenes c. autotrophs ANS: E DIF: Easy REF: 19.4 OBJ: 19.4c List the habitats, pH, and growth temperature ranges possible for methanogens MSC: Understanding 33. Which of the following influences the fermentation efficiency of the gut flora? a. pathogens d. methanogens b. bacteria e. halophiles c. eukarya ANS: D DIF: Easy REF: 19.4 OBJ: 19.4b Compare and contrast different types of methanogenesis MSC: Remembering

34. Which of the following coenzymes is NOT specific for methanogenesis? a. methanofuran (MFR) b. tetrahydromethanopterin (H4MPT) c. cofactor F420 (F420) d. nicotinamide adenine dinucleotide (NAD) e. coenzyme M (CoM) ANS: D DIF: Difficult REF: 19.4 OBJ: 19.4e Explain the biochemistry of methanogenesis and differentiate the methanogenic pathways MSC: Remembering 35. In methanogenesis from CO2 and H2, ________ is hydrogenated and deoxygenated in a stepwise fashion. a. hydrogen d. carbon dioxide b. methane e. carbon c. oxygen ANS: D DIF: Medium REF: 19.4 OBJ: 19.4e Explain the biochemistry of methanogenesis and differentiate the methanogenic pathways MSC: Understanding 36. In methanogenesis from CO2 and H2, the initial incorporation of H2 requires a coupled gradient of which ion? a. sodium d. magnesium b. potassium e. molybdenum c. iron ANS: A DIF: Difficult REF: 19.4 OBJ: 19.4e Explain the biochemistry of methanogenesis and differentiate the methanogenic pathways MSC: Remembering 37. In the haloarchaea, the red pigment bacterioruberin protects cells from damage by a. light. d. acid. b. salt. e. cold. c. heat.

ANS: A DIF: Easy REF: 19.5 OBJ: 19.5b Summarize adaptations that allow halophilic Euryarchaeota growth in high salt MSC: Understanding 38. Which of the following uses light to generate a proton gradient in the haloarchaeotes? a. bacteriorhodopsin d. methanofuran b. bacterioruberin e. ferredoxin c. halorhodopsin ANS: A DIF: Medium REF: 19.5 OBJ: 19.5d Explain how retinal-based photoheterotrophy metabolism functions MSC: Understanding 39. Which is the model haloarchaeon for molecular biology education? a. Haloarcula d. Halobacterium b. Haloquadra e. Halococcus c. Halorubrum ANS: D

DIF: Easy

REF: 19.5

OBJ: 19.5c List the cell shapes, pH, and growth temperature ranges currently known for halophilic Euryarchaeota MSC: Remembering 40. Which of the following contains saturated salts of essentially the same ionic proportions as the ocean? a. thalassic lakes d. undersea brine pools b. athalassic lakes e. underground salt deposits c. solar salterns ANS: A DIF: Medium REF: 19.5 OBJ: 19.5c List the cell shapes, pH, and growth temperature ranges currently known for halophilic Euryarchaeota MSC: Understanding 41. Commercial evaporation pools for salt production benefit from the presence of red ________, whose light absorption accelerates heating and evaporation. a. methanogens d. haloarchaea b. Sulfolobus e. thermophiles c. acidophiles ANS: D DIF: Easy REF: 19.5 OBJ: 19.5a Evaluate different habitats for their ability to support halophilic Euryarchaeota growth MSC: Remembering 42. All of the rhodopsins in the haloarchaeotes have how many alpha helical transmembrane domains? a. one d. seven b. three e. nine c. five ANS: D DIF: Difficult REF: 19.5 OBJ: 19.5d Explain how retinal-based photoheterotrophy metabolism functions MSC: Remembering 43. Bacteriorhodopsin absorbs light and pumps H ________ the cell, whereas light-activated halorhodopsin pumps chloride ________ the cell. a. into; out of d. out of; out of b. out of; into e. through; across c. into; into ANS: B DIF: Medium REF: 19.5 OBJ: 19.5d Explain how retinal-based photoheterotrophy metabolism functions MSC: Understanding 44. Which of the following is responsible for movement away from DNA-damaging light? a. bacteriorhodopsin d. sensory rhodopsin II b. halorhodopsin e. sensory rhodopsin III c. sensory rhodopsin I ANS: D DIF: Difficult REF: 19.5 OBJ: 19.5b Summarize adaptations that allow halophilic Euryarchaeota growth in high salt MSC: Understanding 45. Haloarchaea can regulate their buoyancy through the production of a. contractile vacuoles. d. gas vesicles. b. pigments. e. carbon dioxide.

c. salt.

ANS: D DIF: Easy REF: 19.5 OBJ: 19.5e Recall the structure and function of gas vesicles

MSC: Remembering

46. Archaeoglobus fulgidus conserves energy by sulfate respiration, which drives a unique acetyl-CoA degradation pathway involving the reversal of a. methanogenesis. d. the TCA cycle. b. glycolysis. e. electron transport. c. flagella rotation.

ANS: A DIF: Medium REF: 19.6 OBJ: 19.6c Describe the metabolism of Archaeoglobus

MSC: Understanding

47. Which of the following is an extreme acidophile found anchored to deposits of pyrite ore in mines? a. Thermus aquaticus d. Picrophilus torridus b. Pyrococcus abyssi e. Thermoplasma acidophilum c. Ferroplasma acidarmanus ANS: C DIF: Difficult REF: 19.6 OBJ: 19.6a Compare and contrast extremophilic Euryarchaeota to other Euryarchaeota and to Crenarchaeota MSC: Remembering 48. Most organisms of the order ________ lack both a cell wall and an S-layer. a. Archaeoglobales d. Methanobacteriales b. Thermoplasmatales e. Methanococcales c. Halobacteriales ANS: B DIF: Medium REF: 19.6 OBJ: 19.6d Explain what is unusual about the cell structure of Thermoplasmatales MSC: Remembering 49. Nanoarchaeum equitans is a hyperthermophilic symbiont of a. Ignicoccus. d. Methanococcus. b. Sulfolobus. e. Thermoplasma. c. Halobacterium.

ANS: A DIF: Medium REF: 19.6 OBJ: 19.6a Compare and contrast extremophilic Euryarchaeota to other Euryarchaeota and to Crenarchaeota MSC: Remembering 50. Thermococcales can utilize elemental sulfur as a terminal electron acceptor for anaerobic respiration, yielding ________ as a by-product. a. H2SO4 d. thiosulfate b. S0 e. ammonia c. H2S ANS: C DIF: Medium REF: 19.6 OBJ: 19.6b Appraise the scientific importance of Thermococcales MSC: Understanding SHORT ANSWER 1. Elizabeth Hansen and colleagues suggested which two factors contribute to methanogen presence in human gut microbiomes? What evidence supports these claims?

ANS: Hansen et al. showed that there is a genetic propensity toward methanogenic communities by studying pairs of monozygotic twins (identical) to dizygotic twins (fraternal). Similarities in only identical twins suggest that genetics plays a part. They also showed, through microbiome metagenome sequencing, that twenty-two different bacterial clades (twenty of them Clostridiales) were also correlated to the presence of specific methanogens, suggesting that the presence of these bacterial groups facilitates the methanogen population.

DIF: Medium REF: Special Topic 19.1 OBJ: 19.4c List the habitats, pH, and growth temperature ranges possible for methanogens MSC: Understanding 2. What are some of the unique features of archaeal gene regulation?

ANS: The genes encoding most archaeal proteins contain uninterrupted coding sequences, as in bacteria, but certain tRNA gene sequences are interrupted by introns (nontranslated sequence), similar to the tRNA introns found in eukaryotes. Furthermore, the archaeal apparatus for DNA and RNA polymerases, transcription factors, and protein synthesis show remarkable similarity to those of eukaryotes.

DIF: Medium REF: 19.1 OBJ: 19.1d Compare and contrast genome structure and regulation in archaea with those in bacteria and eukarya MSC: Understanding 3. Why are the archaea so difficult to classify?

ANS: Most archaea are uncultured and known solely through SSU rRNA sequence or through metagenomics. In addition, some deeply branching clades have such divergent SSU rRNA that their sequence fails to amplify with ―standard‖ PCR primers based on the most highly conserved regions of the gene.

DIF: Medium REF: 19.1 OBJ: 19.1f Explain why archaeal phylogeny is challenging to piece together MSC: Understanding 4. What is the function of the device shown in the following figure? Describe what major challenges this instrument overcomes.

ANS: The device is known as the ―Deep Aquarium‖ and it is used to culture organisms from undersea vents. Most vent organisms cannot survive transfer to a laboratory at sea level. These organisms must be kept at high pressure and temperature to ensure viability.

DIF: Medium REF: 19.2 OBJ: 19.2c Outline the challenges associated with collecting and culturing microbes from black smoker habitats MSC: Understanding 5. Describe some of the unique metabolic pathways found in archaea but not bacteria or eukarya.

ANS: Answers may vary. Some archaea use unique variations of the Entner-Doudoroff and Embden-Meyerhof-Parnas pathways to catabolize glucose. Methanogens use a process called methanogenesis, which is an energy-yielding process that results in the production of methane.

Haloarchaea can conduct phototrophy using retinal ion pumps, which contain bacteriorhodopsins instead of chlorophyll.

DIF: Difficult REF: 19.1 OBJ: 19.1a List traits shared by all archaea as well as unique archaeal traits that are not found in other domains of life MSC: Understanding 6. Compare and contrast the supercoiling in hyperthermophilic archaeal species with bacteria and eukaryotes. What is responsible for this feature, and what does it accomplish for these archaea?

ANS: Bacteria and eukaryotes have negatively supercoiled DNA, whereas the hyperthermophilic archaea have positively supercoiled DNA, which is introduced by a specialized reverse gyrase. The positive turns enhance the DNA’s stability, preventing the DNA from melting at high temperatures.

DIF: Medium REF: 19.1 OBJ: 19.1d Compare and contrast genome structure and regulation in archaea with those in bacteria and eukarya MSC: Analyzing 7. Describe two possible explanations for the deep branching position of multiple methanogenic clades in the euryarchaeotes.

ANS: Two possible explanations of this phylogeny would be (1) the ancestral euryarchaeote was a methanogen, but many descendant lineages lost the metabolism; or (2) divergent euryarchaeotes acquired the genes for methanogenesis later, independently by gene transfer.

DIF: Medium REF: 19.4 OBJ: 19.4a Propose two explanations for why methanogens appear in several deeply branching clades of Euryarchaeota MSC: Evaluating 8. Crenarchaeol is a biosignature for Thaumarchaeota. Describe its structure.

ANS: Crenarchaeol is found in all Thaumarchaeota, in varying levels. It is a distinctive tetraether lipid containing occasional six-membered cyclic rings.

DIF: Medium REF: 19.3 OBJ: 19.3a Compare and contrast Thaumarchaeota and Crenarchaeota MSC: Understanding 9. Why are hot springs and geysers important habitats for many crenarchaeotes?

ANS: Most crenarchaeotes are hyperthermophiles with unique metabolic capabilities. In hot springs, reduced minerals precipitate as the water cools and serve as rich energy sources for many crenarchaeotes. Many crenarchaeotes are anaerobes, and within the hot springs there is low oxygen content due to high temperatures. The steep temperature gradients around the springs allow different species to grow in different areas, causing a variegated pattern. Some hot springs also have acidic pHs, which benefits acidophilic crenarchaeotes.

DIF: Difficult REF: 19.2 OBJ: 19.2a Recall the features of hot springs and geysers that impact the growth of microbes MSC: Evaluating 10. Why has Sulfolobus been studied so much more extensively than many archaea, and what is known about it?

ANS: Sulfolobus has been extensively studied because it is relatively easy to culture and of interest as a double extremophile. It is both an acidophile and a thermophile. It has a tetraether membrane that is impermeable to protons, which is important in an acidic environment. It has an S-layer instead of a cell wall. It produces toxins that inhibit other strains of Sulfolobus. Its DNA has multiple origins of replication, and many archaeal viruses infect Sulfolobus.

DIF: Medium REF: 19.2 OBJ: 19.2e List adaptations that favor growth in particular environments MSC: Understanding 11. Discuss the genome and morphology of known archaeal viruses. Why are their genomes all similar in structure?

ANS:

All known archaeal viruses have double-stranded DNA genomes. This suggests that only double-stranded DNA is stable enough to survive at these temperatures. Spindle-shaped capsids are common in archaeal viruses but are never seen in bacteriophages.

DIF: Medium REF: 19.2 MSC: Understanding

OBJ: 19.2f State the structure of archaeal viruses

12. Explain how ammonia-oxidizing Thaumarchaeota gain energy and state the habitats in which they are found.

ANS: Ammonia-oxidizing Thaumarchaeota gain energy by oxidizing ammonia to nitrite (2NH3  3O2  2NO2  2H2O  2H). They can do this under extremely low ammonia concentrations. They are found in nitrogen-rich environments, such as industrial sludge, aquaria, oceans (especially the deep ocean), aquatic water, soils, and even in contact with human skin.

DIF: Medium REF: 19.3 OBJ: 19.3c Identify the habitats occupied by ammonia-oxidizing archaea MSC: Understanding 13. Where are methanogens found in nature? What are some of the problems they can cause in these habitats?

ANS: Methanogens are found in wetland soil and landfills. In landfills, methane can build up and cause explosions unless it is piped out. They can be found in the digestive systems of many organisms living as symbionts. Termites must aerate their mounds so methane does not build up.

Methanogens in the bovine rumen divert carbon from meat production and contribute to global warming. About 10% of human gut anaerobes are methanogens. Seabed methanogens generate large amounts of methane, which crystallize as methane gas hydrates.

DIF: Medium REF: 19.4 OBJ: 19.4c List the habitats, pH, and growth temperature ranges possible for methanogens MSC: Remembering 14. What are methane gas hydrates and where are they found? Discuss the idea of benthic mining.

ANS: Psychrophilic marine methanogens grow at or beneath the seafloor and generate large volumes of methane that seep up slowly from the sediment. Under the great pressure of the deep ocean, the methane becomes trapped as methane gas hydrates, which are crystalline materials in which methane molecules are surrounded by a cage of water molecules. The methane hydrates accumulate in vast quantities. Methane hydrates are of interest as a potential source of natural gas.

DIF: Difficult REF: 19.4 OBJ: 19.4c List the habitats, pH, and growth temperature ranges possible for methanogens MSC: Understanding 15. If a species of Ferroplasma is cultured on pyrite ore, what will they do to their surrounding environment?

ANS:

Ferroplasma use dissolved Fe3 as an oxidizing agent in the presence of H2O; they oxidize the sulfur to sulfuric acid. The chemical equation is FeS2  14 Fe3  8 H2O  15 Fe2  2 SO42  16 H.

The reaction will generate pH values below pH 0.

DIF: Difficult REF: 19.6 OBJ: 19.6b Appraise the scientific importance of Thermococcales MSC: Evaluating 16. Describe the physiological adaptations found in haloarchaea that compensate for the high internal potassium chloride concentrations.

ANS: Most of the haloarchaea have a GC content above 60%. The higher salt concentrations decrease the fidelity of base pairing, so the higher GC content may serve a protective function. Most haloarchaeal proteins are highly acidic, with a high density of negative charge at the protein surface. This tends to maintain a hydration layer in the form of hydrated potassium ions at the surface of the proteins, keeping the proteins soluble in the high-salt concentration of the cytoplasm.

DIF: Difficult REF: 19.5 OBJ: 19.5b Summarize adaptations that allow halophilic Euryarchaeota growth in high salt MSC: Understanding 17. If archaea are distinct from bacteria, why is the major haloarchaeal order called Halobacteriales, and why do most contain bacteriorhodopsin?

ANS: The order was named before the archaea were classified as distinct from bacteria. The name bacteriorhodopsin was chosen to reflect the fact that this was a prokaryotic version of the eukaryotic retinal-based proton pump. Again, the name was given before the distinction was made between the archaea and the bacteria.

DIF: Medium REF: 19.5 OBJ: 19.5d Explain how retinal-based photoheterotrophy metabolism functions MSC: Understanding 18. Discuss the role of the four different types of rhodopsins found in the Halobacterium species (bacteriorhodopsin, halorhodopsin, and sensory rhodopsins I and II).

ANS: Bacteriorhodopsin is a light-driven pump that pumps protons out of the cell. Halorhodopsin is very similar, except that it pumps chloride ions into the cell. The sensory rhodopsins absorb light and signal the chemotaxis motor, through histidine kinases that phosphorylate and dephosphorylate proteins, to regulate the direction of rotation of the flagellar motor. This is a phototaxic response to light. SRII senses blue light, which is damaging to DNA and causes the cell to tumble and change direction away from the light. SRI senses the favorable red light, which causes the cell to swim toward the light.

DIF: Difficult REF: 19.5 OBJ: 19.5d Explain how retinal-based photoheterotrophy metabolism functions MSC: Analyzing

19. What are ―vent polymerases,‖ why are they better than previously used polymerases, and from where are they acquired?

ANS: Vent polymerases are DNA polymerases that are isolated from hyperthermophilic organisms that live near submarine volcanic vents. These polymerases are used in the PCR procedure to copy DNA. They allow denaturation of template DNA at higher temperatures and are more accurate than the previously used Taq polymerase.

DIF: Medium REF: 19.6 OBJ: 19.6b Appraise the scientific importance of Thermococcales MSC: Understanding 20. What is the Ancient Archaeal Group and what is known about these organisms?

ANS: This is a deeply branching division of hyperthermophiles that have not been isolated in pure culture. They were discovered using PCR-amplified rDNA probes of environmental samples. The genome of Candidatus Korarchaeum cryptophilum from the Obsidian Pool has been sequenced. It grows in long filaments and its genes suggest that it gains energy from anaerobic peptide fermentation.

DIF: Medium REF: 19.6 OBJ: 19.6a Compare and contrast extremophilic Euryarchaeota to other Euryarchaeota and to Crenarchaeota MSC: Understanding

CHAPTER 20: Eukaryotic Diversity MULTIPLE CHOICE 1. All of the following are characteristics of eukaryotic organisms EXCEPT a. their cells possess a nucleus. b. all types of eukaryotic cells are surrounded by a cell wall. c. they are highly compartmentalized and have an endomembrane system. d. they include organisms with unicellular complex multicellular bodies or unicellular forms. e. they display aerobic respiration, although some are capable of phototrophy.

ANS: B DIF: Easy REF: 20.1 OBJ: 20.1a Recall the cell structures that are shared by all eukaryotes and are absent in prokaryotes MSC: Remembering 2. One of the smallest eukaryotes recently discovered, the green alga Ostreococcus tauri, measures less than ________ across and its genome (8 Mb) is ________ the size of that of Escherichia coli. a. 2 m; barely twice d. 1 m; three times b. 500 nm; half e. 100 m; five times c. 10 m; about ANS: A DIF: Easy REF: 20.1 OBJ: 20.1b List the major metabolic capabilities of eukaryotes 3. What type of metabolism do eukaryotes conduct? a. heterotrophy only b. oxygenic photosynthesis only

MSC: Remembering

c. oxygenic photosynthesis, heterotrophy, or both d. ethanolic fermentation e. mixed fermentation ANS: C DIF: Easy REF: 20.1 OBJ: 20.1b List the major metabolic capabilities of eukaryotes

MSC: Remembering

4. Which group has the widest range of form but the least diversity in terms of metabolism? a. archaea d. viruses b. eukaryotes e. prokaryotes c. bacteria ANS: B DIF: Easy REF: 20.1 OBJ: 20.1b List the major metabolic capabilities of eukaryotes

MSC: Understanding

5. The protozoa were considered to be microscopic animals because a. they are bigger than bacteria. d. some have proteinaceous cell walls. b. of their capacity to cause disease. e. some reproduce through conjugation. c. of their ability to move.

ANS: C DIF: Easy REF: 20.1 OBJ: 20.1c Differentiate among protozoa, algae, and protists

MSC: Understanding

6. The term ―protist‖ describes single-cell and colonial eukaryotic organisms other than a. paramecia. d. fungi. b. diatoms. e. amebas. c. dinoflagellates.

ANS: D DIF: Easy REF: 20.1 OBJ: 20.1c Differentiate among protozoa, algae, and protists

MSC: Remembering

7. The following are examples of challenges for classification of eukaryotes, EXCEPT a. eukaryotic chromosomes are located inside the nucleus. b. eukaryotes have experienced multiple endosymbiotic events. c. genome size and complexity has delayed completion of genomic sequences. d. for superficial similarity in form and habitat in distant taxa leading to convergent evolution. e. within a clade, some cells have lost structures through reductive evolution; others have not.

ANS: A DIF: Medium REF: 20.1 OBJ: 20.1d Explain why eukaryotic classification can be challenging MSC: Applying 8. Organisms in the ________ clade have lost their mitochondria through the process of reductive (degenerative) evolution. a. Alveolata d. Metamonada b. Heterokonta e. Discoba c. Opisthokonta ANS: D DIF: Medium REF: 20.1 OBJ: 20.1e Distinguish among major eukaryotic clades

MSC: Remembering

9. What distinguishes the Opisthokonta from other eukaryotic clades? a. an insertion coding for 11–17 amino acids in the elongation factor 1 gene b. the sequence of ribosomal RNA genes

c. the sequence of RNA polymerase II d. that some have a cell wall e. that they are obligate heterotrophs ANS: A DIF: Difficult REF: 20.1 OBJ: 20.1e Distinguish among major eukaryotic clades

MSC: Applying

10. Which organisms are considered the possible ―missing link‖ in the evolution from microbial eukaryotes to multicellular animals due to shared genes? a. metazoa d. choanoflagellata b. slime molds e. microsporidia c. eumycota ANS: D DIF: Medium REF: 20.1 OBJ: 20.1e Distinguish among major eukaryotic clades

MSC: Remembering

11. Which of the following is NOT a characteristic of fungi? a. They are chemolithotrophs. b. Most multicellular forms grow by extending multinucleate cell filaments called hyphae. c. Membrane lipids include ergosterol, an analog of cholesterol. d. Cell walls contain chitin. e. They engage in absorptive nutrition.

ANS: A DIF: Easy REF: 20.1 OBJ: 20.2b List the distinctive traits shared by most fungi

MSC: Remembering

12. The following are ecological roles of fungi in nature EXCEPT a. forming mycorrhizae that extend the root systems of plants and assimilate phosphorus. b. nitrogen fixation in legume nodules. c. recycling biomass of wood and leaves. d. digestion of lignin, a component of wood. e. fermentation of plant materials in the digestive tract of ruminants.

ANS: B DIF: Medium REF: 20.2 OBJ: 20.2a Assess the environmental and medical importance of fungi MSC: Applying 13. The structure below represents the polysaccharide ________, which is the main component of cell walls in ________.

a. cellulose; Viridiplantae b. murein; bacteria c. chitin; fungi

d. starch; photosynthetic protists e. hyaluronic acid; animals

ANS: C DIF: Easy REF: 20.1 OBJ: 20.2b List the distinctive traits shared by most fungi

MSC: Remembering

14. Which of the following is mismatched? a. Ascomycota—Penicillium, yeasts, fungal component of lichens b. Basidiomycota—Amanita, Licoperdon, Cryptococcus neoformans c. Chytridiomycota—Batrachochytrium dendrobatidis, Neocallomastix d. Zygomycota—saprophytes, insect parasites e. Microsporidia—arbuscular mycorrhizae ANS: E DIF: Medium REF: 20.2 OBJ: 20.2a Assess the environmental and medical importance of fungi | 20.2f Distinguish among Chytridiomycota, Zygomycota, Ascomycota, and Basidiomycota MSC: Remembering 15. Which of the following is NOT a common trait shared by most mycelium-forming fungi? a. absorptive nutrition d. chitinous cell walls b. hyphae production e. asexual reproduction by budding c. multinucleated cells ANS: E DIF: Easy REF: 20.2 OBJ: 20.2c Describe the structure and function of fungal hyphae MSC: Understanding 16. The figure below shows the cellular basis of extension of a fungal hypha. Which of the following is labeled correctly?

a. A—apical growth zone b. B—absorption zone c. C—vesicles

d. D—apical growth zone e. E—storage zone

ANS: A DIF: Medium REF: 20.2 OBJ: 20.2c Describe the structure and function of fungal hyphae MSC: Analyzing 17. In the organism Saccharomyces cerevisiae, which of the following induces alternation of generations from a haploid to a diploid cell? a. a 10C decrease in optimum growth temperature b. glucose abundance c. starvation stress d. nitrogen deprivation e. a pH change toward acidic conditions ANS: C DIF: Medium REF: 20.2 OBJ: 20.2d Recall specific species of unicellular fungi and their attributes MSC: Remembering 18. Neocallomastix sp. is/does NOT a. classified as a Chytridiomycota. b. an obligate aerobe. c. possess flagellated reproductive forms called zoospores.

d. contain hydrogenosomes evolved from mitochondria. e. ferment plant material in bovine rumen.

ANS: B DIF: Medium REF: 20.2 OBJ: 20.2f Distinguish among Chytridiomycota, Zygomycota, Ascomycota, and Basidiomycota MSC: Applying 19. The figure below shows the life cycle of an ascomycete. What is INCORRECTLY labeled?

a. b. c. d. e.

A—mitosis B—pairing of nuclei C—cytoplasmic fusion D—hyphae containing paired nuclei grow into mycelia E—nuclear fusion

ANS: A DIF: Easy REF: 20.2 OBJ: 20.2c Describe the structure and function of fungal hyphae MSC: Understanding 20. The oomycete (―water fungus‖) ________ caused the Great Irish Famine in the 1840s. a. Opalina sp. d. Amanita muscaria b. Tinea pedis e. Histoplasma capsulatum c. Phytophthora infestans ANS: C DIF: Easy REF: 20.2 OBJ: 20.2f Distinguish among Chytridiomycota, Zygomycota, Ascomycota, and Basidiomycota MSC: Remembering 21. Amanita phalloides makes -amanitin, a dangerous toxin that can be used in the laboratory for studies in molecular biology. What enzyme is inhibited by -amanitin? a. RNA polymerase II d. gyrase b. [H]-ATPase e. [Na/K]-ATPase c. DNA polymerase III ANS: A DIF: Medium REF: 20.2 OBJ: 20.2f Distinguish among Chytridiomycota, Zygomycota, Ascomycota, and Basidiomycota

MSC: Applying 22. Glomeromycota are obligate mutualists of plants a. that form fruiting bodies, such as basidiomycetes. b. and are considered pathogenic to more than 90% of all land plants. c. that form arbuscular mycorrhizae, in which fungal filaments surround the plant cell walls but do not penetrate them. d. that receive sugars from plants and provide ammonium and phosphate to plants. e. that form periarbuscular space within the fungi’s own cell wall.

ANS: D DIF: Easy REF: 20.2 OBJ: 20.2f Distinguish among Chytridiomycota, Zygomycota, Ascomycota, and Basidiomycota MSC: Remembering 23. Encephalitozoon intestinalis is an organism classified as a Microsporidia. It is of clinical importance because it a. causes severe allergic reactions in some people. b. causes trypanosomiasis. c. causes ringworm infections. d. is an opportunistic pathogen in immunocompromised individuals. e. infects catheters by producing biofilms.

ANS: D DIF: Medium REF: 20.2 OBJ: 20.2f Distinguish among Chytridiomycota, Zygomycota, Ascomycota, and Basidiomycota MSC: Remembering 24. The following are characteristics of primary algae EXCEPT that a. they are CO2-fixing producers. b. they all are single-celled organisms. c. they have a cell wall made up of glycoprotein or cellulose. d. chloroplasts are the result of a single endosymbiotic event. e. they include the major clades Chlorophyta and Rhodophyta.

ANS: B DIF: Easy REF: 20.3 OBJ: 20.3a Recall the traits shared by all algae

MSC: Remembering

25. Phytoplankton refers to a. heterotrophic bacteria present in aquatic and marine environments. b. mixotrophic algae and amebas present in aquatic environments. c. photosynthetic algae and bacteria present in aquatic and marine environments. d. heterotrophic algae, bacteria, and protists present in aquatic, marine, and terrestrial environments. e. photosynthetic algae and plants present in aquatic, marine, and terrestrial environments.

ANS: C DIF: Easy REF: 20.3 OBJ: 20.3a Recall the traits shared by all algae

MSC: Applying

26. Species in the genus ________ are unicellular green algae. a. Volvox d. Ulva b. Porphyra e. Chlamydomonas c. Spirogyra ANS: E DIF: Easy REF: 20.3 OBJ: 20.3a Recall the traits shared by all algae

MSC: Understanding

27. Which of the following algae reproduce by opposite mating filaments forming a cytoplasmic conjugate bridge to fuse cellular material? a. filamentous green algae (Spirogyra) b. sheet-forming red algae (Porphyra) c. unicellular green algae (Chlamydomonas) d. diatoms (Corethron) e. foraminiferans (Globigerinella) ANS: A DIF: Medium REF: 20.3 OBJ: 20.3d Describe the structural diversity found within the chlorophyte (green algae) clade MSC: Understanding 28. Some rhodophyta, or red algae, appear red due to the presence of the pigment a. chlorophyll a. d. phycoerythrin. b. chlorophyll b. e. anthocyanin. c. phycocyanin.

ANS: D DIF: Medium REF: 20.3 OBJ: 20.3d Describe the structural diversity found within the chlorophyte (green algae) clade MSC: Understanding 29. The structural characteristic that defines the clade Heterokonta is that they all a. inhabit the same ecological niche. b. rely exclusively on photosynthesis for metabolism. c. have or have had pairs of flagella of different shapes and lengths. d. have a bipartite shell called a frustule. e. move with similar locomotive structures.

ANS: C DIF: Easy REF: 20.3 OBJ: 20.3a Recall the traits shared by all algae

MSC: Analyzing

30. The figure below is a schematic representation of Chlamydomonas life cycle. What is INCORRECTLY labeled?

a. A— mitosis b. B—fusion of gametes

d. D—haploid asexual reproduction e. E—zoospores

c. C—sexual reproduction ANS: A DIF: Difficult REF: 20.3 OBJ: 20.3d Describe the structural diversity found within the chlorophyte (green algae) clade MSC: Understanding 31. Which of the following statements regarding pseudopods is NOT correct? a. The term ―pseudopods‖ means ―false feet.‖ b. Amoebozoa have lobe-shaped pseudopods. c. Lamellar pseudopods of amebas are similar to those generated by human leukocytes. d. Needlelike pseudopods are thin extensions reinforced by myosin polymers. e. The tip of a pseudopod contains a gel of polymerized actin beneath its cell membrane.

ANS: D DIF: Easy REF: 20.4 OBJ: 20.4a Describe the structures and functions of pseudopods MSC: Understanding 32. Ameboid movement is produced by a. cytoplasmic streaming into the extending pseudopodia. b. paired flagella formations extending off the cell membrane. c. cilia structures surrounding the cell. d. regulation of osmotic and gas vacuoles within the cytoplasm. e. barophilic pumps within the cell membrane.

ANS: A DIF: Easy REF: 20.4 OBJ: 20.4a Describe the structures and functions of pseudopods MSC: Understanding 33. Physarum polycephalum is a type of plasmodial slime mold that can be seen as a yellow mass growing on decaying wood. This organism produces a. a fruiting body in which individual cells remain unicellular. b. no fruiting bodies and no spore formations. c. a giant multinucleated cell that produces fruiting bodies. d. fruiting bodies within a calcified shell structure. e. no fruiting bodies and spores that move using pseudopodia.

ANS: C DIF: Easy REF: 20.4 OBJ: 20.4b Explain what causes slug formation in Dictyostelium discoideum | 20.4c Compare and contrast cellular slime molds and plasmodial slime molds MSC: Understanding 34. Which of the following is a signal for the slime mold Dictyostelium discoideum to switch from a unicellular state to an aggregate slug formation? a. bacterial cell wall components (e.g., LPS, teichoic acids) b. cyclic AMP c. high glucose concentrations d. increased light and warmth e. actin polymerization ANS: B DIF: Medium REF: 20.4 OBJ: 20.4b Explain what causes slug formation in Dictyostelium discoideum MSC: Analyzing 35. The slime mold Dictyostelium discoideum disperses spores fruiting body that are distributed by which means? a. water currents d. gravity

b. interacting with passing animals c. air currents

e. piezoelectric force

ANS: C DIF: Easy REF: 20.4 OBJ: 20.4b Explain what causes slug formation in Dictyostelium discoideum MSC: Understanding 36. Amebas that have filopodial movement structures can be found in which categories? a. trypanosomes and metamonads d. cellular and plasmodial slime molds b. diatoms and algae e. radiolarians and foraminiferans c. dinoflagellates and apicomplexans ANS: E DIF: Difficult REF: 20.4 OBJ: 20.4d Distinguish the cell structures of radiolarians and foraminiferans MSC: Remembering 37. Free living amebas are common soil predators that feed on bacteria, algae, rotifers, and so on.

However, some species may harbor bacterial pathogens such as ________, which contaminates water supplies and air ducts. a. Encephalitozoon intestinalis d. Legionella pneumophila b. Toxoplasma gondii e. Giardia lamblia c. Leishmania major ANS: D DIF: Medium REF: 20.4 OBJ: 20.4a Describe the structures and functions of pseudopods MSC: Applying 38. Paramecia beat their cilia in coordinated waves to a. distract and fool predators. b. move forward and acquire food. c. attach to immobile structures for filter feeding. d. deliver toxins to enemies. e. accumulate minerals for shell synthesis.

ANS: B DIF: Easy REF: 20.5 OBJ: 20.5a Recall what ties the alveolates together as a clade

MSC: Understanding

39. A major group of marine phytoplankton that is essential to the marine food chain includes a. microsporidia. d. metamonads. b. dinoflagellates. e. yeasts. c. apicomplexan.

ANS: B DIF: Easy REF: 20.5 OBJ: 20.5a Recall what ties the alveolates together as a clade

MSC: Remembering

40. Dinoflagellates are marine phototrophs responsible for the toxic red tide blooms. What pigments confer the red color to these organisms? a. rhodopsin d. chlorophylls b. tannins e. carotenoids c. anthocyanins ANS: E DIF: Easy REF: 20.5 OBJ: 20.5e Describe the cell structure and metabolism of dinoflagellates MSC: Understanding

41. Plasmodium falciparum is a(n) ________ and is transmitted to the human host by the bite of a ________. a. Apicomplexan; mosquito d. type of Trypanosome; mosquito b. type of Trypanosome; tsetse fly e. Apicomplexan; sand fly c. Apicomplexan; reduviid bug ANS: A DIF: Easy REF: 20.5 OBJ: 20.5f Explain why apicomplexans have undergone reductive evolution and what has been lost in the process MSC: Remembering 42. Schizogony refers to the life-cycle stage of ________ in Plasmodium falciparum, which is found in the ________ stage. a. mitotic reproduction and zygote development into spore-like form for transmission to next host; mosquito b. mitotic reproduction to achieve large population within the vertebrate host; liver c. meiotic reproduction to produce gametes; red-blood-cell d. mitotic reproduction and zygote development into spore-like form for transmission to next host; red-blood-cell e. meiotic reproduction to produce gametes; mosquito ANS: B DIF: Difficult REF: 20.5 OBJ: 20.5g Outline the life cycle of Plasmodium falciparum

MSC: Analyzing

43. New and emerging drug therapy targets for Plasmodium falciparum include a. spore-release inhibitors. d. hemoglobin protease inhibitors. b. uncoupling agents. e. cilia inhibitors. c. conjugation inhibitors.

ANS: D DIF: Difficult REF: 20.5 OBJ: 20.5g Outline the life cycle of Plasmodium falciparum

MSC: Applying

44. The apicomplexans have gone through extensive evolutionary reduction, in which the apicoplast has retained some genetic capabilities from an ancestral chloroplast in order to a. allow only for phototrophic dark reactions. b. produce low levels of ATP as backup metabolism. c. fix carbon dioxide only. d. absorb blue/green light only. e. participate in fatty acid metabolism.

ANS: E DIF: Difficult REF: 20.5 OBJ: 20.5f Explain why apicomplexans have undergone reductive evolution and what has been lost in the process MSC: Applying 45. Trypanosomes are a group of organisms that share which of the following characteristics? a. free-living aquatic parasites, round cell, no flagellum b. intestinal parasites, shelled cell structure with pseudopodia c. opportunistic parasites, multicellular with paired flagellum and apicoplast d. obligate parasites, elongated cell with single flagellum and a kinetoplast e. anaerobic parasites, single cellular structure with cilia ANS: D DIF: Easy REF: 20.6 OBJ: 20.6a Describe the cell structure of trypanosomes

MSC: Applying

46. A kinetoplast is ________ containing a bundle of multiple copies of its circular genome. a. a type of apicoplast d. in the pseudopodia cytoplasm

b. a relict chloroplast c. mitochondrion

e. inside a large chloroplast

ANS: C DIF: Easy REF: 20.6 OBJ: 20.6a Describe the cell structure of trypanosomes

MSC: Applying

47. Leishmania major causes a skin infection that can then disseminate to internal organs and is transmitted to a human host by a. drinking contaminated water. b. eating undercooked meat harboring the organism. c. skin contact with someone carrying the disease. d. bites from infected sand flies. e. sexual transmission.

ANS: D DIF: Easy REF: 20.6 OBJ: 20.6b List some diseases caused by trypanosomes

MSC: Applying

48. Leishmania major infection is most problematic in a. Central and South America. b. South America, Africa, the Middle East, and southern Europe. c. Sub-Saharan Africa. d. eastern Europe and Central Asia. e. the South Pacific.

ANS: B DIF: Medium REF: 20.6 OBJ: 20.6b List some diseases caused by trypanosomes

MSC: Applying

49. Giardia lamblia is an infectious problem in day-care centers because it is a(n) ________ pathogen passed via ________. a. intestinal; water-borne transmission b. aerosol; sneezing and coughing c. mucosal; mucus contamination d. skin; direct skin contact e. blood-borne; contact with an open wound ANS: A DIF: Medium REF: 20.6 OBJ: 20.6c Classify Giardia and summarize its life cycle

MSC: Applying

50. Which of the following is a mismatched pair? a. Trypanosoma brucei—sleeping sickness b. Trypanosoma cruzi—Chagas disease c. Balantidium coli—gastric ulcers d. Entameba histolytica—amebiasis e. Plasmodium falciparum—malaria ANS: C DIF: Easy REF: 20.6 OBJ: 20.6d Name some intestinal parasites MSC:

Understanding

SHORT ANSWER 1. Why are phylogenetic data in the domain Eukarya overall harder to obtain than phylogenetic evidence in either the Bacteria or Archaea domains? How has this affected the systematics of Eukarya?

ANS:

Eukaryotic genomes are much larger than those of prokaryotes and 50%–90% of their DNA can consist of noncoding sequences. As a result, it takes longer to sequence eukaryotic genes and, in addition, they are more challenging to annotate. Multiple events of endosymbiosis, reductive evolution events, convergent evolution, and gene fusions or deletions have occurred in the Eukarya domain, making the study of their phylogeny a more challenging task than it is for prokaryotic organisms.

DIF: Medium REF: 20.1 OBJ: 20.1d Explain why eukaryotic classification can be challenging MSC: Remembering 2. What are nanoeukaryotes and how has their discovery changed our understanding of biological systems?

ANS: Answers will vary.

Nanoeukaryotes are newly discovered organisms that are much smaller than a ―typical‖ eukaryotic cell. Despite their small size, they possess the characteristic compartmentalization of eukaryotic cells. For example, Ostreococcus tauri is a green alga that measures less than 2 m across, yet it contains a chloroplast, a mitochondrion, a nucleus, and Golgi. The discovery of nanoeukaryotes in extreme environments (e.g., extreme temperatures, pH, pressure, etc.), thought to only harbor extremophilic archaea or bacteria, will reshape our understanding of the structure and function of the eukaryotic cell.

DIF: Medium REF: 20.1 OBJ: 20.1a Recall the cell structures that are shared by all eukaryotes and are absent in prokaryotes MSC: Remembering 3. What are choanoflagellates and what is their importance in evolutionary studies?

ANS: Choanoflagellates are protists that alternate between unicellular free-living and multicellular colonial forms of interconnected cells. This ability to form complex colonies suggests that these microbial eukaryotes show the characteristics of early stage transition to multicellular organisms.

The transition from a unicellular flagellate to a multicellular animal could have occurred more than 600 million years ago. Phylogenetic data points to the Metazoan (multicellular animals) being monophyletic and sharing a common ancestor with single-celled choanoflagellates.

Morphologically, the collared cells of choanoflagellates closely resemble the choanocytes of sponges, a primitive animal form.

DIF: Medium REF: 20.1 clades MSC: Understanding

OBJ: 20.1e Distinguish among major eukaryotic

4. What are protists? What is the current status of the classification of protists? What is the difference between protozoa and protists?

ANS:

Historically, unicellular organisms that were motile and appeared (under microscope) animal-like were classified as protozoa. Motile chloroplast-containing organisms classified as algae and others, such as the slime molds, were classified originally with the fungi, but were more akin to the protozoa in terms of form and motility. In the second half of the twentieth century, the protozoa, unicellular algae, and undifferentiated colonial forms were classified as protists. Recent classification based on molecular phylogeny places the several protists in several clades, equidistant from each other as from multicellular eukaryotes animals and plants.

In contemporary terminology, protists are single-celled and colonial eukaryotes other than fungi, comprising many clades of protozoa and algae.

DIF: Medium REF: 20.1 OBJ: 20.1d Explain why eukaryotic classification can be challenging MSC: Understanding 5. Use the figure below and describe the differences between primary and secondary algae. Provide examples of both types.

ANS: Primary alga evolved from a single endosymbiosis event in which an ancestral cell engulfed a cyanobacterium. The host cell retained its nucleus [1] and the bacterial endosymbiont kept some of its original genome, but lost its cell wall and became a chloroplast. The host’s cell membrane, as it enclosed its prey, remained as the chloroplast outer envelope [2]. The cell membrane of the cyanobacterial endosymbiont remained a functional thylakoid [3]. The Chlorophyta (green algae) are an example of primary algae.

Secondary algae descend from protist ancestors that engulfed primary algae and retained their chloroplasts [4] in this second endosymbiosis. Therefore, in addition to the double membrane of chloroplasts in plants and green algae, the secondary algae have additional membrane envelopes surrounding the thylakoids [5]. Because the chloroplast was acquired from a eukaryotic cell, it kept a vestigial nucleus from the engulfed alga, a structure called the nucleomorph [6]. The protist host cell retained its own eukaryotic nucleus [7]. Examples of secondary algae are the Cryptophyta and Chrysophyta.

DIF: Difficult clades MSC: Evaluating

REF: 20.1

OBJ: 20.1e Distinguish among major eukaryotic

6. Why would an organism benefit from undergoing more than one endosymbiotic event throughout evolution? Give an example to support your argument.

ANS: Answers will vary.

Primary endosymbiosis includes events that lead to the formation of a mitochondrion (from an ancestral proteobacterium) or a chloroplast (from an ancestral cyanobacterium). If an organism with a mitochondrion were then to undergo a secondary endosymbiosis event with an organism containing a chloroplast, this new organism would gain two different mechanisms of energy production, namely photosynthesis and aerobic respiration. While primarily phototrophic, some diatoms can live in the absence of light using heterotrophy, assuming that an appropriate carbon source is available. This gives such organisms the advantage to easily adapt to multiple environments.

DIF: Difficult clades MSC: Analyzing

REF: 20.1

OBJ: 20.1e Distinguish among major eukaryotic

7. Why are sponges, jellyfish, worms, reptiles, humans, yeast, and microsporidia placed in the same eukaryotic clade?

ANS: Despite their inherent structural and functional differences, these organisms share two characteristics that demonstrate their evolutionary links. First, they share a unique short-sequence insertion in the translation elongation factor 1 gene that codes for 11–17 amino acids that are not present in EF 1 in other eukaryotic clades. Second, they share the structural feature of being uniflagellar or having a uniflagellar stage at some point in their life cycle. The name of the clade is Opisthokonta, which is Greek for ―pointing backward pole,‖ because the flagellum points backward like an oar.

DIF: Medium REF: 20.1 OBJ: 20.1d Explain why eukaryotic classification can be challenging MSC: Applying 8. The brewer’s yeast Saccharomyces cerevisiae has been called a ―single-celled‖ human because its genome of about 6,000 genes has many human homologs. Briefly describe three human cell processes that can be modeled using yeast.

ANS: Answers will vary. Being opisthokonts, S. cerevisiae and humans possess similar posttranslational modifications, so yeast can be used to clone and express human proteins to study folding, quality control, and intracellular degradation processes. For many years, S. cerevisiae has been used in studies of lipid biology and vesicular trafficking and fusion. The functions of lysosomes and nonplant peroxisomes have been studied in yeast. The establishment and regulation of programmed cell death processes, including apoptosis, have been studied in yeast as an easy-to-culture stand-in for human cells. Yeasts are amenable to study the regulation of the cell cycle in eukaryotes, specially opisthokonts, and the alternation of generations. Yeasts have been extensively used to study mitochondrial metabolism and oxidative stress.

DIF: Medium REF: 20.1 OBJ: 20.1a Recall the cell structures that are shared by all eukaryotes and are absent in prokaryotes MSC: Applying 9. Use the figure below to describe the process of hyphal extension in fungi.

ANS: In a growing fungal hypha, expansion occurs by vesicles moving along with the cytoplasm [1] and using with the cell membrane at the tip. Vesicles formed from the endoplasmic reticulum fuse in a Ca2-induced process [2]. The movement of cytoplasm toward the apical growth zone is driven by turgor pressure [3]. Once the vesicles reach the growing tip they fuse with the cell membrane [4].

Glucose and other nutrients [5] are absorbed from the surrounding medium (such as the cytoplasm of an invaded animal or plant) and enter through the absorption zone, eventually rendering anabolic precursors for growth. As the storage zone accumulates nutrients, the nucleus divides several times, eventually forming septa, thus compartmentalizing the cytoplasm. The turgor pressure driving the expansion process is regulated by release of protons through a [H]-ATPase [6] and K uniport uptake [7].

DIF: Difficult REF: 20.2 OBJ: 20.2c Describe the structure and function of fungal hyphae MSC: Analyzing 10. The Zygomycota taxon comprises saprophytes, mycorrhiza, and insect parasites. They are characterized by having nonmotile gametes that must grow toward each other to fuse and form a zygote (zygospore). Explain why this taxon is classified under the larger taxa of Opisthokonta, which includes organisms with flagellated reproductive cells.

ANS: Zygomycota falls under the true fungi (Eumycota). It is a heterotroph with either single-celled or nonmotile multicellular filaments called (hyphae) with chitin cell walls. True fungi are included in the Opisthokonta clade.

DIF: Medium REF: 20.2 OBJ: 20.2f Distinguish among Chytridiomycota, Zygomycota, Ascomycota, and Basidiomycota MSC: Understanding 11. Briefly describe the life cycle of Ascomyta and describe three ascomycetes that have been used in science or in the culinary arts.

ANS: Answers will vary.

The life cycle in ascomycetes includes a ―dikaryotic‖ phase in which each cell possesses a pair of separate nuclei, one from each parent (n n). This phase is generated by haploid mycelia in which male and female reproductive structures fuse but the nuclei do not. Instead, the paired nuclei undergo several mitotic divisions as they migrate into the growing mycelium. The paired nuclei eventually fuse (2n) in the mycelial tip, which then develop into asci. Each ascus undergoes meiosis and the haploid products (ascospores) segregate, reflecting the order in which the meiotic chromosomes separated.

In the 1940s, George Beadle and Edward Tatum used Neurospora, a bread mold, in their experimental work leading to the one gene–one protein model. In Neurospora the ascospores are aligned in rows, reflecting the ordered chromosomal tetrads. The patterns of the tetrads were used to demonstrate the segregation and independent assortment of chromosomes.

In species such as Morchella hortensis (morels) and Tuber aestivum (truffles), the asci are packed in large mushroom-like fruiting bodies. Ascospores are dispersed by animals, attracted by their flavor.

Aspergillus and Penicillium are also ascomycetes species and their small asexual fruiting bodies are called conidiophores for airborne spore dispersal. Penicillium is known for producing penicillin. Aspergillus is an opportunistic pathogen of immunocompromised patients.

DIF: Difficult REF: 20.2 OBJ: 20.2f Distinguish among Chytridiomycota, Zygomycota, Ascomycota, and Basidiomycota MSC: Applying 12. The Rhodophyta alga Porphyra is known to colonize aquatic environments deeper than the Chlorophyta algae Spirogyra. Why does this happen? What advantages does Porphyra have by inhabiting this niche?

ANS: The Rhodophyta, or red algae, are red due to the photosynthetic pigment phycoerythrin. This photosynthetic pigment absorbs light in the blue-green range. Blue and green wavelengths of light are able to penetrate deeper waters, so Rhodophyta algae can grow there. Deeper waters provide an environmental niche for red algae phototrophy without competition from the green algae.

DIF: Medium algae MSC: Applying

REF: 20.3

OBJ: 20.3c List the two major clades of primary

13. Use the figure below to describe the mechanism of pseudopod motility in Amoebozoa.

ANS: Movement by cytoplasmic streaming consists of a sol-gel transition, which takes place between the cortical cytoplasm (just beneath the cell surface) and the deeper interior cytoplasm. Microtubules serve as ―tracks‖ to transport actin dimers [1] in the cytoplasm (sol); this process uses ATP. The actin dimers polymerize (gel) at the pseudopod [2]. The pseudopod extends as the gel grows, pushing the membrane forward. The actin polymer rolls over like a tank tread [3] and the cell rotates down toward the substrate. As the actin polymer is pushed back deeper into the cytoplasm, it resolubilizes and the cycle repeats. Small areas of the membrane form projections to help the cell adhere to the substrate’s surface [4].

DIF: Medium REF: 20.4 OBJ: 20.4a Describe the structures and functions of pseudopods

MSC: Analyzing 14. Describe how the life cycle of the slime mold Dictyostelium discoideum is dependent upon prokaryotic organisms.

ANS: Haploid Dyctiostelium discoideum amebas may consume bacteria and divide asexually until food runs out. Starving ameba cells release cyclic AMP (cAMP) as an aggregation signal. Other amebas are attracted and aggregate. The amebas that join the aggregate start releasing their own cAMP, attracting even more amebas. The amebas pile on top of one another by the thousands to form slugs that can collectively migrate toward light and warmth. The aggregate slug forms a fruiting body (a spherical sporangium) that disperses spores on air currents. These spores can remain dormant for years, germinating when they detect a bacterial chemical signal. Although these stages in the life cycle described above are asexual, amebas of different mating types may fuse to form a diploid zygote that can undergo meiosis and restore the haploid number of chromosomes.

DIF: Difficult REF: 20.4 OBJ: 20.4b Explain what causes slug formation in Dictyostelium discoideum MSC: Understanding 15. The figure below depicts two paramecia during conjugation. Use the numbered arrows to briefly describe the steps in this phenomenon. The figure can be used to describe what happens in one of the cells.

ANS: Initially, two paramecia of different mating types form a cytoplasmic bridge. In each cell, the diploid (2n) micronucleus undergoes meiosis [1], forming four haploid (n) micronuclei. The macronucleus and three out of the four micronuclei disintegrate. The remaining haploid micronucleus undergoes mitosis [2] to form two daughter micronuclei. Cells exchange one of the daughter micronuclei [3] across the cytoplasmic bridge and fuse with their counterpart on the other cell [4], thus forming a 2n micronucleus in each cell. Micronuclei fissions and one transforms into the macronucleus [5].

DIF: Medium REF: 20.5 OBJ: 20.5d Classify Paramecium and describe its cell structure and reproduction MSC: Analyzing 16. Compare and contrast radiolarians and foraminiferans.

ANS: Answers will vary.

Amebas that form needlelike pseudopods form the clade Rhizaria, which includes the interesting shelled amebas known as radiolarians and foraminiferans. Both groups grow in marine and freshwater habitats. The shell (or test) in radiolarians is made of silica, which is perforated, allowing the pseudopods to radiate in all directions, hence the name ―radiolarian.‖ Foraminiferans have shells formed of calcium carbonate arranged as chambers laid down in a helical manner; the pseudopods extend from one opening in the most recent chamber.

The shells are part of reefs, sedimentary rock, and beach sand. Foraminiferans are indicators of oil deposits in geological strata, as the shells fossilize well and can be found in some rock types that are associated with fossil fuels.

DIF: Difficult REF: 20.4 OBJ: 20.4d Distinguish the cell structures of radiolarians and foraminiferans MSC: Applying 17. Use the figure below as a guide to describe the cycle of Plasmodium falciparum transmission between mosquito and human in malaria.

ANS: Plasmodium falciparum parasites are injected into the bloodstream from the salivary glands in an infected mosquito [1]. The sporozoites travel to the liver [2] and develop into merozoites that infect the red blood cells [3]. Penetration of red blood cells (RBC) occurs via the apical complex interacting with host cell surface receptors. Bursting of RBC release cell fragments that trigger the typical cyclic fevers of malaria. During the RBC stage, merozoites feed on hemoglobin, and may either undergo schizogony (mitotic reproduction of haploid forms to achieve large population within the host) or gamogony (mitotic reproduction and differentiation to form gametes [4], which are acquired by the bloodsucking mosquito). Fertilization takes place inside the mosquito [5]. The diploid zygote undergoes meiosis in the mosquito midgut to form haploid sporozoites [6], spore-like forms for transmission to the next human host.

DIF: Difficult REF: 20.5 OBJ: 20.5g Outline the life cycle of Plasmodium falciparum

MSC: Analyzing

18. Why are coral endosymbionts, known as zooxanthellae, important indicators of ocean health?

ANS: The name ―zooxanthellae‖ refers to the relationship between a dinoflagellate and reef-building corals. Zooxanthellae are vital to coral reef growth and are highly sensitive to temperature. Slight increases in ocean temperature due to global warming can cause coral bleaching, a term that refers to the expulsion of the zooxanthellae and loss of color of the host coral. Eventually, bleaching leads to the death of the coral, affecting surrounding habitats.

DIF: Medium REF: 20.5 OBJ: 20.5e Describe the cell structure and metabolism of dinoflagellates MSC: Applying 19. In the figure below, the letters A, B, and C represent the formation of Giardia intestinalis dormant cysts from trophozoites and back. Briefly describe the structure and life cycle of G. intestinalis.

What conditions lead to the formation of the cyst?

ANS: The parasite Giardia intestinalis (=G. lamblia) is a diplomonad, a term that refers to the presence of a double nucleus, and belongs to the larger group Metamonada. The metamonads are a major group of parasites and symbionts. They have adapted to their hosts’ anaerobic metabolism. Giardia does not have Golgi and their mitochondria, without DNA, are known as ―mitosomes.‖ The parasite is a few micrometers long, possesses four pairs of flagella, and has an adhesive disk that allows the active, feeding form (trophozoite) to attach to the intestinal epithelium and replicate [A].

If the parasite perceives stress, for example, by increases in bile concentration or a high intestinal pH, the organism encysts [B]. Cysts detach from the intestine and are expelled from the body.

After being ingested by a new host, a cyst emerges from dormancy and undergoes excystation [C]; stomach acid triggers differentiation into a trophozoite.

DIF: Medium cycle MSC: Evaluating

REF: 20.6

OBJ: 20.6c Classify Giardia and summarize its life

20. Describe how Trypanosoma brucei overwhelms the immune system of an infected animal host, and explain the possible current targets for drug therapy.

ANS:

Trypanosoma brucei causes the African sleeping sickness and is transmitted by the tsetse fly.

T. brucei multiplies in the bloodstream of the host animal. Repeated cycles of proliferation lead to death if the infection is left untreated. T. brucei possesses an extraordinary degree of antigenic variation. Its genome encodes about 200 different ―active‖ versions of the variant surface glycoprotein (VSG), which is the antigen that induces the immune response, and about 1,600 different ―silent‖ versions, which can recombine with ―active‖ VSG to make even further variations. By frequently generating new antigenic variations, the trypanosome exhausts the repertoire of antibodies, thus overwhelming the host’s immune system.

Because infection of humans requires the interconversion of T. brucei among several forms throughout its life cycle, the molecular basis for the conversion offers new targets for drug therapy.

DIF: Difficult trypanosomes MSC: Evaluating

REF: 20.6

OBJ: 20.6a Describe the cell structure of

CHAPTER 21: Microbial Ecology MULTIPLE CHOICE 1. The instrument shown in step 5 of the figure below is used for what metagenomics step?

a. DNA isolation b. DNA sequencing c. sample filtering

d. cell lysis e. sequence assembly

ANS: B DIF: Medium REF: 21.1 OBJ: 21.1c Outline the steps required to obtain metagenomic data MSC: Remembering 2. The Dutch microbiologist van Niel first demonstrated anoxygenic photosynthesis in soil and water bacteria. He generalized his work by hypothesizing that a. every molecule in nature can be used as a source of nitrogen by some microorganism. b. photosynthesis results in oxygen production. c. microbes are found in every environment on Earth. d. microbes cannot live deep within Earth. e. photosynthesis occurs deep within Earth.

ANS: C DIF: Easy REF: 21.2 OBJ: 21.2c Restate van Niel’s two hypotheses of microbial ecology MSC: Remembering 3. What does the following rarefaction curve NOT suggest about the samples?

a. b. c. d. e.

More soil sequences were collected.

Indoor air samples appear to be sequenced at enough depth.

Water samples were not sequenced at enough depth.

More sequencing should be done for these samples.

Soil samples were not sequenced at enough depth.

ANS: A DIF: Difficult REF: 21.1 OBJ: 21.1a Define metagenome, microbiome, operational taxonomic unit, and rarefaction curve MSC: Analyzing 4. Synechococcus, a cyanobacterium, is a free-living marine organism that fixes CO2 into biomass while producing molecular oxygen utilized by swarms of heterotrophic bacteria. Which of the following is the most likely habitat of this bacterium? a. euphotic zone of the pelagic environment b. the benthos c. the littoral zone d. lake sediments e. aphotic zone ANS: A DIF: Medium REF: 21.5 OBJ: 21.5a Compare the properties of the distinct regions of the marine habitat | 21.5f Outline the relationships present in a marine food web; include the role of viruses MSC: Evaluating 5. The following image illustrates a syntrophic relationship between an archaeon and a bacterium.

The technique used to generate this image was

a. light microscopy. b. transmission electron microscopy. c. metagenomics.

d. fluorescence in situ hybridization. e. atomic force microscopy.

ANS: D DIF: Medium REF: 21.1 OBJ: 21.1f Describe techniques that circumvent the limitations of metagenomic analysis MSC: Understanding

6. The term ―metagenome‖ was coined by Jo Handelsman and colleagues in 1998 to refer to a. shotgun cloning. b. screening of libraries for expression of genes. c. the DNA sequence obtained directly from a mixture of genomes. d. the DNA sequence taken directly from a colony. e. all uncultured organisms from a community.

ANS: C DIF: Easy REF: 21.1 OBJ: 21.1a Define metagenome, microbiome, operational taxonomic unit, and rarefaction curve MSC: Remembering 7. A rarefaction curve is the a. number of sequences generated from a metagenome. b. number of SSU rRNA sequences found in a metagenome. c. number of OTUs found as a function of increasing sample size. d. total number of OTUs from all combined genes in a metagenome. e. number of organisms in an environment.

ANS: C DIF: Difficult REF: 21.1 OBJ: 21.1a Define metagenome, microbiome, operational taxonomic unit, and rarefaction curve MSC: Understanding 8. What does functional annotation in metagenomic analysis involve? a. determining the number of species in the sample b. calculating the %GC in the metagenome c. finding homologs or recurring peptide motifs that infer the function of the sequence d. making contigs and scaffolds and assembling the sequence e. analyzing the RNA sequences to see what was transcribed ANS: C DIF: Medium REF: 21.1 OBJ: 21.1e Compare the approaches used for functional annotation MSC: Remembering 9. Which of the following is NOT true regarding food webs in ecosystems? a. Primary producers assimilate minerals into biomass. b. Primary producers absorb energy from outside the ecosystem. c. Grazers convert 10% of carbon back to carbon dioxide. d. Consumers convert 90% of biomass carbon to atmospheric CO2. e. All energy gained by an ecosystem is eventually lost as heat.

ANS: C DIF: Difficult REF: 21.2 OBJ: 21.2b Explain why all ecosystems require microbes | 21.2e Evaluate the roles of primary producers, consumers, and decomposers in food webs | 21.2f Distinguish different levels of consumers MSC: Understanding 10. The availability of oxygen and other electron acceptors is the most important determinant of the types of metabolism in a habitat. Which of the following is NOT true about anaerobic environments? a. They have slower rates of assimilation compared to aerobic habitats. b. Their rates of dissimilation are slower compared to aerobic environments. c. Microbes sometimes use minerals such as NO2- to oxidize organic compounds. d. Anaerobic microbial biomass far exceeds that of the oxygenated biosphere. e. Respiration of organic compounds is highly dissimilatory, reducing them to CO2.

ANS: E DIF: Difficult REF: 21.2 OBJ: 21.2h Describe the contributions of oxygen levels, pH, salinity, and temperature to metabolic processes MSC: Analyzing 11. Culturing methods often detect organisms that may be rare in the environment but prevail when nutrients appear. What are these typically called? a. weed organisms d. OTUs b. protists e. microbial dark matter c. rhizobia ANS: A DIF: Medium REF: 21.1 OBJ: 21.1b Propose questions that can only be answered with a metagenomics approach MSC: Remembering 12. Which of the following are the main consumers of biomass in the ocean? a. multicellular organisms d. heterotrophic bacteria b. fish and tube worms e. fungi c. protists and viruses ANS: C DIF: Difficult REF: 21.2 OBJ: 21.2e Evaluate the roles of primary producers, consumers, and decomposers in food webs | 21.2g Compare the importance of microbial producers and consumers to that of multicellular producers and consumers in both marine and terrestrial ecosystems MSC: Remembering 13. The algal and fungal interaction within a lichen would best be described as a. mutualism. d. amensalism. b. synergism. e. parasitism. c. commensalism.

ANS: A DIF: Easy REF: 21.3 OBJ: 21.3a Decide whether a particular symbiotic relationship is an example of mutualism, synergism, commensalism, amensalism, or parasitism | 21.3b Distinguish among mutualism, synergism, commensalism, amensalism, and parasitism MSC: Remembering 14. Lichens consist of an intimate mutualistic symbiosis between a fungus, an alga, and/or cyanobacteria. What is one primary role of the cyanobacteria in this association? a. protection of the symbionts d. recycling of waste products b. nitrogen fixation e. degradation of lignin c. decomposition of toxic compounds ANS: B DIF: Medium REF: 21.3 OBJ: 21.3c Identify the partners present in lichensMSC:

Understanding

15. Which step is NOT common for metagenomic processing and analysis? a. FISH d. contig assembly b. binning e. scaffold assembly c. functional annotation ANS: A DIF: Medium REF: 21.1 OBJ: 21.1c Outline the steps required to obtain metagenomic data | 21.1e Compare the approaches used for functional annotation MSC: Understanding 16. The relationship among endosymbiotic microbes in the termite gut that results in complex metabolic fluxes with a negative G, which would NOT happen for individual members, is called

a. mutualism. b. parasitism. c. exothermic association.

d. predation. e. syntrophy.

ANS: E DIF: Medium REF: 21.4 OBJ: 21.4a Define holobiont and syntrophy | 21.4b Describe the organisms in and functions of the termite hindgut microbiome MSC: Understanding 17. Metatranscriptomics is the study of ________ obtained from an environmental community. a. lipids d. DNA b. proteins e. RNA c. organisms ANS: E DIF: Easy REF: 21.1 OBJ: 21.1f Describe techniques that circumvent the limitations of metagenomic analysis MSC: Remembering 18. The ________ is a set of conditions, including its habitat, resources, and relations with other species of the ecosystem, that enable an organism to grow and reproduce. a. benthos d. metagenome b. environment e. resource requirement c. niche ANS: C DIF: Easy REF: 21.2 OBJ: 21.2a Define niche, biomass, and trophic levels

MSC: Remembering

19. In wetlands, Beggiatoa oxidize H2S for energy. Removal of H2S enables growth of other microbes for which H2S is toxic. However, Beggiatoa derives no benefit from these microbes. This interaction is an example of a. syntrophy. d. amensalism. b. mutualism. e. synergism. c. commensalism.

ANS: C DIF: Medium REF: 21.3 OBJ: 21.3a Decide whether a particular symbiotic relationship is an example of mutualism, synergism, commensalism, amensalism, or parasitism | 21.3b Distinguish among mutualism, synergism, commensalism, amensalism, and parasitism MSC: Understanding 20. The reactions on the right side of the following table occur only

a. under thermophilic conditions. b. under anaerobic conditions. c. deep within Earth’s crust.

d. under aerobic conditions. e. in the euphotic zone.

ANS: B DIF: Easy REF: 21.2 OBJ: 21.2h Describe the contributions of oxygen levels, pH, salinity, and temperature to

metabolic processes MSC: Remembering 21. Nonphotosynthetic ________ provide minerals and protection for lichen symbiotic partners. a. plankton d. fungi b. proteobacteria e. cyanobacteria c. algae ANS: D DIF: Easy REF: 21.3 OBJ: 21.3c Identify the partners present in lichensMSC:

Remembering

22. Thousands of species of microbes in the cow ________ ferment and break down plant material to small particles. a. rumen d. reticulum b. stomach e. intestine c. omasum ANS: A DIF: Easy REF: 21.4 OBJ: 21.4c Recall the names and functions of the four chambers of the rumen gut MSC: Remembering 23. Which region of marine habitat refers to the microscopic interface between water and air? a. pelagic zone d. aphotic zone b. neuston e. benthic zone c. euphotic zone ANS: B DIF: Easy REF: 21.5 OBJ: 21.5a Compare the properties of the distinct regions of the marine habitat MSC: Remembering 24. The depth of the photic zone at the coastal shelf of marine habitats is a. 100–200 m. d. about 0.1 m. b. 10–20 m. e. about 2 m. c. about 1 m.

ANS: C DIF: Medium REF: 21.5 OBJ: 21.5a Compare the properties of the distinct regions of the marine habitat MSC: Understanding 25. Animal intestinal microbiota typically yields ________, which the host animal can absorb and digest to completion through aerobic respiration. a. celluloses d. polysaccharides b. CO2 e. short-chain fatty acids c. oligosaccharides ANS: E DIF: Difficult REF: 21.4 OBJ: 21.4d Compare and contrast the termite, cow, and human gut microbiomes MSC: Understanding 26. Much of the microbial fermentation in humans occurs in the a. stomach. d. small intestine. b. colon. e. esophagus. c. rumen.

ANS: B DIF: Medium REF: 21.4 OBJ: 21.4e State some contributions of the commensal gut microbiome to human health MSC: Remembering

27. A holobiont is defined as an a. organism that benefits while providing no benefit or a hidden benefit to its host. b. interaction that harms one partner nonspecifically without an intimate symbiosis. c. organism that forms an intimate relationship with another, where both benefit. d. entity composed of multiple types of organisms, including microbes. e. intimate relationship in which one member benefits while harming a host.

ANS: D DIF: Difficult REF: 21.4 OBJ: 21.4a Define holobiont and syntrophy

MSC: Understanding

28. Which of the following plays an important role in keeping the water column clear enough for the penetration of light? a. algae d. invertebrates b. bacteria e. viruses c. fish ANS: E DIF: Difficult REF: 21.5 OBJ: 21.5f Outline the relationships present in a marine food web; include the role of viruses MSC: Remembering 29. All of the following are likely to be found among the benthic microbes EXCEPT a. barophiles. d. phototrophs. b. psychrophiles. e. methanogens. c. thermophiles.

ANS: D DIF: Medium REF: 21.5 OBJ: 21.5a Compare the properties of the distinct regions of the marine habitat MSC: Analyzing 30. The flame-like vertical forms and breakaway pieces of mat in ice-covered Antarctic lakes are caused by

a. limited light penetration in the lake. b. denitrification. c. sulfur-reducing bacteria.

d. oxygen production. e. freeze-thaw cycles.

ANS: D DIF: Medium REF: Special Topic 21.1 OBJ: 21.5g Recall the properties of the different regions of freshwater habitats MSC: Understanding 31. The ________ region of an oligotrophic lake extends to about 10 meters below the surface. a. neuston d. hypolimnion

b. benthic c. epilimnion

e. euphotic

ANS: C DIF: Medium REF: 21.5 OBJ: 21.5g Recall the properties of the different regions of freshwater habitats MSC: Understanding 32. Which of the following refers to the zone of a lake with higher relative oxygen concentrations? a. neuston d. hypolimnion b. epilimnion e. benthos c. thermocline ANS: B DIF: Easy REF: 21.5 OBJ: 21.5g Recall the properties of the different regions of freshwater habitats MSC: Understanding 33. Lakes that have dilute concentrations of nutrients are termed a. eutrophic. d. oligotrophic. b. syntrophic. e. atrophic. c. aphotic.

ANS: D DIF: Easy REF: 21.5 OBJ: 21.5h Identify factors that lead to eutrophic conditions and compare eutrophic lakes to oligotrophic lakes MSC: Remembering 34. Eutrophic lakes typically support ten times the microbial concentrations of an oligotrophic lake.

Which of the following statements is NOT true of eutrophic lakes? a. Biochemical oxygen demand is high. b. Population of aquatic animals is high. c. Nitrogen and phosphorous levels are usually high. d. Photosynthetic activities are altered. e. Algal blooms are common.

ANS: B DIF: Medium REF: 21.5 OBJ: 21.5b Identify factors that control the biochemical oxygen demand (BOD) | 21.5h Identify factors that lead to eutrophic conditions and compare eutrophic lakes to oligotrophic lakes MSC: Understanding 35. The high biological oxygen demand that accompanies algal bloom in eutrophic lakes increases the span of the ________ zone. a. oxygenic epilimnion d. anoxic benthic b. anoxic hypolimnion e. oxygenic neuston c. coastal shelf ANS: B DIF: Medium REF: 21.5 OBJ: 21.5b Identify factors that control the biochemical oxygen demand (BOD) | 21.5h Identify factors that lead to eutrophic conditions and compare eutrophic lakes to oligotrophic lakes MSC: Understanding 36. Compared to eutrophic lakes, the biochemical oxygen demand, or BOD, of oligotrophic lakes is a. low. d. unpredictable. b. similar. e. extremely high. c. high.

ANS: A DIF: Medium REF: 21.5 OBJ: 21.5b Identify factors that control the biochemical oxygen demand (BOD) | 21.5h Identify

factors that lead to eutrophic conditions and compare eutrophic lakes to oligotrophic lakes MSC: Remembering 37. A graduate student filtered a liter of seawater using a Millipore filter membrane of 2 m pore size.

Her filtrate a. is sterile. d. contains nanoplankton. b. contains microplankton. e. contains all plankton. c. contains picoplankton.

ANS: C DIF: Difficult REF: 21.5 OBJ: 21.5e Contrast the different ways of measuring planktonic community population size MSC: Understanding 38. Bacteria found growing in between crystals of solid bedrock as deep as 3 km below Earth’s surface are called a. endophytes. d. decomposers. b. symbionts. e. saprophytes. c. endoliths.

ANS: C DIF: Medium REF: 21.6 OBJ: 21.6b State the properties of the different soil horizons; include microbes typically found in each layer MSC: Remembering 39. Which of the following is responsible for the characteristic odor of soil? a. Vibrio sp. d. Staphylococcus sp. b. Bacillus sp. e. Pseudomonas sp. c. Streptomyces sp.

ANS: C DIF: Easy REF: 21.6 OBJ: 21.6a Justify the importance of understanding the soil and plant microbial communities MSC: Remembering 40. Which term represents the region of soil influenced by plant roots?

a. stele b. cortex c. root cap

d. rhizoplane e. rhizosphere

ANS: E DIF: Easy REF: 21.6 OBJ: 21.6c Outline the relationships in the soil food web

MSC: Remembering

41. Fungi play a much larger and more significant role in the decomposition of terrestrial biomass than they do in marine ecosystems. This is because fungi a. do not thrive in a marine environment. b. outcompete bacteria in terrestrial habitats. c. can degrade the abundant lignin in terrestrial habitats. d. decompose leghemoglobin rapidly. e. degrade human waste faster than bacteria.

ANS: C DIF: Difficult REF: 21.6 OBJ: 21.6c Outline the relationships in the soil food web | 21.6h Categorize different types of fungus–plant interactions MSC: Understanding 42. Lignin decomposition forms a. arbuscules. b. detritus. c. fruiting bodies.

d. humus. e. rhizopus.

ANS: D DIF: Easy REF: 21.6 OBJ: 21.6c Outline the relationships in the soil food web

MSC: Remembering

43. Most forest trees require mycorrhizae for growth because a. forest soils are rich in phosphorous. b. mycorrhizae limit toxic metal uptake. c. the mycorrhizal form an ammensalic association. d. mycorrhizae significantly increase the uptake of nutrients. e. forest trees do not have deep roots.

ANS: D DIF: Medium REF: 21.6 OBJ: 21.6h Categorize different types of fungus–plant interactions MSC: Understanding 44. Rhizosphere bacteria benefit their host plant by a. degrading plant lignin. b. attracting symbiotic nematodes. c. improving water uptake. d. producing large amounts of photosynthate. e. discouraging growth of plant pathogens.

ANS: E DIF: Medium REF: 21.6 OBJ: 21.6h Categorize different types of fungus–plant interactions MSC: Understanding 45. Vascular abuscular mycorrhizae (VAM) are an example of which of the following? a. ectomycorrhizae d. lignin decomposer b. endomycorrhizae e. nitrogen fixer c. free-living fungus ANS: B DIF: Difficult REF: 21.6 OBJ: 21.6d Compare and contrast ectomycorrhizae and endomycorrhizae MSC: Remembering 46. One of the most important ecological roles of the Florida Everglades is that

a. b. c. d. e.

it is home to beautiful birds. it filters much of the water supply for Florida communities. many bacteria reside in it. nutrients can easily be leached to the lakes. tourists come to see it in large numbers.

ANS: B DIF: Medium REF: 21.6 OBJ: 21.6g Explain why wetlands are among the most productive ecosystems MSC: Understanding 47. Which of the following organisms forms a specific mutualistic association with legumes? a. rhizobia d. morels b. agrobacteria e. Vibrio sp. c. E. coli ANS: A DIF: Easy REF: 21.6 OBJ: 21.6e Recall the benefits endophytes provide to plants and how endophytes impact humans | 21.6f Summarize the colonization of legumes by rhizobia MSC: Remembering 48. In the legume-rhizobium symbiosis, nitrogen fixation is carried out in nodules by a. bacteroids that lack a cell wall. b. intact rhizobia in the plant cortex. c. plant cells in the presence of symbiotic bacteria. d. bacteroids in oxygen-rich nodules. e. photosynthetic bacteroids in plants.

ANS: A DIF: Medium REF: 21.6 OBJ: 21.6e Recall the benefits endophytes provide to plants and how endophytes impact humans | 21.6f Summarize the colonization of legumes by rhizobia MSC: Remembering 49. Bacteroids remain sequestered within a sac of plant-derived membrane known as the a. flavonoid. d. nucleosome. b. infection thread. e. symbiosome. c. Nod factor.

ANS: E DIF: Easy REF: 21.6 OBJ: 21.6f Summarize the colonization of legumes by rhizobia MSC: Remembering 50. Which of the following require endosymbiotic protists and bacteria to digest plant material such as lignin and cellulose? a. termites d. humans b. cattle e. microplankton c. gorillas ANS: A DIF: Medium REF: 21.4 OBJ: 21.4b Describe the organisms in and functions of the termite hindgut microbiome MSC: Remembering SHORT ANSWER 1. Explain at least three ways in which metagenomes may overlook organisms in the environment.

ANS:

Possible answers include the following: the sample was not sequenced enough to catch all the microbes in the environment and may miss the ―rare biosphere.‖ The sample was not properly filtered or DNA extracted from all organisms in the sample. The PCR primers may not be general enough and may miss microbes with very divergent sequences.

DIF: Medium REF: 21.1 OBJ: 21.1a Define metagenome, microbiome, operational taxonomic unit, and rarefaction curve MSC: Remembering 2. What are the benefits and limitations of different environmental sequencing methods? Explain why ribosomal gene sequencing can be used as an initial screen.

ANS: SSU rRNA gene sequence libraries generated with primers may miss microbes with 16S rRNA sequences very different than known microbes. An advantage of 16S rRNA amplicon sequencing is that we may quickly identify many taxa present in a community, including relatively rare members that do not yield full genomes when large-scale sequencing is performed. SSU rRNA gene similarity is used to define OTUs. Direct metagenome sequencing can identify those organisms not amplified with traditional SSU rRNA gene primers, but also sequences other genes than SSU rRNA. Metagenomes require large amounts of computational analysis and are typically much more expensive than targeted sequencing technologies.

DIF: Difficult REF: 21.1 OBJ: 21.1d Identify limitations of SSU rRNA sequencing and metagenomic analysis MSC: Understanding 3. Describe the steps in sequencing a metagenome.

ANS: You first sample the microbial target community and either separate it from its surroundings (in the case of terrestrial samples) or filter the sample (in the case of water samples) to only include the organisms of interest. You lyse the cells to extract the DNA and then clone the DNA fragments or amplify them by PCR. The DNA is then sequenced typically via next-generation sequencing such as Illumina. The sequences are then assembled and contigs can be analyzed by computational pipelines.

DIF: Medium REF: 21.1 OBJ: 21.1c Outline the steps required to obtain metagenomic data MSC: Understanding 4. Explain the difference between assimilation and dissimilation.

ANS: Assimilation refers to processes by which organisms acquire an element, such as carbon from CO2, to build into cells. Common kinds of assimilation include carbon dioxide fixation and nitrogen fixation. Dissimilation is the process of breaking down organic nutrients to inorganic minerals such as CO2 and NO2, usually through oxidation. Microbial dissimilation releases minerals for uptake by plants and other microbes, but microbial dissimilation can decrease habitat quality by removing organic nitrogen.

DIF: Easy REF: 21.2 MSC: Remembering

OBJ: 21.2d Contrast assimilation and dissimilation

5. Name two factors that differentiate aquatic and terrestrial ecosystems and explain how they affect food cycles in these systems.

ANS: A major difference appears between marine and terrestrial ecosystems. In the oceans, the smallest inhabitants, phototrophic bacteria, perform most of the CO2 fixation and biomass production. The main consumers are protists and viruses. Viruses are the most numerous replicating forms in the ocean—and they lyse most marine cells before any multicellular predators get a chance to consume them. In terrestrial ecosystems, by contrast, the major primary producers and fixers of CO2 are multicellular plants. Plants generate detritus, discarded biomass such as leaves and stems, that requires decomposition by fungi and bacteria. While viruses are important, multicellular consumers such as worms and insects play a greater role in decomposition.

DIF: Difficult REF: 21.2 OBJ: 21.2e Evaluate the roles of primary producers, consumers, and decomposers in food webs | 21.2f Distinguish different levels of consumers | 21.2g Compare the importance of microbial producers and consumers to that of multicellular producers and consumers in both marine and terrestrial ecosystems MSC: Analyzing 6. How do microbes live if their metabolic process to generate energy has a positive G? ANS: They live in association with another organism in a relationship known as syntrophy, or ―feeding together.‖ This typically happens when a product from the positive G is removed fast enough by another organism, resulting in a favorable reaction or a community-balanced negative G. DIF: Difficult MSC: Evaluating

REF: 21.4

OBJ: 21.4a Define holobiont and syntrophy

7. Describe the interaction of Vibrio cholerae with copepods. How did sari cloth help decrease the incidence of cholera in Bangladesh?

ANS: Vibrio cholerae is a mutualist on the surfaces of the small, invertebrate copepods. The copepods have come to rely on the bacteria to eat through the chitin of their egg cases to release their young.

Anwar Huq found that if the Bangladesh people filtered their water through several layers of sari cloth, the incidence of cholera decreased.

DIF: Medium REF: 21.3 OBJ: 21.3a Decide whether a particular symbiotic relationship is an example of mutualism, synergism, commensalism, amensalism, or parasitism MSC: Understanding 8. How do metatranscriptomics and metaproteomics address functional limitations of metagenomics?

ANS: Metatranscriptomics, the study of the RNA transcripts (or RNAseq) obtained from an environmental community, and metaproteomics, the study of proteins synthesized by environmental samples, both identify genes that are actually expressed by the target community.

These techniques address a major limitation in metagenomics regarding the actual function of microbes in the environment.

DIF: Medium REF: 21.1 OBJ: 21.1d Identify limitations of SSU rRNA sequencing and metagenomic analysis | 21.1e

Compare the approaches used for functional annotation

MSC: Analyzing

9. Propose a method to measure biomass production in terms of DNA synthesis. What are the limitations?

ANS: The rate of DNA synthesis is determined by the uptake of 14C radiolabeled thymidine. A limitation is that addition of the radiolabeled substrate may raise a nutrient concentration to artificially high levels that distort the naturally occurring rates of activity. Another limitation is that not all growing cells incorporate exogenous thymidine into their DNA. DIF: Medium REF: 21.5 OBJ: 21.5e Contrast the different ways of measuring planktonic community population size MSC: Evaluating 10. Compare and contrast the photic zones of freshwater lake and pelagic ecosystems.

ANS: The photic zone in the marine habitat is called the euphotic zone and is up to 200 meters deep except near the coastal shelf. In lakes, the epilimnion reaches only about 10 meters in depth, making it much shallower than the marine euphotic zone. Both regions are oligotrophic and contain a wide diversity of phototroph primary producers.

DIF: Medium REF: 21.5 OBJ: 21.5a Compare the properties of the distinct regions of the marine habitat | 21.5g Recall the properties of the different regions of freshwater habitats MSC: Understanding 11. Explain how metagenomics and metatranscriptomics have been used to assess ocean diversity.

ANS: A 2015 study led by Shinichi Sunagawa showed that the abundant Prochlorococcus and Synechococcus constitute only a small fraction of the microbes present. Abundant heterotrophs included Proteobacteria, many of which have proteorhodopsins for photoheterotrophy. Also abundant were the Thaumarchaeota, which oxidize ammonia released by fish and other organisms.

Metatranscriptomes were compared to those amplified from metagenomic DNA of the same microbial community. The most highly expressed genes included those encoding functional elements of photosynthesis, such as light-harvesting proteins and Rubisco. Genes for DNA repair were also highly expressed, presumably to correct UV damage in the open ocean. But the most highly expressed genes were some of the rarest in the metagenomes, and 40% of all expressed genes had no counterpart in the metagenome.

DIF: Difficult REF: 21.5 OBJ: 21.5d Evaluate the role of metagenomic approaches to understanding the marine microbial community MSC: Understanding 12. The net biomass of a population does not indicate productivity within an ecosystem. Explain.

ANS: At each trophic level above the producers, about 90% of biomass is consumed for energy generation. Biomass is a small fraction of productivity because it misses the amount of carbon cycled through respiration.

DIF: Difficult

REF: 21.5

OBJ: 21.5f Outline the relationships present in a marine food web; include the role of viruses MSC: Understanding 13. Explain how viruses select for increased diversity of microbial plankton in the oceans.

ANS: Recent studies indicate that cell lysis by viruses breaks down about half of microbial biomass.

Virus particles represent a significant sink for carbon and nitrogen. They accelerate the return of minerals to producers and necessitate a larger base of producers to sustain the ecosystem. Some marine viruses are highly host specific, infecting only certain species of dinoflagellates or cyanobacteria. Their presence selects for diverse communities containing numerous scattered species. Other viruses attack many hosts—and they transfer genes from one host to another, such as the genes encoding photosystems. Thus, marine viruses are a dominant force determining community species distribution and genome content.

DIF: Difficult REF: 21.5 OBJ: 21.5f Outline the relationships present in a marine food web; include the role of viruses MSC: Understanding 14. Define BOD, and explain why it can be used to measure the pollution level of lakes. Describe how effluents carrying high levels of nutrients can cause eutrophication.

ANS: BOD is an abbreviation for biochemical oxygen demand, which is the amount of oxygen removed from water by aerobic respiration. A eutrophic lake is one in which the upper layers have become depleted of oxygen as a consequence of an overgrowth of microbial producers. Problems arise when effluents entering a lake carry high concentrations of nutrients, relieving nitrogen limitation and causing an overgrowth of phototrophs. The cell mass of the phototrophs sinks to the bottom, where an overgrowth of heterotrophs then depletes oxygen.

DIF: Medium REF: 21.5 OBJ: 21.5b Identify factors that control the biochemical oxygen demand (BOD) | 21.5h Identify factors that lead to eutrophic conditions and compare eutrophic lakes to oligotrophic lakes MSC: Applying 15. Explain how endoliths derive energy inside bedrock, where there is no sunlight.

ANS: Endoliths are chemilithotrophs. It is believed that radioactive decay of uranium may be the energy source for these bacteria. Uranium-238 decay generates hydrogen radicals that combine to form hydrogen gas. The hydrogen gas combines with CO2 from carbonate rock, providing an electron donor and a carbon source for methanogens and other endolithic lithotrophs.

DIF: Medium REF: 21.6 OBJ: 21.6b State the properties of the different soil horizons; include microbes typically found in each layer MSC: Understanding 16. Describe the initiation process for legume-rhizobium symbiosis.

ANS:

The legume exudes signaling molecules called flavonoids into its rhizosphere. The flavonoids are detected by rhizobial bacteria, which respond by chemotaxis, swimming toward the root surface.

Flavonoids then induce bacterial expression of Nod factors. The bacterial Nod factor induces the root hair to curl around it and ultimately surround the bacterium with plant cell envelope. The bacterium then induces growth of a tube poking into the plant cell. As the tube grows, bacteria proliferate, forming a column of cells that projects down the tube.

DIF: Medium REF: 21.6 OBJ: 21.6f Summarize the colonization of legumes by rhizobia MSC: Remembering 17. In any environment, pathogens are always outnumbered by a vast community of neutral or helpful microbes. Describe some beneficial as well as devastating incidences of plant pathogens.

ANS: Answers may vary. A plant virus is associated with the production of striped tulips, which are much admired by tulip fanciers. Agrobacterium tumefaciens causes crown gall tumors on plants. It is applied widely for commercial plant engineering as a natural genetic transformation system.

Ophiostoma novo-ulmi, a fungus carried by bark beetles, which bore into the xylem of elm trees, damaging the tree’s transport vessels and allow access for fungal spores.

DIF: Difficult REF: 21.6 OBJ: 21.6h Categorize different types of fungus–plant interactions MSC: Analyzing 18. Describe the process of haustorial parasitism.

ANS: Some fungal pathogens generate specialized structures to acquire nutrients from plants. A hypha grows across the plant’s epidermis, penetrating the cell wall and generating an ingrowth of a bulbous extension called a haustorium. The haustorium never penetrates the plant cell membrane, instead it causes the membrane to invaginate, while expanding into the volume of the plant cell.

The haustorium takes up nutrients such as sucrose, generated by adjacent chloroplasts. Depending on the species of fungus, haustorial parasitism can lead to mild growth retardation, or it can rapidly kill the plant.

DIF: Difficult REF: 21.6 OBJ: 21.6h Categorize different types of fungus–plant interactions MSC: Understanding 19. Describe the technique pioneered by Robert Hungate of the University of California at Davis to study anaerobic microbiology of the rumen. What types of questions can be answered with this technique?

ANS: Robert Hungate pioneered the use of the fistulated, or cannulated, cow to study anaerobic microbes of the rumen. A fistulated cow is a cow in which an artificial connection is surgically made between the rumen and the animal’s exterior. Samples may be taken from the rumen to determine what types of microbes are present, and different foods can be put into the rumen to determine what changes occur.

DIF: Easy REF: 21.4 OBJ: 21.4c Recall the names and functions of the four chambers of the rumen gut MSC: Understanding

20. What is coral bleaching? What is its possible cause?

ANS: Coral bleaching occurs when coral zooxanthellae symbionts die or are expelled from the coral. The zooxanthellae are photosynthetic protists that are sensitive to climate change and pollution. Upon losing the endosymbionts, the coral turns white and soon dies, unless its symbionts return.

DIF: Medium REF: 21.3 OBJ: 21.3d Describe the relationship between corals and zooxanthellae MSC: Applying

CHAPTER 22: Microbes in Global Elemental Cycles MULTIPLE CHOICE 1. The elemental proportions in microbes are a. constant. b. variable. c. not measurable.

d. independent of abiotic factors. e. called their ―reservoirs.‖

ANS: B DIF: Medium REF: 22.1 OBJ: 22.1a Identify some of the ways that microbes have shaped and continue to shape the biosphere MSC: Remembering 2. The Blood Falls ecosystem is driven by microbes that reduce ________ and others that oxidize ________. a. nitrogen; iron d. sulfur; nitrogen b. phosphorus; nitrogen e. carbon; sulfur c. iron; sulfur ANS: C DIF: Medium REF: Special Topic 22.1 OBJ: 22.5a Outline the sulfur cycle and compare it to the nitrogen cycle | 22.5d Summarize the iron cycle | 22.5e State some effects of microbial metal metabolism MSC: Remembering 3. The element with the highest percentage of dry weight in bacteria is a. calcium. d. nitrogen. b. carbon. e. phosphorus. c. hydrogen.

ANS: B DIF: Easy REF: 22.1 OBJ: 22.1c Distinguish the global reservoirs of carbon, nitrogen, and sulfur MSC: Remembering 4. The upper region indicated in the figure below is called

a. deep oxycline. b. upwelling zone. c. benthos.

d. oxygen minimum zone. e. upper oxycline.

ANS: E DIF: Medium REF: 22.3 OBJ: 22.3b Recall the factors that contribute to hypoxic dead zones MSC: Remembering 5. The sink of an element in the ecosystem a. is the reservoir to which it returns during cycling. b. is the most accessible reservoir of that element. c. renders the element inaccessible. d. releases the element into the subsurface. e. is the source of the element for living organisms.

ANS: A DIF: Difficult REF: 22.1 OBJ: 22.1b Define biogeochemistry, sources, sinks, biotic, and abiotic MSC: Understanding 6. Which of the following techniques is used to quantify carbon influx and efflux of CO2 in small, controlled model ecosystems? a. gas chromatography d. stable isotope ratios b. mass spectroscopy e. atomic force microscopy c. radioisotope incorporation ANS: C DIF: Medium REF: 22.1 OBJ: 22.1e Evaluate the methods used to measure levels and fluxes of environmental elements MSC: Remembering 7. What is the cause of the highlighted zone with dissolved oxygen less than 2.0 mg/l?

a. b. c. d. e.

high carbon and nitrogen concentrations high iron concentrations low oxygen concentrations high phosphorus concentrations the Deepwater Horizon oil spill

ANS: A DIF: Medium REF: 22.3 OBJ: 22.3f Explain how the hydrologic cycle and the carbon cycle interact MSC: Understanding 8. The NASA FLUXNET tower is used for sampling and monitoring a. atmospheric CO2 and carbon flux. b. dinitrogen gas and denitrification. c. biomass carbon and dissolved CO2 oceans. d. hydrogen cycle and carbon flux. e. atmospheric nitrogen and carbon.

ANS: A DIF: Medium REF: 22.2 OBJ: 22.2b Explain how humans are responsible for increased environmental CO2 levels and their consequences MSC: Remembering 9. The largest reservoir for carbon is a. the atmosphere. b. ocean biomass. c. carbonate rocks and subsurface carbon. d. wetlands. e. fossil fuels.

ANS: C DIF: Easy REF: 22.2 OBJ: 22.2a Compare and contrast carbon reservoirs

MSC: Remembering

10. Which of the following reservoirs contains the most rapidly cycled carbon? a. the atmosphere d. land biomass b. ocean biomass e. crust below land and ocean

c. ocean inorganic molecules ANS: A DIF: Easy REF: 22.2 OBJ: 22.2a Compare and contrast carbon reservoirs

MSC: Understanding

11. Which of the following is NOT an example of a reduced form of carbon in the carbon cycle? a. methane d. carbon dioxide b. biomass e. methanol c. hydrocarbons ANS: D DIF: Difficult REF: 22.1 | 22.2 OBJ: 22.1d Rank the oxidation states of biospheric carbon, nitrogen, and sulfur | 22.2a Compare and contrast carbon reservoirs MSC: Understanding 12. In the marine photic zone, the rate of photosynthesis a. is equal to the amount of CO2 released from the niche. b. exceeds the rate of respiration. c. is less than the respiration rate. d. does not affect carbon cycling. e. is inversely related to rate of respiration.

ANS: B DIF: Medium REF: 22.2 OBJ: 22.2d Identify carbon sources and sinks | 22.2e Summarize the factors contributing to atmospheric CO2 levels MSC: Remembering 13. What is one of the main challenges of treating industrial runoff versus municipal wastewaters? a. more solid waste b. higher oxygen concentrations c. toxic chemicals d. higher organic loads e. lower oxygen concentrations ANS: C DIF: Medium REF: 22.3 OBJ: 22.3d Compare and contrast water treatment via wastewater treatment plants and wetland filtration MSC: Remembering 14. Corrosion of cement in the sewer pipe shown below is caused by

a. H2S. b. H2S  O2. c. H2  SO42.

d. Ca(OH)2  H2SO4. e. sewage liquid.

ANS: D DIF: Medium REF: 22.5 OBJ: 22.5e State some effects of microbial metal metabolism

MSC: Understanding

15. The release of CO2 by human industry has/is ________ the rate of CO2 fixation globally. a. equal to d. far less than b. tripled e. decreased c. outpaced ANS: C DIF: Easy REF: 22.2 OBJ: 22.2b Explain how humans are responsible for increased environmental CO2 levels and their consequences MSC: Remembering 16. Aeration of an environment containing microbes actively producing methane will a. increase methane release. b. decrease methane release. c. not affect methane release. d. increase nitrous oxide release. e. increase dinitrogen release.

ANS: B DIF: Medium REF: 22.2 OBJ: 22.2c State how oxygen levels influence carbon cycling | 22.2d Identify carbon sources and sinks MSC: Applying 17. Which of the following is an anaerobic respiration reaction? a. conversion of phosphine to phosphate b. methanogenesis c. photolysis of hydrogen sulfide to sulfur d. precipitation of ferric iron with hydroxide e. nitrogen fixation ANS: B DIF: Difficult REF: 22.2 OBJ: 22.2a Compare and contrast carbon reservoirs | 22.2d Identify carbon sources and sinks

MSC: Understanding 18. Which of the following would decrease the amount of carbon dioxide in the atmosphere? a. burning of logs b. microbial decomposition of logs c. increase in photosynthesis by plants d. anaerobic fermentation e. increase in respiration by microbes ANS: C DIF: Medium REF: 22.2 OBJ: 22.2d Identify carbon sources and sinks

MSC: Understanding

19. Marine dead zones are characterized as being a. hypoxic. b. aerated. c. devoid of nitrogen fixation. d. dangerous for ship sail. e. usually naturally occurring.

ANS: A DIF: Easy REF: 22.3 OBJ: 22.3b Recall the factors that contribute to hypoxic dead zones MSC: Remembering 20. Microbes participate in which step of wastewater treatment? a. preliminary d. tertiary b. primary e. every step c. secondary ANS: C DIF: Medium REF: 22.3 OBJ: 22.3c Outline the stages of sewage treatment in a wastewater treatment plant | 22.3e Evaluate the role of microbes in wastewater treatment MSC: Remembering 21. Which of the following organisms does NOT play a major role in secondary wastewater treatment? a. Zoogloea d. Pseudomonas b. Flavobacterium e. Nocardia c. Escherichia ANS: C DIF: Difficult REF: 22.3 OBJ: 22.3e Evaluate the role of microbes in wastewater treatment MSC: Remembering 22. Wastewater treatment generates which of the following gases in quantities sufficient for recovery as fuel? a. carbon dioxide d. methane b. oxygen e. hydrogen sulfide c. nitrous oxide ANS: D DIF: Medium REF: 22.3 OBJ: 22.3d Compare and contrast water treatment via wastewater treatment plants and wetland filtration | 22.3e Evaluate the role of microbes in wastewater treatment MSC: Understanding 23. During wastewater treatment, the secondary treatment requires continual aeration to a. suppress microbial growth. b. select for anaerobic heterotrophs.

c. stimulate abiotic degradation. d. increase microaerophilic filamentous bacteria. e. maximize breakdown of molecules to CO2 and nitrates.

ANS: E DIF: Medium REF: 22.3 OBJ: 22.3c Outline the stages of sewage treatment in a wastewater treatment plant | 22.3e Evaluate the role of microbes in wastewater treatment MSC: Understanding 24. Phosphorus is a fundamental element of which biological molecule? a. cofactors for enzymes d. nucleic acids b. siderophores e. peptidoglycan c. proteins ANS: D DIF: Easy REF: 22.5 OBJ: 22.5c Recall the biological roles of sulfur, phosphorous, and iron MSC: Remembering 25. What do wastewater treatment plants have in common with wetland filtration (purification)? a. The type of wastewater treated is the same. b. The engineering designs and flow are similar. c. They depend on microbes to remove nitrogen and carbon. d. Chlorine is used to decontaminate pollutants. e. They are both continually aerated.

ANS: C DIF: Difficult REF: 22.3 OBJ: 22.3d Compare and contrast water treatment via wastewater treatment plants and wetland filtration MSC: Applying 26. Which of the following major biological elements has the highest number of oxidation states? a. nitrogen d. sulfur b. carbon e. oxygen c. hydrogen ANS: A DIF: Medium REF: 22.4 OBJ: 22.4b Compare the nitrogen cycle to the carbon cycle 27. Which is the most stable form of nitrogen? a. NO b. NO2 c. N2

MSC: Remembering

d. NH3 e. NH

ANS: C DIF: Easy REF: 22.4 OBJ: 22.4a Identify nitrogen sources and sinks

MSC: Remembering

28. Dinitrogen gas constitutes ________ of the atmosphere. a. 10% d. 21% b. 79% e. 0.03% c. 69% ANS: B DIF: Easy REF: 22.4 OBJ: 22.4a Identify nitrogen sources and sinks

MSC: Remembering

29. Which of these is involved in commercial chemical fertilizer production? a. lightning strikes d. nitrification b. the Haber process e. denitrification c. cellular nitrogen fixation

ANS: B DIF: Easy REF: 22.4 OBJ: 22.4c Differentiate the three sides of the nitrogen triangle, and describe what happens in each | 22.4d Explain why nitrogen is often a limiting nutrient in ecosystems and what happens when this limitation is removed MSC: Remembering 30. Eolian sources of iron in marine systems are due to. a. precipitation of Fe3 by OH or PO43. b. phytoplankton consumers. c. iron-oxidizing bacteria. d. wind-borne dust from dry land. e. reduction of Fe3 by anaerobic respiration.

ANS: D DIF: Medium OBJ: 22.5d Summarize the iron cycle

REF: 22.5 MSC: Remembering

31. Which contaminant in water is especially prevalent in agricultural regions of the United States? a. carbon d. nitrate b. sulfur e. magnesium c. phosphate ANS: D DIF: Easy REF: 22.4 OBJ: 22.4c Differentiate the three sides of the nitrogen triangle, and describe what happens in each MSC: Understanding 32. In polluted ocean waters, what type of organisms may contribute significantly to global warming? a. photosynthetic algae d. marine mammals b. methanogens e. denitrifying bacteria c. vent bacteria ANS: E DIF: Difficult REF: 22.4 OBJ: 22.4b Compare the nitrogen cycle to the carbon cycle | 22.4c Differentiate the three sides of the nitrogen triangle, and describe what happens in each MSC: Understanding 33. The highly potent greenhouse gas N2O generates ________ the warming effect of CO2. a. 50X d. 200X b. 100X e. 500X c. 150X ANS: D DIF: Medium REF: 22.4 OBJ: 22.4a Identify nitrogen sources and sinks

MSC: Remembering

34. In the anammox reaction, ________ is the electron donor and ________ is the electron acceptor. a. dinitrogen gas; nitrite b. nitrite; nitrate c. ammonium ion; dinitrogen gas d. dinitrogen gas; nitrate e. ammonium ion; nitrite ANS: E DIF: Difficult REF: 22.4 OBJ: 22.4f Recall the anammox reaction MSC: Remembering 35. If an oligotrophic marine system has low concentrations of both nitrogen and phosphorus, it is said to be a. eutrophic. d. colimited.

b. polluted. c. high BOD.

e. hypoxic.

ANS: D DIF: Medium REF: 22.5 OBJ: 22.5f Explain resource colimitation

MSC: Remembering

36. What types of bacteria will carry out nitrification? a. lithotrophs d. phototrophs b. heterotrophs e. fastidious heterotrophs c. chemoorganotrophy ANS: A DIF: Medium REF: 22.4 OBJ: 22.4c Differentiate the three sides of the nitrogen triangle, and describe what happens in each MSC: Understanding 37. Acid mine drainage is caused primarily by the microbial genus a. Thalassiosira. d. Acidithiobacillus. b. Leptothrix. e. Desulfovibrio. c. Prochlorococcus.

ANS: D DIF: Medium REF: 22.5 OBJ: 22.5a Outline the sulfur cycle and compare it to the nitrogen cycle | 22.5d Summarize the iron cycle | 22.5e State some effects of microbial metal metabolism MSC: Remembering 38. The following image is evidence supporting ________ on Mars.

a. life b. past water c. tectonic processes

d. current water e. volcanic flow

ANS: B DIF: Difficult REF: 22.6 OBJ: 22.6c Compare and contrast Mars and Earth as suitable habitats for life MSC: Understanding 39. Microbes using nitrogen as a terminal electron acceptor would be performing a. nitrogen fixation. d. denitrification. b. ammonification. e. anammox. c. nitrification.

ANS: D DIF: Difficult REF: 22.4 OBJ: 22.4c Differentiate the three sides of the nitrogen triangle, and describe what happens in each MSC: Understanding 40. Which of the following is NOT used as a biosignature? a. metabolic activity d. mineral formations b. isotope ratios e. microfossils c. microscopic imaging ANS: C DIF: Medium REF: 22.6 OBJ: 22.6d List biosignatures that might be used to detect life on other planets MSC: Understanding 41. Increased ________ is NOT needed to terraform Mars. a. greenhouse gases d. air pressure b. temperature e. oxygen c. pH ANS: C DIF: Medium REF: 22.6 OBJ: 22.6a Define astrobiology and terraforming 42. Anaerobically, H2S may be photolyzed to a. sulfate. b. sulfite. c. sulfur dioxide.

MSC: Understanding

d. sulfuric acid. e. elemental sulfur.

ANS: E DIF: Medium REF: 22.5 OBJ: 22.5a Outline the sulfur cycle and compare it to the nitrogen cycle MSC: Remembering 43. Jupiter’s moon ________ is a candidate for extraterrestrial life due to its subsurface oceans. a. Io d. Mimas b. Europa e. Deimos c. Titan ANS: B DIF: Medium REF: 22.6 OBJ: 22.6e Explain why Jupiter’s moon Europa is a candidate for harboring life MSC: Remembering 44. Which of the following is assimilated almost entirely in the oxidized state? a. sulfur d. carbon b. nitrogen e. iron c. phosphorus ANS: C DIF: Medium REF: 22.5 OBJ: 22.5b Contrast phosphorous bioavailability to sulfur availability MSC: Remembering 45. Which of the following spontaneously ignites with a green glow as it emanates from the ground? a. pyrite d. phosphine b. nitrous oxide e. dimethylmercury c. dimethyl sulfide ANS: D DIF: Medium REF: 22.5 OBJ: 22.5c Recall the biological roles of sulfur, phosphorous, and iron

MSC: Remembering 46. If life is found on other planets, it will almost certainly be a. thermophilic. d. psychrophilic. b. microbial. e. multicellular. c. barophilic.

ANS: B DIF: Easy REF: 22.6 OBJ: 22.6b Justify the claim that the majority of biospheres would consist entirely of microbes MSC: Understanding 47. Which of the following does bacteria use for iron uptake? a. ferrodoxin d. siderophores b. protein A e. lipoprotein c. hemoglobin ANS: D DIF: Medium OBJ: 22.5d Summarize the iron cycle

REF: 22.5 MSC: Remembering

48. Which of the following is the most limiting element in marine ecosystems? a. iron d. phosphorous b. sulfur e. hydrogen c. carbon ANS: A DIF: Medium REF: 22.5 OBJ: 22.5c Recall the biological roles of sulfur, phosphorous, and iron MSC: Remembering 49. Modifications of ________ structure and composition represents a common microbial adaptation to limiting phosphorous concentrations. a. membrane d. polysaccharide b. protein e. the cell wall c. DNA ANS: A DIF: Medium REF: 22.5 OBJ: 22.5b Contrast phosphorous bioavailability to sulfur availability MSC: Understanding 50. On which of the following does humankind expect to find life because of the similarity of its geology to that of Earth? a. Jupiter d. Jupiter’s moon Europa b. Venus e. Pluto c. Mars ANS: C DIF: Easy REF: 22.6 OBJ: 22.6c Compare and contrast Mars and Earth as suitable habitats for life MSC: Remembering SHORT ANSWER 1. How did Jill Mikucki test her hypothesis that a subsurface river of brine flows deep beneath the glaciers and permafrost of Taylor Valley, feeding Blood Falls?

ANS:

To gain evidence for this model, Mikucki used an airborne sensor for electrical resistivity, a property that increases as water freezes but decreases with salt concentration. A giant airborne electromagnetic sensor was carried by helicopter above the length and breadth of Taylor Valley.

Traveling back and forth, the sensor mapped electrical resistivity of the geological strata below the lakes. The mapping showed a dramatic drop in electrical resistivity in sediments 500 meters below the glacier surface, indicating salt-saturated groundwater. But this layer of brine rises dramatically at the glacier’s forward edge, emerging to the surface at Blood Falls. Thus, the concentrated remains of a million-year-old river flow underground, bearing with them a vast community of iron and sulfur bacteria.

DIF: Difficult REF: Special Topic 22.1 OBJ: 22.1c Distinguish the global reservoirs of carbon, nitrogen, and sulfur MSC: Understanding 2. Why does the burning of fossil fuels have such a drastic impact on the atmospheric carbon reservoir?

ANS: The atmospheric reservoir is much smaller than other sources, such as the oceans, crustal rock, and fossil fuels. For this reason, the industrial burning of fossil fuels has perturbed the balance between atmospheric CO2 and larger reservoirs, such as the ocean. The ocean actually absorbs a good part of the extra CO2, in equilibrium with carbonates, and microbial photosynthesis traps carbon in biomass.

DIF: Easy REF: 22.2 OBJ: 22.2a Compare and contrast carbon reservoirs | 22.2b Explain how humans are responsible for increased environmental CO2 levels and their consequences MSC: Applying 3. Describe the difference between a source, sink, and reservoir of an element.

ANS: A location within the biosphere that contains a substantial fraction of the element in question is called a reservoir. These sites may be more or less available to acquisition by living systems. When elements are used by an organism, they act as a source. Through the action of metabolic activities, the materials are utilized and eventually returned to a reservoir. The reservoir is then acting as a sink. The elements need not originate and terminate in the same reservoir.

DIF: Medium REF: 22.1 OBJ: 22.1b Define biogeochemistry, sources, sinks, biotic, and abiotic MSC: Understanding 4. The figure below shows the ignition of methane from what source? Why is this methane source a major concern for global warming?

ANS: The methane source is methane hydrates that have accumulated in deep marine sediments, generated by huge benthic communities of methanogens. Warming of methane hydrate releases gaseous methane. Some methane is oxidized by methanotrophs, but an unknown amount rises to the atmosphere. Geological evidence suggests that rapid methane release accompanied the retreat of the glaciers during ice age transitions. A rapid methane release today could accelerate global warming.

DIF: Medium REF: 22.2 OBJ: 22.2d Identify carbon sources and sinks | 22.2e Summarize the factors contributing to atmospheric CO2 levels MSC: Evaluating 5. What would happen if household wastewater was emptied into local receiving rivers without prior treatment?

ANS: Wastewater is rich in organic matter, which would raise the BOD of the receiving river.

Wastewater treatment employs physical filtration and microbial metabolism to decrease the organic content and eliminate human pathogens before recycling the water.

DIF: Medium REF: 22.3 OBJ: 22.3a Summarize the relationship between the concentration of organic compounds and the biochemical oxygen demand MSC: Understanding 6. Compare and contrast carbon cycling in aerobic versus anaerobic terrestrial systems.

ANS: Answers may vary. Although plants perform most of the terrestrial photosynthesis, microbial phototrophs also fix CO2 into biomass. Microbial lithotrophy fixes carbon in soil and in weathered areas of crustal rock. Lithotrophy is performed solely by bacteria and archaea, essential microbial partners in these ecosystems. Much carbon is stored as carbon polymers such as cellulose and lignin. But microbial and animal consumers release a lot of CO2 through respiration. In some forests, the roots and fungi can sequester as much as 22 kilograms of carbon per square meter of forest soil, which may be 70% of the total carbon sequestered.

Anoxic environments support lower rates of biomass production than do oxygen-rich environments because they depend on oxidants of lower redox potential and limited quantity, such as Fe3. Anaerobic conversion of CO2 to biomass is done mainly by bacteria and archaea.

Anaerobic metabolism includes fermentation of organic carbon sources as well as respiration and lithotrophy with alternative electron acceptors such as nitrate, ferric iron (Fe3), and sulfate. In soil, anoxic conditions (extremely low in O2) favor incomplete breakdown of organic material. The partly decomposed matter becomes available for further decomposition. Anoxic environments favor production of methane from the H2, CO2, and other fermentation products of anaerobes.

DIF: Difficult REF: 22.2 OBJ: 22.2a Compare and contrast carbon reservoirs | 22.2c State how oxygen levels influence carbon cycling MSC: Analyzing 7. Compare and contrast assimilatory and dissimilatory nitrate reduction.

ANS: Nitrate assimilation to biomass (NH4) is called assimilatory nitrate reduction. Assimilatory nitrate reduction differs from the nitrate reduction involved in anaerobic respiration (dissimilatory nitrate reduction), which releases the reduced nitrogen and yields energy. Anaerobic respirers in soil or water use an oxidized form of nitrogen as an alternative electron acceptor in the absence of O2. All types of nitrogen-based anaerobic respiration are repressed in the presence of oxygen, a more favorable electron acceptor; therefore, denitrification is limited to anoxic habitats. Nitrate reduction to ammonia is a form of anaerobic lithotrophy or hydrogenotrophy in which nitrate serves as an electron acceptor and hydrogen gas (H2) is the electron donor.

DIF: Difficult REF: 22.4 OBJ: 22.4e Distinguish between assimilatory nitrate reduction and dissimilatory nitrate reduction MSC: Analyzing 8. How are wetlands similar to or different from commercial wastewater treatment plants?

ANS: Wetlands remove nitrogen through the action of denitrifying bacteria. In wetlands, rainwater and river water trickle slowly through vast stretches of soil, where microbial conversion acts as the foundation of a macroscopic ecosystem including trees and vertebrates. Thus, much of the carbon and nitrogen is fixed into valuable biomass. In the wetlands of the Everglades, the remaining water filters slowly through limestone into underground aquifers, which ultimately provide water through wells to human communities. This is similar to the primary treatment achieved by municipal plants. A modern wastewater treatment plant can convert sewage into water that exceeds all government standards for humans to drink.

DIF: Medium REF: 22.3 OBJ: 22.3d Compare and contrast water treatment via wastewater treatment plants and wetland filtration MSC: Analyzing 9. Predict the relative levels of biological oxygen demand (BOD) of water flowing into and out of a municipal wastewater treatment plant. Why is this difference desirable?

ANS:

BOD is the total amount of dissolved oxygen required for microbial respiration. The water flowing into the plant will contain high concentrations of dissolved organic materials and therefore have a high BOD. After treatment, these materials will be minimized and the BOD will be low. A low BOD is desirable for groundwater discharge. High BOD can lead to microbial overgrowth that can, in turn, reduce the amount of oxygen dissolved in the water. If this occurs, fish kills due to anoxia may result.

DIF: Medium REF: 22.3 OBJ: 22.3c Outline the stages of sewage treatment in a wastewater treatment plant MSC: Applying 10. What does the increase in nitrite (NO2-) and nitrous oxide (N2O) in the following figure indicate?

Describe this process in detail.

ANS: Bacteria and archaea reduce nitrate through a series of decreased oxidation states back to atmospheric nitrogen, the first step of which is nitrite production. The sequential rise of NO2 and N2O indicates metabolism of denitrifying bacteria. Because nitrous oxide is a gas, it can escape the system during the process.

DIF: Medium REF: 22.4 OBJ: 22.4c Differentiate the three sides of the nitrogen triangle, and describe what happens in each MSC: Analyzing 11. Discuss how human activities have perturbed the nitrogen cycle.

ANS:

Dinitrogen gas constitutes about 79% of the atmosphere on Earth. Despite its abundance, its stable and unreactive properties make it largely unavailable to most living things. Until recently in Earth’s history, nitrogen was fixed entirely by bacteria and archaea. However, humans have drastically increased the amount of fixed nitrogen by 30%–50% through the Haber process. The massive use of fertilizers pollutes aquatic habitats and the atmosphere through algal blooms and denitrification. Thus, anthropogenic activities have severely altered the nitrogen cycle more than any other.

DIF: Medium REF: 22.4 MSC: Understanding

OBJ: 22.4a Identify nitrogen sources and sinks

12. What are the major limitations to nitrogen fixation? How do organisms overcome these limitations?

ANS: The highly reductive reactions of nitrogenase require exclusion of oxygen, yet they also require a tremendous input of energy, usually provided by aerobic metabolism. Therefore, nitrogen-fixing bacteria generally isolate anaerobic nitrogen fixation from aerobic metabolism by one of several mechanisms, such as the heterocysts of cyanobacteria. Given the energy expense and the need to exclude oxygen, many species of bacteria, as well as all eukaryotes, lack the nitrogen fixation pathway. But all ecosystems, both marine and terrestrial, include some species of bacteria and archaea that fix N2 into ammonia.

DIF: Difficult REF: 22.4 OBJ: 22.4c Differentiate the three sides of the nitrogen triangle, and describe what happens in each | 22.4d Explain why nitrogen is often a limiting nutrient in ecosystems and what happens when this limitation is removed MSC: Understanding 13. What are two mechanisms used by marine organisms to adapt to the scarcity of phosphorous?

ANS: The genomes of marine phototrophs encode many systems for acquiring phosphate from organic sources. Some actually acquire phosphorus in a partly reduced form, such as phosphite or phosphonate, both of which are available in marine water. In addition, marine phototrophs show an unusual ability to substitute nonphosphorus lipids for phospholipids, thus cutting their phosphorus needs by half. Some cyanobacteria can replace membrane phospholipids with sulfonated lipids.

Similarly, some algae species can replace phosphatidylcholine with betaine, which contains no phosphate but includes a carboxylate group. Another microbial response to phosphate scarcity is to replace membrane phosphates with organic phosphonates, in which the phosphorus atom bonds directly to carbon instead of the easily hydrolyzed phosphoester bond.

DIF: Medium REF: 22.5 OBJ: 22.5b Contrast phosphorous bioavailability to sulfur availability MSC: Understanding 14. Discuss the concept of iron fertilization to remove excess CO2 from the atmosphere.

ANS:

The rise of algal populations following iron addition was demonstrated in an ―iron fertilization‖ experiment conducted in 2007 by Phillip Boyd and colleagues at the University of Otago, New Zealand. Several thousand kilograms of ferrous sulfate (FeSO4) were released in the Southern Ocean, near Antarctica. Within a week after the iron release, there was a bloom of phytoplankton.

The dominant phytoplankton in the bloom were diatoms of the species Fragilariopsis kerguelensis.

The dramatic effects of iron fertilization led some researchers to propose that increasing iron throughout the oceans could cause blooms of diatoms, removing CO2 from the atmosphere. If a sufficiently large proportion of the diatoms were to escape predation and fall to the ocean floor, they would effectively remove their carbon from circulation. An alternative outcome, however, would likely be eutrophication, causing an ecological collapse comparable to a dead zone.

DIF: Medium REF: 22.5 MSC: Understanding

OBJ: 22.5d Summarize the iron cycle

15. Some bacteria are responsible for degrading concrete. How do they accomplish this?

ANS: In a concrete sewer pipe, the alternation between anaerobic and oxygenated sulfur biochemistry causes severe corrosion. The microbial decomposition of sewage yields large quantities of toxic H2S, which then volatilizes to high levels that endanger sewer workers. The H2S is then oxidized to sulfuric acid by Acidithiobacillus ferrooxidans, a bacterium that colonizes the surface of the concrete. The sulfuric acid (H2SO4) decreases the pH at the concrete surface to pH 2. In the concrete surface, sulfuric acid converts calcium hydroxide to soluble calcium sulfate. Over several years, this corrosion can eat away half the thickness of a sewer pipe.

DIF: Medium REF: 22.5 OBJ: 22.5e State some effects of microbial metal metabolism

MSC: Understanding

16. Discuss the difference in environmental availability of phosphorus versus sulfur and nitrogen.

ANS: Unlike sulfur and nitrogen, which are found in several different oxidation states, phosphorus is cycled mainly in the fully oxidized state of phosphate. The absence of fully reduced phosphorus in ecosystems may be due to the fact that reduced phosphorus (phosphine, PH3) undergoes spontaneous combustion in the presence of oxygen. Some anaerobic decomposers use phosphate as a terminal electron acceptor, reducing it to phosphine. Although phosphate is abundant in Earth’s crust, its availability in ecosystems is limited by its tendency to precipitate with calcium, magnesium, and iron ions. Thus, dissolved phosphate in water and soil is often a limiting nutrient for productivity. In natural ecosystems, the available phosphate is taken up rapidly by bacteria and phytoplankton, and then consumed by grazers and predators and dispersed by decomposers.

DIF: Difficult REF: 22.5 OBJ: 22.5b Contrast phosphorous bioavailability to sulfur availability MSC: Analyzing 17. What types of evidence suggest the past existence of water on Mars?

ANS:

Martian soil composition showed high levels of perchlorate, a chemical that attracts water to form liquid solution and can support the metabolism of some Earth microbes. Other evidence for liquid water in the past on Mars comes from geological formations surveyed by the Mars Reconnaissance Orbiter in 2007. The orbiter mapped sedimentary deposits in Mars’s Jezero crater. The crater formations reveal flow patterns typical of a river delta flowing into a lake. Claylike mineral deposits may have trapped organic compounds needed for life. The layered patterns are best explained by a model involving fluid flow, such as the flow of water.

DIF: Difficult REF: 22.6 OBJ: 22.6c Compare and contrast Mars and Earth as suitable habitats for life | 22.6d List biosignatures that might be used to detect life on other planets MSC: Remembering 18. What evidence suggests that the biochemistry of life elsewhere would resemble that on Earth?

ANS: Terrestrial life is founded on macroelements in the first two rows of the periodic table, including carbon, nitrogen, oxygen, phosphorus, and sulfur. The valence numbers (that is, the number of electrons in the outer electron shell) of these elements from the middle of the periodic table enable them to form complex molecular structures with strong covalent bonds. The same fundamental molecules that appear in early Earth simulation experiments, such as adenine and glycine, also appear in meteorites. Thus, we suspect that the fundamental building blocks for biochemistry are universal.

DIF: Medium MSC: Analyzing

REF: 22.6

OBJ: 22.6a Define astrobiology and terraforming

19. Explain how the Mississippi River drainage into the Gulf of Mexico off the coast of Louisiana leads to a large dead zone.

ANS: Over its long, meandering course, which includes inputs from the Ohio and Missouri rivers, the Mississippi builds up high levels of organic pollutants, as well as nitrates from agricultural fertilizer. When these nitrogen-rich substances flow rapidly out to the Gulf in the spring, they lift the nitrogen limitation on algal growth and feed massive algal blooms. The algal population then crashes, and its sedimenting cells are consumed by heterotrophic bacteria. The heterotrophs use up the available oxygen, causing hypoxia. Hypoxia kills off the fish, shellfish, and crustaceans over a region equivalent in size to the state of New Jersey.

DIF: Medium REF: 22.3 OBJ: 22.3b Recall the factors that contribute to hypoxic dead zones MSC: Understanding 20. Astrobiology is the study of life in the universe. Why might our rDNA probes NOT be appropriate to detect extraterrestrial life?

ANS: Our rDNA probes were developed based on sequence analysis of many ribosomal genes. With these probes we have been able to identify thousands of unknown species, most of which are nonculturable. If our probes failed to amplify rDNA, those species would be missed. If extraterrestrial life evolved independently of Earth life forms, our probes would most likely not have any relevance.

DIF: Difficult REF: 22.6 OBJ: 22.6d List biosignatures that might be used to detect life on other planets

MSC: Evaluating

CHAPTER 23: Human Microbiota and Innate Immunity MULTIPLE CHOICE 1. An organism found on human skin that derives benefit from but does not harm the host is described as a(n) a. parasite. d. pathogen. b. commensal. e. mutualist. c. opportunist.

ANS: B DIF: Difficult REF: 23.1 OBJ: 23.1a Name regions of the human body harboring a microbiome and regions that are normally sterile MSC: Remembering 2. Which of the following is NOT a benefit provided by gut microbiota? a. inhibits inflammation b. synthesis of vitamins c. host tissue development d. enzymes catalyze food e. contributes to thin intestinal walls ANS: E DIF: Medium REF: 23.2 OBJ: 23.2a Recall examples of benefits provided by gut microbiota MSC: Analyzing 3. Which of the following factors contribute to dysbiosis? a. emotional stress b. carbohydrate catabolism c. probiotics d. bacteriocin e. anti-inflammatory cytokines ANS: A DIF: Medium REF: 23.1 OBJ: 23.2b List factors that contribute to dysbiosis

MSC: Understanding

4. Much of the ________ is normally free from microbes in a healthy individual. a. nose d. respiratory tract b. mouth e. genitourinary tract c. skin ANS: E DIF: Easy REF: 23.1 OBJ: 23.1f Compare the skin, eye, oral and nasal cavities, respiratory tract, genitourinary tract, stomach, and intestine with respect to their microbiomes MSC: Understanding 5. Which condition is NOT related to obesity? a. diabetes b. cardiovascular disease c. cancer d. nonalcoholic fatty liver disease e. alcoholism ANS: E DIF: Medium REF: 23.2 OBJ: 23.3e Propose how the microbiome influences obesity

MSC: Understanding

6. The microbiome can influence obesity through a. regulating energy metabolism. b. increasing intestinal inflammation. c. creating a more diverse gut microbiome. d. It does not influence obesity. e. no bacterial interactions.

ANS: A DIF: Medium REF: 23.2 OBJ: 23.2e Propose how the microbiome influences obesity

MSC: Remembering

7. Which of the following two organisms are commonly used as probiotics? a. Streptococcus mutans and Lactobacillus acidophilus b. Bacteroides and Lactobacillus acidophilus c. Enterococcus and Enterobacter species d. Bifidobacterium and Lactobacillus acidophilus e. Diphtheroids and Fusobacterium species ANS: D DIF: Medium OBJ: 23.2c Justify the use of probiotics

REF: 23.2 MSC: Remembering

8. Which part of the genitourinary tract is considered sterile? a. kidney d. genital tract b. bladder e. vagina c. distal urethra ANS: E DIF: Easy REF: 23.1 OBJ: 23.1a Name regions of the human body harboring a microbiome and regions that are normally sterile MSC: Understanding 9. Which part of the body does NOT meet the external environment? a. skin d. blood b. mouth e. genitourinary tract c. gastrointestinal tract ANS: D DIF: Medium REF: 23.1 OBJ: 23.1c Explain how the microbiome develops

MSC: Understanding

10. Which factor does NOT account for the hygiene hypothesis? a. exposure to animals d. bugs b. caves e. feces c. soap ANS: C DIF: Medium REF: 23.1 OBJ: 23.1d State the hygiene hypothesis MSC: Evaluating 11. An organism responsible for tooth decay is a. Pseudomonas aeruginosa. b. Streptococcus mutans. c. Neisseria meningitides.

d. Streptococcus pneumoniae. e. Haemophilus influenzae.

ANS: B DIF: Medium REF: 23.1 OBJ: 23.1e Recall the benefits and risks of a microbiome

MSC: Understanding

12. Which of the following innate immunity mechanisms is mismatched with its associated structure or body fluid?

a. b. c. d. e.

lysozyme—tears mucociliary elevator—intestines highly acidic pH—stomach acidic pH, sebum, salinity—skin low pH—urogenital tract

ANS: B DIF: Difficult REF: 23.3 OBJ: 23.3b Differentiate between innate and adaptive immunity MSC: Applying 13. Which of the following would contribute to a compromised immune system? a. blood pressure medication d. probiotics b. antidepressant drugs e. vitamins c. anticancer drugs ANS: C DIF: Medium REF: 23.1 OBJ: 23.1b Define compromised host and opportunistic pathogens MSC: Applying 14. Which structure engulfs microbes by phagocytosis?

a. hair follicle b. sebaceous gland c. blood vessels

d. sweat glands e. subcutaneous tissue

ANS: C DIF: Difficult REF: 23.3 OBJ: 23.3c List the cells of the immune system and recall their functions MSC: Applying 15. The major phagocytic cells in the body are

a. T and B lymphocytes. b. basophils and eosinophils. c. erythrocytes and platelets.

d. neutrophils and macrophages. e. epithelial cells and cilia.

ANS: D DIF: Medium REF: 23.3 OBJ: 23.3c List the cells of the immune system and recall their functions MSC: Understanding 16. Which of the following types of cells are antigen-presenting cells? a. only eosinophils d. only neutrophils b. platelets and macrophages e. macrophages and dendritic cells c. only macrophages ANS: E DIF: Medium REF: 23.3 OBJ: 23.3a Describe the structure and function of the immune system MSC: Remembering 17. Which of the following is NOT a lymphoid organ? a. tonsils and adenoids d. stomach b. spleen e. bone marrow c. appendix ANS: D DIF: Easy REF: 23.3 OBJ: 23.3f Name and state the functions of primary and secondary lymphoid organs MSC: Understanding 18. The primary lymphoid organ(s) is/are the a. adenoids. b. appendix. c. Peyer’s patches.

d. thymus. e. tonsils.

ANS: D DIF: Medium REF: 23.3 OBJ: 23.3f Name and state the functions of primary and secondary lymphoid organs MSC: Understanding 19. Which of the following cell types would most likely be elevated in a viral infection? a. eosinophils d. platelets b. lymphocytes e. complement c. basophils ANS: B DIF: Medium REF: 23.3 OBJ: 23.3a Describe the structure and function of the immune system MSC: Remembering 20. Which of the following would NOT result in an increase in natural killer cells? a. internal parasite d. bacterial infection b. herpes virus e. cancer c. Neisseria gonorrhoeae ANS: E DIF: Difficult REF: 23.3 OBJ: 23.3c List the cells of the immune system and recall their functions MSC: Understanding 21. What do NK cells use to distinguish between self and nonself? a. platelets d. dendritic cells b. MHC class I molecules e. monocytes

c. macrophages ANS: B DIF: Medium REF: 23.3 OBJ: 23.3d Explain how natural killer cells recognize self from nonself MSC: Analyzing 22. All of the following statements are correct regarding defensins EXCEPT that a. they are produced by skin, GI-tract, and lung cells for defense when stimulated. b. they form channels that destroy bacterial cytoplasmic membranes, ultimately killing the cell. c. peptides must bind the negatively charged outer membrane lipopolysacccharides. d. like antibodies, they are highly specific in pathogen neutralization. e. variation in defensins produced by different animals partially explains the varying susceptibility of hosts to pathogens.

ANS: D DIF: Difficult REF: 23.4 OBJ: 23.4b Categorize innate chemical defenses against infection MSC: Understanding 23. Defensins are short cationic peptides that a. are produced by skin, GI-tract, and lung cells for defense when stimulated. b. bind to specific protein receptors to gain entry into microbial cells. c. are only produced by phagocytes upon activation. d. inhibit microbial DNA synthesis. e. are equally effective at killing eukaryotic and prokaryotic cells.

ANS: A DIF: Difficult REF: 23.4 OBJ: 23.4c Recall the innate immunity cells present in the skull, gastrointestinal tract, and lungs MSC: Understanding 24. Which part of the physical defense system uses skin-associated lymphoid tissue (SALT)? a. gastrointestinal tract d. mucus membranes b. lungs e. defensins c. skin ANS: C DIF: Medium REF: 23.4 OBJ: 23.4a Compare and contrast physical barriers against infection at different body surfaces MSC: Applying 25. Lysozymes cause damage to the bacterial a. cell membrane b. capsule c. cell wall

d. DNA e. ribosomes

ANS: C DIF: Medium REF: 23.4 OBJ: 23.4a Compare and contrast physical barriers against infection at different body surfaces MSC: Applying 26. A man has been taking excessive amounts of antacids for heartburn. These tablets are very alkaline. Which innate defense mechanism might be altered by his actions? a. mucociliary elevator d. flushing action of urine b. lysozyme e. skin pH c. pH of stomach ANS: C DIF: Medium REF: 23.4 OBJ: 23.4a Compare and contrast physical barriers against infection at different body surfaces

MSC: Applying 27. In cystic fibrosis, a mutation has rendered the receptor for binding and inactivating Pseudomonas defective. The affected gene is the CFTR. The CFTR gene product is located in the a. cytosol. d. mitochondria. b. nucleus. e. phagosome. c. plasma membrane.

ANS: C DIF: Difficult REF: 23.4 OBJ: 23.4a Compare and contrast physical barriers against infection at different body surfaces MSC: Analyzing 28. Extravasation is the process by which ________ move(s) from the bloodstream into surrounding tissues. a. neutrophils d. interferons b. natural killer cells e. complement c. antibodies ANS: A DIF: Medium REF: 23.5 OBJ: 23.5a Define and state the functions of extravasation, opsonization, and autophagy MSC: Remembering 29. Which of the following is NOT an integral part of the inflammatory process? a. dilation of blood vessels b. release of histamines and prostaglandins c. redness d. extravasation e. antibody synthesis ANS: E DIF: Medium REF: 23.5 OBJ: 23.5d Outline the series of steps leading to acute inflammation MSC: Understanding 30. Which of the following is correct regarding inflammation? a. The cardinal signs include rash. b. Some of the phagocytes are stimulated to secrete antibodies specific for the invading pathogen. c. There is increased blood volume. d. Differentiation of B cells into plasma cells occurs at the site of infection. e. AIDS patients have little or no inflammatory responses when they are infected.

ANS: C DIF: Medium REF: 23.5 OBJ: 23.5d Outline the series of steps leading to acute inflammation MSC: Understanding 31. A woman falls and suffers a cut on her leg. The cut went through her skin and she is bleeding.

Which of the following defense mechanisms will participate in eliminating microbes contaminating the cut? a. mucociliary elevator b. normal skin flora c. acidic skin secretions d. lysozyme e. phagocytosis and the inflammatory response ANS: E

DIF: Medium

REF: 23.5

OBJ: 23.5d Outline the series of steps leading to acute inflammation MSC: Applying 32. Interferons are a. high molecular weight cytokines. b. not species specific. c. low molecular weight cytokines. d. not effective against polio virus. e. not effective against influenza virus.

ANS: C DIF: Medium REF: 23.5 OBJ: 23.5c Explain how interferons aid in innate immunity

MSC: Remembering

33. Which of the following definitions is mismatched? a. extravasation—movement of leukocytes through endothelial cells into tissues b. pus— teeming with white blood cells c. vasoactive—chemical degradation inside a phagolysosome d. autophagy—destruction of intracellular pathogens e. opsonization—formation of pseudopods ANS: C DIF: Difficult REF: 23.5 OBJ: 23.5a Define and state the functions of extravasation, opsonization, and autophagy MSC: Understanding 34. Opsonization is a process whereby the innate and adaptive immune mechanisms work together a. to phagocytize an invader. b. to activate complement proteins. c. for antibody secretion. d. to destroy cancer cells. e. during apoptosis.

ANS: A DIF: Easy REF: 23.5 OBJ: 23.5a Define and state the functions of extravasation, opsonization, and autophagy MSC: Remembering 35. Which of the following organisms is NOT a cause of chronic inflammation? a. a splinter b. Mycobacterium tuberculosis c. Mycobacterium marinum d. Actinomyces bovis e. biofilms on surgical implants ANS: A DIF: Difficult REF: 23.5 OBJ: 23.5f Recall the causes and consequences of chronic inflammation MSC: Applying 36. Which of following is NOT associated with the oxidative burst employed by phagocytic cells to kill bacteria? a. hydrogen peroxide d. catalase b. oxygen radicals e. nitric oxide c. NADPH oxidase ANS: D DIF: Difficult REF: 23.5 OBJ: 23.5e Categorize killing mechanisms as oxygen independent or oxygen dependent MSC: Understanding

37. The figure below shows the ________ pathway.

a. oxidative burst b. interferon c. defensins

d. alternative complement e. complement inflammation

ANS: D DIF: Medium REF: 23.6 OBJ: 23.6b Summarize the alternative complement pathway

MSC: Understanding

38. Which is the correct order of the following events in phagocytosis?

(1) discharge of waste material (2) fusion of the phagosome with a lysosome (3) adherence of the microbe to phagocytes (4) digestion of the ingested microbe (5) formation of a phagosome (6) ingestion of the microbe by the phagocyte a. 3, 6, 5, 2, 4, 1 d. 5, 2, 3, 6, 4, 1 b. 3, 4, 6, 5, 2, 1 e. 5, 3, 6, 2, 4, 1 c. 6, 5, 2, 4, 3, 1 ANS: A DIF: Difficult REF: 23.4 OBJ: 23.4b Categorize innate chemical defenses against infection MSC: Applying 39. Which of the following creates a channel in target cell membranes? a. complement b. defensins c. natural killer cells

d. complement and defensins e. complement, defensins, and natural killer cells ANS: E DIF: Difficult REF: 23.6 OBJ: 23.6a List the three different ways the complement pathway can be activated MSC: Applying 40. Interferons are a. antibacterial agents produced by skin, GI-tract, and lung cells. b. secreted by eukaryotic cells in response to intracellular infection. c. only produced by activated phagocytes. d. host specific and virus specific. e. able to block bacterial replication.

ANS: B DIF: Medium REF: 23.5 OBJ: 23.5c Explain how interferons aid in innate immunity

MSC: Remembering

41. IFN-gamma protects the host by a. inducing dsRNA endonucleases. b. interfering directly with viral replication. c. having an immunomodulatory role. d. inducing fever at the hypothalamus. e. blocking adhesion of pathogens.

ANS: C DIF: Difficult REF: 23.5 OBJ: 23.5c Explain how interferons aid in innate immunity

MSC: Remembering

42. Which of the following is/are Type I interferon? a. NOD-receptors d. IFN-gamma b. TLR4 e. cytokines c. IFN-beta ANS: C DIF: Medium REF: 23.3 OBJ: 23.3c List the cells of the immune system and recall their functions MSC: Remembering 43. Toll-like receptors are eukaryotic membrane proteins that bind with bacterial surface molecules and a. form channels through which bacterial proteins can enter the eukaryotic cell. b. cause the cell to phagocytize the bacteria. c. cause the release of antibiotics to kill the bacteria. d. cause the release of cytokines that trigger host defenses against the bacteria. e. activate the complement cascade.

ANS: D DIF: Difficult REF: 23.5 OBJ: 23.5b Distinguish between Toll-like and NOD-like pattern receptors MSC: Remembering 44. Which of the following is an example of a semi-specific, innate immune mechanism associated with mucosal surfaces? a. Secretory IgA prevents adhesion to mucosal surface. b. Extravasation of neutrophils is triggered by specific signals. c. Interferons produced by the host will act on specific viruses in the mucosa. d. Toll-like receptors on the host bind a specific microbe-associated molecular pattern, or MAMP.

e. The type of inflammation mounted varies with pathogen.

ANS: D DIF: Difficult REF: 23.5 OBJ: 23.5b Distinguish between Toll-like and NOD-like pattern receptors MSC: Remembering 45. Natural killer cells target ________ cells that ________. a. infected; have lost MHC class I b. bacterial; have lost MHC class I c. bacterial; are coated with complement d. infected; have lost C-reactive protein e. infected; secrete cytokines ANS: A DIF: Medium REF: 23.3 OBJ: 23.3c List the cells of the immune system and recall their functions MSC: Applying 46. The membrane attack complex, or MAC, kills Gram-negative bacteria through a. opsonization. b. dissolving the cell wall. c. the lectin pathway. d. creating a pore on the bacterial membranes. e. antibody-dependent cell cytotoxicity, or ADCC. ANS: D DIF: Medium REF: 23.6 OBJ: 23.6c Recall the ways that complement helps rid the body of pathogens MSC: Understanding 47. C-reactive protein is an acute-phase reactant that will bind to components of a. IL-1. d. host cell membranes. b. TNF-alpha. e. cytokines. c. bacterial cell surfaces.

ANS: C DIF: Medium REF: 23.6 OBJ: 23.6d Diagnose what elevated levels of serum C-reactive protein indicate MSC: Applying 48. Detection of high levels of mannose-binding lectin in the blood could signify a. the presence of an invading pathogen. b. ongoing virus replication. c. the activation of natural killer cells. d. high levels of interferons. e. in-progress differentiation of leukocytes.

ANS: A DIF: Difficult REF: 23.6 OBJ: 23.6c Recall the ways that complement helps rid the body of pathogens MSC: Applying 49. The hypothalamus is important because it regulates a. body temperature. b. release of complement proteins from the liver. c. neutrophil phagocytosis. d. white blood cell differentiation. e. pain perception.

ANS: A

DIF: Medium

REF: 23.6

OBJ: 23.6e Describe how the hypothalamus controls body temperature MSC: Remembering 50. Interventions that reduce a moderate fever due to infection may be counterproductive because they may a. produce more pyrogens. d. slow recovery. b. produce prostaglandins. e. dull pain perception. c. induce phagocytosis.

ANS: D DIF: Medium REF: 23.6 OBJ: 23.6e Describe how the hypothalamus controls body temperature MSC: Applying SHORT ANSWER 1. What factors might explain the prevalence of Gram-positive bacteria on human skin’s epidermal layer?

ANS: This layer of skin has high salt secretions, as well as high salt secretions and highly keratinized cells. The presence of organic acids and enzymes make it even more unfavorable for bacteria to colonize. However, Staphylococcus epidermidis and other Gram-positives tend to be resistant to these factors.

DIF: Easy REF: 23.1 OBJ: 23.1a Name regions of the human body harboring a microbiome and regions that are normally sterile MSC: Remembering | Evaluating 2. Microbes in and on humans sharpen immunity and protect from infection. Explain why these benefits also come with considerable risk.

ANS: The microbiota of humans are extremely beneficial to the well-being of their human hosts.

However, the ability of these commensals (such as the oral flora) to cause deadly diseases when introduced to sterile body parts, such as the blood, organs, and brain, is worthy of concern. The proximity of the opportunistic pathogens to vulnerable body parts makes the association risky.

DIF: Medium REF: 23.1 OBJ: 23.1a Name regions of the human body harboring a microbiome and regions that are normally sterile MSC: Understanding | Applying 3. How can differences in gut microbiota account for obesity and leanness in humans?

ANS: About 15%–20% of the human caloric intake is derived from colon bacteria that digest and degrade the complex carbohydrates we consume. Different microbiota will affect the efficiency of calorie harvesting from the same diet and how it is subsequently stored. Studies investigating the connection between the presence of methanogens (a specific type of bacteria) in the intestines and obesity are underway.

DIF: Difficult REF: 23.2 OBJ: 23.2d Evaluate the evidence for the influence of the microbiota on obesity MSC: Understanding | Applying

4. Why can acne be treated with antibiotics?

ANS: Acne is treated with antibiotics because it is caused by the Gram-positive, anaerobic rod Propionibacterium acnes. Since this is a bacterial infection, some antibiotics (tetracycline or clindamycin) may be helpful in the treatment of acne conditions. However, only antibiotics that are targeted against Gram-positive organisms will be effective.

DIF: Easy REF: 23.1 OBJ: 23.1b Define compromised host and opportunistic pathogens MSC: Analyzing | Applying 5. How does Propionibacterium acnes—an anaerobic Gram-positive normal flora of the skin—cause acne, especially in teenagers?

ANS: It is a normal microbial resident of the skin, but during the adolescent years, increased hormonal activity leads to increased oil production by the sebaceous glands. The triglycerides in these oils are readily degraded by P. acnes to free fatty acids, which cause inflammation of the sebaceous gland. A plug of fluid and keratin forms in the gland duct, resulting in the typical acne skin eruption.

DIF: Medium REF: 23.1 OBJ: 23.1b Define compromised host and opportunistic pathogens MSC: Analyzing 6. Why are healthy individuals usually ―immune‖ to cholera, whereas malnourished individuals are not?

ANS: Vibrio cholerae, the causative agent of cholera, is extremely sensitive to low pH. The pH of the stomach of healthy individuals is well below 4, which effectively kills V. cholerae. Malnourished individuals are achlorhydric, or have a loss of stomach acid. The pH of their stomachs permits V. cholerae to travel through the stomach and reach the less acidic intestine. It is here that the organism thrives and causes disease.

DIF: Easy REF: 23.1 OBJ: 23.1b Define compromised host and opportunistic pathogens MSC: Analyzing 7. What explains the ability of Helicobacter pylori to defy stomach acidity?

ANS: H. pylori produces ureases, which generate ammonia, thereby increasing the pH of the stomach in its microenvironment. This enables the organism to survive, although it does not grow and divide until it takes up residence in the mucous lining of the stomach. The mucous of the stomach epithelium has a pH of between 5 and 6, allowing the organism to thrive.

DIF: Easy REF: 23.2 OBJ: 23.2a Recall examples of benefits provided by gut microbiota MSC: Analyzing

8. How is it that Clostrioides difficile, often a part of the normal intestinal microflora, can be the causative agent of pseudomembranous enterocolitis?

ANS: When a person takes antibiotics, normal flora microbes are killed. These may be competing with and generally keeping C. difficile at bay. In their absence, C. difficile grows unabated, making a toxin that damages and kills host epithelial cells. Small plaques are formed that eventually coalesce to form a pseudomembrane.

DIF: Medium MSC: Analyzing

REF: 23.2

OBJ: 23.2b List factors that contribute to dysbiosis

9. Using the figure below, demonstrate how butyrate influences appetite.

ANS: The ingestion of bacteriodes/firmicutes produces butyrate, which allows for the harvest of energy by intestinal cells and also influences hormones in the gut that limit hunger.

DIF: Difficult REF: 23.2 OBJ: 23.2e Propose how the microbiome influences obesity 10. Describe what is happening in the figure below.

MSC: Applying

ANS: This is a picture of periodontal disease, including red, swollen gums; bleeding gums; gum shrinkage; and teeth drifting apart.

DIF: Easy REF: 23.1 OBJ: 23.1e Recall the benefits and risks of a microbiome

MSC: Applying

11. Why is it important for people with mitral valve prolapse to take antibiotics prior to a dental exam or procedure?

ANS: During a dental procedure, organisms that are generally innocuous in the oral cavity are released into the bloodstream. This causes transient bacteremia in normal individuals, but in individuals with mitral valve prolapse, some organisms may become trapped in the defective valve. In this case, the bacterial vegetations become encased in glycocalyx and then are relatively inaccessible to antibiotics. As a result, the antibiotic needs to be present when the organisms enter the bloodstream, prior to colonization in the valve.

DIF: Medium REF: 23.1 OBJ: 23.1a Name regions of the human body harboring a microbiome and regions that are normally sterile MSC: Evaluating 12. Explain the distinguishing characteristics of innate and adaptive immunity.

ANS: Innate immunity is also known as nonadaptive immunity. Innate immunity is hardwired into us and exists prior to any microbial exposure. It involves physical barriers, chemical barriers, and relatively nonspecific cellular responses to infection. Adaptive immunity is the body’s reaction to specific antigens. Once the body has been activated by an antigen, it creates a memory of it such that when it encounters the same antigen again, the specific memory cells are quickly reactivated.

DIF: Medium REF: 23.3 OBJ: 23.3b Differentiate between innate and adaptive immunity MSC: Analyzing 13. What is the biology underlying the condition of lupus? How could the symptoms of lupus be lessened on the cellular level?

ANS:

Neutrophil extracellular traps, or NETs, have been shown to be produced by a special neutrophil subset, called low-density granulocytes (LDGs), found in all lupus patients. Autoantibodies, specifically for ribonucleoproteins and the antimicrobial peptide LL-37, accelerate the propagation of NETs, feeding a cycle of more NETs, autoantibodies, LDGs, LL-37, NK cells, CD8 cells, and so on via enhanced interferon (INF-a) production and ultimately amplifying the inflammation and tissue damage seen in lupus. Blocking NET release would be one way to break the cycle and lessen the symptoms of lupus.

DIF: Difficult REF: 23.3 OBJ: 23.3b Differentiate between innate and adaptive immunity MSC: Understanding 14. Are the Langerhans cells of skin-associated lymphoid tissue (SALT) related to the islets of Langerhans of the pancreas that secrete insulin? What is the function of Langerhans cells?

ANS: No, the Langerhans cells are specialized dendritic cells that make up a significant portion of SALT. They phagocytize microbes, migrate to lymph nodes, and serve as antigen-presenting cells that present parts of the microbe to the immune system to activate antimicrobial activity.

DIF: Medium REF: 23.4 OBJ: 23.4a Compare and contrast physical barriers against infection at different body surfaces MSC: Analyzing 15. Is it correct to state that bacteria introduced through a skin cut will most likely be engulfed by Langerhans cells?

ANS: Langerhans cells are resident phagocytic cells that make up a significant portion of skin-associated lymphoid tissue (SALT). It is quite probable that these front-line cells will encounter the bacteria first and then provoke inflammation.

DIF: Medium REF: 23.4 OBJ: 23.4a Compare and contrast physical barriers against infection at different body surfaces MSC: Evaluating 16. Explain the steps of the basic inflammatory response as pictured in the figure below.

ANS: Infection occurs via a splinter. Resident macrophages engulf the pathogens and then release cytokines. This is followed by the vasoactive factors and cytokines helping to deliver more phagocytes. Once the pathogens are destroyed, some cytokines will begin the healing process.

DIF: Medium REF: 23.5 OBJ: 23.5d Outline the series of steps leading to acute inflammation MSC: Understanding | Analyzing 17. Describe how natural killer cells work in response to a bacterial infection.

ANS: The mission of NK cells is to kill host cells that harbor microorganisms. NK cells recognize changes in cell-surface proteins of infected cells and then degranulate to release chemicals that kill those cells.

DIF: Medium REF: 23.3 OBJ: 23.3c List the cells of the immune system and recall their functions MSC: Analyzing 18. Describe antibody-induced opsonization, the process in which innate and adaptive immunity work together to engulf an invader.

ANS: Cells that have a polysaccharide capsule are too slippery to be captured by the innate response of phagocytosis. The adaptive response produces anticapsular antibodies that aid the innate system through opsonization. This process involves the binding of antibodies to the capsule, leaving the Fc regions facing outward to be recognized and bound by receptors on phagocytic cell surfaces.

DIF: Medium REF: 23.3 OBJ: 23.3b Differentiate between innate and adaptive immunity MSC: Analyzing 19. Why is the alternative complement cascade not considered a part of adaptive immunity?

ANS: The serum proteins referred to as complement are not induced during infection; rather, they are present in the blood innately. Their activation, however, is enhanced by the presence of invaders.

Moreover, the same complement proteins are used to target many different organisms. In contrast, adaptive immunity is highly specific, involving antibodies secreted to neutralize a given pathogen.

Antibodies are only needed in inducing the classical complement cascade.

DIF: Difficult REF: 23.6 OBJ: 23.6b Summarize the alternative complement pathway

MSC: Analyzing

20. How is it that Gram-positive cells are more resistant to complement than Gram-negative cells?

ANS: The lipopolysaccharide of outer cell membranes is very efficient at activating the complement cascade. Since Gram-positive cells do not have an outer membrane, the cascade is not as readily activated. The thicker peptidoglycan layer of the Gram-positives also hinders access of the complement components to the bacterial membrane.

DIF: Medium REF: 23.6 OBJ: 23.6c Recall the ways that complement helps rid the body of pathogens MSC: Analyzing

CHAPTER 24: The Adaptive Immune Response MULTIPLE CHOICE 1. Severe combined immunodeficiency is most commonly caused by a. chromosome 22 trisomy.

b. c. d. e.

Y-linked inherited hypermetabolism.

X-linked inherited enzyme or receptor deficiency. chromosome 7 deletion.

XXY inheritance.

ANS: C DIF: Medium REF: 24.1 OBJ: 24.1b Identify factors that contribute to immunogenicity

MSC: Understanding

2. Which of the following could be categorized as an example of humoral immunity? a. T regulatory cells d. T cytotoxic cells b. T helper cells e. macrophages c. antimalaria antibodies ANS: C DIF: Easy REF: 24.1 OBJ: 24.1a Distinguish the two different types of adaptive immunity MSC: Understanding 3. Which of the following would be considered an aspect of the adaptive immune response? a. interferons d. natural killer cells b. lymphocytes e. neutrophils c. defensins ANS: B DIF: Easy REF: 24.1 OBJ: 24.1a Distinguish the two different types of adaptive immunity MSC: Analyzing 4. The small segment of antigen that is capable of eliciting an immune response is called a(n) a. hapten. d. epitope. b. clonotope. e. naïve antigen. c. aggretope.

ANS: D DIF: Easy REF: 24.1 OBJ: 24.1e Differentiate among antigen, epitope, hapten, and immunogen MSC: Remembering 5. The immune response elicited from each individual antigenic determinant found within an antigen is best described as a. monoclonal. d. polyclonal. b. multiclonal. e. triclonal. c. biclonal.

ANS: A DIF: Easy REF: 24.1 OBJ: 24.1e Differentiate among antigen, epitope, hapten, and immunogen MSC: Remembering 6. Of the following cells, which could be considered a ―professional‖ antigen-presenting cell? a. neutrophil d. dendritic cell b. T lymphocyte e. fibroblast c. natural killer cell ANS: D DIF: Easy REF: 24.1 OBJ: 24.1c Assess the role of antigen-presenting cells

MSC: Understanding

7. Anti-HIV antibodies are best at binding to viral proteins when the virus is a. within the cytoplasm of an infected T cell. b. within the nucleus of an infected T cell.

c. within the cytoplasm of an infected macrophage. d. within the nucleus of an infected macrophage. e. extracellular within the bloodstream.

ANS: E DIF: Easy REF: 24.1 OBJ: 24.1b Identify factors that contribute to immunogenicity

MSC: Applying

8. A threshold dose of antigen is best described as the dose needed to a. generate an optimal immune response. b. activate only a few immune cells. c. generate only a T-cell response. d. induce immune complement response. e. induce immunological tolerance.

ANS: A DIF: Easy REF: 24.1 OBJ: 24.1b Identify factors that contribute to immunogenicity

MSC: Remembering

9. Edward Jenner was able to demonstrate the first example of immunological cross-protection because a. the smallpox virus was nonpathogenic. b. the cowpox virus only affected milkmaids. c. cowpox and smallpox viruses were metabolically different. d. cowpox virus was structurally similar to the smallpox virus. e. plague survivors were immune to smallpox.

ANS: D DIF: Easy REF: 24.1 OBJ: 24.1d Express the meaning of immunological specificity

MSC: Remembering

10. People who survived infection with Yersinia pestis during the fourteenth-century European epidemic found themselves immune when reexposed to a. influenza. d. plague. b. syphilis. e. pneumonia. c. smallpox.

ANS: D DIF: Medium REF: 24.1 OBJ: 24.1d Express the meaning of immunological specificity

MSC: Understanding

11. The chickenpox vaccine is created with an attenuated virus, and the rabies vaccine with an inactivated virus. This means that the chickenpox virus is a ________, and the rabies virus is ________. a. subunit vaccine; a genetic vaccine b. genetic vaccine; a subunit vaccine c. nonfunctional form; living but weakened d. subunit vaccine; nonfunctional e. living weakened form; nonfunctional ANS: E DIF: Medium REF: 24.1 OBJ: 24.1d Express the meaning of immunological specificity 12. Figure B below displays a

MSC: Understanding

a. denatured antigen. b. antigen-presenting cell. c. mast cell.

d. native antigen. e. conformational epitope.

ANS: E DIF: Difficult REF: 24.1 OBJ: 24.1e Differentiate among antigen, epitope, hapten, and immunogen MSC: Understanding 13. Which of the following is most likely to elicit the strongest antigen-specific immune response within a human? a. an outer membrane protein from Plasmodium falciparium b. an RNA genome from HIV c. a DNA genome from herpes d. a capsular polysaccharide coating from Streptococcus mutans e. a plasma membrane from Escherichia coli ANS: A DIF: Medium REF: 24.1 OBJ: 24.1e Differentiate among antigen, epitope, hapten, and immunogen MSC: Applying 14. Which of the following is most likely to elicit the strongest antigen-specific immune response if injected intravenously into a mouse? a. a sterile glucose solution b. equine serum albumin c. complement proteins from another mouse d. red blood cells from a transfusion-compatible species e. mouse antigoat antibodies ANS: B DIF: Easy REF: 24.1 OBJ: 24.1e Differentiate among antigen, epitope, hapten, and immunogen MSC: Applying 15. To which superfamily do antibodies belong? a. interleukins b. heat shock c. immunoglobulin

d. major histocompatibility complex e. homeobox

ANS: C DIF: Medium REF: 24.2 OBJ: 24.2a Assess how the structure of an antibody relates to its function

MSC: Understanding 16. The five classes of antibodies (IgG, IgA, IgM, IgE, and IgD) that can be produced during an immune response are based on differences in ________ chain regions. a. CL d. VL b. VH e. all constant and variable c. CH ANS: C DIF: Easy REF: 24.2 OBJ: 24.2b Compare and contrast the five antibody classes

MSC: Applying

17. The difference between antibody allotypes and isotypes is that isotypes are ________ and allotypes are ________. a. the differences in constant regions; differences within isotypes b. differences within allotypes; the differences in constant regions c. the differences in constant regions; alternations in the hypervariable regions d. alternations in the hypervariable regions; differences within isotypes e. alternations in the hypervariable regions of one person; alternations in the hypervariable regions among a species ANS: A DIF: Medium REF: 24.2 OBJ: 24.2c Distinguish among isotype, allotype, and idiotype

MSC: Understanding

18. What process is shown in the figure below?

a. b. c. d. e.

elicitation of an immune response haptens immunoprecipitation antibodies preventing attachment basic antibody structure

ANS: C DIF: Easy REF: 24.2 OBJ: 24.2g Describe the importance of affinity maturation to the adaptive immune response MSC: Understanding 19. Laboratory isolation of an anti-Streptococcus antibody was found to bind to ten Streptococcus pyogenes at one time. The antibody isolated was a. IgG. d. IgD. b. IgM. e. IgE. c. IgA. ANS: B DIF: Easy REF: 24.2 OBJ: 24.2b Compare and contrast the five antibody classes

MSC: Understanding

20. In a radial immunodiffusion assay, immunoprecipitation rings will be created within the agar dish based on a. equivalence point. d. polyclonal antigen preparation. b. antibody isotype. e. Fc binding of antigens. c. antibody allotype.

ANS: A

DIF: Difficult

REF: 24.2

OBJ: 24.2a Assess how the structure of an antibody relates to its function MSC: Applying 21. Complement molecule, C1 complex, will bind to an IgG antibody at the a. VL portion. d. Fc portion. b. F(ab')2 portion. e. J-chain region. c. CL portion.

ANS: C DIF: Easy REF: 24.2 OBJ: 24.2f Explain the genetics of antibody diversity

MSC: Applying

22. A baby will receive ________ class of antibodies from his or her mother before birth through the umbilical cord, and then ________ class of antibodies through the breast milk after birth. a. IgG; IgA d. IgM; IgA b. IgM; IgD e. IgE; IgG c. IgG; IgM ANS: A DIF: Easy REF: 24.2 OBJ: 24.2b Compare and contrast the five antibody classes

MSC: Applying

23. The inflammatory antibody of someone undergoing an allergic reaction to cat dander would be found primarily a. in the lymph nodes. b. free-floating in the bloodstream. c. bound to mast cells and basophils. d. in mucus secretions. e. attached to T cells.

ANS: C DIF: Easy REF: 24.2 OBJ: 24.2b Compare and contrast the five antibody classes

MSC: Applying

24. There are ________ polypeptide chains in the typical antibody. a. 2 d. 6 b. 12 e. 8 c. 4 ANS: C DIF: Medium REF: 24.2 OBJ: 24.2a Assess how the structure of an antibody relates to its function MSC: Remembering 25. Capping of B-cell receptors on the surface of an antigen-exposed B cell immediately causes a. VDJ gene switching, recombination, and hypermutation. b. neutrophil phagocytosis of the antigen. c. complement cascade signaling and antigen destruction. d. cell-signaling cascade, inducing cell proliferation and differentiation. e. helper T-cell proliferation and regulatory T-cell differentiation.

ANS: D DIF: Medium REF: 24.2 OBJ: 24.2e Summarize the differentiation of naïve B cells into plasma and memory B cells via clonal selection MSC: Remembering 26. An example of an antigen that could stimulate naïve B-cell proliferation and differentiation without the help of a T cell would be a(n) ________ molecule from ________. a. lipopolysaccharide; Proteus vulgaris b. plasmid DNA; Yersinia pestis

c. protein A; Staphylococcus aureus d. anthrax toxin; Bacillus anthracis e. porin protein; Escherichia coli ANS: A DIF: Medium REF: 24.2 OBJ: 24.2e Summarize the differentiation of naïve B cells into plasma and memory B cells via clonal selection MSC: Understanding 27. Immunization with the childhood DPT (diphtheria, pertussis, and tetanus) vaccine protects against subsequent exposure to tetanus by a. stopping isotype switching of B cells from IgM to IgA. b. preloading antigen-presenting cells. c. stimulating quick inflammation upon future exposure. d. producing life-spanning antitetanus IgE antibodies. e. generating tetanus-specific memory B cells.

ANS: E DIF: Easy REF: 24.2 OBJ: 24.2d Differentiate between the primary and secondary antibody responses MSC: Applying 28. A typical antibody molecule has ________ antigen-binding sites. a. one d. two b. four e. three c. five ANS: D DIF: Medium REF: 24.2 OBJ: 24.2a Assess how the structure of an antibody relates to its function MSC: Remembering 29. RAG1 and RAG2 are enzymes that control gene splicing on B-cell antibody genes. Which order are segments worked on in the creation of the heavy-chain gene segment? a. VD spliced together, then J, then C b. DJ spliced together, then V c. VJ spliced together, then D d. VC spliced together, then D, then J e. VDJ segments are all spliced together simultaneously.

ANS: B DIF: Difficult REF: 24.2 OBJ: 24.2g Describe the importance of affinity maturation to the adaptive immune response MSC: Understanding 30. Anti-Streptococcus antibodies found in the serum of a patient during a primary antibody response differ from the antibodies produced during a secondary response to the same antigen because of a. VDJ recombination. d. MHC processing. b. affinity maturation. e. antigen adaptation. c. class switching.

ANS: B DIF: Easy REF: 24.2 OBJ: 24.2d Differentiate between the primary and secondary antibody responses MSC: Understanding 31. During the course of an intestinal infection with Salmonella enteritidis, the B cells undergo class switching. ________ switching is most likely to occur, which is caused by ________ cytokines. a. IgD to IgE; B-cell d. IgA to IgG; T-cell b. IgM to IgA; T-cell e. IgD to IgM; T-cell

c. IgG to IgM; B-cell ANS: B DIF: Medium REF: 24.2 OBJ: 24.2c Distinguish among isotype, allotype, and idiotype

MSC: Applying

32. Positive selection in T-cell education refers to a. T-cell receptors that can bind strongly to self MHC proteins. b. CD8 receptors that can bind strongly to self MHC proteins. c. T-cell receptors that can bind weakly to self MHC proteins. d. CD4 that can bind weakly to self MHC proteins. e. B-cell receptors that bind weakly to T-cell receptors.

ANS: C DIF: Easy REF: 24.3 OBJ: 24.3d Describe the process and function of T-cell education MSC: Remembering 33. A complete T-cell receptor on a helper T cell contains both the antigen-binding receptor molecule and a ________ protein for signal transduction. a. CD8 d. MHC II b. CD3 complex e. CD28 c. MHC I ANS: B DIF: Easy REF: 24.3 OBJ: 24.3a Name different types of T cells and recall their functions MSC: Remembering 34. The secondary signal needed for TH0 helper cells to differentiate into either TH1 cells or TH2 cells is the cross-link between ________ (on TH0 helper cells) and ________ (on APC cell). a. CD154; CD40 d. CD8; MHC I b. MHC I; B7 e. CD28; B7 c. CD4; MHC II ANS: E DIF: Medium REF: 24.3 OBJ: 24.3d Describe the process and function of T-cell education MSC: Remembering 35. Mycobacteria spp. have evolved a mechanism to evade adaptive immunity by a. creating autoantibodies against activated T-cell populations. b. triggering T- and B-cell apoptosis. c. hiding within red blood cells of the body (similar to malarial infection). d. inducing the production of anti-inflammatory cytokines (IL-6 and IL-10). e. producing phagocytic chemorepellants and paralyzing neutrophils.

ANS: D DIF: Medium REF: 24.3 OBJ: 24.3e Summarize how activated T cells influence both humoral and cellular immunity MSC: Remembering 36. The antigen-binding receptor expressing hepatitis antigen in an infected liver cell would be a. TCR. d. CD4. b. MHC II. e. CD8. c. MHC I. ANS: C DIF: Easy REF: 24.3 OBJ: 24.3b Distinguish between class I and class II MHC proteins MSC: Understanding

37. Bacteremia is a condition in which live bacteria enter the bloodstream, but not the cells of the body. Which form of processing would occur to stimulate a cell-mediated immune response? a. bacterial peptide transported from cytoplasm to rER for presentation on MHC I b. endocytosis by APC followed by presentation on MHC II c. neutrophil phagocytosis with presentation on Fc receptor d. cytotoxic T-cell endocytosis for presentation on CD8 receptor e. B-cell capping for presentation on the B-cell receptor ANS: B DIF: Easy REF: 24.3 OBJ: 24.3c Outline T-cell activation; include the role of APCs

MSC: Understanding

38. Chlamydia trachomatis is a bacterial STD that lives intracellularly within human host cells. What immune response would most likely prevail in this infection? a. more TH2 cells than TH1 cells b. more TH1 cells than TH2 cells c. equal ratio of TH1 cells to TH2 cells d. more B cells than CD8 cells e. mostly antibodies ANS: A DIF: Medium REF: 24.3 OBJ: 24.3d Describe the process and function of T-cell education MSC: Understanding 39. The cells involved in shutting down immune responses that help prevent autoimmunity are a. B cells. d. Treg cells. b. TH17. e. mast cells. c. cytokines.

ANS: E DIF: Easy REF: 24.3 OBJ: 24.3f Recall how T cells regulate inflammation

MSC: Understanding

40. Myasthenia gravis is an autoimmune neuromuscular disease characterized by weakness of the skeletal muscles due to antiacetylcholine receptor antibodies. Thymectomy is a successful treatment for this condition in some patients because it a. removes all autoreactive B cells from the body. b. primes antigen-presenting cells to reverse their response to self tissue. c. neutralizes the autoantibodies from the body. d. produces proteins to bind the autoantibodies before reaching their target. e. prevents further miseducation of T-cell populations.

ANS: E DIF: Difficult REF: 24.3 OBJ: 24.3d Describe the process and function of T-cell education MSC: Applying 41. Regulation of complement destruction of normal body cells is controlled by a. CD8, serum factor C3b, and serum albumin. b. CD58, serum factor H, and decay-accelerating factor. c. CD4, serum factor Bb, and decay-accelerating factor. d. MHC I, serum factor C5a, and serum lipoprotein. e. MHC II, serum albumin, and T regulatory cells.

ANS: B DIF: Medium REF: 24.4 OBJ: 24.4b Summarize the mechanisms that regulate complement activation MSC: Remembering

42. A mutation that caused a person to have an ineffective complement C6 protein would have a direct effect on formation of a. complement-antibody complex. b. C3 convertase. c. C3b opsonins for phagocytosis. d. membrane attack complex. e. C5 convertase.

ANS: D DIF: Easy REF: 24.4 OBJ: 24.4c List the roles of complement C3a, C4a, and C5a cleavage fragments MSC: Applying 43. What cells are NOT associated with the gut epithelia? a. columnar epithelial cells d. B cells b. intestinal epithelial cells e. helper T cells c. goblet cells ANS: E DIF: Easy REF: 24.5 OBJ: 24.5a Recall the cell types present in the gut epithelia and lamina propria and their functions MSC: Understanding 44. The gut is able to distinguish between indigenous microbiota and pathogens by using which part of epithelial cells? a. TLRs and NLRs d. IL-22 b. SIgA e. ILCs c. cytokines ANS: A DIF: Difficult REF: 24.5 OBJ: 24.5c Explain how the gut immune system mounts a response to pathogens but not indigenous microbiota MSC: Understanding 45. Innate lymphoid cells in the gut can be stimulated by a. Treg cells. d. IgA. b. cytotoxic T cells. e. SIgA. c. hormones.

ANS: C DIF: Easy REF: 24.5 OBJ: 24.5b Categorize gut immunity into innate and adaptive immune responses MSC: Remembering 46. Which antibodies help compartmentalize the gut system? a. IgM d. IgG b. IgE e. IgD c. IgA ANS: C DIF: Difficult REF: 24.5 OBJ: 24.5d Assess the importance of compartmentalizing the gut immune system and recall how it is achieved MSC: Understanding 47. Which of the following is NOT associated with overall human health? a. introduction of Treg cell production b. encounters with TLRs c. antigen interactions with dendritic cells d. encounters with NLRs

e. fecal transplant ANS: E DIF: Medium REF: 24.5 OBJ: 24.5e List the ways the microbiome influences gut immunity and overall human health MSC: Applying 48. The ________ vaccine is inactivated. a. influenza b. DTap c. hepatitis B

d. HPV e. MMR

ANS: A DIF: Easy REF: 24.6 OBJ: 24.6a Compare and contrast the different types of vaccines MSC: Applying 49. If infections are spread by person-to-person contact, what percentage of the population will be protected against herd immunity if people are not vaccinated? a. 66% d. 100% b. 25% e. 40% c. 10% ANS: A DIF: Easy REF: 24.6 OBJ: 24.6c Judge whether herd immunity will protect against a particular disease MSC: Remembering 50. The ________ vaccine stimulates cell-mediated immunity. a. Sabin live polio d. acellular pertussis b. influenza e. PCV c. inactivated polio ANS: A DIF: Easy REF: 24.6 OBJ: 24.6e Identify the factors that determine whether an immune response is primarily humoral or cellular MSC: Understanding SHORT ANSWER 1. In 2004, doctors successfully used gene therapy with a severely defective leukemia virus to insert a cytokine receptor gene needed for T-cell development into the bone marrow of four children with severe combined immunodeficiency (SCID). What is SCID, and how did doing this procedure address the disease?

ANS: Severe combined immunodeficiency (SCID) is frequently inherited as an X-linked genetic disorder. In some patients, the gene mutation involves the accumulation of a toxic by-product due to the lack of the adenosine deaminase enzyme. In other patients, the gene mutation causes a failure to produce a receptor needed for T-cell development. In both cases, the result is severe immunodeficiency to the point that the patients must live within a completely sterile environment.

The children in the 2004 medical breakthrough inherited the second gene mutation mentioned above. By replacing the defective gene through gene therapy targeting their bone marrow cells, the children were able to make T cells with the correct receptor and in turn stimulate B cells, allowing the children to develop an immune response and effectively correcting the immunodeficiency.

DIF: Medium REF: 24.3 OBJ: 24.3a Name different types of T cells and recall their functions

MSC: Applying 2. Why are macrophages, monocytes, mast cells, and dendritic cells considered ―professional‖ antigen-presenting cells, whereas fibroblasts are considered ―nonprofessional‖ antigen-presenting cells?

ANS: Macrophages, monocytes, mast cells, and dendritic cells are considered ―professional‖ antigen-presenting cells because they are programmed to actively carry out endocytosis and present antigen through the MHC II presentation pathway to stimulate T cells. In addition, all these cells are from a hematopoietic lineage, thought to be necessary for presentation for T-cell activation. Fibroblast cells have been shown to also induce T-cell activation but require the right cellular circumstances and conditions for this to happen, so therefore are considered ―nonprofessional.‖ DIF: Medium REF: 24.3 OBJ: 24.3b Distinguish between class I and class II MHC proteins MSC: Analyzing 3. Why is type AB blood considered to be the ―universal recipient‖? Explain what this means in terms of the antigens and antibodies present in blood types.

ANS: Antibodies in the serum of an individual with one blood type bind antigens on the red blood cells of a different blood type. For example, type A people carry anti-B antibodies, type B people carry anti-A antibodies, and type O (universal donor) individuals carry both anti-A and anti-B antibodies. Type AB people have both type A and type B cells in their blood, so their body makes neither anti-A antibodies nor anti-B antibodies. Because of this they are considered universal recipients, meaning that they can be transfused with any of the ABO blood types (A, B, AB, or O).

DIF: Medium REF: 24.1 OBJ: 24.1d Express the meaning of immunological specificity

MSC: Analyzing

4. How can a person who has taken penicillin for a childhood ear infection later develop an allergy to penicillin when prescribed that drug again?

ANS: Penicillin is an example of a hapten. Haptens are small (molecular weight less than 1,000), incomplete antigens that need a carrier protein to become immunogenic. Primary immune recognition of penicillin occurred when the penicillin bound to a carrier protein, making it an immunogenic antigen. This initiated an immune response that ultimately resulted in the formation of antipenicillin antibodies. The IgE class could then sensitize mast cells, which would cause an allergic response upon subsequent penicillin exposure.

DIF: Medium REF: 24.7 OBJ: 24.7a Distinguish between hypersensitivity and autoimmunity MSC: Analyzing 5. If a person is infected with the cold virus one year, why can he or she still catch a cold again the next year, even if his or her immune system is working properly?

ANS:

Cross-protection of antibodies created from exposure to one microbe only affords protection against a second exposure if the proteins critical to the pathogenesis of the two organisms share key antigenic determinants. In the case of the cold virus, cross-protection against strains of rhinovirus frequently does not work because the viral proteins that attach to the ICAM-1 cell surface molecule differ drastically between cold virus strains; therefore, neutralizing antibodies created in the first exposure will not protect from exposure to a different strain.

DIF: Medium REF: 24.3 OBJ: 24.3g List some strategies microbes use to evade the adaptive immune system MSC: Applying 6. Describe the structure of a typical IgG antibody, including the F(ab')2 and Fc portions.

ANS: The general structure of an antibody is the glycoprotein structure consisting of four polypeptide chains, two identical heavy and two identical light chains, held together by disulfide bonding. IgG has a classic monomeric Y-shaped structure and is found free-floating in the bloodstream. The top part of the Y contains two binding regions for antigen, or variable regions (often called the F(ab')2 portion). The bottom part of the Y contains the binding region for cells, or constant regions, called the Fc region. Cells can bind to the Fc region using the Fc receptor. The classical complement cascade can also bind the Fc region to induce complement. The F(ab')2 and Fc portions were originally determined by endoprotease-digestion experiments.

DIF: Medium REF: 24.2 OBJ: 24.2a Assess how the structure of an antibody relates to its function MSC: Analyzing 7. A surgical patient infected with a blood-borne Staphylococcus would initially produce an anti-staphylococcal antibody of the IgM class. Why is that?

ANS: This patient would be undergoing a primary antibody response (antibodies produced during first exposure to antigen). Early synthesis and secretion of IgM antibodies against the antigen by naïve B cells would occur. The IgM class would predominate because naïve B cells already produce membrane-bound IgM, and the switch in this case is initially from a membrane-bound form to a secretory form of IgM. Later in the infection, isotype switching (or class switching) occurs, usually to the gamma class creating IgG. IgG will then predominate, and IgM and IgG levels in the blood will decline as the immunogen is cleared.

DIF: Medium REF: 24.2 OBJ: 24.2a Assess how the structure of an antibody relates to its function MSC: Analyzing 8. Omenn syndrome is an immune disorder associated with mutations in the recombination-activating genes (RAG1 and RAG2) needed for gene switching in lymphocytes. What effect would this mutation have on B cells, T cells, and the overall health of the adaptive immune response?

ANS:

Gene switching occurs during the development of progenitor B cells to mature naïve B cells and in the maturation of progenitor T cells to mature naïve T cells in the B-cell receptors (with a membrane-bound antibody) and T-cell receptors, respectively. The DNA for these receptors consists of many gene segments (called VDJ segments) that are deleted during the process of gene switching. Recombinational events between recombinational signal sequence signals flanking the VDJ regions (by RAG 1 and RAG 2) allow for one V, one D, and one J segment to be joined close together (deleting the intervening V, D, and J sequences), resulting in a unique receptor specificity and creating receptor diversity within the B- and T-cell populations for diverse antigen binding. A person with Omenn syndrome would not be able to make B- and T-cell receptors for antigen binding and would suffer from severe immunodeficiency of the adaptive immune response.

DIF: Difficult REF: 24.3 OBJ: 24.3d Describe the process and function of T-cell education MSC: Applying 9. Using the figure below, interpret what is occurring at stage 3.

ANS: Epithelial cells, macrophages, and dendritic cells present antigens to cells located in Peyer’s patches.

DIF: Medium REF: 24.5 OBJ: 24.5c Explain how the gut immune system mounts a response to pathogens but not indigenous microbiota MSC: Applying 10. Some patients suffering from bare lymphocyte syndrome (BLS), a rare immunodeficiency, have a genetic mutation in their TAP1/TAP2 genes causing the production of a defective TAP transporter.

Describe what effect this has on antigen processing and in what cells.

ANS: TAP transporters are part of the endogenous antigen (antigens found within the cytoplasm of a cell—e.g., intracellular bacterial or viral infection) presentation pathway. Foreign antigenic peptides made in cell cytoplasm are taken up into lumen of rough endoplasmic reticulum (rER) by TAP transporter proteins. Antigenic peptides are then loaded into major histocompatibility complex (MHC) class I receptors in rER and transported by the Golgi complex through the secretory vesicle pathway to the plasma membrane for expression of the MHC I peptide complex.

All nucleated body cells can produce MHC I and therefore can undergo this processing. Patients suffering from BLS would not be able to transport endogenous antigenic peptides from the cytoplasm to the lumen of the rER, and therefore would not be able to undergo any further steps in the processing pathway above.

DIF: Difficult REF: 24.3 OBJ: 24.3b Distinguish between class I and class II MHC proteins MSC: Applying 11. Detail the benefits and predict possible risks of vaccinations.

ANS: Benefits of vaccines include lowering the risk of infection from certain diseases, prevention of certain life-threatening illnesses, and help to allow for herd immunity to protect unvaccinated.

Cons to vaccines include the small chance of the disease and loss of herd immunity if enough individuals are not vaccinated.

DIF: Difficult vaccines MSC: Applying

REF: 24.6

OBJ: 24.6d Evaluate the benefits and risks of

12. If a person was unable to undergo negative selection during T-cell education, what is T-cell education, and why would this be a severe immune problem?

ANS: T-cell education is a two-step process in the thymus that teaches T cells what self antigens are present in the body. In positive selection, the first part of the education process, T cells that have T-cell receptors (TCRs) that can weakly bind to self MHC proteins displayed on the thymus epithelial cells are allowed to survive. The second part of the process is negative selection. This is where T cells that have TCRs that bind too strongly to self MHC proteins displayed on the thymus epithelial cells are killed. If a person was unable to undergo negative selection, then the naïve immunocompetent T cells released from the thymus into the body would be able to bind too tightly to self MHC, causing an increased likelihood of activation to self tissues (autoimmunity).

DIF: Medium REF: 24.3 OBJ: 24.3d Describe the process and function of T-cell education MSC: Applying

13. X-linked hyper IgM syndrome (XHIM) is an immunodeficiency disorder caused by mutations of the gene encoding CD154. Why is this disease characterized by recurrent infections (starting in childhood) and elevated serum levels of IgM? ANS: B-cell activation requires two sets of signals.

The first set of signals includes (1) capping (cross-linking of B-cell receptors) and (2) antigenic pieces produced by innate functions (e.g., complement binding a bacteria or virus, or Toll-like receptor activation). This first set of signals results in only secretory IgM production.

The second set of signals (later in the primary antibody response) requires helper T cells and includes (1) antigen-bound MHC II on the B-cell cross-linking to the T-cell receptors of antigen-specific helper T cells, and (2) secondary cross-linking of CD154 (on the helper T cell) with CD40 (on the B cell). This set of signals induces class differentiation and maturation into plasma or memory B-cell populations.

In XHIM, the second signal in the second set of signaling does not happen. As a result, B cells (1) fail to induce class differentiation (to other Ig classes) and (2) hyper IgM levels fail to mature into plasma or memory B-cell populations; therefore, there is recurrent infection with the same antigen.

DIF: Difficult REF: 24.3 OBJ: 24.3b Distinguish between class I and class II MHC proteins MSC: Evaluating 14. Would treating a person infected with human immunodeficiency virus (HIV) who has recently developed acquired immunodeficiency syndrome (AIDS) using a helper T-cell transfusion work?

Why or why not?

ANS: Answers will vary. HIV infects TH cells by binding to the CD4 receptor. As the disease progresses, CD4 TH cell counts begin to decrease from normal levels (1,000 per microliter blood). The drop in CD4 TH cells gives rise to an increase in opportunistic infections. AIDS develops when CD4 T H cells drop below 400. Although a CD4 TH cells transfusion would initially seem beneficial to combat the dropping counts and increasing opportunistic infection, any CD4 TH cells transfused would have to be tissue-typed to have matching major histocompatibility complexes (MHC) between donor and recipient. If not matched, the transfused cells would be recognized as foreign and a transfusion rejection reaction would occur.

DIF: Difficult REF: 24.3 OBJ: 24.3e Summarize how activated T cells influence both humoral and cellular immunity MSC: Evaluating 15. Using the information presented in the table below, discuss why most vaccines are given between birth and 24 months.

ANS: Vaccines are given in the first 24 months of a baby’s life because newborns are most vulnerable to acquiring diseases. Their immune systems are not fully developed. However, notice that vaccines are spaced out, again for the same reason. Babies’ immune systems are not fully developed.

DIF: Medium REF: 24.6 OBJ: 24.6b Explain why most vaccines are administered during childhood in multiple doses MSC: Evaluating 16. List the steps for the classical complement cascade. Discuss two ways this cascade results in microbial destruction.

ANS: The classical complement cascade is a series of proteins binding in a specific order to induce a membrane attack complex (MAC) pore, destroying the microbe. The steps include: C1 binds to the Fc region of the antibody bound to an antigen surface; C1 cleaves C2 and C4 into two fragments each; One fragment from C2 and another from C4 bind together, forming C3 convertase; C3 convertase cleaves C3 into C3a and C3b; C3b binds to C3 convertase to form C5 convertase; C5 convertase cleaves C5 into C5a and C5b; and C5b sticks to the antigen surface, recruiting C6, C7, C8, and multi-C9 to form MAC. A MAC complex can destroy a microbe because the pore created allows for extracellular materials to leak into the microbial cell and intracellular materials to leak out, resulting in cell lysis. Additionally, C3b stuck to the microbe is an opsonin, inducing phagocytic destruction (phagocytes recruited by the released chemoattractant complement fragments—C3a, C4a, and C5a).

DIF: Medium REF: 24.4 OBJ: 24.4a Compare the classical complement pathway to the alternative pathway MSC: Analyzing 17. Why are antihistamines good for allergic rhinitis but not for atopic asthma?

ANS: Antihistamines are good for allergic rhinitis because they block histamine receptors from binding to histamine released by mast cells. Antihistamines are not as good for atopic asthma because there is more leukotriene release occurring in that response. In asthma, mast cells cause eosinophil chemotaxis and the eosinophils release large amounts of leukotrienes, causing vasoconstriction and inflammation (called late-phase anaphylaxis). Antihistamines are useless at this point, so inhaled steroid treatment (to minimize inflammation) and bronchodilators (to open airways) must be used.

Singulair, a newer asthma treatment, works to block leukotriene receptors in the lungs (which is more similar in action to an antihistamine).

DIF: Medium REF: 24.7 OBJ: 24.7b Compare and contrast the four different types of hypersensitivity reactions MSC: Analyzing 18. A patient presents in the emergency room with large red lesions up and down his arms. His case history reveals that he works for a gardening company, and that this rash most likely developed after clearing a weedy bank two days prior. The resident on duty concludes that the rash is a result of poison ivy exposure. Immunologically speaking, what is going on in this man’s body, and what type of immune response is he experiencing?

ANS:

This man is experiencing a type IV, delayed-type hypersensitivity (DTH) triggered by antigen-specific T cells. These reactions generally take between 24 and 48 hours to develop, as distinguished from antibody-mediated allergic reactions. He first underwent a sensitization stage sometime prior to this exposure. During his initial exposure, the antigen (poison ivy oil) was processed and presented on antigen-presenting cells (APCs). TH0 cells interacted with the APCs, generating activated T cells and subsets of T memory cells.

With this latest exposure (the secondary exposure), DTH was induced in one of two ways: (1) memory TH1 cells bound antigen presented in MHC II receptors at the site of exposure, releasing IFN-g, TNF-b, and IL-2 and subsequently recruiting and activating macrophages, neutrophils (polymorphonuclear cells [PMN]), and natural killer cells. This caused a bystander effect (damage of local tissue due to inflammatory release). (2) Memory TC cells interacted with antigens on MHC I receptors, becoming activated and directly killing host cells (causing inflammation).

DIF: Difficult REF: 24.7 OBJ: 24.7b Compare and contrast the four different types of hypersensitivity reactions MSC: Analyzing 19. Systemic lupus erythematosus (SLE) is a chronic, inflammatory autoimmune disorder affecting the skin, joints, kidneys, and other organs. A hallmark of lupus is the production of an array of autoantibodies. Some scientists believe that the autoantibody formation seen in lupus is a result of Epstein-Barr virus molecular mimicry. What do these scientists believe has happened in the case of lupus? Give one example as evidential support.

ANS: Autoimmunity is the loss of tolerance to self antigens resulting in abnormal immune attack on self tissue that involves either antibodies or T cells. Those with pathology associated with autoimmunity essentially exhibit hypersensitivity reactions resulting when autoantibodies (through antibody-dependent cell-mediated cytotoxicity) or autolymphocytes cause tissue damage.

Formation of autoantibodies is thought to occur via the possible escape of occasional self-reactive B cells from negative selection. These B cells may process self proteins, or foreign proteins mimicking self proteins, and can be activated by T cells, causing autoantibody production.

In the case of lupus, the Epstein-Barr virus may have a self-like molecule (as part of a nonself viral protein) that when processed by the immune system results in an antibody that binds self cells, causing pathology. Examples of this include Streptococcus pyogenes M proteins (pili) creating cardiac autoantibodies, leading to rheumatic fever, and coxsackievirus, which has an antigen similar to the glutamic acid decarboxylase in pancreatic islet cells, creating self-reactive Tc cells that cause Type 1 diabetes.

DIF: Difficult REF: 24.7 OBJ: 24.7d Summarize the factors leading to autoimmune diseases MSC: Analyzing 20. Would taking probiotic health supplements be good for the average person’s immunity?

ANS: Answers will vary. The Special Topic 24.1 reading in the text discusses an experiment with transgenic, gnotobiotic mice (NF B-lux). NF B is a transcription factor for production of pro-inflammatory cytokines, and the lux gene causes light emission when NF B is activated. Two groups of mice were tested: group 1 was fed pathogenic Salmonella enterica only; group 2 was fed commensal Bifidobacterium infantis for three weeks prior to Salmonella enterica infection. Group 2 showed lower inflammation (less NF B light production) and higher regulatory T cells. This experiment concluded that commensals prime intestinal immunity for protection from inflammation.

Probiotics are over-the-counter health supplements that people can take to increase the population of commensal bacteria in their intestines. Based on the gnotobiotic mouse experiment, one may extrapolate that commensals prime intestinal immunity and increase regulatory T cells, and therefore would be good for one’s immunity (by protecting from inflammation).

DIF: Difficult REF: 24.7 OBJ: 24.7c Recall some treatments for hypersensitivity reactions MSC: Evaluating

CHAPTER 25: Microbial Pathogenesis MULTIPLE CHOICE 1. The disease filariasis, commonly known as elephantiasis, is caused by a(n) a. ectoparasite. d. bacterium. b. endoparasite. e. fungus. c. insect.

ANS: B DIF: Easy REF: 25.1 OBJ: 25.1c Distinguish between parasites, primary pathogens, opportunistic pathogens, and reservoirs MSC: Remembering 2. Which of the following are also categorized as frank, or strict, pathogens? a. parasites d. primary pathogens b. endoparasites e. opportunistic pathogens c. ectoparasites ANS: D DIF: Easy REF: 25.1 OBJ: 25.1c Distinguish between parasites, primary pathogens, opportunistic pathogens, and reservoirs MSC: Analyzing 3. The term used to designate how many bacteria or viruses are required to kill 50% of an experimental group of hosts is a. ID50. d. infectivity. b. LD50. e. virulence. c. pathogenicity.

ANS: B DIF: Easy REF: 25.1 OBJ: 25.1d Compare and contrast the LD50 and the ID50 4. Yellow fever and West Nile virus are both a. cancer causing. b. hemorrhagic viruses. c. close relatives of herpes virus.

MSC: Remembering

d. diarrheagenic viruses. e. flaviviruses.

ANS: E DIF: Easy REF: 25.1 OBJ: 25.1a Explain how Koch’s postulates are modified for viral pathogens MSC: Analyzing 5. Which of the following statements is NOT correct about disease reservoirs? a. Reservoirs are mammals or birds, but not insects. b. A vector can be the reservoir of a disease. c. A reservoir is an integral part of the disease cycle. d. Disease-control measures must consider the biological reservoir. e. A reservoir is ultimately the source of infection in a population.

ANS: A DIF: Easy REF: 25.1 OBJ: 25.1e Decide whether an infection cycle is direct or indirect and ascertain the mode of transmission MSC: Remembering 6. Which of the following diseases is transmitted by the mosquito Aedes aegypti? a. yellow fever d. listeriosis b. Ebola e. SARS c. epidemic typhus ANS: A DIF: Easy REF: 25.1 OBJ: 25.1g Describe the role of immunopathogenesis in disease pathology MSC: Remembering 7. An example of vertical transmission of infectious agents is a. Staphylococcus spp. gaining antibiotic resistance genes through conjugation. b. HIV passing from mother to child in utero. c. an infectious ameba obtained from a water sample. d. influenza being passed by a sneeze. e. hepatitis being transmitted by an infected needle stick.

ANS: B DIF: Easy REF: 25.1 OBJ: 25.1e Decide whether an infection cycle is direct or indirect and ascertain the mode of transmission MSC: Understanding 8. A chef cut her finger accidentally. The next morning, she felt pain and warmth and had a little swelling and redness on that finger (which are signs of inflammation). By that night, she was just fine. Which of the following pertains to the chef? a. She had an overt microbial disease. b. She had an infection. c. The inflammation was a response to the cut, not a microbe. d. Microbial toxins, not the vegetative cells, induced inflammation. e. The cut introduced ectoparasites that could not survive.

ANS: B DIF: Easy REF: 25.1 OBJ: 25.1f Identify portals of entry for infectious agents

MSC: Understanding

9. Consider two isolates, A and B. Microbe A had an LD50 of 5  104, while microbe B recorded an LD50 of 5  107. Which isolate is more virulent? a. unable to know based on information provided b. microbe A c. microbe B d. They are equally virulent. e. The values indicate that neither one is virulent.

ANS: B DIF: Easy REF: 25.1 OBJ: 25.1d Compare and contrast the LD50 and the ID50

MSC: Applying

10. The likely mode of transmission of a bacterial disease in which incidence increases with a prolonged warm summer is a. direct transmission. d. common source fomite. b. airborne transmission. e. sexual transmission. c. insect vector transmission.

ANS: C DIF: Difficult REF: 25.1 OBJ: 25.1g Describe the role of immunopathogenesis in disease pathology

MSC: Understanding 11. Pathogenicity islands include all of the following EXCEPT that a. genes are not expressed as operons. b. GC/AT ratio differs from the rest of the genome. c. residual phage genomes flank the island. d. they are often linked to tRNA. e. they encode the type III protein secretion (T3SS) export systems.

ANS: A DIF: Difficult REF: 25.2 OBJ: 25.2d Define pathogenicity islands and describe how researchers recognize them MSC: Remembering 12. The current classification of bacteria pili is based on ________ rather than ________. a. phenotype; function d. origin; protein sequence b. function; amino acid sequence e. size; phenotype c. protein sequence; phenotype ANS: C DIF: Difficult REF: 25.3 OBJ: 25.3a Recall mechanisms used by viruses and bacteria to attach to host cells MSC: Analyzing 13. Synthesis of flagella and pili filaments in Gram-negatives share which of the following attributes? a. Protein export systems are used to deliver subunits to the outside. b. Chaperones are not needed for protein transport. c. There is no periplasmic stopover. d. Flagellar and pili proteins are added in sequence intracellularly. e. Flagellar and pili proteins do not extend beyond the periplasm.

ANS: A DIF: Difficult REF: 25.3 OBJ: 25.3a Recall mechanisms used by viruses and bacteria to attach to host cells MSC: Understanding 14. A life-threatening lung infection caused by biofilm formation in cystic fibrosis patients is a. Pseudomonas aeruginosa. b. Staphylococcus epidermidis. c. Mycobacterium tuberculosis. d. Vibrio cholerae. e. Bordetella pertussis.

ANS: A DIF: Easy REF: 25.3 OBJ: 25.3d Summarize the role of biofilms in infections

MSC: Understanding

15. Type I and Type IV pili both a. are similar in mode of secretion. b. are mannose resistant. c. have an assembly that does not involve the secA general secretory pathway. d. are encoded by a pathogenicity island. e. are exclusively used for pathogenesis.

ANS: C DIF: Difficult REF: 25.3 OBJ: 25.3b Compare and contrast the assembly of type I and type IV pili MSC: Understanding

16. Multivalent adhesion molecule 7, or MAM7, is a unique adhesion because it a. is expressed late in an infection. b. is found only in Gram-positive organisms. c. is important in initiating infection. d. decreases the LD50 of an organism. e. acts as a toxin.

ANS: C DIF: Medium REF: 25.3 OBJ: 25.3c Explain how differences in host susceptibility occur MSC: Understanding 17. Biofilms play a major role in enhancing bacterial virulence because a. biofilm strains are mutants. b. the exopolymer matrix is highly toxic and mutagenic. c. biofilm bacteria are intracellular pathogens. d. bacteria in biofilms are more resistant to antimicrobials and phagocytosis. e. low bacteria density does not alert the human immune system.

ANS: D DIF: Easy REF: 25.3 OBJ: 25.3d Summarize the role of biofilms in infections

MSC: Understanding

18. Exotoxins a. are secreted by Gram-positive bacteria only. b. primarily contain glycolipids. c. are protein toxins made by Gram-positive and Gram-negative bacteria. d. serve as adhesins for mucosal pathogens. e. contain lipid A. ANS: C DIF: Easy REF: 25.4 OBJ: 25.4a Distinguish between exotoxins and endotoxins

MSC: Remembering

19. The toxin gene in Corynebacterium diphtheriae is located on a. the plasmid. d. lysogenic phage genomes. b. mobile genes called transposons. e. the plasma membrane. c. bacterial chromosomes.

ANS: D DIF: Easy REF: 25.4 OBJ: 25.4f List toxins that disrupt protein synthesis

MSC: Remembering

20. Superantigens a. bore holes on eukaryotic cell membranes. b. inhibit phagocytosis. c. prevent degranulation of macrophages. d. are antipyrogenic. e. activate immune cells without being processed.

ANS: E DIF: Easy REF: 25.4 OBJ: 25.4e Compare different mechanisms of host cell cAMP disruption by bacterial exotoxins MSC: Remembering 21. What type of toxin is the alpha hemolysin of Staphylococcus aureus? a. protein synthesis inhibitor b. protease c. superantigen d. cell membrane disruptor

e. second messenger pathway disruptor ANS: D DIF: Easy REF: 25.4 OBJ: 25.4c Recall different types of membrane disrupting toxins and provide examples of each MSC: Remembering 22. Toxins with ADP ribosyltransferase activity cause a. membrane pore formation. b. immune system activation. c. proteolytic degradation of host proteins. d. adenylate cyclase inhibition. e. inhibition of elongation factor 2.

ANS: E DIF: Easy REF: 25.4 OBJ: 25.4b Name the nine functional categories of bacterial exotoxins MSC: Understanding 23. The enterotoxigenic Escherichia coli heat-labile toxin a. damages membranes. b. increases protein synthesis. c. activates second messenger pathways. d. activates immune response. e. acts as a capsule.

ANS: C DIF: Easy REF: 25.4 OBJ: 25.4b Name the nine functional categories of bacterial exotoxins MSC: Remembering 24. The cholera and Escherichia coli (traveler’s diarrhea) toxins ________, leading to high levels of cAMP in cells. a. ADP ribosylate the Gs factor b. ADP ribosylate adenyl cyclase c. inactivate ATP d. are bacterial adenylate cyclase e. phosphorylate the G factor ANS: A DIF: Difficult REF: 25.4 OBJ: 25.4e Compare different mechanisms of host cell cAMP disruption by bacterial exotoxins MSC: Understanding 25. Which of the following produces a toxin that disrupts protein synthesis? a. Clostridium perfringens d. Staphylococcus aureus b. Shigella dysenteriae e. Bacillus anthracis c. Listeria monocytogenes ANS: B DIF: Medium REF: 25.4 OBJ: 25.4b Name the nine functional categories of bacterial exotoxins MSC: Analyzing 26. Which of the following is a nonproteinaceous, yet toxic, compound found in all Gram-negative bacteria? a. endotoxin d. type III pili b. exotoxin e. type IV pili c. type I pili ANS: A

DIF: Medium

REF: 25.5

OBJ: 25.5b Compare and contrast the features of the seven export systems of Gram-negative bacteria MSC: Analyzing 27. Petechiae, which result from large amounts of endotoxin, are distinguished by which symptom? a. diarrhea d. fever b. a pseudomembrane e. a rash c. elephantiasis ANS: E DIF: Medium REF: 25.4 OBJ: 25.4c Recall different types of membrane disrupting toxins and provide examples of each MSC: Analyzing 28. Which of the following does NOT result from the release of endotoxin from Gram-negative bacteria? a. fever b. activation of the alternate complement pathway c. vasodilation d. hypertension e. shock ANS: D DIF: Medium REF: 25.4 OBJ: 25.4c Recall different types of membrane disrupting toxins and provide examples of each MSC: Analyzing 29. The anthrax, Escherichia coli, cholera, and Bordetella toxins all a. inhibit protein synthesis. b. possess ADP ribosyltransferase activity. c. cause diarrhea. d. disrupt the cell membrane. e. trigger apoptosis.

ANS: B DIF: Difficult REF: 25.4 OBJ: 25.4d Describe the structure and function of AB exotoxins MSC: Understanding 30. E. coli O157:H7 has a very low infectious dose because a. it is encapsulated. b. disease results from a synergistic action with Shigella. c. it is resistant to usually lethal gastric acid. d. the intestine has many receptors for the toxin. e. it secretes a superantigen.

ANS: C DIF: Medium REF: 25.5 OBJ: 25.5c Summarize the steps of toxin secretion through type II protein secretion system MSC: Understanding 31. Which of the following statements is NOT correct about a patient who died from endotoxin pathologies? a. Disseminated intravascular coagulation may have contributed to death. b. The methicillin-resistant Staphylococcus aureus, or MRSA, superbug is a likely suspect. c. The patient may have died from hypotension. d. The patient may not have run a fever if AIDS was present. e. The lipid A in the endotoxin is responsible for the virulence.

ANS: B DIF: Medium REF: 25.5 OBJ: 25.5a List the cellular processes that are evolutionarily related to toxin secretion MSC: Applying 32. Which of the following species causes whooping cough? a. Streptococcus mutans d. Neisseria gonorrhoeae b. Staphylococcus aureus e. Mycoplasma c. Bordetella pertussis ANS: C DIF: Easy REF: 25.5 OBJ: 25.5b Compare and contrast the features of the seven export systems of Gram-negative bacteria MSC: Analyzing 33. Which of the following protein secretory systems injects effector molecules directly from the bacterial cytoplasm into the host cytoplasm? a. type I d. type IV b. type II e. types I, II, III, and IV c. type III ANS: C DIF: Medium REF: 25.5 OBJ: 25.5b Compare and contrast the features of the seven export systems of Gram-negative bacteria MSC: Analyzing 34. Binding of the protein ________ of the EPEC pathogenicity system directly triggers a remarkable reorganization of host cellular cytoskeletal components. a. actin d. Nef b. SPI-1 e. Ivet c. intimin ANS: C DIF: Easy REF: 25.5 OBJ: 25.5d Identify examples of type III secretion systems

MSC: Remembering

35. A possible role for quorum sensing in pathogenicity is that it a. detects and responds to the pH as an indicator of the environment. b. delays production of toxins that may alert the host to the presence of the bacteria. c. monitors and responds to concentrations of ions such as magnesium. d. senses and responds to the population of phagocytes at the infection site. e. helps the pathogen escape the adaptive immune response.

ANS: B DIF: Medium REF: 25.6 OBJ: 25.6a Summarize some of the mechanisms pathogens use to determine their location within a host MSC: Remembering 36. Thick polysaccharide capsules are important virulence assets for a. Escherichia coli and Vibrio cholera. b. Clostridium tetani and Bacillus anthracis. c. Neisseria gonorrhoeae and Streptococcus pneumonia. d. Salmonella spp. and Staphylococcus aureus. e. Helicobacter pylori and Enterobacter cloacae.

ANS: C DIF: Medium REF: 25.6 OBJ: 25.6b Recall how pathogens can avoid extracellular immune detections MSC: Remembering

37. The ability to survive in the harsh environment of the phagolysosome is a virulence factor produced by a. uropathogenic Escherichia coli. b. Vibrio cholera. c. Bordetella pertussis. d. Helicobacter pylori. e. Coxilla burnetti.

ANS: E DIF: Medium REF: 25.6 OBJ: 25.6d Outline the three strategies intracellular pathogens use to prevent phagolysosome-induced death MSC: Remembering 38. Which of the following is classified as an intracellular bacterial pathogen? a. HIV d. Neisseria gonorrhoeae b. Streptococcus mutans e. Bacillus anthracis c. Listeria monocytogenes ANS: C DIF: Medium REF: 25.6 OBJ: 25.6c Distinguish between obligate and facultative intracellular pathogens MSC: Analyzing 39. Protein A helps Staphylococcus aureus avoid a. antibiotics. b. apoptosis. c. phagocytosis.

d. cytotoxic T cells. e. phagosome-lysosome fusion.

ANS: C DIF: Easy REF: 25.6 OBJ: 25.6d Outline the three strategies intracellular pathogens use to prevent phagolysosome-induced death MSC: Understanding 40. Bacteria that exhibit antigenic shifts and phase variations will most likely cause a. host immunity. b. recurrent infections in the exposed host. c. death each time a host is infected. d. subclinical infections. e. mild, acute infections.

ANS: B DIF: Difficult REF: 25.6 OBJ: 25.6e Categorize the mechanisms pathogens use to avoid immune detection MSC: Understanding 41. Salmonella and Shigella both a. produce shiga toxin. b. are Gram-positive rods. c. are resistant to gastric acid. d. cause typhoid fever. e. are facultative intracellular pathogens.

ANS: E DIF: Difficult REF: 25.6 OBJ: 25.6c Distinguish between obligate and facultative intracellular pathogens MSC: Understanding 42. Mycobacterium, Trypanosomia, and Leishmania spp. are all unique in that once they are intracellular, they down-regulate the IFN-gamma receptor, causing

a. b. c. d. e.

immune-response suppression. opsonization. complement activation. superantigen reactions. high fever responses.

ANS: A DIF: Medium REF: 25.6 OBJ: 25.6e Categorize the mechanisms pathogens use to avoid immune detection MSC: Understanding 43. Autophagy is used by a host cell to a. activate G-proteins. b. regulate phagocytosis. c. scavenge nutrients from damaged organelles. d. fight extracellular pathogens. e. induce apoptosis.

ANS: C DIF: Medium REF: 25.6 OBJ: 25.6b Recall how pathogens can avoid extracellular immune detections MSC: Understanding 44. Which organism did Koch use to synthesize his two postulates? a. Bacillus anthracis d. SARS b. Staph. aureus e. MERs c. Ebola ANS: A DIF: Easy REF: 25.1 OBJ: 25.1a Explain how Koch’s postulates are modified for viral pathogens MSC: Understanding 45. Which of the following is considered a virulence factor? a. TNF-Alpha d. Strep. pyogenes b. RNA e. capsules c. IFN-gamma ANS: E DIF: Difficult REF: 25.2 OBJ: 25.2a State the roles of virulence factors

MSC: Understanding

46. Which of the following bacteria would you expect to cause the most severe blood disease in a susceptible host? a. a rapidly growing encapsulated bacteria b. a flagellated acidophile c. a barophilic strain d. a piliated slow-growing bacteria e. a halophilic psychrophile ANS: A DIF: Difficult REF: 25.6 OBJ: 25.6d Outline the three strategies intracellular pathogens use to prevent phagolysosome-induced death MSC: Applying 47. Koch’s molecular postulates were originally formulated by a. Robert Koch. d. Matthew Lawrenz. b. Louis Pasteur. e. Stanley Falkow. c. Thomas Rivers.

ANS: C

DIF: Medium

REF: 25.1

OBJ: 25.1a Explain how Koch’s postulates are modified for viral pathogens MSC: Remembering 48. Tropheryma whipplei is the causative agent for Whipple’s disease. It could not be cultured until recently, when the genomic data showed that it a. was auxotrophic for some amino acids. b. was an obligate intracellular pathogen. c. needed a helper virus to grow. d. needed high levels of iron. e. is a virus that needs cell culture.

ANS: A DIF: Medium REF: 25.7 OBJ: 25.7a Explain how genomic tools help elucidate pathogen biology MSC: Remembering 49. Which of the following techniques would be used to identify unknown virulence genes that are only expressed in the host? a. in situ hybridization of cultured bacteria b. creating a genomic library of open reading frames of pathogen c. mutational studies in vitro d. culture techniques e. in vivo expression technology ANS: E DIF: Difficult REF: 25.7 OBJ: 25.7a Explain how genomic tools help elucidate pathogen biology MSC: Understanding 50. Which of the following types of information CANNOT be derived from the full genome of a noncultured bacterial pathogen? a. nutritional requirements b. toxin production c. infectious and lethal doses d. pathogenic islands e. cell receptor binding and tissue tropism ANS: C DIF: Difficult REF: 25.7 OBJ: 25.7a Explain how genomic tools help elucidate pathogen biology MSC: Applying SHORT ANSWER 1. What characteristics of a pathogen distinguish it from a commensal, in terms of its ability to infect and replicate within a eukaryotic host?

ANS: Commensals are essentially relegated to sites where the external environment interacts. These organisms coexist with the host, doing no damage. Pathogens have evolved systems to invade, trick, and take over host defense systems for their own benefit. Typically, genes expressing these virulence factors are only expressed in the eukaryotic host.

DIF: Easy REF: 25.6 OBJ: 25.6e Categorize the mechanisms pathogens use to avoid immune detection MSC: Applying

2. Define a fomite and give at least two specific examples.

ANS: A fomite is an inanimate object that when contaminated may be a mechanism for indirect transmission of a pathogen. Examples would be a shared hypodermic needle, contaminated tissues, or the dressing served at Thanksgiving dinner.

DIF: Easy agents MSC: Applying

REF: 25.1

OBJ: 25.1f Identify portals of entry for infectious

3. What is the rationale for designating disease-causing protozoa and worms as parasites, not as pathogens?

ANS: In a very broad sense, all disease-causing agents are parasites. However, the term ―pathogen‖ is used to describe very small etiologic agents such as bacteria, fungi, and viruses. The basis for the grouping is the size and complexity of the organisms.

DIF: Easy REF: 25.1 OBJ: 25.1e Decide whether an infection cycle is direct or indirect and ascertain the mode of transmission MSC: Applying 4. Microbes can be transmitted indirectly from one person to another by inanimate objects, collectively called fomites. Describe the role of fomites in the spread of influenza.

ANS: The influenza virus can be spread by aerosol and direct transmission. It can also be transmitted through fomites, for example, when a janitorial worker picks up contaminated tissue paper without gloves and later rubs her nose. The viral particles will go through the nasal portal of entry to cause disease. Door and elevator knobs are also culprit fomites in flu transmission.

DIF: Easy REF: 25.1 OBJ: 25.1c Distinguish between parasites, primary pathogens, opportunistic pathogens, and reservoirs MSC: Applying 5. Agent A has an LD50 of 400. Agent B has an LD50 of 600. Which is the more pathogenic agent, A or B? What is the relationship between this measure and microbial virulence?

ANS: Agent A is more virulent than agent B. Virulence is a measure of the severity or intensity of the disease-causing capacity of an organism. A low LD50 would mean that relatively few numbers of the microbe will kill 50% of test animals. Such an organism will be regarded as highly virulent.

Such organisms may possess capsules or other mechanisms of subverting or evading the host defenses. Similarly, organisms with high LD50 are considered as having low virulence.

DIF: Medium REF: 25.1 OBJ: 25.1d Compare and contrast the LD50 and the ID50

MSC: Evaluating

6. How does a pathogenicity island increase the ―fitness‖ of a microorganism (pathogen) to interact with a host and cause disease?

ANS:

Pathogenicity islands contain genes that encode multiple virulence factors including toxins and the type III secretion system (T3SS). The latter allows bacteria to directly inject effector molecules into the host cytoplasm. This ensures success for the microbe. In addition, the virulence genes are often coordinately expressed, enabling the organism to launch a successful attack and damage the host by producing virulence factors at the right time in response to an appropriate signal such as pH or temperature.

DIF: Easy REF: 25.2 OBJ: 25.2b List the molecular Koch’s postulates that confirm the identity of a pathogenicity gene MSC: Applying 7. Describe what is happening at step 1 in the figure below.

ANS: There is a fusion between an effector protein and beta-lactamase in the bacterial cell.

DIF: Medium REF: 25.7 OBJ: 25.7c State how fluorescence resonance energy transfer works and how it is used by researchers MSC: Applying 8. Type IV pili are essential for the interaction of Neisseria meningitidis with brain endothelial cells.

Describe the difference between the type IV and type I pili binding, and explain why knowing the type of binding is important in pathogenesis.

ANS: Type I pili adhere to mannose residues on the host cells, while the type IV pili are mannose resistant. In addition, type IV pili protein, unlike type I, are never free in the periplasm. They are transported directly to the cell surface. Type IV pili is SecA independent. Type IV pili is essential in allowing Neisseria meningitidis to cross the blood-brain barrier, allowing the pathology of meningitis to occur.

DIF: Medium REF: 25.3 OBJ: 25.3b Compare and contrast the assembly of type I and type IV pili MSC: Applying 9. Identify the parts labeled C, D, E, G, L, M, N in the figure below, and state what their purpose is.

ANS: They are protein components of the secretion system. They assemble and disassemble the pilus-like structure. They use it as a piston to push folded toxins or effector proteins through an outer membrane structure.

DIF: Medium REF: 25.5 OBJ: 25.5b Compare and contrast the features of the seven export systems of Gram-negative bacteria MSC: Applying 10. Briefly describe three classic modes of action of bacterial toxins. How are they similar? How are they different?

ANS:

(1) Some microbes damage the host membrane by forming pores, causing the leakage of cell constituents. (2) Some inhibit protein synthesis in the host. Depending on the pathogen, this may be by inactivation of elongation factor 2 (EF2) or of 28S rRNA. (3) Some activate second messenger pathways. These tend to act through G proteins to affect cAMP or cGMP levels, ultimately altering ion transport and fluid movement. (4) Other possibilities include the following: some bacterial toxins activate the immune response (super antigens); disrupt cell cycle; and disrupt the cytoskeleton, vesicle trafficking, exocytosis, and/or cell-cell adhesion. What is similar is that they will all ultimately disable a cell; all use slightly different cellular ways to do it.

DIF: Medium REF: 25.4 OBJ: 25.4c Recall different types of membrane disrupting toxins and provide examples of each MSC: Applying 11. Diphtheria toxin is a classic AB exotoxin. How does it cause host cell damage?

ANS: Diphtheria toxin is an AB toxin whose receptor-binding domain (B) binds to the host membrane, and the toxin enters by endocytosis. The catalytic subunit A is cleaved, but disulfide bonds hold the two subunits together until the endosome acidifies, reducing the disulfide bonds releasing the A subunit. The transmembrane domain allows the catalytic A peptide to pass through the vesicle membrane. It then ADP-ribosylates elongation factor 2 (EF2), halting protein synthesis and killing the cell.

DIF: Medium REF: 25.4 OBJ: 25.4d Describe the structure and function of AB exotoxins MSC: Applying 12. Describe what is occurring in the figure below.

ANS: The guanine and cytosine content of the pathogenicity island is different from the core genome.

DIF: Easy REF: 25.2 OBJ: 25.2b List the molecular Koch’s postulates that confirm the identity of a pathogenicity gene MSC: Applying 13. Describe what kind of assembly is occurring in the figure below, and identify the molecules that are present.

ANS: This figure shows an example of pilus assembly and disassembly. PilA is the protein and PilC1 and Y1 form an attachment tip.

DIF: Medium REF: 25.3 OBJ: 25.3b Compare and contrast the assembly of type I and type IV pili MSC: Applying 14. What process is occurring in the figure below? Describe that process.

ANS: This shows a type IV system showing Bordetella pertussis. It shows the transport of the pertussis toxin from the periplasm across the outer membrane.

DIF: Easy REF: 25.5 OBJ: 25.5b Compare and contrast the features of the seven export systems of Gram-negative bacteria MSC: Applying 15. There is no host cell receptor for the enteropathogenic Escherichia coli intimin adhesion. How does this pathogen successfully colonize human intestines?

ANS: The pathogen uses the type III secretory system to deliver the Tir protein into the host cell. The Tir protein is then used as the receptor for its adhesion, intimin.

DIF: Medium REF: 25.5 OBJ: 25.5c Summarize the steps of toxin secretion through type II protein secretion system MSC: Applying 16. Why is a microbial agent that prevents phagosome-lysosome fusion more virulent as an intracellular pathogen than one that is not?

ANS: If a pathogen can prevent phagosome-lysosome fusion, it avoids the hazard of lysosomal enzymes and therefore will not be degraded internally by phagocytes. A pathogen that cannot do this will be digested by phagocytes. Additionally, for many bacteria this compartment can now become a great home for subsequent microbial growth and infection.

DIF: Medium REF: 25.5 OBJ: 25.5d Identify examples of type III secretion systems

MSC: Applying

17. What are ubiquitination signals? Describe how a microbe can redirect these signals for its own purposes.

ANS: Ubiquitination signals are a cellular regulatory mechanism. Depending on where a protein is ubiquitylated, the protein can either be activated or, alternatively, tagged for destruction by the host proteasome. This process involves a cascade of the enzymes E1, E2, and E3 and also serves as an important mechanism for adaptive immunity (specifically MHC class I processing). Some pathogens make E3 ligases that cause the mistagging of cellular proteins that will be beneficial to the invading microbe (e.g., mumps and measles produce an E3 ligase to tag a component in the interferon signaling that would normally result in cellular destruction; instead, the host cell lives, producing a nice home for the virus).

DIF: Medium REF: 25.6 OBJ: 25.6e Categorize the mechanisms pathogens use to avoid immune detection MSC: Applying 18. What would be expected to happen to the Helicobacter pylori bacteria in a patient who has taken a large amount of antacids in the last month?

ANS: Antacids would reduce the pH of the stomach, where H. pylori lives in a large percentage of the population. Although the effects may differ from person to person (and microbe to microbe), you could anticipate that the H. pylori may change its gene expression to better adapt to the new environment (e.g., reducing urease production, increasing numbers due to its less acidic environment, and so on).

DIF: Medium REF: 25.6 OBJ: 25.6b Recall how pathogens can avoid extracellular immune detections MSC: Evaluating 19. Two Streptococcus pneumoniae strains, agent 1 and agent 2, are administered to groups of animals at different doses. Mortality rates are then measured for the animals that received each dose level of each agent. Agent 1 is found to have an LD50 of 400. Agent 2 is found to have an LD50 of 600.

Which one is producing a capsule and which one is not? How do you know?

ANS: Agent 1 (strain 1) is producing a capsule; agent 2 (strain 2) is not. Capsules make bacteria more virulent and thereby have a lower LD50.

DIF: Medium REF: 25.6 OBJ: 25.6e Categorize the mechanisms pathogens use to avoid immune detection MSC: Evaluating 20. Describe the use of digital gene expression (DGE) in host-pathogen relations. How does it work and what information can it tell us?

ANS:

DGE is a technology that uses beads covered with oligodeoxythymidine (oligo-DT) fragments to bind to poly-A tails of eukaryotic mRNA, allowing for those tagged mRNA molecules to be pulled down by centrifugation. The mRNA are then converted to cDNA, tagged with an oligonucleotide of a known sequence, and then deep sequenced. This allows for the determination of how many RNA transcripts were initially present. Using this technology can tell us the gene-regulation differences between uninfected and infected host cells, as shown in the Brucella example in the text. It could also be used with other infections to deduce similar genetic regulation.

DIF: Difficult REF: 25.7 OBJ: 25.7b Appraise the utility of RNA sequencing in understanding host pathogen interactions MSC: Applying

CHAPTER 26: Microbial Diseases MULTIPLE CHOICE 1. E. coli can cause which of the following infections? a. MRSA d. Rocky Mountain spotted fever b. encephalitis e. meningitis c. German measles ANS: E DIF: Easy REF: 26.1 OBJ: 26.1a List the ways microbial diseases can be classified and identify advantages and disadvantages of each MSC: Understanding 2. What type of disease is an infection that normally affects animals but can be transmitted to humans? a. zoonotic d. recurrent or cyclic b. herd e. community acquired c. fulminating ANS: A DIF: Easy REF: 26.1 OBJ: 26.1c Define differential and zoonotic disease

MSC: Understanding

3. Many infectious diseases display similar ________, making diagnosis difficult. a. syndromes d. disease mechanisms b. symptoms e. modes of transmission c. vectors ANS: B DIF: Easy REF: 26.1 OBJ: 26.1b Justify the role of the patient history in disease diagnosis MSC: Applying 4. A clinician would most likely treat MRSA with a. penicillin G. d. ciprofloxacin. b. tetracycline. e. amoxicillin. c. vancomycin.

ANS: C DIF: Medium REF: 26.2 OBJ: 26.2a State some common infectious diseases of the skin, their symptoms, and their etiological agents MSC: Applying 5. German measles and ________ are different names describing the same disease. a. shingles d. varicella b. rubeola e. smallpox

c. rubella ANS: C DIF: Easy REF: 26.2 OBJ: 26.2a State some common infectious diseases of the skin, their symptoms, and their etiological agents MSC: Understanding 6. Rubeola measles is caused by ________ virus. a. hepatitis B d. rhinovirus b. varicella e. adenovirus c. paramyxovirus ANS: C DIF: Easy REF: 26.2 OBJ: 26.2a State some common infectious diseases of the skin, their symptoms, and their etiological agents MSC: Remembering 7. The major challenge with treating flesh-eating disease caused by Streptococcus pyogenes is that a. the bacterium is a multidrug-resistant pathogen. b. no antibiotic is useful, because it’s a mixed infection. c. toxin-encoding phage also encode antibiotic-degrading enzymes. d. the causative agent is an MRSA. e. rapid necrosis of infected tissue limits treatment access.

ANS: E DIF: Medium REF: 26.2 OBJ: 26.2c Distinguish between Staphylococcus aureus and Streptococcus pyogenes MSC: Understanding 8. A 15-year-old female was said to have Koplik’s spots after a doctor’s examination. This suggests that a. she has measles caused by the rubeola virus. b. no antibiotic is useful because it’s a mixed infection. c. she has a toxin-encoding phage that also encodes antibiotic-degrading enzymes. d. the causative agent is a MRSA. e. rapid necrosis of infected tissue has limited access to the antibiotic.

ANS: A DIF: Difficult REF: 26.2 OBJ: 26.2a State some common infectious diseases of the skin, their symptoms, and their etiological agents MSC: Understanding 9. Which of the following is NOT a symptom of influenza? a. fever d. sore throat b. runny nose e. headache c. muscle aches ANS: B DIF: Easy REF: 26.3 OBJ: 26.3c State some respiratory tract infectious diseases, their symptoms, and their etiological agents MSC: Understanding 10. Streptococcus pneumoniae causes all of the following EXCEPT a. meningitis. d. necrotizing fasciitis. b. lobar pneumonia. e. bacteremia. c. bronchopneumonia.

ANS: D DIF: Easy REF: 26.2 OBJ: 26.2c Distinguish between Staphylococcus aureus and Streptococcus pyogenes MSC: Remembering

11. What virus is shown in the figure below?

a. HIV b. MRSA c. Ebola

d. influenza e. rhinovirus

ANS: C DIF: Easy REF: 26.3 OBJ: 26.6g Summarize the life cycle of the Ebola virus and how it causes disease MSC: Understanding 12. A tuberculin skin test on a patient with an active tuberculosis disease will result in a. a negative result. d. an ulcerating lesion. b. a positive result. e. severe bruising. c. profuse bleeding.

ANS: B DIF: Difficult REF: 26.3 OBJ: 26.3e Explain why tuberculosis is a reemerging disease

MSC: Applying

13. Using the figure below, what does RML stand for?

a. right mediastinum lobe b. right lower lobe c. right middle lobe

d. right upper lobe e. right middle lung

ANS: C DIF: Easy REF: 26.3 OBJ: 26.3a Compare and contrast viral, fungal, and bacterial respiratory infections MSC: Applying 14. Which of the following respiratory infections is caused by a viral pathogen? a. diphtheria b. whooping cough c. tuberculosis d. Legionnaires’ disease e. severe acute respiratory syndrome ANS: E DIF: Easy REF: 26.3 OBJ: 26.3c State some respiratory tract infectious diseases, their symptoms, and their etiological agents MSC: Understanding 15. Bacterial infections of the lung that arise secondary to viral disease are attributable in part to a. the high virulence of the bacterial pathogen. b. viruses providing attachment receptors for the bacteria. c. the host’s phagocytes mutating. d. an impaired mucociliary escalator due to dehydration of the host. e. the low virulence of the viral disease.

ANS: D DIF: Medium REF: 26.3 OBJ: 26.3b Describe how viral infections predispose patients to secondary bacterial infections MSC: Understanding 16. All of the following are true for a positive tuberculin skin test EXCEPT that a. latent tuberculosis is indicated. b. it signifies active disease in all patients. c. a delayed-type hypersensitivity reaction occurred. d. the purified protein derivative is the antigen. e. redness and some swelling was observed.

ANS: B DIF: Medium REF: 26.3 OBJ: 26.3e Explain why tuberculosis is a reemerging disease

MSC: Understanding

17. Using the figure below, which organism is an incidental host for Lyme disease?

a. deer b. horse c. mouse

d. squirrel e. dog

ANS: D DIF: Easy REF: 26.6 OBJ: 26.6e Recall how humans contract Lyme disease and the three stages of the disease MSC: Understanding 18. Most diarrheal diseases are of what origin? a. viral b. bacterial c. fungal

d. archaeal e. They can be of any origin.

ANS: A DIF: Easy REF: 26.4 OBJ: 26.4d Formulate a treatment plan for a patient with a diarrheal disease MSC: Remembering 19. Which disease below is caused without an infection? a. giardiasis b. tetanus c. staphylococcal food poisoning d. candidiasis e. psittacosis ANS: C DIF: Easy REF: 26.4 OBJ: 26.4d Formulate a treatment plan for a patient with a diarrheal disease MSC: Evaluating 20. The causative agent of pseudomembranous enterocolitis is a. Vibrio cholerae. b. Vibrio parahaemolyticus. c. Clostridium perfringens. d. Clostridium difficile. e. Helicobacter pylori.

ANS: D DIF: Difficult REF: 26.4 OBJ: 26.4f Compare Clostridium difficile and enterohemorrhagic E. coli MSC: Remembering 21. Osteomyelitis is a bone infection caused by bacteria with accompanying inflammation and bone destruction. The bones most often affected are in the a. arm. d. nose. b. fingers. e. lower extremities. c. neck.

ANS: E DIF: Medium REF: 26.2 OBJ: 26.2b Define nosocomial, empiric therapy, and osteomyelitis MSC: Understanding 22. The presence of leukocytes in a fecal smear would best indicate ________ infection. a. hepatitis B d. meningococcal b. varicella e. tuberculosis c. enteroinvasive ANS: C DIF: Easy REF: 26.4 OBJ: 26.4c Differentiate among gastritis, gastroenteritis, enteritis, enterocolitis, and colitis MSC: Applying 23. A nationwide recall of spinach in 2006 was due to contamination by cattle water containing a. Neisseria meningitidis. d. Shigella species. b. E. coli O157:H7. e. hepatitis A virus. c. Vibrio cholerae.

ANS: B DIF: Easy REF: 26.4 OBJ: 26.4e Describe the symptoms and causes of food poisoning MSC: Remembering 24. By the age of three, all children are believed to have had a rotavirus infection, which is spread by what route? a. food d. blood b. fecal-oral e. water c. air ANS: B DIF: Easy REF: 26.4 OBJ: 26.4d Formulate a treatment plan for a patient with a diarrheal disease MSC: Remembering 25. Giardia lamblia enters a human or other host in what form? a. spore d. worm b. endospore e. trophozoite c. cyst ANS: C DIF: Medium REF: 26.4 OBJ: 26.4d Formulate a treatment plan for a patient with a diarrheal disease MSC: Remembering 26. Why is antibiotic treatment NOT typically prescribed for staphylococcal food poisoning? a. The bacterium is a multidrug-resistant pathogen. b. No antibiotic is useful because it’s a mixed infection. c. No living cells are involved in the disease.

d. The causative agent is MRSA. e. Some antibiotics will trigger gastrointestinal disease.

ANS: C DIF: Difficult REF: 26.4 OBJ: 26.4d Formulate a treatment plan for a patient with a diarrheal disease MSC: Understanding 27. Helicobacter pylori is thought to cause cancer through a. toxin production. b. inducing superantigens. c. neutralizing acid pH, which allows anaerobes to grow. d. injecting the CagA protein into gastric epithelial cells. e. adhering with pili to the oropharygeal epithelium.

ANS: D DIF: Medium REF: 26.4 OBJ: 26.4h Outline how Helicobacter pylori survives in the stomach and recall diseases caused by this microbe MSC: Understanding 28. The most common route of infection in a urinary tract infection is the ________ to the ________. a. gallbladder; urethra d. urethra; bladder b. bladder; kidney e. kidney; urethra c. kidney; bladder ANS: D DIF: Easy REF: 26.5 OBJ: 26.5b Describe the four ways that UTI-causing bacteria enter the bladder or kidney MSC: Remembering 29. Strains of Escherichia coli that cause about 75% of all urinary tract infections use ________ to latch on to proteins coating the urinary tract epithelium. a. sex pili d. adhesins b. P pili e. glycocalyx c. fimbrae ANS: B DIF: Easy REF: 26.5 OBJ: 26.5d Contrast uropathogenic E. coli to other strains of E. coli MSC: Remembering 30. A chancre is the initial symptom of a. gonorrhea. b. chlamydia. c. syphilis.

d. chancroid. e. genital warts.

ANS: C DIF: Easy REF: 26.5 OBJ: 26.5e List common sexually transmitted diseases, their symptoms, and etiological agents MSC: Applying 31. Chlamydia employs ________ for spreading within and between hosts. a. elementary body b. rapidly replicating reticulate body c. microspore d. conidia e. actin polymer ANS: A DIF: Medium REF: 26.5 OBJ: 26.5e List common sexually transmitted diseases, their symptoms, and etiological agents MSC: Remembering

32. Which of the following STDs is most likely to lead to sterility? a. gonorrhea d. chancroid b. syphilis e. genital herpes c. trichomoniasis ANS: A DIF: Easy REF: 26.5 OBJ: 26.5e List common sexually transmitted diseases, their symptoms, and etiological agents MSC: Applying 33. Which of the following STDs is caused by a protozoan infection? a. Treponema pallidum d. HIV b. Trichomonas vaginalis e. Neisseria gonorrhoeae c. Chlamydophila pneumoniae ANS: B DIF: Difficult REF: 26.5 OBJ: 26.5e List common sexually transmitted diseases, their symptoms, and etiological agents MSC: Remembering 34. In urinary tract infections (UTIs), what is the implication of the ability of bacteria to actually hide urinary tract epithelial cells and form biofilms? a. UTIs can never be cured. b. A reservoir for reinfection is created. c. The kidney will invariably be infected. d. Intracellular pathogens are the etiologies for UTI. e. The ureter is the usual route for bladder infection.

ANS: B DIF: Difficult REF: 26.5 OBJ: 26.5c Name the most common etiological agents of UTIs MSC: Understanding 35. Which of the following pathogens is an intracellular agent? a. chlamydia b. rickettsia c. prion d. chlamydia and rickettsia e. None of these pathogens is an intracellular agent.

ANS: D DIF: Easy REF: 26.5 OBJ: 26.5e List common sexually transmitted diseases, their symptoms, and etiological agents | 26.6a Define the different types of infections possible in the cardiovascular system MSC: Understanding 36. During secondary syphilis, the spirochetes spread to the nervous and cardiovascular system.

Consequently a. secondary syphilis is a latent form of the disease. b. it cannot be cured. c. the host remains infectious and has a characteristic rash. d. serology is negative. e. there is no transplacental transmission.

ANS: C DIF: Difficult REF: 26.5 OBJ: 26.5e List common sexually transmitted diseases, their symptoms, and etiological agents MSC: Applying 37. Which of the following is correctly paired?

a. b. c. d. e.

Koplik’s spot—HIV-induced cancer herd immunity—immunity of animals acetylcholine blocker— botulism toxin Lyme disease—enteric disorder enteric fever—elevated white blood cell counts

ANS: C DIF: Difficult REF: 26.7 OBJ: 26.7d Compare and contrast botulism and tetanus

MSC: Applying

38. Diarrhea associated with the intake of nonabsorbable substrates is categorized as a. osmotic diarrhea. d. inflammatory diarrhea. b. motility-related diarrhea. e. gastroenteritis. c. secretory diarrhea.

ANS: A DIF: Medium REF: 26.4 OBJ: 26.4b Distinguish among the different types of diarrhea

MSC: Analyzing

39. Colitis is classified by inflammation in the a. small intestine. b. stomach lining. c. colon. d. large intestine. e. small and large intestines, stomach lining, and colon.

ANS: D DIF: Medium REF: 26.4 OBJ: 26.4c Differentiate among gastritis, gastroenteritis, enteritis, enterocolitis, and colitis MSC: Remembering 40. What diseases are often called spongiform encephalopathies? a. meningitis d. prion b. cytotoxin e. virus c. neurotoxin ANS: D DIF: Difficult REF: 26.7 OBJ: 26.7e Describe how prions are thought to cause spongiform encephalopathies MSC: Remembering 41. One major source of Clostridium botulinum infection in infants is a. any honey-based meal. d. fomites in the house. b. endospore-contaminated honey. e. breast milk. c. contaminated drinking water.

ANS: B DIF: Easy REF: 26.7 OBJ: 26.7d Compare and contrast botulism and tetanus

MSC: Understanding

42. Regarding the neurotoxigenic disease caused by Clostridium tetani, which of the following is NOT correct? a. The tetanospasmin toxoid is an effective vaccine. b. It is a spasmic paralytic disease. c. The causative agent produces endospores. d. Herd immunity can decrease the risk of acquiring it. e. It inhibits neurotransmitters.

ANS: D DIF: Difficult REF: 26.7 OBJ: 26.7d Compare and contrast botulism and tetanus

MSC: Understanding

43. A commonly implicated causative agent of subacute endocarditis (SBE) is a. Pseudomonas aeruginosa. d. Streptococcus pyogenes. b. Staphylococcus epidermidis. e. Borrelia burgdorferi. c. Viridans streptococci.

ANS: C DIF: Medium REF: 26.6 OBJ: 26.6a Define the different types of infections possible in the cardiovascular system MSC: Remembering 44. Which of the following is NOT correct about malaria? a. It infects over 300 million people worldwide each year. b. It is highly communicable from host to host. c. Plasmodium species are the causative agents. d. Free-iron toxicity is the mode of action of chloroquine. e. Drug resistance is a challenge.

ANS: B DIF: Medium REF: 26.6 OBJ: 26.6c Describe the diagnosis and treatment of malaria

MSC: Understanding

45. Which of the following diseases is likely to increase in incidence if global warming continues unabated? a. Streptococcal pharyngitis d. gonorrhea b. Lyme disease e. hepatitis B c. syphilis ANS: B DIF: Easy REF: 26.6 OBJ: 26.6e Recall how humans contract Lyme disease and the three stages of the disease MSC: Understanding 46. A hunter who presents with flu-like symptoms and lives in Boston, Massachusetts, has a ―bull’s-eye‖ rash on his leg. The appropriate diagnosis is a. Lyme disease d. malaria b. tuleremia e. measles c. meningitis ANS: A DIF: Easy REF: 26.6 OBJ: 26.6e Recall how humans contract Lyme disease and the three stages of the disease MSC: Understanding 47. Why is Yersinia pestis, the causative agent of bubonic plague, considered a potential biowarfare agent? a. The bacteria is readily available in Europe. b. There is no effective antibiotic against it. c. It is readily introduced into the human population by mosquitoes. d. Pneumonic plague is highly communicable with a high mortality rate. e. The bacterium forms long-lasting endospores.

ANS: D DIF: Difficult REF: 26.6 OBJ: 26.6d Compare and contrast bubonic, septicemic, and pneumonic plague MSC: Applying 48. Which of the following is NOT matched correctly? a. erythema migrans—Neisseria gonorrhoeae b. Borrelia burgdorferi—Lyme disease c. salvanic cycle—wild rodent and flea cycling of plague

d. pelvic inflammatory disease—antigen phase variation e. multidrug resistance—emerging Mycobacterium tuberculosis ANS: A DIF: Medium REF: 26.6 OBJ: 26.6a Define the different types of infections possible in the cardiovascular system MSC: Applying 49. Hepatitis A and B viruses both a. are RNA viruses. b. infect the liver. c. can be transmitted by blood products. d. have vaccines. e. infect the liver and are vaccines for both viral diseases.

ANS: B DIF: Medium REF: 26.6 OBJ: 26.6f Distinguish among Hepatitis A, B, and C viruses

MSC: Applying

50. The ________ vaccine is recommended for administration when one becomes an adolescent (11–12 years). a. hepatitis B d. meningococcal b. varicella e. tuberculosis c. pneumococcal ANS: D DIF: Medium REF: 26.7 OBJ: 26.7b Define meningitis and state its causes

MSC: Applying

SHORT ANSWER 1. Why is anthrax primarily, though uncommonly, found in people who work with sheep and sheep-related products?

ANS: Anthrax is caused by a Gram-positive spore-forming rod whose reservoir is the soil. Herbivorous and grazing animals ingest it or bear it on their bodies. Farmers who handle such animals can inhale the endospores or acquire cutaneous anthrax through wounds. It is typically an animal disease; as such, natural infection of man is accidental. It is called a zoonotic disease. It is also called the woolsorter’s disease because of the population affected most.

DIF: Easy MSC: Applying

REF: 26.1

OBJ: 26.1c Define differential and zoonotic disease

2. Using the following figures, interpret what is occurring in Figure A.

ANS: This is a bacterial meningitis infection. It shows petechial (small) components and purpuric (large) components.

DIF: Easy MSC: Applying

REF: 26.7

OBJ: 26.7b Define meningitis and state its causes

3. Predict how a chest X-ray and blood counts differ for a fungal versus bacterial lung infection in children and adults.

ANS: A bacterial lung infection would most likely be confined to one lobe in a healthy adult, whereas infants, children, and the elderly present with infection around the bronchi. A fungal infection in an adult would probably appear quite diffuse in a chest X-ray. Increased band cells and polymorphonuclear leukocytes in the blood are a telltale sign of bacterial infection. Fungal infections do not usually result in an increase in white blood cells or band cells.

DIF: Difficult MSC: Applying

REF: 26.3

OBJ: 26.3d Define metastatic lesions

4. Compare and contrast the characteristic symptoms of the common cold and the flu.

ANS: Symptoms of the common cold are a runny nose, nasal congestion, sneezing, and throat irritation.

Myalgia, or muscle ache, is never observed. Symptoms of influenza are fever, myalgia, pharyngitis (sore throat), and headache. Note that a runny nose is not one of the symptoms.

DIF: Easy REF: 26.3 OBJ: 26.3c State some respiratory tract infectious diseases, their symptoms, and their etiological agents MSC: Analyzing 5. How can prescribing an antibiotic for a sick patient actually lead to triggering gastrointestinal illness? Explain and give an example.

ANS: Antibiotics such as clindamycin can kill most normal intestinal bacteria except the naturally resistant Gram-positive anaerobe Clostridium difficile. Unrestrained by microbial competition, C. difficile can grow, producing toxins and leading to pseudomembranous enterocolitis.

DIF: Medium REF: 26.4 OBJ: 26.4d Formulate a treatment plan for a patient with a diarrheal disease MSC: Applying 6. Why is antibiotic treatment NOT recommended for the enterohemorrhagic E. coli O157:H7, or EHEC? ANS: EHEC produces Shiga toxins 1 and 2 and can result in hemolytic uremic syndrome (HUS) and thrombotic thrombocytopenic purpura (TPP). In HUS, microclots in the kidney lead to decreased urine output and, ultimately, kidney failure. HUS can only be treated with supportive care until kidney function resumes. Antibiotics can actually increase the release of Shiga toxins and trigger HUS. DIF: Difficult REF: 26.4 OBJ: 26.4d Formulate a treatment plan for a patient with a diarrheal disease MSC: Applying 7. Giardia causes more diarrhea than any other protozoan globally. Interpret the reasons for its success in causing disease.

ANS: The reservoir for this pathogen is vast: up to 30% of young children, as well as many animal populations (e.g., rodents, deer, and cattle), can serve as reservoirs. It also has a very low infectious dose, since it is able to survive gastric acid. This protozoan makes resistant cysts that resist harsh environment and facilitate spread. It is usually acquired through contaminated water.

All of these facts explain its notorious position as the most common protozoal diarrhea agent in the world.

DIF: Medium REF: 26.4 OBJ: 26.4a Name the most common etiological agents of diarrheal diseases MSC: Applying 8. Why do urinary tract infections (UTIs) often occur in women?

ANS: Despite the many nonspecific defenses of the female urogenital tract, the frequency of UTI in females is a result of an anatomy in which the proximity of the gastrointestinal terminus to the urinary tract allows accidental infections to occur. In addition, the area of the female anatomy is larger than the male’s, creating surfaces for microbial colonization. Finally, bacteria residing along the superficial urogenital membranes of the urethra can ascend to the bladder more commonly in women.

DIF: Medium REF: 26.5 OBJ: 26.5b Describe the four ways that UTI-causing bacteria enter the bladder or kidney MSC: Applying 9. What makes uropathogenic Escherichia coli different from the other E. coli?

ANS: Genomic analysis shows that the uropathogenic E. coli contains five unique pathogenicity islands.

These islands encode many virulence factors that distinguish the E. coli strains. Continued evolution of strains is driven by pathogenicity-island and phage insertions. Genomic analysis and sequencing are also important tools to understanding the complexity of bacterial evolution.

DIF: Medium REF: 26.5 OBJ: 26.5b Describe the four ways that UTI-causing bacteria enter the bladder or kidney MSC: Analyzing 10. What evidence suggests that Columbus did not bring syphilis back from the New World, but instead brought it from Europe to the New World?

ANS: Native Americans buried before Columbus arrived in America show no signs of syphilis.

Pre-Columbian skeletons in England, however, do show signs of syphilis. It is now thought that Columbus brought syphilis, smallpox, and measles to the Americas.

DIF: Difficult REF: 26.5 OBJ: 26.5e List common sexually transmitted diseases, their symptoms, and etiological agents MSC: Analyzing 11. Using the following figures, interpret what is occurring in Figure C.

ANS: White patches are caused by the organism Candida albicans. This is a secondary infection from having AIDS. DIF: Easy MSC: Applying

REF: 26.5

OBJ: 26.5f Define the four stages of HIV infection

12. Describe the replication cycle of Chlamydia.

ANS: The ―infective‖ elementary bodies (EBs) bind and enter eukaryotic cells by phagocytosis. The EBs differentiate into reticulate bodies (RBs), which can replicate. The replicated RBs then differentiate to EBs and form inclusions. The EBs are released via exocytosis and can infect surrounding cells.

DIF: Medium REF: 26.5 OBJ: 26.5e List common sexually transmitted diseases, their symptoms, and etiological agents MSC: Analyzing 13.

Why is reinfection with Neisseria gonorrhoeae possible?

ANS: No lasting immunity is built up, so reinfection is possible. This is due in part to phase variation in various surface antigens in the microbe. In addition, the organism binds to CD4 T cells, inhibiting their activation and proliferation to become memory T cells.

DIF: Medium REF: 26.5 OBJ: 26.5e List common sexually transmitted diseases, their symptoms, and etiological agents MSC: Understanding 14. What is the reservoir for Trichomonas vaginalis? Explain how it causes disease in the acidic vagina of females.

ANS: Trichomonas vaginalis is a protozoan that causes sexually transmitted disease in humans. Its reservoir is the male urethra and female vagina. The protective acidic vagina is created by Lactobacillus acidophilus, a normal flora of the niche. However, when introduced through intercourse, the T. vaginalis feed on these acid producers and raise vaginal pH to nonhostile levels.

DIF: Medium REF: 26.5 OBJ: 26.5e List common sexually transmitted diseases, their symptoms, and etiological agents MSC: Analyzing 15. People who come down with STDs and do not get treated, frequently end up with co-STD infections. Why is this? Explain.

ANS:

Answers could vary but should include mention of the following two reasons: biologically speaking, the presence of one infection can cause ulcerations in the areas where STDs are transmitted, thereby increasing the portals of entry for coinfection to occur. Additionally, safe sex practices are typically not followed with treated (and/or undiagnosed) infection, leading to a propagation of coinfection.

DIF: Medium REF: 26.5 OBJ: 26.5e List common sexually transmitted diseases, their symptoms, and etiological agents MSC: Evaluating 16. Explain the mechanism by which meningococci get to the brain and spinal fluid to cause disease.

ANS: Meningococci are spread by direct contact such as kissing or indirectly through microdroplet aerosol from sneezes and fomites. They can produce copious polysaccharides that protect from phagocytosis. Bacteremia results because they are complement resistant. They reach the blood-brain barrier and bind the endothelial cells by type IV pili. They internalize and eventually exit the capillaries by transendothelialcytosis. Once in the brain, they divide unchecked and migrate to the spinal fluid. Normally, the endothelial cells of the vascular barrier do not allow any cells to exit, as is the case with extravasation during inflammation.

DIF: Medium REF: 26.7 OBJ: 26.7a Recall an advantage and a disadvantage of the blood-brain barrier MSC: Analyzing 17. How does Clostridium botulinum, an obligate anaerobe, secrete its potent toxins in food?

ANS: Botulism is flaccid paralysis caused by C. botulinum neurotoxin. It is acquired by ingesting preformed toxin, often in home-canned foods. Canned foods or enclosed foods with limited exposure to air are rich media for the bacteria to grow. Aerobes and facultatives use up all the oxygen, allowing C. botulinum to grow and produce toxins. Canned foods that have taken on a bulged shape may indicate gas produced by contaminating bacteria.

DIF: Medium tetanus MSC: Analyzing

REF: 26.7

OBJ: 26.7d Compare and contrast botulism and

18. Name and describe the role of the three domains found in tetanus and botulism neurotoxins.

ANS: Binding domain: binds to ganglioside receptor molecules of the nerve cell. Translocation domain: makes a pore for passage of the toxin. Catalytic domain: the protease toxin disrupts release of the neurotransmitter.

DIF: Medium tetanus MSC: Analyzing

REF: 26.7

OBJ: 26.7d Compare and contrast botulism and

19. Describe epigenetic silencing and the role it plays in malaria.

ANS:

Epigenetic silencing is the ―hiding‖ of inactive genes from the transcription process. Plasmodium species, which cause malaria, have 60 different cloaking genes that can be individually turned on and off to alter antigenic structure. They are regulated by chromosome packaging, in a mechanism called epigenetic silencing. This process allows the parasite to constantly disguise itself, resulting in wave after wave of synchronized release cycles.

DIF: Medium REF: 26.6 OBJ: 26.6b Explain why malarial symptoms repeat every 48–72 hours and why relapse is common MSC: Analyzing 20. Using the figures below, summarize what is occurring at D.

ANS: This is an infection caused by Yersinia pestis, the causative agent of the plague. This is a picture of an infected lung showing a bilateral infection.

DIF: Medium REF: 26.3 OBJ: 26.3c State some respiratory tract infectious diseases, their symptoms, and their etiological agents MSC: Evaluating

CHAPTER 27: Antimicrobial Therapy MULTIPLE CHOICE 1. Why does the structure of gramicidin, shown below, only allow topical use as an antibiotic?

a. b. c. d. e.

synthesis of nucleic acid synthesis of cell wall beta lactam rings DNA synthesis It creates channels in cell membranes.

ANS: E DIF: Easy REF: 27.2 OBJ: 27.2c Propose why gramicidin is for topical use only

MSC: Remembering

2. Bactericidal antibiotics include all of the following EXCEPT a. aminoglycosides. b. rifampin. c. macrolides. d. subcutaneous isoniazidchloramphenicol. e. quinolones.

ANS: C DIF: Medium REF: 27.2 OBJ: 27.2f Classify protein synthesis inhibitor antibiotics

MSC: Understanding

3. The bacteria killed in Alexander Fleming’s experiment during his discovery of penicillin were a. Pseudomonas aeruginosa. d. Streptococcus pyogenes. b. Escherichia coli. e. Klebsiella pneumonia. c. Staphylococcus aureas.

ANS: C DIF: Easy REF: 27.1 OBJ: 27.1a Outline the discovery and development of early antibiotics MSC: Remembering 4. Salvarsan is an arsenical compound used to target the pathogen a. Treponema pallidum. d. Streptococcus mutans. b. Plasmodium falciparium. e. Mycobacterium tuberculosis. c. Escherichia coli.

ANS: A DIF: Medium REF: 27.1 OBJ: 27.1b Define selective toxicity and explain its biological basis

MSC: Understanding 5. If a drug were designed that only seemed to affect the growth of Burkholderia pseudomallei, this drug would be considered ________ range. a. broad d. extremely narrow b. uni-narrow e. species-sensitive c. slightly narrow ANS: D DIF: Medium REF: 27.1 OBJ: 27.1c Distinguish among drug susceptibility, drug sensitivity, spectrum of activity, bactericidal, and bacteriostatic MSC: Understanding 6. The best target for development of a new antibiotic would be a. phospholipids in the plasma membrane. d. the nuclear envelope. b. the glycolysis pathway. e. ribosomes. c. pyrimidine bases.

ANS: E DIF: Easy REF: 27.1 OBJ: 27.1a Outline the discovery and development of early antibiotics MSC: Understanding 7. Sometimes, systemic mycoses require more aggressive treatment. A drug used in this treatment is a. amphotericin B. d. tetracycline. b. penicillin. e. penicillin. c. lamisil.

ANS: A DIF: Difficult REF: 27.5 OBJ: 27.5b Compare and contrast superficial and systemic fungal infections MSC: Understanding 8. A drug designed to poke holes into the plasma membrane of a Pseudomonas aeruginosa bacteria would best be considered a. bactericidal. d. bacteriostatic. b. microbe sensitive. e. bacteriocompetent. c. semiselective.

ANS: A DIF: Easy REF: 27.2 OBJ: 27.2b Describe the mechanisms of action of antibiotics that target the cell wall and bacterial resistance strategies MSC: Applying 9. Minimal inhibitory concentration, or MIC, is ________ concentration of a drug that will prevent the growth of an organism. a. the average d. the midline b. the lowest e. any c. the highest ANS: B DIF: Easy REF: 27.1 OBJ: 27.1d Describe how drug susceptibility is measured 10. An MIC test can determine all of the following EXCEPT a. the lowest level of an antibiotic that kills a particular bacteria. b. the highest level of an antibiotic that kills a particular bacteria. c. levels of an antibiotic that do not kill a particular bacteria. d. drug susceptibility and resistance. e. whether the drug is bacteriostatic or bactericidal.

MSC: Remembering

ANS: E DIF: Easy REF: 27.1 OBJ: 27.1c Distinguish among drug susceptibility, drug sensitivity, spectrum of activity, bactericidal, and bacteriostatic MSC: Remembering 11. Which of the following statements about the Kirby-Bauer assay is true? a. It is used to test multiple bacteria simultaneously on a single plate. b. It uses serial dilutions of specific antibiotics to determine MIC. c. Zones of inhibition that are smaller are better antibiotics than antibiotics that form larger zones. d. It can test up to 12 different antibiotic disks at one time. e. It cannot be correlated with in vivo tissue concentrations.

ANS: D DIF: Medium REF: 27.1 OBJ: 27.1d Describe how drug susceptibility is measured

MSC: Remembering

12. The Mueller-Hinton medium used in the Kirby-Bauer assay contains no para-aminobenzoic acid (PABA, normally found in most media) because it a. causes an increase in bacterial lag time. b. interferes with the diffusion of penicillin and penicillin-like drugs. c. creates a false bacteriostatic effect. d. polymerizes streptomycin drugs and their derivatives. e. inhibits sulfa antibiotics testing.

ANS: E DIF: Medium REF: 27.1 OBJ: 27.1c Distinguish among drug susceptibility, drug sensitivity, spectrum of activity, bactericidal, and bacteriostatic MSC: Remembering 13. A standardized inoculum of bacteria is used in all microbiology labs when performing a Kirby-Bauer assay. This standard allows for a visual turbidity reading to achieve reproducibility in the number of bacteria inoculated on a plate. This is most important because a. multiple antibiotics testing requires that bacteria be spread evenly around the plate. b. the MIC value can only be achieved by serial dilutions. c. the number of organisms placed on an agar surface is inversely proportional to the size of the zone of inhibition. d. bacterial counts need to be the same across all labs, since incubation times can differ. e. bacterial counts need to be the same across all labs, since plate sizes in this assay can differ.

ANS: C DIF: Difficult REF: 27.1 OBJ: 27.1d Describe how drug susceptibility is measured

MSC: Understanding

14. Consider an MIC result of 10 g of penicillin for bacterial strain A, 15 g for stain B, 18 g for strain C, and 27 g of penicillin for strain D. It can be interpreted that bacterial strain ________ is more susceptible to penicillin than the others. a. A d. D b. B e. All strains are equally susceptible. c. C ANS: A DIF: Easy REF: 27.1 OBJ: 27.1c Distinguish among drug susceptibility, drug sensitivity, spectrum of activity, bactericidal, and bacteriostatic MSC: Applying 15. Bacterial peptidoglycan formation uses all of the following components EXCEPT a. N-acetylmuramic acid. d. hopanoid. b. uridine diphosphate. e. N-acetylglucosamine.

c. bactoprenol.

ANS: D DIF: Medium REF: 27.2 OBJ: 27.2a List the cellular targets of antibiotics and explain why they are attractive targets MSC: Remembering 16. A bacterium may be penicillin resistant due to all of the following EXCEPT a. a Gram-negative cell wall. d. modified transpeptidases. b. beta-lactase production. e. modified transglycosylases. c. a Gram-positive cell wall.

ANS: C DIF: Medium REF: 27.2 OBJ: 27.2b Describe the mechanisms of action of antibiotics that target the cell wall and bacterial resistance strategies MSC: Remembering 17. Which virus is NOT effected by antiviral DNA synthesis inhibitors? a. influenza d. Ebola b. HIV e. Marburg c. H1N1 ANS: A DIF: Medium REF: 27.4 OBJ: 27.4c Judge which viruses can be targeted by antiviral DNA synthesis inhibitors MSC: Understanding 18. An example of an antibiotic that binds to the 30S ribosomal subunit would be a. streptogramins. d. fluoroquinolones. b. macrolides. e. aminoglycosides. c. beta-lactams.

ANS: E DIF: Easy REF: 27.2 OBJ: 27.2f Classify protein synthesis inhibitor antibiotics

MSC: Remembering

19. Streptogramins are a drug class that possess a synergistic effect. This means that they a. work best on antibiotic-resistant and antibiotic-intermediate bacteria. b. kill bacteria using both bacteriostatic and bactericidal mechanisms. c. have two drug components working together to create a more potent effect. d. induce an antibody-driven immune response more quickly. e. kill Gram-negative, Gram-positive, and mycobacteria equally well.

ANS: C DIF: Easy REF: 27.2 OBJ: 27.2f Classify protein synthesis inhibitor antibiotics

MSC: Remembering

20. A newly isolated antibiotic that kills Klebsiella sp. was found in soil bacteria. Chemical analysis showed the structure of this molecule to contain a cysteine/valine ring structure. This new antibiotic would be classified as a ________ inhibitor. a. metabolic d. DNA synthesis b. cell membrane e. cell wall c. protein-synthesis ANS: E DIF: Easy REF: 27.2 OBJ: 27.2b Describe the mechanisms of action of antibiotics that target the cell wall and bacterial resistance strategies MSC: Analyzing 21. What does the figure below represent?

a. amphotericin B b. clotrimazole c. nystatin

d. penicillin e. cephalosporin

ANS: B DIF: Difficult REF: 27.5 OBJ: 27.5c Name some antifungal drugs and their mechanisms of action MSC: Applying 22. A possible effective treatment for a patient who comes into a medical office with tuberculosis has been derived from a. Penicillium notatum. d. Streptomyces garyphalus. b. Amycolatopsis orientalis. e. Bacillus subtilis. c. Staphylococcus aureas.

ANS: D DIF: Difficult REF: 27.3 OBJ: 27.3a Propose several reasons for why microbes produce antibiotics MSC: Applying 23. What microbe would you grow if you wanted to prepare and isolate some vancomycin? a. Amycolatopsis orientalis d. Streptomyces garyphalus b. Staphylococcus aureas e. Bacillus subtilis c. Veillonella parvula ANS: A DIF: Medium REF: 27.3 OBJ: 27.3a Propose several reasons for why microbes produce antibiotics MSC: Applying 24. What is shown in the figure below?

a. b. c. d. e.

B-lactam streptogramins protein synthesis inhibitors ribosome mulidrug resistance efflux pump

ANS: E DIF: Easy REF: 27.3 OBJ: 27.3d Explain why multidrug resistance efflux pumps are a very dangerous drug resistance mechanism MSC: Understanding 25. Bactrim, a sulfa drug used to treat urinary tract infections, does NOT harm host cells because eukaryotic cells a. have efflux pumps for the drug. b. take in folic acid in the diet. c. do not transport the drug into the cell. d. are naturally immunized from the drug. e. make their own PABA precursors.

ANS: B DIF: Easy REF: 27.2 OBJ: 27.2d Explain the selective toxicity of the sulfa drugs, quinolones, and metronidazole MSC: Analyzing 26. A bacterial strain exhibiting a DNA gyrase mutation would most likely inhibit the activity of what class of antibiotics? a. metronidazoles d. cephalosporins b. tetracyclines e. sulfa drugs c. quinolones ANS: C DIF: Easy REF: 27.2 OBJ: 27.2d Explain the selective toxicity of the sulfa drugs, quinolones, and metronidazole MSC: Analyzing 27. A bacterial strain exhibiting a unique RNA polymerase structure would most likely inhibit the activity of which antibiotic?

a. rifampin b. nalidixic acid c. penicillin

d. streptomycin e. chloramphenicol

ANS: A DIF: Easy REF: 27.2 OBJ: 27.2e Name drugs that inhibit RNA synthesis

MSC: Analyzing

28. Chemical synthesis of a new drug with a 15-member lactone ring structure would be predicted to be most similar to the antibiotic class ________ and the ________ inhibitor. a. gramicidin; membrane b. nalidixic acid; DNA c. actinomycin D; RNA synthesis d. tetracyclines; 30S e. macrolides; 50S ANS: E DIF: Difficult REF: 27.2 OBJ: 27.2f Classify protein synthesis inhibitor antibiotics

MSC: Analyzing

29. One of the leading sources of human infection by antibiotic-resistant organisms is ________ infections. a. farm animal d. nosocomial b. locker room e. food recall c. dental surgery ANS: D DIF: Easy REF: 27.3 OBJ: 27.3e Hypothesize how antibiotic resistance develops

MSC: Remembering

30. Gene-expression elements that account for rapid transmission of drug resistance due to their mobility and ability to collect resistance gene cassettes are called a. mobile units. d. insertion prophages. b. virulence plasmids. e. multidrug resistant enhancers. c. integrons.

ANS: C DIF: Easy REF: 27.3 OBJ: 27.3c List the four basic forms of antibiotic resistance and provide an example of each MSC: Remembering 31. A persister cell is an unsolved mystery of microbiology because these cells a. grow rapidly in the presence of antibiotics. b. neither grow nor die in the presence of an antibiotic. c. cannot exit log phase growth when placed in an optimum antibiotic niche. d. can form neither individual cells nor biofilms. e. cycle between animal and human populations, never dying out.

ANS: B DIF: Easy REF: 27.3 OBJ: 27.3g Assess the role of persister cells in latent infections and antibiotic tolerance MSC: Remembering 32. Aicrobes that produce antibiotic molecules ________ as a way to prevent self destruction. a. pump the antibiotic out b. modify the target so it cannot bind c. add modifying groups to the antibiotic d. destroy the antibiotic e. There is no need to avoid self-destruction.

ANS: E

DIF: Difficult

REF: 27.3

OBJ: 27.3b Identify ways that microbes avoid harm by the antibiotics they produce MSC: Analyzing 33. One way a macrolide-producing organism, such as Streptomyces sp., prevents its own demise from production of the antibiotic is to a. methylate its own RNA. b. change its peptidoglycan linkages. c. create an MDR pump. d. change its DNA structure. e. only produce the antibiotic during the death phase.

ANS: A DIF: Medium REF: 27.3 OBJ: 27.3b Identify ways that microbes avoid harm by the antibiotics they produce MSC: Applying 34. Which of the following is a clinically important lung bacteria that kills approximately 2 million people annually and is becoming increasingly multidrug resistant? a. Streptococcus pneumoniae b. Staphylococcus aureas c. Mycobacterium tuberculosis d. Escherichia coli e. Plasmodium falciparum ANS: C DIF: Easy REF: 27.3 OBJ: 27.3e Hypothesize how antibiotic resistance develops

MSC: Applying

35. The multidrug resistance, or MDR, efflux pumps found in organisms such as resistant strains of Escherichia coli work most similarly to a. ABC transporters. b. facilitated diffusion. c. reverse osmosis. d. electron transport. e. phospholipid flip-flop.

ANS: A DIF: Easy REF: 27.3 OBJ: 27.3d Explain why multidrug resistance efflux pumps are a very dangerous drug resistance mechanism MSC: Analyzing 36. A bacterium has evolved a new enzyme that can cleave a beta-lactam ring structure. It would NOT be treatable by which class of drugs? a. aminoglycosides d. bacitracin b. ampicillin e. quinolones c. tetracycline ANS: B DIF: Easy REF: 27.2 OBJ: 27.2a List the cellular targets of antibiotics and explain why they are attractive targets MSC: Analyzing 37. Which of the following would NOT be a way that a Pseudomonas aeruginosa bacteria could inherit resistance genes from other bacteria? a. transposons d. plasmid integration b. random mutation e. integrons c. prophages ANS: B

DIF: Medium

REF: 27.3

OBJ: 27.3c List the four basic forms of antibiotic resistance and provide an example of each MSC: Analyzing 38. A negative structural mutation in the norA gene in Staphylococcus aureus could have the effect of a. decreased protein synthesis. b. increased bacterial conjugation. c. decreased drug resistance. d. increased uptake of beta-lactams. e. decreased rate of clonal division.

ANS: C DIF: Difficult REF: 27.3 OBJ: 27.3f Recall methods to identify and overcome drug-resistant pathogens MSC: Applying 39. Which of the following would NOT be considered a way to fight bacterial resistance? a. creating molecules without antibiotic activity that can compete and bind antibiotic-resistance enzymes b. increase the amount of antibiotics in our foods to prevent food-borne infection c. alter the structure of antibiotics to sterically hinder the binding of antibiotic-resistance enzymes d. link different antibiotics together, forming hybrid antibiotics with dual action and targets e. administer antibiotics more prudently when possible ANS: B DIF: Easy REF: 27.3 OBJ: 27.3f Recall methods to identify and overcome drug-resistant pathogens MSC: Applying 40. A newly identified genomic target for treating penicillin-resistant Streptococcus pneumoniae is the a. CaPS: capsular polysaccharides. b. Ply: pneumolysin toxin. c. MotB: flagella protein. d. PGRP: peptidoglycan recognition protein. e. CbpG: pneumococcal adhesin protein.

ANS: E DIF: Medium REF: 27.3 OBJ: 27.3f Recall methods to identify and overcome drug-resistant pathogens MSC: Remembering 41. Platensimycin is a novel antibiotic that was recently discovered. An attribute it does NOT have is that it a. is bacteriostatic. b. binds FabF protein found in fatty acid biosynthesis. c. has a broad spectrum of activity. d. works on both Gram-negative and Gram-positive bacteria. e. targets the bacterial translation of proteins.

ANS: E DIF: Easy REF: 27.3 OBJ: 27.3h State strategies for discovering new antibiotics

MSC: Understanding

42. What is NOT a novel idea for new antibiotic drug development? a. interfering with quorum-sensing mechanisms b. ―corking‖ the type II secretion apparatus c. use of photosensitive chemicals to generate reactive oxygen species d. chemical modification of beta-lactams e. use of nanotubes to poke holes in bacterial membranes

ANS: D DIF: Medium REF: 27.3 OBJ: 27.3h State strategies for discovering new antibiotics

MSC: Understanding

43. Which of the following is an antiviral that inhibits DNA synthesis? a. Acyclovir d. Ribavirin b. Amantadine e. Raltegravir c. Zanamivir ANS: A DIF: Medium REF: 27.4 OBJ: 27.4b List the mechanisms of action of antiviral drugs

MSC: Analyzing

44. The influenza envelope neuraminidase viral spike protein allows the virus to a. escape from antibiotics. b. acidify the endocytic chamber. c. release new virions from an infected host cell. d. bind to host cell glycoproteins. e. undergo viral membrane fusion.

ANS: C DIF: Medium REF: 27.4 OBJ: 27.4b List the mechanisms of action of antiviral drugs

MSC: Understanding

45. Antiviral therapy for the human immunodeficiency virus (HIV) usually consists of ________ or more different ________ inhibitors to prevent resistance. a. five; nonnucleoside reverse transcriptase b. three; nucleoside reverse transcriptase c. four; integrase d. two; protease e. two; nucleoside, nonnucleoside, and protease ANS: E DIF: Easy REF: 27.4 OBJ: 27.4d Summarize HIV antiretroviral therapyMSC:

Understanding

46. Antiviral therapy for the human immunodeficiency virus (HIV) usually consists of a protease inhibitor that inhibits what function? a. viral exit of the newly formed virions by vial budding b. viral fusion of the viral envelope with the host cell membrane c. binding to the CD4 receptor on human immune cells d. insertion of viral DNA into the host cell DNA e. cleavage of polypeptide chains to make functional HIV viral proteins ANS: E DIF: Easy REF: 27.4 OBJ: 27.4d Summarize HIV antiretroviral therapyMSC:

Understanding

47. There are fewer antivirals currently available in most pharmacies than there are antibacterials because a. bacterial cells are less complex than viruses. b. selective toxicity is much easier to achieve for bacteria. c. most antivirals available are for uncommon, life-threatening infections. d. selective toxicity is much easier to achieve for viruses. e. MIC values are larger for bacteria than for viruses.

ANS: B DIF: Easy REF: 27.4 OBJ: 27.4a Explain why there are fewer antiviral drugs than antibacterial drugs MSC: Applying

48. A new antibiotic, platensimycin, was recently discovered from what organism? a. Bacillus subtilis d. Streptomyces platensis b. Bacillus thuringiensis e. Klebsiella pneumoniae c. Escherichia platentis ANS: D DIF: Easy REF: 27.3 OBJ: 27.3h State strategies for discovering new antibiotics

MSC: Applying

49. The antiviral nucleoside inhibitor zidovudine, used in treating HIV infection, works by a. fooling reverse transcriptase to incorporate it, causing a chain termination reaction. b. disabling protease and preventing HIV protein folding. c. blocking gag and pol genes from transcription. d. binding directly to reverse transcriptase and allosterically inactivating the enzyme. e. sterically hindering integrase from cutting into the host nuclear DNA. ANS: A DIF: Medium REF: 27.4 OBJ: 27.4d Summarize HIV antiretroviral therapyMSC:

Applying

50. A patient suffering from a systemic mycosis with aspergillosis would best be served by which antifungal? a. imidazole d. amphotericin B b. lamisil e. griseofulvin c. nystatin ANS: D DIF: Easy REF: 27.5 OBJ: 27.5c Name some antifungal drugs and their mechanisms of action MSC: Applying 51. Bactericidal antibiotics include all of the following EXCEPT a. aminoglycosides. d. macrolides. b. quinolones. e. penicillins. c. rifampins.

ANS: D DIF: Medium REF: 27.2 OBJ: 27.2g Compare bactericidal and bacteriostatic antibiotics

MSC: Remembering

52. Most antiviral drugs approved for clinical use target viral proteins. Which of the following is NOT a targeted viral protein? a. Cap-binding complex d. entry proteins b. proteases e. alpha-glucosidase c. polymerases ANS: A DIF: Difficult REF: 27.4 OBJ: 27.4e Justify targeting host cell proteins for antiviral therapy MSC: Remembering SHORT ANSWER 1. What is the definition of ―antibiotic‖? Where are antibiotics isolated from, and why are these compounds made in nature?

ANS:

Antibiotics derive from the Greek word meaning ―against life.‖ The formal definition is ―compounds produced by one species of microbe that can kill or inhibit the growth of other microbes.‖ Many antibiotics have been isolated from soil bacteria and molds (fungi). These compounds are produced in nature to inhibit the growth of neighboring bacteria or fungi that are competing for the same environmental niche; this gives the bacteria or fungi that can produce these compounds an advantage by decreasing competition for space and resources.

DIF: Medium REF: 27.1 OBJ: 27.1a Outline the discovery and development of early antibiotics MSC: Understanding 2. In the 1930s, Gerhard Domagk injected his own daughter with a red dye in hopes of curing her invasive streptococcal infection, even though testing of this agent on agar plates growing Streptococcus sp. showed no antimicrobial effect. Analyze why he did this. What did this study show the importance of?

ANS: Gerhard Domagk was a German physician who investigated antimicrobial compounds in the 1930s. His daughter had such a serious streptococcal infection, spreading to the lymph nodes, that amputation of her arm seemed necessary. He instead decided to inject her with red dye, Prontosil, which cleared the infection completely. Prontosil had not worked on agar media tests with streptococcal bacteria, but Domagk had also done work in mouse studies with the drug that had shown efficacy. This study shows the importance of different methods of testing to determine efficacy, and in this case the importance of animal studies, since the drug used needed to be metabolized by living cells before gaining efficacy.

DIF: Medium REF: 27.1 OBJ: 27.1a Outline the discovery and development of early antibiotics MSC: Analyzing 3. Summarize what is occurring in the figure below.

ANS: It is an illustration of potential host targets for broad spectrum antivirals. Broad spectrum compounds are connected.

DIF: Medium REF: 27.4 OBJ: 27.4b List the mechanisms of action of antiviral drugs

MSC: Evaluating

4. Summarize how infection is cleared from the body of a patient who has been prescribed antibiotics that are bacteriostatic. Give one example of a bacteriostatic antibiotic in your answer.

ANS: Answers will vary. Bacteriostatic antibiotics prevent bacterial growth from occurring within the body. They differ from bactericidal drugs that kill bacterial directly. By preventing bacterial growth, bacteriostatic drugs allow the immune system to ―catch up‖ with the infection and clear it from the body. Examples of bacteriostatic drugs could include most protein-synthesis inhibitors (exception: aminoglycosides) and sulfa drugs.

DIF: Medium REF: 27.1 OBJ: 27.1c Distinguish among drug susceptibility, drug sensitivity, spectrum of activity, bactericidal, and bacteriostatic MSC: Evaluating 5. A novel antibiotic, discovered to treat blood-borne bacteria during sepsis infection, is found to have a dramatic effect during MIC assays. Mice studies that followed found the drug to be cleared from the body within 15 minutes of oral administration. Would this be a good drug candidate for sepsis? Why or why not? What suggestions would you make? Support your answer.

ANS: Answers will vary. Several factors must be taken into consideration when treating an infection with antibiotics. First, the relative effectiveness of the antibiotic on the organism causing infection (including possible drug resistance) must be determined. The MIC assays in this question showed efficacy in in vitro testing. Second, antibiotics must attain tissue levels of the drug that are above the MIC level. The mouse studies show clearance within 15 minutes of oral administration. This would mean that a person taking this drug would have to take another dose every 10–15 minutes to maintain an acceptable in vivo MIC concentration. This is not a good drug at this time, but perhaps other methods of administration (e.g., intravenous) or tweaking the chemistry of the molecule could prolong in vivo clearance.

DIF: Medium REF: 27.1 OBJ: 27.1d Describe how drug susceptibility is measured

MSC: Understanding

6. A molecular microbiologist identified a unique sequence of DNA causing an amino acid shift mutation within the gene encoding for peptidoglycan transpeptidase in a clinical strain of Streptococcus pneumoniae. Summarize what this molecule does and hypothesize what benefit it could have to an organism.

ANS: The peptidoglycan transpeptidase enzyme cross-links the amino acid chains on the NAM sugar together in the assembly of the cell wall structure. Specifically, transpeptidases bind neighboring amino acid chain L-lysine to the newly formed peptidoglycan units’ penultimate D-ala (with terminal D-ala removed in the process). Inheritance of mutation in either the peptidoglycan transpeptidase or transglycosylases (aka penicillin-binding proteins) can cause an organism to no longer be able to physically bind to penicillin. This mutation could benefit the Streptococcus pneumoniae by making it penicillin resistant.

DIF: Medium REF: 27.3 OBJ: 27.3c List the four basic forms of antibiotic resistance and provide an example of each MSC: Evaluating 7. Why is it that the organism that produces penicillin, Penicillin notatum, is not affected by the production of this molecule, but Staphylococcus aureus is? Of what benefit is the antibiotic in the organism that created it?

ANS: Most antibiotics are considered secondary metabolites in the organism that creates them because they often have no apparent use in the producing organism. Production of these antibiotic molecules may help microbes compete with one another in nature for nutrients and space, although growth inhibition may not have been the original purpose. Penicillin is an example of a secondary metabolite produced by Penicillin notatum. It does not affect the organism that produces it because the fungi lack the peptidoglycan structure necessary for the drug target. S. aureas, on the other hand, has the target structure in the cell wall and is therefore susceptible to the antibiotic molecule.

DIF: Medium REF: 27.3 OBJ: 27.3a Propose several reasons for why microbes produce antibiotics MSC: Applying 8. Compare and contrast the utility of the antibiotic polymyxin versus cephalosporin in clearing up an Escherichia coli skin infection that has become systemic.

ANS: Polymyxin is an antibiotic produced by Bacillus polymyxa. It is a cyclic peptide ring that is positively charged and binds cell membranes. It has a detergent-like effect primarily on Gram-negative cells. Cephalosporins are beta-lactam drugs that affect peptidoglycan synthesis.

Earlier generations are most effective on Gram-positive organisms; later generations have a broader spectrum (including Gram-negatives). Initially this infection may have been cleared by topical polymyxin, but since it has spread internally, an oral cephalosporin would be recommended.

DIF: Medium REF: 27.2 OBJ: 27.2a List the cellular targets of antibiotics and explain why they are attractive targets MSC: Applying 9. Why is metronidazole uneffective against an aerobic bacteria like Staphylococcus aureas?

ANS: Metronidazole is isolated as a prodrug. The drug is activated by bacteria during treatment after it receives an electron (is reduced) from microbial cofactors flavodoxin and ferredoxin. Once activated inside bacteria, it randomly nicks DNA, thus killing the cell. It is not effective against aerobic bacteria, such as Staphylococcus aureas, because in aerobic bacteria, ferredoxin preferentially reduces oxygen rather than the drug, resulting in a lack of activation of the drug inside the bacteria.

DIF: Difficult REF: 27.2 OBJ: 27.2d Explain the selective toxicity of the sulfa drugs, quinolones, and metronidazole MSC: Applying 10. Why is the newly discovered antibiotic class called pyronins considered to be a class of antibiotics that will be hard for a bacteria to become resistant to?

ANS: Pyronins are a new class of drugs produced by Myxococcus fulvis. These antibiotics prevent bacterial RNA polymerase (RNAP) from ever starting polymerization for transcription. They specifically bind to the hinge region of RNA polymerase where the DNA strands are separated (melt). If the DNA cannot melt (no separation), then transcription can never start. This new class of drugs is useful for rifamipin-resistant strains. It is expected that there will be an extremely low possibility of pyronin resistance because mutation in this part of the bacterial system would be potentially deadly (lethal mutation).

DIF: Medium REF: 27.3 OBJ: 27.3h State strategies for discovering new antibiotics

MSC: Applying

11. Why are drug-resistant bacteria less viable in comparison with wild type?

ANS: Drug-resistant bacteria have obtained either mutations and/or genes through horizontal transfer that allow the bacteria an advantage when found in the presence of a specific antibiotic. These extra genes or mutations come at the price of vitality in comparison with wild-type bacteria when found in the absence of an antibiotic environment. Extra and/or mutant genes can decrease viability on a number of different levels (e.g., more energy may be needed to maintain the extra genes; biochemical pathways may be altered, producing less effective products; and normal environmental niches may not provide resistant bacteria the necessary components, in comparison with wild type). Regardless of the biological reasons, resistant bacteria only surpass the vitality of wild type when found in an antibiotic-containing environment.

DIF: Difficult REF: 27.3 OBJ: 27.3e Hypothesize how antibiotic resistance develops

MSC: Understanding

12. How have modern agricultural practices contributed to the increase of antibiotic resistance seen today?

ANS: Answers will vary. The overuse and nondiscriminant use of antibiotics within our world has directly contributed to the prevalence of antibiotic resistance we are seeing today. The more an antibiotic is used, the greater the chance of developing bacterial resistance. Antibiotic resistance developed due to not only antibiotics administered in health care settings but also modern agricultural practices. Modern agricultural practices frequently use animal feed containing antibiotics prophylactically (to prevent infection regardless of whether infection is present or not).

This frequent and nondiscriminant use in animal feed may result in higher and healthier animal yields but also results in increased resistance of normal flora of the animals, which can be passed on to humans (when we have contact with or eat the animals). These resistance genes can then be passed on through horizontal transfer, increasing populations of bacteria containing these resistance genes.

DIF: Medium REF: 27.3 OBJ: 27.3e Hypothesize how antibiotic resistance develops 13. Explain the activation of metronidazole using the figure below.

MSC: Understanding

ANS: For anaerobes, single electron transfers are made by ferrodoxin and flavodoxin. These are capable of reducing oxidized molecules such as thioredoxin. They can also reduce the prodrug form of metronidazole.

DIF: Difficult REF: 27.2 OBJ: 27.2a List the cellular targets of antibiotics and explain why they are attractive targets MSC: Understanding 14. If a Staphylococcus aureas bacterium was to become resistant to a newly discovered antibiotic, what are the four basic forms of resistance this bacterium could have acquired?

ANS: The S. aureas bacterium could have acquired either a mutation or new DNA that encodes a new trait and allows the bacteria to do the following: (1) enzymatically modify the antibiotic target, so the antibiotic cannot bind; (2) destroy the antibiotic before it enters the cell; (3) add modifying groups that inactivate the antibiotic; and (4) pump the antibiotic out using specific or nonspecific transport proteins (pumping the drug out faster than it can get into the cell).

DIF: Medium REF: 27.3 OBJ: 27.3c List the four basic forms of antibiotic resistance and provide an example of each MSC: Applying 15. How does prescribing a ―dummy compound,‖ like clavulanic acid, begin to address an infant bacterial infection with a Klebsiella sp. that is ampicillin resistant?

ANS:

Dummy target compounds like clavulanic acid work by competing for the enzyme that is providing antibiotic resistance within a given bacteria. An infant with an ampicillin-resistant Klebsiella sp. infection could be producing beta-lactamases as the mechanism of antibiotic resistance. Clavulanic acid is a beta-lactam molecule with no antimicrobial properties. If given in combination with a beta-lactam drug (like ampicillin), the clavulanic acid will compete for binding with any secreted beta-lactamases. The binding of clavulanic acid to beta-lactamase is slow to release, allowing the beta-lactam drug (ampicillin) needed to treat the infection to enter the cell and reach its cellular target. Clavulanic acid would not work if the mechanism of resistance was something other than a beta-lactamase.

DIF: Medium REF: 27.3 OBJ: 27.3f Recall methods to identify and overcome drug-resistant pathogens MSC: Applying 16. Outline and discuss the steps that a research laboratory would go through to discover a new antibiotic to treat a systemic infection with methicillin-resistant Staphylococcus aureus (MRSA).

ANS:  Identify new targets (such as unique essential enzymes) based on genomics in the MRSA bacteria.  Find or design compounds to inhibit these targets in vitro and show antibacterial activity.  Show that the target within the bacterial cell is the same as the in vitro target.  Optimize MICs against susceptible species by altering compound structure.  Examine the compound’s spectrum of activity and rate of resistance.  Determine the compound’s toxicity to animals and humans and its pharmacological properties (e.g., therapeutic levels, side effects, etc.). In this case, the new drug must be able to be delivered systemically at the correct therapeutic dose.

DIF: Medium REF: 27.3 OBJ: 27.3h State strategies for discovering new antibiotics

MSC: Applying

17. How does saving the rain forest (and other endangered habitats) correlate with the fight to prevent human morbidity and mortality caused by bacterial disease? Give an example to support your argument.

ANS: Answers will vary. Molecules with antibiotic properties come from all parts of nature. Classical approaches to drug discovery consist of collecting microbes, plants, and animals and screening them for antimicrobial properties. The advent of genetic sequencing has added another powerful tool to search for novel bacterial drug targets or validate theoretical targets. Merck scientists recently screened 250,000 natural product extracts for an ability to inhibit bacterial fatty acid biosynthesis (a good target due to the difference in pathways between prokaryotes and eukaryotes) and found FabF protein, an essential component of fatty acid synthesis that is conserved among many key pathogens. This discovery resulted in a novel antibiotic called platensimycin, made by Streptomyces platensis, isolated from South African soil. Destruction of rain forests and other endangered habitats could destroy potential future cures for human disease.

DIF: Medium REF: 27.3 OBJ: 27.3h State strategies for discovering new antibiotics

MSC: Understanding

18. Describe the mechanism by which the influenza virus enters or exits a host cell and one potential drug target that is being used to prevent infection.

ANS: Answers will vary based on student choice of entry or exit mechanisms. Entry and exit of influenza into and out of a human host cell are dependent upon the two viral spike proteins found within the influenza viral envelope (neuraminidase [NA] and hemagglutinin [HA]). HA binds to host cell glycoproteins, triggering receptor-mediated endocytosis. Once inside the endocytic vesicle, the pH drop allows a receptor change for HA, allowing it to bind to the endocytic compartment membrane and causing viral envelope fusion with the endocytic membrane. The influenza virion is then released into the cytoplasm for replication. Exit of the newly formed viral particles from the host cell relies on NA on the viral envelope.

Two selective targets discovered to stop influenza: (1) The acidification of the endocytic compartment is facilitated by a viral-encoded M2 envelope protein that can be blocked by the antiviral amantadine (a specific inhibitor of influenza M2 protein, effective against influenza A and H1N1).

(2) NA inhibitors are needed for correct viral particle release. NA inhibitors cause NA to aggregate on the viral surface, decreasing the number of viral particles that can be released.

When both amantadine and NA inhibitors are used within 48 hours of infection, influenza duration can be reduced by one day (of benefit to the elderly and children since it minimizes lung damage and secondary bacterial infections).

DIF: Difficult REF: 27.4 OBJ: 27.4b List the mechanisms of action of antiviral drugs

MSC: Applying

19. You are designing a new antibiotic to treat infections caused by the fungal agent Cryptococcus neoformans, a potentially fatal lung infection in patients on long-term corticosteroid therapy. What issues could you run into with selective toxicity, and what strategies would you use in your development?

ANS: Answers regarding development approaches will vary. Fungal infections are much harder to treat than bacterial infections since fungal physiology is much closer to human physiology (both are eukaryotic organisms). Additionally, fungi have efficient drug detoxification systems that can modify and detoxify many antibiotics. In order for antifungal agents to have a fungistatic effect, repeat applications are often necessary to keep levels of the unmodified drug above MIC level.

Strategies that could be used may include the following:  Looking toward modifying targets used in current successful antifungal therapies (sterol synthesis inhibitors, mitotic spindle/cell division blockers, and ergosterol targeting or blocking);  Screening new natural compounds for antifungal effects; and  Genomic analysis of unique fungal targets.

DIF: Difficult REF: 27.5 OBJ: 27.5a Explain why fungal infections are more difficult to treat than bacterial infections MSC: Understanding 20. Several antifungal therapeutic agents act to inhibit sterol synthesis. Explain why this does NOT affect mammalian systems.

ANS: Antifungal agents will specifically inhibit the synthesis of ergosterol. Mammals do not make other sterols or ergosterol. Thus, inhibition of ergosterol synthesis has no effect on mammals.

DIF: Easy REF: 27.5 OBJ: 27.5c Name some antifungal drugs and their mechanisms of action MSC: Understanding

CHAPTER 28: Clinical Microbiology and Epidemiology MULTIPLE CHOICE 1. The cause of the infection from which a patient suffers is best known as the a. clinical agent. d. epidemiological agent. b. etiological agent. e. antibiotic menace. c. pathogenic culprit.

ANS: B DIF: Easy REF: 28.1 OBJ: 28.1a Explain why it is worthwhile to identify an infectious agent MSC: Remembering 2. A person exhibiting glomerular nephritis and rheumatic fever must have had what type of previous infection? a. Shigella sonnei d. Treponema pallidum b. Escherichia coli e. Mycobacterium tuberculosis c. Streptococcus pyogenes ANS: C DIF: Medium REF: 28.1 OBJ: 28.1a Explain why it is worthwhile to identify an infectious agent MSC: Remembering 3. A person who begins to exhibit symptoms of bronchitis and bacterial pneumonia after recovering from the flu would be exhibiting a. drug resistance. d. biological meltdown. b. antiviral susceptibility. e. disease sequelae. c. underlying immunodeficiency.

ANS: E DIF: Easy REF: 28.1 OBJ: 28.1a Explain why it is worthwhile to identify an infectious agent MSC: Understanding 4. Shigella sonnei is the cause of an infection commonly seen in infant day-care facilities due to a. a high prevalence of the microbe in young children. b. its ability to contaminate and grow on plastic toys. c. its inherent antimicrobial nature (it is bleach and cleaning-product resistant). d. diaper changes and hands not being properly washed. e. Gram-positive cell wall structure making the bacteria environmentally resistant.

ANS: D DIF: Medium REF: 28.1 OBJ: 28.1a Explain why it is worthwhile to identify an infectious agent MSC: Understanding 5. Collection of specimen samples from places on or in the body that contain normal flora usually requires a. initial plating on nonselective media. d. direct PCR identification. b. direct Gram staining. e. immunofluorescent staining. c. initial plating on selective media.

ANS: C DIF: Easy REF: 28.1 OBJ: 28.1b Outline the steps for specimen collection from various body sites MSC: Remembering

6. An abscess caused by the anaerobic species Clostridium perfringens would best be collected and transported by a. aspiration into an oxygen-filled tube. b. swabbing onto blood agar media. c. aspiration into a nitrogen-filled tube. d. draining with a catheter. e. draining into a syringe.

ANS: C DIF: Easy REF: 28.1 OBJ: 28.1d Evaluate the importance of proper specimen collection and handling MSC: Understanding 7. Catheterization would be an appropriate method of microbial collection for a. Streptococcus pneumoniae (lung infection). b. Escherichia coli (UTI infection). c. Shigella dysenteriae (GI infection). d. Propionibacterium acnes (skin infection). e. Helicobacter pylori (stomach infection).

ANS: B DIF: Easy REF: 28.1 OBJ: 28.1b Outline the steps for specimen collection from various body sites MSC: Understanding 8. When sampling clinical specimens to determine the cause of a disease, samples are often plated on selective media. The reason for this is to a. initiate an epidemiological investigation. b. prevent the growth of normal flora. c. determine the antibiotic resistance prior to isolation of the pathogen. d. prevent aerobes from growing. e. ensure proper biosafety procedures.

ANS: B DIF: Medium REF: 28.1 OBJ: 28.1b Outline the steps for specimen collection from various body sites MSC: Analyzing 9. Which of the following clinical specimens would be expected to be sterile in a healthy individual? a. blood d. stool b. urine e. skin and wound swabs c. sputum ANS: A DIF: Easy REF: 28.1 OBJ: 28.1c Recall which body sites contain normal microbiota and which are sterile MSC: Understanding 10. Laboratory analysis of a patient suspected to have bacterial meningitis would be performed with which type of sample? a. urine sample d. sputum sampling b. blood draw e. lumbar puncture c. throat swab ANS: E DIF: Easy REF: 28.1 OBJ: 28.1c Recall which body sites contain normal microbiota and which are sterile MSC: Applying

11. In the figure shown below, we see someone wearing a specific biosafety suit. This suit would NOT be required for studying a(n)

a. b. c. d. e.

outbreak of a lethal disease with no known etiological agent.

Ebola outbreak. anthrax outbreak. biosafety level 4 agent. lethal disease with no known treatment or vaccine.

ANS: C DIF: Medium REF: 28.1 OBJ: 28.1c Recall which body sites contain normal microbiota and which are sterile MSC: Analyzing 12. Hektoen agar will grow all of the following microorganisms EXCEPT a. Klebsiella pneumoniae. b. Escherichia coli. c. Salmonella enteritidis. d. Shigella sonnei. e. Streptococcus pneumoniae.

ANS: E DIF: Easy REF: 28.2 OBJ: 28.2a Describe the approaches used to identify pathogens MSC: Remembering 13. Chocolate agar is considered ________ in comparison to blood agar. a. more nutrient rich (capable of growing a greater variety of bacteria) b. less nutrient rich (capable of growing fewer variety of bacteria) c. equally nutrient rich (since they both contain red blood cells)

d. a chemically defined media (whereas blood agar is not) e. better for determining hemolytic bacterial reactions ANS: A DIF: Medium REF: 28.2 OBJ: 28.2a Describe the approaches used to identify pathogens MSC: Remembering 14. Haemophilius influenzae requires ________ and ________ for confirmatory growth of an organism in vitro. a. catalase; oxidase (N disk) b. Eosin-Methylene Blue (EMB) agar; MacConkey agar c. citrate; bile salts d. hemin (X factor); NAD (V factor) e. phenylalanine; ortho-Nitrophenyl--galactoside (ONPG) ANS: D DIF: Medium REF: 28.2 OBJ: 28.2a Describe the approaches used to identify pathogens MSC: Remembering 15. The figure below shows cells stained bright fuchsia. This stain is called a(an) ________ and is used to stain ________.

a. b. c. d. e.

Gram stain; Bacillus anthracis Gram stain; Mycobacterium sp. acid-fast stain; Mycobacterium sp. acid-fast stain; Bacillus anthracis Ziehl-Neelsen; Bacillus anthracis

ANS: C DIF: Medium REF: 28.2 OBJ: 28.2a Describe the approaches used to identify pathogens MSC: Understanding 16. The Lancefield groupings are for ________ bacteria and are based on ________. a. Streptococcus; carbohydrate peptidoglycans b. Escherichia; lipopolysaccharides c. Staphylococcus; peptidoglycan amino acids d. Neisseria; hopanoids e. Pseudomonas; optochin sensitivity ANS: A DIF: Easy REF: 28.2 OBJ: 28.2a Describe the approaches used to identify pathogens MSC: Remembering

17. The diagram shown below shows information relative to Gram-negative rods. We CANNOT consider this diagram to be a(n)

a. b. c. d.

example of tests available on an API 20E strip. algorithm. dichotomous key. example of tests used to determine which type of Enterobacteriaceae an unknown might be. e. random collection of tests for Gram-negative bacteria.

ANS: E DIF: Difficult REF: 28.2 OBJ: 28.2b Use an algorithm to identify a pathogen

MSC: Understanding

18. Catalase-positive organisms such as ________ produce ________ as end products when exposed to hydrogen peroxide. a. Streptomyces; KCl and CO2 b. Streptococcus; H2O2 and H2O c. Lactobacillales; CO2 and O2 d. Stachybotrys; HOCl and H2O e. Staphylococcus; H2O and O2 ANS: E DIF: Medium REF: 28.2 OBJ: 28.2b Use an algorithm to identify a pathogen

MSC: Remembering

19. A bacterial diagnosis of Mycobacterium avium in a sputum sample from an AIDS patient would be best determined by which method? a. blood agar culture b. acid-fast (Ziehl-Neelsen) staining c. MacConkey agar culture d. Gram staining e. bacitracin susceptibility ANS: B DIF: Easy REF: 28.2 OBJ: 28.2b Use an algorithm to identify a pathogen

MSC: Understanding

20. A Gram-negative diplococcus result on a laboratory test would rule out all of the following bacteria EXCEPT a. Neisseria gonorrhoeae. d. Haemophilus influenzae. b. Listeria monocytogenes. e. Escherichia coli. c. Staphylococcus epidermidis.

ANS: A DIF: Medium REF: 28.2 OBJ: 28.2b Use an algorithm to identify a pathogen

MSC: Understanding

21. Which of the following genera of bacteria would NOT change the color of N,N,N',N'7' -tetramethyl-p-phenylenediamine to purple/black upon exposure? a. Salmonella d. Bordetella b. Brucella e. Campylobacter c. Pseudomonas ANS: A DIF: Difficult REF: 28.2 OBJ: 28.2b Use an algorithm to identify a pathogen

MSC: Understanding

22. A hemolysis reaction (on a blood agar plate) with an unidentified colony that results in a green zone due to oxidized iron in nonlysed red blood cells would be called a. beta-hemolytic. d. alpha-hemolytic. b. nonhemolytic. e. epsilon-hemolytic. c. gamma-hemolytic.

ANS: D DIF: Easy REF: 28.2 OBJ: 28.2b Use an algorithm to identify a pathogen

MSC: Understanding

23. Lowenstein-Jensen agar is used to culture ________ bacteria. a. all Gram-negative d. all Gram-positive b. beta lactase–producing e. toxin-producing enteric c. mycolic acid–containing ANS: C DIF: Medium REF: 28.2 OBJ: 28.2a Describe the approaches used to identify pathogens MSC: Applying 24. Symptoms of headache, fever, stiff neck, and confusion in combination with mosquito bites can indicate which viral infection? a. Ebola d. rabies b. West Nile e. HIV c. influenza ANS: B DIF: Easy REF: 28.4 OBJ: 28.2a Describe the approaches used to identify pathogens MSC: Remembering 25. Humans are an incidental (dead-end) host in which clinical disease? a. West Nile virus d. Staphylococcus aureas b. Mycobacterium tuberculosis e. picornavirus c. Streptococcus pyogenes ANS: A DIF: Medium REF: 28.2 OBJ: 28.2a Describe the approaches used to identify pathogens MSC: Remembering

26. PCR-based detection of a person thought to have HIV would require all of the following EXCEPT a. primers specific for HIV genes. d. gel electrophoresis. b. a thermocycler. e. HIV genome isolation/extraction. c. HIV agar media.

ANS: C DIF: Easy REF: 28.2 OBJ: 28.2d Appraise the role of multiplex-PCR, RT-qPCR, DNA sequencing, and mass spectrometry in diagnostics MSC: Understanding 27. Which of the following is NOT true of newer clinical techniques compared to conventional techniques that require culturing? a. The new techniques require no special equipment or training. b. They require less time since bacteria do not have to grow. c. Some of the newer techniques can be quantitated. d. Some newer molecular techniques can be applied to viruses and unculturable bacteria. e. They may rely on the presence of DNA, RNA, antigens or other proteins, and antibodies for detection of the pathogen.

ANS: A DIF: Easy REF: 28.2 OBJ: 28.2c Contrast conventional and rapid techniques of pathogen identification MSC: Understanding 28. The figure shown below is a picture of a gel with multiplex PCR products from Clostridium botulinum isolates. Lane 1 contains DNA molecular weight markers and lanes 2–5 are positive strains as controls for toxins type A, type B, type E, and type F, respectively. Based on the bands shown, what can we say about the isolate results in lane 6?

a. The isolate in lane 6 produces all four toxins but not endotoxin. b. The PCR products from isolate in lane 6 are consistent with that isolate having toxins A, F, and B but not E. c. The isolate in lane 6 produces all four toxins. d. There is no band for endotoxin in lane 6 but the isolate makes three other toxins. e. The gel shows definitive proof that this strain produces three toxins.

ANS: B DIF: Difficult REF: 28.2 OBJ: 28.2d Appraise the role of multiplex-PCR, RT-qPCR, DNA sequencing, and mass spectrometry in diagnostics MSC: Evaluating 29. The figure below shows the mass to charge ratios of two pathogenic Neisseria sp. The molecule being measured is ________ and the technique being used is ________.

a. protein; riboswitch sensor b. protein; MALDI-TOF-MS c. DNA; riboswitch sensor

d. DNA; MALDI-TOF-MS e. RNA; riboswitch sensor

ANS: B DIF: Medium REF: 28.2 OBJ: 28.2d Appraise the role of multiplex-PCR, RT-qPCR, DNA sequencing, and mass spectrometry in diagnostics MSC: Understanding 30. RNA sensors can be used to detect pathogens such as ZIKA virus. The steps below are steps used in testing for ZIKA virus. Which has the required steps in the correct order?

1- LacZ gene product is detected via a color change.

2- DNA is added to an RNA switch that has a hairpin to block transcription of lacZ. 3- Multiple copies of DNA matching ZIKA are produced.

4- In the presence of the ZIKA-trigger RNA, the ―toehold‖ switch is bound and releases the lacZ rbs and start codon so transcription can occur.

5- Reverse transcriptase is used to produce cDNA from the ZIKA RNA. a. 5-2-4-1-3 d. 1-2-3-4-5 b. 3-2-4-1-5 e. 5-3-2-4-1 c. 5-4-3-2-1 ANS: E DIF: Difficult REF: 28.2 OBJ: 28.2e Explain how programmable RNA sensors function

MSC: Analyzing

31. A proper course of action for a patient presenting with Ebola would be a. quarantine and laboratory determination of Ebola IgG antibodies. b. vaccination and laboratory growth of Ebola in culture. c. course of antibiotics and laboratory determination of Ebola antigen. d. antiviral therapy followed by a course of antibiotics. e. in-home supportive therapy and laboratory PCR detection.

ANS: A DIF: Medium REF: 28.1 | 28.2 OBJ: 28.2f Distinguish among serological methods of pathogen detection | 28.1e Contrast the biological safety levels MSC: Understanding 32. Direct fluorescent staining of infected tissue samples taken from a patient allows for rapid identification under what circumstances? a. hard-to-culture organisms b. protist infections c. Gram-negative organisms d. intracellular infections e. metabolically active organisms ANS: A DIF: Easy REF: 28.2 OBJ: 28.2f Distinguish among serological methods of pathogen detection MSC: Understanding 33. Fluorescent antibody staining works well for clinical diagnosis on what types of antigens? a. ribosomal d. capsular b. cytoplasmic e. plasmid c. nuclear

ANS: D DIF: Medium REF: 28.2 OBJ: 28.2f Distinguish among serological methods of pathogen detection MSC: Understanding 34. Eukaryotic parasites, such as Giardia lamblia, are usually diagnosed by a. immunofluorescence. d. biochemical testing. b. PCR. e. direct microscopy. c. RFLP. ANS: E DIF: Easy REF: 28.2 OBJ: 28.2c Contrast conventional and rapid techniques of pathogen identification MSC: Understanding 35. A serum antibody ELISA would be looking for which of the following in a person who is presumed to have a necrotizing fasciitis infection? a. anti–group A streptococcal antibodies b. antimeningococcal antibodies c. group A streptococcal-specific antigens d. enzyme-linked antibody e. anti–group B streptococcal antibodies ANS: A DIF: Medium REF: 28.2 OBJ: 28.2d Appraise the role of multiplex-PCR, RT-qPCR, DNA sequencing, and mass spectrometry in diagnostics MSC: Applying 36. An antigen-capture ELISA could be looking for all of the following in a person who is presumed to have a severe acute lung infection EXCEPT a. mycobacterium antigens. b. SARS antigens. c. Haemophilus sp. antigens. d. pneumococcal antigens. e. anti-influenza antibodies.

ANS: E DIF: Medium REF: 28.2 OBJ: 28.2d Appraise the role of multiplex-PCR, RT-qPCR, DNA sequencing, and mass spectrometry in diagnostics MSC: Applying 37. As point of care (POC) tests are developed, two concerns are sensitivity and specificity. Which of the following statements are true with respect to these terms? a. Sensitivity deals with how much you can dilute the sample to get a result, whereas specificity deals with how much you dilute a control serum to get a result. b. Sensitivity deals with how many false positives you get, whereas specificity deals with false negatives. c. Sensitivity deals with distinguishing between closely related samples such as group A Streptococcus versus group B Streptococcus. Specificity quantitates those differences. d. Sensitivity deals with how often a test is positive when the patient has the disease, whereas specificity deals with how often the test is negative when the patient does not have the disease. e. The sensitivity and specificity of a test must be confirmatory or the test is useless.

ANS: D DIF: Difficult REF: 28.2 OBJ: 28.2g Define sensitivity and specificity in point of care diagnostic tests MSC: Analyzing

38. Point-of-care diagnostics are advantageous for all of the following reasons EXCEPT a. culturing is not required. b. therapy can begin sooner. c. patient compliance is improved. d. antibiotics can be prescribed more effectively. e. lower risk of spreading infection.

ANS: E DIF: Easy REF: 28.2 OBJ: 28.2h List the advantages and disadvantages of point-of-care tests MSC: Remembering 39. Most point-of-care diagnostics rely on a. immunochromatographic assays. b. Qt-polymerase chain reaction. c. ELISA kits. d. immunofluorescence. e. API platforms.

ANS: A DIF: Easy REF: 28.2 OBJ: 28.2h List the advantages and disadvantages of point-of-care tests MSC: Remembering 40. Which of the following organisms falls within biosafety group category II? a. Ebola virus b. SARS c. Mycobacterium tuberculosis d. Escherichia coli strain K-12 e. Campylobacter jejuni ANS: E DIF: Medium REF: 28.1 OBJ: 28.1e Contrast the biological safety levels

MSC: Remembering

41. A defining commonality between biosafety risk group II handling techniques and a biosafety IV facility would be the need for a. a personal positive-pressure suit. b. an isolation facility. c. a negative-pressurized lab space. d. directional air flow in the room. e. the use of aseptic techniques.

ANS: E DIF: Easy REF: 28.1 OBJ: 28.1e Contrast the biological safety levels

MSC: Understanding

42. The use of a laminar flow hood when studying the organism Francisella tularensis is an example of level ________ biological safety. a. 0 d. III b. I e. IV c. II ANS: D DIF: Difficult REF: 28.1 OBJ: 28.1e Contrast the biological safety levels

MSC: Applying

43. Which of the following would NOT be a task for an epidemiologist? a. keeping track of the incidence and prevalence of disease and reportable diseases b. helping to assess the effectiveness of treatments of preventions

c. performing basic research to understand how the etiological agents causes symptoms d. coordinating global measures to minimize an outbreak or epidemic e. finding patient zero ANS: C DIF: Medium REF: 28.3 OBJ: 28.3a State what epidemiologists study

MSC: Understanding

44. The graph shown below diagrams the number of cases of a disease versus time. The high peak near the right-hand side would be considered a(n)

a. prevalence. b. incidence. c. endemic.

d. epidemic. e. pandemic.

ANS: D DIF: Easy REF: 28.3 OBJ: 28.3b Distinguish among endemic, epidemic, and pandemic diseases and between prevalence and incidence MSC: Understanding 45. John Snow, the ―father of epidemiology,‖ is known for deducing the source of which etiologic agent in the 1854 London outbreak? a. Shigella dysenterie d. Giardia lamblia b. Vibrio cholerae e. Yersinia pestis c. Haemophilius influenzae ANS: B DIF: Easy REF: 28.3 OBJ: 28.3e Recall the contributions of John Snow to the field of epidemiology MSC: Remembering 46. Which of the following is a reportable, biosafety level III organism that causes low-grade fever, chills, headache, and malaise followed by a dry cough, shortness of breath, and chest heaviness? a. methicillin-resistant Staphylococcus aureas b. Plasmodium falciparum c. West Nile virus d. Bacillus anthracis e. Yersinia pestis ANS: D DIF: Medium REF: 28.1 OBJ: 28.1e Contrast the biological safety levels

MSC: Remembering

47. Which infectious disease is on the CDC bioterrorism list due to the general population NOT being vaccinated for this disease since the 1970s? a. bubonic plague d. tuberculosis b. rabies e. Machupo virus c. smallpox ANS: C DIF: Medium REF: 28.3 OBJ: 28.3g Identify features of effective bioweapons

MSC: Remembering

48. The correct definition of ―bioweapon‖ is any a. agent categorized as a biosafety level IV organism. b. infectious disease spread person to person with a low mortality rate. c. agent causing widespread psychological trauma, with few casualties. d. microbial agent or pieces of microbes that can be loaded into bombs. e. infectious agent or toxin that has a high virulence and/or mortality rate.

ANS: E DIF: Easy REF: 28.3 OBJ: 28.3g Identify features of effective bioweapons

MSC: Remembering

49. Bubonic plague is endemic in many countries in Africa and in the former Soviet Union. This indicates that a. plague was once a huge problem and has now evolved to not cause infection. b. plague has been eradicated from these areas. c. large numbers of people are infected in these areas and it is spreading. d. the disease is always present in the population at a low frequency. e. human-to-human contact transfers plague.

ANS: D DIF: Easy REF: 28.3 OBJ: 28.3b Distinguish among endemic, epidemic, and pandemic diseases and between prevalence and incidence MSC: Understanding 50. Gaëtan Dugas is frequently referred to as the individual who began the spread of HIV within the gay male community in North America in the 1970s. In epidemiology, he is known as a. the first patient. d. the index case. b. the superspreader. e. patient zero. c. patient 1.

ANS: D DIF: Easy REF: 28.3 OBJ: 28.3c Explain why it is important to determine the index case (patient zero) of an infectious disease MSC: Applying 51. Tuberculosis has become a reemerging pathogen today in large part due to a. increased incidence of HIV infection. b. airline travel reducing geographical distances. c. surge in reservoir animal populations carrying the disease to humans. d. strict compliance with drug regimens. e. concurrent increases in hepatitis C infection.

ANS: A DIF: Medium REF: 28.4 OBJ: 28.4a Outline how emerging diseases are identified and tracked MSC: Remembering 52. Collaborators necessary to solve and control a human epidemic include a. epidemiologists.

b. c. d. e.

ecologists. veterinarians. scientists. epidemiologists, ecologists, veterinarians, and scientists.

ANS: E DIF: Easy REF: 28.3 OBJ: 28.3a State what epidemiologists study

MSC: Remembering

53. Which of the following criteria is NOT required in order for a mosquito-borne virus to become endemic in a new location? a. A person infected elsewhere must travel to the new area. b. A local mosquito must bite a person who has the disease in order to spread it to someone else. c. The virus must move from an Aedes mosquito to another insect vector. d. The virus must move from the local mosquito to a local animal that can then serve as a reservoir. e. The local mosquito must bite another human in that area and give him or her the disease.

ANS: C DIF: Medium REF: 28.4 OBJ: 28.4b List the four requirements for a mosquito-borne virus to become endemic in a new location MSC: Applying 54. The following are all concerns of the influence of global climate change on infectious diseases EXCEPT that a. global climate change will increase the incidence of antibiotic resistance. b. the habitat of insect vectors increases in size as temperatures rise. c. extending ranges of vectors may bring them in contact with new hosts. d. climate change may bring more flooding, thus increasing the spread of gastrointestinal illness. e. infectious disease cycles may speed up or extend through longer portions of the year.

ANS: A DIF: Difficult REF: 28.4 OBJ: 28.4d Assess how climate change affects emerging diseases MSC: Applying 55. Molecular screening is now being used to detect individuals with early stages of TB because a. skin testing is unreliable and needs refrigeration that many countries may not have. b. vaccination with Bacille Calmette-Guérin does not protect against multidrug resistance. c. many countries do not have disposable needles for skin testing. d. it can detect infection earlier than chest X-rays and sputum sampling. e. it can be used more safely on children with the disease.

ANS: D DIF: Easy REF: 28.3 OBJ: 28.3f Summarize the role of molecular techniques in pathogen identification and disease surveillance MSC: Understanding SHORT ANSWER 1. Describe the general protocol used to diagnose a patient with a Salmonella typhimurium infection (from collection to testing).

ANS:

Answers will vary. A patient with a Salmonella typhimurium infection would most likely be experiencing gastrointestinal symptoms. Sample collection would include a stool sample (either collected in a cup or by swab). Since normal flora would be present, plating onto selective media would be advised. Examples include Gram-negative, enteric media such as EMB, MacConkey, or xylose-lysine-desoxycholate (XLD) agar; bismuth sulphite agar; brilliant green agar; Hektoen enteric agar; or any selective chromogenic agar media specifically designed for the differentiation of Salmonella colonies. Confirmatory testing including various biochemical assays, staining, enzyme testing, and molecular methods could all be used.

DIF: Medium MSC: Evaluating

REF: 28.2

OBJ: 28.2b Use an algorithm to identify a pathogen

2. In determining the bacterial etiology of a patient with an infection, the first laboratory test should be what, and why? What type of testing would then follow?

ANS: After isolation of a pure bacterial colony from the patient, the first test is usually a Gram stain to determine whether the bacteria is Gram-negative or Gram-positive. (Sometimes the first test can be to plate on differential agar, based on ability to grow Gram-positive or Gram-negative organisms, then to confirm with a Gram stain.) This Gram-stain result will begin the process of bacterial determination through specific biochemical reactions using dichotomous keys, API strips, or computer analysis. Subsequent analysis will be dependent on the Gram-stain result and laboratory choice.

DIF: Medium REF: 28.2 OBJ: 28.2a Describe the approaches used to identify pathogens | 28.2b Use an algorithm to identify a pathogen MSC: Analyzing 3. Compare and contrast the dichotomous key approach to bacterial determination with the seven-digit-number approach when using the API strip system.

ANS: The API strip system results from this series of biochemical tests can be interpreted two different ways: (1) Using a dichotomous key: this is a step-wise interpretation beginning with a key reaction (e.g., lactose fermentation). Results are read as either a positive reaction or negative reaction, and the bacteria are identified based on the reactions for each of the various biochemical tests included on the strip. The inherent danger in using the dichotomous key method is that one anomalous result can lead to an incorrect identification.

(2) Generating a seven-digit number: the seven-digit number is obtained from given numerical values equated with each individual biochemical test within the strip and is based on whether the biochemical reaction is positive or negative. Once a number is generated, it can be compared to a computer database generating a probability score. The organism receiving the highest probability score is considered to be the determined species. This test is considered more accurate than the dichotomous key, in part because of the extensive and updated computer database and also because of the probability data generated (in comparison with the dichotomous key method, which simply generates data based on a yes/no format).

DIF: Difficult REF: 28.2 OBJ: 28.2a Describe the approaches used to identify pathogens | 28.2b Use an algorithm to identify a pathogen MSC: Analyzing 4. Looking at the laboratory results presented here, what three interpretations can be made?

Growth on blood agar Growth on Hektoen agar Growth of chocolate agar

Colony 1 No growth No growth Growth

Colony 2 Growth No growth Growth

Colony 3 Growth Growth Growth

ANS: Many different interpretations are possible; some answers may include the following:  Colony 1 is nutritionally fastidious and requires the most nutrient-rich agar (chocolate agar) to grow; may be a Neisseria or Haemophilus.  Colony 2 is less nutritionally fastidious than colony 1, since it can grow on both chocolate and blood agar; colony is likely Gram-positive since its growth was inhibited by Hektoen media.  Colony 3 is less nutritionally fastidious than colony 1, since it can grow on both chocolate and blood agar; colony is likely a Gram-negative enteric rod since it grew on Hektoen media.

DIF: Medium MSC: Analyzing

REF: 28.2

OBJ: 28.2b Use an algorithm to identify a pathogen

5. Looking at the laboratory results presented here, what three interpretations can be made?

Growth on blood agar Growth on CNA agar Growth on MacConkey agar

Colony 1 Growth Growth No growth

Colony 2 Growth No growth Growth

Colony 3 Growth Growth Slight growth

ANS: Many different interpretations are possible; some answers may include the following:  Colony 1 is most likely a Gram-positive bacteria; blood agar will grow both Gram-negatives and Gram-positives. CNA agar is a differential medium selecting for the growth of Gram-positive organisms (due to the inhibitors colistin and naladixic acid).  Colony 2 is most likely a Gram-negative bacteria; blood agar will grow both Gram-negatives and Gram-positives. MacConkey agar is a differential medium selecting for the growth of Gram-negative organisms (due to the inhibitors bile salts and crystal violet).  Colony 3 is most likely a Gram-positive bacteria of either Staphylococcus aureas or Enterococcus sp. Blood agar will grow both Gram-negatives and Gram-positives. CNA agar is a differential medium selecting for the growth of Gram-positive organisms (due to the inhibitors colistin and naladixic acid). MacConkey agar is a differential medium selecting for the growth of Gram-negative organisms (due to inhibitors bile salts and crystal violet), but does allow for Staphylococcus aureas or Enterococcus sp. growth (a limitation of this differential medium).

DIF: Difficult MSC: Analyzing

REF: 28.2

OBJ: 28.2b Use an algorithm to identify a pathogen

6. The clinical microbiology laboratory just received a sputum (deep-lung) sample that so far has been very slow-growing in nonselective agar, as well as not Gram stainable. What tests should be performed next, and why?

ANS:

Answers will vary. Based on the case history given (deep-lung sample, slow growing, and non-Gram-stainable), a possible direction to pursue would be that this is a mycobacterium infection (e.g., Mycobacterium tuberculosis or Mycobacterium avium). Tests that may more closely define the etiologic agent as a member of the mycobacterium family could include the following:  Growth on Löwenstein-Jensen agar—specific agar for mycobacterium growth;  Ziehl-Neelsen (acid-fast) staining—mycobacterium stain pink in this procedure, all other bacteria stain blue, presumptive for diagnosis of mycobacterium; and  PCR or RFLP testing using mycobacterium-specific primers.

DIF: Medium REF: 28.2 OBJ: 28.2c Contrast conventional and rapid techniques of pathogen identification MSC: Evaluating 7. Once cultured, bacteria from septic infections or urine can be quickly identified by MALDI-TOF-MS. What is this technique and how does it work?

ANS: MALDI-TOF-MS stands for matrix-associated laser desorption/ionization time of flight mass spectroscopy. It is used to separate and identify molecules based on their mass-to-charge ratio. In this case, it uses whole bacterial cells (or an extract) and identifies the most common proteins in the sample. It starts by spotting the sample onto a plate that contains the matrix. In a vacuum, the samples are ionized and move toward the detector such that those with a smaller mass-to-charge ratio arrive first. Peaks are generated and can be used to identify the proteins and, more importantly, which organism they came from.

DIF: Medium REF: 28.2 OBJ: 28.2d Appraise the role of multiplex-PCR, RT-qPCR, DNA sequencing, and mass spectrometry in diagnostics MSC: Understanding 8. How can reverse transcriptase PCR (RT-PCR) be used to determine the presence and viral load of HIV infection?

ANS: A blood sample would have to be taken from the HIV-infected patient and RNA extracted from the sample. The viral RNA would be converted to cDNA using a single primer and reverse transcriptase—the more viral RNA within the clinical sample, the more cDNA that will form in this first step. cDNA is amplified by PCR using two specific primers and Taq polymerase.

Quantification occurs by addition of a fluorescent oligonucleotide probe to the PCR reaction (fluorescent dye at 3' end, chemical dye at 5' end). This probe binds to an area between primers. If probe binding is kept intact, no light is emitted from the sample. However, if probe binding is degraded by the action of successful PCR amplification, then two ends of the probe are separated and light is emitted. The more copies of cDNA to begin with, the fewer cycles of PCR needed to register a fluorescence increase over background levels.

DIF: Medium REF: 28.2 OBJ: 28.2d Appraise the role of multiplex-PCR, RT-qPCR, DNA sequencing, and mass spectrometry in diagnostics MSC: Analyzing 9. How does a multiplex PCR reaction differ from a traditional PCR detection method? In addition, describe an example of how multiplex can be used in diagnostics.

ANS:

Traditional PCR uses primers that bind to unique genes in a pathogen’s genome to amplify either DNA or RNA present in a sample and then visualize the amplicon on an agarose gel. Multiplex PCR uses multiple primers to simultaneously search for strain variations in pathogenic organisms.

The example from the text shows how multiplex PCR is used to determine different Clostridium botulinum toxins by amplifying four different toxin genes in one PCR reaction.

DIF: Medium REF: 28.2 OBJ: 28.2d Appraise the role of multiplex-PCR, RT-qPCR, DNA sequencing, and mass spectrometry in diagnostics MSC: Analyzing 10. How would a serum antibody ELISA work in the detection of Lyme disease?

ANS: Serum antibody ELISA first starts with antigen being adsorbed to the plastic wells of a 96-well plate. In this case the antigens adsorbed to the well must be from the causative agent Borrelia burgdorferi. Albumin or powered milk is first added to block remaining sites on plastic that could result in false positive reactions. Next, patient serum (in this case, taken from the Lyme disease patient) is added to the wells and allowed to incubate. If anti-Lyme antibodies are present, binding reaction to the Borrelia burgdorferi antigens will occur. After a wash step, goat-antihuman IgG conjugated to an enzyme is then added to sandwich the patient serum antibody in the well. After an additional wash step, chromogenic substrate for the enzyme is added to induce a color change. The amount of color change is measured by an ELISA plate reader and is quantifiable to the amount of antibody present in the patient’s serum.

DIF: Medium REF: 28.2 OBJ: 28.2f Distinguish among serological methods of pathogen detection MSC: Analyzing 11. Compare and contrast the use of the serum antibody ELISA with the antigen-capture ELISA in the detection of Ebola.

ANS: Serum antibody ELISA uses antigen adsorbed to the plastic wells followed by incubation with the patient serum. The addition of a secondary enzyme-linked antibody will allow for the detection and quantification of anti-Ebola antibodies present in the patient serum. This is an indirect test, measuring the body’s immune response to the infectious antigen via antibody detection.

Antigen-capture ELISA uses antibody adsorbed to the plastic wells followed by incubation with patient serum. If the serum contains antigen, it will bind to the adsorbed antibody and detection/quantification can be made using the addition of a secondary enzyme-linked antibody, followed by a chromogenic substrate. This would be considered a direct test since it is directly measuring the presence of antigen.

In the case of Ebola, antibody levels are easier to detect than viral antigen (due to the very low levels of antigen present in a serum sample). However, since antibody development takes time, antigen detection may lead to a quicker diagnosis and therefore a better prognosis.

DIF: Difficult REF: 28.1 | 28.2 OBJ: 28.1a Explain why it is worthwhile to identify an infectious agent | 28.2f Distinguish among serological methods of pathogen detection MSC: Analyzing 12. Why are clinical viral diseases more challenging to diagnose than are clinical bacterial diseases?

ANS:

Answers will vary. Clinical viral diseases are more challenging to diagnose in a lab because viruses are intracellular parasites. Unlike bacteria, viruses do not have a viable existence outside of a host cell, and therefore laboratory diagnosis requires cell-culture techniques. Cell-culture techniques are more expensive and time-consuming, and many clinical labs do not have access to the equipment needed. Newer methods of rapid detection using nucleic acid–based identification are making identification of viruses much easier.

DIF: Medium REF: 28.2 OBJ: 28.2a Describe the approaches used to identify pathogens MSC: Evaluating 13. Compare and contrast the use of point-of-care rapid tests as diagnostic methods in doctors’ offices.

ANS: Answers may vary.  Advantages: culturing not required; antibiotic therapy can be initiated earlier and more effectively; infection chains determined more quickly; better patient compliance  Disadvantages: no data on antibiotic sensitivity; higher risk of technician infection, may miss co-infections; high false-positive and false negative rates (lower sensitivities) DIF: Medium REF: 28.2 OBJ: 28.2h List the advantages and disadvantages of point-of-care tests MSC: Analyzing 14. Compare and contrast the handling of rabies (a category III organism) with Lassa fever (a category IV organism).

ANS: Category III organisms, such as rabies, have greater pathogenic potential than level I and II with a possibility of respiratory transmission and a high risk of infection without proper handling.

Rigorous containment and procedures are necessary during handling, including but not limited to negative-pressure labs, restricted laboratory access, double-door air locks, and so on. A biosafety level III laboratory is necessary to work with these organisms.

Category IV organisms, such as Lassa fever, are extremely dangerous pathogens and need even more rigorous containment and procedures than category III organisms. Rigorous containment and procedures are necessary during handling; these include but are not limited to personal positive-pressure suits, negative-pressure labs in addition to restricted access, and double-door air locks. A biosafety level IV laboratory is necessary to work with these organisms.

DIF: Medium MSC: Analyzing

REF: 28.1

OBJ: 28.1e Contrast the biological safety levels

15. Describe the chain of command that is followed when a patient sees his or her doctor and is diagnosed with a reportable disease such as listeriosis.

ANS:

Notifiable diseases, such as listeriosis, are diseases that due to their severity and transmissibility must be reported by law. Physicians are required to report instances to a central health organization (local, county, and/or state offices). State and local offices report up through the chain of command. Highly infectious or dangerous organisms are reported within 48 hours of diagnosis to the Centers for Disease Control (CDC) for U.S. outbreaks. The CDC then reports to the World Health Organization (WHO), which tracks worldwide outbreaks. As a result, incidences of these diseases can be tracked and analyzed. Emerging diseases can also be detected via a cluster of patients with unusual symptoms or combinations of symptoms. An upsurge in cases sets off ―alarms‖ that initiate efforts to determine the source and cause of the outbreak.

DIF: Medium REF: 28.3 OBJ: 28.3d Outline the steps toward recognition that an epidemic is underway MSC: Analyzing 16. Compare and contrast the epidemiological terms ―endemic,‖ ―epidemic,‖ and ―pandemic.‖ Give an example of each to support your answer.

ANS: Answers will vary. Endemic diseases are always present in a population at low frequency (e.g., Lyme disease is endemic in the northeastern United States because it is found in a reservoir of deer and ticks; humans must have contact with this reservoir for infection). Epidemic diseases occur when large numbers of individuals in a population become infected over a short period of time, due in part to rapid and direct human-to-human transmission (e.g., food-borne illness, H1N1, and mumps). Pandemics are epidemics that occur over a wide geographic area, usually the world; these may be short-lived (e.g., 1918 flu pandemic) or long-lived (e.g., bubonic plague and HIV).

DIF: Medium REF: 28.3 OBJ: 28.3b Distinguish among endemic, epidemic, and pandemic diseases and between prevalence and incidence MSC: Analyzing 17. How were Koch’s postulates modified in the discovery of Tropheryma whipplei, the causative agent of Whipple’s disease?

ANS: Whipple’s disease was first diagnosed in 1907 by George Whipple, although the bacterial etiology was not determined until 1992 through amplified 16S rDNA sequencing of biopsied tissues.

Symptoms from this disease include bouts of watery diarrhea, recurring fevers, flu-like symptoms, profuse night sweats, and joint swelling. Stool samples have no blood or mucus, and blood and stool cultures come back from the lab as negative. Diagnosis of this disease comes from duodenal biopsy (showing large macrophages and bacterial rods) and is confirmed by electron microscopy and PCR. The discovery of this disease happened because all bacteria from biopsied tissues had common and unique 16S rRNA sequences. Primers were developed to the common areas, and PCR amplification revealed fragments that could be sequenced. The sequences found were similar in other Whipple disease patients and different from any known species.

Koch’s postulates state that an organism must be identified and grown in culture. Since this organism (a Gram-positive soil-dwelling actinomycete named Tropheryma whipplei) defies normal culturing techniques, disease causalty was determined with molecular diagnostics.

DIF: Medium REF: 28.3 OBJ: 28.3f Summarize the role of molecular techniques in pathogen identification and disease surveillance MSC: Analyzing

18. As a disease detective investigating an outbreak in the cafeteria of your college, what would be some of the first steps you would need to take to begin your investigation, other than laboratory testing?

ANS: Answers will vary. One of the first things a disease detective does is interview members of the population involved. This would involve talking with students who claim to have symptoms and recording case histories and progression of symptoms. Questions could include the following: When did you eat at the cafeteria? What did you eat specifically? When was the onset of symptoms? What were the symptoms? How long did the symptoms last? The disease detective would also have to conduct the same interviews with other students eating in the cafeteria at the same time, as a control population. Once all the information was collected, the disease detective could start to hypothesize about the disease based on knowing which organisms typically cause which symptoms and under what conditions. Confirmatory laboratory testing of sick students would be needed to determine the actual etiologic agent.

DIF: Medium REF: 28.3 OBJ: 28.3d Outline the steps toward recognition that an epidemic is underway MSC: Evaluating 19. Describe what the One Health Initiative is and the role it played in the 2006 outbreak of food-borne O157:H7 in spinach.

ANS: Ecology influences epidemiology and evolution of pathogens. The knowledge that pathogens have reservoirs in animals, arthropods, and plants has given rise to the collaboration between scientists, clinicians, veterinarians, and ecologists called the One Health Initiative. The goal of the One Health Initiative is to control human disease through animal health and vice versa (e.g., vaccinating wild rodents can decrease Lyme disease in humans). This goal has been extended to plants, since plants can harbor some infections, too (e.g., enteric bacteria can live in plant vascular systems).

Spinach caused the 2006 outbreak of E. coli O157:H7 in 200 people and 20 states. The source of the infection was a spinach farm in Salinas Valley, California. The organisms were found within the vascular system of the spinach (so washing the spinach did not help). A multidisciplinary collaboration allowed for this determination (otherwise the focus would have been solely on human morbidity and mortality).  Epidemiologists and vets found a genetically identical organism in wild hogs in the same fields and in cattle close by. Ecologists and hydrologists found that surface and groundwater was mixing due to drought, and irrigation systems were strained.  One Health concluded that cows defecated in the fields that wild hogs ran through, which then brought the E. coli to the spinach fields, where irrigation water swept the pathogen into the plants’ vascular systems.  In conclusion, a holistic approach is needed to understand, promote, and protect health.

DIF: Medium REF: 28.4 OBJ: 28.4e Evaluate the importance of the One Health Initiative in combating infectious diseases MSC: Analyzing 20. How have changes within our human culture caused new diseases to emerge? Explain your answer using a specific example that supports your statements.

ANS:

Answers will vary. Many new diseases have emerged over the last 30 years (Lyme, MRSA, SARS, Ebola, HIV, E. coli O157:H7, etc.). Advances in technology help infectious diseases to emerge and spread (e.g., travel, blood banks, and suburban sprawl).

Case studies of progress causing infections include the following: 

Lyme disease caused by Borrelia burgdorferi lives in deer and white-footed mice and is passed between these hosts by the deer tick. Suburban sprawl encroached on woodland habitat in Connecticut, resulting in decreased predator populations of mice and closer proximity of humans to the mice/tick/deer cycle.  Mad cow disease—modern farming practices of feeding livestock-rendered animal protein helped to spread transmissible spongiform encephalopathies similar to Creutzfeldt-Jakob prion disease.  Hepatitis C—spread via increasing transfusions and transplants  Influenza—spread via live poultry markets in Asia  Enterohemorrhagic E. coli—modern meat processing allows fecal matter to contaminate ground beef.

Changes in the natural environment can also cause infections. For example, in hantavirus, higher-than-usual rainfall increases plant and animal numbers, which increases the deer-mice population, which grows closer to and interacts more with human communities.

DIF: Medium REF: 28.4 OBJ: 28.4c Describe how human technology can aid infectious disease emergence and spread | 28.4d Assess how climate change affects emerging diseases MSC: Evaluating