Clinical Laboratory ChemistryRobert Sunheimer Test Bank.pdf

For exam and test prep, contact excellentessaywriters@gmail.com

Type:

Test Bank

Resource:

Clinical Laboratory Chemistry

Edition: Author(s):

1st Edition Robert Sunheimer Linda Graves

Clinical Laboratory Chemistry, 2e(Sunheimer) Chapter 1 Laboratory Basics 1) Ion-exchange filters remove which of the following from a water source? A) Ions to reduce the mineral content of water B) Lead C) Organic solvents. D) Bacteria Answer: A 2) Activated carbon filters remove: A) Ions from water.

B) Organic compounds from water.

C) Acids and bases from water.

D) Large particulates from water.

Answer: B 3) A 0.22-micron filter will remove: A) Particles with a diameter of 0.01 microns.

B) Particles with a diameter of 0.01 nanometers.

C) Particles with a diameter of 2.2 microns.

D) Only sodium chloride crystals.

Answer: C 4) The unit of resistivity is: A) Amperes.

B) Volts.

C) Coulombs.

D) MΩ ∙ cm.

Answer: D 5) Microbiological impurities in source water are reported in which format?

A) Colony forming units per mL (Cfu/mL) B) Total organic carbon (TOC) in ng/g C) milligrams of SiO2 D) Resistivity.

Answer: A 6) According to CLSI, the resistivity of clinical laboratory reagent water (CLRW) must be: A) > 100 milliamps.

B) < 10 millivolts.

C) > 10 MΩ ∙ cm.

D) < 10 MΩ ∙ cm.

Answer: C

1 ..

7) Which of the following should not be storied in borosilicate glass because it will etch the inside surface of the glass container?

A) Saline B) Strong bases (caustics) C) Clinical laboratory reagent water D) Weak acids Answer: B 8) Low actinic glassware has which of the following properties?

A) High thermal resistance with no color added to the glass B) Low thermal resistance with a green-yellow color added as an integral part of the glass C) High thermal resistance with a blue color added as an integral part of the glass D) High thermal resistance with an amber or red color added as an integral part of the glass Answer: D 9) Care must be taken before selecting polyethylene plastic for use as test tubes and disposable transfer pipets because: A) Polyethylene can bind or absorb proteins, dyes, stains, and picric acid.

B) Polyethylene does not bind or absorb proteins, dyes, stains, and picric acid.

C) Polyethylene cannot be used to pipet serum.

D) Polyethylene forms insoluble salts in the presence of sodium chloride.

Answer: A 10) Which of the following classes of glassware, including pipets, is manufactured and calibrated to deliver the most accurate volume of liquid?

A) A B) B C) AA D) C Answer: A 11) A to deliver or TD pipet is designed to: A) Allow the user to remove a portion of the sample in the tip for better accuracy.

B) Be vigorously tapped against the test tube after all the liquid is removed.

C) Drain by gravity.

D) Be refilled or rinsed out with the appropriate solvent after the initial liquid has been drained from the pipet.

Answer: C 12) Which of the following devices is used to calibrate laboratory thermometers?

A) Barometer B) Gallium melting point cell C) Titanium freezing point cell D) Platinum cathode voltmeter Answer: B

2 ..

13) Convert 75 mg/dL to mg/L. A) 7.5 mg/L B) 75.0 mg/L C) 750 mg/L D) 7500 mg/L Answer: C 14) Convert 70.0 mg/dL glucose to mmol/L glucose.

A) 3.89 mmol/L B) 38.9 mmol/L C) 70.0 mmol/L D) 389 mmol/L Answer: A 15) If a thermometer reads 39°F, what is the equivalent degree Celsius (°C)?

A) 0.39°C B) 3.9°C C) 39°C D) 40°C Answer: B 16) Convert 200 picograms to grams.

A) 2.0 × 10-10 grams B) 2.0 × 10-8 grams C) 20.0 grams D) 200 grams Answer: A 17) A patient's calcium result is 8.0 mg/dL. Convert this result to mmol/L. A) 0.004 mmol/L B) 0.20 mmol/L C) 2.0 mmol/L D) 20.0 mmol/L Answer: C 18) The surface area of a laboratory bench measures 12 square feet. What is the surface area in square meters?

A) 1.115 square meters B) 11.15 square meters C) 111.5 square meters D) 1115 square meters Answer: A

3 ..

19) What is the weight in kilograms for a 24-hours stool specimen that weighs 0.50 pounds ?

A) 0.0226 kilograms B) 0.2265 kilograms C) 2.265 kilograms D) 22.65 kilograms Answer: B 20) How much serum is required to make a 1 to 4 dilution with a total volume of 100.0 µL ?

A) 0.025 µL B) 0.25 µL C) 2.5 µL D) 25 µL Answer: D 21) A patient's creatinine is outside the linear range of the analyzer; 10 µL of serum is added to 90.0 µL of diluent and the diluted sample is reanalyzed. The creatinine value of the diluted sample is 1.0 mg/dL. Which of the following creatinine values is correct?

A) 1.0 mg/dL B) 10.0 mg/dL C) 20.0 mg/dL D) 100 mg/dL Answer: B 22) What is the dilution factor if 10 mL of sample is added to 190 mL of diluent?

A) 10 B) 19 C) 20 D) 25 Answer: C 23) A serum creatine kinase is diluted 1/200 with a result of 50 U/L. What is the patients' actual creatine kinase result?

A) 50 U/L B) 200 U/L C) 1000 U/L D) 10,000 U/L Answer: D 24) How many grams of sodium hydroxide (NaOH) are required to prepare 250 mL of a 1.00 molar (M) solution?

A) 2.5 g B) 10.0 g C) 25.0 g D) 100 g Answer: B

4 ..

25) What is the normality (N) of a 1.5 molar (M) H2SO4 solution?

A) 1.0 N B) 1.5 N C) 3.0 N D) 36 N Answer: C 26) What is the molality (M) of a solution that contains 330 g of CaCl2 per kilogram?

A) 3.0 M B) 3.3 M C) 33.0 M D) Unable to determine Answer: A 27) What is the concentration in mg/dL of a 140 mEq/L sodium standard?

A) 0.323 mg/dL B) 3.23 mg/dL C) 32.3 mg/dL D) 322 mg/dL Answer: D 28) Convert 145 mEq/L sodium concentration to mmol Na+/L. A) 14.5 mmol Na+/L B) 145 mmol Na+/L C) 167 mmol Na+/L D) 333 mmol Na+/L Answer: B 29) What is the molarity of a 20.0% w/v glucose solution?

A) 0.111 molar B) 1.11 molar C) 2.22 molar D) 11.1 molar Answer: B 30) Determine the molarity (M) of a solution if 125 mL of a 3.5 molar (M) solution is diluted to a final volume of 500 mL. A) 0.875 M B) 3.50 M C) 8.75 M D) 10.0 M Answer: A

5 ..

31) Convert 40°C to °F. A) 60°F B) 90°F C) 100°F D) 104°F Answer: D 32) What is the concentration (g/dL) of a 1/10 dilution of a 12% NaCl solution?

A) 0.12 B) 1.20 C) 12.0 D) 120.0 Answer: B 33) A solution contains 45g/100 mL of glucose. It is diluted 1/10 and diluted a second time 1/10.

What is the concentration in g/100 mL of the final solution?

A) 45.0 g/100mL B) 4.50 g/100 mL C) 0.45 g/100mL D) 0.045 g/100mL Answer: B 34) How many milliliters (mL) of a 2.0M solution are required to prepare 50 mL of a 0.3M solution?

A) 0.075 ml B) 0.75 ml C) 7.5 ml D) 75.0 ml Answer: C 35) A barium chloride solution is prepared by transferring 20 g of barium chloride to 1.0 liters of water. Calculate the chloride concentration in milliequivalents per liter of this solution.

A) 1.92 mEq Cl/L B) 19.2 mEq Cl/L C) 192.0 mEq Cl/L D) 384 mEq Cl/L Answer: C

6 ..

Clinical Laboratory Chemistry, 2e (Sunheimer) Chapter 2 Safety in the Clinical Chemistry Laboratory 1) OSHA standards are written in which of the following documents?

A) Codes of State Regulations (CSRs) B) Codes of Federal Regulations (CFRs) C) Safety Data Sheets (SDS) D) National Fire Protection Agency (NFPA) Answer: B 2) A class A fire involves: A) Combustible metals such as magnesium.

B) Flammable liquids, for example, methanol.

C) Ordinary combustible material including paper and wood.

D) Electrical equipment.

Answer: C 3) Which of the following practices is inappropriate when establishing quality controls ranges?

A) Exclusion of any quality control results greater than ±2 standard deviation from the mean B) Compare your data to the manufacturer of the quality control material.

C) Gather quality control data for a long period of time if necessary.

D) Using control results from all shifts on which the assay is performed Answer: A 4) Liquid nitrogen is an example of which of the following?

A) Carcinogen B) Mutagen C) Halogen D) Cryogen Answer: D 5) The letters SDS represent which of the following?

A) Safety design sheet B) Systems data sheets C) Safety devices schedule D) Safety data sheet Answer: D 6) The label identification system designated NFPA 704-M represents which of the following warnings?

A) Biohazard materials B) Mechanical devices C) Chemical hazards D) Laboratory safety hoods Answer: C

1 ..

7) Sources of nonionizing radiation include which of the following?

A) Beta radiation emitting isotopes (e.g., tritium) B) Gamma radiation emitting isotopes (e.g., 125Iodine) C) Microwaves, tungsten-halogen lamps, xenon lamps D) X-ray imaging devices Answer: C 8) Which of the following statements describes the proper method of storing chemicals in the laboratory?

A) According to their chemical properties and classifications B) Inside a chemical fume hood C) Alphabetically, for easy accessibility D) Inside a walk-in type refrigerator Answer: A 9) Which of the following statements is correct when handling cryogenic liquids?

A) It is not necessary to wear any personal protective equipment because there is no potential for injury to the body.

B) Wear proper personal protective equipment, including a lab coat that is buttoned, heavy gloves and a face shield or safety goggles.

C) Always pour cryogenic liquid into water not the reverse.

D) Cryogenic liquids do not cause embrittlement of materials.

Answer: B 10) Which of the following statements is correct regarding safety cabinets?

A) Safety cabinets are not required to be vented.

B) Cryogenic liquids may be stored in safety cabinets.

C) Large amounts of volatile solvents should be stored in a safety cabinet but are not required to be approved by NFPA and meets OSHA standards.

D) Large amounts of volatile solvents must be stored in a safety cabinet that is approved by NFPA and meets OSHA standards.

Answer: D 11) Which of the following statements is correct regarding laboratories and waste material?

A) Laboratories are not identified by Resource Conservation and Recovery Act (RCRA) as "waste generators."

B) Laboratories are identified by Resource Conservation and Recovery Act (RCRA) as "waste generators."

C) Laboratories are exempt from all state and Federal regulations regarding waste materials.

D) Hydrocarbons, nitro compounds, mercaptan, Freon and concentrated acids can be pour down the sink drains according to Resource Conservation and Recovery Act (RCRA).

Answer: B

2 ..

12) The CDC recommends vigorous rubbing together of all lathered surface for at least: A) 15 seconds. B) 60 seconds. C) 5 minutes. D) 15 minutes. Answer: A 13) Which of the following statements describes "engineered control"? A) A technique used to provide optimum control for quality testing of patient specimens B) Represents an alarm systems that alerts everyone in the laboratory that there is a fire in the building C) Safety equipment that isolates or removes the bloodborne pathogen hazard from the workplace and represents the preferred method for controlling hazards D) Safety equipment that isolates or removes only radiation hazard from the workplace and represents the preferred method for controlling radioactive hazards Answer: C

3 ..

Clinical Laboratory Chemistry, 2e (Sunheimer) Chapter 3 Laboratory Statistics, Method Development and QC 1) Which of the following statements usually determines the acceptable range when evaluating quality control results?

A) The range that includes 75% of the results B) The range encompassed by ±2.5 standard deviations C) The 95% confidence interval of the mean D) The central 68% of results Answer: C 2) Which of the following is an example of nominal type data?

A) Numbers applied to numeric variables for example, cholesterol result of 250 mg/dL B) Numbers applied to nonnumeric variables for example blood types could be coded as group O=1, group A= 2 etc.

C) Numbers that are discrete and ordered for example, 4 = most severe injury, 2 = a moderately severe and 1 = a minor injury D) Arithmetic mean Answer: B 3) A 13s quality control rule violation is defined as: A) One control result that exceeds ±3 s.

B) One control result that exceeds ±1.3s.

C) Three consecutive controls results that exceed ±3 s.

D) One control result that exceeds ±4 s.

Answer: A 4) Which statement listed below is a reason to reject an analytical run?

A) One control result exceeds above +1 standard deviation and the second control result exceeds -1 standard deviation from the mean.

B) Two consecutive control results exceed 2 standard deviations above or below the mean.

C) Four control results steadily increase in value but are less than ±1 standard deviation from the mean.

D) Three consecutive control results exceed plus or minus 1 standard deviation from the mean.

Answer: B 5) Which of the following is an example of an inferential statistic?

A) Mean B) Standard deviation C) F- test D) Correlation coefficient Answer: C

1 ..

6) A graph that shows the difference between your laboratory result and a comparative method results along the x-axis and the percent difference along the y-axis is referred to as which of the following?

A) Levy-Jennings graph B) Linear regression graph C) CUSUM graph D) Bias graph Answer: D 7) Which of the following practices is inappropriate when establishing quality controls ranges?

A) Exclusion of any quality control results greater than ±2 standard deviation from the mean B) Compare your data to the manufacturer of the quality control material.

C) Gather quality control data for a long period of time if necessary.

D) Using control results from all shifts on which the assay is performed Answer: A 8) Which of the following statistics is used to qualify the strength of the relationship between two variables?

A) z- value B) standard error of the difference C) Confidence interval D) Correlation coefficient Answer: D 9) An important difference between parametric statistics and nonparametric statistics is that nonparametric statistics is distribution free, whereas parametric statistics: A) Assumes linearity.

B) Is sensitive to gender and age.

C) Presumes a Gaussian distribution.

D) Accepts all outliers.

Answer: C 10) Recovery experiments, testing proficiency samples and estimating bias are all examples of procedures used to assess: A) Accuracy.

B) Precision.

C) Coefficient of determination.

D) Total error.

Answer: A

2 ..

11) A type II error is defined as which of the following?

A) A serious misinterpretation of quality control rule violation B) Erroneously accepting the null hypothesis, with the result that a real difference is not detected.

C) Erroneously rejecting the null hypothesis or proclaiming a difference to exist when one does not D) Ignoring a large bias between two methods Answer: B 12) A significant limitation of least squares regression analysis is: A) A large confidence intervals may result is false positives.

B) Outliers will not impact the results.

C) It may result in an incorrect decision of analytical reproducibility.

D) Nonlinearity of the data will affect both the slope and intercept.

Answer: D 13) Analysis of variance (ANOVA) is an appropriate statistics to evaluate three or more sets of data among each other, but it does NOT reveal: A) Which set of data is bias.

B) Which set of data is most accurate.

C) Which set of data is most precise.

D) Which set of data is not in agreement with the other data.

Answer: D 14) Deming's linear regression analysis attempts to: A) Compensate for shortcomings of Passing and Bablok regression analysis.

B) Overcome shortfalls in the least squared method.

C) Overcome shortfall due to quality control failures.

D) Overcome issues related to the interpretation of a Student-t test.

Answer: B 15) The McNemar statistics using a two by two contingency table is useful for evaluating which of the following?

A) Correlation between two qualitative assays for example urine β-hCG B) The degree of association between two sets of data C) Correlation between two quantitative assays for serum β-hCG D) Determining the source of error in a qualitative assay Answer: A 16) Linearity is useful for assessing: A) Slope and bias of an analytical method.

B) A large correlation coefficient.

C) Intercept and p value of analytical method.

D) Slope and intercept of an analytical method.

Answer: D

3 ..

17) The term patient demographics refers to which type of information that is entered into a laboratory information system?

A) Patient-specific information, for example, name, age, and date of birth B) Patient-specific information, for example, the total volume of urine collected in a 24-hour period for a creatinine clearance C) Patient-specific information, for example, their mother's and father's first and last name D) Patient-specific information, for example, where they were born and their religious preference Answer: A 18) A cross-reacting compound in a serum sample may result in which of the following?

A) A reliable result B) A precise result C) An accurate result D) A discordant result Answer: D 19) Proportional error in a method is characterized by which of the following?

A) The magnitude of the error stays the same over a wide concentration range.

B) The magnitude of the error increases as the concentration of analyte increases.

C) The magnitude of the error decreases as the concentration of analyte increases.

D) The magnitude of the error is inversely proportional to concentration.

Answer: B 20) A glucose result that is greater than the lower limit of detection of the method should be reported as which of the following?

A) Zero B) Less than the detection limit value C) The actual concentration value given by the analyzer or as calculated by the operator D) Greater than the detection limit value Answer: D 21) The results of a precision study urea nitrogen are shown below. What is the per cent coefficient of variation for the study?

Mean = 15 mg/dL Standard deviation = 1.5 mg/dL Variance = 2.0 mg/dL A) 1.5% B) 2.0% C) 10.0% D) 15.0% Answer: C

4 ..

22) A urea nitrogen result is falsely elevated and it was discovered that the previous sample on the sample carousel has abnormally high serum glucose. Which of the following can cause this error?

A) Pipetting an extra volume of diluents into the sample with the falsely elevated glucose B) Carryover C) A leak in the reagent-dispensing probe D) Double pipetting of the sample with the elevated glucose result Answer: B 23) The term that describes a procedure in which the CLS compares two consecutive laboratory results on a patient is: A) Discordant check.

B) Correlation check.

C) Limits check.

D) Delta check.

Answer: D 24) A deteriorating light source in a spectrophotometer can result in which of the following types of errors?

A) Systematic B) Systemic C) Type I D) Type II Answer: A 25) Which of the following is a procedure that is used to substantiate the continued accuracy of the test system throughout the laboratory reportable range of the tests result of the test system?

A) Quality control B) Calibration C) Bias testing D) Regression analysis Answer: B

5 ..

Clinical Laboratory Chemistry, 2e (Sunheimer) Chapter 4 Instrumentation, Laboratory Automation, and Informatics 1) Electromagnetic radiation exists both as Maxwell's waves and as streams of particles called: A) Photons.

B) Mesons.

C) Electrons.

D) Neutrons.

Answer: A 2) Amplitude of the electromagnetic sine wave is defined as: A) The length of the electronic vector at one-half peak width.

B) The width of the electronic vector at maximum peak height.

C) The length of the electronic vector at maximum peak height.

D) The area under the sine wave.

Answer: C 3) A nanometer is equivalent to: A) 109 meters.

B) 10-9 meters.

C) Nine meters.

D) One-ninth of a meter.

Answer: B 4) What is the concentration of serum uric acid in a solution whose absorbance is 0.098, cuvet pathlength, 1.0 centimeters, absorptivity is 0.102 L g-1cm-1?

A) 0.96 mg/L B) 0.009 g/L C) 0.48 g/L D) 1.96 g/L Answer: A 5) What is the concentration of creatinine in a serum sample if given the following?

Atest = 0.150 Astandard = 0.90 Cstandard = 1.0 mg/dL A) 0.25 mg/dL B) 0.5 mg/dL C) 0.7 mg/dL D) 0.167 mg/dL Answer: D

1 ..

6) Which of the following types of light sources emits radiation that changes in intensity very slowly as a function of wavelength?

A) Pulsating source B) Line source C) Continuum source D) Microwave source Answer: C 7) Filters and diffraction gratings are examples of which of the following?

A) Monochromators B) Cuvettes C) Light sources D) Slits Answer: A 8) The wavelength in nanometers at peak transmittance is termed: A) Spectral bandwidth.

B) Stray light.

C) Nominal wavelength.

D) Electromagnetic spectrum.

Answer: C 9) Bandpass is defined as: A) The range of wavelengths at a point halfway between the baseline and the peak.

B) The half power point or full width at half maximum.

C) The total range of wavelengths transmitted.

D) The product of parallel beams of radiation.

Answer: C 10) A photomultiplier tube functions to: A) Reduce the electronic signal produced as photons cascade from dynode to dynode.

B) Increase the electronic signal produced as photons cascade from dynode to dynode.

C) Decrease the number of transmitted photons from the cuvette.

D) Reduce in a logarithmic fashion the electronic signal created at the cathode.

Answer: B 11) Didymium and holmium oxide filters are used to assess: A) Wavelength accuracy.

B) Voltage values.

C) Stray light.

D) Photometric accuracy.

Answer: A

2 ..

12) Which of the following is a cause of stray light failure in a spectrophotomer?

A) Fingerprints on a cuvette B) Misaligned monochromator C) Room light entering the spectrophotometer and impinging upon the detector D) A dirty holmium oxide filter Answer: C 13) Light reflecting off a urine dipstick absorbent surface is an example of which of the following?

A) Specular reflectance B) Diffuse reflectance C) Refractance D) Chemiluminescence Answer: B 14) Which of the following describes atomic absorption spectroscopy?

A) The transmittance of monochromatic electromagnetic radiation by an element in its excited state B) The measurement of the electromagnetic radiation emitted by an element C) The release of electromagnetic radiation due to a chemical reaction D) The absorption of monochromatic electromagnetic radiation by an element in its ground state with a net zero charge Answer: D 15) Which of the following statements best illustrates the difference between photons from fluorescent emission and the excitation photons?

A) Emission photons are higher energy and longer wavelength.

B) Emission photons are lower energy and longer wavelength.

C) Emission photons are lower energy and shorter wavelength.

D) Emission photons are negatively charged and have zero mass.

Answer: B 16) The polarization of light in fluorescent polarization immunoassay allows the measurement of which of the following?

A) Bound fraction in the presence of the free fraction B) Only the bound fraction after the free fraction is removed C) Both bound and free fractions D) Antibodies to fluorescent label Answer: A 17) A chelate of europium (Eu3+) is used in which of the following assays?

A) Radioimmunoassays B) Chemiluminescent immunoassays C) Time-resolved fluorescent immunoassays D) Fluorescent polarization immunoassays Answer: C

3 ..

18) Oxidation of acridinium esters by hydrogen peroxide in the presence of peroxidase produces which of the following?

A) Fluorescence B) Phosphorescence C) Translucence D) Chemiluminescence Answer: D 19) Turbidimetry is the measurement of the reduction in light transmission caused by: A) Particle formation.

B) Chelation of metals.

C) Slowing of the spin rotation of electrons.

D) Increase in excitation photon energy.

Answer: A 20) The presence of particulates in a urine sample measured by a refractometer will result in which of the following?

A) An increase in reflectance of the solution B) A change in the critical angle of the light as it passes through the solution C) An increase in energy of the solute particles that results in a release of light energy D) A change in Rayleigh scatter patterns Answer: B 21) Which of the following accounts for the temperature rise in freezing point osmometry?

A) Heat of separation B) Thermal currents flowing through the ethylene glycol C) Heat of fusion D) Heat of conduction Answer: C 22) Which of the following electrical devices senses the freezing point of a solution in an osmometer?

A) A pH electrode B) A pressure transducer C) A conductivity electrode D) A thermistor Answer: D 23) Throughput is defined as: A) Numbers of tests performed per hour.

B) Number of stat tests performed per hour.

C) Number of specimen processed per 24 hours.

D) Number of sample aspirations performed in 60 seconds.

Answer: A

4 ..

24) Which of the following statements best describes discrete testing?

A) Automatically measures up to 10 different analytes on a serum specimen whether they are requested or not B) Measures only the test requested on a sample C) Measures analytes in serum samples only D) Automatically measures all of the tests that the analyzer is capable of performing Answer: B 25) Any specimen, by a command to the processing systems, can be analyzed by any available process, in or out of sequence with other specimens, and without regard to their initial order describes which type of sample processing principle?

A) Batch and discrete analysis B) Centrifugal analysis C) Continuous flow analysis D) Random access analysis Answer: D 26) A designated area where a limited number of specific tasks are completed describes which of the following terms?

A) Work area B) Work station C) Work room D) Core laboratory Answer: B 27) Which of the following devices is suitable to detect clots in serum specimens?

A) Aggregometer B) Refractometer C) Luminometer D) Pressure transducer Answer: D 28) A glucose result is falsely elevated and it was discovered that the previous sample on the sample carousel has abnormally high serum glucose. Which of the following can cause this error?

A) Pipetting an extra volume of diluents into the sample with the falsely elevated glucose B) Carryover C) A leak in the reagent-dispensing probe D) Double pipetting of the sample with the elevated glucose result Answer: B 29) Which of the following statements best describes unit test reagents?

A) There is an abundance of reagent present for the performance of several tests.

B) There is exactly twice the amount of reagent present for the performance of a single test.

C) There is sufficient reagent present for the performance of a single test.

D) There is only eight hours of reagent present to perform the tests requested.

Answer: C

5 ..

30) Which of the following represents a disadvantage to acquiring and implementing total laboratory automation?

A) Increases labeling errors B) Increases turnaround times C) Increases the need for additional full time equivalents (FTEs) D) The initial costs are very high.

Answer: D 31) Increase test throughput, reduce turnaround time, and compensate for staff shortages are all examples of which of the following?

A) Factors that lead to more errors B) Factors that drive manual procedures C) Management options used to reduce the number of technologist in the laboratory D) Factors that drive automation Answer: D 32) Automating laboratory testing has resulted in which of the following?

A) Inconsistent sample processing errors B) A reduction in the number of laboratory errors C) Increased turnaround time D) Increased repetitive injuries Answer: B 33) Which of the following is an example of software that allows a laboratory to connect their existing LIS and instrumentation to facilitate sharing information and performs tasks not currently done with laboratories' existing hardware and software?

A) Middleware B) LIS-HIS interface C) RS232 software D) Computer operating system Answer: A 34) Direct tube sampling by automated analyzers eliminates the need to perform which of the following tasks?

A) Pour off specimens into another container B) Manual dilution of specimens C) Check for clots in specimens D) Check for proper sample volume Answer: A 35) A test menu is: A) A listing of all the reagents on-board the analyzer.

B) A listing of preventative maintenance tasks that needs to be performed.

C) A listing of all of the tests or analytes that the instrument is capable of measuring.

D) A listing of consumables used by the analyzer.

Answer: C 6 ..

Clinical Laboratory Chemistry, 2e(Sunheimer) Chapter 5 Immunoassays 1) Which of the following substances does glucose-6-phosphate dehydrogenase bind to in the EMIT assay?

A) Coenzyme B) Substrate C) Antigen D) Antibody Answer: C 2) Which of the following describes the composition of the two particles used in the luminescent oxygen channeling immunoassay (LOCI)?

A) High-energy fluorescent radiation bead and a low-energy fluorescent radiation bead coated with luminal B) One synthetic bead coated with the enzyme alkaline phosphatase and a second synthetic bead coated with the substrate 4-nitrophenylphenol C) One paramagnetic particle coated with anti IgG antibody and a second paramagnetic particle w coated with an IgG receptor antigen D) One synthetic bead coated with Streptavidin that contains photosensitive dye and a second synthetic bead coated with a binding partner specific for the method and contains a chemiluminescent dye Answer: D 3) The antibody that binds to hapten-enzyme in the EMIT assay results in which of the following?

A) Enhancement of enzyme activity B) Inhibition of enzyme activity C) Inhibition of the enzyme substrate complex to reach first order kinetics D) It has no effect on the reaction.

Answer: B 4) Which of the following best describes a procedural difference between homogeneous and heterogeneous immunoassays?

A) There is no physical separation of bound from free fractions in a homogeneous immunoassay whereas in a heterogeneous immunoassay you must separate bound forms from free forms.

B) A homogeneous immunoassay usually takes longer to perform because you must physically separate the bound from free fractions whereas in a heterogeneous immunoassay the time to perform the assay is shorter because you do not have to separate bound forms from free forms.

C) There is a physical separation of bound from free fractions in a homogeneous immunoassay.

D) Separation of bound and free fractions is optional for either type of immunoassays.

Answer: A

1 ..

5) Monoclonal antibodies typically recognize: A) Multiple antigen sites.

B) Single antigen sites.

C) Only polar amino acids containing proteins.

D) Five different antigen sites.

Answer: B 6) Which of the following immunoassays uses a gold electrode to facilitate production of light?

A) Electrochemiluminescence immunoassay B) Fluorescence polarization immunoassay C) Luminescent oxygen-channeling immunoassay D) Substrate labeled fluorescent immunoassay Answer: A 7) Which of the following best describes haptens?

A) Haptens can be any substance capable of reacting with an antibody, but without necessarily being capable of inducing antibody formation.

B) Haptens are immunoglobulins capable of binding specifically to both natural and synthetic antigens.

C) Haptens are substances that are capable of binding an antibody but by themselves cannot stimulate an immune response.

D) Haptens are compounds that can be attached to antigens or antibodies and used as labels for immunoassays.

Answer: C 8) A competitive immunoassay includes a patient analyte (antigen), antibody to the analyte (antigen), and which of the following?

A) A paramagnetic particle to which an antibody is attached B) An antigen labeled conjugate C) A label that is not attached to either an antibody or antigen D) An antibody to the antibody-antigen complex Answer: B 9) In fluorescence polarization immunoassay (FPIA), the electrons in fluorescein molecules chemically attached to the hapten react in which of the following manner?

A) They do not spin at all.

B) They spin 100 times faster than normal.

C) They do not fluoresce.

D) They fluoresce.

Answer: C

2 ..

10) Plastic beads, polyclonal gels, and particles coated with iron oxide used in immunoassays are all examples of which of the following?

A) Antigen label B) Solid phase material C) Immunogens D) Double antibodies Answer: B 11) Luminescent oxygen channeling immunoassay (LOCI) takes advantage of which of the following distance factors to initiate a chemiluminescent reaction?

A) Short diffusion distance of oxygen molecules in the first electronic state B) Long diffusion distance of oxygen molecules in the first electronic state C) Short absorption distances of oxygen D) Short diffusion distance of hydrogen molecules in the first electronic state Answer: A 12) Microparticulate enzyme immunoassay uses which of the following enzymes to catalyze the conversion of the substrate, 4-methylumbelliferyl phosphate to methylumbelliferone?

A) Acid phosphatase B) Alkaline phosphatase C) Gamma-glutamyltransferase D) Aldolase Answer: B 13) Which of the following is an example of a chemiluminescent compound?

A) Fluorescein B) Luminol C) Acridinium D) Cis-platinum Answer: C 14) As the concentration of analyte begins to exceed the amount of antibody present, the dose response curve will flatten (plateau) and with further increase may become negatively sloped; this describes which of the following?

A) Logarithmic relationship of antibody concentration and millivolt output from the detector B) Increase in precision C) Loss of sensitivity D) Hook effect Answer: D

3 ..

15) Which of the following statements is TRUE regarding cloned enzyme donor immunoassays?

A) It uses a unique application of recombinant DNA technology to homogeneous immunoassay technique.

B) It uses a unique application of recombinant DNA technology to a heterogeneous immunoassay technique.

C) It uses a unique application of RNA receptor-capture technology to homogeneous immunoassay technique.

D) It uses an application of nano technology to competitive immunoassay technique.

Answer: A 16) Which statement best defines an antigen?

A) Multiple molecular forms of an isoform B) Immunoglobulin that is capable of binding specifically to both natural and synthetic antigens C) A chemical substance capable of inducing an immune response D) Any material capable of reacting with an antibody, without necessarily being capable of inducing antibody formation Answer: D 17) Which detector label is used in electrochemiluminescence immunoassays?

A) Fluorescein B) Dioxetane C) Ruthenium with tripropylamine D) Glucose-6-phosphate dehydrogenase Answer: C 18) In fluorescent polarization immunoassay, a high concentration of sample analytes results in which of the following?

A) Increased emission of polarized light B) Decreased emission of polarized light C) Increased emission of nonpolarized light D) Decreased emission of nonpolarized light Answer: C 19) Which of the following immunoassays produces a fluorescent molecule, 4methylumbelliferone that serves as the detector compound?

A) Microparticulate enzyme immunoassay B) Substrate labeled fluorescent immunoassay C) Enzyme multiplied immunoassay D) Fluorescent polarization immunoassay Answer: A

4 ..

20) Affinity is described as which of the following?

A) The overall strength of binding of an antibody to an antigen and includes the sum of the binding affinities of all the individual binding sites on the antibody B) Another substance that is capable of producing antibodies C) The thermodynamic quantity defining the energy of interaction of a single antibody-binding site and its corresponding epitope on the antigen D) A chemical substance capable of inducing an immune response Answer: C

5 ..

Clinical Laboratory Chemistry, 2e (Sunheimer) Chapter 6 Molecular Diagnostics 1) Suppose a laboratory received 2 µg of DNA from a clinical sample, when the DNA isolation procedure used stated that 10 µg was optimal. The laboratory's result can be explained by all of the factors below EXCEPT: A) A low patient white blood cell count. B) Inadequate harvesting of the buffy coat from the sample. C) Storage of the whole blood sample at 22°C for 12 hrs prior to use. D) Contamination of the sample with protein. Answer: B 2) The melting temperature (Tm) of the DNA sequence given below is: 5' TAACCTATGCGA 3' 3' ATTGGATACGCT 5' A) 12°C. B) 24°C. C) 34°C. D) 38°C. Answer: D 3) Which of the following is a step in the process of translation? A) RNA polymerase binds to the promoter sequence. B) Introns are removed from the transcript. C) A string of A's are added to the 3' end of the mRNA. D) Anticodons on the tRNAs bind to their complementary codons on mRNA. Answer: B 4) How much DNA would be contained in 200 μg of a sample that has an absorbance at 260nm of 0.40 and an absorbance at 280nm of 0.20? A) 4 μg B) 6 μg C) 8 μg D) 10 μg Answer: A 5) Which of the following is TRUE about gel electrophoresis of DNA? A) DNA of smaller molecular weight will travel far from the point of application. B) DNA migrates toward the cathode. C) Increasing the voltage increases the resolution of DNA fragments separated in the gel. D) DNA electrophoresis requires polyacrylamide as a matrix. Answer: C

1 ..

6) Restriction endonucleases function by: A) Linking 2 pieces of DNA from different sources.

B) Adding a phosphate group onto one end of the DNA. C) Cutting the DNA at specific nucleotide sequences.

D) Breaking the DNA randomly to create fragments of manageable size.

Answer: C 7) All of the following are clinical applications of FISH EXCEPT: A) Detection of chromosome microdeletions.

B) Detection of oncogenes in tumor cells.

C) Monitoring patients with sex-mismatched bone marrow transplants for engraftment.

D) Detecting DNA from tumor-causing viruses in cytologic specimens.

Answer: B 8) RNA differs from DNA in that RNA: A) Contains thymine instead of uracil.

B) Contains an H group instead of an OH group at its number 2 carbon.

C) Is normally single-stranded.

D) Is used to carry the genetic information of most viruses.

Answer: B 9) The protein product derived from the DNA sequence below contains which of the following amino acid sequences?

DNA: 3' TACTTTCGCGGAACT 5' A) Tyrosine-phenylalanine-arginine-glycine-threonine B) Tyrosine-phenylalanine-arginine-glycine C) Methionine-lysine-alanine-proline D) Methionine-lysine-alanine-proline-tryptophan Answer: C 10) Which of the following is NOT a component of a nucleotide?

A) 5' carbon sugar B) Amino acid C) Nitrogenous base D) Phosphate group Answer: C 11) Suppose that a laboratory wanted to separate small DNA fragments that were 10 base pairs (bps) apart in size. The optimal technique to use for the separation is: A) Agarose gel electrophoresis.

B) Polyacrylamide gel electrophoresis.

C) Pulse-field gel electrophoresis.

D) Denaturing gel electrophoresis.

Answer: C

2 ..

12) Which of the following fragments would be generated when the following sequence is cut by SmaI? 5' TACCCCGGGGGCAATTCCCGGGAGATTCCCGGGAACTC 3' A) One 3 bp fragment, two 11 bp fragments, and one 13 bp fragment B) One 4 bp fragment, one 10 bp fragment, one 11 bp fragment, and one 13 bp fragment C) Two 19 bp fragments D) One 6 bp fragment, one 8 bp fragment, one 11 bp fragment, and one 13 bp fragment Answer: B 13) Real-time PCR differs from traditional PCR in that: A) Primers are not necessary.

B) The amplicon is detected as the reaction progresses.

C) The amplicon is detected on a special fluorescent gel.

D) The reaction requires hybridization probes.

Answer: D 14) More nonspecific binding of a probe to DNA sequences in a sample is encouraged when: A) The size of the probe is increased.

B) The salt concentration is decreased.

C) The temperature is decreased.

D) The temperature is increased.

Answer: C 15) Labeled antibodies are used as probes to detect proteins in: A) Hybrid capture assay.

B) Northern blot.

C) Southern blot.

D) Western blot.

Answer: D 16) A suitable method to use for quantitation of HIV in patient blood is: A) bDNA. B) DNA sequencing.

C) SDA. D) Southern blot.

Answer: A

3 ..

Clinical Laboratory Chemistry, 2e(Sunheimer) Chapter 7 Carbohydrates 1) An isomer of glucose with the -OH group of the anomeric carbon C1 that is below the plane of the ring or on the right-hand side is: A) D-glucose.

B) L-glucose.

C) α -glucose.

D) β -glucose.

Answer: C 2) Which of the following carbohydrates is a polysaccharide?

A) Starch B) Sucrose C) Lactose D) Glucose Answer: A 3) Gluconeogenesis is: A) The conversion of glucose to glycogen for storage.

B) The formation of glucose from noncarbohydrate sources, for example, amino acids, glycerol, and lactate.

C) The conversion of glucose into 3-C molecules, for example, lactate and pyruvate.

D) Breakdown of glycogen to form glucose and other intermediate products.

Answer: B 4) Glycolysis is: A) The conversion of glucose into lactate or pyruvate and then CO2 and H2O. B) The conversion of glucose to glycogen for storage.

C) The breakdown of glycogen to form glucose and other intermediate products.

D) The formation of glucose from noncarbohydrate sources.

Answer: A 5) Glycogen is stored in the: A) Pancreas.

B) Liver.

C) Spleen.

D) Gall bladder.

Answer: B 6) Which of the following is the primary hypoglycemic hormone?

A) Insulin B) Thyroxine C) Glucagon D) Growth hormone Answer: C

1 ..

7) Which of the following hormones does NOT stimulate glycogenolysis? A) Insulin B) Glucagon C) Epinephrine D) Thyroxine Answer: A 8) A patient's low glucose, increased insulin, and increased C-peptide is caused by: A) Glucagonoma. B) Addison's disease. C) Insulinoma.

D) Injection of exogenous insulin. Answer: C 9) The only hormone that causes a decrease in blood glucose levels is: A) Glucagon. B) Thyroxine. C) Insulin. D) Parathyroid hormone.

Answer: C 10) Which of the following is characteristic of type 2 diabetes mellitus? A) High insulin levels B) Ketosis C) Obesity and physical inactivity D) Juvenile onset Answer: C 11) Which form of diabetes usually manifests itself early in life, and is associated with ketosis, low insulin levels, and autoantibodies to islet cells? A) Gestational B) Type 1 C) Type 2 D) Congenital Answer: B 12) All of the following are associated with gestational diabetes EXCEPT: A) It converts to diabetes mellitus after pregnancy in 30-60% of patients. B) Is diagnosed using the same glucose tolerance criteria as in nonpregnant women. C) Is defined as glucose intolerance during pregnancy. D) Associated with increased fetal risk. Answer: B

2 ..

13) All of the following are confirmatory of diabetes mellitus EXCEPT: A) Fasting glucose greater than 126 mg/dL. B) Urine glucose greater than 300 mg/dL C) 2-hour postprandial glucose greater than 200 mg/dl.

D) 1- and 2-hour glucose tolerance values greater than 200 mg/dL. Answer: B 14) Complications of diabetes mellitus include all of the following EXCEPT: A) Heart disease and stroke.

B) Neuropathy.

C) Nephropathy.

D) Hepatitis.

Answer: D 15) Instructions for patients preparing for a glucose tolerance tests include all of the following EXCEPT: A) No food 10 hours before and during the test.

B) Patient must be ambulatory for 3 days prior to the test.

C) Carbohydrate intake must be at least 150g/day for 3 days prior to the test.

D) Caffeine and smoking are permitted before and during the test.

Answer: D 16) A patient with an insulinoma may exhibit dizziness and fainting attributable to: A) Hypoglycemia.

B) Hyperglycemia.

C) Ketosis.

D) Acidosis.

Answer: A 17) What type of hypoglycemia is exhibited 8 hours after a meal?

A) Reactive B) Fasting C) Alimentary D) None of the above Answer: B 18) All of the following statements about clinical hypoglycemia are true EXCEPT: A) Neuroglycopenic symptoms must be present at the time of the low blood sugar.

B) Symptoms can be relieved by ingestion of carbohydrates.

C) High fasting insulin levels must be present to make a diagnosis.

D) C-peptide levels are normal or elevated.

Answer: C

3 ..

19) Select the enzyme that is most specific for β-D glucose. A) Phosphohexisomerase B) Hexokinase C) Glucose oxidase D) Glucose dehydrogenase Answer: C 20) The enzyme that catalyzes the reaction ATP + D-glucose → ADP + D-glucose-6-phosphate is: A) Glucose oxidase.

B) Lyase.

C) Hexokinase.

D) Mutase.

Answer: C 21) In the Hexokinase method for glucose determinations, the actual end product measured is the: A) Amount of hydrogen peroxide produced.

B) NADPH + H+ produced from the reduction of NADP. C) Amount of glucose combined with bromcresol purple.

D) Condensation of glucose with an aromatic amine.

Answer: B 22) Glucose concentration in serum is: A) Higher than the concentration in whole blood.

B) Lower than the concentration in whole blood.

C) Equal to the concentration in whole blood.

D) Unable to predict—variable.

Answer: A 23) In a specimen collected for plasma glucose analysis, sodium fluoride: A) Serves as a coenzyme of hexokinase.

B) Prevents reactivity of non glucose reducing substances.

C) Precipitates protein.

D) Inhibits glycolysis.

Answer: D 24) Which of the following 2-hour glucose results would be classified as impaired glucose tolerance?

A) 125 mg/dL B) 135 mg/dL C) 160 mg/dL D) 210 mg/dL Answer: C

4 ..

25) The glucose concentration in normal cerebrospinal fluid is: A) Usually less than 30 mg/dL. B) 60-75% of the plasma glucose concentration. C) Equal to the plasma glucose concentration.

D) Usually greater than 100 mg/dL. Answer: B 26) If a patient's serum glucose is 100 mg/dL, what would you expect the cerebrospinal fluid glucose to read?

A) 45 mg/dL B) 68 mg/dL C) 85 mg/dL D) 95 mg/dL Answer: B 27) A sneaky diabetic tried to lower her glucose by working out and watching her diet 1 or 2 days and before her appointment. The rest of the time she spent the day in front of the television eating chocolates. What test could the doctor order to detect this type of behavior?

A) A glucose tolerance test B) A glycosylated hemoglobin C) Daily urine glucose D) A hospital admission so he could watch her daily Answer: B 28) Which statement regarding glycosylated hemoglobin is TRUE? A) It has a sugar attached to the N-terminal valine of the β-chain of the hemoglobin molecule.

B) Is dependent upon the time averaged blood glucose over the lifespan of the RBC. C) Levels below 7% indicate adequate regulation for 8-12 weeks prior to sampling.

D) All of the above Answer: D 29) Of the following blood glucose levels, which would you expect to result in glucose in the urine?

A) 70 mg/dL B) 100 mg/dL C) 120 mg/dL D) 200 mg/dL Answer: D

5 ..

30) The following glucose tolerance test values are indicative of what state?

Fasting: 85 mg/dL 1/2 hour: 135 mg/dL 1 hour: 139 mg/dL 2 hour: 130 mg/dL A) Normal B) Diabetes mellitus C) Addison's disease D) Hyperinsulinism Answer: A

6 ..

Clinical Laboratory Chemistry, 2e(Sunheimer) Chapter 8 Lipids 1) Bile acids are synthesized in the liver from which lipid?

A) Triglycerides B) Cholesterol C) Fatty acids D) Phospholipids Answer: B 2) Cholesterol is a: A) Glycerol ester.

B) Cyclopentanoperhydrophenanthrene nucleus.

C) Fatty acid.

D) Phospholipid.

Answer: B 3) What percentage of serum cholesterol is present in the form of esters?

A) 10-20% B) 20-40% C) 60-75% D) 80-95% Answer: C 4) Which of the following lipids are derivatives of fatty acids comprised of 20 C atoms including a 5 C cyclopentane ring?

A) Phospholipids B) Prostaglandins C) Triglycerides D) Cholesterol Answer: B 5) Which of the following lipid fractions are very large molecules with a low density and give plasma a milky appearance when present in increased amounts?

A) Chylomicrons B) VLDL C) IDL D) LDL E) HDL Answer: A 6) The lipoprotein fraction that has the highest ratio of lipid to protein is: A) Chylomicrons.

B) VLDL. C) LDL. D) HDL. Answer: A

1 ..

7) Acyl-cholesterol acyltransferase: A) Esterifies free cholesterol from the outer layer of the lipoprotein followed by a shift of the esterified cholesterol to the core of the chylomicrons.

B) Hydrolyzes triglycerides on the surface of chylomicrons to glycerol and fatty acids.

C) Converts free cholesterol to esterified cholesterol for storage.

D) Converts cholesterol to esterified cholesterol.

Answer: C 8) Which of the following is FALSE concerning blood cholesterol concentrations?

A) Increased cholesterol is associated with diabetes mellitus.

B) Increased cholesterol is associated with hyperthyroidism.

C) Increased cholesterol is associated with nephrotic syndrome.

D) Cholesterol levels decrease following strenuous exercise.

E) Cholesterol levels are unchanged when comparing results from fasting and nonfasting blood.

Answer: B 9) Which of the following tests would be included in a routine lipid profile?

A) Cholesterol, LDL-cholesterol, HDL cholesterol B) Cholesterol, triglycerides, phospholipids C) Triglycerides, fatty acids, LDL-cholesterol D) Cholesterol, LDL-cholesterol, HDL cholesterol, triglycerides Answer: D 10) The first step in the enzymatic cholesterol reaction, which results in free cholesterol esterase, is: A) Oxidation of cholesterol.

B) Oxidation of cholesterol esters.

C) Hydrolysis of cholesterol esters.

D) Reduction of cholesterol.

E) Reduction of cholesterol esterases.

Answer: C 11) The enzymatic determination of glycerol in triglyceride analysis usually involves conversion of glycerol to: A) Oleic acid.

B) Phospholipid.

C) Formaldehyde.

D) CO2 and H2O. E) Glycerol phosphate.

Answer: E 12) The serum of a freshly drawn blood sample is slightly turbid. This is probably because: A) Triglycerides only are increased.

B) Cholesterol only is increased.

C) Both are increased.

Answer: A

2 ..

13) In uncontrolled diabetes mellitus, cholesterol and triglycerides are: A) Increased.

B) Decreased.

C) Not affected.

D) Neither is increased.

Answer: A 14) The BORDERLINE range for cholesterol levels as determined by NCEP is: A) Below 200 mg/dL. B) 200-240 mg/dL. C) Over 240 mg/dL. D) Over 300 mg/dL. Answer: B 15) Select the desirable cutoff for serum LDL cholesterol recommended by the National Cholesterol Education Program.

A) 80 mg/dL B) 100 mg/dL C) 150 mg/dL D) 200 mg/dL Answer: B 16) Which of the following test combinations indicates the HIGHEST risk for coronary heart disease?

A) Increased total cholesterol, increased HDL cholesterol B) Increased total cholesterol, decreased HDL cholesterol C) Decreased total cholesterol, decreased HDL cholesterol D) Decreased total cholesterol, increased HDL cholesterol Answer: B 17) A 52-year-old man went to his doctor for a physical examination. The patient was overweight and had missed his last two appointments because of business dealings. His blood pressure was elevated, his cholesterol was 250 mg/dL, and his triglyceride was 170 mg/dL. A high-density lipoprotein (HDL) cholesterol test was performed and the result was 30 mg/dL (2060 mg/dL). Which of the following would be this patient's calculated low-density lipoprotein (LDL) cholesterol value?

A) 157 mg/dL B) 186 mg/dL C) 200 mg/dL D) Cannot be determined from the information given Answer: B

3 ..

18) Which apolipoprotein has the ability to INCREASE the risk of coronary heart disease? A) Apo A1 B) Apo B100 C) Apo B48 D) Apo E11 Answer: B 19) The Friedwald formula for estimating LDL cholesterol should NOT be used when: A) HDL cholesterol is greater than 40 mg/dL. B) Triglyceride is greater than 400 mg/dL. C) Plasma shows no visible evidence of lipemia.

D) Total cholesterol is elevated based on the age and sex of the patient.

Answer: B 20) HDL cholesterol + LDL cholesterol + chylomicrons → HDL. Which is NOT used as a precipitating reagent for determining cholesterol?

A) Heparin-manganese chloride B) Dextran-sulfate-Mn (II) C) Phosphotungstate-Mn (II) D) Sulfosalicylic acid Answer: D 21) Which of the following is a group of interrelated metabolic risk factors that appear to directly promote the development of atherosclerotic cardiovascular disease?

A) Metabolic syndrome B) Hypercholesterolemia C) Syndrome B D) Familial hypercholesterolemia Answer: A 22) Risk factors for coronary heart disease include all of the following EXCEPT: A) Diabetes mellitus.

B) Other forms of atherosclerotic disease.

C) Hypertension.

D) High HDL cholesterol.

Answer: D 23) The National Cholesterol Education Program ATP III goal for desirable HDL cholesterol is: A) < 100 mg/dL. B) ≥ 60 mg/dL. C) < 200 mg/dL. D) > 40 mg/dL. Answer: B

4 ..

24) The following are criteria for Clinical Diagnosis of Metabolic Syndrome EXCEPT: A) Elevated waist circumference.

B) Elevated triglycerides.

C) Reduced HDL-C. D) Low fasting glucose.

Answer: D 25) Secondary causes of elevated LDL include all of the following EXCEPT: A) Hypothyroidism.

B) Chronic renal failure.

C) Obstructive liver disease.

D) Hyperthyroidism.

Answer: D

5 ..

Clinical Laboratory Chemistry, 2e(Sunheimer) Chapter 9 Proteins 1) The chemical bonds between amino acids in the primary structure of proteins are: A) Hydrogen bonds. B) Disulfide bonds. C) Peptide bonds. D) Hydrophilic bonds. Answer: C 2) Protein is approximately ________ nitrogen. A) 10% B) 12% C) 16% D) 20% E) 22% Answer: C 3) The structure of a protein that is determined by the sequence of amino acids in the polypeptide chain is the: A) Primary structure. B) Secondary structure. C) Tertiary structure. D) Quaternary structure. Answer: A 4) The common ingredients of all biuret reagents are: A) Sodium potassium tartrate, copper sulfate, and sodium hydroxide. B) Sodium tungstate and sulfuric acid. C) Copper sulfate and NaOH. D) Ammonium sulfate and sodium hydroxide. Answer: A 5) Hyperalbuminemia is caused by: A) Dehydration syndromes. B) Liver disease. C) Burns. D) Gastroenteropathy. Answer: A 6) Bromcresol Green (BCG) may be used in the dye-binding assay of: A) Lipoprotein. B) Cholesterol. C) Albumin. D) 17-ketosteroids. E) Estrogen. Answer: C

1 ..

7) In agarose gel electrophoresis of human serum at pH 8.6, the slowest moving fraction is: A) α-1 globulin.

B) β-globulin.

C) α-2 globulin.

D) Albumin.

E) γ-globulin.

Answer: E 8) High serum total protein but low albumin is usually seen in: A) Multiple myeloma.

B) Hepatic cirrhosis.

C) Glomerulonephritis.

D) Nephrotic syndrome.

Answer: A 9) Which of the following serum proteins migrates with the beta globulins on cellulose acetate at pH 8.6?

A) Ceruloplasmin B) Hemopexin C) Haptoglobin D) Transthyretin Answer: B 10) Absence of a large decrease in the α-1 globulin peak in a serum electrophoresis pattern suggests: A) Transferrin deficiency.

B) α1- antitrypsin deficiency.

C) Nephrotic syndrome.

D) Chronic inflammation.

Answer: B 11) A protein that is increased or normal in nephrotic syndrome is: A) α1-antitrypsin.

B) α2-macroglobulin.

C) Albumin.

D) Hemopexin.

Answer: B 12) The principal protein for transport of iron from the intestine to the liver, bone marrow, or spleen for storage is: A) Haptoglobin.

B) Transferrin.

C) Ceruloplasmin.

D) Alpha-fetoprotein.

Answer: B

2 ..

13) Ceruloplasmin is an α2-globulin that contains: A) Copper.

B) Manganese.

C) Iron.

D) Zinc.

Answer: A 14) Myeloma (Bence Jones) protein is MOST often found electrophoretically in the area of: A) Albumin or α1-globulins.

B) α2-globulins.

C) β or γ globulins.

D) α1- or α2-globulins.

E) γ-globulins.

Answer: E 15) A decrease in this protein will result in an emphysema-like condition.

A) α1-antitrypsin B) α2-macroglobulin C) β-lipoprotein D) Hemopexin Answer: A 16) In an Acute Phase Reaction (M.I., etc.), there is a(n): A) Decrease in albumin, increase in α1-globulin, α2-globulin, and α3-globulin.

B) Intense band in α1-globulin, increase in albumin.

C) Marked decrease in γ-globulin.

D) Marked increase in immunoglobulin A. E) Increase in α2-globulin.

Answer: A 17) Which of the following conditions is usually associated with an acute inflammatory pattern?

A) Myocardial infarction B) Rheumatoid arthritis C) Hepatitis D) Surgery Answer: A 18) Mary's total protein is 7.5 g/dL and her albumin is 4.2 g/dL. What is her A/G ratio?

A) 1.1 B) 1.3 C) 1.5 D) 1.8 Answer: B

3 ..

19) Which protein band comprises 2-5% of the relative protein?

A) Albumin B) α1-globulin C) α2-globulin D) β-globulin Answer: B 20) What is the clinical significance of testing for Transthyretin?

A) High levels are associated with an acute phase reaction.

B) Levels are associated with glomerular injury in diabetic nephropathy.

C) Low levels indicate compromised nutritional status.

D) Low levels are associated with increased free cortisol.

Answer: C 21) Which is the most abundant γ-globulin?

A) IgG B) IgM C) IgA D) IgE Answer: A 22) Bill has a total protein of 7.5 g/dL and his protein electrophoresis reports a 12% β-globulin.

What is his β-globulin level in g/dL? A) 0.6 g/L B) 0.9 g/L C) 1.2 g/L D) 1.5 g/L Answer: B 23) Which condition is associated with fusion of the β-γ bridging?

A) Cirrhosis B) Acute pancreatitis C) Myocardial infarction D) Nephrotic syndrome Answer: A 24) Which of the following conditions is associated with an elevated total protein?

A) Cirrhosis B) Glomerular disease C) Starvation D) Malignancy Answer: D

4 ..

25) Which of the following proteins is part of the coagulation cascade?

A) Complement B) Fibrinogen C) Transferrin D) Β-microglobulin Answer: B

5 ..

Clinical Laboratory Chemistry, 2e(Sunheimer) Chapter 10 Enzymes 1) Zero order kinetics results: A) When there are equal amounts of enzyme and substrate present. B) When there is more enzyme than substrate present. C) When all of the available sites on the enzyme are saturated with substrate. D) When none of the available sites are saturated with substrate. Answer: C 2) The protein part of the enzyme molecule WITH the cofactor is called a(n): A) Apoenzyme. B) Zymogen. C) Holoenzyme. D) Coenzyme. Answer: C 3) Ligases are a class of enzymes that catalyze: A) Oxidation-reduction reactions. B) The transfer of groups. C) The removal of groups without the addition of water. D) The coupling of two molecules with the use of ATP. Answer: D 4) Enzymes that catalyze the transfer of groups other than hydrogen between compounds are classified as belonging to which enzyme class? A) Hydrolases B) Lyases C) Oxidoreductases D) Transferases Answer: D 5) Many enzymes in the blood plasma show maximum activity in which of the following pH ranges? A) 4 to 5 B) 6 to 7 C) 7 to 8 D) 8 to 9 Answer: C 6) In competitive inhibition of an enzyme reaction: A) The inhibitor binds to the enzyme at the same site as does the substrate. B) The inhibitor often has a chemical structure different than the substrate. C) Activity of the reaction can be decreased by increasing the concentration of the substrate.

D) Activity of the reaction can be increased by decreasing the temperature. Answer: A

1 ..

7) The indicator reaction (what is actually measured) in Oliver-Rosalki is: A) Adenylate kinase.

B) Pyruvate kinase.

C) Lactate dehydrogenase.

D) The reduction of NADP+.

Answer: D 8) Although a total lactate dehydrogenase (LD) determination performed alone yields little information as to the area of tissue destruction, an electrophoretic separation of LD isoenzyme may be useful. With what disorder is an increase in LD-5 and LD-4 associated?

A) Acute hepatic disease B) Acute myocardial infarction C) Pulmonary infarction D) Pancreatitis Answer: A 9) Aspartate aminotransferase is elevated in diseases involving the: A) Renal cortex.

B) Heart muscle.

C) Intestinal epithelium.

D) Acinar cells of the pancreas.

Answer: B 10) Malate dehydrogenase (MD) is used in the aspartate transferase reaction mixture to convert: A) L-glutamate to alpha oxoglutarate.

B) L-glutamate to L-aspartate.

C) L-malate to L-glutamate.

D) Oxaloacetate to L-malate.

Answer: D 11) In which liver disease is the DeRitis ratio (AST: ALT) usually less than or equal to 1?

A) Acute viral hepatitis B) Cirrhosis C) Alcoholic hepatitis D) All of the above Answer: A 12) The highest levels of alkaline phosphatase are seen in: A) Obstructive liver disease.

B) Hepatitis.

C) Renal failure.

D) Myocardial infarction.

E) Pancreatitis.

Answer: A

2 ..

13) Which of the following would NOT show an increase in alkaline phosphatase?

A) Obstructive liver disease (hepatobiliary) rickets B) Rickets C) Hemolytic anemia D) Osteoporosis Answer: D 14) The most sensitive indicator of alcoholic liver disease is: A) AST. B) ALT. C) γGT. D) ALP. Answer: C 15) Which of the following are the most common cause(s) of acute pancreatitis?

A) Gallstones or obstructing tumor B) Abdominal trauma C) Acute alcohol ingestion or drug use D) Chronic alcohol use E) both A and C above Answer: E 16) Serum lipase catalyzes: A) Hydrolysis of triglyceride to fatty acids and glycerol.

B) Hydrolysis of triglyceride to fatty acids and water.

C) Synthesis of triglyceride from fatty acids and water.

D) Synthesis of triglyceride from fatty acids and glycerol.

Answer: A 17) A substrate used in lipase reactions is: A) Starch.

B) ρ-nitrophenyl phosphate.

C) Olive oil emulsion.

D) Creatine phosphate.

Answer: C 18) The best test for pancreatitis in the presence of mumps is: A) Virus isolation.

B) A serologic test for mumps.

C) A urine amylase test.

D) A serum lipase test.

Answer: D

3 ..

19) Serum chemistry results on a 53-year-old female are AST: 120 U/L ALT: 185 U/L ALP: 785 U/L γGT: 225 U/L Total Bilirubin: Direct Bilirubin: urine bilirubin: urine urobilinogen: fecal urobilinogen:

(4-34U/L) (5-40 U/L) (<165 U/L) (5-24 U/L) 10.8 mg/dL 8.6 mg/dL positive Normal decreased

These results are consistent with a diagnosis of: A) Hemolytic anemia.

B) Hepatitis.

C) Dubin-Johnson.

D) Biliary obstruction.

Answer: D 20) Mrs. Smith has the following chemistry results: CK: moderately increased LD: moderately increased LD-1 : increased The probable diagnosis is: A) Myocardial infarction.

B) Acute pancreatitis.

C) Acute hepatitis.

D) Cholecystitis.

Answer: A 21) A patient's CK-MB is reported as 18 μg/L and the total CK is 560 IU/L. What is the CK relative index (CKI)?

A) 0.10% B) 3.2% C) 10.0% D) 30.0% Answer: B 22) The prostatic fraction of acid phosphatase is inhibited by: A) Acetic acid.

B) Citric acid.

C) Sodium nitrite.

D) Tartrate.

Answer: D

4 ..

23) Which of the following sets of results would be consistent with macroamylosemia?

A) Normal serum amylase and elevated urine amylase values B) Increased serum amylase and normal urine amylase values C) Increased serum and urine amylase D) Normal serum and urine amylase values Answer: B 24) Cholinesterase catalyzes the conversion of: A) Choline to lecithin.

B) Acetylcholine to choline and acetic acid.

C) Choline to NH4+ and PO4-3.

D) β-glycerophosphate to glycerol and PO4-3.

E) α-glycerophosphate to choline phosphate.

Answer: B 25) Levels of this enzyme are useful in the diagnosis of a genetic defect, which leads to increased apnea (difficulty breathing) after surgery using succinyl choline.

A) Cholinesterase B) Aldolase C) Leucine aminopeptidase D) 5' nucleotidase E) Acid phosphatase Answer: A

5 ..

Clinical Laboratory Chemistry, 2e (Sunheimer) Chapter 11 Nonprotein Nitrogen Questions 1) Which of the following is NOT an NPN substance?

A) Urea B) Ammonia C) Creatinine D) Troponin T Answer: D 2) Urea/BUN is produced from: A) The catabolism of proteins and amino acids.

B) Oxidation of purines.

C) Oxidation of pyrimidines.

D) The breakdown of complex carbohydrates.

Answer: A 3) An elevated BUN usually indicates: A) Liver disease.

B) Kidney disease.

C) Pancreatic disease.

D) Myocardial infarction.

Answer: B 4) BUN is increased with: A) A high protein diet.

B) A low protein diet.

C) A high carbohydrate diet.

D) It is not affected by diet.

Answer: A 5) In the Berthelot method, BUN is measured by reaction with: A) Sodium hydroxide and arsenomolybdate.

B) Dinitrophenylhydrazine.

C) Phenol and sodium hypochlorite.

D) Dinitrocarbazone.

Answer: C 6) Urea can be measured by incubation with urease followed by all of the following EXCEPT: A) Formation of a colored product by reaction with diacetyl.

B) Measurement of increased conductivity.

C) Ion-selective electrode measurement of the ammonia produced.

D) NADH consumption in a reaction catalyzed by glutamate dehydrogenase.

Answer: A

1 ..

7) Normal values for urea are generally expressed as urea nitrogen. If it is necessary to convert urea nitrogen values to urea, the concentration may be calculated easily by multiplying the urea nitrogen value by: A) 0.47.

B) 1.47.

C) 2.14.

D) 28.

E) 60.

Answer: C 8) A BUN of 10 mg/dL is obtained by a technologist. What is the urea concentration?

A) 25.0 mg/dL B) 21.4 mg/dL C) 18.4 mg/dL D) 9.3 mg/dL Answer: B 9) Renal azotemia is found in: A) Advanced cirrhosis.

B) High protein diets.

C) Nephrotic syndrome.

D) Dehydration.

Answer: C 10) Prerenal hyperuricemia is caused by: A) Dehydration.

B) Uremia.

C) Bladder tumors.

D) Prostatic hypertrophy.

Answer: A 11) Creatinine is formed from the: A) Oxidation of creatine.

B) Oxidation of protein.

C) Deamination of dibasic amino acids.

D) Metabolism of purines.

Answer: A 12) Creatinine reacts with strong alkaline picrate to form a yellow-red compound. This reaction is: A) Nessler's reaction.

B) Ehrlich's diazo reaction.

C) Jaffe reaction.

D) Lieberman-Burchard reaction.

Answer: C

2 ..

13) Creatinine levels are usually: A) 0.1-0.6 mg/dL. B) 0.8-1.2 mg/dL. C) 1.5-2.5 mg/dL. D) 3.0-5.0 mg/dL. Answer: B 14) Creatinine would be increased in which of the following?

A) Reye's syndrome B) Myocardial infarction C) Muscular dystrophy D) Hepatitis Answer: C 15) Serum urea nitrogen and serum creatinine determinations are frequently requested together so that their ratio may be evaluated. What is the range of the normal ratio of urea nitrogen to creatinine?

A) 1/1 and 10/1 B) 12/1 and 20/1 C) 15/1 and 20/1 D) 20/1 and 30/1 E) 25/1 and 30/1 Answer: B 16) A high BUN/creatinine ratio with an elevated creatinine is usually seen in: A) Liver disease.

B) Low protein intake.

C) Tubular necrosis.

D) Postrenal azotemia.

Answer: D 17) A technologist obtains a BUN value of 61 mg/dL and serum creatinine value of 3.5 mg/dL on a patient. The BUN/Creatinine ratio indicates: A) Renal failure.

B) Liver failure.

C) Gout.

D) Prerenal failure.

Answer: A 18) Increased uric acid is found in each of the following conditions EXCEPT: A) Gout.

B) Hypothyroidism.

C) Lesch-Nyhan syndrome.

D) Renal failure.

Answer: B

3 ..

19) All of the following conditions are associated with hyperuricemia EXCEPT: A) Liver failure.

B) Malignancy.

C) Renal failure.

D) Primary "essential" overproduction of uric acid.

Answer: A 20) Uric acid values are usually elevated in patients with leukemia because of the breakdown of: A) Proteins.

B) Nucleic acids (adenine and guanine).

C) Amino acids.

D) Epinephrine.

Answer: B 21) Uric acid may be determined with: A) The enzyme urease.

B) The enzyme uricase.

C) Formation of a blue color with phosphotungstic acid.

D) Formation of a red color with diazotized sulfanilic acid.

E) both B and C above Answer: E 22) The creatinine clearance test is routinely used to assess the glomerular filtration rate. Given the following information for an average size adult, calculate a creatinine clearance.

Urine creatinine: 120 mg/dL Plasma creatinine: 1.2 mg/dL 24h urine volume: 1520 ml A) 10.6 mL/min B) 15.2 mL/min C) 63.3 mL/min D) 94.7 mL/min E) 105.6 mL/min Answer: E 23) The chief source of error in kidney evaluation using the excretion rate of substance is: A) The chemical method of analysis.

B) The timing and completeness of collection.

C) The test chosen for the evaluation.

D) The day-to-day variation of renal function.

Answer: B

4 ..

24) An exogenous substance used to assess the glomerular filtration rate that affords the most accurate measure of renal clearance is: A) Urea.

B) Inulin.

C) Glucose.

D) Creatinine.

E) Para aminohippurate.

Answer: B 25) Which condition is associated with massive proteinuria?

A) Acute glomerulonephritis B) Chronic glomerulonephritis C) Nephrotic syndrome D) Acute pyelonephritis Answer: C 26) The protein section of the reagent strip is MOST sensitive to: A) Albumin.

B) Mucoprotein.

C) Bence Jones protein.

D) Globulin.

Answer: A 27) Dipstick reactions for blood are based on: A) The peroxidase activity of hemoglobin.

B) Oxidation of hemoglobin peroxidase.

C) The reaction of hemoglobin with bromthymol blue.

D) The reduction of a chromogen by hemoglobin.

Answer: A 28) Leukocyte reagent strips are used to detect leukocyte: A) Peroxidase.

B) Esterases.

C) Hydroxylase.

D) Phosphatase.

Answer: B

5 ..

Clinical Laboratory Chemistry, 2e (Sunheimer) Chapter 12 Body Water and Electrolyte Homeostasis 1) Which of the following conditions will cause an increase anion gap?

A) Pulmonary fibrosis B) Hypoaldosteronism C) Renal failure D) Hyperkalemia Answer: C 2) The anion gap is determined from which of the following groups of electrolytes?

A) Sodium, chloride, potassium, and calcium B) Sodium, chloride, potassium, and HCO3C) Sodium, chloride, potassium, and phosphorus D) TCO2, chloride, potassium, and magnesium Answer: B 3) Which of the following conditions may be characterized by an increased anion gap?

A) Salicylate intoxication B) Diabetes mellitus C) Lactate acidosis D) All of the above Answer: D 4) A sweat chloride greater than 60 mEq/L is consistent with which of the following disorder?

A) Multiple sclerosis B) Cystic fibrosis C) Muscular dystrophy D) Pulmonary fibrosis Answer: B 5) Which of the following enzyme is used in several methods to measure serum total carbon dioxide?

A) Phosphoenolpyruvate carboxylase B) Phosphoenolcarboxylase C) Glucose oxidase D) Mercuric thiocyanate Answer: A 6) Patients with hyponatremia may show signs of hypovolemia which is defined as: A) Low blood protein levels.

B) High blood potassium levels.

C) Low blood volume.

D) Low blood pressure.

Answer: C

1 ..

7) Which of the following disorders may develop due to increased secretion of antidiuretic hormone (ADH) by the hypothalamus in the absence of appropriate osmolar or volume stimuli?

A) Diabetic ketoacidosis B) Hypocorticolism C) Hyperaldosteronism D) Syndrome of inappropriate antidiuretic hormone (SIADH) Answer: D 8) Chloride in sweat can be measured by which of the following techniques?

A) pH electrodes B) Coulometry and amperometry C) Photometry D) Gas sensing electrodes Answer: B 9) In the blood, bicarbonate leaves the red blood cell and enters the plasma through an exchange mechanism with which of the following ions?

A) Sodium B) Potassium C) Chloride D) Phosphate Answer: C 10) Which of the following mechanisms aid in the transport of K+ into the cell against a concentration gradient?

A) Na+ ·/Cl- pump B) Na+/K+- ATP pump C) Isohydric shift D) K+- HCO3- - ATP pump Answer: B 11) Symptoms including metal confusion, weakness, tingling sensations, respiratory muscle weakness are all associated with which of the following disorders?

A) Hyperkalemia B) Hypokalemia C) Hyperphosphatemia D) Hypochloremia Answer: A

2 ..

12) Which of the following compounds function to reduce the venous pressure that occurs with a given increase in blood volume, increasing vascular permeability and promoting natriuretic and diuresis?

A) C-type natriuretic peptide B) Renin C) Atrial natriuretic peptide D) Angiotensin II Answer: C 13) Measurement of sodium, potassium, and chloride are commonly performed in laboratories using which of the following?

A) Ion selective electrodes B) Colorimetry C) Photometry D) Gas chromatography Answer: A 14) Calculate the anion gap given the following data: Sodium = 145 mEq/L; Chloride = 102 mEq/L; and HCO3- = 20 mEq/L. A) 23 mEq/L B) -23 mEq/L C) 63 mEq/L D) 120 mEq/L Answer: A 15) Which of the following conditions is associated with hypernatremia?

A) Hypoaldosteronism B) Burns C) Diabetes insipidus D) Diarrhea Answer: C 16) Which of the following electrolyte levels best correlate with plasma osmolality?

A) Chloride B) Sodium C) Calcium D) Bicarbonate Answer: B 17) Plasma osmolality can be calculated using which of the following?

A) Na + Cl + K + HCO3 B) Na + 2(HCO3) + Urea nitrogen - glucose C) 2(Na) + (glucose/18) + (BUN/2.8) D) Glucose + 2(Na) - 2 (BUN) Answer: C

3 ..

18) A patient with a toxic level of blood alcohol would cause which of the following?

A) A decreased osmol gap B) An increased osmol gap C) An osmol gap of zero D) No change in the osmol gap Answer: B 19) Serum lacks which of the following constituents?

A) Electrolytes B) Glucose C) Fibrinogen D) Enzymes Answer: C 20) Freezing point depression is one of the: A) Colligative properties of a solution.

B) Isoelectric point of a solution.

C) Physical properties of an ice cube.

D) Principle temperatures on the Kelvin scale.

Answer: A 21) A patient with syndrome of inappropriate secretion of antidiuretic hormone (SIADH) would present with which of the following laboratory results?

A) Increased serum sodium, osmolality, chloride, and increased urine sodium B) Decreased serum sodium, osmolality, chloride, and increased urine sodium C) Decreased serum sodium, increased osmolality, chloride, and increased urine sodium D) Increased serum sodium, osmolality, decreased chloride, and increased urine sodium Answer: B 22) Which of the following sequences accurately reflects the renin-angiotensin-aldosterone system in response to hyponatremia?

A) Renin is released from the kidney; renin converts angiotensinogen to angiotensin I; angiotensin I is converted to angiotensin II. B) Angiotensinogen is released from the kidney; angiotensinogen converts to angiotensin I; angiotensin I is converted to renin.

C) Angiotensin I is released from the kidney; angiotensin I converts angiotensinogen to angiotensin II; angiotensin II is converted to renin.

D) Renin is released from the kidney; renin converts angiotensinogen to angiotensin II; angiotensin II is converted to angiotensin I. Answer: A 23) Electrolyte exclusion effect is characterized as which of the following?

A) A falsely low serum chloride in a grossly lipemic specimen B) A falsely low serum sodium result in an icteric specimen C) A falsely low serum sodium result in a hemolyzed specimen D) A falsely low serum sodium result in a grossly lipemic specimen Answer: D 4 ..

24) A family of peptides called natriuretic peptides serves to regulate: A) Potassium levels.

B) Sodium and water metabolism.

C) Glucose metabolism.

D) Chloride excretion.

Answer: B 25) Angiotensin II is a potent vasoconstrictor that: A) Suppresses ADH secretion.

B) Stimulates ADH secretion and thirst.

C) Suppresses aldosterone secretion by the adrenal cortex.

D) Reduces NaCl reabsorption by the proximal tubule.

Answer: B

5 ..

Clinical Laboratory Chemistry, 2e (Sunheimer) Chapter 13 Blood Gases, pH, and Acid-base Balance 1) What is the most probable acid/base imbalance in the patient described below?

26-year-old male presents with the following signs and symptoms: Extreme hysteria Hyperventilating Pulse 110 BPM Lab data for ABGs: pH = 7.550 pCO2 = 27 mmHg HCO3- =27 mEq/L pO2 = 98 mmHg A) Respiratory alkalosis B) Respiratory acidosis C) Metabolic alkalosis D) Metabolic acidosis Answer: A 2) Which of the following compensatory mechanisms is correct for a patient in respiratory acidosis?

A) Decrease respiration rate B) Increase the movement of electrolytes such as Na+ and H+ out of the cells and into the blood while increasing K+ from blood into cells.

C) Decrease whole blood pCO2 D) Decrease plasma bicarbonate concentration Answer: C 3) A 43-year-old female arrived at the emergency department with altered level of consciousness. She complained of chronic but moderate severity acid indigestion. This was partially relieved by taking antacids. Her blood gases results are as follows: RESULTS: pH 7.60 pCO2 38 mm Hg HCO3- 40 mEq/L This patient demonstrates: A) Respiratory acidosis.

B) Metabolic alkalosis.

C) Respiratory alkalosis.

D) Metabolic acidosis.

Answer: B

1 ..

4) Which of the following represents the compensatory response of the kidney and lungs to a patient who is in metabolic acidosis?

A) The kidneys will increase bicarbonate reabsorption and the patient will begin to breathe very deeply and often gasp for air.

B) The kidneys will decrease bicarbonate reabsorption and the patient will begin to hyperventilate.

C) The kidneys will increase retention of hydrogen ions and the patient will begin to hold their breath for as long as possible.

D) The kidneys will "shut down" in an attempt to retain all electrolytes and the patient will place a bag over their face to conserve oxygen and carbon dioxide.

Answer: A 5) Respiratory alkalosis can be seen in patients with: A) Severe diarrhea.

B) Chronic obstructive pulmonary disease (COPD).

C) Mechanical hypoventilation.

D) Hysterical hyperventilation.

Answer: D 6) A patient's blood gas results are shown below: pH 7.32; pCO2 = 58 mm Hg; HCO3- = 28 mEq/L. These results indicate: A) Respiratory acidosis.

B) Metabolic alkalosis.

C) Respiratory alkalosis.

D) Metabolic acidosis.

Answer: A 7) Which of the following mechanisms is responsible for metabolic acidosis?

A) Bicarbonate deficiency B) Diminished production of fixed acids C) Rapid and efficient elimination of organic acids D) Increased retention of HCO3Answer: A 8) What is the calculated pH for a patient sample if the measured bicarbonate concentration is 22 mEq/L and the pCO2 is 57 mmHg? A) 6.8 B) 7.0 C) 7.2 D) 7.4 Answer: C

2 ..

9) Which of the following buffers has the greatest percentage buffering capacity? A) Hemoglobin B) Bicarbonate C) Phosphate D) Protein Answer: A 10) Hypercapnia is defined as: A) A decreased blood level of carbonic acid.

B) A decreased blood level of oxygen.

C) An elevated blood level of carbon monoxide.

D) An elevated blood level of carbon dioxide.

Answer: D 11) The specimen of choice for measuring blood pH, pO2, and pCO2 is: A) Heparinized capillary blood.

B) Heparinized arterial blood.

C) Heparinized venous blood.

D) Serum.

Answer: B 12) Name the equation shown below. pH = pK' + log A) Anion gap transformation B) Henderson-Hasselbalch equation C) Isohydric shift algorithm D) Negative log of the hydrogen ion concentration formulation Answer: B 13) Convert pCO2 of 40 mmHg to the SI equivalent in kilopascals (kPa).

A) 4.33 B) 5.00 C) 5.33 D) 5333 Answer: C 14) The reaction that allows CO2 to move from peripheral tissue cells to plasma, then to erythrocytes and O2 from erythrocytes to plasma, and then into peripheral tissue cells is termed: A) Chloride momentum.

B) Isothionate shift.

C) Cytochrome P450 shift.

D) Isohydric shift.

Answer: D

3 ..

15) Which of the following is a derived blood gas parameter? A) Actual base excess B) pCO2 C) pO2 D) pH Answer: A 16) Which of the following materials represents the appropriate calibrator used to calibrate the pCO2 electrode?

A) A gas cylinder containing impure carbon dioxide B) A gas cylinder containing a known amount of carbon dioxide C) A buffer solution containing a known amount of carbon dioxide and hydrogen ions D) A gas cylinder containing an estimated amount of carbon dioxide and oxygen Answer: B 17) Which of the following statements reflects the appropriate action to take after receiving an arterial blood gas specimen for analysis?

A) Dispense an aliquot of the sample into a test tube and transfer it into the blood gas analyzer.

B) Do not gently push out any bubbles or clots that may collect at the end of the syringe.

C) Gently push out any bubbles or clots that may collect at the end of the syringe.

D) Remove any cap that may be at the end of the syringe and mix sample while exposing it to air.

Answer: C 18) Which of the following contributes the most to the serum total CO2?

A) Carbonium ion B) HCO3C) Dissolved carbon dioxide D) PCO2 Answer: B 19) Which of the following effects result from exposure of a normal arterial blood sample to room air?

A) PO2 decreased, PCO2 decreased, pH decreased B) PO2 increased, PCO2 decreased, pH increased C) PO2 decreased, PCO2 increased, pH decreased D) PO2 decreased, PCO2 decreased, pH increased Answer: B

4 ..

20) A patient's blood gas results are as follows: pH = 7.25; dissolved CO2 = 1.8 mEq/L; HCO3= 27 mEq/L. These results would be classified as: A) Metabolic acidosis.

B) Metabolic alkalosis.

C) Respiratory acidosis.

D) Respiratory alkalosis.

Answer: C 21) A patient's blood gas results are: pH= 7.48; PCO2 = 52 mmHg; HCO3- = 40 mEq/L; pO2 = 98 mmHg. These results are consistent with which of the following?

A) Respiratory alkalosis B) Respiratory acidosis C) Partially compensated metabolic alkalosis D) Metabolic acidosis Answer: C 22) Which of the following will shift the oxygen dissociation curve to the left?

A) Alkalosis B) Increase levels of 2,3-DPG C) Hypercapnia D) Increase in temperature Answer: A 23) Which condition results in metabolic acidosis with severe hypokalemia and chronic alkaline urine?

A) Drug-induced acidosis B) Renal tubular acidosis C) Diabetic ketoacidosis D) Acidosis caused by starvation Answer: B 24) Which of the following mechanisms can cause metabolic acidosis?

A) Hyperventilation B) Accumulation of volatile acids C) Excessive retention of dissolved CO2 D) Bicarbonate deficiency Answer: D 25) Which of the following is the primary compensatory mechanism for metabolic acidosis?

A) Hypoventilation B) Hyperventilation C) Bicarbonate excretion D) Retention of hydrogen ions Answer: B

5 ..

26) A patient has the following arterial blood gas results: pH = 6.55; pCO2 = 26 mmHg; pO2 = 99 mmHg; HCO3- = 22 mEq/L. Which of the following is most likely to account for these results?

A) Hypokalemia B) Hyperventilation C) Hypoventilation D) Improper specimen collection Answer: B 27) What is the blood pH when the PCO2 is 60 mmHg and HCO3- is 18 mEq/L? A) 6.99 B) 7.10 C) 7.30 D) 7.40 Answer: B 28) What is the normal ratio of bicarbonate to dissolved CO2 in arterial blood?

A) 1:5 B) 1:10 C) 20:1 D) 40:1 Answer: C 29) Diffusion of gases in the body is defined as: A) The movement of charged protein carriers through the alveoli.

B) The movement of charged, hydrophilic ions through a nonpolar lipid layer.

C) The movement of an uncharged, hydrophobic solute through a lipid bilayer.

D) The passive movement of bound ions through cell membranes that results in the active transport of gases.

Answer: B 30) An increase in temperature will result in a change to hemoglobin-oxygen dissociation curve.

This change reflects which of the following?

A) A shift in the curve to the left B) A shift in the curve to the right C) A downward shift in the curve D) An upward shift in the curve Answer: B

6 ..

Clinical Laboratory Chemistry, 2e (Sunheimer) Chapter 14 Mineral and Bone Metabolism 1) Which of the following electrolyte measurements would be of clinical usefulness to the clinician treating patients for pregnancy-induced hypertension? A) Ionized calcium B) Potassium C) Magnesium D) Phosphorus Answer: C 2) Which of the following statements best reflects the clinical usefulness for measuring Ionized or free calcium in blood?

A) It is the best indication of phosphate status because it is biologically active and tightly regulated by PTH and Vitamin D. B) It is the best indication of calcium status because it is biologically active and tightly regulated

by PTH and Vitamin D. C) It is the best indication of calcium status because it is biologically inactive and tightly regulated by PTH and Vitamin D. D) It is the best indication of calcium status because it is biologically active and tightly regulated by thyroid hormones.

Answer: B 3) Which of the following blood drawing tubes is most appropriate for measuring magnesium?

A) Royal blue tube with K2-EDTA B) Lavender top tube with K2-EDTA C) Plain red top with no additives D) Gray top tube with sodium fluoride/potassium oxalate Answer: C 4) Which of the following reagents is used to determine the concentration of serum magnesium?

A) Biuret B) Bathophenanthroline C) Methylthymol blue D) Phosphomolybdate Answer: C 5) Monitoring intraoperative PTH is useful for: A) Surgical management of primary hyperparathyroidism.

B) Surgical management of thyroid disease.

C) Surgical management of prostate cancer.

D) Surgical management of coronary heart disease.

Answer: A

1 ..

6) Blood levels of ionized calcium are sensitive to which of the following? A) Barometric pressure B) Partial pressure of carbon dioxide C) Magnesium concentration D) pH and temperature Answer: D 7) Which of the following additives is preferred when drawing blood samples to measure parathyroid hormone (PTH)?

A) Acid citrate dextrose because PTH is least stable using this additive B) Potassium (3)-EDTA (K3-EDTA) because PTH is most stable using this additive C) Sodium citrate because PTH is most stable using this additive D) Sodium fluoride/potassium oxalate because PTH will complex with oxalate to increase its stability Answer: B 8) Which of the following statements best illustrates the diagnostic criteria for primary hyperparathyroidism?

A) No serum PTH detected and no serum calcium detected B) Detectable amounts of serum PTH concomitant with elevated total serum calcium C) Elevated total serum calcium only D) A normal level of serum PTH and serum calcium Answer: B 9) Which of the following feedback mechanisms regulate the production of 1, 25(OH) 2D3?

A) Negative feedback mechanism associated with circulating levels of calcium and inorganic phosphorus B) Negative feedback mechanism associated with circulating levels of calcitonin C) Negative feedback mechanism associated with circulating levels of magnesium D) Positive feedback mechanism associated with circulating levels of calcium and inorganic phosphorus Answer: A 10) Which of the following is an effect of increased parathyroid secretion?

A) Decreased intestinal absorption of calcium B) Increased intestinal absorption of calcium C) Decreased blood calcium levels D) Decreased bone resorption Answer: B

2 ..

11) Which of the following laboratory results reflects a patient diagnosed with rickets as a result of a dietary deficiency of vitamin D? A) Increased serum total calcium, decreased serum total alkaline phosphatase, and increased serum inorganic phosphorus B) Decreased serum PINP, decreased serum TRAP, and decreased serum DPD C) Normal serum PINP, normal serum TRAP, and normal serum DPD D) Increased serum PINP, increased serum TRAP, and increased serum DPD Answer: D 12) Which of the following do calcium, phosphorus, and magnesium have in common?

A) They all exist in circulation as only free or ionized forms.

B) They all exist as free or ionized forms, bound to proteins and complexes to radicals, e.g., sulfates to form salts.

C) Calcium exists as bound and free only, phosphorus exists only as bound and complexes to radical to form salts and magnesium exists as free or ionized forms, bound to proteins and complexes to radicals to form salts.

D) Calcium blood levels are regulated by parathyroid hormones, phosphorus is regulated by testosterone, and magnesium is regulated by insulin.

Answer: B 13) A blood specimen is received in the laboratory from a maternity patient in the obstetric unit with blood magnesium ordered by the attending physician. The serum magnesium level is 5.0 mg/dL (RI = 1.6 — 2.6 mg/dL). Which of the following explains the elevated serum magnesium?

A) The patient has primary hyperparathyroidism.

B) The patient has had a massive heart attack.

C) The patient is on magnesium sulfate intravenous infusion because she is experiencing preeclampsia.

D) The patient has Paget's disease.

Answer: C 14) Which of the following is considered a significant problem with using biomarkers of bone turnover in the management of patients with osteoporosis in a clinical setting?

A) They can be repeated over short time intervals thus providing quick results.

B) They are noninvasive.

C) They require no special patient preparation.

D) The measurements are affected by several preanalytical variables both controllable and uncontrollable.

Answer: D 15) Which laboratory test listed would be clinically useful to the clinician to assess patients with osteoporosis?

A) Urinary magnesium B) Total serum calcium C) Serum NTX-I D) Serum PTH Answer: C

3 ..

16) Which of the following laboratory results best represents a patient with Paget's disease?

A) Decreased urinary hydroxyproline and increased serum alkaline phosphatase B) Increased urinary hydroxyproline and decreased serum alkaline phosphatase C) Normal urinary hydroxyproline and normal serum alkaline phosphatase D) Decreased urinary hydroxyproline and decreased serum alkaline phosphatase Answer: A 17) "A progressive systemic skeletal disease characterized by low bone mass and micro architectural deterioration of bone tissue, with a consequent increase in bone fragility and susceptible to fracture" describes which of the following disorders?

A) Osteosarcoma B) Osteoporosis C) Renal osteodystrophy D) Paget's disease Answer: B 18) Which of the following reagents is used in the colorimetric method to determine the concentration of calcium in serum?

A) Ehrlich's reagent B) Cresolphthalein complexone C) P-nitrophenylphosphate D) Alkaline picrate Answer: B 19) Which of the following is an example of a controllable preanalytical variable associated with specimen collection for bone biomarker testing?

A) Diet B) Age C) Gender D) Fractures Answer: A 20) Pyridinoline, carboxy, amino-terminal cross-linked telopeptide of type I collagen, and tartrate-resistant acid phosphatase are all examples of which of the following?

A) Biomarkers of osteoblast conversion to osteoclast B) Biomarkers of formation C) Biomarkers of resorption D) Cancer antigens associated with bone tumors Answer: C 21) Which of the following compounds promote osteoclast formation?

A) Bisphosphonate B) 1, 25-dihydroxy Vitamin D3 C) Calcitonin D) Osteoprotegerin {OPG} Answer: B 4 ..

22) Heat inactivation and chemical inhibition are two methods used to measure which of the following analytes?

A) Acid phosphatase isoenzymes B) Alkaline phosphatase isoenzymes C) Creatine kinase isoenzymes D) Osteocalcin Answer: B 23) Measuring RANK and/or RANKL may be clinically useful for assessing which of the following conditions?

A) Dwarfism B) Bone fractures C) Bone cancer D) Shin splints Answer: B 24) Which of the following instruments can measure calcium, magnesium, and phosphorus in blood samples?

A) Fluorimeter B) Osmometer C) Atomic absorption spectrometer D) Refractometer Answer: C 25) Biomarkers of bone formation include which of the following?

A) Hydroxproline B) Carboxyl-terminal cross-linked telopeptide of type I collagen C) Bone sialoprotein D) Osteocalcin Answer: D

5 ..

Clinical Laboratory Chemistry, 2e (Sunheimer) Chapter 15 The Endocrine System 1) Which hormone is produced by the placenta?

A) Epinephrine B) Human chorionic gonadotropin (hCG) C) Adrenocorticotropin hormone (ACTH) D) Oxytocin Answer: B 2) Pituitary gigantism is associated with which of the following?

A) Growth (GH) deficiency B) Growth (GH) excess C) Hypercorticolism D) Hypeprolactinemia Answer: B 3) Which of the following is the principle estrogen produced by the ovaries and measured to evaluate ovarian function?

A) Estriol B) Estradiol C) Epiestriol D) Hydroxyestrone Answer: B 4) Cushing's syndrome is characterized by which of the following?

A) Excess secretion of pituitary ACTH B) Adrenal insufficiency C) ACTH independent D) ACTH dependent Answer: C 5) Which of the following laboratory tests provides a valid index of glucocorticoid secretion?

A) Urinary free cortisol B) Urinary sodium C) Urinary epinephrine D) Serum thyroxine Answer: A 6) Diabetes insipidus is characterized by: A) Elevated blood levels of antidiuretic hormone (ADH).

B) Loss of thirst sensation.

C) No urine production (anuria).

D) Copious production of urine (polyuria).

Answer: D

1 ..

7) Which of the following classes of compounds are derived from tyrosine and includes epinephrine, norepinephrine, and dopamine?

A) Steroids B) Androgens C) Catecholamines D) Estrogens Answer: C 8) Pheochromocytoma is a tumor arising from which of the following?

A) Bile caniculi B) Trophoblastic cells C) Neurochromaffin cells in the adrenal medulla D) Follicular cells of the thyroid Answer: C 9) Which metabolite is most often increased in carcinoid tumors?

A) 5-Hydroxyindolacetic acid (5-HIAA) B) 3-Methoxy-4-hydroxyphenylglycol (MHPG) C) Epinephrine D) Homovanillic acid Answer: A 10) Which of the following is a metabolite of catecholamine?

A) Monoiodothyronine B) Estradiol 17-beta C) Homogentisic acid (HGA) D) Vanillylmandelic acid (VMA) Answer: D 11) Thyroid hormones are derived from which of the following amino acids?

A) Phenylalanine B) Methionine C) Tyrosine D) Histidine Answer: C 12) The designation of "high sensitivity" for select quantitative serum thyroid stimulating hormone (TSH) tests indicates which of the following?

A) The test exhibits very high level of analytical sensitivity.

B) The test exhibits low analytical sensitivity.

C) The analytical specificity is extremely high.

D) The linearity has a high upper limit level.

Answer: B

2 ..

13) A normally functioning thyroid gland is clinically referred to as: A) Perifollicular thyroid.

B) Hypothyroid.

C) Hyperthyroid.

D) Euthyroid.

Answer: D 14) Which of the following are characteristic of serum hormone binding globulin (SHBG)?

A) Tightly bound to protein moiety, not biologically active and binds to testosterone B) Loosely bound to protein moiety, is biologically active and binds to estrogen C) Hypothalamus D) Thyroid gland Answer: A 15) The goal of early detection and treatment of neonatal hypothyroidism is to eliminate?

A) Carcinoid tumors B) Possibility of developing acromegaly C) Severe mental retardation associated with thyroid hormone deficiency in early infancy D) Development of an enlarged heart Answer: C 16) Which of the following describes the hypothalamic hormones?

A) They act as inhibitor of selected enzyme reactions.

B) They act indirectly on endocrine glands.

C) They act as releasing hormones on the pituitary.

D) They are all glycoproteins.

Answer: C 17) Unconjugated estriol (uE3) is clinically useful for identifying which of the following?

A) Fetal anencephaly B) A fetus with Down syndrome C) Molar pregnancy D) Fetal death Answer: B 18) Which of the following hormones is useful in identifying women with ectopic pregnancies or abnormal intrauterine pregnancies?

A) Human pituitary gonadotropin B) Human chorionic gonadotropin C) Human luteinizing hormone D) Human progesterone Answer: B

3 ..

19) Oxytocin and antidiuretic hormone (ADH) are hormones that are released by the: A) Hypothalamus. B) Anterior pituitary. C) Posterior pituitary. D) Left cardiac ventricle. Answer: C 20) In the thyroid gland, which of the following is described as the secretory unit?

A) Calcitonin B) Follicle C) Colloid D) The isthmus Answer: B 21) Pituitary secretion of ACTH is inhibited by elevated levels of: A) Aldosterone.

B) Cortisol.

C) Estradiol.

D) Progesterone.

Answer: B 22) Tetraiodothyronine describes which of the following compounds?

A) T4 (thyroxine) B) T3 C) MIT D) Reverse T3 Answer: A 23) Which of the following is described as a smooth muscle stimulant and vasoconstrictor?

A) Aldosterone B) Cortisol C) Serotonin D) Deoxycorticosterone Answer: C 24) Which of the following is the principle method used to measure hormone levels in blood in many clinical laboratories?

A) Gas chromatography B) Thin layer chromatography C) Electrophoresis D) Immunoassays Answer: D

4 ..

25) Once produced, the thyroid hormones are stored as thyroglobulin in which of the following?

A) Epithelial cell wall of the follicle B) Colloid C) Isthmus of the thyroid gland D) Extracellular space of the thyroid gland Answer: B 26) In a patient with suspected primary hyperthyroidism (Graves' disease), one would expect the following laboratory serum results: total T4 ________ FT4 ________, and TSH ________.

A) Increased, decreased, increased B) Increased, decreased, decreased C) Increased, increased, decreased D) Decreased, decreased, increased Answer: C 27) Free thyroxine assays measure which of the following?

A) Total thyroxine levels B) Only the bound thyroxine level C) Only the unbound thyroxine level D) The sum of the bound and unbound thyroxine Answer: C 28) Thyroid peroxidase autoantibodies are most sensitive for detecting which thyroid disorder?

A) Hypothyroidism B) Autoimmune thyroid disease (e.g., Hashimoto's thyroiditis) C) Thyroid adenoma D) Thyroid carcinoma Answer: B 29) 3, 5, 3'-triodothyronine is characterized as which of the following?

A) The least potent thyroid hormone B) The most potent thyroid hormone C) Secreted by the anterior pituitary gland in response to low blood levels of TSH D) Used to make both T3 and T4 hormones Answer: B 30) A patient with Addison's disease would present with which of the following?

A) High blood sodium, low blood potassium levels B) Low blood sodium, high blood potassium levels C) Normal blood sodium, low blood potassium levels D) Low blood sodium, low blood potassium levels Answer: B

5 ..

Clinical Laboratory Chemistry, 2e (Sunheimer) Chapter 16 Gastrointestinal Function 1) Mini, Little and Big are all descriptors for which of the following peptides?

A) Secretin B) Parathyroid hormone C) Gastrin D) Cholecystokinin Answer: C 2) Which of the following is the primary physiological role of secretin?

A) Stimulate the intestine to move its contents to the large bowel B) Stimulate the pancreas to secrete an increased volume of juice with high bicarbonate content C) Stimulate the release of gastrin from the antral mucosa D) Stimulate the gut to secrete all of its contents Answer: B 3) The structure of cholecystokinin (CCK) is described as: A) Linear polypeptide with multiple molecular forms.

B) Folded and twisted protein.

C) Large polysaccharide.

D) Saturated fatty acid.

Answer: A 4) Which of the following compounds key physiological action includes stimulation of insulin secretion in the presence of hyperglycemia and increasing intestinal fluid and electrolyte secretion?

A) Bile acid B) Gastrin C) Secretin D) Gastric Inhibitory Polypeptide Answer: D 5) Which of the following represents two primary functions of the GI tract?

A) Assimilation of nutrients and elimination of waste B) Anaerobic respiration and bicarbonate excretion C) Release of hypothalamic factors and maintenance of blood pressure D) Detoxification of drugs and transmethylation of drug metabolites Answer: A 6) Transmural inflammation is associated with: A) Zollinger-Ellison syndrome.

B) Bile salt malabsorption.

C) Crohn's disease.

D) Celiac disease.

Answer: C

1 ..

7) A gastrinoma is classified as which of the following?

A) Pituitary adenoma B) Neuroendocrine tumor (NET) C) Hematoma D) Glomma Answer: B 8) Which of the following GI disorders is characterized by a modified gut immune function?

A) Celiac disease B) Carcinoid tumor C) Achalasia D) Zollinger-Ellison syndrome Answer: A 9) Which of the following cells contain cholecystokinin (CCK)?

A) G cells from the gut B) B cells from the pancreas C) S cells from the salivary glands D) I cells from the upper small intestinal mucosa Answer: D 10) Which of the following laboratory analytes is tested for a patient with suspected lactose intolerance?

A) Glucose B) Fructose C) Mannose D) Lactase Answer: A 11) Which of the following is test(s) are clinically useful for assessing patients with possible mucosal blood loss?

A) 5-hydroxyindolacetic acid B) Serum glucose and insulin C) Serum iron and total iron binding capacity (TIBC) D) Whole blood lead Answer: C 12) Which of the following is a useful clinical laboratory test for bile salt malabsorption?

A) Measurement of 1, 25-dihydroxycholecalciferol B) Measurement of 7α-hydroxy-4-cholesten-3-one C) Measurement of cholesterol D) Measurement of cytotoxin-associated gene A (CagA) Answer: B

2 ..

13) Which of the following clinical laboratory tests is useful for diagnosis of peptic ulcer disease (PUD)? A) Basal acid output and IgM B) Serum measurement of IgM and CagA C) Serum measurement of IgA, IgG, and cytotoxin-associated gene A (CagA) D) Alpha -1-antitrypsin Answer: C 14) A patient with suspected protein-losing enteropathy (PLE) would have which of the following laboratory results?

A) Fecal clearance of alpha-1-antitrypsin B) No change in serum protein or albumin C) Decreased serum protein and increased albumin D) Elevated serum protein and albumin Answer: A 15) Which of the following GI peptides relaxes smooth muscles of gut, blood, and genitourinary system; increases water and electrolyte secretion; and stimulates the release of hormones from pancreas, gut, and hypothalamus?

A) Gastrin B) Cholecystokinin C) Vasoactive intestinal polypeptide D) Secretin Answer: C 16) Which of the following statements is correct regarding glycocholic and taurocholate acid?

A) They are carbohydrates synthesized in the liver.

B) They are bile acids synthesized in the liver.

C) They are bile acids synthesized in the kidney.

D) They are triglycerides synthesized in the liver.

Answer: B 17) Which of the following test results are correct for a patient with Zollinger-Ellison syndrome?

A) Elevated serum gastrin, increase in basal gastric acid output B) Decrease serum gastrin, decreased in basal gastric acid output C) Elevated serum gastrin, decreased in basal gastric acid output D) Decrease serum gastrin, increase in basal gastric acid output Answer: A 18) The cutoff point for fasting serum glucose in the lactose tolerance test is > 30 mg/dL (> 1.7 mmol/L). Which of the following is the correct interpretation for a patient whose fasting serum glucose is < 20 mg/dL (<1.1 mmol/L)?

A) The patient has a lactase intolerance.

B) The patient is lactose intolerant.

C) The patient has Crohn's diseases.

D) The patient is lactose tolerant.

Answer: B

3 ..

19) The consumption of nonsteroidal anti-inflammatory drugs (NSAIDs) such as aspirin can lead to which of the following?

A) Heart attack B) Peptic ulcer disease (PUD) C) Zollinger-Ellison Syndrome D) Helicobacter pylori disease Answer: D 20) Which of the following laboratory results is consistent with protein-losing enteropathy (PLE)?

A) Hyperproteinemia B) Hypoalbuminemia C) Hyponatremia D) Hypercholesterolemia Answer: B

4 ..

Clinical Laboratory Chemistry, 2e(Sunheimer) Chapter 17 Pancreas 1) The alpha cells of the islets of Langerhans of the pancreas produce: A) Insulin.

B) Glucagon.

C) Somatostatin.

D) Pancreatic polypeptide.

Answer: B 2) All of the following are tests of exocrine pancreatic function EXCEPT: A) Secretin/cholecystokinin.

B) Pancreatic elastase.

C) Fecal fat.

D) Insulin.

Answer: D 3) The gold standard for evaluating pancreatic exocrine function is: A) Secretin/cholecystokinin.

B) Pancreatic elastase.

C) Fecal fat.

D) Insulin.

Answer: A 4) Slide #2 in the fecal fat procedure measures: A) Neutral fats (triglycerides).

B) Soaps and neutral fats.

C) Fatty acids, soaps and neutral fats.

D) Soaps.

Answer: C 5) Large orange-red droplets seen on direct microscopic examination of stools mixed with Sudan III represent: A) Cholesterol.

B) Fatty acids.

C) Neutral fats.

D) Soaps.

Answer: C 6) Which test of exocrine pancreatic function is noninvasive and can differentiate pancreatic insufficiency in children with cystic fibrosis?

A) Fecal elastase B) NBT-PABA C) Phospholipase-A2 D) Urinary amylase Answer: A

1 ..

7) Insulin and C-peptide levels are important in diagnosing: A) Glucagonomas. B) Insulinomas. C) Somatostatinomas. D) Pancreatic neoplasms. Answer: B 8) The marker for colorectal and pancreatic carcinoma is: A) CA 19-9.

B) CA 15-3.

C) CA 27-29.

D) CA-125.

Answer: A 9) Which enzyme serves as the activator for the remaining pancreatic enzymes?

A) Chymotrypsin B) Phospholipase-A2 C) Trypsin D) Elastase Answer: C 10) Ranson's Indicators of Severity in Acute Pancreatitis include all of the following tests EXCEPT: A) Glucose.

B) Lactate dehydrogenase.

C) BUN. D) Alanine transaminase.

Answer: D 11) Complications of acute pancreatitis include all of the following EXCEPT: A) Adult respiratory distress syndrome.

B) Hypotriglyceridemia.

C) Pseudocyst formation.

D) Splenic varices.

Answer: B 12) Which disorder is related to mucus accumulation, recurrent infection with unusual pathogens, and increased inflammation in the lungs?

A) Acute pancreatitis B) Chronic pancreatitis C) Cystic fibrosis D) Pancreatic cancer Answer: C

2 ..

13) A neoplasm that blocks the exocrine and endocrine functions of the pancreas is: A) Insulinoma.

B) Somatostatinoma.

C) Glucagonoma.

D) Pancreatic cancer.

Answer: B 14) Laboratory evidence of which protein is diagnostic of cystic fibrosis?

A) Cystic fibrosis transmembrane conductance regulator protein B) Cystic fibrosis regulator protein C) Cystic fibrosis sweat protein D) All of the above Answer: A 15) The most common cause of chronic pancreatitis is: A) Pregnancy.

B) Gall stone obstruction.

C) Chronic alcohol abuse.

D) Mumps.

Answer: C

3 ..

Clinical Laboratory Chemistry, 2e(Sunheimer) Chapter 18 Cardiac Function 1) Serial sampling for cardiac biomarkers is described as: A) Drawing blood samples periodically, usually at prescribed time intervals over the course of the patient's admission.

B) Drawing blood samples randomly during the first four hours after admission to the facility.

C) Drawing a blood sample once after admission to the facility.

D) Making dilutions of each blood sample and analyzing them for the appropriate cardiac biomarker.

Answer: A 2) Risk factors for the development of coronary heart disease include which of the following?

A) Tobacco smoking, elevated serum homocysteine, low serum LDL, and high serum levels of CRP B) Tobacco smoking, low serum homocysteine, low serum LDL, and high serum levels of CRP C) Hypertension, abdominal obesity, low HDL-C, high serum levels of CRP, and elevated levels of homocysteine D) Walking at least one hour per day, low serum homocysteine, low serum CRP, and low serum levels of LDL-C Answer: C 3) Atherosclerosis is described as: A) Hardening of the arteries that occurs over a period of many years due in part to the abnormal accumulation of lipids.

B) Syndromes that encompass a continuum of clinical presentations ranging from unstable angina to non-Q-wave AMI. C) A degenerative condition of the muscles.

D) An acute-phase reactant whose concentration in the blood rises dramatically in response to nonspecific inflammatory stimuli.

Answer: A 4) Which of the following statements summarizes the significance of CRP in the arterial wall?

A) It predicts the severity of arteriosclerosis.

B) It predicts the severity of atherosclerosis and is able to bind to damaged membranes and lipids.

C) It predicts the severity of atherosclerosis but cannot bind to damaged membranes and lipids.

D) It has nothing to do with either arteriosclerosis or atherosclerosis.

Answer: B 5) The atherogenic effect of homocysteine is: A) The toxic effect on the left ventricular wall of the heart.

B) The toxic effect of homocysteine on the adventitia or outer lining the arterial wall.

C) The toxic effect of homocysteine on the endothelial lining of the arteries, which causes plaque formation.

D) The nontoxic effect of homocysteine on the intima lining of the arteries.

Answer: C

1 ..

6) Which of the following is a cause of hyperhomocysteinemia?

A) Deficiency of one of the B complex vitamins B) Excess of one the B complex vitamins C) Deficiency of calcium D) Deficiency of sodium Answer: A 7) Which of the following troponins have been demonstrated in patients with muscular dystrophy, and end-stage renal disease (ESRD)?

A) Cardiac troponin C isoforms B) Cardiac troponin I C) Cardiac troponin C D) Cardiac troponin T Answer: D 8) The role of cardiac biomarkers includes which of the following?

A) Establish odds ratio, diagnosis, and treatment modalities B) Tumor identifications, prognosis, appropriate drug therapy intervention C) Diagnosis, monitoring, risks stratification, and therapeutic management D) Determining life expectancy, staging diseases, population studies Answer: C 9) The albumin cobalt-binding test is used to measure which of the following?

A) Microalbumin B) Ischemia modified albumin C) Albumin/globulin ration D) Serum cobalt Answer: B 10) Which of the following represents the correct sequence for the rise and fall of myoglobin, CK-MB, and cTnI after an AMI? A) CK-MB, cTnI, myoglobin B) cTnI, CK-MB, myoglobin C) Myoglobin, CK-MB, cTnI D) CK-MB, myoglobin, cTnI Answer: C 11) NT-pro-BNP consist of 76 amino acids and is described as a: A) A metabolite of BNP. B) The storage form of BNP. C) The catabolic product of ANP. D) The natriuretic peptide that is the inactive form.

Answer: D

2 ..

12) Which of the following statements is TRUE about cTnI? A) Cardiac forms are never expressed in skeletal muscle.

B) Cardiac forms are expressed in skeletal muscle.

C) In fetal development, the cardiac and skeletal forms are co-expressed in skeletal and cardiac tissues.

D) It is the same as cardiac troponin C (cTnC).

Answer: A 13) Myoglobin is a good cardiac marker because it: A) Diffuses into the blood more quickly than CK-MB. B) Diffuses into the blood more slowly than CK-MB. C) Doesn't diffuse into the blood at all when cardiac tissue dies.

D) Is an extremely large protein and therefore does not diffuse into the blood very easily.

Answer: A 14) In which of the following disorders is measurement of brain type natriuretic peptide (BNP) clinically useful?

A) Acute myocardial infarctions (AMIs) B) Tachycardia C) Congestive heart failure D) Pericarditis Answer: C 15) Which of the following cardiac biomarkers is a better biomarker of plaque instability?

A) MPO B) CRP C) Lp-PLA2 D) Leptin Answer: A 16) The presence of heterophile antibodies, rheumatoid factor, increased blood levels of hemoglobin and circulating cTnI autoantibodies can result in which of the following?

A) High dose hook effect with select cTn assays B) Modification of diagnostic cut off value for cTn assays C) False positive and/or false negative result for BNP or NT-Pro BNP assays D) False positive and/or false negative result for cTnI assays Answer: D 17) What is the clinical usefulness of measuring serum adiponectin?

A) Plasma adiponectin levels may predict cardiovascular events years in advance in a population without diagnosed cardiovascular disease.

B) It is an early biomarker for AMI. C) It is a cardiac biomarker for late presenting AMIs. D) There are two forms of this protein, pregnancy, and acute coronary syndrome; thus, adiponectin can be used for either condition.

Answer: A

3 ..

18) Lp (a) is considered a risk factor for developing atherosclerosis due to which of the following? A) It competes with fibrinogen for binding sites, thus interfering with clot lysis and increasing the risk of acute myocardial infarction (AMI). B) It is produced by macrophages and expressed in atherosclerotic lesions. C) It activates complement. D) It competes with plasminogen for binding sites, thus interfering with clot lysis and increasing the risk of acute myocardial infarction (AMI). Answer: D 19) Which of the following is an advantage of POCT for cardiac biomarkers?

A) Increased turn-around time for analysis B) Delay in rule-out of an AMI C) Rapid identification of AMI D) Delay in risk stratification of an AMI Answer: C 20) Elevated blood levels of pregnancy-associated plasma protein A (PAPP-A) may suggest which of the following?

A) A presumptive diagnosis of heart failure in breathless patients.

B) A low risk factor for developing an acute coronary syndrome (ACS).

C) An S-T segment myocardial infarction (STEMI).

D) The presence of an unstable ACS in patients without increased concentration of biomarkers of necrosis, such as cTn. Answer: D 21) Which of the following is an early (i.e., rapidly in similar fashion to myoglobin) biomarkers of acute myocardial infarction?

A) Unbound free fatty acid (FFAu) B) Placental growth factor (PIGF) C) Heart-type fatty acid binding protein (H-FABP) D) CK-MB Answer: C 22) Infusion of Nesiritide® is documented to act as a confounder for which of the following assays?

A) Brain natriuretic peptide (BNP) B) Atria natriuretic peptide (ANP) C) Cardiac troponin T D) Myoglobin Answer: A

4 ..

23) IL-6, protease-activated receptor signaling (PARS) and soluble CD 40 ligand function to: A) Stabilize an embolus.

B) Induce adhesion of monocytes.

C) Stabilize the one-cell thick endothelium.

D) Resist plaque formation.

Answer: B 24) High blood levels of adiponectin are associated with: A) Reduced risk of heart attacks.

B) Increased risk of heart attacks.

C) Increased risk of plaque rupture.

D) Stabilizing endothelial cell structure.

Answer: A 25) The troponin complex consists of which of the following?

A) Troponin A, troponin C, and troponin T B) Troponin M1, troponin M2, and troponin K C) Troponin M and troponin H D) Troponin T, troponin I, and troponin C Answer: B

5 ..

Clinical Laboratory Chemistry, 2e(Sunheimer) Chapter 19 Liver 1) Bile formed in the liver is stored in the: A) Liver.

B) Gall bladder.

C) Duodenum.

D) Large intestine.

Answer: B 2) A breakdown product of bilirubin metabolism that is produced in the colon from the oxidation of urobilinogen by microorganisms is: A) Porphobilinogen.

B) Urobilin.

C) Stercobilinogen.

D) Protoporphyrin.

E) Protoheme.

Answer: B 3) The enzyme system that catalyzes the conjugation of bilirubin is known as: A) Leucine aminopeptidase.

B) Glucose-6-phosphate dehydrogenase.

C) Uridine diphosphate (UDP) glucoronyl transferase.

D) Carbamyl phosphate synthetase.

E) Lactate dehydrogenase.

Answer: C 4) The cells that make up 70% of the liver's mass are: A) Kupffer cells.

B) Hepatocytes.

C) Endothelial cells.

D) None of the above.

Answer: B 5) Which of the statements regarding bilirubin metabolism is TRUE? A) It is a product of porphyrin metabolism.

B) It is reduced to biliverdin before excretion.

C) It is produced from the destruction of RBCs. D) It is formed by the hydrolysis of the α-methene bridge of urobilingen.

Answer: C 6) Which is a characteristic of unconjugated bilirubin?

A) It is water-soluble.

B) It reacts faster than conjugated bilirubin.

C) It has the same absorbance properties as conjugated bilirubin.

D) It a not water-soluble.

Answer: D

1 ..

7) The term δ-bilirubin (delta) refers to: A) Water-soluble bilirubin. B) Free unconjugated bilirubin. C) Bilirubin tightly bound to albumin. D) Direct-reacting bilirubin. Answer: C 8) Kernicterus is the abnormal accumulation of bilirubin in: A) Heart tissue. B) Brain tissue. C) Liver tissue. D) Kidney tissue. E) Blood. Answer: B 9) What is the most common cause of unconjugated hyperbilirubinemia? A) Hemolytic anemia B) Gilbert's disease C) Bile duct obstruction D) Dubin-Johnson E) Neonatal physiologic jaundice Answer: E 10) Which of the following would be classified as prehepatic jaundice? A) Hepatitis B) Congestive heart failure C) Rotor syndrome D) Cancer of the bile ducts Answer: B 11) In obstructive liver disease, the following test results are found: A) Feces: urobilinogen decreased; urine: bilirubin: positive; serum: conjugated bilirubin increased. B) Feces: urobilinogen decreased or negative; urine: urobilinogen decreased or negative; serum: conjugated bilirubin decreased. C) Feces: urobilinogen increased; urine: bilirubin: normal; serum: conjugated bilirubin normal or slightly elevated. D) None of the above. Answer: A 12) The first serological marker of Hepatitis B is: A) HBsAg. B) HBeAg. C) Anti-HBc. D) Anti-HBs. Answer: A

2 ..

13) Alcoholic liver disease that follows six months to a year of moderate consumption, few lab abnormalities, and is reversible with abstinence from alcohol is termed: A) Alcoholic cirrhosis.

B) Alcoholic hepatitis.

C) Alcoholic fatty liver.

D) None of the above.

Answer: C 14) The reagent (accelerator) in the Jendrassik-Grof bilirubin procedure that makes indirect bilirubin water-soluble is: A) Hydrochloric acid.

B) Caffeine.

C) Methanol.

D) Alkaline tartrate.

Answer: B 15) If a total bilirubin is 4.0 mg/dL and the conjugated bilirubin is 2.5 mg/dL, the unconjugated bilirubin is: A) 1.0 mg/dL. B) 1.5 mg/dL. C) 2.0 mg/dL. D) 3.0 mg/DldL. Answer: B 16) In the Jendrassik-Grof bilirubin, what converts purple azobilirubin to blue azobilirubin measured at 600nm?

A) Hydrochloric acid B) Caffeine C) Methanol D) Alkaline tartrate Answer: D 17) Viral hepatitis that results in the largest percentage of chronic hepatitis is: A) Hepatitis A. B) Hepatitis B. C) Hepatitis C. D) Hepatitis D. Answer: C 18) The two most significant sources of error in accurate ammonia determinations are sample handling and: A) Short shelf life of test reagents.

B) Inability to automate the test procedure.

C) Need for age-dependent reference ranges.

D) Ammonia contamination in the laboratory.

Answer: D

3 ..

19) The following disease is a recessive disorder of copper metabolism, which results in the accumulation of copper in the liver.

A) Hereditary hemochromatosis B) Wilson's disease C) α1-antitrypsin D) Gilbert's disease Answer: B 20) An autosomal recessive disorder of iron metabolism, which is characterized by excessive iron absorption and accumulation in various tissues in the body, is termed: A) Hereditary hemochromatosis.

B) Wilson's disease.

C) α1-antitrypsin.

D) Dubin-Johnson.

Answer: A 21) A Model for End-Stage Liver disease staging system to predict prognosis in cirrhosis uses the following laboratory determinations EXCEPT: A) Bilirubin.

B) INR. C) Creatinine.

D) Aspartate transaminase.

Answer: D 22) Nonalcoholic steatohepatitis is characterized by all of the following EXCEPT: A) Necroinflammatory liver disease associated with accumulation of fat in the liver.

B) AST greater than ALT. C) Consumption of less than 20g of ethanol daily.

D) No inflammation or scarring of the liver.

Answer: B

4 ..

Clinical Laboratory Chemistry, 2e (Sunheimer) Chapter 20 Iron, Porphyrins, and Hemoglobin 1) Which of the following compounds initially condenses to form aminolevulinic acid? A) Coproporphyrinogen and urobilinogen B) Glutamic acid and alanine C) Acetylcholine and epinephrine D) Succinyl coenzyme A and glycine Answer: D 2) What is the required oxidation state (valence) of iron that enables it to bind to a chromogen in most spectrophotometric assays? A) +1 B) +2 C) +3 D) -3 Answer: B 3) Which of the following compounds chelates iron and is the immediate precursor of heme formation? A) Uroporphyrinogen B) Coproporphyrinogen I C) Protophorhyrin IX D) Urobilinogen Answer: C 4) What is the primary storage form of iron? A) Hemosiderin B) Ferritin C) Apotransferrin D) Myoglobin Answer: B 5) Which of the following chromogens will produce a colored complex with iron? A) Biuret B) Ferrozine C) Molybdic acid D) 8-hyroxyquinoline Answer: B 6) Which of the following specimens is appropriate to determine the concentration of lead in body fluids? A) Serum B) Cerebrospinal fluid C) Whole blood D) EDTA plasma Answer: C

1 ..

7) Free erythrocyte protoporphyrin levels are useful for assessing exposure to which of the following metals?

A) Lead B) Chromium C) Zinc D) Copper Answer: A 8) What complex makes up transferrin?

A) Apo-B·Transferrin B) Apotransferrin·Fe3+ C) Lipoprotein A·Transferrin D) Apotransferrin·Fe2+ Answer: B 9) A 30-year-old male with ALA-dehydratase deficient porphyria (ADP) may present with which of the following clinical features?

A) Severe chest pain, shortness of breath, and rapid heart rate (tachycardia) B) Abdominal pain and neurological dysfunction C) Photosensitivity and cutaneous lesion D) Bulging eyes, goiter in the neck, and heat intolerance Answer: B 10) Total iron binding capacity (TIBC) is equal to: A) The sum of the serum iron and unsaturated iron binding capacity (UIBC).

B) The sum of the serum iron and serum ferritin.

C) The sum of the serum transferrin and transferrin saturation.

D) Serum iron minus unsaturated iron binding capacity (UIBC).

Answer: A 11) Hemochromatosis is best described as which of the following?

A) A disorder characterized by an iron overload without associate tissue injury.

B) A genetically related disorder in which the body accumulates excess amounts of iron.

C) A genetically related disorder in which the body develops an iron deficiency.

D) A disorder characterized by an accumulation of porphyrins in the blood.

Answer: B 12) Which of the following statements is correct when procuring specimens for measuring porphyrin compounds?

A) Do not expose the blood specimen to air for prolong period of time.

B) You must add 0.5 N hydrochloric acid to urine specimens to preserve it while storing.

C) It not necessary to collect the specimen in low actinic glassware.

D) Protect the specimen from light.

Answer: D

2 ..

13) A 40-year-old male patient with hemochromatosis often presents to his clinician with which of the following triad of symptoms?

A) Bronzing of the skin, cirrhosis, and diabetes B) Polyuria, polydipsia, and polyphagia C) Yellowing of the sclera of the eyes, shortness of breath, and chest pain D) Abdominal pain, chest pain, and grayish-blue lips Answer: A 14) Protoporphyrins that chelate iron are called: A) Hemin.

B) Hemoglobin.

C) Heme.

D) Hemosiderin.

Answer: C 15) The biosynthesis of heme commences with which two compounds?

A) Glycine and succinyl CoA B) Alanine and glycine C) Glycerin and acetyl-CoA D) Lysine and globulin Answer: A 16) A patient with acute intermittent porphyria is deficient in which enzyme?

A) Coproporphyrinogen oxidase B) Aminolevulinic acid synthase C) Ferrochelatase D) Hydroxymethylbilane synthase Answer: D 17) What is the unique quality that many porphyrin compounds possess that allows for their detection within body tissues and in a test tube?

A) They emit gamma radiation that can be detected using a radiation sensor.

B) They fluoresce and are detected by exposing them to EMR at a specific wavelength.

C) They absorb heat and can be detected using a thermal sensor.

D) They emit an odor that is characteristic of the particular type of porphyrin.

Answer: B 18) Heme is defined as: A) Protoporphyrins that chelate iron.

B) Protoporphyrins that chelate lead.

C) Ferricheme associated with hydroxide.

D) The reduced form of a porphyrin.

Answer: A

3 ..

19) Which of the following enzymes is the first one used in the biosynthesis of heme?

A) Ferrochelatase B) Uroporphyringen decarboxylase C) Delta-aminolevulinate synthase D) Hydroxymethylbilane synthase Answer: C 20) Which of the following laboratory test groups and results best reflects a patient with iron deficiency anemia?

A) Serum iron, decreased; serum TIBC, increased; transferring saturation, decreased B) Serum iron, increased; serum TIBC, increased; transferrin saturation, increased C) Serum lead, increased; serum TIBC, increased; transferrin saturation, increased D) Serum iron, decreased; serum TIBC, decreased; transferrin saturation, decreased Answer: A 21) How many pyrrole rings are there in a porphyrin structure?

A) 5 B) 4 C) 2 D) 1 Answer: B 22) The addition of sufficient Fe3+ to saturate iron binding site of transferrin is referred to as which of the following?

A) Total iron binding saturation B) Unsaturated iron binding capacity C) Serum transferrin saturation D) Total iron index Answer: B 23) Which of the following porphyria's best reflect this patient's symptoms and laboratory results?

A 42-year-old white South African male presents to his clinician experiencing acute neurological attacks and sensitivity of his skin to sunlight. The patient's urine showed PBG>ALA. Urine porphyrins analysis revealed elevation of urinary coproporphyrinogen III. A) ALA-dehydratase deficient porphyria B) Acute intermittent porphyria C) Erythropoietic protoporphyria D) Variegate porphyria Answer: D

4 ..

24) A 25-year-old female visits her physician complaining of lethargy and wants to take a nap all of the time. Her physician orders laboratory tests and the results are shown below. Which of the following conditions best represent this patient's status?

Serum iron (µg/dL) Dec

Transferrin saturation TIBC (µg/dL) (%) Serum Ferritin (µg/L) Inc Dec Dec

A) Thalassemia major B) Iron deficiency anemia C) Variegate porphyria D) Hemochromatosis Answer: B 25) The following laboratory results are consistent with which of the following conditions?

Urine PBG/ALA PBG>ALA

Urine porphyrins Increased

Fecal porphyrins Normal

Erythrocyte porphyrins Normal

A) Hereditary coproporphyria B) ALA-dehydratase deficient porphyria C) Acute intermittent porphyria D) Porphyria cutanea tarda Answer: C

5 ..

Clinical Laboratory Chemistry, 2e (Sunheimer) Chapter 21 Therapeutic Drug Monitoring 1) The fractional extent to which a dose of drug reaches its site of action is referred to as: A) Elimination half-life.

B) Phase I reaction.

C) First- pass effect.

D) Bioavailability.

Answer: D 2) Which of the following best reflect the four correct pharmacological parameters that determine serum drug concentration?

A) Absorption, anabolism, bioactivation, excretion B) Equilibration, biotransformation, reabsorption, elimination C) Absorption, distribution, metabolism, excretion D) Ingestion, conjugation, metabolism, elimination Answer: C 3) Which of the following is an example of an antiarrhythmic drug that has a metabolite with very similar same pharmacological action?

A) Procainamide B) Phenobarbital C) Quinidine D) Caffeine Answer: A 4) Which of the following compounds selectively inhibits proliferation and activation of CD4+ T cells?

A) Digoxin B) Beta hCG C) Progesterone D) Cyclosporine A Answer: D 5) Which of the following is the correct definition of first-pass effect of a drug?

A) When a drug is excreted into the urine B) When a drug is metabolized in the gut wall and liver before it reaches the systemic circulation C) The time it takes for the plasma concentration of drug in the body to be reduced by 50% D) The point when the total amount of drug in a human does not change over multiple loading does intervals Answer: B

1 ..

6) The goal of therapeutic drug monitoring (TDM) is to: A) Provide the patient with the least amount of drug to effect the best outcome.

B) Provide the patient with the cheapest formulation of the drug to effect the best outcome.

C) Provide the patient with the best estimate of a dosage of drug to effect the best outcome.

D) Provide the patient with the optimum dosage of drug to effect the best outcome.

Answer: D 7) The pharmacological response of a drug is initiated when the drug is in which form?

A) Bound to fatty acids B) Bound to proteins C) Bound to carbohydrates D) Free Answer: D 8) FK506 (tacrolimus) is classified as a (an): A) Immunosuppressant.

B) Sedative hypnotic.

C) Cardiac glycoside.

D) Antiasthmatic.

Answer: A 9) Plasma clearance of a drug is defined as: A) The volume of plasma from which all drug appears to be removed in a given volume of blood (e.g., mL/mL).

B) The volume of plasma from which all drug appears to be removed in a given time (e.g., mL/min).

C) The amount of drug removed from urine in a given time (e.g., mg/min).

D) The amount of time it takes for a drug to reach seven half-lives.

Answer: B 10) Steady state of a drug is typically achieved after: A) Approximately seven half-lives.

B) Approximately two half-lives.

C) The drug is completely absorbed from the gut.

D) The drug first begins to appear in the urine.

Answer: A 11) Which of the following drugs is used as an immunosuppressant in liver transplants?

A) Thiocyanate B) Tacrolimus C) Cyclosporine D) Primidone Answer: B

2 ..

12) A drug that is administered into the subarachnoid space or ventricles (intrathecal) is referred to as: A) Oral.

B) Topical.

C) Parenteral.

D) Enteral.

Answer: C 13) Which of the following compounds is an anticonvulsant used to control tonic-clonic (grand mal) seizures?

A) Digoxin B) Acetaminophen C) Lithium D) Phenytoin Answer: D 14) Which of the following compounds relaxes the smooth muscles of the bronchial passages?

A) Acetaminophen B) Lithium C) Phenytoin D) Theophylline Answer: D 15) Which of the following compounds is a cardiac glycoside that is used in the treatment of congenital heart failure and arrhythmias by increasing the force and velocity of myocardial contraction?

A) Digoxin B) Carbamazepine C) Amikacin D) Phenobarbital Answer: A 16) Carbamazepine, primidone, and valproic acid are all examples of: A) Antiarrhythmic drugs.

B) Antidepressant drug.

C) Antibiotics.

D) Antiepileptic drugs.

Answer: D 17) Depakene or Depakote are proprietary names for which of the following compounds?

A) Phenobarbital B) Dilantin C) Valproic acid D) Carbamazepine Answer: C

3 ..

18) Following the entrance of a drug into the vascular compartment, it will be carried to all organs and fluid compartments. This statement describes which of the following?

A) Digestion B) Distribution C) Metabolism D) Reperfusion Answer: B 19) Phase I biotransformation includes: A) Attachment of a hydroxyl group.

B) Conjugation with glucuronic acid.

C) Conjugation with sulfate.

D) Conjugation with glutathione.

Answer: A 20) Which of the following compounds is the major metabolite of primidone?

A) Digoxin B) Theophylline C) N-acetylprocainamide D) Phenobarbital Answer: D 21) A blood sample for a trough drug level should be drawn: A) During the distribution phase of the drug.

B) 1.5 hours after drug administration.

C) Shortly before drug administration.

D) During phase I biotransformation.

Answer: C 22) Which of the following are the toxic effects of phenobarbital?

A) Atrial fibrillation, hyperactive, and very fast breathing rates B) Severe tiredness/dizziness, inability to wake up, and very slow breathing rates C) Ototoxicity and possible nephrotoxicity D) Spontaneous hemorrhage or life-threatening infections Answer: B 23) Clearance (CL) of a drug is defined as which of the following?

A) The rate of elimination by all routes normalized to the concentration of drug, in some biological fluids B) A measure of the apparent space the body has available to contain the drug C) The time required for an amount of drug in blood to decline to one-half its measured value D) The fraction of drug dose reaching the systemic circulation following administration by any route Answer: A

4 ..

24) Which of the following is bactericidal for Streptococci, Corynebacterium, Clostridia, Listeria, and Bacillus species?

A) Tobramycin B) Cyclosporine C) Vancomycin D) Methotrexate Answer: C 25) Phenobarbital is classified as a (an): A) Cardiac glycoside.

B) Anti arrhythmic.

C) Analgesic, antipyretic, and anti-inflammatory.

D) Sedative and hypnotic.

Answer: D

5 ..

Clinical Laboratory Chemistry, 2e(Sunheimer) Chapter 22 Toxic Substances 1) THC (∆9-tetrahydrocannabinol) is the principal active metabolite of which of the following?

A) Benzodiazepine B) Marijuana C) Acetaminophen D) Morphine Answer: B 2) Urine adulteration test strips are designed to detect which of the following?

A) Bleach B) Nitrites C) Creatinine D) All of the above Answer: D 3) Which of the following cytochromes plays a major role in the metabolism of drugs in the liver?

A) Cytochrome P650 B) Cytochrome P490 C) Cytochrome P250 D) Cytochrome P450 Answer: D 4) Levels of 89% carboxyhemoglobin saturation of whole blood are commonly found in which of the following?

A) Fatal carbon monoxide poisoning B) Nonsmoking residents who live in the country C) Nonsmoking residents of large cities D) Cigarette smokers Answer: A 5) Imiprimine is classified as: A) Tetracyclic aminoglycosides.

B) Tricyclic antidepressant.

C) An opioid.

D) Antiepileptic.

Answer: B 6) Which of the following classes of compounds has a sedative effect and is used to treat anxiety?

A) Amphetamines B) Opiates C) Cannabinoids D) Benzodiazepines Answer: D

1 ..

7) Identification of the urinary metabolite benzoylecgonine would be useful in determining the presence of which of the following compounds?

A) Codeine B) Cocaine C) Amphetamine D) Acetaminophen Answer: B 8) The toxic effect of acetaminophen overdose is: A) Cardiac arrest.

B) Hepatocystic necrosis.

C) Renal necrosis.

D) Hypotension.

Answer: B 9) The reason that carbon monoxide is so toxic is because it: A) Is a protoplasmic poison.

B) Combines with cytochrome oxidase.

C) Has 200-250 times the affinity of oxygen for hemoglobin binding sites.

D) Sensitizes the myocardium.

Answer: C 10) Which of the following biological fluids is the specimen of choice for screening and/or analyzing drugs of abuse?

A) Serum B) Whole blood C) Urine D) CSF Answer: C 11) Possible risks of hepatocellular damage due to toxic blood levels of acetaminophen are evaluated based on blood levels and which of the following?

A) Urine levels B) Months post ingestion C) Time (hours) post ingestion D) Degree of level of consciousness (LOC) Answer: C 12) Overexposure to compounds such as Marathon®, Parathion®, Diazinon®, Sevin®, and Furadan® insecticides may prompt a physician to order which of the following tests?

A) Acetaminophen B) Salicylate C) Pseudocholinesterase D) Creatine kinase Answer: C

2 ..

13) Ethanol metabolizes to which of the following acids? A) Formic B) Acetic C) Glycolic D) Hydrochloric Answer: B 14) Screening methods for drug abuse testing requires which of the following assay characteristics?

A) They must be very specific.

B) They must be analytically sensitive.

C) They must be free of interferences.

D) They must be very accurate.

Answer: B 15) Valium and Librium are examples of which of the following classes of drugs?

A) Opiates B) Benzodiazepines C) Barbiturates D) Amphetamines Answer: B 16) Which of the following proteins is a copper transport protein that migrates in the alpha2globulin region?

A) Haptoglobin B) Hemoglobin C) Ceruloplasmin D) Transferrin Answer: C 17) Chromium in blood binds to which of the following proteins?

A) Chromodulin B) Chromoglobulin C) Microalbumin D) Glucuronide Answer: A 18) A person with Menke's syndrome will have which of the following laboratory results?

A) Decreased blood arsenic B) Increased blood zinc C) Increased blood copper D) Decreased blood copper Answer: D

3 ..

19) Trace metals in biological fluids can be measured using which of the following instrumentation techniques?

A) Reflectometry B) Enzyme immunoassay C) Atomic absorption spectrometry D) Osmometry Answer: C 20) Aceruoplasminemia is associated with which of the following?

A) Decreased blood ceruloplasmin, increased copper deposition in the liver, and increased zinc deposition in tissues B) Decreased blood ceruloplasmin, decreased copper deposition in the liver, and increased iron deposition in tissues C) Increased blood ceruloplasmin, increased copper deposition in the liver, and increased iron deposition in tissues D) Decreased blood ceruloplasmin, increased copper deposition in the liver, and increased iron deposition in tissues Answer: D 21) Which of the following sets of laboratory results is associated with Wilson's disease?

A) Decreased plasma copper and plasma ceruloplasmin B) Decreased plasma copper and increased plasma ceruloplasmin C) Increased plasma copper and decreased plasma ceruloplasmin D) Increased plasma copper and increased plasma ceruloplasmin Answer: A 22) Antimony is used to treat patients with which disorder?

A) Diabetes B) Pneumonia C) Schistosomiasis D) Lupus erythematosus Answer: C 23) Which of the following substances when ingested can lead to an excessive amount of aluminum in blood and tissue?

A) Antacids and astringents B) Wine C) Aspirin D) Citrus fruit Answer: A

4 ..

24) Which of the following statements best defines a metalloenzyme?

A) A trace metal that is associated with an enzyme to serve as an inhibitor of an enzyme reaction B) A trace metal that is associated with an enzyme to serve as a nonessential component or cofactor C) A trace metal that is associated with an enzyme to serve as a catalyst for the enzyme reaction D) A trace metal that is associated with an enzyme to serve as an essential component or cofactor Answer: D 25) Which of the following metals is an example of a trace metal?

A) Potassium B) Cobalt C) Calcium D) Magnesium Answer: B 26) Berylliosis in humans affects which of the following organs?

A) Brain B) Heart C) Urinary bladder D) Lungs Answer: D 27) Which of the following has a large amount of aluminum present?

A) Baking soda B) Saline C) Antacids D) Radiator fluid Answer: C 28) What is the primary route of exposure in humans to mercury?

A) Inhalation of vapors B) Contact with the skin of metalal mercury (e.g., mercury containing thermometers) C) Ingestion of mercury containing medications D) Direct injection of mercury from contaminated needles Answer: A 29) Which of the following trace metals is classified as essential?

A) Mercury B) Silver C) Chromium D) Cobalt Answer: C

5 ..

30) What is the best test to assess a patient who has been exposed to beryllium?

A) Belgium leukocyte proliferation test (BeLPT) B) Beryllium leukocyte proliferation test (BeLPT) C) Beryllium lymphocyte proliferation test (BeLPT) D) Belgium lymphocyte proliferation test (BeLPT) Answer: C

6 ..

Clinical Laboratory Chemistry, 2e (Sunheimer) Chapter 23 Nutrition and Vitamins 1) Scurvy is a disorder caused by a deficiency in which of the following?

A) Vitamin K B) Vitamin B2 C) Vitamin C D) Vitamin A Answer: C 2) Vitamins A, D, and K are classified as: A) Water-soluble.

B) Fat-soluble.

C) Insoluble.

D) Soluble in nitric acid only.

Answer: B 3) Vitamin B12 is also named: A) Cyanocobalamin.

B) Riboflavin.

C) Retinol.

D) Tocopherols.

Answer: A 4) Which disorder is associated with vitamin B1 (thiamin) deficiency?

A) Rickets B) Beriberi C) Pellagra D) Pernicious anemia Answer: B 5) A deficiency of vitamin K (menaquinone) can result in which of the following?

A) Scurvy B) Pellagra C) Increased clotting time D) Hyperglycemia Answer: C 6) The term associated with indirect methods for assessment of vitamin status is termed: A) Proportional assays.

B) Functional assays.

C) Reciprocal assays.

D) Bioassays.

Answer: B

1 ..

7) Retinol is formed from which of the following vitamins?

A) Vitamin C B) Vitamin K C) Preformed vitamin A D) Provitamin D Answer: C 8) Insufficient amounts of vitamin A can lead to degenerative changes to the cornea, which leads to poor dark adaptation, or night blindness, also known as: A) Myocarditis.

B) Dyslexia.

C) Photophobia.

D) Nyctalopia.

Answer: D 9) Vitamin D deficiency leads to which of the following conditions?

A) Scurvy B) Peritonitis C) Rickets D) Hives Answer: C 10) Which of the following functions as a chain-breaking antioxidant and is a pyroxyl radical scavenger that protects LDL and polyunsaturated fats in membranes from oxidation?

A) Vitamin D B) α-tocopherol C) Thiamin D) Menaquinone Answer: B 11) Vitamin E toxicity has been associated with which of the following?

A) Atherosclerosis B) Clotting deficiencies C) An affliction of premature infants who have been exposed to high oxygen therapy and later developed retinopathy of prematurity (formerly retrolental fibroplasias) D) Hepatoma Answer: C 12) A direct assay for measurement of plasma phylloquinone is useful to assess: A) Vitamin D status.

B) Vitamin B12 status.

C) Folate deficiency.

D) Vitamin K status.

Answer: D

2 ..

13) Decreased serum levels of vitamin B12 and folic acid are seen in patients with which of the following? A) Coronary artery disease B) Sprue C) Beriberi D) Wilson's disease Answer: B 14) A patient with megaloblastic anemia would show which of the following?

A) Elevated vitamin B12, elevated folic acid B) Elevated vitamin B12, decreased folic acid C) Decrease vitamin B12, elevated folic acid D) Decreased vitamin B12, decreased folic acid Answer: D 15) An individual who consumes massive amounts of vitamin C may develop kidney stones consisting of: A) Glycolic acid.

B) Uric acid.

C) Oxalic acid.

D) Linoleic acid.

Answer: C 16) Coenzyme A (CoA) contains which of the following?

A) Pantothenic acid B) Thiamin C) Riboflavin D) Vitamin D Answer: A 17) Changes in vitamin B12 are most dramatic in tissues with the greatest rate of cell turnover because: A) Deficiencies result in impaired RNA synthesis in any cell where chromosomal replication and division takes place.

B) Deficiencies result in impaired excretion of metabolic waste products from the cells' cytosol.

C) Deficiencies result in impaired function of cytochrome P450.

D) Deficiencies result in impaired DNA synthesis in any cell where chromosomal replication and division takes place.

Answer: D 18) Three natural forms of vitamin B6 are: A) Cholic acid, tauracholic acid, and glycocholic acid.

B) Pyridoxine (pyridoxol) (PN), pyridoxamine (PM), and pyridoxal (PL).

C) Caffeine, xanthene, and ubiquinone.

D) Flavin adenine dinucleotide (FAD), flavin mononucleotide (FMN), and flavin.

Answer: B

3 ..

19) A patient presents with the following symptoms: ∙ ∙ ∙ ∙ ∙

Loss of appetite Generalized weakness and irritability Abdominal pain and vomiting Bright red tongue (glossitis) Skin rash ("Casal's necklace")

Which of the following is associated with these symptoms?

A) Scurvy B) Rickets C) Pellagra D) Dermatitis Answer: C 20) Measurement of vitamin B12 concentration in serum using an immunoassay is an example of which of the following?

A) Indirect assay B) Direct assay C) Screening assay D) Bioassay Answer: B 21) Which of the following is described as a nervous system ailment because of a deficiency of thiamine?

A) Pellagra B) Multiple sclerosis C) Beriberi D) Parkinson disease Answer: C 22) Rickets in children or osteoporosis in adults can be minimized though dietary supplementation with which of the following?

A) Vitamin D, calcium, and phosphorus B) Vitamin K C) Vitamin A D) High doses of ascorbic acid Answer: A 23) Pellagra is associated with a deficiency of which of the following vitamins?

A) Vitamin B2 B) Vitamin B3 C) Vitamin B12 D) Vitamin D Answer: B

4 ..

24) Niacin is converted to which of the following two cofactors? A) Flavin adenine dinucleotide (FAD) and flavin mononucleotide (FMN) B) Vitamin B12 and ubiquinone C) Nicotinamide-adenine dinucleotide and nicotinamide-adenine dinucleotide phosphate D) Thiamine pyrophosphate and biotin Answer: C 25) Which vitamin is a component of two redox coenzymes?

A) Folic acid B) Vitamin A C) Vitamin C D) Vitamin B2 Answer: D

5 ..

Clinical Laboratory Chemistry, 2e(Sunheimer) Chapter 24 Tumor Markers 1) In which of the following disorders would the maternal serum level of α1-fetoprotein be elevated?

A) Neural tube defect B) Cardiac ischemia C) Down syndrome D) Small cell lung carcinoma Answer: A 2) Which of the following statement is correct about PSA? A) It is a cystine protease.

B) It is large globular protein.

C) It is a single-chain glycoprotein consisting of 237 amino acids.

D) It complexes with apoprotein C. Answer: C 3) Which of the following biomarkers is elevated in nonmucinous epithelial ovarian cancer?

A) CA 15-3 B) CA 19-9 C) CA 125 D) CEA Answer: C 4) Which of the following is a sialylated Lewis blood group antigen associated with colorectal cancer?

A) CA 125 B) CA 15-3 C) PSA D) CA 19-9 Answer: D 5) Which of the following biomarkers are elevated in advanced stages of breast cancer?

A) Total and free PSA B) CEA and alpha-fetoprotein C) CA 15-3 and CA 549 D) DUPAN-2 and Gastrin Answer: C 6) Which tumor marker is associated with cancer of the urinary bladder?

A) CA 125 B) CA19-9 C) CA 50 D) Nuclear matrix protein Answer: D

1 ..

7) What is the clinical usefulness of measuring carcinoembryonic antigen?

A) Diagnosis of lung cancer B) Diagnosis of colorectal cancer C) Screening for breast cancer D) Monitoring for recurrence of colon cancer Answer: D 8) Which of the following is used to assess the usefulness of trastuzumab (Herceptin®) therapy for breast cancer?

A) CA 15-3 B) HER-2/neu C) CA 125 D) Prolactin Answer: B 9) Which type of hCG test would be most useful to assess a person suspected of having testicular cancer?

A) Plasma immunoassay for intact hCG and the β-hCG subunits B) Plasma immunoassay for the free alpha and β-hCG subunits C) Urine assay for hCG-β core D) Plasma immunoassay for intact hCG only Answer: A 10) A markedly elevated serum AFP is associated with which of the following?

A) Ovarian cancer B) Lung cancer C) Hepatoma D) Breast cancer Answer: C 11) Which of the following assays is recommended as a screening test for colorectal cancer in persons over 50 years of age?

A) Fecal typsin B) AFP C) BTA D) Occult blood test Answer: D 12) Which of the following must be determined to calculate diagnostic specificity?

A) True-negatives and false-positives B) True-positives and false-positives C) True-positives and false-negatives D) True-negatives and false-negatives Answer: A

2 ..

13) A new tumor marker assay for prostate specific antigen (PSA) is evaluated for diagnostic sensitivity by testing serum samples from patients who have been diagnosed as having prostate cancer. The following results were obtained: Number of prostate cancer patients who tested positive by the new assay = 42 out 46 Number of patients who did not have cancer and tested negative by the new assay = 31 out of 32 What is the sensitivity of the new assay for PSA? A) 98.0% B) 95.0% C) 91.3% D) 88.5% Answer: C 14) Which statement below best describes the molecular difference between free PSA (fPSA) and complex PSA (cPSA)? A) Free PSA is bound by compounds such as ACT, PCI, API, or AMG. B) Free PSA is an active form that can complex with protease inhibitors. C) Free PSA is not bound by compounds such as ACT, PCI, API, or AMG. D) Free PSA cannot be detected in serum, whereas complex PSA can. Answer: C 15) The production of alpha fetal protein (AFP) in a healthy individual is best reflected by which of the following statements? A) The production of AFP remains the same through life. B) The production of AFP increases rapidly at birth and healthy adults and children have negligible or undetectable levels in serum. C) The production of AFP declines rapidly at birth and healthy adults and children have higher than normal levels in serum. D) The production of AFP declines rapidly at birth and healthy adults and children have negligible or undetectable levels in serum.

Answer: D 16) The combination of squamous cell carcinoma antigen (SCCA) and CYFRA 21-1 test results can be used to provide reliable laboratory data for the differential diagnosis of which disease? A) Nonsquamous cell lung carcinoma B) Pancreatic cancer C) Liver cancer D) Pulmonary embolism Answer: A

3 ..

17) A new test for breast cancer is found to have a sensitivity of 85.0% and a specificity of 90.0%. If the prevalence of breast cancer is 3.5% in women over 45 years old, what is the predictive value of a positive test result (PV+) in this group? A) 60.0 B) 50.5 C) 30.0 D) 23.6 Answer: D 18) Nuclear matrix protein-22 (NMP) is a tumor marker designed for what purpose?

A) Test for recurrence of bladder cancer B) Test for recurrence of lung cancer C) Test for recurrence of bone cancer D) Test for recurrence of colorectal cancer Answer: A 19) Which molecular form(s) is/are measured by an intact β-hCG assay?

A) hCG core and "nicked" hCG or hCGn B) The whole molecule C) Only "nicked" hCG or hCGn D) α-hCG and free β-hCG subunits Answer: B 20) Diagnostic specificity is defined as which of the following?

A) The probability that a laboratory test will be positive in the absence of disease B) The probability that a laboratory test will be negative in the absence of disease C) A measure of how often the assay system detects the biomarker when the disease is present

D) The probability that a disease is present when the test is positive or that a disease is absent when a test is negative Answer: B

4 ..

Clinical Laboratory Chemistry, 2e(Sunheimer) Chapter 25 Geriatrics 1) The aging kidney can be described as having: A) a deceased number of nephrons.

B) an overall increase in the amount of kidney tissue.

C) increased diluting capacity.

D) increased renal blood flow.

Answer: A 2) Conditions linked to age-related bone loss include all of the following EXCEPT: A) malabsorption B) alcohol abuse C) hypoparathyroidism D) inactivity Answer: C 3) Which of the following is a biological marker of sarcopenia?

A) AST B) Serum albumin C) Vitamin E D) CK Answer: B 4) Somatopause is associated with a decreased secretion of: A) Growth hormone B) Thyroid hormone C) Epinephrine D) Aldosterone Answer: A 5) Which of the following hormones may be decreased in the geriatric population?

A) TSH B) Follicle-stimulating hormone C) Testosterone D) Luteinizing hormone Answer: C 6) The following analytes decrease with age EXCEPT: A) Total protein B) Creatinine clearance C) Total cholesterol D) Albumin Answer: C

1 ..

7) All of the following are physiological variables affecting geriatric patients EXCEPT: A) Age B) Sex C) Medications D) Physical activity Answer: C

2 ..

Clinical Laboratory Chemistry, 2e(Sunheimer) Chapter 26 Pediatrics 1) The sweat chloride test is designed to: A) evaluation patients with possible renal disease. B) evaluation of patients with possible cystic fibrosis (CF). C) evaluation of patients with urinary tract infection D) evaluation of patients with acute pancreatitis. Answer: B 2) Which of the following genes is located on chromosome 7 and encodes a chloride channel of the same name that's on the surface of specialize cells throughout the body? A) CFTR B) BRAC1 C) CRC D) UBE3A Answer: A 3) Which of the following is a disorder in which a bronchus or bronchi remains dilated after an infection or obstruction? A) Pulmonary stenosis B) Pulmonary embolism C) Bronchiectasis D) Bronchitis Answer: C 4) Energy density is defined as: A) The amount of energy used during an infant's digestion of carbohydrates. B) The amount of energy stored from the conversion of ATP to ADP during the citrus acid cycle. C) The amount of energy required to energize one mole of substrate to form activated complex. D) The concentrated form of metabolic energy storage in food "stuff." Answer: D 5) Which of the following is a biomarker of Alkaptonuria? A) Branched-chain amino acids B) Homogentisic acid C) Tyrosine D) Phenylalanine phenylpyruvic Answer: B 6) Children with untreated phenylketonuria (PKU) may develop: A) Ochronosis. B) Ectopia lentis. C) Mental retardation. D) Corneal ulcers. Answer: C

1 ..

7) Which of the following enzymes is deficient in patients with maple syrup urine disease? A) Tyrosine aminotransferase B) Branched chain ketoacid dehydrogenase C) 4hydroxyphenylpyruvate dioxygenase D) Homogentisic dioxygenase Answer: B 8) Which of the following specimen requirements is correct for blood lactic and pyruvic acid testing? A) Specimen should be collected in a plain red top tube and sent to the lab at room temperature).

B) Specimen should be collected in a lavender top tube. C) Specimen should be collected using a tourniquet and transported at room temperature. D) Specimen should be collected without a tourniquet, transported on ice and analyzed immediately. Answer: D 9) Which of the following disorders is exhibited by a parent who does harm to their child? A) Munchausen syndrome by proxy B) Cushing's syndrome C) Syndrome X D) Toxic shock syndrome Answer: A 10) Currently, the Centers for Disease Control and Prevention (CDC) identifies children with lead levels above what level, as having an elevated lead level and requires further investigation? A) 20 µg/dL B) 15 µg/dL C) 10 µg/dL D) 5 µg/dL Answer: D

2 ..