The Oculus: U21 Shanghai

Universitas 21 is an international network of twenty-three leading research-intensive universities in fifteen countries. Collectively, its members enroll over 830,000 students, employ over 145,000 staff, and have nearly 2.5 million alumni. The network’s purpose is to facilitate collaboration and cooperation between the member universities and to create opportunities for them on a scale that none would be able to achieve operating independently or through traditional bilateral alliances.

Each year, a member institution hosts the Universitas 21 Undergraduate Research Conference. Fudan University in Shanghai, China, hosted the seventh annual conference, organized with the theme of “Share Your Inspirations,” from July 13th to 18th, 2011. The University of Virginia’s student-run research journal, The Oculus, has the privilege of publishing research papers presented at the annual U21 undergraduate research conference.

For more information regarding Universitas 21, visit www.universitas21.com.

The Oculus Co-Editors-in-Chief: Jessleen Kanwal and David Wu Layout Editors: Sarah Smith and Jason Ya Cover Designer: Michelle Choi University of Virginia Charlottesville, Virginia United States of America

U

ni ndergr v eraduate sita s 21 Research Conference: Shanghai U Table of ConTenTs

(1)

Awareness of Equality - Does it Matter?

Linn Alenius Wallin, Lund University

(6)

Visual Numerosity: Combining Behavioral, Computational, and Neural Data Dayan Garmaev-Randalon, Amsterdam University College, University of Amsterdam

(13)

Child Focused Asset Mapping in Tamaki, New Zealand Rebecca Allenby, University of Auckland

(19)

Is the Extension of Control a Blessing or a Curse to China’s Family-controlled Listed Companies?

Ailin Dong, Fudan University

(24)

Pulse Electroplating of Wear and Oxidation Resistant Ni-Cr-Y2O3 Nano-Composite Coatings

Robert Hoye, Weiwei Chen, Wei Gao, University of Auckland

(32)

Calculating the Partial Molar Volume: A Molecular Dynamics Approach Alistair Martin, University of Edinburgh

(37)

Pyrolysis of Plastic Materials for the Production of Fuel in a Batch Reactor Niancin W. Miao, University of Auckland

(40)

Unraveling the Secrets of Neuronal Friendship: The Role of EphA4 Expression in Network Activity and Spine Maturation Jessleen K. Kanwal, University of Virginia

(45)

Metallothionein Gene Dose and the Immune Response Meaghan Roy-O’Reilly, University of Connecticut

(48)

Spatial-Temporal Gait Template and its Application in Gait Recognition Chen Wang, Fudan University

(53)

Improving Treatment Strategies for Glioblastoma Multiforme: The Effect of Oxygen Preconditioning on the Vulnerability of Hypoxic Glioma Cells to Radiotherapy Shayan Moosa, University of Virginia

(59)

Randomised Response Method: Is it a More Effective Survey Technique?

Cissy Zhang, University of New South Wales

(62)

The Effect of Cue Consistency and Motivation on Detection of Non-Verbal Deception Chun Tao, Fudan University

(69)

Matrix Isolation Spectroscopic and Theoretical Study of Water Absorption and Hydrolysis on Molecular Vanadium Oxides Jia Zhuang, Fudan University

(77)

Molecular Study of Atnye1 And Atnye2 in Arabidopsis: An Insight into the Pathway of Chlorophyll Degradation Jiwen Xin, Fudan University

(81)

Resilience of Households: Evidence from Flooding in Bangladesh Tanvir Ahmed Uddin, Alicia Qian, University of New South Wales

(92)

Budget Support & Coordination Problems of Foreign Aid Overlaps and Aid Predictability Louise Lorentzon, Lund University

U21 Undergraduate Research Conference: Shanghai 2011 List of Participants Fudan University Yu Zhang Ying Zhu Jia Zhuang* Jiwen Xin* Chun Tao* Chen Wang* Ailin Dong* Lund University Linn Alenius Wallin* Louise Lorentzon* McGill University Jean-Benoit Lalanne3 Frank Kachanoff National University of Singapore Yu Tian Goh Danny Quah Kien Chuan Chua4 Shanghai Jiao Tong University Yuqian Jiang Lin Tian Sikang Liu University of Edinburgh Alistair Martin* Devin Dunseith Anna Muszkiewicz University of Amsterdam De Lu Anne van Els Dayan Garmaev* University of Auckland Rebecca Allenby* William (Niancen) Miao* Robert Lianqi Zhao Hoye*

*Author’s publication featured in this journal 1 Best Oral Presentation 2 Most Imaginative Oral Presentation 3 Best Poster 4 Most Imaginative Poster

University of British Columbia Meghan Dutot April Dutheil Jessica Baker University of Connecticut Ethan Butler Dayton Horvath Meaghan Anne Roy-O’Reilly* University of Glasgow Craig Anderson Matt von Ferscht-Fountain2 University of Melbourne Xingjian Lai John Teng Ong Yek Monika Raniti University of New South Wales Cissy Zhang* Tanvir Ahmed Uddin* University of Nottingham Tarana Fazel Mark Stevenson University of Queensland Lauren Goldspink Daniel Madden Caitlin Prouatt Byron Hewson University of Virginia Jessleen Kanwal1* Shayan Moosa* Sarah Triolo Waseda University Nina Shimono Yuki Tokushige Aki Arai

The Oculus: Proceedings of the U21 UndergradUate research conference

Awareness of Equality – Does it Matter?

Linn Alenius Wallin Lund University

absTraCT

This essay investigates whether increased knowledge about gender equality, diversity and discrimination, leads to changes in attitude, and willingness to give equality work higher priority. The essay studies municipality managers’ attitudes towards gender equality work before and after they participated at an equality education day.

A questionnaire about the equality work in the municipality was sent out to the administrative managers before the education day, and thereafter followed up by interviews. This study builds upon intersectional theory and uses interviews to research the following issues: what the managers perceive as, and include in, their social concept of equality; how they advocate their own role in equality work; and, if the education day in some way influenced their willingness to work with equality within the municipality.

I found that equality is understood as equality between sexes and even included equality connected with ethnic diversity. The preponderance of administrative managers’ view of equality was based on a heteronormative dualistic view of gender and of the sexes. The complementary dualistic understanding of gender is often associated with a similar complementary view in relation to ethnicity. Instead of focusing upon anti-discrimination and social justice, these managers tended to see diversity as a positive way of “pleasantly spicing up” the work place. The equality education day seem to have made an influence on the attitudes among the administrative managers, both in sense of being aware of their own prejudices, and also by giving equality issues a higher priority in the municipality work procedure.

InTroduCTIon

S

weden is internationally renowned as a country that has worked to create a just society by combating discrimination, and is especially recognized for its efforts to gender equality.

A central aspect of social justice is combating discrimination at the workplace. According to the Swedish legislation around gender equality, every workplace with more than 25 employees shall have a formal written equality plan. The goal of these equality plans is to promote (gender) equality and to work against stereotypes and biases. This law makes clear that discrimination on especially seven specific grounds - sex/gender, sexual orientation, ethnicity, religion, gender transgression (identity or expression), disability and age - is particularly important to address.

I wanted to investigate how this law works in practice, what happens with these documents – do they make any difference? So to take my questions into the field I contacted the municipality of a medium sized town in the south of Sweden, Landskrona. The city was just to begin a new equality project with the intention to educate the Managers and Directors in the municipality.1 As the beginning of more extensive efforts at equality work in the city, and thus the representatives were happy to let me in to their project. As a first step of the investment of resources into equality, diversity and equal treatment, the Management Team (the ten municipality leaders) and representatives from the unions were to participate on an equality education 1 Henceforth referred to as the Management team, or the Municipal Managers.

day. This day was meant to be an eye-opener for the leaders, to promote a greater understanding of the importance of active equality work and to increase awareness of the municipal leaders own importance for the success of this work.

The city has about 40 000 inhabitants, and more than 25 percent of those have background from countries outside Sweden. The city struggles with problems like high unemployment, xenophobia and social exclusion.

PurPose and researCh QuesTIons

My purpose was to investigate whether increased knowledge about gender equality also creates a desire for change, and an increased commitment to gender equality. How does the legislation actually work in practice? Do the Municipal Managers use their Plan of Equality? In what way have the knowledge affected the willingness to work with equality?

The Main Research Questions of the Study:

What do the Municipal Managers include in their concept of equality?

In what way have the willingness to work with gender equality been affected by the knowledge gained during the equality education day?

How do the Municipal Managers perceive their own role in and for the equality work?

This investigation only researched the leaders’ attitudes a short time after the education day.

Previous research has shown that a problem with this kind of investments is that initially there may be a marked increase understanding and willingness to

1

2 work with problems that was hidden before, but that those questions soon disappear from the agenda and there tends to be a reversion of the previous regime.2

MeThods and eThICs

I created a questionnaire to the Municipal Managers to fill in before the Equality Education Day. The questions focused upon how they use their current plan of equality, what kind of their approach to the equality work they had, if they wanted to change their working methods with regard to equality in any way, and what barriers they indicate existed for a successful gender work.

Questionnaires are useful when one wants to capture attitudes without affecting the respondents, which is more likely to happen in an interview situation. Besides, questionnaires do also hold the advantage that the questions are presented in the same way for everyone in the study, and contribute to answering the questions without stress.3 After the equality education day, I interviewed the ten managers individually, and at the same time gave them back their own questionnaires, so they could explain, and talk about, their previous answers.

This process gave the respondents an opportunity to modify their answer, which I mean partly removes the imbalance of power of interpretation between the researcher and the respondent, since the respondent have a more active dialogic role in the process.4 I did also participate on the Equality Education Day, as a participant observer but have chosen to not include this observation into the analysis, since my purpose was to investigate possible attitude changes of the day, and not the Equality Education Day itself.

Although I thought that it was important for the study to know the discussions from the education day. Besides, this participation gave me and the informants a common input, as a shared experience, which was good for the interview.

Like all researchers I am part of what is discussed and what comes up doing the interview.

My estimological point of view is that the results and answers produced in research are also influenced by the researcher and by the researchers situated knowledge.5 As being a white, young, female researcher with a background in the field of Gender studies, my results might be different from someone with another background or connection to the field.

To remain humble in relation to the respondents’ knowledge and experience is also an important ethical aspect of doing research.6 2 Abrahamsson 2000, Sundin 2002, Angervall 2005, Roth 2008.

3 Ejlertsson 2005 4 Both the researcher and the respondent learn from the interview situation, which can be called to have a “dialogical relation to the field” Czarniawska 2005:18.

5 according to eg. Haraway 1991, Sandell, 2005.

6 Mulinari 2005:115

One of the challenges of interviewing people in positions of power is that they often are unaware of how they view themselves as normal and how they view normalcy as desirable. People in positions of power are not often been subjected to any friction with the norms about what is “normal”. They often represent the unspoken assumptions of normality, and may need to gain awareness of their privileged position.7

InTerseCTIonal Theory

“An intersectional perspective raises questions about how power and inequality are woven into the social concept of whiteness, masculinity, gender, heterosexuality, class etc. by a constant (re)creation of new markers that makes the difference between “us” and “them” to social codes.” 8

In the equality work at the municipality, a broader concept of equality was sought. This worked very well with my intention to use intersectional theory. Intersectional theory is a theory developed in gender studies which addresses multiple forms of discrimination, identity and power structures. These may include gender, “race”, ethnicity, age, class, sexuality and disability. This theory encourages a complex analysis and attempts to avoid reducing people to simple categories.

A paradox in gender mainstreaming and equality work lies in this complexity; how can gendered power structures be changed without reproducing stereotypical ideas about sex and gender.9 There are two main problems in this paradox: first, to focus upon difference and at the same time emphasize that there is no difference between women and men and they are equally competent, and, secondly, that the achievement of equality will take place within already existing norms, in this way the gender dichotomy is recreated in the equality announcement.10 Another issue, highlighted by several researchers, is the ignorance of the inbuilt inequality within the existing organizational structures themselves.11 12

analysIs

In this analysis, my purpose is to answer the question about what effect the Equality Education Day has on the management team members 7 For instances, heterosexual people may not be aware of the privilege and protected positions they inhabit in relation to homosexuals ,who may be questioned and experience discrimination.

8 De los Reyes & Mulinari 2005:9 translations by me.

9 Scott 1996 10 Scott 1996 11 Eriksson & Eriksson 2000, Wahl et al. 2000, Eduards 2002, Holgersson 2003 12 This is a simplification of a rather complex argument from Joan Scott and Judith Butler.

The Oculus: Proceedings of the U21 UndergradUate research conference attitudes to gender equality; what do the Municipal Managers mean with equality, what do they include in “the equality concept” after the participation, and how do they picture their own role in equality work.

What is Equality?

The gender equality work of Landskrona city, stresses the importance of a strong perspective on diversity. When the respondents talk about equality, they do most frequently mention only sex/gender and ethnicity. There is a strong desire that it should be equal, sexual orientation or ethnicity should not be reason for open discrimination. Yet it seems that the lack of insights about how discrimination occurs, and what forms discrimination takes, as well as how hegemonic norms about normalcy insult and injury people. It is not enough, I mean, to note that one do not have anything against a mixed personnel group, there need to be more insights about what it means to the individuals. I could see a tendency of placing the problem with exclusion to the ones who are excluded. One of the interview subjects said for example, when we talked about recruitment, that one of the applicants “almost screamed out that she wanted to be discriminated” by placing too much emphasis on her non-heterosexual orientation. (I will return to this statement later.)

There is an apparent desire for integration, but the hegemonic norm is still omnipresent, there is no doubt about which ones are “the others”, what is considered as normal or adverse, and that those “others” are interpreted differently. But the picture is ambiguous, some of the informants could identify both their own role for successful implementation, as well as structures that might obstruct.

Other examples of what the informants meant by equality are the attitude to gender mixed groups.

To have a mixed group is seen as good and desirable, the managers indicate that the mood and behavior of the employees becomes better in mixed groups, one of the informants meant that the same applies to groups of mixed ethnicity: “If there is someone in the team coming from somewhere else it will often be, like, better. It’s the same with gender-mix (…) again, you get another conversation.”

Those attitudes, or opinions, that women and men considered to possess different skills, where the female role is as a complement to the male and to create comfort, has been described by other researchers.13 The belief that men and women performs better together is another usual opinion.14 In my study, the informants also use this additive assumption when it comes to ethnicity, to hold 13 Cockburn 1991, Scott 1996, Eriksson & Eriksson 2000 et. al.

14 Dahl 2005

another ethnicity than Swedish are seen as carrying other competences and experiences than Swedish people. This may of course be interpreted positively, but in terms of gender equality work, there lies a paradox in the assumption to notion women, or in this case ethnicity, as something special, something that could and should offer something over and above the usual. This way of thinking tends to recreate the categories as opposite and essential. Women are supposed to be different and complementary to man, and the same idea of complementary is applied to people with another ethnicity than Swedish.15

The Own Role

Many of the participants talked a lot about their own role for the result of equality implementation, they saw themselves mostly as a good example for other bosses on lower positions, and they meant that “if I show that this is important, others will came after and understand that it is important”. Some of them also speak about their own genuine interests in equality work.

As regards the recruitment processing, one of the informants talked about both the problem with preconceptions within management, but in the same discussion that “when it comes to recruitment it is not about sex or ages or if you have migrant background, then it is the competence”. In this quote there is an assumption of a neutral competence which I will question. If the management holds opinions which are homophobic, xenophobic and sexist, as the informant said, these opinions may influence their ability to make neutral judgments. And it may be naïve to assume that prejudice towards these individuals does not affect the recruitment process.

Some of the informants were able to see the importance of recognition of the societal racism and sexism to permit a response, and put demands, on the employees to not let their discriminatory opinions influence their work practices. Yet, previous research has shown that it often is difficult for the recruiters to see e.g. women as possible candidates for recruitment to higher positions, and this research indicates that discriminatory attitudes do influence the recruitment process.16 This research shows the same pattern about ethnicity; the recruiters do not recognize any possible candidates and therefore they think of those as non-existent.

One of the informants told me that sexuality was always left out from discussion in their management. This informant said that as far as the informant knew there were not any openly homosexuals in that management area “and of course it must be with over 200 employees”. The same informant did also meant that “when I sad that it works very well with the migrants we have in our management – I do not know how they feel, I cannot know.” This informant 15 Compare with Scott 1996, Butler 1999 16 Angerwall 2005, Holgersson 2004, Roth 2008, Wahl et al. 2001, Eduards 2002, Wahl 1994, Acker 1991

3

4 does have insights about their own privilege position, in relation to the previous informant that quote about the jobseeker who was too open about her homosexuality. The privileged position many of the informants hold implies that they do not question the power imbalance that lies in their right to define other as “alright”, even though those others are homosexual or migrant. In this implicit even though, lies mountains of normative valuations.

Again, there is a great willingness to work with equality but the lack of knowledge remains. In some cases one can see a discrepancy between the power this people hold, and the sense of powerless they express.

The Desire For Change?

Generally, a majority of the participant consider the Equality Education Day as a good kick-off for the municipality equality work. Many of them seem to be positive to the equality work and most of them talked about the day as an inspiring eye-opener. The equality day has contributed to two main changes; first, to the realization that the managers themselves embrace prejudices and, second, to the recognition that the equality work has to be more central in the organization than before. Most of the managers ask for a consistent shared approach, and continuity in the municipality for the equality work. This is a positive change from the previous “only when necessary” practice. As new insights the managers also mentioned things as they shall react when people make insulting statement, and the necessary of protect minority groups. Some of them mentioned that it can be uncomfortable to work with equality and preconception but that, as a manager, you must have the courage to take hold of the discussions on expected differences and racist/sexist attitudes.

Before the Equality Education Day, most of the managers thought about the written equality plan as enough, but after the participation they wanted to work more with equality and also saw the importance of the work, which seems good for implementation. The required method most of the participants mention is as a form of gender mainstreaming, where the equality work shall get in to every part of the organization, this gives hope of well spread equality knowledge. Yet the social scientist Nira Yuval-Davis has shown that there is a large risk of gender mainstreaming in that the question never gets its own space or economy.17 One of the informants pointed out the work as important “as long as it not takes time or money from something more necessary”. This statement illustrates exactly that risk Yuval-Davies alleged.

Another manager did also mention that “it (the equality) must not be exaggerated”. Those informants want a reasonably equality framed by already existed hegemony. In organizations there are not only different cultures, but also different 17 Yuval-Davies 2005

ideas about which changes that are desirable.18 One aspect of the equality issue is especially evident – to eradicate unfair differences in pay, does not only imply that marginalized groups should have better conditions, but also that other groups have to give up some of their privileges. The fact that increased awareness not always lead to changes is already known.19 As Nira Yuval-Davis, I can see that the equality issue need its own time and budget in this municipal equality work to get successful.

ConClusIon

While some of the informants seems to be wellinformed and also have the capacity to bring equality into the own management, is there uncertainty with others. In many of the interviews reproduces the picture of “the other”, and knowledge about norms and implicit discrimination still remains incomplete.

Together with a naïve faith in individual perspective and neutral criteria (in recruitment and in meeting with clients) those “others” (im)possibilities in the organization makes invisible.

For the City of Landskrona I establish that this Equality Education Day has served its aim: to place the equality issues on the already full agenda of the municipality managers. This day has been an eye-opener to many even if a lot of work remains. Those who already struggle for gender equality have gained support for giving equality work higher priority, and their invisible work has in some extent been vindicated. The positive attitudes the informants expressed in most cases seem promising, but to achieve sustainable change need long-term work to be continued.

Addendum

After this thesis was done, the city managers team used it as the basis for successful application for a governmental grant funding work for equality and against discrimination at work.

aCknowledgMenTs

I want to thank Professor Tiina Rosenberg, Professor Diana Mulinari, Lecturer Sara Goodman, Assistant Professor Malena Gustavsson, and my supervisor Assistant Professor Irene Pelayo. Without the support, interest and great insights from all of you, this work would never come into existence! Thanks also to the participants of this study, the Municipal Managers, and to my principals, the Personnel Manager and the PA-consultant of Landskrona.

18 Sundin 2002 19 Eduards 2002, Andersson 1994, for example; when changes in the order of gender hierarchy get too emotionally exhausting for those who should surrender privileges, the struggles for rationality reinterpreted in favor to the emotional rationality, and a return of the previous regime. Sundin 2002, compare to Abrahamsson 2000.

The Oculus: Proceedings of the U21 UndergradUate research conference referenCes

1. Abrahamson Lena (2000) Att återställa ordningen.

Könsmönster och förändring i arbetsorganisationer.

Umeå: Boréa.

2. Andersson, Bengt-Erik (1994) Som man frågar får man svar – en introduktion i intervju och enkätteknik.

Göteborg: Prisma ePan. 3. Angervall, Petra (2005) Jämställdhetsarbetets pedagogik: dilemman och paradoxer i arbetet med jämställdhet på ett företag och ett universitet. Diss.

Göteborg: Göteborgs universitet.

4. Butler, Judith (1999) Gender trouble: feminism and the subversion of identity. New York: Routledge.

Cop. 5. Butler, Judith (1993) Bodies that matter: on the discursive limits of “sex”. New York: Routledge.

6. Cockburn, Cynthia (1991) In the way of woman.

Men´s resistance to sex equality in organizations.

Basingstoke: Macmillan.

7. Czarniawska, Barbara (2005) ”Studying up, studying down, studying sideways: om ett dialogiskt förhållande till fältet”. I Lundqvist, Davies, Mulinari (red.) Att utmana vetandets gränser. Malmö: Liber. pp18-30.

8. Dahl, Ulrika (2005) ”Scener ur ett äktenskap: Jämställdhet och heteronormativitet” i: Don Kulick (red.) Queersverige, Stockholm: Natur & Kultur. pp48-71.

9. De los Reyes, Paulina (2004) ”Det problematiska systerskapet: om ´svenskhet´ och ´invandrarskap´ inom svensk genushistorisk forskning” i, Jansdotter, Anna(Red.) & Christina Carlsson Wettergren. Genushistoria: en historiografisk exposé.

Lund: Studentlitteratur. pp189-207.

10. De los Reyes, Paulina & Diana Mulinari (2005) Intersektionalitet: Kritiska reflektioner över (o) jämlikhetens landskap. Malmö: Liber.

11. Eduards, Maud (2002) Förbjuden handling. Om kvinnors organisering och feministisk teori. Malmö: Liber.

12. Ejlertsson, Göran (2005) Enkäten i praktiken. En handbok i enkätmetodik. Malmö; Studentlitteratur.

13. Eriksson, Kristina & Maria Eriksson (2002) ”Kön har ingen betydelse men könsblandning är bra: könsgörande i två professionella sammanhang” i, KVT nr. 1: 2002 pp53-72.

14. Haraway, Donna Jeanne (1991) Simians, Cyborgs, and Women: the reinvention of nature. London: Free Association Books.

15. Holgerssons Charlotte (2004) Rekrytering av företagsledare - en studie i homosocialitet. Stockholm: Elanders Gotab€.

16. Mulinari, Diana (2005) ”Forskarens biografi och situerad kunskapsproduktion” i, Lundqvist, Davies, Mulinari (red.) Att utmana vetandets gränser. Malmö: Liber. pp113-133.

17. Roth, Ann-Katrin (2008) Mångfaldsboken: från teori till praktik. Stockholm: Norstedts Juridik.

18. Sandell, Kerstin (2005) ”Enkla tekniker och besvärliga frågor: att arbeta med Donna Haraway” i, Lundqvist, Davies, Mulinari (red.)

Att utmana vetandets gränser. Malmö: Liber. pp7590.

19. Schömer, Ewa (2003) ”Jämställdhetens dilemman” i, Mulinari, Sandell & Schömer (red.)

Mer än bara kvinnor och män. Feministiska perspektiv på genus. Studentlitteratur : Lund. pp89 - 117.

20. Scott, Joan Wallach (1996) Only paradoxes to offer: French feminists and the rights of man. Cambridge, Mass.: Harvard Univ. Press.

21. Sundin, Elisabeth (2002) ”Rationalitet som norm och hyckleri som praktik: reflektioner kring betydelsen av organisationers genusordningar”, i KVT nr. 1:2002 pp21- 36.

22. Wahl, Anna et al. (2001) Det ordnar sig. Teorier om organisation och kön. Lund: studentlitteratur.

23. Yuval-Davies, Nira (2005) ”Gender mainstreaming och intersektionalitet”, i KVT nr.

2-3: 2005 pp19 – 30.

5

6

Visual Numerosity: Combining Behavioral, Computational, and Neural Data Dayan Garmaev-Randalon

Amsterdam University College, University of Amsterdam

absTraCT

The methodology of exploring the concept of numerosity is dominated by studies which use only artificial stimuli. That “tradition” presents a limited perspective. Status of numerosity as a basic visual property is thus a matter of argument. The current study introduces a more comprehensive research combining different types of data collected for natural stimuli. Computational element of applying natural image statistics to the problem of numerosity provides with a lacking consideration of essential mathematical mechanisms of processing numerosity in the human brain. The two aspects of numerosity—“basicness” of numerosity per se, and the subitizing-counting distinction—are addressed in this study. Natural image statistics seems to play an important role in enumeration. It can also in principle explain the origins of difference between subitizing and counting. Based on the comparative analysis of behavioral, computational, and neural data, the study suggests that numerosity is likely to be reckoned as a basic property with some reservations.

InTroduCTIon

N

umerosity is a property of a scene to contain a relative or absolute number of distinct objects.

The concept of numerosity has two major aspects.

The first is whether the ability of human brain to estimate numerosity in general (i.e. enumeration) is a basic independent visual property (such as color, orientation, density, etc.) being processed at early stages in low-level neural structures. The second aspect is whether enumeration encompasses two different processes—subitizing and counting, each being independent from another to a certain extent.

Both aspects are subject of much debate. The phenomenon of numerosity adaptation was taken as a point in favor of the theory that numerosity is an independent visual property (Burr & Ross, 2008).

The authors exposed artificial stimuli to subjects asking them to estimate the number of dots present in images as more or less relative to a given value.

For control, authors varied not only the number of the dots but also their contrast and orientation.

Behavioral tests showed that the degree of adaptation is much higher only in case of varied number of objects so that numerosity is invariant to contrast and orientation. That study received certain criticism.

One criticism came from (Butterworth, 2008) saying that the authors did not offer any explanation of how the brain can approximate numerosity at lower levels without referring to other basic properties. What computational mechanism underlies abstraction of numerosity from the scene? The consequent question would be: where such mechanism may reside in the brain? While not answering the former, the authors proposed intraparietal sulcus as a candidate structure without giving strong evidence to it. Another criticism came from (Durgin, 2008) claiming that the authors did not prove independence of numerosity from texture density. According to him, much of the observed numerosity adaptation was explained by

more basic texture density adaptation. The former criticism was addressed by (Ross & Burr, 2010) to undermine the role of texture density in enumeration.

The second aspect of numerosity is a hypothetical dichotomy between subitizing—instant perception of numerosity value, and counting— slow perception, respectively (Piazza, Mechelli, Butterworth, & Price, 2002). According to this theory, numbers from 1 to 4 are processed differently than those from 5 to 9 and more, for instance. Previous research indicated significant difference in reaction time (RT) for two numerosity clusters. The authors performed positron emission tomography (PET) experiments and concluded that it cannot be inferred that the two clusters of numerosity values (N) are processed in different neural structures, although counting showed increased activity in occipitoparietal network if compared to subitizing.

All these numerosity studies used only simplistic artificial stimuli in their experimental setup. This fact itself might introduce a bias considering that primate brain evolved in the natural environment, and hence it is likely to be tuned especially to natural stimuli. Rather than just looking at points of subjective equality (PSE) between fixed and variable stimuli grasped in behavioral tests (Burr & Ross, 2008), RTs, and PET patterns separately, I decided to use natural stimuli in this study, and combine behavioral, computational, and neural data.

Natural scenes are regular in their statistics.

For instance, it was observed that such very crucial attribute of a scene as contrast; in particular the distribution of sums over its correlated values follows a Weibull distribution of the form: where c is a constant and μ can be normalized out to achieve illumination invariance (Geusebroek & Smeulders, 2002). The two remaining handy

The Oculus: Proceedings of the U21 UndergradUate research conference

Figure 1. Examples of visual stimuli used in numerosity research. (a) A typical artificial stimulus with dots used in (Ross and Burr, 2010) experiment. (b) A sample natural image used in my behavioral experiment, EEG experiments and computer analysis in (Scholte, Ghebreab, Waldrop, Smeulders, & Lamme, 2009).

Figure 2. From (Scholte, Ghebreab, Waldrop, Smeulders, & Lamme, 2009). (a) Three distinct natural images with profoundly different visual appearance as reflected in their beta and gamma values and an example of an artificial image. The images have contrast distributions that deform from power law (eagle, first row), through Weibull (street, middle row) to Gaussian (grass, third row; but note that power law and Gaussian are special instances of the Weibull distribution). The artificial image (fourth row) has a contrast distribution that deviates from the Weibull distribution. (b) The beta and gamma values are estimated from the gradient magnitudes of each of these images.

The gradient images are derived by filtering the images twice with differently oriented (90° difference) first-order directional Gaussian derivative filters and combining in the following way: the gradient magnitude image. (d) A Weibull function is fitted to the contrast histogram (maximum likelihood) to approximate the beta and gamma parameters with a maximum likelihood fit.

Figure 3. From (Scholte, Ghebreab, Waldrop, Smeulders, & Lamme, 2009). (a) Mapping of a subset of images onto the space. An image’s position is fixed by and values. The axis from bottom left to top right shows an increase in image cluttering and a decrease in figure-ground segmentation. The axis going from top left to bottom right shows a change from images with dissimilar textures to images with similar textures. (b) The values of beta and gamma with their corresponding JPEG compression factor.

Both beta and gamma capture different parts of the complexity of an image as encoded by the JPEG algorithm.

7

8 characteristics of this distribution are (beta) and (gamma). Beta and gamma strongly correlate with event-related potential (ERP) brain responses when processing same natural images (Scholte, Ghebreab, Waldrop, Smeulders, & Lamme, 2009).

All natural images, as shown in Figure 2, follow a Weibull distribution-like shape. At the same time artificial stimuli are essentially different from various natural images in their statistical structure (on the example of contrast distribution). Thereby, the artificial image in the fourth row deviates from the Weibull distribution. In natural image statistics, value corresponds to the degree of contrast (see Figure 3, vertical axis). Thus, variation in is irrelevant (insensitive) for enumeration which provides with information about the whole scene. value, however, corresponds to the spatial degree of clutter on the whole scene (see Figure 3, horizontal axis). Therefore, it is expected that variation is directly connected to the variation of N in different natural scenes. Then, if subitizing-counting theory is true, sensitivity should be nonlinear or even discontinuous with a break point close to between [1, 4] and [5, n] of the N‘s range.

The study in (Ghebreab, Lamme, Scholte, & Smeulders, In submission) showed that neurons of lateral geniculate nucleus (LGN), simulated by using linear filters are likely to approximate and values whilst neurons of V1 layer of occipital visual lobe, simulated by nonlinear filters, performed a bit worse (Ghebreab & Scholte, 2011; Scholte & Ghebreab, 2011).

If the Weibull and approximation takes place in LGN indeed, it can also in principle estimate N. This offers a potential mechanism of rapid low-level scene classification in the brain. Perhaps, numerosity may be also explained by beta-gamma approximation because it (1) involves scene clutter; and (2) is associated especially with rapid visual processing given that RTs of subitizing numerosity values of the range [1, 4] are comparably as small as time intervals needed for beta-gamma approximation.

I suppose that Weibull parameters approximation in the early visual pathway may be involved with enumeration and subitizingcounting distinction. This hypothesis addresses the aforementioned aspects of numerosity in the following way. Potential correlation between values estimated in computer analysis and N values acquired in a behavioral experiment would indicate that numerosity in principle can be processed in the low-level vision, and thus it is likely to be a basic property of a natural scene. This addresses the first aspect of numerosity. An interesting objective peculiarity of parameter, that it is nonlinearly sensitive to the degree of clutter present in images with high difference in numerosity value, would be significant for subitizing-counting threshold determination. This addresses the second aspect of numerosity.

MaTerIals and MeThods

I used images from (Groen, Ghebreab, Lamme, & Scholte, 2010). The original set of visual stimuli consisted of 6800 natural images with a resolution of 640x480 pixels and a bit-depth of 24. Some of the images were target images (1600 animals, 1600 vehicles) and other were distractor images of natural landscapes, city scenes, indoor scenes, wide variety of man-made objects other than vehicles, etc.

In behavioral experiment 6800 images of the original set were presented at two scales: original scale with a resolution of 640x480 pixels, and small scale of 320x240 pixels. The reason for this was two introduce an additional dimension to the analysis.

Each image was exposed 4 times to different subjects (2 times in the original and 2 times in the small scale). A subset of 680 images were flashed on a 17’’ Samsung monitor with a resolution of 1024*768 pixels and a frame-rate of 100 Hz to each subject (40 subjects in total) sitting ca 70 cm from the monitor. An image was presented for 100 ms and then immediately replaced by a masking image. During the exposure of the masking image a subject was assigned to give an estimate of the number of objects present in the image flushed just before the current mask by pressing the corresponding key on the numeric pad. After the subject chose the numerosity value that way, she/he could press the ‘space’ key and with an interval of 1s the next stimulus was flashed.

The mask was a random Fourier phasescrambled image from the subset of 400 images of the original set of 6800. The numerosity values could be chosen from the following range of options: keys from ‘1’ to ‘9’ on the numeric pad for the corresponding N values, key ‘-’ for the category “no objects present,” and key ‘+’ for the category “too many objects present to identify the exact number.” Since there is no exact definition of an object in the natural environment, the subjects were given a freedom to decide themselves what can be considered an object.

EEG and computational Weibull statistics parameters estimation data were taken from the research by (Ghebreab, Lamme, Scholte, & Smeulders, In submission).

In the EEG experiment 6400 images of the original set were briefly flashed on a 19” Ilyama monitor with a resolution of 1024*768 pixels and a frame-rate of 100 Hz to 21 subjects sitting 90 cm from the monitor. Recordings were made with a Biosemi 52-channel Active Two EEG system (Biosemi Instrumentation BV, Amsterdam, The Netherlands).

Data was sampled at 256 Hz. Data preprocessing was identical to (Scholte, Ghebreab, Waldrop, Smeulders, & Lamme, 2009) with the exception that the high-pass filter was placed at 0.1 Hz (12 db/ octave) and the pre-stimulus baseline activity was taken between -100 and 0 ms with regard to stimulus onset. An image was presented on average every 1500 ms (range 1000-2000 ms) for 100 ms during

The Oculus: Proceedings of the U21 UndergradUate research conference

resulTs

The acquired behavioral data was reduced only to the images which have a definite numerosity value from 1 to 9. This was made because the ambiguity between the categories “no objects present” and “too many objects present to identify the exact number” introduced much noise in the data space.

In addition, it is not relevant for this study at all— in the time interval of 100 ms hardly anyone can determine whether she/he saw 10 or 11 objects. The remaining data was clustered by fitting Gaussian mixture distribution into the data space. This was done separately for two different image scales. Both fittings gave two cluster components each. The four component means from the two scale-specific fittings were averaged pair wise to estimate the centres of the final two clusters (c1 and c2). Respectively, the

four pairs of standard deviations resulted in the estimate of the final clusters’ boarders. The range of N values is limited and skewed to the left (i.e. to the low numerosity values). This is the reason the two computed clusters are overlapping and even more limited in their range (see Figure 4). Since this databased clustering covered only a part of the whole numerosity range, two compensative clusters (c3 and c4) were introduced additionally for further analysis.

The following two tables contain correlation coefficients (r) between images’ beta and gamma parameters obtained from the computer analysis and numerosity values obtained from the behavioral experiment. Beta and gamma were estimated with LGN and V1 cell computer simulation using Gaussian and Gabor filters, respectively (Ghebreab, Lamme, Scholte, & Smeulders, In submission; Ghebreab & Scholte, 2011; Scholte & Ghebreab, 2011).

In general, correlation coefficients are reasonably high. However, since the overall distribution is so much skewed to the left, for c1 and c2 it was not possible to estimate exact r, though it does not mean that there is no correlation there. This was especially crucial for parameter. In clusters c1 and c2 linear regression line is shaky around the mass center of the data cloud. Correlation therefore is present though clandestine.

By looking at visual representations of the correlation tables (Figures 4 and 5), it can be observed that both in LGN and V1 correlations (slope of the regression line) are more stable than those of which are stable in LGN (in absolute values for c3 and c4) but flatten as numerosity increases in V1.

Table 1. (see figure 5). Computational (LGN)-behavioural data correlations (r)

Table 2 (see figure 6). Computational (V1)-behavioral data correlations (r)

Table 3. (see figure 7). Computational (LGN)-ERP data correlations (r) for average scale

Table 4. (see figure 8). Computational (V1)-ERP data correlations (r) for average scale

EEG acquisition. EEG responses were averaged over subjects per individual stimulus, resulting in 6400 grand averages ERP responses. The average responses (ERPs) were converted to a Current Source Density (CSD) response to get a signal that is more localized in space than regular EEG. In the computer analysis all images were converted to grayscale images I( x, y) and subsequently convolved with first-order directional Gaussian derivative filters (in case of LGN cell-like) and Gabor filters (in case of V1 cell-like) to determine the beta and gamma parameters of the fitted Weibull function; for further details see (Ghebreab, Lamme, Scholte, & Smeulders, In submission; Ghebreab & Scholte, 2011; Scholte & Ghebreab, 2011).

9

10

Figure 4. Schematic representation of clustered behavioral data distribution where the relative percentage of total data space covered by clusters is shown along the vertical axis and numerosity values along the horizontal axis. Blue distribution is a computed cluster 1 with numerosity range [1, 2]. Red distribution is a computed cluster 2 with numerosity range [1, 6]. Additional clusters 3 with range [5, 9] and 4 with range [6, 9] were introduced to compensate the remaining computationally unclustered data points with high N.

Tables 3 and 4 show correlations between ERP and computational data both clustered according to the behavioral data (see the description of Figure 4). Both and are better correlated to the neural response in LGN than in V1. This is a consequence stronger ERP neural signals correlated to the output of linear image filters than to the one of nonlinear filters, shown shown in (Ghebreab, Lamme, Scholte, & Smeulders, In submission; Ghebreab & Scholte, 2011; Scholte & Ghebreab, 2011). As expected, variation with an increase of N (from c1 to c4) is negligible in both LGN and V1. However, the variation of as numerosity increases is much stronger in LGN than in V1. Thus, sensitivity for numerosity is two times higher in LGN than in V1 (72% and 37% increase in r from c1 to c4, respectively). One can also observe that variation is smaller between c1 and c2, & between c3 and c4, than the one between c2 and c3. In other words, is sensitive discontinuously, as hypothesized to address the subitizing-counting distinction.

Finally, the following Figures 7 and 8 give a glimpse of how basic parameters beta and gamma correspond to subjective numerosity estimate against neural response on a temporal span. The noisiness in

Figure 5. Correlations between and N in natural images (top row).

Correlations and N in natural images (bottom row). First column is for cluster 1, second for cluster 2, third for cluster 3, and fourth for cluster 4. and parameters are obtained with linear filter (LGN cell-like).

Figure 6. Correlations between and N in natural images (top row).

Correlations between and N in natural images (bottom row).

First column is for cluster 1, second for cluster 2, third for cluster 3, and fourth for cluster 4. and parameters are obtained with nonlinear filters (V1 cell-like).

The Oculus: Proceedings of the U21 UndergradUate research conference

Figure 7. Explained ERP variance in channel Oz by both , parameters obtained with linear filter (LGN cell-like) in bold blue, and explained ERP variance in all 52 channels by behavioral data in thin multicolor over the time of stimulus exposure in ms. Top left— for numerosity cluster 1, top right—for cluster 2, bottom left—for cluster 3, and bottom right—for cluster 4.

Figure 8. Explained ERP variance in channel Oz by both , parameters obtained with nonlinear filters (V1 cell-like) in bold blue, and explained ERP variance in all 52 channels by behavioral data in thin multicolor over the time of stimulus exposure in ms. Top left—for numerosity cluster 1, top right—for cluster 2, bottom left—for cluster 3, and bottom right—for cluster 4.

the pictures for N cluster 4 is caused by the relatively small data pool of this cluster if compared to other clusters. Curiously, in all circumstances N is peaking at the first concave of , (after their first and highest peak) ca 170 ms from stimulus onset.

dIsCussIon

By its nature, numerosity cannot be as basic as, for instance, color because it requires information from all individual points of the image combined.

However, this does not exclude a possibility that

numerosity is basic in a sense of its independence from texture density (Durgin, 2008) in particular or any other visual property in general.

My study is most likely exempt from confusing numerosity with those other visual properties because I used natural images with complex patterns of color, orientation, and texture density which have no direct correspondence to Weibull image statistics. The set of stimuli used in the above-described experiments was large and diverse enough not to introduce the selection bias. The skewed nature of the behavioral

11

12 data distribution (see Figure 4) itself indicates that in 100 ms people tend to determine only small numbers of objects. Reasonably high correlation coefficients of N with beta and gamma parameters (see Tables 1 and 2) allow speculating that enumeration is as basic as , approximation in LGN at least to some extent.

The extent of this basicness can be addressed with the following reasoning. The fact that is more stable than in both LGN and V1 (see Figures 5 and 6) indicates that is much more likely to play role in enumeration than . It is also confirmed by the dynamics of sensitivity (see Tables 3 and 4) which show that N of small clusters is more easily distinguished from the N of big clusters at the level of LGN. It may imply that the image is classified as “low N” or “high N” already in LGN rather than in V1 based solely on the approximation. Then, in V1 and on the recurrent way from intraparietal lobe back to V1, further, more specific, enumeration occurs (peaking at 170 ms) eventually resulting in object detection. This is represented by the delay between approximation of basic Weibull properties and enumeration (see Figures 7 and 8). This suggests that enumeration may start already at LGN and then peak on higher levels of vision.

Thus, it seems that threshold between “low N” and “high N” is used already at LGN. This is a “preenumeration” which occurs early but cannot fully explain the whole process of enumeration. Fair to mention, it seems that this early pre-enumeration is just sufficient enough to say what is going to happen next—subitizing or counting if one is pleased to make such distinction. The small RT for subitizing can be explained not by the difference in neural structures used by it compared to counting. Perhaps, it is about the exceptionally small range of N being subitized.

Say, after a very short stimulus onset, a subject would be comfortable to tell whether she/he saw “low N” (with 1 to 4 objects present) or “high N” (4 or more objects present) image. However, telling whether she/ he saw either 3 or 4 objects should be less comfortable, according to my reasoning. Nevertheless, because the range of subitizing consists of 4 or 5 elements only and the range of counting consists of infinite number of elements, it might be easier to tell whether it is 4 or 5 objects than 11 or 12. Pre-enumeration, thus is almost sufficient to determine N values within the range of subitizing.

This way of thinking does not contradict with previous studies of subitizing-counting theory.

As observed by (Piazza, Mechelli, Butterworth, & Price, 2002), PET study did not show evidence that subitizing occurs in different neural structures than counting. It showed that counting exploits more occipitoparietal network than subitizing does. This is exactly where explained ERP variance by N is peaking. N peaks, however, similarly for all clusters.

Enumeration in general is similar for subitizing and counting, but why there is a difference? Why then is it

exactly around 4 or 5 objects to be the threshold in RTs variation which gave rise to the subitizing-counting theory? Probably, it is caused by the limitedness or peculiarity of linear filters characterizing LGN cells to approximate parameter. Once an image was classified as “low N” in LGN, it can already give an approximation of definite N but the enumeration continues farther in higher levels of visual processing.

referenCes

1. Burr, D., & Ross, J. (2008). A visual sense of number. Current Biology, 18(6), 1-4.

2. Butterworth, B. (2008). Numerosity perception: how many speckles on the hen? Current Biology, 18(9), 288-289.

3. Durgin, F. H. (2008). Texture density adaptation and visual number revisited. Current Biology, 18(18), 855-856.

4. Geusebroek, J.M., & Smeulders, A. W. M. (2002).

A physical explanation for natural image statistics.

Paper presented at the 2nd International workshop on texture analysis and synthesis, Heriot-Watt University.

5. Ghebreab, S., Lamme, V. A. F., Scholte, H. S., & Smeulders, A. W. M. (In submission). Local spatial scale control in the precortical pathway.

6. Ghebreab, S., & Scholte, H. S. (2011). V1 responses suffice for rapid natural scene categorization. Paper presented at the 34th European Conference on Visual Perception.

7. Groen, I., Ghebreab, S., Lamme, V. A. F., & Scholte, H. S. (2010). The role of Weibull image statistics in rapid object detection in natural scenes. Journal of Vision, 10(7): 992.

8. Piazza, M., Mechelli, A., Butterworth, B., & Price, C. J. (2002). Are subitizing and counting implemented as separate of functionally overlapping processes? NeuroImage, 15, 435-446.

9. Ross, J., & Burr, D. (2010). Vision senses number directly. Journal of Vision, 10(2):10, 1-8.

10. Scholte, H. S., & Ghebreab, S. (2011). Summary statistics of model neural responses at different stages of the visual hierarchy. Paper presented at the 34th European Conference on Visual Perception.

11. Scholte, H. S., Ghebreab, S., Waldrop, L., Smeulders, A. W. M., & Lamme, V. A. F. (2009).

Brain responses strongly correlate with Weibull image statistics when processing natural images.

Journal of Vision, 9(4):29, 1-15.

The Oculus: Proceedings of the U21 UndergradUate research conference

Child Focused Asset Mapping in Tamaki, New Zealand Rebecca Allenby

University of Auckland

absTraCT

This research was conducted to examine the experiences of childhood in the Tamaki region of Auckland, New Zealand. In 2009, a 20 year urban renewal programme was initiated in Tamaki. This research aimed to highlight areas of focus regarding childhood in Tamaki to be used by both the regeneration project and the University of Auckland. The project used asset mapping to establish those neighbourhood assets that are of importance to Tamaki’s children and about which they should be consulted in the future. The asset mapping used three methods: networking, playground observations and child focus groups. Information gathered through these methods was used to create an inventory of organisations and resources of relevance to Tamaki’s children. Thirty-eight assets were identified including primary schools, public reserves and playgrounds, and after-school programmes. Cost, transport options, and perceived safety were the three key factors that were identified as affecting the utilisation of these assets. Overall recommendations generated from the project were that greater consultation with children is likely to be of benefit in Tamaki and better information pathways are needed to nullify the uncertainty that surrounds both the availability of assets and the safety of those assets.

InTroduCTIon

The Tamaki Transformation Programme (TTP): Why Tamaki?

T

amaki is an area in eastern Auckland comprising of the three suburbs of Glen Innes, Point England and Panmure. The area is prized for both its proximity to Auckland’s central business district and its enviable position looking over Auckland Harbour and the Hauraki Gulf. The current population of the Tamaki area is approximately 1600 (Statistics New Zealand, 2011) and this population is expected to nearly double over the next 20 years (Housing New Zealand Corporation, 2011). It is an area of relatively high deprivation, with average household income falling well below that of Auckland-wide averages and unemployment being approximately 10%, double that of the Auckland-wide average (Statistics New Zealand, 2011). The population also consists of high proportions of ethnic minorities, with Maori and Pacific Island peoples making up approximately 30% and 45% of the population, compared to Aucklandwide averages of just 11.1% and 14.4% respectively (Statistics New Zealand, 2011). Furthermore, the population age structure of the Tamaki community is much younger than that of Auckland as whole, with approximately 30% of Tamaki’s population being aged under 15 years of age compared to an Auckland-wide average of nearer 20% (Statistics New Zealand, 2011).

The Tamaki Transformation Programme is a large-scale urban renewal project. It is intended to run over the next 15–20 years and aims to achieve better economic, infrastructural, educational, social and health outcomes for the population of Tamaki.

It is a multidisciplinary programme and involves a partnership between local and central government

agencies, the private sector, and the Tamaki community in order to achieve positive outcomes for those in the region (Housing New Zealand Corporation, 2011).

Consultation with Children in New Zealand

A key area of interest for this research was the nature of consultation with children in Tamaki and New Zealand as a whole. There is extensive literature supporting the importance of consultation to a child’s psychological development and future civic engagement (Kahne & Sporte, 2008; Speak, 2000).

The literature also details extensively the various methods of consultation. These include focus groups, storytelling, and child-led neighbourhood tours which can be used to effectively engage children in the process of consultation (Cunningham et al., 2003; Loebach, 2010).

Furthermore, the New Zealand Government ratified the United Nations Convention of the Rights of the Child (UNCROC) in 1993 and, as a signatory, became bound by international law to comply with the convention. Article 12(1) states that parties to UNCROC “assure to the child capable of forming [their] own views the right to express those views freely in all matters affecting the child, the views of the child being given due weight in accordance with [their] age and maturity” (Hodgkin & Newell, 2007, p. 149). This article requires the New Zealand Government to consult with children under international law (Hodgkin & Newell, 2007).

This project focussed on children in the Tamaki community because children are a group whose opinions often go unheard in urban renewal processes (Hart, 1992). The TTP has identified that it wants to use a ‘whole of community approach that

13

14 encompasses: the community of place — those who live here now, the community of interest — those who have an interest in the area, and the community of the future — the future community of Tamaki (Housing New Zealand Corporation, 2011). The 30% of Tamaki’s current population who are aged under 15 are members of all three of these communities and, as such, their experiences of the area must be viewed as an integral part of the urban renewal process.

expressed (through processes of consultation or otherwise) and the resources currently in existence that enable them to be active in their communities.

Furthermore, in generating this asset map, questions regarding utilisation were explored to assess to what extent current assets are used, and what untapped capacity exists. This project used three methods in order to generate an asset map: networking, child focus groups and playground observations.

Asset Mapping

MeThods

Asset mapping is the process of recognizing what is valuable in communities and creating a tangible resource in the form of a map or inventory of these assets (Dorfman, 1998). It is an exercise in community development based on the principle that by understanding what is valuable in communities, we can build upon the capacity identified and take advantage of the opportunities presented. A key attribute of asset mapping initiatives is that they are strength based, focusing on the potential and untapped capacity of what is already in existence. This mapping of capacity has been used in many urban regeneration programmes and has achieved many positive outcomes including: increased proactive searching for resources by school counsellors (Griffin & Farris, 2010), obesity reduction initiatives through reduced television watching (Baker, Dennison, Boyer, Sellers, Russo & Sherwood, 2007), and enhanced community collaboration (Jackson, 2003).

Furthermore, there are plans to undertake a large scale asset mapping project in the Tamaki Region in the near future.

For the purposes of this project, the asset mapping focussed on children. It centred on the opportunities that exist for their views to be

Networking

This stage of the asset mapping consisted of gathering information in order to get an overview of what is available (and seen as valuable) to the children of the Tamaki community.

The first stage consisted primarily of internet searches and observations about what is available in the area for children. It also consisted of making observations of what businesses, organisations and places of interest to children were visible in the area.

Having established some of the primary places and people of interest, dialogue took over as the primary means of gaining new information. Through talking to people on the streets and through informal interviews with organizations, a sense of the community’s opinions were gathered on the issues of what resources were available for children, and how and why resources were/were not utilised.

Playground Observations

The use of playgrounds in Tamaki was expressed as being of particular interest to the TTP. They had recognized them as a valuable resource in the community as they are free for children and families to use.

Figure 1. Questions asked on each of the three worksheets given to children during focus group sessions at the Glen Innes Library AkoZone afterschool homework programme.

The Oculus: Proceedings of the U21 UndergradUate research conference Playground observations were based on the observation methodology used by Loukaitou-Sideris and Athanasios Sideris (2010). Two-hour observation sessions were undertaken from 15:30 to 17:30 on weekdays with fine weather. Observations were made of the approximate age group (Adult – above 18 years; Youth – 11-18 years; Child – less than 11 years) of users at each of the play areas. Information about the available play equipment and intended age group of the playground was accessed from the Auckland City Council web page (Auckland Council, 2011). In order to assess utilisation of Tamaki playgrounds, a base line rate of utilisation was established by undertaking observations at a number of playgrounds in neighbouring suburbs with similar play equipment.

Child Focus Groups

Focus groups were undertaken with children attending the Glen Innes Library AkoZone homework programme. The homework programme has children attending from many of the local primary schools in the Tamaki area. Children attending the programme were invited to take part in the group and complete three worksheets, each regarding a separate subject: the neighbourhood, the playgrounds and consultation. Figure 1 depicts the worksheets used.

As the ideas and terminology of consultation can be difficult for children to grasp, the third worksheet uses the methodology of Drakeford et al.

(2009). It uses the idea of a busy road being built near to where children live to help children conceptualise the idea of consultation around things relevant to their lives.

resulTs

Networking Results: Asset Map Inventory

The networking process identified: 12 primary and intermediate schools, 11 churches, 12 reserves with public playgrounds and 17 other public parks/ reserves, 2 public tennis courts, 2 public skate parks, 2 after school activity programmes, 1 homework centre, 2 public libraries, 2 scout groups, a public swimming pool, 2 community development groups and an internet project.

Table 1 shows the observations that were taken in 13 playgrounds and 1 Skate Park across Tamaki and neighbouring suburbs. The suburbs that neighbour Tamaki were used to indicate a baseline rate of playground utilisation for similar parks in similar areas in order to guide estimations regarding playground utilisation. It would seem that the playgrounds in both Tamaki and its neighbouring suburbs are underutilised as the 15:30–17:30 observations sessions represent the peak times that the parks are used. However, the average observations taken in playgrounds in the suburbs neighbouring Tamaki were double the average of the playgrounds in the Tamaki area. This suggests that Tamaki playgrounds are indeed underutilised in comparison to neighbouring areas.

Table 1 also suggests that there may be an association between the target age group of the playgrounds and the levels of utilisation. Those playgrounds that are targeted at the widest age group of 3-14 years were utilised most whilst those targeting the 7-14 age group were used least.

Table 1. Results of sample observations taken over 2 hour periods at 13 playgrounds and a skate park across Tamaki and neighbouring suburbs in December 2010 to January 2011.

15

16 Focus Group Quotations

What are the best things about your neighborhood?

The people and my friends (Girl, 11 yrs) They always help when you are put down and share food and play games and offer you anything (Girl, 11 yrs) My friends playing with me (Boy, 7 yrs) You make friends and play and talk to each other (Girl, 11 yrs) Are there any changes you would like to see happen in your neighborhood?

No more graffiti, there’s too much tagging (Girl, 10 yrs) Friends should be allowed out more (Girl, 11 yrs) Need owners for all the stray pets (Girl, 11 yrs) Do you ever use the playgrounds in your neighborhood?

Sometimes, but sometimes it’s too boring (Girl, 9 yrs) No, because one girl got murdered there so my mum doesn’t think it’s safe... (Girl, 11 yrs) I only use the playground at school with my friends (Boy, 9 yrs) What do you like about them?

Climbing the monkey bars (Boy, 7 yrs) It’s fun, especially rock climbing in the senior park (Boy, 9yrs, talking about St Pius X playground) Sitting and talking with my friends (Girl, 11 yrs) Having fun with my friend, and playing games (Girl, 10 yrs) Imagine there were plans to build a busy road close to where you live. Do you think politicians and adults should ask children what they think?

Yes, because they might have a good point! (Girl, 11 yrs) Yes, so that I’d know what was happening and wouldn’t lose playing space (Boy, 8 yrs) Yes, if they just ask parents children might not agree so I would like to be asked (Girl, 11 yrs) No, children are not old enough to know about things (Boy, 9 yrs)

dIsCussIon

Focus groups

Firstly, the focus groups suggested that, unlike some perceptions expressed in the literature, the children were interested in answering questions and participating. The commonly reported perception that when children are consulted they are passive was not evident in this project.

The third worksheet regarding consultation (see figure 2) was of particular interest. The United Nations Committee for UNCROC emphasized not only that children must have the right to be heard, they must also understand that they have this right (Hodgkin & Newell, 2007). The children in the

focus groups often expressed surprise at the idea that adults and politicians would ask the opinion of children. This would suggest that children in Tamaki are not aware of their right to express opinions about things that affect their lives. It would seem that more could be done to engage children in consultation in accordance with UNCROC.

The Underutilisation of Playgrounds

The results suggest that playgrounds in the Tamaki area are considerably underutilised in comparison to those in neighbouring suburbs.

There are many possible reasons for this pattern of utilisation and these are outlined in the paragraphs below. However, further research with wider scale observations is needed in order to determine the role they play in the differences seen.

Firstly, concerns regarding the safety of public parks in Tamaki arose frequently and this may explain the lower utilisation rates observed. One 11 year old girl stated that she didn’t use the playgrounds in her neighbourhood “because one girl got murdered there so my mum doesn’t think it’s safe...” Safety concerns also arose frequently in discussions with community stakeholders. Some saw crime and violence in parks as an historical issue, whilst others felt it continued to be problematic with particular concerns about gang presence. In order to explore this issue, discussions were held with the Youth Aid constables at Glen Innes Police Station. The constables highlighted that low levels of reporting result in there being little information about criminal and violent activity in parks. They felt that this contributed to an air of uncertainty about the safety of parks. This uncertainty and the perception of possible danger is of importance as research has demonstrated that mere perceptions of danger are associated with lower park visitation and physical activity levels in parks (Active Living Research, 2010).

The type of playgrounds being provided may also explain the underutilisation of Tamaki playgrounds. Those playgrounds aimed at the widest age group of 3-14 years are utilised most whilst those targeting the 7-14 age group are used least (Auckland City Council, 2011). In the focus groups, several children reported that the neighbourhood playgrounds were ‘boring’. Focus groups also highlighted that the school playgrounds, particularly those at St Pius X Primary School were “much more fun”, with the less traditional play features of “monkey bars, rock climbing and the wibbly wobbly bridge”. Additionally, the observations of the skate park showed much higher utilisation not only by adolescents, but also by children. These findings suggest that in the future there is a need to diversify the traditional slide/swings setup of playgrounds to ensure that they remain a captivating play space for children of the older 7-14 year old age group.

Furthermore, the focus groups highlighted that

The Oculus: Proceedings of the U21 UndergradUate research conference school playgrounds were closed after school and at the weekend and, as such, these existing assets are not being fully utilised.

A possible confound exists in this research.

The ethnic makeup of Tamaki differs considerably to that of neighbouring suburbs as it has a much higher proportion of Maori and Pacific Islanders (Statistics New Zealand, 2011). If it is shown that cultural variations exist in the preferences for and utilisation of playgrounds, the differences observed in this project may not be of significance. Currently, there is little literature on ethnic differences in playground utilisation to support this idea.

Neighborhood Assets in Tamaki

A factor that frequently arose in discussion with stakeholders of the children’s assets is cost.

This factor is salient as Tamaki is a relatively low income area with a relatively high unemployment rate (Census, 2011). This price sensitivity is reflected in that Work and Income New Zealand (WINZ) provides subsidies to parents seeking afterschool and holiday childcare. However, discussions highlighted that parents are often not aware of what help is available, or are reluctant to engage with the WINZ system. These patterns are of concern as they are limiting Tamaki children’s access to assets available to them. Whilst cost is of concern to Tamaki parents, the cheapest afterschool care was not fully utilised, whilst a more expensive alternative was. This suggests that other factors, such as transport, are also at play in determining which programmes are used

by Tamaki parents and caregivers.

A primary factor affecting how neighbourhood assets are utilised is uncertainty about what is available and difficulty in contacting those providing these assets. In undertaking this project it was often difficult to contact programmes, particularly outside work hours. This poses a barrier to parents trying to access programmes and services for their children. This issue was compounded as whilst many organisations use internet pages as their primary means of advertising and providing information, the Tamaki area has much lower access to internet and computers than the wider Auckland region.

Lower internet access in the Tamaki region also has implications for the self-help resources that are available to children. Nowadays, many child focused organisations, such as Youth Line, provide interactive resources for children experiencing psychosocial issues such as bullying, grief and loss. In Tamaki, many children have limited access to the internet and to such interactive self-help sites. This is concerning considering the high prevalence of bullying, domestic abuse and crime issues reported by the Glen Innes Family Centre. Whilst the Manaiakalani internet project is currently addressing the low internet access in education, there is also a need to ensure that paper resources, such as those provided by the Ministry of

Justice, the Office of the Children’s Commissioner and the Skylight organisation, are available to Tamaki’s children.

reCoMMendaTIons

It would seem that greater consultation with children is needed in Tamaki. The literature clearly outlines the benefits of consultation with children and, furthermore, these benefits are particularly salient to the aims of the TTP. A common theme throughout the discussions was that of uncertainty: uncertainty about what is safe, about what assets are available, about what financial support is available, and about how to appropriately consult with children. It would seem that better communication networks are needed within the Tamaki community in order to nullify this air of uncertainty and re-establish community knowledge. As such, a key recommendation of this project is to build and strengthen communication networks within Tamaki. Asset mapping may be used as an approach with which to achieve this.

referenCes

1. Active Living Research. (2010). Research Synthesis: Parks, Playgrounds and Active Living. Retrieved March 10, 2011, from http://www.google.co.nz/ url?sa=t&source=web&cd=6&ved=0CEcQFjAF& url=http%3A%2F%2Fwww.activelivingresearch. org%2Ffiles%2FSynthesis_Mowen_Feb2010. pdf&rct=j&q=playgrounds%20use%20ethnicitie s&ei=VCp5Tfa7HJLzrAGHianpBQ&usg=AFQjC NEyMKtQNvxiHcPEQADww5-Tt8L1vw&sig2=Cz20ZM2tjkA8tJzHSJ-vw&cad=rja 2. Auckland City Council. (2011, July 29). Places to go - playgrounds. Retrieved from http:// www.aucklandcity.govt.nz/whatson/places/ playgrounds/default.asp 3. Baker, I.R., Dennison, B.A., Boyer, P.S., Sellers, K.F., Russo, T.J. & Sherwood, N.A. (2007). An assetbased community initiative to reduce television viewing in new york state. Preventative Medicine, 44(5), Retrieved from http://www.sciencedirect. com/science/article/pii/S0091743506005056 doi: 10.1016/j.ypmed.2006.11.013 4. Cunningham, C.J., Jones, M.A., & Dilon, R. (2010). Children and urban regional planning: participation in the public consultation process through story writing. Children’s Geographies, 1(2), 201-221.

5. Dorfman, D. (1998). Mapping community assets workbook. strengthening community education: the basis for sustainable renewal. . Portland: Northwest Regional Educational Laboratory.

6. Drakeford, M., Scourfield, J., Holland, S., & Davies, A. (2009). Welsh children’s views on government and participation. Childhood, 16(2), Retrieved from http://chd.sagepub.com/content/16/2/247.refs doi: 1177/0907568209104404

17

18 7. Griffin, D., & Farris, A. (2010). School counselors and collaboration: finding resources through community asset mapping. Professional school counseling, 13(5), 248-256.

8. Hart, R.A. (1992). Children’s participation: from tokenism to citizenship. UNICEF Innocenti Research Centre, Retrieved from http://www. unicef-irc.org/publications/pdf/childrens_ participation.pdf 9. Hodgkin, R., & Newell, P. (2007). Implementation handbook for the convention on the rights of the child: fully revised third edition. UNICEF. 10. Housing New Zealand Corporation. (2011, February 16). Tamaki transformation programme.

Retrieved from http://www.hnzc.co.nz/hnzc/ web/councils-&-community-organisations/ community-groups/tamaki-transformationprogramme/tamaki-transformationprogramme_home.htm 11. Jackson, S.F., Cleverly, S., Poland, B., Burman, D., Edwards, R., & Robertson, A. (2003). Working with toronto neighbourhoods toward developing indicators of community capacity. Health Promotion International, 18(4), Retrieved from http://heapro. oxfordjournals.org/content/18/4/339.abstract doi: 10.1093/heapro/dag415 12. Kahne, J.E., & Sporte, S.E. (2008). Developing citizens: the impact of civic learning opportunities on students’ commitment to civic participation.

American Educational Research Journal, 45(3), 738766.

13. Loebach, J., & Gilliland, J. (2010). Child-led tours to uncover children’s perceptions and use of neighborhood environments. Children, Youth and Environments, 20(1), 52-90.

14. Loukaitou-Sideris, A., & Sideris, A. (2010).

What brings children to the park? analysis and measurement of the variables affecting children’s use of parks. Journal of the American Planning Association, 76(1), Retrieved from http://www.tandfonline.com/doi/ full/10.1080/01944360903418338 doi: 10.1080/01944360903418338 15. Speak, S. (2000). Children in urban regeneration: foundations for sustainable participation.

Community Development Journal, 35(1), Retrieved from http://cdj.oxfordjournals.org/ content/35/1/31.abstract#cited-by doi: 10.1093/ cdj/35.1.31 16. Statistics New Zealand. (2011, February 16). QuickStats - statistics New Zealand.

Retrieved from http://www.stats.govt.nz/ Census/2006CensusHomePage/QuickStats.aspx

The Oculus: Proceedings of the U21 UndergradUate research conference

Is the Extension of Control a Blessing or a Curse to China’s Family-controlled Listed Companies?

Ailin Dong

Fudan University

absTraCT

Using pooled cross-sectional data from 2003 to 2009 on China’s family-controlled listed companies, this article examines the incentives and entrenchment of the extension of control of family shareholders, analyzes the financing benefits of different ways to enhance control, and gives insight into the influence of age of privatization, firm size, and financial leverage on firm value. The empirical study shows that there is an optimal ownership percentage in terms of maximizing the incentive effects, while the entrenchment in China’s family firms is less economically significant than other East Asian economies. Taking the advantage of specialization into account in the process of expanding and maintaining appropriate percentage of debt in order to give full play to financing benefits of family business groups and minimizing tunneling are crucial to the healthy and long-term development of China’s family-controlled companies.

InTroduCTIon

A

s an aged from of business organization, family firms are still playing a vital part in modern economy. Moreover, since China’s reform and opening, private companies have grown sturdily, especially family-controlled companies. Whether they can grow larger and stronger in the process of going public is highly depended on their abilities to retain control as well as maximize firm value. This article examines the incentive and entrenchment effects in China’s family controlled listed companies and gives insight into the influence of different mechanisms to extend control, age of privatization, firm size, and financial leverage on firm value.

ConTrol, ownershIP, and MeChanIsMs To exTend ConTrol

What is control and what is ownership?

Imagine that you invest in a company and become its shareholder, thus you have voting rights at the general meeting. Then the percentage of your voting rights is your control over the company.

What about ownership? It is your cash flow right.

The extension of control can be defined as control minus ownership. There are several mechanisms to extend control. Pyramids and cross-holdings are most commonly cited examples.

In recent years’ literature, scholars have began to investigate ultimate control. That is, they traced the chain of ownership, calculated control by adding up the minimum voting rights of each chain, while they evaluate ownership by adding up the product of cash flow rights along each chain.

Here are two examples. In such a pyramidal structure (Figure 1), the family controller control Firm X along three chains, each of which has two nodes. Therefore we can calculate the extension of control by subtracting ownership from control—

The same rule works as for the case of cross-holdings. In Figure 2, the family controller control Firm X along two chains. The right chain has only one node, while the left one has two nodes. The family controller invests in Firm A and let Firm A, Firm X hold each others’ shares. Hence, the extension of control of family controller over Firm X is shown by this formula—

lITeraTure revIew

Much Literature gave insight into the relationship between firm value and the extension of control. On one hand, investors with large ownership stakes have strong incentives to maximize their firm’s value by collecting information and overseeing managers, which can greatly help alleviate the principal-agent problems (Jensen and Meckling, 1976) in modern corporations (Claessens et al., 2002).

Figure 1. Pyramidal Structure.

Figure 2. Cross-holding Structure.

19

20

Table 1. The Entrenchment Effect.

On the other hand, firm value falls when the voting rights of the largest shareholder exceed its cash-flow rights, consistent with an entrenchment effect, since controlling shareholders could expropriate the minority shareholder by tunneling (Johnson, 2000).

Harvey (2004) reported that debt financing alleviates the loss in firm value due to large agency problem indicated by the extension of control.

On contrary, domestic research on family firms mainly emphasize on their history, rationality, and culture. Therefore, it is much necessary for us to apply the modern method in the research frontier to study the relationship of extension of control and firm value in China, i.e. whether the extension of control is a blessing or a curse to China’s family controlled listed companies.

daTa

The analysis in this article is based on newly assembled data for China’s family-controlled listed companies from 2003 to 2009. The database is GTA Research Service Center. There are six major independent variables: ownership, control, age of privatization, total assets for controlling firm size, dividends / book value of equity (Andres, 2008) for dividend policy and financial leverage (liabilities / assets) for debt-paying ability or liquidity. The dependent variable is Tobin’s Q, which is a proxy for market-to-book ratio of assets and has been widely used in literature to measure firm value.

Descriptive statistics and correlation analysis have been done to cross out one abnormal observation and see whether these variables could be added in the regression model without causing multicollinearity. Regression analysis was carried out after that.

The Oculus: Proceedings of the U21 UndergradUate research conference

Table 2. The Incentive Effect.

MulTIvarIable analysIs

First, I investigate the entrenchment effect.

Though ownership variable and control variable is highly correlated according to the correlation analysis, control minus ownership variable is highly correlated with ownership variable. Table 1 is the result after joint hypothesis test is applied to cross out eight industry or year dummies. White test is applied and no heterogeneity bias exists in each case.

Second, I explore the incentive effect (Table 2). Quadratic term is used to detest the possible turning point. Because ownership variable and control variable is highly correlated according to the correlation analysis, control variable is not added in this regression to better detect the partial effect of ownership variable. Consistent with economic intuition, there is a turning point of ownership

variable at about 26%. If we draw a figure, putting ownership at X-axis, it will surely be a parabola because the coefficient for the quadratic term is negative.

Finally, dummy variables for mechanisms to extend control are added (Table 3). They are jointly significant. Table 1, 2, and 3 also show a positive effect of age of privatization, a negative effect of firm size (total assets) and a positive effect of financial leverage.

CoMParIson aMong eConoMIes

Following is a further comparison among East Asian economies. The sources of Figure 3 is the research of Claessens et al. (2002). In that paper, quadratic term is not used to detect possible turning points. And the entrenchment effects in other East

21

22

Table 3. Different Mechanisms to Extend Control.

Asian economies, such as Hong Kong, Indonesia, Korea, ad Malaysia are all greater than that in Mainland China.

ConClusIon

The empirical study shows that there is an optimal ownership percentage in terms of maximizing the incentive effect, which is one of the most innovative points of my research, while the entrenchment in China’s family firms is less

economically significant than other East Asian economies. Taking the advantage of specialization into account in the process of expending, avoid the wrong notion of The Bigger, The Better, and maintain appropriate percentage of debt in order to give full play to financing benefits of family business groups and minimizing tunneling are crucial to the healthy and long-term development of China’s familycontrolled companies.

The Oculus: Proceedings of the U21 UndergradUate research conference

Figure 3. Comparison among Economies. Source: Claessens et al. (2002). a Significant at the 1% level; bSignificant at the 5% level; cSignificant at the 10% level

referenCes

1. Andres C. 2008. Large shareholders and firm performance—An empirical examination of founding-family ownership. Journal of Corporate Finance. 14(4): ii431-ii445.

2. Berle A and Means G. 1932. The Modern Corporation and Private Property, Published by Macmillan.

3. Claessens S, Dyankov S and Lang LHP. 2000. The separation of ownership and control in East Asia Corporations. Journal of Financial Economics. 58(12): ii81-ii112.

4. Claessens S, Dyankov S, Fan JPH. and Lang LHP. 2002. Disentangling the Incentive and Entrenchment Effects of Large Shareholdings.

Journal of Finance. 57(6): ii2741-ii2771.

5. Harvey CR, Lins KV and Roper AH. 2004. The effect of capital structure when expected agency costs are extreme. Journal of Financial Economics.

74(1): ii3-ii30.

6. Jensen MC and Meckling WH. 1976. Theory of the firm: managerial behavior, agency costs, and ownership structure. Journal of Financial Economics. 3(4): ii305-ii360.

7. Johnson S, La Porta R, Lopez-de-Silanes F and Shleifer A. 2000. Tunneling. The American Economic Review. 90(2): ii22-ii27.

8. La Porta R, Lopez-De-Silanes F and Shleifer A. 1999. Corporate ownership around the world.

Journal of Finance. 54(2): ii471-ii517.

9. Shleifer A and Vishny RW. 1986. Large Shareholders and Corporate Control. The Journal of Political Economy. 94(3): ii461-ii488.

10. Shleifer A and Vishny RW. 1997. A Survey of Corporate Governance. The Journal of Finance.

52(2): ii 737-ii783.

11. Stein JC. 1997. Internal Capital Markets and the Competition for Corporate Resources. Journal of Finance. 52(1): ii111-ii133.

12. Tirole J. 2005. The Theory of Corporate Finance, Published by Princeton University Press.

23

24

Pulse Electroplating of Wear and Oxidation Resistant Ni-Cr-Y2O3 Nano-Composite Coatings Robert Hoye, Weiwei Chen, Wei Gao University of Auckland

absTraCT

The world’s energy demand is undoubtedly increasing. Improving the efficiency of energy use is an important approach to reduce energy consumption. This work is to develop a nano-structured composite coating system that has improved high temperature oxidation resistance. Equipment with these coatings can then operate at higher temperatures, where the thermal efficiency is higher. The fine dispersion of nanoparticles can also improve the hardness and wear resistance of the coatings. This project has two phases. First is to determine the electrolyte composition and processing conditions for electroplating Ni-Cr coatings that have good oxidation resistance and mechanical properties. Key findings include pulse plating with a larger reverse current than forward current being needed to avoid forming cracked coatings. The second phase is to introduce a fine dispersion of nanoparticles of yttria via the sol-gel method to the Ni-Cr coatings and compare the oxidation resistance and mechanical properties with those of conventional coatings.

InTroduCTIon

B

y 2035, the world’s energy consumption is expected to increase by 49% from 2007 [1].

Improving the high temperature oxidation resistance of materials improves their efficiency of energy consumption. According to Carnot’s equation,

That is, the higher the temperature of the hot reservoir (TH) compared to that of the cold reservoir (TC), the higher the thermal efficiency ( ) [2]. The materials used for high temperature applications, such as chromium-containing steels, have been designed with desirable mechanical properties, but often at the expense of high temperature oxidation resistance [3, 4]. However, by applying coatings to these materials, high temperature oxidation protection can be provided without reducing mechanical properties [5].

The protective oxide scale must be adherent and slow growing [5-8]. Chromia (Cr2O3) from Ni-Cr fulfils these requirements [6]. However, the chromia scale formed has a tendency to crack and spall between thermal cycles. This is due to the large compressive stresses of up to 5 GPa generated in the scale because of its different thermal expansion to that of the underlying coating and substrate [5, 9].

Previous studies have found that scale adhesion can be improved by the addition of small quantities of rare earth elements, such as yttrium. This is known as the rare earth effect (REE) [9-11].

Mechanical properties, such as wear resistance and hardness, are also important for the integrity of the coatings. Orowan mechanisms indicate that high hardness and wear resistance can be obtained by having a fine dispersion of hard particles. When nanoparticles are added to coatings, however, they

form agglomerates that cannot be broken down by agitation or surfactants. Previous research has found that it is possible to produce nanoparticles (~10 nm) via the sol-gel method [12]. Similarly, yttria (Y2O3) nanoparticles could be synthesised in sol and added to produce Ni-Cr-Y2O3 nanocomposite coatings that have a combination of improved mechanical strength and oxidation resistance.

There are therefore two aims to this project: 1. To electroplate Ni-Cr coatings with improved oxidation resistance and mechanical strength compared with the substrate. While electroplating NiCr has been researched, most address corrosion resistance rather than oxidation resistance.

2. To compare the effects of adding rare earth elements, especially yttrium, to the electrolyte as an element in sol, nanoparticles in sol, and as solid powder on the oxidation kinetics of Ni-Cr coatings at temperatures between 700oC and 1000oC.

baCkground and lITeraTure revIew Oxide Scale Environment

Formation

in

an

Oxygen-Rich

High temperature oxidation protection of metallic materials is achieved through the formation of an adherent surface oxide [13, 14]. The growth of the oxide scale depends on diffusion in the coating and scale. In Ni-Cr coatings, when the Cr content exceeds 15wt%, protective chromia (Cr2O3) tends to form in the way shown by Eq. 1: (1) [6]

The Oculus: Proceedings of the U21 UndergradUate research conference The protectiveness of the oxide coating is indicated by the rate law describing the change in scale thickness (ts in cm) with time (t in h). Scale thickness can be expressed as the mass gain per unit surface area. The linear rate law is given by Eq. 2 and indicates that the scale is non-protective: (2) [6] where, k l is the linear rate constant (cm/h or [mg/(cm2h)]).

Another common rate law is the parabolic rate law, which indicates that the scale is stable: (3) [6] where, kp is the parabolic rate constant (cm2/h or [mg2/(cm4h)]) [6].

The Rare Earth Effect

It is known that the small addition of rare earth elements (0.1 – 1.0 wt%), such as yttrium, can improve the high temperature oxidation resistance of alloys and coatings [10]. One reason is the improvement in scale-alloy adhesion [10, 15]. A criterion used by a number of investigators for the loss of metal-scale adhesion is given by Eq. 4: (4) [15] where is scale thickness, W* oxide strain energy per unit volume, 0 and m are the oxide and metal surface free energies, and om metal-oxide interfacial free energy. If the inequality in Eq. 4 is fulfilled, there is a loss in scale adhesion. The REE results in fine, slow growing equiaxed grains and fewer vacancies. These reduce W* , meaning that more time elapses before the minimum value of W* is reached for crack formation at the alloy-scale interface [15].

Production of Nanoparticles in Sol

The production of yttria nanoparticles from yttrium acetate is based on the production of zinc oxide (ZnO) nanoparticles from zinc acetate precursor. ZnO nanoparticles have been produced through the sol-gel method by adding zinc acetate to KOH in methanol. The nanoparticles produced were approximately 3 nm [16]. The reactions involved are shown in Eqs. 5 and 6.

25

10 and 12 to avoid precipitation [16]. It is expected that these correlate with yttria nanoparticle production.

Electrodeposition

Electroplating involves oxidation and reduction reactions at two electrodes [17]. If Ni and Fe were used as electrodes and the Fe connected to the negative terminal of the power source, the supply of electrons to the Fe electrode increases the rate of deposition by reducing cations adjacent to the electrode. Hence, the Fe electrode is the cathode [17, 18].

In the deposition of Ni-Cr, the reduction reactions are given by Eqs. 7 and 8.

(7) (8) The Ni electrode is the anode. The positive potential applied results in the migration of Ni2+ to the cathode for deposition [17].

The factors that affect the coating quality are pH, stirring rate, temperature and current density [19]. Sodium dodecyl sulfate has been found to favour Cr deposition, which is desirable for improving oxidation resistance [20].

Buffering and pH

It is necessary to maintain a low electrolyte pH, as OH- anions can precipitate Ni2+ [20].

At the cathode, water is reduced to form hydroxide anions via Eq. 9: (9) [18] At the anode, water is oxidised according to Eq. 10: (10) [18] Hence, when the pH is lower, cathode efficiency is higher than anode efficiency, as more cations than water are reduced at the cathode. Also, when the pH is too high, Cr3+ undergoes polymerisation reactions more readily, which decreases the concentration of Cr available for deposition [21]. Hence, the optimum pH is 2.5 , as shown in Figure 1 [18, 19].

One method of maintaining the pH at 2.5 is by buffering with boric acid, which dissociates according to Eq. 11:

Hydrolysis:

(11) [17] (5) [16]

Condensation: (6) [16] The important factors are the temperature of reaction and pH. A high temperature is needed to promote the condensation reaction, whereas a low temperature is needed to prevent the growth of nanoparticles. Also, the initial pH must be between

Temperature

Figure 2 shows that the Cr content in Ni-Cr coatings decreases with increasing temperature.

But when temperature increases, the rate of Cr deposition increases due to increased mass transfer rates, decreased activation energy of metal deposition and decreased cathode polarisation.

However, the increase in mass transfer rate and decrease in cathode polarisation for Ni is greater

26 than for Cr, leading to a reduced Cr content in the coating [19]. Reduced temperature leads to longer deposition times, which is uneconomical [22]. The temperature that balances these factors was, in literature, 25oC [19].

CrCl3.6H2O Concentration

CrCl3.6H2O is the typical source of Cr3+ for the Ni-Cr coating. Figure 3 indicates that the optimum amount to add is 75 g/L. This is because a higher concentration of CrCl3.6H2O was found to increase the polymerisation of Cr, which decreased the Cr content in the coating [19].

Current Density and Agitation

Current density is typically expressed as the ion/electron current in the electrolytic cell per cm 2 of cathode surface [18]. Figure 4 shows that with increasing current density, Cr content in the NiCr coating increases. This is due to easier cathode polarisation and higher Cr3+ depositing speed [19].

But when the current density exceeds 160 mA/ cm2, the surface quality deteriorates [19]. This may be due to an increased rate in Eq. 9, leading to the deposition of hydroxides [23].

exPerIMenTal MeThodology Electroplating

316 stainless steel sheets 0.9 mm thick were cut into rectangular samples 8 mm by 15 mm in size.

The samples were ground with SiC paper to P1200 grit and cleaned in ethanol. The sample to be coated was immersed in xylene for at least 30 minutes for degreasing, followed by pickling for 15 minutes in 30% HCl. The sample and electrodes were then mounted into the electrolyte. Figure 5 shows the schematic of the setup used.

In DC plating, the current required was set on the power supply. In pulse plating, the forward and reverse currents and pulse durations were set. The pH and temperature of the bath were also monitored and controlled at 2.5 and room temperature respectively.

Mechanical Testing

The wear resistance of the coatings were measured using the Nanovea Tribometer. In linear mode, the sample was moved linearly at a rate of 100 rpm for 1510 revolutions under an alumina ball with a 2 N load. The amplitude was set to approximately 10 mm. Optical microscopy was used to measure the width of wear tracks and calculate volume loss.

Figure 1. Influence of pH on the Cr content in Ni-Cr coating electrodeposited on Fe substrate at 30 oC, 14 A/dm2 and 100 g/L CrCl3.6H2O [19]

Figure 2. Influence of temperature on Cr content in Ni-Cr coating on Fe substrate with a pH of 2.5 [19]

Figure 3. Influence of CrCl3.6H2O concentration in electrolyte on Cr content in Ni-Cr coating on Fe substrate [19]

Figure 4. Effect of cathode current density on the Cr content of Ni-Cr coatings on Fe substrates at 25oC and pH of 2.5 [19]

The Oculus: Proceedings of the U21 UndergradUate research conference Oxidation Testing

All DC plated Ni-Cr coatings produced almost immediately spalled off in oxidation testing. One possibility is the formation of cracked coatings. The cracked structure is associated with the formation of Cr hydrides, which decomposed to release hydrogen

gas, causing a 15% volume reduction [24]. From Figure 6, there appears to be cracks throughout the DC plated coating. It was also observed with some electroplated samples that the coating peeled off from the substrate.

Pulse plating was used to overcome this problem. Pulse plating is where the current is periodically on in the forward and reverse directions (Figure 8). The objective of pulse plating is to drive off the hydrogen gas using reverse pulses before the coating becomes too thick and cracks. 5 ms for the forward duration and 3 ms for the reverse duration were used based on literature [24].

To test whether pulse plating results in more adherent coatings, oxidation tests were done with uncoated stainless steel, DC plated Ni-Cr coating (13(2)) and pulse plated coating (14(2)). The effective current density for both was 70 mA/cm2.

It can be seen from Figure 9 that the DC plated coating immediately spalled off. However, the pulse plated Ni-Cr coating remained intact in the oxidation test. Also, its parabolic rate constant (kp=0.00011 Âą 0.00002 mg2/(cm4h)) was lower than that of the uncoated stainless steel (kp=0.0008 Âą 0.00002 mg2/ (cm4h)), which can also be seen from the lower rate of mass gain, indicating that the pulse plated NiCr coating is adherent and protective. Hence, pulse plating is used in future experiments.

Figure 5. Schematic showing the setup of the sample and electrodes in the electrolyte

Figure 6 . Optical micrograph showing the cracked structure of DC plated Ni-Cr

Figure 7. Optical micrograph showing the uniform and compact structure of pulse plated Ni-Cr

Figure 8. Schematic illustrating the working principles of pulse plating

Oxidation testing was performed at 900oC in a vertical oxidation furnace. Quartz crucibles were used to contain the samples. Initially, the furnace was heated to the operating temperature with the crucibles to evaporate any moisture. The crucibles were then cooled to room temperature for 20 minutes in a desiccator. Samples were put into one of the six crucibles. The total mass and the mass of the crucible was measured for each crucible and recorded. The crucibles were then mounted on a platform and lowered into the furnace. This was repeated after 1, 2, 3, 20, 40, 60, 80, 100, 160 and 190 hours of oxidation.

resulTs and dIsCussIon

Selecting The Coating Conditions

It can be seen that the optimum pH for Ni-Cr deposition is 2.5 and temperature is 25oC. Hence, only the concentration of chromium (III) cations (Cr3+), and cathode current density were investigated.

The type of plating was also found to be important.

DC vs. Pulse Plating

27

28 Studies on Current Density

Mechanical and oxidation properties were used to decide on the applied current densities.

From the trials with DC plating, it was found that the 160 mA/cm2 current density from literature was too high because the coatings cracked off. On the other hand, when the current density was too low (< 50 mA/cm2), that there was no deposition. The optimum was found to be 80 mA/cm2. Based on this, three current density patterns (Table 1) were studied in detail through oxidation tests. The pulse pattern was 5 ms forward current, 3 ms reverse current.

Figure 10 shows that when the forward current density was larger than the reverse current density, spallation almost immediately occurred, similar to DC plating. One possibility is that the driving off of hydrogen gas was inadequate.

Thus, the two desirable current density patterns are those of 13(1) or 14(2). Wear testing was used to decide on which to use. Figure 11 indicates that when plating with a larger reverse current density, the wear resistance is larger. The wear resistance was also higher than uncoated stainless steel. This is because reverse currents have a tendency to dissolve

Figure 9. Comparison of oxidation kinetics of uncoated stainless steel, DC plated Ni-Cr coating and pulse plated Ni-Cr Coating

Figure 10. Oxidation kinetics of the three different current density patterns for pulse plating studied

The Oculus: Proceedings of the U21 UndergradUate research conference Ni more, leading to a higher Cr composition. As Cr has a higher hardness than Ni, this would lead to a harder Ni-Cr coating overall [24].

Studies on Chromium Content

To determine the [Cr3+] in the electrolyte to use, a study was done on the relationship between the concentration of Cr with the Cr content in the Ni-Cr coating. This was determined from EDS spectra taken from the coating cross-section, as shown in Figure 12. The trendline is dashed because insufficient data points are available to pinpoint that 80 g/L CrCl3.6H2O leads to the optimum Cr content in the coating. However, this is close to the literature value of 75 g/L.

To verify that 80 g/L CrCl3.6H2O leads to good oxidation resistance, the oxidation resistance of uncoated stainless steel, Ni-Cr plated from a bath with 68 g/L CrCl3.6H2O and from a bath with 80 g/L CrCl3.6H2O were compared.

In Figure 13, it can be seen that higher Cr content in the electrolyte leads to significant improvements in oxidation resistance compared with the uncoated stainless steel and also the Ni-Cr coating electroplated from 68 g/L CrCl3.6H2O bath, both of which spalled after 20 hours of oxidation at 900oC. A larger concentration of Cr in the electrolyte than 80 g/L is not needed for two reasons. Firstly, Figure 12 indicates that this leads to a decrease in Cr content in the coating. Secondly, it would be wasteful to use

Figure 11. Comparison of wear resistance of pulse plated samples and uncoated stainless steel; 13(1) has forward and reverse current the same; 14(1) has a larger reverse current than forward current

Figure 12.

29

30 more Cr than is needed: using 80 g/L CrCl3.6H2O results in oxidation kinetics that is adequate for experiments in the second phase of the project.

ConClusIon

The first aim of the project has been fulfilled.

Ni-Cr coatings with a lower rate of oxidation than uncoated stainless steel have been produced. This was through pulse plating with a higher reverse than forward current density (340 mA/cm2 compared with 320 mA/cm2) to drive off hydrogen gas and prevent cracks from forming in the coating. The reverse current presumably also increases the Cr content, resulting in improved oxidation resistance and wear resistance. Sufficient tests have shown that the oxidation and wear resistance properties of the Ni-Cr coatings are good enough for the second phase of the project, in which nanoparticles will be added in to determine their effect on oxidation resistance.

fuTure work

The next step is to develop a repeatable method for producing nanoparticles of yttria in sol. However, preliminary tests have shown that it is difficult to avoid precipitation. A combination of oxidation resistance and mechanical properties may be obtained by adding in hard titania nanoparticles in sol with yttrium-containing sol.

aCknowledgeMenTs

Thanks to Yongjian Yang, Dr. Balan Zhu, Steve Strover, Laura Liang, Dr. Alec Asadov and Peter Buchanan for their technical advice.

referenCes

1. Doeman, L.E. International Energy Outlook 2010.

2010 [cited 2011 March 20 ].

2. Smith, J.M., Van Ness, H.C., Abbott, M.M, Introduction to Chemical Engineering Thermodynamics. Seventh Edition ed. McGrawHill’s Chemical Engineering Series. 2005, New York: McGraw-Hill.

3. Rahman, A., et al., Evaluation of High Temperature Oxidation Behaviour of Nanostructured Cr/Co–Al Coatings. Oxidation of Metals, 2010. 74(5): p. 341358.

4. Trinidade, V., H.-J. Christ, and U. Krupp, GrainSize Effects on the High-Temperature Oxidation Behaviour of Chromium Steels. Oxidation of Metals, 2010. 73(5): p. 551-563.

5. Sloof, W., Self Healing in Coatings at High Temperatures, in Self Healing Materials, S. Zwaag, Editor. 2008, Springer Netherlands. p. 309-321.

6. Young, D.J., ed. High Temperature Oxidation and Corrosion of Metals. 1 ed. Elsevier Corrosion Series, ed. T. Burstein. Vol. 1. 2008, Elsevier: Oxford, UK. 7. Gorr, B., et al., The Effect of Pre-Oxidation Treatment on the High-Temperature Oxidation of Co–Re– Cr Model Alloys at Laboratory Air. Oxidation of Metals, 2010. 74(5): p. 239-253.

8. Zhao, G.-g., Y.-b. Zhou, and H.-j. Zhang, Sliding wear behaviors of electrodeposited Ni composite coatings containing micrometer and nanometer Cr particles. Transactions of Nonferrous Metals Society of China, 2009. 19(2): p. 319-323.

Figure 13. Oxidation kinetics of coated and uncoated stainless steel samples with electrolyte that have different concentrations of CrCl3.6H2O

The Oculus: Proceedings of the U21 UndergradUate research conference 9. Wang, F., Wang, W., Yu, P., Zhu, S., Cyclic Oxidation Behavior of Sputtered Nanocrystalline Coating with Yttrium Additions in Air. Materials Science Forum, 2008. 595-598: p. 1163-1171.

10. Hussey, R.J. and M.J. Graham, The influence of reactive-element coatings on the high-temperature oxidation of pure-Cr and high-Cr-content alloys.

Oxidation of Metals, 1996. 45(3): p. 349-374.

11. Buscail, H., Caudron, E., Cueff, R., El Messki, S., Issartel, C., Riffard, F., Effect of reactive element oxide coating on the high temperature oxidation behaviour of FeCrAl alloys. Applied Surface Science, 2004. 229: p. 233-241.

12. Cheng, X., Synthesis of Nanometer-sized Yttrium Oxide Particles in Diisooctyl Sodium Sulphosuccinate (AOT)/Isooctane Reverse Micelle Solution, in Chemistry. 1999, Virginia Polytechnic Institute and Sate University. p. 95.

13. Whittle, D.P. and J. Stringer, Improvements in High Temperature Oxidation Resistance by Additions of Reactive Elements or Oxide Dispersions.

Philosophical Transactions of the Royal Society of London. Series A, Mathematical and Physical Sciences, 1980. 295(1413): p. 309-329.

14. Yang, X., X. Peng, and F. Wang, Hot corrosion of a novel electrodeposited Ni-6Cr-7Al nanocomposite under molten (0.9Na, 0.1K)2SO4 at 900 째C. Scripta Materialia, 2007. 56(10): p. 891-894.

15. King, W.E., ed. The Reactive Element Effect on High Temperature Oxidation - After Fifty Years.

Materials Science Forum, ed. G.E. Murch. Vol. 43.

1989, Trans Tech Publications: Aedermannsdort, Switzerland.

16. Yuntao, L., Process for preparing nano-sized metal oxide particles. 2009, The Texam A&M University System: USA. 17. Raub, E., Mueller, K., Fundamentals of Metal Deposition. 1967, Netherlands: Elsevier Publishing Company.

18. Lowenheim, F.A., ed. Modern Electroplating. Third ed. 1974, John Wiley & Sons, Inc.: USA. 19. Xu, L.-j., et al., Ni-Cr alloy electrodepositing technology on Fe substrate and coating performance. Journal of Central South University of Technology, 2007.

14(2): p. 181-185.

20. Philippe, L., Heiss, C., Michler, J., Electroplating of Stainless Steel. Chem. Mater., 2008. 20: p. 33773384.

21. Li, B.S., Lin, A., Study of Hard Chromium Plating from Trivalent Chromium Electrolyte. Key Engineering Materials, 2008. 373-374: p. 200-203.

22. Dini, J.W., Electrodeposition: The Materials Science of Coatings and Substrates. 1993, Park Ridge, New Jersey: Noyes Publications.

23. Paunovic, M., Schlesinger, M., Fundamentals of Electrochemical Deposition Second Edition. 2 ed. The Electrochemical Society Series. 2006, New Jersey, USA: John Wiley & Sons, Inc. 24. Lin, K.-L., Hsu, C-J, Hsu, I-M, Chang, J-T, Electroplating of Ni-Cr on Steel with Pulse Plating.

JMEPEG, 1992. 1: p. 359-362

Table 1. Current density patterns studied in oxidation testing

Table 2. Final electrolyte composition for the Ni-Cr plating. *Glycine was added as a complexing agent to allow chromium deposition. **NaF was added as a brightener to reduce the density of carbides on the surface of the coatings and thereby reduce the darkness The final volume was 88 mL: 80 mL distilled water, 8 mL 2 g/L sodium dodecyl sulfate.

Forward current density: 320 mA/cm2, 5 ms duration per cycle Reverse current density: 340 mA/cm2, 3 ms duration per cycle

31

32

Calculating the Partial Molar Volume: A Molecular Dynamics Approach Alistair Martin

University of Edinburgh

absTraCT

The application of molecular dynamics simulations to calculate the partial molar volumes of small gaseous solutes in organic solvents. The discussion of the research is accompanied by a basic introduction into both molecular dynamics and partial molar volumes. two can be further broke down into six “flavours” of InTroduCTIon o those without a scientific background, the title quark which along with the electron are part of the above is most likely daunting and overbearing in thirty six elementary particles that everything in the more than just a few ways, but we implore you to known universe thought to consist of (3) (4). This stay with us while we tell our story and hopefully is a lot to take in at first and we present Figure 1 to you may find something of interest to pick over summarise this; however molecular dynamics exist at in your future thoughts. Within this article we the gap between atoms and sub-atomic particles and are aiming for the lowest barrier of entry so that thus allows us to discard thoughts of the sub-atomic everybody may gain some insight into what we feel and elementary. Even at this level we are viewing the is a very exciting and cutting edge piece of research world on the scale of 10-10 metres; which compared to in the field of computational chemistry. To those with you is roughly the equivalent to comparing yourself a relevant background, we hope that even with this again to the distance between the centres of the very open style of writing you will still appreciate earth and the sun (3). At this specific location we can the underlying science and take away something still look at these building blocks of matter with an new to benefit your own research interests. Finally outlook similar to that we use at our own level of to those who feel left wanting more after reading or observation, molecules interacting with each other feel compelled to ask after the most intricate details; in approximately the same manner as we would for which we have decided to leave to the realms of observe footballs colliding or even planets rotating science publications; we suggest for you to wait just a around each other (5). Any smaller than the atom few months and seek the publication which we hope level and we would begin to experience quantum effects, whereby Newton’s “classical” laws of motion will soon follow. would fail to provide an adequate description of the motion but at this perfect scale we can still apply Molecular Dynamics Before we talk of any of the concepts presented all the physics learned in high school to provide a within the title we will first discuss one of the most description of matter at a base level (6). abstract thoughts that can ever be given to a person.

It however has been proven true numerous times, in many ways, throughout the years, since it first proposal by J. J. Thomson in 1904 (1). This is the fact that matter as you see it around you is composed of extremely tiny particles called molecules which in themselves are built up of atoms. These atoms can vary in their properties in approximately1 one hundred and eighteen different ways depending on the number of protons and electrons they contain which is outlined on the periodic table, with even more variation once you consider the various number of the third sub-atomic particle, the neutron, that each of these may have (2). Out of these three particles; the proton, neutron and electron; the first

T

1 *We choose the word “approximately” here because new elements are being slowly added to the periodic table as they are discovered through the use of nuclear fusion, the process of joining atoms together. In 2011 alone two new elements were confirmed to exist but have yet to be named, a process that is surprisingly constrained for the discoverer (24).

Figure 1: A scale showing the stages and sizes of the breakdown of matter into its components. A molecule consists of many atoms which in turn are made up of protons, neutrons and electrons.

The first two of these can be further broke down into quarks which along with electrons are part of the 36 elementary particles.

The Oculus: Proceedings of the U21 UndergradUate research conference Molecular dynamics (MD) ``abuses’’ this viable description to simulate groups of molecules over a period of time, with each molecule built of atoms interconnected by atomic springs. By providing descriptions of the forces that occur both intramolecular and intermolecular; within a molecule and between molecules respectively; allows us to calculate the resulting trajectories by numerically solving the classical equations of motions for all atoms within a system. Provided the forces are accurate in describing the real world equivalents, we can then analyse the trajectories to view the microscopic properties of the system.

With this we can extract a whole range of useful information; such as locational preferences of molecules, the dynamics of protein folding and even the reaction of a system hit by radiation (7) (8).

It’s even possible to extract macroscopic properties of the system such as pressure and temperature, which are normally associated with our own large world viewpoint. In actuality these properties are just averages of large molecular systems and as such it should not be surprising that we can obtain the information from our atomic simulations; for example air temperature is solely reliant the on the average speed of the nitrogen and oxygen (plus pollutants) that it consists of (3). With the capabilities of MD so wide ranging the scope its application has become hugely diverse, seeing integration into such fields as pharmaceuticals for drug design to food processing for simulations of dough (9) (10).

Partial Molar Volume

The partial molar volume (PMV) as a concept is simple: the volume increase caused when you insert x molecules of substance A into large amount of substance B, Archimedes principle extended for use with the building blocks of matter. However operating at the atomic scale is far more complex than the bathtub of Archimedes’, the volume change relying not just on the size of the solutes but also the strength of their interactions with the solvent and how efficiently the solvent can redistribute to accommodate them. It’s clear to see that when adding different solutes to the same solvent different changes in the overall volume will occur, with even the possibility that if the forces acting between the inserted solute and the solvent are stronger than the solvent-solvent interactions a negative change in volume may occur. In this case the stronger forces from the solute pulling together a clump of the surrounding solvent thereby packing it more efficiently than without its presence, the decrease in volume caused by the efficient packing overshadowing the volume increase caused by the presence of the solute2.

2 An example of this is adding magnesium sulphate to a large quantity of water, the addition of 1 mole of MgSO4 causing an overall decrease in volume of 1.4 cm3 (25).

Although a very interesting physical effect why is the PMV of interest to us as a research topic? The importance lies within the realms of thermodynamics where it appears as a quantity in the equation for the enthalpy of solvation (mixing) and hence its necessity in determining whether heat is given off or taken in when the mixing of substances occurs (3). Of even greater importance is if this system of interest is sealed from the environment, these fluctuations in volume thereby directly influencing the pressure and consequently the rate of any reactions taking place (4). This is a common situation within industry, with many of the reactions in large chemical plants taking place under stringent pressure and temperature conditions set in place so as to maximise yields and hence an understanding of the PMV is essential. Today the level of technology has advanced to such a stage that these changes in volume can now be measured at astonishingly small levels with recent works showing measurements at the ppm levels, one solute molecule for every million solvent molecules (11). With this cutting edge ability to experimentally measure PMV values it would offcourse be favourable to provide theoretical backing to any measurement and as such efforts have been made in developing suitable methodologies to predict volume changes.

The standardised methodology used at present for calculating the PMV revolves around quantum calculations of the solute’s wave function in a dielectric solvent continuum, the solution of the wave function giving all properties of the solute at all point in time (12). Once the wave function is calculated we simply integrate over the region which contains that contains the greatest total proportion of the wave function (>99%), this giving the area in which the solute exerts its presence thereby causing the displacement of solvent. Although this method has been proven to work we found issues when trying to calculate the PMV of small inert gasses; such as hydrogen and carbon monoxide; in various organic solvents. In Table 1 we give our results alongside the experimental values extracted from the works of Handa and Cibulka, from which we can see the huge level of inaccuracy across the board (13) (14) (15). In addition to the theoretical values being drastically low not even the trends across the various solvents were recreated, a clear indication that there must be unconsidered factors. Due to the unsuccessful nature of this technique we approached the use of MD simulations as a replacement, with the hope that it would also provide insight into the formations of the cavities and the dynamics of solutes once solvated, in turn providing reasoning to the failures observed here.

33

34

Table 1. A comparison of experimental PMV with those calculated using DFT

Table 2. A comparison of the simulated solvent densities against experimental values

MeThodology

For our choice of solvents in the simulations we selected on the basis of investigating solvents with both polar and non-polar systems; with and without imbalanced charge distributions; with a particular interest in diethyl ether due to the apparent anomalies shown in its experimental PMVs. The other choices reflected taking the other extreme of the PMV spectrum (methanol/acetone) and a mid-range value (heptane), with this selection also covering our investigation into electrostatic effects; those caused due to electric charges. Our choice of solutes were again based on wanting to cover both polar and non-polar molecules but were more constrained by the experimental data in our choice. We chose hydrogen due to its simplicity and the wide range of data available, with carbon dioxide providing data on large charge imbalances while carbon monoxide provides a middle ground with respect to size and mass.

The parameterisation of the simulation representations of the solvent molecules which describe the forces generated was based solely on the OPLS-aa description, which is known and well documented for its excellent descriptions of organic liquids (16). To confirm that these were modelled correctly we checked the simulated densities of a 5 nm saturated cubic box to experimental values, obtaining densities to within 3% error, as seen in Table 2 (17). Simulations were performed over a period of 5 ns (10 -9 s) using a time step of 1 fs (10-15 s) and a sampling rate of 2 ps (10-12 s) with the first 200 ps removed to accommodate for equilibration, the process whereby the system relaxes in energy from the initial state due to the randomised starting velocities and positions causing imbalances. The time scales used here are roughly on the same

order of magnitude of the movement that occurs within a molecule so as to observe the fastest effects taking place. We keep the conditions of the simulated system at 298 K and 1 atm (lab conditions) by coupling to outside baths using the Berendsen schemes, this causing scaled addition or removal of either temperature or pressure in response to the fluctuations within the simulations (18).

To characterise the solutes we used parameters based upon available literature alongside molecular geometries and charge distributions calculated using quantum methods (19) (20) (21) (22). Using these values as a starting point we would then vary the Lennard Jones parameters as we tried to closely recreate the PMV obtained in a solvent of choice. We are allowed to vary this parameter freely as the Lennard Jones parameters are purely empirical, based on attempting to roughly summate all intermolecular forces (Pauli exclusion and Dispersion) with one equation and thus no physical arguments opposes their variation (23). When applying this method to a solute that has multiple types of atoms we would vary all the parameters in a manner that kept the relative ratios from the initial literature constant. Once the description was aligned to one of the solvent we would then simulate the remaining combinations.

To calculate the PMV of any of the solutesolvent combinations we would insert a varying number of solute molecules; between zero and ten; into the previously generated 5 nm saturated solvent boxes with the subsequent simulations taken place using the same conditions as before. Simply calculating the average change on the volume in each of the systems versus the number of solute molecules inserted produces the PMV i.e. volume per molecule, which can then be converted to standard units.

The Oculus: Proceedings of the U21 UndergradUate research conference

Table 3. A comparison of experimental PMV with those obtained by MD simulations

Figure 2. The simulation volumes for various amounts of hydrogen molecules in an acetone solvent. The results show that linearity is maintained over the entire range and as such we can state that each of the hydrogen solutes cause volume increases independently from the others.

resulTs & dIsCussIon

Before we divulge the full extent of our results we first present Figure 1 in which we give the data set obtained for zero to ten hydrogen diatomics inserted in acetone. This is a perfect representation of our results across the various combinations with no other result showing differences when compared.

The most important aspect of these results is that they maintain a linear nature over the entire range, this showing that the particles inserted are always independent from each other, a requirement via the definition of the PMV which states that insertion should occur in a large excess of the solvent. One would expect the graph to shed this trend when interactions between solutes became sizeable and frequent and since this did not occur we prove that the dilution limit was met. We give all our results in Table 3 alongside the experimental values again for

ease of comparison. What we see is recreation of the PMV in every case to a level of accuracy not achieved before with the quantum calculations. While some inversion of the experimental trends occurs with a few of the simulated values the overall trends are recreated well, with those errors only minor and due to the very close experimental PMVs observed for solutes in acetone and methanol.

In summary, we have successfully obtained the partial molar volume for a diverse range of inert gaseous solutes in organic solvents using molecular dynamics simulations, something unachievable using the standard quantum methodology. Although not mentioned here due to space limitations we direct the interested reader to a paper in the near future where we go on to explain both the source of this extra volume and also give the reasoning behind the failure of the quantum calculations.

35

36 referenCes

1. J.J. Thomson, XXIV. On the Structure of the Atom: an Investigation of the Stability and Periods of Oscillation of a number of Corpuscles arranged at equal intervals around the Circumference of a Circle; with Application of the Results to the Theory of Atomic Structure. Philos. Mag. 6, 1904, Vol. 7, 39, pp. 6-7-39.

2. R.C. Barber, P.J. Karol, H. Nakahara, E. Vardact, E.W. Vogt. Discovery of the elements with atomic numbers greater than or equal to 113. Pure Appl.

Chem. 2011, Vol. 83, 7.

3. P. Atkins, J. Paula. Physical Chemistry, Freeman, 2010.

4. D. Halliday, R. Resnick, J. Walker. Fundamentals of Physics,: Wiley, 2010.

5. L. Verlet. Computer “Experiments” on Classical Fluids. 1.Thermodynamical Properties of Lennard Jones Molecules. Phys. Rev. 1967, Vol. 159, 1.

6. W.H. Miller, I. Prigogine, S.A. Rice. ClassicalLimit Quantum Mechanics and the Theory of Molecular Collisions. Adv. Chem. Phys. 2007, Vol. 25.

7. M. Karplus. Molecular Dynamics Simulations of Biomolecules. Acc. Chem. Res. 2002, Vol. 35, 6.

8. R. Alimi, R. B. Gerber, V. A. Apkarian. Dynamics of molecular reactions in solids: Photodissociation of F2 in crystalline Ar. J. Chem. Phys. 1990, Vol. 92, 6.

9. I.D. Kuntz, Structure-Based Stratergies for Drug Design and Discovery.

Science. 1992, Vol. 257, 5073.

10. R.S. Anderssena, F. Bekesb, P.W. Grasb, A. Nikolovb, J.T. Wood. Wheat-flour dough extensibility as a discriminator for wheat varieties. J. Cereal Sci. 2004, Vol. 39, 2.

11. M. Tjahjono, L. Guo and M. Garland. The development of a response surface model for the determination of infinite dilution partial molar volumes and excess volumes from dilute multi-component data alone. Implications for the characterization of non-isolatable solutes in complex homogeneous . Chem. Eng. Sci. 2005, Vol. 60, 12.

12. M.W. Wong, K.B. Wiberg, M.J. Frisch. Ab initio calculation of molar volumes: Comparison with experiment and use in solvation models. J. Comp.

Chem. 1995, Vol. 16, 3.

13. Y.P. Handa1 and G.C. Benson. Partial molar volumes of gases dissolved in liquids. Part I. Selected literature data and some estimation techniques. FFE. 1982, Vol. 8, 2.

14. Y.P. Handa1, P. J. D’Arcy and G.C. Benson. Partial molar volumes of gases dissolved in liquids. Part II. A dilatometer for measuring infinite-dilution partial molar volumes, and results for 40 liquidgas systems. FFE. 1982, Vol. 8, 2.

15. I. Cibulka, A. Heintz. Partial molar volumes of air-component gases in binary liquid mixtures with n-alkanes and 1-alkanols at 298.15 K. FFE. 1995, Vol. 107, 2.

16. W.L. Jorgensen, D.S. Maxwell, J. Triado-Rives.

Development and Testing of the OPLS All-Atom Force Field on Conformational Energetics and Properties of Organic Liquids. J. Am. Chem.

Soc., 1996, Vol. 118, 45.

17. P. Linstrom, W. Mallard NIST Standar Reference Data.

National Institute of Standards and Technology, 2011.

18. H. J. C. Berendsen, J. P. M. Postma, W. F. van Gunsteren, A. DiNola, J. R. Haak Molecular dynamics with coupling to an external bath.. J. Chem. Phys., 1984, Vol. 81, 8.

19. J.L. Belof, A. C. Stern, B. Space. An Accurate and Transferable Intermolecular Diatomic Hydrogen Potential for Condensed Phase Simulation. J. Chem. Theory Comput. 2008, Vol. 4, 8.

20. J.P. Bouanich, Site-site Lennard-Jones potential parameters for N2, O2, H2, CO and CO2. JQSRT . 1992, Vol. 47, 4.

21. H.F.P. Knaapa, J.J.M. Beenakke. The LennardJones 6–12 potential parameters of H2 and D2.

Physica. 1961, Vol. 27, 6.

22. C. Cadena, J.L. Anthony, J.K. Shah, T.I. Morrow, J.F. Brennecke, E.J. Maginn. Why Is CO2 So Soluble in Imidazolium-Based Ionic Liquids? J. Am. Chem. Soc. 2004, Vol. 126, 16.

23. J.E. Lennard-Jones, On the Determination of Molecular Fields, Proceedings of the Royal Society of London, 1924.

24. W. H. Koppenol. Naming Of New Elements. Pure Appl. Chem. 2002, Vol. 74, 5.

25. M. L. Paramar, P. Sharma, M. K. Guleria. A compartive study of partial molar volumes of some hydrated and anhydrous salts of transition metal sulphates and magnesium sulphate in water at different temperatures. Ind. J. Chem.

2009, Vol. 48, A.

aCknowledgMenTs

Our deepest regards are given to my project supervisors Daniel Cheong Wee Loong and Marco Klähn. We gratefully acknowledge Philip Bailey who without this work would have never been undertook and would also like to thank Marc Garland, Martin Tjahjono and Shuying Cheng for their contributions and discussion throughout this work.

The Oculus: Proceedings of the U21 UndergradUate research conference

Pyrolysis of Plastic Materials for the Production of Fuel in a Batch Reactor Niancen W. Miao

University of Auckland

absTraCT

The wide application of plastics in today’s society has resulted in large amount of plastic waste being generated. As traditional treatment methods such as recycling and incineration have certain limitations, these chemically inert wastes are generally disposed in landfills, where they can persist for many years before decomposition. The purpose of this study is to investigate the thermal degradation of plastics through pyrolysis in a large batch reactor. It was found that under the experimental conditions, the solid plastic materials completely dissociated into gaseous and liquid products. The dominant components of the liquid oil, as revealed by Gas Chromatography, were alkanes and alkenes. These compounds have the potential to be further processed into fuel and other useful chemicals.

InTroduCTIon

P

lastics are polymeric materials derived from petroleum and natural gas, which are nonrenewable in nature. In New Zealand, only 24% of the plastic wastes are currently recycled, resulting in approximately 252,000 tonnes of plastic being disposed in landfill each year. Due to their durability, these “waste” materials can occupy up to 20% of the landfill space [1]. Mechanical recycling is severely constrained by the limited application of recycled product, and the amount of times plastics can be recycled. Another common method of plastic disposal and recovery is incineration [2]. However, incineration is generally not viewed as a viable route in New Zealand as toxic substances such as dioxins are released, making it simply a process of transferring wastes from ground to the atmosphere [3]. However, pyrolysis has emerged in the past decade as an attractive alternative to traditional thermal processes. Advantages of this process include reduction in landfill volume and recovery of energy and other useful chemicals, hence avoiding feed-stocks from other non-renewable sources being used for the same purpose [3].

Pyrolysis, Greek for “fire-separating”, refers to the process of decomposing solid substances at an elevated temperature in the absence of air or oxygen [4]. For plastic polymers such as Polyethylene (PE), this refers to the breaking of the Carbon-Carbon backbone of the molecule into low-molecular products at a temperature above 500oC1. As this is an endothermic process, energy is required to cleave the bonds. Inert anaerobic atmosphere maintained during the thermal decomposition process prevents burning of plastics and hence formation of oxidative compounds.

It is generally accepted that the basis of this route is free radical chain reaction [5]. The steps involved in such mechanism are well studied, and 1 At this temperature there is enough thermal energy to initiate the free radical mechanism

generally include initiation, chain transfer, chain cleavage and termination [6]. As these reaction steps can randomly occur at any location along the plastic polymer chains, the cleaved product molecules follow a wide distribution in chain length [7]. As the variation in chain length leads to variation in boiling point, the product material will separate into a gaseous and a liquid (oil) fraction. In the past, pyrolysis of plastic materials in a batch setting has been done extensively, however, only on a much smaller scale [8-11]. The main purpose of this study is to investigate the principle of batch pyrolysis on a much larger scale.

MeThods

A new 3-litre (250mm id, 600mm height) batch reactor has been designed and built for this experiment the schematic of which is shown in Fig. 1.

During the first stage of this study, the result of which is summarised by this paper, virgin Low Density Polyethylene (LDPE) feed was used. The plastic materials are charged into the Stainless Steel reactor once weighted. The reactor is then sealed, and nitrogen introduced to prevent ingress of oxygen or air. Heat is provided to the reactor

Figure 1. Batch Pyrolysis Reactor with Condenser Attached.

37

38

Figure 3. Chromatograph of “Pyro #1” liquid fraction

Figure 4. Chromatograph of “Pyro #2” liquid fraction

Table 1. Pyrolysis Conditions and Product Yield Results

through the coils on either side of the vessel to desired reaction temperature, which is measured by the thermal couples and controlled by the control panel. When reaction commences, the product exits the reaction chamber as a vapour through the top and enter the condenser, where it is cooled from the reactor temperature to around 70oC. The condensed liquid drains from the bottom of the condenser into a collection bottle (not shown) while any uncondensed vapour would exit the condenser through an outlet which is connected to an extraction fan. The liquid product is finally weighted, and examined in the Gas Chromatography (GC) assay.

Pyrolysis runs were performed on two batches of LDPE feed, with mass of 500g and 1kg respectively.

During both experiments, the reactor temperature was increased step-wise from room temperature to 550oC, in 50oC increments. The nitrogen flow was set at a rate of 80 ml/min, and then switched off once the reactor temperature reached 300oC. The GC equipment was Schimadzu-GC17A with a 20 m, 0.18 mm ID, 0.18 μm column equipped.

Cyclohexane was chosen as the solvent and direct split-less injection with injection volume of 1μl was employed as the injection method.

resulTs and dIsCussIon

The pyrolytic conditions and product yield for both runs are summarised in Table 1.

It must be noted, that due to poor design, some liquid was unable to be captured, and was subsequently deposited in the vapour vent line.

After weighting the deposited liquid inside the vent line, it was found that this liquid is approximately 15% of total plastic mass. Therefore, it is estimated that the liquid yields recorded in Table 1 above were around 15% lower than the actual liquid yield.

An image of the liquid oil generated through this process is shown in Fig. 2.

The Chromatographs of the liquid portion of the two products “Pyro #1” and “Pyro #2” are also shown below in Fig. 3 and Fig. 4, respectively. The

peaks in each chromatograph have been identified base on the retention time of these peaks2.

The amount of plastic fed and the energy required for complete reaction are directly proportional. In a batch reactor, where the rate of energy input is constant, it was expected that the reaction time is also directly linked with the mass of plastic loaded. Such relationship was observed in this study, as shown in Table 1.

Both runs yielded a liquid yield of approximately 75 - 80% (taking into account of the 15% loss through vapour vent line), a result that is comparable with previous works which were carried out on a much smaller scale [8-11]. This demonstrates that the process of thermal decomposition of plastic material process is still applicable after scaling up, making commercial-scale pyrolysis for plastic waste treatment technologically possible. After both runs, no solid residues were found inside the reactor, indicating that charring was not an issue associated with LDPE. This is again congruent to results presented in previous small-scale studies [811], and further shows the viability of scaling-up of this process.

The gas product is mainly comprised of very short hydrocarbon molecules. If captured, this high energy product can be directly combusted to provide heat for the thermal decomposition reactor.

The GC assay on the liquid product from both experiments revealed similar product distribution, as shown in Fig. 1 and Fig. 2. The lighter fractions below C13 overlapped with the solvent peak (cyclohexane), and thus could not be identified.

However, peaks from C13 up to C35 were identified, showing the distribution of carbon chain length in the product. This result is supported by other work [7], and also further confirmed the occurrence of random cleavage along the carbon chain occurred during thermal decomposition. For each peak, there 2 Peaks are labelled with letter “C” – Carbon, and a number indicating the number of carbon atoms in the product molecule chain

The Oculus: Proceedings of the U21 UndergradUate research conference referenCes

Figure 2. Liquid Pyrolytic Oil â&#x20AC;&#x201C; the Main Product of Pyrolysis

were two compounds responsible, the saturated alkane and the unsaturated alkene. As LDPE molecule is a straight carbon chain with only C-H functional group (essentially a very long alkane molecule), the cleaved molecules are usually smaller chains of alkane or alkene. Alkenes were formed along side of alkanes, as Carbon=Carbon doublebounds were created at the location of cleavage. The presence of both alkane and alkene can also be seen in both Fig. 3 and Fig. 4 as the branching at the top of the peaks (indicating two very similar compounds of the same carbon chain length).

As the product liquid is mainly comprised of alkane and alkene, this pyrolytic oil has the potential to be further processed into a variety of fuel products. The lighter fraction, typically below C16, falls in the gasoline and diesel range, whereas the heavier fraction can be used either as commercial candle wax, or be further cracked into lighter products. However, to separate this liquid bulk into cuts of narrower distribution molecule sizes, fractional distillation is required.

ConClusIon

From the results of this study, it is shown that batch pyrolysis can successfully convert plastics into a range of fuel worthy chemicals and materials on a larger scale. Up to 80% of the product yielded was liquid oil, which mainly consists of alkane and alkene with carbon chain length below 35. This product can be separated through distillation, and be further processed into fuel worthy compounds. The remaining product is entirely a gas of high energy content, as there was no solid residue formed during the process.

fuTure work

In the subsequent parts of this study, all the components in the pyrolytic product distribution will be quantified. This result will enable an optimum yield of lighter components in the diesel or gasoline range to be found by altering the conditions of pyrolysis.

1. NZ Recycling Statistics. Plastics New Zealand Inc. 2011 [March 2011]; 2. Goodship, V., Plastic recycling. Sci. Prog. (St. Albans, U. K.), 2007. 90: p. 245-268.

3. Withington, N., Sustainable End-of-Life Options for Plastics in New Zealand, in Research Project Report. 2005, Plastics New Zealand Inc. 4. Demirbas, A., Gaseous products from biomass by pyrolysis and gasification: effects of catalyst on hydrogen yield. Energy Conversion and Management, 2002. 43(7): p. 897-909.

5. Scheirs, J., Kaminsky, W. (editors). Feedstock Recycling and Pyrolysis of Waste Plastics, 2006: John Wiley & Sons, Ltd. 6. Buekens, A.G. and H. Huang, Catalytic plastics cracking for recovery of gasoline-range hydrocarbons from municipal plastic wastes.

Resources, Conservation and Recycling, 1998.

23(3): p. 163-181.

7. Demirbas, A., Pyrolysis of municipal plastic wastes for recovery of gasoline-range hydrocarbons. Journal of Analytical and Applied Pyrolysis, 2004. 72(1): p. 97-102.

8. Williams, E.A. and P.T. Williams, The pyrolysis of individual plastics and a plastic mixture in a fixed bed reactor. Journal of Chemical Technology & Biotechnology, 1997. 70(1): p. 9-20.

9. Demirbas, A., Gaseous products from biomass by pyrolysis and gasification: effects of catalyst on hydrogen yield. Energy Conversion and Management, 2002. 43(7): p. 897-909.

10. Siddiqui, M.N. and H.H. Redhwi, Useful liquid products from the pyrolysis of mixed plastics.

Prepr. Symp. - Am. Chem. Soc., Div. Fuel Chem., 2007. 52: p. 761-762.

11. Marco, I.d., et al., Recycling polymeric wastes by means of pyrolysis. Journal of Chemical Technology & Biotechnology, 2002. 77(7): p. 817824.

aCknowledgMenTs

The author would like to acknowledge his supervisors, Prof. M. Farid and Dr. S. Behzadi, for the insightful guidance afforded to this project.

Sincere appreciation is also extended to the family members of the author, for their strong support and immense understanding throughout this research.

39

40

Unraveling the Secrets of Neuronal Friendship: The Role of EphA4 Expression in Network Activity and Spine Maturation Jessleen K. Kanwal University of Virginia

absTraCT

The pattern of synaptic connectivity dictates the function of a neural network. The specificity of this connectivity is determined at the developmental stage as well as during learning. Developing neurons form specific connections with their targets (other neurons) via electrical and chemical synapses. The connectivity in chemical synapses is directed and possibly maintained via transmembrane signaling molecules that facilitate in intercellular communication, leading to the establishment of a synaptic connection as well as synaptic refinement. My research was aimed at characterizing the influence of one such signaling molecule designated EphA4. With guidance from my mentors, I demonstrated the role of EphA4 in synapse formation in cortical neurons on the basis of morphological observations and physiological assays employing a dense multi-electrode array. Treatment with EphA4 led to a significant increase in the number and density of mature versus immature dendritic spines, even though spine number and density were similar between the control and treatment conditions. Additionally, in vitro recordings of spiking activity in developing neurons maintained in culture demonstrated that when EphA4 was over-expressed in a subset of cultured neurons, network activity was significantly enhanced, as bursts of spiking in single neurons were longer than those in control cultures. These results demonstrate that experimental elevation of EphA4 facilitates in spine maturation, which promotes patterning of network activity in developing neurons. This is likely a result of a rise in functional synaptic pairings within the network.

InTroduCTIon

I

mpairment of social interaction and communication with others are two of the more common characteristics associated with patients of Autism spectrum disorders (ASDs), a form of neurodevelopmental disorder for which the exact etiology remains unknown.

Typically, autistic children lack coordination and an interest to engage and verbalize with others, including the caregiver [1]. Common examples of social behavior disturbances include images of an autistic child playing separately, away from a group of other children, or refusing to participate in pretend play; instead, choosing to remain intensely fixated on a single system or object. Interestingly, studies have shown that the same type of disconnect and lack of communication that occurs behaviorally may also be occurring among the neurons in the brains of autistic patients [1].

Normally, as we grow and develop, the neurons in our brain are forming thousands of synaptic connections with target cells—other neurons located in different regions of the brain.

A complex and flexible social network is created as neurons send messages, in the form of electrical bursts, to one another in order to communicate information needed to carry out mental and physical tasks such as reading a paper or walking to school.

However, much like the personal relationships we make over our lifetime, the formation of connections between neurons is a highly dynamic process,

especially during the time when a child’s brain is growing and developing. Proper, efficient cellular communication is dependent on the neurons’ ability to adjust previously formed connections, which can be done either by making such bonds stronger, or pruning away unnecessary contacts and instead creating new links with other target cells.

In particular, dendrites and axons, the tree branch-like extensions from a neuron’s cell body, are responsible for making connections and transmitting signals along a pathway of synaptically connected neurons. Axons are lead by specific intercellular signaling molecules, which are able to guide these neural extremities in the proper direction and through the complex web of fibers that make up the brain. In patients with autism, there is a disconnect between brain regions, and it is hypothesized that this disruption in connectivity is what leads to the behavioral symptoms previously described in those with autism [2]. Essentially, the neurons in the brain become isolated, no longer seeking target cells to form connections with and thus impair the transmittance of signals from one area to another.

Similar to the socially isolated behavior of autistic children, neurons in the brain can be characterized as becoming socially inactive and ineffective communicators as the brain develops. However, it is unknown whether this developmental disconnect occurs because of a weakening of already established connections or the inability of certain neurons to form proper connections in the first place. In an attempt

The Oculus: Proceedings of the U21 UndergradUate research conference to better understand what could lead to a disconnect between neurons in a network as well as the dynamic changes that occur during brain development, this study focuses on the impact of an intracellular signaling molecule, EphA4, and how it mediates cellular communication and network activity.

Eph proteins are transmembrane receptors that bind to ephrin ligands on neighboring cells and are well-expressed in the developing forebrain [3,4,5,6]. Previous studies have shown that EphA4 overexpression in hippocampal neurons increases the density of dendritic spines, which are minute, thorny protrusions from branches of dendrites.

EphA4 receptors are present on the membrane of these spines and thus are located where neurons make contact with each other. Furthermore, a study on hipoccampal cultures showed that the knockdown, or reduction, of EphA4, reduced spine maturity [7]. The level of spine maturity is a measure of the strength with which two neurons are synaptically connected and thus indicates how well two neurons can communicate with each other.

A more mature spine is said to correlate with a strong connection between neurons and thus better passage of information from one cell to the other.

Little is known, however, about the consequences of EphA4-mediated signaling on dendritic spines in the cerebral cortex. Thus, experiments performed here were conducted using primary cultures of neocortical neurons and results were analyzed to examine the effect of overexpressing EphA4 on dendritic spine maturation.

In parallel, to the morphological observations on the effects of EphA4, physiological analysis was performed to assess how the activity levels among neurons changes during development. Experiments were performed using a multielectrode array (MEA) recording system, consisting of an 8×8 grid of extracellular electrodes embedded within a silicon substrate, that is designed to record from in vitro neural networks at multiple locations [8]. The advantage of such a recording system is that it allows for the analysis of how neural network dynamics change over time as well as over space.

Our results demonstrate that elevated levels of EphA4 in some cultured neurons shifted spontaneous network dynamics, increasing both the duration of network bursts and the number of spikes per burst as well as altering the frequency of bursting in the cultures. In parallel with these physiological shifts, morphological analyses revealed that dendritic spines on EphA4overexpressing cortical neurons were significantly more mature than those on control cells. Together, enhanced network activity and more mature postsynaptic dendritic compartments support a role for EphA4 in promoting synaptic communication as developing cerebral cortical neurons form mature, functional circuits within the brain.

MeThods

Ex-utero Transfection (Eue), Preparation, And Culturing Of Neocortical Neurons

Prior to plating, each MEA device was first coated with 6.25 μg/ml poly-D-lysine for one night and then 6.25 μg/ml of laminin (Roche) the following night. To transfect the cells, EUE of cortical neurons was performed. At embryonic day 15.5, mouse embryos were removed from the amniotic sac and a solution of DNA was injected into the ventricular system (Figure 1). In all conditions, one-quarter of the injected DNA corresponded to a plasmid encoding green fluorescent protein (GFP). Current pulses delivered by tweezerodes (BTX) were then applied across the embryonic head in order to deliver DNA to the cells lining the ventricles.

Following electroporation, cortical neurons were removed, dissociated, and plated onto MEAs at a density of 200,000 cells/MEA. Using this method, 0.1 to 1% of cells in the resulting cultures successfully absorbed the plasmid. The cultures were covered with a gas permeable Teflon membrane to prevent evaporation of media and kept in a humidified chamber maintained at 37°C and 5% CO2. Cultures were monitored daily and provided fresh media every other day, or more frequently as the neurons matured.

Spine Analysis

To assess cell morphology, cortical neurons were transfected with either the control plasmid or full-length EphA4 and an actin-GFP [9] plasmid to label spines. Cells were then plated on laminincoated coverslips at the same density as the MEAs. After 14 days in vitro (DIV), the cells were fixed, immunohistochemistry was performed to enhance the GFP signal (rabbit anti-GFP, 1:3,000; Invitrogen) and to label PSD-95 puncta (mouse anti-PSD-95, clone K28/43, 1:1,000; UC Davis/NIH NeuroMab Facility).

Using fluorescent microscopy (100X), characteristics of dendritic spines were assessed in both controland EphA4-transfected cortical neurons (n = 25 per experiment, 3 experiments).

MEA Recording System

Embedded in the center of each MEA device is an 8×8 square grid of 30 μm diameter titanium nitride electrodes with 200 μm inter-electrode spacing. This recording technique provides a non-invasive method of simultaneously recording electrical activity from up to 60 planar microelectrodes and allows for the monitoring of neural activity over several weeks.

Twenty minutes of neural activity were recorded from each culture on day 7 and continued every 2 to 3 days for the following 2 weeks. To record activity, the MEA was placed in a 37°C preamplifier headstage that was connected to a computer (total gain was 1100X). Electrical activity was sampled at 25 kHz and the recorded data were used to quantify

41

42

Figure 1. Experimental design. (A) To transfect cortical neurons, EUE was performed: a DNA solution (green) was injected into the ventricular system of an embryonic day 15.5 mouse brain (left), current was applied across the head (middle), and cells of the ventricular zone (VZ) transfected (right). Cortical cells were dissociated and plated under conditions that promote neuronal differentiation, either into MEA chambers to monitor neural activity (top) or onto coverslips for morphological analyses (bottom). (B) MEA device with an 8Ă&#x2014;8 grid of electrodes. (C) Transfected neurons plated into MEA flouresce green within 24 hours of EUE. (D) Snapsot of spontaneous activity arising from the developing cortical network. (E) In culture, cortical cells differentiate and form complex neural network. (FH) Dendritic spines from the second dendritic branch (F) of transfected neurons were imaged (G) and their shape was characterized according to the scheme shown (H). Figure 1 courtesy of Meredith Clifford, adapted from Clifford et al. [13].

bursting dynamics generated from the spontaneous firing of neurons from each electrode (Figure 1).

Cultures from three separate experiments were examined per group for each analysis. Statistical analyses were conducted to test for significant differences between the control and EphA4-treated conditions.

Burst Analysis

A burst detection algorithm was used to quantify the bursting patterns from the cortical cultures. After recording, the data were high-pass filtered at 25 Hz, and Offline Sorter (Plexon, Inc., Dallas, TX, USA) was used to detect the time of each spike. Spike detection was based on a threshold, defined as 5 standard deviations away from the biological noise. The time-stamps at which each spike occurred were saved and imported into a proprietary burst analysis program written in Matlab (Natick, MA, USA). For our experiments, a burst was defined to have a minimum number of 20 spikes and a maximum interspike interval of 20 milliseconds. Ten minutes of recording from 60 electrodes were analyzed for each time point.

and immature spines were then calculated for each cell and the data from cells of three experiments were summed together. Altogether, this analysis demonstrated that neurons transfected with EphA4 had a significantly greater proportion of spines classified as mature spines in comparison to control cells (mean control = 0.30 Âą 0.03 versus EphA4 = 0.44 Âą 0.03) (Figure 2). Thus, neurons over-expressing EphA4 consisted of more morphologically mature synapses than control neurons, which suggests that there are more excitatory connections among neurons in the network and that the synaptic connections that have formed among these neurons are strong enough for messages to be reliably transmitted from one cell to another.

resulTs and dIsCussIon

The morphology of cortical cultured neurons was examined in order to discern differences between control and EphA4-transfected neurons.

Analysis was performed 14 days after cell cultures were plated. Mature and immature spines were categorized using a dendritic spine morphology rating scheme [10]. Each unique spine shape was classified as type 1 through 8, with types 1 to 5 considered immature and types 6 to 8 considered mature spines (Figure 1). The proportions of spines of a given shape and the total number of mature

Figure 2. Characteristics of dendritic spines in control and EphA4-transfected neurons at 14 days in vitro. (A,B) Representative dendrite images with protruding dendritic spines in control (A) and EphA4 (B) transfected neurons. Yellow cirlce highlightes an example of an immature spine in control, while red circle highlightes a mature spine in EphA4 transfected condition.

(C) Neurons overexpressing EphA4 have a significantly higher proportion of mature dendritic spines compared to control neurons (**P < 0.01 as determined using ANOVA). Figure modified from Clifford et al. [13].

The Oculus: Proceedings of the U21 UndergradUate research conference Additionally, electrical recordings were preformed to listen in on the neurons and see how active the cells were as well as how the dynamics, or activity levels, of the entire network of neurons changed over time. Analysis of network dynamics was performed at 7 and 14 days after cells were first plated. Cortical networks can display single spiking, quick spurts of electrical activity, and bursting activity (Figure 3). The bursting patterns are characterized by periods of continuous spiking at a relatively high rate and are most typical in mature dissociated cultures of cortical neurons. The duration of bursts can vary but generally last on the order of hundreds of milliseconds. In dissociated cortical cultures, bursts are separated by periods of silence, or little to no activity [11]. These spiking and bursting patterns make up the language of neurons, as they communicate to one another, and thus were the focus of analysis for these experiments.

The results show that cultures overexpressing the EphA4 receptors, displayed a significant increase in burst duration, when compared to the control.

After growing for 7 days, cells in cultures that were transfected with EphA4 fired longer bursts than those fired by cells in control cultures (mean = 211.2 ± 4.9 ms in EphA4 versus 182.5 ± 3.3 ms in control; Figure 4). A similar motif was found when analysis was performed of the neural networks at 14 days after initial plating, with EphA4-transfected cultures exhibiting an increased duration of bursts (mean = 248.9 ± 2.0 ms for EphA4 versus 214.2 ± 1.4 ms for control). Together, these results indicate that networks of neurons with elevated levels of EphA4 are more active. Not only is it evident that the neurons communicate more with each other, from listening to the duration over which spiking activity occurs (length of the neural “conversations”) via an audio monitor where each spike is heard as a tone pip, but also from microscopic observations and quantification of the increase in the proportion of mature dendritic spines after EphA4 treatment compared to the control condition.

One plausible hypothesis for the underlying reason why elevating EphA4 levels leads to such a dramatic shift in network dynamics, may be explained by examining a neural feedback model.

Generally, the associations formed among neurons contain both excitatory and inhibitory connections, where inhibitory synapses regulate the network by preventing activation of some neurons. It is possible that with enhanced levels of EphA4, the excitatory connections become so strong that they override the inhibitory feedback, making it harder to control and down-regulate the firing of neurons. As a result, the inhibitory connections may be gradually pruned so that they no longer form synapses with their target cells. Such a paradigm would suggest that a stronger and more active network of neurons is forming, but one in which essential negative feedback is slowly disappearing and hence may be an explanation of why we see the excessive levels of electrical firing in the EphA4-transfected neural networks.

The parallels between the shifts observed in cortical neuronal network activity and dendritic spine characteristics when EphA4 is up-regulated with results from other neural systems [7, 12] lead to the conclusion that Eph-mediated signaling may be an important means of modulating synaptic formation and function across the nervous system.

It can be inferred that the down regulation of EphA4 would lead to the opposite effects of reduced activity, such as the presence of more immature spines and fewer connections in general. Such characteristics are similar to those described earlier in the brain of patients with Autism. Thus, one possibility of the molecular basis for the onset of Autism could be that the levels of EphA4 receptors are greatly reduced, which would likely lead to the more “socially isolated” neural network.

Further experiments need to be done to test this hypothesis and examine how EphA4 expression may be altered in the developing brain of children who later suffer from an autism disorder, which is likely due to a defect in synaptic connectivity.

Figure 3. Spontaneous activity is in form of bursting and spiking. (A) Single lines represent single spike firing of a neuron. Together the spikes make-up a unit termed a “burst”. (B) Electrical recording of activity from a single neuron over time. Each box represents spiking activity recorded from a single electrode over a period of 2 seconds. Boxes outlined in grey are examples of bursts.

43

44 referenCes

Figure 4. Mean values for burst duration at 7 and 14 DIV. Average burst duration in control (C, white) and EphA4transfected (A4, black) primary cortical networks at 7 DIV (left) and 14 DIV (right). EphA4 transfected networks have significantly longer bursts than control networks at both time points. Bursts at 14 DIV are significantly longer than bursts at 7 DIV in both groups. (***P < 0.0001 as determined using ANOVA). Figure modified from Clifford et al. [13].

aCknowledgMenTs

This research was performed in conjunction with Meredith Clifford, a student in the Interdisciplinary Neuroscience Graduate Program at Georgetown University.

Meredith Clifford also participated in experimental design and the collection and analysis of data, and I would like to give her special thanks for her guidance and mentoring.

The research was performed in the laboratories of Dr. Maria Donoghue and Dr. Rhonda Dzakpasu at Georgetown University, who also greatly assisted in the formulation of experimental design and provided much insight during the experimentation process. Additionally, I would like to thank Xin Chen for writing the burst analysis algorithm and Mustafa Sahin for the full-length EphA4 construct.

Financial contributions were made by the Luce Foundation. Lastly, a version of this paper appeared in the Journal of Neural Development [13]. Figures were modified and reprinted with permission.

1. Belmonte MK, Allen G, Beckel-Mitchener A, Boulanger LM, Carper RA, Webb SJ: Autism and Abnormal Development of Brain Connectivity.

J Neurosci 2004, 24(42):9228-9231.

2. Geschwind DH, Levitt P: Autism spectrum disorders: developmental disconnection syndromes. Current Opinion in Neurobiology 2007, 17(1): 103-111.

3. Gale NW, Holland SJ, Valenzuela DM, Flenniken A, Pan L, Ryan TE, Henkemeyer M, Strebhardt K, Hirai H, Wilkinson DG, Pawson T, Davis S, Yancopoulos GD: Eph receptors and ligands comprise two major specificity subclasses and are reciprocally compartmentalized during embryogenesis. Neuron 1996, 17:9-19.

4. Pasquale EB: Eph-ephrin bidirectional signaling in physiology and disease. Cell 2008, 133:38-52.

5. Yun ME, Johnson RR, Antic A, Donoghue MJ: EphA family gene expression in the developing mouse neocortex: regional patterns reveal intrinsic programs and extrinsic influence. J Comp Neurol 2003, 456:203-216.

6. North HA, Zhao X, Kolk SM, Clifford MA, Ziskind DM, Donoghue MJ: Promotion of proliferation in the developing cerebral cortex

by EphA4 forward signaling. Development 2009, 136:2467-2476.

7. Inoue E, Deguchi-Tawarada M, Togawa A, Matsui C, Arita K, Katahira-Tayama S, Sato T, Yamauchi E, Oda Y, Takai Y: Synaptic activity prompts gamma-secretase-mediated cleavage of EphA4 and dendritic spine formation. J Cell Biol 2009, 185:551-564.

8. Xing W-L, Cheng J: Frontiers in Biochip Technology.

New York: Springer; 2006.

9. Fischer M, Kaech S, Knutti D, Matus A: Rapid actin-based plasticity in dendritic spines.

Neuron 1998, 20:847-854.

10. Irwin SA, Galvez R, Greenough WT: Dendritic spine structural anomalies in fragile-X mental retardation syndrome. Cereb Cortex 2000, 10:1038-1044.

11. Wong RO, Meister M, Shatz CJ: Transient period of correlated bursting activity during development of the mammalian retina. Neuron 1993, 11:923-938.

12. Filosa A, Paixao S, Honsek SD, Carmona MA, Becker L, Feddersen B, Gaitanos L, Rudhard Y, Schoepfer R, Klopstock T, Kullander K, Rose CR, Pasquale EB, Klein R: Neuronglia communication via EphA4/ephrin-A3 modulates LTP through glial glutamate transport. Nat Neurosci 2009, 12:1285-1292.

13. Clifford MA, Kanwal JK, Dzakpasu R, Donoghue MJ: EphA4 expression promotes network activity and spine maturation in cortical neuronal cultures. Neural Development 2011, 6:21

The Oculus: Proceedings of the U21 UndergradUate research conference

Metallothionein Gene Dose and the Immune Response Meaghan Roy-O’Reilly University of Connecticut

absTraCT

Metallothionein (MT) is a small, cysteine rich protein with significant immunomodulatory activity (1).

MT production is upregulated in response to numerous cellular stressors and works to lessen the harmful effects of reactive oxygen species (ROS) and heavy metals (2). Recent studies have shown that the dose of the metallothionein gene present in an individual may have significant effects on the adaptive immune response, yet the mechanism behind this phenomenon remains unknown. We have shown that there is a significant difference in lymphoproliferative response during immunological stress between three mouse strains that produce different amounts of metallothionein due to gene manipulation. Further investigation is needed to determine whether the hyperproliferation of the knockout (MTKO) murine strain is a result of increased oxidative stress and damage due to the lack of functional metallothionein. Insight into these MT gene disparities may help lay the groundwork for future autoimmune disease therapies.

InTroduCTIon

M

etallothionein (MT) is a thiol-rich, low molecular weight protein (1). An abundance of cysteine residues enables MT to scavenge reactive oxygen species and bind both heavy and essential metals (2). Extracellular metallothionein has been shown to cause both chemotaxis and proliferation of lymphocytes, indicating that it plays an important role in the amplification of the immune response.

The MT1 and MT2 isoforms of the protein are present at basal levels in all mammalian tissues (3).

MT is upregulated in response to numerous cellular stressors, including endotoxin, heavy metals and ROS. The capability of MT to bind up to eight zinc molecules is crucial to its role as an immunomodulatory protein. In controlling the availability of free zinc, MT has significant downstream effects on metalcontaining structural proteins and enzymes (4). It has also been shown that low metal availability during infection can inhibit the growth of bacteria that require these essential metals. This ability to bind and sequester toxic metals has been shown to be vital for cellular survival; metallothionein null individuals are more susceptible to heavy metal toxicity than their wildtype counterparts (1).

Metallothionein is also capable of scavenging free oxygen and nitrogen species, thereby altering the tissue redox state (1). When an organism undergoes bacterial infection, the cells of the innate immune system initiate what is known as a “respiratory burst” in which they release ROS and RNS, damaging the bacterial cells. Although intended as a bacteriocide, these free radicals may also cause significant bystander damage to nearby host cells. In mammals, the presence of these ROS upregulate the production of MT, which in turn scavenges and neutralizes the free radicals in order to protect against oxidative damage to the host cells. Metallothionein has 18-

23 free cysteine residues that render it capable of binding ROS and preventing oxidative injury that may result during stressful conditions like radiation and hyperoxia. Recent studies have shown that it acts to protect numerous body systems from toxic amounts of oxidant, including the liver, kidneys and cardiac tissues (5).

The important roles that metal sequestration and redox state play in the immune response may indicate that overall amount of functional metallothionein may also have significant immunomodulatory effects. Mice injected with metallothionein produce a reduced humoral immune response when challenged with a T-cell dependent antigen, an effect that can be blocked by anti-metallothionein antibodies (6).

Injection of metallothionein has been shown to reduce the progression and severity of collagen induced arthritis and experimental autoimmune encephalitis (7, 8). In addition, it has been used as a potential therapeutic to lessen the effects of streptozotocininduced diabetes and cardiac ischemia (9, 10).

Studies have shown that when challenged with ovalbumin, mice that posses a target disruption of the MT genes (C57BL6/J-MT1tm1Bri and MT2tm1Bri, designated as MTKO mice) were found to produce much higher levels of antibody than their wild type counterparts (11). Flow cytometry analysis from MTKO mice showed an upregulation of CD4+ and CD8+ T-cells.

This “immunological priming” of MTKO mice also alters their response to pathogens. Three congenic mouse strains were infected with Listeria monocytogenes; the wild type (WT) C57BL6 strain, the knockout (MTKO) strain and the transgenic (TG) strain C57BL6/J-Tgn(Tm1)174Bri, which overexpresses MT due to 112 gene copies. Surprisingly, both the transgenic and knockout strains were more resistant to infection than the control C57BL/6; there appears to be a significant advantage to having either low or

45

46 high gene doses of metallothionein (12). In addition, MT gene dose has also been found to suppress the advance of rheumatoid arthritis in mice, pointing to the protein as a potential target or treatment of certain autoimmune diseases (13).

If the means by which extreme levels of metallothionein affect the immune response can be characterized, it may enable the development of more targeted therapies that will allow augmentation of a patient’s innate immunity and suppression of debilitating autoimmune disorders. Lymphocyte proliferation is one of the key steps in any immune response; we hypothesize that examining the differences in cellular proliferation between MT transgenic, wild type and knockout mice will yield significant insight as to the importance of the amount genetic metallothionein within an organism.

MaTerIals and MeThods Cells

Primary lymphocytes were re-suspended in complete M199 media (5% FBS, .1mM non-essential amino acids, 1 mM sodium pyruvate, 1 mM l-glutamine, 50 ug/ml gentamycine and sodium bicarbonate). They were incubated at 37 degrees in a special gas mixture (10% CO2, 7% O2, 83% N2) in order to reduce oxidative stress and prolong cell survival.

Figure 1. Dosage curve of WT, KO and TG mouse strains treated with Concanavalin A (ConA). The primary splenocytes isolated from C57BL6/J-MT1tm1Bri (MTKO), C57BL6/J-Tgn(Tm1)174Bri (MT-TGN) and C57BL/6 (WT) mice were cultured in the presence of 5ug/ml (a) or 10 ug/ml (b) Concanavalin A (ConA).

The cultures were aliquoted into 96-well plates and incubated at 37 degrees in a reduced oxidative environment. The Cell Titer Glo assay was used to quantify proliferation at 24h, 48h and 72hours post-stimulation.

Mouse Strains

All of our experiments utilized primary splenocytes from age and sex-matched from C57BL6/J-MT1tm1Bri (MTKO), C57BL6/J-Tgn(Tm1)174Bri (MT-TGN) and C57BL/6 (WT) mice obtained from our own breeding stock kept at the AAALAC accredited University of Connecticut vivarium. The protocols for all of our proposed experiments were submitted and approved by IACUC.

Cell Titer Glo Assay

Proliferation was assayed with the Promega Cell Titer-Glo Assay, which utilizes luminescence to quantify cellular ATP levels as an indication of cell population size. Luminescence was measured by a 96-well microplate reader.

resulTs

In these experiments, splenocytes from each strain were isolated and stimulated with Concanavalin A (ConA) during a three-day incubation, in which proliferation was assayed at different time points.

Twenty-four hours post-stimulation, MTKO cells showed the highest levels of proliferation, yet after forty-eight hours, the MTKO proliferative response had fallen far behind the other strains, indicating that their lack of metallothionein may put them at a disadvantage after the initial primed response. In addition, when the ConA dosage was increased, only the transgenic cells were able to maintain a response to the higher dosage. We conclude that MTKO cells are primed by their lack of metallothionein to respond more quickly to polyclonal activation. In addition, the over-expression of MT in transgenic cells may confer protection and augment cellular survival. Further studies are needed to determine the molecular mechanisms of the MTKO “primed” response and whether it is due to constant low level oxidative stress (which cellular metallothionein is believed to reduce in normal cells).

Additional work is ongoing and will be completed by June 2011. Planned experiments include manipulation of the cellular redox environment with antioxidants, incubation in different oxidative stress conditions and addition of zinc in order to upregulate MT levels in mice that can synthesize the protein.

We also plan to conduct ELIspot assays of the three strains in order to quantify the number of active B-cells secreting antibody in the presence or absence of antioxidant in order to explore the role of oxidant in B-cell differentiation. Using this data, we endeavor to elucidate the role of endogenous metallothionein in the suppression of oxidative stress and cellular protection. If we can characterize the means by which extreme MT levels affect the immune response, it may enable the development of more targeted therapies that will function to augment innate immunity and suppress debilitating autoimmune and inflammatory disorders.

The Oculus: Proceedings of the U21 UndergradUate research conference referenCes

1. 1. Lynes, M.A., et al., Immunomodulatory activities of extracellular metallothionein. I. Metallothionein effects on antibody production. Toxicology, 1993.

85(2-3): p. 161-77.

2. Borghesi L.A and Lynes M.A (1996). Stress proteins as agents of immunological change: some lessons from metallothionein. Cell Stress Chaperones, 1 (2) 99108.

3. Palmiter R.D, The elusive function of metallothioneins.

Proc. Natl. Acad. Sc, 1998. 95 (15): p. 8428-8430.

4. Borghesi, L.A. and M.A. Lynes, Nonprotective effects of extracellular metallothionein. Toxicol Appl Pharmacol, 1996. 139(1): p. 6-14.

5. Sato, M. and M. Kondoh, Recent studies on metallothionein: protection against toxicity of heavy metals and oxygen free radicals. Tohoku J Exp Med, 2002. 196(1): p. 9-22.

6. Borghesi L.A, Joun Y, Olson E.A., Lynes M.A. (1996). Interactions of Metallothionein with Murine Lymphocytes: Plasma Membrane Binding and Proliferation. Toxicology Shannon. 108: 129-140.

7. Lynes MA, Borghesi LA, Youn J, Olson EA. Immunomodulatory activities of extracellular metallothionein. I. Metallothionein effects on antibody production. Toxicology 1993 85:161-177.

8. Youn J, Hwang SH, Ryoo ZY, Lynes MA, Paik DJ, Chung HS, Kim HY. Metallothionein suppresses collageninduced arthritis via induction of TGF-beta and down-regulation of proinflammatory mediators.

Clin Exp Immunol 2002 129:232-239.

9. Penkowa M, Hidalgo J. Treatment with metallothionein prevents demyelination and axonal damage and increases oligodendrocyte precursors and tissue repair during experimental autoimmune encephalomyelitis. J Neurosci Res 2003 72:574-586.

10. Kang YJ, Li Y, Sun X, Sun X. Antiapoptotic effect and inhibition of ischemia/reperfusion-induced myocardial injury in metallothionein-overexpressing transgenic mice. Am J Pathol 2003 163:1579-1586.

11. Crowthers K, Kline V, Giardina C, Lynes, M.A. (2000). Augmented Humoral Immune Function in Metallothionein-Null Mice. Toxicology and Applied Pharmacology.

166 (3): 161-172.

12. Emeny R.T, Marusov G, Lawrence D.A., PedersonLane J, Yin X, Lynes M.A. (2009). Manipulations of Metallothionein Gene Dose Accelerate the Response to Listeria Monocytogenes. Chemico-biological Interactions. 181 (2): 243-253.

13. Huh S, Lee K, Yun H.S., Paik D.J., Kim J.M., Youn J (2007). Functions of Metallothionein Generating Interleukin-10-Producting Regulatory Induced Arthritis. Journal of Microbiology and Biotechnology.

17 (2): 348-58.

aCknowledgMenTs

This work was supported by grants from NIH (ES07408) to MAL.

47

48

Spatial-Temporal Gait Template and its Application in Gait Recognition Chen Wang

Fudan University

absTraCT

In this paper, I study Gait Recognition, a popular problem studied in Computer Vision and Pattern Recognition domain in recent years. Gait Recognition means identifying human beings via their walking styles. It has been widely used in some social security scenarios, such as law enforcement, surveillance and access control, etc. Computer scientists have proposed many approaches to solve this problem. I will introduce a general framework to solve this problem with some state-of-the-arts algorithms from two aspects, named modelbased approach and model-free approach. And I will introduce my work on spatial-temporal gait template, Chrono-Gait Image, a kind of model-free approach. The experimental results on a large scale benchmark dataset will be presented with more comprehensive comparisons and discussions on these methods.

InTroduCTIon

B

iometric authentication has been widely used in various applications, e.g., human identification in some law scenarios, access control systems, etc.

Many biometric features of human beings have been well studied, such as DNA, fingerprint, iris, face, voice. The recognition system based on some of these features, e.g., DNA and fingerprint, can achieve really high accuracy (more than 99.9%) to make it useful and reliable in practice.

Gait, the human beings walking style, is also an important biometric feature of human. Cattin et al.

[3] have verified that everyone has his/her unique walking style, and our perception system can use gait to distinguish human beings. It provides a solid theoretical foundation to develop a gait recognition system to identify human beings by machine automatically.

Identifying human by gait has the following advantages. Firstly, the collection of gait data is noncontactable and hidden. We only need to install come digital cameras in some concealed locations and capture the video. That means we can even collect the data when the observed people do not know. This character may make this technique useful in some law enforcement scenarios. Secondly, to the best of our knowledge, gait is the only feature which is perceptible from a long distance. For example, when someone wants to collect DNA data or fingerprint data, he needs to use a device to contact the observed people. When someone wants to collect iris data or face data, he needs to put a camera just in front of the observed people, around 0.1 meters to 5 meters.

However, gait recognition can be adopted even with a distance more than 100 meters. [11] Due to these two advantages, gait is an irreplaceable biometric feature and it can benefit the long distance biometric authentication.

Gait recognition is also a very challenging problem. The recognition system may suffer from some occlusions and self-occlusions in the video

captured by the camera. And how to locate the human being in the video sequence is also a challenging issue. (It is referred as to image segmentation problem or just a background subtraction problem in computer vision domain) Furthermore, gait recognition system suffers from several exterior factors, e.g., views angles, shoes, clothes, walking surfaces, briefcases, and other environmental factors. Although it is a very challenging task, it is worth studying considering its advantages.

The rest of the paper is organized as follows. Sec. 2 introduces a general framework of gait recognition with some background knowledge and points out that feature extraction plays a central role in a gait recognition system. Sec. 3 gives some state-of-theart algorithms from two aspects and I introduce my research work on Chrono-Gait Image [9] in Sec. 4.

Some experimental results are provided in Sec. 5 and I conclude the whole paper in Sec. 6.

general fraMework of gaIT reCognITIon

Fig. 1 shows the general framework of a gait recognition system. In this section, I will introduce each component of the system briefly.

Data Acquisition

As mentioned before, the recognition system seriously suffers from the occlusions and selfocclusions problem. For example, when the observed people are covered by some obstacles or other people, it is hard for a computer to identify them.

To simplify the problem to concentrate on gait recognition, most researchers now assume that there is no occlusion between the camera and the observed person so that we can achieve clean data. View angle is another factor that may affect the recognition system seriously. Some researchers studied on how to recognize people from different view angles, while most researchers assume that the data is captured from the lateral side of the walking direction. Fig. 2 shows some examples of the gait data.

The Oculus: Proceedings of the U21 UndergradUate research conference

49

Figure 1. A general framework of a gait recognition system.

Figure 2. Examples of gait data. [7]

Feature Extraction

Intuitively, when a person wants to identify human beings via gait, he/she will find some candidates, and judges which one is most like the people in the video. That is also true for a gait recognition system. The most important thing for a gait recognition system is to define the similarity between video sequences.

The similarity function can be set manually or learned by some machine learning techniques mentioned in Sec. 2.3. Considering the complexity of the problem, it is quite hard to tune a good model manually. So learning the model from data is a good choice. However, the video sequence is a high dimensional data, while most machine learning techniques may suffer the dimensional curse problem.

And utilizing the video sequence directly may also affected by many exterior factors mentioned in Sec. 1. To solve this issue, a phase called feature extraction is necessary before learning the similarity function.

Feature extraction is to extract some feature vectors to represent the original gait video sequence.

From mathematics perspective, feature extraction projects the data in the original video space into a much lower dimensional feature space; hence it solves the dimensional curse problem. And the feature extraction technique is carefully designed to achieve some good properties, such as de-noising,

scale-invariant, and rotation-invariant, so that the extracted features are more insensitive to the exterior factors, such as noise, little scale variance, etc.

Model Learning and Prediction

After feature extraction, the recognition can be solved via a popular machine learning framework called supervised learning. This method assumes that we have a set of labeled data as training set, where is the feature of the i-th video sequence and is the label of the i-th video sequence belongs to, i.e., different individuals. A discriminative model (classifier) will be learned from the labeled data to map the data in the feature space into the label space. Giving a new video sequence, we can use the same feature extraction method to get its feature vector, and then employ the learned model to predict which category this video sequence belongs to.

Considering the limited labeled training data and the difficulty of a multi-class classification problem, the 1-NN (nearest neighbor) classifier is employed in most gait recognition systems. It means a given data point will be classified into the same category as the nearest data point: y = f(x) = yi, j = 1..N, | x - xi

j

|,

where | x - xi | is the Euclid Distance from x to xi.

50

Figure 4. Examples of gait silhouettes.

Figure 5. The process of generating GEI template. [4]

Figure 3. Examples of model-based approaches. (a) Bobick et al.â&#x20AC;&#x2122;s work [1]; (b) Lee et al.â&#x20AC;&#x2122;s work [5].

Figure 6. The process of generating CGI template. [9]

However, some studies indicate that the performance of the recognition system can be further enhanced by using more sophisticated machine learning techniques. [10]

relaTed works on gaIT feaTure exTraCTIon

From the previous sections, we can see that the central problem in gait recognition is to define a similarity function between gait video sequences.

In Sec. 2.2 and Sec. 2.3, we divide this problem into two sub-problems, feature extraction and model learning. Suppose we have a really perfect feature extraction technique, then we can use these features with a naĂŻve model learning technique, e.g., 1-NN classifier introduced in Sec. 2.3 to achieve a good performance. While if we have a really perfect model learning technique, we can learn the model based on the original video sequence without any feature extraction.

However, due to the dimensional curse problem, data sensitivity, sparseness of training data problem and other problems mentioned above, we need to make a trade-off between feature extraction and model learning. However, the dimensional curse problem and data sensitivity is much more critical and solving these problems can alleviate other problems, such as limited training data problem.

Therefore, most researchers focus on extracting good gait features. I will introduce some work on gait feature extraction in the following sections.

Model-Based Approaches

Model-based approaches model the human body structures and their motions. For example, Bobick et al. [1] locate the head, hip, left foot and right foot of the human beings and estimate the height of

the person, torso height, leg length and stride length.

Then these gait parameters are utilized as features for gait recognition. Lee et al. [5] segment the human silhouette into 7 regions, i.e., head, torso, hands, front thigh, back thigh, left foot, right foot, and use 7 ellipses to fit these regions. Then they utilized some statistics from these ellipses as features for recognition.

The advantages of this approach include that they can easily handle the little view point variances and scale variances due to these approaches modeling the body structures and motions. These methods are also robust to the exterior factors such as briefcase and occlusion. However, this kind of method requires the knowledge about constraints of gait such as joints dependency. And modelbased approaches also suffer from the localization of different body parts. Additionally, this kind of method is also sensitive to some exterior factors such as shoes and walking surface as this may affect human walking style. Furthermore, this kind of method limits the data collection from the lateral side as it is hard to model body structures and motions from front side of human beings.

Model-Free Approaches

Model-free approaches derive the features from the video sequence itself rather than modeling the body structures and motions. Most of the approaches are based on the silhouettes of the gait.

Firstly, background subtraction is employed on each frame of the video sequence; the original image is classified into two areas, foreground (human beings) and background and converted into a binary image. Then all the silhouettes are aligned into the center and cast into the same size. Fig. 4 shows some examples of silhouettes.

The Oculus: Proceedings of the U21 UndergradUate research conference Sarkar et al. [7] proposed a baseline algorithm which aligns frames between different gait sequence and used Tanimoto similarity measure to define the similarity between frames. The similarity of one gait period is defined as the summation of Tanimoto similarity over the frames in the same period and the median of them on different periods is utilized as the similarity between two gait sequences. In this work, Sarkar et al. use silhouette instead of original video sequence to keep the spatial-temporal correlations in the gait as features and utilize a manually set similarity function to recognize.

However, direct sequence matching has high computational complexity and requires large space to store the dataset. To overcome this disadvantage, some researchers propose to compress the silhouette data on the spatial-temporal domain.

Sundaresan et al. [6] proposed to compress the silhouette data in the spatial domain. They use the 1-D widths of foreground on each row of a silhouette frame as features instead of 2-D silhouette image. Then they employ a Hidden Markov Model (HMM) to model the 1-D featureâ&#x20AC;&#x2122;s change over time.

Even utilizing widths instead of frame decreases the dimension of data, HMM is quite time consuming and makes this method inefficient in practice.

Han et al. [4] proposed another great idea on it. They compress the silhouette data in the temporal domain. They average all the silhouette images in the whole sequence into one gray-scale image as features to represent the original sequence. Fig. 5 shows an example of this process. The gray-scale at each pixel can be viewed as a kind of energy,

so they named it as Gait Energy Image (GEI). This method achieves a big success. Only employing 1-NN classifier on the GEI can achieve remarkable performances. Thus many gait recognition systems are based on such feature extraction technique. [2, 8, 10].

Chrono -gaIT IMage

Although GEI is a good enough in practice, it throws out all the temporal information, which is also very important, during the feature extraction.

Note that GEI only employs the mean of frames to represent the gait sequence, and exchanging the orders of any two frames will not affect GEI feature.

It is unreasonable.

To keep temporal information on the gait template, I proposed another approach, named Chrono-Gait Image (CGI) [9]. The key idea is to encode the temporal information of the gait in one period into different channels. I use RGB channels to make it good to visualize. The process of generating CGI template is illustrated in Fig. 6.

The contours of the silhouettes are extracted firstly and I use a linear interpolation function to map each frame into a color in RGB space as the first row and second row in Fig. 6. The color changes from blue to green, then to red during one period. Thus the spatial information is kept by the contours, while the temporal information is kept by the colors of the contours. Then I sum up all the frames in one period and get an average over all the period. The figure on the bottom-right corner of Fig.6 shows the final CGI template of a gait sequence.

Table 1. Statistics on USF HumanID gait dataset

Table 2. Experimental results on USF HumanID gait dataset

51

52 The advantages of CGI are: 1) it keeps spatialtemporal information in the gait template; 2) unlike gray scale, color can enlarge the distance between gait sequences in the discriminative space and then enhance recognition; 3) this approach is quite easy to implement and has low computational cost and storage requirement to make it useful in practice. To the best of our knowledge, utilizing color to encode temporal information in spatial-temporal template was not studied before my work.

exPerIMenTs Dataset

We evaluate some state-of-the-art gait feature extraction techniques on the USF HumanID gait dataset (silhouette version 2.1). [7] This dataset consists of 122 people walking in elliptical paths in the lateral side of the camera. To evaluate the robustness of the algorithms to different exterior factors, gait data was collected under different conditions, i.e., different views, different shoes, concrete/grass surface, with/without a briefcase, etc. One specific condition is chosen as standard condition to compose the training set while other 12 conditions were chosen as control group and compose the test set. Some information of the dataset can be found in Tab. 1 and more details can be referred to Sarkar et al.’s work [7].

Evaluation Measure

In this paper, we use recognition rate to evaluate the performance of different methods. For each gait video sequence, we predict its category compare it with the ground truth answer to see whether we make a correct prediction, then we can calculate the correct ratio as recognition rate on the whole test set:

And we can also average the recognition rate over all the 12 test sets to evaluate the performance of each algorithm overall.

Experimental Result

The experimental result is illustrated in Tab. 2.

From this table, we can see that CGI can perform better than other methods. It can significantly improve the average recognition rate from 57.72% to 60.54%. This result indicates that encoding temporal information into the gait template can enhance the final gait recognition. Note that my approach cannot perform as well as GEI on Exp. D, E, F, G, while performs well on Exp. H, I, J. This indicates that CGI is sensitive to surface while insensitive to briefcase compared with GEI. Additional experiments in my work [9] indicate that this is because I utilize contour of gait instead of silhouette. And more control experiments shows that by encoding the temporal information into RGB channels can really enhance the recognition performance.

ConClusIon

In this paper, I introduce the problem of gait recognition and describe some state-of-the-art feature extraction approaches for gait recognition and analyze their advantages and disadvantages. And I introduce my works on Chrono-Gait Image, a gait template which can keep spatial-temporal information and improve the computational efficiency. Experimental result shows the effectiveness of CGI.

referenCes

1. A.F. Bobick, A.Y. Johnson. Gait Recognition using Static, Activity-Specific Parameters. In Proc. of CVPR’01, pages 423-430, 2001.

2. C. Chen, J. Zhang, R. Fleischer. Multilinear TensorBased Non-parametric Dimension Reduction for Gait Recognition. In Proc. of ICB’09, pages 10371046, 2009.

3. P.C. Cattin, D. Zlatnik, R. Borer. Biometric System using Human Gait. Mechatronics and Machine Vision in Practice, 2001.

4. J. Han, B. Bhanu: Individual Recognition using Gait Energy Image. TPAMI, 28:316-322, 2006.

5. L. Lee, W.E.L. Grimson. Gait Analysis for Recognition and Classification. In Proc. of Automatic Face and Gesture Recognition, pages 148-155, 2002.

6. A. Sundaresan, A. Roy-Chowdhury, R. Chellappa.

A Hidden Markov model Based Framework for Recognition of Humans from Gait Sequences. In Proc. of ICIP’03, pages 93-96, 2003.

7. S. Sarkar, P.J. Phillips, Z. Liu, I.R. Vega, P. Grother, K.W. Bowyer: The HumanID Gait Challenge Problem: Data Sets, Performance, and Analysis.

TPAMI, 27:162-177, 2005 8. D. Tao, X. Li, X. Wu, S.J. Maybank. General Tensor Discriminant Analysis and Gabor Features for Gait Recognition. TPAMI, 29:1700-1715, 2009.

9. C. Wang, J. Zhang, J. Pu, X. Yuan, L. Wang.

Chrono-Gait Image: A Novel Temporal Template for Gait Recognition. In Proc. ECCV’10, pages 257-270, 2010.

10. D. Xu, Y. Huang, Z. Zeng, X. Xu. Human Gait Recognition using Patch Distribution Feature and Locality-constrained Group Sparse Representation. TIP, 99:1-11, 2011.

11. J. Zhang, J. Pu, C. Chen, R. Fleischer. Lowresolution Gait Recognition. TSMCB 40:986-996, 2010.

aCknowledgMenTs

This work was supported by Hui-Chun Chin and Tsung-Dao Lee Chinese Undergraduate Research Endowment (CURE). I would like to express my sincere gratitude to my advisor Prof. Junping Zhang and other co-authors of my paper for their help during this research. I am very grateful to U21 for holding this research conference. Many thanks also go to Qin Jia, my girlfriend, for her love and support.

The Oculus: Proceedings of the U21 UndergradUate research conference

Improving Treatment Strategies for Glioblastoma Multiforme: The Effect of Oxygen Preconditioning on the Vulnerability of Hypoxic Glioma Cells to Radiotherapy Shayan Moosa

University of Virginia

absTraCT

Glioblastoma multiforme (GBM) is a highly aggressive and invasive form of glioma and the most common primary brain tumor in humans. Even with surgical resection of tumor tissue followed by adjuvant chemotherapy and/or radiotherapy, nearly all patients die within 14 months of diagnosis. Areas of hypoxia and necrosis are common in many rapidly growing solid tumors, and hypoxic conditions have been shown to confer tumor cells with increased resistance to radiation and chemotherapy. This, combined with the highly invasive nature of GBM, makes it nearly impossible to eradicate all tumor tissue. A previous study has shown that oxygen delivery to hypoxic tumor tissue in an animal model prior to irradiation results in increased survival and decreased tumor growth. Importantly, a closer look at this study shows that this increased radiation sensitivity occurs even after oxygen levels in the tumor have returned to the hypoxic baseline. Our study attempts to further investigate this phenomenon, which we have termed â&#x20AC;&#x153;preconditioning-induced intolerance.â&#x20AC;? C6 glioma cells were subjected to rapid-onset and gradual-onset hypoxic conditions in vitro with or without brief reoxygenation and return to hypoxia before irradiation. Radiation treatment following both hypoxia protocols without reoxygenation resulted in decreased cell death as compared to controls, while reoxygenation before the treatment increased radiotherapy-induced cell death. The gradual-onset hypoxia group had the greatest decrease in radiation resistance. Since tumor cells can naturally experience gradual-onset hypoxia in vivo, future studies should employ this paradigm in order to best model in vivo conditions. In addition, this research suggests that exposing the tumor tissue of GBM patients to a brief period of reoxygenation, followed by time to allow the tissue to return to hypoxia before radiation treatment, may maximize radiotherapy effectiveness and improve patient outcomes.

InTroduCTIon

G

lioblastoma multiforme (GBM) is a highly aggressive and invasive form of glioma and the most common primary brain tumor in humans.

Primary brain tumors are relatively rare, comprising 2% of all adult human cancers. However, these types of tumors rank second in causes of death from neurological disease. GBM accounts for 17% of all brain tumors, and three in 100,000 people are newly diagnosed with GBM each year (Tetenhorst et al., 2005). Even with current treatment techniques that involve surgical resection of tumor tissue with adjuvant chemotherapy and/or radiotherapy, nearly all patients die within 14 months of diagnosis (Kanu, 2009).

One of the biggest obstacles to overcome for effective treatment of GBM and other rapidly growing tumors is the presence of pockets of hypoxic cancer cells that are highly resistant to conventional therapy. Areas of hypoxia and necrosis are common in these tumors because poor vascular development and function can result in inadequate blood supply to tumor tissue (Dery et al., 2005; Rong et al., 2006).

Hypoxic resistance to radiotherapy occurs for a number of reasons. Two important reasons for this resistance are: 1) the lack of molecular oxygen during

radiation treatment does not allow for the creation of free radicals that inhibit DNA repair mechanisms and aid in the destruction of targeted tumor cells, and 2) hypoxia induces various cellular-protective adaptations, primarily through expression of the transcription factor hypoxia inducible factor-1 (HIF1) and its downstream targets (Kunz and Ibrahim, 2003; Sheehan, 2008).

HIF-1 is a heterodimer formed from the HIF-1 and HIF-1 subunits. The beta subunit is constitutively expressed, while oxygen levels control alpha subunit expression. The mechanism for this control is based on the actions of prolyl hydroxylases (PHDs). PHDs hydroxylate the prolyl residues of HIF1 , which allows the von Hippel-Lindau (VHL) gene product to bind to the HIF-1 subunit. This product is a component of the E3 ubiquitin ligase complex; thus, the binding of this product to HIF-1 results in the destruction of the subunit in a proteasome.

Furthermore, factor inhibiting HIF (FIH) is activated by oxygen to hydroxylate the asparagyl residues of HIF-1 . This results in a reduction of the transcriptional activity of HIF-1. The HIF-1 subunit is degraded in physiologically normoxic conditions and stabilized in hypoxic conditions of oxygen levels lower than 2% (Chen, 2009). However,

53

54 recent studies have found HIF-1 is not stabilized by hypoxia when glucose conditions are equal to or less than 0.55 mM (Vordermark et al., 2005). Following HIF-1 stabilization, the heterodimer can form and translocate to the nucleus of the cell to induce the transcription of various other genes. These target genes are responsible for cell survival, cell proliferation, apoptosis, glucose metabolism, and angiogenesis (Greijer and Wall, 2004).

Past research has explored the feasibility of increasing oxygen levels in tumor tissue to improve hypoxic tumor cell radiosensitivity and, thusly, radiotherapy effectiveness. These laboratory and clinical studies have utilized normobaric hyperoxia, hyperbaric hyperoxia, and artificial oxygen delivery as radiosensitizing agents. The results of these treatment methods have been varied based on the size of the tumor and its cell type. One of the major drawbacks to this type of intervention is that healthy tissue can also be sensitized and compromised due to non-specificity of oxygen treatments (Kanu, 2009).

In a recent study, Sheehan et al. (2008) used transsodium crocetinate (TSC), a carotenoid compound that allows for increased oxygen diffusivity and perfusion into ischemic tissue, to create a significant but transient elevation of tumor tissue oxygenation in a rat model of GBM. This study showed that TSC treatment increased the vulnerability of tumor tissue to radiation. TSC treated animals showed increased survival time and decreased tumor size after radiation treatment as compared to control animals that did not undergo TSC treatment prior to radiation. Importantly, what this study showed was that irradiating the tumor cells after the tissue had returned to baseline hypoxic conditions significantly improved survival outcomes and reduced tumor size.

This indicates that the presence of molecular oxygen was not necessary for radiosensitization in these cells and that other means of cellular vulnerability must be at play.

This demonstration of a preconditioninginduced intolerance is an important finding because it may provide a better understanding of hypoxic tumor cell resistance and a means of more effectively targeting tumor tissue in cancer therapy.

If Sheehan’s results hold true for human patients, reoxygenation of tumor tissue prior to radiation therapy may provide for a more effective treatment modality for GBM patients.

The overall goal of this study is to determine the effects of oxygen preconditioning on the radiosensitivity of glioma cells. This study attempts to further investigate this preconditioning-induced intolerance phenomenon in a glioblastoma cell line under varying levels of hypoxic conditions in vitro.

In addition, this study aims to evaluate how rapid or gradual onset of hypoxia can affect the growth of GBM cells and their survival ability following radiation exposure.

MeThods

Cell Culture

C6 glioma cells were used as the tumor cell line for this study. This line was used because it has previously demonstrated tumor hypoxia in animal tumor models and can be used in future in vivo experiments (Grobben et al., 2002). The cells were cultured for 20-30 passages in DMEM supplemented with 10% fetal bovine serum and 0.8% penicillin and streptomycin. The media was changed every three days and cells were passaged after reaching ~90% confluence. The cells were grown in 75 cm2 culture flasks and incubated at 37°C in 5% carbon dioxide.

Cell Harvesting

When the C6 cells reached ~90% confluence, or when necessary, the cells were passaged by removal of the media and washing with PBS, followed by detachment with 0.05% trypsin. The cells were suspended in FBS media and centrifuged at 200 rcf for 10 minutes at 4°C. The pellet was then resuspended in FBS media, followed by density analysis, if necessary, using a hemocytometer.

FACS Staining Protocol

The purpose of this preliminary experiment was to determine how long C6 cells could survive at 1% oxygen levels. Cells were first harvested using the cell harvesting protocol above. The pellets of the cell samples were then resuspended in FACS buffer (PBS + 2% FBS) at the desired volume/concentration (~1 * 106 cells per mL) and kept on ice. 500 μL of cell suspension was then pipetted into FACS tubes and FDA was added at a final concentration of 2 μg/mL. The tubes were then vortexed and incubated at 37°C in 5% carbon dioxide for 15 minutes. After this time, the cells were removed from the incubator and PI was added at a final concentration of 2 μg/mL. The tubes were analyzed at the UVA Flow Cytometry Core lab within one hour of staining.

Hypoxia Protocols for Experiment 1

The purpose of this experiment was to define culture conditions necessary to have comparable numbers of cells under rapid hypoxia and gradual hypoxia conditions. Various initial densities were tested at various time points until the right combination was found using the cell counting protocol. Each group underwent the following treatments in a New Brunswick Galaxy 14 S Hypoxia Chamber: 1. The control group remained in 20% oxygen throughout the entirety of the experiment.

2. The rapid hypoxia group was placed in 20% oxygen for 72 hours and then immediately shifted to a 1% oxygen environment forthe remainder of the experiment (up to a total experiment time of 120 hours).

The Oculus: Proceedings of the U21 UndergradUate research conference 3. The gradual hypoxia group was placed in 20% oxygen for 24 hours, after which oxygenconditions were gradually reduced to 1% over the next 48 hours. These cells then remained in 1% oxygen for the remainder of the experiment (up to a total experiment time of 120 hours).

Glucose Concentration Measurements

A glucose assay from Sigma-Aldrich (#GAGO020) was used to determine glucose concentration in the cell media at various time points (see Figure 4). Measurements were taken using a PerkinElmer Lambda 25 UV/VIS Spectrometer.

Hypoxia protocols for Experiment 2

The purpose of this experiment was to test the effects of various forms of hypoxia on glioma cell sensitivity to 5 Gy radiation. Five groups were tested. Based on the results of Experiment 1, the control group and rapid-acute-hypoxia groups were plated at a density of 50,000 cells per well on 6-well plates. The graded-chronic-hypoxia groups were plated at a density of 60,000 cells per well on 6-well plates. Each group underwent a 24-hour period of incubation at 37°C in 5% carbon dioxide before starting the following hypoxia protocols in a New Brunswick Galaxy 14 S Hypoxia Chamber: 1. The control group consisted of C6 cells that remained in 20% oxygen throughout the entirety of the experiment.

2. The rapid-acute-hypoxia without oxygen preconditioning (RAH) group started in 20% oxygen for 48 hours and then shifted to 1% oxygen for 14 hours.

3. The graded-chronic-hypoxia without oxygen preconditioning group (GCH) was shifted from 20% oxygen to 5% oxygen, where it remained for 24 hours. It was then shifted to 3% oxygen, where it remained for another 24 hours before being shifted to 1% oxygen for 14 hours.

4. The rapid-acute-hypoxia with oxygen preconditioning group (RAH reox) was originally placed in 20% oxygen for 48 hours and shifted to 1% oxygen for 14 hours. This was then followed by 45 minutes of reoxygenation at 20% oxygen and a subsequent return to 1% oxygen.

The graded-chronic-hypoxia with oxygen preconditioning group (GCH reox) was shifted from 20% oxygen to 5% oxygen, where it remained for 24 hours. It was then shifted to 3% oxygen, where it remained for another 24 hours before being shifted to 1% oxygen for 14 hours. This was followed by 45 minutes of reoxygenation at 20% oxygen and a subsequent return to 1% oxygen.

varyIng oxygen levels over TIMe In eaCh of The hyPoxIa exPerIMenTs Radiation Treatment

Following the completion of the hypoxia protocols, all cells that were exposed to hypoxic environments were transported in a sealed container (they remained in this container for the entirety of the radiation experiment) at 1% oxygen to the patient radiation machine in the Radiation Oncology Division in UVA’s West Complex (average travel time was 10 minutes). The control group was transported in a sealed container at normal oxygen conditions.

The plates containing the cells were placed in an orientation that allowed equal distribution of radiation. The cells then received 5 Gy of radiation and were transported back to the original lab.

Clonogenic assay

Following the hypoxia protocols and radiation treatment, the cells were harvested using the harvesting protocol above. Cells from each group were then plated on separate 6-well plates at a density of 1000 cells per well. After four days of incubation at 37°C in 5% carbon dioxide, the medium above the cells was removed. Each well was then carefully rinsed with PBS. After removing the PBS, 2-3 mL of a mixture of 6.0% glutaraldehyde and 0.5% crystal violet was added to each well and left for 30 minutes.

The glutaraldehyde cystal violet mixture was then removed and each well was carefully rinsed three times with deionized water. The plates were left to dry for at least 24 hours in normal air at room temperature (20°C). Stained colonies of 50 or more cells were counted using a stereomicroscope.

Equation 1. Method for calculating the surviving fraction of cells for each group

resulTs

C6 cells were viable at 1% oxygen conditions for the duration of the experiment After 24 hours of growth in normoxic conditions and 66 hours at 1% oxygen conditions, FACS analysis showed that 10.6% of the cells were stained with PI, indicating that they were dead.

84.5% of the cells were stained with FDA, indicating that they were alive. 4.73% of the cells were stained with both PI and FDA, and 0.16% of the cells were stained with neither.

faCs analysIs

Both hypoxia protocols attenuated the growth of C6 glioma cells

C6 cells from the GCH and RAH groups grew more slowly than the control group after 72 hours of the experiment when these two groups were placed in an environment with 1% oxygen. The control

55

56

Figure 1. Graphical representation of the hypoxia protocols.

Figure 2. The upper left quadrant depicts cells stained with PI (dead). The lower right quadrant depicts cells stained with FDA (alive).

Figure 3. Growth of cell groups over time. The line with overlaying hollow circles depicts the RAH group. The line with overlaying filled-in circles depicts the GCH group.

Figure 4. Glucose consumption of cell groups over time.

Figure 5. Surviving fraction of cells with either no radiation treatment or a 5 Gy dose of radiation.

The Oculus: Proceedings of the U21 UndergradUate research conference group proliferated exponentially until reaching full confluence at around 100 hours, while the GCH and RAH groups proliferated in an almost linear fashion for the entirety of the experimental protocol.

It is important to note that both the GCH and RAH groups ended at the same density after 120 hours.

This is the result of many tests with different starting densities for both groups. Equal densities were achieved after 120 hours when the GCH group was originally plated at 60,000 cells/well, while the RAH group was originally plated at 50,000 cells/well.

Glucose consumption increased in hypoxic conditions

Glucose levels in the cell media dropped more quickly in the RAH and GCH groups as compared to the controls. However, these levels never dropped below physiological levels.

Oxygen preconditioning increased the efficacy of radiotherapy

As expected, the GCH and RAH groups experienced less cell death after radiation treatment as compared to the control group. In contrast, the GCH reox and RAH reox groups had more cell death after radiation than their corresponding noreoxygenation groups, even when the radiation was delivered under hypoxic conditions. C6 cells subjected to a graded model of hypoxia experienced the most cell death and the greatest change in cell death following reoxygenation before radiation treatment.

dIsCussIon

The results of this research support previous studies that have shown the protective effects of hypoxia in glioma cells. In addition, the current findings also support the idea that oxygen pretreatment can reduce these protective effects prior to irradiation. The most important finding is that increased levels of oxygen did not need to be present at the time of radiation treatment. The GCH reox and RAH reox groups did undergo a 45-minute period of reoxygenation; however, both groups were returned to 1% oxygen before undergoing radiation treatment. Since far fewer cells from these two groups survived the radiation treatment in comparison to the GCH and RAH groups (which did not undergo reoxygenation), this study is consistent with others that have shown that the creation of free radicals from oxygen during radiation is not part of the mechanism for the preconditioning-induced intolerance. In addition, while the rate of glycolysis increased in the hypoxic cells, the glucose assay measurements showed that the glucose levels in the media always remained above normal physiological conditions. This rules out the possibility that HIF-1 expression was hindered due to low glucose levels, which has been shown to occur in some previous studies.

The mechanism behind the preconditioninginduced intolerance phenomenon still remains to be elucidated. Protein was extracted from all tested groups to determine HIF-1 expression levels; however, western blot analysis for this study has to this point been unsuccessful. Since HIF-1 is known to confer protective effects against radiation treatment and is stabilized in hypoxic conditions, there is a good chance that this protein is a key part of the mechanism in question. Future studies should examine HIF-1 expression in glioma cells both before and after they are placed into hypoxic conditions and reoxygenated. This will help to gain further insight into the preconditioning-induced intolerance phenomenon and if it is related to the HIF-1 protein.

While it is unknown how HIF-1 works in the cell, it is possible that HIF-1 levels are lower in the GCH reox and RAH reox groups (due to oxygen exposure) in comparison to the GCH and RAH groups, which would explain the decrease in protective effects seen against radiotherapy.

When comparing the survival results of the GCH and RAH groups, it is apparent that there is a greater shift in survival when the GCH group is reoxygenated prior to irradiation. While both groups remained in 1% hypoxic conditions for the same amount of time, the gradual process of moving to 1% oxygen conditions may be responsible for these results. It is possible that this gradual removal of oxygen from the environment results is a less pronounced shock to the cells, causing a decrease or slowing in HIF-1 stabilization (and subsequently fewer protective effects against radiation treatment).

In addition, since tumor cells can undergo this type of gradual decline into hypoxia in vivo, the GCH group seems to be a better in vitro model for in vivo conditions. To the knowledge of the author, no other studies have used the GCH model; thus, future in vitro studies might employ the use of this model.

Their use together will allow experimenters to better estimate the effects of varying oxygen conditions on cancer cells in vivo.

As mentioned above, GBM is a universally lethal disease due to the fact that full extraction of tumor tissue is practically impossible. The ideal radiotherapy treatment would be timed before rapid expansion of the tumor leading to hypoxia. However, symptoms from GBM usually do not appear until this period of rapid expansion has occurred and secondary symptoms present themselves. If these tumor cells could be selectively made more sensitive to radiotherapy, patient prognosis could be significantly improved. Unfortunately, increasing the presence of oxygen generally throughout the brain prior to radiotherapy can be harmful to normal, healthy tissue. The formation of oxygen atom free radicals can have detrimental effects to the DNA repair mechanisms of tumor and nontumor tissue alike. However, as shown in this study,

57

58 by increasing oxygen levels in the brain prior to radiotherapy and allowing oxygen levels to return to hypoxic conditions, tumor tissue becomes more susceptible to damage from radiation. This allows for greater precision for radiotherapy and increased tumor cell death.

Normobaric hyperoxia, hyperbaric hyperoxia, and artificial oxygen delivery are all methods that can be used in human patients to increase brain tumor tissue oxygen levels prior to radiotherapy.

Studies employing these methods have had mixed results in the past. Since these techniques are nonspecific in their site of action, having higher oxygen levels throughout the normal brain tissue during radiotherapy could lead to neurological damage. Dr. Sheehan’s use of TSC may have been more successful due to the fact that he performed radiotherapy immediately after oxygen levels in the tumor tissue returned to their hypoxic baseline.

Further research is required with TSC and other methods of increasing the amount of oxygen in brain tissue, but all future studies should realize that a certain amount of time is required for oxygen levels to decrease before radiotherapy. Timing is obviously an important factor in maximizing preconditioninginduced intolerance and radiotherapy effectiveness, however, the window of time allowed for this is still unknown. Therefore, future studies should investigate this time window in order to determine the greatest therapeutic benefit for this type of treatment of GBM.

aCknowledgMenTs

This research was performed in the Kevin S. Lee lab at the University of Virginia in conjunction with Ryon Clarke, a student in the Neuroscience Graduate Program at the University of Virginia. Financial contributions were made by the David A. Harrison Undergraduate Research Award and the Ingrassia Family Echols Scholars Research Award.

referenCes

1. Chen, J. Pim-1 plays a pivotal role in hypoxiainduced chemoresistance. Oncogene 28: 1-12 (2009).

2. Dery, M.-A. C., Michaud, M. D., & Richard, D. E. Hypoxia-inducible factor 1: regulation by hypoxic and non-hypoxic activators. The International Journal of Biochemistry & Cell Biology 37: 535-540 (2005).

3. Greijer, A. E., & Wall, E. V. D. The role of hypoxia inducible factor 1 (HIF-1) in hypoxia induced apoptosis. Journal of Clinical Pathology 57: 10091014 (2004).

4. Grobben, Bert, Peter De Deyn, and Herman Slegers. Rat C6 Glioma as Experimental Model System for the Study of Glioblastoma Growth and Invasion. Cell and Tissue Research 310(3): 25770 (2002).

5. Kanu, O. O. Glioblastoma multiforme: a review of therapeutic targets. Expert Opinion Therapeutic Targets 13(6): 701-718 (2009).

6. Kunz, M., & Ibrahim, S. M. Molecular responses to hypoxia in tumor cells. Molecular Cancer 2: 2336 (2003).

7. Rong, Yuan, Donald L. Durden, Erwin G. Van Meir, and Daniel J. Brat. ‘Pseudopalisading’ Necrosis in Glioblastoma. Journal of Neuropathology and Experimental Neurology 65(6): 529-39 (2006).

8. Sheehan, J. Use of trans sodium crocetinate for sensitizing glioblastoma multiforme to radiation.

Journal of Neurosurgery 108(5): 972-978 (2008).

9. Tetenhorst, L., Puttmann, S., Senner, V., & Paulus, W. Genes Associated with Fast Glioma Cell Migration In Vitro and In Vivo. Brain Pathology 15: 46-54 (2005).

10. Vordermark, D., P. Kraft, A. Katzer, T. Bolling, J. Willner, and M. Flentje. Glucose Requirement for Hypoxic Accumulation of Hypoxia-inducible Factor-1 (HIF-1 ). Cancer Letters 230(1): 122-33 (2005).

The Oculus: Proceedings of the U21 UndergradUate research conference

Randomised Response Method: Is It a More Effective Survey Technique?

Cissy Zhang

University of New South Wales

absTraCT

When surveying a population on a sensitive or personal topic, there will often be evasive answers that may come from the fear of admitting the truth or fear of one’s privacy. It is difficult to obtain truthful answers when it comes to sensitive topics like illegal drugs, tax evasion, assault, crime and abortion. The randomised response method was first introduced by Stanley L. Warner in his 1965 paper where he suggested adding a random aspect of probability into the survey process. He proposed the use of a spinner that for example had a 70% chance of landing on “have you taken drugs before?” and a 30% chance of landing on “have you not taken drugs before?” The respondent would answer the randomly selected question from the spinner and thus have full privacy from the interviewer.

However, this research finds that there are a few drawbacks from this randomised response method. The added probability factor leads to a much larger sample variance. This means a larger sample size is needed to gain the same variance as a regular survey. It has also been found that it is difficult to gain the co-operation of the respondent, and there may be problems of misunderstanding and confusion because of this more complicated survey procedure. Overall, the added benefits of the randomised response method must be weighed with its practicality to determine if it can be used effectively for a survey.

InTroduCTIon

T

his report looks at the advantages and disadvantages of the randomised response method and if it is an effective survey technique.

Since Stanley L. Warner’s (1965) introduction of the randomised response method, there have been many alterations and improvements to the randomisation device. Horvitz et al (1967) introduced an Unrelated Question Model and this was further improved by Greenberg et al (1969). The Warner Model and the Unrelated Question Model will be investigated.

The main benefit of the randomised response method is the privacy that it can provide for the respondent. Because of the added element of chance, the respondent can feel confident that the interviewer does now know what question they are answering.

Added privacy can help reduce answer bias and eliminate evasive answers. However, the randomised response method is hardly put into practice in real life. It has many limitations and it must be used with caution if its benefits are to be achieved.

This report will look at the mathematical properties behind the randomised response method, namely sample variance and sample size. It will also look at the practicality of the method and whether this may prevent the randomised response method to provide better estimates than the regular survey method.

varIanCe and saMPle sIze

We will first study the Warner Model, where the respondent will use a randomisation device like a spinner to randomly select one of two questions.

Question 1: Have you committed crime A? (with probability p) Question 2: Have you not committed crime A? (with probability 1-p)

The first term of the variance term in the variance achieved from the regular survey method.

It can be seen from the second term of the variance equation that the randomisation process increases the variance. The variance increases when the sample size n is smaller and the p probability is closer to 0.5. However, Warner was able to show that the number of untruthful respondents need not be too large in order for the variance of the Warner Model to be smaller than the mean squared error of the regular survey method.

Table 1 shows some of the results Warner published. It can be seen that a larger absolute bias allows for the randomised survey to be used more effectively. As absolute bias increases in the regular survey, the mean square error for the randomised survey becomes smaller than the mean square error for the randomised survey.

However, in a lot of cases, the variance tem increases due to the randomisation process. This greater variance term that would have to be solved

59

60

Table 1. Warner Model Results. Excerpt from Warner (1965). With true probability of 0.5 and n=100. Ta=probability member from group A will tell truth. T b=probability member not from group A will tell truth.

by increasing the sample size. For example, if the true estimate is 0.2, and the spinner probabilities are 0.7 and 0.3 then the randomised response method would require 10 times the number of respondents as the regular survey method. Requiring a much larger sample size is a significant disadvantage of the randomised response method.

Since Warner’s Model, there have been numerous models designed to reduce the variance of a randomised response method. One of them has been the Unrelated Question Model first introduced

by Horvitz et al (1967). This model attempted to decrease the variance by introducing an unrelated question. If we introduce an unrelated question with a known distribution then we can further reduce the variance. For this model, the variance is: If we substitute =0.3, p=0.6 and then the variance for the Warner Model becomes 6.21/n and the variance for the Unrelated Question Model becomes 0.654/n. So it is possible to diminish the variance of our randomised response models.

However, the variance will always be larger than the regular survey method.

resPondenT PrIvaCy

It may be the case that respondents do not have complete trust in the randomisation response methods used. Frederick Wiseman, Mark Moriarty and Marianne Schafer conducted a survey where the respondent would pick a poker chip from a box as the randomisation device. Picking a white chip would require an answer to the question “Have you had an illegitimate child?” A blue chip would require a “yes” response and a red chip would require a “no” response. They found that 20% of the people being questioned believed that their interviewer knew which coloured chips they possessed, thus failing to gain their trust. This shows a limitation

to the randomisation response method. Although the aim of a randomisation device is to protect the respondents’ privacy, it may be difficult to convince the respondent that they do have complete privacy.

Thus there may still be answer bias under the randomisation response method.

loss of InforMaTIon

The randomisation response method can only be used to gain an estimate of a population as a whole.

Individual data is lost meaning that further analysis cannot be performed. For example, we would not be able to determine the link between drug use and socio-economic status.

PraCTICalITy

Using a randomisation device like a spinner can complicate the survey process and confuse the respondent. A longer and more complicated survey procedure creates a greater likelihood for misunderstanding and errors to occur. Thus there is the need to carefully explain the survey procedure to respondents, which may take up more time and money. There must be instructions that clearly explain the survey steps and convince the respondent that their privacy will be protected using the randomised response method.

Due to the more complex nature of a randomised response, this method is hardly put into practical use in real life. An experiment by Wiseman, Moriarty and Schafer (1975) showed that the probability of a ‘yes’ response to the question ‘I believe that landlords should have the right to discriminate against homosexuals’ was actually higher for a direct interview than a randomised response model. They were 30% and 24% respectively. This shows that the randomised response does not always provide the most accurate and ideal results. There are many

The Oculus: Proceedings of the U21 UndergradUate research conference factors to take into consideration with surveying a population and the theoretical evidence of randomisation providing more accurate results can be overridden by other factors.

ConClusIon

There has been much research into randomised response methods, however the method is still not commonly used in surveys. Though it has the ability to provide privacy and give more accurate statistics, its benefits must be weighed with their disadvantages which is a difficult thing to do. It is difficult to predict whether the greater accuracy due to added privacy of a randomisation device will be greater than the loss of accuracy due to confusion and misunderstanding caused by a more complicated method.

The main reason why randomised response methods are not used more in surveys is the need for a larger sample size. Larger sample size, longer completion time and higher research costs makes the randomised response method unsuitable for most researchers. Only when the benefits of using this method are certain to lead to greater result accuracy and validity, can it be worthwhile to invest time and money into this survey method. In the end, practicality is key to any research method.

referenCes

1. Warner, S. (1965). Randomized response: a survey technique for eliminating evasive answer bias.

Journal of the American Statistical Association 60, 63-69.

2. Greenberg, B.G., Abul-Ela, A.A., Simmons, W.R. and Horvitz, D.G. (1969). The unrelated question randomized response model: theoretical framework. Journal of the American Statistical Association (June), 520-539.

3. Horvitz, D.G., Shah, B.U. and Simmons, W.R. (1967). The unrelated question randomized response model. Proceedings of the Social Statistics Section. American Statistical Association.

4. Horvitz, D.G., Greenberg, J.R. Abernathy (1976).

Randomized Response: A Data-Gathering Device for Sensitive Questions, International Statistical Review / Revue Internationale de Statistique, Vol. 44, No. 2(Aug), pp. 181-196.

5. Wiseman, F., Moriarty, M., and Shafer, M. (1775), Estimating Public Opinion with the Randomized Response Model. Public Opinion Quarterly, 39, 507-513.

6. Lensvelt-Mulders, G.J.L.M.; Hox, J.J.; van der Heijden, P.G.M.; Maas, C.J.M. (2005). MetaAnalysis of Randomized Response Research: Thirty-Five Years of Validation, Sociological Methods & Research 33: 319â&#x20AC;&#x201C;348.

7. Lensvelt-Mulders, G.J.L.M.; Hox, J.J.; van der Heijden (2005), How to Improve the Efficiency of Randomised Response Designs, Quality & Quantity, 39: 253â&#x20AC;&#x201C;265.

61

62

The Effect of Cue Consistency and Motivation on Detection of Non-Verbal Deception Chun Tao

Fudan University

absTraCT

This study was to explore the essential mechanisms in detection of non-verbal deception. Experiment 1 revealed a significant longer reaction time in the cue-inconsistent condition than that in the cue-consistent one; additionally there was no significant difference between gaze trust percentage of subjects and the level of chance (50%). Experiment 2 revealed a main effect of cue consistency and a marginal significant effect of motivation on reaction time; although no significant differences were detected between gaze trust percentage of subjects and the level of chance (50%) under either condition of motivation, gaze trust percentage in the high-motivated condition was detected to be significantly larger than that in the low-motivated situation.

Briefly, cue consistency played a crucial role in the detecting process; no significant trust preference of cues was revealed in a certain condition; however, trust preference of cues was related to motivation. Thus, both factors should be drawn attention to, in prospective researches.

InTroduCTIon

D

eception, common in social interaction1, is of great difficulty to be detected. Albeit higher accuracy rates of perceived deception by lawenforcement officials and clinical psychologists without additional aids (up to 70%) 2, accuracy rates were usually recorded to be around the level of chance3-4, or even below5, for most observers attempting to detect lies.

Cues, which compose of a variety of channels such as eye contact, gaze direction, body movement, etc.6, are crucial in the detecting process. Eye communication, among all facial expressions, serves an important role in assessment and cognition of personality7. Direct eye contact makes one more charming and worth believing8. To be specific, gaze directions depict interested objects or upcoming behaviors and also function to adjust interaction, implement social control such as deception9. Gaze cues are moreover a prediction of personality10.

Gestures, among body expressions, involve strategic and non-strategic leakage in psychological process11: the former illustrates gestures when one is under strong information, image or behavior management while the latter illustrates gestures when one is out of nervousness or exaggeration of performance.

Non-verbal behavioral cues could validly discriminate truthfulness from deception6-12. This is because some liars “leak” or “betray” their true feelings due to failure in control, some made deception more apparent with their excessive control, and the others did not expect to control them at all13. Based on this explanation, cue consistency, which stands for whether channels of cues act in the same way and imply the same underlying emotion, should be highlighted in the detecting process.

Previous studies suggested a hierarchy of controllability of expressive channels that verbal utterances were the easiest to control, followed by

facial expressions and (non-facial) gestures which was the least easy14. This implied that gestures are more reliable when cues are inconsistent in detection according to cues. Ekman and Friesen (1974) used split videos of either face or body and found that accuracy rates based on body were significantly higher than that based on face in the circumstance of pre-familiarity with the presenter’s behavioral habits; however no significant difference was found without such “warm-up”; in addition, when the observers were asked to list what one should control or avoid doing to become a successful deceiver, they mentioned the face more than the body15.

Studies using facial and body cues simultaneously demonstrated a self-reported tendency to discount facial expressions relative to body expressions when observers are suspicious16. It should be noted that self-report carries memory and individual post-hoc biases.

In chief, the fact that accuracy rates remain around the level of chance has led to the explanation that valid behavioral cues were not necessarily used or were incorrectly used by some (naive) judges6. In other words, concurrent multi-channel information helps valid cues successfully escape observer’ attention or it is a preference of wrong channels when cues are inconsistent ruins the detection.

More clarification of the reason needs to be tested by explicit focus on the effect of cue consistency.

Deception is also known as a situational behavior17. Therefore, detection should take situational aspects into consideration beside cue consistency. Socio-psychological studies proved that little physiological stress could enhance eliciting astonishing behaviors but the power of situation was always underscored18. Significance of deceptive event played an important role in cues since serious lies were associated with more nervous behaviors than trivial ones19. Similar implication came from the

The Oculus: Proceedings of the U21 UndergradUate research conference

Figure 1. This time course depicts examples of two trials for both cue-consistent and cue-inconsistent conditions.

result that the more serious consequences one had perceived if he failed to deceive, the more apparent his physiological response would be during the lying, and the more likely he would be detected 20.

Besides, personally relevant materials were found to be significantly more detectable than the neutral material despite the same consequences of detection21.

High task involvement, high cognitive capacity22 and low motivation23 also predicted higher accuracy rate.

Hence, motivation, which was defined as the level of desire of attaining success in detection generated by personal involvement, was introduced in Experiment 2, to explore potential factors influencing detective strategies, such as trust preference of cues.

This study was aimed at explicitly exploring the essential mechanisms which were involved in detection of non-verbal deception, including the effect of cue consistency, the existence of trust preference of cues as well as the factors influencing the preference (specified in motivation in Experiment 2), to explain current low accuracy rate. To avoiding miscellaneous channels of cues, gaze cue and gesture cue were extracted, presented simultaneously while other channels were also controlled. To get grounded and objective data, standardized presentations with different conditions of cue consistency were actualized by computer program repetitively, while reaction time and responses are automatically recorded. Given previous studies, the hypotheses of Experiment 1 were that reaction time in cueinconsistent condition was significantly longer than that in cue-consistent condition; subjects preferred gesture cues in cue-inconsistent condition. Based on Experiment 1, motivation was added into Experiment 2 as another independent variable and the hypothesis was that gaze trust percentage in the high-motivated condition was significantly larger than that in the low-motivated condition when cues were inconsistent.

exPerIMenT 1 Method

40 undergraduates in Fudan University participated, 27 (14 males) among which counted while data of the others were exclude due to the biological wall of reaction time (150ms). Their mean age was 20.16 (SD=1.55). All of them had normal eyesight (with or without glasses), were naive to the purpose of this experiment and received a gift for their participation.

4 unfamiliar bust figures (2 males) were used as stimuli in the formal session and another 2 (1 male) figures were used in the practice session. Each figure had two versions of pictures, one without cues (like meeting the subject first time but without expression) and another with cues. For those with cues, a figure showed gaze direction and gesture direction concurrently. Cue-consistent condition was presented as gazing to the left and pointing to the left or both to the right, and cue-inconsistent condition was presented as gazing to the left and pointing to the right or gazing to the right and pointing to the left. In all, each figure had 4 pictures for different conditions of cue consistency. Another version for the 2 practice figures was with 5 colorful balloons illustrating at left or right in addition to gaze and gesture cues, which stood for a random prompt (suggests possible deception) after presentation with cues in the practice session. Thus, each practice figure had 8 pictures for the third version with prompt.

The with-subject variable in this experiment was cue consistency, including cue-consistent and cue-inconsistent conditions. The scene of detection of deception was arranged as asking the figure presented on screen where the subject could buy colorful balloons.

The program was designed and run by E-prime 1.0 in reference to a gaze-cueing procedure12. The procedure included one practice session and 4 formal

63

64

Figure 2. This bar chart depicts mean reaction time against different condition of cue consistency at a confidence intervals level of 95%

Figure 3. This chart depicts mean gaze trust percentage against different conditions of cue consistency at a confidence intervals level of 95%, including a reference of the level of chance (50%).

sessions. In the practice session, 16 trials were run as pictures with a random prompt of each figure were presented once. In each formal session, a random prompt was excluded and 4 pictures of each figure with cues were presented 4 times. The conditions of trials were randomized in each separate session.

There were 64 trials in each formal session and altogether 256 formal trials.

Subjects were instructed to imagine asking the figure presented on screen where they could buy colorful balloons and mention the figure might be deceptive. In each trial (seen in Figure 1), subjects fixated at the screen center and had to push button as reaction of to which direction they would like to go after they saw the presentation with cues. Button “m” presented right and button “c” presented left.

Subjects may enjoy a short interval between sessions.

Reaction time and responses were automatically recorded.

both cues when they are consistent as the trust percentage was around 80%, whereas they revealed neither a preference of gaze nor that of gesture as gaze trust percentage was around the level of chance (seen in figure 3). A Paired-Samples T Test

by SPSS 16.0 was performed with cue consistency as independent factors and gaze trust percentage as dependent variables. The analysis revealed gaze trust percentage in the cue-consistent condition was significantly larger (M=79.25, SD=17.51) than that in the cue-inconsistent condition (M=48.81, SD=15.22), t(26)=-7.829, p<.001. Since the level of chance (50%) suggested no preference of cues, another One Way T Test by SPSS 16.0 was performed with subjects or 50% as independent factors and gaze trust percentage as dependent variables. The analysis revealed there is no significant difference between gaze trust percentage of subjects and 50%, t(26)=-.402, p> .05.

Results

Current results highlighted the effect of cue consistency on detection of non-verbal deception.

The lengthened reaction time in cue-inconsistent condition was as expected and could be explained in terms of Donders subtractive method that subjects had to discern cue inconsistency first, following an equilibrium of two channels of cues and decide the preference, while cue-consistent condition was a merely simple decision on whether to believe both cues or not.

It could be seen that subjects were in the process of detection as their gaze trust percentage seldom reached 100%, though large in the cueconsistent condition. Reinharda and Sporerb (2006)

Figure 2 depicted reaction time of subjects against different conditions of cue consistency, which illustrated a 400-millisecond discrepancy.

A Paired-Samples T Test was performed with cue consistency as independent factor and reaction time as dependent variable. The analysis revealed reaction time in the cue-inconsistent condition was significantly longer (M=1764.00, SD=861.3) than that in the cue-consistent condition (M=1365.79, SD=652.1), t(26)=5.595, p<.001.

Responses were transferred to whether the subject trust gaze cues and calculated into gaze trust percentage for analyses. Subjects tended to believe

Discussion

The Oculus: Proceedings of the U21 UndergradUate research conference

Figure 4. This bar chart depicts mean reaction time against different condition of cue consistency and motivation at a confidence intervals level of 95%

pointed out that under low task involvement and/ or low cognitive capacity, observers predominantly used non-verbal information for their credibility judgment22. This experiment could be identified as low task involvement. Thus, in the case of suspicion when cues were consistent, it probably was subjectsâ&#x20AC;&#x2122; high cognitive capacity that required other cues and aroused suspicion.

In the cue-inconsistent circumstance, a preference of gesture (2.4%) to gaze wasnâ&#x20AC;&#x2122;t enough to generate a statistical significant difference.

Compared to previous studies, this experiment used data explicitly represent trust preference of facial cue or gesture cue instead of multichannel self-reports.

The differed results of preference may arise from an alteration of methodology, a simply inconsistent focus (i.e. consideration of believing gestures as successful strategies did not lead to believing them accordingly), or a change of schemes for detection of non-verbal deception due to a whirligig of time, since deliberate rational decision are dominate nowadays in many fields.

exPerIMenT 2 Method

40 undergraduates in Fudan University participated, 33 (18 males) among which counted while data of the others were exclude due to the biological wall of reaction time (150ms). Their mean age was 19.36 (SD=.86). All of them have normal eyesight (with or without glasses), were naive to the purpose of this experiment (didnâ&#x20AC;&#x2122;t participate in Experiment 1) and received a gift for their participation.

6 unfamiliar bust figures (3 males) were used as stimuli in the formal session and another 1 (female) figure was used in the practice one. Each figure had two versions of pictures (similar to experiment 1).

Figure 5. This bar chart depicts mean gaze trust percentage against different condition of cue consistency and motivation at a confidence intervals level of 95%, including a reference of the level of chance (50%).

Another version for the practice figure was with 5 colorful balloons in the low-motivated condition and a running thief from a back view, at left or right.

Thus, the practice figure had 16 pictures for the third version with prompt.

The with-subject variables in this experiment were cue consistency, including cue-consistent and cue-inconsistent conditions and motivation, including high and low conditions. In the highmotivated condition, the subject was instructed to imagine losing the sight of thief who had stolen his precious wallet and asking the person presented where the thief ran to. In the low-motivated condition, the subject was instructed to imagine asking where to buy colorful balloons to kill time.

The program was designed and run by E-prime 1.0 similar to Experiment 1. The procedure included 4 formal sessions, each including one practice session. In the practice session, 8 trials were run as pictures with a random prompt of each figure were accordingly (i.e. 5 colorful balloons in the low-motivated condition) presented once.

Different conditions were balanced designed in 4 sessions as the first and last sessions were highmotivated, the second and third sessions were lowmotivated. In each formal session, a random prompt was excluded and 4 pictures of each figure with cues were presented 2 times. The conditions of trials were randomized in each separate session. There were 48 trials in each formal session and altogether 192 formal trials.

In each session, subjects were instructed to imagine asking the figure presented on screen where they could buy colorful balloons or where the thief ran, and mention the figure might be deceptive (the scene of deception). Each trial flew like that in Experiment 1. Reaction time and responses were automatically recorded.

65

66 Results

Figure 4 illustrated reaction time against conditions of cue consistency and motivation. It could be observed that no matter what condition of motivation, cue-consistent fostered a longer reaction time, while discrepancy between conditions of motivation was not so obvious. A Repeated Measure ANOVA revealed a main effect of cue consistency on reaction, F(1, 32)=39.122, p < .001, ²=.550, and a marginal significant effect on reaction time F(1, 32)=3.996, p=.054, ²=.111, but a significant interaction wasn’t reached.

Whatever level of motivation in the cueinconsistent condition, an apparently smaller gaze trust percentage was presented. To be specific, the cue-consistent condition displayed a comparable result with Experiment 1, whilst the cue-inconsistent condition displayed a preference of gaze in the high-motivated condition to the low-motivated one. A Repeated Measure ANOVA revealed a main effect of cue consistency on gaze trust percentage, F(1, 32)=52.610, p<.001, ²=.622 and a main effect of motivation on gaze trust percentage F(1, 32)=4.297, p<.05, ²=.118, whereas a significant interaction wasn’t reached. In cue-consistent condition, a Pair-Sampled T Test didn’t reveal a significant difference between gaze trust percentage of in the low-motivated and high-motivated conditions. In cue-inconsistent condition, both One Way T Tests performed with the high-motivated condition and the level of chance, the low-motivated condition and the level of chance as independent factor, reaction time as dependent variable revealed no significant difference. In the cue-inconsistent condition, another Paired-Samples T Test revealed that gaze trust percentage in the high-motivated condition (M=.521, SD=.232)was significantly larger than that in the low-motivated condition (M=.451, SD=.243), t(32)=-2.235, p<.05.

Discussion

Results of this experiment reinforced the findings from Experiment 1 that reaction time was significantly longer in cue-inconsistent condition and also no trust preference of cues were shown in either high-motivated or low-motivated condition.

In this experiment, reaction time in the highmotivated condition was marginally significantly longer than that in the low-motivated one, which implied the motivation was aroused from situational stress or high involvement out of serious consequence, other than a sense of urgency.

However, in actual life contexts, motivation would be maximal18. Specific situations in the experiment need more careful design and post-hoc verification for a better external validity.

Design of this experiment was similar to Experiment 1, however specified in the verbalism as buying balloons was to “kill time” (counted little for low accuracy rate). Along with the former

experiment, slight preference of gesture could be seen at 2 percent, underlying a congruency with previous studies by Zuckerman16. Nonetheless, in the high-motivated situation when subjects were confronted with tougher task, a higher gaze trust percentage was reached. This referred a relationship between trust preference of cues and motivation.

To be noted, gaze trust percentage of high motivation to low motivation differed from conditions of cue consistency, which emphasized the effect of cue consistency on both detection and trust preference.

dIsCussIon

The present study remarked the effect of cue consistency and trust preference more definitely.

Both experiments enhanced the effect of cue consistency. The increase in cue-inconsistent reaction time would also result from no significant preference of cues under a certain situation.

Else, subjects would react quickly owing to preassured inclination when facing inconsistent cues.

Discrepancy between this study and previous ones in trust preference may lie in the repeat measures in this study, which ultimately lead gaze trust percentage to the level of chance. This might explain why observers remain low accuracy rate albeit previously found inclination to gesture, namely because of difference in measuring times.

Based on Experiment 1, motivation was further developed by experiment 2. Instead of defining motivation with difficulty of detection 23, this experiment focused on personal involvement of observers and possible consequences similar to daily life, but also suffered from conceivable role of the presented figure as a partner with the thief in the high-motivated situation.

From the perspective of deceptive situational design, with social Contact Theory, which was raised

by Cosmides, suggesting a module of deception detector that could be sensitively triggered by proper situations24, the introduction of gaze cueing procedure to studies of deception remains effective, once situation was designed suitably. For the reaction instruction, current study was based on the previous conclusion that rapid judgments were reliable and valid25 and intuitive processing can significantly improve deception detection performance with comparison to deliberate processing26. However, current experiments suffered from data exclusion of those who reacted too fast owing to biological wall of reaction time. Further design ought to well balance the reliability, validity and data effectiveness.

What’s more, accuracy rate could be involved in the dependent variable to achieve more grounded conclusion based on cue consistency and motivation, or to explain why people are usually deceived when they are highly motivated.

The Oculus: Proceedings of the U21 UndergradUate research conference For prospective studies, more factors could be considered as independent variables as well as controlled aspects, for instances, the effect of gaze cueing effect of gaze cue’s capacity of averting observer’s attention 27, sex differences in preference of cues28 and detecting references29, or particular check of the face of figures. Because whether a face represented honesty was relevant to its similarity with a baby face, characteristics of symmetry and attraction30. In addition, initial accuracy of trustworthiness judgments of untrustworthy faces (America’s Most Wanted criminals’) were less accurate (M=48.8%) than those of trustworthy (Nobel Peace Prize recipients/ humanitarians faces) (M=62.7%)31. As stimuli were produced with unfamiliar faces in this study, trustworthiness judgment along with intuition might influence the detection and require higher control in further studies.

In brief, the present study introduced a new appliance of method, which suggested cue consistency, along with detective preference of cues functioned importantly in exploring the mechanism of detection of non-verbal deception. Additionally, motivation based on personal involvement not only resembled real life, but also played an influential role in the detecting process and brought a novel explanation to why some people were more likely to be deceived.

ConClusIon

Cue consistency played a crucial role in the detecting process since subjects reacted significantly slowly in the cue-inconsistent condition. No significant trust preference of cues, either gaze cue or gesture cue, was revealed in a certain condition.

However, trust preference of cues was related to motivation, especially which arouse from personal involvement. Thus, both factors should be drawn attention to, in prospective researches on detection of non-verbal deception.

referenCes

1. DePaulo, B.M., Kashy, D.A., Kirkendol, S.E., Wyer, M.M., & Epstein, J.A. (1996). Lying in everyday life. Journal of Personality and Social Psychology, 70, 979-995.

2. Ekman, P., O’sullivan, M., &Frank, M.G. (1999).

A few can catch a liar. Psychological Science, 10(3), 263-266.

3. Ekman, P., & O’Sullivan, M. (1991). Who can catch a liar? American Psychologist, 46, 913–920.

4. Bond, C.F.Jr., & DePaulo, B.M. (2006). Accuracy of deception judgments. Personality and Social Psychology Review, 10, 214–234.

5. Porter, S., Woodworth, M., &Birt, A.R. (2000).

Truth, lies, and videotape: An investigation of the ability of federal parole officers to detect deception. Law and Human Behavior, 24, 643–658.

6. Scherer, K.R., & Ekman, P. (1982). Handbook of methods in non-verbal behavior research. Cambridge: Cambridge University Press.

7. Hood, B.M., Macrae, C.N., Cole-Davies, V., & Dias, M. (2003). Eyes remember you: The effects of gaze direction on face recognition in children and adults. Development Science, 6, 67-71.

8. Mason, M.F., Tatkow, E.P., & Macrae, C.N. (2005). The look of love: Gaze shifts and person perception. Psychological Science, 16, 236–239.

9. Zhao, Y., & Zhang, Z. (2007). Eye gaze perception and gaze cueing effect. Chinese Journal of Applied Psyhcology, 13(4), 323-328.

10. Bayliss, A., & Tipper, S.T. (2006). Predictive gaze cues and personality judgments: Should eye trust you? Psychological Science, 17(6), 514-520.

11. Liu, W. (2009). Socio-psychological analysis of gestures. Liberal Art Fans, 1(5), 43-44.

12. Riggio, R.E., & Friedman, H.S. (1983). Individual differences and cues to deception. Journal of Personality and Social Psychology, 45(4), 899-915.

13. Wegner, D.M. (1994). Ironic processes of mentalcontrol. Psychological Review, 101, 34-52.

14. Ekman, P., & Friesen, W.V. (1969). The repertoire of non-verbal behavior: Categories, origins, usage, and coding. Semiotica, 1, 49-98.

15. Ekman, P., & Friesen, W.V. Detecting deception from the body or face. (1974). Journal of Personality and Social psychology, 29(3), 288-298.

16. Zuckerman, M., Spiegel, N. H., DePaulo, B. M., & Rosenthal, R. (1982). Non-verbal strategies for decoding deception. Journal of Non-verbal Behavior, 6(3), 171-187.

17. Hyman, R. (1989). The psychology of deception.

Annual Review of Psychology, 40, 133-154.

18. Ross, L. & Nisbett, R.E. (1991). The person and situation: perspective of social psychology. New York: Temple University Press.

19. Taylor, R., & Hick, R.F. (2007). Believed cues to deception: Judgments in self-generated trivial and serious situations. Legal and Criminological Psychology, 12, 321-331.

20. Gustafson, L.A., & Orne, M.T. (1963). Effects of heightened motivation on the detection of deception, Journal of Applied Psychology, 47(6), 408-411.

21. Thackray, R.L., Orne, M.T. (1968). Effects of the type of stimulus employed and the level of subject of subject awareness on the detection of deception. Journal of Applied Psychology, 52(3), 234239.

22. Reinharda, M.A., & Sporerb, S.L. (2006). Verbal and non-verbal behavior as a basis for credibility attribution: The impact of task involvement and cognitive capacity. Journal of Experimental Social Psychology, 44(3), 477-488.

23. Porter, S., McCabe, S., Woodworth, M., & Peace, K. A. (2007). ‘Genius is 1% inspiration and 99% perspiration.’ or is it? An investigation of the

67

68 impact of motivation and feedback on deception detection. Legal and Criminological Psychology, 12, 297â&#x20AC;&#x201C;309.

24. Cosmides, L. (1989). The logic of social exchange: Has natural selection shaped how humans reason? Studies with the Wason selection task.

Cognition, 31.

25. Vrij, A., Evans, H., Akehurst, L., & Mann, S. (2004). Rapid judgments in assessing verbal and non-verbal cues: Their potential for deception researchers and lie detection. Basic and Applied Social Psychology, 18, 283-296.

26. Albrechtsen, J.S., Meissner, C.A, & Susa, K.J. (2009). Can intuition improve deception detection performance? Journal of Experimental Social Psychology, 45(4), 1052-1055.

27. Langton, S.R.H., &Bruce, V. (1999). Reflexive visual orienting in response to the social attention of others. Visual Cognition, 6 (5), 541-567 28. Nihei, & Yoshiaki. (2009). Sex differences in beliefs among Japanese students about cues.

Psychological Reports, 104(3), 759-769.

29. Hildebrandt, T., Shiovitz, R., Alfano, L, &Greif, R. (2008). Defining body deception and its role in peer based social comparison theories of body dissatisfaction. Body Image, 5, 299-306.

30. Bull, R. (2006). Detecting lies and deceit: The psychology of lying and the implications for professional practice. Journal of Community and Applied Social Psychology, 16, 166â&#x20AC;&#x201C;167.

31. Porter, S., England, L., Juodis, M., Brinke, L.T, & Wilson, K. (2008). Is the face a window to the soul? Investigation of the accuracy of intuitive judgments of the trustworthiness of human faces.

Canadian Journal of Behavioral Science, 40(3), 171-177.

aCknowledgMenTs

I would love to express my sincere gratitude to prof. Xiuyan Guo, Chu Zhou, Lei Zhu, Jun Gao and Fan Chen for their precious suggestions on this study. Many thanks go to FDUROP foundation for this project, Fudan University and Universitas 21. I am pretty grateful to my family and friends, Yini Sun and Kai Liu for supporting me all the time.

The Oculus: Proceedings of the U21 UndergradUate research conference

Matrix Isolation Spectroscopic and Theoretical Study of Water Adsorption and Hydrolysis on Molecular Vanadium Oxides Jia Zhuang

Fudan University

absTraCT

The reactions between molecular vanadium monoxides and dioxides with water were investigated by matrix isolation infrared spectroscopy in solid neon. Vanadium monoxide and dioxide molecules formed the VO(H2O) and VO2(H2O) complexes with water spontaneously on annealing. Under 500< l < 580 nm irradiation, the VO(H2O) and VO2(H2O) complexes rearranged to the more stable HVO(OH) and VO(OH)2 isomers via O-H cleavage and hydrogen atom transfer. Under 300< l < 580 nm irradiation, HVO(OH) isomerized to linear V(OH)2 via hydrogen atom transfer again. The intermediates and products were identified by isotopic substituted experiments as well as density functional calculations.

InTroduCTIon

T

he photocatalytic splitting of water into hydrogen and oxygen using solar energy is a potentially clean and renewable source for hydrogen fuel, so it has gained the most attention in last several decades1-3. The research on photocatalysts develops dramatically in recent years, including biological photocatalysts, non-oxide photocatalysts4,5 and metal-oxide ones6. As a result, the fundamental study on the reactions between reagents and water molecule with atomic resolution is very meaningful for the future exploitation of the novel photocatalysts.

The key step in splitting is the cleavage of O-H bond, and mass spectroscopy proves to be a suitable experimental analytical method to deal with the situation7, while theoretical calculation can help to give abundant supporting data8. When concerned with the metal-containing inorganic reagents like metal oxides, infrared spectroscopy shows their special capability9. Because of this, matrix isolation FTIR spectroscopy can be a promising method to focus on the transient intermediates and the reaction mechanisms. Matrix isolation studies in the laboratory indicate that neutral metal dioxide molecules such as TiO2 and BO2 can react spontaneously with water to form the oxyhydroxide molecules in the presence of O-H cleavage10,11, whereas only water complexes were observed in the reaction of PtO2 and H2O in solid argon12. Group V metal (V, Nb, Ta) oxides photocatalysts attract the scientists due to their special electronic configurations5. In our previous work, we reported a matrix isolation infrared spectroscopic and density functional theoretical study on the reactions of molecular niobium and tantalum oxides with water13, we found that the water molecule coordinated to the metal center on annealing, while the complexes rearranged to more stable isomers through H atom immigration under visible light irradiation. Our interest is in O-H cleavage of water by vanadium oxides.

exPerIMenTal and TheoreTICal MeThods

The experimental setup for pulsed laserevaporation and matrix isolation infrared spectroscopic investigation is similar to those used previously14. Briefly, the 1064 nm fundamental of a Nd:YAG laser (Continuum, Minilite II, 10 Hz repetition rate and 6 ns pulse width) was focused onto a rotating V2O5 target through a hole in a CsI window cooled normally to 4 K by means of a closed-cycle helium refrigerator. The laserevaporated metal oxide species were co-deposited with H2O/Ne mixtures onto the CsI window. In general, matrix samples were deposited for 30 min at a rate of approximately 4 mmol/h. The bulk V2O5 targets were prepared from sintered metal oxide powder. The H2O/Ne mixtures were prepared in a stainless steel vacuum line using standard manometric technique. Distilled water was cooled to 77 K using liquid N2 and evacuated to remove volatile impurities. Isotopically labeled D2O and H218O (Cambridge Isotopic Laboratories, 96%) were used without further purification. Isotopic exchange with water adsorbed on the walls of the vacuum line occurred readily; so in the experiments with the H218O sample, the H216O absorptions were also presented, the situation in the D2O sample resembled to the H218O one. The infrared absorption spectra of the resulting samples were recorded on a Bruker IFS 80V spectrometer at 0.5 cm-1 resolution between 4000 and 450 cm-1 using a liquid nitrogen cooled HgCdTe (MCT) detector. Samples were annealed to different temperatures and cooled back to 4 K for spectral acquisition, and selected samples were subjected to broad band irradiation using a high-pressure mercury arc lamp with glass filters.

Quantum chemical calculations were performed to determine the molecular structures and to help the assignments of vibrational frequencies of the observed reaction products. The calculations were performed at the level of density functional

69

70 theory (DFT) with the B3LYP method, where Beckeâ&#x20AC;&#x2122;s three-parameter hybrid functional and the Lee-YangParr correlation functional were used15. The B3LYP functional is the most popular density functional methods and can provide reliable predictions on the structures and vibrational frequencies of early transition metal-containing compounds16. The 6-311++G(d,p) basis set was used for the H and O atoms, and the SDD pseudo potential and basis set was used for the V atoms17,18. The geometries of various reactants, intermediates and products were fully optimized, and the harmonic vibrational frequencies were calculated with analytic second derivatives. The zero-point energies (ZPE) were derived. Transition state optimizations were done with the Berny Optimization method (TS) and were verified through intrinsic reaction coordinate (IRC) calculations19. All these calculations were performed by using the Gaussian 03 program20.

resulTs and dIsCussIon

It has shown that pulsed laser evaporation of bulk metal oxide target followed by condensation with host gas argon is an effective method in preparing transition metal oxide species for their reactivity study21-23. However, it was found that some transition metal oxide molecules such as Group V metal dioxides trapped in solid argon are coordinated by one or more argon atoms which decreases their reactivity with other molecules24,25.

In order to minimize this matrix effect, we use the more inert neon as host gas in our present study.

VOx

2

O

After 30 min co-deposition of vanadium oxides evaporated from bulk V2O5 target and 0.05% H2O in excess neon matrix, it formed strong VO, VO2, H2O absorptions and weak (H2O)2 absorptions at a temperature of 4K (figure 1, 2 trace a). The absorption at 998.8 cm-1 was according to VO, and that at 997.4 cm-1 was its site frequency. Considering VO2, the absorption at 947.5 cm-1 was its 3 frequency, while the 1 frequency of VO2 is too weak to be detected. When the sample was annealed to 12 K, the absorptions of VO and VO2 decreased sharply, and new peaks at 3693.7, 3614.5, 1581.4, and 1011.4 cm-1 appeared (figure 1, 2 trace b). At the same time, absorptions at 3699.9, 3620.8, 1603.0, 955.9, and 839.9 cm-1 increased dramatically. After 15 min light irradiation using high-pressure mercury arc lamp with the glass filter of 500 < < 580 nm, the absorptions at 3693.7, 3614.5, 1581.4, and 1011.4 cm-1 were fully destroyed, while peaks at 3699.9, 3620.8, 1603.0, 955.9, and 839.9 cm-1 diminished intensively (figure 1,2 trace c). On the other hand, new peaks at 3727.6, 1747.1, 1741.1, 1030.6, 754.0 cm-1 came into the spectrum, along with another group of absorptions at 3718.3, 1022.4, 807.6, 806.2, 691.4, and 466.3 cm1 . Then the sample was treated with the light

between the wavelength of 300 and 580 nm, it was obvious that new absorptions at 3655.8 and 794.1 cm-1 emerged in the spectrum at the expense of the absorptions at 3727.6, 1747.1, 1741.1, 1030.6, 754.0 cm-1 (figure 1, 2 trace d). In the meanwhile, absorptions at 3718.3, 1022.4, 807.6, 806.2, 691.4, and 466.3 cm-1 became larger than before, showing that they were favored with this wavelength range of light. All these changes in the spectrum are showed in the Figures 1 and 2, and the infrared absorption wavenumbers of the intermediates and products are listed in Table 1.

Experiments were also repeated using the isotopic-labeled H216O + H218O and H2O + HDO + D2O mixtures. The spectra in selected regions with different isotopic samples are shown in Figures 3-5, respectively. The corresponding absorptions are summarized in Table 1.

VO(H2O)

The absorptions at 3693.7, 3614.5, 1581.4, and 1011.4 cm-1 are assigned to the vibration modes of VO(H2O) complex. The weak absorptions at 3693.7 and 3614.5 cm-1 is due to the antisymmetric and symmetric O-H stretching modes of the complex, and the one at 1011.4 cm-1 is V=O stretching vibration mode of VO(H2O). The V=O mode is approximately 12.6 cm-1 blue-shift than the diatomic VO. And also, the great absorption at 1581.4 cm-1, together with its isotopic peak at 1574.1 cm-1 in H218O and 1396.8 cm-1 in D2O, showed that it is the O-H bending vibration frequency. VO(H2O) complex formed spontaneously during the annealing process, providing that this coordination is an exothermic reaction and it did not need addition energy to propel the reaction. Under 500 < 580 nm light irradiation, the complex were entirely destroyed and formed its isomer HVO(OH).

DFT/B3LYP method was used to give the theoretical data of the complex. VO has two electronic 4 states 2 and Gaussian results showed that the energy of is lower than that of As a result, the electronic state of VO(H2O) yielded to that of VO, and the complex has a 4A state which enjoys a lower energy. The H2O bending modes was predicted to have large IR intensities, which totally matched the experimental results. However, the relative intensities of O-H antisymmetric and symmetric stretching modes are slightly overestimated because of occasional overestimate about the relative intensities of hydrogen atom-involved vibrational modes21(a),26. The V=O bonding is prolonged to 1.601 Ă&#x2026; because of the coordination of the O atom from water directly to the metal center.

HVO(OH)

After 15 min irradiation under 500 < < 580 nm light, HVO(OH) species appeared in the spectrum at an expense of the VO(H2O) through the transfer of H atom from the water to the metal center. Its absorptions are at 3727.6, 1747.1, 1741.1,

The Oculus: Proceedings of the U21 UndergradUate research conference 1030.6, and 754.0 cm-1. All of these absorptions have great intensities to be easily investigated. The absorption of O-H stretching mode is at 3727.6 cm-1, while its isotopic peaks are at 3715.9 cm-1 in H218O and 2749.9 cm-1 in D2O. The absorption at 1747.1 cm-1, along with 1746.0 cm-1 in H218O and 1262.5cm1 in D2O, proved to be the V-H stretching vibration mode. Its site absorption is at 1741.1 cm-1. In the lower wavenumber range, peak at 1030.6 cm-1 is the V=O stretching mode and which at 754.0 cm-1 is the V-OH stretching vibration frequency. During the next step irradiation, HVO(OH) species disappeared to form its isomer product V(OH)2.

The theoretical data supports the idea of O-H cleavage during the progress. We calculated the energies of the two electronic states of HVO(OH), 2A and 4A, respectively. It was found that the 2A state have a lower energy than the 4A one, so we confirmed that the electronic state of HVO(OH) is 2A, which is quite different from its precursor VO(H2O). The precursor might go through TS3 to reach HVO(OH) in quartet state and then shift to the doublet state; or it might first change to the doublet state and reach HVO(OH) through TS1. The optimized structures of the intermediate and the transition states are shown in Figure 6.

V(OH)2

The absorptions at 3655.8 and 794.1 cm-1 are assigned to the antisymmetric O-H stretching mode and antisymmetric V-OH stretching mode of V(OH)2, respectively. The isotopic absorptions of O-H stretching vibration in H218O and D2O are at 3646.2 cm-1 and 2678.2 cm-1. This species appeared after 300 < < 580 nm light irradiation, forming by H atom transfer from the metal center to the O atom from the original VO. Theoretical calculation showed three useful information: first, the molecule is a linear one which has a C2v symmetry; second, only two vibration modes of the molecule are strong enough to be seen, which met the experimental results; and third, compared to the HVO(OH), the 4B1 state of V(OH)2 is more stable than the 2B1 state, so the reaction from HVO(OH) to V(OH)2 also went through an electronic state change progress. The theoretical data are listed in Table 2.

VO2(H2O)

The 3699.9, 3620.8, 1603.0, 955.9 and 839.9 cm-1 absorptions appeared together on annealing at the expense of the VO2, and are the vibration modes of VO2(H2O) complex. The peaks at 3699.9 and 3620.8 cm-1 are due to the antisymmetric and symmetric stretching vibration of O-H. The bending mode of H2O is at 1603.0 cm-1. Strong absorption at 955.9 cm-1 and weak one at 839.9 cm-1 are the antisymmetric and symmetric V=O stretching modes of the complex.

The antisymmetric vibration frequency is 8.4 cm-1

blue-shift than the VO2. The formation of the complex is an exothermic process. It formed spontaneously during the annealing, decreased intensively when under above 500 nm irradiation, and was totally destroyed when given 15 min irradiation of above 300 nm light.

Theoretical study informs that the electronic state of the complex is 2Aâ&#x20AC;&#x2122;, which correlates to ground state of VO2 (2A1). The complex has Cs symmetry, and the O atom from water coordinates to the vanadium atom. The V=O bonding is elongated to 1.617 Ă&#x2026; because of the coordination of H2O, showing the electrostatic interaction between VO2 and H2O. As listed in Table 2, the calculated vibrational frequencies fit the observed values.

VO(OH)2

The absorptions of VO(OH)2 are shown at 3718.3, 1022.4, 807.6, 806.2, 691.4, and 466.3 cm-1. The 3917.8 cm-1 absorption is according to the antisymmetric O-H stretching vibration, and its isotopic peaks are at 3708.1 cm-1 in H218O and 2741.1 cm-1 in D2O, respectively. The strong 1022.4 cm-1 peak is due to the V=O stretching vibration. At 807.6 cm-1, it is the antisymmetric stretching vibration of the V-OH, and its site is at 806.2 cm-1. The symmetric stretching vibration absorption is at 691.4 cm-1. Quite different from other species, we found the O-H wag vibration absorption at 466.3 cm-1. All these absorptions were strong enough to be detected and assigned to the different vibration modes of VO(OH)2. VO(OH)2 species first came out after 15 min irradiation of 500 < < 580 nm light, and it grew larger when treated with 300 < < 580 nm light.

The theoretical results reached an agreement with the experimental ones. The compound has planar C2v symmetry while the two hydroxide groups are in the cis-cis form. And also, the electronic state of this compound is 2A1, which correlates to its precursor VO2(H2O). By the O-H cleavage of the water in VO2(H2O) complex and the H atom transfer from the water molecule to the O atom originated from VO2, VO2(H2O) formed VO(OH)2 through a transition state TS5. The data are given in Table 2.

Reaction Mechanism

Pulsed laser evaporation of bulk V2O5 targets produces vanadium monoxide and dioxide molecules as the major products. Then the vanadium oxides react with water to form the 1:1 vanadium oxidewater complexes. The spontaneous formation of these metal oxide-water complexes upon annealing implies these coordination reactions are exothermic and it does not need additional energies to propel the reactions.

71

72 The binding energies of the VO(H2O) and VO2(H2O) complexes with respect to VO + H2O and VO2 + H2O were predicted to be 16.0 and 30.7 kcal/mol. The binding energy of VO2(H2O) is about twice as large as the corresponding values of the monoxide complex due to the increased electrostatic interactions.

After 15 min 500 < l < 580 nm light irradiation, the O-H cleavage occurs in both of the complexes.

In VO(H2O) complex, the H atom from the water transfers to the vanadium center to form the HVO(OH) and the electronic state shifts from quartet state of VO(H2O) to the doublet state of HVO(OH), because the doublet state of HVO(OH) has lower energy than the quartet one. Considering VO2(H2O) complexes, the H atom has migration to the O atom in the original VO2 molecules to form final product VO(OH)2. Both of the reactions need activation energies and go through transition states.

The ground state energy of HVO(OH) is 27.5 kcal/mol lower than that of VO(H2O), and the binding energy VO(OH)2 with respect to VO2(H2O) complex is 38.1 kcal/mol. The total energy of doublet state HVO(OH) is 56.0 k/mol lower than the quartet one, so the ground state of HVO(OH) is 2A. The barrier in (3) is 24.6 kcal/mol if the reaction goes via TS1 or 28.9 kcal/mol via TS3. On the other hand, the barrier energy in (4) is 9.7 kcal/mol via TS5.

After 15 min 300 < < 580 nm light irradiation, the HVO(OH) compounds rearrange to the linear V(OH)2 isomer via H atom transfer from vanadium center to the O atom of the original VO. The doublet state goes back to the quartet state according to the preference of the lower energy.

The energy of the final product V(OH)2 is 16.2 kcal/mol lower than the intermediate HVO(OH).

And also, the barrier is 36.0 kcal/mol for TS2 and 57.3 kcal/mol for TS4.

All the calculation data are provided in Table 2, and the structures of the intermediates and the products are shown in Figure 6.

ConClusIon

We report the O-H cleavage of water by molecular vanadium monoxides and dioxides, using matrix isolation infrared spectroscopy, as well as density functional theoretical calculations.

The vanadium monoxide and dioxide molecules from pulse laser evaporation of bulk V2O5 targets reacted with water to form the VO(H2O) and VO2(H2O) complexes spontaneously on annealing.

These 1:1 complexes were characterized to involve coordination interactions between the O atom of water and the metal center. Then VO(H2O)

complexes isomerized to more stable HVO(OH) via O-H cleavage and H atom transfer under visible light excitation with the wavelength range of 500-580 nm.

At the same time, VO2(H2O) complexes rearranged to VO(OH)2 molecules via O-H cleavage and H atom transfer. At last, upon visible light irradiation in the wavelength range of 300-580 nm, the HVO(OH) molecules became the final product V(OH)2 by H atom transfer from the metal center to the O atom from the original VO molecules.

referenCes

1. Honda, K.; Fujishima, A. Nature 1972, 238, 37.

2. Bard, A. J.; Fox, M. A. Acc. Chem. Res. 1995, 28, 141.

3. Zou, Z.; Ye, J.; Sayama, K.; Arakawa, H. Nature 2001, 414, 625.

4. Sato, J.; Saito, n.; Yamada, Y.; Maeda, K.; Takata, T.; Kondo, J. N.; Hara, M.; Kobayashi, H.; Domen K.; Inoue, Y. J. Am. Chem. Soc. 2005, 127, 4150.

5. Maeda, K.; Domen, K. J. Phys. Chem. C 2007, 111, 7851.

6. (a) Park, J. H.; Kim, S.; Bard, A. J. Nano Lett. 2006, 6, 24. (b) Aroutiounian, V.M.; V.M. Arakelyan, Shahnazaryan, G.E. Sol. Energy 2005, 78, 581. (c) Teramura, K.; Maeda, K.; Saito, T.; Takata, T.; Saito, N.; Inoue, Y.; Domen, K. J. Phys. Chem. B 2005, 109, 21915.

7. (a) Bader, K.P.; Renger, G.; Schmid, G.H. Photosynth. Res. 1993, 38, 355. (b) Fong, F. K.; Galloway, L. J. Am. Chem. Soc. 1978, 100, 3594. (c) Koyanagi, G. K.; Bohme, D. K.; Kretzschmar, I.; Schro1der, D.; Schwarz, H. J. Phys. Chem. A 2001, 105, 4259.

8. (a) Valentin C. D. J. Phys. Chem. C 2010, 114, 7054. (b) Magnera, T. F.; David, D. E.; Michl, J. J. Am. Chem. Soc. 1989, 111, 4100.

9. (a) Yamakata, A.; Ishibashi, T.; Onishi, H. J. Mol. Catal. A-Chem. 2003, 199, 85. (b) Ikeda, T.; Fujiyoshi, S.; Kato, H.; Kudo, A.; Onishi, H. J. Phys. Chem. B 2006, 110, 7883.

10. Shao, L. M.; Zhang, L. N.; Chen, M. H.; Lu, H.; Zhou, M. F. Chem. Phys. Lett. 2001, 343, 178.

11. Gong, Y.; Zhou, M. F. J. Phys. Chem. A 2008, 112, 5670.

12. Gong, Y.; Zhou, M. F. ChemPhysChem. 2010, 11, 1888.

13. Zhou, M. F.; Zhuang, J.; Wang, G. J.; Chen, M. H. J. Phys. Chem. A accepted 14. Wang, G. J.; Zhou, M. F. Int. Rev. Phys. Chem.

2008, 27, 1.

15. (a) Becke, A. D. J. Chem. Phys. 1993, 98, 5648. (b) Lee, C.; Yang, W.; Parr, R. G. Phys. Rev. B 1988, 37, 785.

16. (a) Cramer, C. J.; Truhlar, D. G. Phys. Chem. Chem.

Phys. 2009, 11, 10757. (b) Sousa, S. F.; Fernandes, P. A.; Ramos, M. J. J. Phys. Chem. A 2007, 111, 10439.

The Oculus: Proceedings of the U21 UndergradUate research conference 17. (a) Woon, D. E.; Dunning, T. H. Jr. J. Chem. Phys.

1993, 98, 1358. (b) Kendall, R. A.; Dunning, T. H. Jr.; Harrison, R. J. J. Chem. Phys. 1992, 96, 6796.

18. (a) Dolg, M.; Stoll, H.; Preuss, H. J. Chem. Phys.

1989, 90, 1730. (b) Andrae, A.; Haussermann, U.; Dolg, M.; Stoll, H.; Preuss, H. Theor. Chim. Acta.

1990, 77, 123.

19. (a) Peng, C.; Ayala, P. Y.; Schlegel, H. B.; Frisch, M. J. J. Comput. Chem. 1996, 17, 49. (b) Reed, A. E.; Weinhold, F. J. Chem. Phys. 1983, 78, 4066.

20. Gaussian 03, Revision B.05, Frisch, M. J.; Trucks, G. W.; Schlegel, H. B.; Scuseria, G. E.; Robb, M. A.; Cheeseman, J. R.; Montgomery, J. A., Jr.; Vreven, T.; Kudin, K. N.; Burant, J. C.; Millam, J. M.; Iyengar, S. S.; Tomasi, J.; Barone, V.; Mennucci, B.; Cossi, M.; Scalmani, G.; Rega, N.; Petersson, G. A.; Nakatsuji, H.; Hada, M.; Ehara, M.; Toyota, K.; Fukuda, R.; Hasegawa, J.; Ishida, M.; Nakajima, T.; Honda, Y.; Kitao, O.; Nakai, H.; Klene, M.; Li, X.; Knox, J. E.; Hratchian, H. P.; Cross, J. B.; Adamo, C.; Jaramillo, J.; Gomperts, R.; Stratmann, R. E.; Yazyev, O.; Austin, A. J.; Cammi, R.; Pomelli, C.; Ochterski, J. W.; Ayala, P. Y.; Morokuma, K.; Voth, G. A.; Salvador, P.; Dannenberg, J. J.; Zakrzewski, V. G.; Dapprich, S.; Daniels, A. D.; Strain, M. C.; Farkas, O.; Malick, D. K.; Rabuck, A. D.; Raghavachari, K.; Foresman, J. B.; Ortiz, J. V.; Cui, Q.; Baboul, A. G.; Clifford, S.; Cioslowski, J.; Stefanov, B. B.; Liu, G.; Liashenko, A.; Piskorz, P.; Komaromi, I.; Martin, R. L.; Fox, D. J.; Keith, T.; Al-Laham, M. A.; Peng, C. Y.; Nanayakkara, A.; Challacombe, M.; Gill, P. M. W.; Johnson, B.; Chen, W.; Wong, M. W.; Gonzalez, C.; Pople, J. A. Gaussian, Inc.: Pittsburgh, PA, 2003.

21. (a) Zhou, M. F.; Zhang, L. N.; Shao, L. M.; Wang, W. N.; Fan, K. N.; Qin, Q. Z. J. Phys. Chem. A 2001, 105, 10747. (b) Zhou, M. F.; Zhang, L. N.; Qin, Q. Z. J. Phys. Chem. A 2001, 105, 6407.

22. (a) Wang, G. J.; Chen, M. H.; Zhou, M. F. J. Phys.

Chem. A 2004, 108, 11273. (b) Wang, G. J.; Gong, Y.; Chen, M. H.; Zhou, M. F. J. Am. Chem. Soc. 2006, 128, 5974. (c) Wang, G. J.; Chen, M. H.; Zhao, Y. Y.; Zhou, M. F. Chem. Phys. 2006, 322, 354. (d) Wang, G. J.; Lai, S. X.; Chen, M. H.; Zhou, M. F. J. Phys. Chem. A 2005, 109, 9514. (e) Huang, Y. F.; Zhao, Y. Y.; Zheng, X. M.; Zhou, M. F. J. Phys.

Chem. A 2010, 114, 2476.

23. (a) Zhou, M. F.; Wang, C. X.; Li, Z. H.; Zhuang, J.; Zhao, Y. Y.; Zheng, X. M.; Fan, K. N. Angew.

Chem. Int. Ed. 2010, 49, 7757. (b) Wang, C. X.; Zhuang, J.; Wang, G. J.; Chen, M. H.; Zhao, Y. Y.; Zheng, X. M.; Zhou, M. F. J. Phys. Chem. A 2010, 114, 8083. (c) Zhao, Y. Y.; Huang, Y. F.; Zheng, X. M.; Zhou, M. F. J. Phys. Chem. A 2010, 114, 5779.

24. (a) Zhao, Y. Y.; Wang, G. J.; Chen, M. H.; Zhou, M. F. J. Phys. Chem. A 2005, 109, 6621. (b) Zhao, Y. Y.; Gong, Y.; Chen, M. H.; Ding, C. F.; Zhou, M. F. J. Phys. Chem. A 2005, 109, 11765. (c) Zhao, Y. Y.; Gong, Y.; Zhou, M. F. J. Phys. Chem. A 2006, 110, 10777.

25. (a) Zhao, Y. Y.; Gong, Y.; Chen, M. H.; Zhou, M. F. J. Phys. Chem. A 2006, 110, 1845. (b) Zhao, Y. Y.; Zheng, X. M.; Zhou, M. F. Chem. Phys. 2008, 351, 18.

26. (a) Plitt, H. S.; Bär, M. R.; Ahlrichs, R.; Schnöckel, H. Angew. Chem. Int. Ed. 1991, 30, 832. (b) Lee, Y. K.; Manceron, L.; Papai, I. J. Phys. Chem. A 1997, 101, 9650.

aCknowledgMenTs

I gratefully acknowledge my undergraduate research advisor, Professor Mingfei Zhou, and financial support from National Basic Research Program of China (2007CB815203 and 2010CB732306).

73

74

Table 1. Infrared absorptions (in cm-1) from co-deposition of laser-evaporated vanadium oxides with water in excess neon.

Table 2. Calculated total energies (in hartree, after zero point energy corrections), vibrational frequencies (cm-1) and intensities (km/mol) of the species involved in the VOx + H2O reactions (x=1, 2).

The Oculus: Proceedings of the U21 UndergradUate research conference

Figure 1. Infrared spectra in the 1040-830 cm-1 region from codeposition of laser-evaporated vanadium oxides with 0.05%H 2O in neon. (a) 30 min of sample deposition at 4 K, (b) after 12 K annealing, (c) after 15 min of visible light (500 < < 580 nm) irradiation, and (d) after 15 min of visible light (300 < < 580 nm) irradiation.

Figure 3. Difference IR spectra in the 1800-1100 cm-1 region from co-deposition of laser-evaporated vanadium oxides with water in excess neon (Spectrum taken after 15 min of visible light (500 < < 580 nm) irradiation minus spectrum taken after 12 K annealing). (a) 0.05% H2O/Ne, (b) 0.05% H216 H218O/Ne, and (c) 0.05% H2 O/Ne. 2

Figure 2. Infrared spectra in the 3750-3600 and 1760-1560 cm-1 regions from co-deposition of laser-evaporated vanadium oxides with 0.05% H2O in neon. (a) 30 min of sample deposition at 4 K, (b) after 12 K annealing, (c) after 15 min of visible light (500 < < 580 nm) irradiation, and (d) after 15 min of visible light (300 < < 580 nm) irradiation.

Figure 4. Difference IR spectra in the 3760-3600 and 2770-2610 cm-1 regions from co-deposition of laser-evaporated vanadium oxides with water in excess neon (Spectrum taken after 15 min of visible light (300 < < 580 nm) irradiation minus spectrum taken after 15 min of visible light (500 < < 580 nm) irradiation).

18 (a) 0.05% H2O/Ne, (b) 0.05% H216 O/Ne, and (c) 2 0.05% H2 O/Ne. 2

75

76

Figure 5. Difference IR spectra in the 830-670 cm-1 regions from co-deposition of laser-evaporated vanadium oxides with water in excess neon (Spectrum taken after 15 min of visible light (300 < < 580 nm) irradiation minus spectrum taken after 15 min of visible light (500 < < 580 nm) irradiation). (a) 0.05% H 2O/Ne, 18 (b) 0.05% H216 O/Ne, and (c) 0.05% H2 2 O/Ne. 2 Figure 6. Optimized structures (bond lengths in angstroms and bond angles in degrees) of the species involved in the VOx O 2 reactions (x=1, 2).

Figure 7. Potential energy profiles of the VOx

2

The Oculus: Proceedings of the U21 UndergradUate research conference

Molecular Study of AtNYE1 and AtNYE2 in Arabidopsis: an Insight into the Pathway of Chlorophyll Degradation Jiwen Xin

Fudan University

absTraCT

Leaf color turns yellow during senescence due to the degradation of chlorophylls and photosynthetic proteins. A non-yellowing mutant was identified from the M2 population of fast-neutron mutagenized Arabidopsis (Columbia-0). The mutant exhibited a stable non-yellowing phenotype during both natural and dark-induced senescence of leaves. The stay green phenotype was controlled by a single recessive nuclear gene, tentatively symbolized as AtNYE1. AtNYE2 is a putative paralogue of AtNYE1 with an approximately 75% similarity in protein sequence. A knockout line of AtNYE2 didnâ&#x20AC;&#x2122;t stay-green during leaf senescence, however over-expression of AtNYE2 could efficiently cause leaf yellowing, even in nye1-1 background.

Besides, the stay-green phenotype in AtNYE1/AtNYE2 double mutant was enhanced. Through changing the promoter of AtNYE1 and AtNYE2, we revealed that both the promoter as well as the coding sequence in AtNYE1 perform stronger role in the chlorophyll degradation pathway than their counterparts in AtNYE2.

And AtNYE2, a protein which AtNYE2 encodes can function in the pathway of chlorophyll degradation.

InTroduCTIon

S

enescence is known as the last stage of growth and development in plants. It has been elucidated that various environmental and developmental factors are involved in the induction of leaf senescence, and the timing of leaf senescence is controlled by the molecular regulators rather than been a passive degenerative process [1][2].

Leaf yellowing caused by chlorophyll degradation has long been used as a phenotypic marker of plant senescence. Green chlorophyll is converted in a multi-step pathway to linear colorless and nonfluorescent tetrapyrroles, nonfluorescent chlorophyll catabolites (NCCs). The series of reactions begin with the removal of phytol and magnesium (Mg) by chlorophyllase and Mgdechelatase, respectively, followed by the conversion of pheophorbide (pheide) a to pFCC-1, requiring the activity of two enzymes, pheide a oxygenase (PAO) and red chlorophyll catabolite (RCC) reductase (RCCR)[3][4]. Thus, pFCCs are activated by hydroxylation. After further modification, they are imported into the vacuole by another primary active transport system. FCCs are eventually tautomerized non-enzymatically to NCCs because of the acidic vacuolar pH[5][6].

Many senescence-related mutants have been discovered in plants that maintain leaf greenness after the grain-ripening stage, and which are referred to as stay green or non-yellowing [7]. AtNYE1 mutant has been characterized as a Type C mutant, which retains chlorophyll almost indefinitely due to the malfunction of chlorophyll degradation mechanisms. The nye1-1 mutant exhibited a stable non-yellowing phenotype during both natural and dark-induced senescence of leaves either attached,

detached, or in planta(Fig.1) [8]. AtNYE2 is a putative paralogue of AtNYE1 with an approximately 75% protein-sequence similarity. Whether AtNYE2 acts in the chlorophyll degradation pathway remains unknown. In 2008, Hortensteiner et.al point out that AtNYE2 does not significantly contribute to chlorophyll degradation in Arabidopsis by showing that silencing of AtNYE1 expression in the knockout line atnye2-1 did not enhance the stay-green phenotype observed in atsgr1i, a RNAi knockout line of nye1.[9] However, our lab has discovered that over-expression of AtNYE2 could efficiently cause leaf yellowing, even in nye1-1 background(Fig. 2). And double mutant of AtNYE1/AtNYE2 can significantly enhance the nye1-1 mutant phenotype.

Here, we show that AtNYE2 can function in the pathway of chlorophyll degradation without the presence of AtNYE1, and the difference in the activity of promoters between AtNYE1 and AtNYE2 may partly account for their phenotype difference.

MeThods

Plasmid Construction

For the clone of AtNYE1 promoter with AtNYE2 coding sequence and a GFP tag, the fragment of AtNYE1 promoter has already been subcloned into EcoRI and SacI sites of pCHF3; the fragment of GFP has already been subcloned into BamHI and SalI sites of pCHF3; the fragment of the coding sequence of AtNYE2 was amplified by PCR using two oligonucleotides, 5# ATA GGTACC ATGTGTAGTTTGGCTACA 3# (the underlined sequence is a KpnI site) and 5# ATA GGATCC TCCCTTTGATTTCCCAG 3# (the underlined sequence is a BamHI site). The fragment of AtNYE2 coding sequence was subcloned into KpnI and BamHI

77

78

Figure 1. Phenotype of wild type Arabidopsis and nye1-1 mutant. The nye1-1 mutant exhibited a stable non-yellowing phenotype during both natural (right) and dark-induced (left) senescence of leaves.

Figure 2. Phenotype of overexpression of AtNYE1 and AtNYE2. a. AtNYE1 mutant, nye1-1, b. wild type, col-0, c,d: overexpression of AtNYE2

Figure 3. Leaf color after 7 days of dark treatment. The leaves on the left represent AtNYE2 promoter with AtNYE1 coding sequence when they are transformed into nye1-1, the leaves on the top right corner represent AtNYE1 promoter with AtNYE1 coding sequence when they are transformed into nye1-1. The leaves on the bottom right corner from right to left represent wild type, AtNYE1 mutant and AtNYE2 mutatnt respectively.

Figure 4. Leaf color after 7 days of dark treatment. The leaves on the right represent AtNYE1 promoter with AtNYE2 coding sequence when they are transformed into nye1-1, the leaves on the top left corner represent AtNYE1 promoter with AtNYE1 coding sequence when they are transformed into nye1-1. The leaves on the bottom left corner from right to left represent wild type, AtNYE1 mutant, and AtNYE2 mutant respectively.

sites of pCHF3 and GFP and sequenced with selfdesigned primers. Later the fragment of AtNYE2 coding sequence as well as GFP was subcloned into KpnI and SalI sites of pCHF3 and sequenced.

For the clone of AtNYE2 promoter with AtNYE1 coding sequence as well as GFP tag, the fragment of GFP tag has already been subcloned into BamHI and SalI sites of pCHF3; the fragment of AtNYE2 promoter was amplified from the wild type by PCR using two oligonucleotides, 5# ATA GAATTC TTGTCTCCACGGTGTATC 3#(the underlined sequence is an EcoRI site) and 5# ATA GAGCTCCTTTGCTTGTTCTCAAAAAT3#(the underlined sequence is a SacI site). The fragment of AtNYE1 promoter was subcloned into EcoRI and SacI sites of pCHF3. The fragment of AtNYE1 coding sequence was amplified from the wild type by PCR using two oligonucleotides, 5# ATT GGTACC ATGTGTAGTTTGTCGGCG 3# (the underlined sequence is a KpnI site) and 5# ATT GGATCC GAGTTTCTCCGGATTTG 3# (the underlined sequence is a BamHI site). The fragment of AtNYE1 promoter was subcloned into KpnI and BamHI sites of pCHF3 and GFP tag and sequenced with self-designed primers (data not shown). Later the fragment of AtNYE1 coding sequence as well as GTP tag was subcloned into KpnI and SalI sites of pCHF3 and sequenced with self-designed primers.

method [10]. Putative transgenic plants were initially selected with 50 mg L21 Kanamycin (for pCHF3 derived constructs), and their transgenic status was determined by PCR analysis.

Plant Transformation

The constructs were introduced into the Agrobacterium tumefaciens strain LBA4404.

Plants were transformed via the floral-dipping

Mutant materials

The fast-neutron mutagenized M2 seeds in Col-0 genetic background were purchased from Lehle Seeds (Round Rock). About 50,000 3-weekold M2 plants were incubated in darkness for 6 d to screen mutants with delayed Chlorophyll loss.

The putative screened mutants were subjected to further confirmation for a couple of times during the remaining growth period by visually checking the phenotypes of their detached leaves incubated in permanent darkness for 4 to 6 d. A stable nonyellowing mutant, without obvious pleiotropic effects, was finally identified and designated as nye1-1. It was then backcrossed with the wild-type Col-0 four times, and the resulting homozygous nye1-1 plants were used for further analysis.

Growth Conditions

All the wild-type and mutant Arabidopsis (Arabidopsis thaliana) lines used in this study are in the Col-0 background. Seeds were sown in square pots (10 cm in length) with soil (v [peat soil]:v [vermiculite]:v [pearlite] 5 3:9:0.5; Shanghai Institute of Landscape Science) presoaked with plant nutrient medium including 0.5% Suc [11]. Plants were grown at 24_C, with an approximately 100 mmol m22 s21 light intensity under a 16-h light /8-h dark photoperiod. For dark treatment, leaves 4 to 6, or whole plants without roots, from 3- to 4-week-old

The Oculus: Proceedings of the U21 UndergradUate research conference Arabidopsis plants were excised and incubated on wet filter paper in total darkness at 25_C for various periods, as indicated. For the dark treatment of whole plants in soil, trays were covered with black bags and incubated in growth room for a period of time as indicated.

resulTs

After 7 days of dark treatment, leaves from AtNYE2 promoter with AtNYE1 coding sequence displays a stronger stay-green phenotype than leaves from AtNYE1 promoter with AtNYE1 coding sequence when they are transformed into nye1-1 mutant respectively (Fig. 3).

After 7 days of dark treatment, leaves from AtNYE1 promoter with AtNYE2 coding sequence display a less stronger stay-green phenotype than leaves from AtNYE1 promoter with AtNYE1 coding sequence when they are transformed into nye1-1 mutant respectively (Fig. 4).

dIsCussIon

Knockout line of AtNYE2 didn’t display a staygreen phenotype during leaf senescence. Besides, silencing of AtSGR1 expression in the knockout line atsgr2-1 did not enhance the stay-green phenotype observed in atsgr1i, a RNAi knockout line of AtNYE1[9].

All these previous data suggest that AtNYE2 may not significantly contribute to chlorophyll degradation in Arabidopsis. However, by transforming the promoter of AtNYE1 with the coding sequence of AtNYE2 into nye1-1, we have shown that the activity of AtNYE1 promoter is stronger than AtNYE2 promoter and this transgene plant can largely recover the phenotype of wild type Arabidopsis after dark treatment. The results of this experiment suggest that the AtNYE2 protein can function in the pathway of chlorophyll degradation; however AtNYE2 does not perform as strong as AtNYE1 in the chlorophyll degradation pathway probably due to the weaker activity of its own promoter. This explanation has been further confirmed by other experiments including overexpression of AtNYE2 and the phenotype of AtNYE1/AtNYE2 double mutant.

If the promoter activity is the sole reason for different phenotype between AtNYE1 and AtNYE2 mutant, AtNYE1 promoter with AtNYE2 coding sequence should totally complement the function loss of nye1 in nye1-1 when they are transformed, which is not the case in this experiment. Thus, there may be other factors involved in this process, including translational or post-translational factors.

By transforming AtNYE1 promoter with AtNYE2 coding sequence into nye1-1, we have discovered that the function of AtNYE1 coding sequence is also stronger than AtNYE2 coding sequence. Recent co-immunoprecipitation experiments [45] demonstrated that the protein encoded by OsSGR, an ortholog of AtNYE1, was

able to specifically bind LHCII subunits in vivo. This result suggests that OsSGRs are likely candidates for protein factors involved in LHCII disassembly, and absence of OsSGR during senescence only indirectly causes retention of chl within the stable apoproteins.

Thus, one possible hypothesis for different phenotype between AtNYE1 and AtNYE2 mutants would be both AtNYE1 and AtNYE2 proteins are able to bind LHCII and start the chlorophyll degradation pathway in Arabidopsis, however the concentration of AtNYE2 is too low in Arabidopsis that most binding sites of LHCII are occupied by AtNYE1 protein which has a higher expression level in vivo. Further experiment needs to examine whether NYE2 protein bind LHCII in vivo and to what extent these two proteins bind.

ConClusIon

The activity of AtNYE1 promoter is stronger than AtNYE2 promoter. The AtNYE1 coding sequence performs a stronger role in the chlorophyll degradation pathway than AtNYE2 coding sequence.

AtNYE2 protein can function in the chlorophyll degradation pathway without the presence of AtNYE1 protein although to a less extent and AtNYE2 has potential contribution to chlorophyll degradation in Arabidopsis. Further experiment needs to examine the interaction between AtNYE2 and LHCII as well as AtNYE1 in order to elucidate the relationship between AtNYE1 and AtNYE2 as well as the whole chlorophyll degradation pathway.

referenCes

1. Buchanan-Wollaston V (1997) The molecular biology of leaf senescence. J Exp Bot 48:181–199 2. Wingler A, von Schaewen A, Leegood RC, Lea PJ, Quick WP (1998) Regulation of leaf senescence by cytokinin, sugars, and light. Plant Physiol 116:329–335l 3. M.S. Akhtar, E.E. Goldschmidt, I. John, S. Rodoni, P. Matile, D. Grierson, Altered patterns of senescence and ripening in gf, a stay-green mutant of tomato (Lycopersicon esculentum Mill), J. Exp. Bot. 50:1115–1122.

4. Drury R, Hörtensteiner S, Donnison I, Bird CR, Seymour GB (1999) Chlorophyll catabolism and gene expression in the peel of ripening banana fruit. Physiol Plant 107:32–38 5. Oberhuber M, Berghold J, Breuker K, Ho¨rtensteiner S, Kra¨utler B (2003) Breakdown of chlorophyll: a nonenzymatic reaction accounts for the formation of the colorless ‘‘nonfluorescent’’ chlorophyll catabolites. Proc Natl Acad Sci USA 100:6910–6915 6. Hörtensteiner S (2006) Chlorophyll degradation during senescence. Annu Rev Plant Biol 57:55–77 7. Thomas, H., and Smart, C.M. (1993). Crops that stay green. Ann. Appl. Biol. 123: 193–219.

79

80 8. Ren, G. et al. (2007) Identification of a novel chloroplast protein AtNYE1 regulating chlorophyll degradation during leaf senescence in Arabidopsis. Plant Physiol. 144:1429–1441 9. Aubry S., Mani J., Hörtensteiner S..(2008) Staygreen protein, defective in Mendel’s green cotyledon mutant, acts independent and upstream of pheophorbide a oxygenase in the chlorophyll catabolic pathway. Plant Mol Biol.67:243–256 10. CloughS.J., Bent A.F. (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735–743 11. Estelle MA, Somerville CR (1987) Auxin-resistant mutants of Arabidopsis thaliana with an altered morphology. Mol Gen Genet 206: 200–206 12. Park, S-Y. et al. (2007) The senescence-induced staygreen protein regulates chlorophyll degradation. Plant Cell 19, 1649–1664

aCknowledgMenTs

I want especially thank Prof. BK Kuai and my colleague ShouXin Wu for their guidance through out the experiment. And I would like to thank my parents YuanRong Xin, JingWei Wu as well as my friends XiaoLin Qiu and JianNao Zhao for their support. Thank Fudan’s UROP and XiYuan Chinese Undergraduate Research Endowment for their funding.

The Oculus: Proceedings of the U21 UndergradUate research conference

Resilience of Households: Evidence from Flooding in Bangladesh Tanvir Ahmed Uddin, Alicia Qian University of New South Wales

absTraCT

Climate change is predicted to increase the frequency and intensity of natural disasters. Bangladesh is a particularly vulnerable country due to its geography, topography, poverty and low adaptive capacity.

This paper focused on the ability for household characteristics to mitigate the adverse effects of natural shocks. Using a panel dataset from the International Food Policy Research Institute (IFPRI), the econometric methodology involved analysis of several ordinary least squares (OLS) models. This approach helped identify the effects of the floods and to assess which characteristics determined household welfare outcomes.

Moreover, the returns to the characteristics were distinguished using interaction terms between floodexposed and non-exposed households. The floods had significant adverse effects on household welfare.

This finding was robust when additional household characteristics were controlled. In the fuller interactions models, livestock assets were found to consistently mitigate the effects of floods across all the rounds.

Additionally, female education was a strong determinant of household welfare for both calorie and protein consumption measures. Borrowing loans or purchasing food on credit were temporary measures and their associated benefits were limited to only Round 1. Loans were most significant in reducing the response probability of households being extremely food insecure or food poor. Based on these results several policy implications were identified relating to extending credit on flexible arrangements, encouraging use of female education in labour markets and supporting the accumulation of livestock assets.

The case of severe flooding is studied in InTroduCTIon lobal climate change (GCC) is one of the most this paper because this is the most recurrent and significant challenges facing the world today. widespread type of natural disaster in Bangladesh.

GCC refers to the long-term change in the statistical Whilst long-term climatic change is difficult to distribution of weather patterns over periods of time study, the onset of natural disasters provides useful that range from decades to millions of years (IPCC, insights into such phenomena. In the 1998 floods, 2007).1 It relates to the change in average weather households were affected in two ways. Households conditions such as temperature, precipitation and incurred substantial damage to crops and assets as a wind as well as a change in the distribution of events direct result of floodwaters and were also indirectly such as more or fewer extreme weather events affected by higher prices and lower wages.

(EWE). The worldwide impacts of climate change are Subsequently, households experienced lower calorie increasingly evident through the extensive record of consumption and income and the general nutrition devastating natural records in the past few decades. of adults and children declined greatly (Del Ninno There is now a global consensus that climate change et al., 2001). poses a serious threat to the social and economic wellbeing of people in both developed and developing lITeraTure revIew countries (World Bank, 2010).2 GCC is predicted Climatic Change and Natural Disasters According to the IPCC (2007) there have been to increase the intensity and frequency of natural disasters, which will result in significant economic large shifts in long-term temperatures, rainfall and social ramifications globally. For underdeveloped averages, sea levels as well as the frequency and countries that already face considerable economic intensity of droughts and floods. Changes in climate and social challenges, climate change will further are expected to result in the greater intensity and compound their ability to develop (Mirza, 2003). frequency of EWE and natural disasters (Mirza, Specifically, the most threatened societies are those 2003). Scientific evidence indicates that increased that engage in a mixture of subsistence farming and sea surface temperature will subsequently intensify cyclone activity and heighten storm agricultural production for domestic use. surges (Dasgupta et al., 2010). 3 Subsequently, storm 1 The classical length of time is considered to be 30 years surges can create damaging flood conditions in by the World Meteorological Organisation (WMO).

G

2 Unless specified otherwise, the World Bank classifications are based on the World Bank Atlas Method which groups countries as: low income, $995 or less, lower middle income, $3,945 - $12,195, and high income, $12 196 or more (see World Bank, 2011 and http://data.worldbank.org/about/country-classifications)

3 A sea-temperature of 28ยบC is considered an important threshold for the development of major hurricanes of categories 3, 4 and 5 (Michaels, Knappenberger, and Davis 2005: Knutson and Tuleya, 2004; cited in Dasgupta et al., 2010).

81

82 coastal zones and adjoining low-lying areas. 4 The International Workshop on Tropical Cyclones (IWTC) has noted that the vulnerability to flooding from tropical cyclones would increase if global warming causes a projected rise in sea levels (IWTC, 2006). According to Nicholls (2003), in the past 200 years, 2.6 million people may have drowned during storm surge events. The destruction caused by Tropical cyclone Sidr5 in Bangladesh (November 2007) and cyclone Nargis6 in the Irrawady Delta of Myanmar (May 2008) provide recent examples of devastating storm-surge impacts in developing countries. Additionally, the intensity and frequency of extreme precipitation events are likely to increase resulting in more numerous floods and mudslides (IPCC, 2007). A recent example of this phenomenon was the devastating flooding of Pakistan in 2010.

The 1998 Bangladesh Floods and Impacts

The 1998 floods that swept through Bangladesh in late summer were dubbed the ‘flood of the century’ because of its prolonged duration and the depth of water. At its peak in early September, the flood had covered two-thirds of Bangladesh.

This caused severe damage to the aman monsoon rice crop, which was due to be harvested in November/December. 7 Consequently, the total rice production losses exceeded 2.2 million tons which was equivalent to about 10% of the annual rice consumption in Bangladesh (Del Ninno et al., 2001).

The situation threatened the food security of tens of millions of households. The unusually long duration of the flood forestalled any possibility of re-planting rice seedlings which were destroyed in the standing water. The unusually high floodwaters resulted in substantial crop losses: 69% of aus production, 82% of deep water aman and 91% of transplanted aman (Del Ninno et al., 2001). Due to the losses of 24% of the total value of anticipated agriculture production, the prolonged adverse effects of the flood proceeded long after the floodwaters had receded.

4 Storm surge refers to the temporary increase, at a particular locality, in the height of the sea due to extreme meteorological conditions: low atmospheric pressure and/or strong winds (IPCC AR4, 2007) cited in Dasgupta et al. (2010).

5 According to Bangladesh Disaster Management Information Centre (report dated Nov 26, 2007) 3, 243 people were reported to have died and the livelihoods of 7 million people were affected by Sidr.

6 In Myanmar, 100 000 people were reported to have died and the livelihoods of 1.5 million people were affected by Cyclone Nargis.

7 The three crops of rice that are cultivated in Bangladesh are: aman, typically transplanted during the monsoons in June-July and harvested in NovemberDecember; boro, transplanted in December-January and harvested in May-June; and aus, often directly sown in March-April and harvested in April-August.

Departure from existing literature – the role of household characteristics as mitigating factors

Beyond examining the main ways that a natural disaster affects households, previous studies of the 1998 Bangladesh floods have not specifically considered household characteristics as a potential source for the mitigation of the effects of floods.

Although incomplete, existing literature provides useful points to motivate further research. For instance, Skoufias (2003a) has explained that floods can both directly destroy crops and assets as well as create additional suffering due to the resulting higher prices and lower wages. He also documents examples of how ex-ante preparations to EWEs are more effective over ex-post responses. Additionally, various coping strategies have been explained and evaluated. Khandker (2007) identified that 60% of all households adopted one of several different coping mechanisms including borrowing, skipping meals or selling assets. Although outside his scope, Khandker (2007) did not undertake econometric testing of the ability of characteristics to directly mitigate the effects of flooding.

This paper attempts to extend the existing analysis by considering various household characteristics with respect to flood-mitigation.

In addition to identifying beneficial household characteristics, this paper investigates whether the effectiveness of these characteristics vary depending on the level of flood exposure. The IPCC (2007) has stressed that households can play a major role in adapting to GCC and mitigating some of the adverse effects of GCC and EWE. Various researchers have also identified the mechanisms through which households overcome the advent of a natural shock.

These include accumulation of human capital (Baez and Santos, 2007; Gitter and Barham, 2007 and Portner, 2008; cited in van den Berg, 2010), access to microcredit (Khandker, 2007), livelihood strategies (van den Berg, 2010) or asset-smoothing strategies (Hoddinott, 2006; Zimmerman and Carter, 2003).

The approach adopted in this paper can assist in understanding the concepts of poverty and vulnerability8 by focusing on a household’s human and physical endowments. This grassroots knowledge and evidence is crucial for policy makers to target the most vulnerable households. The research presented here complements the existing research in terms of the intersections between 8 Yet, Khandkher (2007) concedes that knowing who is likely to be poor in the future may be more important in designing appropriate policies to mitigate poverty and vulnerability. Another reason for more emphasis on vulnerability than on poverty is that poverty is a stock variable consisting of both chronic poor and transient poor. Transient poverty may be temporary for a large number of households identified as poor.

Hence, it is vulnerability rather than poverty that may be more relevant for policymaking.

The Oculus: Proceedings of the U21 UndergradUate research conference concepts such as poverty and vulnerability, coping strategies, benefits of microcredit and accumulation of human capital. Consequently, this study will shed light on whether, when faced with EWE, household characteristics assist in mitigating the effects of natural disasters or whether external and macrolevel factors are more important.

MeThodology

This paper investigates empirically the characteristics that assist households to maintain welfare during EWEs. A panel dataset developed by the International Food Policy Research Institute (IFPRI) was utilised. The analysis is developed through a series of ordinary least squares (OLS) regressions of the effects of flood exposure and the determinants of calorie consumption. In the full interaction model (Model 3), the flood exposure was interacted with household characteristics to assess whether the latter mitigate or exacerbate the effects of floods.

Defining household welfare and characteristics

Household characteristics are defined broadly here to include endowments such as human, financial and physical capital assets as well as coping strategies. Specifically, the characteristics that are considered include possession of certain assets such as landholding, consumer assets and livestock, household head’s education and total female education, age, borrowing and food credit purchases.9 In this paper, mitigating ‘the effects of a natural shock’ is defined as either prevention of harm to household welfare (such as via investments in human capital) or the maintenance of household consumption (such as borrowing).

eConoMeTrIC fraMework

The following sections explain the econometric framework that was developed across all of the three rounds. The full set of variables with summary statistics (panel form) is provided in Appendix 1.

Simple Panel Data Model

The OLS regression models in the analysis are based on the following simple panel data model. It is used for each of the three rounds, t 1,2,3: where Yit is the dependent variable observed for household at time Fi is an indicator of flood exposure for household at time only is the estimated coefficient of floods across rounds 9 This takes on a broader definition to the category of household characteristics by the United Nations (see United Nations, 2004).

83

Xit is a vector of explanatory variables (household characteristics) for household at time t ß is a vector of estimated coefficients is a vector of estimated interaction term coefficients is the constant of the equation ! is the error term10 0 The ensuing analysis is examining the following models.

developed

by

Model one: effect of flood exposure on calorie consumption

To identify the effect of flood exposure, the following OLS regression model was estimated:

To identify the most significant channels of flood effects, several variations were attempted by testing FVAR, VFVAR and food prices. It must be noted that whilst doesn’t vary across rounds, will vary according to the marginal effect of the flood for all rounds.

Model Two: Flood effects controlling for household characteristics

It is feasible that Model 1 does not provide a realistic indication of the relationship between flood exposure and calorie consumption. Thus, other possible determinants of calorie consumption cannot be assumed to exist in the error term and remain uncorrelated with the flood exposure variable. Leaving out important variables can cause omitted variable bias. Even correlation between a single explanatory variable and the error term can generally result in all OLS estimators being biased (Wooldridge, 2006). As a result, Model 2 estimates the following:

This model allows one to examine the magnitude and significance of after controlling for a vector of household characteristics.

Model Three: Interactive effects

Model 3 investigates the assumption that some households will be better able to cope than others with a given level of flood exposure based on their characteristics. Also, the effects of the characteristics may depend on the level of flood exposure. For instance, it can be hypothesised that education may be more beneficial for households that were non-exposed than exposed ones. Hence, we wish to investigate not only the marginal effect 10 see Appendix 3 for further discussion of the properties and assumptions of the error term

84 of X (conditional on F) but also how X affects the marginal effect of F on Yit. Thus, the following model can be estimated:

This approach is based on Burgess and Donaldson’s study of the interaction between railroads and rainfall in determining famine intensity (Burgess and Donaldson, 2010).

Marginal effect of household characteristics The marginal effect of characteristic can be given by:

each

household

ß and can be compared to distinguish between the effects of each characteristic depending on flood exposure. For instance, when F=0, the marginal effect of a characteristic i.e. is ß whereas, if F=1, the marginal effect is ß + . Depending on the sign restriction on the parameters, the interpretation will vary. For instance if one assumes the following situation: <0 but >0, and ß>0 and >0. These parameter restrictions imply that the flood has a negative effect, but this is mitigated by the characteristic. Also the characteristic has a positive effect regardless of flood exposure. See Appendix 2 below for explanation and derivation of an elasticitybased interpretation approach for the Model 3 results.

A perverse sign on does not necessarily suggest that the characteristic is not predicted to be useful for households. It simply means that it does not mitigate the effect of the floods in a direct manner. As long as ß+ >0, the effect of the characteristics is still positive. However, when the signs alternate, this shows that the sign and size of the effect of the household characteristics can vary depending on flood exposure. For example if ß>0 and <0 the characteristic has a positive relationship with calories for non-exposed households but a negative relationship for non-exposed households.

This is an interesting result in itself as one can make more specific conclusions about the characteristics rather than grouping exposed and non-exposed households together. This is diagrammatically presented in Figure 1.

resulTs

Whilst more robust and concrete models need to be developed (such as certain panel data and instrumental variable models), this section presents some of preliminary results of the OLS regression models that were tested. Across the models used for study, the results show that the floods had a significant impact on household welfare. In Round

Figure 1. Marginal effects of household characteristics for given level of flood exposure

1, households that were directly exposed to the floods consumed on average 228.50 fewer calories than non-exposed households. Particularly, villagelevel flood effects had more significant negative effects on household welfare than household-level flood exposure. Many determinants of calorie consumption were identified including asset variables, female education, food credit purchases and loans. However, their effects varied across rounds. When interaction terms were introduced, livestock assets were found to directly mitigate the effects of the floods in all rounds. Borrowing loans or purchasing food on credit were temporary measures and their associated benefits were limited to only Round 1. The results for other characteristics showed that even if certain characteristics were beneficial, exposed households experienced less benefit than non-exposed households. Food credit and loans were found to most beneficial in mitigating flood effects for the most severe measures of food insecurity and poverty.

ConClusIon

Large parts of the developing world lie in areas that are substantially at risk of being impacted by natural disasters such as floods, droughts, storm surges and cyclones. Under even modest projections of climate change, more intense and frequent natural disasters are predicted globally. The associated adverse impacts of these extreme weather events are predicted to increase disproportionally more in developing countries (IPCC, 2007). Furthermore, the people living in underdeveloped areas have limited capacity to cope with natural shocks and consequently extreme weather events can have persistent effects on their welfare. This paper undertook a case study of Bangladesh, which is one of the most vulnerable countries to climate change and associated natural disasters. Bangladesh’s geography, topography and poverty make it particularly prone to regular flooding and cyclone-induced storm-surges. With very little overall contribution to greenhouse gas emissions, Bangladesh’s only protective response is through adaptation.

The Oculus: Proceedings of the U21 UndergradUate research conference Specifically, the 1998 floods was studied because it was one of the most severe natural disasters in Bangladeshâ&#x20AC;&#x2122;s history. The 1998 floods also had significant effects on income, consumption, nutrition, employment, and wages. Households employed various coping strategies to maintain wellbeing. These included borrowing, skipping meals and selling assets (Khandker, 2007). The research in this paper proceeded on the premise that a better understanding of household characteristics (which encompasses endowments and coping responses) can assist policymakers and researchers to develop suitable adaptation strategies to help the people of Bangladesh adapt to a changing climate.

The principle empirical framework focused on household welfare as measured by household calorie consumption. Welfare was hypothesised to be determined by household characteristics, i.e. their physical, human and financial capital. The results indicated that the floods had significant effects on household welfare. When household and village-level flood effects were compared, only the village-level effects had a significant and strong adverse effect on household welfare. Overall, the household calorie intake was positively influenced by a number of factors including livestock assets, female education, food credit purchases and loans.

Policy implications

It is anticipated that a study of the mitigating effects of these characteristics can inform policy directions amongst governments, donor agencies and NGOs. These organisations can tailor their adaptation strategies according to the beneficial characteristics that households possess. Better targeting can also be achieved by directing postflood emergency programs according to an understanding of how households recover - which could depend on both the level of exposure and household characteristics.

85

Appendix 1. Definitions and summary statistics of the variables (panel form)

aPPendIx

86

13 This was calculated by first dividing the total value of purchases of the particular food group by total quantity and its mean was obtained for all purchases of items within the food group for each household. Thereafter, a village â&#x20AC;&#x201C;level mean was obtained from all households in each village.

11 Outliers for the following variables were removed: AECAL (> 10 000 or <800), RICEPRICE (> 60 or < 3) and ATTAPRICE (> 100 or < 5). Outliers were adjusted because they can adversely influence the OLS estimates (Wooldridge, 2006).

The Oculus: Proceedings of the U21 UndergradUate research conference

87

88

Figure 2. Variance in marginal effects of household characteristics for varying flood exposure

Figure 3. Line curve of coefficient of interactive terms

Appendix 2: Deriving an Elasticity Measure of Interactive Effects

Calculating Units-free Elasticity Measures

Alternatively, an elasticity-based interpretation can be developed using it, ßit and it with two values of any household characteristics (X1 and X2). For instance, one may like to note the percentage change in the effect of the flood on ln(cit) when education is 5 years (completion of primary school) compared to 10 years (completion of Matriculation level).

The following diagram illustrates the difference in marginal effects of the flood for two arbitrary values of the X characteristic. This diagram compares the outcomes between exposed and non-exposed households. Here, the most ideal situation is assumed: where < 0 but 0 + > 0, ß > 0 and > 0.

Based on the diagram above, for the elasticity, predicted percentage change in calorie consumption based on the can be calculated as follows:

However, for ease of comparison, a units-free elasticity measure can be developed. First, it can be noted that Eq. 11 can be draw as a line curve (assuming that > 0).

The equation of the line simply reveals that X influences the marginal effects of the flood. The y-intercept, , is the constant term of the marginal function. Also, the slope of this curve is the coefficient estimate, changes in X. It is hypothesised that if < 0 and > 0, then as X increases, the (adverse) effect of the flood would have minimised.

However, from the figure above, the change in the marginal effects of the flood – between any two values of X – will result in different measures of responsiveness. To simplify interpretation, the elasticity at the mean X can be used. It is also possible to calculate the elasticity at corresponding quintile levels to distinguish the effects based on household expenditure.

Starting with Eq. 11, M(X)= + , the mean value of the X, the point elasticity measure of the responsiveness of the marginal effect of the characteristic is:

This units-free measure enumerates the effect of a 1% change in X (at the mean) on the percentage change in the effect of the floods on ln(cit). The following diagram shows this elasticity graphically when comparing two different values of X.

Functional Forms And Types Of X-Characteristics

When calculating the elasticities and for interpretation of the various characteristics, alternative approaches need to be undertaken depending on the functional form of the characteristic. The following describes how different functional forms may be analysed: discrete variables – directly apply the formula above logarithmic variables – the coefficient estimates already reveal an elasticity measure but a similar calculation can still be made. dummy variables – calculate the difference in outcomes between the two groups Therefore, once the elasticity measures are calculated, the responsiveness may be compared between characteristics and at different values.

referenCes

1. Anand, S. and Harris, C. J., (1994), Choosing a Welfare Indicator, The American Economic Review, Vol. 84, No. 2, pp.226-231.

2. Asian Development Bank, (2007). Climate Change: Strengthening Mitigation and Adaptation in Asia and the Pacific. Accessed 07/03/2010 from: http://www.adb.org/Documents/ Brochures/Climate-Change/default.asp.

The Oculus: Proceedings of the U21 UndergradUate research conference 3. Agrawala, S., Ota, T., Ahmed, A. U., Smith, J., Aalst, M. V., (2003). Development and Climate Change in Bangladesh: Focus on Coastal Flooding and the Sundarbans, Organisation for Economic Cooperation and Development (OCED), Paris.

4. Aziz, F., (1995). “Nutrition, Health and Labour Productivity Analysis of Male and Female Workers: A Test of the Efficiency Wage Hypothesis”. Bulletin No. 95-5, Economic Development Centre, University of Minnesota.

5. Banerjee, L., (2007). “Effect of Flood on Agricultural Wages in Bangladesh: An Empirical Analysis”, World Development, Vol. 35, No. 11, pp.

1989-2009.

6. Bangladesh Bureau of Statistics, (1998). Household expenditure survey 1995–96. Dhaka: Bangladesh Bureau of Statistics, Statistics Division, Ministry of Planning.

7. Barro, J., (2007). Macroeconomics: A Modern Approach. South Western Education Publishing, USA. 8. Blankespoor, B., Dasgupta, S., Laplante, B. and Wheeler, D., (2010). “Adaptation to Climate Extremes in Developing Countries: The Role of Education”, World Bank Policy Research Working Paper Series 5342.

9. Bodwell, C.E., (1979). “Evaluation of plant proteins to solve nutritional problems of the third world”. Plant Foods for Human Nutrition, Vol. 29, pp. 135–162.

10. Boswoth, B. And Collins, S. M., (2008).

“Accounting for Growth: Comparing China and India,” Journal of Economic Perspectives, Vol. 22, No. 1, pp. 45-66.

11. Burgess, R. and Donaldson, D., (2010). “Can Openness Mitigate the Effects of Weather Shocks? Evidence from India’s Famine Era”, American Economic Review: Papers and Proceedings 100, pp. 449-453.

12. Byravan, S., and Rajan, S. C., (2008). The Social Impacts of Climate Change in South Asia. Available at SSRN: http://ssrn.com/ abstract=1129346 13. Cannon, T., Vulnerability Analysis and the Explanation of ‘Natural Disasters’, in Varley, A., ed., (1994). Disasters, Development and Environments, J. Wiley, New York.

14. Chetty, R. and Looney, A., (2005). “Consumption Smoothing and the Welfare Consequences of Social Insurance in Developing Economies”, NBER Working Paper, No. 11709.

15. Dasgupta, S., Huq, M., Khan, Z., Ahmed, M. M. Z., Mukherjee, N. Khan, M. and Pandey, K., (2010). Vulnerability of Bangladesh to Cyclones in a Changing Climate: Potential Damages and Adaptation Cost. World Bank Policy Research Working Paper Series 5280.

16. Davidson, R. and J. G. MacKinnon, (1993).

Estimation and Inference in Econometrics. New York: Oxford University Press.

17. Del Ninno, C., Roy, D. K., and Mukherjee, S., (2001). Impact of the 1998 flood on household food security, FMRSDP Synthesis Report No. 6.

IFPRI, Dhaka.

18. Del Ninno, C. and Dorosh, P., (2001). “Averting a food crisis: private imports and public targeted distribution in Bangladesh after the 1998 flood”, Agricultural Economics, Vol. 25, pp. 337-346.

19. Del Ninno, C., Dorosh, P. A. and Smith, L., (2003).

“Public policy, markets and household coping strategies in Bangladesh: Avoiding a Food Security Crisis following the 1998 floods”, World Development, Vo. 31, No. 7, pp. 1221-1238.

20. Demeke, A. B. Keil, A. And Zeller. M., (2010).

“Using Panel Data to Estimate the Effect of Rainfall Shocks on Smallholders’ Food Security and Vulnerability in Rural Ethiopia”, Climatic Change (5 January 2011), pp. 1-22.

21. Fafchamps, M. and Gavian, S., (1997), “The determinants of livestock prices in Niger”, Journal of African Economies, Vol. 6, pp. 255-95.

22. Fankhauser, S., Smith, J. B. and Tol, R. S. J., (1999).

Weathering climate change: some simple rules to guide adaptation decisions, Ecological Economics, Vol. 30, 67-78.

23. Ghatak, A., (2010). Health, Labour Supply and Wages: A Critical Review of Literature, The Institute for Social and Economic Change Working Paper 244, Bangalore.

24. Glewwe, P., (1991).

“Investigating the determinants of household welfare in Côte d’Ivoire”, Journal of Development Economics, Vol. 35, No. 2, pp. 307-337.

25. Greene, W. H., (2003), Econometric Analysis, 5th ed., Pearson Education, New Jersey.

26. Gunter, B. G., Rahman, A. and Rahman, A., (2008).

How Vulnerable are Bangladesh’s Indigenous People to Climate Change?. Bangladesh Development Research Center (BDRC). Available at SSRN: http://ssrn.com/abstract=1126441.

27. Halegatte, S. and Dumas P., (2009). “Can Natural Disasters have Positive Consequences?

Investigating the Role of Embodied Technical Change”, Ecological Economics, Vol. 68, No. 2, pp.

777-786.

28. Hallegatte, S., Hourcade, J.-C. and Dumas, P., (2007). Why Economic Dynamics Matter in Assessing Climate Change Damages: Illustration on Extreme Events, Ecological Economics, Vol. 62, No. 2, pp. 330-340.

29. Halpern-Felsher, B. L., Millstein, S. G., Ellen, J. M., Adler, N. E., Tschann, J. M. and Biehl, M., (2001). “The Role of Behavioral Experience in Judging Risks”, Health Psychology, Vol 20. No. 2, pp. 120-126.

89

90 30. Hassan, R. and Nhemachena, C., (2008).

“Determinants of African farmers’ strategies for adapting to climate change: multinomial choice analysis”, African Journal of Agricultural and Resource Economics, Vol. 2, No. 1, pp. 83- 104.

31. Hermann, J. R., “Protein and the Body”. Oklahoma Cooperative Extension Service, Division of Oklahoma State University: T–3163–1 – T–3163–4.

32. Hoddinott, J., (2006). “Shocks and their Consequences Across and Within Households in Rural Zimbabwe”, Journal of Development Studies, Vol. 42, No. 2, pp. 301-321.

33. IPCC, (2007a). Climate Change 2007: The Physical Science Basis, Contribution of Working Group I to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change, ed.

Solomon, S., Qin, D., Manning, M., Marquis, M., Averyt, K. Tignor, M., Miller, H. L. Jr. And Chen, Z. Cambridge, UK and New York, NY USA: Cambridge University Press.

34. IPCC, (2007b). Climate Change 2007: Impacts, Adaptation and Vulnerability, Contribution of Working Group II to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change, ed. Parry, M., Canziani, O., Palutikof, J., van der Linden, P. And Hanson, C. Cambridge, UK and New York, NY USA: Cambridge University Press.

35. IPCC, (2007c). Climate Change 2007: Mitigation of Climate Change, Contribution of Working Group III to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change, ed.

Metz, B., Davidson, O., Bosch, P., Dave, R. and Meyer, L.. Cambridge, UK and New York, NY USA: Cambridge University Press.

36. Kabeer, N., (1991)., “Gender dimensions of rural poverty: Analysis from Bangladesh”, Journal of Peasant Studies, Vol. 18, No. 2, pp. 241-262.

37. Kane, S. and Shogren, J. F., (2000). “Linking Adaptation and Mitigation in Climate Change Policy”, Climatic Change, Vol. 45, p. 75-102.

38. Kelly, P. M. and Adger, W. N., (2000). “Theory and Practice in Assessing Vulnerability to Climate Change and Facilitating Adaptation”, Climatic Change, Vol. 47, pp. 325-252.

39. Kézdi, G., (2001). Robust Standard Error Estimation in Fixed-Effects Panel Models, mimeo, University of Michigan Department of Economics.

40. Khandker, S. R., (2007). “Coping with flood: role of institutions in Bangladesh”, Agricultural Economics, Vol. 36, pp. 169-180.

41. Khandker, S. R., Pitt, M. M. and Fuwa, N., (2003).

“Subsidy to Promote Girls’ Secondary Education: The Female Stipend Program in Bangladesh,” mimeo. Accessed from http://mpra.ub.unimuenchen.de/23688/

42. Lilleor, H.B., Giné, X., Townsend, R. and Vickery J., (2005). “Weather Insurance in Semi-Arid India,” Working Paper.

43. Kiene, W., (2004). “Containing the psychology of famine: The international community’s response to the Bangladesh flood of 1998” in Dorosh, P. A., Del Ninno, C. and Shahabuddin, Q. (eds.), The 1998 Floods and Beyond: Towards Comprehensive Food Security in Bangladesh.

44. McMahon, W., (2000). Education and Development: Measuring the Social Benefits. New York: Oxford University Press.

45. Mertz, O., Mbow, C., Reenberg, A. and Dioug, A., (2009). “Farmers’ Perceptions of Climate Change and Agricultural Adaptation Strategies in Rural Sahel, Environmental Management, Vol. 43, pp. 804816.

46. Miguel, E., (2005). “Poverty and Witch Killing”, Review of Economic Studies, Vol. 72, No. 253, p.

1153-1172.

47. Mirza, M., (2003). “Climate Change and Extreme Weather Events: Can Developing Countries Adapt?”, Climate Policy, Vol. 3, No. 3, pp. 233-248.

48. Mueller, Valerie & Quisumbing, Agnes, (2010).

“Short- and long-term effects of the 1998 Bangladesh flood on rural wages,” IFPRI discussion papers 956, International Food Policy Research Institute (IFPRI).

49. Noy, I., (2009). “The macroeconomic consequences of disasters”, Journal of Development Economics, Vol. 88, No. 2, pp. 221-231.

50. Psacharopoulos, G. and Patrinos, H., (2004).

“Returns to investment in education: a global update”, Education Economics, Vol. 12, No. 2, pp.

111–134.

51. Qian, A. and Uddin, T., (2011). “Climate Change and Food Security: Building Resilience by Means of Climate Field Schools”, in Buckley, R. (ed.), Debt-for-Development Exchanges – History and New Applications, Cambridge University Press, New York, pp.236-247.

52. Qureshi, S., (2007). Creating an Index to Measure Food Security: Identifying the Components and Determinants and Testing Usefulness, Heller School for Social Policy and Management, Brandeis University.

53. Ravaillon, M., (2003). Targeted Transfers in Poor Countries: Revisiting the Tradeoffs and Policy Options”, World Bank Policy Research Working Paper No. 3048.

54. Rosenzweig, M. R. and Wolpin, K. I., (1993).

“Credit Market Constraints, Consumption Smoothing and the Accumulation of Durable Production Assets in Low-Income Countries: Investments in Bullocks in India”, Journal of Political Economy, Vol. 101, No. 2, pp. 223-255.

The Oculus: Proceedings of the U21 UndergradUate research conference 55. Skoufias, E., (2003a). “Economic Crisis and Natural Disasters: Coping Strategies and Policy Implications”, World Development, Vol. 31, No. 7, pp. 1087-1102.

56. Skoufias, E., (2003b), “Is the Calorie-Income Elasticity Sensitive to Price Changes? Evidence from Indonesia”, World Development, Vol. 31, No. 7, pp. 1291-1307.

57. Schultz, P., (1988). “Education investments and returns”, in Chenery, H. And Srinivasan, T. N. (Eds), Handbook of Development Economics, 1st edn., pp. 543-630, Elsevier, Oxford.

58. Townsend, R., (1994). “Risk and Insurance in Village India”, Econometrica, Vol. 62, No. 3, p. 539591.

59. UNDP, (2004), A Global Report: Reducing Disaster Risk: A Challenge for Development. https://www.undp.org/bcpr 60. United Nations, (2004). Demographic Yearbook Review, Department of Economic and Social Affairs, Statistics Division, Demographic and Social Statistics Branch, ESA/STAT/2004/6.

61. Van den Berg, M., (2010). “Household income strategies and natural disasters: Dynamic livelihoods in rural Nicaragua”, Ecological Economics, Vol. 69, pp. 592-602.

62. Wijkman, A. and Timberlake, L., (1984). Natural Disasters: Acts of God or Acts of Man?, Earthscan, London.

63. Wooldridge, J., (2003). “Cluster-Sample Methods in Applied Econometrics”, The American Economic Review, Vol. 93, No. 2, pp. 133-138.

64. Wooldridge, J., (2006). Introductory Econometrics - A Modern Approach, 3rd ed., Thomson SouthWestern, USA. 65. World Bank., (2000). World Development Report 2000.Washington, D.C. 66. – , (2010), World Development Report 2010, Washington, D. C. 67. – , (2011), World Development Report 2010, Washington, D. C. 68. Yamauchi, F., Yohannes Y., and Quisumbing, A., (2009). Natural Disasters, Self-Insurance and Human Capital Investment – Evidence from Bangladesh, Ethiopia, and Malawi, World Bank Policy Research Working Paper 4910.

69. Zeller, M. and Sharma, M., (2000). “Many Borrow, more Save and all Insure: Implications for Food and Micro-finance Policy”, Food Policy, Vol. 25, pp.

143-167.

70. Zimmerman, F. J. and Carter, M. R., (2003).

“Asset smoothing, consumption smoothing and the reproduction of inequality under risk and subsistence constraints”, Journal of Development Economics, Vol. 71, pp. 233-260.

aCknowledgMenTs

Foremost, I would like to thank my everpatient and extremely supportive supervisor, Dr. Chris Bidner. Other UNSW economics staff that assisted me, despite their busy schedules, include Dr. Denise Doiron, Dr. Isabella Dobrescu and Dr. Alberto Motta. Additionally, I would like to acknowledge Carlo Del Ninno, Agnes Quisumbing and Wahid Quabili for assisting me with collecting the data and making sense of its structure. I want to also express my appreciation for the International Food Policy Research Institute who did a tremendous job in collating such a crucial dataset and for making it publicly available.

91

92

Budget Support & Coordination Problems of Foreign Aid Overlaps and Aid Predictability Louise Lorentzon Lund University

absTraCT

Coordination failure is stressed as one of the most critical causes to ineffective foreign aid. Budget support is argued to improve and facilitate coordination of foreign aid, why it is an increasingly used disbursement channel. However, there is little empirical studies of budget support and aid effectiveness. The purpose of this study is to investigate if the use of budget support correlates with some characteristics and possible causes to coordination failures in foreign aid. This study brings us closer to determine if budget support improve coordination. The paper examines three hypothesis of how budget support correlates with three different coordination problems. These are: overlaps, aid volatility and predictability. To test the hypothesis, I depict cross-country data from the OECD Creditor Reporting System (online database) and the World Bank (online data, indicators), in scatter plots. The results do not any show strong correlations between budget support and coordination failures. This may indicate that budget support does not reduce these coordination failures, in contrast to what has been argued. First, I find no correlation between overlaps and budget support. Further, there is no indication that aid volatility and predictability correlates with budget support.

InTroduCTIon

O

ne potential factor in poverty alleviation, and a part where the surrounding world can make a difference is to make foreign aid more efficient.

Coordination of aid is internationally recognized as an important element of aid effectiveness.

Fragmentation is a major impediment of coordination. Donor proliferation has increased continuously since 1975 and todays foreign aid is fragmented to hundreds of NGO:s, bilateral and multilateral donors in single recipient countries (Archarya, de Lima, Moore 2004). This fragmentation and the huge number of uncoordinated projects creates imperfect information which makes allocation of aid and domestic resources (recipient) highly suboptimal. An increasingly used method to reduce fragmentation is to shift from the traditional disbursement channel, project aid, to budget support.

Budget support is widely seen to reduce fragmentation, improve coordination and to be align with much of the new international policies of aid effectiveness (see for example Antunes, Carrin and Evans 2008, Vidal and Pillay 2004). However, there is lacking empirical evidence of this, and so far the new policies are based on theories, not empirics.

My question is if budget support improves coordination of foreign aid. I study how the use of budget support correlates with three characteristics and causes of coordination failures: overlap, aid volatility and predictability. I formulate three hypothesis which are empirically tested in crosscountry studies with data from the OECD Creditor Reporting System and the World Bank.

This study contributes to the literature of aid effectiveness by disaggregating aid modalities. It contributes to a policy discussion based on empirical

facts and gets us closer to determine if budget support can be a partial solution to the problem of inefficient aid.

Results

Budget support is not found to correlate with coordination failures. The first result shows no correlation between budget support and overlaps between donor and recipient. The second and third results indicate that budget support does not decrease aid volatility or predictability.

aId dIsburseMenT Channels Project Aid & Budget Support

Aid is heterogeneous and aggregated aid figures neglect these differences, why it is important to study aid modalities separately. Here follows a short presentation of the most common disbursement methods and their pros and cons in terms of aid effectiveness.

Project Aid

Project aid has been the most common disbursement channel since the 1950â&#x20AC;&#x2DC;s and is so still today (Jelovac and Vandeninden 2008, HalonenAkatwijuka 2007). Project aid is aid used for a specific purpose and focuses on solving explicit problems in a determined, relatively short time period. Project aid has the advantage of focusing and delivering expected outputs with high accountability (Antunes, Carrin, Evans 2008). On the other hand, project aid suffers from the risk of poor fit into development strategies and programs. It is also criticized for not building institutional capacities, rather tending to undermine governmental systems by creating parallel systems to domestic institutions (Jelovac, Vandeninden 2008).

The Oculus: Proceedings of the U21 UndergradUate research conference Project aid is mostly implemented and controlled by donors, why it is not likely to sustain without donors’ support (Jelovac and Vandeninden 2008). Donor driven project aid is also at risk of responding to donors’ preferences rather than to national priorities (Antunes, Carrin, Evans 2008).

Since project aid is fragmented, and too many donors in one sector creates transaction costs it can also decrease aid efficiency (Front and Santiso 2010).

Budget Support

There has been a growing focus on budget support since the 1990s, especially for the lowestincome countries (Pillay 2004, Barkan 2009). Budget support is almost the opposite of project aid. It is a financial contribution to the recipient’s state budget and is implemented through domestic institutions (Cordella and Dell’ Ariccia 2003). The purpose of budget support is more general than project aid as it is not linked to specific projects. Budget support has a longer time horizon than project aid and focuses on dialogue and partnership between donor and recipient (Antunes, Carrin, Evans 2008).

Budget support is often associated with conditionality (Ouattara 2005) of which there are two types: fiduciary conditionality is the most common and involves transparency, accountability and good governance. A more controversial type is political conditionality, which deals with sector policies, macro-economic and fiscal policies. However, such aid is limited by the donors’ ability to it.

TheoreTICal fraMework

Coordination Problems, Aid Policies & The Halonen-Akatwijuka Model

This theoretical framework brings up central aspects relevant to problems of coordination of foreign aid and constitutes the ground for my empirical studies.

Coordination Problems & Aid Policies Coordination Problems

Coordination of aid exists in mainly two different directions: donor-coordination and donorrecipient coordination. An important determinant of aid effectiveness is the stability of aid flows (Lensink and Morrissey 2000). Aid volatility is argued and empirically shown to have a negative impact on growth, consumption and welfare (Arellano, Bulír, Lane, and Lipschits 2008, Lensink and Morrisey 2000, Torsvik 2005). A source of aid volatility is conditionality (Bulír and Hamann 2008).

Bulír and Hamann (2008) find little evidence that deviation between aid disbursement and commitment has improved recently, even though it is a part of international agreements of aid effectiveness. Further, aid fluctuates more than domestic fiscal revenues, thus contributing to increased unpredictability and volatility.

Aid Policies & Budget Support

The Paris Declaration is an international attempt to increase aid effectiveness and summarizes the debate and new aid practices.

Budget support is argued to be consistent with The Paris Declaration since it is likely to result in more recipient ownership, alignment and harmonization than project aid (Antunes, Carrin, Evans 2008).

Likewise, Vidal and Pillay (2004) argue that the main objectives when channelling funds through the recipient government’s budget are to improve coordination and aid predictability, to increase national ownership, reduce transaction cost and to make disbursement more flexible.

Since budget support uses the local government system, it can improve and strengthen its institutions, which is another motive for the use of budget support. Good institutions and macro economic conditions are found to be an important factor for economic growth. On the other hand, the outcome of budget support is more sensitive to the existing policy environment than project aid, since it is highly dependent on national institutions.

An increased use of budget support also changes ways to evaluate aid. Project aid is easier to evaluate and have shorter time periods. Budget support needs a broader evaluation system based on national, sector or program level (Vidal and Pillay 2004). The Paris Declaration’s focus on measurable results is a difficult part for budget support.

The Halonen-Akatwijuka Model

The paper by Halonen-Akatwijuka is a background paper for the World Development Report 2004: ”Making Services Work for Poor People”, by the World Bank. Halonen-Akatwijuka analyses allocation of foreign aid between two sectors within a recipient country. The model is set up as a game theory model and deals with coordination failure first between two donors, and second between donor and recipient. Donor fragmentation causes high transaction costs which leads to imperfect information of future budgets which affects the overall resource allocation. Donors and recipient will then make allocation decisions with incomplete information and therefore, in most cases, both parties regret their allocation ex post.

Halonen-Akatwijuka lists three causes to coordination failure: complementary projects, incomplete information, and simultaneous decisions. Discrete investments (project aid) will aggravate the problem. Since budget support causes less fragmentation, it does, in this theoretical framework, cause less incomplete information which, in turn, leads to less coordination failure.

93

94 hyPoThesIs

The following hypothesis concern coordination failures that are central in models and literature in this topic, presented in the previous section of theoretical framework.

Hypothesis A: Overlap

Donors which disburse a high share of aid through budget support have less bilateral overlaps with recipient countries.

According to the Halonen-Akatwijuka model, fragmentation causes incomplete information which causes suboptimal resource allocation within the recipient country. In the case where both donor and recipient government allocate too much resources to one sector, the risk of overlaps increases. Furthermore, Halonen-Akatwijuka states complementary projects as a reason to coordination failure, likewise complementary projects increase the risk of overlaps.

Since budget support is likely to decrease fragmentation, reduce the number of complementary projects and make aid coordination and alignment easier, I expect overlaps between donors and recipient to decrease with budget support (negative correlation between overlaps and budget support).

Hypothesis B: Aid Volatility

An in-stable disbursement of foreign aid is negatively correlated with budget support.

Since budget support causes less fragmentation than project aid, it is likely to diminish the problem of incomplete information. Furthermore, incomplete information detriments the decision-making process about allocation, causing donors to regret their spending ex post and reallocate resources to the next period. Regretting and reallocating aid, cause fluctuations in aid spending. That is why budget support is likely to negatively correlate with instable disbursement of aid, in contrast to the highly fragmented project aid.

The reasoning above is also the foundation for hypothesis C.

Hypothesis C: Aid Predictability

There are less difference between committed and disbursed aid with a large share of budget support, than with a low share.

Assuming that budget support causes less incomplete information than project aid, donorsâ&#x20AC;&#x2122; predictions and the actual resource allocation would be more aligned with extensive use of budget support. Then donors do not regret their spending commitments, and have less reason not to fulfill their commitments. That is why the disparity between commitments and disbursement is likely to be less distinctive with budget support.

eMPIrICs & analysIs Data & Method

The 154 recipient countries with available data in the CRS and the WB data base, are used in the following empirical tests. These countries are: least developed countries, low income countries, lower middle income countries and upper middle income countries.1 The early data of CRS is underreported and sporadic why I am using a recent time period, i.e.

2002-2009. Since aid allocation fluctuates year to year, I use averages of total disbursed ODA and disbursed general budget support (constant 2008 USD).2 However, some data is missing. If underreporting is not random, but rather, more common to certain recipient countries, to certain amounts of aid etcetera, there are biases.

To test the hypothesis, the data is put into scatter-plot graphs where linear trend lines are depicted, and the coefficients of determination R2 are obtained to evaluate the correlations.3 This method makes it possible to see correlations between two variables, however, it makes it unfeasible to dismiss confound variables. Further, it does not say anything about causalities and one cannot, in all cases be sure of the direction of the correlation. However, in combination with theories, one may be able to make plausible statements.

An alternative method with advantage in the aspects of confound variables and causality, is to construct a regression model. However, to be able to construct a relevant regression model one needs information about simple correlations and causes.

Results

Here follows the results and interpretations from tests of each hypothesis.

Hypothesis A

Aldrasoro, Nunnenkamp and Thiele (2009) present a table with the major donorsâ&#x20AC;&#x2122; overlap with the recipientâ&#x20AC;&#x2122;s own development projects. The data is indexed, where 0 reflects no overlap, and 1 reflect complete overlap. The data of overlaps are classified in terms of donors and constitutes the Y-axis in graph A1, A2 and A3. Flows of budget support from donors are divided by total disbursed ODA and is shown on the X-axis. The table by Aldrasoro, Nunnenkamp and Thiele (2009) is classified into three time periods: 1995-1998, 1999-2002 and 20032006. I create one graph for each time period.

The first time period (1995-1998) shows a negative correlation between overlaps and budget 1 2

3

Listed in table 1 in the appendix.

Aid refers to ODA in all the empirical tests, and budget support refers to general budget support (CRS, Sector 510: VI.1. General Budget Support).

All relevant equations used for the empirical tests are depicted in table 4 in the appendix.

The Oculus: Proceedings of the U21 UndergradUate research conference

Figure 1. Graph A1. Overlaps and Budget Support 1995-1998

Figure 2. Graph A2. Overlaps and Budget Support 1999-2002

Figure 3. Graph A3. Overlaps and Budget Support 2003-2006

95

96 support. The second time period (1999-2002) also shows a downwards sloping correlation but with a very low R2 value (0,0386). The third graph (20032006) shows a positive correlation with a low R2 value (0,1108). Overall, these graphs do not indicate a correlation between overlaps and budget support, thus the hypothesis cannot be empirically confirmed.

Hypothesis B

This correlation is based on countries that have the 30 per cent highest shares of budget support since budget support is still rather uncommon. Aid disbursement vary over time, why the variation in aid disbursement (2002-2009) is estimated with the residual diffusion from linear trend lines of actual disbursement of aid (2002-2009).4 High residual diffusion then correspond to in-stable disbursement.

The residual diffusion is shown on the Y-axis.

In cases where data is not available, the residual diffusion is calculated from the years with available data, this may cause some biases. The X-axis reflects the share of budget support in relation to total disbursed ODA. Humanitarian aid is subtracted from the data (for both Y- and X-axis) so that variation in aid in response to natural disasters and conflicts do not affect the fluctuation of aid disbursement.

The graph shows a weak negative linear correlation. A reason that the correlation is not stronger, can be that budget support often is at least fiduciary conditional.

That is when budget support is delayed or withdrawn when fiscal policies, transparency and accountability are not fulfilled by the recipient (Antunes, Carrin, Evans 2008). I do not accept hypothesis B.

Hypothesis C

This section constitutes of two parts, the first part shows a graph with aggregated sectors. In the second part, data is divided into four categories: social, economic, humanitarian and multi-sector.

The data used in these calculations is for 2002-2009, for 154 countries.

Aggregated Sectors

The Y-axis in graph C1 shows disbursed ODA divided by committed ODA. As in B1, humanitarian aid has been subtracted from both disbursed and committed aid. A number above 1 at the Y-axis means that more aid is disbursed than what was committed.

Numbers below 1 account for lower disbursement than commitment. Budget support as a share of total disbursed ODA is shown on the X-axis.

The graph shows a very weak negative linear correlation. This indicates that the use of budget support does not affect the deviation between disbursed and committed aid.

4

The linear trend lines are depicted in table 3 in the appendix.

Disaggregated Sectors

Since both the amount, disbursement method and characteristics like fragmentation vary greatly among sectors, the aggregated data above is split up into four broad sectors (see appendix).

The humanitarian sector has the highest disbursement to commitment average, followed by the social sector, the multi-sector and lastly, the economic sector. It is surprising that the social sector, which is the most fragmented, has a relatively high disbursement ratio compared to the least fragmented: the economic sector. This result questions the assumption that fragmentation causes coordination failures and decreases predictability and effectiveness of aid. An explanation might be that donors that are not pleased with recipientâ&#x20AC;&#x2122;s fulfillments of conditions, prefer to withdraw or delay funding from the economic sector to foster good policies, rather than the social sector which would reduce peoplesâ&#x20AC;&#x2122; access to social services.

Analysis

Here follows a discussion of my findings and the problems of overlaps, aid volatility and predictability.

Overlaps

The result of no correlation between budget support and overlaps, may depend on biases in the type of countries that receive budget support.

However, at first glance it is a surprising result.

Overlaps between donor and recipient is a problem of coordination, planning and allocation. If budget support is delivered according with The Paris Declarations, it is channeled through local institutions.

That, per se, reduces overlaps between donor and recipient. However, it may be that donors who give extensive budget support also are the most altruistic donors. The rationale is that budget support makes it difficult to get visibility for specific accomplishments.

If so, donors that give the most budget support are more likely to give aid to the poorest countries. The poorest recipients are also the ones receiving greatest amounts of aid, most fragmented, and thereby have more overlaps to begin with. A plausible correlation between budget support and overlaps may not be evident even if budget support does reduce overlaps.

Aid Volatility & Predictability

Predictability of aid depends on both the fluctuations of disbursed aid and of the difference between commitment and disbursement. Since my findings do not support the hypothesis that these aspects are improved with use of budget support, I conclude that budget support in general does not improve aid volatility or predictability. It is still possible that budget support is a part of the solution to volatile and unpredictable aid, however, not by it self and not with conditionality.

The Oculus: Proceedings of the U21 UndergradUate research conference ConClusIon

This paper contributes to the empirical research in the area of aid effectiveness. It investigates the wide-spread assumption that budget support reduces coordination failures in foreign aid, on which much of todays international aid practices are based on. The study can also be used regarding to debt cancellation since financial means are transfered through national public systems (Cordella and Dell’ Ariccia 2003).

Overall, my findings show that the use of budget support 2002-2009 has not been a solution to address characteristics and reasons to coordination failures. The results are not in line with the theoretical framework and do not support the assumption that budget support reduce coordination failures. According to Halonen-Akatwijuka, discrete investments (project aid) aggravate the problem of coordination failure. I have not found that the least discrete investments (budget support) diminish coordination failures.

A policy implication appearing from of this study is that budget support, like so many other policies, is no panacea. Budget support cannot by it self, apart from a context of overall effective and coherent policies, solve the coordination problem of foreign aid.

referenCes

1. Aldasoro Inaki, Nunnenkamp Peter and Thiele Rainer (2010), Less Aid Proliferation and More Donor Coordination? The Wide gap between Word and Deeds. Journal of International Development 22(7), 920-940 2. Antunes Adélio Fernandes, Carrin Guy and Evans David B (2008), Budget Support in developing countries, ensuring the health sector’s interests. World Health Organization 2(2008) 3. Archarya A, de Lima Fuzzo, Moore M (2004), Aid proliferation: How responsible are the donors?

IDA (Institute of Development Studies, Brighton, England) Working Paper 214.

4. Barkan, Joel (2009), Smart Aid for African Development, Rethinking Budget Support for Africa: Apolitical Economy Perspective. Lynne Rienner Publisher, Inc. London.

5. Bulír Ales, Hamann Javier (2008), Volatility of Development Aid: From the Frying Pan into the Fire? IMF, World Development 36(10) 2048-2066.

6. CRS purpose codes (2009). The List of CRS Purpose Codes, January 2009, http://www.oecd.org/document/21/0,3746, en_2649_34447_1914325_1_1_1_1,00.html (2 0 10 12-5) 7. DAC list of ODA recipient, http://www.oecd. org/dataoecd/32/40/43540882.pdf, (2010-12-18)

8. Front Emmanuel and Santiso Javier (2010), Crushed aid: Fragmentation in sectorial aid. OECD Development Centre, Working Paper No. 284. http://www.oecd.org/dataoecd/0/37/44341102. pdf (2010-11-20) 9. Halonen-Akatwijuka, Maija (2007), Coordination Failure in Foreign Aid. B.E. Journals of Economic Analysis & Policy 7(1) 1-40 10. IMF, Glossary, ODA http://www.imf.org/ external/np/exr/glossary/showTerm.asp#F, (2010-11-13) 11. Jelovac Izabela and Vandeninden Frieda (2008), How should donors give foreign aid? Project aid versus budget support. Univeristy of Liège, CREPP Working Papers 04(2008) 12. OECD, Paris Declaration on Aid Effectiveness and Accra Agenda for Action http:// w w w . o e c d . o r g /d o c u m e n t 1 8 / 0 , 3 3 4 3 , en_2649_3236398_35401554_1_1_1_1,00.html, (2010-12-09) 13. OECD (2008), The Paris Declaration, Aid Effectiveness and Development Effectiveness, Evaluation of the Paris Declaration, http://www. oecd.org/dataoecd/59/28/41807824.pdf, (2010-1218) 14. Vidal Consuelo, Pillay Rajeev (2004), Official Development Assistance as Direct Budget Support. An Issue Paper for UNDP, (2004-6).

15. Torsvik, Gaute (2005), Foreign economic aid; should donors cooperate? Journal of Development Economics, 77(2) 503-515.

16. The World Bank, Data, Indicators, http://data. worldbank.org/indicator (2010-12-20)

Abbreviations

CRS: Creditor Reporting System NGO: Non-governmental organization ODA: Official Development Assistance OECD: Organization for Economic Cooperation and Development The Paris Declaration: The Paris Declaration of Aid Effectiveness WB: World Bank

97

98 aPPendIx

Table 1. Countries in Graph B anc C

The Oculus: Proceedings of the U21 UndergradUate research conference

Table 2. Overlaps (recipient country and aid sector) (Aldasoro, Nunnenkamp, Thiele 2009, Table 5)

Table 4. Equations

Table 5. DAC Members and Agencies (OECD, DAC, Annex 3. http://www.oecd.org/dataoecd/14/61/31738599.pdf, 2010-12-18)

99

100

Table 3. Trend lines for calculations of residuals in graph B1

The Oculus: Proceedings of the U21 UndergradUate research conference

Figure 4. Graph B1. Variation in Aid Disbursement & Budget Support

Figure 5. Graph C1. Disbursement, Commitment & Budget Support

Figure 6. Graph C2. Social Sector, average dispursement ratio: 83.51 per cent

101

102

Figure 7. Graph C3. conomic Sector, average disbursement ratio: 70.59 per cent.

Figure 8. Graph C4: Multi Sector, average disbursement rate: 77.52 per cent.

Figure 9. Graph C5: Humanitarian Sector, average disbursement rate: 104.19 per cent.