RevistaMVZ_19(2)

Diseño y Diagramación Luis Carlos Salgado Arroyo Ingeniero de Sistemas luis_salga2@hotmail.com Diva Santana Cordero Lic. Informática divayaneth@hotmail.com

Impresión Gráficas del Caribe Ltda.

Cra. 1B No. 40-42 Tel. (57) (4) 782 6622 Telefax (57) (4) 782 7688 email: diseno@graficaribe.co

Revista MVZ Córdoba Journal MVZ Córdoba EDITOR

Marco González T. M.Sc. Universidad de Córdoba. Montería, Colombia

COEDITOR CO-EDITOR

Salim Máttar V. Ph.D. Universidad de Córdoba. Montería, Colombia

ASISTENTES DEL EDITOR - ASSISTANT EDITORS Luis Carlos Salgado A. Ing. German Arrieta B. M.Sc. Diva Santana C. Lic. Universidad de Córdoba. Montería, Colombia

COMITÉ EDITORIAL - EDITORIAL COMMITTEE James N. Mills Nelson Alvis G. Raúl Poutou P. Oscar Vergara G.

Ph.D. Ph.D. Ph.D. Ph.D.

C.D.C. Atlanta, USA U. de Cartagena, Cartagena, Colombia Pontificia Universidad Javeriana, Bogotá Universidad de Córdoba, Colombia

COMITÉ CIENTIFICO - SCIENTIFIC COMMITTEE Nicholas Komar Maria Aguero R. Joaquín Quilez C. Claudio C. Fonseca Priscila V. Logato Marcelo B. Labruna

Ph.D. Ph.D. Ph.D. Ph.D. Ph.D. Ph.D.

C.D.C. Atlanta, USA N. Y. Medical College, USA U. de Zaragoza, España U. Fed. de Vioçosa, Brasil U. Fed. de Lavras, Brasil U. de São Paulo, Brasil

Jorge Salazar B. Juan Carulla F. Henry Grajales L. Claudia Jiménez E. Agustin Góngora O. Sandra Pardo C.

Ph.D. Ph.D. Ph.D. Ph.D. Ph.D. Ph.D.

Texas Tech. University U. Nacional, Colombia U. Nacional, Colombia U. Nacional, Colombia U. de Los Llanos, Colombia U. Nacional, Colombia

Revista MVZ Córdoba La Revista MVZ Córdoba es una publicación científica de la Facultad de Medicina Veterinaria y Zootecnia de la Universidad de Córdoba, Montería, Colombia. Se publican artículos de procedencia nacional e internacional que estén relacionados con las ciencias agropecuarias en la modalidad de artículos originales de investigación, revisiones de literatura, comunicaciones breves y casos clínicos. Los temas que publica la Revista MVZ Córdoba tienen correspondencia con la medicina veterinaria, zootecnia, acuicultura, biología, biotecnología, ciencias básicas biomédicas, salud pública y otros tópicos de interés de las ciencias agropecuarias. La revista está dirigida a los profesionales de la medicina veterinaria, zootecnia, salud pública, epidemiología, acuicultura, biología, ciencias básicas biomédicas y biotecnología.

Artículos y correspondencia: Los artículos deben ser enviados por correo electrónico al Editor de la Revista MVZ Córdoba.

Correos: revistamvz@gmail.com revistamvz@unicordoba.edu.co Preparación de artículos: La información se puede encontrar en la sección Instrucciones para los Autores. También se puede consultar en el sitio web: http:// apps.unicordoba.edu.co/revistas/revistamvz/index.htm.

Suscripción: La Revista MVZ Córdoba se publica cada cuatro meses y circula los meses de abril, agosto y diciembre. Los números de un año se agrupan en un volumen comenzando por el del mes de abril. La suscripción anual tiene un valor de US $40 para Colombia; US $55 para América Latina y el Caribe; US $60 para USA y Canadá; US $75 para otras regiones. Para suscribirse, se debe diligenciar el formulario que aparece al final de cada revista.

Reproducción e impresos: Se autoriza la copia de artículos para uso académico o científico de las instituciones, citando la fuente. Para obtener ejemplares impresos se debe hacer la solicitud al Editor a través de los correos de correspondencia de la Revista MVZ Córdoba.

Publicidad: La Revista MVZ Córdoba y la Universidad de Córdoba aclaran que la aceptación de publicidad no compromete la aprobación ni el respaldo de los productos o servicios que contraten pautas comerciales o de difusión. Teléfono: (57) (4) 756 9027 - Montería, Colombia.

Acceso en línea: http://apps.unicordoba.edu.co/revistas/revistamvz/index.htm En el enlace anterior, se puede encontrar la revista a partir del volumen 5, número 1 enero-junio de 2000, y acceder a los artículos completos, las instrucciones para los autores y las suscripciones.

Journal MVZ Córdoba The Journal MVZ Cordoba is a scientific publication of the Faculty of Veterinary Medicine and Zootechny of the University of Córdoba, Montería, Colombia. It publishes national and international articles related to the agricultural sciences in the form of original investigation, literature reviews, short communications and clinical cases. The subjects that are published in Journal MVZ Córdoba correspond to veterinary medicine and zootechny, agriculture, biology, biotechnology, biomedical basic sciences, public health and other subjects of interest in agricultural sciences. The magazine is directed to professionals in veterinary and zootechny medicine, public health, epidemiology, aquaculture, biology, biomedical basic sciences and biotechnology.

Articles and correspondence: Articles should be sent by via e-mail to the Editor of the Journal MVZ Córdoba.

E-mails: revistamvz@gmail.com. revistamvz@unicordoba.edu.co.

Articles preparation: Information can be found in the Instructions for Authors section. The website can also be consulted: http://apps.unicordoba.edu.co/revistas/ revistamvz/index.htm.

Subscription: The Journal MVZ Córdoba is published every four months and circulates in the months of April, August and December. The issues are compiled in a yearly volume beginning with the month of April. The yearly subscription costs US$40 for Colombia; US $55 for Latin America and the Caribbean; US $60 for USA and Canada; US $75 for other regions. To subscribe, fill out the form that appears at the end of each magazine.

Reproduction and printing: Copying articles for academic or scientific use of the institutions is authorized, citing the source. To obtain printed issues a request should be made to the Editor through the correspondence address of the MVZ Córdoba Magazine.

Publicity: The Journal MVZ Córdoba and the Universidad de Córdoba make clear that accepting advertising does not affect the approval or backing of the products or services that have commercial ads or diffusion. Telephone: (57) (4) 756 9027 Montería, Colombia.

Online access: http://apps.unicordoba.edu.co/revistas/revistamvz/index.htm.

Starting with Volume 5, Issue 1 from January-June 2000, access to complete articles of the journal as well as instructions for authors and for subscriptions can be found in the above link.

Revista MVZ Córdoba Journal MVZ Córdoba

Categoría A1

Impresa desde Volumen 1, número 1, año 1994 Printed effective with Volume 1, issue 1, 1994 Publicación cuatrimestral / Published triannualy ISSN 0122-0268 Rev.MVZ Córdoba © 2014 Facultad de Medicina Veterinaria y Zootecnia, Universidad de Córdoba, Montería, Colombia.

Financiada por / Sponsored by: Universidad de Córdoba

Revista MVZ Córdoba Volumen 19

MAYO - AGOSTO

Número 2

CONTENIDO EDITORIAL ¿Virus Chikungunya en Colombia, simple cuestión de tiempo?

Marco González, Salim Mattar

4045

ORIGINALES Evaluación del valor nutritivo de residuos de caña de azúcar inoculado con hongo Fomes sp Alex Olivera, Emilio Aranda, Jesus Ramos, Luis Vargas, Juan Zaldivar, German Mendoza

4047

Efecto antioxidante de un extracto de jitomate y licopeno en Carassius auratus y Xiphophorus maculatus

Cynthia Montoya, Fernando Vega, Héctor Nolasco, Luis Espinosa, Olimpia Carrillo, Felicitas Olvera

4059

Efecto de fuentes energéticas sobre la digestibilidad aparente total y excreción de nutrientes por bovinos

Laura Romero, Paulo Rodrigues, Carolina Marino, Lerner Pinedo, Maurício Martins, Eduardo Cassiano, Flavio Perna

Distribución espacial de agentes patógenos transmitidos por vectores en perros en la región del Egeo, Turquía Kerem Ural, Mehmet Gultekın, Abidin Atasoy, Bulent Ulutas

4072

4086

Validación de modelos con sesgo constante: un enfoque aplicado

Salvador Medina, Luis Vargas-Villamil, Jorge Navarro, Leonel Avendaño, Luis Colorado, Enrique Arjona-Suarez, German Mendoza-Martinez

4099

Uso de aceites esenciales en el tratamiento de ratones infectados con Trypanosoma evansi

Matheus Baldissera, Aleksandro Da Silva, Camila Oliveira, Rodrigo Vaucher, Roberto Santos, Janice Giongo, Dianni Capeleto, Alexandre Tonin, Silvia Monteiro

Asociación del gen BoLA DRB3.2 a características productivas en un hato lechero de Antioquia, Colombia Juan Zambrano, Julián Echeverri, Albeiro López-Herrera

Dinámica folicular, crecimiento y regresión del cuerpo lúteo en búfalas multíparas y novillas Alejandro Ojeda, Ricardo Londoño, Carlos Gutierrez R, Angela Gonella-Diaza

Remoción de plomo, mercurio y níquel utilizando la levadura Saccharomyces cerevisiae Cherlys Infante, Deniles De Arco, Edgardo Angulo

4109

4116

4130

4141

Revista MVZ Córdoba Volumen 19

MAYO - AGOSTO

Número 2

Caracterización genética del cerdo doméstico (Sus scrofa domestica) en Cereté Colombia, usando marcadores microsatélites Ivan Melendez, Enrique Pardo, Teodora Cavadia

4150

COMUNICACIONES BREVES Densidad de forrajeo para el tití Saimiri sciureus en dos bosques de Puerto López Colombia Jorge Astwood, Jose Rodriguez, Karen Rodriguez

4158

Mercurio en Pelecanus occidentalis de la bahía de Cispatá, Colombia Saudith Burgos, Jose Marrugo, Amado Navarro, Ivan Urango

4168

Journal MVZ Córdoba Volume 19

MAY - AUGUST

Issue 2

CONTENTS EDITORIAL Virus Chikungunya in Colombia, a simple matter of time?

Marco González, Salim Mattar

4045

ORIGINALS Evaluation of the nutritive value of sugarcane residues inoculated with fungus Fomes sp Alex Olivera, Emilio Aranda, Jesus Ramos, Luis Vargas, Juan Zaldivar, German Mendoza

4047

Effects of dietary antioxidant of tomato extract and lycopene on Carassius auratus and Xiphophorus maculatus Cynthia Montoya, Fernando Vega, Héctor Nolasco, Luis Espinosa, Olimpia Carrillo, Felicitas Olvera

4059

Effect of energy sources on the apparent total tract digestibility and excretion of nutrients by bovine cattle

Laura Romero, Paulo Rodrigues, Carolina Marino, Lerner Pinedo, Maurício Martins, Eduardo Cassiano, Flavio Perna

4072

Spatial distribution of vector borne disease agents in dogs in Aegean region, Turkey Kerem Ural, Mehmet Gultekın, Abidin Atasoy, Bulent Ulutas

Validation of models with constant bias: an applied approach Salvador Medina, Luis Vargas-Villamil, Jorge Navarro, Leonel Avendaño, Luis Colorado, Enrique Arjona-Suarez, German Mendoza-Martinez

4086

4099

Using of essential oils in the treatment of mice infected with Trypanosoma evansi

Matheus Baldissera, Aleksandro Da Silva, Camila Oliveira, Rodrigo Vaucher, Roberto Santos, Janice Giongo, Dianni Capeleto, Alexandre Tonin, Silvia Monteiro

4109

Association of gene BoLA DRB3.2 with production traits in a dairy herd of Antioquia, Colombia Juan Zambrano, Julián Echeverri, Albeiro López-Herrera

4116

Follicular dynamics, corpus luteum growth and regression in multiparous buffalo cows and buffalo heifers Alejandro Ojeda, Ricardo Londoño, Carlos Gutierrez R, Angela Gonella-Diaza

4130

Removal of lead, mercury and nickel using the yeast Saccharomyces cerevisiae Cherlys Infante, Deniles De Arco, Edgardo Angulo

4141

Journal MVZ C贸rdoba Volume 19

MAY - AUGUST

Genetic characterization of the domestic pig (Sus scrofa domestica) in CereteColombia, using microsatellite markers Ivan Melendez, Enrique Pardo, Teodora Cavadia

Issue 2 4150

SHORT COMMUNICATIONS Foraging density for squirrel monkey Saimiri sciureus in two forests in Puerto Lopez - Colombia Jorge Astwood, Jose Rodriguez, Karen Rodriguez

4158

Mercury in Pelecanus occidentalis of the Cispata bay, Colombia Saudith Burgos, Jose Marrugo, Amado Navarro, Ivan Urango

4168

Rev.MVZ Córdoba 19(2):4045-4046, 2014. ISSN: 0122-0268

EDITORIAL

Virus Chikungunya in Colombia, a simple matter of time? ¿Virus Chikungunya en Colombia, simple cuestión de tiempo?

Chikungunya virus (CHIKV) is an RNA alphavirus of the family Togaviridae. The alphaviruses consist of 29 species, including eastern, western, and Venezuelan equine encephalitis viruses among others. CHIKV is transmitted by vector mosquitoes, Aedes aegypti and Aedes albipictus, which are abundant in the South American tropics.

El virus Chikungunya (CHIKV) es un ARN alfavirus de la familia Togaviridae. Los alfavirus tienen 29 especies, e incluye los virus de la encefalitis equina oriental, occidental y venezolana entre otros.

CHIKV es transmitido por los mosquitos vectores Aedes aegypti y Aedes albopictus los cuales son abundantes en el trópico suramericano.

CHIKV was first isolated in 1953 in the serum of a patient in Tanzania during an epidemic of dengue.

In a recent dendrogram, t h i s i s o l a t e appeared with the name of Ross low psg (1,2).

The first clinical report of chikungunya was in Thailand between 1962 and 1964 (3). Between 1960 and 2003 CHIKV reemerged and spread in Southeast Asian countries such as India, Malaysia, Indonesia, Vietnam, and Thailand, among others.

A Central African genotype has occurred since 2000 and spread to Europe, Asia, and Australia (4).

From the clinical perspective, CHIKV may produce acute, sub-acute, or chronic illness. The acute phase is characterized by an abrupt onset with fever surpassing 39°C and severe joint pain.

Polyarthralgia, headache, myalgia, back pain, nausea, vomiting, rash, and conjunctivitis are common; the duration of the acute phase is 3 to 10 days (5). Symptoms of CHIKV infection are similar to dengue.

CHIKV fue aislado por primera vez en 1953 en el suero de un paciente de Tanzania durante una epidemia de dengue. En un dendrograma reciente apareció este aislamiento con el nombre de Ross low psg (1,2). El primer reporte clínico del virus fue en Tailandia entre 1962 y 1964 (3). Entre 1960 y 2003 el virus reemergió y se diseminó en el sudeste asiático en países como India, Malasia, Indonesia, Vietnam y Tailandia entre otros. El genotipo africano centro-oriental ha predominado desde el 2000 con una diseminación hacia Europa, Asia y Australia (4). Desde el punto de vista clínico, CHIKV puede producir una enfermedad aguda, subaguda o crónica. La fase aguda se caracteriza por un comienzo abrupto con fiebre alta superior a los 39°C y dolor articular severo. Son comunes la poliartralgia, cefalea, mialgias, dolor de espalda, náuseas, vómitos, rash y conjuntivitis, la duración de la fase aguda puede durar entre 3 y 10 días (5).

Los síntomas por infección de CHIKV son similares a los del dengue.

The inevitable arrival of CHIKV in America occurred on 5 December 2013, when the first indigenous case appeared on the Caribbean island Saint Martin in the French West Indies. On 20 December, 50 cases were confirmed on the island of Martinique; in January 2014 CHIKV rapidly disseminated to the islands of Guadeloupe, Saint Barthelemy, Dominica and the British Virgin Islands. (1). In Rio de Janeiro, Brazil, an imported case was reported in a patient who had visited Sumatra, indicating the high potential for spread of the virus by imported patients bitten by local mosquitoes (6).

The vector of CHIKV was initially believed to be only Aedes aegypti; however, the virus was also adapted to Aedes albipictus, Ae. Vittatus, and Anopheles stephensi. The change of vector

La inevitable llegada a América del CHIKV, sucedió el 5 de diciembre de 2013, cuando apareció el primer caso autóctono en la isla del Caribe San Martin en el archipiélago de las islas francesas del Oeste.

El 20 de diciembre 50 casos fueron confirmados en la isla de Martinica y en enero de 2014 se extendió a las islas de Guadalupe, San Bartolomé, Dominicanas e Islas Vírgenes Británicas (1). En Rio de Janeiro Brasil se informó un caso importado de un paciente que había visitado Sumatra, lo que indica el alto potencial de propagación del virus por pacientes importados cuando estos son picados por mosquitos locales (6).

Inicialmente se creyó que el vector de CHIKV era sólo el Aedes aegypti; sin embargo, el virus también se adaptó a Aedes albipictus, Ae. Vittatus

4045

4046

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

represents a surprising evolutionary adaptation that involved a mutation in the viral envelope that facilitates replication. The genus Aedes has a wide rural and urban distribution in Colombia and specifically in the Caribbean area, which could facilitate the introduction and subsequent endemicity of CHIKV simply and naturally. It follows that Colombian health authorities should identify aircraft and boats from Venezuela and the Caribbean and fumigate holds before removing cargo and baggage. We do not know the ultimate outcome of competition of CHIKV and Dengue virus in a single vector. Nor do we know whether CHIKV will have an enzootic cycle as in Africa and Asia, or a sylvatic cycle in primates and other vertebrates of the Caribbean region by which it could enter Colombia, as West Nile virus did a few years ago.

The introduction of a new pathogen in Colombia poses more challenges than dengue. The impact of CHIKV in other countries has been worse than dengue, causing lengthy absenteeism from work and disabling symptoms (arthritis, arthralgia) that can last for weeks or months. We do not know if this visiting virus has virulence factors that could transform it into a hemorrhagic virus; we only know that CHIKV is very close to the Asian strains isolated in China in 2012, and the Philippines in 2013.

As seen of other emerging and re-emerging viruses, the arrival of the CHIKV in Colombia is simply a matter of time (currently in Venezuela). We must prepare ourselves for a new differential diagnosis and assume from now on the clinical and ecoepidemiological surveillance.

y a Anopheles stephensi. El cambio del vector representa una sorprendente adaptación evolutiva que implicó una mutación en la envoltura del virus lo que facilitó su replicación. El género Aedes sp tiene una amplia distribución rural y urbana en Colombia y específicamente en el área del Caribe, lo que podría facilitar la introducción del virus y la subsecuente endemia de una forma natural y sencilla. En este punto las autoridades sanitarias colombianas deberían prestar atención a los aviones y barcos provenientes de Venezuela y del Caribe, con el fin de fumigar las bodegas antes de sacar la carga y equipajes. No sabemos cómo sería la competencia en un mismo vector de dos virus importantes como el dengue y CHIKV. Tampoco sabemos si el CHIKV tiene un ciclo enzoótico como en África y Asia y si tendrá un ciclo selvático en primates u otros vertebrados de la región Caribe por donde se cree ingresará como lo hizo el virus del Nilo a Colombia hace unos años.

La introducción de un nuevo patógeno en Colombia plantea más retos que el dengue, el impacto de CHIKV en otros países ha sido peor que el dengue, por el largo ausentismo laboral y síntomas incapacitantes (artritis, artralgias) que pueden durar semanas o meses. No conocemos si este virus visitante tendrá factores de virulencia que lo transforme en hemorrágico, solo sabemos que está muy cercano a las cepas asiáticas aisladas en China en el 2012 y Filipinas en el 2013.

Por lo visto con otros virus emergentes y reemergentes, la llegada del virus CHIKV a Colombia es simple cuestión de tiempo, (actualmente en Venezuela) solo queda prepararnos para un nuevo diagnóstico diferencial y asumir desde ahora la vigilancia eco-epidemiológica y clínica.

REFERENCES 1.

Isabelle Leparc-Goffart, Antoine Nougairede, Sylvie Cassadou, Christine Prat, Xavier de Lamballerie.

Chikungunya in the Americas, LANCET 2014; 383:514.

2.

Leparc-Goffart I, Nougairede A, Cassadou S, C Prat, Lamballerie X. Chikungunya in the Americas.

Lancet 2014; 383: 514.

3.

Suchitra Nimmannitya, Scott B. Halstead, Sanford N. Cohen, Mark R. Margiotta. Observations on Hospitalized Patients with Hemorrhagic Fever. Am J Trop Med Hyg November 1969; 18:954-971.

Marco González T. M.Sc.

4.

Powers A, Logue C. Changing patterns of chikungunya virus: re-emergence of a zoonotic Arboviruses. J Gen Virol 2007; 88, 2363-2377.

5.

OPS/CDC. Preparación y respuesta ante la eventual introducción del virus chikungunya en las Américas.

Washington, DC; Organización Panamericana de la Salud; Centers for Disease Control and Prevention: 2011.

6.

Gomes CA, Marandino R, Pimentel MA, Ribeiro NR.Chikungunya virus infection: report of the first case diagnosed in Rio de Janeiro, Brazil. Revista da Sociedade Brasileira de Medicina Tropical 2012; 45(1):128-129.

Salim Mattar V. Ph.D.

Rev.MVZ Córdoba 19(2):4047-4058, 2014. ISSN: 0122-0268 ORIGINAL

Evaluation of the nutritive value of sugarcane residues inoculated with fungus Fomes sp Evaluación del valor nutritivo de residuos de caña de azúcar inoculado con hongo Fomes sp Alex Olivera D,1 M.Sc, Emilio Aranda I,1* Ph.D, Jesus Ramos J,1 Ph.D, Luis Vargas V,1 Ph.D, Juan Zaldivar C,1 Ph.D, German Mendoza M,2 Ph.D. Colegio de Postgraduados, Campus Tabasco. Periferico Carlos A. Molina, Km 3.5. Carretera CardenasHuimanguillo. H. Cardenas, Tabasco, Mexico C.P. 86500. 2Universidad Autonoma Metropolitana–Xochimilco Biotechnology Department, Xochimilco, DF. Mexico. *Correspondence: earanda@colpos.mx 1

Received: April 2013; Accepted: November 2013.

ABSTRACT Objective. Improve the nutritional value of mechanized sugarcane residues inoculating the fungus Fomes sp. EUM1. Materials and methods. The fungus Fomes was inoculated according to a 0, 0.1, 0.2, and 0.3% (w/v) treatment and incubated at a temperature of 35°C for 7, 10 and 13 days. It was obtained DM, OM, CP, ash, NDF and ADF and the effective degradation of DM, NDF and ADF, with an experimental factorial design of 3X3 and a completely randomized design. The factors were growing days in an Erlenmeyer flask (7, 10, and 13) and inoculum percentage (0.1, 0.2 and 0.3). The data were analyzed with the SAS statistical package. Results. Statistical significance was found in the interaction of the fungus growing days by percentage of inoculum, in the variables: DM, CP and pH. The NDF and ADF factor differed in the percentage of inoculum. Effective degradation showed significant for the same type of interaction in all the variables studied. Conclusions. The inoculation of the fungus increased ADF degradation by only 0.2% of the inoculum percentage, without any effect on effective degradation due to the use of soluble fractions at the beginning of the incubation. It is considered that the degradation occurs in stages that are important to consider for determining treatments to maximize the beneficial effects of the fungus in terms of ruminant nutrition.

Key words: Enzymes, fermentation, ruminants (Source: DeCS).

RESUMEN Objetivo. Mejorar el valor nutritivo de los residuos de cosecha mecanizada de la caña de azúcar inoculando el hongo Fomes sp. EUM1. Materiales y métodos. El hongo Formes se inoculó de acuerdo al tratamiento 0, 0.1, 0.2 y 0.3% (p/v), incubándose a una temperatura de 35°C durante 7, 10 y 13 días. Se obtuvo la MS, MO, PC, cenizas, FDN y FDA y la degradación efectiva de la MS, FDN y FDA; con un diseño experimental de tipo factorial 3X3, con un diseño experimental completamente al azar.

Los factores fueron días de crecimiento en matraz Erlenmeyer (7, 10, 13) y porcentajes de inclusión (0.1, 0.2 y 0.3). Los datos se analizaron con el paquete estadístico SAS. Resultados. Se encontró

4047

4048

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

significancia estadística para la interacción días de crecimiento del hongo por porcentaje de inóculo, en las variables MS, PC y pH. La FDN y la FDA presentaron diferencias para el factor porcentaje de inóculo. La degradación efectiva mostró significancia para el mismo tipo de interacción, en todas las variables estudiadas. Conclusiones. La inoculación del hongo aumentó la degradación de la FDA, únicamente al 0.2% de porcentaje de inclusión, sin un efecto sobre la degradación efectiva, debido a la utilización de fracciones solubles al inicio de la incubación. Se considera que la degradación se produce por etapas que son importante considerar para la determinación de tratamientos que maximicen los efectos benéficos del hongo en términos de la nutrición de rumiantes.

Palabras clave: Enzimas, fermentación, rumiantes (Fuente: DeCS).

INTRODUCTION

INTRODUCCIÓN

One of the fundamental problems in the feeding of ruminants in the tropics is the low availability of dry matter in pastures in the rainy and dry seasons; contrary to what occurs in the rainy season. In the state of Tabasco, Mexico, there are 29,112 Ha planted with sugar cane, of which 28,705 Ha are harvested, with a total production of 1,780,551 T of sugarcane and an average of 62.03 T/Ha (1). After the mechanized harvesting, the amount of residues (leaves, tips, stems, buds) remaining in the field is 18 T/DM/Ha (2), which could be used when there is a shortage of fodder. However, the main factors limiting the digestion of sugarcane residues in ruminants are: low protein content and high-fiber content (2).

Uno de los problemas fundamentales en la alimentación de rumiantes en el trópico es la baja disponibilidad de la materia seca en los pastos en la época de lluvias y estiaje; contrario de lo que sucede en la época de lluvias. En el estado de Tabasco, México, hay 29.112 ha sembradas de caña de azúcar, de las cuales se cosechan 28.705 ha, con una producción total de 1.780.551 t de caña molederas y un promedio de 62.03 t/ha (1). Después de la cosecha mecanizada, la cantidad de residuos (hojas, puntas, tallos, cogollo) que queda en el campo es de 18 t/MS/ ha (2), lo cual pudiera ser utilizada en la época de escasez de forrajes. Sin embargo, los principales factores que limitan la digestión de los residuos de la caña de azúcar en los rumiantes son: su bajo contenido de proteína y alto contenido de fibra (2).

Solid fermentation can be defined as a process where microorganisms grow on solid material with very low water levels. The material may be byproducts generated by agricultural and forestry practices (3-6). This type of fermentation improves certain nutritional features of agricultural yields when used as substrates (7). The species of the genus Fomes is mesophilic, since the optimal temperatures for its growth are between 20 and 36°C, very few species are heat-tolerant. The fungus Fomes sp. EUM1 is capable of growing in a temperature ranging from 20 to 40°C; however, its optimum growth temperature has been found to be 30°C (8).

In order to reduce the fibrous components and increase the digestibility of low-quality agricultural byproducts, biotechnological fermentation processes have been used with fungus that produces enzymes such as xylanases, laccases and cellulases (9,10). Therefore, the objective of this study was to improve the nutritional value of mechanized sugarcane residues by inoculating the fungus Fomes sp. EUM1.

La fermentación sólida puede definirse como un proceso donde los microorganismos crecen sobre el material sólido con muy pocos niveles de agua. El material puede ser subproductos generados por las prácticas agrícolas y forestales (3-6). Este tipo de fermentación mejora algunas características nutricionales de los esquilmos agrícolas cuando son utilizados como sustratos (7). La especie del género Fomes es mesofílica, ya que sus temperaturas óptimas de crecimiento se encuentran entre los 20 y 36°C, muy pocas especies son termo tolerantes. El hongo Fomes sp. EUM1 es capaz de crecer en un rango de temperatura que va desde los 20 a los 40ºC; sin embargo, se ha determinado su temperatura óptima de crecimiento a 30ºC (8).

Para reducir los componentes fibrosos e incrementar la digestibilidad de los subproductos agrícolas de baja calidad, se han utilizado procesos biotecnológicos de fermentación con hongos que producen enzimas como xilanasas, lacasas y celulasas (9,10). Por lo anterior, el objetivo del presente trabajo fue mejorar el valor nutritivo de los residuos mecanizados de la caña de azúcar inoculando el hongo Fomes sp. EUM1.

Olivera - Evaluation of the nutritive value of sugarcane residues

4049

MATERIALS AND METHODS

MATERIALES Y MÉTODOS

Study site. The study was carried out in the Food and Animal Science laboratories of Colegio de Postgraduados, Campus Tabasco, located in Cardenas, Tabasco, Mexico.

Sitio de estudio. El trabajo fue realizado en los laboratorios de Alimentos y Ciencia Animal del Colegio de Postgraduados, Campus Tabasco, ubicados en Cárdenas, Tabasco, México.

Substrate. The residue of the mechanized sugarcane harvest from a freshly cut channel of the variety CP 20-86 was used in town C-31 of Cardenas, Tabasco, Mexico. It is mainly composed of: buds, green leaves, pods and dry leaves. It was grinded in a Nogueira mill model DPM-500.1.2.4, powered by a petrol engine obtaining particles between 2 and 5 cm in diameter.

Sustrato. Se utilizó el residuo de la cosecha mecanizada de la caña de azúcar de un cañal recién cortado de la variedad CP 20-86 en el poblado C-31 de Cárdenas, Tabasco, México.

Compuestos principalmente por: cogollos, hojas verdes, hojas secas y vainas. El cual fue molido en un molino marca Nogueira modelo DPM500.1.2.4, con motor de gasolina obteniendo partículas entre 2 y 5 cm de diámetro.

Inoculum. The fungus Fomes of the white patch Fomes sp. EUM1 was used, which has the potential to produce lignocellulolytic enzymes, which were provided by Universidad Autonoma Metropolitana, Campus Iztapalapa, Mexico DF.

Inóculo. Se utilizó el hongo Fomes de la podredumbre blanca Fomes sp. EUM1, que tiene potencial de producir enzimas lignocelulolíticas, el cual fue proporcionado por la Universidad Autónoma Metropolitana, Campus Iztapalapa, México, DF.

Culture medium. Malt extract was used for the propagation of the macro myketos as a source of carbon and nitrogen extracted from yeast. The culture medium was prepared by dissolving the following components in distilled water: 40 g/L of malt extract, 3 g/L of yeast extract and 18 g/L of bacteriological agar (4). This was sterilized in an autoclave for 15 minutes at 120°C. The sterile medium was poured into Petri dishes, which were subsequently inoculated with mycelium in a disc of 0.6 cm in diameter. They were incubated at 30°C for 7 days.

Determination of the DM of the biomass.

This was performed within 7 days of the growth of the mycelium in the culture medium, and the result is used, solely, for the determination of the amount of mycelia for inoculation per treatment.

The biomass was separated from the agar by washing the Petri dish with distilled boiling water.

Once the biomass was separated, it was placed in a paper filter (Whatman No. 541) and dried in a forced air stove SHEL LAB at 60ºC until a constant weight was achieved. The value of the DM of the biomass was obtained by weight difference.

Cultivation in solid medium. Erlenmeyer flasks of 500 ml were used and 105 g of dry substrate (mechanized sugarcane residue), 315 ml of distilled water and 1.05 g of urea were adding 24 h before being inoculation (11,12). Subsequently, all flasks were sterilized in an autoclave (120°C, 15 psi, 20 min) and inoculated with the fungus in accordance with the treatment 0%, 0.1% (w/v), (1.05 g), 0.2% (w/v), (2.1 g), 0.3% (w/v), (3.15 g) of the substrate used. These were incubated at a temperature of 35°C for 7, 10 and 13 days.

Medio de cultivo. Para la propagación del macromiceto, se utilizó extracto de malta como fuente de carbono y como fuente de nitrógeno extracto de levadura. El medio de cultivo se preparó disolviendo los siguientes componentes en agua destilada: extracto de malta 40 g/L, extracto de levadura 3 g/L y agar bacteriológico 18 g/L (4). Se esterilizó en autoclave durante 15 minutos a 120°C. El medio estéril se vertió en cajas de Petri, en las cuales posteriormente fueron inoculados con un disco de 0.6 cm de diámetro con micelio. Se incubaron a 30°C durante 7 días.

Determinación de la MS de la biomasa. Se realizó a los 7 días del crecimiento del micelio en el medio de cultivo y el resultado se utilizó, únicamente, para la determinación de la cantidad de micelio a inocular por tratamiento. La biomasa se separó del agar lavando la caja Petri con agua destilada en ebullición. Una vez separada la biomasa se colocó en papel filtro (Whatman No. 541) y se secó en estufa de aire forzado SHEL LAB a 60oC hasta lograr un peso constante.

El valor de la MS de la biomasa se obtuvo por diferencia de peso.

Cultivo en medio sólido. Se utilizaron Erlenmeyers de 500 ml, se les agregó 105 g de sustrato seco (residuo mecanizado de caña de azúcar), 315 ml de agua destilada y 1.05 g de urea 24 h antes de ser inoculada (11,12). Posteriormente, todos los matraces se esterilizaron en autoclave (120°C, 15 psi, 20 min) y se inocularon con el hongo de acuerdo con el tratamiento 0%, 0.1% (p/v), (1.05 g), 0.2%

4050

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

Chemical analysis. The dry matter (DM) and crude protein (CP) were determined according to the methodology proposed by the AOAC (12), as well as by the fractioning of the fiber in neutral detergent fiber (NDF) and acid detergent fiber (ADF), using the methodology proposed by Van Soest (13). The variable OM was calculated by a difference of 100 – ash; the variable pH was measured taking 10 g of the residues from each flask and placing the same in a 250 ml Erlenmeyer flask, where 90 ml of distilled water was added and stirred for 30 min. Then, it filtered and the pH was immediately measured with a Conductronic pH 10 portable meter.

E f f e c t i v e d e g r a d a t i o n r a t e . Fo r t h e determination of the effective degradation (ED) of the DM (DMED), OM (OMED), NDF (NDFED) and ADF (ADFED), at 96 h, a differential equations system was developed from the concepts of effective degradation described by Noguera (14) and indicated below: dS/dt=-Degradation; dSE/dt=-Effective_degradation-Passage; dD/ dt=Degradation; dDE/dt=Effective_degradation; Passage=kp*SE; Degradation=kd*S; Effective_degradation=kd*SE;.

With the initial values: INIS =100-fSD; INISE=100-fSD; INID=fSD; INIDe=fDE; fSD=50; kd = 0.03; kp = 0.03 Where: S=Substrate for the calculation of degradation; SE=Substrate for the calculation of effective degradation; D=Degraded material; DE=Degraded material taking into account the passage rate (Effective degradation); fSD=Soluble fraction; INIx=Initial value of the variable of state x.

The model was adjusted for the estimation of the soluble fraction (fSD) and degradation rate (td) from the in situ degradation curves of each treatment subject to chemical analysis. The ED corresponded to the value of the variable with the same name at 96 h. To obtain the degradation curves nylon bags were incubated with the material to be evaluated and were taken out at 6, 12, 24, 48, 72 and 96 h using the methodology described by Noguera (14). The program used for the adjustment of the parameters, and the obtaining of the ED was the Berkeley Madonna v8.01 (15).

Experimental design and statistical analysis.

For the variables of chemical composition (DM,

(p/v), (2.1 g), 0.3% (p/v), (3.15 g) del sustrato utilizado. Se incubaron a una temperatura de 35°C durante 7, 10 y 13 días.

Análisis químico. Se determinó la materia seca (MS) y proteína cruda (PC) de acuerdo con la metodología propuesta por la AOAC (12), así como el fraccionamiento de la fibra en fibra detergente neutra (FDN) y fibra detergente ácida (FDA), utilizando la metodología propuesta por Van Soest (13). La variable de MO se calculó por diferencia de 100 - % ceniza, la variable de pH se midió tomando 10 g de los residuos de cada matraz, se depositaron en un matraz Erlenmeyer de 250 ml, en donde se le adicionó 90 ml de agua destilada y se agitó durante 30 min. Posteriormente, se filtró y se midió inmediatamente el pH con un medidor portátil Conductronic Modelo pH 10.

Tasa de degradación efectiva. Para la determinación de la degradación efectiva (DE) de la MS (DEMS), MO (DEMO), FDN (DEFDN) y FDA (DEFDA), a las 96 h, se desarrolló un sistema de ecuaciones diferenciales a partir de los conceptos de degradación efectiva descritos por Noguera (14), y descrito a continuación: dS/dt=-Degradación; dSE/dt=-Degradación_efectiva-Pasaje;dD/ dt=Degradación; dDE/dt=Degradación_efectiva; Pasaje=kp*SE; Degradación=kd*S; Degradación_efectiva=kd*SE;.

Con los valores iniciales: INIS =100-fSD; INISE=100-fSD; INID=fSD; INIDe=fDE; fSD=50; kd = 0.03; kp = 0.03 Dónde: S=Substrato para cálculo de la degradación; SE=Substrato para cálculo de la degradación efectiva; D=Material degradado; DE=Material degradado tomando en cuenta la tasa de pasaje (Degradación efectiva); fSD=Fracción soluble; INIx=Valor inicial de la variable de estado x.

El modelo fue ajustado para la estimación de la fracción soluble (fSD) y tasa de degradación (td) a partir de las curvas de degradación in situ de cada tratamiento al que se le hizo un análisis químico. La DE correspondió al valor de la variable del mismo nombre al tiempo 96 h.

Para la obtención de las curvas de degradación se incubaron en un toro fistulado bolsas de nylon con el material a evaluar y se fueron sacando en horarios de 6, 12, 24, 48, 72, y 96 h, utilizando la metodología descrita por Noguera

Olivera - Evaluation of the nutritive value of sugarcane residues OM, CP, NDF and ADF) and pH, a 3X3 factorial experiment was conducted; where the factor A, days of growth of the fungus, was evaluated at three levels: 7, 10, and 13 days; factor B, percentage of inoculum, was studied at three levels: 0.1, 0.2 and 0.3% (w/v). The combination of the two factors and their levels generated a total of nine treatments that were housed in a completely randomized experimental design with two replications. A variance analysis was performed for each of the variables of chemical composition according to the experimental design proposed and the following linear model: Yijk=μ+αi+γj+πij+eijk; for i = 1, 2, 3; j = 1, 2, 3; k = 1, 2; Where: Yijk represents the observation at level i of factor A with level j of factor B and replication j; μ is the general mean; αi is equivalent to the fixed effect of level i of factor A; γj is the fixed effect of level j of factor B; πij is the effect of the interaction A X B; and eijk is the random error.

Subsequently, for the interaction of the days of growth of the fungus (A) with the inclusion percentage (B) and the main effects that showed to be significant (p<0.05), a multiple comparison of means test was conducted using the Tukey method (16, 17). The information was processed using the statistical analysis software SAS version 9.3 and the procedures glm and mixed (17).

For ED (DMED, OMED, NDFED, and ADFED) at 96 h, a 3X3 factorial experiment was conducted; where the factor A, days of inoculation, was evaluated at three levels: 7, 10, and 13 days; factor B, inclusion percentage, was studied at three levels: 0.1, 0.2 and 0.3% (w/v). The combination of the two factors and their levels generated a total of nine treatments, which were housed in an experimental design of complete randomized blocks, where each block was conformed by an animal. For each of the ED variables, a variance analysis was performed according to the experimental design proposed and the following linear model: Yijk=μ+αi+γ_j+δk+πjk+eijk; for i = 1, 2; j = 1, 2, 3; k = 1, 2, 3; Where Yijk represents the observation of animal or block i, at level j of factor A with level k of factor B; μ is the general mean; αi is equivalent to the random effect of animal i, γj is the effect of level j of factor A; δk is the fixed effect of level k of factor B;

4051

(14). El programa utilizado para el ajuste de los parámetros y la obtención de la DE fue Berkeley Madonna v8.01 (15).

Diseño experimental y análisis estadístico.

Para las variables de composición química (MS, MO, PC, FDN y FDA) y el pH, el experimento fue de tipo factorial 3X3; donde el factor A, días de crecimiento del hongo, fue evaluado en tres niveles: 7, 10, y 13 días; el factor B, porcentaje de inóculo, fue estudiado en tres niveles: 0.1, 0.2, y 0.3% (p/v). La combinación de los dos factores y sus niveles generó un total de nueve tratamientos, mismos que fueron alojados en un diseño experimental completamente al azar con dos repeticiones. Para cada una de las variables de composición química, se realizó un análisis de varianza de acuerdo con el diseño experimental propuesto y al siguiente modelo lineal: Yijk=μ+αi+γj+πij+eijk; para i = 1, 2, 3; j = 1, 2, 3; k = 1, 2; Dónde: Yijk representa la observación en el i-ésimo nivel del factor A con el j-ésimo nivel del factor B y la j-ésima repetición; μ es la media general; αi equivale al efecto fijo el i-ésimo nivel del factor A; γj es el efecto fijo del j-ésimo nivel del factor B; πij es el efecto de la interacción A X B; y eijk es el error aleatorio.

Posteriormente, para la interacción días de crecimiento del hongo (A) por porcentaje de inóculo (B) y efectos principales que resultaron significativos (p<0.05) se realizó una prueba de comparación múltiple de medias mediante el método de Tukey (16,17). La información fue procesada con ayuda del software para análisis estadístico SAS versión 9.3 y los procedimientos glm y mixed (17).

Para las DE (DEMS, DEMO, DEFDN y DEFDA), a 96 h, el experimento fue de tipo factorial 3X3; donde el factor A, días de inoculación, fue evaluado en tres niveles: 7, 10, y 13 días; el factor B, porcentaje de inclusión, fue estudiado en tres niveles: 0.1, 0.2, y 0.3% (p/v). La combinación de los dos factores y sus niveles generó un total de nueve tratamientos, los cuales fueron alojados en un diseño experimental de bloques completos al azar, donde cada bloque estuvo conformado por un animal. Para cada una de las variables de DE, se realizó un análisis de varianza de acuerdo con el diseño experimental propuesto y al siguiente modelo lineal: Yijk=μ+αi+γ_j+δk+πjk+eijk; para i = 1, 2; j = 1, 2, 3; k = 1, 2, 3;

4052

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

πjk is the effect of the interaction A X B; y eijk is the random error.

Subsequently, for the days of inoculation interaction (A) by inclusion percentage (B) and the main effects that resulted significant (p<0.05), a multiple comparison of means test was conducted using the Tukey method (16). The information was processed using the statistical analysis software SAS version 9.3 and the procedures glm and mixed (17).

RESULTS The results of the chemical analyses showed a statistical significance for the interaction A X B, days of growth of the fungus (A) by the inoculum percentage (B), in the variables: DM (p=0.0221), CP (p=0.0022), and pH (p=0.0170).

The variables that showed statistical significance for factor A, days of fungal growth, were NDF (p=0.0082) and ADF (p=0.0185); while the variables OM and ashes were not significant (p>0.05) in all sources of variation. The DM only showed significant differences between the days of growth of the fungus of 0.2% (w/v) of the inclusion percentage, while CP and pH in 0.3% of growth. Table 1 shows the results of the variables with interactions. The global means of the variables were: DM=29.47, OM=90.58, CP=5.19, NDF=72.92, ADF=45.34, Ash=9.42 and pH=7.11. The NDF showed significant differences between day 7 (76.46%), day 10 (71.55%) and day 13 (70.75%) of incubation.

Similarly, the ADF showed differences between day 7 (49.50%), day 10 (43.72%) and day 13 (42.81%).

All variables which degradation was studied showed statistical significance for the interaction of the days of inoculation (A) and the percentage of inclusion (B), DM (p=0.0007), OM (p=0.001), Table 1. Effect of the concentration of the fungus Fomes sp. EUM1 and days of growth in the residues of the mechanized harvesting of sugarcane in its content of DM, CP and pH Variable DM (%)

CP (%)

pH

Days of growth 7 10 13 E.E. 7 10 13 E.E. 7 10 13 E.E.

Percentage of inoculum 0.1 0.2 0.3 31.24a 33.82a 29.06a 30.58a 28.75b 30.89a 29.35a 23.81c 27.72a 1.6284 5.28a 5.69a 5.07a 4.22b 6.19a 5.07a 3.93b 6.00a 5.27a 0.2272 8.26a 6.46a 7.43a 8.58a 6.35a 5.63b 8.44a 6.43a 6.44b 0.3417

abc Means with different superscript in the same column differ in p<0.05.

donde Yijk representa la observación en el i-esimo animal o bloque, en el j-ésimo nivel del factor A con el k-ésimo nivel del factor B; μ es la media general; αi equivale al efecto aleatorio del i-ésimo animal, γj es el efecto del j-ésimo nivel del factor A; δk es el efecto fijo del k-ésimo nivel del factor B; πjk es el efecto de la interacción A X B; y eijk es el error aleatorio.

Posteriormente, para la interacción días de inoculación (A) por porcentaje de inclusión (B) y efectos principales que resultaron significativos (p<0.05) se realizó una prueba de comparación múltiple de medias mediante el método de Tukey (16). La información fue procesada con ayuda del software para análisis estadístico SAS versión 9.3 y los procedimientos glm y mixed (17).

RESULTADOS Los resultados de los análisis químicos mostraron significancia estadística para la interacción A X B, días de crecimiento del hongo (A) por porcentaje de inóculo (B), en las variables: MS (p=0.0221), PC (p=0.0022) y pH (p=0.0170). Las variables que presentaron significancia estadística para el factor A, días de crecimiento del hongo, fueron FDN (p=0.0082) y FDA (p=0.0185); mientras que las variables MO y cenizas no fueron significativas (p>0.05) en todas las fuentes de variación. La MS, únicamente, presentó diferencias significativas entre los días de crecimiento del hongo al 0.2% (p/v) de porcentaje de inclusión, mientras que la PC y pH al 0.3% de crecimiento. En la tabla 1 se pueden ver los resultados de las variables que presentaron interacciones. Las medias globales de las variables fueron: MS=29.47%, MO=90.58%, PC=5.19%, FDN=72.92%, FDA=45.34%, Cenizas=9.42% y pH=7.11. La FDN presentó diferencias significativas entre los 7 días de incubación (76.46%) los 10 (71.55%) y 13 días (70.75%) de incubación. De igual forma, la FDA presentó diferencias entre el 7 día (49.50%) y los 10 (43.72%) y 13 días (42.81%).

Todas las variables, a las que se les estudiaron sus degradaciones DE, mostraron significancia estadística para la interacción días de inoculación (A) por porcentaje de inclusión (B), MS (p=0.0007), MO (p=0.001), FDN (p=0.0035) y FDA (p=0.0419). En todos los casos se presentaron, únicamente, interacciones y diferencias estadísticas significativas entre los tiempos de incubación del inóculo al 0.2% (p/v) de porcentaje de inclusión (Tabla 1), con una disminución evidente de los valores de estas variables al aumentar los días de incubación

Olivera - Evaluation of the nutritive value of sugarcane residues NDF (p=0.0035) and ADF (p=0.0419). In all cases there were only interactions and significant statistical differences between the times of incubation of the inoculum at 0.2% (w/v) of the percentage of inclusion (Table 1), with an apparent decrease in the values of such variables as the days of incubation of the inoculum increased. The study of degradation kinetics showed that these declines were due to a reduction of td that went from 0.0054 to 0.0022, 0.0060 to 0.0025, 0.0062 0.0025 and 0.0059 to 0.0023, for, DM, OM, NDF and ADF (Table 2, 3), respectively, and not due to changes in the amounts of fSD, which showed marginal differences, except in the case of the ADF that was from 0.72 to 10.57% at day 7 to 13 of incubation. The means of all fSD were, 21.05, 26.24, 12.81 and 5.36%, for DM, OM, NDF and ADF, respectively.

Table 2. Effect of the concentration of the fungus Fomes sp. EUM1 and days of growth in residues of the mechanized harvesting of sugarcane in the effective degradation of DM, OM, NDF and ADF. Variable DM (%)

OM (%)

NDF (%)

ADF (%)

Days of growth 7 10 13 E.E. 7 10 13 E.E. 7 10 13 E.E. 7 10 13 E.E.

del inóculo. El estudio de la cinética de la degradación, mostró que estas disminuciones se debieron a una reducción de las td que fueron de 0.0054 a 0.0022, 0.0060 a 0.0025, 0.0062 a 0.0025, y de 0.0059 a 0.0023, para, MS, MO, FDN y FDA (Tablas 2, 3), respectivamente, y no debido a cambios en las cantidades de fSD, las cuales presentaron diferencias marginales, excepto para el caso de la FDA que fue de 0.72 a 10.57% de 7 a 13 días de incubación. Las medias de todas las fSD fueron, 21.05, 26.24, 12.81 y 5.36%, para MS, MO, FDN y FDA, respectivamente.

Table 3. Effect of the concentration of the fungus Fomes sp. EUM1 and days of growth in residues of the mechanized harvesting of sugarcane in the rate of degradation of DM, OM, NDF and ADF. Variable DM (%)

OM (%)

Percentage of inoculum 0.1 52.68a 54.89a 52.04a 1,9756 58.27a 59.92a 57.02a 1,7872 52.72a 55.34a 50.52a 2,5218 40.11a 49.56a 40.73a 4.24

0.2 53.31a 44.58b 35.76c

0.3 53.73a 53.31a 56.57a

58.26a 50.06b 42.27c

59.29a 58.44a 60.60a

51.78a 41.50b 32.67c

53.03a 53.11a 54.05a

43.78a 33.34ba 27.93b

45.91a 46.01a 47.49a

abc Means with different superscript in the same column differ in p<0.05.

DISCUSSION The study of DM resulted in a pattern similar to that found in all variables where ED was studied (DM, OM, NDF and ADF). In these variables, differences were only found between the days of growth of the fungus at 0.2% (w/v) of the inclusion percentage, with a reduction of DM and ED as the days of incubation increased from day 7 to 13. In the case of the concentration of NDF and ADF, the same trend was observed, but for all percentages of inclusion. Similar results have been found in sugarcane bagasse treated with the strain Trichoderma viride M5-2, where a decrease in the NDF, ADF and Hc of 5, 3 and 2% were observed (18, 19). The decrease of DM could be due to the growth of the mycelium during the days of solid-state fermentation and synthesis of organic acids at the expense of a

4053

NDF (%)

ADF (%)

Days of growth 7 10 13 7 10 13 7 10 13 7 10 13

Percentage of inoculum 0.1 0.2 0.3 0.0054 0.0054 0.0055 0.0059 0.0037 0.0058 0.0042 0.0022 0.007 0.0058 0.006 0.0062 0.0065 0.0041 0.0064 0.0047 0.0025 0.0063 0,0061 0.0062 0.0064 0,0064 0.0044 0.0065 0,0046 0.0025 0.0072 0.0046 0.0059 0.0057 0.0059 0.0037 0.0058 0.0034 0.0023 0.0065

DISCUSIÓN El estudio de la MS presentó un patrón similar a lo encontrado en todas las variables en las que se estudiaron las DE (MS, MO, FDN y FDA). En estas variables solamente se encontraron diferencias entre los días de crecimiento del hongo al 0.2% (p/v) de porcentaje de inclusión, con una reducción de la MS y de la DE conforme aumentaron los días de incubación del día 7 al 13. En el caso de la concentración de la FDN y FDA se observó la misma tendencia, pero para todos los porcentajes de inclusión. Resultados similares se han encontrado en el bagazo de caña tratada con la cepa Trichoderma viride M5-2, donde se observó una disminución de la FDN, FDA y Hc en 5, 3 y 2% (18,19). La disminución de la MS pudo deberse al crecimiento del micelio durante los días de fermentación en estado sólido y la síntesis de ácidos orgánicos a costa de una eficiencia de conversión pobre a partir de la hemicelulosa (Hc). La disminución de la Hc como consecuencia de crecimiento del hongo ha sido reportada previamente en ensilaje de caña de azúcar tratada con Pleurotus sapidus, aunque acompañada con un incremento y no con una disminución de la MS (11).

4054

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

poor conversion efficiency from hemicellulose (Hc). The decrease in Hc as a result of the growth of the fungus has been previously reported in sugarcane silage treated with Pleurotus sapidus, although accompanied by an increase and not a decrease in DM (11).

The difference mentioned above may be due to the development phase of the fungus, the type of substrate used, the types of enzymes produced, the percentage of inclusion or an interaction of factors (20). This would explain why there were no differences between the days of incubation for the inclusion percentage of 0.1 and 0.3% (w/v) in DM and OM, as opposed to NDF and ADF. A too fast or too slow relative growth, as a consequence of the percentage of inclusion of the fungus, would leave outside the range of study sections where there are biological and statistical differences between treatments, since periods of stability can be found in all processes involving degradation, at both the beginning and end of these process. At the beginning because microorganisms require a time to adapt to the new conditions and at the end due to the end of the substrates (20).

For practical purposes, neither of these ends is suitable for the use of the fungus, since at the beginning it has not had time to produce enough enzymes to decrease degradation and at the end the substrate is already exhausted, they are not substrates that can be exploited by the ruminant.

The significant differences found in concentrations of CP and pH at 0.1 and 0.3% (w/v) of inoculation, respectively, indicate the existence of processes different from those observed at 0.2% (w/v), and that the statistical similarities found between the levels of 0.1 and 0.3% (w/v) are a consequence of the final balance of the processes and not of identical compositions. Studies similar to this where specific chemical compounds such as Hc and true protein are evaluated could help to understand the changes that occur during the growth of the fungus.

In contrast to this study, in two experiments with the fungus Pleurotus sp., obtained from lignocellulose residues, the content of CP increased in 10-15% (21, 22). Likewise, Pal et al (9) reported an increase in CP in wheat straw fermented with the fungus Trametes versicolor and Pleurotus ostreatus.

Decreases in ED of observed in inclusion percentages of 0.2% (w/v) in all treatments (Table 2) could be caused, similarly for DM, and as it has been previously reported in experiments with Fomes sp. EUM1, because the fungus is using Hc as a source of energy for growth (22), before rising the production of enzymes capable

La diferencia mencionada anteriormente, puede ser debido a la fase en la que se encontraba el desarrollo del hongo, al tipo de sustrato utilizado, a los tipos de enzimas producidas, al porcentaje de inclusión o a una interacción de factores (20). Lo anterior explicaría por qué no se encontraron diferencias entre los días de incubación para los porcentaje de inclusión de 0.1 y 0.3% (p/v), en la MS y MO, pero si en el caso de la FDN y FDA. Un crecimiento relativo demasiado rápido o demasiado lento, a consecuencia del porcentaje de inclusión del hongo, dejaría fuera del rango de estudio secciones donde existen diferencias biológicas y estadísticas entre los tratamientos, ya que en todos los procesos donde se involucran degradaciones, al principio y al final de estos se pueden encontrar períodos de estabilidad. Al principio porque los microorganismos requieren de un tiempo para adaptarse a las nuevas condiciones y al final por la terminación del o los sustratos (20).

Para fines prácticos, ninguno de estos extremos es adecuado para la utilización del hongo, ya que al inicio, este todavía no ha tenido tiempo para producir suficientes enzimas para disminuir la degradación y, al final, el sustrato ya se agotó o no quedan sustratos que pueda ser aprovechados por el rumiante.

Las diferencias significativas encontradas en las concentraciones de la PC y pH al 0.1 y 0.3% (p/v) de inoculación, respectivamente, indican la existencia de procesos diferentes a los observados al 0.2% (p/v), y a que las similitudes estadísticas encontradas entre los niveles de 0.1 y 0.3% (p/v) son una consecuencia del saldo final de los procesos y no a composiciones idénticas. Estudios similares al presente, en donde se evalúen compuestos químicos específicos como la Hc y proteína verdadera, ayudarían a comprender los cambios que se producen durante el crecimiento del hongo.

En contraste con este trabajo, en dos experimentos con el hongo Pleurotus sp., obtenido de residuos lignocelulósicos, se aumentó el contenido de PC de 10-15% (21,22). Asimismo, Pal et al (9) reportaron un incremento de la PC en paja de trigo fermentada con los hongos Trametes versicolor y Pleurotus ostreatus.

Las disminuciones en las DE observadas a los porcentaje de inclusión de 0.2% (p/v) en todos los tratamientos (Tabla 2) pudieron deberse, al igual que para la MS, y como ha sido reportado previamente en experimentos con Fomes sp EUM1, a que el hongo está utilizando la Hc como fuente de energía para el crecimiento (22), antes de elevar la producción de enzimas con capacidad degradadora de lignina (22), con un pico máximo de producción enzimática de celulasas y xilanasas entre los días 9 y 15 (9,10).

Debido a que los tipos de enzimas encontradas en el hongo de estudio son celulasas, xilanasas y lacasas (22), similares a los encontrados en otros trabajos (9,10), esto podría indicar dinámicas similares en la

Olivera - Evaluation of the nutritive value of sugarcane residues of degrading lignin (22), with a peak of enzyme production of cellulases and xylanases between day 9 and 15 (9, 10). Since the types of enzymes found in the fungus under study are cellulases, xylanases and laccases (22), similar to those found in other studies (9, 10), this could indicate similar dynamics in the production of enzymes.

In the same vein, Salcedo et al (23) reported an increase in the degradation of Hc in sugarcane residues treated with commercial ligninolytic enzymes previously using a delignification treatment.

Yan et al (24) found an increase in the in situ digestibility of DM (DMDI) in alfalfa and rice straw using exogenous enzymes. Similarly, in another experiment, an increase of DMDI was observed in a hay compound using 15 and 30% of the cellulose, xylanasa and fibrolytic enzymes (25), which contrasts with what was found in this study, since no increase of ED and/or td was found in any treatment (Table 2 and 3). Contrary to what was previously reported, the ED of DM (DMED) was reduced in 33% and td in 59%, when the inclusion percentage was 0.2% (w/v), and the incubation time increased from 7 to 13 days.

In the case of NDF, Membrillo et al (26) found an increase in the degradation of this fraction using the fungus Pleurotus ostreatus IE-8 and different substrate particle sizes, where the substrate was sugarcane bagasse. In alfalfa hay and rye grass treated with fibrolytic enzymes, Pinos et al (27) reported, in the same way, an increase in the in situ digestibility of NDF (NDFDI) and ADF (ADFDI) of 6 and 72 h. Likewise, in another study an increase in NDFDI was found using treatments with Saccharomyces cerevisiae and Aspergillus oryzae in alfalfa hay (28). However, in this study, both the NDF and the ADF showed a behavior similar to that previously described for DM. Therefore, only at a percentage of inclusion of 0.2% (w/v), the NDFDI decreased in 37% and td in 60%, while the ADFED, at that same percentage, dropped 36% and td 61%, when the incubation time increased from 7 to 13 days. The above represents something contrary to what was expected based on previously published reports. In this study, the decrease in DMED, OMED, NDFED y ADFED, in the only level of the inclusion percentage (0.2% w/v) where significant differences were reported, occurred as a consequence of the decrease in td as the days of incubation increased, since as mentioned above, changes in fSD were marginal (except for ADF) and that td showed marked decreases close to 60%.

In this study, the effect of the inoculation of the fungus, in terms of DM concentration, its fractions

4055

producción de enzimas. En el mismo sentido, Salcedo et al (23) reportaron un aumento en la degradación de la Hc en residuos de caña de azúcar tratados con enzimas ligninolíticas comerciales utilizando previamente un tratamiento de deslignificación.

Yan et al (24) encontraron un aumento en la digestibilidad in situ de la MS (DIMS) en alfalfa y paja de arroz, utilizando enzimas exógenas. De igual forma, en otro experimento se observó un incremento de la DIMS en un compuesto de heno utilizando el 15 y 30% de las enzimas fibrolíticas celulasa y xylanasa (25), lo cual contrasta con lo encontrado en este trabajo, ya que, en ningún tratamiento se encontró un incremento de la DE y/o td (Tabla 2 y 3). Al contrario de lo reportado previamente, la DE de la MS (DEMS) se redujo 33% y la td 59%, cuando el porcentaje de inclusión fue 0.2% (p/v), y el tiempo de incubación aumentó de 7 a 13 días.

En el caso de la FDN, Membrillo et al (26) encontraron un aumento en la degradación de esta fracción utilizando el hongo Pleurotus ostreatus IE-8 y diferentes tamaños de partículas del sustrato, donde el sustrato fue el bagazo de caña de azúcar. En heno de alfalfa y pasto ballicos tratados con enzimas fibrolíticas, Pinos et al (27) reportaron, de igual forma, un aumento en la digestibilidad in situ de la FDN (DIFDN) y FDA (DIFDA) de 6 y 72 h. Asimismo, en otro trabajo, se encontró un aumento de la DIFDN utilizando tratamientos de Saccharomyces cerevisiae y Aspergillus oryzae en heno de alfalfa (28). Sin embargo, en el presente trabajo, tanto la FDN como la FDA tuvieron un comportamiento similar a lo descrito previamente para la MS. Por lo consiguiente, únicamente, al 0.2% (p/v) de porcentaje de inclusión, la DEFDN se redujo 37% y la td 60%, mientras que la DEFDA, a ese mismo porcentaje, se redujo 36% y la td 61%, cuando el tiempo de incubación aumentó de 7 a 13 días. Lo anterior representa algo contrario a lo que se esperaba basado en los reportes previamente publicados. En el presente trabajo, la disminución de las DEMS, DEMO, DEFDN and DEFDA, en el único nivel de porcentaje de inclusión (0.2% p/v) donde se reportaron diferencias significativas, fueron como consecuencia de la disminución de las td al aumentar los días de incubación, ya que, como se mencionó anteriormente, los cambios de las fSD fueron marginales (exceptuando para la FDA) y a que las td presentaron disminuciones muy marcadas cercanas al 60%.

En este trabajo, el efecto de la inoculación del hongo, en términos de concentración de MS, sus fracciones y degradación, pudo deberse al equilibrio de los diferentes procesos que tienen lugar en cada una de las etapas de crecimiento. Es posible que al nivel del 0.2% (p/v) de porcentaje de inclusión, la utilización de fracciones de fácil degradación, como la Hc, que se ha observado en otros trabajos

4056

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

and degradation, could be due to the balance of the different processes that take place in each of the growth stages. It is possible that the level of 0.2% (w/v) of the percentage of inclusion, the use of easily degradable fractions, such as the Hc observed in other studies (11), could contribute to the decrease of the degradation of all fractions as the days of growth increased, since a fraction with high degradation is reduced leaving harddegradation fractions. In this regard, the maximum time of growth of the fungus (13 days) could have limited the manifestation of enzymes on the fiber, since previous reports recommend up to 15 days (9,10) or more of fungal growth (11) to attain a significant effect. Even in these circumstances, the increase of 0.72 to 10.57% in the ADF’s fSD, found at a level of 0.2% (w/v) of the percentage of inclusion as the time of inoculation increased, is a clear indicator of the effect that the enzymes of the fungus have on the fiber, as well as of the need to increase the time of incubation for this effect to be reflected on ED. Under the conditions in which this study was conducted, it is concluded that the inoculation of the fungus Fomes sp. EUM1 in mechanized harvesting of sugarcane waste has an effect on the ADF that is not reflected in the increase of degradation, due to the use of a highly degradable compound such as Hc, which is used as a source of energy at the beginning of its growth, although this effect only occurred at a level of 0.2% (w/v) of the inclusion percentage. Also, it is concluded that degradation occurs in stages that must be considered for the determination of the levels of the percentage of inclusion or incubation times where the beneficial effects of the fungus are maximized in terms of ruminant nutrition. Finally, the results obtained from the analysis of the ED of the different fractions of the material studied and their subsequent comparison with their corresponding fSD and td, demonstrated the usefulness of this methodology to study the processes that take place during the establishment, growth and production of enzymes by the fungus. The above must be taken into consideration for the planning of new experiments.

Acknowledgements To the National Council of Science and Technology (CONACYT) for the scholarship granted for the study of the postgraduate studies on Agro-Food Production in the Tropics of Colegio de Postgraduados, Campus Tabasco. To UAM Ixtapalapa for its contribution of the strain that was used in this research. To the research lines of Colegio de Postgraduados LPI2 and LPI5 for the financial support for reagents and laboratory materials. The effective degradation model was developed for this study by Mr. Luis Manuel Vargas-Villamil.

(11) pudiera contribuir a la disminución de la degradación de todas las fracciones conforme aumentaron los días de crecimiento, ya que se reduce una fracción que tiene una alta degradación, quedando fracciones de difícil degradación. En este mismo sentido, el tiempo de crecimiento máximo del hongo (13 días) pudo haber limitado la manifestación de las enzimas sobre la fibra, debido a que reportes previos recomiendan hasta 15 días (9,10) o más de crecimiento del hongo (11) para alcanzar un efecto significativo. Aún en estas circunstancias, el incremento del 0.72 al 10.57% de la fSD de la FDA, encontrada al nivel de 0.2% (p/v) de porcentaje de inclusión al aumentar el tiempo de inoculación, es un claro indicador del efecto que tienen las enzimas del hongo sobre la fibra, así como de la necesidad de incrementar el tiempo de incubación para que este efecto se refleje en la DE. Bajo las condiciones en que se llevó este estudio, se concluye que la inoculación del Hongo Fomes sp.

EUM1 en los residuos de cosecha mecanizada de la caña de azúcar tiene un efecto en la FDA que no se ve reflejado en el incremento de la degradación, debido a la utilización de compuesto altamente degradables, como la Hc, que son utilizados como fuente de energía al inicio de su crecimiento, aunque este efecto sólo fue manifestado al nivel de 0.2% (p/v) de porcentaje de inclusión. También, se concluye que la degradación se produce por etapas que son importantes considerar para la determinación de niveles de porcentaje de inclusión o de tiempos de incubación donde se maximicen los efectos benéficos del hongo en términos de la nutrición de rumiantes. Finalmente, los resultados obtenidos del análisis de la DE de las diferentes fracciones del material estudiado y su posterior comparación con su correspondiente fSD y td, demostraron la utilidad de esta metodología para estudiar los procesos que tienen lugar durante el establecimiento, crecimiento y producción de enzimas por parte del hongo. Lo anterior, habría que tomarse en cuenta para la planificación de nuevos experimentos.

Agradecimientos Al Consejo Nacional de Ciencia y Tecnología (CONACYT) por la beca otorgada para el estudio del posgrado Producción Agroalimentaria en el Trópico del Colegio de Postgraduados, Campus Tabasco. A la UAM Ixtapalapa, por el aporte de la cepa que se utilizó en dicha investigación. A las líneas de Investigación del Colegio de Postgraduados LPI2 y LPI5 por el apoyo financiero para reactivos y materiales de laboratorio.

El modelo de degradación efectiva fue desarrollado para este trabajo por el Dr. Luis Manuel Vargas-Villamil.

Olivera - Evaluation of the nutritive value of sugarcane residues

4057

REFERENCES 1. S i s t e m a I n t e g r a l d e I n f o r m a c i ó n Agroalimentaria y Pesquera [en línea].

2011. (acceso noviembre del 2013). URL Disponible en: http://www.siap.gob.mx/ index.php?option=com_wrapper&view=wr apper&Itemid=351.

2.

3.

4.

Lal R. Soil quality impacts of residue removal for bioethanol production. Soil Tillage Res 2009; 102:233-241.

Aranda EM, Ruiz P, Mendoza GD, Marcoff CF, Ramos JA, Elías A. Cambios en la digestión de tres variedades de caña de azúcar y sus fracciones de fibra. Rev Cubana Cienc Agric 2004; 38:137-144.

Fernandez JA, Henao JM, Pedrosa AM, Quevedo B. Inmovilización de hongos ligninoliticos para la remoción de colorantes negro reactivos. Rev Colomb Biotechnol 2009; 11:59-72.

5.

Krishna C. Solid state fermentation systems: An overview. Crit Rev Biotechnol 2005; 25:1–30.

6.

Arora DK, Bridge DP, Bhatnagar D. Handbook of Fungal Biotechnology. New York: CRC Press; 2004.

7.

Peláez AA, Meneses M, Miranda RL, Megias RM, Barcena GR, Loera O. Ventajas de la fermentación sólida con Pleurotus sapidus en ensilaje de caña de azúcar. Arch Zootec 2008; 57:25-33.

8.

Ordaz A, Favela E, Meneses M, Mendoza G, Loera O. Hyphal morphology modification in the thermal adaptation by the white rot fungus Fomes sp. EUM1. J Basic Microbiol 2011;52:167–174.

9.

Pal M, Calvo AM, Terrón MC, González AE. Solid-state fermentation of sugarcane bagasse with Flammulina velutipes and Trametes versicolor. J Microbiol Biotechnol 1995; 11:541-545.

10. Sánchez A, Ysunza F, Beltrán M, Esqueda M. Cultivo del hongo comestible Pleurotus sobre residuos vitivinícolas y su manejo pos cosecha. [Tesis de Maestría]. Hermosillo, México: Universidad de Sonora; 2005.

11. Peláez A, Meneses M, Miranda A, Ayala M, Crosby M, Loera O et al. Enzimas fibrolíticas producidas por fermentación en estado sólido para mejorar los ensilajes de caña de azúcar. Agrociencia 2011; 45:675-685.

12. O.A.C. Official Methods of Analysis (18th Ed).

Washington D.C.: O.A.C International; 2005.

13. Van Soest PJ, Robertson JP, Lewis BA. Symposium: Carbohydrate methodology, metabolism and nutritional implications in dairy caltle. J Dairy Sci 1991; 74:3583-3597.

14. Noguera RR, Posada SL. Modelación de la cinética de degradación de alimentos para rumiantes. Rev Col Cienc Pec 2007; 20:174182.

15. B e r k e l e y M a d o n n a ( p r o g r a m a d e computadora). Versión 8.0. Berkeley: University of California; 2000.

16. Steel GDR, Torrie HJ, Dickey DA. Principles and procedures of statistics a biometrical approach. 3ra Ed. Michigan, USA: McGraw Hill Companies, Inc; 1997.

17. SAS/STAT® (programa de computadora).

Versión 9.3. SAS Institute Inc; 2013.

18. Valiño EC, Elías A, Torres V, Carrasco T, Albelo N. Mejoramiento de la composición del bagazo de caña de azúcar por la cepa Trichoderma viride M5-2 en un biorreactor de fermentación en estado sólido. Rev Cubana Cienc Agric 2004; 38:145-153.

19. García Y, Ibarra A, Valiño EC, Dustet JC, Oramas A, Albelo N. Estudio de un sistema de fermentación sólida con agitación en la biotransformación del bagazo de caña de azúcar por la cepa Trichoderma viride M5-2.

Rev Cubana Cienc Agric 2002; 36:265-270.

20. Arce O. Producción de extractos de enzimáticos a partir de Formes sp EUM1 y su evaluación en condiciones ruminales. [Tesis de Doctorado].

México: Universidad Autónoma Metropolitana, Unidad Iztapalapa; 2012.

21. Arias GM, Bueno G, Betancourt D, Álvarez I, González AL. Biotransformación de Residuos Lignocelulósicos con Hongos Pleurotus. Rev CENIC Cienc Biol 2005; 36:1-7.

4058

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

22. Akinfemi A, Ogunnwole OA, Lapido MK, Adu OA, Osineye OMES. Enhancement of the nutritive value of maize leaf treated with white-rot fungi: Pleurotus sajorcaju and Pleurotus pulmonarius, and the effects on chemical composition and in vitro digestibility. Prod Agric Technol 2009; 1:106-110.

23. Salcedo M, López J, Flores P. Evaluación de enzimas para la hidrólisis de residuos (hojas y cogollos) de la cosecha caña de azúcar.

Dyna 2010; 78:182-190.

24. Yan H, Son Y, Beauchemin KA. Effects of exogenous enzymes on ruminal fermentation and degradability of alfalfa hay and rice straw.

Asian-Aust J Anim Sci 2011; 24:56-64.

25. Giraldo LA, Carro MD, Ranilla MJ, Tejido ML. Influence of fibrolytic enzymes on in vitro methane production and rumen fermentation of a substrate containing 60% of grass hay. Livestock Research for Rural Development [en línea] 2007 (acceso 15 de noviembre del 2013); 19:Article 185.

URL disponible en: http://www.lrrd.org/ lrrd19/12/gira19185.htm

26. Membrillo I, Sánchez C, Meneses M, Favela E, Loera O. Particle geometry affects differentially substrate composition and enzyme profiles by Pleurotus ostreatus growing on sugar cane bagasse. J Microbiol Biotechnol 2010; 2:1581-1586.

27. Pinos J, González S, Mendoza G, Bárcena R, Cobos M. Efecto de enzimas fibroliticas exógenas en la digestibilidad in vitro de la pared celular de heno de alfalfa (Medicago sativa) o de ballico (Lolium perenne).

Interciencia 2002; 27:28-32.

28. Miranda RLA, Mendoza MGD, Bárcena-Gama JR, González MSS, Ferrara R, Ortega CME et al. Effect of Saccharomyces cerevisiae or Aspergillus oryzae cultures and NDF level on parameters of ruminal fermentation. Anim Feed Sci Technol 1996; 63:289-296.

Rev.MVZ Córdoba 19(2):4059-4071, 2014. ISSN: 0122-0268 ORIGINAL

Effects of dietary antioxidant of tomato extract and lycopene on Carassius auratus and Xiphophorus maculatus Efecto antioxidante de un extracto de jitomate y licopeno en Carassius auratus y Xiphophorus maculatus Cynthia Montoya M,1 IQ, Fernando Vega V,1 Ph.D, Héctor Nolasco S,2* Ph.D, Luis Espinosa C,1 M.Sc, Olimpia Carrillo F,3 Ph.D, Felicitas Olvera U,1 Lic. Biol.

Universidad de Guadalajara. Centro Universitario de la Costa. Laboratorio de Acuicultura Experimental, Av. Universidad No. 203, Puerto Vallarta, Jalisco, México. 2Centro de Investigaciones Biológicas del Noroeste, Laboratorio de Fisiología Comparada, Instituto Politécnico Nacional No. 195, La Paz, B.C.S. México. 3Universidad de La Habana, Grupo de Biotecnología Marina, La Habana, Cuba. *Correspondence: hnolasco04@cibnor.mx 1

Received: March 2013; Accepted: November 2013.

ABSTRACT Objective. Evaluate the effect on tegument pigmentation, survival, growth and antioxidant capacity in diets supplemented with tomato extract and lycopene as additives in experimental feed for Carassius auratus and Xiphophorus maculatus. Materials and methods. The additives were added in different concentrations to a basic diet. We performed beginning and an ending biometrics for 100% of the population in each bioassay. The growth and survival of organisms were evaluated. The antioxidant capacity was analyzed by ABTS assay, both in the tomato extract sample as well as in foods used in different bioassays. The concentration of lycopene was determined in food and liver and muscle samples of fish fed with it. Acquired pigmentation of fish was assessed through photographs analyzed with Adobe Photoshop®. The results were evaluated by analysis of variance, and when differences were found (p<0.05) the means were compared by the Tukey test. Results. No significant effect (p>0.05) on pigmentation and growth of the organisms under the established experimental conditions was obtained. Significant differences in antioxidant capacity (p<0.05) were obtained in foods with added lycopene. Conclusions. The inclusion of lycopene or tomato extract in food for the organisms used is not recommended to improve pigmentation, but further studies are needed to demonstrate antioxidant effect.

Key words: Antioxidants, carotenoids, pigmentation, tomato (Source: CAB).

RESUMEN Objetivo. Evaluar el efecto sobre la coloración de la piel, la sobrevivencia, el crecimiento y la capacidad antioxidante por dietas suplementadas con extracto de jitomate y licopeno como aditivos en la alimentación de Carassius auratus y de Xiphophorus maculatus. Materiales y métodos. Los aditivos se añadieron en diferentes concentraciones a una dieta base. Se realizó una biometría inicial y una final del 100% de la población en cada bioensayo. Se evaluó el crecimiento y supervivencia de los organismos. La capacidad antioxidante se analizó a través del ensayo ABTS, tanto a la muestra

4059

4060

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

de extracto de jitomate como a los alimentos utilizados en diferentes bioensayos. Se determinó la concentración de licopeno a los alimentos y en muestras de hígado y músculo de peces alimentados con ellos. La pigmentación adquirida por los peces se evaluó a través de fotografías analizadas con el programa de Adobe Photoshop®. Los resultados fueron evaluados con análisis de varianza, cuando se encontraron diferencias (p<0.05) las medias fueron comparadas mediante la prueba de Tukey.

Resultados. No se obtuvo un efecto significativo (p>0.05) sobre la pigmentación y el crecimiento de los organismos en estudio bajo las condiciones experimentales establecidas. Se obtuvieron diferencias significativas (p<0.05) en la capacidad antioxidante en los alimentos adicionados con licopeno.

Conclusiones. La inclusión de licopeno o de extracto de jitomate en alimentos para los organismos utilizados no es recomendable con el fin de mejorar la pigmentación, aunque se requieren otros estudios para demostrar su efecto antioxidante.

Palabras clave: Antioxidantes, carotenoides, pigmentación, tomate (Fuente: CAB).

INTRODUCTION

INTRODUCCIÓN

In aquatic products, the color of skin and muscle is one of the main indicators of quality and affects the consumer’s acceptance of the product and the price of the fish; for example, in salmon, color constitutes one of the most important criteria for quality when commercializing the product, in addition to fatty content and texture.

En los productos acuícolas, el color de la piel y del músculo es uno de los principales indicadores de calidad y que afecta la aceptación del consumidor y los precios de los peces; por ejemplo en el salmón el color constituye uno de los criterios de calidad más importantes al momento de la comercialización, junto con el contenido graso y la textura.

C a r o t e n o i d s p l ay s a n i m p o r t a n t r o l e i n pigmentation of the skin and muscle color in fish. As in other animals, fish do not have the capacity to biosynthesize carotenoids, but must modify dietary carotenoids and store them in tegument and other tissues. Cultivated fish do not have access to a diet rich in carotenoids, and therefore it is necessary to add those compounds to their diet (1).

Due to the high cost and possible toxicity of synthetic pigments, the investigation in the use of yeast (2), marine bacteria, green algae (3), and plant extracts (4) as sources of natural pigment to give fish a bright color.

Carotenoids constitute one of the most important pigments in fish, and have a wide variety of functions including protection against adverse illumination, acting as a ProVitamin A, improving immune response, reproduction, growth, and maturity, regulation of chemotaxis in spermatozoids and is also a powerful antioxidants (5).

Lycopene is one of the first carotenoids that appear in the synthetic route, constituting of a molecular base for the synthesis of other carotenoids. Lycopene, which gives tomato its red color, is also a powerful antioxidant, combating oxidative stress and pathologies associated with it (6).

Los carotenoides juegan un papel importante en la pigmentación de la piel y color del músculo de los peces. Al igual que otros animales, los peces no poseen la capacidad de biosintetizar carotenoides, sino que pueden modificar los carotenoides alimentarios y almacenarlos en el tegumento y otros tejidos. Los peces bajo condiciones de cultivo no tienen acceso a una alimentación rica en carotenoides y, por tanto, es necesario agregar estos compuestos en su dieta (1).

Debido al elevado costo y posible toxicidad de los pigmentos sintéticos, se ha fomentado la investigación del uso de levaduras (2), bacterias marinas, algas verdes (3) y extractos de plantas (4) como fuentes de pigmento naturales para lograr una coloración brillante en los peces.

Los carotenoides constituyen uno de los pigmentos más importantes en peces, estos tienen una amplia variedad de funciones incluyendo la protección frente a condiciones de iluminación adversas, la de actuar como provitamina A, la mejora de la respuesta inmune, de la reproducción, el crecimiento, la maduración, la regulación de la quimiotaxis en los espermatozoides y la de constituir potentes antioxidantes (5).

El licopeno es uno de los primeros carotenoides que aparecen en la ruta sintética, constituyendo la base molecular para la síntesis de otros carotenoides. El licopeno, al cual el jitomate debe su tonalidad roja, es además un poderoso antioxidante, que combate el estrés oxidativo y las patologías asociadas a este (6).

Montoya - Effects of dietary antioxidant of tomato extract and lycopene Carotenoids act as antioxidants due to their capacity to interact with oxygen reactive species, significant among them lycopene. Due to that, ingesting lycopene as an antioxidant in fish could help trap active oxygen species and reduce oxidative stress and the danger of oxidation of cellular components (lipids, proteins and DNA) (7); therefore, many functional foods are currently designed with the objective of providing an elevated amount of antioxidants and reducing the risk of diseases associated with oxidative stress (8).

This investigation was carried out to determine if the use of lycopene and tomato extract in diet could have a double function, as pigmentation as well as an antioxidant, affecting growth and survival of goldfish (C. auratus) and “platy” fishes (X. maculatus).

MATERIALS AND METHODS Experiment site. The experiments took place in the Laboratorio de Acuicultura Experimental of the Centro Universitario de la Costa (CUCOSTA), belongs to the Universidad de Guadalajara, in Puerto Vallarta, Jalisco, Mexico. The cultivation water was taken from the municipal system, and left to sit (7 days) to eliminate the excess of chlorine.

4061

Los carotenoides actúan como antioxidantes debido a su capacidad de interactuar con las especies reactivas de oxígeno, destacando entre todos ellos el licopeno. Por lo anterior, la ingesta de licopeno como antioxidante en los peces pudiera ayudar en atrapar especies activas de oxígeno y reducir el estrés oxidativo y el peligro de oxidación de los componentes celulares (lípidos, proteínas y ADN) (7); así, muchos alimentos funcionales son diseñados actualmente con el objetivo de proporcionar una ingesta elevada de antioxidantes y reducir el riesgo de enfermedades asociadas al estrés oxidativo (8).

La presente investigación se llevó a cabo para determinar si el uso del licopeno y el extracto de jitomate en las dietas podría tener una doble función, como pigmento y antioxidante, influyendo en el crecimiento y sobrevivencia de carpas doradas (C. auratus) y peces “platy” (X. maculatus).

MATERIALES Y MÉTODOS Sitio experimental. Los experimentos se llevaron a cabo en el Laboratorio de Acuicultura Experimental del Centro Universitario de la Costa (CUCOSTA), perteneciente a la Universidad de Guadalajara, en Puerto Vallarta, Jalisco, México. El agua de cultivo fue obtenida del sistema municipal, previamente reposada (7 días) para eliminar el exceso de cloro.

Organisms and experimental units (EU).

The fish used for the experiment were adult goldfish (Carassius auratus) and “platy” fish (Xiphophorus maculatus) from the installations of the Laboratorio de Acuicultura Experimental.

In the EU the pH parameters were taken (7-8) (potentiometer HANNA Instruments®, Distrito Federal, Mexico), dissolved oxygen (7.4±0.4 mg/L) and temperature (25.1±2°C) (oximeter YSI®, Yellow Springs, OH 45387 USA) three times a week. The EU were kept well aired. Leftovers of food and fecal matter were cleaned daily. Sex determination was not performed.

Organismos y unidades experimentales (UE).

Como peces experimentales se utilizaron ejemplares adultos de carpas doradas (Carassius auratus) y peces “platy” (Xiphophorus maculatus) de las instalaciones del Laboratorio de Acuicultura Experimental. En las UE se tomaron parámetros de pH (7-8) (potenciómetro HANNA Instruments®, Distrito Federal, México), oxígeno disuelto (7.4±0.4 mg/L) y temperatura (25.1±2°C) (oxímetro YSI®, Yellow Springs, OH 45387 USA) tres veces por semana. Las UE se mantuvieron con aireación constante. Los restos de comida y los residuos fecales fueron limpiados diariamente. La determinación de sexo no fue realizada.

Bioassays:

Bioensayos:

Bioassay with tomato extract. Seventy eight goldfish (25.9±6.8 g weight and 117.2±13.5 mm length) were distributed randomly in experimental units consisting of 400 L. circular tanks, with flow of filtered water in a filtration system with Aquadyne® spheres and a sterilizer ultraviolet light SmartUV®. Three organisms in each one of the 26 EU were used.

Bioensayo con extracto de jitomate. Setenta y ocho carpas doradas (25.9±6.8 g de peso y 117.2±13.5 mm de longitud) fueron distribuidas al azar en unidades experimentales que constaban de tanques circulares de 400 L., con flujo de agua filtrada con un sistema de filtración de esferas Aquadyne® y un esterilizador de luz ultravioleta SmartUV®. Fueron utilizados 3 organismos en cada una de las 26 UE.

Bioassay with lycopene in C. auratus. Thirty six goldfish (37.8±10.8 g weight and 134.0±12.3 mm length) were distributed randomly in EU as

Bioensayo con licopeno en C. auratus. Treinta y seis carpas doradas (37.8±10.8 g de peso y 134.0±12.3 mm de longitud) fueron distribuidos

4062

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

described above. One was placed in each of the 36 EU.

al azar en UE iguales a las descritas previamente.

Se colocó un organismo en cada una de las 36 UE.

Bioassay with lycopene in X. maculatus.

Twenty three platys fish (0.3±0.1 g weight and 26.5±0.5 mm length) were distributed randomly in the EU, plastic boxes with 5 L. capacity.

Supplementary air was supplied with an electric Boyu® aerator; every third day 100% of the water was changed to maintain clean water. A fish was placed in each one of the 23 EU.

Bioensayo con licopeno en X. maculatus.

Veintitrés peces platys (0.3±0.1 g de peso y 26.5±0.5 mm de longitud) fueron distribuidos al azar en UE constituidas por una caja de material plástico con una capacidad de 5 L. Se suministró aireación suplementaria con un aireador eléctrico marca Boyu®, se realizó recambio del 100% de agua cada tercer día para mantener el agua clara.

Se colocó un pez en cada una de las 23 UE.

Experimental diets and feeding. In all of the feeding tested in this study grenetina was used at 3% (w/w) as a binding agent to guarantee the adequate adhesion of the additives.

Bioassay with tomato extract. Goldfish were fed with Nutripec 2506 AP tilapia feed, Purina® brand, extruded, 3.5 mm length, and 25% protein. Tomato extract was added to the commercial feed (Lycopersicum esculentum) LICOPENE-100 made by Fórmulas Herbolarias Erick Estrada® in concentrations of 0, 1, 3 and 6% (w/w). The feed ration was calculated according to 4% of the initial biomass distributed in two feedings daily (9:00 and 14:00 h)for 45 days.

Bioassay with lycopene in C. auratus. The same feeding base was used as in the previous bioassay, adding lycopene made by Essential Nutrition® (50 mg of lycopene in, 75 mg of wheat germ per capsule) in concentrations of 0, 0.1, 0.3 and 0.6% (w/w). The feed ration was calculated according to 4% of the initial biomass distributed in two daily feedings (9:00 and 14:00 h)for 30 days.

Bioassay with lycopene in X. maculatus.

Platys fish were fed with Nutripec 4510 H tilapia feed, Purina® brand, at spawning stage with 45% protein. The same commercial lycopene in the same concentration was added as described. Feeding was done ad libitum once a day (9:00 h) for 60 days.

Experimental design. An initial and final biometry of 100% of the population was carried out, where the fish were weighed, measured and photographed in order to perceive the effect of the additives on the pigmentation and the parameters: survival, % weight increase, % length increase and specific weigh growth increase (9).

For bioassays with C. auratus, immediately after the final biometry 4 fish of each treatment were randomly selected and placed in a recipient with room temperature water. For the biotic management of stress in the fish, periodically

Dietas experimentales y alimentación. En todos los alimentos probados en este estudio se utilizó grenetina al 3% (p/p) como aglutinante para garantizar la adhesión adecuada de los aditivos.

Bioensayo con extracto de jitomate. Las carpas doradas fueron alimentadas con un alimento para tilapia Nutripec 2506 AP, marca Purina®, extruido, de 3.5 mm de longitud, y con 25% de proteína. El alimento comercial fue adicionado con extracto de jitomate (Lycopersicum esculentum) LICOPENO-100 elaborado por Fórmulas Herbolarias Erick Estrada® a concentraciones de 0, 1, 3 y 6% (p/p). La ración de alimento se calculó de acuerdo con el 4% de la biomasa inicial repartido en dos tomas diarias (9:00 y 14:00 h), durante 45 días.

Bioensayo con licopeno en C. auratus. Se utilizó el mismo alimento base del bioensayo anterior, se le adicionó LICOPENO elaborado por Essential Nutrition® (50 mg de licopeno en 75 mg de aceite de gérmen de trigo por cápsula) a concentraciones de 0, 0.1, 0.3 y 0.6% (p/p). La ración de alimento se calculó de acuerdo con el 4% de la biomasa inicial repartido en dos tomas diarias (9:00 y 14:00 h), durante 30 días.

Bioensayo con licopeno en X. maculatus. Los peces platys fueron alimentados con alimento para tilapia Nutripec 4510 H, marca Purina®, etapa alevinaje con 45% de proteína. Se le adicionó el mismo licopeno comercial ya descrito en las mismas concentraciones. La alimentación se llevó a cabo ad libitum una vez al día (9:00 h), durante 60 días.

Diseño experimental. Se realizó una biometría inicial y una final del 100% de la población, en donde los organismos fueron pesados, medidos y fotografiados. Con el fin de conocer el efecto de los aditivos sobre la pigmentación y en los parámetros: sobrevivencia, % de incremento en peso, % de incremento en longitud y tasa de crecimiento específico de peso (9).

Para los bioensayos en C. auratus, inmediatamente después de las biometrías finales, se seleccionaron al azar 4 peces de cada tratamiento y se colocaron

Montoya - Effects of dietary antioxidant of tomato extract and lycopene (every 10 minutes) part of the water was substituted with cold water until the fish became lethargic by gradual hypothermia and were finally transferred to a freezer to finish killing them (-20°C, 16h). In this way the fish showed no evident stress behavior. The fish in the bioassay with tomato extract were cooked, submerged in distilled water for 3 minutes in a microwave, to boiling point; digital photographs were taken before and after cooking to evaluate pigmentation. Fish in the bioassay with lycopene were used to obtain samples of muscle and liver to determine the content of lycopene.

Determination of antioxidant capacity (CA).

The feed in the bioassays of C. auratus were performed by the decoloration assay of the ABTS radical, according to the procedure described

by Kuskoski et al (10). The initial resulting absorption of the radical ion ABTS was adjusted between 0.72-0.74 to a wave length of 734 nm (A734). After adding 50 μL of the extract of the sample to 1000 μL of the ABTS•+solution the A734 was brought to 37°C for 6 minutes. The results are expressed in μmol equivalents to Trolox/g.

Lycopene determination. The bioassay with lycopene in C. auratus was done according to the method described by Fish et al (11) in the feed, as well as in the liver and muscles of the fish.

Pigmentation evaluation. The analysis of photographs was done with Photoshop ® for specific regions of the body, according to the method described by Yasir et al (12). In C. auratus the cephalic, toracic and caudal fin region was analyzed; in X. maculatus the body, peduncle caudal and caudal fin. Values were obtained with the HSB model (Hue, Saturation and Brightness) to obtain possible changes in coloring.

Statistical analysis of data. The results obtained in this study were expressed as a measure of the values with their corresponding standard deviations. The results presented as percentages were transformed with a square root function of the Arcsine (13). Data from one experiment was statistically compared using the one way variation analysis (ANOVA) after normality tests (Kolmogorov-Smirnov; α= 0.05) and homocedasticidad (Bartlett; α= 0.05). The differences were considered statistically significant when p<0.05. The differences being statistically significant from the ANOVA, the differences between measurements were compared by means of the multiple measurements comparation test of Tukey. The data was analyzed with the SigmaStat V 3.1 statistics program (2004) (9).

4063

en un recipiente con agua a temperatura ambiente.

Para un manejo biótico del estrés de los organismos, periódicamente (cada 10 minutos) se sustituyó parte del agua por agua fría hasta que los organismos se aletargaron por la hipotermia gradual, finalmente se transfirieron a un congelador para terminar el sacrificio de los mismos (-20°C, 16h). De esta manera los peces no presentaron un comportamiento de estrés evidente. Los peces del bioensayo con extracto de jitomate se sometieron a un proceso de cocción, sumergidos en agua destilada durante 3 minutos en horno de microondas, alcanzando el punto de ebullición; se les tomaron fotografías digitales antes y después de la cocción para evaluar la pigmentación.

Los peces del bioensayo con licopeno se utilizaron para obtener muestras de músculo e hígado para determinar el contenido de licopeno.

Determinación de capacidad antioxidante (CA). En los alimentos de los bioensayos en C. auratus se realizó por el ensayo de decoloración del radical ABTS, según el procedimiento descrito por Kuskoski et al (10). La absorbancia inicial del ión radical ABTS resultante fue ajustada entre 0.72-0.74 a una longitud de onda de 734 nm (A734). Tras añadir 50 μL del extracto de la muestra a 1000 μL de la solución ABTS•+ se determinó la A734 a 37°C durante 6 minutos. Los resultados se expresan en μmol equivalentes de Trolox/g.

Determinación de licopeno. Para el bioensayo con licopeno en C. auratus se realizó según el método descrito por Fish et al (11) en los alimentos, así como en el hígado y músculo de los peces.

Evaluación de la pigmentación. Se realizó el análisis de las fotografías con el programa Photoshop® en regiones específicas del cuerpo, según el método descrito por Yasir et al (12). En C. auratus se analizó la región cefálica, torácica y aleta caudal; en X. maculatus se analizó el cuerpo, pedúnculo caudal y aleta caudal. Se utilizaron los valores obtenidos por el modelo HSB (por sus siglas en inglés: Hue [matiz], Saturation [cantidad de color] y Brightness [brillo]) para obtener los posibles cambios en la coloración.

Análisis estadístico de los datos. Los resultados obtenidos en este estudio se expresaron como media de los valores con sus correspondientes desviaciones estándar. Los resultados que se presentaron como porcentajes fueron transformados con la función raíz cuadrada del Arcoseno (13). Los datos de un mismo experimento se compararon estadísticamente utilizando el análisis de varianza de una vía (ANOVA) previas pruebas de normalidad (Kolmogorov-Smirnov; α= 0.05) y homocedasticidad (Bartlett; α= 0.05).

4064

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

RESULTS The level of inclusion of tomato extract and comercial lycopene did not influence the growth of C. auratus (Table 1), since no significant differences were found (p>0.05) among the treatments, including the control group, in each one of the bioassays.

Table 1. Growth of fish in bioassays with C. auratus.

Bioassay with tomato extract

Control

Survival (%) Increase in weight (%) Increase in size (%) TCE

94.4 ±0.5 56.1 ±12.4 11.7 ±3.1 1.0 ±0.2

1% (p/p) 100 ±0.0 42.3 ±19.2 10.6 ±2.3 0.8 ±0.3

3% (p/p) 100 ±0.0 37.5 ±7.3 9.9 ±1.9 0.7 ±0.1

6% (p/p) 95.2 ±0.7 45.2 ±15.3 12.4 ±3.8 0.8 ±0.2

0.1% (p/p) 100 ±0.0 23.9 ±21.4 6.5 ±3.5 0.7 ±0.5

0.3% (p/p) 100 ±0.0 21.6 ±12.1 8.7 ±3.8 0.6 ±0.3

0.6% (p/p) 100 ±0.0 24.1 ±12.3 9.2 ±4.2 0.7 ±0.3

Bioassay with lycopene Control

Survival (%) Increase in weight (%) Increase in size (%) TCE

100 ±0.0 22.2 ±13.0 7.9 ±5.8 0.6 ±0.4

In the ABTS analysis of the C. auratus bioassays, no significant differences could be found (p>0.05) between the control and the feed with the tomato extract, but significant differences were found (p<0.05) in the feed with added lycopene, the control had lessened antioxidant capacity than the experimental feed (Table 2).

In determining the lycopene in experimental feed and the bioassay fish with lycopene in C. auratus (Table 3) significant differences were found (p<0.05), fish fed with the 0.6% treatment (w/w) had a greater capacity of accumulated lycopene in the liver.

The results of the analysis of the pigmentation were found in figures 1, 2 and 3. No significant effects (p>0.05) were found in the increase in pigmentation by means of the HSB analysis in Table 3. Lycopene content in experimental feed, as well as in liver and muscle of fish fed with it.

Lycopene Content Treatment

(μg lycopene/kg) Feed

Liver

Muscle

Control

1.9±0.2

c

3.1±0.9

b

0.1% (w/w)

2.6±0.1

b

3.9±0.6

b

6.8±2.3

ab

0.3% (w/w)

2.9±02

ab

3.1±1.1

b

7.8±1.1

ab

0.6% (w/w)

3.2±0.1

a

10.0±1.6

a

4.4±1.0

b

10.1±2.3

a

Different superscripts per bioassay show statistically significant differences between treatments (p<0.05).

Las diferencias fueron consideradas estadísticamente significativas cuando p<0.05. Detectadas las diferencias estadísticamente significativas con el ANOVA, las diferencias entre medias fueron comparadas mediante el test de comparación múltiple de medias de Tukey. Los datos se analizaron con el programa estadístico SigmaStat V 3.1 (2004) (9).

RESULTADOS El nivel de inclusión de extracto de jitomate y de licopeno comercial no influyó en el crecimiento de los peces C. auratus (Tabla 1), ya que no se encontraron diferencias significativas (p>0.05) entre los tratamientos, incluyendo el control, de cada uno de los bioensayos.

En el análisis ABTS en los bioensayos en C. auratus, no se obtuvieron diferencias significativas (p>0.05) entre el control y los alimentos adicionados con el extracto de jitomate, pero si se obtuvieron diferencias significativas (p<0.05) en los alimentos adicionados con licopeno, obteniendo el control menor capacidad antioxidante que los alimentos experimentales (Tabla 2).

Table 2. Antioxidant activity in administered diets, as well as in the tomato extract used.

Sample

CA (µM of Trolox/g)

Tomato extract

Bioassay with tomato extract

Bioassay with lycopene

11.0 ± 0.2 Control

9.4 ± 0.2

a

1% (w/w)

8.7 ± 0.2

a

3% (w/w)

9.0 ± 0.1

a

6% (w/w)

9.2 ± 0.3

a

Control

9.4 ± 0.2

c

0.1% (w/w)

17.8 ± 0.1

b

0.3% (w/w)

19.8 ± 0.3

a

0.6% (w/w)

19.4 ± 0.6

a

Different superscripts per bioassay show statistically significant differences (p<0.05).

En la determinación de licopeno en los alimentos experimentales y de los peces del bioensayo con licopeno en C. auratus (Tabla 3) se encontraron diferencias significativas (p<0.05), los peces alimentados con el tratamiento de 0.6% (p/p) tuvieron mayor cantidad de licopeno acumulado en el hígado.

Los resultados del análisis de la pigmentación se muestran en las figuras 1, 2 y 3. No se encontró efecto significativo (p>0.05) en el incremento de la pigmentación, a través del análisis HSB, en ninguna de las regiones analizadas de los peces sometidos a los alimentos experimentales en ninguno de los tres bioensayos.

4065

Montoya - Effects of dietary antioxidant of tomato extract and lycopene Cephalic region 45

45

40

Degrees

35

a

30

a

a

a

Caudal fin

Thoracic region

40

Hue a

a

a

35

a

45 40 35

30

30

25

25

25

20

20

20

15

15

15

10

10

10

5

5

0

Control

0,1%

0,3%

0,6%

0

a

a

a

a

Control

0,1%

0,3%

0,6%

a

a

5 Control

0,1%

0,3%

0,6%

0

%

Saturation 100 90 80 70 60 50 40 30 20 10 0

a

a

a

a

90 80

a

a

a

a

0,1%

0,3%

0,6%

70 60 50 40 30 20 10 Control

0,1%

0,3%

0,6%

0

Control

100 90 80 70 60 50 40 30 20 10 0

a

a

Control

0,1%

0,3%

0,6%

a

a

a

a

Control

0,1%

0,3%

0,6%

%

Brightness 100 90 80 70 60 50 40 30 20 10 0

a

a

a

0,3%

0,6%

a

Control

0,1%

100 90 80 70 60 50 40 30 20 10 0

a

Control

a

a

0,1%

0,3%

a

0,6%

100 90 80 70 60 50 40 30 20 10 0

Treatments

Figure 1. Results of color analysis (HSB) in bioassay with tomato extract in C. auratus.

Cephalic region 40

40

Degrees

35

%

a

a

a

35

Hue a

a

a

a

40 35

30

30

25

25

25

20

20

20

15

15

15

10

10

10

5

5

30

0

%

a

Caudal fin

Thoracic region

100 90 80 70 60 50 40 30 20 10 0

100 90 80 70 60 50 40 30 20 10 0

0 Control

a

Control

a

Control

1%

a

1%

a

1%

3%

a

3%

a

3%

6%

a

6%

a

6%

100 90 80 70 60 50 40 30 20 10 0

100 90 80 70 60 50 40 30 20 10 0

a

a

a

a

Control

1%

3%

6%

a

a

a

a

Control

1%

3%

6%

5 Control

1%

3%

6%

Saturation

a

Control

a

1%

a

3%

a

6%

Brightness

0

100 90 80 70 60 50 40 30 20 10 0

90 80

a

a

a

a

70

a

a

a

a

Control

1%

3%

6%

60 50 40 30 20 10

Control

1%

3%

6%

0

Treatments

Figure 2. Results of color analysis (HSB) in bioassay with lycopene in C. auratus.

4066

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

Degrees

Cephalic region 40

30

30

20

40

Hue

a

a

a

T1

T2

T3

20

10

0

TC

T1

T2

101

101

T3

0

TC

T1

T2

Saturation

100

%

a

a a

a

99

TC

a

a

a

a

99

a

a

T3

101

100

100

a

a

a

10

a

a

a

a

a

30

20

a

10

0

Caudal fin

Thoracic region

40

a

a

99

98

98

98

T1

T2

T3

T1

TC

100

T2

T3

97

TC

100

T1

Brightness

a

90

a

%

a a

a

T1

TC

a 90

80

70

T3

a

a

a

a

90

T2

100

T2

T3

a

a

80

80

70

TC

T1

T2

T3

70

TC

T1

T2

T3

TC

Treatments

Figure 3. Results of color analysis (HSB) in bioassay with lycopene in X. maculatus.

any of the regions analyzed of the fish fed the experimental feed in any of the three bioassays.

The red color of crustaceans is produced by carotenoid of the carotene-protein when it is denaturalized by cooking (14) so that this complex can affect the capacity to absorb light of the carotenoide molecule.

The analysis results of the pigmentation of raw and cooked fish in the bioassay with tomato extract in C. auratus is shown in figure 4. Significant differences (p>0.05) in the hue between treatments of the cooked fish are shown, but all treatments are the same as the control group, and therefore it could not be demonstrated that a connection exists between the supplied lycopene in diets with proteins in the tegument of the fish.

Hue

Aac

Aa

Ba

80 Aa

Aac

30

Aa

Abc

Aa Ab

Ab

60

Aab Aab

Abc

Aa

Aa

Abc

60 40

10

20

20

0

0

Control

1%

3%

6%

Control

1%

3%

6%

Crude Cooked

80

40

20

Brightness

100

%

40

Aa

%

Degrees

50

Los resultados del análisis de la pigmentación de los peces crudos y cocidos del bioensayo con extracto de jitomate en C. auratus se muestran en la figura 4. Se encontraron diferencias significativas (p>0.05) en el matiz entre tratamientos dentro de los peces cocidos, pero todos los tratamientos son iguales al control, por lo que no se pudo demostrar que exista una asociación del licopeno suministrado en las dietas con las proteínas en el tegumento de los peces.

Saturation

100

60

El color rojo de los crustáceos se produce por la liberación del carotenoide del complejo carotenoproteínas cuando es desnaturalizado por el calor de cocción (14), por lo que este complejo puede afectar la capacidad de absorción de luz de la molécula del carotenoide.

0

Aa

Control

Aa Aa

Aa Aa

Aa Aa

1%

3%

6%

Treatments

Figure 4. Results of color analysis (HSB) of the bioassay with tomato extract in fish subject to cooking. The vertical lines in each bar represent the standard deviation for each treatment. Different superscripts in capitals indicate statistically significant differences (p<0.05) between the presentation (raw and cooked) within each treatment. Superscripts in lower case indicate statistically significant differences (p<0.05) between treatment within each presentation(raw and cooked).

Montoya - Effects of dietary antioxidant of tomato extract and lycopene

4067

DISCUSSION

DISCUSIÓN

This study confirms that carotenoids do not play an important role in the growth of goldfish.

Although these results agree with some studies, for example, Xu et al (2) reported that adding astaxanthin to red yeast (Xanthophyllomyces dendrorhous) did not have any effect on the weight gain in goldfish. Gouveia et al (15) performed two assays in the ornamental species of the goldfish (Carassius auratus) being fed a dietary supplement of carotenoids of the biomass of microalgae sweet water [Chlorella vulgaris, Haematococcus pluvialis, and cianobacteria Arthrospira maxima (Spirulina)], using a diet containing synthetic astaxanthin and a control diet, without coloring, for comparison, and it was found that feeding growth and efficiency were not significantly different among the groups with the different dietary treatments. The results of Yeşilayer et al (16) were similar, where young goldfish were fed five different diets: astaxanthin, canthaxanthin, Gammarus spp., paprika and a control group without supplement; it was found that growth and the feeding conversion index were not different from the control group in the groups fed with carotenoids.

El presente trabajo confirma que los carotenoides no juegan un papel importante en el crecimiento de las carpas doradas. Aunque estos resultados están de acuerdo con algunos estudios realizados, por ejemplo, Xu et al (2) reportaron que la adición de astaxantina de la levadura roja (Xanthophyllomyces dendrorhous) no tuvo ningún efecto sobre la ganancia de peso en carpas doradas. Gouveia et al (15) realizaron dos ensayos en las especies ornamentales entre ellos la carpa dorada (Carassius auratus) con la alimentación de un suplemento dietético de carotenoides de la biomasa de microalgas de agua dulce [Chlorella vulgaris, Haematococcus pluvialis, y cianobacteria Arthrospira maxima (Spirulina)], utilizando una dieta que contiene astaxantina sintética y una dieta control, sin colorante, para la comparación y se encontró que el crecimiento y la eficiencia alimenticia no fueron significativamente diferentes entre los grupos administrados por los diferentes tratamientos dietéticos. Similar a los resultados de Yeşilayer et al (16) en donde juveniles de carpas doradas fueron alimentadas con cinco diferentes dietas: astaxantina, cantaxantina, Gammarus spp., paprika y un control sin suplemento; encontraron que el crecimiento y el índice de conversión alimenticia no difirió del control con los grupos alimentados con carotenoides.

Not all studies showed similar results: Kiriratnikom et al (3) reported that spirulina induces growth and color of goldfish; they found greater growth with a diet of 3% (p/p) of dried spirulina. Anhilan et al (17) in C. auratus (linnaeus) fed with botanical additives such as coriander, mint and amaranth as a source of carotenoids obtained better weight gain using amaranth at 1% (w/w), followed by fish fed by coriander at 3% (w/w).

Wallat et al (18) used six different commercial diets supplemented with different carotenoids and showed they have a variable effect on skin color and the growth of juveniles of Oranda of C. auratus. Moreira et al (19) reported that in feeding treatments with Artemia and comercial feed in flakes in a circulation system and another with a static system, they found significant differences in growth (weight and size) in animals fed with Artemia (at 60 days). Also, they mentioned that the animals that received Artemia had improved pigmentation, although they did not offer any data on this last point.

The antioxidant capacity of experimental feed determined by the ABTS method has shown its increase in feed with added lycopene, but it could not be concluded that tomato extract does not increase the antioxidant capacity in the diets, since due to the complexity of the oxidation processes it is obvious that no one method of testing exists that completely reflects the antioxidant profile of the studied samples (20).

No todos los estudios obtuvieron resultados similares: Kiriratnikom et al (3) reportaron que la espirulina induce el crecimiento y el color de la carpa dorada; encontrando el mayor crecimiento con la dieta introducida al 3% (p/p) de espirulina seca. Anhilan et al (17) en C. auratus (linnaeus) alimentados con aditivos botánico como cilantro, menta y amaranto como fuente de carotenoides, obteniendo la mayor ganancia de peso utilizando amaranto al 1% (p/p), seguido por los peces alimentados con cilantro al 3% (p/p). Wallat et al (18) utilizaron seis dietas comerciales diferentes suplementadas con diferentes carotenoides y demostraron que tienen un efecto muy variable en la coloración de la piel y el crecimiento de juveniles de la variedad de Oranda de C. auratus.

Moreira et al (19) reportan que bajo tratamientos alimenticios con Artemia y alimento comercial en hojuelas y bajo un sistema de recirculación y otro estático, encontraron diferencias significativas en crecimiento (peso y talla) en los animales alimentados con Artemia (a los 60 días). También, mencionan que los organismos que recibieron Artemia incrementaron su pigmentación, aunque no ofrecen dato alguno sobre esto último.

La capacidad antioxidante de los alimentos experimentales determinada por el método ABTS

4068

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

Additionally, the antioxidant capacity of a mix is not just the sum of the antioxidant capacities of each one of its components; it also depends on the microenvironment in which it is found; the compounds interact with each other, which can produce synergic or inhibitor effects (10).

Consideration should be given to the fact that the majority of the studies done that have been referred to consider the antioxidant activity of the additives or ingredients used, but generally do not evaluate the antioxidant effect of the diet as a whole.

Anhilan et al (17) comment that some investigators found that the development of color seems to depend on the quantity and nature of the carotenoid present in the source of the pigment/ingredient. This is confirmed by the present investigation, since no improvement was found in color when lycopene was used as a carotenoid, contrary to what was found in the majority of the studies that have evaluated the pigmentation of C. auratus with different natural sources of carotenoids and have shown to be an alternative to increase the pigmentation in these fish. In their investigation, Yanar et al (4) found that the addition of 15% alfalfa to the diet can guarantee good pigmentation and acceptable growth when used in goldfish.

Also, Gouveia et al (15) reported that microalgae (Chlorella vulgaris, Haematococcus pluvialis and Arthrospira máxima(Spirulina)) added as carotenoid to the diet increased the content of total carotenoids in the skin of goldfish and that good color was obtained using C. vulgaris and the best red color was obtained using H. pluvialis.

Kiriratnikom et al (3) reported that the results of their investigation showed the positive effect of dried spirulina in the pigmentation of goldfish.

Xu et al (2), when evaluating the addition of astaxanthin to red yeast (Xanthophyllomyces dendrorhous) in the diet of C. auratus, obtained an improvement in color; carotenoid deposits in fish fed with supplemented diets was significantly increased after the 15 th day of feeding in comparison with fish fed with a diet without astaxanthin, but the effect on the color of the fish was evident on the 60th day. Sinha et al (21) made a similar observation in their study with Hibiscus rosasinensis petals, where they showed that it is a powerful natural source of carotenoids in C. auratus that improves their color as well as accelerates gonad development and growth.

Anhilan et al (17) confirmed that the percentage of color development was greater in fish fed with coriander than with amaranth and mint; this could be directly attributed to the higher level of carotenoid content. Orbe-Rogel (22) proved

ha puesto de manifiesto el incremento de la misma en los alimentos adicionados con licopeno, pero no se podría concluir que el extracto de jitomate no incrementa la capacidad antioxidante en las dietas, ya que debido a la complejidad de los procesos de oxidación es obvio que no existe un único método de prueba que refleje de forma completa el perfil antioxidante de la muestra estudiada (20). Además, la capacidad antioxidante de una mezcla no viene dada solo por la suma de las capacidades antioxidantes de cada uno de sus componentes, también, depende del microam­biente en que se encuentra; los compuestos interactúan entre sí pudiendo producirse efectos sinérgicos o inhibitorios (10).

Debe considerarse que la mayoría de los estudios realizados, referidos previamente, consideran la actividad antioxidante de los aditivos o ingredientes utilizados, pero generalmente no evalúan el poder antioxidante de la dieta completa.

Anhilan et al (17) comentan que algunos investigadores encontraron que el desarrollo del color pareciera depender de la cantidad y de la naturaleza del carotenoide presente en la fuente de pigmento/ingrediente. Esto es confirmado en la presente investigación al no haber encontrado mejoras en la coloración al utilizar como carotenoide el licopeno, caso contrario a lo que se confirmó en la mayoría de los trabajos que han evaluado la pigmentación de C. auratus, con diferentes fuentes naturales de carotenoides y han demostrado ser una alternativa para incrementar la pigmentación de estos peces.

Yanar et al (4) en su investigación obtuvieron que la adición del 15% de alfalfa en la dieta puede garantizar una buena pigmentación y crecimiento aceptable en su utilización en carpa dorada.

También Gouveia et al (15) reportaron que añadir microalgas (Chlorella vulgaris, Haematococcus pluvialis y Arthrospira máxima (Espirulina)) como carotenoides en la dieta, se aumenta el contenido de carotenoides totales en la piel de carpa dorada y que el mejor color obtenido se logró utilizando C. vulgaris y el máximo color rojo cuando se utilizó H. pluvialis. Kiriratnikom et al (3) reportaron que los resultados de su investigación mostraron un efecto positivo de espirulina seca en la pigmentación de carpa dorada. Xu et al (2) al evaluar la adición de astaxantina de la levadura roja (Xanthophyllomyces dendrorhous) en las dietas de C. auratus, obtuvieron una mejora de color; la deposición de carotenoides en los peces alimentados con las dietas suplementadas se incrementó significativamente después del día 15 de alimentación en comparación con la de los peces alimentados con la dieta sin astaxantina, pero el efecto sobre el color en los peces fue

Montoya - Effects of dietary antioxidant of tomato extract and lycopene that adding carotenoids in the flower of petals of cempaxúchil presented effects in the growth rate and improved the pigmentation of the skin, although the high concentrations have a negative effect on the pigmentation of goldfish. Yeşilayer et al (16) demonstrated that paprika was as effective as a source of carotenoids as synthetic cantaxanthin and astaxanthin. The results indicated that the C. auratus fish were capable of using in an efficient manner the capsanthin paprika. Pérez-Escalante (23) observed that the food added with the pigments of ground Hibiscus flower can be used as an alternative source to the natural pigments to color C. auratus, as well as improving their growth.

Few studies have been done to evaluate lycopene as a compound with a pigmenting capacity in fish.

Chatzifotis et al (1) reported that lycopene did not have significant effects on coloring the skin of red porgy (Pagrus pagrus); these results are in agreement with this study, where no significant effect on the pigmentation of C. auratus and X. maculates fish were found.

Carotenoids are synthesized by photosynthetic and carotenogenic organisms, the conversion of different carotenoids are catalyzed by enzymes (24,25). The primary red or carotenoid pigment in the skin of goldfish was identified as astaxanthin. Contradictory reports in literature exist about the capacity of goldfish to metabolize other carotenoid pigments in astaxanthin. Wallat et al (18), citing Hata et al (26), reported on the poor conversión of lutein and β-caroteno to astaxanth in goldfish, which is capable of metabolizing equinone to cantaxanthin but can barely metabolize β-carotene to equinone, suggesting that these results show the lack of enzyme in the first stage (Figure 5), which should be investigated in future studies.

Concerning lycopene, no investigation was found that could be used as a base to suggest the reason why fish used in this study could not incorporate pigments in their tegument from the lycopene.

With these results, it is proposed that fish show the capacity to absorb lycopene in the enterocytes of the intestinal wall, since it was found accumulated in muscles and liver in the treatment where they were fed at an inclusion level of 0.6%. This is congruent since the liver is the principal metabolic organ and excreter of carotenoids (27); however, it seems that this storage does not imply that the metabolisms of fish can achieved astaxanthin. The carotenoids were not found as complex carotene-protein in the tegument of the fish, as happens in

4069

evidente hasta el día 60. Observación similar hizo Sinha et al (21) en su estudio con pétalos de Hibiscus rosasinensis, donde mostraron que es una potente fuente natural de carotenoides en C. auratus para mejorar su color, asi como también para acelerar su desarrollo gonadal y su crecimiento.

Anhilan et al (17) confirmaron que el porcentaje de desarrollo del color fue mayor en los peces alimentados con cilantro, que con el amaranto y la menta; esto se podría atribuir directamente a su nivel más alto de contenido de carotenoides.

Orbe-Rogel (22) comprobó que la adición de carotenoides de la harina de pétalos de cempaxúchil presentó efectos en la tasa de crecimiento y potenció la pigmentación de la piel, aunque a concentraciones altas tiene un efecto negativo en la pigmentación de las carpas doradas. Yeşilayer et al (16) demostraron que la paprika fue tan eficaz como una fuente de carotenoides de cantaxantina y astaxantina sintética. Los resultados indicaron que los peces C. auratus fueron capaces de utilizar de manera eficiente la capsantina de la paprika.

Pérez-Escalante (23) observó que los alimentos adicionados con los pigmentos de la harina de la flor de Jamaica, puede ser utilizada como fuente alternativa de los pigmentos naturales para proporcionar color a C. auratus, mejorando además su crecimiento.

A saber pocos estudios se han realizado evaluando al licopeno como compuesto con capacidad pigmentante en peces. Chatzifotis et al (1) reportan que el licopeno no tuvo ningún efecto significativo sobre la coloración de la piel del besugo (Pagrus pagrus); estos resultados concuerdan con los de este estudio donde no se obtuvo ningún efecto significativo en la pigmentación de los peces C. auratus y X. maculatus.

Los carotenoides son sintetizados por organismos fotosintéticos y carotenogénicos, las conversiones de los diferentes carotenoides son catalizadas por enzimas (24,25). El pigmento primario rojo o carotenoide en la piel de las carpas doradas se identificó como astaxantina. Existen informes contradictorios en la literatura sobre la capacidad de las carpas doradas para metabolizar otros pigmentos carotenoides en astaxantina. Wallat et al (18), citando a Hata et al (26), reportan la conversión pobre de luteína y β-caroteno a astaxantina en carpa dorada, la cual es capaz de metabolizar la equinona a cantaxantina pero apenas pueden metabolizar el β-caroteno a equinona, por lo que estos resultados sugieren la falta de la enzima de la primer etapa (Figura 5) lo cual debe ser investigado en próximos estudios.

4070

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014 Sobre el licopeno no se encontró investigación alguna que pudiera servir como fundamento para sugerir la razón por la cual los peces utilizados en este estudio no pudieron incorporar pigmentos en su tegumento a partir del licopeno.

Figura 5. Hypothetical metabolic pathways of carotenoids in fish. Modified from (26).

invertebrate marine organisms, and that can affect the capacity of light absorption of the carotenoid molecule.

The results obtained suggest that the inability of lycopene to increase color in these fish can be due to the lack of an enzymatic system that transforms it into β-carotene and to astaxanthin, probably due to the lack of β-ciclase (25); however, this should be proved.

Based on the results of this investigation, it can be concluded that it is not recommended to include the extract of tomato or of lycopene in feed for Carassius auratus or for Xiphophorus maculatus in order to improve pigmentation and growth, although other studies are required to demonstrate the antioxidant effect in fish and its contribution to health improvement.

Acknowledgements To Dr. José Luis Rodríguez of the Cuba Ministry of Food Industry. To M.C. Olimpia Chong Carrillo for providing information.

Con estos resultados, se propone que los peces muestran la capacidad de absorber licopeno en los enterocitos de la pared intestinal, ya que se encontró acumulado en el músculo y en el hígado en el tratamiento en donde se alimentó con un nivel de inclusión del 0.6%. Esto es congruente ya que el hígado es el principal órgano metabólico y excretor de los carotenoides (27); sin embargo, al parecer este almacenamiento no implica que el metabolismo del pez lo pueda llevar hasta astaxantina. Los carotenoides tampoco se encontraron como complejos de carotenoproteínas en el tegumento de los peces, como sucede en organismos marinos invertebrados y que pudieran estar afectando la capacidad de absorción de luz por la molécula del carotenoide.

Los resultados obtenidos sugieren que la incapacidad del licopeno de incrementar el color en estos peces puede originarse en la falta de un sistema enzimático que permita su transformación a β-caroteno y a partir de este a astaxantina, probablemente por la falta de β-ciclasa (25), sin embargo, esto debe ser comprobado.

Basados en los resultados de esta investigación, se puede concluir que no es recomendable la inclusión de extracto de jitomate o de licopeno en alimentos para Carassius auratus o para Xiphophorus maculatus, con el fin de mejorar la pigmentación y el crecimiento, aunque se requieren otros estudios para demostrar su efecto antioxidante en los peces y que pudiera contribuir a mejorar el estado de salud de los mismos.

Agradecimientos Al Dr. José Luis Rodríguez del Ministerio de la Industria Alimenticia de Cuba. A la M.C. Olimpia Chong Carrillo por la gestión de información.

REFERENCES 1.

Chatzifotis S, Pavlidis M, Doñate-Jimeno C, Vardanis G, Stereoti A, Divanach P. The effect of different carotenoid sources on skin coloration of cultured red porgy (Pagrus pagrus). Aquac Res 2005; 36(15):1517-1525.

2.

Xu X, Jin Z, Wang H, Chen X, Wang C, Yu W. Effect of astaxanthin from Xanthophyllomyces dendrorhous on pigmentation of goldfish, Carassius auratus. J World Aquacult Soc 2006; 37:282-288.

3.

Kiriratnikom S, Zaau R, Suwanpugdee A. Effects of various levels of Spirulina on growth performance and pigmentation in goldfish (Carassius auratus).

Songklanakarin J Sci Technol 2005; 27:133-139.

4.

Yanar M, Erçen Z, Özlüer HA, Büyükçapar HM. The use of alfalfa, Medicago sativa as a natural carotenoid source in diets of goldfish, Carassius auratus. Aquaculture 2008; 284(1-4):196–200.

Montoya - Effects of dietary antioxidant of tomato extract and lycopene 5.

Guillaume J, Kaushik S, Bergot P, Metailler R. Nutrición y alimentación de peces y crustáceos.

España: Ed. Mundi-prensa; 2004.

6.

Cardona EM, Ríos LA, Restrepo GM. Extracción del carotenoide licopeno del tomate Chonto (Lycopersicum esculentum). Vitae 2006; 13(2):44-53.

7.

Waliszewski KN, Blasco G. Propiedades nutraceúticas del licopeno. Salud pública Méx 2010; 52(3):254-265.

8.

Roberfroid MB. Global view on functional foods: European perspectives. Br J Nutr 2002; 88(Supl 2):S133-S138.

9.

Vega-Villasante F, Martínez-López EA, EspinosaChaurand LD, Cortés-Lara MC, Nolasco-Soria H. Crecimiento y supervivencia del langostino (macrobrachium tenellum) en cultivos experimentales de verano y otoño en la costa tropical del pacífico mexicano. Trop Subtrop Agroecosyst 2011; 14(2):581-588.

10. Kuskoski EM, Asuero AG, Troncoso AM, Mancini-Filho J, Fett R. Aplicación de diversos métodos químicos para determinar actividad antioxidante en pulpa de frutos. Ciênc Tecnol Aliment 2005; 25(4):726-732.

11. Fish W, Perkins-Veazie P, Collins J. A quantitative assay for lycopene that utilizes reduced volume of organic solvents. J Food Compost and Anal 2002; 15:309-317.

12. Yasir I, Qin JG. Effect of light intensity on color performance of false clownfish, Amphiprion ocellaris cuvier. J World Aquac Soc 2009; 40(3):337-350.

4071

17. Ahilan B, Jegan K, Felix N, Ravaneswaran. Influence of botanical additives on the growth and colouration of adult Goldfish, Carassius auratus (Linnaeus).

Tamil Nadu J Vet & Animal Sci 2008; 4(4):129-134.

18. Wallat GK, Lazur AM, Chapman FA. Carotenoids of different types and concentrations in commercial formulated fish diets affect color and its development in the skin of the Red Oranda variety of Goldfish. N Am J Aquaculture 2005; 67:42–51.

19. Moreira RL, Da Costa JM, Teixeira EG, Moreira AGL, De Moura PS, Rocha RS and Vieira RHSF. Performance of Carassius auratus with different food strategies in wáter recirculation system. Arch Zootec 2011; 60(232):1203-1212.

20. Pérez RM, Vargas R, Martínez FJ, García EV, Hernández B. Actividad antioxidante de los alcaloides de Bocconia arborea. Estudio sobre seis métodos de análisis. Ars Pharmaceutica 2003; 44(1):5-21.

21. Sinha A. and Oyas AA. China rose (Hibiscus rosasinensis) petals: a potent natural carotenoid source for goldfish (Carassius auratus L.). Aquac Res 2007; 38(11):1123-1128.

22. Orbe-Rogel JC. Elaboración de dietas adicionadas con cempaxúchitl (Tagetes erecta L.) y su efecto sobre el desarrollo del pez japonés (Carassius auratus L.). [Tesis maestría]. México: Instituto Politécnico Nacional, Centro de Desarrollo de Productos Bióticos; 2012.

13. Zar JH. Biostatistical analysis. ed. 5ta. New Jersey, USA: Ed. Prentice-Hall; 2009.

23. Pérez-Escalante V, Aguirre-Guzmán G, VanegasEspinoza PE, Del Villar-Martínez A. Effect of Anthocyanin’s Extract from flour of Roselle calyx (Hibiscus sabdariffa) on growth and pigmentation of Goldfish (Carassius auratus). Thai J Vet Med 2012; 42(1):107-111.

14. Ponce-Palafox J, Arredondo-Figueroa J, VernonCarter E. Carotenoids from plants used in diets for the culture of the pacific white shrimp (Litopenaeus vannamei). Rev Mex Ing Quím 2006; 5:157-165.

24. Farré G, Sanahuja G, Naqvi S, Bai C, Capell T, Zhu C, Christou P. Travel advice on the road to carotenoids in plants. Plant Sci 2010; 179(12):28–48.

15. Gouveia L, Rema P, Pereira O, Empis J. Colouring ornamental fish (Cyprinus carpio and Carassius auratus) with microalgal biomass. Aquacult Nutr 2003; 9:123-129.

25. Giuliano G, Tavazza R, Diretto G, Beyer P, Taylor A. Metabolic engineering of carotenoid biosynthesis in plants. Trends in Biotechnol 2008; 26(3):139-145.

16. Yeşilayer N, Aral O, Karsli Z, Öz M, Karaçuha A, Yağci F. The effects of different carotenoid sources on skin pigmentation of Goldfish (Carassius auratus). The Israeli J Aquacult – Bamidgeh. 2011; 63(IIC:63.2011.523).

26. Hata M and Hata M. Carotenoid pigments in goldfish, VI. The effect of acth and phenylthiourea on the discoloration and the carotenoids metabolism. Camp Biochem Physiol A Comp Physiol 1973; 46(1):95-101.

27. Rajasingh H, Øyehaug L, Våge D, Omholt S. Carotenoides en la dinámica de salmón atlántico.

BMC Biology 2006; 4:10.

Rev.MVZ Córdoba 19(2):4072-4085, 2014. ISSN: 0122-0268 ORIGINAL

Effect of energy sources on the apparent total tract digestibility and excretion of nutrients by bovine cattle Efecto de fuentes energéticas sobre la digestibilidad aparente total y excreción de nutrientes por bovinos Laura Romero S,* M.Sc, Paulo HM Rodrigues, Ph.D, Carolina T Marino, Ph.D, Lerner A Pinedo, Ph.D, Maurício F Martins, M.Sc, Eduardo CO Cassiano, M.Sc, Flavio Perna Jr, M.Sc. Universidade de São Paulo. Departamento de Nutrição e Produção Animal. Faculdade de Medicina Veterinária e Zootecnia. Campus de Pirassununga. Rua Duque de Caxias Norte, 225, Cep:13635-900.

Pirassununga, SP. Brazil. *Correspondencia: laurazootec@hotmail.com Received: June 2013; Accepted: December 2013.

ABSTRACT Objective. To evaluate the effect of three energy sources on the intake, total apparent digestibility and excretion of nutrients in cattle diet. Materials and methods. Six ruminally cannulated cows (730 ± 70 kg) were distributed into three treatments in a replicated 3x3 Latin square experimental design, where: (I) Control: Low ether extract diet (3.50% EE); (II) Soybean: High ether extract diet (5.30% EE) with inclusion of 15% soybean and (III) Citrus pulp: Low ether extract diet (3.00% EE) and high pectin involvement with inclusion of 15% citrus pulp. To determine the digestibility of DM and its fractions, chromic oxide was used as a marker. Nutrient excretion was calculated from the digestibility coefficient of each fraction. Results. The soybean treatment reduced (p<0.05) dry matter, crude protein, nitrogen-free extract and organic matter intake and increased ether extract intake. There was no effect (p>0.05) of the energy source on the digestibility coefficients of DM, CP, NDF, EE, NFE or OM. The TDN value was higher for the soybean treatment. The excretion of DM, NFE and OM was lower (p<0.05) for the soybean treatment. All energy sources influenced the excretion of crude protein. Conclusions. The energy sources used did not affect the digestibility of the diets and are indicated as high potential sources to be used in cattle.

Key words: Citrus pulp, digestibility, food consumption, nutrients, ruminants (Source: USDA).

RESUMEN

Objetivo. Evaluar el efecto de tres fuentes energéticas sobre el consumo, la digestibilidad aparente total y la excreción de nutrientes de la dieta en bovinos. Materiales y métodos. Seis vacas (730±70 kg) canuladas en rumen fueron distribuidas en tres tratamientos, en un diseño experimental cuadrado latino 3x3 replicado, a saber: (I) Control: Dieta de bajo extracto etéreo (3.50% de EE); (II) Soya: Dieta de alto extracto etéreo (5.30% de EE) con inclusión de 15% de grano de soya y (III) Pulpa Cítrica: Dieta de bajo extracto etéreo (3.00% de EE) y alta participación de pectina con inclusión de 15% de pulpa cítrica. Para determinar la digestibilidad de la MS y sus fracciones, fue utilizado el marcador de óxido de cromo. La excreción de nutrientes, fue calculada a partir de los coeficientes de digestibilidad de cada fracción. Resultados. El tratamiento con soya redujo (p<0.05) el consumo de materia seca,

4072

Romero - Effect of energy sources on the apparent total tract

4073

proteína bruta, extracto no nitrogenado y materia orgánica, de igual manera, incrementó el consumo de extracto etéreo. No no se observó efecto (p˃0.05) de fuente energética para los coeficientes de digestibilidad de la MS, PB, FDN, EE, ENN y MO. El valor de NDT fue mayor para el tratamiento con soya. La excreción de MS, ENN y MO fue menor (p<0.05) para el tratamiento con soya. Todas las fuentes energéticas influyeron en la excreción de proteína bruta. Conclusiones. Las fuentes energéticas utilizadas, no afectaron la digestibilidad de las dietas, y estan indicadas como fuentes de elevado potencial en la alimentación de bovinos.

Palabras clave: Consumo de alimento, digestibilidad, nutrientes, pulpa cítrica, rumiantes (Fuente: USDA).

INTRODUCTION

INTRODUCCIÓN

Nutrient consumption and digestibility and their use in the different compartments of the digestive tract are estimated to be the closest approximation to the real nutritional value in food. The knowledge of the characteristics of food and its balance in the formulation of portions is a fundamental tool to meet animal needs, in order for them to express their genetic potential for production. Currently, there is variety of food that may be used in ruminant nutrition.

Meanwhile, their nutritional value and quality are determined by the complex interaction between nutrients and the microorganisms in the digestive tract, digestive process, absorption, transport, and metabolite use, aside from the animal’s own physiological condition (1). The search for alternative ingredients for ruminant nutrition leads to permanent investigation on the dynamics of fermentation and digestion of these ingredients, in processes related to production animal nutrition (2).

El consumo y digestibilidad de los nutrientes y la utilización de estos en los diferentes compartimientos del tracto digestivo son la estimativa que más se aproxima al valor nutritivo verdadero de los alimentos. El conocimiento de las características de los alimentos y su balance en la formulación de raciones, se torna una herramienta fundamental para suplir las necesidades de los animales, con el fin de que puedan expresar su potencial genético para la producción. En la actualidad existe una variedad de alimentos que pueden ser utilizados en la alimentación de rumiantes. Entre tanto, su valor nutricional y su calidad son determinados por la compleja interacción entre los nutrientes y los microorganismos del tracto digestivo en los procesos de digestión, absorción, transporte y utilización de metabolitos, además de la propia condición fisiológica del animal (1). La búsqueda de ingredientes alternativos para la nutrición de rumiantes lleva a constantes investigaciones de la dinámica de la fermentación y digestión de esos ingredientes, en procesos que están relacionados con la nutrición de animales de producción (2).

The digestibility coefficient of a diet is important to indicate the real available nutrients in food for the animal, aside from describing their nutritional value (3), since this shows how much food the microorganisms in the rumen actually use and expresses the capacity of the animal to use each nutrient in a higher or lower scale.

Regarding energy sources, such as citrus pulp and soybean pulp, they are characterized by their ability to alter the fermentative profile, which results in changes in the rumen environment, altering in a certain way the digestibility of some nutrients by rumen pH modulation, as a result of the short chain fatty acid proportion that is formed and the high fermentation speed.

Pectin fermentation in citrus pulp provides a higher pH in comparison to other diets with corn, fat or oils (4). Even though pectin is rapidly fermented in the rumen, it produces acetate as a final product, as occurs in cellulose fermentation.

This way, replacing the sources of starch with citrus pulp may promote beneficial effects,

El coeficiente de digestibilidad de una dieta es importante por indicar que nutrientes de un alimento están realmente disponibles para el animal, además, de describir el valor nutritivo del mismo (3), puesto que refleja el aprovechamiento de cada alimento por los microorganismos del rumen y expresa la capacidad del animal para utilizar, en mayor o menor escala, cada nutriente.

Referente a fuentes energéticas, como la pulpa cítrica y el grano de soya, estas se caracterizan por alterar el perfil fermentativo, resultando en cambios en el ambiente ruminal, logrando, de cierta forma, alterar la digestibilidad de algunos nutrientes por la modulación del pH ruminal, como resultado de la proporción de los ácidos grasos de cadena corta formados y de la velocidad de la fermentación.

La fermentación de la pectina de la pulpa cítrica proporciona un pH más elevado en comparación a dietas con maíz o grasas y aceites (4). La pectina, a pesar de ser rápidamente fermentada en el

4074

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

mainly related to the ruminal environment, because of the buffer effect of pectin, resulting in better conditions for the digestibility of fiber in forage, when having diets rich in concentrates (5). On the other hand, fats and oils have been added to ruminant diets with the purpose of increasing the energetic concentration of the diet. However, one of the main setbacks with the use of fats in ruminant diets, specially, when they are unsaturated, is the negative effect on the consumption of dry matter and the reduction of fiber digestibility (5).

As previously mentioned, the nutritional evaluation of the animals feed is necessary to characterize their potential and use in ruminant diet formulation. This way, the purpose of this study was to evaluate the effect of three energetic sources on consumption, total apparent digestibility, and nutrient excretion in bovines.

MATERIALS AND METHODS Animals and infrastructure. The experiment was undertaken at the Department of Animal Nutrition and Production, of the Faculty of Veterinary Medicine and Animal Husbandry of the Universidad de São Paulo, Brazil, at the facilities of the Experimental Barn and the Laboratory of Animal Nutrition and Bromatology.

Six non-pregnant and non-lactating cows were used, with an average live weight of 730±70 kg and cannulated at the rumen with 10 cm diameter and 7.5 cm wide cannulas.

The animals were kept in a roofed facility with individual compartments with cement feeders and automatic fountains.

Treatments and experimental design. The animals were assigned to one of the three isocaloric (1.55 Mcal of EL l/kg of DM) and isoproteic experimental diets (12.10% of CP), formulated with the program Spartan Dairy Ration Evaluator/Balancer, version 3.0.3., varying according to the energetic source used, as follows: 1) Control: Low ether extract (3.50% EE); 2) Soy: High ether extract (5.30% EE) with an inclusion of 15% soybean, and 3) Citrus Pulp: Low ether extract diet (3.00% EE) and high pectin participation with inclusion of 15% citrus pulp.

The experimental design used was a replicated 3x3 Latin square. The experimental unit was the animal within each period. The experiment included 18 experimental units: 3 animals, 3 periods and 2 squares.

rumen, genera acetato como producto final, como ocurre con la fermentación de la celulosa. De esta forma, el remplazo de fuentes de almidón por pulpa cítrica puede promover efectos benéficos, principalmente con relación al ambiente ruminal, por el efecto tamponante de la pectina, resultando en mejores condiciones para la digestión de la fibra del forraje, cuando se tienen dietas ricas en concentrados (5). Por el contrario, grasas y aceites han sido añadidas en dietas para rumiantes con el objetivo de aumentar la concentración energética de la dieta. Sin embargo, unos de los problemas principales con la utilización de grasas en la dieta de rumiantes, especialmente cuando estas son insaturadas, es el efecto negativo sobre el consumo de materia seca y la reducción de la digestibilidad de la fibra (5).

De acuerdo con lo anteriormente mencionado, la evaluación nutricional de esos alimentos se torna necesaria para la caracterización de su potencial y utilización en la formulación de dietas para rumiantes. De esta forma, el objetivo del presente trabajo fue evaluar el efecto de tres fuentes energéticas sobre el consumo, la digestibilidad aparente total y la excreción de nutrientes en bovinos.

MATERIAL Y MÉTODOS Animales e instalaciones. El experimento fue realizado en el Departamento de Nutrición y Producción Animal, de la Facultad de Medicina Veterinaria y Zootecnia de la Universidad de São Paulo, Brasil, en las instalaciones del Establo Experimental y del Laboratorio de Nutrición Animal y Bromatologia.

Fueron utilizadas seis vacas no gestantes y no lactantes, con peso vivo medio de 730±70 kg y portadoras de cánula ruminal con 10 cm de diámetro y 7.5 cm de grosor. Los animales fueron mantenidos en instalación cubierta, dotada de compartimientos individuales con comederos de cemento y bebederos automáticos.

Tratamientos y diseño experimental. Los animales fueron asignados a una de las tres dietas experimentales, isocalóricas (1.55 Mcal de ELl/kg de MS) e isoprotéicas (12.10% de PB), formuladas con el programa Spartan Dairy Ration Evaluator/ Balancer, versión 3.0.3., variando según la fuente energética utilizada, a saber: 1) control: Dieta de bajo extracto etéreo (3.50% de EE); 2) Soya: Dieta de alto extracto etéreo (5.30% de EE) con inclusión de 15% de soya en grano y 3) Pulpa Cítrica: Dieta de bajo extracto etéreo (3.00% de EE) y alta participación de pectina con inclusión de 15% de pulpa cítrica.

Romero - Effect of energy sources on the apparent total tract Nutritional management and experimental period. The food was offered twice a day, at 08:00 and 16:00 hours, incomplete portions.

In all the diets, the source of forage used was corn silo. The proportions of the different ingredients in the experimental diets and their bramatological composition are described in table 1.

Each experimental period lasted 15 days, considering the first 10 days as adaptation periods for the diets, and the last 5 days for data collection of the evaluated parameters.

The animals were weighted on the first and last day of all the periods of this experiment.

The amounts of forage and concentrate offered to the animals were weighted daily, as well as the remainders of each experimental portion in order to estimate consumption per animal.

Table 1. Proportions of ingredients and estimated and calculated bromatological composition of experimental diets expressed as a percentage of dry matter (DM %).

Treatments Item

Control

Soybean

Pulp

Corn silage

50.00

54.40

48.00

Grinded corn

34.70

27.50

20.70

Soy flour

12.20

-

13.50

Soybean

-

15.00

-

Citrus pulp

-

-

15.00

Table salt

0.50

0.50

0.50

Dicalcium phosphate

0.10

0.10

0.10

Limestone

0.50

0.50

0.50

2.00

2.00

2.00

Ingredients (DM %)

Mineral supplement

1

Bromatological composition Dry matter

53.10

51.00

54.00

CP2 (% DM)

12.10

12.10

12.10

PDR3 (% CP)

65.10

67.10

PNDR3 (% CP)

34.90

32.90

68.40 31.60

NDF2 (% DM)

27.10

31.00

27.90

ADF2 (% DM)

14.40

19.30

16.60

ASTARCH2 (% DM)

39.30

34.40

29.30

MM2 (% DM)

7.60

7.10

8.10

Ca2 (% DM)

0.85

0.72

1.01

P2 (% DM)

0.51

0.59

0.62

EE2 (%DM)

3.50

5.30

3.00

ELl3 (Mcal/kg)

1.55

1.55

1.55

2

(%)

Mineral and vitamin supplement, amount per kg of product: 200 g of calcium, 60 g of phosphorus, 20 g of sulfur, 20 g of magnesium, 70 g of sodium, 15 mg of cobalt, 700 mg of copper, 700 mg of iron, 40 mg of iodine, 1,600 mg of manganese, 19 mg of selenium, 2.500 mg of zinc, 200.000 IU of vitamin A, 50.000 IU of vitamin D3, 1.500 IU of vitamin E. 2Estimated by bromatological analysis, determined in the Laboratory of Animal Nutrition and Food Science of the Department of Animal Nutrition and Production of the Faculty of Veterinary Medicine and Animal Husbandry of the University of São Paulo. 3Estimated through the software Spartan Dairy Ration Evaluator/ Balancer, version 3.0.3.

1

4075

El diseño experimental utilizado fue un cuadrado latino 3x3 replicado. La unidad experimental fue el animal dentro de cada período. El experimento contó con 18 unidades experimentales referentes a 3 animales, 3 períodos y 2 cuadrados.

Manejo nutricional y período experimental.

Los alimentos fueron ofrecidos dos veces al día, a las 08:00 y 16:00 horas, en forma de ración completa. En todas las dietas, la fuente de forraje utilizado fue el ensilaje de maíz. Las proporciones de los diversos ingredientes de las dietas experimentales y la composición bromatológica de las mismas están descritas en la tabla 1.

Cada período experimental fue constituido de 15 días, considerando los primeros 10 días para adaptación a las dietas y los últimos 5 días para colecta de datos de los parámetros evaluados.

En todos los períodos del presente experimento, los animales fueron pesados en el primero y último día. Diariamente se pesaron las cantidades de forraje y concentrados ofrecidos así como de las sobras de cada ración experimental para estimar el consumo por animal.

Parámetros de evaluación. El consumo de materia seca (CMS) fue evaluado diariamente, entre el día 10 hasta el día 15 de cada período experimental. El CMS fue calculado por la cantidad de alimento suministrado en un día y sustraído por la respectiva sobra de alimento colectado y pesado en la mañana siguiente al ofrecimiento de las dietas, multiplicando esto por el porcentaje de materia seca (MS) del alimento.

Las muestras de los alimentos utilizados en las dietas fueron analizadas para determinar el porcentaje de materia seca - MS (Método 2001.12), materia mineral – MM (Método 935.12), proteína bruta PB (Método 968.06), extracto etéreo - EE (Método 920.39), calcio - Ca (Método 935.13), fósforo - P (Método 964.06), conforme metodologías descritas por AOAC (6); energía bruta – EB, determinada mediante bomba calorimétrica adiabática PARR Instruments® y fibra en detergente neutro - FDN, fibra en detergente ácido - FDA y lignina - LIG, según Van Soest (3).

La digestibilidad aparente total de la MS de la dieta y sus fracciones (PB, EE, EB, ENN, FDN, FDA y MO) fueron determinadas por medio del marcador de óxido de cromo (Cr2O3), según la técnica mencionada por Bateman (7). Para tal, entre el día 5 hasta el día 15 de suministro de las dietas de cada periodo experimental, fueron administrados dos veces al día, vía cánula ruminal, 2 g del marcador de Cr2O3 por kg de MS de alimento

4076

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

Evaluation parameters. Dry matter consumption (DMC) was evaluated daily, between days 10 and 15 of each experimental period. DMC was calculated as the amount of food provided in one days and withdrawn from its corresponding leftover, and weighted the next morning, upon offering the diets, multiplying this by the percentage of dry matter (DM) in food.

Samples of the food used in the diets were analyzed to determine the percentage of dry matter – DM (Method 2001.12), mineral matter – MM (Method 935.12), gross protein - GP (Method 968.06), ether extract - EE (Method 920.39), calcium - Ca (Method 935.13), Phosphorous - P (Method 964.06), according to methodologies described by AOAC (6); gross energy – GE, determined by adiabatic calorimeter PARR Instruments® and fiber in neutral detergent - FND, acid detergent fiber ADF and lignin - LIG, according to Van Soest (3).

Total apparent digestibility of DM in the diet and its fractions (GP, EE, GE, ENN, FND, ADF y OM) were determined with a chromium oxide marker (Cr 2O 3), according to the technique mentioned by Bateman (7). For this, 2g of the marker Cr2O3 per kg of DM consumed were administered through the ruminal cannula. For such, between day 5 to day 15 of the supply of the diets of each experimental period, 2 g of the marker Cr2O3 per kg of DM of consumed food were administered two times a day via the rumen cannula through wrappers made from absorbent paper. The digestibility assay was established in two phases, the first five days for adaptation to the marker and the last five for stool collection.

For the analysis of the composition of fecal samples, an aliquot of 200 g per animal was directly removed from the rectum twice a day, which was preserved in the plastic wrap previously identified for each animal and experimental period. During that same period, approximately 200 g of each food offered in the total ration and stored in the plastic wraps previously identified were collected twice a day.

All samples were kept at –20°C until analysis.

Food and feces samples were homogenized and pre-dried in a forced ventilation stove at 65°C for 72 hours. They were subsequently crushed in a mill using a 1.0 mm sieve and coupled into closed bottles for the determination of the Cr2O3 concentration, according to the methodology described by Conceição et al. (8), and other lab tests.

consumido, a través de envolturas confeccionadas en papel absorbente. El ensayo de digestibilidad fue constituido de dos fases, siendo los cinco primeros días para adaptación al marcador y los cinco últimos para colecta de heces.

Para análisis de la composición de las muestras de heces, se retiró una alícuota de 200 g por animal directamente del recto, dos veces al día, la cual fue conservada en envoltura plástica previamente identificada para cada animal y período experimental. Durante ese mismo período, fueron colectados, dos veces al día, aproximadamente 200 g de cada alimento ofrecido en la ración total y almacenados en envolturas plásticas previamente identificadas. Todas las muestras fueron mantenidas a -20°C hasta el momento de análisis. Las muestras de los alimentos y de las heces fueron homogenizadas y sometidas a presecado en estufa de ventilación forzada a 65ºC por 72 horas. Posteriormente fueron trituradas en molino, utilizándose un tamiz de 1.0 mm y acopladas en frascos cerrados para determinación de la concentración de Cr2O3, conforme metodología descrita por Conceição et al (8), y demás análisis de laboratorio.

La concentración de nutrientes digestibles totales (NDT) de las dietas, fue calculada a través de la ecuación propuesta por el NRC (9): NDT(%) = PBD+FDND+CNFD+(2.25 x EED)-7 Dónde: PBD = proteína bruta digestible; FDND = fibra en detergente neutro digestible; CNFD = carbohidratos no fibrosos digestibles; EED = extracto etéreo digestible.

La excreción de MS y de los nutrientes de la dieta, fueron calculadas a partir de los datos del coeficiente de digestibilidad de la MS y sus fracciones, multiplicando el valor del consumo de los nutrientes por sus respectivos coeficientes de digestibilidad y dividiendo esto por 100.

Análisis estadístico. Los resultados fueron analizados por el programa Statistical Analysis System, Versión 9.2 (10), verificando anteriormente la normalidad de los residuos por el test de ShapiroWilk. Los datos fueron sometidos a análisis de varianza por el procedimiento MIXED del SAS, donde el modelo incluyó el efecto de tratamiento como factor fijo y los efectos de animal dentro del cuadrado, cuadrado y periodo como factores aleatorios. Los efectos de tratamiento fueron evaluados por el test de Tukey (p<0.05).

4077

Romero - Effect of energy sources on the apparent total tract The concentration of total digestible nutrients (TDN) of diets was calculated through the equation proposed by NRC (9):

El modelo matemático utilizado fue:

TDN(%) = DCP+DNDF+DNFC+(2.25 x DEE)-7

Donde:

Where: DCP = digestible crude protein; DNDF = digestible neutral detergent fiber; DNFC = digestible not fibrous carbohydrates; DEE = digestible ether extract.

yijk es la observación en la i-ésima línea y k-ésima columna del j-ésimo tratamiento; m es el promedio general; ai es el efecto de la i-ésima columna dentro de cuadrado; tj es el efecto del j-ésimo tratamiento; bk es el efecto de la k-ésima línea. eijk es el error experimental aleatorio

The excretion of DM and the nutrients of the diet were calculated from the data of the DM digestibility coefficient and its fractions, multiplying the nutrient intake value by their respective digestibility coefficients and dividing it by 100.

Statistical analysis. The results were analyzed by the software Statistical Analysis System, Version 9.2 (10), before checking the normality of waste by the Shapiro-Wilk test. The data were subjected to analysis of variance by the SAS MIXED procedure, where the model included the effect of the treatment as a fixed factor and the effects of animal within the square, square and period as random factors. The effects of the treatment were evaluated by the Tukey test (p<0.05).

The mathematical model used was: yijk= m+ai+tj +bk+eijk Where: yijk is the observation in line I and column k of treatment j; m is the general average; ai is the effect of column I in the square; tj is the effect of treatment j; bk is the effect of line k. eijk is the random experimental error.

Ethical considerations. This experiment was conducted according to the guidelines established by the ethics committee on the use of animals of the Faculty of Veterinary Medicine and Animal Husbandry of the University of São Paulo (Brazil), under Protocol No. 2262/2011, in accordance with the ethical principles for animal experimentation, animal care and use.

RESULTS Table 2 shows the mean values of the consumption of dry matter and nutrients for the effects of the energy source.

yijk= m+ai+tj +bk+eijk

Consideraciones éticas. Este experimento fue conducido de acuerdo con las directrices establecidas por la comisión de ética del uso de animales de la Facultad de Medicina Veterinaria y Zootecnia de la Universidad de São Paulo (Brasil), bajo el protocolo Nro. 2262/2011, estando de acuerdo con los principios éticos de experimentación animal, para el cuidado y uso de los animales.

RESULTADOS En la tabla 2 se presentan los valores medios del consumo de materia seca y de los nutrientes, para los efectos de fuente energética.

No hubo efecto de fuente energética sobre el consumo de energía bruta (CEB), ni de fibra en detergente neutro (CFDN), probablemente, porque los animales recibieron dietas isocalóricas con valores semejantes de FDN (Tabla 1), lo que proporcionó a lo largo del día un consumo constante de estos nutrientes, indicando que las condiciones ruminales se mantuvieron también constantes para los tratamientos.

Table 2. Effect of three energy sources on the consumption of DM and nutrients.

Treatments Variables

SD

p-value

CMS (kg/day)

16.42 ±0.95a

14.68 ±1.50b

16.37 ±0.82a

0.32

0.0196

CPB (kg/day)

1.87 ±0.07a

1.67 ±0.19b

1.99 ±0.11a

0.04

0.0048

CEB (Mcal/day)

70.23 ±4.15

69.25 ±6.59

64.39 ±3.44

1.25

0.0775

CFDN (kg/day)

4.43 ±0.23

4.53 ±0.49

4.52 ±0.26

0.08

0.7848

CFDA (kg/day)

2.34 ±0.21b

2.83 ±0.38a

2.68 ±0.15a

0.08

0.0073

CEE (kg/day)

0.57 ±0.04b

0.78 ±0.08a

0.49 ±0.04b

0.03

<0.0001

CENN (kg/day)

8.30 ±0.57a

6.64 ±0.64b

8.01 ±0.37a

0.21

0.0005

CMO (kg/day)

15.17 ±0.91 a

13.63± 1.38b

15.02 ±0.75ab

0.29

0.0273

Control

Soybean Citric Pulp

Different letters in the same line indicate significant differences (p<0.05) through the Tukey test. ab

4078

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

There was no effect of the energy source over the gross energy consumption (GEC) or neutral detergent fiber (NDFC), probably because the animals received isocaloric diets with similar values of NDF (Table 1), which provided a constant intake of these nutrients throughout the day, indicating that the ruminal conditions also remained constants for treatments.

A decrease in the consumption of dry matter (DMC), crude protein (CPC) and nitrogen- free extract (NFEC) was observed (p<0.05) for the soybean treatment as compared to the control and citrus pulp treatments, which in turn were not different from each other. The soybean treatment also reduced (p<0.05) the consumption of organic matter (OMC) when compared with the control treatment and there were no significant differences between these two treatments with regard to the citrus pulp treatment. The depressant effect of lipids on dry matter intake was due to satiety, the decrease in dry matter intake resulted in the decrease of the consumption of crude protein, nitrogen-free extract and organic matter.

The acid detergent fiber consumption (ADFC) was lower (p<0.05) for animals receiving the control treatment than in those that consumed soybean grains or citrus pulp, there being no statistical difference between these last two treatments. This is due to the fact that in the bromatological composition (Table 1), the value for ADF in the control treatment was lower when compared to the ADF content in soybean or citrus pulp treatments. In addition, the increase in the consumption of ADF for soybean or citrus pulp diets was due to the higher content of fibers in these diets, as these sources have a higher ADF percentage when compared with corn.

The effect of the energy source (p<0.05) was observed for the consumption of ether extract (EEC), being this higher for the soybean treatment in relation to the other treatments that, at the same time, were not different among them. This was to be expected since the treatment containing soybean grains was characterized for being a high ether extract diet (5.30% of EE), which means that a portion of non-fibrous carbohydrates was replaced by ether extract.

The results of the DM digestibility coefficients and its fractions, as well as total digestible nutrients, are described in Table 3.

The digestibility coefficients for DM, CP, GE, NDF, EE, NFE and OM were not affected by any of the treatments. There was a significant effect for the digestibility coefficient of ADF as well as for TDN.

Se observó la disminución (p<0.05) en el consumo de materia seca (CMS), de proteína bruta (CPB) y de extracto no nitrogenado (CENN) para el tratamiento con soya en comparación a los tratamientos control y pulpa cítrica, que a la vez, estos últimos no fueron diferentes entre sí. El tratamiento con soya disminuyó (p<0.05) también el consumo de materia orgánica (CMO) cuando fue comparado con el tratamiento control y no presentando diferencias significativas estos dos tratamientos respecto al tratamiento con pulpa cítrica. El efecto depresor de los lípidos sobre el consumo de materia seca fue debido a un efecto de saciedad, cuya disminución de la ingestión de materia seca resultó en disminución del consumo de proteína bruta, de extracto no nitrogenado y de materia orgánica.

El consumo de fibra en detergente ácido (CFDA) fue menor (p<0.05) para los animales que recibieron el tratamiento control que para los que consumieron granos de soya o pulpa cítrica, no presentando diferencias estadísticas estos dos últimos tratamientos. Esto es debido, a que en la composición bromatológica (Tabla 1) el valor de FDA del tratamiento control fue menor con relación al contenido de FDA de los tratamientos con soya o pulpa cítrica. Además, el aumento del consumo de FDA para las dietas con soya o pulpa cítrica, fue debido al mayor contenido de fibras en esas dietas, toda vez que estas fuentes poseen un mayor porcentaje de FDA, cuando comparados con el maíz.

Efecto de fuente energética (p<0.05) fue observado para el consumo de extracto etéreo (CEE), siendo este mayor para el tratamiento con soya con relación a los demás tratamientos que, a la vez, no fueron diferentes entre sí. Esto es esperado, debido a que el tratamiento que contenía granos de soya se caracterizó por ser una dieta con alto extracto etéreo (5.30% de EE), lo que significa que parte de los carbohidratos no fibrosos fueron sustituidos por extracto etéreo.

Los resultados de los coeficientes de digestibilidad de la MS y sus fracciones, así como los nutrientes digestibles totales se describen en la tabla 3.

Los coeficientes de digestibilidad de la MS, PB, EB, FDN, EE, ENN y MO no fueron afectados por ninguno de los tratamientos. Hubo efecto significativo para el coeficiente de digestibilidad de FDA, así como para los NDT. Las fuentes energéticas utilizadas en el presente experimento influyeron en los valores de excreción de la MS y de los nutrientes, como se observa en la tabla 4. Entre tanto, no fueron encontrados datos en la literatura acerca del efecto de fuentes energéticas sobre la excreción de nutrientes de la dieta de bovinos.

4079

Romero - Effect of energy sources on the apparent total tract Table 3. Effect of three energy sources on the apparent total digestibility of DM and its fractions.

Variables

Table 4. Effect of three energy sources on the excretion of DM and nutrients.

Variables

Treatments

SD

p-value

Control

Soybean

Citric Pulp

CDMS (%)

88.87 ±0.48

88.57 ±1.40

89.41 ±0.95

0.61

0.2516

CDPB (%)

87.58 ±0.76

86.58 ±1.70

87.37 ±0.62

0.72

0.1630

CDEB (%)

89.11 ±0.64

88.50 ±1.31

89.76 ±0.87

0.56

0.0623

CDFDN (%)

85.89 ±0.97

85.79 ±1.33

85.94 ±1.28

0.58

0.9733

CDFDA (%)

81.96 ±1.99b

83.36 ±1.87ab

85.21 ±1.60a

0.78

0.0409

CDEE (%)

92.21 ±2.47

94.04 ±2.32

95.21 ±1.48

0.95

0.0980

CDENN (%)

92.20 ±0.91

92.52 ±1.18

93.28 ±1.15

0.47

0.1278

CDMO (%)

89.78 ±0.59

89.64 ±1.13

90.35 ±0.96

0.49

0.2206

86.98 89.50 86.61 0.50 0.0003 ±0.69b ±1.21a ±0.88b ab Different letters in the same line indicate significant differences (p<0.05) through the Tukey test.

TDN (%)

The energy sources used in this experiment influenced the excretion values for DM and nutrients as shown in table 4. Moreover, no data were found in the literature about the effect of energy sources on the excretion of nutrients from cattle diet.

Significant differences (p˃0.05) were not observed between treatments for the excretion of gross energy (GEEx), and neutral detergent fiber (NDFEx). The excretion of dry matter (DMEx), nitrogen-free extract (NFEEx) and organic matter (OMEx) were lower (p<0.05) for the soybean treatment in comparison to the control treatment, without differences of these two with the citrus pulp treatment. This is related to the consumption (Table 2) obtained for these nutrients, being also lower when animals consumed the soybean treatment.

The excretion of acid detergent fiber (ADFEx) and ether extract (EEEx) was higher (p<0.05) for the soybean treatment in relation to the citrus pulp treatment, with these two treatments not being different from the control treatment.

The energy source effect was observed (p<0.05) for the excretion of crude protein (CPEx), being all treatments different among each other, while the citrus pulp treatment promoted an increased protein excretion, while the soybean treatment resulted in a lower excretion of this nutrient.

The same effect (p<0.05) was observed for the excretion of nitrogen (NEx), being higher for the citrus pulp treatment as compared to the soybean treatment. Based on these findings it can be asserted that the increased excretion of protein crude, and consequently of nitrogen, for the citrus pulp treatment is due to a lower

Treatments Control

Soybean Citric Pulp

SD

p-value

DMEx (kg/day)

1.82 ±0.12a

1.67 ±0.13b

1.73 ±0.11ab

0.030

0.0567

CPEx (kg/day)

0.23 ±0.01b

0.22 ±0.02c

0.25 ±0.01a

0.005

0.0020

GEEx (Mcal/day)

7.64 ±4.56

7.35 ±5.27

7.08 ±4.83

0.122

0.0898

NDFEx (kg/day)

0.62 ±0.04

0.64 ±0.06

0.63 ±0.04

0.010

0.8262

ADFEx (kg/day)

0.42 ±0.03ab

0.47 ±0.04a

0.40 ±0.04b

0.011

0.0293

ExEE (kg/day)

0.043 ±0.01ab

0.045 ±0.01a

0.023 ±0.05b

0.004

0.0266

NFEEx (kg/day)

0.65 ±0.09a

0.49 ±0.05b

0.54 ±0.08ab

0.023

0.0048

OMEx (kg/day)

1.55 ±0.11a

1.40 ±0.09b

1.45 ±0.11ab

0.028

0.0308

0.038 ±0.004 ab

0.035 ±0.005b

0.042 ±0.004a

0.001

0.0084

NEx (kg/day)

Different letters in the same line indicate significant differences (p<0.05) through the Tukey test. ab

No fueron observadas diferencias significativas (p˃0.05) entre los tratamientos para la excreción de energía bruta (ExEB), y de fibra en detergente neutro (ExFDN). La excreción de materia seca (ExMS), de extracto no nitrogenado (ExENN) y de materia orgánica (ExMO) fueron menores (p<0.05) para el tratamiento con soya en comparación al tratamiento control, sin diferencias de estos dos con el tratamiento con pulpa cítrica. Esto está relacionado con el consumo (Tabla 2) obtenido para estos nutrientes, siendo que también fue menor cuando los animales consumieron el tratamiento con soya.

La excreción de fibra en detergente ácido (ExFDA) y de extracto etéreo (ExEE) fue más elevada (p<0.05) para el tratamiento con granos de soya en relación al tratamiento con pulpa cítrica, no diferenciándose estos dos tratamientos del tratamiento control.

Efecto de fuente energética fue observado (p<0.05) para la excreción de proteína bruta (ExPB), diferenciándose todos los tratamientos entre sí, siendo que el tratamiento con pulpa cítrica promovió una mayor excreción de proteína, mientras que el tratamiento con soya resultó en menor excreción de este nutriente.

El mismo efecto (p<0.05), fue observado para la excreción de nitrógeno (ExN), siendo más elevada para el tratamiento con pulpa cítrica en comparación al tratamiento con soya. De acuerdo con estos resultados, se puede decir que la mayor excreción de proteína bruta, y consecuentemente de nitrógeno, para el tratamiento con pulpa cítrica es debido a una menor retención de los compuestos nitrogenados por parte de los animales que recibieron este tratamiento.

4080

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

retention of the nitrogenous compounds by the animals that received this treatment.

DISCUSSION The depressant effect of lipids on DMC and the nutrients mentioned above is associated with the inhibition of the microbial activity and consequently, with the rate of digestion. The use of lipids in the diet of bovine cattle may affect fiber digestibility, mainly when these are unsaturated fatty acids (11). This inhibitory effect on fiber degradation has been attributed to a coat of fibrous particles with fat, which generates a physical impediment that lipids exert on microorganisms through a hydrophobic layer, preventing the metabolism and perfect adherence of bacteria to the fiber, thus affecting the proximity of fibrolytic enzymes to the fibrous material (12). On the other hand, the reduction in DMC with the inclusion of lipids is associated with a reduction of ruminal motility and rumination time, which results in a slower transit of digestion and a satiety effect by physical filling based on lower fiber degradation (13). In the case of soybeans, the natural fibrous coverage of the seed shell that surrounds the whole oily grains, can potentially alter the ruminal passage rate or the release of oil within the rumen (14).

The NRC (9) indicates a reduction in DMC in animals receiving soybeans, according to the reduction in the fiber digestibility and at the same time the increase in time of permanence of food in the reticulum-rumen.

The decrease of the CMS is also given by the interference of unsaturated lipids on the activity Gram - negative bacteria, mainly responsible for fiber fermentation (15). The excess of unsaturated fatty acids can cause alteration in ruminal fermentation due to the suppression of the activity of cellulolytic and methanogenic bacteria. This is due to a physicochemical effect generated by the interaction between free fatty acids and bacteria, through a toxic effect of unsaturated fatty acids on microorganisms, where an alteration in the cytoplasmic membrane occurs affecting its permeability (12). On the other hand, the high energy density of the diet might have led to an increase in the blood concentration of native metabolites from the diet (triglycerides and accordingly free fatty acids), which stimulated chemical receptors that activated the satiety center resulting in a decrease in food intake (16).

Similar results to the CMS and the nutrients found in this experiment were reported by Oliveira et al (17), when assessing the effects of

DISCUSIÓN El efecto depresor de los lípidos sobre el CMS y de los nutrientes mencionados anteriormente, está relacionado con la inhibición de la actividad microbiana y consecuentemente, con la tasa de pasaje de la digesta. La utilización de lípidos en la dieta de bovinos puede afectar la digestibilidad de la fibra, principalmente cuando estos son ácidos grasos insaturados (11). Este efecto inhibidor sobre la degradación de la fibra se ha atribuido a un revestimiento de partículas fibrosas con la grasa, lo que genera un impedimento físico que los lípidos ejercen sobre los microorganismos por medio de una capa hidrofóbica, que impide el metabolismo y la perfecta adherencia de las bacterias a la fibra, afectando de esta forma la proximidad de las enzimas fibrolíticas al material fibroso (12). Por otro lado, la reducción del CMS con la inclusión de lípidos, está asociada a una reducción de la motilidad ruminal y del tiempo de rumia, lo que resulta en menor velocidad del tránsito de la digesta y en un efecto de saciedad por llenado físico en función de una menor degradación de la fibra (13). En el caso de la soya en grano, la cobertura fibrosa natural de la cáscara de la semilla que envuelve los granos oleaginosos enteros, puede alterar potencialmente la tasa de pasaje ruminal o la liberación de aceite para dentro del rumen (14). El NRC (9) indica una reducción del CMS en animales que reciben soya en grano, en función de la reducción de la digestibilidad de la fibra y a la vez, por el aumento del tiempo de permanencia de los alimentos en el retículo-rumen.

La disminución del CMS está dada también, por la interferencia de los lípidos insaturados sobre la actividad de las bacterias Gram- negativas, principales responsables por la fermentación de la fibra (15). El exceso de ácidos grasos insaturados puede causar alteración en la fermentación ruminal, debido a la supresión de la actividad de bacterias celuloliticas y metanogênicas. Esto es debido, a un efecto fisicoquímico generado por la interacción entre ácidos grasos libres y bacterias, a través de un efecto tóxico de los ácidos grasos insaturados sobre los microorganismos, donde ocurre una alteración en la membrana citoplasmática, afectando la permeabilidad de esta (12). Por otro lado, la alta densidad energética de la dieta pudo haber llevado a un aumento de la concentración sanguínea de metabolitos oriundos de la dieta (Triglicéridos y consecuentemente ácidos grasos libres), lo que estimuló receptores químicos que activaron el centro de saciedad ocasionando, una disminución de la ingestión de alimentos (16).

Resultados similares al CMS y de los nutrientes encontrados en el presente experimento fueron relatados por Oliveira et al (17), al evaluar los efectos de diferentes fuentes de lípidos

Romero - Effect of energy sources on the apparent total tract

4081

different lipid sources on the consumption and digestibility of buffalo steers in confinement. The authors observed that the consumption of EE by animals fed with diets containing whole soybean grains or soybean oil was higher than those that received the treatment with no additional lipids. This greater intake of lipids resulted in lower consumption of DM, CP and CNF in animals receiving diets with whole soybean grains and soybean oil. This result can be explained by the satiety effect that was produced with the contribution of lipids in ruminant diet, explained by the theory of regulation of energy consumption described by Van Soest (3).

sobre el consumo y la digestibilidad de novillos búfalos terminados en confinamiento. Los autores observaron que el consumo de EE por los animales alimentados con dietas que contenían grano de soya integral o aceite de soya fue mayor al de aquellos que recibieron el tratamiento sin lípido adicional.

Esa mayor ingestión de lípidos provocó menores consumos de MS, PB e CNF en los animales que recibieron las dietas con grano de soya integral y aceite de soya. Ese resultado puede ser explicado por el efecto de saciedad que ocurrió con el aporte de los lípidos en la alimentación de los rumiantes, explicado por la teoría de la regulación del consumo por la energía, descrito por Van Soest (3).

On the other hand, Bassi et al (12), working with 30 zebu heifers, evaluated the use of diets formulated with corn silage and four concentrates, one with no lipid supplementation and three including different oilseeds (soybean, cotton shell and flax seed) in concentrated isoproteic diets (13.3% of CP in DM). The authors observed that the inclusion of soybeans reduced the daily intake of DM when compared to the diet without lipids (8.18 and 8.70 kg, respectively). The same effect was observed for the consumption of OM (6.93 and 7.17 kg); however, for the consumption of CP and NDF, no differences were observed between diets. The consumption of EE increased (0.51 to 0.31 kg/ day) with the inclusion of soybean in relation to the treatment without lipids, respectively. This reduction in the CMS, according to the same authors, can be attributed to the higher energy density of diets containing oilseed grains.

Por otro lado, Bassi et al (12), trabajando con 30 novillos cebuínos, evaluaron el uso de dietas formuladas con ensilaje de maíz y cuatro concentrados, siendo uno sin suplementación de lípidos y tres con inclusión de diferentes granos de oleaginosas (grano de soya, cáscara de algodón y semilla de linaza) en dietas concentradas isoprotéicas (13.3% de PB en MS). Los autores observaron que la inclusión de soya redujo el consumo diario de MS en comparación a la dieta sin inclusión de lípido (8.18 y 8.70 kg, respectivamente). El mismo efecto fue observado para el consumo de MO (6.93 y 7.17 kg); sin embargo, para el consumo de PB y de FDN, no fueron observadas diferencias entre las dietas. El consumo de EE aumentó (0.51 a 0.31 kg/día) con la inclusión de soya con relación al tratamiento sin adición de lípido, respectivamente. Esta reducción en el CMS, de acuerdo con los mismos autores, puede ser atribuida a la mayor densidad energética de las dietas que contenían granos de oleaginosas.

In the digestibility analysis it was not possible to demonstrate effect of the energy source on the digestibility coefficients of DM, CP, GE, NDF, EE, NFE and OM. Leite (18), when working with Holstein lactating cows with a live weight of 652 kg, indicates that there is a reduction in fiber digestibility when lipid sources such as soybean oil are added at a rate of 2% in the DM of the total diet. However, the extent of the reduction is related not only to the amount but also with the type of fatty acid present in the supplement, as rich lipids in unsaturated fatty acids tend to cause a greater reduction in digestibility.

In contrast, Harvatine and Allen (19) did not observed the effects of the inclusion of up to 8.3% of saturated and unsaturated fatty acids on the digestibility of DM, OM, NDF and starch in multiparous Holstein cattle; hence suggesting that large quantities (8.3%) of fatty acids may be added to diets as this does not produce any effect on digestibility.

En el análisis de digestibilidad, no fue posible demonstrar efecto de fuente energética sobre los coeficientes de digestibilidad de la MS, PB, EB, FDN, EE, ENN y MO. Leite (18) al trabajar con vacas holandesas en lactacia, con un peso vivo de 652 kg, señala que existe una reducción en la digestibilidad de la fibra cuando fuentes lipídicas como el aceite de soya son adicionadas en una proporción de 2% en la MS de la dieta total. Sin embargo, la magnitud de reducción está relacionada no sólo con la cantidad, sino también con el tipo de ácido graso presente en el suplemento, una vez que lípidos ricos en ácidos grasos insaturados tienden a provocar una mayor reducción en la digestibilidad. En contraste, Harvatine y Allen (19) no observaron efectos de la inclusión de hasta 8.3% de ácidos grasos saturados e insaturados, sobre la digestibilidad de la MS, MO, FDN y almidón, en vacas multíparas de raza holandesa; sugiriendo de esta forma, que grandes cantidades (8.3%) de ácidos grasos pueden ser adicionados a las dietas al no presentar efectos en la digestibilidad.

4082

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

The citrus pulp treatment showed a greater (p<0.05) digestibility of the ADF fraction when compared with the control treatment. This is explained because the fibrous fraction of citrus pulp has a high ruminal digestibility, since, despite the ADF percentage around 24%, it exhibits a low percentage of lignin (1%), which means that almost all the fiber is digested in the rumen (20). Furthermore, the improvement in ADF digestibility in this study reflects the composition of the citrus pulp, which has been considered an intermediate food between forage and concentrate (21) by improving rumen fermentation, and the higher effectiveness of fiber as compared to corn or soybeans depending on pectin (5). In addition, citrus pulp is rapidly and extensively degraded in the rumen, being its degradation higher when compared to soybeans, as the citrus pulp has a high percentage of soluble carbohydrates and pectin; which is a high rumen degradability component in the cell wall (22).

El tratamiento con pulpa cítrica presentó mayor (p<0.05) digestibilidad de la fracción de FDA, cuando fue comparado con el tratamiento control. Esto se explica, debido a que la fracción fibrosa de la pulpa cítrica presenta elevada digestibilidad ruminal, puesto que, a pesar del porcentaje de FDA en torno de 24%, presenta también bajo porcentaje de lignina (1%), lo que significa que casi la totalidad de la fibra es digerida en el rumen (20). Por otro lado, la mejora en la digestibilidad de la FDA en el presente trabajo, refleja la composición de la pulpa cítrica, la cual ha sido considerada un alimento intermediario entre forraje y concentrado (21), por la mejora en los padrones de la fermentación ruminal y por presentar una mejor efectividad de la fibra en comparación al maíz o granos de soya, en función de la pectina (5). Además, la pulpa cítrica es rápida y extensamente degradada en el rumen, siendo superior en degradación cuando es comparada con los granos de soya, debido a que la pulpa cítrica tiene un alto porcentaje de carbohidratos solubles y contiene pectina; componente de la pared celular de alta degradabilidad ruminal (22).

There was a significant effect (p<0.05) of the energy source on the concentration of TDN, as the soybean treatment showed higher values as compared to other treatments. This was due to the greater use of TDN by animals, since the digestibility of the same was higher for animals receiving the soybean treatment in relation to all other treatments.

Hubo efecto significativo (p<0.05) de la fuente energética para la concentración de NDT, presentando el tratamiento con granos de soya mayor valor en comparación a los demás tratamientos. Esto se debió al mayor grado de aprovechamiento de NDT por parte de los animales, ya que la digestibilidad de los mismos, fue mayor para los animales que recibieron el tratamiento con soya, con relación a los demás tratamientos.

For the energy source effect obtained on the excretion of GE and NDF, the results were consistent with what was observed for the consumption and digestibility of these nutrients, as no significant differences for these variables were found, which confirmed once more the fact that the diets were isocaloric and had similar NDF values, indicating a fermentation profile and the constant and similar utilization of these nutrients and, therefore, no marked effect on the excretion of the same.

The increased excretion of ADF and EE for animals fed with soybeans is related to the composition of these nutrients in diets (Table 1), being higher for the soybean treatment in comparison with the other treatments.

Similarly, such increase was also due to the higher consumption of these nutrients (Table 2) and the absence of the effect of the treatment on digestibility (Table 3) of these variables, which led to a lower retention and utilization of these nutrients and consequently, the increase in the excretion of the same.

On the other hand, while the citrus pulp has a lower CP percentage when compared with corn and soybeans, this protein can be even

Para el efecto de fuente energética obtenido, sobre la excreción de EB y FDN, los resultados coincidieron con lo observado en el consumo y en la digestibilidad de estos nutrientes, siendo que tampoco se encontraron diferencias significativas para esas variables, lo que confirmó una vez más, el hecho de que las dietas eran isocalóricas y con valores similares de FDN, indicando un perfil fermentativo y de aprovechamiento constante y similar de esos nutrientes y, por consiguiente, no presentando un efecto marcado sobre la excreción de los mismos.

El aumento de la excreción de FDA y de EE para los animales que consumieron soya, está relacionado con la composición de estos nutrientes en las dietas (Tabla 1), siendo mayores para el tratamiento con soya en comparación con los demás tratamientos.

De igual forma, ese aumento fue debido también, al mayor consumo de estos nutrientes (Tabla 2) y la ausencia de efecto de tratamiento sobre la digestibilidad (Tabla 3) de estas variables, lo que llevó a una menor retención y aprovechamiento de estos nutrientes y consecuentemente, al aumento de la excreción de los mismos.

Romero - Effect of energy sources on the apparent total tract less digestible, which led to an increase in the excretion of CP and therefore nitrogen in this experiment. Porcionato et al (23), when working with mixed bulls (½ Holstein x ½ Zebu), found lower CP digestibility coefficients as the level of citrus pulp in the diet increased.

This effect is due to the high percentage of protein retained in the fibrous portion of its composition, which reflects a lower retention of nitrogenous compounds in the rumen and consequently, an increase in the excretion of the same.

In contrast, Rodrigues et al (24), when replacing corn with citrus pulp in ovine diets, found no difference in the amount of nitrogen both in feces and urine; which did not alter the nitrogen metabolism. Henrique et al (21) showed a better utilization of nitrogen in sheep when receiving citrus pulp, justified by the increase in the intake of DM with the addition of this energy source.

According to the results obtained, it is concluded that the inclusion of 15% of soybean grains in the diet of cattle reduced the consumption of DM, CP, NFE and OM, while none of the sources altered the consumption of NDF, ADF, and EE. This indicates that the inclusion of citrus pulp is a satisfactory alternative to improve the intake of DM and its fractions.

A rich source of pectin, such as citrus pulp, or in unsaturated fatty acids, such soybean grains, with an inclusion of 15% in DM, was not detrimental for the digestibility of the diets, being these listed as high potential sources for use in cattle diets.

The inclusion of 5.30% of EE from unsaturated fatty acids in the diet of cattle can be carried out, since this does not cause negative effects in the apparent total digestibility of dry matter and its fractions.

The inclusion of citrus pulp proved to be efficient for reducing the excretion of certain nutrients; however, it resulted in a lower retention of nitrogenous compounds, thus increasing their excretion.

Acknowledgements To the institutions that funded the research project, CNPq, CAPES and FAPESP, as well as to the scholarships awarded to the postgraduate learners.

4083

Por otro lado, a pesar de que la pulpa cítrica presenta un menor porcentaje de PB cuando es comparada con el maíz y el grano de soya, esa proteína puede ser aún menos digestible, lo que llevó a un aumento de la excreción de PB y consecuentemente de nitrógeno, en el presente experimento. Porcionato et al (23), al trabajar con bovinos machos, cruzados (½ Holstein x ½ Cebú), encontraron menores coeficientes de digestibilidad de la PB a medida que aumentaron el nivel de pulpa cítrica en la dieta. Este efecto es debido al alto porcentaje de proteína retenida en la parte fibrosa de su composición, lo que refleja una menor retención de los compuestos nitrogenados en el rumen y consecuentemente, un aumento de la excreción de los mismos.

En contraste, Rodrígues et al (24) al sustituir el maíz por pulpa cítrica en dietas para ovinos no encontraron diferencias en la cantidad de nitrógeno tanto en las heces como en la orina; lo que no alteró el metabolismo del nitrógeno. Henrique et al (21) mostraron mejor aprovechamiento del nitrógeno en ovinos recibiendo pulpa cítrica, justificado por el aumento de ingestión de MS con la adición de esta fuente energética.

De acuerdo con los resultados obtenidos, se concluye que la inclusión de 15% de soya en grano en la dieta de bovinos redujo los consumos de MS, PB, ENN y MO. Entre tanto, ninguna de las fuentes alteró el consumo de FDN, FDA, y EE. Esto indica que la inclusión de pulpa cítrica es una alternativa satisfactoria para mejorar el consumo de MS y sus fracciones.

Una fuente rica en pectina, como la pulpa cítrica, o en ácidos grasos insaturados, como el grano de soya, con una inclusión de 15% en la MS, no perjudicaron la digestibilidad de las dietas, siendo indicadas como fuentes de elevado potencial de uso en dietas para bovinos.

La inclusión de 5.30% de EE proveniente de ácidos grasos insaturados, en la dieta de bovinos, puede realizarse, debido a que no provocan efectos negativos en la digestibilidad aparente total de la materia seca y sus fracciones.

La inclusión de pulpa cítrica se mostró eficiente para reducir la excreción de algunos nutrientes; sin embargo, insidió en una menor retención de los compuestos nitrogenados, aumentando de esta forma su excreción.

Agradecimientos A las entidades financiadoras del proyecto de investigación, CNPq, CAPES y FAPESP, así como también por las becas otorgadas a los discentes de pos-graduación.

4084

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

REFERENCES 1.

Véras RML, Ferreira MA, Cavalcanti CVA, Véras ASC, Carvalho FFR, Santos GRA, et al.

Substituição do milho por farelo de palma forrageira em dietas de ovinos em crescimento.

Desempenho. R Bras Zootec 2005; 34:249-256.

12. Bassi MS, Ladeira MM, Chizzotti ML, Chizzotti FHM, Oliveira DM, Neto ORM, et al. Grãos de oleaginosas na alimentação de novilhos zebuínos: consumo, digestibilidade e desempenho. R Bras Zootec 2012; 41(2):353-359.

2.

Fayed AM, El-Ashry MA, Hend AA. Effect of feeding olive tree pruning by-products on sheep performance in Sinai. World J Agric Sci 2009; 5(4):436-445.

13. Harvatine KJ, Allen MS. The effect of production level on feed intake, milk yield, and endocrine responses to two fatty acid supplements in lactating cows. J Dairy Sci 2005; 88:4018-4027.

Van Soest PJ. Nutritional ecology of the ruminant.

2. ed. New York: Cornell University Press; 1994.

14. López SE, López J. Suplementação lipídica para vacas leiteiras. Pesq Agrop Gaúcha, Porto Alegre.

2005; 11(2):103-112.

3.

4.

Nogueira KA, Valinote AC, Nogueira Filho JCM, Leme PR, Silva SL. Substituição do milho pela polpa de citros em dietas com alta proporção de concentrado sobre a degradabilidade e cinética ruminal. Acta Sci Anim Sc 2009; 31(2):155-160.

5.

Eifert EC, Lana RP, Lanna DPD, Leopoldino WM, Oliveira MVM, Arcuri PB, et al. Consumo, produção e composição do leite de vacas alimentadas com óleo de soja e diferentes fontes de carboidratos na dieta. R Bras Zootec 2006; 35(1):211-218.

6.

Association of Official Analytical Chemists.

AOAC. Official methods of analyses. 18th ed.

Gaithersburg MD, USA: AOAC; 2005.

7.

Bateman JV. Nutrición animal. Manual de métodos analíticos. Primera edición en español.

México: Herrero Hermanos, Sucesores, S.A.; 1970.

8.

9.

Conceição D, Jacques R, Bento F, Simonetti A, Selbach P, Camargo F. Redução de cromo hexavalente por bactérias isoladas de solos contaminados com cromo. Cienc Rural 2007; 37(6):1661-1667.

NRC. National Research Council. Nutrients requirements of dairy cattle. 7.ed. Washington, D.C.: National Academy Press; 2001.

10. SAS. Statistical Analysis System [CD-ROM].

Versión 9.2. Cary, NC, USA: SAS Inst, Inc; 2010.

11. Calsamiglia s, Bach A, Blas C, Fernández C, García-Rebollar p. Necesidades nutricionales para rumiantes de leche: Normas FEDNA. Madrid: Peninsular SL; 2009.

15. Oliveira JS, Zanine AM, Santos EM. Diversidade microbiana no ecossistema ruminal. REDVET [Revista en internet] 2007. [acceso 23 de agosto de 2012]; 8(6). Disponible en: http://www. veterinaria.org/revistas/redvet/n060607.html 16. Forbes JM. Voluntary food intake and diet selection in farm animals. 2ª ed. London, UK: CAB International; 2007.

17. Oliveira RL, Assunção DMP, Barbosa MAAF, Ladeira MM, Silva MMP, Mascarenhas AG, et al. Efeito do fornecimento de diferentes fontes de lipídeos na dieta sobre o consumo, a digestibilidade e o N-uréico plasmático de novilhos bubalinos em confinamento. R Bras Zootec 2007; 36:733-738.

18. Leite, LC. Perfil dos ácidos graxos do leite e metabolismo de lipídios no rúmen de vacas recebendo dietas com alto ou baixo teor de concentrado e óleo de soya ou de peixe [Tesis doctoral]. Piracicaba, São Paulo: Universidade de São Paulo, Escola Superior de Agricultura “Luiz de Queiroz”; 2006.

19. Harvatine KJ, Allen MS. Effects of fatty acid supplements on milk yield and energy balance of lactating dairy cows. J Dairy Sci 2006; 89:1081–1091.

20. Marino CT, Otero WG, Rodrigues PHM, Dicostanzo A, Millen DD, Pacheco RLD, et al. Effects of adding polyclonal antibody preparations on ruminal fermentation patterns and digestibility of cows fed different energy sources. J Anim Sci 2011; 89:3228-3235.

Romero - Effect of energy sources on the apparent total tract

4085

21. Henrique W, Sampaio AAM, Leme PR, Alleoni GF, Lanna DPD, Malheiros EB. Digestibilidade e Balanço de Nitrogênio em Ovinos Alimentados à Base de Dietas com Elevado Teor de Concentrado e Níveis Crescentes de Polpa Cítrica Peletizada.

R Bras Zootec 2003; 32(6 Supl 2):2007-2015.

23. Porcionato MAF, Berchielli TT, Franco GL, Andrade P, Silveira RN, Soares WVB. Digestibilidade, degradabilidade e concentração amoniacal no rúmen de bovinos alimentados com polpa cítrica peletizada normal ou queimada. R Bras Zootec 2004; 33(1):258-266.

22. Scoton RA. Substituição do milho moído por polpa cítrica peletizada e/ou raspa de mandioca na dieta de vacas leiteiras em final de lactação [Tesis doctoral]. Piracicaba, São Paulo: Universidade de São Paulo, Escola Superior de Agricultura “Luiz de Queiroz”; 2003.

24. Rodrigues GH, Susin I, Pires AV, Mendes CQ, Araujo RC, Packer IU, et al. Substituição do milho por polpa cítrica em rações com alta proporção de concentrado para cordeiros confinados. Cienc Rural 2008; 38(3):789-794.

Rev.MVZ Córdoba 19(2):4086-4098, 2014. ISSN: 0122-0268 ORIGINAL

Spatial distribution of vector borne disease agents in dogs in Aegean region, Turkey Distribución espacial de agentes patógenos transmitidos por vectores en perros en la región del Egeo, Turquía Kerem Ural, Ph.D, Mehmet Gultekin, Ph.D, Abidin Atasoy, Ph.D, Bulent Ulutas, Ph.D. Adnan Menderes University, Faculty of Veterinary, Department of Internal Medicine, Isikli. Merkez Kampüsü Aytepe Mevkii, 09016, Aydin-Turkey. Corresponding: uralkerem@gmail.com

Received: September 2013; Accepted: December 2013.

ABSTRACT Objective. Assess the spatial distribution of seroprevalence of infection with or exposure to 4 vectorborne pathogens Ehrlichia canis, Anaplasma phagocytophilum, Borrelia burgdorferi and Dirofilaria immitis, across the coastal states of the Aegean region with special reference to clinical signs and haematological variances related to disease condition. Materials and methods. A convenience sample, targeting blood from at least 10 pet dogs from İzmir, Aydin, Denizli, Mugla and Manisa cities involved was evaluated using a canine point-of-care ELISA kit. Results. Out of 307 dogs tested the overall seroprevalence was highest for E. canis (24.42%), followed by E. canis + A. phagocytophilum co-infection (10.42%), A. phagocytophilum (7.49%) and D. immitis (2.28%). Only 2 cases were seropositive to B. burgdorferi albeit 10 dogs were co-infected with more than 2 agents. For both dogs infected with E. canis and co-infected with E. canis and A. phagocytophilum, anemia, thrombocytopenia and leukocytosis, were more commonly detected, whereas thrombocytopenia and leukocytosis were significant finding in dogs infected with A. phagocytophilum or D. immitis, respectively. Variance analysis showed significant differences for mean RBC, Hb, PCV and PLT values (p<0.01) among control group and other groups. Conclusions. Seropositivity for vector-borne pathogens other than B. burgdorferi, is moderately to widely distributed in dogs residing in the Aegean region in Turkey.

Key words: Anaplasma phagocytophilum, Borrelia burgdorferi, Dirofilaria immitis, dogs, Ehrlichia canis, spatial distribution, Turkey (Source: CAB).

RESUMEN Objetivo. Evaluar la distribución espacial de la seroprevalencia de la infección de 4 agentes patógenos de transmisión por vectores Ehrlichia canis, Anaplasma phagocytophilum, Borrelia burgdorferi y Dirofilaria immitis, en los estados costeros de la región del Egeo con especial referencia a los signos clínicos y las variaciones hematológicas relacionadas con la enfermedad. Materiales y métodos. Se tomaron por conveniencia muestras de sangre de al menos 10 perros en las ciudades Izmir, Aydin, Denizli, Mugla y Manisa. Para la evaluación de las muestras se utilizó un kit de ELISA para la detencción de anticuerpos de las enfermedades del estudio. Resultados. De los 307 perros muestreados, la seroprevalencia más alta fue para E. canis (24.42%), seguido por la coinfección entre E. canis + A.

4086

Ural - Spatial distribution of vector borne disease agents in dogs

4087

phagocytophilum (10.42%), A. phagocytophilum (7.49%) y D. immitis (2.28%). Sólo 2 casos fueron seropositivos para B. burgdorferi aunque 10 perros fueron coinfectados con más de 2 agentes. En ambos perros infectados con E. canis y coinfectados con E. canis y A. phagocytophilum, se detectó comúnmente anemia, trombocitopenia y leucocitosis, mientras que la trombocitopenia y leucocitosis fueron significativos en perros infectados con A. phagocytophilum o D. immitis , respectivamente.

El análisis de varianza mostró diferencias significativas para los promedios de RBC, hemoglobina, hematocrito y valores PLT (p<0.01) entre el grupo control y los otros grupos. Conclusiones. La seropositividad transmitida por vectores patógenos distintos de B. burgdorferi, fue moderada y ampliamente distribuida en los perros que residen en la región del Egeo en Turquía.

Palabras clave: Anaplasma phagocytophilum, Borrelia burgdorferi, Distribución espacial, Dirofilaria immitis, Ehrlichia canis, perros, Turquía (Fuente: CAB).

INTRODUCTION The canine vector-borne infectious diseases are emerging problems in veterinary medicine, besides the zoonotic potential of the latter causative agents may carry of importance f o r h u m a n h e a l t h . Te n t a t i ve d i a g n o s i s , therapy applications and prevention of those infections is dependent upon identification of immunopathology of relevant diseases. Despite prospecting advances have been explored in molecular diagnosis and epidemiology of these infections and their vectors, principle pathology knowledge and immunological reflections of the diseases has lagged behind (1, 2).

The vector-borne canine disease caused by Dirofilaria immitis, Borrelia burgdorferi, Ehrlichia canis, and Anaplasma phagocytophilum are frequently observed worldwide. Infection with the latter agents may be controlled in partly through vector avoidance and relevant preventive measures, however morbidity and mortality to those diseases continue to occur in dogs. Albeit the usage of acaricides and insecticides may be insufficient for breaking the enzootic transmission cycles. Within the better knowledge of the pathogenesis of the latter agents for animal and human health, there is clearly a need for additional data on the natural occurence and therefore the prevalence of these infections (1, 2).

Diagnosis, preventive measurements, and therapy of vector borne diseases among dogs are effective even if the extent of infection in particular geographic areas is taken into consideration (1). The real seroprevalences of selected vector borne pathogens in the present study has, in general, been lacking among dogs in Turkey, as limited seroprevalence for each pathogen was evaluated individually and separetely within limited populations in local areas. Therefore cited references from Turkey is lacking through Science Citation Index journals.

In this project according to the authors previous experiences and observations Eagean region of Turkey and relevant provinces were sampled,

INTRODUCCIÓN Las enfermedades infecciosas caninas transmitidas por vectores son problemas emergentes en la medicina veterinaria, además del potencial zoonótico de lo anterior los agentes causantes son de importancia para la salud humana. El diagnóstico de presunción, las aplicaciones de terapia y la prevención de estas infecciones es dependiente de la identificación de la inmunopatología de las enfermedades relevantes. A pesar de que se han explorado avances en prospección en el diagnóstico molecular y la epidemiología de estas infecciones y sus vectores, el principio de conocimiento de la patología y las reflexiones inmunológicos de las enfermedades han quedado rezagadas (1, 2).

La enfermedad canina transmitida por vectores causada por Dirofilaria immitis, Borrelia burgdorferi, Ehrlichia canis y Anaplasma phagocytophilum, se observan con frecuencia en todo el mundo. La infección con estos últimos agentes puede ser controlada en parte evitando el vector y medidas preventivas pertinentes, sin embargo la morbilidad y mortalidad por estas enfermedades continúa registrándose en perros.

Aunque el uso de acaricidas e insecticidas puede ser insuficiente para romper los ciclos de transmisión enzoótica. Según el conocimiento de la patogenia de los anteriores agentes para la salud humana y animal, claramente existe una necesidad de información adicional sobre su ocurrencia natural y por tanto la prevalencia de estas infecciones (1, 2).

El diagnóstico, medidas preventivas y la terapia de enfermedades entre perros transmitidas por vectores son efectivas aún si se tiene en cuenta la extensión de la infección en áreas geográficas particulares (1). Las seroprevalencias reales de los patógenos del vector seleccionado en el presente estudio, en general, han sido pocas entre los perros en Turquía, dado que la seroprevalencia limitada para cada patógeno fue evaluada individualmente y por separado dentro de poblaciones limitadas en áreas locales.

4088

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

as the latter locations were previously known to have E. canis or D. immitis positivity, whereas the real question was the seroprevalence rates for B. burgdorferi and A. phagocytophilum.

Because dogs in the Aegean region of Turkey are not routinely tested by veterinary surgeons in clinic for vector-borne agents, informative data points were needed for this region. The purpose of the present study was to assess the spatial distribution of seroprevalence of infection with or exposure to 4 vector-borne pathogens such as E. canis, A. phagocytophilum, B. burgdorferi and D. immitis in 5 out of 8 provinces in Aegean region of Turkey, with special reference to clinical signs and hematological variances related to disease condition.

MATERIAL AND METHODS Inclusion criteria and sampling. The present study was enrolled among 307 dogs reffered to the Department of Internal Medicine, Faculty of Veterinary, Adnan Menderes University and privately owned small animal clinics in Aegean region (Aydin, Denizli, İzmir, Manisa and Muğla provinces). One hundred fourty nine diseased dogs, referred with histories of at least one of the clinical signs involving anorexia, weight loss, fever, generalized lymphadenopathy, splenomegalia, muscle weakness, bleeding, spontaneous rhinorrhagia, distal limb edema, dyspnoea, and/ or polyarthritis were evaluated using a canine point-of-care ELISA kit for diagnosis of naturally occuring vector borne diseases (Snap 4Dx). Out of 307 dogs, 158 of them (also subjected to a canine point-of-care ELISA kit and found to be negative against all 4 vector borne agents) were also involved and enrolled as control group. The study protocol was approved by the institutional laboratory animals ethics committee of Adnan Menderes University (HADYEK No: B.30.2.A DU.0.00.00.00/050.04/2010/017) and informed written consent was obtained from all of the dogs owners prior to enrollment of the dogs participated in study (n=307, at the age of 3 months to 15 years, 157 male, 150 female).

Haematological examination. Blood samples were withdrawn from vena cephalica antebrachii into anticoagulated (EDTA) and nonanticoagulated tubes. Complete blood counts were performed before within Abacus Junior Vet hematology analyzer.

Serological examinations. Serological analyses were performed for differential diagnoses of some selected diseases appeared to have influence on the study and may have the potential effect on the clinical signs. Each sample belonging to diseased and healthy dogs, was tested by use of an ELISA kit (SNAP 4Dx, IDEXX Laboratories,

Por lo tanto, las referencias citadas de Turquía son pocas en la revistas del Science Citation Index. En este proyecto de acuerdo con las experiencias anteriores de los autores se tomaron muestras y observaciones de la región del Egeo en Turquía y las provincias relevantes, ya que en estos lugares se ha conocido previamente resultados positivos para E. canis o D. immitis, mientras que la pregunta verdadera son las tasas de seroprevalencia para B. burgdorferi y A. phagocytophilum.

Ya que los agentes vectoriales de los perros en la región del Egeo de Turquía no son examinados rutinariamente por veterinarios en una clínica, se necesitan de puntos informativos de datos en esta región. El propósito del presente estudio fue evaluar la distribución espacial de la seroprevalencia de la infección o exposición a patógenos transmitidas por 4 vectores E. canis, A. phagocytophilum, B. burgdorferi y D. immitis en 5 de 8 provincias de la región del Egeo de Turquía, con especial referencia a los signos clínicos y las variaciones hematológicas relacionadas con la condición de la enfermedad.

MATERIALES Y MÉTODOS Criterios de inclusión y toma de muestras.

El presente estudio vinculó los 307 perros mencionados en el Departamento de Medicina Interna, Facultad de Veterinaria, Universidad Adnan Menderes y pequeñas clínicas veterinarias privadas en la región del Egeo (provincias de Aydin, Denizli, İzmir, Manisa y Muğla). Ciento cuarenta y nueve perros enfermos con un historial de por lo menos uno de los signos clínicos que implican anorexia, pérdida de peso, fiebre, linfadenopatía generalizada, esplenomegalia, debilidad muscular, hemorragias, rinorragia espontánea, edema de extremidad distal, disnea y/o poliartritis fueron evaluados usando un kit de cuidado canino ELISA para el diagnóstico de enfermedades transmitidas por vector que ocurren naturalmente (Snap 4Dx). De 307 perros, 158 de ellos (también sometidos a un kit de cuidado canino ELISA y resultar negativos a todos los 4 agentes transmitidos por vectores) también fueron incluidos y vinculados como grupo de control. El protocolo del estudio fue aprobado por el comité de ética animal de los laboratorios institucionales de la Universidad Adnan Menderes (HADYEK No. B.30.2.ADU.0.00.00.00/050.04/2010/017) y se obtuvo un consentimiento informado por escrito de todos los propietarios de los perros antes de la vinculación de los perros que participaron en el estudio (n=307, con una edad de 3 meses a 15 años, 157 machos, 150 hembras).

Ural - Spatial distribution of vector borne disease agents in dogs USA) relevant to the protocol listed in the product insert, and as described previously (1). Aforementioned canine point-of-care ELISA kit detects antibodies occuring against to immunodominant proteins of E. canis (p30 and p30-1), immunodominant protein of A. phagocytophilum (msp2) and the C6 peptide of B. burgdorferi, besides detects circulating carbohydrate antigen of D. immitis (1). The 4 test results were recorded in an Excel spreadsheet.

Statistical analysis. All the data distribution analysis for normality assumptions (ShapiroWilk test) and homogeneity of variance (Levene test) were evaluated. Kruskal-Wallis test was used for the data variance is not homogeneous or do not dissolve normally. Mann-Whitney U test with Bonferroni correction was used for Post hoc multiple comparisons and p<0.05 was considered significant. Results were given as mean ± standard error.

Clinical signs obtained based on presence/ absence such as nasal discharge, loss of appetite, weight loss, tick infestation, muscle weakness, bleeding, findings associated with an increased bleeding tendency (dermal petechiae, epistaxis), polyarthritis, lymphadenopathy, neurological, cardiac, and respiratory disorders was calculated among the groups in comparison with the control by use of chi-square test of independence.

This study was summarized partially from a national project completely funded by Adnan Menderes University, Research Projects Funding Unit with Project number VTF-10004/2011.

RESULTS Animal population enrolled. Dogs (n=137) with naturally occurring infections, were diagnosed by Snap 4Dx test results, of both sexes (63 male, 74 female) were enrolled into 4 different groups. I. group (n = 75) consisted E. canis infected dogs (3 months-15 years of age), II. group involved A. phagocytophilum (n=23) (7 months-15 years of age), III. group E. canis + A. phagocytophilum co-infected dogs (n=32) (3 months-12 years of age) and IV. group D. immitis infected dogs (n=7) (2 to 6 years old).

B. burgdorferi-infected (n=2) or co-infected dogs with more than two etiological agents [E. canis + A. phagocytophilum + D. immitis infected dogs n=4, E. canis + Babesia canis infected dogs n=3, E. canis + A. phagocytophilum + Hepatozoon canis infected dogs n=3] were numerically insufficient (totally n=10) for statistical evaluation, therefore left out of inclusion criteria for intragroup comparison.Dogs were identified as negative within Snap 4Dx (n=158) and available physical examination results, were enrolled as healthy control group (Table 1).

4089

Examen hematológico. Se tomaron muestras de vena cefálica antebraquial en tubos con anticoagulante (EDTA) y sin anticoagulante. Se realizaron conteos sanguíneos completos con el analizador hematológico Abacus Junior Vet. Exámenes serológicos. Se realizaron análisis serológicos para los diagnósticos diferenciales de algunas enfermedades seleccionadas que parecen tener influencia en el estudio y pueden tener un efecto potencial sobre los signos clínicos. Cada muestra perteneciente a perros enfermos y sanos, fue probada por un kit ELISA (SNAP 4Dx, IDEXX Laboratories, EE.UU.) relevante para el protocolo mencionado en el prospecto del producto y como se describió anteriormente (1). El kit de atención canina ELISA mencionado anteriormente detecta los anticuerpos que se producen contra las proteínas inmunodominantes de E. canis (p30 y p30-1), la proteína inmunodominante de A. phagocytophilum (msp2) y el péptido C6 de B. burgdorferi, además de detectar el antígeno carbohidrato circulante de D. immitis (1). Los resultados de las 4 pruebas se registraron en una hoja de cálculo Excel.

Análisis estadístico. Se evaluaron todos los análisis de distribución de datos para los supuestos de normalidad (prueba de Shapiro-Wilk) y homogeneidad de la varianza (prueba de Levene).

Se utilizó la prueba de Kruskal-Wallis para los datos, la varianza no es homogénea o no se disuelve normalmente. Se utilizó la prueba U de Mann-Whitney con corrección de Bonferroni para comparaciones múltiples Post hoc y un p<0.05 fue considerado como significativo. Los resultados fueron mostrados como media ± error estándar.

Los signos clínicos obtenidos en base en la presencia/ ausencia de cosas tales como la secreción nasal, pérdida de apetito, pérdida de peso, infestación de garrapatas, debilidad muscular, hemorragias, hallazgos asociados con una tendencia creciente de sangrado (petequias cutáneas, epistaxis), poliartritis, linfadenopatía, trastornos neurológicos, cardiacos y respiratorios, fue calculado entre los grupos en comparación con el control mediante el uso de la prueba Chi cuadrado de independencia.

Este estudio fue resumido parcialmente a partir de un proyecto nacional totalmente financiado por la Universidad Adnan Menderes, Unidad de Financiación de Proyectos de Investigación con número de proyecto VTF-10004/2011.

RESULTADOS Población animal incluida. Los perros (n=137) con infecciones naturales fueron diagnosticados mediante los resultados de la prueba Snap 4Dx,

4090

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

Table 1. Demographic data among groups.

Breed Beagle Boxer Caucasian Shepherd Dog Cavalier King Charles Spaniel Chow Chow Cocker Spaniel Collie Crosbred Daschund Doberman Pinscher English Bulldog French Bulldog German Shepherd Dog Golden Retriever Irish Setter Jack Russell Labrador Retriever Miniature Pinscher Neapolitan Mastiff Pekingese Pitbull Terrier Pointer Pug Rottweiler Samojed Schnauzer Siberian Husky St. Bernard Terrier Turkish Anatolian Shepherd Dog West Highland Terrier Yorkshire Terrier Gender Female Male

Negative (n=158)

E. canis infected (n=75)

A. phagocytophilum infected (n=23)

E. canis+ A.phagocytophilum coinfected (n=32)

D. immitis (n=7)

1 5 1 3 3 4 1 65 1 2 2 2 9 14 1 4 1 1 2 2 1 4 8 2 10 4 2 3

6 28 2 4 5 1 1 1 6 1 1 1 10 8 -

1 13 1 4 2 1 1 -

5 17 1 5 1 1 2 -

2 1 2 1 1 -

81 78

38 37

11 12

19 13

2 5

Haematological findings. Among hematological findings evaluated, relevant changes were shown in table 2. For both dogs infected with E. canis and co-infected with A. phagocytophilum, anemia, thrombocytopenia and leukocytosis, were more commonly detected, whereas thrombocytopenia was a significant finding in dogs infected with A. phagocytophilum. In dogs infected with D. immitis there was a remarkable leukocytosis.

Haematological variables obtained were shown in table 3. Variance analysis showed significant differences for mean RBC and PLT values (p<0.01) among control group and other groups. Statistically significant differences were observed for mean values of Hb and PCV among control group and others, besides between group III and IV. Variance analysis showed significant differences for mean MCV (p<0.05) [among control group and groups II and IV] and MCHC values (p<0.01) [among group II and other groups] (Table 2).

Serological findings. All related data involving spatial distribution of provinces was shown in figures 1 and 2.

de ambos sexos (63 machos y 74 hembras) y fueron divididos en 4 grupos diferentes. El grupo I. (n=75) consistió de perros infectados con E. canis (3 meses-15 años de edad), el grupo II. Involucró A. phagocytophilum (n=23) (7 meses-15 años de edad), el grupo III. perros coinfectados con E. canis + A. phagocytophilum (n=32) (3 meses-12 años de edad) y el grupo IV. perros infectados con D. immitis (n=7) (2 a 6 años). infectados con B. burgdorferi (n=2) o perros coinfectados con dos o más agentes etiológicos [perros infectados con E. canis + A. phagocytophilum + D. immitis n=4, perros infectados con E. canis + Babesia canis n=3, perros infectados con E. canis + A. phagocytophilum + Hepatozoon canis n=3] fueron numéricamente insuficientes (en total n=10) para la evaluación estadística, por lo tanto quedaron por fuera de los criterios de inclusión para la comparación entre grupos. Los perros fueron identificados como negativos dentro de Snap 4Dx (n=158) y los resultados de la examinación física disponible, fueron incluidos en el grupo sano de control (Tabla 1).

4091

Ural - Spatial distribution of vector borne disease agents in dogs Table 2. haematological abnormalities of dogs infected with E. canis/A. phagocytophilum and D. immitis Haematological findings

E. canis (n/%)

E. canis+ A. phagocytophilum (n/%)

A. phagocytophilum (n/%)

D.immitis (n/%)

13/75 (17.3)

4/32 (12.5)

4/23 (17.39)

1/7 (14.28)

37/75 (49.3)

24/32 (75)

6/23 (26.08)

3/7 (42.85)

0.40-0.56

47/75 (62,6)

27/32 (84.3)

6/23 (26.08)

2/7 (28.57)

200-500

59/75 (78.6)

29/32 (90.6)

11/23 (47.82)

1/7 (14.28)

Reference range

Leukopenia (x109/l)

6-16

Leukocytosis (x109/l) Anemia (Hct l/l) Thrombocytopenia (x109/l)

Table 3. Descriptive statistics relevant to leukocyte and erthrocyte parameters.

Control (n: 158)

E. canis (n: 75)

A. phagocytophilum (n: 23)

E. canis +A. phagocytophilum (n: 32)

D. immitis (n:7)

WBC (x109/l)

11.69 (±0.29)

13.28 (±1.29)

13.97(±1.56)

13.82(±1.33)

17.04(±5.12)

RBC (x1012/l)

6.22 a(±0.08)

4.64 b(±0.18)

5.01 b(±0.23)

4.28 b(±0.22)

4.48 b(±0.63)

9.99

HCT (l/l)

40.46 (±0.52)

29.46

MCV (fL)

65.15 a(±0.55)

63.56 b(±0.60)

65.26

(±1.13)

64.38 b(±0.74)

MCHC (g/dl)

34.36 (±0.16)

33.32 (±0.343)

33.84 (±0.42)

33.70 (±0.26)

34.41 (±1.11)

*

PLT (x109/l)

375 a(±12)

179 b(±23)

207 b(±47)

190 b(±26)

231 b(±39)

*

a, b, c, d;

a

(±1.21)

b,c,d

9.21 d(±0.50)

9.73

32.64 (±1.55)

27.43 (±1.43)

28.54

c

b

a,b

a

d

a

(±1.30)

*

13.74 a(±0.20)

b,c,d

11.01 c(±0.53)

*

HGB (g/dl)

a

(±0,44)

P

b,c,d

b,c,d

64.57

(±3.68)

(±2.25)

a,b

* *

Superscripts presented within different letters at the same row indicated statistical significance (*p≤0.01). Values were indicated as mean ± SE mean.

75 158 7 10

23 2

32

E. canis

A. phagocytophilum

B. burgdorferi

D. immitis

E.canis+A.phagocytophilum

Other dogs

Healthy dogs Figure. 1. Snap 4Dx test results relevant to distribution of etiological agents among total study population

Anaplasmosis. An overall prevalence of 7.49% was detected, besides 10.42% presented both E. canis and A. phagocytophilum antibodies. The highest prevalence of samples with antibodies to A. phagocytophilum were reported from Aydin province (n=10); samples from İzmir also were frequently found to be positive (n=8). None of the dogs tested positive for A. phagocytophilum were co-infected with B. burgdorferi.

Lyme borreliosis. B. burgdorferi antibodies were detected solely in 2 cases in Kuşadası, Aydın.

Hallazgos hematológicos. Los cambios relevantes entre los hallazgos hematológicos evaluados se muestran en la tabla 2. Para ambos perros infectados con E. canis y coinfectados con A. phagocytophilum, anemia, trombocitopenia y leucocitosis, fueron detectados más comúnmente, mientras que la trombocitopenia fue un hallazgo significativo en los perros infectados con A. phagocytophilum. En los perros infectados con D. immitis se presentó una leucocitosis notable.

Las variables hematológicas obtenidas se muestran en la tabla 3. El análisis de varianza mostró diferencias significativas para los valores promedio de RBC y PLT (p<0.01) entre el grupo de control y los demás grupos. Se observaron diferencias estadísticamente significativas para los valores promedio de hemoglobina y hematocritos entre el grupo de control y los otros grupos, además de entre el grupo III. y el IV. El análisis de varianza mostró diferencias significativas para el valor promedio de MCV (p<0.05) [entre el grupo de control y los grupos II y IV] y los valores promedios de MCHC (p<0.01) [entre el grupo II y los demás grupos] (Tabla 2).

Hallazgos serológicos. En las figuras 1 y 2 se muestran todos los datos relacionados que involucran una distribución espacial de las provincias se.

Anaplasmosis. Se detectó una prevalencia general del 7.49%, además el 10.42% presentó anticuerpos

4092

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

Figure 2. Spatial distribution of vector borne agents according to cities enrolled; a) E.canis, b) A. phagocytophilum, c) D. immitis and d) E.canis+ A. phagocytophilum seropositive cases.

Ehrlichiosis. The overall prevalence for E. canis was 24.42% of 307 dogs. Antibodies to E. canis were detected most often in dogs in Aydin (n=33), followed by 22 and 15 cases in Izmir and Mugla provinces, respectively.

Dirofilariosis. The highest percentage of D. immitis antigen-positive samples, was obtained from Aydin (n=4) and Izmir (n=2).

Clinical findings. Chi-square test was used for independence controls among groups and clinical findings observed based on presence (1)- or absence (0) such as nasal discharge, anorexia, weight loss, tick infestation, muscle weakness, bleeding tendency (petechiae/ecchymosis, epistaxis), polyarthritis, lymphadenopathy, neurological/cardiological/respiratoric disorders were dependent variables among groups (control, A. phagocytophilum, D. immitis, E. canis+A. phagoytophilum and E. canis) at the level of p≤0.01.

Taking into account the probable transmission via the bite of ticks for ehrlichial organisms, active tick infestation was evident among 82.60%, 81.25%, and 86.66% of dogs infected with A. phagocytophilum mixed E. canis and A. phagocytophilum, and E. canis, respectively.

Cases were deemed individually, 5 dogs showed corneal and gingival hemorrhage (Figures. 3 a-b), 4 of dogs infected with E. canis presented distal limb edema (probably related to deep vein thrombosis) (Figure 3c-d), whereas some of the A. phagocytophilum infected dogs showed icterus (Figure 4a), lameness in association with

de E. canis y A. phagocytophilum. La mayor prevalencia de muestras con anticuerpos contra A. phagocytophilum se registró en la provincia de Aydin (n=10); muestras de İzmir también fueron frecuentemente encontradas como positivas (n=8).

Ninguno de los perros examinados como positivos para A. phagocytophilum estaban coinfectados con B. burgdorferi.

Borreliosis de Lyme. Se detectaron anticuerpos contra B. burgdorferi únicamente en 2 casos en Kusadasi, Aydın.

Ehrlichiosis. La prevalencia general de E. canis fue del 24,42% entre los 307 perros. Se detectaron anticuerpos contra E. canis con más frecuencia en los perros en Aydin (n=33), seguidos por 22 y 15 casos en las provincias de Izmir y Mugla, respectivamente.

Dirofilariosis. El mayor porcentaje de muestras positivas del antígeno de D. immitis fueron obtenidas de Aydin (n=4) e Izmir (n=2).

Hallazgos clínicos. Se utilizó la prueba Chicuadrado para controles de independencia entre los grupos y los resultados clínicos observados se basaron en presencia (1)- o ausencia (0) de síntomas como secreción nasal, anorexia, pérdida de peso, infestación de garrapatas, debilidad muscular, tendencia al sangrado (petequias/ equimosis, epistaxis), poliartritis, linfadenopatía, trastornos neurológicos/cardiológicos/respiratorios como variables dependientes entre los grupos (control, A. phagocytophilum, D. immitis, E. Canis + A. phagoytophilum y E. canis) a un nivel de p≤0.01.

Ural - Spatial distribution of vector borne disease agents in dogs

4093

d a b c Figure. 3. E. canis seropositive clinical cases showing bleeding tendency a) corneal, b) gingival hemorrhage, c) and d) distal limb oedema due to probable deep vein thrombosis.

a

b

c

d

Figure 4. A. phagocytophilum seropositive cases a) generalized icterus, b) a Rottweiler presenting anemia and central nervous signs, c) a Terrier with anemia and d) Irish Setter with ocular hyperemia.

polyarthritis and central nervous system signs (Figure 4b). Dogs infected with E. canis or A. phagocytophilum presented anemia (Figure 4c), hyperemia (Figure 4d) and bleeding tendency.

DISCUSSION Canine granulocytic anaplasmosis has been r e p o r t e d w o r l w i d e , p o s s e s s i n g p a ra l l e l geographic distribution of human cases (3).

Relatively novel study suggested that A. phagocytophilum infections may be seen in humans from different climatic regions among Turkey. In the latter study it was detected that both the seroprevalence of A. phagocytophilum and probably co-infections of A. phagocytophilum and B. burgdorferi are higher in areas with more suitable habitats for Ixodes ricinus (4). Indeed longitudinal information relevant to I. ricinus among European countries are lacking, and it was suggested that higher incidence of the latter agent could have an efficacy on increased seroprevalence in dogs (5).

The detected A. phagocytophilum ELISA seroprevalence of 7.49% in dogs is not comparable, as relevant published data is lacking. The tested dogs of the present study lived most of their life in Aegean region; no seroprevalence data from this region were available among dogs at the time of testing. It should be kept in mind that the vast majority of dogs naturally infected with

Teniendo en cuenta una transmisión probable mediante la picadura de garrapatas para organismos ehrlichiales, una infestación activa de garrapatas fue evidente entre el 82.60%, 81.25% y el 86,66% de los perros infectados con A. phagocytophilum, mezcla de E. canis y A. phagocytophilum y E. canis, respectivamente. Los casos fueron considerados individualmente, 5 perros mostraron hemorragia gingival y corneal (Figuras. 3 a-b), 4 perros infectados con E. canis presentaron edema de extremidad distal (probablemente relacionado con trombosis venosa profunda) (Figura 3c-d), mientras que algunos de los perros infectados con A. phagocytophilum mostraron ictericia (Figura 4a), señales de cojera en asociación con poliartritis y señales del sistema nervioso central (Figura 4b). Los perros infectados con E. Canis o A. phagocytophilum presentaron anemia (Figura 4c), hiperemia (Figura 4 d) y tendencia a sangrar.

DISCUSIÓN La anaplasmosis granulocítica canina ha sido reportada en todo el mundo, con una distribución geográfica paralela con los casos humanos (3).

Un estudio relativamente novedoso sugirió que las infecciones con A. phagocytophilum pueden observarse en seres humanos de diferentes regiones climáticas de Turquía. En este último estudio se detectó que tanto la seroprevalencia de A. phagocytophilum y probablemente las coinfecciones de A. phagocytophilum y B. burgdorferi son mayores en áreas con hábitats más adecuados para Ixodes ricinus (4). En efecto, hace falta información longitudinal relevante para I. ricinus entre los países

4094

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

A. phagocytophilum may remain clinically healthy. This may be briefly explained with the frequent distribution of anaplasmosis in endemic locations even in the absence of a clinical illness (6, 7). Furthermore A. phagocytophilum infection may be selfl i m i t i n g i n d o g s ( 3 ) . A s p o s i t i ve t i t e r s might be indicating previous exposure, the implications for the discovery of seropositive dogs does not involve active infection all the time. Risk factors for A. phagocytophilum infected dogs involved season of the year, mostly between April and July (3, 8). Although the data was not shown in detail, in our study in agreement with the latter authors, the vast majority of the dogs infected with A. phagocytophilum and/or E. canis were detected in warmer months (between May and July in Aegean region) In a relatively recent study determining the seroprevalence of anti-B. burgdorferi antibodies in a population of Turkish dogs by use of both enzyme-linked protein A/G a s s a y a n d n o v e l f l o w - c y t o m e t r y- b a s e d borreliacidal antibody test, 23.2 and 27.75% seropositivities, respectively, were detected (9). In another study performed in Aydın and İzmir provinces, in Turkey IgG antibodies were detected by use of ELISA among 49 dogs out of 140 with 35% seropositivity (10).

Because A. phagocytophilum shares a vector and reservoir host system with B. burgdorferi, the geographic distribution of cases of HGA parallels that of Lyme borreliosis (11). Seropositivity for B. burgdorferi was similar geographically to that for A. phagocytophilum, especially in a study evaluating the spatial distribution of seroprevalence for 4 vector-borne pathogens, A. phagocytophilum, B. burgdorferi, E. canis and D. immitis, across the western coastal states of the United States (1). In the present study among involved dogs a seropositivity of 7.49% was detected for A. phagocytophilum whereas only 2 dogs were seropositive to B. burgdorferi. This is surprising given the shared tick vectors (Ixodes spp.) and mammalian reservoirs for both A. phagocytophilum and B. burgdorferi. The lack of travel history to A. phagocytophilum or B. burgdorferi seropositive dogs and low seroprevalence rates suggested that disease transmission may be inefficient in Aegean Region, probably due to climate or other environmental conditions, despite the presence of I. ricinus. This specificity is of considerable concern in areas with low seroprevalence for B. burgdorferi, moreover

europeos, y se sugirió que la mayor incidencia del último agente pudo haber sido efectiva en el aumento de la seroprevalencia en perros (5).

La seroprevalencia de A. phagocytophilum detectada mediante ELISA del 7.49% en perros no es comparable, ya que carecen de datos relevantes publicados. Los perros examinados en este estudio vivieron la mayoría de su vida en la región del Egeo; no hay datos disponibles de seroprevalencia en esta región entre perros al momento de la prueba. Debe tenerse en cuenta que la gran mayoría de los perros infectados naturalmente con A. phagocytophilum puede permanecer clínicamente sanos. Esto se puede explicar brevemente mediante la distribución frecuente de anaplasmosis en lugares endémicos incluso en ausencia de enfermedades clínicas (6, 7).

Además, la infección de A. phagocytophilum puede ser autolimitante en perros (3). Títulos positivos pueden ser indicativos de una exposición previa, las implicaciones para el descubrimiento de perros seropositivos no implica una infección activa todo el tiempo. Los factores de riesgo para los perros infectados con A. phagocytophilum involucraron la temporada del año, principalmente entre abril y julio (3, 8). A pesar los datos no fueron expuestos en detalle, en nuestro estudio de acuerdo con estos últimos autores, la gran mayoría de los perros infectados con A. phagocytophilum y/o E. canis fueron detectados en los meses más cálidos (entre mayo y julio en la región del Egeo).

En un estudio relativamente reciente donde se determina la seroprevalencia de anticuerpos contra B. burgdorferi en una población de perros turcos mediante el uso de una prueba A/G de proteínas de enzimas ligadas y una prueba de anticuerpos borreliacidales en base a citometría de flujo, se detectaron 23,2 y 27,75% seropositividades, respectivamente (9). En otro estudio realizado en las provincias de Aydın y İzmir, en Turquía, se detectaron anticuerpos IgG mediante el uso de ELISA entre 49 de 140 perros con una seropositividad del 35% (10).

Dado que A. phagocytophilum comparte un sistema de anfitrión vector y reservorio con B. burgdorferi, la distribución geográfica de los casos de HGA es paralela a la de la borreliosis de Lyme, (11). La seropositividad para B. burgdorferi fue similar geográficamente a la de A. phagocytophilum, especialmente en un estudio de evaluación de la distribución espacial de la seroprevalencia para 4 patógenos transmitidos por vectores, A. phagocytophilum, B. burgdorferi, E. canis y D. immitis, a través de los estados costeros occidentales de los Estados Unidos (1). En el presente estudio se detectó una seropositividad del 7,49% para A. Phagocytophilum entre los perros involucrados, mientras que sólo 2 perros fueron seropositivos para B. burgdorferi. Esto es sorprendente dada los vectores compartidos de garrapatas (Ixodes spp.) y

Ural - Spatial distribution of vector borne disease agents in dogs unexposed dogs may be misclassified (1).

Obtained data available in the present study indicated areas where Lyme disease does not appear to be present, suggesting that strong emphasis on prevalence researches of other areas may be required for affected dogs, possibly by use of a more specific test, as Western blot (1). Only scarcity and limited information is available in Turkey relevant to sero-epidemiology of CME, in reality the overall prevalence is underestimated.

A prevalence rate of 20.8 % was obtained among 284 dogs in 3 different regions in Turkey (12). In the latter study among cities involved Adana (65.3%) and Izmir (40.6%) showed highest prevalences. In previous years, frequently clinical CME cases (13), were reported among dogs in Turkey, whereas among one of the first molecular studies E. canis antibodies was detected by use of IFA and dot-ELISA techniques, with 67.8% and 53.3% seropositivity rates, respectively (14). In later years in another molecular study 3 out of 12 dogs were seropositive to CME (15). In a recent study in Diyarbakir, Snap 3Dx rapid test kit analysis resulted in 4.8 % seropositivity among 82 dogs (16). Among 4 dogs with CME, 3 were female and only 1 dog was male, and 3 of them were at the age of 4 to 7 years (16).

In our study most of the dogs with CME were at the age of 3 months to 15 years of age with no age or sex predisposition.

The most commonly detected haematological alterations were anemia, thrombocytopenia and leukocytosis in dogs infected with E. canis and co-infected with A. phagocytophilum, whereas thrombocytopenia was a significant finding in dogs infected with A. phagocytophilum. Interestingly some of the dogs infected with E. canis presented distal limb edema (probably related to deep vein thrombosis), similarly to what have been reported elsewhere (17,18). Hematological variables presented significant differences for mean RBC, Hb, PCV and PLT values (p<0.01) among control group and other groups. Although not comparable due to the different nature and status of the diseases involved, it may be suggested that the before mentioned hematological variables showed discrepancy in contrast to healthy controls.

The disease agent for which we observed the highest prevalence on a regional level was E. canis. Regarding enrolled population 24.42% of dogs were positive (solely monoinfection with CME) for E. canis on regional pattern,

4095

los reservorios de mamíferos para A. phagocytophilum y B. burgdorferi. La falta de antecedentes de viaje para perros seropositivos para A. phagocytophilum o B. burgdorferi y las bajas tasas de seroprevalencia sugieren que la transmisión de la enfermedad puede ser ineficiente en la región del Egeo, probablemente debido al clima u otras condiciones ambientales, a pesar de la presencia de I. ricinus. Esta especificidad es de considerable preocupación en áreas con una baja seroprevalencia para B. burgdorferi, además los perros no expuestos pueden ser clasificados erróneamente (1).

Los datos obtenidos disponibles en el presente estudio indican las áreas donde la enfermedad de Lyme no parece estar presente, sugiriendo que es necesario un fuerte énfasis en investigaciones de prevalencia en otras áreas para los perros afectados, posiblemente mediante el uso de una prueba más específica, como Western blot (1). Sólo está disponible poca información en Turquía sobre la sero-epidemiología de CME, en realidad se subestima la prevalencia general. Se obtuvo una tasa de prevalencia del 20.8% entre 284 perros en 3 regiones diferentes en Turquía (12). En el último estudio las ciudades involucradas de Adana (65.3%) e Izmir (40.6%) mostraron las prevalencias más altas. En años anteriores, los casos clínicos de CME (13) fueron reportados con frecuencia entre perros en Turquía, mientras que en uno de los primeros estudios moleculares se detectaron anticuerpos contra E. canis por medio del uso de técnicas IFA y dot-ELISA, con tasas de seropositividad del 53.3% y 67.8%, respectivamente (14). En los últimos años en otro estudio molecular, 3 de 12 perros fueron seropositivos a CME (15). En un reciente estudio en Diyarbakir, los análisis con el kit Snap 3Dx tuvieron como resultado una seropositividad del 4.8% entre 82 perros (16). Entre 4 perros con CME, 3 eran hembras y sólo 1 perro era un acho y tres de ellos se encontraban entre los 4 a 7 años de edad (16).

En nuestro estudio la mayoría de los perros con CME tenían una edad de 3 meses a 15 años con ninguna predisposición de edad o sexo.

Las alteraciones hematológicas más comúnmente detectadas fueron anemia, trombocitopenia y leucocitosis en perros infectados con E. canis y coinfectados con A. phagocytophilum, mientras que la trombocitopenia fue un hallazgo significativo en los perros infectados con A. phagocytophilum.

Curiosamente, algunos de los perros infectados con E. canis presentaron edema de miembro distal (probablemente relacionado con trombosis venosa profunda), similarmente a lo reportado en otros lugares (17,18). Las variables hematológicas mostraron diferencias significativas para los valores promedio de RBC, hemoglobina, hematocrito y PLT (p<0.01) entre el grupo de control y los demás grupos. Aunque no es comparable debido a la naturaleza y situación diferente de las enfermedades

4096

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

with the highest regional rate observed in Aydin (44%) and İzmir (29.33%). Taking into account that brown dog tick thrives near territories inhabited by many stray or kennel dogs, including shelters and some multiple-dog facilities in Aegean Region, it should not be unwise to suggest that E. canis is endemic in this area. Further evaluation of specific environments in which seropositive dogs residing would be helpful for interpretation of suggested data and probably for taking control measures and fo r d evel o p i n g m a n a g e m e n t s t ra t e g i e s .

Besides, additional information about the distribution of R. sanguineus might be useful for evaluating risks of other probable pathogens transmitted by the latter tick, as reported previously (1). The prevalence of CME may be related to the distribution of the vector, R. sanguineus, which occurs mainly in tropical and subtropical regions.

The responsible agent causing canine granulocytic ehrlichiosis in Europe has been determined by nucleotide sequencing of the 16S rRNA gene to be identical to the agent of human granulocytic ehrlichiosis (17).

The vector of this pathogen in Europe is I. ricinus and its reservoir -wild and domestic animals-. In accordance, it was reported that ticks of the genera Ixodes, Rhipicephalus and other relevant ones were widespread throughout Anatolia in Turkey (19).

Interestingly among E. canis infected dogs (n=75), 45.82% were residing in Aydin city and to those of most of them were living in coastal areas (Kusadasi, Didim etc.).

According to the history obtained, owned dogs enrolled in the present study did not resided outside the city borders almost their live, therefore the question raised was the real prevalence of the etiological agents, except Aydin city in Eagean region. The high prevalence of CME in the current study may be explained within several factors involving the presence of E. canis in ticks from Aegean Region, frequent exposure of pet dogs to R. sanguineus, and sufficient transmission of E. canis by the latter tick in warmer climates.

Antigenic testing for Dirofilariosis mostly encountered following the last 15 years among Turkish studies, whereas researhes involving solely one type of diagnostic method (microfilaria or antigenic examination) are the vast majority. Turkish studies detected seropositivity within the rates from (0 to 46.22%) (20-27). Taking into account the latter serosurveys, tha vast majority of them involved limited populations and according

involucradas, puede sugerirse que las variables hematológicas mencionadas anteriormente mostraron una discrepancia en contraste con los controles sanos.

El agente de la enfermedad para la cual se observó la mayor prevalencia a nivel regional fue E. canis.

En cuanto a la población incluida, el 24.42% de los perros fueron positivos (únicamente monoinfección con CME) para E. canis en un patrón regional, con la mayor tasa regional observada en Aydin (44%) e İzmir (29.33%). Teniendo en cuenta que la garrapata marrón del perro prospera cerca de los territorios habitados por muchos perros callejeros o perreras, incluyendo refugios y algunas instalaciones para múltiples perros en la región del Egeo, no sería poco prudente sugerir que el E. canis es endémico en esta zona. Una evaluación adicional de entornos específicos en donde residen perros seropositivos que sería de gran ayuda para la interpretación de los datos sugeridos y probablemente para tomar medidas de control y desarrollar estrategias de manejo. Además, información adicional acerca de la distribución de R. sanguineus podría ser útil para evaluar los riesgos de otros patógenos que sea probablemente transmitidos por esta garrapata, como se informó previamente (1).

La prevalencia de CME puede estar relacionada con la distribución del vector, R. sanguineus, que se presenta principalmente en regiones tropicales y subtropicales.

Se ha determinado mediante la secuencia nucleotídica del gen 16s rRNA que el agente responsable que causa ehrlichiosis granulocítica canina en Europa es idéntico al agente de ehrlichiosis granulocítica humana (17).

El vector de este patógeno en Europa es I. ricinus y su reservorio son los animales salvajes y domésticos.

De esta manera, se informó que las garrapatas del género Ixodes, Rhipicephalus y otras relevantes se distribuyeron ampliamente a lo largo de Anatolia en Turquía (19).

Curiosamente, entre los perros infectados con E. canis (n=75), el 45.82% residían en la ciudad de Aydin y la mayoría de ellos vivían en zonas costeras (Kusadasi, Didim etc.). De acuerdo con el historial obtenido, los perros con amo incluidos en el presente estudio no residían por fuera de los límites urbanos casi toda su vida, por lo tanto, la pregunta planteada era la prevalencia real de los agentes etiológicos, excepto en la ciudad de Aydin en la región del Egeo. La alta prevalencia de CME en este estudio puede explicarse por varios factores que implican la presencia de E. canis en garrapatas de la región del Egeo, la exposición frecuente de perros mascota a R. sanguineus y la suficiente transmisión de E. canis por esta última garrapata en climas cálidos.

Se encontraron principalmente pruebas antigénicas para Dirofilariosis en los últimos 15 años entre los estudios realizados en Turquía, mientras que las investigaciones que involucran únicamente un tipo de método de diagnóstico (microfilaria o exámenes

Ural - Spatial distribution of vector borne disease agents in dogs to the authors’ knowledge none of them reported clinical signs related to disease condition. In a prior serosurvey involving 380 stray dogs from Istanbul and Izmir, a seroprevalence rate of 1.52% was detected in İstanbul whereas no seropositivity was determined among dogs in Izmir (28).

In Aydin city, where the present authors residing and working, microfilaremia was detected with a rate of 13.9% among 158 dogs (25). In the present research solely 7 dogs presented D. immitis antigens. This may be partly explained as a reflection of vector availability. The low prevalence of D. immitis found in this study confirmed a n e c t o d a l e v i d e n c e t h a t p r e va l e n c e o f Dirofilariasis is indeed not very high in Aegean Region, Turkey. Furthermore it has also been well recognized that mosquito control programmes are well adapted in this region, which might have influence on Dirofilariasis seroprevalence.

Positive serological results may be attributable to prior exposure and not necessarily disease condition, indeed they may forward clinicians to consider further clinical and diagnostic evaluation of dogs for underlying subclinical illness probably requiring treatment. Serologic test results also may be helpful for determining areaspecific disease prevalence, with contribution to understanding distribution of disease in both human and animal patients (1). Albeit to the present authors’ experience the seroprevalence studies might possess more scientific value in case of invoving expression of clinical signs. The diseases are managed differently, and all may have complications.

Antibacterial chemotherapy and preventive methods, involving vaccination against B. burgdorferi, are currently available for all 4 diseases (1), examined in the present study.

4097

antigénicos) constituyen la basta mayoría. Los estudios en Turquía detectaron seropositividad dentro de las tasas de 0 a 46.22% (20-27). Teniendo en cuenta las últimas encuestas serológicas, la inmensa mayoría de las mismas involucraban poblaciones limitadas y según el conocimiento de los autores ninguno de ellos reportó signos clínicos relacionados con la condición de la enfermedad. En una encuesta serológica previa que incluía 380 perros callejeros de Estambul e Izmir, se detectó una tasa de seroprevalencia del 1.52% en Estambul mientras que no se determinó ninguna seropositividad entre los perros en Izmir (28). En la ciudad de Aydin donde los autores del presente residen y trabajan, se detectó microfilaremia con una tasa del 13.9% entre 158 perros (25). En esta investigación únicamente 7 perros presentaron antígenos de D. immitis. Esto puede ser explicado en parte como un reflejo de la disponibilidad del vector. La baja prevalencia de D. immitis encontrada en este estudio confirmó la evidencia anecdótica de que la prevalencia de Dirofilariasis en efecto no es muy alta en la región del Egeo, Turquía. Además, también ha sido reconocido que los programas de control de mosquitos se encuentran bien adaptados en esta región, lo que podría tener una influencia en la seroprevalencia de Dirofilariasis.

Los resultados serológicos positivos pueden ser atribuibles a una exposición previa y no necesariamente a la condición de la enfermedad, de hecho pueden enviar personal clínico para considerar una mayor evaluación clínica y diagnóstica de perros para enfermedades subclínicas subyacentes que probablemente requieren tratamiento. Los resultados de las pruebas serológicas también pueden ser útiles para determinar la prevalencia de enfermedades específicas en un área, como un aporte para comprender la distribución de la enfermedad en pacientes humanos y animales (1).

Aunque en la experiencia de los autores los estudios de seroprevalencia podrían poseer un valor científico más alto en caso de involucrar la expresión de signos clínicos. Las enfermedades son manejadas de forma diferente y todas pueden conllevar complicaciones. La quimioterapia antibacteriana y métodos preventivos que implican la vacunación contra B. burgdorferi, están actualmente disponibles para todas las 4 enfermedades (1) examinadas en el presente estudio.

REFERENCES 1.

Carrade D, Foley J, Sullivan M, Foley CW, Sykes JE. Spatial distribution of seroprevalence for Anaplasma phagocytophilum, Borrelia burgdorferi, Ehrlichia canis, and Dirofilaria immitis in dogs in Washington, Oregon, and California. Vet Clin Pathol 2011; 40(3):293-302.

2.

Bowman D, Little SE, Lorentzen L, Shields J, Sullivan MP, Carlin EP. Prevalence and geographic distribution of Dirofilaria immitis, Borrelia burgdorferi, Ehrlichia canis, and Anaplasma phagocytophilum in dogs in the United States: Results of a national clinic-based serologic survey. Vet Parasitol 2009; 160(1-2):138-48.

4098

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

3.

Carrade DD, Foley JE, Borjesson DL, Sykes JE. Canine granulocytic anaplasmosis: a review. J Vet Int Med 2009; 23:1129-1141.

in Dogs Experimentally Infected with a New Virulent Strain of Ehrlichia canis. Ann N Y Acad Sci 2006; 1078(1):482-486.

4.

Gunes T, Poyraz O, Atas M, Turgut NH. The seroprevalence of Anaplasma phagocytophilum in humans from two diff erent climatic regions of Turkey and its co-seroprevalence rate with Borrelia burgdorferi. Turk J Med Sci 2011; 41(5):903-908.

16. Icen H, Sekin S, Simsek A, Kochan A, Celik OY, Altas MG. Prevalence of Dirofilaria immitis, Ehrlichia canis, Borrelia burgdorferi infection in dogs from Diyarbakir in Turkey. Asıan J Anım Vet Adv 2011; 6(4):371-378.

5.

Kohn B, Silaghi C, Galke D, Arndt G, Pfister K. Infections with Anaplasma phagocytophilum in dogs in Germany. Res Vet Sci 2011; 91:71-76.

6.

7.

8.

9.

Beall MJ, Chandrashekar R, Eberts MD, Cyr KE, Diniz PP, Mainville C, Hegarty BC, Crawford JM, Breitschwerdt EB. Serological and molecular prevalence of Borrelia burgdorferi, Anaplasma phagocytophilum, and Ehrlichia species in dogs from Minnesota. Vector Borne Zoonotic Dis 2008; 8(4):455-64.

Foley JE, Foley P, Madigan JE. Spatial distribution of seropsitivity to the caustitive agent of granulocytic ehrlichiosis in dogs in California.

Am J Vet Res 2001; 62:1599-1605.

Poitout FM, Shinozaki JK, Stockwell PJ, Holland CJ, Shukla SK. Genetic variants of Anaplasma phagocytophilum infecting dogs in Western Washington State. J Clin Microbiol 2005; 43(2):796-801.

Bhide M, Yilmaz Z, Golcu E, Torun S, Mikula I. Seroprevalence of anti-Borrelia burgdorferi antibodies in dogs and horses in Turkey. Ann Agric Environ Med 2008; 15(1):85-90.

10. Uslu O. Köpeklerde Lyme hastalığının araştırılması. [Master Thesis]. Aydın, Turkey: University of Adnan Menderes, Department of Intenal Medicine; 2008.

11. Daniels TJ, Boccia TM, Varde S, Marcus J, Le JH, Bucher DJ et al. Geographic risk for Lyme disease and human granulocytic ehrlichiosis in Southern New York State. Appl Environ Microbiol 1998; 64:4663-4669.

12. Batmaz H, Nevo E, Waner T, Sentürk S, Yilmaz Z, Harrus S. Seroprevalence of Ehrlichia canis antibodies among dogs in Turkey. Vet Rec 2001; 148(21):665-6.

13. Borku MK, Guzel M, Cıngı CC, Ural K, Karakurum MC. Kronik Erlikiozis’li Bir Köpekte Renal Yetmezlik Olgusu. Yuzuncu Yil Univ Saglik Bilim Derg 2003; 14(2):94-96.

14. Erdeğer J, Sancak A, Ataseven L. Detection of Ehrlichia canis in dogs by IFA Test and DotELISA. Turk J Vet Anim Sci 2003; 27:767-773.

15. Unver A, Huang H, Rikihisa Y. Cytokine Gene Expression by Peripheral Blood Leukocytes

17. Skotarczak B. Canine Ehrlichiosis. Ann Agric Environ Med 2003; 10:137-141.

18. Bressler C, Himes LC, Moreau RE. Portal vein and aortic thromboses in a Siberian husky with ehrlichiosis and hypothyroidism. J Small Anim Pract 2003; 44(9):408-10.

19. Aydin L, Bakirci S. Geographical distribution of ticks in Turkey. Parasitol Res 2007; 101(Suppl 2):163-166.

20. Agaoglu Z, Akgul Y, Ceylan E, Akkan H. Van yöresi köpeklerinde Dirofilaria immitis’in yaygınlığı. YYU Vet Fak Derg 2000; 11(2):41-43.

21. Balıkcı E, Sevgili M. Elazığ ve çevresindeki köpeklerde Dirofilaria immitis’in seroprevalansı. Fırat Univ Sag Bil Vet Derg 2005; 19(2):103-106.

22. Kose K. Erzincan Yöresindeki Köpeklerde Dirofilaria immitis’in Prevalansı Üzerine Araştırmalar. [Master Thesis]. Van, Turkey: University of Yuzuncu Yıl, Institute of Health Sciences; 2005.

23. Simsek S, Utuk AE, Koroglu E, Rishniw M. Serological and molecular studies on Dirofilaria immitis in dogs from Turkey. J Helminthol 2008; 82(2):181-186.

24. Taşçı GT. Kars Yöresi Köpeklerinde Dirofilariosis’in Yaygınlığı. [Master Thesis]. Kars, Turkey: University of Kafkas, Institute of Health Sciences; 2005.

25. Voyvoda H, Paşa S, Ozensoy Toz S, Ozbel Y, Ertabaklar H. Aydın’ın bazı ilçe ve köyleri ile İzmir’in Selçuk ilçesindeki köpeklerde Leishmaniosis ve Diroflariosis’in prevalansı. Turk J Vet Anim Sci 2004; 28:1105-1111.

26. Yildirim A. Ankara ve Çevresindeki Köpeklerde Filarial Etkenlerin Prevalansı. [PhD Thesis].

Ankara, Turkey: University of Ankara, Institute of Health Sciences; 2003.

27. Yildirim A, Ica A, Atalay O, Duzlu O, Inci A. Prevalance and epidemiological aspects of Dirofilaria immitis in dogs form Kayseri province, Turkey. Res Vet Sci 2007; 82:358-363.

28. Oncel T, Vural G. Seroprevalence of Dirofilaria immitis in stray dogs in Istanbul and Izmir. Turk J Vet Anim Sci 2005; 29:785-789.

Rev.MVZ Córdoba 19(2):4099-4108, 2014. ISSN: 0122-0268 ORIGINAL

Validation of models with constant bias: an applied approach Validación de modelos con sesgo constante: un enfoque aplicado Salvador Medina-Peralta,1 M.Sc, Luis Vargas-Villamil,2* Ph.D, Jorge Navarro A,3 Ph.D, Leonel Avendaño R,4 Ph.D, Luis Colorado M,1 M.Sc, Enrique Arjona-Suarez,5 Ph.D, German Mendoza-Martinez,6 Ph.D. Universidad Autónoma de Yucatán, Facultad de Matemáticas, Apartado Postal 172 Cordemex, C.P. 97119, Mérida, Yucatán, México. 2Colegio de Postgraduados, Campus Tabasco, Periférico Carlos A. Molina Km. 3.5, Apartado Postal 24, C.P. 86500, Cárdenas, Tabasco, México. 3Universidad Autónoma de Yucatán, Facultad de Medicina Veterinaria y Zootecnia, Apartado Postal 4-116 Itzimná, C.P. 97100, Mérida, Yucatán, México. 4Universidad Autónoma de Baja California, Instituto de Ciencias Agrícolas, 17 Boulevard Delta s/n, Ejido Nuevo León, C.P. 21705, Baja California, México. 5Colegio de Postgraduados, Programa en Estadística, Km 36.5 Carretera México-Texcoco, C.P. 56230, Montecillo, México. 6Universidad Autónoma Metropolitana, Xochimilco, Departamento de Producción Agrícola y Animal, Medicina Veterinaria y Zootecnia, Edificio 34, 3er piso, Calzada del Hueso 1100 Col Villa Quietud 04960, México D.F., México. Correspondencia: luis@avanzavet.com 1

Received: January 2013; Accepted:November 2013.

ABSTRACT Objective. This paper presents extensions to the statistical validation method based on the procedure of Freese when a model shows constant bias (CB) in its predictions and illustrate the method with data from a new mechanistic model that predict weight gain in cattle. Materials and methods. The extensions were the hypothesis tests and maximum anticipated error for the alternative approach, and the confidence interval for a quantile of the distribution of errors. Results. The model evaluated showed CB, once the CB is removed and with a confidence level of 95%, the magnitude of the error does not exceed 0.575 kg. Therefore, the validated model can be used to predict the daily weight gain of cattle, although it will require an adjustment in its structure based on the presence of CB to increase the accuracy of its forecasts. Conclusions. The confidence interval for the 1-α quantile of the distribution of errors after correcting the constant bias, allows determining the top limit for the magnitude of the error of prediction and use it to evaluate the evolution of the model in the forecasting of the system. The confidence interval approach to validate a model is more informative than the hypothesis tests for the same purpose.

Key words: Statistics, error, confidence interval, models (Source: MeSH).

4099

4100

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

RESUMEN Objetivo. Presentar extensiones al método estadístico para validar modelos basado en el procedimiento de Freese cuando el modelo presenta sesgo constante (SC) en sus predicciones e ilustrar el método con datos provenientes de un modelo mecanístico inédito para la predicción de ganancia de peso de bovinos. Materiales y métodos. Las extensiones fueron la prueba de hipótesis y error máximo anticipado para el planteamiento alternativo y el intervalo de confianza para un cuantil de la distribución de los errores. Resultados. El modelo evaluado presentó SC, una vez eliminado y con un nivel de confianza del 95%, la magnitud del error no sobrepasa 0.575 kg. Por lo que el modelo validado puede usarse para predecir la ganancia de peso diaria de bovinos, aunque requerirá un ajuste en su estructura con base a la presencia de SC para incrementar la exactitud en sus pronósticos. Conclusiones. El intervalo de confianza para el cuantil 1-α de la distribución de los errores una vez que se corrige el sesgo constante, permite determinar una cota superior para la magnitud del error de predicción y usarla para evaluar la evolución del modelo en predicción del sistema. El enfoque de intervalos de confianza para validar un modelo es más informativo que las pruebas de hipótesis para el mismo propósito.

Palabras clave: Estadística, error, intervalo de confianza, modelos (Fuente: MeSH).

INTRODUCTION

INTRODUCCIÓN

The validation of a model is defined as the comparison of the forecasts of the model with the values observed in the actual system to determine whether the model is suitable for the established purpose (1, 2). In the mathematical modeling process, the validation stage with observed data different to those used for obtaining the parameters of the model, plays a fundamental role in the models that will be applied and where forecasts will be used instead of the measurements of the actual system, which may be too costly or difficult to obtain. Barrales et al (3) indicate that in modeling of systems, an essential stage, which poses both conceptual and practical difficulties, is the validation of the models.

La validación de un modelo se define como la comparación de las predicciones del modelo con los valores observados del sistema real para determinar si el modelo es adecuado para el propósito establecido (1, 2). En el proceso de modelación matemática, la etapa de validación con datos observados diferentes a los utilizados en la obtención de los parámetros del modelo, juega un papel fundamental para modelos que serán aplicados y donde las predicciones serán empleadas en lugar de las mediciones del sistema real, las cuales pueden ser demasiado costosas o difíciles de obtener. Barrales et al (3) señalan que en la modelación de sistemas, una etapa esencial y que presenta dificultades tanto conceptuales como prácticas, es la validación de los modelos.

Different approaches and techniques have been presented in the literature to validate models. For Mayer and Butler (4), validation techniques can be grouped into four main categories: subjective evaluation (involves a number of experts in the field of interest), visual techniques (comparative graphs), measures of deviation (based on the differences between the values observed and simulated) and statistical tests. In turn, Tedeschi (5) conducted a review of various techniques to evaluate mathematical models designed for predictive purposes: linear regression analysis, adjusted errors analysis, concordance correlation coefficient, several evaluation measurements, mean squared prediction error, non-parametric analysis and comparison of the distribution of the data observed and predicted. Medina-Peralta, Vargas-Villamil (6), indicate that some measures of deviation for validating models contradict with the graphical methods when the model is biased in its forecasts; they recommend using

En la literatura se han expuesto diferentes enfoques y técnicas para validar modelos. Para Mayer y Butler (4), las técnicas de validación se pueden agrupar en cuatro categorías principales: evaluación subjetiva (involucra a un número de expertos en el campo de interés), técnicas visuales (gráficas comparativas), medidas de desviación (basadas en las diferencias entre valores observados y simulados) y pruebas estadísticas. Por su parte, Tedeschi (5) realizó una revisión de varias técnicas para evaluar modelos matemáticos diseñados para propósitos predictivos: análisis de regresión lineal, análisis de los errores ajustados, coeficiente de correlación de concordancia, diversas medidas para evaluación, cuadrado medio del error de predicción, análisis no paramétricos y la comparación de la distribución de los datos observados y predichos. Medina-Peralta, VargasVillamil (6), señalan que algunas medidas de desviación para validar modelos se contradicen

Medina - Validation of models with constant a graphical methods and measures of deviation to validate models.

Freese (7) presented a statistical procedure for validating models without bias (SS) and with constant bias (SC) or proportional bias (SP) in forecasts, which essentially involves determining whether the accuracy and precision of a model or estimation technique meets the requirements of the modeler or user of the model. Rennie and Wiant (8), based on the procedure of Freese (7), proposed the use of an maximum anticipated error or critical error to determine if a model is accurate and precise. Reynolds (9) reviewed the assumptions, deduced the procedure of Freese and extended the results to the case of SS models: a) an alternative approach to the Chi-square test for the accuracy test, b) another critical error based on the alternative approach, and c) a confidence interval (CI) for the quantile 1-α of the distribution of errors.

Barrales et al (3) extended the procedure of Freese (7) and the modification suggested by Rennie and Wiant (8) in two ways: a) explicit expression of the procedures of the statistical test under the original approach, for models with SC or SP when the maximum permissible error is expressed as a percentage of the actual values, and b) indication of how to obtain the critical error under the original approach when the model presents SC or SP. This paper presents the extensions to the statistical method to validate the models proposed by Freese (7), Rennie and Wiant (8), Reynolds (9) and Barrales et al (3) when the model shows SC in its predictions. The method is illustrated with data from a new mechanistic model for the prediction of weight gain in cattle.

MATERIALS AND METHODS Basic concepts. Let’s suppose that there are “n” pairs to compare (Yi, Zi) i=1,2,…,n, where for the pair i, Yi is the observed value, Zi the corresponding predicted value and Di=Yi–Zi the difference between them. On Freese’s approach (7) for the determination of the accuracy and precision required, the e values (maximum error allowed in deviations |yi–zi|=|di|) and α (1-α represents the level of accuracy required) specified by the modeler or user of the model, must satisfy that D conforms to a normal distribution with mean zero and P(|D|≤e)≥(1-α) for the model to be acceptable and be considered as sufficiently reliable for the prediction of the system. Thus, a model is accurate or unbiased (SS) when it is true that D conforms to a normal distribution with zero mean.

4101

con los métodos gráficos cuando el modelo presenta sesgo en sus pronósticos; recomiendan utilizar conjuntamente medidas de desviación y métodos gráficos para validar modelos.

Freese (7) presentó un procedimiento estadístico para validar modelos sin sesgo (SS) y con sesgo constante (SC) o sesgo proporcional (SP) en sus pronósticos, el cual consiste fundamentalmente en determinar si la exactitud y precisión de un modelo o técnica de estimación satisface los requerimientos del modelador o usuario del modelo. Rennie y Wiant (8) basados en el procedimiento de Freese (7), proponen el empleo de un error máximo anticipado o error crítico para determinar si el modelo es exacto y preciso. Reynolds (9) revisó los supuestos, dedujo el procedimiento de Freese y extendió resultados al caso de modelos SS: a) un planteamiento alternativo a la prueba ji-cuadrada para la prueba de precisión, b) otro error crítico basado en el planteamiento alternativo, y c) un intervalo de confianza (IC) para el cuantil 1-α de la distribución de los errores. Barrales et al (3) extendieron el procedimiento de Freese (7) y la modificación sugerida por Rennie y Wiant (8) de dos formas: a) expresión explícita de los procedimientos de la prueba estadística bajo el planteamiento original, para modelos con SC o SP cuando el máximo error permitido se expresa como un porcentaje de los valores reales, y b) indicación de cómo obtener el error crítico bajo el planteamiento original cuando el modelo presenta SC o SP. En este trabajo se presentan extensiones al método estadístico para validar modelos planteados por Freese (7), Rennie y Wiant (8), Reynolds (9) y Barrales et al (3) cuando el modelo presenta SC en sus predicciones. Se ilustra el método con datos provenientes de un modelo mecanístico inédito para la predicción de ganancia de peso de bovinos.

MATERIALES Y MÉTODOS Conceptos básicos. Suponga que se tienen “n” pares para comparar (Yi, Zi) i=1,2,…,n donde para el i-ésimo par, Yi es el valor observado, Zi el valor predicho correspondiente y Di=Yi–Zi la diferencia entre ellos. En el planteamiento de Freese (7) para la determinación de la exactitud y precisión requerida, se necesita que los valores e (máximo error admitido de las desviaciones |y i –z i |=|d i |) y α (1-a representa el nivel de exactitud requerida) especificados por el modelador o usuario del modelo satisfagan respectivamente que D se ajusta a una distribución normal con media

4102

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

Determination of constant bias. According to the graphical method used by Barrales et al (3) and Medina-Peralta, Vargas-Villamil (6), the presence of SC will be identified in the predictions of the model. The SC is recognized by a value of the average of differences ( d ) away from zero and for the graph of the dots (zi, di=yi–zi) forming a horizontal band centered on d with a systematic distribution to positive or negative (points above and below the line d= d ) (6, 10).

A statistical test for determining if the average of the differences is different from zero would contribute to determine the SC more objectively.

Validation of models with constant bias.

When D has a normal distribution with variance σD2 and mean µD [D~N(µD, σD2 )] and the model is not accurate for having SC, the precision required 2 P(|D|≤e)≥ 1-α translates into σD ≤℮2/ once the SC is eliminated by correcting W = D − D (10).

The correction makes the model to accurate and only one statistical test would be precision. The next step is to test the hypothesis with the original 2 2 2 approach H0 : σD2 ≤ e 2 χ12,1−α vs H1 : σD > e χ1,1−α (7, 10) or the alternative approach

vs

(10). Reject H0 o of significance α’ if: o

with a level

(1)

2

where in general χ k , γ represents the quantile γ of the chi-square distribution with “k” degrees of freedom, i.e., P(Xk2 ≤ χ k2, γ ) = γ . Therefore, if H0is not rejected or is rejected, then the model is considered acceptable to forecast under the original and alternative approach, respectively.

Another approach to evaluate precision is through 2 confidence intervals. Thus, when D~N(µD, σD ) and the model shows SC, the critical errors corresponding to the original and the alternative approach are:

(2)

(3) These were obtained by isolating “e” from the rejection regions in equation (1) for H0 and (10); the relationship existing between hypothesis tests and confidence intervals can be found in Casella and Berger (11), which allows constructing one from the other. Therefore, if the

cero y P(|D|≤e)≥(1-a), para que el modelo sea aceptable y éste sea considerado suficientemente confiable para predicción del sistema. Así, un modelo es exacto o sin sesgo (SS) cuando se cumple que D se ajusta a una distribución normal con media cero.

Determinación de sesgo constante. Conforme al método gráfico, empleado por Barrales et al (3) y Medina-Peralta, Vargas-Villamil (6), se identificará la presencia de SC en las predicciones del modelo. El SC es reconocido por un valor del promedio de las diferencias ( d ) alejado del cero y que el gráfico de los puntos (zi, di=yi–zi) forme una banda horizontal centrada alrededor de d con una distribución sistemática a ser positivos o negativos (puntos arriba y debajo de la recta d= d ) (6,10).

Una prueba estadística para determinar si la media de las diferencias es diferente de cero contribuiría a determinar el SC de manera más objetiva.

Validación de modelos con sesgo constante.

Cuando D tiene una distribución normal con 2 2 media µD y varianza σD [D~N(µD, σD )] y el modelo no es exacto por presentar SC, la precisión 2 requerida P(|D|≤e)≥ 1-a se traduce en σD ≤℮2/ una vez que es eliminado el SC mediante la corrección W = D − D (10). La corrección lleva a que el modelo sea exacto y sólo faltaría una prueba estadística para la precisión. El siguiente paso es probar las hipótesis con el planteamiento 2 2 2 2 2 2 original H0 : σD ≤ e χ1,1−α vs H1 : σD > e χ1,1−α (7, 10) o el planteamiento alternativo vs (10). Rechace H0 o con un nivel de significación α’ si: o

(1)

donde en general χ 2k , γ representa el cuantil γ de la distribución ji-cuadrada con “k” grados de libertad, es decir, P(Xk2 ≤ χ k2, γ ) = γ . Por tanto, si H0 no se rechaza o se rechaza entonces el modelo es considerado aceptable para predicción bajo el planteamiento original y el alternativo respectivamente.

Otro enfoque para evaluar la precisión es por medio de intervalos de confianza. Así, cuando 2 D~N(µD, σD ) y el modelo presenta SC los errores críticos correspondientes al planteamiento original y al alternativo son:

(2)

4103

Medina - Validation of models with constant modeler or user of the model specifies a value for “e” such that ℮≥ o ℮≥ then the model is considered acceptable for predicting the system under the original or the alternative approach, respectively.

2

An estimate with an CI of 100(1-α’)% for eSC=( σD )1/2 (10), the quantile 1-α of the distribution of errors (e) once the SC is corrected through wi=di- d , is given by:

(4)

The CI estimated ( ) means that there is a confidence of 100(1-α’)% that the point of the distribution D − D which must be under 100(1-α)% of the absolute errors is located somewhere in such interval. It allows determining with a certain probability an upper bound for the magnitude of the prediction error and use it to evaluate the evolution of the model in the prediction of the system.

RESULTS To illustrate the application of the methodology, data from a new dynamic mechanistic model called Wakax POS were used for the prediction of the average weight gain (AWG) per day of bovine animals in a tropical area of Mexico (Table 1).

This model was developed by Ph.D. Luis Vargas Villamil of Colegio de Postgraduados, Campus Tabasco, in postdoctoral studies at the Department of Animal Science of the University of California, Davis (UCD). The model Wakax POS describes the biological relationships (digestion, bacterial growth, fermentation and absorption) during the nutrition of cattle fed with sugarcane (CZ) and predicts the average weight gain (AWG) per day in grazing cattle supplemented with CZ, broken corn and/or molasses in a tropical area of Mexico. It consists of 119 states variables that describe the system composed of five sub-models: concentrates, grass, sugarcane, molasses and animal growth. The input variables of the model are: a) live weight; b) consumption of dry matter of corn, molasses, and grass; c) soluble fraction of grass and CZ; d) biodegradable fraction of grass and CZ; and e) ratio of grass and CZ degradation (10).

The goodness of fit tests of Cramer-von Mises (W2=2.172, p<0.003) and Anderson-Darling (A 2=10.733, p<0.003) reject (p<0.05) the 2 hypothesis D~N(0, σD ) with unspecified variance, hence the model is not accurate.

(3) Estos se obtuvieron al despejar “e” de las regiones de rechazo en la ecuación (1) para H0 y (10); en Casella y Berger (11) puede consultarse la relación existente entre pruebas de hipótesis e intervalos de confianza, la cual permite construir uno a partir del otro. Por lo tanto, si el modelador o usuario del modelo especifica un valor de “e” tal que ℮≥ o℮≥ entonces el modelo es considerado aceptable para predecir el sistema bajo el planteamiento original o el alternativo respectivamente.

Una estimación por IC del 100(1-a’)% para eSC=( σD2 )1/2 (10), el cuantil 1-a de la distribución de los errores (e) una vez que se corrige el SC mediante wi=di- d , está dado por:

(4)

El IC estimado ( ) significa que se tiene confianza en un 100(1-a’)% que el punto de la distribución D − D que tiene debajo el 100(1-a)% de los errores absolutos está localizado en alguna parte de dicho intervalo. Permite determinar con cierta probabilidad una cota superior para la magnitud del error de predicción y usarla para evaluar la evolución del modelo en predicción del sistema.

RESULTADOS Para ilustrar la aplicación de la metodología se utilizaron datos provenientes de un modelo dinámico mecanístico inédito llamado Wakax POS para la predicción de la ganancia de peso promedio (GPP) por día de bovinos en una zona tropical de México (Tabla 1). Este modelo fue desarrollado por el Dr. Luis Vargas Villamil del Colegio de Postgraduados, Campus Tabasco, en una estancia posdoctoral en el Departamento de Ciencia Animal de la Universidad de California, Davis (UCD). El modelo Wakax POS describe las relaciones biológicas (digestión, crecimiento bacteriano, fermentación y absorción) durante la nutrición de bovinos alimentados con caña de azúcar (CZ) y predice la ganancia de peso promedio (GPP) por día de bovinos en pastoreo suplementado con CZ, maíz quebrado y/o melaza en una zona tropical de México. Consta de 119 variables de estado que describen el sistema

4104

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

Table 1. Weight gain averages (kg) observed and predicted in 34 experiments.

Observed (yi)

Modeled (zi)

Difference (di=yi-zi)

Correction for SC (wi=di-0.233)

0.366 0.398 0.4930 0.630 0.430 0.400 0.490 0.600 0 0.430 0.700 0.690 0.500 0.680 0.620 0.520 0.640 0.450 0.430 0.760 0.036 0.019 0.412 0.052 0.414 0.050 0.292 0.054 0.308 0.054 0.037 0.051 0.062 0.364

0 0 0.390 0.430 0.130 0.280 0.230 0.290 0.280 0.090 0.320 0.330 0.020 0 0 0.260 0 0 0.330 0.390 0 0 0 0 0 0 0.350 0 0.390 0 0 0 0 0

0.366 0.398 0.103 0.200 0.300 0.120 0.260 0.310 -0.280 0.340 0.380 0.360 0.480 0.680 0.620 0.260 0.640 0.450 0.100 0.370 0.036 0.019 0.412 0.052 0.414 0.050 -0.058 0.054 -0.082 0.054 0.037 0.051 0.062 0.364

0.133 0.165 -0.13 -0.033 0.067 -0.113 0.027 0.077 -0.513 0.107 0.147 0.127 0.247 0.447 0.387 0.027 0.407 0.217 -0.133 0.137 -0.197 -0.214 0.179 -0.181 0.181 -0.183 -0.291 -0.179 -0.315 -0.179 -0.196 -0.182 -0.171 0.131

2

The next step is to test D~N(µ D , σD ) with unspecified mean and variance and identify the type of bias. The hypothesis D~N(µ D , σD2 ) is not rejected (p>0.05) (Cramer-von Mises: W2=0.118, p=0.065; Anderson-Darling: A2=0.655, p=0.084; Shapiro-Wilks: W=0.961, p=0.254; Kolmogorov-Smirnov: KS=0.135, p=0.115). In addition, the distribution of the points in figure 1 shows SC, because: (i) the mean of the differences (µD) is different from zero (t=6.092, g.l.=33, p<0.001), and (ii) the points (zi, di) practically form a horizontal band centered on the line d =0.233.

compuesto por cinco submodelos: concentrado, pasto, caña de azúcar, melaza y crecimiento animal. Las variables de entrada del modelo son: a) peso vivo; b) consumo de materia seca de maíz, melaza y pasto; c) fracción soluble de pasto y CZ; d) fracción degradable de pasto y CZ; y e) razón de degradación de pasto y CZ (10).

Las pruebas de bondad de ajuste de Cramér-von Mises (W2=2.172, p<0.003) y Anderson-Darling (A2=10.733, p<0.003) rechazan (p<0.05) la 2 hipótesis D~N(0, σD ) con varianza no especificada, por lo que el modelo no es exacto.

2

El siguiente paso es probar si D~N(µD, σD ) con media y varianza no especificadas e identificar 2 el tipo de sesgo. La hipótesis D~N(µD, σD ) no se 2 rechaza (p>0.05) (Cramér-von Mises: W =0.118, p=0.065; Anderson-Darling: A2=0.655, p=0.084; Shapiro-Wilks: W=0.961, p=0.254; KolmogorovSmirnov: KS=0.135, p=0.115). Además, la distribución de los puntos en la figura 1 muestra SC, ya que: (i) la media de las diferencias (µD ) es diferente de cero (t=6.092, g.l.=33, p<0.001), y (ii) los puntos (zi, di) forman prácticamente una banda horizontal centrada alrededor de la recta d =0.233.

El siguiente paso es aplicar la corrección por SC para que el modelo sea exacto y probar si 2 W = D − D ~ N(0, σ W ) con varianza no especificada.

Las pruebas de bondad de ajuste de Cramér-von Mises (W2=0.122, p>0.25) y Anderson-Darling (A2=0.675, p>0.25) no rechazan (p>0.05) la 2 hipótesis W~ N(0, σ W ) .

En este ejemplo se aplicaron ambos enfoques, el de pruebas de hipótesis y el de intervalos de confianza, cuando el modelo presenta SC en sus predicciones. Adicionalmente, se calculó el IC del 95% para eSC, el cuantil 1-a de la distribución de los errores (e) una vez que se

The last step is to apply the correction for SC for 2 the model to be exact and test W = D − D ~ N(0, σ W ) with unspecified variance.

The goodness of fit tests of Cramer-von Mises (W 2=0.122, p>0.25) and Anderson-Darling (A2=0.675, p>0.25) do not reject (p>0.05) the 2 hypothesis W~ N(0, σ W ).

In this example both approaches were applied, that of the hypothesis tests and that of the confidence intervals, when the model shows SC in its forecasts.

Figure 1. Relationship between the bias (di) and the values simulated (z i) for average weight gain, where đ is the average of the differences (di).

Medina - Validation of models with constant Additionally, a 95% CI was calculated for eSC, quantile 1-α of the distribution of errors (e) once the SC is corrected by wi=di- d . With α=α’=0.05 y e=0.5 kg as the maximum error admitted by the modeler or the user of the model, we have that: a) P(|D| 2 ≤0.5kg)≥0.95, b) σD ≤(℮2/ )=0.065, c) VSC=25.220 and a level of significance p=0.832 with the original approach (PO) and p=0.168 with the alternative approach (PA). Therefore, the model is considered acceptable for prediction with PO (p>0.05) and unacceptable with the PA (p>0.05).

The maximum anticipated errors or critical errors are =0.365 kg and =0.550 kg; therefore, the modeler or user of the model specifies a precision “e” (P(|D|≤e≥0.95)) such that e≥ =0.365 kg or e≥ =0.550 kg, then the model will be considered reliable enough in the prediction of the system based on the PO and PA, respectively. Thus, if e=0.5 kg model is considered acceptable for prediction with the PO (e≥0.365 kg) and unacceptable with the PA (e<0.550 kg), which coincides with the statistical decisions obtained with the hypothesis testing approach.

The CI of 1-α’=95% for eSC is 0.353 kg <eSC< 0.575 kg, so there is a confidence of 1-α’ = 95% that the point of the |W| distribution which is under 1-α = 95% of the absolute errors (|d- d |) is located somewhere in the interval (0.353 kg-0.575 kg), i.e., with a probability of 95% the magnitude of the forecast error will not exceed 0.575 kg.

With a confidence of 95% of the critical error with the PA and the CI for eSC, a minimum prediction error of 0.550 kg should be allowed, and it would not exceed 0.575 kg. Hence, the validated model could be used to predict the daily AWG of cattle, although it will require an adjustment based on the presence of SC to increase the accuracy of its forecasts.

DISCUSSION The extensions presented for validating models in the presence of SC are applied without the model being modified in its structure, since the type of bias on the available data (zi, yi) is eliminated through the values of the bias (di), i.e. di- d is the correction for SC. Identifying the type of bias would allow improving the structure and evaluation of the model through testing its structure and the data and methods used in all the processes for its construction and validation. For Barrales et al (3), detecting the presence of bias in the model would allow the user to identify in his model the causes that produce

4105

corrige el SC mediante wi=di- d . Con a=a’=0.05 y e=0.5 kg como el máximo error que admite el modelador o usuario del modelo, se tiene: a) 2 P(|D| ≤0.5kg)≥0.95, b) σD ≤(℮2/ )=0.065, SC c) V =25.220 y nivel de significación p=0.832 con el planteamiento original (PO) y p=0.168 con el alternativo (PA). Por lo tanto, el modelo es considerado aceptable para predicción con el PO (p>0.05) y no lo es con el PA (p>0.05).

Los errores máximos anticipados o errores críticos son =0.365 kg y =0.550 kg , por lo tanto, si el modelador o usuario del modelo especifica una precisión “e” (P(|D|≤e)≥0.95) tal que e≥ =0.365 kg o e≥ =0.550 kg, entonces el modelo será considerado suficientemente confiable en predicción del sistema con base en el PO y PA respectivamente. Así, si e=0.5 kg el modelo es considerado aceptable para predicción con el PO (e≥0.365 kg) y no lo es con el PA (e<0.550 kg), la cual coincide con las decisiones estadísticas obtenidas con el enfoque de pruebas de hipótesis.

El IC del 1-a’=95% para eSC es 0.353 kg <eSC<0.575 kg, por lo que se tiene confianza en un 1-a’=95% de que el punto de la distribución |W| que tiene debajo el 1-a=95% de los errores absolutos (|d- d |) está localizado en alguna parte en el intervalo (0.353 kg–0.575 kg), es decir, con probabilidad del 95% la magnitud del error de predicción no sobrepasa 0.575 kg.

Con 95% de confianza, del error crítico con el PA y el IC para eSC, tendría que permitirse como mínimo 0.550 kg de error de predicción y éste no sobrepasaría 0.575 kg. Así, el modelo validado podría usarse para predecir la GPP diaria de bovinos, aunque requerirá un ajuste con base a la presencia de SC para incrementar la exactitud en sus pronósticos.

DISCUSIÓN Las extensiones presentadas para validar modelos en presencia de SC se aplican sin que el modelo sea modificado en su estructura, ya que se elimina el tipo de sesgo a los datos disponibles (zi, yi) a través de los valores del sesgo (di), es decir, di- d es la corrección por SC. Identificar el tipo de sesgo permitiría mejorar la estructura y evaluación del modelo a través de cuestionar desde su estructura hasta los datos y métodos empleados en todos los procesos de su construcción y validación. Para Barrales et al (3) detectar en el modelo la presencia de sesgo permitiría al usuario identificar en su modelo la o las causas que lo producen y corregir deficiencias

4106

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

it and correct any deficiencies in the forecasting behavior, what would lead to decrease discrepancies between what has been estimated by the model and the values provided by the real scenario, allowing the conclusions obtained about the reliability of the model to meet the objectives established. On the other hand, Tedeschi (5) indicates that the identification and acceptance of inaccuracies in a model are step towards the evolution of a more accurate and reliable model.

en el comportamiento predictivo, lo que llevaría a disminuir las discrepancias entre lo estimado por el modelo y los valores proporcionados por el escenario real, permitiendo que las conclusiones que se obtengan acerca de la confiabilidad del modelo cumplan con los objetivos establecidos.

Por su parte Tedeschi (5), señala que la identificación y aceptación de inexactitudes de un modelo es un paso hacia la evolución de un modelo más exacto y de mayor confianza.

The statistical test and critical error with the alternative approach require a value higher than the maximum permissible error (e) than in the original approach to infer that the model is acceptable. This can be observed, for example, with critical errors, because if α’=0.5 then e*=e** and if α’<0.5 then e*<e**. Thus, for a value α’<0.5 and “e” such that e*<e<e**, it follows that the model is adequate using the critical error of the original approach (e>e*) and not the alternative (e<e**). Reynolds (9) indicates that the statistical test for the alternative approach is more conservative and probably preferable to the original approach by more users of the model who need to be reasonably sure that the model will meet their accuracy requirements. The drawback of applying the original approach is the ambiguity that arises by not rejecting the null hypothesis (H0), since what can be inferred is that the data do not provide sufficient evidence to reject it and that the statement established in H0 will not be accepted.

In addition, the research hypothesis is proposed in the alternative hypothesis.

La prueba estadística y error crítico con el planteamiento alternativo requieren un valor más grande del máximo error admisible (e) que el planteamiento original para inferir que el modelo es aceptable. Esto puede observarse, por ejemplo, con los errores críticos, ya que si a’=0.5 entonces e*=e** y si a’<0.5 se tiene que e*<e**. Así, para un valor a’<0.5 y “e” tal que e*<e<e**, se sigue que el modelo es adecuado empleando el error crítico del planteamiento original (e>e*) y no lo es con el alternativo (e<e**).

Reynolds (9) señala que la prueba estadística para el planteamiento alternativo es más conservadora y probablemente preferible al planteamiento original por más usuarios del modelo quienes necesitan estar razonablemente seguros que el modelo cumplirá con sus requerimientos de exactitud. El inconveniente de aplicar el planteamiento original es la ambigüedad que se presenta al no rechazar a la hipótesis nula (H0), ya que lo que se puede inferir es que los datos no proporcionan suficiente evidencia para rechazarla y no que se acepte la declaración establecida en H0. Además, de que la hipótesis de investigación se plantea en la hipótesis alternativa.

Validation by means of the critical errors or the confidence limits approach comes down to calculate the maximum anticipated error or critical error, where the modeler or user decides if the model is acceptable in the prediction of the system, by comparing the critical error with the accuracy required (e) under the values α and α’ specified in advance. This involves a sound understanding of the system by the modeler or the user of the model to establish the maximum permissible error (e). Barrales et al (3) indicate that conceptually, the maximum allowable error and the critical error represent the same, but with the difference that the first is established a priori by the modeler whereas the second is calculated ex-post.

La validación por medio de los errores críticos o de enfoque de límites de confianza se reduce a calcular el error máximo anticipado o error crítico, en donde el modelador o usuario decide si el modelo es aceptable en predicción del sistema, al comparar el error crítico con la exactitud requerida (e) bajo los valores a y a’ especificados con anticipación. Lo anterior implica una buena comprensión del sistema por parte del modelador o usuario del modelo para establecer el máximo error admisible (e). Barrales et al (3) señalan que conceptualmente el máximo error admisible y el error crítico representan lo mismo, pero con la diferencia de que el primero se establece a priori por el modelador, mientras que el segundo se calcula a posteriori.

The estimated CI of 100(1-α’)% for the quantile 1-α of the distribution of errors once the SC is corrected, means a confidence of 100(1-α’)% in that the point of the distribution of errors under 100(1-α)% of the absolute errors is located somewhere in such interval and allows determining, with a certain probability, an upper limit for the magnitude of the prediction error. The CI approach to determine if the model is acceptable to predict, according to

El IC estimado del 100(1-a’)% para el cuantil 1-a de la distribución de los errores una vez que se corrige el SC, significa que se tiene confianza en un 100(1-a’)% que el punto de la distribución de los errores que tiene debajo el 100(1-a)% de los errores absolutos está localizado en alguna parte de dicho intervalo y permite determinar, con cierta probabilidad, una cota superior para la magnitud del error de predicción. El enfoque de IC para determinar si el modelo es aceptable

Medina - Validation of models with constant

4107

requirements of the modeler or the user of the model, is more informative than the hypotheses tests for the same purpose, since they provide the range of possible values for the parameter under consideration and are not as categorical as hypothesis testing.

para predecir, según requerimientos del modelador o usuario del modelo, es más informativo que las pruebas de hipótesis para el mismo propósito, ya que proporcionan la amplitud de los posibles valores del parámetro en consideración y no son tan categóricos como las pruebas de hipótesis.

Moreover, Barrales et al (3) indicate that the confidence limits approach is widely applied, but requires the modeler to be aware of the variability associated with the particular application, in order to allow him to decide, with respect to the magnitude of the limit error (maximum permissible error) in accordance with the accuracy needed for the purposes of the model.

Por otra parte Barrales et al (3) indican que el enfoque de límites de confianza, es de mayor aplicabilidad, pero requiere por parte del modelador un conocimiento de las variabilidades asociadas a la particular aplicación, de manera que le permita decidir, con respecto a la magnitud del error límite (máximo error admisible) de acuerdo con la exactitud necesitada para los fines del modelo.

It should be noted that in the validation of a model, it is recommended to use various methods, for example, measures of deviation together with graphical methods (6) and simple linear regression techniques to assess whether a model is accurate and precise (5).

Cabe señalar que en la validación de un modelo es recomendable utilizar varios métodos, por ejemplo, medidas de desviación conjuntamente con métodos gráficos (6) y la técnica de regresión lineal simple para evaluar si un modelo es exacto y preciso (5).

In conclusion, the validation of models based on Freese’s approach and those presented in this article, constitute a statistical method consisting of hypothesis testing and confidence intervals to determine if the outputs of the model are sufficiently close to the observed values in the actual system.

The method allows analyzing data from models without bias, constant or proportional bias in their forecasts without modifying the structure of the model.

The confidence interval estimate for the quantile 1-α of the distribution of errors, once the constant bias has been corrected, allows determining an upper bound for the magnitude of the prediction error and use it to evaluate the evolution of the model in the prediction of the system.

The confidence intervals approach to determine if the model is acceptable to predict is more informative than the hypothesis tests for the same purpose; in the sense that it allows to know the maximum allowable error of prediction ex post.

Therefore, the confidence intervals approach is recommended.

Acknowledgements To the Undersecretary’s Office of Higher Education and Scientific Research, Programme for the Improvement of Teacher Training of the Secretary’s Office of Public Education of Mexico for financing this research. To UCMEXUS for the support in the postdoctoral work of Ph.D. Luis Vargas-Villamil in the Department of Animal Science of the University of California, Davis.

En conclusión la validación de modelos, basada en el planteamiento de Freese y los presentados en este artículo, constituyen un método estadístico formado por pruebas de hipótesis e intervalos de confianza para determinar si las salidas del modelo están suficientemente próximas a los valores observados del sistema real. El método permite analizar datos provenientes de modelos sin sesgo, sesgo constante o proporcional en sus pronósticos sin modificar la estructura del modelo.

El intervalo de confianza estimado para el cuantil 1-a de la distribución de los errores una vez que se corrige el sesgo constante, permite determinar una cota superior para la magnitud del error de predicción y usarla para evaluar la evolución del modelo en predicción del sistema.

El enfoque de intervalos de confianza para determinar si el modelo es aceptable para predecir es más informativo que las pruebas de hipótesis para el mismo propósito; en el sentido de que permite a posteriori conocer el máximo error admisible de predicción.

Por lo que se recomienda el enfoque de intervalos de confianza.

Agradecimientos A la Subsecretaría de Educación Superior e Investigación Científica, Programa de Mejoramiento del Profesorado de la Secretaría de Educación Pública de México por el financiamiento a esta investigación.

A UCMEXUS por el apoyo en el trabajo post-doctoral del Dr. Luis Vargas-Villamil en el Departamento de Ciencia Animal de la Universidad de California, Davis.

4108

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

REFERENCES 1.

Oberkampf WL, Trucano TG. Verification and validation in computational fluid dynamics.

Prog Aerosp Sci 2002; 38(3):209-72.

2.

Halachmi I, Edan Y, Moallem U, Maltz E. Predicting feed intake of the individual dairy cow. J Dairy Sci 2004; 87(7):2254-67.

3.

Barrales VL, Peña R, Fernández R. Model validation: an applied approach. Agric Tech (Chile) 2004; 64:66-73.

4.

Mayer DG, Butler DG. Statistical Validation.

Ecol Model 1993; 68(1-2):21-32.

5.

Tedeschi LO. Assessment of the adequacy of mathematical models. Agr Syst 2006; 89(2-3):225-47.

6.

Medina-Peralta S, Vargas-Villamil L, Navarro-Alberto J, Canul-Pech C, PerazaRomero S. Comparación de medidas de desviación para validar modelos sin sesgo, sesgo constante o proporcional. Univ Cienc 2010; 26(3):255-63.

7.

Freese F. Testing accuracy. For Sci 1960; 6:139-45.

8.

Rennie JC, Wiant HVJ. Modification of Freese’s chi-square test of accuracy. Note BLM Denver Colorado: USDI Bureau of Land Management; 1978.

9.

Reynolds MR. Estimating the Error in Model Predictions. For Sci 1984; 30(2):454-69.

10. M e d i n a P S . Va l i d a c i ó n d e m o d e l o s mecanísticos basada en la prueba jicuadrada de Freese, su modificación y extensión. Montecillo, Mexico: Colegio de Postgraduados; 2006.

11. Casella G., Berger RL. Statistical Inference, Pacific Grove CA USA. USA: Duxbury Thompson Learning; 2002.

Rev.MVZ Córdoba 19(2):4109-4115, 2014. ISSN: 0122-0268 ORIGINAL

Using of essential oils in the treatment of mice infected with Trypanosoma evansi Uso de aceites esenciales en el tratamiento de ratones infectados con Trypanosoma evansi Matheus D Baldissera,1,2 Biomed, Aleksandro S Da Silva,3* Ph.D, Camila B Oliveira,1 Ph.D, Rodrigo A Vaucher,2 Ph.D, Roberto CV Santos,2 Ph.D, Janice L Giongo,4 Ph.D, Dianni M Capeleto,1 M.Sc, Alexandre A Tonin,1 Ph.D, Silvia G Monteiro,1 Ph.D. Universidade Federal de Santa María (UFSM), Departamento de Microbiología y Parasitología, Avenida Roraima, 1000 - Camobi, Santa Maria - RS, 97105-900, Brasil. 2Centro Universitário Franciscano (UNIFRA), SRua dos Andradas, 1614 - Centro, Santa Maria - RS, 97010-032, Brasil. 3Universidade do Estado de Santa Catarina (UDESC), Departamento de Zootecnia, Avenida Madre Benvenuta, 2007 - Itacorubi, Florianópolis SC, 88035-001, Brasil. 4Universidade Regional Integrada do Alto do Uruguai (URI), Laboratorio de Tecnología Farmacéutica, Centro de Ciências da Saúde, Avenida Batista Bonoto Sobrinho, 733 - Santiago/RS - 97700-000, Brasil. *Correspondencia: aleksandro_ss@yahoo.com.br 1

Received: October 2013; Accepted:January 2013.

ABSTRACT Objective. This study aimed to test the effectiveness of copaiba, andiroba and aroeira essential oils for controlling trypanosomosis by Trypanosoma evansi with mice as experimental model. Materials and methods. Sixty-six mice were divided into eleven groups (A to L) with six animals each. Group A was the unique composed by healthy and uninfected animals (negative control). Animals in groups B to L were inoculated with 0.1 mL of blood containing 2.7 x 106 trypanosomes. Group B was used as a positive control without treatment. In experiment were tested copaiba (C, D and E), andiroba (F, G and H) and aroeira (I, J and L) oils at doses of 0.6, 0.8 and 1.0 mL kg-1 to infected mice (T. evansi).

Results. These protocols did not provide curative efficacy; however, the mice treated with highest dose of copaiba showed a significant increase in the longevity when compared others groups. Conclusions.

Previously in our studies, these essential oils have shown trypanocidal activity in vitro, but when they were tested in vivo in mice infected with T. evansi, this trypanocidal activity, or the curative effect was not found, being only able to prolong the lifespan of the animals treated with copaiba oil.

Key words: Copaiba, in vitro, longevidad, mice, oils (Source: CAB, MeSH).

RESUMEN Objetivo. Este estudio tuvo como objetivo evaluar la eficacia de los aceites esenciales de copaiba, andiroba y aroeira para controlar la tripanosomiasis por Trypanosoma evansi con ratones como modelo experimental. Materiales y métodos. Sesenta y seis ratones se dividieron en once grupos (A a L) con seis animales cada uno. Grupo A fue el único compuesto por los animales sanos y no infectadas (control negativo). Los animales en los grupos B a L fueron inoculados con 0,1 mL de sangre que contiene 2.7 x 106 tripanosomas. Grupo B se utilizó como control positivo, sin tratamiento. En el

4109

4110

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

experimento se pusieron a prueba los aceites de copaiba (C, D y E), andiroba (F, G y H) y aroeira (I, J y L) en una dosis de 0.6, 0.8 y 1.0 ml kg-1 en ratones infectados (T. evansi). Resultados. Estos protocolos no proporcionan una eficacia curativa; sin embargo, los ratones tratados con la dosis más alta de copaiba mostraron un aumento significativo en longevidad en comparación con otros grupos.

Conclusiones. De forma previa en nuestros estudios, estos aceites esenciales han demostrado actividad tripanocida in vitro, pero cuando se ensayaron in vivo en ratones infectados con T. evansi, no se encontró esta actividad tripanocida o el efecto curativo, siendo sólo capaz de prolongar la vida de los animales tratados con aceite de copaiba.

Palabras clave: Aceites, copaiba, in vitro, longevity, ratones (Fuente: CAB, MeSH).

INTRODUCTION

INTRODUCCIÓN

The properties of some components present on medicinal plants have drawn the attention of the population and the scientific community (1). In this context, natural resources from the Amazon region generate interest to be used as herbal medicines, such as copaiba and andiroba oils (2).

Another plant of the region of South America that has excelled results in research is aroeira (3,4).

Las propiedades de algunos componentes presentes en plantas medicinales han llamado la atención de la población y la comunidad científica (1). En este contexto, los recursos naturales de la región amazónica generan interés para ser utilizados como hierbas medicinales, como los aceites de copaiba y andiroba (2). Otra planta de la región de América del Sur que se ha destacado por sus resultados en investigaciones es la aroeira (3,4).

Copaiba oil is extracted from the trunk Copaifera spp., (Leguminosae) a common tree of in the Amazon rainforest (5). In folk medicine this oil resin is commonly used, because it has been described anti-inflammatory action (6), gastric protection, have healing effect (7), bactericidal (6) and phytopathogenic activity (8). The andiroba oil is extracted from a tree known as Carapa guianensis, which belongs to the Meliaceae family, found in several countries in South America (9). Its oil is used in folk medicine due to its properties, such as analgesic, antiinflammatory, antibacterial, antiparasitic and in therapy against various types of cancer (1013), besides having acaricide effect (9), as well as the larvicidal properties (14). The aroeira oil (Schinus molle L.), which has anti-inflammatory and antimicrobial properties, is extracted from a plant belonging to the family Anacardiciaceae, with several species distributed in southern Brazil (3,4). In vitro trypanocidal activity of copaiba, andiroba and aroeira essential oils has been already confirmed in preliminaries studies (15,16).

Trypanosoma evansi is a protozoan, the etiological agent of the disease known as “Mal das cadeiras” or “Surra” in horses (17). The treatment of trypanosomosis by T. evansi is based on antiprotozoal drugs such as suramine, diminazene aceturate, quinapyramine, melarsoprol and isometamidium (18). The diminazene aceturate is the most commonly drug used for controlling the trypanosomosis in domestic animals, since it presents a higher therapeutic index when compared to the other drugs used in this species, besides its lower cost (19). The greatest

El aceite de copaiba se extrae del tronco de Copaifera spp., (Leguminosae) un árbol común en la selva amazónica (5). En la medicina popular esta resina de aceite se utiliza comúnmente por sus efectos antiinflamatorios (6), protección gástrica, efectos curativos (7), bactericida (6) y actividad fitopatógenas (8). El aceite de andiroba se extrae de un árbol denominado Carapa guianensis, el cual pertenece a la familia Meliaceae y es encontrado en varios países de América del Sur (9). Su aceite es utilizado en la medicina popular debido a sus propiedades como analgésico, antiinflamatorio, antibacteriano, antiparasitario y como terapia en contra de varios tipos de cáncer (10-13), además de tener un efecto acaricida (9) así como propiedades larvicidas (14). El aceite de aroeira (Schinus molle L.), el cual posee propiedades antiinflamatorias y antimicrobianas, se extrae de una planta que pertenece a la familia Anacardiciaceae, con varias especies distribuidas en el sur de Brasil (3,4).

La actividad tripanocida in vitro de los aceites esenciales de copaiba, andiroba y aroeira ya ha sido confirmada en estudios preliminares (15,16).

Trypanosoma evansi es un protozoo, el agente etiológico de la enfermedad conocida como “Mal das cadeiras” o “Surra” en caballos (17).

El tratamiento de la tripanosomiasis por T. evansi se basa en fármacos antiprotozoarios como suramina, diaminazina aceturato, quinapiramina, melarsoprol e isometamidium (18). La diaminazina aceturato es el medicamento más comúnmente usado para controlar la

Baldissera - Using of essential oils in the tretment of mice difficulties faced in trypanosomosis therapy are the high toxicity and the emergence of resistant strains, mainly due to the fact that most of these compounds are used in the field therapy for more than forty years (17). It is clear the needs for researches focusing in new therapeutic options, and, therefore, the aim of this study was assess the effectiveness of copaiba, andiroba and aroeira essential oils on the trypanosomosis controlling, using as experimental model mice infected with Trypanosoma evansi.

MATERIAL AND METHODS Study site. The experiment was conducted at Veterinary Parasitology Laboratory, at Santa Maria Federal University, in Santa Maria city, Brazil.

Evaluated oils. Andiroba oil (Carapa guianensis) RF3150 and copaiba oil (Copaifera officinalis) RF3350 were purchased from Beraca Sabará Chemical and Ingredients S/A (São Paulo, Brazil). The leaves of the species Schinus molle L. were collected in the biological reserve of the Universidade da Região da Campanha (URCAMP), Bagé/RS, and extracted in laboratory as previously described (16). This study was used an isolate of T. evansi (LPV-2005) (20) kept cryopreserved in liquid nitrogen in laboratory.

During the first step one rats (R1) were inoculated intraperitoneally with infected blood by T. evansi to obtain a large amount of viable parasites for infection of experimental groups.

Experimental animal. Sixty-six mice (female), 70 days old and weighing an average of 24±0.4 grams were used as the experimental model.

They were kept in cages, six mice each, housed on a light/dark cycle of 12 h, and in an experimental room with temperature and humidity controlled (25ºC; 70% respectively).

They were fed with commercial ration and water ad libitum. All animals were submitted to a period of 10 days for adaptation.

Experimental design and treatments. The mice were divided into eleven groups (A to L) with six animals each. Group A was the unique composed by healthy and uninfected animals (negative control). Animals in groups B to L were inoculated intraperitoneally with 0.1 mL of blood from a rat (R1) containing 2.7 x 106 trypanosomes (on Day 0). Group B was used as a positive control without treatment, while mice of groups C, D and E received treatment with copaiba oil in doses 0.6, 0.8 and 1.0 mL kg-1, respectively. Groups F, G and H were treated with andiroba oil at 0.6, 0.8 and 1.0 mL kg-1,

4111

tripanosomiasis en animales domésticos, ya que presenta un mayor índice terapéutico en comparación con otros fármacos utilizados en esta especie, además de tener un menor costo (19). Las mayores dificultades en la terapia contra la tripanosomiasis son la alta toxicidad y la aparición de cepas resistentes, debido principalmente al hecho de que la mayoría de estos compuestos ha sido utilizado en terapia de campo durante más de cuarenta años (17). Está claro que las necesidades de las investigaciones que se centran en nuevas opciones terapéuticas y, por lo tanto, el objetivo de este estudio, fue la evaluación de la efectividad de los aceites esenciales de copaiba, andiroba y aroeira en el control de la tripanosomiasis, utilizando ratones infectados con Trypanosoma evansi como modelo experimental.

MATERIALES Y MÉTODOS Sitio de estudio. El experimento se realizó en el Laboratorio de Parasitología Veterinaria, en la Universidad Federal de Santa María en la ciudad de Santa María, Brasil.

Aceites evaluados. Se adquirió el aceite de andiroba (Carapa guianensis) RF3150 y el aceite copaiba (Copaifera officinalis) RF3350 de Beraca Sabará Chemical and Ingredients S/A (Sao Paulo, Brasil). Las hojas de la especie Schinus molle L. fueron recolectadas en la reserva biológica de la Universidade da Região da Campanha (URCAMP), Bagé/RS y se extrajeron en un laboratorio según se describió anteriormente (16). En este estudio se utilizó una cepa aislada de T. evansi (LPV-2005) (20) que fue criopreservada en nitrógeno líquido en el laboratorio. Durante el primer paso, las ratas (R1) fueron inoculados intraperitonealmente con sangre infectada con T. evansi para obtener una gran cantidad de parásitos viables para la infección de los grupos experimentales.

Animales experimentales. Sesenta y seis ratones (hembras) de 70 días de edad y con un peso promedio de 24±0.4 gramos fueron utilizados como modelo experimental. Éstos se mantuvieron en jaulas, seis ratones en cada una, ubicados en un ciclo de luz/oscuridad de 12 h y en una habitación experimental con temperatura y humedad controladas (25°C; 70% respectivamente). Fueron alimentados con alimento comercial y agua ad libitum. Todos los animales fueron sometidos a un período de adaptación de 10 días.

Diseño experimental y tratamientos. Los ratones fueron divididos en once grupos (A a L) con

4112

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

respectively. Additionally, Groups I, J and L received treatment with aroeira oil at 0.6, 0.8 and 1.0 mL kg-1, respectively. Treatment with essential oils was done, in all groups, orally.

Two hours after inoculation of trypomastigotes (Day 0) the treatment was initiated, being it kept during three days, with dose intervals of 24 hours.

Evaluation of the experimental animals. The mice were observed for up to 20 days; being the evolution of parasitemia and the effect of the treatment were daily monitored through blood smear. Each slide was prepared with fresh blood collected from the tail vein, stained by the panoptic method, and visualized at a magnification of 1000 x.

Efficacy of treatment was determined by the number of animals healed after infection with T. evansi. However, to assess the treatment effect of essential oils, prepatent period, longevity and mortality of mice was determined.

Statistical analysis. The results of the prepatency period and longevity were submitted to analysis of variance followed by Duncan test (p<0.05).

Ethical approval. The Animal Welfare Committee of Federal University of Santa Maria approved the procedure, number 65/2012.

RESULTS

The positive control group (group B) had in average a prepatent period of 24 hours. Groups C, F, G, I and L had similar prepatent period, while no significant difference was observed between groups (p>0.05). Groups D, E, H and J had a prepatent period significantly higher (p≤0.05) if compared to group B (Table 1).

The experiment lasted 20 days, which was considered as the period of longevity of group A. The longevity of the group B was 5.3 days, similar period observed in groups C, D, F, G, H, I, J and L. In contrast, animals in group E had a longevity of 16.1 days, statistically higher (p<0.05) when compared with others groups (Table 1). However, treatment with different doses the oils of copaiba, andiroba and aroeira had no curative effect in our mice experimentally infected with T. evansi, not preventing mortality of all mice, which occurred due to the high parasitemia observed (more of 100 trypanosomes/field at 1000x magnification).

seis animales en cada uno. El grupo A fue el único compuesto por animales sanos y no infectados (control negativo). Los animales en los grupos B a L fueron inoculados intraperitonealmente con 0,1 mL de sangre de una rata (R1) que contenía 2,7 x 106 tripanosomas (en el Día 0). El grupo B fue utilizado como control positivo sin tratamiento, mientras que los ratones de los grupos C, D y E recibieron tratamiento con aceite de copaiba en dosis de 0,6, 0,8 y 1,0 mL kg-1, respectivamente.

Los grupos F, G y H fueron tratados con aceite de andiroba en dosis de 0,6, 0,8 y 1,0 mL kg-1, respectivamente. Además, los grupos I, J y L recibieron tratamiento con aceite de aroeira en dosis de 0.6, 0.8 y 1.0 mL kg-1, respectivamente.

El tratamiento con aceites esenciales se realizó por vía oral en todos los grupos. El tratamiento inició dos horas después de la inoculación de tripomastigotos (Día 0) y se mantuvo durante tres días, con intervalos de dosis de 24 horas.

Evaluación de los animales experimentales.

Los ratones fueron observados durante 20 días; monitoreando diariamente la evolución de la parasitemia y el efecto del tratamiento a través de un frotis de sangre. Cada lámina fue preparada con sangre fresca recolectada de la vena de la cola, teñida mediante el método panóptico y visualizada con un aumento de 1000x.

La eficacia del tratamiento fue determinada por el número de animales curados después de la infección con T. evansi. Sin embargo, para evaluar el efecto del tratamiento con aceites esenciales, se determinó el período de prevalencia, la longevidad y mortalidad de los ratones.

Análisis estadístico. Los resultados del período de prevalencia y la longevidad se sometieron a un análisis de varianza seguido de la prueba de Duncan (p<0.05).

Aprobación ética. El Comité de Bienestar Animal de la Universidad Federal de Santa María aprobó el procedimiento, número 65/2012.

RESULTADOS

El grupo de control positivo (grupo B) tenía en promedio un período de prevalencia de 24 horas.

Los grupos C, F, G, I y L presentaron un período de prevalencia similar mientras que no se observó ninguna diferencia significativa entre los grupos (p>0.05). Los grupos D, E, H y J presentaron un período de prevalencia significativamente mayor (p≤0.05) si se compara con el grupo B (Tabla 1).

Baldissera - Using of essential oils in the tretment of mice Table 1. Mean and standard deviation of the prepatent period, longevity and mortality using treatment with oil of copaiba, andiroba and aroeira in mice experimentally infected with T. evansi.

Groups

A B C D E F G

Treatment#

Prepatent Longevity Mortality period (Day) (n) (Day)

Negative control

-

20.0a (±0.0)

0/6

Positive control

1.0c (±0.0)

5.3cd (±1.0)

6/6

Copaiba oil (0.6 mL/Kg)

1.5bc (±0.5)

5.5cd (±2.2)

6/6

2.0ab (±1.6)

7.0c (±2.8)

6/6

Copaiba oil (1.0 mL/Kg)

2.8 (±0.9)

16.1 (±4.8)

6/6

Andiroba oil (0.6 mL/Kg)

1.3 (±0.5)

4.1d (±1.4)

6/6

1.0c (±0.0)

4.1d (±0.4)

6/6

7.1c (±3.8)

6/6

Copaiba oil (0.8 mL/Kg)

Andiroba oil (0.8 mL/Kg)

ab

c

b

H

Andiroba oil (1.0 mL/Kg)

2.6a (±1.6)

I

Aroeira oil (0.6 mL/Kg)

1.3c (±0.5)

4.8cd (±0.8)

6/6

2.0ab (±0.7)

7.0c (±3.8)

6/6

1.2c (±0.4)

6.5cd (±1.0)

6/6

J L

Aroeira oil (0.8 mL/Kg) Aroeira oil (1.0 mL/Kg)

Means followed by same letters in the same column do not differ significantly in the test of Duncan. # Each group consisted of six mice.

The experiment lasted 20 until days post-infection, when the last two mice of the treated groups (group E and H) died.

DISCUSSION Our research group has been conducted studies with essential oils by, standing out the experiment where the trypanocidal activity in vitro of copaiba, andiroba and aroeira oils was detected (16). Especially due to these findings, this study was proposed to assess the activity in vivo of these oils on mice infected with T. evansi.

Therefore, was evaluated the susceptibility in vivo of T. evansi to oils of copaiba, andiroba and aroeira in three different concentrations. As a result, was observed that the oils tested were not effective in the treatment of infection by T. evansi in mice at the doses administered, since all animals infected and treated died. However, some mice showed higher pre-patent period when compared to the positive control group, demonstrating an initial trypanocidal activity, but not a long-term curative.

Study showed that animals infected with Leishmania amazonensis and treated orally with the copaiba oil showed a significant reduction in the size of lesions (21). However, when investigators used a similar treatment to mice infected with T. evansi not succeeded because the animals died (22). In the current study, the dose of 1 mL kg-1 prolonged the lives of animals, being a natural product with therapeutic potential for this disease.

4113

El experimento duró 20 días, el cual se considera como el período de longevidad del grupo A. La longevidad del grupo B fue de 5,3 días; se observó un período similar en los grupos C, D, F, G, H, I, J y L. En contraste, los animales del grupo E tuvieron una longevidad de 16,1 días, lo que resulta estadísticamente superior (p<0.05) en comparación con los otros grupos (Tabla 1). Sin embargo, el tratamiento con diferentes dosis de los aceites de copaiba, andiroba y aroeira no tuvo ningún efecto curativo en los ratones infectados experimentalmente con T. evansi, sin prevenir la mortalidad de los ratones, lo que se produjo debido a la alta parasitemia observada (más de 100 tripanosomas/campo con un aumento de 1000x).

DISCUSIÓN Nuestro grupo de investigación ha realizado estudios realizados con aceites esenciales, destacándose el experimento donde la actividad tripanocida in vitro de los aceites de copaiba, andiroba y aroeira fue detectada (16). Debido especialmente a estos resultados, en este estudio se propuso evaluar la actividad in vivo de estos aceites en ratones infectados con T. evansi.

Por lo tanto, se evaluó la susceptibilidad in vivo de T. evansi a los aceites de copaiba, andiroba y aroeira en tres concentraciones diferentes.

Como resultado, se observó que los aceites probados no eran efectivos en el tratamiento de la infección por T. evansi en ratones en las dosis administradas, dado que todos los animales infectados y tratados fallecieron. Sin embargo, algunos ratones mostraron un mayor período de prevalencia en comparación con el grupo control positivo, mostrando una actividad tripanocida inicial pero no un curativo a largo plazo.

El estudio demostró que los animales infectaron con Leishmania amazonensis y tratados por vía oral con el aceite de copaiba mostraron una reducción significativa en el tamaño de las lesiones (21). No obstante, cuando los investigadores utilizaron un tratamiento similar en ratones infectados con T. evansi no tuvieron éxito porque los animales murieron (22). En el presente estudio, la dosis de 1 mL kg-1 prolonga la vida de los animales, al ser un producto natural con un potencial terapéutico para esta enfermedad.

Los estudios in vitro realizados por investigadores demostraron la actividad tripanocida de los compuestos presentes en las plantas del género Copaifera spp., es decir el ácido copalico y β-cariofileno poseen un efecto sinérgico contra cepas de Trypanosoma cruzi en una

4114

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

In vitro, studies conducted by researchers demonstrated the trypanocidal activity of compounds present in plants of the genus Copaifera spp., i.e., the copalic acid and β-caryophyllene had synergistic effect against strains of Trypanosoma cruzi in a concentration of 12 µg mL-1 (23). In the same study, it was also found that kaurenoic and polylactic acid inhibited the proliferation of the parasite in the concentration of 50 µg mL-1. However, even then the terpernes are compounds present in copaiba oil, and presented different mechanisms known to cause death of trypanosomes, as well as oxidative stress, autophagy and osmotic pressure difference (23). Since in our experiment the infection with T. evansi in mice was acute, probably the oil, or its properties, did not have enough time to perform the complete cleaning of the parasite, as it multiplies very fast; allowing only an increase in life time of the animals, as it was possible to observe in study current.

Previ o us resu l t s o f o u r r e s e a r c h g r oup demonstrated that some essential oils showed significant trypanocidal activity on T. evansi, when in vitro conditions. However, in this research, was found that essential oils of andiroba, copaiba and aroeira were not effective in the treatment of mice experimentally infected

by T. evansi, only presenting a slight control of parasitism in the early course of the infection.

Acknowledgments This work was supported by Fundação de Amparo a Pesquisa do Estado do Rio Grande do Sul (FAPERGS, RS, Brazil), and the Universidade Federal de Santa Maria (RS, Brazil).

concentración de 12 µg mL-1 (23). En el mismo estudio se encontró también que el ácido caproico y poliláctico inhibió la proliferación del parásito en un concentración de 50 µg mL-1. Sin embargo, incluso así los terpernos son compuestos presentes en el aceite de copaiba y presentaron diferentes mecanismos que se conoce causan la muerte de los tripanosomas, así como estrés oxidativo, autofagia y diferencia de presión osmótica (23). Puesto que en nuestro experimento la infección con T. evansi en ratones fue aguda, probablemente el aceite, o sus propiedades, no tuvo tiempo suficiente para realizar una limpieza completa del parásito, ya que éste se multiplica muy rápidamente; permitiendo únicamente un aumento en el tiempo de vida de los animales, como fue posible observar en este estudio.

Los resultados previos de nuestro grupo de investigación demostraron que algunos aceites esenciales mostraron una actividad tripanocida significativa en T. evansi bajo condiciones in vitro.

Sin embargo, en esta investigación se encontró que los aceites esenciales de andiroba, copaiba y aroeira no fueron efectivos en el tratamiento de ratones infectados experimentalmente con T. evansi, presentando únicamente un leve control del parasitismo en el curso temprano de la infección.

Agradecimientos Este trabajo fue apoyado por Fundação de Amparo a Pesquisa do Estado Rio Grande do Sul (FAPERGS, RS, Brasil) y la Universidade Federal de Santa María (RS, Brasil).

REFERENCES Pinto AC, Silva DHS, Bolzani VS, Lopes NP, Epifanio RA. Produtos naturais: atualidade, desafios e perspectivas. Químíca Nova 2002; 25:45-61.

4. Marongiu B, Alessandra PSP, Casu R, Pierucci P. Chemical composition of the oil and supercritical CO2 extracts of Schinus molle L. Flav Frag J 2004; 19:554-558.

2. Maciel MAM, Pinto AC, Júnior VF. Plantas medicinais: A necessidade de estudos interdisciplinares. Química Nova 2002; 25: 429–438.

5. Araújo Jr FA, Braz MN, Neto OGR, Costa FD, Brito MVH. Efeito do óleo de copaíba nas aminotransferases de ratos submetidos à isquemia e reperfusão hepática com e sem précondicionamento isquêmico. Acta Cir Bras 2005; 20:93-99.

1.

3. Amorim MMR, Santos LC. Tratamento da vaginose bacteriana com gel vaginal de Aroeira (Schinus terebinthifolius Raddi): ensaio clínico randomizado. Rev Bras Ginecol Obstet 2003; 25:95-102.

6. Veiga VF, Patitucci ML, Pinto AC. Authenticity control of commercial copaiba oils by high resolution gas chromatography. Química Nova 1997; 20:612-615.

Baldissera - Using of essential oils in the tretment of mice 7. Paiva LAF, Gurgel LA, Silva RM, Tomé AR, Gramosa NV, Silveira ER, Santos FA, Rao VNS. Anti-inflammatory effect of kaurenoic acid, a diterpene from copaifera langsdorffi on acetic acid-induced colitis in rats. Vascular Pharmacol 2002; 39:303-307.

8. Oliveira ECP de, Lameira OA, Barros PLC, Poltronieri LS. Avaliação do óleo de copaíba (Copaifera) na inibição do crescimento micelial in vitro de fitopatógenos. Rev Ciênc Agr 2006; 46:53-61.

9. Farias MPO, Sousa DP, Arruda AC, Arruda MSP, Wanderley AG, Alves LC, Faustino MAG. Eficácia in vitro do óleo da Carapa guianensis Aubl.

(Andiroba) no controle de Boophilus microplus (Acari: Ixodidae). Rev Bras Plan Med 2007; 9:68-71.

10. Gilbert B, Teixeira DF, Carvalho ES, De Paula AE, Pereira JF, Almeida MB, Machado RS, Cascon V. Activities of the pharmaceutical technology Institute of the Oswaldo Cruz Fundation with medicinal, insecticidal and repellent plants. Anais Acad Bras Ciênc 1999; 71:265–271.

4115

15. Izumi E. Efeitos do óleo de copaíba e constituintes em Trypanosoma cruzi, 95f. Londrina, PR. [Tese Doutorado em Microbiologia] – Programa de Pós- graduação em Microbiologia, Universidade Federal de Londrina, 2010.

16. Baldissera MD, Da Silva AS, Oliveira CB, Zimmermann CEP, Vaucher RA, Santos RCV, Rech VC, Tonin AA, Giongo JL, Mattos CB, Koester L, Santurio JM, Monteiro SG. Trypanocidal activity of the essential oils in their conventional and nanoemulsion forms: In vitro tests. Exp Parasitol 2013; 134:156-161.

17. Silva RAMS, Seidl A, Ramirez L, Dávila AMR. Trypanosoma evansi e Trypanosoma vivax: biologia, diagnóstico e controle. Corumbá, Brasil: Embrapa Pantanal; 2002.

18. Maudlin I, Holmes P, Miles MA. The trypanosomiases. Wallingford, Inglaterra: CABI Publishing; 2004.

19. Peregrine AS, Mamman M. Pharmacology of Diminazene: A Review. Acta Tropica 1993; 54:185–203.

11. Moura MD, Souza – Silva J, De Oliveira RAG, Diniz MFFM, Barbosa – Filho JM. Natural products reported as potencial inibitors of uterine cervical neoplasia. Acta Farmac Bonar 2002; 21:67–74.

20. Colpo CB, Colpo ETB, Stainki DR, Monteiro SG. Infecção Natural por Trypanosoma evansi em cão no Rio Grande do Sul. Ciência Rural 2005; 35:717-719.

12. Penido C, Costa KA, Costa MF, Pereira JF, Siani AC, Henriques MG. Inhibition of allergen – induced eosinophil recruitment by natural tetranortriterpenoids is mediated by the suppression of IL-5, CCL11/eotaxin and NfkappaB activation. Int Immunopharmacol 2006; 6:109121.

21.

13. Santos RBC, Dos Santos Alves CF, Schneider T, Lopes LQ, Aurich C, Giongo JL, Brandelli A, Vaucher RA. Antimicrobial activity of Amazonian oils against Paenibacillus species. J Inve Pathol 2012; 109:265-268.

14. Mendonça FA, Silva KF, Santos KK, Ribeiro Júnior KA, Sant’ana AE. Activities of some Brazilian plants against larvae of the mosquito Aedes aegypti. Fitorerapia 2005; 76:629-636.

Santos AO, Ueda-Nakamura T, Dias Filho BP, Veiga Junior VFV, Lima MMS, Nakamura CV. Leishmania amazonensis: Effects of oral treatment with copaiba oil in mice. Exp Parasitol 2011; 129:154-151.

22. Dornelles F, Da Silva AS, Oliveira CB, Dalla-Rosa L, Zimmermann CEP, Tonin AA, Oliveira ECP, Santurio, JM, Monteiro SG. Susceptibility of Trypanosoma evansi in the copaiba oil: In vitro test and in mice experimentally infected with the parasite. Acta Scie Vet 2013; 41:1136.

23. Izumi E, Ueda – Kakamura T, Veiga Júnior VF, Pinto AC, Nakamura CV. Terpenes from Copaifera demonstrated in vitro antiparasitic and synergic activity. J Med Chem 2012; 55:2994–3001.

Rev.MVZ Córdoba 19(2):4116-4129, 2014. ISSN: 0122-0268 ORIGINAL

Association of gene BoLA DRB3.2 with production traits in a dairy herd of Antioquia, Colombia Asociación del gen BoLA DRB3.2 con características productivas en un hato lechero de Antioquia, Colombia Juan Zambrano A,1 M.Sc, Julián Echeverri Z,2 Ph.D, Albeiro López-Herrera,2* Ph.D. Universidad Nacional de Colombia sede Medellín, Facultad de Ciencias, Posgrado en Biotecnología, Grupo de Investigación BIOGEM. 2Universidad Nacional de Colombia, Sede Medellín, Facultad de Ciencias Agropecuarias, Departamento de Producción Animal, Grupo de Investigación BIOGEM. Calle 59A No 63-20 –Núcleo el volador, Bloque 50, Oficina 310, Medellín Colombia. *Correspondencia: alherrera@unalmed.edu.co 1

Received: January 2013; Accepted:December 2013.

ABSTRACT Objective. To determine the associations of BoLA DRB3.2 alleles present in Holstein and BON x Holstein cattle to production and milk quality traits in a dairy herd of Antioquia, Colombia. Materials and methods. Ninety-one cows, 66 Holstein and 25 BxH, were genotyped for the BoLA DRB3.2 gene, through PCR-RFLP technique. Furthermore, the association of the alleles of the gene BoLA DRB3.2 with milk yield (PL305), fat yield (PG305), protein yield (PP305) fat percentage (PGRA) and protein percentage (PPRO) were determined, using a general linear model. Results. Twenty-seven BoLA DRB3.2 alleles were identified; the most frequent alleles in Holstein were: BoLA DRB3.2*23, 22, and 24 with frequencies of: 0.159, 0.129, and 0.106, respectively and the most frequent alleles in BxH were: BoLA DRB3.2*23, 24 and 20 with frequencies of: 0.20, 0.140, and 0.120, respectively.

Associations of BoLA DRB3.2 alleles with production and milk quality traits were also determined.

In Holstein cows the BoLA DRB3.2*36 allele was associated with low PL305 (p≤0.01), high PGRA in multiparous cows (p≤0.05) and high PG305 in primiparous cows (p≤0.01). The BoLA DRB3.2*33 allele was associated with increased in the PPRO in multiparous cows (p≤0.01). In BXH cows only the BoLA DRB3*19 allele was associated with high PGRA (p≤0.05). Conclusions. The gene BoLA DRB3.2 shows high polymorphism in both groups; Holstein and BxH and some of its allelic variants were associated with production and milk quality traits.

Key words: DNA, genetic markers, milk protein, PCR (Source:CAB, AIMS).

4116

Zambrano - Association of gene BoLA DRB3.2 in a dairy herd

4117

RESUMEN Objetivo. Determinar la asociación de los alelos BoLA DRB3.2 presentes en vacas Holstein y BONxHolstein con características productivas y de calidad composicional de la leche en un hato lechero de Antioquia, Colombia. Materiales y métodos. Fueron genotipificados 91 animales; 66 Holstein y 25 BONxHolstein (BxH) para el gen BoLA DRB3.2, mediante la técnica PCR-RFLP. También, se determinó la asociación de los alelos del gen BoLA DRB3.2 con producción de leche (PL305), producción de grasa (PG305), producción de proteína (PP305), porcentaje de grasa (PGRA) y porcentaje de proteína (PPRO); usando un modelo lineal generalizado. Resultados. Fueron identificados 27 alelos BoLA DRB3.2; los más frecuentes en Holstein fueron: BoLA DRB3.2*23, 22 y 24 con frecuencias de 0.159, 0.129 y 0.106 respectivamente y los más frecuentes para BxH fueron: BoLA DRB3.2*23, 24, 20 con frecuencias de 0.20, 0.140 y 0.120 respectivamente. También fueron determinadas asociaciones de los alelos BoLA DRB3.2 con características productivas y de calidad composicional de la leche. En vacas Holstein el alelo BoLA DRB3.2*36 fue asociado con baja PL305 (p≤0.01), alto PGRA en vacas multíparas (p≤0.05) y alta PG305 en vacas primíparas (p≤0.01). El alelo BoLA DRB3.2*33 fue asociado con alto PPRO en vacas multíparas (p≤0.01). En vacas BxH sólo el alelo BoLA DRB3.2*19 estuvo asociado con aumento en el PGRA (p≤0.05). Conclusiones. El gen BoLA DRB3.2 presentó un alto polimorfismo en ambos grupos genéticos; Holstein y BxH y algunas de sus variantes alélicas fueron asociadas significativamente con características productivas y características de calidad composicional de la leche.

Palabras clave: DNA, marcadores genéticos, PCR, proteína de la leche (Fuente: CAB, AIMS).

INTRODUCTION

INTRODUCCION

Milk production in Colombia has increased in an accelerated and sustained manner. In the year 1990, raw milk production was 3917 million liters, by the year 2012, it increased by 40%; reaching a production of 6518 million liters (1,2). This growth over the last 20 years shows not just the growth in number of animals, but also the use of bulls selected for their high genetic value for dairy production.

La producción de leche en Colombia se ha incrementado de forma acelerada y sostenida.

En el año 1990, la producción de leche cruda fue de 3917 millones de litros, al año 2012 se incrementó en 40%; llegando a una producción de 6518 millones de litros (1,2). Este crecimiento en los últimos 20 años, refleja no sólo el crecimiento en el número de animales, sino también el uso de toros que han sido seleccionados por su alto valor genético para volumen de producción de leche.

However, the intense selection of productive characteristics has led to an increase in the appearance of infectious diseases, metabolic problems, and diminished fertility in cattle (3).

The costs associated to these types of problems, are mainly represented by the decrease in milk production, veterinary costs, premature discard of animals, milk rejection due to antibiotic contamination, among others (4).

There have been few and isolated intents in Colombia, to know the genetic value (genetic evaluations) of dairy cows and Bulls, and they have been undertaken, mainly to estimate volume of milk (5). Cattle ranchers, on their part, have aimed their production mainly towards milk volume, rather than towards quality, regarding composition and sanitary condition. Thus, strategies are required to allow improvement of production, milk quality, and cattle health.

Genetic improvement assisted by molecular markers is one of the alternatives that allows for the study of genes associated to productivity, milk

Sin embargo, la intensa selección para características productivas ha conllevado al incremento en la incidencia de enfermedades infecciosas, problemas metabólicos y disminución de la fertilidad de las vacas (3). Los costos asociados con este tipo de problemas están representados principalmente en la disminución de la producción de leche, gastos veterinarios, descarte prematuro de animales, descarte de leche por contaminación con antibióticos, entre otros (4).

En Colombia han sido pocos y aislados los intentos por conocer el valor genético (evaluaciones genéticas) de vacas y toros lecheros y han sido estimados principalmente para volumen de producción (5). Los ganaderos, por su parte, han dirigido sus explotaciones principalmente hacia la producción de leche más que a su calidad composicional y/o sanitaria. Por tanto, se requiere plantear estrategias que permitan mejorar además de la producción, la calidad de la leche y la salud de la vaca.

4118

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

quality and also to resistance or vulnerability to infectious diseases. The major histocompatibility complex (MHC), which in bovines is called Bovine Leucocyte Antigen (BoLA), has been widely studied, and some molecular markers associated to production, compositional quality of milk and sanitary problems have been identified, such as gene BoLA DRB3 (6).

Gene BoLA DRB3, is usually expressed by cells in the immune system such as macrophages dendritic cells or B lymphocytes, which process the antigen and then present it to the helper T lymphocytes to unleash the immune response against infectious pathogens(7). Their elevated level of expression and high polymorphism makes them potential molecular markers for Molecular Marker-assisted selection procedures (MAS).

More than 100 different alleles (8,9) have been identified from exon 2, and some of them have been associated to the occurrence of infectious diseases and milk, fat and protein production (6,10-13).

The purpose of this investigation was to determine the association of the alleles of BoLA DRB3.2 gene with milk production and compositional quality traits in Holstein and BON x Holstein cattle, at a dairy farm in Antioquia, Colombia.

MATERIALS AND METHODS Population of the study. The investigation was undertaken at the Paysandú farm, which is property of the Universidad Nacional de Colombia, Medellin branch, located in the department of Antioquia, Township of Santa Elena, 16 km east of Medellín in an area of lower montane rain forest (bmh-MB) with a mean temperature of 14°C at 2500 meters above sea level. 91 bovine females were genotipified at this farm for gene BoLA DRB3.2, 66 of them were Holstein and 25 were from the BxH genetic group.

Data recollection. Data of milk yield per lactation was gathered from the historical production data of the Paysandú farm and adjusted to 305 days (PL305). Milk production was measures with proportional flow meters. The characteristics of compositional quality of the milk were: fat percentage (PGRA) and protein percentage (PPRO), they were determined at the quality control lab of COLANTA, using the MilkoScan FT120® device, based on the FTIR principle (Fourier Transfer Infrared Spectroscopy).

Cows with different number of lactations were taken for this study (between one and eleven).

El mejoramiento genético asistido por marcadores moleculares, es una de las alternativas que permite estudiar genes asociados con productividad, calidad de la leche y también con resistencia y/o susceptibilidad a enfermedades infecciosas.

El complejo mayor de histocompatibilidad (CMH), que en bovinos se denomina antígeno Leucocitario Bovino (BoLA), ha sido ampliamente estudiado y han sido identificados algunos marcadores moleculares asociados a producción, calidad composicional de la leche y también con problemas sanitarios como es el caso del gen BoLA DRB3 (6).

El gen BoLA DRB3, es normalmente expresado por células del sistema inmune como macrófagos, células dendríticas y linfocitos B, las cuales procesan el antígeno y luego lo presentan a los linfocitos T ayudadores para desencadenar la respuesta inmune contra patógenos infecciosos (7). Su nivel de expresión elevado y su alto polimorfismo lo convierte en un marcador molecular potencial para programas de selección asistida por marcadores moleculares (MAS). Del exón 2 de este gen han sido identificados más de 100 alelos diferentes (8,9) y algunos de estos han sido asociados con ocurrencia a enfermedades infecciosas, producción de leche, grasa y proteína (6,10-13).

El objetivo de esta investigación fue determinar la asociación de los alelos del gen BoLA DRB3.2 con características productivas y de calidad composicional de la leche en vacas Holstein y BONxHolstein en un hato lechero de Antioquia, Colombia.

MATERIALES Y METODOS Población de estudio. La investigación se llevó a cabo en el hato Paysandú de propiedad de la Universidad Nacional de Colombia sede Medellín, ubicado en el departamento de Antioquia, corregimiento de Santa Elena, a 16 Km al oriente de Medellín en zona de bosque muy húmedo montano bajo (bmh-MB) con una temperatura media de 14°C y a una altura de 2500 msnm.

En este hato fueron genotipificadas 91 hembras bovinas para el gen BoLA DRB3.2, 66 de raza Holstein y 25 del grupo genético BxH. Recolección de la información. Los datos de producción de leche por lactancia fueron tomados de los registros históricos de producción del hato Paysandú y fueron ajustados a 305 días (PL305).

La producción de leche fue medida con medidores de paso proporcional. Las características de calidad composicional de la leche: porcentaje de grasa (PGRA) y porcentaje de proteína (PPRO),

Zambrano - Association of gene BoLA DRB3.2 in a dairy herd For PGRA and PPRO cows with less than four data per lactation were included. Fat yield (PG305) and protein yield (PP305) in kg/lactation adjusted to 305 days was calculated as of the percentage of these parameters (PPRO y PGRA) and the milk yield adjusted to 305 days (PL305).

DNA extraction. 5 ml of peripheric blood was drawn into vacuum tubes with EDTA as anticoagulant, from each one of the 91 individuals. They were stored at 4ºC until processed. DNA was extracted through the “salting out” method.

Amplification of the BoLA DRB3.2. gene.

Exon 2 of gene BoLA DRB3 was amplified by semi-nested PCR, described by Van Eijk et al (14), with a few modifications. The primers used were: HL030 (ATCCTCTCTCTGCAGCACATTTCC), HL031 (TTTAAATTCGCG CTCACCTCGCCGCT) and HL032 (TCGCCGCTGCACAGTGAAACTCTC). The first amplification cycle was done at a reaction volume of 25 μl containing: 0.4 mM of each dNTP, 0.5 μM primer HLO30 and HLO31, 2.5 μl 10X magnesium free thermophilic buffer [500 mM KCl, 100 mM Tris-HCl (pH 9.0), 1% (v/v) Triton X-100&#093, 2.5 μl of 25 mM MgCl2, 12.8μl of ultra-pure water, 1U Taq DNA polymerase (Fermentas, California, U.S.A) and 50 to 100 ng of genomic DNA. The reaction mixture took place in a thermo cycler (Biometra, Göttingen Germany with the following temperature program: Initial denaturation at 94°C for 240 s, followed by 10 denaturation cycles at 94°C for 60 s, annealing at 60°C for 120 s, extension at 72°C for 60 s and a final extension at 72°C for 300 s.

The second PCR cycle was done at a reaction volume of 60 μl containing: 0.4 mM of each dNTP, 0.6 μM of each primer HLO30 and HLO32, 6 μl of 10X magnesium-free thermophilic buffer, 6 μl of 25 mM MgCl2, 36.9 μl of ultra pure water, 1U of Taq ADN polymerase (Fermentas, California, U.S.A) and 2.5 μl of amplified DNA from the first PCR cycle. The amplification program was as follows: Initial denaturation at 94°C for 240 s, followed by 25 denaturation cycles at 94°C for 60 s, annealing at 67°C for 120 s, extension at 72ºC for 60 s, followed by a final extension of 72°C for 300 s. As negative control, reactions were undertaken without DNA. The resulting product was fixed in agarose gels at 1.5% (p/v) and visualized under ultraviolet light with a trans illuminator. (Biometra, Göttingen Germany).

Digestion with restriction enzymes. The amplification product obtained during the second PCR cycle was digested with three restriction enzymes RsaI, BstYI (New England BioLabs®) and HaeIII (Fermentas, California

4119

se determinaron en el laboratorio de control de calidad de la Cooperativa COLANTA, usando el equipo MilkoScan FT120®, basado en el principio de medición FTIR (infrarrojo por transformada de Fourier).

En esta investigación se incluyeron vacas con diferente número de lactancias (entre una y once). Para PGRA y PPRO fueron incluidas vacas que tenían al menos cuatro mediciones por cada lactancia. La producción de grasa (PG305) y producción de proteína (PP305) en kg/lactancia ajustado a 305 días, fue calculada a partir del porcentaje de estos parámetros (PPRO y PGRA) y de la producción leche ajustada a 305 días (PL305).

Extracción de ADN. Para cada uno de los 91 individuos se colectaron 5 ml de sangre periférica en tubos al vacío con EDTA como anticoagulante y fueron almacenadas a 4°C hasta su procesamiento. El ADN fue extraído empleando el método de “salting out”.

Amplificación del gen BoLA DRB3.2. El exón 2 del gen BoLA DRB3 fue amplificado por PCR semianidada, como lo describe Van Eijk et al (14), con algunas modificaciones.

Los cebadores utilizados fueron: HL030 (ATCCTCTCTCTGCAGCACATTTCC), HL031 (TTTAAATTCGCG CTCACCTCGCCGCT) y HL032 (TCGCCGCTGCACAGTGAAACTCTC). La primera ronda de amplificación se realizó en un volumen de reacción de 25 μl que contenía: 0.4 mM de cada dNTP, 0.5 μM de cebadores HLO30 y HLO31, 2.5 μl de 10X tampón termofílico libre de magnesio [500 mM KCl, 100 mM Tris-HCl (pH 9.0), 1% (v/v) Tritón X-100&#093, 2.5 μl of 25 mM MgCl2, 12.8 μl de agua ultrapura, 1U de Taq ADN polimerasa (Fermentas, California, U.S.A) y 50 a 100 ng de ADN genómico. La mezcla de reacción se llevó a cabo en un termociclador (Biometra, Göttingen Germany con el siguiente programa de temperaturas: Desnaturalización inicial a 94°C por 240 s, seguido de 10 ciclos desnaturalización a 94°C por 60 s, alineación a 60°C por 120 s, extensión a 72°C por 60 s y una extensión final a 72°C por 300 s.

La segunda ronda de PCR se llevó a cabo en un volumen de reacción de 60 μl que contenía: 0.4 mM de cada dNTP, 0.6 μM de cada cebador HLO30 y HLO32, 6 μl de 10X magnesium-free thermophilic tampón, 6 μl de 25 mM MgCl2, 36.9 μl de agua ultra pura, 1U de Taq ADN polimerasa (Fermentas, California, U.S.A) y 2.5 μl de ADN amplificado en la primer ronda de PCR. El programa de amplificación fue el siguiente: Desnaturalización inicial a 94°C por 240 s, seguida de 25 ciclos desnaturalización

4120

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

U.S.A) and separation of fragments was done by electrophoresis in agarose gel. Identification of the alleles of BoLA DRB3.2 was done by combination of the different patterns of restriction obtained in the following order: RsaI, BstYI, HaeIII for each sample, according to the allele nomenclature reported by Van Eijk et al (14). The identified BoLA DRB3.2 alleles for PCR-RFLP, were confirmed by sequencing, for which our amplifiers in the second PCR cycle were purified with the QIAquick kit (QIAGEN) and sent to Macrogene Inc in Seoul Korea for sample sequencing. The sequences obtained were aligned and analyzed with the BioEdit Sequence Alignment Editor program.

Determination of allelic frequencies. The frequency of the different alleles was done by determining the proportion of each form of the gene between the total numbers of copies of the studied population. The homozygotes (two copies of the same allele) and heterozygotes (one copy of each allele) were identified and the frequency for each allele was calculated by counting the homozygotes and adding half of the heterozygotes, with the method described

by Laird and Lange (15).

Statistical analysis. An allele substitution model was used to determine the association of each BoLA DRB3.2 allele with the productive and milk quality traits, using the BoLA DRB3.2*24 substitution allele, according to what was described by Sharif et al (10) and Rupp et al (11).

The model was described as follows: Yijkl = m + GGi + NPj + ΣkbkBoLAijk + eijkl Where: Yijkl corresponds to the phenotype trait (PL305, PP305, PG305, PGRA and PPRO), m is the general mean, GG corresponds to the i effect of the genetic group (i=1, 2), being 1 the Holstein genetic group and 2 the BxH genetic group, NP is the fixed effect of the j number of calvings (j=1,2), being 1 the primiparous cows (of one and two calvings) and 2 multiparous cows (of three or more calvings), bk is the regression coefficient of the number of copies of the k allele BoLA, BoLAijk corresponds to the fixed effect of the number of copies (0,1 and 2) of the BoLA k (k = 1……15) allele present in cow ijk and eijkl is the experimental error.

Dunnett‘s comparison test was used to determine statistical significance between the means of the BoLA DRB3.2 alleles compared with the mean of the substitution allele (allele 24) for each productive trait. The comparison analysis in the Holstein breed was done by comparing means of each one of the groups: primiparous and

a 94°C por 60 s, alineación a 67°C por 120 s, extensión a 72ºC por 60 s, seguido por una extensión final de 72°C por 300 s. Como control negativo se hicieron reacciones en ausencia de ADN. El producto de PCR fue resuelto en geles de agarosa al 1.5% (p/v) y visualizado bajo luz ultravioleta en un fotodocumentador (Biometra, Göttingen Germany).

Digestión con enzimas de restricción. El amplificado obtenido en la segunda ronda de PCR fue digerido con tres enzimas de restricción RsaI, BstYI (New England BioLabs®) y HaeIII (Fermentas, California U.S.A) y la separación de los fragmentos se realizó por electroforesis en gel de Agarosa. La identificación de los alelos del gen BoLA DRB3.2 se realizó por combinación de los diferentes patrones de restricción obtenidos en el siguiente orden: RsaI, BstYI, HaeIII para cada muestra de acuerdo a la nomenclatura alélica reportada por Van Eijk et al (14). Los alelos BoLA DRB3.2 identificados por PCR-RFLP, fueron confirmados por secuenciación, para lo cual las muestras amplificadas en la segunda ronda de PCR fueron purificadas con el kit QIAquick (QIAGEN) y enviadas a la empresa Macrogene Inc en Seúl Corea para realizar secuenciación de las muestras. Las secuencias obtenidas fueron alineadas y analizadas en el programa BioEdit Sequence Alignment Editor.

Determinación de frecuencias alélicas. La frecuencia de los diferentes alelos se realizó determinando la proporción de cada forma del gen entre el número de copias totales de la población en estudio. Se identificaron los homocigotos (dos copias del mismo alelo) y los heterocigotos (una copia de cada alelo) y se calculó la frecuencia de cada alelo contando los homocigotos y añadiendo la mitad de los heterocigotos, con el método descrito por Laird y Lange (15).

Análisis estadístico. Para determinar la asociación de cada alelo BoLA DRB3.2 con características productivas y de calidad de la leche se empleó un modelo de sustitución alélica, utilizando el alelo BoLA DRB3.2*24 como alelo de sustitución, según lo descrito por Sharif et al (10) y Rupp et al (11). El modelo fue descrito como: Yijkl = m + GGi + NPj + ΣkbkBoLAijk + eijkl Donde: Y ijkl corresponde a la característica fenotípica (PL305, PP305, PG305, PGRA y PPRO), m es la media general, GG corresponde al efecto fijo del i-ésimo grupo genético (i=1, 2), siendo 1 el grupo genético Holstein y 2 el grupo genético BxH, NP es el efecto fijo del j-ésimo número de parto (j=1,2), siendo 1 las vacas primíparas

4121

Zambrano - Association of gene BoLA DRB3.2 in a dairy herd multiparous, independently for all the evaluated traits. For BxH the analysis was done in all the cows, due to the low number of animals (n=25) for all the evaluated traits. Alleles with frequency ≤2% were grouped in one category named “others”. The model was undertaken with the GLM (General Linear Model) procedure of SAS V9.1 (16).

RESULTS Allele Frequencies for gene BoLA DRB3.2.

23 alleles from the Holstein breed, and 18 alleles from the BxH genetic group were identified through PCR-RFLP 23 for a total of 27 allele variants of BoLA DRB3.2. The allelic frequencies for the Holstein group were located between 0.008 and 0.159 (light grey bars Figure 1), being the most frequent alleles 23, 22 and 24 with frequencies of 0.159, 0.129 y 0.106, respectively.

In BxH the allele frequencies were between 0.02 and 0.20 (dark bars Figure 1), being 23, 24 and 20 the most frequent alleles with frequencies of 0.20, 0.14 and 0.12, respectively. It was determined that in the Holstein genetic group, 79% of the cows were heterozygote and 21% homozygote, for BxH a very similar result was obtained where 80% were heterozygote and 20% homozygote for gene BoLA DRB3.2.

Milk Production. The average PL305 in the evaluated population was 5361 Kg (Table 1). The genetic group had a significant effect (p≤0.01), with a PL305 mean higher for Holstein (5895 kg), than for BxH (4045 kg). Likewise, the calving effect was significant (p≤0.01); primiparous Holstein cows presented a PL305 mean of 5316 kg, while the mean for multiparous was 6599 kg per lactation (Table 1).

Protein production and percentage. The mean for PP305 was 162 kg. The effect of the

(de uno y dos partos) y 2 las vacas multíparas (de tres o más partos), bk es el coeficiente de regresión del número de copias del k-ésimo alelo BoLA, BoLAijk corresponde al efecto fijo del número de copias (0,1 y 2) del alelo BoLA k (k=1……15) presentes en la vaca ijk y eijkl es el error experimental.

Para determinar la significancia estadística entre las medias de los alelos BoLA DRB3.2 comparadas con la media del alelo de sustitución (alelo 24) para cada característica productiva, se empleó la prueba de comparación de Dunnett‘s. Para la raza Holstein, se realizó el análisis de comparación de medias en cada uno de los grupos: primíparas y multíparas, de manera independiente en todas las características evaluadas. Para BxH el análisis se realizó en todas las vacas, por el bajo número de animales (n=25) en todas las características evaluadas. Los alelos con frecuencias ≤2% fueron agrupados en una sola categoría denominada “otros”. El modelo fue ejecutado con el procedimiento GLM (Modelo Lineal General) de SAS V9.1 (16).

RESULTADOS Frecuencias alélicas para el gen BoLA DRB3.2. Fueron identificados por PCR-RFLP 23 alelos en la raza Holstein y 18 alelos en el grupo genético BxH, para un total de 27 variantes alélicas del BoLA DRB3.2. Las frecuencias alélicas para la raza Holstein se ubicaron entre 0.008 y 0.159 (barras gris claro Figura 1), siendo los alelos más frecuentes el 23, 22 y 24 con frecuencias de 0.159, 0.129 y 0.106, respectivamente. En BxH las frecuencias alélicas estuvieron entre 0.02 y 0.20 (barras oscuras Figura 1), siendo los alelos más frecuentes el 23, 24 y 20 con frecuencias de 0.20, 0.14 y 0.12, respectivamente. En el grupo genético Holstein

Allelic frequencies

Holstein BON x Holstein

Figure 1. Allelic frequencies for gene BoLA DRB3.2 in two genetic groups, Holstein and BxH.

4122

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

Table 1. Mean and standard deviation for milk production and compositional quality traits in Holstein and BxH cows.

Trait n

PL305 kg±DE

n

PP305

PPRO

kg±DE

%±DE

N

PG305

PGRA

kg±DE

%±DE

Holstein primiparous

243

5316±1229

163

155±37

3.02±0.44‡

163

182±40

3.56±0.44

Holstein multiparous

200

6599±1298‡

169

187±42‡

2.87±0.35

169

228±52‡

3.50±0.53

Holstein

443

5895±1366‡

332

171±43‡

2.94±0.35

332

205±52‡

3.53±0.49

BxH

180

4045±853

100

133±28

3.23±0.21‡

100

169±37

4.11±0.48‡

Farm Paysandú

623

5361±1496

432

162±43

3.01±0.35

432

197±51

3.66±0.54

PL305 = Milk yield adjusted to 305 days, PP305= Protein yield adjusted to 305 days, PPRO = Protein Percentage, PG305=Fat yield adjusted to 305 days, PGRA = Fat percentage, n = Number of records, DE= Standard Deviation, *p≤0.10, †p≤0.05, ‡p≤0.01

genetic group was significant (p≤0.01) for this characteristic, with a PP305 mean higher for Holstein (171 kg), than for BxH (133 kg).

Likewise, the effect of the number of calvings was significant (p≤0.01); in the analysis done for Holstein cows; primiparous cows had a PP305 mean of 155 kg, while multiparous cows had a mean of 187 kg (Table 1). The mean for PPRO in the assessed population was 3.01% and the mean for each genetic group was significantly different (p≤0.01); for BxH it was higher with 3.23% and for Holstein it was 2.94%. Regarding the fixed effect of the number of calvings, it was significant for the Holstein breed (p≤0.01), where primiparous cows presented a PPRO mean of 3.02% and multiparous were 2.87% (Table 1).

se determinó que el 79% de las vacas fueron heterocigóticas y el 21% homocigóticas, para BxH se obtuvo un resultado muy similar, 80% de heterocigóticos y 20% homocigóticos para el gen BoLA DRB3.2.

Fat Production and Percentage. PG305 for the assessed population was 197 kg. The fixed effect of the genetic group was significant (p≤0.01), with a mean of PG305 higher for the Holstein breed (205 kg), than for BxH (169 kg). Likewise, the fixed effect of the number of calvings in Holstein cows was significant (p≤0.01); primiparous cows had a PG305 mean of 182 kg, while multiparous cows had a mean of 228 kg (Table 1). The mean for PGRA in the assessed population was 3.66% and the means for each genetic group were significantly different (p≤ 0.01); for BxH it was 4.11% and for Holstein it was 3.53% regarding calving effect, there were no significant differences found in Holstein, primiparous cows had a PPRO mean of 3.56% and multiparous cows had 3.50% (Table 1).

Producción de proteína y porcentaje de proteína. La media para PP305 fue 162 kg.

El efecto del grupo genético fue significativo (p≤0.01) para esta característica, con una media de PP305 mayor para Holstein (171 kg), que para BxH (133 kg). Igualmente, el efecto número de parto fue significativo (p≤0.01); en el análisis realizado para vacas Holstein; las vacas primíparas tuvieron una media de PP305 de 155 kg, mientras que las multíparas presentaron una media de 187 kg (Tabla 1). La media para PPRO en la población evaluada fue de 3.01% y la media para cada grupo genético fue significativamente diferente (p≤0.01); para BxH fue mayor con 3.23% y para Holstein 2.94%.

En cuanto al efecto fijo del número de parto, en la raza Holstein fue significativo (p≤0.01), las vacas primíparas presentaron una media de PPRO de 3.02% y las multíparas de 2.87% (Tabla 1).

Association of BoLA DRB3.2 alleles with PL305, PP305 and PG305. Comparing the PL305 means of each BoLA DRB3.2 allele with the substitution allele (allele 24), a highly significant association in multiparous cows was found, with the decrease in PL305 from allele 36 with 1674 less than those cows carrying the substitution allele (p≤0.01) (Table 2). A significant association was also found in Holstein cows with a rise in the PG305 for allele 36 (p≤0.01) in primiparous cows.

Producción de leche. El promedio de PL305 en la población evaluada fue de 5361 Kg (Tabla 1). El grupo genético tuvo un efecto significativo (p≤0.01), con una media de PL305 mayor para Holstein (5895 kg), que para BxH (4045 kg).

Igualmente, el efecto parto fue significativo (p≤0.01); en Holstein las vacas primíparas presentaron una media para PL305 de 5316 kg, mientras que en las multíparas la media fue de 6599 kg por lactancia (Tabla 1).

Producción de grasa y porcentaje de grasa. La PG305 para la población evaluada fue de 197 kg.

El efecto fijo del grupo genético fue significativo (p≤0.01), con una media de PG305 mayor para la raza Holstein (205 kg), que para BxH (169 kg).

Igualmente, el efecto fijo de número de parto en vacas Holstein fue significativo (p≤0.01); las vacas primíparas tuvieron una media de

Zambrano - Association of gene BoLA DRB3.2 in a dairy herd Table 2. Statistical significance of the association of BoLA DRB3.2 alleles with milk productions and compositional quality traits in Holstein cows.1 Traits PL305

PP305

PPRO

PG305

PGRA

Fre

kg±DE

kg±DE

%±DE

kg±DE

%±DE

33

6.1

148 ±380

-10 ±10

0.40 ±0.07*

-5±9

-0.25 ±0.16

36

2.3

170 ±640

59 ±12

-0.05 ±0.17

98 ±47‡

0.35 ±0.24

24

10.6

0 ±242

0 ±13

0 ±0.19

0 ±9

0 ±0.07

Alelo

Primiparous – Holstein

Multiparous-Holstein 8

6.1

-448 ±355

-1 ±14

0.20 ±0.05

17 ±23

0.48 ±0.16*

16

10.6

-47 ±387

16 ±12

0.21 ±0.06*

9 ±12

0.19 ±0.19

22

12.9

-491 ±201

-3 ±5

0.16 ±0.04

12 ±10

0.45 ±0.15*

36

2.3

-1674 ±372‡

-34 ±14

0.13 ±0.08

-20 ±24

0.55 ±0.18†

24

10.6

0 ±283

0 ±8

0 ±0.05

0 ±11

0 ±0.06

Fre=Frequency; 1Allele 24 was fixed to zero to compare allelic substitution, PL305 = Milk yield adjusted to 305 days, PP305=Protein yield adjusted to 305 days, PPRO = Protein Percentage, PG305 = Fat yield adjusted to 305 days, PGRA = Fat Percentage , DE= Standard Deviation, *p≤0.10, †p≤0.05, ‡p≤0.01

No significant associations were determined for these characteristics in BxH cows.

Association of BoLA DRB3.2 alleles with PPRO and PGRA. Significant associations were determined in the Holstein breed with a rise in PPRO for allele 33 in primiparous cows (p≤0.10) with 0.40% more than in cows bearing the substitution allele and for allele 16 in multiparous cows with 0.21% more than in cows bearing the substitution allele (p≤0.10) (Table 2). For PGRA, allele 36 was associated with a rise in the levels of this trait in multiparous cows (p≤0.05), with 0.55% more than in cows that bear the substitution allele. Alleles 8 and 22 were likewise associated to a rise in PGRA in multiparous cows (p≤0.10) (Table 2). For the BxH genetic group, just one significant association was found in allele 19, with a rise in PGRA with 0.8% more than cows that bear allele 24 (p≤0.05), (Table 3).

Table 3. Statistical significance of the association of BoLA DRB3.2*19 allele with milk production and compositional quality traits in BxH cows1 Traits PL305

PP305

PPRO

PG305

PGRA

Allele

Fre

kg±DE

kg±DE

%±DE

kg±DE

%±DE

19

4

-746±138

-17±4

0.14±0.08

1±7

0,8±0.09†

24

8

0±216

0±1

0±0.08

0±12

0±0.19

Fre=Frequency; Allele 24 was fixed to zero to compare allelic substitution, PL305 = Milk yield adjusted to 305 days, PP305=Protein yield adjusted to 305 days, PPRO = Protein Percentage, PG305 = Fat yield adjusted to 305 days, PGRA = Fat Percentage , DE= Standard Deviation, *p≤0.10, †p≤0.05, ‡p≤0.01.

1

4123

PG305 de 182 kg, mientras que las multíparas presentaron una media de 228 kg (Tabla 1). La media para PGRA en la población evaluada fue de 3.66% y las medias para cada grupo genético fue significativamente diferente (p≤ 0.01); para BxH fue de 4.11% y para Holstein fue de 3.53% y en cuanto al efecto parto, en Holstein no se encontró diferencias significativas, las vacas primíparas tuvieron una media de PPRO de 3.56% y las multíparas de 3.50% (Tabla 1).

Asociación de los alelos BoLA DRB3.2 con PL305, PP305 y PG305. Comparando las medias de PL305 de cada alelo BoLA DRB3.2 con el alelo de sustitución (alelo 24), se encontró en el grupo de vacas multíparas de raza Holstein, una asociación altamente significativa con disminución en la PL305 del alelo 36, con 1674 kg menos que las vacas portadoras del alelo de sustitución (p≤0.01) (Tabla 2). En la raza Holstein, también se encontró una asociación significativa con aumento en la PG305 para el alelo 36 (p≤0.01) en vacas primíparas. En el grupo de vacas BxH no se determinaron asociaciones significativas para estas características.

Asociación de los alelos BoLA DRB3.2 con PPRO y PGRA. En la raza Holstein fueron determinadas asociaciones significativas con aumento en el PPRO para el alelo 33 en vacas primíparas (p≤0.10) con 0.40% más que las vacas portadoras del alelo de sustitución y para el alelo 16 en vacas multíparas con 0.21% más que las vacas portadoras del alelo de sustitución (p≤0.10) (Tabla 2). Para PGRA, el alelo 36 fue asociado con aumento en los niveles de esta característica en vacas multíparas (p≤0.05), con 0.55% más que las vacas que llevan el alelo de sustitución. Los alelos 8 y 22 igualmente fueron asociados significativamente con aumento en el PGRA en vacas multíparas (p≤0.10) (Tabla 2). Para el grupo genético BxH se encontró sólo una asociación significativa en el alelo 19, con aumento en el PGRA con 0.8% más que las vacas que llevan el alelo 24 (p≤0.05), (Tabla 3).

DISCUSIÓN Frecuencias alélicas del gen BoLA DRB3.2.

En el hato Paysandú fueron identificados 27 alelos BoLA DRB3.2 en los grupos genéticos Holstein y BxH, siendo indicativo de un alto polimorfismo para este gen. En el grupo genético Holstein se encontraron 23 alelos BoLA DRB3.2 y los 10 alelos más frecuentes fueron: BoLA DRB3.2*23, 22, 24, 16, 33, 8, 39, 37, 27 y 18 y presentaron una frecuencia acumulada de 0.78. Estos resultados fueron similares a los obtenidos por varios autores que determinaron las frecuencias

4124

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

DISCUSSION Allelic frequencies of gene BoLA DRB3.2. 27 BoLA DRB3.2 alleles were identified at Paysandú cattle farm in genetic groups Holstein and BxH, indicating a high polymorphism for this gene.

The Holstein genetic group had 23 BoLA DRB3.2 alleles, and the 10 most frequent alleles were: BoLA DRB3.2*23, 22, 24, 16, 33, 8, 39, 37, 27 and 18 presenting an accumulated frequency of 0.78. These results were similar to those obtained by various authors who determined the allele frequencies of the gene BoLA DRB3.2 in various Holstein populations and which Support the results of this investigation (6,10,11,17-19).

On the other hand, 18 BoLA DRB3.2 alleles were identified for the BxH genetic group, out of which 11 were reported to be from the blanco Orejinegro (BON) breed, (20). The allelic frequencies obtained in BxH cows in this study were different, compared to those obtained from the BON breed (20). The differences in the allelic frequencies is possibly due to the fact that mainly F2 (25% BON and 75% Holstein) animals were used in this investigation.

de los alelos del gen BoLA DRB3.2 en varias poblaciones de raza Holstein y que soportan los resultados de esta investigación (6,10,11,17-19).

Por otra parte, para el grupo genético BxH, se identificaron 18 alelos BoLA DRB3.2 de los cuales 11 fueron reportados en la raza blanco Orejinegro (BON), (20). Las frecuencias alélicas obtenidas en vacas BxH en este estudio fueron diferentes comparadas con las obtenidas en la raza BON (20). La diferencia en las frecuencias alélicas se debe posiblemente a que en esta investigación se emplearon principalmente animales F2 (25% BON y 75% Holstein).

Asociación de alelos BoLA DRB3.2 con características productivas. Han sido reportados varios alelos BoLA DRB3.2 asociados a características productivas; principalmente producción de leche, grasa y proteína (6, 10, 12, 21-23), (Tabla 4). En este estudio se encontraron asociaciones significativas de los alelos 8, 16 y 22, que también fueron reportados por otros autores (Tabla 4). Sin embargo, algunas asociaciones de los alelos 19, 33 y 36 con características productivas determinadas en este estudio, no han sido reportadas por otros autores.

Table 4. Associations of BoLA DRB3.2 alleles with productive traits found in literature and in this investigation.

Allele

Breed

No Animals

3 6

Holstein Gyr Holstein Gyr Holstein Holstein Holstein Holstein1 Holstein Holstein Holstein Holstein Gyr Holstein Holstein1 BONxHolstein1 Holstein Holstein Holstein1 Holstein Holstein Holstein Holstein Holstein Gyr Holstein1 Holstein1 Holstein1 Holstein1 Gyr

186 1058 186 1058 186 835 328 66 328 186 328 262 424 328 66 25 835 262 66 328 186 262 186 186 424 65 66 66 66 1058

7

8 10 11

16 19 22 23 24 26 27 29 33 36 54

Milk Decrease

Increase

Decrease Increase Decrease

Traits Protein Decrease Increase Increase Decrease Increase Increase

Increase Increase

Increase Increase

Increase

Decrease

Increase*

Decrease Increase*

Increase

Decrease Increase Increase

Decrease

Fat Decrease

Decrease Increase Increase* Increase Decrease Increase Increase*

Decrease

Increase

Increase* Decrease

Decrease*

Increase*

Increase* Increase*

Increase

Decrease

Decrease

Increase Increase* Decrease

Reference 6 12 6 12 6 10 11 6 6 11 22 21 11

10 22 11 6 22 6 6 21

12

BoLA DRB3.2 alleles associated to productive traits found in this investigation. *The association is referenced as a percentage of the evaluated characteristic.

1

Zambrano - Association of gene BoLA DRB3.2 in a dairy herd Association of BoLA DRB3.2 alleles with production traits. Several BoLA DRB3.2 alleles were reported associated to production traits; mainly milk, fat and protein production (6,10,12,21-23), (Table 4). Significant association found in this study were among alleles 8, 16 and 22, which were also reported by other authors (Table 4). However, some associations from alleles 19, 33 and 36 with production trait determined in this study, have not been reported by other authors.

In this study, allele 8 was significantly associated to an increase in PGRA in multiparous cows of the Holstein genetic group. This result agrees with that reported by Sharif et al (10), who determined significant associations with an increase in fat production. However, those authors, also determined that allele 8 was associated to an increase in milk and protein production in Holstein cows, in contradiction to Starkenburg et al (6), who determined significant associations of allele 8 with a decrease in milk, fat and protein production in cows from the selection line of third lactation. Additionally, allele 8 was associated significantly to a decrease in protein and milk production during the third lactation period, in combined lines (control and selection).

Rupp et al (11), likewise, determined significant associations of allele 8 with a decrease in milk production and an increase in protein production (Table 4).

Additionally, during this investigation, a significant association of allele 16 with increase in PPRO in multiparous Holstein cows, Rupp et al (11), determined a significant association of allele 16 with a decrease in the fat production in Holstein cow for the three first lactation periods and Machado et al (21), found for the same allele, a significant association with milk production in Gyr cows. This study found that allele 22 has a significant association with an increase in PGRA in multiparous cows of the Holstein genetic group, which agrees with the results obtained by Pashmi et al (22), who found an increase in fat percentage in Iranian Holstein.

Sharif et al (10) did not find associations of allele 22 with fat production or percentage, but did determine significant associations of this allele with a decrease in milk and protein production in both previous and subsequent lactating groups (Table 4).

Allele 36 was another variant of gene BoLA DRB3.2 that was significantly associated with an increase in PG305 in primiparous cows (p<0.01), with an increase in PGRA (p<0.05) and with a decrease in PL305 in multiparous Holstein cows (p<0.01). Another allele that presented

4125

En este estudio el alelo 8 fue asociado significativamente con incremento en el PGRA en vacas multíparas del grupo genético Holstein, resultado que concuerda con el obtenido por Sharif et al (10), quienes determinaron asociaciones significativas con incremento en la producción grasa. Sin embargo, estos autores también determinaron que el alelo 8 estaba asociado con el incremento en la producción de leche y de proteína en vacas Holstein, pero contradictoriamente, Starkenburg et al (6) determinaron asociaciones significativas del alelo 8 con disminución en la producción de leche, grasa y proteína para vacas de la línea de selección de la tercera lactancia. Además, en líneas combinadas (de control y de selección), el alelo 8 fue asociado significativamente con disminución en la producción de proteína y leche durante la tercera lactancia. Rupp et al (11), igualmente determinaron asociaciones significativas del alelo 8 con disminución en producción de leche y con incremento en la producción de proteína (Tabla 4).

Adicionalmente en esta investigación se determinó una asociación significativa del alelo 16 con el incremento en el PPRO en vacas multíparas de raza Holstein. Rupp et al (11), encontraron una asociación significativa del alelo 16 con disminución en la producción de grasa en vacas Holstein para las tres primeras lactancias y Machado et al (21), encontraron para el mismo alelo una asociación significativa con producción de leche en vacas de raza Gyr. Para el alelo 22, se encontró en este estudio que fue asociado significativamente con aumento en el PGRA en vacas multíparas de del grupo genético Holstein, que concuerda con el resultado obtenido por Pashmi et al (22), quienes encontraron un incremento en el porcentaje de grasa en vacas Holstein Iraní. Sharif et al (10) no encontraron asociaciones del alelo 22 con producción de grasa ni porcentaje de grasa, pero sí determinaron asociaciones significativas de este alelo con disminución en la producción de leche y producción de proteína en los dos grupos de lactancias previas y subsecuentes (Tabla 4).

El alelo 36 fue otra variante del gen BoLA DRB3.2 que estuvo asociado significativamente con aumento en la PG305 en vacas primíparas (p<0.01), con aumento en el PGRA (p<0.05) y con disminución en la PL305 para vacas multíparas de raza Holstein (p<0.01). Otro alelo que mostró asociaciones significativas en vacas BxH fue el alelo 19 (ausente en la raza Holstein), en este caso se encontró que está asociado significativamente con aumento en el PGRA. De estos dos alelos no han sido reportadas asociaciones con características productivas, ni enfermedades infecciosas.

4126

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

significant associations in BxH cows, was allele 19 (absent in Holstein), in this case, it was found to be significantly associated to an increase in PGRA. Associations to productive characteristics or infectious diseases have not yet been reported for these two alleles.

In results obtained by other authors, and compared with those found in this investigation, only one discrepancy was found for allele 8, which was associated with an increase in fat percentage during this study, and which Starkenburg et al (6), determined that was associated with a decrease on fat production. Likewise, there were contradictions between the results obtained by other authors, such as Sharif et al (10) who found that allele 8 was associated to an increase in milk, fat and protein production, while Starkenburg et al (6) found associations of allele 8 with a decrease in milk, fat and protein production.

Rupp et al (11), reported associations of allele 8 with a decrease in the production of milk and an increase in the production of protein.

Sharif et al (10), establishes that these inconsistencies may be due to the different states of linkage disequilibrium between populations and that it is also necessary to apply higher statistical astringency to exclude the possibility of presence of erroneous associations, caused by multiple comparison samples. Other factors that may be involved in the inconsistencies among results obtained by different authors, may possibly be the Genotype-Environment interaction, given that the investigations are undertaken in different parts of the world.

However, to obtain more precise results, the use of populations with high number of individuals is required, given that the elevated number of polymorphism of gene DRB3, leads to the gaining of low allelic and genotype frequencies.

Rupp et al (11), considers that these differences have been notoriously difficult to avoid and are one of the strong impediment for a selection based on the breeding value in the CMH genotype. However, he explains, by quoting Alizadeh et al (23) that this cannot conclude that the information in the expression of CMH genes, does not improve the mechanisms involved in the resistance to diseases or that it is not one of the many tools that may be used to improve animal health and indirectly productivity in these particular populations.

Gene BoLA DRB3 has been associated to resistance and susceptibility to infectious diseases and its main function is the expression of antigen-presenting proteins (7). However, it is also associated to productive traits. Although the

En resultados obtenidos por otros autores, y comparados con los encontrados en esta investigación, solo se encontró una discrepancia para el alelo 8, que en este estudio fue asociado con incremento en el porcentaje de grasa y Starkenburg et al (6), determinaron que fue asociado con disminución en la producción de grasa. Igualmente, hubo contradicciones entre los resultados obtenidos por otros autores, por ejemplo, Sharif et al (10) encontraron que el alelo 8 fue asociado con incremento de la producción de leche, grasa y proteína, mientras que Starkenburg et al (6) encontraron asociaciones del alelo 8 con disminución en la producción de leche, grasa y proteína. Rupp et al (11), reportaron asociaciones del alelo 8 con disminución en la producción de leche y con incremento en la producción de proteína.

Sharif et al (10), establecen que estas inconsistencias pueden ser debido a los diferentes estados de desequilibrio de ligamiento entre poblaciones y que además es necesario aplicar mayor astringencia estadística para excluir la posibilidad de la presencia de asociaciones erróneas, causadas por las pruebas de comparación múltiple. Otros factores que pueden estar involucrados en las inconsistencias entre los resultados obtenidos por los autores mencionados anteriormente, puede ser posiblemente la interacción genotipo ambiente, dado que las investigaciones son realizadas en diferentes partes del mundo. Sin embargo, para obtener resultados más precisos, se requiere de utilizar poblaciones con alto número de individuos, dado que el elevado polimorfismo del gen DRB3, que conlleva a obtener frecuencias alélicas y genotípicas bajas.

Ru p p e t a l ( 1 1 ) , c o n s i d e ra n q u e e s t a s discrepancias han sido notoriamente difíciles de evitar y son uno de los fuertes impedimentos para realizar una selección basada en valor de cría en el genotipo CMH. Sin embargo, explica, citando a Alizadeh et al (23) que no se puede concluir que la información de la expresión de los genes del CMH no mejora los mecanismos involucrados en la resistencia a enfermedades o que no es una de las muchas herramientas que puede ser usada para mejorar la salud animal e indirectamente la productividad de estos en poblaciones particulares.

El gen BoLA DRB3 ha sido asociado con resistencia y susceptibilidad a enfermedades infecciosas y su función principal es la expresión de proteínas presentadoras de antígeno (7).

Sin embargo, también muestra estar asociado con características productivas. No obstante, la relación entre el gen BoLA con estas características

Zambrano - Association of gene BoLA DRB3.2 in a dairy herd

4127

relationship between the gene BoLA with these characteristics is not direct, given that CMH genes are not involved in the process of milk secretion.

The relationship is given when finding animal with allele variants that allow them to be resistant to infectious diseases, and this resistance must be reflected by an increase in productivity, or that very productive animals present allelic variants with susceptibility to infectious diseases (11,24).

no es directa, dado que los genes del CMH no están involucrados en el proceso de secreción de leche. La relación se da al encontrar animales con variantes alélicas que les permite ser resistentes a enfermedades infecciosas y esta resistencia debe ser reflejada en un aumento en la productividad, o que animales muy productivos presenten variantes alélicas asociadas con susceptibilidad a enfermedades infecciosas (11,24).

This investigation found that allele 8 was associated to an increase in the fat percentage in multiparous Holstein cows (p≤0.1). However, other investigations report that it was associated to susceptibility to subclinical mastitis (6,22,25).

Likewise, this investigation determined that allele 33 was significantly associated to the decrease in protein percentage in Holstein primiparous cows (p≤0.1), and it was also reported that allele 33 is associated to resistance of subclinical mastitis (25). Even though some alleles have been associated to production and mastitis, it is clear that alleles from gene BoLA DRB3.2 have not yet been reported, to present concluding superiority for productive traits and resistance to infectious diseases. However, the results obtained in this investigation and in those of other authors, generate great interest in finding genes associated to sanity and production, or even other economically important traits, to be included in molecular marker assisted selection programs.

En esta investigación se encontró que el alelo 8 fue asociado con incremento en el porcentaje de grasa en vacas multíparas de raza Holstein (p≤ 0.1). Sin embargo, en otras investigaciones se reporta que fue asociado con susceptibilidad a mastitis subclínica (6,22,25). De igual manera, se determinó en esta investigación que el alelo 33 fue asociado significativamente con disminución en el porcentaje de proteína en vacas primíparas de raza Holstein (p≤0.1), y también se ha reportado que el alelo 33 ha sido asociado con resistencia a mastitis subclínica (25). Si bien, algunos alelos han sido asociados con producción y mastitis, es claro que aún no han sido reportados alelos del gen BoLA DRB3.2, que presenten superioridad contundente para características productivas y resistencia a enfermedades infecciosas. No obstante, los resultados obtenidos en esta investigación y en las de otros autores, generan gran interés por encontrar genes asociados a sanidad y producción, e incluso de otras características de importancia económica, para ser incluidos en programas de selección asistida por marcadores moleculares.

Acknowledgements This article was part of the project: Correlation between clinical and subclinical mastitis with the genotypic variants of gene BoLA DRB3.2, present in cows and calves of first calving at the milk farm of hacienda Paysandú at the Universidad Nacional de Colombia, QUIPU code 20101006713, financed by the Dirección de Investigación de la Universidad Nacional de Colombia sede Medellín.

Agradecimientos Este artículo fue parte del proyecto: Correlación entre mastitis clínica y subclínica con las variantes genotípicas del gen BoLA DRB3.2, presentes en las vacas y novillas de primer parto del hato lechero de la hacienda Paysandú de la Universidad Nacional de Colombia, código QUIPU 20101006713, financiado por la Dirección de Investigación de la Universidad Nacional de Colombia sede Medellín.

4128

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

REFERENCES 1. Espinal CF, Martínez HJ, González FA. La cadena de lácteos en Colombia: una mirada global de su estructura y dinámica 1991-2005. [En Línea]. 2005 (fecha de acceso 20 abril de 2011); (74). URL disponible en: http://www.agronet.gov. co/www/docs_agronet/2005112162250_ caracterizacion_lacteos.pdf 2. Fedegan. Estadísticas: Producción Colombia.

[En Linea]. 2013. (Fecha de acceso 8 de diciembre de 2013). URL disponible en: http://www.fedegan.org.co/estadisticas/ produccion-0 3. Oltenacu PA, Broom DM. The Impact of genetic selection for increased milk yield on the welfare of dairy cows. Animal Welf 2010; 19(S):39-49 4. Carlén E, Strandberg E, Roth A. Genetic parameters for clinical mastitis, somatic cell score, and production in the first three lactations of Swedish Holstein cows. J Dairy Sci 2004; 87:3062-3070.

5. Quintero GE. Evolución y desarrollo del sector Lácteo en Colombia desde la perspectiva del eslabón primario (Producción). Medellín Colombia: Corporación Universitaria La Sallista, Facultad de Ciencias Administrativas y Agropecuarias. Posgrado en Especialización en Gerencia Agropecuaria: 2011.

6. Starkenburg RJ, Hansen LB, Kehrli JR, ChesterJones H. Frequencies and effects of alternative DRB3.2 alleles of bovine lymphocyte antigen for Holstein in milk selection and control lines.

J Dairy Sci 1997; 80:3411-3419.

7. Behl JD, Verma NK, Tyagi N, Mishra P, Behl R, Joshi BK. The major histocompatibility complex in bovines: A Review. ISRN Veterinary Science 2012; 2012:1-12 8. Wang K, Sun D, Zhang Y. Sequencing of 15 new BoLA-DRB3 Alleles. Int J Immunogenet 2008; 35:331-332.

9. Lee BY, Hur TY, Jung YH, Kem H. Short Communication. Identification of BoLA DRB3.2 alleles in Korean native cattle (Hanwoo) and Holstein populations using a next Generation sequencer. Anim Genet 2012; 43(4):438-441.

10. Sharif S, Mallard BA, Wilkie BN, Sargeant JM, Scott HM, Dekkers JC et al. Associations of the bovine major histocompatibility complex DRB3 (BoLA-DRB3) alleles with production traits in Canadian dairy cattle. Anim Genet 1998; 30:157-160.

11. Rupp R, Hernandez A, Mallard BA. Association of bovine leukocyte antigen (BoLA) DRB3.2 with immune response, mastitis and production and type traits in Canadian Holsteins. J Dairy Sci 2007; 90:1029-1038.

12. Nascimento CS, Machado MA, Martínez ML, Barbosa MV, Martins MF, Campos AL, et al. Association of the bovine major histocompatibility complex (BoLA) BoLADRB3 gen with fat and protein production and somatic cell score in Brazilian Gyr Dairy cattle (Bos indicus). Genet Mol Biol 2006; 29(4):641-647.

13. Wojdak-Maksymiec K, Kmiec M, KowalewskaL u c z ac I , War l i ñ s k i M . DR B 3 G e n e polymorphism and somatic cell count in milk of jersey. J Anim Vet Adv 2010; 9(9):12951300.

14. Van Eijk MJT, Stewart-Haynes JA, Lewin HA. Extensive polymorphism of the BoLA-DRB3 gene distinguished by PCR-RFLP. Anim Genet 1992; 23:483.

15. Laird NM, Lange C. The Fundamentals of Modern Statistical Genétics. New York USA: Springer; 2011.

16. SAS/STAT: [Programa de ordenador] Version 9.1, Cary (NC): SAS Institue Incorporation; 2006.

17. Nassiry MR, Shahroodi EF, Mosafer J, Mohammadi A, Manshad E et al. Analysis and frequency of bovine lymphocyte antigen (BoLA DRB3) alleles in Iranian Holstein Cattle. Russ J Genet 2005; 41(6):664-668.

18. Nassiry MR, Sadeghi B, Tohidi R, Afshari JT, Khosravi M. Comparison of bovine lymphocyte antigen DRB3.2 allele frequencies between two subpopulations of Iranian Holstein cattle.

Afr J Biotechnol 2008; 7(15):2671-2675.

19. Operzadek J, Urtnowski P, Sender G, Pawlik A, Lukaszewicz. Frequency of alleles BoLA-DRB3 in Polish Holstein-Friesian cattle. Anim Sci Pap Rep 2012; 30(2):91-101.

Zambrano - Association of gene BoLA DRB3.2 in a dairy herd 20. Martínez R, Toro R, Montoya F, Burbano M, Tobón J, Gallego J y Ariza F. Caracterización del locus BoLA-DRB3 en ganado criollo colombiano y asociación con resistencia a enfermedades. Arch Zoot 2005; 54:(206207):350-356.

21. Machado MA, Nascimento CS, Martinez ML, Silva GB, Campos AL, Teodoro RL et al.

Association of BoLA-DRB3.2 locus with bovine milk production in Gyr breed. Arq Bras Med Vet Zootec 2005; 57(3):380-389.

22. Pashmi M, Qanbari S, Ghorashi SA, Sharifi AR. Analysis of relationship between bovine lymphocyte antigen DRB3.2 alleles, somatic cell count and milk traits in Iranian Holstein population. J Anim Breed Genet 2009; 126:296–303

4129

23. Alizadeh Z, Karrow N, Mallard BA. Biological effect of varying peptide binding affinity to the BoLA-DRB3*2703 allele. Genet Sel Evol 2003; 35(1):51-65.

24. Rupp R, Boichard D. Genetics of resistance to mastitis in dairy cattle. Vet Res 2003; 34:671688.

25. Zambrano JC, López-Herrera A, Echeverri JJ. Alleles of the BoLA DRB3.2 gene are associated with mastitis in dairy cows. Rev Col Cienc Pec 2011; 24(2):145-156.

Rev.MVZ Córdoba 19(2):4130-4140, 2014. ISSN: 0122-0268 ORIGINAL

Follicular dynamics, corpus luteum growth and regression in multiparous buffalo cows and buffalo heifers Dinámica folicular, crecimiento y regresión del cuerpo lúteo en búfalas multíparas y novillas Alejandro Ojeda R,1* Esp, Ricardo Londoño O,1 MVZ, Carlos Gutierrez R,1 MV, Angela Gonella-Diaza,2 MSc. Fundacion Educativa Para La Equidad y el Desarrollo Rural. Carrera 1ª A No 11-130 Oficina 505 Torre 1. Chia, Cundinamarca, Colombia. 2Universidad Cooperativa de Colombia, Faculty of Veterinary Medicine and Animal Husbandry, Animal nutrition, toxicology and reproduction Research Group. Calle 30 No. 33 - 51. Bucaramanga, Colombia. *Correspondence: alejojeda@hotmail.com 1

Received: May 2013; Accepted: December 2013.

ABSTRACT Objective. Characterize the follicular dynamics and luteal growth and regression pattern of multiparous (MB) and heifer (BH) Murrah buffaloes in Colombian tropical conditions. Material and methods. Ten MB and ten BH were synchronized with a progesterone-releasing intravaginal device. No artificial insemination was performed during the estrous and daily ultrasound examinations were performed 15 days later to determine the number and diameter of the structures present in both ovaries in the subsequent natural estrous cycle. The Student’s T test was used to evaluate differences between MB and BH. All data are presented as mean ± standard deviation. Results. The length of the estrous cycle was 22.00±4.50 days for MB and 22.00±2.70 days for BH. Follicular growth occurs in one (n=1; 5.89%), two (n=14; 82.35%) or three waves (n=2; 11.76%). The first wave initiated the day after ovulation with the recruitment of 8.33±2.06 and 10.00±2.72 follicles in MB and BH, while the second wave started on day 11.00±2.00 and 10.50±2.82, presenting 8.37±2.26 and 8.00±1.51 follicles. The third wave began on day 16.21±3.10 showing 6.50±1.70 follicles, only BM had three waves. The maximum luteal diameter was 19.58±4.16 mm and 17.74±3.32 mm respectively. There were no significant differences between the groups for these variables. Conclusions. These results show that the follicular development in buffaloes occurs in waves, where two waves is the most common pattern, as previously reported by other authors.

Key words: Estrous cycle, ovarian follicles, tropical zones (Source: CAB).

RESUMEN Objetivo. Caracterizar la dinámica folicular y el patrón de crecimiento y regresión del cuerpo lúteo de búfalas multíparas (BM) y búfalas novillas (BN) de la raza Murrah en condiciones del trópico colombiano.

Materiales y métodos. Diez BM y diez BN fueron sincronizadas con dispositivo intravaginal de liberación de progesterona. No se realizó la inseminación artificial al momento del celo y 15 días después se inició el

4130

Ojeda - Follicular dynamics, corpus luteum growth and regression in buffalo

4131

seguimiento ultrasonográfico para determinar el número y diámetro de las estructuras presentes en ambos ovarios en el subsecuente ciclo estral natural. Las diferencias entre BM y BN se evaluaron con pruebas T. Los datos se presentan como media ± desviación estándar. Resultados. La duración del ciclo estral fue de 22.00±4.50 y 22.00±2.70 días en BM y BN. El crecimiento folicular ocurrió en una (n=1; 5.89%), dos (n=14; 82.35%) o tres (n=2; 11.76%) ondas. La primera onda inicio el día siguiente a la ovulación con el reclutamiento de 8.33±2.06 y 10.00±2.72 folículos en BM y BN, mientras que la segunda onda inicio el día 11.00±2.00 y 10.50±2.82 con 8.37±2.26 y 8.00±1.51 folículos. La tercera onda inicio el día 16.21±3.10 con 6.50±1.70 folículos, sólo BM presentaron tres ondas. El diámetro máximo luteal fue de 19.58±4.16 mm y 17.74±3.32 mm. No se observaron diferencias significativas entre los grupos para estas variables.

Conclusiones. Los resultados muestran que el desarrollo folicular de las búfalas se dio en ondas, siendo dos ondas el patrón más común, similar a lo reportado por otros autores.

Palabras clave: Ciclo estral, folículos ováricos, zonas tropicales (Fuente: CAB).

INTRODUCTION

INTRODUCCIÓN

Buffaloes have become a species of economic importance in developing countries in tropical and subtropical regions. They show an efficient conversion, are resistant and require relatively low maintenance costs in the tropics, where the constant availability of food is not always ideal (1). In addition, buffalo milk is of high quality and better paid by dairy processing plants; whereas for meat production, weight gains similar to and in some cases higher than those reported for bovine animals in the same conditions have been observed (1,2). This means that buffaloes are a good source of animal protein, both milk and meat (2, 3).

Los búfalos se han convertido en una especie de importancia económica en los países en vías de desarrollo en regiones tropicales y subtropicales.

Estos tienen una eficiente conversión, son resistentes y requieren de un relativo bajo costo de mantenimiento en las zonas tropicales, donde la disponibilidad constante de alimento no siempre es la ideal (1). Además, la leche de búfala es de alta calidad y es mejor pagada por las plantas procesadoras de lácteos; mientras que, para la producción de carne, se han reportado ganancias de peso similares y en algunos casos superiores a las reportadas para los bovinos en las mismas condiciones (1,2). Esto ha hecho que los búfalos se constituyan en una buena fuente de proteína animal, tanto de leche como de carne (2, 3).

In the past 30 years, the world’s buffalo population (172,263,305) has increased 34%, while during this same period the world cattle inventory has only grown 12%. In addition, since the 1970s the world production of buffalo milk has increased 200% (4). In Colombia, the presence of large expanses of floodable lands with poor soil drainage, high rain seasonality and low fertility, where bovine production fails to be efficient, buffaloes have become in a promising species since it adapts to these conditions and manages efficient production parameters (5).

Therefore, the interest in Buffalo production has notably increased in the last 20 years, with an increase in the number of heads and the establishment of an Association of Buffalo Producers (Aso Bufalos de Colombia; 1).

The productivity of the buffalo system is largely limited by the reproductive efficiency of female buffaloes. When compared to female bovines, the reproductive efficiency of the buffalo is affected by characteristics such as: the late onset of puberty (6-8); the poor presentation of signs of estrous that hinder the use of artificial insemination techniques when the estrous is detected (6.8); the long intervals of postpartum anestrus in females that give birth not during the

En los últimos 30 años la población mundial bufalina (172’263.305) se ha incrementado en 34%, mientras que en este mismo período el inventario bovino mundial solamente ha crecido en 12%. Adicionalmente, desde la década de los setenta, la producción mundial de leche de búfala ha aumentado el 200% (4). En Colombia, la presencia de grandes extensiones de tierras inundables, con mal drenaje de suelos, alta estacionalidad de lluvias y baja fertilidad, en donde la producción bovina no logra ser eficiente, han hecho que los búfalos se conviertan en una especie promisoria ya que se adapta a estas condiciones y logra paramentos productivos eficientes (5). Por esto, en los últimos 20 años ha aumentado notablemente el interés por la producción bufalina, viéndose un aumento en el número de cabezas y en la constitución de una Asociación de Productores de Búfalos (Aso búfalos de Colombia; 1).

La productividad del sistema bufalino está en gran parte limitada por la eficiencia reproductiva de las búfalas. Al comparar con la hembra bovina, la eficiencia reproductiva de la búfala se ve afectada

4132

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

mating station, mainly due to their condition of seasonally polyestrous and short-day breeders (7-9); a lower population of preantral follicles, approximately 10 times less than that in cows, affecting superovulation programs (7,9,10) and a longer gestation (7). However, it is worth highlighting that buffaloes have greater longevity and hardiness than cows and some authors have found that, using genotypes suitable for a specific production, handling and environment system, reproductive parameters can be satisfactory and be deemed a viable production alternative (11,12).

The knowledge and understanding of the physiological phenomena that occur in the bovine ovary allowed the development of reproductive biotechnologies that potentiate the exploitation of female gametes and the reproductive efficiency of cows (13,14). Despite the importance of buffaloes in the global and regional economy, there are still very few studies that deepen in the ovarian physiology of female buffaloes and to date no other experiment has been found where it has been proposed to determine the follicular dynamics of female buffaloes under the conditions of the Colombian tropics; further, comparing the follicular dynamic among multiparous buffaloes (BM) and buffaloes heifers (BN). The objective of this study was to determine the follicular dynamics and the growth and regression pattern of the corpus luteum in Murrah BM and BN subjected to Colombian tropical conditions.

MATERIALS AND METHODS Study site. The experimental phase took place in the facilities of the Centro Internacional de Formacion Agropecuaria (CIFA; north latitude 5°39.075” and west longitude 74°34.843”), located in the municipality of Puerto Salgar (Cundinamarca, Colombia). This municipality is located 195 km from Bogota D.C., 117 meters above sea level and has an average temperature of 27°C and a relative humidity between 75 and 80%.

Animals and grazing. Two experimental groups of 10 each were randomly selected from a population of 500 female buffalo cows. A group with virgin BN and another group with BM. The experimental units selection criteria was: at the time of starting the experiment all animals had regular estrous cycles and were clinically healthy with a body condition of 3 to 3.5 (scale of 1-5) and that all individuals belong to the Murrah breed. The BN cows had an age of 24.72±1.45 months and BM of 81.97±31.75 months with 2.7±0.8 deliveries. To ensure that

por características como: la presentación tardía de la pubertad (6-8); la pobre presentación de los signos de celo que dificultan la utilización de la técnica de inseminación artificial a celo detectado (6,8); los largos intervalos de anestro postparto en hembras que paren por fuera de la estación de apareamiento, debido principalmente a su condición de poliéstricas estacionales de días cortos (7-9); una menor población de folículos preantrales, aproximadamente 10 veces menor que en la vaca, afectando los programas de superovulación (7,9,10) y una gestación más larga (7). Sin embargo, cabe resaltar que las búfalas presentan una mayor longevidad y rusticidad que las vacas y que algunos autores han encontrado que, empleando genotipos adecuados para un sistema de producción, manejo y ambiente determinados, los parámetros reproductivos pueden mostrarse satisfactorios y considerarse una alternativa viable de producción (11,12).

El conocimiento y entendimiento de los fenómenos fisiológicos que se presentan en el ovario bovino permitió el desarrollo de biotecnologías reproductivas que potencializan la explotación de los gametos femeninos y la eficiencia reproductiva de las vacas (13,14). A pesar de la importancia que tienen los búfalos en la economía mundial y regional, existen aún pocos estudios que ahonden la fisiología ovárica de la búfala y a la fecha no se ha encontrado otro experimento donde se intente determinar la dinámica folicular de la hembra bufalina en las condiciones del trópico bajo colombiano; aún más, que comparen los eventos de la dinámica folicular entre búfalas multíparas (BM) y búfalas novillas (BN). El objetivo del presente estudio fue determinar la dinámica folicular, el patrón de crecimiento y regresión del cuerpo lúteo en BM y BN de la raza Murrah sometidas a condiciones del trópico bajo colombiano.

MATERIALES Y MÉTODOS Sitio de estudio. La fase experimental se llevó a cabo en las instalaciones del Centro Internacional de Formación Agropecuaria (CIFA; latitud norte 5°39.075” y longitud oeste 74°34.843”), ubicado en el municipio de Puerto Salgar (Cundinamarca, Colombia). Este municipio se encuentra a 195 km de Bogotá DC, a 117 msnm y cuenta con una temperatura promedio de 27°C y una humedad relativa entre el 75 y el 80%.

Animales y pastoreo. De una población de 500 hembras bufalinas, se seleccionaron aleatoriamente dos grupos experimentales de 10 individuos cada uno. Un grupo con BN vírgenes y otro grupo con

Ojeda - Follicular dynamics, corpus luteum growth and regression in buffalo all animals were under the same conditions they were kept grazing in a experimentation pasture, where they remained until the end of the study.

The pasture had Brachiaria mutica established and mineralized salt and water ad libitum.

Synchronization protocol. A transrectal, palpation and ultrasound examination was carried out prior to the start of the synchronization protocol to evaluate the structures present in the ovaries and select the animals that would enter the experiment. A fixed-time artificial insemination protocol was used (Sincrogest, Ourofino, Saude Animal, Brazil) with a progesterone-releasing intravaginal device on day zero, together with the application of 2 mg of estradiol benzoate (Sincrodiol, Ourofino Saude Animal, Brazil). Later on day 8, the intravaginal device was removed and PGF2 alfa was applied (Sincrocio, Ourofino Saude Animal, Brazil). Finally, 1 mg of estradiol benzoate was applied on day 9 (Sincrodiol, Ourofino Saude Animal, Brazil). Fifty-two hours after removing the intravaginal device a new transrectal examination was conducted to determine the response to the treatment by the presence of a preovulatory follicle. No artificial insemination was performed after the detection of estrous. Due to the low intensity of estrous behavior of buffaloes (6.8), all animals with a follicle larger than 10 mm, the presence of uterine tone and the presence of mucous vaginal discharge were considered in estrus (15).

Ultrasound examinations. Fifteen days after observing synchronized estrus, a new estrus detection began and daily ultrasound examinations was performed with an ultrasound device attached to a linear transducer of 7.5 MHz (Mindray DP 2200 Vet). The day of estrus was taken as day zero of the estrous cycle and thereafter, daily ultrasound monitoring was performed in order to make ovarian maps and assessing the number and diameter of the antral follicles and the diameter of the CL (16). After viewing the image of the ovary in the monitor of the ultrasound device, each ovary was scanned at various levels to ensure and capture the greatest amount of structures and determine their correct size, the data from the measurement of each structure were stored for further analysis. These ultrasound exam were carried out until a second estrus was evident and a second ovulation occurred in each one of the buffaloes.

A follicular wave was considered when finding the growth of a dominant follicle and its cohort and the day of emergence of the follicular wave was defined as the day when the first follicle reached a diameter of 4 mm (17). The deviation of the dominant follicle was determined as the moment

4133

BM. Se tuvieron como criterios de selección de las unidades experimentales: que todos los individuos estuvieran ciclando y se encontraran clínicamente sanos y con una condición corporal de 3 a 3.5 (escala de 1-5) al momento de iniciar el experimento y que todos los individuos fueran de la raza Murrah. Las BN tenían una edad de 24.72±1.45 meses y las BM de 81.97±31.75 meses con 2.7±0.8 partos. Para garantizar que todos los animales se encontraban bajo las mismas condiciones fueron mantenidos en pastoreo en un potrero de experimentación, donde permanecieron hasta finalizar el estudio. El potrero contaba con una pastura establecida de Brachiaria mutica y disposición de sal mineralizada y agua ad libitum.

Protocolo de sincronización. Previo al inicio del protocolo de sincronización, se realizó un examen transrectal, de palpación y ultra sonido con el fin de evaluar las estructuras presentes en los ovarios y realizar la selección de los animales que ingresarían al experimento. Fue empleado un protocolo de inseminación artificial a tiempo fijo con dispositivo intravaginal de liberación de progesterona (Sincrogest, Ourofino, Saúde Animal, Brasil) al día cero, junto con la aplicación de 2 mg de benzoato de estradiol (Sincrodiol, Ourofino Saúde Animal, Brasil).

Posteriormente al día 8, se retiró el dispositivo intravaginal y se aplicó PGF2 alfa (Sincrocio, Ourofino Saúde Animal, Brasil). Finalmente al día 9 se aplicó 1 mg de benzoato de estradiol (Sincrodiol, Ourofino Saúde Animal, Brasil).

Transcurridas 52 horas después de haber retirado el dispositivo intravaginal, se realizó un nuevo examen transrectal para determinar la respuesta al tratamiento por la presencia de un folículo preovulatorio Luego de realizarse la detección de celos, no se realizó la inseminación artificial.

Debido a la baja intensidad del comportamiento estral de las búfalas (6,8), todos los animales con presencia de un folículo mayor a 10 mm, presencia de tono uterino y presencia de descarga vaginal mucosa fueron considerados en celo (15).

Seguimiento ultrasonográfico. Quince días después de evidenciarse los celos sincronizados, se inició una nueva detección de celos y al seguimiento ultrasonográfico diario, con un equipo de ultrasonido acoplado a un transductor lineal de 7.5 MHz (Mindray DP 2200 Vet). El día del celo fue tomado como el día cero del ciclo estral y a partir de ese momento se realizaron seguimientos ultrasonográficos diarios con el fin de hacer mapeos ováricos y evaluar el número y diámetro de los folículos antrales y el diámetro del CL (16). Luego de visualizar la imagen del ovario en el monitor del equipo de ultrasonido, cada ovario fue escaneado en varios planos

4134

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

in which the diameter of the largest follicle was at least two standard deviations above the mean of the follicles of its cohort (18). The dominant follicle was defined as that which grew at least 10 mm and its diameter was greater than that of the other members of its cohort (17,19).

Data processing and statistical analysis. The information from the ovarian map was entered in Excel 2010 spreadsheets, in order to organize the information corresponding to the following variables: length of the estrous cycle, number of follicular waves during the estrous cycle, day of emergence and number of follicles recruited in each wave, day and diameter of the deviation of the dominant follicle (18), maximum diameter reached by the preovulatory follicle and corpus luteum, day and diameter in which the luteal regression began (determined as the second consecutive day in which the diameter of the structure reduces; 18). Each of the variables analyzed was subject to descriptive statistics and t-Student tests were performed to compare the data from BM and BN and those from different follicular growth waves. A significant difference was considered when p<0.05. The data were analyzed in Excel (Microsoft Office) and SAS 9.0 (The SAS Institute Inc). All data were presented as mean ± standard deviation.

RESULTS Response to the synchronization protocol.

Of the total number of females that initiated the protocol (10 BM and 10 BN) a preovulatory follicle was found in 85% (9 BM and 8 BN). The daily ultrasound exam began after 15 days.

Length of the estrous cycle and follicular dynamics. No significant differences were found for the length of the estrus cycle between BM and BN (p>0.05), it being 22.00±4.50 and 22.00±2.70 days, respectively. The follicular growth pattern occurred in one (n=1; 5.89%), two (n=14; 82.35%) or three waves (n=2; 11.76%; (Table 1).

For all the experimental units, the emergence of the first follicular growth wave occurred the day after ovulation, and an average of 8.33±2.06 and 10.00±2.72 follicles for BM and BN, respectively were observed on the ultrasound.

Follicular deviation in the first wave took place at 4.00±2.00 days for BM and 4.62±1.84 days for BN, with a diameter of the dominant follicle of 10.00±1.4 mm and 8.9±1.7 mm, respectively.

There were no significant differences between the groups for these variables (Table 1). The second wave of follicular growth began at 11.00±2.00 days

para asegurar y capturar la mayor cantidad de estructuras y determinar su tamaño correcto, los datos provenientes de la medición de cada estructura se almacenaron para su análisis posterior. Estos seguimientos se realizaron hasta cuando se evidenció un segundo celo y una segunda ovulación en cada una de las búfalas.

Una onda folicular fue considerada al encontrar el crecimiento de un folículo dominante y de su cohorte y el día de emergencia de la onda folicular se definió como el día que el primer folículo alcanzaba un diámetro de 4mm (17). La desviación del folículo dominante se determinó como el momento en el que el diámetro del folículo mayor era de al menos dos desviaciones estándar por encima de la media de los folículos de su cohorte (18). El folículo dominante se definió como aquel que creció por lo menos 10 mm y su diámetro fue mayor que el de los demás miembros de su cohorte (17,19).

Procesamiento de datos y análisis estadístico. La información proveniente del mapeo ovárico fue tabulada en hojas de cálculo del programa Excel 2010, con el objetivo de organizar la información correspondiente a las siguientes variables: duración del ciclo estral, número de ondas foliculares durante el ciclo estral, día de emergencia y número de folículos reclutados en cada onda, día y diámetro a la desviación del folículo dominante (18), diámetro máximo alcanzado por el folículo preovulatorio y por el cuerpo lúteo, día y diámetro en los cuales se inició la regresión luteal (determinada como el segundo día consecutivo en el cual disminuye el diámetro de la estructura; 18). Se realizó estadística descriptiva a cada una de las variables analizadas y se realizaron pruebas T de student para comparar los datos provenientes de las BM y BN y los provenientes de las diferentes ondas de crecimiento folicular. Se consideró diferencia significativa a partir de p<0.05. Los datos fueron analizados en los programas Excel (Microsoft Office) y SAS 9.0 (The SAS Institute Inc).

Todos los datos son presentados como media ± desviación estándar.

RESULTADOS Respuesta al protocolo de sincronización.

Del total de las hembras que iniciaron el protocolo (10 BM y 10 BN) se encontró un folículo preovulatorio en el 85% (9 BM y 8 BN).

Luego de 15 días se dio inicio al seguimiento ultrasonográfico diario.

Duración del ciclo estral y dinámica folicular.

No se encontraron diferencias significativas para

Ojeda - Follicular dynamics, corpus luteum growth and regression in buffalo Table 1. Duration of the estrous cycle and follicular dynamics of multiparous Murrah buffalo cows and heifers in the Colombian tropics.

Variable

Multiparous Buffalo Buffalo p valor Heifers Cows

Duration of the estrous cycle (days)

22.00 ±4.50

22.00 ±2.70

0.74

Number of waves

2.00 ±0.50

2.12 ±0.35

0.56

Emergence of wave 1 (day of the estrous cycle)

1

1

NC

Number of follicles in wave 1

8.33 ±2.06

10.00 ±2.72

0.17

Deviation of wave 1 (day of the estrous cycle)

4.00 ±2.00

4.62 ±1.84

0.42

Diameter of the deviation of wave 1 (mm)

10.00 ±1.40

8.90 ±1.70

0.13

Emergence of wave 2 (day of the estrous cycle)

11.00 ±2.00

10.50 ±2.82

0.68

Number of follicles in wave 2

8.37 ±2.26

8.00 ±1.51

0.70

Deviation of wave 2 (day of the estrous cycle)

14.00 ±2.13

14.50 ±2.32

0.66

Diameter of the deviation of wave 2 (mm)

10.00 ±1.50

9.10 ±1.60

0.11

Emergence of wave 3 (day of the estrous cycle)

16.21 ±3.10

---

---

Number of follicles in wave 3

6.50 ±0.70

---

---

Deviation of wave 3 (day of the estrous cycle)

19.09 ±0.99

---

---

Diameter of the deviation of wave 3 (mm)

9.89 ±0.72

---

---

Diameter of the preovulatory follicle (mm)

17.00 ±4.60

14.00 ±2.90

0.22

NC: Not calculated

for BM and 10.50±2.82 days for BN. An average of 8.37±2.26 and 8.00±1.51 follicular structures were ultrasonographically observed for BM and BN, respectively. On day 14.00±2.13 and 14.50±2.32 the deviation of the dominant follicle started in BM and BV, finding a diameter of 10.00±1.50 and 9.10±1.60 mm, respectively. The third wave of follicular growth started on day 16.21±3.10 with 6.50±1.70 follicles recruited. Only two multiparous BM showed three waves of follicular growth. The maximum diameter reached by the preovulatory follicle was 17.00±4.60 mm for BM and 14.00±2.90 mm for BN. No significant differences were found between the groups for these variables (Table 1).

When comparing the waves of follicular growth among themselves, regardless of the group, it was found that the interval since the emergence of the wave to the deviation of the dominant follicle was 4.29±1.89, 3.29±2.17 and 2.88±1.30 days for the first, second and third wave, respectively; likewise, the number of follicles was 9.11±2.47, 8.18±1.86 and 6.50±0.70. Finally, the diameter of the dominant follicle in the deviation was 9.56±1.58 mm for wave one, 9.75±1.67 mm for wave two and 9.89±0.72 mm for wave three. There was no statistical difference between the waves of follicular growth (Table 2).

4135

la variable duración del ciclo estral entre BM y BN (p > 0.05), siendo de 22.00±4.50 y 22.00±2.70 días, respectivamente. El patrón de crecimiento folicular ocurrió en una (n=1; 5.89%), dos (n=14; 82.35%) o tres ondas (n=2; 11.76%; Tabla 1).

Para el total de las unidades experimentales la emergencia de la primera onda de crecimiento folicular se presentó al día siguiente de evidenciarse la ovulación, observándose a la ecografía un promedio de 8.33±2.06 y 10.00±2.72 folículos para BM y BN respectivamente. La desviación folicular en la primera onda ocurrió a los 4.00±2.00 días en BM y 4.62±1.84 días en BN, con un diámetro del folículo dominante de 10.00±1.4 mm y 8.9±1.7 mm respectivamente. No se encontraron diferencias significativas entre los grupos para estas variables (Tabla 1). La segunda onda de crecimiento folicular inició a los 11.00±2.00 días en BM y 10.50±2.82 días en BN. Como resultado de la ecografía se observó un promedio de 8.37±2.26 y 8.00±1.51 estructuras foliculares para BM y BN, respectivamente. El día 14.00±2.13 y 14.50±2.32 el folículo dominante se desvió en BM y BV, encontrándose con un diámetro de 10.00±1.50 y 9.10±1.60 mm, respectivamente. La tercera onda de crecimiento folicular inicio el día 16.21±3.10 con 6.50±1.70 folículos reclutados. Solamente dos BM multíparas presentaron tres ondas de crecimiento folicular. El diámetro máximo alcanzado por el folículo preovulatorio fue de 17.00±4.60 mm para BM y 14.00±2.90 mm para BN. No se encontraron diferencias significativas entre los grupos para estas variables (Tabla 1).

Al comparar las ondas de crecimiento folicular entre sí, independientemente del grupo, se encontró que el intervalo desde la emergencia de la onda hasta la desviación del folículo dominante fue de 4.29±1.89, 3.29±2.17 y 2.88±1.30 días para la primera, la segunda y la tercera onda respectivamente; así mismo, el número de folículos fue de 9.11±2.47, 8.18±1.86 y 6.50±0.70. Finalmente el diámetro del folículo dominante en la desviación fue de 9.56±1.58 mm para la onda uno, 9.75±1.67 mm para la onda dos y 9.89±0.72 mm para la onda tres. No se encontraron diferencias estadísticas entre las ondas de crecimiento folicular (Tabla 2).

Diámetro y regresión del cuerpo lúteo.

Mediante los seguimientos ecográficos diarios se pudo observar que el diámetro máximo alcanzado por el cuerpo lúteo en las BM fue 19.58±4.16 mm y en las BN de 17.74±3.32 mm. La regresión luteal inicio a los 15.22±5.26 y 17.62±1.68 días del ciclo estral, para BM y BN, respectivamente.

No se observaron diferencias significativas entre los grupos para estas variables (Tabla 3).

4136

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

Table 2. Number of follicles, diameter of deviation and interval of the emergence of deviation in follicular waves of multiparous Murrah buffalo cows and heifers in the Colombian tropics. colombiano.

Variable Number of follicles Diameter of deviation (mm) Interval of emergence of deviation (days)

Wave 1

Wave 2

Wave 3

9.11 ±2.47 9.56 ±1.58 4.29 ±1.89

8.18 ±1.86 9.75 ±1.67 3.29 ±2.17

6.50 ±0.70 9.89 ±0.72 2.88 ±1.30

Table 3. Maximum diameter and luteal regression in multiparous Murrah buffalo cows and heifers in the Colombian tropics.

Multiparous Buffalo Cows

Buffalo Heifers

p valor

Maximum diameter of the corpus luteum (mm)

19.58 ±4.16

17.74 ±3.32

0.33

Corpus luteum regression (days of the estrous cycle)

15.22 ±5.26

17.62 ±1.68

0.23

Variable

No significant differences were detected at 0.05

Corpus luteum diameter and growth.

Through daily ultrasound exams it was to observe that the maximum luleal diameter was 19.58±4.16 mm for BM and 17.74±3.32 mm for BN. Luteal regression took place at 15.22±5.26 and 17.62±1.68 days of the estrous cycle for BM and BN, respectively. No significant differences were observed between the groups for these variables (Table 3).

DISCUSSION The duration of the estrous cycle in this study showed no significant differences when comparing BN to BM nor when comparing the number of waves of follicular growth. Similar results have been obtained by other authors such as Presicce et al (16). They worked with Mediterranean BM and BN and found that for animals with two waves of follicular growth, the duration of the estrous cycle ranged from 20 to 26 days. However, they found a higher proportion of animals with a single wave of follicular growth, which had a shorter cycle duration (8 to 12 days).

Baruselli et al (20), working with Murrah animals, also found 3.33, 66.66 and 33.33% of animals with one, two and three waves respectively. In this study, the duration of the estrous cycle of animals with one wave was 13 days. Awasthi et al (17) found a high proportion of animals with one wave (62.5%) in which the estrous cycle lasted 20.8±0.58 days. It is possible that the absence of significant differences in the duration of the estrous cycle in this study is due to the low proportion of animals with a single wave (n=1) and to the duration of their cycle that was 18 days. The variables that influence the number of waves during the estrous cycle have not been accurately determined yet; however, it has been proposed that the breed, physiological and nutritional conditions, environmental conditions, among others, may affect this variable (19,21,22).

The results obtained in this and other studies are consistent with the fact that the first follicular wave emerges on day one of the estrous cycle

DISCUSIÓN La duración del ciclo estral en el presente estudio, no presentó diferencias significativas al comparar BM de BN ni al comparar el número de ondas de crecimiento folicular. Resultados similares han sido obtenidos por otros autores como Presicce et al (16). Ellos trabajaron con BM y BN de la raza mediterránea y encontraron que para animales con dos ondas de crecimiento folicular, la duración del ciclo estral variaba entre 20 y 26 días. Sin embargo, ellos encontraron una mayor proporción de animales con una sola onda de crecimiento folicular, quienes tenían una menor duración del ciclo (8 a 12 días). También Baruselli et al (20), trabajando con animales de la raza Murrah encontraron 3.33, 66.66 y 33.33% de animales con una, dos y tres ondas respectivamente. En ese estudio, la duración del ciclo estral de los animales de una onda fue de 13 días. Awasthi et al (17) encontraron una alta proporción de animales con una onda (62.5%) en los que el ciclo estral duró 20.8±0.58 días. Es posible que la ausencia de diferencias significativas en cuanto a la duración del ciclo estral en el presente estudio, se deba a la baja proporción de animales con una sola onda (n=1) y a que la duración de su ciclo fue de 18 días. Aun no se ha determinado con exactitud las variables que influyen en el número de ondas durante el ciclo estral; sin embargo, se ha propuesto que la raza, el estado fisiológico y nutricional, condiciones medioambientales, entre otras, puedan afectar esta variable (19,21,22).

Los resultados obtenidos en este y los demás estudios analizados, concuerdan en que la primera onda folicular emerge en el día uno del ciclo estral (17,23). En cuanto a la emergencia de la segunda onda, se presentó a los 11±2.00 días para BM y 10.5±2.82 días para BN. Estos datos son similares a los encontrados por otros autores quienes han determinado la emergencia de la segunda onda alrededor del día 10 para animales de dos ondas y alrededor del día 8 para animales de tres ondas (20,23,24). El presente estudio evidenció que el número de folículos reclutados en la primera onda fue de 8.33±2.06 y 10±2.72 y

Ojeda - Follicular dynamics, corpus luteum growth and regression in buffalo (17.23). As to the emergence of the second wave, it occurred at 11±2.00 days for BM and 10.5±2.82 days for BN. These data are similar to those found by other authors who have determined the emergence of the second wave around the day 10 for animals with two waves and around day 8 for animals with three waves (20,23,24). This study evidenced that the number of follicles recruited in the first wave was 8.33±2.06 and 10±2.72 and in the second wave 8.37±2.26 and 8±1.51, for BM and BN respectively, while for the third wave 6.5±0.7 follicles were recruited, which showed no statistical differences when making a comparison between groups or waves. Similar results were found by Baruselli et al (20), who, working with Murrah BM, concluded that the number of follicles recruited in the first wave was 7.72±4.64 and 7.50±2.75 for animals with estrous cycles of two and three waves respectively, where there are no significant differences.

These results contrast with the experiment carried out in Egypt by Barkawi et al (23), who found a significant difference (p>0.05) in the number of follicles recruited in the first wave when comparing animals with two (6.3±0.3) and three waves (7.8±0.4). All the previous results contrast when compared with the number of follicles recruited in a wave of follicular growth in cows, where it has been estimated that: “the emergence of the follicular wave is characterized by the sudden growth of 8-41 small follicles” (25). It is likely that the marked difference between these species is a consequence of the lower number of primordial follicles of buffalo females with respect to bovine females (7,9,10).

The results obtained for the deviation of the dominant follicle showed that it occurs approximately four days after the emergence of the wave and when it has a diameter of 8-10 mm. Again, no differences were found when comparing between groups or waves.

Sartori et al (26), working with Holstein cows, determined that the dominant follicle deviated when it reached 9.80±0.30 mm in lactating cows and 8.30±0.20 mm in heifers. In another study, Sartori et al (27) found that the diameter at which the dominant follicle deviate was 9.10±0.40 mm in Holstein cows. Working with BN, Gimenes et al (28) found that the dominant follicle is diverted when it reached 7.20±0.20 mm. This result is lower than that found in this study and could be explained by the method used to determine follicular deviation in both cases. In the present study, it was determined that follicular deviation was the moment when the diameter of the largest follicle was at least two standard deviations above the average of

4137

en la segunda onda de 8.37±2.26 y 8±1.51, para BM y BN respectivamente, mientras que para la tercera onda se reclutaron 6.5±0.7 folículos, donde no existieron diferencias estadísticas al hacer la comparación entre grupos ni entre ondas. Similares resultados fueron encontrados por Baruselli et al (20), quienes trabajando con BM de la raza Murrah concluyeron que el número de folículos reclutados en la primera onda fue de 7.72±4.64 y 7.50±2.75 para animales con ciclos estrales de dos y tres ondas respectivamente, donde no existen diferencias significativas.

Estos resultados contrastan con el experimento realizado en Egipto por Barkawi et al (23), quienes encontraron una diferencia significativa (p>0.05) en el número de folículos reclutados en la primera onda al comparar animales de dos (6.3±0.3) y tres ondas (7.8±0.4). Todos los resultados anteriores contrastan al comparase con el número de folículos que se recluta en una onda de crecimiento folicular en vacas, en las que se ha estimado que: “la emergencia de la onda folicular se caracteriza por el súbito crecimiento de 8 - 41 folículos pequeños” (25). Es probable que la marcada diferencia entre estas especies sea consecuencia del menor número de folículos primordiales con los que cuentan las hembras bufalinas con respecto a las bovinas (7,9,10).

Los resultados obtenidos para la desviación del folículo dominante demostraron que esta ocurre aproximadamente cuatro días luego de la emergencia de la onda y cuando este tiene un diámetro de 8–10 mm. Nuevamente no se encontraron diferencias al comparar entre grupos ni entre ondas. Sartori et al (26) trabajando con bovinos de la raza Holstein, determinaron que el folículo dominante se desvió cuando tenía 9.80±0.30 mm en vacas lactantes y 8.30±0.20 mm en novillas. En otro estudio, Sartori et al (27) encontraron que el diámetro en el cual el folículo dominante se desviaba en 9.10±0.40 mm en vacas Holstein. Trabajando con BN, Gimenes et al (28) encontraron que el folículo dominante se desviaba cuando alcanzaba 7.20±0.20mm.

Este resultado, es inferior al encontrado en el presente estudio y podría explicarse por el método utilizado para determinar la desviación folicular en ambos casos. En el presente estudio, se determinó que la desviación folicular era el momento en el que el diámetro del folículo mayor era de al menos dos desviaciones estándar por encima de la media de los folículos de su cohorte (18), mientras que, Gimenes et al (28) definieron el inicio de la desviación como “el fin de la fase de crecimiento común, cuando se detectaron diferencias entre los diámetros de los dos folículos mayores”.

4138

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

the follicles of its cohort (18), while, Gimenes et al (28) defined the beginning of the deviation as “the end of the common growth phase, when differences between the diameters of the two largest follicles were detected.”

Gimenes et al (28,29) conducted experiments to characterize follicular deviation in bovine heifers and BN, respectively. They determined that the deviation in heifers occurs between 1.5 - 4 days after ovulation, when the follicle has a size of 5 to 7 mm (29), while in BN it was determined that the deviation occurred 2.6±0.2 days postovulation at a size of 7.2±0.2 (28).

The maximum diameter reached by the preovulatory follicle in the animals under study was 17±4.6 and 14±2.9 mm for BM and BN. Other studies report similar diameters when working with buffaloes and larger when working with cows. Baruselli et al (20) found that the preovulatory diameter of BM was 1.57, 1.55±0.16 and 1.34±0.13 cm for animals with one, two or three waves of follicular growth, respectively. Similarly, Awasthi et al (17) working with Mehsana buffaloes, found that the maximum diameter of the preovulatory follicle was 12.94±0.59 and 16.03±3.30 for animals with one or two waves. However, in a study comparing the pattern of follicular growth between Mediterranean BM and BN carried out in Italy by Presicce et al (16), significant differences were found (p>0.05) between the maximum diameter of the ovulatory follicle with 13.8±0.6 and 11.0±0.7. It is likely that the marked differences in the conditions under which the experiment of Presicce et al (16) was carried out and this study, are responsible for this discrepancy between results.

When assessing the characteristics of the CL, it was determined that the maximum diameter was 19.58±4.16 mm for BM and 17.74±3.32 mm for BN. Despite the apparent numerical difference in these results, no significant differences were found. In the study of Barkawi et al (23), the maximum diameter for the CL was found to be 15.00±0.40 for BN in Egypt, while Di Francesco et al (30) working with Mediterranean buffaloes during the mating season, found that the CL at day 10 post insemination reached 18.6±0.9 mm and 20.2±0.6 mm in empty and pregnant buffaloes, respectively. They found no statistical differences when comparing the growth pattern of the CL in animals in the reproductive season and in the transition period to the next stadium. However, differences were evidenced in the synthesis of P4, where animals in the reproductive season showed higher concentrations of this hormone. In this study the regression of the CL was found from day 15.22±5.26 for the BM group and 17.62±1.68 for the BN group, data consistent with those previously

Gimenes et al (28,29) realizaron experimentos para caracterizar la desviación folicular en novillas bovinas y BN, respectivamente. Ellos determinaron que la desviación en novillas ocurre entre 1.5 – 4 días post ovulación, cuando el folículo tiene un tamaño de 5 a 7 mm (29), mientras que en BN la desviación se determinó que sucedía 2.6±0.2 días post-ovulación a un tamaño de 7.2±0.2 (28).

El diámetro máximo alcanzado por el folículo preovulatorio en los animales estudiados fue de 17±4.6 y 14±2.9 mm para BM y BN. Otros estudios reportan diámetros similares al trabajar con búfalas y mayores al trabajar con vacas.

Baruselli et al (20) encontraron que el diámetro preovulatorio de BM fue de 1.57, 1.55±0.16 y 1.34±0.13 cm para animales con una, dos y tres ondas de crecimiento folicular respectivamente.

También, Awasthi et al (17) trabajando con búfalas de la raza Mehsana, encontraron que el diámetro máximo del folículo preovulatorio fue de 12.94±0.59 y 16.03±3.30 para animales de una y dos ondas. Sin embargo, en un estudio donde también se compara el patrón de crecimiento folicular entre BM y BN de la raza Mediterránea realizado en Italia por Presicce et al (16) se encontraron diferencias significativas (p > 0.05) entre el diámetro máximo del folículo ovulatorio con 13.8±0.6 y 11.0±0.7. Es probable que, las marcadas diferencias en las condiciones en que se realizó el experimento de Presicce et al (16) y el presente estudio, sean responsables por esta discrepancia entre los resultados.

Al evaluar las características del CL se determinó que el diámetro máximo fue de 19.58±4.16 mm en BM y 17.74±3.32 mm en BN. A pesar de la aparente diferencia numérica en estos resultados, no se encontraron diferencias significativas. En el estudio de Barkawi et al (23) se encontró un diámetro máximo del CL de 15.00±0.40 en BN en Egipto, mientras que, Di Francesco et al (30) trabajando con búfalas de la raza mediterránea durante la estación de apareamientos, encontraron que el CL al día 10 post inseminación alcanzaba 18.6±0.9 mm y 20.2±0.6 mm en búfalas vacías y preñadas respectivamente. Ellos no encontraron diferencias estadísticas al comparar el patrón de crecimiento del CL en animales en la estación reproductiva y en el período de transición hacia la estación siguiente. Sin embargo, sí lograron evidenciar diferencias en la síntesis de P4, donde los animales en la temporada reproductiva mostraron mayores concentraciones de esta hormona. En el presente estudio, la regresión del CL se encontró a partir del día 15.22±5.26 para el grupo BM y en 17.62±1.68 para el grupo BN, datos que concuerdan con lo previamente

Ojeda - Follicular dynamics, corpus luteum growth and regression in buffalo reported by other authors. Satheshkumar et al (31) found that in Murrah BM the luteal regression began on day 16.20±50.76; while Barkawi et al (23) determined that the half-life of the CL was 17.1±0.8 days in buffaloes with normal estrous cycles, while in females with follicular cysts and persistent CL, this half-life increased to 24.80±4.30 and 28.30±6.10 days, respectively. In conclusion, the follicular dynamics and growth pattern and regression of the CL in BM and BN under Colombian tropical conditions are similar to what has been previously reported by other authors. However, it is necessary to conduct new studies with a larger number of animals involved.

Acknowledgements To the Centro Internacional de Formación Agropecuaria (CIFA) and its entire staff for their invaluable cooperation in the preparation of this study.

4139

reportado por otros autores. Satheshkumar et al (31) encontraron que en BM de la raza Murrah la regresión luteal iniciaba el día 16.20±50.76; mientras que, Barkawi et al (23), determinaron que la vida media del CL era de 17.1±0.8 días en búfalas con ciclos estrales normales, mientras que en hembras con presencia de quistes foliculares y CL persistentes, esta vida media incrementaba a 24.80±4.30 y 28.30±6.10 días respectivamente. En conclusión, la dinámica folicular y el patrón de crecimiento y regresión del CL de BM y BN ubicadas en condiciones de trópico bajo colombiano son similares a lo que ha sido previamente reportado por otros autores. Sin embargo, es necesario realizar nuevos estudios donde se aumente el número de animales involucrados.

Agradecimientos A l C e n t r o I n t e r n a c i o n a l d e Fo r m a c i ó n Agropecuaria (CIFA) y la de todo su personal, por su invaluable colaboración en la elaboración de este estudio.

REFERENCES 1.

Cervantes E, Espitia A, Prieto E. Viabilidad de los sistemas bufalinos en colombia. Rev Colombiana Cienc Anim 2010. 2(1):215-24.

2.

De Rensis F, Lopez-Gatius F. Protocols for synchronizing estrus and ovulation in buffalo (Bubalus bubalis): A review. Theriogenology 2007; 67(2):209-16.

3.

Singh J, Nanda AS, Adams GP. The reproductive pattern and efficiency of female buffaloes. Anim Reprod Sci 2000; 60:593-604.

4.

Almaguer-Pérez Y. El búfalo, una opción de la ganadería. REDVET Revista Electronica Veterinaria. 2007; 8(8):1-23.

5.

Angulo RR, LF. Berdugo, JA. Características de calidad de las canales bufalinas y vacunas comercializadas en Medellín, Colombia. [en linea]. Livestock Research for Rural Development 2005; 17(9): Artículo 103. URL Disponible en: http://www.lrrd.org/lrrd17/9/angu17103.htm

6.

Drost M. Bubaline versus bovine reproduction.

Theriogenology 2007; 68(3):447-9.

7.

Mondadori RG, Luque MCA, Santin TR, Bao SN. Ultrastructural and morphometric characterization of buffalo (Bubalus bubalis) ovarian preantral follicles. Anim Reprod Sci 2007; 97(3-4):323-33.

8.

Perera B. Reproductive cycles of buffalo. Anim Reprod Sci 2011; 124(3-4):194-9.

9.

Mondadori RG, Santin TR, Fidelis AAG, Porfirio EP, Bao SN. Buffalo (Bubalus bubalis) Pre-antral follicle population and ultrastructural characterization of antral follicle oocyte. Reprod Domest Anim 2010; 45(1):33-7.

10. Kumar A, Solanki VS, Jindal SK, Tripathi VN, Jain GC. Oocyte retrieval and histological studies of follicular population in buffalo ovaries. Anim Reprod Sci 1997; 47(3):189-95.

11. Perera B. A review of experiences with oestrous synchronization in buffaloes in Sri Lanka. Buffalo J1987. p. 105-14.

12. Usmani RH, Dailey RA, Inskeep EK. Effects of limited suckling and varying prepartum nutrition on postpartum reproductive traits of milked buffalos. J Dairy Sci 1990;73(6):1564-70.

4140

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

13. Azawi OI, Ali AJ, Lazim EH. Pathological and anatomical abnormalities affecting buffalo cows reproductive tracts in Mosul. Iraqi J Vet Sci 2008; 22(2): 59-67.

14. Campanile G, Baruselli PS, Neglia G, Vecchio D, Gasparrini B, Gimenes LU, et al. Ovarian function in the buffalo and implications for embryo development and assisted reproduction. Anim Reprod Sci 2010; 121(1-2):1-11.

15. Neglia G, Natale A, Esposito G, Salzillo F, Adinolfi L, Zicarelli L, et al. Follicular dynamics in synchronized Italian Mediterranean buffalo cows. Italian Ital J Anim Sci 2007;6:611-4.

16. Presicce GA, Senatore EM, Bella A, De Santis G, Barile VL, De Mauro GJ, et al. Ovarian follicular dynamics and hormonal profiles in heifer and mixed-parity Mediterranean Italian buffaloes (Bubalus bubalis) following an estrus synchronization protocol. Theriogenology 2004; 61(7-8):1343-55.

17. Awasthi MK, Khare A, Kavani FS, Siddiquee GM, Panchal MT, Shah RR. Is one-wave follicular growth during the estrous cycle a usual phenomenon in water buffaloes (Bubalus bubalis)? Anim Reprod Sci 2006; 92(3-4):24153.

18. Taylor C, Rajamahendran R. Follicular dynamics, corpus-luteum growth and regression in lactating dairy-cattle. Canadian Ital J Anim Sci 1991;71(1):61-8.

19. Ginther OJ, Kastelic JP, Knopf L. Composition and characteristics of follicular waves during the bovine ESTROUS-CYCLE. Anim Reprod Sci 1989; 20(3):187-200.

20. Baruselli PS, Mucciolo RG, Visintin JA, Viana WG, Arruda RP, Madureira EH, et al. Ovarian follicular dynamics during the estrous cycle in buffalo (Bubalus bubalis). Theriogenology 1997; 47(8):1531-47.

21. Lucy MC, Savio JD, Badinga L, Delasota RL, Thatcher WW. Factors that affect ovarian follicular dynamics in cattle. Ital J Anim Sci 1992;70(11):3615-26.

22. Celik HA, Aydin I, Sendag S, Dinc DA. Number of follicular waves and their effect on pregnancy rate in the cow. Reprod Domest Anim 2005; 40(2):87-92.

23. Barkawi AH, Hafez YM, Ibrahim SA, Ashour G, El-Asheeri AK, Ghanem N. Characteristics of ovarian follicular dynamics throughout the estrous cycle of Egyptian buffaloes. Anim Reprod Sci 2009; 110(3-4):326-34.

24. Manik RS, Palta P, Singla SK, Sharma V. Folliculogenesis in buffalo (Bubalus bubalis): a review. Reprod Fertil Dev 2002;14(5):315-25.

25. Adams GP, Jaiswal R, Singh J, Malhi P. Progress in understanding ovarian follicular dynamics in cattle. Theriogenology 2008; 69(1):72-80.

26. Sartori R, Haughian JM, Shaver RD, Rosa GJM, Wiltbank MC. Comparison of ovarian function and circulating steroids in estrous cycles of Holstein heifers and lactating cows. J Dairy Sci 2004; 87(4):905-20.

27. Sartori R, Fricke PM, Ferreira JCP, Ginther OJ, Wiltbank MC. Follicular deviation and acquisition of ovulatory capacity in bovine follicles. Biol Reprod 2001; 65(5):1403-9.

28. Gimenes LU, Carvalho NAT, Sa Filho MF, Vannucci FS, Torres-Junior JRS, Ayres H, et al.

Ultrasonographic and endocrine aspects of follicle deviation, and acquisition of ovulatory capacity in buffalo (Bubalus bubalis) heifers. Anim Reprod Sci 2011; 123(3-4):175-9.

29. Gimenes LU, Sa MF, Carvalho NAT, Torres JRS, Souza AH, Madureira EH, et al. Follicle deviation and ovulatory capacity in Bos indicus heifers.

Theriogenology 2008; 69(7):852-8.

30. Di Francesco S, Neglia G, Vecchio D, Rossi P, Russo M, Zicarelli L, et al. Influence of season on corpus luteum structure and function and AI outcome in the Italian Mediterranean buffalo (Bubalus bubalis). Theriogenology 2012; 78(8):1839-45.

31. Satheshkumar S, Palanisamy A, Rangasamy S, Kathiresan D, Kumanan K. Comparative analysis of follicular and luteal dynamics in oestrous cycles of buffaloes and crossbred cattle. Buffalo Bulletin 2011; 30(2):148-56.

Rev.MVZ Córdoba 19(2):4141-4149, 2014. ISSN: 0122-0268 ORIGINAL

Removal of lead, mercury and nickel using the yeast Saccharomyces cerevisiae Remoción de plomo, mercurio y níquel utilizando la levadura Saccharomyces cerevisiae Cherlys Infante J,1* M.Sc, Deniles De Arco R,1 M.Sc, Edgardo Angulo M,2 M.Sc. Universidad de Cartagena, Faculty of Pharmaceutical Sciences, Pharmaceutical Chemistry Programme.

Av del Consulado, Calle 30 Nro. 48-152 Cartagena, Colombia. 2Universidad del Atlantico, Faculty of Basic Sciences, Chemistry Programme. Dirección Km 7 Antigua vía Puerto Colombia, Barranquilla, Atlantico. *Correspondence: cinfantej@unicartagena.edu.co 1

Received: June 2013; Accepted: December 2013.

ABSTRACT Objective. In this study the biomass of the yeast Saccharomyces cerevisiae was used to remove lead, mercury and nickel in the form of ions dissolved in water. Materials and methods. Synthetic solutions were prepared containing the three heavy metals, which were put in contact with viable microorganisms at different conditions of pH, temperature, aeration and agitation. Results. Both individual variables and the interaction effects influenced the biosorption process. Throughout the experimental framework it was observed that the biomass of Saccharomyces cerevisiae removed a higher percentage of lead (86.4%) as compared to mercury and nickel (69.7 and 47.8% respectively).

When the pH was set at a value of 5 the effect was positive for all three metals. Conclusions. pH was the variable that had a greater influence on the biosorption of lead on the biomass of Saccharomyces cerevisiae. The affinity of the heavy metals for the biomass followed the order Pb>Hg>Ni. Key words: Bioremediation, heavy metals, biomass, contaminant removal, bioaccumulation (Source: DECS).

RESUMEN Objetivo. En este estudio se utilizó la biomasa de la levadura Saccharomyces cerevisiae para retener plomo, mercurio y níquel en forma de iones disueltos en agua. Materiales y métodos. Se prepararon soluciones sintéticas que contenían los tres metales pesados, las cuales se pusieron en contacto con el microorganismo en forma viable a diferentes condiciones de pH, temperatura, aireación y agitación.

Resultados. Tanto las variables individuales como los efectos de interacción influyeron sobre el proceso de biosorción. A través de todos los experimentos, se observó que la biomasa de Saccharomyces cerevisiae eliminó un mayor porcentaje de plomo (86.4%) en comparación al mercurio y al níquel (69.7 y 47.8% respectivamente). Cuando el pH se fijó en valor de 5, el efecto fue positivo para los tres metales. Conclusiones. El pH fue la variable que tuvo una mayor influencia en la biosorción de plomo sobre la biomasa de Saccharomyces cerevisiae. La afinidad de los metales pesados por la biomasa siguió el orden Pb>Hg>Ni. Palabras clave: Biorremediación, metales pesados, biomasa, remoción de contaminantes, bioacumulación (Fuente: DECS).

4141

4142

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

INTRODUCTION

INTRODUCCIÓN

Low concentrations of heavy metals can be highly toxic to microorganisms, whereas high concentrations can be tolerated if they are provided with enough sulfur. The toxicity of metals such as lead is well known; however, for others such as copper, zinc and nickel, their effects and permissible limits in surface waters are still under discussion (1).

Las bajas concentraciones de metales pesados pueden ser altamente tóxicas para los microorganismos, mientras que altas concentraciones pueden ser toleradas si se provee suficiente sulfuro. Es bien conocida la toxicidad de metales como el plomo; sin embargo, para otros como el cobre, zinc y níquel, aún se discuten sus efectos y sus límites permisibles en aguas superficiales (1).

Uptake mechanisms range from physical adsorption, ion exchange with the functional groups of the cell wall of the microorganism or they may penetrate into the cytoplasm and accumulate in the form of granules or intracellular inclusions (2).

Los mecanismos de captación van desde adsorción física, intercambio iónico con los grupos funcionales de la pared celular del microorganismo o bien pueden penetrar al citoplasma y acumularse en forma de gránulos o inclusiones intracelulares (2).

Various microorganisms have been used for bioremediation purposes, such as bacteria, yeasts, fungi and microalgae; biosorbents based on macroalgae in non-viable state have also been prepared and have been effective in the removal of heavy metals from industrial effluents at concentrations ranging from 1 to 100 mg/L (2).

Growing cells may show a greater capacity for the removal of metals than non-viable biomass, especially in environments with enough nutrients (3) Sources of pollution may be natural such as the erosion and weathering of rocks; or anthropogenic erosion, manufacturing pigments, batteries, biocides, processing of ores and metals, industrial effluent from electroplating plants, effluents from tanneries and sanitary landfills (4).

Saccharomyces cerevisiae possesses phosphate, amino, carboxyl and hydroxyl groups in its cell wall, which are responsible for the removal of heavy metals (5).

The advantages of the use of Saccharomyces cerevisiae include the global boom in bioethanol production, which ensures the availability of a steady supply of residual biomass that could be used in the bioremediation of industrial effluents (6). Moreover, this yeast is considered as safe, which favors its use in practical applications that will thereafter be easily accepted by the population. S. cerevisiae has also been immobilized for recovering precious metals such as platinum (7), being considered as a cheap and plentiful source of biomass, making its application feasible in the

Se han utilizado diversos microorganismos con fines de biorremediación, como bacterias, levaduras, hongos y microalgas; también se han preparado biosorbentes a base de macroalgas en estado no viable que han sido efectivas en la remoción de metales pesados de efluentes industriales en concentraciones que van desde 1 a 100 mg/L (2).

Las células en crecimiento pueden mostrar una mayor capacidad de remoción de metales que la biomasa no viable, especialmente en ambientes con suficientes nutrientes (3) Las fuentes de contaminación pueden ser naturales como la erosión y meteorización de rocas; o antrópicas como la erosión, fabricación de pigmentos, baterías, biocidas, procesamiento de menas y metales, efluentes de industrias de galvanoplastia, efluentes de curtiembres y de rellenos sanitarios (4).

Saccharomyces cerevisiae posee grupos fosfato, amino, carboxilo e hidroxilo en su pared celular, los cuales son responsables de la remoción de metales pesados (5).

Entre las ventajas del uso de Saccharomyces cerevisiae está el auge mundial en la producción de bioetanol, con lo cual se garantiza la disponibilidad de un suministro estable de biomasa residual que podría ser utilizada en la bioremediación de efluentes industriales (6). Además, esta levadura es considerada como segura, lo que favorece su uso en aplicaciones prácticas que luego serán fácilmente aceptadas por la población. S. cerevisiae también ha sido inmovilizada para recuperar metales preciosos como el platino (7), siendo considerada como una fuente barata y abundante de biomasa, lo que hace factible su aplicación en la descontaminación de efluentes de la industria minera.

Infante - Removal of lead, mercury and nickel decontamination of effluents from the mining industry.

The brewing industry is another important source of low-cost yeast with flocculating properties, which facilitates the mechanical separation at the end of the biosorption process (8).

On the other hand, environmental conditions such as aeration, agitation, temperature and pH influence cell growth and an effect on the uptake of heavy metals associated with both the microorganism and the fluid dynamics of the medium could therefore be expected.

The adsorption of heavy metals in the biomass of S. cerevisiae has been reported in numerous studies (6-11).

Based on the above, experiments were carried out in order to determine the influence of the variables pH, temperature, agitation and aeration on the biosorption of lead, mercury and nickel in the biomass of S. cerevisiae.

MATERIALS AND METHODS Microorganism. Commercial dry active baker’s yeast was used, which was kept in refrigeration at 4°C. Culture medium. A culture medium containing 20 g/L of glucose, 20 g/L of peptone and 10 g/L of yeast extract was prepared for the cultures per lot of S. cerevisiae.

This medium was dosed with lead nitrate, nickel chloride and mercuric chloride solutions to obtain a concentration of 100 μM in each of the heavy metals, using a workload of 100 mL in each experiment.

Biosorption. Biosorption tests were carried out according to a 24 factorial design in which the levels of each factor were identified according to the coding (Table 1).

The tests were conducted by inoculating the medium with 0.2 g of dry yeast and incubated Table 1. Levels of variables.

Variables

High level

Low level

A= pH

5

3.5

B= Temperature

30ºC

25ºC

C= Agitation

150 rpm

100 rpm

D= Aeration

4 vvm

1 vvm

4143

La industria cervecera es otra fuente importante de levadura de bajo costo con propiedades floculantes, lo cual facilita la separación mecánica al final del proceso de biosorción (8).

Por otro lado, las condiciones ambientales como la aireación, agitación, la temperatura y el pH influyen sobre el crecimiento celular y podría esperarse por tanto un efecto sobre la captación de metales pesados asociado tanto al microorganismo como a la fluidodinámica del medio.

La adsorción de metales pesados en la biomasa de S. cerevisiae ha sido reportada en numerosos estudios (6-11).

Con base en lo anterior se realizaron experiencias con el fin de determinar la influencia de las variables pH, temperatura, agitación y aireación sobre la biosorción de Plomo, Mercurio y Níquel en la biomasa de S. cerevisiae.

MATERIALES Y MÉTODOS Microorganismo. Se utilizó levadura de panadería seca activa comercial, la cual fue mantenida en refrigeración a 4ºC. Medio de cultivo. Se preparó un medio de cultivo que contenía 20 g/L de glucosa, 20 g/L de peptona y 10 g/L de extracto de levadura para los cultivos por lote de S. cerevisiae.

Este medio se dosificó con soluciones de nitrato de plomo, cloruro de níquel y cloruro de mercurio para obtener una concentración de 100 μM en cada uno de los metales pesados, utilizando un volumen de trabajo de 100 mL en cada experiencia.

Biosorción. Los ensayos de biosorción se realizaron de acuerdo a un diseño con arreglo factorial 24 en el cual los niveles de cada factor fueron identificadas según codificación (Tabla 1).

Los ensayos se realizaron inoculando el medio con 0.2 g de levadura seca e incubando por 24 horas, para luego separar las fases mediante filtración con papel de 0.45 μm.

Determinación de metales pesados. El método de espectroscopia de absorción atómica, fue el seleccionado para analizar los metales pesados, utilizando el espectrofotómetro UNICAM 969. Todas las muestras fueron analizadas por triplicado.

4144

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

for 24 hours, to then separate the phases by filtration with a 0.45 μm paper.

Determination of heavy metals. T he atomic absorption spectroscopy method was selected to analyze the heavy metals, using the spectrophotometer UNICAM 969. All samples were analyzed in triplicate.

The lead and nickel were determined using the flame atomization technique, while the cold vapor technique was used for analyzing mercury, on the basis of the standardized methods compiled in the APHA in section 3112B (12).

Experiment design. A complete 24 factorial design was used. The experiments planned through the combination of the variables under study were performed randomly and in duplicate.

The removal percentages for each metal were reported as the mean of the experiments ± the standard deviation of the mean effect, calculated from the effects of third and fourth order interactions.

The software SPSS Statistics version 17.0 was used for the calculation of the effects. The effects calculated were compared with a reference distribution (F test) at a confidence level of 95%.

RESULTS The biomass of S. cerevisiae adsorbed the metals under study in different proportions (Table 2), showing greater affinity for lead and lower affinity for nickel.

Table 2. Removal percentages of Pb, Hg and Ni by S. cerevisiae.

Treatment

La determinación de plomo y níquel se realizó utilizando la técnica de atomización con llama, mientras que para analizar el mercurio, se utilizó la técnica de vapor frio, tomando como base los métodos normalizados recopilados en el APHA en la sección 3112B (12).

Diseño experimental. Se utilizó un diseño con arreglo factorial completo 24. Los experimentos planeados mediante la combinación de las variables bajo estudio fueron realizados en orden aleatorio y por duplicado.

Los porcentajes de remoción para cada metal se reportaron como la media de los experimentos ± la desviación estándar del efecto medio, calculada a partir de los efectos de las interacciones de tercer y cuarto orden.

Para el cálculo de los efectos se utilizó el software SPSS Statistics versión 17.0. Los efectos calculados fueron comparados con una distribución de referencia (prueba F) a un nivel de confianza de 95%.

RESULTADOS La biomasa de S. cerevisiae adsorbió los metales bajo estudio en distintas proporciones (Tabla 2), mostrando una mayor afinidad por el plomo y una menor afinidad por el níquel.

El promedio de eliminación para el plomo fue 86.4±3.8%, para el mercurio 69.7±3.66% y para el níquel 47.8±2.67%. La capacidad media de biosorción para el plomo fue 8.9 mg/g de levadura seca. El único metal para el cual se obtuvo un 100% de eliminación fue el plomo, particularmente en los experimentos a pH 5, exceptuando el ensayo donde la agitación y el pH estuvieron en el nivel alto.

Pb % removed Hg % removed Ni % removed

I

73.7

50.8

35.3

A

100

61.5

41.4

B

48.4

91.3

72.4

Ab

100

85.3

68.9

C

93.7

58.9

38.8

Ac

66.4

74.0

58.2

Bc

71.2

51.8

31.0

Abc

100

85.8

57.9

D

76.7

52.9

29.5

Ad

100

56.0

38.0

Bd

83.8

74.3

48.2

Abd

100

75.8

65.5

Cd

77.6

91.3

58.6

Acd

100

74.6

46.2

Bcd

91.8

54.7

33.4

Abcd

100

75.8

41.5

La biomasa de S. cerevisiae presentó una capacidad media para el mercurio de 10.25 mg/g.

La capacidad de adsorción para el níquel fue 2.8 mg /g de levadura seca.

Se observó una influencia significativa de las variables para cada metal, representada por efectos simples e interacciones de segundo y tercer orden (Tabla 3). Los efectos calculados corresponden a los coeficientes del modelo lineal, los cuales se consideraron significativos cuando el valor de probabilidad fue menor de 0.05 (p≤0.05).

Análisis de los efectos sobre la biosorción del plomo. De los seis efectos significativos para este metal, el pH fue la variable que tuvo

4145

The biomass of S. cerevisiae showed an average capacity for mercury of 10.25 mg/g.

The adsorption capacity for nickel was 2.8 mg/g of dry yeast.

A significant influence was observed in the variables for each metal, represented by simple effects and second and third order interactions (Table 3). The effects calculated correspond to the coefficients of the linear model, which were considered significant when the likelihood value was less than 0.05 (p≤0.05).

Table 3. Effects of the variables on the biosorption of lead, mercury and nickel.

Treatment

Pb

Hg

Ni

I

86.4

69.7

47.8

A

18.7

7.8

8.8

B

0.9

9.3

9.1

Ab

7.5

4.8

3.4

C

2.2

2.4

-4.2

Ac

-10.6

5.5

1.7

Bc

5.4

-17

-18.6

Abc

2.9

9.4

3.6

D

9.6

-0.5

-5.4

Ad

-1.1

-5.6

-3.4

Bd

4.4

-7.9

-5.0

Abd

-12.8

4.2

3.9

Cd

-0.025

7.0

3.8

Acd

8.4

-5.6

-9.2

Bcd

-3.6

-2.1

-0.4

Abcd

-4.7

0.5

-0.6

Analysis of the effects on the biosorption of lead. Of the six significant effects for this metal, the pH was the variable that had the greatest influence on the uptake of lead by the biomass (Figure 1).

The second most significant and favorable effect for the retention of lead was aeration, this result indicates that the viable state and oxidative metabolism of yeast influence positively on the uptake of this metal. The interaction between pH and agitation had a negative effect on biosorption.

In terms of third-order interactions, a favorable effect was observed for the interaction

Treatments

Figure 1. Comparison of the significant effects on the biosorption of lead.

más influencia en la captación de plomo por la biomasa (Figura 1).

El segundo efecto más significativo y favorable para la retención del plomo fue la aireación, este resultado indica que el estado viable y el metabolismo oxidativo de la levadura influyen de manera positiva en la captación de este metal. La interacción entre el pH y la agitación tuvo efecto negativo sobre la biosorción.

En cuanto a las interacciones de tercer orden, se presentó un efecto favorable para la interacción entre el pH, la agitación y la aireación, lo que indica que si el proceso de biosorción es agitado mecánicamente a pH 5, también deberá airearse con el fin de generar esta interacción positiva; mientras que la interacción entre el pH, la temperatura y la aireación fue negativa, estableciendo a la temperatura como una variable crítica en este proceso.

Análisis de los efectos sobre la biosorción del mercurio. Como se observa en la figura 2, la mayoría de los efectos resultaron significativos para la biosorción de mercurio: la temperatura, el pH, todas las interacciones de segundo orden excepto la que ocurrió entre el pH y la temperatura; así como las interacciones de tercer orden entre pH, temperatura y agitación y entre pH, agitación y aireación.

Effects

For average removed for lead was 86.4±3.8, for mercury 69.7±3.66 and for nickel 47.8±2.67.

The average biosorption capacity for lead was 8.9 mg/g of dry yeast. The only metal for which a removal of 100% was obtained was lead, particularly in experiments with a pH of 5, except the trial where the agitation and pH were at a high level.

Effects

Infante - Removal of lead, mercury and nickel

Treatments

Figure 2. Comparison of the significant effects on the biosorption of Mercury.

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

between pH, agitation and aeration, which indicates that if the biosorption process is mechanically agitated at a pH of 5, it also must be aerated in order to generate this positive interaction; while the interaction between pH, temperature and aeration was negative, setting the temperature as a critical variable in this process.

Analysis of the effects on the biosorption of mercury. As shown in Figure 2, most of the effects were significant for mercury biosorption: temperature, pH, all second-order interactions except for that between pH and temperature; as well as third-order interactions between pH, temperature and agitation and between pH, agitation and aeration.

In addition, a greater number of positive rather than negative effects was noted. The temperature and pH had positive effects as well as the interactions between pH and agitation as well as between agitation and aeration.

The interactions between temperature and agitation; temperature and aeration; as well as pH and aeration, showed a negative effect, the first being the stronger, indicating that the desorption of mercury is favored under these conditions.

The third-order interaction between pH, temperature and agitation was positive and had a strong effect comparable to the effects of pH and temperature separately on the uptake of mercury; while the interaction between pH, agitation and aeration had negative effect.

Analysis of the effects on the biosorption of nickel. Figure 3 shows that the biosorption of nickel displayed the highest number of negative effects, which is consistent with the lower removal percentage observed in this study.

All the variables under study influenced on the biosorption of nickel individually, temperature and pH with positive effects and agitation and aeration with negative effects but with a lower weight than the first two.

The most significant effect was the second-order interaction between temperature and agitation; it can be noticed that as in the case of mercury biosorption, it was negative and had a higher magnitude than the rest of the effects.

It is observed that the third-order interactions, which were significant for the biosorption of lead, were also significant in the case of nickel, but with the opposite sign.

Además, se observó un mayor número de efectos positivos que negativos. La temperatura y el pH tuvieron efectos positivos al igual que las interacciones entre el pH y la agitación así como entre la agitación y la aireación.

Las interacciones entre la temperatura y la agitación; temperatura y aireación; así como pH y aireación, tuvieron un efecto negativo, siendo la primera la más fuerte, indicando que bajo estas condiciones se favorece la desorción del mercurio.

La interacción de tercer orden entre el pH, la temperatura y la agitación fue positiva y tuvo un efecto fuerte comparable a los efectos del pH y de la temperatura por separado sobre la captación de mercurio; mientras que la interacción entre el pH, la agitación y la aireación tuvo efecto negativo.

Análisis de los efectos sobre la biosorción de níquel. La figura 3 muestra que la biosorción de níquel presentó el mayor número de efectos negativos, lo cual es coherente con el menor porcentaje de remoción observado en este estudio.

Todas las variables estudiadas influyeron sobre la biosorción de níquel de forma individual, la temperatura y el pH con efectos positivos y la agitación y la aireación con efectos negativos pero de menor peso que las dos primeras.

El efecto más significativo fue la interacción de segundo orden entre la temperatura y la agitación; puede notarse que al igual que para el caso de la biosorción de mercurio, este fue negativo y de mayor magnitud que el resto de los efectos.

Se observa que las interacciones de tercer orden que fueron significativas para la biosorción de plomo también fueron significativas para el caso del níquel pero con signo contrario.

Effects

4146

Treatments

Figure 3. Comparison of the significant effects on the biosorption of Nickel.

Infante - Removal of lead, mercury and nickel

4147

DISCUSSION

DISCUSIÓN

The higher affinity of biomass for lead was a result in line with what has been reported in other studies (13, 14).

La mayor afinidad de la biomasa por el plomo, fue un resultado coherente con lo reportado en otros estudios (13,14).

At a pH of 5, lead is a positive divalent ion that can interact with the negative functional groups of the cell wall of yeast (13).

Zhang et al (15) found an adsorption capacity of 6.52 Pb/g mg of dry yeast, lower to that obtained in this study (8.9 mg Pb/g of dry yeast).

Skountzou et al (16) reported a capacity of 4 mg Pb/g based on a concentration of 20 mg/L, as that used in this study; in addition, these authors obtained a removal percentage for lead of 71.8%, lower to that obtained in this study.

A pH 5, el plomo es un ión positivo divalente que puede interactuar con los grupos funcionales negativos de la pared celular de la levadura (13).

Zhang et al (15) encontraron una capacidad de adsorción de 6.52 mg Pb/g de levadura seca, menor a la obtenida en este estudio (8.9 mg Pb/g de levadura seca). Skountzou et al (16) reportaron una capacidad de 4 mg Pb/g partiendo de una concentración de 20 mg/L, igual a la utilizada en este estudio; además, estos autores obtuvieron un porcentaje de remoción para plomo de 71.8%, inferior al obtenido en este estudio.

Galedar and Younesi (17) reported a capacity of 1.2 mg Ni/g of dry yeast in experiments with S. cerevisiae immobilized at a pH of 8. Again, this capability was less than that obtained in this study. Another study found a removal rate for nickel of 72% from synthetic solutions, higher than that obtained in this study (18).

Galedar y Younesi (17) reportaron una capacidad de 1.2 mg de Ni/g de levadura seca, en experimentos con S. cerevisiae inmovilizada a pH 8. Nuevamente, esta capacidad fue inferior a la obtenida en este estudio. Otro estudio encontró un porcentaje de remoción de níquel, a partir de soluciones sintéticas, de 72%, superior al obtenido en este estudio (18).

Suazo et al (19) found a direct relationship between the uptake of nickel and pH using S. cerevisiae var ellipsoideus; at a pH of 3.5, the adsorption capacity was 5.74 mg Ni/g of dry yeast for an initial concentration of 1000 µM. In this study, the capacity was approximately half of this value with an initial concentration ten times lower.

Suazo et al (19) encontraron una relación directa entre la captación de níquel y el pH utilizando S. cerevisiae var ellipsoideus; a pH 3.5, la capacidad de adsorción fue 5.74 mg Ni/g de levadura seca para una concentración inicial de 1000 µM. En este estudio, la capacidad fue aproximadamente la mitad de este valor con una concentración inicial diez veces menor.

The repulsion between H+ ions and metal ions at a low pH restricts access to ligands, but as the pH increases, more negatively charged ligands are exposed to capture heavy metals (13).

La repulsión entre los iones H+ y los iones metálicos a pH bajo, restringe el acceso a los ligandos, pero a medida que aumenta el pH, más ligandos con carga negativa quedan expuestos para captar metales pesados (13).

The effect of aeration can be explained taking into account that biosorption is performed with cells in a viable state with an aerobic metabolism, it is expected that a good air supply is reflected in a specific high growth rate and a better use of the nutrients in the culture medium.

The effect of agitation is related to the shear forces generated that could cause the desorption of the metal joined by weak bonds such as electrostatic attraction, hydrogen bonding and Van der Waals forces.

The positive effect of temperature for mercury and nickel can be attributed to an increase in ionic mobility. The relationship between the metal removal capacity and temperature was studied

by Zhang et al (15) finding that the maximum

El efecto de la aireación puede explicarse teniendo en cuenta que la biosorción se realiza con células en estado viable con metabolismo aeróbico, es de esperar que un buen suministro de aire se refleje en una velocidad específica de crecimiento alta y un mejor aprovechamiento de los nutrientes del medio de cultivo.

El efecto de la agitación está relacionado con las fuerzas de cizalla generadas que podrían provocar la desorción del metal unido por enlaces de naturaleza débil como la atracción electrostática, los puentes de hidrógeno y las fuerzas de Van der Waals.

El efecto positivo de la temperatura para mercurio y níquel puede atribuirse a un aumento de la movilidad iónica. La relación entre la capacidad de

4148

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

capacity was obtained at 30°C (20), which corresponds to the high level used in this study.

In conclusion, the pH was the variable that had the greatest influence on the biosorption of lead, mercury and nickel on the biomass of S. cerevisiae. The temperature was the variable that most influenced the biosorption of mercury and nickel. Lead was the metal with greater affinity for biomass, followed by mercury and nickel, which can be asserted by comparing their removal percentage and the effects of the interaction of temperature and agitation.

Second and third order interactions were significant for the biosorption of lead, mercury and nickel. Aeration only had a positive effect on the biosorption of lead, which can indicate a relationship between the uptake of lead and the metabolic state of the cell. The strongest negative effect on the biosorption of mercury and nickel was represented by the interaction between temperature and agitation.

Acknowledgements The authors would like to thank the Universidad de Cartagena for its support in the conduction of this study.

remoción de metales y la temperatura fue estudiada por Zhang et al (15) encontrando que la capacidad máxima se obtuvo a 30ºC (20), la cual corresponde al nivel alto utilizado en este trabajo.

En conclusión, el pH fue la variable que tuvo una mayor influencia en la biosorción de plomo, mercurio y níquel sobre la biomasa de S. cerevisiae.

La temperatura fue la variable que más influyó sobre la biosorción de mercurio y níquel. El plomo fue el metal con mayor afinidad por la biomasa, seguido por el mercurio y el níquel, lo cual puede afirmarse al comparar su porcentaje de remoción y los efectos de interacción de agitación y temperatura. Las interacciones de segundo y tercer orden fueron significativas para la biosorción de plomo, mercurio y níquel. La aireación sólo tuvo efecto positivo sobre la biosorción del plomo, lo cual puede indicar una relación entre la captación de plomo y el estado metabólico de la célula. El efecto negativo más fuerte sobre la biosorción del mercurio y el níquel estuvo representado por la interacción entre la temperatura y la agitación.

Agradecimientos Los autores agradecen a la Universidad de Cartagena por su apoyo para la realización de este trabajo.

REFERENCES 1.

Volesky B. Biosorption and me. Water Res 2007; 41:4017-4029.

2.

Wang J, Chen C. Biosorbents for heavy metals removal and their future. Biotechnol Adv 2009; 27:195–226.

3.

Li C, Xu Y, Jiang W, Dong X, Wang D, Liu B. Effect of NaCl on the heavy metal tolerance and bioaccumulation of Zygosaccharomyces rouxii and Saccharomyces cerevisiae. Biores Technol 2013; 143:46–52.

4.

5.

Soares E, Soares H. Bioremediation of industrial effluents containing heavy metals using brewing cells of Saccharomyces cerevisiae as a green technology: A review.

Env Sci Pollut Res 2012; 19:1066-1083.

Gohari M, Hosseini S,Sharifnia S, Khatami M. Enhancement of metal ion adsorption capacity of Saccharomyces cerevisiae’s cells by using disruption method. J Taiwan Inst Chem E 2013; 44:637–645.

6.

Wang J, Chen C. Biosorption of heavy metals

by Saccharomyces cerevisiae: A review.

Biotechnol Adv 2006; 24:427–451.

7.

Mack CL, Wilhelmi B, Duncan JR, Burgess JE.Biosorptive recovery of platinum from platinum group metal refining wastewaters by immobilised Saccharomyces cerevisiae.

Water Sci Technol 2011; (63):149-55.

8.

Soares E, Soares H. Cleanup of industrial effluents containing heavy metals: a new opportunity of valorising the biomass produced by brewing industry. Appl Microbiol Biotechnol 2013; 97(15):6667-6675.

9.

Ruta L, Paraschivescu C, Matache M, Avramescu S, Farcasanu I C. Removing heavy metals from synthetic effluents using “kamikaze” Saccharomyces cerevisiae cells.

Appl Microbiol Biotechnol 2010; 85:763–771.

Infante - Removal of lead, mercury and nickel

4149

10. Li T, Liu Y, Peng Q, Hu X, Liao T, Wang H, Lu M. Removal of lead(II) from aqueous solution with ethylenediamine-modified yeast biomass coated with magnetic chitosan microparticles: Kinetic and equilibrium modeling. Chem Eng J 2013; 214:189-197.

16. Skountzou P, Soupioni M, Bekatorou A, Kanellaki M, Koutinas A, Marchant R et al. Lead(II) uptake during baker’s yeast production by aerobic fermentation of molasses. Process Biochem 2003; 38:14791482.

11. Ramírez M, Pereira M, Ferreira S, Vasco O, Ocampo C. Packed bed redistribution system for Cr(III) and Cr(VI) biosorption

by Saccharomyces cerevisiae. J Taiwan Inst Chem E 2012; 43: 428–432.

17. Galedar M, Younesi H. Biosorption of ternary cadmium, nickel and cobalt ions from aqueous solution onto saccharomyces cerevisiae cells: batch and column studies.

Am J Biochem Biotechnol 2013; 9(1):47-60.

12. APHA. Métodos normalizados para el análisis de aguas potables y residuales. Método 3112 B. 3-23, 3-24. 21a Edición. España.

Editorial Díaz de Santos; 2005.

18. Machado M, Soares E, Soares H. Removal of heavy metals using a brewer’s yeast strain of Saccharomyces cerevisiae: chemical speciation as a tool in the prediction and improving of treatment efficiency of real electroplating effluents. J Hazard Mater 2010; 180(1-3):347-53.

13. Özer A, Özer D. Comparative study of the biosorption of Pb(II), Ni(II) and Cr(VI) ions onto S. cerevisiae: determination of biosorption heats. J Hazard Mater 2003; B100:219–229.

14. Chen C, Wang J. Influence of metal ionic characteristics on their biosorption capacity

by Saccharomyces cerevisiae. Appl Microbiol Biotechnol 2007; 74:911–917.

15. Zhang Y, Fan C, Meng Q, Diao Z, Dong L, Peng X et al. Biosorption of Pb2+ by Saccharomyces Cerevisiae in Staticand Dynamic Adsorption Tests. Bull Environ Contam Toxicol 2009; 83:708–712.

19. Suazo E, Morales L, Cristiani M, Cristiani E. Efecto del pH sobre la biosorción de níquel (II) por Saccharomyces cerevisiae var. ellipsoideus. Rev CENIC Cienc Quim 2010; 41:1-12.

20. Zhang Y, Liu W, Zhang L, wang M, Zhao M. Application of bifunctional Saccharomyces cerevisiae to remove lead(II) and cadmium(II) in aqueous solution. Appl Surf Sci 2011; 257:9809–9816.

Rev.MVZ Córdoba 19(2):4150-4157, 2014. ISSN: 0122-0268 ORIGINAL

Genetic characterization of the domestic pig (Sus scrofa domestica) in Cerete-Colombia, using microsatellite markers Caracterización genética del cerdo doméstico (Sus scrofa domestica) en Cereté - Colombia, usando marcadores microsatélites Iván Meléndez G,1* M.Sc, Enrique Pardo P,2 Ph.D, Teodora Cavadia M,2 M.Sc. Universidad de Pamplona. Faculty of Basic Sciences. Department of Biology. Laboratory of Genetics.

Ciudad Universitaria. Pamplona, Colombia. 2Universidad de Córdoba. Department of Biology. Genetics Section. Carrera 6 No. 76-103. Monteria. Colombia. *Correspondence: imgelvez@hotmail.com 1

Received: April 2013; Accepted: December 2013.

ABSTRACT Objective. The purpose of this study was to characterize a population of domestic pig (Sus scrofa domestica) in Cereté, Córdoba, using 20 microsatellite; calculate heterozygosity per locus and average heterozygosity. Materials and methods. Hair samples were collected from 62 specimens. DNA was extracted by proteinase K digestion and phenol-chloroform purification. Information from 20 microsatellites was selected out of those recommended for swine biodiversity studies. PCR products were separated by a vertical polyacrylamide gel electrophoresis. The bands were visualized by staining with silver nitrate. Results. All microsatellites used were polymorphic. Between 3 (SW1067) and 15 (IFNG) alleles were detected with an average number of 6.7 and a total de 134 alleles. The average expected and observed heterozygosities were 0.5278 and 0.5479, respectively. PIC values​​ ranged between 0.1999 and 0.8300 for loci SW1067 and SW911, respectively. Conclusions. Levels of observed and expected heterozygosity found in the present study indicate that the domestic pig (Sus scrofa domestica) in Córdoba Cereté show high degree of genetic variability.

Key words. Alleles, genetic diversity, heterozygosity (Source: DeCS).

RESUMEN Objetivo. El objetivo del presente estudio fue caracterizar una población de cerdo doméstico (Sus scrofa domestica) en Cereté, Córdoba utilizando 20 microsatélites; calcular la heterocigosidad por locus y la heterocigosidad media. Materiales y métodos. Se recolectaron muestras de bulbos de pelo de 62 ejemplares. El ADN se extrajo mediante digestión con proteinasa K y una purificación con fenol-cloroformo. Se utilizó la información proporcionada por 20 marcadores microsatélites de los recomendados para estudios de biodiversidad porcina. Los productos de PCR se separaron mediante electroforesis vertical en gel de poliacrilamida. Las bandas se visualizaron por tinción con nitrato de plata Resultados. Todos los microsatélites utilizados fueron polimórficos. Se detectaron, entre 3 (SW1067) y 15 (IFNG) alelos, con un número medio de alelos de 6.7 y un total de 134. Las heterocigosidades media esperadas y observadas fueron 0.5278 y 0.5479 respectivamente. Los valores del PIC oscilaron

4150

Melendez - Genetic characterization of the domestig pig

4151

entre 0.1999 y 0.8300 para los loci SW1067 y SW911 respectivamente. Conclusiones. Los niveles de heterocigosidad observada y esperada encontrados en el presente estudio, indican que el cerdo doméstico (Sus scrofa domestica) en Cereté Córdoba muestran alto grado de variabilidad genética.

Palabras clave: Alelos, diversidad genética, heterocigosidad (Fuente: DeCS).

INTRODUCTION

INTRODUCCIÓN

The domestic pig (Sus scrofa domestica) is a four-legged mammal belonging to the group Suinos of the genus Sus (Family Suidae), which is characterized by having four toes ending in the shape of a hoof; the second and third toes serve as support and the first and fourth are not used for support. The fact that it has four hooves places it in the order Artiodactyla.

El cerdo doméstico (Sus scrofa domestica) es un mamífero cuadrúpedo perteneciente al grupo Suinos, del genéro Sus (Familia Suidae), que se caracteriza por tener cuatro dedos terminados en forma de pezuña; el segundo y el tercer dedo le sirven de apoyo y el primero y cuarto no los apoya.

La posesión de cuatro pezuñas, lo coloca en el orden de los artiodáctilos.

Its head is long and thick, in common races it is pyramid-shaped. Its skull is solid; in young animals the nose and frontal regions are straight and eventually become concave. The snout is cylindrical in shape with a bulky edge; hairless and smooth; the nostrils are small and its eyes have round pupils.

Su cabeza es larga y gruesa, en las razas comunes es de forma piramidal. Su cráneo es sólido; en los animales jóvenes las regiones nasal y frontal son rectas, con el tiempo se hacen cóncavas. El hocico es de forma cilíndrica con un borde abultado; es lampiño y liso; los orificios nasales son pequeños y sus ojos son de pupilas redondas.

Domestic pigs in the Americas have their origin in the Iberian pigs brought by Columbus on his second voyage (1). Years later by imposition of Carlos V, the expedition of Rodrigo Bastidas who left La Española and founded Santa Marta in 1525, brought 300 pigs (2). It is possible that the pigs brought by Bastidas were the first that came to Colombia. It was initially raised outdoors with very rudimentary nutrition. It was looked after because of its fertility, meat and fat. Therefore, in each trip of the Spaniards to the American continent the number of pigs increased considerably, until occupying much the Colombian geography. Thus, it became an indispensable factor in the family feeding of natives.

Los cerdos domésticos del continente americano tienen su origen en los cerdos ibéricos traídos por Colón en su segundo viaje (1). Años más tarde por imposición de Carlos V, la expedición de Rodrigo Bastidas que partió de la española y fundó a Santa Marta en 1525, trajo 300 cerdos (2). Es posible que los cerdos traídos por Bastidas sean los primeros que llegaron a Colombia. Inicialmente se crió al aire libre con nutrición muy rudimentaria. Era apetecido debido a su fertilidad, carne y grasa. Por eso, en cada viaje de los españoles al continente americano, el número de cerdos aumentó en forma considerable, hasta ocupar gran parte en la geografía de Colombia. Así se convirtió en factor indispensable en la alimentación familiar de los nativos.

The Department of Cordoba is one of the regions in Colombia with the largest populations of domestic swine (Sus scrofa domestica), made up mostly by the mixture of the creole race called zungo with other races. It seems that the first pigs were introduced into the Department of Cordoba around 1500-1550, at the time of the Conquest and they came from the Spanish breeds known as hairless (3).

The PCR (Polymerase Chain Reaction) is the most used technique for the study of polymorphic markers such as microsatellites or SSRs (Simple Sequence Repeats), formed by DNA segments between two and seven pairs of bases repeated in tandem as neutral markers of high informative value due to their abundance throughout eukaryotic genomes. They display codominant Mendelian inheritance, featuring high polymorphism, their amplification through

El departamento de Córdoba es una de las regiones de Colombia con mayor población de cerdo doméstico (Sus scrofa domestica), formada en su mayoría por la mezcla de la raza criolla denominada zungo con otras razas. Parece que los primeros cerdos fueron introducidos al departamento de Córdoba alrededor de los años 1500-1550, en la época de la Conquista y eran procedentes de las razas españolas conocidas como lampiña (3).

La PCR (Reacción en Cadena de la Polimerasa), es la técnica más utilizada para el estudio de marcadores polimórficos como son los microsatélites o SSRs (Simple Sequence Repeats), formados por segmentos de ADN entre dos y siete pares de bases repetidas en tándem siendo marcadores neutrales de gran valor informativo por su abundancia a lo largo de los genomas eucariotas. Muestran herencia

4152

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

PCR as well as the interpretation of the results is simple (4).

This study is justified by the interest in contributing to a wider genetic knowledge of the domestic pig (Sus scrofa domestica) in Cerete, Colombia to reveal the status of genetic variability, a conclusive element in the determination of breeding strategies and genetic conservation programs (4) and the establishment of a database that allows comparing the same with other existing populations.

The objective of this study was to characterize a population of domestic swine (Sus scrofa domestica) in Cerete, Colombia using 20 microsatellite; calculating their heterozygosity per locus, their average heterozygosity and compare this information with that obtained in other populations with the same genetic markers.

mendeliana codominante; presentando un elevado polimorfismo, su amplificación por medio de la PCR así como la interpretación de los resultados es sencilla (4).

La justificación de este estudio es el interés en contribuir a un conocimiento genético más amplio del cerdo doméstico (Sus scrofa domestica) en Cereté, Colombia para evidenciar el estado de la variabilidad genética, un elemento concluyente en la determinación de estrategias de crianza y de programas genéticos de conservación (4) y al establecimiento de una base de datos que permita la comparación de la misma con otras poblaciones actuales.

MATERIALS AND METHODS

El objetivo del presente estudio fue caracterizar una población de cerdo doméstico (Sus scrofa domestica) en Cereté, Colombia utilizando 20 microsatélites; calcular sus heterocigosidades por locus, su heterocigosidad media y comparar dicha información con la obtenida en otras poblaciones con los mismos marcadores genéticos.

Study site. The samples were collected in Cerete, Córdoba (08°53’08” N and 75°47’48” W), Colombia.

MATERIALES Y MÉTODOS

Sample collection. Hair samples of 62 specimens were collected. The specimens come from family farms, therefore they lack genealogical records.

Sitio de estudio. Las muestras fueron recolectadas en Cereté, Córdoba (08°53’08” N y 75°47’48” W), Colombia.

Experimental procedure. The DNA of each one of the samples was extracted by means of a modification to the protocol described by Sambrook and Russell (5). The DNA was extracted from the hair bulb by digestion of proteins with the enzyme Proteinase K and phenol-chloroform purification.

Recolección de la muestra. Se recolectaron muestras de pelo de 62 ejemplares. Los ejemplares provienen de explotaciones familiares, por lo cual carecen de registros genealógicos.

The 20 microsatellites used in the study belong to the panel of those recommended by the FAO / ISAG (International Society of Animal Genetics) (6) for swine biodiversity studies. The amplification of the same was carried out using a thermal cycler Mycycler Bio-Rad® in a final volume of 25 mL which included 10 μL of 100 μM dNTPs, 2.5 μL of a 10X buffer, 1.0 μL of MgCl2 25 mM, 3.0 μL of specific primers for each locus of 10 pmol, 0.3 μL of the enzyme Taq DNA polymerase at a concentration of 1 U/μL, 4.0 μL of genomic DNA at a concentration of 50 ng/μL and 4.2 μL of sterile bidistilled water.

The PCR reaction consisted of a denaturalization phase at 94°C for 30 seconds, followed by 30 denaturation cycles at 94°C for 30 seconds, hybridization at 56°C for 30 seconds and elongation at 72°C for 30 seconds. PCR products were separated by vertical gel electrophoresis of polyacrylamide in a Mini-Protean II Biorad® chamber. The bands were visualized by staining with silver nitrate (7).

Procedimiento experimental. De cada una de las muestras se extrajo el ADN mediante una modificación al protocolo descrito por Sambrook y Russell (5). Se procede a la extracción de DNA a partir del bulbo piloso mediante digestión de las proteínas con la enzima Proteinasa K y una purificación con fenol-cloroformo.

Los 20 microsatelites utilizados para el estudio pertenecen al panel de los recomendados por la FAO/ ISAG (International Society of Animal Genetics) (6) para estudios de biodiversidad porcina. La amplificación de los mismos se efectuó utilizando un termociclador Mycycler Bio-Rad® en un volumen final de 25 mL que incluyó 10 μL de dNTPs 100 μM, 2.5 μL de amortiguador 10X, 1.0 μL de MgCl2 25 mM, 3.0 μL de cebadores específicos de cada locus de 10 pmol, 0.3 μL de enzima Taq ADN polimerasa a una concentración de 1 U/μL, 4.0 μL de ADN genómico a una concentración de 50 ng/μL y 4.2 μL de agua bidestilada esterilizada.

La reacción de PCR consistió de una fase de desnaturalización a 94°C por 30 segundos, seguida

4153

Melendez - Genetic characterization of the domestig pig An allelic ladder was used to determine the size of the alleles and the allelic allocation was made by an adjustment to a linear regression curve developed from the migration distances of fragments of a known size.

Computer software and statistical analysis.

The allele frequencies, heterozygosities, the value of FIS (8), the existence of the Hardy-Weinberg (HW) equilibrium, the allelic richness and the consanguinity coefficient were evaluated using the software GENEPOP v. 4.0.6 (9). Additionally, the Polymorphic Information Content (PIC) of each microsatellite was calculated using the software CERVUS v. 3.0.3 (10).

RESULTS All the microsatellites used showed a high degree of polymorphism, evidenced in the average number of alleles per locus, detecting a total of 134 alleles with a range between 3 (SW1067) and 15 (IFNG) per locus (Table 1).

The statistics FIS (Table 2) ranged from -0.414 for SW911 to 0.304 for the marker SWR345. Eleven of the 20 markers show a positive sign and 9 have a negative sign. The average FIS found was -0.033 (Table 3).

Table 1. Microsatellites typified, number of alleles detected (NA), repetition and allelic range in domestic pigs in Cerete, Colombia.

Marker

NA

Repetition

Allelic Range (pb)

SW489

7

(GT)16

148 – 181

SW2519

8

(CA)20

187 – 232

SW780

5

(GT)11(GA)9

115 – 170

SW2083

6

(GT)10

143 – 167

SW2019

4

(GT)14AT(GT)4

127 – 147

SW2410

6

(GT)15

103 – 137

S0215

8

(CT)18(CA)12

125 – 194

SW72

7

(GT)15

97 – 119

de 30 ciclos de desnaturalización a 94°C por 30 segundos, hibridización a 56°C por 30 segundos y elongación a 72°C por 30 segundos. Los productos de PCR se separaron mediante electroforesis vertical en gel de poliacrilamida en una cámara Mini-Protean II Biorad®. Las bandas se visualizaron por tinción con nitrato de plata (7).

Para determinar el tamaño de los alelos se utilizó escalera alélica y la asignación alélica se hizo mediante ajuste a una curva de regresión lineal desarrollada a partir de las distancias de migración de los fragmentos de tamaño conocido.

Programas informáticos utilizados y análisis estadístico. Las frecuencias alélicas, las heterocigosidades, el valor de FIS (8) la existencia de equilibrio Hardy-Weinberg (HW), la riqueza alélica y el coeficiente de consanguinidad se evaluaron mediante el programa GENEPOP v. 4.0.6 (9). Adicionalmente, se calculó el Contenido de Información Polimórfica (PIC) de cada microsatélite mediante el programa CERVUS v. 3.0.3 (10).

RESULTADOS Todos los microsatélites utilizados mostraron un alto grado de polimorfismo, evidenciado en el Table 2. Microsatellites typified, heterozygosity expected (He), heterozygosity observed (Ho), polymorphic information content (PIC), probability of equilibrium (p-val) and inbreeding coefficient (FIS) of the domestic pig of Cerete, Colombia.

Marker

He

Ho

PIC

p-val

FIS

SW489

0.4811

0.6459

0.5222

0.5357 NS

-0.292

SW2519

0.7836

0.8168

0.7034

0.1362 NS

0.242

SW780

0.5871

0.5755

0.5156

0.0343*

0.199

SW2083

0.2564

0.3643

0.3490

0.3454 NS

-0.102

SW2019

0.4503

0.5544

0.5134

0.7723 NS

-0.363

SW2410

0.7345

0.6578

0.4567

0.5646 NS

0.027

S0215

0.1891

0.6566

0.7479

0.0043*

-0.102

SW911

5

(CA)22

147 – 177

SW72

0.7507

0.6743

0.5121

0.4341 NS

-0.371

IFNG

15

(GA)11

221 – 245

SW911

0.4872

0.6581

0.8300

0.742 NS

-0.414

IFNG

0.6961

0.1887

0.5173

0.3234 NS

0.045

SW1041

0.5789

0.4537

0.5363

0.0427*

-0.296

SWR345

0.3459

0.3165

0.4521

0.0965 NS

0.304

TNFB

0.6438

0.7456

0.6812

0.4217 NS

0.066 -0.029

SW1041

4

(CA)9

93 – 101

SWR345

5

(CA)12

134 – 160

TNFB

12

(CTG)20

142 – 203

S0385

6

(CA)21

145 – 192

SW787

5

(CA)19

144 – 164

S0385

0.6166

0.6781

0.5365

0.2244 NS

SW787

0.4332

0.3496

0.2132

0.2072 NS

0.083

S0090

0.6024

0.5881

0.6176

0.0056*

0.026 0.098

S0090

6

(CA)24

227 – 251

SW1083

0.4865

0.5342

0.5587

0.4957 NS

SW1083

5

(GT)15

108 – 152

SW957

0.7423

0.6914

0.5234

0.1319 NS

0.187

SW957

10

(GT)28

112 – 157

SW2427

0.4343

0.6876

0.5158

0.7433 NS

-0.214

SW2427

7

(GT)13

116 – 146

SW1067

0.2564

0.1221

0.1999

0.1189 NS

0.237

(CT)20(CA)22

137 – 175

SW1067

3

NS: Not significant. * Markers not in the Hardy-Weinberg equilibrium (P<0.05).

4154

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

Table 3. Number of samples analyzed (N), average number of alleles (NA), allelic richness (RA), average heterozygosity expected (He), average heterozygosity observed (H 0 ), average polymorphic information content (PIC), average inbreeding coefficient (FIS) for the microsatellites used in the population of domestic pig in Cerete, Colombia.

N

NA

RA

He

H0

PIC

FIS

62

6.7

6.0

0.5278

0.5479

0.5251

-0.033

The polymorphic information content (PIC) obtained (Table 2) varied between 0.1999 (SW1067) and 0.8300 (SW911), values that corresponded to markers that showed the lesser and the greater number of alleles. The high degree of polymorphism was also evidenced by the average number of alleles of 6.7 found in the population (Table 3).

Of the microsatellites studied, three were not found to be in the Hardy-Weinberg equilibrium, (SW2083, S0215 and SWR345) which indicates an excess of homozygotes.

DISCUSSION Previous studies on the genetic diversity of pigs reported greater and lower average values of alleles per locus as follows: between 5 and 13 alleles; (11, 12) and values between 2 and 3 alleles (13).

After applying the statistics FIS to 20 markers, 11 show a positive sign indicating an excess of homozygotes and 9 show a negative sign. The average FIS of -0.033 indicate a low value of exogamy, but with a slight excess of heterozygotes.

According to Liu et al (14), of the 20 markers analyzed, 15 can be considered as very informative (PIC>0.5) at the time of detecting the genetic variability in the population of domestic pigs in Cerete, Colombia, 3 markers are fairly informative (PIC>0.25) and 2 markers are little informative (PIC<0.25). The average PIC value in this study was lower in comparison with the data previously published in a study conducted with pigs from Portuguese and European breeds (15) and similar to those reported by the studies carried out in Mamellado of Uruguay and native pigs from China (11, 16, 17).

Of the total number of microsatellites analyzed, seventeen were found in the Hardy-Weinberg equilibrium, so it may indicate that the population is genetically stable (Table 2). In principle this could

promedio de alelos por locus, detectándose un total de 134 alelos, con un rango comprendido entre 3 (SW1067) y 15 (IFNG) por locus (Tabla 1).

El estadístico FIS (Tabla 2) varió entre -0.414 para SW911 y 0.304 para el marcador SWR345.

Once de los 20 marcadores presentan signo positivo y 9 presentan signo negativo. El FIS promedio encontrado fue de -0.033 (Tabla 3).

El contenido de información polimórfica (PIC) obtenido (Tabla 2) varió entre 0.1999 (SW1067) y 0.8300 (SW911), valores que correspondieron con los marcadores que presentaron el menor y el mayor número de alelos. El alto grado de polimorfismo también fue evidenciado por el número promedio de alelos encontrados en la población de 6.7 (Tabla 3).

De los microsatélites estudiados, tres no se encontraron en equilibrio de Hardy-Weinberg, (SW2083, S0215 y SWR345) lo que indica un exceso de homocigotos.

DISCUSIÓN Estudios previos de diversidad genética en cerdos reportan valores promedio mayores y menores de alelos por locus así: entre 5 Y 13 alelos; (11,12) y valores entre 2 Y 3 alelos (13).

Aplicando el estadístico FIS a los 20 marcadores, 11 presentan signo positivo, indicando exceso de homocigotos, y 9 presentan signo negativo.

El F IS promedio de -0.033, indica un valor bajo de exogamia, pero con ligero exceso de heterocigotos.

Según Liu et al (14), de los 20 marcadores analizados, 15 pueden ser considerados muy informativos (PIC>0.5), a la hora de detectar variabilidad genética en la población de cerdo doméstico en Cereté, Colombia, 3 marcadores son medianamente informativos (PIC>0.25) y 2 marcadores son poco informativos (PIC<0.25). El valor medio de PIC en el presente estudio, resultó menor en comparación con datos previamente publicados en un estudio realizado con cerdos en razas portuguesas y europeas (15) y similar a los reportados por estudios que se realizaron en Mamellado de Uruguay y en cerdos nativos de China (11, 16,17).

Del total de microsatélites analizados, diecisiete se encontraron en equilibrio de Hardy-Weinberg, por lo que puede indicarse que la población es genéticamente estable (Tabla 2). En un principio esto podría mostrar que los apareamientos dentro de la población se produjeron de forma

Melendez - Genetic characterization of the domestig pig show that the mating in the population occurred randomly (in relation to the markers taken into consideration) or that, if there are new animals that have recently joined this population, these come from other populations with the same gene pool of the individuals in the population under analysis (18).

Three loci showed a significant deviation from the H-W equilibrium (SW2083, S0215 and SWR345) revealing an excess of homozygotes. The excess of homozygotes in a population may be the result of inbreeding events within the same (19). However, inbreeding equally affects the entire genome so it would be expected that if this phenomenon were to be the most transcendent, all the markers used should show an excess of homozygotes, which is not the case.

Likewise, the existence of a possible genetic structure by subdivision (Wahlund Effect) may also occur. If so, this would mean that there are marked differences between close populations of domestic swine for the markers (SW2083, S0215 and SWR345), but not for the other markers. If these differences for these markers have not been removed it is because the gene flow among nearby populations is limited (aspect not showed by other markers), or that these markers (SW2083, S0215 and SWR345) are linked to genes undergoing selection natural that act differentially at micro or macro-spatial level. Another possibility is the presence of null alleles in such loci (20), an event that can be discarded in this study as it was not found.

A founder effect (few reproducers arrived that then multiplied a lot) could have also occurred.

In this study, the average heterozygosity expected of 0.527 and observed of 0.547 (Table 3) shows a high degree of variability, since it is considered as such when values exceeded 0.5. This value is similar to that reported in previous studies carried out in creole pigs in Uruguay, Cuban creole pigs, the Mexican hairless pigs and Argentinian creole pigs (21-24).

The percentage of heterozygous individuals was over 50%, reaching values of 54.79% for the average heterozygosity observed and 52.78% for the average heterozygosity expected. These values are similar to those reported in Denmark and the Netherlands and are exceeded by those reported in China, Brazil and Thailand (25-28).

The parameters mean number of alleles per locus and allelic richness indicate that this population exhibits certain degree of variability.

Since this is the first study where it is attempted to learn the population genetic diversity of Sus scrofa domestic in Cerete, Colombia and there is no prior

4155

aleatoria (en lo referente a los marcadores considerados) o que, si hay nuevos animales que se han sumado recientemente a esta población, éstos provienen de otras poblaciones con el mismo acervo genético de los individuos de la población analizada (18).

Tres loci mostraron una desviación significativa con respecto al equilibrio H-W (SW2083, S0215 y SWR345), revelando un exceso de homocigotos. El exceso de homocigotos en una población podría ser el resultado de eventos de endogamia dentro de la misma (19). Sin embargo, la endogamia afecta por igual a todo el genoma por lo que se esperaría que si este fenómeno fuera el más trascendente, todos los marcadores empleados deberían mostrar un exceso de homocigotos, cosa que no ocurre.

Igualmente pudiera ocurrir la existencia de una posible estructura genética por subdivisión, (Efecto Wahlund). De ser así, eso significaría que existen diferencias marcadas entre las poblaciones cercanas de cerdo doméstico para los marcadores (SW2083, S0215 y SWR345), pero no para los otros marcadores.

Si esas diferencias para estos marcadores no se han eliminado es porque el flujo génico entre poblaciones cercanas es limitado (aspecto que no muestran los otros marcadores), o que dichos marcadores (SW2083, S0215 y SWR345), están ligados a genes sometidos a selección natural que actúen diferencialmente a nivel micro o macroespacial. Otra posibilidad es la presencia de alelos nulos en dichos loci (20), evento descartable en este estudio por no encontrarse. También pudo haberse dado un efecto fundador (llegaron pocos reproductores que se multiplicaron mucho).

En el presente estudio la heterocigosidad media esperada de 0.527 y la observada de 0.547 (Tabla 3), muestran un alto grado de variabilidad, ya que así se considera cuando los valores superan el 0.5. Este valor es similar a los reportados en estudios previos llevados a cabo en cerdos criollos de Uruguay, cerdo Criollo Cubano, el Pelón Mexicano y los criollos argentinos (21-24).

El porcentaje de individuos heterocigotos se comportó por encima del 50%; alcanzándose valores de 54.79%, para la heterocigosidad media observada y 52.78% para la heterocigosidad media esperada. Estos valores son similares a los reportados en Dinamarca y Holanda y se ven superados por los reportados en China, Brasil y Tailandia (25-28).

Los parámetros número medio de alelos por locus y riqueza alélica indican que dicha población exhibe cierto grado de variabilidad.

4156

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

information allowing to explore the possibility of loss of genetic diversity over time; the possibility of inbreeding processes for this population of the Colombian Caribbean region cannot be ruled out.

The results of this study allow concluding that the microsatellites used in the population of domestic swine (Sus scrofa domestica) in Cerete, Colombia revealed a high degree of polymorphism. In addition, the high percentage of markers with a high PIC would facilitate the implementation and optimization of this technique for other studies on this race such as genealogical research and allocation of individuals to populations. Similarly, the heterozygosity levels observed and expected found in this study indicate that the domestic pig (Sus scrofa domestica) in Cerete, Colombia show a high degree of genetic variability.

Debido a que éste es el primer trabajo en el que se intenta conocer la diversidad genética poblacional de Sus scrofa doméstica en Cereté, Colombia y no se cuenta con información previa que permita explorar la posibilidad de pérdida de diversidad genética en el tiempo; no se puede descartar la posibilidad de procesos endogámicos para esta población de la región del Caribe colombiano.

Los resultados del presente estudio permiten concluir que Los microsatélites utilizados en la población de cerdo doméstico (Sus scrofa domestica) en Cereté-Colombia revelaron un alto grado de polimorfismo. Además, el alto porcentaje de marcadores con un PIC elevado facilitarían la implementación y optimización de esta técnica para otros estudios dentro de la raza como la investigación genealógica y la asignación de individuos a poblaciones. De igual manera los niveles de heterocigosidad observada y esperada encontrados en el presente estudio, indican que el cerdo doméstico (Sus scrofa domestica) en Cereté Colombia muestran alto grado de variabilidad genética.

REFERENCES 1.

Burgos-Paz W, Souza CA, Megens HJ , Ramayo-Caldas Y, Melo M et al. Porcine colonization of the Americas: a 60k SNP story. Heredity 2013; 110:321–330.

2.

Peña M, Mora C. Historia de Colombia.

Bogotá: Editorial Norma; 1977.

3.

Cabeza VM. Estudio comparativo de la raza nativa de cerdo Zungo con razas mejoradas.

[Tesis de Maestría]. Bogotá Universidad Nacional de Colombia: ICA; 1976.

4.

Pimentel L, Tambasco-Talhari D, Pozzi A, Lehmann L, Correia de Almeida L. Genetic characterization of Aberdeen Angus cattle using molecular markers. Genet Mol Biol 2003; 26(2):133-137.

5.

Sambrook J, Russell DW. Molecular Cloning: A laboratory manual (3rd ed.). New York: Cold Spring Harbor Laboratory Press; 2001.

6.

FAO. Draft guidelines on Molecular Genetic C h a ra c t e r i z a t i o n o f A n i m a l G e n e t i c Resources. [Consulta en internet]. ROMA [Accesado marzo de 2013]. 2011. URL Disponible en: http://www.fao.org/docrep/ meeting/022/am652e.pdf

7.

Shanlian Q, Jichen C, Si L, Xinjian L. A comparison of silver staining protocols for detecting DNA in polyester-backed polyacrylamide gel. Braz J Microbiol 2012; 43:649-652.

8.

Weir BS. Estimating F-Statistics: A Historical View. Philos Sci 2012; 79:637-643.

9.

Rousset F. Genepop 007: a complete reimplementation of the genepop software for Windows and Linux. Mol Ecol Resour 2008; 8:103-106.

10. Kalinowski ST, Taper ML, Marshall TC. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment.

Mol Ecol 2007; 16:1099-1106.

11. Li SJ, Yang SL, Yang SH, Zhao SH, Fan B, Yu M et al. Genetic diversity analyses of 10 indigenous Chinese pig populations based on 20 microsatellites. J Anim Sci 2004; 82:368-74.

Melendez - Genetic characterization of the domestig pig 12. Megens HJ, Crooijmans R, Cristobal MS, Hui X, Li N, Groenen MM. Biodiversity of pig breeds from China and Europe estimated from pooled DNA samples: differences in microsatellite variation between two areas of domestication. Gen Sel Evol 2008; 40:103-128.

13. Chang WH, Chu HP, Jiang YN, Li SH, Wang Y, Chen CH et al. Genetic variation and phylogenetics of Lanyu and exotic pig breeds in Taiwan analyzed by nineteen microsatellite markers. J Anim Sci 2009; 87:1-8.

14. Liu K, Muse SV. PowerMarker: integrated analysis environment for genetic marker data. Bioinformatics 2005; 21:2128-2129.

15. Vicente AA, Carolino MI, Sousa MC, Ginja C, Silva FS, Martinez AM et al. Genetic diversity in native and commercial breeds of pigs in Portugal assessed by microsatellites.

J Anim Sci 2008; 86:2496-2507.

16. Castro G. Porcicultura urbana y periurbana en ciudades de América Latina y el Caribe.

Lima: Ediciones IPES Promoción del Desarrollo Sostenible. 2007.

17. Zhang GX, Wang ZG, Sun FZ, Chen WS, Yang GY, Guo SJ et al. Genetic diversity of microsatellite loci in fifty six Chinese native pig breeds. Yi Chuan Xue Bao 2003; 30(3):225-233.

18. Wang J. On the measurements of genetic differentiation among populations. Genet Res 2012 94:275-289.

19. Allendorf FW, Luikart G. Conservation and the genetics of populations. Massachusetts: Blackwell; 2007.

20. Chapuis MP, Estoup A. Microsatellite null alleles and estimation of population differentiation. Mol Biol Evol 2007; 24(3):621-631.

4157

21. Kelly L, Clop A, Vadell A, Nicolini P, Monteverde S, Amills M, Sánchez A. El cerdo Pampa-Rocha como recurso zoogenético en Uruguay. Veterinaria 2004; 39:155-159.

22. Canul M, Sierra A, Martínez A, Ortiz O, Delgado JV, Vega-Pla J, Pérez G. Caracterización genética del cerdo pelón mexicano mediante marcadores moleculares. Arch Zootec 2005; 54:267-272.

23. Pérez-Pineda E. Caracterización genética del cerdo criollo Cubano utilizando marcadores moleculares. [Tesis doctoral]. España: Universidad de Córdoba; 2005.

24. Revidatti M.A. Caracterización de cerdos criollos del Nordeste Argentino. [Tesis Doctoral].

España: Universidad de Córdoba; 2009.

25. San Cristobal M, Chevalet C, Haley CS, Joosten R, Rattink AP et al. Genetic diversity within and between European pig breeds using microsatellite markers. Anim Genet 2006; 37:189–198.

26. Fang M, Hu X, Jin W, Li N, Wu C. Genetic uniqueness of Chinese village pig populations inferred from microsatellite markers. J Anim Sci 2009; 87:3445-3450.

27. Sollero BP, Paiva SR, Faria DA, Guimaraes SE, Castro S, Egito A et al. Genetic diversity of Brazilian pig breeds evidenced by microsatellite markers. Livest Sci 2009; 123:8-15.

28. Shenglin, Y. Genetic diversity of Thai indigenous pigs, wild boars and Chinese Qianbei black pigs based on microsatellite DNA and sequence polymorphism of mitochondrial DNA cytochrome B gene.

[Tesis Doctoral]. Nakhon Ratchasima: Suranaree University of Technology, Institute of Agriculture Technology; 2007.

Rev.MVZ Córdoba 19(2):4158-4167, 2014. ISSN: 0122-0268 SHORT COMMUNICATION

Foraging density for squirrel monkey Saimiri sciureus in two forests in Puerto Lopez - Colombia Densidad de forrajeo para el tití Saimiri sciureus en dos bosques de Puerto López - Colombia Jorge Astwood R,1 Biol, José Rodríguez P,2 M.Sc, Karen Rodríguez-C,3* M.Sc. Universidad de los Llanos, Km 12 Via Puerto Lopez, Villavicencio-Meta, Colombia. 2Universidad de los Llanos, GIRGA research group, Km 12 Via Puerto Lopez, Villavicencio-Meta, Colombia. 3Universidade Federal de São Carlos, Laboratório de Biodiversidade Molecular e Conservação. R. Washington Luis, km 235 - SP-310 São Carlos - São Paulo - Brazil. Correspondence: karengiselle2004@gmail.com 1

Received: September 2013; Accepted: January 2014.

ABSTRACT Objective. Forest remnants were analyzed to determine the density of squirrel monkeys (Saimiri sciureus) and the degree of alteration of the forest, by selecting areas for the conservation and maintenance of the species in natural environments. Materials and methods. Linear transects were conducted on two wooden fragments, “La Reforma” and “Campo Hermoso” farms (Puerto Lopez, Meta, Colombia), recording sightings of squirrel monkeys and identifying the tree species used by the primates. Results. The fragments studied correspond to trails at the edge of water bodies with low connectivity. Highest density values were observed on the second transect of La Reforma, a possible consequence of an overcrowding phenomenon due to the high degree of isolation of the fragment. The species preferentially used as refuge and food source were: Bellucia grossularioides, Eugenia jambos, Inga alba, Mauritia flexuosa, Pseudolmedia laevis and Rollinia edulis. Conclusions. The phenology of the plant species allows for a dynamic food supply, considering the constant availability of food for the primates. Therefore, despite the evident ecological problem of these forests, it is possible to use active restoration programs to strengthen the existing dynamics and balance the biogeochemical dynamics of the ecosystem, so that socioeconomic human activities are not in conflict with conservation efforts and vice versa.

Key words: Food, conservation, population density, dispersion, refuges (Source: ASFA).

RESUMEN Objetivo. Fueron analizados remanentes boscosos para determinar la densidad del Tití (Saimiri sciureus) y el grado de alteración del bosque, pretendiendo seleccionar áreas para conservación y mantenimiento de la especie en ambientes naturales. Materiales y métodos. Se realizaron transectos lineales en dos fragmentos boscosos, Hacienda La Reforma y Campo Hermoso (Puerto López, MetaColombia), registrando avistamientos del Tití e identificando las especies de árboles utilizadas por los primates. Resultados. Los fragmentos estudiados son senderos a la vera de cuerpos de agua con baja conectividad. Se observaron mayores valores de densidad en el segundo transecto de La

4158

Astwood - Foraging density for squirrel monkey Saimiri sciureus

4159

Reforma; posiblemente como consecuencia de un fenómeno de sobrepoblación, debido al alto grado de aislamiento del fragmento. Las especies utilizadas preferencialmente como refugio y fuente alimenticia son: Bellucia grossularioides, Eugenia jambos, Inga alba, Mauritia flexuosa, Pseudolmedia laevis y Rollinia edulis. Conclusiones. La fenología de las especies de plantas permite un abastecimiento de alimento dinámico, considerando la disponibilidad constante de alimento para los primates, permitiendo afirmar que a pesar del evidente problema ecológico de estos bosques es posible utilizar programas de restauración activa para fortalecer la dinámica existente y equilibrar la dinámica biogeoquímica del ecosistema, para que las actividades antrópicas socio-económicas no estén en contraposición a la conservación y viceversa.

Palabras clave: Alimento, conservación, densidad poblacional, dispersión, refugios (Fuente: ASFA).

INTRODUCTION

INTRODUCCIÓN

The squirrel monkey (Saimiri sciureus, Cebidae) is a primate species with a wide distribution in Colombia. Reports for the region of Llanos Orientales indicate that they are located in the foothills of the East Andes, from 1500 m.a.s.l. to the Colombian Amazon forest and the banks of the Orinoco River (1).

El mono Tití (Saimiri sciureus, Cebidae) es una especie de primate que presenta una amplia distribución en Colombia. Los reportes para la región de los Llanos Orientales indican que se encuentran en el piedemonte de la cordillera Oriental de los Andes, desde los 1500 m.s.n.m hasta la Amazonía colombiana y la margen del río Orinoco (1).

Defler (1) has reported that the species occupies different types of forests, mainly gallery forests and even palm groves. Within these it frequently uses all arboreal strata for moving, foraging and refuge.

Defler (1) ha reportado que la especie ocupa diferentes tipos de bosques, principalmente bosques de galería e inclusive palmares. Dentro de estos usa frecuentemente todos los estratos arbóreos para su desplazamiento, forrajeo y refugio.

While the classification for the species by the IUCN (2) is of low risk and it is found in appendix II in the CITES, there is still a large concern in the department of Meta since this species has the highest rates of illegal capture within primates, from their natural sites to be sold as pets. Likewise, the threat of the implementation of agricultural crops, livestock activities, tourism development, human settlements and forest fragmentation has been noted (3).

A pesar de que la clasificación para la especie en la IUCN (2) es de bajo riesgo y en el CITES se encuentra en el apéndice II, no deja de haber una preocupación grande en el departamento del Meta debido a que esta especie tiene las tasas más altas de extracción ilegal, dentro de los primates, desde sus sitios naturales con el fin de comercializarlos como mascotas. Igualmente se ha señalado como amenaza la implementación de cultivos agrícolas, actividades ganaderas, desarrollo turístico, asentamientos humanos y la fragmentación del bosque (3).

In the year 1970 5,563 individuals were legally exported from Colombia to other sites of the world, illegal exports could double this number (4). Hence the need to study them in the field, in order to know their phylogeographic, ecological aspects and the composition of the habitat necessary for their survival (5).

Under these conditions, the research was developed in two forest remnants, La Reforma and Campo Hermoso farms in the vicinity of the municipality of Puerto Lopez (Meta, Colombia), I order to learn population-related aspects and the habitat of the squirrel monkey Saimiri sciureus, as a tool for the selection of areas for their conservation (Figure 1).

En el año de 1970 fueron exportados legalmente desde Colombia hacia otros sitios del mundo 5.563 individuos, las exportaciones ilegales podrían llegar a duplicar esta cantidad (4). Nace entonces la necesidad de estudiarlos en campo, con el fin de conocer aspectos filogeográficos, ecológicos y de la composición del hábitat necesaria para su sobrevivencia (5).

Bajo estas condiciones, la investigación fue desarrollada en dos remanentes de bosque, Hacienda La reforma y Campo hermoso, en inmediaciones del municipio de Puerto López (Meta, Colombia), para conocer aspectos poblacionales y del hábitat del tití Saimiri sciureus, como herramienta para la selección de áreas para su conservación (Figura 1).

4160

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

R1, R2: Transects; La Reforma. Ch1, Ch2: Transects; Campo Hermoso

Figure 1. Location of the study area in Colombia and transects analyzed in the region under study.

MATERIALS AND METHODS

MATERIALES Y METODOS

Data collection. The density of the squirrel monkey in each forest was estimated using the method of linear transects of variable width (6).

Two trenches were placed in each of the forest, La Reforma and Campo Hermoso, separated by a minimum of 500 m (Table 1).

Recolección de datos. La densidad del tití en cada bosque fue estimada con el método de transectos lineales de ancho variable (6). En cada uno de los bosques, La reforma y Campo hermoso, se establecieron dos trochas, separadas entre ellas por un mínimo de 500m (Tabla 1).

The access roads, human settlements and soil uses were identified in each forest (Figure 1). A sampling point was established in each observation, which was demarcated during the walks for the estimation of density.

Se identificaron en cada bosque, vías de acceso, asentamientos humanos y usos del suelo (Figura 1). Se procedió a establecer en cada observación un punto de muestreo, el cual fue demarcado durante los recorridos para la estimación de la densidad.

Table 1. Location and length of the transects established in two forest remnants: La Reforma and Campo Hermoso.

Area

T

Length (Km)

1

0.85

2

0.9

1

1

2

1

La Reforma (Ref)

Campo Hermoso (CH)

T=Transects

Start Coordinate

Group

End Coordinate

N 4º4’25,7”

N 4º4’21,6”

W 73º28’55”

W 73º28’30.5”

N 4º5’10.6”

N 4º5’3.6”

W 73º29’18.7”

W 73º29’46.9”

N 4º3’6.12”

N 4º3’7.6”

W 73º28’27.2”

W 73º28’54.8”

N 4º2’56.8”

N 4º2’58.37”

W 73º28’21.41”

W 73º27’49”

P= perpendicular distance S= Radial distance T= Distance linear transect

Figure 2. Variables measured during observation walks of Saimiri sciureus.

Astwood - Foraging density for squirrel monkey Saimiri sciureus

4161

The journeys to the samplings sites were carried out three days a week, twice a day, at 0500 HR and at 1000 HR and between 1400 HR and 1600 HR, since the activity peaks of the squirrel monkey occur at these hours (3.7). The walks were made at an average speed of 0.5 km/hour.

Los recorridos para los muestreos se realizaron tres días a la semana, dos veces por día, de las 0500 HR a las 1000 HR y entre las 1400 HR y 1600 HR, debido a que en estas horas se registran los picos de mayor actividad del tití (3,7). Los recorridos fueron realizados a una velocidad media de 0.5 km/hora.

The following information was recorded on each journey: perpendicular distance (P): animal detected to the transect line; radial distance (S): distance of the observer when detecting the animal (Figure 2); time of detection; distance in the transect; number of individuals and number of troops.

En cada recorrido, se registró la siguiente información: distancia perpendicular (P): animal detectado hasta la línea del transecto; distancia radial (S): distancia del observador al momento de ser detectado el animal (Figura 2); hora de detección; distancia en el transecto; número de individuos y número de tropas.

Statistical analysis. The size and shape of the patches, degree of isolation, scattering, interaction and heterogeneity were evaluated through digital cartographic analysis of the vegetation cover map of the IGAC (8) and Landsat images (Figure 1) in order to estimate the degree of alteration in each forest.

Análisis estadístico. Para estimar el grado de alteración en cada bosque fueron evaluados tamaño y forma de los parches, grado de aislamiento, dispersión, interacción y heterogeneidad a través del análisis cartográfico digital del mapa de coberturas vegetales del IGAC (8) e imágenes Landsat (Figura 1).

Each of the above named features were calculated through indexes: shape index (Di) that connects the size and shape of patches; isolation index of a patch (ri) which connects the distance between patches; isolation index of all patches (ai) which shows the degree of isolation of all patches and also the interaction index between patches (Ii), all such calculated according to the formulas proposed

by Gonzalez et al (9).

Identification of flora. The tree species used by primates and the plant composition they were feeding from (fruit, young leaves or flowers) were marked and identified using the methodology employed by Dueser and Shugart Jr (10), the species preferentially used as refuge were also identified. The height in the tree or shrub at which the animals were found and the activity carried out at the time of the observation (11) were noted in each sighting. Some trees that provided food were marked to perform phonological follow-up.

RESULTS The forest fragments studied were limited to small trails on the edge of water bodies that, in most cases, were not even within the provisions of the Law in terms of conservation and maintenance of vegetation around streams as provided for by Decree 877/1976 issued by the Ministry of Agriculture of Colombia. The patches showed irregular shapes mainly due to the high intervention to which they are subjected in addition to the low connectivity between the same (Figure 1). In the vicinity of these forests, the land is mainly used for cattle ranching and the cultivation of African palm. In addition, in the

Cada una de las características anteriormente nombradas fueron calculadas a través de índices: índice de forma (Di) que relaciona el tamaño y la forma de los parches; índice de aislamiento de un parche (ri) el cual relaciona la distancia entre los parches; índice de aislamiento de todos los parches (ai) que muestra el grado de aislamiento de todos los parches e igualmente el índice de interacción entre parches (Ii), todos ellos calculados siguiendo las formulas propuestas por González et al (9).

Identificación de la flora. Utilizando la metodología empleada por Dueser y Shugart Jr (10) se marcaron e identificaron las especies de los árboles que eran utilizados por los primates como alimento y cuál era la composición vegetal de la cual se estaban alimentando (frutos, hojas jóvenes o flores), igualmente se identificaron las especies usadas preferencialmente como refugio. En cada avistamiento se anotaron, la altura en el árbol o arbusto en la cual se encontraron los animales y la actividad realizada al momento de la observación (11). Algunos árboles que suministraban alimento fueron marcados para realizar un seguimiento fenológico.

RESULTADOS Los fragmentos de bosque estudiados se limitaron a pequeños senderos a la vera de los cuerpos de agua que en la mayoría de ocasiones ni siquiera se encontraban dentro de las disposiciones de Ley en términos de conservación y mantenimiento de la vegetación en rondas de caños tal como lo prevé el Decreto 877 de 1976 del Ministerio de Agricultura de Colombia. Los parches presentaron formas irregulares principalmente por la alta

4162

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

proximity to the forest of La Reforma there is an hydrocarbon processing plant.

The results for the rate of encounters (ER), estimated density of the troops (DS) and density of animals per hectare in each sampling area (D) are listed in figure 3. The highest values for the three variables were observed in transect number two of La Reforma. However, it is possible that there is some overpopulation phenomenon occurring there.

80 70

ER DS

60

D

Hectare

40 30 20 10 0 2 Ref

1CH

2 CH

Figure 3. Densities calculated for populations of Saimiri sciureus in the transects made.

When analyzing the rates of encounter of troops or groups calculated for each area, a tendency to increase in proportion to the perpendicular distance in meters was observed.

Within the alteration indices of forest fragments, the shape index (Di) showed that the fragments analyzed had an irregular shape and were far from Euclidean parameters (Table 2). In terms of the isolation between patches (ri), it was observed that the fragment where transect 1 of La Reforma is located showed the greatest separation with neighboring patches (Figure 4).

However, the isolation index of all patches (ai) showed that the area with the greatest isolation with all patches within the landscape is the fragment where transect 2 of La Reforma is located. Finally, the index of interaction between patches (Ii) allowed detecting that the fragment Table 2. Degree of landscape alteration through the analysis of satellite images.

Area La Reforma Campo Hermoso

Los resultados para la tasa de encuentros (ER), densidad estimada de las tropas (DS) y densidad de animales por hectárea en cada zona de muestreo (D) se encuentran relacionados en la figura 3. En el transecto número dos de La Reforma, se observaron los mayores valores para las tres variables. Sin embargo, es posible que allí se esté presentando algún fenómeno de sobrepoblación.

Al analizar las tasas de encuentro de tropas o grupos calculados para cada zona, se evidenció una tendencia a aumentar de manera proporcional a la distancia perpendicular en metros.

50

1 Ref

intervención a la cual estos se ven sometidos, además, de la baja conectividad entre ellos (Figura 1). En inmediaciones de estos bosques, la tierra es usada principalmente para ganadería extensiva y cultivo de palma africana. Además, en cercanías al bosque de La reforma existe una central de manejo de hidrocarburos.

Transect

Di

ri

ai

Ii

1

2.33

0.0006

542.6

1.76

2

2.66

0.0002

1049.6

2.06

1y2

2.57

0.0003

996.2

25.84

Dentro de los índices de alteración de los fragmentos de bosque, el índice de forma (Di), expresó que los fragmentos analizados presentaron una forma irregular y se alejaron de cualquiera de los parámetros euclidianos (Tabla 2). En cuanto al aislamiento entre los parches (ri), se observó que el fragmento donde se encuentra ubicado el transecto 1 de La Reforma, es el que presentó mayor separación con los parches vecinos (Figura 4).

Sin embargo, el índice de aislamiento de todos los parches (ai), mostró que la zona con mayor aislamiento con todos los parches dentro del paisaje, es el fragmento donde se encuentra ubicado el transecto 2 de La Reforma. Finalmente, el índice de interacción entre parches (Ii), permitió detectar que el fragmento de Campo Hermoso, presentó un mayor grado de interacción con sus parches vecinos al compararlo con los otros fragmentos analizados.

Durante los recorridos de los transectos se encontró que las especies utilizadas preferencialmente como refugio y como fuente alimenticia: Bellucia grossularioides, Eugenia jambos, Inga alba, Mauritia flexuosa, Pseudolmedia laevis y Rollinia edulis (Tabla 3).

Es importante destacar que durante el transcurrir del tiempo, la mayoría de especies van cambiando su estado fenológico de manera asincrónica, por tal razón, el abastecimiento de alimento para los primates es dinámico en términos de la parte de la planta disponible en una época determinada (Flor, fruto, hoja), pero constante en el sentido de que los animales siempre cuentan con algún recurso para su alimentación, que es además, relativamente abundante.

4163

Astwood - Foraging density for squirrel monkey Saimiri sciureus

Table 3. Number of trees used as food sources and/ or refuge in the fragments analyzed.

0.0007

Patches separation

0.0006

Transect

0.0005

Species

Foraging # Trees

Refuge # Trees

Bellucia grossularioides

5

4

0.0004

Eugenia jambos

5

0

0.0003

Guatteria recurvisepala

5

0

0.0002

Inga alba

5

2

Mauritia flexuosa

2

4

Pseudolmedia laevis

5

0

Rollinia edulis

4

2

Alchornea triplinervia

0

3

Bellucia grossularioides

3

0

Eugenia jambos

3

0

Inga alba

3

2

Inga edulis

4

0

Mauritia flexuosa

3

3

Pseudolmedia laevis

1

3

Virola sebifera

0

2

Alchornea triplinervia

0

4

Bellucia grossularioides

5

3

Casearia javitensis

2

0

Eugenia jambos

5

3

Guatteria recurvisepala

2

2

Inga alba

5

0

Mauritia flexuosa

4

3

Pseudolmedia laevis

3

3

Bellucia grossularioides

4

0

Inga alba

3

1

Inga edulis

5

0

Mauritia flexuosa

2

3

Pseudolmedia laevis

2

2

Virola sebifera

0

5

Xylopia aromatica

3

0

Zygia basijuga

3

0

Ref 1

0.0001 0.0000 1

2 La Reforma

1y 2

Ref 2

Campo Hermoso

Figure 4. Patch isolation index (ri).

of Campo Hermoso had the greatest degree of interaction with its neighboring patches when compared with other fragments analyzed.

During the walks of the transects it was found that the species preferentially used as refuge and as food source were: Bellucia grossularioides, Eugenia jambos, Inga alba, Mauritia flexuosa, Pseudolmedia laevis and Rollinia edulis (Table 3).

It is worth noting that during the passing of time, most species are changing their phenological condition asynchronously, for this reason, the supply of food for primates is dynamic in terms of the part of the plant available at a given time (flower, fruit, leaf), but constant in the sense that animals always have some resource for feeding, which is also relatively abundant.

CH 1

CH 2

Ref: Reforma; CH: Campo Hermoso

DISCUSSION

DISCUSIÓN

Due to the low degree of conservation of the fragments, transects were established within vegetation strips round a body of water. Despite the fact that Buckland et al (6) recommend that transects are established perpendicularly to avoid having a bias toward the greater abundance of resources in said strips, it was not performed in this way because transects are located in open areas of grasslands where it is not possible to collect data related to the density of primates.

Similarly, the area was not enough to locate the five trenches proposed, separated at least by 500 meters.

Debido al bajo grado de conservación de los fragmentos, se establecieron transectos dentro de las franjas de vegetación de ronda de un cuerpo de agua. A pesar que Buckland et al (6) recomiendan que los transectos se establezcan de manera perpendicular para evitar el sesgo de mayor abundancia de recursos en dichas franjas, no fue realizado de esta manera, porque los transectos habrían quedado ubicados en las áreas abiertas de pastizales donde no es posible recolectar datos de densidad de primates. Igualmente el área no fue suficiente para ubicar las cinco trochas propuestas, separadas al menos por 500 metros.

With regard to the conditions of conservation of the forests, the establishment of cattle farms in the area of La Reforma typifies the area as of high intervention with forest presence between 11-20% of the landscape and in the area of the farm Campo Hermoso, and as of low intervention with forest presence of 3140%. Such information is consistent with what was observed in the results obtained during

Con respecto a las condiciones de conservación de los bosques, el establecimiento de ganaderías en la zona de La Reforma tipifican el área con alta intervención con una presencia del bosque entre 11 – 20% del paisaje y en la zona de la hacienda Campo Hermoso, una baja intervención con una presencia entre el 31 – 40% de bosque. Tal información es consecuente con lo observado en los resultados obtenidos durante el presente estudio,

4164

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

this study, being directly related to the density values obtained (Figure 3). Thus, the density of specimens per hectare in two transects of Campo Hermoso (21.6 and 29 animals/Ha) is more in line with the amounts of the available habitats than in the area of La Reforma (20.6 and 72.7 animals/Ha) if taking into account that the area of the latter is substantially smaller.

relacionándose directamente con los valores de densidad obtenidos (Figura 3). Así, la densidad de individuos por hectárea en los dos transectos de Campo Hermoso (21.6 y 29 animales/ha), está más acorde con las cantidades del hábitats disponibles que en la zona de La Reforma (20.6 y 72.7 animales/ha) si se tiene en cuenta que el área de ésta última es sustancialmente menor.

If strictly observing the numbers of the rates of encounters and density in the area of La Reforma, especially in the transect 2, it may be possible to think that by having a density close to and/or above that of Campo Hermoso, the condition of the populations is more favorable; however, the high values for the shape index (Di), the isolation index with respect to a patch and all patches (ai) and the interaction index (Ii) (Table 2), allow observing the little connectivity of vegetation fragments in La Reforma and therefore argue that rather than a higher density of individuals per area unit, what is observed is a clear process of overcrowding due to the high reproduction capacity of Saimiri sciureus (12, 13). As the gaps of small forests grow larger, there is an increase in the rates of extinction and a decrease in the recolonization by fragmentation of the habitat (14). Even under unfavorable conditions; this is a phenomenon that could trigger, in the short term, health problems within the population, with a potential risk for human beings in terms of public health

Si se observan estrictamente los números de tasas de encuentro y densidad en el área de La Reforma, especialmente del transecto 2, podría pensarse que por presentar una densidad cercana y/o superior a la de Campo Hermoso, la condición de las poblaciones es más favorable; sin embargo, los altos valores para los índices de forma (Di), el índice de aislamiento con respecto a un parche y todos los parches (ai) y el índice de la interacción (Ii) (Tabla 2), permiten observar la escasa conectividad de los fragmentos de vegetación en La Reforma y por tanto argumentar que más que una mayor densidad de individuos por unidad de área, lo que se observa es un claro proceso de hacinamiento debido a la alta capacidad de reproducción de Saimiri sciureus (12, 13). A medida que se hacen mayores las separaciones de los pequeños bosques hay incremento en las tasas de extinción y una disminución de la recolonización por fragmentación del hábitat (14). Inclusive bajo condiciones desfavorables; fenómeno que podría desencadenar, a corto plazo, problemas de salud dentro de la población, con el potencial riesgo que tiene para el ser humano en términos de salud pública.

The troops of primates registered in transect 2 of La Reforma showed a higher average in the perpendicular distance of troop detection, this phenomenon may be related to increased competition for resources (12) and possible stress levels that this produces on animals, which are more cautious when there are humans walking through the forest floor, therefore they keep themselves farther away.

In terms of availability of resources, in the area of La Reforma, 10 tree species were recorded, belonging to eight families divided in the two transects. Likewise, there were 12 species in the area of Campo Hermoso belonging to 9 families. Defler (1) and Williams et al (12), reported that Saimiri sciureus exploits the food resources of the families Moraceae, Fabaceae, Flacourtiaceae, Melastomataceae, Annonaceae and Myrtaceae, among others, these observations are consistent with those made in this study, in which it was observed that species of the genera Bellucia (Melastomataceae), Eugenia (Myrtaceae), Guateria (Annonaceae), Inga (Fabaceae), Mauritia (Arecaceae), Pseudolmedia (Moraceae), Rollinia (Annonaceae), Alchornea (Euphorbiaceae), Virola (Myristicaceae), Casearia

Las tropas de primates registradas en el transecto 2 de La Reforma, presentaron un promedio más alto en la distancia perpendicular de detección de tropas, este fenómeno puede estar relacionado con una mayor competencia por recursos (12) y los posibles niveles de estrés que esto produce en los animales, los cuales son más cautelosos cuando algún ser humano camina por el suelo del bosque, por ello se mantienen más alejados.

En cuanto a disponibilidad de recursos, en el área de La Reforma, se registraron 10 especies de árboles, pertenecientes a ocho familias repartidas en los dos transectos. Asimismo, en el área de Campo Hermoso, se registraron 12 especies, pertenecientes a 9 familias. Defler (1) y Williams et al (12), reportan que Saimiri sciureus, explota recursos alimenticios de las familias Moraceae, Fabaceae, Flacourtiaceae, Melastomataceae, Annonaceae y Myrtaceae, entre otras, dichas observaciones están acordes con las presentes en este estudio, en las que se observó que especies de los géneros Bellucia (Melastomataceae), Eugenia (Myrtaceae), Guateria (Annonaceae), Inga (Fabaceae), Mauritia (Arecaceae), Pseudolmedia (Moraceae), Rollinia (Annonaceae), Alchornea

Astwood - Foraging density for squirrel monkey Saimiri sciureus (Flacourtiaceae), Xylopia (Annonaceae) and Zygia (Fabaceae), alternate their phenological stages, allowing the primate troops to enjoy a variety of food resources over time in Gallery forests with a lot of obstacles to predators and a adequate supply of insects, bats and lizards (15), as it occurs in agricultural landscapes (Table 3).

Coupled to this and although the graphics show, at first glance, some differences in the availability of food resources and shelter, no significant differences were found (p>0.05) in the means of any of the variables. This means that S. sciuerus uses all resources available on an equitable basis and for the results of this study there is no trend or marked preference towards any of them, neither for food nor shelter.

The relationship between abundance, frequency, dominance and basal area is proportional, which indicates that all species have a significant degree of importance to the structure of the patches and each species is therefore fundamental for the maintenance of the populations of S. sciureus.

The disappearance or isolation of primates entails important consequences since in their trophic niche they are important dispersers of seeds and modify the composition and distribution of forests. In addition, they have a very important role as insect controllers (3).

The serious transformation and fragmentation processes to which the forests and ecosystems of the area have been subject to were evident during the development of this study. This aspect is a neuralgic point and must be the epicenter of the conservation efforts, i.e. the permanence and health of the species’ population, not only of primates, but the rest of the fauna and flora inhabiting these forests, depends mainly on the implementation of strategies for the restoration of connectivity and the reestablishment of biological corridors that allow the networks for the transfer of energy and biomass of the system to work properly.

The size of squirrel monkey troops is positively associated with the percentage of the tree component, fruit supply, wet areas and the density of the edges in the ecotone and negatively with the presence of other primates, predators or the absence of insects (3). By preferring the secondary habitat, the mix of forests in different succession stages increases the vulnerability of the species by the presence of man and the indiscriminate use of agrochemicals.

4165

(Euphorbiaceae), Virola (Myristicaceae), Casearia (Flacourtiaceae), Xylopia (Annonaceae), y Zygia (Fabaceae), alternan sus estados fenológicos, permitiendo que las tropas de primates cuenten con variedad de recursos alimenticios a los largo del tiempo, en bosques de galería con gran cantidad de obstáculos a predadores y buena oferta en insectos, murciélagos y lagartijas (15), como ocurre en agropaisajes (Tabla 3).

Sumado a esto, y aunque en los gráficos citados se encuentren, a primera vista, algunas diferencias en cuanto a la disponibilidad de recursos de alimento y refugio, no se encontraron diferencias significativas (p>0.05), en las medias de alguna de las variables.

Quiere decir esto, que S. sciuerus, utiliza de manera equitativa todos los recursos disponibles y para los presentes resultados, no existe una tendencia o una preferencia marcada hacia alguno de ellos, ni para alimento, ni para refugio.

La relación entre abundancia, frecuencia, dominancia y área basal es proporcional, lo que índica que todas las especies presentan un grado significativo de importancia para la estructura de los parches y por tanto cada especie es fundamental para el mantenimiento de las poblaciones de S. sciureus.

La desaparición o aislamiento de primates tiene grandes consecuencias ya que por su nicho trófico son dispersores importantes de semillas, modifican la composición y distribución de los bosques.

Además, tienen un papel muy importante como controladores de insectos (3).

Durante el desarrollo del presente estudio se evidenciaron los procesos graves de transformación y fragmentación a los que se ha sometido a los bosques y ecosistemas de la zona. Dicho aspecto constituye un punto neurálgico y debe ser el epicentro de los esfuerzos de conservación, es decir, la permanencia y salud poblacional de las especies, no sólo de primates, sino del resto de la fauna y flora que habita en estos bosques, depende principalmente de la implementación de estrategias de restauración de la conectividad y el reestablecimiento de corredores biológicos que permitan que las redes de transferencia de energía y biomasa del sistema funcionen correctamente.

El tamaño en las tropas de Titi está relacionada positivamente con el porcentaje del componente arbóreo, oferta de frutos, áreas húmedas y la densidad de los bordes en el ecotono y negativamente con la presencia de otros primates, predadores o ausencia de insectos (3). Al preferir el hábitat secundario, la mezcla de bosques en diferentes etapas de sucesión, aumenta la vulnerabilidad de la especie por la presencia del hombre y el uso indiscriminado de agroquímicos.

4166

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

Finally, the results obtained in terms of phenological and structural dynamics in the forest fragments under study allow establishing that despite the obvious ecological problem of these forests, it is still possible to induce nature through active restoration programs for strengthening the existing dynamics and balance the biogeochemical dynamics of the ecosystem in a relatively short period of time, so that the socioeconomic human activities already established supporting the population are not contrary to the conservation efforts and vice versa.

Finalmente, los resultados obtenidos en cuanto a dinámica fenológica y estructural de los fragmentos de bosque estudiados permiten establecer que a pesar del evidente problema ecológico de estos bosques, aún es posible inducir a la naturaleza a través de programas de restauración activa para fortalecer esa dinámica aún existente y equilibrar en un tiempo relativamente corto la dinámica biogeoquímica del ecosistema, de manera tal, que las actividades antrópicas socio-económicas ya establecidas, que sustentan a la población, no vayan en contraposición de la conservación y viceversa.

Acknowledgements

Agradecimientos

This article is part of agreement 28205-007, Minutes 03. Cormacarena - Research institute (IIOC) of Universidad de los Llanos. The authors also thank Javier Hernandez (r.i.p.), for his fieldwork and Mauricio Torres M. for his unconditional support.

Este artículo hace parte del convenio 28205-007, Acta 03. Cormacarena- instituto de investigaciones (IIOC) de la Universidad de los Llanos. Los autores también agradecen a Javier Hernández (q.e.p.d.), por su trabajo en campo y a Mauricio Torres M. por su apoyo incondicional.

REFERENCES 1.

Defler TR. Historia natural de los primates colombianos. 2da edición. ed. Bogotá: Universidad Nacional de Colombia. Facultad de Ciencias. Departamento de Biología; 2010.

2.

IUCN. The IUCN Red List of Threatened Species: International Union for Conservation of Nature and Natural Resources; 2003. Available URL: http://www.iucnredlist.org/details/41537/0.

3.

Solano D, Wong G. Hábitat y población de mono tití (Cebidae: Saimiri oerstedii oerstedii) en la península de Osa, Costa Rica. Ambientales 2009; 38:33-46.

4.

Ruiz-García M, Leguizamón N, Vásquez C, Rodríguez K, Castillo MI. Métodos genéticos para la reintroducción de monos de los géneros Saguinus, Aotus y Cebus (Primates: Cebidae) decomisados en Bogotá, Colombia. Rev Biol Trop 2010; 58(3):1049-67.

5.

Ruiz-García M, Castillo MI, Álvarez D, Gardeazabal J, Borrero LM, Ramírez DM, et al. Estudio de 14 especies de primates platirrinos (Cebus, Saimiri, Aotus, Saguinus, Lagothrix, Alouatta y Ateles), utilizando 10 loci microsatélites: análisis de la diversidad génica y de la detección de cuellos de botella con propósitos conservacionistas. Rev Orinoquia 2007; 11:19-37.

6.

Buckland ST, Plumptre AJ, Thomas L, Rexstad EA. Design and analysis of line transect surveys for primates. Int J Primatol 2010; 31(5):833-47.

7.

Leonardi R, Buchanan-Smith HM, Dufour V, MacDonald C, Whiten A. Living together: behavior and welfare in single and mixed species groups of capuchin (Cebus apella) and squirrel monkeys (Saimiri sciureus). Am J Primatol 2010;72(1):33-47.

8.

IGAC. Cartographer Cobertura y uso de las Tierras. [en linea]. Colombia: IGAC; 2005. URL Disponible en: http://geoportal.igac.gov.co/ssigl2.0/visor/ galeria.req?mapaId=9&title=Cobertura%20 uso%20de%20la%20tierra.

9.

González DU, Estrada E, Cantú-Ayala C. Análisis de fragmentación en colonias del perrito llanero mexicano (Cynomys mexicanus). Ciencia-UANL 2012; 15(57):43-9.

10. Dueser RD, Shugart Jr HH. Microhabitats in a forest-floor small mammal fauna. Ecology 1978; 59(1):89-98.

11. Gómez-Posada C. Dieta y comportamiento alimentario de un grupo de mico maicero Cebus apella de acuerdo a la variación en la oferta de frutos y artrópodos, en la Amazonía colombiana.

Acta Amazónica 2012; 42(3):363-72.

Astwood - Foraging density for squirrel monkey Saimiri sciureus

4167

12. Williams LE, Brady AG, Abee CR. Squirrel monkeys. The UFAW Handbook on the Care and Management of Laboratory and Other Research Animals, Eighth Edition 2010: 564-78.

14. Manel S, Schwartz MK, Luikart G, Taberlet P. Landscape genetics: combining landscape ecology and population genetics. Trends Ecol Evol 2003; 18(4):189-97.

13. Trevino HS. Seasonality of reproduction in captive squirrel monkeys (Saimiri sciureus). Am J Primatol 2007; 69(9):1001-12.

15. Guisan A, Thuiller W. Predicting species distribution: offering more than simple habitat models. Ecol Lett 2005;8(9):993-1009.

Rev.MVZ Córdoba 19(2):4168-4174, 2014. ISSN: 0122-0268 SHORT COMMUNICATION

Mercury in Pelecanus occidentalis of the Cispata bay, Colombia Mercurio en Pelecanus occidentalis de la bahía de Cispatá, Colombia Saudith Burgos N,1* Quim, José Marrugo N,1 Ph.D, Amado Navarro F,2 Ph.D, Ivan Urango C,1 Quim.

Universidad de Cordoba, Faculty of Basic Sciences and Engineering, Research Group of Waters, Applied Chemistry and the Environment. Carrera 6 No. 76-103. Monteria - Colombia. 2Universidad Tecnologica de Izucar de Matamoros. Extension to Reform 168, Barrio de Santiago Mihuacan, Izucar de Matamoros, Puebla, Mexico. *Correspondence: saubur1224@hotmail.com.

1

Received: September 2012; Accepted: October 2013.

ABSTRACT Objective. Assessment the total concentration of mercury in the liver and feathers of Pelecanus occidentalis of the Cispata bay, Colombia. Materials and methods. Mercury concentrations in liver and feather of Pelecanus occidentalis residents in the Cispata bay – Colombia were evaluated by digestion with an acidic mixture of H2SO4–HNO3 and KMnO4 to eliminate organic matter. The concentration of mercury was determined by the Atomic Absorption - Cold Vapor method (CVAAS). Results. Total mercury levels found in this study were higher in feathers (0.31-9.17 mgHg/kg) than in the liver (0.63–6.29 mgHg/kg), being higher than those reported in other seabirds studies. Conclusions. The high levels of total mercury in feathers and liver can be explained by the feeding habits of the organisms under study, showing the utility of feathers as a potential non-invasive tool for the monitoring of the ecosystem and thereby preventing the sacrifice of specimens.

Key words: Aquatic ecosystem, chemical analysis, marine pollution (Source: UNESCO).

RESUMEN Objetivo. Evaluar las concentraciones de mercurio total en hígado y plumas de Pelecanus occidentalis de la Bahía de Cispatá, Colombia. Materiales y métodos. Se evaluó la concentración de mercurio en hígado y plumas de Pelecanus occidentalis pertenecientes a la bahía de Cispatá – Colombia, por digestión con una mezcla ácida de H2SO4–HNO3 y KMnO4 para eliminar la materia orgánica. La concentración de mercurio fue determinada por el método de Absorción Atómica - Vapor Frio (CVAAS).

Resultados. Los valores de mercurio total fueron más altos en plumas (0.31-9.17 mgHg/kg) que en hígado (0.63–6.29 mgHg/kg), siendo mayores a los reportados en otros estudios de aves marinas.

Conclusiones. Las altas concentraciones de mercurio total en plumas e hígado pueden ser atribuidas a la dieta de los organismos estudiados; demostrando la utilidad de las plumas como herramienta potencial no invasiva de monitoreo del ecosistema y evitando con ello el sacrificio de los individuos.

Palabras clave: Análisis químico, contaminación marina, ecosistema acuático (Fuente: UNESCO).

4168

Burgos - Mercury in the liver and feathers of Pelecanus occidentalis

4169

INTRODUCTION

INTRODUCCIÓN

Seabirds are often utilized as indicators of the health of marine ecosystems and are frequently used to monitor mercury (Hg) concentrations in marine environments (1). Birds are an excellent bioindicator of metal contamination and can be used as effective and accurate monitors of metals for different reasons: (i) the birds are plentiful in number, (ii) have a wide range of geographical distribution, (iii) have different feeding habits and occupy different trophic levels, and (iv) many birds have a high longevity (2).

Las aves marinas a menudo son utilizadas como indicadoras de la salud de los ecosistemas marinos y frecuentemente usadas para monitorear las concentraciones de mercurio (Hg) en ambientes marinos (1). Las aves son un excelente bioindicador de la contaminación metálica y pueden ser usados como monitores efectivos y precisos de metales por diferentes razones: (i) las aves son abundantes en número, (ii) tienen un gran rango de distribución geográfica, (iii) presentan variados hábitos alimenticios y ocupan diferentes niveles tróficos, y (iv) muchas aves tienen alta longevidad (2).

The use of chemicals is increasing daily in the industry, pharmacy and at home. Aquatic environments are particularly vulnerable due to the rapid movement of contaminants in the water when compared to movement in terrestrial environments. The concentrations of many of these toxic substances are high in marine and coastal ecosystems due to the influence of rivers, runoff water, point sources of pollution, transport and atmospheric deposition (3, 4).

El uso de químicos se está incrementando diariamente en la industria, farmacia y en el hogar. Los ambientes acuáticos son particularmente vulnerables debido al rápido movimiento de los contaminantes en el agua, comparado con el movimiento en ambientes terrestres. Las concentraciones de muchos de estos tóxicos son elevadas en ecosistemas marinos y costeros debido a la influencia de los ríos, escorrentías, fuentes puntuales de contaminación, transporte y deposición atmosférica (3, 4).

The effects of pollutants on seabirds as on other organisms are the result of acute or chronic exposure. Acute exposure to a contaminant may have a different impact than the chronic ingestion of small amounts. For seabirds, the ingestion of food and water are the main routes of exposure (3).

Los efectos de los contaminantes sobre las aves marinas, como en otros organismos, son el resultado de la exposición que puede ser aguda o crónica. La exposición aguda a un contaminante puede tener un impacto diferente a la ingesta crónica de pequeñas cantidades. Para las aves marinas, la ingestión de alimentos y agua son las principales rutas de exposición (3).

Seabirds eliminate through the feather molt and a small proportion of the body burden is excreted in the manure or eggs. High mercury concentrations in birds affect the immune, detoxification and nervous systems. This article assesses the mercury concentrations in feathers and liver of Pelecanus occidentalis (pelican) collected in the Cispata bay, Colombia, which is an important biodiversity location.

Currently no study has been documented on mercury pollution on aquatic birds of the bay of Cispata - Colombia.

Las aves marinas eliminan mercurio a través de la muda y una pequeña proporción de la carga corporal es excretada en el guano o huevos. Las altas concentraciones de mercurio en aves afectan los sistemas inmune, de detoxificación y el nervioso.

En este artículo se evalúan las concentraciones de mercurio en plumas e hígado de Pelecanus occidentalis (pelicano) colectados en la bahía de Cispatá, Colombia, el cual es un importante sitio de biodiversidad.

Actualmente no se encuentra documentado algún estudio acerca de la contaminación por mercurio en aves acuáticas de la bahía de Cispatá - Colombia.

MATERIALS AND METHODS

MATERIALES Y MÉTODOS

Study area. The Cispata bay is located in the Colombian Caribbean coast, former delta of the river Sinu on the southwestern tip of the Gulf of Morrosquillo, which is part of the municipalities of San Antero and San Bernardo del Viento, Department of Cordoba (Figure 1). The geographical coordinates of the endpoints of the study area are: north latitude 9°25’12” and 9°20’8” and west longitude 75°47’37” and 75°55’30” (5).

Área de estudio. La bahía de Cispatá, se encuentra localizada en el Litoral Caribe colombiano, antiguo delta del río Sinú, en el extremo suroeste del Golfo de Morrosquillo, haciendo parte de los municipios de San Antero y San Bernardo del Viento, departamento de Córdoba (Figura 1). Las coordenadas geográficas de los puntos extremos del área objeto del estudio son: latitud norte 9°25’12’’ y 9°20’8’’ y longitud oeste 75°47’37’’ y 75°55’30’’ (5).

4170

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

Figure 1. Study area: Cispata Bay – Colombia

Sample collection. Pelecanus occidentalis were captured (n=10) during March 2010 and July 2011 in the Cispata bay, which included 6 young and 4 adult specimens, according to their morphometric variables such as weight, wingspan and beak length. The birds were euthanized and transported immediately to the laboratory for their dissection in order to separate the feathers and liver, which were tagged and packed in polythene bags. The latter were refrigerated until analysis. Permission for the capture and processing of birds was authorized by the local environmental authority (Corporación Autónoma Regional de los Valles del Sinú y del San Jorge, CVS).

Chemical analysis. Feather samples were washed with deionized water and acetone for eliminating free metals, they were then dried at 60°C for 48 h and the liver and feather samples were digested with a mixture of H2SO4-HNO3 (2:1, v/v) at 100-110°C for 3 h, and KMnO4 (5%, w/v) at 100°C for 30 min. The concentration of total mercury was measured using atomic absorption spectrophotometry with cold vapor (CVAAS) at a wavelength of 253.7 nm in a Thermo Electron spectrophotometer (6).

The detection limits for biological samples were 26.4 μg/kg dry for weight and 13.1 μg/kg for wet weight, respectively. The analytical quality

Colecta de muestras. Se capturaron Pelecanus occidentalis (n=10) durante marzo de 2010 y julio de 2011 en la bahía de Cispatá, que incluyeron 6 especímenes jóvenes y 4 adultos, de acuerdo con sus variables morfométricas, como peso, largo del ala y del pico. Las aves fueron eutanizadas y transportadas inmediatamente al laboratorio para su disección con el fin de separar las plumas e hígado los cuales fueron etiquetadas y empacadas en bolsas de polietileno.

Estos últimas fueron refrigerados hasta su análisis.

El permiso para la captura y procesamiento de las aves fue autorizado por la autoridad ambiental local (Corporación Autónoma Regional de los Valles del Sinú y del San Jorge, CVS).

Análisis químico. Las muestras de plumas fueron lavadas con agua desionizada y acetona con el fin de la eliminación del metales libres, posteriormente fueron secadas a 60°C durante 48 h las muestras de hígado y plumas fueron digeridas con una mezcla de H2SO4-HNO3 (2:1, v/v) a 100–110°C por 3 h, y KMnO4 (5%, p/v) a 100°C por 30 min. La concentración de mercurio total fue medida usando espectrofotometría de absorción atómica con vapor frío (CVAAS) a una longitud de onda de 253.7 nm en un espectrofotómetro Thermo Electron (6).

Los límites de detección para las muestras de plumas e hígado fueron de 26.4 μg/kg peso seco y 13.1 μg/kg peso húmedo, respectivamente. El control de calidad analítico fue realizado usando

Burgos - Mercury in the liver and feathers of Pelecanus occidentalis control was performed using certified reference material and doped samples. The concentrations of total mercury for the biological material (IAEA086; International Atomic Energy Agency) was 0.56±0.03 mg/kg (0.534-0.612 mg/kg certified value).

4171

material de referencia certificado y muestras dopadas. Las concentraciones de mercurio total para el material biológico (IAEA-086; Agencia De Energía Atómica Internacional) fue 0.56±0.03 mg/kg (0.534-0.612 mg/kg valor certificado).

Statistical analysis. Mercury data analyzed are presented as mean ± standard deviation. The results obtained were subjected to a normality test and Bartlett’s test to verify their distribution.

Since the data did not show a normal distribution, non-parametric statistics was used to make comparisons (Mant Whitney - Shapiro Wilk test) of the concentrations of metals found between juveniles and adults of the same and different species, all tests were performed at a significance level of p<0.05.

Análisis estadístico. Los datos del mercurio analizados son presentados como la media ± la desviación estándar. Los resultados obtenidos se sometieron a la prueba de normalidad y prueba de Bartlett, para verificar su distribución. Debido a que los datos no presentaron una distribución normal, se utilizó estadística no paramétrica para la realización de las comparaciones (prueba de Mant Whitney – Shapiro Wilk) de las concentraciones de metales halladas entre aves jóvenes y adultos de la misma y diferentes especies, todas las pruebas se realizaron a un nivel de significancia de p<0.05.

RESULTS

RESULTADOS

The concentrations of T-Hg in liver and feathers are shown in figure 2. The concentrations in feathers were in the range 0.31-9.17 mg/kg while in liver they were 0.63 - 6.29 mg/kg.

Las concentraciones de T-Hg en hígado y plumas se muestran en la figura 2. Las concentraciones en plumas estuvieron en un rango de 0.31-9.17 mg/kg, mientras que en hígado fueron de 0.63 – 6.29 mg/kg.

DISCUSSION Mercury in feathers can represent up to 93% of the accumulated body burden (7). High concentrations of mercury in feathers can be explained by the high affinity of this metal to keratin sulfhydryl groups (8). The concentrations of this metal in feathers above 5.0 mg/kg are associated with the reduction of reproduction (9), it is important to note that in this study the Hg levels found in both young and adult organisms evaluated are higher than this value and are above those reported in the literature for waterfowls. table 1 shows the comparison of the average concentrations found in this study and those of others conducted in different places of the world.

In the liver, total mercury concentrations can be explained by the ability of this organ to accumulate the metal as a result of the demethylase processes that take place in the same. The concentration of total mercury in birds is mainly due to the dietary habits of these organisms (15, 16); pelicans are

6 Concentration Hg (mg/kg)

Mercury concentrations in adult pelicans were higher than in young specimens and showed statistically significant differences (Z=2.17, p≤0.05). The results for mercury in feathers were greater than those found in liver with averages of 4.06 and 3.02 mg/kg, respectively. These values showed statistically significant differences (p≤0.05).

5

Feather Liver

4 3 2 1 0

P. occidentalis - young

P. occidentalis - Adult

Figure 2. Total mercury levels in liver and feathers of P. Occidentalis in the Cispata Bay Colombia.

Las concentraciones de mercurio en pelicanos adultos fueron mayores que en los jóvenes y presentaron diferencias estadísticamente significativas (Z=2.17, p≤0.05). Los resultados de mercurio en plumas fueron mayores a los hallados en hígado con promedios de 4.06 y 3.02 mg/kg, respectivamente. Estos valores mostraron diferencias estadísticamente significativas (p≤0.05).

DISCUSIÓN El mercurio en las plumas puede representar hasta el 93% de la carga corporal acumulada (7).

Las altas concentraciones de mercurio en plumas

4172

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

Table 1. Mercury Concentrations in the feathers and liver of waterfowls reported in the literature.

Species

Location

Feathers

Liver

Ref

Ardea alba

Nueva Jersey

2.61 ±0.529

-

(7)

Larus michahellis

Western Mediterranean

2.43 ±1.30

-

(10)

Mouth of the Yellow River, China

-

0.200 ±0.090

(11)

-

3.42 ± 0.54

Anas poecilorhyncha Ardea purpurea Phalacrocorax carbo

Lake Biwa, Japan

0.0028 ±0.0027

12 ±9

(12)

Cepphus Columba

Aleutian Islands, Alaska

2.41 ±0.297*

-

(13)

3.30 ±0.410**

-

Anas platyrhynchos

New Jersey Meadowlands

0.258 ±0.0418

40.9 ±6.72

(14)

Pelecanus occidentalis

Cispata Bay, Colombia

9.17 ±1.43

6.29 ±1.67

This study

* Birds not contaminated with crude oil. ** Birds contaminated with crude oil.

a piscivorous species mainly, in this context, their diet plays an important role in the accumulation of mercury (17).

Jakimska et al (18), found that the highest levels of mercury were recorded in the tissues of carnivorous marine birds evaluated in the study. Once the contaminant has been ingested it can be excreted directly or absorbed in the bloodstream; subsequently, the metal absorbed is carried and stored in white organs or stored in feathers (3). The content of mercury in the liver of young specimens was approximately five times lower than in adults. This fact can be explained by the limited ability of the biotransformation metabolism in young birds (6). Although mercury is a contaminant of interest in marine waters, the main source of mercury in the aquatic food chain comes from anthropogenic sources (7).

The bioavailability of mercury in sediments belonging to the study area was evidenced in the study developed by Paternina (19), who found that the exchangeable fraction of the metal reached 29%, a fact that would explain the passage of the contaminant from fish to birds.

The results found in this study were higher than those reported by Houserova et al (15) for the liver of Phalacrocorax carbo (3.40 mg/ kg) and by Paez-Osuna et al (11) for Pelecanus occidentalis in muscle (2.85 mg/kg).

It is important to highlight that this study represents the first documented report on

pueden ser explicadas por la gran afinidad de este metal hacia los grupos sulfhidrilo de la queratina (8). Las concentraciones de este metal en plumas por encima de 5.0 mg/kg están vinculadas a la reducción de la reproducción (9), es importante resaltar que para el presente estudio los niveles de Hg hallados tanto en los organismos jóvenes como adultos evaluados son superiores a este valor y se encuentran por encima de los registrados en la bibliografía para aves acuáticas. En la tabla 1 se muestra la comparación de las concentraciones promedio halladas en este estudio y las de otros realizados en diferentes lugares del mundo.

En hígado, las concentraciones de mercurio total pueden ser explicadas por la capacidad de este órgano para acumular el metal como consecuencia de los procesos de demetilación que son llevados en el mismo. La concentración de mercurio total en aves se debe principalmente a los hábitos alimenticios de estos organismos (15, 16); los pelicanos son una especie principalmente piscívora, en este contexto, su dieta juega un papel importante en la acumulación de mercurio (17).

Jakimska et al (18), encontraron que los niveles más altos de mercurio se registraron en los tejidos de las aves marinas carnívoras evaluadas en su estudio. Una vez ingerido el contaminante puede ser excretado directamente o absorbido en el torrente sanguíneo; subsecuentemente, el metal absorbido es llevado y almacenado en órganos blanco o secuestrado en las plumas (3). El contenido de mercurio en hígado de especímenes jóvenes fue aproximadamente 5 veces menor que en los adultos. Este hecho puede ser explicado por la limitada habilidad del metabolismo de biotransformación en las aves jóvenes (6). Aunque el mercurio es un contaminante de interés en las aguas marinas, la principal fuente de mercurio en la cadena alimentaria acuática proviene de fuentes antropogénicas (7).

La biodisponibilidad del mercurio en sedimentos pertenecientes a la zona de estudio fue evidenciada en el trabajo desarrollado por Paternina (19), quien encontró que la fracción intercambiable del metal alcanzó hasta el 29%, hecho que explicaría el paso del contaminante de los peces a las aves.

Los resultados encontrados en este estudio fueron mayores a los reportados por Houserova et al (15) para hígado de Phalacrocorax carbo (3.40 mg/kg) y por Páez-Osuna et al (11) para Pelecanus occidentalis en musculo (2.85 mg/kg).

Es importante resaltar que este este estudio representa el primer reporte documentado acerca de la contaminación por mercurio en aves acuáticas del Caribe colombiano, brindando valiosa información

Burgos - Mercury in the liver and feathers of Pelecanus occidentalis

4173

the contamination by mercury in aquatic birds of the Colombian Caribbean, providing valuable information on the status of this type of organisms in the Cispata bay - Colombia.

Mercury is the pollutant of greatest concern in the marine environment and this study verified the use of feathers as a non-invasive monitoring tool, as an alternative to the use of other tissues such as liver that can cause damage to the population of the organisms employed for environmental monitoring. This study confirms what has been found in many areas of Europe and in other continents, where birds have proven to be very useful Hg biomonitors, especially seabirds and waterfowls (20).

sobre el estado de este tipo de organismos de la Bahía de Cispatá – Colombia. El mercurio es el contaminante de mayor preocupación en el ambiente marino y en este estudio se comprobó el uso de plumas como herramienta no invasiva de monitoreo, como alternativa al uso de otros tejidos como hígado que pueden causar daño a la población de los organismos empleados para el monitoreo ambiental. Con este estudio se confirma lo encontrado en muchas zonas de Europa, y también en otros continentes, donde las aves han demostrado ser muy útiles como biomonitores de Hg, especialmente marinas y aves acuáticas (20).

Acknowledgements

A la Universidad de Córdoba por el apoyo financiero y al Grupo de investigación en Aguas Química Aplicada y Ambiental.

To the Universidad de Cordoba for its financial support and to the Research Group of Waters, Applied Chemistry and the Environment.

Agradecimientos

REFERENCES 1.

Bond A, Diamond A. Mercury concentrations in seabird tissues from Machias Seal Island, New Brunswick, Canada. Sci Total Environ 2009; 407:4340-4347.

2.

Zamani-Ahmadmahmood R, Esmaili A, Ghasempouri S, Savabieasfahani M. Mercury in wetland birds of Iran and Iraq: contrasting resident moorhen, Gallinula chloropus, and migratory Common Teal, Anas crecca, life strategies. B Environ Contam Tox 2009; 82:450-453.

3.

Burger J. Gochfeld. Marine birds as sentinels of environmental pollution. Eco Health 2004; 1:263-274.

4.

Burger J, Gochfeld M. Mercury and other metals in feathers of common eider (Somateria mollissima) and tufted puffin (Fratercula cirrhata) from the aleutian chain of Alaska. Arch Environ Contam Toxicol 2009; 56:596-606.

5.

Corporación de los Valles del Sinú y San Jorge CVS. Plan de manejo integral - Zona de uso sostenible del sector estuarino de la bahía de Cispatá. Departamento de Córdoba, Colombia. Montería, Colombia: Corporación Nacional de Investigación y Fomento Forestal – CONIF; 2005.

6.

Marrugo J, Benitez L, Olivero J. Distribution of mercury in several environmental Ccompartments in an aquatic ecosystem impacted by gold mining in northern Colombia. Arch Environ Contam Toxicol 2008; 55:305-316.

7.

Burger J. Temporal trends (1989–2011) in levels of mercury and other heavy metals in feathers of fledgling great egrets nesting in Barnegat Bay. Environ Res 2013; 122:11-17.

8.

Lucia M, Marc Andre J. Gontier K, Diot N, Veiga J, Davail S. Trace element concentrations (Mercury, Cadmium, Copper, Zinc, Lead, Aluminium, Nickel, Arsenic, and Selenium) in some aquatic birds of the southwest atlantic coast of France. Arch Environ Con Tox 2009. 58:844-53.

9.

Burger J, Tsipoura N, Newhouse M, Jeitner C, Gochfeld M, Mizrahi D. Lead, mercury, cadmium, chromium, and arsenic levels in eggs, feathers, and tissues of Canada geese of the New Jersey Meadowlands. Environ Res 2011; 111:775-784.

10. Ramos R, Ramirez F, Jover Ll. Trophodynamics of inorganic pollutants in a wide-range feeder: The relevance of dietary inputs and biomagnification in the Yellow-legged gull (Larus michahellis). Environ Pollut 2013; 172:235-242.

4174

REVISTA MVZ CÓRDOBA • Volumen 19(2) Mayo - Agosto 2014

11. Cui B, Zhang O, Zhang K, Liu X, Zhang H. Analyzing trophic transfer of heavy metals for food webs in the newly-formed wetlands of the Yellow River Delta, China. Environ Pollut 2011; 159:1297-1306.

12. Tanabe S, Nama D, Anan Y, Ikemoto T, Okabe Y, Kimb E, et al. Specific accumulation of 20 trace elements in great cormorants (Phalacrocorax carbo) from Japan. Environ Pollut 2005; 134:503-514.

13. Burger J, Gochfeld M, Sullivan K, Irons D. Mercury, arsenic, cadmium, chromium lead, and selenium in feathers of pigeon guillemots (Cepphus columba) from Prince William Sound and the Aleutian Islands of Alaska.

Sci Total Environ 2007; 387:175-184.

14. Burger J, Tsipoura N, Newhouse M, Jeitner C, Gochfeld M, Mizrahi D. Lead, mercury, cadmium, chromium, and arsenic levels in eggs, feathers, and tissues of Canada geese of the New Jersey Meadowlands. Environ Res 2011; 111:775-784.

15. Houserova P, Kuban V, Kracmar S, Sitko J. Total mercury and mercury species in birds and fish in an aquatic ecosystem in the Czech Republic. Environ Pollut 2007; 145:185-194.

16. Ruelas J, Paez F, Arvizu M. Mercury Distribution in Selected Tissues of Migratory and Resident Avifauna from Altata-Ensenada del Pabellón Lagoon, Southeast Gulf of California. Bull Environ Contam Toxicol 2007; 78:39-43.

17. Páez-Osuna F, Ruelas-Inzunza J, HernándezOsuna J. Organic and total mercury in muscle tissue of five aquatic birds with different feeding habits from the SE Gulf of California, Mexico. Chemosphere 2009; 76:415-418.

18. Jak i m s k a A, Ko n i e c z k a P, Sko ra K , Namiesnik J. Bioaccumulation of metals in tissues of marine animals, part II: metal concentrations in animal tissues. Environ Stud 2011; 20:1127-1146.

19. Paternina R. Evaluación de la contaminación por metales pesados en la Ciénaga la Soledad y Bahía de Cispatá, cuenca del Bajo Sinú, departamento de Córdoba [Tesis de Maestría]. Montería: Universidad de Córdoba; 2011.

20. Stankovic S, Kalaba P, Stankovic A. Biota as toxic metal indicators. Environ Chem Lett.

2013 jun. [Epub ahead of print]; 2(103).

Disponible en: http://link.springer.com/ article/10.1007/s10311-013-0430-6.

Revista MVZ Córdoba Instrucciones para los autores La Revista MVZ Córdoba es una publicación científica de la Facultad de Medicina Veterinaria y Zootecnia de la Universidad de Córdoba, Montería, Colombia. Se publican artículos de procedencia nacional e internacional que estén relacionados con las ciencias agropecuarias en la modalidad de artículos originales de investigación, revisiones de literatura, comunicaciones breves y casos clínicos. Los temas que publica la Revista MVZ Córdoba tienen correspondencia con la medicina veterinaria, zootecnia, acuicultura, biología, biotecnología, ciencias básicas biomédicas, salud pública y otros tópicos de interés de las ciencias agropecuarias.

La revista está dirigida a los profesionales de la medicina veterinaria, zootecnia, salud pública, epidemiología, acuicultura, biología, ciencias básicas biomédicas y biotecnología.

“La revista MVZ Córdoba apoya las políticas para registro de ensayos clínicos de la Organización Mundial de la Salud (OMS) y del International Committee of Medical Journal Editors (ICMJE), puesto que se reconoce la importancia de esas iniciativas para el registro y divulgación internacional de información sobre estudios clínicos, en acceso abierto. En consecuencia, desde el 2007, en la revista MVZ Córdoba solamente se publican los artículos de investigaciones clínicas que hayan recibido un número de identificación en uno de los Registros de Ensayos Clínicos validados por los criterios establecidos por OMS e ICMJE, cuyas direcciones están disponibles en el sitio web del ICMJE. El número de identificación se registra al final del resumen”.

Requisitos y normas generales para publicación de artículos Los interesados deberán enviar al editor, debidamente diligenciados y firmados por cada uno de los autores, los formularios: Presentación de artículos y autorevisión, los cuales se encuentran disponibles en el link: http://www.unicordoba.edu.co/ revistas/revistamvz/index.htm

Preparación de artículos El artículo debe ser redactado en tercera persona, escrito en procesador de palabras, a espacio sencillo, con letra verdana a 12 puntos, en una sola columna, con márgenes de 3 cm. El artículo, incluyendo tablas, figuras, referencias, leyenda de tablas y de figuras, no debe exceder las 6000 palabras para artículos originales y revisiones de literatura; 3000 para comunicaciones breves y casos clínicos. Se aceptan artículos en español e inglés y a partir del año 2015, deberán ser enviados en los dos idiomas, anexando la certificación de traducción que corresponda.

En el artículo se usará la palabra “Figura” para referirse a todas las ilustraciones (gráficas de datos, fotografías o dibujos originales). Las figuras deben ser de buena calidad, con trazos limpios, bien definidos y texto legible; y sus márgenes deben ser de máximo 1 cm. Las fotografías deben ser nítidas, bien enfocadas y con iluminación balanceada.

Todas las tablas y figuras deben ser tituladas, las tablas en la parte superior y las figuras en la parte inferior, numeradas y citadas en el artículo, sin recuadros. Las tablas no se admiten en formato de imagen y todas deben anexarse al final del texto en páginas separadas. El número máximo entre tablas y figuras será de 8. Cada figura debe enviarse por separado con las siguientes especificaciones: formato TIFF, resolución: 300 pixeles por pulgada y 16 cm de ancho.

En caso de incluir fotografías, se deben enviar los archivos originales e indicar la fuente, con los siguientes requerimientos: formato jpg, resolución de 180 pixeles por pulgada y 26 cm de ancho. Si se utiliza Microsoft Excel para gráficos de datos, se debe remitir el archivo en formato xls o xlsx.

Recepción y evaluación de los artículos Una vez recibido un artículo para posible publicación, se le comunicará formalmente al autor corresponsal su recepción y se verificará el cumplimiento de normas y requisitos. Concluida la etapa anterior, el artículo será enviado confidencialmente a dos árbitros externos a la institución mediante la modalidad de doble ciego para que lo evalúen.

Se recurrirá a un tercer árbitro en caso de discrepancia. En todos los casos se tomarán las medidas necesarias para que el artículo no presente elementos que permitan que los árbitros identifiquen a los autores. El editor será el único responsable de comunicar a los autores el resultado de la evaluación. El Comité Editorial y el editor se reservan el derecho de rechazar los artículos que no cumplan con los requisitos y las normas, así como el derecho de introducir (con la aprobación de los autores) los cambios editoriales inherentes a normas gramaticales, compaginación, maquetación y reparto del espacio editorial. Si el artículo es aprobado, se le enviará una prueba de galera al autor corresponsal, quien será el único responsable de socializar, corregir y aprobar la versión final del artículo junto con los coautores.

1.2. Autores: Son aquellos que participan en la planeación, ejecución, elaboración, discusión y escritura del artículo. El nombre de los autores se deberá escribir de la siguiente manera: El primer nombre, primer apellido y la inicial en mayúscula del segundo apellido seguida de coma, salvo excepciones de firmas registradas, de credo u otras. También se podrán incluir los dos apellidos unidos por un guión (Arrieta-Contreras) seguidos de coma y por un superíndice que indica la filiación de cada autor y el último título o grado académico obtenido por el autor (se requiere como mínimo el título de profesional o tecnólogo. No se aceptan candidaturas). Se utilizarán las siguientes abreviaturas según el caso: Especialización (Esp.), maestría (M.Sc.), doctorado (Ph.D.) o la abreviatura del título profesional. Se deberá indicar con un asterisco el autor corresponsal y escribir su correo electrónico, el cual aparecerá en el artículo y por tanto será público. La filiación institucional de los autores deberá ser jerarquizada: Institución, Facultad, Departamento, Instituto, Laboratorio, Grupo de estudio, etc., dirección postal, ciudad y país. Ejemplo: Determinación de bacterias ácido lácticas termoresistentes Determination of bacteria acid lactic thermoresistant

La revista MVZ Córdoba se acoge a los requisitos generales de uniformidad para revistas biomédicas (normas de Vancouver) con algunas modificaciones que se mencionan a continuación.

1. Estructura de los artículos originales: Los títulos se deben escribir en mayúscula sostenida, alineados a la izquierda y resaltados con negrita. Deben contener la siguiente información: 1.1. Título del artículo: Deberá ser escrito en español e inglés, en minúscula y resaltado con negrita, este último debajo del primero dejando doble espacio y en tamaño de 10 puntos. El título debe ser preciso e informativo, sin abreviaturas y de máximo 15 palabras.

Los nombres en latín se escribirán en cursiva.

Debe incluir debajo del título en inglés, un título abreviado del mismo en inglés, máximo de 8 palabras.

Lactic acid bacteria Mario Pérez B,1* Ph.D, Vanessa ArrietaContreras,2 M.Sc, Diva Almentero S,1 Lic. Universidad de Córdoba, Facultad de Medicina Veterinaria y Zootecnia, Instituto de Investigaciones Biológicas del Trópico, A.A. Nro. 354, Montería, Colombia. 2Lactoanálisis.

Calle 27 Nro. 18-62 Montería, Colombia. *Correspondencia: elcorreopig@servidor.com 1

1.3. Resumen: Debe ser estructurado y tener máximo 250 palabras y mínimo 150, escritas en un solo párrafo. Deberá ofrecer una idea clara del contenido del artículo incluyendo los subtítulos: objetivo, materiales y métodos, resultados y conclusiones, resaltados con negrita. Después de cada subtítulo se debe escribir un punto y seguido a partir del cual se inicia la redacción del texto de cada sección.

1.4. Palabras clave: Son términos cortos que definen el contenido del artículo, su clasificación y permiten localizarlo en un archivo automatizado. Se sugiere emplear seis palabras, como máximo, que no estén contenidas en el título del artículo, escritas en orden alfabético. Se deben usar los términos de la lista MeSH u otro tesauro acorde con el tema de investigación, tales como DeCS, BIREME, NLM, CAB thesaurus, AGROVOC thesaurus, tesauro de ASFA, tesauro de biología animal IEDCYT, tesauro ambiental para Colombia, National agricultural library, etc., e indicar al final de ellas, el o los tesauros utilizados escritos entre paréntesis y en cursiva así: Palabras clave: Extramedular, nódulos linfáticos, plasmocitoma (Fuentes: DeSC, CAB).

1.5. Abstract: Es el mismo resumen en español traducido al inglés; debe tener la misma estructura y contenido.

1.6. Key words: Deben ser las mismas palabras clave de español traducidas al inglés.

1.7. Introducción: Debe indicar claramente el propósito de la investigación, relacionando igualmente en forma selectiva la literatura pertinente. No se pueden incluir datos ni conclusiones del trabajo que se está dando a conocer. Esta sección deberá finalizar con el objetivo general.

1.8. Materiales y métodos: Se deben describir claramente los procedimientos empleados en la investigación, lo cual incluye diseño estadístico y análisis de datos.

Esta sección deberá ser estructurada (con subtítulos) para especificar tipo de estudio, sitio, condiciones geo-climáticas, coordenadas del sitio de estudio, pacientes o animales de estudio, métodos de laboratorio, aspectos éticos, análisis de resultados, etc. Los subtítulos deberán ser resaltados con negrita y después de cada uno de ellos se debe colocar un punto y seguido a partir del cual se inicia la redacción del texto.

1.8.1. Aspectos éticos: Se hará una breve descripción de los procedimientos de manejo de pacientes (humanos o animales)

y de los riesgos y las garantías de seguridad ofrecidas durante el estudio, de acuerdo con el tipo de investigación realizada. Se deberá declarar que la investigación solo se inició cuando se obtuvo la autorización de los entes implicados. Es necesario adjuntar el formulario de consentimiento informado de participantes (humanos), así como la certificación de la aprobación del proyecto emitida por el Comité de Ética. Los documentos de soporte deben ser escritos en papel membretado de la institución correspondiente y luego escaneados para su remisión.

A modo de ejemplo se cita el siguiente texto: “Las muestras fueron recolectadas por estudiantes de la Facultad de Medicina Veterinaria y Zootecnia, de la Universidad de Córdoba, quienes tuvieron en cuenta para los procedimientos de recolección de muestras, manejo y conservación, las normas éticas, técnicas, científicas y administrativas para la investigación en animales contenidas en la Ley 84 (Congreso Nacional de Colombia, 1989). Durante el estudio, se mantuvo la confidencialidad de la información de predios muestreados y animales positivos.

La investigación fue aprobada por el Comité de Ética del Instituto de Investigaciones Biológicas del Trópico de la Universidad de Córdoba, mediante la Resolución 012009 de febrero 1 de 2014”.

Además, en esta sección se deben citar las reglamentaciones existentes y vigentes de cada país, incluyendo producción limpia, conservación del medio ambiente, así como aquellas de regulación internacional de obligatorio cumplimiento global.

1.9. Resultados: Corresponde a la información de los hallazgos, pero sin incluir comentarios ni referencias a otros trabajos. Se sugiere utilizar tablas y figuras. Los resultados se deben expresar en tiempo pasado, anotando el nivel de significancia estadística entre paréntesis (p≤ 0.05, p≤0.01, p>0.05). Las tablas y figuras deberán citarse en esta sección en estricto orden. La citación en el texto se podrá hacer de dos maneras: a)... como se puede apreciar en la tabla 2; o b)…éxito de captura de 0.1313 individuos/horas-red (Tabla 1).

Las unidades de medida se citarán de acuerdo con el sistema métrico decimal y se deberá dejar un espacio entre el número y la unidad, excepto para los signos de porcentaje (%), grados centígrados (ºC) y pesos ($) que siempre irán unidos a la cifra. Las unidades de medida no deben ser usadas en plural ni llevar punto final (Ejemplo: kg en lugar de kgs, kg.). Cuando una unidad de medida rige para varios números, sólo acompañará al último valor (Ejemplo: 8 - 15 kg en lugar de 8 kg – 15 kg). Los decimales no se deben expresar con coma, sino con punto. Todos los compuestos y reactivos, así como los equipos utilizados, deberán incluir entre paréntesis la casa matriz productora, ciudad sede y estado o país (Ejemplo: Sigma, St. Louis, MO). No se deberán incluir nombres comerciales en el texto y siempre se hará referencia al principio activo.

1.10. Discusión: Es la interpretación de los resultados obtenidos y la contrastación de los mismos con estudios relacionados que hayan realizado otros autores. Se debe destacar las limitaciones del estudio y evitar especulaciones.

Es necesario incluir las conclusiones del estudio y las recomendaciones para futuras investigaciones.

1.11. Agradecimientos: Relacione el nombre de las personas, instituciones, empresas, laboratorios, fincas, etc., que hayan colaborado con la investigación (financiación, logística, etc.). Esta sección no es obligatoria, pero es recomendable. Tiene un máximo de 50 palabras.

1.12. Referencias: Deben numerarse consecutivamente según el orden en que se mencionen por primera vez en el texto, por medio de números arábigos entre paréntesis (1). En esta sección deben aparecer solamente aquellos artículos directamente relacionados con la investigación, para evitar revisiones bibliográficas extensas. Si un artículo tiene de uno a seis autores, en la referencia se deben incluir todos; pero si son más, después del sexto se escribe la expresión et al, la cual debe ir sin cursiva y sin puntuación (et al).

Los títulos de las revistas serán abreviados (nombre corto, sin puntuación) según el estilo empleado en el IndexMedicus. (http://www. ncbi.nlm.nih.gov/sites/entrez?db=journals).

La lista de referencias se presentará en una hoja aparte, en estricto orden de aparición en el texto, no en orden alfabético. Para los artículos originales se aceptarán hasta 30 referencias; para las revisiones de literatura, hasta 50 y para la presentación de casos clínicos y comunicaciones breves, hasta 15.

Los resúmenes de congresos, seminarios, eventos, cursos, presentaciones, informes técnicos, boletines, comunicaciones personales, consultas electrónicas no indexadas, monografías, sitios web, así como los trabajos de grado de pregrado, no se aceptan como referencias. Las referencias deben ser actualizadas y no mayores a 10 años de antigüedad. En caso de ser necesario, se podrán incluir con la debida justificación, pero no podrán sobrepasar el 20% del total de las referencias. Solamente se pueden incluir hasta dos referencias que sean de libros.

2. Comunicaciones breves: Deben tener el mismo contenido estructural de los artículos originales. La extensión será mínimo de 1.800 palabras y máximo de 3.000.

3. Casos clínicos: El contenido estructural es similar al de las comunicaciones breves, pero el resumen no es estructurado. Además, después de la introducción se incluirá la evaluación del paciente (subtítulos: anamnesis, hallazgos al examen clínico, ayudas diagnósticas, etc., resaltados con negrita), enfoque de tratamiento.

4. Revisiones de literatura: Consisten en un análisis crítico de la literatura publicada en torno a un tema de actualidad, interés y pertinencia para las ciencias pecuarias. Deben ajustarse a las normas anteriores, sin incluir las secciones de materiales y métodos, resultados y discusión; en su lugar, se utilizarán los títulos y subtítulos (resaltados con negrita) necesarios y relacionados con el tema que se aborda. Los autores deberán argumentar, sustentar o controvertir la información contenida en la revisión. Además, deberán hacer un aporte crítico sobre las fortalezas, debilidades y oportunidades de investigación del tema propuesto. Generalmente, el editor es quien hace la invitación a los autores expertos y reconocidos para que hagan estas contribuciones.

Derechos de impresión y copia: Los autores se comprometen a ceder a la Revista MVZ Córdoba los derechos de reimpresión del material publicado. La traducción o publicación parcial o total de la Revista requerirá del permiso escrito del editor. La Revista MVZ Córdoba y la Universidad de Córdoba no se responsabilizan por las opiniones y los resultados expresados por los autores. Los contenidos publicados en la Revista MVZ Córdoba están bajo la licencia “Atribución – Sin Derivar – No comercial” de Creative Commons, 3.0 cuyo texto completo se puede consultar en: http://co.creativecommons. org/tipos-de-licencias/.

Correspondencia: Nombre completo del autor corresponsal, dirección laboral y residencial, correo electrónico, teléfono celular y teléfono fijo. Esta información se debe diligenciar en el Formulario de declaración para los autores.

La Revista MVZ Córdoba se compromete con el manejo confidencial de la información suministrada por los autores.

Consultas: Deben ser realizadas exclusivamente por el autor corresponsal, quien será el único responsable de la comunicación administrativa con la revista, escribiendo siempre en el asunto del correo remisorio el nombre del artículo que se desea consultar, a los correos: editormvzcordoba@gmail.com, revistamvz@ unicordoba.edu.co y revistamvz@gmail.com.

Certificaciones: Serán expedidas a los árbitros una vez entreguen el dictamen del artículo. A los autores solo se entregarán cuando el artículo haya sido evaluado, aprobado y corregido para publicación. La Revista MVZ Córdoba no se compromete con la publicación diligente de artículos relacionados con la obtención de grados académicos (M.Sc., Ph.D.), fuentes de financiación, informes finales de proyectos de investigación, etc., y por lo tanto dichos artículos estarán sometidos a la misma reglamentación vigente.

Identidad de autores: Será manejada bajo estricta reserva por el equipo editorial de la revista. Los artículos retirados por los autores y los rechazados para su publicación por el Comité Editorial serán archivados en la base de datos histórica de la revista y sus contenidos no serán utilizados bajo ninguna circunstancia.

Plagio y autoplagio: Los autores deberán respetar y reconocer todas las fuentes de información en la obtención de datos, figuras, fotografías, etc., dando el crédito respectivo a los autores consultados. El incumplimiento de esta norma será causal de retiro inmediato del artículo cuando se descubra durante el proceso de sometimiento. En caso de detectarse con posterioridad a la publicación, bien sea por miembros de la revista o por el reclamo o denuncia de otros autores, la Revista MVZ Córdoba, previa verificación, publicará la correspondiente nota de retractación. La Revista MVZ Córdoba corregirá oportunamente los errores tipográficos o de otra índole que pudieran haberse presentado con la publicación de cualquier artículo. Se aceptarán solicitudes de retractación debidamente argumentadas.

Cambios en la autoría: Pueden ser por incorporación, supresión o modificación en el orden inicialmente remitido. En cualquier caso, el autor corresponsal deberá enviar una carta al editor, en la que justifique tales cambios y en la que aparezcan las firmas de los implicados.

En ningún caso los cambios serán permitidos después de la aprobación del artículo.

Comité Editorial de la Revista MVZ Córdoba Universidad de Córdoba, Facultad de Medicina Veterinaria y Zootecnia Teléfonos: (57) (4) 756 90 27 Montería - Colombia Editor: Marco González Tous. MVZ., M.Sc. editormvzcordoba@gmail.com. http://revistas.unicordoba.edu.co/revistamvz/.

Journal MVZ Córdoba Instructions to Authors The Journal MVZ Cordoba is a scientific publication of the Faculty of Veterinary Medicine and Zootechny of the University of Córdoba, Montería, Colombia. It publishes national and international articles related to the agricultural sciences in the form of original investigation, literature reviews, short communications and clinical cases.

The subjects that are published in Journal MVZ Córdoba correspond to veterinary medicine and zootechny, agriculture, biology, biotechnology, biomedical basic sciences, public health and other subjects of interest in agricultural sciences. The magazine is directed to professionals in veterinary and zootechny medicine, public health, epidemiology, aquaculture, biology, biomedical basic sciences and biotechnology.

“The Journal MVZ Cordoba follows the policies of the World Health Organization (WHO) and of International Committee of Medical Journal Editors (ICMJE), for clinical trials registration, recognizing the importance of those initiatives for international dissemination of information on clinical research, in open access. Therefore, since 2007 the Journal MVZ Córdoba only publishes articles from clinical investigations that have received an identification number in one of the Clinical Trial Registries validated by criteria established by WHO and ICMJE, whose addresses are available on the ICMJE website. The identification number is listed at the end of the abstract”.

Requirements and general guidelines for article publication Interested parties should send the following forms to the editor, duly filled out and signed by each one of the authors: Presentation of articles and self-review, which can be found in the link: http:// www.unicordoba.edu.co/revistas/ revistamvz/index.htm

Article preparation The article should be written in third person, using a word processor, single spaced, in 12 point Verdana Font, in one column with 3 cm margins. The article, including tables, figures, references, table and figure legends should not exceed 6.000 words for original articles and literature reviews; 3.000 for short communications and clinical cases. Articles in Spanish and in English are accepted and from 2015 they should be sent in the two languages, annexing the corresponding translation certificate.

In the article will use the word “Figure” to refer to all the illustrations (graphs, photographs and original drawings). The figures should be of good quality, with well defined, clean lines and legible text; margins should be maximum 1 cm. Photographs should be neat, in focus and with balanced lighting.

All tables and figures should have titles, tables in the upper part and figures in the lower part, numbered and cited in the article, without boxes. Tables in image format are not accepted and they all should be annexed at the end of the text in separate pages. The maximum amount of tables and figures will be 8. Each figure should be sent separately with the following specifications: TIFF format, resolution: 300 pixels per inch and 16 cm wide. When including photographs, original files should be sent, indicating the source, with the following requirements: jpg format, 180 pixels per inch and 26 cm wide. If Microsoft Excel is used for graphs, the file should be sent in xls or xlsx format

Receiving and evaluating articles When an article for possible publication is received, the corresponding author will be formally notified of the receipt of the article and

compliance with guidelines and requirements will be verified. After that step, the article will be confidentially sent to two referees, external to the institution, using the double blind method for evaluation. In case of discrepancy, a third referee will be used. In each case the necessary measures will be taken so that the article does not contain elements that allow the referees to identify the authors. The editor will be the only one responsible for communicating the result of the evaluation to the authors. The Editorial Committee and the Editor reserve the right to reject articles that do not comply with the requirements and guidelines, as well as the right to introduce (with the approval of the authors) editorial changes pertaining to grammatical rules, makeup, layout and distribution of editorial space. If the article is approved, a galley proof will be sent to the corresponding author, who will be the only one responsible for socializing, correcting and approving the final version of the article with the coauthors.

The Journal MVZ Cordoba conforms to the general uniformity guidelines for biomedical magazines (Vancouver style) with some modifications as mentioned below.

1. Structure of original articles: Titles should be capitalized, text left aligned and in boldface type. They should contain the following information: 1.1. Title of the article: This should be written in Spanish and English, in lower case and in bold, underneath the first line with double spacing and 10 point font. The title should be precise and informative, without abbreviations and a maximum of 15 words.

Names in Latin should be written in cursive.

Under the title in English an abbreviated title in English should be included with a maximum of 8 words.

1.2. Authors: Are those that participate in the planning, execution, preparation, discussion and writing of the article. The name of the authors should be written in the following way: The first name, first surname and the initial of the second surname in capitals followed by a comma, except in the case of registered signatures, creed or other types. Two surnames could be included if they are joined by a hyphen

(Arrieta-Contreras), followed by a comma and by a superscript that indicates the relationship of each author and the last title or academic degree obtained by the author (the professional or technologist title is required as a minimum. Candidates are not accepted). The following abbreviations will be used according to the case: Specialization (Esp.), Masters (M.Sc.), doctorate (Ph.D.) or the abbreviation of the professional title. The name of the corresponding author should be marked with an asterisk and the email should be included, which will appear in the article and will therefore be public. The institutional affiliation of the authors should be organized hierarchically: Institution, Faculty, Department, Institute, Laboratory, Study Group, etc., address, city and country.

Example: Determination of Thermo-resistant Lactic Acid Bacteria Determinación de bacterias ácido lácticas termoresistentes Lactic Acid Bacteria Mario Pérez B,1* Ph.D, Vanessa ArrietaContreras,2 M.Sc, Diva Almentero S,1 Lic. Universidad de Córdoba, Facultad de Medicina Veterinaria y Zootecnia, Instituto de Investigaciones Biológicas del Trópico, A.A. Nro. 354, Montería, Colombia.

2 Lactoanalysis. Calle 27 Nro. 18-62 Montería, Colombia. *Correspondence: elcorreopig@servidor.com 1

1.3. Abstract: It should be structured and have a maximum of 250 words and a minimum of 150, written in one paragraph.

It should offer a clear idea of the content of the article including subtitles: objective, materials and methods, results and conclusions, in boldface type. Each subtitle should be followed with a period and space, after which the text of each section should begin.

1.4. Key words: These are short terms that define the content of the article, classify it

and allow it to be found in an automated file. A suggestion is to use a maximum of six words that are not in the title of the article, written in alphabetical order. The terms in the MeSH list or another thesaurus should be used according to the subject of the investigation, such as DeCS, BIREME, NLM, CAB thesaurus, AGROVOC thesaurus, ASFA thesaurus, IEDCYT animal biology thesaurus, environmental thesaurus for Colombia, National Agricultural library, etc., and indicate at the end the thesaurus used, written in parenthesis and in italic type: Key words: Extramedullary, lymph nodes, plasmacytoma (Source: DeSC, CAB).

1.5. Resumen: This is the same summary in English translated to Spanish; it should have the same structure and content.

1.6. Palabras clave: These should be the same key words in English translated into Spanish.

1.7. Introduction: It should clearly indicate the purpose of the investigation, as well as selectively connecting pertinent literature.

Data and conclusions on the work that is being discussed should not be included. This section should end with a general objective.

1.8. Materials and methods: Procedures used in the investigation should be clearly described, including statistical design and data analysis. This section should be structured (with subtitles) to specify the type of study, location, geo-climatic conditions, study location coordinates, patients or animals in the study, laboratory methods, ethical aspects, results analysis, etc. Subtitles should be in boldface type, followed by a period and space, and then the text.

1.8.1. Ethical aspects: A brief description of the procedures for handling patients (humans or animals) and the safety risks and guarantees offered during the study according to the type of investigation carried out. It should be stated that the investigation began only after obtaining the authorization of the entities involved. The informed consent form of the participants (humans) and the approval certification

issued by the Ethical Committee should be annexed. Support documents should be on the letterhead of the corresponding institution and then scanned and sent in.

As an example, the following text is cited: “Samples were collected by students of the Faculty of Veterinary Medicine and Zootechny of the Universidad de Córdoba, who took into account the procedures for sample collection, handling and preservation, techniques, and the scientific, administrative and ethical standards for animal investigation contained in Law 84 (Colombian National Congress, 1989). During the study, the confidentiality of information about sampled farms and positive animals was maintained. The investigation was approved by the Ethical Committee of the Institute of Tropical Biological Investigations of the Universidad de Córdoba by means of Resolution 012009 on February 1, 2014”.

Additionally, in this section existing and in force regulations of each country should be cited, including clean production and preservation of the environment, as well as those pertaining to international regulations of compulsory global compliance.

1.9. Results: This is the information on the findings, without including comments or references from other studies. The use of tables and figures is suggested. The results should be expressed in the past, noting the level of statistical significance in parenthesis (p≤ 0.05, p≤0.01, p>0.05). Tables and figures should be cited in this section in strict order. Text citation could be done in two ways: a) …as can be seen in Table 2; or b) …capture success of 0.1313 individuals/ hours-network (Table 1).

Units of measurement will be cited according to the decimal metric system and a space between the number and the unit should be left except for percent signs (%), centigrade degrees (ºC) and pesos ($) which should always be next to the amount. Units of measurement should not be used in plural or have a final period (example: kg instead of kgs, kg.). When a unit of measurement is used for several numbers, only the last value will have the sign (example: 8 – 15 kg

instead of 8 kg â&#x20AC;&#x201C; 15 kg). Decimals should not be written with commas, but with periods.

All the composites, reagents and equipment used should include in parenthesis the main production company, headquarter city, state and country (example: Sigma, St. Louis, MO).

No commercial names should be included in the text and the active ingredient will always be referenced.

1.10. Discussion: This is the interpretation of the results obtained and comparison with related studies done by other authors. The limitations of the study should be highlighted and speculations avoided. Conclusions of the study and recommendations for future investigations should be included.

1.11. Acknowledgments: Relate the names of the people, institutions, businesses, laboratories, farms, etc., that have collaborated with the investigation (financing, logistics, etc.). This section is not obligatory though it is recommended.

Maximum 50 words.

1.12. References: These should be numbered consecutively according to the order they are first mentioned, using Arabic numerals in parenthesis (1). Only those articles directly related to the investigation should appear in this section in order to avoid extensive bibliography reviews. If an article has from one to six authors, all of them should be included in the reference; but if there are more, after the sixth one the expression et al should be written, in italics and without punctuation (et al). Journal titles will be abbreviated (short name, no punctuation) according to the style used in the IndexMedicus. (http://www.ncbi. nlm.nih.gov/sites/entrez?db=journals).

The list of references will be submitted on a separate page, in strict order as they appear in the text, not in alphabetic order.

For original articles up to 30 references will be accepted; for literature reviews, up to 50

and for the presentation of clinical cases and short communications, up to 15.

Summaries of conferences, seminaries, events, courses, presentations, technical reports, newsletters, personal statements, non-indexed electronic consultations, monographs, websites and undergraduate graduate work are not accepted as references. References should be up to date and not be older than 10 years. If necessary, they could be included with proper justification but cannot go beyond 20% of the total amount of references. Only two books can be included as references.

2. Short communications: These should have the same structural content as the original articles. Minimum 1.800 words and maximum 3.000.

3. Clinical cases: Structural content is similar to that of short communications, but the summary is not structured. Additionally, after the introduction an evaluation of the patient will be included (subtitles: anamnesis, clinical exam findings, diagnostic aids, etc., in boldface type), treatment approach.

4. Literature reviews: These consist of a critical analysis of literature published on a timely subject of interest and pertinent to animal sciences. The above guidelines should be adhered to, without including materials and methods, results and discussion sections; in its place, use the necessary titles and subtitles (in boldface type) related to the subject considered. Authors should discuss, sustain or dispute the information in the review. Additionally, they should make a critical contribution on the strengths, weaknesses and investigation opportunities of the proposed subject. Generally, the editor is the one that invites expert and known authors to make these contributions.

Printing and copy rights: Authors are bound to cede reprinting rights of the published material to Journal MVZ Córdoba.

Translation or partial or total publication of the magazine requires written permission from the Editor. The Journal MVZ Córdoba and the Universidad de Córdoba are not responsible for the opinions and results expressed by the authors. Content published in the Journal MVZ Córdoba are under the license “Attribution – No Derivs – Noncommercial” from Creative Commons, 3.0 whose complete text can be consulted in: http://co.creativecommons.org/tipos-delicencias/.

Correspondence: Complete name of the corresponding author, work and home address, email, cell phone and landline.

This information should be filled out on the Author declaration form. The Journal MVZ Córdoba will keep all information provided by the authors confidential.

Consultation: This should be done exclusively by the corresponding author, who will be the only one responsible for administrative communication with the Journal. The name of the article to be consulted should be included in the subject line of the email and sent to the following emails: editormvzcordoba@gmail. com, revistamvz@unicordoba.edu.co and revistamvz@gmail.com.

Certificates: These will be issued to the referees once the opinion on the article is delivered. These will only be issued to the authors when the article has been evaluated, approved and corrected for publication. The Journal MVZ Córdoba does not make any commitments to the speedy publication of articles related to obtaining academic degrees (M.Sc., Ph.D.), funding sources, final reports on investigation projects, etc., and therefore those articles will be subject to the same current regulations.

Identity of the authors: Will be held strictly confidential by the editorial team of the journal. Articles withdrawn by the authors and those rejected by the Editorial Committee for publication will be filed in the historic data base of the journal and its contents will not be used under any circumstances.

Plagiarism and self-plagiarism: Authors should respect and acknowledge all sources of information in obtaining data, figures, photographs, etc., giving respective credit to the consulted authors. Incompliance with this rule will cause the immediate withdrawal of the article when discovered during the submission process. In case of being detected after publication, whether by members of the journal or because of a complaint or report from other authors, the Journal MVZ Córdoba, after verification, will publish the corresponding retraction notice. Journal MVZ Córdoba will correct typographical or any other type of errors in any published article. Duly argued retraction requests will be accepted.

Changes in authorship: Can be due to incorporation, suppression or modification in the order initially sent. In any case the corresponding author should send a letter to the editor justifying such changes and include the signature of the involved parties. Under no condition will changes be allowed after the article is approved.

Editorial Committee of the Journal MVZ Cordoba Universidad de Córdoba, Facultad de Medicina Veterinaria y Zootecnia.

Telephone: (57) (4) 756 90 27 Montería - Colombia Editor: Marco González Tous. MVZ., M.Sc. editormvzcordoba@gmail.com. http://revistas.unicordoba.edu.co/ revistamvz/.