Tjh 2019 2 by LookUs Scientific

Issue 2

June 2019

E-ISSN: 1308-5263

Volume 36

Research Articles Tumor Necrosis Factor Alpha-308G/A Polymorphism and the Risk of Multiple Myeloma: A Meta-Analysis of Pooled Data from Twelve Case-Control Studies Yingchao Li and Yong Lin; Xiamen, China

Prognostic Factors in Elderly Patients with Diffuse Large B-Cell Lymphoma and Their Treatment Results Süleyman Cem Adıyaman et al.; İzmir, Turkey

Dose Adjustment Helps Obtain Better Outcomes in Multiple Myeloma Patients with Bortezomib, Melphalan, and Prednisolone (VMP) Treatment Su-Hee Cho et al.; Busan, Korea

Cover Picture: Monika Błocka-Gumowska, Justyna Holka, Olga Ciepiela, Warsaw, Poland Hypersegmentation of Granulocytes and Monocytes in a Patient with Primary Myelofibrosis Treated with Hydroxycarbamide

International Review Board

Editor-in-Chief Reyhan Küçükkaya

İstanbul, Turkey rkucukkaya@hotmail.com

Associate Editors

A. Emre Eşkazan

İstanbul University-Cerrahpaşa, İstanbul, Turkey

Ayşegül Ünüvar

İstanbul University, İstanbul, Turkey aysegulu@hotmail.com

Cengiz Beyan

Ufuk University, Ankara, Turkey cengizbeyan@hotmail.com

Hale Ören

Dokuz Eylül University, İzmir, Turkey hale.oren@deu.edu.tr

İbrahim C. Haznedaroğlu

Hacettepe University, Ankara, Turkey haznedar@yahoo.com

M. Cem Ar

İstanbul University-Cerrahpaşa, İstanbul, Turkey mcemar68@yahoo.com

Selami Koçak Toprak

Ankara University, Ankara, Turkey sktoprak@yahoo.com

Semra Paydaş

Çukurova University, Adana, Turkey sepay@cu.edu.tr

Şule Ünal

Hacettepe University, Ankara, Turkey

Assistant Editors Ali İrfan Emre Tekgündüz

Dr. A. Yurtaslan Ankara Oncology Training and Research Hospital, Ankara, Turkey

Claudio Cerchione

University of Naples Federico II Napoli, Campania, Italy

Elif Ünal İnce

Ankara University, Ankara, Turkey

İnci Alacacıoğlu

Dokuz Eylül University, İzmir, Turkey

Müge Sayitoğlu

İstanbul University, İstanbul, Turkey

Nil Güler

Ondokuz Mayıs University, Samsun, Turkey

Olga Meltem Akay

Koç University, İstanbul, Turkey

Veysel Sabri Hançer

İstinye University, İstanbul, Turkey

Zühre Kaya

Gazi University, Ankara, Turkey

A-I

Nejat Akar Görgün Akpek  Serhan Alkan  Çiğdem Altay  Koen van Besien  Ayhan Çavdar M. Sıraç Dilber  Ahmet Doğan  Peter Dreger  Thierry Facon Jawed Fareed  Gösta Gahrton  Dieter Hoelzer  Marilyn Manco-Johnson Andreas Josting Emin Kansu  Winfried Kern  Nigel Key  Korgün Koral Abdullah Kutlar Luca Malcovati  Robert Marcus  Jean Pierre Marie Ghulam Mufti Gerassimos A. Pangalis Antonio Piga Ananda Prasad Jacob M. Rowe Jens-Ulrich Rüffer Norbert Schmitz Orhan Sezer  Anna Sureda Ayalew Tefferi Nükhet Tüzüner Catherine Verfaillie Srdan Verstovsek Claudio Viscoli

TOBB Economy Technical University Hospital, Ankara, Turkey Maryland School of Medicine, Baltimore, USA  Cedars-Sinai Medical Center, USA  Ankara, Turkey Chicago Medical Center University, Chicago, USA Ankara, Turkey  Karolinska University, Stockholm, Sweden  Mayo Clinic Saint Marys Hospital, USA Heidelberg University, Heidelberg, Germany Lille University, Lille, France  Loyola University, Maywood, USA  Karolinska University Hospital, Stockholm, Sweden Frankfurt University, Frankfurt, Germany Colorado Health Sciences University, USA  University Hospital Cologne, Cologne, Germany  Hacettepe University, Ankara, Turkey  Albert Ludwigs University, Germany  University of North Carolina School of Medicine, NC, USA Southwestern Medical Center, Texas, USA Georgia Health Sciences University, Augusta, USA  Pavia Medical School University, Pavia, Italy  Kings College Hospital, London, UK  Pierre et Marie Curie University, Paris, France  King’s Hospital, London, UK  Athens University, Athens, Greece  Torino University, Torino, Italy  Wayne State University School of Medicine, Detroit, USA Rambam Medical Center, Haifa, Israel  University of Köln, Germany  AK St Georg, Hamburg, Germany  Memorial Şişli Hospital, İstanbul, Turkey  Santa Creu i Sant Pau Hospital, Barcelona, Spain  Mayo Clinic, Rochester, Minnesota, USA  İstanbul Cerrahpaşa University, İstanbul, Turkey  University of Minnesota, Minnesota, USA The University of Texas MD Anderson Cancer Center, Houston, USA San Martino University, Genoa, Italy

Past Editors Erich Frank Orhan Ulutin Hamdi Akan Aytemiz Gürgey

Language Editor Leslie Demir

Senior Advisory Board Yücel Tangün Osman İlhan Muhit Özcan Teoman Soysal Ahmet Muzaffer Demir

Editorial Office İpek Durusu Bengü Timoçin

Publishing Services

Statistic Editor Hülya Ellidokuz

GALENOS PUBLISHER Molla Gürani Mah. Kaçamak Sk. No: 21/1, Fındıkzade, İstanbul, Turkey Phone: +90 212 621 99 25 • Fax: +90 212 621 99 27 • www. galenos.com.tr

Contact Information Editorial Correspondence should be addressed to Dr. Reyhan Küçükkaya E-mail : rkucukkaya@hotmail.com

All Inquiries Should be Addressed to TURKISH JOURNAL OF HEMATOLOGY Address Phone Fax E-mail

: Turan Güneş Bulv. İlkbahar Mah. Fahreddin Paşa Sokağı (eski 613. Sok.) No: 8 06550 Çankaya, Ankara / Turkey : +90 312 490 98 97 : +90 312 490 98 68  : info@tjh.com.tr

E-ISSN: 1308-5263

Publishing Manager

Publishing House

Muhlis Cem Ar

Molla Gürani Mah. Kaçamak Sk. No: 21, 34093 Fındıkzade, İstanbul, Turkey Tel: +90 212 621 99 25

Management Address Türk Hematoloji Derneği Turan Güneş Bulv. İlkbahar Mah. Fahreddin Paşa Sokağı (eski 613. Sok.) No: 8 06550 Çankaya, Ankara / Turkey

Fax: +90 212 621 99 27 E-mail: info@galenos.com.tr Publisher Certificate Number: 14521

Online Manuscript Submission

Publication Date

http://mc.manuscriptcentral.com/tjh

02.05.2019

Web page

Cover Picture

www.tjh.com.tr

Owner on Behalf of the Turkish Society of Hematology Güner Hayri Özsan

International scientific journal published quarterly. The Turkish Journal of Hematology is published by the commercial enterprise of the Turkish Society of Hematology with Decision Number 6 issued by the Society on 7 October 2008.

A-II

Monika Błocka-Gumowska, Justyna Holka, Olga Ciepiela, Warsaw, Poland Hypersegmentation of Granulocytes and Monocytes in a Patient with Primary Myelofibrosis Treated with Hydroxycarbamide Hypersegmentation of white blood cells in peripheral blood of patient treated with hydroxycarbamide: (A) eosinophils, (B) basophils, (C) monocytes, and (D) neutrophils.

AIMS AND SCOPE The Turkish Journal of Hematology is published quarterly (March, June, September, and December) by the Turkish Society of Hematology. It is an independent, non-profit peer-reviewed international English-language periodical encompassing subjects relevant to hematology. The Editorial Board of The Turkish Journal of Hematology adheres to the principles of the World Association of Medical Editors (WAME), International Council of Medical Journal Editors (ICMJE), Committee on Publication Ethics (COPE), Consolidated Standards of Reporting Trials (CONSORT) and Strengthening the Reporting of Observational Studies in Epidemiology (STROBE). The aim of The Turkish Journal of Hematology is to publish original hematological research of the highest scientific quality and clinical relevance. Additionally, educational material, reviews on basic developments, editorial short notes, images in hematology, and letters from hematology specialists and clinicians covering their experience and comments on hematology and related medical fields as well as social subjects are published. As of December 2015, The Turkish Journal of Hematology does not accept case reports. Important new findings or data about interesting hematological cases may be submitted as a brief report. General practitioners interested in hematology and internal medicine specialists are among our target audience, and The Turkish Journal of Hematology aims to publish according to their needs. The Turkish Journal of Hematology is indexed, as follows: - PubMed Medline - PubMed Central - Science Citation Index Expanded - EMBASE - Scopus - CINAHL - Gale/Cengage Learning - EBSCO - DOAJ - ProQuest - Index Copernicus - Tübitak/Ulakbim Turkish Medical Database - Turk Medline - Hinari - QUARE - ARDI - GOALI Impact Factor: 0.650 Open Access Policy Turkish Journal of Hematology is an Open Access journal. This journal provides immediate open access to its content on the principle that making research freely available to the public supports a greater global exchange of knowledge. Open Access Policy is based on the rules of the Budapest Open Access Initiative (BOAI) http://www.budapestopenaccessinitiative.org/. Subscription Information  The Turkish Journal of Hematology is published electronically only as of 2019. Therefore, subscriptions are not necessary. All published volumes are available in full text free-of-charge online at www.tjh.com.tr.

A-III

Address: İlkbahar Mah., Turan Güneş Bulvarı, 613 Sok., No: 8, Çankaya, Ankara, Turkey Telephone: +90 312 490 98 97  Fax: +90 312 490 98 68 Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh  Web page: www.tjh.com.tr  E-mail: info@tjh.com.tr   Permissions  Requests for permission to reproduce published material should be sent to the editorial office. Editor: Professor Dr. Reyhan Küçükkaya Adress: Turan Güneş Bulv. İlkbahar Mah. Fahrettin Paşa Sokağı (Eski 613. Sokak) No: 8, 06550 Çankaya, Ankara, Turkey Telephone: +90 312 490 98 97  Fax: +90 312 490 98 68  Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh  Web page: www.tjh.com.tr  E-mail: info@tjh.com.tr Publisher Galenos Yayınevi Molla Gürani Mah. Kaçamak Sk. No:21 34093 Fındıkzade-İstanbul, Turkey Telephone : +90 212 621 99 25 Fax : +90 212 621 99 27 info@galenos.com.tr Instructions for Authors Instructions for authors are published in the journal and at www.tjh.com.tr Material Disclaimer Authors are responsible for the manuscripts they publish in The Turkish Journal of Hematology. The editor, editorial board, and publisher do not accept any responsibility for published manuscripts. If you use a table or figure (or some data in a table or figure) from another source, cite the source directly in the figure or table legend. Editorial Policy Following receipt of each manuscript, a checklist is completed by the Editorial Assistant. The Editorial Assistant checks that each manuscript contains all required components and adheres to the author guidelines, after which time it will be forwarded to the Editor in Chief. Following the Editor in Chief’s evaluation, each manuscript is forwarded to the Associate Editor, who in turn assigns reviewers. Generally, all manuscripts will be reviewed by at least three reviewers selected by the Associate Editor, based on their relevant expertise. Associate editor could be assigned as a reviewer along with the reviewers. After the reviewing process, all manuscripts are evaluated in the Editorial Board Meeting. Turkish Journal of Hematology’s editor and Editorial Board members are active researchers. It is possible that they would desire to submit their manuscript to the Turkish Journal of Hematology. This may be creating a conflict of interest. These manuscripts will not be evaluated by the submitting editor(s). The review process will be managed and decisions made by editor-in-chief who will act independently. In some situation, this process will be overseen by an outside independent expert in reviewing submissions from editors.

TURKISH JOURNAL OF HEMATOLOGY INSTRUCTIONS FOR AUTHORS The Turkish Journal of Hematology accepts invited review articles, research articles, brief reports, letters to the editor, and hematological images that are relevant to the scope of hematology, on the condition that they have not been previously published elsewhere. Basic science manuscripts, such as randomized, cohort, cross-sectional, and case-control studies, are given preference. All manuscripts are subject to editorial revision to ensure they conform to the style adopted by the journal. There is a double-blind reviewing system. Review articles are solicited by the Editorin-Chief. Authors wishing to submit an unsolicited review article should contact the Editor-in-Chief prior to submission in order to screen the proposed topic for relevance and priority. The Turkish Journal of Hematology does not charge any article submission or processing charges. Manuscripts should be prepared according to ICMJE guidelines (http:// www.icmje.org/). Original manuscripts require a structured abstract. Label each section of the structured abstract with the appropriate subheading (Objective, Materials and Methods, Results, and Conclusion). Letters to the editor do not require an abstract. Research or project support should be acknowledged as a footnote on the title page. Technical and other assistance should be provided on the title page. Original Manuscripts Title Page Title: The title should provide important information regarding the manuscript’s content. The title must specify that the study is a cohort study, cross-sectional study, case-control study, or randomized study (i.e. Cao GY, Li KX, Jin PF, Yue XY, Yang C, Hu X. Comparative bioavailability of ferrous succinate tablet formulations without correction for baseline circadian changes in iron concentration in healthy Chinese male subjects: A single-dose, randomized, 2-period crossover study. Clin Ther 2011;33:2054-2059). The title page should include the authors’ names, degrees, and institutional/ professional affiliations and a short title, abbreviations, keywords, financial disclosure statement, and conflict of interest statement. If a manuscript includes authors from more than one institution, each author’s name should be followed by a superscript number that corresponds to their institution, which is listed separately. Please provide contact information for the corresponding author, including name, e-mail address, and telephone and fax numbers. Running Head: The running head should not be more than 40 characters, including spaces, and should be located at the bottom of the title page. Word Count: A word count for the manuscript, excluding abstract, acknowledgments, figure and table legends, and references, should be provided and should not exceed 2500 words. The word count for the abstract should not exceed 300 words.

A-IV

Conflict of Interest Statement: To prevent potential conflicts of interest from being overlooked, this statement must be included in each manuscript. In case there are conflicts of interest, every author should complete the ICMJE general declaration form, which can be obtained at http://www.icmje.org/downloads/coi_disclosure.zip Abstract and Keywords: The second page should include an abstract that does not exceed 300 words. For manuscripts sent by authors in Turkey, a title and abstract in Turkish are also required. As most readers read the abstract first, it is critically important. Moreover, as various electronic databases integrate only abstracts into their index, important findings should be presented in the abstract. Objective: The abstract should state the objective (the purpose of the study and hypothesis) and summarize the rationale for the study. Materials and Methods: Important methods should be written respectively. Results: Important findings and results should be provided here. Conclusion: The study’s new and important findings should be highlighted and interpreted. Other types of manuscripts, such as reviews, brief reports, and editorials, will be published according to uniform requirements. Provide 3-10 keywords below the abstract to assist indexers. Use terms from the Index Medicus Medical Subject Headings List (for randomized studies a CONSORT abstract should be provided: http:// www.consort-statement.org). Introduction: The introduction should include an overview of the relevant literature presented in summary form (one page), and whatever remains interesting, unique, problematic, relevant, or unknown about the topic must be specified. The introduction should conclude with the rationale for the study, its design, and its objective(s). Materials and Methods: Clearly describe the selection of observational or experimental participants, such as patients, laboratory animals, and controls, including inclusion and exclusion criteria and a description of the source population. Identify the methods and procedures in sufficient detail to allow other researchers to reproduce your results. Provide references to established methods (including statistical methods), provide references to brief modified methods, and provide the rationale for using them and an evaluation of their limitations. Identify all drugs and chemicals used, including generic names, doses, and routes of administration. The section should include only information that was available at the time the plan or protocol for the study was devised (https://www.strobe-statement.org/ fileadmin/Strobe/uploads/checklists/STROBE_checklist_v4_combined.pdf). Statistics: Describe the statistical methods used in enough detail to enable a knowledgeable reader with access to the original data to verify the reported results. Statistically important data should be given in the

text, tables, and figures. Provide details about randomization, describe treatment complications, provide the number of observations, and specify all computer programs used. Results: Present your results in logical sequence in the text, tables, and figures. Do not present all the data provided in the tables and/or figures in the text; emphasize and/or summarize only important findings, results, and observations in the text. For clinical studies provide the number of samples, cases, and controls included in the study. Discrepancies between the planned number and obtained number of participants should be explained. Comparisons and statistically important values (i.e. p-value and confidence interval) should be provided. Discussion: This section should include a discussion of the data. New and important findings/results and the conclusions they lead to should be emphasized. Link the conclusions with the goals of the study, but avoid unqualified statements and conclusions not completely supported by the data. Do not repeat the findings/results in detail; important findings/ results should be compared with those of similar studies in the literature, along with a summarization. In other words, similarities or differences in the obtained findings/results with those previously reported should be discussed. Study Limitations: Limitations of the study should be detailed. In addition, an evaluation of the implications of the obtained findings/ results for future research should be outlined. Conclusion: The conclusion of the study should be highlighted. References Cite references in the text, tables, and figures with numbers in square brackets. Number references consecutively according to the order in which they first appear in the text. Journal titles should be abbreviated according to the style used in Index Medicus (consult List of Journals Indexed in Index Medicus). Include among the references any paper accepted, but not yet published, designating the journal followed by “in press”. Examples of References: 1. List all authors Deeg HJ, O’Donnel M, Tolar J. Optimization of conditioning for marrow transplantation from unrelated donors for patients with aplastic anemia after failure of immunosuppressive therapy. Blood 2006;108:1485-1491. 2. Organization as author Royal Marsden Hospital Bone Marrow Transplantation Team. Failure of syngeneic bone marrow graft without preconditioning in post-hepatitis marrow aplasia. Lancet 1977;2:742-744. 3. Book Wintrobe MM. Clinical Hematology, 5th ed. Philadelphia, Lea & Febiger, 1961. 4. Book Chapter Perutz MF. Molecular anatomy and physiology of hemoglobin. In: Steinberg MH, Forget BG, Higs DR, Nagel RI, (eds). Disorders of Hemoglobin:

A-V

Genetics, Pathophysiology, Clinical Management. New York, Cambridge University Press, 2000. 5. Abstract Drachman JG, Griffin JH, Kaushansky K. The c-Mpl ligand (thrombopoietin) stimulates tyrosine phosphorylation. Blood 1994;84:390a (abstract). 6. Letter to the Editor Rao PN, Hayworth HR, Carroll AJ, Bowden DW, Pettenati MJ. Further definition of 20q deletion in myeloid leukemia using fluorescence in situ hybridization. Blood 1994;84:2821-2823. 7. Supplement Alter BP. Fanconi’s anemia, transplantation, and cancer. Pediatr Transplant 2005;9(Suppl 7):81-86. Brief Reports Abstract length: Not to exceed 150 words. Article length: Not to exceed 1200 words. Introduction: State the purpose and summarize the rationale for the study. Materials and Methods: Clearly describe the selection of the observational or experimental participants. Identify the methods and procedures in sufficient detail. Provide references to established methods (including statistical methods), provide references to brief modified methods, and provide the rationale for their use and an evaluation of their limitations. Identify all drugs and chemicals used, including generic names, doses, and routes of administration. Statistics: Describe the statistical methods used in enough detail to enable a knowledgeable reader with access to the original data to verify the reported findings/results. Provide details about randomization, describe treatment complications, provide the number of observations, and specify all computer programs used. Results: Present the findings/results in a logical sequence in the text, tables, and figures. Do not repeat all the findings/results in the tables and figures in the text; emphasize and/or summarize only those that are most important. Discussion: Highlight the new and important findings/results of the study and the conclusions they lead to. Link the conclusions with the goals of the study, but avoid unqualified statements and conclusions not completely supported by your data. Invited Review Articles Abstract length: Not to exceed 300 words. Article length: Not to exceed 4000 words. Review articles should not include more than 100 references. Reviews should include a conclusion, in which a new hypothesis or study about the subject may be posited. Do not publish methods for literature search or level of evidence. Authors who will prepare review articles should already have published research articles on the relevant subject. The study’s new and important findings should be highlighted and interpreted in the Conclusion section. There should be a maximum of two authors for review articles.

Perspectives in Hematology “Perspectives” are articles discussing significant topics relevant to hematology. They are more personal than a Review Article. Authors wishing to submit a Perspective in Hematology article should contact the Editor in Chief prior to submission in order to screen the proposed topic for relevance and priority. Articles submitted for “Perspectives in Hematology” must advance the hot subjects of experimental and/or clinical hematology beyond the articles previously published or in press in TJH. Perspective papers should meet the restrictive criteria of TJH regarding unique scientific and/or educational value, which will impact and enhance clinical hematology practice or the diagnostic understanding of blood diseases. Priority will be assigned to such manuscripts based upon the prominence, significance, and timeliness of the content. The submitting author must already be an expert with a recognized significant published scientific experience in the specific field related to the “Perspectives” article.

slides. Explain the internal scale and identify the staining method used. Figures should be submitted as separate files, not in the text file. Highresolution image files are not preferred for initial submission as the file sizes may be too large. The total file size of the PDF for peer review should not exceed 5 MB. Authorship Each author should have participated sufficiently in the work to assume public responsibility for the content. Any portion of a manuscript that is critical to its main conclusions must be the responsibility of at least one author. Contributor’s Statement

References: Should not include more than 50 references

All submissions should contain a contributor’s statement page. Each statement should contain substantial contributions to idea and design, acquisition of data, and analysis and interpretation of findings. All persons designated as an author should qualify for authorship, and all those that qualify should be listed. Each author should have participated sufficiently in the work to take responsibility for appropriate portions of the text.

Images in Hematology

Acknowledgments

Article length: Not to exceed 200 words.

Acknowledge support received from individuals, organizations, grants, corporations, and any other source. For work involving a biomedical product or potential product partially or wholly supported by corporate funding, a note stating, “This study was financially supported (in part) with funds provided by (company name) to (authors’ initials)”, must be included. Grant support, if received, needs to be stated and the specific granting institutions’ names and grant numbers provided when applicable.

Abstract length: Not to exceed 150 words. Article length: Not to exceed 1000 words.

Authors can submit for consideration illustrations or photos that are interesting, instructive, and visually attractive, along with a few lines of explanatory text and references. Images in Hematology can include no more than 200 words of text, 5 references, and 3 figures or tables. No abstract, discussion, or conclusion is required, but please include a brief title. Letters to the Editor Article length: Not to exceed 500 words. Letters can include no more than 500 words of text, 5-10 references, and 1 figure or table. No abstract is required, but please include a brief title. The total number is usually limited to a maximum of five authors for a letter to the editor. Tables Supply each table in a separate file. Number tables according to the order in which they appear in the text, and supply a brief caption for each. Give each column a short or abbreviated heading. Write explanatory statistical measures of variation, such as standard deviation or standard error of mean. Be sure that each table is cited in the text. Figures Figures should be professionally drawn and/or photographed. Authors should number figures according to the order in which they appear in the text. Figures include graphs, charts, photographs, and illustrations. Each figure should be accompanied by a legend that does not exceed 50 words. Use abbreviations only if they have been introduced in the text. Authors are also required to provide the level of magnification for histological

A-VI

Authors are expected to disclose on the title page any commercial or other associations that might pose a conflict of interest in connection with the submitted manuscript. All funding sources that supported the work and the institutional and/or corporate affiliations of the authors should be acknowledged on the title page. Ethics When reporting experiments conducted with humans indicate that the procedures were in accordance with ethical standards set forth by the committee that oversees human subject research. Approval of research protocols by the relevant ethics committee, in accordance with international agreements (Helsinki Declaration of 1975, revised 2013 available at https://www.wma.net/policies-post/wma-declarationof-helsinki-ethical-principles-for-medical-research-involving-humansubjects/), is required for all experimental, clinical, and drug studies. Patient names, initials, and hospital identification numbers should not be used. Manuscripts reporting the results of experimental investigations conducted with humans must state that the study protocol received institutional review board approval and that the participants provided informed consent.

Non-compliance with scientific accuracy is not in accord with scientific ethics. Plagiarism: To re-publish, in whole or in part, the contents of another author’s publication as one’s own without providing a reference. Fabrication: To publish data and findings/results that do not exist. Duplication: Use of data from another publication, which includes republishing a manuscript in different languages. Salami slicing: To create more than one publication by dividing the results of a study unnecessarily. We disapprove of such unethical practices as plagiarism, fabrication, duplication, and salami slicing, as well as efforts to influence the review process with such practices as gifting authorship, inappropriate acknowledgments, and references. Additionally, authors must respect participants‘ right to privacy. On the other hand, short abstracts published in congress books that do not exceed 400 words and present data of preliminary research, and those that are presented in an electronic environment, are not considered as previously published work. Authors in such a situation must declare this status on the first page of the manuscript and in the cover letter. (The COPE flowchart is available at http://publicationethics.org.) We use iThenticate to screen all submissions for plagiarism before publication. Conditions of Publication All authors are required to affirm the following statements before their manuscript is considered: 1. The manuscript is being submitted only to The Turkish Journal of Hematology; 2. The manuscript will not be submitted elsewhere while under consideration by The Turkish Journal of Hematology; 3. The manuscript has not been published elsewhere, and should it be published in The Turkish Journal of Hematology it will not be published elsewhere without the permission of the editors (these restrictions do not apply to abstracts or to press reports for presentations at scientific meetings); 4. All authors are responsible for the manuscript’s content; 5. All authors participated in the study concept and design, analysis and interpretation of the data, and drafting or revising of the manuscript and have approved the manuscript as submitted. In addition, all authors are required to disclose any professional affiliation, financial agreement, or other involvement with any company whose product figures prominently in the submitted manuscript. Authors of accepted manuscripts will receive electronic page proofs and are responsible for proofreading and checking the entire article within two days. Failure to return the proof in two days will delay publication. If the authors cannot be reached by email or telephone within two weeks, the manuscript will be rejected and will not be published in the journal.

Copyright At the time of submission all authors will receive instructions for submitting an online copyright form. No manuscript will be considered for review until all authors have completed their copyright form. Please note, it is our practice not to accept copyright forms via fax, e-mail, or postal service unless there is a problem with the online author accounts that cannot be resolved. Every effort should be made to use the online

A-VII

copyright system. Corresponding authors can log in to the submission system at any time to check the status of any co-author’s copyright form. All accepted manuscripts become the permanent property of The Turkish Journal of Hematology and may not be published elsewhere, in whole or in part, without written permission. Note: We cannot accept any copyright form that has been altered, revised, amended, or otherwise changed. Our original copyright form must be used as is.

Units of Measurement Measurements should be reported using the metric system, according to the International System of Units (SI). Consult the SI Unit Conversion Guide, New England Journal of Medicine Books, 1992. An extensive list of conversion factors can be found at https://www. nist.gov/sites/default/files/documents/pml/wmd/metric/SP1038.pdf. For more details, see http://www.amamanualofstyle.com/oso/public/jama/ si_conversion_table.html.

Abbreviations and Symbols Use only standard abbreviations. Avoid abbreviations in the title and abstract. The full term for an abbreviation should precede its first use in the text, unless it is a standard abbreviation. All acronyms used in the text should be expanded at first mention, followed by the abbreviation in parentheses; thereafter the acronym only should appear in the text. Acronyms may be used in the abstract if they occur 3 or more times therein, but must be reintroduced in the body of the text. Generally, abbreviations should be limited to those defined in the AMA Manual of Style, current edition. A list of each abbreviation (and the corresponding full term) used in the manuscript must be provided on the title page.

Online Manuscript Submission Process The Turkish Journal of Hematology uses submission software powered by ScholarOne Manuscripts. The website for submissions to The Turkish Journal of Hematology is http://mc.manuscriptcentral.com/tjh. This system is quick and convenient, both for authors and reviewers.

Setting Up an Account New users to the submission site will need to register and enter their account details before they can submit a manuscript. Log in, or click the “Create Account” button if you are a first-time user. To create a new account: After clicking the “Create Account” button, enter your name and e-mail address, and then click the “Next” button. Your e-mail address is very important. Enter your institution and address information, as appropriate, and then click the “Next” Button. Enter a user ID and password of your choice, select your area of expertise, and then click the “Finish” button. If you have an account, but have forgotten your log-in details, go to “Password Help” on the journal’s online submission system and enter your e-mail address. The system will send you an automatic user ID and a new temporary password. Full instructions and support are available on the site, and a user ID and password can be obtained during your first visit. Full support for

authors is provided. Each page has a “Get Help Now” icon that connects directly to the online support system. Contact the journal administrator with any questions about submitting your manuscript to the journal (info@tjh.com.tr). For ScholarOne Manuscripts customer support, click on the “Get Help Now” link on the top right-hand corner of every page on the site.

The Electronic Submission Process Log in to your author center. Once you have logged in, click the “Submit a Manuscript” link in the menu bar. Enter the appropriate data and answer the questions. You may copy and paste directly from your manuscript. Click the “Next” button on each screen to save your work and advance to the next screen.

Upload Files Click on the “Browse” button and locate the file on your computer. Select the appropriate designation for each file in the drop-down menu next to the “Browse” button. When you have selected all the files you want to upload, click the “Upload Files” button. Review your submission before sending to the journal. Click the “Submit” button when you are finished reviewing. You can use ScholarOne Manuscripts at any time to check the status of your submission. The journal’s editorial office will inform you by e-mail once a decision has been made. After your manuscript has been submitted, a checklist will then be completed by the Editorial Assistant. The Editorial Assistant will check that the manuscript contains all required components and adheres to the author guidelines. Once the Editorial Assistant is satisfied with the manuscript it will be forwarded to the Senior Editor, who will assign an editor and reviewers.

The Review Processs Each manuscript submitted to The Turkish Journal of Hematology is subject to an initial review by the editorial office in order to determine if it is aligned with the journal’s aims and scope and complies with essential requirements. Manuscripts sent for peer review will be assigned to one of the journal’s associate editors that has expertise relevant to the manuscript’s content. All accepted manuscripts are sent to a statistical and English language editor before publishing. Once papers have been reviewed, the reviewers’ comments are sent to the Editor, who will then make a preliminary decision on the paper. At this stage, based on the feedback from reviewers, manuscripts can be accepted or rejected, or revisions can be recommended. Following initial peer-review, articles judged worthy of further consideration often require revision. Revised manuscripts generally must be received within 3 months of the date of the initial decision. Extensions must be requested from the Associate Editor at least 2 weeks before the 3-month revision deadline expires; The Turkish Journal of Hematology will reject manuscripts that are not received within the 3-month revision deadline. Manuscripts with extensive revision recommendations will be sent for further review (usually by the same reviewers) upon their re-submission. When a manuscript is finally

A-VIII

accepted for publication, the Technical Editor undertakes a final edit and a marked-up copy will be e-mailed to the corresponding author for review and any final adjustments.

Submission of Revised Papers When revising a manuscript based on the reviewers’ and Editor’s feedback, please insert all changed text in red. Please do not use track changes, as this feature can make reading difficult. To submit revised manuscripts, please log in to your author center at ScholarOne Manuscripts. Your manuscript will be stored under “Manuscripts with Decisions”. Please click on the “Create a Revision” link located to the right of the manuscript title. A revised manuscript number will be created for you; you will then need to click on the “Continue Submission” button. You will then be guided through a submission process very similar to that for new manuscripts. You will be able to amend any details you wish. At stage 6 (“File Upload”), please delete the file for your original manuscript and upload the revised version. Additionally, please upload an anonymous cover letter, preferably in table format, including a point-by-point response to the reviews’ revision recommendations. You will then need to review your paper as a PDF and click the “Submit” button. Your revised manuscript will have the same ID number as the original version, but with the addition of an R and a number at the end, for example, TJH-2011-0001 for an original and TJH-2011-0001.R1, indicating a first revision; subsequent revisions will end with R2, R3, and so on. Please do not submit a revised manuscript as a new paper, as revised manuscripts are processed differently. If you click on the “Create a Revision” button and receive a message stating that the revision option has expired, please contact the Editorial Assistant at info@tjh.com.tr to reactivate the option.

English Language and Statistical Editing All manuscripts are professionally edited by an English language editor prior to publication. After papers have been accepted for publication, manuscript files are forwarded to the statistical and English language editors before publishing. Editors will make changes to the manuscript to ensure it adheres to TJH requirements. Significant changes or concerns are referred to corresponding authors for editing.

Online Early The Turkish Journal of Hematology publishes abstracts of accepted manuscripts online in advance of their publication. Once an accepted manuscript has been edited, the authors have submitted any final corrections, and all changes have been incorporated, the manuscript will be published online. At that time the manuscript will receive a Digital Object Identifier (DOI) number. Both forms can be found at www.tjh. com.tr. Authors of accepted manuscripts will receive electronic page proofs directly from the printer and are responsible for proofreading and checking the entire manuscript, including tables, figures, and references. Page proofs must be returned within 48 hours to avoid delays in publication.

CONTENTS 72

Prognostic Factors in Elderly Patients with Diffuse Large B-Cell Lymphoma and Their Treatment Results Süleyman Cem Adıyaman, İnci Alacacıoğlu, Ayça Ersen Danyeli, Doğuş Türkyılmaz, Ömür Gökmen Sevindik, Fatih Demirkan, Özden Pişkin, Mehmet Ali Özcan, Bülent Ündar, Sermin Özkal, Güner Hayri Özsan; İzmir, Turkey

Comparison of Myeloablative Versus Reduced-Intensity Conditioning Regimens for Allogeneic Hematopoietic Stem Cell Transplantation in Acute Myeloid Leukemia: A Cohort Study Rafiye Çiftçiler, Hakan Göker, Haluk Demiroğlu, Elifcan Aladağ, Salih Aksu, İbrahim Celalettin Haznedaroğlu, Nilgün Sayınalp, Osman Özcebe, Fatma Tekin, Yahya Büyükaşık; Ankara, Turkey

Co-culture of Platelets with Monocytes Induced M2 Macrophage Polarization and Formation of Foam Cells: Shedding Light on the Crucial Role of Platelets in Monocyte Differentiation Mahdieh Mehrpouri, Davood Bashash, Mohammad Hossien Mohammadi, Mohammad Esmail Gheydari, Esmail Shahabi Satlsar, Mohsen Hamidpour; Tehran, Iran

106

Dose Adjustment Helps Obtain Better Outcomes in Multiple Myeloma Patients with Bortezomib, Melphalan, and Prednisolone (VMP) Treatment Su-Hee Cho, Ho-Jin Shin, Ki Sun Jung, Do Young Kim; Busan, Korea

112

Brief Report

117

Images in Hematology

120

Hypersegmentation of Granulocytes and Monocytes in a Patient with Primary Myelofibrosis Treated with Hydroxycarbamide Monika Błocka-Gumowska, Justyna Holka, Olga Ciepiela; Warsaw, Poland

122

Letters to the Editor

124

The Coexistence of Chronic Lymphocytic Leukemia and Multiple Myeloma Ceren Hangül, Orhan Kemal Yücel, Bahar Akkaya, Levent Ündar, Sibel Berker Karaüzüm; Antalya, Turkey

126

Investigation of MDM2 Oncogene Copy Number Alterations in Cases of Chronic Lymphocytic Leukemia Şule Darbaş, Çiğdem Aydın, Ozan Salim, Sibel Berker Karaüzüm; Antalya, Burdur, Turkey

Assessment of Health-Related Quality of Life in Pediatric Acute Lymphoblastic Leukemia Survivors: Perceptions of Children, Siblings, and Parents Deniz Kızmazoğlu, Seher Sarı, Melike Evim Sezgin, Arzu Kantarcıoğlu, Özlem Tüfekçi, Fatma Demir Yenigürbüz, Birol Baytan, Şebnem Yılmaz, Adalet Meral Güneş, Hale Ören; İzmir, Bursa, Turkey

Osteoblastic Solitary Plasmacytoma of Bone Chrissa Sioka, Konstantinos Sakelariou, Alexandra Papoudou-Bai, Christos Tolis, Jihand Al-Boucharali, Andreas Fotopoulos; Ioannina, Greece

Remarks on Myeloid Sarcoma in Children Sevgi Gözdaşoğlu

A-IX

128

Clonal Evolution of Acute Myeloid Leukemia with CEBPA Double Mutations after Long-Term Remission: Case Report and a Literature Review Ying Li, Long Su; Changchun, China

130

Progressive Hepatic Cirrhosis Early After Allogeneic Hematopoietic Stem Cell Transplantation in a Patient with Chronic Hepatitis C Infection Satoshi Kaito, Noriko Doki, Tsunekazu Hishima, Yasunobu Takaki, Kazuteru Ohashi; Tokyo, Japan

133

Venous Thromboembolism in a Young Girl with Duplication of the Inferior Vena Cava and Protein S Deficiency Wei-Li Liao, Ming-Yang Shih, Jiaan-Der Wang; Taichung, Taiwan

135

A Successful Coronary Artery Bypass Operation with Intermittent Factor VIII Administration in a Hemophilia A Patient Who Was Admitted Due to Acute Myocardial Infarction: A Rare and Difficult Case Ulaş Serkan Topaloğlu, Rıfat Özmen, Recep Civan Yüksel, Murat Çetin, Gülşah Akyol; Kayseri, Turkey

137

Prospective Evaluation of Non-Compliant Severe Hemophilia Patients Mehmet Can Uğur, Kaan Kavaklı; İzmir, Turkey

138

Bleomycin-Induced Flagellate Dermatitis Esra Turan Erkek, Ceren Nur Karaali, Güven Yılmaz, Emine Gültürk; İstanbul, Turkey

A-X

RESEARCH ARTICLE DOI: 10.4274/tjh.galenos.2019.2018.0238 Turk J Hematol 2019;36:72-80

Tumor Necrosis Factor Alpha-308G/A Polymorphism and the Risk of Multiple Myeloma: A Meta-Analysis of Pooled Data from Twelve Case-Control Studies Tümör Nekroz Faktör Alfa-308G/A Polimorfizmi ve Multipl Myelom Riski: On İki Olgu Kontrol Çalışması Havuz Datasının Meta Analizi Yingchao Li1,

Yong Lin2,3

1Xiamen University Zhongshan Hospital, Department of Orthopedics, Xiamen, China 2Xiamen University Zhongshan Hospital Clinical Laboratory, Xiamen, China 3Medical College of Xiamen University, Institute of Infectious Disease, Xiamen, China

Abstract

Öz

Objective: Tumor necrosis factor alpha (TNF-α) is an important cytokine involved in inflammation, immune response, and other biological processes. The association between polymorphism -308G/A in its promoter and the risk of multiple myeloma (MM) is not clear. Thus, we conducted a meta-analysis to clarify this question.

Amaç: Tümör nekroz faktör alfa (TNF-α) enflamasyon, immün cevap ve diğer biyolojik süreçlerde rol alan önemli bir sitokindir. TNF-α -308G/A promotor bölge polimorfizmi ile multipl myelom (MM) riski arasındaki ilişki net değildir. Bu soruya cevap aramak amacıyla bir meta-analiz çalışması gerçekleştirdik.

Materials and Methods: Twelve eligible studies, which included 2204 MM cases and 3478 controls, were enrolled in our meta-analysis by searching the PubMed, China National Knowledge Infrastructure, Scopus, Web of Science, and Google Scholar databases up to December 2018. The effect of polymorphism -308G/A on MM risk was evaluated by calculating the pooled odds ratio (OR) and the 95% confidence interval (CI). Furthermore, the Q-test and I2 statistical analyses were used to estimate the degree of heterogeneity. Sensitivity analysis was conducted to test the robustness of the meta-analysis results. Publication bias was assessed by Egger’s test and visual inspection of a funnel plot.

Gereç ve Yöntemler: Meta analize 2018 Aralık ayına kadar PubMed, China National Knowledge Infrastructure, Scopus, “Web of Science”, ve “Google Scholar”da yayınlanmış olan 2204 MM hastası ve 3478 kontrol içeren 12 çalışma dahil edildi. -308G/A polimorfizminin MM üzerine olan etkisi birleştirilmiş odds oranı (OR) ve %95 güven aralığı (CI) ile değerlendirildi. Heterojenite derecesinin hesaplanması için Q-test ve I2 istatistiksel analizleri kullanıldı. Meta analiz sonuçlarının kuvvet testi için hassasiyet analizi kullanıldı. Yayın yanlılık değerlendirilmesi Egger testi ve huni grafiğinin görsel incelemesi ile yapıldı.

Results: In the dominant model, -308G/A polymorphism was associated with reduced MM risk (OR=0.80, 95% CI: 0.65-0.97), and it also demonstrated a significant protective effect with a pooled OR of 0.82 (95% CI: 0.68-0.99) in the Caucasian subgroup. Because of the limited number of individual studies with AA genotype carriers, only eight studies were included in the recessive model, and no significant difference was observed. Moreover, the meta-analysis of the allele frequency demonstrated that the A allele has a protective effect against MM risk with a pooled OR of 0.83 (95% CI: 0.69-0.99). Sensitivity analysis suggested that the synthesized effect size was not influenced by any individual study. Moreover, the Egger’s test statistical analysis suggested that publication bias was not obvious in the present analysis.

Bulgular: Baskın modelde, -308G/A polimorfizmi azalmış MM riski ile ilişkili bulundu (OR=0,80, %95 CI: 0,65-0,97), ve bu polimorfizm varlığının anlamlı koruyucu etkisi beyaz ırkta 0,82 (%95 CI: 0,680,99) birleştirilmiş OR ile de gösterildi. AA genotip taşıyıcılarının bireysel çalışmalarda daha az sayıda bulunması nedeniyle çekinik modele sadece 8 çalışma dahil edildi ve anlamlı bir farklılık gözlenmedi. Dahası, allel frekansının meta analizinde A allelinin MM için koruyucu etkisi 0,83 (%95 CI: 0,69-0,99) birleştirilmiş OR ile gösterildi. Hassasiyet analizi sentezlenen etki büyüklüğünde hiçbir çalışmanın tek başına belirleyici etkisinin olmadığını gösterdi. Ayrıca, Egger test istatistiksel analizi ile bu çalışmada yayın yanlılığının olmadığını ortaya kondu.

Address for Correspondence/Yazışma Adresi: Yong LIN, M.D., Xiamen University Zhongshan Hospital Clinical Laboratory, Xiamen, China Phone : +86 592 2993322 E-mail : mikhail929@163.com ORCID-ID: orcid.org/0000-0001-5120-8221

Received/Geliş tarihi: July 09, 2018 Accepted/Kabul tarihi: January 02, 2019

Li Y and Lin Y: Meta-Analysis on Multiple Myeloma

Turk J Hematol 2019;36:72-80

Abstract

Öz

Conclusion: Overall, the -308G/A polymorphism was associated with reduced MM risk in the dominant model and allele frequency. Further investigation is needed to gain better insight.

Sonuç: Sonuç olarak, -308G/A polimorfizmi baskın modelde ve allel sıklığında MM riskinde azalma ile ilişkili bulunmuştur. Bu ilişkinin daha iyi anlaşılabilmesi için ileri çalışmalar gereklidir.

Keywords: Multiple myeloma, Tumor necrosis factor-α, Polymorphism, Meta-analysis

Anahtar Sözcükler: Multiple myelom, Tümör nekroz faktör-α, Polimorfizm, Meta-analiz

Introduction Multiple myeloma (MM) is a bone marrow-based disseminated neoplasm commonly preceded by premalignant monoclonal gammopathy of undetermined significance [1]. Among the hematologic malignancy types, MM accounts for approximately 10% of diagnosed cases, maintaining the second position after non-Hodgkin’s lymphoma [2]. According to the latest statistics, there are 30,330 new MM cases and 12,650 deaths attributed to MM in the United States annually [3]. With the rapid progress made in pharmaceutical research, novel proteasome inhibitors and immune modulatory drugs have been applied in the treatment of MM [4], and the prognosis of MM has significantly improved among all MM patients. Despite the improvement in both treatment and survival, MM is currently regarded as an incurable disease, and the major goal of treatment is to achieve partial or complete remission. Therefore, it is of critical importance to investigate the risk factors of MM and to identify high-risk populations at the early stage of the disease. Previous studies have revealed that genetic abnormalities contribute to the risk of developing MM, especially genes related to the immune response. For example, the rs2285803 polymorphism located in the human leukocyte antigen (HLA) region was found to be associated with an elevated MM risk in the European population [5] but not in Chinese individuals [6]. Moreover, a study identified several polymorphisms in HLA by applying a novel statistical model, suggesting the important role of HLA in MM [7]. Previous studies have also suggested that mutations in germline lysine-specific demethylase 1 and elongation factor for RNA polymerase II 2 (ELL2) are associated with an elevated risk of MM [8,9]. Tumor necrosis factor alpha (TNF-α) is an important cytokine, and cytotoxin triggers have been implicated in tumor regression, septic shock, and cachexia [10]. Mutations in the promoter region of TNF-α may affect the binding of transcription factors and consequently result in alterations in mRNA expression. The -308G/A polymorphism of TNF-α has been widely investigated in relation to various diseases, including infectious diseases and cancers. The A allele of the -308G/A polymorphism is associated with stronger transcription activity compared with the wild type and increased TNF-α expression in vivo [11]. Moreover, most HLA variations associated with MM can be explained by rs2285803,

and we found that the -308G/A polymorphism and rs2285803 are in linkage disequilibrium with a D’ value of 0.7308 and an R2 value of 0.0197. Considering the findings that we observed, in the present study, we conducted a meta-analysis on the -308G/A polymorphism and MM risk in accordance with the Preferred Reporting Items for Systematic Reviews and MetaAnalyses guidance, which would provide information on the association between polymorphisms in both TNF-α and HLA and MM.

Materials and Methods Search Strategy and Study Eligibility A literature search was independently conducted by two investigators for genetic studies on TNF-α in PubMed, the China National Knowledge Infrastructure (CNKI), Scopus, Web of Science, and Google Scholar databases without any restriction of publication language. All relevant studies reported up to 10 December 2018 and the following key words were searched: “multiple myeloma”, “plasma cell”, “plasmacell”, “plasmacytoma”, “myelomatosis”, “Kahler’s disease”, “TNF-α”, “tumor necrosis factor alpha”, and “-308G/A”. Studies that fulfilled all the following criteria were included in the meta-analysis: (1) studies used case-control study design; (2) studies evaluated the association between TNF-α polymorphisms and the risk of developing MM; and (3) studies included genotype distribution of TNF-α polymorphisms in both cases and controls and other essential information required to estimate the odds ratio (OR) and 95% confidence interval (CI). Studies that met any one of the following criteria were excluded: (1) data were not relevant to the association between TNF-α polymorphisms and MM risk; (2) reviews, cases reports, editorial comments, and communications were included; or (3) there were insufficient data to estimate OR and 95% CI. Quality Assessment and Data Extraction The Newcastle-Ottawa Scale was used to evaluate the quality of the enrolled studies independently by two investigators. Disagreements between the two investigators were settled by discussions to reevaluate the methodological quality of original studies. 73

Li Y and Lin Y: Meta-Analysis on Multiple Myeloma

Turk J Hematol 2019;36:72-80

Results

The extraction of data from individual studies included the following: the surname of the first author, the year of publication, the location of the study, the ethnicity and the source of controls, the genotyping method, the Hardy-Weinberg equilibrium (HWE) in controls, and the count of each TNF-α genotype in MM cases and controls.

Study Identification and Main Characteristics In total, we identified 167 records from the PubMed and CNKI databases in a primary literature search, and after removing duplicates, 135 records were subjected to title and abstract screening. Sixteen of them were reviewed in full; two were removed because of the absence of genotype distribution data, and two were excluded due to possible overlapping subjects (Figure 1). Finally, 12 studies met the inclusion criteria for our meta-analysis for evaluating the relationship between the -308G/A polymorphism and MM risk [12,13,14, 15,16,17,18,19,20,21,22,23]. Among these studies, eight were based on Caucasian populations, and the remaining four were conducted with Asian subjects. The quality score average was 7.3, which combined all the enrolled studies together; a score greater than 5 was considered appropriate for inclusion in the meta-analysis. Based on the chi-square test results, the genotype distribution in the control group was consistent with the HWE among all 12 enrolled studies. The name of the first author, year of publication, country, ethnicity, source of controls, genotyping method, and HWE in the control group are listed in Table 1. The quality score of each individual study is shown in Table 2 and the detailed genotype distribution is demonstrated in Table 3.

Statistical Analysis The strength of the association between TNF-α polymorphism and MM risk was evaluated by OR and 95% CI. We applied the following models to calculate different ORs: the dominant genetic model (GA+AA vs. GG), the recessive genetic model (AA vs. GA+GG), and the allele model (A vs. G). Z-tests were used to determine the statistical significance of pooled ORs. The heterogeneity between enrolled studies was assessed by using the Q-test, and we applied a random-effects model to calculate pooled effect size. Subgroup analysis by ethnicity was performed to estimate and demonstrate the pooled MM risk caused by TNF-α polymorphism in different races. Each study was removed in turn for sensitivity analyses, and the remaining studies were reanalyzed to assess the stability of the results. Moreover, publication bias among enrolled studies was examined using Egger’s test, where a p-value of less than 0.10 was considered statistically significant. Metaregression was used to identify the source of heterogeneity among covariates in the presence of heterogeneity. If the intercept was significantly different from zero, the estimate of the effect was considered biased. All statistical analyses were performed with STATA Version 12.0 software (Stata Corp, College Station, TX, USA). All p-values in the present study were two-sided, and p< 0.05 was considered statistically significant unless otherwise specified.

Quantitative Synthesis The genotype distribution of the -308G/A polymorphism in the cases and controls of all enrolled studies was extracted, and based on that, we performed a meta-analysis; the main outcome is demonstrated in Figure 2 and Table 4. In the dominant model, the -308G/A polymorphism was associated with a reduced MM risk (OR=0.80, 95% CI: 0.65-0.97). The

Table 1. Main characteristics of enrolled studies in meta-analysis. First author

Year

Country

Ethnicity

Control population#

Genotyping method

HWE for controls

Quality score

Zheng et al. [15]

2000

Sweden

Caucasian

PCR-RFLP

0.515

Neben et al. [21]

2002

Germany

Caucasian

PCR-RFLP

0.060

Yakupova et al. [22]

2003

Russia

Caucasian

PCR-RFLP

0.665

Jin et al. [14]

2004

China

Asian

TaqMan

0.279

Morgan et al. [12]

2005

Caucasian

IHG

0.182

Au et al. [23]

2006

China

Asian

PCR-RFLP

0.317

Brown et al. [17]

2007

Caucasian

TaqMan

0.176

Kádár et al. [13]

2008

Hungary

Caucasian

PCR-RFLP

0.157

Du et al. [19]

2010

China

Asian

PCR-RFLP

0.068

Liu et al. [20]

2012

China

Asian

PCR-LDR

0.443

Martino et al. [16]

2014

IMMEnSE*

Caucasian

TaqMan

0.150

Nielsen et al. [18]

2017

Denmark

Caucasian

TaqMan

0.281

*International Multiple Myeloma Research (IMMEnSE) Consortium includes 7 European countries: Italy, Poland, Spain, France, Portugal, Hungary, and Denmark. #HB: Hospital-based, PB: population-based, PCR-RFLP: polymerase chain reaction-restriction fragment length polymorphism, HWE: Hardy-weinberg equilibrium.

Li Y and Lin Y: Meta-Analysis on Multiple Myeloma

Turk J Hematol 2019;36:72-80

subgroup analysis showed a similar association between the -308G/A polymorphism and MM risk in the Caucasian (OR=0.82, 95% CI: 0.68-0.99) but not the Asian subgroups (OR=0.70, 95% CI: 0.35-1.39). Due to the very limited number of AA homozygous carriers, only one Asian study was included in the recessive model, and the overall effect size based on eight studies was 0.84 (95% CI: 0.42-1.71). For the allele model, according to our estimation, the A allele of TNF-α -308G/A polymorphism confers a protective effect against MM risk with a pooled OR of 0.83 (95% CI: 0.69-0.99) in the overall population, and significance was observed. However, no significant association was observed in the Caucasian (OR=0.84, 95% CI: 0.70-1.02) and Asian (OR=0.75, 95% CI: 0.41-1.38) populations in the estimation of subgroup analysis. Heterogeneity Analysis As seen in the quantitative synthesis, heterogeneity was observed in the overall population and in both subgroups in the dominant model; the p-values of the Q-test were all less than 0.05. Similar to the dominant model, intermediate heterogeneity was detected in the allele model. However, no significant heterogeneity was found in the recessive model according to the Q-test results. Sensitivity Analysis To evaluate the robustness of the present meta-analysis, we performed sensitivity analysis by sequentially removing each eligible study and observing the changes in the overall effect size. As shown in Figure 3, the significance of the overall effect size was not influenced by any single study in both the dominant and allele models, indicating that our results were statistically robust.

Figure 1. Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) flow diagram for inclusion and exclusion of studies in the meta-analysis. CNKI: China National Knowledge Infrastructure.

Table 2. The quality score of included studies by using Newcastle-Ottawa Scale. First author

Year

Selection S1

Comparability

★

Exposure

No. of stars

★

Zheng et al. [15]

2000

★

Neben et al. [21]

2002

★

Yakupova et al. [22]

2003

★

Jin et al. [14]

2004

★

Morgan et al. [12]

2005

★

Au et al. [23]

2006

★

Brown et al. [17]

2007

★

Kádár et al. [13]

2008

★

Du et al. [19]

2010

★

Liu et al. [20]

2012

★

Martino et al. [16]

2014

★

Nielsen et al. [18]

2017

★

Selection: S1, is the case definition adequate?; S2, representativeness of the cases; S3, selection of controls; S4, definition of controls. Comparability: C1, comparability of cases; C2, controls of the basis of the design or analysis. Exposure: E1, ascertainment of exposure; E2, same method of ascertainment for cases and controls; E3, non-response rate.

Li Y and Lin Y: Meta-Analysis on Multiple Myeloma

Publication Bias We applied Begg’s funnel plot and Egger’s test to assess publication bias in the present meta-analysis of the -308G/A polymorphism and MM risk. The funnel plots’ shapes of the dominant and allele models (Table 5; Figure 4) did not provide obvious evidence of asymmetry, and all the p-values of Egger’s test were greater than 0.05, providing statistical evidence for the funnel plots’ symmetry. Thus, the above results suggest that publication bias was not evident in this meta-analysis. Meta-regression As demonstrated in the previous section, heterogeneity was observed in both the dominant and allele model analyses but

Turk J Hematol 2019;36:72-80

not in the recessive model. Therefore, meta-regression was conducted to identify the possible source of heterogeneity by testing the year of publication, sample size, ethnicity, study quality, control source, and genotyping method. As can be seen in Table 6, the p-values of all the tested covariates were greater than 0.05, indicating no contribution to heterogeneity.

Discussion TNF-α is a proinflammatory cytokine that is mainly secreted by multinuclear giant cells, with a wide range of biological activities, including the regulation of host immune functions and the inflammatory reaction process [24]. Moreover, TNF-α is capable of inducing cell apoptosis, and in contrast, it can accelerate tumor growth. Growing evidence has demonstrated

Figure 2 The association of tumor necrosis factor alpha -308G/A polymorphism with multiple myeloma risk in (A) dominant model, (B) recessive model, and (C) allele model. OR: Odds ratio, CI: confidence interval.

Li Y and Lin Y: Meta-Analysis on Multiple Myeloma

Turk J Hematol 2019;36:72-80

that TNF-α participates in several key processes of tumor progression, including oncogene activation, DNA damage, and tumor metastasis [25]. For instance, it has been reported that TNF-α has elevated expression in colorectal cancer tissue compared with normal colorectal tissue, and that cancer tissues in advanced stages have higher TNF-α expression compared with cancer tissues in earlier stages [26]. As mentioned before, the -308G/A polymorphism is associated with elevated expression of TNF-α mRNA through its effect on transcription. Our metaanalysis comprehensively reviewed published findings and demonstrated that it has a protective effect against MM risk in the dominant model and allele analysis. Substantial studies have shown that the -308G/A polymorphism is associated with elevated constitutive and inducible protein levels compared with wild-type carriers [27]. A low concentration of TNF-α was observed in subjects carrying the GG genotype, and intermediate and high levels were associated with the GA and AA genotypes, respectively. Therefore, it was reasonable

to assume that the -308G/A polymorphism increases the risk of developing MM through its effect on the TNF-α expression level. It has been acknowledged that the inflammation and immune responses triggered by TNF-α lead to the progression of cancer and often predict a worse outcome. A previous study conducted on 44 MM cases demonstrated that MM patients with advanced progression had significantly elevated serum TNF-α levels compared with normal controls [28]. Consistent with this result, Jurisić and Colović [29] examined the TNF-α levels in MM patients and found that serum level positively correlated with clinical stage and osteolysis, which is a severe complication of MM. Moreover, a cell assay revealed that TNF-α was capable of inducing IL-6 expression via the JAK/STAT pathway in U266 MM cells [30]. Thus, both epidemiological observations and laboratory studies support the unfavorable effects of TNF-α on MM. However, our results were inconsistent with the previous findings.

Figure 3. Sensitivity analysis for tumor necrosis factor alpha -308G/A polymorphism in (A) dominant model and (B) allele model.

Figure 4. Begg’s funnel plot for the evaluation of publication bias of tumor necrosis factor alpha -α -308G/A polymorphism in (A) dominant model and (B) allele model.

CI: Confidence interval.

OR: Odds ratio.

Li Y and Lin Y: Meta-Analysis on Multiple Myeloma

Turk J Hematol 2019;36:72-80

The pooled OR in the dominant and allele model showed a protective effect of the -308G/A polymorphism. A possible explanation is that inflammation caused by elevated TNF-α would definitely promote the progression and development of MM, which is confirmed by comparing MM cases in different stages. TNF-α has also been proven to possess anti-tumor effects through various mechanisms. For instance, TNF-α

has been shown to have cytotoxic activity in tumor cells in paraformaldehyde-fixed activated monocytes [31]. Moreover, it has been revealed that TNF-α is associated with B-cell proliferation and immunoglobulin production by interacting with TNF-R2 in healthy individuals [32]. Based on these findings, we assume that elevated TNF-α levels can reduce the MM risk by improving immune surveillance and eliminating tumor

Table 3. Tumor necrosis factor alpha -308G/A polymorphism genotype distribution in cases and controls. First author

Year

Zheng et al. [15]

MM cases

Controls

Total

2000

129

Neben et al. [21]

2002

184

255

142

200

Yakupova et al. [22]

2003

Jin et al. [14]

2004

114

Morgan et al. [12]

2005

141

180

158

233

Au et al. [23]

2006

Brown et al. [17]

2007

125

388

137

543

Kádár et al. [13]

2008

111

141

Du et al. [19]

2010

182

210

170

218

Liu et al. [20]

2012

153

172

Martino et al. [16]

2014

478

143

630

859

289

1181

Nielsen et al. [18]

2017

244

344

250

355

MM: Multiple myeloma.

Table 4. Summary of odds ratios and 95% confidence intervals of tumor necrosis factor alpha -308G/A polymorphism with multiple myeloma risk. Genetic model

Dominant model

Recessive model

Allele

Subgroup

No. of studies

Test of association

Test of heterogeneity

95% CI

Model

Overall

0.80

0.66-0.97

0.024*

Random

43.8%

0.046*

Caucasian

0.82

0.68-0.99

0.038*

Random

31.4%

0.021*

Asian

0.70

0.36-1.39

0.312

Random

66.4%

0.030*

Overall

0.84

0.42-1.71

0.638

Random

41.7%

0.100

Caucasian

0.77

0.38-1.55

0.460

Random

41.7%

0.113

Asian

5.24

0.25-109.79

0.286

Random

N/A

Overall

0.83

0.69-0.99

0.042*

Random

46.8%

0.043*

Caucasian

0.84

0.70-1.02

0.072

Random

45.2%

0.030*

Asian

0.75

0.41-1.38

0.357

Random

61.2%

0.052

*p<0.05. CI: Confidence interval, OR: odds ratio.

Table 5. The evaluation of publication bias by using Egger’s test. Genetic model

Coefficient

Standard error

p> I t I

95% CI

Dominant

-0.095

0.679

-0.14

0.891

-1.61 to 1.42

Recessive

3.982

3.075

1.30

0.243

-3.54 to 11.51

Allele

-0.081

0.709

-0.11

0.912

-1.66 to 1.50

CI: Confidence interval.

Li Y and Lin Y: Meta-Analysis on Multiple Myeloma

Turk J Hematol 2019;36:72-80

Table 6. Meta-regression of tumor necrosis factor alpha polymorphism -308G/A polymorphism with multiple myeloma risk. Model

Dominant

Allele

Covariate

Coefficient

Tau2

I2-Res

Adj. R2

Year

0.006

0.004

47.56%

-92.07%

0.776

Sample size

0.004

0.047

48.32%

-142.10%

0.852

Ethnicity

0.116

0.025

47.38%

-28.79%

0.690

Study quality

-0.122

0.051

48.78%

-159.46%

0.622

Control source

0.051

0.038

48.48%

-95.09%

0.834

Genotyping method

-0.237

0.039

48.80%

-102.08%

0.902

Year

0.002

0.047

51.49%

-56.55%

0.943

Sample size

0.001

0.051

51.53%

-69.22%

0.982

Ethnicity

0.076

0.038

50.89%

-26.30%

0.786

Study quality

-0.145

0.050

51.03%

-66.59%

0.513

Control source

0.088

0.040

50.79%

-33.77%

0.698

Genotyping method

0.108

0.039

49.96%

-29.43%

0.629

cells, but in individuals who have already developed MM, the elevated TNF-α level may have unfavorable effects associated with shorter survival time. In subgroup analysis by ethnicity, we observed contradictory results in the dominant model but not allele frequency. As observed, the -308G/A polymorphism has a protective effect in the Caucasian population but not in the Asian population; we assume that this can be attributed to the limited number of Asian population studies when compared with Caucasian populations. Therefore, it is possible that the subgroup analysis showed a null association in the Asian population. In addition, we also analyzed the difference between genotyping methods employed by included studies. Due to the limited number of included studies, we categorized the genotyping methods as polymerase chain reaction-restriction fragment length polymorphism (PCRRFLP), which is a classic genotyping method, and others, as one subgroup. PCR-RFLP is a technique that detects DNA sequence mutations by the lengths of fragments after digestion with specific restriction endonucleases [33]. However, it requires a larger amount of DNA and often involves multiple manual processes. In addition, techniques such as TaqMan offer rapid processing and a more sensitive way to determine SNPs with distinct fluorescent dye-based technology [34]. The subgroup analysis showed a similar trend between subgroups in both the dominant model and allele analysis. Based on the results, we assume that the genotyping methods did not interfere with the overall effect size. Study Limitations Some limitations of our study must be mentioned. First, the rare frequency of the AA genotype in some of the included studies led to the unavailability of these studies in the recessive model. Second, the present study failed to identify the source of heterogeneity using meta-regression, although heterogeneity was rather intermediate.

Nonetheless, we provided novel insight into the association investigated in this study, suggesting that elevated TNF-α levels may reduce MM risk, which deserves investigation of its underlying mechanism.

Conclusion In summary, only intermediate heterogeneity was detected in two genetic models with no sign of publication bias. We attempted to identify the source of heterogeneity by conducting meta-regression; however, no contribution to the heterogeneity was found. The sensitivity analysis indicated that the pooled effect size was not influenced by any single study, indicating satisfactory robustness of the present study. Therefore, we concluded that the synthesized effects and conclusions about TNF-α polymorphism were solid. Ethics Ethics Committee Approval: No applicable, since this is a metaanalysis. Informed Consent: Meta-analysis study. Authorship Contributions Concept: Y. Lin; Design: Y. Lin; Data Collection or Processing: Y. Li; Analysis or Interpretation: Y. Li, Y. Lin; Literature Search: Y. Li, Y. Lin; Writing: Y. Li, Y. Lin. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Kyle RA, Therneau TM, Rajkumar SV, Offord JR, Larson DR, Plevak MF, Melton LJ 3rd. A long-term study of prognosis in monoclonal gammopathy of undetermined significance. N Engl J Med 2002;346:564-569.

Li Y and Lin Y: Meta-Analysis on Multiple Myeloma

Turk J Hematol 2019;36:72-80

2. Morabito F, Recchia AG, Mazzone C, Gentile M. Targeted therapy of multiple myeloma: the changing paradigm at the beginning of the new millennium. Curr Cancer Drug Targets 2012;12:743-756.

17. Brown EE, Lan Q, Zheng T, Zhang Y, Wang SS, Hoar-Zahm S, Chanock SJ, Rothman N, Baris D. Common variants in genes that mediate immunity and risk of multiple myeloma. Int J Cancer 2007;120:2715-2722.

3. Siegel RL, Miller KD, Jemal A. Cancer statistics, 2016. CA Cancer J Clin 2016;66:7-30.

18. Nielsen KR, Rodrigo-Domingo M, Steffensen R, Baech J, Bergkvist KS, Oosterhof L, Schmitz A, Bødker JS, Johansen P, Vogel U, Vangsted A, Dybkær K, Bøgsted M, Johnsen HE. Interactions between SNPs affecting inflammatory response genes are associated with multiple myeloma disease risk and survival. Leuk Lymphoma 2017;58:2695-2704.

4. Palumbo A, Anderson K. Multiple myeloma. N Engl J Med 2011;364:1046-1060. 5. Chubb D, Weinhold N, Broderick P, Chen B, Johnson DC, Försti A, Vijayakrishnan J, Migliorini G, Dobbins SE, Holroyd A, Hose D, Walker BA, Davies FE, Gregory WA, Jackson GH, Irving JA, Pratt G, Fegan C, Fenton JA, Neben K, Hoffmann P, Nöthen MM, Mühleisen TW, Eisele L, Ross FM, Straka C, Einsele H, Langer C, Dörner E, Allan JM, Jauch A, Morgan GJ, Hemminki K, Houlston RS, Goldschmidt H. Common variation at 3q26.2, 6p21.33, 17p11.2 and 22q13.1 influences multiple myeloma risk. Nat Genet 2013;45:1221-1225. 6. Wang X, An G, Wang J, Zhang Y, Li Q, Wei H, Qiu L, Ru K. The association of HLA-C alleles with multiple myeloma in Chinese patients. Exp Hematol Oncol 2018;7:19. 7. Beksac M, Gragert L, Fingerson S, Maiers M, Zhang MJ, Albrecht M, Zhong X, Cozen W, Dispenzieri A, Lonial S, Hari P. HLA polymorphism and risk of multiple myeloma. Leukemia 2016;30:2260-2264. 8. Wei X, Calvo-Vidal MN, Chen S, Wu G, Revuelta MV, Sun J, Zhang J, Walsh MF, Nichols KE, Joseph V, Snyder C, Vachon CM, McKay JD, Wang SP, Jayabalan DS, Jacobs LM, Becirovic D, Waller RG, Artomov M, Viale A, Patel J, Phillip J, Chen-Kiang S, Curtin K, Salama M, Atanackovic D, Niesvizky R, Landgren O, Slager SL, Godley LA, Churpek J, Garber JE, Anderson KC, Daly MJ, Roeder RG, Dumontet C, Lynch HT, Mullighan CG, Camp NJ, Offit K, Klein RJ, Yu H, Cerchietti L, Lipkin SM. Germline lysine-specific demethylase 1 (LSD1/KDM1A) mutations confer susceptibility to multiple myeloma. Cancer Res 2018;78:2747-2759. 9. Li N, Johnson DC, Weinhold N, Kimber S, Dobbins SE, Mitchell JS, Kinnersley B, Sud A, Law PJ, Orlando G, Scales M, Wardell CP, Försti A, Hoang PH, Went M, Holroyd A, Hariri F, Pastinen T, Meissner T, Goldschmidt H, Hemminki K, Morgan GJ, Kaiser M, Houlston RS. Genetic predisposition to multiple myeloma at 5q15 is mediated by an ELL2 enhancer polymorphism. Cell Rep 2017;20:2556-2564. 10. Kriegler M, Perez C, DeFay K, Albert I, Lu SD. A novel form of TNF/cachectin is a cell surface cytotoxic transmembrane protein: ramifications for the complex physiology of TNF. Cell 1988;53:45-53. 11. Wilson AG, Symons JA, McDowell TL, McDevitt HO, Duff GW. Effects of a polymorphism in the human tumor necrosis factor alpha promoter on transcriptional activation. Proc Natl Acad Sci U S A 1997;94:3195-3199. 12. Morgan GJ, Adamson PJ, Mensah FK, Spink CF, Law GR, Keen LJ, Roman E, Davies FE, Rollinson S, Child JA, Bidwell JL. Haplotypes in the tumour necrosis factor region and myeloma. Br J Haematol 2005;129:358-365. 13. Kádár K, Kovács M, Karádi I, Melegh B, Pocsai Z, Mikala G, Tordai A, Szilágyi A, Adány R, Füst G, Várkonyi J. Polymorphisms of TNF-alpha and LT-alpha genes in multiple myeloma. Leuk Res 2008;32:1499-1504. 14. Jin HY, Wang DX, Guo C, Chen XD, Jiang H, Hou J. Relationship between the polymorphism of promoter region in TNF-α gene and the susceptibility to multiple myeloma. Current Immunology 2004;24:407-409. 15. Zheng C, Huang DR, Bergenbrant S, Sundblad A, Osterborg A, Björkholm M, Holm G, Yi Q. Interleukin 6, tumour necrosis factor α, interleukin 1β and interleukin 1 receptor antagonist promoter or coding gene polymorphisms in multiple myeloma. Br J Haematol 2000;109:39-45. 16. Martino A, Campa D, Jurczyszyn A, Martínez-López J, Moreno MJ, Varkonyi J, Dumontet C, García-Sanz R, Gemignani F, Jamroziak K, Stępieł A, Jacobsen SE, Andersen V, Jurado M, Landi S, Rossi AM, Lesueur F, Marques H, Dudziński M, Wątek M, Moreno V, Orciuolo E, Petrini M, Reis RM, Ríos R, Sainz J, Vogel U, Buda G, Vangsted AJ, Canzian F. Genetic variants and multiple myeloma risk: IMMEnSE validation of the best reported associations--an extensive replication of the associations from the candidate gene era. Cancer Epidemiol Biomarkers Prev 2014;23:670-674.

19. Du J, Yuan Z, Zhang C, Fu W, Jiang H, Chen B, Hou J. Role of the TNF-α promoter polymorphisms for development of multiple myeloma and clinical outcome in thalidomide plus dexamethasone. Leuk Res 2010;34:1453-1458. 20. Liu Y, Zhang P, Song W, Bai X, Liu J, Song B. Polymorphisms of tumor necrosis factor and susceptibility to multiply myeloma. Chin J Cancer Prev Treat 2012;19:1696-1699. 21. Neben K, Mytilineos J, Moehler TM, Preiss A, Kraemer A, Ho AD, Opelz G, Goldschmidt H. Polymorphisms of the tumor necrosis factor-alpha gene promoter predict for outcome after thalidomide therapy in relapsed and refractory multiple myeloma. Blood 2002;100:2263-2265. 22. Yakupova EV, Grinchuk OV, Kalimullina DKh, Bakirov BA, Galimova RR, Makarova OV, Khusnutdinova EK, Viktorova TV. Molecular genetic analysis of the interleukin 6 and tumor necrosis factor alpha gene polymorphisms in multiple myeloma. Mol Biol (Mosk) 2003;37:420-424. 23. Au WY, Fung A, Wong KF, Chan CH, Liang R. Tumor necrosis factor alpha promoter polymorphism and the risk of chronic lymphocytic leukemia and myeloma in the Chinese population. Leuk Lymphoma 2006;47:2189-2193. 24. Despotovic M, Stoimenov TJ, Stankovic I, Pavlovic D, Sokolovic D, Cvetkovic T, Kocic G, Basic J, Veljkovic A, Djordjevic B. Gene polymorphisms of tumor necrosis factor alpha and antioxidant enzymes in bronchial asthma. Adv Clin Exp Med 2015;24:251-256. 25. Balkwill F. Tumour necrosis factor and cancer. Nat Rev Cancer 2009;9:361-371. 26. Al Obeed OA, Alkhayal KA, Al Sheikh A, Zubaidi AM, Vaali-Mohammed MA, Boushey R, Mckerrow JH, Abdulla MH. Increased expression of tumor necrosis factor-α is associated with advanced colorectal cancer stages. World J Gastroenterol 2014;20:18390-18396. 27. Abraham LJ, Kroeger KM. Impact of the -308 TNF promoter polymorphism on the transcriptional regulation of the TNF gene: relevance to disease. J Leukoc Biol 1999;66:562-566. 28. Filella X, Blade J, Guillermo AL, Molina R, Rozman C, Ballesta AM. Cytokines (IL-6, TNF-alpha, IL-1alpha) and soluble interleukin-2 receptor as serum tumor markers in multiple myeloma. Cancer Detect Prev 1996;20:52-56. 29. Jurisić V, Colović M. Correlation of sera TNF-alpha with percentage of bone marrow plasma cells, LDH, β2-microglobulin, and clinical stage in multiple myeloma. Med Oncol 2002;19:133-139. 30. Lee C, Oh JI, Park J, Choi JH, Bae EK, Lee HJ, Jung WJ, Lee DS, Ahn KS, Yoon SS. TNFα mediated IL-6 secretion is regulated by JAK/STAT pathway but not by MEK phosphorylation and AKT phosphorylation in U266 multiple myeloma cells. Biomed Res Int 2013;2013:580135. 31. Fishman M. Cytolytic activities of activated macrophages versus paraformaldehyde-fixed macrophages; soluble versus membraneassociated TNF. Cell Immunol 1991;137:164-174. 32. Aversa G, Punnonen J, de Vries JE. The 26-kD transmembrane form of tumor necrosis factor alpha on activated CD4+ T cell clones provides a costimulatory signal for human B cell activation. J Exp Med 1993;177:1575-1585. 33. Ghamari E, Farnia P, Saif S, Marashian M, Ghanavi J, Farnia P, Velayati AA. Comparison of single nucleotide polymorphisms [SNP] at TNF-α promoter region with TNF receptor 2 (TNFR2) in susceptibility to pulmonary tuberculosis; using PCR-RFLP technique. Am J Clin Exp Immunol 2016;5:55-61. 34. Shen GQ, Abdullah KG, Wang QK. The TaqMan method for SNP genotyping. Methods Mol Biol 2009;578:293-306.

RESEARCH ARTICLE DOI: 10.4274/tjh.galenos.2019.2018.0219 Turk J Hematol 2019;36:81-87

Prognostic Factors in Elderly Patients with Diffuse Large B-Cell Lymphoma and Their Treatment Results Yaşlıların Diffüz Büyük B Hücreli Lenfoması Tedavi Sonuçları ve Etkileyen Prognostik Faktörler Süleyman Cem Adıyaman1, İnci Alacacıoğlu2, Ayça Ersen Danyeli3, Doğuş Türkyılmaz2, Ömür Gökmen Sevindik2, Fatih Demirkan2, Özden Pişkin2, Mehmet Ali Özcan2, Bülent Ündar2, Sermin Özkal3, Güner Hayri Özsan2 1Dokuz Eylül University Faculty of Medicine, Department of Internal Medicine, İzmir, Turkey 2Dokuz Eylül University Faculty of Medicine, Department of Hematology, İzmir, Turkey 3Dokuz Eylül University Faculty of Medicine, Department of Pathology, İzmir, Turkey

Abstract

Öz

Objective: Diffuse large B-cell lymphoma (DLBCL) is the most common type of non-Hodgkin lymphoma (NHL). The treatment of older NHL patients has always been a struggle; however, treatment statistics have begun showing favorable results similar to those of younger DLBCL patients thanks to newer treatment protocols. Here, we analyze the progress of our own elderly DLBCL patients who were followed between 2000 and 2016 in our center.

Amaç: Diffüz büyük B hücreli lenfoma (DBBHL), Hodgkin dışı lenfomalar (NHL) arasında en sık görülen tiptir. Yaşlı NHL hastalarının tedavisi genellikle zorlu olmakla beraber günümüzde gelişen tedavi protokolleri ile birlikte yaşlı hastalarda da genç DBBHL hastalarına benzer oranda daha iyimser sonuçlar elde edilmektedir. Bu çalışmaya Dokuz Eylül Üniversitesi Hematoloji Anabilim Dalı’nda 2000-2016 yılları arasında takip ve tedavi edilmiş 87 yaşlı DBBHL hastası dahil edildi.

Materials and Methods: Eighty-seven DLBCL patients, who were diagnosed and treated in the Dokuz Eylül University Department of Hematology between 2000 and 2016, were included in this study. Median age was 72 (65-89) years and 13 (14.9%) patients were older than 80 years. Results: Median follow-up time was 19 months and 45 patients (51.7%) died during the follow-up period. Median overall survival (OS) was 55 months and median progression-free survival was calculated as 27 months. Sixty-three patients (72.4%) received standard R-CHOP therapy. Complete response was seen in 46 (52.9%) patients. The median survival time for patients who had complete response was 136 months (p<0.001); however, OS was not statistically different between older (>80 years) and younger patients (p=0.236). Conclusion: According to our findings, we think that being able to complete standard R-CHOP therapy is vital for the survival rate of elderly DLBCL patients.

Gereç ve Yöntemler: Yaş ortalaması 72 (65-89), 80 yaşının üzerinde 13 (%14,9) hasta mevcuttu. Ortalama takip süresi 19 ay olup, tüm takip süresinde hastaların 45’inin (%51,7) öldüğü gözlendi. Bulgular: Ortalama genel sağkalım süresi 55 ay iken progresyonsuz sağkalım süresi 27 ay olarak hesaplandı. Hastaların 63’ünün (%72,4) standart R-CHOP tedavisi almış olduğu görüldü. Ek olarak hastaların 46’sında (%52,9) tam yanıt alındığı gözlendi. Tam yanıt izlenen hastaların ortalama genel sağkalım süresi 136 ay olarak saptandı (p<0,001), ancak, 80 yaş üzeri hastalar ile altındaki hastaların genel sağkalım süreleri arasında anlamlı istatistiksel fark izlenmedi (p=0,236). Sonuç: Bu veriler ışığında yaşlı DBBHL’li hastalarda standart R-CHOP tedavisinin tamamlanmasının sağkalım süresine önemli etkisi bulunduğunu söyleyebiliriz. Anahtar Sözcükler: Lenfoid neoplaziler, B hücreli neoplaziler, Lenfomalar, Hodgkin dışı Lenfoma

Keywords: Lymphoid cell neoplasms, B-Cell neoplasms, Lymphomas, Non-Hodgkin lymphoma

Address for Correspondence/Yazışma Adresi: Süleyman Cem ADIYAMAN, M.D., Dokuz Eylül University Faculty of Medicine, Department of Internal Medicine, İzmir, Turkey Phone : +90 536 355 63 73 E-mail : cemadiyaman@hotmail.com ORCID-ID: orcid.org/0000-0001-5404-9270

Received/Geliş tarihi: June 25, 2018 Accepted/Kabul tarihi: February 06, 2019

Adıyaman SC, et al: Prognostic Factors in Elderly Patients with Diffuse DLBCL and Their Treatment Results

Turk J Hematol 2019;36:81-87

Introduction

Immunohistochemical Method

Diffuse large B-cell lymphoma (DLBCL) is the most common non-Hodgkin lymphoma (NHL) type and accounts for 30%40% of all NHL cases [1]. In the United States, its incidence is 7/100,000 [2], whereas in Europe it is 4.9/100,000 [3]. In Turkey, based on 2014 data, the incidence of DLBCL is 6/100,000 [4]. The diagnosis rate for DLBCL is higher in Caucasians than Africans and Asians [5]. The median age of DLBCL patients is 64 years and it is slightly more common in men than women (male/ female=1.5) [2].

IH stains were applied to some patients’ biopsy materials whose subtypes were unknown. To achieve that, formalin-fixed, paraffin-embedded sections of 4 µm were collected from patient samples. On lysine slides, CD10 (VENTANA anti-CD-10 SP67 1:100 dilution), Bcl-6 (Cell Marque, 1:200 dilution), and MUM-1 (VENTANA, 1:100 dilution) stains were applied. Afterward, these slides were analyzed under a microscope.

According to recent studies, approximately 70% of all newly diagnosed neoplasms will be observed in geriatric patients by 2020 [6]. Nearly 53% of all the newly diagnosed NHL patients are over 65 years old [7]. Because of their comorbid diseases and their frail conditions, elderly patients have always been considered poor responders to treatment in comparison to younger patients. However, recent studies with newer treatment agents have shown that older DLBCL patients may also respond well to treatment, like younger patients. According to early studies conducted with elderly DLBCL patients when the CHOP regimen alone was the standard of care, the rate of complete response (CR) was 40% to 50% and 3-year overall survival (OS) was around 30%, which was considered unsatisfactory, whereas in studies conducted in the rituximab era, CR was reported as 60% to 80% and 3-year overall survival rates were found to be around 70% [8]. In light of this information, it is especially important to consider the right treatment option for elderly DLBCL patients. In this study, we analyzed the progress of our own elderly DLBCL patients who were followed between 2000 and 2016 in our center.

Materials and Methods A total of 87 patients were included in this study, all of whom were diagnosed and followed between 2000 and 2016 in the Dokuz Eylül University Hospital Department of Hematology. Consent of the patients and approval were obtained from Dokuz Eylül University Ethics Board (date: 28.1.2016 2425-GOA, approval number: 2016/03-24) before the start of the study. Patients who had previously been diagnosed with another form of malignancy were excluded from the study. In this retrospective study, university archives were used to analyze patient information such as age, time of diagnosis, stage, treatment regimes, treatment results, side effects, and comorbid diseases. Additionally, in order to assess the pathological subtype of DLBCL, immunohistochemical (IH) staining was applied to some of our patients’ biopsy materials by the department of pathology with the informed consent of patients and/or their relatives. 82

Statistical Analysis Assessment of the acquired data was done with SPSS 17. The suitability of the numeric variables was assessed using the Kolmogorov-Smirnov test. The chi-square test was used to test the relationship between two categorical variables. Kaplan-Meier analysis was used in order to show the impact of prognostic factors on survival rates. For multivariate data analysis, the Cox regression method was used. Probability values less than 0.05 were considered statistically significant.

Results The median age of patients was 72 (65-89) years. Forty-seven patients (54%) were male and 40 (46%) female. Seventy-four (85.1%) of our patients were younger than 80 years old and 13 (14.9%) of them were older than 80. Median follow-up time was 19 (1-180) months. In total, 45 patients (51.7%) died during follow-up. Comorbid diseases such as type 2 diabetes, hypertension, and congestive heart failure were seen in 62 of our patients (71.3%), whereas 25 (28.7%) patient had no previously diagnosed comorbidities (Table 1). Among the 51 patients whose subtypes could be identified by immunochemical staining, 14 (27.5%) were classified as having the GCB (germinal-center type B-cell) subtype and 37 (72.5%) as non-GCB. Patients were also categorized using Ann Arbor staging: 11 (12.6%) patients as stage 1, 31 (35.6%) as stage 2, 22 (25.3%) as stage 3, and 23 (26.4) as stage 4. We also calculated patients’ International Prognostic Index (IPI) scores. Patients with IPI scores of 2 and 3 were in the majority with 30 (34.5%) patients each, while there were 15 (17.2%) patients with an IPI Table 1. Patient demographics and clinical data. Age, mean (range)

72 (65-89)

Age, n (%) <80

74 (85.1%)

>80

13 (14.9%)

Sex, n (%) Male

47 (54%)

Female

40 (46%)

Comorbidity, n (%) Yes No

62 (71.3%) 25 (28.7%)

Turk J Hematol 2019;36:81-87

AdÄąyaman SC, et al: Prognostic Factors in Elderly Patients with Diffuse DLBCL and Their Treatment Results

score of 4, 12 (13.8%) patients with an IPI score of 1, and no patients with an IPI score of 5 (Table 2). Most of the patients (72.4%) were treated with R-CHOP at regular dosage, 2 patients (2.3%) with reduced-dose R-CHOP, 4 patients (4.6%) with R-CEOP, 4 patients (4.6%) with R-CVP, 10 patients (11.5%) with CHOP, 1 patient (1.1%) with miniCEOP, and 3 patients (3.4%) with R-steroid. Anthracyclinebased chemotherapy was given to 75 patients (86.2%) in total, whereas rituximab was used for 76 (87.4%) of all patients. Additionally, high-risk patients received the proper intrathecal methotrexate as part of the CNS prophylaxis strategy according to their National Comprehensive Cancer Network central nervous system risk score. Radiotherapy was used in 24 (27.6%) patients (Table 3). Table 2. Tumor-related characteristics. Immunohistochemical subtypes, n (%) Germinal Non-germinal

14 (27.5%) 37 (72.5%)

Staging (Ann Arbor), n (%) I II III IV

11 (12.6%) 31 (35.6%) 22 (25.3%) 23 (26.4%)

IPI score, n (%) 1 2 3 4

12 (13.8%) 30 (34.5%) 30 (34.5%) 15 (17.2%)

IPI: International Prognostic Index.

Sixty patients (69%) were able to complete their designated therapy and, among those patients, 46 (52.9%) had CR. When comparing IH subtypes and treatment results, we saw that 9 (64.3%) patients with the GCB subtype had CR, whereas in patients with non-GCB subtypes, 14 (37.8%) had CR. However, statistically we found no significant difference between the IH subtypes (p=0.174). CR was seen in 6 patients (46.2%) who were older than 80 and in 40 patients (46%) who were under the age of 80; there was no statistically significant difference between the treatment results and age (p=0.585). The most common side effect in this study was neutropenia, which occurred in 65 (74.7%) of our patients. Other side effects were heart failure, neuropathy, pneumonia, sepsis, renal failure, thrombosis, and reactivation of tuberculosis. Median progression-free survival time (PFS) was 27 months. Median OS time in our study was 55 months, while 3-year, 5-year, and 10-year OS was calculated as 54%, 44%, and 33%, respectively. For patients older than 80 years old, OS was 31 months, while in younger patients it was 57 months. However, no significant statistical difference was found between the two groups (p=0.236) (Figure 1). OS in patients with the GCB subtype was 27 months and in patients with non-GCB subtype the OS was 21 months; between these two subtypes we found no statistically significant difference (p=0.218) (Figure 2). In patients who could complete standard-dose R-CHOP therapy, 3-year OS was 48% for the GCB group and 42% for non-GCB. Even though we found no statistical difference between stage and OS (p=0.999), we did find a statistical difference between IPI scores and survival rates. Among patients whose IPI score

Table 3. Patient treatment statistics. Treatment regimens, n (%)

General

>80 years old

<80 years old

R-CHOP standard R-CHOP, dose-reduced CHOP R-CEOP R-CVP MINI-CEOP R-Steroid

63 (72.4%) 2 (2.3%) 10 (11.5%) 4 (4.6%) 4 (4.6%) 1 (1.1%) 3 (3.4%)

7 (53.8%) 0 0 0 2 (15.4%) 1 (7.7%) 3 (23.1%)

56 (75.7%) 2 (2.7%) 10 (13.5%) 4 (5.4%) 2 (2.7%) 0 0

75 (86.2%) 12 (12.8%)

7 (53.8%) 6 (46.2%)

68 (91.9%) 6 (8.1%)

76 (87.4%) 11 (12.6%)

12 (92.3%) 1 (7.7%)

64 (86.5%) 10 (13.5%)

24 (27.6%) 63 (72.4%)

4 (30.8%) 9 (69.2%)

20 (27%) 54 (73%)

Anthracycline, n (%) Received Did not receive Rituximab, n (%) Received Did not receive Radiotherapy, n (%) Received Did not receive

AdÄąyaman SC, et al: Prognostic Factors in Elderly Patients with Diffuse DLBCL and Their Treatment Results

was 1, median survival time was 97 months, and in those who had an IPI score of 4, it was 14 months (p=0.008). When the general survival rate was evaluated in our elderly patient group, IPI score was detected as an independent predictive feature even if it was adapted using sex and comorbidity in Cox regression analysis (p=0.003). The median survival time was 69 months for patients who had no previous comorbid disease and 35 months in patients who had previously been diagnosed with a chronic comorbid disease; statistically, there was no significant difference (p=0.366). The 3-year OS was calculated as 70% in patients without

Turk J Hematol 2019;36:81-87

comorbidities and 45% for those who had an accompanying chronic disease (Figure 3). The median survival rate for patients who received rituximab was 58 months and 3-year OS was 57%, whereas for patients who did not receive rituximab, the median survival rate was 27 months and 3-year OS was found as 36% (p=0.379). Additionally, 5-year OS and 10-year OS for patients who received rituximab therapy was 47% and 37%, respectively. The median survival of patients who had a complete treatment response was 136 months, which was statistically significant compared to other patients who had partial response or nonresponders (p<0.001) (Figure 4).

Figure 1. Overall survival and age. OS: Overall survival.

Figure 3. Overall survival and comorbid diseases. OS: Overall survival.

Figure 2. Overall survival and immunohistochemical subtypes.

Figure 4. Overall survival and treatment response.

OS: Overall survival.

Turk J Hematol 2019;36:81-87

AdÄąyaman SC, et al: Prognostic Factors in Elderly Patients with Diffuse DLBCL and Their Treatment Results

Relapse was seen in 22 patients (25.3%). Median relapse time was 16.5 (3-132) months. The OS in patients with an early relapse (<1 year) was 14 months, whereas it was 69 months for those with late relapse (>1 year), which was statistically significant (p=0.025). The PFS in patients with early relapse (<1 year) was 8 months, whereas it was 27 months for those with late relapse (>1 year), which was also statistically significant (p<0.001).

Discussion DLBCL is the most common type of NHL and its prevalence grows with age [1]. Treatment options have always been a struggle in elderly patients for reasons like frailty and comorbid diseases [9]. According to other previous studies, being unable to receive appropriate treatment, the standard treatment regimen being R-CHOP, usually has negative effects in elderly patients [10]. DLBCL is an aggressive hematologic malignancy and patients diagnosed with DLBCL have an average lifespan of less than 1 year without treatment. However, as recent studies show, with newer and improved therapy options the survival rates are much better than before in older DLBCL patients [11].

responders to treatment compared to patients with non-GCB subtypes; however, according to recent studies conducted after the rituximab era, the two subtypes have begun showing similar treatment results. A 10-year prospective study conducted in Finland with 194 DLBCL patients showed that adding rituximab to therapy leads to better survival rates in patients with nonGCB subtypes [16]. Though it seems that there was a favorable outcome in our study for patients with the GCB subtype, no statistically significant difference was discovered (p=0.205). This may be explained by the small number of patients and the fact that we included patients from both the pre-rituximab and post-rituximab era in our study population. There are many studies in the literature that analyzed the relationship between age and treatment results. A large retrospective study conducted by Thieblemont et al. [17] after the rituximab era in 2008 revealed that even though younger patients showed more favorable results, there were no statistically significant differences between younger patients and patients who were older than 80. We also found similar results within our study group; patients older than 80 had 46.2% CR whereas younger patients had 46% CR (p=0.572).

In our study, we analyzed DLBCL patients who were older than 65 years retrospectively. Our population was between the age of 65 and 89 (mean: 72) years and the male/female ratio was 1.17, which was similar to the literature [2]. Additionally, we studied IH subgroups based on the Hans algorithm [12]. In various other studies, it has been shown that non-GCB subtypes are more common in older DLBCL patients. In 51 patients whose subgroups we could identified, we found that most of them (72.5%) were patients with non-GCB subtype, which was similar to the literature [13]. Based on the literature, 60% of patients diagnosed with DLBCL who are older than 70 have an accompanying chronic disease [14], while in our study group 62 patients (71.3%) had other comorbidities and the most common comorbid disease was diabetes mellitus type 2 (17.2%), followed by hypertension (14.9%) and heart failure (14.9%), respectively. In our study group, patients mostly received standard-dose R-CHOP therapy (72.4%). In the literature, neutropenic fever is the most common side effect seen in DLBCL patients, and in elderly patients its frequency is nearly 40% [15]. Consistent with other studies, neutropenic fever was the most common side effect (42.5%) in our study.

In our study, median survival time in general was calculated as 55 months. We also found that, for patients younger than 80 years old, overall median survival time was 57 months, whereas for older patients it was 31 months. However, there were no statistically significant differences between the two groups (p=0.236). In several large studies of DLBCL patients, in the German DLBCL group of Pfreundschuh et al. [11], in patients between the ages of 60 and 80 who received rituximab, the 3-year OS was found as 78%. In another large-scale study conducted by the GELA group, the 10-year OS was shown as 44% for patients who received rituximab treatment [18]. Among the patients receiving rituximab in our study, the 3-year OS was calculated as 54% and 10-year OS was 37%. For patients older than 80 years, the 3-year OS was 38%, and for those younger than 80 it was 58%. The difference between the literature and our study might be explained by the different current lifespans of those countries (France, Germany, etc.) and ours. According to 2015 WHO data, life expectancy in Turkey is 75.8 years, while it is 82.5 in France and 81.1 in Germany. Additionally, in our study population, we had patients older than 80 years old and that was also different from those larger studies in which the maximum age was 80.

In this study, the treatment completion rate in general was 69% and 52.9% of the patients had complete treatment response. Furthermore, CR was higher (76.1%) in patients who received R-CHOP therapy, which was similar to other larger randomized studies such as RICOVER-60 [11]. Additionally, we saw a 64.3% CR rate in patients with the GCB subtype, whereas 37.8% patients with non-GCB had CR. According to other studies in the past, patients with GCB subtypes were found to be better

Even though we could not identify all of our patientsâ&#x20AC;&#x2122; subgroups, we found that median survival time was 27 months for GCB types and 21 months for patients with non-GCB subtypes, for which there was not a significant statistical difference (p=0.218). In a large study of DLBCL patients between the ages of 23 and 88 conducted by Seki et al. [19], 3-year OS was found as 68% in patients with the GCB subtype and 67% for nonGCB among patients who received R-CHOP. In our study, we 85

Adıyaman SC, et al: Prognostic Factors in Elderly Patients with Diffuse DLBCL and Their Treatment Results

found that the 3-year OS of patients who received R-CHOP with GCB subtype was 48% while it was 42% for non-GCB subtypes, which was consistent with the literature of the postrituximab era. When we analyzed the effect of disease stage on patients, we found no statistical difference; median survival time of patients with stage 1 was found as 72 months and that of stage 4 was calculated as 69 months (p=0.999). However, like other previous studies [20], we found a statistically significant difference regarding the IPI scores of our patients. The median survival time was 97 months for patients with IPI scores of 1 and 14 months for patients with IPI scores of 4 (p=0.008). In the literature, there are studies that show the negative effects of comorbidities on elderly DLBCL patients [14]. In our study, the median survival time for patients without any comorbid diseases was found as 69 months, whereas it was 35 months for patients with an accompanying chronic disease; however, though the survival times of the patients without comorbidities seemed favorable, there was not a statistically significant difference (p=0.366). Before the age of rituximab, anthracycline-based CHOP therapy was considered the standard therapy for patients with DLBCL and the cure rates in those times were around 50%-60% for younger patients and 25%-30% for older patients [21,22,23]. In the GELA group study of Coiffier et al. [18], 10-year OS for the patients who only received CHOP therapy was 28% and they showed that adding rituximab to therapy increased the 10-year OS to 44%. Among our study group, the median survival time of patients receiving rituximab was calculated as 57 months, compared to 27 months for those who did not receive rituximab treatment. While we saw a tendency in favor of the rituximab group, it was not statistically significant (p=0.513). Despite old age and frailty, 60 (69%) of our patients could complete their designated therapies and 63 (72.4%) of them received full standard-dose R-CHOP therapy. Among those patients, we saw a complete treatment response in 46 (52.9%), among whom the median survival time was calculated as 136 months, and that was statistically significant (p<0.001). The median relapse time in our study was calculated as 16.5 months and the relapse rate was 25.3%. In other studies conducted among similarly aged patients (60-80 years), relapse rates were found to be generally higher (up to 51%) [8]. This difference might be explained by the fact that our study group was relatively smaller. However, similar to the literature, we did find a statistically significant difference between early relapses (<1 year) and late relapses (OS, p=0.025; PFS, p<0.001).

Conclusion We think that in elderly DLBCL patients, being able to complete the rituximab-based standard therapy regimen directly affects survival rates. Additionally, comorbidities and higher IPI scores have very important effects on the survival of DLBCL patients. 86

Turk J Hematol 2019;36:81-87

Based on our results, we can safely say that treating elderly DLBCL patients with standard R-CHOP therapy is very important and shows favorable results similar to those of younger patients. Ethics Ethics Committee Approval: Dokuz Eylül University (date: 28.1.2016 2425-GOA, approval number: 2016/03-24). Informed Consent: Informed consent was received from patients or their relatives. Authorship Contributions Surgical and Medical Practices: S.C.A., F.D., Ö.P., M.A.Ö., B.Ü., S.Ö., G.H.Ö.; Concept: S.C.A., İ.A., G.H.Ö., F.D., Ö.P., M.A.Ö., B.Ü.; Design: S.C.A., İ.A., F.D., Ö.P., M.A.Ö., B.Ü., S.Ö., G.H.Ö.; Data Collection or Processing: S.C.A., A.E.D., D.T.; Analysis or Interpretation: A.E.D., S.Ö., Ö.G.S.; Literature Search: S.C.A., D.T., Ö.G.S., A.E.D.; Writing: S.C.A., Ö.G.S., İ.A., D.T. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Swerdlow SH, Campo E, Pileri SA, Harris NL, Stein H, Siebert R, Advani R, Ghielmini M, Salles GA, Zelenetz AD, Jaffe ES. The 2016 revision of the World Health Organization classification of lymphoid neoplasms. Blood 2016;127:2375-2390. 2. Morton LM, Wang SS, Devesa SS, Hartge P, Weisenburger DD, Linet MS. Lymphoma incidence patterns by WHO subtype in the United States, 19922001. Blood 2006;107:265-276. 3. Sant M, Allemani C, Tereanu C, De Angelis R, Capocaccia R, Visser O, Marcos-Gragera R, Maynadié M, Simonetti A, Lutz JM, Berrino F; HAEMACARE Working Group. Incidence of hematologic malignancies in Europe by morphologic subtype: results of the HAEMACARE project. Blood 2010;116:3724-3734. 4. Republic of Turkey. Ministry of Health 2014 Statistics. Ankara, Ministry of Health, 2014. 5. Shirley MH, Sayeed S, Barnes I, Finlayson A, Ali R. Incidence of haematological malignancies by ethnic group in England, 2001-7. Br J Haematol 2013;163:465-477. 6. Balducci L. Geriatric oncology: challenges for the new century. Eur J Cancer 2000;36:1741-1754. 7. Morrison VA, Hamlin P, Soubeyran P, Stauder R, Wadhwa P, Aapro M, Lichtman SM; International Society of Geriatric Oncology. Approach to therapy of diffuse large B-cell lymphoma in the elderly: the International Society of Geriatric Oncology (SIOG) expert position commentary. Ann Oncol 2015;26:1058-1068. 8. Sarkozy C, Coiffier B. Diffuse large B-cell lymphoma in the elderly: a review of potential difficulties. Clin Cancer Res 2013;19:1660-1669. 9. Dixon DO, Neilan B, Jones SE, Lipschitz DA, Miller TP, Grozea PN, Wilson HE. Effect of age on therapeutic outcome in advanced diffuse histiocytic lymphoma: the Southwest Oncology Group experience. J Clin Oncol 1986;4:295-305. 10. Bastion Y, Blay JY, Divine M, Brice P, Bordessoule D, Sebban C, Blanc M, Tilly H, Lederlin P, Deconinck E, Salles B, Dumontet C, Brière J, Coiffier

Turk J Hematol 2019;36:81-87

Adıyaman SC, et al: Prognostic Factors in Elderly Patients with Diffuse DLBCL and Their Treatment Results

B. Elderly patients with aggressive non-Hodgkin’s lymphoma: disease presentation, response to treatment, and survival--a Groupe d’Etude des Lymphomes de l’Adulte study on 453 patients older than 69 years. J Clin Oncol 1997;15:2945-2953. 11. Pfreundschuh M, Schubert J, Ziepert M, Schmits R, Mohren M, Lengfelder E, Reiser M, Nickenig C, Clemens M, Peter N, Bokemeyer C, Eimermacher H, Ho A, Hoffmann M, Mertelsmann R, Trümper L, Balleisen L, Liersch R, Metzner B, Hartmann F, Glass B, Poeschel V, Schmitz N, Ruebe C, Feller AC, Loeffler M; German High-Grade Non-Hodgkin Lymphoma Study Group (DSHNHL). Six versus eight cycles of bi-weekly CHOP-14 with or without rituximab in elderly patients with aggressive CD20+B-cell lymphomas: a randomised controlled trial (RICOVER-60). Lancet Oncol 2008;9:105-116. 12. Hans CP, Weisenburger DD, Greiner TC, Gascoyne RD, Delabie J, Ott G, Müller-Hermelink HK, Campo E, Braziel RM, Jaffe ES, Pan Z, Farinha P, Smith LM, Falini B, Banham AH, Rosenwald A, Staudt LM, Connors JM, Armitage JO, Chan WC. Confirmation of the molecular classification of diffuse large B-cell lymphoma by immunohistochemistry using a tissue microarray. Blood 2004;103:275-282. 13. Mareschal S, Lanic H, Ruminy P, Bastard C, Tilly H, Jardin F. The proportion of activated B-cell like subtype among de novo diffuse large B-cell lymphoma increases with age. Haematologica 2011;96:1888-1890. 14. Janssen-Heijnen ML, van Spronsen DJ, Lemmens VE, Houterman S, Verheij KD, Coebergh JW. A population-based study of severity of comorbidity among patients with non-Hodgkin’s lymphoma: prognostic impact independent of International Prognostic Index. Br J Haematol 2005;129:597-606. 15. Pettengell R, Johnsen HE, Lugtenburg PJ, Silvestre AS, Dührsen U, Rossi FG, Schwenkglenks M, Bendall K, Szabo Z, Jaeger U. Impact of febrile neutropenia on R-CHOP chemotherapy delivery and hospitalizations among patients with diffuse large B-cell lymphoma. Support Care Cancer 2012;20:647-652. 16. Nyman H, Adde M, Karjalainen-Lindsberg ML, Taskinen M, Berglund M, Amini RM, Blomqvist C, Enblad G, Leppä S. Prognostic impact of

immunohistochemically defined germinal center phenotype in diffuse large B-cell lymphoma patients treated with immunochemotherapy. Blood 2007;109:4930-4935. 17. Thieblemont C, Grossoeuvre A, Houot R, Broussais-Guillaumont F, Salles G, Traullé C, Espinouse D, Coiffier B. Non-Hodgkin’s lymphoma in very elderly patients over 80 years. A descriptive analysis of clinical presentation and outcome. Ann Oncol 2008;19:774-779. 18. Coiffier B, Thieblemont C, Van Den Neste E, Lepeu G, Plantier I, Castaigne S, Lefort S, Marit G, Macro M, Sebban C, Belhadj K, Bordessoule D, Fermé C, Tilly H. Long-term outcome of patients in the LNH-98.5 trial, the first randomized study comparing rituximab-CHOP to standard CHOP chemotherapy in DLBCL patients: a study by the Groupe d’Etudes des Lymphomes de l’Adulte. Blood 2010;116:2040-2045. 19. Seki R, Ohshima K, Fujisaki T, Uike N, Kawano F, Gondo H, Makino S, Eto T, Moriuchi Y, Taguchi F, Kamimura T, Tsuda H, Ogawa R, Shimoda K, Yamashita K, Suzuki K, Suzushima H, Tsukazaki K, Higuchi M, Utsunomiya A, Iwahashi M, Imamura Y, Tamura K, Suzumiya J, Yoshida M, Abe Y, Matsumoto T, Okamura T. Prognostic impact of immunohistochemical biomarkers in diffuse large B-cell lymphoma in the rituximab era. Cancer Sci 2009;100:1842-1847. 20. Ziepert M, Hasenclever D, Kuhnt E, Glass B, Schmitz N, Pfreundschuh M, Loeffler M. Standard International Prognostic Index remains a valid predictor of outcome for patients with aggressive CD20+ B-cell lymphoma in the rituximab era. J Clin Oncol 2010;28:2373-2380. 21. McKelvey EM, Gottlieb JA, Wilson HE, Haut A, Talley RW, Stephens R, Lane M, Gamble JF, Jones SE, Grozea PN, Gutterman J, Coltman C, Moon TE. Hydroxyldaunomycin (Adriamycin) combination chemotherapy in malignant lymphoma. Cancer 1976;38:1484-1493. 22. O’Reilly SE, Connors JM, Macpherson N, Klasa R, Hoskins P. Malignant lymphomas in the elderly. Clin Geriatr Med 1997;13:251-263. 23. Connors JM, O’Reilly SE. Treatment considerations in the elderly patient with lymphoma. Hematol Oncol Clin North Am 1997;11:949-961.

RESEARCH ARTICLE DOI: 10.4274/tjh.galenos.2019.2018.0220 Turk J Hematol 2019;36:88-96

Comparison of Myeloablative Versus Reduced-Intensity Conditioning Regimens for Allogeneic Hematopoietic Stem Cell Transplantation in Acute Myeloid Leukemia: A Cohort Study Allojenik Hematopoetik Kök Hücre Nakli Yapılan Akut Myeloid Lösemili Hastalarda Myeloablatif Hazırlama Rejimi ile İndirgenmiş Yoğunlukta Hazırlama Rejiminin Karşılaştırılması: Kohort Çalışması Rafiye Çiftçiler, Hakan Göker, Haluk Demiroğlu, Elifcan Aladağ, Salih Aksu, Nilgün Sayınalp, Osman Özcebe, Fatma Tekin, Yahya Büyükaşık

İbrahim Celalettin Haznedaroğlu,

Hacettepe University Faculty of Medicine, Department of Hematology, Ankara, Turkey

Abstract

Öz

Objective: Allogeneic hematopoietic stem cell transplantation (HSCT) is an effective treatment modality for a variety of malignant and non-malignant hematologic disorders. Myeloablative conditioning (MAC) and reduced-intensity conditioning (RIC) regimens could have different clinical outcomes. This purpose of this study was to assess the long-term outcome of MAC versus RIC regimens in patients with acute myeloid leukemia (AML) undergoing allogeneic HSCT.

Amaç: Allojenik hematopoetik kök hücre nakli (AHKHN), çeşitli malign ve malign olmayan hematolojik hastalıklar için etkili bir tedavi yöntemidir. Myeloablatif hazırlama rejimi (MHR) ve düşük yoğunlukta hazırlama rejimleri farklı klinik sonuçlara sahip olabilir. Bu çalışmanın amacı, AHKHN uygulanan akut myeloid lösemili (AML) hastalarda myeloablatif ve indirgenmiş yoğunlukta hazırlama rejimlerinin uzun dönem sonuçlarını değerlendirmektir.

Materials and Methods: We retrospectively compared long-term outcomes with MAC and RIC regimens in patients with AML who underwent allo-HSCT at our tertiary transplantation center.

Gereç ve Yöntemler: Üçüncü basamak transplantasyon merkezimizde myeloablatif ve indirgenmiş yoğunlukta hazırlama rejimleri ile AHKHN uygulanan AML’li hastalarda uzun dönem sonuçları geriye dönük olarak karşılaştırıldı.

Results: We analyzed survival outcomes after MAC-HSCT versus RICHSCT among 107 adult patients with AML diagnosed from 2001 through 2017. Of those, 44 patients underwent a MAC regimen, whereas 63 patients received a RIC regimen. The median follow-up time was 37 months (range: 6-210) for the entire group. The 3-year overall survival (OS) for RIC and MAC patients was 67% and 60%, respectively (p>0.05). The 3-year progression-free survival (PFS) for RIC and MAC patients was 88% and 77%. In multivariate analysis, the type of conditioning regimen (RIC vs. MAC) did not influence PFS (p=0.24). Acute graft-versus-host disease (GVHD) was seen in five of the RIC patients and 9 of the MAC patients. Chronic GVHD was seen in 16 of the RIC patients and 6 of the MAC patients. There was no significant difference between the two groups in terms of acute GVHD (p=0.089), but there was a significant difference between the two groups in terms of chronic GVHD (p=0.03). Conclusion: This retrospective analysis confirmed that MAC and RIC regimens had a consistently equivalent rate of OS and PFS in AML patients who underwent allo-HSCT. The choice of MAC versus RIC conditioning regimen might be decided on the basis of patient and disease characteristics. Keywords: Acute myeloid leukemia, Allogeneic hematopoietic stem cell transplantation, Regimen

Bulgular: 2001-2017 yılları arasında AML tanısı almış 107 erişkin hastada AHKHN sonrasında sağkalım sonuçları analiz edildi. Ortanca takip süresi tüm hastalar için 37 aydı (6-210). İndirgenmiş yoğunlukta ve MHR alan hastalar için 3 yıllık genel sağkalım (GS), sırasıyla %67 ve %60 saptandı (p>0,05). İndirgenmiş yoğunlukta ve MHR alan hastalar için 3 yıllık progresyonsuz sağkalım (PS) %88 ve %77 olarak saptandı. Multivariate analizde hazırlama rejiminin PS’yi etkilemediği gözlendi (p=0,24). İndirgenmiş yoğunlukta hazırlama rejimi alan hastaların 5’inde ve MHR alan hastaların 9’unda akut graft-versus-host hastalığı (GVHH) gözlendi. İndirgenmiş yoğunlukta hazırlama rejimi alan hastaların 16’sında ve MHR alan hastaların 6’sında kronik GVHH gözlendi. İki grup arasında akut GVHH açısından anlamlı fark yoktu (p=0,089), ancak iki grup arasında kronik GVHH açısından anlamlı fark vardı (p=0,03). Sonuç: Bu retrospektif analizde, indirgenmiş yoğunlukta yada MHR rejimi ile AHKHN uygulanan AML hastalarında GS ve PS arasında anlamlı farklılık saptanmadı. AHKHN öncesi hazırlama rejimine hastaya ve hastalığın özelliğine göre karar verilmelidir. Anahtar Sözcükler: Akut myeloid lösemi, Allojenik hematopoetik kök hücre nakli, Rejim

Address for Correspondence/Yazışma Adresi: Rafiye ÇİFTÇİLER, M.D., Hacettepe University Faculty of Medicine, Department of Hematology, Ankara, Turkey Phone : +90 505 583 17 98 E-mail : rafiyesarigul@gmail.com ORCID-ID: orcid.org/0000-0001-5687-8531

Received/Geliş tarihi: June 26, 2018 Accepted/Kabul tarihi: February 04, 2019

Turk J Hematol 2019;36:88-96

Çiftçiler R, et al: Comparison of Myeloablative Versus Reduced-Intensity Conditioning Regimens

Introduction Allogeneic hematopoietic stem cell transplantation (allo-HSCT) is a therapy with curative potential in patients with acute myeloid leukemia (AML) as well as other hematologic neoplastic disorders [1]. The therapeutic outcome of allo-HSCT lies in the balance of the risk of the myelotoxic conditioning regimen before allo-HSCT and an immunological graft-versus-leukemia effect of donor cell reactivity against host malignant cells. In AML patients, complete remission (CR) can be achieved with induction chemotherapy in almost 65% of cases. However, the 5-year progression-free survival (PFS) rate is usually lower than 50% with conventional chemotherapy [2,3,4]. Recipient age, disease status at the time of allo-HSCT, donor type, cytogenetics of the AML patients, and hematopoietic cell transplantation (HCT)-comorbidity index contribute to the outcome variables in both myeloablative conditioning (MAC) and reduced-intensity conditioning (RIC) [5]. RIC regimens could decrease toxicities related to allo-HSCT with an acceptable relapse rate. Therefore, RIC has extended the approach of allo-HSCT in AML to include patients who are not eligible candidates for standard allo-HSCT because of their advanced age and/or comorbidities [6,7,8,9]. Despite the common use of RIC allo-HSCT for the treatment of AML patients, few randomized clinical trials have compared the survival outcomes between RIC and MAC in AML patients for allo-HSCT [10,11,12]. Furthermore, several previous studies comparing the survival outcomes of RIC and MAC allo-HSCT in AML patients have reported contradictory results. Thus, we retrospectively compared long-term outcomes of AML patients who received MAC and RIC regimens for allo-HSCT at our tertiary transplantation center. Additionally, we analyzed the patient characteristics, disease and transplantation characteristics, and incidences of acute and chronic graft-versus-host disease (GVHD). This is a retrospective study. It gives insight about the almost equivalent efficacy of RIC allo-HSCT in comparison to MAC allo-HSCT.

Materials and Methods Study Design, Data Collection, and Supportive Care Our study was performed in a retrospective manner. One hundred and seven patients with AML who received allo-HSCT in our tertiary transplant center between the years of 2001 and 2017 were evaluated. RIC and MAC patients were transplanted during the same period. Patients who had intermediate or adverse cytogenetic risk scores according to the European LeukemiaNet classification [13] and who failed the first induction chemotherapy or relapsed after complete remission underwent allo-HSCT. Patients without t(8;21), inv 16, t(15;17), and t(2;5) received allo-HSCT. Patients who had a performance status between 0 and 2 by Eastern Cooperative Oncology Group (ECOG) criteria also underwent allo-HSCT [14]. Patients received antiviral prophylaxis against herpes simplex and varicella zoster,

and prophylaxis against Pneumocystis jirovecii, for 6 months after allo-HSCT. As a result of application standards of the hospitals of our tertiary center, it was confirmed from patient records that all studied patients gave informed consent at the time of admission to the hospital and before the administration of allo-HSCT. Patient, Disease, and Transplant Characteristics In this study, there were 59 males and 48 females with a median age of 45 (range: 20-66) years at the time of transplantation. Stem cells were obtained from HLA-matched related donors. Donor peripheral blood stem cells were mobilized by granulocyte colony-stimulating factor. Peripheral blood stem cells were used for all patients who underwent allo-HSCT. The indications for selecting the RIC regimen were as follows: inadequate liver, kidney, or cardiac functions (defined as serum transaminase levels >3 times the upper limit of normal reference value, total bilirubin >2 mg/dL, creatinine clearance <60 mL/min, left ventricular ejection fraction <50%); serious fungal infection before allo-HSCT; ECOG performance status of >2; and the patient’s refusal of the MAC regimen before allo-HSCT. Conditioning Regimens Mainly the busulfan, fludarabine, and antithymocyte globulin (BU/FLU/ATG) RIC regimen was preferred. An intravenous BU/FLU/ATG regimen was applied for 63 patients, consisting of intravenous (i.v.) fludarabine at 50 mg/kg over 30 min for 6 consecutive days, 9 mg/kg or less oral busulfan (or intravenous equivalent q6h for 2 consecutive days), and ATG at 5 mg/kg/day for 3±1 consecutive days [15]. Phenytoin was given to prevent busulfan-induced seizures. The preferred MAC regimen was i.v. cyclophosphamide at 60 mg/kg daily for 2 days and busulfan at >8 mg/kg orally (or intravenous equivalent more than 0.8 mg/kg i.v. infusion q6h) for 4 days [16]. The other myeloablative conditioning regimen was i.v. BU at >0.8 mg/kg q6h for 4 days, plus i.v. FLU with ATG. GVHD Prophylaxis and Grading All patients received standard cyclosporine A (CsA) and methotrexate therapy for GVHD prophylaxis. Usually, tapering of immune suppression was initiated at 3 months after alloHSCT in the absence of acute or chronic GVHD, with the aim of stopping it by approximately 6 months after HSCT. Acute and chronic GVHD were graded according to the related consensus criteria [17,18]. Statistical Analysis SPSS 25 (IBM Corp., Armonk, NY, USA) was used to perform statistical analyses. The variables were investigated using visual (histograms, probability plots) and analytical methods (Kolmogorov-Smirnov/Shapiro-Wilk test) to determine whether they were normally distributed or not. Statistical 89

Çiftçiler R, et al: Comparison of Myeloablative Versus Reduced-Intensity Conditioning Regimens

comparisons were made using chi-square tests for categorical data. The Student t-test (for two independent samples) was used for comparison of continuous numerical data. Survival analyses were made using the Kaplan-Meier test. Multivariate analyses of predictors of survival were performed using the Cox regression test. Parameters with p≤0.20 in univariate tests were included in the multivariate analysis, and p<0.05 was considered to indicate statistical significance. Cumulative incidences of relapse and non-relapse mortality were calculated by means of the statistical software environment R version 2.15.2 [19].

Turk J Hematol 2019;36:88-96

of admission to the hospital and before the administration of chemotherapy and other relevant diagnostic/therapeutic standards of care.

Results Patient and Allo-HSCT Characteristics Patient and transplant characteristics for all patients with AML are summarized in Table 1. One hundred and seven patients with AML underwent allo-HSCT using peripheral blood stem cells from matched related donors. The RIC regimen was applied to 63 patients (58.8%) and the MAC regimen was applied to 44 patients (41.2%). The median age at transplantation was 51 (23-66) years for RIC patients and 43 (20-63) years for MAC patients. The median age at transplantation was significantly higher in RIC patients compared to MAC patients (p=0.002). There was no statistically significant difference between the two groups for sex of the patients (p=0.28). There was also no statistically significant difference between the two groups for

Ethics All of the ethical considerations were strictly followed in accordance with the 1964 Helsinki Declaration in the Hacettepe University Faculty of Medicine. As standard care/ action of the hospitals of the Hacettepe University Faculty of Medicine, it has been recognized from the patient records that all of the studied patients gave informed consent at the time

Table 1. Patient and transplantation characteristics of reduced-intensity conditioning and myeloablative conditioning patients. Parameters

RIC

MAC

63 (58.8%)

44 (41.2%)

Sex, male/female (%)

32/31 (50.7%/49.3%)

27/17 (61.3%/38.7%)

0.28

Donor sex, male/female (%)

34/29 (54%/46%)

30/14 (68.2/31.8%)

0.14

Sex combinations of patients and donors (recipient/donor)

0.84

Female/male

17 (27%)

14 (31.8%)

Male/female

14 (22.2%)

11 (25.0%)

Female/female

14 (22.2%)

3 (6.8%)

Male/male

18 (28.6%)

16 (36.4%)

51 (23-66)

43 (20-63)

0.002

1 (1.6%)

3 (6.8%)

39 (61.9%)

41 (93.2%)

23 (36.5%)

Favorable

Intermediate

42 (66.7%)

35 (79.5%)

Adverse

14 (22.2%)

5 (11.4%)

Missing

7 (11.1%)

4 (9.1%)

Median age at transplantation (range)

<0.001

ECOG performance status

Cytogenetic risk group

Cell counts in the transplant (CD34+)

0.25

7.5

(±4.0)x106/kg

9.3

(±5.6)x106/kg

CMV serologic status of the patients

0.52

CMV seropositive

62 (98.4%)

42 (95.4%)

CMV seronegative

1 (2.3%)

Missing

1 (1.6%)

1 (2.3%)

CMV status of the donors

0.88

CMV seropositive

54 (85.7%)

38 (86.4%)

CMV seronegative

1 (1.6%)

1 (2.3%)

Missing

8 (12.7%)

5 (11.4%)

CMV: Cytomegalovirus, RIC: reduced-intensity conditioning, MAC: myeloablative conditioning, n: number of patients.

0.06

Turk J Hematol 2019;36:88-96

Çiftçiler R, et al: Comparison of Myeloablative Versus Reduced-Intensity Conditioning Regimens

sex combinations of patients and donors (p=0.84). The number of patients graded with ECOG performance status 0, 1, and 2 was 1 (1.6%), 39 (61.9%), and 23 (36.5%) for RIC patients, while 3 (6.8%) and 41 (93.2%) MAC patients were graded with performance status 0 and 1, respectively [14]. There was a statistically significant difference between the two groups for ECOG performance status (p<0.001). Patients who received the MAC regimen had better ECOG performance status than patients who received the RIC regimen. Cytogenetic analyses were present for 96 patients: 42 (66.7%) patients were classified in the intermediate-risk group and 14 (22.2%) patients were in the adverse-risk group among RIC patients, while 35 (79.5%) patients were classified in the intermediate-risk group and 5 (11.4%) patients were in the adverse-risk group for MAC patients according to the European LeukemiaNet classification [13]. There was no statistically significant difference between the two groups for karyotype analyses (p=0.25). The CD34+ cell counts were 7.5 (±4.0)x106/kg for RIC patients and 9.3 (±5.6)x106/kg for MAC patients (p=0.06). Cytomegalovirus

seropositivity statuses of the patients and donors were similar between the two groups receiving RIC and MAC regimens (p=0.52). The HCT-comorbidity index of patients was statistically significantly different between the two groups (p<0.001). There was no statistically significant difference in terms of the disease risk index between the two groups of patients (p=0.31). The disease statuses of RIC and MAC patients during transplantation were similar. Primary graft failure was not observed in those patients. A total of 22 (34.9%) RIC recipients and 15 (34.1%) MAC recipients died during the follow-up period (p=0.93). The clinical characteristics of RIC and MAC patients are summarized in Table 2. Survival Outcomes The median follow-up period was 37 months (range: 6-210) for the all patients. The 6-month overall survival (OS) was 93% in RIC patients compared to MAC patients with 82%, with no

Table 2. Disease characteristics of the reduced-intensity conditioning and myeloablative conditioning patients. Parameters

RIC

MAC

22 (34.9%)

40 (90.9%)

15 (23.8%)

4 (9.1%)

24 (38.1%)

2 (3.2%)

HSCT-comorbidity index

p <0.001

Disease risk index

0.31

Low

Intermediate

48 (76.2%)

31 (70.5%)

High

11 (17.5%)

8 (18.2%)

Very high

1 (2.3%)

Missing

4 (6.3%)

4 (9.1%)

CR1 (%)

50 (79.4%)

32 (72.7%)

Subsequent CR (%)

10 (15.9%)

5 (11.4%)

Active disease (%)

3 (4.8%)

7 (15.9%)

After first induction chemotherapy

50 (83.3%)

32 (86.5%)

After second induction chemotherapy

10 (16.7%)

5 (13.5%)

Relapse

17 (77.3%)

8 (53.3%)

Infection

5 (22.7%)

5 (33.3%)

GVHD

1 (6.7%)

Heart attack

Disease status during transplantation

0.88

Complete remission

0.68

Causes of death

0.05

1 (6.7%)

Mortality

22/63 (34.9%)

15/44 (34.1%)

0.93

Relapse incidence

17/63 (27%)

8/44 (18.2%)

0.49

Median time from allo-HSCT to relapse (range) months

6 (0.7-37.8)

3.5 (1.0-18.9)

0.19

Non-relapse mortality

5/63, 7.9%

8/44, 18.1%

0.027

HSCT: Hematopoietic cell transplantation, RIC: reduced-intensity conditioning, MAC: myeloablative conditioning, CR1: first complete remission, CR: complete remission.

Çiftçiler R, et al: Comparison of Myeloablative Versus Reduced-Intensity Conditioning Regimens

statistically significant difference. The 3-year OS for RIC and MAC patients was 67% and 60%, respectively (p=0.22). The 5-year OS rates for RIC and MAC patients were both 60%. The OS for RIC patients was 135±12 versus 88±13.0 months for MAC patients with no statistically significant difference, as shown in Figure 1 (p=0.29). The 3-year PFS for RIC and MAC patients was 88% and 77%. The type of conditioning regimen did not influence 3-year PFS (p=0.24). The 5-year PFS for RIC and MAC patients was 59% and 59%, respectively. The PFS for RIC patients was different from the PFS for MAC patients (130±12 versus 96±12 months), but no statistically significant difference was observed, as shown in Figure 2 (p=0.78). Non-relapse Mortality

Turk J Hematol 2019;36:88-96

did not differ to a statistically significant extent (Figures 4 and 5; Table 3). Cox Regression Analysis In univariate analyses the parameters that affected OS were development of chronic GVHD (p=0.04) and CD34+ counts (p<0.001), as shown in Table 4. Cox regression analysis revealed CD34+ cell counts and development of chronic GVHD as parameters to predict OS. In univariate analyses the parameters that affected PFS were cytogenetics of the patients (p=0.08), disease risk index (p=0.006), and HCT-comorbidity index of the patients (p=0.10), as shown in Table 4. However, Cox regression analysis revealed no parameters to predict PFS.

Non-relapse mortality (NRM) was more frequent in the MAC patients than RIC patients (7/44, 15.9% vs. 5/63, 7.9%, p=0.027). The major causes of NRM were infections (5 vs. 5), GVHD (1 vs. 0), and heart attack (1 vs. 0) in the MAC and RIC patients, respectively. The cumulative relapse incidence was not statistically significantly different between RIC and MAC patients (p=0.49) (Figure 3). Acute and Chronic GVHD Nine of the RIC patients (14.3%) and 9 of the MAC patients (20.5%) developed acute GVHD. Sixteen of the RIC patients (25.4%) and 8 of the MAC patients (18.2%) developed chronic GVHD. There was no statistically significant difference between the RIC and MAC patients in terms of acute (p=0.40) and chronic GVHD (p=0.37). The cumulative incidence rates of acute (p=0.22) and chronic GVHD (p=0.79) in the RIC and MAC groups

Figure 2. The progression-free survival for RIC and MAC patients (p=0.78). PFS: Progression-free survival, RIC: reduced-intensity conditioning, MAC: myeloablative conditioning.

Figure 1. The overall survival for RIC and MAC patients (p=0.29). OS: Overall survival, RIC: reduced-intensity conditioning, MAC: myeloablative conditioning.

Figure 3. Cumulative incidence of non-relapse mortality for reduced-intensity conditioning (RIC) and myeloablative conditioning (MAC) regimens (MAC 1 and RIC 1) (p=0.027) and cumulative incidence of relapse for RIC and MAC regimens (MAC 2 and RIC 2) (p=0.496). RIC: Reduced-intensity conditioning, MAC: myeloablative conditioning.

Turk J Hematol 2019;36:88-96

Ă&#x2021;iftĂ§iler R, et al: Comparison of Myeloablative Versus Reduced-Intensity Conditioning Regimens

Discussion

and patient-related factors including age, donor availability, and presence of comorbid conditions are the parameters to be considered [20].

Allo-HSCT is an effective treatment modality for several malignant and non-malignant hematologic disorders [1]. The intensity of conditioning regimens can vary substantially. When selecting the right conditioning regimen for AML patients, disease-related factors such as diagnosis and remission status

Recently a randomized study was performed in patients with AML or MDS in remission comparing RIC conditioning to MAC conditioning and using related or unrelated donor grafts. The

Table 3. Acute and chronic Graft-versus-host disease in patients treated with myeloablative conditioning and reduced-intensity conditioning regimens. Acute GVHD, n (%)

RIC, n (%)

MAC, n (%)

9 (14.3%)

9 (20.5%)

Grade 1

6 (9.5%)

3 (6.8%)

Grade 2

2 (3.2%)

4 (9.1%)

Grade 3

1 (1.6%)

1 (2.3%)

Grade 4

1 (2.3%)

Chronic GVHD, n (%)

0.40

16 (25.4%)

8 (18.2%)

Limited

10 (15.9%)

7 (15.9%)

Extensive

6 (9.5%)

1 (2.3%)

0.37

GVHD: Graft-versus-host disease, MAC: myeloablative conditioning, RIC: reduced-intensity conditioning, n: number of patients.

Table 4. Univariate and multivariate analysis of overall survival and progression-free survival (univariate comparisons with p<0.20 were included in multivariate analysis in which statistical significance threshold was acknowledged as p<0.05). Univariate analysis

Multivariate analysis

Parameters for OS

Hazard ratio

95% confidence p interval

Hazard ratio

95% confidence interval

Age (years)

0.993

0.973-1.014

0.50

Sex (male/female)

1.044

0.644-1.693

0.86

Cytogenetic

0.786

0.526-1.175

0.24

ECOG PS

0.802

0.474-1.355

0.40

Conditioning regimen

0.358

0.214-0.601

0.29

Acute GVHD

1.047

0.531-2.065

0.89

Chronic GVHD

1.798

1.004-3.221

0.04

0.502

0.279-0.905

0.02

CMV serologic status

0.489

0.080-3.006

0.44

HSCT-comorbidity index

0.940

0.707-1.250

0.67

Disease risk index

0.828

0.548-1.251

0.36

Cell counts in the transplant (CD34+)

1.127

1.065-1.193

<0.001

1.133

1.072-1.197

<0.001

Age (years)

1.002

0.970-1.034

0.91

Sex (male/female)

1.049

0.707-1.558

0.81

Cytogenetic

1.503

0.939-2.404

0.08

1.391

0.702-2.755

0.34

ECOG PS

1.210

0.550-2.661

0.63

Conditioning regimen

1.060

0.455-2.466

0.78

Acute GVHD

1.504

0.450-5.028

0.50

Chronic GVHD

1.122

0.448-2.813

0.80

CMV serologic status

1.286

0.442-3.738

0.64

HSCT-comorbidity index

1.412

0.928-2.150

0.10

1.394

0.866-2.246

0.17

Diseases risk index

1.242

0.733-2.106

0.006

1.073

0.490-2.354

0.86

Cell counts in the transplant (CD34+)

1.039

0.951-1.134

0.39

Parameters for PFS

GVHD: Graft-versus-host disease, PFS: progression-free survival, CMV: cytomegalovirus, ECOG PS: ECOG performance status, HSCT: hematopoietic cell transplantation. OS: overall survival.

Çiftçiler R, et al: Comparison of Myeloablative Versus Reduced-Intensity Conditioning Regimens

trial closed with 272 enrolled patients due to excess relapse in the RIC arm. RIC was associated with more relapse, lower NRM, lower relapse-free survival, and, in the AML subgroup, lower OS. The conclusion of the study was that MAC conditioning should be the standard of care for fit patients with AML or MDS [12]. Choosing the proper conditioning remains challenging, given the need to balance the risk of relapse with the risk of transplantation-related mortality. The main finding of our study

Figure 4. Cumulative incidence plot of acute graft-versus-host disease for reduced-intensity conditioning and myeloablative conditioning regimens (p=0.22). GVHD: Graft-versus-host disease, CI: cumulative incidence, RIC: reduced-intensity conditioning, MAC: myeloablative conditioning.

Turk J Hematol 2019;36:88-96

was that RIC and MAC yielded similar outcomes (OS and PFS), even though patients in the RIC arm were somewhat older. The European Group for Blood and Marrow Transplantation analyzed survival outcomes of patients with AML older than 50 years treated with HLA-matched sibling allo-HSCT after RIC or MAC regimens. Despite the older age of the RIC patients, grade 2-4 acute GVHD and transplant-related mortality were significantly lower after the RIC regimen. However, there was no statistically significant difference in OS and PFS for patients receiving either the MAC or the RIC regimen, regardless of the status of the disease at the time of transplantation [21]. Goker et al. [22] compared survival outcomes of patients transplanted with RIC versus MAC regimens. They showed that the MAC regimen was associated with lower OS and PFS. Additionally, they showed an apparent favorable effect of the RIC regimen as a lower acute GVHD rate. On the other hand, it had a higher rate of chronic GVHD. GVHD and relapses remain major causes of mortality during HSCT [23,24]. The RIC regimen caused less tissue damage and lower levels of inﬂammatory cytokines, which may explain the lower incidence of severe GVHD following RIC conditioning [23,25,26,27]. It has been demonstrated that the incidence of acute GVHD was related to the intensity of the conditioning regimen. RIC, which consists of total body irradiation (2 Gy) with or without fludarabine, was reported to reduce the incidence of severe acute GVHD compared with MAC [27]. Cutler et al. [28] showed that allogeneic peripheral blood stem cell transplantation was associated with a greater degree of acute and chronic GVHD than bone marrow transplantation and this may be related to lower rates of relapse. Peripheral blood grafts were used for all allo-HSCT procedures in our patients. This study showed that the incidence of acute and chronic GVHD was similar between RIC and MAC regimen groups. Reported incidence rates range from 9% to 50% in patients who receive allo-HSCT from a genotypically HLAidentical sibling [29,30]. We followed our patients closely and made sure that they used their immunosuppressive drugs regularly. Therefore, this study may show a lower rate of GVHD. Future studies will reveal the cause of chronic GVHD seen to be lower in MAC regimens than in RIC regimens in this study.

Conclusion

Figure 5. Cumulative incidence plot of chronic graft-versus-host disease for reduced-intensity conditioning and myeloablative conditioning regimens (p=0.79). GVHD: Graft-versus-host disease, CI: cumulative incidence.

In this retrospective evaluation, RIC allo-HSCT outcomes were similar when compared to the MAC allo-HSCT outcomes in our patients with AML. MAC and RIC regimens were similar in terms of OS and PFS in AML patients with allo-HSCT. The incidence of acute and chronic GVHD was also similar between the two groups. NRM was more frequent in the MAC patients than RIC patients. Relapse rate was similar between the RIC and MAC

Turk J Hematol 2019;36:88-96

Çiftçiler R, et al: Comparison of Myeloablative Versus Reduced-Intensity Conditioning Regimens

patients. This study has some limitations. First of all, the study was retrospective. There were imbalances between the patient populations, which is known as a weakness of this type of retrospective study. Local standards also changed from 2001 to 2017. Therefore, spanning a long time period was a limitation of this study. In conclusion, the conditioning regimen should be tailored and chosen based on the disease and individual patient characteristics. Future powerful randomized clinical trials could further elucidate the type of conditioning to be used and tailored on a per patient basis. Ethics Ethics Committee Approval: All of the ethical considerations were strictly followed in accordance with the 1964 Helsinki Declaration in the Hacettepe University Faculty of Medicine. As standard care/action of the hospitals of the Hacettepe University Faculty of Medicine, it has been recognized from the patient records that all of the studied patients gave informed consent at the time of admission to the hospital and before the administration of chemotherapy and other relevant diagnostic/ therapeutic standards of care. Informed Consent: All of the studied patients gave informed consent at the time of admission to the hospital. Authorship Contributions Surgical and Medical Practices: R.Ç.; Concept: H.G., N.S.; Design: H.D.; Data Collection or Processing: E.A., F.T.; Analysis or Interpretation: Y.B., O.Ö., Literature Search: İ.C.H., S.A.; Writing: R.Ç. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Santos GW, Tutschka PJ, Brookmeyer R, Saral R, Beschorner WE, Bias WB, Braine HG, Burns WH, Elfenbein GJ, Kaizer H, Mellits D, Sensenbrenner LL, Stuart RK, Yeager AM. Marrow transplantation for acute nonlymphocytic leukemia after treatment with busulfan and cyclophosphamide. N Engl J Med 1983;309:1347-1353. 2. Lowenberg B, Downing JR, Burnett A. Acute myeloid leukemia. N Engl J Med 1999;341:1051-1062. 3. Rowe JM, Tallman MS. Intensifying induction therapy in acute myeloid leukemia: has a new standard of care emerged? Blood 1997;90:2121-2126. 4. Leith CP, Kopecky KJ, Chen IM, Eijdems L, Slovak ML, McConnell TS, Head DR, Weick J, Grever MR, Appelbaum FR, Willman CL. Frequency and clinical significance of the expression of the multidrug resistance proteins MDR1/ P-glycoprotein, MRP1, and LRP in acute myeloid leukemia. A Southwest Oncology Group Study. Blood 1999;94:1086-1099. 5. Sorror ML, Maris MB, Storb R, Baron F, Sandmaier BM, Maloney DG, Storer B. Hematopoietic cell transplantation (HCT)-specific comorbidity index: a new tool for risk assessment before allogeneic HCT. Blood 2005;106:29122919.

6. Wahid SF. Indications and outcomes of reduced-toxicity hematopoietic stem cell transplantation in adult patients with hematological malignancies. Int J Hematol 2013;97:581-598. 7. Cornelissen JJ, Gratwohl A, Schlenk RF, Sierra J, Bornhäuser M, Juliusson G, Råcil Z, Rowe JM, Russell N, Mohty M, Löwenberg B, Socié G, Niederwieser D, Ossenkoppele GJ. The European LeukemiaNet AML Working Party consensus statement on allogeneic HSCT for patients with AML in remission: an integrated-risk adapted approach. Nat Rev Clin Oncol 2012;9:579. 8. Horwitz ME. Reduced intensity versus myeloablative allogeneic stem cell transplantation for the treatment of acute myeloid leukemia, myelodysplastic syndrome and acute lymphoid leukemia. Curr Opin Oncol 2011;23:197-202. 9. Pidala J, Kim J, Anasetti C, Kharfan-Dabaja MA, Nishihori T, Field T, Perkins J, Perez L, Fernandez HF. Pharmacokinetic targeting of intravenous busulfan reduces conditioning regimen related toxicity following allogeneic hematopoietic cell transplantation for acute myelogenous leukemia. J Hematol Oncol 2010;3:36. 10. Bornhäuser M, Kienast J, Trenschel R, Burchert A, Hegenbart U, Stadler M, Baurmann H, Schäfer-Eckart K, Holler E, Kröger N, Schmid C, Einsele H, Kiehl MG, Hiddemann W, Schwerdtfeger R, Buchholz S, Dreger P, Neubauer A, Berdel WE, Ehninger G, Beelen DW, Schetelig J, Stelljes M. Reducedintensity conditioning versus standard conditioning before allogeneic haemopoietic cell transplantation in patients with acute myeloid leukaemia in first complete remission: a prospective, open-label randomised phase 3 trial. Lancet Oncol 2012;13:1035-1044. 11. Scott BL, Pasquini MC, Logan B, Wu J, Devine S, Porter DL, Maziarz RT, Warlick E, Fernandez HF, Alyea EP, Hamadani M, Bashey A, Giralt SA, Leifer E, Geller N, Le-Rademacher J, Mendizabal AM, Horowitz MM, Deeg HJ, Horwitz ME. Results of a phase III randomized, multi-center study of allogeneic stem cell transplantation after high versus reduced intensity conditioning in patients with myelodysplastic syndrome (MDS) or acute myeloid leukemia (AML): Blood and Marrow Transplant Clinical Trials Network (BMT CTN) 0901. Blood 2015;126:8. 12. Scott BL, Pasquini MC, Logan BR, Wu J, Devine SM, Porter DL, Maziarz RT, Warlick ED, Fernandez HF, Alyea EP, Hamadani M, Bashey A, Giralt S, Geller NL, Leifer E, Le-Rademacher J, Mendizabal AM, Horowitz MM, Deeg HJ, Horwitz ME. Myeloablative versus reduced-intensity hematopoietic cell transplantation for acute myeloid leukemia and myelodysplastic syndromes. J Clin Oncol 2017;35:1154-1161. 13. Döhner H, Estey E, Grimwade D, Amadori S, Appelbaum FR, Büchner T, Dombret H, Ebert BL, Fenaux P, Larson RA, Levine RL, Lo-Coco F, Naoe T, Niederwieser D, Ossenkoppele GJ, Sanz M, Sierra J, Tallman MS, Tien HF, Wei AH, Löwenberg B, Bloomfield CD. Diagnosis and management of AML in adults: 2017 ELN recommendations from an international expert panel. Blood 2017;129:424-447. 14. Oken MM, Creech RH, Tormey DC, Horton J, Davis TE, McFadden ET, Carbone PP. Toxicity and response criteria of the Eastern Cooperative Oncology Group. Am J Clin Oncol 1982;5:649-656. 15. Giralt S, Ballen K, Rizzo D, Bacigalupo A, Horowitz M, Pasquini M, Sandmaier B. Reduced-intensity conditioning regimen workshop: defining the dose spectrum. Report of a workshop convened by the Center for International Blood and Marrow Transplant Research. Biol Blood Marrow Transplant 2009;15:367-369. 16. Bacigalupo A, Ballen K, Rizzo D, Giralt S, Lazarus H, Ho V, Apperley J, Slavin S, Pasquini M, Sandmaier BM, Barrett J, Blaise D, Lowski R, Horowitz M. Defining the intensity of conditioning regimens: working definitions. Biol Blood Marrow Transplant 2009;15:1628-1633. 17. Khouri IF, Przepiorka D, van Besien K, O’Brien S, Palmer JL, Lerner S, Mehra RC, Vriesendorp HM, Andersson BS, Giralt S, Körbling M, Keating MJ, Champlin RE. Allogeneic blood or marrow transplantation for chronic lymphocytic leukaemia: timing of transplantation and potential effect of fludarabine on acute graft‐versus‐host disease. Br J Haematol 1997;97:466-473.

Çiftçiler R, et al: Comparison of Myeloablative Versus Reduced-Intensity Conditioning Regimens

18. Gratwohl A, Hermans J, Niederwieser D, van Biezen A, van Houwelingen HC, Apperley J; Chronic Leukemia Working Party of the European Group for Blood and Marrow Transplantation EBMT. Female donors influence transplant-related mortality and relapse incidence in male recipients of sibling blood and marrow transplants. Hematol J 2001;2:363-370. 19. R Core Team. A Language and Environment for Statistical Computing. Vienna, R Foundation for Statistical Computing, 2015. 20. Gyurkocza B, Sandmaier BM. Conditioning regimens for hematopoietic cell transplantation: one size does not fit all. Blood 2014;124:344-353. 21. Aoudjhane M, Labopin M, Gorin NC, Shimoni A, Ruutu T, Kolb HJ, Frassoni F, Boiron JM, Yin JL, Finke J, Shouten H, Blaise D, Falda M, Fauser AA, Esteve J, Polge E, Slavin S, Niederwieser D, Nagler A, Rocha V; Acute Leukemia Working Party (ALWP) of the European group for Blood and Marrow Transplantation (EBMT). Comparative outcome of reduced intensity and myeloablative conditioning regimen in HLA identical sibling allogeneic haematopoietic stem cell transplantation for patients older than 50 years of age with acute myeloblastic leukaemia: a retrospective survey from the Acute Leukemia Working Party (ALWP) of the European group for Blood and Marrow Transplantation (EBMT). Leukemia 2005;19:2304-2312. 22. Goker H, Ozdemir E, Uz B, Buyukasik Y, Turgut M, Serefhanoglu S, Aksu S, Sayinalp N, Haznedaroglu IC, Tekin F, Karacan Y, Unal S, Eliacik E, Isik A, Ozcebe OI. Comparative outcome of reduced intensity and myeloablative conditioning regimen in HLA identical sibling allogeneic hematopoietic stem cell transplantation for acute leukemia patients: a single center experience. Transfus Apher Sci 2013;49:590-599. 23. Ferrara JL, Cooke KR, Pan L, Krenger W. The immunopathophysiology of acute graft‐versus‐host‐disease. Stem Cells 1996;14:473-489. 24. Harris AC, Ferrara JL, Levine JE. Advances in predicting acute GVHD. Br J Haematol 2013;160:288-302.

Turk J Hematol 2019;36:88-96

25. Goker H, Haznedaroglu IC, Chao NJ. Acute graft-vs-host disease: pathobiology and management. Exp Hematol 2001;29:259-277. 26. Pérez-Simón JA, Díez-Campelo M, Martino R, Brunet S, Urbano A, Caballero MD, de León A, Valcárcel D, Carreras E, del Cañizo MC, López-Fidalgo J, Sierra J, San Miguel JF. Influence of the intensity of the conditioning regimen on the characteristics of acute and chronic graft‐versus‐host disease after allogeneic transplantation. Br J Haematol 2005;130:394-403. 27. Mielcarek M, Martin PJ, Leisenring W, Flowers ME, Maloney DG, Sandmaier BM, Maris MB, Storb R. Graft-versus-host disease after nonmyeloablative versus conventional hematopoietic stem cell transplantation. Blood 2003;102:756-762. 28. Cutler C, Giri S, Jeyapalan S, Paniagua D, Viswanathan A, Antin JH. Acute and chronic graft-versus-host disease after allogeneic peripheral-blood stem-cell and bone marrow transplantation: a meta-analysis. J Clin Oncol 2001;19:3685-3691. 29. Filipovich AH, Weisdorf D, Pavletic S, Socie G, Wingard JR, Lee SJ, Martin P, Chien J, Przepiorka D, Couriel D, Cowen EW, Dinndorf P, Farrell A, Hartzman R, Henslee-Downey J, Jacobsohn D, McDonald G, Mittleman B, Rizzo JD, Robinson M, Schubert M, Schultz K, Shulman H, Turner M, Vogelsang G, Flowers ME. National Institutes of Health consensus development project on criteria for clinical trials in chronic graft-versus-host disease: I. Diagnosis and staging working group report. Biol Blood Marrow Transplant 2005;11:945-956. 30. Jagasia M, Arora M, Flowers ME, Chao NJ, McCarthy PL, Cutler CS, UrbanoIspizua A, Pavletic SZ, Haagenson MD, Zhang MJ, Antin JH, Bolwell BJ, Bredeson C, Cahn JY, Cairo M, Gale RP, Gupta V, Lee SJ, Litzow M, Weisdorf DJ, Horowitz MM, Hahn T. Risk factors for acute GVHD and survival after hematopoietic cell transplantation. Blood 2012;119:296-307.

RESEARCH ARTICLE DOI: 10.4274/tjh.galenos.2019.2018.0449 Turk J Hematol 2019;36:97-105

Co-culture of Platelets with Monocytes Induced M2 Macrophage Polarization and Formation of Foam Cells: Shedding Light on the Crucial Role of Platelets in Monocyte Differentiation Trombositlerin Monositlerle Ortak Kültürü ile İndüklenen M2 Makrofaj Polarizasyonu ve Köpük Hücrelerinin Oluşumu: Monosit Farklılaşmasında Trombositlerin Önemli Rolü Üzerine Işık Tutma Mahdieh Mehrpouri1, Davood Bashash1, Mohammad Hossien Mohammadi2, Esmail Shahabi Satlsar1, Mohsen Hamidpour2

Mohammad Esmail Gheydari3,

1Shahid Beheshti University of Medical Sciences, Faculty of Allied Medical Sciences, Department of Hematology and Blood Banking, Tehran, Iran 2HSCT Research Centre, Department of Hematology and Blood Banking, School of Allied Medical Sciences, Shahid Beheshti University of Medical

Sciences, Tehran, Iran 3Shahid Beheshti University of Medical Sciences Faculty of Medicine, Taleghani General Hospital, Department of Cardiology, Tehran, Iran

Abstract

Öz

Objective: Far beyond hemostasis and thrombosis, significant evidence has indicated the critical role of platelets in atherosclerosis. SDF-1 is among the pro-inflammatory chemokines that are increased in platelets of patients with coronary artery disease (CAD). The goal of the current work is to identify the in vitro effect of platelets from either CAD patients or healthy volunteers on the induction of macrophages and foam cells.

Amaç: Hemostaz ve trombozun çok ötesinde, önemli kanıtlar trombositlerin aterosklerozdaki kritik rolüne işaret etmektedir. SDF-1 koroner arter hastalığı (KAH) olan hastaların trombositlerinde artan proenflamatuvar kemokinler arasında yer almaktadır. Bu çalışmanın amacı, KAH olan hastalar ve sağlıklı gönüllülerin trombositlerinin makrofajlar ve köpük hücrelerinin indüksiyonunda in vitro etkilerini belirlemektir.

Materials and Methods: The expression of SDF-1 on platelet surfaces in CAD patients and healthy volunteers was investigated using flow cytometry. We also evaluated the CXCR4/CXCR7 expression on monocytes from buffy coats of healthy volunteers. The effect of platelets from CAD patients and healthy volunteers on differentiation of monocytes and foam cell formation was evaluated using Oil Red O (ORO) staining. Flow cytometry and real-time PCR were also employed to evaluate surface markers and mRNA expression of genes involved in this process after co-culture of platelets with monocytes.

Gereç ve Yöntemler: KAH olan hastalar ve sağlıklı gönüllülerde trombosit yüzeyindeki SDF-1 ekspresyonu akım sitometri ile incelendi. Biz ayrıca sağlıklı gönüllülerin beyaz kan hücrelerinin bir tabakasından elde edilen monositlerde CXCR4/CXCR7 ekspresyonunu değerlendirdik. KAH olan hastalar ve sağlıklı gönüllülerin trombositlerinin monositler ve köpük hücreleri oluşumu üzerine etkisi Oil Red O (ORO) boyası kullanılarak değerlendirildi. Yüzey belirteçlerini ve trombositlerin monositlerle ortak kültürü sonrası süreçteki genlerin mRNA ekspresyonunu değerlendirmek için ayrıca akım sitometri ve gerçek zamanlı polimeraz zincir reaksiyonu çalışıldı.

Results: Monocytes in co-culture with platelets acquired a spindleshape appearance and ORO-positive lipid droplets. In addition, platelets could induce CD163 expression, as an important marker of M2 macrophage, and upregulate the mRNA expression of the SRB, CD36, ACAT, LXR-α, and ABCA1 genes in monocytes. Notably, platelets of CAD patients with higher expression of SDF-1, increased the expression of genes encoding SRB and CD36 as compared to platelets of healthy volunteers.

Bulgular: Trombositler ile ortak kültüre edilen monositler iğ şeklinde görünüm ve ORO-pozitif yağ damlacıkları kazandılar. Ayrıca, trombositler M2 makrofajın önemli bir belirteçi olan CD163 ekspresyonunu indüklediler ve monositlerdeki SRB, CD36, ACAT, LXR-α, ve ABCA1 genlerinin mRNA ekspresyonunu up-regüle ettiler. Özellikle, SDF-1 ekspresyonu yüksek olan KAH olan hastaların trombositleri, sağlıklı gönüllülere göre SRB ve CD36’yı kodlayan genlerin ekspresyonunu artırdı.

Conclusion: Our results indicate that platelets from CAD patients could provoke monocyte differentiation into macrophages with an M2 phenotype, which in turn may participate in an atheroprotective process.

Sonuç: Bulgularımız, KAH olan hastaların trombositlerinin, monositlerin M2 fenotipinde makrofajlara farklılaşmasına neden olduklarını ve böylece ateroprotektif sürece iştirak ettiklerini göstermektedir.

Keywords: SDF-1, Monocytes, Platelets, Co-culture, Foam cells

Anahtar Sözcükler: SDF-1, Monositler, Trombositler, Ortak kültür, Köpük hücreleri

Address for Correspondence/Yazışma Adresi: Mohsen HAMIDPOUR, M.D., Shahid Beheshti University of Medical Sciences, Hematopoietic Stem Cells Research Centre, Tehran, Iran E-mail : mohsenhp@sbmu.ac.ir ORCID-ID: orcid.org/0000-0002-3658-1551

Received/Geliş tarihi: December 30, 2018 Accepted/Kabul tarihi: March 08, 2019

Mehrpouri M, et al: Co-culture of Platelets with Monocytes

Introduction Atherosclerosis is a multifactorial process that leads to cardiovascular diseases and involves a complex interaction between cellular and non-cellular constituents, which include platelets, cytokines, and leukocytes [1]. Far beyond hemostasis and thrombosis, the critical role of platelets in wound healing, inflammation, atherosclerosis, and the immunity system has been recognized [2,3]. Platelets store a wide variety of cytokines, chemokines, mitogens, angiogenic factors, and other bioactive molecules in their granules [4,5], which can potentially induce pro- and anti-inflammatory responses [6]. Several investigations have reported the crucial role of chemokines in the pathogenesis of cardiovascular diseases [7]. SDF-1 (CXCL12) is among the pro-inflammatory chemokines released following platelet activation [8,9]. Circulating platelets of patients with coronary artery disease (CAD) have elevated expression of SDF-1 [10,11], which is associated with cardio-protection and enhanced left ventricular functional recovery after myocardial infarction [12,13]. At injury sites, platelets recruit and activate leukocytes through cell-cell interactions or indirectly by release of their mediators [14]. Remarkably, platelet-derived SDF-1 can bind to its chemokine receptors, CXCR4 and CXCR7, on monocytes and facilitate phagocytosis of apoptotic platelets by these cells and promote their differentiation into foam cells [15]. Classically, macrophages are classified into two major subtypes: pro-inflammatory M1 macrophages and anti-inflammatory M2 macrophages [16]. Briefly, M1 macrophages sustain the inflammatory response through production of inflammatory cytokines. On the other hand, M2 macrophages contribute to wound repair and tissue regeneration [17]. According to the expression of surface markers, CD86 is used as an M1 macrophage marker [18], while CD163 is commonly used to detect M2 macrophages [19]. We hypothesized that increased expression of SDF-1 on the platelets of CAD patients will promote differentiation of monocytes into macrophages or foam cells. Therefore, the aim of this study was to investigate the in vitro effect of CAD patients’ platelets in induction of macrophage and foam cells in comparison with normal platelets.

Materials and Methods Materials Mouse monoclonal anti-human CD61-FITC (Dako, Denmark), mouse monoclonal anti-human CXCR4-PE (BioLegend, USA), mouse monoclonal anti-human/mouse CXCR7-PE (BioLegend, USA), mouse monoclonal anti-human SDF-1-PerCP (Novus Biologicals, USA), mouse monoclonal anti-human CD14-PE (Beckman Coulter, USA), mouse monoclonal anti-human CD11bPE (Dako, Denmark), mouse monoclonal anti-human CD11c-FITC 98

Turk J Hematol 2019;36:97-105

(Dako, Denmark), mouse monoclonal anti-human CD86-PerCP (Abcam, USA), and mouse monoclonal anti-human CD163-FITC (R&D Systems, UK) were used in our study. Ficoll-Hypaque was from Lymphodex (Inno-Train, Germany), Taq DNA Polymerase 2x Master Mix RED and Real Q Plus Master Mix Green Low ROX were procured from Ampliqon (Copenhagen, Denmark), the RevertAid First Strand cDNA Synthesis Kit was from Thermo Fisher Scientific (USA), and trypan blue, Oil Red O (ORO) stain, and TRIzol were purchased from Sigma-Aldrich (USA). Expression of SDF-1 on Platelets of CAD Patients and Healthy Volunteers Ten patients with symptomatic CAD who were visited in the cardiovascular section of Taleghani Hospital (Tehran) were investigated for SDF-1 expression on the surface of platelets. CAD patients were selected with respect to clinical symptoms, myocardial ischemia markers, and ECG results. The increased level of SDF-1 was an inclusion criterion for selection of CAD patients for evaluation in co-culture, while exclusion criteria were diabetes, history of CAD in the family, hypertension, hyperlipidemia, smoking, and medication usage on admission. Ten healthy volunteers with no history of cardiovascular diseases, who were matched with the CAD patients regarding age and sex (p>0.05), were also evaluated as normal controls. Finally, three patients with high expression of this marker were selected for platelet preparation in comparison with three healthy volunteers with low expressions of SDF-1. This study was approved by the Ethics Committee of Shahid Beheshti University of Medical Sciences (IR.SBMU.RETECH. REC.1396.717) and all the participants gave informed consent in accordance with the Declaration of Helsinki. To detect the surface expression of SDF-1, diluted platelet-rich plasma (PRP) was incubated with mouse monoclonal anti-human SDF-1-PerCP and mouse monoclonal anti-human CD61-FITC or their respective isotype controls and analyzed by flow cytometer (Attune NxT; Life Technologies, USA). Platelet CD61 expression was used in the present study for identifying the platelet population. We also used mean fluorescence intensity (MFI) as a quantitative indicator for the surface expression of the indicated protein. Isolation of Platelets Peripheral blood was collected in ACD-A (Acid Citrate Dextrose, solution-A) anticoagulant (1:4) from CAD patients and healthy volunteers and centrifuged at 200 g for 15 min. The prepared PRP was added to Tyrode’s HEPES buffer (HEPES - 2.5 mM, NaCl - 150 mM, KCl - 1 mM, NaHCO3 - 2.5 mM, NaH2PO4 - 0.36 mM, glucose - 5.5 mM, BSA - 1 mg/mL, pH 6.5) and centrifuged at 800 x g for 10 min. The platelet pellet was suspended in Tyrode’s HEPES buffer (pH 7.4; supplemented with CaCl2 - 1 mM, MgCl2 - 1 mM).

Mehrpouri M, et al: Co-culture of Platelets with Monocytes

Turk J Hematol 2019;36:97-105

Peripheral Blood Monocyte Preparation

Flow Cytometry Assessment of Monocytes

Buffy coats from healthy volunteers were used for isolation of peripheral blood monocytes. Subsequently, we purified monocytes through centrifugation on a Ficoll-Hypaque density gradient (20 min, 760 x g) and adhesion to a plastic surface. Non-adherent cells were removed by gentle washing after 4 h and the remaining adherent cells (monocytes) were harvested. Viability of monocytes, as measured by trypan blue dye exclusion, was >98% immediately after their isolation. Monocyte purity was assessed using flow cytometry analysis of FSC-SSC and surface CD14 expression. The expressions of CXCR4 and CXCR7 on monocytes were also evaluated by flow cytometry.

Surface expressions of markers on differentiated macrophages were analyzed using flow cytometry following 7 days of coculture. PBS was used to wash the cells, and with fluorescentconjugated antibodies against CD14, CD11b, CD11c, CD86, and CD163 or their respective isotype controls, cells were labeled. After 30 min of incubation in the dark at 4 °C, cells were then fixed with 0.5% paraformaldehyde and were measured using flow cytometry. Analysis of data was performed by gating on viable cells using FSC-SSC characteristics in the monocyte/ macrophage population. The percentage of each marker was determined against its respective isotype control.

Monocyte and Platelet Co-culture

Total RNA was isolated from harvested monocytes following 7 days of co-culture with TRIzol according to the manufacturer’s recommendation and converted to complementary DNA (cDNA) using a cDNA synthesis kit. Quantitative real-time PCR for ABCA1, CD36, SRB, PPARγ, SRA, ACAT1, ABCG1, and LXR-α (NR1H3) was carried out with a Rotor Gene Q kit (QIAGEN, Germany) using Real-Time PCR Master Mix. The housekeeping gene ABL was also used as a control for differences in RNA concentrations. All the primers that were used in our research are given in Table 1.

Monocytes were grown in RPMI-1640 medium supplemented with 100 U/mL penicillin, 100 µg/mL streptomycin, 2 mM L-glutamine, and 10% fetal calf serum in a humidified atmosphere of 5% CO2 at 37 °C. Isolated platelets were added to monocytes (monocyte to platelet ratio of 1:100), and half of the medium was exchanged with fresh complete medium every 2 days. During co-culture, monocytes were examined by microscopic analysis. After co-culture, platelets or floating cells were washed away and monocytes were evaluated by ORO staining, flow cytometry, and real-time PCR. ORO Staining for Foam Cell Evaluation For ORO staining, the cells were stained after 7, 10, and 15 days of co-culture. After 2-3 washings with PBS, 10% formalin was used to fix the cells for 30 min, and then they were penetrated with 60% isopropanol for 5 min and stained with ORO staining for 10 min at room temperature. To remove any residual ORO stain, 60% isopropanol was used to destain wells for 15 s, and next the wells were washed 3 times with PBS. Images of foam cells were taken under 10x and 40x objectives by light microscope (Olympus) with an Optika camera (Italy). Image analysis was performed using ImageJ software.

cDNA Synthesis

Statistical Analysis Each experimental condition was performed in triplicate to evaluate the mean ± standard deviation (SD). All data were analyzed using Prism software (USA). To determine the difference between two groups, the unpaired two-tailed Student t-test was applied. ANOVA was applied to compare multiple data. In all cases, the minimum statistical significance was p<0.05.

Results Platelets of Patients with CAD Had Increased Expression of SDF-1 As shown in Figure 1, analysis of flow cytometry data showed that the expression of SDF-1 on the platelets of CAD patients

Table 1. Primers that were used for cDNA synthesis. Gene

Forward primer (5′-3′)

Reverse primer (5′-3′)

Product size (bp)

ABCA1

GGCAATCATCAGGGTGCTGACG

CCGCAGAAAGATGTCATCAACG

CD36

GCAGCAACATTCAAGTTAAGC

AGCCTCTGTTCCAACTGATAG

158

SRB

TTGCCAACGGGTCCATCTAC

CAGTTTGTCCAATGCCTGCG

288

PPARγ

ATTCTCAGTGGAGACCGCCC

GGAAATGTTGGCAGTGGCTC

292

SRA

CACTGATTGCCCTTTACCTCCTC

CATTTCCTCTTCGCTGTCATTTCC

170

ACAT

TCTACTCCATGTACCACCATAAAC

CATAAGCGTCCTGTTCATTTCG

298

ABCG1

TAGATAATAACCTCACGGAAGC

CCACCAACTCACCACTATTG

177

NR1H3

ACAACCCTGGGAGTGAGAGT

AACATCAGTCGGTCATGGGG

295

ABL1

CTTCTTGGTGCGTGAGAGTGAG

GACGTAGAGCTTGCCATCAGAAG

115

Mehrpouri M, et al: Co-culture of Platelets with Monocytes

Turk J Hematol 2019;36:97-105

was significantly higher than that of healthy controls (MFI: 1112±304 vs. 943±131, p=0.042). Surface Expression of CXCR4 and CXCR7 on Monocytes We evaluated the expression of CXCR4 and CXCR7 on surface of monocytes which were isolated from buffy coats on the first day. Our results showed that the expression levels of CXCR4 and CXCR7 on monocytes were 51.7±3.2% and 28.5±2.5%, respectively (Figure 2). Platelets Significantly Induced Spindle-Shape Appearance in Macrophages In vitro and in vivo maturation of blood monocytes into macrophages takes place as a consequence of interactions with different cell types. We evaluated monocyte morphology for 20 days of co-culture and we showed that monocyte-platelet coculture prompted platelet clearance. Moreover, platelets induced differentiation of monocytes into macrophages with spindleshaped appearance. After prolonged co-culture (15 days), a considerable proportion of these cells showed morphological characters of foam cells. Furthermore, our results indicated that platelets of CAD patients had enhanced differentiation of monocytes to foam cells in comparison with platelets of healthy volunteers (Figure 3). Figure 1. Assessment of the expression of SDF-1 on the platelets of ten healthy volunteers and ten patients with symptomatic coronary artery disease (CAD). (a) Platelet SDF-1 expression was significantly higher in CAD patients than in the healthy controls. (b) Comparison of the expression of SDF-1 on the platelets of controls and CAD patients. Statistical values are given as mean ± standard deviation. *p<0.05. MFI: Mean fluorescence intensity.

ORO Staining Showed Significant ORO-Stained Lipid Droplets in Monocytes Formation of foam cells is time-dependent, so we stained and analyzed ORO-stained lipid droplets on days 7, 10, and 15 following co-culture of monocytes and platelets. After 7 days, macrophages showed no significant ORO-stained lipid droplets, but after prolonged co-culture to 10 and 15 days, lipid droplets were seen more significantly in macrophages cultured with

Figure 2. Flow cytometry analysis of CXCR4 and CXCR7 on monocytes isolated from buffy coats. (a) Histograms show that monocytes isolated from buffy coats expressed CXCR4 and CXCR7 with respect to corresponding isotype controls. (b) Comparison of expression of CXCR4 and CXCR7 on monocytes isolated from buffy coats. Experiments were conducted in triplicate. 100

Turk J Hematol 2019;36:97-105

platelets. Furthermore, ORO staining indicated that platelets of CAD patients had enhanced differentiation of monocytes into foam cells in comparison with platelets of healthy volunteers (Figure 4). Platelets Increased CD163 Expression on Monocytes After 7 Days Monocytes express CD163 at low to moderate levels [20]; however, alternatively activated macrophages have high expressions of this marker. These cells play an important role in inhibiting the inflammatory responses and scavenging components of damaged cells [21]. Flow cytometry was conducted to detect the surface expression of monocyte markers following isolation. As shown in Figure 5a, monocyte purity, which was investigated using FSC-SSC and CD14 expression, was above 98%. Expression of other markers was analyzed on day 1 and high expressions of CD11b and CD11c and low expressions of CD163 and CD86 were identified. In monocytes on day 7, whether cultured in the presence of platelets or without platelets, high expressions of CD14, CD11b, and CD11c were detected (Figure 5b). CD86 expression on monocytes was associated with a decrease after 7

Mehrpouri M, et al: Co-culture of Platelets with Monocytes

days of co-culture, independent of the presence or absence of platelets. A slightly increased expression of CD163 was observed in platelet-free cultures on day 7 compared with day 1. However, a significant increase of this marker was detected on monocytes co-cultured with platelets (Figure 5c). Platelets Induced the Expression of the Genes Involved in Cholesterol Absorption, Cholesterol Esterification, and Cholesterol Efflux in Monocytes In this study, following co-culture of monocytes with platelets, we investigated the mRNA expression of CD36, scavenger receptor class A (SRA), and acyl-coenzyme A cholesterol acyltransferase (ACAT) in monocytes, which are among the key genes in lipid accumulation [22,23]. We also evaluated the gene expression changes that are expected to enhance the cholesterol efflux from foam cells, including ATP-binding cassette transporter A1 (ABCA1), ATP-binding cassette transporter G1 (ABCG1), peroxisome proliferator-activated receptor γ (PPARγ), liver X receptor-α (LXR-α), and scavenger receptor class B (SRB) [24,25,26]. Our results showed that platelets elevated the expression of mRNA of CD36, ACAT, ABCA1, SRB, and LXR-α.

Figure 3. Assessment of changes in monocyte morphology at different days of culture. (a) Platelets helped monocytes differentiate into macrophages and foam cells as compared to platelet-free culture. Furthermore, platelets of coronary artery disease (CAD) patients had more monocytes differentiated into foam cells in comparison with platelets of healthy volunteers. Monocyte shape changed following co-culture with platelets as shown with arrows in the pictures. Magnification: 400x. (b) Bar diagram representing a comparison of monocyte shape changes on different days of cultures. Experiments were conducted in triplicate. 101

Mehrpouri M, et al: Co-culture of Platelets with Monocytes

Furthermore, platelets of CAD patients had significantly elevated mRNA expression of CD36 and SRB in comparison with platelets of healthy volunteers, which indicated that these platelets play a larger role in the formation of macrophage and foam cells (Figure 6).

Discussion Platelets are important players in atherosclerosis and recruit other cells towards lesion sites [27]. Alpha-granules of platelets are major sources of SDF-1, a well-known chemokine that is overexpressed on the surface of platelets upon activation [28]. Notably, it has been reported that among leukocyte subtypes, monocytes preferentially interact with activated platelets through CXCR4 and CXCR7 [15]. According to studies, CD163 expression, as an important marker of M2 macrophages, is elevated in macrophages of inflamed tissues like atherosclerotic lesions [29]. Moreover, Buchacher et al. [30] indicated that

Turk J Hematol 2019;36:97-105

monocytes with spindle-shape morphology are mainly representative of M2 macrophages. In this study, we evaluated the interaction of monocytes and platelets for 20 days. We showed that over 7 days platelets not only drive the monocytes to differentiate into spindle-shape macrophages, but also upregulate the expression of CD163, which is in agreement with a recent study conducted by Chatterjee et al. [15]. Our results also revealed that longer co-culture of cells resulted in a considerable proportion of macrophages presenting morphological characteristics of foam cells. Platelets of CAD patients that expressed a higher percentage of SDF-1 induced greater numbers of foam cells as compared to platelets of healthy volunteers, indicating that SDF-1 derived from platelets may play a probable role in differentiation of monocytes to foam cells. Although previous studies discussed the contributory role of platelets in the differentiation of monocytes into foam cells [9],

Figure 4. Evaluation of macrophage foam cells using Oil Red O (ORO) staining during different days of co-culture. (a) After 7 days, macrophages showed no significant ORO-stained lipid droplets, although after 10 and 15 days of co-culture, significantly more lipid droplets with ORO staining could be observed in foam cells cultured with platelets. Furthermore, ORO staining indicated that platelets of coronary artery disease patients had enhanced differentiation of monocytes to foam cells in comparison with platelets of healthy volunteers. Foam cells are shown with arrows in the picture. Magnification: 400x. (b) Bar diagram representing a comparison of OROpositive cells between different samples on days 10 and 15. Each experiment was conducted in triplicate. CAD: Coronary artery disease.

102

Turk J Hematol 2019;36:97-105

Mehrpouri M, et al: Co-culture of Platelets with Monocytes

Figure 5. Platelets in co-culture induced monocytes to differentiate into CD163-positive macrophages. (a) Flow cytometry measurement of CD14 expression was used to assess the purity of isolated monocytes. (b) Bar graph represents phenotypes of monocytes in terms of CD14, CD11b, and CD11c surface expression in co-culture with platelets compared with platelet-free cultures. (c) Flow cytometry data represent CD86 and CD163 expressions of monocytes. Flow cytometric histograms of CD86 and CD163 expression showed substantial expression of CD163 as compared to the corresponding isotype controls on monocytes in co-culture with platelets. Representative flow cytometric bar diagrams of CD86/CD163 expression on monocytes show predominant CD163 expression of monocytes in co-culture with platelets compared with platelet-free cultures. CD86 expression of monocytes was associated with a decrease after 7 days of culture.

Figure 6. Evaluation of gene expression changes of monocytes after 7 days. After co-culture of monocytes with platelets of healthy volunteers, quantitative reverse transcription-polymerase chain reaction analysis demonstrated the increased expression of the following genes: SRB, CD36, ACAT, LXR-α, and ABCA1. Co-culture of monocytes with platelets of CAD patients had the same results, but compared to platelets of healthy volunteers, increased expression of CD36 and SRB was observed. Statistical values are given as the mean ± standard deviation of 3 independent experiments. *p≤0.05. 103

Mehrpouri M, et al: Co-culture of Platelets with Monocytes

the precise molecular mechanisms of this effect were poorly understood. To the best of our knowledge, this is the first time that the expression levels of genes that are mainly involved in the conversion of monocytes-macrophages into foam cells were evaluated after co-culture of platelets with monocytes. Our findings demonstrated that platelets increased the mRNA expression of the CD36, ACAT, SRB, LXR-α, and ABCA1 genes. The role of these genes per se in foam cell formation from monocytes is controversial. Multiple lines of evidence indicated that CD36 and ACAT pave the way for the formation of foam cells through enhancing the capability of the cells to uptake platelets/ox-LDL and cholesterol esterification, respectively [22,23]. On the other hand, increased expression levels of SRB, LXR-α, and ABCA1 were also reported to be associated with the cholesterol efflux from macrophage foam cells [24,25,26]. Other studies also showed that the gene expression of proteins such as CD36, ACAT1, LXR-α, and ABCA1 are increased during macrophage-derived foam cell formation [22,23,31,32]. Tsukamoto et al. [33] suggested a fundamental role for CD36 as well as SRB, but not SRA, in the formation of foam cells during ox-LDL treatment of THP-1 cells [33]. Of particular interest, co-culture of monocytes with the platelets of CAD patients resulted in a superior upregulation of CD36 and SRB mRNA expression as compared with the results of co-culture using platelets of healthy volunteers.

Conclusion Using an in vitro co-culture of monocytes and platelets, our study indicates that platelets from CAD patients could provoke monocyte differentiation into macrophages with an M2 phenotype, which in turn may participate in an atheroprotective process. Acknowledgments We would like to acknowledge the Deputy of Research of the School of Allied Medical Sciences, Department of Cardiology, and the HSC Laboratory of Taleghani Hospital for support and the provision of research facilities. Ethics Ethics Committee Approval: The Ethics Committee of Shahid Beheshti University of Medical Sciences, approval number IR.SBMU.RETECH.REC.1396.717. Authorship Contributions Concept: M.H.; Design: M.H., M.M.; Selection of Patients: M.E.G.; Laboratory Practices (Cell Culture/Real Time/Flow Cytometry): M.M., M.H.M., M.E.G., E.S.S.; Collection of Data: M.M.; Analysis of Data: M.M.; Literature Search: M.H., M.M.; Writing: M.M., D.B., M.H. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, 104

Turk J Hematol 2019;36:97-105

and/or affiliations relevant to the subject matter or materials included.

References 1. Galkina E, Ley K. Immune and inflammatory mechanisms of atherosclerosis. Ann Rev Immunol 2009;27:165-197. 2. Mekaj YH. The roles of platelets in inflammation, immunity, wound healing and malignancy. Int J Clin Exp Med 2016;9:5347-5358. 3. Ghoshal K, Bhattacharyya M. Overview of platelet physiology: its hemostatic and nonhemostatic role in disease pathogenesis. ScientificWorldJournal 2014;2014:781857. 4. Heijnen HF, Debili N, Vainchencker W, Breton-Gorius J, Geuze HJ, Sixma JJ. Multivesicular bodies are an intermediate stage in the formation of platelet α-granules. Blood 1998;91:2313-2325. 5. Golebiewska EM, Poole AW. Platelet secretion: from haemostasis to wound healing and beyond. Blood Rev 2015;29:153-162. 6. Gleissner CA, Shaked I, Little KM, Ley K. CXC chemokine ligand 4 induces a unique transcriptome in monocyte-derived macrophages. J Immunol 2010;184:4810-4818. 7. Aukrust P, Halvorsen B, Yndestad A, Ueland T, Øie E, Otterdal K, Gullestad L, Damås JK. Chemokines and cardiovascular risk. Arterioscler Thromb Vasc Biol 2008;28:1909-1919. 8. Stellos K, Langer H, Daub K, Schoenberger T, Gauss A, Geisler T, Bigalke B, Mueller I, Schumm M, Schaefer I, Seizer P, Kraemer BF, Siegel-Axel D, May AE, Lindemann S, Gawaz M. Platelet-derived stromal cell-derived factor-1 regulates adhesion and promotes differentiation of human CD34+ cells to endothelial progenitor cells. Circulation 2008;117:206215. 9. Stellos K, Seizer P, Bigalke B, Daub K, Geisler T, Gawaz M. Platelet aggregatesinduced human CD34+ progenitor cell proliferation and differentiation to macrophages and foam cells is mediated by stromal cell derived factor 1 in vitro. Semin Thromb Hemost 2010;36:139-145. 10. Stellos K, Bigalke B, Langer H, Geisler T, Schad A, Kögel A, Pfaff F, Stakos D, Seizer P, Müller I, Htun P, Lindemann S, Gawaz M. Expression of stromalcell-derived factor-1 on circulating platelets is increased in patients with acute coronary syndrome and correlates with the number of CD34+ progenitor cells. Eur Heart J 2009;30:584-593. 11. Rath D, Chatterjee M, Borst O, Müller K, Stellos K, Mack AF, Bongartz A, Bigalke B, Langer H, Schwab M, Gawaz M, Geisler T. Expression of stromal cell-derived factor-1 receptors CXCR4 and CXCR7 on circulating platelets of patients with acute coronary syndrome and association with left ventricular functional recovery. Eur Heart J 2013;35:386-394. 12. Abbott JD, Huang Y, Liu D, Hickey R, Krause DS, Giordano FJ. Stromal cellderived factor-1α plays a critical role in stem cell recruitment to the heart after myocardial infarction but is not sufficient to induce homing in the absence of injury. Circulation 2004;110:3300-3305. 13. Geisler T, Fekecs L, Wurster T, Chiribiri A, Schuster A, Nagel E, Miller S, Gawaz M, Stellos K, Bigalke B. Association of platelet-SDF-1 with hemodynamic function and infarct size using cardiac MR in patients with AMI. Eur J Radiol 2012;81:486-490. 14. Schrottmaier WC, Kral JB, Badrnya S, Assinger A. Aspirin and P2Y12 inhibitors in platelet-mediated activation of neutrophils and monocytes. Thromb Haemost 2015;114:478-489. 15. Chatterjee M, von Ungern-Sternberg SN, Seizer P, Schlegel F, Büttcher M, Sindhu NA, Müller S, Mack A, Gawaz M. Platelet-derived CXCL12 regulates monocyte function, survival, differentiation into macrophages and foam cells through differential involvement of CXCR4-CXCR7. Cell Death Dis 2015;6:e1989. 16. Murray PJ, Wynn TA. Obstacles and opportunities for understanding macrophage polarization. J Leukoc Biol 2011;89:557-563.

Turk J Hematol 2019;36:97-105

Mehrpouri M, et al: Co-culture of Platelets with Monocytes

17. Wolfs IM, Donners MM, de Winther MP. Differentiation factors and cytokines in the atherosclerotic plaque micro-environment as a trigger for macrophage polarisation. Thromb Haemost 2011;105:763-771.

25. Hamidpour M, Bashash D, Nehzati P, Abbasalizadeh M, Hamidpour R. The expression of hSR-B1 receptor on platelets of patients with coronary artery disease (CAD). Clin Hemorheol Microcirc 2019;71:9-15.

18. Li W, Katz BP, Spinola SM. Haemophilus ducreyi-induced IL-10 promotes a mixed M1 and M2 activation program in human macrophages. Infect Immun 2012;80:4426-4434.

26. Chawla A, Boisvert WA, Lee CH, Laffitte BA, Barak Y, Joseph SB, Liao D, Nagy L, Edwards PA, Curtiss LK, Evans RM, Tontonoz P. A PPARγ-LXR-ABCA1 pathway in macrophages is involved in cholesterol efflux and atherogenesis. Mol Cell 2001;7:161-171.

19. Khramtsova G, Liao C, Khramtsov A, Li S, Gong C, Huo D, Nanda R. The M2/ alternatively activated macrophage phenotype correlates with aggressive histopathologic features and poor clinical outcome in early stage breast cancer. In: Thirty-Second Annual CTRC‐AACR San Antonio Breast Cancer Symposium, Abstracts, 2009. 20. Pulford K, Micklem K, McCarthy S, Cordell J, Jones M, Mason DY. A monocyte/macrophage antigen recognized by the four antibodies GHI/61, Ber-MAC3, Ki-M8 and SM4. Immunology 1992;75:588-595.

27. Lievens D, von Hundelshausen P. Platelets in atherosclerosis. Thromb Haemost 2011;105:827-838. 28. Chatterjee M, Gawaz M. Platelet‐derived CXCL 12 (SDF‐1α): basic mechanisms and clinical implications. J Thromb Haemost 2013;11:19541967. 29. Ratcliffe NR, Kennedy SM, Peter PM. Immunocytochemical detection of Fcγ receptors in human atherosclerotic lesions. Immunol Lett 2001;77:169-174.

21. Moestrup SK, Møller HJ. CD163: A regulated hemoglobin scavenger receptor with a role in the anti‐inflammatory response. Ann Med 2004;36:347-354.

30. Buchacher T, Ohradanova-Repic A, Stockinger H, Fischer MB, Weber V. M2 polarization of human macrophages favors survival of the intracellular pathogen Chlamydia pneumoniae. PLoS One 2015;10:e0143593.

22. Yao S, Miao C, Tian H, Sang H, Yang N, Jiao P, Han J, Zong C, Qin S. Endoplasmic reticulum stress promotes macrophage-derived foam cell formation by up-regulating cluster of differentiation 36 (CD36) expression. J Biol Chem 2014;289:4032-4042.

31. Langmann T, Klucken J, Reil M, Liebisch G, Luciani MF, Chimini G, Kaminski WE, Schmitz G. Molecular cloning of the human ATP-binding cassette transporter 1 (hABC1): evidence for sterol-dependent regulation in macrophages. Biochem Biophys Res Commun 1999;257:29-33.

23. Yang L, Yang JB, Chen J, Yu GY, Zhou P, Lei L, Wang ZZ, Cy Chang C, Yang XY, Chang TY, Li BL. Enhancement of human ACAT1 gene expression to promote the macrophage-derived foam cell formation by dexamethasone. Cell Res 2004;14:315-323.

32. Shiffman D, Mikita T, Tai JT, Wade DP, Porter JG, Seilhamer JJ, Somogyi R, Liang S, Lawn RM. Large scale gene expression analysis of cholesterolloaded macrophages. J Biol Chem 2000;275:37324-37332.

24. Yvan-Charvet L, Wang N, Tall AR. Role of HDL, ABCA1, and ABCG1 transporters in cholesterol efflux and immune responses. Arterioscler Thromb Vasc Biol 2010;30:139-143.

33. Tsukamoto K, Kinoshita M, Kojima K, Mikuni Y, Kudo M, Mori M, Fujita M, Horie E, Shimazu N, Teramoto T. Synergically increased expression of CD36, CLA-1 and CD68, but not of SR-A and LOX-1, with the progression to foam cells from macrophages. J Atheroscler Thromb 2002;9:57-64.

105

RESEARCH ARTICLE DOI: 10.4274/tjh.galenos.2019.2019.0306 Turk J Hematol 2019;36:106-111

Dose Adjustment Helps Obtain Better Outcomes in Multiple Myeloma Patients with Bortezomib, Melphalan, and Prednisolone (VMP) Treatment Bortezomib, Melfalan ve Prednizolon (VMP) Tedavisinde Doz Ayarlaması Multipl Myelom Hastalarında Daha İyi Tedavi Sonuçlarının Alınmasına Yardımcıdır Su-Hee Cho,

Ho-Jin Shin,

Ki Sun Jung,

Do Young Kim

Pusan National University Yangsan Hospital, Clinic of Hematology-Oncology, Busan, Korea

Abstract

Öz

Objective: Multiple myeloma (MM) has a better survival outcome because of the development of drugs. However, equivalent outcomes cannot be expected from the same drug. Therefore, how the treatment schedule is managed is important. We analyzed VMP (bortezomib, melphalan, and prednisolone) data to determine an effective treatment strategy.

Amaç: Günümüzde yeni geliştirilen ilaçlar sayesinde multiple myelom (MM) hastalarında tedavi sonuçları daha iyidir. Ancak, aynı ilaç için her hastada eşit sonuçlar elde edilmesi beklenemez. Bu nedenle, tedavi şemalarının nasıl düzenlendiği büyük önem taşımaktadır. Biz VMP (bortezomib, melfalan ve prednizolon) tedavi verilerini etkin tedavi stratejisi belirlemek amacıyla inceledik.

Materials and Methods: We collected the data of 59 patients who were newly diagnosed with MM from January 2012 to April 2017 using electronic medical records. We analyzed baseline characteristics, responses, dose reductions, and survival.

Gereç ve Yöntemler: Ocak 2012’den Nisan 2017’ye kadar yeni tanı almış 59 MM hastalarının elektronik dosyaları incelendi. Tedavi öncesi özellikler, tedavi cevapları, doz azaltımları ve sağkalımları analiz edildi.

Results: The overall response rate was 86.5% [complete response (CR): 32.2%, very good partial response (VGPR): 37.3%]. The median progression-free survival was 33.6 months and the 5-year overall survival rate was 70%. There were significant better progressionfree survival outcomes between CR and non-CR for each of the 4 cycles. Of the four patients who achieved CR after the first cycle, none have had disease progression as of yet. We divided patients into two groups according to the median dose (52.1 mg/m2) and we found no differences between the high-dose and low-dose groups. About 78% of patients completed 9-cycle schedules and 84% patients experienced dose reduction, mostly for reasons of non-hematologic toxicities. Conclusion: Active dose reduction helped to continue treatment and it increased the opportunity to be exposed to drugs. In the end, it resulted in improved outcome.

Bulgular: Tüm yanıt oranı %86,5 [tam yanıt (TY) %32,2; çok iyi parsiyel yanıt %37,3) idi. Medyan progresyonsuz yaşam 33,6 ay ve 5 yıllık genel sağkalım %70 idi. Her 4 siklus için de TY sağlanan hastalarda medyan progresyonsuz yaşam TY sağlanamayan hastalara göre istatistiksel olarak anlamlı düzeyde daha iyiydi. İlk siklus sonrasında TY sağlanmış olan 4 hastanın hiçbirinde şu ana kadar progresyon izlenmedi. Hastaları median doza göre (52,1 mg/m2) ikiye ayırdığımızda düşük ve yüksek dozda ilaç alanlar arasında fark izlenmedi. Hastaların yaklaşık %78’i planlanan 9 siklusu tamamladı ve %84’ü genellikle hematolojik olmayan toksisiteye bağlı olarak doz azaltılması gerektirdi. Sonuç: Aktif doz azaltılması, tedavinin devamının sağlanmasına yardım etmekte ve ilaçlara maruziyetinin artmasına fırsat tanımaktadır. Sonuç olarak da daha iyi tedavi sonuçları sağlamaktadır. Anahtar Sözcükler: Prednizolon

Multipl

myelom,

Bortezomib,

Melfalan,

Keywords: Multiple myeloma, Bortezomib, Melphalan, Prednisolone

Address for Correspondence/Yazışma Adresi: Su-Hee CHO, M.D., Pusan National University Yangsan Hospital, Clinic of Hematology-Oncology, Busan, Korea Phone : +82-55-360-2385 E-mail : soonsoo0801@naver.com ORCID-ID: orcid.org/0000-0002-0616-5880

106

Received/Geliş tarihi: March 10, 2019 Accepted/Kabul tarihi: April 15, 2019

Turk J Hematol 2019;36:106-111

Cho SH, et al: Dose Adjustment Helps Obtain Better Outcomes in MM Patients with VMP Treatment

Introduction Multiple myeloma (MM) has a better survival outcome than other hematologic malignancies such as aggressive lymphoma and acute leukemia [1,2,3]. The survival rate has improved as many new drugs have been developed. Mainstream therapies such as proteasome inhibitors (PIs) and immune modulating drugs (IMiDs), as well as monoclonal antibodies, check point inhibitors, and chimeric antigen receptors, have shown promising results [4,5,6]. However, equivalent outcomes cannot be expected from the same drug. Therefore, how the treatment schedule is managed is as important as the kind of drugs selected. In Korea, government insurance has allowed bortezomib-based treatment as a first-line treatment in transplant-ineligible patients since 2012. We collected and analyzed VMP (bortezomib, melphalan, and prednisolone) data to determine an effective treatment strategy [7,8,9].

Materials and Methods Patients We enrolled 59 patients who were newly diagnosed with MM and had started VMP therapy from January 2012 to April 2017. All patients were transplant-ineligible. The most common reason for this was age, because the government does not allow transplants over the age of 65 in Korea. Four patients who were under 65 were transplant-ineligible because of poor performance. Data were collected from electronic medical records in two hospitals affiliated with Pusan National University. A response evaluation was conducted in each treatment cycle using serum/urine protein electrophoresis (PEP) and serum free light-chain assay measurements. All patients had bone marrow examinations. A diagnosis was made and a response evaluation was undertaken according to International Myeloma Working Group criteria [10].

or to the last follow-up visit. Survival rates were compared for statistical differences using log-rank analysis, and we used Pearsonâ&#x20AC;&#x2122;s correlation coefficient for correlation analysis (SPSS 21). A p-value of less than 0.05 was considered to indicate a significant difference.

Results Clinical Characteristics The median patient age was 72 years (range: 53-81 years), and the male-to-female ratio was 1:1.2. According to the International Scoring System, there were stage I patients (16.9%), stage II patients (30.5%), and stage III patients (52.5%). Of these, only 9 (15.3%) patients had confirmed plasmacytoma at various sites and 11 (18.6%) patients were classified as having light-chain MM (LCMM). Patients in the LCMM category had a high level of only one light-chain without monoclonal immunoglobulin on PEP [11]. Chromosomal abnormalities were identified in 17 (28.8%) patients and complex karyotypes were the most common. Baseline clinical characteristics of all patients are summarized in Table 1. Treatment and Response All patients were treated with VMP according to the schedule in the VISTA trial, with a subcutaneous bortezomib injection [12]. Ten patients (16.9%) received radiotherapy for symptom control Table 1. Baseline characteristics (n=59). n (%) Median age (range), years

72 (53-81)

Sex Men

27 (45.8)

Women

32 (54.2)

ISS disease stage at diagnosis I

10 (16.9)

Treatment

18 (30.5)

All patients received treatment according to the VISTA trial. They received a total of 9 cycles. One cycle was 6 weeks and treatment comprised bortezomib at 1.3 mg/m2 on days 1, 4, 8, 11, 22, 25, 29, and 32 in cycles 1-4 and on days 1, 8, 22, and 29 in cycles 5-9; melphalan at 9 mg/m2 on days 1-4 in cycles 1-9; and prednisone at 60 mg/m2 on days 1-4 in cycles 1-9. Unlike in VISTA, bortezomib was applied subcutaneously.

III

31 (52.5)

Statistical Analysis Overall survival (OS) and progression-free survival (PFS) were estimated using the Kaplan-Meier method. PFS was calculated from the start-of-treatment date to the date of disease progression, the last follow-up visit, or the date of death if the disease had not progressed until the time of investigation. OS was measured from the date of diagnosis to the date of death,

Multiple myeloma subtype IgG

35 (59.3)

IgA

12 (20.3)

IgD

1 (1.7)

Light chain

11 (18.6)

Karyotype Normal

37 (62.7)

Abnormal

17 (28.8)

Unknown

5 (8.5)

Plasmacytoma Yes

9 (15.3)

50 (84.7)

ISS: International Scoring System.

107

Cho SH, et al: Dose Adjustment Helps Obtain Better Outcomes in MM Patients with VMP Treatment

Turk J Hematol 2019;36:106-111

before or during the treatment period. A total of 46 patients (78%) completed nine treatment cycles, and 13 patients (22%) stopped treatment early. Disease progression was the main reason for stopping treatment (n=9), followed by death (n=3), and one patient declined to proceed with treatment (n=1). There were 19 (32.2%) patients who achieved complete response (CR), including stringent CR (sCR), while 11 (18.6%) patients achieved very good partial response (VGPR) and 22 (37.3%) patients achieved partial response (PR). The overall response rate (ORR) including sCR, CR, VGPR, and PR was 86.5% (Table 2).

total dose of bortezomib in the patients who completed the 9 treatment cycles. If we included the patients who discontinued treatment, patients with disease progression would be in the low-dose group. Finally, the low-dose group seemed to have poor outcome. Therefore, we selected 46 patients (78%) who had completed 9-cycle schedules and divided them into groups according to the median dose (52.1 mg/m2; range: 33.8-67. 5 mg/m2). There was no difference in PFS and OS between the high-dose (≥52.1 mg/m2) and low-dose (<52.1 mg/m2) groups (Figure 3).

The median follow-up duration was 31.1 months (range: 4.064.3 months) and the median PFS was 33.6 months (range: 4.053.5 months). The median OS was not reached and the 5-year survival rate was 70%. During the follow-up period, 29 patients showed disease progression and most of them received further treatment. In the first cycle, 4 patients achieved CR, and none of them have shown disease progression to date (range: 21.7-52.8 months). In the second, third, and fourth cycles, the patients achieving CR numbered 10, 14, and 15, respectively. All of them showed superior PFS compared to the non-CR group (Figure 1). We also divided the patients into two groups according to VGPR; one group included CR and VGPR while the remaining patients formed the other group for each of the 4 cycles. There was a tendency for a better outcome in the good response group, but this was not statistically significant. In terms of the best response, the ≥VGPR patients showed a statistically significantly improved PFS outcome, with a tendency for an improved OS outcome. The median PFS in the ≥VGPR was 46.7 months, and it was 26.2 months in the ≤PR group (Figure 2).

Dose Reduction

We divided the patients into groups according to whether they completed 9 cycles of treatment or not. There was significant survival superiority in the 9-cycle group. We only checked the

Discussion

Table 2. Treatment and response (n=59).

During the VMP treatment, 84.7% of patients experienced dose reduction, and 23.7% of patients had the dose reduced twice. One-third of patients (n=16, 32%) experienced dose reduction in the first cycle and 14 patients (28%) and 15 patients (30%) in the second and third cycles, respectively. There was a high dose reduction rate in the first cycle, which showed the tendency of dose reduction. When patients complained about adverse effects, physicians always discussed dose reduction with them. Almost all dose reduction (90%) was done prior to the third cycle, so the proportion of dose reductions had been definitively reduced by the 4th cycle. We could check the reason for dose reduction in 32 patients. The main reason for dose reduction was non-hematologic toxicity (92.7%), including peripheral neuropathy (36.6%) (Table 3). Other non-hematologic toxicities were weakness (n=8), emesis (n=4), ileus (n=2), skin rash (n=2), infection (n=2), dizziness (n=2), diarrhea (n=1), mucositis (n=1), and disorientation (n=1).

The VISTA trial reported that a higher dosage improved patient outcome and confirmed the relationship between dose and Table 3. Dose reduction.

Total cycles 9 cycles

46 (78.0)

<9 cycles

13 (22.0)

Best response sCR + CR

19 (32.2)

VGPR

11 (18.6)

n (%) Dose reduction times (n=59) 0

9 (15.3)

36 (61.0)

14 (23.7)

First dose reduction cycle (n=50)

22 (37.3)

3 (5.1)

First cycle

16 (32.0)

1 (1.7)

Second cycle

14 (28.0)

Unknown

3 (5.1)

Third cycle

15 (30.0)

Fourth cycle

5 (10.0)

Reason for discontinuation

Reason for dose reduction (n=32)

Finishing 9 cycles of VMP

46 (78.0)

Disease progression

9 (15.3)

Non-hematologic toxicity

38 (92.7)

Death Other

3 (5.1) 1 (1.7)

Peripheral neuropathy

15 (36.6)

Other non-hematologic toxicity

23 (56.1)

Hematologic toxicity

3 (7.3)

CR: Complete response.

108

Turk J Hematol 2019;36:106-111

Cho SH, et al: Dose Adjustment Helps Obtain Better Outcomes in MM Patients with VMP Treatment

survival, regardless of discontinuation. The authors of the VISTA report found that patients who had been administered more than 39 mg/m2 of bortezomib had better PFS and OS [13]. However, poor responders might have been included in the low-dose group because they analyzed all patients regardless of discontinuation due to poor response. That could make the survival outcome appear worse than the real effect [14].

Because of this, we analyzed only patients who had completed the VMP schedule. The patients who could not finish the whole schedule because of poor response were excluded. In this study, the median dose of bortezomib was 52.1 mg/m2, and we found no differences between the high- and low-dose groups in terms of PFS and OS. This showed that the total dose of bortezomib in the same period was not important.

Figure 1. Progression-free survival according to presence of complete response. CR: Complete response.

Figure 2. Progression-free survival and overall survival according to very good partial response or partial response. VGPR: Very good partial response, PR: partial response.

109

Cho SH, et al: Dose Adjustment Helps Obtain Better Outcomes in MM Patients with VMP Treatment

Turk J Hematol 2019;36:106-111

Figure 3. Progression-free survival and overall survival according to median dose. On the contrary, continuation of treatment can be more effective [15]. In the VISTA trial, 41% of the patients discontinued treatment compared to 22% in our study. The most common reason for discontinuing treatment in the VISTA trial was an adverse event, but no patients stopped treatment because of toxicity in this study. We think that the active dose reduction resulted in low discontinuation because the dose reduction rate (85%) was higher than in the VISTA trial (67%). In particular, if the early dose reduction rate is relatively high, it can also help to continue treatment. Poor disease control may be a concern in early dose reduction. However, there were no differences in survival and response between the dose reduction group and the other groups. We suggest that active dose reduction may help to continue treatment and enable completion of the planned cycles [16,17,18]. It provided patients with an increased opportunity to be exposed to bortezomib and resulted in an improved response. There were more PR patients in our study (88%) than in the VISTA trial (70%). In CR patients (32%), our result was similar to that of VISTA (30%). The method of bortezomib injection was different compared to VISTA. For this reason, peripheral neuropathy occurred less in this study, and that could be related to lower discontinuation. Nonetheless, the dose reduction rate was higher than in VISTA, which could explain the tendency of active dose reduction strongly. We think that our results may have been underestimated. In LCMM, many patients did not receive a bone marrow examination, as this is not easy to perform for every response evaluation in practice. Therefore, these patients were usually placed in the PR group, and it is possible that we may have had an even better response if the LCMM patients had received a bone marrow examination. We also confirmed the importance of an early deep response. All the CR patients in the first cycle have maintained early deep 110

response to date. The CR patients in each cycle between the second and fourth cycles showed a significantly better PFS outcome. In the VISTA trial, the authors also confirmed that CR patients had better PFS than the PR patients [19]. Additionally, we analyzed PFS according to VGPR and confirmed the tendency of a better outcome in the VGPR group. From Korean Multiple Myeloma Working Party data, we know that an early response results in longer survival, and many other studies have also shown similar results [20,21,22].

Conclusion We reviewed the records of patients who received VMP treatment, which are similar to previous data. However, we could check that better outcomes were obtained through active dose reduction. The dose reduction makes treatment easier to continue. Finally, it provides an opportunity to administer more drugs and obtain a better response. More data and assessments are required to support these conclusions. Ethics Ethics Committee Approval: It was received. Informed Consent: It was received. Authorship Contributions Surgical and Medical Practices: C.S.H., S.H.J., J.K.S., K.D.Y.; Concept: C.S.H., S.H.J.; Design: C.S.H., S.H.J.; Data Collection or Processing: C.S.H., K.D.Y.; Analysis or Interpretation: C.S.H.; Literature Search: C.S.H., S.H.J., Writing: C.S.H. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

Turk J Hematol 2019;36:106-111

Cho SH, et al: Dose Adjustment Helps Obtain Better Outcomes in MM Patients with VMP Treatment

References 1. Kyle RA, Rajkumar SV. Multiple myeloma. N Engl J Med 2004;351:18601873. 2. Brenner H, Gondos A, Pulte D. Recent major improvement in long-term survival of younger patients with multiple myeloma. Blood 2008;111:25212526. 3. Kumar SK, Rajkumar SV, Dispenzieri A, Lacy MQ, Hayman SR, Buadi FK, Zeldenrust SR, Dingli D, Russell SJ, Lust JA, Greipp PR, Kyle RA, Gertz MA. Improved survival in multiple myeloma and the impact of novel therapies. Blood 2008;111:2516-2520. 4. Brudno JN, Maric I, Hartman SD, Rose JJ, Wang M, Lam N, StetlerStevenson M, Salem D, Yuan C, Pavletic S, Kanakry JA, Ali SA, Mikkilineni L, Feldman SA, Stroncek DF, Hansen BG, Lawrence J, Patel R, Hakim F, Gress RE, Kochenderfer JN. T cells genetically modified to express an anti-B-cell maturation antigen chimeric antigen receptor cause remissions of poorprognosis relapsed multiple myeloma. J Clin Oncol 2018;36:2267-2280. 5. Lokhorst HM, Plesner T, Laubach JP, Nahi H, Gimsing P, Hansson M, Minnema MC, Lassen U, Krejcik J, Palumbo A, van de Donk NW, Ahmadi T, Khan I, Uhlar CM, Wang J, Sasser AK, Losic N, Lisby S, Basse L, Brun N, Richardson PG. Targeting CD38 with daratumumab monotherapy in multiple myeloma. N Engl J Med 2015;373:1207-1219. 6. Jelinek T, Hajek R. PD-1/PD-L1 inhibitors in multiple myeloma: the present and the future. Oncoimmunology 2016;5:e1254856. 7. San Miguel JF, Schlag R, Khuageva NK, Dimopoulos MA, Shpilberg O, Kropff M, Spicka I, Petrucci MT, Palumbo A, Samoilova OS, Dmoszynska A, Abdulkadyrov KM, Schots R, Jiang B, Mateos MV, Anderson KC, Esseltine DL, Liu K, Cakana A, van de Velde H, Richardson PG; VISTA Trial Investigators. Bortezomib plus melphalan and prednisone for initial treatment of multiple myeloma. N Engl J Med 2008;359:906-917. 8. Mateos MV, Richardson PG, Schlag R, Khuageva NK, Dimopoulos MA, Shpilberg O, Kropff M, Spicka I, Petrucci MT, Palumbo A, Samoilova OS, Dmoszynska A, Abdulkadyrov KM, Schots R, Jiang B, Esseltine DL, Liu K, Cakana A, van de Velde H, San Miguel JF. Bortezomib plus melphalan and prednisone compared with melphalan and prednisone in previously untreated multiple myeloma: updated follow-up and impact of subsequent therapy in the phase III VISTA trial. J Clin Oncol 2010;28:2259-2266. 9. San Miguel JF, Schlag R, Khuageva NK, Dimopoulos MA, Shpilberg O, Kropff M, Spicka I, Petrucci MT, Palumbo A, Samoilova OS, Dmoszynska A, Abdulkadyrov KM, Delforge M, Jiang B, Mateos MV, Anderson KC, Esseltine DL, Liu K, Deraedt W, Cakana A, van de Velde H, Richardson PG. Persistent overall survival benefit and no increased risk of second malignancies with bortezomib-melphalan-prednisone versus melphalan-prednisone in patients with previously untreated multiple myeloma. J Clin Oncol 2013;31:448-455. 10. Rajkumar SV, Dimopoulos MA, Palumbo A, Blade J, Merlini G, Mateos MV, Kumar S, Hillengass J, Kastritis E, Richardson P, Landgren O, Paiva B, Dispenzieri A, Weiss B, LeLeu X, Zweegman S, Lonial S, Rosinol L, Zamagni E, Jagannath S, Sezer O, Kristinsson SY, Caers J, Usmani SZ, Lahuerta JJ, Johnsen HE, Beksac M, Cavo M, Goldschmidt H, Terpos E, Kyle RA, Anderson KC, Durie BG, Miguel JF. International Myeloma Working Group updated criteria for the diagnosis of multiple myeloma. Lancet Oncol 2014;15:538548. 11. Magrangeas F, Cormier ML, Descamps G, Gouy N, Lodé L, Mellerin MP, Harousseau JL, Bataille R, Minvielle S, Avet-Loiseau H. Light-chain only multiple myeloma is due to the absence of functional (productive) rearrangement of the IgH gene at the DNA level. Blood 2004;103:38693875.

12. Moreau P, Pylypenko H, Grosicki S, Karamanesht I, Leleu X, Grishunina M, Rekhtman G, Masliak Z, Robak T, Shubina A, Arnulf B, Kropff M, Cavet J, Esseltine DL, Feng H, Girgis S, van de Velde H, Deraedt W, Harousseau JL. Subcutaneous versus intravenous administration of bortezomib in patients with relapsed multiple myeloma: a randomised, phase 3, non-inferiority study. Lancet Oncol 2011;12:431-440. 13. Mateos MV, Richardson PG, Dimopoulos MA, Palumbo A, Anderson KC, Shi H, Elliott J, Dow E, van de Velde H, Niculescu L, San Miguel JF. Effect of cumulative bortezomib dose on survival in multiple myeloma patients receiving bortezomib-melphalan-prednisone in the phase III VISTA study. Am J Hematol 2015;90:314-319. 14. Hsieh PY, Liu CJ, Teng CJ. Immortal time bias and reverse causality in retrospective analysis: Comment on “Effect of cumulative bortezomib dose on survival in multiple myeloma patients receiving bortezomib-melphalanprednisone in the phase III VISTA study”. Am J Hematol 2015;90:146. 15. Mateos MV, Oriol A, Martínez-López J, Teruel AI, Bengoechea E, Palomera L, de Arriba F, Esseltine DL, Cakana A, Pei L, van de Velde H, Miguel JS. Outcomes with two different schedules of bortezomib, melphalan, and prednisone (VMP) for previously untreated multiple myeloma: matched pair analysis using long-term follow-up data from the phase 3 VISTA and PETHEMA/GEM05 trials. Ann Hematol 2016;95:2033-2041. 16. Sopena M, Clavero EM, Villa P, Martinez-Lopez J. Efficacy and safety of reduced-intensity induction therapy with a bortezomib-based regimen in elderly patients with multiple myeloma. Ther Adv Hematol 2012;3:147-154. 17. Tokuhira M, Watanabe R, Nemoto T, Hanzawa K, Sagawa M, Tomikawa T, Mori S, Kizaki M. Successful treatment with a modified bortezomib schedule of weekly and longer intervals for patients with refractory/resistance multiple myeloma. Leuk Res 2011;35:591-597. 18. Bringhen S, Larocca A, Rossi D, Cavalli M, Genuardi M, Ria R, Gentili S, Patriarca F, Nozzoli C, Levi A, Guglielmelli T, Benevolo G, Callea V, Rizzo V, Cangialosi C, Musto P, De Rosa L, Liberati AM, Grasso M, Falcone AP, Evangelista A, Cavo M, Gaidano G, Boccadoro M, Palumbo A. Efficacy and safety of once-weekly bortezomib in multiple myeloma patients. Blood 2010;116:4745-4753. 19. Harousseau JL, Palumbo A, Richardson PG, Schlag R, Dimopoulos MA, Shpilberg O, Kropff M, Kentos A, Cavo M, Golenkov A, Komarnicki M, Mateos MV, Esseltine DL, Cakana A, Liu K, Deraedt W, van de Velde H, San Miguel JF. Superior outcomes associated with complete response in newly diagnosed multiple myeloma patients treated with nonintensive therapy: analysis of the phase 3 VISTA study of bortezomib plus melphalan-prednisone versus melphalan-prednisone. Blood 2010;116:3743-3750. 20. Lee HS, Kim YS, Kim K, Kim JS, Kim HJ, Min CK, Suh C, Eom HS, Yoon SS, Lee JH, Kim MK, Kim SH, Bae SH, Mun YC, Jo DY, Chung JS; Korean Multiple Myeloma Working Party (KMMWP). Early response to bortezomib combined chemotherapy can help predict survival in patients with multiple myeloma who are ineligible for stem cell transplantation. J Korean Med Sci 2013;28:80-86. 21. Shah J, Bladé J, Sonneveld P, Harousseau JL, Lantz K, Londhe A, Lowery C, Orlowski RZ. Rapid early monoclonal protein reduction after therapy with bortezomib or bortezomib and pegylated liposomal doxorubicin in relapsed/ refractory myeloma is associated with a longer time to progression. Cancer 2011;117:3758-3762. 22. Kim JS, Kim K, Cheong JW, Min YH, Suh C, Kim H, Jo DY, Ryoo HM, Yoon SS, Lee JH; Korean Multiple Myeloma Working Party. Complete remission status before autologous stem cell transplantation is an important prognostic factor in patients with multiple myeloma undergoing upfront single autologous transplantation. Biol Blood Marrow Transplant 2009;15:463470.

111

BRIEF REPORT DOI: 10.4274/tjh.galenos.2018.2018.0351 Turk J Hematol 2019;36:112-116

Assessment of Health-Related Quality of Life in Pediatric Acute Lymphoblastic Leukemia Survivors: Perceptions of Children, Siblings, and Parents Çocukluk Çağı Akut Lenfoblastik Lösemi Sağ Kalanlarında Sağlıkla İlişkili Yaşam Kalitesinin Değerlendirilmesi: Çocukların, Kardeşlerin, Ebeveynlerin Algılaması Deniz Kızmazoğlu1, Seher Sarı1, Melike Evim Sezgin2, Arzu Kantarcıoğlu2, Birol Baytan2, Şebnem Yılmaz1, Adalet Meral Güneş2, Hale Ören1

Özlem Tüfekçi1,

Fatma Demir Yenigürbüz1,

1Dokuz Eylül University Faculty of Medicine, Department of Pediatric Hematology, İzmir, Turkey 2Uludağ University Faculty of Medicine, Department of Pediatric Hematology, Bursa, Turkey

Abstract

Öz

Objective: We investigated the health-related quality of life (HRQL) in survivors of pediatric acute lymphoblastic leukemia (ALL) and evaluated the perceptions of the children, their siblings, and their parents.

Amaç: Çocukluk çağı akut lenfoblastik lösemi (ALL) sağ kalanlarında sağlıkla ilişkili yaşam kalitesinin (HRQL) araştırılması ve çocukların, kardeşlerinin ve ebeveynlerinin bununla ilgili algılamalarının değerlendirilmesi amaçlandı.

Materials and Methods: Seventy ALL survivors, who were between 7 and 17 years of age and had completed therapy ≥2 years, were included. The control group consisted of their healthy siblings. HRQL was assessed by the age-specific KINDLR questionnaire.

Gereç ve Yöntemler: Çalışma grubu 7-17 yaş arası, kemoterapisi en az 2 yıl önce tamamlanmış 70 ALL’li çocuktan oluşturuldu. Kontrol grubu hastaların sağlıklı kardeşlerini (n=32) içerdi. HRQL ölçümü için yaşa uygun KINDLR anket formları kullanıldı.

Results: No significant differences could be found among HRQL scores of ALL survivors with respect to variables such as sex, risk group, and having chronic illness. HRQL scores for physical well-being, emotional well-being, family, and social functioning of the patient and sibling self-reports and parent proxy reports were lower than the expected values for healthy and chronically ill children. Conclusion: These results demonstrate that both ALL survivors and their families need help via psychological counseling programs to improve their HRQL even after completion of therapy. Keywords: Acute lymphoblastic leukemia, Health-related quality of life, KINDLR questionnaire

Bulgular: ALL sağ kalanlarında HRQL skorları cinsiyet, risk grubu, kronik hastalığı olma ve relaps öyküsü açısından istatistiksel anlamlı fark göstermedi. Hastalar ve kardeşlerinin HRQL skorlarıyla ebeveynlerin hasta çocuklarının durumuna bakış açısı skorları değerlendirildiğinde fiziksel iyilik, duygusal iyilik, aile ve sosyal ilişkiler ile ilgili HRQL skorları sağlıklı ve kronik hastalığa sahip çocuklara göre düşük bulundu. Sonuç: Hasta ve ebeveynlerin HRQL skorlarının düşük saptanması çocukluk çağı ALL sağ kalanları ve ebeveynlerinin tedavi bitimi sonrasında da psikolojik danışmanlık programlarına ihtiyacı olduğunu göstermektedir. Anahtar Sözcükler: Akut lenfoblastik lösemi, Sağlıkla ilişkili yaşam kalitesi, KINDLR anketi

Introduction

of life is negatively affected, with difficulties in social and

Acute lymphoblastic leukemia (ALL) comprises 26%-28% of all childhood malignancies [1,2]. The outcome of ALL has improved and survival periods have become longer [3,4]. Five-year overall survival was 79.9% at our centers between 1995 and 2009 [5]. Investigations of survivors have documented that their quality

intellectual functioning [6,7,8,9,10]. The aim of this study was to investigate health-related quality of life (HRQL) in survivors of pediatric ALL and to evaluate the perceptions of the children, their siblings, and their parents.

Address for Correspondence/Yazışma Adresi: Hale ÖREN, M.D., Dokuz Eylül University Faculty of Medicine, Department of Pediatric Hematology, İzmir, Turkey Phone : +90 232 412 61 41 E-mail : hale.oren@deu.edu.tr ORCID-ID: orcid.org/0000-0001-5760-8007

112

Received/Geliş tarihi: October 10, 2018 Accepted/Kabul tarihi: November 06, 2018

Turk J Hematol 2019;36:112-116

Kızmazoğlu D, et al: Health-Related Quality of Life in Leukemia

Materials and Methods

rank correlations (categorical variables) were calculated to evaluate relationships between changes in HRQL scores.

Patients The study population consisted of children who were diagnosed with ALL and had been treated with the ALL Berlin-FrankfurtMuenster (BFM) 95 protocol [11] at Dokuz Eylül University and Uludağ University Hospitals. We included 70 children diagnosed with ALL who were between the ages of 7 and 17 years, in complete remission, who had been followed for ≥2 years after completion of therapy. The control group consisted of 32 healthy siblings. We analyzed only one sibling of a patient who was in the age group of 7-17 years to obtain reliable results, since children may begin adequately describing their HRQL by the age of 7 years [12]. One parent for each patient (62 mothers, 8 fathers) filled out a questionnaire. The sociodemographic data of the patients were collected via questionnaire. Data about ALL therapy and follow-up period were recorded from hospital files. If the family’s monthly income was under 2000 Turkish lira (TL), participants were classified in the lower income group; if it was between 2000 and 5000 TL, they were classified in the middle income group; and if it was above 5000 TL, they were classified in the higher income group. Evaluation of HRQL There are different methods for evaluating HRQL [12,13,14,15,16]. We used the KINDLR questionnaire for measuring HRQL in children and adolescents. The KINDLR questionnaire was developed by Bullinger et al. and revised by Ravens-Sieberer and Bullinger [13,14,15,16,17]. The KINDLR aims more at the psychosocial than the physical aspects of HRQL. The method of assessment is child self-report or parent proxy report. Age- and sex-specific versions take into account the changes in the HRQL dimensions in the course of child development [14,15,17]. The KINDLR questionnaire consists of 24 items that assess six subscales: physical wellbeing, emotional well-being, self-esteem, family, friends, and everyday functioning (school) [17]. A total score of these six subscales is calculated after transforming the raw data on a scale ranging from 0 to 100. The Turkish version of the KINDLR questionnaire was modified by Eser et al. [18] and the results of their study indicated that the Turkish Kid-KINDL is a reliable and factorially valid assessment of children’s HRQL. Statistical Analysis The data were evaluated using SPSS 20.0 for Windows. Comparing the categorical variables of groups, nonparametric Kruskal-Wallis analysis was used. The Student t-test and MannWhitney U test were used when appropriate. Correlation and regression were used for determining the relationship between quality of life scores. Correlation was calculated with the Pearson correlation as a parametric method, while Spearman

This study was approved by the Ethics Committee of the Dokuz Eylül University Faculty of Medicine (approval number: 2015/1011).

Results The mean age of patients at the time of the study was 12.7±2.5 years and the mean age at diagnosis was 4.8±2.4 years. Fortytwo patients (60%) were in the age group of 7-13 years and 28 patients (40%) were in the age group of 14-17 years. The study group represented 65% of the survivors treated at two centers with similar characteristics. The sociodemographic properties of the study group are given in Table 1. Median follow-up duration was 8.2 years after completion of chemotherapy (Table 2). The mean age of the siblings was 14.1±2.9 years. There was statistically no difference between the two groups in age or sex. Information about the treatment center, therapy type, risk group of patients, relapse history, and time after therapy is summarized in Table 2. Twelve patients (17.1%) had chronic disease. Seven of them had endocrinological disease (obesity, insulin resistance, hypothyroidism), 4 had cardiac disease (2 hypertension, 2 minimal diastolic dysfunction), and 1 had epilepsy. Statistically, no differences could be found among HRQL scores of survivors with respect to variables including sex, therapy type, risk group, time after completion of therapy, income status, having chronic illness, relapse history, and therapy center. The mean HRQL scores of patients, siblings, and healthy and chronically ill children (children with chronic diseases such as asthma, obesity, and neurodermatitis) from self-reports and parent proxy reports are given in Table 3 [14,15,17]. There were statistically no differences between the scores of patient selfreports, sibling self-reports, and parent proxy reports. Total HRQL scores and the HRQL scores for physical well-being, Table 1. Sociodemographic data of the patients. Patients

n=70

Sex

Female Male

38 32

54 46

Education year

No school 1-5 years 6-10 years >10 years

1 27 37 5

1.4 38.6 52.9 7.1

Employment status

Yes No

1 69

1.4 98.6

Household economic condition

Low income Middle income High income

7 43 20

10 61.4 28.6

46.2

113

Kızmazoğlu D, et al: Health-Related Quality of Life in Leukemia

emotional well-being, family, and social functioning of the patients and sibling self-reports and parent proxy reports were lower than the expected values for healthy and chronically ill children. The HRQL scores for everyday functioning (school) of the patients appeared to be lower than the expected values for healthy children. When we investigated the HRQL scores of patient self-reports and sibling self-reports, we found no significant correlations between the two groups (physical well-being: r=0.266, p=0.245; emotional well-being: r=0.264, p=0.275; self-esteem: r=-0.159, p=0.503; friends: r=0.122, p=0.609; school: r=-0.016, p=0.948; family: r=0.354, p=0.125; and total score: r=0.312, p=0.136). When we investigated the HRQL scores of patient self-reports and parent proxy reports, we found moderate but significant Table 2. Information about patients’ treatment center, therapy type, risk group, relapse history, and time after completion of therapy.

Treatment center

Therapy

Risk group

Relapse Site of relapse Time after completion of therapy

Patients

Dokuz Eylül University

72.9

Uludağ University

27.1

Only CT

70.0

CT + RT

22.9

CT + HSCT

7.1

Standard risk

14.3

Intermediate risk

67.1

High risk

18.6

Yes

8.6

91.4

Bone marrow

83.3

Bone marrow + CNS 1

16.7

2-5 years

18.6

6-10 years

55.8

≥10 years

25.7

CT: Chemotherapy, RT: radiotherapy, HSCT: hematopoietic stem cell therapy, CNS: central nervous system.

Turk J Hematol 2019;36:112-116

positive correlations for all subscales (physical well-being: r=0.444, p=0.000; emotional well-being: r=0.331, p=0.005; self-esteem: r=0.244, p=0.042; friends: r=0.266, p=0.026; school: r=0.344, p=0.004; family: r=0.269, p=0.024; and total score: r=0.258, p=0.032).

Discussion Quality of life is negatively affected by the adverse effects of treatment in survivors of childhood leukemia [19,20,21]. In this study, we found no differences among HRQL subscale scores of ALL survivors with respect to variables including sex, therapy type, risk group, time after therapy, income status, having chronic illness, relapse history, and therapy center. Most of our patients were followed for more than 6 years after completion of therapy. A recent review of 22 studies representing 2073 children found that overall HRQL is reduced among children with ALL receiving treatment compared to healthy children, and HRQL was reported to improve over time after completion of therapy [20]. In the same review, inconsistent associations between clinical/demographic factors and HRQL outcomes were found; poor HRQL during ALL treatment appeared to be associated with intensive phases of chemotherapy, experiencing greater toxicity, corticosteroid therapy, older age, and female sex. High-risk patients who have undergone hematopoietic stem cell therapy may have poorer HRQL scores. In a recent study, it was demonstrated that HRQL and depression scores were significantly lower among survivors 2-5 years after treatment when compared to 6-10 years and 10 years or more [21]. Similar to our findings, Kanellopoulos et al. [19] and Sitaresmi et al. [22] reported that demographic characteristics, cancer, and treatment-related variables were not associated with poor HRQL in survivors. Identifying children at higher risk of these side effects and determining effective supportive care can improve HRQL outcomes [19,20,23,24]. Evaluation of HRQL in children is not easy [12,25,26]. Patients who were 7-17 years old were included in this study to obtain reliable results and appropriate KINDLR questionnaires were

Table 3. Health-related quality of life scores by patient self-reports, sibling self-reports, and parent proxy reports. Subscale Physical well-being Emotional well-being Self-esteem Family Social functioning School Total score

Patients, mean ± SD

Siblings, mean ± SD

Parents, mean ± SD

Healthy children*

Children

Chronically ill children** Parents

38.12±14.00 36.69±13.15 63.66±23.60 55.89±11.93 66.96±12.46 63.03±15.41 54.06±7.40

33.92±20.00 34.21±13.20 64.06±22.10 54.37±09.00 65.62±14.90 71.87±20.20 54.00±16.43

37.23±17.40 35.53±14.80 69.82±22.40 55.17±15.00 67.14±18.40 60.98±15.90 54.31±14.79

75.56 83.01 66.60 83.99 78.18 73.13 76.75

70.63±17.31 80.31±14.88 57.88±20.56 77.69±17.13 71.44±18.25 64.56±21.88 70.58±11.94

64.00±18.44 69.44±17.75 56.06±19.50 79.38±17.75 67.94±18.13 66.63±18.06 56.58±13.15

*The mean health-related quality of life scores for healthy children’s self-reports (n=1501). **The mean ± standard deviation health-related quality of life scores for chronically ill children’s self-reports and parent proxy reports (n=1050). SD: Standard deviation.

114

Kızmazoğlu D, et al: Health-Related Quality of Life in Leukemia

Turk J Hematol 2019;36:112-116

used for child self-reports and parent proxy reports [14,15,17]. We found that total HRQL scores of the ALL survivors appeared to be lower than the expected values for healthy and chronically ill children in the literature [14,15,17]. A strong association between poor HRQL in survivors of pediatric ALL and depression, anxiety, insomnia, pain, and obesity was found in several studies [19,20,21,27,28,29,30]. As a remarkable finding of our study, the scores for physical well-being, emotional well-being, family, and social functioning of the patient and sibling self-reports and parent proxy reports also appeared to be lower than the expected values for healthy and chronically ill child self-reports and their parent proxy reports. Including siblings and healthy children for two different control groups would make our study results stronger. As a control group, we could have chosen healthy children, but their family functioning and sociocultural situations could show differences. The reduced HRQL scores for these subscales may be due to problematic family functioning, household size, or social and cultural impairment [19,30]. The diagnosis, treatment, and follow-up periods for ALL cause significant disruption to normal family life and this negative effect may continue for many years [19,20,21]. In our study the HRQL scores of patient self-reports and parent proxy reports showed moderate but significant positive correlations in all subscales. It has been established that parent perception is important and ideally should reflect the child self-report [31,32,33]. The parent’s perception may not always be consistent with the child’s self-report, with parents overestimating their children’s impairment [20,34,35,36]. Mothers were more likely to report better HRQL in their children than fathers during induction therapy for ALL [37]. Children who self-reported poorer quality of life had mothers who were more depressed; parents who reported poorer quality of life for their children reported more illness stressors and perceived their children as being more vulnerable [36]. Exploration of the reasons for differences may improve the parent-child relationship.

Conclusion The low HRQL scores of the patient and sibling self-reports and parent proxy reports showed that both ALL survivors and their families need help via psychological counseling programs. Identifying patients and families at risk and providing them psychological support may improve the HRQL for ALL survivors and their families. Acknowledgments The authors would like to thank all the children and parents who participated in the study. They acknowledge the support of Dr. Pembe Keskinoğlu, Department of Biostatics and Medical Informatics, Dokuz Eylül University, and her valuable input on the statistical analysis of this report.

Ethics Ethics Committee Approval: This study was approved by the Ethics Committee of the Dokuz Eylül University Faculty of Medicine (approval number: 2015/10-11). Informed Consent: It was obtained from parents or legal guardians before patients’ enrollment in the study. Authorship Contributions Concept: S.S., A.M.G., H.Ö.; Design: S.S., A.M.G., Ş.Y., H.Ö.; Data Collection or Processing: S.S., D.K., M.E.S., A.K., B.B., F.D.Y., Ş.Y.; Analysis or Interpretation: S.S., D.K., Ö.T., A.M.G., H.Ö.; Literature Search: S.S., D.K., Ö.T., H.Ö.; Writing: D.K., Ö.T., H.Ö. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Linabery AM, Ross JA. Trends in childhood cancer incidence in the US (1992-2004). Cancer 2008;112:416-432. 2. Spallek J, Spix C, Zeeb H, Kaatsch P, Razum O. Cancer patterns among children of Turkish descent in Germany: a study at the German Childhood Cancer Registry. BMC Public Health 2008;8:152. 3. Schrappe M, Möricke A, Reiter A, Henze G, Welte K, Gadner H, Ludwig WD, Ritter J, Harbott J, Mann G, Klingebiel T, Gruhn B, Niemeyer C, Kremens B, Niggli F, Debatin KM, Ratei R, Stanulla M, Beier R, Cario G, Schrauder A, Zimmermann M. Key treatment questions in childhood acute lymphoblastic leukemia: results in 5 consecutive trials performed by the ALL-BFM study group from 1981 to 2000. Klin Padiatr 2013;225(Suppl 1):62-72. 4. Schrappe M, Nachman J, Hunger S, Schmiegelow K, Conter V, Masera G, Pieters R, Pui CH. Educational symposium on long-term results of large prospective clinical trials for childhood acute lymphoblastic leukemia (1985-2000). Leukemia 2010;24:253-254. 5. Güneş AM, Ören H, Baytan B, Bengoa SY, Evim MS, Gözmen S, Tüfekçi O, Karapınar TH, İrken G. The long-term results of childhood acute lymphoblastic leukemia at two centers from Turkey: 15 years of experience with the ALL-BFM 95 protocol. Ann Hematol 2014;93:1677-1684. 6. Pui CH, Yang JJ, Hunger SP, Pieters R, Schrappe M, Biondi A, Vora A, Baruchel A, Silverman LB, Schmiegelow K, Escherich G, Horibe K, Benoit YC, Izraeli S, Yeoh AE, Liang DC, Downing JR, Evans WE, Relling MV, Mullighan CG. Childhood acute lymphoblastic leukemia: progress through collaboration. J Clin Oncol 2015;33:2938-2948. 7. Mody R, Li S, Dover DC, Sallan S, Leisenring W, Oeffinger KC, Yasui Y, Robison LL, Neglia JP. Twenty-five-year follow-up among survivors of childhood acute lymphoblastic leukemia: a report from the childhood cancer survivor study. Blood 2008;111:5515-5523. 8. Robison LL. Late effects of acute lymphoblastic leukemia therapy in patients diagnosed at 0-20 years of age. Hematology Am Soc Hematol Educ Program 2011;2011:238-242. 9. Haddy TB, Mosher RB, Reaman GH. Late effects in long-term survivors after treatment for childhood acute leukemia. Clin Pediatr (Phila) 2009;48:601608. 10. Kalafatcilar AI, Tüfekçi O, Ören H, Hız S, Güleryüz H, Akay A, Orçim E, Olgun Y, İrken G. Assessment of neuropsychological late effects in survivors of childhood leukemia. Pediatr Hematol Oncol 2014;31:181-193.

115

Kızmazoğlu D, et al: Health-Related Quality of Life in Leukemia

11. Möricke A, Reiter A, Zimmermann M, Gadner H, Stanulla M, Dördelmann M, Löning L, Beier R, Ludwig WD, Ratei R, Harbott J, Boos J, Mann G, Niggli F, Feldges A, Henze G, Welte K, Beck JD, Klingebiel T, Niemeyer C, Zintl F, Bode U, Urban C, Wehinger H, Niethammer D, Riehm H, Schrappe M; German-Austrian-Swiss ALL-BFM Study Group. Risk-adjusted therapy of acute lymphoblastic leukemia can decrease treatment burden and improve survival: treatment results of 2169 unselected pediatric and adolescent patients enrolled in the trial ALL-BFM 95. Blood 2008;111:4477-4489. 12. Savage E, Riordan AO, Hughes M. Quality of life in children with acute lymphoblastic leukemia: a systematic review. Eur J Oncol Nurs 2009;13:36-48.

Turk J Hematol 2019;36:112-116

N. Health status and quality of life of long-term survivors of childhood acute leukemia: the impact of central nervous system irradiation. J Pediatr Hematol Oncol 2015;37:109-116. 25. Pickard AS, Topfer LA, Feeny DH. A structured review of studies on health-related quality of life and economic evaluation in pediatric acute lymphoblastic leukemia. J Natl Cancer Inst Monogr 2004;33:102-125. 26. Ravens-Sieberer U, Redegeld M, Bullinger M. Quality of life after in-patient rehabilitation in children with obesity. Int J Obes Relat Metab Disord 2001;25(Suppl 1):63-65.

13. Bullinger M, Mackensen S, Kirchberger I. KINDL - ein Fragebogen zur gesundheitsbezogenen Lebensqualität von Kindern. Zeitschrift für Gesundheitspsychologie 1994;2:64-67.

27. Nayiager T, Anderson L, Cranston A, Athale U, Barr RD. Health-related quality of life in long-term survivors of acute lymphoblastic leukemia in childhood and adolescence. Qual Life Res 2017;26:1371-1377.

14. Ravens-Sieberer U, Görtler E, Bullinger M. Subjective health and health behavior of children and adolescents--a survey of Hamburg students within the scope of school medical examination. Gesundheitswesen 2000;62:148-155.

28. Furlong W, Rae C, Feeny D, Gelber RD, Laverdiere C, Michon B, Silverman L, Sallan S, Barr R. Health-related quality of life among children with acute lymphoblastic leukemia. Pediatr Blood Cancer 2012;59:717-724.

15. Ravens-Sieberer U, Bullinger M. Assessing the health related quality of life in chronically ill children with the German KINDL: first psychometric and content-analytical results. Quality Life Res 1998:7:399-407.

29. Wilson CL, Stratton K, Leisenring WL, Oeffinger KC, Nathan PC, WasilewskiMasker K, Hudson MM, Castellino SM, Stovall M, Armstrong GT, Brinkman TM, Krull KR, Robison LL, Ness KK. Decline in physical activity level in the childhood cancer survivor study cohort. Cancer Epidemiol Biomarkers Prevention 2014;23:1619-1627.

16. Ravens-Sieberer U, Ellert U, Erhart M. Health related quality of life of children and adolescents in Germany. Norm data from the German Health Interview and Examination Survey (KiGGS). Bundesgesundheitsblatt Gesundheitsforschung Gesundheitsschutz 2007;50:810-818. 17. Ravens-Sieberer U, Bullinger M. KINDLER Questionnaire for Measuring Health-Related Quality of Life in Children and Adolescents, Revised Version. Manual 2000. Available online at https://www.kindl.org/english/manual/. 18. Eser E, Yüksel H, Baydur H, Erhart M, Saatli G, Cengiz Ozyurt B, Ozcan C, Ravens-Sieberer U. The psychometric properties of the new Turkish generic HRQL questionnaire for children (Kid-KINDL). Turk Psikiyatri Derg 2008;19:409-417. 19. Kanellopoulos A, Hamre HM, Dahl AA, Fosså SD, Ruud E. Factors associated with poor quality of life in survivors of childhood acute lymphoblastic leukemia and lymphoma. Pediatr Blood Cancer 2013;60:849-855. 20. Vetsch J, Wakefield CE, Robertson EG, Trahair TN, Mateos MK, Grootenhuis M, Marshall GM, Cohn RJ, Fardell JE. Health-related quality of life of survivors of childhood acute lymphoblastic leukemia: a systematic review. Qual Life Res 2018;27:1431-1443. 21. Baytan B, Aşut Ç, Çırpan Kantarcıoğlu A, Sezgin Evim M, Güneş AM. Health-related quality of life, depression, anxiety, and self-image in acute lymphocytic leukemia survivors. Turk J Hematol 2016;33:326-330. 22. Sitaresmi MN, Mostert S, Gundy CM, Sutaryo, Veerman AJ. HRQL assessment in Indonesian childhood acute lymphoblastic leukemia. Health Qual Life Outcomes 2008;6:96. 23. Essig S, von der Weid NX, Strippoli MP, Rebholz CE, Michel G, Rueegg CS, Niggli FK, Kuehni CE; Swiss Pediatric Oncology Group (SPOG). HRQL in longterm survivors of relapsed childhood acute lymphoblastic leukemia. PLoS One 2012;7:e38015. 24. Benadiba J, Michel G, Auquier P, Chastagner P, Kanold J, Poirée M, Plantaz D, Padovani L, Berbis J, Barlogis V, Contet A, Chambost H, Sirvent

116

30. Myers RM, Balsamo L, Lu X, Devidas M, Hunger SP, Carroll WL, Winick NJ, Maloney KW, Kadan-Lottick NS. A prospective study of anxiety, depression, and behavioral changes in the first year after a diagnosis of childhood acute lymphoblastic leukemia. Cancer 2014;120:1417-1425. 31. Mitchell HR, Lu X, Myers RM, Sung L, Balsamo LM, Carroll WL, Raetz E, Loh ML, Mattano LA Jr, Winick NJ, Devidas M, Hunger SP, Maloney K, Kadan-Lottick NS. Prospective, longitudinal assessment of quality of life in children from diagnosis to 3 months off treatment for standard risk acute lymphoblastic leukemia: results of Children’s Oncology Group study AALL0331. Int J Cancer 2016;138:332-339. 32. Tremolada M, Bonichini S, Altoè G, Pillon M, Carli M, Weisner TS. Parental perceptions of HRQL in children with leukemia in the second week after the diagnosis: a quantitative model. Support Care Cancer 2011;19:591-598. 33. Pöder U, Ljungman G, von Essen L. Parents’ perceptions of their children’s cancer-related symptoms during treatment: a prospective, longitudinal study. J Pain Symptom Manage 2010;40:661-670. 34. Gordijn MS, van Litsenburg RR, Gemke RJ, Huisman J, Bierings MB, Hoogerbrugge PM, Kaspers GJ. Sleep, fatigue, depression, and quality of life in survivors of childhood acute lymphoblastic leukemia. Pediatr Blood Cancer 2013;60:479-485. 35. Eiser C, Morse R. Can parents rate their child’s health-related quality of life? Results of a systematic review. Qual Life Res 2001;10:347-357. 36. Vance YH, Morse RC, Jenney ME, Eiser C. Issues in measuring quality of life in childhood cancer: measures, proxies, and parental mental health. J Child Psychol Psychiatry 2001;42:661-667. 37. van Litsenburg RR, Huisman J, Pieters R, Verhaak C, Kaspers GJ, Gemke RJ. Determinants of quality of life during induction therapy in pediatric acute lymphoblastic leukemia. Support Care Cancer 2014;22:3235-3242.

IMAGES IN HEMATOLOGY DOI: 10.4274/tjh.galenos.2019.2018.0419 Turk J Hematol 2019;36:117-119

Osteoblastic Solitary Plasmacytoma of Bone Kemiğin Osteoblastik Soliter Plazmasitomu Chrissa Sioka1, Konstantinos Sakelariou1, Andreas Fotopoulos1

Alexandra Papoudou-Bai2,

Christos Tolis3,

Jihand Al-Boucharali1,

1School of Health Sciences, University Hospital of Ioannina Faculty of Medicine, Department of Nuclear Medicine, Ioannina, Greece 2School of Health Sciences, University Hospital of Ioannina Faculty of Medicine, Department of Pathology, Ioannina, Greece 3Oncoderm Center, Ioannina, Greece

Figure 1. Chest X-ray (upper panel) revealing a hyperdense lesion in the left 8th rib (arrows); the computed tomography scan of the chest (lower panel, arrows) documented the abnormality. CT: Computed tomography.

Figure 2. Whole-body bone scan with Tc-99m-methylene diphosphonate demonstrated increased radionuclide uptake, indicating an osteoblastic lesion in a large portion of the rib (arrows), with intense focal uptake (arrowhead).

Address for Correspondence/Yazışma Adresi: Chrissa SIOKA, M.D., School of Health Sciences, University Hospital of Ioannina Faculty of Medicine, Department of Nuclear Medicine, Ioannina, Greece Phone : +30 26510 07514 E-mail : csioka@yahoo.com ORCID-ID: orcid.org/0000-0002-2184-4945

Received/Geliş tarihi: December 02, 2018 Accepted/Kabul tarihi: February 26, 2019

117

Sioka C, et al: Osteoblastic Solitary Plasmacytoma of Bone

Turk J Hematol 2019;36:117-119

Figure 3. Histological examination of the bone lesion revealed plasma cell infiltrate (3A, hematoxylin and eosin staining, magnification 600x). The neoplastic cells were CD138-positive (3B, DAB, magnification 200x) and CD38-positive (3C, DAB, magnification 200x) and expressed IgA (3D, DAB, magnification 200x). Immunostainings for kappa and lambda light chains showed cytoplasmic light chain positivity (3E, DAB, magnification 200x) and absence of kappa light chain (3F, DAB, magnification 200x).

A 54-year-old woman was subjected to a routine annual chest X-ray for work license renewal, which showed a hyperdense lesion of the left 8th rib (Figure 1). A chest computed tomography (CT) scan documented this abnormality, which was considered to represent Paget’s disease, bone metastasis, or a primary bone tumor. A whole-body bone scan showed increased radionuclide uptake (Figure 2), indicating an osteoblastic lesion in a large portion of the rib (arrows), with intense focal uptake (arrowhead). Diagnostic biopsy and histological examination of a tissue specimen from the affected rib (Figure 3) revealed dense infiltration of plasma cells (Figure 3A, hematoxylin and eosin stain, 600x). Immunohistochemically, the cells expressed CD138 (Figure 3B, DAB, 200x) and CD38 (Figure 3C, DAB, 200x) and were IgA-positive (Figure 3D, DAB, 200x). Immunostaining showed lambda light-chain restriction (Figure 3E, DAB, 200x) with no expression of kappa light-chain (Figure 3F, DAB, 200x), consistent with plasma cell neoplasm. The bone marrow biopsy obtained from the left iliac crest was free of neoplastic invasion. An X-ray of the axial skeleton and long bones and a CT scan of the skull and thorax were performed, which did not reveal any additional bone lesions. Laboratory test results demonstrated normal creatinine (0.73 mg/dL) and total calcium (9.6 mg/dL) levels. The results of the 118

complete blood count showed a white blood cell count of 3.39x103/µL with no other remarkable findings. B2 microglobulin was 2091 µL (normal range: 700-3400) and alkaline phosphatase was 40 IU/L (normal range: 30-125). Serum free light-chains were absent and there was no serum or urine monoclonal paraprotein detection. Taking into consideration all of the above-mentioned findings, a diagnosis of osteoblastic solitary plasmacytoma was made. Solitary osseous plasmacytoma consists of a mass of neoplastic monoclonal plasma cells associated with bone osteolysis [1,2]. During diagnostic workup, fludeoxyglucose-positron emission tomography should be performed, if available, to rule out smoldering multiple myeloma and monitor response to treatment [3,4]. Solitary osteolytic bone plasmacytomas, although rare, have been reported in several bone areas such as the lumbar spine vertebra, the sternum, or even the ribs [2,5]. However, plasmacytoma exhibiting osteoblastic characteristics such as in our case is extremely rare and deserves further investigation. Keywords: Plasmacytoma, Bone scintigraphy, Multiple myeloma Anahtar Sözcükler: Plazmasito, Kemik sintigrafisi, Multipl myelom

Turk J Hematol 2019;36:117-119

Informed Consent: Received. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Hartshorne MF, Cawthon MA, Bauman JM. Plasmacytoma of the lumbar spine by SPECT. Clin Nucl Med 1986;11:65-66.

Sioka C, et al: Osteoblastic Solitary Plasmacytoma of Bone

2. Solav S. Bone scintiscanning in osteolytic lesions. Clin Nucl Med 2004;29:12-20. 3. Albano D, Bosio G, Treglia G, Giubbini R, Bertagna F. 18F-FDG PET/CT in solitary plasmacytoma: metabolic behavior and progression to multiple myeloma. Eur J Nucl Med Mol Imaging 2018;45:77-84. 4. Nanni C, Rubello D, Zamagni E, Castellucci P, Ambrosini V, Montini G, Cavo M, Lodi F, Pettinato C, Grassetto G, Franchi R, Gross MD, Fanti S. 18F-FDG PET/CT in myeloma with presumed solitary plasmocytoma of bone. In Vivo 2008;22:513-517. 5. Tajima K, Uchida N, Azuma Y, Okada T, Sasamoto H, Yokoo H, Kuwano H. Surgical resection of a solitary plasmacytoma originating in a rib. Ann Thorac Cardiovasc Surg 2014;20(Suppl):609-612.

119

IMAGES IN HEMATOLOGY DOI: 10.4274/tjh.galenos.2019.2018.0395 Turk J Hematol 2019;36:120-121

Hypersegmentation of Granulocytes and Monocytes in a Patient with Primary Myelofibrosis Treated with Hydroxycarbamide Hidroksikarbamid ile Tedavi Edilen Primer Miyelofibrozisli bir Hastada Granülositler ve Monositlerin Hiperpigmentasyonu Monika Błocka-Gumowska1,

Justyna Holka2,

Olga Ciepiela1,3

1Central Laboratory at Public Central Teaching Hospital in Warsaw, Warsaw, Poland 2Medical University of Warsaw, Students Scientific Group of Laboratory Medicine, Warsaw, Poland 3Medical University of Warsaw Department of Laboratory Diagnostics, Warsaw, Poland

Figure 1. Hypersegmentation of white blood cells in peripheral blood of patient treated with hydroxycarbamide: (A) eosinophils, (B) basophils, (C) monocytes, and (D) neutrophils. ©Copyright 2019 by Turkish Society of Hematology Turkish Journal of Hematology, Published by Galenos Publishing House

Address for Correspondence/Yazışma Adresi: Olga CIEPIELA, M.D., Central Laboratory at Public Central Teaching Hospital in Warsaw, Warsaw, Poland Phone : +48 225992405 E-mail : olga.ciepiela@wum.edu.pl ORCID-ID: orcid.org/0000-0002-3694-4076

120

Received/Geliş tarihi: November 12, 2018 Accepted/Kabul tarihi: January 23, 2019

Turk J Hematol 2019;36:120-121

Błocka-Gumowska M, et al: Hypersegmentation of White Blood Cells

A 62-year-old man with a history of primary myelofibrosis was admitted to the emergency room due to abdominal pain. He remains under maintenance therapy with hydroxycarbamide. Complete blood count showed the following: white blood cell (WBC) count, 169.73x109/L, including 65.8% neutrophils and 24.4% immature granulocytes; hemoglobin, 113 g/L; mean corpuscular volume, 115.20 fL; and platelet count, 119x109/L. A peripheral blood film showed 10% blasts, macrocytosis, and nuclear hypersegmentation of neutrophils, basophils, and eosinophils with hypersegmented-like monocytes (Figure 1). The complete hemogram was as follows: red blood cell count, 3.02x1012/L; hematocrit, 34.8%; red blood cell distribution width, 14.9%; mean corpuscular hemoglobin, 37.4 pg; and mean corpuscular hemoglobin concentration, 32.5 g/dL.

megaloblastic anemia and hypersegmentation of neutrophils. However, impaired segmentation of other granulocytes’ nuclei and “polymorphonuclear” monocytes remain unusual findings. While the first report of hypersegmentation of basophils and eosinophils after treatment with HU was presented by Xu [1], our finding of “hypersegmented” monocytes is the first such report worldwide.

Ineffective treatment with hydroxyurea (sustained hyperleukocytosis and splenomegaly) was replaced by cytarabine, 6-mercaptopurine, and interferon alpha, obtaining improvement of leukocytosis (WBC count: 21.63x109/L).

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

Hydroxycarbamide (hydroxyurea, HU) decreases the production of deoxyribonucleotides via inhibition of ribonucleoside reductase. Cytoreductive treatment with HU often results in

Reference

Keywords: Granulocytes, Hypersegmentation, Hydroxycarbamide, Monocytes, Primary myelofibrosis Anahtar Sözcükler: Granülositler, Hiperpigmentasyon, Hidroksikarbamid, Monositler, Primer Myelofibrozis Informed Consent: Received.

1. Xu X. Nuclear hypersegmentation of neutrophils, eosinophils, and basophils due to hydroxycarbamide (hydroxyurea). Blood 2014;124:1392.

121

LETTERS TO THE EDITOR Turk J Hematol 2019;36:122-140

Remarks on Myeloid Sarcoma in Children Çocuklarda Myeloid Sarkom Üzerine Yorumlar Sevgi Gözdaşoğlu Retired Professor of Pediatrics, Hematology and Oncology

To the Editor, Arslantaş et al. [1] reported “A Rare Cause of Paraplegia: Myeloid Sarcoma” in a recent issue of this journal. I would like to remark on a few points not mentioned in that paper. Extramedullary infiltrations (EIs) of the soft tissue, also known as myelosarcoma (MS) or granulocytic sarcoma (GS), occur in approximately 4% to 5% of children with acute myeloid leukemia (AML) in western countries [2]. MS may develop before, during, or after the occurrence of AML. AML is a clinically and genetically heterogeneous disease. Immunohistochemistry and immunophenotyping are important for the accurate diagnosis of AML. White blood cell (WBC) count at diagnosis, FAB subtypes, and cytogenetics are the main important prognostic factors. For that reason, these analyses should be performed for all patients [3,4,5]. Cytogenetic analysis has become an important parameter for the diagnosis, prognosis, and treatment selection of AML. t(8;21) is the most common abnormality and it is primarily found in the M2 subtype. The inv(16) and t(16;16) associated with M4Eo and t(15;17) and t(11;17) associated with the M3 subtype are favorable, whereas 11q23 associated with M4 and M5 variants is found unfavorable for prognosis [2]. Xu et al. [5] reported that monosomal karyotypes are independent risk factors for poor prognosis. The prognostic significance of MS in childhood AML is still controversial. Some groups reported an unfavorable prognosis but others demonstrated a favorable outcome [3,4,6]. Central nervous system leukemia and MS together with high initial WBC count at diagnosis are high risk factors for relapse [6]. Orbital granulocytic sarcoma (OGS) was first reported in 1971 by Çavdar et al. [7] from Turkey. Some researchers in Turkey also reported that there was a connection between AML and EI in several retrospective analyses of patients as well as in some case reports [8,9,10]. Çavdar et al. [7] analyzed 33 patients presenting with OGS characterized by exophthalmos, proptosis, chemosis, and orbital masses (Figure 1). OGS was noted in 33 (27%) of 121 patients. These patients were compared with 41 cases of AML without OGS seen during the same period. The 122

Figure 1. Appearance of exophthalmos, proptosis, chemosis, and orbital mass. majority of the patients with OGS were of low socioeconomic status. The mean age was 6.7 years and 24 of the patients were male while 9 were female. OGS occurs in patients with M4 or M5 subtypes. Hematological findings in the two groups were not significantly different. Cytogenetic study revealed that the t(8;21) abnormality was frequent. The expression of tissue adhesion molecules CD56 and CD44 and the expression of MDR (p-gp) were more common in OGS cases. These findings might explain the different prognosis in patients with OGS [4,11]. The mean survival time of 8.7 months in the OGS group was significantly shorter than that of patients without OGS (28.6 months) (p<0.01) treated before 1990 [4]. Çavdar et al. [11] suggested that this type of presentation could indicate a special high-risk biological entity. Further molecular and therapeutic studies are required for a better understanding of the reasons for tissue involvement and to choose the most effective treatment options. Keywords: Myeloid sarcoma, Cytogenetic, Prognosis Anahtar Sözcükler: Myeloid sarkom, Sitogenetik, Prognoz Informed Consent: Informed consent was received from the parents.

LETTERS TO THE EDITOR

Turk J Hematol 2019;36:122-140

Conflict of Interest: The author of this paper has no conflict of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Arslantaş E, Bayram C, Odaman Al I, Uysalol E, İribaş A, Akı H, Adaletli İ, Ayçicek A, Özdemir N. A rare cause of paraplegia: myeloid sarcoma. Turk J Hematol 2018;35:206-207. 2. Bennett C, Hsu K, Look AT. Myeloid leukemia, myelodysplasia and myeloproliferative disease in children. In: Nathan DG, Orkin SH, Ginsburg D, Look AT (eds). Nathan and Oski’s Hematology of Infancy and childhood. Philadelphia, WB Saunders Company, 2003. 3. Bisschop MM, Révész T, Bierings M, van Weerden JF, van Wering ER, Hählen K, van der Does-van den Berg A. Extramedullary infiltrates at diagnosis have no prognostic significance in children with acute myeloid leukemia. Leukemia 2001;15:46-49. 4. Gözdaşoğlu S, Yavuz G, Ünal E, Taçyıldız N, Çavdar AO. Orbital granulocytic sarcoma and AML with poor prognosis in Turkish children. Leukemia 2002;16:962. 5. Xu J, Huang B, Liu X, Zhang Y, Liu Y, Chen L, Luan Y, Li N, Chu X. Poor prognosis in acute myeloid leukemia patients with monosomal karyotypes. Turk J Hematol 2017;34:126-130.

6. Kobayashi R, Tawa A, Hanada R, Horibe K, Tsuchida M, Tsukimoto I; Japanese childhood AML cooperative study group. Extramedullary infiltration at diagnosis and prognosis in children with acute myelogenous leukemia. Pediatr Blood Cancer 2007;48:383-398. 7. Çavdar AO, Gözdaşoğlu S, Arcasoy A, Demirağ B. Chloroma like ocular manifestations in Turkish children with acute myelomonocytic leukemia. Lancet 1971;1:680-682. 8. Baytan B, Evim MS, Güneş AM, Kocaeli H, Balaban Ş, Korfalı E, Tüzüner N. Cerebellar granulocytic sarcoma: a case report. Turk J Hematol 2012;29:177180. 9. Kaygusuz Ç, Kankaya D, Ekin C, Topçuoğlu P, Kuzu I. Myeloid sarcomas: a clinico-pathologic study of 20 cases. Turk J Hematol 2015:32:35-42. 10. Hiçsönmez G, Çetin M, Tuncer AM, Yenicesu I, Aslan D, Özyürek E, Ünal S. Children with acute myeloblastic leukemia presenting with extramedullary infiltration: the effects of high-dose steroid treatment. Leuk Res 2004;28:25-34. 11. Çavdar AO, Babacan E, Gözdaşoğlu S, Kılıçturgay K, Arcasoy A, Cin S, Ertem U, Erten J. High risk subgroup of acute myelomonocytic leukemia (AMML) with orbito-ocular granulocytic sarcoma (OOGS) in Turkish children. Retrospective analysis of clinical, hematological, ultrastructural and therapeutical findings of thirty-three OOGS. Acta Haematol 1989;81:8085.

Address for Correspondence/Yazışma Adresi: Sevgi GÖZDAŞOĞLU, M.D., Retired Professor of Pediatrics, Hematology and Oncology Phone : +90 532 793 71 06 E-mail : sgozdasoglu@hotmail.com ORCID-ID: orcid.org/0000-0001-7198-6880

Received/Geliş tarihi: January 02, 2019 Accepted/Kabul tarihi: January 16, 2019 DOI: 10.4274/tjh.galenos.2019.2019.0002

Reply from the Authors To the Editor, We read the letter regarding our publication, “A Rare Cause of Paraplegia: Myeloid Sarcoma”. Because of its different localization and symptoms, myeloid sarcoma is difficult to diagnose, in particular in patients without initial bone marrow involvement. Thus, the correct diagnosis of MS is often delayed and the misdiagnosis rate is high. Our patient was referred to us with a complaint of hemiparesis and a subsequent thoracolumbar mass detected by magnetic resonance imaging, and no blasts were detected on peripheral blood film but bone marrow aspiration showed blasts compatible with AML. In this regard, the aim of our publication was to highlight to diagnostic challenges and rare presentations of MS in childhood. We believe, like the author of the preceding letter, that immunohistochemistry, immunophenotyping, and cytogenetic and molecular examinations play an important role in the diagnosis and prognosis, and before creating a treatment plan these should be performed for all patients. Radiology, histology, immunophenotyping, and molecular analyses are all essential for risk stratification and treatment planning. The next step is giving AML-based systemic chemotherapy and, in some cases, as in our case, surgery and/or radiotherapy may be indicated. We could not mention the clinical, cytogenetic, and molecular features of MS extensively, as our publication was in the format of a Letter to the Editor. We would like to thank the author for her valuable contribution.

Best Regards, Esra Arslantaş, Cengiz Bayram, Işık Odaman Al, Ezgi Uysalol, Ayça İribaş, Hilal Akı, İbrahim Adaletli, Ali Ayçiçek, Nihal Özdemir

123

LETTERS TO THE EDITOR

Turk J Hematol 2019;36:122-140

The Coexistence of Chronic Lymphocytic Leukemia and Multiple Myeloma Kronik Lenfositik Lösemi ve Multipl Myelom Birlikteliği Ceren Hangül1,

Orhan Kemal Yücel2,

Bahar Akkaya3,

Levent Ündar2,

Sibel Berker Karaüzüm1

1Akdeniz University Faculty of Medicine, Department of Medical Biology and Genetics, Antalya, Turkey 2Akdeniz University Faculty of Medicine, Department of Hematology, Antalya, Turkey 3Akdeniz University Faculty of Medicine, Department of Pathology, Antalya, Turkey

To the Editor, Multiple myeloma (MM) and chronic lymphocytic leukemia (CLL) are neoplastic diseases originating from different stages of B-cell maturation. The coexistence of MM and CLL in the same patient is quite rare [1]. Here we report a patient with CLL who later developed kappa light chain MM. A 67-year-old male was diagnosed with CLL with CD5+, CD19+, CD23+ B lymphocytes detected by flow cytometry. Karyotype analysis revealed 45,X,Y[4]/46,XY[10] and 55% deletion of 11q22.3 was found as the sole anomaly by fluorescence in situ hybridization (FISH). He was treated with chlorambucil and dexamethasone. Five years later, he was admitted with fatigue, back pain, hypercalcemia, and acute renal failure. There was no palpable lymphadenopathy or hepatosplenomegaly. Serum and urine immunofixation electrophoresis revealed kappa light chain monoclonal protein, while bone marrow (BM) aspiration revealed at least 30% atypical plasma cells. Similarly, BM immunophenotyping revealed 30% clonal plasma cells (CD38+,

CD138+) and approximately 1% residual CLL cells. The complex karyotype was found as 46,XY,der(6)t(1;6)(q11;q23),t(11;14) (q13;q32),dup(17)(q23q25)[17]/46,XY[2] (Figure 1). FISH analysis revealed t(11;14) and deletion 6q23, but not the prior 11q22.3 deletion. He was diagnosed with MM. Intravenous hydration, plasmapheresis, furosemide, pamidronate, and dexamethasone were started. Following discharge from the hospital, he was lost to follow-up. The coexistence of CLL and MM is quite rare and there is controversy as to whether the two diseases arise from the same clone or distinct clones. Fermand et al. [2] showed that these malignancies came from the same clone by the identification of Ig idiotypes. After CLL cells were exposed to mitogens and allogenic T cells, a class switch from IgG to IgA was observed, showing that CLL cells can be precursors of plasma cells. Brouet et al. [3], Novak et al. [4], and Kaufmann et al. [5] showed Ig molecules synthesizing different light chains, revealing the coexistence of two distinct clones. However, Ig subtyping cannot always eliminate clonality. In some cases CLL and MM are diagnosed together, whereas in others MM is diagnosed

Figure 1. Karyotyping analysis showing 46,XY,der(6)t(1;6)(q11;q23),t(11;14)(q13;q32),dup(17)(q23q25)[17]/46,XY[2] (94x64 mm; 72x72 DPI). 124

LETTERS TO THE EDITOR

Turk J Hematol 2019;36:122-140

1-15 years after CLL. Barlogie and Gale [6] indicated a difference in pathophysiology; in CLL, most tumor B cells are inert and arrested in the G0/G1 phase, whereas in MM there is an increase in proliferation with stromal cell cytokines like IL-6. In our case, there was ATM deletion at the time of the CLL diagnosis, but not at MM diagnosis, indicating multiclonality. Compatible with our case, there are reported cases of patients diagnosed with MM after CLL who had chromosome 11 anomalies at the time of the CLL diagnosis [7], raising the following question: Could some of the chromosome 11 anomalies be related to transformation from CLL to MM, and used as a predictor? To clarify the role of these genetic, epigenetic [8,9], or microenvironmental factors for the coexistence of two diseases, more case reports are needed. Acknowledgments This study was supported by the Akdeniz University Scientific Research Management Foundation. Keywords: Chronic lymphocytic leukemia, Multiple myeloma, Hematological malignancy, Clonality

References 1. Kough RH, Makary AZ. Chronic lymphocytic leukemia (CLL) terminating in multiple myeloma: report of two cases. Blood 1978;52:532-536. 2. Fermand JP, James JM, Herait P. Associated chronic lymphocytic leukemia and multiple myeloma: origin from a single clone. Blood 1985;66:291-293. 3. Brouet JC, Fermand JP, Laurent G, Grange MJ, Chevalier A, Jacquillat C, Seligmann M. The association of chronic lymphocytic leukemia and multiple myeloma: a study of eleven patients. Br J Haematol 1985;59:55-66. 4. Novak PM, Mattson JC, Crisan D, Chen J, Poulik MD, Decker D. Separate clones in concomitant multiple myeloma and second B-cell neoplasm demonstrated by molecular and immunophenotypic analysis. Eur J Haematol 1995;54:254-261. 5. Kaufmann H, Ackermann J, Nösslinger T, Krömer E, Zojer N, Schreiber S, Urbauer E, Heinz R, Ludwig H, Huber H, Drach J. Absence of clonal chromosomal relationship between concomitant B-CLL and multiple myeloma - a report on two cases. Ann Hematol 2001;80:474-478. 6. Barlogie B, Gale RP. Multiple myeloma and chronic lymphocytic leukemia: parallels and contrasts. Am J Med 1992;93:443-450. 7. Pantic M, Schroettner P, Pfeifer D, Rawluk J, Denz U, Schmitt-Gräff A, Veelken H, Wäsch R, Engelhardt M. Biclonal origin prevails in concomitant chronic lymphocytic leukemia and multiple myeloma. Leukemia 2010;24:885-890.

Anahtar Sözcükler: Kronik lenfositik lösemi, Multipl myelom, Hematolojik malignensi, Klonalite

8. Dimopoulos K, Gimsing P, Gronbaek K. The role of epigenetics in the biology of multiple myeloma. Blood Cancer J 2014;4:e207.

Informed Consent: It was received.

9. Martín-Subero JI, Lopez-Otin C, Campo E. Genetic and epigenetic basis of chronic lymphocytic leukemia. Curr Opin Hematol 2013;4:362-368.

Address for Correspondence/Yazışma Adresi: Ceren HANGÜL, M.D., Akdeniz University Faculty of Medicine, Department of Medical Biology and Genetics, Antalya, Turkey Phone : +90 242 244 96 97 E-mail : cerenhangul@hotmail.com - sibelberkerkarauzum@gmail.com ORCID-ID: orcid.org/0000-0001-6869-8802

Received/Geliş tarihi: March 12, 2018 Accepted/Kabul tarihi: June 20, 2018 DOI: 10.4274/tjh.galenos.2018.2018.0096

125

LETTERS TO THE EDITOR

Turk J Hematol 2019;36:122-140

Investigation of MDM2 Oncogene Copy Number Alterations in Cases of Chronic Lymphocytic Leukemia Kronik Lenfositik Lösemi Olgularında MDM2 Onkogen Kopya Sayısı Değişiminin Araştırılması Şule Darbaş1,

Çiğdem Aydın2,

Ozan Salim3,

Sibel Berker Karaüzüm1

1Akdeniz University Faculty of Medicine, Department of Medical Biology and Genetics, Antalya, Turkey 2Mehmet Akif Ersoy University Bucak School of Health, Department of Nursing, Burdur, Turkey 3Akdeniz University Faculty of Medicine, Department of Hematology, Antalya, Turkey

To the Editor, Chronic lymphocytic leukemia (CLL) is a disease characterized by deposition of malignant monoclonal lymphocytes. Chromosomal abnormalities have been determined in 30%-50% of patients with CLL [1]. The most common chromosomal abnormalities are 13q14 deletion (51%), 11q22.3 deletion (17%-20%), trisomy 12 (15%), 17p13 deletion (7%), 6q23 deletion (7%), and t(14;19) translocation (1%-2%) [2,3].

CLL cases might be more dependent on the extent of 17p13.1 deletion than the stage of the disease [9]. In the present study, only 4 patients had 17p13.1 deletion in >20 cells. Two of them died because of progressive disease and the other two were lost to follow-up. If evaluated from this perspective, the high level of 17p13.1 deletion was observed in 10% of our cases. It has been observed that patients with 17p13.1 and 11q2.3 deletion have a poor prognosis, and patients with isolated 13q14 deletion were found to have slower progression and longer survival time

In CLL patients, overexpression of the MDM2 gene was shown in earlier studies at protein and RNA levels [4,5,6], and it was aimed to be shown at the DNA level for the first time in this study. MDM2 gene amplification was investigated by the fluorescence in situ hybridization (FISH) method in 40 patients with CLL and 20 patients with Ph+ chronic myeloid leukemia as a control group. Informed consent was received. The modified Rai staging system was used for staging our patients. Conventional cytogenetic analysis and FISH analysis using CLL-specific FISH probes for 17p13.1 (TP53), 13q14 (RB), 6q22-q23 (MYB), 11q22.3 (ATM), and chromosome 12 centromere were applied for all patients. The cytogenetic analysis revealed abnormal karyotypes in 3 of 40 patients. 47,XX,inv(9)(p11q13),del(13)(q14),+21[2],46,XY,del (7) (q31),dup(12)(q21q21)[8], and 46,XY,del(20)(q12)[6] karyotypes were observed in these patients. MDM2 gene amplification could not be detected in either the patient or the control group. FISH analysis results were as follows in CLL cases: deletion of 17p13.1 in 16 cases (40%), 13q14 deletion in 13 cases (32.5%), trisomy 12 in 12 cases (30%), 11q22.3 deletion in 6 cases (15%), and 6q23 deletion in 1 case (2.5%). Frequencies of molecular cytogenetic findings are presented in Figure 1A. Compared to the literature, where the frequency of deletion of 17p13.1 in early-stage CLL was reported between 7% and 10% [7,8], the higher rate observed in 75% of our CLL patients might be due to differences in the methods and probes used, variability of laboratory cut-off values, or the limited number of cases in this study. The clinical implication of having 17p13.1 deletions in 126

Figure 1. A) Chromosomal abnormalities detected by routine fluorescence in situ hybridization (FISH) analysis of 40 chronic lymphocytic leukemia cases. B) Signal patterns in interphase nuclei of normal FISH results for the MDM2 gene.

LETTERS TO THE EDITOR

Turk J Hematol 2019;36:122-140

[2]. We observed that early-stage patients with isolated 13q14 deletion showed slower progression and these patients did not have treatment indications. MDM2 has pivotal roles in the regulation and stabilization of p53 [10]. In our study, amplification of the MDM2 gene was not determined in CLL patients, but 30 (75%) of 40 cases were clinically diagnosed as an early stage by the FISH method (Figure 1B). We thought that the absence of MDM2 gene amplification in our patients might be related to the early stage of the disease. On the other hand, the reason for being unable to observe amplification of the MDM2 gene in 10 (25%) of 40 patients at advanced stages might be the presence of other abnormalities such as trisomy 12 or deletions of 17p13.1, 11q22.3, and 6q23. We also suggest that reevaluation of MDM2 gene amplification in patients having a relapse in the future is important for demonstrating the MDM2-CLL relationship. In previous studies, MDM2 overexpression was examined at mRNA and protein levels [4,5,6], but amplification of the MDM2 gene at DNA level in CLL patients has been examined for the first time in our study. Keywords: MDM2, Chronic lymphocytic leukemia, Fluorescence in situ hybridization, P53 Anahtar Sözcükler: MDM2, Kronik lenfositik lösemi, Floresan in situ hibridizasyon, P53 Informed Consent: It was received. Conflict of Interest: The authors of this paper have no conflicts of interest including specific financial interests, relationships,

and/or affiliations relevant to the subject matter or materials included.

References 1. Glassman AB, Hayes KJ. The value of fluorescence in situ hybridization in the diagnosis and prognosis of chronic lymphocytic leukemia. Cancer Genet Cytogenet 2005;158:88-91. 2. Döhner H, Stilgenbauer S, Benner A, Leupolt E, Kröber A, Bullinger L, Döhner K, Bentz M, Lichter P. Genomic aberrations and survival in chronic lymphocytic leukemia. N Engl J Med 2000;343:1910-1916. 3. Mayr C, Speicher MR, Kofler DM, Buhmann R, Strehl J, Busch R, Hallek M, Wendtner CM. Chromosomal translocations are associated with poor prognosis in chronic lymphocytic leukemia. Blood 2006;107:742-751. 4. Bueso-Ramos CE, Yang Y, deLeon E, McCown P, Stass SA, Albitar M. The human MDM-2 oncogene is overexpressed in leukemias. Blood 1993;82:2617-2623. 5. Haidar MA, El-Hajj H, Bueso-Ramos CE, Manshouri T, Glassman A, Keating MJ, Maher A. Expression profile of MDM-2 proteins in chronic lymphocytic leukemia and their clinical relevance. Am J Hematol 1997;54:189-195. 6. Winkler D, Schneider C, Kröber A, Pasqualucci L, Lichter P, Döhner H, Stilgenbauer S. Protein expression analysis of chromosome 12 candidate genes in chronic lymphocytic leukemia (CLL). Leukemia 2005;19:1211-1215. 7. Yu L, Kim HT, Kasar S, Benien P, Du W, Hoang K, Aw A, Tesar B, Improgo R, Fernandes S, Radhakrishnan S, Klitgaard J, Lee C, Getz G, Setlur SR, Brown JR. Survival of del17p CLL depends on genomic complexity and somatic mutation. Clin Cancer Res 2017;23:735-745. 8. Hallek M. Chronic lymphocytic leukemia: 2017 update on diagnosis, risk stratification, and treatment. Am J Hematol 2017;92:946-965. 9. Tam CS, Shanafelt TD, Wierda WG, Abruzzo LV, Van Dyke DL, O’Brien S, Ferrajoli A, Lerner SA, Lynn A, Kay NE, Keating MJ. De novo deletion 17p13.1 chronic lymphocytic leukemia shows significant clinical heterogeneity: the M. D. Anderson and Mayo Clinic experience. Blood 2009;114:957-964. 10. Pei D, Zhang Y, Zheng J. Regulation of p53: a collaboration between Mdm2 and Mdmx. Oncotarget 2012;3:228-235.

Address for Correspondence/Yazışma Adresi: Sibel BERKER KARAÜZÜM, M.D., Akdeniz University Faculty of Medicine, Department of Hematology, Antalya, Turkey Phone : +90 242 249 69 70 E-mail : sibelberker@akdeniz.edu.tr ORCID-ID: orcid.org/0000-0002-6338-7623

Received/Geliş tarihi: August 02, 2018 Accepted/Kabul tarihi: October 15, 2018 DOI: 10.4274/tjh.galenos.2018.2018.0270

127

LETTERS TO THE EDITOR

Turk J Hematol 2019;36:122-140

Clonal Evolution of Acute Myeloid Leukemia with CEBPA Double Mutations after Long-Term Remission: Case Report and a Literature Review Uzun Süreli Remisyon sonrası CEBPA Çift Mutasyonu ile Akut Myeloid Löseminin Klonal Evolüsyonu: Olgu Sunumu ve Bir Literatür Derlemesi Ying Li1,

Long Su2

1Changchun Central Hospital, Clinic of Hematology, Changchun, China 2Jilin University the First Hospital, Clinic of Hematology, Changchun, China

To the Editor, Mutations in the CEBPA gene occur in 7%-15% of all acute myeloid leukemia (AML) patients [1,2]. However, we found that the frequency of such mutation may be high in Chinese AML patients [3,4]. Although AML with CEBPA double mutations (CEBPAdm) indicates a favorable outcome, recent data show that more than 50% of patients finally relapsed when consolidated with chemotherapy alone [5]. Clonal evolution (CE) is an important factor for relapse [6]. However, studies discussing CE in AML patients with CEBPAdm are limited [7,8]. Here, we report CE in two patients with CEBPAdm determined by sensitive nextgeneration sequencing (NGS). Two female AML patients were diagnosed in our hospital in January 2012 and September 2013. Standard ‘3+7’ induction chemotherapy was administered. Both of them achieved CR after

induction therapy. Patient 1 received consolidation therapy with one course of DA (daunorubicin + cytarabine), four courses of high-dose cytarabine (HD-Ara-C), and one course of DA. Patient 2 received consolidation therapy with three courses of HD-Ara-C and two courses of immunotherapy. After long-term remissions (63 and 40 months), they both relapsed. Cytogenetic and fusion gene analyses indicated no difference from diagnosis. NGS analysis indicated altered mutations sites of the CEBPA gene in Patient 2 (Figure 1). New co-occurring mutations emerged at relapse: SETD2 mutation in Patient 1 and WT1 mutation in Patient 2 (Table 1). After relapse, Patient 1 achieved CR with a DA regimen and Patient 2 refused treatment. The first report for CE in patients with CEBPAdm included two patients [7]. In the first patient, the amino-terminal frameshift mutation was duplicated and found on both alleles at relapse. In the second patient, the amino-terminal frame-shift

Figure 1. CEBPA gene mutations of these two patients at diagnosis and relapse. 128

LETTERS TO THE EDITOR

Turk J Hematol 2019;36:122-140

Table 1. CEBPA and co-occurring mutations at diagnosis and relapse. Diagnosis

Relapse

Patient 1

Patient 2

Patient 1

Patient 2

68_69insCC

CEBPA mutations Nucleotide change

Amino acid change

Co-occurring mutations Nucleotide change Amino acid change

86_89delinsTGCCGCGTAGGC

68_69insCC

85_90delinsGTGCCACGTAGGCC

940_941insCCA AGCAGCGCAA CGTGGAGACG CAGCAGAAGG

935_936insTTT

940_941insCCA AGCAGCGCAA CGTGGAGACG CAGCAGAAGG

935_936insTTT

Pro23fs

Ala29fs

P23fs

Ala29fs

Lys313_Val314insAla LysGlnArgAsnValGlu ThrGlnGlnLys

Gln312delinsHisLeu

Lys313_Val314insAla LysGlnArgAsnValGlu ThrGlnGlnLys

Gln312delinsHisLeu

GATA2

SETD2

GATA2

WT1

949A>C

4715C>A

949A>C

1142dupC

953C>T

Asn317His

Ser1572X

Asn317His

Ala318Val

mutation and a mutation in the fork region were found either alone or combined on the same allele, suggesting a subclone formation [7]. Another study reported CE in 22 patients; two of them lost mutations and none acquired new mutation at relapse [8]. Twenty patients harboring CEBPA mutations relapsed with identical mutation patterns; three of them had a second relapse that also exhibited the same patterns as their initial diagnosis and first relapse [8]. Two patients had concomitant FLT3-ITD mutations at diagnosis and one was lost at relapse. Two patients acquired FLT3-TKD mutations at relapse. N-RAS mutations were detected in three patients at diagnosis and two of them retained the identical mutation at relapse [8]. In this case report, we found mutation site alteration in the CEBPA gene and two newly emerged co-occurring mutations. CE of patients with CEBPAdm can be summarized as follows: 1) allele alteration of CEBPA gene: acquire or lose mutation site in allele; 2) mutation site alteration in CEBPA gene: acquire or lose mutation site in CEBPA gene other than allele; 3) co-occurring mutation alteration: acquire or lose co-occurring mutation. One issue that needs to be resolved is the relationship between time and CE after CR. In this case report, these two patients relapsed after long-term remissions, and new co-occurring mutations emerged in both of them. Hence, whether late relapse is associated with new co-occurring mutations is unknown. Acknowledgments We thank the Department of Hematology of the First Hospital, Bethune Medical College of Jilin University, for assistance in this work. Informed consent was obtained from the patients or their relatives for this case report.

Ser381fs

Keywords: Acute myeloid leukemia, CEBPA mutations, Nextgeneration sequencing, Clonal evolution, Relapse Anahtar Sözcükler: Akut myeloid lösemi, CEBPA mutasyonu, Yeni nesil dizileme, Klonal evolüsyon, Relaps Informed Consent: Received. Conflict of Interest: The authors of this paper have no conflicts of interest including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Dufour A, Schneider F, Metzeler KH, Hoster E, Schneider S, Zellmeier E, Benthaus T, Sauerland MC, Berdel WE, Büchner T, Wörmann B, Braess J, Hiddemann W, Bohlander SK, Spiekermann K. Acute myeloid leukemia with biallelic CEBPA gene mutations and normal karyotype represents a distinct genetic entity associated with a favorable clinical outcome. J Clin Oncol 2010;28:570-577. 2. Fasan A, Haferlach C, Alpermann T, Jeromin S, Grossmann V, Eder C, Weissmann S, Dicker F, Kohlmann A, Schindela S, Kern W, Haferlach T, Schnittger S. The role of different genetic subtypes of CEBPA mutated AML. Leukemia 2014;28:794-803. 3. Su L, Gao S, Liu X, Tan Y, Wang L, Li W. CEBPA mutations in patients with de novo acute myeloid leukemia: data analysis in a Chinese population. Onco Targets Ther 2016;9:3399-3403. 4. Su L, Tan Y, Lin H, Liu X, Yu L, Yang Y, Liu S, Bai O, Yang Y, Jin F, Sun J, Liu C, Liu Q, Gao S, Li W. Mutational spectrum of acute myeloid leukemia patients with double CEBPA mutations based on next-generation sequencing and its prognostic significance. Oncotarget 2018;9:2497024979. 5. Schlenk RF, Taskesen E, van Norden Y, Krauter J, Ganser A, Bullinger L, Gaidzik VI, Paschka P, Corbacioglu A, Göhring G, Kündgen A, Held G, Götze K, Vellenga E, Kuball J, Schanz U, Passweg J, Pabst T, Maertens J, Ossenkoppele GJ, Delwel R, Döhner H, Cornelissen JJ, Döhner K, Löwenberg B. The value

129

LETTERS TO THE EDITOR

Turk J Hematol 2019;36:122-140

of allogeneic and autologous hematopoietic stem cell transplantation in prognostically favorable acute myeloid leukemia with double mutant CEBPA. Blood 2013;122:1576-1582. 6. Graubert TA, Brunner AM, Fathi AT. New molecular abnormalities and clonal architecture in AML: from reciprocal translocations to whole-genome sequencing. Am Soc Clin Oncol Educ Book 2014:334-340.

7. Tiesmeier J, Czwalinna A, Müller-Tidow C, Krauter J, Serve H, Heil G, Ganser A, Verbeek W. Evidence for allelic evolution of C/EBPalpha mutations in acute myeloid leukaemia. Br J Haematol 2003;123:413-419. 8. Shih LY, Liang DC, Huang CF, Wu JH, Lin TL, Wang PN, Dunn P, Kuo MC, Tang TC. AML patients with CEBPA mutations mostly retain identical mutant patterns but frequently change in allelic distribution at relapse: a comparative analysis on paired diagnosis and relapse samples. Leukemia 2006;20:604-609.

Received/Geliş tarihi: June 21, 2018 Accepted/Kabul tarihi: September 11, 2018

Address for Correspondence/Yazışma Adresi: Long SU, M.D., Jilin University the First Hospital, Clinic of Hematology, Changchun, China Phone : +86 0431 88782157 E-mail : sulongjdyy@163.com ORCID-ID: orcid.org/0000-0002-5360-468X

DOI: 10.4274/tjh.galenos.2018.2018.0215

Progressive Hepatic Cirrhosis Early After Allogeneic Hematopoietic Stem Cell Transplantation in a Patient with Chronic Hepatitis C Infection Kronik Hepatit C Enfeksiyonu Olan Hastada Allojenik Kök Hücre Nakli Sonrası Erken Dönemde Progresif Karaciğer Sirozu Satoshi Kaito1,

Noriko Doki1,

Tsunekazu Hishima2,

Yasunobu Takaki3,

Kazuteru Ohashi1

1Tokyo Metropolitan Cancer and Infectious Diseases Center, Komagome Hospital, Hematology Division, Tokyo, Japan 2Tokyo Metropolitan Cancer and Infectious Diseases Center, Komagome Hospital, Pathology Division, Tokyo, Japan 3Tokyo Metropolitan Cancer and Infectious Diseases Center, Komagome Hospital, Radiology Division, Tokyo, Japan

To the Editor, Hepatitis C virus (HCV)-infected allogeneic hematopoietic stem cell transplantation (allo-HSCT) recipients have a higher incidence of liver cirrhosis over long-term follow-up compared to recipients without HCV infection [1,2]. However, liver dysfunction related to HCV is usually mild in the first 3 months after allo-HSCT [3]. We present the progressive hepatic cirrhosis soon after allo-HSCT in an HCV-infected recipient. The clinical and histopathological features were very similar to fibrosing cholestatic hepatitis (FCH) caused by HCV reactivation. A 50-year-old woman with myelodysplastic syndrome with excess blasts-1 was admitted to undergo allo-HSCT. The patient had a history of hepatitis C positivity (genotype 2a) for more than 20 years. Liver enzyme levels at admission were slightly elevated (aspartate aminotransferase 57 U/L, alanine aminotransferase 61 U/L, alkaline phosphatase 434 U/L, cholinesterase 115 U/L, total bilirubin (T-Bil) 1.2 mg/dL, and hepatitis C viral load 2.5x104 IU/mL). The serological tests for hepatitis B virus (HBV) and polymerase chain reaction for HBV-DNA were negative. Computed tomography (CT) demonstrated hepatosplenomegaly. Abdominal ultrasonography (US) showed coarse hepatic echostructure over the entire liver with a dull edge, smooth 130

surface, and straight hepatic vein without ascites or any signs of portal hypertension. Liver biopsy was not performed because of thrombocytopenia. Just before transplantation, no risk factors except for the mild hepatic dysfunction and age were found, the hematopoietic cell transplantation-comorbidity index (HCT-CI) was 1, and the age-adjusted HCT-CI score was 2 [4,5]. Meanwhile, bone marrow examination revealed active disease with 6.7% myeloblasts. Considering the situation, the patient underwent peripheral blood stem cell transplantation from her human leukocyte antigen-identical sibling after myeloablative conditioning with cyclophosphamide (120 mg/kg) and total body irradiation (12 Gy). Considering drug-induced liver dysfunction, we avoided the use of busulfan. Cyclosporine and short-term methotrexate were used for graft-versus-host disease (GVHD) prophylaxis. After neutrophil engraftment, T-Bil was elevated up to 8.3 mg/dL and hepatitis C viral load was noted to have increased to 4.0x106 IU/mL on day 36 after allo-HSCT. Methylprednisolone was started at 1 mg/kg/day on day 36 for acute GVHD, with gradual improvement in liver test results. We performed deliberate observation of the patient with weekly US and monthly CT

Turk J Hematol 2019;36:122-140

LETTERS TO THE EDITOR

after allo-HSCT, which revealed progressive liver atrophy accompanied with ascites.

decreased, the patient developed liver failure and died on day 126 after allo-HSCT (Supplementary Figure 1).

On day 82 after allo-HSCT, the patient once again became jaundiced and hepatitis C viral load increased over 6.9x107 IU/mL. Transjugular liver biopsy showed bridging and pericellular fibrosis with architectural distortion, prominent ballooning, and spotty necrosis, consistent with early cirrhotic changes, and severe hepatocyte damage (Figures 1A-1D). There was mild portal inflammation without histologic evidence of the small bile duct changes of GVHD. Moreover, there was no sinusoidal obstruction. It was unlikely that the hepatopathy would be caused by cyclophosphamide, considering the timing of administration. From the pathological findings and the increased viral load, HCV reactivation was assumed to be the cause of liver dysfunction. Direct-acting antiviral (DAA) therapy with ledipasvir (90 mg/day) and sofosbuvir (400 mg/day) was started on day 110 after allo-HSCT. Although the viral load

A few case reports have been published on FCH caused by recurrence of HCV in recipients of liver transplantation [6], renal transplantation [7], and allo-HSCT [8]. The histopathological findings of FCH included periportal fibrosis, ballooning degeneration of hepatocytes, prominent cholestasis, and paucity of inflammation [8]. Although cholestasis was not prominent in our case, other pathological findings and the clinical course were very similar to those of FCH. We speculated that this discrepancy may have been due to the timing of liver biopsy, which was performed immediately after the re-elevation of T-Bil and presumably in the early phase of FCH. Generally, the initiation of DAA therapy is recommended at least 3 to 6 months after allo-HSCT in HCV-infected recipients because of the rarity of fulminant hepatitis caused by HCV reactivation in this period and the overlapping toxic effects

Figure 1. Photomicrographs of transjugular liver biopsy specimen on day 82 after transplantation, when the patient once again became jaundiced and hepatitis C viral load increased. A) There was extensive bridging and pericellular fibrosis with architectural distortion (silver staining, low power field). B) There was severe damage to hepatocytes. Lymphoid infiltration of the portal region was scarce (hematoxylin and eosin staining, low power field). C) Ballooning degeneration of hepatocytes was evident (hematoxylin and eosin staining, high power field). D) The hepatocytes varied in size with oxyphilic and vacuolated cytoplasm. Scattered focal necrosis was evident (black arrow) (hematoxylin and eosin staining, high power field). 131

LETTERS TO THE EDITOR

Turk J Hematol 2019;36:122-140

Supplementary Figure 1. Clinical course of the patient showing serial changes in her liver function. DAA: Direct-acting antiviral therapy, CyA: cyclosporine; mPSL: methylprednisolone, CY: cyclophosphamide, TBI: total body irradiation, rPBSCT: peripheral blood stem cell transplantation from related donor, ALP: alkaline phosphatase, ALT: alanine aminotransferase, T-Bil: total bilirubin, HCV: hepatitis C virus. *DAA included ledipasvir (90 mg/day) and sofosbuvir (400 mg/day). †1000 mg of methylprednisolone was administered for 3 days.

or potential drug-drug interactions of DAA with other agents [9]. In this case, we started DAA therapy based on the liver pathology and the increased HCV viral load. However, earlier intervention with DAA soon after the initiation of corticosteroid therapy should be considered, because it is a major risk factor for viral replication.

Informed Consent: Obtained from the family of the patient.

There were some limitations of our clinical practice. First, pretransplant liver status was not fully evaluated. Elastography should be considered for accurate evaluation of the degree of fibrosis [10]. Second, reduced intensity conditioning should be considered to avoid HCV-associated hepatopathy, although in our case the HCT-CI and age-adjusted HCT-CI scores were relatively low. Last, as stated above, earlier diagnosis and intervention with DAA might contribute to good outcomes.

References

In conclusion, the possibility of HCV recurrence should be also considered as a cause of progressive hepatopathy early after allo-HSCT. Keywords: Hepatitis C virus, Allogeneic hematopoietic stem cell transplantation, Liver cirrhosis, Early posttransplant period, Fibrosing cholestatic hepatitis Anahtar Sözcükler: Hepatit C virüs, Allojenik kök hücre transplantasyonu, Karaciğer sirozu, Erken posttransplant dönemi, Fibrozan kolestatik hepatit 132

1. Peffault de Latour R, Lévy V, Asselah T, Marcellin P, Scieux C, Adès L, Traineau R, Devergie A, Ribaud P, Espérou H, Gluckman E, Valla D, Socié G. Long-term outcome of hepatitis C infection after bone marrow transplantation. Blood 2004;103:1618-1624. 2. Ljungman P, Locasciulli A, de Soria VG, Békássy AN, Brinch L, Espigado I, Ferrant A, Franklin IM, O’Riordan J, Rovira M, Shaw P, Einsele H; Infectious Diseases Working Party of the European Group for Blood and Marrow Transplantation. Long-term follow-up of HCV-infected hematopoietic SCT patients and effects of antiviral therapy. Bone Marrow Transplant 2012;47:1217-1221. 3. Peffault de Latour R, Ribaud P, Robin M, Valla D, Marcellin P, Socié G, Asselah T. Allogeneic hematopoietic cell transplant in HCV-infected patients. J Hepatol 2008;48:1008-1017. 4. Sorror ML, Maris MB, Storb R, Baron F, Sandmaier BM, Maloney DG, Storer B. Hematopoietic cell transplantation (HCT)-specific comorbidity index: a new tool for risk assessment before allogeneic HCT. Blood 2005;106:29122919. 5. Sorror ML, Storb RF, Sandmaier BM, Maziarz RT, Pulsipher MA, Maris MB, Bhatia S, Ostronoff F, Deeg HJ, Syrjala KL, Estey E, Maloney DG, Appelbaum FR, Martin PJ, Storer BE. Comorbidity-age index: a clinical measure of biologic age before allogeneic hematopoietic cell transplantation. J Clin Oncol 2014;32:3249-3256.

LETTERS TO THE EDITOR

Turk J Hematol 2019;36:122-140

6. Satapathy SK, Sclair S, Fiel MI, Del Rio Martin J, Schiano T. Clinical characterization of patients developing histologically-proven fibrosing cholestatic hepatitis C post-liver transplantation. Hepatol Res 2011;41:328-339. 7. Delladetsima JK, Boletis JN, Makris F, Psichogiou M, Kostakis A, Hatzakis A. Fibrosing cholestatic hepatitis in renal transplant recipients with hepatitis C virus infection. Liver Transpl Surg 1999;5:294-300. 8. Evans AT, Loeb KR, Shulman HM, Hassan S, Qiu WC, Hockenbery DM, Ioannou GN, Chauncey TR, Gretch DR, McDonald GB. Fibrosing cholestatic hepatitis C after hematopoietic cell transplantation: report of 3 fatal cases. Am J Surg Pathol 2015;39:212-220.

9. Kyvernitakis A, Mahale P, Popat UR, Jiang Y, Hosry J, Champlin RE, Torres HA. Hepatitis C virus infection in patients undergoing hematopoietic cell transplantation in the era of direct-acting antiviral agents. Biol Blood Marrow Transplant 2016;22:717-722. 10. Ziol M, Handra-Luca A, Kettaneh A, Christidis C, Mal F, Kazemi F, de Lédinghen V, Marcellin P, Dhumeaux D, Trinchet JC, Beaugrand M. Noninvasive assessment of liver fibrosis by measurement of stiffness in patients with chronic hepatitis C. Hepatology 2005;41:48-54.

Address for Correspondence/Yazışma Adresi: Noriko DOKI, Ph.D., Tokyo Metropolitan Cancer and Infectious Diseases Center, Komagome Hospital, Hematology Division, Tokyo, Japan Phone : 81 3 3823 2101 E-mail : n-doki@cick.jp ORCID-ID: orcid.org/0000-0002-8661-3179

Received/Geliş tarihi: June 27, 2018 Accepted/Kabul tarihi: February 04, 2019 DOI: 10.4274/tjh.galenos.2019.2018.0224

Venous Thromboembolism in a Young Girl with Duplication of the Inferior Vena Cava and Protein S Deficiency Vena Kava İnferior Dublikasyonu ve Protein S Eksikliği Olan Genç Kızda Venöz Tromboemboli Wei-Li Liao1,

Ming-Yang Shih1,

Jiaan-Der Wang2,3

1Department of Pediatrics, Taichung Veterans General Hospital, Taichung, Taiwan 2Center for Rare Disease and Hemophilia, Taichung Veterans General Hospital, Taichung, Taiwan 3Tunghai University, Faculty of Medicine, Department of Pediatrics, Taichung, Taiwan

To the Editor, A previously healthy 13-year-old girl presented with a 3-day history of progressive swelling and pain in her left lower limb. She also complained of cough in the last 2 weeks. No trauma, surgery, travel, or medication was noted before this illness. Physical examination revealed significant swelling and tenderness in her left lower limb. The laboratory data showed a high level of D-dimer (13.0 mg/L FEU, reference range <0.55 mg/L FEU). Multidetector computed tomography showed extensive emboli formation from the left calf region to the left ilio-femoral veins and duplication of the inferior vena cava (IVC) (Figure 1). Pulmonary ventilation-perfusion (V/Q) scintigraphy revealed several mismatched areas diagnostic for bilateral acute pulmonary embolism. Tracing the family history, her father had developed venous thromboembolism (VTE) at the age of 40 years and was diagnosed with protein S deficiency. A thrombophilia screening in this patient identified severe protein S deficiency (protein S activity: 2%, reference range: 55%-140%). Other results, including levels of homocysteine, antithrombin III, and protein C activity, were within normal limits; factor II G20210, factor V Leiden G1691A, anti-cardiolipin antibody, and anti-β2-

glycoprotein I IgM and IgG were all negative. Her symptoms and signs subsided after treatment with heparin, followed by warfarin for 3 months. The repeated measurement of protein S activity was 7% after discontinuation of treatment with warfarin for one week. Given that two provoking risk factors were present, the patient continued to receive prophylactic therapy with warfarin. Virchow’s triad describes the three main factors contributing to thrombosis, which include hypercoagulability, vessel injury, and venous stasis. Congenital anomalies of IVC may predispose to VTE due to resultant venous stasis. Duplication of IVC is usually considered as asymptomatic and an incidental finding while performing retroperitoneal surgery or venous interventional radiology. However, an increasing number of studies suggest that cases of unprovoked VTE were associated with duplication of the IVC [1,2,3,4]. The ages of these patients ranged from 18 to 84 years. No pediatric patient was reported. VTE is long considered to be far less common in children than in adults. Most pediatric VTE is provoked and occurs with multiple risk factors [5]. Genetic risk factors play an important role in children who develop VTE and thrombophilia screening 133

LETTERS TO THE EDITOR

Turk J Hematol 2019;36:122-140

Figure 1. Left panel: Contrast-enhanced computed tomography image demonstrating duplicated inferior vena cava (whitish arrow). Right panel, from top to bottom: Arrow indicates thrombosis found in engorged left iliac vein, femoral vein, and popliteal vein. 254x190 mm (72x72 DPI). is suggested in selected patients with VTE, such as young patients [6]. Protein S deficiency leads to loss of control of thrombin generation and fibrinolysis, and is associated with 5.8-fold increased odds of index VTE [7]. VTE in unusual sites has unique and obscure provoking factors [8]. Therefore, protein S deficiency was an important risk factor for the VTE event in this patient. In summary, we hypothesize that duplication of the IVC and protein S deficiency both promoted intravenous thrombus formation and predisposed the patient to develop VTE at a younger age. The combination of a rare congenital thrombophilic trait with a rare anatomic variant is very infrequent. In young patients with VTE less common causes of thrombosis such as inherited thrombophilias and anatomic abnormalities should be considered. Keywords: Vena thromboembolism

cava,

Protein

deficiency,

Venous

Anahtar Sözcükler: Vena kava, Protein S eksikliği, Venöz tromboemboli Informed Consent: Received. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, 134

and/or affiliations relevant to the subject matter or materials included.

References 1. Anne N, Pallapothu R, Holmes R, Johnson MD. Inferior vena cava duplication and deep venous thrombosis: case report and review of literature. Ann Vasc Surg 2005;19:740-743. 2. Milani C, Constantinou M, Berz D, Butera JN, Colvin GA. Left sided inferior vena cava duplication and venous thromboembolism: case report and review of literature. J Hematol Oncol 2008;1:24. 3. Saad K, Saad P, Amorim CA, Armstrong D, de Freitas Soares BL, Neves PCF, Filho AR. Duplication of the inferior vena cava: case report and a literature review of anatomical variation. J Morphol Sci 2012;29:6064. 4. Lambert M, Marboeuf P, Midulla M, Trillot N, Beregi JP, MounierVehier C, Hatron PY, Jude B. Inferior vena cava agenesis and deep vein thrombosis: 10 patients and review of the literature. Vasc Med 2010;15:451-459. 5. Van Ommen CH, Heijboer H, Büller HR, Hirasing RA, Heijmans HS, Peters M. Venous thromboembolism in childhood: a prospective two-year registry in the Netherlands. J Pediatr 2001;139:676-681. 6. Colucci G, Tsakiris DA. Thrombophilia screening: universal, selected, or neither? Clin Appl Thromb Hemost 2017;23:893-899. 7. Young G, Albisetti M, Bonduel M, Brandao L, Chan A, Friedrichs F, Goldenberg NA, Grabowski E, Heller C, Journeycake J, Kenet G, Krümpel A, Kurnik K, Lubetsky A, Male C, Manco-Johnson M, Mathew P, Monagle P, van Ommen H, Simioni P, Svirin P, Tormene D, Nowak-Göttl U. Impact

LETTERS TO THE EDITOR

Turk J Hematol 2019;36:122-140

of inherited thrombophilia on venous thromboembolism in children: a systematic review and meta-analysis of observational studies. Circulation 2008;118:1373-1382.

8. Shatzel JJ, O’Donnell M, Olson SR, Kearney MR, Daughety MM, Hum J, Nguyen KP, DeLoughery TG. Venous thrombosis in unusual sites: A practical review for the hematologist. Eur J Haematol 2019;102:53-62.

Address for Correspondence/Yazışma Adresi: Jiaan-Der WANG, M.D., Center for Rare Disease and Hemophilia, Taichung Veterans General Hospital, Taichung, Taiwan Phone : 886 4 23592525 / 5995 E-mail : wangjiaander@gmail.com ORCID-ID: orcid.org/0000-0002-7908-4969

Received/Geliş tarihi: September 27, 2018 Accepted/Kabul tarihi: January 16, 2019 DOI: 10.4274/tjh.galenos.2019.2018.0332

A Successful Coronary Artery Bypass Operation with Intermittent Factor VIII Administration in a Hemophilia A Patient Who Was Admitted Due to Acute Myocardial Infarction: A Rare and Difficult Case Akut Myokard İnfarktüsü ile Başvuran Bir Hemofili A Hastasında Aralıklı Faktör VIII Uygulamasıyla Başarı Sağlanabilen Koroner Arter Bypass Operasyonu: Nadir ve Zor Olgu Ulaş Serkan Topaloğlu1,

Rıfat Özmen2,

Recep Civan Yüksel3,

Murat Çetin4,

Gülşah Akyol5

1Kayseri City Training and Research Hospital, Clinic of Internal Medicine, Kayseri, Turkey 2Kayseri City Training and Research Hospital, Clinic of Cardiovascular Surgery, Kayseri, Turkey 3Erciyes University Faculty and Medicine, Department of Internal Medicine, Intensive Care Unit, Kayseri, Turkey 4Erciyes University Faculty and Medicine, Department of Cardiology, Kayseri, Turkey 5Kayseri City Training and Research Hospital, Clinic of Hematology, Kayseri, Turkey

To the Editor, There is not a large study in the literature other than a few case reports and reviews about the procedure of coronary artery bypass grafting surgery planned for patients with hemophilia. An internationally accepted definitive algorithm that recommends an approach to these patients was not included in the guidelines. A 51-year-old male patient admitted in emergency service due to sudden and severe chest pain. He had no other medical history except hemophilia A. His electrocardiographic findings showed ST elevation in derivations II, III, and aVF. Troponin T at 0.19 ng/mL (normal: 0-0.1) was accepted as positive. The patient was admitted to the coronary intensive care unit with an initial diagnosis of acute inferior myocardial infarct and coronary angiography was urgently performed. Angiography revealed a moderate left ventricular ejection fraction (49%) with three occluded coronary arteries. The left anterior descending artery was critically stenotic up to 80%. The right coronary artery was stenotic up to 50%. The circumflex coronary artery was also stenotic up to 90% (Figure 1). The patient received 50 U/kg (4000 U) factor VIII (FVIII) after angiography, which he was not able to receive before angiography due to the urgency of the case. Thereafter, he received 25 U/kg (2000) FVIII twice a day for 3 days, and then 20 U/kg (1600 U) FVIII was given for

the following 7 days at intervals of 12 h. No intervention was performed during angiography because of multi-vessel disease and bypass operation was decided. Among blood parameters tested during admission of the patient, the activated partial thromboplastin time (aPTT) was 51.4 s. The FVIII inhibitor test was negative. His childhood FVIII level was 11.3; thus, he was evaluated as having a mild case of hemophilia A. Prior to the bypass operation, the patient received 50 U/kg (4000 U) FVIII replacement and was taken to the operation with an aPTT value of 45.6 s. The bypass operation was carried out with the same procedures as for non-hemophiliac patients including standard heparinization. In order to prevent disseminated intravascular coagulation during factor replacements of the patient, heparin was not used except for a pump procedure. After the patient was weaned from the cardiopulmonary pump, 50 U/kg (4000 U) bolus FVIII was administered. For the following 3 days, 25 U/kg (2000 U) FVIII was administered at intervals of 12 h. Thereafter, 20 U/kg (1600 U) FVIII was administered for 7 days at intervals of 12 h (Table 1). The patient has been followed for 3 years with routine controls. Within this period, he has had no serious medical problems except nosebleeds. When the literature was analyzed, it was identified that continued infusion of FVIII was rarely administered in pre135

LETTERS TO THE EDITOR

Turk J Hematol 2019;36:122-140

Figure 1. Stenosis: right coronary artery, 50%; left anterior descending artery, 80%; and circumflex coronary artery, 90%. Table 1. Daily total dosage of factor VIII and evaluation of activated partial thromboplastin time and factor VIII during the perioperative period. Day

aPTT

FVIII

FVIII dosage (daily)

0 (angiography)

51.4

1-3

2x2000 U

49.1

14.5

2x1600 U

5-10

2x1600 U

1x4000 U

Operation decision and surgery preparations 25 (bypass)

45.6

26-28

2x4000 U 2x2000 U

40.5

29.8

2x1600 U

30-35

2x1600 U

36 (nosebleed)

39.9

2x2000 U

35.5

2x2000 U

34.0

2x2000 U

Exit from intensive care

Discharge preparations and warnings 39

33.1

None

33.4

None

41 (discharge)

36.1

53.7

None

aPTT: Activated partial thromboplastin time, FVIII: factor VIII.

136

and intraoperative periods [1,2]. Similar to the literature, we did not administer continued infusion of FVIII because we believed that thrombosis risk was more of an issue compared to the bleeding. The World Hemophilia Federation recommends FVIII levels between 80% and 100% before and after major operations [3], but considering the urgency and thrombosis risk in our case we brought a different approach, addressing all disciplines responsible for the case and arriving at a consensus. We present our method in Table 1 as a recommendation. In this method, we administered 2x50 U/kg on the day of the operation (1 day), 2x25 U/kg for the following 3 days, and 2x20 U/kg for the following 7 days and we named it the “13-7 protocol”. Our protocol needs to be tested with further studies. Keywords: Hemophilia A, Coronary artery bypass surgery, Intermittent factor VIII administration Anahtar Sözcükler: Hemofili A, Koroner arter bypass operasyonu, Aralıklı faktör VIII uygulaması Informed Consent: Received.

LETTERS TO THE EDITOR

Turk J Hematol 2019;36:122-140

References 1. Kypson AP, Rodriguez E, Anderson CA. Coronary surgery in a hemophiliac with continuous factor VIII replacement. Asian Cardiovasc Thorac Ann 2012;20:191-192.

2. Shalabi A, Spiegelstein D, Lipey A, Kassif Y, Misgav M, Kogan A, Raanani E. Cardiac surgery in patients with hemophilia A and B. In: 62nd Annual Conference of the Israel Heart Society; Tel Aviv, Israel; 13-14 April 2015. 3. Srivastava A, Brewer AK, Mauser-Bunschoten EP, Key NS, Kitchen S, Llinas A, Ludlam CA, Mahlangu JN, Mulder K, Poon MC, Street A; Treatment Guidelines Working Group on Behalf of the World Federation of Hemophilia. Guidelines for the management of hemophilia. Haemophilia 2013;19:1-47.

Address for Correspondence/Yazışma Adresi: Ulaş Serkan TOPALOĞLU, M.D., Kayseri City Training and Research Hospital, Clinic of Internal Medicine, Kayseri, Turkey E-mail : ustop38@gmail.com ORCID-ID: orcid.org/0000-0001-6625-7763

Received/Geliş tarihi: August 02, 2018 Accepted/Kabul tarihi: November 23, 2018 DOI: 10.4274/tjh.galenos.2018.2018.0271

Prospective Evaluation of Non-Compliant Severe Hemophilia Patients Tedaviye Uyumsuz Ağır Hemofili Hastalarının Prospektif Değerlendirilmesi Mehmet Can Uğur1,

Kaan Kavaklı2

1University of Health Sciences, İzmir Bozyaka Training and Research Hospital, Clinic of Hematology, İzmir, Turkey 2Ege University Faculty of Medicine, Department of Pediatric Hematology, İzmir, Turkey

To the Editor, Patient compliance with the determined treatment regimen is a current issue in the treatment of hemophilia, and there are many studies that report compliance issues in patients with hemophilia [1,2]. In our study, we applied a survey to 40 patients who participated in the adolescent workshop of Hemophilia Federation in March 2017, and we monitored 16 adolescent patients with severe hemophilia and investigated the changes in their compliance rates during a 1-year period. The survey was applied using face-to-face method. Subjects who were found to be non-compliant (patients who neglect to apply prophylaxis as recommended by their physicians) were monitored for 1 year. These subjects were reached by phone in months 6 and 12. The scope of these telephone calls was as follows: whether the subject was currently on prophylaxis, whether they were complying with the treatment plan, and the reasons for non-compliance. This survey was an activity initiated for patients during a routine workshop. Therefore, we did not apply for ethics committee approval.

There were a total of 40 subjects: thirty nine patients with severe hemophilia and 1 patient with von Willebrand disease (vWD). Among these subjects, 16 were found to be noncompliant: twelve patients with hemophilia A, 3 patients with hemophilia B, and 1 patient with vWD. The average age of these 16 subjects was 21.25 years. Ten patients (62.5%) were receiving prophylaxis. Two of the patients were middle school, 11 were high school, and 3 were university graduates. There were 10 patients who were receiving prophylaxis at the start of study. The number of patients on prophylaxis increased to 12 and 14 at 6 and 12 months of follow-up. The rate of compliant patients was 43.75% in the sixth month and 56.25% in the first year. It was determined that there were three reasons for noncompliance with the treatment: time constraints, being tired of the treatment, and problems with vascular access. The number of patients reporting these problems is presented in Table 1. The definition of “acceptable compliance” can greatly different between studies. Generally, if patients administer at least 75% to 80% of the recommended doses, they are accepted to have perfect compliance [3]. Sixteen subjects who were found to be 137

LETTERS TO THE EDITOR

Turk J Hematol 2019;36:122-140

it might be useful to conduct individual meetings with each patient instead of group trainings.

Table 1. The causes of non-compliance with treatment of 16 patients. Time constraints (n)

Being tired of Problems with the treatment vascular access (n) (n)

Month 0

Month 6

Month 12

Keywords: Hemophilia, Compliance, Adolescent Anahtar Sözcükler: Hemofili, Tedavi uyumu, Adölesan

non-compliant were monitored for 1 year, and it was determined that the rate of compliance increased only to 56.25% in our prospective cohort study. Adolescent patients are more resistant to comply with recommended treatment plans. In this age group, the patients go through several biological, social, and emotional changes that influence their approach to the disorder [4]. Due to these factors, the non-compliance problem has a complicated nature that cannot be resolved through advising only. Treatment nonadherence is a chronic process in life-long chronic diseases such as hemophilia. As each patient is affected by different factors,

References 1. van Os SB, Troop NA, Sullivan KR, Hart DP. Adherence to prophylaxis in adolescents and young adults with severe haemophilia: a quantitative study with patients. PLoS One 2017;12:e0169880. 2. Khair K. Compliance, concordance and adherence: what are we talking about? Haemophilia 2014;20:601-603. 3. Thornburg CD. Physicians’ perceptions of adherence to prophylactic clotting factor infusions. Haemophilia 2008;14:25-29. 4. Brand B, Dunn S, Kulkarni R. Challenges in the management of haemophilia on transition from adolescence to adulthood. Eur J Haematol 2015;95(Suppl 81):30-35.

Address for Correspondence/Yazışma Adresi: Mehmet Can UĞUR, M.D., University of Health Sciences, İzmir Bozyaka Training and Research Hospital, Clinic of Hematology, İzmir, Turkey E-mail : med.can@hotmail.com ORCID-ID: orcid.org/0000-0002-5600-3169

Received/Geliş tarihi: August 07, 2018 Accepted/Kabul tarihi: October 02, 2018 DOI: 10.4274/tjh.galenos.2018.2018.0281

Bleomycin-Induced Flagellate Dermatitis Bleomisin ile İlişkili Flagella Dermatit Esra Turan Erkek1,

Ceren Nur Karaali2,

Güven Yılmaz1,

Emine Gültürk1

1Lütfi Kırdar Training and Research Hospital, Clinic of Hematology, İstanbul, Turkey 2Bahçeşehir University Faculty of Medicine, İstanbul, Turkey

To the Editor, Bleomycin is a cytostatic, antineoplastic antibiotic that is used in both of the first-line treatments of Hodgkin lymphoma: ABVD (doxorubicin, bleomycin, vinblastine, dacarbazine) and BEACOPP (doxorubicin, bleomycin, vincristine, cyclophosphamide, etoposide, prednisone, procarbazine). The bleomycin hydrolase enzyme metabolizes bleomycin. This enzyme is not found in the skin or lung tissues; therefore, bleomycin accumulates in those areas and causes side effects [1]. The dermatologic side effects of bleomycin may vary from onycholysis, pruritus, and scleroderma-like skin changes to Stevens-Johnson syndrome. Flagellate dermatitis, resulting after bleomycin therapy, was originally described 138

by Moulin et al. [2] in 1970 as “bleomycin-induced linear hyperpigmentation” [3]. Although the term “flagellate dermatitis” was described for bleomycin-induced dermatitis, other causes of this symptom have been defined over time (Table 1) [4]. The characteristic symptoms are pruritic linear hyperpigmentations, arranged in a flagellate pattern and developing, in particular, on the trunk. Even though the exact mechanism is not clear, minor skin traumas are thought to be responsible since they increase blood flow to the affected area and cause drug accumulation [1]. We present a 24-year-old female patient who was diagnosed in August 2016 with stage IIA Hodgkin lymphoma (right cervical, submandibular, and bilateral palatine tonsil involvement

LETTERS TO THE EDITOR

Turk J Hematol 2019;36:122-140

was observed in positron emission tomography/computed tomography). A BEACOPP chemotherapy regimen was chosen for first-line therapy. After the second cycle of BEACOPP, the patient developed generalized and intense pruritus along with the appearance of papules and plaques on her back, shoulders, and trunk, with a remarkable whip-like mark formation (Figures 1 and 2), which evolved into hyperpigmentation. There was no evidence of mucosal or systemic involvement. Contrary to expectations, there was no evidence of dermatographia. Flagellate dermatitis was diagnosed by the clinical features. The patient did not have a history of dermatomyositis, Still’s disease, hypereosinophilic syndrome, or shiitake mushroom intake. The BEACOPP regimen was interrupted after three cycles of chemotherapy were completed. The skin lesions started to resolve two weeks after the bleomycin-inducing therapy was suspended. Bleomycin-induced flagellate dermatitis is a dose-dependent reaction that usually occurs with total doses above 100 U [5,6]. In contrast with these results, some patients develop

skin symptoms after low doses. The incidence of developing flagellate dermatitis and consequent hyperpigmentation after receiving bleomycin treatment is reported between 8% and 22% [7]. The lesions usually diminish 3-4 months after the interruption of the bleomycin treatment. Other than the suspension of the bleomycin treatment, no effective treatment has been reported for bleomycin-induced ﬂagellate dermatitis. In the literature, there are some cases that report the use of topical or systemic corticosteroid treatments, as well as oral antihistamine treatments. However, it is stated that those treatments provide only symptomatic relief. The cessation of bleomycin is necessary to prevent further relapse [8]. We found it worthwhile to present our case since the development of this condition is rarely seen after a low dosage, the lesions disappear shortly after the suspension of the medication, and flagellate dermatitis is not observed with the other medications that our patient was receiving. Clinicians must be aware of this uncommon complication and act immediately to interrupt the causative agent.

Table 1. Causes of flagellate dermatitis. True flagellation/mechanical

Religious punishment, torture, abuse, sadomasochism, dermatitis artefacta

Chemotherapy-induced

Bleomycin, peplomycin, docetaxel, bendamustine

Rheumatologic disorders

Dermatomyositis, adult-onset Still’s disease

Toxin-induced

Shiitake mushroom ingestion, cnidarian stings, Paederus and other insects

Other pruritic dermatitis

Dermatographism, excoriations from pruritic conditions, phytophotodermatitis, poison ivy dermatitis

Hypereosinophilic syndrome

Chikungunya fever-induced

Idiopathic

Figure 1. Flagellate dermatitis on trunk.

Figure 2. Flagellate dermatitis on extremity. 139

LETTERS TO THE EDITOR

Turk J Hematol 2019;36:122-140

Keywords: Bleomycin, Hodgkin lymphoma, Flagellate dermatitis

2. Moulin MMJ, Fière B, Beyvin A. Cutaneous pigmentation caused by bleomycin. Bull Soc Fr Dermatol Syphiligr 1970;293-296.

Anahtar Sözcükler: Bleomisin, Hodgkin Lenfoma, Flagella dermatit

3. Bronner AK, Hood AF. Cutaneous complications of chemotherapeutic agents. J Am Acad Dermatol 1983;9:645-663.

Informed Consent: Received.

4. Bhushan P, Manjul P, Baliyan V. Flagellate dermatoses. Indian J Dermatol Venereol Leprol 2014;80:149-152.

5. Vignini M, Miori L, Brusamolino E, Pelfini C. Linear streaking after bleomycin administration. Clin Exp Dermatol 1989;14:261. 6. Cortina P, Garrido JA, Tomas JF, Unamuno P, Armijo M. ‘Flagellate’ erythema from bleomycin. With histopathological findings suggestive of inflammatory oncotaxis. Dermatologica 1990;180:106-109.

References

7. Ziemer M, Goetze S, Juhasz K, Elsner P. Flagellate dermatitis as a bleomycinspecific adverse effect of cytostatic therapy. Am J Clin Dermatol 2011;12:6876.

1. Diao DY, Goodall J. Bleomycin-induced flagellate dermatitis. CMAJ 2012;184:1280.

8. Todkill D, Taibjee S, Borg A, Gee BC. Flagellate erythema due to bleomycin. Br J Haematol 2008;142:857.

Address for Correspondence/Yazışma Adresi: Esra TURAN ERKEK, M.D., Lütfi Kırdar Training and Research Hospital, Clinic of Hematology, İstanbul, Turkey Phone : +90 533 447 85 95 E-mail : dresraturan@gmail.com ORCID-ID: orcid.org/0000-0001-7206-6699

140

Received/Geliş tarihi: 12 September 12, 2018 Accepted/Kabul tarihi: 2 January 02, 2019 DOI: 10.4274/tjh.galenos.2019.2018.0317

Advisory Board of This Issue (June 2019) Ahu Demiröz, Turkey Asiful Islam, Malaysia Aydan Akdeniz, Turkey Bruna Codispoti, Italy Burhan Ferhanoğlu, Turkey Cem Mirili, Turkey Cengiz Ceylan, Turkey Christoph Schmid, Germany Claudio Cerchione, Italy Daulath Singh, USA Deniz Karapınar, Turkey Eric Solary, France Fatma Burcu Belen, Turkey Francesco Spina, Italy Giuseppe Colucci, Switzerland Giuseppe Milone, Italy Gökhan Görgişen, Turkey

Gülsüm Çağlıyan, Turkey Hilmi Erdem Gözden, Turkey İnci Alacacıoğlu, Turkey İrfan Yavaşoğlu, Turkey Işınsu Kuzu, Turkey Ivan Novak, Argentina Jane Liesveld, USA Jesus Cardenas-De La Garza, Mexico John M. Bennett, USA Lloyd Damon, USA Mahmut Bayık, Turkey Mansour Aljabry, Saudi Arabia Marie Detrait, France Melih Aktan, Turkey Meral Beksaç, Turkey Moustapha Hassan, Sweden Muhit Özcan, Turkey

Mustafa Çetiner, Turkey Nazan Sarper, Turkey Nejat Akar, Turkey Nükhet Tüzüner, Turkey Nur Hilal Büyükkurt, Turkey Olympia Anastasiou, Germany Rauf Haznedar, Turkey Şefik Güran, Turkey Simranjeet Kaur Dhaliwal, India Ulaş Bayraktar, Turkey Ümit Yavuz Malkan, Turkey Yahya Büyükaşık, Turkey Yosep Chong, Korea Zafer Çetin, Turkey Zahit Bolaman, Turkey