Arora and Seth: Antigenicity and immunogenicity of HIV envelope gene medium, lactalbumin hydrolysate and yeast extract. Sf 21 cells were cultured at 27oC in TNM-FH medium supplemented with 10% FBS (TNM-FH/FBS). Vaccinia expressed recombinant gp120 and gp160 (vPE8 and vPE16) were obtained through NIH AIDS Research and Reference Reagent Program.
20µl of 10M-ammonium acetate. Samples were then spotted on to the nitrocellulose membrane by loading on the wells of the dot blot manifold apparatus (Bio Rad Laboratory, Richmond, CA). Vacuum suction was applied to drain off the entire solution. Membrane was dried at room temperature for 5-10 min and then baked for 2 hrs at 80oC. Hybridization was performed using !32P-dCTP labeled envelope probe prepared by random primer labeling using Klenow fragment of DNA polymerase 1 (Amersham Biosciences, Piscataway, NJ). The membrane was then washed and exposed to a Kodak-X film overnight at -70oC.
B. DNA constructs 3kb env-tat-rev gene segment (nt 5352- nt 8354) of HIV-1 subtype B strain, BRU, was PCR amplified using primers API (5352-5390) TTATTCTAGAGAGAAGAGCAAGAAATGGA TCCAGTAGAT and APII (8316-8354) TTTTTGAGCTCTTGCCACCCATTTTAAAGTAAAGACCTT and cloned into pCR-Script (SK+) cloning vector to produce pSBRU-TRE as described earlier (Arora and Seth, 2001). The 3kb HIV-1 env-tat-rev gene segment was released by restriction digestion of pSBRU-TRE with Xba I, Not I and Bgl I. The env, tat and rev gene fragment was then purified from low melting point agarose gel and subcloned into baculovirus transfer vector, pBacPAK9 predigested with Xba I and Not I to generate pBacBRU-TRE. Recombinant clone was screened by colony hybridization followed by restriction enzyme analysis. pCIBRUTRE, mammalian expression vector expressing 3kb HIV-1 envtat-rev gene under the control of Immediate-Early Promoter/Enhancer of CMV, used in this study for immunizing Balb/c mice has been described earlier (Arora and Seth, 2001).
F. In vitro expression A time course experiment was performed to examine the expression of HIV-1 env gene in Sf 21 cells infected with the recombinant virus. Cells were harvested at various time intervals post infection. SDS PAGE, immunofluorescence and Western Blot analysis of cell lysate were conducted to study expression of proteins. SDS-PAGE was performed according to Laemmli. For Western Blot analysis proteins were resolved by SDS-PAGE and transferred onto a nitrocellulose membrane using Trans-blot SD semi-dry electrophoretic transfer Cell (Bio Rad Laboratories) The membrane was treated with non-fat powdered milk in TTBS (Tween 20- Tris buffer Saline) for 1 hr at room temp. and reacted with HIV-1 positive human polyclonal serum (at a dilution of 1:200) in TBS for 1h at room temperature. After washing thrice with TTBS, the membrane was incubated at room temperature for 1 hr. with anti-human IgG conjugated with alkaline phosphatase (1:10,000). Membrane was then washed thrice with TTBS and incubated in the substrate solution (Sigma fast BCIP/NBT tablet dissolved in 10ml of deionized water, Sigma Chemicals Co., St. Louis). For Immunofluorescence, P4 (recombinant baculovirus) infected cells, uninfected cells (control) and AcNPv (wild type virus) infected cells were harvested at different time points and washed thrice with PBS. 1x104 cells were spotted onto the wells of a teflon-coated slide and fixed with acetone: methanol (1:1) at -20oC for 30 min. For staining, cells were allowed to react with HIV-1 positive human polyclonal serum (1:50) for 1h at 37oC. Cells were then washed with PBS and incubated with FITC conjugated anti-human IgG (Sigma) and incubated for 1hr at 37oC. Thereafter, the cells were washed and mounted with glycerol buffer and visualized under fluorescent microscope.
C. Generating a recombinant virus Recombinant virus was prepared as per manufacturer's instructions. Briefly, 35mm tissue culture dishes were seeded with 1x106 Spodoptera frugiperda cells (Sf21) (Vaughn et al, 1977) in 1.5 ml of complete TNM-FH/FBS medium and incubated overnight at 27oC in a humid chamber. 500ng of plasmid pBacBRU-TRE DNA, along with Bsu 361 digested BacPAK6 viral DNA was mixed with 5µg of lipofectin and incubated at room temperature for 15 min. Culture medium in the tissue culture dishes containing Sf21 cells was replaced with 1.5 ml of serum free TNM-FH. Lipofectin-DNA complex was then gently added to Sf21 cells. Plates were incubated at 27oC for 5 hrs. Thereafter, serum free TNM-FH medium was replaced with TNM-FH/FBS medium and the plates were returned for incubation at 27oC for 4 days.
G. T cell proliferation assay
D. Isolation of recombinant virus
3
H thymidine uptake assay was used to measure the proliferation of splenocytes after antigenic stimulation. Balb/c mice were immunized intramuscularly with pCIBRU-TRE or pCI (control vector) DNA as described earlier (Arora and Seth, 2001). Six groups of Balb/c mice were taken (each group comprising 5 mice) (Table 1). In-group D3 three doses of 100 µg DNA each were given at bi-weekly intervals. In D0P2 group animals were immunized with 2 doses of P4 with no DNA priming. In-group D3P2 animals were immunized with 3 doses of pCIBRU-TRE DNA followed by 2 doses of P4. Group D3V2 consisted of mice immunized with 3 doses of pCIBRU-TRE followed by 2 doses of recombinant vaccinia virus expressed gp120 and gp160 (vPE8 and vPE16). D0V2 group consisted of mice immunized with 2 doses of vPE8 and vPE16 with no priming with DNA construct and control group. Stimulating antigens included vaccinia expressed recombinant gp160/gp120 (vPE16/ vPE8) and baculovirus expressed gp160 (P4). Splenocytes from various groups of mice were harvested and resuspended at a concentration of 2x106 cells/ml in RPMI 1640 medium supplemented with 10% FCS. Cells were stimulated in
Plaque assay was performed using co-transfection supernatant to generate a pure clone of recombinant virus. 1x106 Sf21 cells were seeded in 35mm tissue culture dishes and incubated overnight at 27oC. These cells were then infected with 100µl of neat or 10-1 dilution of co-transfection supernatant. One hour later, the virus inoculum was removed and infected cells were overlaid with 1.5ml of agarose (1.5% in TNM-FH/FBS). After agarose was set 1.5 ml of TNM-FH/FBS medium was added to each dish and incubated for 4 days at 27oC. Plaques were stained with .03% of neutral red solution. 4 plaques were picked up and transferred into an eppendorf tube containing 500µl of TNM-FH/FBS and stored at 4oC overnight.
E. Virus propagation and evaluation The plaque picks were used as a source of virus to infect cells in a 96 well plate. Infections were performed in duplicate. Cells were harvested 4 days following infection and cell lysate was used to perform dot blot analysis to detect the recombinant virus. Each sample was suspended in 200µl of 0.5N NaOH and
38