Gene Therapy & Molecular Biology Volume 10 Issue B

GENE THERAPY & MOLECULAR BIOLOGY FROM BASIC MECHANISMS TO CLINICAL APPLICATIONS

Volume 10 Number 2 December 2006 Published by Gene Therapy Press

GENE THERAPY & MOLECULAR BIOLOGY FREE ACCESS www.gtmb.org

!!!!!!!!!!!!!!!!!!!!!!!!

Editor

Teni Boulikas Ph. D., CEO Regulon Inc. 715 North Shoreline Blvd.

Mountain View, California, 94043 USA Tel: 650-968-1129 Fax: 650-567-9082 E-mail: teni@regulon.org

Teni Boulikas Ph. D., CEO, Regulon AE. Gregoriou Afxentiou 7 Alimos, Athens, 17455 Greece Tel: +30-210-9853849 Fax: +30-210-9858453 E-mail: teni@regulon.org

!!!!!!!!!!!!!!!!!!!!!!!!

Assistant to the Editor Maria Vougiouka B.Sc., Gregoriou Afxentiou 7 Alimos, Athens, 17455 Greece Tel: +30-210-9858454 Fax: +30-210-9858453 E-mail: maria@cancer-therapy.org

!!!!!!!!!!!!!!!!!!!!!!!!

Associate Editors

Aguilar-Cordova, Estuardo, Ph.D., AdvantaGene, Inc., USA Berezney, Ronald, Ph.D., State University of New York at Buffalo, USA Crooke, Stanley, M.D., Ph.D., ISIS Pharmaceuticals, Inc, USA Crouzet, Joël, Ph.D. Neurotech S.A, France Gronemeyer, Hinrich, Ph.D. I.N.S.E.R.M., IGBMC, France Rossi, John, Ph.D., Beckman Research Institute of the City of Hope, USA Shen, James, Ph.D., Institute of Molecular Biology, Academia Sinica, Taipei, Taiwan, Republic of China & University of California at Davis, USA. Webb, David, Ph.D., Celgene Corporation, USA Wolff, Jon, Ph.D., University of Wisconsin, USA

!!!!!!!!!!!!!!!!!!!!!!!!

Editorial Board Akporiaye, Emmanuel, Ph.D., Arizona Cancer Center, USA Anson, Donald S., Ph.D., Women's and Children's Hospital, Australia Ariga, Hiroyoshi, Ph.D., Hokkaido University, Japan Baldwin, H. Scott, M.D Vanderbilt University Medical Center, USA Barranger, John, MD, Ph.D., University of Pittsburgh, USA Black, Keith L. M.D., Maxine Dunitz Neurosurgical Institute, Cedars-Sinai Medical Center, USA Bode, Jürgen, Gesellschaft für Biotechnologische Forschung m.b.H., Germany Bohn, Martha C., Ph.D., The Feinberg School of Medicine, Northwestern University, USA Bresnick, Emery, Ph.D., University of Wisconsin Medical School, USA Caiafa, Paola, Ph.D., Università di Roma “La Sapienza”, Italy

Chao, Lee, Ph.D., Medical University of South Carolina, USA Cheng, Seng H. Ph.D., Genzyme Corporation, USA Clements, Barklie, Ph.D., University of Glasgow, USA Cole, David J. M.D., Medical University of South Carolina, USA Chishti, Athar H., Ph.D., University of Illinois College of Medicine, USA Davie, James R, Ph.D., Manitoba Institute of Cell Biology;USA DePamphilis, Melvin L, Ph.D., National Institute of Child Health and Human, National Institutes of Health, USA Donoghue, Daniel J., Ph.D., Center for Molecular Genetics, University of California, San Diego, USA Eckstein, Jens W., Ph.D., Akikoa Pharmaceuticals Inc, USA Fisher, Paul A. Ph.D., State University of New York, USA

Galanis, Evanthia, M.D., Mayo Clinic, USA Gardner, Thomas A, M.D., Indiana University Cancer Center, USA Georgiev, Georgii, Ph.D., Russian Academy of Sciences, USA Getzenberg, Robert, Ph.D., Institute Shadyside Medical Center, USA Ghosh, Sankar Ph.D., Yale University School of Medicine, USA Gojobori, Takashi, Ph.D., Center for Information Biology, National Institute of Genetics, Japan Harris David T., Ph.D., Cord Blood Bank, University of Arizona, USA Heldin, Paraskevi Ph.D., Uppsala Universitet, Sweden Hesdorffer, Charles S., M.D., Columbia University, USA Hoekstra, Merl F, Ph.D., Epoch Biosciences, Inc., USA Hung, Mien-Chie, Ph.D., The University of Texas, USA Johnston, Brian, Ph.D., Somagenics, Inc, USA Jolly, Douglas J, Ph.D., Advantagene, Inc.,USA Joshi, Sadhna, Ph.D., D.Sc., University of Toronto Canada Kaltschmidt, Christian, Ph.D., Universität Witten/Herdecke, Germany Kiyama, Ryoiti, Ph.D., National Institute of Bioscience and Human-Technology, Japan Krawetz, Stephen A., Ph.D., Wayne State University School of Medicine, USA Kruse, Carol A., Ph.D., La Jolla Institute for Molecular Medicine, USA Kuo, Tien, Ph.D., The University of Texas M. D. Anderson Cancer USA Kurachi Kotoku, Ph.D., University of Michigan Medical School, USA Kuroki, Masahide, M.D., Ph.D., Fukuoka University School of Medicine, Japan Lai, Mei T. Ph.D., Lilly Research Laboratories USA Latchman, David S., PhD, Dsc, MRCPath University of London, UK Lavin, Martin F, Ph.D., The Queensland Cancer Fund Research Unit, The Queensland Institute of Medical Research, Australia Lebkowski, Jane S., Ph.D., GERON Corporation, USA Li, Jian Jian, Ph.D., City of Hope National Medical Center, USA Li, Liangping Ph.D., Max-Delbrück-Center for Molecular Medicine, Germany Lu, Yi, Ph.D., University of Tennessee Health Science Center, USA Lundstrom Kenneth, Ph.D. , Bioxtal/Regulon, Inc. Switzerland Malone, Robert W., M.D., Aeras Global TB Vaccine Foundation, USA Mazarakis, Nicholas D. Ph.D., Imperial College London, UK Mirkin, Sergei, M. Ph.D., Tufts University, USA Moroianu, Junona, Ph.D., Boston College, USA Müller, Rolf, Ph.D., Institut für Molekularbiologie

und Tumorforschung, Phillips-Universität Marburg, USA Noteborn, Mathieu, Ph.D., Leiden University, The Netherlands Papamatheakis, Joseph (Sifis), Ph.D., Institute of Molecular Biology and Biotechnology Foundation for Research and Technology Hellas, USA Platsoucas, Chris, D., Ph.D., Temple University School of Medicine, USA Rockson, Stanley G., M.D., Stanford University School of Medicine, USA Poeschla, Eric, M.D., Mayo Clinic, USA Pomerantz, Roger, J., M.D., Tibotec, Inc., USA Raizada, Mohan K., Ph.D., University of Florida, USA Razin, Sergey, Ph.D., Institute of Gene Biology Russian Academy of Sciences, USA Robbins, Paul, D, Ph.D., University of Pittsburgh, USA Rosenblatt, Joseph, D., M.D, University of Miami School of Medicine, USA Rosner, Marsha, R., Ph.D., Ben May Institute for Cancer Research, University of Chicago, USA Royer, Hans-Dieter, M.D., (CAESAR), Germany Rubin, Joseph, M.D., Mayo Medical School Mayo Clinic, USA Saenko Evgueni L., Ph.D., University of Maryland School of Medicine Center for Vascular and Inflammatory Diseases, USA Salmons, Brian, Ph.D., (FSG-Biotechnologie GmbH), Austria Santoro, M. Gabriella, Ph.D., University of Rome Tor Vergata, USA Sharrocks, Andrew, D., Ph.D., University of Manchester, USA Shi, Yang, Ph.D., Harvard Medical School, USA Smythe Roy W., M.D., Texas A&M University Health Sciences Center, USA Srivastava, Arun Ph.D., University of Florida College of Medicine, USA Steiner, Mitchell, M.D., University of Tennessee, USA Tainsky, Michael A., Ph.D., Karmanos Cancer Institute, Wayne State University, USA Sung, Young-Chul, Ph.D., Pohang University of Science & Technology, Korea Taira, Kazunari, Ph.D., The University of Tokyo, Japan Terzic, Andre, M.D., Ph.D., Mayo Clinic College of Medicine, USA Thierry, Alain, Ph.D., National Cancer Institute, National Institutes of Health, France Trifonov, Edward, N. Ph.D., University of Haifa, Israel Van de Ven, Wim, Ph.D., University of Leuven, Belgium Van Dyke, Michael, W., Ph.D., The University of Texas M. D. Anderson Cancer Center, USA White, Robert, J., University of Glasgow, UK White-Scharf, Mary, Ph.D., Biotransplant, Inc., USA Wiginton, Dan, A., Ph.D., Children's Hospital Research Foundation, CHRF , USA

Yung, Alfred, M.D., University of Texas, USA Zannis-Hadjopoulos, Maria Ph.D., McGill Cancer Centre, Canada

Zorbas, Haralabos, Ph.D., BioM AG Team, Germany

!!!!!!!!!!!!!!!!!!!!!!!!

Associate Board Members

Aoki, Kazunori, M.D., Ph.D., National Cancer Center Research Institute, Japan Cao, Xinmin, Ph.D., Institute of Molecular and Cell Biology, Singapore Falasca, Marco, M.D., University College London, UK Gao, Shou-Jiang, Ph.D., The University of Texas Health Science Center at San Antonio, USA Gibson, Spencer Bruce, Ph.D., University of Manitoba, USA Gra•a, Xavier, Ph.D., Temple University School of Medicine, USA

For submission of manuscripts and inquiries: Editorial Office Teni Boulikas, Ph.D./ Maria Vougiouka, B.Sc. Gregoriou Afxentiou 7 Alimos, Athens 17455 Greece Tel: +30-210-985-8454 Fax: +30-210-985-8453 and electronically to maria@cancer-therapy.org

Gu, Baohua, Ph.D., The Jefferson Center, USA Hiroki, Maruyama, M.D., Ph.D., Niigata University Graduate School of Medical and Dental Sciences, Japan MacDougald, Ormond A, Ph.D., University of Michigan Medical School, USA Rigoutsos, Isidore, Ph.D., Thomas J. Watson Research Center, USA

Instructions to authors: Gene Therapy and Molecular Biology (GTMB) FREE ACCESS www.gtmb.org Scope Gene Therapy and Molecular Biology, bridging various fields is one of the most rapid with free access at gtmb.org.

The scope of Gene Therapy and Molecular Biology is to promote interaction between researchers in the fields of Gene Therapy and Molecular Biology providing rapid publication of review articles and research papers. Articles (both invited and submitted) review or report novel findings of importance to a general audience in gene therapy, molecular medicine, gene discovery, and molecular biology with emphasis to molecular mechanisms. The journal will accept papers on all aspects of gene therapy, including gene delivery systems, gene therapy of cancer and other diseases (e.g. CFTR, hemophilia, AIDS, restenosis) at the clinical, preclinical or cell culture stage, gene discovery, cancer immunotherapy, DNA vaccines, use of DNA regulatory elements in gene transfer, cell therapy and transplantation, arraying technologies & DNA chips, peptide libraries and drug discovery related to gene therapy, cell targeting, gene targeting, therapy with oligonucleotides (antisense, ribozymes, triplex). The authors are encouraged to elaborate on the molecular mechanisms that govern a gene therapy approach. Gene Therapy and Molecular Biology will also publish articles on, transcription factors, DNA replication, recombination, repair, chromatin, nuclear matrix, DNA regulatory regions, locus control regions, protein phosphorylation, signal transduction, development, and on molecular mechanism of human disease. To make the publication attractive authors are encouraged to include color figures.

Type of articles Both review articles and original research articles will be considered. In addition, short 1-2 page news & views will also be considered for publication. Original research articles should contain a generous introduction in addition to experimental data. The articles contain information important to a general audience as the volume is also addressed to researches outside the field. There is no limit on the length of the articles provided that the subject is interesting to a general audience and covers exhaustively a field. The typical length of each manuscript is a approximately 4-20 printed page including Figures and Tables. This is 12-60 manuscript pages.

Charges, Complimentary reprints & Subscriptions There are no charges for color figures or page numbers. Corresponding authors get a one-year free subscription (hard copy) plus 25 reprints free of charge. The free subscription can be renewed for additional years by having one paper per year accepted for publication.

The free electronic access to articles published in " Gene Therapy and Molecular Biology " to a big general audience, the attractive journal title, the speed of the reviewing process, the no-charges for page numbers or color figure reproduction, the 25 complimentary reprints, the rapid electronic publication, the embracing of many fields in gene therapy (from molecular mechanisms to clinical trials), the high quality in depth reviews and first rate research articles and most important, the eminent members of the Editorial Board being assembled are prognostic factors of a big success for GTMB.

Sections of the manuscript Each manuscript should have a Title, Authors, Affiliation, Corresponding Author (with Tel, Fax, and E-mail), Summary, key words , running title and Introduction; review articles are subdivided into headings I, II, III, etc. (starting with I. Introduction) subdivided into A, B, C, and further subdivided using 1, 2, 3, etc. You can further subdivide into 1, 2, 3, etc. Research articles are divided into Summary; I. Introduction; II. Materials and Methods III. Results; IV. Discussion; Acknowledgments; and References. Please include in your text citations the name of authors and year in parenthesis; for three or more authors use: (name of first author et al, with year); for two authors please use both names. Please delete hidden text for references. In the reference list, please, type references with year and Journal in boldface and provide full title of the article such as: Buschle M, Schmidt W, Berger M, Schaffner G, Kurzbauer R, Killisch I, Tiedemann J-K, Trska B, Kirlappos H, Mechtler K, Schilcher F, Gabler C, and Birnstiel ML (1998) Chemically defined, cellfree cancer vaccines: use of tumor antigen-derived peptides or polyepitope proteins for vaccination.

Gene Ther Mol Biol 1, 309-321.

To avoid delays it is essential to submit an electronic and a hard copy version of your manuscript via e-mail and mail in a floppy, CD-ROM or ZIP, containing the manuscript that will be used to typeset the paper. Please include in the digital media: Tables, if any, (preferably as a Microsoft Word text) and Figure legends. Please use Microsoft Word, font “Times” (Mac users) or “Times New Roman” (PC users) and insert Greek or other characters using the “Insert/Symbol” function in the Microsoft Word rather than simple conversion to font “Symbol”. Please boldface Figure 1, 2, 3 etc. as well as Table 1, 2, etc. throughout the text. Please provide the highest quality of prints of your Figures; whenever possible, please provide in addition an electronic version of your figures.

Article contributors are kindly requested to provide a color (or black/white) photo of themselves (preferably 4x5 cm or any size) or a group photo of the authors, as we shall include these in the publication Submission and reviewing Peer reviewing is by members of the Editorial Board and external referees. Please suggest 2-3 reviewers providing their electronic addresses, mailing addresses and telephone/fax numbers. Authors are sent page proofs.

Gene Therapy and Molecular Biology is published in on high quality paper, hardbound, and with excellent reproduction of color figures.

Reviewing is completed within 5-15 days from receiving the manuscript.

Articles accepted without revisions (i.e., review articles) will be published online (www.gtmb.org) in approximately 1 month following submission.

Please submit an electronic version of full text and figures preferably in jpeg format. The electronic version of the figures will be used for the rapid reviewing process. High quality prints or photograph of the figures and the original with one copy should be sent via express mail to the Editorial Office.

Citation in MedLine Articles accepted for publication by GTMB or Cancer Therapy can be included in MedLine (PubMed) as full articles upon the request of authors provided that the authors have completed their published

work under a government grant by NIH (or EU/Japan government grant). If this is you case, please consult the NIH Manuscript Submission System http://www.nihms.nih.gov/.

Editorial Office Teni Boulikas, Ph.D./ Maria Vougiouka, B.Sc. Gregoriou Afxentiou 7 Alimos, Athens 17455 Greece Tel: +30-210-985-8454 Fax: +30-210-985-8453 and electronically to maria@cancer-therapy.org The free electronic access to articles published in "GTMB" to a big general audience, the attractive journal title, the speed of the reviewing process, the no-charges for page numbers or color figure reproduction, the 25 complimentary reprints, the rapid electronic publication, the embracing of many fields in cancer, the anticipated high quality in depth reviews and first rate research articles and most important, the eminent members of the Editorial Board being assembled are prognostic factors of a big success for the newly established journal.

Gene Therapy and Molecular Biology (GTMB) is covered in the following Thomson Scientific services: " Science Citation Index Expanded (also known as SciSearch# ) " Biotechnology Citation Index# " Journals Citation Reports/Science Edition

Table of contents

Gene Therapy and Molecular Biology Vol 10 Number 2, December 2006

Pages

Type of Article

Article title

Authors (corresponding author is in boldface)

165-172

Research Article

173-178

Research Article

179-184

Review Article

Emanuela Frascella, Claudia Zampieron, Martina Piccoli, Francesca Intini, Giuseppe Basso Mutaz Akkawi, Ibrahim Abbasi, Abraham Hochberg, Ofer N. Gofrit, Hassan !Dweik, Imad J. Matouk Cristina Faleiro-Rodrigues, Isabel Macedo-Pinto, Deolinda Pereira

185-192

Research Article

FLT3-ITD: technical approach and characterization of cases with double duplications The Human VG5Q Gene Transcript is Over !Expressed in Colorectal and Bladder Carcinomas Research Article Title-loss of "catenin is an independent prognostic factor in ovarian carcinomas: !A multivariate analysis New generations of retroviral vector for safe, efficient and targeted gene therapy

193-198

Research Article

199-206

Research Article

The association of endothelial constitutive Nitric Oxide Synthase polymorphisms with family history of coronary heart disease in men Apoptotic signaling induced by Tiazofurin-an in vitro study

207-222

Research Article

Effects of spatial configuration on tumor cells transgene expression

223-232

Research Article

233-244

Research Article

245-250

Research Article

251-254

Research Article

Use of lectin as an anchoring agent for adenovirus- microbead conjugates: Application to the transduction of the inflamed colon in mice Replicating minicircles: Generation of nonviral episomes for the efficient modification of dividing cells Cloning, Expression and Purification of a novel anti- angiogenic factorTumstatin Plasmodium and host carbonic anhydrase: !molecular function and biological process

Walter H. G端nzburg, Juraj Hlavaty, Stanislav Indik, Walter Tabotta, Ingrid Walter, Christine Hohenadl, Eva Maria Brandtner, Francoise Rouault, Matthias Renner and Brian Salmons Nasser M. Al-Daghri

Sujata Pathak, Himani Sharma, Chandresh Sharma, Hiremagalur N. Jayaram, Neeta Singh Cecilia C. Casais, Armando L. Karara, Gerardo C. Glikin, and Liliana M. E. Finocchiaro Alan Jerusalmi, Samuel J. Farlow and Takeshi Sano

Kristina Nehlsen, Sandra Broll and Juergen Bode Chongbi Li, Liming Yang, Hongli Jia

Viroj Wiwanitkit

255-262

Research Article

Isolation of genes controlling apoptosis through their effects on cell survival

263-268

Research Article

269-276

Research Article

The prevalence of antibiotic resistance in anaerobic bacteria isolated from patients with skin infections Transfection of the anti-apoptotic gene bcl-2 inhibits oxidative stress-induced cell injuries through delaying of NF#B activation

Gwyn T. Williams, Jane P. Hughes Victoria Stoneman, Claire L. Anderson, Nicola J. McCarthy, Mirna Mourtada-Maarabouni, Mark Pickard, Vanessa L. Hedge, Ian Trayner, Farzin Farzaneh Gita Eslami, Fatemeh Fallah, Hossein Goudarzi and Masoumeh Navidinia Shinobu Yanada, Masashi Misumi, Yasukazu Saitoh, Yasufumi Kaneda, Nobuhiko Miwa

Gene Therapy and Molecular Biology Vol 10, page 165 Gene Ther Mol Biol Vol 10, 165-172, 2006

FLT3-ITD: technical approach and characterization of cases with double duplications Research Article

Emanuela Frascella*, Claudia Zampieron, Martina Piccoli, Francesca Intini, Giuseppe Basso Laboratory of Pediatric Hematology-Oncology Unit, Department of Pediatrics, University of Padova, Italy

__________________________________________________________________________________ *Correspondence: Emanuela Frascella, MD, PhD, Paediatric Haematology-Oncology Unit, Department of Paediatrics, University of Padova, via Giustiniani 3, 35128 Padova, Italy; Tel: +39-0498211455; Fax: +39-0498211462; e-mail: emanuela.frascella@unipd.it Key words: FLT3-ITD, AML, acrylamide, purification, mutant level Abbreviations: acute myeloid leukaemia, (AML); Internal Tandem Duplication, (ITD); tyrosine-kinase-receptor, (RTK) Received: 11 January 2006; Revised: 04 April 2006 Accepted: 18 May 2006; electronically published: May 2006

Summary FLT3-Internal Tandem Duplication (ITD) of the juxtamembrane domain is one of the most common genetic alterations in acute myeloid leukemia (AML) and in some FAB subgroups seems to represent an unfavorable prognostic factor. Thus, its correct identification is critical. We analyzed 261 AML cases to individuate FLT3-ITD

by RT-PCR and we compare different techniques (agarose and polyacrilamide gel electrophoresis, sequence and Genescan of PCR products) to define FLT3-ITD presence, length and number. All 53 positive cases were identified by electrophoresis on agarose gel. The sequence of the FLT3-ITD amplicons eluted from polyacrilamide gel was successfully performed while failing from agarose gel. We compared different methods of purifying PCR products from polyacrilamide gel to identify the fastest and most effective one. Genescan analysis was used to confirm the presence and the length of the ITD and to study the rate between ITD/WT transcripts. In our experience electrophoresis on 2% agarose gel is adequate for identifying FLT3-ITD, while purification from polyacrilamide gel is suggested for sequencing. In our series we found 20% of positive cases, 7.5% of these lacked FLT3 wild-type transcript and 13.2% showed two different FLT3-ITDs. In addition we identify 2 cases carrying 2 FLT3-ITD with the same length but different nucleotide sequence.

ligand-independent activation of the receptor and activation of a downstream signaling pathway. Some cases with both FLT3 alleles mutated and some lacking the residual wild-type allele have been described (Withman et al, 2001; Thiede et al, 2002). Patients with AML harboring FLT3-ITD mutations have a significantly greater relapse and many studies suggested that the presence of FLT3ITD is associated with poor clinical outcome in both pediatric and adult AML patients (Kottaridis et al, 2001; Schaniptger et al, 2002; Thiede et al, 2002). Recently there has been great interest in developing FLT3-inhibitors for therapeutic use and several molecules are currently under investigation (Stirewalt and Radich, 2003). Considering prognostic and therapeutic relevance of this mutation, the standardization of methods to study FLT3-ITD seems useful. In our study, we compare the efficiency of different techniques to define FLT3-ITD presence, length and number and analyzed by sequencing all ITD found. In

I. Introduction FLT3 is a member of the class III tyrosine-kinasereceptor-family (RTK) involved in differentiation, proliferation and apoptosis of hematopoietic cells. It is mainly expressed by early myeloid and lymphoid progenitor cells and is one of the most frequently mutated genes in Acute Myeloid Leukemia (AML). It has been detected in all AML FAB subtypes, with the highest reported frequency among M3 subtype (Rosnet et al, 1996; Abu-Duhier et al, 2001; Stirewalt and Radich, 2003). The most common type of mutation is an internal tandem duplication (ITD) of the juxtamembrane domain which is found in about 25% of AML (Stirewalt and Radich, 2003).

FLT3-ITD results from a head-to-tail duplication of 3-400 base pair in exons 14 or 15 which encode the juxtamembrane domain of FLT3; they are variable in length from patient to patient, but are always in frame (Schaniptger et al, 2002). These repeat sequences cause a

165

Frascella et al: FLT3-ITD: technical approach of NaAcetate 0.3 M pH 5.4 (100 µl) and cold absolute Ethanol (1 ml), hold at –20°C for 30 min and centrifuged at 15000 x g for 20 min at 4°C. The supernatant was decanted and the pellet was washed in Ethanol 70% and dried. DNA recovery from polyacrilamide gel with Ultrafree"-MC and Amicon# Microcoon# Centrifugal Filter Devices (Millipore, Billerica, MA, USA) was performed following manufacturer’s instructions.

Samples were dissolved in sterile water and 5 µl of eluted samples were re-amplified by PCR reactions in a 100 µl mixture using the same PCR primers and electrophoresed by 2% agarose gel. To evaluate the critical step of each method we mixed the two elution protocols in six different combinations (see results).

addition we identified a group of cases carrying more than one FLT3-ITD in which we analyzed the sequence of ITDs and the mutant level.

II. Materials and methods A. Patients We analyzed, retrospectively, bone marrow (BM) diagnostic samples, obtained after informed consent, in a series of 261 Italian children with AML, treated at AIEOP centers between 1988 and 1998 and whose RNA were available.

B. RNA extraction and RT-PCR method BM samples were centralized at diagnosis in the reference laboratory at the University of Padua. Nucleated cells were isolated by the Ficoll-Hypaque technique and frozen in liquid nitrogen. Total RNA was isolated using the RNAzol-B reagent (Tel-Test, Inc., Friendswood, TX, USA), dissolved in DEPc water and quantified with GeneQuant spectrophotometry (Pharmacia, Amersham Biosciences, Freiburg, Germany). 2 µg of total RNA were reverse transcribed using Superscript! II (Life Technologies, Invitrogen, Milan, Italy) and random hexamers.

A PCR with ABL specific primers was performed, in each sample, to assess the presence of intact RNA and amplifiable cDNA and to exclude the presence of genomic DNA. Forward and reverse ABL primers (CCT TCT CGC TGG ACC CAG TGA and TGT GAT TAT AGC CTA AGA CCC GGA G), were located in two distinct exons. The length of PCR products derived from mRNA and DNA were 127 bp and 691 bp, respectively. Forward and reverse primers used to amplify FLT3 transcript were GCAATTTAGGTATGAAAGCCAGC and CACCTGATCCTAGTACCTTCCCA. Also these primers were located between different exons: the length of the wild-type amplicon derived from mRNA was 155 bp whilst the amplicon derived from genomic DNA was 222 bp. In each assay a sample without nucleic acid were included to verify the absence of cross contamination. PCR amplification was performed using Amplitaq polymerase (Applied Biosystem, Monza, Italy) according to the BIOMED-1 protocol. PCR reaction products were electrophoresed through 2% agarose gel and 12,5% polyacrilamide gel, and then stained with ethidium bromide (Nakao et al, 1996; Kiyoi et al, 1997; van Dongen et al, 1999).

F. Genescan analysis and sequencing All positive samples and 20 negative samples were analysed on ABI Prism 310 Genetic Analyzer after a PCR reaction with FAM5’ labelled antisense-primer. PCR products were mixed with Genescan-500 Tamra Size Standards (Applied Biosystem, Monza, Italy) and analysed by capillar electrophoresis using POP 4 (Applied Biosystem, Monza, Italy)

by Genescan analysis software. The Genescan analysis software (Applied Biosystem, Monza, Italy) was used to quantify the areas under the curves that resulted from this analysis for FLT-ITD and FLT3 wild type transcripts. The level of FLT3-ITD was expressed as a percentage of total FLT3 (wild-type plus mutated). Positive sample were sequenced using BigDye™ Terminator mix and automated sequencer ABI Prism 310 Genetic Analyzer (Applied Biosystem, Monza, Italy), according to manufacturer’s instructions. Results of sequencing were analyzed by Chromas software and sequences were aligned with reference sequence (Z26652) by DotLET (http://www.isrec.isbsib.ch/java/dotlet/Dotlet.html) and BLAST (http://www.ncbi.nih.gov/BLAST/).

III. Results and discussion We found 53 out of 261 (20%) positive cases and 61 FLT3-ITD. All ITDs were identified using electrophoresis on 2% agarose gel in which they appeared as one or more amplicons longer than the expected product (Figure 1 A).

Due to scarce availability of material 2 cases were only analysed by electrophoresis on agarose gel. All the other PCR products were electrophoresed on 12.5% polyacrilamide gel to evaluate agarose gel sensitivity and specificity in showing shortest insertions: the presence of ITD was always confirmed and we did not identify any additional positive case. It is noteworthy that, on polyacrilamide gel, all positive cases showed a specific migration pattern, including two or more products with seemingly high molecular weight in addition to WT and ITD. These bands were cut and the PCR product was eluted: its re-amplification produced both WT and ITD transcripts (Figure 1, B1 and B2) showing that these bands contain heterodimers.

The sequence of PCR products extracted from agarose gel was successfully performed for the WT transcript, but failed for the ITD amplicons in which the re-amplification show both WT and ITD products (Figure1 A1). Instead the sequence of the products eluted from polyacrilamide gel was successfully carried out for both WT and ITD transcript (Figure1 B3).

In view of the fact that sequence and Genescan analysis is required to better characterize FLT3-ITD, we compared the efficiency of different techniques to purify PCR

C. Purification of PCR products PCR products were processed with NucleoSpin ® Extract 2 in 1 (M-Medical, Milan, Italy), Microcon YM Centrifugal Filter Device (Millipore, Billerica, MA, USA) and CENTRI-SEP COLUMNS (Princeton Separation, Adelphia, NJ, USA) following manufacturer’s instructions.

D. Purification of PCR products from agarose gel FLT3-ITD and FLT3-WT bands were cut and eluted from agarose gel with NucleoSpin ® Extract 2 in 1 and QIAquick PCR Purification KIT (Qiagen, Milano, Italy) following manufacturer’s instructions.

E. Purification of polyacrilamide gel

PCR products from

Bands were excised and eluted using two different methods. Classical method (Sambrook et al, 1989) with minor modification was used in our laboratory. Briefly, gel pieces were crushed and incubate, over night at 55°C, into microcentrifuge tube with 380 µl of elution buffer (10 mM Tris HCl pH 7.4, 0.1% SDS, 1 mM EDTA pH 8). Elution buffer were recovered, added

166

Gene Therapy and Molecular Biology Vol 10, page 167 products directly, from agarose and polyacrilamide gel, using different methods, buffers and columns. After purification, each sample was quantified by spectrophotometer to evaluate DNA recovery, reamplificated with same primers, and sequenced with different template concentrations. Results are illustrated in Table 1.DNA recovery percentage and sequence quality was equivalent in almost all methods used to purify amplicons directly or from agarose gel. On the contrary, we observed different results in processing samples from polyacrilamide gel. Re-amplification failed using products eluted by ethanol precipitation without further purification.

The two buffers used allowed a comparable DNA recovery, nevertheless the buffer with Tris-HCl required a longer incubation time than buffer with Na4+-acetate, and further salt addition for nucleic acid recovery. Ethanol precipitation needed a longer assay-time than purification by column.

We evaluated also the sequencing result after purification of PCR products. Preliminary experiments, using progressive amounts of template ranged from 10 to 80 ng, showed that better results were obtained with 25 ng of PCR product using the reverse primer (data not shown).

Sequencing was successfully performed after purification of PCR products and agarose gel, while, in several cases after elution from polyacrilamide gel an additional reamplification is required.

In our series FLT3-ITD was found in 53 out of 261 patients. Duplications ranging from 18 to 132 bp and involved the region between 1702 to 1857 nucleotides of the FLT3 reference sequence Z26652. We did not find any association between the region involved in the tandem

repeat and the different FAB subtype. All ITDs were inframe, according with other studies (Schaniptger et al, 2002; Thiede et al, 2002). In two cases ITD’s sequence contained a portion of the intron sequence and in 12 included an insertion range between 5 and 38 nt. In 4 patients, the analysis by agarose gel showed the lack of WT transcripts, however in 3 out of 4 electrophoresis by polyacrilamide gel showed a very weak band of WT FLT3 transcript. In these 3 cases Genescan analysis identified a little peak corresponding to the WT amplicon.

Seven cases show more than one ITD (Table 2). Five were identified by agarose gel and 2 (M167 and M380) only by polyacrilamide gel. For 6 out of 7 cases there were available material for sequencing and Genescan analysis.

FLT3-ITDs ranged from 21 to 99 bp, only one had an insertion of 6 bp. In 2 cases (M167 and M218) the ITDs involved different regions. In 2 cases (M375 and M380) there was a partial overlap and in the last 2 ones (M397 and M447) the shorter ITD involved a region completely included in the longer (Figure 2). Cases M167 and M380 had two ITDs with the same length but different sequences. These cases were identified by polyacrilamide gel and confirmed by sequencing, whilst when analyzed

by Genescan showed a unique peak (Figure 3, panel D).

In this group the total level of mutants detected ranged from 12.5% to 90.2%. In 3 cases the values were compatible with a heterozygous mutation in all or the majority of cells; in case M397 results suggested the lack of wild-type transcript, while in the other two cases data suggested the presence of mutation in a cell sub-clone.

Figure 1. Electrophoresis on agarose and polyacrilamide gels. Patients are identified by number. First line molecular weight markers.

Panel A: agarose gel. Panel A1: re-amplification after elution of ITD amplicon generates both ITD and wild-type products. Panel B: polyacrilamide gel. Panel B1 and B2: electrophoresis on agarose (B1) and polyacrilamide (B2) after elution and re-amplification of the amplicon with seemingly high molecular weight. The re-amplification generates both ITD and wild-type products. Panel B3: reamplification after elution of ITD amplicons generates only ITD product.

167

Frascella et al: FLT3-ITD: technical approach Table 1. Evaluation of different methods of PCR product purification. Assay-time, DNA recovery and quality of reamplification and sequence were evaluated for each method. PCR elution from polyacrilamide gel was performed using two different buffers: *Buffer 10 mM TRIS HCl pH 7.4, 0.1% SDS, 1 mM EDTA pH 8; ^Buffer 0.5 M NH4+ Acetate, 2 mM EDTA pH 8, 0.1% SDS.

Poliacrylammide gel

Agarose gel

PCR product

Source of amplicon

#

Purification Method

Assay Time

% DNA recovery

Re-amplification

1

No purification

0

100

+

2

Nucleospin Extract (M-Medical Cat. N. 740-590-250)

60 min

9

+

3

Microcon YM Centrifugal Filter Device (Millipore Cat N. 20 min 42413)

8

+

4

Centri-Sep Columns (Priceton Separations Cat. N. CS-901)

150 min

9

+

5

Nucleospin Extract (M-Medical Cat. N. 740-590-250)

90 min

11

+/-

6

QIAquick PCR purification Kit (Qiagen Cat. N. 28180)

120 min

8

+

7

Elution buffer with Tris-HCl*, Ultrafree–MC 0.45 µm 750 min (Millipore Cat N. UFC3 0HV 0S) for polyacrilamide residues

2

+

8

Elution buffer with Tris-HCl*, ethanol precipitation.

890 min

8

-

9

Elution buffer with Tris-HCl *, ethanol precipitation, 910 min purification with Microcon YM

2

+

10 Elution buffer with ammonium acetate^, ethanol precipitation 270 min

4

-

290 min

2

+

Elution buffer with ammonium acetate^, Ultrafree–MC 0.45 12 µm for polyacrilamide residues, purification with Microcon 155 min YM

4

+

11

Elution buffer with ammonium acetate^, precipitation, purification with Microcon YM

We analyzed also the level of each mutant in the 4 cases in which the internal tandem duplications were different in length. In two cases (M218 and M397) the strong difference of the mutant level suggested the presence of two different mutant clones. In the others we did not able to exclude a unique sub-clone in which the WT FLT3 transcript was lacked. In conclusions, in our experience electrophoresis on agarose 2% gel showed excellent sensitivity and specificity in the identification of the FLT3-ITD and shorter ITD were never found, even after capillary electrophoresis analysis. The use of polyacrilamide gel is suggested to isolate the ITD amplicons for sequencing, due to their strong propensity in forming heterodimers with the WT amplicon. Purification of PCR products is useful to sequence amplicons. Methods tested to purify PCR products directly or from agarose gel were equivalent. Thus, the method chosen could be based on cost and time-assay. On the contrary, purification from polyacrilamide can be very laborious and poorly effective: in our experience elution by Ultrafree-MC column with NH4+-acetate buffer, followed by a further purification by

Table 2. Cases with double FLT3-ITD N. Pts.

FLT3-ITD sequence

M167

1705-1725 1777-1797 1714-1779 1789-1812 not done not done

M218 M300 M375 M380 M397 M447

1798-1839 1786-1806 1768-1788 1777-1797 1738-1836 1774-1794 1756-1833 1798-1827

FLT3-ITD length (insertion) 21 21 66 24

42 (6 nt) 21 21 21 99 21 78 30

ethanol

Genescan analysis ITD/WT+ITD Unique peak 12.5% 12% 52% not done not done 27% 18.5% Unique peak 41% 86.5% 3.7% 13 % 13.5%

168

Gene Therapy and Molecular Biology Vol 10, page 169

Figure 2. Representation of the internal tandem duplication found ordered by sample. Colors identified different patients. Group 1 red and green. Group 2 orange and blue. Group 3 pink and yellow.

Figure 3. Upper: Sequence and scheme of 4 exemplificative samples. White-boxes: exons; black-boxes: tandem duplication; square-box: intron fragment. ITDs are highlighted in bolded character and are underlined together with the previous exonic similar sequence.

Lower: Genescan electropherograms of the same samples. Red line molecular weight markers, blue line PCR products. White arrows indicate wild-type amplicon peak, black arrows point to ITD peaks. Panel A: normal peripheral blood. Panel B: sample #400 with a 18 bp ITD. Panel C: sample #447 with two ITDs of 30 and 81 bp, respectively.

Panel D: sample #380. This sample had two ITD with the same length (21 bp) but Genescan analysis was not able to discriminate them. Panel E: sample #089 with a very small peak corresponding to the ITD.

169

Frascella et al: FLT3-ITD: technical approach Frascella E, Rondelli R, Pigazzi M, Zampieron C, Fagioli F, Favre C, Lippi AA, Locatelli F, Luciani M, Menna G, Micalizzi C, Rizzari C, Testi AM, Pession A, Basso G (2004) Clinical features of childhood acute myeloid leukaemia with specific geneRearrangements. Leukemia 18, 1427-1450.

Gaymes TJ, Mufti GJ, Rassool FV (2002) Myeloid leukemias have increased activity of the nonhomologous end joining pathway and concomitant DNA misrepair that is dependent on the Ku70/86 heterodimer. Cancer Res. 62: 2791-2797.

Kiyoi H, Naoe T, Yokota S, Nakao M, Minami S, Kuriyama K, Takeshita A, Saito K, Hasegawa S, Shimodaira S, Tamura J, Shimazaki C, Matsue K, Kobayashi H, Arima N, Suzuki R, Morishita H, Saito H, Ueda R, Ohno R (1997) Internal tandem duplication of the FLT3 associated with leukocytosis in acute promyelocytic leukemia. Leukemia Study Group of the Ministry of Health and welfare (Kohseisho). Leukemia 11, 1447-1452.

Kiyoi H, Towatari M, Yokota S, Hamaguchi M, Ohno R, Saito H, Naoe T (1998) Internal tandem duplication of the FLT3 gene is a novel modality of elongation mutation which causes constitutive activation of the product. Leukemia 12, 1333-1337.

Kottaridis PD, Gale RE, Frew ME, Harrison G, Langabeer SE, Belton AA, Walker H, Wheatley K, et al (2001) The presence of an internal tandem duplication in patients with acute myeloid leukemia (AML) adds important prognostic information to cytogenetic risk group and response to the first cycle of chemotherapy: analysis of 854 patients from the United Kingdom Medical Research Council AML 10 and 12 trials. Blood 98, 1752-1759.

Libura M, Asnafi V, Tu A, Delabesse E, Tigaud I, Cymbalista F, Bennaceur-Griscelli A, Villarese P, Solbu G, Hagemeijer A, Beldjord K, Hermine O, Macintyre E (2003) FLT3 and MLL intragenic abnormalities in AML reflect a common category of genotoxic stress. Blood 102, 2198-2204.

Nakao M, Yokota S, Iwai T, Kaneko H, Horiike S, Kashima K, Sonoda Y, Fujimoto T, Misawa S (1996) Internal tandem duplication of the flt3 gene found in acute myeloid leukemia.

Leukemia 10, 1911-1918.

Rosnet O, Buhring HJ, Marchetto S, Rappold I, Lavagna C, Sainty D, Arnoulet C, Chabannon C, Kanz L, Hannum C, Birnbaum D (1996) Human FLT3/FLK2 receptor tyrosine kinase is expressed at the surface of normal and malignant hematopoietic cells. Leukemia 10, 238-248.

Sambrook J, Fritsh EF, and Maniatis T (1989) Molecular Cloning, a laboratory manual. Cold Spring Harbor Laboratory Press, New York, USA. Schnittger S, Schoch C, Dugas M, Kern W, Staib P, Wuchter C, Loffler H, Sauerland CM, Serve H, Buchner T, Haferlach T, Hiddemann W (2002) Analysis of FLT3 length mutations in 1003 patients with acute myeloid leukemia: correlation to cytogenetics, FAB subtype, and prognosis in AMLCG study and usefulness as a marker for the detection of minimal residual disease. Blood 100, 59-66.

Stirewalt D and Radich JP (2003) The role of FLT3 in haematopoietic malignancies. Nat Rev Cancer 3, 650-665.

Thiede C, Steudel C, Mohr B, Schaich M, Schakel U, Platzbecker U, Wermke M, Bornhauser M, Ritter M, Neubauer A, Ehninger G, Illmer T (2002) Analysis of FLT3activating mutations in 979 patients with acute myelogenous leukemia: association with FAB subtype and identification of subgroups poor prognosis. Blood 99, 4326-4335. van Dongen JJ, Macintyre EA, Gabert JA, Delabesse E, Rossi V, Saglio G, Gottardi E, Rambaldi A, Dotti G, Griesinger F, Parreira A, Gameiro P, Diaz MG, Malec M, Langerak AW, San Miguel JF, Biondi A (1999) Standardized RT-PCR

Microcon-YM column, represents the most effective and fast method (Table 1 number 12).

The Genescan analysis allowed for the identification of normal and mutated transcripts even if present in very low amounts. In addition it allowed the study of mutant level.

In our series 20% of AML carried an FLT3-ITD and according with previous report all the internal tandem duplication found were in-frame. The high frequency of FLT3-ITD could be due to the retrospective nature of the study (Frascella et al. 2004) and the high number of acute promyelocytic leukaemia (52/261). In contrast with data regarding adult population (Withman et al, 2001), in our paediatric series the absence of the WT transcript seems to be very rare. In 3 out of 4 cases a low quantity of WT FLT3 transcript was found but we suppose that this small amount could originate from residual bone marrow normal cells.

Finally we individuate a subset of patients carrying more than one FLT3-ITD. Among these cases we identify 2 cases carrying two internal tandem duplications with the same length but different nucleotide sequence. These cases were discovered by polyacrilamide gel because the ITDs appeared as a unique band on agarose gel and as a unique peak with the Genescan analysis. It is to note that, in this group, only in one case the lack of WT FLT3 might suggest lost of heterozygosity or biallelic mutation. In these patients the structure of the couple of ITDs found could be classify in 3 group based on the region involved in the duplication: group 1- different ITDs (M167, M218); group 2 - partially overlapped ITDs (M375, M380); group 3 - completely overlapped ITDs, in which all the nucleotide involved in the shorter one are included also in the longer (M397, M447) (Figure 2). Until now no definitive hypothesis regarding FLT3-ITD origin exists.

Some authors suggested that binding sites for Topoisomerase II, identified in the region interested by duplication, could cause breaks to double strand of the DNA (Libura et al, 2003). These breaks are normally repaired by either non-homologous or homologous repair systems. In some AML a decreased efficiency of the nothomologous repair system has been reported (Gaymes et al, 2002; Zhong et al, 1999), and it could contribute to the creation of the FLT3-ITD in consequence of the loop formation, (Kiyoi et al, 1998). In our series we could hypothesize different mutation in group 1 patients cases while an evolution of the first mutation could be suggested in group 2 and 3 cases.

Acknowledgments We thank Dr C. Case for manuscript preparation.

This research was supported by Fondazione CittĂ della Speranza and AIL.

References Abu-Duhier FM, Goodeve AC, Wilson GA, Care RS, Peake IR, Reilly JT (2001) Genomic structure of human FLT3: implication for mutational analysis. Br J Haematol 113, 1076-1077.

170

Gene Therapy and Molecular Biology Vol 10, page 171 analysis of fusion gene transcripts from chromosome aberrations in acute leukemia for detection of minimal residual disease. Report of the BIOMED-1 Concerted Action: investigation of minimal residual disease in acute leukemia Leukemia 13, 1901-1928 Whitman SP, Archer KJ, Feng L, Baldus C, Becknell B, Carlson BD, Carroll AJ, Mrozek K, Vardiman JW, George SL, Kolitz JE, Larson RA, Bloomfield CD, Caligiuri MA (2001)

Absence of the wild type allele predicts poor prognosis in adult de novo acute myeloid leukemia with normal cytogenetics and internal tandem duplication of FLT3: a cancer and leukemia group B study. Cancer Res 61, 72337239.

Zhong S, Hu P, Ye TZ, Stan R, Ellis NA, Pandolfi PP (1999) A role for PML and the nuclear body in genomic stability.

Oncogene 18, 7941-7947.

From the top to the bottom and from the left to right: Emanuela Frascella, Claudia Zampieron, Martina Piccoli, Francesca Intini, Giuseppe Basso

171

Frascella et al: FLT3-ITD: technical approach

172

Gene Therapy and Molecular Biology Vol 10, page 173 Gene Ther Mol Biol Vol 10, 173-178, 2006

The Human VG5Q Gene Transcript is Over Expressed in Colorectal and Bladder Carcinomas Research Article

Mutaz Akkawi1, Ibrahim Abbasi1, Abraham Hochberg2, Ofer N. Gofrit2, Hassan Dweik1, Imad J. Matouk1,2,* 1

Faculty of Science and Technology, Al-Quds University, Abu-Dis, Jerusalem The Department of Biological Chemistry, Alexander Silberman Institute of life Science, The Hebrew University of Jerusalem 2

__________________________________________________________________________________ *Correspondence: Imad J. Matouk, Department of Biology, Faculty of Science and Technology, Alquds University, Abu-DisJerusalem and Silberman Institute of Life Science, Hebrew University, Jerusalem-Israel; Fax: 972-2-561-0250; e-mail: imatook@cc.huji.ac.il Key words: Colorectal and bladder carcinomas; VG5Q; Tumor marker; Cancer grade; Primary and secondary growth Abbreviations: human umbilical vein endothelial cells, (HUVECS); klippel-trenaunay syndrome;, (KTS); reverse transcriptase polymerase chain reaction, (RT-PCR); TNF-related weak inducer of apoptosis, (TWEAK); tumor necrosis factor (ligand) superfamily, member 12, (TNFSF12); vascular endothelial growth factor, (VGEF); vasculogenesis gene on 5q, (VG5Q) Received: 15 June 2006; Accepted: 20 June 2006; electronically published: July 2006

Summary We studied the pattern of the human VG5Q (AGGF1) mRNA expression in both normal and noeplastic colorectal and bladder tissues. VG5Q mRNA was detected by RT-PCR technique. VG5Q is weekly expressed in the majority of normal cases (n=12). Seven of eight colorectal carcinomas (87.5%) overexpressed VG5Q mRNA when compared to their corresponding normal colorectal tissues of the same patient. The level of VG5Q expression in primary tumor is also upregulated in (75%) of the cases when compared to their corresponding liver metastasis. No consistent relationship in the expression level of VG5Q could be deduced when comparing normal colorectal samples to their liver metastasis colorectal tumors. Comparing 4 normal bladder and 16 bladder carcinomas samples reveal that VG5Q expression is also upregulated in bladder carcinomas. The level of VG5Q expression is more frequently upregulated in low grade when compared to high grade bladder carcinomas. These are the first results indicating the association of the newly discovered VG5Q gene transcript with human colorectal and bladder carcinomas. Further studies are needed to evaluate the usage of VG5Q as a complementary histopathologic and a candidate tumor marker among other modalities in both and other types of cancers.

probably by interacting with the C-terminal domain of TWEAK (also known as TNFSF12) (Tian et al, 2004).

VG5Q colocolizes with TWEAK around the nuclei in HUVECS cultured on plastic dishes. When endothelial tube formation is induced in matrigel, VG5Q and TWEAK moved to the cell surface, and VG5Q detected also outside of cells. Purified wild type VG5Q protein promoted strong angiogenesis in a chick chorioallantoic membrane assay, demonstrating that VG5Q is a potent angiogenic factor. It can bind to endothelial cells and promotes cell proliferation, suggesting that the protein may act in an autocrine fashion. VG5Q shows strong expression in blood vessels and is secreted when vessel formation is initiated. Furthermore, VG5Q was detected in human umbilical vein endothelial cells (HUVECs), human heart fibroblast (HHF) and ovarian cancer cells (OV-3), but low

I. Introduction In the past decade, the field of angiogenesis has greatly widened with the discovery of new factors having either angiogenic or anti-angiogenic activities.

Angiogenesis plays a central role in ovulation, implantation of the fertilized ovum, fetal growth and gestation, wound healing and repair following surgery and trauma (Carmeliet, 2005). In many serious disease states, the body loses control over angiogenesis. Excessive angiogenesis occurs in cancer, age-related macular degeneration, rheumatoid arthritis and many other pathological conditions (Carmeliet and Jian, 2000).

VG5Q is a newly discovered angiogenic factor (Tian et al, 2004). Its physiological properties resemble those of the VEGF, but mediate distinct downstream events,

173

Akkawi et al: Positive association between AGGF1 overexpression with colorectal and bladder carcinomas GTCCCCAAGCCTGCATGTGTT-3'), as described by Tian et al. (2004). The PCR products were electrophorized on 2% agarose containing ethedium bromide dye.

expression was detected in kidney cancer cells (RP-45), HeLa cells and bladder cancer cells. VG5Q was ubiquitously expressed in human tissues examined, including heart, brain, placenta, lung, liver, skeletal muscle, kidney, and pancreas. The VG5Q gene was identified at the 5q13.3 breakpoint of a translocation t(5;11)(q13.3;p15.1) (Tian et al, 2004).

Defects in VG5Q associated with its overexpression, and through mutation render its protein hyperactive are a cause of klippel-trenaunay syndrome (KTS). KTS is a congenital disease characterized by malformations of capillary, venous and lymphatic vessels. Susceptibility to vascular defects typical of KTS is increased either by higher expression of the gene due to chromosomal translocation, or by a mutant protein which is assumed to be hyperactive (Tian et al, 2004).

The association and probably contribution of VG5Q gene product in cancer progression and metastasis is not studied yet, nor do its upstream and its downstream effectors identified. It is the aim of our study to investigate whether VG5Q is differentially expressed in normal and neoplastic states of colorectal and bladder carcinomas. We report here for the first time that the expression level of VG5Q is elevated in primary colorectal carcinomas when either compared to normal tissue or secondary growth tumor that metastasizes to the liver. Moreover, VG5Q is overexpressed in bladder carcinomas when compared to normal bladder tissues. The level of VG5Q overexpression is more frequent in low grade tumor of the bladder when compared to high grade.

Moreover we found that the expression level of VG5Q mRNA is not induced when bladder carcinoma (T24P) and hepatocellular carcinoma (Hep3B) cell lines are exposed to hypoxic stress conditions under different culture confluences.

C. Hypoxic condition Hep3B cells (Hepatocellular carcinoma) and T24P cells (Bladder carcinoma) were seeded in 5 ml medium flasks at different conflencies 24 hours pre-treatment. Cells were either placed into Aneoropack rectangular jar (Mitsubishi chemical company Japan) to create a hypoxic conditions within an hour (1% O2, 20% CO2), or left into normal oxygen concentration.

Incubation lasted for 24 hours before RNA extraction.

D. Specimens Normal, primary tumor samples from the ceacum and the sigmoid colon and colon, and their corresponding liver metastasis were obtained fresh from surgery from eight patients, and immediately transferred snap frozen in liquid nitrogen, and stored at -80 °C for later RNA extraction. Histological grading was performed on the biopsies by two pathologists who were unaware of our experimental design. Low grade bladder carcinomas used in this study are of grade 1, while those of high grade are of grade 3, according to modern grading classification of bladder cancer (Epstein et al, 1998). All are classified as transitional cell carcinomas of the bladder.

III. Results and discussion The mechanisms by which the growing tumor tissue recruits new blood vessels has been the subject of intense investigations over the last few years as the acquisition of a functional blood supply seems to be rate-limiting for the ability of a tumor to grow beyond a certain size and to metastasize to other sites. High proliferating tumors frequently outstrip their vascular supply leading to a tumor microenvironment characterized by low oxygen tension, low glucose levels, and an acidic pH (Folkman, 1992; Ellis and Fidler, 1996; Hanahan and Folkman, 1996). Hypoxia is a common feature of solid tumor growth. Reduced pO2 levels have been found in the majority of human tumors analyzed compared with normal tissue of the corresponding organ (Brown and Giaccia, 1998; Vaupel et al, 1989). A wide range of genes known to be involved in adaptive mechanisms to hypoxia, such as those coding for angiogenic growth factors, enzymes of glucose metabolism, and pH regulation, have classically been associated with tumors. (Semenza, 1998).

Based on this reasoning we studied if VG5Q is a responsive gene to hypoxic stress. Hepatocelluar (Hep3B) and bladder carcinoma (T24P) cell lines were exposed to hypoxic stress under different culture confluences. As shown in (Figure 1) hypoxic stress does not affect the expression level of VG5Q mRNA in both cell lines tested even at different confluences. The integrity of the RNA samples was verified by performing a PCR for GADPH housekeeping gene which showed no differences between samples (data not shown). These negative results could indicate that VG5Q promoter does not contain consensus sequence to specific transcription factors involved in hypoxic stress response. However, possibilities of other types of regulation are still possible namely protein stability, activity and secretion.

II. Materials and methods A. Cell culture All the human carcinoma cell lines used in this study were obtained from the American type culture collection (Manassas, VA) and were maintained in DMEM-F12 (1:1) medium containing 10% fetal calf serum (inactivated 55 oC for 30 min), 25 mM HEPES (pH 7.4), penicillin (180 units/ml), streptomycin (100 !g/ml) and amphotericin B (0.2 !g /ml). Approximately 4x104 cells/cm 2 were plated in polystyrene culture dishes (NUNC). Every 4 days, the cells were trypsinized with 0.05% trypsin-EDTA solution (Biet Haemek) for 10 min and re-plated again at the same initial densities.

B. Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) Total RNA was extracted from cultured cell lines, and patient specimens using the TRI REAGENT (Sigma) according to the manufacturer’s instructions and treated with DNase I to exclude genomic DNA contamination. The synthesis of cDNA was performed using the p(dT)15 primer (Roche, Germany), to initiate reverse transcription of 2!g total RNA with 400 units of Reverse Transcriptase (Gibco BRL), according to manufacturer's instructions. The PCR reaction was carried out with peQLab Taq-polymerase for 29 cycles (94 °C for 1 min, 52 °C for 45s, and 72 °C for 45s) preceded by 94 °C for 5 min, and a final extension of 5 min at 72°C. The primers used in the PCR reaction were (5'-ACGTACTTGAGCATGGAGATG-3') and (5'-

174

Gene Therapy and Molecular Biology Vol 10, page 175

Figure 1. The effect of hypoxia on the expression level of VG5Q mRNA in Hep3B and T24P cell lines seeded at different confluences: Hep3B and T24P cells were cultured in normal medium conditions for 24 hours at different confluences before hypoxic manipulation. Shown are RT- PCR products for VG5Qin Hep3B cells (1-4), and T24P cells (5-8). C= PCR blank. 1, 2, 5, 6 (Hep3B and T24P cultured at low confluences and grow in normal (1, 6) and hypoxic (2, 7) conditions respectively. 3, 4 7, 8 (Hep3B and T24P cultured at high confluences and grow in normal (4, 7) and hypoxic (5, 8) conditions respectively. Hypoxic manipulation lasted for 24 hours.

Colorectal cancer is one of the most common types of cancer in both men and women. About 6 per cent of the populations in Western countries develop bowel cancer at some time during their lives, making this the second commonest cause of cancer-related death. Approximately 50% of patients diagnosed with colorectal cancer die within 5 years from diagnosis. Prevention and early detection of colorectal cancer will improve the patients’ chance of survival dramatically. Altogether, new models based on a deeper molecular understanding of the disease are required to improve screening, diagnosis, treatment, and, ultimately, survival (Bertario et al, 1999).

The clinical value of angiogenesis-related factors as a tumor marker is well established (Sund et al, 2005; Zlobec et al, 2005). In our present study, we explored the status of VG5Q expression in normal versus neoplastic tissues. So we next checked if VG5Q is differentially expressed in normal versus cancer tissues taken from the same patient in colorectal cancer. VG5Q expression levels were assessed by semi-quantitative reverse transcriptase polymerase chain reaction. Samples of colorectal cancers (primary growth) and cancer that metastasize to the liver (secondary growth), and their normal counterpart tissue taken adjacent to cancer primary site from the same patient were analyzed for VG5Q expression. Results show that VG5Q mRNA is upregulated in primary colorectal cancer relative to the normal in seven out of eight samples (87.5%) (Figure 2a, b). The status of VG5Q expression in primary tumors does not correlate with its expression in liver metastasic tumors. The level of VG5Q expression in primary tumor is also upregulated in (75%) of the cases when compared to their corresponding liver metastasis.

(Figure 2a, b).

No consistent relationship in the expression level of VG5Q could be deduced when comparing normal colorectal samples to their liver metastasis colorectal tumors. (Figure 2a, b).

A number of disparities between the characteristics of primary tumor tissue and that of metastatic disease have been described suggesting that metastatic tumors are biologically distinct from the primary tumors from which they arose (Agui et al, 2002). Although angiogenesis is needed to sustain growth of primary and metastatic lesions, comparison of microvessel density between

primary colorectal cancers and their liver metastases revealed that angiogenesis scores were significantly lower in metastatic lesions compared with their primary tumors (Mooteri et al, 1996). Moreover, the level of VEGF expression may be site specific in patients with metastatic disease, with decreased expression noted in liver metastases relative to primary tumors and abdominal metastases (Berney et al, 1998; Cascinu et al, 2000).

Similar results were obtained for VEGFR2, where decreased VEGFR-2 expression was documented in hepatic metastasis compared to primary colon tumors.

This could explain why, in our case, the level of VG5Q expression in primary colorectal carcinomas is elevated when compared to their corresponding liver metastases. It was reported that the primary tumor produces a potent antiangiogenic factor, which prevented vascularization and thereby outgrowth of metastasis (O’Reilly et al, 1994; Sckell et al, 1998). The suppression of secondary tumor growth by its primary tumor via inhibition of angiogenesis is a widely accepted phenomenom not only in animal models, but also in human cancer patients (Peeters et al, 2004). Thus in our case we speculate that endogenous inhibitor could be secreted from primary colorectal tumor to suppress the expression of VG5Q angiogenic factor and others in its liver metastatic tumor.

We also checked if VG5Q mRNA expression is elevated in bladder carcinomas and associated with tumor grade. Bladder cancer is the fourth most common malignancy in men, and the eighth most common cause of death from cancer. More than 90% of bladder tumors are urothelial carcinomas. At the time of initial diagnosis, approximately 80% of urothelial carcinomas are confined to the epithelium (pTa, CIS) or lamina propria (pT1), whereas the remaining 20% invade the muscularis propria (pT2, pT3, pT4). Our finding that VG5Q expression is more abundant in low grade bladder carcinoma. pTa tumors are the commonest type of primary bladder tumor.

These tumors rarely progress but recur in more than 50% of cases. Because most of these tumors show VG5Q overexpression, the detection of such changes may provide an accurate additional means of follow-up and identification of tumor recurrences. This could be especially useful for low-grade lesions, which are difficult to detect by urine cytology and which harbor VG5Q 175

Akkawi et al: Positive association between AGGF1 overexpression with colorectal and bladder carcinomas overexpression in all of cases tested as shown in (Figure 3).

Figure 2. VG5Q transcript is differentially expressed in primary colorectal carcinomas when compared to their normal and corresponding liver metastasis. Normal, primary tumor and their corresponding liver metastasis biopsies from the ceacum and the sigmoid colon (A) and colon (B), were obtained fresh from surgery, and immediately transferred snap frozen in liquid nitrogen, and stored at -80 °C for later RNA extraction. RNA extraction and subsequent RT-PCR analysis for VG5Q was performed as described in ‘materials and methods’. Shown is the PCR product of VG5Q in 6 patients of sigmoid colon (A P1-P4), and caecum (A P5-P6). 1Primary cancer, 2-corresponding liver metastasis, 3-Normal. (B)-The expression level of VG5Q in two other patients (Patient 1, 2) of colon carcinomas 1- Normal, 2- Primary cancer, 3- corresponding liver metastasis. M= 100 Bp molecular weight marker. The PCR products were electrophorized on 2% agarose containing ethedium bromide dye.

Figure 3. VG5Q transcript is elevated in bladder carcinomas when compared to normal bladder with a more pronounced expression in low grade carcinomas. Total RNA from normal, low grade bladder carcinomas (grade 1), high grade bladder carcinomas (grade 3) biopsies were obtained and handled as described and subjected to RT-PCR analysis for VG5Q. Shown is the PCR product for VG5Q in 4 normal specimens (A, 1-4), 7 low grade carcinomas (A, 5-11), and 9 high grade carcinomas (B). C is a PCR blank and M=100Bp molecular weight marker.

176

Gene Therapy and Molecular Biology Vol 10, page 177 treatment with VEGF inhibitors. Clin Exp Metastasis 18, 651-55.

Ellis LM, Fidler IJ (1996) Angiogenesis and metastasis. Eur J Cancer 32A, 2451-60.

Epstein JI, Amin MB' Reuter VR (1998) The world health organization/International society of urological pathology consensus classification of urothelial (transitional cell) neoplasms of the urinary bladder. Bladder consensus conference committee. Am J Surg Pathol 22, 1435-48.

Folkman J (1992) The role of angiogenesis in tumor growth.

Semin Cancer Biol 3, 65-71.

Hanahan D, Folkman J (1996) Pattern and emerging mechanisms of the angiogenic switch during tumorigenesis. Cell 86, 35364.

Mooteri S, Rubin D, Leurgans S, Jakate S, Drab E, Saclarides T (1996) Tumor angiogenesis in primary and metastatic colorectal cancers. Dis Colon Rectum 10, 1073-1080.

O'Reilly MS, Holmgren L, Shing Y, Chen C, Rosenthal RA, Moses M, Lane WS, Cao Y, Sage EH, Folkman J (1994) Engiostatin: a novel angiogenesis inhibitor that mediates the suppression of metastasis by a Lewis lung carcinoma. Cell 79, 315-28.

Peeters CF, Westphal JR, de Waal RM, Ruiter DJ, Wobbes T, Ruers TJ (2004) Vascular density in colorectal liver metastasis increases after removal of the primary tumor in human cancer patients. Int J Cancer 112, 554-59.

Sckell A, Safabakhsh N, Dellian M, Jian RK (1998) Primary tumor size- dependent inhibition of angiogenesis at a secondary site: an intravital microscopic study in mice.

Cancer Res 58, 5866-9.

Semenza GL (1998) Hypoxia inducible factor: master regulator of O2 homeostasis. Curr Opin Genet Dev 8, 588-94.

Sund M, Zeisberg M, Kalluri R (2005) Endogenous stimulators and inhibitors of angiogenesis in gastrointestinal cancers: basic science to clinical application. Gastroenterology 129, 20761-91.

Tian XL, Kadaba R, You SA, Liu M, Timur AA, Yang L, Chen Q, Szafranski P, Rao S, Wu L, Housman DE, DiCorleto PE, Driscoll DJ, Borrow J, Wang Q (2004) Identification of an angiogenic factor that when mutated causes susceptibility to Klippel-Trenaunay syndrome. Nature 427:640-45.

Vaupel P, Kallinowski F, Okunieff P (1989) Blood flow, oxygen and nutrient supply, and metabolic microenvironment of human tumors: a review. Cancer Res 49, 6449-65.

Zlobec I, Steele R, Compton CC (2005) VEGF as a predictive marker of rectal tumor response to preoperative radiotherapy.

Cancer 104, 2517-21.

To the best of our knowledge, this is the first report that studied pattern of VG5Q expression in normal, primary cancer, and secondary cancer growth, in colorectal cancers, and studied its expression in normal bladder and bladder cancers at different grades. Future studies are required to further elucidate the biological function of VG5Q, especially its role in the tumorigenic process, and to evaluate its diagnostic and prognostic value in larger number of specimens and different tumor types.

Acknowledgments We are very grateful to Dr. Offer Gofrit (Hadassah medical hospital) for providing us with the patient samples used to perform this study.

This work was supported by funds of DFG (Deutsche Forschungs gemeinschaft) SA 7772/6-1 and is gratefully acknowledged.

References Agui T, McConkey DJ, Tanigawa N (2002) Comparative study of various biological parameters, including expression of survivin, between primary and metastatic human colonic adenocarcinomas. Anticancer Res 22, 1769-76.

Berney CR, Yang JL, Fisher RJ (1998) Vascular endothelial growth factor expression is reduced in liver metastasis from colorectal cancer and correlates with urokinase-type plasminogen activator. Anticancer Res 18, 973-77.

Bertario L, Russo A, Sala P, Eboli M, Radice P, Presciuttini S, Andreola S, Rodriguez-Bigas MA, Pizzetti P, Spinelli P (1999) Survival of patients with hereditary colorectal cancer: Comparison of hnpcc and colorectal cancer in fap patients with sporadic colorectal cancer. Int J Cancer 80, 183-87.

Brown JM, Giaccia AJ (1998) The unique physiology of solid tumors: opportunities (and problems) for cancer therapy.

Cancer Res 58, 1408-16.

Carmeliet P (2005) Angiogenesis in life, disease and medicine.

Nature 438, 932-36.

Carmeliet P, Jian PK (2000) Angiogenesis in cancer and other diseases. Nature 407, 249-57.

Cascinu S, Graziano F, Catalano V, Staccioli MP, Barni S, Giordani P, Rossi MC, Baldelli AM, Muretto P, Valenti A, Catalano G (2000) Differences of vascular endothelial growth factor (VEGF) expression between liver and abdominal metastases from colon cancer. Implications for the

177

Akkawi et al: Positive association between AGGF1 overexpression with colorectal and bladder carcinomas

178

Gene Therapy and Molecular Biology Vol 10, page 179 Gene Ther Mol Biol Vol 10, 179-184, 2006

Title-loss of !catenin is an independent prognostic factor in ovarian carcinomas: A multivariate analysis Research Article

Cristina Faleiro-Rodrigues1,*, Isabel Macedo-Pinto1, Deolinda Pereira2 1

Department of Anatomy and Pathology Department of Medical Oncology, Portuguese Institute of Oncology of Francisco Gentil, Centro Regional do Norte, Porto, Portugal 2

__________________________________________________________________________________ *Correspondence: Faleiro-Rodrigues C., Instituto Portugu锚s de Oncologia Francisco Gentil, Centro Regional do Norte, Departamento de Anatomia Patol贸gica, Rua Dr. Ant贸nio Bernardino de Almeida4200-072 Porto, Portugal; Telephone: +351-22-5084000 Ext 1002; Fax +351-22-5084001; e-mail: cristinafaleiro@mail.com Key words: ovarian cancer, cell adhesion, epithelial cadherin, !-catenin, immunohistochemistry Abbreviations: avidin-biotin peroxidase, (ABC); E-cadherin catenin unit, (ECCU); Epithelial cadherin, (E-cadherin); International Federation of Gynaecology and Obstetrics system, (FIGO); Overall survival, (OS); World Health Organization, (WHO) Received: 10 March 2006; Revised: 26 April 2006 Accepted: 16 May 2006; electronically published: July 2006

Summary In ovarian carcinomas, numerous studies have shown consistent prognostic significance of FIGO stage and residual tumour as independent prognostic factors. However, these prognostic factors alone cannot accurately predict disease outcome since a considerable degree of heterogeneity remains within the various subgroups limiting the predictive value of these factors. Therefore, the identification of new molecular markers that may possibly distinguish patients at a higher risk is of great importance. In two previous studies, the individual loss of E-cadherin and the individual loss of !-catenin were important prognostic factors of poorer overall survival in patients with ovarian carcinomas. Purpose of the present study was to re-analyse the immunohistochemical expression of Ecadherin and !-catenin in 104 patients with ovarian carcinomas, and evaluate whether these two proteins continue to be important independent prognostic factors when assessed together in a multivariate Cox麓s proportional hazard regression analysis. Results In the multivariate analysis, the most important independent prognostic factors of poorer overall survival were loss of !-catenin expression ([HR], 5.79, 95% CI, 2.38 to 14.10; P=0.0001), FIGO stage IV ([HR], 7.19, 95% CI, 1.02 to 50.8; P=0.04) and residual tumour ([HR], 6.78, 95% CI, 1.41 to 32.56; P=0.034).

Conclusion The loss of !-catenin expression is a stronger prognostic factor than E-cadherin. The findings in the present study and previously reported data suggest that !-catenin is a significant prognostic indicator in patients with epithelial ovarian cancer, however, these results should be supported by more and larger studies.

adhesion and epithelial tissue integrity. The intracellular domain of E-cadherin is found in a complex linked with the catenins ("-and !-). The association of catenins to cadherins is a key step in the function of intact adhesion complexes. The catenins link the cadherin molecules to the cytoskeleton and mediate signal transduction mechanisms that regulate cell adhesion, growth and differentiation (Frixen et al, 1991; Tsukita et al, 1992; Kemler, 1993; Hinck et al, 1994). Detachment of tumour cells from the primary lesion is considered a main step in the process of invasion and metastases. Increasing evidence points to a role for E-cadherin and the catenins in cancer progression since the loss or reduced expression of E-cadherin and !-

I. Introduction In ovarian carcinomas, numerous studies have shown consistent prognostic significance of FIGO tumour stage and size of residual tumour as independent prognostic factors (Rubin et al, 2003). However, these prognostic factors alone cannot accurately predict disease outcome since a considerable degree of heterogeneity remains within the various subgroups limiting the predictive value of these factors. Therefore, the identification of new molecular markers that may possibly distinguish patients at a higher risk is of great importance. Epithelial cadherin (E-cadherin) is a calcium-dependent cell adhesion molecule which plays a key role in cell-cell epithelial

179

Faleiro-Rodrigues et al: Loss of ! catenin expression in primary ovarian carcinomas without previous knowledge of the patients clinicopathological details. E-cadherin and !-catenin immunoexpression in the tumours was scored semi-quantitatively on a scale of 0 to 3 (0=complete absence of expression, 1=10%, 2 >10 and = 50%, 3 >50%). For all the association analyses, the subdivision into negative (0 scale) and positive expression (1-3 scale) was used.

catenin correlates with invasive behaviour, increased lymph node metastasis and poor outcome in patients with malignant melanoma and gastric carcinomas (Jawhari et al, 1997; Ramesh et al, 1999; Kageshita et al, 2001; Tanaka et al, 2002). In two previous individual studies, a significant correlation between poor overall survival and the loss of E-cadherin and the loss of !-catenin was observed in patients with ovarian carcinomas. The loss of E-cadherin and !-catenin immunoexpression was also shown to be independent predictors of poorer survival in a multivariate analysis (Faleiro-Rodrigues et al 2004a, b).

This study represents a re-analyse of previously published data with the purpose of determining whether these two proteins continue to be important independent prognostic factors when assessed together in a multivariate Cox‚s proportional hazard regression analysis.

D. Statistical analysis The statistical software used was the Statistical Package for the Social Sciences (SPSS version 8.0, SPSS, Chicago). Clinical data was obtained from the Cancer Registry Records of the patients and evaluated by a Medical Oncologist. Overall survival (OS) was defined as the time from diagnosis to death or last clinical control date, and used as a measure of prognosis.

Univariate survival curves were estimated using the KaplanMeier method and compared using the Log-rank or the Breslow test. Multivariate analysis was performed using the Cox´s proportional hazards regression model with overall survival as the outcome measure. Forward stepwise procedure was used to select the independent variables in the multivariate analysis.

Forward selection, allows variables to be considered one at a time for entry into the model. After a variable is added to the model, all variables already in the model are examined for removal. The algorithm stops when no more variables meet entry or removal criteria. A value of P<0.05 was regarded as significant.

II. Material and Methods Routinely formalin-fixed and paraffin-embedded tissue samples from 104 cases of primary ovarian carcinomas were retrieved from the Department of Pathology at the Portuguese Institute of Oncology of Francisco Gentil, Porto, from January 1995 to December 1999. The mean age at the time of diagnosis was 56 years (range, 21 to 89 years). None of these patients had undergone neoadjuvant chemotherapy prior to surgery. All tissue specimens were reviewed and re-evaluated by an experienced gynaecological pathologist. Histological classification was performed according to the World Health Organization (WHO) standards. The grading and staging of the tumours were assigned according to the International Federation of Gynaecology and Obstetrics system (FIGO). The mean overall survival duration of the patients was 35 months. At the end of the follow-up period, 65 (62%) patients were without evidence of disease, 35 (34%) patients had died of disease, and 4 (4%) patients were lost for follow up.

III. Results The present series consisted of 104 carcinomas that were classified into the following histological types, 56 serous carcinomas, 22 mucinous carcinomas, 16 clear cell carcinomas, 8 endometrioid and 2 transitional cell carcinomas. These carcinomas were graded into 26 welldifferentiated, 27 moderately differentiated and 51 poorly differentiated tumours. In this series, 31 cases were diagnosed with FIGO stage I tumours, 7 in FIGO stage II, 47 in FIGO stage III and 19 in FIGO stage IV. The clinicopathological parameters studied were FIGO staging, histological type, tumour differentiation, peritoneal metastasis, and residual tumour after surgery, the appearance of the ovarian capsule, peritoneal cytology and lymphatic/vascular invasion (previously described in Faleiro-Rodrigues et al 2004a).

A. Tissue sections All the tissue sections (stained by haematoxylin and eosin) from each case were observed. Areas of necrosis or deterioration of tissue morphology were avoided. The pathologist selected the best tumour section representing well preserved tissue architecture and cell morphology with approximately 2.0 x 1.0 cm.

A. Immunoreactivity of E-cadherin and !-catenin in carcinoma tissue

B. Immunohistochemical staining Archival tissue was fixed in 10% formalin and 3 Âľm sections were used for both histological and immunohistochemical studies. Immunohistochemistry was performed in all cases using the avidin-biotin peroxidase (ABC) complex with an additional step for microwave antigen retrieval as described (Faleiro-Rodrigues et al, 2004b). The following monoclonal antibodies were used: E-cadherin (C20820), and !catenin (C19220) (Transduction Laboratories, Lexington, UK).

To ensure accurate and reproducible staining, normal skin epithelium was used as a positive control.

Staining of E-cadherin and !-catenin was localized on the cell membrane of epithelial cells, particularly at areas of cell-tocell contact. Normal skin epithelium without the primary antibody was used as a negative control.

Negative E-cadherin expression was observed in 7 (7%) malignant tumours, and positive in 97 (93%).

Negative !-catenin expression was observed in 15 (14%) malignant tumours, and positive in 89 (86%).

B. Relationship between E-cadherin and !-catenin expression in carcinoma tissue In the 15 carcinomas demonstrating negative expression for !-catenin, 3 carcinomas showed negative expression for E-cadherin, and 12 carcinomas showed positive expression for E-cadherin (Table 1).

C. Evaluation of E-cadherin and ! -catenin immunostaining

C. Relationship between the expression of E-cadherin and !-catenin and patient overall survival

Membranous immunoreactivity of the catenins was assessed by light microscopy by two independent observers,

180

Gene Therapy and Molecular Biology Vol 10, page 181 In the univariate survival analysis, patients whose carcinoma tissue demonstrated negative E-cadherin expression had a statistically significant decreased 5-year overall survival rate compared with patients showing positive expression (29% versus 66%, P=0.006), (FaleiroRodrigues et al, 2004a). Patients whose carcinoma tissue demonstrated negative !-catenin expression had a statistically significant decreased 5-year overall survival rate compared with patients showing positive expression (44% versus 66%, P=0.022), (Faleiro-Rodrigues et al, 2004b).

The parameters that had a significant impact on overall survival as E-cadherin (P=0.006), !-catenin (P=0.022), FIGO stage (P!0.0001), peritoneal metastasis (P!0.0001), and post-operative residual tumour (P!0.0001), peritoneal cytology (P!0.0001) and lymphatic/vascular invasion (P=0.008), were then reviewed by a multivariate analysis (Cox´s proportional hazards regression model, Table 2). Negative expression of !-catenin (P=0.0001); (Figure 1), FIGO stage IV (P=0.04) and residual postoperative tumour (P=0.01) were shown to associate significantly with poor patient prognosis.

disease in advanced tumour stages with widespread metastatic disease at the time of diagnosis (Ozols et al, 2000). To date, the molecular mechanisms that allow ovarian cancer cells to detach from the primary tumour and consequently interact with the mesothelium are not fully characterized.

Cell adhesion molecules may play an important role in epithelial ovarian carcinogenesis, since cell-to-cell adhesion plays a critical role in a wide variety of biological processes including embryogenesis, maintenance of cell polarity, cell growth, and cell differentiation (Skubitz, 2002). The loss of cell adhesion molecules may lead to changes in cellular adhesion and to increased motility, processes that contribute to the invasive and/or metastatic potential of cells (Vleiminckx et al, 1991; Birchmeier and Behrens, 1993; Mareel et al, 1994; Van Aken et al, 2001).

E-cadherin has been identified as an important transmembrane molecule involved in the adhesion of epithelial cells at adherens junctions. Adherens junctions are organized around transmembrane proteins of the cadherin family. While the extracellular domain of the Ecadherin molecule interacts with that of an opposing Ecadherin on a neighbouring cell, the intracellular cytoplasmic domain of E-cadherin associates with Ă&#x;catenin, which in turn complexes with "-catenin mediating the connection of E-cadherin to the cytoskeleton (Tsukita et al, 1992). The complex of E-cadherin and the

IV. Discussion The cause of epithelial ovarian carcinoma is unknown and diagnosis is retarded by the lack of symptoms in early stage disease. Consequently, the poor overall survival and morbidity associated with epithelial ovarian cancer deaths results from the detection of the

Table 1. Relationship between E-cadherin and !-catenin expression in ovarian carcinomas Immunoexpression

NÂş

E-cadherin Negative Positive

7 97

3 12

4 85

Total

104

15

89

Hazard ratio (95% CI) 1 5.58 (0.47-65.6) 2.99 (0.47-19.1) 7.19 (1.02-50.8)

P value

!-catenin Negative Positive

Table 2. Multivariate analysis for overall survival Covariate I II III IV Residual tumour (-) (+)

0.1700 0.2400 0.0400

1 6.78 (1.41-32.56)

0.0100

1 5.79 (2.38-14.1)

0.0001

!-catenin (+) (-)

181

Faleiro-Rodrigues et al: Loss of ! catenin expression in primary ovarian carcinomas

Figure 1. Immunoreactivity of !-catenin (A) Negative expression, (B) Mucinous carcinoma showing positive Ă&#x;-catenin expression.

catenins is a functional unit, which is termed here as the Ecadherin-catenin unit (ECCU). Binding to catenins is important for E-cadherin function, rendering the catenins regulatory molecules of E-cadherin. Thus, alterations in Ecadherin or the catenins may lead to loss of cell-cell adhesion, resulting in tumour aggressiveness and invasiveness in neoplastic disease (Ozawa et al, 1990; Frixen et al, 1991; Mareel et al, 1994).

In two previous individual studies, the significance of E-cadherin and the catenins ", !- and #-, as predictors of poorer survival in patients with ovarian carcinomas was assessed. The first study showed that negative E-cadherin immunoexpression significantly predicted a poorer overall survival, and was an independent prognostic factor in the multivariate analyses (Faleiro-Rodrigues et al 2004a). In the second study, although negative immunoexpression of "-catenin and #-catenin was observed, only negative !catenin expression was associated with patient poorer overall survival in the univariate analyses. In the multivariate analysis, !-catenin immunoexpression and residual tumour were shown to be independent prognostic factors for survival (Faleiro-Rodrigues et al 2004b).

In the present study, when E-cadherin and !-catenin were assessed together in a Cox´s multivariate regression analysis to determine whether the immunoexpression of these two proteins continued to be independent prognostic factors, only !-catenin continued to be an independent prognostic factor of poor survival. The loss of !-catenin expression, FIGO stage IV and residual tumour, when considered with parameters that had a significant impact on overall survival as peritoneal metastasis, peritoneal cytology, lymphatic/vascular invasion and E-cadherin expression, were shown to be the strongest independent predictors of poor survival. The results of this study suggest that when !-catenin and E-cadherin are assessed in a multivariate analysis, the loss of !-catenin proves to be a more important prognostic marker than the loss of Ecadherin in patients with ovarian carcinomas.

A study by the group of Akimoto et al, showed that the expression of E-cadherin in murine adenocarcinomas

correlated well with the expression of !-catenin. They also showed that reduced expression of !-catenin in these tumours correlated with enhanced metastasis formation (Akimoto et al, 1999). Whether !-catenin alone could have affected the propensity of these tumour cells to metastasise is unclear. However, some recent studies show an independent role of the catenins in tumour invasion and metastases (Kawanishi et al, 1995; Vermeulen et al, 1995).

Studies on the molecular organization of the ECCU using recombinant proteins have demonstrated !-catenin to play a central role in the formation of the E-cadherin complex (Oyama et al, 1994; Kawanishi et al, 1995; Vermeulen et al, 1995; Harington and Syrigos, 2000). In general, adhesion between normal epithelial cells is strong and stable. For tumour cells to dissociate, invade and metastasize, cell-to-cell associations must be disrupted. In our series of ovarian carcinomas, despite the small number of tumours showing loss of expression for !-catenin the observation that a) 15 carcinomas demonstrated negative expression for !-catenin, of which 3 were negative and 12 were positive for E-cadherin, respectively, and b) !catenin expression was shown to be an independent prognostic factor in a previous (Faleiro-Rodrigues et al 2004b) and in the present study, reinforces the viewpoint that !-catenin is a crucial and indispensable component in the formation of the ECCU, and that loss of !-catenin alone may be sufficient to disassemble the adherent junction, leading to loss of intercellular adhesion. Thus, loss of !-catenin expression may be an important step in the development of a malignant tumour, by this approach, enable the dissociation of cells from the primary tumour, and thus possibly contribute to tumour cell invasion and tumour peritoneal implantation in ovarian cancer patients.

Although the prognostic value of !-catenin needs to be supported by more studies and a larger number of patients, this retrospective study, suggests that the immunohistochemical assessment of !-catenin into negative versus positive expression on primary ovarian carcinomas may prove to be a useful marker for selecting

182

Gene Therapy and Molecular Biology Vol 10, page 183 in patients with primary ovarian carcinomas. Ann Oncol 15, 1532-1542.

Faleiro-Rodrigues C, Macedo-Pinto I, Pereira D, Lopes CS (2004b) Loss of !-catenin, is associated with poor survival in ovarian carcinomas. Int J Gynecol Pathol 23, 337-346.

Frixen UH, Behrens J, Sachs M, Eberle G, Voss B, Warda A, Lochner D, Birchmeier W (1991) Ecadherin mediated cellcell adhesion prevents invasiveness of human carcinoma cells. J Cell Biol 113, 173-185.

Garcia del Muro X, Torregrosa A, Munoz J, Castellsague X, Condom E, Vigues F, Arance A, Fabra A, Germa JR (2000) Prognostic value of expression of E-cadherin and !-catenin in bladder cancer. Eur J Cancer 36, 357-362.

Harington KJ, Syrigos KN (2000) The role of E-cadherin-catenin complex: more than an intercellular glue? Ann Surg Oncol 7, 783-788.

Hinck L, N채thke IS, Papkoff J, Nelson WJ (1994) Dynamics of cadherin/catenin complex formation: novel protein interactions and pathways of complex assembly. J Cell Biol 125, 13271340.

Jawhari A, Jordan S, Poole S, Browne P, Pignatelli M, Farthing MJ (1997) Abnormal immunoreactivity of the E-cadherincatenin complex in gastric carcinoma: relationship with patient survival. Gastroenterology 112, 46-54.

Kageshita T, Hamby CV, Ishihara T, Matsumoto K, Saida T, Ono T (2001) Loss of !-catenin expression associated with disease progression in malignant melanoma. Br J Dermatol 145, 210216.

Kawanishi J, Kato J, Sasaki K, FujiisS, Watanabe N, Niitsu Y (1995) Loss of E-cadherin dependent cell-cell adhesion due to mutation of the !-catenin gene in a human cancer cell line HSC-39. Molecular Cell Biol 15, 1175-1181.

Kemler R (1993) From cadherins to catenins: cytoplasmatic protein interactions and regulation of cell adhesion. Trends Genetics 9, 317-321.

Lo Muzio LL, Staibano S, Pannone G, Grieco M, Mignogna MD, Cerrato A, Testa NF, De Rosa G (1999) ! and #-catenin expression in oral squamous cell carcinoma. Anticancer Res 19, 3817-3826.

Mareel M, Bracke M, Van Roy F (1994) Invasion promoter versus invasion suppressor molecules: the paradigm of Ecadherin. Mol Biol Rep 19, 45-67.

Oyama T, Kanai Y, Ochiai A, Akimoto S, Oda T, Yanigihara K, Nagafuchi A, Tsukita S, Shibamoto S, Ito F et al (1994) A truncated !-catenin disrupts the interaction between ECadherin and "-catenin: A cause of loss of intercellular adhesiveness in human cancer cell lines. Cancer Res 54, 6282-6287.

Ozawa M, Ringwald M, Kemler R (1990) Uvomorulin-catenin complex formation is regulated by aspecific domain in the cytoplasmic region of the cell adhesion molecule. Proc Natl Acad Sci USA 87, 4246-4250.

Ozols RF, Rubin SC, Thomas GM, Robboy SJ (2000) Epithelial ovarian cancer. In Hoskins W J, Perez CA, Young RC (eds.): Principles and Practice of Gynecologic Oncology, 3rd edition. Philadelphia: PA: Lippincott Williams & Wilkins; 981-1058.

Ramesh S, Nash J, McCulloch PG (1999) Reduction in membranous expression of !-catenin and increased cytoplasmic E-cadherin expression predict poor survival in gastric cancer. Br J Cancer 81, 1392-1397.

Rubin SC, Sabbatini P, Randall ME (2002) Ovarian Cancer. In: Pazdur R, Coia LR, Hoskins W J,Wagman LD (eds): Cancer Management: A Multidisciplinary Approach, 3rd edition.

287-307.

Skubitz APN (2002) Adhesion molecules. Cancer Treat Res 107, 305-329.

a small group of patients with a high risk of suffering an unfavourable clinical outcome. Whether this information can be used to stratify patients for therapeutic strategies also needs to be explored in future clinical studies.

In several carcinomas, loss of !-catenin expression by immunohistochemistry has been associated with malignant transformation as increased invasiveness, disease progression, and poor prognosis (Takayama et al, 1996; Jawhari et al, 1997; Muzio et al, 1999; Ramesh et al, 1999; Garcia del Muro et al, 2000; Kageshita et al, 2001; Tanaka et al, 2002). However, the molecular mechanisms that bring about the loss of !-catenin in these tumours have not been characterized and yet to be investigated.

The causal mechanism for the loss of !-catenin protein expression in our series of ovarian carcinomas is not clear.

Several mechanisms may impair !-catenin from being expressed, such as hypermethylation of the !-catenin gene (CTNNB1) promoter, CTNNB1 mutations and deletions (Ebert et al, 2003; Ueda et al, 2001). It is now of interest to evaluate further the molecular mechanisms that underlie the observed loss of !-catenin observed in the present study. Future investigations on the regulation of the expression of !-catenin may elucidate possible mechanisms resulting in the loss of this protein.

Nevertheless, irrespective of the mechanism that impairs the expression of !-catenin, based on the above results, it seems that tumour cells may become increasingly invasive and show an aggressive cellular phenotype upon the loss of !-catenin, which may be an important step in the progression of ovarian carcinomas.

In conclusion, these findings suggest that !-catenin immunoexpression may assist in the identification of a group of patients who run a higher risk of an unfavourable disease outcome, and may be a useful prognostic marker for the clinical assessment of epithelial ovarian cancer complementary to other established prognostic factors as FIGO tumour stage and residual tumour. It should be noted that these results need be supported by more studies and a larger number of patients.

Acknowledgements This project was supported by a Ph.D. grant PRAXIS XXI/BD/9615/96 from the Foundation of Science and Technology (FCT).

References Akimoto T, Kawabe S, Grothey A, Milas L (1999) Low Ecadherin and !-catenin expression correlates with increased spontaneous and artificial lung metastases of murine carcinomas. Clin Exp Metastasis 17, 171-176.

Birchmeier W, Behrens J (1993) Cadherin expression in carcinomas: role in the formation of cell junctions and the prevention of invasiveness. Biochim Biophys Acta 1198, 11-26.

Ebert MP, Yu J, Hoffmann J, Rocco A, Rocken C, Kahmann S, Muller O, Korc M, Sung JJ, Malfertheiner P (2003) Loss of !-catenin expression in metastatic gastric cancer. J Clin Oncol 21, 1708-1714.

Faleiro-Rodrigues C, Macedo-Pinto I, Pereira D, Lopes CS (2004a) Prognostic value of E-cadherin immunoexpression

183

Faleiro-Rodrigues et al: Loss of ! catenin expression in primary ovarian carcinomas Takayama T, Shiozaki H, Shibamoto S, Oka H, Kimura Y, Tamura S, Inoue M, Monden T, Ito F, Monden M (1996) !catenin expression in human cancers. Am J Pathol 148, 3946.

Tanaka M, Kitajima Y, Edakuni G, Sato S, Miyazaki K (2002) Abnormal expression of E-cadherin and !-catenin may be a molecular marker of submucosal invasion and lymph node metastasis in early gastric cancer. Br J Surgery 89, 236-244.

Tsukita S, Tsukita S, Nagafuchi A, Yonemura S (1992) Molecular linkage between cadherins and actin filaments in cell-cell adherens junctions. Curr Opin Cell Biol 4, 834839.

Ueda M, Gemmill RM, West J, Winn R, Sugita M, Tanaka N, Ueki M, Drabkin HA (2001) Mutations of the !- and #catenin genes are uncommon in human lung, breast, kidney, cervical and ovarian carcinomas. Br J Cancer 85, 64-68.

Van Aken E, De Wever O, Correia da Rocha AS, Mareel M (2001) Defective E-cadherin/catenincomplexes in human cancer. Virchows Archn 439, 725-751.

Vermeulen SJ, Bruyneel EA, Bracke ME, De Bruyne GK, Vennekens KM, Vleminckx KL, Berx GJ, van Roy FM, Mareel MM (1995) Transition from the noninvasive to the invasive phenotype and loss of !-catenin in human colon cancer cells. Cancer Res 55, 4722-4728.

Vleiminckx K, Vakaet l Jr, Mareel M, Fiers W, Van Roy F (1991) Genetic manipulation of E-Cadherin expression by epithelial tumor cells reveals an invasion suppressor role.

Cell 66, 107-119.

Cristina Faleiro-Rodrigues

184

Gene Therapy and Molecular Biology Vol 10, page 185 Gene Ther Mol Biol Vol 10, 185-192, 2006

New generations of retroviral vector for safe, efficient and targeted gene therapy Review Article

Walter H. G端nzburg1,2,*, Juraj Hlavaty1, Stanislav Indik1,2, Walter Tabotta1,3, Ingrid Walter4, Christine Hohenadl3, Eva Maria Brandtner3, Francoise Rouault3, Matthias Renner3 and Brian Salmons3 1

Research Institute for Virology and Biomedicine, University of Veterinary Medicine, Vienna, Austria Christian Doppler Laboratory for Gene Therapeutic Vector Development, Vienna, Austria 3 Austrianova Biotechnology GmbH, Vienna, Austria 4 Institute of Histology, Department of Pathobiology, University of Veterinary Medicine, Vienna, Austria 2

__________________________________________________________________________________ *Correspondence: Walter H. G端nzburg, Research Institute for Virology and Biomedicine, University of Veterinary Medicine, Veterinaerplatz 1, A-1210 Vienna, Austria. Phone +43-1-25077-2301; Fax +43-1-25077-2390; email: walter.guenzburg@vu-wien.ac.at Key words: retroviral vector, murine leukaemia virus, mouse mammary tumour virus, improvements, promoter conversion vector, reconstituting vector Abbreviations: cytomegalovirus, (CMV); enhanced green fluorescent protein, (eGFP); mouse mammary tumour virus, (MMTV); murine leukaemia virus, (MLV); promoter conversion, (ProCon); Rev responsive element, (RRE); woodchuck posttranscriptional regulatory element, (WPRE) Received: 1 March 2006; Accepted: 29 May 2006; electronically published: July 2006

Summary Retroviral vectors were the first virus vectors to be used in gene therapy trials and have proved to be successful for the treatment of X-linked severe combined immunodeficiency. However, there are safety concerns associated with the use of retroviral vectors or indeed delivery systems based upon viruses in general. Over the last few years, we have been developing retroviral vectors with the aim of (i) removing the retroviral promoter in transduced cells (ii) obtaining limited expression of therapeutic genes in therapeutically relevant cells by the inclusion of targeting promoters in place of the retroviral promoter (iii) being able to stably produce retroviral vectors carrying toxic genes from cells. Two of these vector systems, promoter conversion vectors and reconstituting vectors, have been described in proof of principle studies, but suffered from reduced titres that precluded their effective use in the clinic. A number of vector optimisation modifications have been made to these vectors, resulting in the successful improvement of both titre and expression levels such that these vectors are now suitable for use in clinical trials.

The use of such optimised vectors for in vitro and in vivo applications using a number of different genes of interest will be described. Future successful gene therapy of solid tumours may require the use of replicating vectors. The application of many of the principles learned from the vector optimisation modifications described above to replicating MLV and MMTV based vectors will be described along with data demonstrating efficient tissue specific expression targeting.

The ability to redesign such vectors so that they specifically target therapeutically relevant cells has long been an aim of gene therapists since it was realised early on that this would increase both the efficacy as well as the safety of gene transfer (Salmons and G端nzburg, 1993; Weber et al, 2001). Virus vectors can either be modified so that they are preferentially able to infect particular cell types (infection targeting) or so that the gene of interest is expressed only in therapeutically relevant cells (expression targeting). While infection targeting has been shown to be achievable by many groups using a number of different

I. Introduction Retroviral vectors have delivered some of the first promising successes in gene therapy, such as the successful gene therapeutic treatment of severe combined immunodeficiency (Cavazzana-Calvo et al, 2000) and yet this success has been bittersweet since it was accompanied by the confirmation that retroviruses also have the potential to play a role in the series of events that culminate in tumorigenesis in humans (Hacein-Bey-Abina et al, 2003a).

185

Günzburg et al: New generations of retroviral vector for safe, efficient and targeted gene therapy strategies, it is invariably associated with drastic reductions in infection and thus gene transfer efficiency (Karavanas et al, 1998). Another means to achieve the targeted production of a therapeutic product is to express it from a tissue specific promoter and there have been many strategies employed to create such expression targeted retroviruses.

Over the last decade, we have been developing retroviral vectors that allow expression targeting, but that also replace the virus promoter with the targeting promoter in the infected cell. This is an important feature since (i) the virus promoter often overrides or inactivates the tissue specific promoter in other types of expression targeted vectors and (ii) it contributes to safety since the virus promoter has the potential to play a role in tumorigenesis (Hacein-Bey-Abina et al, 2003b) and its removal reduces the chances for recombination occurring that might generate a replication competent vector.

viruses that have to replicate via a DNA. The virus encoded reverse transcriptase that creates the double stranded DNA form of the genome from the single stranded virus genomic RNA. The promoter conversion ProCon vectors that we have been developing utilise the reverse transcriptase mediated genetic reorganisation to replace the virus promoter, which is active in the vector producing (i.e. packaging) cells, with a heterologous promoter in the vector transduced cell. If this heterologous promoter is preferentially expressed in a given cell type, it is expected that expression of the therapeutic gene carried by the vector will be limited to the very same cells (Figure 1). Proof of concept for ProCon vectors has been obtained using murine leukaemia virus (MLV) vectors carrying a variety of nonhomologous promoters, i.e. constitutively active promoters like the cytomegalovirus (CMV) promoter or tissue specific/restrictive promoters like that of mouse mammary tumour virus (Saller et al, 1998) or whey acidic protein (Özturk-Winder et al, 2002; Lipnik et al, 2005). Inducible promoters are also useful in this context since they allow cells transduced with genes encoding proteins that are not compatible with cell growth to be obtained in the absence of the inducer (Mrochen et al, 1997). The ProCon strategy can be applied in principle to all retroviral and lentiviral vectors.

II. Promoter conversion vectors based on murine leukaemia virus Promoter conversion (ProCon) vectors utilise the characteristics of the natural and reproducible genetic reshuffling that retroviruses must go through during the process of reverse transcription. Retroviruses are RNA

Figure 1. The promoter conversion (ProCon) principle. The U3 region carried in the 3’ LTR of the retroviral vector is removed (except for the inverted repeated required for integration) and replaced with a promoter of choice (shaded box). The vector is then introduced into retroviral vector packaging cells and produces a packageable transcript. Target cells are then transduced with the vector, resulting in reverse transcription of the packaged RNA into a double-stranded proviral DNA. During reverse transcription, the promoter of choice, originally located at the 3’ end of the retroviral genomic transcript is duplicated and one copy placed at the 5’end of the virus. The provirus is then integrated into the host cell genome by the virus enzyme integrase.

186

Gene Therapy and Molecular Biology Vol 10, page 187 Although such MCV based ProCon vectors function as expected, the titres of vector obtained are reduced ~100 fold as compared to nonmodified, first generation type MLV vectors. While these titres are still useful in cell culture experiments, they preclude use in the clinic. A second drawback to the use of retroviral vectors based upon MLV, regardless of whether they are of the first generation or ProCon type, is that the level of expression in the infected cell is not always optimal. This depends on the activity of the promoter that drives expression in the particular cell type of therapeutic relevance and can affect both first generation and ProCon vectors. Promoters that are preferentially active only in certain cell types (i.e.tissue specific promoters) are often relatively weak in their ability to drive gene expression. Here we highlight some of the modifications that can be made to vectors to improve both the titres and the efficacy of gene expression in transduced cells. Moreover, a combination of these modifications in a single vector results in high titre vectors that efficiently express the delivered transgene to high levels.

2. Inclusion of an extended attachment site and the AT stretch At the time of construction of the first ProCon vector, it was generally accepted that the terminal 13bp of the double stranded DNA is necessary and sufficient as a recognition sequence to which the virus encoded integrase binds in order to effect the integration of double stranded MLV DNA into the host cell genome. Recently, it has been shown that a longer sequence is involved and so an additional 23bp has been included in the vector (Figure 2). An AT rich sequence has also been identified that is located just upstream of the polypurine tract that affects the efficiency of reverse transcription (Figure 2).

Incorporation of both sequences resulted in a 2-fold increase in titre but no significant improvement in the efficiency of reverse transcription (Hlavaty et al, 2004a).

3. Inclusion of a triple polyadenylation signal In addition to the AAUAAA sequence located 16 to 25bp upstream of the polyadenylation site and a GU rich site 20-30bp downstream of this site, some retroviruses carry an additional polyadenylation signal in the U3 region. As a result of the vector design, any regulatory signals carried in the U3 region are no longer present in the ProCon vector. To ensure that efficient polyadenylation was occurring, three copies of the SV40 early polyadenylation signal were inserted into the 5’ end of the U5 region carried by the 3’LTR, resulting in a 2 fold increase in viral titre (Hlavaty et al, 2004a).

A. Modifications to improve virus titre 1. Inclusion of a strong enhancer in the plasmid carrying the vector One possible reason for suboptimal titres of vector produced from packaging cells is that the amount of genomic RNA is limiting. To address this issue, we have introduced a CMV enhancer into the backbone of the vector in both orientations and nearer either to the 5’ or to the 3’ long terminal repeat (LTR) (Figure 2). The insertion of the CMV enhancer reproducibly enhanced vector expression in both human and murine packaging cells two fold and increased the titre of vector produced from these cells by two fold also as measured by the number of genome containing virions in the supernatant of producer cells (determined by real-time RT-PCR) or as by G418 resistant colony formation. This enhancement is obtained regardless of the site and orientation of insertion of the enhancer (Hlavaty et al, 2004a).

4. Removal of procaryotic sequences from the vector The original ProCon vectors carry a bacterial origin of replication to facilitate the recloning of proviruses from infected cells. This was deemed important for proof of principle and further characterisation of ProCon vectors.

However it could be shown that removal of these sequences results in a 2 fold improvement in vector virus titres. A further improvement in vector titre was obtained by replacing the gene that confers G418 resistance to infected cells with the puromycin resistance gene (Hlavaty et al, 2004b). This confirms the data obtained by others (Bowtell et al, 1988; Artelt et al, 1991; Byun et al, 1996).

Figure 2. Summary of modifications improving titre and expression. Schematically shown are the modifications undertaken to improve ProCon vectors: (1) replacement of the U3 region in the 5’ LTR with a strong, constitutively active cytomegalovirus (CMV) promoter (2) extension of the inverted repeat (att) recognition site for integrase (3) insertion of three copies of a heterologous polyadenylation site in the U5 region of the 3’LTR (4) insertion of the woodchuck post-transcriptrional regulatory element (WPRE) (5) deletion of the SV40neomycin resistance cassette (6) deletion of the prokaryotic origin of replication (ori).

187

Günzburg et al: New generations of retroviral vector for safe, efficient and targeted gene therapy

B. Modifications expression

to

improve

longterm growth of the vector producing cells. A popular strategy to overcome this difficulty is to create drug inducible vector systems. These are however always to some extent leaky and it is difficult to remove the inducer (often an antibiotic or hormone) from the final vector preparation which may cause problems or raise safety issues.

The reconstituting vector has been created to overcome this problem. Similar to the ProCon system, the principle behind the ReCon system is based on the necessity for the genomic retroviral RNA to undergo reverse transcription in the target infected cell, thereby producing a provirus which then gives rise to therapeutic gene expression (Figure 3). The retroviral vector that is introduced into the producing cell line has two features: (i) it carries the therapeutic gene coding sequences, lacking a promoter, in the opposite orientation to the vector transcription in place of the U3 region at the end of the transcriptional unit, which thus cannot be expressed and (ii) it carries a promoter of choice inserted into the U5 region at the 5’ end, also in the opposite orientation to the vector transcription, which thus cannot drive expression in vector producing cells (Figure 3). The vector genomic RNA, expressed from the classic retroviral promoter, is packaged into virions and infection of target cells with the vector virus can proceed as usual. After infection, the virus genomic RNA is reverse transcribed and generates a double stranded proviral DNA in which the coding sequence of the therapeutic gene is now placed in close proximity to the heterologous promoter thereby creating a functional transcriptional unit. Moreover, there are two copies of the promoter-gene expression cassette, one at each end of the provirus, in the virus infected cell (Figure 3). Proof of principle for the ReCon vector has been obtained using the enhanced green fluorescent protein (eGFP) gene and a number of promoters (Tabotta et al, 2001). Genes encoding toxins such as the diphtheria A toxin are now being tested in the ReCon system.

gene

The removal of prokaryotic sequences and the replacement of the neomycin resistance gene with the puromycin resistance gene not only improved the titres of ProCon vectors but also improved expression of genes carried by these vectors by about two fold (Hlavaty et al, 2004b).

Some retroviruses carry sequences that facilitate the transport of transcripts from the nucleus of infected cells to the cytoplasmic compartment. The classic example of this is the Rev/RRE system of human immunodeficiency virus (HIV). Rev is a virus encoded regulatory factor that binds the Rev Regulatory Element (RRE) present on viral nonspliced, genomic as well as single spliced env coding transcripts and couples them to cell encoded RNA transport proteins such as Crm-1 for efficient export out of the nucleus of infected cells. The woodchuck hepadnavirus also carries a posttranscriptional regulatory element, the WPRE, in its genome (Donello et al, 1998).

The WPRE has already been used to improve the transport and thus expression of gene delivered by virus vectors (Zuffrey et al, 1999). In comparison to other candidate RNA transport elements, inclusion of the WPRE element in ProCon vectors resulted in an up to 4 fold increase in expression (Figure 2 and Table 1). Indeed it could be shown that improvement in expression levels can be obtained regardless of the site of introduction of the WPRE in the vector genome (Hlavaty et al, 2005).

Nevertheless, it should be noted that we have recently shown the ability of the WPRE to improve gene expression can be both promoter and cell type specific (Klein et al, 2006).

Recently, a high incidence of liver tumours after in utero application of a third-generation equine infectious anaemia virus vectors carrying the WPRE has been observed (Coutelle et al, 2005) and it remains to be seen if this finding is generally applicable to all vector types and configurations as well as for nonfatal gene transfer.

IV. Mouse Mammary Tumour Virus as a retroviral vector

III. Reconstituting vectors based on MLV

As mentioned above, the mouse mammary tumour virus (MMTV) promoter shows specificity in that it is preferentially active in mammary epithelial and tumour cells as well as B-lymphocytes (Günzburg and Salmons, 1992; Zhu and Dudley, 2001). Further MMTV promoter activity is inducible by glucocorticoid hormones

It is difficult to establish stable, quality controllable, retroviral vector producing cells delivering genes that encode a toxic protein, or proteins that are not compatible with cell growth such as cell cycle inhibitors or proapoptotic proteins since these gene products preclude

Table 1. Some post-transcriptional regulatory elements that function poorly in ProCon vectors1 Element

Source

constitutive transport element (CTE)

simian retrovirus type D (SRV-1)

Retroviral transport element (RTE)

endogenous retrovirus VL30

5’ untranslated transcript region (5’UTR)

heat shock protein 70 gene

1

Hlavaty et al, 2005

188

Reference Zhao et al, 2000 Nappi et 2001; Smulevitch et al, 2005 Huez et al, 1998; Vivinus et al, 2005

Gene Therapy and Molecular Biology Vol 10, page 189

Figure 3. The reconstituting (ReCon) vector principle. The U3 region carried in the 3’LTR of the retroviral vector is removed (except for the inverted repeated required for integration) and replaced with a promoterless gene of choice inserted in the opposite transcriptional orientation to that of the vector (shaded box). In addition, a promoter of choice is inserted into the U5 region of the 5’LTR (without deleting U5 sequences), again in the opposite transcriptional orientation to the vector. Thus the promoter and gene of interest are physically separated and are not active in vector producing cells. The vector is then introduced into retroviral vector packaging cells and produces a packageable transcript. Target cells are then transduced with the vector, resulting in reverse transcription of the packaged RNA into a double-stranded proviral DNA. During reverse transcription, the promoter of choice, originally located at the 5’ end of the retroviral genomic transcript is duplicated and one copy placed at the 3’ end of the provirus and the gene of interest is also duplicated and one copy placed at the 5’ end of the provirus. Thus two reconstitute expression cassettes are generated at either end of the provirus, which is then integrated into the host cell genome by the virus enzyme integrase.

(Günzburg and Salmons, 1992; Aurrekoetxea-Hernandez and Buetti, 2004), shows mammary specificity in transgenic mice (Figure 4) and, when it is inserted into a ProCon vector it retains both cell type specificity, at least in transgenice mice, as well as hormone inducibility (Mrochen et al, 1997; Saller et al, 1998). MMTV is thought to be poorly infective in cell culture, though in vivo it may show infection specificity for murine mammary epithelial cells and other glandular cells as well as for B and T lymphocytes. MMTV would thus make an ideal mammary/B-lymphocyte specific infection and expression targeted vector system. However, the virus is poorly infectious even for mouse mammary gland cells in cell culture and it is reported to be poorly infectious for human cells. This latter observation seemed to be supported by the recent identification of the MMTV receptor as the murine transferrin receptor, since the human form of this receptor appears to be either nonfunctional (Ross et al, 2002) or only weakly functional (Zhang et al, 2003). Nevertheless, the murine transferrin

receptor is known to be expressed on many cell types in vivo and so this alone cannot explain apparent infection spectrum of MMTV in vivo. One caveat to the studies involved in the identification of the MMTV receptor is that they were conducted using pseudotyped vectors consisting of an MLV genome carrying the ßgalactosidase gene in an MLV core with the envelope of MMTV. These pseudotyped vectors were generated by transient transfection. It is conceivable that such vectors do not accurately mimic the infection with a wild type MMTV. In addition, only one strain of MMTV envelope was tested in these pseudotyped vectors whereas there are many MMTV variants in mice.

We have recently shown that both wild-type MMTV produced from a mouse mammary tumour derived cell line as well as a replication competent MMTV vector carrying an eGFP gene can efficiently infect a number of cultured human cell lines including mammary tumour derived cell lines (Indik et al, 2005). A number of lines of evidence for specific, infection mediated transfer of MMTV rather than 189

G端nzburg et al: New generations of retroviral vector for safe, efficient and targeted gene therapy a non-infection specific transfer have been provided (Table 2). The ability of MMTV to infect human cells opens up the possibility of developing MMTV as a mammary tumour and B-lymphocyte specific vector for use in gene therapy approaches for the treatment of human diseases.

Intriguingly, these findings also strengthen previously reported observations that MMTV DNA sequences can be found in between 37-42% of human breast tumours (Etkind et al, 2000; Lui et al, 2001; Melana et al, 2001; Ford et al, 2003),

Figure 4. Transgenic mouse carrying an MMTV-eGFP expression construct. Shown is a mouse carrying a transgene consisting of the MMTV LTR linked to the eGFP gene.

Expression of eGFP can be seen specifically in the mammary glands.

Table 2. Evidence for true and specific infection of human cells by MMTV1 Action

Result

Infection with: wild type virus

specific PCR signals in infected human cells

eGFP carrying replication competent virus

eGFP expressing cells

------------------------------------------------------------------------------------------------------------------Pre-treatment of virus with: MMTV neutralising antibody Abolishes infection Heat Abolishes infection Virus with premature termination codon in MMTV Env

Abolishes infection

---------------------------------------------------------------------------------------------------------------------Sequencing of DNA from MMTV Typical of retroviral integration: integration sites from host genome - deletion of last 2bp of viral RNA - duplication of 5bp at site of integration Human specific sequences found with no known mouse counterparts 1

data from Indik et al, 2005

190

Gene Therapy and Molecular Biology Vol 10, page 191 Soulier J, Leiva LE, Wissler M, Prinz C, Rabbitts TH, Le Deist F, Fischer A, Cavazzana-Calvo M (2003b) LMO2associated clonal T cell proliferation in two patients after gene therapy for SCID-X1. Science 302, 415-9.

Hlavaty J, Portsmouth D, Stracke A, Salmons B, Günzburg WH and Renner M (2004b) Effects of sequences of prokaryotic origin on titre and transgene expression in retroviral vectors.

Virology 330, 351-60.

Hlavaty J, Schittmayer M, Stracke A, Jandl G, Knapp E, Felber BK, Salmons B, Günzburg WH and Renner M (2005) Effect of post-transcriptional regulatory elements on transgene expression and virus production in the context of retrovirus vectors. Virology 341, 1-11.

Hlavaty J, Stracke A, Klein D, Salmons B, Günzburg WH and Renner M (2004a). Multiple modifications allow high titer, tissue-specific retroviral vector production. J Virol 78, 138492.

Huez I, Creancier L, Audigier S, Gensac MC, Prats AC and Prats H (1998) Two independent internal ribosome entry sites are involved in translation initiation of vascular endothelial growth factor mRNA. Mol Cell Biol 18, 6178-6190.

Indik S, Günzburg WH, Salmons B and Rouault F (2005) Mouse mammary tumor virus infects human cells. Cancer Res 65, 6651-9.

Karavanas G, Marin M, Salmons B, Gunzburg WH and Piechaczyk M (1998) Cell targeting by murine retroviral vectors. Crit Rev Oncol Hematol 27, 7-30.

Klein R, Ruttkowski B, Knapp E, Salmons B, Günzburg WH and Hohenadl C (2006) WPRE mediated enhancement of gene expression is promoter and cell line specific. Gene, in press Lipnik K, Petznek H, Renner-Muller I, Egerbacher M, Url A, Salmons B, Günzburg WH and Hohenadl C (2005) A 470 bp WAP-promoter fragment confers lactation independent, progesterone regulated mammary-specific gene expression in transgenic mice. Transgenic Res 14, 145-58.

Liu B, Wang Y, Melana S, Pelisson I, Najfeld V, Holland JF and Pogo BG (2001) Identification of a proviral structure in human breast cancer. Cancer Res 61, 1754-9.

Melana SM, Holland JF and Pogo BG (2001) Search for mouse mammary tumor virus-like env sequences in cancer and normal breast from the same individuals. Clin Cancer Res 7, 283-4.

Mrochen S, Klein D, Salmons B, Nikol S, Smith JR and Günzburg WH (1997) Inducible expression of p21WAF1/CIP-1/SDI-1 from a promoter-conversion retroviral vector.

J Mol Med 75, 820-8.

Nappi F, Schneider R, Zolotukhin K, Smulevitch S, Michalowski D, Bear J, Felber BK, Pavlakis GN (2001) Identification of a novel posttranscriptional regulatory element by using a revand RRE-mutated human immunodeficiency virus type 1 DNA proviral clone as a molecular trap. J Virol 75, 4558-69. Öztürk-Winder F, Renner M, Klein D, Müller M, Salmons B and Gunzburg WH (2002) The murine whey acidic protein promoter efficiently directs gene expression to human mammary tumors after retroviral transduction. Cancer Gene Therapy 9, 421-31.

Ross SR, Schofield JJ, Farr CJ and Bucan M (2002) Mouse transferrin receptor 1 is the cell entry receptor for mouse mammary tumor virus. Proc Natl Acad Sci U S A 99, 12386-90.

Saller R, Öztürk-Winder F, Salmons B and Günzburg WH (1998) Construction and characterization of a hybrid mouse mammary tumor virus/murine leukemia virus based retroviral vector. J Virol 72, 1699-703.

Salmons B and Gunzburg WH (1993) Targeting of retroviral vectors for gene therapy. Human Gene Therapy 4, 129-41.

Smulevitch S, Michalowski D, Zolotukhin AS, Schneider R, Bear J, Roth P, Pavlakis, GN and Felber BK (2005)

thus suggesting that MMTV infection may also play a role in breast tumour development in women. If these findings are verified, then an evaluation of MMTV antigen status in women may become a public health issue.

Acknowledgements The authors would like to thank the members of the Research Institute for Virology and Biomedicine, the Christian Doppler Laboratory for Gene Therapeutic Vector Development and Austrianova Biotechnology that contributed to the work summarised in this review. This work was financed by the Christian Doppler Society and the FFG.

References Artelt P, Grannemann R, Stocking C, Friel J, Bartsch J and Hauser H (1991) The prokaryotic neomycin-resistanceencoding gene acts as a transcriptional silencer in eukaryotic cells. Gene 99, 249-54.

Aurrekoetxea-Hernandez K and Buetti E (2004) Transforming growth factor beta enhances the glucocorticoid response of the mouse mammary tumor virus promoter through Smad and GA-binding proteins. J Virol 78, 2201-11.

Bowtell DDL, Cory S, Johnson GR and Gonda TJ (1988) Comparison of expression in hemopoietic cells by retroviral vectors carrying two genes. J Virol 62, 2464-73.

Byun J, Kim J-M, Kim S-H, Yim J, Robbins PD and Kim S (1996) A simple and rapid method for the determination of recombinant retrovirus titre by G418 selection. Gene Therapy 3, 1018-20.

Cavazzana-Calvo M, Hacein-Bey S, de Saint Basile G, Gross F, Yvon E, Nusbaum P, Selz F, Hue C, Certain S, Casanova JL, Bousso P, Deist FL, Fischer A (2000) Gene therapy of human severe combined immunodeficiency (SCID) - X1 disease. Science 288, 669-72.

Coutelle C, Themis M, Waddington SN, Buckley SM, Gregory LG, Nivsarkar MS, David AL, Peebles D, Weisz B and Rodeck C (2005) Gene therapy progress and prospects: fetal gene therapy--first proofs of concept--some adverse effects.

Gene Therapy 12, 1601-7.

Donello JE, Loeb JE and Hope TJ (1998) Woodchuck hepatitis virus contains a tripartite posttranscriptional regulatory element. J Virol 72, 5085-92.

Etkind P, Du J, Khan A, Pilliterri J and Wiernik PH (2000) Mouse mammary tumor virus-like env gene sequences in human breast tumors and in a lymphoma of a breast cancer patient. Clin Cancer Res 6, 1273-8.

Ford CE, Tran D, Deng Y, Ta VT, Rawlinson WD and Lawson JS (2003) Mouse mammary tumor virus-like gene sequences in breast tumors of Australian and Vietnamese women. Clin Cancer Res 9, 1118-20 Günzburg WH and Salmons B (1992) Factors controlling the expression of mouse mammary tumour virus. Biochem J 283, 625-32.

Hacein-Bey-Abina S, von Kalle C, Schmidt M, Le Deist F, Wulffraat N, McIntyre E, Radford I, Villeval JL, Fraser CC, Cavazzana-Calvo M, Fischer A (2003a) A serious adverse event after successful gene therapy for X-linked severe combined immunodeficiency. N Engl J Med 348, 255-6.

Hacein-Bey-Abina S, Von Kalle C, Schmidt M, McCormack MP, Wulffraat N, Leboulch P, Lim A, Osborne CS, Pawliuk R, Morillon E, Sorensen R, Forster A, Fraser P, Cohen JI, de Saint Basile G, Alexander I, Wintergerst U, Frebourg T, Aurias A, Stoppa-Lyonnet D, Romana S, Radford-Weiss I, Gross F, Valensi F, Delabesse E, Macintyre E, Sigaux F,

191

Günzburg et al: New generations of retroviral vector for safe, efficient and targeted gene therapy Structural and functional analysis of the RNA transport element , a member of an extensive family present in the mouse genome. J Virol 79, 2356-2365.

Tabotta W, Klein D, Hohenadl C, Salmons B and Gunzburg WH (2001) Tightly controlled expression of transduced genes by reconstituting retroviral vectors. J Gene Medicine 3, 418-26.

Vivinus S, Baulande S, van Zanten M, Campbell F, Topley P, Ellis JH, Dessen P, Coste H (2001) An element within the 5’ untranslated region of human Hsp70 mRNA which acts as a general enhancer of mRNA translation. Eur J Biochem 268, 1908-1917.

Weber E, Anderson WF and Kasahara N (2001) Recent advances in retrovirus vector-mediated gene therapy: teaching an old vector new tricks. Curr Opin Mol Ther 3, 439-53.

Zhang Y, Rassa JC, deObaldia ME, Albritton LM and Ross SR (2003) Identification of the receptor binding domain of the mouse mammary tumor virus envelope protein. J Virol 77, 10468-78.

Zhao Y, Low W and Collins MKL (2000) Improved safety and titre of murine leukaemia virus (MLV)-based retroviral vectors. Gene Ther 7, 300-305.

Zhu Q and Dudley JP (2001) A retroviral model for tissuespecific transcription: lessons for gene therapy. Gene Ther Mol Biol 6, 169-181.

Zufferey R, Donello JE, Trono D and Hope TJ (1999) Woodchuck hepatitis virus posttranscriptional regulatory element enhances expression of transgenes delivered by retroviral vectors. J Virol 73, 2886-92.

Walter H. Günzburg

192

Gene Therapy and Molecular Biology Vol 10, page 193 Gene Ther Mol Biol Vol 10, 193-198, 2006

The association of endothelial constitutive Nitric Oxide Synthase polymorphisms with family history of coronary heart disease in men Research Article

Nasser M. Al-Daghri King Saud University College of Science, Biochemistry Department, Riyadh, Saudi Arabia

__________________________________________________________________________________ *Correspondence: Al-Daghri, Nasser M., Department of Biochemistry, College of Science, King Saud University, PO Box 2455, Riyadh 11451, KSA; Tel: +96614675792 / +96614675939; Fax: +96614675931; Mobile: +966505417640; e-mail: aldaghri2000@hotmail.com Key words: ecNOS gene, History of coronary heart disease, Physical activity, Type 2 Diabetes Abbreviations: acute myocardial infarction, (AMI); coronary heart disease, (CHD); endothelial nitric oxide synthase, (ecNOS); myocardial infarction, (MI); polymerase chain reaction, (PCR)

Received: 11 April 2006; Revised: 15 May 2006 Accepted: 10 July 2006; electronically published: July 2006

Summary It has been reported that endothelial nitric oxide synthase (ecNOS) gene polymorphism is associated with the risk of CHD, acute myocardial infarction (AMI) and atherosclerosis but hitherto no subjects with a family history of CHD have been examined. 292 native Saudi males of matching ages were drawn from normal, healthy male volunteers attending the blood bank at Alshmasee and the King Khalid University Hospital in Riyadh, Saudi Arabia. Blood samples were collected for the determination of lipids profiles using routine laboratory methods and Genotype was determined by polymerase chain reaction and restriction fragment length polymorphism analysis. The genotype frequencies for bb, ab and aa were 31.5, 53 and 5.5% respectively and the calculated allele frequencies for the ecNOS4b (0.65) and ecNOS4a (0.35) were not statistically different. The subjects were divided according to the family history of CHD, with an excess of individuals homozygous for bb and aa among the subjects who have a history of CHD standing at 61% and 12%, compared with those who do not have a history of CHD (59% and 4% respectively, p= 0.04). The ecNOS gene was found to be associated with family history of Coronary heart disease in Saudis male subjects more attention to these patients should be considered.

prevalence of metabolic risk factors for CHD in Saudi subjects and a regional variation in the prevalence of the disease. Changes in lifestyle are clearly important to the current epidemic of obesity, diabetes and CHD in Saudis, but genetic factors may also contribute to the risk of CHD in this population. Moreover, the prevalence of smoking in Saudi Arabia is very high and has become a significant public health problem there (Al-Nuaim, 1997; Osman, 2000). In another study in Saudi Arabia, it was found that 19% of stroke patients registered from 1989-1993 were smokers (Al-Rajeh et al, 1998).

These essential roles of NO in vascular regulation suggest that a derangement in endothelial NO synthesis might lead to the development of atherosclerosis (Cooke et al, 1992). It has been reported that the ecNOS gene a/b polymorphism caused by four (allele ecNOSa) or five (allele ecNOSb) repeats of a 27-base pair sequence in intron 4 of the ecNOS gene is associated with the risk of

I. Introduction Coronary Heart Disease (CHD) is a major public health problem which has been associated with various risk factors, including hypertension, hyperlipidaemia, diabetes mellitus and smoking (Simons, 1986; Jorde, 1988) However, in some individuals, CHD is not associated with conventional risk factors, suggesting that other genetic factors are involved in the predisposition to coronary atherosclerosis and its thrombotic complications (Nora et al, 1980; Marenberg et al, 1994).

Several studies show a clustering of CHD risk factors in the people of Saudi Arabia (Al-Nuaim, 1997; Khattab et al, 1999; Musaiger, 2002; Al-Nozha et al, 2002; Hakim et al, 2003; Al-Rukban, 2003; Al-Shehri et al, 2004). The prevalence of diabetes mellitus and CHD in Saudis is 24% and 6% respectively (Al-Nozha et al, 2004a, b). Osman, (2000) and Al-Nuaim, (1997) have shown a high

193

Al-Daghr: ecNOS polymorphisms with history of CHD in men CHD, AMI (Thomas et al, 2002) and atherosclerosis (Cooke et al, 1992).

The human ecNOS gene is located on chromosome 7q 35-36 and comprises 26 exons spanning 21 kb: A number of variable tandem repeats and dinucleotide repeats [(CA)n] have been identified in the ecNOS gene (Janssens et al, 1992; Marsden et al, 1992; Sessa et al, 1992; Miyahara et al, 1994; Nadaud et al, 1994). Among the reported polymorphisms in the endothelial ecNOS gene, a close association has been shown to exist between the allele (four repeats) in intron 4 and the onset of CHD in an Australian population (Khattab et al, 1999). The effects of conventional risk factors such as smoking, hypertension, diabetes and HDL on the association between the ecNOS gene and ischaemic stroke have been determined in other populations (Bonnardeaux et al, 1995; Wang et al, 1996; Asanuma et al, 2001; Basset et al, 2002).

Nitric oxide has recently been implicated in a number of diverse physiological processes, including smooth muscle relaxation, inhibition of platelet aggregation, neurotransmission, immune regulation and penile erection (Furchgott, 1989; Dudzinski et al, 2006). Nitric oxide is produced from L-arginine by nitric-oxide synthase with a concomitant production of L-citrulline. There appear to be at least three distinct isoforms of nitric-oxide synthase (Furchgott, 1989; Yui et al, 1991a,b; Iyanagi, 2005). All three isoforms contain consensus sequences for the binding of FMN, FAD, and NADPH cofactors, and the structures of the isoforms have close homology to cytochrome p-450 reductase. The NOSs N-terminus bind tetrahydrobipoterine and heme, and the N- and C-terminal domains are linked by a short sequence that binds calmodulin (Bredt et al, 1991).

Hence, we investigated whether the polymorphism in intron 4 of the ecNOS gene is an independent risk factor for CHD in Saudi population.

B. Genotyping Genomic DNA was extracted from buffy coats as described previously (Hayden et al, 1987). The Taq I polymorphism was originally described by Drayna and Lawan (Drayna, 1987). Ec NOS genotypes were determined with minor modifications by a polymerase chain reaction (PCR) using oligonucleotide primers (sense: 5’-AGGCCCTATGGTAGTGCCTTT-3’; antisense, 5’TCTCTTAGTGCTGTGGTCAT-3’ Prizma Laboratory Products Industry and Trade Co. LTD., Istanbul, TR) which flank the region of the 27bp direct repeat in intron 4 as described previously. Reactions were performed in a total volume of 24!L containing 500ng genomic DNA, 10 pmol of each primer, 0.2mm dNTP, 0.5U Taq DNA polymerase (MBI Fermentas Inc., New York, NY). The thermocycling procedure (Perkin Elmer Cetus, DNA Thermal Cycler 480, USA and Eppendorf Mastercycler Personal 5332, Germany) consisted of initial denaturation at 95°C for 5 min, 35 cycles of denaturation for 94°C for 1 min., annealing at 55°C for 1 min and extension at 72°C for 1 min. The PCR products were analyzed using 2% agarose gel electrophoresis and visualized by ethidium bromide staining. The large allele, ecNOS4b, contains 5 tandem 27bp repeats and the smaller allele, ecNOS4a, contains 4 repeats. The sizes of the PCR products were 393bp and 420bp respectively for the ecNOS4a and ecNOS4b alleles.

C. Statistical analysis Statistical manipulations and sample difference testing were carried out using SPSS version 10 for Windows (SPSS, Evanston, IL, USA). Data were tested for normality using normal probability plots and, if appropriate, transformed to produce a normal distribution. Differences among genotypes were tested on transformed data using one-way ANOVA. Due to multiple group comparisons, the Bonferroni correction was used to ascertain the statistically significant differences between the group means.

Correlations were investigated using Pearson’s correlation coefficient. The frequencies of discrete variables such as genotypes were compared by a chi-square test and of continuous variables by t-test or analysis of variance. We used logistic regression analysis for the association between presence of CHD and polymorphism. The presence of CHD was regarded as the dependent variable and the ecNOS4 polymorphism, gender, hypertension, diabetes, age, lifetime smoking, BMI, lipids parameters and lipoprotein levels were regarded as independent variables.

This statistical test was also performed to examine whether the genotype frequencies were in Hardy-Weinberg equilibrium.

II. Patients and methods A. Patients The subject population was drawn from normal, healthy male volunteers attending the blood bank at Alshmasee and King Khalid University Hospital in Riyadh, Saudi Arabia. Ethical approval was obtained from the local institutions, and written informed consent was obtained from each participant in the study. Information on sociodemographic characteristics, personal and family medical history and health-relevant behaviors, including smoking, exercise and diet was obtained by a standardized interview at the time of venesection. Height and weight were measured and blood pressure was measured once with a standard mercury sphygmomanometer.

Two 5 mL non fasting blood samples were obtained in EDTA coated vacuum tubes. After centrifugation for 10 minutes at 1000 rpm, plasma was stored at -20 oC in 1.5 mL aliquots; the remaining red blood cells were stored at -20 oC in 4 mL tubes for DNA extraction. Plasma total cholesterol, HDL-cholesterol and triglycerides were determined by routine enzymatic methods with a Roche modular analyzer. Apolipoproteins A I (apo A I) and Apolipoproteins A II (apo A II) were measured by a commercial immunoturbidmetric assay using a Roche modular analyzer.

III. Results The characteristics of the Saudi male subjects (N = 262) are shown in Table 1, for both the whole group and for the three ecNOS genotypes. Comparison of age, BMI and the incidence of several conventional risk factors for CHD, including systolic and diastolic blood pressure, lipids, glucose and lipoproteins between ecNOS genotypes (aa + ab and bb) revealed no significant difference (Table 1).

The calculated allele frequencies for ecNOS4b and ecNOS4a were 0.65 and 0.35 respectively. The genotype frequencies for bb (0.35), ab (0.59) and aa (0.6) were significantly different from their expected values (R2 = 11.6, p <0.01). The distribution of the three investigated polymorphisms significantly deviated from the HardyWeinberg equilibrium exhibiting 50% decrease in aa, 17% decrease in bb, and 29.5% increase in ab genotypes as compared to their respective expected frequencies.

194

Gene Therapy and Molecular Biology Vol 10, page 195 Table 1. Demographic, biochemical and life-style characteristic of the populations and according to eNOS genotype. Data shown are the mean (SD).

CHARACTERISTICS Numbers Age (years) BMI (Kg) Current smoker (Numbers) Family history of CHD (Numbers) F. Glucose (mmol/L) Cholesterol (mmol/L) HDL (mmol/L) Triglyceride (mmol/L) SPB DPB Hips (cm) Waist (cm) APOA1{mg/dl) APOA11{mg/dl) a

TOTAL 262 29.4(8.4) 28.9(7.1) 114 49 5.4(1.1) 4.6(0.9) 0.97(0.3) 2.2(1.4) 118.7(12.7) 75.8(10.4) 106.6(17.2) 94.6(12.7) 117.4(17.1) 43.7(7.2)

BB 92 29.2(8.2) 28.5(8.6) 62 27 5.8(0.8) 4.7(1.0) .9(.2) 2.3(1.6) 120.9(12.8) 74.7(9.8) 106.9(27.2) 98.7(13.9) 115.8 (16.3) 42.8(7.8)

AB 154 30.7(9.6) 30.3(5.9) 44 15 5.2(1.1) 4.5(0.6) 0.9(0.2) 2.1(1.3) 117.9(12.3) 77.1(7.8) 98.7(9.9) 360.0(484.9)a 119.2(16.9) 45.2(10.9)

AA 16 28.9(7.9) 28.9(6.7) 8 7 5.5(1.2) 4.5(0.9) 0.9(0.3) 2.1(1.2) 117.6(13.0) 75.9(11.4) 106.6(9.2) 92.7(12.2)b 118.5(18.02) 44.2(6.8)

p= 0.001 (ANOVA) between groups 1 and 3. p=0.01 between groups 2 and 3

b

Table 2. Clinical characteristics and metabolic parameters of Subjects without history of CHD (No CHD) and subjects with history of CHD. Characteristics Numbers Age (years) BMI (Kg) Family history of CHD (Numbers) F. Glucose (mmol/L) Cholesterol (mmol/L) HDL (mmol/L) Triglyceride (mmol/L) SPB DPB Hips (cm) Waist (cm) APOA1{mg/dl) APOA11{mg/dl)

N0 CHD 206 30.9(9.4) 27.9(9.02) 0 5.4(1.2) 4.6(0.9) 0.9(0.3) 2.2(1.2) 120.9(11.9) 75.8(7.03) 106.5(19.1) 158.2(229.3) 118.3(14.6) 43.9(7.4)

CHD 56 28.7(7.8) 28.9(7.02) 56 5.6(1.6) 4.6(0.9) 0.9(0.2) 2.2(1.4) 118.7(12.6) 75.6(11.2) 105.3(9.04) 94.2(13.2) 118.6(17.4) 44.2(7.1)

P value 0.12 0.51 0.576 0.68 0.14 0.66 0.30 0.66 0.83 0.038 0.78 0.7

Data are presented as mean (SD)

Categorical distribution subjects according to HDL level (Table 3) smoking habit (Table 4) and family history of diabetes (Table 5) failed to show any significant difference with respect to distribution of the ecNOS4a genotype and allele prevalence. The subjects with the history of CHD showed 61/ ba and 12/ aa as expand to 59% bb and 4% aa in the individual without the history of CHD (P<0.04), clinical characteristic (Table 2). Where as family history of CHD was significantly associated with the homozygous presentation of alleles (Table 6). In analyzing the dominant effect of the ecNOS4a allele, the prevalence of the non-bb genotype (AA+BB) was found to be significantly higher in the group which had a history of

CHD than in the control group (54%versus 64%, p< 0.05).

Stepwise regression for all the groups showed a significant association (P<0.05) between the ecNOS genotype and physical activity (in a group which took 20 minutesâ&#x20AC;&#x2122; exercise daily), with R2 0.2.

IV. Discussion Several studies have investigated the relation between ecNOS gene polymorphism and CHD, myocardial infarction (MI) and atherosclerosis and have produced varied or contradictory results (Tsukada et al, 1998; Thomas et al, 2002). It was found that the 4a allele was

195

Al-Daghr: ecNOS polymorphisms with history of CHD in men associated with CHD but not with previous MI (Wang et al, 1997; Tsukada et al, 1998). Whereas, positive associations of 4a compared with 4b were reported in African-Americans with MI (Hooper et al, 1999), Caucasians with MI and CHD (Fowkes et al, 2000), Japanese patients with MI (Ichihara et al, 1998) and Australians with severely stenosed arteries and a history of MI (Wang et al, 1996). Other studies on German (Sigusch et al, 2000) or Japanese (Elbaz et al, 2000) patients fails to observe such an association. Since this polymorphism is in a non-coding region, it could merely be a genetic marker

which is associated with the functional mutation. This is the first study to have found a relationship between the ecNOS gene and people with a history of CHD. The main finding of the present study is that sequence polymorphisms of the ecNOS gene locus are associated with a history of CHD, suggesting the pathophysiological of ecNOS 4a and 4b in the development of CHD in the Saudi population. The functional significance of ecNOS gene polymorphisms has been reported by several investigators (Wang et al, 1996; Ichihara et al, 1998; Elbaz et al, 2000; Sigusch et al, 2000; Yoshimura et al, 2000).

Table 3. Distribution of individuals between high and low HDL group for ecNOS polymorphism, the number of Individuals is given for High HDL (HDL cholesterol >1.2 mmol/L) or low HDL (HDL cholesterol<1.1). This is also expressed as a percentage of the total number of individuals in that group.

Polymorphism BB AB AA

Low HDL group Numbers % 116 57 74 37 11 6

High HDL group Numbers % 40 67 17 28 5 5

Chi-Sq=2.1 p-value=0.35 Df=2

Table 4. Distribution of individuals between subjects without history of CHD (No CHD) and subjects with history of CHD (H.CHD). This is also expressed as a percentage of the total number of individuals in that group.

Polymorphism BB AB AA

No CHD Numbers 125 77 9

% 59 37 4

H. CHD Numbers 34 15 7

% 61 27 12

Chi-Sq=6.2 p-value=0.044 Df=2

Table 5. Distribution of individuals between smoking and non smoking subject. This is also expressed as a percentage of the total number of individuals in that group.

Polymorphism BB AB AA

Non-smokers Numbers % 91 62 48 33 8 6

Smoking Numbers 62 44 8

% 56 38 6

Chi-sq= 1.53 p-value= 0.47 DF=2

Table 6. Distribution of individuals between subjects without history of diabetes (No H.DM) and subjects with history of diabetes (H.DM). This is also expressed as a percentage of the total number of individuals in that group.

Polymorphism BB AB AA

No.H.DM Numbers 100 48 8

H.DM % 64 31 5

Chi-sq=2.9 p-value = 0.23 DF=2

196

Numbers 58 42 8

% 54 39 7

Gene Therapy and Molecular Biology Vol 10, page 197 the eastern province of Saudi Arabia. Cerebrovasc Dis 8, 86-89.

Al-Rukban MO (2003) Obesity among Saudi male adolescents in Riyadh, Saudi Arabia. Saudi Med J 24, 27-33.

Al-Shehri SN, Saleh ZA, Salama MM, Hassan YM (2004) Prevalence of hyperlipidemia among Saudi school children in Riyadh. Ann Saudi Med 24, 6-8.

Asanuma K, Yokoyama K, Tsukada T, Takemoto F, Hara S, Yamada A, Tomino Y (2001) An intron 4 gene polymorphism in endothelial cell nitric oxide synthase might modulate lipid metabolism in nondiabetic patients on hemodialysis. Nephron 88, 39-43.

Basset el-EA, Berthoux P, Cecillon S, Deprle C, Thibaudin D, De Filippis JP, Alamartin E, Berthou F (2002) Hypertension after renal transplantation and polymorphism of genes involved in essential hypertension: ACE, AGT, AT1 R and ecNOS. Clin Nephrol 57, 192-200.

Bonnardeaux A, Nadaud S, Charru A, Jeunemaitre X, Corvol P, Soubrier F (1995) Lack of evidence for linkage of the endothelial cell nitric oxide synthase gene to essential hypertension. Circulation 91, 96-102.

Bredt DS, Hwang PM, Glatt CE, Lowenstein C, Reed RR and Snyder SH 1991 Cloned and expressed nitric oxide synthase structurally resembles cytochrome p-450 reducatse. Nature 351(6329), 714-718.

Cooke JP, Singer AH, Tsao P, Zera P, Rowan RA, Billingham ME (1992) Antiatherogenic effects of L-arginine in the hypercholesterolemic rabbit. J Clin Invest 90, 1168-1172.

Drayna D, Lawn R (1987) Multiple RFLPs at the human cholesteryl ester transfer protein (CETP) locus. Nucleic Acids Res 15, 4698.

Dudzinski A, Igarashi J, Grief, D, and Michel T (2006) The regulation and pharmacology of endothelial nitric oxide synthase. Annual Review of Pharmacology and Toxicology 46, 235-276.

Elbaz A, Poirier O, Moulin T, Chedru F, Cambien F, Amarenco P (2000) Association Between the Glu298Asp Polymorphism in the Endothelial Constitutive Nitric Oxide Synthase Gene and Brain Infarction. Stroke 31, 1634-1639.

Fowkes FG, Lee AJ, Hau CM, Cooke A, Connor JM, Lowe GD (2000) Methylene tetrahydrofolate reductase (MTHFR) and nitric oxide synthase (ecNOS) genes and risks of peripheral arterial disease and coronary heart disease: Edinburgh Artery Study. Atherosclerosis 150, 179-185.

Furchgott RF (1989) Endothelium-derived relaxing and contracting factors. FASEB J 3, 2007-2018.

Hakim IA, Alsaif MA, Alduwaihy M, Al-Rubeaan K, Al-Nuaim AR, Al-Attas OS (2003) Tea consumption and the prevalence of coronary heart disease in Saudi adults: results from a Saudi national study. Prev Med 36, 64-70.

Hayden MR, Kirk H, Clark C, Frohlich J, Rabkin S, McLeod R, Hewitt J (1987) DNA polymorphisms in and around the APO-A1-CIII genes and genetic hyperlipidemias. Am J Hum Genet 22, 245-251.

Hooper WC, Lally C, Austin H, Benson J, Dilley A, Wenger NK, Whitsett C, Rawlins P, Evatt BL (1999) The relationship between polymorphisms in the endothelial cell nitric oxide synthase gene and the platelet GPIIIa gene with myocardial infarction and venous thromboembolism in African Americans. Chest 116, 880-886.

Ichihara S, Yamada Y, Fujimura T, Nakashima N, Yokota M (1998) Association of a polymorphism of the endothelial constitutive nitric oxide synthase gene with myocardial infarction in the Japanese population. Am J Cardiol 81, 8386.

Janssens SP, Quertermous T, Bloch DB, Bloch KD (1992) Cloning and expression of a cDNA encoding human endothelium-derived relaxing factor/nitric oxide synthase. J

The genotype distribution of our subjects is within the Hardy-Weinberg equilibrium. Our result also showed significant differences in both genotype distribution and allele prevalence between the two groups, with or without a history of CHD. Elbaz and colleagues (2000) observed a significant difference in the distribution of genotypes when analysis were restricted to pairs of cases and matched controls, both free of previous cardiovascular and cerebrovascular history (cases: 50.0% GG, 40.1% GT, 9.9% TT; controls: 36.0% GG, 50.8% GT, 13.2% TT).

Moreover, Wang et al found that ecNOS genotype was associated with a history of myocardial infarction (Wang et al, 1996). Previous studies have also shown that ecNOS gene polymorphism is responsible for variations in the genetic control of the plasma concentration of nitric oxide metabolites (Nava et al, 1995; Tsukada et al, 1998).

Moreover, nitric oxide can inhibit vascular smooth cell proliferation (Sakar et al, 1995), which is responsible for the synthesis and assembly of the macromolecules which strengthen the fibrous cap. Therefore, there is a possibility that the inhibition of smooth muscle cell proliferation with changing ecNOS activity determined by ecNOS genotype contributes to the formation of a friable fibrous cap (Libby, 1991). Finally, brief exercise training may alter the gene expression for the enzyme, the constitutive endothelial NO synthase, which forms NO and may be part of the vascular adaptation seen after aerobic exercise training.

Furthermore, if there is a genetic predisposition to produce NO, as in world class athletes or animals bred to race, NO may contribute to spectacular exercise performance (Shen et al, 1995). One potential mechanism which may contribute to the enhanced production of nitrite in vessels from exercised dogs may be the induction of the calciumdependent ecNOS gene (Sessa et al, 1995). In our study we found an association between the ecNOS gene and physical activity. The high prevalence of Obesity, diabetes and CHD in Saudi (Al-Nuaim, 1997; Osman et al, 2000; Al-Nozha et al, 2002, 2004a, b; Al-Rukban, 2003) can explained the effect of the history of CHD on the association between gene polymorphism and CHD development so this polymorphism seems most useful for future research in CHD patients.

References Al-Nozah M, Al-Daghri N, Bartlett WA, Al-Attas O, AlMaatouq M, Martin SC, Kumar S, Jones AF (2002) Serum homocysteine concentration is related to diabetes mellitus, but not to coronary heart disease, in Saudi Arabians.

Diabetes Obes Metab 4, 118-23.

Al-Nozha MM, Al-Maatouq MA, Al-Mazrou YY, Al-Harthi SS, Arafah MR, Khalil MZ, Khan NB, Al-Khadra A, AlMarzouki K, Nouh MS, Abdullah M, Attas O, Al-Shahid MS, Al-Mobeireek A (2004a) Diabetes mellitus in Saudi Arabia. Saudi Med J 25, 1603-10.

Al-Nozha MM, Arafah MR, Al-Mazrou YY, Al-Maatouq MA, Khan NB, Khalil MZ, Al-Khadra AH, Al-Marzouki K, Abdullah MA, Al-Harthi SS, Al-Shahid MS, Nouh MS, AlMobeireek A (2004b) Coronary artery disease in Saudi Arabia. Saudi Med J 25, 1165-71.

Al-Rajeh S, Larbi EB, Bademosi O, Awada A, Yousef A, alFreihi H, Miniawi H (1998) Stroke register: experience from

197

Al-Daghr: ecNOS polymorphisms with history of CHD in men Biol Chem 267, 14519-145122, [Erratum in: J Biol Chem.

1992 Nov 5;267(31):22694].

Jorde LB (1988) Relation between family history of coronary artery disease and coronary risk variables. Am J Cardiol 62, 708-13.

Iyanagi T (2005) Structure and function of NADPH-cytochrome P450 reductase and nitric oxide synthase reductase domain.

Biochem Biophys Res Commun 338, 520-8.

Khattab MS, Abolfotouh MA, Alakija W, al-Humaidi MA, alWahat S (1999) Risk factors of coronary heart disease: attitude and behaviour in family practice in Saudi Arabia.

East Mediterr Health J 5, 35-45.

Libby PP (1991) Molecular bases of the acute coronary syndrome. Circulation 91, 2844-2850.

Marenberg RN, Berkman LF, Floderus B, De Faire U (1994) Genetic susceptibility to death from coronary heart disease in a study of twins. N Engl J Med 330, 1041-1046.

Marsden PA, Heng HH, Scherer SW, Stewart RJ, Hall AV, Shi XM, Tsui LC, Schappert KT (1992) Structure and chromosomal localization of the human constitutive endothelial nitric oxide synthase gene. J Biol Chem 268, 17478-17488.

Miyahara K, Kawamoto T, Sase K, Yui Y, Toda K, Yang LX, Hattori R, Aoyama T, Yamamoto Y, Doi Y, et al (1994) Cloning and structural characterization of the human endothelial nitric-oxide-synthase gene. Eur J Biochem 223, 719-726.

Musaiger AO (2002) Diet and prevention of coronary heart disease in the Arab Middle East countries. Med Princ Pract 2(11 Suppl), 9-16.

Nadaud S, Lathrop M, Soubrier F (1994) Gene structure, polymorphism and mapping of the human endothelial nitric oxide synthase gene. Biochem Biophys Res Commun 198, 1027-1033 Nava E, Luscher TF (1995) Nitric oxide in cardiovascular disease. Ann Med 27, 343-351.

Nora JJ, Spangler RD, Nora AH, Kimberling WJ (1980) Geneticepidemiologic study of early-onset ischemic heart disease.

Circulation 61, 503-508.

Osman AK (2000) Risk factors of coronary artery disease in different regions of Saudi Arabia. East Mediterr Health 6, 465-474.

Rahman Al-Nuaim A (1997) High prevalence of Metabolic risk factors for cardiovascular diseases among Saudi population, aged 30-64 years. Int J Cardiol 62, 227-235.

Sakar RW, Stanley JC (1995) Nitric oxide inhibition of endothelial cell mitogenesis and proliferation. Surgery 118, 274-280.

Sessa WC, Harrison JK, Barber CM, Zeng D, Durieux ME, D'Angelo DD, Lynch KR, Peach MJ (1992) Molecular cloning and expression of a cDNA encoding endothelial cell nitric oxide synthase. J Biol Chem 267, 15274-15276.

Sessa WC, Pritchard K, Seyedi N, Wang J, Hintze TH (1994) Chronic exercise in dogs increases coronary vascular nitric oxide production and endothelial cell nitric oxide synthase gene expression. Circ Res 74, 349-53.

Shen W, Zhang X, Zhao G, Wolin MS, Sessa W, Hintze TH (1995) Nitric oxide production and NO synthase gene expression contribute to vascular regulation during exercise.

Med Sci Sports Exerc 27, 1125-1134.

Sigusch HH, Surber R, Lehmann MH, Surber S, Weber J, Henke A, Reinhardt D, Hoffmann A, Figulla HR (2000) Lack of association between 27-bp repeat polymorphism in intron 4 of the endothelial nitric oxide synthase gene and the risk of coronary artery disease. Scand J Clin Lab 60, 229-235.

Simons LA (1986) Interrelations of lipids and lipoproteins with coronary artery disease mortality in 19 countries. Am J Cardiol 57, 5-10.

Thomas S, Birkhead A, Wang L (2002) Effect of ecNOS polymorphisms and coronary artery disease upon exhaled nitric oxide. J Mol Med 80, 181-186.

Tsukada T and Arai T (1998) Evidence of association of the ecNOS gene polymorphism with plasma NO metabolite levels in humans. Biochem Biophys Res Commun 245, 190-193.

Tsukada T, Yokoyama K, Arai T, Takemoto F, Hara S, Yamada A, Kawaguchi Y, Hosoya T, Igari J (1998) Evidence of association of the ecNOS gene polymorphism with plasma NO metabolite levels in humans. Biochem Biophys Res Commun 245, 190-193.

Wang XL, Badenhop RF, McCredie RM, Wilcken DE (1996) A smoking-dependent risk of coronary artery disease associated with a polymorphism of the endothelial nitric oxide synthase gene. Nat Med 2, 41-45.

Wang XL, Mahaney MC, Sim AS, Wang J, Wang J, Blangero J, Almasy L, Badenhop RB, Wilcken DE (1997) Genetic contribution of the endothelial constitutive nitric oxide synthase gene to plasma nitric oxide levels. Arterioscler Thromb Vasc Biol 17, 3147-3153.

Yoshimura M, Yasue H, Nakayama M, Shimasaki Y, Ogawa H, Kugiyama K, Saito Y, Miyamoto Y, Ogawa Y, Kaneshige T, Hiramatsu H, Yoshioka T, Kamitani S, Teraoka H, Nakao K (2000) Genetic risk factors for coronary artery spasm: significance of endothelial nitric oxide synthase gene T-786C and missense Glu298Asp variants. J Invest Med 48, 367374.

Yui Y, Hattori R, Kosuga K, Eizawa H, Hiki K, Kawai C (1991a) Purification of nitric oxide synthase from rat macrophages. J Biol Chem 266, 12544-12547.

Yui Y, Hattori R, Kosuga K, Eizawa H, Hiki K, Ohkawa S, Ohnishi K, Terao S, Kawai C (1991b) Calmodulinindependent nitric oxide synthase from rat polymorphonuclear neutrophils. J Biol Chem 266, 33693371.

198

Gene Therapy and Molecular Biology Vol 10, page 199 Gene Ther Mol Biol Vol 10, 199-206, 2006

Apoptotic signaling induced by Tiazofurin-an in vitro study Research Article

Sujata Pathak1, Himani Sharma1, Chandresh Sharma1, Hiremagalur N. Jayaram2, Neeta Singh1,* 1

Department of Biochemistry, All India Institute of Medical Sciences, New Delhi-110029, India Department of Biochemistry and Molecular Biology, Indiana University School of Medicine and Richard Roudebush Veterans Affairs Medical Center-151, Indianapolis, Indiana IN 5122, USA 2

__________________________________________________________________________________ *Correspondence: Dr. Neeta Singh, Professor, Department of Biochemistry, Room No 3027A, All India Institute of Medical Science, Ansari Nagar, New Delhi 110029, India; Tel: 91-11-26588663; Fax: 91-11-26594945; E mail: singh_neeta26@rediffmail.com Key words: Tiazofurin, apoptosis, mitochondria, cytochrome c Abbreviations: apoptosis inducing factor, (AIF); cerebellar granule cells, (CGCs); human colorectal carcinoma, (RKO); inosine 5’ mono phosphate dehydrogenase, (IMPDH); nicotinamide 5’ mononucleotide adenylyltransferase, (NMNAT); phosphate-buffered saline, (PBS); poly, (ADP-ribose) polymerase, (PARP); propidium iodide, (PI); Relative Units, (RU); thiazole-4-carboxamide adenine dinucleotide, (TAD); Tiazofurin, (TR); Tris buffered saline, (TBS) Received: 10 May 2006; Revised 02 June 2006 and 6 July 2006; Accepted: 18 July 2006; electronically published: August 2006

Summary Tiazofurin (TR), is a novel anticancer agent exhibiting potent cytotoxic activity in malignant cell lines. It exhibits at least two different mechanisms of action. First is by inhibition of inosine 5’ monophosphate dehydrogenase (IMPDH), a rate-limiting enzyme for guanylate (GTP, dGTP) biosynthesis and second is by the induction of apoptosis. But the mechanism of induction of apoptosis is not clear. The purpose of the present study was to elucidate the apoptotic signaling induced by TR in different human cancer cell lines. The effect of TR was studied on SiHa (human cervical cancer cell line), Hep2 (human laryngeal cancer cell line) and Ca Ski (human cervical cancer cell line) cells. Morphological examination, flowcytometry and Caspase-3 assay were used for detection of apoptosis. Expression of various proteins was seen by Western blotting. Our results reveal that TR at a dose of 100!M induces apoptosis in SiHa and Hep2 cells whereas for Ca Ski cells this dose is 150!M as studied by morphology and flow cytometry. A downregulation of anti-apoptotic proteins Bcl-2 and Bcl-xL was observed whereas the expression level of the pro-apoptotic protein Bax remained unaffected in all these cell lines. An upregulation of p53 was observed while no change was seen on the level of apoptosis inducing factor (AIF). A moderate increase in caspase-9 activity was seen. There was a significant increase in caspase-3 activity, which was accompanied by PARP cleavage. Release of cytochrome c from the mitochondria to the cytosol was also observed.

The findings suggest that TR induces apoptosis in SiHa, Hep2 and Ca Ski cells via the intrinsic mitochondrial pathway.

nuclear shrinkage and the formation of apoptotic bodies (Borner, 2003).

In general terms, apoptotic pathways can be subdivided into two categories- extrinsic apoptotic signals by ligand engagement of cell surface receptors such as Fas and TNF receptors, and intrinsic pathways activated by signals emanating from cellular damage sensors (e.g. p53) or development cues. Although the pathways activated by extrinsic and intrinsic signals can overlap to some extent, receptor ligation typically leads to recruitment of adaptor proteins that promote caspase oligomerization and autoprocessing (Ashkenazi and Dixit, 1998). Intrinsic signals

I. Introduction Apoptosis is a genetically controlled process of cell death. Signaling for apoptosis occurs through multiple independent pathways that are initiated either from triggering events within the cell or from outside the cell.

Finally the apoptosis signaling pathways converge on a common machinery of cell destruction that is activated by a family of cysteine proteases (caspases) that cleave proteins at aspartate residues, causing degradation of cellular proteins and disassembly of the cell, leading to morphological changes such as chromatin condensation,

199

Pathak et al: Apoptotic signaling induced by Tiazofurin-an in vitro study growing cells were used for all experiments. TR was dissolved in autoclaved double distilled water. The cells were treated with TR for 24 hr. The IC50 of TR had been studied on the basis of MTT assay and flow cytometry. The calculated IC50 has been used for all subsequent experiments. Treatment with cisplatin in the above cell lines was used as positive control. Normal human lymphocytes were used as controls.

usually operate by triggering the release of proteins from the intermembrane space of the mitochondria to the cytosol (Green and Reed, 1998). Most notable among these is cytochrome c; binding of cytochrome c to a central apoptotic regulator, Apaf-1 promotes oligomerization of Apaf-1 and activation of caspase-9 (Budihardjo et al, 1999). Caspase -9 subsequently activates effector caspases such as caspase -3, -6 and -7.

The molecular participants of apoptosis are located in mitochondria, plasma membrane, cytosol, nucleus, with interplay between these compartments. The pathways converge at two main initiator caspases-8 and -9 to signal via distinct receptor or mitochondrial mediated pathways and activate the effectors pro-caspase-3 within the cytosol.

The release of mitochondrial proteins is blocked by the anti-apoptotic Bcl-2 family members and promoted by pro-apoptotic members. Majority of chemotherapeutic agents trigger the mitochondrial pathway, but the death receptors have also been reported to be involved in chemotherapy induced apoptosis (Yuan and Whang, 2002; Calviello et al, 2003).

Tiazofurin (TR: 2-!-D-ribofuranosylthiazole-4carboxamide) exhibits cytotoxicity in vitro. The mechanism of action of TR is thought to be due to he conversion to its active metabolite, an analogue of NAD, thiazole-4-carboxamide adenine dinucleotide (TAD).

TAD, in turn is a potent inhibitor of inosine-5’-mono phosphate dehydrogenase (IMPDH) which is a ratelimiting enzyme involved in the synthesis of guanylates (GTP and dGTP). Tiazofurin has been extensively studied both

C. MTT (cell viability) assay The growth inhibitory effect of TR was assessed by the MTT assay. Briefly, 1x104 cells were seeded in a 96-well microtiter plate. Cells were then treated with different concentrations (50!M, 100!M, 150!M and 200!M) of tiazofurin for 24 hrs. 100!l of 5mg/ml of MTT was added followed by incubation for 4 hrs at 37ºC. The formazan crystals thus formed were dissolved in DMSO and the absorbance was measured at 570nm using an ELISA reader and 620nm as the reference wavelength (Sen et al, 2005). IC50 of TR was found to be 100!M for SiHa and Hep2 cells, whereas it was 150!M for Ca Ski cells.

D. Detection of apoptosis 1. Morphological analysis Apoptotic cell death was evaluated by observing morphological changes typical of apoptosis by light microscopy (Singh et al, 2002).

2. Flow cytometry Briefly, 2 x 106 cells were washed once in phosphatebuffered saline (PBS) and fixed in 70% ethanol at -200C overnight. Fixed cells were washed and resuspended in a buffer containing 5 mg/ml propidium iodide (PI), 0.1% sodium citrate, and 1% Triton-X-100. PI stained cells were analyzed using a FACScan cytometer (Coulter) equipped with an argon laser using Win MDI 2.8 software (Sharma et al, 2005).

in pre-clinical (Jayaram et al, 1999) and clinical studies (Tricot et al, 1989; Wright et al, 1996), and has been approved for treatment of patients with acute myeloid leukaemia in blast crisis (Grifantini, 2000). Recently, studies from our laboratory

3. Immunoblot analysis The levels of expression of Bcl-2, Bcl-xL, Bax, p53, AIF, PARP and cytochrome c were determined in control and treated cells by Western blotting as described previously (Sharma et al, 2005). Briefly, control and treated cells were washed twice in PBS and lysed in RIPA lysis buffer containing protease and phosphatase inhibitors. Protein quantification of the lysates was done by Bradford’s method. Equal amounts of protein extracts were then electrophoresed on 10-15% SDS-Polyacrylamide gel depending upon the molecular weight of the protein, transferred to nitrocellulose membrane, and nonspecific binding blocked with 5% BSA and 5% FCS in Tris buffered saline (TBS) for 2.5hrs at 37ºC. The blot was washed with 0.05% Tween-20 in TBS and then TBS for 10 min each. The blot was incubated with primary antibodies at 4ºC overnight against the protein of interest and then incubated with secondary antibody conjugated to alkaline phosphatase for 2hrs at room temperature, rinsed with 0.05% Tween-20 in TBS, then with TBS. This was followed by addition of AP buffer and the bands visualized by adding BCIP and NBT. The bands were analyzed and quantitated using a "imager scanning densitometer (Alpha Innotech, USA). The protein expression is expressed in Relative Units (RU). The density of the control was taken as 1 and the results of treatments were expressed in relation to the control.

have shown that another IMPDH inhibitor benzamide riboside possibly exerts its apoptotic effect through the mitochondrial mediated pathway in human lung cancer H520 cells (Khanna et al, 2004). The thrust of the present study was to investigate the mechanism of induction of apoptosis by TR using different human malignant cell lines. An understanding of the mechanism of induction of apoptosis with TR is of interest since this may help to develop a novel approach to treat cancer.

A. Materials TR was obtained from the Drug Synthesis and Chemistry Branch, Division of Cancer Treatment, National Cancer Institute, Bethesda, MD, USA. The cell lines were obtained from National Centre for Cell Science, Pune, India. Caspase-3 assay kit was from Pharmingen, Germany and Caspase-8 and -9 substrates were obtained from Genotech, USA. Western blot kit was purchased from Promega Corporation, USA. Bcl-2, Bcl-xL, Bax, p53, AIF and cytochrome c antibodies were obtained from Santa Cruz, USA. PARP antibody was purchased from Neo Markers, USA.

E. Measurement of Cytochrome c release

B. Cell culture and treatments

For cytochrome c determination, cytosolic fraction was obtained by differential centrifugation. Cytochrome c was detected by western blotting as described earlier (Sharma et al, 2005). Staurosporine treated HeLa cells were used as a positive control for cytochrome c release.

Human malignant cell lines SiHa (human cervical cancer cell line) and Hep2 (human laryngeal cancer cell line) were grown in DMEM medium whereas Ca Ski (human cervical cancer cell line) was grown in RPMI medium. The media was supplemented with 10% fetal calf serum and antibiotics in a humified atmosphere of 5% CO 2 in air, at 370C. Logarithmically

200

Gene Therapy and Molecular Biology Vol 10, page 201 Statistical analysis of the samples was done using the SAS software. Paired t-test was used to analyze the difference in the parameters between control and various treatments. A ‘p’ value of less than 0.05 was considered to be statistically significant.

F. Caspase-3, -8 and -9 activity assay Caspase-3, -8, -9 were measured by the direct assay for caspase enzyme activity in the cell lysate using synthetic fluorogenic substrate (Ac-DEVD-AMC; substrate for caspase-3; Pharmingen, Germany; Ac-LETD-AFC, substrate for caspase-8 and Ac-LEHD-AFC, substrate for caspase-9; Genotech, USA) as described by the manufacturer. Briefly, the cells were washed with PBS and lysed in lysis buffer on ice for 20 min. Aliquots of cell lysate (50-100!l) were then added to reaction buffer along with 250 !M fluorogenic substrate) and incubated for 1 hr at 37oC. Amounts of fluorogenic AMC/AFC moiety released was measured using a spectrofluorimeter (ex.380nm, em.420-460nm for Caspase-3; ex.400nm, em.490-520nm for Caspase-8 & -9).

The results were expressed as Arbitrary Fluorescence Units/mg protein (Sen et al, 2005).

III. Results To explore the cytotoxicity of tiazofurin, we started our study with the cell viability assay to determine the IC50 value in SiHa, Hep2 and Ca Ski cells. Figure 1 shows the dose response study in SiHa, Hep2 and Ca Ski cells that were treated with various concentrations of TR for a period of 24 hours. The IC50 value of TR was found to be 100!M for SiHa and Hep2 whereas this value was found to be 150!M in the case of Ca Ski cells. TR at its respective dose for different cell lines, induced apoptotic features in all the three cell lines as revealed by light microscopy (Figure 2).

G. Statistical analysis

Figure 1. Cell viability of SiHa, Hep2 and Ca Ski cells as measured

by MTT (3-(4,5-dimethylthiazol-2yl)-2,5-diphenyl tetrazolium bromide) assay. TR: Tiazofurin. The results are the mean ± SE of three different experiments.

Figure 2. Morphological changes in a) SiHa, b) Hep2 and c) Ca Ski cells as revealed by light microscopy. The photographs are of native, unstained cells, taken under an inverted microscope (200X).

201

Pathak et al: Apoptotic signaling induced by Tiazofurin-an in vitro study Besides the morphological changes, apoptosis was also quantitated by measuring the sub-diploid population of cells by flowcytometry. TR treated cells showed 34.93%, 49.67% and 31.23% apoptosis in SiHa, Hep2 and Ca Ski cells, respectively (Figure 3).

treatment in the respective cell lines as observed by Western blotting (Figure 4e).

C. Mitochondrial involvement An increase of 1.52, 1.81 and 1.7 fold in cytochrome c level was seen in cytosolic extracts after TR treatment in SiHa, Hep2 and Ca Ski cells respectively (Figure 4f) suggesting the involvement of mitochondria in TRinduced apoptosis.

A. Tiazofurin downregulated Bcl-2 and Bcl-xL expression without affecting Bax expression level Since the anti-apoptotic and pro-apoptotic proteins are important regulators of apoptosis, therefore we analyzed their expression in treated as well as control cells. We found that TR downregulated the expression of the anti-apoptotic protein Bcl-2 by 1.33, 1.49 and 1.75 fold and Bcl-xL by 1.69, 2.04and 1.32 fold in SiHa, Hep2 and Ca Ski cells respectively as seen by Western blotting.

However, no significant change in the expression level of Bax was observed in all the three cell lines (Figure 4a,b,c).

D. PARP cleavage Since PARP cleavage is one of the biochemical hallmarks of apoptosis, we investigated this cleavage in our study and measured it by western blotting. After TR treatment, a 1.47, 2.04 and 1.4 fold decrease was seen in PARP 116 KDa band in SiHa, Hep2 and Ca Ski cells respectively (Figure 4g).

E. TR increased caspase-3 and caspase-9 activity Since caspases are the key players in apoptotic cascade we investigated the effect of TR on initiator and the effector caspases. TR causes 3.09, 3.62 and 2.52 fold increase in caspase-3 activity in SiHa, Hep2 and Ca Ski cells whereas an increase of 1.81, 2.61 and 1.69 fold in Caspase-9 activity was seen after TR treatment in the respective cell lines. However, no significant increase in caspase-8 level was seen after TR treatment in all the three cell lines (Figure 5).

B. Tiazofurin treatment upregulated p53 expression, whereas it had no effect on AIF levels An increase of 2.33, 1.71 and 1.54 fold in p53 protein level was observed in TR treated SiHa, Hep2 and Ca Ski cells respectively (Figure 4d), whereas no significant difference was observed in AIF levels after TR

Figure 3. Percentage apoptosis in a) SiHa b) Hep2 and c) Ca Ski as observed by flowcytometry.

202

Gene Therapy and Molecular Biology Vol 10, page 203

Figure 4. Densitometric analysis of protein expression of a) Bcl-2, b) Bcl-xL, c) Bax, d) p53, e) AIF, f) cytochrome c (cytosolic fraction) and g) PARP in control and treated cells as measured by western blot analysis. The bars represent the mean of three independent experimentsÂą S.D. (*) indicates the statistical significance (p <0.05).

203

Pathak et al: Apoptotic signaling induced by Tiazofurin-an in vitro study

Figure 5. Caspase-3, -8, and â&#x20AC;&#x201C;9 activity assays in SiHa, Hep2 and Ca Ski cells.

and Bcl-xL, are located in the outer mitochondrial membrane and act to promote cell survival. Many of the pro-apoptotic members of the Bcl-2 family, such as Bad and Bax also mediate their effects though the mitochondria, either by interacting with Bcl-2 and Bcl-xL, or through direct interactions with the mitochondrial membrane. In the present study it seems that the observed downregulation of Bcl-2 and Bcl-xL was sufficient to cause cytochrome c release from the mitochondria, as there was no significant change in the protein expression level of Bax. In conjunction with our study there are several reports in the literature that have shown that apoptosis is induced without causing any change in Bax protein level in cerebellar granule cells (CGCs), human colorectal carcinoma (RKO) cells and in human non-small lung cancer (H520) cells (Gorman et al, 1999; Ji et al, 2001; Khanna et al, 2004).

In our study, TR induced caspase-9 activation followed by activation of downstream effector caspase-3, whereas only a limited, non-significant increase in caspase-8 was observed in all the three cell lines. Hence it appears that TR induces apoptosis via the mitochondrial pathway followed by caspase-3 activation and this activation was followed by cleavage of its substrate poly (ADP-ribose) polymerase (PARP), an enzyme involved in short-patch base excision repair. This PARP cleavage by TR in our study is contrary to a report where TR has been reported to exhibit PARP inhibitory effect (Yalowitz et al,

IV. Discussion Apoptosis is a tightly controlled multistep mechanism of cell suicide. It is critical in many physiological and pathological contexts. In pathological states, while a failure to undergo apoptosis may cause abnormal cell outgrowth and malignancy, excessive apoptosis may contribute to organ injury (Tatton and Olanow, 1999; Lowe and Lin, 2000; Strasser et al, 2000).

Tumor cells often evade apoptosis by expressing several anti-apoptotic proteins, downregulation of pro-apoptotic genes and alteration in signaling pathways thereby restricting therapy induced apoptosis. Thus insights into apoptotic mechanism and the factors that affect them is critical to design more potent, specific and effective cancer therapies.

TR, a purine nucleoside analogue with the potential for use in cancer therapy has been demonstrated to exhibit dual mechanism of action (Grusch et al, 1999). One involves the inhibition of IMPDH, the rate limiting enzyme for GTP and dGTP synthesis that plays a major role in DNA synthesis, cell proliferation and regulation, and the other causes the induction of apoptosis (Novotny et al, 2002). In the present study we analyzed the apoptotic signaling mechanism induced by TR in SiHa, Hep2 and Ca Ski cells.

Mitochondria plays an important role in the regulation of cell death. For example, anti-apoptotic members of the Bcl-2 family of proteins, such as Bcl-2

204

Gene Therapy and Molecular Biology Vol 10, page 205 Hengstschaeger M, Kruptiza G, Jayaram HN (1999) Benzamide riboside induces apoptosis independent of Cdc25A expression in ovarian carcinoma N.1 cells. Cell Death Differ 6, 736-744.

Hunakova L, Bies J, Sedlak J, Duraj J, Jakubikova J, Takacsova X, Novotny L (2000) Differential sensitivity of ovarian carcinoma cell lines to apptosis induced by the IMPDH inhibitor benzamide riboside. Neoplasma 47, 274-279.

Jayaram HN, Cooney DA, Grusch M, Krupitza G. (1999) Consequences of IMP dehydrogenase inhibition, and its relationship to cancer and apoptosis. Curr Med Chem 6, 561-574.

Ji C, Amarnath V, Peitenpol JA, Marnett LJ (2001) 4hydroxynonenal induces apoptosis via caspase-3 activation and cytochrome c release. Chem Res Toxicol 14, 10901096.

Khanna N, Jayaram HN, Singh N (2004) Benzamide riboside induced mitochondrial mediated apoptosis in human lung cancer H520 cells. Life Sci 75, 179-190.

Lowe SW, Lin AW (2000) Apoptosis in cancer. Carcinogenesis 21, 485-495.

Novotny L, Rauko P, Yalowitz JA, Szekeres T (2002) Antitumor activity of Benzamide riboside in vitro and in vivo. Curr Med Chem 9, 773-779.

Sen S, Sharma H, Singh N (2005) Curcumin enhances Vinorelbine mediated apoptosis in NSCLC cells by the mitochondrial pathway. Biochem Biophys Res Commun 33, 1245-1252.

Sharma H, Sen S, Singh N (2005) Molecular pathways in the chemosensitization of Cisplatin by quercetin in human head and neck cancer. Cancer Biol Ther 4, 949-55.

Singh N, Khanna N, Sharma H, Kundu S, Azmi S (2002) Insights into the molecular mechanism of apoptosis induced

by TNF-" in mouse epidermal JB6-derived RT-101 cells.

Biochem Biophys Res Commun 295, 24-30.

Strasser A, Oâ&#x20AC;&#x2122;conor L, Dixit VM (2000) Apoptosis signalling.

Annual Rev Biochem 69, 217-245.

Tatton WG, Olanow CW (1999) Apoptosis in neurodegenerative diseases: the role of mitochondria. Biochem Biophys Acta 1410, 195-213.

Tricot GJ, Jayaram HN, Lapis E, Natsumeda Y, Nichols CR, Kneebone P, Heerema N, Weber G, Hoffman R. (1989).

Biochemically directed-therapy of leukemia with tiazofurin, a selective blocker of inosine 5'-phosphate dehydrogenase activity. Cancer Res. 49, 3696-3701.

Wright DG, Boosalis MS, Waraska K, Oshry LJ, Weintraub LR,Vosburgh E. (1996). Tiazofurin effects on IMPdehydrogenase activity and expression in the leukemia cells of patients with CML blast crisis. Anticancer Res. 16:334951.

Wright DG, Boosalis M, Malek K, Waraska K (2004) Effects of the IMP-dehydrogenase inhibitor, Tiazofurin, in bcr-abl positive acute myelogenous leukemia. Part II. In vitro studies. Leuk Res 28, 1137-43.

Yalowitz JA, Pankiewicz K, Patterson SE, Jayaram HN (2002) Cytotoxicity and cellular differentiation activity of methylenebis (phosphonate) analogs of tiazofurin and mycophenolic acid adenine dinucleotide in human cancer cell lines. Cancer Lett 181, 31-8. Erratum in: Cancer Lett 199, 107-8.

Yuan XJ, Whang YE (2002) PTEN sensitizes prostate cancer cells to death receptor-mediated and drug-induced apoptosis through a FADD-dependent pathway. Oncogene 21, 319327.

2002). But similar to our findings there are reports in which IMPDH inhibitors have been shown to cause PARP cleavage in human ovarian carcinoma cell lines (Grusch et al, 1999; Hunakova et al, 2000). Moreover our results clearly demonstrate that caspase-8 is not a requirement for TR induced apoptosis in SiHa, Hep2 and Ca Ski cells.

Also a non-significant difference in the protein expression level of AIF was observed in untreated and treated cells therefore ruling out the possibility of involvement of this protein in TR induced apoptosis. It appears to execute apoptosis via the non-receptor mediated caspase activation which is dependent on p53, as we observed a significant increase in p53 expression levels in all the three cell lines.

Also there was a significant increase in cytochrome c after TR treatments, which further supports the involvement of mitochondria in TR induced apoptotic signaling pathway.

Similar to our findings, the IMPDH inhibitor TR has been shown to induce apoptosis in various leukemic and human colon carcinoma cell lines (Yalowitz et al, 2002; Colovic et al, 2003; De Abreu et al, 2003; Wright et al, 2004). It selectively inhibits tumor cell growth and induces apoptosis in various human tumor cell lines. IMPDH inhibitors are biochemically convenient in inhibiting parallel pathways, thus their antitumor potential is particularly high.

In conclusion, our results indicate that TR induces apoptosis via the intrinsic mitochondrial pathway in SiHa, Hep2 and Ca Ski cells. Also, the downregulation of antiapoptotic proteins such as Bcl-2 and Bcl-xL and the upregulation of p53 which accompanied with activation of initiator as well as effector caspases-9, -3 by TR suggest its potential usefulness as a therapeutic for cancer treatment.

References Ashkenazi A and Dixit VM (1998) Death receptors: signalling and modulation. Science 281, 1305-1308.

Borner C (2003) The Bcl-2 protein family: sensors and checkpoints for life or death decisions. Mol Immunol 39, 615-647.

Budihardjo I, Oliver H, Lutter M, Luo H and Whang X (1999) Biochemical pathways of caspase activation during apoptosis. Annu Rev Cell Dev Biol 15, 269-290.

Calviello G, di Nicuolo F, Piccioni E, Marcocci ME, Serini S, Maggiano N, Jones KH, Cornwell DG, Palloza P (2003) #Tocopheryl quinone induces apoptosis in cancer cells via caspase-9 activation and cytochrome C release.

Carcinogenesis 24, 427-433.

Colovic M, Sefer D, Bogdanovic A, Suvajdzic N, Jankovic G, Atkinson HD, Milenkovic P (2003) In vitro sensitivity of hematopoietic progenitors to tiazofurin in refractory acute myeloid leukemia and in the blast crisis of chronic myeloid leukemia. Cancer Lett 195, 153-159.

Gorman AM, Bonfoco E, Zhivotovsky B, Orrenius S, Ceccatelli S (1999) Cytochrome C release and caspase-3 activation during colchicines-induced apoptosis of cerebellar granule cells. Eur J Neurosci 11, 1067-1072.

Green DR, Reed JC (1998) Mitochondria and apoptosis. Science 281, 1309-1312.

Grifantini M. (2000). Tiazofurine ICN Pharmaceuticals. Curr Opin Investig Drugs 1, 257-262.

Grusch M, Rosenberger G, Fuhrmann G, Braun K, Titscher B, Szekeres T, Fritzer-Skekeres M, Oberhuber G, Krohn K,

205

Pathak et al: Apoptotic signaling induced by Tiazofurin-an in vitro study

206

Gene Therapy and Molecular Biology Vol 10, page 207 Gene Ther Mol Biol Vol 10, 207-222, 2006

Effects of spatial configuration on tumor cells transgene expression Research Article

Cecilia C. Casais, Armando L. Karara, Gerardo C. Glikin, and Liliana M. E. Finocchiaro* Unidad de Transferencia Genética, Instituto de Oncología "Ángel H. Roffo", Universidad de Buenos Aires, Argentina

__________________________________________________________________________________ *Correspondence: Liliana M. E. Finocchiaro, Ph.D, Unidad de Transferencia Genética, Instituto de Oncología "A. H. Roffo" UBA, Av. San Martín 5481, 1417 Buenos Aires, Argentina; Telephone/FAX: 54 (11) 4580-2813; Email: gglikin@bg.fcen.uba.ar Key words: multicellular tumor spheroids, persistent gene expression, non-viral vectors Abbreviations: !-galactosidase, (!gal); analysis of variance, (ANOVA); cytomegalovirus immediate early promoter, (CMVie); LM05e spheroids, (LM05e/S); monolayers, (/M); simian virus 40 early promoter/enhancer, (SV40e); spheroids, (/S); three-dimensional, (3D)

Received: 10 April 2006; Revised: 26 June 2006 Accepted: 10 July 2006 electronically published: August 2006

Summary We investigated the impact of the multicellular architecture on transgene expression of LM05e and LM3 spontaneous Balb/c-mammary adenocarcinoma and HEp-2 human laryngeal squamous carcinoma cell lines. When transferred from monolayers to spheroids, tumor cells strongly enhanced transient transgene expression, which surprisingly was still detectable 75 days after lipofection. The cytomegalovirus immediate early promoter (CMVie) yielded a very high !-galactosidase (!gal) transgene expression, which resulted 8-, 6- and 3-fold greater in LM05e, LM3 and HEp-2 spheroids than the corresponding monolayers. The SV40 early promoter displayed both, a lower spheroids/monolayers ratio and about 10% of !gal expression driven by CMVie. Cis-addition of Epstein Barr virus EBNA-1/oriP cassette enhanced the CMVie-driven transgene expression only in human HEp-2. Deletion of a 325 bp 5’ fragment of the CMVie promoter dropped spheroids !gal expression to 5%. This effect was restored to 10-25% or 25-60% by the insertion of one KCS (18 bp) or four myc-max consensus sequences (67 bp) respectively. When spheroids disassembled and grew as monolayers, !gal activity dropped accordingly. Our results demonstrated that the spatial configuration determined the expression enhancement and persistence in spheroids, being an event: fully reversible, proportional to spheroid compactness and independent of plasmid integration into the host genome.

intermediate complexity between monolayer cultures in vitro and tumors in vivo. In brief, spheroids combine the relevance of organized tissues with the controlled environment of in vitro methodology (Mueller-Klieser, 1997; Bates et al, 2000). Furthermore, they mirror the radius and chemosensitivity of differentiating tumors in vivo more closely than conventional cell cultures (Olive and Durand, 1994; Kolchinsky and Roninson 1997; Fehlauer et al, 2004). Being highly complex systems, their cellular properties are dependent on the origin of the tumor cells, their transformation state, and medium and growth conditions.

Non-viral vectors such as cationic lipids have important safety advantages over viral approaches, including their reduced immunogenicity, low cytotoxicity and minimal capacity for insertional mutagenesis (Glover et al, 2005). Although the efficacy of new cationic lipids

I. Introduction Multicellular spheroids are tissue-like structures of cells, with no artificial substrate for cell attachment (Mueller-Klieser, 1997). These cell aggregates organized in vitro have a great potential for a number of clinical and biomedical applications (Sutherland, 1998; Santini and Rainaldi, 1999). This three-dimensional (3D) cell system has been widely used as a model for microenvironmental effects on basic biological mechanisms, such as the regulation of proliferation, metabolism, differentiation, cell death, invasion, angiogenesis or immune response (Bates et al, 2000; Fehlauer et al, 2004). Compared to conventional monolayer cultures, 3D-cell aggregates resemble more closely the in vivo situation with regard to cell shape and cell environment, which in turn can affect gene expression and biological behavior of the cells. These 3D-structures offer a versatile in vitro system of 207

Casais et al: Transgene expression in multicellular spheroids formulations is comparable to adenovirus vectors, it takes many more copies of transgene to achieve a comparable expression. Despite the relative in vivo efficacy and variability frequently associated to these non-viral vectors, that varies greatly depending on the targeted tissue, many groups have demonstrated clinical efficacy using intratumor cationic lipid mediated gene transfer (Gottesman 2003; Yoshida et al, 2004; O’Malley et al, 2005).

We have developed 3D-cell cultures established from LM05e and LM3 spontaneous Balb/c murine mammary adenocarcinoma cell lines (Karara et al, 2002; Finocchiaro et al, 2004) and from HEp-2, a well-established human derived laryngeal squamous carcinoma tumor cell line, as models to investigate how the spatial configuration of cells affects the expression level of a transfected gene.

In this work we present evidence showing that transiently lipofected tumor cells, when transferred from 2D- to 3D-cultures, displayed higher and prolonged expression achieved by non-viral plasmid-based vectors.

This enhancement was reverted when the spheroids were disassembled and reorganized as monolayers, and would occur independently of vector structure or integration into the host genome.

gene. After deleting in CMVie the Eco RI – Nco I 5’- fragment (326 bp), oligodeoxynucleotides carrying (i) 4 copies of the mycmax consensus binding sequence (bold) (Sugaya et al, 1996): 5’AATTCCCACCACGTGGTGCCTCCCACCACGTG GTGCCTCCCACCACGTGGTGCCTCCCACCACGTGGTG CCTC-3’ or (ii) one copy of the kinase consensus sequence (KCS, bold) (Kuhen et al, 1998): 5’-AATTCAGGGAAGG CGGAGTCCAAC-3’ were ligated to replace the removed fragment yielding pMYCCMV! and pKCSCMV! respectively. (iii) Fill-in and self-ligation of the Eco RI – NcoI sites yielded p"5´CMV!. On the other hand, the full-length CMVie promoter was deleted in pCMV! (between Eco RI and Sac I sites) and replaced by (iv) an oligodeoxynucleotide preserving the CMVie sequences TATA-BOX and Sp1-CS2, obtaining pTATA!. (v) By inserting in pTATA! the oligodeoxynucleotide with the 4 copies of the myc-max consensus sequence upstream of the TATA-BOX and Sp1-CS2 sequences, we obtained pMYCTATA!. pCMVGM was obtained by replacing the lacZ gene in pCMV! by the hGM-CSF gene. A Not I - Not I fragment containing the lacZ gene was deleted from pCMV! and replaced by a suitable multiple cloning site, in which an Xho I - Hind III fragment containing the hGM-CSF gene was inserted. In a similar way, we replaced the lacZ gene in pCH110 (Kpn I - Bam HI fragment) by the hGM-CSF gene through an intermediate multiple cloning site, creating pSVGM. Plasmids were amplified, grown and purified as described (Finocchiaro et al, 2004). Plasmid constructs used in this work are schematically depicted in Figure 1.

II. Materials and Methods A. Cell cultures and growth Cell lines derived from M05 (LM05e), M3 (LM3) and M38 (LM38) spontaneous Balb/c murine mammary adenocarcinomas; B16-F10 C57 murine melanoma (ATCC #CRL-76475), and HEp-2 (human laryngeal squamous carcinoma, ATCC #CCL-23) were cultured as monolayers and multicellular spheroids as described (Karara et al, 2002, Finocchiaro et al, 2004). The size of growing spheroids was estimated during a period of 75 days as the average of two diameters and the results were expressed as mean (of a minimum of 20 spheroid diameters) ± s.e.m. (n=4 independent assays).

D. Liposome lipofection

preparation and in vitro

DC-Chol (3!(N-(N',N'-dimethylaminoethane)-carbamoyl cholesterol) and DMRIE (1,2-dimyristyloxypropyl-3-dimethylhydroxyethilammonium bromide) were synthesized and kindly provided by BioSidus S.A. (Buenos Aires, Argentina). DOPE (1,2-dioleoyl-sn-glycero-3-phosphatidyl ethanolamine) was purchased from Sigma (St Louis, MO). Liposomes were prepared at lipid/co-lipid molar ratios of 1:1 (DMRIE:DOPE) or 3:2 (DCChol:DOPE) by sonication as described (Felgner et al, 1994; Gao and Huang, 1995). Optimal DNA:lipid ratios and lipid mixtures were determined for every cell line: LM05e and HEp-2 cells were transfected with a mixture of 3:1 DC-Chol:DOPE/ DMRIE:DOPE at 1:4 µg DNA/nmol lipid, and LM3 cells were transfected with an equimolar mixture of DCChol:DOPE/DMRIE:DOPE at 1:6 µg DNA/nmol lipid.

Lipoplexes (0.5 µg DNA/cm2) were prepared in 0.1 M Na2HPO 4/NaH2PO 4 buffer (pH 7.3) and applied to cultured cells at a density of 3x104 cells/cm2 (about 30% confluence) in a serum-free medium (OptiMEM, Gibco-BRL, Gaithersburg, MD).

In co-lipofections, 0.25 µg DNA/cm2 of each plasmid was used.

After 6-8 hours, the lipofection mixture was removed and medium with serum was added. 12-18 hours later, lipofected cells were trypsinized and some of them were seeded on the top of solidified agar to form spheroids (2-3 x 105 cells/ml) while the remaining ones were kept in monolayer cultures on regular plates (2-3 x 104 cells/cm2). Cells were incubated in regular culture conditions. Twice a week, culture medium was totally (monolayers) or partially (spheroids) replaced.

For stable expression, cells were lipofected with hIL-2 or lacZ gene carried by pRc/CMV (Invitrogene) as described above.

After 48 h cells were selected with medium containing 500-700 µg/ml geneticin (Gibco-BRL). Single clones were isolated and tested for their hIL-2 or !gal expression by ELISA or ONPG assays as described below.

B. DNA synthesis determinations DNA synthesis was evaluated in cells seeded as spheroids in 96-well plates (5x104 cells/well) by 3H-thymidine (New England Nuclear, Boston, MA; 1 Ci/mmol) incorporation as described (Finocchiaro et al, 2004). 3H-thymidine (0.3 µCi/well) was added to the cultures at 8, 15, 30, 45 and 60 days and incubation lasted for 72 hours. Cells were harvested and radioactivity was measured in a !-scintillation counter.

C. Plasmids Plasmids pCMV! (MacGregor and Caskey, 1989) and pCH110 (Hall et al, 1983) are commercial (Clontech, Mountain View, CA), carrying the E. Coli lacZ gene under CMVie and SV40e promoters respectively.

An Eco RI fragment containing the human Epstein-Barr virus oriP and EBNA-1 gene (under its own promoter) from p205MTCAT (Yates et al, 1985) was cloned at the Eco RI site of pCMV!, yielding pEBCMV!.

A Sal I – Bst YI fragment containing the human EpsteinBarr oriP and EBNA-1 gene from pREP4 (Invitrogen, Carlsbad, CA) was cloned together with a Sal I - Bam HI fragment containing the CMVie promoter from pRc/CMV (Invitrogen) at the Sal I site of pCMV!, yielding pEB2CMV!. In this plasmid EBNA-1 is under the CMVie promoter.

We created a series of promoter constructs containing various lengths of the CMVie promoter upstream of !gal reporter

208

Gene Therapy and Molecular Biology Vol 10, page 209

Figure 1. Plasmids. CMVie: human cytomegalovirus immediate-early promoter. lacZ: E. Coli lacZ gene (coding for !-galactosidase). pUC: prokaryotic plasmid backbone.

EBNA-1: Epstein-Barr virus nuclear antigen 1 gene. EBNA-1pr: EBNA1 promoter. oriP: Epstein-Barr virus eukaryotic origin of replication.

3'CMV: 3' region of CMVie promoter (Nco I - Sac I fragment).

4myc: 4 copies of the myc-max consensus binding sequence. KCS: KCS consensus sequence. TATA: Sp1-CS2 and TATA-box CMVie sequences. SV40e: Simian Virus 40 early promoter. hGM-CSF: human granulocyte-macrophage colony stimulating factor gene. pBR322: prokaryotic plasmid backbone. (See Materials and Methods for detailed construction)

described, and genomic (Maniatis et al, 1982) and episomal (Hirt, 1967) DNA was extracted by standard methods. Portions (8 to 15 µg) of DNA were digested with Hind III, and fragments were electrophoresed on a 0.8% agarose gel and subjected to standard Southern transfer onto positively charged nylon membranes (GeneScreen, New England Nuclear). Hybridization was performed with a 32P-radiolabeled Eco RV - Sac I fragment (825-bp probe) of the lacZ gene contained in all !gal plasmids used.

E. !-Galactosidase assays To measure gene transfer efficiency, lipofected cells were trypsinized, fixed in suspension, stained with 5-bromo-4-chloro3-indolyl !-D-galactopyranoside (X-Gal, Sigma) by standard methods (Teifel and Friedl, 1995; Finocchiaro et al, 2004) and counted. The same fixation and staining procedure was performed onto spheroids in suspension for micrography (Finocchiaro et al, 2004).

For quantitative gene expression, trypsinized monolayers and untreated spheroids were collected, washed with PBS and divided in two fractions. One fraction was resuspended in hypotonic solution (10 mM HEPES, 10 mM KCl, 0.1 mM EDTA, 1 mM PMSF and 1 mM DTT) and sonicated for 5 seconds, and !gal activity was assayed with orthonitrophenyl 1!-D-galactopyranoside (ONPG, Sigma) as described (Teifel and Friedl, 1995; Finocchiaro et al, 2004). The remaining fraction of each sample was resuspended in 0.1 N NaOH and total protein was measured as described (Bradford, 1976). Specific !gal activity was expressed as mU !gal/mg protein, as the mean ± s.e.m. of n independent assays measured by triplicate.

H. Statistical analysis Results were expressed as mean ± standard error of the mean (s.e.m.) (n: number of experiments corresponding to independent assays). Differences between groups were determined by analysis of variance (ANOVA).

III. Results and Discussion A. Tumor cells grew multicellular spheroids

in

vitro

as

LM3, LM05e and LM38 (murine mammary adenocarcinomas), B16 (murine melanoma), and HEp-2 (human laryngeal squamous carcinoma) cells readily formed spheroids when plated on the top of solidified agar. While LM05e and LM3 spheroid cells appeared intimately associated with each other and closely packed, HEp-2 formed more loosely associated cell aggregates in which single cells could be clearly distinguished (Figure 4). B16 initially formed lax aggregates, which became more compact beyond day 15 (Finocchiaro et al, 2004), and LM38 spheroids resulted similar to HEp-2 aggregates (data not shown).

Spheroids obtained from LM05e, LM3 and HEp-2 tumor cell lines revealed different growth potential (Figure 2). LM3 and HEp-2 aggregates showed extensive growth, increasing their diameter about 2.5-fold from day 4 to day 40, when they reached a plateau up to day 75.

Conversely, compact LM05e spheres showed only a slight increase of 1.3-fold in diameter from day 4 to day 20, and then they reached a plateau up to day 75 (Figure 2a).

F. ELISA hGM-CSF assay Human recombinant GM-CSF secreted to the culture medium was assayed by ELISA. Briefly, assays were performed in 96-well plates coated overnight at 4°C with 0.4 µg/well antihGM-CSF monoclonal antibody (R&D, Minneapolis, MN).

Plates were subsequently blocked at room temperature with 2% BSA in PBS for 2 h. hGM-CSF samples and standards (purified recombinant hGM-CSF, R&D) were added and incubated overnight at 4°C. Then the samples were consecutively incubated with a biotinylated polyclonal anti-hGM-CSF antibody (20 ng/well) (R&D), streptavidin-peroxidase conjugate (Sigma) and a colorimetric substrate (OPD: o-phenylenediamine dihydrochloride, Gibco BRL). Absorbance was measured at 490 nm. Total protein was measured as described above. hGM-CSF levels were expressed as ng/mg protein/day, as the mean ± s.e.m. of n independent assays measured by triplicate.

G. Southern blot analysis Cells were lipofected with pCMV! or pEBCMV! plasmids, cultured as spheroids over a 40-day period as

209

Casais et al: Transgene expression in multicellular spheroids 3D cell aggregates incorporate less 3H-thymidine than an equivalent amount of the corresponding monolayers (Finocchiaro et al, 2004). The rate of 3Hthymidine incorporation into DNA correlated with the diameter increase during the spheroid growing phase.

Whereas LM05e spheroids (LM05e/S) displayed a very low 3H-thymidine incorporation rate over time, both LM3/S and HEp-2/S showed an initial higher rate at day 8 followed by a steady lower rate up to day 60 (Figure 2b).

HEp-2/S doubled the LM3/S 3H-thymidine incorporation as total protein did, while both spheroids had similar 3 diameters.

Therefore, the higher H-thymidine incorporation by HEp-2/S should reflect a higher number of spheroids. LM05e/S showed low total amounts of protein, which correlates to their small size.

Total protein remained relatively constant over time in HEp-2/S and LM3/S, suggesting balanced growth and death rates. On the other hand, LM05e/S total protein decreased gradually over time, reaching 50% of the initial value at day 75. Considering that LM05e/S size did not decrease, this protein decay would be due to death of some small spheroids (Figure 2c).

B. Spheroids displayed enhanced and persistent transgene expression In a previous study, we demonstrated that CMViedriven transgene expression in LM05e, LM3 and B16 spheroids was considerably higher than in their respective monolayers (Finocchiaro et al, 2004). To address this issue in greater detail, we compared the temporal course of CMVie and simian virus 40 early promoter/enhancer (SV40e) driven !gal expression in cells grown as monolayers (/M) or spheroids (/S).

Before the development of long-lasting multicellular spheroid cultures generally, it was not possible to keep viable cells for more than two weeks in culture without active cell division, and transgene expression rapidly diluted over time. On the other hand, monolayers replating abolished most of transgene expression, which decreased between 10 to 100 times after two passages (data not shown). Therefore, we worked with monolayers that became mostly quiescent after reaching confluence, showing growth kinetics similar to spheroids: LM05e/M, LM3/M and HEp-2/M total protein increased 40, 50 and 70% respectively from day 8 to 15. A major advantage of spheroids is that they could be kept viable without replating for more than 75 days, while unreplated monolayer cultures started to detach and die beyond 15 days.

Figure 2. Growth parameters in spheroids. (a) Time course of spheroids growth curves. Average spheroid diameters were calculated over 20 measurements in 4 independent assays.

LM05e (!); LM3 (!); HEp-2 (!). LM3 and HEp-2 vs.

LM05e: p<0.01.(b) 3H-thymidine incorporation into spheroids DNA. LM05e (black bars), LM3 (gray bars) and HEp-2 (white bars) spheroids were 72 h pulsed with 3Hthymidine and harvested at each time point as described in Materials and Methods. Each point represents the mean Âą s.e.m. of 4 determinations of the amount of 3H-thymidine incorporated into DNA. * p < 0.05 and ** p<0.01: with respect to LM05e o p < 0.05 and oo p<0.01: with respect to LM3 (c) Time course of spheroids total protein. LM05e (!); LM3 (!); HEp-2 (!). Each value represents mean plus s.e.m. of 9 independent assays. LM3 and LM05e vs. HEp-2: p<0.05.

210

Gene Therapy and Molecular Biology Vol 10, page 211 As shown in Figure 3a-c, the CMVie promoter directed higher-level reporter activity in cells grown as spheroids when compared to the same cells cultured as monolayers, displaying cell line specific patterns. In LM05e/S, !gal activity showed the highest expression levels with a maximum at day 8 after lipofection followed by a continuous decay that reached 10% of the maximal activity at day 75. LM3/S displayed a similar pattern with maximal !gal activity at days 4-8, and about 40% lower than LM05e/S. Then a relatively fast decay up to day 30 followed by a slow decay dropped the activity to 8% of the maximal activity at day 75. On the other hand, HEp-2/S

presented constant activity during the first 30 days after lipofection, followed by a slow decay that reached 37% of the maximal activity on day 75. Although HEp-2/S initial expression levels were only 10% of those of LM05e/S and about 20% of LM3/S, their slower decay over time determined that at day 75 HEp-2/S expression was similar to LM3/S and near 40% of LM05e/S. In Figure 5a-c, pEBCMV! was compared to pCMV!. As expected, replicating pEBCMV! carrying an EBNA-1/oriP cassette displayed very different !gal activity patterns in rodent and human cells. In HEp-2

Figure 3. Effect of culture configuration on !gal reporter gene expression. Cultured cells were in vitro lipofected with pCMV! (n=14) or pCH110 (n=6) plasmids as indicated. Twenty-four hours later, part of the cells was then seeded on coated plates as spheroids (/S), while the other part was kept as monolayers (/M). In each time point, cells were homogenized and assayed for !gal activity as described in Materials and Methods. (a-c) Spheroids and monolayers !gal specific activity: expressed as mU/µg protein ± s.e.m of (n) independent assays after correction for background (pCMV!: n=14; pCH110: n=6). Spheroid pCMV! vs. pCH110: p<0.01 in the 3 cell lines. pCMV!: S (•)vs. M (!): p<0.01 in the 3 cell lines. pCH110: S (o)vs. M ("): p<0.01 in LM05e and LM3 from day 8 to 15. (d) Spheroids !gal total activity: expressed as mU ± s.e.m. of 14 independent assays after correction for background. LM05e (!) and LM3 (!)vs. HEp-2 (!): p<0.01 up to 15 days after lipofection.

211

Casais et al: Transgene expression in multicellular spheroids Although !gal activity in spheroids decreased over time, it is noteworthy that expression at day 75 was similar to monolayer expression at days 4-8 in all cell lines tested.

At day 4, !gal specific activity displayed by pCMV! resulted about 8-fold (LM05e), 6-fold (LM3) and 3-fold (HEp-2) greater in spheroids than the corresponding monolayers. In addition, pCMV! expression levels were longer standing in 3D- than 2D- cultures: at day 15, !gal activity was 109% (LM05e/S), 63% (LM3/S) and 117% (HEp-2/S) of that at day 4, while in monolayers, !gal activity relative to day 4 was 34, 21 and 45%, respectively.

Taken together, these differences in levels and persistence of expression determined that, at day 15, !gal activity resulted 26-fold (LM05e), 14-fold (LM3) and 7-fold (HEp-2) greater in spheroids than in the corresponding monolayers. As it was the case in spheroids, monolayer maximal !gal activity in HEp-2 was lower than LM05e and LM3 (32 and 24% respectively).

The effect of spatial configuration resulted less dramatic when !gal was driven by SV40e promoter (pCH110), whose expression levels in spheroids were about 10% of pCMV!. Spheroid !gal expression was relatively constant over time in LM05e and HEp-2 cells, falling about 30% at day 15 in LM3.

In monolayers, differences between pCH110- and pCMV!- driven expression were smaller, with pCH110 displaying at day 4 after lipofection 26% of pCMV! activity in LM05e/M, 10% in LM3/M and 13% in HEp2/M. SV40e-driven !gal activity was maximal in LM05e/M and LM3/M at day 4 followed by a 50% diminution at day 8 when a plateau was reached, while in HEp-2/M it remained constant from day 4 to day 15.

In both LM05e/S and LM3/S, SV40e-driven !gal activity was significantly higher, but in HEp-2/S was only slightly higher than their respective monolayers.

So, lower monolayers !gal expression with the two plasmids tested, was probably due to: (i) the decline in the percentage of transfected cells by transgene dilution during replication of the target population, and/or (ii) loss of the transgene by nuclease digestion or partitioning to non-nuclear compartments.

In general terms, cells growing as spheroids expressed significantly higher levels of !gal than the same cells in monolayers in all the assayed conditions, suggesting that 3D-configuration strongly enhanced transgene expression.

On the other hand, total spheroid !gal activity (mU) displayed a similar pattern to !gal specific activity (mU/mg protein). Maximal !gal total activity driven by CMVie promoter was comparable in LM05e/S and LM3/S (about 23 and 17 mU respectively) and much lower (about 6 mU) in HEp-2/S that displayed steady values from day 4 to 45 followed by a slow decay up to 50% on day 75.

Nevertheless, total activity levels in the three assayed cell lines converged beyond day 45 (Figure 3d). It is worth to note that the relative values of maximum spheroid specific activity (mU/mg protein) among cell lines were maintained when expressed as total !gal activity (mU), demonstrating that they were not artificially produced by the differences in protein levels and that could be

attributed to actual variations of transgene expression.

Therefore, we might suppose that the high expression in LM05e/S is a consequence of their low growth rate, slow plasmid loss kinetics and/or to the availability of the transcription/translation cellular machinery in quiescent cells. However, LM3/S have a growth pattern similar to HEp-2/S, but LM3/S maximum expression levels are about 6-fold higher than HEp-2/S and only 40% lower than LM05e/S, suggesting that a high expression rate is not in direct correlation with slow growth kinetics. On the other hand, taking into account that LM05e/S and LM3/S are clearly more compact than HEp-2/S, it can be suggested that the high expression correlates with the degree of compactness. Indeed, B16 (Finocchiaro et al, 2004) and LM38 (data not shown) spheroids, which are initially poorly compacted, display low initial expression levels.

The effects of spatial configuration on !gal reporter gene expression were confirmed by X-Gal staining of !gal-lipofected cells (Figure 4). The amount of X-Gal stained cells, clustered in defined regions throughout the spheroid, increased from day 1 to 15 after lipofection, and then displayed a first fast diminution from day 15 to 30 followed by a slow decay from day 30 to 75.

C. The EBNA-1/oriP cassette increased the CMVie-driven !gal long-term expression in human cells Since persistent gene expression is required for some applications of gene therapy, we assayed the effect of some persistence elements and factors. We constructed pEBCMV!, an Epstein-Barr virus (EBV)-based vector carrying the EBV latent origin of replication for episomal persistence, oriP (about 2200 bp) and a replication initiation factor, EBNA-1 (EBV-encoded nuclear antigen 1). By binding to the cis-acting viral DNA element oriP in the Epstein-Barr virus genome, EBNA-1 enables plasmids to persist as multicopy episomes that attach to chromosomes during mitosis and enhances transcription from these EBV episomes (Yates et al, 1985; Kaneda et al, 2000; Tu et al, 2000).

In HEp-2 human cells, when equipping the plasmid with this cassette (pEBCMV!), there was a significant expression increase both in monolayers and spheroids from day 4 to 15. In HEp-2/S, !gal activity increased about 2-fold from day 4 to 15 after lipofection; then it reached a steady state up to day 30 when it started a slow decrease up to day 75 (about 70%). In murine LM3/S and LM05e/S, the cis-addition of the EBNA-1/oriP sequences not only did not modify pCMV! !gal expression in LM3/S but resulted in about 32% diminution with respect to pCMV! in LM05e/S, probably because the expression of EBNA-1 gene was employing an important fraction of the spheroid cellular machinery involved in gene expression and/or because of larger plasmids lower lipofection efficiency (Figure 5d). After high initial levels from day 4 to 15, !gal activity promptly decreased (about 90%) between day 15 and 75 in LM50e and LM3 spheroids since mouse genomes do not possess elements that allow replication and further segregation of the

212

Gene Therapy and Molecular Biology Vol 10, page 213

Figure 4. Distribution of long-term !gal expression in spheroids. Representative micrographs of X-Gal stained LM05e, LM3 and HEp-2 spheroids at 4; 8; 15; 30; 45 and 60 days post-lipofection with pCMV!. Cells were transfected in vitro with lipoplexes containing pCMV!, harvested 24 h later and seeded on coated plates as multicellular spheroids. At each time point, specimens were fixed in suspension and stained with X-Gal, as described in Materials and Methods. The dark spheroid areas indicate !-galactosidase activity.

213

Casais et al: Transgene expression in multicellular spheroids

Figure 5. Effect of EBNA1/oriP persistence elements on !gal expression. (a-c) Time course of specific !gal reporter activity following lipofection with pCMV! (#,"), pEBCMV! ($,"), pEB2CMV! (",#) or pCMV!+pCMVGM (pCMV!/2) (%,&) plasmids in LM05e (a), LM3 (b) and HEp-2 (c) cells cultured as spheroids (main plot, black symbols) or monolayers (inserted plot, open symbols). At the indicated times, cells were homogenized and assayed for !gal activity as described in Materials and Methods. Results were expressed as mU of !gal activity/mg protein ± s.e.m. of (n) independent assays after correction for background (pCMV!: n=14; pEBCMV!: n=9; pEB2CMV!: n=8).

Showing the P-values obtained by ANOVA test PLASMID \ CELLS pCMV! vs. pEBCMV! pEB2CMV! pCMV!/2 pCMV!/2 vs. pEBCMV! pEB2CMV!

Spheroids n.s.

LM05e Monolayer n.s.

p<0.05 (days 4-30) p<0.01 (days 4-45) p<0.01 (days 4-15) p<0.01 (days 4-15)

n.s.

Spheroids n.s

LM3 Monolayer n.s.

p<0.05 (days 4-8)

p<0.05 (days 4-45) p<0.01 (days 4-45)

n.s. p<0.05 (days 4-8)

p<0.05 (days 4-8) p<0.05 (day 8)

p<0.01 (days 4-15) p<0.05 (day 8)

p<0.01 (days 4-8) p<0.05 (days 4-8)

HEp-2 Spheroids Monolayer p<0.05 p<0.05 (days 8-60) (day 15) n.s p<0.05 (day 4) p<0.01 p<0.01 (days 4-8) p<0.01

p<0.01

p<0.01

n.s.

(d) Effect of EBNA1/oriP cassette on gene transfer efficiency: LM05e (gray bars), LM3 (white bars) and HEp-2 (light gray bars) cells transfected with pCMV!, pEBCMV! or pEB2CMV! lipoplexes were stained with X-Gal 48 h later and counted as described in Materials and Methods. The results were expressed as % of X-Gal blue staining cells ± s.e.m. of (n) independent experiments (pCMV!: n=16; pEBCMV!: n=9; pEB2CMV!: n=8). + p < 0.05 and ++ p<0.01: with respect to pCMV! in the same cell line. o p < 0.05 and oo p<0.01: with respect to LM05e/S respective plasmid.

214

Gene Therapy and Molecular Biology Vol 10, page 215 replicated EBV oriP plasmids to daughter cells upon cell division (Yates et al, 1985; Tu et al, 2000). Despite the differences observed between pCMV! and pEBCMV! expression in spheroids at earlier times after lipofection, in the three cell lines values tended to converge on day 75.

On the other hand, in monolayers from day 4 to 15, pEBCMV! !gal activity decreased about 50% in LM05e and 70% in LM3 cells, while remained constant in HEp-2 cells.

As it was the case with pCMV!, pEBCMV! also displayed a remarkable increase of specific activity in spheroids with respect to monolayers: about 7-fold for LM05e, 5-fold for LM3 and 4-fold for HEp-2 at day 8. In an EBNA-1/oriP construct, the replacement of EBNA-1 promoter by the stronger CMVie promoter resulted in a 20-fold increase in EBNA-1 expression (Kaneda et al, 2000; Tu et al, 2000). So, to investigate if a higher amount of EBNA-1 could induce a greater enhancement of transgene expression, we constructed pEB2CMV!, a plasmid similar to pEBCMV! but with EBNA-1 under CMVie promoter. However, this construct resulted in less efficient !gal expression in the three cell lines (Figure 5ac), suggesting that (i) the amount of this regulating protein driven by its own original promoter was already enough for maximal !gal activity driven by CMVie; (ii) an excessive amount of EBNA-1 bound to oriP might inhibit nuclear retention and/or migration of the plasmid, presumably because of the formation of large complexes that cannot pass through the nuclear pore (Kaneda et al, 2000), (iii) the presence of this second CMVie promoter, competing for the same factors and (iv) of this CMViedriven gene competing for the transcription/translation machinery, had a significant inhibitory effect on !gal expression. A similar effect was observed with pCMV! !gal expression, when co-transfected with a second plasmid carrying the human granulocyte-macrophage colony stimulating factor (hGM-CSF) gene under CMVie promoter. As shown in Figure 5a-c, co-expression of hGM-CSF under CMVie promoter caused a dramatic inhibition of !gal activity (about 90% inhibition in LM05e/S and LM3/S (day 8), and 70% in HEp-2/S (day 15)). This exceeded the expected diminution in expression levels due to half amount of plasmid used in co-lipofection experiments.

However, pEB2CMV!-driven !gal expression in spheroids and monolayers was higher than !gal expression in pCMV!+pCMVGM co-lipofection (Figure 5a-c). In spheroids, these differences were about 6-fold in LM05e, 2-fold in LM3 and 3-fold in HEp-2 at day 8, while beyond 45 days values tended to converge. In monolayers this effect was weaker: pEB2CMV!-driven !gal expression was about 2-fold (LM05e), 3-fold (LM3) and 1.5-fold (HEp-2) higher than !gal expression from pCMV!+pCMVGM at day 8.

On the other hand, in each cell line, lipofection efficiency measured as X-Gal stained cells at day 1 partially correlated with !gal specific activity measured by the ONPG method (Figure 5d). Despite the fact that pCMV! displayed the highest efficiencies, larger pEB2CMV! and pEBCMV! plasmids resulted about 5560% of pCMV!. The relative strengths of the constructs in

different cell lines were approximately the same, with LM05e being the most efficient for transgene expression followed by HEp-2 and LM3 (about 30 % of LM05e). It is worth to note that while LM3 and HEp-2 cells displayed similar lipofection efficiencies, the significantly higher total and specific !gal expression in LM3/S with respect to HEp-2/S would be related to the degree of spheroid compactness.

D. Persistent reporter activity was due to sustained transgene expression To evaluate if !gal activity persistence was due to sustained transgene expression in addition to slow foreign protein turnover in the cytoplasm, we also analyzed the long-term expression of a secreting gene product such as hGM-CSF. By co-lipofection of pCMV! and pCMVGM, intracellular !gal expression was paralleled to extracellularly secreted cytokine produced by the hGMCSF gene. As it occurred for !gal, the maximal hGM-CSF production in LM3 and LM05e spheroids appeared between days 4 and 15 with a fast decay up to day 30 followed by a slower decay up to day 75 (Figure 6a).

Since 24 h hGM-CSF secretion after renewing the culture medium reflects the actual transgene expression rate, the equivalent kinetics of both transgenes in LM3 and LM05e spheroids confirmed that persistence was mainly due to continuous gene expression. But HEp-2 spheroids, whose expression levels were markedly lower than those of LM05e (about 10%), showed a maximal hGM-CSF production at day 4 followed by a continuous decay that dropped the expression to 5% of the initial level at day 40.

When comparing the expression patterns of both transgenes, we can see that in HEp-2 cells hGM-CSF production dropped faster than !gal activity. Since the half-life of the !-galactosidase enzyme in some cell lines could reach several days (Klunder and Hulser, 1993), we can assume that persistence of HEp-2 !gal activity was partially due to its stability in cytoplasm. On the other hand, the continuous and long-term exposure of spheroid cells to high levels of secreted hGM-CSF could display unspecific mild toxic effect leading to down regulate its own expression or to hGM-CSF degradation. This result obtained with in vitro cultured HEp-2 spheroids strikingly paralleled in vivo G-CSF expression as measured in serum after i.v. injections of the G-CSF gene containing lipoplexes specially devised for long-term expression (Tu et al, 2000).

At day 8, monolayers displayed lower hGM-CSF production than spheroids in LM05e (about 3-fold) and in LM3 (about 20-fold), as occurred with !gal activity.

Conversely, at day 4 the hGM-CSF production resulted equivalent in HEp-2 spheroids and monolayers. But in all cell lines monolayers production immediately dropped, while spheroid hGM-CSF production did it smoothly. This gave rise to greater differences between spheroids and monolayers at day 15: at this time, S/M production ratios were 118 for LM3, 20 for HEp-2 and 7 for LM05e.

As it was the case with the !gal gene, SV40e promoter drove a significantly lower hGM-CSF production than CMVie promoter with similar decay kinetics in all cell lines), and this

production was lower in monolayers than in spheroids, 215

Casais et al: Transgene expression in multicellular spheroids except in LM05e cells, where both S and M displayed

similar production levels (Figure 6d-f).

Figure 6. Expression analysis of secreting human GM-CSF gene product. (a-c) Time course of specific !-galactosidase activity and hGM-CSF production after co-lipofection with pCMV! (circles) + pCMVGM (triangles) plasmids in LM05e, LM3 and HEp-2 cells cultured as spheroids (/S, black symbols) or monolayers (/M, open symbols). Data are expressed as a percentage over the !-gal activity or hGM-CSF production in spheroids at day 4. Each value represents mean ± s.e.m. of (n) independent assays (pCMV!: n=20; pCMVGM: n=9). Maximal !-gal activities (mU/mg protein): 64 (LM05e/S), 67 (LM3/S) 23 (HEp-2/S). Maximal hGM-CSF production (ng/106cells/day): 1568 (LM05e/S), 1185 (LM3/S), 783 (HEp-2/S). pCMV! vs. pCMVGM: p<0.01 at days 15 to 75 in HEp-2/S. pCMV! vs. pCMVGM: p<0.01 at days 8 to 15 in HEp-2/M. (d-f) Time course of hGM-CSF specific production after co-lipofection with pCMV! + pCMVGM (triangles) or pCH110 + pSVGM (squares) plasmids in LM05e, LM3 and HEp-2 cells cultured as spheroids (/S, black symbols) or monolayers (/M, open symbols). Each value represents mean ± s.e.m. of (n) independent assays (pCMVGM: n=9; pSVGM: n=4). pCMVGM vs. pSVGM: p<0.01 in the 3 lines.

216

Gene Therapy and Molecular Biology Vol 10, page 217 of plasmid DNA; (iii) transgene expression was dependent on the promoter and the number of regulating sequences; and (iv) spheroids always displayed higher transgene activity than the corresponding monolayers.

Here, we demonstrated that cells assembled as spheroids strongly enhanced transgene expression of all the tested plasmids, but perhaps the most surprising finding was that reporter expression was still detectable 75 days after lipofection. As far as we know, such in vitro persistent transgene expression from non-viral vectors has not been reported previously.

E. The full-length CMVie promoter mediated maximal transgene expression in spheroids The control of transgene expression is a complex process, dependent in part on the availability and/or activity of cellular factors and proximal sequences necessary for promoter function. The full-length CMVie promoter mediated a very high spheroid transgene expression of plasmid DNA for prolonged periods. To characterize some properties of CMVie promoter (533 bp), we designed a series of constructs derived from pCMV! (Figure 1) containing various lengths of the CMVie promoter upstream of !gal reporter gene: (i) p!5'CMV!: a construct containing the 3’ region of CMVie promoter that goes from Nco I to Sac I sites (208 bp), where the 5’ region between EcoR I and NcoI sites (325 bp) was deleted. This deleted region was substituted by (ii) four tandem repeats containing the myc-max consensus binding sequence (Sugaya et al, 1996), yielding pMYCCMV!, or (iii) 1 copy of the KCS sequence (Kuhen et al, 1998) (which binds factors released in presence of !-IFN), yielding pKCSCMV!. On the other hand, (iv) the fulllength CMVie promoter was deleted and replaced by a minimal promoter containing the 3´CMVie sequences TATA-BOX and Sp1-CS2, obtaining pTATA!; and then (v) four tandem repeats of myc-max consensus binding sequence were added upstream, yielding pMYCTATA!.

The reporter gene activity of all these constructs was evaluated in monolayers and spheroids over a 75-day period (Figure 7).

Deletion of a 325 bp Eco RI - Nco I fragment (p!5'CMV!) strongly dropped the expression of the reporter gene driven by CMVie promoter in the three cell lines, either cultured as spheroids (more than 95% inhibition) or monolayers (about 80-85% inhibition). The insertion of 4 myc-max consensus sequences (67 bp) partially restored the CMVie promoter strength: 25% in LM05e/S and 50-60% in LM3/S and HEp-2/S. Since mycmax levels arise with proliferation and apoptosis, the lower activity of this construct in LM05e could be due to the lower growth rate of these cells as spheroids.

Conversely, in monolayers this restoration was nearly total at day 4 in LM05e and HEp-2. Probably these cells express higher levels of myc-max proteins while proliferating.

The insertion of only 18 bp of the KCS sequence restored about 10-25% (spheroids) and 25-60% (monolayers) of the CMVie promoter activity. This specific behavior would be due to different levels of regulatory factors binding to promoters in 2D- and 3Dcultured cells.

On the other hand, because of the lack of enough regulatory elements, pTATA! could support only 10% of the pCMV! expression even after the insertion of 4 mycmax sequences (pMYCTATA!).

Four important conclusions may be drawn from these data: (i) the composition of the expression cassette was a major determinant of the levels of transgene expression, but did not affect its time extent; (ii) the full-length CMVie promoter mediated the best transgene expression

F. The effects of culture configuration on transgene expression were reversible When transferred from non-adhesive to regular cell culture plates, spheroids tended to disassemble and grow as monolayers. The ability to form these monolayers was inversely correlated to the degree of compactness of spheroids: HEp-2 spheroids formed these monolayers more readily than LM05e or LM3, and this ability decreased in the three cell lines over the time, when spheroids became more compact.

Spheroids lipofected with pCMV! were transferred to regular plates at different times (4 to 37 days postlipofection), and 7 days later, specific !gal activity was measured in both spheroids and the resulting monolayers (removing previously the remaining spheroids). As it can be seen in Figure 8, !gal activity in these monolayers dropped to similar values than control monolayers in all cell lines. At every time point, monolayers !gal activities were more than 90% lower than the parental spheroids from which they derived 7 days before, while if they continued as spheroids expression only dropped 5 to 50% in LM05e/S and HEp-2/S, and 15 to 75% in LM3/S from day 15 to 45. These results demonstrated that the expression enhancement tightly depends on spatial configuration and that it can be reversible. These findings were confirmed by microscopy (Figure 8, right panel).

Eight days after lipofection spheroids were transferred to regular plates, and 2 to 4 days later, the remaining spheroids and the radially growing monolayers were XGal stained for !gal expression and photographed. As expected, intense staining can be seen in the remaining assembled spheroids, while monolayers showed few or no stained cells.

G. Long-term transgene expression occurred independently of plasmid integration into the host genome Genomic and episomal DNA of spheroids at day 40 post-lipofection with pCMV! and pEBCMV! were prepared and subjected to Southern blot analysis with a lacZ probe (as described in Materials and methods). The Southern transfer could not reveal any integration of plasmid vectors into the host genome and episomal plasmid was detected 40 days post-lipofection demonstrating that most of these lipofected plasmids remained as episomes (Figure 9).

On the other hand, pCMVhIL2 transiently lipofected LM3 cells produced at day 8: 36.5 ± 4.5 or 332.1 ± 47.8 217

Casais et al: Transgene expression in multicellular spheroids ng hIL-2/mg protein/day as monolayers or spheroids respectively (n=7). Conversely, pRc/CMVhIL2 stably transfected LM3 and LM38 monolayers, expressed at day 4: 1.0 ± 0.4 and 2.3 ± 0.7 ng hIL-2/mg protein/day respectively (n=4). When transferred from monolayers to spheroids, the same stably transfected cells produced undetectable hIL-2 levels (<0.1 ng mg/mg protein/day).

This opposite effect of spatial configuration on integrated

transgenes was confirmed by pRc/CMV! stably transfected LM3 cells. Whereas as monolayers !gal activity remained mostly constant (146±18 U/mg protein) from day 4 to 15 respectively, the same stably lipofected cells growing as spheroids presented similar levels from day 4 to 8 (133±19 U/mg protein), dropping to 42 % of the

Figure 7. Properties of a partially deleted/substituted CMVie promoter. Specific !-galactosidase activity after lipofection with pCMV! (circles), pMYCCMV! (squares), pKCSCMV! (triangles), p"5'CMV! (rhombs), pMYCTATA! (squares, dotted line) or pTATA! (rhombs, dotted line) plasmids in LM05e, LM3 and HEp-2 cells cultured as spheroids (black symbols) or monolayers (open symbols). Each value represents mean ± s.e.m. of (n) independent assays (pCMV!: n=14, pMYCCMV!: n=9, pKCSCMV!: n=6, p"5'CMV!: n=8, pMYCTATA!: n=5, pTATA!: n=5).

Showing the P-values obtained by ANOVA test PLASMID/CELLS pCMV! vs. pMYCCMV!

LM05e Spheroids Monolayer p<0.01 n.s.

LM3 Spheroids Monolayer p<0.05 n.s. (days 45-75) p<0.05 n.s.

pKCSCMV!

p<0.01

n.s.

p"5'CMV!, pTATA! pMYCTATA! p"5'CMV!, pTATA! pMYCTATA! vs. pMYCCMV!

p<0.01

p<0.05

p<0.01

p<0.05

p<0.01

p<0.05

p<0.05

pKCSCMV!

p<0.01

p<0.05

p<0.01 (days 4-30) p<0.01 (days 4-15)

218

p<0.05

HEp-2 Spheroids Monolayer p<0.05 p<0.05 (days 8-15) (days 8-15) p<0.05 p<0.05 (days 8-15) p<0.01 p<0.05

p<0.01 (days 4-60) p<0.01 (days 4-60)

p<0.05 (days 4-8) p<0.05 (days 4-8)

Gene Therapy and Molecular Biology Vol 10, page 219

Figure 8. Effects of culture configuration reversion on transgene expression. Left panel: Specific !-galactosidase activity from LM05e, LM3 and HEp-2 spheroids (gray bars) and monolayers derived from the respective spheroids (white bars) at different times after lipofection with pCMV!. At each time point, the monolayers derived from disassembling spheroids seeded in regular culture plates 7 days before. Each value represents mean Âą s.e.m. of 6 independent assays. Right panel: Representative micrographs of X-Gal stained LM05e, LM3 and HEp-2 disassembling spheroids and the radially growing monolayers at 11 days post-lipofection with pCMV!.

(Spheroids were transferred to regular culture plates at day 8 post-lipofection). Dark spheroid areas indicate !-galactosidase activity.

219

Casais et al: Transgene expression in multicellular spheroids

Figure 9. Southern blot analysis of spheroid episomal DNA. Forty days post-lipofection with pCMV! or pEBCMV!; LM05e, LM3 and HEp-2 spheroids DNA was extracted, electrophoresed, blotted and hybridized as described in Materials and Methods. Cell lines and plasmids are indicated on the picture. M: Hind III digested plasmids as size markers.

monolayers activity on day 15 (S: 69Âą11 M: 165Âą11 U/mg protein; p<0.001, n=4). These results agree with those reporting a reduced portion of producing cells in stably transfected spheroids with respect to the same cells growing as monolayers (Klunder and Hulser, 1993).

All these data support the hypothesis that the high transgene expression in spheroids was driven by episomal plasmids, since in the case of any plasmid integration; its contribution to transgene expression would be negligible.

An exciting property of spheroids was that the reporter gene expression was maintained during all the spheroid life span and seemed to occur independently of plasmid integration into the host genome. The significant differences in the activities driven by different constructs observed at day 8 converged to similar low values after 30-60 days of spheroids incubation, indicating that beyond the promoter used, the 3D-configuration is the main responsible for long-term gene expression. It is noteworthy that spheroids transgene expression at day 75 not only was detectable but it was similar to monolayer expression at day 8 in all cell lines tested. At least four processes seem to be critical for spheroid efficient and sustained expression of a heterologous transgene. First, the ability of spheroid cells to retain transfected DNA. Second, a low decline in the percentage of transfected cells by transgene dilution during replication of slowly proliferating spheroids. Third, a low loss of the transgene by nuclease destruction or partitioning to non-nuclear compartments. Fourth, a low attenuation of promoter function leading to silencing of transgene expression.

Two questions arise from our data: How significant would be the spatial configuration effect on transgene expression in vivo where 3D-assembled differentiated cells present low replication rates and can be metabolically active for very long times? Could non-integrative nonviral gene transfer be useful for particular gene therapy applications that need long-term transgene expression?

Although the search for new vectors (viral and nonviral) continues, cationic liposomes are among the most interesting vectors for cancer gene therapy because they are non-infective, have low immunogenicity, low toxicity and high stability, as well as low cost and ease of

IV. Conclusion The results presented in this paper suggest that monolayer cultures and 3D- spheroids represent two very different experimental tumor models. The most surprising finding was that tumor cells assembled as spheroids provide an approach for achieving strongly enhanced and persistent transgene expression. As far as we know, such in vitro persistent transient transgene expression from nonviral vectors has not been reported previously. All the plasmids so far tested showed an improved transgene expression in spheroids that correlated with their degree of compactness. Then, the major reason for enhanced expression of a heterologous transgene should be searched on specific cellular properties that appear to be optimized when growing in three-dimensional aggregates with respect to flattened monolayer cells as: (i) spherical cell and nuclear shape, (ii) the cellular environment, (iii) the DNA conformation and packing, (iv) the accessibility and composition of transcription factors, (v) the transcriptional/post-transcriptional activation, (vi) the increased protein synthesis, and (vii) cell cycle times that can affect gene expression and biological behavior.

220

Gene Therapy and Molecular Biology Vol 10, page 221 production (Yoshida et al, 2004; Glover et al, 2005). In addition, cationic lipids demonstrated to be sufficiently effective in some cancer gene therapy approaches to be used in veterinary (Dow et al, 1998; Finocchiaro et al, 2005) and human (Bergen et al, 2003; Yoshida et al, 2004; O’Malley et al, 2005) clinical trials.

The most positive message emerging from this article is that the 3D-configuration is the main responsible for long-term gene expression. Multicellular tumor spheroids, which mimic more closely in vivo solid tumors and micrometastases, are realistic experimental models to investigate many aspects of tumor biology (MuellerKlieser, 2000; Finocchiaro et al, 2004). It is therefore plausible to speculate that non-viral plasmid transfer of in vivo tumors can achieve enhanced long-term transgene expression. This was confirmed by the fact that early passages cultured cell lines derived from five spontaneous canine melanomas formed spheroids that expressed pCMV! 3- to 6-fold more efficiently than their respective monolayers during the first 15 days after transient lipofection. Conversely, preliminary results suggest that the expression enhancement observed in tumor spheroids did not occur in the non-tumor monkey kidney VERO cell line (ATCC #CCL 81), that displayed similar levels of !gal activity in spheroids and monolayers (19.5 ± 3.3 and 25.3 ± 4.5 mU/mg protein, respectively, n=13), during the first 15 days following transient lipofection.

The biological and clinical significance of these observations remains to be determined. Therefore, the next step is to evaluate how broad this effect is in human nontumor and tumor cells of various histologies. If enhanced long-term spheroids transgene expression is characteristic of tumor spheroids, the possibility of a targeted gene therapy where tumor cells express higher levels of the delivered gene than normal tissue is open. In addition, whether after gene transfer a low probability event of plasmid integration occurs, it would not significantly contribute to transgene expression. All these observations encourage the implementation of non-viral gene therapy strategies for the delivery of therapeutic genes to tumors where high-level and fairly long-lasting gene expression is required.

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72, 248-254.

Dow SW, Elmslie RE, Willson AP, Roche L, Gorman C, Potter TA (1998) In vivo tumor transfection with superantigen plus cytokine genes induces tumor regression and prolongs survival in dogs with malignant melanoma. J Clin Invest 101, 2406–2414 Fehlauer F, Stalpers LJ, Panayiotides J, Kaaijk P, Gonzalez Gonzalez D, Leenstra S, van der Valk P, Sminia P (2004) Effect of single dose irradiation on human glioblastoma spheroids in vitro. Oncol Rep 11, 477-485.

Felgner JH, Kumar R, Sridhar CN, Wheeler CJ, Tsai YJ, Border R, Ramsey P, Martin M, Felgner PL (1994) Enhanced gene delivery and mechanism studies with a novel series of cationic lipid formulations. J Biol Chem 269, 2550-2561.

Finocchiaro LME, Bumaschny VF., Karara AL, Fiszman GL., Casais CC, Glikin GC (2004) Herpes simplex virus thymidine kinase/ganciclovir system in multicellular tumor spheroids. Cancer Gene Ther 11, 333-345.

Finocchiaro LME, Maminska ME, Castillo PJJ, Karara AL, Fiszman GL, Riveros MD, Glikin GC. (2005) Tumor vaccine combined with cytokines and suicide gene therapy for canine spontaneous melanoma. Mol Ter 11 (Suppl. 1), S270.

Gao X, Huang L (1995) Cationic liposome-mediated gene transfer. Gene Ther 2, 710-722.

Glover DJ, Lipps HJ, Jans DA (2005) Towards safe, non-viral therapeutic gene expression in humans. Nat Rev Gen 6,299310.

Gottesman MM (2003) Cancer gene therapy: an akward adolescence. Cancer gene Ther 10, 501-508.

Hall CV, Jacob PE, Ringold GM, Lee F (1983) Expression and regulation of Escherichia coli lacZ gene fusions in mammalian cells. J Mol Appl Genet 2, 101-109.

Hirt B (1967) Selective extraction of polyoma DNA from infected mouse cell cultures. J Mol Biol 26, 365-369.

Kaneda Y, Saeki Y, Nakabayashi M, Zhou WZ, Kaneda MW, Morishita R (2000) Enhancement of transgene expression by cotransfection of OriP plasmid with EBNA-1 expression vector. Hum Gene Ther 11, 471-479.

Karara AL, Bumaschny VF, Fiszman GL, Casais CC, Glikin GC, Finocchiaro LME. (2001) Lipofection of early passages of cell cultures derived from murine adenocarcinomas: in vitro and ex vivo testing of the thymidine kinase/ganciclovir system. Cancer Gene Ther 8, 96-99.

Klunder I, Hulser DF (1993) Beta-galactosidase activity in transfected Ltk- cells is differentially regulated in monolayer and in spheroid cultures. Exp Cell Res 207, 155-162.

Kolchinsky A, Roninson IB (1997) Drug resistance conferred by MDR1 expression in spheroids formed by glioblastoma cell lines. Anticancer Res 17, 3321-3328.

Kuhen KL, Vessey JW, Samuel CE (1998) Mechanism of Interferon Action: Identification of Essential Positions within the Novel 15-Base-Pair KCS Element Required for Transcriptional Activation of the RNA-Dependent Protein Kinase pkr Gene. J Virol 72, 9934–9939.

MacGregor GR, Caskey T (1989) Construction of plasmids that express E coli !-galactosidase in mammalian cells. Nucleic Acids Res 17, 2365-2365.

Maniatis T, Fritsch EF, Sambrook J (1982) Molecular Cloning, a laboratory manual.; Cold Spring Harbor Laboratory, 280281.

Mueller-Klieser W (1997) Three-dimensional cell cultures: from molecular mechanisms to clinical applications. Am J Physiol 273, C1109-C1123.

Mueller-Klieser W (2000) Tumor biology and experimental therapeutics. Critical Rev. Oncol Hematol 36, 123-139.

Acknowledgments We thank Ana Bihary for technical assistance, Dr. Gabriel Fiszman for hIL-2 stably transfected LM3 and LM38 and Dr. Alejandro Urtreger for !gal stably transfected LM3. This work was partially supported by a grant from FONCYT: BID1201/OC-AR # PICT 2002 12084, and a grant from BioSidus S.A. A.L.K., G.C.G. and L.M.E.F. are members, and C.C.C. is a fellow of the Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET, Argentina).

References Bates RC, Edwards NS, Yates JD (2000) Spheroids and cell survival. Critical Rev Oncol Hematol 36, 61-74.

Bergen M, Chen R, Gonzalez R (2003) Efficacy and safety of HLA-B7/beta-2 microglobulin plasmid DNA/lipid complex (Allovectin-7) in patients with metastatic melanoma. Expert Opin Biol Ther 3, 377-384.

221

Casais et al: Transgene expression in multicellular spheroids Olive PL, Durand RE (1994) Drug and radiation resistance in spheroids: cell contact and kinetics. Cancer Metastasis Rev 13, 121-138.

Oâ&#x20AC;&#x2122;Malley BW Jr, Li D, McQuone SJ, Ralston R (2005) Combination Nonviral Interleukin-2 Gene Immunotherapy For Head and Neck Cancer: From Bench Top to Bedside.

Laryngoscope 115,391-414.

Santini MT, Rainaldi G (1999) Three-dimensional spheroid model in tumor biology. Pathobiology 67, 48-157.

Sugaya S, Fujita K, Kikuchi A, Ueda H, Takakuwa K, Kodama S, Tanaka K (1996) Inhibition of tumor growth by direct intratumoral gene transfer of herpes simplex virus thymidine kinase gene with DNA-liposome complex. Hum Gene Ther 7, 223-230.

Sutherland R, Buchegger F, Schreyer M, Vacca A, Mach JP (1987) Penetration and binding of radiolabeled anticarcinoembryonic antigen monoclonal antibodies and their antigen binding fragments in human colon multicellular tumor spheroids. Cancer Res 47, 1627-1633.

Sutherland RM (1998) Cell and environment interactions in tumor microregions: the multicell spheroid model. Science 240, 177-184.

Teifel M, Friedl P (1995) New lipid mixture for efficient lipidmediated transfection of BHK cells. Biotechniques 19, 7982.

Tu G, Kirchmaier AL, Liggitt D, Liu Y, Liu S, Yu WH, Heath TD, Thor A, Debs RJ (2000) Non-replicating Epstein-Barr virus-based plasmids extend gene expression and can improve gene therapy in vivo. J Biol Chem 39, 3040830416.

Yates JL, Warren N, Sugden B (1985) Stable replication of plasmids derived from Epstein-Barr virus in various mammalian cells. Nature 313, 812-815.

Yoshida J, Mizuno M, Wakabayashi T (2004) Interferon-! gene therapy for cancer: Basic research to clinical application.

Cancer Sci 95, 858-865.

222

Gene Therapy and Molecular Biology Vol 10, page 223 Gene Ther Mol Biol Vol 10, 223-232, 2006

Use of lectin as an anchoring agent for adenovirusmicrobead conjugates: Application to the transduction of the inflamed colon in mice Research Article

Alan Jerusalmi, Samuel J. Farlow and Takeshi Sano* Center for Molecular Imaging Diagnosis and Therapy and Basic Science Laboratory, Department of Radiology, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts, USA

__________________________________________________________________________________ *Correspondence: Takeshi Sano, Ph.D., Beth Israel Deaconess Medical Center, 77 Avenue Louis Pasteur, Harvard Institutes of Medicine 118, Boston, Massachusetts 02115, USA; Tel: +1-617-667-0142; Fax: +1-617-975-5560; e-mail tsano@bidmc.harvard.edu Key words: Adenoviral vectors; virus-microbead conjugates; lectin; interleukin-10; inflammatory bowel disease Abbreviations: 2,4,6-trinitrobenzenesulfonic acid, (TNBS); 4'-6-diamidino-2-phenylindole, (DAPI); 5-bromo-4-chloro-3-indoyl-!-Dgalactopyronoside, (X-gal); concanavalin A, (Con A); cytomegalovirus, (CMV); enzyme-linked immunosorbent assay, (ELISA); inflammatory bowel disease, (IBD); interleukin-10, (IL-10); phosphate-buffered saline, (PBS) Received: 18 July 2006; Revised: 21 August 2006 Accepted: 23 August 2006; electronically published: August 2006

Summary Virus-mediated delivery of therapeutic transgenes to the inflamed colon offers a great potential to serve as an effective therapeutic strategy for inflammatory bowel disease (IBD). However, the transduction of the inflamed colon by viral vectors upon intra-colonical administration is generally poor, primarily because of the inability of administered viral vectors to associate stably with the colonic tissue. We investigated if the use of adenoviral vectors in the form of virus-microbead conjugates could enhance the transduction efficiency of the inflamed colon. In particular, a lectin, concanavalin A (Con A), was tested as an anchoring agent for adenovirus-microbead conjugates. The co-attachment of Con A allowed adenovirus-microbead conjugates to associate stably with target cells when analyzed in vitro. Intra-colonical administration of adenovirus-microbead conjugates containing Con A resulted in efficient transduction of the inflamed colon, while little transduction was seen with adenovirusmicrobead conjugates without Con A or free adenoviral vectors. When adenoviral vectors carrying the mouse interleukin-10 gene were used, local interleukin-10 levels became considerably higher upon intra-colonical administration of adenovirus-microbead conjugates containing Con A. These results demonstrate that Con A can serve as an effective anchoring agent for adenovirus-microbead conjugates and suggest that adenovirus-microbead conjugates containing Con A may be useful for efficient delivery of therapeutic transgenes to the inflamed colon for the therapy of IBD.

carriers allows the co-attachment of other materials to the microbead surface to enhance or control the functionality of the adenovirus-microbead conjugates. In the present study, we investigated if this gene transfer technology with adenovirus-microbead conjugates could be used for efficient transduction of the inflamed colon by adenoviral vectors toward its application to gene therapy of inflammatory bowel disease (IBD), such as Crohnâ&#x20AC;&#x2122;s disease and ulcerative colitis (for reviews, Podolsky, 2002; Strober et al, 2002; Bouma and Strober, 2003; Dignass et al, 2004; Korzenik and Podolsky, 2006).

The colorectal system is potentially an attractive target for in vivo somatic gene therapy since it is readily accessible externally. However, the presence of the mucous coat on the epithelium and the dynamic fluidic

I. Introduction Over the course of the last few years, we have developed a novel gene transfer technology, in which adenoviral vectors are attached stably to the surfaces of microbeads (nanoparticles) using the extremely strong (strept)avidin-biotin interaction and delivered to target cells in the form of adenovirus-microbead conjugates (Pandori et al, 2002; Pandori and Sano, 2005). When analyzed in vitro, such adenovirus-microbead conjugates showed infectivities equivalent to or even greater than adenoviral vectors used free in solution. In particular, the infectivity for target cells, which are poorly permissive to infection by free adenoviral vectors, can be enhanced considerably. In addition, the use of microbeads as virus

223

Jerusalmi et al: Adenovirus-microbead conjugates containing lectin from Dr. Peter Thomas, Boston University School of Medicine.

HeLa and SW620 cells were maintained in Dulbecco’s modified Eagle’s medium (BioWhittaker) supplemented with 10% fetal bovine serum (BioWhittaker). COLO 205 and MIP-101 cells were maintained in RPMI 1640 (BioWhittaker) supplemented with 10% fetal bovine serum, 4.5 mg/ml glucose, 1.5 mg/ml sodium bicarbonate, and 10 mM 4-(2-hydroxyethyl)-1piperazineethanesulfonic acid.

properties of the colorectal system act as barriers for the access to the colonic tissue by viral vectors that are administered intra-colonically. In IBD, chronic intestinal inflammation occurs, which causes severe destruction of the mucosal layer. This exposes the colonic tissue, making it directly accessible by viral vectors that are administered intra-colonically. However, the dynamic fluidic properties of the colorectal system limit the direct, stable contact of administered viral vectors with the colonic tissue. This considerably reduces the overall transduction efficiency of the colonic tissue by viral vectors. Thus, previous attempts for intra-colonical delivery of viral vectors to the inflamed colon involved the use of large amounts of viral vectors to achieve sufficient levels of transgene expression (Lindsay et al, 2003; Wirtz et al, 1999, 2002). This suggests that, if viral vectors could be made capable of associating stably with colonic cells, the transduction of the colonic tissue by viral vectors could be enhanced considerably. In the present study, we tested if intra-colonical administration of adenoviral vectors in the form of virus-microbead conjugates could enhance the transduction of the inflamed colon. In particular, we investigated if the co-attachment of an anchoring agent to adenovirus-microbead conjugates could provide the conjugates with the abilities to associate stably with the colonic tissue and to transduce the inflamed colon efficiently. We chose a lectin, concanavalin A (Con A), as a potential anchoring agent.

Con A, isolated from Canavalia ensiformis (Jack bean) seeds, binds to "-D-glucopyranosyl and "-Dmannopyranosyl moieties, which exist abundantly in carbohydrate chains on the cell surfaces (Lis and Sharon, 1986, 1998; Sharon and Lis, 1989, 1995). We previously showed that the co-attachment of Con A can restore the ability of adenovirus-microbead conjugates containing chemically inactivated adenoviral vectors to associate stably with target cells (Pandori and Sano, 2005). We hypothesized that the co-attachment of Con A allows adenovirus-microbead conjugates to associate stably with the colonic tissue upon intra-colonical administration, resulting in efficient transduction of the inflamed colon.

C. Preparation of adenovirus-microbead conjugates with and without the co-attachment of Con A Adenovirus-microbead conjugates were prepared by the method described previously (Pandori et al, 2002). Briefly, purified adenoviral vectors (Ad5.CMV-LacZ or Ad5.CMV-IL10) were biotinylated using sulfo-NHS-LC-biotin (Pierce) at 20 #g/ml, at which concentration the viral infectivity can be maintained (Pandori et al, 2002; Hobson et al, 2003). After nonvirion-associated biotinylation reagent was removed by repeated ultrafiltration, the resulting biotinylated adenoviral particles were attached to avidin-coated polystyrene microbeads (diameter, 0.48 #m; specific gravity, 1.06 g/cm3; Spherotech) at appropriate ratios. The co-attachment of Con A to the microbead surfaces was done by the addition of excess biotinylated Con A (Vector Laboratories) to adenovirus-microbead conjugates (2.5 #g biotinylated Con A per 1.67 x 107 microbeads), followed by the removal of unbound Con A. The addition of excess biotinylated Con A is essential for the prevention of the formation of aggregates, which have considerably reduced infectivity. Under these conditions, the surfaces of the microbeads, to which adenoviral vectors had been attached, should be saturated with biotinylated Con A.

D. Infectivity analysis of adenovirusmicrobead conjugates containing Ad5.CMV-LacZ The infectivity of adenovirus-microbead conjugates with and without the c-attachment of Con A, prepared using Ad5.CMV-LacZ as above, was analyzed on HeLa and COLO 205 cell lines. Cells were cultured in wells (5 x 104 cells per well) at 37 °C for 24 hr. An appropriate amount of adenovirusmicrobead conjugates or free Ad5.CMV-LacZ was applied to each well (the actual amount of adenoviral particles added to each well is given in the legends to Figures 1 and 3). Cells were incubated for 37 °C for 48 hr, fixed with 0.5% glutaraldehyde, and stained for !-galactosidase (LacZ) activity using X-gal (5bromo-4-chloro-3-indoyl-!-D-galactopyronoside) as the substrate. The numbers of infected cells, which were stained blue, were counted under a light microscope.

II. Materials and Methods A. Adenoviral vectors Two adenoviral vector constructs, both of which are derived from adenovirus serotype 5 with the deletion of the viral E1 and E3 genes, were used in this study. One adenoviral vector construct, Ad5.CMV-LacZ (Qbiogene, Montreal, Canada), carries the bacterial lacZ (!-galactosidase) gene under the control of the human cytomegalovirus (CMV) immediate/early promoter. The other adenoviral vector construct, Ad5.CMVIL10, carries the mouse interleukin-10 (IL-10) gene containing the coding sequence for the signal peptide under the control of the CMV immediate/early promoter (a generous gift from Dr. Andrea Gambotto, University of Pittsburgh School of Medicine).

E. Cell-binding analysis microbead conjugates

of

adenovirus-

Adenovirus-microbead conjugates with and without the coattachment of Con A were prepared using Ad5.CMV-LacZ at 50 adenoviral particles per microbead, as described above. These conjugates were applied to HeLa and COLO 205 cells grown at 37 °C on glass cover slips. At 4 hr and 24 hr after the application of adenovirus-microbead conjugates, cells were washed with PBS (phosphate-buffered saline) and fixed with 4% paraformaldehyde. Cell nuclei were stained with DAPI (4'-6diamidino-2-phenylindole; blue fluorescence), and stained cells were examined under a fluorescence microscope with appropriate filters (Axioscop 2, Carl Zeiss). Association of adenovirus-microbead conjugates with target cells can be detected by cell-associated red fluorescence, derived from the microbeads used that contain a rhodamine derivative.

B. Cell lines The following four cell lines were used as targets: HeLa (human cervical adenocarcinoma), COLO 205 (human colorectal adenocarcinoma), MIP-101 (human colonic carcinoma), and SW620 (human colorectal adenocarcinoma). These cell lines were obtained from the American Type Culture Collection (Manassas, VA, USA), except for MIP-101 that is a generous gift

224

Gene Therapy and Molecular Biology Vol 10, page 225 collected. Each colon sample was homogenized in 2 ml of 0.25 mM Tris-Cl (pH 7.8) using a glass Potter homogenizer. The resulting homogenates were centrifuged at 4 째C at 1,600 x g for 20 min, and the supernatants were subjected to the quantitation of mouse IL-10 by ELISA in triplicate (OptEIA Mouse IL-10 ELISA kit), as described in F above. The total protein contents of the supernatants were also determined by the protein assay method of Bradford (Bradford, 1976) using bovine serum albumin as the standard.

F. Analysis of in vitro production of mouse IL-10 upon transduction by adenovirusmicrobead conjugates containing Ad5.CMV-IL10 Adenovirus-microbead conjugates with and without the coattachment of Con A were prepared using Ad5.CMV-IL10 at 50 adenoviral particles per microbead, as above. The ability of these conjugates to produce mouse IL-10 upon transduction was analyzed by using three colonic cell lines (COLO 205, MIP-101, and SW620), along with HeLa cells, as targets. Cells were cultured in wells (5 x 104 cells per well) at 37 째C for 24 hr.

Appropriate amounts of adenovirus-microbead conjugates with and without the co-attachment of Con A, along with free Ad5.CMV-IL10, were applied to target cells (the actual amount of adenoviral particles added to each well is given in the legend to Figure 5). Cells were incubated at 37 째C for 24 hr, and the amounts of mouse IL-10, which had been produced and secreted into the culture media, were determined quantitatively by enzyme-linked immunosorbent assays (ELISA) (OptEIA Mouse IL-10 ELISA kit; BD Pharmingen). Purified recombinant mouse IL-10 (BD Pharmingen) was used as the standard for quantitation.

III. Results A. Effect of the number of viral particles per microbead on the infectivity of adenovirus-microbead conjugates First, we analyzed the effect of the number of adenoviral particles per microbead on the infectivity of adenovirus-microbead conjugates using cultured cells. An adenoviral vector construct carrying the lacZ (!galactosidase) gene (Ad5.CMV-LacZ) was used.

Adenovirus-microbead conjugates were prepared by the method, described in the Materials and Methods section, at varying numbers of adenoviral particles per microbead.

The infectivity of the resulting adenovirus-microbead conjugates, along with free Ad5.CMV-LacZ as a control, was analyzed in vitro using two cell lines, HeLa (moderately permissive to infection by free adenoviral vectors) and COLO 205 (very poorly permissive to infection by free adenoviral vectors) (Fechner et al, 2000) (Figure 1). On HeLa cells, the infectivity of adenovirusmicrobead conjugates was approximately 60 - 70% of that of free Ad5.CMV-LacZ. However, the infectivity of the conjugates was hardly affected by the number of adenoviral particles per microbead tested (up to 50 adenoviral particles per microbead). In contrast, when COLO 205 cells were used as targets, the infectivity of adenovirus-microbead conjugates slightly increased with increasing the number of adenoviral particles per microbead. At 50 or 100 adenoviral particles per microbead, the infectivity of the conjugates became even higher than that of free Ad5.CMV-LacZ. However, the overall effect of the number of adenoviral particles per microbead on the infectivity of adenovirus-microbead conjugates was found to be relatively small in the range tested (up to 100 adenoviral particles per microbead), in agreement with a previous study (Pandori et al, 2002).

From these results, we decided to use adenovirusmicrobead conjugates containing 50 adenoviral particles per microbead in subsequent experiments.

G. Transduction of the inflamed colon in mice upon intra-colonical administration of adenovirus-microbead conjugates containing Ad5.CMV-LacZ All animal procedures were carried out in accordance with NIH guidelines following approval by the Harvard Medical Area Standing Committee on Animals. Adenovirus-microbead conjugates with and without the co-attachment of Con A were prepared using Ad5.CMV-LacZ at 50 adenoviral particles per microbead, as above. A mouse acute colitis model was prepared by intra-colonical administration of 0.75 mg TNBS (2,4,6trinitrobenzenesulfonic acid), dissolved in 100 #l of 50% ethanol (TNBS-induced colitis) (Jurjus et al, 2004), into Balb/c mice (6 8 weeks old; Taconic) by enema. At 48 hr after the administration of TNBS, adenovirus-microbead conjugates with and without the co-attachment of Con A, along with free Ad5.CMV-LacZ, were administered intra-colonically into mice by enema (5 x 108 adenoviral particles in 100 #l PBS per mouse).

At 48-hr post-administration, mice were euthanized, and their colons were collected. The colon samples were frozen in tissue freezing media (Tissue-Tek O.C.T. compound, Miles), followed by the preparation of cryosections (thickness, 5-7 #m). These colon sections were subjected to the analysis of transduction by Ad5.CMV-LacZ or the detection of microbeads, used as adenovirus carriers. For transduction analysis, colon sections were stained for !-galactosidase activity using X-gal as the substrate, with counter-staining with neutral red. Stained colon sections were examined under a light microscope. For the detection of microbeads (red fluorescence), colon sections were counter-stained with DAPI and examined under a fluorescence microscope.

B. Effect of the co-attachment of Con A on the cell-binding ability and the infectivity of adenovirus-microbead conjugates

H. Production of mouse IL-10 in the inflamed colon upon intra-colonical administration of adenovirus-microbead conjugates containing Ad5.CMV-IL10

The effect of the co-attachment of Con A on the ability of adenovirus-microbead conjugates to associate with target cells was analyzed using HeLa and COLO 205 cells as targets. Adenovirus-microbead conjugates with and without the co-attachment of Con A were prepared using Ad5.CMV-LacZ at 50 adenoviral particles per microbead. These conjugates were applied to target cells, and cell-associated red fluorescence, derived from the microbeads that contain a rhodamine derivative (red

Adenovirus-microbead conjugates with and without the coattachment of Con A were prepared using Ad5.CMV-IL10 at 50 adenoviral particles per microbead, as described above. These adenovirus-microbead conjugates, along with free Ad5.CMVIL10, were administered intra-colonically into mice with TNBSinduced colitis by enema (1 x 109 adenoviral particles in 100 #l PBS per mouse) (3 mice per sample). At 24-hr postadministration, mice were euthanized, and their colons were

225

Jerusalmi et al: Adenovirus-microbead conjugates containing lectin fluorescence), was visualized under a fluorescence microscope (Figure 2). When Con A was attached to adenovirus-microbead conjugates, the amount of cellassociated red fluorescence became greater then that seen with adenovirus-microbead conjugates without Con A for both HeLa and COLO 205 cells. In particular, the coattachment of Con A allowed adenovirus-microbead conjugates to associate efficiently with COLO 205 cells, for which no appreciable association of the conjugates was seen in the absence of the co-attachment of Con A. This result demonstrates that the co-attachment of Con A can considerably enhance the ability of adenovirus-microbead conjugates to associate with target cells, in agreement with a previous study with adenovirus-microbead conjugates containing chemically inactivated adenoviral vectors (Pandori and Sano, 2005).

The infectivity of adenovirus-microbead conjugates was also investigated in the absence and presence of the co-attachment of Con A using HeLa and COLO 205 cells as targets. Adenovirus-microbead conjugates with and without Con A were applied to target cells. At 48-hr postapplication, cells were analyzed for lacZ expression (Figure 3). Adenovirus-microbead conjugates showed higher infectivities than free Ad5.CMV-LacZ on both HeLa and COLO 205 cells. The co-attachment of Con A to adenovirus-microbead conjugates further enhanced the infectivity of the conjugates. These results reveal that the co-attachment of Con A makes adenovirus-microbead conjugates capable of associating more efficiently with target cells, resulting in enhanced transduction of the cells.

transduce the inflamed colon was investigated in vivo using a mouse TNBS-induced colitis model. Adenovirusmicrobead conjugates with and without the co-attachment of Con A were prepared using Ad5.CMV-LacZ at 50 adenoviral particles per microbead. These conjugates, along with free Ad5.CMV-LacZ, were administered intracolonically by enema into mice with TNBS-induced colitis (a total of 5 x 108 adenoviral particles per mouse). No appreciable effect on the health and behavior of mice was seen upon intra-colonical administration of free Ad5.CMV-LacZ and its microbead conjugates with and without the co-attachment of Con A until they were euthanized. When free Ad5.CMV-LacZ was used, no appreciable transduction was detected in colon sections (Figure 4A). Similarly, little transduction of the colon was seen when adenovirus-microbead conjugates without the co-attachment of Con A was administered intracolonically (Figure 4B). In contrast, the use of adenovirus-microbead conjugates containing Con A resulted in efficient transduction of colonic cells (Figures 4C and 4D). Transduction was seen primarily near the surfaces of mucosal layers, to which administered adenovirus-microbead conjugates should have easy access due to their destruction caused by colonic inflammation.

Colon sections were also analyzed under a fluorescence microscope for the presence of adenovirusmicrobead conjugates. When adenovirus-microbead conjugates were used without the co-attachment of Con A, few red fluorescence spots, derived from the microbeads used that contain a rhodamine derivative, were seen in colon sections (Figure 4E). In contrast, red fluorescent spots were seen in many colon sections when adenovirusmicrobead conjugates with Con A were administered intra-colonically (Figure 4F). This result reveals that adenovirus-microbead conjugates can associate stably with

C. In vivo transduction of the inflamed colon in mice by adenovirus-microbead conjugates containing Ad5.CMV-LacZ The ability of adenovirus-microbead conjugates to

Figure 1. Effect of the number of viral particles per microbead on the infectivity of adenovirus-microbead conjugates. Adenovirusmicrobead conjugates were prepared using Ad5.CMV-LacZ at varying numbers of adenoviral particles per microbead. The infectivity of the resulting adenovirus-microbead conjugates were analyzed on HeLa and COLO 205 cell lines. Cells were cultured in wells (5 x 104 cells per well) at 37 째C for 24 hr. Adenovirus-microbead conjugates, along with free Ad5.CMV-LacZ, were applied to each well (2 x 107 adenoviral particle per well for HeLa cells, and 2 x 108 adenoviral particles per well for COLO 205 cells), and cells were incubated at 37 째C for 48 hr. Cells were stained for !-galactosidase activity using X-gal as the substrate, and the number of infected cells in each well was counted under a light microscope. Each datum shown is the average number of infected cells per well with a standard deviation (n = 8 for HeLa cells, and n = 9 for COLO 205 cells).

226

Gene Therapy and Molecular Biology Vol 10, page 227

Figure 2. Enhancement of the ability of adenovirus-microbead conjugates to associate with target cells by the co-attachment of Con A. Adenovirus-microbead conjugates with and without the co-attachment of Con A were prepared using Ad5.CMV-LacZ at 50 adenoviral particles per microbead. These conjugates were applied to HeLa and COLO 205 cells. At 4 hr and 24 hr after the application of adenovirus-microbead conjugates, cells were washed and fixed. Then, cell nuclei were stained with DAPI (blue fluorescence), and stained cells were examined under a fluorescence microscope with appropriate filters. Association of adenovirus-microbead conjugates with target cells can be detected by cell-associated red fluorescence, derived from the microbeads used that contain a rhodamine derivative (red fluorescence). Representative images are shown.

Figure 3. Enhancement of the infectivity of adenovirus-microbead conjugates by the co-attachment of Con A. Adenovirus-microbead conjugates with and without the co-attachment of Con A were prepared using Ad5.CMV-LacZ at 50 adenoviral particles per microbead.

The infectivity of these conjugates was analyzed on HeLa and COLO 205 cells. Cells were cultured in wells (5 x 104 cells per well) at 37 째C for 24 hr. Adenovirus-microbead conjugates, along with free Ad5.CMV-LacZ, were applied to each well (5 x 107 adenoviral particles per well for HeLa cells, and 5 x 108 adenoviral particles per well for COLO 205 cells), and cells were incubated at 37 째C for 48 hr. Cells were stained for !-galactosidase activity using X-gal as the substrate, and the number of infected cells in each well was counted under a light microscope. Each datum shown is the average number of infected cells per well with a standard deviation (n = 12). A, free Ad5.CMV-LacZ; B, adenovirus-microbead conjugates without the co-attachment of Con A; C, adenovirus-microbead conjugates with the co-attachment of Con A.

the colonic tissue upon administration into the inflamed colon and transduce colonic cells efficiently if Con A is co-attached to the conjugates. Without the co-attachment of Con A, adenovirus-microbead conjugates have a limited ability to transduce the colonic tissue, similar to free adenoviral vectors. These results demonstrate that Con A can serve as an efficient anchoring agent for adenovirusmicrobead conjugates, providing the conjugates with the ability to transduce the colonic tissue efficiently upon intra-colonical administration.

D. In vitro production of mouse IL-10 upon transduction by adenovirus-microbead conjugates containing Ad5.CMV-IL10 Experimental results with Ad5.CMV-LacZ above (Figure 4) suggest that adenovirus-microbead conjugates containing Con A could be useful for the delivery of therapeutic transgenes to the inflamed colon for the therapy of IBD. To test this, we used an adenoviral vector construct carrying the gene for a potent anti-inflammatory factor, IL-10. IL-10 is a promising therapeutic agent for

227

Jerusalmi et al: Adenovirus-microbead conjugates containing lectin IBD, particularly for Crohn's disease. IL-10 has potent immuno-suppressive and anti-inflammatory activities and plays a key role in mucosal immuno-regulation, inhibiting both the innate and cell-mediated inflammatory responses (de Waal Malefyt et al, 1992; Moore et al, 2001). IL-10 also inhibits the synthesis of pro-inflammatory cytokines, such as tumor necrosis factor-", IL-2, IL-3, and interferon$, the elevated expression of which is seen in IBD patients. IL-10 knockout mice (IL-10-/-) spontaneously develop an enterocolitis with multi-focal inflammatory lesions throughout the gastrointestinal tract (Kuhn et al, 1993; Spencer et al, 1998). This strongly suggests the potential therapeutic effectiveness of IL-10 for IBD. Initially, the ability of adenovirus-microbead conjugates, prepared using Ad5.CMV-IL10, to produce the encoded IL-10 upon transduction of target cells was analyzed in vitro. Three colonic cell lines, COLO 205, MIP-101 (poorly permissive to infection by free adenoviral vectors), and SW620 (very poorly permissive to infection by free adenoviral vectors), along with HeLa

cells, were used as targets. Adenovirus-microbead conjugates with and without the co-attachment of Con A (50 adenoviral particles per microbead), along with free Ad5.CMV-IL10 as a control, were applied to target cells.

At 24-hr post-administration, the amount of mouse IL-10, which had been expressed and secreted into the culture media, was determined quantitatively by ELISA (Figure 5). When adenovirus-microbead conjugates without Con A were used, the amount of mouse IL-10 produced was slightly reduced, as compared to free Ad5.CMV-IL10. In contrast, the production of mouse IL-10 became significantly greater for all of the cell lines when Ad5.CMV-IL10 was used in the form of adenovirusmicrobead conjugates containing Con A. These results demonstrate that the use of adenovirus-microbead conjugates containing Con A can considerably enhance the transduction of colonic cell lines by Ad5.CMV-IL10, resulting in efficient production of the encoded mouse IL10.

Figure 4. In vivo transduction of the inflamed colon in mice by Ad5.CMV-LacZ upon intra-colonical administration of adenovirusmicrobead conjugates with and without the co-attachment of Con A. Adenovirus-microbead conjugates with and without the coattachment of Con A were prepared using Ad5.CMV-LacZ at 50 adenoviral particles per microbead. These conjugates, along with free Ad5.CMV-LacZ, were administered intra-colonically into mice with TNBS-induced colitis by enema (a total of 5 x 108 adenoviral particles per mouse). At 48-hr post-administration, mice were euthanized, and colon cryosections were prepared. For transduction analysis, colon sections were stained for !-galactosidase activity using X-gal as the substrate, with counter-staining with neutral red (A D). Stained colon sections were examined under a light microscope. A, free Ad5.CMV-LacZ; B, adenovirus-microbead conjugates without the co-attachment of Con A; C and D, adenovirus-microbead conjugates with the co-attachment of Con A. For the detection of microbeads (red fluorescence), colon sections were counter-stained with DAPI (blue fluorescence) and examined under a fluorescence microscope (E and F). E, adenovirus-microbead conjugates without the co-attachment of Con A; F, adenovirus-microbead conjugates with the co-attachment of Con A. Representative images are shown.

228

Gene Therapy and Molecular Biology Vol 10, page 229

Figure 5. Enhanced production of mouse IL-10 by cells upon transduction by adenovirus-microbead conjugates with the co-attachment of Con A. Adenovirus-microbead conjugates with and without the co-attachment of Con A were prepared using Ad5.CMV-IL10 at 50 adenoviral particles per microbead. Three colonic cell lines (COLO 205, MIP-101, and SW620), along with HeLa cells, were used as targets. Cells were cultured in wells (5 x 104 cells per well) at 37 째C for 24 hr. Adenovirus-microbead conjugates, along with free Ad5.CMV-LacZ, were applied to each well (5 x 107 adenoviral particles per well for HeLa cells; 5 x 108 adenoviral particles per well for COLO 205 and SW620 cells; 3 x 108 adenoviral particles per well for MIP-101 cells). Cells were incubated at 37 째C for 24 hr, and the amounts of mouse IL-10, produced and secreted into culture media, were determined quantitatively by ELISA. Each datum shown is the total amount of mouse IL-10 produced per well with a standard deviation (n = 6). A, Free Ad5.CMV-IL10; B, adenovirus-microbead conjugates without the co-attachment of Con A; C, adenovirus-microbead conjugates with the co-attachment of Con A.

Figure 6. Local IL-10 levels in the inflamed colons upon intracolonical administration of adenovirus-microbead conjugates with and without the co-attachment of Con A. Adenovirusmicrobead conjugates with and without the co-attachment of Con A were prepared using Ad5.CMV-IL10 at 50 adenoviral particles per microbead. These conjugates, along with free Ad5.CMV-IL10, were administered intra-colonically into mice with TNBS-induced colitis by enema (a total of 1 x 109 adenoviral particles per mouse). At 24-hr post-administration, colon homogenates were prepared from mice, and the amounts of IL-10 in the colon homogenates were determined by ELISA. Each datum shown is the average amount of mouse IL-10 in the colon homogenate, normalized at 1 mg total protein, with a standard deviation. A, control (without the administration of Ad5.CMV-IL10); B, free Ad5.CMV-IL10; C, adenovirusmicrobead conjugates without the co-attachment of Con A; D, adenovirus-microbead conjugates with the co-attachment of Con A.

229

Jerusalmi et al: Adenovirus-microbead conjugates containing lectin conjugates containing Con A allows for efficient transduction of the colon with TNBS-induced colitis, raising the local IL-10 level considerably.

E. Local production of IL-10 in the inflamed colon upon intra-colonical administration of adenovirus-microbead conjugates containing Ad5.CMV-IL10

IV. Discussion

Adenovirus-microbead conjugates containing Con A were used to test if local IL-10 levels in the colons of mice with TNBS-induced colitis could be raised upon intracolonical administration of the conjugates. Adenovirusmicrobead conjugates with and without Con A (50 adenoviral particles per microbead), along with free Ad5.CMV-IL10, were administered intra-colonically into mice with TNBS-induced colitis (a total of 1 x 109 adenoviral particles per mouse). No appreciable changes of the health and behavior were seen with mice upon intracolonical administration of free Ad5.CMV-IL10 and its microbead conjugates with and without the co-attachment of Con A. At 24-hr post-administration, the local level of mouse IL-10 in the colon was determined quantitatively

by ELISA (Figure 6). When free Ad5.CMV-IL10 was used, the level of mouse IL-10 in the colon became slightly higher than that of control mice, which received no adenoviral vectors. The use of adenovirus-microbead conjugates without Con A slightly reduced the local IL-10 level in the colon, as compared to that of control mice. In contrast, when Ad5.CMV-IL10 was administered intracolonically in the form of adenovirus-microbead conjugates containing Con A, the amount of IL-10 in the colon was raised considerably to a level that is almost an order of magnitude higher than that of control mice.

We also tested if either avidin-coated microbeads, used as virus carriers, or Con A, used as an anchoring agent for adenovirus-microbead conjugates, contributed to the elevated IL-10 level in the colon, seen with intracolonical administration of adenovirus-microbead conjugates containing Con A above. In particular, Con A might have contributed to the elevated IL-10 level in the colon since repeated, intravenous administration of Con A can induce IL-10 production (Louis et al, 2000).

Biotinylated Con A was attached to avidin-coated microbeads to saturate the microbead surface, followed by the removal of unbound Con A. The resulting avidincoated microbeads containing Con A were administered intra-colonically into mice with TNBS-induced colitis by enema (a total of 2 x 107 microbeads in 100 #l PBS per mouse; the same amount of microbeads as that used for adenovirus-microbead conjugates containing Ad5.CMVIL10 above). At 24-hr post-administration, mice were euthanized, and the local IL-10 levels in the colons were determined quantitatively by ELISA. No appreciable changes in the local IL-10 levels were seen, as compared to control mice that received PBS alone (P > 0.4), suggesting that neither avidin-coated microbeads nor conjugated Con A induced the production of IL-10 in the colon (data not shown). These results indicate that the elevated IL-10 level in the colon upon intra-colonical administration of adenovirus-microbead conjugates containing Con A (Figure 6) was indeed derived from the transduction of the colon by Ad5.CMV-IL10. These results reveal that intra-colonical administration of Ad5.CMV-IL10 in the form of adenovirus-microbead

We have demonstrated that the use of adenovirusmicrobead conjugates containing Con A allows for efficient transduction of the inflamed colon by adenoviral vectors upon intra-colonical administration by enema. The co-attachment of Con A as an anchoring agent has shown to be essential for enhanced transduction of the inflamed colon by adenovirus-microbead conjugates. Without the co-attachment of Con A, adenovirus-microbead conjugates showed a limited ability to transduce the inflamed colon, and their transduction efficiency was similar to that of free adenoviral vectors. These results suggest the potential for the gene transfer technology with adenovirus-microbead conjugates containing Con A to serve as an effective means for the delivery of therapeutic transgenes to the inflamed colon for the therapy of IBD. In addition, the size of adenovirus-microbead conjugates and the use of Con A as an anchoring agent could effectively inhibit systemic absorption of the conjugates. This could reduce uncontrolled migration of adenoviral vectors to and subsequent transduction of non-target organs.

Furthermore, since adenovirus-microbead conjugates containing Con A have higher infectivity and broader tropism than free adenoviral vectors, a smaller amount of adenoviral vectors should be needed to achieve a given level of transgene expression. Hence, the use of adenovirus-microbead conjugates containing Con A for the delivery of therapeutic transgenes to the inflamed colon could also offer safety enhancement by minimizing both undesirable transduction of non-target organs and the number of adenovirus vectors required.

With an efficient transduction system for the inflamed colon now in hand, it should be possible to investigate, rigorously, the effect of local expression of the IL-10 and other therapeutic genes in the colon on the amelioration of established colitis. Studies are currently in progress by using a few different mouse colitis models, including the one with TNBS-induced colitis used in this study, to ask if the intra-colonical delivery of Ad5.CMVIL10 to the inflamed colon in the form of adenovirusmicrobead conjugates containing Con A could offer enhanced amelioration of colitis. These studies address several key questions, including the relationship between the local levels of IL-10 in the colon and the therapeutic effect on established colitis and whether the use of adenoviral vectors in the form of adenovirus-microbead conjugates containing Con A could minimize uncontrolled migration of viral particles to non-target organs. In addition, what cell types in the colon can be transduced by adenoviral vectors upon intra-colonical administration of adenovirus-microbead conjugates containing Con A is being determined, since this serves as a critical factor that determines the persistency of the expression of the IL-10 and other therapeutic genes.

Acknowledgments We would like to thank Andrea Gambotto for 230

Gene Therapy and Molecular Biology Vol 10, page 231 Hodgson HJ (2003) Local delivery of adenoviral vectors encoding murine interleukin 10 induces colonic interleukin 10 production and is therapeutic for murine colitis. Gut 52, 363-369.

Lis H and Sharon N (1986) Lectins as molecules and as tools.

Annu Rev Biochem 55, 35-67.

Lis H and Sharon N (1998) Lectins: Carbohydrate-specific proteins that mediate cellular recognition. Chem Rev 98, 637-674.

Louis H, Le Moine A, Quertinmont E, Peny MO, Geerts A, Goldman M, Le Moine O and Deviere J (2000) Repeated concanavalin A challenge in mice induces an interleukin 10producing phenotype and liver fibrosis. Hepatology 31, 381390.

Moore KW, de Waal Malefyt R, Coffman RL and O'Garra A (2001) Interleukin-10 and the interleukin-10 receptor. Annu Rev Immunol 19, 683-765.

Pandori MW, Hobson DA and Sano T (2002) Adenovirusmicrobead conjugates possess enhanced infectivity: a new strategy for localized gene delivery. Virology 299, 204-212.

Pandori MW and Sano T (2005) Chemically inactivated adenoviral vectors that can efficiently transduce target cells when delivered in the form of virus-microbead conjugates.

Gene Ther 12, 521-533.

Podolsky DK (2002) Inflammatory bowel disease. New Engl J Med 347, 417-429.

Sharon N and Lis H (1989) Lectins as cell recognition molecules.

Science 246, 227-234.

Sharon N and Lis H (1995) Lectinsâ&#x20AC;&#x201C;proteins with a sweet tooth: functions in cell recognition. Essays Biochem 30, 59-75.

Spencer SD, Di Marco F, Hooley J, Pitts-Meek S, Bauer M, Ryan AM, Sordat B, Gibbs VC and Aguet M (1998) The orphan receptor CRF2-4 is an essential subunit of the interleukin 10 receptor. J Exp Med 187, 571-578.

Strober W, Fuss IJ and Blumberg RS (2002) The immunology of mucosal models of inflammation. Annu Rev Immunol 20, 495-549.

Wirtz S, Becker C, Blumberg R, Galle PR and Neurath MF (2002) Treatment of T cell-dependent experimental colitis in SCID mice by local administration of an adenovirus expressing IL-18 antisense mRNA. J Immunol 168, 411420.

Wirtz S, Galle PR and Neurath MF (1999) Efficient gene delivery to the inflamed colon by local administration of recombinant adenoviruses with normal or modified fibre structure. Gut 44, 800-807.

providing Ad5.CMV-IL10, Andrew Keates for the instructions on the preparation of a mouse colitis model, and Peter Thomas for providing the MIP-101 cell line. We also thank Khashayarsha Khazaie, William Faubion, Cox Terhorst, and Mark Pandori for useful suggestions. AJ was supported by a training grant from the National Cancer Institute (CA59367; awarded to Dr. Melvin E. Clouse).

This work was supported, in part, by the Broad Medical Research Program of The Eli and Edythe L. Broad Foundation (IBD-0078).

References Bouma G and Strober W (2003) The immunological and genetic basis of inflammatory bowel disease. Nature Rev Immunol 3, 521-533.

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72, 248-254. de Waal Malefyt R, Yssel H, Roncarolo MG, Spits H and de Vries JE (1992) Interleukin-10. Curr Opin Immunol 4, 314320.

Dignass AU, Baumgart DC and Sturm A (2004) Review article: the aetiopathogenesis of inflammatory bowel disease-immunology and repair mechanisms. Aliment Pharmacol Ther 20 Suppl 4,9-17.

Fechner H, Wang X, Wang H, Jansen A, Pauschinger M, Scherubl H, Bergelson JM, Schultheiss HP and Poller W (2000) Trans-complementation of vector replication versus Coxsackie-adenovirus-receptor overexpression to improve transgene expression in poorly permissive cancer cells. Gene Ther 7, 1954-1968.

Hobson DA, Pandori MW and Sano T (2003) In situ transduction of target cells on solid surfaces by immobilized viral vectors.

BioMed Central Biotechnol 3, 4.

Jurjus AR, Khoury NN and Reimund J-M (2004) Animal models of inflammatory bowel disease. J Pharmacol Toxicol Methods 50, 81-92.

Korzenik JR and Podolsky DK (2006) Evolving knowledge and therapy of inflammatory bowel disease. Nature Rev Drug Discov 5, 197-209.

Kuhn R, Lohler J, Rennick D, Rajewsky K and Muller W (1993) Interleukin-10-deficient mice develop chronic enterocolitis.

Cell 75, 263-274.

Lindsay JO, Ciesielski CJ, Scheinin T, Brennan FM and

231

Jerusalmi et al: Adenovirus-microbead conjugates containing lectin

232

Gene Therapy and Molecular Biology Vol 10, page 233 Gene Ther Mol Biol Vol 10, 233-244, 2006

Replicating minicircles: Generation of nonviral episomes for the efficient modification of dividing cells Research Article

Kristina Nehlsen#,§, Sandra Broll# and Juergen Bode* GBF, German Research Centre for Biotechnology, Mascheroder Weg 1, D-38124 Braunschweig

__________________________________________________________________________________ *Correspondence: Juergen Bode, GBF, German Research Centre for Biotechnology, Mascheroder Weg 1, D-38124 Braunschweig, Germany; Tel +49(0)531 6181 5200; Fax +49(0)531 6181 5002; Juergen.Bode@helmholtz-hzi.de Key words: replicating episome, nonviral vector, minicircle, S/MAR, maintenance element, segregation Abbreviations: Luria-Bertani media, (LB); origins of replication, (ORIs); population doublings, (PDs); prototype episome, (pEPI); scaffold/matrix attachment region, (S/MAR); stress-induced duplex destabilization, (SIDD)

§This work is part of the STREP-program in the EU-FW6 “Episomal Vectors as Gene Delivery Systems for Therapeutic Application” (“EpiVector”) #both authors contributed equally Received: 23 August 2006; Accepted: 8 September 2006; electronically published: September 2006

Summary Nonviral replicating circular episomes are a rather new addition to the field of mammalian expression vectors.

After their establishment, which conventionally requires an initial phase under selection pressure, these entities utilize the replication apparatus of the host cell to replicate in accord with the cell cycle. The requirements of a selection agent, the gradual inactivation by cellular defense mechanisms, and a limited cloning capacity (up to 5 kb could be realized for the prototype) have remained the critical parameters. Here we introduce a site-specific recombination-based strategy that permits the excision of prokaryotic vector parts after the parental construct has been amplified as a plasmid. The remaining 4 kb ´minicircle´ consists of only one active transcription unit and a scaffold/matrix attachment region (S/MAR). In contrast to the parent plasmid vector it can be established in the absence of selection, it is not subject to epigenetic silencing and it replicates stably without a sign of integration. In further contrast to available minicircles that are maintained only in non-dividing tissues our minicircle represents the first example that is suited for the modification of dividing cells and tissues due to its association with the nuclear matrix and its authentic segregation.

solution episomes have emerged. However, until recently the only replicating episomes were of viral origin and needed viral (and thereby oncogenic) factors for their propagation (Bode et al, 2001).

A more general problem goes back to the fact that eukaryotes have evolved elaborate defense systems to protect the integrity of their genomes and to fight the expression of ectopic transcription units. In mammals, the insertion of retroviral DNA, the incorporation of repeat arrays and the co-introduction of prokaryotic vector parts are the major triggers of transcriptional silencing processes. In case of retroviruses it has been suggested that the cell recognizes structural features of integration intermediates. Additional defense strategies go back to the fact that dinucleotide frequencies in mammals differ from

I. Introduction Gene therapy is dedicated to the treatment or prevention of disease through gene transfer. To this end, several methods are explored based on viral vectors or "naked" DNA. Viruses have the natural inclination to invade human cells and deposit their genome in the nucleus. They would be the preferred vectors for applications in gene therapy in the absence of distinct drawbacks: viruses may trigger the immune system and some of them interfere with the expression of essential genes by integration. Although the past decade has brought vector technology a long way from the early days of using wild-type viruses, even today the associated problems could not be fully resolved and this is one reason that alternatives gain increasing attention. As a potential 233

Nehlsen et al: Replicating minicircles those of other organisms, especially regarding the abundance of CpG dinucleotides. In general, the DNA of higher eukaryotes is impoverished in these motifs relative to bacteria, for which the abundance is in accord with statistical expectations. Most silencing processes are accompanied by the methylation of CpGs, which may be preceded by histone H3 methylation at Lys-9 (Fuks et al, 2003). A methylation center in turn can trigger chromatin condensation spreading to a downstream promoter to provide it with a heterochromatin-like structure – at least in the cases where such a process is not blocked by an intervening insulator element (Goetze et al, 2005).

Typically, a high level of transgene expression is detected shortly after DNA has been delivered to target cells, but this expression is silenced, within a few weeks, even though vector DNA may remain in an extrachromosomal state. The short duration and the shutdown of transgene expression are important limitations that have to be overcome for many potential clinical gene therapy applications. We and others have applied chromosome-based and epigenetic principles for the optimal utilization of the transcription and replication apparatus of mammalian cells (review: Bode et al, 2003; Jackson et al, 2006). According to this concept, transgenes are introduced in the form of an autonomous domain, which, in its extreme, is a circular, nonviral episome with a single domain boundary (S/MAR).

One of the fundamental properties ascribed to S/MARs is their strand-separation potential (Bode et al, 1992, 2006), which is the likely reason for the fact that these elements are regularly found in association with origins of replication (ORIs). This ORI-support capacity has been exploited to develop pEPI, one of the first examples of a plasmid-based episomal vector that replicates extrachromosomally (Piechaczek et al, 1999).

Available evidence indicates that this vector class recruits, via the huIFN-! 5´ S/MAR, components of the cellular replication apparatus to support an authentic segregation (Baiker et al, 2000). Following these pilot studies we have started to refine the system by reducing its size to the absolutely required minimum. We demonstrated that for pEPI most sequences apart from the (correctly oriented) egfp gene and the S/MAR element are not required for episomal maintenance and expression (Nehlsen, 2004) and that a largely functional S/MAR can be assembled from 150 bp modules (Jenke et al, 2004, Bode et al, 2006). The latter plasmid performed replication comparable to pEPI but it did not express the egfp-gene to any measurable extent – possibly due to the fact that transcription of the 150 bp repeats leads to mRNA instability.

Here we resume these efforts by the generation of “minicircles” via a deletion of prokaryotic sequences after the vector has been amplified, as a plasmid, in a bacterial producer strain. The deletion comprises the resistance marker, which, in case of the original pEPI-vector, is essential for establishing the plasmid in the recipient cell (Figure 1 and Papapetrou et al, 2006). Although convenient and efficient, such a selection routine would not be compatible with most gene therapeutic regimens.

We will demonstrate that the deletion strategy supports the establishment and maintenance of functional, replicating

episomes in the absence of selection pressure even in rapidly dividing cells. It also overcomes the rapid epigenetic inactivation, which presents a major impediment to the application of the parent plasmid-type “pEPI”-vector. These and related properties of the minicircle will be demonstrated exemplarily for three prototype cell lines (CHO – transformed chinese hamster ovary cells; HEK293 - human transformed primary embryonal kidney cells; NIH3T3 – immortal but nontransformed clone from mouse embryonic fibroblasts) where it can be established in the absence of any selection pressure.

II. Materials and methods A. Plasmids and strains Escherichia coli strain MM294Flp (MM294 (CGSC #6315 (294-FLP: F–, !–, supE44, endA1, thi-1, hsdR17, lacZ:cI857FLP)) (Buchholz et al, 1996) was kindly provided by Francis Stewart (University of Dresden): Flp recombinase gene under the control of !PR -promoter was inserted into the bacterial lacZ gene using the gene replacement technique as described by Buchholz et al (Buchholz et al, 1996).

B. Minicircle production and purification A single colony of Escherichia coli MM294Flp was transformed with the maxicircle (Figure 3A) and grown overnight in a shaking incubator at 30°C in Luria-Bertani media (LB) containing 25 mg/ml Kanamycin. Cells were pelleted at 4000 rpm before resuspension in 4:1 (v/v) LB. After washing, cells were re-pelleted at 4000 rpm and resuspended in 2:1 (v/v) fresh LB. Flp expression was initiated by incubation at 40°C for 20 min. Incubation of bacteria was continued for 2.5 h at 35°C in a shaking incubator (180 rpm). This period was succeeded by a second initiation step at 40°C for 20 min and incubation was continued for an additional 1.5 h at 35°C. The superhelical status of the vector turned out to be a relevant parameter for episomal establishment and therefore various procedures, CsCl gradient centrifugation, Qiagen mediprep system and Capillary Gel Electrophoresis, were initially explored for its preparation. It was found that all three procedures could be applied with similar success in the context of our protocol. For present work the pool of DNA products was digested by HindIII, which linearizes the maxicircle and the miniplasmid but not the minicircle. Undigested supercoiled minicircle could then be separated from the linearized maxicircle and the bacterial miniplasmid by agarose gel electrophoresis (Figure 3B´). The respective band was excised from the gel and the DNA was extracted using the Qiagen Gel Purification Kit. A further purification step, the application of ATP dependent nuclease, could be applied to free the gel-extracted minicircle from nicked or linear contaminants (Figure 3B´´). To this end 42 ml of the extract were provided with 5 ml 10"Plasmid SafeTM reaction buffer, 2 ml of 25 mM ATP and 1 ml Plasmid-SafeTM ATP-dependent DNAse (all materials from Epicentre / Biozym Scientific GmbH). After shaking (37°C) supercoiled DNA was recovered by the QIAquick PCR purification kit according to the manufacturer´s instructions.

C. Cell culture -NIH 3T3 cells (ACC59; population doubling time 20 h) were cultured in Dulbecco's modified Eagle's medium containing 10% fetal calf serum, 20 mM glutamine, 60 µg of penicillin/ml, and 100 µg of streptomycin/ml.

234

Gene Therapy and Molecular Biology Vol 10, page 235

Figure 1. Performance of a 6.4 kb plasmid as replicating episome. A. Constitution of the parental vector. The function of the wellcharacterized pEPI-vector (here called “maxicircle”) depends on a S/MAR (here the 2 kb element upstream to the human interferon-b gene, symbolized by the hook symbol) and a transcription unit (here: egfp). Transcription has to traverse part of the S/MAR as indicated.

The role (if any) of the second transcription unit (neor ) and of the plasmid (pUC) origin (upper box) in episomal maintenance is one subject of this study. The basic vector has been provided with two identical 48 bp FRT wildtype-sites (half arrows) permitting the Flpinduced deletion of the intervening sequence, i.e. the conversion of the maxicircle into a minicircle and a miniplasmid (Figure 3).

Abbrevations: P SV40, SV40 promoter/enhancer driving the neomycin/kanamycin encoding gene as a selection marker for mammalian cells or E. coli, resp.; ORIpuc, plasmid origin of treplication; Pcmv, CMV promoter driving the egfp coding unit; FRT, full (48 bp) Flprecombinase target sites. B. Maxicircles are lost in the absence of selection. After lipofection according to the GenePorterTM protocol the persistence of maxicircles strictly depends on selection in G418 (500µg/ml) (compare traces “Maxicircle +” and “Maxicircle – “).

Minor expression levels of the neor/kanr unit are known to suffice for G418 resistance. Among the resistant cells 40% also express measurable levels of egfp as indicated. If an initial selection period is discontinued after 12 population doublings (“Maxicircle +/-“) a decrease of expression levels and of episomal persistence is noted at a rate that is largely reduced relative to the “Maxicircle -“ case. C. Dependence of pEPI-type maxicircles on selection. Lanes 2 contains a loading control, i.e. 100 pg of linearized episome DNA in the presence of 4 µg genomic DNA from non-transfected CHO K1 cells. Lane 1 is a corresponding control for the minicircle. Lanes 3 and 4 (taken from cells 20 PDs after lipofection) show that pEPI can be maintained if CHO-K1 cells are kept under selection pressure (+G418). Lane 5 demonstrates the total loss of the maxicircle after 20 PDs in the absence of the drug (-G418). Left and right panels show size markers, lane “wt” shows non-transfected (“empty”) cells.

-CHO-K1 cells (ACC110; population doubling time 24 h) were cultured in a 1:1 mixture of Nut. Mix F12 (HAM) medium with GlutaMAX (Gibco) and Dulbecco's modified Eagle's medium which were both supplemented with 10% fetal calf serum, 20 mM glutamine, 60 µg of penicillin/ml, and 100 µg of streptomycin/ml.

-HEK293 cells (ACC305; average population doubling time 24 h) were cultured in Minimal Essential Medium containing Earle's salts supplanted by 20 mM glutamine, 60 µg of penicillin/ml, 100 µg of streptomycin/ml and 10% fetal calf serum.

Since electroporation was found to seriously interfere with the superhelical status and thereby to promote integration into the genome, we optimized a lipofection protocol as this method generated the highest proportion of cells for which expression was exclusively due to the episome and not accompanied by inadvertent integration events. For mini- and maxicircle-transfer to 5"104 cells on a 6-well culture plate 1 µg of DNA was diluted to 50 ml by ‘DNA diluent’ and left for 5 min at room temperature. In a different vial 10 µl of GenePORTER TM2 reagent (Genlantis) were mixed with 40 µl of serum free medium. The DNA-solution was added, without vortexing, to the GenePORTER TM2 -solution. After a 10 minute incubation at

D. Transfection 235

Nehlsen et al: Replicating minicircles room temperature the mixture was carefully pipetted onto the cells with 1 ml of serum free medium. After 4 hours an additional ml (containing 20 % FCS) was added to reach a final concentration of 10 % FCS. Medium exchange was performed the following day and selection with G418 (CHO-K1: 500 µg/ml; NIH3T3: 700 µg/ml) was applied where applicable.

transcription, which may support its conversion to the single-stranded state. For pEPI an artificial termination site has been localized within the 2 kb S/MAR sequence after 800 bp (Figure 1A and Nehlsen 2004). In addition, the direction of transcription was shown to matter: if the egfp transcription unit was inverted by the use of Cre recombinase in combination with two inversely oriented lox P sites, only the original orientation was maintained as an episome whereas the inverse one was lost without indications for an integration.

Meanwhile pEPI-type vectors have emerged as potential tools for applications in gene therapy and their performance has recently been evaluated for dividing cells of the haematopoietic system (Papapetrou et al, 2006; review: Papapetrou et al, 2005). These studies show that, in the absence of initial selection, at most 1% of replicating cord blood cells retain the vector after 28 days suggesting that it is poorly maintained in progeny cells. In fact, a selection step has to be applied for establishing this episome, which may be compatible with the modification of cells ex vivo but not in vivo. Our data in Figure 1B support these principles by using rapidly dividing CHO cells, for which most data of pEPI-type vectors have been derived. In our model experiment the vector is lost during 12 population doublings (PDs; see Figure 1B and lane 5 in Figure 1C). On the other hand, an initial selection in G418 is sufficient to enrich a subpopulation of cells that continues to propagate even in the absence of the drug, although, under these conditions, a >50% loss of expressing cells is observed over 50 PDs (“Maxicircle +/“). A stable subpopulation of cells can finally be obtained if transfected cells are selected in the permanent presence of 500 µg/ml of G418 (Figure 1B, trace “Maxicircle +”).

Over some years our experiments have indicated an inverse relation between episome size and –stability, especially regarding the superhelical state during freezingthawing cycles, which frequently caused problems for the maxicircle (S. Broll, unpublished; see Discussion). To improve this situation we started different approaches such as the design and construction of a minimal S/MAR element that could be obtained by oligomerizing a S/MAR-module, a so called ´unpairing element´ (UE; see Jenke et al, 2004), or the deletion of sequences that are exclusively needed for plasmid amplification in bacteria.

For present work we decided to leave the S/MAR element constant since artificial S/MARs with repetitive sequences caused unexpected complications regarding egfp expression (Nehlsen, unpublished). As a consequence, we will compare below a pEPI-like ´maxicircle´ with a ´minicircle´ that is the result of excising all sequences that are only required for producing the plasmid precursor.

E. FACS analysis The intrinsic fluorescence of the GFP-protein is used for the analysis of expression levels in living cells. To this end nonconfluent cells were trypsinized and collected in EPICS (PBS, 10 % heat inactivated FCS) buffer. Cells were collected by centrifugation (5 min, 1000 rpm) in a Heraeus-Christ minifuge before they were diluted to 1"107 ml in EPICS-buffer. Propidium iodide (2 mM) was used to stain and exclude dead cells. eGFP fluorescence was excited by irradiation at 488 nm. Sorted cells were kept for four days in the presence of Gentamycin (5 µl/ml of a stock containing 10 mg/ml).

F. Localization and episomal status of transgenes FISH-analysis: Cells were grown to 60-80 % confluence and split one day before the preparation of metaphase spreads.

Colcemide was added to a final concentration of 40 ng/ml medium and the culture was subjected to a 4 hour incubation at 37°C. After trypsinization the cell pellets were incubated in 2M NaCl/KCl (1:1) for 1 minute, centrifuged at 1200 rpm for 5 minutes, fixed three times in MeOH/Acetic acid (3:1) and incubated overnight at 4°C. An additional three fixation steps with MeOH/Acetic acid were performed by applying the solution on pre-cooled slides. Hybridization of the slides was done with a labelled nick-translated pEpi-plasmid DNA probe using SpectrumRed (Invitrogen) and counter stained with 10 µl of DAPI (0.187 µg/ml in Vectashield mounting medium).

G. Southern blot analysis High molecular weight DNA was harvested from 1x106 cells and digested with the respective restriction enzyme. The genomic as well as extrachromosomal DNA was then separated on 0.8 % agarose gels, blotted and hybridized with a 32P-labeled SV40-DNA probe.

F. Epigenetic reactivation experiments Cells were seeded at a densitiy of 1x105 and incubated in medium containing either Butyrate (5 mM), TSA (165 nM) or 5AzaC (24µM). Reactivation of eGfp-expression is determined by FACS-analysis after 48 hours.

III. Results A. General properties The prototype episome (pEPI) does not depend on any viral factor and it divides in synchrony with cellular replication (Schaarschmidt et al, 2004). Its function depends on a S/MAR element by which the replication apparatus of the host cell can be recruited and utilized (see Figure 1A). Authentic segregation into daughter cells is supported by the S/MAR´s capacity to act as a maintenance element (Bode et al, 2001). Beyond these properties S/MARs are proven tools to restrict epigenetic silencing via DNA-methylation/histone deacetylation (Dang et al, 2000).

Previous experiments have shown that in this case the S/MAR function depends on its (at least partial)

B. Scaffold/Matrix attachment regions (S/MARs) All S/MARs, whether they are located within a chromatin domain or at its borders, share a common criterion: they consist of a more or less regular succession of DNA-unpairing elements at which the double strand separates under negative superhelical tension (Bode et al, 2006). These UEs together constitute the architecture that

236

Gene Therapy and Molecular Biology Vol 10, page 237 is required for the accommodation of prototype nuclear matrix proteins (Bode et al, 2003). This feature is illustrated by the SIDD (stress-induced-duplex destabilization) profiles in Figures 2A and 2B, which are routinely recorded for the negative superhelicity that is typically present in a plasmid (Bode et al, 2006). The coding region (egfp) has no propensity to separate strands, in contrast to the transcriptional termination site, which is highly destabilized. Previous contributions have demonstrated that these are common features found for any gene and have revealed the functional background of such an architecture (Bode et al, 2006). In this respect it is intriguing to note that the minicircle is destabilized over its entire length with the sole exception of the egfp-tract.

An E. coli strain (MM294Flp) with the Flprecombinase gene under the control of a heat-inducible promoter (Buchholz et al, 1996) was kindly provided by Francis Stewart (University of Dresden). We applied this system for the amplification of the 6.4 kb pEPI-derivative in Figure 3A, which had been provided with equi-directed FRT-sites (half-arrows) and for which the egfp coding unit was promoter-free. This setup guarantees that the only specimens expressing eGFP will be those that underwent excision and it overcomes any ambiguity that could be ascribed to remainders of the educt.

The Flp-mediated recombination between the FRT sites was triggered by a shift to 40°, which served to eliminate the intervening sequences and to pose the egfp unit under the control of the SV40 promoter. As a result, a fluorescent 4.1 kb episome (´minicircle´) and a 2.3 kb

C. Minicircles generated in bacteria

Figure 2. Molecular components necessary for episomal replication: Structural analyses. The molecular constitution and stressinduced duplex destabilization (SIDD-) profiles are shown for the 6.4 kb parental plasmid from Figure 3A (A) and for the minicircle (B). A value G(x)=0 kcal/mol would mean strand separation at the respective site under a standard superhelix density of " = -0.05 (Bode et al, 2006). Note that the minicircle is destabilized throughout with the exception of the egfp coding region.

237

Nehlsen et al: Replicating minicircles

Figure 3. Generation of the minicircle by Flp-mediated recombination A. The principle. Flp recombinase is induced in E. coli strain MM294-Flp by the temperature shift cycle (30° ! 40° ! 35°) described in “Materials and Methods”. The “minicircle” is generated from the eukaryotic sequence parts (lower box in Figure 1A) and a “miniplasmid” from the plasmid parts. This process places the egfp reporter gene under the control of the SV40 promoter. Abbreviations other than those in Figure 1A: PA-SV40 and PA-HSV-tk: polyadenylation signals derived from SV40 or the HSV-tk gene, resp.. B. Analyses (B´) The reaction mixture is treated with HindIII (lane 3) whereby the educt and the miniplasmid are linearized and converted to substrates of ATP-dependent DNase; the supercoiled minicircle remains unaffected. For analytical purposes lane 2 shows a digest by BamHI which linearizes all species except the miniplasmid. (B´´) Supercoiled minicircles after extraction from an electrophoretic gel; the effect of ATP-dependent DNase. The lane marked “-“ shows (from top to bottom) traces of a sc minicircle-dimer, the lin minicircle, the sc minicircle and traces of lin miniplasmid.

´miniplasmid´ were generated (Figure 3A). While the minicircle contains the S/MAR and the egfp-tract, the miniplasmid carries the prokaryotic sequences together with the neor/kanr selection gene. This situation is analyzed in Figure 3B´ after digestion with HindIII (single cut in the parental construct and the miniplasmid leaving a supercoiled minicircle) and with BamHI (single cut in the parental plasmid and in the minicircle).

Figure 3B´´ demonstrates that superhelical, circular DNA can efficiently be purified by ATP-dependent DNase (Wilcox et al, 1976). Under standard reaction conditions this enzyme rapidly degrades duplex linear DNA. It also utilizes energy from ATP hydrolysis to move along the DNA and to unwind regions of the molecule, releasing large partially or totally single-stranded fragments on which it acts as an endonuclease; duplex circular DNA is not a substrate (Wilcox e t al, 1976)). In our example we demonstrate the ultimate purification of a minicircle that has been separated by gel electrophoresis, followed by extraction using the QUIAquick procedure. Alternatively, crude plasmid DNA was treated with HindIII as for Figure 3B´ (trace 3) and all DNAs except the minicircle were directly removed by ATP-dependent DNAse. All following experiments are based on the first variant in

order to suppress any kind of integration that might follow the transfer of linear DNA remainders.

Figure 4A compares situations in which either the maxicircle (Figure 1A) or preparations of the minicircle were transferred and analyzed at various time points.

Starting with a 40-45% contribution of fluorescent cells (lipofection transfer efficiency) five population doublings (PDs) were allowed for the establishment of episomes before fluorescent cells were recovered by FACSorting.

Detailed analyses started after 12 PDs, at which time a functional minicircle was left in 70% of the cells while fluorescent maxicircles persisted in less than 10% of the cell population. During the subsequent 40 PDs the minicircles showed a stable propagation whereas the fate of the maxicircles strictly depended on the treatment of cells: Figure 4A demonstrates a close to complete loss in the absence of selection while continued selection in G418 media led to the enrichment of a subpopulation in which both the egfp and the neor cassette were expressed.

Essentially similar results were obtained for human embryonic kindney (HEK293; Figure 5A) and murine NIH3T3 cells (Figure 5B). For HEK293 cells the minicircle is seen to yield a broad though stable population between 32 and 60 PDs whereas the maxicircle-transfected cells show a continuous drift to lower expression levels.

238

Gene Therapy and Molecular Biology Vol 10, page 239 This drift can be reversed, to a large extent, by the addition of (R)-Trichostatin A (TSA), an established inhibitor of histone deacetylases that permits histone (re-)acetylation (Schlake et al, 1994). The same treatment for the minicircle population leaves the FACS-profile unchanged indicating that only the maxicircle is subject to epigenetic inactivation. NIH3T3 cells, an immortal but nontransformed, contact inhibited cell line, reveals the most clearcut differences between the systems: while the minicircle is stably expressed between 32 and 55 PDs, the maxicircle has undergone an almost complete shutoff already at 32 PDs.

The copy number of pEPI-type vectors is low (Baiker et al, 2000) but stably maintained during cell divisions (Schaarschmidt et al, 2004). In Figure 6 we show FISH analyses comparing the properties of maxiand minicircles. For the minicircles we consistently find sharp fluorescent spots in association with the metaphase chromosomes. The same is true for the majority of maxicircle-containing cells but there are notable exceptions, where intense doublets on both chromosome arms indicate occasional integration events of the plasmidtype vectors during continued cultivation. An example is given in the upper right section of Figure 6.

Figure 4. Long-term expression of replicating episomes in CHO-K1 cells after a single FACS-enrichment of eGfp-expressing cells. A. After a 5-days period of ´episome establishment´ fluorescent cells are recovered by FACSorting. Measurements start at day 12 when 65% of fluorescent cells are left for the minicicle, and 3% for the maxicircle (here: the pEPI-vector shown in Figure 1A). If the latter population is kept under selection pressure (G418) the fluorescent subpopulation becomes dominant and reaches 60% after 53 population doublings. In case of the minicircle selection is neither possible nor required as the population is perfectly stable at the 65% level over the entire time interval. B. Southern blot-analysis for episomally replicating mini- and maxicircles in CHO-K1-cells. Lanes 14: Minicircle from four separate transfection experiments of the minicircle after 26 PDs and linearization with BamHI. Lanes 5, 6 corresponding analyses for the maxicircle kept for 26 PDs in the presence or absence of G418, respectively. Size marks indicate the 7.1 kb pEPI-vector and the 4.1 kb minicircle derived from the pEPI-derivative as shown in Figure 3A; the corresponding lanes “PMini” and “PMaxi” are loading controls i.e. 100 pg of linearized episome DNA in the presence of 4 #g genomic DNA from non-transfected CHO K1 cells, lane “wt” shows just the genomic DNA. C. Episomes (mini- or maxicircles as indicated) in CHO-K1 cells were analyzed in two parallel transfection experiments after 18 or 32 population doublings (18 PD or 32 PD, resp.) in the absence of selection pressure (“Minicircle” / “Maxicircle –“) according to section A. Both experiments demonstrate a faster inactivation of the maxicircle. If selection pressure is applied from the time of sorting (5 PDs) on (situation “Maxicircle +”), an expressing population emerges that approaches the level of the minicircle population (see the continuous shift from trace 18 PD to 32 PD and 60 PD).

239

Nehlsen et al: Replicating minicircles

Figure 5. Persistence and expression of plasmid vectors and minicircles in two other cell lines. A. Analyses corresponding to Figure 4 but for HEK293 cells. For the left-hand transfection experiments minicircles and maxicircles were analyzed after 32 and 60 PDs. After 60 PDs cells were subjected to treatments with either 165 nM (R)-Trichostatin A (“TSA”) or 24 mM 5-Aza-cytidine (“AzaC”) as indicated and re-analyzed after an additional 48 h in the presence of these drugs. B. NIH3T3 cells: FACS-analyses for miniand maxicircles after 32 and 55 PDs. For the minicircle the profiles remain nearly unchanged in this interval. For the maxicircle a complete shutoff is noted already after 32 PDs.

have to be overcome if episomal vectors are to be used for the modification of proliferating cells. To be effective it is required that the new genetic material not only replicates but that it is also actively retained through cell division and passed on to daughter cells. These considerations have set the stage for the present study.

In past work we have already defined the essential components of an episome that replicates once per cell cycle (Schaarschmidt et al, 2004), i.e. an active transcription unit and a S/MAR while the SV40 origin function was found to be dispensable (Nehlsen 2004). In a computer-assisted way analogous to Figure 2 S/MAR elements were designed such that they can accommodate components of the nuclear scaffold / nuclear matrix, among these scaffold-attachment factor A (SAF-A / hnRNP-U; Jenke et al, 2001, 2004). These interactions mediate the association of the vector with the chromosome arms enabling an effective segregation into the daughter cells (maintenance function, see Bode et al 2001). Other established S/MAR functions are the capacity to reduce epigenetic silencing and to promote histone hyperacetylation (Klehr et al, 1992). Interestingly, the performance of S/MARs can be boosted by the application of histone deacetylase inhibitors such as (R)-Trichostatin A (TSA), butyrate (Schlake et al, 1994) or by certain derivatives (e.g. phenylbutyrate) that have found use for therapeutical applications (Gore et al, 1997). These activities depend – at least in part – on S/MAR

IV. Discussion While there is significant progress in the modification by episomal DNA of slowly-dividing tissues like liver, muscle and brain, maintenance problems have so far limited the use of nonviral episomes for dividing cells, for instance of the hematopoietic system (Papapetrou et al, 2005, 2006). For liver, the most advanced vehicles appear to be “minicircles”, small circular vectors that are exclusively composed from eukaryotic sequences. In contrast to linear DNA, minicircles do not concatemerize and are less prone to integration. It is also known that, owing to their superhelical status, they are better transcriptional templates than linear DNA (Weintraub et al, 1986).

Based on this rationale M. A. Kay and coworkers could demonstrate that transgene expression levels in nonreplicating minicircles are not only 45-560 fold higher but also more persistent compared to conventional plasmids (Chen et al, 2003; Riu et al, 2005). The authors applied a critical test to prove the episomal state of these vectors, i.e. a 2/3 hepatectomy upon which almost every hepatocyte undergoes one or two cell doublings until the liver mass is reconstituted. It was shown that during cell cycling the minicircles were lost in accord with their non-integrated (episomal) status (Chen et al, 2001). The results clearly demonstrate that this class of vectors is not functionally attached to chromosomal DNA, which would otherwise provide the required centromere function (Bode et al, 2001) and they anticipate the category of problems that 240

Gene Therapy and Molecular Biology Vol 10, page 241 conformational changes that are brought about by a nearby active transcription unit (see Figure 1A).

Our present series of experiments expands the knowledge about the essential vector components. It has been shown before that a S/MAR that is at least partially traversed by the transcription machinery is essential while either the deletion (Baiker et al, 2000) or the inversion (Nehlsen, 2004) of the transcription unit lead to integration. Here we show, for the first time, that minicircles but not maxicircles give raise to a stable population of cells as long as they contain a single active gene (egfp) and the S/MAR (Figure 4A). Together these results prove that, while a second transcription unit (here: neor/kanr) is compatible with the episomal status, it is not required as it can be deleted together with the prokaryotic vector parts (including the pUC origin of replication, ORIpUC). The resulting minicircles provide an increased cloning capacity, which according to preliminary observations may be as high as 7 – 8 kb and even higher in cases the subunits of a protein can be encoded by separate episomes (Nehlsen, 2004). They also have an improved long-term- (Figure 4A) and physical stability (transformed cells resist multiple freezing-thawing cycles; S. Broll, unpublished). Most important, however, they can be transferred into the dividing cells and established in the absence of any selection pressure, meeting a major requirement of gene therapeutic applications.

The criteria that are sometimes used to establish the episomal status are subject to considerable contention.

Among these is i - a full-length PCR amplification, which would give the same result in case the transgenes had integrated as a head-to-tail multimeric concatemer – a typical concomitant of the classical Ca++-phosphate transfection procedure. ii - A clear-cut Southern-blot signal is a more stringent criterion as additional bordering fragments would arise in case of integration. Inspecting Figure 4B, we can state that, considering the low copy number in our clone mixtures, background-signals are negligible for the minicircles (lanes 1-4 in Figure 4B refer to four independently prepared clone mixtures, lanes 5 and 6 exemplify the maxicircle). Where present, most of this background arises during the establishment phase as a probable consequence of some non-superhelical contaminants. iii - The common extraction procedure according to Hirt leads to the enrichment of non-integrated DNA - at least at early passages. The efficiency of this protocol decreases with time since continued rounds of replication can give raise to extrachromosomal chains (concatenates) even in case of the viral systems (Klehr and Bode, 1988). iv - A plasmid-rescue, i.e. a re-transfer of circular episomes from CHO cells to E. coli, has been suggested as yet another criterion. This procedure is not feasible in our case since the present concept demands that minicircles do not contain the necessary bacterial DNA components. Even more important, it may be ambiguous again since integrated concatemers may generate circular specimens due to intramolecular recombination (Wegner et al, 1989).

For these reasons we have put emphasis on the FISHvisualization of transgenes on metaphase spreads, which had proven its potential before (Baiker et al, 2000). In this

approach we either get multiple sharp spots in association with the chromosomes when we have to deal with intact episomes; this association is lost if the preparation involves shear forces (Baiker et al, 2000). Alternatively, we find a single intense signal indicating the typical cointegration of multiple copies immediately subsequent to DNA transfer (Baiker et al, 2000). In our present series of experiments (Figure 6) we find the first situation. For the maxicircle there are some exceptions where an additional intense doublet of spots (one on each chromatid) indicates integration events that happen during continued cultivation and replication.

In accord with current concepts (Chen et al, 2003, Riu et al, 2005) all our results suggest that the stability of the replicating minicircle can be ascribed to the absence of prokaryotic vector parts. The observation (Figure 5A) that an epigenetic re-activation by TSA is effective for the maxicircle (pEPI) but not for the minicircle is in accord with this explanation. We have to mention, however, that another difference exists between the episomes that we compare in Figure 4: the egfp-unit is driven by the CMV promoter in the maxicircle (pEPI) but by the SV40 promoter in the minicircle. This difference permitted our deletion strategy and the detection of fluorescence arising from this process (Figure 3A). Even more important, however, maintenance of the SV40 unit was dictated by the fact that nuclear transfer of plasmid DNA is facilitated by the association of ubiquitous transcription factors with this sequence and the subsequent exposure of their NLS signals (Vacik et al, 1999). This study also demonstrated that the CMV promoter is inactive in this respect (Vacik et al, 1999). Therefore, if we had chosen to drive the egfp unit by the CMV promoter in both cases, facilitated nuclear pore passage would have been abolished for the minicircle but maintained for the maxicircle where PSV40 drives the selection gene. A completely different series of experiments would have to be developed to trace promoter-specific susceptibilities to epigenetic silencing.

We do not anticipate this kind of promoter-specific effects, however, since both the CMV- (Grassi et al, 2003) and the SV40-sequences (Broday et al, 1999) are subject to methylation-dependent inactivation.

While one transcription unit is sufficient to mediate episomal maintenance, the example of pEPI-type vectors shows that a second transcription unit is at least compatible with such a status. Experiments with pEPI (Figure 1A) derivatives and two antibody chain genes in place of the egfp-unit, each controlled by a separate promoter, point into the same direction (Nehlsen, unpublished). A logical extension of our findings will therefore be the generation of a two-transcription unit minicircle devoid of plasmid sequences. In this case egfp will be the ´gene on duty´ that provides for the required conformational changes at the S/MAR. A second complete transcription unit, the ´gene of interest´, will be added at an upstream position. Cells containing this vector can be traced or isolated by FACS as in the present study, while the GOI is expressed in parallel. Again, this approach will require knowledge on the performance of promoter(combination)s in the context of a replicating episome.

241

Nehlsen et al: Replicating minicircles

Figure 6. Copy numbers and status of maxi- and minicircles: FISH analyses. FISH-analysis were performed 55PDs after transfection (cf. the final situation in Figure 4A). The control (box with “empty” CHO-K1 and HEK293 cells) shows no signals. In contrast, the majority of transfected cells showed clear fluorescent signals. For the maxicircles there are single, chromosome-associated signals and, in about 40% of all cells, also intense doublets that cover corresponding positions on both chromosome arms and are therefore indicative of eventual integration. All minicircle preparations show signals throughout the metaphase spread and copy numbers that are comparable with the maxicircle situation. However, in the minicircle case there is no indication of integration events. Average copy numbers have been derived from 10-20 individual metaphase spreads and are given together with their standard deviation.

There are intriguing indications that multiple nuclear association sites may exist for the episomes, which vary in their properties. In the present study this has first become apparent during the Figure 1B experiments where we find a certain contribution of non-egfp expressing (but G418resistant) cells. A similar phenomenon seems to hold for HEK293 cells (Figure 5A), where a narrow range of copy numbers (1-3 per cell) is associated with a wide range of expression levels (more than two orders of magnitude). On the basis of the FACS-profiles in Figure 4C and 5 in comparison with the FISH analyses in Figure 6, it is therefore tempting to speculate that points of association are highly defined and maintained over many generations.

Other classes of less appropriate sites may exist in the “transient expression phase” during which the nonfunctional sites are abandoned. In case of the minicircles this phase has terminated after 10 PDs or even before (Figure 4A). For maxicircles, on the other hand, active selection has to be applied in order provide a selective advantage for the rare subpopulation in which the maxicircle is propagated in an active state.

In summary, concepts have become available to improve plasmid-based, replicating episomes up to the stage where they support the predictable and long-term expression of transgenes also in dividing cells. These strategies will not only overcome detrimental effects of prokaryotic sequences but will also take into account the targeting capacity of S/MAR(-derivatives) or related elements by which subnuclear structures can be addressed for an optimized transcriptional capacity.

Acknowledgments We thank Wolfgang Deppert (Pette Institute Hamburg) for the initial spark that started this project and the group of Hans-Joachim Lipps (University of WittenHerdecke) for the cooperation over many years. The help of Silke Winkelmann during the generation of FISH-data is gratefully acknowledged. Particular thanks go to our colleagues Armin Baiker (now Max-von-Pettenkofer Institute, University of Munich) and Christoph Piechaczek (now Miltenyi, Bergisch-Gladbach) for their interest and advice, to Francis Stewart for E. coli strain MM294Flp

242

Gene Therapy and Molecular Biology Vol 10, page 243 Grassi G, Maccaroni P, Meyer R, Kaiser H, D'Ambrosio E, Pascale E, Grassi M, Kuhn A, Di Nardo P, Kandolf R and Küpper JH (2003) Inhibitors of DNA methylation and histone deacetylation activate cytomegalovirus promotercontrolled reporter gene expression in human glioblastoma cell line U87. Carcinogenesis 24, 1625-1635.

Jackson DA, Juranek S and Lipps HJ (2006) Designing Nonviral Vectors for Efficient Gene Transfer and Long-Term Gene Expression. Mol Ther in press.

Jenke BH, Fetzer CP, Joensson F, Fackelmayer FO, Conradt HC., Bode J and Lipps HJ (2001). An episomally replicating vector binds to the nuclear matrix protein SAF-A in vivo.

EMBO Reports 3, 349-354.

Jenke AW, Stehle IM., Eisenberger T, Baiker A, Bode J, Fackelmeyer FO. and Lipps HJ (2004). Nuclear scaffold/matrix attached region modules linked to a transcription unit are sufficient for replication and maintenance of a mammalian episome. Proc Natl Acad Sci USA, 101, 11322-11327.

Klehr D and Bode J (1988) Comparative Evaluation of Bovine Papilloma Virus (BPV) Vectors for the Study of Gene Expression in Mammalian Cells. Mol Gen (Life Science Adv) 7, 47 52.

Klehr D, Schlake T, Maass K and Bode J (1992) ScaffoldAttached Regions (SAR elements) Mediate Transcriptional Effects Due to Butyrate. Biochemistry 31, 3222-3229.

Nehlsen K (2004). Molekulare Grundlagen der episomalen Replikation: Charakterisierung zirkulärer, nichtviraler Vektoren.

Dissertation Technische Universität Braunschweig.

Papapetrou EP, Zoumbos NC, Athanassiadou A (2005) Genetic modification of hematopoietic stem cells with nonviral systems: past progress and future prospects, Gene Ther Suppl 1, 118-30.

Papapetrou E, Ziros PG, Mitcheva ID, Zoumbos NC and Athanassiadou A (2006) Gene transfer into human hematopoietic progenitor cells with an episomal vector carrying an S/MAR element. Gene Ther 13, 40–51.

Piechaczek C, Fetzer C, Baiker A, Bode J and Lipps HJ (1999) A Vector Based on the SV40 origin of replication and chromosomal S/MARs replicates episomally in CHO cells.

Nucleic Acid Res 27, 426-428.

Riu E, Grimm D, Huang Z and Kay MA (2005) Increased maintenance and persistence of transgenes by excision of expression cassettes from plasmid sequences in vivo. Hum Gene Ther 16, 558-570.

Schaarschmidt D, Baltin J, Stehle IM, Lipps H J and Knippers R (2004) An episomal mammalian replicon: sequenceindependent binding of the origin recognition complex.

EMBO J 23, 191-201.

Schlake T, Klehr-Wirth D, Yoshida M, Beppu T and Bode J (1994) Gene expression within a chromatin domain: The role of core histone hyperacetylation. Biochemistry 33, 41974206.

Vacik J, Dean BS, Zimmer WE and Dean DA (1999) Cellspecific nuclear import of plasmid DNA. Gene Ther 6, 1006-1014.

Wegner M, Zastrow G, Klavinius A, Schwender S, Müller F, Luksza H, Hoppe J, Wienberg J and Grummt F (1989) Cisacting sequences from mouse rDNA promote plasmid DNA amplification and persistence in mouse cells: implication of HMG-I in their function. Nucleic Acid Res 17, 9909-9932.

Weintraub H, Cheng PF and Conrad K (1986) Expression of transfected DNA depends on DNA topology. Cell 46, 115122.

Wilcox KW and Smith HO (1976) Mechanism of DNA degradation by the ATP-dependent DNase from Hemophilus influenzae. J Biol Chem 251, 6127-6134.

together with the relevant protocols, and to Martin Schleef (PlasmidFactory D-33607 Bielefeld) for performing the capillary electrophoresis mentioned under II-B.

References Baiker A, Maercker C, Piechaczek C, Schmidt SBA, Bode J, Benham C and Lipps HJ (2000) Mitotic stability of a human scaffold/matrix attached region containing episomal vectors is provided by association with nuclear matrix. Nat Cell Biol 2, 182-184.

Bode J, Fetzer CP, Nehlsen K, Scinteie M, Hinrich BH, Baiker A, Piechazcek C Benham C and Lipps HJ (2001) The Hitchhiking Principle: Optimizing episomal vectors for the use in gene therapy and biotechnology. Gene Ther Mol Biol 6, 33-46.

Bode J, Goetze S, Ernst E, Huesemann Y, Baer A, Seibler J. and Mielke C (2003a) Architecture and utilization of highlyexpressed genomic sites, New Comprehensive Biochemistry 38: Gene Transfer and Expression in Mammalian Cells, Chap 20, pp551-572 (G. Bernardi, and S. Makrides, Eds). Elsevier, Amsterdam.

Bode J, Goetze S, Heng H, Krawetz SA and Benham C (2003b) From DNA structure to gene expression: Mediators of nuclear compartmentalization and –dynamics. Chromosome Res 11, 435-445.

Bode J, Kohwi Y, Dickinson L, Joh T, Klehr D, Mielke C and Kohwi-Shigematsu T (1992). Biological significance of unwinding capability of nuclear matrix-associating DNAs. Science 255, 195-197.

Bode J, Winkelmann S, Goetze S, Spiker S, Tsutsui K, Bi C, AK P. and Benham C (2006) Correlations Between Scaffold/Matrix Attachment Region (S/MAR) Binding Activity and DNA Duplex Destabilization Energy. J Mol Biol 358, 597-613.

Broday L, Lee YW. and Costa M (1999) 5-Azacytidine induces transgene silencing by DNA methylation in chinese hamster cells. Mol Cell Biol 19, 3198-3204.

Buchholz F, Angrand PO and Stewart AF (1996) A simple assay to determine the functionality of Cre or FLP recombination targets in genomic manipulation constructs. Nucleic Acids Res 24, 3118-3119.

Chen ZY, He CY, Erhardt A and Kay MA (2003) Minicircle DNA vectors devoid of bacterial DNA result in persistent and high-level transgene expression in vivo. Mol Ther 8, 495-500.

Chen ZY, Yant SR., He CY, Meuse L, Shen S, and Kay MA (2001) Linear DNAs concatemerize in vivo and result in sustained transgene expression in mouse liver. Mol Ther 3, 403-410.

Dang Q, Auten J and Plavec I (2000) Human beta interferon scaffold attachment region inhibits de novo methylation and confers long-term, copy number-dependent expression to a retroviral vector. J Virol 74, 2671-2678 Fuks F, Hurd PJ, Wolf D, Nan X, Bird AP and Kouzarides T (2003) The Methyl-CpG-binding Protein MeCP2 Links DNA Methylation to Histone Methylation. J Biol Chem 278, 4035-4040.

Goetze S, Baer A, Winkelmann S, Nehlsen K, Seibler J., Maass K and Bode J (2005) Genomic bordering elements: their performance at pre-defined genomic loci. Mol Cell Biol 25, 2260-2272.

Gore SD, Samid D and Weng LJ (1997). Impact of the putative differentiating agents sodium phenylbutyrate and sodium phenylacetate on proliferation, differentiation, and apoptosis of primary neoplastic myeloid cells. Clin Cancer Res 3, 1755-1762.

243

Nehlsen et al: Replicating minicircles

244

Gene Therapy and Molecular Biology Vol 10, page 245 Gene Ther Mol Biol Vol 10, 245-250, 2006

Cloning, Expression and Purification of a novel antiangiogenic factor-Tumstatin Research Article

Chongbi Li1,*, Liming Yang2, Hongli Jia3 1

The Center of Biopharmaceutical Research and Development of Zhaoqing University, 526061, China (PR) Institute of Microbiology, Chinese Academy of Sciences, Beijing 100080, China (PR) 3 The Institute of Microbiology and Epidemiology, Academy of Military Medical Sciences, Beijing 100071, China (PR) 2

__________________________________________________________________________________ *Correspondence: Chongbi Li, Biochemistry and Molecular Biology, The Center of Biopharmaceutical Research and Development of Zhaoqing University, 526061, China (PR); Tel: (86-0758)2752578; E-mail: lchongbi@Yahoo.com Key words: tumstatin, cloning and expression; IMAC Abbreviations: immobilized metal-chelating affinity chromatography, (IMAC); Luria-Bertani, (LB); noncollagenous 1, (NC1); Reverse transcription, (RT); vascular endothelial growth factor, (VEGF)

This study has laid a foundation for manufacturing anti-tumor based on Tumstatin.

Received: 29 May 2006; Revised: 12 June and 13 July 2006 Accepted: 17 August 2006; electronically published: September 2006

Summary Tumor progression may be controlled by various fragments derived from noncollagenous 1 (NC1) C-terminal domains of type IV collagen. Tumstatin peptide is an angiogenesis inhibitor derived from type IV collagen and inhibits in vivo neovascularization induced by vascular endothelial growth factor (VEGF), Here, we firstly showed the expression, cloning and purification of tumstatin from Chinese abortus kidney tissue by RT-PCR, and the construction of pET-His expressive plasmid in prokaryotic cells. Also its’ activity was examined by mouse antiserum against native Tumstatin. The results indicated E.coli BL21(DE3)plysS/ pET-His-tumstatin was induced 3 h by 0.2 mmol/L IPTG at 30°C, and got a high-level expression of 37.9%. The Tumstatin protein was one-step purified by immobilized metal-chelating affinity chromatography (IMAC) and its purity was above 95%. Western blot identified it’s right. indicated that they had diverse antiangiogenic actions (Sudhakaret al 2003).

Up to now, few of the structure, characteristics and its’ protein knowledge of tumstatin has been known, and in particular, the report on the gene of tumstatin from Chinese human tissues has not been found yet.!

Additionally, Purification of bioactive recombinant protein from E. coli has been recognized challenging. Our ! strategy would center on the optimization of the E. coli expression system because of its higher efficiency! "#! expressing foreign proteins as compared with the other systems. The study showed the cloning, expression, purification and its’ activity of tumstatin from Chinese kidney tissues. It would lay a theoretical foundation for the clinical application on tumstatin.

I. Introduction Tumstatin is a ramification of basement membrane proteins in human body (28Kda, an endogenously produced a third ! chain of basement membrane collagen, type IV). It inhibited specific for the protein synthesis of endothelial cells (Maeshima et al, 2002). In the experiment on rats, it showed that Tumstatin could inhibit tumor growth (Maeshima et al, 2000), and anti-tumor activity of Tumstatin was also verified (Maeshima et al, 2002). A physician, J. Folkman in Harvard medical collage in USA firstly mentioned the theory inhibiting tumors through angiogenesis. He thought that if the blood vessels of tumors were inhibited, tumors could not get hyperplasia, metastasis instead of shrinking. Tumstatin prevents angiogenesis through inhibition of endothelial cell proliferation and promotion of apoptosis with no effect on migration, whereas endostatin prevents endothelial cell migration with no effect on proliferation. Therefore, it probably fit for curing many types of cancers. Because of the distinct properties of tumstatin and endostatin, it

II. Materials and methods A. Material, bacterial strains and reagents The kidney tissue of abortus fetus were collected from associated hospital in medical college Inner Mongolia. PET-His

245

Li et al: Cloning, expression and Purification of Tumstatin expressive vector, E.coli host strain, DH5!, and BL21(DE3)plysS stored in our laboratory, RNA purified kit (Shanghai Huashun Co), pGEM-Tvector kit, T4 DNA ligase and plasmid purified kit (Promega), restriction enzyme, BamH I, Nhe I (NEB), Taq plus DNA polymerase, dNTPs, X-gal, IPTG and agarose( biotechnology Co, Shanghai), DL2000 DNA molecular weight marker and multi clone antibody(invitrogen), HRPlabaled IgG of sheep against mouse(Huamei Co in Beijing).

PstI and cloned into expressive vector, pET-His digested with the same two enzymes mentioned above and ligated to generate plasmids pET-His-tumstatin. The plasmids were subsequently transferred to E coli cells. The recombinants were selected and identified named pET-His-tumstatin. The pET-His-tumstatin were also transferred to E.coli BL21 (DE3) plysS competent cells. and the positive bacteria were identified by PCR. The bacteria selected were incubated in LB medium induced with IPTG in different concentrations of 0.2, 0.4, 0.6, 0.8 mmol/L at the same time. And the bacteria were sampled 0.2ml once each before and after inducing. The samples were precipitated and cellular proteins were analyzed by sodium dodecyl sulfatepolyacrylamide gel electrophoresis. The quantity of expression was analyzed by Gel imaging instrument made in Japan.

B. Combined buffer 20 mmol/L NaH2PO 4, 500mmol/L NaCI, pH 7.4, Washing buffer NaH2PO420 mmol/L, NaCI 500 mmol/L, imidazole 500 mmol/L, pH 7.4.

C. Sequencing and cloning of Tumstatin

E. Tumstatin purification

1. Synthesis and designing of the primers

To determine Tumstatin activities, the engineering E.coli added in 1000 ml of LB culture with a 1/100 volume. And E.coli was grown at 37°C to an optical density of 0.5 at 570 nm. The culture was added with a final concentration of 0.2 mmol/L IPTG at 37°C for 3h. The cell culture were pelleted by centrifugation at 5000 $ g for 10 min, and the cells were resuspended in 100ml of 30mM PBS buffer, and centrifugation at 5000 $ g for 10 min, and resuspended as above mentioned. Cell lysis was carried out by ultrosonic way. And the cell fragments were removed by centrifugation at 13,000 $ g for 30 min. The supernatant is run through a volume of 5 ml HiTrap chelating Ni-NTA column (Amersham Pharmacia). ÄKTA FPLC purifying system for protein would be connected with the column. The column is then washed with the washing buffer, followed by elution of the bound protein from the column using the elution buffer. Finally, the column is re-equilibrated with washing buffer. washing or eluting, the compounds down the column by varying the eluting solvent using a flow rate of 1ml/min. And all the fractions were pooled with an absorbance > ~0.03. And the tumstatin solution was concentrated using Ultrafree-15 concentrators of 10kDa. The Ultrafree-15 concentrators are used to concentrate protein samples based on a technique known as ultrafiltration. These disposable devices hold up to 15 ml of sample at a time and can be centrifuged at 2,000 $ g for 15 min, and the step was repeated for 3 times (refer to the Ultrafree-15 manual for more information). The samples were pooled and resolved with sterilized PBS of 10ml. The samples were analyzed by the gel of 15 % SDS-PAGE and also quantified with the method of Bradford.

A pair of primers was designed according to the sequence from GenBank (No. AF258351), tum1: 5"CGGGATCCCCAGGTTTGAAAGG-3"and tum2: 5"GGCTAGCGTGTCTTTTCTTCATGCACA-3", underlined nucleotides indicated the recognized sites of restriction enzyme as BamHI, NheI. Amplified the fragment of gene was about 750 nt long.

2. Preparation of template Total RNA of kidney from Chinese abortus fetus was isolated with RNA extract kit. Reverse transcription (RT) would carried out when the content and purity were qualified. It did according to the instruction of the RT kit. PCR would be done with the cDNA synthesized as a template.

3 Cloning and sequencing of Tumstatin SuperScriptTM First-Strand Synthesis System for RT-PCR (Invitrogen) E.coli Top10 was grown on Luria-Bertani (LB) medium and incubated at 37" under aeration. Amplification reactions were performed in a total volume of 50 ml containing 100 #M (each) dATP, dCTP, dGTP, and dTTP, 25 pmol of each primer, 2 ng of pLSC400 DNA, 2.5 U of Pwo DNA polymerase (Boehringer, Mannheim, Germany), and the corresponding 1$ Pwo buffer. Reactions were carried out with a Perkin-Elmer thermocycler by using initial denaturation at 94°C for 5 min, followed by 5 cycles consisting of 94°C for 30s, 46°C for 30s, and 72°C for 80s and followed by 25 cycles consisting of 94°C for 30s, 55°C for 30s, and 72°C for 80s a final extension step consisting of 72°C for 10 min. The amplified products were identified by electrophorsis of 1% agarose. Each DNA was further purified by treatment with phenol-chloroform as described by Sambrook et al, 1989. Plasmid DNA was isolated from the recombinant E.coli by a method described previously (Sambrook et al, 1989). DNA sequences were determined by the dideoxy chain termination method with sequencing kits (Biotechnology Co, Shanghai). The purpose product by PCR was ligated with GEM-T vector, then transformed to E.coli DH5! competent cells by the method of CaCl2. And recombinant were selected through blue and white spots, and identified by situ-PCR and endoenzyme digesting. The positive recombinant plasmid would be sequenced by Biotechnology Co, Shanghai.

F. Identification of Tumstatin 1. Western blot of tumstatin After running SDS-PAGE (Sambrook et al, 1989), the extracts were transferred to nitrocellulose membrane (Sigma).

Blots were stained firstly with Ponceau dye for 2 min and then developed with first antibody (antiserum against V5 from mice), followed by staining with secondary antibody (horseradish peroxidase labeled anti-mouse IgG).

2. Detection using indirect ELISA For visualization, nitro blue tetrazolium/5-bromo-4-chloro3-indolyl phosphate was used. Tumstatin (450 µg/ml) were diluted at 1:100, 1:200, 1:400 and 1:800 respectively, and added 100 µl each hole on plate of 96 holes at 4" overnight. Next day, the plate was blocked with 3% bovine serum albumin in Tris buffered saline with 0.1% Tween 20 for 1 h and incubated with 100 µl first antibody (polyclone against-mouse antiserum)at 1:500 dilutions for 30min at 37". After washing with PBST, it also was incubated with 100 µl of HRP labeled anti-mouse IgG at 1:1000 dilutions and washed as above mentioned. A drop of

D. Construction and inducing expression of pET-His-tumstatin plasmid The extracted plasmid containing tumstatin gene, pGEMT/tum was digested with BamHI and NheI. Tumstatin DNA was recollected and cloned into expressive vector, pET-His digested with the same two enzymes, that contained an NcoI site and a PstI recognition sequence within the forward and reverse primers, respectively. The amplified product was digested with NcoI and

246

Gene Therapy and Molecular Biology Vol 10, page 247 developing fluid A and B were added respectively for 5min followed by adding a drop of terminal reactive fluid. OD values were determined at 450nm.The positive was determined according to the ratio of experimental holes to negative holes if the ratios were larger than 2.1.

was 3h at 30". The quantity of expression recombinant protein in gross protein was about 35.66. It also presented either inclusion bodies or soluble proteins (Figure 3).

3. Antitumor effect of Tumstatin Twenty 7-week-old male Kun Ming mice without thymus gland per group were used as test animals. And kidney tumor induction was performed as follows. 786-0 nephrosarcoma cells were subcutaneously transplanted to the back region, and attacking numbers of nephrosarcoma cell were 2#106. After a week of injections, when the tumor growth volume was up to 600-700mm3, the ten mice were injected tumstatin of 6 mg/kg subcutaneously in the back region a time, and once a day for ten time injections. however, the another ten mice were only

injected with 0.9% normal saline (vehicle) at the same time. Tumor growth volume (width #length #0.52) needed to be determined with vernier caliper on a daily basis.

III. Results A. Cloning and sequencing of tumstatin

Figure 1. Electrophoresis of PCR. 1.DL2000 DNA Marker, 2.

PCR product of tumstatin, 3. negative control.

PCR product of tumstatin would run electrophoresis using 1% agarose, the result showed the 700bp fragment presenting, and it was the same as anticipation. It found the nucleotides of the 96th was mutated T$C but nonsense mutation (Figure 1).

B. Construction of expression vector The fragment of pGEM-T/tum-digested with BamHI and NheI was cloned into pET-His plasmid, and ligation product were transformed DH5! competent cells. Thus 5 monoclonal colony were selected and identified by PCR. DNA of positive plasmid was extracted and digested with BamHI and NheI. An objective fragment of 741 bp was finally identified (Figure 2).

C. Expression and recombinant tumstatin

induction

Figure 2. Vector pET-His-tumstatin digested with BamHI and NheI 1. DL2000 DNA Marker, 2. pET-His-tumstatin/ BamHI and NheI, 3. pET-His-tumstatin, 4. pET-His.

of

To investigate the regulation of tumstatin expression

by IPTG and time, recombinant E.coli was each grown in three batches by shaking conditions for approximately 3h.

Through several conditions obtimization, concentrations of IPTG added was 0.2 mmol/L IPTG and inducing time Figure 3.

SDS-PAGE of plysS/pET-His-tumstatin in BL21(DE3). 1. Molecular marker, 2. Sample before induction, 3 Sample after adding 0.2 mmol/L IPTG, 4. Sediment sample from ultrosolic way destruction after induction 3h, 5 Supernatant sample from ultrosolic way destruction after induction 3h.

247

Li et al: Cloning, expression and Purification of Tumstatin inhibition appeared to be similar (610±98.6 mm3 in the experimental group instead 1100±155.2mm3 in the control one). There was a significant difference between them (t test, p<0.05). These results suggest that an expression and purification system for tumstatin protein from E. coli has been successfully established in a laboratory setting.

D. Purification of Tumstatin Purification of human tumstatin was achieved using the IMAC column with 6#His tag, and the column was washed with 200 mmol/L imidazole gradient elution buffer.15ml eluted fluid were obtained and concentrated.

Furthermore, the absorbance of concentrated fluid at 280 nm and the method of Bradford (Kirazov et al, 1993; Liu, 2001) provided identical values for the protein concentrations (850 #g/ml). 25mg of purified tumstatin were obtained in all, and sheet scanning of the resulting purified tumstatins indicated that the proteins were more than 95% pure (Figure 4).

E. Identification of Tumstatin protein Western blot indicated visible band the position 29 kDa around (Figure 4), and also indicated the purified tumstatin protein had been recognized by specific polyclonal antibody. Furthermore, the results of indirect ELISA showed that tumstatin also could be detected when it was a 1:1000 dilution (0.085 mg). It consequently was identified the activity of tumstatin through its’ immunoreaction.

F. In Vivo antitumor effect of Tumstatin Figure 4. Purification and western blot of soluble Tumstatin 1. low MW marker, 2. purified Tumstatin, 3. Western blot of Tumstatin

To assess the antitumor activity of the obtained tumstatin, the Kun Ming mice without thymus gland were inoculated 786-0 nehrosarcoma cells as carcinoma model in this study. After comparing the tumor growth volume between the experimental group and the control one, it was found that a substantial inhibitory effect was observed in mice treated with tumstatin(Fig 5), and the degree of

Figure 5. In vivo antitumor effect of tumstatin.

248

Gene Therapy and Molecular Biology Vol 10, page 249 alternative method that will prove valuable in helping to determine the clinical activity of tumstatin. Thus, we anticipate that this recombinant tumstatin will have potency over an antitumor curing field .

The yield and purity of this antitumor protein produced from the reported procedure allow its virtual application at different laboratory levels. The established protocol also has the potential to be adapted to a larger scale production.

IV. Discussion In the present study, a single copy of Chinese human tumstatin-encoding gene was transformed into the vector of laboratory strain of E coli BL21 and constitutively expressed under the induction of IPTG. And biologically active human tumstatin can be achieved in the E.coli expression system, whereas a high yield (8050 Âľg/ml culture) and a high purity (>95%). And also a protocol for purification of human tumstatin protein from E. coli as a inclusion body form was shown. Furthermore the in vivo antitumor effect of the purified protein are comparable to those of the control, there is a significant difference. The results showed that the IPTG-inducible T7 lac promoter used in our system has previously been shown to be highly efficient in expressing heterologous proteins, including tumstatin. Additionally, with the conventional purification protocol described previously, the cultured bacteria are lysed under denaturing condition (8 M urea), and the dissolved tumstatin is then subject to bound to a Ni-NTA column chromatography for His tag-specific purification.

And after the recombinanat protein was extracted through the column and also passed through a step of ultrafiltration with Ultrafree-15 ultrafiltration tube (Millipore). Through these steps, a purified recombinant tumstatin could be achieved. However, the purified protein precipitates during the dialysis that eliminates urea from the solvent system.

In this study, a purification approach was taken the advantages of inclusion body formation in the tumstatinexpressing E. coli cells. Usually, inclusion bodies are insoluble or biologically inactive molecules, however, in our approach, highly purified tumstatin could be dissolved and used the experiment. Although soluble endostatin prepared from a yeast system is being used in ongoing phase I clinical trials, the low yield (approximately 20 mg/liter culture) and high cost of the system have made it difficult to produce in quantities that are realistic for comprehensive clinical evaluation and application.

This study outlines a strategy for the cloning, expression and isolation of a soluble form of tumstatin.

Additionally, it showed that the purified recombinant protein has an antitumor effect in vivo at a low dose level (6 mg/kg /d). However, past report show that the 20mg/kg/d dose of purified endostatin given gives a significant tumor growth inhibition. Through comparasion, the purified recombinant tumstatin is better than endostatin. Our results presented in this report offer an

References Darland DC, D'Amore PA (1999) Blood vessel maturation: vascular development comes of age. J Clin Invest 103, 157158.

Kirazov LP, Venkov LG, Kirazov EP (1993) Comparison of the Lowry and the Bradford protein assays as applied for protein estimation of membrane-containing fractions. Anal Biochem 208, 44-48.

Liu C (2001) Introduction of tissue soluble protein. In: Handbook of Protein Technology (ed. by W. Wang & W.F. Fan) Science Press of China, Beijing, pp. 172-183.

Maeshima Y, Colorado PC, Torre A, Holthaus KA, Grunkemeyer JA, Ericksen MB, Hopfer H, Xiao Y, Stillman IE, Kalluri R (2000) Distinct antitumor properties of a type IV collagen domain derived from basement membrane. J Biol Chem 275, 21340-21348.

Maeshima Y, Manfredi M, Reimer C, Holthaus KA, Hopfer H, Chandamuri BR, Kharbanda S, Kalluri R (2001) Identification of the anti-angiogenic site within vascular basement membrane-derived tumstatin. J Biol Chem 276, 15240-15248.

Maeshima Y, Sudhakar A, Lively JC, Ueki K, Kharbanda S, Kahn CR, Sonenberg N, Hynes RO, Kalluri R (2002) Tumstatin, an endothelial cell-specific inhibitor of protein synthesis. Science 295, 140-3.

O'Reilly MS, Boehm T, Shing Y, Fukai N, Vasios G, Lane WS, Flynn E, Birkhead JR, Olsen BR, Folkman J (1997) Endostatin: an endogenous inhibitor of angiogenesis and tumor growth. Cell 88, 277-285.

Sambrook J, Fritsch E and Maniatis T (1989) Molecular cloning: A laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Sudhakar A, Sugimoto H, Yang C, Lively J, Zeisberg M, Kalluri R (2003) Human tumstatin and human endostatin exhibit distinct antiangiogenic activities mediated by alpha-V-beta-3 and alpha-5-beta-1 integrins. Proc Nat Acad Sci 100, 47664771.

249

Li et al: Cloning, expression and Purification of Tumstatin

250

Gene Therapy and Molecular Biology Vol 10, page 251 Gene Ther Mol Biol Vol 10, 251-254, 2006

Plasmodium and host carbonic anhydrase: molecular function and biological process Research Article

Viroj Wiwanitkit Department of Laboratory Medicine, Faculty of Medicine, Chulalongkorn University, Bangkok Thailand 10330

__________________________________________________________________________________ *Correspondence: Viroj Wiwanitkit, M.D., Department of Laboratory Medicine, Faculty of Medicine, Chulalongkorn University, Bangkok, Thailand 10330; Tel: 662 256 4136; Fax: 662 218 3640; e-mail: Viroj.W@Chula.ac.th Key words: human, Plasmodium falciparum, carbonic anhydrase, function Abbreviations: Carbonic anhydrase, (CA); Mouse Genome Informatics, (MGI); Saccharomyces Genome Database, (SGD); Received: 8 August 2006; Revised: 25 September 2006 Accepted: 29 September 2006; electronically published: November 2006

Summary Carbonic anhydrase (CA) is an enzyme that catalyzes an interconversion of CO2 and HCO3-. CA is present at high levels in humans and Plasmodium spp. However, the function of CA in malarial infection is not well characterized.

Here, the author used a new gene ontology technology to predict molecular function and biological process of CA. Using GoFigure server, the molecular function and biological process of human and P. falciparum CA are predicted. Comparing to human CA, the P. falciparum CA has similar molecular functions as carbonate dehydratase activity and zinc ion binding. Although the basic sequences for human and P. falciparum CA are totally different, the molecular functions are similar. This finding implies that any treatment aiming at blocking the functions of P. falciparum CA can affect human CA. Thus any drug targeting at P. falciparum CA might not be a magic bullet. The more specific structural antagonist that can directly block amino acid of P. falciparum CA is more favorable.

Aikawa, 1998). Here, the author used a new gene ontology technology to predict the molecular function and biological process of this enzyme.

I. Introduction Carbonic anhydrase (CA) is an enzyme that catalyzes an interconversion of CO2 and HCO3-. CA is present at high levels in humans and Plasmodium spp (Reungprapavut et al, 2004). Existence of at least three isozymes was demonstrated in P. falciparum and a rodent malarial parasite P. berghei (Reungprapavut et al, 2004).

Krungkrai et al found that the parasite enzyme activity was sensitive to well-known sulfonamide-based inhibitors of both bacterial and mammalian enzymes. They noted that the enzyme inhibitors had antimalarial effect against in vitro growth of P. falciparum (Krungkrai et al, 2002).

Reungprapavut et al noted that P. falciparum carbonic anhydrase was a possible target for chemotherapy (Reungprapavut et al, 2004).

In malarial infection, CO2 is essential for the growth of intraerythrocytic malarial parasite to synthesize pyrimidine through CO2 fixation and regulate intracellular pH and CO2 transport across the plasma membrane of erythrocytes, which are facilitated by CA (Sein and Aikawa, 1998). However, the function of the CA in malarial infection is not well characterized. Krungkrai et al noted that a full understanding host and parasite CA promised advances in malarial treatment (Sein and

!!. Materials and methods A. Getting the sequence The database Unitprot (Bairoch et al, 2005) was used for data mining of the amino acid sequence for human host and P. falciparum CA.

B. Prediction of molecular function and biological process The author performed prediction of molecular function and biological process of human and P. falciparum CA using a novel gene ontology prediction tool, GoFigure (Bairoch et al, 2005).

GoFigure is a computational algorithm tool which was recently developed in gene ontology (Bairoch et al, 2005). The tool accepts an input DNA or protein sequence, and uses BLAST to identify homologous sequences in gene ontology annotated databases (Bairoch et al, 2005). The approach uses a BLAST search to identify homologs in public databases that have been annotated with gene ontology terms (Bairoch et al, 2005). These include: SwissProt, Flybase (Drosophila), the Saccharomyces Genome Database (SGD), Mouse Genome Informatics (MGI) and Wormbase (nematode) (Bairoch et al, 2005). The contents of

251

Wiwanitkit: Plasmodium and host carbonic anhydrase results will show molecular function as well as biological process of the studied protein (Bairoch et al, 2005). The prediction of molecular function and biological process were presented and compared.

enzyme an attractive target for therapeutic evaluation (Krungkrai et al, 2001). In addition, there are some current researches on the possible use of CA inhibitors to kill cancer kills. The possible mechanisms are inhibition of CA isozymes which predominate in tumor cell membranes, perhaps causing acidification of the intercellular milieu, or inhibition of intracellular isozymes which provide bicarbonate for the synthesis of nucleotides and other essential cell components (Supuran et al, 2001).

Roles of both host and parasite CA in cellular level metabolism during a malarial infection have been proposed (Sein and Aikawa, 1998; Sein and Aikawa, 1998). Until present, the function of P. falciparum CA, correlating to human CA, is not well explored and there is a need for better understanding function of these proteins.

In this work, the author explores and compares the potential functions of malarial and human carbonic anhydrase by gene ontology.

Based on recent advance in the genomics technology, current microarray technology permits examination of gene expression patterns of ten thousands of genes (Bairoch et al, 2005). A challenge facing the biologist interpreting such data is recognizing the function of many of the hits identified in a single experiment (Khan et al, 2003). While one can check the literature, a rapid means to get some idea of potential function of a gene product is to obtain the ontology terms that describe the gene (Khan et al, 2003). The gene ontology is developed for this specific purpose. Many gene ontology tools have been constructed and launched. Here, the author used a gene ontology tool to perform a comparative study on the predicted function of human and P. falciparum CA. This bioinformatics approach may be of interest to predict gene functions as an enormous inflow of information is derived from current genome projects on malarial organisms.

III. Results A. Sequence From searching of the database Uniprot, sequence of human and P. falciparum CA was derived as shown in Figure 1.

B. Prediction of molecular function and biological process Using GoFigure server, the molecular function and biological process in human and P. falciparum CA is predicted. The molecular function and biological process of human and P. falciparum CA are presented in Figure 2 and Figure 3, respectively. The molecular function of human CA is “Carbonase dehydratase activity”, “Zinc ion binding” and “Lyase activity” and the molecular function of P. falciparum CA is “Carbonase dehydratase activity”, and “Zinc ion binding”. The biological processes of human and P. falciparum CA are “One carbon compound metabolism” and “One carbon compound metabolism”, respectively.

IV. Discussion CA is an enzyme that is believed to have a significant role in malarial infection. The malarial parasite P. falciparum encodes for an alpha-carbonic CA possessing catalytic properties distinct of that of the human host, which was only recently purified (Krungkrai et al, 2002).

CA inhibitors are possible effective antimalarial drug (Krungkrai et al, 2005). Recently, Krungkrai et al said that the vital contribution of CA to parasite survival made the

Figure 1. Sequence of human and P. falciparum CA.

252

Gene Therapy and Molecular Biology Vol 10, page 253

Figure 2. Expected molecular function of human CA.

Figure 3. Expected biological process of Plasmodium falciparum CA.

253

Wiwanitkit: Plasmodium and host carbonic anhydrase Compared to human CA, the P. falciparum CA has similar molecular functions as carbonase dehydratase activity and zinc ion binding. However, human CA has additional significant activity as lyase activity. It is a well known fact that crucial enzymes such as lactate dehydrogenase (LDH) are highly conserved among the species and throughout evolution and thus it is not surprising that this applies also to CA. Although the basic sequences for human and P. falciparum CA are totally different, the molecular functions are similar. This implies that any treatment aiming at blocking the functions of P. falciparum CA can affect human CA. Thus any drug targeting at P. falciparum CA might not be a magic bullet.

More specific structural antagonist that can directly block amino acid of P. falciparum CA is more favorable.

However, some concerns on this conclusion should be addressed. While the enzymes may have similar or identical functions among the species, there can be substrates that are preferred by the mammalian or the protozoan enzyme. For example, the quantification of growth inhibition of anti-malarial drugs is often done measuring LDH activity in the parasitized red blood cells.

There is ample quantity of LDH in human red blood cell, but the substrates used by the parasitic LDH are highly selective for the parasitic enzyme. Thus, one can envision that screening for an anti-malarial drug would compare the various candidate drugs in regards to their ability to inhibit at lower concentrations the protozoan CA than compared to the mammalian CA. Overall, in order to give significance to the conclusion, it has to evaluate whether the enzymes have same substrate specificity and whether all anti-malarial drugs have the same dose range of toxicity when tested on parasite cultures and on mammalian cell cultures.

Indeed, three of fourteen CA isozymes detected in mammalians have been identified in P. falciparum (Reungprapavut et al, 2004). This can confirm that human CA and P. falciparum CA share common substrates. This can be the reason for the fact that there are issues with currently marketed sulfonamide drugs on undesirable side effects (Lee et al, 2004; Sheth, 2004). Based on the basic principles of chemical reaction in organic chemistry, the dose ranges of the same antimalarial drugs for the same enzymatic blocking reaction of enzymes using the same substrate depend directly on those enzymes. Basically, the molecular weight of human CA is significantly higher than P. falciparum CA. This implies that the amount of CA inhibitors for human CA is more than that of P. falciparum CA. Therefore, it can imply that CA inhibitors inhibit at lower concentrations the protozoan CA than compared to the mammalian CA. However, the ideal CA inhibitors should be selective for the reactions without identical substrate between host and parasite. An ultimate proof of the biological functions would still require biochemical experiments. Further experimental studies are needed before making a conclusion on this topic. Nevertheless,

the findings in this study not only support the previous knowledge on malarial CA but also give the new view on the function of malarial CA.

References Bairoch A, Apweiler R, Wu CH, Barker WC, Boeckmann B, Ferro S, Gasteiger E, Huang H, Lopez R, Magrane M, Martin MJ, Natale DA, O'Donovan C, Redaschi N, Yeh LS (2005) The Universal Protein Resource (UniProt). Nucleic Acids Res 33, D154-9.

Khan S, Situ G, Decker K, Schmidt CJ (2003) GoFigure: automated Gene Ontology annotation. Bioinformatics 19, 2484-5.

Krungkrai J, Scozzafava A, Reungprapavut S, Krungkrai SR, Rattanajak R, Kamchonwongpaisan S, Supuran CT (2005) Carbonic anhydrase inhibitors. Inhibition of Plasmodium falciparum carbonic anhydrase with aromatic sulfonamides: towards antimalarials with a novel mechanism of action?

Bioorg Med Chem 13, 483-9.

Krungkrai S, Rochanakij S, Prapunwattqana P, Krungkrai J (2002) Carbonic anhydrase in Plasmodium falciparum and Plasmodium berghei. Presented at In: InCob, ed. The International Conference on Bioinformatics: North-South Networking. Bangkok: InCob, 2002; 158 Krungkrai SR, Suraveratum N, Rochanakij S, Krungkrai J (2001) Characterisation of carbonic anhydrase in Plasmodium falciparum. Int J Parasitol 31, 661-8.

Lee AG, Anderson R, Kardon RH, Wall M (2004) Presumed â&#x20AC;&#x153;sulfa allergyâ&#x20AC;? in patients with intracranial hypertension treated with acetazolamide or furosemide: cross-reactivity, myth or reality? Am J Ophthalmol 138, 114-118.

Reungprapavut S, Krungkrai SR, Krungkrai J (2004) Plasmodium falciparum carbonic anhydrase is a possible target for malaria chemotherapy. J Enzyme Inhib Med Chem 19, 249-56.

Sein KK, Aikawa M (1998) The pivotal role of carbonic anhydrase in malaria infection. Med Hypotheses 50, 19-23.

Sheth RD (2004) Metabolic concerns associated with antiepileptic medications. Neurology 63,S24-S29.

Supuran CT, Briganti F, Tilli S, Chegwidden WR, Scozzafava A (2001) Carbonic anhydrase inhibitors: sulfonamides as

antitumor agents? Bioorg Med Chem 9, 703-14.

Viroj Wiwanitkit

254

Gene Therapy and Molecular Biology Vol 10, page 255 Gene Ther Mol Biol Vol 10, 255-262, 2006

Isolation of genes controlling apoptosis through their effects on cell survival Research Article

Gwyn T. Williams1,*, Jane P. Hughes1,3, Victoria Stoneman1,4, Claire L. Anderson1, Nicola J. McCarthy1 Mirna Mourtada-Maarabouni1, Mark Pickard1, Vanessa L. Hedge1, Ian Trayner2, Farzin Farzaneh2 1

Institute for Science and Technology in Medicine, Huxley Building, Keele University, Keele, ST5 5BG, UK King's College London, Department of Haematological and Molecular Medicine, The Rayne Institute, 123 Coldharbour Lane, London SE5 9NU, UK 3 Present address; Neurology and GI Centre of Excellence for Drug Discovery, GlaxoSmithKline Research and Development Limited, New Frontiers Science Park, Third Avenue, Harlow CM19 5AW, Essex, UK 4 Present address; Department of Medicine, University of Cambridge, ACCI Level 6 Box 110, Addenbrookes Hospital, Hills Road, Cambridge, UK 2

__________________________________________________________________________________ *Correspondence: Prof. Gwyn T. Williams, Institute for Science and Technology in Medicine, Huxley Building, Keele University, Keele, ST5 5BG, UK; Phone 44-1782-583032; Fax 44-1782-583516; E-mail g.t.williams@keele.ac.uk Key words: apoptosis, forward genetics, functional cloning, retroviral insertional mutagenesis, oncogenes, tumour suppressor genes Abbreviations: Complementary DNA, (cDNA); Factor-dependent continuous cell line from the Paterson Institute, (FDCP-1); Interleukin-3, (IL-3); Phytohaemagglutinin, (PHA); Polymerase chain reaction, (PCR); Receptor for activated protein kinase C 1, (RACK1); Retroviral insertional mutagenesis, (RIM); Vacuolar ATPase, (vATPase); Walter and Elisa Hall Institute-105.726, (WEHI105.726) Received: 25 October 2006; Revised: 30 November 2006 Accepted: 12 December 2006; electronically published: December 2006

Summary The identification of the most suitable molecular targets for gene and drug therapy is the crucial first step in the development of new disease treatments. The rational identification of such targets depends on a detailed understanding of the pathological changes occuring at the molecular level. We have applied forward genetics approaches to the identification of the critical genes involved in the control of apoptosis in mammalian cells, since defective control of apoptosis underlies many diseases, including cancer and neurodegenerative diseases. We have identified two groups of genes by their effects on cell survival using retroviral cDNA functional expression cloning and retroviral insertional mutagenesis. The identification of these novel genes opens up new areas for apoptosis research and subsequently for the development of new gene and drug therapies.

Thompson, 1995; Hale et al, 1996;). Much cancer therapy, to quote an important example, relies on inducing apoptosis in tumour cells (Kerr et al, 1994). Since our knowledge of the molecular control of apoptosis is still incomplete, the identification of the genes involved in cell death and survival is of major importance in defining targets for rational design of gene and drug therapies.

The control of apoptosis is complex (e.g. Hengartner, 2000) and involves many genes. Some of these genes are now relatively well characterised, e.g. the bcl-2 family (Cory and Adams, 2002) and the caspase family (Thornberry and Lazebnik, 1998), but it is likely that many others have yet to be identified. Many strategies, such as isolation of proteins through their affinity for known components of the apoptosis machinery, are currently

I. Introduction Apoptosis is now recognised as central to mammalian cell biology in general- no picture of any human or other mammalian system can be accepted as complete without some consideration of the potential role played by apoptosis. Apoptosis is consequently of profound significance in physiology, pathology and therapeutic medicine.

The analysis of the molecular mechanisms involved in apoptosis is therefore of great importance in developing gene and drug therapies for the many diseases where the control of apoptosis is perturbed. Apoptosis dysfunction occurs, for instance, in neurodegenerative diseases (too much apoptosis) and in autoimmune and neoplastic diseases (too little apoptosis) (Williams and Smith, 1993; 255

Williams et al: Isolation of genes controlling apoptosis being used to identify the missing molecules. We have chosen to identify genes controlling apoptosis and cell survival through the biological effects of the genes themselves on mammalian cells. This approach, sometimes known as forward genetics (Stark and Gudkov, 1999), is independent of previous knowledge and both can and does result in the identification of entirely novel and unpredicted components. This strategy also focuses automatically on those components which can actually affect the cell death/survival decision within the cell, as distinct from those associated with cell death but not having any controlling role. It is this first group which are likely to be of the greatest biological and clinical importance and which provide the best targets for gene and drug therapies.

Earlier work from Kimchi and co-workers using this sort of strategy resulted in the isolation of several important genes (Deiss et al, 1995; Cohen et al, 1997) including DAP-kinase, which can play an important role in metastasis (Inbal et al, 1997). Other groups have also used this approach, resulting in the isolation of several interesting and important genes (e.g. Hitoshi et al, 1998).

We have used two related approaches within this general strategy; firstly, we have transfected cDNA libraries in expression vectors into clonal mammalian cells which are uniformly susceptible to apoptosis stimuli (Figure 1). The isolation and analysis of the cDNA clones expressed by cells which survive the stimulation of apoptosis identifies candidate apoptosis-controlling genes. The activity of these genes can later be confirmed by isolation of the sequence, re-cloning into an expression vector and expressing in fresh host cells which are then challenged with apoptosis stimuli. Secondly, we have infected clonal

apoptosis-sensitive cell lines with retroviruses and again induced apoptosis under conditions where fewer than 1 in 104 host cells normally survive (Figure 2). In this case, the amplification of the host DNA flanking the inserted retrovirus using inverse PCR allows the identification of the gene affected by the insertion to produce the apoptosisresistant phenotype. Our use of these two strategies resulted in the identification of several known apoptosiscontrolling genes. The additional isolation of a larger number of genes not previously known to be involved in this process indicates that many more components of the cellular apoptosis-controlling machinery still remain to be identified.

II. Materials and methods A. Cell culture The W7.2 mouse thymoma cell line, originally derived from line WEHI-105.726 (Danielsen et al, 1983), and the FDCP1 haemopoietic cell line (Dexter et al, 1980), used as hosts were grown in RPMI 1640 with 10% fetal calf serum (Hyclone, UT, USA) at 370C in a 5% CO2 humidified incubator. FDCP-1 medium was supplemented with mouse IL-3 (Dexter et al, 1980; McCarthy, 1993). Both cell lines were cloned in soft agar (McCarthy, 1993; Mourtada-Maarabouni et al, 2003) and apoptosis-sensitive clones containing less than 1 in 104 apoptosisresistant cells were identified and grown to produce large stocks which were stored in liquid nitrogen. These target cells were used after thawing and a minimal number of subcultures in order to minimise the appearance of spontaneously apoptosis-resistant cells. The clones used in the present study were FDCP-1B, which had an even lower frequency of spontaneous IL-3 independence of 2(Âą1.9) x10-6) (McCarthy, 1993), and W7.2c (MourtadaMaarabouni et al, 2003).

Figure 1. Production of apoptosis-deficient cell clones by retroviral cDNA library functional expression cloning.

256

Gene Therapy and Molecular Biology Vol 10, page 257

Figure 2. Different pathways for production of apoptosis-deficient cell clones by retroviral insertional mutagenesis (RIM).

cDNA inserts from apoptosis-resistant clones were amplified by PCR, using primers complementary to the adjoining vector, and sequenced (Mourtada-Maarabouni et al, 2003).

B. cDNA functional expression cloning Target cells were treated with 90 ng/ml tunicamycin at 3 x 105 cells/ml for 18 hours and washed before infection with retrovirus. Two different cDNA expression libraries were used, both in the pRUFneo retroviral expression vector (Rayner and Gonda 1994). cDNA for the first library was derived from human bone marrow stromal cells (Zannetino et al, 1996), and for the second library from FDCP1 cells (Rayner and Gonda, 1994)). !2 ecotropic murine packaging cells producing the libraries seeded at 5 x 106 cells per 225cm2 flask were grown overnight to about 60% confluence and "-irradiated using a 60Co source (2500cGy).

The supernatant was removed and 25ml of W7.2c cell suspension was added with 8Âľg/ml polybrene for 3 days co-culture. The cells in suspension were centrifuged and washed before being stored in aliquots in liquid nitrogen.

D. Retroviral Insertional Mutagenesis (RIM) Target W7.2c and FDCP-1B cells were infected with the retroviral vector pBABEpuro (Morgenstern and Land, 1990) produced in the ecotropic packaging cell line GP+E86 (Miller and Miller, 1992). Target cells were pre-incubated with tunicamycin and washed before co-culture with gammairradiated packaging cells for 2 days in the presence of polybrene. After several infection cycles, infected W7.2c cells were washed and selected as above. Infected FDCP-1B cells were washed 3 x to remove IL-3 and incubated for 24 hours prior to cloning in soft agar; cells were incubated for a total of 7 days without IL-3, and IL-3 was then added to the soft agar. The site of retroviral insertion in surviving clones was determined by inverse PCR.

C. Selection of apoptosis-resistant clones Several selection protocols were employed at different times to allow the identification of a range of different apoptosisresistant mutant cells. Selection with "-radiation was carried out using a 60Co radiation source delivering a dose of 500-1000 cGy. Selection with dexamethasone (20- 50nM) was carried out for 6 days, after which time the cells were washed to remove the dexamethasone prior to cloning in soft agar (MourtadaMaarabouni et al, 2003). Continuous treatment with dexamethasone during cloning was avoided since this would not allow the isolation of cells resistant to the apoptosis-inducing effects alone- any colonies growing in the continuous presence of dexamethasone would have to be resistant to its cytostatic effects as well.

Selection of W7.2c cells with Phytohaemagglutinin (PHA; HA16, Murex Biotech UK), either as the sole stimulus or after irradiation or dexamethasone treatment, was carried out by including the PHA in the soft agar cloning dishes at final concentrations of 5-10Âľg/ml.

III. Results and Discussion A. cDNA functional expression cloning The use of techniques which depend on an unbiased screen based solely on the function of the gene has the potential to identify many genes which act by highly diverse mechanisms. This diversity is demonstrated in Table 1 which lists 18 genes isolated from W7.2c cells which survived apoptotic stimuli. They are therefore candidate apoptosis-regulating genes. However it is likely that several will be false positives- e.g. isolated from cells fortuitously carrying genomic mutations giving resistance to apoptosis. For several of the clones however, apoptosissuppressing activity has been confirmed by re-expressing the inserts in fresh host cells and challenging with apoptosis-inducing stimuli (e.g. Protein phosphatase 4, RACK1 and rFau (antisense to Fau).

257

Williams et al: Isolation of genes controlling apoptosis The sequences isolated by cDNA functional expression cloning include full protein-coding sequences, such as Onzin/PLAC8, as well as partial coding sequences, such as Protein Phosphatase 4, and antisense sequences, such as rFau. These sequences can be assumed to modulate apoptosis in very different ways. PLAC8/ Onzin, for example, is likely to act as an inhibitor of apoptosis (Rogulski et al, 2005), whereas the partial

mRNA sequence of Protein Phosphatase 4 identified appears to act by inhibiting the activity of endogenous proapoptotic Protein Phosphatase 4 (Mourtada-Maarabouni et al, 2003). The partial antisense sequence of Fau identified is likely to suppress apoptosis by hybridising to the mRNA of endogenous pro-apoptotic Fau (Mourtada-Maarabouni et al, 2004).

Table 1. Candidate apoptosis-regulating genes identified by cDNA functional expression cloning Gene name(s)

cDNA library selected

Challenge for isolation

Host cell for isolation

PPP4C; Protein Phosphatase 4, catalytic subunit

Mouse FDCP1 cDNA in retroviral vector pRUFneo (Rayner and Gonda, 1994) Mouse FDCP1 cDNA in retroviral vector pRUFneo (Rayner and Gonda, 1994)

Dexamethasone followed by "radiation

W7.2c (MourtadaMaarabouni et al, 2003)

Dexamethasone followed by "radiation

Mouse FDCP1 cDNA in retroviral vector pRUFneo (Rayner and Gonda, 1994) Mouse FDCP1 cDNA in retroviral vector pRUFneo (Rayner and Gonda, 1994) Mouse FDCP1 cDNA in retroviral vector pRUFneo (Rayner and Gonda, 1994) Mouse FDCP1 cDNA in retroviral vector pRUFneo (Rayner and Gonda, 1994) Mouse FDCP1 cDNA in retroviral vector pRUFneo (Rayner and Gonda, 1994) Mouse FDCP1 cDNA in retroviral vector pRUFneo (Rayner and Gonda, 1994) Mouse FDCP1 cDNA in retroviral vector pRUFneo (Rayner and Gonda, 1994) Mouse FDCP1 cDNA in retroviral vector pRUFneo (Rayner and Gonda, 1994) Human bone marrow stromal cells (Zannettino et al, 1996)

Fau; MNSFbeta

Gnb2l1/RACK1 ; Receptor for Active C Kinase 1 Atp6v1e1; Vacuolar/ lysosomal ATPase, subunit E Gas5; Growth Arrest Specific transcript 5 Plac8; Onzin; C15

Limk2; LIMmotif-containing protein kinase 2 Fus; Tls; Pigpen

Ucp2; Uncoupling protein 2 Prtn3; mPR3; Proteinase 3

HTRA1; PRSS11; HTRA serine peptidase 1

cDNA originally isolated Partial, sense

Confirmation of effects on cell survival Yes (MourtadaMaarabouni et al, 2003)

W7.2c (MourtadaMaarabouni et al, 2003)

Partial, antisense

"-radiation followed by PHA

W7.2c (MourtadaMaarabouni et al, 2003)

Partial, sense

Yes (MourtadaMaarabouni et al, 2004) Yes (MourtadaMaarabouni et al, 2005)

"-radiation followed by PHA

W7.2c (MourtadaMaarabouni et al, 2003)

Partial, sense

Yes (Anderson and Williams, 2003)

"-radiation

W7.2c (MourtadaMaarabouni et al, 2003)

Not applicable

-

"-radiation followed by PHA

W7.2c (MourtadaMaarabouni et al, 2003)

Yes (Rogulski et al, 2005)

Cloning in PHA

W7.2c (MourtadaMaarabouni et al, 2003)

Full coding sequence, sense Partial, sense

"-radiation followed by PHA

W7.2c (MourtadaMaarabouni et al, 2003)

Partial, sense

-

Dexamethasone followed by PHA

W7.2c (MourtadaMaarabouni et al, 2003)

Partial, sense

-

Etoposide

W7.2c (MourtadaMaarabouni et al, 2003)

Partial, sense

-

PHA

W7.2c (MourtadaMaarabouni et al, 2003)

Partial, sense

-

258

-

Gene Therapy and Molecular Biology Vol 10, page 259 Gene name(s)

cDNA library selected

Challenge for isolation

Host cell for isolation

RPLP1; Ribosomal protein, large, P1 TncRNA; Trophoblastderived noncoding RNA S100A6; S100 calcium binding protein A6 (calcyclin) SEC61A1; HSEC61; protein transport protein SEC61 alpha subunit HNRPD; AUF1A; Heterogeneous nuclear ribonucleoprotei n D; AU-rich element RNA binding protein 1 TNFAIP8; GG21, SCC-S2, MDC-3.13; Tumor necrosis factor, alphainduced protein 8 GMFB; Glia maturation factor beta

Human bone marrow stromal cells (Zannettino et al, 1996) Human bone marrow stromal cells (Zannettino et al, 1996) Human bone marrow stromal cells (Zannettino et al, 1996) Human bone marrow stromal cells (Zannettino et al, 1996)

PHA

W7.2c (MourtadaMaarabouni et al, 2003)

PHA

W7.2c (MourtadaMaarabouni et al, 2003)

PHA

CTSD; CPSD; Cathepsin D

cDNA originally isolated Full coding sequence, sense Not applicable

Confirmation of effects on cell survival -

W7.2c (MourtadaMaarabouni et al, 2003)

Partial, sense

-

PHA

W7.2c (MourtadaMaarabouni et al, 2003)

Partial, sense

-

Human bone marrow stromal cells (Zannettino et al, 1996)

PHA

W7.2c (MourtadaMaarabouni et al, 2003)

Partial, sense

-

Human bone marrow stromal cells (Zannettino et al, 1996)

PHA

W7.2c (MourtadaMaarabouni et al, 2003)

Partial, sense

-

Human bone marrow stromal cells (Zannettino et al, 1996) Human bone marrow stromal cells (Zannettino et al, 1996)

PHA

W7.2c (MourtadaMaarabouni et al, 2003)

Partial, sense

-

PHA

W7.2c (MourtadaMaarabouni et al, 2003)

Partial, sense

Yes, e.g. LiaudetCoopman et al, 2006

In other cases, mutated/truncated proteins may be produced which can have either dominant negative inhibitory activity, or which may be constitutively activated.

The anti-apoptotic effect of the partial sense protein phosphatase 4 sequence was confirmed by isolation of the cDNA insert from the genomic DNA of the corresponding W7.2c clone using PCR and subsequent expression in fresh host cells (Mourtada-Maarabouni et al, 2003). Many of the proteins important in the control of apoptosis are regulated by phosphorylation and dephosphorylation, e.g. the Bcl-2 family of apoptosis regulators (e.g. Deng et al, 1998; Chiang et al, 2001). The identification of Protein

-

Phosphatase 4 as functionally important in apoptosis suggests that it may act on one or more of these. The sequence antisense to Fau is also of particular significance since a Fau antisense sequence is also found in the FinkelBiskis-Reilly murine sarcoma virus (Finkel et al, 1976).

The anti-apoptotic effect of Fau antisense sequences, and the pro-apoptotic effects of Fau, have been confirmed directly (Mourtada-Maarabouni et al, 2004). Fau may therefore act as a tumour suppressor, and down-regulation of Fau may be important in oncogenesis.

One of the cDNA sequences isolated by sequential selection with "-radiation and PHA is a partial cDNA for the receptor for activated protein kinase C (RACK1),

259

Williams et al: Isolation of genes controlling apoptosis which includes the 3'-untranslated sequence of the mRNA. Although this sequence does not contain the full coding sequence of RACK1, it up-regulates endogenous RACK1, presumably by interacting with endogenous regulatory molecules. Studies on the expression of full length RACK1 have confirmed its anti-apoptotic activity, which may be related to its established interactions with Src kinases (Chang et al, 2002), integrins (Liliental and Chang, 1998) or other molecules (Mourtada-Maarabouni et al, 2005).

Vacuolar ATPase subunit E was identified in two separate screens. Firstly, by temporary withdrawal of IL-3 from BAF-3 IL-3-dependent cells (Anderson and Williams, 2003) and, independently, by selection of W7.2c cells with "-radiation followed by PHA. In both cases the suppression of apoptosis appeared to be due to indirect effects on the endogenous vATPase through regulatory molecules which modulate the activity of the vATPase.

This proton pump can affect both cytoplasmic and vacuolar/lysosomal pH, as well as other aspects of cell metabolism (reviewed by Nishi and Forgac, 2002).

regulating genes. Two of the genes identified by RIM have been shown to be involved in the control of apoptosis.

Firstly, Notch1 has been shown to play a crucial role in the control of cell fate, including the control of apoptosis (e.g.

Jundt et al, 2002). Secondly, the insulin-like growth factor receptor (Igf1r) has been shown to regulate apoptosis and to play an important role in oncogenesis in many tissues (e.g. Roschier et al, 2001). Spink2, on the other hand, could not be demonstrated to play any significant role in apoptosis in the Jurkat human T-cell line, or in the TF-1 human growth factor dependent cell line (Hedge and Williams, unpublished work). This serves as a reminder that the candidate apoptosis-regulating genes listed in both Table 1 and Table 2 are bound to include some false positives. Further studies are required in each case to confirm or refute the potential roles in apoptosis control.

In the present paper we have confirmed that forward genetics, either using cDNA functional expression cloning or using RIM, is a very valuable strategy for the analysis of the molecular controls on apoptosis. In several cases, entirely unpredicted genes have been identified, each of which opens up a new avenue for apoptosis research.

Since regulation of apoptosis is crucial to many diseases, this molecular dissection of apoptosis identifies novel targets for the gene and drug therapy of these diseases.

B. Retroviral Insertional Mutagenesis (RIM) The information which has flowed from the human and mouse genome projects over the past few years has been very valuable in allowing the rapid identification of the sites of retroviral insertion in cells showing resistance to apoptosis (Table 2). This has made it possible to identify the flanking sequences obtained by inverse PCR (e.g. Nowrouzi et al, 2006; Shin et al, 2004) and so to suggest the identity of novel candidate apoptosis-

Acknowledgments We thank the Wellcome Trust and BBSRC UK for financial support and Dr. Janet Meredith for subcloning candidate genes.

Table 2. Candidate apoptosis-regulating genes identified by retroviral insertional mutagenesis Mouse chromosome insertion

Gene closest insertion

to

Gene associated insertion

10

Cdh23; Cadherin-23; Otocadherin (insertion into intron)

GI:24475914

-

3

Gstm1; Glutathione-STransferase Mu-1 (insertion into intron)

GI: 68051724

-

2

Notch1

GI :31543331

Yes, e.g. Jundt et al, 2002

14

Pheromone V3R6

receptor

GI:26083204

-

5

Spink2; Serine peptidase inhibitor, Kazal type 2

GI:34304086

-

7

Igf1r; insulin-like growth factor I receptor

GI:3025893

Yes, e.g. Roschier et al, 2001

260

sequence with

Confirmation of effects on cell survival

Gene Therapy and Molecular Biology Vol 10, page 261 McCarthy N J, (1993) Apoptosis induced by cancer chemotherapeutic drugs and its genetic suppression. D. Phil (University of Birmingham).

Miller D G and Miller A D (1992) Tunicamycin treatment of CHO cells abrogates multiple blocks to retrovirus infection one of which is due to a secreted inhibitor. J Virol 66, 78-84.

Morgenstern J P, Land H (1990) Advanced mammalian genetransfer - high titer retroviral vectors with multiple-drug selection markers and a complementary helper-free packaging cell-line Nucl Acid Res 18, 3587-3596.

Mourtada-Maarabouni M, Kirkham L, Farzaneh F, Williams G T (2004) Regulation of apoptosis by fau revealed by functional expression cloning and antisense expression. Oncogene 23, 9419-9426.

Mourtada-Maarabouni M, Kirkham L, Farzaneh F, Williams G T, (2005) Functional expression cloning reveals a central role for the receptor for activated protein kinase C 1 (RACK1) in T cell apoptosis. J Leuk Biol 78, 503-514.

Mourtada-Maarabouni M, Kirkham L, Jenkins B, Rayner J, Gonda T J, Starr R, Trayner I, Farzaneh F, Williams G T (2003) Functional expression cloning reveals proapoptotic role for protein phosphatase 4. Cell Death Diff 10, 10161024.

Nishi T, Forgac M (2002) The vacuolar (H+)-ATPases - Nature's most versatile proton pumps. Nat Rev Mol Cell Biol 3, 94103.

Nowrouzi A, Dittrich M, Klanke C, Heinkelein M, Rammling M, Dandekar T, von Kalle C, Rethwilm A (2006) Genome-wide mapping of foamy virus vector integrations into a human cell line. J Gen Virol 87, 1339-1347.

Rayner J R, Gonda T J (1994) A simple and efficient procedure for generating stable expression libraries by cDNA cloning in a retroviral vector. Mol Cell Biol 14, 880-887.

Rogulski K, Li Y J, Rothermund K, Pu L X, Watkins S, Yi F H, Prochownik E V (2005) Onzin a c-Myc-repressed target promotes survival and transformation by modulating the AktMdm2-p53 pathway. Oncogene 24, 7524-7541 Roschier M, Kuusisto E, Suuronen T, Korhonen P, Kyrylenko S, Salminen A (2001) Insulin-like growth factor binding protein 5 and type-1 insulin-like growth factor receptor are differentially regulated during apoptosis in cerebellar granule cells. J Neurochem 76, 11-20.

Shin M S, Fredrickson T N, Hartley J W, Suzuki T, Agaki K, and Morse H C (2004) High-throughput retroviral tagging for identification of genes involved in initiation and progression of mouse splenic marginal zone lymphomas. Cancer Res 64, 4419-4427.

Stark G R, Gudkov A V (1999) Forward genetics in mammalian cells: functional approaches to gene discovery. Hum Mol Genet 8, 1925-1938.

Thompson C B (1995) Apoptosis in the pathogenesis and treatment of disease. Science 267, 1456-1462.

Thornberry N A, Lazebnik Y (1998) Caspases: Enemies within.

Science 281, 1312-1316.

Williams G T, Smith C A (1993) Molecular regulation of apoptosis - genetic controls on cell-death. Cell 74, 777-779.

Zannettino A C W, Rayner J R, Ashman L K, Gonda T J, Simmons P J (1996) A powerful new technique for isolating genes encoding cell surface antigens using retroviral expression cloning. J Immunol 156, 611-620.

References Anderson C L and Williams G T (2003) Apoptosis gene hunting using retroviral expression cloning. SciWorld J 3, 51-58.

Chang B Y, Harte R A, Cartwright C A (2002) RACK1: a novel substrate for the Src protein-tyrosine kinase. Oncogene 21, 7619-7629.

Chiang C W, Harris G, Ellig C, Masters S C, Subramanian R, Shenolikar S, Wadzinski B E, Yang E (2001) Protein phosphatase 2A activates the proapoptotic function of BAD in interleukin-3-dependent lymphoid cells by a mechanism requiring 14-3-3 dissociation. Blood 97, 1289-1297.

Cohen O, Feinstein E, Kimchi A (1997) DAP-kinase is a Ca2+ calmodulin-dependent cytoskeletal-associated protein kinase with cell death-inducing functions that depend on its catalytic activity. EMBO J 16, 998-1008.

Cory S, Adams J M (2002) The BCL2 family: Regulators of the cellular life-or-death switch. Nat Rev Cancer 2, 647-656.

Danielsen M, Peterson D O, Stallcup M R (1983) Immunological selection of variant mouse lymphoid cells with altered glucocorticoid responsiveness. Mol Cell Biol 3, 1310-1316.

Deiss L P, Feinstein E, Berissi H, Cohen O, Kimchi A (1995) Identification of a novel serine threonine kinase and a novel 15-kd protein as potential mediators of the gammainterferon-induced cell-death. Genes Dev 9, 15-30.

Deng X, Ito T, Carr B, Mumby M, Stratford May Jr M (1998) Reversible phosphorylation of Bcl2 following interleukin-3 or bryostatin 1 is mediated by direct interaction with PP2A. J Biol Chem 273, 34157-34163.

Dexter T M, Garland J, Scott D, Scolnick E, Metcalf D (1980) Growth of factor-dependent hematopoietic precursor celllines. J Exp Med 152. 1036-1047.

Finkel M P, Reilly Jr C A, Biskis B O (1976) Recent Results Cancer Res 54, 92-103.

Hale A J, Smith C A, Sutherland L C, Stoneman V E A, Longthorne V L, Culhane A C, Williams G T (1996) Apoptosis: Molecular regulation of cell death. Eur J Biochem 236, 1-26.

Hengartner M O (2000) The biochemistry of apoptosis. Nature 407, 770-776.

Hitoshi Y, Lorens J, Kitada S I, Fisher J, LaBarge M, Ring H Z, Francke U, Reed J C, Kinoshita S, Nolan G P (1998) Toso, a cell surface specific regulator of Fas-induced apoptosis in T cells. Immunity 8, 461-471.

Inbal B, Cohen O, PolakCharcon S, Kopolovic J, Vadai E, Eisenbach L, Kimchi A (1997) DAP kinase links the control of apoptosis to metastasis. Nature 390, 180-184.

Jundt F, Anagnostopoulos I, Forster R, Mathas S, Stein H, Dorken B (2002) Activated Notch1 signaling promotes tumor cell proliferation and survival in Hodgkin and anaplastic large cell lymphoma. Blood 99, 3398-3403.

Kerr J F R, Winterford C M, Harmon B V (1994) Apoptosis - its significance in cancer and cancer-therapy. Cancer 73, 20132026.

Liaudet-Coopman E, Beaujouin M, Derocq D, Garcia M, Glondu-Lassis M, Laurent-Matha V, Prebois C, Rochefort H, Vignon F (2006) Cathepsin D: newly discovered functions of a long-standing aspartic protease in cancer and apoptosis.

Cancer Letts 237, 167-179.

Liliental J, Chang DD (1998) Rack1 a receptor for activated protein kinase C interacts with integrin beta subunit. J Biol Chem 273, 2379-2383.

261

Williams et al: Isolation of genes controlling apoptosis

262

Gene Therapy and Molecular Biology Vol 9, page 263 Gene Ther Mol Biol Vol 9, 263-268, 2005

The prevalence of antibiotic resistance in anaerobic bacteria isolated from patients with skin infections Research Article

Gita Eslami*, Fatemeh Fallah, Hossein Goudarzi and Masoumeh Navidinia Microbiology Department, Medical Faculty Shaheed Beheshti University of Medical Science & Pediatric Infectious Research Center Tehran- Iran

__________________________________________________________________________________ *Correspondence: Gita Eslami Ph.D, Associate Professor, Microbiology Department, Medical Faculty of Shaheed Beheshti University, Evin Street, Charman High way, Tehran-Iran; Tel: 0098-21-23872556; Fax: 009821-2413042; E-mail: g_eslami@yahoo.com Key words: Antibiotic resistance, anaerobic bacteria, skin infection Received: 2 September 2005; Revised: 01 August 2006 Accepted: 17 August 2006; electronically published: December 2006

Summary Antibiotic resistance in Anaerobic bacteria and the lack of proper outline to treatment of anaerobic infections have been increased in recent years, In this study 100 patients with skin infections (10-60 years old) were considered.

Specimens were collected in the sterile condition and transported and cultured in the Thioglycolate media. After growing and staining of bacteria (gram staining) from selective media, bacteria were cultured in the differentiated media. Strains that were isolated, undergone antibiogram test (Kirby bauer method). Skin infections are usually polymicrobial involving aerobic and anaerobic bacteria. Common aerobic and anaerobic facultative bacteria contained: Staphylococcus aureus (37.3%), non coagolase Staphylococci (8.5 %), group A streptococci (16.3 %), group D enterococci (5.7%), E.coli (15.6 %), enterobacter-spp (5.6%), citrobacter-spp (0.8%), Pseudomonas aeruginosa (6.9%), proteus-spp (2.7%), others (0.6%). Predominant anaerobic bacteria contained: Peptostreptococcus-spp (42.5%), pigmented prevotella and Porphyromon-spp (5.4%), Fusobacterium (7.6%) Bacteroides-spp (23.2%), Clostridium-spp (18.4%), Propionebacteriom acnes (2.1%), others (0.8%). Atibiogram test was done on aerobic-anaerobic facultative bacteria. Susceptibility of these bacteria were as following: Cefizoxim100%, Ciprofloxcin 98%, Ceftazidim 82%, Tobramycin 47%, and Amikacin 33%. And their resistance to Gentamycin was 97%, Penicillin 93%, Cloxacillin 86%, and Erythromycin 62%. In anaerobic bacteria, susceptibility to Ciprofloxacin was 100%, Ceftyzoxim 100, Ceftazidim 91% Rifampin 76%, Colistin 67%, and their resistance to Penicillin was 95%, Erythromycin 83%, Cloxacillin 85%. Susceptibility of both anaerobic and aerobic bacteria to Ceftizoxim was 100 %, so we suggest this drug for treatment of many skin infections. even more problem with increasing resistance among these groups of organisms. A number of antimicrobials have poor or no activity against some bacteria (Wexler et al, 1998; Chau, 1999; Nichols et al, 1999). Failure to provide antibacterial coverage against the anaerobes in a mixed aerobic-anaerobic infection may lead to inadequate response. This could, of course, be attributed to another factor such as the possibility of an untrained abscess (Holten and Onusko, 2000). The therapeutic approach in anaerobic infections is complex and involves modification of the local environment of the infected site and the use of appropriate antibacterial agents.

Surgical management, particularly drainage and debridement is an important aspect of treatment of the most anaerobic infections. In a large number of soft tissue infections, anaerobes may play an important role. Among these are superficial infections of the skin and skin

I. Introduction Anaerobic bacteria are important because they dominate the diagnose flora. They are commonly found in different infections. Some of these infections are serious and have high mortality rate (Brook, 1995; Finegold, 1995; Summanen et al, 1995). It has to be paid more attention to anaerobic infections because special precautions are needed for appropriate collection and transport of specimens. Isolation and identification of anaerobic bacteria can be complex, difficult, laborintensive, and expensive. The majority of these infections have caused mixtures of numerous strains of aerobic and anaerobic bacteria. Interpreting culture to establish the extent, to which any one particular anaerobe in the mixture is contributing to infection, is difficult (Brook et al, 1997; Wexler and Finegold, 1998). Treatment considerations for these mixed anaerobic infections are difficult and causing 263

Eslami et al: Antibiotic resistance in anaerobic bacteria isolated from patients with skin infections anaerobic. Plates must be immediately placed in anaerobic jars condition (jar with gas pack generates H2 gas and a cold palladium catalyst converts remaining O2 to water) and examined after 48-72 h. After growing of the colonies, we stained colonies of bacteria with gram staining and determined shape of bacteria.

Then we used specific culture and test for identifying type of bacteria. In the mean time we used aerobic and anaerobic condition. When we identified type of bacteria which caused infections, we performed antibiogram test by Kirby-Bauer method (gel diffusion test) in blood or chocolate agar with Muller-Hinton base agar. After 24 h for aerobic and 48-72 h for anaerobic bacteria, we reported susceptibility of bacteria to antibiotic disk.

structures such as cellulites, infected cutaneous ulcer, infected sebaceous or inclusion cysts, hidradenitis supportive, pyoderma, paronychia, and tropical ulcer (Goldstein et al, 2002). The choice of single-agent therapy of mixed infections is ideally based on local data of susceptibility patterns of the bacteria involved in these infections.

II. Materials and methods This descriptive study was performed at faculty of medicine in medical university of shaheed Beheshti and medical sciences from March 2002 through 2003. In this research, 100 patients with skin infections including samples of ulcer (in foot, gluteal, nose, under breast, knee elbow), abscesses (from inguinal, neck, perianal, nose), pastula, acnes and bullea were examined.

Collecting was done with syringe and swabs. All of specimens were transferred to transport media. Swab specimens were homogenized in a small amount of broth. Aspirates were thoroughly mixed before inoculation. For transport media Tripticase soy broth for aerobic bacteria and Thioglycolate broth for anaerobic bacteria were used. Then we cultured these specimens in blood agar, (with L-cysteine, yeast extract vitamin k and hemin), selective media bile-esculin agar which is anaerobic blood agar containing Kanamycin to inhibit facultative gram negative rods and Vancomycin to inhibit gram positive bacteria, chocolate agar and Mac conkey agar, for first screening.

Therefore, we used 6 plates for each specimen; 3 plates for aerobic condition that were examined after 24 h and 3 plates for

III. Results We examined 100 samples from patients with ulcer (in foot, Gluteal, nose, under breast, knee, and elbow), abscesses (from inguinal, neck, perianal, nose), pastula, acnes, bullea. In our research, we examined 58 specimens from women (Figure 1) and 42 specimens from men with age between 10-60 years old (Figure 2). Common aerobic and anaerobic facultative bacteria (Figure 3) were: Staphylococcus aureus (37.3%), non coagolase Staphylococci (8.5 %), group A Streptococci (16.3 %), group D Enterococci (5.7%), E.coli (15.6 %), Enterobacter-spp (5.6%), Citrobacter- spp (0.8%), Pseudomonas aeruginosa (6.9%), Proteus-spp (2.7%), others (0.6%) (Figure 4).

Figure 1. The symptoms in infectious skin in women

Figure 2. The age of patients with skin infection

264

Gene Therapy and Molecular Biology Vol 9, page 265

Figure 3. Microbiology of specimens from patients with skin infection

Figure 4. The prevalence of aerobic bacteria isolated from patients with skin infection

Predominant anaerobic bacteria were: Peptostreptococcus-spp (42.5%), pigmented Prevotella and Porphyromon-spp (5.4%), Fusobacterium (7.6%) Bacteroides-spp (23.2%), Clostridium-spp (18.4%), Propionebacteriom acnes (2.1%), others (0.8%) (Figure 5).

Atibiogram test was done on aerobic-anaerobic facultative bacteria.

Susceptibility of these bacteria were as following: Cefizoxim100%, Ciprofloxcin 98%, Ceftazidim 82%, Tobramycin 47%, and Amikacin 33%. And their

resistance to Gentamycin was 97%, Penicillin 93%, Cloxacillin 86%, and Erythromycin 62% (Figure 6). In anaerobic bacteria, susceptibility to Ciprofloxacin was 100%, Ceftyzoxim 100, Ceftazidim 91% Rifampin 76%, Colistin 67%, and their resistance to Penicillin was 95%, Erythromycin 83%, Cloxacillin 85% (Figure 7).

Susceptibility of both anaerobic and aerobic bacteria to Ceftizoxim was 100 %, so we suggest this drug for treatment of many infections.

Figure 5. The prevalence of anaerobic bacteria isolated from patients with skin infection

265

Eslami et al: Antibiotic resistance in anaerobic bacteria isolated from patients with skin infections

Figure 6. The prevalence of antibiotic susceptibility aerobic bacteria isolated from patients with skin infection

Figure 7. The prevalence of antibiotic susceptibility anaerobic bacteria isolated from patients with skin infection

our study we found S.aureus (37.3%) and streptococcus pygenes (16.3%). Other reports showed that the isolation rates of Bacteroides Fragilis group organism have recently been increasing in both primary and post operative infection (Caceres et al, 1999; Bryskier, 2001; Goldstein et al, 2002) and Peptosterptococci typically are the most common isolated anaerobic bacteria (Wexler and Finegold, 1998; Wexler et al, 1998; Chau, 1999). We isolated Peptostreptococci (43%) and Bacteroides group organism (23.2%), which is as same as the other reports.

Nevertheless, accurate information regarding the efficacy of a certain agent in inhibiting or killing the organism will certainly give useful clinical information for choice of a therapeutic agent. A consensus group of infectious disease clinicians concluded that in the most serious infections involving anaerobes, susceptibility test results correlate with the clinical response. The mechanisms by which anaerobic bacteria become resistant to !lactames antibiotics are similar to those described in aerobes and include the production of ! lactames, changes in penicillin G binding proteins, and changes in outer membrane

IV. Discussion Expecting exact correlation of laboratory results with clinical outcome is not realistic. Infections involving anaerobes are typically polymicrobial (Caceres et al, 1999; Bryskier, 2001; Ueno et al, 2002); It is often not necessary to eradicate all of the organisms to gain a cure.

Appropriate surgical manipulation, the patients general health status, and the microenvironment at the site of the infection will have a significant impact on the outcome, regardless of whether a particular isolate is susceptible to the antimicrobial. The aims of this study were to determine the antimicrobial susceptibility pattern and to study the role of bacteria which had been isolated from the cultures which had been taken from different skin infections.

In many studies of skin and soft tissue, Staphylococcus aureus was the most common pathogen.

Group A Streptococci ranks as a second common pathogen in gram positive cocci (Caceres et al, 1999; Chau, 1999; Goldstein et al, 2002; Ueno et al, 2002). In

266

Gene Therapy and Molecular Biology Vol 9, page 267 Caceres M, Carrera E, Palma A, Berrios G, Weintraub A, Nord CE (1999) Antimicrobial susceptibility of anaerobic and aerobic bacteria isolated from patients with mixed infections in Nicaragua. Rev Esp Quimioter 12, 332-9.

Chau JC (1999) Combating bacterial resistance in skin and skinstructure infection: importance of !-lactamase inhibition. Am J Ther 6, 13-18.

Finegold SM (1995) Anaerobic infections in humans: an overview. Anaerobe 1, 3-9.

Goldstein EJ, Citron DM, Merriam CV, WarrenY, Tyrrell KL, Gesser RM (2002) General microbiology and in vitro susceptibility of anaerobes isolated from complicated skinstructure infections from complicated skin and skin -structure infections in patients enrolled in a comparative trail of eratapennem versus piperacillin-tazobactam. Clin Infect Dis 35(suppl 1):S119-25.

Holten KB, Onusko EM (2000) Appropriate prescribing of oral !-lactam antibiotics. Am Fam Physician 62, 611-20.

Nichols RL, Graham DR, Barriere SL, Rodgers A, Wilson SE, Zervos M, Dunn DL, Kreter B (1999) Treatment of hospitalized patients with complicated gram-positive skin and skin structure infections: two randomized, multicentre studies of quinupristin/dalfopristin versus cefazolin, oxacillin or vancomycin. Synercid Skin and Skin Structure Infection Group. J Antimicrob Chemother 44, 263-73.

Summanen PH, Talan DA, Strong C, McTeague M, Bennion R, Thompson JE, Vaisanen ML, Moran G, Winer M, Finegold SM (1995) The bacteriology of skin and soft tissue infections: a comparison of infections in intravenous drug abusers and nonintravenous drug abusers. Clin Infect Dis 20 (Suppl 2), S279-S282.

Ueno K, Kato N, Kato H (2002) The status of research on anaerobes in Japan. Clin Infect Dis 35 (supply 1), 828-35.

Wexler HM, Molitoris E, Molitoris D, Finegold SM (1998) In vitro activity of levofloxacin against a selected group of anaerobic bacteria isolated from skin and soft tissue infections. Antimicrob Agents Chemother 42, 984-6.

Wexler HM, Finegold SM (1998) Current susceptibility patterns of anaerobic bacteria. Yonsei Med J 39, 495-501.

permeability to ! lactames (Holten and Onusko, 2000; Bryskier, 2001). Antibacteria therapy must cover the key pathogens. Some compounds have significant activity against both aerobic and anaerobic microorganisms (Caceres et al, 1999; Chau, 1999; Goldstein et al, 2002; Ueno et al, 2002). The antibiogram test of anaerobic and aerobic isolated from Iranian patients with skin infection was determined by using the most common antimicrobial agents used in Iran.

In our survey, it was shown that anaerobic and aerobic facultative bacteria resistance rate were: Cloxacillin (86%), Penicillin (93%), Gentamycin (97%) and susceptibility were Ceftizoxim (100%), Ciprofloxacin (98%).

In anaerobic bacteria, resistance to penicillin were (95%), Cloxacillin (85%), Erthromycin (83%), and susceptibility to Ciprofloxacin, Ceftyzoxim were (100%), Ceftazidim (91%).

We concluded that, in skin infections which are composed of both aerobic and anaerobic bacteria, Ciprofloxacin, Ceftyzoxim were highly active drugs that could eradicate the major pathogens bacteria found from skin infection in Iranian patients.

In conclusion, the results of the present investigation show a high level of resistance in aerobes and anaerobes bacteria. This may be the result of the extensive antibiotic used in patients.

References Brook I (1995) Microbiology of secondary bacterial infection in scabies lesions. J Clin Microbiol 33, 2139-2140.

Brook I, Frazier EH, Yeager JK (1997) Microbiology of nonbullous impetigo. Pediatr Dermatol 14, 192-5.

Bryskier A (2001) Anti-anaerobic activity of antibacterial agents.

Expert Opin Investig Drugs 10, 239-67.

267

Eslami et al: Antibiotic resistance in anaerobic bacteria isolated from patients with skin infections

268

Gene Therapy and Molecular Biology Vol 10, page 269 Gene Ther Mol Biol Vol 10, 269-276, 2006

Transfection of the anti-apoptotic gene bcl-2 inhibits oxidative stress-induced cell injuries through delaying of NF-!B activation Research Article

Shinobu Yanada1, Masashi Misumi1, Yasukazu Saitoh1, Yasufumi Kaneda2, Nobuhiko Miwa1,* 1

Laboratory of Cell-Death Control BioTechnology, Faculty of Life and Environmental Sciences, Prefectural University of Hiroshima, Hiroshima 727-0023, Japan 2 Division of Gene Therapy Science, Graduate School of Medicine, Osaka University Medical School, 2- 2 Yamada-oka, Suita, Osaka, Japan

__________________________________________________________________________________ *Correspondence: Nobuhiko Miwa, Ph.D., Laboratory of Cell-Death Control BioTechnology, Faculty of Life and Environmental Sciences, Prefectural University of Hiroshima, 562 Nanatsuka, Shobara, Hiroshima 727-0023, Japan; Tel and Fax: +81-824-74-1754; Email: miwa-nob@pu-hiroshima.ac.jp Key words: Bcl-2, NF-!B, H2O 2, oxidative stress, apoptosis Abbreviations: artificial viral envelope, (AVE); Dulbeccoâ&#x20AC;&#x2122;s modified Eagleâ&#x20AC;&#x2122;s medium, (DMEM); enhanced chemiluminescence, (ECL); electrophoretic mobility shift assay, (EMSA); post-ischemic reperfusion, (I/R); reactive oxygen species, (ROS); hemagglutinating virus of Japan, (HVJ); human Bcl-2, (hBcl-2); terminal deoxyribonucleotidyl transferase (TdT)-mediated dUTP nick-end labeling, (TUNEL); tert-butyl hydroperoxide, (t-BuOOH) Received: 25 November 2006; Revised: 16 December 2006 Accepted: 22 December 2006; electronically published: December 2006

Summary We investigated the relation between endogenous NF-!B and exogenous overexpressed Bcl-2 in rat fibroblastic cells (Rat-1) in response to H2O2 after confirming the cytoprotective effect of Bcl-2 against oxidative stresses such as in vitro treatment with H2O2 and in vivo hepatic post-ischemic reperfusional (I/R) injury. Exogenous Bcl-2, which was expressed by hemagglutinating virus of Japan (HVJ)-artificial viral envelope (AVE) liposome-mediated gene transfer of human bcl-2 that was incorporated into an SV2 vector, prevented I/R-induced hepatic injuries such as cellular DNA strand cleavages more effectively than the non-transfection treatment. The bcl-2-transfected Rat-1 fibroblasts exerted the cytoprotective effect against H2O2 of 50-250 uM more markedly than the SV2 vectortransfected or non-transfected counterpart cells. Immunocytochemical analysis and electrophoretic mobility shift assay (EMSA) showed that intracellular activation of NF-!B in bcl-2-transfectants was repressed more appreciably than in SV2-transfectants at a period as early as 30 min after H2O2 stimulation, but, at advanced periods of 90 and 120 min, was increasingly exhibited up to the similar and exceeding levels relative to those of SV2-transfetants, respectively. Thus the prevention by the anti-apoptotic gene bcl-2 against oxidative stress-induced injury may be attributed at least partly to the repressed early activation and/or the delayed activation of NF-!B. The results provide the foundation for redox-mediated gene therapies using bcl-2 gene directing at ameliorative effects against oxidative stress-induced injuries.

1988; Reed, 1994; Tsujimoto, 2003). A number of mechanisms have been proposed to explain the ability of Bcl-2 to suppress apoptosis (Oltvai et al, 1993; Yang et al, 1997; Shimizu et al, 1998). The localization of Bcl-2 at the loci of free radical generation such as mitochondria may correlate with its ability to protect the subcellular organization (Gross et al, 1999) and to function as an apparent anti-oxidant agent against oxidative stress that

I. Introduction Bcl-2, a mammalian homologue of the anti-apoptotic gene ced-9 in C. elegans, is localized mainly to the mitochondrial membrane (Hockenbery et al, 1990; Akao et al, 1994), and is known to be a key regulator for apoptosis, functioning as an anti-apoptotic protein with the ability to protect against a variety of physiologic or pathologic insults and environmental stimuli (Vaux et al, 269

Yanada et al: Exogenous Bcl-2 inhibition through delayed activation of NF-!B 2005). Prepared HVJ-AVE liposome mixture (200 $g of plasmid DNA and 65 $g of HMG-1, 2 mixture [Wako Pure Chemicals Industries, Osaka]) was injected into the liver via the portal vein by cannulation. The transfection ratio into hepatocytes by this cannulation was approximately 20-30% on the second day after transfection. The transfected genes were expressed around the portal vein of median and left lobes at 2 days after transfection (Yanada et al, 2005). At the time, therefore, livers were quarried and analyzed.

may induce apoptosis (Hockenbery et al, 1993; Voehringer et al, 2000; Jang et al, 2003).

We previously showed that in vitro cytoprotective effects of human Bcl-2 (hBcl-2) against oxidants such as the tert-butylhydroperoxide (t-BuOOH) or post-hypoxic anoxia-induced oxidative injury (Saitoh et al, 2003a,b).

And we recently demonstrated that in vivo inhibitory effects of hBcl-2 on ischemia-reperfusion (I/R) injury involve the repression of increased reactive oxygen species (ROS) (Yanada et al, 2004 and 2005). However, we have not demonstrated definite inhibitory mechanism against oxidative stress by Bcl-2, and it has been in a state of controversy.

As a hint to elucidate the mechanism underlying celldeath inhibition by Bcl-2, it is able to cite the ubiquitous eukaryotic transcription factor, NF-!B which regulates expression of numerous cellular genes that play important roles in mediating/regulating immune and stress responses, inflammation, apoptosis, proliferation and cell survival (Baeuerle et al, 1994 and 1996). In addition, NF-!B is known to be activated by oxidative stress, which is generated by ROS such as H2O2 and O2-, resulting in occurrence of apoptosis and/or necrosis in correspondence to balance with inherent anti-oxidative cellular defense (Wang et al, 2002).

In the present study, after confirming the inhibitory effect of Bcl-2 on in vivo oxidative stress, to investigate the practical mechanisms involved in Bcl-2 cytoprotection against H2O2-induced oxidative stress, we focused on the relations between activation of endogenous NF-!B and exogenous overexpressing Bcl-2 in rat fibroblastic cells.

D. TUNEL assay Cell death associated with I/R-induced hepatic injuries was analyzed by terminal deoxyribonucleotidyl transferase (TdT)mediated dUTP nick-end labeling (TUNEL) assay using the In situ Apoptosis Detection Kit (TaKaRa, Shiga, Japan) according to the manufacture’s protocol as described (Yanada et al, 2005).

Sections of the caudal and median lobes in the I/R-receiving rat livers were prepared at 150 min after reperfusion, and were evaluated by TUNEL assays as compared with those of nontransfected and bcl-2-transfected rats. Sections were examined under a laser scanning confocal fluorescence microscope [MRS600 Cosmos; Carl Zeiss, Oberkochen, Germany (Bio-Rad, Hercules, CA)] at a 100-fold magnification, and expressed in pseudo-color from red (scarcely stained) via yellow (weakly stained) to purple (most strongly stained) by processing of fluorescence intensity with an NIH-Image software for evaluation of the degree of apoptosis. And to elucidate degrees of I/R-induced DNA strand cleavages, images were analyzed and expressed by histogram.

E. Cell culture Rat fibroblastic cells, Rat-1 (Topp, 1981) were used as a parent type, and were kindly provided by Dr. Shoji Yamaoka of Tokyo Med. Dent. Univ. Rat-1 cells (non-transfectants, WT) were cultured in complete medium, Dulbecco’s modified Eagle’s medium (DMEM, Nissui Pharmaceutical Co., Ltd., Tokyo, Japan) containing 10% heat-inactivated fetal bovine serum (FBS; GIBCO BRL, Grand Island, NY), 4 mM L-glutamine, 50 $g/ml penicillin, and 50 $g/ml streptomycin at 37# in a humidified atmosphere of 95% air and 5% CO2. To make stable bcl-2overexpressed transfectants or SV2 (the empty vector without encoding bcl-2) transfectants, Rat-1-SV2 cells, pC"j-SV2 or pC"j-bcl-2 was introduced into Rat-1 cells by the calcium phosphate precipitation method, respectively as described (Paker et al, 1979). Briefly, 1.5 x 105 cells of Rat-1 were seeded into a 35-mm dish. At 16 hr after seeding, 275 $l of 2 M Ca2+ solution containing plasmid DNA (pC"j-bcl-2 or pC"j-SV2, 10 $g each) and 275 $l of 2 x HBS was mixed under supplying air. The DNA mixture solution was poured into the cells. After 1-2 days, the cells were washed twice with phosphate-buffered saline [PBS(-)], and subcultured into 100-mm dishes at appropriate cell concentration in complete medium containing 600 $g/ml Geneticin disulfate (G418; Wako) at 37# in a humidified atmosphere of 95% air and 5% CO2. Medium was changed at every 3 days. After 2 weeks, single colony picked up using a cloning cup (Iwaki Co., Tokyo), and cultured to be grown up and become near-confluent. Bcl-2 expression levels of our preparedbcl-2- transfectants were compared with the level of bcl-2-stable transfectants, b5 cells (a kind gift from Dr. Shoji Yamaoka of Tokyo Med. Dent. Univ.), and the cells which expressed the same level as that of b5 cells were selected out of some candidate colonies.

". Materials and methods A. Plasmid DNA As a plasmid vector, pC"j-SV2 and pC"j-bcl-2 (12.5 kbp, 13.5 kbp; [Tsujimoto, 1989]) was used as previously described (Yanada et al, 2004). Human bcl-2 cDNA (1.0 kbp) was inserted into the EcoRI sites of SV40 early promoter in the pC"j-SV2.

The plasmids were amplified in Escherichia coli DH5a. Both plasmids were kindly provided by Dr. Shoji Yamaoka of Tokyo Med. Dent. Univ. and Dr. Yoshihide Tsujimoto of Osaka Univ., respectively.

B. In vivo oxidative stress model; I/R operation of rat livers Male Wistar rats weighting 250 to 300 g (8-weeks old) were purchased from Japan SLC, Shizuoka, Japan, and were housed at 22 ± 2# for 12 hr light-dark cycle with access to water and food. They were used in experiments following adjustment to these conditions for at least 3 days and were fasted overnight before the experiments. I/R operation was performed as previously described (Eguchi et al, 2003; Yanada et al, 2004 and 2005). An approximately 70% region of the whole liver was made ischemic by clamping both portal vein and the hepatic artery, and resultantly ROS was generated in the ischemic livers (Eguchi et al, 2003).

C. In vivo transfection of plasmids encoding bcl-2 gene

F. Western blotting

For preparing gene transfection’s vector, hemagglutinating virus of Japan (HVJ)-artificial viral envelope (AVE) liposome was prepared as described (Saeki et al, 1997; Yanada et al,

Western blotting was performed for analysis of bcl-2 expression of Rat-1 and our picked up- SV2- or bcl-2-

270

Gene Therapy and Molecular Biology Vol 10, page 271 3’. The oligonucleotides were labeled with [&-32P]dATP (Pharmacia) using the Klenow fragment of DNA polymerase I (Takara, Tokyo) and purified using a gel-filtration column (MicroSpin G-25, Pharmacia).

transfectant, as previously described (Saitoh et al, 2003a,b). Cells were washed twice with PBS and lysed with an ice-cold buffer containing 50 mM Tris- HCl (pH 7.5), 150 mM NaCl, 1 mM DTT, 1 mM PMSF, 1% IGEPALCA-630, 1% SDS, 4 mM leupeptin, and 3 $M pepstatin A. After being three times freezethawed, the lysate was centrifuged at 20,000 g for 5 min at 4# and the supernatant was collected. The amount of protein was measured using DC Protein Assay kit (Bio-Rad). The cell lysates were resuspended in buffer containing 62.5 mM Tris-HCl (pH 6.8), 15% glycerol, 10% %-mercaptoethanol, 0.005% bromophenol blue, and 4% SDS. Then the cell lysates were boiled for 3 min and applied to a 12% SDS–polyacrylamide gel, and the separated proteins were blotted to 0.45-$m thick polyvinylidene difluoride (PVDF) membranes (Millipore).

Nonspecific binding was blocked by incubating the membranes for 2 hr at room temperature in a blocking buffer containing 50 mM Tris-HCl (pH 7.5), 3% bovine serum albumin, and 150 mM NaCl. The membranes were then stained with the 1: 2,500 diluted mouse monoclonal antibody against human Bcl-2 (product #sc-509; Santa Cruz Biotechnology, CA) in blocking buffer overnight at 48# with agitation. After they were washed three times with washing buffer containing 50 mM Tris (pH 7.9), 100 mM NaCl, and 0.05% Tween-20, the membranes were incubated with the 1: 3,000 diluted horseradish peroxidaseconjugated anti-mouse IgG antibody in a blocking buffer for 30 min at room temperature. After they were washed twice with the washing buffer, the membranes were washed with the blocking buffer. The specific bands were detected using an enhanced chemiluminescence (ECL) detection system (AmershamPharmacia Biotech, England, UK), and blots were exposed to Hyperfilm MP (Amersham) for 0.5–2 min. Laser scanning densitometry was conducted for semiquantitative analysis of the data. Approximately equivalent amounts of loaded proteins were confirmed by the densitometric values of some randomly selected bands on the Coomassie Brilliant Blue-stained gel.

I. Visualized detection of activation of NF!B: Immunocytochemical staining Cells of 3.8 x 103 were seeded into each well of 8 well chamber slide (Nunc. Inc., Roskilde, Denmark), after 24-hr incubation, the cells were treated with H2O 2 at 100 $M for 2 hr.

After further 24-hr incubation, the intracellular activation of NF!B in SV2-transfectants and bcl-2- transfectants was analyzed at 0, 15, 30 and 90 min. Briefly, the cells were washed twice in PBS(-), and fixed with 4.5% paraformaldehyde in PBS(-) for 15 min, and subsequently washed with PBS(-). Cells were then treated with 0.5% Triton X-100 in PBS(-) for 20 min, and were thereafter treated with anti-rat NF-!B, p65 subunit (c-20) rabbit polyclonal antibody (product # sc-372, Santa Cruz Biotechnology Inc., CA) at a final concentration of 0.5 $g/ml in 3% bovine serum albumin (BSA, Sigma) in PBS(-) at 37# for 1 hr in humidified atmosphere. Cells were then washed with 0.05% Triton X-100 in PBS(-), and subsequently were incubated with the secondary antibody, an FITC-conjugated anti-rabbit IgG goat antibody (product #55646, Organon Technika Co.) at a final concentration of 0.1 $g/ml in 3% BSA in PBS(-) at 37# for 40 min. The preparations were thereafter washed three times with PBS(-) for 10 min and mounted in PermaFluor aqueous mounting medium (Immnunon, Pittsburgh, PA). The slides were examined on a confocal laser scanning fluorescence microscope [MRS-600 Cosmos; Carl Zeiss (Bio-Rad)] equipped with an argon laser as the light source, and then were analyzed with Photoshop 4.0J and NIH Image softwares.

III. Results A. In vivo protective effect of Bcl-2 on ischemia-reperfusion (I/R) in rat nontransfected livers and bcl-2-transfected livers

G. Cell viability assay Cell viability of Rat-1 and SV2- or bcl-2-transfected cells was measured by WST-1 method as previously described (Saito et al, 2003a and b). Briefly, the cell layer in a dish was incubated with WST-1 (2-(4-iodophenyl)- 3-(4-nitrophenyl)-5-(2,4disulfophenyl)-2 H-tetrazolium, monosodium salt) (Dojin Laboratories Co., Kumamoto, Japan) solution at 1:10 volume of phenol red-free culture medium for 3 hr at 37#. Viable cells with activity of mitochondrial dehydrogenases such as succinate dehydrogenage are capable of reducing the WST-1 dye to generate the yellowish formazan. At the end of incubation period, the absorbance of each sample was measured at 450 nm with an absorbance plate reader (Bio-Rad), and the absorbance values detected have been demonstrated to be proportional to viable cell numbers. Since there was no difference in the basal viability (mitochondrial dehydrogenase activity) between nontransfectants and transfectants, the values obtained from control cultures (non-treated non-transfectants and transfectants) are represented as 100% viability. The values of treated cultures are expressed as a percentage of those versus the corresponding control cells.

Tissue sections of I/R-operated livers were made at 150 min after reperfusion, and comparison was made within two groups: bcl-2-transfected, and the nontransfected livers as analyzed by TUNEL method (Figure 1). Apoptotic TUNEL-positive cells, indicated by purple or deep blue dots, were markedly observed in the median lobes of non-transfected livers, concomitantly with the nuclear condensation in the vicinity of the portal vein (Figure 1Ab). In contrast, in the median lobes of bcl-2transfected livers and the caudal lobes of non- and bcl-2transfected livers, TUNEL-positive cells were scarcely observed (Figures 1Aa, c and d). The I/R-induced DNA strand cleavage 3’-OH terminals, indicative of a symptom for apoptotic cells, were also detected by histogram analysis (Figure 1Bb). Apoptotic cells were observed to be significantly diminished in the median lobes of bcl-2transfected livers, and were not detected by histogram analysis (Figure 1Bd). Thus, exogenously transfected bcl2 is suggested to markedly prevent I/R-induced cellular DNA strand cleavages.

H. Detection of the activation of NF-!B: Electrophoretic mobility shift assay Nuclear protein extraction was performed as described previously (Yang et al, 1995). Electrophoretic mobility shift assay (EMSA) was performed with specific gel-shift assay system of NF-!B (Promega, Madison, WI). The double-stranded oligonucleotide probe containing the specific wild-type DNA binding domain for NF-!B was as follows: 5’-TTTCTAGGGACTTTCCGCCTGGGGACTTTCCAG-

B. Expression of Bcl-2 in Rat-1 cells, SV2or bcl-2-transfectants To investigate the relationship between endogenous NF-!B and exogenous hBcl-2 after stimulation of ROS,

271

Yanada et al: Exogenous Bcl-2 inhibition through delayed activation of NF-!B we made bcl-2-transfectants, and analyzed Bcl-2 expression without ROS stimulation by western blotting (Figure 2). Bcl-2 expression in bcl-2-transfectants was markedly overexpressed when compared to their nontransfected and SV2-transfected Rat-1 cells. In addition, when compared to expression of Bcl-2 stable expressed cell line, b5 cells, it was confirmed that the Bcl-2 expression level of our picked up-bcl-2 transfectants was similar to that of b5 cells (data not shown).

cells were exposed to the indicated concentrations of H2O2 (0–250 $M) for 2 hr. After the indicated exposure time, cells were incubated for 24 hr in fresh medium, and then were assessed for the cell viability by WST-1 assay.

Treatment with H2O2 for 2 hr decreased the cell viability of both the parent and bcl-2-transfected cells in a dosedependent manner (Figure 3). Cell viability of bcl-2transfected cells was more markedly retained than that of the parent Rat-1 or SV2-transfected cells against H2O2 induced injuries, and was slightly increased than the initiate level at 100 and 125 $M of H2O2.

C. Protective effect of bcl-2 genes against H2O2–induced cell death in Rat-1, SV2- or bcl2- transfectants To examine the role of bcl-2 genes in the cytotoxic response to H2O2, Rat-1 and SV2- and bcl-2- transfected

Figure 1. Cellular DNA cleavages in paraffin-embedded tissue sections of non-transfected and bcl-2-transfected livers after postischemic reperfusion (I/R) as assayed by TUNEL method (A). The sections of the caudal (non-ischemia; a, c) and median lobes (ischemia treatment; b, d) of the I/R-receiving rat livers were prepared at 150 min after the beginning of reperfusion, and were evaluated for non-transfected rats (a, b), and bcl-2-transfected rats (c, d) by TUNEL assays. Sections were examined under a confocal fluorescence microscope at a 100-fold magnification, and expressed in pseudo-color from red (scarcely stained) via yellow (weakly stained) to purple (most strongly stained) by processing of fluorescence intensity with an NIH-Image software for evaluation of the degree of DNA 3’-OH cleavage terminals as an indicator for apoptosis. The scale indicates 50 $m. To detect I/R-induced DNA strand cleavages, images were analyzed to be expressed in histograms (B). All data shown are typical of 3-4 sheets of micro-slices per each examined groups that showed the same staining degree among three independent experiments.

Figure 2. Expression of exogenous human Bcl-2 in wild type (Rat-1 cells; WT), SV2- and bcl-2- transfected cells. After establishment of transfectants, each cell population was analyzed for expression of Bcl-2 without oxidative stimulation by western blotting using an anti-hBcl-2 antibody.

272

Gene Therapy and Molecular Biology Vol 10, page 273

Figure 3. Dependences of cell viability of Rat-1, SV2- and bcl-2-transfected cells on treatment with H2O2. At 24 hr after stimulation of different H2O 2 concentration (0-250 $M), cell viability in each cell population was evaluated by mitochondrial dehydrogenase-based WST-1 assay. And microscopic views of SV2- and bcl-2-transfected cells with treatment of H 2O2 (0, 100 and 125 $M) show together.

The scale in the image indicates 50 $m.

bcl-2-transfectants was markedly occurred than that in SV2-transfectants (Figure 4). These results suggest that Bcl-2 affected intracellular activation of NF-!B at an initiate period after stimulation of H2O2. And to visualize the expression and intracellular distribution of NF-!B under stimulation of H2O2, immunocytochemical analysis using polyclonal antibody which recognized a p65 subunit of NF-!B was performed. At 15 and 30 min after the stimulation, intracellular activation of NF-!B was appreciably detected in SV2-transfectants, but weakly observed in bcl-2-transfectants. At 90 min after the stimulation, in both SV2-transfectant and bcl-2transfectant, translocation of NF-!B into the nucleus was observed (Figure 4), showing the consistence with results of EMSA.

D. Bcl-2 affects intracellular activation of NF-!B at initiate period after stimulation of H2 O2 To elucidate the cytoprotective mechanism of Bcl-2, we examined whether activations of NF-!B in non- or bcl2-transfectants would be occurred when both cells were exposed to 100 $M of H2O2. The intracellular activation of NF-!B in SV2- and bcl-2-transfectants was analyzed at 0120 min by EMSA system. In SV2-transfectants, intracellular activations of NF-!B were rapidly and strongly occurred at 30 min, but, in bcl-2-transfectants, were detected weakly at 0 and 30 min (Figure 4).

However, at 90 and 120 min after stimulation, intracellular activation of NF-!B was strongly detected in both cells (Figure 4). Moreover, interestingly, NF-!B activation in 273

Yanada et al: Exogenous Bcl-2 inhibition through delayed activation of NF-!B Figure 4. Time course analysis of DNA binding activities of NF-!B in SV2- and bcl-2-transfected cells by electrophoretic mobility shift assay (EMSA) after stimulation of H2O 2. The cells were treated with H2O2 at 100 $M for 2 hr. The intracellular activation of NF-!B in SV2- and bcl-2-transfectants was analyzed at 0-120 min. Nuclear protein extraction of each cell was analyzed at different time after stimulation of H2O 2 by EMSA using specific gel-shift assay system.

stimulation of H2O2, which is known at higher doses to lower the electric potential at the mitochondrial membrane through a depolarization effect. Recently, it has been reported by our laboratory that treatment with H2O2 of lower concentrations enhances the maximum cell population doubling level of human skin keratinocytes together with slow-down of age-dependent shortening of telomeric DNA (Yokoo et al, 2004), suggesting a trace H2O2-induced benefit effects such as telomere protection and enhanced bcl-2 expression in common through a feeble oxidant-induced bottom-up effect on the emergent antioxidant ability.

And exogenous Bcl-2 repressed intracellular activation of NF-!B at an initial period after stimulation of H2O2, although activation of NF-!B was occurred in SV2transfectant (Figure 4). Activation of NF-!B has been reduced under the existence of in the presence of the intracellular antioxidant in Rat-1 cells after stimulation of ROS as previously reported (Nagao et al, 2000).

Additionally, we have previously detected intracellular ROS accumulation in Rat-1 cells when the cells were exposed to the alkyl hydroperoxide t-BuOOH or operated with hypoxia-reoxygeneration which occurred accumulation of ROS such as H2O2 resulting in cell death (Saitoh et al, 2003b). At this time, in b5 cells (bcl-2-stable transfectants), intracellular accumulation of ascorbic acid was enhanced than in the parental cells, Rat-1, suggesting that intracelluar anti-oxidants may be indirectly related with overexpression of bcl-2 (Saitoh et al, 2003a) assumedly owing to lowering of demand for scavenging of cell-death-derived secondarily generated extra ROS. Moreover, at 90 and 120 min after stimulation of H2O2, although activation of NF-!B was detected in both bcl-2and SV2-transfetants, the activation in bcl-2-transfectants remarkably increased than that of SV2-transfectants in particular (Figure 5). High constitutive DNA binding and transcriptional activities of NF-!B were observed in rat pheochromocytoma PC12 cells overexpressing bcl-2 gene after stimulation of H2O2 (Jang et al, 2004), which mostly supports our results in spite of difference in cell lines.

IV. Discussion In the present study, exogenous Bcl-2 prevented I/Rinduced apoptosis in rat livers. And our prepared-bcl-2transfectants have the preventive effect against cell injuries induced with 50 -250 $M of H2O2. Additionally, the in vitro examination in bcl-2-transfectants by immunocytochemical analysis and EMSA showed that Bcl-2 repressed intracellular activation of NF-!B at an initiate period after stimulation of H2O2, although NF-!B activation was quickly and strongly occurred in SV2transfectants. And at 90 and 120 min after stimulation, NF-!B activation in bcl-2-transfectants were more remarkably detected than that in SV2-transfectants, suggesting that the transient repressive effect of exogenous Bcl-2 on an early NF-!B activation might be attributed to the avoidance from the subsequent destiny to oxidative injuries.

We showed using TUNEL method with histogram analysis that exogenous Bcl-2 has the in vivo preventive potential against I/R injury (Figure 1). In our previous study, it has firstly reported that inhibitory effect of Bcl-2 in combination with the Bcl-2-associated athanogene 1 protein, BAG-1 can be evaluated by the same method (Yanada et al, 2005). These results suggest histogram analysis with by the same method can easily and usefully quantify I/R-induced apoptosis. Furthermore, it suggests that transfection by Bcl-2 alone is a useful strategy for gene therapy against I/R injury.

Regarding the in vitro examination to investigate the relation between Bcl-2 and NF-!B, we took a notice of H2O2 as an ROS stimulant, which is known to less difficultly penetrate through the living membrane and be generated when the cells are exposed to oxidative stress such as I/R. The cytoprotective effect of exogenous Bcl-2 against H2O2-induced injuries was obtained, and accentuated for H2O2 as low as 100 and 125 $M, as shown by the hormesis-like enhancement in cell viability of bcl2-transfectants over the initiate level (Figure 3). It seems that this increase depends on the increase in viable cells with activity of mitochondrial dehydrogenase by the

274

Gene Therapy and Molecular Biology Vol 10, page 275

Figure 5. Immunocytochemical analysis of the transcriptional factor NF-!B in SV2- and bcl-2-transfected cells after stimulation with H2O2. The intracellular activation of NF-!B in SV2- and bcl-2-transfectants was analyzed at 0, 15, 30 and 90 min after 2 hr treatment with H2O 2 at 100 $M. The slides were examined on a confocal laser scanning fluorescence microscope ([MRS-600 Cosmos] equipped with an argon laser as the light source), and expressed in pseudo-color similarly as in Fig. 1. The scale indicates 50 $m. Data shown are typical of 3-4 sheets of micro-slices per each group that showed the similar staining degree among three independent experiments.

These results suggest the possibility that constitutive activation of redox-sensitive transcription factor NF-!B acts as survival signal in bcl-2-overexpressing cells.

Currently, NF-!B has been attempted as a target of gene therapy in several diseases such as nephritis, liver failure and glioblastomas (Tomita et al, 2000; Robe et al, 2004; Higuchi et al, 2006). On the other hand, an experimental gene therapy using mitochondrial superoxide dismutase gene is reported to significantly reduce acute liver damage and be associated with redox activation of NF-!B, suggesting a benefit effect against oxidative stress-induced hepatic injuries (Zwacka et al, 1998). We have demonstrated the possibility of gene therapy against oxidative stress-induced injuries using Bcl-2 as a putative function as an antioxidant, which prevents apoptosis by controlling ROS through increase of intracellular antioxidant (Yanada et al, 2004 and 2005). And in the present study, showed that transfection of bcl-2 repressed intracellular activation of NF-!B at an initiate period after stimulation of H2O2, resultantly H2O2 induced-cell death was inhibited. Taken together, exogenous Bcl-2 may be able to control indirectly the transcription factor NF-!B, because Bcl-2 acts as a multiplier or consumption-saver for intracellular antioxidants. Thus, it is possible that an in vivo transfection of bcl-2 is useful as one of some strategies for gene therapy against oxidative stress-induced injury together with gene therapy using mitochondrial superoxide dismutase gene, which controls the intracellular redox state after stimulation of oxidative stress.

Acknowledgments The authors thank Dr. Rika Ouchida and Dr. Norio Nagao of Prefectural University of Hiroshima, for their technical assistance and encouragement. The present study was supported in part by a Grant-in-Aid for Exploratory Research from the Ministry of Education, Science and Culture of Japan to N.M.

References Akao Y, Otsuki Y, Kataoka S, Ito Y, Tsujimoto Y (1994) Multiple subcellular localization of bcl-2: detection in nuclear outer membrane, endoplasmic reticulum membrane, and mitochondrial membranes. Cancer Res 54, 2468-2471.

Baeuerle PA and Baltimore D (1996) NF-!B: ten years after.

Cell 87, 13-20.

Baeuerle PA and Henkel T (1994) Function and activation of NF-!B in the immune system. Annu Rev Immunol 12, 141179.

Eguchi M, Miyazaki T, Masatsuji-Kato E, Tsuzuki T, Oribe T, Miwa N (2003) Cytoprotection against ischemia-induced DNA cleavages and cell injuries in the rat liver by provitamin C via hydrolytic conversion into ascorbate. Mol Cell Biochem 252, 17-23.

Gross A, Mcdonnell JM, Korsmeyer SJ (1999) BCL-2 family members and the mitochondria in apoptosis. Genes Dev 13, 1899â&#x20AC;&#x201C;1911.

Higuchi Y, Kawakami S, Oka M, Yamashita F, Hashida M (2006) Suppression of TNF! production in LPS induced liver failure in mice after intravenous injection of cationic liposomes/NF!B decoy complex. Pharmazie 61,144-147.

Hockenbery D, Nunez G, Milliman C, Schreiber RD, Korsmeyer SJ (1990) Bcl-2 is an inner mitochondrial membrane protein that blocks programmed cell death. Nature 348, 334-336.

275

Yanada et al: Exogenous Bcl-2 inhibition through delayed activation of NF-!B Hockenbery DM, Oltvai ZN, Yin XM, Milliman CL, Korsmeyer SJ (1993) Bcl-2 functions in an antioxidant pathway to prevent apoptosis. Cell 75, 241-251.

Jang JH and Surh YJ (2003) Potentiation of cellular antioxidant capacity by Bcl-2: implications for its antiapoptotic function.

Biochem Pharmacol 66, 1371-1379.

Jang JH and Surh YJ (2004) Bcl-2 attenuation of oxidative cell death is associated with up-regulation of gammaglutamylcysteine ligase via constitutive NF-!B activation. J Biol Chem 279, 8779-8786.

Nagao N, Etoh T, Yamaoka S, Okamoto T, Miwa N (2000) Enhanced invasion of Tax-expressing fibroblasts into the basement membrane is repressed by phosphorylated ascorbate with simultaneous decreases in intracellular oxidative stress and NF-!B activation. Antioxid Redox Signal 2, 727-738.

Oltvai ZN, Milliman CL, Korsmeyer SJ (1993) Bcl-2 heterodimerizes in vivo with a conserved homolog, Bax, that accelerates programmed cell death. Cell 74, 609-619.

Paker BA and Stark GR (1979) Regulation of simian virus 40 transcription: sensitive analysis of the RNA species present early in infections by virus or viral DNA. J Virol 31, 360369.

Reed JC (1994) Bcl-2 and the regulation of programmed cell death. J Cell Biol 124, 1–6.

Robe PA, Bentires-Alj M, Bonif M, Rogister B, Deprez M, Haddada H, Khac MT, Jolois O, Erkmen K, Merville MP, Black PM, Bours V (2004) In vitro and in vivo activity of the nuclear factor-!B inhibitor sulfasalazine in human glioblastomas. Clin Cancer Res 10, 5595-5603.

Saeki Y, Matsumoto N, Nakano Y, Mori M, Awai K, Kaneda Y (1997) Development and characterization of cationic liposomes conjugated with HVJ (Sendai virus): reciprocal effect of cationic lipid for in vitro and in vivo gene transfer.

Hum Gene Ther 8, 2133-2141.

Saitoh Y, Ouchida R, Miwa N (2003a) Bcl-2 prevents hypoxia/reoxygenation-induced cell death through suppressed generation of reactive oxygen species and upregulation of Bcl-2 proteins. J Cell Biochem 90, 914-924.

Saitoh Y, Ouchida R, Kayasuga A, Miwa N (2003b) Antiapoptotic defense of bcl-2 gene against hydroperoxideinduced cytotoxicity together with suppressed lipid peroxidation, enhanced ascorbate uptake, and upregulated Bcl-2 protein. J Cell. Biochem 89, 321–334.

Shimizu S, Eguchi Y, Kamiike W, Funahashi Y, Mignon A, Lacronique V, Matsuda H, Tsujimoto Y (1998) Bcl-2 prevents apoptotic mitochondrial dysfunction by regulating proton flux. Proc Natl Acad Sci USA 95, 1455-1459.

Tomita N, Morishita R, Tomita S, Gibbons GH, Zhang L, Horiuchi M, Kaneda Y, Higaki J, Ogihara T, Dzau VJ (2000) Transcription factor decoy for NF!B inhibits TNF-&-induced

cytokine and adhesion molecule expression in vivo. Gene Ther 7, 1326-32.

Topp WC (1981) Normal rat cell lines deficient in nuclear thymidine kinase. Virology 113, 408 -411.

Tsuboniwa N, Morishita R, Hirano T, Fujimoto J, Furukawa S, Kikumori M, Okuyama A, Kaneda Y (2001) Safety evaluation of hemagglutinating virus of Japan-artificial viral envelope liposomes in nonhuman primates. Hum Gene Ther 12, 469-487.

Tsujimoto Y (1989) Overexpression of the human BCL-2 gene product results in growth enhancement of Epstein-Barr virusimmortalized B cells. Proc Natl Acad Sci 86, 1958-1962.

Tsujimoto Y (2003) Cell death regulation by the Bcl-2 protein family in the mitochondria. J Cell Physiol 195, 158-167.

Vaux DL, Cory S, Adams JM (1988) Bcl-2 gene promotes haemopoietic cell survival and cooperates with c-myc to immortalize pre-B cells. Nature 335, 440–442.

Voehringer DW and Meyn RE (2000) Redox aspects of Bcl-2 function. Antioxid Redox Signal 2, 537-550.

Wang T, Zhang X, Li JJ (2002) The role of NF-!B in the regulation of cell stress responses. Int Immunopharmacol 2, 1509-1520.

Yanada S, Saitoh Y, Kaneda Y, Miwa N (2004) Cytoprotection by bcl-2 Gene Transfer against Ischemic Liver Injuries Together with Repressed Lipid Peroxidation and Increased Ascorbic Acid in Livers and Serum. J Cell Biochem 93, 857-870.

Yanada S, Sasaki M, Takayama S, Kaneda Y, Miwa N (2005) Hemagglutinating virus of Japan-artificial viral envelope liposome-mediated cotransfer of bag-1 and bcl-2 genes protects hepatic cells against ischemic injury through BAG1-assisted preferential enhancement of bcl-2 protein expression. Hum Gene Ther 16, 627-633.

Yang J, Liu X, Bhalla K, Kim CN, Ibrado AM, Cai J, Peng TI, Jones DP, Wang X (1997) Prevention of apoptosis by Bcl-2: Release of cytochrome c from mitochondria blocked.

Science 275, 1129-1132.

Yang JP, Merin JP, Nakano T, Kato T, Kitade Y, Okamoto T (1995) Inhibition of the DNA-binding activity of NF-!B by gold compounds in vitro. FEBS Lett 361, 89-96.

Yokoo S, Furumoto K, Hiyama E, Miwa N (2004) Slow-down of age-dependent telomere shortening is executed in human skin keratinocytes by hormesis-like-effects of trace hydrogen peroxide or by anti-oxidative effects of pro-vitamin C in common concurrently with reduction of intracellular oxidative stress. J Cell Biochem 93, 588-597.

Zwacka RM, Zhou W, Zhang Y, Darby CJ, Dudus L, Halldorson J, Oberley L, Engelhardt JF (1998) Redox gene therapy for ischemia/reperfusion injury of the liver reduces AP1 and NF!B activation. Nat Med 4, 698-704.

276