Volume 7 Number 1 June 2009
Instructions to Authors Cancer Therapy OPEN ACCESS
http://cancer-therapy.org
Scope This journal, bridging various fields is one of the most rapid with free access at www.cancer-therapy.org. The scope of Cancer Therapy is to rapidly publish original and in-depth review articles on cancer embracing all fields from molecular mechanisms to results on clinical trials. Articles (both invited and submitted) review or report novel findings of importance to a general audience in cancer therapy, molecular medicine, gene discovery, and molecular biology with emphasis to molecular mechanisms and clinical applications. The journal will accept papers on all aspects of cancer, at the clinical, preclinical or cell culture stage on chemotherapy and new experimental drugs, gene discovery, cancer immunotherapy, DNA vaccines, use of DNA regulatory elements in gene transfer, cell therapy and drug discovery related to cancer therapy. The authors are encouraged to elaborate on the molecular mechanisms that govern a cancer therapy approach. To make the publication attractive, authors are encouraged to include color figures. Type of articles Both review articles and original research articles will be considered. Original research articles should contain a generous introduction in addition to experimental data. The articles contain information important to a general audience as the volume is addressed also to researches outside the field. There is no limit on the length of the articles provided that the subject is interesting to a general audience and covers exhaustively a field. The typical length of each manuscript is 12-60 manuscript pages (approximately 4-20 printed pages) plus Figures and Tables. Free of Charge publication, Complimentary reprints & Subscriptions There are no page charges, no fees for color reproduction, and furthermore, authors receive 25 free reprints, a hard-bound issue containing their article, and an electronic format of their article that they can use in their personal website or to distribute freely to colleagues. Authors are also entitled to use Figures from their work originally published in Cancer Therapy in review articles for other journals by simply citing the original source. Sections of the manuscript Each manuscript should have a Title, Authors, Affiliation, Corresponding Author (with Tel, Fax, and E-mail), Summary, and Introduction; review articles are subdivided into headings I, II, III, etc. (starting with I. Introduction) and subdivided into A, B, C, etc. You can further subdivide into 1, 2, 3, etc. Research articles are divided into Summary; I. Introduction; II. Materials and Methods; III. Results IV Discussion, Acknowledgments and References. Please include in your text citations the name of authors and year in parenthesis; for three or more authors use: (name of first author et al, with year); for two authors please use both names. Please delete hidden text for references. In the reference list, please, type
references with year and Journal in boldface and provide full title of the article such as: Buschle M, Schmidt W, Berger M, Schaffner G, Kurzbauer R, Killisch I, Tiedemann J-K, Trska B, Kirlappos H, Mechtler K, Schilcher F, Gabler C, and Birnstiel ML (1998) Chemically defined, cell-free cancer vaccines: use of tumor antigen-derived peptides or polyepitope proteins for vaccination. Gene Ther Mol Biol 1, 309-321. Please use Microsoft Word, font “Times” (Mac users) or “Times New Roman” (PC users) and insert Greek or other characters using the “Insert/Symbol” function in the Microsoft Word rather than simple conversion to font “Symbol”. Please boldface Figure 1, 2, 3 etc. as well as Table 1, 2, etc. throughout the text. Please provide the highest quality of prints of your Figures; whenever possible, please provide in addition an electronic version of your figures (optional). Corresponding authors are kindly requested to provide a color (or black/white) head photo (preferably 4x5 cm or any size), or a group photo of the authors, as we shall include these in the publication. Submission and reviewing Peer reviewing is by members of the Editorial Board and external referees. Please suggest 2-3 reviewers providing their electronic addresses, mailing addresses and telephone/fax numbers. Authors are being sent page proofs. Cancer Therapy (Volume 1, 2003) is published on high quality paper with excellent reproduction of color figures and electronically.
Reviewing is completed within 2-3 weeks from receiving the manuscript. Articles accepted without revisions (i.e., review articles) will be published online (www.cancer-therapy.org) in approximately 1 month following submission. Please submit an electronic version of full text and figures preferably in jpeg format. The electronic version of the figures will be used for the rapid reviewing process. High quality prints or photograph of the figures and the original with one copy should be sent via express mail to the Editorial Office.
Editorial Office Gene Therapy& Molecular Biology Cancer Therapy Teni Boulikas, Ph.D. Gregoriou Afxentiou 7 Alimos, Athens 17455 Greece Tel: +30-210-985-8454 Fax: +30-210-985-8453 And electronically to Editor Assistants: Maria Koutoudi, B.A. , M.A. Email: maria.koutoudi@cancer-therapy.org
Soma Lotfollahi, B.Sc. Email: soma@cancer-therapy.org Dina Genti, B.Sc. Email: dina.genti@cancer-therapy.org Editor Assistants Afxentiou 7 Alimos, Athens 17455 Greece Tel: +30-210-9858-454 Fax: +30-210-9858-453 Email: maria.koutoudi@cancer-therapy.org
The open electronic access to articles published in "Cancer Therapy" to a big general audience, the attractive journal title, the speed of the reviewing process, the no-charges for page numbers or color figure reproduction, the 25 complimentary reprints, the rapid electronic publication, the embracing of many fields in cancer, the anticipated high quality in depth reviews and first rate research articles and most important, the eminent members of the Editorial Board assembled are prognostic factors of a big success for the newly established journal Citation in MedLine If you have NIH funded research program your full article published in Gene Therapy & Molecular Biology or Cancer Therapy will appear on PubMed as full article freely accessible.
Articles accepted for publication by Cancer Therapy can be included in MedLine (PubMed) as full articles upon the request of authors provided that the authors have completed their published work under a government grant by NIH (or EU/Japan government grant). If this is your case, please consult the NIH Manuscript Submission System http://www.nihms.nih.gov/. Cancer Therapy and Gene Therapy & Molecular Biology are Abstracted & Indexed in: Chemical Abstracts, Directory of Open Access Journals (DOAJ), Open J-Gate, HEAL-Link, Genamics, British Library Direct, Index Copernicus, Hinari Access to Research Initiative, PubMed Central (under consideration), Elsevier Bibliographic databases: Scopus and Embase, EBSCO Host (Academic SearchTM Complete) / PubsHub / ExLibris. Gene Therapy & Molecular Biology that is included in Gene Therapy Net is also Abstracted & Indexed in: Thompson Scientific Furthermore, they are listed and electronically searchable in many libraries, institutes and universities worldwide, such as Karolinska Institute, Max Planck Institute, Geneva Foundation for Medical Education and Research, National Research Council of Canada, San Jose Public Libraries, California Digital Library, German Electronic Journals Library, Memorial University, Stanford University, Columbia University, University of Oslo, Kun Shan University (Taiwan), Charles Sturt University (Australia), OhioLink Library, Berkley Library and many more.
Cancer Therapy is acknowledged by the National Library of Medicine http://www.ncbi.nlm.nih.gov/sites/entrez?db=PubMed search field: Cancer Ther search: journals http://www.ncbi.nlm.nih.gov/sites/entrez?Db=nlmcatalog&doptcmdl=Expanded&cmd=search&Term=101174596[NlmId]
Table of contents Cancer Therapy Vol 7 Number 1, June 2009 1-6
Case Report
Complete clinical response of a metastatic cancer patient treated with the combination of lapatinib and gemcitabine: first reported activity of the combination
Joan Manel Gasent Blesa, Juan Laforga Canales, Vicente Alberola Candel
7-20
Review Article
Contemporary management of thyroid carcinoma
Eric M. Genden, Elise Brett
21-26
Case Report
Splenic marginal B-cell lymphoma with epithelioid granulomas. Report of a case with cytologic and immunohistochemical study
Juan B. Laforga, F. Ignacio Aranda, Joan M. Gasent
27-30
Research Article
Size over 20mm is an independent risk factor of endoscopic mucosa resection (EMR) for colorectal lateral spread tumor (LST): A prospective study and multivariate analysis
Hei-Ying Jin, Kunlan Wu, Hui Ye, Yong Zhu, Jinhao Zhang, Yijiang Ding
31-34
Case Report
Pseudomixoma peritonei: a case report
Raffaele Lanteri, Marco Santangelo, Cristian Rapisarda, Agostino Racalbuto, Antonio Di Cataldo, Antonio Licata
35-42
Research Article
Phage L5 integrating vectors are present within the Mycobacterial Cell in an equilibrium between integrated and excised states
Beatrice Saviola
43-48
Research Article
Expression of DcR3 in bone and soft tissue tumors
Masaya Imabori, Toshihiro Akisue, Kenta Kishimoto, Hitomi Hara, Shinichiro Kishimoto, Yoshiyuki Okada, Naomasa Fukase, Shinya Hayashi, Teruya Kawamoto, Masahiro Kurosaka
49-52
Research Article
Analysis of bone marrow plasma cells in patients with solitary bone plasmacytoma
Archana Bhaskar, Ritu Gupta, Atul Sharma, Lalit Kumar, Paresh Jain
53-58
Research Article
The study of possible cytogenetic activity of spironolactone
Armen Nersesyan, Anahit Martirosyan, Rafael Muradyan, Gayane Zalinyan
59-62
Review Article
The history and future of canine lymphoma monoclonal antibody 231
K. Ann Jeglum
63-70
Research Article
Long term follow-up of Thalidomide plus Interleukin-2 based therapy in metastatic renal cell cancer patients
Robert J. Amato, Muhammad Khan, Somyata Saxena
71-76
Case Report
Mucormycosis in children with acute lymphoblastic leukemia: report of 5 cases
Taha Khattab, Ayad Atra, Sami Felimban, Hneef Kamal, Abimbola Osoba
77-96
Research Article
Cardiac myxoma: molecular markers, critical disease pathways, drug targets, and putative targeting miRs
Debmalya Barh, Sanjeeb Parida
97-102
Case Report
Repeated Therapeutic Embolization with Systemic Chemotherapy for Hepatic Metastases from !Fetoprotein-producing Gastric Cancer
103-108
Research Article
Desmoid tumours therapeutic approach in relation to pathogenesis
Fernando Brivio, Luca Fumagalli, Paolo Lissoni, Franco Rovelli, Marco Colzani, Marianna Denova
109-112
Case Report
Follicular lymphoma resembling with Hyaline-vascular type of Castleman’s disease. The morphological and immunohistochemical findings of two cases
Masaru Kojima, Shinji Sakurai, Atsushi Isoda, Norihumi Tsukamoto, Nobuhide Masawa, Naoya Nakamura
113-118
Research Article
Weekly gemcitabine and cisplatin in concurrence with pelvic radiation in the primary therapy of cervical cancer: a phase I/II study in Thai women
Bandit Chumworathayi, Jeerichuda Pattamadilok, Vorachai Tangvorapongchai, Srichai Krusun, Montien Pesee, Chunsri Supaadirek
119-122
Case Report
Leiomyosarcoma of the inferior cava Giovanni Li Destri, Rosalia Latino, Raffaele vein : case report Lanteri, Francesca
Ji-Hyun Ju, Won Sup Lee, Myung Hee Kang, Seok Hyun Kim, Hoon Gu Kim, Dong Chul Kim, Tae-Beom Shin, Kyungsoo Bae
Brancato, Marco Santangelo, PierFrancesco Veroux, Antonio Di Cataldo 123-132
Research Article
Paclitaxel inhibits radiation induced VEGF secretion and enhances radiosensitizing effects in human colon cancer cell HT29
133-140
Research Article
Relation of age with myelosuppression induced by the CHOP regimen in patients with Non-Hodgkin’s Lymphoma
Fumiaki Kitazawa, Toshio Abe, Kumi Ueda, Satoshi Murakami, Kohshi Nishiguchi, Kohji Takara, Teruyoshi, Yokoyama, Hikofumi Sugii
141-148
Research Article
Cell-selective mitochondrial targeting: A new approach for cancer therapy
Bhuvaneshwar Vaidya, Rishi Paliwal, Shivani Rai, Kapil Khatri, Amit K. Goyal, Neeraj Mishra, Suresh P Vyas
149-152
Research Article
153-162
Research Article
163-173
Review Article
174-187
Research Article
Yuji Toiyama, Yasuhiro Inoue, Junichiro Hiro, Eiki Ojima, Hideki Watanabe, Youhei Narita, Masato Okigami, Atuko Hosono, Chikao Miki, Masato Kusunoki
Cognitive and emotive state in elderly treatment-naĂŻve patients with advanced cancer compared with an elderly healthy control population
Fable Zustovich, Malihe Shams, Pasquale Anselmi, Giuseppe Lombardi, Davide Pastorelli, Giuseppe Cartei
Ixabepilone, a new class of chemotherapy for advanced breast cancer
Frances M. Palmieri, Una Hopkins
New approaches in treatment of Bcell chronic lymphocytic leukemia
Meat consumption and cancer risk: a multisite case-control study in Uruguay
Mariusz Stram, Jacek Tabarkiewicz, Iwona Hus, Jacek Roli!ski
Dagfinn Aune, Alvaro Ronco, Paolo Boffetta, Hugo Deneo-Pellegrini, Enrique Barrios. Giselle Acosta, Maria Mendilaharsu, Eduardo De
Stefani
188-199
Review Article
200-214
Review Article
215-218
Review Article
Treatment options for metastatic melanoma. A systematic review
Considering SRC-ABL as a promising therapeutic target in cancer
Fulvestrant activity in the treatment of metastatic prostate cancer
219-226
Review Article
PML: An emerging tumor suppressor and a target with therapeutic potential
227-233
Review Article
Adjuvant chemotherapy should be used as the standard of care for resectable pancreatic cancer
234-239
Review Article
Schnitzler´s syndrome – complete resolution of symptoms on treatment with anakinra after 12 years of unsuccessful therapy with other regimens
245-250
Review Article
Lymph node retrieval and assessment in colorectal cancer
240-244
Research Article
Partial Hepatectomy in rats results in significant growth of liver metastases by increased expression of H19 gene
Joan Manel Gasent Blesa, Enrique Grande Pulido, Mariano Provencio Pulla, Vicente Alberola Candel
Joan Manel Gasent Blesa, Mariano Provencio Pulla, Vicente Alberola Candel
Joan Manel Gasent Blesa, Vicente Alberola Candel, Enrique Grande Pulido, Mariano Provencio Pulla, Oscar Juan Vidal Erin L. Reineke, HungYing Kao
Sousana Amptoulach, Evangelos Kalaitzakis, Faisal Azam Zden"k Adam, Lud"k Pour L, Marta Krej#i1, Ji$í Neubauer J, Ji$í Prá%ek, Tomá% Büchler, Roman Hájek
Vijaya V. Mysorekar
Vladimir Sorin, Aya Mizrahi, Patricia Ohana, Suhail Ayesh, Tatiana Birman, Abraham Hochberg, Abraham Czerniak
251-253
Review Article
Surgical resection of primary malignant adenocarcinoma of trachea in a 60-year-old man
254-267,
Review Article
Chemokine signaling in cancer: Implications on the tumor microenvironment and therapeutic targeting
268-276
Review Article
Stress sensor Gadd45 genes as therapeutic targets in cancer
Antonio Giovanni Petino, Rosaria Pavia, Francesco Tornambene, Raffaele Lanteri, Filippo Fragetta, Maurizio Nicolosi Stacey L. Hembruff, Nikki Cheng
Alexandra Cretu, Xiojen Sha, Jennifer Tront, Barbara Hoffman, Dan A Liebermann
Cancer Therapy Vol 7, page 1 Cancer Therapy Vol 7, 1-6, 2009
Complete clinical response of a metastatic cancer patient treated with the combination of lapatinib and gemcitabine: first reported activity of the combination Case Report
Joan Manel Gasent Blesa1,*, Juan Laforga Canales2, Vicente Alberola Candel3 Hospital de Dènia Marina Salud, Partida de Beniadlà, s/n. Denia 03700, Alacant, Spain Hospital General Universitari Marina Alta, Dènia, Alacant, Spain 3 Hospital Universitari Arnau de Vilanova, València, Spain 1 2
__________________________________________________________________________________ *Correspondence: Joan Manel Gasent Blesa MD PhD, Hospital de Dènia Marina Salud, Partida de Beniadlà, s/n. Denia. 03700, Alacant, Spain; Tel: +34 606311233; e-mail: joanmagasent@telefonica.net Key words: metastatic cancer, lapatinib, gemcitabine Abbreviations: computed tomography, (CT); epidermal growth factor receptor 1, (EGFR); epidermal growth factor receptor 2, (ErbB2); estrogen and progesterone receptors, (ER-PR); Magnetic Resonance, (MRI) Received: 27 October 2008; Revised: 28 November 2008 Accepted: 1 December 2008; electronically published: January 2009
Summary Treatment of metastatic breast cancer is challenging. We have recently assisted to the development of targeted therapies, in combination with chemotherapy or in monotherapy, that have improved results for selected groups of patients. Lapatininb is a dual tyrosine kinase inhibitory drug that has shown its efficacy. Consequently its use has been approved for the treatment of Her2neu positive breast cancer in combination with capecitabine. Here we present a case of complete clinical response to the combination of Lapatinib and GemcitabineThis is, to our knowledge, the first reported patient, treated with this combination.
kinase domain and results in autophosphorylation and initiation of divergent signal transduction cascades (Moyer et al, 1997). Whereas ErbB-2 is generally thought to be orphaned from a high-affinity ligand, it participates in signaling by heterodimerization with ligand-bound members of the type I receptor family. EGFR and ErbB-2 are known to signal through the Ras pathway, stimulating cell division (Ciardiello et al, 2000) and through the PI3K pathway, resulting in cell growth and survival (Krasilnikov, 2000). Because these effects on cell growth and survival are dependent on the catalytic activity of EGFR and ErbB-2, it is believed that inhibition of this activity could provide a therapeutic opportunity for patients with tumors expressing elevated levels of EGFR and ErbB-2. Lapatinib is a small-molecule competitive tyrosine kinase inhibitor that binds reversibly with the cytoplasmic ATP-binding site in the kinase domains of EGFR and HER2, thereby inhibiting receptor phosphorylation (ie, activation) (Rusnak et al, 2001). Lapatinib induces growth
I. Introduction Metastatic breast cancer ultimately develops in 35% to 40% of all patients with breast cancer. Anthracyclines and taxanes are increasingly being used as adjuvant treatment in the early course of the disease, and are the basis for the treatment of metastatic disease. There is a pressing need for novel therapy including combination therapy in this setting of resistance to, or disease progression after anthracycline and taxane therapy, and also for alternatives to anthracyclines. The epidermal growth factor receptor 1 (EGFR) and 2 (ErbB-2) are members of the type I receptor tyrosine kinase family and have been converted in targets for cancer therapy because of their overexpression in a variety of neoplastic tissues (Krasilnikov, 2000). With the exception of ErbB-3, which acts as a noncatalytic partner to other erbB family members, the type I receptors have functional tyrosine kinase catalytic domains. When ligand bind to type I receptors, dimerization occurs. This causes a conformational change in the receptor that activates the 1
Blesa et al: Complete clinical response of a metastatic cancer patient treated with lapatinib & gemcitabine arrest and/or apoptosis in EGFR and ErbB-2 dependent tumor cell lines. The marked inhibition of EGFR1 and ErbB-2, results in inhibition of MAPK and AKT. In fact, experimental evidence suggests that Lapatinib may be better than EGFR specific TKI´s inhibitors in inhibiting PI3K in vitro and in vivo. Complete inhibition of activated AKT in HER2 overexpressing cells correlated with a strong increase in apoptosis. These observations were reproduced in vivo in human tumor xenografts. Inhibition of AKT may be of therapeutic interest for the use of Lapatinib as monotherapy, or it may enhance the antitumor activity of chemotherapeutics, of which Akt may mediate chemo-resistance. Lapatinib activity has been linked to inhibition of the breast-cancer stem cell in the impressive work of Li and colleagues in 2007 in the same way, EGFR has been directly linked to stem-cell self renewal. Lapatinib seems to have no major side effects, which reflects its apparent ability to target cancer stem cells specifically. In preclinical studies, Lapatinib was not cross-resistant with Trastuzumab (Rusnak et al, 2001; Wood et al, 2004; Konecny et al, 2006). In a phase 3 randomized study, Lapatinib combined with Capecitabine improved the response rate and significantly (P = .002) delayed disease progression in comparision with capecitabine alone in patients with metastatic HER2overexpressing breast cancer whose disease had progressed following Trastuzumab-based therapy (Geyer et al, 2006). Lapatinib is now accepted in combination with capecitabine for treatment of metastatic Her2neu positive breast cancer. However, Lapatinib has not yet demonstrated clinical efficacy against breast tumors that express EGFR (Spector et al, 2006). Gemcitabine is a pyrimidine nucleoside antimetabolite. Gemcitabine is converted to difluorodeoxycytidine triphosphate, which inhibits DNA synthesis by inhibition of DNA polymerase and directly incorporates into DNA, leading to premature termination of DNA chain elongation. The diphosphate intermediate of Gemcitabine also inhibits ribonucleotide reductase, and thereby depletes intracellular pools of deoxyuridine monophosphate required for DNA synthesis (Huang et al, 1991). This agent has proven antitumor activity and tolerability in various malignancies, including breast cancer. Gemcitabine monotherapy has led to response rates of 37% in the first-line setting (Blackstein et al, 2002), 26% in the second-line setting (Brodowicz et al, 2000), and 18% in the third-line setting (Brodowicz et al, 2000). Gemcitabine has a unique mechanism of action as well as a favorable toxicity profile, thereby limiting the risks of pretreatment- related drug resistance and overlapping toxicity, and allowing it to be an excellent agent for combination therapy. Recent phase II and phase III studies combining Gemcitabine with taxanes, platinum agents, vinorelbine, anthracyclines, and 5-fluorouracil have shown higher efficacy than either single agent, especially in pretreated patients. Because of its unique mechanism of action and non-overlapping toxicities, Gemcitabine can be added to several chemotherapeutic agents, and cannot be considered as cross resistant with taxanes or anthracyclines.
II. Clinical Case A 62 years old lady was diagnosed with a right breast cancer. The patient consulted because of right arm pain and presence of a right axillary mass which she has noticed a month before the consultation in September 2007. On physidal examination we founda right breast mass of 30 x 50 mm, and a right axillary mass that could not be measured. Homolateral supraclavicular lymph nodes of 40 x 50 mm were also detected. Breast echography revealed a 29 mm right breast mass with microcalcifications located at the upper external quadrant, and a right lymph node conglomerate. We carried out a biopsy of the breast. The pathological study showed a high grade ductal infiltrating carcinoma, negative for estrogen and progesterone receptors (ER-PR), and with positive for Herceptest (+++). A Breast Magnetic Resonance (MRI) detected a 28x26x20 mm lesion at the upper exterior quadrant and another lesion of 30x21 mm at the lower exterior quadrant of the right breast, as well as multiple right axillary lymph nodes. Neither computed tomography (CT), nor bone scan did find lesions suspicious of metastatic dissemination. She began chemotherapy with Adriamicyn 60 mg/m2Cyclophosphamide 600mg/m2 every 21 days (AC) with 4 cycles planned, followed by Docetaxel 75mg/m 2 associated to Trastuzumab 8 mg/kg (first dose), followed by 6 mg/kg (subsequent administrations) every 21 days for a total of 4 cycles. The CT scan performed after the chemotherapy did only reveal partial response at the axillary metastases. Physical examination did not reveal any breast tumor. After treatment completion, she was sent to surgery. In January 2008 a mastectomy with lymph node dissection was performed. According to pathological findings, she was considered for a 4 grade response to the treatment. Only an infiltrating ductal carcinoma, measuring 4 mm, was detected. Out of the six nodes resected with extension to the perinodal tissues, we found metastases in five. The patient continued with Trastuzumab 6 mg/kg every three weeks. In March 2008, the patient detected a right subscapular tumor, as well as a growth ot the supraclavicular and right axillary lymph nodes. Therefore she came to our hospital, and we performed a pathological review. The physical examination revealed a right supraclavicular mass, measuring 50 x 40 mm, the right subscapular mass, measuring30x40 mm, and some right axillary lymph nodes were detected, measuring up to 20 mm. The CT scan revealed the right supraclavicular adenopathies, right adenopathies up to 14 mm, a subcutaneous periscapular nodule of 14 mm, and two smaller ones (Figure 1). The bone scan did not reveal bone dissemination. Performance Status (PS) was established in two and the biopsy confirmed metastatic breast dissemination positive for Her 2 (+++) and moderate for EGFR (35%) (Figure 1). The patient was considered then in progression and with a primary resistance to Trastuzumab. After discussing with her the treatment options, we decided to offer Lapatinib 1250 m taken orally on a daily basis, and as the patient was reluctant to take so many tablets, we decided to offer her a combination of Lapatinib with Gemcitabine 1000 mg/m2 days 1,8 every 21 days, so a compassionate use in agreement with the Spanish rules was requested. After the authorization was received, the patient began treatment at the end of March 2008. After two cycles we decided to reduce the dose of Lapatinib to 1000 mg daily, because of grade-two diarrhea, that could not be controlled with codeine. After the reduction of the dose, no more relevant side effects were recorded. At the beginning of every cycle the patient was
2
Cancer Therapy Vol 7, page 1 examined, and we confirmed a progressive reduction of all of the masses that were present at the first physical examination. The control CT scan carried outin July confirmed a complete clinical remission of all of the described lesions
(Figure 2), the patient had then a PS 1, and the treatment continues today. The last CT scan has been made in Octobe 2008, ant the patient continues in complete clinical response and with a PS of 0.
Figure 1. Left: EGFR2 positivity (+++), Right: EGFR1 moderate expression (35%).
Figure 2. Left: CT March 2008, right:CT July 2008.
3
Blesa et al: Complete clinical response of a metastatic cancer patient treated with lapatinib & gemcitabine Kubista E, Zielinski CC (2000) Single-agent Gemcitabine second- and third-line treatment in metastatic breast cancer. Breast 9, 338-342. Ciardiello F, Caputo R, Bianco R, Damiano V (2000) Antitumor effect and potentiation of cytotoxic drugs activity in human cancer cells by ZD-1839 (Iressa), an epidermal growth factor receptor-selective tyrosine kinase inhibitor. Clin Cancer Res 6, 2053-2063. Geyer CE, Forster J, Lindquist D, Chan S, Romieu CG, Pienkowski T, Jagiello-Gruszfeld A, Crown J, Chan A, Kaufman B, Skarlos D, Campone M, Davidson N, Berger M, Oliva C, Rubin SD, Stein S, Cameron D (2006) Lapatinib plus capecitabine for HER-2-positive advanced breast cancer. N Engl J Med 355, 2733-2743. Gilmer TM, Cable L, Alligood K, Rusnak D, Spehar G, Gallagher KT, Woldu E, Carter HL, Truesdale AT, Shewchuk L, Wood ER (2008) Impact of Common Epidermal Growth Factor Receptor and HER2 Variants on Receptor Activity and Inhibition by Lapatinib. Cancer Res 68, 571-579. Huang P, Chubb S, Hertel LW, Grindey GB, Plunkett W (1991) Action of 2’,2’-difluorodeoxycytidine on DNA synthesis. Cancer Res 51, 6110-6117. Konecny GE, Pegram MD, Venkatesan N, Finn R, Yang G, Rahmeh M, Untch M, Rusnak DW, Spehar G, Mullin RJ, Keith BR, Gilmer TM, Berger M, Podratz KC, Slamon DJ (2006) Activity of the dual kinase inhibitor Lapatinib (GW572016) against HER-2-overexpressing and Trastuzumab-treated breast cancer cells. Cancer Res 66, 1630-1639. Krasilnikov MA (2000) Phosphatidylinositol-3 kinase dependent pathways: the role in control of cell growth, survival, and malignant transformation. Biochemistry (Mosc) 65, 59-67. Li X, Creighton C, Wong H, Hilsenbeck SG, Osborne CK, Rosen JM, Lewis MT, Chang JC (2007) Decrease in tumorigenic breast cancer stem cells in primary breast cancers with neoadjuvant Lapatinib (Abstr 82). SABCS. Moyer JD, Barbacci EG, Iwata KK, Arnold L, Boman B, Cunningham A, DiOrio C, Doty J, Morin MJ, Moyer MP, Neveu M, Pollack VA, Pustilnik LR, Reynolds MM, Sloan D, Theleman A, Miller P (1997) Induction of apoptosis and cell cycle arrest by CP-358,774, an inhibitor of epidermal growth factor receptor tyrosine kinase. Cancer Res 57, 4838-4848. Rusnak DW, Lackey K, Affleck K, Wood ER, Alligood KJ, Rhodes N, Keith BR, Murray DM, Knight WB, Mullin RJ, Gilmer TM (2001) The effects of the novel, reversible epidermal growth factor receptor/ErbB-2 tyrosine kinase inhibitor, GW2016, on the growth of human normal and tumor-derived cell lines in vitro and in vivo. Mol Cancer Ther 1, 85-94. Smylie M, Blumenschein G, Dowlati A, Garst J, Shepherd FA, Rigas JR, Hassani H, Berger M, Zaks T, Ross HJ (2007) A phase II multicenter trial comparing two schedules of lapatinib (LAP) as first or second line monotherapy in subjects with advanced or metastatic non-small cell lung cancer (NSCLC) with either bronchioloalveolar carcinoma (BAC) or no smoking history (Abstr 7611). J Clin Oncol 25 No 18S (June 20 Supplement). Spector N, Blackwell K, Hurley J, Harris JL, Lombardi D, Bacus. S, Ahmed SB, Boussen H, Frikha M, Ayed FB (2006) EGF103009, a phase II trial of Lapatinib monotherapy in patients with relapsed/refractory inflammatory breast cancer (IBC): clinical activity and biologic predictors of response (Abstr 502). J Clin Oncol 24 No 18S (June 20 Supplement). Wood ER, Truesdale AT, McDonald OB, Yuan D, Hassell A, Dickerson SH, Ellis B, Pennisi C, Horne E, Lackey K, Alligood KJ, Rusnak DW, Gilmer TM, Shewchuk L (2004)
III. Discussion Treatment of metastatic breast cancer has currently many options. Patients who harbor tumors positive for Her2neu, have great benefit with the use of Trastuzumab, combined with chemotherapy and as maintenance treatment. Primary resistance to Trastuzumag is challenging, and the prognosis of these patiens is poor. Lapatinig is a modern TKI that has the capacity of inhibition of EGFR1 and Her2neu, is authorized to treat metastatic breast cancer patients who progress after Trastuzumab, in combination with capecitabine. There are many clinical trials currently exploring the combination of Lapatinib with different chemotherapeutics and hormone treatments. Gemcitabine is an active drug for the treatment of breast cancer. Its toxic profile is considered to be safe, what allows for combination with a wide range of agents. Gemcitabine is not cross resistant with taxanes or anthracyclines. Taking in consideration the reluctancy of our patient to take so many tablets, we considered this combination as potentially reasonable for our patient. Results obtained are challenging, taking in consideration the immediate tumor growth after two cycles of maintenance therapy with Trastuzumab, and the proximity to the surgery. All of these facts reflect the existence of a primary resistance to Trastuzumab harbored by the tumor that we were treating. We cannot correlate the response observed in this case with the moderate expression of EGFR, as has been published (Smylie et al, 2007; Gilmer et al, 2008), but for us, this conclusion is tempting. The occurrence of a complete response happened only in one patient treated with Lapatinib and Capecitabine in the most important Lapatinib clinical trial published to date and that was used as the basis for the approval of Lapatinib by the Food and Drug Administration (Geyer et al, 2006). It is also anecdotal, in patients treated with Gemcitabine monotherapy. Our patient is to our knowledge, the first patient treated with a combination of these two drugs, considering that our patient had a primary resistance to Trastuzumab, the result obtained is exciting. We cannot exclude the existence of a synergistic effect, although we are not able to investigate it. In view of this result, we can conclude that the combination of Gemcitabine and Lapatinib deserves future consideration in basic research, conducted within clinical trials and which look for potential synergies.
Acknowledgments We would like to thank Francisco Sanchez Garcia for linguistic advice and revision.
References Blackstein M, Vogel CL, Ambinder R, Cowan J, Iglesias J, Melemed A (2002) Gemcitabine as first-line therapy in patients with metastatic breast cancer: A phase II trial. Oncology 62, 2-8. Brodowicz T, Kostler WJ, Möslinger R, Tomek S, Vaclavik I, Herscovici V, Wiltschke C, Steger GG, Wein W, Seifert M,
4
Cancer Therapy Vol 7, page 1 A unique structure for epidermal growth factor receptor bound to GW572016 (Lapatinib): relationships among protein conformation, inhibitor off-rate, and receptor activity in tumor cells. Cancer Res 64, 6652-6659.
Joan Manel Gasent Blesa
5
Blesa et al: Complete clinical response of a metastatic cancer patient treated with lapatinib & gemcitabine
6
Cancer Therapy Vol 7, page 7 Cancer Therapy Vol 7, 7-20, 2009
Contemporary management of thyroid carcinoma Review Article
Eric M. Genden1, Elise Brett2 1
Department of Otolaryngology-Head and Neck Surgery and Head and Neck Cancer Center, The Mount Sinai Medical Center 2 Department of Medicine, Division of Endocrinology, Mount Sinai School of Medicine
__________________________________________________________________________________ *Correspondence: Eric M. Genden. M.D., F.A.C.S., Professor and Chairman, Department of Otolaryngology-Head and Neck Surgery, Director, Head and Neck Cancer Center, The Mount Sinai Medical Center, Box 1189; The Mount Sinai School of Medicine, USA; Tel: 212 241-8331 (Academic Office); fax: 212 369-5701; e-mail: eric.genden@mssm.edu Key words: anaplastic thyroid carcinoma, Clinical staging, risk group classification, Diagnosis, external beam radiotherapy, follicular thyroid carcinoma, Hurthle cell carcinoma, Management, Medullary thyroid carcinoma, N+ neck, N0 neck, papillary thyroid carcinoma, Preoperative evaluation, Radioiodine therapy, Thyroid hormone suppression, thyroid nodule Abbreviations: American Joint Committee on Cancer (AJCC); computed tomography (CT); European Organization for Research on Treatment of Cancer (EORTC); external beam radiotherapy (EBRT); familial medullary thyroid carcinoma (FMTC); High resolution ultrasonography (HUS); high resolution ultrasound (HUS); Hurthle cell carcinoma (HCC); magnetic resonance imaging (MRI); Medullary thyroid carcinoma (MTC); multiple endocrine neoplasia (MEN); Papillary thyroid carcinoma (PTC); positron emission tomography (PET); radioimmune therapy (RIT); recombinant human TSH (rhTSH) Received: 8 August 2007; Revised: 20 September 2007 Accepted: December 2007; electronically published: January 2009
Summary The diagnosis and management of thyroid cancer is the subject of some debate. The introduction of high resolution imaging and positron emission tomography has raised questions regarding the management of incidentally identified nodules and glucose avid carcinoma. This review is designed to address the contemporary approach to the management of thyroid cancer and discuss the controversies associated with initial management and recurrent disease.
on neck imaging for evaluation of the cervical spine, carotid arteries, or other diagnoses. Less commonly it may present as a lateral neck mass (Hay, 1990). Thyroid nodules are common however in most studies the rate of malignancy is only 4-5% (Rojeski and Gharib, 1985; Lin et al, 2005). The prevalence of thyroid nodules increases with age and is estimated to occur in roughly 50% of the US population 50 years of age and older (Mazzaferri, 1993). Thyroid cancer may present as a dominant nodule in a multinodular gland or as a solitary nodule. It was previously thought that the risk of malignancy was lower in a multinodular gland, but it is now recognized that the risk per gland is equivalent (Tollin et al, 2000) and that incidentally discovered nodules carry a similar risk of malignancy (Liebeskind et al, 2005). What this suggests is that any nodule may represent a cancer, and that every nodule should be evaluated. Upon initial presentation, a careful history is essential because it can reveal information that immediately stratifies a patient into a high risk category. High risk factors include a prior history of head and neck radiation including radiation for Hodgkin’s disease (Sklar et al, 2000), radiation exposure from the Chernobyl
I. Introduction Thyroid carcinoma is a result of activation of several ill defined protooncogenes and defects related to a tumor suppressor gene. Malignant transformation occurs most commonly in the follicular cell population resulting in well-differentiated carcinoma however it may also occur in the parafollicular cell or c- cell population resulting in poorly differentiated carcinoma. Thyroid cancer is relatively uncommon although the incidence has increased by 82% over the past decade making thyroid cancer the fasted growing cancer in the United States (Libutti, 2005). The dramatic increase in the rate of newly diagnosed thyroid cancers is likely a result of the improvement in imaging including high resolution ultrasound (HUS), positron emission tomography (PET), magnetic resonance imaging (MRI) and computed tomography (CT). While more than 25,000 people in the United States will be diagnosed with thyroid cancer next year, only 1500 will die from the disease.
II. Evaluation of the thyroid nodule Thyroid carcinoma usually presents as a palpable thyroid nodule or a nodule that is discovered incidentally 7
Genden and Brett: Contemporary management of thyroid carcinoma accident (Tronko et al, 2006), and a family history of thyroid cancer. The risk of thyroid cancer in first degree relatives of patients with differentiated thyroid cancer has been shown to be six times that of the general population (Handkiewcz-Junak et al, 2006). Other important high risk factors include a history of rapid growth of a solid nodule, pain, dysphagia, or dysphonia. Although less than 20% of patients with thyroid carcinoma will present with a regional metastasis, a neck mass in the presence of a thyroid nodule raises the likelihood of malignancy. Young age (<20 years), older age (>70 years), and male gender may also represent an increased risk (Thyroid Carcinoma Task Force, 2001). To most accurately determine the risk of malignancy, it is essential to consider a variety of factors (Table 1). There is no single laboratory study that is able to determine the presence of thyroid malignancy. Although elevated baseline calcitonin levels represent occult medullary carcinoma in 10-40% of cases, the presence of false positive elevations, the low incidence of medullary carcinoma, and the high cost of testing have led to recommendations against routine testing in the United States (Hodak and Burman, 2004). Calcitonin levels are usually reserved for high risk patients and those with a family history of medullary thyroid carcinoma or multiple endocrine neoplasia (MEN). Thyroglobulin is not useful in the work up because there are a variety of conditions that can lead to elevated levels including thyroid inflammation, glandular stimulation or injury following radiation, surgery, or even a biopsy. TSH should be measured to exclude a toxic nodule, as toxic nodules are almost never malignant and generally do not require fine needle aspiration. If the TSH is suppressed, then radioisotope imaging should be performed to confirm and localize the toxic nodule(s).
87.5% in distinguishing follicular adenoma from follicular carcinoma (Miyakawa et al, 2005). Generally, no additional imaging is required although CT and MRI scanning can sometimes be helpful in assessing presence of a substernal component of the gland or in pre-operative planning in cases where there is suspicion of laryngeal, tracheal, or esophageal invasion. Once a suspicious nodule has been identified, ultrasound guided fine needle aspiration should be performed. Determining which nodules should be aspirated and whether there should be a size cut-off, has been a heavily debated topic largely because microscopic tumors are generally less aggressive (Burman, 2006). The American Thyroid Association and American Association of Clinical Endocrinologist recommended against routine aspiration of nodules <1cm unless there are suspicious ultrasound characteristics, a family history of thyroid cancer or history of head or neck irradiation (Cooper et al, 2006). The FNA has been demonstrated as the a highly sensitive method for identifying malignancy (Mandell et al, 2001) and the diagnostic information that a FNA provides has been successful in decreasing the number of thyroidectomies while increasing the yield of malignancies in patients who undergo thyroidectomy (Sidawy et al, 1997). Several studies have demonstrated that FNA is extremely reliable yielding a false-positive rate less than 1% and a false-negative rate less than 2% (Gharib et al, 1993; Haber, 2002) although other studies have shown substantially higher false negative rates (Sidawy et al, 1997; Flanagan et al, 2006). The FNA may yield one of four possible diagnoses: Malignant disease, benign disease, suspicious for malignancy, or non-diagnostic. Malignant lesions on FNA Table 1. Risk factors for thyroid carcinoma
A. Role of ultrasound and ultrasoundguided fine needle aspiration
History of radiation exposure Family history of papillary thyroid carcinoma Single dominant solid nodule greater than 4 cm. Male gender Rapid growth of a nodule Younger than 20 years old Older than 70 years old
In contrast to other malignancies of the head and neck, the physical exam may not always be a strong predictor of malignancy (Hay and Klee, 1993). Rare characteristics such as attachment to overlying skin and muscle, vocal cord paralysis, firmness to palpation, and the presence of lymphadenopathy, may raise the suspicion of a malignancy however, the majority of welldifferentiated thyroid cancers will present with subtle findings that may only be identified on imaging or cytology. High resolution ultrasonography (HUS) offers the most sensitive and cost effective method for detecting a thyroid carcinoma (Reading and Gorman, 1993; Grebe and Hay, 1997; Krishnamurthy et al, 2001). Using a 10 to 13 MHz transducer, nodules as small as 2mm can be clearly identified and evaluated. (Table 2). Ultrasonographic characteristics suggestive of malignancy include hypoechogenicity, ill-defined margins, irregular borders, heterogeneity, and presence of calcification, particularly microcalcifications. Using these criteria, the sensitivity of ultrasound has been demonstrated as high as 86.5% and specificity 92.3% for non- follicular neoplasms (Koike et al, 2001). Doppler ultrasound has recently been shown to have a sensitivity of 92% and specificity of
Cervical metastasis Evidence of invasion on imaging
Table 2. Findings on ultrasonography that suggest malignancy Absence of a â&#x20AC;&#x153;haloâ&#x20AC;? sign Solid/Hypoechogenic nodule Heterogeneous echogenic structure Irregular margins Extraglandular extension Fine punctuate internal Calcifications
8
Cancer Therapy Vol 7, page 9 should prompt a hemithyroidectomy with frozen section examination; in most cases this will result in total thyroidectomy. In the event that the FNA reveals a benign diagnosis, observation with repeat ultrasound in six months is generally appropriate. Levothyroxine suppression therapy is no longer recommended. In the event that there is an increase in size of the nodule, the FNA should be repeated or the patient should be managed with a hemithyroidectomy. A single repeat FNA for a previously benign aspirate will increase the sensitivity for malignancy from 81.7 to 90.4% and decrease the falsenegative rate from 17.1% to 11.4%. In the event that the FNA reveals a suspicious diagnosis, a hemithyroidectomy with frozen section pathologic analysis is recommended. Based on the intraoperative frozen section, the decision to complete the thyroidectomy or terminate the operation can be made. We offer patients with bilateral nodules and a suspicious aspirate the option of total thyroidectomy initially to avoid the possibility of requiring completion thyroidectomy or continued monitoring of the contralateral lobe. In some cases, a FNA may yield the diagnosis of “follicular neoplasm, can not rule out carcinoma” or “Hurthle cell neoplasm”. In these cases, the decision making is more difficult. The FNA cannot differentiate a follicular carcinoma or Hurtle cell carcinoma from an adenoma because angioinvasion and invasion of the capsule can not be detected on cytology. The patient’s risk factors, the size of the nodule and the patient’s preference should be considered in the decision- making process. If observation is elected, the nodule should be followed closely with ultrasound. Cytology specimens that reveal predominantly Hurthle cells should prompt hemithyroidectomy because up to 2/3 represent neoplastic disease with a 16% malignancy rate (Alaedeen et al, 2005). If the FNA yields a non- diagnostic result, a repeat the FNA is warranted (Orija et al, 2004).
performed. In one recent study, ultrasound detection of nodes altered the surgical procedure in 40.5% of patients undergoing an initial procedure (Stulak et al, 2006). Ultrasound has also been shown to be highly sensitive and specific for detecting tracheal invasion by papillary thyroid cancer, which may be important in preoperative planning (Tomoda et al, 2005).
C. Clinical staging and risk group classification To effectively treat a malignancy of the thyroid gland it is essential to understand and document the behavior of the tumor. Clinical staging and risk group classification is particularly important in the management of thyroid cancer because it often will direct management, in particular the decision to treat the patient with radioactive iodine, external beam radiation, or combination therapy. The lack of prospective randomized studies assessing the relationships between tumor stage, treatment, and outcome, means that the majority of data that is used to create risk- group classifications is derived from retrospective reviews. As a result, there are variety of classification systems that are based on factors such as age, tumor size, gender, tumor grade, multicentricity, metastatic disease, and other variables. The AGES system (Hay et al, 1987) is based on factors including age, grade, extent, and size of the tumor (Table 3). In the AGES system, those patients with an aggregate score 4+ are high risk and those with a score less than 4 are low risk. The AMES system (Cady and Rossi, 1988) considers age, distant metastasis, extent, and size of tumor (Table 4). Additionally, there are systems devised by the European Organization for Research on Treatment of Cancer (EORTC) (Byar et al, 1979), the National Thyroid Cancer Treatment Cooperative Study (Sherman et al, 1998), and others (Cady and Rossi, 1988; Hay et al, 1993). Most of these classification systems utilize similar information with minor variations. Irrespective of the classification system that is used, it is important to consider risk group stratification during the management of a patient with thyroid cancer. Separate from these stratification systems is the TNM tumor staging system endorsed by the American Joint Committee on Cancer (AJCC) (Table 5) which serves to provide a uniform language when evaluating management and outcome.
B. Preoperative evaluation The preoperative evaluation of a patient with suspected thyroid cancer should include a complete physical examination and a direct examination of the larynx to assess vocal fold motion. Pre-operative ultrasound of the neck for patients with cytology suspicious for malignancy can be useful in identifying non-palpable lymph nodes and should routinely be Table 3. AGES Classification System
Prognostic score = 0.05 x age (if age !40) +1 (if grade 2) +3 (if grade 3 or 4) +1 (if extrathyroidal) +3 (if distant spread) +0.2 x tumor size (cm maximum diameter) Survival by AGES score " 3.99 = 99% 4- 4.99 = 80% 5- 5.99 = 67% !6 = 13%
9
Genden and Brett: Contemporary management of thyroid carcinoma Table 4. AMES Classification System Low Risk Young patients (men" 41 years old, women "51 years old) without distant metastasis Older patients (intrathyroidal papillary thyroid cancer, minor capsular invasion for follicular lesion) Primary cancers < 5 cm in diameter No distant metastasis High Risk All patients with distant metastasis Extrathyroidal papillary Major capsular invasion for follicular All older patients with extrathyroidal spread All older patients with primary cancer > 5 cm in diameter (men> 40, women >50) Survival by AMES score Low risk = 99% High risk = 61% Table 5. TNM Classification System for Differentiated Thyroid Carcinoma
T1 T2 T3 T4a T4b Tx
TNM Classification System Tumor diameter 2 cm. or smaller Primary tumor diameter >2 to 4 cm. Primary tumor diameter >4 cm. limited to the thyroid or with minimal extracapsular extension Tumor of any size extending beyond the thyroid capsule to invade the subcutaneous soft tissues, larynx, trachea, esophagus, or recurrent laryngeal nerve Tumor invades prevertebral fascia or encases carotid artery or mediastinal nerves Primary tumor size unknown, but without extrathyroid extension
N0 N1a NIb Nx M0 M1
No metastatic nodes Metastasis to level VI (pretracheal, paratracheal, prelaryngeal) Metastasis to unilateral or bilateral or contralateralcervical or superior mediastinum Nodes not assessed at surgery No distant metastasis Distant metastasis Stages for Differentiated Thyroid Cancer Patient age < 45 years Patient age >45 years Stage I Any T, any N, MO T1, N0, M0 Stage II Any T, any N, M1 T2, N0, M0 Stage III T3, N0, M0 T3, N0, M0 T1, N1a, M0 T1, N1a, M0 T2, N1a, M0 T2, N1a, M0 T3, N1a, M0 T3, N1a, M0 Stage IVA T4a, N0, M0 T4a, N0, M0 T4a, N1a, M0 T4a, N1a, M0 T2, N1b, M0 T2, N1b, M0 T3, N1b, M0 T3, N1b, M0 T4a, N1b, MO T4a, N1b, M0 Stage IVB Any T4b, any N, M0 Any T4b, any N, M0 Stage IVC Any T, Any N, M1 Any T, Any N, M1
III. Wellcarcinoma
differentiated
cancers (Hundahl et al, 1998) (Table 6). PTC is derived from the follicular cells. These cells tend to concentrate iodine and secrete thyroglobulin. As a result, surveillance and detection of recurrence can be relatively straightforward. The prognosis for PTC is usually excellent.
thyroid
A. Papillary thyroid carcinoma Papillary thyroid carcinoma (PTC) is the most common form of the follicular cell derived carcinomas and comprises three quarters of all newly diagnosed thyroid 10
Cancer Therapy Vol 7, page 11 Table 6. New thyroid tumors by histological group.
1. Management carcinoma
of
papillary
thyroid
exists in the low risk patient sub-group. Several studies have failed to demonstrate that low risk patients experience an improvement in cause-specific mortality after undergoing a total thyroidectomy (Hay et al, 1987, 1998) while several large studies have demonstrated that there is a benefit to total thyroidectomy (Hay et al, 1992; Sanders and Cady, 1998). The conflicting data can make the decision-making process a difficult one. As a result, not all surgeons favor such guidelines and many prefer to perform a total thyroidectomy in spite of the risk stratification suggesting that the rate of morbidity in the hands of an experienced surgeon is exceedingly low (Clark et al, 1988). To support this contention, a recent study found that surgeons who perform more than 100 thyroidectomies per year reported complication rates of 4.3% while those surgeons who performed less than 10 thyroidectomies per year reported a four-fold increase in complication rate. In spite of the complication rate, when a sub-total thyroidectomy is performed for the management of thyroid carcinoma, it becomes difficult to follow thyroglobulin levels for surveillance (Inabnet, 2000). This may represent the most compelling argument to perform a total thyroidectomy for malignancy. Finally, the American Thyroid Association recently recommended that a total thyroidectomy should be performed for the management of well- differentiated thyroid carcinoma (Sidawy et al, 1997).
Surgery is the primary treatment for papillary thyroid cancer and a complete resection offers the best chance of cure (Nishida et al, 2000; Thyroid Carcinoma Task Force, 2001). While the role of a complete surgical resection is indisputable, the extent of the initial surgical resection has been topic of controversy. Primary management of thyroid malignancy has included nodulectomy, hemithyroidectomy with and without isthmusectomy, subtotal thyroidectomy, and total thyroidectomy. The high rate of recurrence associated with nodulectomy has confirmed that this approach is inadequate. While there has been a trend toward more aggressive surgical resection based on the well-documented multicentric nature of the disease, there are still some who insist that a partial thyroidectomy is sufficient (Shah et al, 1993). Proponents of total thyroidectomy point to data that demonstrates a rate of multicentric bilateral disease ranges from 18% to 46% (Shah et al, 1992; Mazzaferri and Jhiang, 1994). Opponents of total thyroidectomy suggest that multicentric bilateral disease is often microscopic and not clinically significant. This is further supported by the observation that several large studies have failed to demonstrate a survival advantage to total thyroidectomy when compared with hemithyroidectomy (Rossi et al, 1986; Sanders and Cady, 1998). In spite of these findings, most clinicians agree that there is a subset of patients who benefit from total thyroidectomy while there is another distinct subset of patients that may be treated more conservatively. The concern regarding “over-treating” a patient by performing a total thyroidectomy instead of a hemithyroidectomy relates to the surgical risk including an increased risk of vocal cord paralysis and a risk of permanent hypoparathyroidism. In an effort to guide surgical management, the AGES and the AMES classification systems represent two commonly used systems that are used to classify patients into either a “high risk” group or a “low risk” group. It has been suggested that “low risk” patients can be managed with a thyroid lobectomy and isthmusectomy while “high risk” patients are better managed with a total thyroidectomy. Most surgeons agree with the recommendation to perform a total thyroidectomy when faced with a high risk patient. However the controversy
B. Follicular thyroid carcinoma Follicular carcinoma is less common than papillary thyroid carcinoma (Hundahl et al, 1998) and typically behaves more aggressively than papillary thyroid carcinoma. The aggressive nature of follicular thyroid carcinoma is largely a result of its propensity for hematogenous dissemination. Unlike papillary thyroid carcinoma, which spreads through lymphatics, follicular carcinoma has a tendency to metastasize hematogenously to the lung and bones. The incidence of distant metastasis at presentation is not uncommon occurring between 10 and 20% of new cases (Shaha et al, 1997; Lin et al, 1999; Eichhorn et al, 2003). As a result, a bony lesion or pathologic fracture may represent the initial presentation. The key to effective management of follicular carcinoma is making an early diagnosis and total thyroidectomy.
11
Genden and Brett: Contemporary management of thyroid carcinoma
1. Management carcinoma
of
follicular
paratracheal region to the lateral compartment (levels III and IV), however it has been documented that regional disease may occur in the jugular chain without evidence of disease in the paratracheal basin in as many as 18% of cases (Noguchi et al, 1987). In spite of this rather high rate of â&#x20AC;&#x153;skip metastasisâ&#x20AC;?, most surgeons do not advocate a lateral neck dissection unless there is clinical evidence of disease in the lateral compartment. The rate of occult regional metastasis in papillary thyroid carcinoma is relatively high however occult metastasis in follicular carcinoma is rare. Hence, in patients with follicular carcinoma, an elective lymph node dissection is not commonly performed in the N0 neck. If lymphadenopathy is detected, a paratracheal and pretracheal central compartment neck dissection should be performed. In papillary thyroid carcinoma, the high rate of paratracheal disease constitutes an ipsilateral paratracheal neck dissection when there is clinical evidence of disease. Node plucking is not acceptable as the rate likelihood of recurrence is exceedingly high (Goldman et al, 1996).
thyroid
In contrast to papillary thyroid cancer, the frozen section pathological analysis is not helpful in making the diagnosis of follicular carcinoma because capsular and vascular invasion must be identified and this requires fine section analysis that can not be completed with FNA or at the time of frozen section (LiVolsi and Baloch, 2005). The definitive diagnosis of follicular thyroid carcinoma can be made only on permanent section. Once the diagnosis of follicular carcinoma has been confirmed, the decision to proceed with a completion thyroidectomy or follow the patient is based on a variety of factors including risk group analysis. Most agree that high risk patients require a total thyroidectomy. Not only does a total thyroidectomy improve prognosis but it is very helpful in achieving accurate surveillance by facilitating RAI administration and thyroglobulin monitoring. There is controversy regarding the low risk group patients who present with minimally invasive lesions. The decision to perform a completion thyroidectomy is often based on age of the patient and invasiveness of the tumor. In patients greater than 50 years old or those with extensive invasion, we recommend a completion thyroidectomy. Patients with low grade tumors, tumors that demonstrate minimal invasion, can be managed conservatively with observation and serial ultrasound examination. Minimally invasive follicular thyroid carcinoma tends to behave like a follicular adenoma. There is a very low incidence of metastasis in low grade follicular carcinoma (Young et al, 1980; van Heerden et al, 1992) and unlike papillary thyroid carcinoma, minimally invasive lesions are rarely multifocal. However, as follicular lesions grow larger than 3 cm, nearly 30% will demonstrate malignant conversion (Bell and Mazzaferri, 1993). While some have advocated suppressive therapy for low risk patients, this approach has failed to demonstrate the benefit of suppressive therapy.
3. Management of the N0 neck The approach to management of the N0 neck in papillary carcinoma has been a topic of controversy largely because there are few randomized, controlled, long term studies that demonstrate the impact of surgical treatment of the N0 neck. Currently, most surgeons perform a pretracheal and ipsilateral paratracheal lymph node dissection on high risk patients (those patients aged 45 years or older, or patients with tumors greater than 4 cm, or invasive disease). Only when the thyroid tumor crosses the midline is a contralateral lymph node dissection warranted. When a contralateral lymph node dissection is performed, the patient must be informed of the increased risk related to transient and permanent hypoparathyroidism (Henry et al, 1998). As discussed earlier, in spite of the relatively high rate of documented skip metastasis, most surgeons do not advocate a lateral neck dissection. The rationale for this approach stems from the lack of data demonstrating the benefit of a lateral neck dissection for subclinical disease and the prevailing belief that I131 can be used to manage microscopic lateral metastasis.
2. Management of regional disease in welldifferentiated thyroid carcinoma Unlike squamous cell carcinoma, the impact of lymph node metastasis from thyroid cancer on survival is negligible, at least in the younger population. Several studies have suggested that lymph node metastasis may not impact survival (Carcangiu et al, 1985; Noguchi et al, 1987) however when adjusted for age, it is clear that although regional disease does not significantly impact on survival in young patients, it does decrease survival in patients over the age of 45 (Harwood et al, 1978). Long term studies have confirmed these observations and identified that in the population of patients over 45 years old, regional metastasis does impact survival (Mazzaferri and Jhiang, 1994). As a result, most experts agree that clinically involved regional lymph nodes should be managed with a lymph node dissection. There is, however, controversy regarding the impact of elective neck dissection on survival. This is largely a result of the paucity of controlled randomized studies. Thyroid cancer commonly progresses in a defined pathway from the first echelon lymph nodes of the
4. Management of N+ neck Unlike follicular carcinoma in which lymph nodes metastases are rare, metastasis in papillary thyroid carcinoma is common. While only a small proportion of patients will initially present with a neck mass (Shaha et al, 1996), a significant number of patients will harbor subclinical paratracheal disease at the time of diagnosis. The size of the primary thyroid tumor has little bearing on the extent or location of regional disease. Several groups including our own, have found that while large cancers of the thyroid may remain localized, microcarcinoma may present with extensive regional disease (McConahey et al, 1986). As a result it is difficult to predict the risk of regional disease based on the size of the tumor and therefore every patient must be evaluated for regional metastasis.
12
Cancer Therapy Vol 7, page 13 When lymph node metastasis is identified, a neck dissection is warranted. I131 has not been demonstrated effective for management of gross regional disease (Wilson and Bock, 1971). In the past, there was controversy regarding the extent of the dissection however most surgeons now advocate a selective neck dissection (levels III, IV, and VI) in which the jugular vein, sternocleidomastoid muscle, and the accessory nerve are preserved. Although rare, when invasion of the surrounding structures occurs, a modified neck dissection may be warranted.
8. Diagnosis of recurrent and distant disease Recurrent well-differentiated thyroid cancer is not uncommon. Following total thyroidectomy, as many as 15% of patients will develop neck disease 0 to 5 years after initial therapy (McConahey et al, 1986; Mazzaferri and Kloos, 2001). Since the volume of recurrent or distant metastatic disease correlates relatively well with the prognosis, early diagnosis and management is essential. Whole body I131 scanning and should be performed in high risk patients 6 to 12 months after the primary surgery. Low risk patients can usually be evaluated by recombinant TSH (Thyrogen) stimulated thyroglobulin levels avoiding the need for an iodine scan. Since the majority of recurrences occur in the thyroid bed, neck ultrasonography represents the most sensitive means for detecting recurrence in the presence of elevated thyroglobulin. For those patients with elevated thyroglobulin and a negative iodine scan, PET/CT is exceptionally helpful in identifying recurrent and distant disease and has been shown to provide important prognostic information. Jadvar et al. evaluated 10 patients with suspected recurrent papillary thyroid cancer using PET and concluded in this small series that PET was useful in the evaluation of patients with suspected recurrent papillary thyroid cancer when the I131 scan is negative (Jadvar et al, 1998). In a more recent study, eight patients underwent combined PET/CT scanning for suspected recurrence. Four (50%) of 8 patients underwent PET/CT indicating recurrence in the head and neck. A total of 11 lesions in these 4 patients were suspicious for recurrence on combined PET/CT imaging. Three patients with 8 lesions suspicious for recurrence on PET/CT underwent surgical removal of disease. All 3 patients had pathologic confirmation of recurrence, with 75.0% of the 8 lesions being positive. The authors concluded that combined PET/CT imaging is a valuable tool for the diagnosis and localization of recurrent thyroid cancer (Zimmer et al, 2003). Recent evidence suggests that PET- positive disease is unlikely to I131 and may be associated with a more biologically aggressive tumor (McDonald et al, 1996).
5. Radioiodine therapy Remnant ablation with 131I is routinely performed in all patients except for very low risk patients after total thyroidectomy to decrease the risk of recurrence and facilitate monitoring of thyroglobulin. Thyroid replacement is discontinued and a low iodine diet instituted in an effort to increase the avidity of the residual thyroid tissue. Once the TSH has risen above 25 to 30 mU/L, the patient is given radioiodine in doses ranging 30 mCi to 100mCi. Patients in whom residual microscopic disease is suspected and those with more aggressive tumor histology or known distant metastasis are administered higher doses of I131 in the range of 100 to 300 mCi. Younger patients with iodine avid tumors tend have a favorable response to 131I. The response of pulmonary metastasis to I131 is predicated on the size of the lesion, the age of the patient, and its ability to concentrate I131 (Casara et al, 1993; Schlumberger et al, 1996). In contrast, bone metastases, which occur more commonly in follicular thyroid carcinoma, are less responsive to therapy. The use of recombinant human TSH (rhTSH) for remnant ablation and in the treatment of metastatic disease is now being studied and has the advantage of avoiding symptomatic hypothyroidism (Luster et al, 2005).
6. Thyroid hormone suppression Thyroid hormone suppression is routinely used after total thyroidectomy for differentiated thyroid cancer. Although randomized controlled trials are lacking, benefit was suggested in a large meta-analysis (McGriff et al, 2002). Higher risk patients are initially treated with a greater degree of suppression. Due to the risk of osteoporosis, many clinicians will now reduce the levothyroxine dose once the patient has been free of disease for several years.
9. Management of recurrent disease The management of recurrent or metastatic disease largely depends on the extent of the disease. When there is microscopic persistent or recurrent disease, I131 dosing should be repeated. However when palpable gross tumor is identified, surgical management is the treatment of choice. When distant disease is identified, adjuvant I131 is usually the preferred. I131 scanning is the most accurate method for assessment of distant disease (Maheshwari et al, 1981). Non- iodine avid tumors represent a challenge and may indicate a poorly differentiated tumor that is often associated with a more aggressive behavior and a poor prognosis (McDonald et al, 1996). EBRT may be used for gross residual disease unresponsive to radioiodine and not amenable to further surgery. External beam radiation or surgical resection can also be used for the management of pain or to decompress nerve root compression in the vertebrae however neither therapy has an impact on prognosis. There are few studies demonstrating the efficacy of systemic chemotherapy however there is data
7. Role of external beam radiotherapy Although prospective controlled trials are lacking, several studies have shown excellent local-regional control of disease with external beam radiotherapy (EBRT) in patients with locally advanced differentiated thyroid cancer after the primary surgery and before or after radioiodine (Tsang et al, 1998; Kim et al, 2003; Meadows et al, 2006). Several groups have suggested that EBRT be considered in patients over 45 years with suspect persistent local disease after surgery which is unlikely to respond to radioiodine (Brierley and Tsang, 1999; Kim et al, 2003).
13
Genden and Brett: Contemporary management of thyroid carcinoma to suggest that doxorubicin may be effective in some patients (60- 75mg/m2 every 3 weeks) (Gottlieb et al, 1972). Currently, systemic chemotherapy is used only in clinical trials.
Vassilopoulou- Sellin found in 1998 no difference in outcome between HCC and follicular cell carcinoma when cases are stratified by extent of invasion (Evans and Vassilopoulou-Sellin, 1998). Like follicular cell carcinoma, the most important factor in assessing the prognosis seems to be the extent of capsular invasion. When tumors invade less than 1.0 mm, the rate of recurrence in exceedingly small, however as the extent of capsular invasion increases, the likelihood of regional and distant metastasis increases (Evans and VassilopoulouSellin, 1998).
C. Hurthle cell carcinoma Hurthle cell carcinoma (HCC) is a relatively rare form of thyroid cancer that is generally considered to be a more aggressive variant of follicular carcinoma. Similar to follicular carcinoma, the distinction between a benign Hurthle cell adenoma and a HCC is determined on the presence of vascular or capsular invasion. Similar to follicular cell carcinoma, the diagnosis can not be made on fine needle aspiration or frozen section analysis. Patients with HCC tend to be older. In one review series it was found that the median age of presentation for patients with follicular cell carcinoma was 55 years while the HCC patients presented at a mean age of 62 years. Patients presenting with HCC have a lower risk of regional metastasis at presentation when compared with follicular carcinoma, but a slightly increased risk of distant metastasis (Shaha et al, 1996). When followed long term, the number of patients that eventually develop distant metastasis is higher in HCC patients (30%) than papillary or follicular thyroid carcinoma patients. When distant metastasis occurs, 40% occur in the bone and as many as 30% occur in the lung (Ruegemer et al, 1988).
D. Medullary thyroid carcinoma Medullary thyroid carcinoma (MTC) is derived from the non- epithelial parafollicular cells (c-cells) which produce the peptide calcitonin. Since the parafollicular cells embryo logically develop from the neural crest or diffuse neuroendocrine system, they commonly produce neuropeptides and catecholamines. Tumors deriving from diffuse neuroendocrine system, such as carcinoid tumors, pancreatic islet tumors, and pheochromocytomas, are cytologically and functionally similar. MTC exists in a sporadic and familial forms. While the gender distribution is roughly equivalent, the sporadic form of the disease occurs in 80 to 90% of newly diagnosed cases. The familial form of the disease occurs in an autosomal dominant trait as either isolated familial medullary thyroid carcinoma (FMTC), multiple endocrine neoplasia type IIA (MEN IIA), or multiple endocrine neoplasia type IIB (MEN IIB) (Table 7). Each of these familial forms of the disease is associated with a ret oncogene mutation located on chromosome 10. This provides a reliable screening tool to identify affected family members. Since the penetrance of medullary thyroid cancer is >90% in people with the RET gene mutation, prophylactic thyroidectomy is recommended at a young age (Moore and Dluhy, 2005).
1. Management of Hurthle cell carcinoma The management of HCC is not significantly different from follicular cell carcinoma. HCC with minimal capsular invasion (<1mm) can be safely managed with a thyroid lobectomy and isthmusectomy. However, because it has been demonstrated that patients treated with a total thyroidectomy have a lower risk of recurrence (Carcangiu et al, 1991; McDonald et al, 1996), recommend a total thyroidectomy. All high risk patients or patients with more extensive capsular invasion are managed with a total thyroidectomy. Following surgery, I131 is administered to achieve ablation and facilitate surveillance with thyroglobulin.
1. Clinical presentation of Medullary thyroid carcinoma Not unlike other forms of thyroid carcinoma, sporadic MTC typically presents as a thyroid nodule with or without an associated neck mass. Since MTC is derived from the diffuse neuroendocrine system, patients may present with a paraneoplastic syndrome resulting in diarrhea and abdominal cramping as a result of
2. Prognosis of Hurthle cell carcinoma Less that 200 new cases of HCC carcinoma are diagnosed in the United States each year. As a result, there are few long term outcome studies however, Evans and Table 7. Familial medullary thyroid carcinoma Familial medullary thyroid cancer MEN IIA (Sipple Syndrome)
Medullary thyroid cancer Parathyroid adenoma Pheochromocytoma MEN IIB Medullary thyroid carcinoma Pheochromocytoma Ganglioneuromatosis Marfanoid habitus
14
Cancer Therapy Vol 7, page 15 prostaglandin and vasoactive peptide release. The biological behavior and clinical presentation of MTC can be variable. Most tumors present as a well circumscribed encapsulated nodule within the thyroid gland. More aggressive tumors may present with a neck mass or in rare cases distant metastasis to the lungs, liver, or adrenal glands. In some cases, tumors may remain stable or quiescent while other tumors may progress rapidly. There has been little data to help predict the biological aggressiveness of MTC.
et al, 2005). Systemic chemotherapy has little impact on the natural course of the disease, and while Schlumberger et al. demonstrated 20 % response rate in patients treated with doxorubicin, there is little data to support the use of systemic chemotherapy in MTC (Schlumberger et al, 1995). A new therapy using pretargeted anticarcinoembryonic antigen radioimmune therapy (RIT) has shown a survival benefit in a small clinical trial (Chatal et al, 2006).
E. Management of regional disease
2. Diagnosis of medullary thyroid cancer
When faced with regional recurrence, surgery is the treatment of choice. Regional metastasis mandates a neck dissection. Unlike well- differentiated thyroid cancer, radioactive iodine uptake is negligible in MTC and therefore aggressive surgical management of regional disease is justified. If a bilateral neck dissection was not performed at the time of initial therapy, bilateral neck dissections should be considered, even in the face of unilateral recurrence.
The most accurate method for diagnosis of MTC is a FNA of the thyroid nodule or neck mass. While cytodiagnostic features are recognized (Forrest et al, 1998), immunostaining for calcitonin in the presence of negative thyroglobulin staining, is the most accurate method of diagnosis. When the calcitonin polymerizes, amyloid deposits can be found on histological analysis. There are no histological differences between the sporadic and familial forms of the disease. However, it is interesting to note that familial MTC has a predilection for presenting as a thyroid nodule at the junction of the upper third and lower two-thirds of the thyroid gland because this is the area of the gland in which the density of C cells is the highest. Sporadic disease usually presents as a unilateral nodule while familial disease is more commonly bilateral and multifocal. Familial disease is considered more aggressive and commonly presents in the second or third decades while sporadic disease presents later, in the sixth or seventh decades.
3. Management carcinoma
of
medullary
F. Management of distant disease Distant disease represents a significant dilemma. As discussed, conventional adjuvant therapy offers little for patients with regional or distant disease. Clinical trials are often offered at tertiary care medical centers.
G. Management persistent disease
of
recurrent
and
When patients demonstrate a persistently elevated calcitonin level following surgery, it is because there is residual or recurrent disease. Identifying the location of the residual disease is often a challenge. CT, MRI, and PET have all been used with little success unless there is gross disease remaining in the neck or thyroid bed. The management of a patient with a persistently elevated calcitonin level and no radiographic evidence of disease is controversial. This is because there is evidence to suggest that this patient group does not necessarily have a compromised outcome (van Heerden et al, 1990) and when reoperation is pursued, the rate of success is low (Tisell et al, 1986). We recommend bilateral selective neck dissections for those patients that have not already undergone a neck dissection.
thyroid
Medullary thyroid carcinoma requires a total thyroidectomy and paratracheal lymph node dissection. Larger thyroid tumors are associated with an increased risk of neck disease and therefore tumors greater than 2 cm should be treated with an ipsilateral selective neck dissection in addition to a bilateral paratracheal lymph node dissection (Duh et al, 1989). Some have suggested that all patients should be treated with bilateral selective neck dissections because patients with unilateral intrathyroidal tumors, as many as 81% of patients have lymph node metastasis in levels II- V and 44% have disease in the contralateral lymph nodes level II-V (Moley and DeBenedetti, 1999). Aggressive surgical therapy is warranted because occult metastases are common and surgery is the only effective method of therapy. There is no evidence that medical therapy has any role in the primary management of MTC and there is little evidence to suggest that adjuvant medical therapy will impact outcome. There is no role for radioiodine or thyroid hormone suppression in the treatment of medullary cancer. Brierley et al. treated a series of 40 patients at high risk for recurrence with external beam radiation and demonstrated an improvement in local- regional control (86% vs. 52%) at 10 years (Brierley and Tsang, 1996; Brierley et al, 1996) however several other studies have failed to demonstrate an improvement in survival with external beam radiotherapy (Saad et al, 1984; Rosenbluth
H. Prognosis of medullary thyroid cancer Prognosis is better in younger patients, female gender, familial disease, and those with disease confined to the thyroid gland. The overall 5-year survival rate ranges from 25% to 75% (Gordon et al, 1973; Raue et al, 1994). When nodal disease is present at the time of diagnosis, which occurs in 50% of patients, the 5-year survival rate drops to less than 50% (Brandi et al, 2001). A recent series suggests that the 5 and 10 year survival rates are as high as 90% and 80% (Duh et al, 1989).
V. Anaplastic thyroid carcinoma Although less than 2% of all thyroid carcinomas are anaplastic thyroid carcinoma, it accounts for 14-39% of thyroid carcinoma deaths (Hundahl et al, 1998; Kitamura 15
Genden and Brett: Contemporary management of thyroid carcinoma et al, 1999).The diagnosis of anaplastic thyroid carcinoma can be elusive. Not uncommonly, a FNA will be repeatedly interpreted as “undifferentiated carcinoma” until an open biopsy provides enough tissue to reveal the anaplastic nature of the carcinoma. Unlike other forms of thyroid cancer, anaplastic is characteristically aggressive and unrelenting. Accounting for less than 5% of malignant thyroid cancers, anaplastic thyroid cancer is often heralded by a rapidly growing thyroid mass with destruction of the adjacent cartilage, nerve and infiltrating muscles.
based cancer registries between 1973 and 2000. They found that patients less than 60 years old with intrathyroidal anaplastic thyroid cancer appear to have a better prognosis than older patients with extra- thyroidal spread following total thyroidectomy and external beam radiation (Kebebew et al, 2005). Long term survivors are few however in those that do survive the disease, they commonly have only a small focus of anaplastic tumor arising within a preexisting well-differentiated thyroid cancer (Hundahl et al, 1998; Voutilainen et al, 1999). Adjuvant therapy has also been controversial. Standard fractionated radiation therapy has not been demonstrated to significantly change the clinical course (Levendag et al, 1993). Hyperfractionated therapy has resulted in a marginal improvement in response rates however the side effects, including esophagitis, can be debilitating (Mitchell et al, 1999). Tennvall et al. reported using preoperative hyper fractionated radiation (30 Gy), doxyrubicin, and surgical resection followed by postoperative radiation (46Gy). They demonstrated promising results with this regimen, controlling local recurrence in 48% of patients and disease free survival in 12% (Tennvall et al, 1990). In advanced disease, the goals include establishing an airway, a source of nutrition, and an acceptable quality of life. Surgery is warranted for the control or prevention of airway obstruction or extensive skin ulceration.
A. Clinical presentation of anaplastic thyroid carcinoma Anaplastic thyroid carcinoma typically presents in the elderly population with a history of thyroid goiter (Aldinger et al, 1978). Up to 20% of patients will have a history of well- differentiated thyroid cancer or co-existing well- differentiated thyroid cancer present within the thyroid specimen (Spires et al, 1988; Venkatesh et al, 1990). Patients usually present with a rapidly growing neck mass, true vocal cord paralysis, and or dysphagia (Aldinger et al, 1978). The mass tends to present as a fixed neck mass invading the surrounding structures. Direct invasion of the airway and larynx can lead to hoarseness or airway obstruction. As the lesion becomes more advanced, esophageal invasion can result in dysphagia. Anaplastic carcinoma may arise de novo or as a “conversion tumor” arising in the presence of a preexisting papillary or follicular carcinoma. When anaplastic carcinoma arises de novo, the tumor may progress rapidly metastasizing to the lungs, liver, and bones within weeks of presentation.
D. Prognosis carcinoma
of
anaplastic
thyroid
Anaplastic thyroid carcinoma is one of the most aggressive human malignancies. It is associated with an almost uniformly rapid and lethal clinical course (Libutti, 2005). Several studies have confirmed the universal lethal course associated with anaplastic thyroid cancer. Patient age, gender, tumor size, extent of disease, leukocytosis, presence of acute local symptoms, coexisting multinodular goiter and well differentiated thyroid carcinoma, surgical resection, and multimodal therapy all reportedly influence patient survival according to some studies (Jereb et al, 1975; Sugitani et al, 2001). However, there are few interventions that have improved survival.
B. Diagnosis of anaplastic thyroid cancer A FNA is often the first approach to diagnosis however necrosis and degeneration of the tumor may occur as the tumor rapidly out grows its blood supply. A FNA aspiration may yield necrotic material. Alternatively, the FNA may yield poorly differentiated cells suggestive of either lymphoma, anaplastic thyroid cancer, or poorly differentiated carcinoma of unknown origin. Flow cytometry is useful to rule out lymphoma, however immunohistochemistry and electron microscopy may be necessary to confirm the diagnosis of anaplastic thyroid carcinoma.
References Alaedeen DI, Khiyami A, McHenry CR (2005) Fine-needle aspiration biopsy specimen with a predominance of Hurthle cells: a dilemma in the management of nodular thyroid disease. Surgery 138, 650-6;(discussion 656-7). Aldinger KA, Samaan NA, Ibanez M, Hill CS Jr (1978) Anaplastic carcinoma of the thyroid: a review of 84 cases of spindle and giant cell carcinoma of the thyroid. Cancer 41, 2267-75. Bell B, Mazzaferri EL (1993) Familial adenomatous polyposis (Gardner's syndrome) and thyroid carcinoma. A case report and review of the literature. Dig Dis Sci 38, 185-90. Besi# N (2003) The role of initial debulking surgery in the management of anaplastic thyroid carcinoma. Surgery 133, 453-4;(author reply 454-5). Brandi ML, Gagel RF, Angeli A, Bilezikian JP, Beck-Peccoz P, Bordi C, Conte-Devolx B, Falchetti A, Gheri RG, Libroia A, Lips CJ, Lombardi G, Mannelli M, Pacini F, Ponder BA, Raue F, Skogseid B, Tamburrano G, Thakker RV, Thompson
C. Management of anaplastic thyroid carcinoma There is controversy regarding the ideal management of anaplastic carcinoma largely because it is rapidly progressing and poorly responsive to therapy (Sherman, 2003). Defining the goals of management is essential. The options for therapy range from multimodal therapy, surgical resection, debulking, radiotherapy, chemotherapy, and palliative therapy (Aldinger et al, 1978; Busnardo et al, 2000; Besic et al, 2003). Early disease, disease confined to the thyroid gland, is poorly responsive to unimodality therapy, however in a recent study, investigators reviewed a cohort of 516 patients with anaplastic thyroid carcinoma reported to 12 population-
16
Cancer Therapy Vol 7, page 17 NW, Tomassetti P, Tonelli F, Wells SA Jr, Marx SJ (2001) Guidelines for diagnosis and therapy of MEN type 1 and type 2. J Clin Endocrinol Metab 86, 5658-71. Brierley J, Tsang R, Simpson WJ, Gospodarowicz M, Sutcliffe S, Panzarella T (1996) Medullary thyroid cancer: analyses of survival and prognostic factors and the role of radiation therapy in local control. Thyroid 6, 305-10. Brierley JD, Tsang RW (1999) External-beam radiation therapy in the treatment of differentiated thyroid cancer. Semin Surg Oncol 16, 42-9. Brierley JD, Tsang RW (1996) External radiation therapy in the treatment of thyroid malignancy. Endocrinol Metab Clin North Am 25, 141-57. Burman KD (2006) Micropapillary thyroid cancer: should we aspirate all nodules regardless of size? J Clin Endocrinol Metab 91, 2043-6. Busnardo B, Daniele O, Pelizzo MR, Mazzarotto R, Nacamulli D, Devido D, Mian C, Girelli ME (2000) A multimodality therapeutic approach in anaplastic thyroid carcinoma: study on 39 patients. J Endocrinol Invest 23, 755-61. Byar DP, Green SB, Dor P, Williams ED, Colon J, van Gilse HA, Mayer M, Sylvester RJ, van Glabbeke M (1979) A prognostic index for thyroid carcinoma. A study of the E.O.R.T.C. Thyroid Cancer Cooperative Group. Eur J Cancer 15, 1033-41. Cady B, Rossi R (1988) An expanded view of risk-group definition in differentiated thyroid carcinoma. Surgery 104, 947-53. Carcangiu ML, Bianchi S, Savino D, Voynick IM, Rosai J (1991) Follicular Hurthle cell tumors of the thyroid gland. Cancer 68, 1944-53. Carcangiu ML, Zampi G, Pupi A, Castagnoli A, Rosai J (1985) A clinicopathologic study of 241 cases treated at the University of Florence, Italy. Cancer 55, 805-28. Casara D, Rubello D, Saladini G, Masarotto G, Favero A, Girelli ME, Busnardo B (1993) Different features of pulmonary metastases in differentiated thyroid cancer: natural history and multivariate statistical analysis of prognostic variables. J Nucl Med 34, 1626-31. Chatal JF, Campion L, Kraeber-Bodéré F, Bardet S, Vuillez JP, Charbonnel B, Rohmer V, Chang CH, Sharkey RM, Goldenberg DM, Barbet J; French Endocrine Tumor Group (2006) Survival improvement in patients with medullary thyroid carcinoma who undergo pretargeted anticarcinoembryonic-antigen radioimmunotherapy: a collaborative study with the French Endocrine Tumor Group. J Clin Oncol 24, 1705-11. Clark OH, Levin K, Zeng QH, Greenspan FS, Siperstein A (1988) Thyroid cancer: the case for total thyroidectomy. Eur J Cancer Clin Oncol 24, 305-13. Cooper DS, Doherty GM, Haugen BR, Kloos RT, Lee SL, Mandel SJ, Mazzaferri EL, McIver B, Sherman SI, Tuttle RM; The American Thyroid Association Guidelines Taskforce (2006) Management guidelines for patients with thyroid nodules and differentiated thyroid cancer. Thyroid 16, 109-42. Duh QY, Sancho JJ, Greenspan FS, Hunt TK, Galante M, deLorimier AA, Conte FA, Clark OH (1989) Medullary thyroid carcinoma. The need for early diagnosis and total thyroidectomy. Arch Surg 124, 1206-10. Eichhorn W, Tabler H, Lippold R, Lochmann M, Schreckenberger M, Bartenstein P (2003) Prognostic factors determining long-term survival in well-differentiated thyroid cancer: an analysis of four hundred eighty-four patients undergoing therapy and aftercare at the same institution. Thyroid 13, 949-58.
Evans HL, Vassilopoulou-Sellin R (1998) Follicular and Hurthle cell carcinomas of the thyroid: a comparative study. Am J Surg Pathol 22, 1512-20. Flanagan MB, Ohori NP, Carty SE, Hunt JL (2006) Repeat thyroid nodule fine-needle aspiration in patients with initial benign cytologic results. Am J Clin Pathol 125, 698-702. Forrest CH, Frost FA, de Boer WB, Spagnolo DV, Whitaker D, Sterrett BF (1998) Medullary carcinoma of the thyroid: accuracy of diagnosis of fine-needle aspiration cytology. Cancer 84, 295-302. Gharib H, Goellner JR, Johnson DA (1993) Fine-needle aspiration cytology of the thyroid. A 12-year experience with 11,000 biopsies. Clin Lab Med 13, 699-709. Goldman ND, Coniglio JU, Falk SA (1996) Thyroid cancers. I. Papillary, follicular, and Hürthle cell. Otolaryngol Clin North Am 29, 593-609. Gordon PR, Huvos AG, Strong EW (1973) Medullary carcinoma of the thyroid gland. A clinicopathologic study of 40 cases. Cancer 31, 915-24. Gottlieb JA, Hill CS Jr, Ibanez ML, Clark RL (1972) Chemotherapy of thyroid cancer. An evaluation of experience with 37 patients. Cancer 30, 848-53. Grebe SK, Hay ID (1997) Follicular cell-derived thyroid carcinomas. Cancer Treat Res 89, 91-140. Haber RS (2002) Ultrasound-guided fine-needle aspiration of thyroid nodules. Endocr Pract 8, 70-1. Haigh PI, Ituarte PH, Wu HS, Treseler PA, Posner MD, Quivey JM, Duh QY, Clark OH (2001) Completely resected anaplastic thyroid carcinoma combined with adjuvant chemotherapy and irradiation is associated with prolonged survival. Cancer 91, 2335-42. Handkiewcz-Junak D, Banasik T, Kolosza Z, Roskosz J, Kukulska A, Puch Z, Jarzab B (2006) Risk of malignant tumors in first-degree relatives of patients with differentiated thyroid cancer -- a hospital based study. Neoplasma 53, 6772. Harwood J, Clark OH, Dunphy JE (1978) Significance of lymph node metastasis in differentiated thyroid cancer. Am J Surg 136, 107-12. Hay ID (1990) Papillary thyroid carcinoma. Endocrinol Metab Clin North Am 19, 545-76. Hay ID, Bergstralh EJ, Goellner JR, Ebersold JR, Grant CS (1993) Predicting outcome in papillary thyroid carcinoma: development of a reliable prognostic scoring system in a cohort of 1779 patients surgically treated at one institution during 1940 through 1989. Surgery 114, 1050-7;(discussion 1057-8). Hay ID, Grant CS, Bergstralh EJ, Thompson GB, van Heerden JA, Goellner JR (1998) Unilateral total lobectomy: is it sufficient surgical treatment for patients with AMES low-risk papillary thyroid carcinoma? Surgery 124, 95864;(discussion 964-6). Hay ID, Grant CS, Taylor WF, McConahey WM (1987) Ipsilateral lobectomy versus bilateral lobar resection in papillary thyroid carcinoma: a retrospective analysis of surgical outcome using a novel prognostic scoring system. Surgery 102, 1088-95. Hay ID, Grant CS, van Heerden JA, Goellner JR, Ebersold JR, Bergstralh EJ (1992) Papillary thyroid microcarcinoma: a study of 535 cases observed in a 50-year period. Surgery 112, 1139-46;(discussion 1146-7). Hay ID, Klee GG (1993) Thyroid cancer diagnosis and management. Clin Lab Med 13, 725-34. Henry JF, Gramatica L, Denizot A, Kvachenyuk A, Puccini M, Defechereux T (1998) Morbidity of prophylactic lymph node dissection in the central neck area in patients with papillary thyroid carcinoma. Langenbecks Arch Surg 383, 167-9.
17
Genden and Brett: Contemporary management of thyroid carcinoma Hodak SP, Burman KD (2004) The calcitonin conundrum--is it time for routine measurement of serum calcitonin in patients with thyroid nodules? J Clin Endocrinol Metab 89, 511-4. Hundahl SA, Fleming ID, Fremgen AM, Menck HR (1998) A National Cancer Data Base report on 53,856 cases of thyroid carcinoma treated in the U.S., 1985-1995 [see comments]. Cancer 83, 2638-48. Inabnet WB (2000) Surgical management of thyroid cancer. Endocr Pract 6, 465-8. Jadvar H, McDougall IR, Segall GM (1998) Evaluation of suspected recurrent papillary thyroid carcinoma with [18F]fluorodeoxyglucose positron emission tomography. Nucl Med Commun 19, 547-54. Jereb B, Stjernswärd J, LÜwhagen T (1975) Anaplastic giant-cell carcinoma of the thyroid. A study of treatment and prognosis. Cancer 35, 1293-5. Kebebew E, Greenspan FS, Clark OH, Woeber KA, McMillan A (2005) Anaplastic thyroid carcinoma. Treatment outcome and prognostic factors. Cancer 103, 1330-5. Kim TH, Yang DS, Jung KY, Kim CY, Choi MS (2003) Value of external irradiation for locally advanced papillary thyroid cancer. Int J Radiat Oncol Biol Phys 55, 1006-12. Kitamura Y, Shimizu K, Nagahama M, Sugino K, Ozaki O, Mimura T, Ito K, Ito K, Tanaka S (1999) Immediate causes of death in thyroid carcinoma: clinicopathological analysis of 161 fatal cases. J Clin Endocrinol Metab 84, 4043-9. Koike E, Noguchi S, Yamashita H, Murakami T, Ohshima A, Kawamoto H, Yamashita H (2001) Ultrasonographic characteristics of thyroid nodules: prediction of malignancy. Arch Surg 136, 334-7. Krishnamurthy S, Bedi DG, Caraway NP (2001) Ultrasoundguided fine-needle aspiration biopsy of the thyroid bed. Cancer 93, 199-205. Levendag PC, De Porre PM, van Putten WL (1993) Anaplastic carcinoma of the thyroid gland treated by radiation therapy. Int J Radiat Oncol Biol Phys 26, 125-8. Libutti SK (2005) Understanding the role of gender in the incidence of thyroid cancer. Cancer J 11, 104-5. Liebeskind A, Sikora AG, Komisar A, Slavit D, Fried K (2005) Rates of malignancy in incidentally discovered thyroid nodules evaluated with sonography and fine-needle aspiration. J Ultrasound Med 24, 629-34. Lin JD, Chao TC, Huang BY, Chen ST, Chang HY, Hsueh C (2005) Thyroid cancer in the thyroid nodules evaluated by ultrasonography and fine-needle aspiration cytology. Thyroid 15, 708-17. Lin JD, Huang MJ, Juang JH, Chao TC, Huang BY, Chen KW, Chen JY, Li KL, Chen JF, Ho YS (1999) Factors related to the survival of papillary and follicular thyroid carcinoma patients with distant metastases. Thyroid 9, 1227-35. LiVolsi VA, Baloch ZW (2005) Use and abuse of frozen section in the diagnosis of follicular thyroid lesions. Endocr Pathol 16, 285-93. Luster M, Lippi F, Jarzab B, Perros P, Lassmann M, Reiners C, Pacini F (2005) rhTSH-aided radioiodine ablation and treatment of differentiated thyroid carcinoma: a comprehensive review. Endocr Relat Cancer 12, 49-64. Maheshwari YK, Hill CS Jr, Haynie TP 3rd, Hickey RC, Samaan NA (1981) 131I therapy in differentiated thyroid carcinoma: M.D. Anderson Hospital experience. Cancer 47, 664-71. Mandell DL, Genden EM, Mechanick JI, Bergman DA, Biller HF, Urken ML (2001) Diagnostic accuracy of fine-needle aspiration and frozen section in nodular thyroid disease. Otolaryngol Head Neck Surg 124, 531-6. Mazzaferri EL (1993) Management of a solitary thyroid nodule. N Engl J Med 328, 553-9.
Mazzaferri EL, Jhiang SM (1994) Long-term impact of initial surgical and medical therapy on papillary and follicular thyroid cancer. Am J Med 97, 418-28. Mazzaferri EL, Kloos RT (2001) Clinical review 128: Current approaches to primary therapy for papillary and follicular thyroid cancer. J Clin Endocrinol Metab 86, 1447-63. McConahey WM, Hay ID, Woolner LB, van Heerden JA, Taylor WF (1986) Papillary thyroid cancer treated at the Mayo Clinic, Mayo Clin Proc 61, 978-96. McDonald MP, Sanders LE, Silverman ML, Chan HS, Buyske J (1996) Hurthle cell carcinoma of the thyroid gland: prognostic factors and results of surgical treatment. Surgery 120, 1000-4;(discussion 1004-5). McGriff NJ, Csako G, Gourgiotis L, Lori C G, Pucino F, Sarlis NJ (2002) Effects of thyroid hormone suppression therapy on adverse clinical outcomes in thyroid cancer. Ann Med 34, 554-64. Meadows KM, Amdur RJ, Morris CG, Villaret DB, Mazzaferri EL, Mendenhall WM (2006) External beam radiotherapy for differentiated thyroid cancer. Am J Otolaryngol 27, 24-8. Mitchell G, Huddart R, Harmer C (1999) Phase II evaluation of high dose accelerated radiotherapy for anaplastic thyroid carcinoma. Radiother Oncol 50, 33-8. Miyakawa M, Onoda N, Etoh M, Fukuda I, Takano K, Okamoto T, Obara T (2005) Diagnosis of thyroid follicular carcinoma by the vascular pattern and velocimetric parameters using high resolution pulsed and power Doppler ultrasonography. Endocr J 52, 207-12. Moley JF, DeBenedetti MK (1999) Patterns of nodal metastases in palpable medullary thyroid carcinoma: recommendations for extent of node dissection. Ann Surg 229, 8807;(discussion 887-8). Moore FD, Dluhy RG (2005) Prophylactic thyroidectomy in MEN-2A--a stitch in time? N Engl J Med 353, 1162-4. Nishida T (2000) Local control in differentiated thyroid carcinoma with extrathyroidal invasion. Am J Surg 179, 8691. Noguchi M, Yamada H, Ohta N, Ishida T, Tajiri K, Fujii H, Miyazaki I (1987) Regional lymph node metastases in welldifferentiated thyroid carcinoma. Int Surg 72, 100-3. Orija IB, Hamrahian AH, Reddy SS (2004) Management of nondiagnostic thyroid fine-needle aspiration biopsy: survey of endocrinologists. Endocr Pract 10, 317-23. Raue F, Frank-Raue K, Grauer A (1994) Multiple endocrine neoplasia type 2. Clinical features and screening. Endocrinol Metab Clin North Am 23, 137-56. Reading CC, Gorman CA (1993) Thyroid imaging techniques. Clin Lab Med 13, 711-24. Rojeski MT, Gharib H (1985) Nodular thyroid disease. Evaluation and management. N Engl J Med 313, 428-36. Rosenbluth BD, Serrano V, Happersett L, Shaha AR, Tuttle RM, Narayana A, Wolden SL, Rosenzweig KE, Chong LM, Lee NY (2005) Intensity-modulated radiation therapy for the treatment of nonanaplastic thyroid cancer. Int J Radiat Oncol Biol Phys 63, 1419-26. Rossi RL, Cady B, Silverman ML, Wool MS, Horner TA (1986) Current results of conservative surgery for differentiated thyroid carcinoma. World J Surg 10, 612-22. Ruegemer JJ, Hay ID, Bergstralh EJ, Ryan JJ, Offord KP, Gorman CA (1988) Distant metastases in differentiated thyroid carcinoma: a multivariate analysis of prognostic variables. J Clin Endocrinol Metab 67, 501-8. Saad MF, Ordonez NG, Rashid RK, Guido JJ, Hill CS Jr, Hickey RC, Samaan NA (1984) Medullary carcinoma of the thyroid. A study of the clinical features and prognostic factors in 161 patients. Medicine (Baltimore) 63, 319-42.
18
Cancer Therapy Vol 7, page 19 Sanders LE, Cady B (1998) Differentiated thyroid cancer: reexamination of risk groups and outcome of treatment. Arch Surg 133, 419-25. Schlumberger M, Abdelmoumene N, Delisle MJ, Couette JE (1995) Treatment of advanced medullary thyroid cancer with an alternating combination of 5 FU-streptozocin and 5 FUdacarbazine. The Groupe d'Etude des Tumeurs a Calcitonine (GETC). Br J Cancer 71, 363-5. Schlumberger M, Challeton C, De Vathaire F, Travagli JP, Gardet P, Lumbroso JD, Francese C, Fontaine F, Ricard M, Parmentier C (1996) Radioactive iodine treatment and external radiotherapy for lung and bone metastases from thyroid carcinoma. J Nucl Med 37, 598-605. Shah JP, Loree TR, Dharker D, Strong EW (1993) Lobectomy versus total thyroidectomy for differentiated carcinoma of the thyroid: a matched-pair analysis. Am J Surg 166, 331-5. Shah JP, Loree TR, Dharker D, Strong EW, Begg C, Vlamis V (1992) Prognostic factors in differentiated carcinoma of the thyroid gland. Am J Surg 164, 658-61. Shaha AR, Shah JP, Loree TR (1997) Differentiated thyroid cancer presenting initially with distant metastasis. Am J Surg 174, 474-6. Shaha AR, Shah JP, Loree TR (1996) Patterns of nodal and distant metastasis based on histologic varieties in differentiated carcinoma of the thyroid. Am J Surg 172, 692-4. Sherman SI (2003) Thyroid carcinoma. Lancet 361, 501-11. Sherman SI, Brierley JD, Sperling M, Ain KB, Bigos ST, Cooper DS, Haugen BR, Ho M, Klein I, Ladenson PW, Robbins J, Ross DS, Specker B, Taylor T, Maxon HR 3rd (1998) Prospective multicenter study of thyrois]carcinoma treatment: initial analysis of staging and outcome. National Thyroid Cancer Treatment Cooperative Study Registry Group. Cancer 83, 1012-21. Sidawy MK, Del Vecchio DM, Knoll SM (1997) Fine-needle aspiration of thyroid nodules: correlation between cytology and histology and evaluation of discrepant cases. Cancer 81, 253-9. Sklar C, Whitton J, Mertens A, Stovall M, Green D, Marina N, Greffe B, Wolden S, Robison L (2000) Abnormalities of the thyroid in survivors of Hodgkin's disease: data from the Childhood Cancer Survivor Study. J Clin Endocrinol Metab 85, 3227-32. Spires JR, Schwartz MR, Miller RH (1988) Anaplastic thyroid carcinoma. Association with differentiated thyroid cancer. Arch Otolaryngol Head Neck Surg 114, 40-4. Stulak JM, Grant CS, Farley DR, Thompson GB, van Heerden JA, Hay ID, Reading CC, Charboneau JW (2006) Value of preoperative ultrasonography in the surgical management of initial and reoperative papillary thyroid cancer. Arch Surg 141, 489-94;(discussion 494-6). Sugitani I, Kasai N, Fujimoto Y, Yanagisawa A (2001) Prognostic factors and therapeutic strategy for anaplastic carcinoma of the thyroid. World J Surg 25, 617-22. Tennvall J, Tallroth E, el Hassan A, Lundell G, Akerman M, Biörklund A, Blomgren H, Löwhagen T, Wallin G (1990) Anaplastic thyroid carcinoma. Doxorubicin, hyperfractionated radiotherapy and surgery. Acta Oncol 29, 1025-8.
Thyroid Carcinoma Task Force (2001) AACE/AAES medical/surgical guidelines for clinical practice: management of thyroid carcinoma. American Association of Clinical Endocrinologists. American College of Endocrinology. Endocr Pract 7, 202-20. Tisell LE, Hansson G, Jansson S, Salander H (1986) Reoperation in the treatment of asymptomatic metastasizing medullary thyroid carcinoma. Surgery 99, 60-6. Tollin SR, Mery GM, Jelveh N, Fallon EF, Mikhail M, Blumenfeld W, Perlmutter S (2000) The use of fine-needle aspiration biopsy under ultrasound guidance to assess the risk of malignancy in patients with a multinodular goiter. Thyroid 10, 235-41. Tomoda C, Uruno T, Takamura Y, Ito Y, Miya A, Kobayashi K, Matsuzuka F, Kuma K, Miyauchi A (2005) Ultrasonography as a method of screening for tracheal invasion by papillary thyroid cancer. Surg Today 35, 819-22. Tronko MD, Howe GR, Bogdanova TI, Bouville AC, Epstein OV, Brill AB, Likhtarev IA, Fink DJ, Markov VV, Greenebaum E, Olijnyk VA, Masnyk IJ, Shpak VM, McConnell RJ, Tereshchenko VP, Robbins J, Zvinchuk OV, Zablotska LB, Hatch M, Luckyanov NK, Ron E, Thomas TL, Voillequé PG, Beebe GW (2006) A cohort study of thyroid cancer and other thyroid diseases after the chornobyl accident: thyroid cancer in Ukraine detected during first screening. J Natl Cancer Inst 98, 897-903. Tsang RW, Brierley JD, Simpson WJ, Panzarella T, Gospodarowicz MK, Sutcliffe SB (1998) The effects of surgery, radioiodine, and external radiation therapy on the clinical outcome of patients with differentiated thyroid carcinoma. Cancer 82, 375-88. van Heerden JA, Grant CS, Gharib H, Hay ID, Ilstrup DM (1990) Long-term course of patients with persistent hypercalcitoninemia after apparent curative primary surgery for medullary thyroid carcinoma. Ann Surg 212, 395400;(discussion 400-1). van Heerden JA, Hay ID, Goellner JR, Salomao D, Ebersold JR, Bergstralh EJ, Grant CS (1992) Follicular thyroid carcinoma with capsular invasion alone: a nonthreatening malignancy. Surgery 112, 1130-6;(discussion 1136-8). Venkatesh YS, Ordonez NG, Schultz PN, Hickey RC, Goepfert H, Samaan NA (1990) Anaplastic carcinoma of the thyroid. A clinicopathologic study of 121 cases. Cancer 66, 321-30. Voutilainen PE, Multanen M, Haapiainen RK, Leppäniemi AK, Sivula AH (1999) Anaplastic thyroid carcinoma survival. World J Surg 23, 975-8;(discussion 978-9). Wilson SM, Bock GE (1971) Carcinoma of the thyroid metastatic to lymph nodes of the neck. Arch Surg 102, 28591. Young RL, Mazzaferri EL, Rahe AJ, Dorfman SG (1980) Pure follicular thyroid carcinoma: impact of therapy in 214 patients. J Nucl Med 21, 733-7. Zimmer LA, McCook B, Meltzer C, Fukui M, Bascom D, Snyderman C, Townsend DW, Johnson JT (2003) Combined positron emission tomography/computed tomography imaging of recurrent thyroid cancer. Otolaryngol Head Neck Surg 128, 178-84.
19
Genden and Brett: Contemporary management of thyroid carcinoma
20
Cancer Therapy Vol 7, page 21 Cancer Therapy Vol 7, 21-26, 2009
Splenic marginal B-cell lymphoma with epithelioid granulomas. Report of a case with cytologic and immunohistochemical study Case Report
Juan B. Laforga1, F. Ignacio Aranda2, Joan M. Gasent3 1
Department of Pathology, Hospital de Denia, Denia, Alicante, Spain Department of Pathology, Hospital General de Alicante, Alicante, Spain 3 Department of Oncology, Hospital de Denia, Denia, Alicante, Spain 2
__________________________________________________________________________________ *Correspondence: Dr. Juan B. Laforga, Servicio de Patología, Hospital de Denia.Ptda Beniadla S/N, 03700 Denia. Alicante, Spain; email: laforga_jua@gva.es Key words: Splenic marginal zone lymphoma; Epithelioid Granuloma; Cytology; Immunohistochemistry Abbreviations: non-Hodgkin lymphomas, (NHL); Splenic marginal zone lymphoma, (SMZL); World Health Organization, (WHO) Received: 27 October 2008; Revised: 17 November 2008 Accepted: 19 November 2008; electronically published: January 2009
Summary Splenic marginal zone lymphoma (SMZL) is a rare and distinctive type of low-grade B-cell lymphoma. We report a case of SMZL in a 42 yr-old male patient which presented splenomegaly and peripheral blood containing “villous lymphocytes”. The diagnosis was obscured by the presence of many epithelioid granulomas which created troubles to make the accurate diagnosis. The bone marrow also was involved by a nodular pattern of atypical lymphoid cells. Immnohistochemical study showed the typical immunophenotype with CD20+, BCL-2+, CD10 -, CD5 -, CD21- and cyclin D1-. The epithelioid granulomas stained with CD68. Touch imprints from the spleen showed many epithelioid granulomas containing lymphocytes, some of which disclosed atypical features. The presence of striking welldeveloped epithelioid granulomas in cytologic material obtained from FNAB of lymph nodes or spleen should alert to include lymphoproliferative diseases in the differential diagnosis which could be easily missed if it is not taken into consideration.
We describe a case of SMZL with epithelioid granulomas along the entire splenic white pulp which caused problems to make accurately the diagnosis. In addition, the patient presented peripheral blood and bone marrow involvement with a nodular pattern.
I. Introduction Splenic marginal zone lymphoma (SMZL) is a rare subtype of lymphoma accounting less of 1% of all nonHodgkin lymphomas (NHL) and about 20% of primary splenic NHLs (Dogan and Isaacson, 2003). It is considered as a distinct entity in the World Health Organization (WHO) Classification scheme (Isaacson et al, 2008). Generally it is characterized by massive splenomegaly and involvement of bone marrow and peripheral blood (Franco et al, 2003). The presences of non-necrotic epithelioid cell granulomas are well known findings in lymph nodes, spleen, bone marrow, and liver from patients with Hodgkin’s disease (Kadin et al, 1970; Bricken, 1972). Such granulomas are few in number. Epithelioid granulomas in association with non-Hodgkin’s lymphomas are only rarely observed (Bricken, 1972; Dorfman and Kim, 1975; Hall et al, 1988; Hollingsworth et al, 1993).
II. Material and Methods A. Case report A 42 year-old man presented with a week history of leftsided abdominal discomfort and asthenia. Physical examination was notable for palpable spleen 5 fingerbreadths below the left costal margin. There was not peripheral or abdominal lymphadenopathy. The hemogram showed Hb 8.1 g/dl, VCM 74 fl, leucocytes 7.1 x109/L (n 36%, lymph 39%), PLT 197.000 x 109/L. Serologic tests against toxoplasma, VHB, VHC, HIV, CMV, VEB and agglutination for Brucella-Salmonella were negative. 2% of villous lymphocytes were noted on peripheral smear. The Immunocytologic study from peripheral blood showed
21
Laforga et al: Splenic marginal lymphoma with epithelioid granulomas CD19+, CD5-, CD10-, CD23-, CD25-, CD103-, CD11c+. The atypical lymphocytes lacked surface immunoglobulins. An abdominal CT scan showed splenomegaly. The patient underwent a bone marrow biopsy followed by a splenectomy. He received 8 cycles of CHOP-Rituximab every 21 days, and at the last control, was considered in complete remission a year after slpenectomy.
hematopoyesis were observed. Zhiel-Nilsen, PAS and Grocott stains were negative.
C. Immunohistochemical features Both the bone marrow and white and red pulp of the spleen showed infiltration by atypical cells stained with CD20, CD79a and bcl-2 (Figure 2D). The epithelioid granulomas also were infiltrated by these cells Figure 2B). The epithelioid cells from the granulomas in the spleen stained with CD68 (Figure 2C). Stains for CD5, CD10, CD21, bcl-6, Cyclin D1, CD43 and IgD were negative. With ki-67 the proliferative activity was low.
B. Pathologic study The bone marrow showed a nodular infiltration made of intermediate atypical lymphocytes (Figure 2D). The surrounding tissue showed myelodisplastic changes. Splenectomy: Grossly, the spleen measured 29 x 18 x 5 cm and weighted 1910 g. The capsule was smooth and brilliant. At cut section, the white pulp showed a vaguely nodular appearance. The hylium lacked any adenopathy. Microscopically, the white pulp showed a striking presence of epithelioid granulomas, which occasionally showed coalescence, and without necrosis. They were surrounded by a crown of lymphocytes and occasionally atypical lymphocytes of medium size, with round nuclei, clumped chromatin, small nucleoli and moderate amount of cytoplasm (Figure 1D and Figure2 A). Focally,
D. Cytologic features Touch-imprints were taken from the splenectomy tissue. They were stained with Giemsa stain. The slides showed a bloody background and many three-dimensional structures formed by loosely cohesive epithelioid cells containing large amounts of cytoplasms and multiple round to ovoid nuclei with bland chromatin. These epithelial cells were surrounded by small and intermediate sized lymphocytes, some of which exhibited atypical nuclear features such as slightly irregular nuclei with clumped chromatin and frequent small nucleoli. The cytoplasms showed distinct borders (Figure 1 A, B, C).
Figure 1. (A) Touch imprints from the spleen showing loosely aggregates of epithelioid cells (Diff-Qick stain, x400). (B) Large epithelioid granuloma showing scattered lymphocytes with atypical nuclei (Diff Quick stain, x400). (C) The small lymphocytes are surrounding the epithelioid cells (Diff-Quick stain, x400). (D) White pulp of the spleen showing sticking epithelioid granulomas (hematoxylin-eosin, x100).
22
Cancer Therapy Vol 7, page 23
Figure 2. (A) Spleen showing epithelioid granuloma surrounded by atypical small lymphocytes (hematoxylin-eosin, x400). (B) Atypical lymphocytes surround and infiltrate the epithelioid granulomas (CD20 stain, x400). (C) The epithelioid cells stained diffusely with CD68 (CD68 stain, x400). (D) Bone marrow showing a nodular infiltration by atypical small to medium-size cells (CD20 stain, x 250).
granulomatous reaction arranged around and within the neoplastic nodules, which obscured the neoplastic infiltrate (Mollejo et al, 1995). The presence of this epithelioid histiocytic response has been reported in 2 to 7% of cases of non-Hodkin’s lymphoma, and in many the granulomas were found in sites not involved by lymphoma (Kim and Dorfman, 1974; Brincker, 1986). In contrast, this finding has been reported in 2 to 29% of cases of large series of Hodkin’s lymphomas (Kadin et al, 1970; O’connell et al, 1975; Pick et al, 1978; Sacks et al, 1978; Brincker, 1986). Cases of Hodgkin lymphomas with epithelioid granulomas have a better prognosis and disease free and relapse-free survival rates (O’connell et al, 1975; Sacks et al, 1978; Colby and Warnke, 1980; Brincker, 1986). There is limited information about the prognostic significance of granulomatous reaction in non-Hodgkin’s lymphoma. A delay in the diagnosis and treatment has been reported (Braylan et al, 1977; Kahn et al, 1977). Regarding the average age in SMZL range from 63 to 69 (Dogan and Isaacson, 2003). It is extremely rare in patients younger than 30 years, although a case was reported in a 22-year-old woman (Depowski et al, 2002). Interestingly our patient was only 42 years old, similarly
III. Discussion The case under discussion exhibited three particular features which are rare in this entity. First, the age of presentation. The majority of SLMZ appears at sixties or even more. Second, the presence of large number of epithelioid granulomas which obscured the diagnosis. Third, the pattern of involvement of bone marrow, which in the large percentage of cases show interstitial infiltration. Of these, obviously the most important is the presence of florid granulomatous reaction because of the difficulties to make an accurate diagnosis. This striking feature was reported in many lymphoid neoplasms. In the spleen, this rare eventuality was first described by Braylan and colleagues in 1977 who reported the unusual combination of malignant lymphoma and non-necrotic granulomas in three patients with prominent splenomegaly without peripheral lymphadenopathy. Thus, the presence of large number of concomitant granulomas resulted in difficulty in microscopic interpretation with considerable delay in arriving to a correct diagnosis. Retrospectively, the clinical and morphologic features fit well with this entity. In a series of 13 patients with SMZL, 2 cases showed a conspicuous presence of non-necrotic
23
Laforga et al: Splenic marginal lymphoma with epithelioid granulomas patients presenting primary splenic marginal zone lymphoma with or without circulating villous lymphocytes. Br J Haematol 122, 404-412. Braylan RC, Long JC, Jaffe ES, Greco FA, Orr SL, Berard CW (1977) Malignant lymphoma obscured by concomitant extensive epithelioid granulomas. Cancer 39, 1147-1155. Bricken H (1972) Sarcoid reactions and sarcoidosis ion Hodgkin’s disease and other malignant lymphomata. BrJ Cancer 26, 120-128. Brincker H (1986) Sarcoid reactions in malignant tumors. Cancer Treat Rev 13, 147-56. Colby TV, Warnke RA (1980) The histology of the initial relapse of Hodgkin’s disease. Cancer 45, 289-92. Costes V, Duchayne E, Taib J, Delfour C, Rousset T, Baldet P, Delsol G, Brousset P (2002) Intrasinusoidal bone marrow infiltration: a common growth for different lymphoma subtypes. Br J Haematol 119, 916-22. Depowski PL, Dunn H, Purdy S, Ross J, Nazeer T (2002) Splenic marginal zone lymphoma. A case report and review of the literature. Arch Pathol Lab Med 126, 214-216. Dogan A, Isaacson PG (2003) Splenic marginal zone lymphoma. Semin Diagn Pathol 20, 121-127. Dorfman RF, Kim H (1975) Relationship of histology to site in the non-Hodgkin’s lymphomata: A study based on surgical staging procedures. Br J Cancer 31(Suppl 2), 217-220. Franco V, Florena AM, Campesi G (1996) Intrasinusoidal bone marrow infiltration: a possible hallmark of splenic lymphoma. Histopathology 29, 571-5. Franco V, Florena AM, Iannitto E (2003) Splenic marginal zone lymphoma. Blood 101, 2464-2472. Hall PA, Kingston J, Stansfeld AG (1988) Extensive necrosis in malignant lymphoma with granulomatous reaction mimicking tuberculosis. Histopathology 13, 339-346. Heymer B (1980) Sarcoid-like granulomatous reactions against malignancies. In:Grundmann E, ed. Metastatic tumor growth. New York, Gustav Fischer Verlag 167-72. Hollingsworth HC, Longo DL, Jaffe ES (1993) Small noncleaved cell lymphoma associated with florid epithelioid granulomatous response. A clinicopathologic study of seven patients. Am J Surg Pathol 17, 51-59. Isaacson PG, Piris MA, Berger F, Swerdlow SH, Thieblemont C, Pittaluga S, Harris NL. (2008) Splenic B-cell marginal zone lymphoma. In Swerdlow SH, Campo E, Harris NL, Jaffe ES, Pileri SA, Stein H, Thiele J, Vardiman JW (Eds.): WHO classification of tumours of haematopoietic and lymphoid tissues. IARC, Lyon 85-187. Kadin ME, Donaldson SS, Dorfman RF (1970) Isolated granulomas in Hodgkin’s disease. N Engl J Med 283, 859861. Kahn LB, King H, Jacobs IP (1977) Florid epithelioid cell and sarcoid-type reaction associated with non-Hodgkin’s lymphoma. S AfrMed J 51, 341-7. Kent SA, Variakojis D, Peterson LC (2002) Comparative study of marginal zone lymphoma involving bone marrow. Am J Clin Pathol 117, 698-708. Kim H, Dorfman RF (1974) Morphological studies of 84 untreated patients subjected to laparotomy for the staging of non-Hodgkin’s lymphomas. Cancer 33, 657-74. Labouyrie E, Marit G, Vial JP, Lacombe F, Fialon P, Bernard P, de Mascarel A, Merlio JP (1997) Intrasinusoidal bone marrow involvement by splenic lymphoma with villous lymphocytes: a helpful immunohistologic feature. Mod Pathol 10, 1015-20. López JI, Del Cura JL, Fernández de Larrinoa A, Gorriño O, Zabala R, Bilbao FJ (2006) Role of ultrasound-guided core biopsy in the evaluation of spleen pathology. APMIS 114, 492-499.
to the case reported recently, of 40 years old (Manipadam et al, 2007). Concerning the bone marrow infiltration in SMZL it was largely studied. It appears that the intrasinusoidal pattern is a hallmark of this entity or at least may be a helpful feature (Franco et al, 1996; Labouyrie et al, 1997; Costes et al, 2002; Audouin et al, 2003; Schenka et al, 2003; Pich et al, 2006). However, it was not invariably present, and was not specific for SMZL since similar pattern of infiltrates were found in patients with other small B-cell lymphoproliferative disorders (Kent et al, 2002). Our case, showed an interstitial nodular pattern of infiltration, again similarly to other case report (Manipadam et al, 2007). Many possible mechanisms of genesis of granulomas in tumors have been postulated. Antigens derived from the tumor cells could stimulate the activation of monocytes to form epithelioid histiocytes, by means of a hypersensitivity reaction mediated by T-helper cells (Brincker, 1986). We call attention to the eventual presence of epithelioid granulomas found in FNAB or ultrasoundguided core biopsy of the spleen, which may be the initial approach in the study of spleen pathology (López et al, 2006). Initially, the first temptation is to think about a sarcoid or inflammatory/infectious disease involving spleen or lymph nodes. However, more close attention to the small atypical lymphocytes (which may be easy to miss) should alert to the possible diagnosis of SMZL, and indicate the diagnostic splenectomy to make an accurate diagnosis. Furthermore, the serologic studies ruled-out granulomatous infections. Splenic sarcoidosis should be considered in the differential diagnosis, the hallmark of this entity is the noncaseating granuloma, made up of monocytes that have differentiated into epithelioid monocytes and multinucleated giant cells which may contain inclusions (Schaumann bodies, asteroid bodies, and residual bodies). A clue to the diagnosis of sarcoidosis is the presence of a dense band of fibroblasts, collagen and occasional mast cells which were lacking in this case. In cases like the one under discussion in which the atpypial lymphoid cells are intermixed with the prominent granulomaotus reaction, to make the correct diagnosis may be a challenge. Then, flow cytometry should be very helpful, providing evidence of light chain reaction, which was not available in our case. In summary, to the best of our knowledge, we report the cytologic features of a SMZL containing epithelioid granulomas, for the first time. The presence of lymphocytes with atypical nuclei in the context of a granulomatous reaction should be considered suspicious.
Acknowledgment The authors are grateful with Dr. Miguel A. Piris (CNIO, Madrid) in confirming the diagnosis.
References Audouin J, Le Tourneau A, Molina T, Camilleri-Broët S, Adida C, Comperat E, Benattar L, Delmer A, Devidas A, Rio B, Diebold J (2003) Patterns of bone marrow involvement in 58
24
Cancer Therapy Vol 7, page 25 Manipadam MT, Viswabandya A, Sirvastava A (2007) Primary splenic marginal zone lymphoma with florid granulomatous reaction-A case report and review of literature. Pathol Res Practice 203, 239-243. Mollejo M, Menárguez J, Lloret E, Sánchez A, Campo E, Algara P, Cristóbal E, Sánchez E, Piris MA (1995) Splenic marginal zone lymphoma: A distinctive type of low-grade lymphoma. A clinicopathological study of 13 cases. Am J Surg Pathol 19, 1146-1157. O’connell MJ, Schimpff SC, Kirschner RH, Abt AB, Wiernik PH (1975) Epithelioid granulomas in Hodgkin’s disease. JAMA 233, 886-9. Pich A, Fraire F, Fornari A, Bonino LD, Godio L, Bortolin P, Chiusa L, Palestro G (2006) Intrasinusoidal bone marrow
infiltration and splenic marginal zone lymphoma: a quantitative study. Eur J Haematol 76, 392-8. Pick AI, Duer D, Kessler H, Kenan Z, Weiss H, Topilski M (1978) Delayed hypersensivity and lymphocitic transformation in patients with Hodgkin’s disease and granulomas. Cancer 41, 2192-6. Sacks EL, Donaldson SS, Gordon J, Dorfman RF (1978) Epithelioid granulomas associated with Hodgkin’s diseaseclinical correlations in 55 previously untreated patients. Cancer 41, 562-567. Schenka AA, Gascoyne RD, Duchayne E, Delsol G, Brousset P (2003) Prominent intrasinusoidal infiltration of the bone marrow by mantle cell lymphoma. Hum Pathol 34, 789-791.
From left to right: Juan B. Laforga and F. Ignacio Aranda
25
Laforga et al: Splenic marginal lymphoma with epithelioid granulomas
26
Cancer Therapy Vol 7, page 27 Cancer Therapy Vol 7, 27-30, 2009
Size over 20mm is an independent risk factor of endoscopic mucosa resection (EMR) for colorectal lateral spread tumor (LST): A prospective study and multivariate analysis Research Article
Hei-Ying Jin*, Kunlan Wu, Hui Ye, Yong Zhu, Jinhao Zhang, Yijiang Ding National Center of Colorectal Surgery, the 3rd Affiliated Hospital of Nanjing University of Traditional Chinese Medicine, 1 Jinling Road, Nanjing 210001, China.
__________________________________________________________________________________ *Correspondence: Hei-Ying Jin, National Center of Colorectal Surgery, the 3rd Affiliated Hospital of Nanjing University of Traditional Chinese Medicine, 1 Jinling Road, Nanjing 210001, China; e-mail: jinheiying@yahoo.com.cn Key words: endoscopic mucosa resection, colorectal lateral spread tumor Abbreviations: endoscopic mucosa resection, (EMR); endoscopic submucosa dissection, (ESD); granular type, (G-type); Lateral spreading tumors, (LST); Nanjing University of Traditional Chinese Medicine, (NUTCM) Received: 17 September 2008; Revised: 3 November 2008 Accepted: 12 November 2008; electronically published: January 2009
Summary Lateral spreading tumors (LST) of the colorectum are lesions over 10mm in diameter and extend laterally along the luminal wall. Most of literatures show that endoscopic mucosa resection (EMR) for LST is an efficient and safe procedure. But there exist some complications such as bleeding, perforation and recurrence. This study aims to investigate the related risk factors of EMR for LST and find some controllable factors and reduce the complications of EMR for LSTs. Data were collected prospectively from cases with LSTs and treated by EMR from October 2004 to October 2007 in the National Center of colorectal surgery, the Third Affiliated Hospital of Nanjing University of Traditional Chinese Medicine (NUTCM). Factors of complication were analyzed with multivariate logistic regression (stepwise forward algorithm). There were 94 lesions in 84 patients which were treated by EMR in NUTCM. Fifty-six patients were male and 28 were female. The average age was 57±13yrs (ranged from 30 to 85yrs). Ten (10.6%)lesions were located in the cecum and ascending colon, 9 (9.6%) in the transverse colon, 12 (12.8%) in the descending colon, 27 (28.7%)in the sigmoid colon and 36 (38.3%) in the rectum. Sixty-three lesions (69.2%) were of the granular type (G-type) and 28 lesions (20.8%) were the flat type (F-type). Pathological findings showed that 69 (73.4%) lesions were tubular adenomas, 6 (6.4%) villous adenomas, 17(18.1%) were mixed type adenomas and 2 (2.1%) were T1 colorectal cancer. the average size of the polyps was 15±7mm (ranged from 10 to 40mm). Eighty-three lesions were removed by en-bloc resection and 11 lesions were removed by piecemeal resection. Two patients bled when the procedure was done and they were successfully treated with clips, and 2 patients bled after EMR at 3 and 6 days and and were treated conservatively. Mean followed-up time was 25±7 Months (ranged from 3 to36 months). Three cases were found to have a recurrence of lesions. On the univariate analysis, recurrence was found to be related to piecemeal resection and size over 20mm, while the bleeding and total complications were related to the piecemeal resection, pathology and size over 20mm. The logistic regression found that the total complications were independently related to the size over 20mm. Size over 20mm is an independent risk factor for LSTs treated by EMR. For the LST over 20mm, it is suggested that another method should be considered, such as Endoscopic submucosa dissection (ESD) or even a major operation.
2002). Most of literature indicates that endoscopic mucosa resection (EMR) for LST is an efficient and safe procedure (Hurstone et al, 2004). However, there can be certain complications such as bleeding, perforation and
I. Introduction Lateral spreading tumors (LST) of the colorectum are lesions over 10mm in diameter which extend laterally along the luminal wall (Paris Workshop Participants, 27
Jin et al: Independent risk factor of EMR for colorectal LST recurrence. Hurstone and colleagues reported in 2006 the EMR bleeding rate for LST to be 10% and the recurrence rate 17%.Tanaka and colleagues reported in 2001 that the rate of bleeding after EMR was 16% and the rate of local recurrence was 7.4%. Though some studieshave mentioned the complications of EMR, there were no many paper to study of the risk factors of EMR for LSTs (Yokota et al, 1994; Rembacken et al, 2001). This study aims to investigate the related risk factors of EMR for LST and identify those controllable factors which might allow a reduction of such complications.
III. Results A. Patient demographic data From 2004.10 to 2007.10, there were 94 lesions in 84 patients which were treated by EMR in NUTCM. Fifty-six patients were male and 28 were female. The average age was 57±13yrs (range from 30 to 85yrs). Ten (10.6%) lesions were located in the cecum and ascending colon, 9 (9.6%) in the transverse colon, 12 (12.8%) in the descending colon, 27 (28.7%) in the sigmoid colon and 36(38.3%) in the rectum. Sixty-three lesions (69.2%) were of the granular type (G-type) and 28 lesions (20.8%) were the flat type (F-type). The pathological findings showed that 69 (73.4%) lesions were tubular adenomas, 6 (6.4%) villous adenomas, 17(18.1%) mixed type adenoma and 2(2.1%) T1 colorectal cancer. As evaluated by forceps biopsy, the average size of the polyps were 15±7mm (range from 10 to 40mm). Eighty-three lesions were removed by en-bloc resection and 11 lesions were removed by piecemeal resection.
II. Materials and methods A. Patients Data were collected prospectively from cases with LSTs and treated by EMR from October 2004 to October 2007 in the National Center of colorectal surgery, the Third Affiliated Hospital of NUTCM. All patients signed an informed consent before the study. All the patients were diagnosed with LSTs and were treated by EMR. Patients were excluded if: (1) lesions had spread to the submucosa or muscle layer; (2) blood test showed that the CEA level was high and thus suspected to be invasive cancers; (3) there was the absence of any lift sign and hence they were unresectable endoscopically.
B. Complications There was no perforation when EMR was performed. Two patients bled when the procedure was done and were successfully treated with clips. Two patients bled after EMR 3 days and were treated conservatively. All of the patients underwent follow-up. The mean follow-up time was 25±7 Months (range from 3 to36 months). Three cases were found to have a recurrence of lesions. One case was found with a 6mm lesion in the rectum after 6 months, which (and were) was removed endoscopically; (and) the pathological type was villous adenoma. One case was found with a 2mm lesion in the site of EMR after 12 months and the pathological features were of a (was) tubular adenoma. One case was found to have a 10mm lesion near the scar of EMR and was resected locally through (anal and) the anus. The pathological features were of a (was) villous adenoma.
B. Procedures (Yokota et al, 1994; Rembacken et al, 2001; Tanaka et al, 2001; Bergmann and Beger, 2003; Hurstone et al, 2004) After the lesions were located, 0.9% indigo carmine dye was sprayed around the lesions and magnification colonoscopy was used to inspect the lesions and mark the cutting margin. The “lift and cut” EMR technique was used. Briefly, a 50% glucose solution with 1:30000 was injected into the submucosal layer below the lesion using a 23-gauge needle to separate the mucosa from the muscularis propria. Next, a diathermy snare was placed around the raised polyp in the surrounding normal colorectal epithelium. Resection was then carried out, using cutting and coagulation currents. En bloc resection was always attempted in order to obtain a satisfactory histological specimen. If this was impossible, piecemeal resection was done. Resection was judged to be endoscopically complete if, after excision, the muscle layer became visible, and was surrounded by normal epithelium.
C. Analysis of the risk factors of EMR Data were gathered for analysis which included gender, age, lesion site, histological type, size over 20mm or not, en-bloc resection or piecemeal resection. The risk factors related to the bleeding, recurrence and total complications were analyzed and Logistic regression was adopted for multivariate analysis. In the univariate analysis, recurrence was related to piecemeal resection and size over 20mm, while the bleeding and total complications were related to the piecemeal resection, pathology and size over 20mm. The results of the univariate analysis are summarized in Table 1. The Logistic regression found that the total complications were independently related to the size over 20mm. The results of multivariate analysis are summarized in Table 2.
C. Follow-up After EMR, Patients were followed up endoscopically at 3,6,12 and 24 months. Recurrenctlesions were defined as tumor evident at previous EMR sites or tumor adjacent to the EMR scar.
D. Statistics Statistical evaluation was performed using SPSS 14 (SPSS Inc., Chicago, IL, USA) for Windows. Continuous parameters are shown either as the mean ± standard deviation and were analyzed with Student t-tests for independent groups. Categorical variables were analyzed with the Chi-Square-test or, where appropriate, with Fisher`s exact test or log-rank non-parametric analysis. A p-value of < 0.05 was considered significant. Factors of complication were analyzed with multivariate logistic regression (stepwise forward algorithm).
IV. Discussion Certain studieshave suggested the management of LSTs by EMR to be an efficient and safe procedure (Yokota et al, 1994; Rembacken et al, 2001; Tanaka et al, 2001; Bergmann and Beger, 2003; Hurstone et al, 2004). 28
Cancer Therapy Vol 7, page 29 Table 1. The results of univariate analysis (n=94*).
no age Gende: male female Piecemeal resection Yes no site ascending transverse descending sigmoid rectum Pathology tubular villous mixed T1 cancer size: !20mm 20mm
bleeding yes p
57±13
57±15
60 30
4 0
no
0.972 0.162
58±13 64 27
recurrence yes p 48±12 0 3
0.032 11 79
2 2
10 9 11 25 35
0 0 1 2 1
69 5 15 1
0 1 2 1
82 8
0 4
Total complication# no yes p
0.796 0.07
57±13
58±12
61 27
3 3
0.007 11 80
2 1
10 9 12 27 33
0 0 0 0 3
68 5 16 2
1 1 1 0
81 10
1 2
0.702
0.008 10 78
3 3
10 9 11 26 32
0 0 1 1 4
68 4 15 1
1 2 2 1
81 7
1 5
0.288
0.003
0.551
0.118
0.000
0.874 0.326
0.000
0.004
0.000
*if a patient had 2 LSTs, he was analyzed as two cases #One patients had bleeding and recurrence
Table 2. The results of multivariate analysis (n=94)
gender age piecemeal pathology site size 20mm
B 4.293 -.027 -2.602 .980 1.072 7.530
S.E. 2.403 .059 1.895 .724 .688 3.039
Wald 3.191 .218 1.885 1.833 2.428 6.139
Although there can be certain complications such as bleeding, perforation and recurrence, the rate of the complications is acceptable, which means a range from 5% to 20%. Yokota and colleagues in 1994 in their series involving 137 flat lesions resected by EMR found complication rates of 0.7% and 0.4% for perforation and bleeding, respectively. Bergmann and Berger used in 2003 EMR for 71 lesions of sizes ranging from 10 to 50 mm. They encountered 1 case of bleeding which was treated endoscopically and 1 case of perforation, which was treated by surgery. At 18 months follow-up, local recurrence was observed in 2 cases. In our group, the bleeding rate was 4.3% and the recurrence rate 3.4%, which is similar to previous reports. However, there are not many papers of the risk factors for complications OF EMR. From the results of the univariate analysis, the rate of bleeding and recurrence are related to the piecemeal
df 1 1 1 1 1 1
Sig. .074 .641 .170 .176 .119 .013
Exp(B) 73.197 .973 .074 2.664 2.922 1862.601
resection, pathological type and size over 20mm, whilethe multivariate analysis shows that the size over 20mm is an independent risk factor. Because the LST is characterized as flat lesion which is spread along the bowel wall if the size is over 20mm, it is very difficult to perform en-bloc resection. Most of them have to be resected piecemeally, which means that the piecemeal resection is a relative risk factor with the size over 20mm. Therefore, in the multivariate analysis, the size over 20mm becomes the independent risk factor. Jameel and colleagues reported in 2001 33 EMRs which were performed on 30 lesions in 24 of these patients. Two cases were found with bleeding and no recurrence of lesion was found on the median 21 month follow-up. Kato and colleagues reported in 2001 that the EMR indication for LST was not limited by the size of lesion, but rather, the lifting condition, which means that lesion can be resected without any sign of lift. Saitor and
29
Jin et al: Independent risk factor of EMR for colorectal LST of lateral spread tumors: a prospective analysis of endoscopic mucosa resection. Gut 53, 1334-1339. Jameel JK, Pillinger SH, Moncur P, Tsai HH, Duthie GS (2001) Endoscopic mucosal resection (EMR) in the management of large colo-rectal polyps. Endoscopy 33, 682-686. Kato H, Haga S, Endo S, Hashimoto M, Katsube T, Oi J, Aiba M, Kajiwara T (2001) Lifting of lesions during endoscopic mucosa resection(EMR)of early colorectal cancer:implication for the assessment of resection. Endoscopy 33, 568-573. Paris Workshop Participants (2002) The Paris endoscopic classification of superficial neoplastic lesions: esophagus, stomach and colon. Gastrointest Endosc 58, S3-S43. Rembacken BJ, Gotoda T, Fujii T, Axon AT (2001) Endoscopic mucosal resection. Endoscopy 33, 709-18. Saito Y, Fujii T, Kondo H, Mukai H, Yokota T, Kozu T, Saito D (2001) Endoscopic treatment for laterally spreading tumors in the colon. Endoscopy 33, 682-686. Tanaka S, Haruma K, Oka S, Takahashi R, Kunihiro M, Kitadai Y, Yoshihara M, Shimamoto F, Chayama K (2001) Clinicopathological features and endoscopic treatment of superficial spreading colorectal neoplasms larger than 20 mm. Gastrointest Endosc 54, 62-66. Yokota T, Sugihara K, Yoshida S (1994) Endoscopic mucosal resection for colorectal neoplastic lesions. Dis Col Rectum 37, 1108-11.
colleagues also reported in 2001 that the EMR for LST was limited by submucosal invasion ,which depended on the historical type and the level of depression in the tumor. EMR for LST is a safety and efficient technique, but for these lesion over 20mm, the complication is higher. For those patients, except for the EMR, other technique such as endoscopic submucosa dissection (ESD) or surgery should be resorted to (Hurlstone et al, 2006; Arebi et al, 2007).
References Arebi N, Swain D, Suzuki N, Fraser C, Price A, Brain P. Saunder S (2007) Endoscopic mucosal resection of 161 cases of large sessile or flat colorectal polyps. Scand J Gastroenter 42, 859-866. Bergmann U, Beger HG (2003) Endoscopic mucosal resection for advanced non-polypoid colorectal adenoma and early stage carcinoma. Surg Endosc 17, 475-9. Hurlstone DP, Sanders DS, Thomson M, Cross SS (2006) â&#x20AC;&#x153;Salvageâ&#x20AC;? endoscopic mucosal resection in the colon using a retroflexion gastroscope dissection technique:a prospective analysis. Endoscopy 38, 902-906. Hurstone DP, Sanders DS, Cross SS, Adam I, Shorthouse AJ, Brown S, Drew K, Lobo AJ (2004) Colonoscopic resection
30
Cancer Therapy Vol 7, page 31 Cancer Therapy Vol 7, 31-34, 2009
Pseudomixoma peritonei: a case report Case Report
Raffaele Lanteri*, Marco Santangelo, Cristian Rapisarda, Agostino Racalbuto, Antonio Di Cataldo, Antonio Licata Department of Surgical Sciences, Organ Transplantations and Advanced Technologies – University of Catania
__________________________________________________________________________________ *Correspondence: Raffaele Lanteri M.D. Ph.D., Department of Surgical Sciences, Organ Transplantations and Advanced Technologies, Viale Andrea Doria 59, Italy; Tel 00390957167481; Fax 0039095221529; e-mail: lanteri@unict.it Key words: pseudomixoma, peritonei, tumour, mucocele, chemotherapy Received: 29 June 2007; Revised: 10 December 2008 Accepted: 17 December 2008; electronically published: January 2009
Summary Pseudomyxoma is a rare disease characterized by the accumulation of mucus in the abdominal cavity. It is generally caused by a malignant tumour or peritoneal implantation from ruptured benign cysts or appendicular disease. The Mucus sets on the peritoneal surface and successively it stratifies onto organs. Successively its solidification could give compression on vascular structures, hepatic hilum and intestinal ansae. We report a case of a male patient 65 years old who came in under observation in March 2001. The patient stated he had an abdominal pain in the right iliac *fossa (che cosè??) three months before and since then he had had many episodes of abdominal pain. CT scan demonstrated the presence of a big gelatinous mass, which involved the abdominal cavity. The patient underwent surgical operation in which were made cholecystectomy, omentectomy, peritonectomy, total colectomy and extirpation of surgical surface also an intraoperative hyperthermic chemoterapy for 30 minutes was carried out. The patient had no complications and was discharged 10 days after surgery. By now, 72 months after surgery the patient is well and without disease. Peritoneal pseudomixoma is a very rare pathology. In our opinion surgery is the best treatment associated to an intraoperative hyperthermic chemotherapy and an adjuvant chronomodulated systemic chemotherapy.
II. Case report
I. Introduction
L.U. male, 65 years old, petrol station owner, came under our observation at the Department of Surgical Sciences in March 2001; general status was good. His history started three months before, with acute pain in the lower abdominal quadrants, particularly in the lower right, nausea, abdominal distension spontaneously regressed without any therapy. Patient came under our observation for a pain in the lower right quadrant, rectal bleeding, weight loss (about 5 kg in 5 months) and dyspepsia. Abdominal examination showed a mass, palpable in the left upper intestinal quadrant; no fever. Digital rectal examination was normal. A colonoscopy demonstrated just the presence of diverticular disease. Oncological markers established only a little growth of CEA values. So we decided to perform a CT scan (Figure 1), that revealed the presence of a big gelatinous mass in abdominal cavity. So a laparotomy was performed. We found a gelatinous mass, which involved the entire abdominal cavity, especially the hepatic hilum and the lower abdominal cavity. The liver surface was completely occupied by a solidified mass (Figure 2). The omentum looked like a
Peritoneal pseudomixoma is a rare disease described by Cruveilhie in 1848 as “maladie gèlatineuse du pèritoine” which results from implantation of malignant tumours or peritoneal irritation from ruptured benign cysts or appendicular disease (Little and Halliday, 1969; Fernandez and Daly, 1980; Germain et al, 1992; Fann et al, 1993); in particular ovarian cysts are responsible in 60% of cases, while appendicular mucocele represents 0.04/ 0.45 of all the appendicectomy (Woodruff and Mac Donald, 1950; Giumarra, 1982; Germain et al, 1992; Alberti et al, 1993). Some Authors described pseudomixoma like a “pathological status in which abdominal cavity is full of mucinous ascites which look like gelatine with epithelial cells in the sites of implantations” (Aho et al, 1973; Bayle et al, 1981; Cardin et al, 1983; Germain et al, 1992). However, disease progression remains difficult to predict because of the spectrum of underlying pathologic process with varying malignant potential. About 500 cases have been described in literature; we describe about how one case recently came to our attention.
31
Lanteri et al: Pseudomixoma peritonei: a case report white mass, stone-like. We performed a cholecystectomy, a total colectomy, right and left subphrenic peritonectomy, a complete pelvic peritonectomy, an omentectomy and extirpation of liver surface. After debulking surgery, patient had an intraperitoneal chemohyperthermia for 30 minutes, 41-42 degrees C, using cisplatin (100 mg/mq) and mitomycin-C (25 mg/mq). After intraperitoneal hyperthermic perfusion we performed an ileorectal anastomosis. A leukocytes fall complicated postoperative period treated successfully with filgastrim. Histological findings of resected specimen (figure 3) demonstrated the presence of adenocarcinoma’s areas in the mucus. So patient underwent chronomodulated systemic chemotherapy and at the time of this article, 72 months after surgery is well without disease.
(diverticulitis, inflammation, polyps) at the base of appendix, which gives an accumulation of mucus inside the appendix, increasing volume and consequently causing rupture. Another theory is nervous; hyperincretion of mucus and muscular paralysis could cause the changement of appendix in a cyst (Alberti et al, 1993). According to Higa classification we know retention cysts, caused by mucin accumulation and dilations due to hyperproduction of mucus by an appendicular benign or malignant neoplasia (Higa et al, 1973; Cucinotta et al, 2002). In this last condition it is important to specify the nature of the malignancy because gelatinous mass cells have an autonomic growth maintaining mucosecernant function (Woodruff et Donald, 1950). Three characteristic pictures are very common in this pathology (Carditello et al, 2002): 1) Appendicular lesions like simple metaplasia, different grades of parietal dysplasia and carcinomatous lesions; 2) The characteristic mucus (like gelatine) 3) Granulous peritoneal lesions, index of malignancy. Macroscopically, we can find two forms (Germain et al, 1992): diffuse form, in which gelatinous substance is diffused in the abdominal cavity, between intestinal bowel, and sometimes this magma solidified involving omentum, like in our case, and a localized form which interests generally the right iliac quadrant. The first event is the most dangerous because gelatinous substance could involve hepatic hilum, causing an obstruction of the biliary tract; successively the mucus could solidify, generating an intestinal occlusion. Performing CT scan is necessary in preoperative diagnosis (Germain et al, 1992; Alberti et al, 1993; Fann et al, 1993), which in our case demonstrated the presence of a mass, which involved the entire abdominal cavity. In our patient we found a gelatinous mass (the characteristic “jelly belly”), which involved the entire abdominal cavity especially the hepatic hilum and the lower abdominal cavity. The liver surface was plenty of solidified mass and the omentum looked like a white mass, very hard, like a stone. we performed a colecystectomy, a total colectomy, right and left subphrenic peritonectomy, a complete pelvic peritonectomy, an omentectomy and an extirpation of liver surface. According to our oncologists, following Sugarbaker’s procedure (Sugarbaker et al, 1993), we also performed an intraperitoneal chemohyperthermia for 30 minutes, 41-42°C, using cisplatin (100 mg/mq) and mitomycin-C (25 mg/mq). A leukocytes fall appeared two days after surgery, resolved in three days using filgastrim. Patient was so discharged ten day after surgery. Histological findings demonstrated well-differentiated mucinous adenocarcinoma of the appendix and presence of areas of adenocarcinoma in the mucus (peritoneal mucinous carcinomatosis according to Ronnett criteria [Ronnett et al, 1995]). So patient received 6 cycles of adjuvant systemic chemotherapy, according with our Oncologists and with some Authors (Yoshito et al, 2001; Baradi and Ponsky, 2002), with cisplatin and 5fluorouracil. We think that postoperative chemotherapy can amplify benefits of surgery and intraperitoneal
III. Discussion Peritoneal pseudomyxoma is a rare disease described by Cruveilhie in 1848 as “maladie gèlatineuse du pèritoine” which results from implantation of malignant tumours or peritoneal irritation from ruptured benign cysts or appendilcular disease (Little and Halliday, 1969; Fernandez and Daly, 1980; Germain et al, 1992; Fann et al, 1993). Later, the entity was termed pseudomyxoma peritonei because of material was chemically different from mucin (Little and Halliday, 1969; Fernandez and Daly, 1980; Fann et al, 1993; Fisher, 1954; Weaver et al, 1937). In 1953, the cause of pseudomyxoma was postulated to be an appendiceal mucinous adenocarcinoma, and not an obstruction of appendiceal lumen with resultant mucocele (Woolner, 1953). Pseudomyxoma, in which peritoneal surface is diffusely involved, can result from tumour implantation or peritoneal irritation from ruptured cysts (Fernandez and Daly, 1980; Little and Halliday, 1969). Pseudomyxoma peritonei syndrome is an uncommon, slowly progressive condition that usually arises from perforation of an adenoma in the appendix (Brueggen et al, 2007). Mucocoele of the appendix occurs when obstruction of the appendiceal lumen results in mucus accumulation and consequent abnormal dilatation. The most important aetiology, from a surgical perspective, is either mucinous cystadenoma or cystadenocarcinoma. In the latter, a spontaneous or iatrogenic rupture of the mucocoele can lead to mucinous intraperitoneal ascites, a syndrome known as pseudomyxoma peritonei (Dixit et al, 2007). Mucocele of the appendix is an infrequent event, representing 0.3%-0.7% of appendiceal pathology and 8% of appendiceal tumors (Ruiz-Tovar et al, 2007). Pseudomyxoma peritonei is characterized by mucin accumulation in the peritoneal cavity. Mucinous implants are found on all peritoneal surfaces and the omentum. Pseudomyxoma peritonei rarely metastasizes outside the abdominal cavity but remains a fatal illness as the space in the abdomen and pelvis required for normal function of the gastrointestinal tract becomes filled with copious amounts of the mucinous tumor (Brueggen et al, 2007). Different theories had been postulated in literature about mucocele origin. The first, postulated by Neeslund (Alberti, 1993), is mechanical and starts from an obstacle 32
Cancer Therapy Vol 7, page 33 chemohyperthermia, improving quality of life and survival rate. Patient is at the time of this article (72 months after surgery) well, without signs of disease.
Fisher ER (1954) Pseudomyxoma cystoadenoma, a misnomer? Obstet Gynecol 4, 616-21. Germain A, Hureau J, Seddik A, Lafargue JP, Preel JL (1992) Maladie gélatineuse du péritoine. Chirurgie 118, 348-55. Giumarra G (1982) Una affezione non frequente in chirurgia addominale: il mucocele appendicolare. Chir Gastroenterol 16, 625-8. Higa E, Rosai J, Pizzimbono CA, Wise L (1973) Mucosal hyperplasia, mucinus cystoadenoma and mucinous adenocarcinoma of the appendix, a re-evaluation of appendiceal mucocele. Cancer 32, 1525-41. Kuroki Y, Otagiri S, Tzukada K (2001) Disseminated peritoneal adenomucinosis associated with a pamperitonitis-like onset, report of a case. Surg Today 31, 646-650. Little M, Halliday JP (1969) Pseudomyxoma peritonei. Lancet 2, 659-63. Ronnett BM, Zahn CM, Kurman RJ, Kass ME, Sugarbaker PH, Shmookler BM (1995) Disseminated peritoneal adenomucinosis and peritoneal mucinous carcinomatosis: a clinicopathologic analysis of 109 cases with emphasis on distinguishing pathologic features, site of origin, prognosis, and relationship to ‘pseudomyxoma peritonei’. Am J Surg Pathol 19, 1390-1408 Ruiz-Tovar J, Teruel DG, Castiñeiras VM, Dehesa AS, Quindós PL, Molina EM (2007) Mucocele of the appendix. World J Surg 31, 542-8. Sugarbaker PH, Zhu BW, Sese GB, Shmookler B (1993) Peritoneal carcinomatosis from appendiceal cancer: results in 69 patients treated by cytoreductive surgery and intraperitoneal chemotherapy. Dis Colon Rectum 36, 323-9. Weaver CH (1937) Mucocele of appendix with pseudomucinous degeneration. Am J Surg 36, 523-26. Woodruff R, Mac Donald JR (1950) Benign and malignant cystic tumors of the appendix. Surg Gynecol Obstet 71, 750-3.
References Aho AJ, Heinonen R, Lauren P (1973) Benign and malignant mucocele of the appendix. Histological types and prognosis. Acta Chir Scand 139, 392-400. Alberti P, Bonera A, Antoci G e Bianchi P (1993) Il mucocele appendicolare. Min Chir 48, 865-70. Baradi H, Ponsky J (2002) Pseudomyxoma peritonei. Surgery 131, 230-231. Bayle E, Tran-Ky, Halgrain JP, Moussalier K, Dunaud JL and Drouard F (1981) A propos de quatre observations de maladie gélatineuse du péritoine. Lyon Chir 77, 353-56. Brueggen C, Baird G, Meisheid A (2007) Pseudomyxoma peritonei syndrome of appendiceal origin: an overview. Clin J Oncol Nurs 11, 525-32. Cardin JL, Kerbrat P, Chevran-Breton O, Bourdonnec P, Guérin D (1983) Pseudomixome péritonéal et cystoadénocarcinome mucineux ovarien. A propos de trois cas. Ann Chir 37, 369 73. Carditello A, Pollicino A, Pino G, Stilo F, Basile M (2002) Tumore mucosecernente dell’appendice con cospicuo versamento gelatinoso. Chir Ital 54, 99-102. Cucinotta E, Palmeri R, Lorenzini C, Melita G, Melita P (2002) Il mucocele appendicolare Chir Ital 54, 107-110. Dixit A, Robertson JH, Mudan SS, Akle C (2007) Appendiceal mucocoeles and pseudomyxoma peritonei. World J Gastroenterol 13, 2381-4. Fann JI, Vierra M, Fischer D, Oberhelmann HA, Cobb L (1993) Pseudomyxoma peritonei. Surg Gynecol Obstet 177, 441-7. Fernandez RN, Daly JM (1980) Pseudomyxoma peritonei. Arch Surg 115, 409-414.
Woolner LB (1953) Carcinoma of the appendix, comments on pathology. Proc. Mayo Clin, 28, 17-20.
33
Lanteri et al: Pseudomixoma peritonei: a case report
34
Cancer Therapy Vol 7, page 35 Cancer Therapy Vol 7, 35-42, 2009
Phage L5 integrating vectors are present within the Mycobacterial Cell in an equilibrium between integrated and excised states Research Article
Beatrice Saviola Basic Medical Sciences, College of Osteopathic Medicine, Western University of Health Sciences, 309 E. Second St. Pomona CA 91766
__________________________________________________________________________________ *Correspondence: Beatrice Saviola, Basic Medical Sciences, College of Osteopathic Medicine, Western University of Health Sciences, 309 E. Second St. Pomona CA 91766, USA; Tel: +1 909 469-5373, Fax: +1 909 469-5698; e-mail: bsaviola@westernu.edu Key words: mycobacterial cell, Bacterial strains, plasmids, Plasmid DNA, Vector loss assay Abbreviations: Luria Broth, (LB); optical density, (OD); polymerase chain reaction, (PCR) Received: 4 November 2008; Revised: 21 November 2008 Accepted: 23 December 2008; electronically published: January 2009
Summary Integrating mycobacterial plasmids containing the phage L5 attachment site (attP) are able to insert into the mycobacterial chromosome attB site. Plasmids containing the attP site and chromosome containing the attB site are present in equilibrium between the inserted and the excised states in the presence of the phage L5 integrase.
additional attB site. In the presence of integrase, these two vectors are extremely unstable unless the integrase gene is eliminated (Saviola and Bishai, 2004). I demonstrate that these vectors can be excised from the mycobacterial chromosome and be reintegrated into the mycobacterial chromosome. In a two-plasmid system, it is feasible to observe integration, excision, and reintegration of a phage L5 integrating plasmid. It is shown that integrating vectors are present in equilibrium between integrated and excised states within the mycobacterium. In addition, it is possible to recover L5 integrating plasmid DNA from mycobacterial strains containing a previously integrated vector by this equilibrium.
I. Introduction Vector systems have been developed to integrate into the mycobacterial chromosome (Lee et al, 1991; Snapper et al, 1988). These systems utilize the mycobacterial phage L5 attachment site attP and its target bacterial attachment site attB in conjunction with the phage L5 integrase (Lee and Hatfull, 1993; Pedulla et al, 1996, Pena et al, 1996, 1997, 1998, 1999, 2000). Integrase thus catalyzes the integration of vectors bearing an attP site into the bacterial attB site. These integrative vectors, however, can be unstable within the mycobacterium and can result in plasmid loss (Lewis and Hatfull, 2000; Springer at al, 2001). It has subsequently been determined that elimination of the integrase gene after integration of a target vector resulted in an extremely stable integrative vector within the mycobacterial cell (Springer et al, 2001). Additionally, transformation of mycobacteria containing a previously integrated vector with an additional L5 integrating vector results in replacement of the first vector with the second vector in the presence of integrase (Pashley and Parish, 2003). Thus integrase mediates L5 vector instability as well as integrated vector exchange. It is possible to insert two integrative plasmids sequentially into the mycobacterial chromosome. When an integrative vector containing an additional plasmid borne attB site is integrated into the mycobacterial chromosome, an additional L5 integrating vector can be inserted into this
II. Material and Methods A. Bacterial strains and plasmids Mycobacterium smegmatis strain mc2 155 (American Type Culture Collection ATCC, Manassas VA) and Escherichia coli strain DH5! were used for all experiments. Integrating vectors used were pBS11 and pBS29 which contain the phage attP site and the phage L5 integrase as previously described (Saviola and Bishai, 2004). Additionally, the pBS29 contains a bacterial attachment site attB, the pBS11 a hygromycin resistance gene, and the pBS29 a kanamycin resistance gene (Saviola and Bishai, 2004). Vectors pBS33 and pBS37 lacking L5 integrase were used as previously described (Saviola and Bishai, 2004). The pBS33 and pBS37 were created by cutting out the integrase containing PstI fragment of pBS11 and pBS29 respectively. The
35
Saviola: Phage L5 integrating vectors present with in the mycobacterial cell pBluescriptint contains the integrase gene within a vector which is nonreplicative in mycobacteria (Springer et al, 2003).
Sau3A1 (NEB) and electrophoriesed on a 2.0 % agarose gel and were compared with each other. Recovered plasmids bearing similarity to pBS11 or pBS29 were retransformed into electrocompetant M. smegmatis and plated onto 7H10 agar plates containing 100 "g/ml hygromycin (Calbiochem) or 50 "g/ml kanamycin (Fisher) respectively.
B. Vector loss assay M. smegmatis was transformed with the integrating vectors pBS29 or pBS37 + pBluescriptint and transformants were recovered on 7H10 agar (Difco) + 10% ADC (5% w/v bovine serum albumen Fisher, 2% w/v dextrose EM Science, 0.85% w/v NaCl EM Science) plates containing 50 "g/ml kanamycin. Electrocompetant cells were prepared using the resultant M. smegmatis integrating vector transformed strains. Electrocompetant cells containing integrated pBS29 or pBS37 were then transformed with pBS11 or pBS33 + pBlueScriptint respectively. Transformants were grown overnight in 7H9 broth (Difco) supplemented with 10% ADC in the absence of antibiotic (20 hrs), diluted, and plated on to 7H10 agar (Difco) supplemented with 10% ADC without any antibiotics. Resultant individual single colonies were numbered and then patched onto each of 7H10 agar plates containing either hygromycin 100 "g/ml or kanamycin 50 "g/ml to determine antibiotic resistance. One hundred individual bacterial colonies each were tested for M. smegmatis transformed with pBS29 + pBS11, or pBS33 + pBS37. Kanamycin sensitive strains were assayed for loss of aph via the polymerase chain reaction (PCR). Briefly, M. smegmatis strains were lysed by an initial exposure to 99oC for 10 min, followed 1 min at 95oC, and subsequently primers BS27 and BS28 which bind to the 5â&#x20AC;&#x2122; and 3â&#x20AC;&#x2122; ends of the aph gene within integrated vector DNA were annealed at 55oC for 2 min. Elongation of primers with Taq DNA polymerase (New England Biolabs) was performed at 72oC for 1 min. PCR was performed for 30 cycles excluding the initial 10 min incubation at 99oC on an Eppendorf Mastercycler Personal thermocyler.
III. Results When total DNA is purified from M. smegmatis containing the L5 integrative plasmid pBS11 inserted into its chromosome, the unintegrated form of the plasmid can be recovered in small quantities. Total DNA was prepared from M. smegmatis with integrated pBS11 grown 20 hrs in the absence of antibiotic. Recovery of unintegrated plasmid was performed by transformation of the total DNA into electrocompetant E. coli cells and E. coli bearing the plasmid were selected on 200 "g/ml hygromycin. The rate of recovery of transformants was 0.001 hygromycin resistant transformants/ng of total DNA. Hygromycin resistant plasmid could then be recovered from transformed E. coli by miniprep procedure. All plasmids recovered in this manner could be retransformed into electrocompetant M. smegmatis cells indicating that they are pBS11. This finding indicates that L5 integrative plasmids are present within some of the bacteria in an excised form at least temporarily. Integrated plasmids are likely present in equilibrium between excised and integrated states within host bacterial cell. If the excision rate is slow and the integration rate is rapid this will favor plasmid retention within the mycobacterial cell. To test the stability of pBS11 in the chromosome, M. smegmatis with pBS11 integrated into the chromosome was incubated overnight in the absence of antibiotic. The mycobacterial culture was then serially diluted and plated onto 7H10 agar media in the absence of antibiotic to recover single colonies. After growth on 7H10 agar plates single colonies were patched onto agar plates containing hygromycin. One hundred single colonies were tested and all grew when patched onto hygromycin agar plates indicating that pBS11 is not readily lost from the host bacterial cell. The above observations indicate that phage L5 integrating plasmids are in equilibrium between integrated and excised state within the mycobacterial cell, though the plasmids are rarely lost from the bacterium. In order to observe experimentally the excision and the reintegration of pBS11, I used a two-plasmid system previously described (Saviola and Bishai, 2004). This two-plasmid system utilizes an integrating plasmid pBS29 that contains an additional bacterial attachment attB site as well as a kanamycin resistance gene, aph (Figure 1). By integrating into the M. smegmatis chromosome pBS29 will retain an additional attB site and the pBS11 can be integrated into the retained site. M. smegmatis was first transformed with pBS29, competent cells were prepared, and these cells were then transformed with pBS11 and selected for on hygromycin and kanamycin 7H10 plates. pBS29 + pBS11 transformants were grown up overnight for 20 hrs in the absence of antibiotics and plated on 7H10 agar plates in the absence of antibiotics. Individual colonies were numbered and patched on both agar plates containing either kanamycin or hygromycin. The loss rate for
C. Plasmid DNA recovery and analysis Total DNA containing small quantities of excised integrative L5 plasmid was prepared by growing the mycobacterial strains overnight to saturation. Three milliliters of mycobacteria were centrifuged and resuspended in 550 "l 10mM tris (Fisher) and 1mM EDTA (EM Science) (TE) with 10 mg/ml lysozyme (Fisher) and incubated overnight at 37oC. After overnight incubation 70 "l of 10 % SDS (Fisher) and 6 "l 10 mg/ml proteinaseK (New England Biolabs) were added and the reaction incubated at 65oC for 10 min. One hundred "l 5 M NaCl (EM Science) and 80 "l 10 % CTAB (cetyl trimethyl ammonium bromide) and 0.7 N NaCl (EM Science) were added and the samples were further incubated for 10 min at 65oC. The samples were then extracted with phenol chloroform (Fisher) twice and then extracted once with chloroform isoamylalcohol (EM Science) (24:1). DNA was precipitated with 700 "l isopropanol (Acros) for 30 min at -80oC. The samples were centrifuged at 14,000 RPM for 15 min. The supernatants were removed and the pellets were washed with 70 % ETOH (Shelton Scientific). The pellets were then dried and resuspended in TE with RNAse If (NEB). Total mycobacterial DNA was quantitated by determining the optical density (OD) 260 nm. Purity of the DNA was estimated by comparison of the ratio of the OD 260 nm to the OD 280 nm on a Genesys 10 UV spectrophotometer (thermospectronic). Recovery of excised L5 integrative plasmids was performed by transformation of Electocompetant DH5! E. coli with total DNA from M. smegmatis. This total DNA may contain a small amount of excised L5 integrative plasmid. Antibiotic resistant E. coli transformants were recovered on Luria Broth (LB) agar (Difco) containing either 50 "g/ml of kanamycin or 200 "g/ml hygromycin. Plasmid DNA was prepared from these E. coli transformants using the Wizard Miniprep system (Promega). Plasmids recovered from kanamycin and hygromycin resistant E. coli as well as pBS29 and pBS11 were cut with
36
Cancer Therapy Vol 7, page 37 kanamycin resistance was 33% while the loss rate for hygromycin resistance was 3%. No colony was found to be sensitive to kanamycin and hygromycin both. Seventeen kanamycin sensitive strains were tested for loss of the kanamycin resistance gene. All strains lost the gene as assayed by PCR, whereas 2 control strains that retained kanamycin resistance maintained the gene as assayed by PCR (Figure 2). Thus mutation of the kanamycin gene is an unlikely explanation of kanamycin sensitivity. Loss of pBS29 containing kanamycin resistance could explain the resultant kanamycin sensitivity. One mechanism to explain kanamycin sensitivity and retained hygromycin resistance within the mycobacterial cell is the excision of pBS11 followed by excision of pBS29 (Figure 3) and reintegration of pBS11 (Figure 4). The pBS11 lacking the additional attB site would effectively block reintegration into the chromosome by pBS29 due to the absence of an available attB attachment site (Figure 4). Thus it is possible to observe excision of pBS11 out of the mycobacterial chromosome, followed by reintegration as evidenced by the loss of pBS29. It is also possible that pBS29 (with pBS11 integrated within pBS29) excises and pBS11 subsequently excises from this extra-chromosomal
composite vector. In the previous scenario, pBS11 could reintegrate to block future reintegration of pBS29 (Figure 4). If pBS29 reintegrates first, however, pBS11 can then reintegrate into the retained attB site. Thus as pBS29 lacks the ability to block reintegration of pBS11, this most likely accounts for the low rate of loss of this second plasmid. Rarely pBS11 can fail to reintegrate and thus may be lost from the mycobacterial cell as 3% of bacteria are hygromycin sensitive after growth in the absence of antibiotic for 20 hours. Even more rarely both pBS29 and pBS11 fail to reintegrate and both plasmids are lost from the host cell. No mycobacteria assayed developed this pattern of sensitivity when grown in the absence of antibiotic. Based on the above data pBS11 both excises within the mycobacterial cell and reintegrates within the chromosome. At the same time that bacteria were grown overnight in the absence of antibiotic, total DNA was prepared that may also carry small amounts of excised phage L5 integrative plasmid. E. coli were transformed with total DNA from M. smegmatis bearing pBS29 and pBS11 integrated vectors grown in the absence of antibiotic. If excised vectors are present within the total DNA they
Figure 1. pBS29 containing an attB site is integrated into the M. smegmatis chromosome. The additional attB is preserved and can accept integration by pBS11. The resultant M. smegmatis strain is kanamycin and hygromycin resistant.
37
Saviola: Phage L5 integrating vectors present with in the mycobacterial cell
Figure 2. M. smegmatis strains lacking kanamycin resistance were assayed by PCR for the presence of aph. One M. smegmatis strain that retained kanamycin resistance revealed the presence of aph as assayed by amplification. Another kanamycin resistant strain was assayed and the aph gene was also amplified (data not shown). Four kanamycin sensitive bacterial colonies lacked amplification of the aph gene. The remaining 13 kanamycin sensitive colonies all lacked amplification of the aph gene (data not shown).
Figure 3. The pBS29 and pBS11 double transformed strain is unstable. Both pBS11 and pBS29 can excise from the mycobacterial chromosome in the presence of integrase.
38
Cancer Therapy Vol 7, page 39
Figure 4. After excision of pBS11 and pBS29, pBS11 can reintegrate into the M. smegmatis chromosome blocking subsequent reintegration by pBS29 as the attB site is absent.
should transform E. coli and confer antibiotic resistance. A greater number of kanamycin resistant transformants (0.33/ng total DNA transformed) were recovered than hygromycin resistant transformants (0.17/ng total DNA transformed). Sixteen kanamycin resistant E. coli colonies containing plasmid were grown in liquid culture and plasmid DNA was purified using a miniprep procedure. The plasmids were then cut to verify similarity to the parent plasmids pBS29 and to reveal small plasmid differences with the frequent cutter Sau3AI. The results revealed identical cutting profiles for plasmids recovered from kanamycin resistant strains and pBS29 (Figure 5). Eight hygromycin resistant E. coli colonies were grown up and plasmid DNA was prepared. Plasmids were cut with Sau3AI and compared to cut pBS11. All plasmids prepared from the hygromycin resistant E. coli had an identical Sau3AI cutting profile as pBS11 (Figure 5). All plasmids recovered from kanamycin and hygromycin resistant E. coli could be retransformed into M. smegmatis to confer kanamycin and hygromycin resistance indicating that they were in fact pBS29 and pBS11 respectively. Thus it seems likely that integrated vectors are present within the mycobacterial cell as an extrachromosomal excised plasmid at least a portion of the time. Both pBS29 and pBS11 possess the integrase gene. Deletion of the integrase gene in pBS29 and pBS11 created the plasmids pBS33 and pBS37 respectively. M. smegmatis was transformed with pBS33 + pBluescriptint which has the integrase present on a mycobacterial non replicating vector. The pBS33 integrates in M. smegmatis bacterial cells and the nonreplicating integrase containing plasmid pBluescript is lost. The procedure is repeated with pBS37 and pBluescriptint. M. smegmatis with pBS33 and pBS37 integrated into the chromosome were grown for 20 hours in the absence of antibiotic. The mycobacteria were diluted and plated on 7H10 plates lacking antibiotic to obtain single colonies. Bacterial colonies were numbered
and patched onto 7H10 + kanamycin or 7H10 + hygromycin plates. Removal of the integrase gene after M. smegmatis chromosomal integration by pBS33 or pBS37 completely prevented the loss of either plasmid as evidenced by the lack of development of kanamycin or hygromycin sensitivity during growth in the absence of antibiotic selection. One hundred individual colonies were tested. In addition, when total DNA was prepared from M. smegmatis bearing pBS33 and pBS37 and used to transform E. coli, this experiment resulted in no kanamycin resistant transformants/1.4 "g of total DNA transformed and no hygromycin resistant transformants/ 1.4 "g of total DNA transformed indicating that pBS33 and pBS37 are not present in an extrachromosomal form. Thus the process of in vivo excision and reintegration of phage L5 based integrating plasmids as well as the presence of extrachromosomal excised plasmid is dependent on the presence of the integrase gene product. In addition, it is extremely unlikely that the high rate of loss of kanamycin and hygromycin resistance in M. smegmatis with integrated pBS29 and pBS11 is due to mutation of the antibiotic resistance marker or some recombinitorial mechanism. As stated above, kanamycin and hygromycin resistant plasmids were recovered from E. coli after transformation of total DNA prepared from M. smegmatis bacteria bearing integrated pBS29 and pBS11. One potential alternative explanation for the recovery of pBS29 and pBS11 plasmids is that pieces of chromosomal DNA containing the integrated vectors present in the total DNA were transformed into E. coli. Integrated plasmids present within chromosomal DNA could excise with the aid of de novo synthesis of the integrase protein within transformed E. coli. In this scenario one would expect each kanamycin resistant transformant to also be hygromycin resistant as excision of pBS29 requires either pre-excision of pBS11, or excision of pBS29 containing pBS11 integrated within 39
Saviola: Phage L5 integrating vectors present with in the mycobacterial cell
Figure 5. The pBS29 and pBS11 as well as plasmids recovered from kanamycin and hygromycin resistant E. coli strains were cut with Sau3A1 and were visualized on a 2.0 % agarose gel.
this plasmid (Figure 1). In either case the E. coli strain would be both kanamycin and hygromycin resistant. Total DNA prepared from M. smegmatis containing integrated vectors pBS29 and pBS11 grown in the absence of antibiotic selection was used to transform E. coli. There were 52 kanamycin resistant transformants in E. coli patched onto hygromycin LB agar plates. Of the kanamycin resistant transformants none were also hygromycin resistant. Thus it seems likely that hygromycin resistant plasmids and kanamycin resistant plasmids are present within prepared total DNA as extrachromosomal structures that can be transformed separately into E. coli.
shown to function additionally as an excisionase (Lewis and Hatfull, 2000; Springer et al, 2001). Also, L5 integrated plasmids can be replaced by transformation of a mycobacterium containing a previously integrated vector with a novel second integrating vector (Pashley and Parish, 2003). It was determined that the original integrated vector is excised and then replaced with the new integrating vector at a fairly high rate (Pashley and Parish, 2003). This present study demonstrates that integrating vectors are found within mycobacteria in equilibrium between integrated and excised states by showing that pBS11 can excise and then reintegrate into the mycobacterial chromosome with some frequency. Finally the fact that integrated vectors are present in equilibrium indicates that in a certain percentage of cells, excised vectors will be present. Thus investigators wanting to recover integrated vectors from mycobacteria can prepare total DNA and transform that DNA into competent E. coli cells to obtain the desired plasmids. In addition, if investigators wish to employ an L5 integrative vector with a deleted integrase and provide the integrase on a mycobacterial nonreplicating vector, the resultant integrated plasmid will be extremely stable. If
IV. Discussion Phage L5 based integrating vectors are present within the bacterial cell in equilibrium between integrated and excised states. This is important because with selective pressure integrated plasmids can be lost from the bacterial cell in the presence of integrase. It had previously been shown that integrated plasmids are unstable within the host cell and this is probably due to integrase which was
40
Cancer Therapy Vol 7, page 41 Pena CEA, Lee MH, Pedulla ML, Hatfull GF (1997) Characterization of mycobacteriophage L5 attachment site, attP, J. Mol. Biol. 266, 76-92. Pena CEA, Kahlenburg JM, Hatfull GF (1998) The role of supercoiling in mycobacteriophage L5 integrative recombination. Nucleic Acids Res. 26, 4012-4018. Pena CA, Kahlenberg M, Hatfull GF (1999) Protein-DNA complexes in mycobacteriophage L5 integrative recombination. J. Bact. 181, 454-461. Pena CEA, Kahlenberg M, Hatfull GF (2000) Assembly and activation of site-specific recombination complexes. Proc. Natl. Acad. Sci. USA 93, 7760-7773. Saviola B, Bishai B (2004) Method to integrate multiple plasmids into the mycobacterial chromosome. Nucleic Acids Res. 32, 1-4. Snapper SB, Lugosi L, Jekkel A, Melton R, Kieser T, Bloom BR, Jacobs WR Jr. (1988) Lysogeny and transformation of Mycobacteria:stable expression of foreign genes. Proc. Natl. Acad. Sci. USA 85, 6987-6991. Snapper SB, Melton RE, Mustafa S, Keiser T, Jacobs WR Jr (1990) Isolation and characterization of efficient plasmid transformation mutants of Mycobacterium smegmatis. Mol. Microbiol. 4, 1911-1919. Springer B, Sander P, Sedlacek L, Ellrott K, Bottger EC (2001) Instability and site-specific excision of integration-proficient mycobacteriophage L5 plasmids: development and stably maintained integrative vectors. Int. J. Med. Microbiol. 290, 669-675.
investigators wish to recover the integrated plasmid, integrase can then be provided subsequently on a transformed replicating plasmid. Exposure of the integrated plasmid to the integrase supplied in trans should be sufficient to induce the integrating plasmid to again persist in equilibrium between integrated and excised states. Total DNA preparation should allow recovery of the integrated plasmid. Thus this will provide all the benefits of an extremely stable integrative plasmid while allowing for the ease of plasmid recovery.
Acknowledgements I thank Graham Hatfull for providing pMH94 from which pBS29, pBS11, pBS33, and pBS37 were constructed. I thank Burkhart Springer for providing pBluescriptint. This work was supported by a National Institutes of Health grant 5R03AI054794-02, an American Lung Association Grant, a California Lung Association grant, and a Potts Memorial Foundation grant.
References Lee MH, Pascopella L, Jacobs WR, Hatfull GF (1991) Site specific integration of mycobacteriophage L5:integrationproficient vectors for Mycobacterium smegmatis, Mycobacterium tuberculosis, bacilli Calmette-Guerin. Proc. Natl Acad. Sci. USA 88, 3111-3115. Lee ML, Hatfull GF (1993) Mycobacteriophage L5 integrasemediated site-specific integration in vitro. J. Bact. 175, 6836-6841. Lewis JA, Hatfull GF (2000) Identification and characterization of mycobacteriophage L5 excisionase. Mol. Microbiol. 35, 350-360. Pashley CA, Parish T (2003) Efficient switching of mycobacteriophage L5-based integrating plasmids in Mycobacterium tuberculosis. FEMS Microbiol Lett. 229, 211-215. Pedulla ML, Lee MH, Lever DC, Hatfull GF (1996) A novel host factor for integration of mycobacteriophage L5. Proc. Natl Acad. Sci. USA 93, 15411-15416. Pena CEA, Stoner JE, Hatfull GF (1996) Positions of strand exchange in mycobacteriophage L5 integration and characterization of the attB site. J. Bact. 178, 5533-5536.
Beatrice Saviola
41
Saviola: Phage L5 integrating vectors present with in the mycobacterial cell
42
Cancer Therapy Vol 7, page 43 Cancer Therapy Vol 7, 43-48, 2009
Expression of DcR3 in bone and soft tissue tumors Research Article
Masaya Imabori, Toshihiro Akisue, Kenta Kishimoto, Hitomi Hara, Shinichiro Kishimoto, Yoshiyuki Okada, Naomasa Fukase, Shinya Hayashi, Teruya Kawamoto, Masahiro Kurosaka Department of Orthopaedic Surgery, Kobe University Graduate School of Medicine, Kobe, Japan
__________________________________________________________________________________ *Correspondence: Toshihiro Akisue, MD, Department of Orthopaedic Surgery, Kobe University Graduate School of Medicine, 7-5-1 Kusunoki-cho, Chuo-ku, Kobe, Hyogo 650-0017, Japan; Tel: 81-78-382-5985; Fax: 81-78-351-6944; e-mail: akisue@med.kobe-u.ac.jp Key words: Fas, FasL, DcR3, mRNA, Sarcoma Abbreviations: Decoy receptor 3, (DcR3); hapatocellular carcinoma, (HCC); Human glyceraldehyde-3-phosphate dehydrogenase, (GAPDH); tumor necrosis factor receptor, (TNFR); tumor necrosis factor receptor, (TNFR) Received: 7 November 2008; Revised: 12 January 2009 Accepted: 15 January 2009; electronically published: January 2009
Summary Decoy receptor 3 (DcR3) is considered to play an important role in inhibiting Fas-mediated apoptosis. DcR3 binds to FasL, LIGHT and TL1A. DcR3 competes with Fas in binding to FasL and inhibits Fas-mediated apoptosis. DcR3 is overexpressed in colon adenocarcinoma, pancreas adenocarcinoma and neuroblastoma. There is no data available about DcR3 expression in bone and soft tissue tumors. Therefore to analyze the expression of DcR3 in bone and soft tissue tumors, we used 38 malignant bone and soft tissue samples and 12 benign bone and soft tissue samples, and 7 malignant bone and soft tissue cell lines. RT-PCR showed that DcR3 mRNA was highly expressed in malignant bone and soft tissue tumor samples (92%), and benign tumor samples (100%). Real time PCR showed that the ratio of mRNA expression of DcR3 to Fas in malignant tumors was statistically higher than in benign tumors. mRNA expression of DcR3 was correlated with the grade of malignancy. Western blotting showed that DcR3 protein was expressed in osteosarcoma and malignant fibrous histiocytoma (MFH) cell lines as well as DcR3 mRNA. These results suggest that DcR3 may play an important role in inhibiting Fas-mediated apoptosis in bone and soft tissue tumors as well as in other cancers.
from the cells (Pitti et al, 1998). DcR3 binds to at least three different ligands: FasL (Pitti et al, 1998), LIGHT (Yu et al, 1999), and TL1A (Migone et al, 2002). DcR3 can bind to FasL, therefore overexpression of DcR3 leads to inhibition of interaction between FasL and Fas. Thus it is hypothesized that DcR3 may act as an inhibitor of Fasmediated apoptosis by blocking FasL interaction with its receptors (Pitti et al, 1998). It has already been demonstrated that DcR3 is mostly overexpressed in tumor cells in a number of cancers including lung (Pitti et al, 1998) and colon cancers (Pitti et al, 1998), gliomas, gastrointestinal tract tumors (Bai et al, 2000), and virusassociated leukemia (Ohshima et al, 2000). In addition, some normal tissues, including the colon, stomach, spleen, lymph node, spinal cord, pancreas, and lung, have been shown to express DcR3 (Pitti et al, 1998; Bai et al, 2000). In contrast, no data are available regarding the expression and amplification of DcR3 gene in bone and soft tissue tumors. In this study, we investigated expression of DcR3 in bone and soft tissue tumors and the
I. Introduction Fas is a member of the tumor necrosis factor receptor (TNFR) superfamily (Smith et al, 1994), and plays one of the most important roles in blocking cell growth through the mechanisms of apoptosis (Yonehara et al, 1989; Itoh et al, 1991). In various malignant tumors, Fas-madiated apoptosis is blocked, resulting in tumor growth, although Fas is often expressed in malignant tumor cells (Strand and Galle, 1998; Tsuji et al, 2003). FasL is one of the ligands for Fas. The binding of FasL to Fas induces activation of death caspases, which causes apoptosis of the cells (Bai et al, 2000; Roth et al, 2001). Recent studies have suggested that escape from Fas-mediated apoptosis in malignant tumors may be due to the presence of Decoy receptors for Fas. Decoy receptor 3 (DcR3)/ TR6/ M68 has recently been found as a member of the tumor necrosis factor receptor (TNFR) superfamily (Pitti et al, 1998). DcR3 does not have the transmembrane domain of conventional TNFRs and is thought to be a soluble protein secreted 43
Imabori et al: Expression of DcR3 in bone and soft tissue tumors Biosystems). Pre-designed primers and probes for human DcR3 and human Fas (Applied Biosystems). RNA of DcR3, Fas, GAPDH was amplified for 45 cycles.
relationship between expression of DcR3 and malignancy.
II. Materials and Methods A. Tumor samples and cell lines
E. Statistical analysis
Fifty tumor samples were obtained from patients undergoing biopsy at Department of Orthopedic Surgery of Kobe University Hospital, Japan, in accordance with institutional guidelines. Informed consent was obtained from all patients. The samples were immediately stored at -80°C. Tumor tissues were 10 osteosarcomas, 10 malignant fibrous histiocytoma (MFH), 12 liposarcomas, 6 synovial sarcomas, and 12 schwannomas. Seven cell lines were 3 osteosarcomas (KHOS, KTHOS, and MG63) and 4 MFH (Nara H, Nara F, TNMY 1, and GBS 1). Cell lines were cultured in MEM containing 10% fetal bovine serum and 100U/ml of penicillin-streptomycin at 37°C and 5%CO2.
The chi-square test was used to compare for categorical values. ANOVA with post hoc test was used to compare for continuous values. Probability values less than 0.05 were considered to be significant.
III. Results A. Expression of DcR3 mRNA in bone and soft tissue tumor samples Forty-seven of 50 tumor samples (94%) were positive for DcR3 mRNA expression. Twelve of 12 schwannomas (100%), 10 of 10 osteosarcomas (100%), 9 of 10 MFH (90%), 10 of 12 liposarcomas (83%), 6 of 6 synovial sarcomas (100%) showed mRNA expression of DcR3. In benign tumors, 12 of 12 tumor samples (100%) were positive for DcR3 mRNA. In malignant tumors, 35 of 38 tumor samples (92%) were positive. We did not find any significant difference in mRNA expression of DcR3 between malignant and benign tumors (Table 1).
B. RT-PCR analysis RNA of frozen tumor samples and cell lines was extracted with QIAshredder and RNeasy Mini kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. 1µg of total RNA was reverse-transcribed to first-strand cDNA with 1.25µM oligo dT primer in 40µl PCR buffer II containing 2.5mM MgC12, 0.5mM dNTP mix, 0.5U RNase inhibitor, and 1.25U MuLV reverse transcriptase (Perkin Elmer, Foster City, CA) at 42°C for 60 min. The PCR reaction buffer contained 1.5mM MgC12, 0.2mM dNTP mix, 0.5µM sense and antisense primer, 1.5U AmpliTaq Gold DNA polymerase, and 1µl of RT reaction mixture in 20µ1 of PCR buffer II (Perkin Elmer). For TaqMan PCR, the conditions of thermal cycling for DcR3 were consisted of 40 cycles of denaturation at 93°C for 30 sec, annealing at 58°C for 60 sec, and extension at 72°C for 45 sec. The primers used were 5’-TCAATGTGCCAGGCTCTTC-3’ (sense) and 5’GCCTCTTGATGGA GATGTCC-3’ (anti-sense). Human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control for RNA integrity. RT-PCR products were run on 2% agarose gel, stained with ethidium bromide, and visualized by UV illumination.
B. Quantitive PCR in bone and soft tissue tumor samples We investigated the extent of DcR3 mRNA compared with the extent of Fas mRNA using quantitative PCR. The mean ratio of mRNA expression of DcR3 to Fas was 1.50 in 35 malignant tumors which expressed DcR3 mRNA using RT-PCR (10 osteosarcomas, 9 MFH, 10 liposarcomas, and 6 synovial sarcomas), whereas the mean ratio of mRNA expression of DcR3 to Fas was 0.34 in benign tumors (12 schwannomas) (Figure 1a). There was a significant difference between malignant and benign tumors in the ratio of mRNA expression of DcR3 to Fas (P<0.05). The mean ratios of mRNA expression of DcR3 to Fas were 1.96 in osteosarcoma, 1.95 in MFH, 1.37 in synovial sarcoma, 0.84 in liposarcoma, and 0.34 in schwannoma (Figure 1b). The extent of DcR3 mRNA expression in high-grade malignant bone and soft tissue tumors was greater than that in benign or low-grade malignant tumors.
C. Western blotting For the isolation of cytoplasmic proteins, adherent cells were washed 3 times with PBS and lysed in hypotonic lysis buffer (25mM Tris, 1% NP-40, 150mM NaCl, 1.5mM EGTA) supplemented with protease and phosphatase inhibitor mix (Roche Diagnostics, Basel, Switzerland) on ice for 20 min. The lysates were centrifuged at 15,000 rpm for 20 min to remove cellular debris and the supernatants were collected. To analyze DcR3 proteins, we used 7 cell lines. Cytoplasmic proteins were quantified by the Bradford method with protein assay reagent (BioRad, Hercules, CA), and diluted to an equal concentration with hypotonic buffer. Each sample was mixed with 3x electrophoresis sample buffer (BioRad) and electrophoresed on 12% polyacrylamide gel and transblotted electrically onto the blotting membrane (Amersham Bioscience, Arlington Heights, IL). The expression of DcR3 protein was detected using mouse anti-human DcR3 polyclonal Ab (R&D systems, Minneapolis, MN) and anti-mouse IgG Ab with Chemilumino analyzer LAS-3000 mini (FUJI FILM, Tokyo, Japan).
C. Expression of DcR3 mRNA and protein in cell lines of malignant bone and soft tissue tumor Seven of 7 cell lines (100%) expressed mRNA of DcR3 (Figure 2a). The mean ratios of mRNA expression of DcR3 to Fas in 7 cell lines were 3.05 in KHOS cells, 1.45 in KTHOS cells, 2.15 in MG63 cells, 2.51 in Nara H cells, 1.51 in Nara F cells, 1.81 in TNMY1 cells, and 2.56 in GBS1 cells. Western blotting confirmed that DcR3 protein was also expressed in the cytoplasm of seven cell lines (Figure 2b). Based on semi-quantitative analysis of protein expression of DcR3, the extent of protein expression of DcR3 in KHOS cells was higher than that in MFH cells. These results showing protein expression of DcR3 were compatible with the mRNA expression of
D. Quantification of DcR3 mRNA expression The relative expression levels of mRNA encoding DcR3 in tumor samples were compared with expression of Fas. In cell lines the relative expression of DcR3 mRNA were compared with expression of GAPDH. Expression of DcR3, Fas and GAPDH were compared by TaqMan® real-time PCR using an ABI prism 7700 sequence detection system (Applied
44
Cancer Therapy Vol 7, page 45 DcR3 in KHOS and MFH cells using real time PCR.
chromosome 20q13.3. This region is identified as gene amplification and rearrangement in human cancer (Muleris et al, 1995). Previous reports have shown genomic amplifications of 20q13 in breast tumors (Shinomiya et al, 1999), gastric tumors (Sakakura et al, 1999), colon tumors, lung tumors (Pitti et al, 1998), and neuroblastoma (Altura et al, 1997). Recently, several experiments have suggested that DcR3 expressed in cancer cells might play important roles in this mechanism (Tsuji et al, 2003).
IV. Discussion It has been suggested that malignant tumors may develop a mechanism by which their cells escape the immune surveillance of the host (Strand and Galle, 1998) and the malignant cells are protected from Fas-induced growth inhibition signals although the cancer cells also express Fas on the cell surface. DcR3 gene is mapped on Table 1. Expressions of DcR3 mRNA.
schwannoma osteosarcoma MFH synovial sarcoma liposarcoma benign tumor malignant tumor
Expression of DcR3 12/12 10/10 9/10 6/6 10/12 12/12 35/38
Percentage of positive DcR3 100% 100% 90% 100% 83% 100% 92%
Figure 1. Quantitive PCR for DcR3 and Fas expression in bone and soft tissue tumor samples. (A) The mean ratio of mRNA expression of DcR3 to Fas was 1.50 in malignant bone and soft tissue tumors, and 0.34 in benign tumor samples (schwannomas). There was a significant difference between malignant and benign tumors (P<0.05) (B) The mean ratio of mRNA expression of DcR3 to Fas in osteosarcoma, MFH, and synovial sarcoma was greater than that in benign tumors (schwannoma) (*P<0.05). But there was no significant difference between liposarcoma and benign tumors.
45
Imabori et al: Expression of DcR3 in bone and soft tissue tumors
Figure 2. mRNA and protein expression of DcR3 in cell lines using RT-PCR and western blotting. (A) Seven of 7 cell lines (100%) expressed mRNA of DcR3. (B) DcR3 protein was also expressed in all cell lines.
Pitti and colleagues has reported that DcR3 gene is expressed in human lung cancer and human colon adenocarcinomas and that overexpression of DcR3 blocked FasL-induced cell death (Pitti et al, 1998). Shen and colleagues reported that DcR3 is overexpressed in hapatocellular carcinoma (HCC) and there was a significant difference in the apoptosis index between DcR3-positive and DcR3-negative HCC (Shen et al, 2005). Tsuji and colleagues demonstrated that DcR3 is highly expressed in many pancreatic cancers and that endogenous DcR3 blocks the growth inhibition signals mediated by FasL (Tsuji et al, 2003). In bone and soft tissue tumors, no data are available on DcR3, Fas, and FasL expression and the roles of these molecules in the mechanisms for tumor growth. In this study, we demonstrated that DcR3 is highly expressed in bone and soft tissue tumors. Previous studies have shown DcR3 was highly expressed in 67% of pancreas adenocarcinoma tissues and 71% of pancreas adenocarcinoma cell lines (Tsuji et al, 2003). DcR3 was positive in 53% of colon cancers and 44% of lung cancers (Pitti et al, 1998). In the current study, 47 of 50 (94%) bone and soft tissue tumors were positive for DcR3 mRNA expression. This result suggests that bone and soft tissue tumors highly express DcR3. However, there was no significant difference in DcR3 mRNA expression qualitatively between malignant and benign bone and soft tissue tumors. Based on the results of the cell lines, both mRNA and the protein of DcR3 were expressed in 3 osteosarcoma and 4 MFH cell lines. Although we have not tested the protein expression of DcR3 in the specimens from patients, DcR3 protein has been proven to be expressed in bone and soft tissue tumors in which the expression of DcR3 mRNA has been detected. It has been demonstrated that the extent of DcR3 mRNA is parallel to the extent of DcR3 protein in cytoplasm and supernatant (Tsuji et al, 2003). The current
study also showed that the protein expression of DcR3 was compatible with mRNA expression in sarcoma cell lines. The high extent of DcR3 expression significantly correlated with cancer apoptosis (Tsuji et al, 2003; Shen et al, 2005). It has been also documented that the extent of Fas expression correlates with the metastatic potential of human osteosarcoma cells (Lafleur et al, 2004). Therefore, we investigated the extent of DcR3 and Fas by real time PCR and the correlation between DcR3/Fas ratio in mRNA expression and the histologic grades of the tumors. The current study showed that DcR3/Fas ratio in high-grade malignant tumors was higher than in benign tumors. DcR3 can bind to FasL, resulting in inhibition of interaction between Fas and FasL followed by decrease of Fas-mediated apoptosis. If DcR3/ Fas ratio was high, interaction between Fas and FasL is inhibited and Fasmediated apoptosis is suppressed. Other mechanisms for escaping Fas-mediated apoptosis by DcR3 in malignant tumors may be proposed because LIGHT and TL1A have been identified as other ligands for DcR3. However, we consider that overexpression of DcR3 may be one of the important mechanisms for inhibition in Fas-mediated apoptosis. The limitations of the current study are as follows: we have demonstrated expression of DcR3 and DcR3/fas expression ratio only in mRNA level, but not in protein and post-translational modification levels in human specimen. In vitro experiment has not been conducted to explore the correlation between DcR3/fas expression ratio and FasL-induced cell death. Further studies are necessary to explore precise roles of DcR3 in tumorigenesis of bone and soft tissue tumors. In conclusion, we demonstrated that a high percentage of bone and soft tissue tumors and cell lines express DcR3 mRNA. In sarcoma cell lines, DcR3 was expressed at the levels of, not only mRNA, but also protein. However, no significant difference in the mRNA expression could be detected between malignant and benign musculoskeletal tumors. DcR3/Fas ratio in high 46
Cancer Therapy Vol 7, page 47 of a decoy receptor for fas ligand (DcR3) in virus (EBV or HTLV-I) associated lymphomas. Cancer Lett 160, 89-97. Pitti RM, Marsters SA, Lawrence DA, Roy M, Kischkel FC, Dowd P, Huang A, Donahue CJ, Sherwood SW, Baldwin DT, Godowski PJ, Wood WI, Gurney AL, Hillan KJ, Cohen RL, Goddard AD, Botstein D, Ashkenazi A (1998) Genomic amplification of a decoy receptor for Fas ligand in lung and colon cancer. Nature 396, 699-703. Roth W, Isenmann S, Nakamura M, Platten M, Wick W, Kleihues P, B채hr M, Ohgaki H, Ashkenazi A, Weller M (2001) Soluble decoy receptor 3 is expressed by malignant gliomas and suppresses CD95 ligand-induced apoptosis and chemotaxis. Cancer Res 61, 2759-2765. Sakakura C, Mori T, Sakabe T, Ariyama Y, Shinomiya T, Date K, Hagiwara A, Yamaguchi T, Takahashi T, Nakamura Y, Abe T, Inazawa J (1999) Gains, losses, and amplifications of genomic materials in primary gastric cancers analyzed by comparative genomic hybridization. Genes Chromosomes Cancer 24, 299-305. Shen HW, Gao SL, Wu YL, Peng SY (2005) Overexpression of decoy receptor 3 in hepatocellular carcinoma and its association with resistance to Fas ligand-mediated apoptosis. World J Gastroenterol 141, 5926-5930. Shinomiya T, Mori T, Ariyama Y, Sakabe T, Fukuda Y, Murakami Y, Nakamura Y, Inazawa J (1999) Comparative genomic hybridization of squamous cell carcinoma of the esophagus: the possible involvement of the DPI gene in the 13q34 amplicon. Genes Chromosomes Cancer 24, 337-344. Smith CA, Farrah T, Goodwin RG (1994) The TNF receptor superfamily of cellular and viral proteins: activation, costimulation, and death. Cell 76, 959-962. Strand S, Galle PR (1998) Immune evasion by tumors: involvement of the CD95 (APO-1/Fas) system and its clinical implications. Mol Med Today 4, 63-68. Tsuji S, Hosotani R, Yonehara S, Masui T, Tulachan SS, Nakajima S, Kobayashi H, Koizumi M, Toyoda E, Ito D, Kami K, Mori T, Fujimoto K, Doi R, Imamura M (2003) Endogenous decoy receptor 3 blocks the growth inhibition signals mediated by Fas ligand in human pancreatic adenocarcinoma. Int J Cancer 106, 17-25. Yonehara S, Ishii A, Yonehara M (1989) A cell-killing monoclonal antibody (anti-Fas) to a cell surface antigen codownregulated with the receptor of tumor necrosis factor. J Exp Med 169, 1747-1756. Yu KY, Kwon B, Ni J, Zhai Y, Ebner R, Kwon BS (1999) A newly identified member of tumor necrosis factor receptor superfamily (TR6) suppresses LIGHT-mediated apoptosis. J Biol Chem 274, 13733-13736.
grade malignant tumors was higher than that in benign tumors. These results suggested that DcR3 may play an important role in tumor growth through the mechanisms for inhibition of Fas-mediated apoptosis in bone and soft tissue tumors as well as other caners. DcR3 might be one of the molecular targets for treatment in bone and soft tissue tumors.
Acknowledgments The authors express their thanks to Ms. Janina Tubby for her editorial assistance.
References Altura RA, Maris JM, Li H, Boyett JM, Brodeur GM, Look AT (1997) Novel regions of chromosomal loss in familial neuroblastoma by comparative genomic hybridization. Genes Chromosomes Cancer 19, 176-184. Bai C, Connolly B, Metzker ML, Hilliard CA, Liu X, Sandig V, Soderman A, Galloway SM, Liu Q, Austin CP, Caskey CT (2000) Overexpression of M68/DcR3 in human gastrointestinal tract tumors independent of gene amplification and its location in a four-gene cluster. Proc Natl Acad Sci USA 97, 1230-1235. Itoh N, Yonehara S, Ishii A, Yonehara M, Mizushima S, Samwahima M, Hase A, Seto Y, Nagata S (1991) The polypeptide encoded by the cDNA for human cell surface antigen Fas can mediate apoptosis. Cell 66, 233-243. Lafleur EA, Koshkina NV, Stewart J, Jia SF, Worth LL, Duan X, Kleinerman ES (2004) Increased Fas Expression Reduces the Metastatic Potential of Human Osteosarcoma Cells. Clin Cancer Res 10, 8114-8119. Migone TS, Zhang J, Luo X, Zhuang L, Chen C, Hu B, Hong JS, Perry JW, Chen SF, Zhou JX, Cho YH, Ullrich S, Kanakaraj P, Carrell J, Boyd E, Olsen HS, Hu G, Pukac L, Liu D, Ni J, Kim S, Gentz R, Feng P, Moore PA, Ruben SM, Wei P (2002) TL1A is a TNF-like ligand for DR3 and TR6/DcR3 and functions as a T cell costimulator. Immunity 16, 479492. Muleris M, Almeida A, Gerbault-Seureau M, Malfoy B, Dutrillaux B (1995) Identification of amplified DNA sequences in breast cancer and their organization within homogeneously staining regions. Genes Chromosomes Cancer 14, 155-163. Ohshima K, Haraoka S, Sugihara M, Suzumiya J, Kawasaki C, Kanda M, Kikuchi M (2000) Amplification and expression
47
Imabori et al: Expression of DcR3 in bone and soft tissue tumors
48
Cancer Therapy Vol 7, page 49 Cancer Therapy Vol 7, 49-52, 2009
Analysis of bone marrow plasma cells in patients with solitary bone plasmacytoma Research Article
Archana Bhaskar1, Ritu Gupta1,*, Atul Sharma2, Lalit Kumar2, Paresh Jain1,ยง 1
Laboratory Oncology Unit Department of Medical Oncology, Dr. B.R.A.IRCH, All India Institute of Medical Sciences, New Delhi, India ยง Ex-Assistant Professor Laboratory Oncology Unit, Dr. B.R.A.IRCH, All India Institute of Medical Sciences, New Delhi, India 2
__________________________________________________________________________________ *Correspondence: Dr. Ritu Gupta, E-110, Ansari Nagar East, AIIMS Campus, New Delhi-110029, India; Fax: 91-11-26588641/91-1126588663; e-mail: drritugupta@gmail.com Key words: Bone marrow plasma cells; solitary bone plasmacytoma; multiple myeloma; neoplastic plasma cells, flow cytometry Abbreviations: kappa, (!); lambda, (!); monoclonal gammopathy of undetermined significance, (MGUS); multiple myeloma, ((MM); plasma cell, (PC); solitary bone plasmacytoma, (SBP) Received: 24 November 2008; Revised: 12 December 2008 Accepted: 19 January 2009; electronically published: January 2009
Summary Local radiotherapy is the treatment of choice for solitary bone plasmacytoma (SBP) and the role of adjuvant systemic chemotherapy in preventing progression to multiple myeloma (MM) is controversial. The purpose of this study was to examine the presence of systemic disease in the form of neoplastic plasma cells (PC) in bone marrow of patients with SBP. Flow cytometric immunophenotyping of PC was carried out on bone marrow aspirate of 7 patients using monoclonal antibodies: CD19 FITC, CD45 FITC, CD20 FITC, CD52 PE, CD117 PE, CD56 PE, CD38 PerCP-Cy5.5, CD138 APC, anti-kappa (!) FITC and anti-lambda (!) PE. The neoplastic as well as normal PC were identified in bone marrow aspirate of all the patients at the time of diagnosis; the neoplastic PC ranged from 0.1%to 0.7% of all BM cells and 33.5% to 89.7% of total BMPC. The !:! ratio was normal in all the samples ranging from 0.5% to 1.6%. The present work shows the presence of systemic disease in the form of neoplastic PC in bone marrow of patients with SBP. Prospective studies would be required to study if the levels of neoplastic PC in the bone marrow may help us identify patients who are likely to progress to overt MM and benefit from systemic chemotherapy.
and persistence of M-protein for more than one year after radiotherapy is the only independent adverse prognostic factor predicting progression to MM (Dimopoulos et al, 2000; Wilder et al, 2002). In patients with non-secretory SBP at presentation, other parameters which can predict the likelihood of progression to MM need to be established. Monoclonal gammopathy of undetermined significance (MGUS) is another hematological condition where about 16% patients have been reported to develop MM with a median follow-up period of 10 years (Kyle, 1993). Using aberrant immunophenotype to identify neoplastic PC, it has been demonstrated that the bone marrow of patients with MGUS contain normal as well as neoplastic PC and predominance of neoplastic PC in the bone marrow plasma cell compartment at the time of diagnosis correlates with a higher risk of progression to MM (Perez-Persona et al, 2007). The immunophenotyping
I. Introduction Plasmacytoma are clonal proliferation of plasma cells (PC) that are identical to multiple myeloma (MM) but have a single bone lesion - solitary bone plasmacytoma (SBP); or less commonly, a soft tissue massextramedullary plasmacytoma. Solitary bone plasmacytoma make up about 5% of PC neoplasms and the common sites are in marrow areas with active hematopoiesis (Soutar et al, 2004). The diagnosis of SBP requires presence of a localized mass of clonal PC, absence of other lytic lesion on skeletal survey, no evidence of plasmacytosis in the bone marrow and absence of anemia, hypercalcaemia, or renal involvement. These tumors are usually treated with localized radiotherapy but the outcome varies and as many as 75% of patients develop MM with a median time to progression of 2-4 years (Soutar et al, 2004). Monoclonal paraproteinemia is seen in 24-72% of patients with SBP
49
Bhaskar et al: Analysis of BMPC in SBP paraformaldehyde. To study cytoplasmic ! and ! light chains expression, fixation and permeabilization prior to staining was carried out as per manufacturerâ&#x20AC;&#x2122;s recommendation (Serotec). Acquisition was done on a flow cytometer (BD FACS Calibur or BD FACS Canto) equipped with facility for at least 4-color immunophenotyping and 105 events were acquired in each tube.
of bone marrow plasma cells in SBP has not been investigated so far and since a significant number of these patients progress to MM, we hypothesized that the bone marrow of patients with SBP might contain neoplastic PC at the time of diagnosis, which may correlate with risk of progression to MM.
C. Flow cytometric data analysis
II. Materials and Methods
Analyses were carried out using FCS Express V3 (De Novo Software). Plasma cells were identified based on dual expression of CD38 and CD138 and expression of other antigens was analyzed on this gated population of PC. A tube with cells labeled only with gating reagents was included as negative control with every sample. Normal PC were defined as CD19+CD56- (Harada et al, 1993). A PC was defined as neoplastic when it displayed at least two aberrant antigens i.e. CD19-, CD56+, CD45-, CD52+, CD117+, CD20+. The !:! ratio was defined as abnormal if < 0.5 or > 3 (Morice et al, 2007).
A. Patients A total of 7 patients who fulfilled the criteria of SBP are included in this study. Bone marrow aspirates was collected in ethylene diamine tetraacetic acid from all the patients after obtaining informed consent as per the guidelines of the ethical committee of the institute. Serum and urine protein electrophoresis was performed on all the patients as part of routine diagnostic work-up.
B. Flow cytometric immunophenotyping
III. Results
Immunophenotyping studies were carried out on the bone marrow aspirates using the pre-titrated volumes of the following monoclonal antibodies: CD19 FITC, CD45 FITC, CD20 FITC, CD52 PE, CD117 PE, CD56 PE, CD38 PerCP-Cy5.5, CD138 APC (BD Biosciences, San Jose, CA, USA) Kappa (!) FITC and Lambda (!) PE (Serotec). Staining was done using standard whole blood lysis technique. Briefly, for tube assessing only surface antigens an aliquot of BM aspirate containing 2 x 106 cells was processed using 2 ml of ammonium chloride for 10 minutes at room temperature followed by washes in phosphate buffer saline containing sodium azide and resuspended in
Plasma cells were easily identified based on dual expression of CD38 and CD138 in the bone marrow aspirates and varied from 0.17% to 1.05%. The neoplastic as well as normal PC were seen in the bone marrow aspirates of all the cases at the time of diagnosis and ranged from 0.10% to 0.70% and 0.06% to 0.49% of all the bone marrow cells respectively (Figure 1).
Figure 1. Flow cytometric dot-plots showing immunoprofile of bone marrow plasma cells in a patient with solitary bone plasmacytoma. Arrows indicate neoplastic plasma cells.
50
Cancer Therapy Vol 7, page 51 Table1. Profile of seven patients with solitary bone plasmacytoma Age(y)/S ex
Site
NPC/all BMPC (%)
k/! ratio
SPE At diagnosis
53/F 37/M 58/M 38/M 64/M 35/F 50/M
Femur Tibia Femur L5 vertebra Rib D6 vertebra Humerus
60.8 33.5 49.7 69.8 56.6 70.6 89.7
1.3 1 1.5 1.6 1.5 0.8 0.5
P P N P N P P
Progression to MM At follow-up (months) P (18) N (18) N (7) N (7) N (6) N (5) P (4)
Yes No No No No No Yes
BMPC indicates bone marrow plasma cells; SPE, serum protein electrophoresis; NPC, neoplastic plasma cells; MM, multiple myeloma; k, kappa; !, lambda; P, positive; N, negative
Neoplastic PC comprised 33.5% to 89.7% (median: 60.8%) of the total bone marrow plasma cells. Similar to other studies, the aberrant immunophenotype rather than the light chain restriction pattern was useful in identification of low number of neoplastic plasma cells in the bone marrow as the !:! ratio was normal in all the samples (range: 0.5% to 1.6%). Protein electrophoresis studies on serum and urine revealed an M-band in five cases at the time of diagnosis and in two patients subsequent to therapy (Table 1). During a median followup period of 7 months, two of the patients progressed to MM (Table 1).
was associated with relatively high numbers of neoplastic PC in the bone marrow. Small number of cases studied and the relatively short duration of follow-up preclude a definitive opinion on value of these findings at this time. However, given the ease of flow cytometric quantitative detection and enumeration of neoplastic PC in the bone marrow, studies with larger sample size and longer follow-up may reveal potential benefits on evaluation of the effect of radiotherapy alone or along with adjuvant chemotherapy on the systemic load of neoplastic PC in patients of SBP. Further, it might be of interest to ascertain if a certain level of neoplastic PC in the bone marrow of patients with SBP correlates with risk of progression to overt MM and help in identifying patients who may benefit from systemic chemotherapy.
IV. Discussion In patients with SBP, the persistence of monoclonal protein for more than one year after therapy is the only independent adverse prognostic factor predicting progression to myeloma and complete disappearance of the monoclonal protein after therapy is associated with lower risk of progression to myeloma (Wilder et al, 2002). Definitive local radiotherapy is the treatment of choice for SBP as the disease is believed to be localized and the response to radiotherapy is measured by documenting the reduction in the levels of monoclonal protein, which is a slow process. There is no suitable parameter which can predict the likelihood of progression to myeloma upfront at the time of diagnosis itself in patients with this plasma cell proliferative disorder. The role of adjuvant chemotherapy in preventing progression to MM is controversial. Some reports have suggested that adjuvant chemotherapy may delay progression to MM while others consider it to be nonbeneficial (Mayr et al, 1990; Holland et al, 1992; Shih et al, 1995; Aviles et al, 1996; Tsang et al, 2001). The SBP as per their defining criteria do not exhibit bone marrow plasmacytosis and unlike MGUS, the existence of neoplastic PC in the bone marrow of patients with SBP is largely unknown. Our study demonstrates, for the first time, the existence of systemic disease albeit of low load, in the form of neoplastic PC in the bone marrow of patient with SBP at the time of their initial diagnosis The rapid progression to myeloma in the second case in this study
Acknowledgments We gratefully acknowledge support of Professor Subroto Sinha and Dr. Neera Nath, Department of Biochemistry, who made available the flow cytometric laboratory facility to carry out this work. This study was supported by research funding from Department of Science & technology, Government of India to RG under the SERC-Fast track scheme. Grant number: SR/FT/L-29/2005.
References Aviles A, Huerta-Guzman J, Delgado S, Fernández A, DíazMaqueo JCl (1996) Improved outcome in solitary bone plasmacytomata with combined therapy. Haematol Oncol 14, 111–117. Dimopoulos MA, Moulopoulos LA, Maniatis A, Alexanian R (2000) Solitary plasmacytoma of bone and asymptomatic multiple myeloma. Blood 96, 2037–2044. Harada H, Kawano MM, Huang N, Harada Y, Iwato K, Tanabe O, Tanaka H, Sakai A, Asaoku H, Kuramoto A (1993) Phenotypic difference of normal plasma cells from mature myeloma cells. Blood 81, 2658-2663. Holland J, Trenkner DA, Wasserman TH, Fineberg B (1992) Plasmacytoma. Treatment results and conversion to myeloma. Cancer 69, 1513-1517. Kyle RA (1993) "Benign" monoclonal gammopathy- after 20 to 35 years of follow-up. Mayo Clin Proc 68, 26-36.
51
Bhaskar et al: Analysis of BMPC in SBP Mayr NA, Wen BC, Hussey DH, Burns CP, Staples JJ, Doornbos JF, Vigliotti AP (1990) The role of radiation therapy in the treatment of solitary plasmacytomas. Radiother Oncol 17, 293-303. Morice WG, Hanson CA, Kumar S, Frederick LA, Lesnick CE, Greipp PR (2007) Novel multi- parameter flow cytometry sensitively detects phenotypically distinct plasma cell subsets in plasma cell proliferative disorders. Leukemia 21, 20462049. Pérez-Persona E, Vidriales MB, Mateo G, García-Sanz R, Mateos MV, de Coca AG, Galende J, Martín-Nuñez G, Alonso JM, de Las Heras N, Hernández JM, Martín A, López-Berges C, Orfao A, San Miguel JF (2007) New criteria to identify risk of progression in monoclonal gammopathy of uncertain significance and smoldering multiple myeloma based on multiparameter flow cytometry analysis of bone marrow plasma cells. Blood 110, 25862592. Shih LY, Dunn P, Leung WM, Chen WJ, Wang PN (1995) Localised plasmacytomas in Taiwan: comparison between extramedullary plasmacytoma and solitary plasmacytoma of bone. Br J Cancer 71, 128-33. Soutar R, Lucraft H, Jackson G, Reece A, Bird J, Low E, Samson D (2004) Guidelines on the diagnosis and management of solitary plasmacytoma of bone and solitary extramedullary plasmacytoma. Br J Haematol 124, 717-726.
Tsang RW, Gospodarowicz MK, Pintilie M, Bezjak A, Wells W, Hodgson DC, Stewart AK (2001) Solitary plasmacytoma treated with radiotherapy: impact of tumor size on outcome. Int J Radiat Oncol Biol Phys 50, 113-120. Wilder RB, Ha CS, Cox JD, Weber D, Delasalle K, Alexanian R (2002) Persistence of myeloma protein for more than one year after radiotherapy is an adverse prognostic factor in solitary plasmacytoma of bone. Cancer 94, 1532-1537.
Ritu Gupta
52
Cancer Therapy Vol 6, page 53 Cancer Therapy Vol 6, 53-58, 2008
The study of possible cytogenetic activity of spironolactone Research Article
Armen Nersesyan1,*, Anahit Martirosyan2, Rafael Muradyan3, Gayane Zalinyan4 1
National Center of Oncology Research Center of Maternal and Child Health Protection 3 Institute of Organic Chemistry 4 State University, Yerevan, Republic of Armenia 2
__________________________________________________________________________________ *Correspondence: Armen K. Nersesyan, Environmental Toxicology Group, Institute of Cancer Research, Borschkegasse 8A, 1090, Vienna Austria; Tel: +431 4277 65147; Fax: +431 4277 9651; e-mail: armen.nersesyan@meduniwien.ac.at Key words: spironolactone, chromosomal aberrations, micronucleus, human lymphocytes, mouse bone marrow Abbreviations: chromosomal aberrations, (CA); cyclophosphamide, (CP); micronucleus, (MN); polychromatic erythrocytes, (PCEs); polycystic ovary syndrome, (PCOS); sriponolactone, (SPL) Received: 17 November 2008; Revised: 15 January 2009 Accepted: 20 January 2009; electronically published: January 2009
Summary Due to its anti-androgen effect, spironolactone (SPL) is used to treat polycystic ovary syndrome (PCOS) and hirsutism. This drug is widely used in medicine, but practically nothing is known about its mutagenic activity, although SPL was found to be carcinogenic in rats. The aim of this study was the evaluation of mutagenic activity of SPL by means of chromosomal aberrations test in lymphocytes obtained from healthy women and PCOS patients, and micronucleus (MN) assay in mouse bone marrow cells. The results of experiments with lymphocytes of healthy women and PCOS patients showed that it was inactive even at highest doses used. The drug did not induce also MN in bone marrow cells of mice at high doses. Our results could suggest that carcinogenic activity of SPL may not be connected with genotoxicity.
pharmacological preparation, Pfizer, Australia (http://www.pbs.gov.au/pi/pfpaldat11106.pdf). No data were found in IARC monograph, although this substance was evaluated for its carcinogenicity by the experts (IARC, 2001). It is written in the monograph that “No data were available to the Working Group.” and “No data on the genotoxicity of SPL were available”. This is surprising because there is some evidence that SPL possess carcinogenic activity in rats (thyroid follicular-cell adenomas in males and females and Leydigcell tumors in males) (IARC, 2001). The aim of this study was the evaluation of mutagenic activity of SPL by means of chromosomal aberrations (CA) test in human lymphocytes and micronucleus (MN) assay in mouse bone marrow cells. Since this drug is used very frequently for treatment of hirsutism (Armanini et al, 2007; Koulouri and Conway, 2008), lymphocytes of both women with PCOS and healthy women were used. Recently we showed significantly increased level of CA in lymphocytes of women with PCOS (Nersesyan et al, 2006).
I. Introduction Spironolactone (SPL) is a synthetic 17-lactone steroid which is a renal competitive aldosterone antagonist in a class of pharmaceuticals called potassium-sparing diuretics. Due to its anti-androgen effect, it can also be used to treat polycystic ovary syndrome (PCOS) and hirsutism (Armanini et al, 2007; Koulouri and Conway, 2008). SPL inhibits the effect of aldosterone by competing for intracellular aldosterone receptor in the distal tubule cells. This increases the secretion of water and sodium, while decreasing the excretion of potassium. SPL acts both as a diuretic and as an antihypertensive drug by this mechanism (IARC, 2001). Although this drug is widely used in medicine, practically nothing is known about its mutagenic activity. Search in scientific databases such as PubMed-Medline, ScienceDirect and Scopus revealed the absence of relevant data. Only the data concerning the absence of its activity in the Ames (Salmonella/microsomes) assay on 5 strains with and without exogenous metabolic activation was found in the website of one of the producers of SPL as
53
Nersesyan et al: The study of possible cytogenetic activity of spironolactone routinely used in our laboratory was applied (Nersesyan and Stopper, 2003; Nersesyan et al, 2007). This assay gives the possibility to register both structural and numerical chromosomal aberrations. Each experimental group consisted of 5 mice. SPL was administered to mice twice at 0 and 24 h at doses equal to 0.5 and 0.25 of LD50, both intraperitoneally (i. p.) and orally, and mice were sacrificed at 48 h. SPL pills are used orally and application of this route of administration (oral) is clear, and i. p. route of administration was used because this route of administration of tested compounds induces more strong effects than oral one for many chemical agents (Nersesyan, 1987). According to the data of one of the producers of SPL as pharmacological preparation, Pfizer, Australia, the oral LD50 of SPL is greater than 1,000 mg/kg in mice, rats, and rabbits. Based on mentioned data, the doses of 500 and 250 mg/kg of SPL (dissolved in pure ethanol) were used. Using this protocol, we avoid to study MN-inducing effect at 24 h, 48 h and 72 h. Application of Kirkhart’s protocol can give the possibility to register MN-inducing effect of even weak mutagens and save time and animals. As positive control cyclophosphamide (CP, Merck, Germany) was used at a dose of 40 mg/kg (dissolved in 0.5 ml of saline). It was given orally and mice were killed 24 h after. As negative control the solvent of the compounds was used - ethanol, 0.5 ml (40%) which was administered either orally or i. p., based on the route of administration of SPL in various experiments. Bone marrow was flushed by means of newborn calf serum (0.2 ml, Sigma, USA) onto slides and smears were prepared. The slides were fixed with cold methanol for 20 min 24 h after the slides preparation. Slides were stained with azureeosin. After being stained, the slides were coded so that the reader was unaware of the identity of slides being scored. Each slide was assessed for MN in 2,000 polychromatic erythrocytes (PCEs). In addition, the per cent content of PCEs was calculated among 1,000 erythrocytes.
II. Materials and methods A. Subjects The study comprised 6 females of Armenian nationality newly diagnosed with polycystic ovary syndrome (PCOS) at Institute of Obstetrics and Gynecology, Ministry of Health, Yerevan, Armenia. All these women had expressed hirsutism. Six healthy female non-smoking volunteers with similar age and physical parameters (25-33 years old, mean age was 27.5±1.7 years) were included in investigations as controls. All the subjects gave their written consent to be included in the study. All females with PCOS had the following symptoms: 1) hirsutism score >6; 2) significantly increased level of testosterone in blood; 3) oligo-amenorrhea. All biochemical analyses were carried out at Research Center of Maternal and Child Health Protection, in Laboratory of Biochemistry. Hirsutism score was evaluated by a dermatologist using Ferriman-Gallway score.
B. Chromosomal analysis The CA assay was carried out using conventional techniques (Moorhead et al, 1960) with some modifications used in our laboratory (Batikian et al, 1981; Nersesyan et al, 2006). All reagents and chemicals used in this study, except specially noted, were produced in Russia. Heparinized blood (0.5 ml) was added to 4.5 ml medium, containing 78% RPMI 1640, 20% inactivated foetal bovine serum, antibiotics (penicillin and streptomycin) and stimulated with 2% of phytohaemagglutinin (Difco, USA), and incubated for 72 h at 37 °C. SPL (Sigma, St. Louis, USA) was dissolved in pure warm ethanol (30 mg in 1.0 ml) (O’Brien et al, 1985). It was added to cell cultures at 46 h of cultivation at concentrations of 300, 150 and 75 µg/ml. Based on the solubility of SPL and the toxicity of ethanol in human lymphocytes (maximal concentration of it in cell media must not be more 1%, Anupama et al, 2008), the abovementioned concentrations of SPL were studied. As a positive control antitumor drug photrinum (Fotretamine, photrinura, 2,2,4,4,6pentaethylenimino-6-morpholino-cyclotriphospha-zatriene, PTR) at concentration of 0.25 µg/ml was used (dissolved in physiological saline). This is alkylating agent with strong antitumor properties widely used in clinical oncology in Russia. It has strong mutagenic (clastogenic) activity (Batikian et al, 1981). Colchicine was added to a final concentration of 0.5 !g/ml culture medium, 2 h prior to harvesting. Lymphocytes were stained with azure-eosin. The end points analysed were total chromosome aberrations, percentage of aberrant metaphases and types of aberrations. Circa 75 well-spread metaphases containing 46 ± 1 chromosomes were studied from each donor. The classification of aberrations was based on ISCN 2005. Gaps were registered but not considered as CAs. The slides were evaluated under a light microscope MBI-6 (the USSR) with x 1000-fold magnification using oil immersion.
D. Statistics Analysis of human cells data was carried by application of chi-square test calculated by means of web calculator with Yate’s correction: http://people.ku.edu/~preacher/chisq/chisq.htm. Nonparametric Mann-Whitney U-test was used to compare the data obtained in animal experiments (GraphPad Prism, version 3.02).
III. Results and discussion The results of CA test in lymphocytes of healthy women and patients with PCOS treated with SPL are presented in Tables 1 and 2, respectively. Absolutely no changes were noted in lymphocytes of healthy women. In contrast, 1.3-fold increase was observed in lymphocytes of patients when the concentration of SPL was 300 and 150 µg/ml, although the differences with negative and solvent controls were not significant. The types of CA in treated lymphocytes also were not changed compared with the negative control. Mostly chromosomal breaks were registered in lymphocytes of PCOS patients which is in concordance with our previous work where 15 patients were investigated (Nersesyan et al, 2006). The percent of aberrant cells in lymphocytes induced by antitumor drug PTR increased circa 20- and 38-fold compared with negative controls in PCOS patients and healthy women, respectively. Martirosyan found in 1996 that heterochromatin content in chromosome #1 of women with expressed hirsutism (also due to PCOS) is decreased significantly by 22%. At the same time she found that close female relatives of these
C. Animals All animal experiments were approved by Ethic Commission of Ministry of Health of Armenia. The investigations were carried on 20 Swiss albino male mice (22-25 g) obtained from Institute of Zoology, Yerevan, Armenia. Before the experiment, within two weeks, the animals were subjected to acclimatization. The temperature in the rooms made up 22o C ± 2o C, humidity 45-50% ± 10%, the artificial light regime 12:12. The animals were kept in polypropylene cages (5 animals of the same sex per cage). Drinking water and standard rodent chow were at mice disposal ad libitum. Micronucleus assay in mouse bone marrow cells. The protocol for MN assay described by Kirkhart in 1981 and
54
Cancer Therapy Vol 6, page 55 patients also have decreased level of heterochromatin (17%). It is noteworthy, that Druzhinin showed in 1990 that either increase or decrease of heterochromatin in chromosomes #1 and #9 leads to increased sensitivity to environmental mutagens. Earlier Martirosyan found in 1996 that chromosomes of PCOS patients are more sensitive to some hormonal agents used in therapy of PCOS. In our experiments we did not observe any signs of increased sensitivity of chromosomes obtained from PCOS patients. Furthermore, the effect of PTR was more expressed in healthy women (37.6-fol increase compared with negative control in healthy women vs. 20-fold in patients). These observations can be interpreted as an complete inactivity of SPL in lymphocytes of healthy women and PCOS patients.
The results of MN experiments on mice are presented in Tables 3 and 4. It can be seen that SPL did not induce significant changes in MN level compared with the negative (solvent) controls administrated by both routes. Only the number of PCEs was significantly decreased in the group of mice treated i. p. with SPL at dose of 500 mg/kg (by 12.4%). It means that mentioned dose is slightly toxic for bone marrow. CP used permanently as positive control in our laboratory, increased the number of MN in PCEs circa 10-fold compared with solvent control. Ethanol (0.5 ml of 40%) was not MN-inducing in the experimental conditions. CP was non-significantly more active when administered i. p. which was also shown in other studies (Nersesyan, 1987).
Table 1. Chromosomal aberrations level in lymphocytes of patients with PCOS treated with spironolactone. Treatment (µg/ml)
Number of studied cells 395 359 383 363
SPL (300) SPL (150) SPL (75) Ethanol (solvent control) PTR 435 (0.25, positive control) Saline 620 (negative control)
Number of aberrant cells 15* 12* 13* 10*
Aberrant Number of cells (%) aberrations per 100 cells 3.80* 4.5* 3.84* 4.7* 2.87* 3.4* 2.85* 3.3*
Total number of aberrations Gaps Chro- Chromo- Exchanmatid somal ges breaks breaks 5* 7* 10* 1 6* 5* 11* 0 4* 5* 9* 1 2 12* 0 0
201**
46.2**
51.7**,†
32** 148**
54**
23**
14*
2.3*
2.6*
2
10*
0
6*
* p<0.05; ** p<0.001; each parameter was compared with corresponding one of healthy women † p<0.001 compared with negative and solvent controls; chi square test with Yate’s correction
Table 2. Chromosomal aberrations level in lymphocytes of healthy women treated with spironolactone. Treatment (µg/ml)
SPL (300) SPL (150) SPL (75) Ethanol (solvent control) PTR (0.25, positive control) Saline (negative control)
Number of studied cells 548 605 527 582
Number of aberrant cells 6 5 5 5
Aberrant cells (%)
1.1 1.0 1.0 0.9
Number of Total number of aberrations aberrations Gaps Chro- Chromo- Exchanper 100 cells matid somal ges breaks breaks 1 1 1 0 0 1 2 1 0 0 1 1 1 0 0 0.9 2 1 0 0
448
135*
30.1*
33.2*
19*
80*
52*
15*
748
6
0.8
1
0
6
0
0
* p<0.001 compared with negative and solvent controls; chi square test with Yate’s correction
55
Nersesyan et al: The study of possible cytogenetic activity of spironolactone
Table 3. Micronucleus level in polychromatic erythrocytes of Swiss male mice treated with spironolactone orally. Group of mice
Dose (mg/kg)
PCEs with MN (‰; mean ± S.D.)
SPL
500
Positive control (CP) Solvent control (40% ethanol)
3.2±0.6
Total number of MN per 1000 PCEs (mean ± S.D.) 3.2±0.6
Number of PCEs among 1000 erythrocytes (mean ± S.D.) 52.2±4.2
250
2.7±1.0
2.7±1.0
52.8±5.1
40
20.0±3.8*
23.6±4.5*
51.6± 6.2
20 0.5 ml/mice
2.6±0.9
2.6±0.9
55.2±6.2
* p<0.001 compared solvent control; Mann-Whitney U-test with Gaussian approximation
Table 4. Micronucleus level in polychromatic erythrocytes of Swiss male mice treated with spironolactone intraperitoneally. Group of mice
Dose (mg/kg)
SPL
Positive control (CP) Solvent control (40% ethanol)
500
PCEs with MN Total number of (‰; MN per 1000 (mean ± S.E.) PCEs (mean ± S.E.) 4.1±1.0 4.1±1.0
Number of PCEs among 1000 erythrocytes (mean ± S.E.) 45.4±4.3*
250
3.4 ±1.1
3.4 ±1.1
52.0±1.6
40
28.0±1.8**
32.6±2.5**
52.0± 3.7
20 0.5 ml/mice
3.1±0.9
3.1±0.9
51.8±2.7
* p<0.05; ** p<0.001 compared solvent control; Mann-Whitney U-test with Gaussian approximation
of polycystic ovary syndrome with spironolactone plus licorice. Eur J Obstet Gynecol Reprod Biol 131, 61-7. Batikian GG, Zalinian GG, Arutiunian RM (1981) Effect of modifying the action of dipin and PTR in a human lymphocyte culture. Tsitol Genet 15, 31-6. Druzhinin VG (1990) The characteristics of the localization of induced ruptures in human chromosomes. Tsitologiia 32, 847-51. http, //www.pbs.gov.au/pi/pfpaldat11106.pdf IARC Monographs on the Evaluation of Carcinogenic risks to Humans. Some Thyrotropic Agents. Diuretic, Spironolactone. (2001) Vol. 79. pp. 317-378. IARC, Lyon, France. ISCN, International System for Human Cytogenetics Nomenclature (2005), L G. Schaffer and N. Tommerup (Ed.), Basel, Switzerland.
Since SPL did not induce significant increase of MN at doses equivalent to " and # of LD50, it can be concluded it has no cytogenetic activity in mice. To our knowledge, this is the first study on cytogenetic activity of SPL in human and animal cells. Since we did not obtain any evidence of activity in human cells in vitro and mouse bone marrow erythrocytes in vivo, and the producers of SPL reported about the absence of its activity in the Ames assay, it may be proposed that SPL is genetically inactive. Carcinogenic activity of this compound in chronic experiments in rats is possibly connected with its influence on metabolism and antiandrogenic activity (IARC, 2001). And, hence, carcinogenic activity of SPL may not be connected with its genotoxicity.
Jewell CW, Watson LE, Mock J, Dostal DE (2006) Aldosterone receptor antagonists and cardiovascular disease: do we need a change of the guard? Cardiovasc Hematol Agents Med Chem 4, 129-53. Kinkhart B (1981) Micronucleus test on 21 compounds. In, Ashby J, de Serres FJ, Shelby MD, Margolin BH, Ishidate M, Beckong GG (Eds.). Evaluation of Short-Term Tests for Carcinogenens (Vol 1). Geneva, University Press, 698-704.
References Anupama M, Murgan SS, Murthy PB (2008) Broccoli flower head extract reduces mitomycin-C induced sister chromatid exchange in cultured human lymphocytes. Food Chem Toxicol 46, 3351-3 Armanini D, Castello R, Scaroni C, Bonanni G, Faccini G, Pellati D, Bertoldo A, Fiore C, Moghetti P (2007) Treatment
56
Cancer Therapy Vol 6, page 57 Koulouri O, Conway GS (2008) A systematic review of commonly used medical treatments for hirsutism in women. Clin Endocrinol (Oxf) 68, 800-5. Martirosyan AA (1996) Genealogic and cytogenetic investigations of phenotype of Armenian women with endocrine disturbances and hirsutism. PhD thesis. Institute of Physiology, Yerevan, Armenia. Moorhead PS, Nowell PC, Mellman WJ, Batipps DP. Hungeford DA (1960) Chromosome preparations of leukocytes cultured from human peripheral blood. Exp Cell Res 20, 613-616. Nersesyan A, Martirosyan A, Parsadanyan G, Zalinyan G (2006) Chromosomal aberrations level in peripheral blood lymphocytes of women with polycystic ovary syndrome. J BUON 11, 477-80. Nersesyan A, Muradyan R, Arsenyan F (2007) The influence of three newly synthesized pyrimidine-containing compounds on micronucleus induction and tumor growth. J BUON 12, 521-7. Nersesyan A, Stopper H (2003) Genotoxic activity of four newly synthesized pyrrolin-2-one derivatives. J BUON 8, 357-63. Nersesyan AK (1987) Modification of mutagenesis and carcinogenesis by means of physiologically active compounds. DSc thesis. Institute of Biochemistry, Yerevan, Armenia.
O'Brien MS, Salamone LF, Gibson TP (1985) Effect of spironolactone on the renal clearance of digoxin in dogs. J Pharmacol Exp Ther 234, 190-4.
Armen Nersesyan
57
Nersesyan et al: The study of possible cytogenetic activity of spironolactone
58
Cancer Therapy Vol 7, page 59 Cancer Therapy Vol 7, 59-62, 2009
The history and future of canine lymphoma monoclonal antibody 231 Review Article
K. Ann Jeglum Adjunct Associate Professor, The Wistar Institute, Philadelphia, PA
__________________________________________________________________________________ *Correspondence: K. Ann Jeglum, V.M.D, Diplomate, ACVIM (Oncology), Veterinary Oncology Services and Research Center, 739 E. Nields St., West Chester, PA 19382, USA: Tel: 610-692-6272; Fax: 610-696-4635; e-mail: Kajeglum@aol.com Veterinary Oncology Service's Radiation Center, 24 W. Butler Ave., Chalfont, PA 18914, USA; Tel: 215-822-8225; Fax: 215-8228324 Key words: canine lymphoma monoclonal antibody 231, Characterization Abbreviations: activated mouse macrophages, (ADMC); acute myelogenous leukemia, (AML); antibody-dependent cell-mediated cytotoxicity, (ADCC); antigen-presenting cells, (APCs); Canine anti-mouse antibodies, (CAMA); complement-dependent cytotoxicity assay, (CDC); Food and Drug Administration’s, (FDA); Monoclonal antibody, (MAb); multidrug resistance, (MDR); Peripheral blood leukocytes, (PBLs); United States Department of Agriculture, (USDA) Received: 14 May 2008; electronically published: January 2009
Presented in the Theilen Tribute Symposium at UC Davis 31st May- 1st June 2008.
Summary Canine lymphoma monoclonal antibody 231 was the first therapeutic anti-cancer monoclonal antibody (MAb) to be government approved for veterinary medicine. It was well-characterized as a specific lymphoma binding, cytotoxic MAb. Its recommended use was a maintenance therapy following induction of remission with short term chemotherapy using an eight week course of chemotherapy. The clinical data showed comparable remission durations and survival times without maintenance chemotherapy. As observed with human MAb therapy in lymphoma, chemotherapy resistance appeared to be modified. The reinduction of multiple remissions were attained with the same chemotherapy drugs thus prolonging survival times and avoiding the need for rescue protocols
recommended followed by a three week rest prior to MAb therapy. Dogs not in remission at that time should not receive MAb 231. Synbiotics Corporation had sublicensed MAb 231 from The Wistar Institute in 1990 and had the product on the veterinary market from 1992 to 1996. Many challenges ensued in trying to convince the veterinary profession, including oncologists, of the potential benefits of this treatment approach. Many of the problems involved the off label use of the product after many months of chemotherapy when significant immunosuppression may have already occurred. However, with the advent of rituximab, the long time elusive validation of immunotherapy as the fourth modality of human cancer therapy was reached. It is the intent of this paper to recite the history of the development and characterization MAb 231 as an introduction to clinical data being presented at this symposium. The clinical dilemmas of treating canine lymphoma and issues relative to the future of chemoimmunotherapy will also be addressed.
I. Introduction Since 1997 monoclonal antibody (MAb) therapy has become a gold standard of therapy in conjunction with chemotherapy in human non-Hodgkin’s lymphoma (Bello and Sotomayor, 2007). The first, rituximab, an anti-CD-20 chimeric monoclonal antibody, was approved for the treatment of refractory or relapsed B-cell non-Hodgkin's lymphomas. More therapeutic MAbs have been introduced since then. In 1992, prior to the U.S. Food and Drug Administration’s (FDA) approval of the first monoclonal antibody for the treatment of human cancer, the United States Department of Agriculture (USDA) had approved the licensing of MAb 231 for use in dogs with lymphoma. Canine lymphoma MAb 231 is a murine-derived MAb. The license was for the use of MAb 231 as adjuvant therapy following remission induction with chemotherapy. The recommended chemotherapy protocol to be used was VCAA (vincristine, cyclophosphamide, L-asparaginase and doxorubicin) based on the clinical efficacy data presented to the USDA. Only two, four week cycles of chemotherapy or a total of eight weeks were 59
Jeglum: The history and future of canine lymphoma monoclonal antibody 231 development of tumors in nude mice (p<0.001) and mice did not develop tumors in the 300 day follow-up period (Steplewski et al, 1990). It was also shown that MAb 231 mediated tumor lysis by activated mouse macrophages (ADMC). Therefore, MAb 231 presented cytotoxic activity in all systems tested: ADCC and CDC with canie effector cells, ADMC with murine macrophages, and inhibition of tumor growth in nude mice. Additional mechanisms of MAb-mediated cytotoxicity have been shown. One is the direct induction of apoptosis following the binding of antigen by the MAb (Alas et al, 2001; Byrd et al, 2002; Jazirehi and Bonavida 2005). Additionally, a mechanism relating to the potential “vaccinal effect” of MAb has been gaining attention. The killing of lymphoma cells by MAb might promote the cross-presentation of lymphoma antigens by antigen-presenting cells (APCs) and priming of lymphoma antigen-specific T-cells (Selenko et al, 2001).
II. Characterization of MAb 231 In 1983, canine lymphoma cell line 17-71 was established form a dog with multicentric lymphoma (Steplewski et al, 1987). Using the hybridoma technology developed by Kohler and Milstein in 1975, the selective specifications of 6 anti-canine lymphoma Mabs were reported. Several selection criteria were used to screen for potential therapeutic MAbs. First was the demonstration of restricted binding to tumor cells and not normal cells using in vitro assays including radio immunoassay, cytofluorimetry and immunoperoxidase assays. Secondly, the therapeutically desirable MAb isotypes were IgG2a and IgG3 since they mediate cytotoxicity. And lastly, the antibodies should be cytotoxic against target tumor cells. MAb 231 did not bind to normal lymphocytes from peripheral blood, lymph node, spleen or bone marrow (Steplewski et al, 1987). The minimal cross reactivity of MAb 231 (IgG2a) observed with the human myelomonocytic cell line and with monocytes and granulocytes was probably due to the binding of IgG2a protein to the Fc receptors expressed by these cells. MAb 231 bound to 73% of the lymphomas tested in this initial study. In further screening in clinical cases using an immunoperoxidase assay on formalin-fixed, paraffinembedded tumor tissue, approximately 75% of dogs with lymphoma bound MAb 231. In the antigen analysis of this panel of MAbs, 231 did not bind to immunoblots of tumor cell extracts and no protein molecules were immunoprecipitated from the tumor or normal cells. No binding of those MAbs to glycolipid extracts of tumor and normal cells was detected. More sophisticated methods of identifying the 231 antigen were never attempted. However, in subsequent studies of immunoconjugates with MAb 231, the antigen was found to rapidly internalize, thereby potentially affecting the ability to identify its molecular weight. Peripheral blood leukocytes (PBLs), nonadherent lymphocytes and adherent monocytes separated from freshly isolated blood of 15 dogs were analyzed for their ability to mediate antibody-dependent cell-mediated cytotoxicity (ADCC) in combination with murine antitumor MAbs (Rosales et al, 1988). Canine monocytes presented high ADCC activity against the canine lymphoma 17-71 tumor cell line with MAb 231. Canine lymphocytes generally showed lower ADCC activity than total PBLs or monocytes. Analysis of the role of murine MAb isotypes on ADCC activity against tumors by canine cells using anti-human tumor class-switch variant MAbs and a panel of anti-canine lymphoma MAbs of different IgG subclass revealed the highest ADCC activity with MAbs of the IgG2a and IgG3 subclasses. IgG2a subclass antilymphoma MAbs were also able to lyse tumor cells in complement-dependent cytotoxicity assay (CDC). These results supported the potential value of MAbs of IgG2a and IgG3 subclasses in immunotherapy of canine lymphoma. Further in vivo studies were conducted to substantiate MAb 231's anti-tumor effects. Tumor growth inhibition experiments were conducted using a 17-71 xenograft model in nude mice. MAb 231 and MAb 2342a, both IgG2a isotypes, inhibited completely the
III. The future and issues Immunoconjugate studies have been conducted with MAb 231 using a potent chemotherapy drug, calicheamicin. The first step was to determine that in fact MAb 231 internalized and therefore, was an excellent candidate for immunoconjugation. One of the calicheamicin derivatives, n-acetyl-gamma-DM was selected for the canine lymphoma studies (Jeglum et al, 1994). The MAb 231 immunoconjugate was first shown to kill canine lymphoma 17-71 cells in vitro. It was also evaluated in a 17-71 xenograft model. Tumors grew to approximately 400 mg in size at day 7 post implantation. Twelve mice were in the control group and received no treatment and all had progressive tumor growth. Intraperitoneal treatment with either drug alone, n-acetyl!dimethyl hydrazide or the MAb 231 conjugate was begun on days 7, 11, and 14 days post implantation at various dosage levels. Animals treated with 0.5 ug of conjugated drug alone had progressive growth, although slower than the control group. Mice treated with 2 and 4 ug respectively of the conjugate had complete regression of tumor. All 12 mice had long term survival with no delayed toxicity and were considered cured. This immunoconjugate appears to be a good candidate to treat canine lymphoma without prior induction of remission with chemotherapy. Subsequent to the canine lymphoma studies, human clinical trials with a calicheamicin immunoconjugate were undertaken in acute myelogenous leukemia (AML). These trials resulted in gemtuzumab ozogamicin (Mylotag,™) being licensed by the FDA for treatment of patients with CD33 + AML. Its indication is for first relapse patients who are 60 years of age or older in first relapse and who are not considered candidates for other cytotoxic chemotherapy. One important observation made in the clinical trials of MAb 231 was the possible modification of multidrug resistance (MDR). Most would agree that the ultimate cause of death in lymphoma patients is the lack of response to chemotherapy thereby resulting in progressive disease. In the dog, failure to respond to the most commonly used first line protocols using combinations of 60
Cancer Therapy Vol 7, page 61 cyclophosphamide, doxorubicin, vincristine, prednisone and L-asparaginase, whatever the individual variations, results in shortened overall survival times. Second remission inductions have historically been low. Avoidance of MDR will result in longer survival times. In relapsed MAb 231 dogs, second remission rates were 80% with many attaining additional remissions with relapse and still using VCAA for reinduction. Similar observations of MDR modifications have been made with rituximab therapy. This deserves further elucidation of possible mechanisms. The issue, of the lack of identification of the tumor antigen that MAb 231 targets, will need to be readdressed using newer techniques. One might raise issue of this being a murine-derived MAb versus a “caninized” like the chimeric, humanized MAbs. Canine anti-mouse antibodies (CAMA) were evaluated in treated dogs. All dogs had low, preexisting CAMA. A peak response above baseline was observed at 2-3 weeks post MAb infusion. The CAMA titer declined back to pretreatment values over the next 3-4 months. Dogs receiving more than one cycle of MAb showed a stronger, earlier, and longer lasting antibody response thus mimicking a normal immune response to an initial sensitization followed by a booster. The CAMA observed was a nonspecific anti-mouse antibody and not anti-idiotype. There were no clinical ill effects observed in dogs treated with murine MAb in contrast to humans who received the early murine-derived therapeutic MAbs. The length of repeated remissions and survival times did not appear to be affected. Synbiotics Corporation stopped production of CL/MAb 231™ in the mid 1990’s. Unfortunately they continued to hold the sublicense from Wistar despite their lack of MAb production. As of January, 2008 Synbiotics agreed to terminate the license and the hybridomas have been returned to Wistar Institute. As of April 2008, the Hybridoma Core Facility at Wistar has produced MAb 231 and confirmed the subisotype to be IgG2a. Binding studies and confirmation of cytotoxicity are planned. To quote Dr. Alfred Legendre from a recent editorial, “despite a great deal of effort, extension of median survival time much beyond 1 year is still an elusive goal in veterinary oncology” and “I doubt if major breakthroughs in survival times will be achieved with reshuffling of currently available chemotherapy drugs.” (Legendre, 2007). It has only been in the last several years that veterinary oncologists have acknowledged that long term maintenance chemotherapy does not extend median remission and survival times (Garrett et al, 2002; Simon et al, 2006; Hosoya et al, 2007). The role of maintenance chemotherapy in enhancing MDR has to be questioned. It may be time to more universally recognize that immunotherapy can play an important role as maintenance therapy in extending both remission and survival times and improving reinduction of remissions. MAb 231 already has been characterized, has governmental approval and has been used in the clinical setting. Several approaches could be undertaken to potentially improve the clinical efficacy of MAb 231. A longer than eight week induction protocol, such as those recently published without maintenance, may further
improve the first remission duration. Repeated cycles of maintenance MAb231, as done in humans with rituximab, may prolong first remissions and overall survival. Additionally, the future of immunoconjugates remains to be seen. Since there has been no significant improvement in the survival times of treating canine lymphoma in the decade since MAb 231 has not been available, it may be appropriate for the revival of chemoimmunotherapy (Jeglum, 1996).
References Alas S, Emmanouilides C, Bonavida B (2001) Inhibition of interleukin 10 by rituximab results in down regulation of bcl2 and sensitization of B-cell non-Hodgkin’s lymphoma to apoptosis. Clin Cancer Res 7, 709-723. Bello C, Sotomayor E (2007) Monoclonal antibodies for B-cell lymphomas, rituximab and beyond. American Society of Hematology Education Book, Hematology. Byrd JC, Kitada S, Flinn IW, Aron JL, Pearson M, Lucas D, Reed JC (2002) The mechanism of tumor cell clearance by rituximab in vivo in patients with B-cell chronic lymphocytic leukemia, evidence of capase activation and apoptosis. Blood 99, 1038-1043. Garrett LD, Thamm DH, Chun R, Dudley R, Vail DM (2002) Evaluation of a 6-month chemotherapy protocol withn no maintenance therapy for dogs with lymphoma. J Vet Int Med 16, 704-709. Hosoya K, Kisseberth WC, Lord LK, Alvarez FJ, Lara-Garcia A, Kosarek CE, London CA, Couto CG (2007) Comparison of COAP and UW-19 protocols for dogs with multicentric lymphoma. J Vet Int Med 21, 1355-1363. Jazirehi AR, Bonavida B (2005) Cellular and molecular signal transduction pathways modulated by rituximab (rituxin, antiCD 20 MAb) in non-Hodgkin’s lymphoma, implications in chemosensitization and therapeutic intervention. Oncogene 24, 2121-2143. Jeglum KA (1996) Chemoimmunotherapy of canine lymphoma with adjuvant monoclonal antibody 231.Vet Clin N Amer, Sm Anim Pract 26, 73-85. Jeglum KA, Hinman LM, Harmann PR, Beyer CF (1994) Antitumor effects of a calicheamicin immunoconjugate with anti-canine lymphoma monoclonal antibody 231. Proceedings AACR 35, 3016. Legendre AM (2007) Treatment of dogs with lymphoma, a work in progress. J Vet Intern Med 21, 1166-1167. Rosales C, Jeglum KA, Obrocka M, Steplewski Z (1988) Cytolytic activity of murine anti-dog lymphoma monoclonal antibodies with canine effector cells and complement. Cellular Immunology 115, 420-428. Selenko N, Maidic O, Draxier S, Berer A, Jäger U, Knapp W, Stöckl J (2001) CD20 antibody (C2B8)-induced apoptosis of lymphoma cells promotes phagocytosis by dendritic cells and cross-priming of CD8+ cytotoxic T cells. Leukemia 15, 1619-1626. Simon D, Nolte I, Eberle N, Abbrederis N, Killich M, Hirschberger J (2006) Treatment of dogs with lymphoma using a 12-week maintenance-free combination chemotherapy protocol. J Vet Int Med 20, 948-954. Steplewski Z, Jeglum KA, Rosales C, Weintraub N (1987) Canine lymphoma-associated antigens defined by murine monoclonal antibodies. Cancer Immunol Immunother 24, 197-201. Steplewski Z, Rosales C, Jeglum KA, McDonald-Smith J (1990) In vivo destruction of canine lymphoma mediated by murine monoclonal antibodies. In Vivo 4, 231-234.
61
Jeglum: The history and future of canine lymphoma monoclonal antibody 231
62
Cancer Therapy Vol 7, page 63 Cancer Therapy Vol 7, 63-70, 2009
Long term follow-up of Thalidomide plus Interleukin-2 based therapy in metastatic renal cell cancer patients Research Article
Robert J. Amato*, Muhammad Khan, Somyata Saxena Department of Internal Medicine, University of Texas Medical School, Houston, TX
__________________________________________________________________________________ *Correspondence: Robert J Amato, DO, Professor, University of Texas Medical School, Department of Internal Medicine, Division of Oncology, 6410 Fannin, Suite 710, Houston, Texas 77030, USA; Tel: 832-325-7701; Fax; 713-512-7132; e-mail: Robert.Amato@uth.tmc.edu Key words: Thalidomide, IL-2, MRCC Abbreviations: basic fibroblast growth factor (bFGF); Granulocyte macrophage-colony stimulating factor (GM-CSF); interferon-! (IFN-!); interleukin-1 (IL-1); interleukin-2 (IL-2); Karnofsky performance status, (KPS); magnetic resonance imaging (MRI); metastatic RCC (MRCC); Overall survival (OS); Progression free survival (PFS); renal cell carcinoma (RCC); tumor necrosis factor-! (TNF-!); vascular endothelial growth factor receptor (VEGF); von Hippel-Lindau (VHL) Received: 4 December 2006; Revised: 26 February 2007 Accepted: 29 June 2007; electronically published: February 2009
Summary A number of agents targeting cellular proteins have shown modest single agent response rates and improved survival rate and some have shown greater anti-tumor activity in combination with standard cancer therapies. Emerging data shows that combinations of molecular targeting agents may be better than single agents. Between January 2001 to February 2005, 83 clear cell Metastatic Renal Cell Carcinoma patients received an initial dose of Thalidomide 200 mg/day for a week and escalated to 400 mg within 48 hours during the first week (week 0) prior to the initiation of the cytokines. IL-2 at 7 MIU/m2 was given to all patients while GM-CSF at 250ug/m was given to only 31 patients after the initial week of thalidomide therapy. Median overall survival rates were as follow: for the favorable risk group it was 28.8 months, for intermediate risk group it was 19.9 months and for poor risk group, it was 9.07 months. These results show significant improvement in survival rates with the combination of Thalidomide + IL-2 as compared to Memorial Sloan Kettering Cancer Center prognostic model.
by a distinct clear or granular cell appearance visible by light microscopy and the majority is associated with the inactivation of the von Hippel-Lindau (VHL) tumor suppressor gene (Amato, 2000; George and Kaelin, 2003). When detected at an early stage, RCC can often be successfully treated by radical nephrectomy or with nephron-sparing surgery, if feasible; however, as many as 20% to 30% of patients develop metastatic disease following these procedures (Godley and Taylor, 2001). Approximately one third to one half of RCC patients present with locally advanced or stage IV disease, having missed characteristic, though nonspecific symptoms such as fatigue, weight loss, malaise, fever, and/or night sweats (Godley and Taylor, 2001; Bleumer et al, 2003). The 5year survival rate for metastatic patients is <2% (Godley and Taylor, 2001). Treatment for RCC is limited. In contrast to many other malignancies, RCC is generally resistant to both
I. Introduction Despite significant progress in understanding the biology of renal cell carcinoma (RCC), it is estimated that over 39,000 people in the United States will be diagnosed and approximately 12,800 will die from this disease in 2006. RCC presently ranks tenth as the leading cause of cancer death and constitutes 3% of all solid neoplasms. For reasons not entirely well understood, 62% of the estimated new cases will occur in men and only 38% in women (Jemal et al, 2006). However, the incidence of RCC is rising in women: from 1975 to 1995, it rose by 3.1% and 4.3% in white and black women, respectively, whereas in white and black men it rose by 2.3% and 3.9%, respectively (Chow et al, 1999). The majority of renal tumor malignancy is classified as RCC and originates from the proximal tubule epithelium (Amato, 2000). Predominantly known as clearcell type or renal adenocarcinoma, RCC is characterized 63
Amato et al: Long term follow-up of Thalidomide plus IL-2 in metastatic renal cell cancer patients chemotherapy and hormone therapy (Motzer et al, 2000). With the advent of nonspecific biological response modifiers in the 1980s and their subsequent approval, single-agent interleukin-2 (IL-2) and interferon-! (IFN-!), achieved response rates (complete response + partial response) of 10% to 20% (Amato, 2000). Though modest, these responses were clearly superior to chemotherapy and represented a significant advance. Long-term survival, however, is achieved in few patients (Motzer et al, 2000). To improve upon these findings and exploit the impressive synergy observed in in vitro models, combination IL-2 plus IFN-! trials were subsequently conducted. For reasons not clearly well understood, response rates rarely exceeded 20-30%: an early indication that cancer cell lines could not always predict clinical outcome (Amato, 2000). Since the approval of IL-2 for the treatment of metastatic RCC (MRCC), for 14 years no other agents have demonstrated significant enough antitumor activity to warrant Food and Drug Administration (FDA) approval until recently. Complicating the issue is that response rates are often difficult to discern from the natural history of the disease, and therefore must be carefully scrutinized (Amato, 2003). In the past several years, however, promising new agents have proven successful in not only preclinical, but in early phase I and II clinical testing and now in phase III testing. Two multi-targeted molecular agents, Sorafenib and Sunitinib, have been approved for advanced RCC patients. The development of many of these new agents has been driven by the extraordinary progress in understanding many of the biological mechanisms that contribute to oncogenesis, such as immune regulation dysfunction, inappropriate activation of signal transduction pathways, and tumor angiogenesis. Nephrectomy remains the only known effective curative therapy for the treatment of localized RCC and is typically considered solely for palliation in patients with MRCC. Key prognostic features in advanced RCC have been discussed by a number of authors. Three prognostic groups (poor, intermediate and favorable risk) have been characterized based upon the number of abnormal patient characteristics. The risk factors for evaluation are: • Low ECOG performance status (PS " 2) • High lactate dehydrogenate (> 1.5 x ULN) • Low serum hemoglobin (< the lower limit of normal) • Corrected calcium > 10 mg/dl • Absence of prior nephrectomy Patients who have demonstrated no abnormalities from the list above had a median survival of 20 months. Those with 1 or 2 risk factors had a median survival of 10 months and those with 3 or more risk factors had a median survival of 4 months (Motzer et al, 2000). Approximately 45% to 50% of all RCC cases arise from mutations in the VHL gene and are classified as clear-cell carcinomas (Presti et al, 1991; Zambrano et al, 1999; Linehan et al, 2001). Mutations of VHL result in a deregulation and induction of hypoxia-responsive genes involved in the regulation of VEGF and angiogenesis
(Maxwell et al, 1999; Blancher et al, 2001; Linehan et al, 2001). Excessive expression of VEGF promotes an angiogenic environment, resulting in a highly vascular tumor consisting of malignant clear cells surrounding capillaries and blood sinuses (Linehan et al, 2001). Excessive expression of basic fibroblast growth factor (bFGF) has also been reported in renal cell tumors, and patients with increased bFGF levels have a poorer prognosis (Rasmuson et al, 2001). The cytokine IL-2 possesses both antineoplastic and immunomodulating activity, although its exact mechanism remains unknown (Wirth, 1993; Bukowski, 1997; Motzer and Russo, 2000; Bukowski, 2001; Glaspy, 2002). Treatment with IL-2 results in similar response rates to IFN-! (Wirth, 1993; Bukowski, 1997, Fisher et al, 2000; Motzer and Russo, 2000). However, reviews of IL-2 activity have reported a 3% to 9% complete response rate not observed with IFN-! treatment (Negrier et al, 2000; Bukowski, 1997). Therefore, in order to optimize the response to IL-2 treatment, several agents, including IFN!, have been combined with IL-2. Some benefit has been noted with IL-2 combination regimens to date, although mortality rates for patients with MRCC remain high (Fyfe et al, 1995; Bukowski, 1997; Linehan et al, 2001; Zisman et al, 2001; Amato, 2002; Dutcher, 2002; Fishman and Seigne, 2002; Morgan et al, 2005). The biologic agent thalidomide has potent antiangiogenic and immunomodulatory activity (Sampaio et al, 1991; D'Amato et al, 1994; Kenyon et al, 1997; Thomas and Kantarjian, 2000). Although its mechanism of activity is not fully known, thalidomide has been shown in experimental models to promote apoptosis of established neovasculature, as well as down regulate molecules involved in neutrophil-endothelial interaction and the adhesion cascade (D'Amato et al, 1994; Geitz et al, 1996). Thalidomide has been shown to inhibit the production of tumor necrosis factor-! (TNF-!), VEGF, and bFGF and increase the production of IL-2 (Sampaio et al, 1991, D'Amato et al, 1994; Kenyon et al, 1997; Haslett et al, 1998; Shannon and Sandoval, 1998; Davies et al, 2001). Granulocyte macrophage-colony stimulating factor (GM-CSF) is a cytokine capable of inducing TNF and interleukin-1 (IL-1) expression as well as activation of macrophage and dendritic cells. The mechanism to enhance anti-tumor immunity is through direct activation of dendritic cells as well as indirect T-cell activation via IL-1 release. Single agent trials performed with GM-CSF has demonstrated anti-tumor activity in MRCC (Stadler et al, 1995; Wos et al, 1996). Cytokine-based combinations using GMCSF reported both safety and tolerability in addition to added anti-tumor activity (Steger et al, 1995; Mendel et al, 2006). Due to the extensive neovasculature of RCC, the ability of thalidomide to inhibit angiogenesis (bFGF and VEGF), increase IL-2 production and the similar activity of thalidomide and IL-2 as immune augmenting agents, there is potential to develop thalidomide plus IL-2 combination therapy as a therapeutic regimen for the treatment of MRCC (Amato et al, 2006). Another previous study combined treatment of mRCC tested in a phase II
64
Cancer Therapy Vol 7, page 65 clinical trial based on administration of IL-2 together with thalidomide. Thirty-seven patients who had not been previously treated systemically received treatment that consisted of thalidomide 400 md/d for 6 weeks and IL-2 (7 MIU/m2, days 1-5 for 4 weeks). The overall response rate was 53% (CR â&#x20AC;&#x201C; 8%, PR â&#x20AC;&#x201C; 28%) (D'Amato et al, 1994). A phase II study was initiated to explore the possibility of further enhancing the anti-tumor activity and improving the results of Thalidomide and IL-2 with GM-CSF. We will review the results of both the clinical trials utilizing thalidomide with IL-2 as the foundation (Motzer et al, 2004; Amato et al, 2006a,b).
Table 1. Patient characteristics and risk classification.
II. Methods Pretreatment Evaluation: Baseline evaluation; to determine eligibility consisted of a medical history; physical examination; Karnofsky performance status (KPS); vital signs; cardiac profile (ECG and echocardiogram); hematology (CBC with differential, platelet count), coagulation (PTT, PT, INR), and chemistry profiles (total protein, albumin, BUN, creatinine, sodium, potassium, chloride, CO2 content, bilirubin, ALT, AST, alkaline phosphates, and lactate dehydrogenase); thyroid function studies (TSH, T3 and T4) and urinalysis. Imaging included CT scan of the chest, abdomen and pelvis, magnetic resonance imaging (MRI) of the brain, and bone scan (in patients with known bone involvement). Diagnostic imaging tests were performed within 4 weeks of initial thalidomide treatment. Female patients of childbearing potential were subject to a "-HCG pregnancy test within 1 week before treatment initiation.
Characteristic Male/Female Age (years)
(n = 83) 60/23
Median Range Karnofsky Performance Status 60 80 100 Prior Nephrectomy Sites of Metasatic Disease Lung Nodal Liver Bone No. of Metastatic Sites 1 2
59.3 31.5-78.6
MSKCC Risk Group Low Intermediate High
(%) 72/28
4 25 54 81
5 30 65 98
60 25 19 22
72 30 23 27
35 47
42 57
26 54 3
31 66 3
A. Assessment of safety C. Assessment of response
Weekly evaluations examined hematology and limited chemistry profile (creatinine, BUN, sodium, potassium, chloride, CO2 content, bilirubin, ALT, AST, alkaline phosphatase). Every six weeks an evaluation included interim history, physical examination, KPS, complete hematology and chemistry profile, thyroid function studies, and urinalysis. If clinically indicated, cardiac and pulmonary function studies. Patients who received at least 1 week of thalidomide were considered evaluable for toxicity. Toxicity monitoring was conducted every 6 weeks, except for laboratory which was performed weekly, and utilized the National Cancer Institute Common Toxicity Criteria, version 3.0.
The first evaluation of tumor response to therapy was assessed after the initial 2 courses of therapy were completed (13 weeks) utilizing the similar diagnostic imaging studies from baseline with the exception of an MRI of the brain. Patients determined to be stable or responding to therapy were assessed after every 2 courses (12 weeks). After the completion of 6 courses, for those patients with an objective response, reevaluation occurred every 12 weeks. Patients who received at least 1 week of thalidomide plus cytokine therapy were considered evaluable for response. Response to therapy was assessed utilizing RECIST recommendations (Amato et al, 2006a).
B. Treatment regimen
D. Toxicity
An initial dose of Thalidomide 200 mg/day was administered to all the 83 patients seven days before the introduction of IL-2 and/or GM-CSF treatment. The thalidomide dose was increased to 400mg increment within 48 hours during the first week (week 0) to achieve the assigned dose before the initiation of the combination of cytokines. Thalidomide was given without an interruption at bedtime. Administration of IL-2 was fixed at 7MIU/m2 to all the 83 patients. After the initial week of thalidomide therapy, only 31 of patients received GM-CSF at 250 ug/m (Table 1). The delivery of IL-2 and GM-CSF was subcutaneously on days 1 through 5 of weeks 1 through 4. Weeks 5 and 6 were considered off weeks from IL-2 and GM-CSF. A course of therapy consisted of 6 weeks, with the exception of a 7 week initial course. Following the completion of 6 courses (9.1 months) of combination therapy, patients were continued on thalidomide. For those patients who had a complete response they continued for an additional 6 months, while those patients who had a partial or stable response continued thalidomide until disease progression or unacceptable toxicity was observed.
Thalidomide-based toxicities included somnolence, constipation and peripheral neuropathy. Toxicity commonly associated with IL-2 administration included; flu-like symptoms, hypotension, and nausea. Thalidomide plus IL-2 overlapping toxicity included fluid retention and skin rash. GM-CSF related toxicity was consistent with bone discomfort. Hematologic changes consisted of leukocytosis, neutropenia, lymphocytosis, eosinophilia, and thrombocytopenia. Overall the safety profiles reported were predominantly reversible grade 1 and 2 toxicity. Dose reductions of thalidomide were performed in less than 20% of the patients from 400 mg to 200 mg. There were no dose reductions for IL-2 and/or GM-CSF.
E. Statistical methods The primary end point of the study was response rate. The secondary end points were progression free survival (PFS) and overall survival (OS). Response rate was defined as total of complete responders and partial responders. PFS is defined as the
65
Amato et al: Long term follow-up of Thalidomide plus IL-2 in metastatic renal cell cancer patients date of initiating thalidomide to the date of first observation of progressive disease or death. OS is defined as the date of thalidomide initiation to date of death. Statistical analysis was performed using Graph Pad Prism 4 software program along with the help of MedCalc version 8.2.1.0 and Excel. Survival distributions were estimated using Kaplan-Meier methodology. Clinical features used in survival analysis included KPS, prior nephrectomy and selected baseline biochemical parameters like hemoglobin, LDH and corrected calcium. Corrected calcium was calculated using the formula: corrected calcium = total calcium – 0.707*(albumin – 3.4). Risk classification was done based on comparison between normal and measured values. Patients were divided among one of the three risk categories: those with zero risk factors (favorable risk), those with one or two (intermediate risk), and those with three or more (poor risk) accordingly. Survival curves for each of these groups in both arms were analyzed and the groups were compared using the log-rank test. An alpha of 0.05 was used as a standard for P-value comparison. Censored Data- Missing values were taken into consideration at the time of analyses. Case deletion was used to handle missing values. Patients lost to follow-up were counted as
censored values. This is indicated through the use of tick marks in the graphs.
III. Results A. Patient characteristics 83 patients (60 male, 23 female) of median age 59.3 years (range 31.5 – 78.6) were enrolled from January 2001 to February 2005. All patients were predominantly clear cell type. 31 (37.34%) of 83 patients received GM-CSF. 81(97.5%) had undergone prior nephrectomy. 26 (31.3%) patients had favorable risk, 54 (65.5%) had intermediate risk and 3 (3.6%) had poor risk (Table 2). Refer to Table 2 for complete listing of patient characteristics.
B. Baseline laboratory parameters The median of corrected calcium was 9.26, between the range of 3.2 and 15.7. The median for hemoglobin was 13.8 with range of 9.8 and 16.7 (Figure 1). Refer to Table 3, for the median, minimum and maximum values.
Table 2. Baseline laboratory parameters and range values. Laboratory Parameters Albumin Calcium Corrected Calcium Hemoglobin Male Female Lactate Dehydrogenase KPS
Normal Range 3.8 – 5.0 g/dL 8.6 – 10.6 mg/dL !10 mg/dL
Median 4.3 g/dL 9.5 mg/dL 9.26 mg/dL
Range 2.6 – 5.2 8.0 – 12.5 3.2 - 15.7
14 - 18 12 – 16 >1.5 x ULN 0 - 100
13.8
9.8-16.7
180 100
109.0 - 1153.0 60 - 100
Table 3. Treatment risk stratification and statistical numbers. Risk Groups
Median Survival
P-value
Favorable Intermediate Poor
28.80 19.90 9.07
0.0034
Figure 1. This graph compares the overall survival according to the risk groups in the entire study population. The survival proportions are based on the MSKCC (Memorial Sloan Kettering Cancer Center prognostic model) Criteria. The tick marks indicate the censored subjects in the study. The results are summarized in Tables 3 & 4.
66
Cancer Therapy Vol 7, page 67
C. Overall survival (OS)
risk group it was 19.9 months and for poor risk group, it was 9.07 months.
The combined median follow-up time was 39.03 months. Since 70 month period was used as a standard for comparison, altogether 15 people remained alive at the end of 70 month period. 59 patients had died by 70 month period. Total of 1 had no data and 8 were counted as lost to follow-up for entire group. Refer to Table 4 and 5 for complete OS data. Median survival rates were as follow: for the favorable risk group it was 28.8 months, for intermediate
D. Progression free survival (PFS) For the PFS analysis, the median was 11.74 months (Figure 2). No cut-off time limit was used. There were 73 events of interest (progression) and 10 subjects were censored from the analysis. The median was 50.22 months and mean was 51.21 months. Refer to Table 5 for detailed data.
Table 4. MSKCC patient counts. Male/ Female
Total
Survivors at 70 month
Death by 70 month
Subjects with no data
15/2 8/1
17 9
4 5
13 4
0 0
22/12 13/7
34 20
8 6
257 14
1 0
0/1 2/0
1 2
0 0
1 2
0 0
Number Progressed
Censored Subjects
Median Survival
Median 95% CI
42 18 8 2 3
2 2 0 0 0
11.74 months
50.22 months (44.89, 57.52)
Favorable Risk Group Thalidomide +IL-2 Thalidomide + IL-2 + GM-CSF Intermediate Risk Group Thalidomide +IL-2 Thalidomide + IL-2 + GM-CSF Poor Risk Group Thalidomide +IL-2 Thalidomide + IL-2 + GM-CSF
Table 5. Progression free survival count & statistical data.
Thalidomide + IL-2 + GM-CSF 1 year 1-2 year 2-3 year 3-4 year 4-5 year
&
Figure 2. The graph shows progression free survival (PFS) for both treatment groups. The tick marks indicate censored subjects. Median survival is 11.74 months for the entire group. Table 6 summarizes the results for progression free survival graph.
or without GM-CSF added in MRCC (predominantly clear cell) patients as compared to MSKCC prognostic criteria. The rationale for this combination was to determine
IV. Discussion The purpose of this review was to evaluate the efficacy of the combination of thalidomide plus IL-2 with 67
Amato et al: Long term follow-up of Thalidomide plus IL-2 in metastatic renal cell cancer patients whether the potential complementation of activities could be explored to improve the anti-tumor activity for MRCC patients. The greatest clinical benefit in the management of this malignancy is palliation with an acceptable toxicity profile. Angiogenesis inhibitors that have been assessed in phase II/III trials currently report mixed results concerning disease progression, stability, and duration, such as vascular endothelial growth factor inhibitor (Avastin), epidermal growth factor receptor inhibitors (Erbitux, Iressa, Tarceva), and platelet derived growth factor receptor inhibitors (Gleevac) and tyrosine kinase inhibitors (Sorafenib and Sunitinib). Often, stability alone is observed with these agents; regression has not been commonly observed until more recently with Sunitinib. Thus, objective responses are not commonly expected with single agent clinical trials of molecular targeted agents. A newly approved angiogenesis inhibitor Thalidomide, received approval from the FDA in May 2006 to treat multiple myeloma, and is being investigated as a treatment for many other disorders. Our study clearly supports the notion that Thalidomide when combined with IL-2 produces substantial results as compared to the MSKCC prognostic model. Thalidomide plus IL-2 compares favorably with two recent approved molecularly targeted-agents, Sorafenib and Sunitinib. As evident from the study results, combination of Thalidomide + IL-2 prolonged progression free survival and also improved overall survival. Progression free survival had a median of 11.74 months with 73 subjects experiencing disease progression by the end of the study. Overall survival for the favorable risk group for Thalidomide + IL-2 was 28.8 vs. 19.9 months for MSKCC model, a 44.7% improvement. Combined median survival for the intermediate group was 48.2% higher with combination of Thalidomide + IL-2 (19.9 vs. 10.3 months for MSKCC). Median survival for the poor risk group also showed improvement of 57.0% (9.07 vs. 3.9 months for MSKCC). These results show significant improvement in median survival rates with the combination of Thalidomide + IL-2 as compared to the MSKCC prognostic model. Duration and stability represent previously unexplored yet valuable endpoints to evaluate the efficacy of anti-angiogenic agents, both established and novel. In the past several years, advances in the underlying biologic mechanisms of RCC, particularly the role of tumor angiogenesis, has permitted the design of molecularly targeted-agents, such as Sorafenib and Sunitinib. The encouraging data of these agents has been reported in abstracts, various meetings, and in recent literature (Escudier et al, 2005; Motzer et al, 2005, 2006; Ratain et al, 2005). The available data for Sorafenib suggests that it inhibits vascular endothelial growth factor receptor (VEGF), as well as a number of tyrosine kinases, including the Raf kinase. In a recent phase III doubleblind, randomized trial the median duration of progression-free survival for Sorafenib was 24 weeks verses 12 weeks for placebo (p<0.00001). At 12 weeks,
79% of patients were progression-free in the sorafenib arm, compared to 50% in the placebo arm. Sorafenib is considered to be generally well tolerated (Updated Overall Survival Analysis Presented on Nexavar Phase III Trial, 2006). These findings indicate that Sorafenib improved progression free survival in MRCC patients. Also, an updated analysis indicated that the overall survival was longer for Sorafenib patients at 19.3 months versus 15.9 months for placebo patients (p=0.015, hazard ratio 0.77). This is after censoring the placebo patients. This suggests a favorable survival trend for Sorafenib patients (Ratain et al, 2005; Nexavar速 Approved by the FDA for Renal Cell Carcinoma, 2005; Updated Overall Survival Analysis Presented on Nexavar Phase III Trial, 2006). Another effective drug is Sunitinib. In a randomized Phase III trial, untreated patients with clear-cell MRCC were randomized 1:1 to receive Sunitinib (6-week cycles: 50 mg orally once daily for 4 weeks, followed by 2 weeks off) or IFN-! (6-week cycles: subcutaneous injection 9 MU given three times weekly). The primary endpoint was PFS. The median PFS for Sunitinib was 47.3 weeks and the objective response rate ranged from 24.8% to 35.7%. The median survival for IFN-! was 24.9 weeks and the objective response rate ranged from 4.9% to 8.8%. There were 49 deaths and 8% withdrew due to adverse events for Sunitinib and 65 deaths and 13% adverse events for IFN!. These results demonstrated statistically significant improvement in PFS and objective response rate for Sunitinib over IFN-! in first-line treatment of patients with MRCC (Updated Overall Survival Analysis Presented on Nexavar Phase III Trial, 2006). In another Phase III trial, one hundred and ninety-two patients were randomized to receive either high-dose IL-2 (95 patients) or IL-2 with IFN-! (91 patients). The results reported 10 patients progression-free at 3 years for HD IL2 versus just 3 patients for IL-2 and IFN-! group. The median survivals were 17.5 and 13 months (P = 0.24). Also, for patients with bone or liver metastases (P = 0.001) or with a primary tumor (P = 0.040), survival was superior with HD IL-2. These results therefore prove HD IL-2 to be an effective alternative for metastatic renal cell carcinoma patients (McDermott et al, 2005). Similarly, the combination of Thalidomide + IL-2 in our study signifies reliable treatment options. As compared to Sorafenib, Thalidomide + IL-2 had OS of approximately 19.30 months, similar to the 19.3 months for Sorafenib. As for PFS, the combined median for Thalidomide + IL-2 was 11.74 months, therefore, proving higher than Sorafenib of 4.61 months, 9.09 months for Sunitinib and 4.78 months for IFN-! as recorded in Phase III trials. In summary, the data presented here clearly shows the biologic effects in MRCC patients treated with a combination of thalidomide plus IL-2. The amount of antitumor activity is meaningful; however it requires further evaluation due to the encouraged overall durability that influences overall survival. To fully evaluate the merit of the combination of thalidomide plus IL-2, the scrutiny of a comparative phase II trial is required. Furthermore, for the group of MRCC patients who fail Sorafenib and Sunitinib, this provides a viable alternative. Additionally, this may
68
Cancer Therapy Vol 7, page 69 recombinant interleukin-2 therapy. J Clin Oncol 13, 688696. Geitz H, Handt S, Zwingenberger K (1996) Thalidomide selectively modulates the density of cell surface molecules involved in the adhesion cascade. Immunopharmacology 31, 213221. George DJ, Kaelin WG Jr. (2003) The von Hippel-Lindau protein, vascular endothelial growth factor, and kidney cancer. N Engl J Med 349, 419-421. Glaspy JA (2002) Therapeutic options in the management of renal cell carcinoma. Semin Oncol 29, 41-46 (suppl 7). Godley PA, Taylor M (2001) Renal cell carcinoma. Curr Opin Oncol 13, 199-203. Haslett PA, Corral LG, Albert M, Kaplan G (1998) Thalidomide costimulates primary human T lymphocytes, preferentially inducing proliferation, cytokine production, and cytotoxic responses in the CD8+ subset. J Exp Med 187, 1885-1892. Jemal A, Siegel R, Ward E, Murray T, Xu J, Smigal C, Thun MJ (2006) Cancer Statistics. CA Cancer J Clin 56, 106-30. Kenyon BM, Browne F, Dâ&#x20AC;&#x2122;Amato RJ (1997) Effects of thalidomide and related metabolites in a mouse corneal model of neovascularization. Exp Eye Res 64, 971-978. Linehan WM, Zhar B, Bates SE, Zelefsky MJ, Yang JC (2001) Cancer of the kidney and ureter, in DeVita VT Jr, Hellman S, Rosenberg SA (eds): Cancer: Principles & Practice of Oncology, 6th ed. Philadelphia, PA: Lippincott Williams & Wilkins, 1362-1396. Maxwell PH, Wiesener MS, Chang GW, Clifford SC, Vaux EC, Cockman ME, Wykoff CC, Pugh CW, Maher ER, Ratcliffe PJ (1999) The tumour suppressor protein VHL targets hypoxia-inducible factors for oxygen-dependent proteolysis. Nature 399, 271-275. McDermott DF, Regan MM, Clark JI, Flaherty LE, Weiss GR, Logan TF, Kirkwood JM, Gordon MS, Sosman JA, Ernstoff MS, Tretter CP, Urba WJ, Smith JW, Margolin KA, Mier JW, Gollob JA, Dutcher JP, Atkins MB (2005) Randomized Phase III Trial of High-Dose Interleukin-2 Versus Subcutaneous Interleukin-2 and Interferon in Patients With Metastatic Renal Cell Carcinoma. J Clin Oncol 23, 133-141. Mendel DB, Laird AD, Xin X, Louie SG, Christensen JG, Li G, Schreck RE, Abrams TJ, Ngai TJ, Lee LB, Murray LJ, Carver J, Chan E, Moss KG, Haznedar JO, Sukbuntherng J, Blake RA, Sun L, Tang C, Miller T, Shirazian S, McMahon G, Cherrington JM (2006) In vivo anti-tumor activity of SU11248, a novel tyrosine kinase inhibitor targeting vascular endothelial growth factor and platelet-derived growth factor receptors: determination of a pharmacokinetic/pharmacodynamic relationship Clin Cancer Res 9, 327-337. Morgan M, Rawat A, Amato RJ (2005) Phase II Studyof Thalidomide, Interleukin 2 plus Granulocyte macrophagecolony Stimulating Factor (GM-CSF) in Patients (Pts) with Metasatic Renal Cell Carcinoma (MRCC). J Clin Oncol (Meeting Abstracts) Vol 23, 4717. Motzer RJ, Bander NH, Nanus DM (1996) Renal-cell carcinoma. N Engl J Med 335, 865875. Motzer RJ, Hutson TE, Tomczak P, Michaelson MD, Bukowski RM, Rixe O, Oudard S, Kim ST, Baum CM, Figlin RA (2006) Phase III randomized trial of sunitinib malate (SU11248) versus interferon-alfa (IFN-!) as first-line systemic therapy for patients with metastatic renal cell carcinoma (MRCC). J Clin Oncol (Meeting Abstracts) Vol 24, LBA3. Motzer RJ, Mazumdar M, Bacik J, Berg W, Amsterdam A, Ferrara J (1999) Survival and Prognostic Stratification of 670 Patients With Advanced Renal Cell Carcinoma. J Clin Oncol 17, 2530-2555.
provide the basis for combining other molecular targeted agents with IL-2.
References Amato RJ (2000) Chemotherapy for renal cell carcinoma. Semin Oncol 27, 177-186. Amato RJ (2003) Thalidomide therapy for renal cell carcinoma. Crit Rev Oncol Hematol 46, 59-65. Amato RJ (2002) Thalidomide: an antineoplastic agent. Curr Oncol Rep 4, 56-62. Amato RJ (2006) Thalidomide Plus Interleukin-2 With or Without Granulocyte Macrophage-Colony. Stimulating Factor in Patients with Metastatic Renal Cell Cancer. International Cytokine Society Annual Meeting, Vienna Austria Amato RJ, Malya R, Rawat A (2006a) Phase II Study of Thalidomide, Interleukin-2 plus Granulocyte MacrophageColony Stimulating Factor in Patients with Metastatic Renal Cell Carcinoma. Am J Clin Oncol, in press. Amato RJ, Morgan M, Rawat A (2006b) Phase I/II Study of Thalidomide in Combination with Interleukin-2 in Patients with Metastatic Renal Cell Carcinoma. Cancer 106, 1498506. Blancher C, Moore JW, Robertson N, Harris AL (2001) Effects of ras and von Hippel-Lindau (VHL) gene mutations on hypoxia-inducible factor (HIF)-1, HIF-2, and vascular endothelial growth factor expression and their regulation by the phosphatidylinositol 3â&#x20AC;&#x2122;-kinase/Akt signaling pathway. Cancer Res 61, 7349-7355. Bleumer I, Oosterwijk E, De Mulder P, Mulders PF (2003) Immunotherapy for renal cell carcinoma. Eur Urol 44, 6575. Bukowski RM (2001) Cytokine therapy for metastatic renal cell carcinoma. Semin Urol Oncol 19, 148-154. Bukowski RM (1997) Natural history and therapy of metastatic renal cell carcinoma: the role of interleukin-2. Cancer 80, 1198-1220. Chow WH, Devesa SS, Warren JL, Fraumeni JF Jr. (1999) Rising incidence of renal cell cancer in the United States. JAMA 28, 1628-1631. D'Amato RJ, Loughnan MS, Flynn E, Folkman J (1994) Thalidomide is an inhibitor of angiogenesis. Proc Natl Acad Sci USA 91, 4082-4085. Davies FE, Raje N, Hideshima T, Lentzsch S, Young G, Tai YT, Lin B, Podar K, Gupta D, Chauhan D, Treon SP, Richardson PG, Schlossman RL, Morgan GJ, Muller GW, Stirling DI, Anderson KC (2001) Thalidomide and immunomodulatory derivatives augment natural killer cell cytotoxicity in multiple myeloma. Blood 98, 210-216. Dutcher J (2002) Current status of interleukin-2 therapy for metastatic renal cell carcinoma and metastatic melanoma. Oncology (Huntingt) 16, 4-10 (suppl 13). Escudier B, Szczylik C, Eisen T, Stadler W, Schwartz B, Shan M, Bukowski RM (2004) Randomized phase III trial of the Raf kinase and VEGFR inhibitor sorafenib (BAY 43-9006) in patients with advanced renal cell carcinoma (RCC). J Clin Oncol (Meeting Abstracts) Vol. 22, A1628. Fisher RI, Rosenberg SA, Fyfe G (2000) Long-term survival update for high-dose recombinant interleukin-2 in patients with renal cell carcinoma. Cancer J Sci Am 6, S55-S57 (suppl 1). Fishman M, Seigne J (2002) Immunotherapy of metastatic renal cell cancer. Cancer Control 9, 293-304. Fyfe G, Fisher RI, Rosenberg SA, Sznol M, Parkinson DR, Louie AC (1995) Results of treatment of 255 patients with metastatic renal cell carcinoma who received high-dose
69
Amato et al: Long term follow-up of Thalidomide plus IL-2 in metastatic renal cell cancer patients Motzer RJ, Mazumdar M, Bacik J, Russo P, Berg WJ, Metz EM (2000) Effect of cytokine therapy on survival for patients with advanced renal cell carcinoma. J Clin Oncol 18, 19281935. Motzer RJ, Michaelson MD, Redman BG, Hudes GR, Wilding G, Figlin RA, Ginsberg MS, Kim ST, Baum CM, DePrimo SE, Li JZ, Bello CL, Theuer CP, George DJ, Rini BI (2006) Activity of SU 11248, a multitargeted inhibitor of vascular endothelial growth factor receptor and platelet-derived growth factor receptor, in patients with metastatic renal cell carcinoma. J Clin Oncol 24, 16-24. Motzer RJ, Rini BI, Michaelson MD, Redman BG, Hudes GR, Wilding G, Bukowski RM, George DJ, Kim ST, Baum CM, the SU11248 Study Group (2005) Phase II trials of SU11248 show anti-tumor activity in second-line therapy for patients with metastatic renal cell carcinoma (RCC). J Clin Oncol (Meeting Abstracts) Vol 23, A4508. Motzer RJ, Rini BI, Michaelson MD, Redman BG, Hudes GR, Wilding G, Figlin RA, Zhu J, Kim ST, Baum CM (2004) SU011248, a novel tyrosine kinase inhibitor, shows antitumor activity in second-line therapy for patients with metastatic renal cell carcinoma: Results of a phase 2 trial. J Clin Oncol (Meeting Abstracts) Vol 22, A4500. Motzer RJ, Russo P (2000) Systemic therapy for renal cell carcinoma. J Urol 163, 408-417. Negrier S, Maral J, Drevon M, Vinke J, Escudier B, Philip T (2000) Long-term follow-up of patients with metastatic renal cell carcinoma treated with intravenous recombinant interleukin-2 in Europe. Cancer J Sci Am 6, S93-S98 (suppl 1). NexavarÂŽ Approved by the FDA for Renal Cell Carcinoma (2005) FDA News. http://professional. cancerconsultants.com/fda. Presti JC Jr, Rao PH, Chen Q, Reuter VE, Li FP, Fair WR, Jhanwar SC. (1991) Histopathological, cytogenetic, and molecular characterization of renal cortical tumors. Cancer Res 51, 1544-1552. Rasmuson T, Grankvist K, Jacobsen J, Ljungberg B (2001) Impact of serum basic fibroblast growth factor on prognosis in human renal cell carcinoma. Eur J Cancer 37, 21992203. Ratain MJ, Eisen T, Stadler WM, Flaherty KT, Gore M, Desai A, Patnaik A, Xiong HQ, Schwartz B, Oâ&#x20AC;&#x2122;Dwyer P (2005) Final findings from a phase II, placebo controlled, randomized discontinuation trial (RDT) of sorafenib (BAY 43-9006) in patients with advanced renal cell carcinoma (RCC). J Clin Oncol (Meeting Abstracts) Vol 23, A 4544. Sampaio EP, Sarno EN, Galilly R, Cohn ZA, Kaplan G (1991) Thalidomide selectively inhibits tumor necrosis factor production by stimulated human monocytes. J Exp Med 173, 699-703.
Shannon EJ, Sandoval F (1995) Thalidomide increases the synthesis of IL-2 in cultures of human mononuclear cells stimulated with Concanavalin-A, staphylococcal enterotoxin A, and purified protein derivative. Immunopharmacology 31, 109-116. Stadler WM, McKay S, Ryback E, Vogelzang NG (1995) Subcutaneous granulocyte macrophage colony stimulating factor (GM-CSF) with or without oral pentoxifylline in the treatment of patients with metastatic renal cell carcinoma. Proc ASCO 14, A6430. Steger GG, Kaboo R, deKernion JB, Figlin R, Belldegrun A (1995) The effects of granulocyte-machrophage colonystimulating factor in tumor-infilitrating lymphocytes from renal cell carcinoma. Brit J of Cancer 72, 101-107. Thomas DA, Kantarjian HM (2000) Current role of thalidomide in cancer treatment. Curr Opin Oncol 12, 564-573. Updated Overall Survival Analysis Presented on Nexavar Phase III Trial (2006) ASCO Annual Meeting Proceedings, Abstract 4524. Wirth MP (1993) Immunotherapy for metastatic renal cell carcinoma. Urol Clin North Am 20, 283-295. Wos E, Olencki T, Tuason L, Budd GT Peereboom D, Sandstrom K, McLain D, Finke J, Bukowski RM (1996) Phase II trial of subcutaneously administered granulocyte-macrophage colony stimulating factor in patients with metastatic renal cell carcinoma. Cancer 77, 1149-1153. Zambrano NR, Lubensky IA, Merino MJ, Linehan WM, Walther MM (1999) Histopathology and molecular genetics of renal tumors: toward unification of a classification system. J Urol 162, 1246-1258. Zisman A, Pantuck AJ, Belldegrun AS (2001) Molecular-based therapies for renal cell carcinoma. Curr Urol Rep 2, 55-61.
Robert J. Amato
70
Cancer Therapy Vol 6, page 71 Cancer Therapy Vol 6, 71-76, 2008
Mucormycosis in children with acute lymphoblastic leukemia: report of 5 cases Case Report
Taha Khattab1,*, Ayad Atra1, Sami Felimban, Hneef Kamal2, Abimbola Osoba3 1
Section of Pediatric Oncology/Hematology Pediatric Infectious Disease 3 Microbiology, Princess Nourah Oncology Center, King Abdulaziz Medical City - Jeddah, Kingdom of Saudi Arabia 2
__________________________________________________________________________________ *Correspondence: Dr. Taha Khattab, Pediatric Oncology/Hematology, Princess Noorah Oncology Center, King Abdulaziz Medical City, PO Box 9515, Jeddah 21423, Kingdom of Saudi Arabia; Tel: 00966-2-6240000 Ext 23276; Fax: 00966-2-6247242; e-mail: khattabt@hotmail.com Key words: mucormycosis, acute lymphoblastic leukemia Abbreviations: acute lymphoblastic leukaemia, (ALL); pediatric intensive care unit, (PICU) Received: 30 May 2008; Revised: 21 November 2008 Accepted: 24 November 2008; electronically published: February 2009
Summary Mucormycoses are serious fungal infections of immunocompromised patients which may take several clinical forms according to the site affected. The diagnosis depends on demonstration of characteristic hyphae in tissue and specimens obtained from the lesion. Early treatment with amphotericinâ&#x20AC;&#x201C;B or its liposomal forms and repeated surgical resection are the mainstay of treatment. We report 5 children with acute lymphoblastic leukemia (ALL) who developed mucormycosis while on chemotherapy, 4 during induction and one during delayed intensification. The sites of infection were skin and cutaneous tissue (n=3), pulmonary (n=1) and one rhinocerebral. One patient with cutaneous mucormycosis died before the start of specific antifungal therapy (index case) and the other two were alive following treatment with amphotericin-B and repeated surgical debridements, one of them died during reinduction for late bone marrow relapse. The patient with rhinocerebral mucormycosis died of disseminated disease. One patient with pulmonary disease recovered after treatment with amphotericin-B and surgical resection of the affected segment. He subsequently died of toxicity post-allogeneic bone marrow transplantation following relapse of his underlying leukemia. Despite recent advances in antifungal therapy and surgical techniques, mucormysosis remains a serious infection with a high morbidity and mortality. Early diagnosis and radical surgical resection with high dose of liposomal ampho-B are the mainstay of treatment.
distinct which allows for a presumptive identification from clinical specimens. The hyphae are broad (5-15 mm diameter), irregularly branched, and have rare septations. This is in contrast to the hyphae of aspergillous, which are narrow (2-5 mm diameter), and have regular branching and many septations (Gary, 2003). According to the site of infection, mucormycoses may present as pulmonary, cutaneous, gastrointestinal or rhinocerebral disease (Pagano et al, 1997). The latter is associated with extremely poor outcome. The incidence of mucormycosis is increasing in patients with hematological malignancy due to increasing intensity of various chemotherapy regimens and increasing number of hemopoeitic stem cell transplantation done worldwide (Kontoyiannis et al, 2000). The diagnosis depends on demonstration of characteristic hyphae in debridement
I. Introduction Mucormycoses are a rare group of fungal infection that can cause serious human disease. Infections are most common in immunocompromised patients particularly patients with hematological malignancies, Diabetes mellitus and those on corticisteroids (Kontoyiannis et al, 2000). Mucormycosis is characterized by infarction and necrosis of host tissues that result from invasion of the vasculature by hyphae. The pace of mucormycosis is usually very fast, but there are rare descriptions of infections with an indolent course (Pagano et al, 1997). The genera most commonly found in human infection in approximate order of frequency are: Rhizopus, Absidia, Cunninghamella, Rhizomucor, Syncephalastrum, Saksenaea, Apophysomycus and Mucor. The hyphae are
71
Khattab et al: Mucormycosis in children with acute lymphoblastic leukemia admitted to PICU and died from disseminated rhinocerebral mucormycosis within 7 days (Abbas et al, 2002).
tissue and specimens obtained from bronchoalveolar lavage or biopsy of the lesion. Early treatment with amphotericin-B or its lipid forms and repeated surgical debridements are the mainstay of treatment (Pagano et al, 1997). We reported 5 children with ALL who developed mucormycosis during their treatment. All these patients did not received antifungal prophylaxsis therapy during their leukemia management.
D. Case 4 A 12 years old girl diagnosed as ALL with initial WBC 38.5 x 109/l She was started on induction chemotherapy based on high risk-CCG protocol (Nachman et al, 1998). By end of 2nd week she developed bullous lesions on the dorsum of both hands (Figure 2). Surgical debridement was done and Amphotericin-B was started. The diagnosis of mucormycosis was confirmed by culture and histopathological examination of excised tissue. Two further debridements followed by skin graft were successfully done. The patient made good recovery on ambisome received for 3 month. She was well and in full remission having finished 2 years chemotherapy she developed late bone marrow relapse, died secondary to toxicity during reinduction therapy.
II. Case Reports A. Case 1 This was the case index, a 5 years old boy found to have blasts on routine preoperative full blood count. The diagnosis of ALL was confirmed by bone marrow aspiration. During second week of induction chemotherapy using UKALL X protocol, regimen D (Chessels et al, 1995), a round purple-red lesion at dorsum of left hand was noticed. The lesion was increasing in size and involving surrounding skin and subcutaneous tissue. Surgical management was initially debridement followed by extremity amputation because of rapid progressive tissue necrosis and erosion by fungal lesions in an attempt to stop further progression. The lesion was relentlessly progressive and a new lesion developed on the other hand. The diagnosis of mucormycosis was confirmed by histopathological examination and growth of mucormycosis in culture. The patient died from disseminated mucormycosis before the start of specific therapy.
E. Case 5 A 5 years old girl diagnosed as standard risk ALL with a presenting WBC count of 10,000. During the second week of induction using COG protocol (Nachman et al, 1998) while she was severely neutropenic 0.2 x109/l developed two red lesions over medial aspect of left forearm (Figure 3). Three antibiotics (ceftazidime, amikacin and vancomycin ) were started, but with no improvement. Surgical debridement by the plastic surgical team was done and microbiology and histopathology confirmed mucormycosis. Lipid complex ampho-B (Abelcet) was started and continued for 6 month. Repeated surgical debridements including most of the extensor muscles were done. Two months later a skin graft was successfully implanted. Currently the patient is well and off chemotherapy more than 2 year.
B. Case 2 A 4 years old boy diagnosed to have pre-B ALL. He developed fever and respiratory distress during UKALL XI (Hann et al, 2001) induction and required admission to pediatric intensive care unit (PICU). Chest x-ray revealed a left lower zone consolidation and the patient was commenced on broad spectrum antibiotics and amphotericin-B. CT scan of the chest showed an opacity in left lower lobe with fluid level and pneumopericardium. The patient did not show any improvement, so surgical intervension were decided and resection of the affected segement was done and the diagnosis of mucormycosis was confirmed by culture and histopathological examination. Amphotericin-B was continued for 2 months and the patient recovered from infection, but died 4 years later from toxicity of BMT following relapse of his underlying leukemia.
C. Case 3 A 13 years old girl diagnosed as T- ALL with initial WBC count of 247x109/l. She achieved remission after induction using ALL-MRC 97 protocol (Hann et al, 2001). She developed acute viral hepatitis B and was treated with Lamivudine. Few days after starting the third intensification block, she developed steroid induced diabetes mellitus, which was controlled with insulin. A week later she presented with a one day history of headache, fever, right orbital pain and impaired vision in the right eye. A day later, she developed proptosis with a round necrotic lesion over right nasal bridge (Figure 1). She was started on IV Ceftazidime, Amikacin and Vancomycin. A CT scan and MRI of brain showed right paraorbital cellulitis, and bilateral ethmoidal and maxillary sinusitis with intracerebral fungal mass. Amphotericin-B was commenced. Biopsy of the lesion by ENT surgeon confirmed mucormycosis. At that stage with extensive intracerebral mass lesion with vision loss surgical intervension offered to family and would be a devastating type of surgery and parent elected conservative management. Amphotericin-B was replaced by liposomal Amphotericin (Ambisome), but the patient became unconscious, Figure1. Rhinocerebral mucormycosis
72
Cancer Therapy Vol 6, page 73
Figure 2. Bilateral mucormycosis.
cutaneous
Figure 3. Early cutaneous mucormycosis at venepuncture site.
patients with acute leukemia in an Italian multicenter review (Pagano et al, 1997). Zaoutis and colleagues in 2007 made a systematic review and analysis of reported cases in children, where157 cases of zygomycosis registered, 25 (16%) cases with malignancy, 28 (18%) were neutropenic and 22 patient had no underlying condition. Rhizopus spp. Was most commonly identified, followed by mucor spp. The most common patterns of infection were cutaneous 27%, gastrointestinal 21%, rhinocerebral 18% and pulmonary 16% (Zaoutis et al, 2007). In this report Table 1 summarizes age of presentation, site of involvement, underlying factors, treatment and outcome. Case No. 2 and 4 survived the mucormycosis infection but died later from relapsed leukemia. The sites of infection were cutaneous in 3 patients, rhino-cerebral (previously reported) (Abbas et al, 2002) and pulmonary in each of the remaining two patients. Diagnosis was confirmed in all patients by identifying the characteristic hyphae in histopathology specimens and supported by culture in all patients (Parfrey, 1986).
III. Discussion Mucormycoses are a group of zygomycoses that can cause serious human infections. These fungi are common environmental contaminants which can produce large number of spores and cause infection by inhalation, ingestion or innoculation. The disease may present clinically as pulmonary, cutaneous, gastrointestinal or rhinocerebral mucormycosis (Kontoyiannis et al, 2000). Among 355 children diagnosed to have acute lymphoblastic leukemia (ALL) between March 1993 and June 2004, at King Abdulaziz Medical City, Jeddah, western region of Saudi Arabia (KAMC) 37/355 (10%) developed documented invasive fungal infections. Five/355 (1.4 %), 2 boys, aged 4-13 years (median 7.8) were confirmed to have mucormycosis while on chemotherapy. The frequency in U.S. of a recent review of mucormycosis cases at one cancer center showed that it was present in 0.7% of patient at autopsy and in 20 patients per 100,000 admission (Kontoyiannis et al, 2000). The incidence of the disease appear to be increasing. Internationally, mucormycosis was found in 1% of 73
Khattab et al: Mucormycosis in children with acute lymphoblastic leukemia Table 1. Patient charachteristics, site and phase of involvement, therapy and outcome Case No. 1.
Age/Yr & Sex 5 Male
Site of involvement Extremities/ cutaneous
Stage of therapy Day 10 of induction
2.
4 Male
Pulmonary
3.
13 Female Figure 1
4.
12 Female Figure 2 5 Female Figure 3
5.
Season
Therapy
Outcome
Octuber
-
Dead
Day 25 induction
Underlying risk factors Accidental diagnosis of ALL Steroid & Neutropenia
May
Rhinocerebral
Post 3rd block of intensive chemotherapy
Steroid; Diabetis; Neutropenia
February
Survived; relapsed, died post BMT Died, disseminated infection
Cutaneous
Day 24 induction
Steroid; Neutropenia
May
AmphoB 1.5mg/kg + Itraconazole Ampho-B 1.5 mg/kg & Ambisome 5mg/kg Ampho-B & Ambisome 5mg/kg
Cutaneous
Day 9 induction
Steroid Neutropenia
May
Lipid complex Ampho-B 5mg/kg
Survived+skin graft
Cutaneous mucormycosis may result from infection of the dermis by fungi following trauma or venipuncture (Chakrabarti et al, 1997). The initial lesion usually starts as a small reddish brown area with or without blisters, which rapidly increases in size and becomes deeper causing necrosis and sloughing of soft tissues. Rhinocerebral mucormycosis usually follows inhalation of fungal spores causing infection of paranasal sinuses. Clinically it manifests as local pain, periorbital oedema and redness. Infection often spreads rapidly and relentlessly into orbit and brain causing destruction and tissue necrosis (Radner et al, 1995). The diagnosis of pulmonary mucormycosis is difficult as the clinical and radiological features are nonspecific. CT scan may show area of consolidation or infarction with air crescent sign (Tedder et al, 1994; Lee et al, 1999). A high index of suspicion is required to make early diagnosis and initiate early treatment. The diagnosis depends on demonstration of characteristic hyphae in debridement tissue and specimens obtained from bronchoalveolar lavage or biopsy of the lesion (Murphy and Miller, 1996; Al-Abbadi et al, 1997). New molecular detection assays have recently been described which may prove useful in early diagnosis (Hall et al, 2004). Early antifungal therapy and repeated surgical debridements are the mainstay of treatment (Pagano et al, 1997). The antifungal therapy of choice is amphotericin-B or its lipid forms (Herbrecht et al, 2001). Posaconazole, a new triazole antifungal agent may be considered in patients not responding to first line therapy or as prophylaxis in high-risk patients (Greenberg et al, 2003; Tobon et al, 200). Two recent studies have shown overall success rates of 60-70% with posaconazole as salvage therapy for mucormycosis. These encouraging data suggest that posaconazole may represent an advance in
Survived+skin graft Relapse/died
antifungal therapy for patients with mucormycosis (Raad II et al, 2006). There are no clear guidelines about the duration of antifungal therapy. In the M.D. Anderson series, absence of pulmonary involvement, surgical debridement, recovery of neutrophils and cumulative dose ampho-B > 2000 mg were associated with a more favorable outcome (Kontoyiannis et al, 2000). We recommend continued antifungal treatment until there is evidence of clinical and radiological recovery and improvement of neutrophil count. We also suggest therapeutic doses of amphotericin or its lipid form during periods of febrile neutropenia while patients are still requiring an intensive chemotherapy.
References Abbas AAH, Fryer CJH, Felimban SK (2002) Fatal rhinocerebral mucormycosis in a leukemic child presenting with sudden loss of vision: a case report. Haema 5, 341-344. Al-Abbadi RA, Russok, Wilkinson EJ (1997) Pulmonary mucormycosis diagnosed by brochoalveolar lavage: A case report and review of the literature. Pediatr pulmonol 23, 222-232. Chakrabarti A, Kumar P, Padhye AA, Chatha L, Singh SK, Das A, Wig JD, Kataria RN (1997) Primary cutaneous zygomycosis due to Saksenaea vasifo and Apophysomyces elegans. Clin Infect Dis 24, 580-585. Chessels JM, Bailey C, Richards S (1995) Intensification of treatment and survival in all children with lymphoblastic leukaemia: results of UK Medical Research Council trial UKALL X. Lancet 345, 143-148. Gary MC (2003) mucormycosis (zygomycosis); UpToDate 12, 1. Greenberg RN, Anstead G, Herbrecht R, Langston A, Marr K, Mullane K, Raad I, Schiller G, Schuster M, Van Burik J, Wingard JR, Hare R, Corcoran G (2003) Posaconazole (POS) experience in the treatment of zygomycosis.In:43rd
74
Cancer Therapy Vol 6, page 75 Interscience Conference on Antimicrobial Agents and Chemotherapy.American Society of Microbiology; 14-17 September; Chicago, IL (Abstr M-1757) p.1476. Hall L, Wohlfiel S, Roberts GD (2004) Experience with the MicroSeq D2 large-subunit ribosomal DNA sequencing kit for identification of filamentous fungi encountered in the clinical laboratory. J Clin Microbiol 42, 622-626. Hann I, Vora A, Richards S, Hill F, Gibson B, Lilleyman J, Kinsey S, Mitchell C, Eden OB (2001) Benefit of intensified treatment for all children with acute lymphoblastic leukaemia: results from MRC UKALL XI and MRC ALL97 randomised trials. Leukemia 14, 356-363. Herbrecht R, Letscher-Bru V, Bowden RA, Kusne S, Anaissie EJ, Graybill JR, Noskin GA, Oppenheim, Andrès E, Pietrelli LA (2001) Treatment of 21 cases of invasive Mucomycosis with Amphotericin B Colloidal Dispersion. Eur J Clin Microbiol Infect Dis 20, 460-466. Kontoyiannis DP, Wessel VC, Bodey GP, Rolsten KVI (2000) Zygomycosis in the 1990s in a tertiary care cancer center. Clin Infect Dis 30, 851-856. Lee FY, Mossad SB, Adel KA (1999) Pulmonary mucormycosis: the last 30 years. Arch Intern Med 159, 1301-1309. Murphy RA, Miller WT (1996) Pulmonary mucormycosis; Semina Roentgenol 31, 83-88. Nachman JB, Sather HN, Sensel MG, Trigg ME, Cherlow JM, Lukens JN, Wolff L, Uckun FM, Gaynon PS (1998) Augmented post-induction therapy for children with highrisk acute lymphoblastic leukemia and a slow response to initial therapy. N Eng J Med 338, 1663-1671.
Pagano L, Ricci P, Tonso A, Nosari A, Cudillo L, Montillo M, Cenacchi A, Pacilli L, Fabbiano F, Del Favero A (1997) Mucormycosis in patients with hematological malignancies: a retrospective clinical study of 37 cases. Br J Haematology 99, 331-336. Parfrey NA (1986) Improved diagnosis and prognosis of mucormycosis: a clinicopathologic study of 33 cases. Medicine (Baltimore) 65, 113-123. Raad II, Graybill JR, Bustamante AB, Cornely OA, GaonaFlores V, Afif C, Graham DR, Greenberg RN, Hadley S, Langston A, Negroni R, Perfect JR, Pitisuttithum P, Restrepo A, Schiller G, Pedicone L, Ullmann AJ (2006) Safety of long-term oral posaconazole use in the treatment of refractory invasive fungal infections. Clin Infect Dis. 42, 1726-1734 Radner AB, Witt MD, Edwards JE Jr (1995) Acute invasive rhinocerebral zygomycosis in an otherwise healthy patient: case report and review. Clin Infect Dis 20, 163-169. Tedder M, Spratt JA, Anstadt MP, Hegde SS, Tedder SD, Lowe JE (1994) Pulmonary mucormycosis: Results of medical and surgical therapy. Ann thorac Sur 57, 1044-1050. Tobon AM, Arango M, Fernandez D, Restrepo A (2003) Mucormycosis (zygomycosis) in a heart-kidney transplant recipient: recovery after posaconazole therapy. Clin Infect Dis 36, 1488-1491. Zaoutis TE, Roilides E, Chiou CC, Buchanan WL, Knudsen TA, Sarkisova TA, Schaufele RL, Sein M, Sein T, Prasad PA, Chu JH, Walsh TJ (2007) Zygomycosis in children: a systematic review and analysis of reported cases. Pediatric I D J 26, 723-727.
75
Khattab et al: Mucormycosis in children with acute lymphoblastic leukemia
76
Cancer Therapy Vol 7, page 77 Cancer Therapy Vol 7, 77-96, 2009
Cardiac myxoma: molecular markers, critical disease pathways, drug targets, and putative targeting miRs Research Article
Debmalya Barh*, Sanjeeb Parida Centre for Genomics and Applied Gene Technology, Institute of Integrative Omics and Applied Biotechnology (IIOAB), Nonakuri, Purba Medinipur, WB, India
__________________________________________________________________________________ *Correspondence: Debmalya Barh, Ph.D., Centre for Genomics and Applied Gene Technology, IIOAB (www.iioab.webs.com), Nonakuri, Purba Medinipur, West Bengal -721172, India; Tel: +91-944-955-0032; e-mail: dr.barh@gmail.com Key words: Biomarkers, cardiac myxoma, critical disease pathway, drug targets, key nodes, let-7, microRNA Abbreviations: Alpha-Smooth muscle actin, (!-SMA); Calretinin, (CALB2); Canary complex, (CC); Cardiac homeobox gene, (CHG); computed tomographic, (CT); Desmin, (DES); Endothelin, (ET1); Fibromodulin, (FMOD); gradient recalled echo, (GRE); high throughput, (HTP); Lethal-7, (let-7); magnetic resonance imaging, (MRI); microRNA, (miR); Myosin head motor domain, (MYH8); Neuron-specific enolase, (NSE); Neuron-specific enolase, (NSE); Phospholipid transfer protein, (PLTP); sporadic cardiac myxoma, (CM); Thrombomodulin, (THBD); Thymidine phosphorylase, (TYMP); Vimentin, (VIM)
Received: 21 October 2008; Revised: 11 January 2009 Accepted: 27 January 2009; electronically published: February 2009
Summary Left atrial sporadic cardiac myxoma (CM) is the commonest benign tumor of heart. Till now no drug is available and surgery is the only treatment option which frequently evokes post-surgery complaints mainly recurrence and other cardiac problems. Therefore, there is a dare need of alternative treatment options. But due to the rarity of the disease, less characterization, and unknown biology; drug targets are not yet identified. In this study, using approaches from bioinformatics, molecular markers in CM have been identified and subsequent critical disease pathways have been developed. Then analyzing pathway networks, potential drug targets are identified. Finally, various miR analysis databases and tools are used to identify potential miRs those may block the entire critical disease pathway. Analysis shows that seven groups of molecular markers and five critical disease pathways (either solitary or in interplay) are involved in CM development. 37 key nodes and several potential drug targets have been identified and combination of let-7, miR-125, miR-205, miR-214, miR-217, and miR-296 found to target maximum key molecules and predicted to have potentiality to disrupt the entire critical disease pathway network. The precise role of these miRs in CM development and their potentiality in CM therapy need to be thoroughly studied keeping in mind the challenges in RNA based therapeutics. Similarly these identified drug targets are required to be experimentally evaluated with novel targeting agents. In this article we have also provided an overview of cardiac myxoma. But because of the rarity of the disease, a systematic and multi-institutional approach is essential for better understanding of the molecular pathogenesis and subsequent drug development.
Fibrosarcoma (11.3%), Lymphoma (6%), Osteosarcoma (4%), Thymoma (3%), Neurogenic sarcoma (2%), Leiomyosarcoma (< 1%), Liposarcoma (< 1%), and Synovial sarcoma (< 1%) (McAllister et al, 1978; Lam et al, 1993; Vander Salm, 2000; Fernandes et al, 2001; Piazza et al, 2004). Reports suggest that malignant cardiac tumors may cause 20 times higher death rate than that of the primary tumors (Salcedo et al, 1992; Lam et al, 1993; Silvestri et al 1997).
I. Introduction A. Cardiac myxoma epidemiology Primary cardiac tumors are very unusual (Reynan, 1996) that may constitutes less than 0.1% of all cancers (Lam et al, 1993). 75% of cardiac tumors are benign in nature and rest are malignant. 75% malignant cardiac tumors are sarcomas (Vander Salm, 2000; Laissy et al, 2004) and most frequent are Angiosarcoma (33%), Rhabdomyosarcoma (21%), Mesothelioma (16%),
77
Barh and Parida: Cardiac myxoma: molecular markers, critical disease pathways, drug targets, and putative targeting miRs Cardiac myxoma is the most common benign tumor of heart which accounts for 50-85% of all primary cardiac tumors (Holley et al, 1995; Reynen, 1995; Roberts, 1997; Bossert et al, 2005; Roschkov et al, 2007; Figueroa-Torres et al, 2008). 90% of the myxomas are sporadic and only around 7% are heritable (familial myxoma), referred as Carney complex (CC) that is transmitted in an X-linked autosomal dominant manner and characterized by primary pigmented nodular adrenocortical disease along with cutaneous pigmentous lentigines and hypercortisolism (Carney, 1985; Carney et al, 1986; Reynen, 1995; Carney and Ferreiro 1996). 94% of CMs are generally solitary in nature and the incidence is highest in age groups between 30 and 60 years (Carney, 1985). The Caribbean population takes mean age of 51.49 years to develop clinical symptoms (Figueroa-Torres et al, 2008). According to Yu et al, (2007) age group of 70-79 years is exclusively myxoma and age group of 0-9 years does not show CM. But recently one report suggests that right ventricular myxoma can occur at the age of 2 years that can block pulmonary artery (Kumagai et al, 2008). Familial myxomas are more likely occur in young age irrespective of sex and 22% of them originate form atrium or ventricle and are generally multicentric (van Gelder et al, 1992; King et al, 1993; Burke and Virmani, 1993; Kennedy et al, 1995). CM is more common in women than men (Pinede et al, 2001) and 90% of left atrial myxomas in women have been found between the age group of 50 and 70 years (Shapiro, 2001).
originating from mitral leaflets blocking the left ventricular outflow have been reported by Ozcan and colleagues in 2008. Mitral valve obstruction have been noticed in 53% patients and respectively 56% and 50% cases of calcification and cardiomegaly have been found in right atrial myxoma (Grebenc et al, 2002). Right atrial myxomas generally have broad-based attachments and occasionally found calcified than that of the left atrial myxomas (St. John et al, 1980; Kennedy et al, 1995). They rarely arise from inferior vena cava (Juneja et al, 2006) and superior part of the interatrial septum (Duran and Ozkan, 2008). In case of left atrial myxoma, most common clinical symptoms are dyspnea (Becker et al, 2008) and embolic complications. According to some reports specific symptoms are dyspnea (54-71%), cardiac auscultation (71%), increased erythrocyte sedimentation rate (51%), neurological symptoms (50%), embolism (27%), and atrial fibrillation (19%) (Acebo et al, 2003; Sultan et al, 2006). High fever (Uchino et al, 2002), and irregular mysterious fever for years (Falasca et al, 2008) are also have been reported. Embolisms have been observed in 30-50% cases of CM (Orlandi et al, 2005). Rare symptoms like chronic progressive renal failure and neuroinfection (Dewilde et al, 1983; Janion et al, 2008), rheumatic mitral stenosis (Seagle et al, 1984), severe dyspnea on exertion, tricuspid valve injury (Hirota et al, 2004), low cardiac output syndrome (Pelczar et al, 2004), myocardial infarction (Demir et al, 2005), left ventricular dysfunction (Ku"niar et al, 2007), cerebral artery infarction and embolization to eye and kidney (Yeh et al, 2006), cerebral infarction and embolism (Pradhan and Acharya, 2006; Thielke et al 2008), sudden death due to acute pulmonary embolism (Sato et al 2008), ischemic stroke (Yoo and Graybeal, 2008), Sepsis (Janion et al, 2008), and ventricular fibrillation (Attar et al, 2008). Myxomas infected with Streptococcus viridans (Dawson et al, 1988; Karachalios et al, 2004), S. oralis (Uchino et al, 2002; García-Quintana et al, 2005; Janion et al, 2008), and Enterococcus faecalis (Leone et al, 2008) complicates the disease. Caribbean myxoma population have been reported to show congestive heart failure (35%), chest pain (18%), and neurologic symptoms (14%) (Figueroa-Torres et al, 2008). Neurological symptoms are aphasia, hemiparesis, eye sight problem, and progressive dementia. Dyspnoea, renal emboli, pulmonary embolism (Mattle et al, 1995) and neovascularization (Fueredi et al, 1989; Van Cleemput et al, 1993) are also in report. Severe complications includes pulmonary hypertension due blockage of the right atrioventricular ostium or to embolism or Budd-Chiari syndrome with severe abdominal pain (Tok et al, 2007). Malignancy, metastasis, and recurrence have been found in many cases (Gerbode et al, 1967; Hannah et al, 1982; Gray and Williams, 1985; Markel et al, 1986; Shinfeld et al, 1998; Hou et al, 2001; Kurian et al, 2006). Atrial myxoma frequently results in heart failure, stroke, and rheumatologic symptoms (Carney, 1985; McCarthy et al, 1986; Molina et al, 1990; Gawdzínski et al, 1996; Centofanti et al, 1999; Kapusta et al, 2007; Yanagawa et al, 2008, Detko-Barczy#ska et al 2008), dyspnea, chest pain, fever, syncope, tricuspid regurgitation, ventricular
B. Location of cardiac myxoma Various studies have demonstrated that myxomas can occur in any compartment of the heart. Sporadic atrial myxomas can originate from anywhere within the atrium including the appendage but generally arise from the interatrial septum of the fossa ovalis border (Reynen, 1995). According to reports 60-86% CMs are left atrial, 15-28% right atrial, 8% right ventricular, 1.6-8.5% biatrial, and 1.6% multifocal (Reynen, 1995; Reynen, 1996; Pinede et al, 2001; Grebenc et al, 2002; Burke and Virmani, 1993; Butany et al, 2005; Irani et al, 2008; Rathore et al, 2008). Ventricular myxomas are mainly found in women and children. Left ventricular myxomas normally arise from the free wall and left ventricle. Mitral valve myxoma is rare (Rajani et al, 2008). Though biatrial and multicentric myxomas generally originate from atrial septum and frequent in familial cases (Imperio et al, 1980); sporadic case is also in report (Shaikh et al, 2008).
C. Symptoms and associated diseases Symptoms of CM mainly depend on the location, size, and mobility of the neoplasm and 10 to 15% of patients are asymptomatic (Reynen, 1995; Pinede et al, 2001, Butany et al, 2005; Patanè et al, 2008). CMs may be lethal due to their strategic position (Gonzales et al, 1980). Weight loss, loss of appetite, unusual fever, lethargy, fatigue, anorexia, painful erythema, upregulation of gammaglobulin, chronic anemia, anorexia, and facial edema can be considered as constitutional symptoms in cardiac myxoma (Glasser et al, 1971; Reynen, 1995; Tok et al, 2007; Sotokawa et al, 2008). Multiple myxomas 78
Cancer Therapy Vol 7, page 79 failure, systemic embolism, and positional syncope (Chu et al, 2005; Bakkali et al 2008). While large left atrial myxomas correlate with constitutional symptoms, congestive heart failure, syncope, and mitral valve disease; smaller myxomas are generally associated with embolization (Patanè et al, 2008). Several asymptomatic cases are also recently reported those may be associated with neovascularization and ossification (DetkoBarczy#ska et al, 2008; Panagiotou et al, 2008). 20% of familial myxomas are complex myxomas (McCarthy et al, 1986) those generally show adrenocortical nodule hyperplasia, Sertoli cell and pituitary tumors, multiple myxoid breastfibroadenoma, cutaneous myomas, and facial or labial pigmented spots (Carney, 1985; Carney et al, 1986). CMs are reported to associate with Graves' disease (Suzuki et al, 1999), arthrogryposis (Veugelers et al, 2004), myocardial infarction (Namazee et al, 2008; Patanè et al, 2008), neuroblastoma therapy (Hill et al, 2008), Gerstmann's syndrome (Sakellaridis et al, 2008), and hemangioblastoma (Yanagawa et al, 2008).
in various proportions. The stalk can be a solid mass consisting of spindle-shaped tumor cells with hypercellular proliferation activities (Kusumi et al, 2008). Cysts, extramedullary hematopoesis focai, and hemorrhage lesions are reported to scattered throughout the matrix (Prichard, 1951; Kaminsky et al, 1989; Carney et al, 1986). Calcium and metastatic bone deposits and glandular-like structures have been reported in 10% cases (Kaminsky et al, 1989; Carney et al, 1986).
E. Diagnosis Echocardiography is frequently used and most reliable diagnostic method for early detection (Reynen, 1995; Becker et al, 2008; Yoo and Graybeal, 2008) and for familial variant of cardiac artrial myxomas (Sun and Wang, 2008). But differential diagnostic approaches are required for CM diagnosis those must include valvular heart disease, disturbances cardiac rhythm, cardiac insufficiency, cardiomegaly, syncope, systemic or pulmonary embolism, and bacterial endocarditis. Transesophageal (Reynen, 1995) along with transthoracic echocardiography is most effective and is recommended first to know the size, localization and mobility of the tumor mass (Rahmanian et al, 2007). As the atrial thrombi often mimic the echocardiographic features of atrial myxoma and also echocardiography cannot distinguish myxoma and other cardiac mass (Perez de Isla et al, 2002), additional approaches along with echocardiography such as thoracic computed tomographic (CT) scan (Mattle et al, 1995), coronary angiography for tumors localizes to right coronary atrial branches and neovascularization (Van et al, 1993; Janas et al, 2006; Roth et al, 2006; Rahmanian et al, 2007) is required to be performed. Heterogeneous or hypoattenuated spherical or ovoid lesions with lobular borders and point of attachment can be observed in CT scan and magnetic resonance imaging (MRI). Multiplanar and Cine gradient recalled echo (GRE) MR imaging, can provide precise location, size, and point of attachment of myxoma lesions that can assist in surgery (Grebenc et al, 2002). MRI can be used to precisely characterize myxoma and cardiac thrombi. For myxoma MRI specifically shows the typical histological signs like hypointensity of the mass, high extra cellular water content, heterogeneity, necrotic lesions, calcification, and hemorrhage. Gadolinium-enhanced MRI can be used to find massperfusion (Rahmanian et al, 2007). Recently X-ray (Sato et al, 2008) and ultrasound (West and Kaluza, 2008) have reported for diagnosis.
D. Histology Though the myxoma is histologically benign (Reynen, 1995), myxoma population is found to be heterogeneous in nature. CMs are generally grossly, gelatinous and villous in appearance, rounded or oval shaped with a smooth or lobular surface, 5 -15 cm in diameter, covered with thrombus, and rapidly growing. Most CMs are stalked and sessile forms are uncommon. Papillary myxomas are fragile and gelatinous those occasionally form emboli (Reynen, 1995; Pinede et al, 2001; Yeh et al, 2006, Becker et al, 2008). Left atrial myxomas have reported to show an average 1.8 or 5.7 cm/year growth rate (Malekzadeh and Roberts, 1989; Lane et al, 1994). In general, histology varies depending on site, clinical appearance, age and sex of the patient. Although according to Merkow and colleagues in 1969 mitosis is unlikely in myxoma, nuclear mitosis in myxoma are also in report (Burke and Virmani, 1993; Kusumi et al, 2008). Surface thrombus (41%), fibrosis (41%), mitotic activity (23%), calcification (20%), gamma bodies (17%), ossification (8%), extramedullary hematopoiesis (7%), mucin-forming glands (3%), atypical cells those simulates malignancy (3%), and thymic rests (1%) have been reported in corresponding percent cases. Calcification and fibrosis are more likely found in respectively right atrial and nonembolic myxomas. Embolic tumors are often thrombosed and widely myxoid in nature with an irregular frond-like surface (Burke and Virmani, 1993). Electron microscopy shows various types of mesenchymal multipotential cells in different differentiation stages and electron dense granules and stray collagen fibers localizes in the matrix (Chopra and Sharma, 1983). Myxomas are generally polypoid and show polygonal cells having oval nuclei and eosinophilic cytoplasm, capillary channels, myxomatous tissue, and coagulation necrotic bodies embedded in an acid-mucopolysaccaride myxoid matrix (Reynen, 1995; Rahmanian et al, 2007; Kusumi et al, 2008). The matrix also found to contain smooth muscle cells, reticulocytes, collagen, elastin fibers, and blood cells
F. Treatments and complications Till now surgery is the only available treatment option and alone chemotherapy is not satisfactory. Surgical excision of the myxoma is not only costly and risky it also shows several post-surgery complaints. Although in certain cases surgery prevents recurrence (Durgut et al, 2002), lowers mortality rate, and gives good long-term outcome (D'Alfonso et al, 2008), post surgery problems like transient ischemic attacks and a stroke with persistent neurological deficit, complete atrioventricular block, and myocardial infarction (Scrofani et al, 2002), respiratory failure (Bakaeen et al, 2003), stroke (Lad et al, 79
Barh and Parida: Cardiac myxoma: molecular markers, critical disease pathways, drug targets, and putative targeting miRs 2006), cardiac tamponade (Swartz et al, 2006), and recurrence (Vohra et al, 2002; Hermans et al, 2003; Macarie et al, 2004; Kojima et al, 2005; Ito et al, 2006) have been reported in many cases. Incidence of recurrence has been reported to be 1-3% in sporadic, 12% in familial, and 22% in complex form of myxomas (Etxebeste et al, 1998). Second recurrence is unlikely except few reports (Duveau et al, 1994; Roldan et al, 2000). Recurrence from left atrium and right ventricle to respectively left ventricle and left atrium is recently reported (Rathore et al, 2008). Recurrence occurs due to incomplete removal of the original tumour, familial predisposition, intracardiac embolic fragment implantation, and existence of pretumoural foci in the myocardium (Hermans et al, 2003). Endoscopically assisted surgical excision with supplementary cryoablation can be effective in recurrent cases (Rathore et al, 2008). Biatrial myxoma can be removed by surgery using a cardiopulmonary bypass through a midline sternotomy (Irani et al, 2008). Conventional transeptal, left and right atriotomy, and combined transeptal and atriotomy can be performed for effective and long term survival (Becker et al, 2008).
III. Results A. Molecular markers in cardiac myxoma Literature screening shows that, mutations in PRKAR1A gene are mostly found in familial cardiac myxomas (Carney complex) but not in sporadic cases (Casey et al, 2000; Kirschner et al, 2000; Kirschner et al, 2000; Fogt et al, 2002; Aspres et al, 2003; Kojima et al, 2005; Wilkes et al, 2005; Puntila et al, 2006). Therefore, detection of PRKAR1A mutation can help in disease prognosis (Imai et al, 2005). Microsatellite instability on chromosome 17q (Sourvinos et al, 1999) and missense mutation in the Myosin head motor domain (MYH8) (Veugelers et al, 2004) have been found in few cases of CC. Sporadic cardiac myxoma rarely shows mutation. P53 mutation is not associated with CM and only one case of KRAS mutation (Gly 12 Asp) has been reported by Karga and colleagues in 2000. Cardiac myxomas do not express Myoglobin (Johansson, 1989), P53 and BCL2 (Suvarna SK, and Royds, 1996), Stem cell factor, Granulocyte colony-stimulating factor, Hepatocyte growth factor, and ET3 (Sakamoto et al, 2004), and ERBB3 and WT1 (Orlandi et al, 2006). CMs show expression of wide range of molecular markers of various functionalities. CMs express F8, Desmin (DES), Vimentin (VIM), Cytokeratin (CAM 5.2 and AE1/AE3), and S100 (S100A1) (Johansson, 1989), Lu-5, CAM 5.2, VIM, and Neuron-specific enolase (NSE) (Curschellas et al, 1991), Factor XIIIa (Berrutti et al, 1996), CD34 and CD31 (Farrell et al, 1996), PCNA, MIB1, NM23, and RB1 (Suvarna et al, 1996), CEA, and CA19.9 (Lindner et al, 1999), Protein 9.5, S100, and NSE (Pucci et al, 2000), RAS and P21 (Karga et al, 2000), Calretinin (CALB2) (Terracciano et al, 2000), Thrombomodulin (THBD) and CALB2 (Acebo et al, 2001), VIM, S100, and NSE (Oyama et al, 2001), NKX2.5/CSX, GATA4, Cardiac homeobox gene (CHG), and eHAND (Kodama et al, 2002), Chemotactic protein-1 (CCL2), Thymidine phosphorylase (TYMP), and CC chemokine receptor-2 (CCR2) (Zhang et al, 2003), ANXA3, Phospholipid transfer protein (PLTP), Tissue inhibitor of metalloproteinase 1 (TIMP1), Secretory leucocyte protease inhibitor (SLPI), SPP1, Fibromodulin (FMOD), SOX9, and CALB2 (Skamrov et al, 2004), MUC2 and MUC5AC (Chu et al, 2005), and AlphaSmooth muscle actin (!-SMA), CD34, SOX9, NOTCH1, NFATc1, SMAD6, MMP1 and MMP2 (Orlandi et al, 2006). While downregulation is observed for vascular myosin heavy chain isoform (SM2) (Suzuki et al, 2000), in several cases upregulation has been observed for nonmuscle-type vascular myosin heavy chain isoform (SMemb) (Suzuki et al, 2000), CXC chemokines, IL8, Growth-related oncogene-!, Endothelin (ET1) and its precursor Big ET1 (Sakamoto et al, 2004), MIA and PLA2G2A (10 fold higher) (Skamrov et al, 2004), MT1MMP, Pro-MMP2, TIMP2, and Pro-MMP-9 in embolic myxomas (Augusto et al, 2005), MUC1 (Chu et al, 2005), and C-reactive protein and Gammaglobulin (Endo et al, 2006). Highly proliferative, angiogenic, and malignant myxomas exhibit over-expression of IL6 (Hirano et al,
G. Objective To avoid costly and risky surgery, post-surgery complications, and moreover, to develop alternative treatment; the biology and drug targets of cardiac myxoma should be thoroughly studied. In this research, based on available data; molecular biomarkers, critical disease pathways, and drug targets of CM have been identified. Next, an effort has been made to target those critical components of the constructed pathway with minimum numbers of naturally occurring miRs to block the entire network, which might be a potential therapeutic strategy in CM.
II. Materials and Methods A broad bioinformatics approach was taken into consideration. Pubmed, Elsevier, and Medline literature databases were screened for articles describing sporadic cardiac mixoma related genes, proteins, markers etc. Data obtained from searches were classified into four groups viz. expressed, down-regulated, up-regulated, and highly up-regulated in malignant cases. Frequently expressed and up-regulated genes are considered for critical disease pathway construction. Initially, Osprey 1.0.1 powered with human GRID database (http://biodata.mshri.on.ca/osprey/servlet/Index) is used to find out protein-protein interaction and then a general myxoma disease pathway is constructed by mining various pathways from Invitrogen, KEGG, BioCarta, Ambion, and Cell Signaling pathway databases using identified genes from literature mining (pathway not shown). Signaling network, key nodes, and up and down-stream target analysis are done following methods of Barh and Das in 2008. Considering all results, the final critical disease pathway has been drawn using CellDesigner4.0beta (http://systems-biology.org/software/celldesigner). Identification of minimum number of miRs to block the entire critical disease pathway is based on as described by Barh and colleagues in 2008. 80
Cancer Therapy Vol 7, page 81 1987; Seino et al, 1993; Parissis et al, 1996; Mendoza et al, 2001), VEGF, PCNA, FGF$, FGFR1, VEGF, VEGFR1 (flt-1), and VEGFR2 (Kono et al, 2000; Fujisawa et al, 2002; Sakamoto et al, 2004). Table 1 represents a list of frequently up-regulated markers in cardiac myxoma.
B. Protein-protein interactions functional groups of molecular markers
NME1, NOTCH1, SOX9, TIMP1, TIMP2, VEGFA), cell adhesion (F8, MIA, THBD), cell cycle (PCNA, RB1), and cell migration and metastasis (VEGFR2, MMP2, MMP9, THBD, VEGFA, VIM). Osprey interaction map also shows that these proteins interact with various proteins those are also involved in processes like heart development and tumorigenesis (Table 2). Specific groups (same for biological function) of proteins are found to interact with other groups of proteins by connecting molecules. For example, groups of heart developmental proteins where key proteins are GATA4, HIND1, and SOX9 link to growth receptor signaling pathway through KPNB1. Similarly NOTCH1 signaling pathway of heart development is connected to growth receptor signaling pathway through MUC1 (Figure 1). Reported individual case specific markers like F8, THBD, FMOD, PLA2G2A, CCL2, and CCR2 are connected to the entire network through MMP2 (Figure 1).
and
The Osprey interaction map (Figure 1) shows that several groups of proteins consisting of complicated mitogenic and cardiac developmental pathways are involved in CM pathogenesis. Key proteins those are expressed in myxoma are found to be involved in Gprotein signaling (CCL2, CCR2, EDN1, IL8), heart development (EDN1, GATA4, HAND1, MIB1, NFATC1, NKX2.5, NOTCH1, SOX9), angiogenesis (FGF2, FGFR1, VEGFR2, NOTCH1,THBD, VEGFA), cell proliferation (FGF2, FGFR1, IL6, IL8, VEGFR1, VEGFR2, MIA,
Table 1. Frequently upregulated proteins in sporadic cardiac myxoma. Molecular markers Protein gene product 9.5 S100A1 Neuron-specific enolase CALB2 THBD Calretinin bFGF FGFR1 SOX9 NOTCH1 NFATc1
% of Cases 94% 88% 56% 100% 82.6% 73.9% 73.3% 67.7% 100% 87.5% 37.5%
References Angela et al, 2000 Angela et al, 2000 Angela et al, 2000 Terracciano et al, 2000 Acebo et al, 2001 Acebo et al, 2001 Fujisawa et al, 2002 Fujisawa et al, 2002 Orlandi et al, 2006 Orlandi et al, 2006 Orlandi et al, 2006
Table 2. Osprey protein-protein interaction. Only key proteins and their interacting partners and functions are listed. NA denotes for data not available. Proteins in bold letters are directly involved in cardiogenesis or cardiac function or cardiac myxoma. Annotations are taken form Human GRID database associated with Osprey tool. Protein ACTA2 (Alpha-cardiac actin) ANXA3 (Annexin III)
CALB2 (Calbindin 2) CCL2 (Monocyte chemoattractant protein-1) CCR2 (MCP-1 receptor) CEACAM5 (Carcinoembryonic antigen-related cell adhesion molecule 5) CRP
Functions ATP binding, muscle development.
Interactions VDBG+CCTs+TMSB4 X+CFL1+DNASE1+M YL1
Diphosphoinositolpolyphosphate diphosphatase and phospholipase A2 inhibitor. NA
REG3A
G-protein signaling, apoptosis.
FY+CSPG2+CCR5+ CCR2
GPCR pathway. NA
CSPG2+CCR5+ CCL2+CCL7+JAK2+I FR2 HNRPM+EWSR1
CCL7: chemokine activity; JAK2: cell cycle regulation, myeloid cell differentiation, mesoderm development, apoptosis, IFR2: NA HNRPM: RNA splicing; EWSR1: regulation of transcription.
C-Reactive Protein
NA
NA
TUBA1+KRT1
81
Comments VDBG: vitamin D binding; CCT: cell cycle regulation; TMSB4X: cellular component organization and biogenesis; CFL1: Rho signaling, anti-apoptosis; DNASE1: apoptosis; MYL1: muscle development REG3A: multicellular organismal development, heterophilic cell adhesion, cell proliferation.
TUBA1: bone development; KRT1: epidermis development. FY: GPCR pathway; CSPG2: cell adhesion, multicellular organismal development; CCR5: GPCR pathway; CCR2: GPCR pathway.
Barh and Parida: Cardiac myxoma: molecular markers, critical disease pathways, drug targets, and putative targeting miRs (C-Reactive Protein) DES (Desmin)
Muscle development and contraction, heart contraction.
DSP+S100B+S100A1+ SYNC1
GPCR Pathway, heart development.
NPPC+EDNRA+ADM
Cell adhesion.
F9+CANX+VWF+F10 +PROC
Ras protein signaling, MAPKK activation, cell proliferation, angiogenesis. Negative regulation of apoptosis; cell proliferation, angiogenesis, MAPKKK cascade. Transforming growth factor.
FGFR1
GATA4 (GATA binding protein 4)
Transcription factor, gastrulation, embryonic heart tube pattern formation.
NR5A1+ZFPM2+MAP K3+MEF2C+NFATC4 (NFAT3)+FOS+TBX5 +NKX2-5+HAND2
HAND1 (Basic helix-loophelix transcription factor HAND1)
Heart development, cell differentiation, mesoderm formation, multicellular organismal development. Cytokine, negative regulation of apoptosis, regulation of cell proliferation. Chemokine , GPCR signaling, regulation of cell proliferation, angiogenesis, regulation of cell adhesion. Angiogenesis, cell proliferation.
HAND2+MYOD1+PR KACA+PRKCA+TCF3 +PPP2R5D
Endothelial cell differentiation, hemopoiesis, angiogenesis, cell migration. Cell proliferation, cell-
VEGFA+FLT1/ VEGFR1+ SHB +SHC1+GRB2
EDN1/ET1 (Endothelin 1) F8 (Coagulation factor VIII) FGF 2 (Fibroblast growth factor 2) FGFR1 (Fibroblast growth factor receptor 1) FMOD (Fibromodulin)
IL6 (Interleukin-6) IL8 (Interleukin-8)
VEGFR1
KDR/VEGFR2 (Kinase insert domain receptor) MIA
DSP: epithelial to mesenchymal transition, epidermis development; S100B: cell proliferation; S100A1: regulation of heart contraction, cell communication; SYNC1: NA NPPC: vasoconstriction; EDNRA: heart development, embryonic development; ADM: heart development, induction of cell proliferation. F9: blood coagulation; CANX: angiogenesis; VWF: platelet activation, cell adhesion; PROC: negative regulation of apoptosis, chymotrypsin activity. FGFR1: cell proliferation, morphogenesis.
FGF5+SHC1+KPNB1+ SHB+FGF
FGF5: FGF signaling, cell cycle regulation, cell proliferation; SHC1: EGFR signaling, MAPK activation, induction of cell proliferation; FGF2: (See previous)
TGFB1+TGFB2+ TGFB3
TGFB1: anti-apoptosis, regulation of cell cycle and proliferation, epithelial to mesenchymal transition, exit from mitosis, NF-kappaB activation; TGFB2: cytokine activity, induction of cardioblast differentiation, cardiomyocyte proliferation and cardioblast differentiation, heart development, heart contraction, mesoderm formation, angiogenesis, TGFB production, anti-apoptosis; TGFB3: activation of MAPK activity, epithelial to mesenchymal transition, cell cycle regulation. MAPK3: cell cycle regulation, organ morphogenesis; MEF2C: heart development, blood vessel development and remodeling; NFATC4: transcription factor, heart development, FOS: transcription factor, cell proliferation; TBX5: transcription factor, pericardium development, cardioblast differentiation, heart development, inhibition of cardiac muscle cell proliferation; NKX2-5: transcription factor, cardiac muscle development and differentiation, adult heart development, heart looping, embryonic heart tube development; HAND2: transcription factor, adult heart development, heart looping, angiogenesis. HAND2: (See previous); MYOD1: myoblast differentiation and fate determination; PRKCA: regulation of heart contraction and cell cycle, induction of apoptosis.
PTHLH+IL6R
PTHLH: G-protein signaling, epithelial cell differentiation, positive regulation of cell proliferation; IL6R: cell proliferation.
FY+GNA12+SDC1+IL 8RA+CCL4+IL8RB
FY: chemokine, GPCR pathway; IL8RA: GPCR pathway; CCL4: chemokine, cell adhesion, cell polarity; IL8RB: chemokine, GPCR pathwa, positive regulation of cell proliferation.
FGF5+SHB+SHC1+FG F+GRB2
FGF5: FGF signaling, cell proliferation; SHB: angiogenesis; SHC1: EGFR signaling, MAPK activation, positive regulation of cell proliferation; GRB2: Ras and EGFR signaling. (See previous and later)
FN1
FN1: cell migration, cell adhesion.
82
Cancer Therapy Vol 7, page 83 (Melanoma inhibitory activity) MIB1 (Mind bomb homolog 1) MMP2 (Matrix metalloproteinase 2)
MMP9 (Matrix metalloproteinase 9)
MUC1 (Mucin 1)
MYH8 (Myosin heavy polypeptide 8) NFATC1 (NFAT transcription complex cytosolic component) NKX2-5 (NK2 transcription factor related, locus 5) NME1 (Non-metastatic cells 1) NOTCH1 (Neurogenic locus notch homolog protein 1)
PCNA (Proliferating cell nuclear antigen) PLA2G2A (Phospholipase A2, group IIA)
matrix adhesion. Heart looping and development, blood vessel development. Collagen catabolism, blood vessel maturation.
DAPK1+DAB2
DAPK1: anti-apoptosis; DAB2: cell proliferation.
CCL7+TGFB1+THBS1 +TIMP2+COL18A1+IT GAV+MMP17+CXCL1 2+MMP14+PSMA7+M MP8
Skeletal development, apoptosis, extracellular matrix organization and biogenesis, collagen catabolism.
THBS1+LCN2+TIMP3 +THBS2+COL1A1+FN 1+MMP7+CD44+REC K+COL4AS
Actin binding, hormone activity.
GSK3B+ERBB2,3,4+P RKCD+APC+SOS1+C TNNB1+CTNND1+EG FR+GALNT1+VEGFC +GRB2
THBS1: negative regulation of angiogenesis, cell adhesion; TIMP2: negative regulation of cell proliferation; COL18A1: organ morphogenesis, negative regulation of cell proliferation, cell adhesion; ITGAV: cell-matrix adhesion, blood vessel development, integrin-mediated signaling pathway; CXCL12: cell adhesion, GPCR pathway; MMP14: endothelial cell proliferation, focal adhesion formation, angiogenesis, tissue remodeling, cell migration. THBS1: (See previous); TIMP3: transmembrane receptor protein tyrosine kinase signaling pathway, induction of apoptosis by extracellular signals; THBS2: cell adhesion; COL1A1: epidermis development; FN1: (See previous); CD44: cell-matrix adhesion; RECK: extracellular matrix organization and biogenesis, negative regulation of cell cycle. GSK3B: NF-kappaB binding, negative regulation of apoptosis, Wnt receptor signaling; ERBB2,3,4: positive regulation of epithelial cell proliferation, angiogenesis, heart development; PRKCD: negative regulation of cell cycle, Wnt receptor signaling, pattern formation; CTNNB1: cell adhesion, ectoderm development, negative regulation of cell differentiation, gastrulation, heart development; CTNND1: cell adhesion; EGFR: positive regulation of cell proliferation and migration; GRB2: epidermal growth factor receptor signaling pathway.
Muscle development.
NA
Heart development, G1/S transition of mitotic cell cycle.
PIM1
PIM1: multicellular organismal development, negative regulation of apoptosis, cell proliferation.
Cardiac muscle development and differentiation, heart looping, embryonic heart tube development. Positive regulation of epithelial cell proliferation, regulation of apoptosis. Heart development, endoderm development, Notch signaling pathway, cell proliferation, angiogenesis, regulation of apoptosis.
HIPK1+HIPK2+SRF+T BX5+GATA4
TBX5: (See previous); GATA4: (See previous); HIPK2: induction of apoptosis, positive regulation of TGF beta receptor signaling pathway; SRF: heart development and heart looping, muscle maintenance.
APEX1+SET+RRAD+ POLR1C+PCNA
RRAD: small GTPase mediated signal transduction; PCNA: (See later)
GSK3B+LEF1+RBPS UH+DLL4+RELA+PS EN1+NFKB1
DNA replication, regulation of progression through cell cycle, cell proliferation. Phospholipids metabolism.
CCND1+HDAC1+DN MT1+CDK2+APEX
GSK3B (see later); LEF1: mesoderm formation, Wnt receptor signaling pathway, somitogenesis; RBPSUH: Notch signaling pathway, epithelial to mesenchymal transition, angiogenesis, heart development, hemopoiesis, cell proliferation; DLL4: angiogenesis, multicellular organismal development, Notch signaling pathway; RELA: anti-apoptosis, chemokine mediated signaling, NF-kappaB activation; PSEN1: antiapoptosis, cell adhesion, heart development, Notch receptor processing; NFKB1: anti-apoptosis. CCND1: re-entry into mitotic cell cycle, positive regulation of cyclin-dependent protein kinase activity; HDAC1: anti-apoptosis; CDK2: G2/M transition of mitotic cell cycle, positive regulation of cell proliferation. CSPG2: cell adhesion, multicellular organismal development; DCN: organ morphogenesis; PLA2G1B: phospholipid metabolism
CSPG2+DCN+PLA2G 1B
83
Barh and Parida: Cardiac myxoma: molecular markers, critical disease pathways, drug targets, and putative targeting miRs RB1 (Retinoblastoma 1)
S100A1 (S100 calciumbinding protein A1)
SMAD6 (SMAD family member 6)
SOX9 (Sex-determining region Y-box 9)
THBD (Thrombomodulin)
TIMP1 (Tissue inhibitor of metalloproteinase 1) TIMP2 (Tissue inhibitor of metalloproteinase 2) VEGFA (Vascular endothelial growth factor A)
VIM (Vimentin)
Erythrocyte differentiation, regulation of cell cycle and proliferation, androgen receptor signaling. Regulation of heart contraction, intracellular signaling, nervous system development.
MYOD1+HDAC+CCN D1+CDK4+E2F+MAP K9+JUN+MYC
(See previous)
S100B+NIF3L1+GFAP +DES+PLN+ATP2A2+ RYR1+GJA1+S100A4
Transcription factor, TGF-beta signaling.
CTBP1+SMAD1+SMU RF1+MAP3K7+MAP3 K7IP1
S100B: induction of apoptosis, cytokine biosynthesis, cell proliferation; DES: regulation of heart contraction, muscle development, PLN: inhibition of heart contraction, cardiac muscle development, calcium ion homeostasis. ATP2A2: cell adhesion, regulation of the force of heart contraction, calcium ion homeostasis; RYR1: Apoptosis, cell motility, cell cycle regulation, muscle contraction, calcium ion transport; GJA1: NFkappaB cascade, apoptosis, blood vessel morphogenesis, embryonic and adult heart tube development, heart looping; S100A4: epithelial to mesenchymal transition. SMAD1: BMP signaling, brain development, embryonic pattern specification; CTBP1: negative regulation of cell proliferation; SMURF1: inhibition of BMP signaling, ectoderm development, cell differentiation, protein ubiquitination; MAP3K7: JNK, TGF-beta, TCR, and NF-kappaB cascades, inhibition of apoptosis, angiogenesis; MAP3K7IP1: TGF-beta signaling, embryonic development, heart morphogenesis.
Transcription factor activity, heart development, epithelial to mesenchymal transition, regulation of cell proliferation and apoptosis. Blood coagulation, embryonic development, inhibition of angiogenesis, cell motility, cell adhesion. Metalloendopeptidase inhibitor, development, positive regulation of cell proliferation. Metalloendopeptidase inhibitor, negative regulation of cell proliferation. Mesoderm development, antiapoptosis, positive regulation of cell proliferation, angiogenesis, cell migration. Intermediate filamentbased process, cell motility, oxygen transport.
NR5A1+MED12+MAF +TRAF2+KPNB1.
NR5A1: transcription coactivator, steroid biosynthesis; cell differentiation; TRAF2: Apoptosis, cytokine production; KPNB1: protein import into nucleus.
PROC+ F2+CPB2+PF4+F8
PROC: (See previous); F2: blood coagulation, cell cycle regulation, apoptosis; PF4: chemokine mediated signaling; angiogenesis inhibition; F8: (See previous).
MMP3+MMP1
MMP3: collagen catabolism.
MMP2+MMP14+PSM A7+MMP8
MMP2: (See previous); MMP14: (See previous); PSMA7: threonine endopeptidase, ubiquitin-dependent protein catabolism; MMP8: collagenase, proteolysis.
FGF5+FLT1+VEGFR2 +NRP1+NRP2
FGF5: (See previous); FLT1: angiogenesis, cell migration, VEGFR signaling, cell differentiation. VEGFR2: (See previous); NRP1: cell adhesion, organ morphogenesis, angiogenesis, cell differentiation and proliferation, heart development, NRP2: (same as NRP1).
CDH5+GFAP+DSP+NI F3L1
CDH5: cell proliferation inhibition, cell adhesion, blood vessel maturation; GFAP: intermediate filamentbased process; DSP: keratinocyte differentiation; NIF3L1: unknown.
84
catabolism;
MMP1:
collagen
Cancer Therapy Vol 7, page 85
Figure 1. Osprey protein-protein interactions. Various groups of proteins showing involvement of multiple pathways in cardiac myxoma.
C. Common genes involved in heart and myxoma development
these genes during embryonic development may contribute to myxoma growth but as the myxoma is mostly found in the age group of 70-79 years and no cases have been diagnosed within the age group 0-9 years (Yu et al, 2007); the heart developmental pathway may not be involved in the development of CM. Therefore, a possible explanation may be an epigenetic regulation of these heart developmental genes at later stage of age that contribute to CM development. But as there is no age and stage specific high through put (HTP) expression data available for cardiac myxoma, the precise molecular mechanism of these genes or the involvement of the heart developmental pathway in CM is unclear from this analysis.
Observing the presence of heart developmental pathway in cardiac myxoma, as evident form the proteinprotein interaction map, an attempt has been taken to find out the entire gene sets involved in various stages of cardiac development. Using review literatures (Srivastava and Olson, 2000; McFadden and Olson, 2002; Zaffran and Frasch 2002; Brand, 2003) and Cardiovascular Database (www.cardio.bjmu.edu.cn) cardiogenesis gene are identified and a mammalian heart development pathway has been constructed (Figure 2) with an aim to identify differentially expressed genes those are involved only in myxoma development. Unable to identify only CM related gene sub-sets form the whole pool of heart developmental genes, focus has been shifted to identify common gene set which is involved in both the processes. Result shows that, NKX2.5/CSX, GATA4, HOX, HAND, MYOD, SOX4-6, S100, and TGF-$ are involved in both heart and cardiac myxoma development. But these genes are found active at vary early stage of cardiac development mainly during transition form mesoderm. Therefore, upregulation of
D. Cardiac myxoma critical disease pathways and drug targets As shown in Figure 3, several pathways are found to interplay either solitary or in combination cross talking with one another in developing CM. Main critical disease pathways include CCR2, FMOD-TGFB, S100A1-FGFR, NKX2.5-GATA4-SOX9-FGFR, HAND1-GATA4, and MUC1 regulated NOTCH signaling and several mitogenic 85
Barh and Parida: Cardiac myxoma: molecular markers, critical disease pathways, drug targets, and putative targeting miRs pathways. At a certain point, all pathways found to follow the growth receptor signaling pathways and MYC, FOS, and MMP9 are identified as common downstream targets. Based on key-nodes analysis, it has been found that, CCR2, TGF-$, MUC1, FGFR, EGFR, GATA4, and
HAND1 are critical for the entire network. All these key nodes and their upstream regulators and downstream targets (Tables 2-3, Figure 3) those are of various molecular and biological functions are also found as potential drug targets.
Figure 2. Sequential events and gene (s) involvement in mammalian heart development.
86
Cancer Therapy Vol 7, page 87
Figure 3. Cardiac myxoma critical disease pathways. The network includes all prevalent CM markers and their normal role in the cascade. But alteration of any one of these genes will lead to CM.
Table 3. Key nodes and their upstream regulators and downstream targets. Key nodes
Up stream regulators
Down stream targets
$-catenin CDK4 E2F4 FOS EGFR ERBB2/ HER2/neu GATA4 JUN K-RAS MMP2 MUC1 MYC MMP9 NF-"B PCNA
AKT, TNF MYC BRCA1 AP1/JUN, EGF, ESR1, IFNG, IL22, SRC, STAT EGF, MUC1 AR, EGF, GABPA, MUC1, MYC, SPI1
VEGF TGF-$
AP1, BRCA1, ERK, SMAD, SP1, TGF FMOD
CCND1, FOS, MYC BRCA1, CCND1 CDK1, CDK2, Cyclin A, PCNA, RB ET1, FLG, FRA1, IL2, IL6, IL8, MMP1, P53 JUN, MAPK9, RARA CCND1, ESR1, KRAS, MMP2, MMP9, MYC, PTEN FGFR, FOS, SOX9 ESR1, MSH2 CCND1, MMP2, MMP9 MMP9, TSP1 $-catenin, EGFR, GRB2, NOTCH CDC25A, CDK4, Eif-4E, ERBB2, TERT NF-"B, TSP1, TSP2, FOS, MYC, PCNA DNA Ligase-1, GTBP, MSH3, POL-D andE, RARA, RFCs VEGF-A, VEGF-165, VEGF-145 MMP2
HAND1, NKX2.5 CNK, EGF, IKK, TGF, SENP1 CTF, HER2, P53, SP1 AP-2!, ESR1, HER2, KRAS, P53 AP1, AP2, EGF, MAK, SP1, STAT, TCF4 HER2, MMP2, SDF1, TGF MMP9, PTEN P53, IKK-!, NF"B, E2F4, P53, ESR1, AP1/JUN
87
Barh and Parida: Cardiac myxoma: molecular markers, critical disease pathways, drug targets, and putative targeting miRs
E. microRNA: prospective therapeutics?
mouse. These facts show that a given miR can target multiple target genes. Therefore, all possible targets, immunogenic responses, and other side effects of a miR selected for therapy is required to be carefully studied. Along with the multi-gene targeting capability of a single miR, there are several other drawbacks in miR therapy as described by Barh in 2008. In brief, the foremost difficulty is the tissue specific targeted delivery. siRNA delivary methods are generally followed in delivaring miRs. Antisense oligonucleotide based siRNA technology using unmodified DNA oligonucleotides are not much effective in miR silencing due to their low-binding affinity (Boutla et al, 2003). But chemically modified single-stranded RNA analogues complementary to specific miRs (ASOs and AMOs) and antagomirs (Valoczi et al, 2004; Jacobsen et al, 2005; Krutzfeldt et al, 2005; Castoldi et al, 2006; Davis et al, 2006; Kloosterman et al, 2006; Naguibneva et al, 2006; Nelson et al, 2006; Orom et al, 2006; Weiler et al, 2006; Busch et al, 2007; Grunweller and Hartmann, 2007) are better option those are widely used in regulating miRNA expression (Esau and Monia, 2007). Wolfrum et al, 2007 have shown that siRNA in conjugation with highdensity lipoprotein increase delivery efficacy into only in kidney, gut, liver, and endocrin organs. Along with the delivery method, synthesis and purification of therapeutic grade miR and antagomir is also difficult. Lentivirus mediated and intranasal administration though have been found to be effective in respectively mouse model of breast and lung cancers (Sempere et al, 2007; Yu et al, 2007; Esquela-Kerscher et al, 2008), these methods are required to be standardized to reduce non-targeted site introduction of miR and neuron specific delivery method is yet to be developed (Krutzfeldt et al, 2007). In general, miRs regulate gene expression by complementarity base pairing at 3! UTRs target mRNAs inhibiting translation or cleaving target mRNAs (Lai, 2002; de Moor et al, 2005; Robins and Press, 2005; Stark et al, 2005; Sun et al, 2005). But truncation mutation of a target gene that removes the miR binding can escape from miR induced repression Therefore, 3! UTR truncated HMGA2 mediated tumorigenesis (Mayr et al, 2007) may not be controlled by miR therapy.
miRs are natural endogenous non-coding pool of small RNA molecules of 20-24 nucleotides in length which are found deregulated in several cancers and restoration of these key deregulated miRs have now showing promising results in cancer therapy. Speculating that, miRs are universally target-specific regardless the type of cancer, using similar bioinformatics approaches as described by Barh and colleagues in 2008, it has been predicted that a combination of let-7, miR-125, miR-205, miR-214, miR-217, and miR-296 can cover maximum key molecules and potentially disrupt the entire critical disease pathway of CM by targeting maximum key nodes and their upstream and downstream molecules (Table 4). But until now no high throughput (HTP) gene expression data or microRNA profile available for CM. Therefore, the precise roles of these identified putative therapeutic miRs in CM pathogenesis are yet to be experimentally identified. Similarly, there are several challenges in RNA based therapeutics especially when microRNAs are used. Strategies like restoration of normal expression of a particular miR or inhibition of translation of a given mRNA by miR both have similar hurdles. For example, let-7 is deregulated in lung and hepatic cancers and ectopic expression or restoration of normal expression level of let7 in these tumors have been found to represses cancer growth by inhibiting RAS, MYC, and by directly or indirectly targeting several genes of multiple cell proliferation pathways (Yanaihara et al, 2006; Inamura et al, 2007; Johnson et al, 2007; Esquela-Kerscher et al, 2008, Kumar et al, 2008; Yu et al, 2008) Similarly, induced overexpression of let-7 inhibits proliferation and growth of Burkitt lymphoma by targeting MYC and its target genes (Sampson et al, 2007), uterine leiomyoma by repressing HMGA2 (Peng et al, 2008), breast cancer by targeting HRAS and HMGA2 (Sempere et al, 2007; Yu et al, 2007), melanoma by downregulating cyclins CDK4, cyclins-A, -D1, and -D3 (Schultz et al, 2008). According to Grimm et al, (2006), ectopic AAV mediated recombinant pre-miRNAs saturated and overwhelmed XPO5 leading to the inhibition of normal cellular premiRNAs processing resulting liver cytoxicity and death in
Table 4. Cardiac myxoma critical disease pathway targeting miRs. miRs are selected on the basis of experimental data and miR analysis databases (mirBase, miRanda, PicTar, TarBase, and TargetScan,) miRs let-7
miR-125
miR-205 miR-214 miR-217 miR-296
Targets CCND1-2, CDC25A, CDK4, CDK6, DNA-Polymerases, E2F5-6, FGFR, GRB2, HAND1, HMG2, IGF1, IGFR1, IL6, IL8, MAPK4-6, MMP2, MMP8, MYC, NKX2-5, PCNA, RAS, RB1, TGFB, TGFBR $-catenin, CDC25A, CDK11, DES, E2F3, EDN1/ET-1, ERBB2-4, ESRRA, FGF, FGFR, FMOD, FOS, IGF, IL6R, MAPKs, MIA, MMP11, NFIB, NKX2-5, PCNA, S100A1, SP1, TGFBR1, TNF, VEGF BCL2, CDK4, CDK11, E2F1, E2F5, E2F6, EIF4A3, EIF4E1B, ERBB3, ERBB4, FGF1, FGF4, HRAS, IL5, KRAS, MAPK9, MMP2, NFIB, NOTCH1, S100A1, SP4, VEGFA $-catenin, CCR2, EGFR, HAND1, MUC1, NFKB1, SOX9 IL6, PCNA, S100A1 CCND1, CCND3, ERBB2, ESR1, FMOD, HAND1, JUN, MMP2, MUC1, NKX2-5, SOX9, TGFB1
88
Cancer Therapy Vol 7, page 89 HAND, MYOD, SOX4-6, S100, and TGFB. But in case of heart development they mainly act during mesodermal transition at early embryonic stage. As the age group of 09 does not show myxoma (Yu et al, 2007), therefore, heart developmental pathway may not be involved rather an epigenetic regulation of these genes may play a role in CM development and further study is required to come to a clear conclusion. Till now the only effective treatment option is surgical excision of the myxoma though it is costly, risky, and with various post-surgery complaints including recurrences. Again alone chemotherapy is not satisfactory. In search of alternative treatment options, in this study it has been predicted that therapy with a combination of let7, miR-125, miR-205, miR-214, miR-217, and miR-296 microRNAs those have the potentiality to block the entire critical disease pathway network may be an effective measure in treatment of CM. Very few reports are available regarding the role of miRNAs in cardiac development and cardiovascular disorders. According to van Rooij and colleagues in 2006 miR-23, miR-24, and miR-195 overexpression induces hypertrophic cardiomyocyte growth and upregulation of miR-150 and miR-181b reduces cardiomyocyte cell size. miR-1 is reported to inhibit ventricular cardiomyocyte proliferation and cardiomyocyte differentiation (Zhao et al, 2005) and its induced upregulation prevents hypertrophic growth (Sayed et al, 2007). Table 5 represents a list of heart specific miRs and their cardiac functions and pathophysiology. Among the identified miRs, previous reports shows that let-7 is expressed in cardiac and artery smooth muscles (Lagos-Quintana et al, 2002; Ji et al, 2007) and modulates vascular endothelial cell migration (Kuehbacher et al, 2007; Suarez et al, 2007), miR-125 is expressed in artery smooth muscles (Ji et al, 2007), and over-expression of miR-214 induces hypertrophic cardiomyocyte growth (van Rooij et al, 2006). Except this information, there is no other data available right now regarding the deregulation or specific function of identified miRs in this study in respect to cardiogenesis, cardio vascular disorder, and cardiac myxoma. Therefore, CM specific microRNA expression data is crucial to identify miRs involved in CM pathogenesis and to evaluate the treatment efficacy of these predictive miRs (identified in this research) keeping in mind those difficulties in miR based cancer therapy as discussed earlier. In particular, expression levels in normal and CM condition; there actual roles in cardiogenesis and CM, the delivery methods in situ, and immunogenic and cytotoxic side effects of these miRs should be answered in depth. Similarly, novel targeting agents specific for these identified targets need to be identified and for both these miR and drug based approaches to modulate this complex network of CM pathogenesis require long term experimental studies to identity both the treatment efficacy and possible side effects. Moreover, a systematic, multiinstitutional, and worldwide study is essential to make a worldwide database of all prevalent cases and to share these data for in depth study for etiological factors and molecular markers those may help in better understanding
IV. Discussion In this research, using various strategies form bioinformatics and publicly available data, molecular biomarkers in CM have been identified and then a critical disease pathway has been developed using those markers. Later the network is analyzed to identify drug targets. It has been found that cardiac myxomas frequently overexpress VEGF, PCNA, bFGF, FGFR1, IL6, chemokines, MMPs, CALB2, THBD, MUC1, SOX9, NOTCH1, S100A1, neuron-specific enolase, MIA, and PLA2G2A. Only SM2 is found down-regulated and in very few cases mutations are noticed in P53 and KRAS. Analysis shows that, molecular markers are of diverse functionalities and are involved in heart development, NOTCH signaling, and various growth receptor signaling pathways. Considering all identified markers, when a general critical disease pathway is developed, it has been found that, growth receptor signaling pathways consisting of MYC, FOS, and MMP9 are seems to be the common downstream components of the entire network and CCR2, TGF-$, MUC1, FGFR, EGFR, GATA4, and HAND1 are supposed to be critical key nodes in this network. Subsequent network analysis reveals that one or more transcription factors, cell cycle regulators, components of replication machinery, tumor suppressor genes, and growth factors are downstream targets of several key nodes (Table 3, Figure 3). For example, PTEN, KRAS, CCND1, ESR1, MMP2, MMP9, and MYC are downstream targets of HER2 and HER2 is regulated by GABPA, MYC, SPI1, AR, EGF, and MUC1. Downstream targets of MYC are found to be FOS, CDC25A, CDK4, eIF4E, and ERBB2. Similarly, PCNA regulates its downstream targets mainly key components of replication machinery such as POLD and E, DNA ligases, and replication factors etc. and itself is regulated by NF"B, E2F4, P53, ESR1, AP1/JUN. Therefore, key nodes, their regulators, and down-stream targets can be considered as drug targets to block that specific pathway unique for certain CM. There is no clear conclusion about the origin of CM. Though, Johansson in 1989 and Curschellas and colleagues in 1991 suggested an origin of embryonic cell remnants for expression of F8, DES, VIM, Cytokeratins, S100, LU5, CAM 5.2, and neuron-specific enolase, Terracciano eand colleagues in 2000 predicted an endocardial sensory nerve tissue origin because of CALB2 expression by CM. While report of Farrell and colleagues in 1996 and Lindner and colleagues in 1999 indicates a histogenetic endodermal origin for CMâ&#x20AC;&#x2122;s positivity for CD34, CD31, CEA, and CA19.9, Kodamaand colleagues in 2002 and Sakamoto and colleagues in 2004 concluded that CM originates from mesenchymal cells and are capable of endothelial differentiation because of their expression of NKX2.5/CSX, GATA4, cardiac homeobox gene, and eHAND, and no expression of Stem cell factor, Granulocyte colony-stimulating factor, Hepatocyte growth factor, and ET3. In this study, it has been found that common genes those are involved in both heart and myxoma development are NKX2.5/CSX, GATA4, HOX,
89
Barh and Parida: Cardiac myxoma: molecular markers, critical disease pathways, drug targets, and putative targeting miRs Table 5. Heart specific miRs and their cardiac functions and pathophysiology. ! and " indicates respectively up and down-regulation of miR responsible for the pathophysiology. miRs
Expression
let-7
Cardiac and artery smooth muscles Heart, skeletal muscle
Target genes (predicted/direct)
Cardiac function Vascular endothelial cell migration
RASA1, CDK9, RHEB, FN1 HSP60, HSP70 CX43, KCNJ2, KCNN4
Heart development, hypertrophy Cardiomyocyte apoptosis Cardiac conduction
miR-1
Left ventricle
GATA6, HRT2, HAND1, HAND2
miR-1-2
Ventricle, skeletal muscle
HAND2, HLF, RBBP9 IRX5, CX43, IK1, HCN2, HCN4
miR-21 miR-125
Vascular wall, spleen, small intestine, colon Artery smooth muscles
Physiopathology
Cardiac morphogenesis, cardiomyocyte differentiation, inhibits ventricular cardiomyocyte proliferation Cardiomyocyte number Hyperplasia
Kuehbacher et al, 2007 Suarez et al, 2007 !Cardiac hypertrophy and heart failure
Sayed et al, 2007 Care´ et al, 2007 Xu et al, 2007
!Myocardial infarction, cardiac arrhythmias !Dilative cardiomyopathy, coronary artery disease !End-stage heart failure " Dilated cardiomyopathy or aortic stenosis "Congenital heart disease, hyperplasia, cardiomyocyte hypertrophy
Yang et al, 2007
" Arrhythmias and sudden death
Ventricular septation, regulation of heart rate
"Lethality due to ventricle wall defect, reduction in heart rate !Proliferative vascular diseases, cardiomyocyte hypertrophy
Vascular smooth muscle cell proliferation and apoptosis, cardiac hypertrophy
CASP9
Cardiomyocyte apoptosis
Heart, skeletal muscle RHOA, CDC42, WHSC2 HERG, HCN2
miR-195
Heart
miR-208
Heart
Heart size Electrical conductance Cardiac hypertrophy
THRAP1
Contraction
miR-214
90
Thum et al, 2007 Ikeda et al, 2007 Zhao et al, 2005
Zhao et al, 2007; Yang et al, 2007 Xiao et al, 2007 Zhao et al, 2007 Cheng et al, 2007; Sayed et al, 2007 Tatsuguchi et al, 2007 Ji et al, 2007 Ji et al, 2007 Xu et al, 2007
"Transverse aortic constriction miR-133
Xu et al, 2007
Zhao et al, 2007 Zhao et al, 2007
Electrical conductance
BCL2, PTEN
References
"Cardiac hypertrophy and heart failure "Arrhythmias and sudden death "Dilated cardiomyopathy, heart failure " Inhibition of stress induced remodeling, and "-MHC upregulation, cardiac hypertrophy "Hypertrophic cardiomyocyte growth
Van Rooij et al, 2006 Cheng et al, 2007 Thum et al, 2007 Yang et al, 2007 Care´ et al, 2007 Xiao et al, 2007 Xiao et al, 2007 Van Rooij et al, 2006 Van Rooij et al, 2007
van Rooij et al, 2006
Cancer Therapy Vol 7, page 91 Brand T (2003) Heart development: molecular insights into cardiac specification and early morphogenesis. Dev Biol 258, 1-19. Burke AP, Virmani R (1993) Cardiac myxoma. A clinicopathologic study. Am J Clin Pathol 100, 671-680. Busch AK, Litman T, Nielsen PS (2007) MicroRNA expression profiling using LNA-modified probes in a liquid-phase beadbased array. Nat Methods 4, I-ii. Butany J, Nair V, Naseemuddin A, Nair GM, Catton C, Yau T (2005) Cardiac tumours: diagnosis and management. Lancet Oncol 6, 219-228. Carè A, Catalucci D, Felicetti F, Bonci D, Addario A, Gallo P, Bang ML, Segnalini P, Gu Y, Dalton ND, Elia L, Latronico MV, Høydal M, Autore C, Russo MA, Dorn GW 2nd, Ellingsen O, Ruiz-Lozano P, Peterson KL, Croce CM, Peschle C, Condorelli G (2007) MicroRNA-133 controls cardiac hypertrophy. Nat Med 13, 613-618. Carney JA (1985) Differences between nonfamilial and familial cardiac myxoma. Am J Surg Pathol 9, 53-55. Carney JA, Ferreiro JA (1996) The epitheloid blue nevus, a multicentric familial tumor with important associations, including cardiac myxoma and psammomatous melanotic schwannoma. Am J Surg Pathol 20, 259-572. Carney JA, Hruska L, Beauchamp GD (1986) Dominant inheritance of the complex of myxomas, spotty pigmentation and endocrine overactivity. Mayo Clin Proc 61, 165-172. Casey M, Vaughan JH, Hatcher CJ, Winter JM, Weremowicz S, Montgomery K, Morton CC, Basson CT (2000) Mutations in the protein kinase A R1a regulatory subunit cause familial cardiac myxomas and Carney complex. J Clin Invest 106, 31-38. Castoldi M, Schmidt S, Benes V, Noerholm M, Kulozik AE, Hentze MW, Muckenthaler MU (2006) A sensitive array for microRNA expression profiling (miChip) based on locked nucleic acids (LNA). RNA 12, 913-920. Centofanti P, Di Rosa E, Deorsola L, Dato GM, Patanè F, La Torre M, Barbato L, Verzini A, Fortunato G, di Summa M (1999) Primary cardiac tumors: early and late results of surgical treatment in 91 patients. Ann Thorac Surg 68, 1236-1241. Chen JF, Mandel EM, Thomson JM, Wu Q, Callis TE, Hammond SM, Conlon FL, Wang DZ (2006) The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation. Nat Genet 38, 228-233. Cheng Y, Ji R, Yue J, Yang J, Liu X, Chen H, Dean DB, Zhang C (2007) MicroRNAs are aberrantly expressed in hypertrophic heart: do they play a role in cardiac hypertrophy? Am J Pathol 170, 1831-1840. Chopra P, Sharma VK (1983) Left atrial myxoma. An ultrastructural study. Jpn Heart J 24, 571-580. Chu PH, Jung SM, Yeh TS, Lin HC, Chu JJ (2005) MUC1, MUC2 and MUC5AC expressions in cardiac myxoma. Virchows Arch 446, 52-55. Curschellas E, Toia D, Borner M, Mihatsch MJ, Gudat F (19991) Cardiac myxomas: immunohistochemical study of benign and malignant variants. Virchows Arch A Pathol Anat Histopathol 418, 485-491. D'Alfonso A, Catania S, Pierri MD, Matteucci SL, Rescigno G, Münch C, Staine J, Iacobone G, Piccoli GP (2008) Atrial myxoma: a 25-year single-institutional follow-up study. J Cardiovasc Med (Hagerstown) 9, 178-181. Davis S, Lollo B, Freier S, Esau C (2006) Improved targeting of miRNA with antisense oligonucleotides. Nucleic Acids Res 34, 2294-2304. Dawson JR, Law A, Oldershaw PJ (1988) Left atrial myxoma infected with Streptococcus viridans. Int J Cardiol 21, 354358.
of the patho-physiology of CM. The most essential thing is the biomarker specific characterization of myxoma cases because the existing evidences show that there are several biomarkers and at least five critical pathways are involved in disease pathogenesis. Identification of unique, case specific, and early stage biomarkers and then subsequent marker specific drug development is important for targeted therapy and to increase treatment efficacy without surgery.
Acknowledgements We thank to all Bioinformatics software and database providers, whose tools and data were used in this research. We highly appreciate their public, free licensing, academic, and limited trial options.
References Acebo E, Val-Bernal JF, Gómez-Roman JJ (2001) Thrombomodulin, calretinin and c-kit (CD117) expression in cardiac myxoma. Histol Histopathol 16, 1031-1036. Acebo E, Val-Bernal JF, Gómez-Román JJ, Revuelta JM (2003) Clinicopathologic study and DNA analysis of 37 cardiac myxomas: a 28-year experience. Chest 123, 1379-1385. Aspres N, Bleasel NR, Stapleton KM (2003) Genetic testing of the family with a Carney-complex member leads to successful early removal of an asymptomatic atrial myxoma in the mother of the patient. Australas J Dermatol 44, 12122. Attar MN, Moore RK, Khan S (2008) Left atrial myxoma presenting with ventricular fibrillation. J Cardiovasc Med (Hagerstown) 9, 282-284. Bakaeen FG, Reardon MJ, Coselli JS, Miller CC, Howell JF, Lawrie GM, Espada R, Ramchandani MK, Noon GP, Weilbaecher DG, DeBakey ME (2003) Surgical outcome in 85 patients with primary cardiac tumors. Am J Surg 186, 641-647. Bakkali A, Sedrati M, Cheikhaoui Y, Kacemi RD, Maazouzi W (2008) Cardiac myxomas (a series of 23 cases). Ann Cardiol Angeiol (Paris) [ahead of print]. Barh D, Das K (2008) Targeting critical disease pathways in male breast cancer: a pharmacogenomics approach. Can Ther 6, 193-112. Barh D, Parida S, Parida BP, Viswanathan G (2008) Let-7, miR125, miR-205, and miR-296 are prospective therapeutic agents in breast cancer molecular medicine. Gene Ther Mol Biol 12, 189-206. Barh D (2008) Let-7 replacement therapy: applicability in cancer. Cancer Ther 6, 939-984. Becker R P, Ramírez M A, Zalaquett S R, Moran V S, Irarrázaval Ll MJ, Arretz V C, Córdova A S, Arnaiz G P (2008) Cardiac myxoma: clinical characterization, diagnostic methods and late surgical results. Rev Med Chil 136, 287295. Berrutti L, Silverman JS (1996) Cardiac myxoma is rich in factor XIIIa positive dendrophages: immunohistochemical study of four cases. Histopathology 28, 529-535. Bossert T, Gummert JF, Battellini R, Richter M, Barten M, Walther T, Falk V, Mohr FW (2005) Surgical experience with 77 primary cardiac tumors. Interact Cardiovasc Thorac Surg 4, 311-315. Boutla A, Delidakis C, Tabler M (2003) Developmental defects by antisense-mediated inactivation of micro-RNAs 2 and 13 in Drosophila and the identification of putative target genes. Nucleic Acids Res 31, 4973-4980.
91
Barh and Parida: Cardiac myxoma: molecular markers, critical disease pathways, drug targets, and putative targeting miRs De Moor CH, Meijer H, Lissenden S (2005) Mechanisms of translational control by the 3! UTR in development and differentiation. Semin Cell Dev Biol 16, 49-58. Demir M, Akpinar O, Acarturk E (2005) Atrial myxoma: an unusual cause of myocardial infarction. Tex Heart Inst J 32, 445-447. Detko-Barczy#ska J, Dabrowski R, Kraska A, Szwed H (2008) Left atrial myxoma in a patient with heart failure after myocardial infarction - a case report. Kardiol Pol 66, 661663. Dewilde J, Mignon F, Meyrier A, Bienvenu MP, Rachoin R, Cabrol C, Acar J (1983) Myxoma of the left atrium and advanced renal failure. Ann Med Interne (Paris) 134, 549554. Duran NE, Ozkan M (2008) Left atrial myxoma with atypical localization. Turk Kardiyol Dern Ars 36, 256-258. Durgut K, Görmüs N, Ozulku M, Ozergin U, Ozpinar C (2002) Clinical Features and Surgical Treatment of Cardiac Myxoma: Report of 18 Cases. Asian Cardiovasc Thorac Ann 10, 111-114. Duveau D, Baron O, Jegou B (1994) Multiple and recurrent cardiac myxomas. Is it a familial disease? Chirurgie 119, 357-361. Endo A, Ohtahara A, Kinugawa T, Ogino K, Hisatome I, Shigemasa C (2006) Characteristics of cardiac myxoma with constitutional signs: A multicenter study in Japan. Clin Cardiol 25, 367-370. Esau CC, Monia BP (2007) Therapeutic potential for microRNAs. Adv Drug Deliv Rev 59, 101-114. Esquela-Kerscher A, Trang P, Wiggins JF, Patrawala L, Cheng A, Ford L, Weidhaas JB, Brown D, Bader AG, Slack FJ (2008) The let-7 microRNA reduces tumor growth in mouse models of lung cancer. Cell Cycle 7, 759-764. Etxebeste J, Arrillaga L, Basurto J, Gonzalez J, Andraca L, Ortis De Salazar A (1998) Multiple recurrent local myxoma. Echocardiography 15, 257-258. Falasca K, Ucciferri C, Mancino P, Di Girolamo A, Vecchiet J (2008) Infected atrial myxoma: a rare cause of fever. Infez Med 16, 41-43. Farrell DJ, Bulmer E, Angus B, Ashcroft T (1996) Immunohistochemical expression of endothelial markers in left atrial myxomas: a study of six cases. Histopathology 28, 147-152. Fernandes F, Soufen HN, Ianni BM, Arteaga E, Ramires FJ, Mady C (2001) Primary neoplasms of the heart. Clinical and histological presentation of 50 cases. Arq Bras Cardiol 76, 231-237. Figueroa-Torres Y, Martínez-Ojeda JA, Franqui-Rivera H, Martínez-Toro J (2008) Benign cardiac neoplasms: the experience at the Cardiovascular Center of Puerto Rico and the Caribbean. P R Health Sci J 27, 373-376. Fogt F, Zimmerman RL, Hartmann CJ, Brown CA, Narula N (2002) Genetic alterations of Carney complex are not present in sporadic cardiac myxomas. Int J Mol Med 9, 59-60. Fueredi GA, Knechtges TE, Czarnecki DJ (1989) Coronary angiography in atrial myxoma: findings in nine cases. Am J Roentgenol 152, 737-738. Fujisawa H, Koide N, Kono T, Takayama K, Tsukioka K, Wada Y, Zhang T, Kitahara H, Nakano H, Suzuki JI, Isobe M, Amano J (2002) Expression of basic fibroblast growth factor and its receptor-1 in cardiac myxoma. J Cardiovasc Surg (Torino) 43, 589-594. García-Quintana A, Martín-Lorenzo P, Suárez de Lezo J, DíazEscofet M, Llorens R, Medina A (2005) Infected left atrial myxoma. Rev Esp Cardiol 58, 1358-1360. Gawdzínski MP, Sypula S (1996) The long term results of treatment of heart myxomas with special attention to very
rare myxoma of the right ventricle. J Cardiovasc Surg (Torino) 37, 121-129. Gerbode F, Kerth WJ, Hill JD (1967) Surgical management of tumors of the heart. Surgery 61, 94-101. Glasser SP, Bedynek JL, Hall RJ, Hopeman AR, Treasure RL, McAllister HA Jr, Esterly JA, Manion WC, Sanford HS (1971) Left atrial myxoma: report of a case including hemodynamic, surgical, and histologic characteristics. Am J Med 50, 113-122. Gonzales A, Altieri PI, Marquez E, Cox RA, Castillo M (1980) Massive pulmonary embolism associated with a right ventricular myxoma. Am J Med 69, 795-798. Gray IR, Williams WG (1985) Recurring cardiac myxoma. Br Med J 53, 645-649. Grebenc ML, Rosado-de-Christenson ML, Green CE, Burke AP, Galvin JR (2002) Cardiac myxoma: imaging features in 83 patients. Radiographics 22, 673-689. Grimm D, Streetz KL, Jopling CL, Storm TA, Pandey K, Davis CR, Marion P, Salazar F, Kay MA (2006) Fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways. Nature 441, 537-541. Grunweller A, Hartmann RK (2007) Locked nucleic acid oligonucleotides: the next generation of antisense agents? Biodrugs 21, 235-243. Hannah H 3rd, Eisemann G, Hiszcznskyj R, Winsky M (1982) Cohen Invasive atrial myxoma: documentation of malignant potential of cardiac myxomas. Am Heart J 104, 881-883. Hermans K, Jaarsma W, Plokker HW, Cramer MJ, Morshuis WJ (2003) Four cardiac myxomas diagnosed three times in one patient. Eur J Echocardiogr 4, 336-338. Hill G, Castellino S, Williams D (2008) Cardiac Myxoma After Treatment for Childhood Neuroblastoma. Pediatr Cardiol 21, [ahead of print] Hirano T, Taga T, Yasukawa K, Nakajima K, Nakano N, Takatsuki F, Shimizu M, Murashima A, Tsunasawa S, Sakiyama F (1987) Human B-cell differentiation factor defined by an anti-peptide antibody and its possible role in autoantibody production. Proc Natl Acad Sci USA 84, 228231. Hirota J, Akiyama K, Taniyasu N, Maisawa K, Kobayashi Y, Sakamoto N, Komatsu N (2004) Injury to the tricuspid valve and membranous atrioventricular septum caused by huge calcified right ventricular myxoma: report of a case. Circ J 68, 799-801. Holley DG, Martin GR, Brenner JI, Fyfe DA, Huhta JC, Kleinman CS, Ritter SB, Silverman NH (1995) Diagnosis and management of fetal cardiac tumors: a multicenter experience and review of published reports. J Am Coll Cardiol 28, 516-520. Hou YC, Chang S, Lo HM, Hsiao CH, Lin FY (2001) Recurrent cardiac myxoma with multiple distant metastasis and malignant change. J Formos Med Assoc 100, 63-65. Ikeda S, Kong SW, Lu J, Bisping E, Zhang H, Allen PD, Golub TR, Pieske B, Pu WT (2007) Altered micro-RNA expression in human heart disease. Physiol Genom 31, 367-373. Imai Y, Taketani T, Maemura K, Takeda N, Harada T, Nojiri T, Kawanami D, Monzen K, Hayashi D, Murakawa Y, Ohno M, Hirata Y, Yamazaki T, Takamoto S, Nagai R (2005) Genetic analysis in a patient with recurrent cardiac myxoma and endocrinopathy. Circ J 69, 994-995. Imperio J, Summers D, Krasnow N, Piccone VA Jr (1980) The distribution patterns of biatrial myxomas. Ann Thorac Surg 29, 469-473. Inamura K, Togashi Y, Nomura K, Ninomiya H, Hiramatsu M, Satoh Y, Okumura S, Nakagawa K, Ishikawa Y (2007) let-7 microRNA expression is reduced in bronchioloalveolar carcinoma, a non-invasive carcinoma, and is not correlated with prognosis. Lung Cancer 58, 392-396.
92
Cancer Therapy Vol 7, page 93 Irani AD, Estrera AL, Buja LM, Safi HJ (2008) Biatrial myxoma: a case report and review of the literature. J Card Surg 23, 385-390. Ito F, Tanaka H, Oi K, Arai H, Sunamori M (2006) Multiple recurrence of cardiac myxoma in a Carney complex patient 4 years after the first operation. Kyobu Geka 59, 1159-1162. Jacobsen N, Lomholt C, Mouritzen P, Nielsen PS, Noerholm M (2005) Detection and analysis of microRNA using LNA probes. J Biotechnol 118, S17. Janas R, Jutley RS, Fenton P, Sarkar P (2006) Should we perform preoperative coronary angiography in all cases of atrial myxomas. Catheter Cardiovasc Interv 67, 379-383. Janion M, Sielski J, Ciuraszkiewicz K (2008) Sepsis complicating giant cardiac myxoma. Am J Emerg Med 26, 387.e3-4. Ji R, Cheng Y, Yue J, Yang J, Liu X, Chen H, Dean DB, Zhang C (2007) MicroRNA expression signature and antisensemediated depletion reveal an essential role of microRNA in vascular neointimal lesion formation. Circ Res 100, 15791588. Johansson L (1989) Histogenesis of cardiac myxomas. An immunohistochemical study of 19 cases, including one with glandular structures, and review of the literature. Arch Pathol Lab Med 113, 735-741. Johnson CD, Esquela-Kerscher A, Stefani G, Byrom M, Kelnar K, Ovcharenko D, Wilson M, Wang X, Shelton J, Shingara J, Chin L, Brown D, Slack FJ (2007) The let-7 microRNA represses cell proliferation pathways in human cells. Cancer Res 67, 7713-7722. Juneja MS, Arunkumar N, Srinivas CN, Rajan S, Ajit M (2006) Right atrial myxoma arising from the inferior vena cava. Indian Heart J 58, 356-358. Kaminsky ME, Ehlers KH, Engle MA, Klein AA, Levin AR, Subramanian VA (1979) Atrial myxoma mimicking a collagen disorder. Chest 75, 93-95. Kapusta A, Lipiec P, Chrzanowski L, Fory% J, Kasprzak JD (2007) Untypical cause of heart failure--right atrial myxoma. Pol Arch Med Wewn 117, 470-472. Karachalios G, Bablekos G, Karachaliou I, Zoganas L, Charalabopoulos A, Charalabopoulos K (2004) Left atrial myxoma prolapsing into the left ventricle. Case report and review of the literature. Chemotherapy 50, 297-301. Karga H, Papaioannou P, Karayianni M, Papadimitriou K, Priftis D, Voujuklakis T, Migdou B, Nanas J, Papapetrou P (2000) Ras oncogenes and p53 tumor suppressor gene analysis in cardiac myxomas. Pathol Res Pract 196, 601-605. Kennedy P, Parry AJ, Parums D, Pillai R (1995) Myxoma of the aortic valve. Ann Thorac Surg 59, 1221-1223. King YL, Dickens P, Chan ACL (1993) Tumors of the heart. Arch Pathol Lab Med 117, 1027. Kirschner LS, Carney JA, Pack SD, Taymans SE, Giatzakis C, Cho YS, Cho-Chung YS, Stratakis CA (2000) Mutations of the gene encoding the protein kinase A type I-a regulatory subunit in patients with the Carney complex. Nat Genet 26, 89-92. Kirschner LS, Sandrini F, Monbo J, Lin JP, Carney JA, Stratakis CA (2000) Genetic heterogeneity and spectrum of mutation of PRKAR1A gene in patients with Carney complex. Hum Mol Genet 9, 3037-3046. Kloosterman WP, Wienholds E, de Bruijn E, Kauppinen S, Plasterk RHA (2006) In situ detection of miRNAs in animal embryos using LNA-modified oligonucteotide probes. Nat Methods 3, 27-29. Kodama H, Hirotani T, Suzuki Y, Ogawa S, Yamazaki K (2002) Cardiomyogenic differentiation in cardiac myxoma expressing lineage-specific transcription factors. Am J Pathol 161, 381-389.
Kojima S, Sumiyoshi M, Watanabe Y, Suwa S, Matsumoto M, Nakata Y, Daida H (2005) A Japanese case of familial cardiac myxoma associated with a mutation of the PRKAR1alpha gene. Intern Med 44, 607-610. Kono T, Koide N, Hama Y, Kitahara H, Nakano H, Suzuki J, Isobe M, Amano J (2000) Expression of vascular endothelial growth factor and angiogenesis in cardiac myxoma: a study of fifteen patients. J Thorac Cardiovasc Surg 119, 101-107. Krutzfeldt J, Kuwajima S, Braich R, Rajeev KG, Pena J, Tuschl T, Manoharan M, Stoffel M (2007) Specificity, duplex degradation and subcellular localization of antagomirs. Nucleic Acids Res 35, 2885-2892. Krutzfeldt J, Rajewsky N, Braich R, Rajeev KG, Tuschl T, Manoharan M, Stoffel M (2005) Silencing of microRNAs in vivo with ‘antagomirs’. Nature 438, 685-689. Kuehbacher A, Urbich C, Zeiher AM, Dimmeler S (2007) Role of Dicer and Drosha for endothelial microRNA expression and angiogenesis. Circ Res 101, 59-68. Kumagai K, Sai S, Endo M, Tabayashi K (2008) Right ventricular myxoma obstructing the pulmonary artery during early childhood. Gen Thorac Cardiovasc Surg 56, 351-353. Kumar MS, Erkeland SJ, Pester RE, Chen CY, Ebert MS, Sharp PA, Jacks T (2008) Suppression of non-small cell lung tumor development by the let-7 microRNA family. Proc Natl Acad Sci USA 105, 3903-3908. Kurian KC, Weisshaar D, Parekh H, Berry GJ, Reitz B (2006) Primary cardiac angiosarcoma: case report and review of the literature. Cardiovasc Pathol 15, 110-112. Kusumi T, Minakawa M, Fukui K, Saito S, Ohashi M, Sato F, Fukuda I, Kijima H (2008) Cardiac tumor comprising two components including typical myxoma and atypical hypercellularity suggesting a malignant change. Cardiovasc Pathol [ahead of print]. Ku"niar TJ, Hinchcliff M, Zunamon A, Balagani R, Enzler M, Mandzij R (2007) Severe reversible left ventricular dysfunction associated with multiple cardiac myxomata. Wiad Lek 60, 291-293. Lad VS, Jain J, Agarwala S, Sinha VK, Khandekar JV, Agrawal NB, Khandeparkar JM, Patwardhan A (2006) Right atrial trans-septal approach for left atrial myxomas - nine-year experience. Heart Lung Circ 15, 38-43. Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T (2002) Identification of tissue-specific miRNAs from mouse. Curr Biol 12, 735-739. Lai EC (2002) Micro RNAs are complementary to 3! UTR sequence motifs that mediate negative post-transcriptional regulation. Nat Genet 30, 363-364. Laissy JP, Fernandez P, Mousseaux E, Dacher JN, Crochet D (2004) Cardiac tumors. J Radiol 85, 363-369. Lam KY, Dickens P, Chan AC (1993) Tumors of the heart. A 20year experience with a review of 12,485 consecutive autopsies. Arch Pathol Lab Med 117, 1027-1031. Lane GE, Kapples EJ, Thompson RC, Grinton SF, Finck SJ (1994) Quiescent left atrial myxoma. Am Heart J 127, 1629-1631. Leone S, dell'aquila G, Giglio S, Magliocca M, Maio P, Nigro FS, Pacifico P, De Chiara G, Acone N (2007) Infected atrial myxoma: case report and literature review. Infez Med 15, 256-261. Lindner V, Edah-Tally S, Chakfé N, Onody T, Eisenmann B, Walter P (1999) Cardiac myxoma with glandular component: case report and review of the literature. Pathol Res Pract 195, 267-272. Macarie C, Stoica E, Chioncel O, Carp A, Gherghiceanu D, Stiru O, Zarma L, Herlea V (2004) Recurrent atrial myxoma. Rom J Intern Med 42, 625-634. Malekzadeh S, Roberts WC (1989) Growth rate of left atrial myxoma. Am J Cardiol 64, 1075-1076.
93
Barh and Parida: Cardiac myxoma: molecular markers, critical disease pathways, drug targets, and putative targeting miRs Markel ML, Armstrong WF, Waller BF, Mahomed Y (1986) Left atrial myxoma with multicentric recurrence and evidence of metastases. Am Heart J 111, 409-413. Mattle HP, Maurer D, Sturzenegger M, Ozdoba C, Baumgartner RW, Schroth G (1995) Cardiac myxomas: a long term study. J Neurol 242, 689-694. Mayr C, Hemann MT, Bartel DP (2007) Disrupting the pairing between let-7 and Hmga2 enhances oncogenic transformation. Science 315, 1576-1579. McAllister HA, Fenoglio JJ (1978) Tumors of the cardiovascular system. In: Atlas of tumor pathology, second series. Armed Forces Institute of Pathology: Washington. McCarthy PM, Piehler JM, Schaff HV, Pluth JR, Orszulak TA, Vidaillet HJ Jr, Carney JA (1986) The significance of multiple, recurrent, and “complex” cardiac myxomas. J Thorac Cardiovasc Surg 91, 389-396. McFadden DG, Olson EN (2002) Heart development: learning from mistakes. Curr Opin Genet Dev 12, 328-335. Mendoza CE, Rosado MF, Bernal L (2001) The role of interleukin-6 in cases of cardiac myxoma. Clinical features, immunologic abnormalities, and a possible role in recurrence. Tex Heart Inst J 28, 3-7. Merkow LP, Kooros MA, Magovern G, Hayeslip DW, Weikers NJ, Pardo M, Fisher DL (1969) Ultrastructure of a cardiac myxoma. Arch Pathol 88, 390-398. Molina JE, Edwards JE, Ward HB (1990) Primary cardiac tumors: experience at the University of Minnesota. Thorac Cardivasc Surg 38, 183-191. Naguibneva I, Ameyar-Zazoua A, Nonne N, Polesskaya A, AitSi-Ali S, Groisman R, Souidi M, Pritchard LL, Harel-Bellan A (2006) An LNA-based lossof-function assay for microRNAs. Biomed Pharmacother 60, 633-638. Namazee MH, Rohani-Sarvestani HR, Serati AR (2008) The early presentation of atrial myxoma with acute myocardial infarction. Arch Iran Med 11, 98-102. Nelson PT, Baldwin DA, Kloosterman WP, Kauppinen S, Plasterk RHA, Mourelatos Z (2006) RAKE and LNA-ISH reveal microRNA expression and localization in archival human brain. RNA 12, 187-191. Orlandi A, Ciucci A, Ferlosio A, Genta R, Spagnoli LG, Gabbiani G (2006) Cardiac myxoma cells exhibit embryonic endocardial stem cell features. J Pathol 209, 231-239. Orlandi A, Ciucci A, Ferlosio A, Pellegrino A, Chiariello L, Spagnoli LG (2005) Increased Expression and Activity of Matrix Metalloproteinases Characterize Embolic Cardiac Myxomas. Am J Pathol 166, 1619-1628. Orom UA, Kauppinen S, Lund AH (2006) LNA-modified oligonucleotides mediate specific inhibition of microRNA function. Gene 372, 137-141. Oyama H, Nakayama M, Ikeda A, Maeda M, Miyahara T, Inoue S, Sakurai H, Murayama H, Hasegawa H, Iizuka H, Endoh O, Shibuya M (2001) A case of cardiac myxoma with multiple brain hemorrhage. No Shinkei Geka 29, 533-537. Ozcan AV, Evrengul H, Bir F, Tanriverdi H, Goksin I, Kaftan A (2008) Multiple myxomas originating from anterior and posterior mitral leaflets in the left ventricle leading to LV outflow tract obstruction. Circ J 72, 1709-1711. Panagiotou M, Panagopoulos ND, Ravazoula P, Kaklamanis L, Koletsis EN (2008) Large asymptomatic left atrial myxoma with ossification: case report. J Cardiothorac Surg 3, 19. Parissis JT, Mentzikof D, Georgopoulou M, Gikopoulos M, Kanapitsas A, Merkouris K, Kefalas C (1996) Correlation of interleukin-6 gene expression to immunologic features in patients with cardiac myxomas. J Interferon Cytokine Res 16, 589-593. Patanè S, Marte F, Di Bella G (2008) Revelation of left atrial myxoma during acute myocardial infarction. Int J Cardiol 128, 134-136.
Pelczar M, Go"dzik A, Derkacz A, Lipi#ska-Gediga M, Kustrzycki W (2004) A giant left atrial myxoma as a cause of a low cardiac output syndrome: a case report. Kardiol Pol 60, 260-262. Peng Y, Laser J, Shi G, Mittal K, Melamed J, Lee P, Wei JJ (2008) Antiproliferative effects by Let-7 repression of highmobility group A2 in uterine leiomyoma. Mol Cancer Res 6, 663-673. Perez de Isla L, de Castro R, Zamorano JL, Almeria C, Moreno R, Moreno M, Lima P, Garcia Fernandez MA (2002) Diagnosis and treatment of cardiac myxomas by transesophageal echocardiography. Am J Cardiol 90, 14191421. Piazza N, Chughtai T, Toledano K, Sampalis J, Liao C, Morin JF (2004) Primary cardiac tumours: eighteen years of surgical experience on 21 patients. Can J Cardiol 20, 1443-1448. Pinede L, Duhaut P, Loire R (2001) Clinical presentation of left atrial cardiac myxoma. A series of 112 consecutive cases. Medicine (Baltimore) 80, 159-172. Poliseno L, Tuccoli A, Mariani L, Evangelista M, Citti L, Woods K, Mercatanti A, Hammond S, Rainaldi G (2006) MicroRNAs modulate the angiogenic properties of HUVECs. Blood 108, 3068-3071. Pradhan B, Acharya SP (2006) A case of left atrial myxoma: anaesthetic management. Kathmandu Univ Med J (KUMJ) 4, 349-353. Prichard RW (1951) Tumors of the heart: review of the subject and report of one hundred and fifty cases. Arch Pathol 51, 98. Pucci A, Gagliardotto P, Zanini C, Pansini S, di Summa M, Mollo F (2000) Histopathologic and clinical characterization of cardiac myxoma: Review of 53 cases from a single institution. Am Heart J 140, 134-138. Puntila J, Hakala T, Salminen J, Pihkala J (2006) Positive genetic test led to an early diagnosis of myxoma in a 4-year-old boy. Interact Cardiovasc Thorac Surg 5, 662-663. Rahmanian PB, Castillo JG, Sanz J, Adams DH, Filsoufi F (2007) Cardiac myxoma: preoperative diagnosis using a multimodal imaging approach and surgical outcome in a large contemporary series. Interact Cardiovasc Thorac Surg 6, 479-483. Rajani R, Bhanot DK, Prasad SK, Holt PM (2008) Mitral valve myxoma: a case of mistaken identity. J Cardiovasc Med (Hagerstown) 9, 1290-1292. Rathore KS, Hussenbocus S, Stuklis R, Edwards J (2008) Novel strategies for recurrent cardiac myxoma. Ann Thorac Surg 85, 2125-2126. Reynan K (1996) Frequency of primary tumors of the heart. Am J Cardiol 77,107-116. Reynen K (1995) Cardiac myxomas. N Engl J Med 333, 16101617. Roberts WC (1997) Primary and secondary neoplasms of the heart. Am J Cardiol 80, 671-182. Robins H, PressWH (2005) Human microRNAs target a functionally distinct population of genes with AT-rich 3! UTRs. Proc Natl Acad Sci USA 102, 15557-15562. Roldan FJ, Varras-Barron J, Espinola-Zavaleta N, Keims C, Romero-Cardenaz A (2000) Recurrent myxoma implanted in the left atrial appendage. Echocardiography 17, 169-171. Roschkov S, Rebeyka D, Mah J, Urquhart G (2007) The dangers of cardiac myxomas. Prog Cardiovasc Nurs 22, 27-30. Roth JE, Conner WC, Porisch ME, Shry E (2006) Sinoatrial nodal artery to right atrium fistula after myxoma excision. Ann Thorac Surg 82, 1106-1107. Sakamoto H, Sakamaki T, Kanda T, Tsuchiya Y, Sato M, Sato H, Oyama Y, Sawada Y, Tamura J, Nagai R, Kurabayashi M (2004) Vascular endothelial growth factor is an autocrine growth factor for cardiac myxoma cells. Circ J 68, 488-493.
94
Cancer Therapy Vol 7, page 95 Sakamoto H, Sakamaki T, Sumino H, Sawada Y, Sato H, Sato M, Fujita K, Kanda T, Tamura J, Kurabayashi M (2004) Production of endothelin-1 and big endothelin-1 by human cardiac myxoma cells--implications of the origin of myxomas. Circ J 68, 1230-1232. Sakellaridis T, Argiriou M, Koukis I, Panagiotakopoulos V, Spiliotopoulos C, Dimakopoulou A, Charitos C (2008) Gerstmann's syndrome: can cardiac myxoma be the cause? Hellenic J Cardiol 49, 52-54. Salcedo EE, Cohen GI, White RD, Davison MB (1992) Cardiac tumors: diagnosis and management. Curr Probl Cardiol 17, 73-137. Sampson VB, Rong NH, Han J, Yang Q, Aris V, Soteropoulos P, Petrelli NJ, Dunn SP, Krueger LJ (2007) MicroRNA let-7a down-regulates MYC and reverts MYC-induced growth in Burkitt lymphoma cells. Cancer Res 67, 9762-9770. Sato H, Tanaka T, Kasai K, Kita T, Tanaka N (2008) Sudden death due to acute pulmonary embolism from asymptomatic right atrial myxoma. J Forensic Leg Med 15, 454-456. Sayed D, Hong C, Chen IY, Lypowy J, Abdellatif M (2007) MicroRNAs play an essential role in the development of cardiac hypertrophy. Circ Res 100, 416-424. Schultz J, Lorenz P, Gross G, Ibrahim S, Kunz M (2008) MicroRNA let-7b targets important cell cycle molecules in malignant melanoma cells and interferes with anchorageindependent growth. Cell Res 18, 549-557. Scrofani R, Carro C, Villa L, Botta M, Antona C (2002) Cardiac myxoma: surgical results and 15-year clinical follow-up. Ital Heart J Suppl 3, 753-758. Seagle RL, Nomeir AM, Watts LE (1984) Left atrial myxoma associated with rheumatic mitral stenosis. Clin Cardiol 7, 370-372. Seino Y, keda U, Shimada K (1993) Increased expression of interleukin 6 mRNA in cardiac myxomas. Br Heart J 69, 565-567. Sempere LF, Christensen M, Silahtaroglu A, Bak M, Heath CV, Schwartz G, Wells W, Kauppinen S, Cole CN (2007) Altered MicroRNA expression confined to specific epithelial cell subpopulations in breast cancer. Cancer Res 67, 1161211620. Shaikh AH, Khan G, Hanif B, Malik F, Bashir A (2008) Biatrial myxoma. J Coll Physicians Surg Pak 18, 639-640. Shapiro LM (2001) Cardiac tumours: diagnosis and management. Heart 85, 218-222. Shinfeld A, Katsumata T, Westaby S (1998) Recurrent cardiac myxoma: seeding or multifocal disease? Ann Thorac Surg 66, 285-288. Silvestri F, Bussani R, Pavletic N, Mannone T (1887) Metastases of the heart and pericardium. G Ital Cardiol 27, 1252-1255. Skamrov AV, Nechaenko MA, Goryunova LE, Feoktistova ES, Khaspekov GL, Kovalevsky DA, Vinnitsky LI, Sheremeteva GF, Beabealashvilli RS (2004) Gene expression analysis to identify mRNA markers of cardiac myxoma. J Mol Cell Cardiol 37, 717-733. Sotokawa M, Nishiya Y, Hoshino S, Ueda T, Saitou N, Murata A, Yusa H, Tateishi M, Usuda K, Nagata Y, Miwa A, Uchiyama A (2008) Huge right atrial myxoma. Kyobu Geka 61, 1035-1038. Sourvinos G, Parissis J, Sotsiou F, Arvanitis DL, Spandidos DA (1999) Detection of microsatellite instability in sporadic cardiac myxomas. Cardiovasc Res 42, 728-732. Srivastava D, Olson EN (2000) A genetic blueprint for cardiac development. Nature 407, 221-226. St John Sutton MG, Mercier LA, Giuliani ER, Lie JT (1980) Atrial myxomas: a review of clinical experience in 40 patients. Mayo Clin Proc 55, 371-376. Stark A, Brennecke J, Bushati N, Russell RB, Cohen SM (2005) Animal microRNAs confer robustness to gene expression
and have a significant impact on 3! UTR evolution. Cell 123, 1133-1146. Suarez Y, Fernandez-Hernando C, Pober JS, Sessa WC (2007) Dicer dependent microRNAs regulate gene expression and functions in human endothelial cells. Circ Res 100, 11641173. Sultan FA, Syed A, Kazmi K, Dhakam S (2006) Cardiac myxomas-clinical spectrum and outcome. J Coll Physicians Surg Pak 16, 501-503. Sun M, Hurst LD, Carmichael GG, Chen JJ (2005) Evidence for a preferential targeting of 3!-UTRs by cis-encoded natural antisense transcripts. Nucleic Acids Res 33, 5533-5543. Sun P, Wang ZB (2008) Familial atrial myxoma. Cardiol Young 18, 525-527. Suvarna SK, Royds JA (1996) The nature of the cardiac myxoma. Int J Cardiol 57, 211-216. Suzuki H, Shimura H, Haraguchi K, Harii N, Endo T, Hosaka S, Yoshii S, Tada Y, Onaya T (1999) Exophthalmos, pretibial myxedema, osteoarthropathy syndrome associated with papillary fibroelastoma in the left ventricle. Thyroid 9, 1257-1260. Suzuki J, Takayama K, Mitsui F, Kono T, Yazaki Y, Takei M, Amano J, Isobe M (2000) In situ interleukin-6 transcription in embryonic nonmuscle myosin heavy chain expressing immature mesenchyme cells of cardiac myxoma. Cardiovasc Pathol 9, 33-37. Swartz MF, Lutz CJ, Chandan VS, Landas S, Fink GW (2006) Atrial myxomas: pathologic types, tumor location, and presenting symptoms. J Card Surg 21, 435-440. Takamizawa J, Konishi H, Yanagisawa K, Tomida S, Osada H, Endoh H, Harano T, Yatabe Y, Nagino M, Nimura Y, Mitsudomi T, Takahashi T (2004) Reduced expression of the let-7 microRNAs in human lung cancers in association with shortened postoperative survival. Cancer Res 64, 37533756. Tatsuguchi M, Seok HY, Callis TE, Thomson JM, Chen JF, Newman M, Rojas M, Hammond SM, Wang DZ (2007) Expression of microRNAs is dynamically regulated during cardiomyocyte hypertrophy. J Mol Cell Cardiol 42, 11371141. Terracciano LM, Mhawech P, Suess K, D'Armiento M, Lehmann FS, Jundt G, Moch H, Sauter G, Mihatsch MJ (2000) Calretinin as a Marker for Cardiac Myxoma. Am J Clin Pathol 114, 754-759. Thielke D, Thyssen JP, Sejersen HM (2008) Cardiac myxoma--a rare cause of cerebral embolism. Ugeskr Laeger 170, 2460. Thum T, Galuppo P, Wolf C, Fiedler J, Kneitz S, van Laake LW, Doevendans PA, Mummery CL, Borlak J, Haverich A, Gross C, Engelhardt S, Ertl G, Bauersachs J (2007) Micro-RNAs in the human heart: a clue to fetal gene reprogramming in heart failure. Circulation 116, 258-267. Tok M, Oc M, Ucar HI, Dogan OF, Ozyuksel A, Kaya B, Farsak MB, Yorgancioglu AC (2007) Giant right atrial myxoma mimicking hepatic cirrhosis: a case report. Heart Surg Forum 10, E107-109. Uchino K, Mochida Y, Ebina T, Tobe M, Kobayashi S, Yano Y, Kobayashi T, Nakazawa I, Ishikawa T, Kimura K, Takanashi Y, Umemura S (2002) Infected left atrial myxoma. Intern Med 41, 957-960. Valoczi A, Hornyik C, Varga N, Burgyan J, Kauppinen S, Havelda Z (2004) Sensitive and specific detection of microRNAs by northern blot analysis using LNA-modified oligonucleotide probes. Nucleic Acids Res 32, e175. Van Cleemput J, Daenen W, De Geest H (1993) Coronary angiography in cardiac myxomas: findings in 19 consecutive cases and review of the literature. Cathet Cardiovasc Diagn 29, 217-220.
95
Barh and Parida: Cardiac myxoma: molecular markers, critical disease pathways, drug targets, and putative targeting miRs van Gelder HM, O'Brien DJ, Staples ED, Alexander JA (1992) Familial cardiac myxoma. Ann Thorac Surg 53, 419-424. van Rooij E, Sutherland LB, Liu N, Williams AH, McAnally J, Gerard RD, Richardson JA, Olson EN (2006) A signature pattern of stress-responsive microRNAs that can evoke cardiac hypertrophy and heart failure. Proc Natl Acad Sci USA 103, 18255-18260. Van Rooij E, Sutherland LB, Qi X, Richardson JA, Hill J, Olson EN (2007) Control of stress-dependent cardiac growth and gene expression by a microRNA. Science 316, 575-579. Vander Salm TJ (2000) Unusual primary tumors of the heart. Semin Thorac Cardiovasc Surg 12, 89-100. Veugelers M, Bressan M, McDermott DA, Weremowicz S, Morton CC, Mabry CC, Lefaivre JF, Zunamon A, Destree A, Chaudron JM, Basson CT (2004) Mutation of perinatal myosin heavy chain associated with a Carney complex variant. N Engl J Med 351, 460-469. Vohra HA, Vohra H, Patel RL (2002) Cardiac myxoma with three recurrences. J R Soc Med 95, 252-253. Weiler J, Hunziker J, Hall J (2006) Anti-miRNA oligonucleotides (AMOs): ammunition to target miRNAs implicated in human disease? Gene Ther 13, 496-502. West BT, Kaluza A (2008) A Case of Multi-System Signs and Symptoms Unified Under the Diagnosis of Atrial Myxoma. J Emerg Med [ahead of print] Wilkes D, McDermott DA, Basson CT (2005) Clinical phenotypes and molecular genetic mechanisms of Carney complex. Lancet Oncol 6, 501-508. Wolfrum C, Shi S, Jayaprakash KN, Jayaraman M, Wang G, Pandey RK, Rajeev KG, Nakayama T, Charrise K, Ndungo EM, Zimmermann T, Koteliansky V, Manoharan M, Stoffel M (2007) Mechanisms and optimization of in vivo delivery of lipophilic siRNAs. Nat Biotechnol 25,1149-1157. Xiao J, Luo X, Lin H, Zhang Y, Lu Y, Wang N, Zhang Y, Yang B, Wang Z (2007) MicroRNA miR-133 represses HERG K+ channel expression contributing to QT prolongation in diabetic hearts. J Biol Chem 282, 12363-12367. Xiao J, Yang B, Lin H, Lu Y, Luo X, Wang Z (2007) Novel approaches for gene-specific interference via manipulating actions of microRNAs: examination on the pacemaker channel genes HCN2 and HCN4. J Cell Physiol 212, 285292. Xu C, Lu Y, Pan Z, Chu W, Luo X, Lin H, Xiao J, Shan H, Wang Z, Yang B (2007) The muscle-specific microRNAs miR-1 and miR-133 produce opposing effects on apoptosis by targeting HSP60, HSP70 and caspase-9 in cardiomyocytes. J Cell Sci 120, 3045-3052.
Yanagawa Y, Shimazaki H, Shima K, Isoda S, Maehara T (2008) Atrial myxoma occurring 15 years after subtotal resection of cerebellar hemangioblastoma. Neurol Med Chir (Tokyo) 48, 37-39. Yanaihara N, Caplen N, Bowman E, Seike M, Kumamoto K, Yi M, Stephens RM, Okamoto A, Yokota J, Tanaka T, Calin GA, Liu CG, Croce CM, Harris CC (2006) Unique microRNAmolecular profiles in lung cancer diagnosis and prognosis. Cancer Cell 9, 189-198. Yang B, Lin H, Xiao J, Lu Y, Luo X, Li B, Zhang Y, Xu C, Bai Y, Wang H, Chen G, Wang Z (2007) The muscle-specific microRNA miR-1 regulates cardiac arrhythmogenic potential by targeting GJA1 and KCNJ2. Nat Med 13, 486-491. Yeh HH, Yang CC, Tung WF, Wang HF, Tung JN (2006) Young stroke, cardiac myxoma, and multiple emboli: a case report and literature review. Acta Neurol Taiwan 15, 201-205. Yoo M, Graybeal DF (2008) An echocardiographic-confirmed case of atrial myxoma causing cerebral embolic ischemic stroke: a case report. Cases J 1, 96. Yu F, Yao H, Zhu P, Zhang X, Pan Q, Gong C, Huang Y, Hu X, Su F, Lieberman J, Song E (2007) let-7 regulates self renewal and tumorigenicity of breast cancer cells. Cell 131, 1109-1123. Yu K, Liu Y, Wang H, Hu S, Long C (2007) Epidemiological and pathological characteristics of cardiac tumors: a clinical study of 242 cases. Interact Cardiovasc Thorac Surg 6, 636-639. Yu SL, Chen HY, Chang GC, Chen CY, Chen HW, Singh S, Cheng CL, Yu CJ, Lee YC, Chen HS, Su TJ, Chiang CC, Li HN, Hong QS, Su HY, Chen CC, Chen WJ, Liu CC, Chan WK, Chen WJ, Li KC, Chen JJ, Yang PC (2008) MicroRNA signature predicts survival and relapse in lung cancer. Cancer Cell 13, 48-57. Zaffran S, Frasch M (2002) Early Signals in Cardiac Development. Circ Res 91, 457-469. Zhang T, Koide N, Wada Y, Tsukioka K, Takayama K, Kono T, Kitahara H, Amano J (2003) Significance of monocyte chemotactic protein-1 and thymidine phosphorylase in angiogenesis of human cardiac myxoma. Circ J 67, 54-60. Zhao Y, Ransom JF, Li A, Vedantham V, von Drehle M, MuthAN, Tsuchihashi T, McManus MT, Schwartz RJ, Srivastava D (2007) Dysregulation of cardiogenesis, cardiac conduction, and cell cycle in mice lacking miRNA-1-2. Cell 129, 303-317. Zhao Y, Samal E, Srivastava D (2005) Serum response factor regulates a muscle-specific microRNA that targets Hand2 during cardiogenesis. Nature 436, 214-220.
From left: Debmalya Barh and Sanjeeb Parida.
96
Cancer Therapy Vol 7, page 97 Cancer Therapy Vol 7, 97-102, 2009
Repeated Therapeutic Embolization with Systemic Chemotherapy for Hepatic Metastases from !Fetoprotein-producing Gastric Cancer Case Report
Ji-Hyun Ju1, Won Sup Lee1,2,*, Myung Hee Kang1, Seok Hyun Kim1, Hoon Gu Kim1, Dong Chul Kim3, Tae-Beom Shin4, Kyungsoo Bae4 1
Division of Hematology- Oncology Department of Internal Medicine Gyeongsang Institute of Health Sciences, 3 Department of Pathology, 4 Department of Radiology Gyeongsang National University College of Medicine, South Korea 2
__________________________________________________________________________________ *Correspondence: Won Sup Lee M.D., PhD. Division of Hematology-Oncology Department of Internal Medicine, Gyeongsang National University !"#$$%&of Medicine and Gyeongsang Institute of Health Sciences, 90 Chiram-dong Jinju, 660-702 South Korea; Tel: + 82-55-750-8733; Fax: + 82-55-755-9078, 82-55-758-9122; e-mail: lwshmo@hanmail.net, lwshmo@gshp.gsnu.ac.kr Key words: cancer, stomach, alpha-fetoprotein, therapeutic embolization, combination chemotherapy Abbreviations: !-Fetoprotein, (AFP); advanced gastric cancer, (AGC); computed tomography, (CT); intratumoral microvessel density, (IMVD); multifunctional dynamic computed tomography, (MDCT); transarterial embolization, (TAE); transarterial infusion, (TAI); vascular endothelial growth factor, (VEGF) Received: 27 August 2008; Revised: 28 October 2008 Accepted: 28 January 2009; electronically published: February 2009
Summary !-Fetoprotein (AFP)-producing gastric cancer is rare, characterized by high malignant potential (high proliferative activity, lack of apoptosis, and rich neovascularization), and associated with a dismal prognosis when it metastasizes to the liver. We present here a case of metastatic !-fetoprotein-producing gastric cancer to the liver in a 72-year-old man who was treated with repeated hepatic transarterial embolization (TAE) in combination with systemic chemotherapy. The tumor metastasis controlling effects seen may suggest a therapeutic option in these cases.
median survival period is about 2 to 6 months (Wagner et al, 2006). For these patients, palliative chemotherapy is one of the best treatment alternatives with a response rate of approximately 40% to 70% (Wagner et al, 2006). Because hepatic transarterial embolization (TAE) can be performed under local anesthesia and the mortality rate of the procedure is close to zero percent (Georgiades et al, 2005), its application range has recently been widened to the palliative treatment of inoperable primary tumors or metastatic cancer to the liver. Use of TAE with iodized oil (Lipiodol) is based on the premise that nutrient blood is mainly supplied from the hepatic artery in over 95 % of primary cancers and in some metastatic liver cancer (Nakashima et al, 1983), and Lipiodol use results in selective embolization of tumorfeeding blood vessels allowing to selectively shut off blood supply and causes tumor damage while minimizing damage to normal liver tissue. Interventional treatments such as TAE have been applied mainly to primary liver cancer, especially hepatocellular carcinoma (HCC),
I. Introduction Throughout most of the twentieth century, gastric cancer has been a leading cause of cancer-associated mortality worldwide, and in advanced gastric cancer, the liver is the most frequent metastatic site (approximately 30% of patients) followed by lymph nodes (Taniguchi et al, 1997; Adachi et al, 2002). In particular, !-Fetoprotein (AFP)-producing gastric cancer is rare and, relative to its !-AFP-negative counterpart, associated with a greater malignant potential (high proliferative activity, lack of apoptosis, and rich neovascularization) (Koide et al, 1999) and significantly higher levels of neovascularization markers, such as vascular endothelial growth factor (VEGF) expression and intratumoral microvessel density (IMVD). In turn, augmented tumor neovascularization is an important factor in liver metastasis, which is associated with poor clinical outcome and prognosis. Gastric cancer with liver metastasis is rarely an indication for curative surgery, and without treatment the
97
Ju et al: Repeated Therapeutic Embolization for Hepatic Metastases from !-Fetoprotein-producing Gastric Cancer present underlying chronic liver disease stigmata such as spider angioma and viral markers. Therefore, percutaneous biopsy of the lesion was performed, and histological findings revealed adenocarcinoma suspiciously metastatic (Figure 2). Gastrofiberscopy was performed to search for the primary lesion, and advanced gastric cancer (AGC, Borrmann type III) was found with histological findings revealing adenocarcinoma matching the metastatic lesion (Figure 2). The case was therefore diagnosed as AFP-producing gastric cancer with liver metastases and treated at Seoul National University Hospital with combination chemotherapy consisting of 800 mg/m2 of capecitabine and 55 mg/m2 of cisplatin (dose reduction by 20% due to his old age). Patient was then referred to our hospital for further follow-up. On admission to Gyeongsang National University Hospital, vital signs were stable. Hemoglobin was 12.2 g/dL, hematocrit was 36 %, leukocyte was 3820/mm3, and platelet was 332,000/mm3. In biochemical tests, protein and albumin levels were reduced to 6.2 g/dL and 3.3 g/dL, respectively, and alkaline phosphatase level was elevated to 193 U/L. Other findings were within normal range. In a tumor marker test, the level of serum AFP was reduced to 501 ng/mL after the first TAE. The initial multifunctional dynamic computed tomography (MDCT) had revealed that the mass in the liver corresponded to a hypervascular tumor fed by the hepatic artery even though the pattern was not the same as the typical one for hypervascular HCC (Figure 1).
because HCC is hypervascular and fed by the hepatic artery in contrast to the characteristic hypovascularity of metastatic cancers in the liver. However, AFP-producing gastric cancer has augmented vascularity and there are reports that TAE can be applicable to patients with metastatic AFP-producing gastric cancer to the liver (Kobayashi et al, 1996; Yoshida et al, 2005). Here, we present a case that suggests that repeated TAE and systemic chemotherapy might be effective for controlling hepatic metastasis in AFP-producing gastric cancer.
II. Case Report A 72-year-old man was admitted for epigastric pain with right upper quadrant discomfort to Seoul National University Hospital in October 2006. No abnormal finding was noted upon physical examination. Abdominal computed tomography revealed rim-like contrast enhancement during the arterial phase as well as progressive centripetal enhancement during the portal venous and delay phases (Figure 1). Serologic assays for HBs Ag and HCV Ab yielded negative results. Tumor markers assays revealed an AFP level of 1,100 ng/mL and a CEA level below 1.0 ng/mL, suggestive of HCC, and thus angiography was performed for TAE. Although angiography revealed a hypervascular tumor suggestive of HCC, CT findings were not typical for HCC and the case did not
Figure 1. Initial MDCT images of the abdomen. These images were obtained during (A) the arterial, (B) portal venous and (C) delay phase of dynamic enhancement. There are masses in the both lobes of the liver that demonstrate rim-like contrast enhancement during the arterial phase and progressive centripetal enhancement during the portal venous and delay phases. This prolonged delayed enhancement is not usual for hepatocellular carcinoma.
98
Cancer Therapy Vol 7, page 99
Figure 2. Microphotographs of the biopsy specimens. (A) The gastric biopsy specimen shows well-differentiated adenocarcinoma with hepatoid differentiation (H&E stain, X200). (B) The cancer cells of the gastric biopsy specimen show diffuse strong positivity for AFP, especially in the area showing hepatoid differentiation. (C) However, the cancer cells display absent reactivity to hepatocyte specific antigen. (B&C, Immunohistochemical stain, X400). (D) The liver biopsy specimen shows metastatic adenocarcinoma of which some cancer cells displays moderate positivity for AFP. (Immunohistochemical stain, X200).
Figure 3. Lipiodol CT images after repeated TAE treatments. (A) Baseline CT image before TAE treatments. (B) Lipiodol CT images after the fourth TAE. (C) Lipiodol CT images after the fifth TAE. In comparison with the baseline images, the multicentric lipiodol uptake nodule sizes were decreased with repeated TAE and systemic chemotherapy. (B-upper) After the fourth TAE treatment, partial retention of Lipiodol was observed in the nodule of segment 4 whereas homogeneous retention of Lipiodol was apparent in the nodules of segment 8 and 3. (C-upper) After the fifth TAE treatment, Lipiodol-uptake in the nodule of segment 4 was increased. (C) Shrinkage of normal liver parenchyma was apparent compared with the image before TAE treatment.
99
Ju et al: Repeated Therapeutic Embolization for Hepatic Metastases from !-Fetoprotein-producing Gastric Cancer Abdominal computed tomography (CT) on admission in Gyeongsang National University Hospital revealed that while the size of the smaller nodules (38 metastatic nodules) in the liver were decreased with high compact Lipiodol uptake relative to the initial CT finding, the largest hepatic nodule ( 6.5 X 7.5cm) in the segment 4 were increased with poor Lipiodol uptake after the first TAE and systemic chemotherapy (data not shown). This finding suggested that further selective TAE was needed for the large hepatic nodule in segment 4, and as shown in Figure 3A, repeated TAE was effective in controlling the mass. Under the diagnosis of AFP-producing gastric cancer with liver metastases, combination chemotherapy consisting of 800 mg/m2 capecitabine and 55 mg/m2 cisplatin (dose reduction by 20% due to old age) was continued at 3-week intervals, along with TAE every 6 weeks. An abdominal CT scan performed after 6 cycles of combination chemotherapy and 4 times of TAE revealed that although the previously detected metastatic tumors had shrunk, new metastatic lesions were present. However, the new metastatic lesions were highly impacted by Lipiodol after TAE (Figure 3B-lower). Based on this finding, we posited that while systemic chemotherapy was not effective, TAE was effective. Therefore, we changed the chemotherapy regimen to a combination of TS-1 (60mg bid for 28 days) and cisplatin (65mg/m2) while continuing TAE. Although upon evaluation after the fifth TAE multiple new nodules were apparent, previously detected new metastatic nodules were highly impacted by Lipiodol as evidenced by shrinking (Figure 3Clower). A last TAE with CPT-11 monotherapy was performed in light of the shrinkage of normal parenchyma (Figure 3C). The performance status of patient was ECOG 1 with no symptomatic complaints. During follow-up, pneumonia with sepsis developed and the patient expired. However, the final event of pneumonia with sepsis is not likely to result from TAE and systemic chemotherapy toxicity because of the absence of cytopenia during admission. The time from diagnosis to death is 10 months.
AFP-negative gastric cancer. However, the response rates of both treatments were lower than the response rate (30%-70%) of combination chemotherapy in that study; one of twelve patients (8%) and three of twelve patients (25%) were in partial remission after TAE or TAI, respectively (Tarazov, 2000). These results suggest that combination chemotherapy should be required for the treatment of metastatic gastric cancer. Although a case of metastatic AFP-producing gastric cancer in the liver successfully controlled by TAE followed by TS-1 also supports the necessity of systemic chemotherapy in this disease (Okazaki et al, 2001), it is unclear whether systemic chemotherapy was effective in the case subject of this report because new lesions developed continuously. In the first report on repeated TAE in metastatic AFP-producing gastric cancer in the liver, repeated TAE was successfully performed without combination chemotherapy (Kobayashi et al, 1996). Therefore, further studies are warranted on the need to use both repeated TAE and systemic chemotherapy for AFPproducing gastric cancer; a large randomized trial may not be possible because AFP-producing gastric cancer is rare. Although repeated TAE can control the tumor growth of AFP-producing gastric cancer with liver metastasis, repeated TAE can lead to shrinkage of normal liver parenchyma as seen in Figure 3, a side effect that warrants attention.
Acknowledgments We thank Roberto Pataca for a carefully revision the manuscript. This study was partially supported by the Korean Cancer Research Institute.
III. Discussion
References
AFP-producing gastric cancer is rare and the prognosis is very poor. This case underscores the feasibility of hepatic TAE and combination chemotherapy for the treatment of AFP-producing gastric cancer with liver metastasis. Although some successful cases of hepatic TAE for the management of metastatic AFPproducing gastric cancer in the liver had been reported (Kobayashi et al, 1996; Okazaki et al, 2001; Yoshida et al, 2005), in those cases TAE were performed to stop bleeding from a ruptured tumor mass or as adjuvant treatment before surgery. To my knowledge, this is the first case on repeated TAE with combination chemotherapy in metastatic AFP-producing gastric cancer for the control of inoperable disease, and the second case for repeated TAE for metastatic AFP-producing gastric cancer in the liver (Yoshida et al, 2005). As shown above, success of hepatic TAE in gastric cancer with liver metastasis is favored by the hypervascularity of metastatic lesions with the hepatic artery being the main blood supplier. Although AFPproducing gastric cancer is a hypervascular tumor with active neovascularization, and thus it is theoretically amenable to treatment with hepatic TAE, metastatic AFPnegative gastric cancer in the liver is not as hypervascular, and a retrospective study showed better survival with transarterial infusion (TAI) than with TAE for metastatic
Adachi Y, Tsuchihashi J, Shiraishi N, Yasuda K, Etoh T, Kitano S (2003) AFP-producing gastric carcinoma: multivariate analysis of prognostic factors in 270 patients. Oncology 65, 95-101. Georgiades CS, Hong K, D'Angelo M, Geschwind JF (2005) Safety and efficacy of transarterial chemoembolization in patients with unresectable hepatocellular carcinoma and portal vein thrombosis. J Vasc Interv Radiol 16, 1653-1659. Kobayashi T, Hirose K, Niimoto S, Katayama K, Yamaguchi A, Nakagawara G (1996) Effective transcatheter arterial embolization for hepatic metastasis in a case of AFP producing gastric cancer. Gan To Kagaku Ryoho 23, 17051708. Koide N, Nishio A, Igarashi J, Kajikawa S, Adachi W, Amano J (1999) AFP-producing gastric cancer: histochemical analysis of cell proliferation, apoptosis, and angiogenesis. Am J Gastroenterol 94, 1658-1663. Nakashima T, Okuda K, Kojiro M, Jimi A, Yamaguchi R, Sakamoto K, Ikari T (1983) Pathology of hepatocellular carcinoma in Japan. 232 Consecutive cases autopsied in ten years. Cancer 51, 863-877 Okazaki M, Yamamura J, Kawasaki Y, Ohtsuru M, Kobayakawa K, Yasuda S, Oka H, Yamamura M, Hayashi Y (2001) A case of advanced gastric cancer producing alpha fetoprotein with multiple liver metastases responding to TS-1 after TAE. Gan To Kagaku Ryoho 28, 2073-2077 Taniguchi H, Takahashi T, Sawai K, Yamaguchi T, Hagiwara A, Kitamura K, Hoshima M, Masuyama M, Mugitani T, Takada
100
Cancer Therapy Vol 7, page 101 A, Yamaguchi A (1997) Comparison in survival between hepatic metastases of gastric and colorectal cancer. Hepatogastroenterology 44, 897-900. Tarazov PG (2000) Transcatheter therapy of gastric cancer metastatic to the liver: preliminary results. J Gastroenterol 35, 907-911. Wagner AD, Grothe W, Haerting J, Kleber G, Grothey A, Fleig WE (2006) Chemotherapy in advanced gastric cancer: a systematic review and meta-analysis based on aggregate data. J Clin Oncol 24, 2903-2909. Yoshida H, Mamada Y, Taniai N, Mizuguchi Y, Nakamura Y, Nomura T, Yoshioka M, Kiyama T, Kato S, Nishi K, Naito Z, Akimaru K, Tajiri T (2005) Ruptured metastatic liver tumor from an !-fetoprotein-producing gastric cancer. J Nippon Med Sch 72, 236-240.
Won Sup Lee
101
Ju et al: Repeated Therapeutic Embolization for Hepatic Metastases from !-Fetoprotein-producing Gastric Cancer
102
Cancer Therapy Vol 7, page 103 Cancer Therapy Vol 7, 103-108, 2009
Desmoid tumours therapeutic approach in relation to pathogenesis Research Article
Fernando Brivio1,*, Luca Fumagalli1, Paolo Lissoni2, Franco Rovelli2, Marco Colzani3, Marianna Denova1 1
Department of Surgical Sciences and Intensive Care, III Division of General Surgery, University of Milano Bicocca Department of Oncology, San Gerardo Hospital, Monza, Milan, Italy 3 Surgical Division, Bassini Hospital, Milan, Italy 2
__________________________________________________________________________________ *Correspondence: Dott. Fernando Brivio, Department of Surgery, Ospedale E. Bassini, via M. Gorki 50, 20092 Cinisello Balsamo (Mi), Italy; Tel.: +39-0261725259, Fax: +39-0261725466; e-mail: fernando_brivio@fastwebnet.it Key words: Desmoid tumor surgery, hormone therapy and melatonin Abbreviations: extra-cellular matrix, (MMPs); glycosaminoglycans, (GAG); Transforming Growth Factor !1, (TGF !1) Received: 30 May 2008; Revised: 25 September 2008 Accepted: 22 October 2008; electronically published: February 2009
Summary Desmoid tumour is a rare neoplasm locally invasive characterized from a high incidence of recurrence after surgical removal. Recently has been proven tumour growth pathological mechanism due to abnormal secretion of TGF ! from fibroblasts and TNF from monocytes. This is the first detection of an endocrine immunological alteration involved in tumour development and progression. Probably, it can be considered a paradigm of tumour connective growth also for other solid tumour. We report our successful experience of combined surgical and hormone therapy with toremifene plus melatonin in a casistic of 10 patients observed in the last ten years. Antiestrogens are able to counteract TGF ! production (Locci et al, 2001) and melatonin is proven to reduce TNF secretion (Sacco et al, 1998). In order to the pathological mechanism and the experience reported, we consider hormone combined therapy and surgery the first line no toxic treatment of this rare disease.
represented location is the rectal muscles of abdominal wall where quite frequently the tumour arises after a delivery or abdominal surgery. The incidence is reported as double in woman in respect the male, but the major incidence in female is detected only in juvenile age and in fertile woman, while in old age the incidence of desmoid tumour is the same in both genders (Reitamo et al, 1982, 1986). We believe that is a good thing to consider a distinction among desmoid arising on familial poliposi (Gardner’s Syndrome) and sporadic desmoid tumour. Gardner’s syndrome associate desmoid in 20% of the cases and the highest incidence is in female. The intraabdominal presentation is more frequent in patients (68% of cases) with Gardner’s syndrome, while the muscle of abdominal wall are interested in 14%; minus than 10% are the extra-abdominal localizations (Hansmann et al, 2004). In these patients the treatment of colonic pathology is preponderant in respect that of desmoid tumour. The sporadic desmoid arise more frequently in segmental muscle and intra-abdominal localization is reported only in the 8% of the cases (Reitamo et al, 1982). It is our intention to focalize the attention on sporadic desmoid
I. Introduction Desmoid tumour is histologically benign neoplasm derived from muscoloaponeurotic structures it is also called “aggressive fibromathosis” and this term indicates an aggressive local behaviour even though the apparent benign histological aspects (Poster et al, 1989). This neoplasm is quite rare, but the interest is related to the difficult growth control and the frequency of recurrence after surgical removal. The tumour can from any skeletal muscle to rise, it has an infiltrating local invasion extending to the adjacent muscles and inducing their fibrous degeneration. Fibroblast is the source of desmoid tumour and the local invasion is usually limited to the musculoaponeurotic structures and the covering skin is always normal.
A. Incidence Desmoid represent only the 0.03% of all neoplasm diseases; in literature is reported a prevalence that reaches the 15- 20% in patients with familiar poliposis of the colon, and this fact might be the expression of a common genetic alteration among this two diseases. The more 103
Brivio et al: Desmoid tumors therapy tumour because of the emerging of interesting physiopathological elements related to an alteration of immunoendocrinological homeostasis with interesting consequence on therapeutic approach.
evidence of a relation among immune-endocrine alteration and pathogenesis of a neoplastic disease. It is a recent concept that the desmoid growth is due to an increase of organic extra-cellular matrix rather than a cellular proliferation. The fact remains in the hypothesis that these patients have a lack of metalloproteinase activity of the extra-cellular matrix (MMPs). In practice the connective matrix is the result of a continuous balance between collagen produced and degraded by MMPs. A local increase of MMPs inhibitor called TIMP 1 and TIMP 2 can be the origin of the lack of MMPs activity with consequence collagen accumulation and tumour growth (Balducci et al, 2005). A complete and persuasive mechanism was referred recently (Locci et al, 2001) from an in vitro culture of Fibroblast pulled out from desmoid tumours. These fibroblasts, in vitro, have a major expression of mRNA for Transforming Growth Factor ! 1 (TGF ! 1) and an increasing secretion of this growth factor with strong receptorial affinity in respect to normal fibroblasts (Locci et al, 2001). Furthermore, TGF 1! significantly increase TNF" production by monocytes and desmoid fibroblast are sensitive to it which enhanced glycosaminoglycans (GAG) accumulation. It has been proven that antiestrogen drug Toremifene inhibit the secretion of TGF 1! and has an inhibitory effect on TNF " production by monocytes via an estrogens receptorindependent pathway. This mechanism may explain the therapeutic efficacy of anti-estrogens on this disease frequently reported in literature (Hansmann et al, 2004; Heidemann et al, 2004; Maseelall et al, 2005). In consideration of this physiopathologycal mechanism the main objective of therapy is to counteract TGF 1! and TNF production. If it has been demonstrated that antiestrogens therapy namely toramifene is able to inhibit TGF 1! secretion from desmoid fibroblasts, we believe that is possible to associate a therapy with pineal hormone melatonin which has been proven to inhibit TNF accumulation and function in vitro and in vivo without any side effects (Sacco et al, 1998).
B. Location of desmoid tumours 1. Muscles of abdominal wall This location has high frequency in sporadic desmoid (49%) (Reitamo et al, 1982). often there is relation among the tumour development and previous abdominal surgery: in these cases the tumour occurs in the scar site and arises generally within four years from the previous surgery (Reitamo et al, 1986). Female gender and fertile age are typical of this location. It is possible to see the tumour development after a pregnancy and isn’t rare to detect tumour regression in menopausal; and this fact can induce to believe that there is an important relation between tumour growth and hormonal conditions (Reitamo et al, 1982, 1986; Hansmann et al, 2004).
2. Extra-abdominal muscles Represent the 43% of all desmoids tumour (Reitamo et al, 1982). Preferred site is the shoulder and upper limb even if it is possible to find origin from every muscle of the limbs and trunk. The retroperitoneal location is not rare presentation and takes origin from Psoas muscle or loin’s squared muscles. The difference between desmoids and retroperitoneal fibrosis (Ormond’s disease) is the bulky mass with a thickness greater than 3 cm. and the late uretheral compression with consequent hydronephrosis in patients with desmoid tumour. The extra-abdominal locations are the same in both the gender, generally the relations with previous scars is less evident than in abdominal desmoids, and have a high risk of local recurrence after surgical removal. Plural locations are rare and generally limited in the same body district (Reitamo et al, 1986).
3. Intra abdominal Desmoid tumours In terms of diagnosis and treatment is the most problematic location. Intra-abdominal desmoids represent only the 8% of all desmoids tumours. The growth is asymptomatic and sneaky. The symptoms are late and generally due to bowel’s compression with unexplained weight loss. The T.C. scan imaging is able to detect an intra-abdominal mass poorly vascularised, but it’s very difficult to suppose a correct diagnosis that it’s possible only after histological examination. Frequently the tumour is discovered incidentally during ultrasonography examination or CT scan performed for other pathologies.
II. Patients and methods The aim of this presentation is to refer about 10 cases observed in our surgical department in San Gerardo Hospital Monza in order to evaluate the results of combined surgical and hormone therapy. A general consideration about the clinical results in relation to tumour’s biology is important to formulate a general behaviour in treating of this pathology mainly in order to the anatomical site. In the last fifteen years 10 desmoid tumour has been observed in our surgical department. Eight of them were treated surgically. One patient with bulky retroperitoneal desmoid arrived at our observation in decline status and died for bowel occlusion by compression due to the tumour. No effective treatment was administered. A second retroperitoneal bulky inoperable desmoid tumour (Figure 1 and Figure 2) was treated with Toremifene (60 mg orally daily) and melatonin (10 mg orally in the evening) for more than ten years: the combined therapy was able to induce a tumour regression and stabilization. This patient died for colon cancer without evidence of evolution of desmoid tumour. The complete casuistic is reported in Table 1. Eight patients underwent to surgical procedure, four of them due to mesenteric desmoid tumours, two tumours localized
C. Pathogenesis of sporadic desmoid A relation between estrogens hormones and desmoids is supposed by many years in relation to the fact that in fertile woman the tumour grew three or four times faster than in male patients, and there are many clinical report of the effective response to anti-estrogens therapy in literature (Reitamo et al, 1986; Hansmann et al, 2004). The well documented knowledge of pathogenesis of Desmoids tumour is quite recent and represents an
104
Cancer Therapy Vol 7, page 105 on abdominal wall, one extra-abdominal site and the last patient with a bulky retroperitoneal localization died in post-operative course for surgical complications.
B. Abdominal desmoid tumour A fertile woman with tumour arising from rectal abdominal muscle was successfully treated with surgical removal without any adjuvant therapy. A young male, 22 years old surgically treated for an abdominal desmoid of rectal muscle returned nine months later with bulky recurrence. After a second operation requiring a complete removal of rectal muscle and fascia and reconstruction with polypropylene prosthesis was treated successfully with toremifene and melatonin for five years.
A. Mesenteric desmoid tumour All four patients underwent surgery for abdominal mass requiring in two cases ileal resection, one transverse colon resection (Figure 3 and Figure 4) and one distal pancreatosplenctomy. In two cases the tumour discovery was incidentally in the other two patients was symptomatic with ileal obstruction. All these patients were treated with antiestrogens therapy plus melatonin 10 mg orally in the evening for five years. Follow-up was performed with clinical examination and ultrasonography every six months and C.T. scan annually. No recurrence was detected in these four patients.
C. Extra-abdominal desmoids The last patient, male 45 years old, affected from desmoid tumour of thorax wall had early recurrence after surgery with fast asymptomatic growth. After a second radical operation was treated with adjuvant therapy consisting of toramifene and melatonin for five years without any further recurrence. The therapy was interrupted after five years and patients remained free from disease.
Figure 1. Retroperitoneal bulky Desmoid. Tumour growth stopped with hormone therapy by toremifene and melatonin.
Figure 2. Histological aspect of retroperitoneal desmoid.
105
Brivio et al: Desmoid tumors therapy Table 1. Casistic and primary treatment of desmoid tumours. Patient
age
sex
tumour site
Surgery
Hormone therapy
Outcome
1
57
M
Retroperitoneum
No
no
exitus
2
65
M
Retroperitoneum
No
Toramifene + MLT
disease control
3
21
M
Abdominal Wall
Yes
no
Recurrence*
4
56
M
Thorax Wall
Yes
no
Recurrence*
5
57
M
Mesenteric desmoid
yes
Toremifene + MLT
Free from disease
6
37
F
Abdominal wall
Yes
no
Free from Disease
7
61
F
Mesenteric desmoid
Yes
TAM + MLT
Free from Disease
8
58
F
Retroperitoneum
Yes
no
exitus
9
23
M
Mesenteric desmoid
Yes
Tormifene + MLT
Free from disease
10
63
M
Mesenteric Desmoid
Yes
Toremifene + MLT
Free from disease
* Second operation and adjuvant hormone therapy. No further recurrence.
Figure 3. TC scan of mesenteric desmoid tumour.
Figure 4. Mesenteric Desmoid Tumour arising in transverse colon mesentery (the same case of TC scan). Successful of surgical ablation plus hormone adjuvant therapy.
106
Cancer Therapy Vol 7, page 107 Heidemann J, Ogawa H, Otterson MF,Shidham VB, Binion DG (2004) Angiogenic treatment of mesenteric desmoid tumor with toremifene and interferon "-2b report of two cases. Dis Colon Rectum 47, 118-122. Locci P, Bellocchio S, Lilli C, Marinucci L, Cagini L, baroni T, Giustozzi G, balducci C, Becchetti E (2001) Synthesis and secretion of transforming growth factor-! in desmoid fibroblast cell line and its modulation by toremifene. J Interferon Cyt Res 21, 961-970. Maseelall P, Robins JC, Williams DB,Thomas MA (2005) Stabilization and regression of a recurrent desmoid tumor with antiestrogen toremifene. Fertil Steril 84, 2. Poster MC, Shiu MH, Newsome L, Haidu SI, Gaynor JJ, Brennan MF (1989) The desmoid tumor. Not a benign disease. Arch Surg 124, 191-196. Reitamo JJ, H채yry P, Nykyri E, Saxen E (1982) The desmoid tumor. Incidence, sex and anatomical distribution in the Finnisch Population. Am Soc Clin Path 77, 665-673. Reitamo JJ, Scheinin T M. H채yry P (1986) The desmoid Syndrome. New aspects in the cause, Phatogenesis and treatment of desmoid tumor. Am J Surg 151, 230-237. Sacco S, Aquilini L, Ghezzi P, Pinza M, Guglielmotti A (1998) Mechanism of inhibitory effect of melatonin on tumor necrosis factor production in vivo and in vitro. Eur J Pharmacol 343, 249-255.
III. Discussion Desmoids tumour represents the first neoplastic disease in which the pathophisiological evolution is attested. The over-production of TGF ! from fibroblasts and TNF from monocytes is the source of glycosaminoglycans (GAG) production and accumulation with consequent tumour growth. Anti- estrogens is able to counteract TGF ! production and melatonin has an inhibitory effect on TNF production in vitro and in vivo (Sacco et al, 1998). In our experience the combination therapy with toramifene (60 mg daily) and melatonin (10 mg in the evening) had showed to be an effective therapy, without any side effects, able to counteract tumour growth and preventing recurrence after surgical removal. We consider this combined therapy the first line therapy for inoperable retroperitoneal desmoid tumours. Antiestrogens therapy plus melatonin can be considered useful to prevent recurrence after surgery for mesenteric desmoids and is recommended after a second surgical approach for recurrence in abdominal and extra abdominal desmoid tumours. In our experience the combined therapies were administered for three years without showing adverse side effects. Chemotherapy and radiotherapy are empiric approach without phyisiopathological evidence and their clinical use must be restricted in case of hormone therapy failure. On the other hand, since efficacy of anti-estrogens therapy seems to be not related to an estrogens- receptor mechanism, drugs as aromatase inhibitor or fulvestrant can be tested in second line therapy before appeal to chemotherapeutics drugs.
References Balducci C, Lilli C, Stabellini G, Marinucci L, Giustozzi G, Becchetti A, Cagini L, Locci P (2005) Human desmoid fibroblastsmatrix metalloproteinases, their inhibitors and modulation by toremifene. BMC Cancer 5, 22 Brooks MD, Ebbs SR, Colletta AA, Baum M (1992) Desmoid tumours treated with trohenylethylenes. Eur J Cancer 28, 1014-1018. Hansmann A, Adolph C, Vogel Y, Unger A, Moeslein G (2004) High-dose tamoxifen and sulindac as first-line treatment for desmoid tumors. Cancer 100, 39612-620.
Fernando Brivio
107
Brivio et al: Desmoid tumors therapy
108
Cancer Therapy Vol 7, page 103 Cancer Therapy Vol 7, 103-108, 2009
Desmoid tumours therapeutic approach in relation to pathogenesis Research Article
Fernando Brivio1,*, Luca Fumagalli1, Paolo Lissoni2, Franco Rovelli2, Marco Colzani3, Marianna Denova1 1
Department of Surgical Sciences and Intensive Care, III Division of General Surgery, University of Milano Bicocca Department of Oncology, San Gerardo Hospital, Monza, Milan, Italy 3 Surgical Division, Bassini Hospital, Milan, Italy 2
__________________________________________________________________________________ *Correspondence: Dott. Fernando Brivio, Department of Surgery, Ospedale E. Bassini, via M. Gorki 50, 20092 Cinisello Balsamo (Mi), Italy; Tel.: +39-0261725259, Fax: +39-0261725466; e-mail: fernando_brivio@fastwebnet.it Key words: Desmoid tumor surgery, hormone therapy and melatonin Abbreviations: extra-cellular matrix, (MMPs); glycosaminoglycans, (GAG); Transforming Growth Factor !1, (TGF !1) Received: 30 May 2008; Revised: 25 September 2008 Accepted: 22 October 2008; electronically published: February 2009
Summary Desmoid tumour is a rare neoplasm locally invasive characterized from a high incidence of recurrence after surgical removal. Recently has been proven tumour growth pathological mechanism due to abnormal secretion of TGF ! from fibroblasts and TNF from monocytes. This is the first detection of an endocrine immunological alteration involved in tumour development and progression. Probably, it can be considered a paradigm of tumour connective growth also for other solid tumour. We report our successful experience of combined surgical and hormone therapy with toremifene plus melatonin in a casistic of 10 patients observed in the last ten years. Antiestrogens are able to counteract TGF ! production (Locci et al, 2001) and melatonin is proven to reduce TNF secretion (Sacco et al, 1998). In order to the pathological mechanism and the experience reported, we consider hormone combined therapy and surgery the first line no toxic treatment of this rare disease.
represented location is the rectal muscles of abdominal wall where quite frequently the tumour arises after a delivery or abdominal surgery. The incidence is reported as double in woman in respect the male, but the major incidence in female is detected only in juvenile age and in fertile woman, while in old age the incidence of desmoid tumour is the same in both genders (Reitamo et al, 1982, 1986). We believe that is a good thing to consider a distinction among desmoid arising on familial poliposi (Gardner’s Syndrome) and sporadic desmoid tumour. Gardner’s syndrome associate desmoid in 20% of the cases and the highest incidence is in female. The intraabdominal presentation is more frequent in patients (68% of cases) with Gardner’s syndrome, while the muscle of abdominal wall are interested in 14%; minus than 10% are the extra-abdominal localizations (Hansmann et al, 2004). In these patients the treatment of colonic pathology is preponderant in respect that of desmoid tumour. The sporadic desmoid arise more frequently in segmental muscle and intra-abdominal localization is reported only in the 8% of the cases (Reitamo et al, 1982). It is our intention to focalize the attention on sporadic desmoid
I. Introduction Desmoid tumour is histologically benign neoplasm derived from muscoloaponeurotic structures it is also called “aggressive fibromathosis” and this term indicates an aggressive local behaviour even though the apparent benign histological aspects (Poster et al, 1989). This neoplasm is quite rare, but the interest is related to the difficult growth control and the frequency of recurrence after surgical removal. The tumour can from any skeletal muscle to rise, it has an infiltrating local invasion extending to the adjacent muscles and inducing their fibrous degeneration. Fibroblast is the source of desmoid tumour and the local invasion is usually limited to the musculoaponeurotic structures and the covering skin is always normal.
A. Incidence Desmoid represent only the 0.03% of all neoplasm diseases; in literature is reported a prevalence that reaches the 15- 20% in patients with familiar poliposis of the colon, and this fact might be the expression of a common genetic alteration among this two diseases. The more 103
Brivio et al: Desmoid tumors therapy tumour because of the emerging of interesting physiopathological elements related to an alteration of immunoendocrinological homeostasis with interesting consequence on therapeutic approach.
evidence of a relation among immune-endocrine alteration and pathogenesis of a neoplastic disease. It is a recent concept that the desmoid growth is due to an increase of organic extra-cellular matrix rather than a cellular proliferation. The fact remains in the hypothesis that these patients have a lack of metalloproteinase activity of the extra-cellular matrix (MMPs). In practice the connective matrix is the result of a continuous balance between collagen produced and degraded by MMPs. A local increase of MMPs inhibitor called TIMP 1 and TIMP 2 can be the origin of the lack of MMPs activity with consequence collagen accumulation and tumour growth (Balducci et al, 2005). A complete and persuasive mechanism was referred recently (Locci et al, 2001) from an in vitro culture of Fibroblast pulled out from desmoid tumours. These fibroblasts, in vitro, have a major expression of mRNA for Transforming Growth Factor ! 1 (TGF ! 1) and an increasing secretion of this growth factor with strong receptorial affinity in respect to normal fibroblasts (Locci et al, 2001). Furthermore, TGF 1! significantly increase TNF" production by monocytes and desmoid fibroblast are sensitive to it which enhanced glycosaminoglycans (GAG) accumulation. It has been proven that antiestrogen drug Toremifene inhibit the secretion of TGF 1! and has an inhibitory effect on TNF " production by monocytes via an estrogens receptorindependent pathway. This mechanism may explain the therapeutic efficacy of anti-estrogens on this disease frequently reported in literature (Hansmann et al, 2004; Heidemann et al, 2004; Maseelall et al, 2005). In consideration of this physiopathologycal mechanism the main objective of therapy is to counteract TGF 1! and TNF production. If it has been demonstrated that antiestrogens therapy namely toramifene is able to inhibit TGF 1! secretion from desmoid fibroblasts, we believe that is possible to associate a therapy with pineal hormone melatonin which has been proven to inhibit TNF accumulation and function in vitro and in vivo without any side effects (Sacco et al, 1998).
B. Location of desmoid tumours 1. Muscles of abdominal wall This location has high frequency in sporadic desmoid (49%) (Reitamo et al, 1982). often there is relation among the tumour development and previous abdominal surgery: in these cases the tumour occurs in the scar site and arises generally within four years from the previous surgery (Reitamo et al, 1986). Female gender and fertile age are typical of this location. It is possible to see the tumour development after a pregnancy and isn’t rare to detect tumour regression in menopausal; and this fact can induce to believe that there is an important relation between tumour growth and hormonal conditions (Reitamo et al, 1982, 1986; Hansmann et al, 2004).
2. Extra-abdominal muscles Represent the 43% of all desmoids tumour (Reitamo et al, 1982). Preferred site is the shoulder and upper limb even if it is possible to find origin from every muscle of the limbs and trunk. The retroperitoneal location is not rare presentation and takes origin from Psoas muscle or loin’s squared muscles. The difference between desmoids and retroperitoneal fibrosis (Ormond’s disease) is the bulky mass with a thickness greater than 3 cm. and the late uretheral compression with consequent hydronephrosis in patients with desmoid tumour. The extra-abdominal locations are the same in both the gender, generally the relations with previous scars is less evident than in abdominal desmoids, and have a high risk of local recurrence after surgical removal. Plural locations are rare and generally limited in the same body district (Reitamo et al, 1986).
3. Intra abdominal Desmoid tumours In terms of diagnosis and treatment is the most problematic location. Intra-abdominal desmoids represent only the 8% of all desmoids tumours. The growth is asymptomatic and sneaky. The symptoms are late and generally due to bowel’s compression with unexplained weight loss. The T.C. scan imaging is able to detect an intra-abdominal mass poorly vascularised, but it’s very difficult to suppose a correct diagnosis that it’s possible only after histological examination. Frequently the tumour is discovered incidentally during ultrasonography examination or CT scan performed for other pathologies.
II. Patients and methods The aim of this presentation is to refer about 10 cases observed in our surgical department in San Gerardo Hospital Monza in order to evaluate the results of combined surgical and hormone therapy. A general consideration about the clinical results in relation to tumour’s biology is important to formulate a general behaviour in treating of this pathology mainly in order to the anatomical site. In the last fifteen years 10 desmoid tumour has been observed in our surgical department. Eight of them were treated surgically. One patient with bulky retroperitoneal desmoid arrived at our observation in decline status and died for bowel occlusion by compression due to the tumour. No effective treatment was administered. A second retroperitoneal bulky inoperable desmoid tumour (Figure 1 and Figure 2) was treated with Toremifene (60 mg orally daily) and melatonin (10 mg orally in the evening) for more than ten years: the combined therapy was able to induce a tumour regression and stabilization. This patient died for colon cancer without evidence of evolution of desmoid tumour. The complete casuistic is reported in Table 1. Eight patients underwent to surgical procedure, four of them due to mesenteric desmoid tumours, two tumours localized
C. Pathogenesis of sporadic desmoid A relation between estrogens hormones and desmoids is supposed by many years in relation to the fact that in fertile woman the tumour grew three or four times faster than in male patients, and there are many clinical report of the effective response to anti-estrogens therapy in literature (Reitamo et al, 1986; Hansmann et al, 2004). The well documented knowledge of pathogenesis of Desmoids tumour is quite recent and represents an
104
Cancer Therapy Vol 7, page 105 on abdominal wall, one extra-abdominal site and the last patient with a bulky retroperitoneal localization died in post-operative course for surgical complications.
B. Abdominal desmoid tumour A fertile woman with tumour arising from rectal abdominal muscle was successfully treated with surgical removal without any adjuvant therapy. A young male, 22 years old surgically treated for an abdominal desmoid of rectal muscle returned nine months later with bulky recurrence. After a second operation requiring a complete removal of rectal muscle and fascia and reconstruction with polypropylene prosthesis was treated successfully with toremifene and melatonin for five years.
A. Mesenteric desmoid tumour All four patients underwent surgery for abdominal mass requiring in two cases ileal resection, one transverse colon resection (Figure 3 and Figure 4) and one distal pancreatosplenctomy. In two cases the tumour discovery was incidentally in the other two patients was symptomatic with ileal obstruction. All these patients were treated with antiestrogens therapy plus melatonin 10 mg orally in the evening for five years. Follow-up was performed with clinical examination and ultrasonography every six months and C.T. scan annually. No recurrence was detected in these four patients.
C. Extra-abdominal desmoids The last patient, male 45 years old, affected from desmoid tumour of thorax wall had early recurrence after surgery with fast asymptomatic growth. After a second radical operation was treated with adjuvant therapy consisting of toramifene and melatonin for five years without any further recurrence. The therapy was interrupted after five years and patients remained free from disease.
Figure 1. Retroperitoneal bulky Desmoid. Tumour growth stopped with hormone therapy by toremifene and melatonin.
Figure 2. Histological aspect of retroperitoneal desmoid.
105
Brivio et al: Desmoid tumors therapy Table 1. Casistic and primary treatment of desmoid tumours. Patient
age
sex
tumour site
Surgery
Hormone therapy
Outcome
1
57
M
Retroperitoneum
No
no
exitus
2
65
M
Retroperitoneum
No
Toramifene + MLT
disease control
3
21
M
Abdominal Wall
Yes
no
Recurrence*
4
56
M
Thorax Wall
Yes
no
Recurrence*
5
57
M
Mesenteric desmoid
yes
Toremifene + MLT
Free from disease
6
37
F
Abdominal wall
Yes
no
Free from Disease
7
61
F
Mesenteric desmoid
Yes
TAM + MLT
Free from Disease
8
58
F
Retroperitoneum
Yes
no
exitus
9
23
M
Mesenteric desmoid
Yes
Tormifene + MLT
Free from disease
10
63
M
Mesenteric Desmoid
Yes
Toremifene + MLT
Free from disease
* Second operation and adjuvant hormone therapy. No further recurrence.
Figure 3. TC scan of mesenteric desmoid tumour.
Figure 4. Mesenteric Desmoid Tumour arising in transverse colon mesentery (the same case of TC scan). Successful of surgical ablation plus hormone adjuvant therapy.
106
Cancer Therapy Vol 7, page 107 Heidemann J, Ogawa H, Otterson MF,Shidham VB, Binion DG (2004) Angiogenic treatment of mesenteric desmoid tumor with toremifene and interferon "-2b report of two cases. Dis Colon Rectum 47, 118-122. Locci P, Bellocchio S, Lilli C, Marinucci L, Cagini L, baroni T, Giustozzi G, balducci C, Becchetti E (2001) Synthesis and secretion of transforming growth factor-! in desmoid fibroblast cell line and its modulation by toremifene. J Interferon Cyt Res 21, 961-970. Maseelall P, Robins JC, Williams DB,Thomas MA (2005) Stabilization and regression of a recurrent desmoid tumor with antiestrogen toremifene. Fertil Steril 84, 2. Poster MC, Shiu MH, Newsome L, Haidu SI, Gaynor JJ, Brennan MF (1989) The desmoid tumor. Not a benign disease. Arch Surg 124, 191-196. Reitamo JJ, H채yry P, Nykyri E, Saxen E (1982) The desmoid tumor. Incidence, sex and anatomical distribution in the Finnisch Population. Am Soc Clin Path 77, 665-673. Reitamo JJ, Scheinin T M. H채yry P (1986) The desmoid Syndrome. New aspects in the cause, Phatogenesis and treatment of desmoid tumor. Am J Surg 151, 230-237. Sacco S, Aquilini L, Ghezzi P, Pinza M, Guglielmotti A (1998) Mechanism of inhibitory effect of melatonin on tumor necrosis factor production in vivo and in vitro. Eur J Pharmacol 343, 249-255.
III. Discussion Desmoids tumour represents the first neoplastic disease in which the pathophisiological evolution is attested. The over-production of TGF ! from fibroblasts and TNF from monocytes is the source of glycosaminoglycans (GAG) production and accumulation with consequent tumour growth. Anti- estrogens is able to counteract TGF ! production and melatonin has an inhibitory effect on TNF production in vitro and in vivo (Sacco et al, 1998). In our experience the combination therapy with toramifene (60 mg daily) and melatonin (10 mg in the evening) had showed to be an effective therapy, without any side effects, able to counteract tumour growth and preventing recurrence after surgical removal. We consider this combined therapy the first line therapy for inoperable retroperitoneal desmoid tumours. Antiestrogens therapy plus melatonin can be considered useful to prevent recurrence after surgery for mesenteric desmoids and is recommended after a second surgical approach for recurrence in abdominal and extra abdominal desmoid tumours. In our experience the combined therapies were administered for three years without showing adverse side effects. Chemotherapy and radiotherapy are empiric approach without phyisiopathological evidence and their clinical use must be restricted in case of hormone therapy failure. On the other hand, since efficacy of anti-estrogens therapy seems to be not related to an estrogens- receptor mechanism, drugs as aromatase inhibitor or fulvestrant can be tested in second line therapy before appeal to chemotherapeutics drugs.
References Balducci C, Lilli C, Stabellini G, Marinucci L, Giustozzi G, Becchetti A, Cagini L, Locci P (2005) Human desmoid fibroblastsmatrix metalloproteinases, their inhibitors and modulation by toremifene. BMC Cancer 5, 22 Brooks MD, Ebbs SR, Colletta AA, Baum M (1992) Desmoid tumours treated with trohenylethylenes. Eur J Cancer 28, 1014-1018. Hansmann A, Adolph C, Vogel Y, Unger A, Moeslein G (2004) High-dose tamoxifen and sulindac as first-line treatment for desmoid tumors. Cancer 100, 39612-620.
Fernando Brivio
107
Brivio et al: Desmoid tumors therapy
108
Cancer Therapy Vol 7, page 109 Cancer Therapy Vol 7, 109-112, 2009
Follicular lymphoma resembling with Hyalinevascular type of Castleman’s disease. The morphological and immunohistochemical findings of two cases Case Report
Masaru Kojima1, Shinji Sakurai2, Atsushi Isoda3, Norihumi Tsukamoto4, Nobuhide Masawa5, Naoya Nakamura6 1
Department of Pathology and Clinical Laboratories, Gunma Cancer Center Hospital, Ohta, Japan Department of Tumor Pathology, Graduate School of Medicine, Gunma University Maebashi, Japan 3 Department of Hematology, National Nishigunma Hospital, Shibukawa, Japan 4 Department of Medicine and Clinical Science, Gunma University School of Medicine, Maebashi, Japan 5 Department of Diagnostic and Anatomic Pathology, Dokkyo Medical University School of Medicine, Mibu, Japan 6 Department of Pathology, Tokai University School of Medicine, Isehara, Japan 2
__________________________________________________________________________________ *Correspondence: Masaru Kojima, M D, Department of Pathology and Clinical Laboratories, Gunma Cancer Center Hospital, 617-1, Takabayashinishi-cho Ohta, 373-8550, Japan; Tel: +81-276-38-0771; Fax:+81-276-38-8386; e-mail:mkojima@gunma-cc.jp Key words: Follicular lymphoma/Castleman’ disease/hyaline-vascular type/immunohistochemistry Abbreviations: Castleman’s disease, (CD); cyclophosphamide, doxorubicin, vincristine, prednisone, (CHOP); follicular dendritic cells, (FDCs); follicular lymphoma, (FL); hematoxylin-eosin, (HE); hyaline-vascular, (HV); immunoglobulin heavy-chain, (IgH); polymerase chain reaction, (PCR)
Received: 3 December 2008; Revised: 12 February 2009 Accepted: 24 February 2009; electronically published: February 2009
Summary The neoplastic follicles of follicular lymphoma may rarely showed a concentric arrangement and penetration by hyalinized vessels that mimics Castleman’s disease of hyaline-vascular type. We report here two such cases. Majority of the lymphoid follicles had relatively small germinal centers and were occasionally penetrated by small vessels Moreover, few germinal centers had inconspicuous vascularity and were characterized by a predominance of follicular dendritic cells with enlarged nuclei and conspicuous nucleoli and resembling so called “epithelioid germinal centers”. Both lesions demonstrated a germ line bands on polymerase chain reaction assay for the immunoglobulin heavy chain gene. Moreover, the neplastic follicles were bcl-2- in one case. However, the expression of CD10 and Bcl-6 was seen in both the follicular and interfollicular areas in both lesions. Moreover, cytogenetic analyses demonstrated that one contained a characteristic translocation involving in the long arm of chromosomes 14 and 18, t(14;18)(q32;q21) in nine of 20 cells. Immunostaining for CD10 and bcl-6 and cytogenetic study confirmed neoplastic follicular center cell nature of both lesions.
I. Introduction
II. Case report A. Case 1
Morphological spectrum of follicular lymphoma (FL) demonstrated marked morphological varieties. The neoplastic follicles may rarely showed a concentric arrangement and penetration by hyalinized vessels that mimics Castleman’s disease (CD) of hyaline-vascular (HV) type (Keller et al, 1972; Warnke et al, 1995; Nozawa et al, 2002). We report here, two such cases.
A 53-year-old Japanese female presented with a 10-month history of swelling in the left submandibular region. Biopsy of the enlarged lymph nodes showed non-Hodgkin’s lymphoma and staging demonstrated widespread lymphadenopathy (stage IVA). She was administered Rituximab+ CHOP (cyclophosphamide, doxorubicin, vincristine, prednisone) therapy and is currently alive without disease 10 month after the onset of disease.
109
Kojima et al: Follicular lymphoma
B. Case 2
Cytogenetic analyses demonstrated that Case 1 contained a characteristic translocation involving in the long arm of chromosomes 14 and 18, t(14;18)(q32;q21) in nine of 20 cells. Genotypic studies with IgH probes demonstrated a germ line bands in both cases.
A 75-year-old Japanese female presented with systemic lymphadenopathy. Biopsy of the enlarged lymph nodes showed non-Hodgkin’s lymphoma and staging demonstrated widespread lymphadenopathy (stage IIIA). She was administered Rituximab+CHOP therapy and is currently alive without disease 10 month after the onset of disease.
V. Discussion
III. Material and Methods
An unusual histological variant of follicular lymphoma resembling CD is extremely rare in the previously reported variants (Warnke et al, 1995; Nozawa et al, 2002). Such cases can be distinguished from CD of HV type with a richer B-lymphocytes in the germinal centers, and the presence in other areas of more typical histological findings of follicular lymphoma. In problematic cases, immunohistological and genotypic studies are needed to clarify the diagnosis (Warnke et al, 1995). However, there were monotypic intracytoplasmic immunoglobulins in either lesion. Moreover, the tumor cells from Case 2 was bcl-2-(Wang et al, 1995). Dogan and colleagues reported in 2000 that in follicular lymphoma, the expression of CD10 and Bcl-6 was seen in both the follicular and interfollicular areas, whereas in follicular hyperplasia, CD10 and BCL-6 were expressed almost exclusively by the follicular center cells (Dogan et al, 2000). Immunostaining for CD10 and bcl-6 and cytogenetic study confirmed neoplastic follicular center cell nature of both lesions (Dogan et al, 2000). Interestingly, both lesions contained “epithelioid germinal centers”, which is one of the characteristic findings of multicentric CD (Frizzera et al, 1983, 2000; Weisenberger, 1985). Histologically, a portion of the multicentric CD demonstrated HV type (Weisenberger, 1985). Moreover, both cases showed multicentric lymphadenopathy. However, there was no clinical findings characteristic of multicentric CD, such as systemic symptoms, hepatosplenomegaly, polyclonal hyperimmunoglobulinemia and positivity for autoantibodies (Frizzera et al, 1983, 2000; Weisenberger, 1985). CD23 immunostain demonstrated that FDC networks of some of the neoplastic lymphoid follicles showed a tight/concentric pattern which is characteristic FDC findings of HV CD, as previously reported by Nugyen and colleagues in 1994. Both lesions demonstrated a germ line bands on PCR assay for the IgH gene. It has been said that there is a false negative rate on the PCR technique of 10-40% (Segal, 1996; Chan, 2007). The false negative rate is higher for germinal center and post germinal center B-cell neoplasms (such as follicular lymphoma and extranodal marginal zone B-cell lymphoma of mucosa-associated lymphoid tissue type) because the rearranged immunoglobulin genes somatic hypermutations (Segal, 1996; Chan, 2007). The false negativity of IgH gene rearrangement appears that both lesions are follicular lymphoma.
The tissue specimens were fixed in formalin solution, routinely processed and embedded in paraffin. For light microscopic examination, the sections were stained with hematoxylin-eosin (HE). Immunohistochemical studies were performed using the Ventana automated (BenchMarkTM) stainer according to the manufacturer's instructions. The panel of antibodies included human immunoglobulin light chains (! and ") (Novocastra, Newcastle, UK) , PS-1 (CD3; Immunotech, Marseille, France), 4C7 (CD5; Novocastra), 56C6 (CD10; Novocastra), L26 (CD20; Dako A/S, Glostrup, Denmark), 1B12 (CD 23; Novocastra), SP-4 (Cyclin D1; Nichirei Co., Tokyo, Japan), 124 (bcl-2; Dako) and polyclonal bcl-6 (Dako). Sections with known reactivity for the antibodies assayed served as positive controls and the sections treated with normal rabbit- and mouse serum served as negative controls. Paraffin-embedded tissues from the operatively resected specimen were prepared for polymerase chain reaction (PCR), and the rearranged immunoglobulin heavy-chain (IgH) genes were amplified using the seminested PCR method as described by Wan and colleagues in 1990.
IV. Results Both cases showed essentially similar histological findings. The lymphoid follicles were well separated and not closely packed (Figure 1A). They had also well defined mantle zone, but a few tingible body macrophages and mitotic figures. Majority of the lymphoid follicles had relatively small germinal centers and were occasionally penetrated by small vessels (Figure 1B). Moreover, few germinal centers had inconspicuous vascularity and were characterized by a predominance of follicular dendritic cells (FDCs) with enlarged nuclei and conspicuous nucleoli and resembling so called “epithelioid germinal centers” described by Frizzera and colleagues in 1983 (Figure 1C). The germinal center cells composed of small cleaved cells and large non-cleaved cells (Figure 1B, C). The lymphoid follicles were extended into the perinodal tissue in both cases. On HE-stained section, FL resembling CD was suspected. The germinal center cells were CD3-, CD5-, CD10+, CD20+, CD23-, CD43-, Cyclin D1-, bcl-6+(Figure 1D) and intracytoplasmic immunoglobuline-. The germinal center cells expressed bcl-2 in Case 1 (Figure 1E) whereas, the germinal center cells in Case 2 were bcl-2-. However, numerous CD10+, Bcl-6+ medium- to large Bcells were found in both the follicular and interfollicular area (Figure 1D). CD23 immunostain demonstrated that FDC networks showed a tight/concentric pattern in neoplastic follicles resembling HV and epithelioid germinal centers (Figure 1F).
110
Cancer Therapy Vol 7, page 111
Figure1. (A) The lymphoid follicles were well separated and not closely packed. Some of the lymphoid follicles had relatively small germinal centers. Case 1. HEx25. (B) Note a small germinal center penetrated by small vessels. The germinal center cells composed of small cleaved cells and large non-cleaved cells. Case1. HEx100. (C) Note a germinal center had inconspicuous vascularity and were characterized by a predominance of follicular dendritic cells with enlarged nuclei and conspicuous nucleoli (arrows). Case 2 HEx100. (D) Numerous bcl-6+ medium- to large lymphoid cells were seen in the interfollicular area as well as in the germinal center. Case 2 x50. (E) The neoplastic germinal center cells were bcl-2+ Case 1x50. (F) CD23 inmmunostain demonstrated a tight/concentric pattern of the follicular dendritic cell network in a epithelioid germinal center. Case 2 x50.
111
Kojima et al: Follicular lymphoma Nozawa Y, Hirao M, Kamimura K, Hara Y, Abe M (2002) Unusual case of follicular lymphoma with hyaline vascular follicles. Pathology International 52, 794-795. Segal GH (1996) Assessment of B-cell clonality by polymerase chain reaction: a pragmatic overview. Adv Anat Pathol 3, 195-203. Wan JH, Trainor KJ, Brisco MJ, Morley AA (1990) Monoclonality in B cell lymphoma detected in paraffin wax embedded sections using the polymerase chain reaction. J Clin Pathol 43, 888-890. Wang T, Lasota J, Hanau CA, Miettinen M (1995) Bcl-2 oncoprotein is widespread in lymphoid tissue and lymphoma but its different expression in benign versus malignant follicles and monocytoid B-cell proliferation is of diagnostic value. APMIS 103, 655-662. Warnke RF, Weiss LM, Chan JKC, Clearre ML, Dorfman RF (1995) Tumor of the lymph nodes and spleen (Atlas of tumor pathology, 3rd series, fascicle 14). Armed Forces Institute of Pathology, Bethesda MD
References Chan JKC (2007) Tumor of the lymphoreticular syspem. Part A. The lymph node. In: Fletcher CDM (ed) Diagnostic histopathology of tumor, 3rd edn. Elsevier, Philadelphia, PA, pp 1139-1288. Dogan A, Bagdi E, Munson P, Isaacson PG (2000) CD10 and BCL-6 expression in paraffin sections of normal lymphoid tissue and B-cell lymphomas. Am J Surg Pathol 24, 846852. Frizzera G (2000) Atypical lymphoproliferative disorders. In: Knowles DM (ed). Neoplastic hematopathology, 2nd edn. Lippincott Williams & Wilkins1, Baltimore, pp569-622. Frizzera G, Massarelli G, Banks BM, Rosai J (1983) A systemic lymphoproliferative disorder with morphologic features of Castleman's disease. Pathological findings in 15 patients. Am J Surg Pathol 7, 211-231. Keller AR, Hochholzer L, Castleman B (1972) Hyaline-vascular and plasma-cell types of giant lymph node hyperplasia of the mediastinum and other locations. Cancer 29, 670-683. Nguyen DT, Diamond LW, Hansmann ML, Alavakko MJ, Schrer H, Fellbaum C, Fischer R (1994) Castleman's disease, Differences in follicular dendritic network in the hyaline vascular and plasma cell variants. Histopathology 24, 437441.
Weisenberger DD, Nathwani BN, Winberg CD, Rappaport H (1985) Multicentric angiofollicular lymph node pyperplasdia: a clinicopathologic study of 16 cases. Hum Pathol 16, 162172.
112
Cancer Therapy Vol 7, page 113 Cancer Therapy Vol 7, 113-118, 2009
Weekly gemcitabine and cisplatin in concurrence with pelvic radiation in the primary therapy of cervical cancer: a phase I/II study in Thai women Research Article
Bandit Chumworathayi1,*, Jeerichuda Pattamadilok1, Vorachai 2 2 2 Tangvorapongchai , Srichai Krusun , Montien Pesee , Chunsri Supaadirek2 1
Division of Gynecologic Oncology, Department of Obstetrics and Gynecology, Faculty of Medicine, Khon Kaen University, Khon Kaen, Thailand, 40002 2 Radiotherapy Division, Department of Radiology, Faculty of Medicine, Khon Kaen University, Khon Kaen, Thailand, 40002
__________________________________________________________________________________ *Correspondence: Assoc. Prof. Bandit Chumworathayi, MD, Division of Gynecologic Oncology, Department of Obstetrics and Gynecology, Faculty of Medicine, Khon Kaen University, 123 Mitraparp Road, Khon Kaen, Thailand, 40002; Tel: 66-4336-3030; Fax: 66-4334-8395; e-mail; bchumworathayi@gmail.com Key words: Cervical cancer; Concurrent chemoradiation; Cisplatin; Gemcitabine Abbreviations: absolute neutrophil count, (ANC); dextrose in half strength saline, (DNSS/2); Dose limiting toxicity, (DLT); high dose rate, (HDR); International Federation of Obstetrics and Gynecology, (FIGO); maximum tolerated dose, (MTD) Received: 28 January 2009, Revised: 24 February 2009 Accepted: 25 February 2009; electronically published: March 2009
Summary This study was done to evaluate the compliance, response and side effects of weekly gemcitabine (125 mg/m2) given concomitantly with lower-than-standard-dose weekly cisplatin (20 mg/m2) and pelvic radiotherapy for primary treatment of locally advanced cervical cancer in Thai women. Weekly gemcitabine with cisplatin was given for a maximum of six cycles. Radiation consisted of 5000 cGy in 25 daily fractions combined with brachytherapy to take point A to about 8600 cGy. If 5 or more of the first 10 patients had DLT, cisplatin dose will be reduced to 15 mg/m 2, and if more than 50% of patients still had DLT, cisplatin dose will be further reduced to 10 mg/m2. Weekly gemcitabine with cisplatin given to 31 patients concurrently with primary pelvic radiotherapy resulted in 96.8% of complete response with low toxicities. Dose limiting toxicities happened in only 12.9%. No ototoxicity or nephrotoxicity was found. No dose de-escalation was needed. Weekly combination of low dose gemcitabine and low dose cisplatin given concurrently with pelvic radiotherapy in primary treatment of locally advanced cervical cancer resulted in a high response rate with a good compliance.
However, Pattaranutaporn and colleagues reported in 2001 that using weekly gemcitabine at 300 mg/m2 for 6 courses in concurrent chemoradiation for treatment of 19 cervical cancer patients stage IIIB was not only tolerable but more effective. At 19.9 months of follow-up period, disease-free survival was 84.2% and overall survival rate was 100%. This was much better than general 5-years overall survival of stage IIIB cervical cancer patients in Thailand which is as low as 50% (Deerasamee and Srivatanakul, 1999). Although the survival data from a small phase II study with extremely short follow-up should not be compared with generally accepted survival data, it gave us a hope. There were also previous phase II trials, using weekly gemcitabine at dose of 125 mg/m2 with cisplatin at
I. Introduction Currently accepted treatment for locally advanced cervical cancer (stage IB2-IVA) is cisplatin-based concurrent chemoradiation for better disease control and also better survival (Basile et al, 2006). National Cancer Institute (NCI) of the United States of America has announced this new standard in Febuary, 1999 (US Department of Health and Human Services, 1999). Since 2002, Gynecologic Oncology Division together with Radiotherapy Division in Srinagarind Hospital, Khon Kaen University, have implemented this regimen for treatment of locally advanced cervical cancer patients and found that it is effective, safe, save, practical and tolerable (Tangsiriwatthana et al, 2007).
113
Chumworathayi et al: Gemcitabine and cisplatin with pelvic radiation in the primary therapy of cervical cancer dose of 40 mg/m2 given concurrently with primary pelvic radiotherapy, reported moderate toxicities with low compliance (Umanzor et al, 2003; Zarba et al, 2003; Duenas-Gonzalez et al, 2005). Chumworathayi and colleagues adopted in 2007 this dosage to a clinical trial in Thai women as it may be more effective than single weekly cisplatin but less expensive than single weekly gemcitabine. However, they found that overall toxicity was unacceptable, similar to the cisplatin-gemcitabine regimen using in the reverse drug sequence by Swisher and colleagues in 2006. Likewise, they concluded that, in weekly combined regimen, lower gemcitabine dose is not needed (Swisher et al, 2006; Chumworathayi et al, 2007) but lower cisplatin dose is (Chumworathayi et al, 2007). The maximum tolerated dose (MTD) of cisplatin in combination with weekly gemcitabine for Thai women is still unknown, consequently, the MTD of cisplatin in combination with weekly gemcitabine should be defined with phase I dose de-escalation study (Chumworathayi et al, 2007). In this study, authors report the evaluated compliance and adverse effects of weekly gemcitabine (125 mg/m2) (GemzarTM, manufactured by Lilly France SAS, Fegersheim, France) given concomitantly with lower weekly cisplatin dose (20 mg/m2) (PlacisTM, manufactured by Boryung Pharm, Kyungki-Do, Korea) and standard pelvic radiotherapy in 31 Thai women with locally advanced cervical cancer as a phase I dose de-escalation study.
B. Chemotherapy Gemcitabine (125 mg/m2) was given by intravenous infusion over 30 min immediately after cisplatin (20 mg/m2) for six weekly cycles with concurrent radiotherapy. The time required for cisplatin prehydration was approximately 12 hours, during which 2000 ml of 5% dextrose in half strength saline (DNSS/2) was infused overnight. Dose was calculated by body surface area not to exceed 2.0 m2. Toxicity was centrally monitored by 4 staffs in Gynecologic Oncology Division by using the Common Terminology Criteria for Adverse Events, Version 3.0 (Cancer Therapy Evaluation Program, 2006). Chemotherapy was initiated during the first week of radiation therapy and then was given every 7 days thereafter for 6 weeks prior to radiation of the same day (either external beam or brachytherapy). Supportive treatment was given according to institutional policy.
C. Radiotherapy External radiation and brachytherapy were delivered in a manner consistent with guidelines of the Radiotherapy Division. External beam radiation consisted of 4000-5000 cGy to the whole pelvis delivered in 5 fractions weekly over 4-5 weeks using high-energy photons (6 MV) with an additional 600-1000 cGy boost to the sides of grossly involved parametriam. Pelvic radiotherapy was delivered without the use of a midline block if the cervical mass was larger than 5 cm (19.6 cm2), but with it after 4000 cGy in mass larger than 4 cm (12.6 cm2), after 3000 cGy in mass larger than 3 cm (7.1 cm2), after 2000 cGy in mass smaller than 3 cm. Additional 600-1000 cGy may be boosted to the invaded parametria if it was still felt thickened on evaluation by pelvic examination after 5000 cGy by 3-5 fractions of 200 cGy. This is followed by 4 fractions of 600 cGy high dose rate (HDR) brachytherapy. Typical field borders (4 fields) for the APPA field were: the superior border (50% isodose line) was at the L4-L5 interspace, inferior border at the lower obturator foramen, lateral borders at 1.5 cm lateral to bony pelvis. For the lateral fields: the superior and inferior borders were the same, the anterior field border was at the anterior symphysis pubis, and the posterior border included the anterior sacral silhouette. Modifications to the field size were allowed for better coverage of lower vaginal or uterine extension. No para-aortic radiation was given (Chumworathayi et al, 2007; Tangsiriwatthana et al, 2007). External beam radiation was combined with HDR brachytherapy boost, to take point A LDR equivalent dose about 8600 cGy. HDR brachytherapy was given after completion of external beam radiation or beginning in week 5-6 once weekly for 3-4 times if tumor geometry was satisfactory. No external beam radiation was given on the day of the HDR implant. Applications were 600 cGy each to point A. HDR brachytherapy was given using conscious intravenous sedation (Chumworathayi et al, 2007; Tangsiriwatthana et al, 2007).
II. Materials and methods A. Eligibility The study was approved by the Khon Kaen University Ethics Committee for Human Research. Eligible patients were at least 20 years old with pathological confirmation of cervical cancer with squamous cell carcinoma or adenocarcinoma, and were of the International Federation of Obstetrics and Gynecology (FIGO) stage IB2-IVA. Patients must be eligible to receive primary chemoradiation with curative intent and could not have undergone previous hysterectomy. Patients could not have evidence of tumor metastases in para-aortic lymph nodes either by surgical staging or diagnostic imaging, if these were done. Para-aortic lymph nodes greater or equal to 1.5 cm in diameter on imaging studies must have been biopsy-proven negative for cancer. Required pretreatment evaluation included: history and physical examination (including pelvic examination), evaluation of performance status, clinical tumor measurements, laboratory testing (including complete blood count, urinary analysis, renal function test, liver function test), cysto-proctoscopy and para-aortic lymph node evaluation by surgery or CT scan, if clinically indicated. Eligibility required a Karnofsky performance status > 60, and documentation of adequate bone marrow function (absolute granulocyte count > 1500 cells/mm3, platelet count > 100000 cells/mm3), renal function (serum creatinine < 1.5 mg/dl or calculated GFR > 40 ml/min), and liver function (bilirubin < 2 times the institutional upper limit of normal and SGOT < 3 times the upper limit of normal). Exclusion criteria included: a previous malignancy within 5 years, prior pelvic radiation, prior systemic chemotherapy, previous hysterectomy, evidence of distant metastases, active serious infection, pregnancy, breast-feeding, or documented HIV infection.
D. Dose limiting toxicity (DLT) DLT was defined as any patient experiencing creatinine grade 2, grade 4 hematological toxicity (excluding hemoglobin), or if chemotherapy was held for toxicity for > 7 days or 2 separated episodes or total treatment time was greater than 77 days due to treatment-related toxicity. Other toxicities could be considered a DLT at the discretion of the first author. When any patient experienced a DLT, her protocol treatment would be stopped. If 5 or more of the first 10 patients had DLT, cisplatin dose will be reduced to 15 mg/m2, and if more than 50% of patients still had DLT, cisplatin dose will be further reduced to 10 mg/m2. If on the day of scheduled administration of chemotherapy, the absolute neutrophil count (ANC) was less than 1500
114
Cancer Therapy Vol 7, page 115 used STATA version 10.0 software to calculate the percentages,
cells/mm3 or the platelet count was less than 75000 cells/mm3 (grade 2), chemotherapy was held. Then it was resumed on schedule the following week if these levels of neutrophil and platelet counts were reached. If hematological toxicity reached grade 4 [ANC was less than 500 cells/mm3 or the platelet count was less than 25000 cells/mm3, excluding hemoglobin], resumption of treatment consisted of radiotherapy only. G-CSF was not given prophylactically. If the patient's ANC was < 1000 cells/mm3 (grade 3), G-CSF could be used at the discretion of the treating physician. Patients with grade 3 or 4 non-hematological toxicity other than alopecia, nausea, or vaginal or cervical ulceration required a hold on chemotherapy treatment until the toxicity had subsided. The resumption of chemotherapy could consist of cisplatin chemotherapy only at the discretion of the treating physician. Gemcitabine was not to be resumed after a DLT in an individual patient. Similarly, radiation treatment could be held at the discretion of the treating radiotherapist and was to be held for grade 3 or 4 gastrointestinal or bladder toxicity.
means, standard deviations, standard errors, and 95%CI (confident interval).
III. Results A total of 31 patients were treated on protocol between January, 2006 and December, 2007. Latest follow up was on 30th September, 2008. Mean follow up time was 21.5 (95%CI, 19.124) months. Locoregional relapse free survival was 19.9 (95%CI, 16.9-22.8) months. Disease free survival was 19.5 (95%CI, 16.422.6) months. One year survival rate was 96.8% (Figure 1). Pretreatment clinical characteristics are summarized in Table 1. Patients were mean age 46.6 years. 20 of them had stage II, and 11 had stage III. 26 patients had squamous cell carcinoma and 5 had adenocarcinoma. 19 of them (61.3%) had bulky diseases (equal or larger than 4X4 cm or 12.6 cm2). There was no lymph node biopsy or whole abdominal diagnostic imaging done in any patients. Treatment results of each patient are summarized in Table 2. 30 of them (96.8%) had complete responses (no clinical residual tumor plus negative Papanicolaou smear and/or negative biopsy in some suspicious cases). Only four of them (12.9%) had DLTs, whereas 27 (87.1%) had complete 6 courses without any DLT. Four DLTs were; 3 prolonged leukopenias, and 1 Escherichia Coli septic shock after 1st course without neutropenia (the one who has only one course and partial response). All patients received 5000 cGy external beam radiation to the pelvis. Every patient received high dose rate brachytherapy given for four times of weekly application after completion of external beam therapy. However, even on the day 195th after treatment, the one with partial response still had persistent tumor proved by a punch biopsy. Palliative chemotherapy with paclitaxel was given but she finally died of disease on day 441st. The incidence and severity of acute toxicities in 175 courses are shown in Table 3. Nausea, anemia, fatique, and leukopenia were found in respect to order of frequency (35.4%, 34.3%, 26.3%, and 25.7%). For grade 3-4 toxicities, only 6 grade 3 leukopenias, 1 grade 3 thrombocytopenia, 4 grade 3 neutropenias, and 1 grade 4 anemia were found (12/175, 6.9%). Fortunately, no ototoxicity or nephrotoxicity was found.
E. Responses Responses were assessed at 3 months (12 weeks) after completion of treatment (last brachytherapy). Tumor size, clinically measured in cm, was calculated in the form of largest plane area (cm2) by using the formula !r2 for the round masses, and !r1r2 for the elliptic masses, while r1 was the longer radius and r2 was the shorter one. We realize that 3-dimension calculation is better but it was not affordable in our low-resource setting. Therefore, the radius was defined clinically because it is practical although the 3rd dimension can not usually be achieved. In order to define a complete response, there must be no clinical residual tumor plus negative Papanicolaou smear and/or negative biopsy in some suspicious cases. In order to define a partial response, there must be a proof by positive biopsy with clinical residual tumor size not more than 50% of baseline. In order to define a stable disease, there must also be a proof by positive biopsy with clinical residual tumor size not less than 50% and not more than 25% of baseline. In order to define a progressive disease, there must be a proof by positive biopsy with clinical
residual tumor size more than 25% of baseline. Locoregional relapse free survival and disease free survival were defined by duration from the first day of treatment to the day those events occurred in months. We
Figure 1. Survival curve of 31 treated patients at 14 months.
115
Chumworathayi et al: Gemcitabine and cisplatin with pelvic radiation in the primary therapy of cervical cancer
Table 1. Pre-treatment clinical characteristics of 31 treated patients. Characteristics Age (year)
Mean or number 46.68
Standard deviation or % 1.32
95% CI 43.99-49.37
Body surface area (BSA) (m2)
1.56
0.02
1.51-1.61
Glomerular filtration rate (GFR) (ml/min) Stage IIA IIB IIIA IIIB Histology Squamous cell carcinoma (SCCA) Adenocarcinoma (ACA) Grade Well differentiated Moderately differentiated Poorly differentiated Tumor size (cm2)
84.76
3.62
77.37-92.16
2 18 1 10
6.5% 58.1% 3.2% 32.3%
26 5
88.9% 16.1%
12 15 14 15.8
38.7% 48.4% 12.9% 1.75
12.23-19.37
Table 2. Summary of treatment results in 31 patients. Results Total courses received 1 2 5 6 Total radiation delays 0 1 2 3 Total treatment time (days) Treatment responses Complete Partial Time to complete responses (days)
Mean or number
Standard error or %
95% CI
1 1 2 27
3.2% 3.2% 6.5% 87.1%
14 6 8 3 49.32
45.2% 19.4% 25.8% 9.7% 1.53
46.2-52.45
30 1 152.63
96.8% 3.2% 10.04
132.1-173.17
Table 3. The incidence and severity of acute toxicities in 175 courses Adverse effects
1. Leucocytes 2. Thrombocytes 3. Neutrophils 4. Hemoglobin 5. Nausea 6. Diarrhea 7. Skin 8. Fatique
Total (%)
45 (25.7) 6 (3.43) 26 (14.9) 60 (34.3) 62 (35.4) 6 (3.43) 3 (1.7) 46 (26.3)
Grade 1
2
3
4
21 5 15 48 62 6 2 46
18 0 7 11 0 0 1 0
6 1 4 0 0 0 0 0
0 0 0 1 0 0 0 0
116
Cancer Therapy Vol 7, page 117 achieved. To authors’ knowledge, this study is the first prospective report using the regimen of weekly gemcitabine 125 mg/m2 after weekly cisplatin 20 mg/m2 in combination with pelvic radiation. Taken into consideration that due to our treatment strategy, a thorough pathological examination could not be carried out in all cases, this strategy still requires further investigation before being applied to a clinical setting. Future study is still also needed to determine the two-year and five-year survival of these patients.
IV. Discussion 2
Weekly gemcitabine at dose of 125 mg/m with cisplatin at dose of 20 mg/m2 given concurrently with primary pelvic radiotherapy resulted in an excellent response (CR in 96.8%), which was higher than previous higher cisplatin dose trial by Chumworathayi and colleagues in 2007 (85.7%), but with lower toxicities. DLTs happened in only 12.9% of patients in comparing with 71.4% in previous study (Chumworathayi et al, 2007). Unlike Swisher and colleagues in 2006 and Chumworathayi and colleagues in 2007, no ototoxicity or nephrotoxicity was found in this study. In summary, a weekly combination of low dose gemcitabine and low dose cisplatin concurrent with pelvic radiotherapy in primary treatment of locally advanced cervical cancer resulted in a high response rate with a good compliance. The high toxicity of adding gemcitabine to weekly cisplatin and radiation is not surprising. Swisher and colleagues in 2006 concluded that there might be only little space for any platinum sensitizer because of the difficulty in delivering timely weekly cisplatin at 40 mg/m2. Although there was no patient demonstrated ototoxicity or nephrotoxicity in this study, previous study using weekly cisplatin 40 mg/m2 reported that ototoxicity occurred in 10%, (Chumworathayi et al, 2005) and nephrotoxicity occurred in 42.9% in a study using weekly combination of gemcitabine with this standard dose of cisplatin (Chumworathayi et al, 2007). These two adverse effects were also considered as an expected toxicity from cisplatin (Chumworathayi et al, 2007). Recently, Rose and colleagues reported in 2007 acute dose-limiting toxicity occurred even with weekly cisplatin at a dose of 30 mg/m2 and gemcitabine at a dose of 75 mg/m2. In addition to acute hematologic and acute and late non-hematologic toxicities, late grade 3 and 4 GI and GU toxicities have occurred in two of six patients at this dose level. Finally, the MTD found in their study was weekly gemcitabine 50 mg/m2 followed by cisplatin 30 mg/m2 (Rose et al, 2007). These findings supported this study protocol that if gemcitabine was fixed at 125 mg/m2, cisplatin should be de-escalated from 20 mg/m2. In this study, grade 3-4 neutropenia was found in only 5.7%, which is far less than 28.6% found in previous study, (Chumworathayi et al, 2007) but comparable to 7.8% found in single cisplatin at 40 mg/m2 in concurrent with pelvic radiation (Yuenyao et al, 2007). This was considered as an expected toxicity from the combination of both agents. These findings support authors’ new protocol decreasing cisplatin dose when combined with gemcitabine aims to decrease its adverse effects, because preclinical data also indicated that platinum sensitization can occur even with very low doses of gemcitabine (Moufarij et al, 2003). In the three studies using gemcitabine 125 mg/m2 after weekly cisplatin 40 mg/m2 in combination with radiation, (Umanzor et al, 2003; Zarba et al, 2003; Duenas-Gonzalez et al, 2005) although the overall toxicity was acceptable, it was moderate with low compliance. In this study in Thai women, after cisplatin dose was decreased to 20 mg/m2, not only low toxicity but good compliance and excellent responses were successfully
References Basile S, Angioli R, Manci N, Palaia I, Plotti F, Benedetti Panici P (2006) Gynecological cancers in developing countries: the challenge of chemotherapy in low-resources setting. Int J Gynecol Cancer 16, 1491-7. Cancer Therapy Evaluation Program (2006) Common Terminology Criteria for Adverse Events, Version 30 DCTD, NCI, NIH, DHHS March 31, 2003 (http://ctep.cancer.gov/). Chumworathayi B, Suprasert P, Charoenkwan K, Srisomboon J, Phongnarisorn C, Siriaree S, Cheewakriangkrai C, Tantipalakorn J, Kiatpeerakul C, Pantusart A (2005) Weekly versus three-weekly cisplatin as an adjunct to radiation therapy in high-risk stage I-IIA cervical cancer after surgery: a randomized comparison of treatment compliance. J Med Assoc Thai 88, 1483-92. Chumworathayi B, Yuenyao P, Tangvorapongchai V, Luanratanakorn S, Pattamadilok J, Krusun S (2007) Weekly gemcitabine and cisplatin concurrent with pelvic irradiation for primary therapy of cervical cancer: report of the first seven cases in Thai women. Radiat Med 25, 474-9. Deerasamee S, Srivatanakul P (1999) Cervix uteri. In: Deerasamee S, Martin N, Sontipong S, Sriamporn S, Sriplung S, Srivatanakul P, et al, editors. Cancer in Thailand Vol II 1992-1994 Lyon: IARC, 56-9. Dueñas-González A, Cetina-Perez L, Lopez-Graniel C, Gonzalez-Enciso A, Gómez-Gonzalez E, Rivera-Rubi L, Montalvo-Esquivel G, Muñoz-Gonzalez D, Robles-Flores J, Vazquez-Govea E, de La Garza J, Mohar A (2005) Pathologic response and toxicity assessment of chemoradiotherapy with cisplatin versus cisplatin plus gemcitabine in cervical cancer: a randomized phase II study. Int J Radiat Oncol Biol Phys 61, 817-23. Moufarij MA, Phillips DR, Cullinane C (2003) Gemcitabine potentiates cisplatin cytotoxicity and inhibits repair of cisplatin-DNA damage in ovarian cancer cell lines. Mol Pharmacol 63, 862-9. Pattaranutaporn P, Thirapakawong C, Chansilpa Y, Therasakvichya S, Ieumwananontachai N, Thepamongkhol K (2001) Phase II study of concurrent gemcitabine and radiotherapy in locally advanced stage IIIB cervical carcinoma. Gynecol Oncol 81, 404-7. Rose PG, Degeest K, McMeekin S, Fusco N (2007) A phase I study of gemcitabine followed by cisplatin concurrent with whole pelvic radiation therapy in locally advanced cervical cancer: a Gynecologic Oncology Group study. Gynecol Oncol 107, 274-9. Puget Sound Oncology Consortium, Swisher EM, Swensen RE, Greer B, Tamimi H, Goff BA, Garcia R, Koh WJ (2006) Weekly gemcitabine and cisplatin in combination with pelvic radiation in the primary therapy of cervical cancer: a phase I trial of the Puget Sound Oncology Consortium. Gynecol Oncol 101, 429-35. Tangsiriwatthana T, Chumworathayi B, Yuenyao P, Luanratanakorn S, Pattamadilok J (2007) Response of concurrent chemoradiation in women with cervical cancer
117
Chumworathayi et al: Gemcitabine and cisplatin with pelvic radiation in the primary therapy of cervical cancer IB2-IVA: experience from Srinagarind Hospital. Radiat Med 25, 502-10. Umanzor J, Aguiluz M, Pineda C, Andrade S, Erazo M (2003) Concurrent chemoradiation in locally advanced cervical carcinoma (LACC): role of a combination of cisplatin, gemcitabine and radiotherapy-A phase II trial. Proc Am Soc Clin Oncol 22, 486. US Department of Health and Human Services (1999) NCI Clinical announcement. Bethesda: Public Health Service, National Institutes of Health. Yuenyao P, Chumworathayi B, Luanratanakorn S, Wongsena M, Soopa-atakon P, Chotanaprasit T (2007) Hematologic toxicities of cisplatin concurrent chemoradiation in cervical cancer at Ubonrajchathani Cancer Center. Srinagarind Med J 22, 127-32. Zarbรก JJ, Jaremtchuk AV, Gonzalez Jazey P, Keropian M, Castagnino R, Mina C, Arroyo G; GETICS (Grupo de Estudio, Tratamiento e Investigaciรณn del Cรกncer del Sur) Argentina (2003) A phase I-II study of weekly cisplatin and gemcitabine with concurrent radiotherapy in locally advanced cervical carcinoma. Ann Oncol 14, 1285-90.
Bandit Chumworathayi
118
Cancer Therapy Vol 7, page 119 Cancer Therapy Vol 7, 119-122, 2009
Leiomyosarcoma of the inferior cava vein : case report Case Report
Giovanni Li Destri1, Rosalia Latino1, Raffaele Lanteri1,*, Francesca Brancato2, Marco Santangelo1, PierFrancesco Veroux1, Antonio Di Cataldo1 1
Department of Surgical Sciences, Organ Transplantation and Advanced Technologies, University of Catania, Via Santa Sofia 86, 95125, Catania, Italy 2 Department of Pathologic Anatomy, University of Catania, Via Santa Sofia 86, 95125, Catania, Italy
__________________________________________________________________________________ *Correspondence: Raffaele Lanteri M.D., Ph.D., Viale Andrea Doria 59, 95123 Catania, Italy; Fax: 0039095221529; e-mail: lanteri@unict.it Key words: Leiomyosarcoma, cava vein, oncology
Received: 19 January 2009; Revised: 13 February 2009 Accepted: 24 February 2009; electronically published: March 2009
Summary Leiomyosarcoma of the inferior cava vein is a rare clinical entity and according to the literature has been described in less than 300 patients. C.S., 54 yrs old, male, artisan, came to our observation in March 2005 for abdominal pain (upper right quadrant) and asthenia. Ultrasound demonstrated the presence of a gallbladder lithiasis and an echogenic mass, 7 x 8 cm, in retroperitoneal space, behind the liver. Computed tomography confirmed the presence of the mass apparently originating from middle cava vein. This mass displaced duodenum, common bile duct and pancreatic head. Doppler examination demonstrated the permeability of cava vein. Mass was resected together with anterior wall of the cava vein. Histological finding demonstrated an encapsulated high-grade leiomyosarcoma (Ki67/Mib1 index: 20%, alfa-actin positive, desmin positive, h-caldesmon positive). Leiomyosarcoma of the inferior cava vein is a rare, potentially aggressive neoplasma. Nowadays, surgery performed by an interdisciplinary team represents gold standard treatment, even if adjuvant therapy role should be demonstrated.
The five and ten yrs survival rates of this tumour are respectively 38% and 14% (Karmeli et al, 2003).
I. Introduction Leiomyosarcoma of the inferior cava vein is a rare clinical entity and according to the literature has been described in less than 300 patients (Perl, 1871; Hollembeck et al, 2003; Dew et al, 2005). Leiomyosarcoma is a rare neoplasm involving uterus, gastrointestinal tract and skin; retroperitoneal localizations are quietly rare, in particular inferior vena cava involvement (Armstrong and Franklin, 2002; Shindo et al, 2002; Soury et al, 2005). Since the first case has been described, in 1871 by Perl (1,2), 218 have been reported in International Registry of Inferior Vena Cava Leyomiosarcoma until 1996 (Mingoli et al, 1996) and less than 300 patients have been described until 2003 in literature (Karmeli et al, 2003). They are rare malignant tumours originating from the muscle mass cells of the vessel wall4. About two thirds of leiomyosarcomas are found in retroperitoneal space and surgical resection is the treatment of choice. Complete removal is the most important factor in preventing local recurrence and attaining a good outcome (Shindo et al, 2002), while role of adjuvant therapy remains unclear (Karmeli et al, 2003).
II. Case report C.S., 54 yrs old, male, artisan, came to our observation in March 2005. He presented a clinical history characterized by an aspecific symptomatology, with gravative pain in upper right abdominal quadrant, asthenia. No fever, jaundice and weight loss were present. Ultrasound demonstrated the presence of a gallbladder lithiasis and an echogenic mass, 7 x 8 cm, in retroperitoneal space, behind the liver. Computed tomography and Magnetic Resonance confirmed the presence of the mass apparently originating from middle cava vein. The mass displaced duodenum, common bile duct and pancreatic head (Figures 1, 2). Doppler examination demonstrated permeability of cava vein. An 111 Indio-Octreotide scintigraphy was performed, and no evidence of accumulation has been described. Surgery was performed by an interdisciplinary team composed by general and vascular surgeons. During surgery a 11 x 7 x 4 cm mass was found. This mass spread out from middle cava vein and displaced duodenum, pancreatic head and common bile duct. It was resected together with anterior wall of the cava vein (Figure 3). The defect was 0.7 cm transversally and 3 cm longitudinally. Cava vein was repaired
119
Li Destri et al: Leiomyosarcoma of cava vein with a transversally double layer continuous stitch suture without any stenosis. Cholecistectomy was performed. Histological finding demonstrated an encapsulated highgrade leiomyosarcoma (Ki67/Mib1 index: 20%, alfa-actin positive, desmin positive, h-caldesmon positive) (Figure 4), with free resection margins without lymphonodal involvement. No complications were observed in the postoperative course and low-dosage heparin was administered for one month. Patient was discharged 10 days after surgery. Adjuvant radiation therapy has been planned and the patient underwent a CT scan every year until three years after surgery. After four years patient is well without any sign of disease.
III. Discussion Retroperitoneal tumors are uncommon, and typically remain asymptomatic until the tumor becomes evident as a large mass (Shindo et al, 2002). Leiomyosarcoma, malignant lymphoma, liposarcoma are most frequent malignant retroperitoneal tumors (Shindo et al, 2002), while Leiomyosarcoma is the second most common retroperitoneal neoplasm in adults (Yuzer et al, 2004). Leyomiosarcoma is a slow-growing tumor, generally well encapsulated that tends to growth by expansion, rather than invading surrounding organs (Shindo et al, 2002). So clinical presentation depends on
Figure 1. CT scan: the mass appear originating from the middle cava vein.
Figure 2. Magnetic Resonance: The mass duodenum, common bile duct and pancreatic head
Figure 3. Surgical finding: The mass (11 x 7 x 4 cm) was resected together the anterior wall of the cava vein.
Figure 4. Histological finding demonstrated an encapsuled Leiomyosarcoma (Ki67/Mib1 index: 20%, alfa-actin positive, desmin positive, h-caldesmon positive).
120
displaced
Cancer Therapy Vol 7, page 121 which part of the inferior vena cava is involved (Yuzer et al, 2004) and classified in relation to the renal and hepatic veins. In a review of 144 cases, 34% occurred in Segment I (from the renal to hepatic veins), 41.7% occurred in Segment II (infrarenal portion), and 24.3% in Segment III (from the hepatic vein to the right atrium) (Mingoli et al, 1996; Armstrong and Franklin, 2002). Our patient was asymptomatic. The gravative pain, probably due to gallbladder lithiasis, suggested us to perform an ultrasound examination which showed biliary lithiasis and the presence of the tumor, probably originating from the cava vein. Cholecystectomy has been performed due to the symptomatology by the gallbladder disease. The majority of patients with leiomyosarcoma are women, with a reported male to female ratio of 1:5 to 1:6 (Yuzer et al, 2004). Surgical removal is the treatment of choice while role of the neoadjuvant therapy is still controversial (Soury et al, 2005). Surgical treatment is tumour removal together with the IVC involved wall and its reparation with an homograft or synthetic patch or direct double layer suture (Karmeli et al, 2003). In our patient, the dimension of the defeat allowed a direct suture without patch, and a double layer transversal suture has been realized without any stenosis. Poor prognosis is due to high rate of local recurrence which is described in literature among 70% of patients and only 30% of these survived for 5 years (Shindo et al, 2002; Soury et al, 2005). No series has found age or gender to be predictive factor of survival rate (Hines et al, 1999). The prognostic factors predicting local recurrence were incomplete resection and high grade (G3). The prognostic factors predicting metastasis were incomplete resection, lymph node metastasis at the time of the resection of the primary tumor and tumor histology. The prognostic factors predicting survival were incomplete resection, a tumor of high grade (G3), metastases to lymph nodes and distant metastasis (Alldinger et al, 2006). In 1992 International Registry of Inferior Vena Cava Leiomyosarcoma registry demonstrated a higher death rate in patients with upper segment tumour complicated by lower extremity edema, Budd-Chiari.Syndrome, intraluminal tumour growth and inferior vena cava occlusion (Mingoli et al, 1996). A clear surgical margin is the most important factor in five year survival while a 36% of local recurrence has been reported also after adjuvant radiotherapy. Leiomyosarcoma of the IVC is a serious disease. Although surgical resection combined with chemotherapy is usually not curative, it can achieve reasonably long-term survival. In literature has been reported that an aggressive operative management using the latest vascular surgery and oncology techniques is the gold standard in order to treat this kind of neoplasma (Kieffer et al, 2006; Cho et al, 2008). The independent impact of perioperative CT, RT, or CRT treatments cannot be adequately determined (Ito et al, 2007). In conclusion Leiomyosarcoma of the inferior vena cava is a rare, potentially, aggressive neoplasma. Nowadays, surgery represents gold standard treatment even if role of adjuvant therapy should be demonstrated.
References Alldinger I, Yang Q, Pilarsky C, Saeger HD, Knoefel WT, Peiper M (2006) Retroperitoneal soft tissue sarcomas: prognosis and treatment of primary and recurrent disease in 117 patients. Anticancer Res 26, 1577-81. Armstrong PJ, Franklin PD (2002) Pararenal vena cava Leiomyosarcoma versus leiomyomatosis: difficult diagnosis. J Vascular Surg 36, 1256-1259. Cho SW, Marsh JW, Geller DA, Holtzman M, Zeh H 3rd, Bartlett DL, Gamblin TC (2008) Surgical management of leiomyosarcoma of the inferior vena cava. J Gastrointest Surg12, 2141-8. Dew J, Hansen K, Hammon J, McCoy T, Levine EA, Shen P (2005) Leiomyosarcoma of the inferior vena cava: surgical management and clinical results. Am Surg 71, 497-501. Hines OJ, Nelson S, Baldrich WJ, Elber FR (1999) Leiomyosarcoma of the inferior vena cava; prognosis and comparison with Leiomyosarcoma of other anatomic sites. Cancer 85, 1077-83. Hollembeck ST, Grobmyer SR, Kent C, Brennan MF (2003) Surgical treatment and outcomes of patients with primary inferior vena cava Leiomyosarcoma. J Am Coll Surg 197, 575-579. Ito H, Hornick JL, Bertagnolli MM, George S, Morgan JA, Baldini EH, Wagner AJ,Demetri GD, Raut CP (2007) Leiomyosarcoma of the inferior vena cava: survival after aggressive management. Ann Surg Oncol 14, 3534-41. Karmeli R, Eyal A, Eldar S, Fajer S (2003) Primary Leiomyosarcoma of the inferior vena cava and interposition of a bovine pericardial graft. EJVES Extra 6, 119-121. Kieffer E, Alaoui M, Piette JC, Cacoub P, Chiche L (2006) Leiomyosarcoma of the inferior vena cava: experience in 22 cases. Ann Surg 244, 289-295. Mingoli A, Cavallaro A, Sapienza P, Di Marzo L, Feldhaus RJ, Cavallari N (1996) International Registry of inferior vena cava leiomyosarcoma: analysis of a world series on 218 patients. Anticancer Res 16, 3201-5. Perl L (1871) Ein Fall von Sarkom der vena Cava inferior. Virchows Arch Pathol Anat 53, 378-383. Shindo S, Matsumoto H, Ogata K, Katahira S, Kojima A, Iyori K, Ishimoto T, Kobayashi M, Tada Y, Suzuki T, Itakura J, Iizuka H, Matsumoto Y (2002) Surgical treatment of retroperitoneal leiomyosarcoma invading the inferior vena cava: report of three cases. Surg Today 32, 929-933 Soury P, Lepechou C, Guinebetrire JM, Laurian C (2005) LĂŠioyosarcomes de la veine cave infĂŠrieure. EMC Cardiologie Angiologie 2, 90-96. Yuzer Y, Zeytunlu M, Makay O, Sozbilen M, Yuce G (2004) Leiomyosarcoma of the inferior vena cava: report of a case. Surg Today 34, 370-373.
Raffaele Lanteri
121
Li Destri et al: Leiomyosarcoma of cava vein
122
Cancer Therapy Vol 7, page 123 Cancer Therapy Vol 7, 123-132, 2009
Paclitaxel inhibits radiation induced VEGF secretion and enhances radiosensitizing effects in human colon cancer cell HT29 Research Article
Yuji Toiyama, Yasuhiro Inoue, Junichiro Hiro, Eiki Ojima, Hideki Watanabe, Youhei Narita, Masato Okigami, Atuko Hosono, Chikao Miki, Masato Kusunoki* Department of Gastrointestinal and Pediatric Surgery, Division of Reparative Medicine, Institute of Life Sciences, Mie University Graduate School of Medicine, Edobashi, Tsu, Japan
__________________________________________________________________________________ *Correspondence: Masato Kusunoki, Department of Gastrointestinal and Pediatric Surgery, Division of Reparative Medicine, Institute of Life Sciences, Mie University Graduate School of Medicine, 2-174 Edobashi, Tsu, Mie 514-8507, Japan; Phone: 81-59-231-5294; Fax: 81-59-232-6968; E-mail: kusunoki@clin.medic.mie-u.ac.jp Key words: colon cancer, 5-fluorouracil, paclitaxel, VEGF, radioenhancement Abbreviations: 5-fluorouracil, (5-FU); Paclitaxel, (PXL); vascular endothelial growth factor, (VEGF); Received: 20 December 2006; Revised: 23 March 2007 Accepted: 5 December 2007; electronically published: March 2009
Summary This study investigated that 5-fluorouracil (5-FU) or Paclitaxel (PXL) pretreatment in clinical doses modifies the radio-enhance effect and angiogenetic molecule on human colon cancer cell line HT29. Cell growth inhibition by each drug at various concentrations followed by radiation was investigated using a WST-8 colorimetric assay. To investigate the mechanism of radioenhancement, flow cytometry was conducted to define the cell cycle distributions. Furthermore, the alterations in expression of an angiogenesis factorvascular endothelial growth factor, (VEGF) induced by each drug were investigated. Each drug inhibited cell growth and acted as radiosensitizer in a dose- and time-dependent manner. Cytotoxic concentrations of PXL that cause accumulation of cells in the G2/M phase have strong radio-enhancing effects. In contrast, 5-FU did not affect cell cycle distributions. The maximum non-cytotoxic concentrations of 5-FU and PXL were 0.1!M and 0.01!M, respectively. Radiosensitizing effect at non-cytotoxic dose of PXL was significantly greater than that of 5-FU. The gene expression and protein of VEGF induced by radiation was suppressed by PXL treatment, but this phenomenon was not recognized in 5-FU treatment. PXL pretreatment had the potential to act as radiosensitizer even at non-cytotoxic dose. Furthermore, Radiation induced VEGF were significantly down-regulated by PXL pretreatment. These data indicated that PXL might have a high potential for clinical use in neoadjuvant chemoradiotherapy and for inhibition of radiation induced VEGF production in colorectal cancer.
Colorectal Cancer Collaborative Group, 2001). However, the exact role of preoperative radiotherapy remains controversial for several reasons, especially regarding its survival benefit, as distant metastasis remained a significant problem even after preoperative radiation therapy (Ahmad and Nagle, 1997; Trial SRC, 1997). Recently, it has been reported that serum vascular endothelial growth factor (VEGF) increased after radiotherapy in brain tumor patients (Gridley et al, 1998), suggestive of radiation induced activation of VEGF pathway. In fact, Gorski and colleagues showed in 1999 that in a number of human tumor cell lines a single dose of
I. Introduction For the last three decades, (neo-)adjuvant radiotherapy with or without chemotherapy has been used widely in attempt to improve outcome in rectal cancer. National Cancer Institute Consensus Conference in the United States in 1990 recommended postoperative chemoradiotherapy for patients with TNM stage II and III rectal cancer as a standard treatment (NIH Consensus Conference, 1990). A recent meta-analysis concluded that the combination of preoperative radiotherapy and surgery, as compared with surgery alone, significantly improved local control and overall survival (Camma et al, 2000; 123
Toiyama et al: Paclitaxel pretreatment enhance radiation-effect and inhibit VEGF expression 10 Gy irradiation induced enhanced VEGF secretion after 24 h. In colorectal cancer, some studies revealed a relationship between increased expression of VEGF, distant metastasis, and poor prognosis (Takahashi et al, 1995; Cascinu et al, 2002). Furthermore, overexpression of VEGF in tumor after preoperative radiotherapy may be involved in the development of distant metastasis (Nozue et al, 2001). It is therefore hypothesised that radiation induced systemic induction of angiogenetic molecule partly explains the increased development of distant metastasis that affects overall survival. 5-fluorouracil (5-FU) is one of the most commonly used chemotherapeutic agents for colorectal cancer and it has been used extensively with radiation. Recently manufactured chemotherapeutic agents including capecitabine, irinotecan, and oxaliplatin have also been identified as radiosensitizers (Zhu and Willett, 2003). Paclitaxel (PXL) is the most promising anticancer drug developed in the last two decades (Rowinsky and Donehower, 1995). It has been shown that PXL blocks the progression of cells at the G2/M boundary of the cell cycle by inhibiting the dynamic reorganization of the microtubule network required for spindle formation during cell mitosis (Schiff and Horwitz, 1980; Horwitz, 1992). Since the G2/M boundary is the most radiosensitive phase of the cell cycle (Sinclair, 1968), paclitaxel could enhance the cytotoxicity of radiation even in cancer cells that are resistant to paclitaxel as a single agent (Milross et al, 1997), response to paclitaxel/radiation was not affected by the presence of p53 mutations. It has been suggested that PXL may prove to be a useful radiosensitizing agent for combined chemotherapy/radiotherapy of colorectal cancer. Furthermore, although the G2/M-phase of the cell cycle is considered the primary target, PXL effect is universal throughout the cell cycle (interphase) (Rowinsky et al, 1990) resulting in disturbances of cell functions other than mitosis, such as cell movement or angiogenesis (Belotti et al, 1996). Accordingly, it can be expected that PXL may have different effects on the molecular mechanisms of tumor cell invasion. It can act both as angiogenesis or cell movement inhibitor without affecting any cell proliferation (Zhou et al, 2001). In the present study, we investigated whether conventional PXL pretreatment acts as a radiosensitizer to colon cancer cell line HT29 in the clinical dose in comparison with 5-FU. And furthermore, we address the question: Does pretreatment with each drug have inhibitory effect on the radiation induced angiogenesis molecule VEGF.
B. Anticancer agents 5-FU and PXL were obtained from Sigma-Aldrich Inc., reconstituted in distilled water at appropriate concentrations and stored at -20°C until use.
C. Experimental protocol concept We used clinical concentrations of 5-FU, PXL as much as possible. The drug information on 5-FU indicated that the plasma concentration of 5-FU reaches 15.3!g/ml (100 !M) after a bolus injection of 5-FU (500 mg/body) and 0.6ug/ml (5!M) during continuous infusion of 5-FU (60 mg/kg/48h). The PXL concentration was chosen based on plasma concentrations obtained from clinical use cited in the drug information for TAXOL INJECTION (paclitaxel) from Bristol Myers Squibb Company (Tokyo, Japan). This information indicated that the plasma concentration of PXL reaches 1-10 !g/ml (1-10 !M) after an injection and 0.05-0.1 !g/ml (50-100 nM) at 24 h after drip infusion of PXL(105- 270 mg/m2). In order to elucidate irradiation effect in clinical dose, irradiation was carried out with fixed doses (2.5Gy). All irradiation treatments were performed on CLINAC 2100C X-ray system (Varian Oncology Services, USA) at 4 MV using 40 mm solid water phantom with a dose rate of 217cGy/min.
D. Drug concentrations, irradiation and administration schedules As mentioned above, we adopted clinically relevant concentrations of 5-FU and PXL in this study. Although we should ideally consider the doubling time of HT29 cells before deciding the drug exposure time, we chose to use an exposure of 24 h, 48h for each drug for experimental simplicity. The final concentrations ranged from 0.1-1,000 !M for 5-FU and from 0.001-10 !M for PXL. To test the cytotoxicity of each drug, HT29 cells in the exponential growth phase were treated for 24 h or 48h with various concentrations of 5-FU or PXL. After discarding the media containing each drug and replacing it with fresh media, the cytotoxicity was evaluated using a WST-8 colorimetric assay. For irradiation experiments, HT29 cells were treated with various concentrations of each drug for 24h mentioned above. After removing the drugs from the wells and filling with fresh medium, irradiation were carried out by 2.5Gy. The cells with irradiation were incubated for 0 or 24 or 48h, the cytotoxicity was evaluated using a WST-8 colorimetric assay. The drugexposure and irradiation schedules were summarized in Scheme 1a,b.
E. Growth inhibition assay The cytotoxicity was evaluated using a WST-8 (2-(2methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)2H- tetrazolium, monosodium salt) colorimetric assay. 5"103cells were seeded into 96-well cell plates (Becton Dickinson Labware, NJ, USA) in 100 !l of culture medium for 24 h prior to drug exposure, and then treated with various concentrations of 5-FU or PXL for various durations depending on the protocol. After drug exposure for the indicated concentrations and times, the medium was discarded and replaced with 90 ul of fresh medium. Next, 10 !l of WST-8 reagent solution (Cell Counting Kit; Dojindo Laboratories, Japan) was added and incubated for 1 h at 37°C. Cell viability was determined colorimetrically by the optical density (OD) at a wavelength of 450 nm, as measured using a microplate reader (SoftMax, Molecular Devices Corporation, CA, USA). Cytotoxicity was evaluated using the Cell Counting Kit according to manufacturer’s instructions.
II. Materials and methods A. Cell culture A p53 mutant type human colon adenocarcinoma cell line HT29 was obtained from the Cell Resource Center for Biomedical Research, Institute of Development, Aging and Cancer, Tohoku University. HT29 cell were grown in RPMI1640 (Sigma-Aldrich Inc., St. Louis, MO, USA), supplemented with fetal bovine serum (10%FBS; 10% (v/v); Gibco BRL, Tokyo, Japan), glutamine (2mM), penicillin (1000,000 U/L), streptomycin (100mg/l) at 37°C in a 5% CO2 incubator.
124
Cancer Therapy Vol 7, page 125
Scheme 1. (A) Schematic representation of drug exposure schedule, (B) Schematic representation of drug followed by exposure schedule.
F. Cell cycle determination HT29 cells were cultured at 1"105 cells per 60-mm dish. After treatment with various concentrations of each drug for 24 h, the cells were harvested, fixed in 70% ethanol, incubated with 2 mg/ml RNase and stained with propidium iodide solution (50 µg/ml). The DNA content of approximately 1 x 106 stained cells was analyzed using a FACScan flow cytometer. The fractions of cells in the G0/G1, S and G2/M phases were analyzed using a DNA software program.
I. ELISA The concentration of VEGF in the CM was measured using a commercially available ELISA kit (Immunoassay Kit Human VEGF; Biosource International Camarillo, Calif.,USA). Samples were incubated in microtiter plates precoated with a monoclonal antibody specific for VEGF. After incubation at room temperature for 2h and washing, a substrate solution was added. Color development was stopped after 30 min at room temperature, and the color intensity was read at 450 nm within 30 min.
G. RNA extraction and semiquantitive RTPCR analysis
J. Statistical analysis
HT29 cells were grown to 80% to 90% confluence in their respective medium containing 10% FBS in 60-mm dish. RNA was isolated from HT29 cells which was treated depending on the protocol at adequate point using an RNeasyTM Mini Kit (QIAGEN). Oligo(dT)-primed cDNA was prepared from this RNA(2!g) by reverse transcription using an Omniscript RT kit(QIAGEN). RT-PCR was performed using specific primers for VEGF and #-actin. Primer sequences were as follows: !-actin, 5'-ACAGAGCCTCGCCTTTGC -3' (sense primer) and 5'GCGGCGATATCATCATCC-3' (anti-sense primer); and VEGF, 5'-CTTGCCTTGCTGCTCTACCT-3' (sense primer) and 5'ATGATTCTGCCCTCCTCCTT-3' (anti-sense primer). Optimum cycling parameters, in the linear range of amplification, consisted of 30 s of denaturation at 94°C, 30 s of annealing at 60°C , and 1 min of elongation at 72°C , and 23-28 cycles were performed for the selected gene. A control PCR was also done for #-actin which served as a standard for sample normalization for 25 cycles. Amplified products were separated electrophoretically, visualized, and photographed under UV light after ethidium bromide staining.
The results are expressed as the means ± SD. The MannWhitney U test was used for comparisons among unpaired groups. P values of less than 0.05 were considered statistically significant.
III. Results A. Growth inhibition of HT29 cells by each drug We first evaluated the time- and dose-dependent viabilities of HT29 cells after exposure to 5-FU or PXL. Growth inhibitory effect of each drug on HT29 was assessed at 0h, 24h and 48h after drug exposure, followed by the WST-8 colorimetric assay. Growth inhibitory effects were observed for treatment with 5-FU or PXL in dose-and time-dependent manners (Figure 1a, b). Since, HT29 cell growth was significantly inhibited at the concentrations of PXL (0.1-10!M), and at that of 5-FU (11000!M) compared to control, we defined PXL concentrations of less than or equal to 0.01!M as noncytotoxic doses and more than or equal to 0.1!M as cytotoxic. In contrast, 5-FU concentrations of less or equal to 0.1!M as non-cytotoxic doses and of more than or equal to 1!M as cytotoxic doses. Furthermore, maximum noncytotxic doses of PXL or 5-FU to HT29 were 0.01!M and 0.1!M, respectively (Figure 1c).
H. Condition medium Cancer cells were grown to 80% to 90% confluence in their respective medium containing 10% FBS in 60-mm dish. The medium was removed and the cells were washed with PBS. Cells were incubated for 24 hours in 3mL serum-free medium. After treatment depending on protocol, conditioned medium was collected and stored at -20°C until use. Before use, protein concentration was determined by the Lowry method (BCA Protein Assay Reagent kit, Pierce Biotechnology, Inc., Rockford, IL).
125
Toiyama et al: Paclitaxel pretreatment enhance radiation-effect and inhibit VEGF expression
Figure 1. Cytotoxicities of PXL (A) and 5-FU (B) in HT29 cells. Cells were treated with different concentrations of each drug for 24 h, 48h and the cell growth was determined using a WST-8 colorimetric assay. The results are expressed as percentages of cell growth relative to untreated control cells (C). The data represent the meansÂąSD of eight experiments.
B. Cell growth inhibition by each drug pretreatment and radiation
contribute to radiosensitivity. The S phase is most radioresistant, and the G2/M phase is usually most radiosensitive. We investigated the cell cycle distribution following 5-FU or PXL treatment invanous doses for 24h. There were no significant differences in the cell cycle distributions at the non-cytotoxic concentrations of PXL. However, a significant accumulation of cells in G2/M phase was observed with PXL at cytotoxic doses. (Figure 3a). In contrast, 5-FU exposure for 24h increased S phase fraction in a dose dependent manner (Figure 3b).
To examine the radioenhance effect of each drug, HT29 cells were treated with PXL or 5-FU at various concentrations for 24h. After removing the drugs from the wells and filling the wells with fresh medium, cells were irradiated at the dose of 0 or 2.5Gy. Growth inhibition was evaluated by using the WST-8 colorimetric assay. The results are shown in Figure 2. Cell growth inhibitions were shown in each drug followed by radiation in a timedose dependent manner. 5-FU concentrations of more than 10!M enhanced radiosensitive effect, resulted in inhibiting cell growth compared to concentrations of less than 1!M for 24h and 48h, respectively (p<0.05) (Figure 2b). In contrast, the cell growth inhibition at cytotoxic doses of PXL pretreatment followed by radiation was greater than at non-cytotoxic doses for both 24 and 48 h after treatment (P < 0.05). Furthermore, PXL pretreatment with maximal non-cytotoxic doses also significantly inhibited cell growth (P < 0.05), but this inhibition was lower than that with PXL pretreatment at cytotoxic doses (Figure 2a).
D. VEGF gene expression patterns induced by each exposure or pretreatment with each drug followed by radiation using RT-PCR VEGF gene expression was induced by radiation without any pretreatment. However, the gene expression was significantly inhibited after radiation under PXL pretreatment. In contrast, 5-FU pretreatment did not inhibit radiation-induced VEGF gene expression (Figure 4).
C. Cell cycle distribution in HT29 following each drug treatment Cell cycle distribution has long been known to 126
Cancer Therapy Vol 7, page 127
E. The changes of VEGF secretion in CM with pretreatment of each drug or pretreatment of each drug followed by radiation
Inhibitory effect for VEGF secretions of PXL (0.1!M) was same as that of PXL (1-10!M) (Figure 5a,b). In contrast, VEGF secretions in CM under 5-FU exposure showed same patterns as control for 24h and 48h (Figure 5c,d). Radiation induced VEGF protein secretion in a timedependent manner. However, radiation induced VEGF protein secretions in CM were completely inhibited by PXL pretreatment even at cytotoxic dose (0.1-1!M) for 24h and 48h, compared to control respectively.
VEGF protein secretion in CM increased in a timedependent manner. However, VEGF secretions under PXL exposure at low-cytotoxic dose (0.1-10!M) was significantly suppressed compared to PXL at noncytotoxic dose for 24h and 48h, respectively. (p<0.05)
Figure 2. Radiation induced cell growth inhibition after 5-FU and PXL pretreatment for 24h. Cells were treated with either 5-FU (0.1, 1, 10, 100 or 1000 !M for 24 h) followed by radiation (0Gy or 2.5Gy) (A) or paclitaxel (0.001, 0.01, 0.1, 1, 10!M for 24 h) followed by radiation (0Gy or 2.5Gy) (B), and the cell growth was determined using a WST-8 colorimetric assay. The data represent the meansÂąSD of eight experiments.
Figure 3. Effects of 5-FU and PXL exposure for 24h on the cell cycle distribution. Cells were treated with either 5-FU (0.1, 1, 10, 100 or 1000 !M) or PXL (0.01, 0.1, 1, 10 or 100 !M) for 24 h. The cells were then harvested and the cell cycle distributions were analyzed by flow-cytometry. The results from three separate experiments were averaged, and the percentages of cells in the G1, S and G2/M phases are shown in a vertical stacked bar graph format for each drug.
127
Toiyama et al: Paclitaxel pretreatment enhance radiation-effect and inhibit VEGF expression
Figure 4. VEGF gene expression patterns in HT29 cell line under various conditions was evaluated by semi-quantitative RT-PCR. A control PCR was also done for B-actin which served as a standard for sample normalization.1.no drug for 24h, 2.PXL (0.1uM) for 24h, 3.5-FU (10uM) for 24h, 4.no drug followed by radiation (2.5Gy), 5. PXL (0.1uM) for 24h followed by radiation (2.5Gy), 6. 5-FU (10uM) for 24h followed by radiation (2.5Gy).
Figure 5. VEGF scretion of HT29 cancer cell line treated by PXL and 5-FU. The cells were incubated in various concentrations of 5FU(control, 0.1, 1, 10, 100!M) for 24h (A) and 48h (B) or PXL control, 0.01, 0.1, 1, 10!M for 24h (C) and 48h (D). VEGF protein expression levels in CM were evaluated at 24h and 48h by using system. The data indicate the meanÂąSD of the experiments carried out in triplicate.
128
Cancer Therapy Vol 7, page 129 control. In other word, optimal concentration of 5-FU as a radiosensitizer had a certain potential at 10!M which was obtained at continuous infusion of 5-FU in clinical. In contrast, PXL are mitotic inhibitors that stabilize microtubules by promoting their assembly and retarding their depolymerization (Manfredi et al, 1982). After exposure to the paclitaxel, cells are arrested in the G2/M phase of the cell cycle, which is the most radiosensitive phase (Schiff and Horwitz, 1980). Our result showed that the induction of radiosensitization by PXL pretreatment at cytotoxic doses were significantly higher compared to at non-cytotoxic dose after 24h and 48h, respectively. In fact, flowcytometry analysis in cell distribution showed that PXL caused accumulation of cells in G2/M phase at cytotoxic dose. It seems likely that cytotoxic doses of PXL causes “freezing” of microtubules and produces a G2/M arrest, resulting in enhancing radiosensitization. Interestingly, PXL pretreatment of non-cytotoxic dose (0.01uM) also had potential of radiosensitive effects. Previous reports showed that the increased cell radiosensitivity with exposure to PXL is evident at very low drug concentrations, below those required for the cytotoxic effects or G2/M arrest. Furthermore, G2/M arrest does not result in PXL radio-sensitization in all cell types and sensitivity persists well after the relatively brief period of G2/M synchronization, suggesting that other cellular factors may be involved in this process (Gupta et al, 1997). Recent studies (Steren et al, 1993, Rodriguez et al, 1995) have investigated new combination schedules with radiation and low, sub-therapeutic PXL doses that did not result in cell cycle perturbation.
(p<0.05). Interestingly, PXL (0.1!M) pretreatment inhibited radiation-induced VEGF protein secretion to the same amount as PXL (1!M) pretreatment (Figure 6a). However, PXL pretreatment at non-cytotoxic doses did not inhibit VEGF protein secretion after radiation. In contrast, VEGF protein secretion induced by radiation was not inhibited by 5-FU pretreatment (Figure 6b).
IV. Discussion Paclitaxel is a potent mitotic poison that causes cell arrest at the G2/M phase of the cell cycle and this provided the biologic rationale for testing the paclitaxel/radiation combination in vitro (Tishler et al, 1992). Preliminary in vitro studies suggested that paclitaxel was a useful radiation-sensitizing agent in a variety of tumor cell lines (Choy et al, 1993; Geard et al, 1993; Liebmann et al, 1994). In recent studies, combinations of paclitaxel and radiation therapy were applied to the treatment of a variety of tumor types. However, few study relevant to paclitaxel/radiation in colorectal cancer have not been shown because An Eastern Cooperative oncology Group Trial (PA286) (Einzig et al, 1996) demonstrated that paclitaxel as a single agent does not have any activity in adenocarcinoma of the colon or rectum. In this study, we investigated whether conventional chemotherapeutic agents 5-FU or PXL pretreatment act as radiosensitizer to colon cancer cell line HT29 in a clinical dose. Our results showed that 5-FU pretreatment had radiosensitization to HT29 cells in dose- and timedependent manner. Cytotoxic doses (10-1000!M) of 5-FU pretreatment have a significant potential of radiosensitization compared to non-cytotoxic dose or
Figure 6. VEGF scretion of HT29 cancer cell line treated by PXL pretreatment or 5-FU pretreatment followed by radiation. Cells were treated with either 5-FU (0, 1, 10, 100!M for 24 h) followed by radiation (2.5Gy) (A) or paclitaxel (0, 0.01, 0.1, 1!M for 24 h) followed by radiation (2.5Gy) (B) VEGF protein expression levels in CM were evaluated at 0h, 24h and 48h after radiation by using ELIZA system. The date indicated the mean±SD of the experiments carried out in triplicate.
129
Toiyama et al: Paclitaxel pretreatment enhance radiation-effect and inhibit VEGF expression These studies aimed to obtain information on: (a) the best synergistic effect as a result of the optimal combination of cell line characteristics, growth phase, drug concentration and scheduling; and (b) the cellular mechanism of action of PXL-mediated radio-sensitization, in terms of cytokinetic alterations, interference with post-irradiation DNA repair, apoptosis and reoxygenation (Milas et al, 1995). However further study should be required for other possible contributory factors cited above. Direct up-regulation of VEGF after irradiation of various cancer cell lines has been reported (Gridley et al, 1998). Specific signal pathway is known that radiation therapy results in the reoxygenation of hypoxic tumor cells and the production of reactive oxygen species that induce the activity of HIF-1, which directly activates transcription of the VEGF gene encoding vascular endothelial growth factor (Moeller et al, 2004). In locally advanced rectal cancers, Nozue and colleague described in 2001 that VEGF status before and after preoperative radiotherapy. They found a greater number of VEGF-positive tumors and more intense VEGF immunoreactivity after treatment. Upregulation of VEGF expression in the tumor is known to be associated with poor prognosis in patients with colorectal cancer and linked to liver metastasis. (Shaheen et al, 1999; Yamamura et al, 2001) With these considerations in mind, we firstly investigated that how conventional chemotherapeutic agents (5-FU, PXL) alter expression pattern of angiogenetic factor such as VEGF in particular. And secondary, whether pretreatment of these agents inhibit VEGF expression induced by radiation. It remains controversial whether 5-FU stimulates VEGF secretion. Reidel and colleagues reported in 2004 the treatment of head and neck squamous cell carcinoma cell lines with 5-FU resulted in a significant induction of VEGF production. Otherwise, Fan YF et al. demonstrated that expression of VEGF in tumors was clearly inhibited by TNP-470 in combination with 5-FU or 5-FU (Fan et al, 2002). Our results demonstrated that 5-FU exposure at various concentrations did not alter VEGF gene expression and VEGF protein secretion in CM compared to control. Furthermore, radiation induced VEGF gene expression and protein secretion pattern were not difference with or without 5-FU pretreatment. In contrast, PXL exposure inhibited VEGF gene expression compared to control or 5-FU exposure. Furthermore, radiation induced VEGF gene expression was inhibited by PXL pretreatment compared to control. VEGF protein secretion was significantly downregulated by PXL exposure at cytotoxic doses for 24h and 48h, resepectively. Interestingly, direct upregulation of VEGF after radiation was also inhibited by PXL exposure at cytotoxic doses. PXL has been reported to have an antiangiogenic activity in xenografts at concentrations that translate to treatment doses at or below those that are administered therapeutically in patients (Myoung et al, 2001). The mechanism of this antiangiogenic effect is considered to be inhibition of proliferation, motility and cord formation of endothelial cells, the angiogenic response in vivo, and neovascularization induced by vascular endothelial growth factor (VEGF) (Belotti et al, 1996; Klauber et al, 1997; Myoung et al, 2001). These
reports were consisted with our results that PXL treatment to colon cancer inhibited VEGF expression. Furthermore, we first demonstrated that interesting phenomenon which is PXL pretreatment inhibit radiation induced VEGF expression. In other words, this could be suggested that combination of PXL and radiation therapy might be rational in inhibition of tumor regrowth and metastasis. In conclusion, non-cytotoxic concentration of PXL which not related cell cycle regulation had a potential that act as radiosensitizer. PXL at cytotoxic doses might have a high potential for use as a clinical agent for the treatment of neoadjuvand chemoradiotherapy and inhibition to radiation induced angiogenesis molecule in colorectal cancer.
References Ahmad NR, Nagle D (1997) Long-term results of preoperative radiation therapy alone for stage T3 and T4 rectal cancer. Br J Surg 84, 1445-1448. Belotti D, Vergani V, Drudis T Borsotti P, Pitelli MR, Viale G, Giavazzi R, Taraboletti G (1996) The microtubule-affecting drug paclitaxel has antiangiogenic activity. Clin Cancer Res 2, 1843-1849. Camma C,Giunta M, Fiorica F, Pangliaro L, Craxi A, Cottone M (2000) Preoperative radiotherapy for respectable rectal cancer: A meta-analysis. JAMA 284, 1008-1015. Cascinu S, Graziano F, Catalano V, Staccioli MP, Rossi MC, Baldelli AM, Barni S, Brenna A, Secondino S, Muretto P, Catalano G (2002) An analysis of p53, BAX and vascular endothelial growth factor expression in node-positive rectal cancer. Relationships with tumour recurrence and event-free survival of patients treated with adjuvant chemoradiation. Br J Cancer 86,744-749. Choy H, Rodriguez FF, Koester S, Hilsenbeck S, Von Hoff DD (1993) Investigation of Taxol as a potential radiation sensitizer. Cancer 71, 3774-3778. Colorectal Cancer Collaborative Group (2001) Adjuvant radiotherapy for rectal cancer: a systematic overview of 8,507 patients from 22 randomised trials. Lancet 358, 1291304. Einzig AI, Neuberg D, Wiernik PH, Grochow LB, Ramirez G, O'Dwyer PJ, Petrelli NJ (1996) Phase II Trial of Paclitaxel in Patients with Advanced Colon Cancer Previously Untreated with Cytotoxic Chemotherapy: An Eastern Cooperative Oncology Group Trial (PA286). Am J Ther 3, 750-754. Fan YF, Huang ZH, Nie J (2002) Inhibitory effects of TNP-470 in combination with 5-fluorouracil on growth of human colon cancer Ai Zheng 21, 1319-1323. Geard CR, Jones JM, Schiff PB (1993) Taxol and radiation. J Natl Cancer Inst 15, 89-94. Gorski DH, Beckett MA, Jaskowiak Nt, Calvin DP, Mauceri HJ, Salloum RM, Seetharam S, Koons A, Hari DM, Kufe DW, Weichselbaum RR (1999) Blockage of the vascular endothelial growth factor stress response increases the antitumor effects of irradiation. Cancer Res 59, 3374-3378. Gridley DS, Loredo LN, Slater JD, Archambeau JO, Bedros AA, Andres ML, Slater JM (1998) Pilot evaluation of cytokine levels in patients undergoing radiotherapy for brain tumor. Cancer Detect Pre 22, 20-29. Gupta N, Hu LJ, Deen DF (1997) Cytotoxicity and cell-cycle effects of paclitaxel when used as a single agent in combination with ionizing radiation. Int J Radiat Oncol Biol Phys 37, 885-895. Horwitz SB (1992) Mechanism of action of taxol. Trends Pharmacol Sci 13, 134-136.
130
Cancer Therapy Vol 7, page 131 Klauber N, Parangi S, Flynn E, Hamel E, Dâ&#x20AC;&#x2122;Amato RJ (1997) Inhibition of angiogenesis and breast cancer in mice by the microtubule inhibitors 2-methoxyestradiol and Taxol. Cancer Res 57, 81-86. Liebmann J, Cook JA, Fisher J, Teague D, Mitchell JB (1994) In vitro studies of Taxol as a radiation sensitizer in human tumor cells. J Natl Cancer Inst 86, 441-446. Manfredi JJ, Parness J, Horwitz SB (1982) Taxol binds to cellular microtubules. J Cell Biol 94, 688-696. Milas L, Hunter NR, Mason KA, Milross CG, Saito Y, Peters LJ (1995) Role of reoxygenation in induction of enhancement of tumor radioresponse by paclitaxel. Cancer Res 55, 35643568. Milross CG, Mason KA, Hunter NR, Terry NH, Patel N, Harada S, Jibu T, Seong J, Milas L (1997) Enhanced radioresponse of paclitaxel-sensitive and -resistant tumors in vivo. Eur J Cancer 33, 1299-1308. Moeller BJ, Cao Y, Li CY, Dewhirst MW (2004) Radiation activates HIF-1 to regulate vascular radiosensitivity in tumors: role of reoxygenation, free radicals, and stress granules. Cancer Cell 5, 429-441. Myoung H, Hong SD, Kim YY, Hong SP, Kim MJ (2001) Evaluation of the anti-tumor and anti-angiogenic effect of paclitaxel and thalidomide on the xenotransplanted oral squamous cell carcinoma. Cancer Lett 163, 191-200. NIH Consensus Conference (1990) Adjuvant therapy for patients with colon and rectal cancer. JAMA 264, 1444-1450. Nozue M,Isaka N,Fukao K (2001) Over-expression of vascular endothelial growth factor after preoperative radiation therapy for rectal cancer. Oncol Rep 8, 1247-1249. Riedel F, Gotte K, Goessler U, Sadick H, Hormann K (2004) Targeting chemotherapy-induced VEGF up-regulation by VEGF antisense oligonucleotides in HNSCC cell lines. Anticancer Res 24, 2179-2183. Rodriguez M, Sevin BU, Perras J, Nguyen HN, Pham C, Steren AJ, Koechli OR, Averette HE (1995) Paclitaxel: a radiation sensitizer of human cervical cancer cells. Gynecol Oncol 57, 165-169. Rowinsky EK, Cazenave LA, Donehower RC (1990) Taxol: a novel investigational antimicrotubule agent. J Natl Cancer Inst 82, 1247-1259. Rowinsky EK, Donehower RC (1995) Paclitaxel (Taxol). New Engl J Med 332, 1004 -1008.
Schiff PB, Horwitz SB (1980) Taxol stabilizes microtubules in mouse fibroblast cells. Proc Natl Acad Sci USA 77, 15611565. Shaheen RM, Davis DW, Liu W Zebrowski BK, Wilson MR, Bucana CD, McConkey DJ, McMahon G, Ellis LM (1999) Antiangiogenic therapy targeting the tyrosine kinase receptor for vascular endothelial growth factor receptor inhibits the growth of colon cancer liver metastasis and induces tumor and endothelial cell apoptosis. Cancer Res 59, 5412-5416. Sinclair WK (1968) Cyclic X-ray response in mammalian cells in vitro. Radiat Res 33, 620-643. Steren A, Sevin BU, Perras J, Ramos R, Angioli R, Nguyen H, Koechli O, Averette HE (1993) Taxol as a radiation sensitizer: a flow cytometric study. Gynecol Oncol 50, 8993. Takahashi Y, Kitadai Y, Bucana CD, Cleary KR, Ellis LM (1995) Expression of vascular endothelial growth factor and its receptor, KDR, correlates with vascularity, metastasis, and proliferation of human colon cancer. Cancer Res 55, 3964-3968. Tishler RB, Schiff PB, Geard CR, Hall EJ (1992) Taxol: a novel radiation sensitizer. Int J Radiat Oncol Biol Phys 22, 613617. Trial SRC (1997) Improved survival with preoperative radiotherapy in respectable rectal cancer. Swedish Rectal Cancer Trial. N Engl J Med 336, 980-987. Yamamura T, Tsukikawa S, Yamada K, Yamaguchi S (2001) Morphologic analysis of microvessels in colorectal tumors with respect to the formation of liver metastases. J Surg Oncol 78, 259-264. Zhou X, Li J, Kucik DF (2001) The microtubule cytoskeleton participates in control of beta2 integrin avidity. J Biol Chem 276, 44762-44769. Zhu AX, Willett CG (2003) chemotherapeutic and biologic agencys as radiosensitizers in rectal cancer. Semin Radiat Oncol 13, 454-468. Steren A, Sevin BU, Perras J, Ramos R, Angioli R, Nguyen H, Koechli O, Averette HE. (1993) Taxol as a radiation sensitizer: a Xow cytometric study. Gynecol Oncol 50, 8993.
131
Toiyama et al: Paclitaxel pretreatment enhance radiation-effect and inhibit VEGF expression
132
Cancer Therapy Vol 7, page 133 Cancer Therapy Vol 7, 133-140, 2009
Relation of age with myelosuppression induced by the CHOP regimen in patients with Non-Hodgkin’s Lymphoma Research Article
Fumiaki Kitazawa1, Toshio Abe1, Kumi Ueda1, Satoshi Murakami2, Kohshi Nishiguchi3, Kohji Takara3,*, Teruyoshi Yokoyama4, Hikofumi Sugii1 1
Department of Pharmacy, Social Insurance Kyoto Hospital, Kyoto, Japan Internal Medicine and Hematology, Social Insurance Kyoto Hospital, Kyoto, Japan 3 Department of Clinical Pharmacy, Division of Clinical Pharmaceutical Sciences, Kyoto Pharmaceutical University, Kyoto, Japan 4 Faculty of Pharmaceutical Sciences, Himeji Dokkyo University, Himeji, Japan 2
__________________________________________________________________________________ *Correspondence: Kohji Takara, Ph.D. Department of Clinical Pharmacy, Division of Clinical Pharmaceutical Sciences, Kyoto Pharmaceutical University, Kyoto 607-8414, Japan; Tel: +81-75-595-4628; Fax: +81-75-595-4752; e-mail: takara@mb.kyoto-phu.ac.jp Key words: aging, cancer chemotherapy, myelosuppression, non-Hodgkin’s lymphoma, prediction of adverse effect Abbreviations: aspartate aminotransferase (AST); creatinine clearance (Ccr); cyclophosphamide (CPA); cyclophosphamide, doxorubicin, vincristine, and prednisone (CHOP); doxorubicin (DXR); granulocyte colony-stimulating factor (G-CSF); hemoglobin (Hb); non-Hodgkin’s lymphoma (NHL); !erformance status (PS); platelet (PLT); serum creatinine (Scr); vincristine (VCR); white blood cell (WBC)
Conflict of interest statement: The authors declare that no conflict of interest exists. Received: 18 November 2008; Revised: 5 January 2009 Accepted: 12 January 2009; electronically published: March 2009
Summary The purpose of this study is to explore factors contributing to myelosuppression induced by the CHOP (cyclophosphamide, doxorubicin, vincristine, and prednisone) regimen in patients with non-Hodgkin’s lymphoma, and to present the possibility of predicting myelosuppression. The medical records of 34 patients who received chemotherapy based on the CHOP or rituximab (R)-CHOP regimen between April 2003 and October 2006 at the Social Insurance Kyoto Hospital, were analyzed retrospectively. The rates of decrease in the white blood cell (WBC) count dropped as the dose of cyclophosphamide or doxorubicin, but not vincristine, increased suggesting that other factors contribute to myelosuppression. Attention was paid to age, and the patients were classified into three groups, i.e., 65 years or younger, 65 to 74 years old, and 75 years or older. There was no difference in hepatic or renal function prior to chemotherapy among the three groups, but scores for performance status increased with age. Myelosuppression was greater in the 75 or older group, whereas the dose of chemotherapeutic agents decreased with age. Therefore, the rates of decrease in the WBC count, platelet count, and hemoglobin concentration were corrected by dividing by the dose of chemotherapeutic agents. The dose-compensated rate of decrease in the WBC count or hemoglobin concentration increased significantly with age, while that in the platelet count tended to increase. In conclusion, the aggravation of myelosuppression by chemotherapeutic agents was affected by not only dose but also the patient’s age, suggesting the necessity for dose-adjustments based on age.
(DXR), vincristine (VCR), and prednisolone. This treatment has been demonstrated effective against 44% of aggressive NHLs (Fisher et al, 1993), but hematologic toxicity has also been reported (Tirelli et al, 1998; Balducci and Lyman, 2001). In addition, introducing rituximab into the CHOP regimen (R-CHOP) has
I. Introduction A trend toward the onset of non-Hodgkin’s lymphoma (NHL) is recognized in elderly patients over 60 years old, but the mechanisms involved remain unclear. The standard chemotherapy for NHL is the CHOP regimen with cyclophosphamide (CPA), doxorubicin 133
Kitazawa et al: Relation of age with myelosuppression in patients with NHL chemotherapy. Performance status (PS) before chemotherapy was scored using the Eastern Cooperative Oncology Group scale. All the patients were given PS scores of 0 to 3.
enhanced the complete-response rate among elderly patients with NHL (Coiffier et al, 2002). However, both the CHOP and R-CHOP regimens have a dose-limiting factor, myelosuppression, although the use of granulocyte colony-stimulating factor (G-CSF) may enable high doses to be maintained (Niitsu and Iijima, 2001; Pfreundschuh et al, 2004). Elderly patients tolerate chemotherapy poorly because of a progressive reduction in organ function and comorbidity related to age (Colantuoni et al, 2003). In addition, the rate of chemotherapy-related deaths tends to be increased in the elderly. Thus, elderly patients are considered a difficult population for chemotherapy. As NHL patients are generally older than other patients with cancer, the control of serious adverse effects would improve clinical outcome and safety among this particular group. However, little is known about whether aging affects the onset of adverse effects in cancer chemotherapy. In the present study, we examined retrospectively the function of bone marrow and dose of chemotherapeutic agents in 34 NHL patients treated with the CHOP or RCHOP regimen. Based on the findings, factors contributing to myelosuppression induced by either regimen were evaluated, and predictions of myelotoxicity were also made.
C. Bone marrow function before and after chemotherapy White blood cell (WBC) counts, platelet (PLT) counts, and hemoglobin (Hb) concentrations were selected as parameters of bone marrow function, and examined before and after chemotherapy. The rate of decrease was calculated from the nadir after chemotherapy. If the value after chemotherapy was not less than that prior to chemotherapy, the rate of decrease was assumed to be 0%. In addition, the rate of decrease was divided by dose per body-surface area of the chemotherapeutic agents, yielding the dose-compensated rate of decrease.
D. Statistical analysis Data are expressed as the mean ± S.D. Nonparametric multiple comparisons (dose and age) were performed with the Kruskal-Wallis H-test followed by the Student-Newman-Keuls test. Parametric multiple comparisons (hepatic or renal function and age, rates of decrease in blood corpuscles and age) were performed with a non-repeated Measures ANOVA followed by the Student-Newman-Keuls test. Correlations between age and PS scores were evaluated using Spearman's rank correlation coefficient. Other correlations were analyzed using a Pearson product-moment correlation coefficient. Differences with a p value of 0.05 or less were considered significant.
III. Results
II. Materials and Methods
A. Relation between the rate of decrease in the WBC count and doses of chemotherapeutic agents
A. Subjects Thirty-four NHL patients treated with the CHOP or RCHOP regimen were examined in terms of bone marrow function and dose of chemotherapeutic agents (Table 1). All the patients received their chemotherapy between April 2003 and October 2006 at the Social Insurance Kyoto Hospital (Kyoto, Japan). The patients were divided by age into three groups; 65 years or younger, 65 to 74 years old, and 75 years or older.
B. Condition chemotherapy
of
patients
prior
Figure 1 shows correlations between the rate of decrease in the WBC count and dose of CPA, DXR, or VCR. The rate of decrease in the count tended to decline according to the dose of CPA or DXR. No such pattern was observed in the case of VCR.
to
B. Classification of patients by age Thirty four NHL patients were classified into three groups, 65 or younger, 65 to 74 years old, and 75 or older (Table 2). There was no difference in liver function, i.e., AST and bilirubin levels, among the three groups.
Hepatic function was evaluated by examining the blood concentrations of aspartate aminotransferase (AST) and bilirubin prior to chemotherapy. Renal function was evaluated based on serum creatinine (Scr) values and creatinine clearance (Ccr) values estimated from the Cockcroft-Gault model prior to
Table 1. Characteristics of patients with non-Hodgkin’s lymphoma in the present study. Number of patients (male/female)! Age (mean ± S.D.) [Range] Regimen (Patient No.) Hepatic function Renal function Performance status (Patient No.)
AST (IU/L) Bilirubin (mg/dL) Scr (mg/dL) Ccr (mL/min) PS 0 PS 1 PS 2 PS 3
34 "22/12# 70.3 ± 10.0 [36-87] CHOP (21) R-CHOP (13) 23.4 ± 10.0 [6-58] 0.6 ± 0.2 [0.2-1.8] 0.8 ± 0.2 [0.4-1.4] 63.9 ± 17.1 [26-107] 12 5 15 2
Hepatic and renal functions were evaluated prior to chemotherapy. AST, aspartate aminotransferase; Scr, serum creatinine; Ccr, creatinine clearance. Ccr was estimated using the Cockcroft-Gault model. PS, performance status.
134
Cancer Therapy Vol 7, page 135
Figure 1. Correlation between the rate of decrease in the white blood cell count and dose of cyclophosphamide (A), doxorubicin (B), or vincristine (C). Each correlation was analyzed using a Pearson product-moment correlation coefficient. WBC: white blood cell.
Table 2. Comparison of hepatic and renal function based on age.
Number of subjects Hepatic function AST (IU/L) Bilirubin (mg/dL) Renal function Scr (mg/dL) Ccr (mL/min)
65 or younger 11
65 to 74 8
75 or older 15
19.5 ± 5.7 0.7 ± 0.1
28.9 ± 17.1 0.6 ± 0.2
23.3 ± 8.7 0.5 ± 0.3
0.8 ± 0.1 83.5 ± 15.0
0.9 ± 0.2 61.6 ± 14.9**
0.8 ± 0.2 50.7 ± 10.6**
The functions of the liver and kidneys were evaluated prior to chemotherapy. Laboratory data represents the mean ± S.D. AST, aspartate aminotransferase; Scr, serum creatinine; Ccr, creatinine clearance. Ccr was estimated using the Cockcroft-Gault model. **p<0.01 significantly different from the 65 years or younger group (Non-repeated measures ANOVA followed by Student-NewmanKeuls test).
In addition, Scr values as an index of renal function were comparable among the groups. However, Ccr decreased with age significantly. Prior to chemotherapy, PS scores were higher in the 75 or older group than in the other groups (p<0.01, Figure 2). Doses of chemotherapeutic agents in the three groups are shown in Figure 3. The dose of CPA decreased
significantly with age: the dose in the 75 or older group was 60% of that in the 65 or younger group. A similar pattern was observed for the dose of DXR. In the case of VCR, its dose was significantly lower in the 75 or older group than 65 or younger group.
Figure 2. Effects of age on performance status. Performance status (PS) was evaluated prior to chemotherapy. Each correlation was analyzed using a Spearman's rank correlation coefficient.
135
Kitazawa et al: Relation of age with myelosuppression in patients with NHL
Figure 3. Effects of age on dose of cyclophosphamide (A), doxorubicin (B), or vincristine (C). Each bar represents the mean ± S.D. The numbers of subjects 65 or younger, 65 to 74 years old, and 75 or older were 11, 8, and 15, respectively. **p<0.01 significantly different from the corresponding group (Kruskal-Wallis H-test followed by Student-Newman-Keuls test).
C. Bone chemotherapy
marrow
function
after
compensated rates of decrease in the WBC count with age. In addition, the change in the WBC count was remarkable as compared with that in the PLT count or Hb concentration.
The rates of decrease in WBC counts, PLT counts, and Hb concentrations in the three groups are shown in Figure 4. There was no difference in the rates of decrease in the WBC count among the groups. The rates of decrease in the PLT count or Hb concentration were also comparable among the three groups. However, rates of decrease in the WBC count were higher than those in the PLT count and Hb concentration in all groups. Based on these findings, the rates of decrease were corrected using the dose of chemotherapeutic agents (Figure 5). For CPA, the dose-compensated rates of decrease in the WBC count, PLT count, and Hb concentration increased with age. The same pattern was observed for DXR and VCR. All of the chemotherapeutic agents showed a significant increase in the dose-
D. Relation with the dose-compensated rates of decrease in WBC, PLT, or Hb and patient’s age Figure 6 shows the correlation between age and the dose-compensated rate of decrease in the WBC count, PLT count, or Hb concentration. For all the chemotherapeutic agents, the dose-compensated rates of decrease in the WBC count correlated significantly with age. In the case of the PLT count and Hb concentration, the dose-compensated rates of decrease also showed a positive correlation with age. Figure 4. Effects of age on the rates of decrease in blood corpuscles. Each bar represents the mean ± S.D. The numbers of subjects 65 or younger, 65 to 74 years old, and 75 or older were 11, 8, and 15, respectively. WBC: white blood cell, PLT: platelet, Hb: hemoglobin.
136
Cancer Therapy Vol 7, page 137
Figure 5. Effects of age on the dose-compensated rates of decrease in blood corpuscles. (A) cyclophosphamide, (B) doxorubicin , and (C) vincristine. Each bar represents the mean Âą S.D. The numbers of subjects 65 or younger, 65 to 74 years old, and 75 or older were 11, 8, and 15, respectively. WBC: white blood cell, PLT: platelet, Hb: hemoglobin. *p<0.05 significantly different from the corresponding group. **p<0.01 significantly different from the corresponding group (Non-repeated Measures ANOVA followed by Student-NewmanKeuls test).
tended to increase with age. In addition, the function of the liver and kidneys showed no significant change with age (Table 2). Consequently, the patientâ&#x20AC;&#x2122;s age, not only the dose of chemotherapeutic agent, was suggested to be important for predicting the aggravation of myelosuppression. In the present study, the PS score increased in an age-dependent manner (Figure 2). Numbers of hematopoietic stem cells have been reported to show an age-related decline (Balducci, 2003). It is also wellestablished that the potential ability of bone marrow and internal organs is lower in elderly patients than in younger ones. In addition, the pharmacokinetics of chemotherapeutic agents was reported to differ in the elderly as compared with younger patients (Lichtman, 2004). Notably, renal function, which plays a significant role in the pharmacokinetics of drugs, is known to decline with age, and similar findings were obtained in the present study (Table 2). As all of the chemotherapeutic agents used in the CHOP regimen are mainly metabolized in the liver, a decline in renal function would have contributed little to the deterioration of myelosuppression with aging. However, there was no difference in hepatic function among the three age groups. Consequently, aging was considered a factor in the worsening of myelosuppression. Even laboratory data are considered inadequate for evaluating the effects of aging, making it difficult to establish doses of chemotherapeutic agents for elderly patients. Next, the correlation between age and the dosecompensated rates of decrease was analyzed. A significant and positive correlation was observed for the dosecompensated rate of decrease in the WBC count or Hb concentration, but not PLT count (Figure 6).
IV. Discussion The CHOP regimen can cause serious myelosuppression, especially in elderly patients with NHL (Tirelli et al, 1998; Balducci and Lyman, 2001). The present study clarified that the rate of decrease in the WBC count after chemotherapy dropped followed by an increase in the dose of CPA or DXR (Figure 1). These findings suggest the influence of factors other than the doses of chemotherapeutic agents. Therefore, we paid attention to the age of the patients. To clarify the relation between age and onset of myelosupression, the subjects were classified into three groups. A retrospective analysis of myelosuppression induced by either the CHOP or the R-CHOP regimen was conducted, because the hematological toxicity of the two regimens is reported to be similar (Coiffier et al, 2002; Pfreundschuh et al, 2006). Gomez and colleagues reported 35 treatment-related deaths among 267 patients (median age: 70 years-old) receiving the CHOP regimen (Gomez et al, 1998). As 63% of the deaths occurred after the first cycle, and 82% were caused by an infection, the present study analyzed data obtained during the first cycle of chemotherapy. As expected, the dose of CPA, DXR, and VCR decreased with age (Figure 3). Chemotherapeutic agents with myelotoxic effects aggravate myelosuppression dependent on their dose. However, the rate of decrease in the WBC count lowered followed by an increase in the dose of CPA or DXR (Figure 1) and the rate of decrease in the WBC count or Hb concentration tended to increase with age (Figure 4). Therefore, we corrected the rates of decrease by dividing the indexes of myelosuppression by the dose of chemotherapeutic agent (mg/m2). Figure 5 shows that the dose-compensated rates of decrease in the WBC count or Hb concentration increased significantly in an age-dependent manner, and those of the PLT count
137
Kitazawa et al: Relation of age with myelosuppression in patients with NHL
Figure 6. Correlation between the dose-compensated rates of decrease in blood corpuscles and age. Upper, cyclophosphamide; Middle, doxorubicin; Lower, vincristine. Each correlation was analyzed using a Pearson product-moment correlation coefficient.
Table 3. Prediction of myelosuppression based on both patientâ&#x20AC;&#x2122;s age and the dose of chemotherapeutic agents. Age
Dose (%)
Drug
65 or younger
100 100 100 100 80 80 60 60
CPA DXR CPA DXR CPA DXR CPA DXR
65 to 74 75 or older
Decrease WBC > 78.0 > 79.3 80.3 < 81.5 <
82.1 < 82.7 < 61.5 < 62.0 <
rates (%) Hb > 12.3 > 12.6 12.8 - 16.4 13.0 - 16.8 13.5 < 13.7 < 10.1 < 10.3 <
The predicted rates of decrease in WBC count and Hb concentrations were calculated from the regression lines in Figure 6. CPA, cyclophosphamide; DXR, doxorubicin.
138
Cancer Therapy Vol 7, page 139 V, Gridelli C (2003) Chemotherapy in elderly patients with advanced breast cancer. Cancer Therapy 1, 71-79. d’Amore F, Brincker H, Christensen BE, Thorling K, Pedersen M, Nielsen JL, Sandberg E, Pedersen NT, Sørensen E (1992) Non-Hodgkin’s lymphoma in the elderly: A study of 602 patients aged 70 or older from a Danish population-based registry. Ann Oncol 3, 379-386. Dixon DO, Neilan B, Jones SE, Lipschitz DA, Miller TP, Grozea PN, Wilson HE (1984) Effect of age on therapeutic outcome in advanced diffuse histiocytic lymphoma: the Southwest Oncology Group experience. J Clin Oncol 4, 295-305. Fisher RI, Gaynor ER, Dahlberg S, Oken MM, Grogan TM, Mize EM, Glick JH, Coltman CA, Miller TP (1993) Comparison of a standard regimen (CHOP) with three intensive chemotherapy regimens for advanced nonHodgkin’s lymphoma. N Engl J Med 328, 1002-1006. Gómez H, Hidalgo M, Casanova L, Colomer R, Pen DL, Otero J, Rodriguez W, Carracedo C, Cortés-Funes H, Vallejos C (1998) Risk factors for treatment-related death in elderly patients with aggressive non-Hodgkin’s lymphoma: results of a multivariate analysis. J Clin Oncol 16, 2065-2069. Lichtman S M (2004) Chemotherapy in the elderly. Semin Oncol 31, 160-174. Mori M, Niitsu N, Takagi T, Tomiyama J, Matsue T, Nakagawa Y, Okamoto R (2001) Reduced-dose CHOP therapy for elderly patients with non-Hodgkin’s lymphoma. Leuk Lymphoma 41, 359-366. Niitsu N, Iijima K (2001) Full-dose CHOP chemotherapy combined with granulocyte colony-stimulating factor for aggressive non-Hodgkin’s lymphoma in elderly patients: a prospective study. Ann Hematol 80, 602-606. Pfreundschuh M, Trümper L, Kloess M, Schmits R, Feller AC, Rübe C, Rudolph C, Reiser M, Hossfeld DK, Eimermacher H, Hasenclever D, Schmitz N, Loeffler M (2004) Twoweekly or 3-weekly CHOP chemotherapy with or without etoposide for the treatment of elderly patients with aggressive lymphomas: results of the NHL-B2 trial of the DSHNHL. Blood 104, 634-641. Pfreundschuh M, Trümper L, Österborg A, Pettengell R, Trneny M, Imrie K, Ma D, Gill D, Walewski J, Zinzani P-L, Stahel R, Kvaloy S, Shpilberg O, Jaeger U, Hansen M, Lehtinen T, López-Guillermo A, Corrado C, Scheliga A, Milpied N, Mendila M, Rashford M, Kuhnt E, Loeffler M (2006) CHOP-like chemotherapy alone in young patients with goodprognosis diffuse large-B-cell lymphoma: a randomized controlled trial by the MabThera International Trial (MinT) Group. Lancet Oncol 7, 379-391. Tirelli U, Errante D, Van Glabbeke M, Teodorovic I, KluinNelemans JC, Thomas J, Bron D, Rosti G, Somers R, Zagonel V, Noordijk EM (1998) CHOP is the standard regimen in patients > or = 70 years of age with intermediategrade and high-grade non-Hodgkin’s lymphoma: results of a randomized study of the European Organization for Research and Treatment of Cancer Lymphoma Cooperative Study Group. J Clin Oncol 16, 27-34. Tirelli U, Zagonel V, Serraino D, Thomas J, Hoerni B, Tangury A, Ruhl U, Bey P, Tubiana N, Breed WPM, Roozendaal KJ, Hagenbeek A, Hupperets PS, Somers R (1998) NonHodgkin’s lymphoma in 137 patients aged 70 years or older: a retrospective European Organization for Research and Treatment of Cancer Lymphoma Group study. J Clin Oncol 6, 1708-1713.
In the case of WBC numbers, the correlation observed for CPA (r = 0.754) was comparable to that for DXR (r = 0.733), but the correlation observed for VCR was low compared with that for CPA or DXR. This may be explained by a dose-limiting factor of VCR, neurotoxicity, different from CPA and DXR. Therefore, in the case of CPA and DXR, myelosuppression may be predicted from both the patient’s age and the doses of chemotherapeutic agents. Based on the present retrospective study, we tried to predict the rate of decrease in the WBC count and Hb concentration (Table 3). When 80% of the standard dose of CPA or DXR was administered to patients 75 years or older, the rate of decrease in the WBC count and Hb concentration was predicted to be more than 80% and 14%, respectively. This implies the onset of a decrease in WBC numbers corresponding to grade 4, although the decrease in Hb is mild. However, when 60% of the standard dose of CPA or DXR was administered, the rates of decrease were predicted to be more than 60% and 10%, respectively, indicating a remission of myelosuppression. To maintain the response rate, more than 80% of the standard dose in the CHOP regimen would be necessary for elderly patients (Dennis et al, 1986; Tirelli et al, 1988; d’Amore et al, 1992; Mori et al, 2001), although the present predictions showed the probability of an increase in the risk of myelosuppression. Collectively, an understanding and the control of myelosuppression will enable us to individualize doses of chemotherapeutic agents and plan the use of G-CSF and measures to counter infections. Therefore, the precision of these predictions should be certified by a prospective analysis, which is ongoing. In conclusion, the aggravation of myelosuppression induced by chemotherapeutic agents was clarified to be affected by not only dose but also the patient’s age. These findings suggest the necessity of dose-adjustments for chemotherapeutic agents based on age. Therefore, physicians and pharmacists should attempt to predict the extent of adverse drug reactions based on the patient’s age when starting the CHOP or R-CHOP regimen.
References Balducci L (2003) Myelosuppression and its consequences in elderly patients with cancer. Oncology 17, 27-32. Balducci L, Lyman GH (2001) Patients aged > or = 70 are at high risk for neutropenic infection and should receive hemopoietic growth factors when treated with moderately toxic chemotherapy. J Clin Oncol 19, 1583-1585. Coiffier B, Lepage E, Briere J, Herbrecht R, Tilly H, Bouabdallah R, Morel P, Van Den Neste E, Salles G, Gaulard P, Reyes F, Gisselbrecht C (2002) CHOP chemotherapy plus rituximab compared with CHOP alone in elderly patients with diffuse large-B-cell lymphoma. N Engl J Med 346, 235-242. Colantuoni G, Rossi A, Ferrara C, Nicolella D, Gaizo FD, Guerriero C, Airoma G, Barzelloni ML, Maione P, Salerno
139
Kitazawa et al: Relation of age with myelosuppression in patients with NHL
140
Cancer Therapy Vol 7, page 141 Cancer Therapy Vol 7, 141-148, 2009
Cell-selective mitochondrial approach for cancer therapy
targeting:
A
new
Research Article
Bhuvaneshwar Vaidya, Rishi Paliwal, Shivani Rai, Kapil Khatri, Amit K. Goyal, Neeraj Mishra, Suresh P Vyas* Drug Delivery Research Laboratory, Department of Pharmaceutical Sciences, Dr. H. S. Gour Vishwavidyalaya, SAGAR470003 (MP) India
__________________________________________________________________________________ *Correspondence: Prof. Suresh P. Vyas, Drug Delivery Research Laboratory, Department of Pharmaceutical Sciences, Dr. H. S. Gour Vishwavidyalaya, SAGAR-470003 (MP) India; Tel: 91-7582-265525; Fax: 91-7582-265525; e-mail: vyas_sp@rediffmail.com Key words: Cell-selective targeting, Mitochondrial targeting, Cancer therapy, Paclitaxel, Apoptosis Abbreviations: 3-(4,5-dimethylthiazol-2-yl)-2,5 diphenyltetrazolium bromide, (MTT); Banaras Hindu University, (BHU); fetal bovine serum, (FBS); folic acid, (FA); glycosylphosphatidylinositol, (GPI); infrared, (IR); National Center for Cancer studies, (NCCS); phosphotungstic acid, (PTA); reverse-phase high performance liquid chromatography, (RP-HPLC); rhodaminephosphatidylethanolamine, (Rh-PE); transmission electron microscopy, (TEM); University Grant Commission, (UGC) Received: 15 July 2008; Revised: 21 October 2008 Accepted: 23 January 2009; electronically published: March 2009
Summary Many distinct differences in mitochondrial structure and function between normal cells and cancer cells offer the potential for the clinical use of mitochondria as targets for novel and site-specific anti-cancer agents. Mitochondrial targeting can be made possible if the bioactive molecule is selectively delivered to the mitochondria of correct cell type, using cell specific ligands and mitochondriotropic molecules. Attempts have been made to enhance the selective tumor cell killing by using folic acid as a ligand to target tumor cells over expressing folate receptors. In the present study folic acid is conjugated at the surface of DQAsomes. Antitumor activity of folic acid conjugated DQAsomes was studied using HeLa cells. Confocal laser scanning microscopy was performed for the investigation of selective mitochondrial targeting using folic acid conjugated system. In the present study paclitaxel is used as a model drug since it induces apoptosis by targeting mitochondria upstream of caspase activation. It was found that folic acid conjugated DQAsomes show better antitumor activity as compared to plain DQAsomes, folic acid conjugated liposomes and paclitaxel solution.
location within the cell (Weissig, 2005; Paliwal et al, 2007). To achieve this specificity of target, more efficient and selective delivery vehicle should be constructed so that they can transport bioactive molecule to the desired site of mitochondria. Engineering of such mitochondria selective homing devices is now a subject of current interest for controlled delivery of bioactives to mitochondria. Mitochondrial therapy may be successful by constructing such vehicles and/or carrier systems, which deliver the drug/DNA to the mitochondria of specific cell that is in pathological state. This can be achieved only when cell specific homing ligand should also be attached with mitochondria selective drug delivery port to make it cell specific. Design and development of potential carriers for cell specific delivery of mitochondrial therapeutics depend essentially on the selectivity of the carrier to the cellular receptors distributed variably at intracellular site
I. Introduction Mitochondria, the powerhouse of the cell, are highly vulnerable to inhibition or uncoupling of the energy harnessing process. The unique structural and functional characteristics of mitochondria provide a number of primary targets for xenobiotic-induced bioenergetic failure, which also provide opportunities for selective delivery of drugs to the mitochondrion (Weissig et al, 2004). The world of mitochondrial medicine can be open up by using intrinsic properties of mitochondria (a motor of cell-death), which are essential for efficient production of energy by this powerhouse of the cell. Mitochondrial importance can not be ignored since it has key role in apoptosis and necrosis, or in the regulation of cancer. Since desired effect of any targeted drug or gene delivery can be achieved only if bioactive molecule is delivered to the destined organ and/or cell type, and also to the desired
141
Vaidya et al: Cell-selective mitochondrial targeting: A new approach for cancer therapy dispersion was sonicated (Soniweld, India) for the time until an opalescent solution was obtained. Dispersion was centrifuged at 2000 rpm for 3 min for the removal of debrices and other contaminants. Unentrapped drug was not separated from the DQAsomal preparation since the solubility of paclitaxel in aqueous phase is very low (0.172 µg/ml) and the separation procedure was unnecessary (Cheng et al, 2005).
and on the surface of cellular systems (Weissig et al, 2006; Paliwal et al, 2007). The folate receptor is a glycosylphosphatidylinositol (GPI)-anchored, high-affinity membrane folate binding protein over expressed in a wide variety of human tumors, including >90% of ovarian carcinomas. Meanwhile, normal tissue distribution of folate receptor is highly restricted, making it a useful marker for targeted drug delivery to tumors (Shi et al, 2002; van Steenis et al, 2003). Folic acid, a high-affinity ligand for the folate receptor (Kd~10-10 M), retains its receptor binding property when covalently derivatized via its gammacarboxyl (Reddy and Low, 2000). Folate conjugates have been shown to be taken into receptor-bearing tumor cells via folate receptor-mediated endocytosis. Folateconjugation, therefore, presents a useful method for receptor-mediated drug delivery into receptor-positive tumor cells. Folic acid is potentially superior to antibodies as a targeting ligand because of its small size, lack of immunogenicity, ready availability, and simple and defined conjugation chemistry (Wang and Low, 1998; Leamon and Low, 2001). In the current study, a folic acid-conjugated DQAsomal formulation of paclitaxel was synthesized and evaluated in HeLa cells for cellular uptake and antitumor activity. The rational behind selecting paclitaxel as a model drug are • Poor aqueous solubility, hence DQAsomes, a colloidal drug carrier, enhance its solubility. • Cremophor EL (vehicle of marketed product) an oil of considerable toxicity. • Very narrow span between the maximal tolerated dose and intolerable toxic levels. • Directly act on mitochondria and trigger apoptosis (Cheng et al, 2005).
2. Preparation of folic acid (FA) conjugated DQAsomes Folic acid was activated by using EDC as a coupling agent as described earlier (Quintana et al, 2002; Henne et al, 2006). Briefly, folic acid was dissolved in the PBS (pH 7.4) and excess quantity of EDC, as coupling agent was added to this solution and stirred for 30 min in the dark.
3. Synthesis of FA-PEG-COOH FA-PEG-COOH was synthesized using procedure reported by Kim and colleagues in 2005, with minor modifications. Briefly, folic acid was activated using EDC as described above and activated folic acid solution was added to the solution of NH2-PEG-COOH and stirred for 3 h at room temperature. Prepared conjugate (FA-PEG-COOH) was purified using sephadex G-50 column and PBS as eluent. Conjugate was characterized by infrared (IR) spectroscopy and Mass spectroscopy (MALDI-TOF). A mass spectrum shows that peak intensity is high at the molecular weight of 2437.1 which is the approximately weight of FA- PEG2000-COOH (2437 Da).
4. Conjugation of FA-PEG-COOH DQAsomes (FA-PEG-DQA)
to
the
COOH group of FA-PEG-COOH was activated using EDC as described above. Activated FA-PEG-COOH was added to the suspension of DQAsomes and stirred for 3 h at room temperature. Conjugate was purified using dialysis membrane (molecular weight cutoff of 12400 Da Sigma, USA) against PBS (pH 7.4). Conjugation was characterized by UV spectroscopy.
5. Optimization of coating efficiency reference to initial quantity of excess folic acid
with
Optimization was carried out with reference to folic acid quantitative conjugation on the surface of DQAsomes. The initial folic acid to dequalinium chloride ratio was varied between 1:1 to16:1 in order to achieve a saturable linking of folic acid over DQAsomes. The folic acid conjugation onto the surface of DQAsomes was quantified by UV spectroscopy at 363 nm (Quintana et al, 2002; Henne et al, 2006).
II. Materials and methods Dequalinium chloride was purchased from Aldrich chemicals (St. Louis, USA). Rhodamine 123 was purchased from Sigma Chemicals (St. Louis, USA). Paclitaxel was spared as a kind gift sample by Dabur Research Foundation, Ghaziabad (India). All the solvents used were of HPLC grade.
A. Cell culture
6. Preparation of folic acid conjugated paclitaxel loaded Liposomes (Control)
HeLa cells, obtained from the National Center for Cancer studies (NCCS), Pune were cultured in DMEM media supplemented with 10% heat-inactivate fetal bovine serum (FBS), 100 U/mL penicillin, 100 !g/mL streptomycin, and Lglutamine at 37 °C in a humidified atmosphere containing 5% CO2.
Folic acid conjugated liposomes were prepared by film hydration method using DPPC/DSPE-PEG-FA/Cholesterol at the molar ratio of 7.0:0.05:2.95 and drug to lipid ratio 1:33 using method given by Wu and colleagues in 2006, with minor modification. DSPE-PEG-FA was prepared by corbodimide chemistry using FA-PEG-COOH and DSPE. Sonication was performed to reduce the size of the vesicle.
B. Preparation of folic acid conjugated paclitaxel loaded DQAsomes
C. In-vitro characterization
1. Preparation of plain DQAsomes Paclitaxel loaded plain DQAsomes were prepared according to the procedure given by Cheng and colleagues in 2005. Briefly, dequalinium chloride and paclitaxel were dissolved in methanol and vortexed for some time. The solvent was evaporated using rotary flask vaccum evaporator (Strike 180, Stereoglass Italy) the thin film casted on the inner wall of the round bottom flask was hydrated with PBS (pH 7.4). The
Transmission electron microscopy (TEM) was performed for morphological study (JEOL, Japan). Vesicles size and size distribution was determined using photon correlation spectroscopy (Malvern Zeta Sizer Nano ZS, UK). Entrapment efficiency of the formulations was determined by the procedure given by Cheng et al, 2005, with minor modification. Paclitaxel loaded DQAsomal dispersion was
142
Cancer Therapy Vol 7, page 143 dissolved in methanol/water mixture 10/1, v/v. Paclitaxel concentration was determined by reverse-phase high performance liquid chromatography (RP-HPLC) using methanol/water 60/40, v/v as mobile phase at 227 nm (Crossaso et al, 2003).
then aspirated (200 µl) and serial dilutions of the various preparations were added in triplicate (n= 3) to a final volume of 200 µl. Control wells were also prepared (n= 3) where only cells and medium (200 µl) were present. The plates were then incubated for 24 h in a humidified incubator at 37±20C with 95% air and 5% CO2. The medium containing the drug loaded formulations treatment was removed and the plates were washed once with PBS. A 100 µl solution of 1 mg/ml MTT solution was added to each well and the plates were subsequently re-incubated (at 37 ºC) with 5% CO2, for further 4 h. Subsequently, the medium was aspirated (100 µl) using a fine needle. Supernatant (100 µl) was carefully removed from each well and replaced with 100 µl of DMSO. Complete solubilization of formazan crystals was attained by repeated pipetting of the solution. The plates were then read on a plate reader (Molecular Devices, USA) and the amount of purple color formed indicating the conversion of MTT by the redox activity of living cells, was measured at 540 nm. The means and standard deviations were determined for percentage of the control and was calculated using following formula:
D. Drug localization in the DQAsomes Drug localization in the system was studied using FTIR spectroscopy. FTIR spectra of DQAsomal suspension was performed by KBr disc method on FTIR-8400S (Shimadzu). IR spectrum of pure paclitaxel (powder form), plain DQAsomes and paclitaxel loaded DQAsomes were compared.
E. In vitro drug release In vitro drug release studies of both plain and folic acid conjugated DQAsomal formulations were performed using dialysis-bag diffusion method. 1 ml of paclitaxel loaded formulation was diluted with 10 ml of PBS (pH 7.4). 5 ml of diluted formulation was transferred in to the dialysis bag of membrane of molecular weight cutoff of 12,400 Da (Sigma, USA) and bag was immersed in to 500 ml of release medium with continuous gentle stirring at 370C. At predetermined time intervals, 3 ml aliquots of the aqueous solution were withdrawn from the medium and replaced with the same volume of fresh medium to maintain a nonsaturable sink conditions. The amount of paclitaxel released in each time interval was determined by RP-HPLC using the procedure as described elsewhere in the text.
Relative viability =
(Experimental absorbance - background absorbance) ! 100% (Absorbance of untreated controls - background absorbance)
III. Results and Discussion A. Preparation of folic acid conjugated paclitaxel loaded DQAsomes Paclitaxel loaded DQAsomes were prepared according to the procedure described by Cheng and colleagues in 2005. Folic acid conjugation at the surface of DQAsomes was affected by corbodiimide chemistry using water soluble corbodiimide (EDC) as a coupling agent. Folic acid conjugated DQAsomes were purified by gel chromatography, using PBS (pH 7.4) as an eluent.
F. Cell uptake studies of folic acid conjugated DQAsomes Cell uptake studies were performed using 1% rhodaminephosphatidylethanolamine (Rh-PE) loaded DQAsomes. Rh-PE loaded DQAsomes were prepared by the same procedure as described elsewhere in the text, by replacing paclitaxel with 1 % Rh-PE. For uptake studies HeLa cells were incubated in to the 96 well plate for 24 h prior to incubation with formulations, at 370C with 5% CO2. The viability and cell count were recorded by employing 1:1 mixture of cell suspension and trypan blue solution. Cells (2x105cells/ml) were incubated with optimized formulations containing 1% Rh-PE for 4 h. After incubation, the cells were washed 5 times with HBBS and viewed under a fluorescence microscope (Nikon Eclipse E 200, Japan).
B. Characterization of the prepared DQAsomes Free amine groups at the surface of DQAsomes react with the carboxyl group of FA-PEG-COOH. Free amine groups at the surface of DQAsomes were determined by Kaiser ninhydrin test (Kaiser et al, 1970). Briefly, Solutions of ninhydrin (0.5 g in 10 ml ethanol), phenol (40 g in 10 ml ethanol), and pyridine (1 ml of 0.001 M potassium cyanide in 49 ml pyridine) were added to the small amount of DQAsomes. The DQAsomes-solution mixture was immersed in boiling water for 2 minutes. A blue color indicated the presence of free amine at the surface of DQAsomes. Coupling efficiency of folic acid was calculated by estimating the folic acid using UV spectroscopic method at 363 nm. It was found that 5.3 mol% folic acid of dequalinium chloride was bound to the surface of DQAsomes at the ratio of 8:1 folic acid to dequalinium chloride. At higher ratio no further increment in the coupling efficiency was recorded (Table 1). The prepared systems were characterized for their shape and surface morphology by TEM (Philips CM-10, Netherlands) using carbon coated copper grids and 1% phosphotungstic acid (PTA) as a negative stain. TEM images are shown in the Figure 1. TEM of paclitaxel loaded DQAsomes show that it is rode like in shape (Figure 1). The same result also obtained with folic acid
G. Intracellular localization of folic acid conjugated DQAsomes Cells (2x105cells/ml) were incubated with optimized formulations containing 1% Rh-PE for various time intervals. After incubation, the cells were washed 5 times with HBBS and grown in complete medium for another 4 h. For the visualization of mitochondria in cells not incubated with Rh-PE loaded formulations, cells were incubated with rhodamine 123 (10 µg/ml) for 30 min as reported by Johnson et al, 1980. Slides were prepared by fixing cells in glycerol-based mounting medium and images were taken using multiphoton laser scanning confocal microscope (BIO-RAD, radiance 2000, UK).
H. In vitro cytotoxicity studies To assess the cytotoxic effects of the prepared systems, the cell lines were evaluated in vitro at a physiological pH (7.4) by employing the hydrogen acceptor 3-(4,5-dimethylthiazol-2-yl)2,5 diphenyltetrazolium bromide (MTT) to estimate cellular viability. Aliquots (200 µl) of the cells (4x105 cells/well) were dispensed into 96-well microtitre plates (Kam et al, 2005). The plates were incubated overnight in a humidified incubator at 37±20C with 95% air and 5% CO2. The medium was
143
Vaidya et al: Cell-selective mitochondrial targeting: A new approach for cancer therapy Table 1. Optimization of coating efficiency with reference to initial quantity of excess folic acid. S. No. 1 2 3 4
Molar ratio of folic acid to Dequalinium chloride 1:1 4:1 8:1 16:1
% conjugation of Dequalinium chloride 1.5 3.0 5.3 5.3
Figure 1. TEM Images of paclitaxel loaded plain DQAsomes (A) and folic acid conjugated DQAsomes (B) (Bar 200 nm).
conjugated system. TEM photographs of all prepared formulations show that prepared systems are vesicular in nature. Change in the shape of the system might occurred by the closer arrangement of paclitaxel in the vesicle of dequalinium chloride. Closer molecular association and dense packing in the vesicles membrane results in a decrease of the vesicle curvature, which results in the formation of tube-like structures (Lu et al, 2006). FTIR studies provided significant insight into the location of paclitaxel with respect to dequalinium chloride molecules in the prepared vesicles (DQAsomes) (Figure 2). A clear loss in the resolution of infrared features of paclitaxel in system was observed when compared with that of paclitaxel powder. The peaks due to C=O amide stretch at 1647 cm-1 are considerably broadened in vesicular system in comparison with powder paclitaxel. Further, the peaks representing CH2 scissoring mode of paclitaxel at 1451 cm-1 decreased in intensity in the system. A shift in wave number owing to CH3 bending at 1371.43 cm-1 of paclitaxel to 1363 cm-1 occurred. Broadening of the CH2 symmetric stretching band and shifting towards higher frequency in the FTIR of paclitaxel loaded DQAsomes revealed the conformational changes in the dequalinium chloride layer. Above observations revealed that paclitaxel intercalated between the dequalinium chloride where hydrophobic interactions may occur between hydrophobic parts of these molecules (Ricci et al, 2000; Dhanikula and Panchagnula, 2004; Mahmoud et al, 2007).
Photon correlation spectroscopy studies revealed that slight increase in the size folic acid coupled DQAsomes from 673±19nm to 694±24nm as compared to plain DQAsomes. Entrapment efficiency of folic acid conjugated DQAsomes (66.34±2.16%) was found to be low compared to plain DQAsomes (67.68±3.53%). In the case of liposomes vesicles size was found to be 525±35 nm whereas entrapment efficiency of the same was 86.23±5.4%. In vitro release study showed that cumulative drug released was 22.21±1.54 % at 36 h in case of plain DQAsomes, however percent cumulative drug release of FA-PEG-DQA is found to be 19.13±1.84 (Figure 3). Further drug release was found to remain constant for over subsequent 72 h. The initial release profile might be the result of surface associated drug release from the vesicles whereas further release profile might be ascribed to strong hydrophobic interaction of paclitaxel to the hydrophobic part of the dequalinium chloride. In the case of FA-PEGDQA results might be ascribed to the presence of double barrier provided by PEG around the DQAsomes. Above results revealed that drug released in initial hours might be induce apoptosis by targeting mitochondria whereas further sustained released drug show better activity for longer period of time.
C. Cell uptake studies Cell uptake study of folic acid conjugated DQAsomes was conducted using fluorescence microscopy (Figure 4). The absence of fluorescence in the control 144
Cancer Therapy Vol 7, page 145
Figure 2. FTIR spectra of paclitaxel (A) DQAsomes (B) and paclitaxel loaded DQAsomes (C)
Figure 3. In vitro release profiles of various DQAsomal formulations
Figure 4. Fluorescence photographs showing cellular uptake of prepared systems (A) Cells treated with plain DQAsomes (B) Cells treated with FA conjugated DQAsomes
145
Vaidya et al: Cell-selective mitochondrial targeting: A new approach for cancer therapy cells (without formulation) was observed. The intense fluorescence in the cells incubated with plain DQAsomes as well as folic acid conjugated DQAsomes revealed cellular uptake of these formulations. Relatively higher fluorescence in the case of folic acid-conjugated DQAsomes incubated cells compared to plain DQAsomes incubated cells revealed that receptor-mediated uptake of folic acid conjugated preparation could be accounted for higher fluorescence level in the folate receptor over expressed cells (HeLa cells) To study the fate of folic acid-coupled DQAsomal formulation after endocytosis, intracellular localization study was performed using HeLa cell lines. Typically obtained confocal microscopic images are shown in Figure 5. Figure 5.A displays cells incubated with FAPEG-DQA, which have been labeled by incorporation of 1 mol% Rh-PE, while Figure 5.B shows cells, the mitochondria of cells which have specifically stained with Rhodamine 123. On comparing both figures it can be appreciated that cells incubated with FA-PEG-DQA display the same distinct and punctate fluorescence pattern as cells stained with the mitochondria-specific dye. Such a comparison of staining patterns has been used by Boddapati et al, 2005 to show the mitochondria targeting potential of STTP liposomes. Filipovska et al, 2004 also used this comparison pattern to reveal the localization of labeled thiol proteins inside mitochondria.
D. Cytotoxicity studies For in vitro anticancer study cells were incubated with three formulations (plain and folic acid conjugated DQAsomes and folic acid conjugated liposomes) for 24 h in 96-well microtitre plates. Control cells were taken without formulations and incubated with medium. Cell viability assay was performed using MTT assay. Results showed (Figure 6) that after incubation of cells with folic acid conjugated paclitaxel loaded formulations higher anticancer activity was observed. Percent cell viability was determined using control as 100%. The higher cytotoxicity of folic acid conjugated DQAsomes could be attributed to the higher uptake of paclitaxel by the cells. Higher uptake might be ascribed to the receptor-mediated uptake of DQAsomes by the cell in to its cytoplasm. Further, receptor-mediated uptake was confirmed by competition assay using an excess of folic acid in the culture media. Paclitaxel have been shown to have multiple pharmacologic effects in human cancer cells, including increased polymerization and stabilization of microtubules, inhibition of DNA synthesis and induction of apoptosis (Millenbaugh et al, 1998). Paclitaxel inside the cells may act following either of mechanisms of actions, i.e. antitubulin activity as well as mitochondrial apoptosis activity (Figure 7). Figure 5. Confocal microscopic images showing fate of DQAsomal formulations (A) Mitochondria stained with Rhodamine 123 (B) Mitochondria stained with Rh-PE loaded FA conjugated DQAsomes
Figure 6. Percent cell viability of cancer cells treated with various DQAsomal formulations
146
Cancer Therapy Vol 7, page 147
Figure 7. Schematic presentation of mechanism of action of paclitaxel loaded folic acid conjugated DQAsomes.
Antitubulin activity might be attributed to released paclitaxel partially in the cytoplasm, which acts on the tubulin (pathway I) whereas major part of paclitaxel selectively targets mitochondria, which help in the initiation of apoptotic signals, by acting on the mitochondrial membrane (pathway II) (Andre et al, 2000; Andre et al, 2002). Suggested mechanism may also be confirmed by comparing the result with folic acid conjugated liposomes. Results showed that folic acid conjugated liposomes are more cytotoxic as compared to plain DQAsomes but these are less cytotoxic as compared to folic acid conjugated DQAsomes. These results revealed that folic acid conjugated DQAsomes delivered drug not only to the cytosol but also to mitochondria whereas folic acid conjugated liposomes delivered drug only to cytosol.
mitochondria of specific cells. Further, in vivo studies are necessary for the assessment of potential of such systems.
Acknowledgements This work was supported by University Grant Commission (UGC) New Delhi, India. Author B. Vaidya is highly thankful to Prof. S.C. Lakhotia, Cytogenetics laboratory Banaras Hindu University (BHU), Varanasi, India for providing help in confocal microscopic study. Author is also thankful to NCCS Pune, India for providing required cancer cell lines.
References Andre N, Braguer D, Brasseur G, Gonรงalves A, LemesleMeunier D, Guise S, Jordan MA, Briand C (2000) Paclitaxel induces release of Cytochrome c from mitochondria isolated from human neuroblastoma cells. Cancer Res 60, 53495353. Andre N, Carre M, Brasseuer G, Pourroy B, Kovacic H, Briand C, Braguer D (2002) Paclitaxel targets mitochondria upstream of caspase activation in intact human neuroblastoma cells. FEBS Letters 532, 256-260. Boddapati SV, Tongcharoensirikul P, Hanson RN, D'Souza GG, Torchilin VP, Weissig V (2005) Mitochondriotropic liposomes. J Liposome Res 15, 49-58.
IV. Conclusion The study demonstrated that DQAsomes could be targeted to the mitochondria of specific cells by attaching respective ligand. In this study folic acid has been attached to the surface of DQAsomes and resulted FA-PEG-DQA could target mitochondria of HeLa cells specifically. It was also found that functionalized DQAsomes show higher anticancer activity. This study might be helpful in the treatment of cancer by inducing apoptosis by targeting
147
Vaidya et al: Cell-selective mitochondrial targeting: A new approach for cancer therapy Cheng SM, Pabba S, Torchilin VP, Fowle W, Kimpfler A, Schubert R, Weissig V (2005) Towards mitochondriaspecific delivery of apoptosis inducing agents: DQAsomal incorporated paclitaxel. J Drug Del Sci Technol 15, 81-86. Crosasso P, Ceruti M, Brusa P, Arpicco S, Dosio F, Cattel L (2000) Preparation, characterization and properties of sterically stabilized paclitaxel-containing liposomes. J Control Rel 63, 19-30. Dhanikula AB, Panchagnula R (2004) Development and characterization of biodegradable chitosan films for local delivery of paclitaxel. AAPS J 6, 1-12. Domnina LV, Ivanova OY, Pletjushkina OY, Fetisova EK, Chernyak BV, Skulachev VP, Vasiliev JM (2004) Marginal blebbing during the early stages of TNF-induced apoptosis indicates alteration in actomyosin contractility. Cell Biology International 28, 471-475. Filipovska A, Eccles MR, Smith RA, Murphy MP (2004) Delivery of antisense peptide nucleic acids (PNAs) to the cytosol by disulphide conjugation to a lipophilic cation. FEBS Lett 556, 180-186. Henne WA, Doorneweerd DD, Lee J, Low PS, Savran C (2006) Detection of folate binding protein with enhanced sensitivity using a functionalized quartz crystal microbalance sensor. Anal Chem 78, 4880-4884. Johnson LV, Walsh ML and Chen LB (1980) Localization of mitochondria in living cells with rhodamine 123. Proc Natl Acad Sci USA 77, 990-994. Kaiser E, Colescott RL, Bossinger CD, Cook PI (1970) Color test for detection of free terminal amino groups in the solidphase synthesis of peptides. Anal Biochem 34, 595-598. Kam NWS, Oâ&#x20AC;&#x2122;Connell M, Wisdom JA, Dai H (2005) Carbon nanotubes as multifunctional biological transporters and near-infrared agents for selective cancer cell destruction. Proc Natl Acad Sci USA 102, 11600-11605 Kim SH, Jeong JH, Cho KC, Kim SW, Park TG (2005) Targetspecific gene silencing by siRNA plasmid DNA complexed with folate-modified poly(ethylenimine). J Control Rel 104, 223-232. Leamon CP, Low PS (2001) Folate-mediated targeting: from diagnostics to drug and gene delivery. Drug Discovery Today, 6, 44-51. Lu T, Han F, Li Z, Huang J (2006) Transitions of organized assemblies in mixed systems of cationic bolaamphiphile and anionic conventional surfactants. Langmuir 22, 2045-2049. Mahmoud SS, Gehman JD, Azzopardi K, Robins-Browne RM, Separovic F (2008) Liposomal phospholipid preparations of
chloramphenicol for ophthalmic applications. J Pharma Sci 97, 2691-2701. Millenbaugh NJ, Gan Y, Au JL (1998) Cytostatic and apoptotic effects of paclitaxel in human ovarian tumors. Pharm Res 15, 122-127. Paliwal R, Rai S, Vaidya B, Mahor S, Gupta PN, Rawat A, Vyas SP (2007) Cell-selective mitochondrial targeting: progress in mitochondrial medicine. Curr Drug Del 4, 211-224. Quintana A, Raczka E, Piehler L, Lee I, Myc A, Majoros I, Patri AK, Thomas T, Mule J, Baker JR (2002) Design and function of a dendrimer-based therapeutic nanodevice targeted to tumor cells through the folate receptor. Pharm Res 19, 1310-1316. Rawat A, Vaidya B, Khatri K, Goyal AK, Gupta PN, Mahor S, Paliwal R, Rai S, Vyas SP (2007) Targeted intracellular delivery of therapeutics: an overview. Pharmazie 62, 643658. Reddy JA, Low PS (2000) Enhanced folate receptor mediated gene therapy using a novel pH-sensitive lipid formulation. J Control Rel 64, 27-37. Ricci M, Sassi P, Nastruzzi C, Rossi C (2000) Liposome-based formulations for the antibiotic nonapeptide leucinostatin A: Fourier transform infrared spectroscopy characterization and in vivo toxicologic study. AAPS PharmSciTech 1, E2. Shi G, Guo W, Stephenson SM, Lee RJ (2002) Efficient intracellular drug and gene delivery using folate receptortargeted pH-sensitive liposomes composed of cationic / anionic lipid combinations. J Control Rel 80, 309-319. van Steenis JH, van Maarseveen EM, Verbaan FJ, Verrijk R, Crommelina DJA, Storma G, Hennink WE (2003) Preparation and characterization of folate-targeted pEGcoated pDMAEMA-based polyplexes. J Control Rel 87, 167-176. Wang S, Low PS (1998) Folate-mediated targeting of antineoplastic drugs, imaging agents, nucleic acids to cancer cells. J Control Rel 53, 39-48. Weissig V (2005) Targeted drug delivery to mammalian mitochondria in living cells. Expert Opin Drug Deliv 2, 89102. Weissig V, Boddapati SV, Cheng SM, D'Souza GGD (2006) Liposomes and liposome-like vesicles for drug and DNA delivery to mitochondria. J Liposome Res 16, 249-264. Weissig V, Cheng SM, Dâ&#x20AC;&#x2122;Souza GGD (2004) Mitochondrial pharmaceutics. Mitochondrion 3, 229-244. Wu J, Liu Q, Lee RJ (2006) A folate receptor-targeted liposomal formulation for paclitaxel. Int. J. Pharm 316, 148-153.
Members of Drug Delivery Research Laboratory: (from left to right) Shivani Rai, Rishi Paliwal, Bhuvaneshwar Vaidya, Prof. S. P. Vyas, Kapil Khatri, Amit K Goyal and Neeraj Mishra
148
Cancer Therapy Vol 7, page 149 Cancer Therapy Vol 7, 149-152, 2009
Cognitive and emotive state in elderly treatmentna誰ve patients with advanced cancer compared with an elderly healthy control population Research Article
Fable Zustovich*, Malihe Shams, Pasquale Anselmi, Giuseppe Lombardi, Davide Pastorelli, Giuseppe Cartei Oncologia Medica 1, Istituto Oncologico Veneto - IRCCS, Padova, Italy
__________________________________________________________________________________ *Correspondence: Fable Zustovich, Oncologia Medica 1, IOV-IRCCS, Via Gattamelata n.64, 35128 Padova, Italy; Tel: +39.3479775504; Fax: +39.049.8042089; e-mail: fable.zustovich@ioveneto.it Key words: Cancer; Cognitive impairment; Elderly Abbreviations: Activities of Daily Living, (ADL); Geriatric Depression Scale, (GDS); Instrumental Activities of Daily Living, (IADL); Mini Mental State Examination, (MMSE); Performance Status, (PS) Received: 30 December 2008; Revised: 19 January 2009 Accepted: 22 January 209; electronically published: March 2009
Summary The elderly may have cognitive impairment due to several physiological and pathological conditions. In cancer patients cognitive impairment has been related to some anticancer treatments while few data are available regarding the role of advanced cancer itself. Thus, we planned a prospective study. We evaluated the Mini Mental State Examination (MMSE) of elderly patients with advanced cancer, before starting anticancer treatments, compared to a control population. Other causes of cognitive impairment, related to disease or to the treatment, were investigated and excluded. To investigate the possible influence of depression and Performance Status (PS) on cognitive status, the Geriatric Depression Scale (GDS), the Activities of Daily Living (ADL) and the Instrumental Activities of Daily Living (IADL) scores were also evaluated. Results: mean MMSE scores of cancer patients (n = 66) and control population (n = 31) were respectively 21.9 and 23.7. The difference was statistically significant (U = 694.5; p < 0.05). A difference between the 2 groups was seen also for ADL and IADL scores (U = 695.5; p < 0.01 and U = 501.5; p < 0.001 respectively), whilst no significant difference was seen for GDS score. Among cancer patients there was a correlation between MMSE, ADL and IADL (r = 0.38; p < 0.01 and r = 0.26; p < 0.05 respectively) while in the control group a negative correlation was found between MMSE and GDS (r = -0.49; p < 0.01). Anticancer treatment na誰ve patients with advanced cancer present with cognitive impairment that does not seem to be related to depression, as in healthy subjects, but to other causes among which the tumour might play a fundamental role.
small cell lung cancer may present with cognitive impairment at the onset of the disease in 35 and 97% of cases respectively (Wefel et al, 2004; Komaki et al, 1995). Unfortunately, no data are available in selected elderly patients with advanced cancers before treatment compared with an elderly control population. Thus, to clarify this issue we studied prospectively a group of stage IV elderly cancer patients at the onset of the disease compared with a control group of elderly healthy subjects. To exclude the possible influence of emotional status on cognitive impairment depression was also investigated.
I. Introduction Cognitive impairment is frequent in the general elderly population and up to 7.8% of the elderly population may have a clinical pattern consistent with the diagnosis of dementia (Robertson et al, 1989). Of the 560,000 deaths for cancer in the USA 440,000 involve people over 60 years of age and 160,000 over 80 (Jemal et al, 2006). Some studies show long term cognitive impairment in survivors after whole brain radiotherapy (Gregor et al, 1996), hormonal deprivation for prostate cancer (Salminen et al, 2004) and adjuvant chemotherapy for breast cancer (Van Dam et al, 1998; Tchen et al, 2003; Falleti et al, 2005; Bender et al, 2006). In terminal cancer patients cognitive function is often seriously impaired (Massie et al, 1983; Bruera et al, 1992; Minagawa et al, 1996; Pereira et al, 1997). Patients with breast cancer and
II. Materials and methods Patients over 65 years of age with metastatic cancer to be treated with chemotherapy were prospectively enrolled. All patients were investigated during baseline 149
Zustovich et al: Cognitive and emotive state in elderly treatment-naïve patients medical evaluation, thus before starting chemotherapy. Patients with CNS metastatic involvement were excluded, as well as patients who developed CNS involvement within 6 months after the MMSE evaluation. We also excluded patients with small cell lung cancer (SCLC) due to the high incidence of immune-related paraneoplstic neurological syndromes. Patients with a history of known previous cognitive impairment, cerebrovascular disease, non neoplastic chronic disease, and disability unrelated to cancer (such as femur fracture) were excluded as well. Healthy control subjects were consecutively enrolled from a volunteer population (adults over 65 years of age coming to the hospital for reasons unrelated to their health such as patients’ relatives and accompanying persons). The same exclusion criteria were used for the control group with the addition of the exclusion of subjects with a history of cancer. The following questionnaires were administered to all subjects to evaluate cognitive, depressive and functional conditions, the latter as expression of the performance status: Mini Mental State Examination (MMSE) (Folstein et al, 1975), Geriatric Depression Scale (GDS) (Yesavage et al, 1983), Activities of Daily Living (ADL) (Katz et al, 1963), Instrumental Activities of Daily Living (IADL) (Lawton and Brody, 1969). All the questionnaires were simultaneously administered by qualified psychologists. Data from MMSE was corrected by age and scolarity using the adjustment coefficients for the Italian elderly population (Magni et al, 1996). Statistical evaluation was performed using Kolmogorov-Smirnov test to verify the distribution type. T-test, Pearson’s chi-square test and Mann-Whitney U-test were used to observe statistically significant difference between the groups according to the distribution type. Pearson’s correlation coefficient was used to observe the strength and direction of the linear relationship between the tests.
correlation was found between MMSE and GDS (r = 0.49; p < 0.01).
IV. Discussion The two groups were well balanced for age and scolarity. ECOG Performance status was not considered because better represented by ADL and IADL scores (Repetto et al, 2002). Cancer patients’ baseline cognitive performances were inferior to controls (mean values: 21.9 vs. 23.7; p < 0.05). There was no significant difference between the GDS scores of the groups, a trend was observed in favour of controls (mean values: 5.6 vs. 4.3) but with a high variance within the two groups. No significant correlation between MMSE and GDS scores in cancer patients was found. On the other hand healthy elderly control cognitive function and depression scores had a negative correlation (r = -0.49; p < 0.01) as expected according to the prior reports concerning geriatric population (Buntinx et al, 1996; Cervilla and Prince, 1997; Ganguli et al, 1999; Gabryelewicz et al, 2004). These results might mean that the cancer diagnosis itself does not necessarily cause depression and that depression might not be the cause of cognitive impairment in this subset. Some authors have demonstrated that depression is related to cognitive impairment, cardiopathy, neurological disease but not to cancer in the elderly population (Papadopoulos et al, 2005). Cancer patients also had poorer ADL and IADL scores versus controls (mean values: 5.5 vs. 6.0; p < 0.01 and 5.8 vs. 7.4; p < 0.001 respectively) with a clear correlation between MMSE, ADL and IADL (r = 0.38 and 0.26 with p < 0.01 and < 0.05 respectively), thus a correlation with the grade of cancer related performance status. Cognitive impairment might be one of the
Table 1. Characteristics of the study population.
III. Results We enrolled 97 subjects, see Table 1 for subjects’ demographics and cancer diagnosis. See Tables 2 and 3A-B for questionnaire scores and correlations between questionnaire scores for both groups. No statistical differences between the groups were found by age and scolarity. Cancer patients had lower MMS mean scores compared with controls (21.9 vs. 23.7) and this difference was statistically significant (U = 694.5; p < 0.05). There also was a statistically significant difference between ADL and IADL for the two groups (U = 695.5; p < 0.01 and U = 501.5; p < 0.001 respectively) in favour of the control population. No statistically significant difference was found for GDS. We used GDS-15 with a cut-off for depression at 6. Depressed subjects were 28 out of 66 among the cancer population and 9 out of 31 among the control group. In cancer patients a statistically significant positive correlation was found between MMSE, ADL and IADL scores (r = 0.38; p < 0.01 and r = 0.26; p < 0.05 respectively) while in the control population a negative
Age (years): Mean S.D. Range Scolarity: Degree/Secondary School Primary School Elementary School No licence Histology: NSCLC GIC BC HNC Other
Cancer n (%) 66 (68)
Control n (%) 31 (32)
74.1 5.0 66-94
75.1 7.3 65-91
14 (21.2) 8 (12.1) 35 (53.0) 9 (13.6)
7 (22.6) 3 (9.7) 15 (48.4) 6 (19.4)
31 (47.0) 16 (24.2) 5 (7.6) 5 (7.6) 9 (13.6)
NSCLC = No Small Cell Lung Cancer; GIC = Gastro Intestinal Cancer; BC = Breast Cancer; HNC = Head and Neck Cancer.
150
Cancer Therapy Vol 7, page 151 Table 2. MMS, GDS, ADL and IADL scores by group.
MMS
GDS
ADL
IADL
Mean S.D. Range Mean S.D. Range Mean S.D. Range Mean S.D. Range
Cancer 21.9 4.4 (8-29) 5.6 3.1 (1-14) 5.5 0.9 (1-6) 5.8 2.1 (0-8)
Control 23.7 3.9 (14-28) 4.3 3.2 (0-10) 6.0 0.2 (5-6) 7.4 1.2 (4-8)
U = 694.5; p < 0.05
U = 803; p = .09
U = 695.5; p < 0.01
U = 501.5; p < 0.001
Table 3A. Correlation between MMS, GDS, ADL, IADL scores in cancer group.
MMS GDS ADL IADL
MMS 1 -0.198 0.377 (**) 0.255 (*)
GDS -0.198 1 -0.172 -0.019
ADL 0.377 (**) -0.172 1 0.468 (**)
IADL 0.255 (*) -0.019 0.468 (**) 1
*p < 0.05; ** p < 0.01
Table 3B. Correlation between MMS, GDS, ADL, IADL scores in control group.
MMS GDS ADL IADL
MMS 1 -0.488 (**) 0.222 0.079
GDS -0.488 (**) 1 0.078 -0.075
ADL 0.222 0.078 1 0.068
IADL 0.079 -0.075 0.068 1
** p < 0.01
determinants of functional disability (Dodge et al, 2005) or functional disability might be solely a consequence of the presence of the cancer and its effects, like neoplastic cachexia. One important recent hypothesis to note is that cognitive impairment, might be the consequence of chronic inflammation and cytokine release due to the presence of cancer (Maier SF et al, 2003). This hypothesis may be supported by studies on senile dementia and Alzheimerâ&#x20AC;&#x2122;s disease where there is evidence that a chronic inflammatory underlining status may favour a cognitive functional decay (Mago et al, 2000). In fact, patients with systemic lupus erythematosus and rheumatoid arthritis, (both severe chronic inflammatory diseases), present with variable grades of cognitive impairment (Carbotte et al, 1986; Hanly et al, 1992; Carlomagno et al, 2000; Loukkola et al, 2003; Appenzeller et al, 2004). In conclusion our data provides support for alterations in cognitive function due to the presence of cancer. The pathogenesis of such cognitive impairment is not fully understood. Cancer related chronic inflammation might be one of the involved factors. Study limitations include the lack of evaluation of some potential confounding factors, such as long-term smoking related cerebrovascular disease in patients with NSCLC, vitamin B12 depletion, the presence of anemia
and fatigue. To investigate the potential correlation between general inflammatory status and cognitive impairment in cancer patients a combined MMSE and serum inflammatory indexes evaluation is ongoing.
References Appenzeller S, Bertolo MB, Costallat LT (2004) Cognitive impairment in rheumatoid arthritis. Methods Find Exp Clin Pharmacol 26, 339-343. Bender CM, Sereika SM, Berga SL, Vogel VG, brufsky AM, Paraska KK, Ryan CM (2006) Cognitive impairment associated with adjuvant therapy in breast cancer. Psychooncology 15, 422-430. Bruera E, Miller L, McCallion J, Macmillan K, Krefting L, Hanson J (1992) Cognitive failure in patients with terminal cancer: a prospective study. J Pain Symptom Manage 7, 192-195. Buntinx F, Kester A, Bergers J, Knottnerus JA (1996) Is depression in elderly people followed by dementia? A retrospective cohort study based in general practice. Age Ageing 25, 231-233. Carbotte RM, Denburg SD, Denburg JA (1986) Prevalence of cognitive impairment in systemic lupus erythematosus. J Nerv Ment Dis 174, 357-364. Carlomagno S, Migliaresi S, Ambrosone L, Sannino M, Sanges G, Di Iorio G (2000) Cognitive impairment in systemic lupus
151
Zustovich et al: Cognitive and emotive state in elderly treatment-naïve patients erythematosus: a follow-up study. J Neurol 247, 273-299. Cervilla JA, Prince MJ (1997) Cognitive impairment and social distress as different pathways to depression in the elderly: a cross-sectional study. Int J Geriatr Psychiatry 12, 995 1000. Dodge HH, Kadowaki T, Hayakawa T, Yamakawa M, Sekikawa A, Ueshima H (2005) Cognitive impairment as a strong predictor of incidence of disability in specific ADL-IADL tasks among community-dwelling elders: the Azuchi Study. Gerontologist 45(2), 220-230. Falleti MG, Sanfilippo A, Maruff P, Weih L, Phillips KA (2005) The nature and severity of cognitive impairment associated with adjuvant chemotherapy in women with breast cancer: a meta-analysis of the current literature. Brain Cogn 59, 6070. Folstein MF, Folstein SE, Mc Hugh PR (1975) Mini-mental state. A practical method for grading the cognitive state of patients for the clinician. J Psychiatr Res 12, 189-198. Gabryelewicz T, Styczynska M, Pfeffer A, Wasiak B, Barczak A, Luczywek E, Androsiuk W, Barcikowska M (2004) Prevalence of major and minor depression in elderly persons with mild cognitive impairment--MADRS factor analysis. Int J Geriatr Psychiatry 19, 1168-1172. Ganguli M, Dube S, Johnston JM, Pandav R, Chandra V, Dodge HH (1999) Depressive symptoms, cognitive impairment and functional impairment in a rural elderly population in India: a Hindi version of the geriatric depression scale (GDS-H). Int J Geriatr Psychiatry 14, 807-820. Gregor A, Cull A, Traynor E, Stewart M, Lander F, Love S (1996) Neuropsychometric evaluation of long-term survivors of adult brain tumours: relationship with tumour and treatment parameters. Radiother Oncol 41, 55-9. Hanly JG, Fisk JD, Sherwood G, Jones E, Jones JV, Eastwood B (1992) Cognitive impairment in patients with systemic lupus erythematosus. J Rheumatol 19, 562-567. Jemal A, Siegel R, Ward E, Hao Y, Xu J, Murray Thalidomide, Thun MJ (2006) Cancer statistics. CA Cancer J Clin 56, 106-130. Katz S, Ford AB, Moskowitz RW, Jackson BA, Jaffe MW (1963) Studies of illness in the age. The index of ADL: a standardized measure of biological and psychosocial function. JAMA 185, 914-919. Komaki R, Meyers CA, Shin DM, Garden AS, Byrne K, Nickens JA, Cox JD (1995). Evaluation of cognitive function in patients with limited small cell lung cancer prior to and shortly following prophylactic cranial irradiation. Int J Radiat Oncol Biol Phys, 33, 179–182. Lawton MP, Brody EM (1969) Assessment of older people: selfmaintaining and instrumental activities of daily living. Gerontologist 9, 179-186. Loukkola J, Laine M, Ainiala H, Peltola J, Metsanoja R, Auvinen A, Hietaharju A (2003) Cognitive impairment in systemic lupus erythematosus and neuropsychiatric systemic lupus erythematosus: a population-based neuropsychological study. J Clin Exp Neuropsychol 25, 145-151. Magni E, Binetti G, Bianchetti A, Rozzini R, Trabucchi M (1996) Mini-mental state examination: a normative study in Italian elderly population. Eur J Neurol 3, 1-5. Mago R, Bilker W, Ten Have T, Harralson T, Streim J, Parmalee P, Katz IR (2000) Clinical laboratory measures in relation to depression, disability, and cognitive impairment in elderly patients. Am J Geriatr Psychiatry 8, 327-332. Maier, S.F., & Watkins, L.R. (2003). Immune-to-central nervous system communication and its role in modulating pain and
cognition: Implications for cancer and cancer treatment. Brain, Behavior, & Immunity, Suppl 1, S125-131. Massie MJ, Holland J, Glass E (1983) Delirium in terminally ill cancer patients. Am J Psychiatry 140, 1048-1050. Minagawa H, Uchitomi Y, Yamawaki S, Ishitani K (1996) Psychiatric morbidity in terminally ill cancer patients. A prospective study. Cancer 78, 1131-1137. Papadopoulos FC, Petridou E, Argyropoulou S, Kontaxakis V, Dessypris N, Anastasiou A, Katsiardani KP, Trichopoulos D, Lyketsos C (2005) Prevalence and correlates of depression in late life: a population based study from a rural Greek town. Int J Geriatr Psychiatry 20, 350-357. Pereira J, Hanson J, Bruera E (1997) The frequency and clinical course of cognitive impairment in patients with terminal cancer. Cancer 79, 835-842. Repetto L, Fratino L, Audisio RA, Venturino A, Gianni W, Vercelli M, parodi S, Dal Lago D, Gioia F, Monfardini S, Aapro MS, Serraino D, Zagonel V (2002) Comprehensive geriatric assessment adds information to Eastern Cooperative Oncology Group performance status in elderly cancer patients: an Italian Group for Geriatric Oncology Study. J Clin Oncol 20, 494-502. Robertson D, Rockwood K, Stolee P (1989) The prevalence of cognitive impairment in an elderly Canadian population. Acta Psychiatr Scand. 80 (4): 303 – 309. Salminen EK, Portin RI, Koskinen A, Helenius H, Nurmi M (2004) Associations between serum testosterone fall and cognitive function in prostate cancer patients. Clin Cancer Res 10, 7575-7582. Tchen N, Juffs HG, Downie FP, Yi QL, Hu U, Chemerynsky I, Clemons M, Crump M, Goss PE, Warr D, Tweedale ME, Tannock IF (2003) Cognitive function, fatigue, and menopausal symptoms in women receiving adjuvant chemotherapy for breast cancer. J Clin Oncol 21, 41754183. Van Dam FS, Schagen SB, Muller MJ, Boogerd W, vd Wall E, Droogleever Fortuyn ME, Rodenhuis S (1998) Impairment of cognitive function in women receiving adjuvant treatment for high-risk breast cancer: high-dose versus standard-dose chemotherapy. J Natl Cancer Inst 90, 210-218. Wefel JS, Lenzi R, Theriault R, Buzdar AU, Cruickshank S, Meyers CA (2004). ‘Chemobrain’ in breast carcinoma?: A prologue. Cancer 101, 466-475. Yesavage JA, Brink TL, Rose TL, Lum O, Huang V, Adey M, Leirer VO (1983) Development and validation of a geriatric depression screening scale: a preliminary report. J Psychiatr Res 17, 37-49.
Fable Zustovich
152
Cancer Therapy Vol 7, page 153 Cancer Therapy Vol 7, 153-162, 2009
Ixabepilone, a new class of chemotherapy for advanced breast cancer Research Article
Frances M. Palmieri1,*, Una Hopkins2 1
Breast Clinic and Breast Cancer Program, Mayo Clinic, USA Albert Einstein Cancer Center, Montefiore Medical Center, USA
2
__________________________________________________________________________________ *Correspondence: Frances M. Palmieri RN, MSN, OCN, Manager, Breast Clinic and Breast Cancer Program, Mayo Clinic, 4500 San Pablo Road, Jacksonville, Florida 32224 USA; Tel: 904-953-0707; Fax: 904-953-1412; e-mail: Palmieri.frances@mayo.edu Key words: breast cancer, ixabepilone, drug resistance Abbreviations: alanine aminotransferase, (ALT); aspartate aminotransferase, (AST); colony stimulating factors, (CSFs); Lactated Ringerâ&#x20AC;&#x2122;s Injection, USP, (LRI); locally-advanced breast cancer, (LABC); metastatic breast cancer, (MBC); non-steroidal antiinflammatory drugs, (NSAIDs); non-steroidal anti-inflammatory drugs, (NSAIDs); upper limit of normal, (ULN) Received: 26 January 2009; Revised: 9 March 2009 Accepted: 18 March 2009; electronically published: March 2009
Summary Ixabepilone is a member of a new class of cytotoxic agents, the epothilones, developed as a novel therapy for patients who are resistant to anthracyclines, taxanes or the fluorinated pyrimidines (ie, capecitabine). The efficacy and safety of ixabepilone as a single agent or in combination with capecitabine has been demonstrated in locally advanced and metastatic breast cancer. Based on the positive results obtained in phase II and III clinical trials, ixabepilone is FDA approved both in combination with capecitabine for patients with metastatic or locally advanced breast cancer after failure of an anthracycline and a taxane, or as monotherapy for patients with metastatic or locally advanced breast cancer after failure of an anthracycline, a taxane, and capecitabine. Adverse events associated with ixabepilone therapy, when administered as a single-agent or in combination with capecitabine, are manageable. Common adverse events include: hematologic toxicity, peripheral neuropathy, fatigue/asthenia, myalgia/arthralgia, alopecia, nausea, stomatitis/mucositis, and vomiting. Nurses have an essential role in recognizing and managing such adverse events to ensure that patients derive the maximum benefit from ixabepilone therapy.
be intrinsically resistant to any one, or all, of these agents and even those individuals achieving an initial response will inevitably relapse (Crown et al, 2002; Hamilton and Hortobagyi, 2005; Lee and Swain, 2005). Even with the use of new targeted therapies such as trastuzumab, lapatinib, and bevacizumab (Nahta and Esteva, 2006; Schneider and Sledge, Jr., 2007), few patients with MBC achieve long-term survival (American Cancer Society, 2007). Ixabepilone is one of the first in a new class of chemotherapy agents called epothilones (Cortes and Baselga, 2007). Naturally occurring epothilones have shown only modest in vivo antitumor activity because of their poor metabolic stability, unfavorable pharmacokinetic properties and narrow therapeutic window (Lee et al, 2001). To address these limitations, semi-synthetic analogs have been developed to improve on the characteristics of these naturally occurring agents.
I. Introduction Breast cancer is responsible for >40,000 deaths per year in the US (Jemal et al, 2007). The majority of these deaths will be a result of complications associated with recurrent or metastatic disease (O'Shaughnessy, 2005). The primary goals of metastatic breast cancer (MBC) treatment include prevention and palliation of symptoms, and maintenance or improvement of quality of life. However, over the last decade, important advances in chemotherapeutic agents have improved prognosis for patients with MBC (Gennari et al, 2005; Hamilton and Hortobagyi, 2005; Colozza et al, 2006). Currently, the core chemotherapy agents for the treatment of MBC are the anthracyclines (eg, doxorubicin, epirubicin), taxanes (eg, paclitaxel, docetaxel), and fluorinated pyrimidines (ie, capecitabine). These agents are considered the most active agents for patients with MBC, and are often used as firstor second-line agents (Colozza et al, 2006). Patients may
153
Palmieri and Hopkins: Ixabepilone, a new class of chemotherapy for advanced breast cancer Ixabepilone, a semi-synthetic analog of epothilone B, targets and stabilizes microtubules, but unlike taxanes and anthracyclines, ixabepilone has a low susceptibility to multiple mechanisms of drug resistance (Lee and Swain, 2005; Pivot et al, 2007) The causes of drug resistance in breast cancer are not fully understood, but the mechanisms are believed to be multifactorial, involving the overexpression of P-glycoprotein and microtubule associated tau, and mutations in the beta-tubulin subunit (Cortes and Baselga, 2007). The differential binding of epothilones to beta-tubulin versus other antimicrotubule agents may, in part, be responsible for the lack of resistance following treatment with ixabepilone. Other mechanisms of resistance, including insensitivity to druginduced apoptosis and induction of drug-detoxifying mechanisms, may also play an important role in acquired anticancer drug resistance (Gottesman, 2002). Ixabepilone has been studied extensively, both as a single-agent (Low et al, 2005; Denduluri et al, 2007; Perez et al, 2007; Roché et al, 2007; Thomas et al, 2007) and in combination with capecitabine (Thomas et al, 2007b; Vahdat et al, 2007). Its efficacy and safety has been demonstrated across a broad spectrum of breast cancer, ranging from patients with locally-advanced breast cancer (LABC) or MBC receiving ixabepilone as primary systemic therapy, to patients who have developed resistance to multiple lines of previous therapy (Baselga et al, 2005; Perez et al, 2007). A combination of ixabepilone and capecitabine has demonstrated superior clinical efficacy compared with capecitabine alone in two phase III clinical studies of patients with anthracyclinepretreated or -resistant and taxane-resistant MBC or LABC (Thomas et al, 2007b; Vahdat et al, 2007). Based on the positive results obtained in phase II and III clinical trials, ixabepilone is FDA-approved in combination with capecitabine for patients with MBC or LABC after failure of an anthracycline and a taxane, or as monotherapy for patients with MBC or LABC after failure of an anthracycline, a taxane, and capecitabine, as detailed in the package insert (Bristol-Myers Squibb [IXEMPRA], 2007). The purpose of this review is to provide nurses with practical recommendations for the effective and safe use of ixabepilone in the clinic.
Squibb [IXEMPRA], 2007; Thomas et al, 2007b; Vahdat et al, 2007). Treatment-related adverse events were mainly grade 1 or 2 and reversible. The toxicity profile of this combination was similar to that of ixabepilone and capecitabine administered individually (Bristol-Myers Squibb [IXEMPRA], 2007; Thomas et al, 2007b). With the increasingly common use of anthracyclines and taxanes as adjuvant therapy for early breast cancer (NCCN, 2008), some patients may receive ixabepilone regimens as first-line therapy for MBC (Roché et al, 2007). Data indicate that the benefit of adding ixabepilone to capecitabine is greatest in these patients (Bristol-Myers Squibb [IXEMPRA], 2007; Fumoleau et al, 2007; Thomas 2007b; Vahdat et al, 2007). In a phase II trial, neoadjuvant treatment with ixabepilone was active in patients with invasive stage IIA-IIB breast cancer (Baselga et al, 2005). Furthermore, ixabepilone as first-line therapy was also effective in another phase II trial of patients with MBC previously treated with an adjuvant anthracycline (Roché et al, 2007). In both trials, the safety profile of ixabepilone was manageable (Baselga et al, 2005; Roché et al, 2007). Patients with advanced breast cancer in whom anthracyclines, taxanes, and capecitabine have all failed (multi-resistant patients) create a treatment sequencing challenge for the treating clinician, typically with limited therapeutic options and a poor prognosis (O'Shaughnessy et al, 2005; Perez et al, 2007). Despite this, in this population, ixabepilone demonstrated clinical activity and a manageable safety profile (Perez et al, 2007). Responses were durable and clinically relevant in patients who had not previously responded to multiple prior therapies (Perez et al, 2007). Subgroup analyses have been conducted to determine whether the clinical benefits of ixabepilone are affected by certain patient characteristics, such as hormone receptor status, HER-2 status, age, prior therapy, and sites of metastatic disease (Lerzo et al, 2007; Pivot et al, 2007; Vahdat et al, 2007). These analyses have shown consistent clinical benefits for ixabepilone in combination with capecitabine in the majority of different patient subpopulations (Vahdat et al, 2007) (Figure 1). This is true even in patients with poor prognosis, for example in the subgroup of patients with HER-2+ tumors or visceral metastases (Lerzo et al, 2007; Vahdat et al, 2007). When selecting patients for ixabepilone therapy, special consideration needs to be given to patients presenting with liver dysfunction. The combination of ixabepilone and capecitabine should not be administered to patients with abnormal liver function (serum alanine aminotransferase [ALT] or aspartate aminotransferase [AST] > 2.5 x upper limit of normal [ULN] or serum total bilirubin > 1 x ULN). Furthermore, ixabepilone monotherapy should be given at a reduced dose depending on the degree of hepatic impairment (Bristol-Myers Squibb [IXEMPRA], 2007). Ixabepilone monotherapy is not recommended in patients with AST or ALT >10 x ULN or bilirubin > 3 x ULN. In addition, ixabepilone is not recommended for use in patients who have previously experienced hypersensitivity to drugs formulated with Cremophor® EL, or in patients with a baseline neutrophil
II. Selection of patients for treatment with ixabepilone Appropriate patient selection is important in defining the population most likely to benefit from ixabepilone without compromising tolerability. Patients eligible for treatment with ixabepilone will have received prior chemotherapy either for metastatic/locally advanced disease or in the adjuvant setting. In patients previously treated with, or resistant to, anthracyclines (doxorubicin, epirubicin) and taxanes (paclitaxel, docetaxel), capecitabine is regarded as the standard therapy (Blum et al, 1999; Blum, 2001; Reichardt et al, 2003; Fumoleau et al, 2004). Two phase III trials have shown that addition of ixabepilone to capecitabine significantly improves overall response rate and progression-free survival in patients with LABC or MBC previously treated/resistant to anthracyclines or resistant to taxanes (Bristol-Myers 154
Cancer Therapy Vol 7, page 155 count <1500 cells/mm3 or a platelet count <100,000
cells/mm3 (Bristol-Myers Squibb [IXEMPRA], 2007).
Figure 1. Ixabepilone Plus Capecitabine Demonstrates Consistent Clinical Benefits in the Majority of Different Patient Subpopulations (Thomas et al, 2007b). KPS = Karnofsky performance status; ER = estrogen receptor; HER2 = human epidermal growth factor receptor 2; PR = progesterone receptor
(Table 2). The non-overlapping toxicity profiles of ixabepilone and capecitabine, coupled to their demonstrated synergistic antitumor activity, make this combination a rational approach to treating metastatic breast cancer (Bristol-Myers Squibb [IXEMPRA], 2007; Thomas et al, 2007b). Non-hematologic adverse events with the combination of ixabepilone plus capecitabine in the phase III study were similar to those seen in the phase II study of patients with multi-resistant disease (Perez et al, 2007), with the exception of hand-foot syndrome, which was the second most common non-hematologic adverse event (Bristol-Myers Squibb [IXEMPRA], 2007; Thomas et al, 2007b) (Table 2). However, this is a typical capecitabine-related adverse event, with a similar incidence in the pivotal phase III trial with ixabepilone plus capecitabine (64%) and capecitabine alone (62%) (Thomas et al, 2007b). Importantly, capecitabine does not exacerbate neuropathy or myelosuppression caused by
III. Management of adverse events Nursing assessment and intervention in the recognition and management of adverse events can ensure that patients derive the maximum benefit from therapy with ixabepilone with or without capecitabine. Adverse events associated with ixabepilone therapy, when administered as a single-agent or in combination with capecitabine, are manageable (Table 1). Ixabepilone monotherapy appears to be tolerated even when administered to patients with heavily pretreated disease, for example in patients with multi-resistant disease (Perez et al, 2007). In a phase II study of ixabepilone monotherapy in patients with resistance to multiple lines of chemotherapy, the most frequently reported nonhematologic adverse event was peripheral neuropathy, which was reported in 60% of patients (13% grade 3, 1% grade 4). Other common non-hematologic adverse events included: fatigue/asthenia, alopecia, nausea, stomatitis/mucositis, and vomiting (Perez et al, 2007)
155
Palmieri and Hopkins: Ixabepilone, a new class of chemotherapy for advanced breast cancer ixabepilone (Bristol-Myers Squibb [IXEMPRA], 2007; Thomas et al, 2007b).
Neuropathy is a common adverse event associated with agents targeting microtubules, including taxanes and epothilones (Markman, 2003; Lee and Swain, 2005; Mielke et al, 2006). Neuropathy associated with ixabepilone is cumulative, reversible and mainly sensory.
A. Peripheral sensory neuropathy
Table 1. Management of Adverse Events Associated with Ixabepilone (CancerSymptoms.org, 2006; Denduluri et al, 2007; Perez et al, 2007; Roche et al, 2007; Thomas et al, 2007a; Vahdat et al, 2007). Adverse event
Symptoms
Peripheral neuropathy
• • • • •
GI symptoms
• • • • • • • -
Diarrhea
-
Constipation
• • • -
Bone marrow suppression
Anorexia Nausea/vomiting Mucositis/ stomatitis
Myalgias and arthralgias Fatigue
Alopecia
Management
Loss of sensation Weakness Numbness Tingling Burning pain from distal to proximal areas occurring in stocking/glove distribution Bilateral symptoms Fever Sore throat Sores in mouth Infection Ulcers Flu-like symptoms
Early recognition important Reversible with ixabepilone dose reduction or delay
•
Hematopoietic growth factors (eg, G-CSF) Ixabepilone dose reduction
•
• • • •
Dose reductions Intensive fluid management Antidiarrheal medications Prophylactic antibiotics (in patients also experiencing neutropenia) Increase fiber intake Laxatives Nutritional support Antiemetics
• • •
Soothing mouthwashes Pain relief Nutritional support
• •
Dose reduction Analgesics e.g. NSAIDS
•
Correction of known causes (eg, anemia, sleep disorders, anxiety) Regular exercise Antidepressants Antianxiety medications Attention restoring exercises Psychological counseling Physical therapy Plan for hair loss management Cut hair short prior to treatment Use of wig Temporary of permanent discontinuation of ixabepilone
• • • • Stomach pain Bloated feeling Lack or loss of appetite
Sores/inflammation in the mouth Bleeding Severe pain Difficulty swallowing, talking, and eating as well • Severe infections • Pain in muscles (commonly shoulder and paraspinal muscles) • Joints • Lack of energy • Weakness • Difficultly concentrating • • • •
•
• •
• • • • • • •
Hair loss
• Cardiac adverse events
• •
Cardiac ischemia Impaired cardiac function
156
• •
Cancer Therapy Vol 7, page 157 Table 2. Treatment-related Adverse Events (%) Occurring in !10% of Patients in Clinical Trials of Ixabepilone in MBC. Adverse event
Non-hematologic toxicity Peripheral sensory neuropathy Fatigue/asthenia Myalgia/arthralgia Alopecia Nausea Stomatitis/mucositi s/pharyngitis Vomiting Diarrhea Rash Musculoskeletal pain Anorexia Constipation Nail changes Fever Abdominal pain/cramping Headache Neuropathic pain Pain, other Infection without neutropenia Infection/febrile neutropenia Motor neuropathy Taste disturbance/dysgeu sia Hand-foot syndrome Hematologic toxicity Neutropenia Leukopenia Anemia Thrombocytopenia
Thomas et al, 2007b Ixa + X (n = 369) 64 (grade 3/4: 21) 64 (grade 3/4: 16) 53 31 53 33 39
X (n = 368) 16 (grade 3/4: 0) 30 (grade 3/4: 4) 6 3 40 21 24
44 53
39 6
Perez et al, 2007 (n = 126)
RochĂŠ et al, 2007 (n = 65)
Denduluri et al, 2007 (n = 49)
Thomas et al, 2007a (n = 23)
60 (grade 3/4: 14) 50 (grade 3/4: 14) 49 48 42 29 29
71 (grade 3/4: 20) 68 (grade 3/4: 6) 97 92 54 32 26
52 (grade 3/4: 0) 78 (grade 3/4: 13) 30 87 61
63 (grade 3/4: 12) 76 (grade 3/4: 27) 84 43 57 28 41
22 49
29 97 22
48 30
39
31 84 12
20 31 22 20
14 6 8
19 16 9
18 20 17 14 8
13 11
14 12 14 14
8
16
0.3
64
62
89 (grade 3/4: 67) 90 (grade 3/4: 57) 90 (grade 3/4: 9) 54 (grade 3/4: 8)
43 (grade 3/4: 11) 54 (grade 3/4: 6) 70 (grade 3/4: 4) 31 (grade 3/4: 4)
56 56
18 20 8 16 10
8 65 12
6
0
10 6
6 11
9 65
79 (grade 3/4: 54) 90 (grade 3/4: 49) 84 (grade 3/4: 8) 44 (grade 3/4: 8)
89 (grade 3/4: 58) 92 (grade 3/4: 50) 92 (grade 3/4: 3) 40 (grade 3/ 4: 0)
87 (grade 3/4: 22)
83 (grade 3/4: 0) 52 (grade 3/4: 4)
6
(grade 3/4: 53) 6 (grade 3/4: 2) 6 (grade 3/4: 4)
Ixa = ixabepilone; X = capecitabine; Grade 3/4 = National Cancer Institute Common Toxicity Criteria (CTC) grade 3 or 4; MBC = metastatic breast cancer.
In the pivotal phase III trial, 21% of patients with MBC previously treated with or resistant to anthracycline and resistant to taxanes receiving a combination of ixabepilone plus capecitabine had grade 3/4 peripheral sensory neuropathy compared with no patients receiving capecitabine alone (Thomas et al, 2007b). Most
neuropathy with ixabepilone appears to be reversible within an acceptable timeframe and manageable with dose reduction (Armstrong et al, 2005; Gianni, 2007; Vahdat et al, 2007; Wickham, 2007). In the phase II study of ixabepilone monotherapy in patients with triple resistant MBC, the median time to resolution of grade !2
157
Palmieri and Hopkins: Ixabepilone, a new class of chemotherapy for advanced breast cancer neuropathy was 4.0 weeks and the median time to improvement of grade !3 neuropathy (returning to baseline or grade 1) was 4.6 weeks (Perez et al, 2007). A similar result was observed in the phase III study of ixabepilone in combination with capecitabine, where grade 3/4 neuropathy resolved within a median of 6 weeks (Thomas et al, 2007b). In comparison, approximately half of the patients treated with polyoxyethylated castor oilbased paclitaxel experience improvement in peripheral neuropathy within 9 months (Postma et al, 1995). The median time to improvement of neuropathy following treatment with nanoparticle albumin-bound paclitaxel was 22 days in a phase III trial (Gradishar et al, 2005). Risk factors that need to be considered in the treatment of patients with microtubule stabilizing agents include preexisting neuropathies, diabetes mellitus, and prior exposure to neurotoxic drugs (Markman, 2003; Gianni, 2007; Wickham, 2007) (Table 3). Ixabepilone is not a suitable therapy for patients with grade 2 or higher neuropathy, and these patients were excluded from the clinical trials program (Bristol-Myers Squibb [IXEMPRA], 2007). Patients with diabetes mellitus are at increased risk of severe neuropathy; therefore, caution is warranted when using ixabepilone in these patients (Bristol-Myers Squibb [IXEMPRA], 2007). The total cumulative dose and duration of infusion of ixabepilone therapy are known risk factors for peripheral neuropathy (Table 3) (Wickham, 2007). This is also the case with other microtubule-stabilizing agents, including taxanes (Lee and Swain, 2005). For this reason the 3-hour infusion schedule for ixabepilone was designed to minimize neuropathy (Thomas et al, 2007a). Early recognition of neuropathy is important in limiting and managing this adverse event, and careful baseline and ongoing assessment is warranted. Early identification of patients who are at risk of developing chemotherapy-induced peripheral neuropathy is enhanced with a brief assessment of the peripheral nervous system at baseline and before each chemotherapy cycle (Table 4) (Armstrong et al, 2005; Wickham, 2007). Effective management also includes education of common neurological symptoms, such as loss of sensation that could progress to weakness, numbness or tingling (parasthesia), or burning pain from the most distal to proximal areas occurring in a stocking/glove distribution (Table 4) (Armstrong et al, 2005; Wickham, 2007). These symptoms are bilateral, occur in either the short or long term and may be cumulative. Patients experiencing clinically relevant neuropathy (ie, more than minimal numbness and tingling in the fingers and toes) (Markman, 2003) should have their dose of ixabepilone reduced or delayed (Bristol-Myers Squibb [IXEMPRA], 2007). Ixabepilone should not be restarted in these patients until neuropathy returns to baseline or less than grade 1 severity. It may not always be practical for nurses to undertake comprehensive neurologic assessment of patients. However, evaluation of baseline neurological function tests (selected for their ease of use) in a phase II study of ixabepilone monotherapy (Low et al, 2005) showed that some methods may help predict the
occurrence of peripheral neuropathy (Lee et al, 2006) Further studies are needed to confirm these findings.
B. Bone marrow suppression Bone marrow suppression is common in patients receiving ixabepilone alone or in combination with capecitabine and is manageable with dose modification. While the majority of patients experience some degree of neutropenia, grade 3/4 febrile neutropenia is uncommon (Perez et al, 2007; Thomas et al, 2007b; Vahdat et al, 2007). Hematopoietic growth factors may be used at the discretion of the oncologist (Thomas et al, 2007b; Vahdat et al, 2007)0. ASCO guidelines recommend the use of colony stimulating factors (CSFs) when the risk of febrile neutropenia is greater than 20%, for example following treatment with anthracyclines or taxanes (Smith et al, 2006). Proactive use of G-CSF can reduce the severity and shorten the duration of chemotherapy-induced neutropenia (Wilson and Gardner, 2007). Treatment with G-CSF should also be considered for patients who are predisposed to febrile neutropenia, for example patients who have had previous episodes of febrile neutropenia or prolonged periods of neutropenia. Other risk factors include: use in patients who are greater than 65 years of age, poor performance status, extensive prior treatment, administration of combined chemotherapy, and more advanced disease (Smith et al, 2006; Wilson and Gardner, 2007). Anemia and thrombocytopenia following treatment Table 3. Risk Factors for Chemotherapy-induced Peripheral Neuropathy (Markman, 2003; Gianni, 2007; Wickham, 2007). Advanced age Treatment schedule and dose Total cumulative dose Doses per cycle Duration of infusion Comorbid conditions Peripheral vascular disease Arthritis or connective tissue disease Diabetes Alcoholism HIV and other immunosuppressive illnesses Nutritional problems (eg, vitamin B-1, E or folate deficiency) Crohnâ&#x20AC;&#x2122;s disease Congenital neuropathy Previous sensory neuropathy Previous and concomitant exposure to other neurotoxic agents (eg, Cisplatin) CNS depressants (sedatives, antiemetics, and tranquilizers) Heavy metals or industrial toxins
158
Cancer Therapy Vol 7, page 159 Table 4. Management of Chemotherapy-induced Peripheral Neuropathy (Armstrong et al, 2005; Wickham, 2007). Actions Baseline assessment
• • • – • • – – – • – – – – •
Identify patients at risk of neuropathy Assess risk factors Review medications Assess previous chemotherapy regimens Determine current symptoms Are they consistent with neuropathy (eg, tingling, numbness, bilateral vs focal) Brief/focused physical assessment (gait, motor, reflexes, sensory, autonomic) Ensure early recognition of symptoms Document and report onset and progression Neuropathy occurs within one week of treatment and resolves less than two weeks after chemotherapy administration Grade severity and effects on daily living Distinguish from hypersensitivity reactions Encourage nurse-patient communication Promote the reporting of symptoms Safe administration of chemotherapy (eg, dose modification) Adjunctive therapies, eg, Pain management (dependent on pain severity and type) IV/oral calcium and magnesium B complex vitamin supplement Promotion of self and home safety Potholder use Gardening/dish gloves Water temperature awareness Foot injury prevention Occupational therapy consult for adapting activities of daily living
• •
Assessment and revision of home environment Low impact exercise
• •
Massage Mild temperature whirlpool therapy
• – – – • – •
Ongoing assessment
Patient education Interventions
• • –
with ixabepilone are generally mild-to-moderate (Perez et al, 2007). Anemia may be treated with erythropoieticstimulating agents if clinically indicated (Mock and Olsen, 2003; Smyth and Zumbrink, 2005; Foubert, 2006; Bokemeyer et al, 2007). Patients who experience severe neutropenia or thrombocytopenia should have their dose of ixabepilone reduced on subsequent cycles. In the phase III trial, it was observed that the risk of mortality associated with neutropenia was higher in patients with liver dysfunction (Thomas et al, 2007).
atropine, but may necessitate dose modification. Prophylactic treatment with antibiotics may be considered in patients with neutropenia experiencing diarrhea (Marse et al, 2004). Nausea and vomiting with ixabepilone is infrequent; when it does occur, antiemetics may be prescribed as needed for individual patients, with anticipatory guidance and appropriate symptom management in these cases (Dibble et al, 2004). Mucositis and stomatitis are also not common following treatment with ixabepilone, but can be managed using soothing mouthwashes and appropriate pain relief, as well as nutritional support (Wojtaszek, 2000; Harris and Knobf, 2004; Cawley and Benson, 2005).
C. Gastrointestinal adverse events Gastrointestinal symptoms (anorexia, constipation, stomatitis/pharyngitis, nausea, vomiting, and diarrhea) caused by ixabepilone may require dose reductions and intensive fluid management, depending on the type and severity of the toxicity. Grade 3/4 diarrhea is rare with ixabepilone but can be the most dangerous adverse event associated with capecitabine (Marse et al, 2004). Patient education is critical to the early identification of treatmentrelated diarrhea associated with combination therapy. Diarrhea can generally be treated with antidiarrheal medications such as loperamide, or diphenoxylate and
D. Other adverse events Myalgias and arthralgias occur infrequently following treatment with ixabepilone. Presentation occurs most commonly in the shoulder and paraspinal muscles within a few days post treatment, with resolution within 26 days. These adverse events are primarily treated with non-steroidal anti-inflammatory drugs (NSAIDs) (Markman, 2003). Ixabepilone dose reductions or treatment with analgesics (including narcotics) may be 159
Palmieri and Hopkins: Ixabepilone, a new class of chemotherapy for advanced breast cancer warranted, depending on the severity of myalgia or arthralgia. Fatigue is one of the most problematic side effects reported following treatment for breast cancer and is common with ixabepilone. It can add to the severity of other symptoms of chemotherapy, and may affect the patient’s quality of life and ability to manage self-care (NCCN, 2007). Fatigue is described as lethargy with weakness, total lack of energy, or malaise. It may be associated with sleep disorders, anxiety, difficulty with concentration, thinking clearly, or difficulty in making decisions. Interventions for fatigue can be based on identification of symptoms causing distress and the impact on activities of daily living or function. Interventions include the following: correction of known causes of fatigue (for example anemia, nutritional deficits, sleep disorders), regular exercise, antidepressants and antianxiety medications, attention restoring activities, psychological counseling, and physical therapy (NCCN, 2007). Cardiac adverse events are uncommon following treatment with ixabepilone. However, temporary or permanent discontinuation of ixabepilone should be considered in patients who develop cardiac ischemia or impaired cardiac function (Bristol-Myers Squibb [IXEMPRA], 2007). Alopecia caused by ixabepilone and capecitabine may have a pronounced psychological effect in women. Steps should be taken to minimize the impact of profound hair loss, for example working with the patient to develop a plan for hair loss management. The patient may choose to direct the events of hair loss by cutting their hair short prior to first treatment, or to use a wig (Markman, 2003; Frith et al, 2007). Hand-foot syndrome should be managed by appropriate dose modifications (Lassere and Hoff, 2004; Marse et al, 2004). Symptomatic relief can be provided by hand creams and emollients (Marse et al, 2004).
solution may be stored in the vial for a maximum of 1 hour at room temperature and room light. After final dilution with LRI, the solution is stable at room temperature and room light for a maximum of 6 hours. Administration of the entire infusion volume must be completed within the 6-hour time period. The recommended dose of ixabepilone is 40 mg/m2. Doses for patients with a body surface area greater than 2.2 m2 should be calculated as for 2.2 m2. Ixabepilone is given by IV administration over 3 hours. The infusion must be administered through an appropriate in-line filter with a 0.2 to 5.0 micron microporous membrane. Other schedules of ixabepilone, such as 6 mg/m2/day given on days 1 to 5 every 3 weeks, have been developed in an effort to continue to optimize the therapeutic ratio for individual patients (Denduluri et al, 2007). Premedication with orally administered H1- and H2blocking antihistamines is required to minimize the risk of hypersensitivity reactions. Corticosteroid premedication is not mandatory for ixabepilone. However, if the patient has experienced a previous hypersensitivity reaction, premedication may be needed. In contrast, the taxanes, paclitaxel and docetaxel, exhibit greater hypersensitivity and both require steroid premedication (Myers, 2000; Markman, 2003). The constituted admixture solution of ixabepilone contains less total dose Cremophor® EL compared with these taxanes (Perez et al, 2007; BristolMyers Squibb [TAXOL], 2007). If hypersensitivity reactions do occur with ixabepilone, they must be managed immediately and appropriately. Management may include stopping the infusion, administering oxygen, infusing fluids, monitoring blood pressure, pulse, and oxygenation, and initiating IV corticosteroids and diphenhydramine or other emergency medications (Myers, 2000; Lenz, 2007) Patients who experience a hypersensitivity reaction in one cycle of ixabepilone are premedicated in subsequent cycles with a corticosteroid in addition to the H1 and H2 antagonists, and an extension of the infusion time should be considered. Future regimens for the treatment of breast cancer may combine ixabepilone with other chemotherapies and targeted agents such as bevacizumab and trastuzumab. A recent phase II study demonstrated that a combination of trastuzumab, weekly ixabepilone and carboplatin was active and had an acceptable safety profile in patients with HER-2-positive MBC (Moulder et al, 2007; Pivot et al, 2007). A phase III trial comparing ixabepilone plus trastuzumab with docetaxel plus trastuzumab in patients with HER-2-positive locally advanced and/or metastatic disease [NCT00490646] is underway. An additional randomized, phase III, three-arm trial will compare two schedules of ixabepilone plus bevacizumab with paclitaxel plus bevacizumab as first-line therapy in patients with locally recurrent or metastatic disease [NCT00370552].
IV. Practical aspects of ixabepilone administration for nurses Ixabepilone is supplied as a 2-vial system (lyophile and vehicle for constitution). Appropriate protective clothing, eye shield, mask, and gloves should be worn and Class II vertical-laminar-airflow safety cabinets should be used during the preparation and handling of ixabepilone. The diluent used with ixabepilone is a BMS-purified polyoxyethylated castor oil (Cremophor® EL), which has the potential for inducing a hypersensitivity reaction. The constituted solution must be further diluted with Lactated Ringer’s Injection, USP (LRI) before administration. It is important to use LRI containers that are free from di-(2ethylhexyl) phthalate (DEHP) to minimize patient exposure to this plasticizer, which may be leached from PVC infusion bags or sets. Ixabepilone should be stored in the refrigerator and protected from light. Both the lyophile and vehicle should be removed from the refrigerator and allowed to stand at room temperature for 30 minutes before constitution. Any precipitate that may be present in the vehicle should dissolve after being at room temperature. After constitution with Cremophor® EL, the
V. Conclusions Ixabepilone is one of the first agents in a new class of effective chemotherapy agents, the epothilones, which offers the clinical advantage of less susceptibility to drug resistance mechanisms than taxanes. For patients in whom taxanes and anthracyclines have failed, ixabepilone 160
Cancer Therapy Vol 7, page 161 (2002) Chemotherapy for metastatic breast cancer-report of a European expert panel. Lancet Oncol 3, 719-27. Denduluri N, Low JA, Lee JJ, Berman AW, Walshe JM, Vatas U, Chow CK, Steinberg SM, Yang SX, Swain SM (2007) Phase II trial of ixabepilone, an epothilone B analog, in patients with metastatic breast cancer previously untreated with taxanes. J Clin Oncol 25, 3421-7. Dibble SL, Casey K, Nussey B, Israel J, Luce J (2004) Chemotherapy-induced vomiting in women treated for breast cancer. Oncol Nurs Forum 31, E1-8. Foubert J (2006) New EORTC guidelines for the treatment of anaemia in patients with cancer: implications for nursing practice. Eur J Oncol Nurs 10, 177-86. Frith H, Harcourt D, Fussell A (2007) Anticipating an altered appearance: Women undergoing chemotherapy treatment for breast cancer. Eur J Oncol Nurs 11, 385-91. Fumoleau P, Largillier R, Clippe C, Dieras V, Orfeuvre H, Lesimple T, Culine S, Audhuy B, Serin D, Curé H, Vuillemin E, Morère JF, Montestruc F, Mouri Z, Namer M (2004) Multicentre, phase II study evaluating capecitabine monotherapy in patients with anthracycline- and taxanepretreated metastatic breast cancer. Eur J Cancer 40, 53642. Fumoleau P, Llombart-Cussac A, Roché H, Pivot X, Martin M, Kubista E, Verrill M, Conté PF (2007, September) Clinical activity of the novel epothilone B analog, ixabepilone, across the breast cancer disease continuum. Presented at ECCO 14, Barcelona, Spain. Gennari A, Conte P, Rosso R, Orlandini C, Bruzzi P (2005) Survival of metastatic breast carcinoma patients over a 20year period: a retrospective analysis based on individual patient data from six consecutive studies. Cancer 104, 174250. Gianni L (2007) Ixabepilone and the narrow path to developing new cytotoxic drugs. J Clin Oncol 25, 3389-91. Gottesman MM (2002) Mechanisms of cancer drug resistance. Annu Rev Med 53, 615-27. Gradishar WJ, Tjulandin S, Davidson N, Shaw H, Desai N, Bhar P, Hawkins M, O'Shaughnessy J (2005) Phase III trial of nanoparticle albumin-bound paclitaxel compared with polyethylated castor oil-based paclitaxel in women with breast cancer. J Clin Oncol 23, 7794-803. Hamilton A, Hortobagyi G (2005) Chemotherapy: what progress in the last 5 years? J Clin Oncol 23, 1760-75. Harris DJ, Knobf MT (2004) Assessing and managing chemotherapy-induced mucositis pain. Clin J Oncol Nurs 8, 622-28. Jemal A, Siegel R, Ward E, Murray T, Xu J, Thun MJ (2007) Cancer statistics, 2007. CA Cancer J Clin 57, 43-66. Lassere Y, Hoff P (2004) Management of hand-foot syndrome in patients treated with capecitabine (Xeloda). Eur J Oncol Nurs 8 Suppl 1, S31-40. Lee FY, Borzilleri R, Fairchild CR, Kim SH, Long BH, Reventos-Suarez C, Vite GD, Rose WC, Kramer RA (2001) BMS-247550: a novel epothilone analog with a mode of action similar to paclitaxel but possessing superior antitumor efficacy. Clin Cancer Res 7, 1429-37. Lee JJ, Low JA, Croarkin E, Parks R, Berman AW, Mannan N, Steinberg SM, Swain SM (2006) Changes in neurologic function tests may predict neurotoxicity caused by ixabepilone. J Clin Oncol 24, 2084-91. Lee JJ, Swain SM (2005) Development of novel chemotherapeutic agents to evade the mechanisms of multidrug resistance (MDR). Semin Oncol 32, S22-26. Lenz HJ (2007) Management and preparedness for infusion and hypersensitivity reactions. Oncologist 12, 601-9. Lerzo G, Lee RK, Thomas ES, Chung H, Fein LE, Chan VF, Jassem J, Hurtado de Mendoza F, Mukhopadhyay P, Roché
provides an effective treatment option, as a single agent or in combination with capecitabine. In addition, patients who have received multiple prior therapies and have developed resistance, clinical activity is seen in patients with LABC or MBC receiving ixabepilone as their primary systemic therapy. Ixabepilone has a manageable safety profile in these populations, but awareness of potential adverse events and risk factors for these events, notably peripheral neuropathy, is essential to optimize the therapeutic benefits of this new chemotherapy agent.
Acknowledgement The authors take full responsibility for the content of this publication, and confirm that it reflects their viewpoint and medical expertise. They also wish to acknowledge Gardiner-Caldwell US, funded by Bristol-Myers Squibb, for providing writing and editing support. Bristol-Myers Squibb did not influence the content of the manuscript, nor did the authors receive financial compensation for authoring the manuscript.
References American Cancer Society. How is breast cancer staged? Retrieved November 2008 from http://www.cancerorg/docroot/CRI/content/CRI_2_4_3X_Ho w_is_breast_cancer_staged_5 asp. Armstrong T, Almadrones L, Gilbert MR (2005) Chemotherapyinduced peripheral neuropathy. Oncol Nurs Forum 32, 30511. Baselga J, Gianni L, Llombart A, Manikhas G, Kubista E, Steger G, Lee H, Ronczka A, Xu L, Clark E, Galbraith S (2005) Predicting response to ixabepilone: genomics study in patients receiving single agent ixabepilone as neoadjuvant treatment for breast cancer (BC). Breast Cancer Res Treat 94, S31. Blum JL, Jones SE, Buzdar AU, LoRusso PM, Kuter I, Vogel C, Osterwalder B, Burger HU, Brown, CS, Griffin T (1999) Multicenter phase II study of capecitabine in paclitaxelrefractory metastatic breast cancer. J Clin Oncol 17, 485-93. Blum, JL (2001) The role of capecitabine, an oral, enzymatically activated fluoropyrimidine, in the treatment of metastatic breast cancer. Oncologist 6, 56-64. Bokemeyer C, Aapro MS, Courdi A, Foubert J, Link H, Osterborg A, Repetto L, Soubeyran P; European Organisation for Research and Treatment of Cancer (EORTC) Taskforce for the Elderly (2007) EORTC guidelines for the use of erythropoietic proteins in anemic patients with cancer: 2006 update. Eur J Cancer 43, 258-70. Bristol-Myers Squibb (2007) IXEMPRA™ (ixabepilone) package insert. Princeton, NJ. Bristol-Myers Squibb (2007) TAXOL® (paclitaxel) package insert. Princeton, NJ. CancerSymptoms.org (2006) Information for Understanding Cancer Symptoms. Retrieved November 2008 from http://www.cancersymptoms.org/. Cawley MM, Benson LM (2005) Current trends in managing oral mucositis. Clin J Oncol Nurs 9, 584-92. Colozza M, de Azambuja E, Cardoso F, Bernard C, Piccart MJ (2006) Breast cancer: achievements in adjuvant systemic therapies in the pre-genomic era. Oncologist 11, 111-25. Cortes J, Baselga J (2007) Targeting the microtubules in breast cancer beyond taxanes: the epothilones. Oncologist 12, 27180. Crown J, Dieras V, Kaufmann M, von Minckwitz G, Kaye S, Leonard R, Marty M, Misset JL, Osterwalder B, Piccart M
161
Palmieri and Hopkins: Ixabepilone, a new class of chemotherapy for advanced breast cancer HH (2007, September) Phase III study of ixabepilone plus capecitabine in metastatic breast cancer (MBC) progressing after anthracyclines and taxanes: Subgroup analysis in HER2+ disease. Presented at the 2007 ASCO Breast Cancer Symposium, San Francisco, California, USA. Low JA, Wedam SB, Lee JJ, Berman AW, Brufsky A, Yang SX, Poruchynsky MS, Steinberg SM, Mannan N, Fojo T, Swain SM (2005) Phase II clinical trial of ixabepilone (BMS247550), an epothilone B analog, in metastatic and locally advanced breast cancer. J Clin Oncol 23, 2726-34. Markman M (2003) Management of toxicities associated with the administration of taxanes. Expert Opin Drug Saf 2, 141-6. Marse H, Van CE, Grothey A, Valverde S (2004) Management of adverse events and other practical considerations in patients receiving capecitabine (Xeloda). Eur J Oncol Nurs 8 Suppl 1, S16-30. Mielke S, Sparreboom A, Mross K (2006) Peripheral neuropathy: a persisting challenge in paclitaxel-based regimes. Eur J Cancer 42, 24-30. Mock V, Olsen M (2003) Current management of fatigue and anemia in patients with cancer. Semin Oncol Nurs 19, 3641. Moulder SL, Wang M, Gradishar W, Perez EA, Sparano J, Pins M, Sledge G, Eastern Cooperative Oncology Group (2007, September) A phase II trial of trastuzumab, weekly ixabepilone and carboplatin (TIC) in patients with HER2/neu-positive (HER2+) metastatic breast cancer (MBC): A trial coordinated by the Eastern Cooperative Oncology Group. Presented at the 2007 ASCO Breast Cancer Symposium, San Francisco, California, USA. Myers JS (2000) Hypersensitivity reaction to paclitaxel: nursing interventions. Clin J Oncol Nurs 4, 161-3. Nahta R, Esteva FJ (2006) HER2 therapy: molecular mechanisms of trastuzumab resistance. Breast Cancer Res 8, 215. National Comprehensive Cancer Network (NCCN) (2008) Practice Guidelines in Oncology: Breast Cancer - v.2.2008. Retrieved November 2008 from http://www.nccn.org/. O'Shaughnessy J (2005) Extending survival with chemotherapy in metastatic breast cancer. Oncologist 10 Suppl 3, 20-9. O'Shaughnessy JA, Clark RS, Blum JL, Mennel RG, Snyder D, Ye Z, Liepa AM, Melemed AS, Yardley DA (2005) Phase II study of pemetrexed in patients pretreated with an anthracycline, a taxane, and capecitabine for advanced breast cancer. Clin Breast Cancer 6, 143-9. Perez EA, Lerzo G, Pivot X, Thomas E, Vahdat L, Bosserman L, Viens P, Cai C, Mullaney B, Peck R, Hortobagyi GN (2007) Efficacy and safety of ixabepilone (BMS-247550) in a phase II study of patients with advanced breast cancer resistant to an anthracycline, a taxane, and capecitabine. J Clin Oncol 25, 3407-14. Pivot X, Dufresne A, Villanueva C (2007) Efficacy and safety of ixabepilone, a novel epothilone analogue. Clin Breast Cancer 7, 543-9. Pivot X, Lee RK, Thomas ES, Chung H, Fein LE, Chan VF, Jassem J, Hurtado de Mendoza F, Mukhopadhyay P, Roché HH (2007) Phase III study of ixabepilone plus capecitabine in patients with metastatic breast cancer (MBC) resistant to anthracyclines/taxanes: Subgroup analysis by estrogen receptor (ER) status (Abst 221). Presented at the 2007 ASCO Breast Cancer Symposium, San Francisco, California, USA. Postma TJ, Vermorken J B, Liefting AJ, Pinedo HM, Heimans JJ (1995) Paclitaxel-induced neuropathy. Ann Oncol 6, 489-94. Reichardt P, Von Minckwitz G, Thuss-Patience PC, Jonat W, Kölbl H, Jänicke F, Kieback DG, Kuhn W, Schindler AE, Mohrmann S, Kaufmann M, Lück HJ (2003) Multicenter phase II study of oral capecitabine (Xeloda(")) in patients
with metastatic breast cancer relapsing after treatment with a taxane-containing therapy. Ann Oncol 14, 1227-33. Roché H, Yelle L, Cognetti F, Mauriac L, Bunnell C, Sparano J, Kerbrat P, Delord JP, Vahdat L, Peck R, Lebwohl D, Ezzeddine R, Curé H (2007) Phase II clinical trial of ixabepilone (BMS-247550), an epothilone B analog, as firstline therapy in patients with metastatic breast cancer previously treated with anthracycline chemotherapy. J Clin Oncol 25, 3415-20. Schneider BP, Sledge GW Jr (2007) Drug insight: VEGF as a therapeutic target for breast cancer. Nat Clin Pract Oncol 4, 181-9. Smith TJ, Khatcheressian J, Lyman GH, Ozer H, Armitage JO, Balducci L, Bennett CL, Cantor SB, Crawford J, Cross SJ, Demetri G, Desch CE, Pizzo PA, Schiffer CA, Schwartzberg L, Somerfield MR, Somlo G, Wade JC, Wade JL, Winn RJ, Wozniak AJ, Wolff AC (2006) 2006 update of recommendations for the use of white blood cell growth factors: an evidence-based clinical practice guideline. J Clin Oncol 24, 3187-205. Smyth D, Zumbrink S (2005) Optimising the management of anaemia in patients with cancer with practice guidelines using erythropoiesis-stimulating proteins. Eur J Oncol Nurs 9 Suppl 1, S3-13. Thomas E, Tabernero J, Fornier M, Conté P, Fumoleau P, Lluch A, Vahdat LT, Bunnell CA, Burris HA, Viens P, Baselga J, Rivera E, Guarneri V, Poulart V, Klimovsky J, Lebwohl D, Martin M (2007a) Phase II clinical trial of ixabepilone (BMS-247550), an epothilone B analog, in patients with taxane-resistant metastatic breast cancer. J Clin Oncol 25, 3399-406. Thomas ES, Gomez HL, Li RK, Chung HC, Fein LE, Chan VF, Jassem J, Pivot XB, Klimovsky JV, de Mendoza FH, Xu B, Campone M, Lerzo GL, Peck RA, Mukhopadhyay P, Vahdat LT, Roché HH (2007b) Ixabepilone plus capecitabine for metastatic breast cancer progressing after anthracycline and taxane treatment. J Clin Oncol 25, 5210-7. Vahdat L, Thomas E, Li R, Jassem J, Gomez H, Chung H, Peck R, Mukhopadhyay P, Klimovsky J, Roché H (2007) Phase III trial of ixabepilone plus capecitabine compared to capecitabine alone in patients with metastatic breast cancer (MBC) previously treated or resistant to an anthracycline and resistant to taxanes. J Clin Oncol 25, 18S. Wickham R (2007) Chemotherapy-induced peripheral neuropathy: a review and implications for oncology nursing practice. Clin J Oncol Nurs 11, 361-76. Wilson BJ, Gardner AE (2007) Nurses' guide to understanding and implementing the National Comprehensive Cancer Network guidelines for myeloid growth factors. Oncol Nurs Forum 34, 347-53. Wojtaszek C (2000) Management of chemotherapy-induced stomatitis. Clin J Oncol Nurs 4, 263-70.
Frances M. Palmieri, Una Hopkins
162
Cancer Therapy Vol 7, page 163 Cancer Therapy Vol 7, 163-173, 2009
New approaches in treatment of B-cell chronic lymphocytic leukemia Review Article
Mariusz Stram1, Jacek Tabarkiewicz1,*, Iwona Hus2, Jacek Roli!ski1 1
Clinical Immunology Department, Medical University of Lublin, Lublin, Poland Hematooncology and Bone Marrow Transplantation Department, Medical University of Lublin, Lublin, Poland
2
__________________________________________________________________________________ *Correspondence: Jacek Tabarkiewicz, Clinical Immunology Department, Medical University of Lublin, Lublin, Poland; Tel: +48 81 718 73 15; Fax: +48 81 718 73 15; e-mail: tabar@mp.pl Key words: chronic lymphocytic leukemia, monoclonal antibodies, immunotherapy, dendritic cells Abbreviations: Alemtuzumab, (Campath-1H, ALT); antibody dependent cytotoxicity, (ADCC); Cancer and Leukemia Group B, (CALGB); complement dependent cytotoxicity, (CDC); complete response, (CR); cyclo-oxygenase 2, (COX-2); cytomegalovirus pneumonitis, (CMV); dendritic cells, (DCs); fludarabine, cyclophosphamide, and rituximab, (FCR); graft-versus-leukemia, (GVL); immunoglobulin heavy-chain variable region, (IgVH); lactate dehydrogenase, (LDH); lipoprotein lipase, (LPL); minimal residual disease, (MRD); non-Hodgkin`s lymphoma, (NHL); overall response, (OR); overall survival, (OS); progression-free survival time, (PFS); Rituximab, (Mabthera, RIT); transplant related mortality, (TRM) Received: 24 February 2009; Revised: 16 March 2009 Accepted: 20 March 2009; electronically published: March 2009
Summary Chronic lymphocytic leukemia is one of the most common adult leukemias in the western world, with a very variable clinical course. Many patients do not need any treatment for a long time, but some have to be treated directly after the diagnosis. The conventional therapy scheme includes treatment with alkylating agents, purine analogues, monoclonal antibodies, or hematopoietic cell transplantation. New treatment approaches of B-CLL are vaccination with dendritic cells (DCs) and use of novel agents such as immunomodulating drugs.
progression are associated with the defects of apoptosis (programmed cell death) (McConkey et al, 1998). B-CLL is currently incurable and concerns mainly elderly patients, over the age of 65 (Rozman et Montserrat, 1995). The clinical course and prognosis of this disease is highly variable. The median survival time after diagnosis ranges 10 years in early stage patients, although individual survival varies (Rai et al, 1975). The diagnosis of B-CLL does not signify the need for therapy. In many cases, patients do not need treatment for a long time, or even for the rest of their lives. Treatment is necessary when patients become symptomatic or develop signs of rapid progression. The treatment is usually noncurative, but reduces the symptoms (Abbott, 2006). The starting time of chemotherapy in CLL patients has been established by the National Cancer Institute Sponsored Working Group. Therapy should not be initiated in patients with Rai stage 0 or Binet A until the disease progression or disease related symptoms are observed (Cheson et al, 1996, Update 2008). The current standards include treatment with alkylating agents, purine analoges, or both. Recently, monoclonal antibodies
I. Introduction B-cell chronic lymphocytic leukemia (B-CLL) is the most common type of adult leukemia in western countries. It occurs most frequently in Europe, North America and is less common in Asia, Japan and China (Linet et al, 1988; Sgambati et al, 2003). The diagnosis of B-CLL requires the presence of at least 5 x 109 B lymphocytes/L in the peripheral blood. The clonality of the circulating B lymphocytes needs to be confirmed by flow cytometry. The leukemia cells found in the blood are small, mature lymphocytes with a narrow border of cytoplasm and a dense nucleus, lacking discernible nucleoli and having partially aggregated chromatin (Hallek et al, 2008). It is characterized by accumulation and proliferation of neoplastic, functionally incompetent, CD5+, CD19+, CD20+, HLA-DR+, CD23+, sIg dim B cells in the blood, bone marrow, spleen and lymph nodes (Cheson et al, 1996). Characteristically, the level of surface immunoglobulin, CD20 is low comparing to this on normal B cells (Ginaldi et al, 1998). Most of those B-cells are in the early, G1 phase of the cell cycle (Obermann et al, 2007). The accumulation of leukemic cells and disease
163
Stram et al: New approaches in treatment of B-cell chronic lymphocytic leukemia therapy has been introduced in treatment strategies (Zent et Kay, 2004). A potential cure for B-CLL is allogeneic stem cell transplantation, but it is associated with high risk of complications (Keating et al, 2003). The new treatment option is immunotherapy: monoclonal antibodies or vaccines with modified leukemic cells or dendritic cells. In this article we present conventional and innovatory approach for B-CLL treatment.
lower risk of progressive disease and a longer survival time, whereas cases with the absence of this mutation characterize poorer clinical course, higher clinical staging, shorter survival time and worse response to treatment (Damle et al, 1999; Hamblin et al, 1999). Unfortunately, gene sequence determination is very difficult, expensive and time consuming procedure, therefore it is not frequently carried out in daily medical practice (Bosch et al, 2003). That is why there was a strong need to discover some parameters, which can deflect the immunoglobulin gene mutational status and which could be used routinely in clinical practice. The ZAP-70, CD38, genes expression for lipoprotein lipase (LPL) or for methaloproteinase 29 (ADAM29) could be used as surrogate marker for IgVH mutational status in B-CLL (Crespo et al, 2003; Damle et al, 1999; Del Poeta et al, 2001,Van`t Veer et al, 2006; Oppezzo et al, 2005). In addition to the classical clinical staging systems (Rai and Binet) which are used to classify the patients into simple prognostic groups, other additional prognostic factors which have been described above help to evaluate the possible clinical course of individual patients with BCLL and combination, the clinical staging systems and additional prognostic factors, provide more precise guidelines for the therapy choice (Herishanu et Polliack, 2005). Some of the prognostic factors and their possible influence on the prognosis are listed in Table 1.
II. Diagnosis and clinical staging Clinical course of B-CLL is very heterogeneous. Sometimes it is very slow and the patient does not need treatment for a long time with the survival time similar to healthy people at the same age, but some patients demonstrate fast progression with the survival time reaching not more than few months. That is why the prognostic factors of this disease are of real significance (Palma et al, 2006). The most common prognostic factor in the patients with B-CLL is the clinical staging. This system was proposed in 1975 by Binet and Rai in 1981. On its basis, it is possible to identify three risk groups of patients. The first with low disease risk - Rai stage 0, Binet stage A - whose median survival is > 10 years, the second group with intermediate disease risk Rai stage I or II, Binet stage B with median survival of about 5-7 years, and those with high disease risk - Rai stage III/IV, Binet stage C with the median survival of 3-4 years (Vasconcelos et al, 2003). Many prognostic factors in B-CLL have been described, e.g. age, sex, lymphocytosis, blood lymphocyte doubling time, type of bone marrow accumulation, serum markers such as: lactate dehydrogenase (LDH), Ă&#x;2microglobulin, sCD23 (a soluble form of CD23) and thymidine kinase; genetic factors such as: chromosome aberration, mutational status (presence or absence) of IgVH genes, ZAP-70 protein expression, CD38 molecule expression, or lipoprotein lipase (LPL) and methaloproteinase (ADAM29) in neoplastic lymphocytes (Dighiero, 2005; Hamblin et al, 1999; Hus et al, 2006; Rai et al, 2001; Kay et al, 2002). Depending on location, chromosome aberrations can be associated with extended or shorten survival time. Patients with 17p deletion (the location of the p53 gene) have a short median survival time (about 30 months) and do not respond to conventional therapy, particularly to purine analogs (Cordone et al, 1998), whereas those with 11q deletion have a rapid disease progression and considerable lymphadenopathy with a median survival time of about 79 months (Dohner et al, 2000). Moreover, patients with 13q deletion have a good prognosis with a median survival time of about 133 months, but those with trisomy of 12 - about 114 months (Dohner et al, 2000). One of the most important prognostic factors is mutational status of immunoglobulin-heavy-chainvariable-region (IgVH). Accordingly we can divide BCLL patients into two prognostic subgroups depending on presence or absence of mutations in the IgVH. (Oscier et al, 1997). Patients with the presence of mutation have
III. Treatment Indication for treatment of patients with B-CLL has been described by National Cancer Institute-Working Group for CLL and it is presented in Table 2 below.
Table 1. Prognostic factors in B-CLL (Shanafelt et al, 2004; Montillo et al, 2005).
Prognostic factors Sex Age Rai clinical staging Binet clinical staging Leukocytosis (x 10 9) Lymphocyte doubling time Trephanobiopsy-type infiltration Percentage of lymphocytes in pattern of bone marrow IgVH gene ZAP-70 CD38 Genetic abnormalities "2-microglobulin; thymidine kinase; LDH; sCD23 - level
164
Prognosis Worse Female < 60 0 A <50 >12
Better Male > 60 III, IV C >50 <12
Non-diffuse
Diffuse
< 80 %
> 80 %
Mutated ! 20 % ! 20 % None; del (11q) Low
Unmutated > 20 % > 20 % del(13q); del (17p) High
Cancer Therapy Vol 7, page 165 (Binet A), Hgb >13 g/dL, blood lymphocytes less than 30x10 9/L, non-diffuse pattern of bone marrow, and lymphocyte doubling time longer than 12 months (Molica, 1991). The response criteria have been described by National Cancer Institue- Working Group for CLL and they are presented in Table 3.
Table 2. Indication for treatment (Hallek et al, 2008). Massive or progressive splenomegaly Massive node or progressive lymphadenopathy General symptoms (weight loss, fatigue, sweat and fever without infections) Lymphocyte doubling time shorter than 6 months Anemia and/or thrombocytopenia not responsive to corticosteroids Clinical staging III, IV Rai or C Binet
A. Chemotherapy For many years alkylating agents have been used as a primary B-CLL therapy. The main drug of alkylating agents - chlorambucil is often combined with prednisone and it is associated with an initial response rate of 60-90 %, but complete remission is observed in less than 10% of treated patients (<10%) (Rai et al, 2000; Robak et al, 2002). Chlorambucil is introduced in the treatment of progressive B-CLL, mainly in older patients and does not prolong the survival time in cases with early clinical staging (Dighiero et al, 1998; Robak, 2007). Chlorambucil combined with prednisone is associated with higher response rate versus monotherapy but both drugs used concomitantly do not prolong the survival time in comparison to the monotherapy (Han et al, 1973).
According to French Cooperative Group on CLL and the Cancer and Leukemia Group B (CALGB) treatment of patients with the early stage disease does not prolong survival and may be associated with higher frequency of epithelial cancers (French Cooperative Group on CLL, 1990). Many patients can be observed without treatment until they exhibit a progressive or symptomatic disease, while patients with advanced clinical staging require therapy at the moment of diagnosis (“watch and wait strategy”). Treatment should not be applied to patients who have smoldering CLL that is those with Rai stage 0
Table 3. Response criteria according to NCI-WG CLL (Hallek et al, 2000) Response Criteria Partial Remission (PR) ! Peripheral blood lymphocyte ! Lymphadenopathy and/or hepatosplenomegaly + one or more of: ! Neutrophils ! !
Platelets Hgb
! Duration Complete Remission (CR) ! Peripherial blood lymphocyte ! Lymphadenopathy ! Hepatomegaly, splenomegaly ! Neutrophils ! Platelets ! Hgb ! Duration ! Bone marrow lymphs Progressive Disease (PD) ! Lymphadenopathy , hepato- or splenomegaly ! Peripheral blood lymphocyte ! Transformation to a more aggressive histology ! Platelets !
# 50% decrease # 50% decrease > 1,5x10 9/L (1500/µL) or > 50% improvement >100x10 9/L (100 000/µL) or # 50% increase 110 g/L (11g/dL) or 50% improvement # 2 month < 4x10 9/L (4000/µL) None > 1,5 cm None >1,5x10 9/L (1500/µL) > 100x10 9/L (100 000/µL) > 110g/L (11g/dL) without transfusion # 2 month < 30% # 50% increase or new # 50% increase Richter`s syndrome Decrease of # 50% from baseline secondary to CLL Decrease of > 2g/dL from baseline secondary to CLL
Hgb
Stabile Disease (SD) ! Patients who have not achieved a PR or a CR, or have not exhibited PD
165
Stram et al: New approaches in treatment of B-cell chronic lymphocytic leukemia In cases when chlorambucil is poorly tolerated, we can use another alkylating agent, such as cyclophosphamide which is more often used in the combination therapy: COP (with vincristine and prednisone) or CHOP (with doxorubicin, vincristine and prednisone), but it still does not prolong the survival time in patients with B-CLL (Flinn et al, 2004). The introduction of purine nucleoside analogues, such as fludarabine and 2-chlorodeoxyadenosine which increase the complete response rate but also increase the complete remission, was a turning point in the treatment of patients with B-CLL. Purine nucleoside analogues are effective by inhibiting ribonucleotide reductase and DNA polymerase and finally promoting apoptosis (Grever et al, 1988). Currently, purine analogues are mainly used in combination with cyclophosphamide and this combination, as it has been shown by Eichorst et al, causes response in 94% cases, complete remission in 24%, and longer progression-free survival time (48 months) comparing to the fludarabine monotherapy (Robak et al, 2000; Rai et al, 2000; Eichorst et al, 2006). It has not been proved that the therapy with purine nucleoside analogues (PNA) prolong survival time (Leporrier et al, 2001) but PNA are counted as a group with the highest efficiency in B-CLL (Johnson et al, 1996), although it could cause complications such as opportunistic infections (Varicella zoster, Herpes zoster, CMV viruses; Pneumocystis carinii) and autoimmune anemia.
30-40%, but in patients not treated previously the response rate was 75-80% (Osterborg et al, 1997; Ludlin et al, 2002). It is possible that alemtuzumab has its efficacy in patients with poor prognosis, such as mutations in p53 gene (deletion of 17p or 11q) which are associated with a shorter survival time and resistance to chemotherapy (Lens et al, 1997; Stilgenbauer et al, 2002). Alemtuzumab eradicated minimal residual disease (MRD) in some patients with CLL, which has been associated with improved survival time (Moreton et al, 2005). Hillmen et al. in their study demonstrated the superiority of alemtuzumab compared with chlorambucil as the first-line treatment for patients with B-CLL. The treated patients had significantly longer progression-free survival time (PFS), higher overall response rate (OR) and complete response (CR), compared with chlorambucil. Despite opportunistic infections, such as cytomegalovirus pneumonitis or pneumocystis carinii pneumonia which have been reported as the most important side effects of alemtuzumab, it may be the most active single agent for the treatment of B-CLL patients with poor risk cytogenetics (Hillmen et al, 2007).
2. Rituximab Rituximab (Mabthera) is a chimeric human/mouse monoclonal antibody that binds the cell surface antigen CD20 and has activity against non-Hodgkin`s lymphoma (NHL), including CLL (McLaughlin et al, 1998). It has single-agent activity in CLL, moreover enhances the response to chemotherapy (Hainsworth et al, 2003). It has anti-tumor activity through mechanisms binding with antibody-dependent cellular cytotoxicity, induction apoptosis and complement activation (Maloney et al, 2002). When rituximab was administrated as a monotherapy to previously untreated B-CLL patients 51% OR rate and 4% CR rate were observed (Hainsworth et al, 2003). CD20 density on B-CLL cells is lower than on lymphoma cells, therefore higher rituximab doses should be used for treatment of patients with CLL (Keating et al, 2000).
B. Immunotherapy The new strategy for treatment of patients with BCLL is use of monoclonal antibodies which can bind specific antigens expressed on B-CLL cells. After binding with antigens, three diverse immune mechanisms of activity have been observed. They may cause antibody dependent cytotoxicity (ADCC), complement dependent cytotoxicity (CDC) and apoptosis activation (Lundin et al, 2004; Dearden et al, 2002). Currently, two monoclonal antibodies, alemtuzumab and rituximab, have most important clinical value in patients with B-CLL.
3. Ofatumumab
1. Alemtuzumab
Ofatumumab is a fully human anti-CD20 monoclonal antibody with higher in vitro efficacy on CLL cells than rituximab (Teeling et al, 2004). It is hypothesized that this efficacy is due to a more stable CD20 binding in comparison with Rituximab. Moreover Ofatumumab binds a different epitope of the CD20 antigen and this may explain some of the difference between this antibodies (Coiffier et al, 2008). It might be an effective treatment for refractory and relapsed patients who have treated with rituximab. Coiffier and colleagues shows results of the a phase 1-2 study of ofatumumab in patients with CLL are encouraging and support further studies (Coiffier et al, 2008).
Alemtuzumab (Campath-1H) is a recombinant DNAderived, humanized MoAb (monoclonal antibody) that is directed against the cell glycoprotein, CD52, which is expressed on the surface of normal and malignant B and T lymphocytes, natural killer cells, monocytes, and macrophages (Gilleece et al, 1993). Binding of alemtuzumab to CD52 initiates complement activation and the membrane attack complex leads to the lysis of the cell. Apart form CDC, alemtuzumab also works by ADCC or by forming a complex between CD52 the cells and Fc receptors on natural killer cells, monocytes and macrophages, leading to target cell destruction. Moreover, the third mechanism of action is the induction of apoptosis of CD52-positive cells (Mone et al, 2004). Alemtuzumab was approved for treatment of the CLL patients with refractory to fludarabine. Osterborg and colleagues have described efficiency of alemtuzumab in patients resistant to conventional therapy and this response rate was about
4. Lumiliximab Lumiliximab is a human primatized monoclonal antibody, targets the CD23 antigen on CLL cells (Byrd et al, 2007). Chu and colleagues have shown that 166
Cancer Therapy Vol 7, page 167 lumiliximab induces apoptosis of B-CLL cells (Chu et al, 2003). Treatment with lumiliximab seemed to be well tolerated and to have clinical activity in patients with previously treated and refractory CLL (Byrd et al, 2007).
German CLL study group (GCLLSG) initiated a multicentre phase III trial, CLL8, to evaluate the efficacy and tolerability of FCR versus FC for the first-line treatment of CLL patients (Hallek et al, 2008). In this study the CR rate of the FCR arm was 52% as compared to 27% in the FC arm. The OR rate was significantly higher in the FCR arm (95%) compared to FC arm (88%), moreover PFS was 76,6% at 2 years in the FCR arm and 62,3% in the FC arm. Treatment with FCR caused more leucopenia and neutropenia without increasing the incidence of severe infections. This study suggest that FCR combination might become the new standard firstline treatment for CLL patients (Hallek et al, 2008). REACH was multicentre, randomized, phase III study to evaluate the efficacy and tolerability of R-FC (Rituximab, Fludarabine, and Cyclophosphamide) versus FC in relapsed or refractory patients with CLL. The primary point of the study was PFS and it was significantly prolonged by median 10 months in the R-FC arm (30,6 months) compared to FC (20,6 months). R-FC was statistically significant and clinically meaningful superior to FC in the primary analysis (Robak et al, 2008). Del Poeta et al. demonstrated that the consolidation and maintenance therapy with rituximab prolong PFS in clinical CR or PR patients with minimal residual disease (MRD) (Del Poeta et al, 2008).
5. Other monoclonal antibodies New monoclonal antibodies have been investigated in several clinical trials for treatment of non-Hodgkin`s lymphoma (NHL) including CLL: epratuzumab - a humanized anti-CD22 monoclonal antibody (Carnahan et al, 2006), CHIR-12.12 - fully human anti-CD40 monoclonal antibody (Tong et al, 2005), milatuzumab (hLL1) - anti-CD74 monoclonal antibody (Stein et al, 2004), galiximab - anti-CD80 monoclonal antibody, or apolizumab (HU1D10) - IgG1 antibody specific for a polymorphic epitope on HLA-DR-Ă&#x;-chain (Lin et al, 2002) and their activity is still under consideration.
C. Chemoimmunotherapy Several reports have suggested that the combination of purine nucleoside analogues and monoclonal antibodies is more efficient than monotherapy. Monoclonal antibodies and chemotherapy cause death of CLL cells by different mechanisms and most probably it is suggested in preclinical evidence, they may act in a synergistic manner (Keating, 2007). Elter et al. investigated the combination of fludarabine and alemtuzumab and they achieved overall response (OR) in about 80% cases with 30% CR even in CLL patients refractory to fludarabine and alemtuzumab monotherapies (Elter et al, 2005). Moreover, Wendtner et al. have shown that consolidation therapy with alemtuzumab caused prolonged PFS and overall survival (OS) (Wendter et al, 2004). Clinical studies have suggested that rituximab sensitizes cells to fludarabine and cyclophosphamide and that fludarabine enhances cell sensitivity to rituximab (Golay et al, 2000; Palma et al, 2006). The addition of rituximab to fludarabine has caused higher overall and complete response rates, and also prolonged disease-free and overall survival time in previously untreated CLL patients (Byrd et al, 2003). Schultz et al. showed that the combination of fludarabine and rituximab (FR) enhances efficacy (25% CR) in previously untreated patients with CLL (Schultz et al, 2002). Keating et al. demonstrated that the combination of fludarabine, cyclophosphamide, and rituximab (FCR) induces 70% CR (OR rate of 95%) as front-line therapy, moreover the combination of fludarabine and rituximab causes prolonged PFS and OS compared to fludarabine monotherapy (Keating et al, 2005). Tam et al. have shown that FCR is the most effective regimen for the initial therapy of CLL. The addition of rituximab to fludarabine and cyclophosphamide (FC) doubled the CR rate and remission duration (72% and 80 month, respectively). The safety profile of FCR was favorable, with early deaths occurring in less than 1% of patients. The FCR regimen has the longest remission duration, highest CR rate, and most survival of frontline regimens for the treatment of CLL (Tam et al, 2008).
D. Hematopoietic cell transplantation Transplantation of autologous or allogeneic hematopoeitic cells provides a therapeutic option for BCLL. It has been applied mainly for patients who failed standard therapies and had high-risk B-CLL (Kharfan et al, 2007), particulary, younger people (<50 years) with remarkably poor prognosis and short predicted survival time (Palma et al, 2006).
1. Autologous transplantation
hematopoietic
cell
One of the most important factors influencing the outcome of autologous transplantation is to control the basic disease before introducing hematopoietic cell transplantation (HCT) (Penesha et al, 2005). Patients with well controlled disease (after the first-line treatment) have been chosen for transplantation, moreover CR after autologous hematopoietic cell transplantation (Auto HCT) is more often in patients without the presence of MRD (Esteve et al, 2001). In the Gribben study 5 of 65 (8%) patients developed posttransplant acute myelogenous leukemia/myelodysplastic syndrome (AML/MDS) (Gribben JG, 2005). Auto HCT is feasible and has low treatment-related mortality (ranges is between 5-19%), but is not curative in B-CLL (Seftel et al, 2007).
2. Allogeneic transplantation
hematopoietic
cell
European Bone Marrow Transplant (EBMT) guidelines conclude that there is evidence base for the efficacy of allogeneic hematopoietic cell transplantation (Allo HCT) in CLL, and this procedure is indicated in high-risk CLL patients. High-risk patients, who have p53 abnormalities, patients who fail to achieve CR or who 167
Stram et al: New approaches in treatment of B-cell chronic lymphocytic leukemia progress within 12 months after purine analogues, those who have relapsed after prior Auto HCT , those who relapse within 24 months after having achieved a response with purine-analogue-based combination therapy, or those who are fludarabine refractory (Gribben, 2009). It can be considered a potentially curative treatment but transplant related mortality (TRM) is still very high (from 25-50%) (Dreger et al, 2005). The graft-versus-leukemia (GVL) effect plays a fundamental role. One of the studies has described that unmutated IgVH genes in patients remained in molecular CR about two years after the transplant (Ritgen et al, 2004). Allo HCT can induce durable response even in cases refractory to conventional therapy, and can induce the plateau phase (free of disease 5-6 years after transplantation in 40-60% of the remaining alive cases) (Montserrat et al, 2007). This transplant should be reserved mainly for younger patients who are not responsive to conventional therapy and with little comorbidity (Seftel et al, 2007). Studies from Anderson Cancer Center demonstrate improved outcome after Allo HCT compared to Auto HCT, suggesting that Allo HCT can induce durable remission even in patients with refractory disease (Gribben, 2009). Reduced-Intensity Conditioning (RIC) Allo HCT, which is applicable to older patients with CLL, attemps to exploit the GVL effect that exists in CLL (Gribben JG, 2009). The availability of RIC has increased use of Allo HCT in B-CLL (Dreger et al, 2007).
loaded with leukemic cells antigens were published. Vaccination with DCs was confirmed as safe and feasible. During the treatment with allologous dendritic cells the number of leukocytes decreased and leukemic CD5+/CD19+ lymphocytes were noted in the peripheral blood (Hus et al, 2005). Nine patients (clinical stage Rai 0 and Rai 1) were included in this trial. Twelve patients (Rai 0-2) were vaccinated with autologous DCs and 5 patients show a decrease of blood leukemic cells count, 3 patients remain in a stable disease and in 5 patients progression of the disease was noticed (Hus et al, 2008). After vaccination, a significant increase of specific cytotoxic CD8+ cells was detected and in responding patients we noticed increased levels of IL-12 serum concentration and decrease in the percentage of circulating T regulatory cells. Vaccination with modified leukemic cells or dendritic cells loaded with leukemic antigens is feasible and safe, but clinical response is still unsatisfying.
F. Novel strategies for treatment of CLL Many new therapeutic options are considered for treatment of B-CLL currently. Merkel and colleagues have demonstrated that arsenic trioxide (As2O3) can induce apoptosis in B-CLL cells, particularly in patients with unfavorable prognostic factors such as unmutated IgVH status, high ZAP-70 expression, high CD38 expression on B cells, del17p13 (Merkel et al, 2008). O`Brien and colleagues have shown randomized phase III trial of fludarabine plus cyclophosphamide with oblimersen sodium (Bcl-2 antisense) in patients with relapsed or refractory CLL (O`Brien et al, 2007). Expression of the antiapoptotic protein Bcl-2 is associated with chemotherapy resistance and decreased survival in CLL. The antisense oligonucleotide oblimersen downregulates Bcl-2 protein in a concentration and time dependent manner and induces apoptosis. The addition of oblimersen to fludarabine plus cyclophosphamide significantly increases the CR and nodular partial response (nPR) rate and duration, when compared to FC combination. Results of this trial suggest that oblimersen therapy is most beneficial in patients who remain fludarabine sensitive (O`Brien et al, 2007). Bendamustine (BEN) is a purine analog / alkylator hybrid agent with a particular mechanisms of action that provides effective treatment for a number hematologic malignancies. The aim of randomized phase III multicenter study was to compare the efficacy and safety of BEN versus chlorambucyl (CLB) in treatment-na誰ve patients with CLL Binet stage B/C. BEN was significantly more effective than CLB in achieving remissions in patients. PFS and duration of remission were also significantly longer and the drug was well tolerated. BEN should be considered as first-line chemotherapy for BCLL Binet stage B/C patients (Knauf et al, 2007). Jensen and colleagues have described in 2008 phase I clinical trials with a novel pro-apoptotic drug R-etodolacnonsteroidal anti-inflammatory drug. This group of drugs can exert anti-tumor activity by inhibiting cyclooxygenase 2 (COX-2) but also through other COXindependent mechanisms. R-etodolac can induce apoptosis
E. Vaccines This is a very interesting option for patients with BCLL, as treatment and vaccination with modified leukemic cells or dendritic cells loaded with B-CLL antigens were included in clinical trials. Wierda and colleagues achieved significant clinical response with the use of leukemic B lymphocytes transduced to express CD154 - CD40-ligand in 7/11 patients (Wierda et al, 2000). Biagi and coworkers also vaccinated B-CLL patients with leukemic lymphocytes modified to express CD154 and additionally IL-2 (Biagi et al, 2005). In three of nine patients specific immunoglobulins were detected after vaccination. Three patients had significant reduction in the size of affected lymph nodes. Nonetheless, the antitumor immune responses were transient and high number of circulating T regulatory cells were present before, during and after vaccination and in vitro removal of these cells increased the specific T-cell reactivity. Oxidized leukemic cells are the next therapeutic agents used for vaccination and clinical response was noted in 5/18 patients vaccinated with this method (Spaner et al, 2005). In all of the mentioned studies, enhanced T cell anti-tumor responses were confirmed. The next method of inducing specific T cells is vaccination with gamma irradiated leukemic cells. Authors noticed significant elongation of lymphocyte doubling time in 7/17 vaccinated patients (Hus et al, 2008). Dendritic cells (DCs) are the most potent antigen presenting cells which seem to be useful tools in immunotherapy of cancer. Results of two clinical trials with the use of autologous and allologous dendritic cells 168
Cancer Therapy Vol 7, page 169 mainly through activation of caspases, down-regulation of antiapoptotic proteins Bcl-2 and Mcl-2, and suppression of cell adhesion molecules. Above proprietes caused that Retodolac therapy may be of interest in B-CLL patients (Jensen et al, 2008). Flavopiridol is a cyclin dependent kinase inhibitor, which in vitro induces apoptosis in B-CLL in cases of drug-resistant CLL (Grever et al, 2007). Another studies have shown that the drug induces apoptosis proteins such as Mcl-1 and X-linked inactivator of apoptosis that mediate resistance to apoptosis in CLL cells lines (Kitada et al, 2000). Christian and colleagues have shown that flavopiridol is a promising agent that induces p53independent apoptosis and a high response rate (Christian et al, 2007). Another potential agent in the treatment of B-CLL is silvestrol, natural molecule isolated from Aglaia foveolata, which also regulates apoptosis independently of p53 (Grever et al, 2007). In preclinical studies silvestrol demonstrates cytotoxicity in the low nanomolar range and in vivo inhibition of tumor cell growth in animal models (Grever et al, 2007). New classes of agents that change expression of cytokines and stimulate effector cells are immunomodulating drugs such as thalidomide and lenalidomide (less toxic analogue of thalidomide). The immunomodulatory effect of these agents is still unclear, but many investigators have suggested that these drugs mediate down regulation of prosurvival cytokines such as tumor necrosis factor alpha (TNF$), interleukines 6 (IL-6) and 8 (IL-8), and vascular endothelial growth factor (VEGF) in the tumor-cell microenvironment (ChananKhan and Porter, 2006). Thalidomide has an antiangiogenic activity, induces apoptosis and modulates the function of T cells. ChananKhan and colleaguesin a phase I/II clinical trial showed the safety and efficacy of combining thalidomide with fludarabine in patients with treatment-naive CLL. OR rate was 100% with 55% of patients achieving CR (ChananKhan AA et al, 2005). Furman and colleagues in a phase II trial investigated thalidomide versus thalidomide and fludarabine in patients who have relapsed or refractory disease. OR rate was 50% for the combination treatment versus 12,5% for thalidomide, and one patient in the combination treatment had a complete response (Furman et al, 2005). However, long-term cure and dose escalation are limited by the drugs' sedative and neurologic effects (Molica S, 2007). Lenalidomide, a thalidomide analogue, is an immunomodulating drug with antitumor activity reported in various malignant disorders but does not have the neurotoxic and teratogenic effects of thalidomide (Molica, 2007). It has demonstrated the ability to decrease the production of several prosurvival cytokines, including TNF$, VEGF, IL-6. Lenalidomide modulate an immune effector cell response through activation of the natural killer and T cells and induce apoptosis in tumor cells. Chanan-Khan and colleagues demonstrated in 2006 in phase II study, clinical efficacy of lenalidomide in patients with relapsed or refractory CLL. The OR rate was 47% and 9% of the patients achieved a complete remission
(Chanan-Khan et al, 2006). These results are encouraging and require further investigation.
IV. Conclusions The prognosis of the B-CLL and its clinical course is very heterogeneous and the treatment decision depends on clinical staging and prognostic factors. Many patients do not require specific treatment for a long time, but some are treated once after diagnosis. New prognostic factors such as ZAP-70 and CD38 may correlate with clinical course and may influence therapeutic options. For many years chlorambucil has been the main agent in the treatment of B-CLL, particularly in elderly patients. Resent investigations proved that monoclonal antibodies and hematopoietic stem cell transplantation are real therapeutic options. Vaccines could be useful for treatment of patients with B-CLL, but they still need to be optimized and their efficiency should be established. Despite many new therapeutic agents and strategies of treatment, B-CLL is still an incurable disease.
References Alfarano A, Indraccolo S, Circosta P, Minuzzo S, Vallario A, Zamarchi R, Fregonese A, Calderazzo F, Faldella A, Aragno M, Camaschella C, Amadori A, Caligaris-Cappio F (1999) An alternatively spliced form of CD79b gene may account for altered B-cell receptor expression in B-chronic lymphocytic leukemia. Blood 93, 2327-2335. Banerji V, Johnston JB, Seftel MD (2007) The role of hematopoietic stem cell transplantation in Chronic Lymphocytic Leukemia. Transfus Apher Sci 37, 57-62. Biagi E, Rousseau R, Yvon E, Schwartz M, Dotti G, Foster A, Havlik-Cooper D, Grilley B, Gee A, Baker K, Carrum G, Rice L, Andreeff M, Popat U, Brenner M (2005) Responses to human CD40 ligand/human interleukin-2 autologous cell vaccine in patients with B-cell chronic lymphocytic leukemia. Clin Cancer Res 11, 6916-23. Binet JL, Auquier A, Dighiero G, Chastang C, Piguet H, Goasguen J, Vaugier Potron G, Colona P, Oberling F, Thomas M, Tchernia G, Jacquillat C, Boivin P, Lesty C, Duault MT, Monconduit M, Belabbes S, Gremy F (1981) A new prognostic classification of chronic lymphocytic leukemia derived from a multivariate survival analysis. Cancer 48, 198-206. Bosch F, Villamor N (2003) ZAP-70 expression in chronic lymphocytic leukaemia: a new parameter for an old disease. Haematologica 88, 724-725. Abbott BL (2006) Chronic Lymphocytic Leukemia: Recent Advances in Diagnosis and Treatment; The Oncologist 11, 21-30. Carnahan J, Stein R, Qu Z, Hess K, Czesano A, Hansen H, Goldenberg D (2007) Epratuzumab, a CD22targeting recombinant humanized antibody with a different mode of action from rituximab. Molecular Immunology 44, 1331-1341. Chanan-Khan A, Miller KC, Musial L, Lawrence D, Padmanabhan S, Takeshita K, Porter CW, Goodrich DW, Bernstein ZP, Wallace P, Spaner D, Mohr A, Byrne C, Hernandez-Ilizaliturri F, Chrystal C, Starostik P, Czuczman MS (2006) Clinical efficacy of lenalidomide in patients with relapsed or refractory chronic lymphocytic leukemia: results of a phase II study. J Clin Oncol 24, 5343-5349. Chanan-Khan A, Miller KC, Takeshita K, Koryzna A, Donohue K, Bernstein ZP, Mohr A, Klippenstein D, Wallace P, Zeldis JB, Berger C, Czuczman MS (2005) Results of a phase 1 clinical trial of thalidomide in combination with fludarabine
169
Stram et al: New approaches in treatment of B-cell chronic lymphocytic leukemia as initial therapy for patients with treatment-requiring chronic lymphocytic leukemia (CLL). Blood 106, 33483352. Chanan-Khan A, Porter CW (2006) Immunomodulating drugs for chronic lymphocytic leukaemia. Lancet Oncol 7, 480488. Cheson BD, Bennett JM, Grever M, Kay N, Keating MJ, O'Brien S, Rai KR (1996) National Cancer Institute-Sponsored Working Group Guideline For Chronic Lymphocytic Leukemia: Revised Guidelines for Diagnosis and Treatment. Blood 87, 4990-4997. Christian BA,. Grever MR, Byrd J, Lin TS (2007) Flavopiridol in the treatment of chronic lymphocytic leukemia. Current Opinion in Oncology 19, 573-578. Chu P, Scales L, Zou A (2003) Mechanism of IDEC-152induced apoptosis in chronic lymphocytic leukemia B cells. Proc Am Assoc Cancer Res (2nd ed), 126-127. Coiffier B, Lepretre S, Pedersen LM, Gadeberg O, Fredriksen H, van Oers MH, Wooldridge J, Kloczko J, Holowiecki J, Hellmann A, Walewski J, Flensburg M, Petersen J, Robak T (2008) Safety and efficacy of ofatumumab, a fully human monoclonal anti-CD20 antibody, in patients with relapsed or refractory B-cell chronic lymphocytic leukemia: a phase 1-2 study. Blood 111, 1094-100. Constantine S. Tam, Susan O’Brien, William Wierda, Hagop Kantarjian, Sijin Wen, Kim-Anh Do, Deborah A. Thomas, Jorge Cortes, Susan Lerner,and Michael J. Keating (2008) Long-term results of the fludarabine, cyclophosphamide, and rituximab regimenas initial therapy of chronic lymphocytic leukemia. Blood 112, 975-980. Cordone I, Masi S, Mauro FR, Soddu S, Morsilli O, Valentini T, Vegna ML, Guglielmi C, Mancini F, Giuliacci S, Sacchi A, Mandelli F, Foa R (1998) p53 expression in B-cell chronic lymphocytic leukemia: a marker of disease progression and poor prognosis. Blood 91, 4342-4349. Crespo M, Bosch F, Villamor N, Bellosillo B, Colomer D, Rozman M, Marcé S, López-Guillermo A, Campo E, Montserrat E (2003) ZAP-70 expression as a surrogate for Immunoglobulin-variable-region mutations in chronic lymphocytic leukemia. N Engl J Med 348, 1764-1775. Damle RN, Wasil T, Fais F, Ghiotto F, Valetto A, Allen SL, Buchbinder A, Budman D, Dittmar K, Kolitz J, Lichtman SM, Schulman P, Vinciguerra VP, Rai KR, Ferrarini M, Chiorazzi N (1999) Ig V gene mutation status and CD38 expression as a novel prognostic indicators in chronic lymphoctic leukemia. Blood 94, 1840-1847. Dearden C (2002) Monoclonal antibody therapy of haematological malignancies. Bio Drugs 16, 283-301. Del Poeta G, Del Principe M, Buccisano F, Maurillo L, Apelli G, Luciano F, Pio Perrotti A, Degan M, Venditti A, De Fabritiis P, Gattei V, Amadori S (2008) Consolidation and Maintenance Immunotherapy With Rituximab Improve Clinical Outcome in Patients With B-cell Chronic Lymphocytic Leukemia. Cancer 112, 119-128 Del Poeta G, Maurillo L, Venditti A, Buccisano F, Epiceno AM, Capelli G, Tamburini A, Suppo G, Battaglia A, Del Principe MI, Del Moro B, Masi M, Amadori S (2001) Clinical significance of CD38 expression in chronic lymphocytic leukemia. Blood 98, 2633-2639. Dighiero G (2005) CLL Biology and Prognosis. Hematology Am Soc Hematol Educ Program 278-284. Dighiero G, Maloum K, Desablens B, Cazin B, Navarro M, Leblay R, Leporrier M, Jaubert J, Lepeu G, Dreyfus B, Binet JL, Travade P (1998) Chlorambucil in indolent chronic lymphocytic leukemia. N Engl J Med 338, 1506-1514. Döhner H, Stilgenbauer S, Benner A, Leupolt E, Kröber A, Bullinger L, Döhner K, Bentz M, Lichter P (2000) Genomic
aberrations and survival in chronic lymphocytic leukemia. N Engl J Med 343, 1910-1916. Dreger P, Brand R, Mulligan D (2005) Reduced intensity conditioning lowers treatment related mortality of allogenic stem cell transplantation for chronic lymphocytic leukemia: a population matches analysis. Leukemia 19:1029-1033. Dreger P, Corradini P, Kimby E, Michallet M, Milligan D, Schetelig J, Wiktor-Jedrzejczak W, Niederwieser D, Hallek M and E Montserrat E, on behalf of the Chronic Leukemia Working Party of the EBMT (2007) Indications for allogeneic stem cell transplantation in chronic lymphocytic leukemia:the EBMT transplant consensus. Leukemia 21, 1217. Eichrost BF, Busch R, Hopfinger G, Pasold R, Hensel M, Steinbrecher C, Siehl S, Jager U, Bergmann M, Stilgenbauer S, Schweighofer C, Wendtner CM, Dohner H, Brittinger G, Emmerich B, Hallek M German CLL Study Group (2006) Fludarabine plus cyclophosphamide versus fludarabine alone in first-line therapy of younger patients with chronic lymphocytic leukemia. Blood 107(3), 885-891. Elter T, Borchmann P, Schulz H, Reiser M, Trelle S, Schnell R, Jensen M, Staib P, Schinkothe T, Stutzer H, Rech J, Gramatzki M, Aulitzky W, Hasan I, Josting A Hallek M, Engert A (2005) Fludarabine in combination in patients with relapsed or refractory a B-cell chronic lymphocyticleukemia: results of phase II trial. J Clin Oncol 23(28), 7024-7031. Esteve J, Villamor N, Colomer D, Cervantes F, Campo E, Carreras E, Montserrat E (2001) Stem cell Transplantation for chronic lymphocytic leukemia: different outcome after autologous and allogeneic transplantation and correlation with minimal residual disease status. Leukemia 15, 445-451. Flinn IW, Berdeja JG (2004) The initial management of patients with chronic lymphocytic leukemia. Hematology Am Soc Hematol Educ Program 170-175. French Cooperative Group on Chronic Lymphocytic Leukemia (1990) A randomized clinical trial of chlorambucil versus COP in stage B chronic lymphocytic leukemia. Blood 75, 1422-1425. Furman RR, Leonard JP, Allen SL, Coleman M,Rosenthal T, Gabrilove JL (2005) Thalidomide alone or in combination with fludarbabine are effective treatments for patients with fludarabine-relapsed and refractory CLL. J Clin Oncol , ASCO Annual Meeting Proceedings 23, 16S, Part I of II, 6640. Gilleece MH, Dexter TM (1993) Effect of Campath-lH antibody on human hematopoietic progenitors in vitro. Blood 82, 807812. Ginaldi L, De Martinis M, Matutes E, Farahat N, Morilla R, Catovsky D (1998) Levels of expression of CD19 and CD20 in chronic B cell leukaemias. J Clin Pathol 51, 364-369. Golay J, Zaffaroni L, Vaccari T, Lazzari M, Borleri GM, Bernasconi S, Tedesco F, Rambaldi A, Introna M (2000) Biologic response of B lymphoma cells to anti-CD20 monoclonal antibody rituximab in vitro: CD55 and CD59 regulate complement-mediated cell lysis. Blood 95, 39003908. Grever MR, Kopecky KJ, Coltman CA, Files JC, Greenberg BR, Hutton JJ, Talley R, Von Hoff DD, Balcerzak SP (1988) Fludarabine monophosphate: a potentially useful agent in chronic lymphocytic leukemia. Nouv Rev Fr Hematol 30, 457-459. Grever MR, Lucas DM, Johnson AJ, Byrd JC (2007) Novel agents and strategies for treatment of p53-defective chronic lymphocytic leukemia. Best Pract Res Clin Haematol. 20(3), 545-556. Gribben JG American Society for Blood and Marrow Transplantation (2009) Stem Cell Transplantation in Chronic
170
Cancer Therapy Vol 7, page 171 Lymphocytic Leukemia Biol Blood Marrow Transplant 15, 1553-1558. Gribben JG, Zahrieh D, Stephans K, Bartlett-Pandite L, Alyea EP, Fisher DC, Freedman AS, Mauch P, Schlossman R, Sequist LV, Soiffer RJ, Marshall B, Neuberg D, Ritz J, Nadler LM (2005) Autologous and allogeneic stem cell transplantation for poor risk chronic lymphocytic leukemia. Blood 106, 4389-4396. Hainsworth JD, Litchy S, Barton JH, Houston GA, Hermann RC, Bradof JE, Greco FA (2003) Network Single-agent rituximab as first-line and maintenance treatment for patients with chronic lymphocytic leukemia or small lymphocytic lymphoma: a phase II trial of the Minnie Pearl Cancer Research Network. J Clin Oncol 21, 1746-1751. Hallek M, Cheson BD, Catovsky D, Caligaris-Cappio F, Dighiero G, Dohner H, Hillmen P, Keating MJ, Montserrat E, Rai KR, Kipps TJ (2008) Guidelines for the diagnosis and treatment of chronic lymphocytic leukemia: a report from the International Workshop on Chronic Lymphocytic Leukemia updating the National Cancer Institute-Working Group 1996 guidelines. Blood 111, 5446-5456. Hallek M, Cheson BD, Catovsky D, Caligaris-Cappio F, Dighiero G, Döhner H, Hillmen P, Keating MJ, Montserrat E, Rai KR, Kipps TJ International Workshop on Chronic Lymphocytic Leukemia (2008) Guidelines for the diagnosis and treatment of chronic lymphocytic leukemia: a report from the International Workshop on Chronic Lymphocytic Leukemia updating the National Cancer Institute-Working Group 1996 guidelines. Blood 111, 5446-5456. Hamann PR, Hinman LM, Hollander I, Beyer CF, Lindh D, Holcomb R, Hallett W, Tsou HR, Upeslacis J, Shochat D, Mountain A, Flowers DA, Bernstein I (2002) Gemtuzumab ozogamicin, a potent and selective anti-CD33 antibodycalicheamicin conjugate for treatment of acute myeloid leukemia. Bioconjug Chem 13, 47-58. Hamblin TJ, Davis Z, Gardiner A, Oscier DG & Stevenson FK (1999) Unmutated IgV(H) genes are associated with a more aggressive form of chronic lymphocytic leukemia. Blood 94, 1848-1854. Han T, Ezdini EZ, Shimaoka K, Desai DV (1973) Chlorambucil versus combined chlorambucil-corticosteroid therapy in chronic lymphocytic leukemia. Cancer 31, 502-508. Herishanu Y., Polliack A (2005) Chronic lymphocytic leukemia: A review of some new aspects of the biology, factors influencing prognosis and therapeutic options. Transfusion and Apheresis Science 32, 85-97. Hus I, Kawiak J, Tabarkiewicz J, Radej S, Hoser G, BojarskaJunak A, Schmitt M, Giannopoulos K, Dmoszy%ska A, Roli%ski J (2008) Immunotherapy with irradiated autologous leukemic cells in patients with B-CLL in early stages Oncology Reports 2008 20, 443-451. Hus I, Roli%ski J, Tabarkiewicz J, Wojas K, Bojarska-Junak A, Greiner J, Giannopoulos K, Dmoszy%ska A, Schmitt M (2005) Allogeneic dendritic cells pulsed with tumor lysates or apoptotic bodies as immunotherapy for patients with early-stage B-cell chronic lymphocytic leukemia. Leukemia 19, 1621-1627. Hus I, Schmitt M, Tabarkiewicz J, Radej S, Wojas K, BojarskaJunak A, Schmitt A, Giannopoulos K, Dmoszy%ska A, Roli%ski J (2008) Vaccination of B-CLL patients with autologous dendritic cells can change the frequency of leukemia antigen-specific CD8+ T cells as well as CD4+CD25+FoxP3+ regulatory T cells toward an antileukemia response. Leukemia 22, 1007-1017. Hus I., Podhorecka M., Bojarska-Junak A., Roli%ski J., Schmidt M., Sieklucka M., W&sik-Szczepanek E.,Dmoszy%ska A. (2006); The clinical significance of ZAP-70 and CD38
expression In B-cell chronic lymphocytic leukemia; Annals of Oncology 17, 683-690 Jensen M, Engert A, Weissinger F, Knauf W, Kimby E, Poynton Ch, Anton Oliff I, J. Rummel M and Österborg A (2008) Phase I study of a novel pro-apoptotic drug R-etodolac in patients with B-cell chronic lymphocytic leukemia. Inwest New Drugs 26, 139-149 Byrd JC, O’Brien S, Flinn IW, Kipps TJ, Weiss M, Rai K, Lin TS, Woodworth J, Wynne D, Reid J, Molina A, Leigh B, Harris S (2007) Phase 1 study of lumiliximab with detailed pharmacokinetic and pharmacodynamic measurements in patients with relapsed or refractory chronic lymphocytic leukemia. Clin Cancer Res 13, 4448-4455. Johnson S, Smith AG, Loffler H, Osby E, Juliusson G, Emmerich B, Wyld PJ, Hiddemann W (1996) Multicentre prospective randomized trial of fludarabine versus cyclophosphamide, doxorubicin, and prednisone (CAP) for treatment of advanced-stage chronic lymphocytic leukemia. The French Cooperative Group on CLL. Lancet 347, 14321438. Kay NE, Jelinek DF, Dewald GW (2002) Progression events in B-chronic lymphocytic leukemia. Hematology Am Soc Hematol Educ Program 197-213. Keating M (2007) Chemoimmunotherapy of chronic lymphocytic leukemia Best Practice & Research Clinical Haematology 20, 3479-3498. Keating M, O`Brien S (2000) High-dose rituximab therapy in chronic lymphocytic leukemia. Semin Oncol Suppl 12, 8690. Keating MJ, O'Brien S, Albitar M, Lerner S, Plunkett W, Giles F, Andreeff M, Cortes J, Faderl S, Thomas D, Koller C, Wierda W, Detry MA, Lynn A, Kantarjian H (2005) Early results of a chemoimmunotherapy regimen of fludarabine, cyclophosphamide, and rituximab as initial therapy for chronic lymphocytic leukemia. J Clin Oncol 23, 4079-4088. Kharfan-Dabaja MA, Anasetti C, Santos ES (2007) Hematopoietic cell transplantation for chronic lymphocytic leukemia: an evolving concept. Biol Blood Marrow Transplant 13, 373-385. Kitada S, Zapata JM, Andreeff M, Reed JC (2000) Protein kinase inhibitors flavopiridol and 7-hydroxy-staurosporine downregulate antiapoptosis proteins in B-cell chronic lymphocytic leukemia. Blood 96, 393-397. Lens D, Dyer MJ, Garcia-Marco JM, De Schouwer PJ, Hamoudi RA, Jones D, Farahat N, Matutes E, Catovsky D (1997) p53 abnormalities in CLL are associated with excess of prolymphocytes and poor prognosis. Br J Haematol 99, 848-857. Leporrier M, Chevre S, Cazin B, Boudjerra N, Feugier P, Desablens B, Rapp MJ, Jaubert J, Autrand C, Divine M, Dreyfus B, Maloum K, Travade P, Dighiero G, Binet JL, Chastang C French Cooperative Group on Chronic lymphocytic Leukemia (2001) Randomized comparision of fludarabine, CAP, and ChOP in 938 previously untreated stage B and C chronic lymphocytic leukemia patients. Blood 98, 2319-2325. Lin TS , Stock W, Lucas MS (2002) A phase I dose escalation study of apolizumab (Hu1D10) using a stepped up dosing schedule in patients with chronic lymphocytic leukemia (CLL) and acute lymphocytic leukemia (ALL). Blood 100, 3167. Linet MS (1988) Chronic lymphocytic leukemia. Polliack A Catovsky D, editors. The epidemiology of chronic lymphocytic leukemia. Chur: Harwood Academic Publishers, 11-32. Lundin J, Kimby E, Bjorkholm M, Broliden PA, Celsing F, Hjalmar V, Mollgard L, Rebello P, Hale G, Waldmann H, Mellstedt H, Osterborg A (2002) Phhase II trial of
171
Stram et al: New approaches in treatment of B-cell chronic lymphocytic leukemia subcutaneous anti-CD52 monoclonal antibody alemtuzumab (Campath-1H) as first-line treatment for patients with B-cell chronic lymphocytic leukemia (B-CLL). Blood 100, 768773. Lundin J, Osterborg A (2004) Advances in the use of monoclonal antibodies in the therapy of chronic lymphocytic leukemia. Semin Hematol 41, 234-245. Maloney DG, Smith B, Rose A (2002) Rituximab: mechanism of action and resistance. Semin Oncol 29, 2-9. McConkey DJ (1998) Biochemical determinants of apoptosis and necrosis. Toxicol Lett 99, 157-168. McLaughlin P, Grillo-López AJ, Link BK, Levy R, Czuczman MS, Williams ME, Heyman MR, Bence-Bruckler I, White CA, Cabanillas F, Jain V, Ho AD, Lister J, Wey K, Shen D, Dallaire BK (1998) Rituximab chimeric anti-CD20 monoclonal antibody therapy for relapsed indolent lymphoma: half of patients respond to a four-dose treatment program. J Clin Oncol 16, 2825-2833. Merkel O, Heuder C, Asslaber D, Hamacher F, Tinhofer I, Holler C, Stocher M, Prokesch A, Papak C, Scheideler M, Trajanoski Z, Greol R (2008) Arsenic trioxide induces apoptosis preferentially in B-CLL cells of patients with unfavourable prognostic factors including del17p13. J Mol Med 86, 541-552. Messmer B, Damle RN, Allen SL, Rai KR, Ferrarini M, Kipps TJ (2003) Biology and treatment of chronic lymphocytic leukemia. Hematology Am Soc Hematol Educ Program 153-175. Molica S (1991) Progression and survival studies in early chronic lymphocytic leukemia. Blood 78, 895-899. Molica S (2007) Immunomodulatory drugs in chronic lymphocytic leukemia: a new treatment paradigm. Leuk Lymphoma 48, 866-869. Mone AP, Huang P, Pelicano H, Cheney CM, Green JM, Tso JY, Johnson AJ, Jefferson S, Lin TS, Byrd JC (2004) Alemtuzumab induces cell death in human chronic lymphocytic leukemia cells through lipid-raft dependent mechanism. Blood 104, 1846-1854. Montillo M, Hamblin T, Hallek M, Montserrat E, Morra E (2005) Chronic lymphocytic leukemia: novel prognostic factors and their relevance for risk-adapted therapeutic strategies. Haematologica 90, 391-399. Montserrat E, Gine E, Moreno C, Esteve J (2007) The role of stem-cell transplantation in chronic lymphocytic leukemia risk-adapted therapy. Best Practice & Research Clinical Haematology 20, 529-543. Moreton P, Kennedy B, Lucas G, Leach M, Rassam SM, Haynes A, Tighe J, Oscier D, Fegan C, Rawstron A, Hillmen P (2005) Eradication of minimal residual disease in B-cell chronic lymphocytic leukemia after alemtuzumab therapy is associated with prolonged survival. J Clin Oncol 23, 29712979. Obermann E, Went P, Tzankov A, Pileri S, Hofstaedter F, Marienhagen J, Stoehr R, Dirnhofer S (2007) Cell cycle phase distribution analysis in chronic lymphocytic leukaemia: a significant number of cells reside in early G1phase. Journal of Clinical Pathology 60,794-797. Opezzo P, Vasconcelos Y, Settegrana C, Jeannel D, Vuillier F, Legarff-Tavernier M, Kimura EY, Bechet S, Dumas G, Brissard M, Merle-Beral H, Yamamoto M, Dighiero G, Davi F French Cooperative Group on CLL (2005) The LPL/ADAM29 expression ratio is a novel prognosis indicator in chronic lymphocytic leukemia. Blood 106, 650657. Oscier DG, Thompsett A, Zhu D, Stevenson FK (1997) Differential rates of somatic hypermutation in V(H) genes among subsets of chronic lymphocytic leukemia defined by chromosomal abnormalities. Blood 89, 4153-4160.
Osterborg A, Dyer MJ, Bunjes D, Pangalis GA, Bastion Y, Catovsky D, Mellstedt H (1997) Phase II multicenter study of human CD52 antibody in previously treated chronic lymphocytic leukemia. European Study Group of CAMPATH-1H Treatment in Chronic Lymphocytic Leukemia. J Clin Oncol 15, 1567-1574. Palma M, Kokhaei P, Lundin J, Choudhury A, Mellstedt H, Osterborg A (2006) The biology and treatment of chronic lymphocytic leukemia. Annals of Oncology 17, 144-154. Penesha S, Milligan DW (2005) Stem cell transplantation for chronic lymphocytic leukemia. Br J Haematol 128, 145152. Poole J, Meng J, Reff M, Spellman M, Rosenwasser L (2005) Anti-CD23 monoclonal antibody, lumiliximab, inhibited allergen-induced responses in antigen-presenting cells and T cells from atopic subjects. J Allergy Clin Immunol 116, 780-788. Rai KR, Dohner H, Keating MJ, Montserrat E (2001) Chronic lymphocytic leukemia: case-based session. Hematology Am Soc Hematol Educ Program 140-156. Rai KR, Peterson BL, Appelbaum FR, Kolitz J, Elias L, Shepherd L, Hines J, Threatte GA, Larson RA, Cheson BD, Schiffer CA (2000) Fludarabine compared with chlorambucil as primary therapy for chronic lymphocytic leukemia. N Engl J Med 14, 1750-1757. Rai KR, Sawitsky A, Croncite EP, Chanana AD, Levy RN, Pasternack BS (1975) Clinical staging of chronic lymphocytic leukemia. Blood 46, 219-234. Ritgen M, Stilgenbauer S, von Neuhoff N, Humpe A, Brüggemann M, Pott C, Raff T, Kröber A, Bunjes D, Schlenk R, Schmitz N, Döhner H, Kneba M, Dreger P (2004) Graft-versus-leukemia activity May overcome therapeutic resistance of chronic lymphocytic leukemia with unmutatedimmunoglobulin variable heavy-chain gene status: implications of minimal residual disease measurement with quantitative PCR. Blood 104, 2600-2602. Robak T (2007) Recent progress in the management of chronic lymphocytic leukemia. Cancer Tretment Reviews 33, 710728. Robak T, Blo%ski JZ, Kasznicki M, Blasinska-Morawiec M, Krykowski E, Dmoszy%ska A, Mruga'a-(piewak H, Skotnicki AB, Nowak W, Konopka L, Ceglarek B, Maj S, Dwilewicz-Trojaczek J, Hellmann A, Urasi%ski I, Zdziarska B, Kotlarek-Haus S, Potoczek S, Grieb P (2000) Cladribine with prednisone versus chlorambucil with prednisone as first-line therapy in chronic lymphocytic leukemia: report of a prospective, randomized, multicenter trial. Blood 96, 27232729. Robak T, Kasznicki M (2002) Alkylating agents and nucleoside analogues in the treatment of B-cell chronic lymphocytic leukemia. Leukemia 16, 1015-1027. Robak T, Sergey I, Moisee IS, Dmoszynska A, Solal-Céligny P, Warzocha K, Loscertales J, Catalano J, Afanasiev VB, Larratt L, Geisler Ch, Montillo M, Ganly P, Dartigeas C, Rosta A, Janssens A, Mendila M, Maurer J and Wenger MK (2008) Rituximab, Fludarabine, and Cyclophosphamide (RFC) Prolongs Progression Free Survival in Relapsed or Refractory Chronic Lymphocytic Leukemia (CLL) Compared with FC Alone: Final Results from the International Randomized Phase III REACH Trial. ASH Annual Meeting Abstracts Blood 112: Abstract 1 Rozman C, Montserrat E (1995) Chronic lymphocytic leukemia, N Eng J Med 333,1052-1057. Schulz H, Klein SK, Rehwald U, Reiser M, Hinke A, Knauf WU, Aulitzky WE, Hensel M, Herold M, Huhn D, Hallek M, Diehl V, Engert A German CLL Study Group (2002) Phase 2 study of a combined immunochemotherapy using rituximab
172
Cancer Therapy Vol 7, page 173 and fludarabine in patients with chronic lymphocytic leukemia. Blood 100, 3115-3120. Sgambati M, Linet MS, Devesa S (2003) Chronic lymphoid leukemias. In: Cheson BD, editor. Chronic lymphoid leukemias. 2nd ed. New York: M. Dekker, 33-62. Shanafelt TD, Geyer SM, Kay NE (2004) Prognosis at diagnosis: integrating molecular biologic insights into clinical practice for patients with CLL. Blood 103, 1202-1210. Spaner DE, Hammond C, Mena J, Foden C, Deabreu A (2005) A phase I/II trial of oxidized autologous tumor vaccines during the "watch and wait" phase of chronic lymphocytic leukemia. Cancer Immunol Immunother 54, 635-46. Stein R, Qu Z, Cardillo T, Chen S, Rosario A,. Horak I, Hansen H, Goldenberg D (2004) Antiproliferative activity of a humanized anti-CD74 monoclonal antibody, hLL1, on B-cell malignancies. Blood 104, 3705-3711. Stilgenbauer S, Dohner H (2002) Campath-1H-induced complete remission of chronic lymphocytic leukemia despite p53 gene mutation and resistance to chemotherapy. N Engl J Med 347, 452-453. O’Brien S, Moore JO, Boyd TE, Larratt LM, Skotnicki A, Koziner B, Chanan-Khan AA, Seymour JF, Bociek RG, Pavletic S, Rai KR (2007) Randomized Phase III Trial of Fludarabine PlusCyclophosphamide With or Without Oblimersen Sodium (Bcl-2 antisense) in Patients With Relapsed or Refractory Chronic Lymphocytic Leukemia. J Clin Oncol 25,1114-1120. Teeling JL, French RR, Cragg MS, van den Brakel J, Pluyter M, Huang H, Chan C, Parren PW, Hack CE, Dechant M, Valerius T, van de Winkel JG, Glennie MJ (2004) Characterization of new human CD20 monoclonal antibodies with potent cytolytic activity against non-Hodgkin lymphomas. Blood 104, 1793-1800. Tong X, Georgakis GV, Long L, O'Brien S, Younes A, Luqman M (2005) In Vitro Activity of a Novel Fully Human AntiCD40 Antibody CHIR-12.12 in Chronic Lymphocytic Leukemia: Blockade of CD40 Activation and Induction of ADCC. ASH Annual Meeting Abstracts. Blood 106, 2504. Van`t Veer MB, Brooijmans AM, Langerak AW, Verhaaf B, Goudswaard CS, Graveland WJ, an Lom K, Valk PJ (2006) The predictive value of lipoprotein lipase for survival in chronic lymphocytic leukemia. Haematologica 1, 56-63. Vasconcelos Y, Davi F, Levy V, Oppezzo P, Magnac C, Michel A, Yamamoto M, Pritsch O, Merle-Béral H, Maloum K, Ajchenbaum-Cymbalista F, Dighiero G (2003) Binet’s staging system and VH genes are independent but complementary prognostic indicators in chronic lymphocytic leukemia. Journal of Clinical Oncology 21, 3928-3932. Wendtner CM, Ritgen M, Schweighofer CD, Fingerle-Rowson G, Campe H, Jager G Eichhorst B, Busch R, Diem H, Englert A, Stilgenbauer S, Dohner H, Kneba M, Eichhorst B, Busch R, Study Group (GCLLSG) (2004) Consolidation with alemtuzumab in patients with chronic lymphocytic leukemia (CLL) in first remission-experience on safety and efficacy within a randomized multicenter phase III trial of the German CLL Study Group (GCLLSG). Leukemia 18, 10931101. Wierda WG, Cantwell MJ, Woods SJ, Rassenti LZ, Prussak CE, Kipps TJ (2000) CD40-ligand (CD154) gene therapy for chronic lymphocytic leukemia. Blood 96, 2917-2924. Knauf WU, Lissichkov T, Aldaoud A, Herbrecht R, Liberati AM, Loscertales J, Juliusson G, Dittrich Ch, Merkle K (2007) Bendamustine Versus Chlorambucil in Treatment-Naive Patients with B-Cell Chronic Lymphocytic Leukemia (BCLL): Results of an International Phase III Study. Blood (ASH Annual Meeting Abstracts) 110, Abstract 2043.
Zent CS, Kay NE (2004) Update on monoclonal antibody therapy in chronic lymphocytic leukemia. Clin Adv Hematol Oncol 2, 107-113.
173
Aune et al: Meat consumption and cancer risk Cancer Therapy Vol 7, 174-187, 2009
Meat consumption and cancer risk: a multisite casecontrol study in Uruguay Research Article
Dagfinn Aune1,2,*, Alvaro Ronco3, Paolo Boffetta4, Hugo Deneo-Pellegrini5, Enrique Barrios6, Giselle Acosta5, Maria Mendilaharsu5, Eduardo De Stefani5 1
Department of Biostatistics, University of Oslo, Norway Department of Nutrition, University of Oslo, Norway 3 Departamento de Epidemiologıa y Metodos Cientıficos, Facultad de Medicina, Centro Latinoamericano de Economıa Humana (CLAEH), Montevideo, Uruguay 4 International Agency for Research on Cancer, Lyon, France 5 Grupo de Epidemiología, Departamento de Anatomía Patológica, Facultad de Medicina, Hospital de Clínicas, Montevideo, Uruguay 6 Registro Nacional de Cancer, Montevideo, Uruguay 2
__________________________________________________________________________________ *Correspondence: Dagfinn Aune, Department of Biostatistics, Institute of Basic Medical Sciences, University of Oslo, P.O. Box 1122, N-0317 Oslo, Norway; Tel: +0047 22 85 15 60; Fax: +0047 22 85 13 13; e-mail: dagfinn.aune@medisin.uio.no Key words: Meat, diet, food, cancer, epidemiology Abbreviations: food frequency questionnaire, (FFQ); heterocyclic amines, (HCA); polycyclic aromatic hydrocarbons, (PAH); World Cancer Research Fund/American Institute for Cancer Research, (WCRF/AICR) Received: 24 February 2009; Revised: 9 March 2009 Accepted: 12 March 2009; electronically published: April 2009
Summary There is strong evidence that meat intake increases the risk of colorectal cancer. However, for other cancer sites there is currently less convincing evidence. To further explore the association between meat intake and cancer risk we conducted a case-control study of 26 cancer sites in Uruguay between 1988 and 2000, including 6892 cancer cases and 1832 hospital controls. Unconditional logistic regression was used to estimate multivariate adjusted odds ratios (ORs) and 95% confidence intervals of various cancers for intake of total meat, red meat, beef, lamb and processed meat. There was a statistically significant increase in the odds of cancers of the mouth and pharynx (OR=1.63), esophagus (OR=3.30), larynx (OR=1.85), stomach (OR=4.02), colorectum (OR=1.78), lung (OR=1.59), sarcomas (OR=2.27), prostate (OR=1.58), bladder (OR=1.68), kidney (OR=1.96), nervous system (OR=3.12), thyroid (OR=2.38), non-Hodgkin’s lymphoma (OR=1.79), myeloma (OR=3.28) and all cancer sites combined (OR=1.61) with high intake of total meat and similar findings were found with red meat, beef and lamb. Intake of processed meat was associated with increased odds of cancers of the pharynx (OR=1.90), esophagus (OR=1.51), larynx (OR=2.03), stomach (OR=4.39), colorectum (OR=1.76), breast (OR=1.23), non-Hodgkin’s lymphoma (OR=2.01), leukemia (OR=2.11) and with all cancer sites combined (OR=1.32). Our results confirm earlier findings of increased risk of gastrointestinal cancers with higher meat intake and suggest that meat consumption increases the risk of multiple other cancer sites.
of cancer where the current evidence suggest there may be an increased risk, including cancers of the esophagus, lung, stomach, pancreas, prostate and endometrium (World Cancer Research Fund/American Institute for Cancer Research, 2007). Uruguay is the country with the highest per capita meat consumption in the world (Speedy, 2003) and cancer rates are also very high. The agestandardised incidence-rates for cancers of the colorectum, lung, prostate and for all sites except non-melanoma skin
I. Introduction Previous studies have reported elevated cancer risks with a high intake of total meat, red meat and processed meat (World Cancer Research Fund/American Institute for Cancer Research, 2007). Although an increased risk of colorectal cancer is well established (Larsson and Wolk, 2006; World Cancer Research Fund/American Institute for Cancer Research, 2007) there are a number of other types
174
Cancer Therapy Vol 7, page 175 1832 controls (response rate 96.3%). They served as a common control group for all groups of cases. The questionnaire was administered by trained social workers and included questions on socio-demographic factors, occupational history, a history of cancer among 1st degree relatives, self-reported height and weight 5 years before admission, smoking history, alcohol intake (history and usual intake), mate intake (a local herbal tea), reproductive history (women) and a short food frequency questionnaire (FFQ). The FFQ, which has not been validated, included questions about the intake of fresh red meat (beef and lamb), processed meat, salted meat, milk and total vegetables and fruits. Total meat was defined as the sum of fresh red meat (beef and lamb), processed meat and salted meat. Results specifically for salted meat will be reported separately.
cancer among men, are 39.6, 60.0, 46.6 and 320.4 per 100 000 persons per year, respectively (Ferlay et al, 2002). Among women rates of breast cancer and all cancer sites except non-melanoma skin cancer are also high with agestandardised incidence rates of 63.1 and 237.5 per 100,000 persons per year, respectively (Ferlay et al, 2002). Thus, Uruguay is an interesting setting for investigating the association between meat intake and cancer risk. Several previous studies conducted in this population suggested increased risk of multiple cancers including those of the upper aerodigestive tract (De Stefani et al, 1994, 1995, 1999; Oreggia et al, 2001), stomach (De Stefani et al, 1990, 1998a), colorectum (De Stefani et al, 1997a), breast (De Stefani et al, 1997b), kidney (De Stefani et al, 1998b), lung (Deneo-Pellegrini et al, 1996; De Stefani et al, 2002) and of non-Hodgkin’s lymphoma (De Stefani et al, 1998c), with high meat intake. Further, in a previous analysis of dietary patterns and cancer risk we reported increased risk of several cancers with a western dietary pattern, with high loadings of red and processed meat (De Stefani et al, 2009). However, no systematic evaluation of meat consumption and cancer risk across multiple sites has previously been conducted in this population. Three multisite case-control studies, two in Italy (Tavani et al, 2000; Levi et al, 2004) and one in Canada (Hu et al, 2008), have previously reported increased risk of several cancers with high meat intake. Recently the NIH-AARP Diet and Health cohort study also suggested increased risk of multiple cancers with high red and processed meat intake (Cross et al, 2007). To further expand upon these findings we decided to explore the association between meat consumption and cancer risk in a case-control study of 26 types of cancer in Uruguay.
A. Statistical methods Odds ratios of cancer for the middle and upper tertiles of the distribution of meat intake were estimated with unconditional logistic regression, using the lowest tertile as the referent group; the tertiles were based on functional cut-off points in servings per week. We used a multivariable model including the following covariates: age (continuous), sex (when applicable), residence (urban/rural), education (continuous), smoking status (never, former, current), cigarettes per day (continuous), age at starting smoking (continuous), age at quitting smoking (continuous), duration of smoking (continuous), current alcohol intake (continuous), intake of fruits and vegetables (continuous) and intake of milk (continuous). Analyses of breast, ovarian and endometrial cancers were also adjusted for age at menarche (continuous), age at menopause (continuous), number of pregnancies (continuous) and duration of lactation (continuous). The analysis of cervical cancer was also adjusted for age at first sexual intercourse (continuous) and number of pregnancies (continuous). Analyses with confounders treated as categorical variables yielded similar results to analyses with confounders as continuous variables. Potential confounders were included in the multivariate model mostly based on a review of the literature and from comparisons of cases vs. controls with student’s t-test. Because of lack of information on weight and height in a large number of participants (>50%) we could not include these covariates in the overall analyses. However, we conducted sensitivity analyses restricted to those participants with information on height and weight to investigate whether these covariates altered the results for all cancer sites combined. Because of the possibility that benign breast disease and benign prostate hyperplasia may be intermediates between diet and breast and prostate cancer risk, respectively, we repeated these analyses with exclusion of these controls. For cancers of the mouth and pharynx, larynx, esophagus, upper aerodigestive tract combined and lung we conducted sensitivity analyses with exclusions of respiratory disease controls. Tests for linear trend were calculated by entering the categorical variables as continuous parameters in the models. For comparison with other studies, we also analyzed meat consumption as a continuous variable and in this model, the unit of intake was set to 1 serving per day. Possible interactions between meat intake and age, sex, smoking status, alcohol intake, and intake of fruits, vegetables and milk, were assessed by including cross product terms in the multivariable models. We also investigated more extreme categorizations of meat intake to assess whether an effect is apparent only for very high intake of meat. A two-tailed P-value of <0.05 was considered to be statistically significant. All statistical tests were carried out using STATA version 9.2.
II. Material and methods In the time period between 1988 and 2000 we conducted a case-control study including cancers of the mouth (n=251), pharynx (n=243), esophagus (n=374), stomach (n=128), colon (n=177), rectum (n=200), pancreas (n=104), larynx (n=275), lung (n=1174), female breast (n=1607), cervix uteri (n=253), corpus uteri (n=82), ovary (n=83), prostate (n=376), testis (n=62), bladder (n=183), kidney (n=168), nervous system (n=64), thyroid (n=51) and sarcoma (n=147), melanoma (n=117), non-melanoma skin (n=390), Non-Hodgkin’s lymphoma (n=199), Hodgkin’s lymphoma (n=72), myeloma (n=46), leukemia (n=66) and all cancers combined (n=6892). The cases were between 20 and 89 years old and were admitted for diagnosis and treatment of a primary cancer in the Institute Nacional de Oncologia of Montevideo and completed a routine questionnaire on risk factors for cancer shortly after admittance. Of a total of 7142 eligible patients, 117 (1.6%) patients were too ill or deceased to participate and 133 (1.9%) patients refused the interview leaving a total of 6892 cases (response rate 96.5%). In the same time period 1832 hospital controls (age 20-89 years) without malignancies were admitted to the institute. The controls were affected with the following disorders: oral diseases (n=99, 5.4%), acute peritonitis (n=87, 4.7%), respiratory disorders (n=105, 5.7%), skin diseases (n=82, 4.5%), male genital diseases (n=103, 5.6%), benign breast disease (n=286, 15.6%), female genital diseases (n=78, 4.3%), benign lesions (n=182, 9.9%), various other diseases (n=527, 28.8%) and some were healthy check-up controls (n=283, 15.5%). Of a total of 1902 eligible controls, 31 (1.6%) patients were too ill or deceased and 39 (2.1%) refused the interview, leaving a total of
175
Aune et al: Meat consumption and cancer risk distribution of cases and controls by intake of meats is shown in the supplementary Table. High intake of total meat (OR=1.85; p for trend =0.003), red meat (OR=1.65; p for trend = 0.01), beef (OR=1.79; p for trend = 0.001) and processed meat (OR=2.03; p for trend =0.003) was associated with increased risk of laryngeal cancer. Similarly, high intake of most meat groups was associated with 2-4 fold increases in the risk of cancers of the esophagus, upper aerodigestive tract and stomach. Exclusion of respiratory disease controls from these analyses did not materially alter these results. High intake of total meat (OR=1.78; p for trend <0.0001), red meat (OR=1.89; p for trend <0.0001), beef (OR=2.04; p for trend <0.0001) and processed meat (OR=1.76; p for trend <0.0001) was associated with an increased risk of colorectal cancer.
III. Results The distribution of cases and controls according to socio-demographic variables and selected risk factors is shown in Table 1. Cancer cases were generally older and less educated, they also had higher intake of alcohol and tobacco, milk and total meat, but a similar intake of fruits and vegetables compared with the controls. The adjusted odds ratios for meat groups are shown in Table 2. The risk of oral cancer was increased in the highest tertile of intake of red meat (OR=2.09; p for trend <0.0001) and beef (OR=2.20; p for trend <0.0001), while intake of total meat (OR=1.61; p for trend = 0.03), red meat (OR=1.71; p for trend = 0.007), beef (OR=1.69; p for trend = 0.003), lamb (OR=1.85; p for trend = 0.009) and processed meat (OR=1.90; p for trend = 0.004) was associated with increased risk of pharyngeal cancer. The
Table 1. Comparison of selected covariates among all cases and controls (values are means (SD), unless other is specified). Variable Age, years Sex, n (%) Men Women Education, years Smoking status, n (%) Never smoker Former smoker Current smoker Cigarettes per day Ethanol, ml/d Fruits and vegetables, servings/week Milk, servings/week Total meat, servings/week
Cases 61.7 (13.3)
Controls 55.0 (16.6)
P <0.0001
3692 (53.6) 3200 (46.4 4.8 (3.1)
742 (40.50) 1090 (59.50) 5.8 (3.5)
<0.0001
2529 (36.7) 1527 (22.2) 2836 (41.1) 15.5 (17.9) 74.7 (153.4) 6.4 (4.4) 7.3 (5.5) 9.9 (6.2)
747 (40.8) 352 (19.2) 733 (40.0) 12.4 (15.5) 44.4 (115.6) 6.5 (4.4) 6.6 (5.5) 8.3 (5.6)
<0.0001 <0.0001 0.12 <0.0001 <0.0001
Table 2. Odds ratios, 95% confidence intervals of cancers with meat consumption1. Cancer site
Tertile2
Total meat
Fresh red meat
Beef
Lamb
Processed meat
Oral
1
1.00
1.00
1.00
1.00
1.00
2
1.40 (0.93-2.10)
1.50 (1.00-2.24)
1.62 (1.08-2.42)
0.96 (0.58-1.58)
0.95 (0.61-1.49)
3
1.53 (0.99-2.36)
2.09 (1.36-3.21)
2.20 (1.42-3.41)
0.99 (0.55-1.78)
0.99 (0.69-1.42)
Ptrend
0.083
<0.0001
<0.0001
0.98
0.96
Serv/d Pharynx
Oral, pharynx
3
1.16 (0.98-1.38)
1.41 (1.14-1.73)
1.57 (1.23-2.00)
0.89 (0.47-1.68)
0.62 (0.35-1.10)
1
1.00
1.00
1.00
1.00
1.00
2
1.30 (0.88-1.93)
1.17 (0.81-1.70)
1.28 (0.89-1.84)
1.11 (0.66-1.88)
1.69 (1.01-2.84)
3
1.61 (1.07-2.42)
1.71 (1.16-2.52)
1.69 (1.14-2.51)
1.85 (1.04-3.30)
1.90 (1.23-2.94)
Ptrend
0.028
0.007
0.003
0.009
0.004
Serv/d
1.31 (1.11-1.55)
1.47 (1.20-1.80)
1.56 (1.22-1.99)
1.38 (0.81-2.35)
1.09 (0.67-1.77)
1
1.00
1.00
1.00
1.00
1.00
2
1.37 (1.02-1.86)
1.36 (1.01-1.82)
1.51 (1.13-2.01)
0.96 (0.66-1.39)
1.20 (0.84-1.70)
3
1.63 (1.19-2.24)
1.97 (1.45-2.68)
2.08 (1.51-2.84)
1.28 (0.83-1.95)
1.27 (0.95-1.68)
Ptrend
0.005
<0.0001
<0.0001
0.073
0.10
Serv/d
1.16 (1.02-1.31)
1.35 (1.16-1.57)
1.47 (1.23-1.77)
1.21 (0.79-1.85)
0.97 (0.59-1.59)
176
Cancer Therapy Vol 7, page 177 Esophagus
Larynx
Upper aerodigestive tract
Stomach
Colon
Rectum
Colorectal
Pancreas
Lung
Sarcomas
1
1.00
1.00
1.00
1.00
1.00
2
1.70 (1.16-2.51)
1.55 (1.08-2.22)
1.56 (1.10-2.18)
1.59 (0.96-2.63)
1.18 (0.80-1.76)
3
3.30 (2.22-4.89)
2.95 (2.03-4.28)
2.80 (1.92-4.07)
2.72 (1.56-4.74)
1.51 (1.09-2.08)
Ptrend
<0.0001
<0.0001
<0.0001
<0.0001
0.006
Serv/d
1.74 (1.52-1.99)
1.91 (1.61-2.27)
2.08 (1.70-2.56)
3.08 (1.96-4.83)
1.85 (1.29-2.67)
1
1.00
1.00
1.00
1.00
1.00
2
1.37 (0.93-2.04)
1.36 (0.94-1.95)
1.31 (0.91-1.87)
1.33 (0.79-2.23)
2.01 (1.22-3.32)
3
1.85 (1.23-2.77)
1.65 (1.12-2.42)
1.79 (1.22-2.64)
1.52 (0.86-2.70)
2.03 (1.31-3.13)
Ptrend
0.003
0.011
0.001
0.12
0.003
Serv/d
1.38 (1.18-1.61)
1.50 (1.24-1.83)
1.68 (1.33-2.12)
1.04 (0.61-1.76)
1.43 (0.94-2.19)
1
1.00
1.00
1.00
1.00
1.00
2
1.62 (1.29-2.04)
1.53 (1.23-1.91)
1.59 (1.28-1.97)
1.31 (0.97-1.76)
1.33 (1.02-1.73)
3
2.33 (1.82-2.97)
2.34 (1.85-2.96)
2.40 (1.89-3.05)
1.81 (1.29-2.54)
1.47 (1.19-1.83)
Ptrend
<0.0001
<0.0001
<0.0001
<0.0001
<0.0001
Serv/d
1.37 (1.25-1.51)
1.54 (1.36-1.73)
1.69 (1.47-1.94)
1.50 (1.07-2.12)
1.44 (0.99-2.09)
1
1.00
1.00
1.00
1.00
1.00
2
2.09 (1.10-3.98)
1.54 (0.85-2.78)
1.49 (0.83-2.67)
1.99 (0.81-4.90)
2.37 (1.03-5.43)
3
4.02 (2.09-7.74)
3.70 (2.04-6.73)
3.66 (2.01-6.65)
2.80 (1.03-7.60)
4.39 (2.17-8.90)
Ptrend
<0.0001
<0.0001
<0.0001
0.025
<0.0001
Serv/d
1.97 (1.62-2.40)
2.08 (1.60-2.70)
2.18 (1.59-2.99)
4.47 (2.37-8.44)
3.75 (2.44-5.75)
1
1.00
1.00
1.00
1.00
1.00
2
1.31 (0.85-2.03)
1.53 (0.99-2.36)
1.45 (0.94-2.24)
1.32 (0.73-2.39)
2.11 (1.21-3.68)
3
1.87 (1.14-3.06)
1.99 (1.20-3.30)
2.00 (1.19-3.35)
1.53 (0.72-3.26)
2.10 (1.30-3.39)
Ptrend
0.019
0.008
0.001
0.29
0.002
Serv/d
1.41 (1.16-1.72)
1.48 (1.16-1.90)
1.57 (1.18-2.08)
1.27 (0.50-3.24)
1.65 (0.98-2.76)
1
1.00
1.00
1.00
1.00
1.00
2
1.29 (0.84-1.97)
1.26 (0.83-1.91)
1.42 (0.93-2.16)
1.36 (0.75-2.44)
1.10 (0.65-1.86)
3
1.64 (1.03-2.63)
1.70 (1.06-2.72)
1.92 (1.18-3.13)
1.12 (0.53-2.35)
1.60 (1.07-2.39)
Ptrend
0.056
0.031
0.001
0.93
0.01
Serv/d
1.29 (1.07-1.55)
1.35 (1.08-1.71)
1.53 (1.18-2.00)
0.68 (0.26-1.76)
1.85 (1.16-2.94)
1
1.00
1.00
1.00
1.00
1.00
2
1.29 (0.97-1.72)
1.37 (1.04-1.81)
1.43 (1.08-1.88)
1.32 (0.91-1.91)
1.54 (1.05-2.26)
3
1.78 (1.29-2.45)
1.89 (1.37-2.61)
2.04 (1.47-2.83)
1.32 (0.82-2.13)
1.76 (1.28-2.40)
Ptrend
<0.0001
<0.0001
<0.0001
0.28
<0.0001
Serv/d
1.30 (1.13-1.49)
1.36 (1.14-1.63)
1.51 (1.23-1.85)
0.93 (0.51-1.69)
1.57 (0.93-2.66)
1
1.00
1.00
1.00
1.00
1.00
2
0.87 (0.49-1.55)
0.96 (0.55-1.69)
0.92 (0.53-1.62)
1.83 (0.71-4.67)
1.08 (0.55-2.10)
3
1.32 (0.72-2.43)
1.44 (0.77-2.67)
1.36 (0.72-2.56)
2.19 (0.75-6.40)
1.34 (0.78-2.28)
Ptrend
0.38
0.28
0.25
0.14
0.23
Serv/d
1.30 (1.02-1.66)
1.31 (0.96-1.78)
1.28 (0.89-1.83)
1.69 (0.65-4.42)
1.74 (0.94-3.22)
1
1.00
1.00
1.00
1.00
1.00
2
1.26 (1.00-1.58)
1.28 (1.03-1.59)
1.29 (1.04-1.60)
1.33 (0.97-1.82)
1.33 (1.01-1.74)
3
1.59 (1.24-2.03)
1.68 (1.32-2.14)
1.66 (1.30-2.12)
1.91 (1.33-2.75)
1.24 (0.99-1.56)
Ptrend
<0.0001
<0.0001
<0.0001
<0.0001
0.11
Serv/d
1.30 (1.18-1.44)
1.43 (1.26-1.62)
1.36 (1.17-1.58)
1.45 (0.99-2.13)
1.22 (0.92-1.62)
1
1.00
1.00
1.00
1.00
1.00
2
1.55 (0.94-2.54)
1.39 (0.86-2.25)
1.34 (0.83-2.16)
1.00 (0.54-1.84)
1.92 (1.10-3.35)
3
2.27 (1.31-3.91)
2.18 (1.27-3.73)
2.08 (1.20-3.60)
1.03 (0.46-2.29)
1.55 (0.96-2.52)
Ptrend
0.004
0.004
0.001
0.94
0.16
Serv/d
1.60 (1.31-1.96)
1.72 (1.33-2.23)
1.77 (1.26-2.49)
1.28 (0.47-3.44)
1.15 (0.62-2.12)
177
Aune et al: Meat consumption and cancer risk Melanoma
1
1.00
1.00
1.00
1.00
1.00
2
0.89 (0.55-1.44)
0.92 (0.57-1.49)
0.98 (0.61-1.58)
1.24 (0.62-2.49)
1.51 (0.84-2.72)
3
0.93 (0.52-1.68)
0.96 (0.52-1.76)
0.92 (0.49-1.74)
0.87 (0.33-2.28)
1.14 (0.69-1.88)
Ptrend
0.79
0.87
0.86
0.63
0.82
Serv/d
0.93 (0.71-1.22)
0.94 (0.67-1.30)
0.97 (0.64-1.46)
0.64 (0.17-2.42)
0.76 (0.34-1.69)
1.00
1.00
1.00
1.00
1.00
Non-melanoma 1 skin 2
Breast
Cervix uteri
Corpus uteri
Ovary
Prostate
Testis
Bladder
Kidney
1.14 (0.85-1.54)
1.03 (0.77-1.38)
1.06 (0.79-1.42)
1.11 (0.75-1.64)
1.69 (1.19-2.41)
3
1.20 (0.85-1.69)
1.23 (0.88-1.74)
1.36 (0.96-1.92)
1.23 (0.75-2.02)
1.32 (0.98-1.79)
Ptrend
0.38
0.26
0.023
0.40
0.21
Serv/d
1.08 (0.93-1.26)
1.17 (0.97-1.41)
1.15 (0.92-1.45)
0.82 (0.42-1.57)
1.02 (0.66-1.57)
1
1.00
1.00
1.00
1.00
1.00
2
1.10 (0.92-1.33)
1.06 (0.88-1.26)
1.02 (0.86-1.23)
1.16 (0.91-1.46)
1.27 (0.98-1.64)
3
1.19 (0.93-1.52)
1.38 (1.06-1.79)
1.36 (1.04-1.78)
1.65 (1.12-2.43)
1.23 (1.01-1.51)
Ptrend
0.15
0.034
0.059
0.016
0.067
Serv/d
1.06 (0.94-1.20)
1.16 (0.99-1.35)
1.15 (0.97-1.36)
1.71 (0.84-3.48)
1.10 (0.72-1.68)
1
1.00
1.00
1.00
1.00
1.00
2
1.11 (0.81-1.54)
1.12 (0.82-1.54)
1.08 (0.79-1.48)
1.29 (0.83-2.00)
0.84 (0.54-1.31)
3
1.39 (0.94-2.05)
1.59 (1.05-2.39)
1.57 (1.04-2.38)
1.53 (0.80-2.92)
0.94 (0.67-1.31)
Ptrend
0.10
0.04
0.06
0.20
0.83
Serv/d
1.19 (0.99-1.43)
1.40 (1.11-1.76)
1.45 (1.13-1.86)
1.67 (0.67-4.14)
0.71 (0.41-1.23)
1
1.00
1.00
1.00
1.00
1.00
2
0.73 (0.43-1.25)
0.54 (0.31-0.93)
0.50 (0.29-0.87)
0.83 (0.45-1.53)
1.30 (0.63-2.66)
3
1.17 (0.62-2.20)
1.36 (0.70-2.61)
1.41 (0.73-2.73)
1.02 (0.37-2.83)
1.37 (0.77-2.44)
Ptrend
0.91
0.95
0.94
0.84
0.31
Serv/d
0.94 (0.66-1.33)
1.04 (0.67-1.61)
1.11 (0.69-1.78)
0.29 (0.02-3.57)
1.01 (0.29-3.50)
1
1.00
1.00
1.00
1.00
1.00
2
1.23 (0.73-2.07)
1.10 (0.66-1.84)
1.24 (0.74-2.06)
1.40 (0.69-2.90)
1.57 (0.77-3.21)
3
0.89 (0.43-1.83)
1.16 (0.56-2.41)
1.00 (0.45-2.20)
1.59 (0.55-4.61)
1.34 (0.73-2.46)
Ptrend
0.95
0.66
0.77
0.37
0.45
Serv/d
0.92 (0.65-1.31)
0.99 (0.65-1.53)
0.99 (0.62-1.58)
1.02 (0.15-6.85)
0.74 (0.21-2.60)
1
1.00
1.00
1.00
1.00
1.00
2
1.25 (0.88-1.78)
1.33 (0.95-1.87)
1.44 (1.03-2.02)
1.08 (0.69-1.68)
0.98 (0.64-1.49)
3
1.58 (1.08-2.30)
1.42 (0.99-2.06)
1.56 (1.08-2.28)
1.02 (0.61-1.69)
1.06 (0.76-1.48)
Ptrend
0.018
0.072
0.022
0.99
0.71
Serv/d
1.17 (1.00-1.37)
1.17 (0.97-1.42)
1.25 (0.99-1.56)
0.99 (0.58-1.69)
1.11 (0.70-1.77)
1
1.00
1.00
1.00
1.00
1.00
2
1.46 (0.74-2.91)
1.16 (0.61-2.21)
1.50 (0.78-2.88)
1.55 (0.58-4.19)
1.53 (0.66-3.56)
3
2.04 (1.00-4.18)
1.89 (0.97-3.68)
2.08 (1.03-4.20)
2.48 (0.83-7.43)
1.44 (0.70-2.94)
Ptrend
0.051
0.05
0.037
0.059
0.40
Serv/d
1.33 (0.99-1.79)
1.51 (1.05-2.15)
1.56 (1.03-2.36)
1.94 (0.77-4.86)
1.00 (0.43-2.30)
1
1.00
1.00
1.00
1.00
1.00
2
1.17 (0.76-1.82)
0.98 (0.64-1.49)
1.00 (0.66-1.51)
1.64 (0.86-3.13)
1.75 (1.07-2.86)
3
1.68 (1.06-2.66)
1.76 (1.14-2.72)
1.71 (1.10-2.65)
1.89 (0.92-3.88)
1.22 (0.79-1.88)
Ptrend
0.029
0.012
0.007
0.071
0.75
Serv/d
1.36 (1.13-1.64)
1.45 (1.15-1.83)
1.41 (1.07-1.86)
1.52 (0.81-2.85)
1.18 (0.67-2.08)
1
1.00
1.00
1.00
1.00
1.00
2
1.47 (0.90-2.38)
1.33 (0.82-2.15)
1.33 (0.82-2.14)
1.18 (0.61-2.28)
1.57 (0.95-2.60)
3
1.96 (1.16-3.33)
2.43 (1.45-4.06)
2.47 (1.46-4.15)
1.80 (0.84-3.87)
1.21 (0.79-1.86)
Ptrend
0.019
0.001
<0.0001
0.099
0.63
Serv/d
1.47 (1.22-1.78)
1.81 (1.43-2.30)
1.84 (1.33-2.53)
2.11 (1.00-4.45)
0.73 (0.38-1.43)
178
Cancer Therapy Vol 7, page 179 Nervous system
Thyroid
Lymphomas
NonHodgkinâ&#x20AC;&#x2122;s lymphoma
Hodgkinâ&#x20AC;&#x2122;s disease
Myeloma
Leukemia
All sites
1
1.00
1.00
1.00
1.00
1.00
2
1.64 (0.76-3.53)
1.97 (0.92-4.21)
2.18 (1.01-4.70)
1.28 (0.48-3.37)
1.79 (0.74-4.31)
3
3.12 (1.40-6.97)
3.79 (1.69-8.50)
3.97 (1.73-9.11)
1.75 (0.55-5.63)
1.80 (0.85-3.80)
Ptrend
0.006
0.001
<0.0001
0.33
0.15
Serv/d
1.39 (1.01-1.91)
1.81 (1.23-2.66)
2.02 (1.26-3.23)
1.09 (0.25-4.74)
0.66 (0.22-1.98)
1
1.00
1.00
1.00
1.00
1.00
2
1.28 (0.60-2.71)
1.82 (0.85-3.88)
1.54 (0.73-3.26)
1.47 (0.49-4.42)
0.42 (0.17-1.03)
3
2.38 (1.07-5.31)
2.17 (0.90-5.26)
2.33 (0.98-5.50)
3.05 (0.87-10.72)
0.73 (0.41-1.29)
Ptrend
0.039
0.083
0.071
0.064
0.83
Serv/d
1.11 (0.92-1.34)
1.04 (0.84-1.30)
1.54 (0.91-2.60)
1.55 (0.36-6.58)
1.24 (0.63-2.41)
1
1.00
1.00
1.00
1.00
1.00
2
1.27 (0.93-1.74)
1.52 (1.13-2.06)
1.46 (1.08-1.97)
1.33 (0.88-2.01)
1.73 (1.13-2.65)
3
1.87 (1.33-2.64)
1.95 (1.37-2.76)
1.93 (1.36-2.75)
1.81 (1.09-3.00)
2.01 (1.41-2.86)
Ptrend
0.006
<0.0001
<0.0001
0.019
<0.0001
Serv/d
1.27 (1.09-1.48)
1.37 (1.14-1.66)
1.48 (1.19-1.83)
1.24 (0.68-2.27)
1.40 (0.79-2.48)
1
1.00
1.00
1.00
1.00
1.00
2
1.33 (0.86-2.04)
1.87 (1.21-2.88)
1.69 (1.10-2.59)
1.46 (0.78-2.72)
1.74 (1.03-2.94)
3
1.79 (1.11-2.88)
2.02 (1.22-3.35)
1.85 (1.11-3.09)
2.03 (0.97-4.25)
2.01 (1.30-3.11)
Ptrend
0.025
0.005
0.003
0.052
0.004
Serv/d
1.26 (1.05-1.52)
1.40 (1.12-1.76)
1.39 (1.02-1.89)
1.45 (0.64-3.25)
0.94 (0.52-1.68)
1
1.00
1.00
1.00
1.00
1.00
2
1.15 (0.68-1.92)
1.09 (0.67-1.75)
1.16 (0.71-1.87)
1.43 (0.71-2.87)
2.10 (0.86-5.15)
3
1.48 (0.83-2.64)
1.09 (0.61-1.95)
1.34 (0.75-2.39)
0.97 (0.38-2.50)
2.15 (1.00-4.63)
Ptrend
0.19
0.77
0.42
0.74
0.065
Serv/d
1.09 (0.77-1.53)
1.09 (0.71-1.66)
1.22 (0.85-1.75)
0.32 (0.07-1.46)
1.02 (0.47-2.19)
1
1.00
1.00
1.00
1.00
1.00
2
1.33 (0.55-3.23)
1.10 (0.47-2.61)
1.16 (0.50-2.71)
0.85 (0.32-2.27)
1.24 (0.43-3.62)
3
3.28 (1.34-8.00)
3.55 (1.52-8.31)
3.47 (1.47-8.21)
2.07 (0.67-6.40)
2.07 (0.89-4.78)
Ptrend
0.01
0.005
0.003
0.16
0.058
Serv/d
1.82 (1.31-2.53)
2.14 (1.38-3.31)
2.29 (1.34-3.93)
2.61 (0.78-8.71)
1.27 (0.43-3.71)
1
1.00
1.00
1.00
1.00
1.00
2
0.87 (0.45-1.69)
0.99 (0.51-1.90)
1.06 (0.55-2.04)
1.61 (0.61-4.22)
1.99 (0.84-4.73)
3
1.55 (0.77-3.16)
1.70 (0.82-3.51)
1.87 (0.89-3.91)
1.27 (0.37-4.38)
2.11 (1.01-4.44)
Ptrend
0.25
0.18
0.092
0.83
0.058
Serv/d
1.52 (1.13-2.06)
1.40 (0.95-2.07)
1.49 (0.92-2.41)
0.89 (0.20-4.01)
2.75 (1.40-5.38)
1
1.00
1.00
1.00
1.00
1.00
2
1.19 (1.05-1.35)
1.19 (1.05-1.34)
1.20 (1.06-1.36)
1.24 (1.05-1.47)
1.36 (1.15-1.62)
3
1.61 (1.38-1.88)
1.71 (1.46-1.99)
1.73 (1.48-2.03)
1.63 (1.31-2.03)
1.32 (1.15-1.51)
Ptrend
<0.0001
<0.0001
<0.0001
<0.0001
<0.0001
Serv/d
1.24 (1.16-1.34)
1.35 (1.23-1.47)
1.41 (1.27-1.56)
1.41 (1.07-1.88)
1.12 (0.92-1.36)
1
Adjusted for: age, sex (when applicable), education, residence, smoking status, cigarettes per day, age at starting smoking, years since quitting smoking, duration of smoking, type of tobacco, alcohol intake, fruits and vegetables and milk. Results for breast, ovarian and uterine corpus cancers were also adjusted for age at menarche, age at menopause, number of pregnancies and lactation while results for cervical cancer were adjusted for age at first sexual intercourse and number of pregnancies. 2 Cut-off points and medians for tertiles: Total meat, ! 5, 5-11, >11 times per week, medians: 3, 7.9, 15.9 times/wk. Red meat (fresh): ! 4, 4.02-9, >9 times per week, medians: 2.2, 7.1, 14.1 times/wk. Beef: ! 3, 3.02-7, >7 times per week, medians: 2, 7, 14 times/wk. Lamb: 0, 0.02-1, >1 time per week, medians: 0, 0.5, 3 times/wk. Processed meat: 0, 1/year-1/month, >1/month, medians: 0, 1/month, 1/week. 3 Serv/d = analysis on a continuous scale, for an intake of 1 serving per day.
179
Aune et al: Meat consumption and cancer risk Most indicators of meat intake were not associated with pancreatic cancer, with the exception of an association for total meat on a continuous scale (OR=1.30). High intake of total meat (OR=1.59; p for trend <0.0001), red meat (OR=1.68; p for trend <0.0001), beef (OR=1.66; p for trend <0.0001) and lamb (OR=1.91; p for trend <0.0001) was associated with increased risk of lung cancer, while an association with processed meat was not statistically significant (OR=1.24; p for trend =0.11). High intake of total meat, red meat and beef was associated with a two-fold increased risk of sarcomas, but such an association was not observed with melanoma and non-melanoma skin cancer. High intake of red meat (OR=1.38; p for trend =0.03), beef (OR=1.36; p for trend =0.06), lamb (OR=1.65; p for trend = 0.02) and processed meat (OR=1.23; p for trend = 0.07) was associated with increased risk of breast cancer, but such an association was not observed for total meat. Exclusion of controls with a diagnosis of benign breast disease did not alter these results (results not shown). Similarly, high intake of red meat (OR=1.59; p for trend = 0.04) and beef (OR=1.57; p for trend = 0.06) was associated with increased risk of cervical cancer, but no association was observed between any type of meat and cancers of the corpus uteri and the ovaries. High intake of total meat (OR=1.58; p for trend = 0.02) and beef (OR=1.56; p for trend = 0.02) was significantly associated with risk of prostate cancer, while intake of total meat (OR=2.04; p for trend = 0.05), red meat (OR=1.89; p for trend = 0.05) and beef (OR=2.08; p for trend =0.04) was associated with testicular cancer risk. The results for prostate cancer were unaltered when we excluded controls with a diagnosis of benign prostate hyperplasia from the analysis (results not shown). A high intake of total meat (OR=1.68; p for trend = 0.03), red meat (OR=1.76; p for trend = 0.01) and beef (OR=1.71; p for trend = 0.007) was associated with increased risk of bladder cancer; the same pattern was observed for kidney cancer risk (total meat: OR=1.96; p for trend = 0.02), red meat: OR=2.43; p for trend =0.001 and beef: OR=2.47; p for trend <0.0001) and risk of cancer of the nervous system (total meat: OR=3.12; p for trend =0.006), red meat: OR=3.79; p for trend =0.001 and beef: OR=3.97; p for trend <0.0001), while high intake of total meat (OR=2.38; p for trend = 0.04) was associated with elevated risk of thyroid cancer. High intake of total meat (OR=1.87; p for trend = 0.006), red meat (OR=1.95; p for trend <0.0001), beef (OR=1.93; p for trend <0.0001), lamb (OR=1.81; p for trend = 0.02) and processed meat (OR=2.01; p for trend <0.0001) were associated with increased risk of all lymphomas combined; similar findings were found for non-Hodgkinâ&#x20AC;&#x2122;s lymphoma and myeloma, but not for Hodgkinâ&#x20AC;&#x2122;s disease. An association was suggested between leukemia risk and high intake of processed meat (OR=2.11; p for trend = 0.058) and total meat (OR=1.52) on a continuous scale, but not with other types of meat. High intake of total meat (OR=1.61; p for trend <0.0001), red meat (OR=1.71; p for trend <0.0001), beef (OR=1.73; p for trend <0.0001), lamb (OR=1.63; p for
trend <0.0001) and processed meat (OR=1.32; p for trend <0.0001) was associated with increased risk of all cancer sites included in the study combined. When we restricted the latter analysis to the participants with information on height and weight, inclusion of height and weight or BMI as additional covariates did not alter the results. We repeated the analyses of total meat, red meat and beef with more extreme cut-points to see whether extremes of intake yielded stronger results (Figure 1). There was a stronger association with this categorisation than using our original cut-off points with ORs of 2.04 to 2.31 for the highest category compared with the lowest, and this was also the case for most of the individual cancer sites (results not shown), however the effect estimates for several of the sites became rather unstable with considerably wider confidence intervals. Age modified the association between total and red meat consumption and risk of all cancer sites combined (p for interaction 0.004 and 0.01 for total and red meat, respectively), with stronger ORs among younger persons (<40 years, OR=2.02, 95% CI: 1.32-3.10 for high intake of total meat and 1.83, 95% CI: 1.19-2.81 for high intake of red meat), than among middle-aged (40-60 years, corresponding ORs=1.64, 95% CI: 1.26-2.12 and 1.70, 95% CI: 1.31-2.21) and elderly (>60 years, corresponding ORs=1.44, 95% CI: 1.16-1.79 and 1.58, 95% CI: 1.271.96) (Table 3). Smoking modified the association between total meat intake and risk of all cancer sites combined with weaker ORs among never smokers (OR=1.43, 95% CI: 1.12-1.83) and former smokers (OR=1.55, 95% CI: 1.11-2.15) than among current smokers (OR=1.82, 95% CI: 1.42-2.34, p for interaction = 0.02), but a similar interaction was not observed between smoking and high intake of red and processed meat (Table 3). Further, when smoking-related cancers and nonsmoking related cancers were analysed separately there were no significant interactions between total, red or processed meat intake and smoking (results not shown). Sex, alcohol intake and intake of fruits and vegetables and milk did not modify the effect of meat intake on risk of all cancer sites combined (p for all comparisons "0.09). The increased risks with total meat, red meat and processed meat persisted among the group of never smokers, nondrinkers of alcohol and in most subgroups with respect to age, sex, intakes of fruit and vegetables and milk. With stepwise addition of each of the confounders to the age and sex-adjusted results it was observed that adjustment for smoking explained most of the attenuation of the OR for lung cancer and upper aerodigestive tract cancers, but this attenuation was relatively small for all cancer sites combined (results not shown).
IV. Discussion In this large hospital-based case-control study we found increased risk of multiple cancers with intake of total meat, red meat, beef, lamb and processed meat. The cancer site which has been most investigated previously in relation to meat intake is colorectal cancer and our finding of an elevated risk with higher intake is consistent with previous studies (De Stefani et al, 1997a; Singh and Fraser, 1998; Norat et al, 2005; Cross et al, 180
Cancer Therapy Vol 7, page 181
Figure 1. Odds ratios (squares) and 95% confidence intervals (yellow lines) for risk of all cancer sites combined with more extreme ranges of intake of total meat, red meat and beef (x-axis shows servings per week) with adjustment for confounders listed in footnote to Table 2. Medians of meat intake in each category: Total meat: 1, 3, 5.5, 8.2, 11.2 and 17 servings/week; red meat: 1, 3, 5.2, 8, 11 and 15 servings/week and beef: 1, 3, 5, 7, 9.3 and 14 servings/week.
Table 3. Odds ratios and 95% CIs for meat consumption and all cancer sites combined in strata of covariates. All sites
Total meat
Red meat
Processed meat
2
3
2
3
2
3
!40 yrs
1.27 (0.90-1.80)
2.02 (1.32-3.10)
1.19 (0.85-1.67)
1.83 (1.19-2.81)
2.28 (1.35-3.85)
1.56 (1.04-2.33)
>40-60 yrs
1.22 (0.98-1.52)
1.64 (1.26-2.12)
1.14 (0.92-1.41)
1.70 (1.31-2.21)
1.28 (0.95-1.71)
1.35 (1.07-1.70)
>60 yrs
1.13 (0.94-1.36)
1.44 (1.16-1.79)
1.18 (0.98-1.41)
1.58 (1.27-1.96)
1.27 (1.01-1.60)
1.27 (1.05-1.53)
Men
1.16 (0.94-1.44)
1.69 (1.34-2.13)
1.21 (0.99-1.49)
1.67 (1.34-2.09)
1.34 (1.03-1.75)
1.21 (0.98-1.50)
Women
1.22 (1.04-1.43)
1.46 (1.18-1.80)
1.16 (0.99-1.36)
1.70 (1.36-2.12)
1.35 (1.08-1.69)
1.39 (1.16-1.65)
Fruits,
!median
1.15 (0.95-1.39)
1.70 (1.37-2.11)
1.12 (0.94-1.35)
1.71 (1.38-2.12)
1.44 (1.14-1.82)
1.40 (1.15-1.70)
vegetables
>median
1.23 (1.03-1.47)
1.50 (1.21-1.86)
1.25 (1.06-1.49)
1.67 (1.34-2.09)
1.31 (1.03-1.68)
1.24 (1.03-1.50)
Milk
!median
1.16 (0.99-1.36)
1.59 (1.31-1.94)
1.16 (1.00-1.35)
1.80 (1.47-2.20)
1.34 (1.08-1.66)
1.27 (1.07-1.50)
>median
1.25 (1.00-1.56)
1.63 (1.27-2.08)
1.24 (1.00-1.54)
1.56 (1.21-2.00)
1.42 (1.08-1.88)
1.40 (1.12-1.75)
Never
1.17 (0.97-1.41)
1.43 (1.12-1.83)
1.28 (1.06-1.53)
1.75 (1.35-2.26)
1.20 (0.93-1.56)
1.26 (1.03-1.55)
Former
1.21 (0.90-1.63)
1.55 (1.11-2.15)
1.19 (0.89-1.59)
1.51 (1.09-2.10)
1.09 (0.74-1.59)
1.20 (0.87-1.64)
Current
1.24 (1.00-1.55)
1.82 (1.42-2.34)
1.07 (0.87-1.33)
1.66 (1.30-2.12)
1.83 (1.37-2.44)
1.50 (1.20-1.88)
Nondrinker
1.20 (1.03-1.40)
1.59 (1.31-1.92)
1.22 (1.05-1.41)
1.73 (1.42-2.12)
1.36 (1.10-1.66)
1.38 (1.17-1.62)
1-120 drinks/yr
1.30 (0.96-1.75)
1.70 (1.23-2.34)
1.22 (0.91-1.62)
1.70 (1.25-2.31)
1.37 (0.94-2.00)
1.16 (0.85-1.57)
121+ drinks/yr
0.97 (0.60-1.58)
1.48 (0.91-2.41)
1.01 (0.66-1.57)
1.54 (0.98-2.42)
1.40 (0.80-2.46)
1.37 (0.89-2.11)
Age
Sex
Smoking
Alcohol
2007; World Cancer Research Fund/American Institute for Cancer Research, 2007). Previous meta-analyses showed an elevated risk of colorectal cancer with higher meat intake (Norat et al, 2002; Larsson and Wolk, 2006) and in
the World Cancer Research Fund/American Institute for Cancer Research (WCRF/AICR) report from 2007, the evidence that red and processed meat increases colorectal cancer risk was judged to be convincing (World Cancer 181
Aune et al: Meat consumption and cancer risk Research Fund/American Institute for Cancer Research, 2007). Our finding of an elevated risk of oral and pharyngeal cancer with higher intake of red meat and beef is consistent with some (Levi et al, 1998; Franceschi et al, 1999), but not all previous case-control studies (Zheng et al, 1992). We did not find an elevated risk of oral cancer with higher processed meat intake as some case-control studies have indicated (Levi et al, 1998; Levi et al, 2004), but we did find a positive association with risk of pharyngeal cancer. Our findings suggested a strong increase in the risk of esophageal cancer with all meat groups and is in line with recent case-control (Navarro Silvera et al, 2008) and cohort studies (Gonzalez et al, 2006; Cross et al, 2007) and the WCRF/AICR report which found limited suggestive evidence for an association with both red and processed meat (World Cancer Research Fund/American Institute for Cancer Research, 2007). Most previous studies reported elevated risks of laryngeal cancer with higher intake of red and/or processed meat (Bosetti et al, 2002; Cross et al, 2007; Sapkota et al, 2008) and our study provides further support for these findings. Stomach cancer risk was strongly associated with meat intake in this study. A previous meta-analysis found evidence that processed meat was associated with increased stomach cancer risk (Larsson et al, 2006b) and our results support these findings. The large European EPIC-study found increased stomach cancer risk with higher intake of total, red and processed meat (Gonzalez et al, 2006), but a recent American cohort could not confirm these findings (Cross et al, 2007). We found little association between meat intake and pancreatic cancer in line with some (Stolzenberg-Solomon et al, 2002; Michaud et al, 2003), but not all studies (Tavani et al, 2000; Nothlings et al, 2005; Larsson et al, 2006a; Cross et al, 2007). However, the statistical power of our study was not adequate to detect a moderate increase in risk of pancreatic cancer. Lung cancer risk was elevated with higher intake of total meat, red meat, beef, lamb and processed meat, in line with several studies (Deneo-Pellegrini et al, 1996; Alavanja et al, 2001; De Stefani et al, 2002; Cross et al, 2007; Hu et al, 2008) and the recent WCRF/AICR report which stated that there was limited suggestive evidence for an adverse effect of red and processed meat on lung cancer risk (World Cancer Research Fund/American Institute for Cancer Research, 2007). Given the strong association between tobacco smoking and lung cancer, however, a residual confounding effect of this habit cannot be completely excluded. We found an elevated risk of sarcoma with intake of most meats, but another study found no association (Tavani et al, 1997). A limited number of previous studies of meat intake and melanoma and non-melanoma skin cancer are consistent with our general findings of no association (Veierod et al, 1997; Davies et al, 2002). We found a significant increase in breast cancer risk with intake of red meat, beef and lamb and a marginally significant increase with intake of processed meat, but not with total meat. These results are not entirely consistent
with a previous study from this population which found strong increases in the risk with higher total and red meat intake (De Stefani E. et al, 1997b). A previous metaanalysis of meat consumption and breast cancer risk including 22 case-control studies and 9 cohort studies found evidence of increased risk (Boyd et al, 2003), while a pooled analysis of seven cohort studies found no association (Missmer et al, 2002). More recent studies have also found conflicting results, with some case-control (Kruk, 2007; Bessaoud et al, 2008) and cohort studies (Cho et al, 2006; Taylor et al, 2007; Egeberg et al, 2008) reporting positive associations while others reported no association (Cross et al, 2007; Kabat et al, 2007). In our study high intake of red meat and beef were associated with increased risk of cervical cancer, but we did not find any associations between meat intake and cancers of the uterus or ovaries. A previous meta-analysis of 9 casecontrol studies and one cohort study found a positive association between total and red meat intake and endometrial cancer (Bandera et al, 2007) in contrast to our null findings. A review of the literature suggested that meat intake was associated with increased risk of ovarian cancer (Schulz et al, 2004), but recent cohorts found mixed results (Kiani et al, 2006; Cross et al, 2007; Schulz et al, 2007). Recent studies found positive associations between intake of meat (Ghosh et al, 2008) or processed meat (Cross et al, 2007) and cervical cancer, but the evidence is limited (World Cancer Research Fund/American Institute for Cancer Research, 2007). In this study high intake of total meat and beef was positively associated with risk of prostate cancer and high intake of total meat, red meat and beef were associated with increased risk of testicular cancer. Previous studies of meat intake and prostate cancer have provided conflicting results with some showing a positive association (Gann et al, 1994; Le Marchand L. et al, 1994), while others found no association (Tavani et al, 2000; Park et al, 2007). Some studies reported positive associations with advanced or metastatic prostate cancers, but not with total prostate cancer (Michaud et al, 2001; Cross et al, 2007). The WCRF/AICR report stated that there was limited suggestive evidence that processed meat increases prostate cancer risk (World Cancer Research Fund/American Institute for Cancer Research, 2007). Few studies have previously investigated meat intake and testicular cancer with some reporting positive associations (Sigurdson et al, 1999; Hu et al, 2008) while others reported no association (Bonner et al, 2002). We found positive associations between intake of total meat, red meat and beef and bladder cancer risk, in line with some (Steineck et al, 1988; Mills et al, 1991; Tavani et al, 2000; Hu et al, 2008; Lumbreras et al, 2008), but not all previous studies (Augustsson et al, 1999). We also found positive associations between total meat, red meat and beef and kidney cancer risk, also consistent with some (Chow et al, 1994; Maclure and Willett, 1990; De Stefani et al, 1998b; Hsu et al, 2007), but not all studies (Augustsson et al, 1999; Tavani et al, 2000). Higher intake of total meat, red meat and beef were associated with increased risk of nervous system cancers, while only total meat was associated with thyroid cancer
182
Cancer Therapy Vol 7, page 183 risk. A previous meta-analysis of 9 studies found increased risk of brain cancers with intake of processed meat (Huncharek et al, 2003) while the results have been mixed for thyroid cancer (Tavani et al, 2000; Cross et al, 2007). In our study intake of all types of meat were associated with increased risk of lymphomas and similar results were apparent for non-Hodgkinâ&#x20AC;&#x2122;s lymphoma and myeloma, but not with Hodgkinâ&#x20AC;&#x2122;s disease. Other studies have also reported positive associations between total meat or red meat intake and non-Hodgkinâ&#x20AC;&#x2122;s lymphoma (Chiu et al, 1996; Zhang et al, 1999), but most studies reported no association (Talamini et al, 2006; Cross et al, 2007; Hu et al, 2008). A few previous studies found increased risk of myeloma with intake of red meat (Tavani et al, 2000) or processed meat (Cross et al, 2007), while others reported no association (Hosgood, III et al, 2007; Brown et al, 2001). Total and processed meat intake was associated with increased risk of leukemia in line with a few casecontrol studies of childhood (Petridou et al, 2005; Sarasua and Savitz, 1994) or adulthood leukemia (Hu et al, 2008), but in contrast to prospective studies (Ross et al, 2002; Cross et al, 2007). All the meat groups were associated with increased risk of all cancer sites combined. It should be noted that our estimate for all cancer sites (included in this study) combined is not equal to an effect on total cancer incidence because we did not have information on several cancer sites and because the distribution of cancers in this study is not representative of that of the Uruguayan population. Several potential mechanisms could explain the association between meat intake and increased cancer risk. A detrimental effect of meat intake on cancer risk has often been attributed to the content of saturated fat and cholesterol. High intake of fat increases the formation of secondary bile acids which are carcinogenic in the colon and rectum (Nagengast et al, 1995); it may also increase estrogen and androgen levels in plasma (Forman, 2007) and may lead to obesity, an established risk factor for several different cancer sites (World Cancer Research Fund/American Institute for Cancer Research, 2007). However, the epidemiological evidence for dietary fat and cancer risk is weaker than that for meat for several cancer sites (World Cancer Research Fund/American Institute for Cancer Research, 2007). Other possible mechanisms of meat-induced carcinogenesis include formation of heterocyclic amines (HCA) and polycyclic aromatic hydrocarbons (PAH) during cooking and grilling of meats, nitrite and nitrate in processed meats and the heme-iron content of red meat. HCAs are known to increase increase free radical formation and oxidative stress which can induce DNA adducts and mutations (Cross and Sinha, 2004). They have been shown to induce several cancers in animals, including cancers of the liver, lung, stomach, colorectum and breast and sarcomas (Ohgaki et al, 1984; Lijinsky, 1987; Snyderwine, 2002). Processed meats contain nitrite and nitrate which can be converted to nitrosamines which in turn are multi-organ carcinogens in animals (Lijinsky, 1987). Some processed meats contain added salt, a suspected risk factor for
stomach cancer (World Cancer Research Fund/American Institute for Cancer Research, 2007) and one study reported increased risk of gastroesophageal reflux, an established risk factor for esophageal adenocarcinoma with higher intake of salted meat (Nilsson et al, 2004). Higher intake of heme-iron, but not organic iron, may increase the risk of gastrointestinal cancers by increasing the endogenous formation of N-nitroso compounds (Cross et al, 2003; Lunn et al, 2007) and some studies found increased risk of colorectal cancer with intake of hemeiron (Larsson et al, 2005; Balder et al, 2006). Heme-iron may increase oxidative stress and the formation of lipid peroxidation products, such as 1,4-dihydroxynonane mercapturic acid and 8-iso-prostaglanding-F2#, which have been associated with preneoplastic lesions in the colon of rats (Pierre et al, 2006). In addition, animal experiments suggest that higher iron intake may enhance the development of breast (Diwan et al, 1997) and the formation of lung tumours (Yano et al, 1994). Higher body iron stores or dietary iron intake have been associated with increased risk of colorectal, lung and liver cancer in epidemiological studies (Knekt et al, 1994; Polesel et al, 2007). Because of limitations in the dietary assessment in this study we were not able to further address the issues of dietary fat, cooking mutagens, preservatives or heme-iron intake. Our study has several potential limitations; as with any case-control study we cannot rule out the possibility of recall or selection biases. The finding of elevated risks of multiple cancers with weak or limited prior evidence could be interpreted to suggest that selection bias may be present. If the controls either consume or report their meat consumption differently than the general population biased results may occur. However, the mean red meat intake among the controls in this study (140 grams per day (g/d)) is similar to the estimated mean intake of 145 g/d (168 g/d and 122 g/d among men and women, respectively) in dietary surveys from the same region, including Argentina and Paraguay (reference no. 67 in (Norat et al, 2002)). The participation rates were very high and similar among cases and controls suggesting that response bias due to different participation rates has been minimized. Selection of hospital controls is another potential source of bias. Because some of the controls (benign breast disease, benign prostate hyperplasia and benign diseases) might be intermediates between diet and cancer risk we conducted sensitivity analyses with exclusions of these controls for these cancers and in the overall analysis, but the results were similar. Further, exclusion of oral and respiratory disease controls did not materially alter the results for cancers of the upper aerodigestive tract or lung. Recall bias is a potential problem in case-control studies because of the retrospective assessment of diet. The possible link between meat intake and cancer risk is mostly unknown to the general population in Uruguay and the participants in this study were generally of low socioeconomic status, with minimal knowledge about the role of diet in affecting cancer risk. Meat intake is not considered an unhealthy dietary habit in this population and these points should make recall bias less likely. Nevertheless, we cannot exclude the possibility that recall
183
Aune et al: Meat consumption and cancer risk bias could explain some of our findings. The short food frequency questionnaire that was used is an additional limitation of this study and we were only able to adjust for the intake of some dietary factors that may affect cancer risk, such as fruits, vegetables and milk in the multivariable analysis. We were not able to adjust for energy intake, BMI or physical activity because of missing or incomplete information on these variables. When we restricted the analysis of all cancer sites combined to those participants with complete information on weight and height, further adjustment for height and weight or BMI did not alter the results. Further, adjustment for BMI and other food groups in another study currently under way from the same population appeared to strengthen rather than weaken the results (unpublished results) and in several previous publications from the Uruguayan population the results for meat intake appeared to be independent of BMI and energy intake (Deneo-Pellegrini et al, 1996; De Stefani et al, 1997a,b, 1999; Oreggia et al, 2001). Thus, we believe our findings may not be subject to substantial confounding by these variables. Also, other studies found that the association between meat intake and cancer risk remained significant even after adjustment for physical activity (Cross et al, 2007; Hu et al, 2008; Bessaoud et al, 2008; Taylor et al, 2007; Norat et al, 2005). We cannot exclude the possibility of residual confounding by smoking or unknown or unmeasured factors (e.g. use of aspirin, other medications or infections). However, the finding that meat intake was associated with increased risk of cancer even among the group of never smokers and non-drinkers suggest that residual confounding by smoking or alcohol intake is not likely to explain the results. Also, the finding that the results persisted in most other subgroups when stratified suggests that meat intake may be an independent risk factor for cancer. For some sites, we may have had too low power to detect significant associations due to the small number of cases. Since we investigated meat intake and multiple cancers, some of our findings may have been due to chance. Our study has several strengths as well; the high meat intake and the relatively large dietary variation in the Uruguayan population increased the power to detect significant associations. The large number of cancer sites available gave us the chance to investigate the relationship between meat intake and several cancers which have been minimally examined previously. Our finding of a doseresponse relationship between meat consumption and increased cancer risk and that more extreme exposure increases the risk further, suggest that our findings are real and that there is a biological gradient underlying the risk. Also, future investigations may want to pay attention to the categorisation of intakes and evaluate whether more extremes of dietary intake (both at the lower and higher end) leads to stronger results. The stronger results for some cancers (e.g. esophagus and stomach) observed in this population as compared to studies conducted in North America and Europe may reflect the higher meat intake in Uruguay than in other countries. For example, in the European EPIC-cohort, the mean red meat intake in the highest quartile and the lowest quartile was 84.6 and 34.3
g/d for men, and 52.9 and 22.6 g/d for women, respectively (Gonzalez et al, 2006). In the NIH-AARP Diet and Health Study the mean red meat intake in the highest and the lowest quintile was 67.0 and 12.0 g/1000 kcal/d for men and 54.7 and 7.8 g/1000 kcal/d for women, respectively, which amount to an absolute intake of approximately 135 and 24 g/day for men and 86 and 12 g/d for women in the highest and lowest quintiles, respectively (Cross et al, 2007). In contrast, the mean red meat intake in the highest and lowest tertile among controls was 295.5 g/d and 49.7 g/d in this study (assuming a 150 gram serving size), suggesting a 2-3 fold higher intake in this population than in these other studies. However, when assessed on a continuous scale the OR per serving per day is comparable with the results from several studies from European and North-American countries (Tavani et al, 2000; Norat et al, 2005; Gonzalez et al, 2006; Navarro Silvera et al, 2008), suggesting that the high ORs observed in the categorical analysis in this study may be explained by the high intake in this population. Our findings therefore underscore the importance of having a large dietary variation within the population so the contrasts between extreme categories are large enough to detect a difference in risk. In a previous study we found that a western dietary pattern with high loadings of red and processed meat was positively associated with a number of cancers (De Stefani et al, 2009), which is consistent with our present findings for meat. Collectively, these results suggest that meat intake may account for part of the association between the western dietary pattern and cancer risk, although other factors in the western dietary pattern also may be important.
V. Conclusion Our results confirm earlier findings of an increased risk of gastrointestinal cancers with high meat intake, but also suggest that meat consumption may increase the risk of several other cancers. While a prospective cohort study in this population could more definitely establish the causal nature of the observed associations by ruling out some potential biases inherent in the case-control study design, our findings provide further evidence for an unfavourable effect of meat intake upon cancer risk and suggest that meat intake increases the risk of multiple cancer sites. Reducing meat consumption might be an important modifiable risk factor for several types of cancer and may remove a relatively large proportion of the cancer burden in a population characterized by a high intake of meat such as this one.
References Alavanja MC, Field RW, Sinha R, Brus CP, Shavers VL, Fisher EL, Curtain J, Lynch CF (2001) Lung cancer risk and red meat consumption among Iowa women. Lung Cancer 34, 37-46. Augustsson K, Skog K, Jagerstad M, Dickman PW, Steineck G (1999) Dietary heterocyclic amines and cancer of the colon, rectum, bladder, and kidney: a population-based study. Lancet 353, 703-707.
184
Cancer Therapy Vol 7, page 185 Balder HF, Vogel J, Jansen MC, Weijenberg MP, van den Brandt PA, Westenbrink S, van der MR, Goldbohm RA (2006) Heme and chlorophyll intake and risk of colorectal cancer in the Netherlands cohort study. Cancer Epidemiol Biomarkers Prev 15, 717-725. Bandera EV, Kushi LH, Moore DF, Gifkins DM, McCullough ML (2007) Consumption of animal foods and endometrial cancer risk: a systematic literature review and meta-analysis. Cancer Causes Control 18, 967-988. Bessaoud F, Daures JP, Gerber M (2008) Dietary factors and breast cancer risk: a case control study among a population in Southern France. Nutr Cancer 60, 177-187. Bonner MR, McCann SE, Moysich KB (2002) Dietary factors and the risk of testicular cancer. Nutr Cancer 44, 35-43. Bosetti C, La Vecchia C, Talamini R, Negri E, Levi F, Dal Maso L, Franceschi S (2002) Food groups and laryngeal cancer risk: a case-control study from Italy and Switzerland. Int J Cancer 100, 355-360. Boyd NF, Stone J, Vogt KN, Connelly BS, Martin LJ, Minkin S (2003) Dietary fat and breast cancer risk revisited: a metaanalysis of the published literature. Br J Cancer 89, 16721685. Brown LM, Gridley G, Pottern LM, Baris D, Swanson CA, Silverman DT, Hayes RB, Greenberg RS, Swanson GM, Schoenberg JB, Schwartz AG, Fraumeni JF, Jr. (2001) Diet and nutrition as risk factors for multiple myeloma among blacks and whites in the United States. Cancer Causes Control 12, 117-125. Chiu BC, Cerhan JR, Folsom AR, Sellers TA, Kushi LH, Wallace RB, Zheng W, Potter JD (1996) Diet and risk of non-Hodgkin lymphoma in older women. JAMA 275, 13151321. Cho E, Chen WY, Hunter DJ, Stampfer MJ, Colditz GA, Hankinson SE, Willett WC (2006) Red meat intake and risk of breast cancer among premenopausal women. Arch Intern Med 166, 2253-2259. Chow WH, Gridley G, McLaughlin JK, Mandel JS, Wacholder S, Blot WJ, Niwa S, Fraumeni JF, Jr. (1994) Protein intake and risk of renal cell cancer. J Natl Cancer Inst 86, 11311139. Cross AJ, Leitzmann MF, Gail MH, Hollenbeck AR, Schatzkin A, Sinha R (2007) A Prospective Study of Red and Processed Meat Intake in Relation to Cancer Risk. PLoS Med 4, e325. Cross AJ, Pollock JR, Bingham SA (2003) Haem, not protein or inorganic iron, is responsible for endogenous intestinal Nnitrosation arising from red meat. Cancer Res 63, 23582360. Cross AJ, Sinha R (04) Meat-related mutagens/carcinogens in the etiology of colorectal cancer. Environ Mol Mutagen 44, 4455. Davies TW, Treasure FP, Welch AA, Day NE (2002) Diet and basal cell skin cancer: results from the EPIC-Norfolk cohort. Br J Dermatol 146, 1017-1022. De Stefani E, Deneo-Pellegrini H, Boffetta P, Ronco AL, Aune D, Acosta G, Mendilaharsu M, Brennan P, Ferro G (2009) Dietary patterns and risk of cancer: a factor analysis in Uruguay. Int J Cancer 124, 1391-1397. De Stefani E, Deneo-Pellegrini H, Mendilaharsu M, Ronco A (1999) Diet and risk of cancer of the upper aerodigestive tract--I. Foods. Oral Oncol 35, 17-21. De Stefani E, Fierro L, Barrios E, Ronco A (1998c) Tobacco, alcohol, diet and risk of non-Hodgkin's lymphoma: a casecontrol study in Uruguay. Leuk Res 22, 445-452. De Stefani E, Boffetta P, Mendilaharsu M, Carzoglio J, DeneoPellegrini H (1998a) Dietary nitrosamines, heterocyclic amines, and risk of gastric cancer: a case-control study in Uruguay. Nutr Cancer 30, 158-162.
De Stefani E, Brennan P, Ronco A, Fierro L, Correa P, Boffetta P, Deneo-Pellegrini H, Barrios E. (2002) Food groups and risk of lung cancer in Uruguay. Lung Cancer 38, 1-7. De Stefani E, Correa P, Fierro L, Carzoglio J, Deneo-Pellegrini H, Zavala D (1990) Alcohol drinking and tobacco smoking in gastric cancer. A case-control study. Rev Epidemiol Sante Publique 38, 297-307. De Stefani E, Deneo-Pellegrini H, Mendilaharsu M, and Ronco A. (1997a) Meat intake, heterocyclic amines and risk of colorectal cancer: a case-control study in Uruguay. Int.J Oncology 10, 573-80. De Stefani E, Fierro L, Mendilaharsu M, Ronco A, Larrinaga MT, Balbi JC, Alonso S, Deneo-Pellegrini H (1998b) Meat intake, 'mate' drinking and renal cell cancer in Uruguay: a case-control study. Br J Cancer 78, 1239-1243. De Stefani E, Oreggia F, Ronco A, Fierro L, Rivero S (1994) Salted meat consumption as a risk factor for cancer of the oral cavity and pharynx: a case-control study from Uruguay. Cancer Epidemiol Biomarkers Prev 3, 381-385. De Stefani E, Oreggia F, Rivero S, Ronco A, Fierro L (1995) Salted meat consumption and the risk of laryngeal cancer. Eur J Epidemiol 11, 177-180. De Stefani E, Ronco A, Mendilaharsu M, Guidobono M, DeneoPellegrini H (1997b) Meat intake, heterocyclic amines, and risk of breast cancer: a case-control study in Uruguay. Cancer Epidemiol Biomarkers Prev 6, 573-581. Deneo-Pellegrini H, De Stefani E, Ronco A, Mendilaharsu M, Carzoglio JC (1996) Meat consumption and risk of lung cancer; a case-control study from Uruguay. Lung Cancer 14, 195-205. Diwan BA, Kasprzak KS, Anderson LM (1997) Promotion of dimethylbenz[a]anthracene-initiated mammary carcinogenesis by iron in female Sprague-Dawley rats. Carcinogenesis 18, 1757-1762. Egeberg R, Olsen A, Autrup H, Christensen J, Stripp C, Tetens I, Overvad K, Tjonneland A (2008) Meat consumption, Nacetyl transferase 1 and 2 polymorphism and risk of breast cancer in Danish postmenopausal women. Eur J Cancer Prev 17, 39-47. Ferlay J, Bray F, Pisani P, Parkin DM (2004) GLOBOCAN 2002. Cancer Incidence, Mortality and Prevalence Worldwide. IARC Cancer Base No. 5 Version 2.0. Lyon, France: IARC-Press. Forman MR (2007) Changes in dietary fat and fiber and serum hormone concentrations: nutritional strategies for breast cancer prevention over the life course. J Nutr 137, 170S174S. Franceschi S, Favero A, Conti E, Talamini R, Volpe R, Negri E, Barzan L, La Vecchia C (1999) Food groups, oils and butter, and cancer of the oral cavity and pharynx. Br J Cancer 80, 614-620. Gann PH, Hennekens CH, Sacks FM, Grodstein F, Giovannucci EL, Stampfer MJ (1994) Prospective study of plasma fatty acids and risk of prostate cancer. J Natl Cancer Inst 86, 281-286. Ghosh C, Baker JA, Moysich KB, Rivera R, Brasure JR, McCann SE (2008) Dietary intakes of selected nutrients and food groups and risk of cervical cancer. Nutr Cancer 60, 331-341. Gonzalez CA, Jakszyn P, Pera G, Agudo A, Bingham S, Palli D, Ferrari P, Boeing H, del GG, Plebani M, Carneiro F, Nesi G, Berrino F, Sacerdote C, Tumino R, Panico S, Berglund G, Siman H, Nyren O, Hallmans G, Martinez C, Dorronsoro M, Barricarte A, Navarro C, Quiros JR, Allen N, Key TJ, Day NE, Linseisen J, Nagel G, Bergmann MM, Overvad K, Jensen MK, Tjonneland A, Olsen A, Bueno-de-Mesquita HB, Ocke M, Peeters PH, Numans ME, Clavel-Chapelon F, Boutron-Ruault MC, Trichopoulou A, Psaltopoulou T,
185
Aune et al: Meat consumption and cancer risk Roukos D, Lund E, Hemon B, Kaaks R, Norat T, Riboli E (2006) Meat intake and risk of stomach and esophageal adenocarcinoma within the European Prospective Investigation Into Cancer and Nutrition (EPIC). J Natl Cancer Inst 98, 345-354. Hosgood HD, III, Baris D, Zahm SH, Zheng T, Cross AJ (2007) Diet and risk of multiple myeloma in Connecticut women. Cancer Causes Control 18, 1065-1076. Hsu CC, Chow WH, Boffetta P, Moore L, Zaridze D, Moukeria A, Janout V, Kollarova H, Bencko V, Navratilova M, Szeszenia-Dabrowska N, Mates D, Brennan P (2007) Dietary risk factors for kidney cancer in eastern and central europe. Am J Epidemiol 166, 62-70. Hu J, La Vecchia C, Desmeules M, Negri E, Mery L, Group CC (2008) Meat and fish consumption and cancer in Canada. Nutr Cancer 60, 313-324. Huncharek M, Kupelnick B, Wheeler L (2003) Dietary cured meat and the risk of adult glioma: a meta-analysis of nine observational studies. J Environ Pathol Toxicol Oncol 22, 129-137. Kabat GC, Miller AB, Jain M, Rohan TE (2007) Dietary iron and heme iron intake and risk of breast cancer: a prospective cohort study. Cancer Epidemiol Biomarkers Prev 16, 1306-1308. Kiani F, Knutsen S, Singh P, Ursin G, Fraser G (2006) Dietary risk factors for ovarian cancer: the Adventist Health Study (United States). Cancer Causes Control 17, 137-146. Knekt P, Reunanen A, Takkunen H, Aromaa A, Heliovaara M, Hakulinen T (1994) Body iron stores and risk of cancer. Int J Cancer 56, 379-382. Kruk J (2007) Association of Lifestyle and Other Risk Factors with Breast Cancer According to Menopausal Status: A Case-Control Study in the Region of WesternPomerania (Poland). Asian Pac J Cancer Prev 8, 513-524. Larsson SC, Adami HO, Giovannucci E, Wolk A (2005) Re: Heme iron, zinc, alcohol consumption, and risk of colon cancer. J Natl Cancer Inst 97, 232-233. Larsson SC, Hakanson N, Permert J, Wolk A (2006a) Meat, fish, poultry and egg consumption in relation to risk of pancreatic cancer: a prospective study. Int J Cancer 118, 2866-2870. Larsson SC, Orsini N, Wolk A (2006b) Processed meat consumption and stomach cancer risk: a meta-analysis. J Natl Cancer Inst 98, 1078-1087. Larsson SC, Wolk A (2006) Meat consumption and risk of colorectal cancer: a meta-analysis of prospective studies. Int J Cancer 119, 2657-2664. Le Marchand L, Kolonel LN, Wilkens LR, Myers BC, Hirohata T (1994) Animal fat consumption and prostate cancer: a prospective study in Hawaii. Epidemiology 5, 276-282. Levi F, Pasche C, La Vecchia C, Lucchini F, Franceschi S, Monnier P (1998) Food groups and risk of oral and pharyngeal cancer. Int J Cancer 77, 705-709. Levi F, Pasche C, Lucchini F, Bosetti C, La Vecchia C (2004) Processed meat and the risk of selected digestive tract and laryngeal neoplasms in Switzerland. Ann Oncol 15, 346349. Lijinsky W (1987) Carcinogenicity and mutagenicity of Nnitroso compounds. Mol Toxicol 1, 107-119. Lumbreras B, Garte S, Overvad K, Tjonneland A, ClavelChapelon F, Linseisen JP, Boeing H, Trichopoulou A, Palli D, Peluso M, Krogh V, Tumino R, Panico S, Bueno-deMesquita HB, Peeters PH, Lund E, Martinez C, Dorronsoro M, Barricarte A, Chirlaque MD, Quiros JR, Berglund G, Hallmans G, Day NE, Key TJ, Saracci R, Kaaks R, Malaveille C, Ferrari P, Boffetta P, Norat T, Riboli E, Gonzalez CA, Vineis P (2008) Meat intake and bladder cancer in a prospective study: a role for heterocyclic aromatic amines? Cancer Causes Control 19, 649-656.
Lunn JC, Kuhnle G, Mai V, Frankenfeld C, Shuker DE, Glen RC, Goodman JM, Pollock JR, Bingham SA (2007) The effect of haem in red and processed meat on the endogenous formation of N-nitroso compounds in the upper gastrointestinal tract. Carcinogenesis 28, 685-690. Maclure M, Willett W (1990) A case-control study of diet and risk of renal adenocarcinoma. Epidemiology 1, 430-440. Michaud DS, Augustsson K, Rimm EB, Stampfer MJ, Willet WC, Giovannucci E (2001) A prospective study on intake of animal products and risk of prostate cancer. Cancer Causes Control 12, 557-567. Michaud DS, Giovannucci E, Willett WC, Colditz GA, Fuchs CS (2003) Dietary meat, dairy products, fat, and cholesterol and pancreatic cancer risk in a prospective study. Am J Epidemiol 157, 1115-1125. Mills PK, Beeson WL, Phillips RL, Fraser GE (1991) Bladder cancer in a low risk population: results from the Adventist Health Study. Am J Epidemiol 133, 230-239. Missmer SA, Smith-Warner SA, Spiegelman D, Yaun SS, Adami HO, Beeson WL, van den Brandt PA, Fraser GE, Freudenheim JL, Goldbohm RA, Graham S, Kushi LH, Miller AB, Potter JD, Rohan TE, Speizer FE, Toniolo P, Willett WC, Wolk A, Zeleniuch-Jacquotte A, Hunter DJ (2002) Meat and dairy food consumption and breast cancer: a pooled analysis of cohort studies. Int J Epidemiol 31, 78-85. Nagengast FM, Grubben MJ, van Munster I (1995) Role of bile acids in colorectal carcinogenesis. Eur J Cancer 31A, 10671070. Navarro Silvera SA, Mayne ST, Risch H, Gammon MD, Vaughan TL, Chow WH, Dubrow R, Schoenberg JB, Stanford JL, West AB, Rotterdam H, Blot WJ, Fraumeni JF, Jr. (2008) Food group intake and risk of subtypes of esophageal and gastric cancer. Int J Cancer 123, 852-860. Nilsson M, Johnsen R, Ye W, Hveem K, Lagergren J (2004) Lifestyle related risk factors in the aetiology of gastrooesophageal reflux. Gut 53, 1730-1735. Norat T, Bingham S, Ferrari P, Slimani N, Jenab M, Mazuir M, Overvad K, Olsen A, Tjonneland A, Clavel F, BoutronRuault MC, Kesse E, Boeing H, Bergmann MM, Nieters A, Linseisen J, Trichopoulou A, Trichopoulos D, Tountas Y, Berrino F, Palli D, Panico S, Tumino R, Vineis P, Bueno-deMesquita HB, Peeters PH, Engeset D, Lund E, Skeie G, Ardanaz E, Gonzalez C, Navarro C, Quiros JR, Sanchez MJ, Berglund G, Mattisson I, Hallmans G, Palmqvist R, Day NE, Khaw KT, Key TJ, San JM, Hemon B, Saracci R, Kaaks R, Riboli E (2005) Meat, fish, and colorectal cancer risk: the European Prospective Investigation into cancer and nutrition. J Natl Cancer Inst 97, 906-916. Norat T, Lukanova A, Ferrari P, Riboli E (2002) Meat consumption and colorectal cancer risk: dose-response metaanalysis of epidemiological studies. Int J Cancer 98, 241256. Nothlings U, Wilkens LR, Murphy SP, Hankin JH, Henderson BE, Kolonel LN (2005) Meat and fat intake as risk factors for pancreatic cancer: the multiethnic cohort study. J Natl Cancer Inst 97, 1458-1465. Ohgaki H, Kusama K, Matsukura N, Morino K, Hasegawa H, Sato S, Takayama S, Sugimura T (1984) Carcinogenicity in mice of a mutagenic compound, 2-amino-3methylimidazo[4,5-f]quinoline, from broiled sardine, cooked beef and beef extract. Carcinogenesis 5, 921-924. Oreggia F, De Stefani E, Boffetta P, Brennan P, Deneo-Pellegrini H, Ronco AL (2001) Meat, fat and risk of laryngeal cancer: a case-control study in Uruguay. Oral Oncol 37, 141-145. Park SY, Murphy SP, Wilkens LR, Henderson BE, Kolonel LN (2007) Fat and meat intake and prostate cancer risk: The multiethnic cohort study. Int J Cancer 121, 1339-1345.
186
Cancer Therapy Vol 7, page 187 Petridou E, Ntouvelis E, Dessypris N, Terzidis A, Trichopoulos D (2005) Maternal diet and acute lymphoblastic leukemia in young children. Cancer Epidemiol Biomarkers Prev 14: 1935-1939. Pierre F, Peiro G, Tache S, Cross AJ, Bingham SA, Gasc N, Gottardi G, Corpet DE, Gueraud F (2006) New marker of colon cancer risk associated with heme intake: 1,4dihydroxynonane mercapturic acid. Cancer Epidemiol Biomarkers Prev 15, 2274-2279. Polesel J, Talamini R, Montella M, Maso LD, Crovatto M, Parpinel M, Izzo F, Tommasi LG, Serraino D, La Vecchia C, Franceschi S (2007) Nutrients intake and the risk of hepatocellular carcinoma in Italy. Eur J Cancer 43, 23812387. Ross JA, Kasum CM, Davies SM, Jacobs DR, Folsom AR, Potter JD (2002) Diet and risk of leukemia in the Iowa Women's Health Study. Cancer Epidemiol Biomarkers Prev 11, 777781. Sapkota A, Hsu CC, Zaridze D, Shangina O, SzeszeniaDabrowska N, Mates D, Fabianova E, Rudnai P, Janout V, Holcatova I, Brennan P, Boffetta P, Hashibe M (2008) Dietary risk factors for squamous cell carcinoma of the upper aerodigestive tract in central and eastern Europe. Cancer Causes Control 19, 1161-1170. Sarasua S, Savitz DA (1994) Cured and broiled meat consumption in relation to childhood cancer: Denver, Colorado (United States). Cancer Causes Control 5, 141148. Schulz M, Lahmann PH, Riboli E, Boeing H (2004) Dietary determinants of epithelial ovarian cancer: a review of the epidemiologic literature. Nutr Cancer 50, 120-140. Schulz M, Nothlings U, Allen N, Onland-Moret NC, Agnoli C, Engeset D, Galasso R, Wirfalt E, Tjonneland A, Olsen A, Overvad K, Boutron-Ruault MC, Chajes V, Clavel-Chapelon F, Ray J, Hoffmann K, Chang-Claude J, Kaaks R, Trichopoulos D, Georgila C, Zourna P, Palli D, Berrino F, Tumino R, Vineis P, Panico S, Bueno-de-Mesquita HB, Ocke MC, Peeters PH, Lund E, Gram IT, Skeie G, Berglund G, Lundin E, Hallmans G, Gonzalez CA, Quiros JR, Dorronsoro M, Martinez C, Tormo MJ, Barricarte A, Bingham S, Khaw KT, Key TJ, Jenab M, Rinaldi S, Slimani N, Riboli E (2007) No association of consumption of animal foods with risk of ovarian cancer. Cancer Epidemiol Biomarkers Prev 16, 852-855. Sigurdson AJ, Chang S, Annegers JF, Duphorne CM, Pillow PC, Amato RJ, Hutchinson LP, Sweeney AM, Strom SS (1999) A case-control study of diet and testicular carcinoma. Nutr Cancer 34, 20-26.
Singh PN, Fraser GE (1998) Dietary risk factors for colon cancer in a low-risk population. Am J Epidemiol 148, 761-774. Snyderwine EG (2002) Mammary gland carcinogenesis by foodderived heterocyclic amines: metabolism and additional factors influencing carcinogenesis by 2-amino-1-methyl-6phenylimidazo[4,5-b]pyridine (PhIP). Environ Mol Mutagen 39, 165-170. Speedy AW (2003) Global production and consumption of animal source foods. J Nutr 133, 4048S-4053S. Steineck G, Norell SE, Feychting M (1988) Diet, tobacco and urothelial cancer. A 14-year follow-up of 16,477 subjects. Acta Oncol 27, 323-327. Stolzenberg-Solomon RZ, Pietinen P, Taylor PR, Virtamo J, Albanes D (2002) Prospective study of diet and pancreatic cancer in male smokers. Am J Epidemiol 155, 783-792. Talamini R, Polesel J, Montella M, Dal Maso L, Crovatto M, Crispo A, Spina M, Canzonieri V, La Vecchia C, Franceschi S (2006) Food groups and risk of non-Hodgkin lymphoma: a multicenter, case-control study in Italy. Int J Cancer 118, 2871-2876. Tavani A, La Vecchia C, Gallus S, Lagiou P, Trichopoulos D, Levi F, Negri E (2000) Red meat intake and cancer risk: a study in Italy. Int J Cancer 86, 425-428. Tavani A, Pregnolato A, Negri E, Franceschi S, Serraino D, Carbone A, La Vecchia C (1997) Diet and risk of lymphoid neoplasms and soft tissue sarcomas. Nutr Cancer 27, 256260. Taylor EF, Burley VJ, Greenwood DC, Cade JE (2007) Meat consumption and risk of breast cancer in the UK Women's Cohort Study. Br J Cancer 96, 1139-1146. Veierod MB, Thelle DS, Laake P (1997) Diet and risk of cutaneous malignant melanoma: a prospective study of 50,757 Norwegian men and women. Int J Cancer 71, 600604. World Cancer Research Fund/American Institute for Cancer Research. (2007) Food, Nutrition, Physical Activity and the Prevention of Cancer: a Global Perspective. Washington DC: AICR. Yano T, Obata Y, Ishikawa G, Ichikawa T (1994) Enhancing effect of high dietary iron on lung tumorigenesis in mice. Cancer Lett 76, 57-62. Zhang S, Hunter DJ, Rosner BA, Colditz GA, Fuchs CS, Speizer FE, Willett WC (1999) Dietary fat and protein in relation to risk of non-Hodgkin's lymphoma among women. J Natl Cancer Inst 91, 1751-1758. Zheng W, Blot WJ, Shu XO, Diamond EL, Gao YT, Ji BT, Fraumeni JF, Jr. (1992) Risk factors for oral and pharyngeal cancer in Shanghai, with emphasis on diet. Cancer Epidemiol Biomarkers Prev 1, 441-448.
187
Blesa et al: Update on melanoma treatment Cancer Therapy Vol 7, 188-199, 2009
Treatment options for metastatic melanoma. A systematic review Review Article
Joan Manel Gasent Blesa1,*, Enrique Grande Pulido2, Mariano Provencio Pulla3, Vicente Alberola Candel4 Medical Oncology Service, Hospital Marina Alta de Dénia, Alacant, Spain Pfizer Medical Oncology Department, Madrid, Spain 3 Medical Oncology Service, Hospital Arnau de Vilanova, València, Spain 4 Medical Oncology Service, Hospital Puerta de Hierro, Madrid, Spain 1 2
__________________________________________________________________________________ *Correspondence: Joan Manel Gasent Blesa MD Ph.D., Hospital de Dènia Marina Salud, Partida de Beniadlà, s/n. Denia. 03700, Alacant, Spain; Tel: +34 606311233; e-mail: joanmagasent@telefonica.net Key words: angiogenesis, DTIC, immunotherapy, melanoma, treatment Abbreviations: Adoptive Cell Transfer, (ACT); cisplatin, DTIC, and carmustine, (CBD); cisplatin, DTIC, carmustine, and tamoxifen, (CBDT); dacarbacin, (DTIC); Eastern Cooperative Oncology Group, (ECOG); European Organization for Research and Treatment of Cancer, (EORTC); Food and Drug Administration, (FDA); interferon !, (IFN-!); interleukin-2, (IL-2); temozolomide, (TMZ); totalbody irradiation, (TBI); umor-infiltrating lymphocytes, (TILs) Received: 12 January 2009; Revised: 9 March 2009 Accepted: 13 March 2009; electronically published: April 2009
Summary Metastatic melanoma is considered to be one of the most resistant tumors to standard chemotherapy approaches nowadays. Old anti-cancer treatments like dacarbacin (DTIC) or interleukin-2 (IL-2) continue to be the only approved treatments by the main worldwide health authorities. Up to now, no combination or new anti-targeted agent has shown an improvement in overall survival when compared to either of these two drugs alone. In fact, more than a dozen phase III randomized trials have tried to go beyond these old approaches, without meeting any success. Despite the fact that the median overall survival of patients diagnosed with metastatic melanoma is lower than 9 months, melanoma emerges as a challenging disease for testing new drugs and implementing the deeper knowledge in the molecular biology underlying this tumor. New immunotherapeutic targets have appeared recently trying to modulate the host immune response against the tumor. Furthermore, in the last three years, new targeted agents have changed the standard of care of other solid tumor types like renal cancer. We wonder if these new agents will be incorporated in the standard management of advanced melanoma patients in the coming years.
I. Introduction
II. Single agent therapy A. Dacarbazine and Temozolomide
Metastatic melanoma is highly resistant to chemotherapy, radiation therapy, hormonal therapy and current immunotherapeutic approaches. There are several promising phase II studies suggesting long-term benefits with immunotherapeutic approaches like IL-2, ipilimumab or tremelimumab; however, no large-scale phase III randomized trial has demonstrated any superiority versus chemotherapy alone as of yet. In this article we will review the current data regarding the agents most used either as monotherapy or in combination, as well as the promising data derived from the new targeted therapies and new immunotherapeutic agents under clinical development.
Single-agent chemotherapy produces objective response rates of less than 20%. However, a small subset of patients, mainly those with metastases to the lungs, good performance status and normal blood lactate dehydrogenase (LDH) enzyme levels, can achieve longterm disease control with a good quality of life, and some of them may even achieve a complete remission, with potential to cure (Coates and Segelov, 1994). Dacarbazine (DTIC) induces response rates ranging from 15% to 25% in single-institution trials with median response durations of 5 to 6 months, but less than 5% of these responses are complete in historical series (Balch et al, 1997).
188
Cancer Therapy Vol 7, page 189 with resistance to agents that produce O6 methylation (DTIC, TMZ, and nitrosoureas). Administration of TMZ results in decreased ATase activity within 4 hours of an oral dose that persists in peripheral blood mononuclear cells for at least 24 hours (Newlands et al, 1992). Daily administration resulted in the progressive depletion of ATase activity over the 5 days of treatment. Thus, on each day of treatment, there is increased sensitivity to the cytotoxic effects of TMZ resulting from the decrease in ATase activity induced by the prior day's chemotherapy. Currently, there is an ongoing trial conducted by the European Organization for Research and Treatment of Cancer (EORTC) comparing DTIC with prolonged daily administration of TMZ. The extended dose of TMZ (75 mg/m2 per day) administered for 6 weeks followed by a 2week rest is well tolerated and may be used in patients who have a borderline performance status. Other agents that lower ATase are Lomeguatrib (Patrin, PM), which is an orally bioavailable, highly potent O6-MeG analog and poly (ADP-ribose) polymerase inhibitor that is well tolerated as a singe agent (Plummer et al, 2006; Tawbi et al, 2006) (Table 1).
Long-term follow-up of patients treated with DTIC alone shows that less than 2% can be expected to survive for 6 years. In modern designed Phase III trials that used strict response assessment criteria, the response rates with DTIC did not exceed 12% (Falkson et al, 1998; Middleton et al, 2000; Avril et al, 2004). It has been demonstrated that single doses of DTIC (850-1000 mg/m2) are well tolerated, and should be the reference standard for randomized trials comparing new therapies with DTIC (Eggermont and Kirkwood, 2004). DTIC remains the only cytotoxic drug approved by the U.S. Food and Drug Administration (FDA) for the treatment of metastatic melanoma. Despite its low singleagent activity, it has remained the basis for many combination chemotherapy regimens. A DTIC related agent is temozolomide (TMZ), an oral formulation prodrug of DTIC with demonstrated improved brain penetration. Based on this, TMZ may represent a viable alternative to DTIC, which is ineffective against CNS metastases (Bafaloukos, 2002). Single-agent activity of TMZ in metastatic melanoma has been detected in Phase I/II studies (Newlands et al, 1992). In a randomized trial conducted on 305 patients with advanced melanoma, TMZ showed equivalence to DTIC in terms of objective response rate, time to progression, disease-free survival and overall survival (Avril et al, 2004). The median survival was 7.7 months for patients who received TMZ and 6.4 months for patients who received DTIC. The median progression-free survival was 1.9 months in the TMZ-treated group and 1.5 months in the DTIC-treated group. Overall, TMZ had a good tolerance, and appeared to have advantages in terms of improved quality of life. This trial excluded patients who had brain metastases. The FDA did not accept the results of this trial for approving a melanoma indication for TMZ, because the trial design was intended to demonstrate the superiority of TMZ over DTIC, not its equivalence. It has been suggested that the administration of TMZ in multiple doses per day or as a prolonged daily administration may overcome some chemotherapy drugresistance mechanisms. The rationale for the use of these doses of TMZ is based on an evaluation of recent data on the drugâ&#x20AC;&#x2122;s mechanism of action. Five-(3-methyltriazen-1y) imidazole-4-carboximide, which is the active metabolite of DTIC and the end product of spontaneous metabolism of TMZ, methylates guanine residues in DNA at the O6 position (Newlands et al, 1992). Increased levels of O6alkylguanine-DNA alkyltransferase (ATase) are associated
B. Nitrosoureas Nitrosoureas induce objective responses ranging from 13% to 18% of patients. It is supposed that these drugs cross the blood-brain barrier. However, when given at conventional doses, little or no activity was observed against melanoma brain metastases (Boaziz 1991). Furthermore, nitrosoureas induce prolonged myelosuppression. Despite this, they have frequently been included in multiagent chemotherapy regimens, presumably because of their ability to penetrate into the CNS. Fotemustine is probably the most active nitrosourea in metastatic melanoma. It has been tested in 5 Phase II trials on 351 patients with response rates of 20 to 25% and complete response rates of 5 to 8% (Jacquillat et al, 1990; Calabresi et al, 1991; Kleeberg et al, 1995). Fotemustine was the first drug to show significant efficacy in brain metastases. In the first published phase II trial, one hundred sixty-nine patients with histologic evidence of disseminated malignant melanoma, including patients with cerebral metastases, were treated with a regimen based on 100 mg/m2 1 hour IV infusion every week for 3 consecutive weeks, followed by a 4 to 5 week rest period (induction therapy) of fotemustine. One hundred fiftythree patients were evaluable for response.
Table 1. Randomized studies comparing dacarbazine monotherapy with combinaton chemotherapy.
Reference Cocconi Falkson Buzaid Falkson Chapman
Year 1992 1991 1993 1998 1999
Response Rate % n of pat. combinat. 117 28 64 53 150 19 280 21 240 18.5
189
PFS monother combinat 20 14 15 2.6 10.2 20
SURV (mo) monother 48 VS 29 2.6
8.9 7 48 VS 29
Blesa et al: Update on melanoma treatment Three complete responses and 34 partial responses were observed, leading to an objective response rate of 24.2% (95% confidence interval: 17.4% to 31.0%). Responses were also documented on cerebral (25.0%), visceral (19.2%), or nonvisceral (31.8%) metastatic sites. The median duration of response was 22 weeks (range, 7 to 80 weeks). The objective response rate in previously untreated patients was 30.7% (19 of 62 patients). The main toxicity was hematologic with delayed and reversible leukopenia and/or thrombopenia (Jacquillat et al, 1990).
agent DTIC (Constanzi et al, 1975, 1997; Vorobiof et al, 1986; Fletcher et al, 1988; Avril et al, 1990). After those disappointing results, trials with more aggressive, multiagent regimens were conducted. Phase II studies of 3- and 4-drug combinations generally produced response rates that ranged from 30% to 50% in singleinstitution studies. The 4-drug combination, named the Dartmouth regimen, based on cisplatin, DTIC, carmustine, and tamoxifen (CBDT), produced responses in 46% of 141 patients (16 complete responses and 49 partial responses). The median response duration was 7 months (Del Prete et al, 1984). The authors suggested that the inclusion of tamoxifen was essential, with only 10% of response rates for the 3 cytotoxic drugs in the same doses when tamoxifen was omitted (Lattanzi et al, 1995). A randomized Phase III trial conducted by the National Cancer Institute of Canada that compared CDBT with cisplatin, DTIC, and carmustine (CBD) produced a response rate of 30% for the CDBT arm compared with 21% for the CDB arm (P = .187). Six percent of the patients who received Tamoxifen achieved a complete response, compared with 3% of the patients who did not receive Tamoxifen, although this difference was not statistically significant (P = .33). In this study, more patients in the tamoxifen group achieved a partial remission (27% vs 14%). This difference was of borderline significance (P = .05). Gender did not seem to be a predictive factor of response. The response rate and the median survival for women in the tamoxifen group did not differ statistically compared with those for women in the chemotherapy-alone group. Similarly, there was no difference between men in the treatment groups. Progression-free survival and overall survival did not differ significantly between the 2 arms (P = .86 and P = .52) (Rusthoven et al, 1996). In another randomized Phase III trial, the CDBT combination was compared with single-agent DTIC. 240 patients were recruited for this trial. The response rate was 10.2% for the DTIC regimen compared with 18.5% for the CDBT regimen (P = .09). The median survival was 7 months, with no significant difference between the 2 treatment arms. Toxicity was substantially greater for the combination regimen than with DTIC (Chapman et al, 1999). The 3-drug combination CVD (cisplatin, vinblastine, and DIC) was developed by Legha and colleagues in 1989 at M. D. Anderson Cancer Center and induced responses in 40% of 50 evaluable patients in a phase II trial. Complete response rate was achieved in the 4% of the patients with a median duration of response of 9 months (Legha et al, 1989). Nevertheless, in a randomized trial comparing CVD with single-agent DTIC, the CVD arm produced a 19% response rate compared with 14% for the DTIC arm, and there were no differences in either response duration or survival (Buzaid et al, 1993). A very small phase II trial of carboplatin and paclitaxel as a first line therapy published in 2002 reported 20% partial response and 47% stable disease (Hodi et al, 2002), while a randomized phase II study of weekly paclitaxel versus carboplatin and paclitaxel as a second
C. Platins Cisplatin as a single-agent therapy has induced a 15% response rate with a median duration of 3 months (Kirkwood and Argwala, 1993). Doses up to 150 mg/m2 in combination with amifostine produced tumor responses in 53% of patients (Glover et al, 1987). Some of the responses were complete, and the median response duration was 4 months (Glover et al, 2003). A response rate of 19% was reported in 26 chemotherapy-na誰ve patients with metastatic melanoma who received carboplatin. In those patients, there were 5 partial responses, and thrombocytopenia was the doselimiting toxicity (Evans et al, 1987). In vitro studies have suggested that oxaliplatin can be more active than cisplatin or carboplatin in the treatment of melanoma, but oxaliplatin has yet to be tested extensively in patients with melanoma (Mohammed and Retsas, 2000). A small Phase II trial in 10 patients who had received and failed to prior chemotherapy did not show any objective responses (Lutzky et al, 2006).
D. Vinca alkaloids and taxanes Vinca alkaloids, particularly vindesine and vinblastine, have been studied, and responses were found in approximately 14% of patients (Quagligana et al, 1984). Taxanes have produced responses ranging from 16 to 17% of patients (Einzig et al, 1991; Aamdal et al, 1994; Bedikian et al, 1995). A potentially active new drug is ABI-007 (abraxane), which is an albumin-bound nanoparticle formulation of paclitaxel with an improved therapeutic index. It has been tested in a Phase II trial in 37 previously treated and chemotherapy-na誰ve patients with metastatic melanoma and showed an overall response rate of around 30%. ABI007 will be explored in a randomized Phase III trial (Hersh et al, 2006).
III. Combination chemotherapy Single-agent chemotherapy regimens have demonstrated only modest activity in the treatment of metastatic melanoma. Many combination regimens have been tested in clinical trials with a view to improving these results. Initially, 2-agent combinations were used. DTIC was combined with either a nitrosourea, a vinca alkaloid, or a platinum compound. In the majority of those trials, response rates ranging from 10 to 20% were observed, and there was low evidence to suggest superiority to single-
190
Cancer Therapy Vol 7, page 191 line therapy in 2003 produced an overall response rate of less than 10% in both arms (Zimpfer-Rechner et al, 2003). In this regard, (Rao et al, 2006) recently added a retrospective review of 31 pretreated patients to the carboplatin and paclitaxel literature documenting a 26% ORR. An Eastern Cooperative Oncology Group phase III trial of carboplatin and paclitaxel with and without sorafenib is ongoing.
2003). The overall objective response rate of 32% was higher than that achieved with TMZ alone. One patient presented deep vein thrombosis and no thrombotic events were reported in the second one. In a more recent trial, 26 patients with brain metastasis achieved an objective response rate of 11% in the brain lesions (Hwu et al, 2005). However, the combination of TMZ plus thalidomide should not be accepted as a standard therapy until and unless it demonstrates superiority in Phase III trials or at least until the high response rate can be confirmed in larger, multiinstitutional Phase II trials using strict response assessment criteria. In addition, it should be noted that, in a Phase II study of TMZ, thalidomide, and whole-brain radiation therapy in patients with brain metastases from melanoma that was conducted by the Cytokine Working Group in 40 patients, no patient exhibited a systemic response (Atkins et al, 2005).
IV. Combinations of chemotherapy with immunomodulatory or hormonal agents A. Tamoxifen and Interferon ! Combinations of cytotoxic drugs that have minimal efficacy with immunomodulatory or hormonal agents have been investigated. The results of adding tamoxifen to CDB chemotherapy were discussed above; however, tamoxifen also has been added to single-agent DTIC in several studies. Results from a small, randomized trial of DTIC with or without tamoxifen indicated that combination therapy may be more effective (Cocconi et al, 1992). A response rate of 28% and a median survival of 41 weeks were reported for patients who received DTIC plus tamoxifen compared with a response rate of only 12% and a median survival of 23 weeks for patients who received DTIC alone. Similar results were reported with the combination of DTIC plus interferon ! (IFN-!). In a small, randomized trial that compared DTIC with or without IFN-!2b, the combination therapy produced 12 complete responses and 4 partial responses in 30 patients compared with only 2 complete responses and 4 partial responses among 30 patients who received DTIC (Falkson et al, 1991). The median response and survival were prolonged significantly for the DTIC plus IFN-!2b arm in that trial. To further evaluate the potential benefits of combining DTIC with either tamoxifen or IFN-!, or both, the Eastern Cooperative Oncology Group (ECOG) conducted a 4-arm, 2 " 2, design, Phase III trial that failed to confirm the initial results (ECOG 3690) (Falkson et al, 1998) The overall response rate in that trial was 18%, and the median time to treatment failure was 2.6 months. The median survival was identical (9.1 months) for all 4 arms tested. In that trial, there was no advantage in terms of response or survival with the addition of IFN-!2b, tamoxifen, or both agents to DTIC. In a recent meta-analysis of 6 published, randomized trials involving a total of 912 patients who were randomized to receive either chemotherapy or biochemotherapy with or without tamoxifen, no improvements in the rates of overall response, complete response, or survival were demonstrated (Lens et al, 2003). The combination of TMZ plus thalidomide is one of the most promising of those reported thus far. Thalidomide is an antiangiogenic agent with immune modulatory properties. An ORR of 32% was reported in a phase II study in 38 patients (Hwu et al, 2003) without brain metastasis and a 15% ORR in 60 patients in a phase II trial including patients with brain metastasis (Danson et al,
B. Biochemotherapy In the last decade, several trials have evaluated the role of combination chemotherapy with other agents, such as IFN-! and IL-2. Many investigators have combined IL2 with both IFN-! and chemotherapy in an attempt to improve both the response rate and the percentage of durable complete remissions. A large body of data exists signifying that such biochemotherapy combinations can produce response rates ranging from 40% to 60%, with a complete response rate of approximately 10% (Flaherty et al, 1993; Atkins et al, 1994; Legha et al, 1998). Durable remissions exceeding 5 years were achieved by approximately 5% to 10% of patients. Recurrences beyond the 2-year time point were uncommon, thus suggesting that those patients who exhibited durable responses may have achieved a cure (Legha et al, 1998; O´Day et al, 1999). However, many of the most active biochemotherapy regimens are associated with moderate to severe toxicity, which has limited their broader use and acceptance. Many trials have been performed in an attempt to identify biochemotherapy regimens that may be administered in an outpatient setting, with less toxicity, and using lower doses of intravenous or subcutaneous IL-2 (Keilholzet al, 1998). Unfortunately, biochemotherapy regimens that involved low-dose, subcutaneous IL-2 administration appeared to produce lower response rates than were observed generally with regimens involving intravenous IL-2 (Keilholz et al, 1998). Two meta-analyses of patients with metastatic melanoma who were included in studies with various combinations of chemotherapy, biotherapy, or biochemotherapy demonstrated an improvement in response rates, but not in survival, with the use of biochemotherapy. In a report by Keilholz and colleagues (Keilholz et al, 1997) patients with metastatic melanoma who were treated with IL-2/IFN-!/chemotherapy, IL2/IFN- without chemotherapy, and IL-2/chemotherapy without IFN-!regimens, had response rates of 45%, 21%, and 15%, respectively. However, in this trial, survival did not differ significantly between the groups (10.5 months), with 20% and 10% survival rates at 2 years and 5 years, 191
Blesa et al: Update on melanoma treatment respectively, that did not differ among the groups. In a second meta-analysis of combined studies that involved 7711 patients with advanced melanoma from 168 published trials, treatment with an IL-2/IFN!/chemotherapy combination resulted in a significantly improved response rate compared with treatment that used chemotherapy or IL-2-based biotherapy (Keilholz et al, 2005). Different prospective, randomized studies in the United States and Europe evaluated aggressive biochemotherapeutic regimens that contained IL-2 and IFN-!. In a prospective European trial, 138 patients with metastatic melanoma were randomized to receive IFN and decreasing doses of IL-2 with or without cisplatin (Keilholz et al, 1998). The results demonstrated a significant increase in the response rate (from 18% to 33%) in the group that received biochemotherapy compared to the group that received biotherapy, and an increase in progression-free survival from 53 days to 92 days without any statistical differences in terms of survival. A second trial by the EORTC involving 363 patients evaluated cisplatin, DTIC, and IFN-! with or without IL-2 (Keiholz et al, 2005). No statistical improvement in response rate was shown with the addition of IL-2 (22.8% vs 20.8%, respectively) and in progression-free survival (median 3.0 months vs 3.9 months, respectively). The median survival was 9 months in both arms, and the 2-year survival rate was 12.9% and 17.6%, respectively (P = .32). Another study that was conducted by Rosenberg and his colleagues (Rosenberg et al, 1999) at the National Cancer Institute-Surgery Branch randomized 102 patients with stage IV melanoma to receive either chemotherapy (DTIC, cisplatin, and tamoxifen) or biochemotherapy (IL2, IFN-!, DTIC, cisplatin, and tamoxifen). Although the response rate in the biochemotherapy arm (44%) was almost twice that obtained in the chemotherapy arm (27%), the difference was not statistically significant (P = .07). Furthermore, there was a survival advantage in the chemotherapy arm compared with the biochemotherapy arm (median survival 5.8 months in the biochemotherapy arm vs. 10.7 months in the chemotherapy arm; P = .05). One of the reasons for this survival finding may be due to the administration of high-dose IL-2 as salvage therapy to
a significant proportion of the patients who failed to respond to chemotherapy alone. A large-scale Phase III trial that enrolled 482 patients and compared CVD chemotherapy with CVD plus intravenous IL-2 and subcutaneous IFN-!was the ECOG E3695. Important aspects of the E3695 protocol were that it was large enough to distinguish clinically meaningful differences in survival and durable responses, and that it involved a population with a relatively large percentage of patients who had prior IFN exposure in the adjuvant setting. There were no statistically significant differences between the chemotherapy and biochemotherapy arms in response rate, progression-free survival, or overall survival. It should be noted that there were many inevaluable patients, many patients were not treated according to the protocol, and more patients were randomized to the biochemotherapy arm (Atkins et al, 2003). Nonetheless, the conclusion from this and all randomized biochemotherapy trials performed to date was that biochemotherapy should not be used routinely outside of a clinical trial. The study conducted by Eton and colleagues in 2002 comparing CVD vs. CVD plus intravenous IL-2 and subcutaneous IFN-!in 183 evaluable patients was the only one that showed a statistically significant advantage of biochemotherapy over chemotherapy alone in terms of response rate (48% vs. 25%, respectively), complete response rate (7% vs. 2%, respectively), and median time to recurrence (4.9 months vs. 2.4 months). A modest but statistically significant increase in median overall survival (11.9 months vs. 9.2 months, respectively) was also observed (Eton et al, 2002). More recently the E3695 (Atkins et al, 2008) published its phase II trial comparing chemotherapy with CVD versus CVD concurrent with interleukin-2 and INF !-2b (BCT every 21 days, for a maximum of 4, in four hundred fifteen enrolled patients, with 395 patients assessable. The response rate was 19.5% for BCT and 13.8% for CVD, non significant. Median progression-free survival was significantly longer for BCT than for CVD (4.8 vs. 2.9 months (P = .015), although this did not translate into an advantage in either median overall survival (9.0 vs. 8.7 months) or the percentage of patients alive at 1 year (41% vs. 36.9%). The side effects were also more relevant in the biochemotherapy group (Table 2).
Table 2. Randomized studies comparing chemotherapy with bio chemotherapy.
Reference Kieholz Rosenberg Dorval Eton Ridolfi Atkins Ecog
Year 1997 1999 1999 2002 2002 2003 2008
Response Rate % n of pat. combinat. 138 33 102 44 101 24 183 48 176 25.3 482 16.6 395 19.5
PFS SURV (mo) monother combinat monother 18 92 53 9 27 10.7 VS 15.8 16 9.1 6.6 10.9 VS 10.4 25 4.9 2.4 11.9 VS 9.2 20.2 4 3 11 VS 9.5 11.9 5 3.1 8.4 VS 9.1 13.8 4.9 2.9 9 VS 9.1
192
Cancer Therapy Vol 7, page 193
C. Granulocyte-macrophage stimulating factor
colony-
However, in a Phase I/II study that combined carboplatin and paclitaxel with escalating doses of sorafenib in 35 patients, a promising response rate of 31% was observed, and another 54% of patients experienced stable disease that lasted more than 3 months (Flaherty et al, 2004). This study was recently updated to include 105 patients, and the current response rate is 27%. It is noteworthy that responses to sorafenib have not been correlated to date with BRAF mutation status (Amaravadi et al, 2006). Responses were observed in previously treated patients and in at least 1 patient with a noncutaneous primary melanoma. Two Phase III trials have been launched to assess the efficacy of carboplatin and paclitaxel plus sorafenib versus placebo in chemotherapy-naïve patients (E2603) and in previously treated patients. Relatively little is known about the inherent activity of carboplatin and paclitaxel as systemic therapy for patients with stage IV melanoma, particularly at the doses employed in the Phase II trial and, now, in the Phase III trial. In a report on previously treated patients, no responses were observed among 19 patients who received the 2-drug combination (Cocconi et al, 1992), whereas a second trial in chemotherapy-naïve patients resulted in 3 partial responders and 7 patients with stable disease among 15 evaluable patients (Rao et al, 2006). Thus, it is likely that the combination of carboplatin and paclitaxel, by itself, has inherent activity in metastatic melanoma. The results of the Phase III trials will define the real impact of adding sorafenib to this regimen in patients with metastatic melanoma. A randomized Phase II trial of 2 schedules of TMZ plus sorafenib is also underway, and the preliminary results have been considered encouraging (Amaravadi et al, 2006).
A phase I study to investigate the feasibility and safety of immunoembolization with granulocytemacrophage colony-stimulating factor (GM-CSF; sargramostim) for malignant liver tumors, predominantly hepatic metastases from patients with primary uveal melanoma, was published by the group of Sato (Sato et al, 2008). This group treated a total of thirty-nine patients with surgically unresectable malignant liver tumors, including 34 patients with primary uveal melanoma. Hepatic artery embolization accompanied an infusion of dose-escalated GM-CSF given every 4 weeks. The maximum tolerated dose was not reached up to the dose level of 2,000 µg, and there were no treatmentrelated deaths. Thirty-one assessable patients with uveal melanoma were included. Of these patients, two complete responses were observed, eight partial responses, and 10 stable diseases in their hepatic metastases. The median overall survival of intent-to-treat patients who had metastatic uveal melanoma was 14.4 months. The multivariate analyses indicated that female sex, high doses of GM-CSF (>/= 1,500 µg), and regression of hepatic metastases were correlated to longer overall survival. Moreover, high doses of GM-CSF were associated with prolonged progressionfree survival in extrahepatic sites.
V. Combinations of chemotherapy with targeted therapies The intrinsic resistance of melanoma to conventional chemotherapy has led investigators to evaluate new approaches such as protein kinase inhibitors (e.g. sorafenib), agents that act on cytotoxic T-lymphocyte antigen 4 (CTLA-4) or on apoptotic mechanisms (e.g. oblimersen sodium; previously referred to as G3139), and antiangiogenic agents (e.g. bevacizumab, axitinib, MEDI522, PI-88).
B. Imatinib mesylate Twenty-six patients were enrolled in a multicenter phase II trial of another oral kinase inhibitor, imatinib (Wyman et al, 2006). No objective clinical responses were noted among the 25 evaluable patients. The median time to progression was 54 days and the median overall survival was 200 days. No patient was free of disease progression at 6 months. The immunostaining of the tumors described three tumors with moderate and 5 tumors with weak staining for c-kit.
A. Sorafenib plus chemotherapy Sorafenib targets the adenosine triphosphate-binding site of the BRAF kinase and inhibits both wild-type and mutant BRAF in vitro. In addition, the spectrum of kinases inhibited by sorafenib includes CRAF, vascular endothelial growth factor receptor 2, platelet-derived growth factor receptor!, flt-3, and c-kit (Wilhelm et al, 2004). Preclinical studies demonstrated a significant retardation in the growth of human melanoma tumor xenografts with sorafenib (Karasarides et al, 2004). In a Phase I study, the maximum tolerated dose of sorafenib as a single agent was established at 400 mg twice daily, and the most common toxicities were gastrointestinal (mainly diarrhea), dermatologic (skin rash, hand-foot syndrome), and fatigue (Strumberg et al, 2005). In a Phase II trial involving 20 patients with refractory metastatic melanoma, sorafenib showed modest activity, with 1 partial response and 3 patients who achieved stable disease (Ahmad et al, 2004). In another Phase II, randomized, discontinuation trial, no objective responses were reported, and 19% of patients achieved stable disease (Eisen et al, 2006).
C. Anti-CTLA-4 chemotherapy
antibodies
and
Two human anti-CTLA-4 monoclonal antibodies have been tested in clinical trials: ipilimumab (formerly MDX-010) and tremelimumab (formerly CP-675,206). Responses have been observed with both antibodies administered as single-agent therapy in patients with metastatic melanoma (Tchekmedyian et al, 2002; Ribas et al, 2005), providing a rationale for combinations with chemotherapy. In a Phase II study, the activity of ipilimumab alone or in combination with DTIC was assessed. There were 2 partial responses in the antibody alone arm and 1 complete response and 4 partial responses in the antibody plus DTIC arm, suggesting more activity for the combination (Hersh et al, 2004). In the long term follow-up of this study, 1 additional complete response 193
Blesa et al: Update on melanoma treatment was observed in the combination arm, and durable clinical responses were noted (Fischkoff et al, 2005). These results are intriguing, but it remains unclear whether the activity of the combination is simply additive or truly synergistic, and further study is probably warranted in preclinical models. Auto-immune hypophysitis was recently reported to occur in 5% of patients treated with anti-CTLA-4 antibodies (Blansfield et al, 2005). Symptoms included extreme fatigue, headaches, memory loss, and loss of libido. In most cases diagnosis could be confirmed by enlargement of the pituitary on MRI. Patients treated emergently with high dose steroids appeared to have better recovery of pituitary function, although all patients continued to require some hormone replacement at the time of publication. The authors recommend that baseline hormone levels and MRI measurement of the pituitary be obtained prior to treatment, and that complaints of headache, fatigue, and visual changes be carefully evaluated. While auto immune side effects are dangerous, they are associated with clinical response, thereby suggesting that the immune system is effectively activated by anti-CTLA-4. Tremelimumab is a fully human IgG2 monoclonal antibody directed against the CTLA-4 receptor of the T cells. Tremelimumab owns an extremely long half life of 22 days that allows its intravenous administration every 3 months. In a phase I/II study conducted in 119 patients with pretreated advanced melanoma, tremelimumab showed an objective response rate of 7% but with a median overall survival of 11.5 months in those patients treated with the every three months dosing. The key element of this trial was the amazing duration of response, ranging from 11 to more than 36 months. Based on this promising activity, a prospective randomized phase III trial in na誰ve advanced melanoma patients was recently reported. A total of 655 patients were randomized to receive either tremelimumab or chemotherapy (DTIC or TMZ as single agent). Unfortunately, tremelimumab failed to demonstrate a better overall survival versus chemotherapy (11.7 vs. 10.7 months; p = .73). No differences in either response rate or progression-free survival were observed. The duration of responses was clearly longer for those patients treated with Tremelimumab (Ribas et al, 2005, 2008). An active search for both tumor and host biomarkers that could predict for response to these anti-CTLA4 agents is needed and the future role of these drugs is not yet established.
progression-free survival was also improved with the combination (74 days vs. 49 days; P = .0003). In an updated analysis, for the subgroup of patients with LDH values #2 times the institutional upper limit of normality, there was a statistically significant survival benefit for combination therapy (10.2 months vs. 8.7 months; P = .02) (Bedikian et al, 2006). These data support the idea that oblimersen has at least modest activity when combined with DTIC, justifying further studies of this compound and similar strategies to overcome drug resistance in melanoma (Eggermont, 2006).
VI. MEDI-522 MEDI-522 is a humanized monoclonal antibody directed against the !Vb3 is essential for endothelial cell proliferation, maturation, and survival; and, when it is blocked, proliferating endothelial cells undergo apoptosis and regress. In addition, !V!3 is highly expressed in melanomas and is associated with tumor growth (Mitjans et al, 2000). In preclinical studies using !Vb3 antagonists, inhibition of melanoma tumor growth independent of its antiangiogenic effects was reported (Jaissle et al, 2008). In the Phase II trial, 57 patients received MEDI-522 alone, and 55 patients received MEDI-522 plus DTIC. MEDI522 with or without DTIC was well tolerated and was active in patients with metastatic melanoma. The median survival was 12.6 months for the group that received MEDI-522 with DTIC and 9.4 months for the group that received MEDI-522 without DTIC (Hersey et al, 2005).
A. Bevacizumab Bevacizumab is a potent antibody against the vascular endothelial growth factor (VEGF). Recently, high effectiveness of bevacizumab in combination with paclitaxel was reported in a single metastatic melanoma case of a 68-year-old man with a vitreous melanoma metastasis of the left eye, treated with a revitrectomy combined with intravitreal bevacizumab application because of iris neovascularization and progressive epiretinal tumor plaques. The melanoma-associated neovascularization completely disappeared four days after the treatment, but it recurred after 6 weeks. Although repetitive administration of local bevacizumab produced the same antiangiogenetic effect, progression of the epiretinal tumor plaques could not be stopped with the local bevacizumab treatment (Jaissle et al, 2008).
B. Axitinib Axitinib is a new and potent oral multitargeted tyrosine kinase inhibitor against the vascular endothelial growth factor receptor-1 (VEGFR-1), VEGFR-2, VEGFR3, and PDGFR. Fruehauf et al. conducted a small phase II trial in 32 previously treated advanced melanoma patients. Six of 32 (19%) patients achieved an objective radiological response according to RECIST criteria in this highly pretreated subpopulation. One complete response was also confirmed. The median duration of response was 7.9 months (95% CI: 2.3-NA). The median progressionfree survival for the whole sample was 2.3 months. Axitinib was well tolerated, with fatigue and hypertension
D. Anti-BCL2 antisense oligonucleotide Oblimersen sodium, an anti-BCL2 antisense oligonucleotide, was originally tested in a Phase I/II trial in combination with DTIC that was followed by a randomized Phase III trial in 771 patients. The primary endpoint of the trial was overall survival, which was not statistically significantly different between the 2 arms (9.1 months for the combination arm vs. 7.9 months for DTIC alone arm), although overall and complete response rates were significantly better for the combination arm (overall response 11.7% vs. 6.8%, respectively; P = .019) and 194
Cancer Therapy Vol 7, page 195 being the most common toxicities found. Further investigation of this new targeted agent is warranted in advanced melanoma patients (Fruehauf et al, 2008).
appear to be mutually exclusive, suggesting that activation at one stage of the pathway is sufficient, with B-RAF mutations predicting in vitro sensitivity to MEK inhibitors. A better understanding of specific genetic lesions in melanoma should lead to improved targeted therapies. In this regard, a recent analysis of 126 melanomas published by Curtin and colleagues in 2005, categorized tumors into four groups based on clinical profiling, and found that these groups could be distinguished based on genetic profiling with 70% accuracy. Acral and mucosal abnormality had more frequent chromosomal abnormalities in this study, while BRAF mutations were found most commonly in melanomas developing on skin without sun damage. KIT, a tyrosine kinase receptor which inhibits the MAP kinase pathway, was recently found to be selectively activated on mucosal, acral, and sun-associated melanomas, but not in those melanomas growing on skin without sun damage (Curtin et al, 2006).
VII. Adoptive cell transfer Adoptive T cell transfer has previously shown efficacy in melanoma, with an ORR of 51% reported by Rosenberg and colleagues in a phase I study of 35 patients (Rosenberg et al, 2004). In order to circumvent the requirement that patients have preexisting antitumor T cells which can be expanded in vitro, Morgan and colleagues (Morgan et al, 2006) isolated peripheral blood mononuclear cells (PBMCs) from patients, cultured them with IL-2 and anti-CD3, and transduced them with a retroviral vector containing the gene for T cell receptor (TCR) a and b chains reactive against the melanoma antigen MART-1. Seventeen patients with refractory disease received fludarabine and cyclophosphamide as part of a lymphodepleting regimen, followed by transduced T cells, followed by IL-2. Transduced TCRs were shown to persist by PCR of DNA from PBMCs and two out of 17 patients had complete responses. This is the first published clinical study of treatment with TCRtransduced T cells, and it is hoped that it will lead to future therapeutic advances. The group led by Steven Rosenberg (Dudley et al, 2008) performed two additional sequential trials of Adoptive Cell Transfer (ACT) with autologous tumorinfiltrating lymphocytes (TILs) in patients with metastatic melanoma refractory to standard therapies. They used a host preparative lymphodepletion consisting of cyclophosphamide and fludarabine with either 2 (25 patients) or 12 Gy (25 patients) of total-body irradiation (TBI) administered before cell transfer. The nonmyeloablative chemotherapy alone showed a response rate of 49%. When 2 or 12 Gy of TBI were added, the response rates were 52% and 72% respectively. Responses were seen in all visceral sites including the brain. There was one treatment-related death in the 93 patients. Objective responses were correlated with the telomere length of the transferred cells.
IX. Conclusions When compared with standard chemotherapy based on DTIC, no other drug has shown benefits in terms of survival up to now. Adding more chemotherapeutic agents to DTIC or combining chemotherapy with classical immunotherapeutic drugs like IL-2 or interferon has failed to improve survival in this setting. It seems that the current chemo- and biotherapy armamentarium will not significantly provide a significant benefit in survival to our patients. However, a deeper knowledge not only of the molecular biology of the tumor but also of the immune system allows the design of new molecular targeted drugs directed against the tumor or inducing patient immunity against the melanoma. Melanoma remains a challenging disease and represents a niche to explore new targeted agents and immunotherapeutic approaches.
References Aamdal S, Wolff I, Kaplan S, Paridaens R, Kerger J, Schachter J, Wanders J, Franklin HR, Verweij J (1994) Docetaxel (Taxotere) in advanced malignant melanoma: a phase II study of the EORTC Early Clinical Trials Group. Eur J Cancer 30A(8), 1061-1064. Ahmad T, Marais R, Pyle L, James M, Schwartz B, Gore M, Eisen T (2004) BAY 43-9006 in patients with advanced melanoma: the Royal Marsden experience (Abst 7506). J Clin Oncol 22 No 14S (July 15 Supplement). Amaravadi R, Schucter LM, Kramer A, Barth SF, Villanueva J, Troxel AB, Tuveso DA, Nathanson KL, O'Dwyer PJ, Flaherty KT (2006) Preliminary results of a randomized Phase II study comparing two schedules of temozolomide in combination with sorafenib in patients with advanced melanoma (Abst 8009). J Clin Oncol 24 No 18S (June 20 Supplement). Atkins MB, Hsu J, Lee S, Cohen GI, Flaherty LE, Sosman JA, Sondak VK, Kirkwood JM; Eastern Cooperative Oncology Group (2008) Phase III trial comparing concurrent biochemotherapy with cisplatin, vinblastine, dacarbazine, interleukin-2, and interferon alfa-2b with cisplatin, vinblastine, and dacarbazine alone in patients with metastatic malignant melanoma (E3695): a trial coordinated by the
VIII. Potential new targets Available information regarding genetic lesions in melanomas is expanding. Two stereotypical tumor suppressor mutations in melanoma are p16 and PTEN. P16, or CDKN2a, is a locus on chromosome 9 encoding both INK4a) and ARF. PTEN, meanwhile, on chromosome 10, regulates phosphatidylinositol signaling, thereby modulating AKT and antiapoptotic factor bcl-2. Bcl-2 is overexpressed in melanoma. Other genes of more recent interest are MITF, a melanocyte differentiation factor which may function as an oncogene, and genes of the WNT signaling pathway including b-catenin. Of particular clinical relevance is the RAS-RAF-MEK-ERK signaling pathway. This pathway is constitutively activated in human tumors with somatic missense mutations in B-RAF reported in 66% of melanomas (Davies et al, 2002). A further 15% of melanomas have mutated N-Ras proteins. Intriguingly, these mutations
195
Blesa et al: Update on melanoma treatment Eastern Cooperative Oncology Group. J Clin Oncol 26, 5748-54. Atkins MB, Lee S, Flaherty LE, Sosman J. A, Sondak V K. Kirkwood JM (2003) A prospective randomized Phase III trial of concurrent biochemotherapy (BCT) with cisplatin, vinblastine, dacarbazine (CVD), IL-2 and interferon alpha-2b (IFN) versus CVD alone in patients with metastatic melanoma (E3695): An ECOG-coordinated intergroup trial (Abst 2847). Proc Am Soc Clin Oncol 22. Atkins MB, O'Boyle KR, Sosman JA, Weiss GR, Margolin KA, Ernest ML, Kappler K, Mier JW, Sparano JA, Fisher RI (1994) Multiinstitutional Phase II trial of intensive combination chemoimmunotherapy for metastatic melanoma. J Clin Oncol 12, 1553-1560. Atkins MB, Sosman J, Agarwala S, Logan T., Clark J, Ernstoff M, Lawson D, Dutcher J, Weiss G,. Urba W, Margoli K (2005) A Cytokine Working Group Phase II study of temozolomide (TMZ), thalidomide (THAL) and whole brain radiation therapy (WBRT) for patients with brain metastases from melanoma (Abst 7552). J Clin Oncol 23 No 16S (June 1 Supplement). Avril MF, Aamdal S, Grob JJ, Hauschild A, Mohr P, Bonerandi JJ, Weichenthal M, Neuber K, Bieber T, Gilde K, Guillem Porta V, Fra J, Bonneterre J, Saïag P, Kamanabrou D, Pehamberger H, Sufliarsky J, Gonzalez Larriba JL, Scherrer A, Menu Y (2004) Fotemustine compared with dacarbazine in patients with disseminated malignant melanoma: a Phase III study. J Clin Oncol 22, 1118-1125. Avril MF, Bonneterre J, Delaunay M, Grosshans E, Fumoleua P, Israel L, Bugat R, Namer M, Cupissol D, Kerbrat P (1990) Combination chemotherapy of dacarbazine and fotemustine in disseminated malignant melanoma. Experience of the French Study Group. Cancer Chemother Pharmacol 27, 81-84. Bafaloukos D, Aravantinos G, Fountzilas G, Stathopoulos G, Gogas H, Samonis G, Briasoulis E, Mylonakis N, Skarlos DV, Kosmidis P (2002) Docetaxel in combination with dacarbazine (DTIC) in patients with advanced melanoma. Oncology 63, 333-337. Balch CM, Reintgen DS, Kirkwood JM (1997) Cutaneous melanoma. In: DeVita VT Jr, Hellman S, Rosenber SA, eds. Cancer: Principles and Practice of Oncology. 5th ed. Philadelphia, Pa: Lippincott-Raven; pp. 1947-1994. Bedikian AY, Millward M, Pehamberger H, Conry R, Gore M, Trefzer U, Pavlick AC, DeConti R, Hersh EM, Hersey P, Kirkwood JM, Haluska FG; Oblimersen Melanoma Study Group (2006) Bcl-2 antisense (oblimersen sodium) plus dacarbazine in patients with advanced melanoma: the Oblimersen Melanoma Study Group. J Clin Oncol 24, 47384745. Bedikian AY, Weiss GR, Legha SS, Burris HA 3rd, Eckardt JR, Jenkins J, Eton O, Buzaid AC, Smetzer L, Von Hoff DD (1995) Phase II trial of docetaxel in patients with advanced cutaneous malignant melanoma previously untreated with chemotherapy. J Clin Oncol 13, 2859-2899. Blansfield JA, Beck KE, Tran K, Yang JC, Hughes MS, Kammula US, Royal RE, Topalian SL, Haworth LR, Levy C, Rosenberg SA, Sherry RM (2005) Cytotoxic T-lymphocyteassociated antigen-4 blockage can induce autoimmune hypophysitis in patients with metastatic melanoma and renal cancer. J Immunother 28, 593-598. Boaziz C, Breau JL, Morere JF, Israël R (1991) Brain metastases of malignant melanomas. Bull Cancer 78, 347-353. Buzaid AC, Legha S, Winn R, Belt R, Pollock T, Wiseman C, Ensign LG (1993) Cisplatin (C), Vinblastine (V), and Dacarbazine (D) (CVD) versus dacarbazine alone in metastatic melanoma: preliminary results of a Phase II
Cancer Community Oncology Program (CCOP) trial (Abst 389). Proc Am Soc Clin Oncol 12. Calabresi F, Aapro M, Becquart D, Dirix L, Wils J, Ardizzoni A, Gerard B (1991) Multicenter Phase II trial of the single fotemustine in patients with advanced malignant melanoma. Ann Oncol 2, 377-378. Chapman PB, Einhorn LH, Meyers ML, Saxman S, Destro AN, Panageas KS, Begg CB, Agarwala SS, Schuchter LM, Ernstoff MS, Houghton AN, Kirkwood JM (1999) Phase III multicenter randomized trial of Dartmouth regimen versus dacarbazine in patients with metastatic melanoma. J Clin Oncol 17, 2745-2751. Coates AS, Segelov E (1994) Long term response to chemotherapy in patients with visceral metastatic melanoma. Ann Oncol 5, 249-251. Cocconi G, Bella M, Calabresi F, Tonato M, Canaletti R, Boni C, Buzzi F, Ceci G, Corgna E, Costa P, (1992) Treatment of metastatic malignant melanoma with dacarbazine plus tamoxifen. N Engl J Med 327, 516-523. Costanza ME, Nathanson L, Schoenfeld D, Wolter J, Colsky J, Regelson W, Cunningham T, Sedransk N (1977) Results with methyl-CCNU and DTIC in metastatic melanoma. Cancer 40, 1010-1015. Costanzi JJ, Vaitkevicius VK, Quagliana JM, Hoogstraten B, Coltman CA Jr, Delaney FC (1975) Combination chemotherapy for disseminated malignant melanoma. Cancer 35, 342-346. Curtin JA, Busam K, Pinkel D, Bastian BC (2006) Somatic activation of KIT in distinct subtypes of melanoma. J Clin Oncol 24, 4340-4346. Curtin JA, Fridlyand J, Kageshita T, Patel HN, Busam KJ, Kutzner H, Cho KH, Aiba S, Bröcker EB, LeBoit PE, Pinkel D, Bastian BC (2005) Distinct sets of genetic alterations in melanoma. N Engl J Med 353, 2135-2147. Danson S, Lorigan P, Arance A, Clamp A, Ranson M, Hodgetts J, Lomax L, Ashcroft L, Thatcher N, Middleton MR (2003) Randomized phase II study of temozolomide given every 8 hours or daily with either interferon alfa-2b or thalidomide in metastatic malignant melanoma. J Clin Oncol 21, 25512557. Davies H, Bignell GR, Cox C, Stephens P, Edkins S, Clegg S, Teague J, Woffendin H, Garnett MJ, Bottomley W, Davis N, Dicks E, Ewing R, Floyd Y, Gray K, Hall S, Hawes R, Hughes J, Kosmidou V, Menzies A, Mould C, Parker A, Stevens C, Watt S, Hooper S, Wilson R, Jayatilake H, Gusterson BA, Cooper C, Shipley J, Hargrave D, PritchardJones K, Maitland N, Chenevix-Trench G, Riggins GJ, Bigner DD, Palmieri G, Cossu A, Flanagan A, Nicholson A, Ho JW, Leung SY, Yuen ST, Weber BL, Seigler HF, Darrow TL, Paterson H, Marais R, Marshall CJ, Wooster R, Stratton MR, Futreal PA. (2002) Mutations of the BRAF gene in human cancer. Nature 417, 949-954. Del Prete SA, Maurer LH, O'Donnell J (1984) Combination chemotherapy with cisplatin, carmustine, dacarbazine and tamoxifen in metastatic melanoma. Cancer Treat Rep 68, 1403-1405. Dudley ME, Yang JC, Sherry R, Hughes MS, Royal R, Kammula U, Robbins PF, Huang J, Citrin DE, Leitman SF, Wunderlich J, Restifo NP, Thomasian A, Downey SG, Smith FO, Klapper J, Morton K, Laurencot C, White DE, Rosenberg SA (2008) Adoptive cell therapy for patients with metastatic melanoma: evaluation of intensive myeloablative chemoradiation preparative regimens. J Clin Oncol 26, 5233-5339. Eggermont AM, Kirkwood JM (2004) Re-evaluating of the role of dacarbazine in metastatic melanoma: what have we learned in 30 years? Eur J Cancer 40, 1825-1836.
196
Cancer Therapy Vol 7, page 197 Eggermont AMM (2006) Reaching first base in the treatment of metastatic melanoma [editorial]. J Clin Oncol 24, 4673. Einzig AI, Hochster H, Wiernik PH, Trump DL, Dutcher JP, Garowski E, Sasloff J, Smith TJ (1991) A Phase II study of Taxol in patients with malignant melanoma. Invest New Drugs 9, 59-64. Eisen T, Ahmad T, Flaherty KT, Gore M, Kaye S, Marais R, Gibbens I, Hackett S, James M, Schuchter LM, Nathanson KL, Xia C, Simantov R, Schwartz B, Poulin-Costello M, O'Dwyer PJ, Ratain MJ (2006) Sorafenib in advanced melanoma: a Phase II randomised discontinuation trial analysis. Br J Cancer 95, 581-586. Eton O, Legha SS, Bedikian AY, Lee JJ, Buzaid AC, Hodges C, Ring SE, Papadopoulos NE, Plager C, East MJ, Zhan F, Benjamin RS (2002) Sequential biochemotherapy versus chemotherapy for metastatic melanoma: results from a Phase III randomized trial. J Clin Oncol 20, 2045-2052. Evans LM, Casper ES, Rosenbluth R (1987) Participating community oncology program investigators: Phase II trial of carboplatin in advanced malignant melanoma. Cancer Treat Rep 71, 171-172. Falkson CI, Falkson G, Falkson HC (1991) Improved results with the addition of interferon alfa-2b to dacarbazine in the treatment of patients with metastatic malignant melanoma. J Clin Oncol 9, 1403-1408. Falkson CI, Ibrahim J, Kirkwood JM, Coates AS, Atkins MB, Blum RH (1998) Phase III trial of dacarbazine versus dacarbazine with tamoxifen versus dacarbazine with interferon alfa-2b and tamoxifen in patients with metastatic malignant melanoma: an Eastern Cooperative Oncology Group study. J Clin Oncol 16, 1743-1751. Fischkoff SA, Hersh E, Weber J, Powderly J, Khan K, Pavlick A, Samlowski W, O'Day S, Nichol G, Yellin M (2005) Durable responses and long-term progression-free survival observed in a Phase II study of MDX-010 alone or in combination with dacarbazine (DTIC) in metastatic melanoma (Abst 7525). Proc Am Soc Clin Oncol 23, 716S. Flaherty KT, Brose M, Schucter L, D. Tuveson D, Lee R, Schwartz B, Lathia C, Weber B, O'Dwyer P (2004) Phase I/II trial of BAY 43-9006, carboplatin (C) and paclitaxel (P) demonstrates preliminary antitumor activity in the expansion cohort of patients with metastatic melanoma (Abst 7507). J Clin Oncol 22 No 14S (July 15 Supplement). Flaherty LE, Robinson W, Redman BG, Gonzalez R, Martino S, Kraut M, Valdivieso M, Rudolph AR. (1993) A Phase II study of dacarbazine and cisplatin in combination with outpatient administered interleukin-2 in metastatic malignant melanoma. Cancer 71, 3520-3525. Fletcher WS, Green S, Fletcher JR, Dana B, Jewell W, Townsend RA (1988) Evaluation of cis-platinum and DTIC combination chemotherapy in disseminated melanoma. A Southwest Oncology Group Study. Am J Clin Oncol 11, 589-593. Fruehauf JP, Lutzky J, McDermott CK, Brown CK, Pithavala YK, Bycot Wt, Shalinsky D, Liau KF, A. Niethammer A, O. Rixe O (2008) Axitinib (AG-013736) in patients with metastatic melanoma: a phase II study (Abstr 9006). J Clin Oncol 26 (May 20 Supplement). Glover D, Glick JH, Weiler C, Fox K, Guerry D (1987) WR2721 and high-dose cisplatin: an active combination in the treatment of metastatic melanoma. J Clin Oncol 5, 574-578. Glover D, Ibrahim J, Kirkwood J, Glick J, Karp D, Stewart J, Ewell M, Borden E; Eastern Cooperative Oncology Group (2003) Phase II randomized trial of cisplatin and WR-2721 versus cisplatin alone for metastatic melanoma: an Eastern Cooperative Oncology Group Study (E1686). Melanoma Res 13, 619-626.
Hersey P, Sosman J, O'Day S, J. Richards J, Bedikian A,. Gonzalez R, Sharfman W, R. Weber R, Logan T, Kirkwood JM (2005) A Phase II, randomized, open-label study evaluating the antitumor activity of MEDI-522, a humanized monoclonal antibody directed against the human metastatic melanoma (MM) (Abst 7507). J Clin Oncol 23 No 16S (June 1 Supplement). Hersh E, O'Day S, Gonzalez R, Ribas A, Samlowski W, Gordon M (2006) Phase II trial of ABI-007 (Abraxane) in previously treated and chemotherapy naive patients with metastatic melanoma (Abst ABS-0141). Melanoma Res 16, S78. Hersh EM, Weber JJ, Powderly J, Yellin M, Kahn K, Pavlick A, Samlowski W, Nichol G, O'Day S (2004) A Phase II, randomized multi-center study of MDX-010 alone or in combination with dacarbazine (DTIC) in stage IV metastatic malignant melanoma (Abst 7511). J Clin Oncol 22 No 14S (July 15 Supplement). Hodi FS, Soiffer RJ, Clark J, Finkelstein DM, Haluska FG (2002) Phase II study of paclitaxel and carboplatin for malignant melanoma. Am J Clin Oncol 25, 283-286. Hwu WJ, Krown SE, Menell JH, Panageas KS, Merrell J, Lamb LA, Williams LJ, Quinn CJ, Foster T, Chapman PB, Livingston PO, Wolchok JD, Houghton AN (2003) Phase II study of temozolomide plus thalidomide for the treatment of metastatic melanoma. J Clin Oncol 21, 3351-3356. Hwu WJ, Lis E, Menell JH, Panageas KS, Lamb LA, Merrell J, Williams LJ, Krown SE, Chapman PB, Livingston PO, Wolchok JD, Houghton AN (2005) Temozolomide plus thalidomide in patients with brain metastases from melanoma: a phase II study. Cancer 103, 2590-2597 Jacquillat C, Khayat D, Banzet P, Weil M, Fumoleau P, Avril MF, Namer M, Bonneterre J, Kerbrat P, Bonerandi JJ (1990) Final report of the French multicentric Phase II study of the nitrosurea fotemustine in 153 evaluable patients with disseminated malignant melanoma including patients with cerebral metastases. Cancer 66, 1873-1878. Jaissle GB, Ulmer A, Henke-Fahle S, Fierlbeck G, BartzSchmidt KU, Szurman P (2008) Suppression of melanomaassociated neoangiogenesis by bevacizumab. Arch Dermatol 144, 525-527. Karasarides M, Chiloeches A, Hayward R, Niculescu-Duvaz D, Scanlon I, Friedlos F, Ogilvie L, Hedley D, Martin J, Marshall CJ, Springer CJ, Marais R (2004) B-RAF is a therapeutic target in melanoma. Oncogene 23, 6292-6298. Keilholz U, Conradt C, Legha SS, Khayat D, Scheibenbogen C, Thatcher N, Goey SH, Gore M, Dorval T, Hancock B, Punt CJ, Dummer R, Avril MF, BrĂścker EB, Benhammouda A, Eggermont AM, Pritsch M (1998) Results of interleukin-2based treatment in advanced melanoma: a case record-based analysis of 631 patients. J Clin Oncol 16, 2921-2929. Keilholz U, Goey SH, Punt CJ, Proebstle TM, Salzmann R, Scheibenbogen C, Schadendorf D, LiĂŠnard D, Enk A, Dummer R, Hantich B, Geueke AM, Eggermont AM (1997) Interferon alfa-2a and interleukin-2 with or without cisplatin in metastatic melanoma: a randomized trial of the European Organization for Research and Treatment of Cancer Melanoma Cooperative Group. J Clin Oncol 15, 2579-2588. Keilholz U, Punt CJ, Gore M, Kruit W, Patel P, Lienard D, Thomas J, Proebstle TM, Schmittel A, Schadendorf D, Velu T, Negrier S, Kleeberg U, Lehman F, Suciu S, Eggermont AM (2005) Dacarbazine, cisplatin and interferon-alfa-2b with or without interleukin-2 in metastatic melanoma: a randomized Phase III trial (18951) of the European Organization for Research and Treatment of Cancer Melanoma Group. J Clin Oncol 23, 6747-6755. Kirkwood JM, Agarwala S (1993) Systemic cytotoxic and biologic therapy melanoma. In: DeVita VT, Hellman S,
197
Blesa et al: Update on melanoma treatment Rosenberg SA, eds. PPO Updates. Vol 7. Philadelphia, Pa: Lippincott; 1. Kleeberg UR, Engel E, Israels P, BrĂścker EB, Tilgen W, Kennes C, GĂŠrard B, Lejeune F, Glabbeke MV, Lentz MA (1995) Palliative therapy of melanoma patients with fotemustine. Inverse relationship between tumour load and treatment effectiveness. A multicenter Phase II trial of the EORTC Melanoma Cooperative Group (MCG). Melanoma Res 5, 195-200. Lattanzi SC, Tosteson T, Chertoff J, Maurer LH, O'Donnell J, LeMarbre PJ, Mott L, DelPrete SA, Forcier RJ, Ernstoff MS (1995) Dacarbazine, cisplatin and carmustine, with or without tamoxifen, for metastatic melanoma: 5-year followup. Melanoma Res 5, 365-369. Lee SM, Thatcher N, Margison GP (1991) O6-alkylguanineDNA alkyltrasferase depletion and regeneration in human peripheral lymphocytes following dacarbazine and fotemustine. Cancer Res 51, 619-623. Legha SS, Ring S, Eton O, Bedikian A, Buzaid AC, Plager C, Papadopoulos N (1998) Development of a biochemotherapy regimen with concurrent administration of cisplatin, vinblastine, dacarbazine, interferon alfa, and interleukin-2 for patients with metastatic melanoma. J Clin Oncol 16, 17521759. Legha SS, Ring S, Eton O, Bedikian A, Buzaid AC, Plager C, Papadopoulos N (1998) Development of a biochemotherapy regimen with concurrent administration of cisplatin, vinblastine, dacarbazine, interferon alfa, and interleukin-2 for patients with metastatic melanoma. J Clin Oncol 16, 17521759. Legha SS, Ring S, Papadopoulos N, Plager C, Chawla S, Benjamin R (1989) A prospective evaluation of a triple-drug regimen containing cisplatin, vinblastine and dacarbazine (CVD) for metastatic melanoma. Cancer 64, 2024-2029. Lens MB, Reiman T, Husain AF (2003) Use of tamoxifen in the treatment of malignant melanoma. Systematic review and metaanalysis of randomized controlled trial. Cancer 98, 1355-1361. Lutzky J, Nunez Y, Graham P (2006) A Phase II trial of oxaliplatin in patients with advanced melanoma (Abst 18016). J Clin Oncol 24 No 18S (June 20 Supplement). Middleton MR, Grob JJ, Aaronson N, Fierlbeck G, Tilgen W, Seiter S, Gore M, Aamdal S, Cebon J, Coates A, Dreno B, Henz M, Schadendorf D, Kapp A, Weiss J, Fraass U, Statkevich P, Muller M, Thatcher N (2000) Randomized Phase III study of temozolomide versus dacarbazine in the treatment of patients with advanced metastatic malignant melanoma. J Clin Oncol 18, 158-166. Miller AJ, Mihm MC Jr (2006) Melanoma. N Engl J Med 355, 51-65. Mitjans F, Meyer T, Fittschen C, Goodman S, Jonczyk A, Marshall JF, Reyes G, Piulats J (2000) In vivo therapy of malignant melanoma by means of antagonists of aV integrins. Int J Cancer 87, 716-723. Mohammed MQ, Retsas S (2000) Oxaliplatin is active in vitro against human melanoma cell lines: comparison with cisplatin and carboplatin. Anticancer Drugs 11, 859-863. Morgan RA, Dudley ME, Wunderlich JR, Hughes MS, Yang JC, Sherry RM, Royal RE, Topalian SL, Kammula US, Restifo NP, Zheng Z, Nahvi A, de Vries CR, Rogers-Freezer LJ, Mavroukakis SA, Rosenberg SA (2006) Cancer regression in patients after transfer of genetically engineered lymphocytes. Science 314, 126-129. Newlands ES, Blackledge GR, Slack JA, Rustin GJ, Smith DB, Stuart NS, Quarterman CP, Hoffman R, Stevens MF, Brampton MH (1992) Phase I trial of temozolomide (CCR 81045: M&B 39831: NSC 362856). Br J Cancer 65, 287291.
O'Day SJ, Gammon G, Boasberg PD, Martin MA, Kristedja TS, Guo M, Stern S, Edwards S, Fournier P, Weisberg M, Cannon M, Fawzy NW, Johnson TD, Essner R, Foshag LJ, Morton DL (1999) Advantages of concurrent biochemotherapy modified by decrescendo interleukin-2, granulocyte colony-stimulating factor and tamoxifen for patients with metastatic melanoma. J Clin Oncol 17, 27522761. Plummer R, Lorigan P, Evans J, Steven N, Middleton M, Wilson R, Snow K, Dewji R, Calvert H (2006) First and final report of a Phase II study of the poly-(ADP-ribosed) polymerase (PARR) inhibitor, AGO14699 in combination with temozolomide (TMZ) in patients with metastatic malignant melanoma (MM) (Abst 8013). J Clin Oncol 24 No 18S (June 20 Supplement). Quagliana JM, Stephens RL, Baker LH, Costanzi JJ (1984) Vindesine in patients with metastatic malignant melanoma. A Southwest Oncology Group study. J Clin Oncol 4, 316-319. Rao RD, Holtan SG, Ingle JN, Croghan GA, Kottschade LA, Creagan ET, Kaur JS, Pitot HC, Markovic SN (2006) Combination of paclitaxel and carboplatin as second-line therapy for patients with metastatic melanoma. Cancer 106, 375-382. Ribas A, Camacho LH, Lopez-Berestein G, Pavlov D, Bulanhagui CA, Millham R, Comin-Anduix B, Reuben JM, Seja E, Parker CA, Sharma A, Glaspy JA, Gomez-Navarro J (2005) Antitumor activity in melanoma and anti-self responses in a Phase I trial with the anti-cytotoxic T lymphocyte-associated antigen 4 monoclonal antibody CP675,206. J Clin Oncol 23, 8968-8977. Ribas A, Hauschild A, Kefford R, Punt J, Haanen JB, Marmol M, Garbe C, Gomez-Navarro J, Pavlov D, Marshall M (2008) Phase III, open label, randomized, comparative study of tremelimumab (CP-675,206) and chemotherapy (TMZ or DTIC) in patients with advanced melanoma (abstr LBA9011). J Clin Oncol 26 (May 20 Supplement). Rosenberg SA, Dudley ME (2004) Cancer regression in patients with metastatic melanoma after the transfer of autologous antitumor lymphocytes. Proc Natl Acad Sci U S A 101(Suppl 2), 14639-14645. Rosenberg SA, Yang JC, Schwartzentruber DJ, Hwu P, Marincola FM, Topalian SL, Seipp CA, Einhorn JH, White DE, Steinberg SM (1999) Prospective randomized trial of the treatment of patients with metastatic melanoma using chemotherapy with cisplatin, dacarbazine, and tamoxifen alone or in combination with interleukin-2 and interferon alfa-2b. J Clin Oncol 17, 968-975. Rusthoven JJ, Quirt IC, Iscoe NA, McCulloch PB, James KW, Lohmann RC, Jensen J, Burdette-Radoux S, Bodurtha AJ, Silver HK, Verma S, Armitage GR, Zee B, Bennett K (1996) Randomized, double-blind placebo-controlled trial comparing the response rates of carmustine, dacarbazine and cisplatin with and without tamoxifen in patients with metastatic melanoma. J Clin Oncol 14, 2083-2090. Sato T, Eschelman DJ, Gonsalves CF, Terai M, Chervoneva I, McCue PA, Shields JA, Shields CL, Yamamoto A, Berd D, Mastrangelo MJ, Sullivan KL (2008) Immunoembolization of malignant liver tumors, including uveal melanoma, using granulocyte-macrophage colony-stimulating factor. J Clin Oncol 26, 5436-4542. Solit DB, Garraway LA, Pratilas CA, Sawai A, Getz G, Basso A, Ye Q, Lobo JM, She Y, Osman I, Golub TR, Sebolt-Leopold J, Sellers WR, Rosen N (2006) BRAF mutation predicts sensitivity to MEK inhibition. Nature 439, 358-362. Strumberg D, Richly H, Hilger RA, Schleucher N, Korfee S, Tewes M, Faghih M, Brendel E, Voliotis D, Haase CG, Schwartz B, Awada A, Voigtmann R, Scheulen ME, Seeber S (2005) Phase I clinical and pharmacokinetic study of the
198
Cancer Therapy Vol 7, page 199 novel Raf kinase and vascular endothelial growth factor receptor inhibitor BAY 43-9006 in patients with advanced refractory solid tumors. J Clin Oncol 23, 965-972. Tawbi H, Tarhini A, Moschos S, Sulecki M, Viverette F, Radkowski R, Shipe-Spotloe J,. Kunkel C, Rae M, Kirkwood J (2006) Phase I trial of lomeguatrib (PN) combined with dacarbazine (DTIC) for treatment of patients with melanoma and other solid tumors: initial results (Abst 8016). J Clin Oncol 24 No 18S (June 20 Supplement). Tchekmedyian S, Glasby J, Korman A, Keler T, Deo Y, Davis TA (2002) MDX-010 (human anti-CTLA4): a Phase I trial in malignant melanoma (Abst 56). Proc Am Soc Clin Oncol 21. . Vorobiof DA, Sarli R, Falkson G (1986) Combination chemotherapy with dacarbazine and vindesine in the treatment of metastatic malignant melanoma. Cancer Treat Rep 70, 927-928. Wilhelm SM, Carter C, Tang L, Wilkie D, McNabola A, Rong H, Chen C, Zhang X, Vincent P, McHugh M, Cao Y, Shujath J, Gawlak S, Eveleigh D, Rowley B, Liu L, Adnane L, Lynch M, Auclair D, Taylor I, Gedrich R, Voznesensky A, Riedl B, Post LE, Bollag G, Trail PA (2004) BAY 43-9006 exhibits broad spectrum oral antitumor activity and targets the RAF/MEK/ERK pathway and receptor tyrosine kinases involved in tumor progression and angiogenesis. Cancer Res 64, 7099-7109. Wyman K, Atkins MB, Prieto V, Eton O, McDermott DF, Hubbard F, Byrnes C, Sanders K, Sosman JA (2006) Multicenter Phase II trial of high-dose imatinib mesylate in metastatic melanoma: significant toxicity with no clinical efficacy. Cancer 106, 2005-2011.
Zimpfer-Rechner C, Hofmann U, Figl R, Becker JC, Trefzer U, Keller I, Hauschild A, Schadendorf D (2003) Randomized phase II study of weekly paclitaxel versus paclitaxel and carboplatin as second-line therapy in disseminated melanoma: a multicentre trial of the Dermatologic Cooperative Oncology Group (DeCOG). Melanoma Res 13, 531-536.
Joan Manel Gasent Blesa
199
Blesa et al: Considering SRC-ABL as a promising therapeutic target in cancer Cancer Therapy Vol 6, 200-214, 2008
Considering SRC-ABL as a promising therapeutic target in cancer Review Article
Joan Manel Gasent Blesa1,*, Mariano Provencio Pulla2, Vicente Alberola Candel3 Medical Oncology Service, Hospital Marina Alta de Dénia, Alacant, Spain Medical Oncology Service, Hospital Arnau de Vilanova, València, Spain 3 Medical Oncology Service, Hospital Puerta de Hierro, Madrid, Spain 1 2
__________________________________________________________________________________ *Correspondence: Joan Manel Gasent Blesa MD Ph.D., Hospital de Dènia Marina Salud, Partida de Beniadlà, s/n. Denia. 03700, Alacant, Spain; Tel: +34 606311233; e-mail: joanmagasent@telefonica.net Key words: SRC-ABL, cancer, FAK-C-SRC, adenovirus, Tyrosine kinase inhibitors, antisense nucleotides, Proteins, Antibodies, Chemotherapy, Genetic therapy Abbreviations: 1,2-dioleoyl-sn-glycero-3-phosphatidylcholine, (DOPC); 5-fluorouracil, (5-FU); Adenovirus-containing FAK-CD, (AdFAK-CD); epidermal growth factor receptor, (EGFR); epidermal growth factor receptor, (EGFR); extracellular signal-related kinase, (ERK); FAK Related Non-Kinase, (FRNK); focal adhesion targeting, (FAT); four 1-ezrin-radixin-moesin, (FERM); glycogen synthetase kinase 3 type !, (GSK3!); matrix metalloproteinases, (MMPs); of thymidylate synthase, (TS); Proline-rich tyrosine Kinase 2, (PYK2); ribonucleotide reductase M1 polypeptide, (RRM1); Rous Sarcoma´s Virus, (RSV); tyrosine 397, (Y397); vascular endothelial growth factor, (VEGF) Received: 19 January 2009; Revised: 9 March 2009 Accepted: 16 March 2009; electronically published: 22 March 2009
Summary Integrins are a family of transmembrane receptors that link to the extracellular matrix (ECM) to the intracellular actin cytoskeleton. These cell-matrix areas of adhesion are known as focal adhesions. Integrin clustering not only has a structural role, it also induces the activation of intracellular signaling pathways that lead to cell proliferation, survival and migration responses in normal and tumor cells (Guo and Giancotti, 2004). In this setting, the non receptor intracellular tyrosine Kinases Focal adhesion kinase (FAK) and C-src play a central role as intracellular effectors of the signal initiated by these integrin-ECM interactions. Clustered integrins transduce the signal into the cells through the activation of the kinases FAK and C-src. Cellular responses mediated by FAK and C-src as a result of the co-clustering of Integrins and tyrosin kinase receptors (TKRs) occur frecuently Therefore, FAK and Csrc are intracellular signaling proteins that integrate signals from inegrins and TKRs in normal and in tumor cells.Linked activities of C-src and FAK control cellular processes such as proliferation, survival, migration and invasion. In FAKt, an increased expression of both proteins has been associated with more invasive and aggressive phenotypes. Accordingly, drugs against C-src and against FAK are potent inhibitors of tumor cell migration (Nam et al, 2005; Slack-Davis et al, 2005; Jallal et al, 2007).
Different FAK isoforms due to alternatively splicing have been found: FAK, Proline-rich tyrosine Kinase 2 (PYK2) and FAK Related Non-Kinase (FRNK) (Burgaya et al, 1997). FRNK lacks the catalytic domain (Schaller et al, 1993) This isoform works as an FAK inhibitor due to it competes with FAK for the localization at focal adhesions areas. PYK2 has high sequence similitude with FAK and shows its highest expression in the nervous system (Burgaya et al, 1997). FAK+, FAKbox6, -box7 and box28 are also FAK isoforms expressed in brain tissue (Burgaya and Girault, 1996). FAK contains a central region which shows the catalytic kinase activity. The kinase domain is flanked by a large N-terminal region that contains the erythrocyte
I. FAK structure and function FAK was first described in 1992 by Schaller and colleagues and Guan and Shalloway in 1992 as a focal adhesion-associated non receptor protein tyrosine kinase (Schlaepfer et al, 1999) FAK was originally identified in chicken fibroblast as a protein phosphorylated in tyrosines in response to transformation induced by oncogenic C-src (Zachary, 1997). The FAK gene maps on human chromosome 8 and encodes a protein with a molecular weight of 119-121 kDa. Based on the electrophortetic cell mobility of FAK, it is known as p125FAK (Slack-Davis et al, 2005). FAK is an evolutionarily highly conserved gene from xenopus to humans (Slack-Davis et al, 2005).
200
Cancer Therapy Vol 6, page band four 1-ezrin-radixin-moesin (FERM) domain and by a C-terminal region that contains the focal adhesion targeting (FAT) domain. The tyrosine 397 (Y397) adjacent to the kinase domain, is autophosphorylated in response to the clustering of integrins. This autophophorilation increases the catalytic activity of FAK. The phospho Y397 binds to proteins containing SH2 (C-src homology 2) domains such as the kinase C-src (Calalb et al, 1995). The tyrosines Y576 and Y57 placed in the catalytic loop of the kinase domain are also phosphorylated in response of the binding of C-src. This Phophorilation event in Y576 and Y577 is necessary for the full catalitic acivity of FAK (Calalb et al, 1995; Owen et al, 1999). In absence of signal stimuli from integrins and TKRs, the FERM domain works as a negative regulator of the FAK activity (Cooper et al, 2003). FERM domain interacts with the kinase domain preventing the phosphorylation in Y397. Contrary, in response of coclusters of integrins-TKRs, the FERM domain interacts with the cytoplasmic tail of the !-integrin. allowing the authophosphorimation in Y397. The FAT sequence placed in the C-terminal region mediates the localization of FAK in focal adhesions areas through the interaction of FAK with focal adhesion associated proteins such as talin and paxillin (Hildebrand et al, 1993). Furthermore, two proline rich domains adjacents to the FAT domain mediate the interaction of FAK with SH3 containing proteins such as p130 CAS. FAK is also ubiquitously expressed (Schaller and Parsons, 1994; Cary and Guam, 1999; Nam et al, 2005; Slack-Davis et al, 2005) FAK-null embryos exhibit an embryonic lethal phenotype (they die at day e8.5) with multiple defects, including a disorganized cardiovascular system. These FAK"/" embryos show endothelial cells indicating that FAK is not involved in endothelial cell differentiation (Ilic eet al, 1995). However, FAK-null embryos fail to form vascular networks, suggesting that FAK functions in angiogenesis and vascular remodelling (Gordon et al, 2005). In adult tissues, FAK controls many cell biological processes. FAK is involved in the regulation of the turnover of the focal adhesions, a process that is crucial for cell migration. FAK has been also associated with cell growth and survival responses. FAK signaling protects cells from anoikis (apotosis induced when anchorage-dependent cells detach from the surrounding ECM) (Gordon et al, 2005). FAK activation is also involved in resistance to anoikis in tumor cells, allowing them to survive, grow and metastatizate when they have lost their anchorage (Frisch et al, 1996; Xu et al, 2000). In addition, enhanced FAK signaling have been associated with an uncontrolled proliferation, survival and/or migration/invasion in tumors suggesting a role for FAK in cancer development and/or progression (Mon et al, 2006). A large number of reports have shown FAK as a important promoter of tumor cell proliferation(Schaller et al 1993; Tsai et a, 2000; Chen et al, 2001; Nam et al, 2005; Hu et al, 2006), survival (Schaller et al 1993; Almeida et al, 2000; Hood eet al, 2003; Cascone et al, 2005; Nam et al, 2005; Huveneens et al, 2007; Kahashi et al, 2007; Mc Carrigle and Huang 2007) tumor cell
spreading (Schaller et al 1993; Martin, 2001; Brown et al, 2005; Mc Carrigle and huang 2007; Migliaccio et al, 2007), migration (Schaller et al 1993; Guam, 1997; Martin, 2001; Bruton et al, 2004; Westhoff et al, 2004; Nam et al, 2005; Bryant et al, 2006; Van Nimwegen, et al, 2007; Chang et al, 2007) and (Schaller et al 1993; Sheta et al, 2000; Nam et al, 2005; Hu et al, 2006; Mitra and Schaepfer, 2006; Shawney et al, 2006; Zeng et al, 2006). An pro-angiogenic effect for FAK signaling in tumors has been also suggested (Schaller et al 1993; Martin, 2001; Nam et al, 2005; Cascone et al 2005; Bryant et al 2006). FAK expression has been found in tumor endothelial cells form grade III and IV astrocytoma biopsies whereas FAK expression was abscent in endothelial cells of normal brain biopsies (Haskell et al, 2003). Furthermore, tumor endothelial cells transfected with FRNK (a negative regulator of FAK) showed less migration in vitro than control cells, suggesting that FAK promotes tumor angiogenesis at least in part, through the induction of endothelial cell migration. Recently, preclinical data form breast cancer cell lines suggested that FAK signaling is also involved in the induction of VEGF expression in tumor cells (Mitra and Schaepfer, 2006). Phosphorylation of Y925 of FAK allows the recruitment of Grb2 and the subsequent MAPK pathway activation that subsequently leads to VEGF expression in tumor cells (Mitra and Schaepfer, 2006). Additionally, it has been showed that Ang-1 and its RTK Tie-2 are involved in the angiogenic remodelling. Cross-talk between Tie-2 and integrins would pomote the sprouting and stabilization of the new vessels during tumor progression (Cascone et al, 2005). Tie-2 and intgrin "1!5 would interact and the binding of intgrin "1!5 to ECM glycoproteins such as fibronectin would increase RTK-Integrin association. Finally, Ang-1 stimulation would promote the recruitment of FAK to the RTK-integrin complex that would lead to the endothelial cell response (Marti, 2001). Although, immunohistological date about the expression of active FAK in different tumor types and different tumor stages is need, current evidence suggests that FAK might be a promising target for the development of new anti-cancer drugs. In FAKt, as we review below, clinical trials with agents that are able to block the activity of FAK are currently underway in cancer patients.
II. C-SRC structure and function C-src is the first human oncogene discovered. In 1909 Peyton Rous identified the Rous Sarcoma´s Virus (RSV). Later, in 1958, H. Temin and H. Rubin identified the v-src gene as the cause that allowed to RSV to produce the sarcoma when it infected healthy chikens. The v-src gene was taken up by RSV and incorporated into its genome conferring it with the advantage of being able to stimulate uncontrolled proliferation of host chicken cells. Finally, Michael Bishop, characterized c-c-src, the human homologue of the v- src gene, as the first oncogene in humans (Martin, 2001). C-src like FAK is a non-receptor protein tyrosine kinase protein. C-src family comprises eight members in humans (C- src, Fyn, Yes, Lyn, Lck, Hck, Blk and Fgr)
201
Blesa et al: Considering SRC-ABL as a promising therapeutic target in cancer with a molecular weigh between 52-62KDa (Thomas and Brugge, 1997). Each C- src kinase family member is comprised of six domains a SH4 domain that is placed in N-terminal and that is involved in targeting c-src to the plasmatic membrane. Adjacent to the SH4 domain, a region that is specific of each c- src family members followed by a SH3 and a SH2 domain, both of them involved in the interaction of c-src with other intracellular proteins. Additionally, In the C-terminal, there is a SH1 domain involved in ATP and substrate binding. This SH1 domain shows tyrosine kinase activity. The phosphorilation in Y419 of the SH1 domain is required for maximum kinase activity. Placed adjacent to the SH1 domain there is a negative regulatory domain. After the phosphorilation of the Y530, placed in the negative regulatory domain, c-src undergoes conformational changes and becomes inactive. c-src is not only a critical modulator of signaling pathways mediated by TKRs (Biscardi et al, 1998) and integrins (Huveneers et al, 2007). It also transducer signals form G protein coupled receptors (Mc Garrigle and Huang, 2007), cell-cell adhesion molecules and steroid hormone receptors (Migliaccio et al, 2007). In response to a signal stimuli C-src translocates from the cytosol to the membrane where it will be activated by phosphorylation. Once activated, C-src not only activates FAK (Brunon et al, 2005), it also activates other important effectors such as Signal Transducer and Activator of Transcription (STAT) family members, paxilin and p130CAS (Cowell et al, 2006). C-src regulates a variety of normal and oncogenic processes such as cell proliferation, survival, adhesion, motility and invasion (Brown and Cooper, 1996; Yeatman, 2004). C-src null mice show had defects in osteoclast and bone resortion (Soriano et al, 1991). Accordingly, patients treated with a C-src inhibitor reduced in serum markers of bone reabsortion (Macarulla et al, 2006). These data suggested that C-src is involved in osteclast function and that C-src inhibition may be effective for the treatment of established bone metastasis. Evidence shows that human cancers show altered Csrc protein expression and/or C-src regulation. This relationship between C-src and human cancer is best documented in breast and colon (Verbeek et al, 1996; Mc Garrigle and Huang 2007) (Figure 1).
residue of FAK provides a docking site for C-src (Provenzano et al, 2008). C-src, then, phophorylates FAK, allowing the recruitment of SH2-containing signaling proteins such as Grb2 and PI3K7 (Schlaepferand Hunter, 1998; burgaya et al, 1997). Grb2, once bound to FAK can recruit SOS into the complex allowing the activation of the Ras-MAPK signaling pathway. PI3K also will transduce the signal through the activation of Akt. FAK is under strict regulation by kinases and phosphatases such as glycogen synthetase kinase 3 type ! (GSK3!), tyrosine phosphatase SHP-2 and serine/threonine protein phosphatase type 1 (Manes et al, 1999; Tamura et al, 1999; Vadlamudi et al, 2002; Schlaepfer et al, 2004; Zhang et al, 2004a; Wang et al, 2005; Cox et al, 2006). There are data linking the FAK-c-src pathway in involved in the changes in the cell matrix and intercellular adhesion, necessary for the cells to metastatize. FAK and c-src are potent inhibitors of the cell migration (Hiscox et al, 2006; Serrels et al, 2006) and invasion (Nam et al, 2005; Jallal et al, 2007). C-src is a required downstream in the vascular endothelial growth factor (VEGF) (Eliceri et al, 1999). C-src is also involved in the bone resorption induced by the osteoclast activation secondary to the secretion of growth FAKtors released by the bone marrow invading tumor cells; this effect leads to the secretion of growth FAKtors from bone, which can stimulate tumor growth, establishing a positive feedback between tumor invasion and bone resorption (Roodman, 2004) (Figure 2). It is possible that inhibition of C-src and/or FAK may have potent anti-invasive activity, which may prevent tumour dissemination rather than reduce tumour bulk.
A. The effects of FAK targeting on malignant characteristics of cells As FAK was shown to regulate the malignant characteristics of cancer cells, direct inhibition of FAK signalling utilizing different mechsnisms, is under research in cancer treatment.
IV. Preclinical agents in the focal adhesion targeting construct A. Use of adenovirus The FAT domain is a region in the C-terminal of the FAK molecule composed of 148 amino acids, that binds to paxillin, talin and vascular endothelial growth FAKtor (VEGF)-receptor-3 (Schlaepfer et al, 1999; Garces et al, 2006; Shawney et al, 2006). A FAT domain construct was found to compete with FAK for localisation to the FAs, inhibiting FAK activation and attenuating the epidermal growth factor receptor (EGFR) signalling at the cell membrane, thereby inhibiting EGF-dependent migration (Jones et al, 2001). It was also demonstrated that the FAT construct was sufficient to inhibit invasion and induce apoptosis in glioblastoma cells (Jones et al, 2001).
III. The FAK-C-SRC intracellular pathway …and more Integrins co-localizes with RTKs allowing FAK the simultaneous transduction of signals in response of both receptors (Schlaepfer et al, 1999; Siu et al, 2007; Mon et al, 2006) Integrins cluster in the focal adhesions contacts when they bind to the ECM (Miranti and Brugge, 1999). In response to the clustering, FAK associates the cytoplasmic tail of integrins and becomes autophophorylated in its Y397. This phosphotyrosine
202
Cancer Therapy Vol 6, page
Figure 1. FAK-SRC-HER2 pathway.
Figure 2. FAK-SRC.
1. FAK-related nonkinase construct
FRNK treatment of murine fibrosarcoma cells did not affect cell growth in vivo, but reduced the invasive capacity of the cells in vitro by inhibiting cell motility and experimental metastasis (Hanada et al, 2005). In human malignant cells, FRNK treatment decreased, in vitro, the proliferation and anchorage-independent growth rates of cutaneous and uveal melanoma cells (Hess and Hendrix, 2006), but it did not seem to affect the growth of viralsarcoma transformed fibroblasts (Hauck et al, 2002). Transfection of human uveal and cutaneous melanoma cells (Yang et al, 2004; Hess et al, 2005) as well as
The FRNK construct, a N-terminally truncated form of FAK normally expressed in chicken fibroblasts that can be produced by alternative splicing. The use of FRNK disrupted FAK localization to the FAs, thereby altering FAK phosphorylation status and signalling. Transfection of rat breast adenocarcinoma cells with FRNK resulted in decreased cell proliferation, attachment and spreading, inhibition of primary tumour growth and experimental metastasis formation in the lung (Van Nimwegen et al, 2005). 203
Blesa et al: Considering SRC-ABL as a promising therapeutic target in cancer ovarian (Sood et al, 2004) and prostate (Zheng et al, 1999) cancer cells with FRNK, resulted in inhibition of the spreading of malignant cells (Bryant et al, 2006; Haskell et al, 2003) , invasion (Haskel et al, 2003; Hu et al, 2006) and migration (Martin et al, 2001; Haskell t al, 2003; Zheng et al, 2006). On the contrary, in viral-sarcoma transformed fibroblasts, FRNK treatment inhibited invasion of cells, but not cell motility (Hu et al, 2006). In prostate cancer cells, the use of FRNK resulted in a statistically significant decrease in motility of the bombesin-treated, but not untreated, cells (Lacoste et al, 2005). Furthermore, the use of FRNK was shown to affect the vasculogenic mimicry of melanoma cells (Zheng et al, 2006). This was also supported by a study on human astrocytic tumours, presenting evidence that FRNK treatment resulted in a significant reduction in the migration (35-50%) of intratumoural endothelial cells, as well as in the branched tube formation and tube length (40-50%) (Haskell et al, 2003). The hypothesis that FRNK treatment could block the formation of metastasis in vivo was supported by the downregulation of transendothelial migration rate of human breast cancer cells through bovine lung microvessel endothelium (Earley and Plopper, 2006), as well as the inhibition of the experimental metastasis of human transformed fibroblasts (Hu et al, 2006) and melanoma cells (Abdel-Ghany et al, 2002) to the lung in experimental animal models.
B. Agents affecting FAK c-c-src activation 1. Tyrosine kinase inhibitors and FAK FAK activates all its downstream molecules by phosphorylating them, thus the use of kinase inhibitors that blocked the enzymatic activity of FAK, disturbed signalling transduction. Some of them, such as the EGFtyrosine kinase inhibitor gefitinib and the soy-bean derived PTK inhibitor genistein are already under clinical trial in patients presenting different cancer types (Liu et al, 2000; Shintani et al, 2000). Gefitinib is available for the treatment of inoperable or reccurent non-small-cell lung cancer in Japan (Mauer et al, 1999). Imatinib mesilate induced apoptosis in human cholangiocarcinoma cells in a concentration-dependent manner, coupled with a decrease in net cell number, by diminishing EGFR and FAK tyrosine phosphorylation (Chiorean et al, 2004). Genistein increased the adhesion of prostate cancer cells by modulating FAK activity (Wang et al, 2005). The antibiotic herbimycin A, also a PTK inhibitor, decreased FAK tyrosine phosphorylation and resulted in decreased migration of oral squamous cancer cells (Matsumoto et al, 1994). The effects of gefitinib in a study on oral squamous cancer cells were similar, as it inhibited the metastasis of cancer cells to the lymph nodes and reduced the volume of the formed lymph node metastases (Mauer et al, 1999). Cells exhibited decreased cell adhesion to the extracellular matrix at significant levels in respect for adhesion to fibronectin, but not to laminin. Gefitinib treatment resulted also in a significant reduction in the expression of some integrin subtypes, as well as in the level of FAK phosphorylation. It was also suggested that gefitinib selectively downregulated integrin expression and FAK phosphorylation, leading to a reduction in spontaneous metastasis from the highly metastatic oral cancer cells (Mauer et al, 1999). More recent studies focused on the potential therapeutic benefits from the use of ATPcompetitive kinase inhibitors that were relatively specific for FAK. These inhibitors interact with FAK in the ATPbinding domain and prevent FAK autophosphorylation (Slack-Davis et al; 2004; Shi et al, 2007). These results of the PF 573,228 in vitro study on several cell lines were promising (Liu et al, 2007) PF573,228 inhibited FAK phosphorylation on tyrosine 397. Treatment of a rat fibroblast cell line (REF52) with PF573,228 resulted in the inhibition of serum or fibronectindirected migration and decreased FA turnover, whereas it failed to inhibit growth and apoptosis of either this cell line or the others tested (PC3 prostate adenocarcinoma and Madin-Darby canine kidney cell lines). More promising are the results regarding the novel FAK inhibitor, TAE 226, another low molecular weight ATP-competitive tyrosine kinase inhibitor (Cox et al, 2006). TAE226 was found in cell-based kinase assays to be a relatively specific inhibitor of FAK and insulin growth FAKtor-I receptor, with an IC 50 value > 10-fold less sensitive compared with the other kinases tested (Serrels et al, 2006). In an study in human malignant glioblastoma cell lines (Cox et al, 2006), TAE226 inhibited the phosphorylation of FAK, as well as the
2. Ad-FAK-CD Focal adhesion kinase (FAK) and C-src have been shown to be overexpressed in colon cancer. Adenoviruscontaining FAK-CD (Ad-FAK-CD), a dominant-negative, COOH-terminal portion of FAK, was used to inhibit FAK and cause apoptosis in colon and breast cancer cell lines. The colon cancer cell lines were more resistant to AdFAK-CD-induced detachment and apoptosis than the breast cancer cell line, BT474. Colon cancer cell lines overexpressed highly active C-src and FAK. Ad-FAK-CDinduced apoptosis was significantly increased by PP2, an inhibitor of C-src family kinases. Activation of caspase-3, down-regulation of FAK, and C-src and AKT activities were demonstrated in Ad-FAK-CD + PP2-treated colon cancer cells undergoing apoptosis. The results suggested that FAK and C-src are both important survival FAKtors, playing a role in protecting colon cancer cell lines from Ad-FAKCD- induced apoptosis. Dual inhibition of these kinases may be important for therapies designed to enhance the apoptosis in colon cancers (Golubovskaya et al, 2003).
3. AV3 VEGF receptor-3 with its specific sequence AV3, as well as AV3 peptide construct, have been shown to interact with the FAT domain of FAK (Werthoff et al, 2004). This interaction disrupted FAK localisation from the FAs and resulted in apoptosis induction in breast cancer cells. The result from the AV3 peptide interaction with FAK is similar to this. Furthermore, a therapeutic window seemed to exist, as the peptide affected the cancer cells more than the normal ones.
204
Cancer Therapy Vol 6, page downstream effectors Akt, without altering total Akt protein levels, extracellular signal-related kinase (ERK)-1, ERK-2, and S6 ribosomal protein. TAE226 did not alter total FAK protein levels in any of the cell lines tested, but dramatically inhibited the phosphorylation of FAK at critical tyrosine residues, depending on the cell type used. TAE226 treatment resulted in the inhibition of the growth of glioma cells through a mechanism associated with preventing progression through the G2 phase of the cell cycle. Additionally, it increased the fraction of sub G0 cells in all glioma cell lines tested and significantly increased apoptosis in tumour cells, with D54MG cells being more sensitive. Finally, increasing concentrations of TAE226 prevented the attachment, TAE226 treatment induced caspace-mediated apoptosis in tumour cells in correlation with the p53 status, as apoptosis was induced only in the subset of glioma cell lines containing the mutant p53 gene. Finally, the in vivo intracranial glioma xenograft model showed that treatment with TAE226 at concentrations of 50-75 mg/kg significantly extended median survival. PF 562,271has recently entered a Phase I clinical trial in patients with several malignancies, including lung, gastric, colorectal, breast, neuroendocrine, skin and ovarian (Siu et al, 2007), the results of this Phase I trial are awaited.
of an anti-FAK and c-c-src inhibiton strategy in colon cancer cells where FAK and c-c-src have been shown to be overexpressed. This group had previously been studied the role of these two kinases in resistance to apoptosis. Adenovirus-containing FAK-CD (Ad-FAK-CD), a dominant-negative, COOH terminal portion of FAK, was used to inhibit FAK and cause apoptosis. Colon cancer cell lines were more resistant to Ad-FAK-CD-induced detachment and apoptosis than the breast cancer cell line, BT474. Colon cancer cell lines overexpressed highly active c-src and FAK. Ad-FAK-CD-induced apoptosis was significantly increased by PP2, an inhibitor of c-src family kinases. Activation of caspase-3, down-regulation of FAK, and c-src and AKT activities were demonstrated in AdFAK-CD + PP2-treated colon cancer cells undergoing apoptosis. The results suggest that FAK and c-src are both important survival factors, playing a role in protecting colon cancer cell lines from Ad-FAKCD- induced apoptosis. Dual inhibition of these kinases may be important for therapies designed to enhance the apoptosis in colon cancers.
D. Interfering RNA´S and antisense nucleotides 1. Agents affecting FAK expression i. Small interfering RNAs Targeting FAK with siRNA reduced the transendothelial migration rate of human breast cancer cells through bovine lung microvessel endothelium (Biscardi et al, 1995). In addition, similar treatment reduced the overall levels of FAK phosphorylation on tyrosines 397 and 576, and blocked the pressurestimulated adhesion of colon cancer cells (Thamilselvan et al, 2004), although in another study, it almost completely inhibited matrix metalloproteinases (MMPs) production and in vitro invasiveness of cholangiocarcinoma cells (Mon et al, 2006). Huang and colleagues showed in 2005 that FAK targeting with siRNA resulted in decreased FAK expression and potently blocked the migration of pancreatic cancer cells, while not affecting proliferation or apoptosis (Huang et al, 2005). Duxbury and colleagues confirmed in 2004 that siRNA anti-FAK treatment significantly reduced metastasis, presenting evidence that pancreatic cancer cells treated with anti-FAK siRNA ex vivo and then implanted into mice, did not metastasise to the liver or lung, in contrast to controls (Duxbury et al, 2004). FAK siRNA treatment was found to suppress anoikis resistance in vitro by increasing caspase activities, particularly caspases-3 and -8 and, to a lesser extent, -2 and -9 (Brown and Cooper, 1996). Another study presented that FAK siRNA treatment reduced FAK protein level and phosphorylation status in human lung carcinoma and transformed embryonic kidney cells (Han et al, 2001). FAK protein reduction resulted in decreased colony formation in both clonogenic and soft-agar assays, as transfected cells exhibited decreased migration capability in the presence of bovine serum or EGF. On the contrary, there was no discernable difference in apoptotic rates or cell morphology between treated cells and control ones (Yeatman, 2004).
2. Tyrosine kinase inhibitors and c-src Resistance to chemotherapy is believed to be a major cause of treatment failure in pancreatic cancer. The hypothesis that C-src tyrosine kinase inhibition could augment the chemosensitivity of 5-fluorouracil (5-FU) has teen tested by the group of Ischenko and colleagues in 2008 in (5-FU)-resistant human pancreatic cancer cells, detected by MTT proliferation assay. Propidium iodide and annexin V staining, a combination of 5-FU and c-Csrc kinase inhibitor PP2 (4-amino-5-(4-chlorophenyl)-7-(tbutyl) pyrazolo[3,4-d]pyrimidine) reflected the chemotherapeutic sensitivity and restored the 5-FUinduced apoptosis in 5-FU-resistant cells. Furthermore, when small-interfering RNA approach to silence C-src gene expression was applied, the degree of 5-FU-induced apoptosis was increased in all cell lines independently of the chemoresistance status. Western blotting and RTâ&#x20AC;&#x201C;PCR analysis revealed that the expression of thymidylate synthase (TS) was higher in 5-FU-resistant cells, however, decreased significantly after pretreatment with PP2. Furthermore, the combination of 5-FU#PP2 decreased the 5 FU-induced activation of epidermal growth factor receptor (EGFR)-AKT pathway. Finally, PP2 in combination with 5-FU substantially decreased the in vivo tumor growth and inhibited distant metastases. 5-FU chemoresistance could be reversed through indirect TS regulation by inhibiting C-src tyrosine kinase. A potential mechanism of action of C-src kinase inhibitors on 5-FU chemosensitivity might be linked to the inhibition of 5FU-induced EGFRâ&#x20AC;&#x201C;AKT activation.
C. Combination of Adenovirus and TKI inhibitors The group of Golubovskaya and colleagues in 2003 and Slack-Davis and colleagues in 2007 studied the effects 205
Blesa et al: Considering SRC-ABL as a promising therapeutic target in cancer domain (Owen et al, 1999; Schlaepfer et al, 1999). It has been shown that the N-terminal region of FIP200 was associated with the kinase domain of FAK. The middle domain of FIP200 also associated with the kinase domain of FAK, but inhibited FAK activity to a lesser extent than the N-terminal domain. The C-terminal domain of FIP200 bound to the FERM domain of FAK and it did not affect FAK activity. As FIP200 is expressed in many tissues and cell lines, it may play an important role in regulating some of the FAK-induced cellular processes. Finally, data exist suggesting that FIP200 may play a role as a tumour suppressor molecule in normal cells. A potential role in breast cancer was suggested by the group leaded by Melkoumian (Melkoumian et al, 2005), in their study showing that it inhibited G 1 to S phase progression, proliferation and survival of human breast cancer cells, by decreasing cyclin-D1 and increasing p21 protein levels, leading to pRb hypophosphorylation. FIP200 did not seem to affect pRb levels, as was shown in previous studies (Chano et al, 2002), probably due to different cell lines used.
E. FAK antisense oligonucleotides and FAK targeting ribozymes FAK antisense oligonucleotide treatment, blocked MMP-9 and suppressed MMP-2 secretion in human ovarian cancer cells, as well as both basal and hyluraninduced MMP-2 secretion in human small-cell lung carcinoma cells (Zhang et al, 2002). Treatment of oral cancer cells increased their apoptotic rates (Zhang et al, 2004b), whereas in a study on hepatocellular carcinoma (HCC) cells it significantly inhibited cell growth by 3060%, attachment by 25-55% and invasion by 15-25%, increased their apoptotic rate and reduced the number of cells at the S-phase of cell cycle (Gu et al, 2003). Finally, FAK antisense treatment was found to completely block the gastrin-induced invasion of human colon cancer cells (Yu et al, 2006) , whereas it decreased the growth rate of HCC cells and their adhesion ability, as well as the colony formation in vitro , without changing integrin expression (Fang et al, 2001). According to Guan and colleagues, the results of FAK antisense oligonucleotide treatment are not satisFAKtory, as the target RNA number is too large for complete blocking and oligonucleotides are very easily degraded (Guan et al, 2006). The use of a constructed FAK targeting ribozyme, which was sequence specific, gave interesting results, as it significantly inhibited the expression of FAK mRNA and protein with consequent apoptosis of gastric cancer cells, suggesting its possible use in the treatment of gastric carcinoma (Schlaepfer et al, 1999).
2. FNIII-14 FNIII-14 is a synthetic peptide derived from the fourteenth type III module of fibronectin and was found to inhibit cell adhesion. Kato and colleagues studied in 2002 the effects of FNIII-14 in the metastatic process of murine T lymphoma and human Burkittâ&#x20AC;&#x2122;s lymphoma cells (Kato et al, 2002). FNIII-14 inhibited lymphoma cell adhesion, migration and experimental liver and spleen metastases and decreased the tyrosine phosphorylation of FAK and paxillin. It was suggested that FNIII-14 effects might be mediated by the negative regulation of FAK and paxillin phosphorylation and hope was given that this peptide may be applicable as a new type of antimetastatic agent.
F. Antibodies The use of antibodies is another possibility, indirectly resulting in decreased FAK phosphorylation. Raso and colleagues (Raso et al, 2005) showed that the monoclonal antibody PAC-1, directed to the active form of integrin $ IIb ! 3 , significantly decreased FAK tyrosine phosphorylation in murine melanoma cells, by activating a protein kinase C-dependent phosphatase. PAC-1 treated melanoma cells lost their ability to metastasise to the lung, suggesting that their invasive potential was also abrogated in vivo (Jallal et al, 2007). In another study, treatment of SCLC cell lines with anti-GD2 ganglioside antibodies resulted in increased apoptosis and reduced growth of cancer cells (Aixinjueluo et al, 2005). The use of anti-GD2 ganglioside antibodies also reduced FAK and Erk1/2, although it increased p38 phosphorylation. As GD2 could be precipitated with integrin and/or FAK, it was suggested that GD2, FAK and integrins formed a complex across the plasma membrane and anti-GD2 treatment caused conformational changes in this complex leading to the dephosphorylation of FAK, resulting in increased apoptosis (Eliceiri et al, 1999).
H. Chemotherapy 1. FAK is implicated in chemoresistance of cancer cells FAK tyrosine phosphorylation was decreased in oral squamous carcinoma cells resistant to cisplatin compared with non-resistant cells in vitro (Nakahara et al, 2003). After the initiation of cisplatin treatment, FAK phosphorylation increased in resistant cells, whereas in sensitive cells FAK phosphorylation decreased. Interestingly, FAK was degraded in sensitive but not resistant cells. Additionally, in another study, FAK phosphorylation was maintained in human ovarian adenocarcinoma cells resistant to cisplatin, but not in cisplatin-sensitive cells (Villedieu et al, 2006). FAK protein expression was correlated with decreased sensitivity of acute myelogenous leukemia malignant cells to daunorubicin (Recher et al, 2004).
G. Proteins
2. Positive results by the combination of conventional chemotherapy with FAK targeting agents
1. FIP200 Recently, an inhibitor known as FIP200 has also been shown to regulate FAK activity. FIP200 is a cellular protein first identified by yeast two-hybrid screening, which inhibited FAK activity by binding to the kinase
Wu and colleagues presented evidence that FAK antisense oligonucleotide treatment significantly reduced 206
Cancer Therapy Vol 6, page FAK protein levels and consequently induced apoptosis in human glioblastoma cells (Wu et al, 2006). The antisense oligonucleotides were also found to disrupt mitochondrial membrane integrity and to activate caspase-3, effects that probably mediated the induction of apoptosis. The effects were cytotoxic in vitro almost at the same levels with the known anticancer agents cisplatin, etoposide and nimustine hydrochloride. When these anticancer agents were used in combination with the FAK antisense oligonucleotides, the effects were clearly additive (Zheng et al, 1999). Similar were the results of a study on the effects of FRNK use, alone or in combination with chemotherapeutic agents, on squamous cell carcinomas of the oral and nasal cavities (Kornberg, 2005). FAK immunoreactivity at tyrosine 397 was greatly reduced after cell transfection with a recombinant adenovirus causing FRNK overexpression, which in turn resulted in increased, but not statistically significant for SCC cells of the tongue, apoptosis when compared with control ones transfected with adenovirus, not causing FRNK overexpression. Furthermore, FRNK overexpression led to a substantial decrease of the migration of tumour cells by 50%. The chemotherapeutic agents etoposide, 5-FU and paclitaxel, caused a concentration dependent decrease in cancer cells viability. In cancer cells with nasal septum origin, chemotherapy and FRNK caused an additive increase in apoptosis, whereas in cancer cells of tongue origin, the effect was synergistic (Lacoste et al, 2005). The effects of combined chemotherapy and anti-FAK treatment were also studied in human HCC cells in vitro (Fang et al, 2001). More specifically, when TNF- $ plus cycloheximide treatment was combined with FAK antisense treatment, an increase in the apoptotic index was observed, accompanied by lower Akt levels. This effect persisted even after PI3K blocking, suggesting that FAK antisense treatment enhanced chemotherapy by downregulating Akt levels through an unknown pathway that does not include PI3K. Furthermore, another in vitro study suggested that the use of FAK siRNA treatment potentiated Gemcitabine action against pancreatic cancer cells (Duxbury et al, 2003) by inducing a large increase in the apoptotic fraction of cells following gemcitabine treatment, which was accompanied by increased caspase-3 activity. In the nude mouse xenograft model, FAK siRNA treatment in combination with gemcitabine induced a statistically significant inhibition of tumour size by 75% compared with gemcitabine monotherapy and by 73% compared to treatment with gemcitabine and control siRNA (Abdel-Ghany et al, 2002). In addition, treatment of human epithelial ovarian cancer cells with FAK siRNA resulted in a 70-90% decrease in FAK levels within 72 h of treatment and augmented docetaxel-induced growth inhibition and apoptosis in both sensitive and resistant cells (Hauck et al, 2002). Based on their previous results, Halder and colleagues evaluated anti-FAK treatment alone and in combination with docetaxel in human ovarian cancer cells (Halder et al, 2006). FAK siRNA incorporated in neutral liposome 1,2-dioleoyl-sn-glycero-3phosphatidylcholine (DOPC) was used to downregulate FAK expression in vivo in mice bearing human ovarian cancer cells. Western blot revealed > 80% reduction in
FAK levels within 48 h, which persisted for at least 4 days and began to return to basal levels by the sixth day after a single treatment. Treatment of mice with siRNA-DOPC resulted in decreased tumour weight by 44-72%. Treatment with siRNA-DOPC in combination with docetaxel resulted in even greater reduction of tumour weight by 94-98%. After statistical analysis combination therapy was found to be statistically superior. Furthermore, combined treatment led to decreased microvessel density, decreased VEGF and MMP-9 expression and increased apoptosis of tumour-associated endothelial cells and tumour cells. siRNA-DOPC treatment resulted also in a 72% decrease of the mean tumour weight of cisplatin-resistant tumour studied. The combination of siRNA-DOPC with cisplatin was more effective than cisplatin alone. It was suggested that FAK siRNA treatment, combined with docetaxel or cisplatin, could be a potent therapeutic combination against ovarian cancer resistant to chemotherapy. Furthermore, combined use of doxorubicin with the FRNK construct resulted in increased apoptosis compared with doxorubicin treatment, whereas treatment with doxorubicin plus the FAT construct was less effective (Yang et al, 2004). In addition, Smith and colleagues showed in 2005 that FAK antisense oligonucleotide treatment enhanced the effects of 5-FU treatment in human melanoma cells (Smith et al, 2005). FAK antisense oligonucleotides significantly increaced cell detachment and apoptosis when used alone or in combination with 5-FU. The effects of combined treatment on a melanoma cell line were approximately additive. FAK antisense oligonucleotides decreased FAK protein levels after 24-48 h of treatment, an effect that was also observed by 5-FU treatment, at a smaller level, and by the combination of antisense oligonucleotides and 5-FU (Shintani et al, 2003) Conclusively, FAK-targeting compounds augment the action of several conventional anticancer agents. Nonetheless, further research should be done on the possibility of the potential use of such results in the clinical setting.
3. The role of FAK C-SRC and FAK targeting in the hormonal therapy of breast cancer FAK, as well as c-src, were associated with the progression and metastasis of estrogen receptor (ER)positive breast cancer in vitro (Planas-Silva et al, 2006). csrc and FAK signalling were enhanced in breast cancer cell cultures during the acquisition of tamoxifen-resistant growth. Furthermore, active c-src and FAK were frequently found at the metastatic site on relapse of hormone-treated early breast cancer, whereas proliferation of tamoxifen-resistant cells was blocked by inhibiting the signalling from the C-src family kinases. Another study proved that elevated levels of activated c-src in tamoxifenresistant cells promoted an increase in FAK phosphorylation at tyrosines 861 and 925 and uncoupled FAK activation from an adhesion-dependent process (Hiscox et al, 2007). All these findings suggested the existence of an interaction between ER and c-src/FAK signalling cascade and pointed out the possibility that blocking this cascade might act co-operatively with 207
Blesa et al: Considering SRC-ABL as a promising therapeutic target in cancer hormonal therapy. This hypothesis was supported by Bartholomew and colleagues who showed that estradiol treatment of human breast cancer cells affected FAK function (Bartholomew et al, 1998). Estradiol enhanced the expression of the receptor, which could be activated by insulin and in turn could activate tyrosine phosphatases that targeted and dephosphorylated FAK (Siu et al, 2007). Another study showing the relations and potential therapeutic target was the pulibshed by Matthew and colleagues in 2006 in the breast cancer cell line MCF-7 cells stably expressing the mutant type estrogen receptor ERA. These cells showed increased c-Src kinase activity and c-Src tyrosine phosphorylation when compared with wild-type ERA-expressing cells. A c-Src inhibitor, AZD0530, was used to analyze the biological effects of pharmacologically inhibiting c-Src kinase activity. MCF-7 cells showed an anchorage dependent growth IC50 of 0.47 Mmol/L, which was increased 4-fold in the presence of estrogen. In contrast, cells stably expressing the mutant ERA had an elevated IC50 that was only increased 1.4fold by estrogen stimulation. The c-Src inhibitor effectively inhibited the anchorage-independent growth of both of these cells, and estrogen was able to reverse these effects. When cells were treated with suboptimal concentrations of c-Src inhibitor and tamoxifen, synergistic inhibition was observed, suggesting a cooperative interaction between c-Src and ERA. These data clearly show an important role for ERA and estrogen signaling in c-Src–mediated breast cancer cell growth and survival.
and PI3K, and also blocked the signal transduction at the levels of the Shc and PIP3 activation (Burgaya and Girault, 1996; Zhang et al, 2002; Duxbury et al, 2004; Han et al, 2004). Furthermore, evidence was presented that overexpression of the ribonucleotide reductase M1 polypeptide (RRM1) gene in human and mouse lung cancer cells induced PTEN expression, reduced FAK phosphorylation and inhibited migration, invasion, metastasis formation and also increased survival in an animal model (Gautam et al, 2003).
I. Src-Abl tyrosin kinase inhibitors 1. Dasatinib Dasatinib is an orally active small molecule inhibitor of both the src and abl proteins with IC50s for the isolated kinases of 0.55 and 3.0 nM, respectively (Lombardo et al, 2004). Dasatinib is 20-fold more potent than imatinib against cells expressing wild-type Bcr-Abl, respectively, and similar improvements are maintained for all imatinibresistant mutants tested in vitro, with the exception of T315I (O´Hare et al, 2005). In another study it was shown that dasatinib also inhibits c-Kit in addition to inhibition of src and bcl kinases (Lombardo et al, 2004) and some have implicated in the inhibition of PDGFR (Coluccia et al, 2008). Therefore, inhibitory activity of dasatinib on the growth of triple-negative breast cancer cell lines may also be attributed to inhibition of c-Kit in these cell lines. Recently, dasatinib was approved for the treatment of imatinib refractory chronic myelogenous leukemia (CML) and bcr-abl positive acute lymphoblastic leukemia (ALL) (Talpaz et al, 2006).
4. Genetic therapy perspectives Transfection of cancer cells with FAK mutants or genes encoding phosphatases that inhibited FAK activation resulted in favourable results, rendering genetic therapy as a possible future option for anticancer therapy. Deletion of the FAK gene was associated with reduced migration of mouse squamous cancer cells in vitro and increased cell death rates, both in vivo and in vitro (McLean et al, 2001, 2004). Transfection of human melanoma cells with a FAK mutant on tyrosine residue 397 impeded the early metastatic growth of experimental lung metastasis in an animal model (Huveneers et al, 2007), whereas the use of FAK mutants on residues 397 and 925 resulted in the suppression of MMP-9 secretion in human cholangiocarcinoma cells (Brunton et al, 2005). Zhang and colleagues correlated increased FAK expression with reduced PTEN expression in HCC tissues and cell lines (Calalb et al, 1995; Zhang et al, 2004a). Upregulation of PTEN expression was also a part of the PPAR % agonist-induced anoikis of thyroid carcinoma cells, through the dephosphorylation of FAK and paxillin and the FAs disassembly (Chen et al, 2006). PTEN expression, by modulating FAK signalling, inhibited the migration, invasion, spreading and growth of glioblastoma (Burgaya and Girault, 1996; Gu et al, 1998; Tamura et al, 1998, 1999) and colon carcinoma (Haier and Nicolson, 2002) cells and induced apoptosis in HCC (Yang et al, 2004) and breast cancer (Chen et al, 2005) cells, in vitro. PTEN dephosphorylated FAK, inhibiting its downstream signalling effectors, such as p130Cas, Grb2
2. AZD0530 AZD0530 is a novel, potent, and highly selective Src/Abl kinase inhibitor (Plé et al, 2004). In cell cultures it has been shown additive effects when combined with tamoxifen in tamoxifen-resistant MCF-7 cells were more sensitive to AZD0530 than their nonresistant counterparts (Hiscox et al, 2006). Other groups (Gaben et al, 2004; Matthew et al, 2006) also showed that in tamoxifenresistant epidermal growth factor receptor over expressing MCF-7 cells, the combination of AZD0530 and the epidermal growth factor receptor inhibitor gefitinib blocked migration and invasion in an additive manner. A number of studies have shown that inhibiting c-Src activity in breast cancer cells blocks estrogen-induced cell cycle progression and mitogenesis (Castoria et al, 1999). c-Src inhibitors have also been shown to block estrogeninduced migration in endometrial cells (Acconcia et al, 2006) and disrupt adherans junctions in endothelial cells (Groten et al, 2005). Activity of AZD0530 has been shown activity against carcinogenesis in a preclinical model of skin cancer (Serrels et al, 2008), in prostate cancer models (Chang et al, 2008): It has also shown additive effects when combined with gefitinib, an Epidermal growth factor receptor in head and neck cancer cell lines (Koppikar et al, 2008), in the prevention of acquired estrogen inhibition resistance in breast cancer cells (Hiscox et al, 2008) and has shown cooperative activity when combined with 208
Cancer Therapy Vol 6, page tamoxifen in the inhibition of breast cancer cells growth (Herynk et al, 2006).
assess both target inhibition and anti-invasive efficacy will be crucial to help guide future clinical trials. Currently inhibition of C-src autophosphorylation and downstream substrate phosphorylation are being evaluated clinically as markers of C-src inhibition (Tabernero et al, 2007). A large number of clinical trials are underway with C-src inhibitors against a range of different tumour types, both as single agents and in combination with other therapeutics. The development of FAK inhibitors is not as far advanced but as both clinical and preclinical studies advance in the next few years many of the questions surrounding the clinical utility of both classes of tyrosine kinase inhibitors will be answered.
3. Bosutinib SKI- 606 (Bosutinib) is a potent, orally bioavailable, dual Src/Abl kinase inhibitor. It has shown to have antiproliferative effects in chronic myelogenous leukemia cells, inhibiting colon tumor cell colony formation in soft agar, and to suppress tumor growth in K562and colon tumor cell xenograft models (Golas et al, 2003; Golas et al, 2005). In breast cancer Vultur and colleagues in 2008 have recently published that Bosutinib caused a decrease in cell motility and invasion of breast cancer cell lines with an IC50 of f250 nmol/L, which was also the IC50 for inhibition of cellular Src kinase activity in intact tumor cells. These changes were accompanied by an increase in cell to-cell adhesion and membrane localization of Bcatenin. By contrast, cell proliferation and survival were unaffected at concentrations sufficient to block cell migration and invasion. Analysis of downstream effectors of Src revealed that Bosutinib inhibits the phosphorylation of focal adhesion kinase (FAK), proline-rich tyrosine kinase 2 (Pyk2), and Crk-associated substrate (p130Cas), with an IC50 similar to inhibition of cellular Src kinase. In CML Bosutinib induced apoptosis in the imatinibresistant cell lines K562-R, LAMA-R, and KCL22-R (Lombardo et al, 2004) and is effective against a number of Bcr-Abl point mutations. In fibroblast models, Bosutinib demonstrated inhibition of phosphorylation of Src kinase targets Lyn and Hck at concentrations as low as 50 nmol/L. Based on the favorable pharmacokinetic profiles observed in the phase I solid tumor study with bosutinib (Lombardo et al, 2004), a phase I/II study in patients with CML who had a failed response to imatinib has been initiated with a starting dose of 400 mg once daily.
References Abdel-Ghany M, Cheng HC, Elble RC, Pauli BU (2002) Focal adhesion kinase activated by !(4)integrin ligation to mCLCA1 mediates early metastatic growth. J Biol Chem 277, 34391-34400. Acconcia F, Barnes CJ, Kumar R (2006) Estrogen and tamoxifen induce cytoskeletal remodeling and migration in endometrial cancer cells. Endocrinology 147, 1203-1712. Aixinjueluo W, Furukawa K, Zhang Q (2005) Mechanisms for the apoptosis of small cell lung cancer cells induced by antiGD2 monoclonal antibodies: roles of anoikis. J Biol Chem 280, 29828-29836. Almeida EA, Ili& D, Han Q, Hauck CR, Jin F, Kawakatsu H, Schlaepfer DD, Damsky CH (2000) Matrix survival signaling: from fi bronectin via focal adhesion kinase to cJun NH(2)-terminal kinase. J Cell Biol 149, 741-754. Bartholomew PJ, Vinci JM, Depasquale JA (1998) Decreased tyrosine phosphorylation of focal adhesion kinase after estradiol treatment of MCF-7 human breast carcinoma cells. J Steroid Biochemv Mol Biol 67, 241-249. Biscardi JS, Belsches AP, Parsons SJ (1998) Characterization of human epidermal growth factor receptor and c-Src interactions in human breast tumor cells. Mol Carcinog 4, 261-272. Brown MC, Cary LA, Jamieson JS, Cooper JA, Turner CE (2005) C-src and FAK kinases cooperate to phosphorylate paxillin kinase linker, stimulate its focal adhesion localization and regulate cell spreading and protrusiveness. Mol Biol Cell 19, 4316-4328. Brown MT, Cooper JA (1996) Regulation, substrates, and functions of c-src. Biochim Biophys Acta 1287, 121-49. Brunton VG, Avizienyte E, Fincham VJ, Serrels B, Metcalf CA 3rd, Sawyer TK, Frame MC (2005) Identification of Srcspecific phosphorylation site on focal adhesion kinase: dissection of the role of Src SH2 and catalytic functions and their consequences for tumor cell behavior. Cancer Res 65, 1335-1342. Bruton VG, MacPherson IRJ, Frame MC (2004) Cell adhesion receptors, tyrosine kinases and actin modulators: a complex three-way circuitry. Biochim Biophys Acta 1692, 121-144. Bryant P, Zheng Q, Pumiglia K (2006) Focal adhesion kinase controls cellular levels of p27/Kip1 and p21/Cip1 through Skp2-dependent and-independent mechanisms. Mol Cell Biol 26, 4201-4213. Burgaya F, Girault JA (1996) Cloning of focal adhesion kinase, pp125FAK, from rat brain reveals multiple transcripts with different patterns of expression. Brain Res Mol Brain Res 37, 63-73. Burgaya F, Toutant M, Studler JM, Costa A, Le Bert M, Gelman M, Girault JA (1997) Alternatively spliced focal adhesion
V. Conclusions The combined inhibition of FAK and c-src is a promising strategy; mainly in the metastases prevention strategy however, it remains difficult to assess the efficacy of anti-metastatic agents in the clinical setting. Such agents are likely to be maximally effective in patients with preinvasive disease or patients with surgically resected localized disease or oligo-metastatic disease, who are at high risk of recurrent disease due to the presence of micrometastases. New surrogate end points should be established for these new agents, due to its mechanism of action. Measuring only tumor size, like is done for conventional agents, may be not appropriate for agents that inhibit cell invasion and spread in the setting of micro-metastatic disease, where there is no radiologically detectable measurable or evaluable disease. However, the hope is that with the use of more sophisticated imaging technologies that allow visualization of tumour cells at the leading margins of tumours in both animals and humans and for the detection of micro-metastases that in time strategies will be developed to prevent tumour spread. Furthermore, the identification of validated biomarkers to
209
Blesa et al: Considering SRC-ABL as a promising therapeutic target in cancer kinase in rat brain with increased autophosphorylation activity. J Biol Chem 272, 28720-28725. Calalb MB, Polte TR, Hanks SK (1995) Tyrosine phosphorylation of focal adhesion kinase at sites in the catalytic domain regulates kinase activity: a role for Src family kinases. Mol Cell Biol 1 5, 954-963. Cary LA, Guan JL (1999) Focal adhesion kinase in integrinmediated signaling.Front. Biosci 4, D102-D113. Cascone I, Napione L, Maniero F, Serini G, Bussolino F (2005) Stable interaction between alpha5beta1 integrin and Tie2 tyrosine kinase receptor regulates endothelial cell response to Ang-1. J Cell Biol 170, 993-1004. Castoria G, Barone MV, Di Domenico M, Bilancio A, Ametrano D, Migliaccio A, Auricchio F (1999) Non-transcriptional action of oestradiol and progestin triggers DNA synthesis. EMBO J 18, 2500-2510. Chang F, Lemmon CA, Park D, Romer LH (2007) FAK potentiates Rac1 activation and localization to Matrix Adhesion Sites: a role for {!}PIX. Mol Biol Cell 18, 253264. Chang YM, Bai L, Liu S, Yang JC, Kung HJ, Evans CP (2008) Src family kinase oncogenic potential and pathways in prostate cancer as revealed by AZD0530. Oncogene 27, 6365-6375. Chano T, Ikegawa S, Kontani K, Okabe H, Baldini N, Saeki Y (2002) Identification of RB1CC1, a novel human gene that can induce RB1 in various human cells. Oncogene 21, 12951298. Chen QY, Wang CY, Wu HS, Chen DD (2005) Exogenous PTEN gene induces apoptosis in breast cancer cells. Zhonghua Yi Xue Za Zhi 85, 33-36. Chen R, Kim O, Li M, Xiong X, Guan JL, Kung HJ, Chen H, Shimizu Y, Qiu Y (2001) Regulation of the PH-domaincontainingtyrosine kinase Etk by focal adhesion kinasethrough the FERM domain. Nat Cell Biol 3, 439-444. Chen Y, Wang SM, Wu JC, Huang SH (2006) Effects of PPAR % agonists on cell survival and focal adhesions in a Chinese thyroid carcinoma cell line. J Cell Biochem 98, 1021-1035. Chiorean MV, Guicciardi ME, Yoon JH, Bronk SF, Kaufmanns SH, Gores GJ (2004) Imatinib mesylate induces apoptosis in human cholangiocarcinoma cells. Liver Int 24, 687-695. Coluccia AM, Cirulli T, Neri P, Mangieri D, Colanardi MC, Gnoni A, Di Renzo N, Dammacco F, Tassone P, Ribatti D, Gambacorti-Passerini C, Vacca A (2008) Validation of PDGFR! and c-Src tyrosine kinases as tumor/vessel targets in patients with multiple myeloma: preclinical efficacy of the novel, orally available inhibitor dasatinib. Blood 112, 134656. Cooper LA, Shen TL, Guan JL (2003) Regulation of focal adhesion kinase by its amino-terminal domain through an autoinhibitory interaction. Mol Cell Biol 23, 8030-8041. Cowell LN, Graham JD, Bouton AH, Clarke CL, O'Neill GM (2006) Tamoxifen treatment promotes phosphorylation of the adhesion molecules, p130Cas/BCAR1, FAK and Src, via an adhesion-dependent pathway. Oncogene 25, 7597-7607. Cox BD, Natarajan M, Stettner MR, Gladson CL (2006) New conceptsregarding focal adhesion kinase promotionof cell migration and proliferation.J. Cell Biochem 99, 35-52. Duxbury MS, Ito H, Benoit E, Zinner MJ, Ashley SW, Whang EE (2003) RNA interference targeting focal adhesion kinase enhances pancreatic adenocarcinoma gemcitabine chemosensitivity. Biochem Biophys Res Commun 311, 786-792. Duxbury MS, Ito H, Zinner MJ, Ashley SW, Whang EE (2004) Focal adhesion kinase gene silencing promotes anoikis and suppresses metastasis of human pancreatic adenocarcinoma cells. Surgery 135, 555-562.
Earley S, Plopper E (2006) Disruption of focal adhesion kinase slows transendothelial migration of AU-565 breast cancer cells. Biochem Biophys Res Commun 350, 405-412. Eliceiri BP, Paul R, Schwartzberg PL, Hood JD, Leng J, Cheresh DA (1999) Selective requirement for C-src kinases during VEGF-induced angiogenesis and vascular permeability. Mol Cell 4, 915-924. Fang Y, Fang X, Wang L (2001) Influence of focal adhesion kinase (FAK) on the biological behaviors of human hepatocellular carcinoma cells. Zhonghua Zhong Liu Za Zhi 23, 125-127. Fang Y, Wang L, Jin J, Zha X (2001) Focal adhesion kinase affects the sensitivity of human hepatocellular carcinoma cell line SMMC-7721 to TNF- $ /cycloheximide-induced apoptosis by regulating protein kinase B levels. Eur J Biochem 268, 4513-4519. Frisch SM, Vuori K, Ruoslahti E, Chan-Hui PY (1996) Control of adhesion-dependent cell survival by focal adhesion kinase. J Cell Biol 134, 793-799. Gaben AM, Saucier C, Bedin M, Redeuilh G, Mester J (2004) Mitogenic activity of estrogens in human breast cancer cells does not rely on direct induction of mitogen-activated protein kinase/extracellularly regulated kinase or phosphatidylinositol 3-kinase. Mol Endocrinol 18, 27002713. Garces CA, Kurenova EV, Golubovskaya VM, Cance WG (2006) Vascular endothelial growth FAKtor receptor-3 and focal adhesion kinase bind and suppress apoptosis in breast cancer cells. Cancer Res 66, 1446-1454. Gautam A, Li ZR, Bepler G (2003) RRM1-induced metastasis suppression through PTEN-regulated pathways. Oncogene 22, 2135-2142. Golas JM, Arndt K, Etienne C, Lucas J, Nardin D, Gibbons J, Frost P, Ye F, Boschelli DH, Boschelli F (2003) SKI-606, a 4-anilino-3- quinolinecarbonitrile dual inhibitor ofSrc and Abl kinases, is a potent antiproliferative agent against chronic myelogenous leukemia cells in culture and causes regression ofK562 xenografts in nude mice. Cancer Res 63, 375-381. Golas JM, Lucas J, Etienne C, Golas J, Discafani C, Sridharan L, Boghaert E, Arndt K, Ye F, Boschelli DH, Li F, Titsch C, Huselton C, Chaudhary I, Boschelli F (2005) SKI-606, a Src/Abl inhibitor with in vivo activity in colon tumor xenograft models. Cancer Res 65, 5358-5364. Golubovskaya VM, Gross S, Kaur AS, Wilson RI, Xu LH, Yang XH, Cance WG (2003) Simultaneous inhibition of focal adhesion kinase and C-SRC enhances detachment and apoptosis in colon cancer cell lines. Mol Cancer Res 1, 755764. Groten T, Pierce AA, Huen AC, Schnaper HW (2005) 17 hEstradiol transiently disrupts adherens junctions in endothelial cells. FASEB J 19, 1368-1370. Gu J, Tamura M, Yamada KM (1998) Tumor suppressor PTEN inhibits integrin- and growth FAKtor-mediated mitogenactivated protein (MAP) kinase signaling pathways. J Cell Biol 143, 1375-1383. Gu Y, Chen JS, Zhou XD (2003) Inhibitory effects of antisense focal adhesion kinase oligodeoxynucleotides on the invasion of Bel 7402 hepatocellular carcinoma cells. Zhonghua Gan Zang Bing Za Zhi 11, 612-615. Guan GX, Jian HX, Lei DY, Lu HS, Zhang XF (2006) Construction of retroviral vector of p(125FAK) specifi c ribozyme genes and its effects on BGC-823 cells. World J Gastroenterol 12, 686-690. Guan JL (1997) Role of focal adhesion kinase inintegrin signaling. Int J Biochem Cell Biol 29, 1085-1096.
210
Cancer Therapy Vol 6, page Guan JL, Shalloway D (1992) Regulation of focal adhesionassociated protein tyrosine kinase by both cellular adhesion and oncogenic transformation. Nature 358, 690-692. Guo W, Giancotti FG (2004) Integrin signalling during tumour progression Nat Rev Mol Cell Biol 10, 816-826. Haier J, Nicolson GL (2002) PTEN regulates tumor cell adhesion of colon carcinoma cells under dynamic conditions of fluid flow. Oncogene 21, 1450-1460. Halder J, Kamat AA, Landen CN Jr, Han LY, Lutgendorf SK, Lin YG, Merritt WM, Jennings NB, Chavez-Reyes A, Coleman RL, Gershenson DM, Schmandt R, Cole SW, Lopez-Berestein G, Sood AK (2006) Focal adhesi贸n kinase targeting using in vivo short interfering RNA delivery in neutral liposomes for ovarian carcinoma therapy. Clin Cancer Res 12, 4916-24. Han EK, Mcgonigal T, Wang J, Giranda VL, Luo Y (2004) Functional analysis of focal adhesion kinase (FAK) reduction by small inhibitory RNAs. Anticancer Res 24, 3899-3905. Hanada M, Tanaka K, Matsumoto Y, Nakatani F, Sakimura R, Matsunobu T, Li X, Okada T, Nakamura T, Takasaki M, Iwamoto Y (2005) Focal adhesion kinase is activated in invading fibrosarcoma cells and regulates metastasis. Clin Exp Metast 22, 485-494. Haskell H, Natarajan M, Hecker TP, Ding Q, Stewart J Jr, Grammer JR, Gladson CL (2003) Focal adhesion kinase is expressed in the angiogenic blood vessels of malignant astrocytic tumors in vivo and promotes capillary tube formation of brain microvascular endothelial cells. Clin Cancer Res 9, 2157-21565. Hauck CR, Hsia DA, Puente XS, Cheresh DA, Schlaepfer DD (2002) FRNK blocks v-C-src-stimulated invasion and experimental metastases without effects on cell motility or growth. EMBO J 21, 6289-62302. Herynk MH, Beyer AR, Cui Y, Weiss H, Anderson E, Green TP, Fuqua SA (2006) Cooperative action of tamoxifen and c-Src inhibition in preventing the growth of estrogen receptorpositive human breast cancer cells. Mol Cancer Ther 5, 3023-3031. Hess AR, Hendrix MJC (2006) Focal adhesion kinase signaling and the aggressive melanoma phenotype. Cell Cycle 5, 478480. Hess AR, Postovit LM, Margaryan NV, Seftor EA, Schneider GB, Seftor RE, Nickoloff BJ, Hendrix MJ (2005) Focal adhesion kinase promotes the aggressive melanoma phenotype. Cancer Res 65, 9851-9860. Hildebrand JD, Schaller MD, Parsons JT (1993) Identification of sequences required for the efficient localization of the focal adhesion kinase, pp125FAK, to cellular focal adhesions. J Cell Biol 123, 993-1005. Hiscox S, Jordan NJ, Morgan L, Green TP, Nicholson RI (2007) C-src kinase promotes adhesion-independent activation of FAK and enhances cellular migration in tamoxifen-resistant breast cancer cells. Clin Exp Metast 24, 157-167. Hiscox S, Jordan NJ, Smith C, James M, Morgan L, Taylor KM, Green TP, Nicholson RI (2008) Dual targeting of Src and ER prevents acquired antihormone resistance in breast cancer cells. Breast Cancer Res Treat Hiscox S, Morgan L, Green TP, Barrow D, Gee J, Nicholson RI (2006) Elevated C-src activity promotes cellular invasion and motility in tamoxifen resistant breast cancer cells. Breast Cancer Res Treat 97, 263-274. Hood JD, Frausto R, Kiosses WB, Schwartz MA, Cheresh DA (2003) Differential alphav integrin-mediated Ras-ERK signaling during two pathways of angiogenesis. J Cell Biol 162, 933-943. Hu B, Jarzynka MJ, Guo P, Imanishi Y, Schlaepfer DD, Cheng SY (2006) Angiopoietin 2 induces glioma cell invasionby stimulating matrix metalloprotease 2expression through the
$v!1 integrinand focal adhesion kinase signaling pathway. Cancer Res 66, 775-783. Huang YT, Lee LT, Lee PP, Lin YS, Lee MT (2005) Targeting of focal adhesion kinase by fl avonoids and small-interfering RNAs reduces tumor cell migration ability. Anticancer Res 25, 2017-2025. Huveneers S, Truong H, Danen HJ (2007) Integrins: signaling, disease, and therapy. Int J Radiat Biol 83, 743-751. Ili& D, Furuta Y, Kanazawa S, Takeda N, Sobue K, Nakatsuji N, Nomura S, Fujimoto J, Okada M, Yamamoto T (1995) Reduced cell motility and enhanced focal adhesion contact formation in cells from FAK-deficient mice. Nature 377, 539-544. Ischenko I, Camaj P, Seeliger H, Kleespies A, Guba M, De Toni EN, Schwarz B, Graeb C, Eichhorn ME, Jauch KW, Bruns CJ (2008) Inhibition of C-src tyrosine kinase reverts chemoresistance toward 5-fluorouracil in human pancreatic carcinoma cells: an involvement of epidermal growth factor receptor signaling. Oncogene 27, 7212-7222. Jallal H, Valentino ML, Chen G, Boschelli F, Ali S, Rabbani SA (2007) A Src/Abl kinase inhibitor, SKI-606, blocks breast cancer invasion, growth, and metastasis in vitro and in vivo. Cancer Res 67, 1580-1588. Jones G, Machado J Jr, Merlo A (2001) Loss of focal adhesion kinase (FAK) inhibits epidermal growth FAKtor receptordependent migration and induces aggregation of NH(2) terminal FAK in the nuclei of apoptotic glioblastoma cells. Cancer Res 61, 4978-4981. Jones G, Machado J Jr, Tolnay M, Merlo A (2001) PTENindependent induction of caspase-mediated cell death and reduced invasion by the focal adhesion targeting domain (FAT) in human astrocytic brain tumors which highly express focal adhesion kinase (FAK). Cancer Res 61, 56885691. kahashi R, Sonoda Y, Ichikawa D, Yoshida N, Eriko AY, Tadashi K. Y, Ichikawa (2007) Focal adhesion kinase determines the fate of death or survival of cells in response to TNFalpha in the presence of actinomycin D. Biochim Biophys Acta 1770, 518-526. Kato R, Ishikawa T, Kamiya S, Oguma F, Ueki M, Goto S, Nakamura H, Katayama T, Fukai F (2002) A new type of antimetastatic peptide derived from fibronectin. Clin Cancer Res 8, 2455-2462. Koppikar P, Choi SH, Egloff AM, Cai Q, Suzuki S, Freilino M, Nozawa H, Thomas SM, Gooding WE, Siegfried JM, Grandis JR (2008) Combined inhibition of c-Src and epidermal growth factor receptor abrogates growth and invasion of head and neck squamous cell carcinoma. Clin Cancer Res 14, 4284-4291. Kornberg LJ (2005) Adenovirus-mediated transfer of FRNK augments drug-induced cytotoxicity in cultured SCCHN cells. Anticancer Res 25, 4349-4356. Lacoste J, Aprikian AG, Chevalier S (2005) Focal adhesion kinase is required for bombesin-induced prostate cancer cell motility. Mol Cell Endocrinol 235, 51-61. Liu TJ, LaFortune T, Honda T, Ohmori O, Hatakeyama S, Meyer T, Jackson D, de Groot J, Yung WK (2007) Inhibition of both focal adhesion kinase and insulin-like growth FAKtor-I receptor kinase suppresses glioma proliferation in vitro and in vivo. Mol Cancer Ther 6, 1357-1367. Liu Y, Kyle E, Lieberman R, Crowell J, Kellof G, Bergan RC (2000) Focal adhesion kinase (FAK) phosphorylation is not required for genistein-induced FAK- !-1-integrin complex formation. Clin Exp Metast 18, 203-212. Lombardo LJ, Lee FY, Chen P, Norris D, Barrish JC, Behnia K,Castaneda S, Cornelius LA, Das J, Doweyko AM, Fairchild C,Hunt JT, Inigo I, Johnston K, Kamath A, Kan D, Klei H, MaratheP, Pang S, Peterson R, Pitt S, Schieven GL,
211
Blesa et al: Considering SRC-ABL as a promising therapeutic target in cancer Schmidt RJ,Tokarski J, Wen ML, Wityak J, Borzilleri RM (2004) Discoveryof N-(2-chloro-6-methyl-phenyl) -2-(6-(4(2-hydroxyethyl) -piperazin-1-yl) -2-methylpyrimidin-4ylamino) thiazole-5carboxamide (BMS-354825) , a dual Src/Abl kinase inhibitor with potentantitumor activity in preclinical assays. J Med Chem 47, 6658-6661. Macarulla T, Ramos FJ, Capdevila J, Saura C, Tabernero J (2006) Novel targets for anticancer treatment development in colorectal cancer. Clin Colorectal Cancer 6, 265-72. Manes S, Mira E ,Gomez -Mouton C, Zhao Zi,Lacalle RA, Martínez A C (1999) Concerted activity of tyrosine phosphataseSHP-2 and focal adhesion kinase in regulation of cell motility. Mol Cell Biol 19, 3125-3135. Martin GS (2001) The hunting of the Src. Nat Rev Mol Cell Biol 2, 467-75. Matsumoto K, Matsumoto K, Nakamura T, Kramer RH (1994) Hepatocyte growth FAKtor/scatter FAKtor induces tyrosine phosphorylation of focal adhesion kinase (p125FAK) and promotes migration and invasion by oral squamous cell carcinoma cells. J Biol Chem 269, 31807-31813. Matthew H, Herynk MH, Beyer AR, Cui Y, Weiss H, Anderson E, Green TP, Fuqua SA (2006) Cooperative action of tamoxifen and c-Src inhibition in preventing the growth of estrogen receptor-positive human breast cancer cells. Mol Cancer Ther 5, 3023-31. McGarrigle D, Huang XY (2007) GPCRs signaling directly through Src-family kinases. Sci STKE 26, pe35. McLean GW, Brown K, Arbuckle MI, Wyke AW, Pikkarainen T, Ruoslahti E, Frame MC (2001) Decreased focal adhesion kinase suppresses papilloma formation during experimental mousev skin carcinogenesis. Cancer Res 61, 8385-8389. McLean GW, Carragher NO, Avizienyte E, Evans J, Brunton VG, Frame MC (2005) The role of focal-adhesion kinase in cancer? a new therapeutic opportunity. Nature Reviews Cancer 5, 505- 515. McLean GW, Komiyama NH, Serrels B, Asano H, Reynolds L, Conti F, Hodivala-Dilke K, Metzger D, Chambon P, Grant SG, Frame MC (2004) Specifi c deletion of focal adhesion kinase suppresses tumor formation and blocks malignant progression. Genes Dev 18, 2998-3003. Melkoumian ZK, Peng X, Gan B, Wu X, Guan JL (2005) Mechanism of cell cycle regulation by FIP200 in human breast cancer cells. Cancer Res 65, 6676-6684. Migliaccio A, Castoria G, Auricchio F (2007) Src-dependent signalling pathway regulation by sex-steroid hormones: therapeutic implications. Int J Biochem Cell Biol 39, 13431348. Miranti C, Brugge J (1999) Nat Cell biol 4:E83-E90, 2002. Prog Biophys Mol Biol 71, 435-78. Mitra SK, Schaepfer DD (2006) Integrin-regulated FAK-C-src signalingin normal and cancer cells. Curr OpinCell Biol 18, 516-523. Mon NN, Hasegawa H, Thant AA, Huang P, Tanimura Y, Senga T, Hamaguchi M (2006) A role for focal adhesion kinase signaling in TNF-$-dependent matrix metalloproteinase-9 production in a cholangiocarcinoma cell line, CCKS1. Cancer Res 66, 6778-6784. Mon NN, Ito S, Senga T, Hamaguchi M (2006) FAK signaling in neoplastic disorders: a linkage between inflammation and cancer. Ann N Y Acad Sci 1086, 199-212. Nakahara S, Miyoshi E, Noda K, Ihara S, Gu J, Honke K, Inohara H, Kubo T, Taniguchi N (2003) Involvement of oligosaccharide changes in $5!1 integrin in a cisplatinresistant human squamous cell carcinoma cell line. Mol Cancer Ther 2, 1207-1214. Nam S, Kim D, Cheng JQ, Zhang S, Lee JH, Buettner R, Mirosevich J, Lee FY, Jove R (2005) Action of the Src
family kinase inhibitor, dasatinib (BMS-354825) , on human prostate cancer cells. Cancer Res 65, 9185-9189. O'Hare T, Walters DK, Stoffregen EP, Jia T, Manley PW, Mestan J, Cowan-Jacob SW, Lee FY, Heinrich MC, Deininger MW, Druker BJ (2005) In vitro activity of BcrAbl inhibitors AMN107 and BMS-354825 against clinically relevant imatinib-resistant Abl kinase domain mutants. Cancer Res 65, 4500-4505. Owen JD, Ruest PJ, Fry DW, Hanks SK (1999) Induced focal adhesion kinase (FAK) expression in FAK-null cells enhances cell spreading and migration requiring both. Mol Cell Biol 19, 4806-4818. Planas-Silva MD, Bruggeman RD, Grenko RT, Stanley Smith J (2006) Role of c-C-src and focal adhesion kinase in progression and metastasis of estrogen receptor-positive breast cancer. Biochem Biophys Res Commun 341, 73-81. Plé PA, Green TP, Hennequin LF, Curwen J, Fennell M, Allen J, Lambert-Van Der Brempt C, Costello G (2004) Discovery of a newclass of anilinoquinazoline inhibitors with high affinity and specificity for the tyrosine kinase domain of c-Src. J Med Chem 47, 871-887. Provenzano PP, Inman DR, Eliceiri KW, Beggs HE, Keely PJ (2008) Mammary epithelial-specific disruption of focal adhesion kinase retards tumor formation and metastasis in a transgenic mouse model of human breast cancer. Am J Pathol 173, 1551-1565. Rásó E, Tóvári J, Ladányi A, Varga N, Tímár J (2005) Ligandmimetic anti- $ IIb ! 3 antibody PAC-1 inhibits tyrosine signaling, proliferation and lung colonization ofv melanoma cells. Pathol Oncol Res 11, 218-223. Recher C, Ysebaert L, Beyne-Rauzy O, Mansat-De Mas V, Ruidavets JB, Cariven P, Demur C, Payrastre B, Laurent G, Racaud-Sultan C (2004) : Expression of focal adhesion kinase in acute myeloid leukemia is associated with enhanced blast migration, increased cellularity, and poor prognosis. Cancer Res 64, 3191-3197. Roodman GD (2004) Mechanisms of bone metastasis. N Engl J Med 350, 1655-1664. Schaller MD, Borgman CA, Cobb BS, Vines RR, Reynolds AB, Parsons JT (1992) pp125 FAK a structurally distinctive protein-tyrosine kinase associated with focal adhesions. Proc Natl Acad Sci USA 89, 5192-5196. Schaller MD, Borgman CA, Parsons JT (1993) Autonomous expression of a noncatalytic domain of the focal adhesionassociated protein tyrosine kinase pp125FAK. Mol Cell Biol 13, 785-791. Schaller MD, Parsons JT (1994) Focal adhesion kinase and associated proteins. Curr Opin Cell Biol 6, 705-710. Schlaepfer DD, Hauck CR,Stieg DJ (1999) Signaling through focala dhesion kinase. Prog Biophys Mol Biol 71, 435-478. Schlaepfer DD, Hunter T (1998) Integrins signaling and tyrosine hosphorylation: just the FAKs. Trends Cell Biol 8, 151-157. Schlaepfer DD, Mitra SK, ILIC D (2004) Control of motile and invasive cell phenotypes by focal adhesion kinase. Biochim Biophys Acta 1692, 77-102. Serrels A, Macpherson IR, Evans TR, Lee FY, Clark EA, Sansom OJ, Ashton GH, Frame MC, Brunton VG (2006) Identification of potential biomarkers for measuring inhibition of C-src kinase activity in colon cancer cells following treatment with dasatinib. Mol Cancer Ther 5, 3014-3022. Serrels B, Serrels A, Mason S, Baldeschi C, Ashton GH, Canel M, Mackintosh LJ, Doyle B, Green T, Frame MC, Sansom OJ, Brunton VG (2008) A novel Src kinase inhibitor reduces tumour formation in a skin carcinogenesis model. Carcinogenesis Shawhney RS, Cookson MM, Omar Y, Hauser J, Brattain MG (2006) Integrin $ 2-mediated ERKand calpain activation
212
Cancer Therapy Vol 6, page play a critical role incell adhesion and motility via focaladhesion kinase signaling: identification of a novel signaling pathway. J Biol Chem 281, 8497-8510. Sheta EA, Harding MA, Conaway MR, Theodorescu D (2000) Focal adhesion kinase, Rap1, and transcriptional inductionof vascular endothelial growth FAKtor.J. Natl Cancer Inst 92, 1065-1073. Shi Q, Hjelmeland AB, Keir ST, Song L, Wickman S, Jackson D, Ohmori O, Bigner DD, Friedman HS, Rich JN (2007) A novel low-molecular weight inhibitor of focal adhesion kinase, TAE226, inhibits glioma growth. Mol Carcinog 46, 488-496. Shibata K, Kikkawa F, Nawa A, Thant AA, Naruse K, Mizutani S, Hamaguchi M (1998) Both focal adhesion kinase and cRas are required for the enhanced matrix metalloproteinase 9 secretion by fi bronectin in ovarian cancer cells. Cancer Res 58, 900-903. Shintani S, Li C, Mihara M, Nakashiro K, Hamakawa H (2003) Gefi tinib (‘ Iressa ’) , an epidermal growth FAKtor receptor tyrosine kinase inhibitor, mediates the inhibition of lymph node metastasis in oral cancer cells. Cancer Lett 201, 149155. Siu LL, Burris HA, Mileshkin L (2007) Phase 1 study of a focal adhesion kinase (FAK) inhibitor PF-00562271 in patients (pts) with advanced solid tumors (Abst 3527). J Clin Oncol 25 No 18S (June 20 Supplement). Slack-Davis JK, Martin KH, Tilghman RW, Iwanicki M, Ung EJ, Autry C, Luzzio MJ, Cooper B, Kath JC, Roberts WG, Parsons JT (2007) Cellular characterization of a novel focal adhesion kinase inhibitor. J Biol Chem 282, 14845-14852. Smith CS, Golubovskaya VM, Peck E, Xu LH, Monia BP, Yang X, Cance WG (2005) Effect of focal adhesion kinase (FAK) down regulation with FAK antisense oligonucleotides and5fluorouracil on the viability of melanomacell lines. Melanoma Res 15, 357-362. Sood AK, Coffin JE, Schneider GB, Fletcher MS, DeYoung BR, Gruman LM, Gershenson DM, Schaller MD, Hendrix MJ (2004) Biological significance of focal adhesion kinase in ovarian cancer: role in migration and invasion. Am J Pathol 165, 1087-1095. Soriano P, Montgomery C, Geske R, Bradley A (1991) Targeted disruption of the c-src proto-oncogene leads to osteopetrosis in mice. Cell 64, 693-702. Tabernero J, Cervantes A, Hoekman K, Hurwitz HI, Jodrell DI, Hamberg P, Stuart M, Green TP, Iacona RB, Baselga J (2007) Phase I study of AZD0530, an oral potent inhibitor of C-src kinase: first demonstration of inhibition of C-src activity in human cancers. J Clin Oncol 25 No 18S (June 20 Supplement). Talpaz M, Shah NP, Kantarjian H, Donato N, Nicoll J, Paquette R, Cortes J, O'Brien S, Nicaise C, Bleickardt E, BlackwoodChirchir MA, Iyer V, Chen TT, Huang F, Decillis AP, Sawyers CL (2006) Dasatinib in imatinib resistant Philadelphia chromosome-positive leukemias (Abst 3520). N Engl J Med 354, 2531-2541. Tamura M, Gu J, Danen EH, Takino T, Miyamoto S, Yamada KM (1999) PTEN interactions with focal adhesion kinase and suppression of the extracellular matrix-dependent phosphatidylinositol 3-kinase/Akt cell survival pathway. J Biol Chem 274, 20693-20703. Tamura M, Gu J, Matsumoto K, Aota S, Parsons R, Yamada KM (1998) Inhibition of cell migration, spreading, and focal adhesions by tumor suppressor PTEN. Science 280, 16141617. Tamura M, Gu J, Takino T, Yamada KM (1999) Tumor suppressor PTEN inhibition of cell invasion, migration, and growth: differential involvement of focal adhesion kinase and p130Cas. Cancer Res 59, 442-449.
Tamura M, Gu J, Tran H, Yamada KM (1999) PTEN gene and integrin signaling in cancer. J Natl Cancer Inst 91, 18201828. Thamilselvan V, Basson MD (2004) Pressure activates colon cancer cell adhesion by inside-out focal adhesion complex and actin cytoskeletal signaling. Gastroenterology 126, 818. Thomas SM, Brugge JS (1997) Cellular functions regulated by C-src family kinases. Annu Rev Cell Dev Biol 13, 513-609. Tsai YT, Su YH, Fang SS, Huang TN, Qiu Y, Jou YS, Shih HM, Kung HJ, Chen RH (2000) Etk, a Btk family tyrosine kinase, mediatescellular transformation by linking C-src toSTAT3 activation. Mol Cell Biol 20, 2043-2054. V, Verkoeijen S, van Buren L, Burg D, van de Water B (2005) Requirement for focal adhesion kinase in the early phase of mammary adenocarcinoma lung metastasis formation. Cancer Res 65, 4698-4706. Vadlamudi RK, Adam L, Nguyen D, Santos M, Kumar R (2002) Differential regulation of components of the focaladhesion complex by heregulin: roleof phosphatase SHP-2. J Cell Physiol 190, 189-199. Van Nimwegen MJ, Van Dewater B (2007) Focal adhesion kinase:a potential target in cancer therapy.Biochem. Pharmacol 73, 597-609. Verbeek BS, Vroom TM, Adriaansen-Slot SS, Ottenhoff-Kalff AE, Geertzema JG, Hennipman A, Rijksen G (1996) c-C-src protein expression is increased in human breast cancer. An immunohistochemical and biochemical analysis. J Pathol 180, 383-388. Villedieu M, Deslandes E, Duval M, Héron JF, Gauduchon P, Poulain L (2006) Acquisition of chemoresistance following discontinuous exposures to cisplatin is associated in ovarian carcinoma cells with progressive alteration of FAK, ERK and p38 activationin response to treatment. Gynecol Oncol 101, 507-519. Vultur A, Buettner R, Kowolik C, Liang W, Smith D, Boschelli F, Jove R (2008) SKI-606 (bosutinib) , a novel Src kinase inhibitor, suppresses migration and invasion of human breast cancer cells. Mol Cancer Ther 7, 1185-1194. Wang FM, Liu HQ, Liu SR, Tang SP, Yang L, Feng GS (2005) SHP-2 promoting migration andmetastasis of MCF-7 with loss of E-cadherin, dephosphorylation ofFAK and secretion of MMP-9 inducedby IL-1! in vivo and in vitro.Breast Cancer Res. Treat 89, 5-14. Wang WJ, Kuo JC, Yao CC, Chen RH (2002) DAP-kinase induces apoptosis by suppressing integrin activity and disrupting matrix survival signals. J Cell Biol 159, 169-179. Westhoff MA, Serrels B, Fincham VJ, Frame MC, Carragher NO (2004) C-SRC-mediated phosphorylation of focal adhesion kinase couples actin and adhesion dynamics to survival signaling. Mol Cell Biol 24, 8113-8133. Wu ZM, Yuan XH, Jiang PC, Li ZQ, Wu T (2006) Antisense oligonucleodes targeting the focal adhesion kinase inhibit proliferation, induce apoptosis and cooperate with cytotoxic drugs in human glioma cells. J Neurooncol 77, 117-123. Xu LH, Yang X, Bradham CA, Brenner DA, Baldwin AS Jr, Craven RJ, Cance WG (2000) The focal adhesion kinase suppresses transformation-associated, anchorageindependent apoptosis in human breast cancer cells. Involvement of death receptor-related signaling pathways. J Biol Chem 275, 30597-30604. Yang J, Price MA, Neudauer CL, Wilson C, Ferrone S, Xia H, Iida J, Simpson MA, McCarthy JB (2004) Melanoma chondroitin sulfate proteoglycanbenhances FAK and ERK activation bydistinct mechanisms. J Cell Biol Yang ZF, Yi JL, Li XR, Xie DX, Liao XF, Ma X (2004) PTEN induces apoptosis and up-regulates p53 expression in HepG2 cells. Zhonghua Gan Zang Bing Za Zhi 12, 745-748.
213
Blesa et al: Considering SRC-ABL as a promising therapeutic target in cancer Yeatman TJ (2004) A renaissance for C-SRC. Nat Rev Cancer 4, 470-80. Yu HG, Tong SL, Ding YM, Ding J, Fang XM, Zhang XF, Liu ZJ, Zhou YH, Liu QS, Luo HS, Yu JP (2006) Enhanced expression of cholecystokinin-2 receptor promotes the progression of colon cancer through activation of focal adhesion kinase. Int J Cancer 119, 2724-2732. Zachary I (1997) Focal adhesion kinase.Int. J Biochem Cell Biol 29, 929-934. Zeng ZZ, Jia Y, Nathan J. Hahn NJ , Markwart SM, Korrene Rockwood KF, Livant DL (2006) Role of Focal Adhesion Kinase and Phosphatidylinositol 3'-Kinase in Integrin Fibronectin Receptor-Mediated, Matrix Metalloproteinase-1Dependent Invasion by Metastatic Prostate Cancer Cells. Cancer Res 66, 8091-8099. Zhang L, Yu Q, He J, Zha X (2004a) Study of the PTEN gene expression and FAK phosphorylation in human hepatocarcinoma tissues and cell lines. Mol Cell Biochem 262, 25-33. Zhang Y, Lu H, Dazin P, Kapila Y (2004b) Squamous cell carcinoma cell aggregates escape suspension-induced, p53mediated anoikis: fi bronectin and integrin $ v mediate survival signals through focaladhesion kinase. J Biol Chem 279, 48342-48349. Zhang Y, Thant AA, Hiraiwa Y, Naito Y, Sein TT, Sohara Y, Matsuda S, Hamaguchi M (2002) A role for focal adhesion kinase in hyluronan-dependent MMP-2 secretion in a human small-cell lung carcinoma cell line, QG90. Biochem Biophys Res Commun 290, 1123-1127.
Zheng DQ, Woodard AS, Fornaro M, Tallini G, Languino LR (1999) Prostatic carcinoma cell migration via $(v) ! 3 integrin iscmodulated by a focal adhesion kinase pathway. Cancer Res 59, 1655-1664.
Joan Manel Gasent Blesa
214
Cancer Therapy Vol 7, page 215 Cancer Therapy Vol 7, 215-218, 2009
Fulvestrant activity in the treatment of metastatic prostate cancer Case Report
Joan Manel Gasent Blesa1,*, Vicente Alberola Candel2, Enrique Grande Pulido1, Mariano Provencio Pulla3, Oscar Juan Vidal2 Medical Oncology Service, Hospital Marina Alta de Dénia, Alacant, Spain Medical Oncology Service, Hospital Arnau de Vilanova, València, Spain 3 Hospital Puerta de Hierro, Madrid, Spain 1 2
__________________________________________________________________________________ *Correspondence: Joan Manel Gasent Blesa MD Ph.D., Hospital de Dènia Marina Salud, Partida de Beniadlà, s/n. Denia. 03700, Alacant, Spain; Tel: +34 606311233; e-mail: joanmagasent@telefonica.net Key words: Fulvestrant, metastatic prostate cancer, Abbreviations: androgen independent PCa, (AIPCA); Estrogen receptor b, (ER-b); estrogen receptor, (ER); Insulin Growht Factor Receptor -1, (IGR-1); intramuscularly, (im); prostate cancer, (PCa) Received: 15 January 2009; Revised: 12 March 2009 Accepted: 16 March 2009; electronically published: 22 March 2009
Summary Metastatic prostate cancer is an incurable disease. After a period of hormone sensitivity, that allows for the use of antiandrogens, the disease invariably progress to a situation of androgen independent growth, which deserves the consideration or the use of chemotherapy. As many of these patients are elderly and fragile treatment with chemotherapy is challenging. Therefore, new drugs are required. Preclinical evidence supports the role of estrogen receptor (ER) signaling in prostate cancer. In this paper we report the first published evidence of PSA control in a patient with metastatic prostate cancer treated with fulvestrant acetate.
action is different from that of tamoxifen. In fact Fulvestrant is recommended for the treatment of ER positive metastatic breast cancer in postmenopausal women with disease progression following acquired tamoxifen resistance (Howell et al, 2002). Recently, interest in using estrogenic therapies for advanced PCa has reemerged, primarily in response to the published results (Ho, 2004). Estrogens alone, or in synergism with an androgen, are potent inducers of aberrant growth and neoplastic transformation in the prostate. The mechanisms of estrogen carcinogenicity could be mediated via induction of unscheduled cell proliferation or through metabolic activation of estrogens to genotoxic metabolites. Re-expression of ER-beta in metastatic PCa cells raises the possibility of using ER-!specific ligands in triggering cell death in these malignant cells (Ho, 2004). Estrogen receptor b (ER-b) is the predominant ER subtype expressed in normal basal epithelial cells of the prostate, in local PCa, and in PCa metastasized to the lymph nodes and bones (Leav et al, 2001). It has been showed that ER is expressed in abundance in most established PCa cell lines, including DU145, which we found to express only the ER-! subtype
I. Introduction In the United States, prostate cancer (PCa) is the second leading cause of cancer death in men. Approximately 50% of men with PCa have locally advanced or metastatic disease (Bott, 2004), and 30% of patients with apparent localized disease have biochemical relapse after the first line of treatment (Loberg et al, 2003). Androgen ablation therapy is the mainstay treatment for metastatic PCa (Taplin and Ho, 2001), However most neoplasms ultimately become androgen-refractory, at which time virtually no effective therapies are available” Docetaxel is an effective treatment option (Tannock et al, 2004), but the treatment with chemotherapy is challenging for elderly and fragile patients. Therefore, there is a strong demand for alternatives to the treatment of androgen independent PCa (AIPCA). Fulvestrant belongs to the SERD class of estrogen receptor (ER) antagonists and has shown no estrogenagonist activity in either preclinical or clinical studies (Osborne et al, 1995; Nuttall et al, 2005). Fulvestrant binds competitively to the ER, inhibits receptor dimerization (Fawell et al, 1990), and reduces the receptor’s half-life by increasing protein turnover (Dauvois et al, 1992). Thus, fulvestrant’s mechanism of
215
Blesa et al: Fulvestrant activity in the treatment of metastatic prostate cancer reduced to 15 ng/ml. In January 2005 the PSA level raised up to 67 ng/ml, subsequently, GA was discontinued and the daily dose of bicalutamide was increased to 150 mg. In May 2005 the PSA level reached the level of 120 ng/ml, and the patient began to suffer from bone pain. Bicalutamide was stopped and the patient began treatment with 280 mg of oral Estramustine phosphate. In June 2005 the patient was sent to the Oncology Department. The PSA at that moment was of 128.6 ng/ml. We offered him the possibility of beginning chemotherapy with Docetaxel 75 mg/m2 every three weeks, and oral prednisone 5 mg twice daily. He completed 9 cycles of chemotherapy. The PSA after 9 cycles was 12 ng/ml, the bone pain disappeared, and no medication was required for pain control any more. The patient, who was a mountain-climber, was able to maintain his physical activity. In March 2006 the PSA level increased up to 67 ng/ml and the osteo arthralgias reappeared. We reinitiated chemotherapy with Docetaxel-Prednisone at the same dose level, but after 6 cycles the PSA raised to 152 ng/ml without any symptomatic improvement. At that point, we decided to offer second line chemotherapy with a combination of Doxorubicin 20 mg/m2, as a 24-h intravenous infusion on the first day of every week in combination with ketoconazole 400 mg orally thrice daily for 7 days. In weeks 2, 4, and 6, treatment consisted of vinblastine 4 mg/m2 intravenously on the first day of every week in combination with estramustine 140 mg orally thrice daily for 7 days and maintenance on 30 mg hydrocortisone (Tu et al, 2001). The PSA level at the moment of the first cycle was 156 ng/ml. After 3 cycles it descended to 6,7 ng/ml. The patient was then considered in biochemical response. Surprisingly, one month later the PSA level went up to 109 ng/ml and 129 ng/ml in two separated determinations. Due to his good clinical status, we offered chemotherapy under compassionate use, by means of a combination of Oxaliplatin and Capecitabine, as we were doing in a phase II clinical trial, where we were observing interesting responses. The patient completed 4 cycles without achieving any PSA reduction, and presenting with increasing generalized bone pain, that required support with paracetamol and tramadol. After discussing with the patient the potential alternatives and expectancies, we began treatment with oral Vinorelbine 60mg/m2 in January 2007. After three cycles the treatment was discontinued due to PSA increase up to 998 ng/ml. At that point, we suspended the chemotherapy and began treatment with oral Ciproterone Acetate 50 mg every 8 hours. This treatment kept the PSA stable until June 2008, when the PSA level reached the level of 1608 ng/ml, after a first increase of 1261 ng/ml one month before. At that moment, we decided to request authorization to the Spanish Health Authorities, for treatment with fulvestrant under compassionate use. When the authorization was received we began treatment with a loading dose strategy, namely 500 mg intramuscularly (im) every two weeks during the first month, and 250 mg im monthly thereafter. This strategy followsthe CONFIRM study, as a dose-response existence is supposed for fulvestrant (Robertson et al, 2001; Gutteridge et al, 2004). The first dose was administered in June 2008. After first month completion, the PSA level felt to 1268 ng/ml, then to 1157ng /ml at the second monthly control, 858 ng/ml at the third and 653 mg/ml at the fourth (Figure 1). The patient has also diminished his analgesia requirements. The main side effect was grade two asthenia, according to the National Cancer Institute Common Toxicity Criteria (NCI common toxcicity criteria).
of ER (Lau et al, 2000; Mobley et al, 2004). Collectively, these data suggest that ER-b may confer survival advantages to PCa cells. Thus, targeted activation or blockade of ER-b action with selective ligands may present an attractive strategy for the therapeutic intervention of PCa. It has been reported cell growth inhibition of the DU 145 prostate cancer cell line by the effect of Fulvestrant by an ER-!-dependent mechanism (Lau et al, 2000). Androgen receptor (AR) expression is retained in a significant proportion of AIPC (Santos et al, 2004; Culig and Bartsch, 2006). AR seems to be a key protein involved in many cases of AR-dependent PCa and is critical for promoting prostate cancer cell growth. AR expression increases after chronic androgen ablation in vitro. In several xenografts, AR upregulation is the most consistent change identified during progression towards therapy resistance. In contrast, the AR pathway may be by-passed during chronic treatment with a nonsteroidal antiandrogen. AR sensitivity in prostate cancer increases as a result of activation of the Ras/mitogen-activated protein kinase pathway (Santos et al, 2004; Culig and Bartsch, 2006). One of the major difficulties in endocrine therapy for prostate cancer is acquisition of agonistic properties of AR antagonists observed in the presence of mutated AR Therefore, targeting the AR for down-regulation or degradation could be a useful approach for decreasing ARdependent prostate cancer cell growth and for treating AIPC (Scher et al, 2004). The group of Bhattacharyya published interesting results treating prostate cancer cell lines with Fulvestrant. After 6 days of Fulvestrant treatment, a 70% growth inhibition was seen in androgen-stimulated LNCaP cells, showing that Fulvestrant is a potent AR downregulator that can produce significant inhibition of prostate cancer cell growth and suggesting an strategy for treating prostate cancer with Fulvestrant (Rumi et al, 2006). Very interesting results about the potential utility of the combined inhibition of the Insulin Growht Factor Receptor -1 (IGR-1) with the association of Fulvestrant and Finasteride, in mouse models, have also been published (Huynh et al, 2001). A phase II trial was recently published with the use of Fulvestrant in castration resistant prostate cancer patients, and no evidence of activity was detected (Chadha et al, 2008).
II. Clinical case A 80 years old male patient was diagnosed in July 2004, with a Gleason 6 Metastatic Prostate Cancer to the bones. Initially, he was treated with Gosereline Acetate 10.4 mg-Depot (GA) quarterly, and oral Bicalutamide 50 mg on a daily bases. He also received 8 Gy of palliative radiation to the Dorsal 1st-3rd vertebrae, because the bone metastases were producing posterior vertebral wall protrusion, and 4 mg of monthly intravenous
A. Zoledronic acid In our patient, the initial PSA level was of 254 ng/ml (<4ng/ml). After three months of treatment the PSA level was
216
Cancer Therapy Vol 7, page 217
Figure 1. PSA (ng/ml) dynamics.
III. Discussion
References
Treatment of AIPC is a current challenge in Oncology. Docetaxel based chemotherapy has demonstrated capacity for increasing overall survival in AIPC (Tannock et al, 2004), but, its side effects are relevant. Many of our patients are eldery and fragile men, with important co-morbidities. It is urgent to have new agents with new mechanisms of action available in the clinic for the management of metastatic PCa that do not bear a potentially high cost in terms of side effects for these patients. Fulvestrant is an interesting drug to be studied in this context, because of its novel mechanism of action and its low side effect profile. The present case report is, to the best of our knowledge, the first reported PSA response to Fulvestrant, in PCa. If we consider that our patient had received three lines of hormonal treatment and three lines of chemotherapy, the observed activity is exciting. Asthenia was the most important recorded side effect. This side effect does not follow the adverse effects reported by the group of Chadha and colleagues in 2008 in their phase II trial. This group did not describe any relevant toxicity in any of their recruited patients. It is possible that the fact that we used a loading dose strategy, and that our patient is a highly pretreated one, could explain these differences. So probably it seems reasonable to consider the existence of a potential relation between dose and response, when designing future trials with Fulvestrant in prostate cancer. Under the view of this reported activity we consider justified to continue with the investigation of Fulvestrant in patients with advanced PCa, and the inclusion of Fulvestrant in the design of future trials for the treatment of PCa. We are beginning to treat similar patientswith Fulvestramt, and we will communicate our results in future papers.
Bott SR (2004) Management of recurrent disease after radical prostatectomy. Prostate Cancer Prostatic Dis 7, 211-216. Chadha MK, Ashraf U, Lawrence D (2008) Phase II study of fulvestrant (faslodexÂŽ) in castration resistant prostate cancer. Prostate 68, 1461-1466. Culig Z, Bartsch G (2006) Androgen axis in prostate cancer. J Cell Biochem 99, 373-81. Dauvois S, Danielian PS, White R, Parker MG (1992) Antiestrogen ICI 164,384 reduces cellular estrogen receptor content by increasing its turnover. Proc Natl Acad Sci USA 89, 4037-4041. Fawell SE, White R, HoareS, Sydenham M, Page M, Parker MG (1990) Inhibition of estrogen receptor-DNA binding by the "pure" antiestrogen ICI 164,384 appears to be mediated by impaired receptor dimerization. Proc Natl Acad Sci USA 87, 6883-6887. Gutteridge E, Robertson JFR, Cheung KL, Pinder S, Ellis IO, Wakeling AE (2004) Effects of fulvestrant on estrogen receptor levels during long-term treatment of patients with advanced breast cancer â&#x20AC;&#x201C; final results (Abst 4086). Breast Cancer Res Treat 88(Suppl 1), S177. Ho SM (2004) Estrogens and anti-estrogens: key mediators of prostate carcinogenesis and new therapeutic candidates. J Cell Biochem 91, 491-503. Howell A, Robertson JF, Quaresma Albano J, Aschermannova A, Mauriac L, Kleeberg UR, Vergote I, Erikstein B, Webster A, Morris C (2002) Fulvestrant, formerly ICI 182,780, is as effective as anastrozole in postmenopausal women with advanced breast cancer progressing after prior endocrine treatment. J Clin Oncol 20, 3396-3403 Huynh H, Alpert L, Alaoui-Jamali MA, Chan TWM (2001) Coadministration of finasteride and the pure anti-oestrogen ICI 182,780 act synergistically in modulating the IGF system in rat prostate. J Endocrinol 171, 109-118 Lau KM, LaSpina M, Long J, Ho SM (2000) Expression of estrogen receptor (ER)-alpha and ER-beta in normal and malignant prostatic epithelial cells: regulation by methylation and involvement in growth regulation. Cancer Res 60, 31753182. Leav I, Lau KM, Adams JY, McNeal JE, Taplin ME, Wang J, Singh H, Ho SM (2001) Comparative studies of the estrogen receptors beta and alpha and the androgen receptor in normal human prostate glands, dysplasia, and in primary and metastatic carcinoma. Am J Pathol 159, 79-92.
217
Blesa et al: Fulvestrant activity in the treatment of metastatic prostate cancer Loberg RD, Fielhauer JR, Pienta BA, Dresden S, Christmas P, Kalikin LM, Olson KB, Pienta KJ (2003) Prostate-specific antigen doubling time and survival in patients with advanced metastatic prostate cancer. Urology 62 (Suppl 1), 128-133. Mobley JA, Lâ&#x20AC;&#x2122;Esperance JO, Wu M, Friel CJ, Hanson RH, Ho SM (2004) The novel estrogen 17alpha-20Z-21-[(4amino)phenyl]-19-norpregna1,3,5(10),20-tetraene3,17beta-diol induces apoptosis in prostate cancer cell lines at nanomolar concentrations in vitro. Mol Cancer Ther 3, 587-595. National Cancer Institute (NCI) Common Toxicity Criteria Versions 3. Nuttall ME, Pendrak I, Emery JG, Nadeau DP, Fisher PW, Nicholson TA, Zhu Y, Suva LJ, Kingsbury WD, Gowen M (2001) Antagonism of oestrogen action in human breast and endometrial cells in vitro: potential novel antitumour agents. Cancer Chemother Pharmacol 47, 437-443. Osborne CK, Coronado-Heinsohn EB, Hilsenbeck SG, McCue BL, Wakeling AE, McClelland RA, Manning DL, Nicholson RI (1995) Comparison of the effects of a pure steroidal antiestrogen with those of tamoxifen in a model of human breast cancer. J Natl Cancer Inst 87, 746-750. Robertson JF, Nicholson RI, Bundred NJ, Anderson E, Rayter Z, Dowsett M, Fox JN, Gee JM, Webster A, Wakeling AE, Morris C, Dixon M (2001) Comparison of the short-term biological effects of 7alpha-[9-(4,4,5,5,5pentafluoropentylsulfinyl)- nonyl]estra-1,3,5, (10)-triene3,17 beta-diol (Faslodex) versus tamoxifen in postmenopausal women with primary breast cancer. Cancer Res 61, 6739-6746. Rumi S, Bhattacharyya R, Aruna V, Krishnan AV, Swami S, Feldman D (2006) Fulvestrant (ICI 182,780) down-regulates androgenreceptor expression and diminishes androgenicresponses in LNCaP human prostate cancer cells. Mol Cancer Ther 5, 1539-1549. Santos AF, Huang H, Tindall DJ (2004) The androgen receptor: a potential target for therapy of prostate cancer. Steroids 69, 79-85. Scher HI, Buchanan G, Gerald W, Butler LM, Tilley WD (2004) Targeting the androgen receptor: improving outcomes for
castration-resistant prostate cancer. Endocr Relat Cancer 11, 459-476. Tannock IF, de Wit R, Berry WR, Horti J, Pluzanska A, Chi KN, Oudard S, ThĂŠodore C, James ND, Turesson I, Rosenthal MA, Eisenberger MA (2004) Docetaxel plus Prednisone or Mitoxantrone plus Prednisone for Advanced Prostate Cancer. NEJM 351, 1502-1512 Taplin ME and Ho SM (2001) Clinical review 134: the endocrinology of prostate cancer. J Clin Endocrinol Metab 86, 3467-3477. Tu SM, Millikan RE, Mengistu B, Delpassand ES, Amato RJ, Pagliaro LC, Daliani D, Papandreou CN, Smith TL, Kim J, Podoloff DA, Logothetis CJ (2001) Bone-targeted therapy for advanced androgen-independent carcinoma of the prostate: a randomized phase II trial. Lancet 357, 336-41.
Joan Manel Gasent Blesa
218
Cancer Therapy Vol 7, page 219 Cancer Therapy Vol 7, 219-226, 2009
PML: An emerging tumor suppressor and a target with therapeutic potential Review Article
Erin L. Reineke, Hung-Ying Kao* Department of Biochemistry, School of Medicine, Case Western Reserve University (CWRU) and the Comprehensive Cancer Center of CWRU. 10900 Euclid Avenue, Cleveland, Ohio 44106, USA
__________________________________________________________________________________ *Correspondence: Hung-Ying Kao, Department of Biochemistry, School of Medicine, Case Western Reserve University (CASE) the Comprehensive Cancer Center of CASE. 10900 Euclid Avenue, Cleveland, Ohio 44106, USA; Tel: (216)368-1150; Fax: (216)368-3419; e-mail hxk43@cwru.edu Key words: Cancer, pathways by PML, therapy Abbreviations: Acute Promyelocytic Leukemia, (APL); casein kinase 2, (CK2); Fluorescence recovery after photobleaching, (FRAP); histone deacetlyase 7, (HDAC7); non-small cell lung carcinoma, (NSCLC); PML nuclear bodies, (PML NB); promyelocytic leukemia protein, (PML); retinoblastoma, (RB); RING/B box/coiled-coil, (RBCC); signal transducers and activators of transcription, (STATs) Received: 24 February 2009; Revised: 18 March 2009 Accepted: 30 March 2009; electronically published: April 2009
Summary Though originally discovered as a tumor suppressor in Acute Promyelocytic Leukemia (APL), the importance of promyelocytic leukemia protein (PML) in cancers of other origins has not been widely studied. Recent studies have shown that multiple types of cancers show decreased expression of PML protein, though the mechanisms leading to this down-regulation are unknown. Decreased expression of PML can result in loss of cell cycle control and prevention of apoptosis and is likely a key event in the promotion of oncogenesis. Many of these effects are due to changes in the transcriptional profile of the cell as a result of decreased size and number of PML nuclear bodies. Several mouse studies confirm the contribution of PML to oncogenesis and cancer progression. It is important to not only further define a role for PML as a tumor suppressor, but also to begin to develop strategies to target PML therapeutically.
apoptotic. For those tumor suppressors involved in a wide variety of cancers, it is worthwhile to develop treatments that can target their activities. Therefore, it is also important to identify other tumor suppressors that play a large role in many different cases of oncogenesis. This review focuses on the activities of the tumor suppressor PML and suggests that PML is one such tumor suppressor worth targeting in cancer therapy. PML was originally identified due to its involvement in a chromosomal translocation that causes the development of APL (de The et al, 1991). Since its discovery, studies have found that PML plays a role in many cellular processes including apoptosis, viral infection, transcriptional regulation, cell cycle regulation and DNA damage repair (Maul et al, 2000; Borden, 2002; Ching et al, 2005). The role of the PML translocation in APL provided the first indication that PML could act as a tumor suppressor and recent work has established this role for non-translocated PML. It has become clear that PML plays an extensive role in tumor suppression by promoting
I. Introduction Simply, cancer arises when normal cells grow out of control. There are numerous events that can lead to oncogenesis, ultimately involving activation of oncogenes, repression of tumor suppressor genes or both. Oncogenes often control cell division and differentiation. In cancer, oncogenes are expressed at times when they would not normally be present, leading to increased cell division and resistance to cell death. Conversely, tumor suppressor genes normally act to slow down cell division, repair DNA mistakes, and induce apoptosis. When these genes are mutated, leading to their inactivation, the gene product is either decreased or not functional, allowing the cell to divide uncontrollably and often leading to the development of cancer. In general, the protein product of a tumor suppressor gene is known as a tumor suppressor. While there are numerous tumor suppressors, some are more commonly inactivated than others. Notable tumor suppressors include Rb (retinoblastoma) which is involved in cell cycle regulation, p53 which is involved in DNA damage repair and apoptosis, and Pten which is anti-
219
Reineke and Kao: PML: An emerging tumor suppressor and a target with therapeutic potential apoptosis and inhibiting cell growth through multiple mechanisms.
(FRAP) experiments have shown that the PML in PML NBs exchanges between the nucleoplasm and PML NBs as well as between different PML NBs (Wiesmeijer et al, 2002). Furthermore, other proteins move in and out of the nuclear bodies in response to environmental stimuli. For example, many DNA repair and checkpoint proteins localize to PML NBs in response to UV damage (Dellaire and Bazett-Jones, 2004). As such, aberrant expression of PML may have profound effects on these cellular processes.
II. PML and PML NBs PML is a member of the RBCC/TRIM family of proteins due to its N-terminal RING/B box/coiled-coil (RBCC) domain (Jensen et al, 2001). This domain is important for protein-protein interactions and is required for many of the activities of PML. The PML transcript undergoes extensive processing and alternative splicing resulting in more than 11 different isoforms, that primarily vary at the C-terminus of the protein (Jensen et al, 2001). These isoforms carry out both redundant and nonredundant functions in the cell which complicates many of the cellular studies of this protein. Furthermore, while most isoforms include a nuclear localization sequence and are found in the nucleus, some isoforms exist in the cytoplasm and at least one isoform, PML1, can shuttle between the two subcellular compartments. Interestingly, the nuclear forms of PML are known to reside in subnuclear structures that are known as PML nuclear bodies (PML NB) (also known as ND10 and PODs). Research has shown that PML NBs are responsible for many PML functions. Furthermore, PML NBs are disrupted in APL (de The et al, 1991; Kakizuka et al, 1991; Dyck et al, 1994) and reform when APL cells are treated with drugs known to induce remission in APL patients. PML NBs have been proposed to act as cellular organizing centers for the coordinated regulation of different processes (Bernardi and Pandolfi, 2007). PML NBs range in size and number due to cell type, cell environment, and extracellular stimuli. More than 50 proteins are known to localize in PML NBs either constitutively or transiently. This varying composition is responsible for their involvement in so many cellular functions (Zhong et al, 2000; Buschbeck et al, 2007). For example, several proteins shuttle in and out of NBs in response to DNA damage including p53, ATR, MRE11, NBS1 and BLM (Dellaire and Bazett-Jones, 2004). In another case, proteins involved in the apoptotic pathways which localize in the NBs in response to cell-death signals include p53, Mdm2, Daxx, Bax, and p27Kip1 as well as many others (Hofmann and Will, 2003; Takahashi et al, 2004). The importance for PML in these subnuclear structures is highlighted by their absence in PML-/primary cells, which can be recovered with the expression of exogenous PML (Zhong et al, 2000; LallemandBreitenbach et al, 2001). As a result, it is thought that PML is essential for the formation and stability of PML NBs. PML NBs are associated with the nuclear matrix and at their periphery make contacts with chromatin fibers (Eskiw et al, 2004). These points of contact have been shown to be non-random in nature. The regions of the nucleus in which PML NBs are located are enriched in transcriptionally active genes; however, PML NBs have not been found to contain DNA themselves (Wang et al, 2004). The size, number, and position of PML NBs are not static, but change under normal and stress-induced conditions. Fluorescence recovery after photobleaching
III. Regulation of PML in cancer Traditionally, the silencing of tumor suppressor genes is thought to follow Knudsonâ&#x20AC;&#x2122;s two-hit hypothesis, meaning that two genetic mutations are required in the tumor suppressor gene, one in each allele. This is indeed the case for many cancer genes. However, recently, much work has described a new class of tumor suppressor genes that do not necessarily follow this classical definition (Paige, 2003). In fact, there are instances of haploinsufficient genes that only require mutation in one allele. Furthermore, epigenetic silencing has become important for many tumor suppressor genes, often due to hypermethylation of the tumor suppressor promoter (Paige, 2003). PML appears to belong, to the latest class of tumor suppressors, with regulation occurring mostly posttranslationally, making it a unique model in the growing list of tumor suppressor proteins. In addition to its disruption due to translocation in APL, loss of PML has been observed in many different types of cancer. An immunohistochemical analysis of tissue samples from tumors of several origins indicates that PML protein expression is abolished or greatly diminished in tumor cell lines derived from prostate adenocarcinomas, colon adenocarcinomas, breast carcinomas, lung carcinomas, lymphomas, CNS tumors (including medulloblastomas and oligodendroglial tumors), germ cell tumors, and non-Hodgkinâ&#x20AC;&#x2122;s lymphomas (Figure 1). Interestingly, there is no change in PML transcript levels in these tissues compared to their normal counterparts as assayed by in situ hybridization (Gurrieri et al, 2004). Furthermore, other studies have shown decreased PML in breast carcinomas, gastric cancer, small cell lung carcinomas, and invasive epithelial tumors (Koken et al, 1995; Gambacorta et al, 1996; Zhang et al, 2000; Lee et al, 2007). Lastly, in a few of these cancers, such as breast, prostate, and CNS tumors, loss of PML correlates with increased tumor grade (Gurrieri et al, 2004). These studies all highlight an important role for PML in tumor suppression; however, the mechanisms underlying the loss of PML are largely unknown. Despite this, there are examples of changes in PML in response to various stimuli, which may provide a hint as to the pathways by which PML expression is decreased in cancer cells. Furthermore, recent work in our laboratory has highlighted an important mechanism by which PML levels are controlled in the absence of extracellular stimuli. PML is known to be regulated by several distinct mechanisms. At the transcriptional level, PML gene expression can be up-regulated in response to a number of transducers and
220
Cancer Therapy Vol 7, page 221 controlled through the localization of PML as well as through multiple post-translational modifications. Cytoplasmic PML is capable of binding to nuclear isoforms of PML and sequestering the nuclear isoforms in the cytoplasm, thus controlling NB size and number (Bellodi et al, 2006a,b). Conversely, in response to TGF" signaling, cytoplasmic isoforms of PML can be transported and maintained in the nucleus, thereby disrupting interactions of nuclear isoforms of PML with downstream players of TGF" signaling such as Smads 2/3 and SARA (Lin et al, 2004). In the context of post-translational modifications, PML can be phosphorylated, sumoylated, acetylated, ubiquitinylated, and ISGylated (Kamitani et al, 1998; Duprez et al, 1999; Bernardi et al, 2004; Hayakawa and Privalsky, 2004; Scaglioni et al, 2006; Hayakawa et al, 2008; Lallemand-Breitenbach et al, 2008; Shah et al, 2008; Tatham et al, 2008; Weisshaar et al, 2008). All of these modifications control different aspects of PML function, either through changes in protein-protein interactions, localization, or stability. For example, sumoylation has been found to be integral for NB formation and is important for many of the contacts that PML makes with other proteins in the NB (Shen et al, 2006). In many instances sumoylation is coordinately controlled with phosphorylation of PML, leading to changes in PML function in response to many different signaling pathways. As mentioned previously, many of these modifications occur in response to specific extracellular stimuli, such as arsenic trioxide, which can promote phosphorylation of PML in an Erk2-dependent manner and which is required for the subsequent sumoylation of PML and its eventual degradation (Hayakawa and Privalsky, 2004). In order to understand how PML is down-regulated in tumors of multiple origins, it is important to understand the regulation of PML in the absence of extracellular stimuli. Our lab has shown that PML stability can be controlled through interactions with the peptidyl-prolyl cis-trans isomerase Pin1. Since Pin1 causes a change in the two-dimensional and ultimately three-dimensional structure of the proteins with which it associates, Pin1 can have dramatic effects on target protein stability. This is indeed the case for the interaction between PML and Pin1. The ability of PML to interact with Pin1 controls the steady-state levels of PML in the cell. Interestingly, this interaction is dependent on site-specific phosphorylation of PML and is blocked by PML sumoylation (Reineke et al, 2008). Furthermore, Pin1 expression has been found to be elevated in many different cancers (Wulf et al, 2003). Thus, this pathway could contribute to the decreased levels of PML protein observed in many tumors and is consistent with decreases in PML protein accumulation without parallel changes in mRNA accumulation. Due to the various stimuli that can control post-translational modifications of PML, this pathway may be utilized under several different circumstances to down regulate PML protein levels in cancer. In another study, we showed that PML protein and NB levels are up-regulated through the interaction of PML with HDAC7, which may present another mechanism by which PML accumulation can be
Figure 1. Incidence of Decreased PML in Cancer. PML has been found to be down-regulated in many cancer types. One recent study used tissue microarrays to study the incidence of decreased PML expression in many different human neoplasms (Gurrieri et al, 2004). Each type of neoplasm is depicted with a heat map of the percent of samples studied that showed a complete loss of PML expression. Light green indicates a lower incidence of loss of PML expression while dark green indicates a greater loss. Furthermore, PML was decreased, though not completely lost in: 31% of colon adenocarcinomas, 36% of lung adenocarcinomas, 63% of prostate adenocarcinomas, 21% of breast adenocarcinomas, 24% of CNS tumors, 36% of germ cell tumors, and 14% of lymphomas. An asterisk (*) indicates that a decreased PML expression has been observed for this type of neoplasia in an independent study.
activators of transcription (STATs) and other interferonstimulated transcription factors to bind to the PML promoter and stimulate PML mRNA transcription (Lavau et al, 1995; Stadler et al, 1995; Grotzinger et al, 1996; Heuser et al, 1998; Vannucchi et al, 2000; Dror et al, 2007; Kim et al, 2007). This can also be achieved through DNA damaging agents that promote p53 binding to the PML promoter (de Stanchina et al, 2004). Tumor necrosis factor ! treatment can also up-regulate PML mRNA expression through a currently uncharacterized mechanism that involves histone deacetlyase 7 (HDAC7) (Gao et al, 2008). As mentioned previously, at the mRNA level, PML is subject to alternative splicing which directly controls which PML isoforms exist under certain conditions or in different cell types (Jensen et al, 2001). Several isoforms have restricted subcellular localizations, cytoplasmic or nuclear. Post-translationally, the functions of PML are
221
Reineke and Kao: PML: An emerging tumor suppressor and a target with therapeutic potential altered in cancer (Gao et al, 2008). The events regulating PML in response to these interactions with Pin1 and HDAC7 still need to be investigated fully. Interestingly, other studies have shown that PML can be stabilized by proteosome inhibitors and undergoes ubitquitin-dependent degradation (Cao et al, 2008; Lallemand-Breitenbach et al, 2008; Scaglioni et al, 2008; Tatham et al, 2008; Weisshaar et al, 2008), which could likely play a role in Pin1 and HDAC7 control of PML. Perhaps the strongest evidence for the direct control of PML protein levels by another protein that is overexpressed during oncogenesis is the effects of casein kinase 2 (CK2) on PML. CK2 marks PML for ubiquitinmediated degradation through site-directed phosphorylation. Importantly, in non-small cell lung carcinoma (NSCLC), PML is often decreased while CK2 is over-expressed. To link the regulation of PML by CK2 to these PML expression changes, NCSLC cell lines and primary human NSCLC specimens were examined for PML protein levels and CK2 activity. As expected, there was a direct correlation between decreased PML protein and enhanced CK2 activity (Scaglioni et al, 2006, 2008). These data strongly implicates this pathway in the loss of PML during NCSLC. It remains to be determined if this also occurs in other types of cancer where CK2 is elevated, such as in mammary tumors and lymphomas. Taken together, these data suggest that there may be multiple important pathways for regulating PML protein levels, thus highlighting the importance of modulating PML protein levels and activity in oncogenesis. It is also likely that other oncogenic pathways target PML to promote tumor formation.
activity in cancer. Uncontrolled growth factor signaling eliminates the ability of PML to prevent too much cell growth, as it would in a normal cell. Interestingly, androgen has been shown to decrease protein levels of PML and therefore may utilize this pathway in some prostate cancers (Yang et al, 2004). In another study, it was shown that induction of PML is important for inhibition of cell growth in U87MG astrocyte cancer cells (Kim et al, 2007). Finally, several studies have indicated that overexpression of PML resulted in a decrease in the proliferation of several cancer cell lines which correlated with G1 arrest (Chan et al, 1997; Le et al, 1998; Son et al, 2005; Li et al, 2006). The ability of PML to block cell proliferation is intertwined with its ability to stimulate cell death. PML has been shown to be involved in both extrinsic and intrinsic cell death pathways and therefore acts downstream of a wide range of death-inducing stimuli (Bernardi et al, 2008). We have shown that PML expression sensitizes MDA-MB-231 breast cancer cells to hydrogen peroxide-induced cell death (Reineke et al, 2008). In other cases, PML promotes DNA damageinduced apoptosis (Bernardi et al, 2008). As mentioned previously, there is a significant change in NB protein composition in response to extracellular stimuli, including that of DNA-damaging agents which promote movement of p53 and caspase-2 to NBs (Tang et al, 2005; Bernardi et al, 2008). By concentrating in the NB, many of the proteins involved in the same cellular response, are brought into close proximity of each other, thus promoting an efficient response through protein-protein interactions and protein modifications. Recruitment of transcription factors to the NBs is particularly important. PML can affect transcription factor activity through direct interaction or the control of posttranslational modification and stability of transcription factors. These changes by PML can be stimulatory or inhibitory to transcriptional activity of each transcription factor. Furthermore, PML targets transcription factors from both tumor suppressor and oncogenic pathways. PML binding to p53 is important in controlling its tumor suppressive functions (Bernardi et al, 2008). PML is able to control the transcriptional competence of p53 through modulation of its acetylation by p300 and site-specific phosphorylation by HIPK2 (Ferbeyre et al, 2000; Pearson et al, 2000; Moller et al, 2003). Furthermore, PML can control the stability of p53 via several distinct mechanisms, including PML binding to Mdm2 to prevent the latterâ&#x20AC;&#x2122;s interaction and subsequent ubiquitination of p53 or by promoting de-ubiquitination of p53 by the ubiquitin protease HAUSP (Everett et al, 1997; Li et al, 2002; Bernardi et al, 2004). PML can also abrogate the interaction between Mdm2 and p53 through promotion of phosphorylation of p53 by CK1 and Chk2 (Louria-Hayon et al, 2003; Alsheich-Bartok et al, 2008). One family of transcription factors that has been shown to have both tumor-suppressive and oncogenic activity affected by PML is AP-1. c-Jun co-localizes with PML NBs in response to UV irradiation and the absence of PML interferes with the stimulation of the transcriptional activity of c-Jun by UV (Salomoni et al,
IV. Control of cancer-inducing pathways by PML As previously mentioned, PML and PML NBs are involved in a wide range of cellular processes. Interestingly, PML is able to act as a tumor suppressor through multiple mechanisms, controlling proteins involved in both the regulation of the cell cycle as well as apoptosis. This includes preventing cell cycle progression through interactions such as that with Rb and supporting apoptosis through NB proteins such as p53 and Daxx (Pearson and Pelicci, 2001; Takahashi et al, 2004). Thus, the down-regulation of PML can allow uncontrolled cell growth and oncogenesis. In general, in comparison to a normal cell, a cancer cell is characterized by uncontrolled growth accompanied by decreased cell death. Various studies indicate that PML is intimately involved in both of these processes. We have previously shown that a reduction of PML protein levels by siRNA leads to an increase in the proliferation of breast cancer cells. This can be modulated through the previously described interaction between PML and Pin1 (Reineke et al, 2008). Therefore, it is likely that agents known to induce Pin1 expression or activity will lead to decreased PML expression. One such class of agents is growth factors, which activate several pathways, at least one of which results in increased Pin1 (You et al, 2002), and thus likely decreased PML. While growth factors are required for normal cellular functions, many are over-expressed or their receptors show increased 222
Cancer Therapy Vol 7, page 223 2005). Furthermore, PML can be immunoprecipitated in an AP-1 complex and has been shown to control the transcriptional activity of another AP-1 member, c-Fos, which has also been suggested to play a role in the tumor suppressive activity of PML (Vallian et al, 1998). Other transcription factors implicated in oncogenesis that are known to associate with PML include NF-kappB and Myc. PML can bind to and sequester the RelA/p65 subunit of NF-!B in the NB, thereby preventing its binding to target promoters (Wu et al, 2003; Kuwayama et al, 2008). In turn, this prevents NF-!B from stimulating cell growth through the up-regulation of pro-survival genes such as survivin (LaCasse et al, 1998). Similarly, the transcriptional program of Myc has been shown to be altered in the absence of PML, though the mechanism of these changes is not well characterized (Cairo et al, 2005). In this manner, many of the contacts made within the NB are integral to the tumor suppressive functions of PML (Figure 2). Changes in the abundance of PML can cause changes in a wide variety of cellular genes through the sequestration or modification of transcription factors in the NB. These are lost in instances where PML is downregulated or NBs are disrupted, such as in APL.
playing a role in this regulation, evidence to link these events together through mouse models is not very abundant. There are, however, a few studies to support the idea of PML as a tumor suppressor in vivo and perhaps a regulator in oncogenesis. PML-/- mice develop normally, but are more prone to develop tumors induced by chemical insults than their wild type counterparts (Wang et al, 1998). Furthermore, the PML null animals are no longer protected by the ability of retinoic acid to inhibit tumor growth. Some of these effects are likely due to the loss of PML control of apoptotic pathways since the mice are unaffected by ionizing radiation and anti-Fas antibodies, two cell deathinducing treatments (Bernardi et al, 2008). Similarly, when PML -/- MEFs are integrated into nude mice, the mice grow larger fibrosarcomas and have increased tumor vascularization as compared to their wild type counterparts (Bernardi et al, 2006). These results provide evidence for a link between oncogenic pathways and PML. When PML -/- mice are crossed with Pten +/- mice, the resulting animals have increased polyp number and size in the colon, thus further suggesting a role of PML in tumor suppression (Trotman et al, 2006). This work also supports cross-talk between the Pten and PML pathways. PML has been shown to control Pten nuclear localization and its activity (Song et al, 2008). Furthermore, when PML -/-mice are crossed with a transgenic mutant model of K-
V. Evidence for a role of PML in cancer in vivo While PML protein levels are down-regulated in human tumors, and several pathways are implicated in
Figure 2. Loss of PML is an important step in tumorigenesis. Top panel: Under normal cellular conditions, multiple transcription factors associate with PML NBs and often PML itself. In the nuclear body (NB), many of these transcription factors are modified to enhance or inhibit their transcriptional activity. Under conditions of cellular insult, PML can stimulate transcription through proapoptotic transcription factors such as p53 by leading to its phosphorylation which promotes its transcriptional activity. Likewise, PML can sequester pro-survival transcription factors, such as NF!B, thus preventing it from activating its target genes. Bottom panel: When PML is decreased, as in the case of oncogenesis, there are smaller and fewer nuclear bodies. In this case, transcription factors such as p53 cannot be modified and therefore are prevented from promoting transcription while other transcription factors such as NF-!B are released. The net change of these transcription factor activities leads to the promotion of cell growth without the normal balance of cell death. In mice, this net change can lead to the formation of tumors.
223
Reineke and Kao: PML: An emerging tumor suppressor and a target with therapeutic potential RasG12D-induced non-small cell lung cancer, the mice show increased tumor burden coupled with an increased malignant phenotype (Scaglioni et al, 2006). These data support the idea that the loss of PML observed in lung tumors is an important step in lung cancer progression. Similarly, a cross of PML -/- mice with a mouse model for leukemia expressing a human capethespin G promoter driven- PML-RAR! APL translocation transgene, leads to increased tumor incidence and accelerated leukemia progression as compared to mice with PML (Rego et al, 2001). Finally, there is a previously characterized pathway whereby Ras induction of p53 is PML-dependent and required for Ras-induced senescence, another process linked to cancer incidence (Ferbeyre et al, 2000; Pearson et al, 2000). In contrast, there are examples where the loss of PML does not increase tumorigenesis. A cross of PML-/mice with the breast cancer model MMTV/neu transgenic mice had no effect (Rego et al, 2001). However, in the majority of cases, loss of PML plays an integral role in controlling the speed and magnitude of cancer progression. In comparison, overexpression of PML prevents cancer progression in a mouse model of skin carcinogenesis. Transgenic mice overexpressing PML in the epidermis and hair follicles showed decreased DMBAinduced papilloma number and size, as well as decreased progression from papilloma to carcinoma (Virador et al, 2008). Similarly, adenovirus-mediated over expression of PML in prostate cancer cell lines is able to prevent tumor growth when injected into nude-mice. Injection of adenovirus expressing PML into already established prostate-cancer cells did not prevent tumors in nude mice but decreased their growth by 64% (He et al, 1997). Overall, these in vivo studies suggest that targeting PML is a common target in oncogenesis and not just a side effect of the modulation of other proteins. Therefore we believe that PML warrants further investigation in carcinogenesis and may be an attractive target for therapeutics.
effects and increased efficacy. The existing cancer mouse models in which PML has been shown to effect cancer growth and progression provide a platform by which to test combinatorial treatments. For example, interferons, tumor necrosis factor alpha, DNA-damaging agents, apoptosis-inducing agents, and proteosome inhibitors are all agents that have been shown in cell culture to be able to up-regulate PML protein levels. It will be important to first validate the effects of these agents on PML in mouse models. Studies in this direction will perhaps lead to the development of new combinations of drugs that may not have previously been evident. There are many new cancer therapy targets and PML should be one of these targets. The work done by many since its discovery in APL clearly suggest that it plays a larger role in oncogenesis than originally expected.
Acknowledgements We thank Dr. Samols for his comments on the manuscript. Hung-Ying Kao is supported by NIH (DK078965), the Pardee Foundation, and the American Cancer Society.
References Alsheich-Bartok O, Haupt S, Alkalay-Snir I, Saito S, Appella E, Haupt Y (2008) PML enhances the regulation of p53 by CK1 in response to DNA damage. Oncogene 27, 3653-3661. Bellodi C, Kindle K, Bernassola F, Cossarizza A, Dinsdale D, Melino G, Heery D, Salomoni P (2006a) A cytoplasmic PML mutant inhibits p53 function. Cell Cycle 5, 2688-2692. Bellodi C, Kindle K, Bernassola F, Dinsdale D, Cossarizza A, Melino G, Heery D, Salomoni P (2006b) Cytoplasmic function of mutant promyelocytic leukemia (PML) and PML-retinoic acid receptor-alpha. J Biol Chem 281, 1446514473. Bernardi R, Guernah I, Jin D, Grisendi S, Alimonti A, TeruyaFeldstein J, Cordon-Cardo C, Simon MC, Rafii S, Pandolfi PP (2006) PML inhibits HIF-1alpha translation and neoangiogenesis through repression of mTOR. Nature 442, 779-785. Bernardi R, Pandolfi PP (2007) Structure, dynamics and functions of promyelocytic leukaemia nuclear bodies. Nat Rev Mol Cell Biol 8, 1006-1016. Bernardi R, Papa A, Pandolfi PP (2008) Regulation of apoptosis by PML and the PML-NBs. Oncogene 27, 6299-6312. Bernardi R, Scaglioni PP, Bergmann S, Horn HF, Vousden KH, Pandolfi PP (2004) PML regulates p53 stability by sequestering Mdm2 to the nucleolus. Nat Cell Biol 6, 665672. Borden KL (2002) Pondering the promyelocytic leukemia protein (PML) puzzle: possible functions for PML nuclear bodies. Mol Cell Biol 22, 5259-5269. Buschbeck M, Uribesalgo I, Ledl A, Gutierrez A, Minucci S, Muller S, Di Croce L (2007) PML4 induces differentiation by Myc destabilization. Oncogene 26, 3415-3422. Cairo S, De Falco F, Pizzo M, Salomoni P, Pandolfi PP, Meroni G (2005) PML interacts with Myc, and Myc target gene expression is altered in PML-null fibroblasts. Oncogene 24, 2195-2203. Cao X, Clavijo C, Li X, Lin HH, Chen Y, Shih HM, Ann DK (2008) SUMOylation of HMGA2: selective destabilization of promyelocytic leukemia protein via proteasome. Mol Cancer Ther 7, 923-934. Chan JY, Li L, Fan YH, Mu ZM, Zhang WW, Chang KS (1997) Cell-cycle regulation of DNA damage-induced expression of
VI. Controlling PML in therapy The literature contains many examples suggesting the importance of controlling PML activity and protein levels in oncogenesis. Many studies have aimed at determining how PML protein levels are down-regulated and the pathways by which PML is controlled. It is now time to begin to think about applying this information to the clinical setting. Future research will hopefully determine the cellular PML E3 ligases that may be pharmacologically targeted, or a specific modification of PML that stabilizes the protein under multiple conditions that may be manipulated. In the meantime, we can use the information available regarding the regulation of PML to re-induce its expression in tumors. Many currently used treatments for cancer already target PML expression. However, each by itself may not be effective to achieve high enough levels of PML. Therefore, by using combinations of already existing strategies that target PML expression, it may be possible to induce PML expression to endogenous levels. Combining drugs all aimed at manipulating PML may also allow using lower doses of each drug, hopefully leading to decreased side 224
Cancer Therapy Vol 7, page 225 the suppressor gene PML. Biochem Biophys Res Commun 240, 640-646. Ching RW, Dellaire G, Eskiw CH, Bazett-Jones DP (2005) PML bodies: a meeting place for genomic loci? J Cell Sci 118, 847-854. de Stanchina E, Querido E, Narita M, Davuluri RV, Pandolfi PP, Ferbeyre G, Lowe SW (2004) PML is a direct p53 target that modulates p53 effector functions. Mol Cell 13, 523-535. de The H, Lavau C, Marchio A, Chomienne C, Degos L, Dejean A (1991) The PML-RAR alpha fusion mRNA generated by the t(15;17) translocation in acute promyelocytic leukemia encodes a functionally altered RAR. Cell 66, 675-684. Dellaire G, Bazett-Jones DP (2004) PML nuclear bodies: dynamic sensors of DNA damage and cellular stress. Bioessays 26, 963-977. Dror N, Rave-Harel N, Burchert A, Azriel A, Tamura T, Tailor P, Neubauer A, Ozato K, Levi BZ (2007) Interferon regulatory factor-8 is indispensable for the expression of promyelocytic leukemia and the formation of nuclear bodies in myeloid cells. J Biol Chem 282, 5633-5640. Duprez E, Saurin AJ, Desterro JM, Lallemand-Breitenbach V, Howe K, Boddy MN, Solomon E, de The H, Hay RT, Freemont PS (1999) SUMO-1 modification of the acute promyelocytic leukaemia protein PML: implications for nuclear localisation. J Cell Sci 112 (Pt 3), 381-393. Dyck JA, Maul GG, Miller WH, Jr, Chen JD, Kakizuka A, Evans RM (1994) A novel macromolecular structure is a target of the promyelocyte-retinoic acid receptor oncoprotein. Cell 76, 333-343. Eskiw CH, Dellaire G, Bazett-Jones DP (2004) Chromatin contributes to structural integrity of promyelocytic leukemia bodies through a SUMO-1-independent mechanism. J Biol Chem 279, 9577-9585. Everett RD, Meredith M, Orr A, Cross A, Kathoria M, Parkinson J (1997) A novel ubiquitin-specific protease is dynamically associated with the PML nuclear domain and binds to a herpesvirus regulatory protein. Embo J 16, 566-577. Ferbeyre G, de Stanchina E, Querido E, Baptiste N, Prives C, Lowe SW (2000) PML is induced by oncogenic ras and promotes premature senescence. Genes Dev 14, 2015-2027. Gambacorta M, Flenghi L, Fagioli M, Pileri S, Leoncini L, Bigerna B, Pacini R, Tanci LN, Pasqualucci L, Ascani S, Mencarelli A, Liso A, Pelicci PG, Falini B (1996) Heterogeneous nuclear expression of the promyelocytic leukemia (PML) protein in normal and neoplastic human tissues. Am J Pathol 149, 2023-2035. Gao C, Ho CC, Reineke E, Lam M, Cheng X, Stanya KJ, Liu Y, Chakraborty S, Shih HM, Kao HY (2008) Histone deacetylase 7 promotes PML sumoylation and is essential for PML nuclear body formation. Mol Cell Biol 28, 5658-5667. Grotzinger T, Sternsdorf T, Jensen K, Will H (1996) Interferonmodulated expression of genes encoding the nuclear-dotassociated proteins Sp100 and promyelocytic leukemia protein (PML). Eur J Biochem 238, 554-560. Gurrieri C, Capodieci P, Bernardi R, Scaglioni PP, Nafa K, Rush LJ, Verbel DA, Cordon-Cardo C, Pandolfi PP (2004) Loss of the tumor suppressor PML in human cancers of multiple histologic origins. J Natl Cancer Inst 96, 269-279. Hayakawa F, Abe A, Kitabayashi I, Pandolfi PP, Naoe T (2008) Acetylation of PML is involved in histone deacetylase inhibitor-mediated apoptosis. J Biol Chem 283, 2442024425. Hayakawa F, Privalsky ML (2004) Phosphorylation of PML by mitogen-activated protein kinases plays a key role in arsenic trioxide-mediated apoptosis. Cancer Cell 5, 389-401. He D, Mu ZM, Le X, Hsieh JT, Pong RC, Chung LW, Chang KS (1997) Adenovirus-mediated expression of PML suppresses
growth and tumorigenicity of prostate cancer cells. Cancer Res 57, 1868-1872. Heuser M, van der Kuip H, Falini B, Peschel C, Huber C, Fischer T (1998) Induction of the pro-myelocytic leukaemia gene by type I and type II interferons. Mediators Inflamm 7, 319325. Hofmann TG, Will H (2003) Body language: the function of PML nuclear bodies in apoptosis regulation. Cell Death Differ 10, 1290-1299. Jensen K, Shiels C, Freemont PS (2001) PML protein isoforms and the RBCC/TRIM motif. Oncogene 20, 7223-7233. Kakizuka A, Miller WH, Jr, Umesono K, Warrell RP, Jr, Frankel SR, Murty VV, Dmitrovsky E, Evans RM (1991) Chromosomal translocation t(15;17) in human acute promyelocytic leukemia fuses RAR alpha with a novel putative transcription factor, PML. Cell 66, 663-674. Kamitani T, Nguyen HP, Kito K, Fukuda-Kamitani T, Yeh ET (1998) Covalent modification of PML by the sentrin family of ubiquitin-like proteins. J Biol Chem 273, 3117-3120. Kim TK, Lee JS, Oh SY, Jin X, Choi YJ, Lee TH, Lee E, Choi YK, You S, Chung YG, Lee JB, DePinho RA, Chin L, Kim H (2007) Direct transcriptional activation of promyelocytic leukemia protein by IFN regulatory factor 3 induces the p53dependent growth inhibition of cancer cells. Cancer Res 67, 11133-11140. Koken MH, Linares-Cruz G, Quignon F, Viron A, Chelbi-Alix MK, Sobczak-Thepot J, Juhlin L, Degos L, Calvo F, de The H (1995) The PML growth-suppressor has an altered expression in human oncogenesis. Oncogene 10, 1315-1324. Kuwayama K, Matsuzaki K, Mizobuchi Y, Mure H, Kitazato KT, Kageji T, Nakao M, Nagahiro S (2008) Promyelocytic leukemia protein induces apoptosis due to caspase-8 activation via the repression of NF{!}B activation in glioblastoma. Neuro Oncol. LaCasse EC, Baird S, Korneluk RG, MacKenzie AE (1998) The inhibitors of apoptosis (IAPs) and their emerging role in cancer. Oncogene 17, 3247-3259. Lallemand-Breitenbach V, Jeanne M, Benhenda S, Nasr R, Lei M, Peres L, Zhou J, Zhu J, Raught B, de The H (2008) Arsenic degrades PML or PML-RARalpha through a SUMO-triggered RNF4/ubiquitin-mediated pathway. Nat Cell Biol 10, 547-555. Lallemand-Breitenbach V, Zhu J, Puvion F, Koken M, Honore N, Doubeikovsky A, Duprez E, Pandolfi PP, Puvion E, Freemont P, de The H (2001) Role of promyelocytic leukemia (PML) sumolation in nuclear body formation, 11S proteasome recruitment, and As2O3-induced PML or PML/retinoic acid receptor alpha degradation. J Exp Med 193, 1361-1371. Lavau C, Marchio A, Fagioli M, Jansen J, Falini B, Lebon P, Grosveld F, Pandolfi PP, Pelicci PG, Dejean A (1995) The acute promyelocytic leukaemia-associated PML gene is induced by interferon. Oncogene 11, 871-876. Le XF, Vallian S, Mu ZM, Hung MC, Chang KS (1998) Recombinant PML adenovirus suppresses growth and tumorigenicity of human breast cancer cells by inducing G1 cell cycle arrest and apoptosis. Oncogene 16, 1839-1849. Lee HE, Jee CD, Kim MA, Lee HS, Lee YM, Lee BL, Kim WH (2007) Loss of promyelocytic leukemia protein in human gastric cancers. Cancer Lett 247, 103-109. Li L, He D, He H, Wang X, Zhang L, Luo Y, Nan X (2006) Overexpression of PML induced apoptosis in bladder cancer cell by caspase dependent pathway. Cancer Lett 236, 259268. Li M, Chen D, Shiloh A, Luo J, Nikolaev AY, Qin J, Gu W (2002) Deubiquitination of p53 by HAUSP is an important pathway for p53 stabilization. Nature 416, 648-653.
225
Reineke and Kao: PML: An emerging tumor suppressor and a target with therapeutic potential Lin HK, Bergmann S, Pandolfi PP (2004) Cytoplasmic PML function in TGF-beta signalling. Nature 431, 205-211. Louria-Hayon I, Grossman T, Sionov RV, Alsheich O, Pandolfi PP, Haupt Y (2003) The promyelocytic leukemia protein protects p53 from Mdm2-mediated inhibition and degradation. J Biol Chem 278, 33134-33141. Maul GG, Negorev D, Bell P, Ishov AM (2000) Review: properties and assembly mechanisms of ND10, PML bodies, or PODs. J Struct Biol 129, 278-287. Moller A, Sirma H, Hofmann TG, Rueffer S, Klimczak E, Droge W, Will H, Schmitz ML (2003) PML is required for homeodomain-interacting protein kinase 2 (HIPK2)mediated p53 phosphorylation and cell cycle arrest but is dispensable for the formation of HIPK domains. Cancer Res 63, 4310-4314. Paige AJ (2003) Redefining tumour suppressor genes: exceptions to the two-hit hypothesis. Cell Mol Life Sci 60, 2147-2163. Pearson M, Carbone R, Sebastiani C, Cioce M, Fagioli M, Saito S, Higashimoto Y, Appella E, Minucci S, Pandolfi PP, Pelicci PG (2000) PML regulates p53 acetylation and premature senescence induced by oncogenic Ras. Nature 406, 207-210. Pearson M, Pelicci PG (2001) PML interaction with p53 and its role in apoptosis and replicative senescence. Oncogene 20, 7250-7256. Rego EM, Wang ZG, Peruzzi D, He LZ, Cordon-Cardo C, Pandolfi PP (2001) Role of promyelocytic leukemia (PML) protein in tumor suppression. J Exp Med 193, 521-529. Reineke EL, Lam M, Liu Q, Liu Y, Stanya KJ, Chang KS, Means AR, Kao HY (2008) Degradation of the tumor suppressor PML by Pin1 contributes to the cancer phenotype of breast cancer MDA-MB-231 cells. Mol Cell Biol 28, 9971006. Salomoni P, Bernardi R, Bergmann S, Changou A, Tuttle S, Pandolfi PP (2005) The promyelocytic leukemia protein PML regulates c-Jun function in response to DNA damage. Blood 105, 3686-3690. Scaglioni PP, Yung TM, Cai LF, Erdjument-Bromage H, Kaufman AJ, Singh B, Teruya-Feldstein J, Tempst P, Pandolfi PP (2006) A CK2-dependent mechanism for degradation of the PML tumor suppressor. Cell 126, 269283. Scaglioni PP, Yung TM, Choi SC, Baldini C, Konstantinidou G, Pandolfi PP (2008) CK2 mediates phosphorylation and ubiquitin-mediated degradation of the PML tumor suppressor. Mol Cell Biochem 316, 149-154. Shah SJ, Blumen S, Pitha-Rowe I, Kitareewan S, Freemantle SJ, Feng Q, Dmitrovsky E (2008) UBE1L represses PML/RAR{alpha} by targeting the PML domain for ISG15ylation. Mol Cancer Ther 7, 905-914. Shen TH, Lin HK, Scaglioni PP, Yung TM, Pandolfi PP (2006) The mechanisms of PML-nuclear body formation. Mol Cell 24, 331-339. Son SH, Yu E, Choi EK, Lee H, Choi J (2005) Promyelocytic leukemia protein-induced growth suppression and cell death in liver cancer cells. Cancer Gene Ther 12, 1-11. Song MS, Salmena L, Carracedo A, Egia A, Lo-Coco F, TeruyaFeldstein J, Pandolfi PP (2008) The deubiquitinylation and localization of PTEN are regulated by a HAUSP-PML network. Nature 455, 813-817. Stadler M, Chelbi-Alix MK, Koken MH, Venturini L, Lee C, Saib A, Quignon F, Pelicano L, Guillemin MC, Schindler C, de Thè H (1995) Transcriptional induction of the PML growth suppressor gene by interferons is mediated through an ISRE and a GAS element. Oncogene 11, 2565-2573.
Takahashi Y, Lallemand-Breitenbach V, Zhu J, de The H (2004) PML nuclear bodies and apoptosis. Oncogene 23, 28192824. Tang J, Xie W, Yang X (2005) Association of caspase-2 with the promyelocytic leukemia protein nuclear bodies. Cancer Biol Ther 4, 645-649. Tatham MH, Geoffroy MC, Shen L, Plechanovova A, Hattersley N, Jaffray EG, Palvimo JJ, Hay RT (2008) RNF4 is a polySUMO-specific E3 ubiquitin ligase required for arsenicinduced PML degradation. Nat Cell Biol 10, 538-546. Trotman LC, Alimonti A, Scaglioni PP, Koutcher JA, CordonCardo C, Pandolfi PP (2006) Identification of a tumour suppressor network opposing nuclear Akt function. Nature 441, 523-527. Vallian S, Gaken JA, Gingold EB, Kouzarides T, Chang KS, Farzaneh F (1998) Modulation of Fos-mediated AP-1 transcription by the promyelocytic leukemia protein. Oncogene 16, 2843-2853. Vannucchi S, Percario ZA, Chiantore MV, Matarrese P, ChelbiAlix MK, Fagioli M, Pelicci PG, Malorni W, Fiorucci G, Romeo G, Affabris E (2000) Interferon-beta induces S phase slowing via up-regulated expression of PML in squamous carcinoma cells. Oncogene 19, 5041-5053. Virador VM, Flores-Obando RE, Berry A, Patel R, Zakhari J, Lo YC, Strain K, Anders J, Cataisson C, Hansen LA, Yuspa SH (2008) The human promyelocytic leukemia protein is a tumor suppressor for murine skin carcinogenesis. Mol Carcinog. Wang J, Shiels C, Sasieni P, Wu PJ, Islam SA, Freemont PS, Sheer D (2004) Promyelocytic leukemia nuclear bodies associate with transcriptionally active genomic regions. J Cell Biol 164, 515-526. Wang ZG, Delva L, Gaboli M, Rivi R, Giorgio M, Cordon-Cardo C, Grosveld F, Pandolfi PP (1998) Role of PML in cell growth and the retinoic acid pathway. Science 279, 15471551. Weisshaar SR, Keusekotten K, Krause A, Horst C, Springer HM, Gottsche K, Dohmen RJ, Praefcke GJ (2008) Arsenic trioxide stimulates SUMO-2/3 modification leading to RNF4-dependent proteolytic targeting of PML. FEBS Lett 582, 3174-3178. Wiesmeijer K, Molenaar C, Bekeer IM, Tanke HJ, Dirks RW (2002) Mobile foci of Sp100 do not contain PML: PML bodies are immobile but PML and Sp100 proteins are not. J Struct Biol 140, 180-188. Wu WS, Xu ZX, Hittelman WN, Salomoni P, Pandolfi PP, Chang KS (2003) Promyelocytic leukemia protein sensitizes tumor necrosis factor alpha-induced apoptosis by inhibiting the NF-!B survival pathway. J Biol Chem 278, 1229412304. Wulf G, Ryo A, Liou YC, Lu KP (2003) The prolyl isomerase Pin1 in breast development and cancer. Breast Cancer Res 5, 76-82. Yang L, Yeh SD, Xie S, Altuwaijri S, Ni J, Hu YC, Chen YT, Bao BY, Su CH, Chang C (2004) Androgen suppresses PML protein expression in prostate cancer CWR22R cells. Biochem Biophys Res Commun 314, 69-75. You H, Zheng H, Murray SA, Yu Q, Uchida T, Fan D, Xiao ZX (2002) IGF-1 induces Pin1 expression in promoting cell cycle S-phase entry. J Cell Biochem 84, 211-216. Zhang P, Chin W, Chow LT, Chan AS, Yim AP, Leung SF, Mok TS, Chang KS, Johnson PJ, Chan JY (2000) Lack of expression for the suppressor PML in human small cell lung carcinoma. Int J Cancer 85, 599-605. Zhong S, Muller S, Ronchetti S, Freemont PS, Dejean A, Pandolfi PP (2000) Role of SUMO-1-modified PML in nuclear body formation. Blood 95, 2748-2752.
226
Cancer Therapy Vol 7, page 227 Cancer Therapy Vol 7, 227-233, 2009
Adjuvant chemotherapy should be used as the standard of care for resectable pancreatic cancer Review Article
Sousana Amptoulach1,*, Evangelos Kalaitzakis2, Faisal Azam3 1
Department of Oncology Sahlgrenska University Hospital, Gothenburg, Sweden Section of Gastroenterology and Hepatology, Department of Internal Medicine, Sahlgrenska University Hospital, Gothenburg, Sweden 3 Department of medical oncology Churchill Hospital, Old road, Oxford, OX3 7LJ, United Kingdom 2
__________________________________________________________________________________ *Correspondence: Sousana Amptoulach MD, Department of Oncology, Sahlgrenska university Hospital, 413 15 Gothenburg, Sweden; Tel: +46313421000; Fax: +4631411966; e-mail: sousana.amptoulach@vgregion.se; drsouzana@yahoo.gr Key words: pancreatic cancer, Adjuvant therapy, Chemo-radiotherapy, Surgery, Meta-analyses Abbreviations: 5-fluorouracil, (5-FU); European Organisation of Research and Treatment of Cancer, (EORTC); European Study Group for Pancreatic Cancer, (ESPAC); external-beam radiotherapy, (EBRT); Gastrointestinal tumor study group, (GITSG); Pancreatic cancer, (PC) Received: 6 March 2009; Revised: 18 March 2009 Accepted: 20 March 2009; electronically published: April 2009
Summary The prognosis in patients who undergo surgery for pancreatic cancer is still poor. The disease is considered to have systemic spread very early in its course, and the majority of patients develop distant metastasis even if they have potentially resectable tumor and no evidence of metastatic disease at the first presentation. Randomized trials, mostly with 5-fluorouracil-based and more recently, with gemcitabine-based chemotherapy or chemo-radiotherapy, have tried to evaluate the efficacy of adjuvant treatment after curative resection of pancreatic cancer and to improve the surgical outcome. In this review article we summarize some of the most important randomized controlled trials on postoperative chemotherapy and chemo-radiotherapy that have given support to use these treatments after resection.
patients with PC is determined by systematic failure, a treatment approach after resection is necessary and adjuvant treatment strategies probably provides the only hope of improving the prognosis of patients with this aggressive tumor. This article describes the different treatment modalities available as well as the evidence for adjuvant treatment in PC. The major trials conducted in the field are briefly discussed.
I. Introduction Pancreatic cancer (PC) is one of the top five causes of cancer death in the western world (Lowenfels and Maisonneuve, 2002). Nearly 90% of pancreatic neoplasms are adenocarcinomas which arise from the exocrine duct system. Despite advances in the understanding of the underlying biology and improvements in imaging modalities patients with PC have a poor prognosis. For all stages combined, the 1-year survival rate is 19% and the 5year survival rate is from 0.4% to 4% (Bramhall et al, 1995; Jemal et al, 2003). The poor prognosis is due to late diagnosis. The majority of PCs are metastatic at the time of diagnosis and only 10% of patients are suitable for resection. Surgical resection offers the best possibility for long-term survival with a 5-year survival rate of 25-30% for node-negative disease and 10% for node positive cancers (Lim et al, 2003). After surgery the progressionfree period varies between 8-12 months and most recurrences occur within 2 years (Gastrointestinal Tumor Study, 1987). Sites of recurrence are the liver (38-73%), the retroperitoneum (34-87%), the peritoneum (19-53%), and the lungs (8-29%) (Boeck et al, 2007). As the prognosis of
II. Treatment of pancreatic cancer A. Surgery Surgery is the only curative treatment option for PC, but the majority of patients are not candidates for surgery due to the advanced stage of the disease at the time of diagnosis. Selection of those patients who are eligible for curative resection is very important as incomplete surgical resection of the primary tumor has median survival comparable to that of patients with inoperable locally advanced disease (stage III) treated with chemotherapy and radiotherapy (Nishimura et al, 1997; Millikan et al,
227
Amptoulach et al: Adjuvant chemotherapy in pancreatic cancer 1999; Sohn et al, 2000; Neoptolemos et al, 2001; Richter et al, 2003; Takai et al, 2003; Kuhlmann et al, 2004). The imaging modalities for the diagnosis and staging of pancreatic cancer prior to surgery include ultrasound, multidetector row computed tomography and endoscopic ultrasound. Although ultrasound is the first examination to be performed in patients presenting with biliary obstruction, multidetector row computed tomography is best used to assess unresectability and metastatic disease (Smith and Rajan, 2004). Endoscopic ultrasound, on the other hand, has the ability to detect small pancreatic lesions and it offers the possibility of taking biopsies (Michl et al, 2006). Endoscopic ultrasound is generally considered superior to compute tomography for the diagnosis and the local staging of PC, but is limited by availability and inability to assess metastatic disease (Wong and Lu, 2008). Surgical approaches are of two types. Pancreaticoduodenectomy for right-sided tumors and distal or caudal pancreatectomy for left sided tumors. Moreover the more conservative, pylorus-preserving pancreaticoduodenectomy is not inferior to the classic Kausch-Whipple resection (Tran et al, 2004; Takada et al,
1997; Di Carlo et al, 1999; Lin and Lin, 1999). Factors that appear to be important in predicting long-term survival after resection are clear surgical margins, negative lymph nodes, tumor size, as well as vascular, lymphatic and perineural invasion (Luttges et al, 1998; Sperti et al, 1997). Patients with resected pancreatic body or tail tumors have generally found to have a worse outcome than those with pancreatic head tumors (Dalton et al, 1992; Nordback et al, 1992).
B. Adjuvant therapy Adjuvant treatment including chemo-radiotherapy and chemotherapy alone in pancreatic cancer is controversial. Disease relapses are quite common, even after radical surgery. This can, probably be explained by the presence of microscopic residual disease at the time of resection (Verbeke et al, 2006). To reduce this risk it is reasonable to instigate adjuvant treatment after potentially complete resection of PC. The evidence for using adjuvant treatment in PC is outlined below. Selected randomized studies assessing adjuvant therapy in PC are summarized in the Table1.
Table 1. Randomized controlled trials for adjuvant postoperative therapy in pancreatic and periampullary cancer. Study
Year
(Kalser and Ellenberg, 1985)
1985
GITSG (1987)
1987
(Klinkenbijl et al., 1999)
1999
(Bakkevold et al., 1993)
1993
(Takada et al., 2002)
2002
(Kosuge et al., 2006)
2006
(Neoptolemos et al., 2004)
2004
(Oettle et al., 2007)
2007
(Regine et al., 2008)
2008
No of patients
Treatment arm
Median survival (months) 21*
Median disease-free survival(months)
5 year survival (%)
_
_
10.9
_
_
21
Surgery + CRT
22
Surgery
30
Surgery + CRT
18
_
_
108
Surgery
19
16
22
110 31
Surgery + RT + CT Surgery
24.5** 11
17.4** _
25** 8
30 81
Surgery + CT CT
23* _
_ _
4 ** 11.5
77 45
Surgery CT
_ 12.5
_ _
18 ** 26.4
44 145 vs 144
Surgery CRT vs no CRT
15.8 15.9 vs 17.9**
_ _
14.9 ** 10 vs 20**
147 vs 142
CT vs no CT
20.1 vs 15.5*
_
21 vs 8*
179
Surgery + CT
22.1
13.4
22.5
175
Surgery
20.2**
6.9*
11.5 **
221
Surgery + CT(5FU)
16.9
_
_
20.5**
_
_
RT
+
221 Surgery + RT + CT (Gemcitabine)
CRT= chemo-radiotherapy, RT= radiotherapy, CT= chemotherapy *= statistically significance **= statistically not significance
228
Cancer Therapy Vol 7, page 229 respectively, after a median follow-up of 11.7 years (Smeenk et al, 2007).
1. 5-FU based Chemo-radiotherapy i. GITSG trial The Gastrointestinal tumor study group (GITSG), studied the possible benefit of chemo-radiotherapy as adjuvant therapy in patients with resectable PC. This was the first prospective randomized multicenter study showing an effect of adjuvant treatment in pancreatic cancer; its results were published in 1985 (Kalser, 1985). Patients with completely resected pancreatic cancer (microscopically negative margins) were randomized to observation arm or bolus 5-fluorouracil (5-FU) (500mg/m2 daily) on the first 3 days of each period of split course external-beam radiotherapy (EBRT) of 20 Gy in 10 fractions with 2-week break and resumption of radiation to a total dose of 40 Gy. After radiotherapy the protocol called for weekly 5FU chemotherapy for 2 years or until recurrent disease was found. The study was originally designed to enroll at least 100 patients but only 43 patients were randomized. The study was terminated prematurely because of a low rate of accrual and an early analysis of the data demonstrated a survival benefit for the patients receiving the combined-modality therapy compared with patients in the observation arm after surgery (21.0 months vs. 10.9 months, respectively, p=0.03). This study was criticized for small sample size, poor patientsâ&#x20AC;&#x2122; accrual and early termination. The GITSG 1987 study, tried to confirm the results of the GITSG 1985 and a further 30 patients were registered to the treatment arm. The median survival was noted to be 18 months. The limitations of this study were that it did not have a control arm, the patients were not randomized and the performance status of the participants before study enrolment was better than that of all patients in the initial study. Although this study was considered as a study of chemo-radiotherapy the maintenance chemotherapy was an important component of treatment in this group of patients.
2. 5-FU based chemotherapy i. Norwegian Trial Bakkevold and colleagues (Bakkevold et al, 1993) conducted a small randomized multicentre trial between 1984 and 1987 to investigate the role of adjuvant chemotherapy in patients with PC (n=47) and carcinomas of the ampulla of Vater (n=14). A total of 61 radically resected patients were randomized either to receive postoperative systemic chemotherapy, according to the AMF regimen [5-fluorouracil (5-FU) 500mg/m2, doxorubicin 40mg/m2, mitomycin C 6mg/m2] every 3 weeks for 6 cycles, or to observation. Chemotherapy was associated with an improvement of the median survival, 23 months vs. 11 months in the control group (p=0.02) and a delay in the incidence of recurrence in the first 2 years after radical surgery, but the 5-year survival was not significantly different (4% vs. 8%, p>0.05). It is to mention that 16 out of 22 patients after the first course needed hospitalizations because of toxic side effects and only 13 of 22 patients managed to complete the 6 cycles. ii. Japanese trials Takada and colleagues (Takada et al, 2002) in a large scale randomized controlled clinical trial recruited, between April 1986 and June 1992, a total of 508 patients with resectable pancreaticobiliary cancer (pancreatic, gallbladder and ampulla of Vater) including 173 resected pancreatic cancer patients. Patients were randomized either to receive the MF regimen (mitomycin C 6mg/m2 on the day of surgery and 5-FU 310mg/m2 for 5 days during weeks 1 and 3 postoperatively), followed by daily oral 5FU 100mg/m2 from postoperative week 5 until recurrence of disease or to observation. The trial was designed to be analyzed per protocol for each disease of resected pancreaticobiliary carcinoma separately. The 5-year survival rate was higher in the control arm (18%) compared to patients with pancreatic cancer (11.5%) in the MF arm but this did not reach statistical significance, p>0.05. Kosuge and colleagues randomized in 2006 89 patients who underwent radical surgery into 2 groups: surgery + chemotherapy group [2 courses of postoperative adjuvant systematic chemotherapy with cisplatin 80mg/m2 day one and 5-FU given 500mg/m2/day as a continuous infusion for the first 5 days] and surgery-alone group. The trial could not demonstrate a clear survival benefit for the group which received chemotherapy compared to the surgery-alone group (26.4% vs. 14.9%, p>0.05).
ii. EORTC study The European Organisation of Research and Treatment of Cancer (EORTC) (Klinkenbijl et al, 1999) conducted a prospective randomized phase III study that was designed to validate the results of the GITSG. Between 1987 and 1995, 218 patients with pancreatic cancer (n=114) or periampullary cancers (n=104) were enrolled in 29 institutions across Europe. A total of 108 patients were randomized to the observation arm after surgery and 110 were randomized to the treatment arm. The adjuvant treatment was similar to that in the GITSG trial, except that maintenance chemotherapy was not administered after chemo-radiation. The chemotherapy regimen consisted of continuous infusion of 5-FU 25mg/kg per 24 hours, to a maximal daily dose of 1500mg and was given concomitantly with radiotherapy. Radiotherapy was delivered over a period of 6 weeks, with a 2-week break and a total 40 Gy was delivered in 2 courses of 20Gy. This trial shows no difference between adjuvant chemo-radiotherapy and observation, in terms of median survival (24.5 months vs. 19 months respectively, p>0.05) and in progression-free survival 1.5 years (95% CI: 1.0-1.8 years) vs. 1.2 years (95% CI: 0.9-1.7 years)
iii. ESPAC-1 trial The European Study Group for Pancreatic Cancer (ESPAC) (Neoptolemos et al, 2004) performed a randomized multicentre trial in order to answer two questions: the roles of adjuvant chemotherapy and chemoradiation. They used a 2x2 factorial design, to compare the effects of chemo-radiotherapy and chemotherapy on survival following resection for pancreatic ductal adenocarcinoma. The patients were randomized to 1 of 4
229
Amptoulach et al: Adjuvant chemotherapy in pancreatic cancer treatment arms: 1: adjuvant chemotherapy with 5-FU 425mg/m2 + folinic acid 20mg/m2 , daily for 5 days every 28 days for 6 months. 2: chemo-radiotherapy (analogous to GITSG regimen), 3: a sequence of chemo-radiotherapy and chemotherapy. 4: observation only. While 541 patients were randomized, only 289 patients were included in the 2x2 factorial design comparing chemotherapy with no chemotherapy or chemo-radiotherapy with no chemoradiotherapy. Besides the 2x2 factorial design allocation, the randomization of an additional 261 patients was permitted in the main treatment comparisons (chemotherapy vs. no chemotherapy and chemoradiotherapy vs. no chemo-radiotherapy). The results of the ESPAC-1, at a median follow-up of 47 months, showed a significant survival benefit for adjuvant chemotherapy and that chemo-radiotherapy had a deleterious effect on survival. The median survival was 21.6 months (95% CI: 13.5- 27.3) for the chemotherapy arm, 19.9 months (95% CI: 14.2- 22.5) for the chemo-radiotherapy plus chemotherapy arm, 13.9 months (95% CI: 12.2-17.3) for the chemo-radiotherapy arm and 16.9 months (95% CI: 12.3-24.8) for the observation arm. This trial has been criticized both because of the lack of quality control of the radiotherapy delivered as part of chemo-radiotherapy and because only 50% of patients received treatment in the chemotherapy arm according to the protocol.
margins-negative and positive patients, irrespective of nodal status and tumor size. ii. RTOG 97-04 trial This randomized Gastrointestinal-US-Intergroup trial was designed to determine if the addition of gemcitabine to adjuvant 5-FU based chemo-radiotherapy improves survival in patients with resectable PC. The study results were published in 2008. Overall 451 patients were eligible to be randomized either to gemcitabine (1000mg/m2 weekly) or to 5-FU (continuous infusion of 250mg/m2/day) for 3 weeks prior to chemo-radiation and 12 weeks after chemo-radiation (using 5-FU as radiosensitizer in both groups). The median survival was 20.5 months and the 3-year survival rate 31% in the gemcitabine and chemo-radiotherapy arm compared with 16.9months and a 3-year survival rate 22%, respectively in the 5FU and chemo-radiotherapy arm (95% confidence interval, 0.65-1.03; p=0.09). Thus, the addition of gemcitabine to 5FU-based chemo-radiation seems to improve survival in patients with PC, but this did not reach statistical significance (Regine et al, 2008).
4. Meta-analyses Stocken and colleagues performed in 2005 a metaanalysis to investigate the role of adjuvant chemotherapy and chemo-radiation following curative resection of pancreatic cancer. Of the five selected randomized controlled trials (1987; Bakkevold et al, 1993; Kalser, 1985; Klinkenbijl et al, 1999; Neoptolemos et al, 2004) (total number of patients with pancreatic adenocarcinoma =939), individual patients data were available in four (875) - the GITSG trial was not able to provide individual patients data due to the age of trial. Assessment of adjuvant chemotherapy trials revealed that the median survival was 19 (95% CI: 16.4-21.1) months with chemotherapy and 13.5 (95% CI: 12.2-15.8) without. The 5 years survival rates were estimated at 19% with and 12% without chemotherapy. The median survival was estimated at 15.8 (95% CI: 13.9-18.1) months with and 15.2 (95% CI: 13.1-18.2) without chemoradiation. The 5 year survival rate was 12% with and 17% without chemoradiation. Boeck and colleagues in 2007 performed a metaanalysis the primary endpoint of which was to estimate median survival time and the 5-year survival rate in patients who undergo adjuvant chemotherapy after complete macroscopic resection for pancreatic cancer. Five randomized clinical trials (Bakkevold et al, 1993; Takada et al, 2002; Neoptolemos et al, 2004; Kosuge et al, 2006; Oettle et al, 2007) were included in this analysis, which also contains also CONKO-001 data (Oettle et al, 2007). A total of 482 patients were allocated to the chemotherapy arm and 469 patients to the control group. The authors estimated that the prolongation of median survival time for patients in the chemotherapy arm was 3 months (95% CI: 0.3-5.7 months, p=0.03). However the 5year survival rate in the meta-analysis did not show a statistically significant benefit of adjuvant chemotherapy.
3. Gemcitabine based chemotherapy Gemcitabine has shown significant clinical activity in PC with a good safety profile and low incidence of grade 3 or 4 toxicity (Bramhall et al, 1995). In 1997, Burris et al reported a phase III study that showed a significant benefit in survival with single agent gemcitabine compared with 5FU as first-line chemotherapy for advanced pancreatic cancer (Burris et al, 1997). These findings led other investigators to hypothesize that gemcitabine-based chemotherapy might be effective in the adjuvant setting as well. i. CONKO-001 Study In the same year that Burris et al. published their results, a multicenter randomized controlled phase III trial was initiated by the German Study Group of Pancreatic Cancer (CONKO-001) (Oettle et al, 2007). This study compared adjuvant gemcitabine treatment with observation only after complete curative intent resection of PC. Patients in the gemcitabine group were given 6 cycles of gemcitabine every 4 weeks. Each cycle consisted of 3weekly infusions of gemcitabine 1000 mg/m2 intravenously over 30 minutes followed by one-week rest. The primary endpoint of the trial was disease-free survival, which was 13.4 months in the gemcitabine group (95% confidence interval, 11.4-15.3) compared with 6.9 months (95% confidence interval, 6.1-7.8; p<0.001) in the control (observation only) group. A benefit in disease-free survival was also noted at 1, 2, 3 and 5 years with 58%, 30.5%, 23.5%, and 16.5% respectively in the gemcitabine group and 31%, 14.5%, 7.5%, and 5.5% in the control group (p<0.01). This benefit was seen both in resection-
230
Cancer Therapy Vol 7, page 231 patients will develop local recurrence (Kayahara et al, 1993; Westerdahl et al, 1993), which indicates underestimation of resections margin involvement (Verbeke et al, 2006; Verbeke, 2008). This could have influenced the survival outcome in trials for the assessment of adjuvant therapy for pancreatic cancer. Although guidelines for the processing of pancreatic specimens have been established, a detailed and internationally accepted protocol is still lacking. Some groups have proposed guidelines for pathologic evaluation of pancreatic specimens (Staley et al, 1996; Esposito et al, 2008). It is mandatory that future trials adhere to a broadly accepted and standardized protocol for pancreatic specimen examinations which would enable the generation of comparable data from different institutions (Esposito et al, 2008).
5. Future trials in assessment of adjuvant treatment in pancreatic cancer There are some undergoing randomized trials further evaluating the role of adjuvant chemotherapy and chemoradiotherapy in patients with resectable pancreatic cancer. In particular, the results of the ESPAC-3 study (2003b) (Figure 1), which aims to evaluate the effectiveness of gemcitabine vs. 5FU, as well as those of the EORTC 40013 trial (2003a) (Figure 2) which continues to investigate the role of gemcitabine-based adjuvant chemoradiation, are awaited. Certain methodological limitations of the studies performed thus far should be taken into consideration when interpreting their results. It is well known that one of the most important histopathologic predictors for long term survival is the resection margin status. Even after potential curative resection and adjuvant treatment some
Figure1. ESPAC-3 (European Study Group for Pancreatic Cancer) trial design. Ongoing trial evaluating the effect of 5-fluorouracil vs. gemcitabine vs. observation in resectable pancreatic cancer.
Figure 2. EORTC 40013 (European Organisation for Research and Treatment of Cancer) trial, design. Ongoing trial evaluating the effect of gemcitabine-based chemoradiation vs. gemcitabine chemotherapy in resectable pancreatic cancer.
231
Amptoulach et al: Adjuvant chemotherapy in pancreatic cancer Dalton RR, Sarr MG, van Heerden JA, Colby TV (1992) Carcinoma of the body and tail of the pancreas: is curative resection justified? Surgery 111, 489-494. Di Carlo V, Zerbi A, Balzano G, Corso V (1999) Pyloruspreserving pancreaticoduodenectomy versus conventional whipple operation. World J Surg 23, 920-925. Esposito I, Kleeff J, Bergmann F, Reiser C, Herpel E, Friess H, Schirmacher P, Buchler MW (2008) Most pancreatic cancer resections are R1 resections. Ann Surg Oncol 15, 16511660. Jemal A, Murray T, Samuels A, Ghafoor A, Ward E, Thun MJ (2003) Cancer statistics, 2003. CA Cancer J Clin 53, 5-26. Kalser MH, Ellenberg SS (1985) Pancreatic cancer. Adjuvant combined radiation and chemotherapy following curative resection. Arch Surg 120, 899-903. Kalser MHE, S.S. (1985) Pancreatic cancer: Adjuvant combined radiation and chemotherapy following curative resection. Gastrointestinal Tumor Study Group. Arch Surg 120, 899903. Kayahara M, Nagakawa T, Ueno K, Ohta T, Takeda T, Miyazaki I (1993) An evaluation of radical resection for pancreatic cancer based on the mode of recurrence as determined by autopsy and diagnostic imaging. Cancer 72, 2118-2123. Klinkenbijl JH, Jeekel J, Sahmoud T, van Pel R, Couvreur ML, Veenhof CH, Arnaud JP, Gonzalez DG, de Wit LT, Hennipman A, Wils J (1999) Adjuvant radiotherapy and 5fluorouracil after curative resection of cancer of the pancreas and periampullary region: phase III trial of the EORTC gastrointestinal tract cancer cooperative group. Ann Surg 230, 776-782; discussion 782-774. Kosuge T, Kiuchi T, Mukai K, Kakizoe T (2006) A multicenter randomized controlled trial to evaluate the effect of adjuvant cisplatin and 5-fluorouracil therapy after curative resection in cases of pancreatic cancer. Jpn J Clin Oncol 36, 159-165. Kuhlmann KF, de Castro SM, Wesseling JG, ten Kate FJ, Offerhaus GJ, Busch OR, van Gulik TM, Obertop H, Gouma DJ (2004) Surgical treatment of pancreatic adenocarcinoma; actual survival and prognostic factors in 343 patients. Eur J Cancer 40, 549-558. Lim JE, Chien MW, Earle CC (2003) Prognostic factors following curative resection for pancreatic adenocarcinoma: a population-based, linked database analysis of 396 patients. Ann Surg. 237, 74-85. Lin PW, Lin YJ (1999) Prospective randomized comparison between pylorus-preserving and standard pancreaticoduodenectomy. Br J Surg 86, 603-607. Lowenfels AB, Maisonneuve P (2002) Epidemiologic and etiologic factors of pancreatic cancer. Hematol Oncol Clin North Am 16, 1-16. Luttges J, Vogel I, Menke M, Henne-Bruns D, Kremer B, Kloppel G (1998) The retroperitoneal resection margin and vessel involvement are important factors determining survival after pancreaticoduodenectomy for ductal adenocarcinoma of the head of the pancreas. Virchows Arch 433, 237-242. Michl P, Pauls S, Gress TM (2006) Evidence-based diagnosis and staging of pancreatic cancer. Best Pract Res Clin Gastroenterol 20, 227-251. Millikan KW, Deziel DJ, Silverstein JC, Kanjo TM, Christein JD, Doolas A, Prinz RA (1999) Prognostic factors associated with resectable adenocarcinoma of the head of the pancreas. Am Surg 65, 618-623; discussion 623-614. Neoptolemos JP, Stocken DD, Dunn JA, Almond J, Beger HG, Pederzoli P, Bassi C, Dervenis C, Fernandez-Cruz L, Lacaine F, Buckels J, Deakin M, Adab FA, Sutton R, Imrie C, Ihse I, Tihanyi T, Olah A, Pedrazzoli S, Spooner D, Kerr DJ, Friess H, Buchler MW (2001) Influence of resection margins on survival for patients with pancreatic cancer treated by
III. Conclusions In the hope of prolonging survival, adjuvant chemoradiotherapy and chemotherapy (using single agents or combination drugs) has been tried in several trials with variable success. Most studies compared adjuvant 5-FUbased chemo-radiation with surgery alone but results are not unanimous with trials showing positive (GITSG), none (EORTC, RTOG 97-04), or negative (ESPAC-1) effects on survival. However tree randomized trials (Norwegian, ESPAC-1, and CONKO-001) support the benefit of adjuvant chemotherapy. Two meta-analyses (Stocken et al, 2005; Boeck et al, 2007) indicate that adjuvant chemotherapy can increase disease-free survival, although but also that its effect on the 5-year survival rate did not reach statistical significance. In conclusion there is evidence which support the benefit of adjuvant chemotherapy after resection of pancreatic cancer but further randomized trials are needed to find the optimal chemotherapy regimen. In particular trials to investigating the role of gemcitabine-based regimens in this group of patients are warranted. Future studies should adhere to a broadly accepted and standardized protocol for pancreatic specimen examinations which would enable the generation of comparable data from different institutions (Esposito et al, 2008).
References Gastrointestinal Tumor Study (1987) Further evidence of effective adjuvant combined radiation and chemotherapy following curative resection of pancreatic cancer. Gastrointestinal Tumor Study Group. Cancer 59, 2006-2010. National Cancer Institute: (2003a) Phase II/III Randomized Study of Gemcitabine Followed By Chemoradiotherapy With Gemcitabine Versus Gemcitabine Alone After Prior Curative Resection in Patients With Pancreatic Head Adenocarcinoma. National Cancer Institute: Bethesda. National Cancer Intitute: (2003b) Phase III Randomized Adjuvant Study of Gemcitabine Versus Fluorouracil and Leucovorin Calcium Versus Observation in Patients With Completely Resected Pancreatic Cance. National Cancer Intitute: Bethesda. Bakkevold KE, Arnesjo B, Dahl O, Kambestad B (1993) Adjuvant combination chemotherapy (AMF) following radical resection of carcinoma of the pancreas and papilla of Vater--results of a controlled, prospective, randomised multicentre study. Eur J Cancer 29A, 698-703. Boeck S, Ankerst DP, Heinemann V (2007) The role of adjuvant chemotherapy for patients with resected pancreatic cancer: systematic review of randomized controlled trials and metaanalysis. Oncology 72, 314-321. Bramhall SR, Allum WH, Jones AG, Allwood A, Cummins C, Neoptolemos JP (1995) Treatment and survival in 13,560 patients with pancreatic cancer, incidence of the disease, in the West Midlands: an epidemiological study. Br J Surg 82, 111-115. Burris HA, 3rd, Moore MJ, Andersen J, Green MR, Rothenberg ML, Modiano MR, Cripps MC, Portenoy RK, Storniolo AM, Tarassoff P, Nelson R, Dorr FA, Stephens CD, Von Hoff DD (1997) Improvements in survival and clinical benefit with gemcitabine as first-line therapy for patients with advanced pancreas cancer: a randomized trial. J Clin Oncol 15, 24032413.
232
Cancer Therapy Vol 7, page 233 adjuvant chemoradiation and/or chemotherapy in the ESPAC-1 randomized controlled trial. Ann Surg 234, 758768. Neoptolemos JP, Stocken DD, Friess H, Bassi C, Dunn JA, Hickey H, Beger H, Fernandez-Cruz L, Dervenis C, Lacaine F, Falconi M, Pederzoli P, Pap A, Spooner D, Kerr DJ, Buchler MW (2004) A randomized trial of chemoradiotherapy and chemotherapy after resection of pancreatic cancer. N Engl J Med 350, 1200-1210. Nishimura Y, Hosotani R, Shibamoto Y, Kokubo M, Kanamori S, Sasai K, Hiraoka M, Ohshio G, Imamura M, Takahashi M, Abe M (1997) External and intraoperative radiotherapy for resectable and unresectable pancreatic cancer: analysis of survival rates and complications. Int J Radiat Oncol Biol Phys 39, 39-49. Nordback IH, Hruban RH, Boitnott JK, Pitt HA, Cameron JL (1992) Carcinoma of the body and tail of the pancreas. Am J Surg 164, 26-31. Oettle H, Post S, Neuhaus P, Gellert K, Langrehr J, Ridwelski K, Schramm H, Fahlke J, Zuelke C, Burkart C, Gutberlet K, Kettner E, Schmalenberg H, Weigang-Koehler K, Bechstein WO, Niedergethmann M, Schmidt-Wolf I, Roll L, Doerken B, Riess H (2007) Adjuvant chemotherapy with gemcitabine vs observation in patients undergoing curative-intent resection of pancreatic cancer: a randomized controlled trial. JAMA 297, 267-277. Regine WF, Winter KA, Abrams RA, Safran H, Hoffman JP, Konski A, Benson AB, Macdonald JS, Kudrimoti MR, Fromm ML, Haddock MG, Schaefer P, Willett CG, Rich TA (2008) Fluorouracil vs gemcitabine chemotherapy before and after fluorouracil-based chemoradiation following resection of pancreatic adenocarcinoma: a randomized controlled trial. JAMA 299, 1019-1026. Richter A, Niedergethmann M, Sturm JW, Lorenz D, Post S, Trede M (2003) Long-term results of partial pancreaticoduodenectomy for ductal adenocarcinoma of the pancreatic head: 25-year experience. World J Surg 27, 324329. Smeenk HG, van Eijck CH, Hop WC, Erdmann J, Tran KC, Debois M, van Cutsem E, van Dekken H, Klinkenbijl JH, Jeekel J (2007) Long-term survival and metastatic pattern of pancreatic and periampullary cancer after adjuvant chemoradiation or observation: long-term results of EORTC trial 40891. Ann Surg 246, 734-740. Smith SL, Rajan PS (2004) Imaging of pancreatic adenocarcinoma with emphasis on multidetector CT. Clin Radiol 59, 26-38. Sohn TA, Yeo CJ, Cameron JL, Koniaris L, Kaushal S, Abrams RA, Sauter PK, Coleman J, Hruban RH, Lillemoe KD (2000) Resected adenocarcinoma of the pancreas-616 patients:
results, outcomes, prognostic indicators. J Gastrointest Surg 4, 567-579. Sperti C, Pasquali C, Piccoli A, Pedrazzoli S (1997) Recurrence after resection for ductal adenocarcinoma of the pancreas. World J Surg 21, 195-200. Staley CA, Cleary KR, Abbruzzese JL, Lee JE, Ames FC, Fenoglio CJ, Evans DB (1996) The need for standardized pathologic staging of pancreaticoduodenectomy specimens. Pancreas 12, 373-380. Stocken DD, Buchler MW, Dervenis C, Bassi C, Jeekel H, Klinkenbijl JH, Bakkevold KE, Takada T, Amano H, Neoptolemos JP (2005) Meta-analysis of randomised adjuvant therapy trials for pancreatic cancer. Br J Cancer 92, 1372-1381. Takada T, Amano H, Yasuda H, Nimura Y, Matsushiro T, Kato H, Nagakawa T, Nakayama T (2002) Is postoperative adjuvant chemotherapy useful for gallbladder carcinoma? A phase III multicenter prospective randomized controlled trial in patients with resected pancreaticobiliary carcinoma. Cancer 95, 1685-1695. Takada T, Yasuda H, Amano H, Yoshida M, Ando H (1997) Results of a pylorus-preserving pancreatoduodenectomy for pancreatic cancer: a comparison with results of the Whipple procedure. Hepatogastroenterology 44, 1536-1540. Takai S, Satoi S, Toyokawa H, Yanagimoto H, Sugimoto N, Tsuji K, Araki H, Matsui Y, Imamura A, Kwon AH, Kamiyama Y (2003) Clinicopathologic evaluation after resection for ductal adenocarcinoma of the pancreas: a retrospective, single-institution experience. Pancreas 26, 243-249. Tran KT, Smeenk HG, van Eijck CH, Kazemier G, Hop WC, Greve JW, Terpstra OT, Zijlstra JA, Klinkert P, Jeekel H (2004) Pylorus preserving pancreaticoduodenectomy versus standard Whipple procedure: a prospective, randomized, multicenter analysis of 170 patients with pancreatic and periampullary tumors. Ann Surg 240, 738-745. Verbeke CS (2008) Resection margins and R1 rates in pancreatic cancer--are we there yet? Histopathology 52, 787-796. Verbeke CS, Leitch D, Menon KV, McMahon MJ, Guillou PJ, Anthoney A (2006) Redefining the R1 resection in pancreatic cancer. Br J Surg 93, 1232-1237. Westerdahl J, Andren-Sandberg A, Ihse I (1993) Recurrence of exocrine pancreatic cancer--local or hepatic? Hepatogastroenterology 40, 384-387. Wong JC, Lu DS (2008) Staging of pancreatic adenocarcinoma by imaging studies. Clin Gastroenterol Hepatol 6, 13011308
233
Cancer Therapy Vol 7, page 234 Cancer Therapy Vol 7, 234-239, 2009
Schnitzler´s syndrome – complete resolution of symptoms on treatment with anakinra after 12 years of unsuccessful therapy with other regimens Review Article
Zden!k Adam1, Lud!k Pour L1, Marta Krej"i1, Ji#í Neubauer J2, Ji#í Prá$ek3, Tomá$ Büchler4, Roman Hájek1 1
Department of Internal Medicine – Hematooncology Department of Radiology 3 Department of Nuclear Medicine, Faculty of Medicine and University Hospital, Masaryk University, Brno, Czech Republic 4 Department of Oncology, Thomayer University Hospital and 1st Faculty of Medicine, Charles University, Prague, Czech Republic 2
_________________________________________________________________________________ *Correspondence: Prof. Dr. Zdenek Adam, Department of Internal Medicine – Hematooncology, Faculty of Medicine and University Hospital, Masaryk University, Jihlavska 100, 625 00 Brno, Czech Republic, Tel: +42054719-3644, Fax: +42054719-3603, email: z.adam@fnbrno.cz Key words: Schnitzler´s syndrome, Gammapathy, Urticaria, Anakinra Received: 18 March 2009; Revised: 3 April 2009 Accepted: 7 April 2009; electronically published: 13 April 2009
Summary Schnitzler´s syndrome is a rare disorder characterized by chronic urticaria, the presence of monoclonal class IgM immunoglobulin, lymphadenopathy and fevers. We report on a patient who was diagnosed in 1996 and over the next 12 years underwent a number of therapies. Bone pain associated with proven osteolytic and osteosclerotic lesions resolved on regular bisphosphonate treatment with pamidronate and, later, clodronate. The patient had transient benefit from treatments with interferon-% and with PUVA. No therapeutic effects were seen with highdose dexamethasone, 2-chlordeoxyadenosin, cyclosporine, or the combination of bortezomib, thalidomide, and dexamethasone. However, on therapy with anakinra the patient’s skin symptoms resolved completely and the values of CRP and hemoglobin normalized.
I. Introduction In 1974, Schnitzler and collaborators described five patients with chronic urticaria (urticarial vasculitis) associated with bone lesions (a combination of hyperostosis and osteolysis), lymphadenopathy and the presence of IgM monoclonal immunoglobulin. Further description of the clinical course of these patients was published in 1989 (Schnitzler 1974, 1989). Diagnostic criteria and the most common symptoms are summarized in Table 1. Schnitzler´s syndrome is a differential diagnosis to consider in a patient with chronic urticaria and fever of unknown origin (de Kleijn 1997, de Koning, 2007). We describe the clinical course and effects of various treatments in a patient who has been in our care over the past 12 years.
II. Case report A 45-year-old male with unremarkable medical history presented in 1989 to a dermatology clinic with urticarial rash. No cause for the rash was identified but six years later he was referred to a hematology clinic with suspicion for Waldenström macroglobulinemia after the detection of monoclonal IgM immunoglobulin in the serum. At this time, the patient reported unbearable itch of large urticarial skin lesions and pain in the lumbar spine and pelvis. Laboratory and radiological investigations were carried out with the following results: • CT of mediastinum and abdomen - no lymphadenopathy or other abnormal findings • Bone marrow biopsy – fibrous bone marrow, no pathologic infiltration
234
Cancer Therapy Vol 7, page 235 •
• • •
•
• •
Blood cell counts - leukocytes: 9.78•109/l, erythrocytes: 4.06•1012/l, hemoglobin 128 g/l, platelets: 278•109/l. neutrophils 6.3•109/l. Beta2-microglobulin: 0.90 g/l Total serum protein 85 g/l, urine protein 0.16 g/l Immunofixation and densitometric quantification of serum and urine monoclonal immunoglobulin – IgM kappa, concentration 17.4 g/l, presence of traces of kappa light chains in the urine Polyclonal immunoglobulins - IgG 16.6 g/l, IgA 2.30 g/l, polyclonal IgM was not measured because of the presence of monoclonal IgM C-reactive protein elevated to 46 mg/l, erythrocyte sedimentation rate increased Other laboratory parameters including urea, creatinine, electrolytes, and liver tests were in the normal range.
The working diagnosis was that of IgM monoclonal gammapathy of unknown significance (MGUS) with urticaria of unknown origin. None of the available antihistamines was able to control the pruritus. Some, but not complete, relief of the itch and a reduction in the urticarial rash was obtained with prednisone which was dosed 10-30mg per day according to the intensity of the symptoms and maintained as a long-term medication. In June 1996, the patient complained of worsening pains in the sacroiliac joint, pelvis, and hip joints as well as intermittent fevers. Increased temperature correlated with the formation of new urticarial lesions. On examination, the findings were unremarkable except for extensive urticarial eruptions. There was no palpable lymphadenopathy, hepato- or splenomegaly. CT of the pelvis was indicated because of the bone pain and arthralgia and it revealed a combination of sclerotic lesions and small areas of osteolysis in the right iliac
bone (Figure 1-3). Mild splenomegaly was also seen. Bone scan showed significant accumulation of the radioisotope in the right pelvis and the right sacroiliac joint (Figure 4). Skin biopsy was undertaken and the histological examination findings were non-specific and consistent with urticaria, i.e. perivascular infiltrates composed of lymphocytes, histiocytes, and neutrophils. No clonal cell populations were detected. The level of beta2-microglobulin was within the normal range, but CRP levels continued to be high, ranging between 46 and 70 mg/l. These findings meet the diagnostic criteria for Schnitzler syndrome. Another pathologic finding was that of osteopenia that could be either diseaseor treatment.related. The bone density gradually decreased over the follow-up, from -0.8 SD in 1999 to -1.1 SD in 2008 in the L2-L4 region. The various treatments that were used in the patient are summarized below.
A. Bisphosphonates As soon as bone lesions were detected we started the patient on pamidronate 90 mg in 28-day intervals. Later we hanged the treatment to clodronate 900 mg intravenous infusion in 14-day intervals or 1500mg intravenous infusion in 28-day intervals. Over the 12 years of treatment, the therapy was interrupted three times and the bone pains always reappeared but were promptly suppressed upon retreatment with bisphosphonates.
B. High-dose dexamethasone High-dose dexamethasone (40 mg orally days 1-4, 1013, and 20-23 of a 28-day cycle) is useful in the treatment of multiple myeloma. We used the therapy over 3 months in an attempt to induce remission and control the patient’s symptoms. However, a relief in the symptoms as well as objective improvements only occurred on the days when dexamethasone was given. The treatment did not have longterm efficacy and was discontinued.
Table 1. Diagnostic criteria of Schnitzler syndrome (Lipsker 2001). Major criteria • •
Minor criteria
urticarial skin rash monoclonal IgM component or IgG by variant type
• • • • • •
intermitent fever or subfebrile episodes arthralgia or arthritis or bone pain palpable lymph nodes liver or spleen enlargement elevated erythrocyte sedimentation rate leukocytosis
•
abnormal finding on bone morphologic investigation
Diagnosis of Schnitzler syndrome requires the presence of two major criteria and at least two minor criteria, and the exclusion of the following disorders: hyperIgD syndrome, adult-onset Still disease, urticarial vasculitis with decreased complement level, acquired CT inhibitor deficiency, cryoglobulinemia.
235
Zden!k et al: Schnitzler´s syndrome and treatment with anakinra
Figure 1: Osteolytic – osteosclerotic changes of the facial bones
Figure 2:Mix of osteolytic and osteosclerotic changes of pelvis bones, with a light periostal apposition on the left.
Figure 3: Discrete osteosclerotic changes in the basis of iliac bones, the changes are more pronounced on the left.
The intensity of these symptoms increased with the length of interferon therapy and gradually outweighed its benefits.
C. 2-chlordeoxyadenosine (2-CDA) 2-CDA exhibits significant activity in Waldenström macroglobulinemia. We hypothesized that it may be a useful therapy for Schnitzler syndrome which is also associated with IgM monoclonal gammapathy. 2-CDA was administered in a dose of 0.1 mg/kg/day by intravenous infusion over 7 days. Overall, 3 cycles were given. The rash disappeared only for 14 days following the infusion and afterwards reappeared in the same intensity. The concentration of monoclonal immunoglobulin remained unchanged. The therapy was terminated after 3 cycles due to the lack of a lasting response.
E. Psoralen plus UVA (PUVA) treatment PUVA treatment was started in May 2001 after the interferon therapy in an attempt to control the pruritus affecting almost all of the skin. Urticarial rash was effectively suppressed during the PUVA treatment but small, punctuate, and intensively pruritic indurations did keep appearing. The treatment continued until March 2003 and was stopped upon request of the patient who did not consider it beneficial anymore.
D. Interferon-!
F. Cyclosporin A
Interferon-! was given in the dose of 3 MU subcutaneously three times weekly starting in 1998. The intensity of pruritus as well as the area of urticaria decreased on the treatment. The treatment continued for two years and eventually was terminated because of toxicities associated with log-term interferon treatment which included flu-like syndrome, fatigue, and depression.
A therapeutic trial of cyclosporin A 5mg/kg (total dose 300mg) was started in June 2004 based on published reports. However, after 3 months of therapy there was no objective or subjective response. Moreover, the treatment was complicated by a generalized cutaneous fungal infection.
236
Cancer Therapy Vol 7, page 237 during the treatment but as soon as one month after the last cycle they both returned to their original strength.
I. Anakinra First reports on the efficacy of anakinra, an interleukin-1 receptor antagonist, in Schnitzler syndrome were published in 2005 (Martinez-Taboada et al. 2005). The patient started receiving therapy with subcutaneous daily injections of anakinra in November 2007. The extent of urticarial exanthema before the first injection of anakinra is shown in figures 5, 6, 7, and 8. After the first injection of anakinra, urticaria regressed significantly and after the third injection both pruritus and rash resolved completely (Fig. 9 and 11). The treatment with anakinra was well tolerated. We were able to discontinue prednisone, the only other drug that had partially controlled the pruritus in the long term but that had also caused steroid-induced diabetes requiring insulin. To completely suppress the patient’s symptoms, it was necessary to apply anakinra injections daily. Alternate-day administration was attempted but some pruritus did reappear on this lower-intensity regimen. The level of CRP returned to normal range and the anemia of chronic disease resolved. Neutrophil counts remained lower during anakinra treatment but did not decrease below 1·109/l. Monoclonal IgM levels have been stable, the value in 1995 was 17.4 g/l, similar to the 2008 level of 21 g/l. The levels of polyclonal immunoglobulins have significantly decreased since diagnosis: total IgG from 16.6 g/l to 3.29 g/l, and total IgA from 2.30 to 0.12 g/l. We did not observe an increased occurrence of infections despite the low neutrophil counts and reduced levels of polyclonal immunoglobulins. The patient continues on the bisphosphonate clodronate in a dose of 1500mg intravenously once monthly. The intensity of pruritus and the extent of urticaria receded during the treatment but as soon as one month after the last cycle they both returned to their original strength.
Figure 4: Technetium Tc 99m pyrophosphate bone scan. Areas of increased uptake are seen in the following areas: 3rd and 4th right ribs anteriorly, 6th and 7th left ribs anteriorly, right sacroiliac joint, right iliac bone, left stenoclavicular joint, and right metatarsu.
G. Thalidomide Based on published reports of efficacy of thalidomide in multiple myeloma and other hematologic disorders including Schnitzler syndrome, the treatment was initiated in September 2004 in a dose of 100mg once daily. The patient soon reported a 50% reduction in the intensity of pruritus. After 4 months of treatment, however, the patient declined to continue in the therapy as he felt that the side effects of thalidomide exceed its benefits.
III. Discussion Schnitzler syndrome is an uncommon disease that is, possibly, often misdiagnosed. There are approximately 50 cases described in the literature. The median age of the reported patients was 60 years (Lipsker 2001, de Koning 2007). Several treatment approaches to a patient with Schnitzler syndrome have been suggested (reviewed by de Koning 2007) but their long-term efficacy was inconsistent at best. We have applied some of the more promising treatment regimens in our patient with little or no therapeutic effect. Anakinra, an antagonist of interleukin-1 receptor, has been reported to be highly active in patients with Schnitzler syndrome. In all reported cases, the first injection of the drug induced complete regression of pruritus and rash (de Koning 2006, Eiling 2007, Gilson 2007, Martines 2005, Schneider 2007, Treudler 2007).
H. Bortezomib Bortezomib became available in 2005 as a novel and highly active agent for the treatment of multiple myeloma and other indolent lymphoproliferative diseases. We decided to treat the patient with a combined bortezomibbased regimen (bortezomib 1.3 mg/m2 day 1, 4, 8, and 11, thalidomide 100 mg daily, and dexamethasone 40 mg days 1-4 and 8-11 of a 21-day cycle). Dexamethasone was subsequently reduced from 40mg to 20mg because of steroid-induced diabetes and, starting with cycle 5, bortezomib was given only on days 1 and 4 because of thrombocytopenia. Overall, 9 cycles were administered. The intensity of pruritus and the extent of urticaria receded 237
Zden!k et al: Schnitzler´s syndrome and treatment with anakinra
Figure 5 Figure 9
Figure 6
Figure 10
Figure 7
Figure 11 Figures 9-11: Almost complete resolution of the urticaria on the third day after the start of anakinra therapy.
Figure 8 Figures 5-8: Urticarial eruption in Schnitzler syndrome before the onset of anakinra treatment.
238
Cancer Therapy Vol 7, page 239 de Koning HD, Bodar EJ, Simon A, van der Hilst JCH, Netea MG, van der Meer MWM (2006). Beneficial response to anakinra and thalidomide in Schnitzler's syndrome. Ann Rheum Dis, 65(4): 542-4. Eiling E, Möller M, Kreiselmaier I, Brach J, Schwarz T. (2007) Schnitzler syndrome: treatment failure to rituximab but response to anakinra. J Am Acad Dermatol, 57(2): 361-4.
The longest reported treatment with anakinra was three years, and the patient remained in symptom remission throughout this period (de Koning 2006). Our experience confirms partial treatment effects of interferon-! and PUVA. However, other treatments including high-dose dexamethasone, 2-CDA, thalidomide, cyclosporine A, and a bortezomib/thalidomide /dexamethasone combination regimen were inefficient in our patient. Treatment with anakinra led to prompt resolution of all symptoms, including severe pruritus, fevers, and urticaria, that had significantly limited the quality of life of this patient over the previous 18 years.
Gilson M, Abad S, Larroche C, Dhote R. (2007) Treatment of Schnitzler's syndrome with anakinra. Clin Exp Rheumatol, 25(6): 931. Martinez-Taboada VM, Fontalba A, Blanco R, Fernandez-Luna JL. (2005) Successful treatment of refractory Schnitzler´s syndrome with anakinra: Arthritis Rheum, 52(7): 2226-7. Schneider SW, Gaubitz M, Luger TA, et al. (2007) Prompt response of refractory Schnitzler´s syndrome to treatment with anakinra. J Am Acad Dermatol, 56(5 Suppl): S120-2. Treudler R, Kauer F, Simon JC. (2007) Striking effect of the IL1 receptor antagonist anakinra in chronic urticarial rash with polyclonal increase in IgA and IgG. Acta Derm Venereol, 87(3): 280-1.
Acknowledgments This work was supported in part by grants MSMT:LC 06027 and VZ 0021622434.
References Schnitzler L, Hurez D, Verret JL (1989) Urticaire chronique osteoconcensation-macroglobulinemie. Cas Princeps Etude sur 20 ans Ann. Dermatol Venereol, 116: 547-550. Schnitzler L, Schubert B, Boasson M, et al. (1974) Urticaire chronique lesions osseuses macroglobulinémie IgM: Maladie de Waldenström? Bull Soc Fr Dermatol Syph, 81: 363-366. de Kleijn EM, Telgt D, Laan R. (1997) Schnitzler's syndrome presenting as fever of unknown origin (FUO). The role of cytokines in its systemic features. Neth J Med, 51(4):140-2. de Koning HD, Bodar EJ, van der Meer JW, A. Simon on befalf of the Schnitzler´s Syndrome Study Group (2007) Schnitzler´s syndrome: beyond the case reports: review and follow-up of 94 patients with an emphasis on prognosis and treatment. Semin Arthritis Rheum, 37(3): 137-48.
Prof Dr. Zdenek Adam
239
Cancer Therapy Vol 7, page 245 Cancer Therapy Vol 7, 245-250, 2009
Lymph node retrieval and assessment in colorectal cancer Review Article
Vijaya V. Mysorekar* Department of Pathology, M.S. Ramaiah Medical College, Bangalore, India
__________________________________________________________________________________ *Correspondence: Dr. Vijaya V. Mysorekar, 89, A.G.â&#x20AC;&#x2122;s office colony, 5th main, 6th cross, New BEL Road, Bangalore â&#x20AC;&#x201C; 560 054. India. Email: vijayamysorekar@yahoo.com, Tel: 91-080-23600395, Fax: 91-080-23606213 Key words: colorectal cancer, lymph node assessment, staging, prognosis, survival Received: 16 March 2009; Accepted: 2 April 2009; electronically published: 14 April 2009
Summary The single most important determinant of prognosis in patients with apparently localised carcinoma of the colon and rectum is the presence or absence of nodal metastases at the time of surgical treatment. The survival of a patient with nodal metastases can be prolonged with adjuvant chemotherapy. Thus, a complete regional lymph node clearance by the surgeon, and a detailed evaluation for nodal involvement, by the pathologist, are two factors of crucial importance to avoid understaging and to ensure appropriate treatment decisions in colorectal cancer. In this article, the various factors influencing the adequacy of lymph node assessment, and the methods to improve lymph node retrieval in colorectal resection specimens, are reviewed.
to search diligently for nodes. Failure to examine enough lymph nodes may be associated with incorrectly designating a patient as having no metastases in the lymph nodes (Stage I or II). As the delivery of adjuvant treatment, to a large extent, is dependent on nodal status, understaging of colorectal cancer might cause clinicians not to offer adjuvant chemotherapy, thus reducing the patientâ&#x20AC;&#x2122;s survival rate.
I. Introduction Colorectal cancer is a leading cause of morbidity and mortality in the developed world, with age-adjusted rates of 26.6/100,000/year in females and 40.0/100,000/year in males (IARC GLOBOCAN, 2002). In developing countries, although the incidence rates of colorectal cancer are lower, an increasing number of these cases are now being found in the urban population. An intriguing observation is the occurrence of rectal cancer in young Indians (Mohandas and Desai, 1999). Adequate retrieval and assessment of lymph nodes in colorectal resection specimens is critical for accurate determination of patient prognosis, and treatment planning. The identification of metastases in lymph nodes in a colorectal resection specimen denotes a cancer that is associated with significantly worse prognosis. Five-year survival for stage I colorectal cancer is 80-85% and for stage II colorectal cancer is 70-75%, and these patients are generally treated with surgery alone (Wright et al, 2003). In contrast, survival for patients with positive lymph nodes (stage III) is only 45% with surgery alone. These patients with stage III disease derive a 33% increased survival benefit from a combination of surgery and adjuvant chemotherapy (Wright et al, 2003). Optimal lymph node retrieval and assessment require: i) the surgeon to remove an adequate length of specimen and adjoining mesentery, and ii) the pathologist
II. Guidelines for lymph node assessment Recent National Cancer Institute guidelines (Nelson et al, 2001) suggest that a minimum of 12 lymph nodes is required to accurately determine whether a patient has positive lymph nodes. In other studies, the recommended minimum number of nodes that need to be examined to accurately stage the regional lymph node basin, has varied from 6 to 18 (Hernanz et al, 1994; Goldstein et al, 1996, Caplin et al, 1998; Wong et al, 1999; Cianchi et al, 2002; Berberoglu, 2004; Yoshimatsu et al, 2005; Jha et al, 2006; Tsai et al, 2007; Tsai et al, 2008). There are some authors who feel that the minimum number of lymph nodes to be harvested in colorectal cancer specimens cannot be set at a fixed number (Tekkis et al, 2006). However, it has generally been agreed upon, that examining an increased number of lymph nodes increases the probability that, if present, positive nodes will be detected. Thus, more the 245
Mysorekar: Lymph node retrieval and assessment in colorectal cancer nodes removed, more accurate is the staging of colorectal cancer. Hence, it is recommended that a thorough search and subsequent examination, of all lymph nodes identified, should be done. The number of positive lymph nodes found, along with the total number of lymph nodes assessed, should be reported. The small lymph nodes seen on histology, immediately adjacent to the tumour, must also be assessed. In spite of the above guidelines, it has been found that many centres do not assess the suggested number of lymph nodes needed to accurately define node negativity in a colorectal cancer specimen. Wright and colleagues found in 2003 that in their studied population, 73% of stage II specimens had fewer than 12 lymph nodes assessed, and in 4% of these cases, no lymph nodes were assessed. Morris and colleagues found in 2007 that although the overall percentage of patients receiving adequate lymph node assessment increased year over year during their study period, even in the year 2003, only 35.7% of stage I patients obtained an adequate lymphadenectomy, according to the 12-node standard. They feel that approximately 9% of their population were misstaged. These authors have shown a 5.4% 5-year survival difference (58.8% versus 53.4%) between patients who did or did not receive an adequate lymphadenectomy. Disease recurrence in stage II colon cancer patients has been attributed to inaccurate staging due to inadequate retrieval and assessment of lymph nodes (Law et al, 2003). Hence, it has been suggested that those patients with stage II colorectal cancer with only a few nodes examined, should be offered postoperative chemotherapy on a routine basis, because of the distinct possibility that they have been understaged (Sarli et al, 2005).
found to be similar in both obese and non-obese patients (Gรถrรถg et al, 2003). Thus, obesity cannot be an excuse by the surgeon to justify poor lymph node retrieval.
D. Specimen length An adequately resected specimen should include the segment of colon containing the tumour, along with its associated lymph node-bearing mesentery upto the level of the origin of the main lymphovascular supply to that segment of the colon (Wong et al, 1999; Nelson et al, 2001). Increased specimen length provides the pathologist with enough lymph nodes to dissect.
E. Tumour location Right-sided resection specimens are usually longer and contain larger amounts of mesentery than left-sided resections, because of the anatomy of the bowel. This may make it easier to identify more nodes in right colon cancers (Caplin et al, 1998; Morris et al, 2007). The number of lymph nodes retrieved is lower in rectal than in colonic specimens (Wong et al, 1999; Tekkis et al, 2006; Rullier et al, 2008). This is due to the smaller specimen length and the smaller size of the lymph nodes in rectal cancer specimens (85% of lymph nodes less than 5 mm) (Dworak, 1989).
F. Tumour size Better lymph node retrieval is associated with larger tumours (Wright et al, 2003; Thorn et al, 2004; Morris et al, 2007, Rullier et al, 2008). This may not always be due to metastases. Larger tumours are expected to provide a more intense antigenic immune challenge to the draining lymph nodes, making them more visible to the examining pathologist (Wright et al, 2003; Morris et al, 2007). Distension and prominence of the lymphatic sinusoids, called sinus histiocytosis, may represent a host immune response against neoplastic cell products. This is a common cause for enlargement of lymph nodes draining cancer, even in the absence of metastatic spread.
III. Factors influencing lymph node retrieval in colorectal resection specimens A. Age Better lymph node yield is obtained in younger patients (Wright et al, 2003; Morris et al, 2007; Tekkis et al, 2006). There is evidence to suggest that the size of nodes reduces as patients get older, and this may make it more difficult to identify and retrieve them (Morris et al, 2007). However, a confounding factor here, is the less extensive surgery performed by surgeons, on older patients.
G. Extent of local invasion A higher yield of lymph nodes is obtained in cases of tumours with more advanced local invasion (Wright et al, 2003; Morris et al, 2007).
H. Nodal size B. Sex
Nodes may sometimes exhibit adipose metaplasia (i. e. they are infiltrated by fat except for a thin peripheral semilunar rim) and are hence difficult to identify grossly (Rosai, 2004). Node-positive specimens are more likely to have larger nodes, which, therefore, leads to an increased yield, whereas node-negative specimens have smaller nodes, which are more difficult to recover (Wong et al, 1999). However, it must be noted that lymph nodes involved by metastases are frequently less than 5 mm in size. Authors have shown that 61-77% of positive lymph nodes are likely to be less than 5 mm in greatest dimension (Herrera-Ornelas et al, 1987).
The odds of adequate lymphadenectomy increase in female patients, probably due to the sex differences in pelvic anatomy that affect the ease of surgical clearance (Morris et al, 2007).
C. Obesity Obesity has been found to decrease lymph node recovery in rectal resections, when the length of the specimen is short (16 cm or less) (Gรถrรถg et al, 2003). No definite explanation for this finding, has been offered. However, the surgeon can overcome this problem by resecting a longer segment of the rectum (more than 16 cm), in which case, the lymph node recovery has been 246
Cancer Therapy Vol 7, page 247
IV. Methods to improve lymph node retrieval
I. Immune response There may be less immune response generated by certain aggressive tumours, or a subset of patients may have a diminished immune response. Both may lead to smaller lymph nodes, with a lower number thus being identified (Caplin et al, 1998; Sarli et al, 2005).
A. Adequate surgery The lymphatic drainage and route of metastatic spread for tumours of the right colon, is along the right and middle colic arteries and their branches, to the preaortic nodes around the origin of the superior mesenteric artery. Tumours of the left colon and rectum drain along the left colic artery and superior rectal artery respectively, to the pre-aortic nodes around the origin of the inferior mesenteric artery (Gabella, 1995). A significant proportion of draining lymph nodes are situated along the mesenteric arteries, and hence, ligation of these arteries at their aortic origin, is recommended. Thus, an adequate colorectal resection requires en bloc removal of the cancer with sufficient proximal and distal bowel to encompass potential submucosal lymphatic tumour spread, and should include the mesentery with draining lymphatics and lymph nodes upto the level of origin of the main lymphovascular supply to that segment of the bowel (Wong et al, 1999). High ligation of the mesenteric arteries also prevents potential intravascular dissemination of cancer cells during tumour manipulation (Titu et al, 2008).
J. Preoperative radiotherapy Lymphoid tissue is highly radiosensitive. Preoperative radiotherapy administered to patients with locally advanced rectal cancer causes apoptosis (Rullier et al, 2008), lymphocyte depletion and fibrosis (Sermier et al, 2006) in the lymph nodes, leading to shrinkage of the lymph node size. This results in a significant decrease (about 25%) of lymph nodes detected within the tumourbearing specimen. Thus, there is significant downstaging with fewer positive lymph nodes, in these cases (Wichmann et al, 2002; Sermier et al, 2006; Rullier et al, 2008). The dose of radiotherapy influences the number of lymph nodes retrieved (Rullier et al, 2008). Sermier et al (2006) found, in their study, that 31% of patients of rectal cancer who underwent preoperative radiotherapy had 4 or less nodes in their surgical specimen, resulting in inadequate tumour staging. They also found that the longer the delay between radiotherapy and surgery, the lower is the yield of lymph nodes in the mesorectum. In a study by Beresford and colleagues in 2005, the median number of lymph nodes recovered in 161 surgically resected specimens of rectal cancer after preoperative chemoradiation, was 5. They found that node-negative patients with at least 3 nodes recovered, had a 3-year survival rate of 70%. On the other hand, node-negative patients in whom 2 or less nodes were recovered, or patients with positive nodes, had a lower 3-year survival rate.
B. Proper technique and meticulousness in lymph node dissection by the pathologist The procedure for lymph node dissection is as follows: The fat containing the nodes is first dissected from the colon in the fresh state, using forceps and sharp scissors. In the gastrointestinal tract, most of the nodes are found in very close proximity to the muscular wall of the organ, so dissection of fat should be done in such a way as to expose the clean muscular surface (Rosai, 2004). The fat has to be shredded to dissect out all the lymph nodes. One should be gentle with the nodes at the time of dissection, as nodes dissected before fixation can be easily crushed. Alternatively, one can fix the fat overnight in 10% formalin or Carnoy’s solution, and search for nodes the next day. Carnoy’s solution is a mixture of ethanol, chloroform and glacial acetic acid (Puchtler et al, 1968). This solution dissolves most of the fat and at the same time, fixes the lymph nodes, rendering them firm in consistency, so that they can be easily palpated. Kelder and colleagues reported, in 2008, improved lymph node retrieval by the use of modified Davidson’s fixative which is a mixture of ethanol, formalin and glacial acetic acid. All lymph nodes isolated should be submitted for histology, the processing being done in the conventional manner. Small lymph nodes upto 3 mm in size can be submitted as a single piece. Several small node groups may be microscopically examined on a single glass slide. Larger lymph nodes are bisected, and, if necessary, further cut into 2 to 3 mm slices. Each large node can be studied on a separate slide. If the number of nodes found in a given specimen is substantially lower than that expected for that operation, it may be advisable to consult a senior pathologist or the concerned surgeon before proceeding further. It has been recommended that when less than 12 lymph nodes are found, an additional 24-hour fixation in Bouin’s fluid
K. Quality of surgical resection This is important because the surgeon must provide an adequate specimen for accurate evaluation of the lymph node status. Surgeon or hospital volume may be an indicator of surgical quality (Chang et al, 2007). Surgeons with better specialisation may also be performing a more complete resection of the primary tumour with its draining lymph nodes, with a resultant higher lymph node recovery (Chang et al, 2007). Patients in high-volume hospitals and those in teaching hospitals have more lymph nodes evaluated, with improved staging accuracy, as compared to patients in low-volume and non-teaching hospitals (Chang et al, 2007; Truong et al, 2008).
L. Meticulous dissection of lymph nodes Although differences in pathological techniques used may account for variations in lymph node yields, the most influential factor is the experience, effort and diligence of the reporting pathologist (Morris et al, 2007). In one study, pathology assistants have been demonstrated to identify more lymph nodes than residents or busy pathologists, as they have less workload constraints (Galvis et al, 2001).
247
Mysorekar: Lymph node retrieval and assessment in colorectal cancer facilitates residual lymph node recovery by increasing the colour contrast between lymph nodes (round white nodules) and yellow adipose tissue of the mesentery (Rullier et al, 2008). When the lymph node counts are low, randomly submitting fat for histopathological examination, may also help in identifying more nodes (Wright et al, 2004).
should be restricted to use (Govindarajan and Baxter, 2008).
in
research
settings
D. Pathology template A pathology template is a standardised format used to report key pathologic variables, whether they are positive or negative (Wright et al, 2003). Thus, pathology templates ensure that prognostically important characteristics of a colorectal cancer specimen are included in the pathology report. The use of such a systematic approach has been found to be associated with an increased number of lymph nodes examined in colorectal resection specimens (Wright et al, 2003). This scheme of reporting can be used as a method of quality control in establishing minimum standards for data collection in laboratories.
C. Sentinel lymph node mapping The sentinel node is the first node to be affected by metastasis. Sentinel lymph node mapping is based on the concept that if the sentinel node is negative, the other nodes of that group will also be negative in nearly all instances, whereas, if it is positive, the chance that there will be additional metastases in that nodal group is about 33%. Sentinel lymph node mapping is done during the procedure of colectomy. After mobilisation of the colon and mesentery, 1 to 2 ml of isosulphan blue dye is injected subserosally around the tumour. The first node(s) highlighted with the blue dye is identified as the sentinel node(s) (Read et al, 2005). Some workers use a combination of radiotracer (technetium-99m-phytate) and blue dye (patent blue) (Quadros et al, 2008), while others use indocyanine green fluorescence imaging (Kusano et al, 2008) for visualising the sentinel nodes. The sentinel lymph nodes are studied for metastases, by enhanced pathological examination, referred to as â&#x20AC;&#x153;ultrastagingâ&#x20AC;?. This is done by multilevel sectioning, i. e. taking at least three step sections, which are stained with haematoxylin and eosin (H&E). In addition, at least one section is immunostained for keratin, which will aid in detecting micrometastases (tumour deposits ! 2 mm) (Greenson et al, 1994). Molecular evaluation of lymph nodes by reverse transcriptase-polymerase chain reaction (RT-PCR) also helps in detection of micrometastases (Mori et al, 1995). However, this method is expensive and time-consuming. Frozen sections of the sentinel node can be studied for metastases, in cases where the surgeon requires an immediate report. A large number of authors have found sentinel node mapping to be useful, as it identifies those lymph nodes most likely to harbour metastases. The sentinel node may be the only site of metastasis in some cases. The procedure of sentinel node examination has been found to upstage a proportion of patients (ranging from 23.1% upto 38.8%) from node-negative to node-positive, following the detection of micrometastases (Mulsow et al, 2003; Saha et al, 2004; Saha et al, 2005; KĂśksal et al, 2007; Quadros et al, 2008). Those patients who are upstaged can then benefit from adjuvant chemotherapy. The negative predictive value for sentinel lymph node mapping has been reported to be 89% in one study (Smith et al, 2006). Saha et al (2004) had a success rate of 100% for detecting sentinel lymph nodes, and an overall accuracy rate of 96.2% for predicting positive or negative metastatic disease. A few authors, however, state that sentinel lymph node biopsy does not have the same advantages in the treatment of patients with colon cancer, as in the treatment of patients with breast cancer or melanoma (Read et al, 2005; Govindarajan and Baxter, 2008). They feel that it
E. Education programme A multifaceted education programme directed at both surgeons and pathologists that is aimed at increasing awareness of adequate pathological staging has been proposed (Wright et al, 2003). Workload constraints should not be a barrier to optimal lymph node assessment. Pathologists need to be convinced that the procedure of retrieval of adequate lymph nodes in colorectal cancer is time-consuming, and may, in some cases, require more than 30 minutes of diligent dissection. Pathologists should be aware that they are responsible for the accuracy of the final report, which will decide the necessity for any adjuvant therapy. Surgeons and pathologists need to have productive joint discussions to arrive at a consensus regarding the minimum number of lymph nodes to be retrieved from colorectal specimens. Increasing the minimum number from 12 to 16, for increased accuracy in staging, is a point to be considered. To sum up, improving the quality of care can ensure more complete lymphadenectomies, better staging, and, ultimately, better disease management.
References Berberoglu U (2004) Prognostic significance of total lymph node number in patients with T1-4N0M0 colorectal cancer. Hepatogastroenterology 51, 1689-93. Beresford M, Glynne-Jones R, Richman P, Makris A, Mawdsley S, Stott D, Harrison M, Osborne M, Ashford R, Grainger J, Al-Jabbour J, Talbot I, Mitchell IC, Meyrick Thomas J, Livingstone JI, McCue J, MacDonald P, Northover JA, Windsor A, Novell R, Wallace M, Harrison RA (2005) The reliability of lymph-node staging in rectal cancer after preoperative chemoradiotherapy. Clin Oncol (R Coll Radiol) 17, 448-55. Caplin S, Cerottini JP, Bosman FT, Constanda MT, Givel JC (1998) For patients with Dukes' B (TNM stage II) colorectal carcinoma, examination of six or fewer lymph nodes is related to poor prognosis. Cancer 83, 666-72. Chang GJ, Rodriguez-Bigas MA, Skibber JM, Moyer VA (2007) Lymph node evaluation and survival after curative resection of colon cancer: systematic review. J Natl Cancer Inst 99, 433-41. Cianchi F, Palomba A, Boddi V, Messerini L, Pucciani F, Perigli G, Bechi P, Cortesini C (2002) Lymph node recovery from
248
Cancer Therapy Vol 7, page 249 colorectal tumor specimens: recommendation for a minimum number of lymph nodes to be examined. World J Surg 26, 384-9. Dworak O (1989) Number and size of lymph nodes and node metastases in rectal carcinomas. Surg Endosc 3, 96-9. Gabella G (1995) Lymphatic system, in Williams PL, Bannister LH, Berry MM, Collins P, Dyson M, Dussek JE, Ferguson MWJ (eds): Gray’s Anatomy, 38th ed. Edinburgh: Churchill Livingstone, 1605-26. Galvis CO, Raab SS, D'Amico F, Grzybicki DM (2001) Pathologists’ assistants practice: a measurement of performance. Am J Clin Pathol 116, 816-22. Goldstein NS, Sanford W, Coffey M, Layfield LJ (1996) Lymph node recovery from colorectal resection specimens removed for adenocarcinoma. Trends over time and a recommendation for a minimum number of lymph nodes to be recovered. Am J Clin Pathol 106, 209-16. Görög D, Nagy P, Péter A, Perner F (2003) Influence of obesity on lymph node recovery from rectal resection specimens. Pathol Oncol Res 9, 180-3. Govindarajan A, Baxter NN (2008) Lymph node evaluation in early-stage colon cancer. Clin Colorectal Cancer 7, 240-6. Greenson JK, Isenhart CE, Rice R, Mojzisik C, Houchens D, Martin EW Jr (1994) Identification of occult micrometastases in pericolic lymph nodes of Dukes’ B colorectal cancer patients using monoclonal antibodies against cytokeratin and CC49. Correlation with long-term survival. Cancer 73, 563-9. Hernanz F, Revuelta S, Redondo C, Madrazo C, Castillo J, Gómez-Fleitas M (1994) Colorectal adenocarcinoma: quality of the assessment of lymph node metastases. Dis Colon Rectum 37, 373-7. Herrera-Ornelas L, Justiniano J, Castillo N, Petrelli NJ, Stulc JP, Mittelman A (1987) Metastases in small lymph nodes from colon cancer. Arch Surg 122, 1253-6. IARC GLOBOCAN (2002) Cancer incidence, mortality and prevalence worldwide. www-dep.iarc.fr/. Jha MK, Corbett WA, Wilson RG, Koreli A, Papagrigoriadis S (2006) Variance of surgeons versus pathologists in staging of colorectal cancer. Minerva Chir 61, 385-91. Kelder W, Inberg B, Plukker JT, Groen H, Baas PC, Tiebosch AT (2008) Effect of modified Davidson’s fixative on examined number of lymph nodes and TNM-stage in colon carcinoma. Eur J Surg Oncol 34, 525-30. Köksal H, Bostanci H, Mentes BB (2007) Importance of sentinel lymph nodes in colorectal cancer: a pilot study. Adv Ther 24, 583-8. Kusano M, Tajima Y, Yamazaki K, Kato M, Watanabe M, Miwa M (2008) Sentinel node mapping guided by indocyanine green fluorescence imaging: a new method for sentinel node navigation surgery in gastrointestinal cancer. Dig Surg 25, 103-8. Law CH, Wright FC, Rapanos T, Alzahrani M, Hanna SS, Khalifa M, Smith AJ (2003) Impact of lymph node retrieval and pathological ultra-staging on the prognosis of stage II colon cancer. J Surg Oncol 84, 120-6. Mohandas KM, Desai DC (1999) Epidemiology of digestive tract cancers in India. V Large and small bowel. Indian J Gastroenterol 18, 118-21. Mori M, Mimori K, Inoue H, Barnard GF, Tsuji K, Nanbara S, Ueo H, Akiyoshi T (1995) Detection of cancer micrometastases in lymph nodes by reverse transcriptasepolymerase chain reaction. Cancer Res 55, 3417-20. Morris EJ, Maughan NJ, Forman D, Quirke P (2007) Identifying Stage III colorectal cancer patients: the influence of the patient, surgeon, and pathologist. J Clin Oncol 25, 2573-9.
Mulsow J, Winter DC, O’Keane JC, O’Connell PR (2003) Sentinel lymph node mapping in colorectal cancer. Br J Surg 90, 659-67. Nelson H, Petrelli N, Carlin A, Couture J, Fleshman J, Guillem J, Miedema B, Ota D, Sargent D (2001) Guidelines 2000 for colon and rectal cancer surgery. J Natl Cancer Inst 93, 58396. Puchtler H, Waldrop FS, Conner HM, Terry MS (1968) Carnoy fixation: practical and theoretical considerations. Histochemie 16, 361-71. Quadros CA, Lopes A, Araujo I, Fregnani JH, Fahel F (2008) Upstaging benefits and accuracy of sentinel lymph node mapping in colorectal adenocarcinoma nodal staging. J Surg Oncol 98, 324-30. Read TE, Fleshman JW, Caushaj PF (2005) Sentinel lymph node mapping for adenocarcinoma of the colon does not improve staging accuracy. Dis Colon Rectum 48, 80-5. Rosai J (ed) (2004) Gross techniques in surgical pathology, in Rosai and Ackerman’s Surgical Pathology, 9th ed. St Louis: Mosby, 25-36. Rullier A, Laurent C, Capdepont M, Vendrely V, Belleannée G, Bioulac-Sage P, Rullier E (2008) Lymph nodes after preoperative chemoradiotherapy for rectal carcinoma: number, status, and impact on survival. Am J Surg Pathol 32, 45-50. Saha S, Dan AG, Beutler T, Wiese D, Schochet E, Badin J, Branigan T, Ng P, Bassily N, David D (2004) Sentinel lymph node mapping technique in colon cancer. Semin Oncol 31, 374-81. Saha S, Dan AG, Viehl CT, Zuber M, Wiese D (2005) Sentinel lymph node mapping in colon and rectal cancer: its impact on staging, limitations, and pitfalls. Cancer Treat Res 127, 105-22. Sarli L, Bader G, Iusco D, Salvemini C, Mauro DD, Mazzeo A, Regina G, Roncoroni L (2005) Number of lymph nodes examined and prognosis of TNM stage II colorectal cancer. Eur J Cancer 41, 272-9. Sermier A, Gervaz P, Egger JF, Dao M, Allal AS, Bonet M, Morel P (2006) Lymph node retrieval in abdominoperineal surgical specimen is radiation time-dependent. World J Surg Oncol 4, 29. Smith J, Hwang H, Wiseman KW, Filipenko D, Phang PT (2006) Ex vivo sentinel lymph node mapping in colon cancer: improving the accuracy of pathologic staging? Am J Surg 191, 665-8. Tekkis PP, Smith JJ, Heriot AG, Darzi AW, Thompson MR, Stamatakis JD (2006) A national study on lymph node retrieval in resectional surgery for colorectal cancer. Dis Colon Rectum 49, 1673-83. Thorn CC, Woodcock NP, Scott N, Verbeke C, Scott SB, Ambrose NS (2004) What factors affect lymph node yield in surgery for rectal cancer? Colorectal Dis 6, 356-61. Titu LV, Tweedle E, Rooney PS (2008) High tie of the inferior mesenteric artery in curative surgery for left colonic and rectal cancers: a systematic review. Dig Surg 25, 148-57. Truong C, Wong JH, Lum SS, Morgan JW, Roy-Chowdhury S (2008) The impact of hospital volume on the number of nodes retrieved and outcome in colorectal cancer. Am Surg 74, 944-7. Tsai HL, Lu CY, Hsieh JS, Wu DC, Jan CM, Chai CY, Chu KS, Chan HM, Wang JY (2007) The prognostic significance of total lymph node harvest in patients with T2-4N0M0 colorectal cancer. J Gastrointest Surg 11, 660-5. Tsai HL, Cheng KI, Lu CY, Kuo CH, Ma CJ, Wu JY, Chai CY, Hsieh JS, Wang JY (2008) Prognostic significance of depth of invasion, vascular invasion and numbers of lymph node retrievals in combination for patients with stage II colorectal cancer undergoing radical resection. J Surg Oncol 97, 383-7.
249
Mysorekar: Lymph node retrieval and assessment in colorectal cancer Wichmann MW, MĂźller C, Meyer G, Strauss T, Hornung HM, Lau-Werner U, Angele MK, Schildberg FW (2002) Effect of preoperative radiochemotherapy on lymph node retrieval after resection of rectal cancer. Arch Surg 137, 206-10. Wong JH, Severino R, Honnebier MB, Tom P, Namiki TS (1999) Number of nodes examined and staging accuracy in colorectal carcinoma. J Clin Oncol 17, 2896-900. Wright FC, Law CH, Last L, Khalifa M, Arnaout A, Naseer Z, Klar N, Gallinger S, Smith AJ (2003) Lymph node retrieval and assessment in stage II colorectal cancer: a populationbased study. Ann Surg Oncol 10, 903-9. Wright FC, Law CH, Last LD, Ritacco R, Kumar D, Hsieh E, Khalifa M, Smith AJ (2004) Barriers to optimal assessment of lymph nodes in colorectal cancer specimens. Am J Clin Pathol 121, 663-70.
cancer? Determination on the basis of cumulative survival rate. Hepatogastroenterology 52, 1703-6.
Vijaya V. Mysorekar
Yoshimatsu K, Ishibashi K, Umehara A, Yokomizo H, Yoshida K, Fujimoto T, Watanabe K, Ogawa K (2005) How many lymph nodes should be examined in Dukesâ&#x20AC;&#x2122; B colorectal
250
Sorin et al: Partial Hepatectomy results in significant growth of liver metastases by increased expression of H19 gene Cancer Therapy Vol 7, 240-244, 2009
Partial Hepatectomy in rats results in significant growth of liver metastases by increased expression of H19 gene Research Article
Vladimir Sorin1,*, Aya Mizrahi2, Patricia Ohana2, Suhail Ayesh2, Tatiana Birman2, Abraham Hochberg2, Abraham Czerniak1 1
Department of Surgery “A”, E.Wolfson Medical Center, Holon, Israel Department of Biological Chemistry, Institute of Life Sciences, The Hebrew University of Jerusalem, Jerusalem, Israel
2
__________________________________________________________________________________ *Correspondence: Dr. Vladimir Sorin, Department of Surgery, E.Wolfson Medical Center, Ha Lochamim 62, Holon, Israel, 58100; Fax: +97225610250; e-mail: vladimir.sorin@gmail.com Key words: RNA products of H19 and HGF, RNA isolation and cDNA synthesis, hepatectomy, liver metastases Abbreviations: hepatocyte growth factor, (HGF)
The first and second authors contributed equally to this work. Received: 24 February 2009; Revised: 27 February 2009 Accepted: 3 March 2009; electronically published: 14 April 2009
Summary H19 is a maternally expressed oncofetal gene, which is expressed at substantial levels in embryonic tissues and various human tumor types, but marginally or not expressed in the corresponding tissue of the adult. Dramatic increase in H19 mRNA was found in hepatocytes following the initiation of their proliferation by hepatectomy. H19 is a target gene for HGF, which also sharply increases after hepatectomy. The growth of liver metastases after hepatectomy and it's correlation with levels of the H19 and HGF RNA were evaluated on an orthotopic model of rat colon liver metastases. Significant increase in tumor growth was found after 70% hepatectomy. HGF and H19 RNAs levels in tumors were substantially elevated after hepatectomy compared to those observed in tumors with no hepatectomy. A direct positive correlation between the level of H19 RNA and the extent of liver resection was found. HGF has an important role in overexpression of H19 resulting in a rapid growth of metastases in the remaining liver after hepatectomy. These findings may have important clinical applications, when decisions regarding partial hepatectomy, two stage hepatectomy procedure or staged radiofrequency ablation prior to hepatectomy has to be taken.
progression (Ayesh et al, 2002). Partial hepatectomy is preferred therapeutic modality for liver metastases. However, overall recurrence rate is high and may reach 60% in various series (Schlag PM et al, 2002). Progression of tumor and metastases growth after liver resection was noted in experimental (de Jong et al, 1995; Ikeda et al, 1995; Garcia-Alonso et al, 2003) and clinical (von Schweinitz et al, 1998; Elias et al, 1999) studies. This progression may be related to the increase in hepatocyte growth factor (HGF) level after hepatectomy. H19 is a target gene for HGF, thus implicating upregulation of H19 in morphogenesis and/or migration of epithelial cells (Adriaenssens et al, 2002). Hence, a rise in
I. Introduction It has recently been reported that hepatectomy induces an increase in H19 mRNA in hepatocytes (Yamamoto et al, 2004). H19 is a maternally expressed, oncofetal gene that encodes an RNA (with no protein product) acting as a “riboregulator” (Erdmann et al, 2001), which is expressed at substantial levels in embryonic tissues, in different human tumor types, and marginally or not expressed in the corresponding tissue of the adult (Ariel et al, 1995,1997, 1998). Its precise function is being debated. Our recent data suggest a role of H19 in enabling tumor cells to survive under stress conditions by promoting angiogenesis, metastasis and cancer 240
Cancer Therapy Vol 7, page 241 and (5´-GCTGTGTGGGTCTGCTCTTTCAAGATG) downstream. The polymerase chain reaction (PCR) was carried out for 30 cycles (98°C for 15 s, 58°C for 30s, and 72°C for 40 s) and finally 72°C for 5 min. The primer sequences used to amplify the HGF transcript were: (5’TTGGCCATGAATTTGACCTC) upstream and 5’ACATCAGTCTCATTCACAGC) downstream. The PCR was carried out for 27 cycles (94° C for 5 min, 98° C for 15 sec, 58° C for 30 sec, 72° C for 40 sec), and 72° C for 5 min. The integrity of the cDNA was assayed by PCR analysis of the ubiquitous, cell cycle independent, histone variant, H3.3. For statistical analysis of the differences between means, we used the Mann-Whitney test, and differences were considered significant at p < 0.05. All the protocols were approved by The Animal Care and Use Committee according to Helsinki Declaration.
the level of H19 RNA in liver tumors during liver regeneration may have important clinical application. In the present study we have evaluated the impact of partial hepatectomy on the tumor size in the remaining liver as well as correlation between H19 and HGF levels in tumors and the remaining liver.
II. Material and Methods A. Animal model of hepatectomy and liver metastases 40 Adult (12 weeks old) Wag/Rij male rats (240-260 gr) were used in the study. The model of liver metastases was generated by direct subcapsular injection of 100 µl tumor cells suspension containing 50000 CC531 colonic cancer cells (kindly gifted by Peter J.K. Kuppen, Leiden University Medical Center, The Netherlands). The tumor cell suspension (0.1ml) was injected immediately after hepatectomy into the right lateral lobe using a 27-gauge needle. The rats were divided into four groups according to the extent of hepatectomy performed. Group A underwent 0% hepatectomy (sham operation), Group B, C and D underwent 10%, 30% and 70% hepatectomy respectively. Each group included 8 to 12 rats. Two rats in each group were operated without injection of tumor cells. Hepatectomy: 70% and 30% hepatectomy was carried out through an upper midline incision according to the method of Higgins and Anderson (Higgins and Anderson R1931). A preliminary experiment (6 rats) was carried out to verify the percent of hepatectomy performed. 10% hepatectomy was achieved by resection of left medial lobe. Anesthesia was achieved by an intraperitoneal injection of Chloralhydrate (Sigma-Aldrich Laborchemikalien GmbH) 0.8 mg/kg. One surgeon performed all procedures. The rats underwent relaparotomy after two weeks. The liver was exposed and dimensions of the developed tumors were taken in-vivo by a caliber. They were then sacrificed; the tumors were excised, weighed, and measured by a caliber again. Tumor volume was determined according to equation V=a2b/2, where “a” and “b” are the smallest and the largest dimensions of the tumor respectively. Tissue samples from tumors were frozen immediately in liquid Nitrogen and kept in -80ºC for RNA extraction. Additional samples were fixed in formalin for microscopic examination and histological verification of tumor presence.
III. Results An overall increase in tumor size was found following partial hepatectomy. This increase was directly correlated with the extent of hepatectomy performed. Tumor size has significantly increased (about seven folds) following 70% hepatectomy (Group D) compared to sham operated animals (p<00.5) (Group A) (Figure 1). 30% hepatectomy (Group C) resulted in substantial increase (about two folds) in tumor size compared to sham operated rats (Group A), however, these differences were not statistically significant. Similarly, the weight of the tumors in the rats which underwent hepatectomy (Groups C, D) was respectively higher than in Group A (Figure 1). Tumor weight in group D ranged from 0.064 gr to 0.9 gr (mean 0.191) as compared to a mean weight of 0.013 gr (range from 0.011 to 0.02) in the control group (A), and this difference was statistically significant (p<0.05).
B. RNA isolation and cDNA synthesis Total RNA was extracted from cell lines or tissues, using the RNA STAT-60 Total RNA/mRNA isolation reagent (TelTest, Inc., Friendswood, TX, USA), according to the manufacture’s instructions. The RNA was treated with RNasefree DNase I (Roche Diagnostics GmbH, Mannheim, Germany) to eliminate any contaminating DNA. The cDNA was synthesized from 2 !g total RNA in 20 !l reaction volume as described (Ayesh et al, 2003).
C. Determination of the level of RNA products of H19 and HGF Samples of liver and tumor from each rat were taken for the evaluation the H19 and HGF levels. PCR reactions were carried out in 25 µl volumes in the presence of 6 ng/µl of each of the forward and the reverse primers of the corresponding H19 or HGF cDNAs using 0.05 units/µl of Taq polymerase (TaKaRa Biomedicals, Japan) according to the manufacture’s instructions. The primer sequences used to amplify the rat H19 transcript were: (5´-ACTGGAGACTAGGGAGGTCTCTAGCA) upstream
Figure 1. Determination of tumor size and weight after 70%, 30% and 0% hepatectomy. Two weeks after hepatectomy the mean ex vivo tumor volume and weight from the excised liver after 70 %, 30% and 0% hepatectomy were measured after sacrifice. The differences in the tumor size and weight were statistically significant only between groups of 0% and 70% hepatectomy.
241
Sorin et al: Partial Hepatectomy results in significant growth of liver metastases by increased expression of H19 gene hepatotrophic stimulator is HGF. Hepatectomy results in significant elevation of serum HGF levels which correlate with extent of hepatectomy performed (Miyata et al, 1996), these levels reach a 15-17 fold increase after 2/3 hepatectomy (Michalpoulos et al, 1993) that enables rapid liver regeneration. We have demonstrated a significant increase in tumor volume and weight in the remaining liver after hepatectomy in a rat metastatic liver model. Importantly, this increase correlates with the extent of the hepatectomy performed and is maximal after 70% liver resection (Figure 1). These findings are probably related to the elevation of HGF responding to hepatectomy in the framework of the mechanism of regeneration. HGF acts as a pleiotrophic biologic agent for a wide variety of cell types, exclusively of epithelial origin. It stimulates cell growth (mitogen) and cell motility (motogen) as well as inducts multicellular morphogenesis (morphogen) (Matsumoto et al, 1993). HGF is produced by several tissues including neoplasms. A number of studies investigated the influence of HGF on malignant cell growth. Thus, Tajima and colleagues found in 1991 inhibiting effect of HGF on several tumor cell lines including HepG2 human hepatocellular carcinoma cells, B6/F1 murine melanoma cells, KB squamous cell carcinoma. The suggestion that HGF may work as a tumor suppressor during the early stages of liver carcinogenesis was also proposed by Santoni-Rugiu and colleagues in 1996, and Thorgeirsoon and Santoni-Rugiu in 1996. In contrast, other investigators demonstrated enhancement of the invasive activity of human hepatocellular carcinoma cell lines (Kamiyama et al, 1998) and local and metastatic tumor progression after liver resection in experimental and clinical studies (Jiang et al, 1993; de Jong et al, 1995; Ikeda et al, 1995; Elias et al, 1999; von Schweinitz et al, 1998; Garcia-Alonso et al, 2003). Clinical and scientific evidence of the important role of HGF in cancer invasion and metastasis has also been demonstrated (Guirouilh et al, 2000). However, the function of HGF in the mechanism of tumor growth is not clear.
Tumor size and weight in rats which underwent 10% (Group B) hepatectomy, were only slightly larger than in the control group (A) and these differences were not statistically significant (data not shown). HGF RNA levels in tumors after hepatectomy were significantly increased (Figure 2, upper pannel, lanes 1, 3, 5) compared to the observed level in tumor with no hepatectomy (group A) (Figure 2, upper panel, lane 7). The levels of H19 RNA were also higher in tumors after hepatectomy (Figure 2, lower panel, lanes 1, 3, 5) compared to the levels determined in the control group (Figure 2, lower panel, lane 7). Importantly, a direct positive correlation between the level of H19 RNA and the extension of liver resection performed was found. HGF RNA levels were also elevated in the regenerating normal liver tissue after hepatectomy (Figure 2, upper panel, lanes 2,4,6), whereas H19 RNA levels were only slightly increased (Figure 2, lower panel, lanes 2,4,6).
IV. Discussion Almost unlimited regenerative capacity of the liver tissue providing rapid restoration of the liver mass and function allows major hepatic resection in patients with liver metastases. Two-stage hepatectomy has recently been introduced for treatment of unresectable liver metastases for volumetric reasons when the future remaining liver is too small to ensure survival (Elias et al, 1998). The first stage includes right portal vein embolization resulting in right lobe atrophy and left liver lobe hypertrophy enabling resection of the involved right liver lobe. The observation that the presence of liver metastases in the regenerating left lobe may result in their significant growth which is more rapid then the normal liver tissue was firstly reported by Eliasand colleagues in 1999. This growth of the tumors during the regenerative process of liver parenchyma was also demonstrated after partial hepatectomy (Panis et al, 1992). The regulation of the regenerative process is mediated by a number of cytokines. The most potent
Figure 2. The level of H19 and HGF transcripts in rat tumor liver metastases and liver tissue of the same liver after hepatectomy determined by RT-PCR. RNA samples from tumors after 10%, 30% and 70% hepatectomy (lanes 1,3,5 respectively), from the corresponding non tumor areas of the liver (lanes 2,4,6 respectively), from tumor with no hepatectomy (lane 7), and from healthy liver tissue after hepatectomy (lane 8). M- 100 bp molecular weight marker. The upper panel is the 558 bp HGF c-DNA. The panel below is
242
Cancer Therapy Vol 7, page 243 213 bp histone internal control and the lower panel is the 454 bp H19 c-DNA. marker in bladder carcinoma. Urology 45, 335-338. Ariel I, Miao HQ, Ji XR Schneider T, Roll D, de Groot N, Hochberg A, Ayesh S (1998) Imprinted H19 oncofetal RNA is a candidate tumor marker for hepatocellular carcinoma. Mol Pathol 51, 21-25. Ayesh B, Matouk I, Ohana P, Sughayer MA, Birman T, Ayesh S, Schneider T, de Groot N, Hochberg A (2003) Inhibition of tumor growth by DT-A expressed under the control of IGF2 P3 and P4 promoter sequences. Mol Ther 7, 535-541. Ayesh S, Matouk I, Schneider T, Ohana P, Laster M, Al-Sharef W, De-Groot N and Hochberg A (2002) The possible physiological role of H19 RNA. Mol Carcinog 35, 63-74. Cooper MJ, Fischer M, Komitowski D, Shevelev A, Schulze E, Ariel I, Tykocinski ML, Miron S, Ilan J, de Groot N, Hochberg A (1996) Developmentally imprinted genes as markers for bladder tumor progression. J Urol 155, 21202127. de Jong KP, Lont HE, Bijma AM, Brouwers MA, de Vries EG, van Veen ML, Marquet RL, Slooff MJ Terpstra OT (1995) The effect of partial hepatectomy on tumor growth in rats: in vivo and in vitro studies. Hepatology 22, 1263-1272. Elias D, De Baere T, Roche A, Ducreux M, Leclere J, Lasser P (1999) During liver regeneration following right portal embolization growth rate of liver metastases is more rapid than that of the liver parenchyma. Br J Surg 86, 784-788. Elias D, Debaere T, Roche A, Bonvallot S, Lasser P (1998) Preoperative selective portal vein embolization are an effective means of extending in indications of major hepatectomy in the normal and injured liver. Hepatogastroenterology 45, 170-177. Erdmann VA, Barciszewska MZ, Szymanski M, Hochberg A, de Groot N and Barciszewski J (2001) The non-coding RNAs as riboregulators. Nucleic Acids Res 29, 189-193. Fellig Y, Ariel I, Ohana P, Schachter P, Sinelnikov I, Birman T, Ayesh S, Schneider T, de Groot N, Czerniak A, Hochberg A .(2005) H19 expression in hepatic metastases from a range of human carcinomas. J Clin Pathol 58, 1064-1068. Garcia-Alonso I, Palomares T, Alonso A, Portugal V, Castro B, Caramés J, Méndez J (2003) Effect of hepatic resection on development of liver metastasis. Rev Esp Enferm Dig 95, 765-770. Guirouilh J, Castroviejo M, Balabaud C, Desmouliere A, Rosenbaum J (2000) Hepatocarcinoma cells stimulate hepatocyte growth factor secretion in human liver myofibroblasts. Int J Oncol 17, 777-781. Higgins G, Anderson R (1931) Experimental pathology of the liver.I. Restoration of the liver of the white rat following partial surgical removal. Arch Pathol 12, 186-202. Hochberg A (2005) The Oncofetal H19 RNA in human cancer, from the bench to the patient. Cancer Therapy 3, 1-18. Ikeda Y, Matsumata T, Takenaka K, Sasaki O, Soejima K, and Sugimachi K (1995) Preliminary report of tumor metastasis during liver regeneration after hepatic resection in rats. Eur J Surg Oncol 21, 188-190. Jiang WG, Hallet MB, Puntis MC (1993) Hepatocyte growth factor/Scatter factor, liver regeneration and cancer metastasis. Br J Surg 80, 1368-1373. Kamiyama T, Une Y, Uchino J, Hamada J (1998) Hepatocyte growth factor enhances the invasion activity of human hepatocellular carcinoma cell lines. Int J Oncol 12, 655-659. Matouk I, Ohana P, Ayesh S, Sidi A, Czerniak A, de Groot N, Matsumoto K, NaKamura T (1993) Roles of HGF as a pleiotropic factor in organ regeneration. In Goldberg ID, Rosen EM (eds.): Hepatocyte growth factor – scatter factor (HGF-SF) and the C-met receptor. Basel: Birkhauser Verlag 225-249.
Knowledge of the genes involved in the regulation of carcinogenesis may further our understanding. H19 gene is expressed during fetal development and down-regulated at birth (Pachnis et al, 1998; Poirier et al, 1991). Overexpression of H19 gene was detected in most cancers (Rachmilewitz et al, 1995; Cooper et al, 1996; Adriaenssens et al, 1998), particularly, in primary liver cancer and liver metastases from colonic origin (Ohana et al, 2005). We have found it expressed in more then 80% of liver metastases colonic origin in our patients (Fellig et al, 2005). Moreover, its expression correlates with tumor differentiation (Adriaenssens et al, 2002). The results of Yomamoto and colleagues in 2004 suggest possible roles of H19 mRNA in the regulation of hepatocyte proliferation. Recently, up-regulation of H19 by HGF was determined (Adriaenssens et al, 2002). Indeed, we have demonstrated correlation between the increase in HGF levels after partial hepatectomy, rapid hepatocytes proliferation, and the overexpression of H19 in the liver tissue (Figure 2, lanes 2,4,6). Besides, significantly increased HGF levels in tumor after hepatectomy strongly correlate with H19 overexpression in the tumor cells (Figure 2, lanes 1,3,5). Taking in consideration the fact that H19 gene is responsive to hypoxic stress that accompanied tumor growth and the indications that it may promote tumor cell survival under harsh conditions by promoting angiogenesis (Matouk et al, 2005) it may explain the rapid growth of liver metastases after partial liver resection. Indeed, we have demonstrated a clear correlation between the extent of hepatectomy, tumor size, HGF and H19 levels in the tumor (Figures 1,2), that further suggests regulative role of HGF in H19 expression and tumor growth. These experimental findings provide scientific basis to the described clinical phenomenon of the rapid growth of liver metastases in the regenerative liver. These findings may have important clinical applications, when decisions regarding partial hepatectomy, two stage hepatectomy procedure or staged radiofrequency ablation prior to hepatectomy has to be taken.
References Adriaenssens E, Dumont L, Lottin S, Bolle D, Leprêtre A, Delobelle A, Bouali F, Dugimont T, Coll J, Curgy JJ (1998) H19 overexpression in breast adenocarcinoma stromal cell is associated with tumor values and steroid receptor status but independent of p53 and Ki-67 expression. Am J Pathol 153, 1597-1607. Adriaenssens E, Lottin S, Berteaux N, Hornez L, Fauquette W, Fafeur V, Peyrat JP, Le Bourhis X, Hondermarck H, Coll J, Dugimont T, Curgy JJ (2002) Cross-talk between mesenchyme and epithelium increases H19 gene expression during scattering and morhogenesis of epithelial cells. Exp Cell Res 275, 215-229. Ariel I, Ayesh S, Perlman EJ, Pizov G, Tanos V, Schneider T, Erdmann VA, Podeh D, Komitowski D, Quasem AS, de Groot N, Hochberg A (1997) The product of the imprinted H19 gene is an oncofetal RNA. Mol Pathol 50, 34-44. Ariel I, Lusting O, Schneider T, Pizov G, Sappir M, De-Groot N and Hochberg A (1995) The imprinted H19 gene as a tumor
243
Sorin et al: Partial Hepatectomy results in significant growth of liver metastases by increased expression of H19 gene Michalopoulos GK, Appasamy R (1993) Metabolism of HGF-SF and its role in liver regeneration. EXS 65, 275-283. Miyata K, Taniguchi H, Takeuchi K, Koyama H, Tanaka H, Takahashi T (1996) Weight of resected liver is positively correlated with serum hHGF level. Hepatogastroenterology 43, 1589-1593. Ohana P, Schachter P, Ayesh B, Mizrahi A, Birman T, Schneider T, Matouk I, Ayesh S, Kuppen PJ, de Groot N, Czerniak A, Hochberg A (2005) Regulatory sequences of H19 and IGF2 genes in DNA-based therapy of colorectal rat liver metastases. J Gene Med 7, 366-374. Pachnis V, Brannan CI, Tilghman SM (1988) The structure and expression of a novel gene activated in early mouse embryogenesis. EMBO J 7, 673-681. PanisY, Ribeiro J, Chretien Y, Nordlinger B (1992) Dormant liver metastases: an experimental study. Br J Surg 79, 221223. Poirier F, Chan CT, Timmons, PM Robertson EJ, Evans MJ, Rigby PW (1991) The murine H19 gene is activated during embryonic stem cell differentiation in vitro and at the time of implantation in the developing embryo. Development 113, 1105-1114. Rachmilewitz J, Elkin M, Rosensaft J, Gelman-Kohan Z, Ariel I, Lustig O, Schneider T, Goshen R, Biran H, de Groot N (1995) H19 expression and tumorigenicity of choriocarcinoma derived cell lines. Oncogene 11, 863-870. Santoni-Rugiu E, Preisegger KH, Kiss A, Audolfsson T, Shiota G, and Schmidt EV, Thorgeirsson SS (1996) Inhibition of neoplastic development in the liver by hepatocyte growth factor in a transgenic mouse model. Proc Natl Acad Sci USA 93, 9577-9582. Schlag PM, Benhidjeb T, Stroszczynski C (2002) Resection and local therapy for liver metastases. Best Pract Res Clin Gastroenterol 16, 299-317. Tajima H, Matsumoto K, and NaKamura T (1991) Hepatocyte growth factor has a potent antiproliferative activity in various
tumor cell lines. FEBS Lett 291, 229-232. Thorgeirsson SS, Santoni-Rugiu E (1996) Transgenic mouse model in carcinogenesis: interaction of c-myc with transforming growth factor alpha and hepatocyte growth factor in hepatocarcinogenesis. Br J Clin Pharmacol 42, 4352. von Schweinitz D, Fuchs J, Gluer S, Pietsch T (1998) The occurrence of liver growth factor in hepatoblastoma. Eur J Pediatr Surg 8, 133-136. Yamamoto Y, Nishikawa Y, Tokairin T, Omori Y, Enomoto K (2004) Increased expression of H19 non-coding mRNA follows hepatocyte proliferation in the rat and mouse. J Hepatol 40, 808-814.
Vladimir Sorin
244
Cancer Therapy Vol 7, page 251 Cancer Therapy Vol 7, 251-253, 2009
Surgical resection of primary malignant adenocarcinoma of trachea in a 60-year-old man Review Article
Antonio Giovanni Petino1, Rosaria Pavia1, Francesco Tornambene1, Raffaele Lanteri2,*, Filippo Fragetta3, Maurizio Nicolosi1 1
Department of Thoracic Surgery, Cannizzaro Hospital, Catania, Italy Department of Surgical Sciences, Organ Transplantation and Advanced Technologies University of Catania 3 Service of Pathologic anatomy- Cannizzaro Hospital 2
__________________________________________________________________________________ *Correspondence: Prof. Raffaele Lanteri MD PhD, Department of Surgical Sciences, Organ Transplantation and Advanced Technologies, University of Catania (Italy), Via S. Sofia 86 95123 Catania (Italy); Tel 0039335212431; e-mail: lanteri@unict.it Key words: Tracheal tumors, Adenocarcinoma, Surgical resection Abbreviations: poorly differentiated adenocarcinoma, (PDA) Received: 16 March 2009; Revised: 6 April 2009 Accepted: 7 April 2009; electronically published: 14 April 2009
Summary Primary malignant neoplasms of trachea are extremely rare, accounting for 0.2% out of all malignancies and represent 0.12% of all death from trachea and lung cancer in UK. Furthermore, just a few reports featuring primary adenocarcinoma have been identified among large series of tracheal resections. Clinical presentation and histopathologic characteristics of a case of tracheal adenocarcinoma, treated at our Division, are described. A 60year-old male, treated with bronchodilators and oral steroids for a presumed diagnosis of asthma during the previous three years, was admitted to our hospital with cough, dyspnea and wheezing. Computerized tomography showed a tracheal tumor. Bronchoscopy confirmed a wide-base polypoid tumor at the left wall of trachea, spot 4 cm above the carina and occluding >90% of lumen. A biopsy was taken and pathological examination reported a poorly differentiated adenocarcinoma (PDA). Through cervicosternotomy, a tracheal resection that contains two rings of trachea with malignant lesion was performed. No operative mortality and intraoperative or postoperative complications were observed. Nowadays, at the time of the article, the patient is alive and disease free 19 months after surgery. We conclude that primary malignant adenocarcinoma of trachea is an exceedingly rare neoplasm. Complete surgical resection remains the treatment of choice for improving the overall prognosis of tracheal tumors of this kind. To our knowledge this is the 10th case described in literature and we describe it for its rarety.
II. Case report
I. Introduction
A 60-year-old male, treated with broncodilators and oral steroids for a presumed diagnosis of asthma during the previous three years, was admitted to our hospital with cough, dyspnea and wheezing. Computerized tomography showed an intraluminal circular mass in trachea with a base 1.3 cm wide and 0.5 cm thick max (Figure 1). Both flexible and rigid bronchoscopy confirmed a large sessile polypoid tumor (approximately 1.5 cm in diameter) in trachea, spot on the left wall just 4 cm above the carina and occluding greater than 90% of lumen (Figure 2). By means of a rigid bronchoscope the lesion was resected and pathologic examination reported a tracheal adenocarcinoma. The patientâ&#x20AC;&#x2122;s obstructive symptoms immediately resolved and the patient underwent surgery for resection/anastomosis of mediastinal trachea(4th to 5th ring) by cervicosternotomy (Figure 3) and mediastinal linfoadenectomy.
Tracheal tumors represent only 0.2% out of all the malignancies of the respiratory tract and represent 0.12% of all death from trachea and lung cancers (Grillo and Mathisen, 1990; Regnard et al, 1996). They may occur in all age groups and the clinical course has been correlated with the pathological features. Squamous cell and adenoid cystic carcinomas, accounting for approximately 75% of the total, had a statistically better prognosis than other types of tracheal cancer (Grillo and Mathisen, 1990; Regnard et al, 1996). Adenocarcinoma is a very rare malignant tumour of trachea representing 4% of all trachea cancer in UK and very few cases are described in literature (Licht et al, 2001; Gaissert, 2003; Macchiarini, 2006; Webb et al, 2006). We report the case of a man who underwent tracheal resection for primary malignant adenocarcinoma. 251
Petino et al: Surgical resection of primary malignant adenocarcinoma of trachea
Figure 1. Preoperative Axial CT scan of the chest demonstrates near complete obstruction of the trachea by the tumor.
Figure 2: Tracheal lesion viewed throught a rigid broncoscopy prior to resection demonstrating greater than 90% obstruction of the mid-tracheal lumen.
Figure 3. Tracheal resection with malignant lesion through cervicosternotomy.
Figure 4. Specimen: tracheal portion including two cartilage rings; ulcered plaque-shaped solid whitish neoplasm on the interior surface.
The specimen consisted of a tracheal portion 2 cm long, including two cartilage rings; an ulcered plaqueshaped (1,6x0,8 cm) solid whitish neoplasm was on the interior surface (Figure 4). Microscopically, the lesion was a poorly differentiated adenocarcinoma (PDA), sporting a few features in common with neuroendocrine carcinoma, which infiltrates the tracheal wall all the way thick, including the cartilage, up to the peri-tracheal fibrous-adipose tissue, with vascular, lymphatic, perineural and venous invasion, and even on peri-tracheal surface (Figures 5A,B). Upper and lower borders were tumor-free on the mucosa. The histological results have been confirmed by means of special procedures of immuno-histochemical (CK 7, CK LOW MW, NSE positivity and TTF-1, cromogranine A, synaptofisine, GFAP negativity). The patient underwent an oncological evaluation to complete therapeutic routine. No complications were observed and the patient was discharged 7 days after surgery. About 3 months later, the
patient underwent bronchoscopy under local anesthesia which demonstrate no evidence of tumor recurrence and nowadays 19 month after surgery, at the time of this article 19 month after surgery, he is still alive and disease free.
III. Discussion Combined single and multivariate surveys showed that patients with malignant tracheal cancers had an average survival of 6 months after diagnosis, even if varying widely according to diverse histological types (Licht et al, 2001; Webb et al, 2006). Adenocarcinomas of the trachea are extremely rare tumors and have the poorest outlook (Ishimaru et al, 2004). Most of the symptoms were no specific and a delay in diagnosing is the result. Generally they comprise upper airway irritation signs such as coughing, hemoptysis, or, as in this case, airway obstruction (Yang, 1997). The most common finding on radiologic evaluation was the tumor mass itself together with pneumonia and atelectasis. Bronchoscopy with 252
Cancer Therapy Vol 7, page 253
Figure 5. Histophotomicrograph of the adenocarcinoma demonstrating the presence of branching cores of fibrovascular tissue are covered by a single layer of columnar cells with bland nuclei ((A) Hematoxylin and (B) eosin stain, 400 ! ).
Licht PB Friis S, Pettersson G (2001) Tracheal cancer in Denmark: a nationwide study. Eur J Cardiothorac Surg 19, 339-45. Macchiarini P. (2006) Primary tracheal tumours. Lancet Oncol 7, 83-91. Mortality statistics England and Wales 1990. London: HMSO. Regnard JF, Fourquier P, Levasseur P (1996) The French Society of Cardiovascular Surgery. Results and prognostic factors in resections of primary tracheal tumors: a multicenter retrospective study. J Thorac Cardiovasc Surg 111, 808-14. Webb BD, Walsh GL, Roberts DB, Sturgis EM (2006) Primary tracheal malignant neoplasms: the University of Texas MD Anderson Cancer Center experience. J Am Coll Surg 202, 237-46. Yang KY, Chen YM, Huang MH, Perng RP (1997) Revisit of primary malignant neoplasms of the trachea: clinical characteristics and survival analysis. Jpn J Clin Oncol 27, 305-9.
biopsy still constitutes the main diagnostic device. The clinical course correlates with histological grade, and hilar lymph node involvement has been reported to be the worst prognostic sign in these patients. Surgical resection is the first choice of treatment if the disease is locally confined. Those who have not undergone complete resection are usually treated with radiation therapy, although the effectiveness is still controversial. We report a case of a tracheal adenocarcinoma successfully treated through tracheal resection. The lesion was endoscopically removed for pathological and histological grading before definitive resection. We reconstructed the trachea without complication employing bronchoplastic procedures. The patient is still recurrence free at 19 months. In our knowledge this is the 10th case described in literature.
IV. Conclusions Adenocarcinoma is a rare malignant tumour of trachea and a survey of 9 documented reports in the literature shows that this tumor has a statistically worse prognosis than other types of tracheal cancer, thus requiring immediate complete tumor resection. We report this case for its rarety.
References Gaissert HA. Primary tracheal tumors (2003). Chest Surg Clin N Am 13, 247-56. Gelder CM, Hetzel MR (1993) Primary tracheal tumors: a national survey. Thorax 48, 688-92. Grillo HC, Mathisen DJ (1990) Primary tracheal tumors: treatment and results. Ann Thorac Surg 49, 69-77. Ishimaru S, Katayama H, Hamada H, Yokoyama A, Kadowaki T, Ito R, Iwamoto Y, Miyazawa T, Higaki J (2006) A case of primary adenocarcinoma of the trachea. Nihon Kokyuki Gakkai Zasshi 42, 966-9.
Raffaele Lanteri
253
Hembruff and Cheng: Chemokine signaling in cancer Cancer Therapy Vol 7, 254-267, 2009
Chemokine signaling in cancer: Implications on the tumor microenvironment and therapeutic targeting Review Article
Stacey L. Hembruff, Nikki Cheng* Department of Pathology and Laboratory Medicine, University of Kansas Medical Center, University of Kansas Cancer Center; Kansas City, KS 66160
__________________________________________________________________________________ *Correspondence: Nikki Cheng, Department of Pathology and Laboratory Medicine, Mailstop 3045, University of Kansas Medical Center, 3901 Rainbow Blvd, Kansas City, KS 66160, USA; Tel: 913-945-6773; Fax: 913-588-6650; e-mail: ncheng@kumc.edu Key words: chemokine, inflammation, cancer, microenvironment, chemokine antagonist Abbreviations: Caspase-8 homologue FLICE-Inhibitory Protein(c-FLIP); Latent Membrane Protein 1(LMP1); Macrophage Stimulating Protein, (MSP); natural killer, (NK); reactive oxygen species, (ROS); Regulated upon Activation Normal T cell Expressed and Secreted, (RANTES); small interfering RNA, (siRNA); Tumor Necrosis Factor !, (TNF-!)
Conflict of interest: The authors have declared that no conflict of interest exists Received: 20 March 2009; Revised: 2 April 2009 Accepted: 4 April 2009; electronically published: 14 April 2009
Summary Chemokines are soluble factors shown to play important roles in regulating immune cell recruitment during inflammatory responses and defense against foreign pathogens. De-regulated expression and activity of several chemokine signaling pathways have been implicated in cancer progression, including: CCL2, CCL5, CXCL1 and CXCL12. While studies in the past have focused the role of these chemokine signaling pathways in regulating immune responses, emerging studies show that these molecules regulate diverse cellular processes including angiogenesis, and regulation of epithelial cell growth and survival. New evidence indicates that chemokines are critical for cancer progression and indicate complex and diverse functions in the tumor microenvironment. This review will focus on the contributions of chemokine signaling in regulating cancer microvironment and discuss the utility of targeting or delivering chemokines in cancer therapeutics.
migration of immune cells, but also the migration, proliferation and survival signals in multiple cell types. While chemokine receptors and ligands are expressed in amphibians and mammals, expression of chemokine ligands and receptors is highly conserved between humans and mice, making the mouse model an advantageous and extensively used system to study chemokine function in vivo and in vitro (DeVries et al, 2006; Zlotnick et al, 2006). The mouse model has been used to study the role of chemokines in normal physiologic responses and also during inflammatory diseases contributed in part by deregulated expression or activitiy of chemokines (Gillitzer and Goebeler, 2001; De Paepe et al, 2008). These studies have lead to promising developments in the treatment of inflammatory diseases such as rheumatoid arthritis (Vital and Emery, 2008). More recently, in vitro and in vivo studies have implicated several inflammatory chemokines including: CCL2, CCL5, CXCL1 and CXCL12 in the
I. Introduction Chemotactic cytokines, also referred as to as chemokines, have long been recognized as critical mediators of the inflammatory response by regulating recruitment of cells from both the innate and adaptive immune systems to the site of injury or infection ( Zabel et al, 2006; De Paepe et al, 2008). Early work on chemokines involved studying the effects of Platelet Factor-4 (also known as CXCL4) on the movement of neutrophils and monocytes (Deuel et al, 1981) through chemotaxis, the process by which cells migrate in response to a concentration gradient of chemokine. Since then, chemokines have also been shown regulate other biological processes including angiogenesis, embryonic implantation, and germ and stem cell migration during embryonic development (Rostene et al, 2007; Salamonsen et al, 2007; Beider et al, 2008; Li and Ransohoff, 2009). It is clear that chemokines not only regulate cellular 254
Cancer Therapy Vol 7, page 255 progression of various cancers. While development of chemokine receptor antagonists to inhibit chemokine signaling is currently a promising avenue in cancer therapeutics, the complex functions and mechanisms of chemokine signaling in the cancer microenvironment may complicate the effectiveness of these agents. It is therefore important to investigate and understand the functions of inflammatory chemokine signaling in cancer progression at the molecular, cellular and whole organism levels. This review will focus on the current knowledge regarding the role of inflammatory chemokine signaling in cancer progression and the current status of chemokines in cancer therapy and prognosis.
same receptor exert different biological effects in certain cell types. For example, CCL3, CCL4 and CCL5 have been shown stimulate migration of activated T cells, but only CCL5 can stimulate migration of resting T cells (Taub et al, 1993). Moreover, knockout mouse studies of chemokine receptors and ligands such as CCL2 and CCR2 do not show compensatory upregulation of other ligands (Boring et al, 1997; Huang et al, 2001). The purpose of the multiple ligand/receptor binding pairs remains under investigation, but these studies indicate that unique roles for each chemokine/receptor pair may serve as a mechanism to regulate cellular responses to chemokine signaling. Other multiple mechanisms also exist to regulate chemokine signaling. Continuous chemokine signaling has been shown to lead to receptor desensitization, internalization through b arrestin and clathrin dependent mechanisms, resulting in downregulation of chemokine signaling (Aramori et al, 1997; Oppermann, 2004). In addition, the D6 and Duffy receptors which bind multiple ligands (Table 1), do not appear to activate signaling pathways, indicating that these receptors may act to sequester chemokine ligands as additional regulatory mechanisms for down regulation of chemokine signaling (Locati et al, 2005; Comerford et al, 2007). In fully developed mammalian organisms, these mechanisms are vital to controlling immune responses during inflammation to restore normal tissue homeostasis.
II. Structure and signal transduction Chemokines are a large family of proteins of which over 40 ligands have been identified. The chemokines have been subdivided into classes depending on the spacing of the cysteine amino acid residues at the NH2 terminus; an X denotes a non- cysteine amino acid residue separating the otherwise conserved cysteine motif. Current classes of the chemokine family are referred to as CC, CXC and CX3C (Tables 1A-C). While the CXC class of chemokines have been shown regulate recruitment of neutrophils and T cells, the CC chemokine regulate both T cells, B cells and recruitment of bone marrow derived cells including-monocytes and dendritic cells (Laing and Secombes, 2004; DeVries et al, 2006). Chemokines signal to seven transmembrane G coupled receptors at the N terminus, resulting in phosphorylation of serine/threonine residues at the Cterminus, conformational changes to the receptor and activation of a heterotrimeric G protein complex bound to the receptor intracellular domain. Activation involves GTP binding to Ga subunit leading to disassociation from its Gb and g subunit partners, and subsequent activation of downstream signaling pathways (Figure 1). These signaling pathways, including: PI-3 Kinase, Rho family of GTPases and MAPK regulate cellular processes such as proliferation, motility and gene expression of matrix metalloproteinases and cytokines (Ganju et al, 1998; Bug et al, 2002; Chinni et al, 2006; Ou et al, 2006). It should be noted that chemokines receptors also activate signaling pathways independent of G proteins, including p38MAPK (Goda et al, 2006) and JAK/Stat (Vila-Coro et al, 1999) to regulate cellular processes such as migration and gene transcription. The ability of multiple chemokines to bind to the same receptor and the ability of a single chemokine to bind to multiple receptors (Table 1) create the possibility of redundant signaling. In vitro studies have shown that chemokines stimulate migration through common signaling pathways such as G coupled protein dependent mechanisms (Cotton and Claing, 2009). However, there is also evidence supporting the possibility of unique functions for each chemokine ligand/receptor pair. First, chemokine ligands exhibit different binding affinities to the same receptor. For example, chemokines exhibit a greater affinity for CXCR2 versus CXCR1 (Devalaraja and Richmond, 1999; Rajagopalan and Rajarathnam, 2006). In addition, different ligands which bind to the
Figure 1. G protein dependent signal transduction through chemokinereceptors: CXCR4 signaling in lymphocytes as a model
255
Hembruff and Cheng: Chemokine signaling in cancer Table 1. Systemic and alternative nomenclature for human and mouse chemokineligands and receptors. A. CXCL family Chemokine ligand Systemic name
Human
Mouse
Chemokine receptors
CXCL1 CXCL2 CXCL3 CXCL4 CXCL5 CXCL6 CXCL7 CXCL8 CXCL9 CXCL10 CXCL11 CXCL12 CXCL13 CXCL14 CXCL15 CXCL16
GRo-a, MGSA, SCYB1 GRo-B, MGSA-b, SCYB2 Gro-g/MGSA-g, SCYB3 PF4, SCYB4 ENA-78, SCYB5 GCP-2, SCYB6 NAP-2, SCYB7 IL-8, SCYB8 MIg, SCYB9 IP-10, SCYB10 I-TAC, SCYB11 SDF-1 a/b, SCYB12 BCA-1, SCYB13 BRAK, bolekine, MIP-2g, SCYB14 Lungkine, WECHE, SCYB15 SR-PSOX
Gro1, Mgsa, KC, Scyb1 GROb, MIP-2a, KC, Scyb2 GRO, MIP-2, KC, Scyb3 PF4, Scyb4 GCP-2, LIX, Scyb5 GCP-2, Scyb6 unknown unknown Mig, Scyb9 IP-10, CRG-2, Scyb10 I-TAC, Scyb11 SDF-1, PBSF, Scyb12 BLC, Scyb13 Scyb14 Lungkine, WECHE, Scyb15 Zmynd15
CXCR2, CXCR1, Duffy CXCR2, Duffy CXCR2 unknown CXCR2, Duffy CXCR2 CXCR2, Duffy CXCR1, CXCR2, Duffy CXCR3 CXCR3 CXCR3 CXCR4 CXCR5 unknown unknown CXCR6
B. CCL family Chemokine ligand Systemic name
Human
Mouse
Chemokine receptors
CCL1
I-309, SCYA1
TCA-3, P500, Scya1
CCL2 CCL3 CCL4 CCL5 CCL6 CCL7 CCL8 CCL9/10 CCL11 CCL12 CCL12 CCL14 CCL15 CCL16 CCL17 CCL18 CCL19 CCL20 CCL21 CCL22 CCL23 CCL24 CCL25 CCL26 CCL27 CCL28
MCP-1/MCAF, TDCF, SCYA2 MIP-1a, SCYA3 SCYA2, SCYA4, MIP1B RANTES, SCYA5 Mrp-1, SCYA6 MCP-3, MARC, FIC, SCYA7 MCP-2, SCYA8 unknown Eotaxin, SCYA11 SCYA12 MCP-4, SCYA13, NCC-1 HCC-1, NCC2, SCYA14 HCC-2, MIP-1d, MIP-5, SCYA15 HCC-4, LEC, LCC-1, SCYA16 TARC, SCYA17 DC-CK, PARC, AMAC-1, SCYA18 MIP-3b, ELC, exodus-3, SCYA19 MIP-3a, LARC, exodus-1, SCYA20 6CKine, SLC, exodus-2, SCYA21 MDC, STCP-1, SCYA22 MPIF-1, CKb8, SCYA23 Eotaxin2, MPIF-2, SCYA24 TECK, SCYA25 Eotaxin-3, SCYA26 CTACK/ILC, SCYA27 MEC, CCK1, SCYA28
JE. Scya2 MIP-1a, Scya3 MIP-1b, Scya2, Scya4 RANTES, Scya5 C10/MRP-1, Scya6 MARC, Scya7, mcp3 mcp2, Scya8, HC14 MRP-2, CCF18, MIP-1g, Scya9 Scya11 MCP-5, Scya12 unknown unknown unknown unknown TARC, ABCD-2, Scya17 unknown MIP-3b/ELC, exodus-3, Scya19 Scya20 6CKinase, SLC, exodus-2, TCA-4 ABCD-1, Scya22 unknown MPIF2, Scya24 TECK, Scya25 eotaxin-3, Scya26 unknown MEC, Scya28
CCR8 CCR2, CCR4, CCR5, Duffy, D6 CCR1, CCR5, D6 CCR1, CCR5 CCR5, Duffy, D6 CCR1, CCR3, CCR5 CCR1, CCR2, CCR3, D6 CCR1, CCR2, CCR3 CCR3, CCR5 CCR3 CCR2 CCR2, CCR3 CCR2, CCR3 CCR1, CCR3 CCR1, CCR2 CCR4, D6 unknown CCR7 CCR6 CCR7 CCR4, D6 CCR1 CCR3 CCR9 CCR3 CCR10 CCR3/CCR1
256
Cancer Therapy Vol 7, page 257 C. XCL and CX3CL families Chemokine ligand Systemic name
Human
Mouse
Chemokine receptors
XCL1 XCL2 CX3CL1
lymphotactin/SCM-1a/ATAC SCM-1b fractaline
lymphotactin unknown neurotactin/ABCD-3
XCR1 XCR1 CX3CR
While the causes for chronic chemokine signaling are still under investigation, gene mutations in chemokine receptors in immune cells (Hernandez et al, 2003) and increased expression of cytokines which regulate chemokine expression at the site of inflammation (Firestein, 2004) may be important contributing factors. These studies indicate that that loss of control over chemokine signaling results in long range consequences with damaging changes in the tissue microenvironment. Emerging studies indicate that de-regulation of the activity and expression of chemokine ligands and receptors in cancer may also alter the tumor microenvironment with long term consequences.
III. Role of chemokine signaling in inflammation and cancer A. Phenotypes of knockout mouse models Chemokines appear to play dual roles in the inflammatory process. On the one hand, targeted deletion of CC and CXC chemokine receptors or ligands in mice leads to increased susceptibility to viral or bacterial infections and decreased clearance of pathogens due to diminished immune cell recruitment. On the other hand, targeted deletion of chemokines and chemokine receptors have been shown to alleviate the phenotypes of inflammatory diseases including rheumatoid arthritis, multiple sclerosis, autoimmune encephalitis and macular degeneration (Table 2). Chronic chemokine signaling is associated with macrophage and T cell accumulation at the inflammatory site, and studies indicate that chronic activation of macrophages may lead to alterations in normal tissue architecture, abnormal angiogenesis and DNA damage due to excess secretion of reactive oxygen species (ROS); (Gillitzer and Goebeler, 2001; Moll et al, 2009).
B. Expression patterns in cancer Many studies indicate a significant correlation of elevated expression of chemokines and signaling receptors with poor cancer prognosis and lymph node metastases in various cancers as determined by immunohistochemistry and RNA in situ analyses (Table 3). Interestingly, the same chemokine receptors that show chronic signaling inflammatory diseases are upregulated in cancer, including CCL2, CCL5, CXCL1 and CXCL12.
Table 2. Targeted deletion of inflammatory chemokineand chemokinereceptors in mice Gene CCL2
CCR2
CCL5 CCR5
CXCL1 CXCR2
CXCL12
CXCR4
phenotype diminished macrophage and TH1 T cell responses inexperimental autoimmune encephalomyelitis (EAE), no compensatory upregulation of CCR2 binding ligands decreased formation of lung granulomas induced by mycobacterium bovis, similar phenotype in EAE as ccl2-/-, decreased monocyte recruitment to inflamed tissues defects in T cell proliferation, an overall reduction in T cell activation and recruitment in cutaneous delayed-type hypersensitivity assays decreased NK cell mobilization in mice infected with herpes simplex virus 2 leading to decreased survival, increased NK cell infiltration in experimental mouse model of colitis correlating with increased resistance to disease
citation Huang et al, 2001
artherosclerotic lesions leads to a reduction in macrophage recruitment associated with decreased lesion formation decreased neutrophil recruitment and delayed wound healing responses, abnormal granulocyte differentiation, mice develop splenomegaly
Boisvert et al, 2006
perinatal lethality, defects in B cell development in in fetal liver and bone marrow, reduction in myeloid progenitors in bone marrow , defects in cardiac development perinatal lethality due to multiple defects including decreased bone marrow cell and B cell development abnormal cerebellum morphology
Nagasawa et al, 1996
257
Boring et al, 1997; Fife et al, 2000; Tsou et al, 2007 Makino et al, 2002 Yamaoka et al, 1998; Andres et al, 2000; Thapa et al, 2007
Cacalano et al, 1994; Devalaraja et al, 2000
Ma et al, 1998
Hembruff and Cheng: Chemokine signaling in cancer
Table 3. Protein expression of commonly found chemokinesand chemokine receptors in cancer epithelium.
CCL2 CCR2 CCL5 CCR5 CXCL1 CXCR2 CXCL12 CXCR4
Breast
colorectal
brain
melanoma
prostate
+1 nd +1,2 +3 +4 nd vl1,4 +1,5
+ vl nc nc + + + +
+6 +6 nd +7 +6,7 +7 +7 +6
+ nd + + + + nd +
vl + + nd + + + +
nonsmall cell lung nd + + + nd + nd +
ovarian
thyroid
pancreatic
renal cell
nd nd nd + + + +
nd nd +9 nd nd +10 nd +9
+ vl + nd nd + + +
nd nd nd nd + + + +
(-): reduced expression, (+): increased expression, nd: not determined, vl: very low or undetectable; nc: no change invasive ductal carcinoma 2 estrogen receptor negative (ER negative)/progesterone receptor negative stage II breast cancer 3 infiltrating ductal carcinoma and infiltrating lobular carcinoma 4 ER negative breast cancer 5 invasive lobular carcinoma 6 glioblastoma 7 glioma, 8 astrocytoma 9 papillary thyroid carcinoma 10 medullary thyroid carcinoma 1
Epithelial specific expression of chemokines and chemokine receptors have been validated by protein and RNA expression analysis of breast, renal, prostate cancer cell lines (Schrader et al, 2002; Vaday et al, 2006; Wente et al, 2008). In addition, decreased expression of Duffy and D6 decoy receptors in breast cancer inversely correlate with lymph node metastases and increased survival rates, indicating the cancer cells showed impaired ability to down regulate chemokine signaling (Ou et al, 2006; Wu et al, 2008). These studies associate increased expression of chemokines and decreased expression of decoy receptor with invasive cancer. However, recent studies show loss of CCL2 in ovarian cancer (Arnold et al, 2005) and reduced CCR2 expression in patients with myeloma (Van de Broek et al, 2006) indicate a possible tumor suppressive role for chemokine signaling which may in part be tissue dependent. Studies have also found associations between the patterns of chemokine expression and levels of immune cells in the primary tumor, as demonstrated by studies of CCL2. In breast cancer, increased CCL2 expression is associated with increased levels of tumor associated macrophages, which have been found to correlate with the invasive phenotype and poor cancer prognosis (Valkovic et al, 1998; Ueno et al, 2000). However, in cervival cancer, loss of CCL2 expression is associated with decreased levels of macrophages in cervical cancer, and correlates with poor cancer prognosis (Kleine-Lowinski et al, 1999). Taken together, these studies demonstrate a tissue dependent pattern of expression and a tissue dependent role for chemokines and immune cells in cancer progression.
Recent studies have shown that the surrounding tumor stroma also show significant changes to chemokine expression. In particular, increased expression of CXCL1 was consistently observed in the stroma of multiple types of breast cancers by microarray analysis of tumor associated stroma, correlating with lymph node metastases, invasiveness and poor patient survival (Finak et al, 2008). Recent studies have shown that CXCL1 and CXCR2 may play a role in regulating replicative senescence in fibroblasts through a p53 dependent mechanism as a possible means to suppress tumor formation. Furthermore, gene mutations in components of the CXCL1 signaling pathway may allow tumor cells to escape this tumor suppressive mechanism (Acosta et al, 2008). In addition to CXCL1, increased expression of CXCL12 have been reported in the stroma of basal and invasive mammary ductal adenocarcinoma, head and neck cancer, papillary thyroid carcinoma and squamous cell carcinoma by SAGE, differential display and immunohistochemistry studies (Frederick et al, 2000; Shellenberger et al, 2004). The increased expression of these chemokines in the stroma correlates with tumor size and lymph node invasion (Kleer et al, 2008; Oliveira-Neto et al, 2008). These studies indicate that stromal specific expression of chemokines may be an important factor to consider when determining cancer prognosis. While changes in protein or RNA expression of chemokine receptors and ligands are strongly associated with progression of various cancer types, few studies of serum levels and polymorphisms have currently yielded
258
Cancer Therapy Vol 7, page 259 significant links to cancer. Elevated serum levels of CCL5 correlate with poor patient prognosis in ovarian cancer (Tsukishiro et al, 2006) and breast cancer (Niwa et al, 2001). While serum levels of CCL5 had no significant association with patient survival in gastric cancer, high serum levels of CCL5 correlated significantly with invasive disease. Serum level studies have involved comparisons between healthy vs. cancer patient samples, as well as malignant vs. benign samples. The differences in results in serum level studies may be due to differences in patient samples in terms age, disease stage, and whether or not disease was treated prior to sample collection. Future comparative analyses must consider such variables, as well as the possibility that changes in chemokine levels may be restricted to the local tumor environment. Therefore the prognostic value of serum analyses might be lower than analysis of expression within the tumor/stroma itself.
understand the functional mechanisms of these gene variants during cancer progression. In summary, studies analyzing differences in local expression of chemokines, compared to those measuring chemokine levels in the serum, offer a stronger, more consistent association is between cancer prognosis and changes in patterns of chemokines ligands and receptors in the primary tumor and metastatic lesions. Currently, the genetic link between chemokine expression patterns and cancer remains unclear. As a number of soluble factors can regulate expression of chemokine ligands and receptors, it is more likely that alterations in expression of these regulators combined with possible genetic mutations may contribute to de-regulated expression of chemokines and their receptors.
D. Role of chemokines progression in the mouse model
in
tumor
The use of transgenic and transplantion mouse models of cancer have proven invaluable in understandng the functions and significance of chemokine signaling during disease progression. A tumor promoting role for inflammatory chemokines is best demonstrated in studies of breast cancer. Over expression of CXCL1 in breast cancer cells results in increased tumor growth and lung metastasis when these over expressing cells are grafted in the mammary fat pads of nude mice (Li and Sidell, 2005; Vazquez-Martin et al, 2007). In addition, siRNA mediated knockdown of CXCR4 expression in mouse and human mammary carcinoma cells inhibits tumor growth and metastatic spread in nude mice (Smith et al, 2004; Liang et al, 2005). CCL2 knockout mice bred to HER2/neu transgenic mice produce progeny exhibiting slower mammary tumor growth and longer tumor latency (Conti et al, 2004). While these studies indicate that expression of chemokines in the tumor epithelial is sufficient to promote breast cancer progression in mice, mesenchymal stem cells have been shown to enhance cancer progression in nude mice through CCL5, CXCL12, CXCR4 and CCL2 dependent mechanisms (Karnoub et al, 2007) indicating these chemokine also regulate breast cancer progression through mediation of stromal: epithelial interactions. The same chemokines shown to play tumor promoting roles in breast cancer affect other types of cancer differently. Targeted deficiency in expression of CCR2 in the XK14-HPVR(2) mouse model of cervical carcinoma does not significantly affect tumor angiogenesis or end stage progression even though decreased numbers of macrophages have been observed in the primary tumor. The modest phenotype may be due to increased presence of tumor associated neutrophils observed in the CCR2 deficient mice; these cells have been proposed to exert tumor promoting effects to balance out any tumor suppressive effects caused by CCR2 deficiency (Pahler et al, 2008). In addition, CCL2 over expression in colon carcinoma cells and rat gliosarcoma cells suppress tumor formation when these tumor cells are injected into rodents (Hoshino et al, 1995). This anti-tumor phenotype correlates with increased accumulation and activation of macrophages at the site of injection in immunocompromised mice (Rollins and Sunday, 1991)
C. Regulation of chemokine expression As a number of studies have reported alterations in the expression of chemokines and chemokine receptors in various cancers, current studies are underway to determine the possible causes for the changes in expression during cancer progression. Certain environmental and soluble factors have been shown to induce expression of chemokines and chemokine receptors in epithelial and mesenchymal cells. Hypoxic regulated factors and hepatocyte growth factor (HGF) were shown to induce expression of CXCR4 in MCF-7 cells and MDA-MB-231 cells (Matteucci et al, 2007), while TNF-a enhanced CXCR4 expression in ovarian cancer cells (Kulbe et al, 2005). Multiple cytokines and growth factors including, TNF-a, IL-6, MSP, LMP1, CD40 were shown to induce expression of CCL2 and CCL5 in epithelial cells, macrophages, fibroblasts and endothelial cells (Biswas et al, 1998; Buettner et al, 2007). The possibility of genetic mutations as a possible cause for abnormal chemokine expression is currently under investigation. Loss of heterozygosity of CCL2 in cervical carcinoma at 17q11.2 has been associated with diminished progression, increased survival, and macrophage accumulation (Zijlmans et al, 2006). Gene variants of chemokines and receptors have been detected in one study in the form of base substitutions or base deletions: CCL5 -403(G>A), CXCL12 +801(G>A), CCR2 V64I (G>A), CCR5 (Delta32), though only CXCL12 +801(G>A) has been found to be associated with increased prostate cancer risk (Petersen et al, 2008). In addition, the polymorphism CCL5 -403(G/A) has been associated with increased susceptibility of prostate cancer (Saenz-Lopez et al, 2008). Studies of CXCL1 signaling have suggested that inactivating point mutations to CXCR2 (CXCR2G354W allele) in lung adenocarcinoma may be a means to escape CXCL1 induction of cellular senescence, and consequently tumor suppression (Acosta et al, 2008) While these few studies have detected a significant association with cancer risk or invasiveness, the functional significance to these gene variants remain largely unclear. Further studies should be conducted to investigate and 259
Hembruff and Cheng: Chemokine signaling in cancer and increased T cell responses in immunocompetent mice (Manome et al, 1995). Moreover, over expression of CCL5 in the thymoma cell lines EL4 or EG 7 has been shown to inhibit tumor growth when injected in mice, characterized by increased recruitment of T cells, natural killer (NK) cells, and dendritic cells. These studies indicate that enhanced chemokine signaling in cancer in part drives immune cell recruitment to the primary tumor. The ability of immune cells to mount an anti-tumor response may in part be tissue type dependent, and dependent on the mouse model used, as immune cells appear to be more effective in preventing establishment of the primary tumor in mice with intact immune systems as opposed to immunocompromised mice. In addition, studies have reported tumor-promoting roles for antigen presenting cells including macrophages and dendritic cells in immunocompromised mouse models and transgenic mouse models of cancer, which may in part be regulated by signals in the tumor microenvironment (Pollard, 2004; Melief, 2005; Allavena et al, 2008).
Expression of chemokines in the tumor-associated stroma indicates that chemokines may regulate stromal: epithelial interactions in the primary tumor microenvironment. This hypothesis is supported by studies of carcinoma cells interactions with various stromal cell types. Increased expression of CXCL1 in melanomaassociated fibroblasts indicated that CXCL1 may regulate paracrine signaling interactions between fibroblasts and melanoma cancer cells to promote cancer cell proliferation and migration (Gallagher et al, 2005). In lung adenocarcinoma cells that showed increased expression of CXCR2, co-culture with lung stromal cells including macrophages, endothelial cells and fibroblasts increased carcinoma cell proliferation and enhanced tumor growth in mice, through a CXCL1/CXCR2 dependent mechanism (Zhong et al, 2008). Studies have also shown that stromal: epithelial interactions regulated by chemokines signaling may also have important implications in metastatic spread. To study the mechanisms of bone metastases during prostate cancer, human prostate cancer cells were co-cultured with normal human bone fibroblasts in a 3-D co-culture model. These experiments resulted in long term changes in gene expression patterns in the bone fibroblasts including increased expression of CCL5, CXCL5 and CXCL15. Moreover, co-culture of these carcinoma-associated bone fibroblasts enhanced tumor progression of a benign prostate cell line in mice, associated with increased chemokine expression (Sung et al, 2008), indicating that carcinoma cells can exert long term tumor promoting changes in stromal cells associated with enhanced chemokine signaling. In other studies, increased expression of CCL2 in human bone marrow endothelial cells was shown to enhance prostate cancer cell proliferation and migration associated with increased Rac1 signaling when co-cultured in vitro (van Golen et al, 2008) with important implications in the mechanism of transendothelial migration of prostate cancer cells to the bone. In other studies, mesenchymal stem cells co-cultured with human breast cancer cell lines including: MCF-7, T47D and MDA-MB-231 cells enhanced cancer cell migration in vitro through CCL5, CCL2 and CXCL12 dependent mechanisms with implications in bone metastases as well as invasiveness of the primary tumor (Karnoub et al, 2007; Corcoran et al, 2008; Molloy et al, 2009). Furthermore, CXCL12 and its receptor CXCR4 have been shown to regulate homing of receptor expressing cancer cells to tissues where non-malignant stromal cells express CXCL12 (Muller et al, 2001). These studies demonstrate that tumor cell metastasis is not random, but guided by the expression of chemokine receptors and adhesion molecules on the neoplastic cells.
E. Role of chemokine signaling in epithelial and tumor associated stromal cells Studies have revealed that chemokines regulate growth and migratory signals in multiple types of epithelial cells. Induction of chemotaxis has been observed in a number of carcinoma cell lines including those of breast, prostate, melanoma and lung (Prest et al, 1999; Woodward et al, 2002, Loberg et al, 2006; Huang et al, 2008). Chemokines were also shown to regulate growth of certain carcinoma cell lines. CXCL12, CCL2, CCL5 and CXCL1 were shown to stimulate proliferation of melanoma, glioma, and prostate cancer cell proliferation (Payne and Cornelius, 2002; Darash-Yahana et al, 2004; Loberg et al, 2006; Vaday et al, 2006). These same chemokines appear to mainly stimulate migratory signals in breast cancer cells; however, CXCL12 has been shown to stimulate proliferation of breast cancer cells (Allinen et al, 2004). These studies indicate that the abilty of chemokines to stimulate cell proliferation may be cell type specific. In addition to signaling in epithelial cells, chemokines have also been shown to regulate the functions of various mesenchymal cell types. The ability of chemokines to stimulate chemotactic responses of T cells and antigen presenting cells using in vitro assays is well established (Zabel et al, 2006). Additional studies have shown that CCL2, CXCL1, CCL5, CXCL12 function as potent angiogenic factors, stimulating endothelial cell migration and tube formation, as well as angiogenesis in corneal and chick cam angiogenesis assays (Goede et al, 1999; Salcedo et al, 2000; Azenshtein 2002; Dhawan and Richmond, 2002). Recent studies have also shown that chemokines can also regulate migration of lung fibroblasts through a CXCR2 dependent mechanism (Wislez et al, 2006); however the significance of chemokines on the regulation of fibroblast behavior currently remains unclear. These studies demonstrate that chemokines can regulate the functions of multiple types of mesenchymal cells with important implications on the functions on these cells in the tumor microenvironment.
IV. Current use of chemokines in cancer therapy As the importance of chemokine expression becomes more recognized in the growth, invasion and metastasis of cancer, it also becomes necessary to develop inhibitors of these chemokines or their related receptors. There have been many studies performed using various inhibitors of chemokines and chemokine receptors and recently have 260
Cancer Therapy Vol 7, page 261 shown efficacy in the treatment of cancer of solid tissues in preclinical models. Currently, a few of these studies have proceeded to clinical trials towards patient therapy. One promising avenue in the treatment of metastatic disease in solid tumors is in the targeting of the CXCL12 and its receptor CXCR4, which have been shown to regulate homing of cancer cells to distant sites as best demonstrated in breast cancer (Muller et al, 2001). One of the most widely studied compounds is AMD3100 which is thought to specifically block CXCR4 signaling (Burger et al, 1999). This compound has shown efficacy in murine models as it delays pulmonary metastases of mammary carcinoma cells (Smith et al, 2004), reduces dissemination of ovarian cancer cells (Kajiyama et al, 2008) and reduces gastric cancer tumor growth (Yasumoto et al, 2006). While the mechanism of action for AMD3100 is currently under investigation, AMD3100 has been shown to inhibit CXCL12 stimulated migration of breast (Cabioglu et al, 2005), ovarian (Scotton et al, 2002) and gastric cancer cells (Ohira et al, 2006) as well as decrease the invasiveness of prostate cancer cells (PC3 cell line) (Zhang et al, 2008). This compound has been also been tested in vitro studies with other cell types including, pancreatic, colorectal, osteosarcoma and, malignant melanoma (Burger and Peled, 2009). These studies indicate that AMD3100 inhibits tumor progression, in part by inhibiting tumor epithelial cell proliferation, migration and invasion. Recent studies have shown that AMD3100 has mobilizes hematopoietic cells into the peripheral blood (Azab et al, 2009). The increased mobilization renders leukemia and myeloma cells more sensitive to chemotherapeutic intervention by decreasing their association with the bone marrow (Nervi et al, 2008). Thus, the potential benefits of AMD3100 are currently being evaluated in combination with other chemotherapies in patients with blood cancers (Cashen et al, 2008; Stewart et al, 2009). However, the effects of AMD3100 on hematopoietic cells in solid tumors remain unclear. Given the contribution of hematopoietic cells to the progression of solid tumors (Pollard, 2004; Karnoub et al, 2007), the functional consequences of AMD3100 in the tumor microenvironment should be further investigated. Other inhibitors to the CXCL12/CXCR4 pathway have shown promising results in pre-clinical models and in early clinical trials. CTCE-9908, which is a peptide analog of CXCL12 and an active inhibitor of the ligand, has shown promising results as a well tolerated drug that stabilized disease in early clinical trials for late stage cancer patients (Hotte et al, 2007; Evans, 2008). In preclinical studies, this compound has been used in the treatment of osteogenic sarcoma in mice and has been found to decrease growth, adhesion, migration, and invasion in osteosarcoma cells in vitro (Kim et al, 2008). When these cells were then injected into the tail veins of mice, treatment with CTCE-9908 resulted in a 50% reduction in the number of gross metastatic lung nodules and a marked decrease in micro-metastatic disease. Similar results have also seen with melanoma cells, but only when the cells were pre-treated with the inhibitor before injection (Kim et al, 2008). While CTCE-9908 specifically targets CXCL12 and AMD3100 is inhibits
CXCR4, both compounds inhibited metastatic spread of various cancers in preclinical models, underscoring the importance of CXCL12/CXCR4 signaling in metastatic disease. Another chemokine receptor/ligand pair that has been studied in the growth and metastasis of cancer is CCL5/CCR5. Like CXCL12/CXCR4, this pair of proteins has been implicated in the growth and metastasis of many types of cancers, including breast cancer and multiple myeloma. One study showed that monoclonal antibodies to CCR5 significantly blocked CCL5 signaling in MDAMB-231 breast cancer cells enhanced by mesenchymal stem cells in vitro. Furthemore, systemic treatment of tumor bearing mice with anti -CCR5 inhibited metastatic spread of MDA-MB-231 cells (Karnoub et al, 2007). These studies indicate that CCR5 antagonists significantly block interactions between tumor epithelial cells and mesenchymal stem cells during tumor progression. In other studies, daily systemic treatment of a functional antagonist to CCL5 (met-RANTES or met-CCL5) slowed tumor growth of 410.4 breast cancer cells transplanted into mice, and also reduced macrophage infiltration into the tumor (Robinson et al, 2003). However, Met-CCL5 was unable to reduce the infiltration of other immune cells such as neutrophils (Robinson et al, 2003), which have also been shown to play tumor promoting roles in breast cancer (Queen et al, 2005). One possibility is that these cells express other chemokine or cytokine receptors that could respond to other ligands in the tumor microenvironment while another possibility is that other CCR5 binding ligands could compensate for lack of CCL5 function. Thus, it is possible that redundant signaling of chemokine receptors could reduce the efficacy of these chemokine antagonists in cancer. Indeed, these factors may be partly responsible for the lack of improvement reported in Phase IIA clinical trials for the treatment of rheumatoid arthritis (Vergunst et al, 2008). These studies indicate that inhibiting stromal: epithelial interactions mediated by CCL5 represent one potential approach to treating metastatic disease. Another CCR5 antagonist, TAK-779 has been found to inhibit CCL5-induced prostate cancer cell invasion in a concentration dependent manner (Vaday et al, 2006), indicating that CCR5 antagonists also affects autocrine signaling in cancer cells. However, the mechanism of this compound and efficacy in other types of cancers in in vitro and in vivo studies still remains unclear. Taken together, these studies indicate that the CCL5/CCR5 represents another potentially significant chemokine signaling pathway to target in cancer therapeutics. Other chemokine antagonists have also shown potential for clinical application in cancer treatment. For example, the CXCR2-selective antagonist AZ10397767 has been shown to decrease resistance of androgenindependent prostate cancer cells to oxaliplatin through an NF-kB dependent mechanism (Wilson et al, 2008). Coadministration of this inhibitor with TRAIL increased the sensitivity of PC3 cells, and was most likely due to the ability of AZ10397767 to block TRAIL and IL-8-induced upregulation of c-FLIP (Wilson et al, 2008). These studies
261
Hembruff and Cheng: Chemokine signaling in cancer indicate potential benefits in combining chemokine antagonists with other therapies. In addition to pharmacologic inhibitors that have been designed to specifically target chemokines and their receptors, recent studies have also found that pharmacologic inhibitors used to target other molecules also act as chemokine inhibitors. For example, Etanercept (Enbrel), a TNF-a inhibitor normally used to treat arthritis, has been shown to significantly decrease systemic levels of CCL2 in patients with metastatic breast cancer (Madhusudan et al, 2004). In addition, tamoxifen treatment has been found to inhibit CCL2 mRNA and protein expression in endometrial cancer cell line (EFE184) (Wang et al, 2006). These studies reveal that therapies intended to target specific molecules also indirectly affect the expression of other molecules. However, these unintended side effects may be exploited towards the treatment of cancer, as CCL2 as well as many other chemokines have been shown to play tumor promoting roles in different cancers (Table 3). It is possible that current drug therapies used to treat inflammatory diseases or particular types of cancers could function as inhibitors of chemokine signaling and be redirected towards the treatment of other cancers. However, this avenue of treatment requires further investigation and understanding how conventional therapies affect expression and function of chemokines at the molecular and cellular levels. In summary, while few chemokine antagonists have proceeded to clinical trials (Table 4), the development of chemokine antagonists for the treatment of cancer remains a promising avenue to explore.
indicate these expression patterns may be indicative of host responses towards the tumor. Chemokine expression has correlated with the presence of immune cells in some cancers representing either a positive or poor progonosis in cancers (KleineLowinski et al, 1999; Ueno et al, 2000) and may be dependent on the tissue type. The ability of immune cells to mount anti- tumor response may be in part dependent on the soluble factors expressed in the tumor microenvironment (Lewis and Pollard, 2006). Thus, by regulating the recruitment of immune cells to the primary tumor, the expression of chemokines in cancer may have multi-level consequences on cancer progression. While further studies should be investigated on the functional consequences of chemokine signaling on immune cells recruitment in cancer, the strong correlations of cancer stromal specific expression of chemokines and tumor malignancy indicate that a practical application for chemokines may be as markers for cancer prognosis. While studies have shown that chemokine antagonists are effective in treating invasive cancer in mouse models, there are many issues associated with therapeutic targeting of chemokines that have to be addressed and fully understood prior to their use in the treatment of cancer. The possibility of cytotoxic effects in normal tissues is always a consideration in the delivery of chemotherapeutic drugs which target specific molecules (Chari, 2008; Wysocki et al, 2008). This issue is an important consideration particularly for chemokines and their receptors, which are expressed in normal and cancer tissues. The promiscuous binding of ligands to multiple receptors may further complicate the ability of chemokine antagonists to specifically target cancer tissues. While some chemokine ligand/receptor pairs exhibit unique functions, as demonstrated by CCL2/CCR2 signaling, the possibility of redundant signaling may further complicate the effectiveness of chemokine antagonists in cancer. In summary, while current studies indicate promising roles for chemokines in the clnical setting, the sheer number of chemokines, pleiotropic effects of chemokines, and complex mechanisms of signal transduction add further questions regarding the functions of chemokines in cancer. What signaling pathways do chemokines activate to regulate cellular proliferation and migration, and are these signaling pathways activated in a cell type dependent
V. Summary and Conclusions: Future role of chemokines in the clinical setting It is apparent that chemokine signaling regulates multiple processes during tumor progression including primary tumor growth, tumor angiogenesis and metastatic spread. Based on current studies, chemokines mediate stromal: epithelial interactions in the primary tumor microenvironment to regulate tumor growth and invasion (Figure 2A). In addition, studies also indicate that chemokines also regulate homing of chemokine receptor expressing cancer cells to distant sites in metastatic disease (Figure 2B). Studies of chemokine expression in the cancer stroma and cancer stage, grade and patient survival and Table 4. Current use of chemokinesin cancer therapy
Chemokine Target CXCR4 CXCL12
Antagonist/Agonist AMD3100 CTCE-9908
CCL5 CCR5 CXCR2
Met-CCL5 TAK-779 AZ10397767 SB225002 MLN1202
CCR2
Cancer Leukemia and Lymphoma Late stage ovarian, breast, lung, colorectal, melanoma, gastric Breast Cancer Multiple Myeloma, Prostate Prostate Esophageal Breast
262
Clinical Trial Status Phase II Phase I/II Pre-clinical Pre-clinical Pre-clinical Pre-clinical
Cancer Therapy Vol 7, page 263
Figure 2. Model for the functional roles of inflammatory chemokinesignaling in cancer. (A) Stromal and epithelial cells secrete inflammatory chemokines, contributing to the bioavailability of chemokinesin the local tisuemicroenvironment. Inflammatory chemokinesregulate autocrineand paracrinesignaling interactions between stromal and epithelial cells to regulate cellular proliferation, migration and invasion. (B) Expression of Inflammatory chemokinesin normal tissues, as demonstrated by CXCl12 and CCL5 create a chemokinegradient which regulate homing of chemokinereceptor expressing cancer cells to other organs.
context? How do chemokines regulate the dynamic interactions between different types of immune cells in the tumor microenvironment? How do chemokines coordinate with other signaling pathways in the tumor microenvironment to regulate tumor progression? Answering these and other questions through further study will lead to a greater understanding of the role of chemokines in tumor progression, and will enable the design of more effective applications for chemokines in the clinical setting.
References Adriaenssens E, Dumont L, Lottin S, Bolle D, LeprĂŞtre A, Delobelle A, Bouali F, Dugimont T, Coll J, Curgy JJ (1998) H19 overexpression in breast adenocarcinoma stromal cell is associated with tumor values and steroid receptor status but independent of p53 and Ki-67 expression. Am J Pathol 153, 1597-1607. Acosta JC, O'Loghlen A, Banito A, Guijarro MV, Augert A, Raguz S, Fumagalli M, Da Costa M, Brown C, Popov N, Takatsu Y, Melamed J, d'Adda di Fagagna F, Bernard D, Hernando E, Gil J (2008) Chemokine signaling via the CXCR2 receptor reinforces senescence. Cell 133, 10061018. Allavena P, Sica A, Solinas G, Porta C, Mantovani A (2008) The inflammatory micro-environment in tumor progression: the role of tumor-associated macrophages. Crit Rev Oncol Hematol 66, 1-9. Allinen M, Beroukhim R, Cai L, Brennan C, Lahti-Domenici J, Huang H, Porter D, Hu M, Chin L, Richardson A, Schnitt S, Sellers WR, Polyak K (2004) Molecular characterization of
Acknowledgement This work was supported by grant number 1K99CA127357-01A2 from the National Cancer Institute and funds from University of Kansas Endowment.
263
Hembruff and Cheng: Chemokine signaling in cancer the tumor microenvironment in breast cancer. Cancer Cell 6, 17-32. Aramori I, Ferguson SS, Bieniasz PD, Zhang J, Cullen B, Cullen MG (1997) Molecular mechanism of desensitization of the chemokine receptor CCR-5: receptor signaling and internalization are dissociable from its role as an HIV-1 coreceptor. EMBO J 16, 4606-4616. Arnold JM, Huggard PR, Cummings M, Ramm GA, ChenevixTrench G (2005) Reduced expression of chemokine (C-C motif) ligand-2 (CCL2) in ovarian adenocarcinoma. Br J Cancer 92, 2024-2031. Azab AK, Runnels JM, Pitsillides C, Moreau AS, Azab F, Leleu X, Jia X, Wright R, Ospina B, Carlson AL, Alt C, Burwick N, Roccaro AM, Ngo HT, Farag M, Melhem MR, Sacco A, Munshi NC, Hideshima T, Rollins BJ, Anderson KC, Kung AL, Lin CP, Ghobrial IM (2009) The CXCR4 inhibitor AMD3100 disrupts the interaction of multiple myeloma cells with the bone marrow microenvironment and enhances their sensitivity to therapy. Blood. Epub,ahead of print. Beider K, Abraham M, Peled A (2008) Chemokines and chemokine receptors in stem cell circulation. Front Biosci 13, 6820-6833. Biswas P, Delfanti F, Bernasconi S, Mengozzi M, Cota M, Polentarutti N, Mantovani A, Lazzarin A, Sozzani S, Poli G (1998) Interleukin-6 induces monocyte chemotactic protein-1 in peripheral blood mononuclear cells and in the U937 cell line. Blood 91, 258-265. Boring L, Gosling J, Chensue SW, Kunkel SL, Farese RV, Jr, Broxmeyer HE, Charo IF (1997) Impaired monocyte migration and reduced type 1 (Th1) cytokine responses in CC chemokine receptor 2 knockout mice. J Clin Invest 100, 2552-2561. Buettner M, Meyer B, Schreck S, Niedobitek G (2007) Expression of RANTES and MCP-1 in epithelial cells is regulated via LMP1 and CD40. Int J Cancer 121, 2703-2710. Bug G, Rossmanith T, Henschler R, Kunz-Schughart LA, Schroder B, Kampfmann M, Kreutz M, Hoelzer D, Ottmann OG (2002) Rho family small GTPases control migration of hematopoietic progenitor cells into multicellular spheroids of bone marrow stroma cells. J Leukoc Biol 72, 837-845. Burger JA, Burger M, Kipps TJ (1999) Chronic lymphocytic leukemia B cells express functional CXCR4 chemokine receptors that mediate spontaneous migration beneath bone marrow stromal cells. Blood 94, 3658-3667. Burger JA, Peled A (2009) CXCR4 antagonists: targeting the microenvironment in leukemia and other cancers. Leukemia 23, 43-52. Cabioglu N, Summy J, Miller C, Parikh NU, Sahin AA, Tuzlali S, Pumiglia K, Gallick GE, Price JE (2005) CXCL12/stromal cell-derived factor-1alpha transactivates HER2neu in breast cancer cells by a novel pathway involving Src kinase activation. Cancer Res 65, 6493-6497. Cashen A, Lopez S, Gao F, Calandra G, MacFarland R, Badel K, DiPersio J (2008) A phase II study of plerixafor (AMD3100) plus G-CSF for autologous hematopoietic progenitor cell mobilization in patients with Hodgkin lymphoma. Biol Blood Marrow Transplant 14, 1253-1261. Chari RV (2008) Targeted cancer therapy: conferring specificity to cytotoxic drugs. Acc Chem Res 41, 98-107. Chinni SR, Sivalogan S, Dong Z, Filho JC, Deng X, Bonfil RD, Cher ML (2006) CXCL12/CXCR4 signaling activates Akt-1 and MMP-9 expression in prostate cancer cells: the role of bone microenvironment-associated CXCL12. Prostate 66, 32-48. Comerford I, Litchfield W, Harata-Lee Y, Nibbs RJ, McColl SR (2007) Regulation of chemotactic networks by 'atypical' receptors. Bioessays 29, 237-247
Conti I, Dube C, Rollins BJ (2004) Chemokine-based pathogenetic mechanisms in cancer. In Cancer and Inflammation, D.J. Chadwick, J. Goode, eds. (Novartis Foundation), pp. 29-39. Corcoran KE, Trzaska KA, Fernandes H, Bryan M, Taborga M, Srinivas V, Packman K, Patel PS, Rameshwar P (2008) Mesenchymal stem cells in early entry of breast cancer into bone marrow. PLoS ONE 3, e2563. Cotton M, Claing A (2009) G protein-coupled receptors stimulation and the control of cell migration. Cell Signal. Epub, ahead of print. Darash-Yahana M, Pikarsky E, Abramovitch R, Zeira E, Pal B, Karplus R, Beider K, Avniel S, Kasem S, Galun E, Peled A (2004) Role of high expression levels of CXCR4 in tumor growth, vascularization, metastasis. Faseb J 18, 1240-1242. De Paepe B, Creus KK, De Bleecker JL (2008) Chemokines in idiopathic inflammatory myopathies. Front Biosci 13, 25482577. Deuel TF, Senior RM, Chang D, Griffin GL, Heinrikson RL, Kaiser ET (1981) Platelet factor 4 is chemotactic for neutrophils and monocytes. Proc Natl Acad Sci U S A 78, 4584-4587. Devalaraja MN, Richmond A (1999) Multiple chemotactic factors: fine control or redundancy? Trends Pharmacol Sci 20, 151-156. DeVries ME, Kelvin AA, Xu L, Ran L, Robinson J, Kelvin DJ (2006) Defining the origins and evolution of the chemokine/chemokine receptor system. J Immunol 176, 401-415. Dhawan P and Richmond A (2002) Role of CXCL1 in tumorigenesis of melanoma. J Leukoc Biol 72, 9-18. Evans D (2008) Chemokine Therapeutics Announces Final Results of CTCE-9908 Phase I/II Clinical Trial in Late Stage Cancer Patients. Reuters. Epub, Press release from Chemokine Therapeutics Corp. Finak G, Bertos N, Pepin F, Sadekova S, Souleimanova M, Zhao H, Chen H, Omeroglu G, Meterissian S, Omeroglu A, Hallett M, Park M (2008) Stromal gene expression predicts clinical outcome in breast cancer. Nat Med 14, 518-527. Firestein GS (2004) The T cell cometh: interplay between adaptive immunity and cytokine networks in rheumatoid arthritis. J Clin Invest 114, 471-474. Frederick MJ, Henderson Y, Xu X, Deavers MT, Sahin AA, Wu H, Lewis DE, El-Naggar AK, Clayman GL (2000) In vivo expression of the novel CXC chemokine BRAK in normal and cancerous human tissue. Am J Pathol 156, 1937-1950. Gallagher PG, Bao Y, Prorock A, Zigrino P, Nischt R, Politi V, Mauch C, Dragulev B, Fox JW (2005) Gene expression profiling reveals cross-talk between melanoma and fibroblasts: implications for host-tumor interactions in metastasis. Cancer Res 65, 4134-4146. Ganju RK, Brubaker SA, Meyer J, Dutt P, Yang Y, Qin S, Newman W, Groopman JE (1998) The alpha-chemokine, stromal cell-derived factor-1alpha, binds to the transmembrane G-protein-coupled CXCR-4 receptor and activates multiple signal transduction pathways. J Biol Chem 273, 23169-23175. Gillitzer R, Goebeler M (2001) Chemokines in cutaneous wound healing. J Leukoc Biol 69, 513-521. Goda S, Inoue H, Umehara H, Miyaji M, Nagano Y, Harakawa N, Imai H, Lee P, Macarthy JB, Ikeo T, Domae N, Shimizu Y, Iida J (2006) Matrix metalloproteinase-1 produced by human CXCL12-stimulated natural killer cells. Am J Pathol 169, 445-458. Goede V, Brogelli L, Ziche M, Augustin HG (1999) Induction of inflammatory angiogenesis by monocyte chemoattractant protein-1. Int J Cancer 82, 765-770.
264
Cancer Therapy Vol 7, page 265 Hernandez PA, Gorlin RJ, Lukens JN, Taniuchi S, Bohinjec J, Francois F, Klotman ME, Diaz GA (2003) Mutations in the chemokine receptor gene CXCR4 are associated with WHIM syndrome, a combined immunodeficiency disease. Nat Genet 34, 70-74. Hoshino Y, Hatake K, Kasahara T, Takahashi Y, Ikeda M, Tomizuka H, Ohtsuki T, Uwai M, Mukaida N, Matsushima K, Miura Y (1995) Monocyte chemoattractant protein-1 stimulates tumor necrosis and recruitment of macrophages into tumors in tumor-bearing nude mice: increased granulocyte and macrophage progenitors in murine bone marrow. Exp Hematol 23, 1035-1039. Hotte S, Hirte H, Iacobucci A, Wong D, Korz W, Miller W (2007) Phase I/II study of CTCE-9908, a novel anticancer agent that inhibits CXCR4, in patients with advanced solid cancers. Paper presented at: Molecular Targets and Cancer Therapeutics International Conference. Huang CY, Fong YC, Lee CY, Chen MY, Tsai HC, Hsu HC, Tang CH (2008) CCL5 increases lung cancer migration via PI3K, Akt and NF-kappaB pathways. Biochem Pharmacol. 77, 794-803. Huang DR, Wang J, Kivisakk P, Rollins BJ, Ransohoff RM (2001) Absence of monocyte chemoattractant protein 1 in mice leads to decreased local macrophage recruitment and antigen-specific T helper cell type 1 immune response in experimental autoimmune encephalomyelitis. J Exp Med 193, 713-726. Kajiyama H, Shibata K, Terauchi M, Ino K, Nawa A, Kikkawa F (2008) Involvement of SDF-1alpha/CXCR4 axis in the enhanced peritoneal metastasis of epithelial ovarian carcinoma. Int J Cancer 122, 91-99. Karnoub AE, Dash AB, Vo AP, Sullivan A, Brooks MW, Bell GW, Richardson AL, Polyak K, Tubo R, Weinberg RA (2007) Mesenchymal stem cells within tumour stroma promote breast cancer metastasis. Nature 449, 557-563. Kim SY, Lee CH, Midura BV, Yeung C, Mendoza A, Hong SH, Ren L, Wong D, Korz W, Merzouk A, Salari H, Zhang H, Hwang ST, Khanna C, Helman LJ (2008) Inhibition of the CXCR4/CXCL12 chemokine pathway reduces the development of murine pulmonary metastases. Clin Exp Metastasis 25, 201-211. Kleer CG, Bloushtain-Qimron N, Chen YH, Carrasco D, Hu M, Yao J, Kraeft SK, Collins LC, Sabel MS, Argani P, Gelman R, Schnitt SJ, Krop IE, Polyak K (2008) Epithelial and stromal cathepsin K and CXCL14 expression in breast tumor progression. Clin Cancer Res 14, 5357-5367. Kleine-Lowinski K, Gillitzer R, Kuhne-Heid R, Rosl F (1999) Monocyte-chemo-attractant-protein-1 (MCP-1)-gene expression in cervical intra-epithelial neoplasias and cervical carcinomas. Int J Cancer 82, 6-11. Kulbe H, Hagemann T, Szlosarek PW, Balkwill FR, Wilson JL (2005) The inflammatory cytokine tumor necrosis factoralpha regulates chemokine receptor expression on ovarian cancer cells. Cancer Res 65, 10355-10362. Laing KJ, Secombes CJ (2004) Chemokines. Dev Comp Immunol 28, 443-460. Lewis CE, Pollard JW (2006) Distinct role of macrophages in different tumor microenvironments. Cancer Res 66, 605612. Li J, Sidell N (2005) Growth-related oncogene produced in human breast cancer cells and regulated by Syk proteintyrosine kinase. Int J Cancer 117, 14-20. Li M, Ransohoff RM (2009) The roles of chemokine CXCL12 in embryonic and brain tumor angiogenesis. Semin Cancer Biol 19, 111-115. Liang Z, Yoon Y, Votaw J, Goodman MM, Williams L, Shim H (2005) Silencing of CXCR4 blocks breast cancer metastasis. Cancer Res 65, 967-971.
Loberg RD, Day LL, Harwood J, Ying C, St John LN, Giles R, Neeley CK, Pienta KJ (2006) CCL2 is a potent regulator of prostate cancer cell migration and proliferation. Neoplasia 8, 578-586. Locati M, Torre YM, Galliera E, Bonecchi R, Bodduluri H, Vago G, Vecchi A, Mantovani A (2005) Silent chemoattractant receptors: D6 as a decoy and scavenger receptor for inflammatory CC chemokines. Cytokine Growth Factor Rev 16, 679-686. Madhusudan S, Foster M, Muthuramalingam SR, Braybrooke JP, Wilner S, Kaur K, Han C, Hoare S, Balkwill F, Talbot DC, Ganesan TS, Harris AL (2004) A phase II study of etanercept (Enbrel), a tumor necrosis factor alpha inhibitor in patients with metastatic breast cancer. Clin Cancer Res 10, 65286534. Manome Y, Wen PY, Hershowitz A, Tanaka T, Rollins BJ, Kufe DW, Fine HA (1995) Monocyte chemoattractant protein-1 (MCP-1) gene transduction: an effective tumor vaccine strategy for non-intracranial tumors. Cancer Immunol Immunother 41, 227-235. Matteucci E, Ridolfi E, Maroni P, Bendinelli P, Desiderio MA (2007) c-Src/histone deacetylase 3 interaction is crucial for hepatocyte growth factor dependent decrease of CXCR4 expression in highly invasive breast tumor cells. Mol Cancer Res 5, 833-845. Melief CJ (2005) Cancer immunology: cat and mouse games. Nature 437, 41-42. Moll NM, Cossoy MB, Fisher E, Staugaitis SM, Tucky BH, Rietsch AM, Chang A, Fox RJ, Trapp BD, Ransohoff RM (2009) Imaging correlates of leukocyte accumulation and CXCR4/CXCL12 in multiple sclerosis. Arch Neurol 66, 4453. Molloy AP, Martin FT, Dwyer RM, Griffin TP, Murphy M, Barry FP, O'Brien T, Kerin MJ (2009) Mesenchymal stem cell secretion of chemokines during differentiation into osteoblasts, their potential role in mediating interactions with breast cancer cells. Int J Cancer 124, 326-332. MĂźller A, Homey B, Soto H, Ge N, Catron D, Buchanan ME, McClanahan T, Murphy E, Yuan W, Wagner SN, Barrera JL, Mohar A, VerĂĄstegui E, Zlotnik A (2001) Involvement of chemokine receptors in breast cancer metastasis. Nature 410, 50-56. Nervi B, Ramirez P, Rettig MP, Uy GL, Holt MS, Ritchey JK, Prior JL, Piwnica-Worms D, Bridger G, Ley TJ, Dipersio JF (2008) Chemosensitization of AML following mobilization by the CXCR4 antagonist AMD3100. Blood.Epub, ahead of print. Niwa Y, Akamatsu H, Niwa H, Sumi H, Ozaki Y, Abe A (2001) Correlation of tissue and plasma RANTES levels with disease course in patients with breast or cervical cancer. Clin Cancer Res 7, 285-289. Ohira S, Sasaki M, Harada K, Sato Y, Zen Y, Isse K, Kozaka K, Ishikawa A, Oda K, Nimura Y, Nakanuma Y (2006) Possible regulation of migration of intrahepatic cholangiocarcinoma cells by interaction of CXCR4 expressed in carcinoma cells with tumor necrosis factor-alpha and stromal-derived factor1 released in stroma. Am J Pathol 168, 1155-1168. Oliveira-Neto HH, Silva ET, Leles CR, Mendonca EF, Alencar Rde C, Silva TA, Batista AC (2008) Involvement of CXCL12 and CXCR4 in lymph node metastases and development of oral squamous cell carcinomas. Tumour Biol 29, 262-271. Oppermann M (2004) Chemokine receptor CCR5: insights into structure, function, regulation. Cell Signal 16, 1201-1210. Ou ZL, Wang J, Hou YF, Luo JM, Shen ZZ, Shao ZM (2006) [Downregulation of Duffy antigen receptor for chemokine (DARC) is associated with lymph node metastasis in human breast cancer]. Zhonghua Zhong Liu Za Zhi 28, 586-589.
265
Hembruff and Cheng: Chemokine signaling in cancer Pahler JC, Tazzyman S, Erez N, Chen YY, Murdoch C, Nozawa H, Lewis CE, Hanahan D (2008) Plasticity in tumorpromoting inflammation: impairment of macrophage recruitment evokes a compensatory neutrophil response. Neoplasia 10, 329-340. Payne AS, Cornelius LA (2002) The role of chemokines in melanoma tumor growth and metastasis. J Invest Dermatol 118, 915-922. Petersen DC, Severi G, Hoang HN, Padilla EJ, Southey MC, English DR, Hopper JL, Giles GG, Hayes VM (2008) No association between common chemokine and chemokine receptor gene variants and prostate cancer risk. Cancer Epidemiol Biomarkers Prev 17, 3615-3617. Pollard JW (2004) Tumour-educated macrophages promote tumour progression and metastasis. Nat Rev Cancer 4, 7178. Prest SJ, Rees RC, Murdoch C, Marshall JF, Cooper PA, Bibby M, Li G, Ali SA (1999) Chemokines induce the cellular migration of MCF-7 human breast carcinoma cells: subpopulations of tumour cells display positive and negative chemotaxis and differential in vivo growth potentials. Clin Exp Metastasis 17, 389-396. Queen MM, Ryan RE, Holzer RG, Keller-Peck CR, Jorcyk CL (2005) Breast cancer cells stimulate neutrophils to produce oncostatin M: potential implications for tumor progression. Cancer Res 65, 8896-8904. Rajagopalan L, Rajarathnam K (2006) Structural basis of chemokine receptor function--a model for binding affinity and ligand selectivity. Biosci Rep 26, 325-339. Robinson SC, Scott KA, Wilson JL, Thompson RG, Proudfoot AE, Balkwill FR (2003) A chemokine receptor antagonist inhibits experimental breast tumor growth. Cancer Res 63, 8360-8365. Rollins BJ, Sunday ME (1991) Suppression of tumor formation in vivo by expression of the JE gene in malignant cells. Mol Cell Biol 11, 3125-3131. Rostene W, Kitabgi P, Parsadaniantz SM (2007) Chemokines: a new class of neuromodulator? Nat Rev Neurosci 8, 895-903. Saenz-Lopez P, Carretero R, Cozar JM, Romero JM, Canton J, Vilchez JR, Tallada M, Garrido F, Ruiz-Cabello F (2008) Genetic polymorphisms of RANTES, IL1-A, MCP-1 and TNF-A genes in patients with prostate cancer. BMC Cancer 8, 382. Salamonsen LA, Hannan NJ, Dimitriadis E (2007) Cytokines and chemokines during human embryo implantation: roles in implantation and early placentation. Semin Reprod Med 25, 437-444. Salcedo R, Ponce ML, Young HA, Wasserman K, Ward JM, Kleinman HK, Oppenheim JJ, Murphy WJ (2000) Human endothelial cells express CCR2 and respond to MCP-1: direct role of MCP-1 in angiogenesis and tumor progression. Blood 96, 34-40. Schrader AJ, Lechner O, Templin M, Dittmar KE, Machtens S, Mengel M, Probst-Kepper M, Franzke A, Wollensak T, Gatzlaff P, Atzpodien J, Buer J, Lauber J (2002) CXCR4/CXCL12 expression and signalling in kidney cancer. Br J Cancer 86, 1250-1256. Scotton CJ, Wilson JL, Scott K, Stamp G, Wilbanks GD, Fricker S, Bridger G, Balkwill FR (2002) Multiple actions of the chemokine CXCL12 on epithelial tumor cells in human ovarian cancer. Cancer Res 62, 5930-5938. Shellenberger TD, Wang M, Gujrati M, Jayakumar A, Strieter RM, Burdick MD, Ioannides CG, Efferson CL, El-Naggar AK, Roberts D, Clayman GL, Frederick MJ (2004) BRAK/CXCL14 is a potent inhibitor of angiogenesis and a chemotactic factor for immature dendritic cells. Cancer Res 64, 8262-8270.
Smith MC, Luker KE, Garbow JR, Prior JL, Jackson E, PiwnicaWorms D, Luker GD (2004) CXCR4 regulates growth of both primary and metastatic breast cancer. Cancer Res 64, 8604-8612. Stewart DA, Smith C, MacFarland R, Calandra G (2009) Pharmacokinetics and pharmacodynamics of plerixafor in patients with non-Hodgkin lymphoma and multiple myeloma. Biol Blood Marrow Transplant 15, 39-46. Sung SY, Hsieh CL, Law A, Zhau HE, Pathak S, Multani AS, Lim S, Coleman IM, Wu LC, Figg WD, Dahut WL, Nelson P, Lee JK, Amin MB, Lyles R, Johnstone PA, Marshall FF, Chung LW (2008) Coevolution of prostate cancer and bone stroma in three-dimensional coculture: implications for cancer growth and metastasis. Cancer Res 68, 9996-10003. Taub DD, Conlon K, Lloyd AR, Oppenheim JJ, Kelvin DJ (1993) Preferential migration of activated CD4+ and CD8+ T cells in response to MIP-1 alpha and MIP-1 beta. Science 260, 355-358. Tsukishiro S, Suzumori N, Nishikawa H, Arakawa A, Suzumori K (2006) Elevated serum RANTES levels in patients with ovarian cancer correlate with the extent of the disorder. Gynecol Oncol 102, 542-545. Ueno T, Toi M, Saji H, Muta M, Bando H, Kuroi K, Koike M, Inadera H, Matsushima K (2000) Significance of macrophage chemoattractant protein-1 in macrophage recruitment, angiogenesis, survival in human breast cancer. Clin Cancer Res 6, 3282-3289. Vaday GG, Peehl DM, Kadam PA, Lawrence DM (2006) Expression of CCL5 (RANTES) and CCR5 in prostate cancer. Prostate 66, 124-134. Valkovic T, Lucin K, Krstulja M, Dobi-Babic R, Jonjic N (1998) Expression of monocyte chemotactic protein-1 in human invasive ductal breast cancer. Pathol Res Pract 194, 335340. Van de Broek I, Leleu X, Schots R, Facon T, Vanderkerken K, Van Camp B, Van Riet I (2006) Clinical significance of chemokine receptor (CCR1, CCR2 and CXCR4) expression in human myeloma cells: the association with disease activity and survival. Haematologica 91, 200-206. van Golen KL, Ying C, Sequeira L, Dubyk CW, Reisenberger T, Chinnaiyan AM, Pienta KJ, Loberg RD (2008) CCL2 induces prostate cancer transendothelial cell migration via activation of the small GTPase Rac. J Cell Biochem 104, 1587-1597. Vazquez-Martin A, Colomer R, Menendez JA (2007) Protein array technology to detect HER2 (erbB-2)-induced 'cytokine signature' in breast cancer. Eur J Cancer 43, 1117-1124. Vergunst CE, Gerlag DM, Lopatinskaya L, Klareskog L, Smith MD, van den Bosch F, Dinant HJ, Lee Y, Wyant T, Jacobson EW, Baeten D, Tak PP (2008) Modulation of CCR2 in rheumatoid arthritis: a double-blind, randomized, placebocontrolled clinical trial. Arthritis Rheum 58, 1931-1939. Vila-Coro AJ, Rodriguez-Frade JM, Martin De Ana A, MorenoOrtiz MC, Martinez AC, Mellado M (1999) The chemokine SDF-1alpha triggers CXCR4 receptor dimerization and activates the JAK/STAT pathway. FASEB J 13, 1699-1710. Vital EM, Emery P (2008) The development of targeted therapies in rheumatoid arthritis. J Autoimmun 31, 219-227. Wang L, Zheng W, Zhang S, Chen X, Hornung D (2006) Expression of monocyte chemotactic protein-1 in human endometrial cancer cells and the effect of treatment with tamoxifen or buserelin. J Int Med Res 34, 284-290. Wente MN, Mayer C, Gaida MM, Michalski CW, Giese T, Bergmann F, Giese NA, Buchler MW, Friess H (2008) CXCL14 expression and potential function in pancreatic cancer. Cancer Lett 259, 209-217. Wilson C, Wilson T, Johnston PG, Longley DB, Waugh DJ (2008) Interleukin-8 signaling attenuates TRAIL- and
266
Cancer Therapy Vol 7, page 267 chemotherapy-induced apoptosis through transcriptional regulation of c-FLIP in prostate cancer cells. Mol Cancer Ther 7, 2649-2661. Wislez M, Fujimoto N, Izzo JG, Hanna AE, Cody DD, Langley RR, Tang H, Burdick MD, Sato M, Minna JD, Mao L, Wistuba I, Strieter RM, Kurie JM (2006) High expression of ligands for chemokine receptor CXCR2 in alveolar epithelial neoplasia induced by oncogenic kras. Cancer Res 66, 41984207. Woodward JK, Elshaw SR, Murray AK, Nichols CE, Cross N, Laws D, Rennie IG, Sisley K (2002) Stimulation and inhibition of uveal melanoma invasion by HGF, GRO, IL1alpha and TGFbeta. Invest Ophthalmol Vis Sci 43, 31443152. Wu FY, Ou ZL, Feng LY, Luo JM, Wang LP, Shen ZZ, Shao ZM (2008) Chemokine decoy receptor d6 plays a negative role in human breast cancer. Mol Cancer Res 6, 1276-1288. Wysocki PJ, Zolnierek J, Szczylik C, Mackiewicz A (2008) Targeted therapy of renal cell cancer. Curr Opin Investig Drugs 9, 570-575. Yasumoto K, Koizumi K, Kawashima A, Saitoh Y, Arita Y, Shinohara K, Minami T, Nakayama T, Sakurai H, Takahashi Y, Yoshie O, Saiki I (2006) Role of the CXCL12/CXCR4
axis in peritoneal carcinomatosis of gastric cancer. Cancer Res 66, 2181-2187. Zabel BA, Zuniga L, Ohyama T, Allen SJ, Cichy J, Handel TM, Butcher EC (2006) Chemoattractants, extracellular proteases, the integrated host defense response. Exp Hematol 34, 10211032. Zhang S, Qi L, Li M, Zhang D, Xu S, Wang N, Sun B (2008) Chemokine CXCL12 and its receptor CXCR4 expression are associated with perineural invasion of prostate cancer. J Exp Clin Cancer Res 27, 62. Zhong L, Roybal J, Chaerkady R, Zhang W, Choi K, Alvarez CA, Tran H, Creighton CJ, Yan S, Strieter RM, Pandey A, Kurie JM (2008) Identification of secreted proteins that mediate cell-cell interactions in an in vitro model of the lung cancer microenvironment. Cancer Res 68, 7237-7245. Zijlmans HJ, Fleuren GJ, Baelde HJ, Eilers PH, Kenter GG, Gorter A (2006) The absence of CCL2 expression in cervical carcinoma is associated with increased survival and loss of heterozygosity at 17q11.2. J Pathol 208, 507-17. Zlotnick A, Yoshie O, Nomiyama H (2006) The chemokine and chemokine receptor superfamilies and their molecular evolution. Genome Biology 7, 243.
267
Cretu et al: Stress Sensor Gadd45 genes as therapeutic targets in cancer Cancer Therapy Vol 7, 268-276, 2009
Stress sensor Gadd45 genes as therapeutic targets in cancer Review Article
Alexandra Cretu*, Xiojen Sha, Jennifer Tront, Barbara Hoffman, Dan A Liebermann* Fels Institute for Cancer Research and Molecular Biology, and Department of Biochemistry, Temple University School of Medicine, Philadelphia, PA, 19140 USA
__________________________________________________________________________________ *Correspondence: Alexandra Cretu PhD, Fels Institute for Cancer Research and Molecular Biology; Dan Liebermann., PhD, Professor, Biochemistry, Professor, Fels Institute for Cancer Research and Molecular Biology, Temple University School of Medicine, Philadelphia, PA, 19140 USA; Tel: 215-707- 6903 ; Fax: 215-707-2805; e-mail: alexandra.cretu@temple.edu, lieberma@temple.edu Key words: Gadd45, cellular stress, Cell cycle arrest, DNA repair, gene activation, Demethylation, Apoptosis, Survival, Senescence, PCNA, p21, sCdc2/cyclinB1, MAPK stress kinases Abbreviations: global genomic repair, (GGR); Mouse Embryo Fibroblasts, (MEFs); nucleotide excision repair, (NER) Received: 3 March 2009; Revised: 30 March 2009 Accepted: 31 March 2009; electronically published: 14 April 2009
Summary Gadd45 genes have been implicated in stress signaling responses to various physiological or environmental stressors, resulting in cell cycle arrest, DNA repair, cell survival and senescence, or apoptosis. Evidence accumulated up to date suggests that Gadd45 proteins function as stress sensors, mediating their activity through a complex interplay of physical interactions with other cellular proteins that are implicated in cell cycle regulation and the response of cells to stress. These include PCNA, p21, cdc2/cyclinB1, and the p38 and JNK stress response kinases. Disregulated expression of Gadd45 has been observed in multiple types of solid tumors as well as in hematopoietic malignancies. Also, evidence has accumulated that Gadd45 proteins are intrinsically associated with the response of tumor cells to a variety of cancer therapeutic agents. Thus, Gadd45 proteins may represent a novel class of targets for therapeutic intervention in cancer. Additional research is needed to better understand which of the Gadd45 stress response functions may be targeted for chemotherapeutic drug design in cancer therapy. encoded by these genes play pivotal roles as stress sensors that modulate and integrate the response of mammalian cells to a variety of environmental and physiological stressors (Fornace, 1992; Fornace et al, 1992; Liebermann and and Hoffman 1998; Zhang et al, 1999) either dependent or independent of p53 (Carrier et al, 1995; Liebermann and Hoffman 1995; Zhan et al, 1996). They also function to modulate tumor formation in response to oncogenic stress (Tront et al, 2006). Gadd45 proteins appear to serve similar, but not identical, functions depending upon the particular stress response pathway activated. For example, only Gadd45b is induced by TGFb (Selvakumaran et al, 1994a; Yoo et al, 2003), whereas only Gadd45a is a p53 target (Kastan et al, 1992; Selvakumaran et al, 1994b; Guillouf et al, 1995). All three genes are induced with different expression kinetics during terminal hematopoietic differentiation, associated with growth arrest and apoptosis (Zhang et al, 1999). Distinct expression patterns for these genes were also observed in a variety of murine tissues (Zhang et al, 1999; Zhang 2000).
I. Gadd45 in cellular stress responses Gadd45 genes were cloned in this laboratory (Abdollahi et al, 1990; Zhang et al, 1999), in the laboratory of Dr. Smith (Beadling et al, 1993) and in the Fornace laboratoy at the NIH (Fornace 1992). Gadd45, MyD118, and CR6 (currently termed Gadd45a, Gadd45b, & Gadd45g, respectively) are referred to as Gadd45 proteins, gadd45 genes or Gadd45 family members. These small (18kd), evolutionarily conserved proteins are highly homologous to each other (55%-57% overall identity at the amino acid level), highly acidic (pI=4.0-4.2) (Figure 1), and are localized primarily within the cell nucleus (Abdollahi et al, 1990; Zhang et al, 1999; Vairapandi et al, 2002). Gadd45 family members are rapidly induced by genotoxic stress agents (Papathanasiou et al, 1989; Fornace et al, 1991; Vairapandi et al, 2002), as well as by terminal differentiation and apoptotic cytokines (Abdollahi et al, 1990; Zhan et al, 1994; Zhang et al, 1999; Zhang 2000). Emerging evidence indicates that the proteins
268
Cancer Therapy Vol 7, page 269
Figure 1. Homology of Gadd45a family of proteins. Alignment of amino acid sequence of the various gadd45a family members including murine MyD118 (Gadd45b), murine Gadd45 (Gadd45a) and murine CR6 (Gadd45g). Boxes reveal conserved amino acid residues.
Importantly, individual members of the Gadd45 family are differentially induced by a variety of genotoxic and environmental stress agents (Takekawa et al, 1998; Shaulian and Karin 1999; Wang et al, 1999; Zhang et al, 1999, 2001; Zhang 2000), indicating that each gene is induced by a distinct subset of environmental stresses. To what extent the function of each of the Gadd45 proteins is unique or overlaps with the function of the remaining family member proteins remains to be determined. As detailed below, Gadd45 genes have been implicated in the control of cell cycle arrest (Beadling et al, 1993; Liebermann and Hoffman 1998; Wang et al, 1999; Zhang et al, 1999; Vairapandi et al, 2002), DNA repair (Vairapandi et al, 1992; Smith et al, 1994, 2000), cell survival (Smith et al, 1996, 2000; De Smaele et al, 2001; Amanullah et al, 2003; Gupta et al, 2005, 2006),
apoptosis (Selvakumaran et al, 1994a; Takekawa et al, 1998; Vairapandi et al, 2000; Azam et al, 2001; Zhang et al, 2001; Yoo et al, 2003), senescence (Tront et al, 2006), and susceptibility of cells for transformation in vitro and in tumor development in vivo (Hollander et al, 1999; Tront et al, 2006).
II. Mode of action of Gadd45 proteins Evidence accumulated in recent years implies that Gadd45 proteins function as stress sensors, mediating their activity via a complex interplay of physical interactions with other cellular proteins. These interactions have been shown to regulate cell cycle control, DNA repair, epigenetic changes, apoptosis, survival and senescence (Figure 2).
Figure 2. Gadd45 function in stress signaling. Summary of the various functions of Gadd45 family members affecting cellular processes such as cell cycle arrest, DNA repair, survival, apoptosis, senescence as well as epigenetic gene activation.
269
Cretu et al: Stress Sensor Gadd45 genes as therapeutic targets in cancer
A. Cell cycle control
activation by repair-mediated DNA demethylation is not global (Engel et al, 2009). Other investigators have recently demonstrated that DNA demethylation in zebrafish involves the coupling of a deaminase, a glycosylase, and Gadd45b (Rai et al, 2008). Furthermore, transient activation of mature dentate granule cells has been observed to induce Gadd45b through an NMDARCa2+-CaM kinase pathway. Gadd45b was shown to be a key factor in an epigenetic regulation path that actively demethylate specific CpG sites in regulatory regions of genes, resulting in increased late-phase expression in mature neurons. Release of these extrinsic factors from mature neurons in turn promotes several key aspects of adult neurogenesis (Ma et al, 2009). Gadd45 interactions with PCNA and/or histones (Carrier et al, 1999) may play a role in this function.
Inhibiting endogenous expression of Gadd45a, Gadd45b, or Gadd45g in human cells by antisense Gadd45 constructs was found to impair the G2/M checkpoint following exposure to UV radiation or MMS (Liebermann and Hoffman 1998; Wang et al, 1999; Vairapandi et al, 2002). In addition, microinjecting a Gadd45a expression vector into primary human fibroblasts arrested the cells at the G2/M boundary of the cell cycle (Wang et al, 1999). In another study (Fan et al, 1999), deregulated ectopic expression of CR6 (Gadd45g) in HeLa cells had little effect on HeLa cell growth under normal culture conditions. However, following serum withdrawal Gadd45g blocked HeLa cell G2/M transition and caused endoreduplication. In contrast, under normal culture conditions in USO2 cells, ectopic expression of any one of the Gadd45 proteins resulted in blocking either G1/S or G2/M transitions (Fan et al, 1999). In this laboratory it was observed that IPTG-induced ectopic expression of Gadd45a, Gadd45b, or Gadd45g in both H1299 and M1 cells, in the absence of genotoxic stress, retarded cell growth and increased accumulation of cells in the G1 phase of the cell cycle (Zhang et al, 2001). G2/M cell cycle arrest mediated by Gadd45 proteins was shown to be due to their ability to interact with and inhibit the kinase activity of the cdc2/cyclinB1 complex (Zhan et al 1999; Vairapandi et al. 2002). Association of either Gadd45a or Gadd45b proteins with cdc2/cyclinB1 results in dissociation of the cdc2/cyclinB1 complex that, in turn, inhibits cdc2 kinase activity (Vairapandi et al, 2002). Their ability to arrest cells in G1 is less well understood. It is possible that interaction of Gadd45 proteins with p21 plays a role in G1 cell cycle arrest. As such, all 3 family members have been observed to interact with p21 (Zhang et al, 1993; Xiong etal, 1993; El-Deiry Et al, 1993), but the role for this interaction remains to be further elucidated.
D. Apoptosis Ample evidence exists that Gadd45 proteins have a pro-apoptotic function. For example, it was observed that blocking MyD118 (Gadd45b) by antisense expression in M1 myeloblastic leukemia cells impaired TGFb-induced cell death, thereby implicating Gadd45b as a positive modulator of TGFb-induced apoptosis (Selvakumaran et al, 1994a). Consistent with this notion, IPTG-inducible ectopic expression of Gadd45b accelerated TGFb-induced apoptosis in M1 cells (Zhang, 2000). More recently, it was demonstrated that TGFb-induced apoptosis is mediated by Gadd45b via p38 activation in primary hepatocytes from wild type mice, and was blocked in hepatocytes from Gadd45b-/- mice (Yoo et al, 2003). Furthermore, ectopic expression of all three Gadd45 proteins was shown to induce apoptosis in HeLa cells (Takekawa et al, 1998). This induction of apoptosis was shown to be dependent upon the interaction of Gadd45 proteins with MEKK4, an upstream activator of the stress induced p38/JNK kinases (Takekawa et al, 1998). That Gadd45 proteins can directly interact with and activate p38 kinase was observed as well (Bulavin et al, 2003). In addition, ectopic expression of all three Gadd45 proteins was shown to induce apoptosis in HeLa cells (Takekawa et al, 1998) as well as enhance stress mediated apoptosis in both M1 leukemia and H1299 lung carcinoma cells (Vairapandi et al, 2000; Azam et al, 2001; Zhang et al, 2001). Also, BRCA-1-mediated induction of gadd45a has been implicated in apoptosis of breast cancer cells (Harkin et al, 1999), whereas Gadd45g expression was shown to have a role in neuronal cell death (Kojima et al, 1999). Lastly, gadd45a has also been implicated in apoptosis of UV-irradiated keratinocytes (Hildesheim et al, 2002).
B. DNA repair Current evidence suggests that Gadd45a and Gadd45b function in DNA excision repair through their interactions with PCNA (Vairapandi et al. 1992; Smith et al, 1994, 2000). As such, experimental data obtained shows that interaction of either Gadd45a or Gadd45b with PCNA participates in nucleotide excision DNA repair (Vairapandi et al. 1992; Smith et al, 1994, 2000). Whether Gadd45g plays a role in DNA repair has not been established.
C. Demethylation dependent epigenetic gene activation
E. Survival
A recent study documented that Gadd45a promotes epigenetic gene activation by repair-mediated DNA demethylation (Barreto et al, 2007). Additionally, it has been shown that TAF12 recruits Gadd45a and the nucleotide excision repair complex to the promoter of rRNA genes, leading to active DNA demethylation (Schmitz et al, 2009). However, we have recently shown conserved DNA methylation in Gadd45a -/- mice, suggesting that Gadd45a promotion of epigenetic gene
Intriguingly, in apparent contradiction to the role Gadd45 proteins play in cell death, many observations are consistent with a role in cell survival. Clonogenic survival assays with gadd45a-/- MEFs (Smith et al, 2000) and RKO cells expressing antisense Gadd45a RNA (Smith et al, 1996) showed that deficiency in Gadd45a increases the sensitivity of cells to killing by UV irradiation or cisplatin. It has been suggested that Gadd45b plays a role in TNF!NF"B mediated cell survival of mouse embryo fibroblasts 270
Cancer Therapy Vol 7, page 271 (De Smaele et al, 2001), although additiona data has challenged this view (Amanullah, et al, 2003). In addition, it was recently documented that Gadd45a and Gadd45b deficiency each sensitized hematopoietic cells to genotoxic stress induced apoptosis (Gupta et al, 2005). It was shown that in hematopoietic cells exposed to UV radiation, Gaddd45a and Gadd45b cooperate to promote cell survival by two distinct signaling pathways involving activation of a novel Gadd45a mediated p38-NF-"Bmediated survival pathway and Gadd4545b-mediated inhibition of the stress response MKK4-JNK pathway (Gupta et al, 2006). The role Gadd45 proteins play in DNA repair and cell cycle arrest is compatible with a survival function. Consistent with the idea that interaction of Gadd45 proteins with PCNA may promote cell survival by enhancing DNA repair, it was observed that Gadd45/PCNA interaction impedes their apoptotic function (Vairapandi et al, 2000; Azam et al, 2001).
III. Gadd45 as sensors of oncogenic stress which modulate tumor development The complex role of stress sensors in monitoring oncogenic stress ultimately leading to tumor development is not fully understood. The best and most studied example of oncogenic stress in tumorigenesis is p53 and its varied cellular functions. Recent observations have implicated Gadd45 proteins as important sensors of oncogenic stress, both in vitro and in vivo. It is known that whereas primary mouse cells require introduction of two activated oncogenes for transformation, disruption of certain key growth control genes allows single oncogene transformation (Lundberg et al, 2000; Drayton et al, 2002). It was shown that for MEFs obtained from Gadd45a-/- mice, H-ras was sufficient for transformation (Hollander et al, 1999; Bulavin et al, 2003). The role Gadd45b and/or Gadd45g play in susceptibility of MEFs to single oncogene transformation remains to be assessed. Evidence was obtained that Gadd45 proteins also play a role in modulation of tumor development in vivo. Gadd45a-/- and Gadd45b-/- mice were observed to display increased mutation frequency, and susceptibility to ionizing radiation (IR) and chemical carcinogenesis (Hollander et al, 1999). Also, it has been documented that NF-"B-mediated repression of Gadd45a and Gadd45g is essential for cancer cell survival (Zerbini and Liebermann, 2005). More recently, evidence was obtained that loss of Gadd45a accelerates ras-driven mammary tumor formation. Ras-driven tumor formation in the absence of Gadd45a resulted in both a decrease in apoptosis, linked to a decrease in JNK activation, and a decrease in senescence, correlated with a decrease in p38 kinase activation (Tront et al, 2006). Altogether, these results provide a novel model for the tumor suppressive function of Gadd45a in the context of ras-driven breast carcinogenesis; Gadd45a elicits its function through activation of the stress induced JNK & p38 kinases, which contribute to increased apoptosis and ras-induced senescence. How loss of Gadd45a may effect breast carcinogensis driven by other oncogenes, and how loss of other Gadd45 genes may contribute to breast carcinogenesis are interesting questions to be addressed in future studies.
F. Senescence Senescence represents a physiological stress response associated with cellular aging. When primary mammalian cells are cultured in vitro they undergo a limited number of cell divisions and then arrest in a state known as replicative senescence. Such cells are irreversibly arrested in the G1 phase of the cell cycle and are no longer sensitive to growth factor stimulation (Drayton et al, 2002; Lundberg et al, 2000 & references therein). Senescence is a barrier that cells must overcome in order to become immortal and proliferate indefinitely, and, therefore, functions as a tumor-suppressing mechanism that limits the proliferative capacity of cells in vivo (Drayton et al, 2002; Lundberg et al, 2000). Recent data has shown that cellular senescence is in fact a physiological mechanism that constrains tumor development in vivo (Lundberg et al, 2000; Drayton et al, 2002). The signaling pathways that mediate replicative or oncogene induced senescence are not fully understood. In Mouse Embryo Fibroblasts (MEFs), p19ARF, which is encoded by a partially overlapping alternative reading frame at the p16INK4A locus, has been implicated as a major mediator of replicative senescence. p19ARF binds directly to and sequesters MDM2, thereby inhibiting the ability of MDM2 to induce degradation of the p53 tumor suppressor protein (Lundberg et al, 2000). This loss of MDM2 function, in turn, results in the stabilization of p53 and activation of p53-mediated growth arrest, believed to play a major role in the irreversible growth arrest associated with the senescent phenotype. The integrity of both the p16INK4A/pRB and p19ARF/p53 pathways is essential for oncogene-induced senescence (Drayton et al, 2002). Studies with MEFs deficient for one or more Gadd45 genes, notably Gadd45a, have provided evidence that Gadd45 genes play important roles in both replicative and oncogene mediated senescence (Hollander et al, 1999; Bulavin et al, 2003). The molecular nature of stress response pathways involving Gadd45 and its interacting proteins in MEF senescence, and whether there is crosstalk with the p16INK4A/pRB and p19ARF/p53 pathways remains to be determined.
V. GADD45 disregulation in cancer Although members of the Gadd45 family seem infrequently mutated in cancer based on current knowledge, reduced expression of the three Gadd45 family members due to promoter methylation has been observed in several types of human cancers. The Gadd45a promoter is methylated in the majority of breast cancers, resulting in reduced expression when compared with normal breast epithelium (Zerbini and Lbermann, 2005). In pituitary adenomas, silencing of the Gadd45c gene is seen in 67% of patients. This downregulation is primarily associated with methylation of the Gadd45g gene and reversal of this epigenetic change results in re-expression of the protein (Bahar et al, 2004). Gadd45g is also down- regulated in anaplastic
271
Cretu et al: Stress Sensor Gadd45 genes as therapeutic targets in cancer thyroid cancer and in 65% of hepatocellular carcinomas due to hypermethylation of the Gadd45g promoter (Sun et al, 2003). Interestingly, the Gadd45b gene is methylated and silenced in hepatocellular carcinoma as well, indicating a strong linkage between at least two Gadd45 genes and liver cancer. Ying and colleagues analyzed the methylation status of two regions in the Gadd45g promoter in a total of 75 cell lines as well as primary tissues and tumors (Ying et al, 2005). They show that promoter hypermethylation is frequently detected in tumors cell lines, including 85% of non-Hodgkin, 50% of Hodgkin lymphoma, 73% of nasopharyngeal, 50% of cervical, 29% of esophageal, and 40% of lung carcinoma but not in immortalized normal epithelial cell lines, normal tissues, or peripheral blood mononuclear cells. To gain more insight into the Gadd45g methylation, they also did high-resolution bisulfite genomic sequencing. They found that densely methylated CpG sites were detected in all silenced cell lines, indicating that epigenetic silencing of Gadd45g could be involved in the pathogenesis of tumors. Other observations showing that activated NF-"B leads to repression of GADD45a and GADD45g in various types of cancer (Zerbini and Libermann, 2005) together with the frequent constitutive activation of NF-"B in cancers suggest that there are at least two mechanisms whereby Gadd45 genes become repressed in cancer. Thus, repression of Gadd45 gene expression in various types of cancer via methylation or NF-kB activation may be two different methods through which Gadd45 deregulated expression may lead to tumorigenesis. Because activation of NF-"B is a critical step for many cells in escaping programmed cell death and is dependent on Gadd45a and Gadd45g repression, methylation of the Gadd45g gene as reported by Ying et al, may result in a similar phenotype. Moreover, very recently, a methylation-mediated repression of Gadd45a was observed in prostate cancer. The role of Gadd45a as a potential therapeutic target has been highlighted by the fact that it is up-regulated on
docetaxel treatment and may contribute to docetaxelmediated cytotoxicity of prostate cancer cells (Ramachandran et al, 2009). Interestingly, Gadd45a mutations have been documented in pancreatic cancer. One study has shown that gadd45a expression is elevated in several pancreatic ductal adenocarinoma cell lines, and loss of Gadd45a expression limits growth and survival of one cell line in culture (Schneider et al, 2006). In another study, it was observed that ectopic expression of Gadd45a in the PANC1 pancreatic cancer cell line resulted in apoptosis and cell cycle arrest (Li et al, 2009). These two studies suggest contradictory roles of gadd45a in pancreatic tumor cell growth and survival. In our lab, we have observed that inhibition of endogenous gadd45a expression in the PANC1 cell line by shRNA limits cell number, due to cell cycle arrest &/or apoptosis (Figure 3). As such, further investigation is needed to better define a role for Gadd45a and other family members in pancreatic cancer development. A small study in Japan attempted to correlate expression of Gadd45a and p53 inactivation in human pancreatic cancer (Yamasawa et al, 2002). This was important since gadd45a is a p53 target gene, although it has been shown by this lab as well as by others to also be expressed independently of p53. Interestingly, elevated Gadd45a expression levels were reported in 54% of human pancreatic ductal carcinomas and the frequency of point mutations was found to be almost 14% (Yamaguchi et al, 2002). Moreover, over-expression of Gadd45a protein, along with possible p53 loss of function, significantly contributed to poor prognosis, compared with patients with undetectable Gadd45a expression levels (Yamasawa et al, 2002). In resectable invasive pancreatic ductal carcinomas, Gadd45a is frequently mutated, and this mutation combined with the p53 status affects the survival of these patients (Yamasawa et al, 2002).
Figure 3. Gadd45a knockdown decreases tumor cell proliferation. PANC1 pancreatic adenocarcinoma tumor cells were transfected with shRNA vectors specific for Gadd45a (Open Biosystems). shRNA vectors 1 and 3 significantly decreased Gadd45a protein expression levels (data not shown). Proliferation was significantly decreased in Gadd45a knock-down PANC1 tumor cells as compared to no treatment or scrambed shRNA (-) controls. MTS assays were performed according to manufacturerâ&#x20AC;&#x2122;s instructions (Promega). Bars-SD.
272
Cancer Therapy Vol 7, page 273
In order to further understand pancreatic cancer initiation and progression in vivo, several mouse models of this disease have been established. Hingorani et al developed the mouse model KrasG12D;Pdx1-cre, where endogenous expression of KrasG12D was directed to progenitor cells of the mouse pancreas (Hingorani et al, 2003). In addition, a second mouse model (KrasG12D;P53R172HPdx1-cre) in which both k-ras is activated and p53 inactivated recapitulates human disease in vivo. Immunohistochemistry of tumors was performed from each of the two mouse pancreatic cancer models. Gadd45a expression is upregulated in the tumor microenvironment when compared to normal pancreatic tissue (Figure 4). This upregulation, however, is p53 dependent, as tumors with inactive p53 do not express this protein (Figure 4). These observations on primary mouse tumors appear contradictory to results obtained in cell lines, where elevated Gadd45a can promote tumor survival and growth and yet loss of Gadd45a expression in the mouse model is associated with the more aggressive tumor state (KrasG12D;P53R172HPdx1-cre). However, it is known that the biological effects of Gadd45a are dependent upon the cellular context within which it is expressed. Since the genetic background of the pancreatic tumor cell lines is not known, varies from one line to another, as well as from one laboratory to the next, our studies will focus on the complementary approaches of animal models and human tumors to elucidate the role of Gadd45a in pancreatic
ductal adenocarcinoma (PDA). Finally, a recent study has documented Gadd45 downregulation in AML (Perugini et al, 2009). Furthermore we have observed that Gadd45a and Gadd45b function as suppressor of BCR-ABL driven leukemogenesis in a mouse model, using adaptive transplantation of BCR-ABL transduced wt and Gadd45 knockout hematopoietic cells into irradiated mice (Xiojen Sha, unpublished). In combination, these observations suggest a role for Gadd45 disregulation in hematopoietic malignancies.
VI. Prospects of targeting Gadd45 proteins in cancer therapy To conclude, Gadd45 proteins play important roles in modulating diverse molecular pathways of stress signaling in response to a wide variety of extrinsic and physiological stress agents. Disregulated expression of Gadd45 expression has been observed in multiple types of solid tumors as well as in hematopoietic malignancies. These observations, in conjunction with the fact that Gadd45 proteins are intrinsically associated with tumor cell response to a variety of cancer therapeutic agents imply that Gadd45 proteins may serve as a novel class of targets for therapeutic intervention of cancer. Additional research is needed to pinpoint which of the Gadd45 stress response functions may be best suited for the target of cancer therapeutics.
Figure 4. Gadd45a immunohistochemistry of normal and diseased pancreas. Paraffin-embedded tissue sections were stained according to manufacturerâ&#x20AC;&#x2122;s instructions (Santa Cruz Biotechnology). Anti-Gadd45a antibody was utilized at a 1:50 dilution followed by appropriate biotinylated secondary antibody (1:200). Top left panel: Tissue section obtained from pancreatic tumor mouse model initiated by loss of p53 as well as activation of k-ras. Top right panel: Tissue section obtained from pancreatic tumor mouse model initiated by activation of k-ras. Bottom panel Normal pancreatic tissue. Tissue sections were kindly provided by Dr. Sunil Hingorani, Fred Hutchinson Cancer Research Center.
273
Cretu et al: Stress Sensor Gadd45 genes as therapeutic targets in cancer
Elledge SJ (1996) Cell cycle checkpoints: preventing an identity crisis. Science 274, 1664-72. Fornace AJ Jr, Nebert DW, Hollander MC, Luethy JD, Papathanasiou M, Fargnoli J, Holbrook NJ (1991) Induction by ionizing radiation of the Gadd45 gene in cultured human cells: lack of mediation by protein kinase C. Mol Cell Biol 11, 1009-16. Fornace AJ, Jackman J, Hollander MC, Hoffman-Liebermann B, Liebermann DA (1992) Genotoxic-stress-response genes and growth-arrest genes: gadd, MyD, other genes induced by treatments eliciting growth arrest. Ann N Y Acad Sci 663, 139-154. Fornace AJ Jr. (1992) Mammalian genes induced by radiation; activation of genes associated with growth control. Annu Rev Genet 26, 507-526. Guillouf C, Grana X, Selvakumaran M, Hoffman B, Giordano A, Liebermann DA (1995) Dissection of the genetic programs of p53 G1 growth arrest and apoptosis: Blocking p53induced apoptosis unmasks G1 arrest. Blood 85, 2691-98. Gupta M, Gupta SK, Hoffman B, Liebermann DA (2006) Gadd45a and Gadd45b Protect Hematopoietic Cells From UV Induced Apoptosis Via Distinct Signaling Pathways including p38 actiivation and JNK inhibition. J Biol Chem 281, 17552-17558. Gupta M, Gupta SK, Balliet AG, Hollander MC, Fornace AJ, Hoffman B, Liebermann DA (2005) Hematopoietic Cells from Gadd45a and Gadd45b Deficient Mice are Sensitized to Genotoxic-stress Induced Apoptosis. Oncogene 24, 7170-9. Harkin DP, Bean JM, Miklos D, Song YH, Truong VB, Englert C, Christians FC, Ellisen LW, Maheswaran S, Oliner JD, Haber DA (1999) Induction of GADD45 and JNK/SAPKdependent apoptosis following inducible expression of BRCA1. Cell 97, 575-86. Harper JW, Adami GR, Wei N, Keyomarsi K, Elledge SJ (1993) The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 Cell 75, 805-816. Hildesheim J, Bulavin DV, Anver MR, Alvord WG, Hollander MC, Vardanian L, Fornace AJ Jr (2002) Gadd45a protects against UV irradiation-induced skin tumors, promotes apoptosis and stress signaling via MAPK and p53. Cancer Res 62, 7305-15. Hingorani SR, Petricoin EF, Maitra A, Rajapakse V, King C et al. (2003) Preinvasive and invasive ductal pancreatic cancer and its early detection in the mouse. Cancer Cell 4, 437–450. Hollander MC, Sheikh MS, Bulavin DV, Lundgren K, AugeriHenmueller L, Shehee R, Molinaro TA, Kim KE, Tolosa E, Ashwell JD, Rosenberg MP, Zhan Q, Fernandez- Salguero PM, Morgan WF, Deng CX, Fornace AJ Jr (1999) Genomic instability in Gadd45a- deficient mice. Nat Genet 23, 176-84. Jin S, Antinore MJ, Lung FD, Dong X, Zhao H, Fan F, Colchagie AB, Blanck P, Roller PP, Fornace AJ Jr, Zhan Q (2000) The GADD45 inhibition of Cdc2 kinase correlates with GADD45- mediated growth suppression. J Biol Chem. 275, 16602-8. Jonsson ZO and Hubsche U (1997) Proliferating cell nuclear antigen: more than a clamp for DNA polymerases. Bio Essays 19, 967-975. Kastan MB, ZhanQ, El-Deiry WS, Carrier F, Jacks T, Walsh WV, Plunkett BS, Vogelstein B, Fornace AJ Jr (1992) A mammalian cell cycle checkpoint utilizing p53 and Gadd45 is defective in Ataxia-telangiectasia. Cell 71, 587-597. Kelman Z, Hurwitz J (1998) Protein-PCNA interactions: a DNAscanning mechanism? Trends Biochem Sci 23, 236-238. Kojima S, Mayumi-Matsuda K, Suzuki H, Sakata T (1999) Molecular cloning of rat GADD45g, gene induction and its role during neuronal cell death. FEBS Lett 446:313-7. Li Y, Qian H, Li X, Wang H, Yu J, Liu Y, Zhang X, Liang X, Fu
Acknowledgments Supported By NIH grants 1R01HL084114-01 (DAL), 1R01CA122376-01 (DAL), NIH, RO1 CA081168-06 (BH). Tissue sections were kindly provided by Dr. Sunil Hingorani, Fred Hutchinson Cancer Research Center.
References Abdollahi A, Hoffman-Liebermann B, Liebermann D (1990) Sequence and expression of a cDNA encoding MyD118: A novel myeloid differentiation primary response gene induced by multiple cytokines. Oncogene 6, 165-167. Amanullah A, Azam N, Balliet A, Hollander C, Hoffman B, Fornace A, Liebermann D (2003) Cell signalling: cell survival and a Gadd45-factor deficiency. Nature 424, 741-42. Azam N, Vairapandi M, Zhang W, Hoffman B, Liebermann DA. Azam N, Vairapandi M, Zhang W, Hoffman B, Liebermann DA (2001) Interaction of CR6 (GADD45g) with proliferating cell nuclear antigen impedes negative growth control. J Biol Chem 276, 2766-74. Bahar A, Bicknell JE, Simpson DJ, Clayton RN, Farrell WE (2004) Loss of expression of the growth inhibitory gene GADD45gamma, in human pituitary adenomas, is associated with CpG island methylation. Oncogene 23, 93 -44. Barreto G, Schäfer A, Marhold J, Stach D, Swaminathan SK, Handa V, Döderlein G, Maltry N, Wu W, Lyko F, Niehrs C (2007) Gadd45a promotes epigenetic gene activation by repair-mediated DNA demethylation. Nature 445, 671-5. Beadling C, Johnson KW, Smith KA (1993) Isolation of interleukin 2-induced immediate-early genes. Proc Natl Acad Sci USA 90, 2719-23. Bulavin DV, Kovalsky O, Hollander MC, Fornace AJ Jr (2003) Loss of oncogenic H-ras-induced cell cycle arrest and p38 mitogen-activated protein kinase activation by disruption of Gadd45a. Mol Cell Biol 23, 3859-71. Carrier F, Georgel PT, Pourquier P, Blake M, Kontny HU, Antinore MJ, Gariboldi M, Myers TG, Weinstein JN, Pommier Y, Fornace AJ Jr. (1999). Gadd45, a p53responsive stress protein, modifies DNA accessibility on damaged chromatin. Mol Cell Biol. 19(3):1673-85. Carrier F, Smith ML, Bae I, Kilpatrick KE, Lansing TJ, Chen CY, Engelstein M, Friend SH, Henner WD, Gilmer TM, Fornace AJ Jr (1995) Characterization of human Gadd45, a p53-regulated protein. J Biol Chem 269, 32672-7. Chan TA, Hwang PM, Hermeking H, Kinzler KW, Vogelstein B (2000) Cooperative effects of genes controlling the G(2)/M checkpoint. Genes Dev 14, 1584-8. Engel N, Tront JS, Erinle T, Nguyen N, Latham KE, Sapienza C, Hoffman B, Liebermann DA (2009) Conserved DNA methylation in Gadd45a(-/-) mice. Epigenetics 4, Epub ahead of print. De Smaele E, Zazzeroni F, Papa S, Nguyen DU, Jin R, Jones J, Cong R, Franzoso G (2001) Induction of Gadd45b by NF-"B downregulates pro-apoptotic JNK signalling. Nature 414, 308-13. Deng C, Zhang P, Harper JW, Elledge SJ, Leder P (1995) Mice lacking p21CIP1/WAF1 undergo normal development, but are defective in G1 checkpoint control. Cell 82, 675-84. Drayton S, Peters G (2002) Immortalisation and transformation revisited. Curr Opin Genet Dev 12, 98-104. El-Deiry WS, Tokino T, Velculescu VE, Levy DB, Parsons R, Trent JM, Lin D, Mercer WE, Kinzler KW, Vogelstein B (1993) WAF1, a potential mediator of p53 tumor suppression. Cell 75, 817-25.
274
Cancer Therapy Vol 7, page 275 M, Zhan Q, Lin C (2009) Adenoviral-mediated gene transfer of Gadd45a results in suppression by inducing apoptosis and cell cycle arrest in pancreatic cancer cell. J Gene Med 11, 313. Liebermann DA, Hoffman B (1995) MyD/GADD genes in terminal differentiation growth arrest and apoptosis in "Differentiation Therapy" (ed. S. Waxman) Ares-Serono Symposia-Series Challange of Modern Medicine, Vol.10, 107-116. Liebermann DA, Hoffman B (1998) MyD genes in negative growth control. Oncogene 17, 3319-30. Lu B, Yu H, Chow C, Li B, Zheng W, Davis RJ, Flavell RA (2001) GADD45g mediates the activation of the p38 and JNK MAP kinase pathways and cytokine production in effector TH1 cells. Immunity 14, 583-90. Lundberg AS, Hahn WC, Gupta P, Weinberg RA (2000) Genes involved in senescence and immortalization. Curr Opin Cell Biol 12, 705-9. Ma DK, Jang MH, Guo JU, Kitabatake Y, Chang ML, PowAnpongkul N, Flavell RA, Lu B, Ming GL, Song H (2009) Neuronal activity-induced Gadd45b promotes epigenetic DNA demethylation and adult neurogenesis. Science 323, 1074-7. Fan W, Richter G, Cereseto A, Beadling C, Smith KA (1999) Cytokine response gene 6 induces p21 and regulates both cell growth and arrest. Oncogene 18, 6573-82. O'Connor PM (1997) Mammalian G1 and G2 phase checkpoints. Cancer Surv 29, 151-82. Papa S, Zazzeroni F, Bubici C, Jayawardena S, Alvarez K, Matsuda S, Nguyen DU, Pham CG, Nelsbach AH, Melis T, De Smaele E, Tang WJ, D'Adamio L, Franzoso G (2004) Gadd45 b mediates the NF-" B suppression of JNK signalling by targeting MKK7/JNKK2. Nat Cell Biol 6, 14653 Papathanasiou MA, Kerr NC, Robbins JH, McBride OW, Alamo I Jr, Barrett SF, Hickson ID, Fornace AJ Jr (1989) Mammalian genes coordinately regulated by growth arrest signals and DNA-damaging agents. Mol Cell Biol 10, 4196203. Perugini M, Kok CH, Brown AL, Wilkinson CR, Salerno DG, Young SM, Diakiw SM, Lewis ID, Gonda TJ, D'Andrea RJ (2009) Repression of Gadd45! by activated FLT3 and GMCSF receptor mutants contributes to growth, survival and blocked differentiation. Leukemia, in press. Ramachandran K, Gopisetty G, Gordian E, Navarro L, Hader C, Reis IM, Schulz WA, Singal R (2009) Methylation-mediated repression of GADD45! in prostate cancer and its role as a potential therapeutic target. Cancer Res 69, 1527-35. Rai K, Huggins IJ, James SR, Karpf AR, Jones DA, Cairns BR (2008) DNA demethylation in zebrafish involves the coupling of a deaminase, a glycosylase, Gadd45. Cell 135, 1201-12. Sancar A (1994) Mechanisms of DNA excision repair. Science 266, 1954-1956, Schmitz KM, Schmitt N, Hoffmann-Rohrer U, Sch채fer A, Grummt I, Mayer C (2009) TAF12 recruits Gadd45a and the nucleotide excision repair complex to the promoter of rRNA genes leading to active DNA demethylation.. Mol Cell 33, 344-53. Schneider G, Weber A, Zechner U, Oswald F, Friess HM, Schmid RM, Liptay S (2006) Gadd45a is highly expressed in pancreatic ductal adenocarcinoma cells and required for tumor cell viability. Int J Cancer 11, 2405-11. Selvakumaran M, Lin HK, Miyashita T, Wang HG, Krajewski S, Reed JC, Hoffman B, Liebermann D (1994b) Immediate early up-regulation of bax expression by p53 but not TGFb1: A paradigm for distinct apoptotic pathways. Oncogene 9, 1791-1798.
Selvakumaran, M, Lin, HK, Tjin Tham Sjin, R, Reed, J, Liebermann, D, Hoffman B (1994a) The novel primary response gene MyD118 and the proto-oncogenes myb, myc and bcl-2 modulate transforming growth factoMol. Cell Biol 14, 2352-2360. Shaulian E, Karin M (1999) Stress-induced JNK activation is independent of Gadd45 induction. J Biol Chem 274, 295958. Smith ML, Chen IT, Zhan Q, Bae I, Chen CY, Gilmer TM, Kastan MB, O'Connor PM, Fornace AJ Jr (1994) Protein interaction of the p53-regulatproliferating cell nuclear antigen. Science 266, 1376-80. Smith ML, Ford JM, Hollander MC, Bortnick RA, Amundson SA, Seo YR, Deng CX, Hanawalt PC, Fornace AJ Jr (2000) p53-mediated DNA repair responses to UV radiation: studies of mouse cells lacking p53, p21, and/or Gadd45 genes. MCB 20, 3705-14. Smith ML, Kontny HU, Zhan Q, Sreenath A, O'Connor PM, Fornace AJ Jr (1996) Antisense GADD45 expression results in decreased DNA repair and sensitizes cells to u.v.irradiation or cisplatin. Oncogene 13, 2255-63. Sun L, Gong R, Wan B, Huang X, Wu C, Zhang X, Zhao S, Yu L (2003) GADD45g, down- regulated in 65 % hepatocellular carcinoma (HCC) from 23 Chinese patients, inhibits cell growth and induces cell cycle G2/M arrest for hepatoma Hep-G2 cell lines. Mol Biol Rep 30, 249-53. Takekawa M, Saito H (1998) A family of stress-inducible GADD45-like proteins mediate activation of the stressresponsive MTK1/MEKK4/MAPKKK. Cell 95, 521-30. Tront JS, Hoffman B, Liebermann DA (2006) Gadd45a Suppresses Ras-driven Mammary Tumorigenesis by Activation of JNK and p38 Stress Signaling Resulting in Apoptosis and Senescence. Cancer Res 66, 8448-54. Vairapandi M , Azam N, Balliet AG, Hoffman B, Liebermann DA (2000) Characterization of MyD118, Gadd45, PCNA interacting domains: PCNA impedes MyD/Gadd Mediated Negative Growth Control. J Biol Chem 275, 16810-16819. Vairapandi M, Balliet AG, Hoffman B, Liebermann DA (1996) The differentiation primary response gene MyD118, related to GADD45, encodes for a nuclear protein which interacts with PCNA and p21WAF1/CIP1. Oncogene 12, 2579-2594. Vairapandi M, Balliet AG, Hoffman B, Liebermann DA (2002) GADD45b and GADD45g are cdc2/cyclinB1 kinase inhibitors with a role in S and G2/M cell cycle checkpoints induced by genotoxic stress. J Cell Physiol 192, 327-38. Wang X, Gorospe M, Holbrook NJ (1999) Gadd45 is not required for activation of c-Jun N- terminal kinase or p38 during acute stress. J Biol Chem 274, 29599-602. Wang XW, Zhan Q, Coursen JD, Khan MA, Kontny HU, Yu L, Hollander MC, O'Connor PM, Fornace AJ Jr, Harris CC (1999) GADD45 induction of a G2/M cell cycle checkpoint. Proc Natl Acad Sci USA 96, 3706-11. Xiong Y, Hannon GJ, Zhang H, Casso D, Kobayashi R, Beach D (1993) p21 is a universal inhibitor of cyclin kinases. Nature 366, 701-4. Yamasawa K, NioY, Dong M,Yamaguchi K, Itakura M (2002) Clinicopathological significance of abnormalities in Gadd45 expres sion and its relationship to p53 in human human pancreatic cancer. Clin Cancer Res 8, 2563-9. Yang J, Zhu H, Murphy TL, Ouyang W, Murphy KM (2001) IL18-stimulated GADD45 b required in cytokine-induced, but not TCR-induced, IFN-g production. Nat Immunol 2, 15764. Yang Q, Manicone A, Coursen JD, Linke SP, Nagashima M, Forgues M, Wang XW (2000) Identification of a functional domain in a Gadd45-mediated G2/M checkpoint. J Biol Chem 275, 36892-8. Ying J, Srivastava G, Hsieh WS, Gao Z, Murray P, Liao SK,
275
Cretu et al: Stress Sensor Gadd45 genes as therapeutic targets in cancer Ambinder R, Tao Q (2005) The stress-responsive gene GADD45G is a functional tumor suppressor, with its response to environmental stresses frequently disrupted epigenetically in multiple tumors. Clin Cancer Res 11, 64429. Yoo J, Ghiassi M, Jirmanova L, Balliet AG, Hoffman B, Fornace AJ Jr, Liebermann DA, Bottinger EP, Roberts AB (2003) TGF-b-induced apoptosis is mediated by Smad-dependent expression of GADD45B through p38 activation. JBC 278, 43001-7. Zerbini LF, Libermann TA (2005) Life and death in cancer. GADD45 ! and g are critical regulators of NF-"B mediated escape from programmed cell death. Cell Cycle 4, 18-20. Zhan Q, Antinore MJ, Wang XW, Carrier F, Smith ML, Harris CC, Fornace AJ Jr (1999) Association with Cdc2 and inhibition of Cdc2/Cyclin B1 kinase activity by the p53regulated protein Gadd45. Oncogene 18, 2892-900. Zhan Q, Fan S, Smith ML, Bae I, Yu K, Alamo I Jr, O'Connor PM, Fornace AJ Jr. (1996) Abrogation of p53 function affects gadd gene responses to DNA base-damaging agents and starvation. DNA Cell Biol 15, 805-15.
Zhan Q, Lord KA, Alamo I Jr, Hollander MC, Carrier F, Ron D, Kohn KW, Hoffman B, Liebermann DA, Fornace AJ Jr (1994) The gadd and MyD genes define a novel set of mammalian genes encoding acidic proteins that synergistically suppress cell growth. Mol Cell Biol 14, 23612371. Zhang H, Xiong Y, Beach D (1993) Proliferating cell nuclear antigen and p21 are components of multiple cell cycle kinase complexes. Mol Biol Cell 4, 897-906. Zhang W, Bae I, Krishnaraju K, Azam N, Fan W, Smith K, Hoffman B, Liebermann DA (1999) CR6: A third member in the MyD118 & Gadd 45 gene family which functions in negative growth control. Oncogene 18, 4899-4907. Zhang W, Hoffman B, Liebermann DA (2001) Ectopic expression of MyD118/Gadd45/CR6 (Gadd45b/!/g) sensitizes neoplastic cells to genotoxic stress-induced apoptosis. Int J Oncol 18, 749-57. Zhang W (2000) The MyD118/Gadd4/CR6 gene gamily in negative growth control. Thesis. Temple University.
Alexandra Cretu, Xiojen Sha, Jennifer Tront, Barbara Hoffman, Dan A Liebermann
276