NCEA Level 3 Biology Internals by BIOZONE International

NCEA LEVEL 3 BIOLOGY INTERNALS Meet the writing team

Tracey

Senior Author

Tracey Greenwood I have been writing resources for students since 1993. I have a Ph.D in biology, specialising in lake ecology and I have taught both graduate and undergraduate biology. Lissa Bainbridge-Smith I worked in industry in a research and development capacity for 8 years before joining BIOZONE in 2006. I have a M.Sc from Waikato University.

Lissa Author

Kent Pryor I have a BSc from Massey University majoring in zoology and ecology and taught secondary school biology and chemistry for 9 years before joining BIOZONE as an author in 2009. Kent Author

Richard Allan I have had 11 years experience teaching senior secondary school biology. I have a Masters degree in biology and founded BIOZONE in the 1980s after developing resources for my own students. Richard

Cover photograph Emperor penguin chick. The emperor penguin (Aptenodytes forsteri) is the largest of all penguin species and well adapted to the harsh Antarctic environment, tolerating temperatures of -40°C. Feathers, down, and subdermal fat help the emperor penguin to maintain its body temperature around 39°C. However, when the environmental temperature drops below -10°C the penguins increase their metabolic rate to maintain their core body temperature. PHOTO: aussieanouk https://eu.fotolia.com/id/87990059

Founder & CEO

Thanks to: The staff at BIOZONE, including Nell Travaglia and Holly Coon for design and graphics support, Paolo Curray and Malaki Toleafoa for IT support, Debbie Antoniadis and Arahi Hippolite for office handling and logistics, and the BIOZONE sales team. Second edition 2017

Purchases of this book may be made direct from the publisher:

BIOZONE International Ltd. P.O. Box 5002 Hamilton 3242, New Zealand Telephone: (07) 856 8104 Fax: (07) 856 9243 Email: sales@biozone.co.nz Website: www.BIOZONE.co.nz

www.BIOZONE.co.nz

All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted in any form or by any means, electrical, mechanical, photocopying, recording or otherwise, without the permission of BIOZONE International Ltd. This book may not be re-sold. The conditions of sale specifically prohibit the photocopying of exercises, worksheets, and diagrams from this book for any reason.

Contents Using This Book ...................................................... v Using the Tab System ............................................ vii Using Biozone's Website....................................... viii

AS 3.1 Practical investigation in a biological context 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

Achievement criteria and explanatory notes ...... 1 How Do We Do Science?..................................... 3 Choosing Your Topic............................................. 4 Ethical and Safety Issues of Research................ 5 Designing a Fair Test............................................ 6 Designing a Pattern Seeking Investigation.......... 8 Variables and Controls....................................... 10 Maintaining a Logbook ...................................... 12 Which Graph to Use? ........................................ 13 Describing Relationships Between Variables .... 14 Mean, Median, and Mode.................................. 15 Spread of Data................................................... 17 Detecting Bias in Samples................................. 18 Analysis and Interpretation ............................... 19 Interpreting Results of a Fair Test ..................... 21 Pattern Seeking: Investigating Distribution......... 23 A Template for Your Investigation ...................... 25

AS 3.2 Responses to a socio-scientific Issue 17 18 19 20

Achievement criteria and explanatory notes .... Examples of Socio-Scientific Issues ................. Genetic Screening ............................................ Evaluating the Information................................. Presenting Your Findings ..................................

27 28 29 30 32

AS 3.4 Maintaining a stable internal environment Achievement criteria and explanatory notes ..... 21 Homeostasis...................................................... 22 Maintaining Homeostasis .................................. 23 Negative Feedback ........................................... 24 Positive Feedback .............................................. 25 Nervous Regulatory Systems............................ 26 What You Know So Far: Principles of Homeostasis ................................ 27 Thermoregulation in Humans ........................... 28 Thermoregulatory Abilities in Newborns ........... 29 The Role of the Skin in Thermoregulation ........ 30 Hypothermia...................................................... 31 Hyperthermia .................................................... 32 Drugs and Thermoregulation ............................ 33 Hyperthyroidism and Thermoregulation ............ 34 What You Know So Far: Thermoregulation ....... 35 Hormonal Regulatory Systems.......................... 36 Control of Blood Glucose .................................. 37 Insulin and Cellular Uptake of Glucose .............

CODES:

Activity is marked:

to be done

33 35 36 38 39 40 42 43 45 46 47 49 50 51 52 53 54 55

38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68

The Liver's Role in Carbohydrate Metabolism. .. 56 Type 1 Diabetes Mellitus ................................... 57 Type 2 Diabetes Mellitus.................................... 59 Alcohol and Blood Glucose ............................... 61 Nicotine and Blood Glucose .............................. 62 What You Know So Far: Blood Glucose ............ 63 What Determines Blood Pressure?.................. .. 64 Water Budget in Humans.................................... 65 The Homeostatic Role of the Kidney ................ 66 The Structure of a Nephron .............................. 67 How Kidney Regulates Fluid and Electrolytes .. 68 ADH and Water Balance ................................... 70 Caffeine and the Body....................................... 71 Control of Blood Pressure ................................. 72 Hypertension...................................................... 73 The Consequences of Kidney Failure ............... 74 What You Know So Far: Osmotic Balance ....... 75 Gas Transport in Humans ................................. 76 Responding to Changes in Oxygen Demand..... 78 Homeostasis During Exercise............................ 79 Exercise and Heart Rate ................................... 81 Fight or Flight..................................................... 82 The Effects of High Altitude .............................. 83 Cooperating Systems: Acid-Base Balance ....... 84 The Challenges of the Coast to Coast .............. 86 The Ultramarathon: A Personal Account ........... 89 Smoking and the Gas Exchange System ......... 90 Smoking and the Cardiovascular System ......... 92 What You Know So Far: Respiratory Gases....... 93 Essay Question.................................................. 94 KEY TERMS AND IDEAS: Homeostasis........... 96

AS 3.7 Human manipulation of genetic transfer Achievement criteria and explanatory notes ..... 97 69 A History of Human Genetic Manipulation ........ 99 70 What is DNA Manipulation? ............................ 100 71 Making Recombinant DNA............................... 101 72 Creating and Using Recombinant Bacteria...... 103 73 Gel Electrophoresis.......................................... 105 74 DNA Amplification Using PCR ........................ 106 75 What is Transgenesis? .................................... 108 76 Vectors for Transgenesis ................................. 109 77 The Applications of Transgenesis ................... 110 78 Ethics of Transgenesis .................................... 111 79 Using Recombinant Plasmids in Industry ....... 112 80 Engineering for Improved Nutrition.................. 114 81 Using Recombinant Plasmids in Medicine....... 116 82 Engineering for Insect Resistance .................. 118 83 Food for the Masses ....................................... 120 84 What You Know So Far: Transgenesis ............. 122 85 Determining Gene Function ............................. 123

when completed

Contents 86 New Tools: Gene Editing with Crispr ............... 125 87 Gene Probes ................................................... 126 88 Studying Gene Expression ............................. 127 89 Gene Therapy.................................................. 129 90 Vectors for Gene Therapy ................................ 130 91 Treating SCID with Gene Therapy.................... 131 92 Treating Cystic Fibrosis with Gene Therapy..... 132 93 What You Know So Far: Gene Function........... 133 94 Vegetative Propagation of Plants..................... 134 95 Plant Tissue Culture......................................... 136 96 Cloning by Embryo Splitting............................... 138 97 Cloning by Somatic Cell Nuclear Transfer............ 139 98 What You Know So Far: Cloning....................... 141 99 What is Selective Breeding?............................ 142 100 Selective Breeding in Dogs.............................. 143 101 Selective Breeding in Dairy Cattle................... 144 102 IVF and Embryo Transfer Technologies in Cattle............................................................. 145 103 Genetic Tools for Selective Breeding................ 147 104 Marker Assisted Selection............................... 149 105 Identifying Pedigrees........................................ 151 106 Conservation and Genetic Diversity................. 152 107 Selective Breeding in Plants............................ 154 108 Selective Breeding Modern Wheat.................. 156 109 What You Know So Far: Selective Breeding..... 158 110 Essay Question: Genetic Transfer.................... 159 111 KEY TERMS AND IDEAS: Genetic Transfer.... 160

MODEL ANSWERS................................................. 161

APPENDIX A: Some Common Tools in Genetic Modification................................................. 178 APPENDIX B: Terms and Notation.......................... 179 APPENDIX C: Choosing A Statistical Test............... 180 APPENDIX D: Questioning Terms............................ 181 PHOTO CREDITS.................................................... 181

INDEX .................................................................... 182

CODES:

Activity is marked:

to be done

when completed

Using This Book BIOZONE's NCEA Level 3 Biology Internals contains material to meet the needs of New Zealand students studying NCEA Biology Level 3 Internal Achievement Standards. The NCEA Level 3 Biology Internals is compliant with Level 8 of the NZ Curriculum (Nature of Science – The Living World) and the NCEA Biology Level 3 Internal Achievement Standards. A wide range of activities will help you to build on what you already know, explore new topics, work collaboratively, and practise your skills in data handling and interpretation. We hope that you find this resource useful and that you make full use of its features.

The outline of the chapter structure below will help you to navigate through the material in the chapters "Maintaining a Stable Internal Environment" and Manipulating Genetic Transfer". Sections within a chapter share the same structure. They correspond to natural topic breaks within the Achievement Standard.

Introduction

Activities

Review

Test

• A check list of achievement criteria and explanatory notes • A check list of what you need to know • A list of key terms

• The KEY IDEA provides your focus for the activity • Annotated diagrams help you understand the content • Questions review the content of the page

• Create your own summary for review • Hints help you to focus on what is important • Your summary will help you with the essay question

• Essay style questions conclude clusters of related activities • These enable you to practise your essay writing skills

Key terms and ideas • Includes a question based on key terms • Other questions test your understanding of the section content

36 Control of Blood Glucose Key Idea: The endocrine portion of the pancreas produces two hormones, insulin and glucagon, which maintain blood glucose at a steady state through negative feedback. Blood glucose levels are controlled by negative feedback involving two hormones, insulin and glucagon. These hormones are produced by the islet cells of the pancreas, and act in opposition to control blood glucose levels. Insulin lowers blood glucose by promoting the uptake of glucose

by the body's cells and the conversion of glucose into the storage molecule glycogen in the liver. Glucagon increases blood glucose by stimulating the breakdown of stored glycogen and the synthesis of glucose from amino acids. Negative feedback stops hormone secretion when normal blood glucose levels are restored. Blood glucose homeostasis allows energy to be available to cells as required. The liver has a central role in these carbohydrate conversions.

Blood sugar (mmol L-1)

Summarise what you know about this topic so far under the headings provided. You can draw diagrams or mind maps, or write short notes to organise your thoughts in preparation for the essay question at the end of the chapter. Use the points in the introduction and the hints provided to help you:

6.0

5.0

Diabetes mellitus

HINT: Compare and contrast the differences between type 1 and type 2 diabetes and their treatments.

94 Blood glucose regulation

4.0

HINT: Describe the role of the antagonistic hormones insulin and glucagon in regulating blood glucose levels. Time 3:00 5:00

Blood insulin levels Blood glucose levels 3.0 7:00

9:00

11:00

meal

13:00

15:00

17:00

19:00

meal

21:00

23:00

1:00

meal

beta cells

68 KEY TERMS AND IDEAS: Homeostasis

Rise in BG

Normal blood glucose (BG) level

effector

A Regulation of the internal environment to maintain a stable, constant condition.

homeostasis

B Organ or part of body that responds to signals from a control centre (brain).

hormones

C A destabilising mechanism in which the output of the system causes an escalation in the initial response.

Fall in BG Breakdown of glycogen to glucose in the liver.

3.9-5.6 mmol L -1

Decreases blood glucose

1. Test your vocabulary by matching each term to its definition, as identified by its preceding letter code.

alpha cells Stimulates α cells to secrete glucagon

Stimulates β cells to secrete insulin

Uptake of glucose by cells. Conversion of glucose to stored glycogen or fat in the liver.

67 Essay Question: Homeostasis 1. Homeostasis refers to the (relatively) constant physiological state of the body despite fluctuations in the external environment. Using the control of blood glucose as an example, discuss why it is important that animals maintain a constant internal environment. You may use extra paper if needed. Your answer should include: • The components of the control system involved 96 • The role of hormones and negative feedback in maintaining blood glucose levels • Reference to factors (e.g. disease and drugs) that might disrupt blood glucose homeostasis

Negativeinfeedback in blood glucose regulation Negative feedback blood glucose regulation Blood glucose can be tested using a finger prick test. The glucose in the blood reacts with an enzyme electrode, generating an electric charge proportional to the glucose concentration. This is displayed as a digital readout.

43 What Your Know So Far: Blood Glucose

7.0

hypothalamus negative feedback

Release of glucose into the blood

nerves

1. (a) Identify the stimulus for the release of insulin: (b) Identify the stimulus for the release of glucagon:

D Chemical messenger that induces a specific physiological response. E

Cells that transmit information in the form of electrochemical impulses.

A mechanism in which the output of a system acts to oppose changes to the input of the system. The net effect is to stabilise the system and dampen fluctuations.

positive feedback

G The region of the brain which coordinates the nervous and endocrine systems via the pituitary gland.

receptor

H A structure that detects changes and sends a message to a control centre.

2. Study the graph below, and answer the questions following it. In your answers, use biological terms appropriately to show your understanding.

Drugs and blood glucose regulation

HINT: Effects of alcohol and nicotine on BG regulation.

(d) How does insulin decrease blood glucose level?

Type of feedback mechanism: +

2. Explain the pattern of fluctuations in blood glucose and blood insulin levels in the graph above:

Mode of action:

3. The stimulus for the production and release of insulin and glucagon is: hormonal / humoral / neural (circle one): WEB

KNOW

LINK

–

Biological examples of this mechanism:

3. (a) Name the excretory organ of vertebrates: (b) Name the selective filtering element of the kidney: (c) The length of this is directly related to the ability of an organism to concentrate urine: (d) Name the hormone involved in controlling urine output: 4. (a) The hormones secreted by a and b cells together act to…

REVISE (b) What mechanism controls the secretion of these hormones?

TEST

(b) Where do these metabolic processes occur?

TEST

PHOTOCOPYING PROHIBITED

Understanding the activity coding system and making use of the online material identified will enable you to get the most out of this resource. The chapter content is structured to build knowledge and skills but this structure does not necessarily represent a strict order of treatment. Be guided by your teacher, who will assign activities as part of a wider programme of independent and group-based work. Look out for these features and know how to use them: The activities form most of this book. They are numbered sequentially and each has a task code identifying the skill emphasised. Each activity has a short introduction with a key idea identifying the main message of the page. Most of the information is associated with pictures and diagrams, and your understanding of the content is reviewed through the questions. Some of the activities involve modelling and group work.

The chapter introduction provides you with a summary of the achievement criteria and explanatory notes as identified in the Achievement Standard. A check list of what you need to know to meet the knowledge requirements of the standard is provided on the second page of the introduction. Use the check boxes to identify and mark off the points as you complete them. A list of key terms for the chapter is included.

118

Human manipulation of genetic transfer

Achievement Standard

3.7

Humans have the capability to manipulate the transfer of genetic information from generation to generation. This is not a new phenomenon. It began with selective breeding of plants and animals but can now be more directed and more rapid with the advent of gene technologies. Manipulations of genetic transfer have biological and social implications.

Transgenesis annealing DNA amplification

Achievement criteria and explanatory notes c

Demonstrate understanding of human manipulations of genetic transfer and its biological implications: Use biological ideas to describe human manipulations of genetic transfer and its biological implications.

Demonstrate in-depth understanding of human manipulations of genetic transfer and its biological implications: Use biological ideas to explain how humans manipulate genetic transfer and the biological implications of these manipulations.

Demonstrate comprehensive understanding of human manipulations of genetic transfer and its biological implications: Link biological ideas about human manipulations of genetic transfer and its biological implications. This may involve justifying, relating, evaluating, comparing and contrasting, and analysing.

plasmid restriction enzyme transgenesis

Bacillus thuringiensis is a soil bacterium. It also occurs naturally in the gut of caterpillars and on leaf surfaces. The bacteria form spores that are associated with crystalline proteins called d-endotoxins. These are lethal to butterfly and moth larvae but do not affect other insects such as beetles or bees (or any other animal). For this reason the Bt toxin has been used as a targeted insecticide since the 1960s. In 1996 the seed company Monsanto released its first version of Bt corn. This corn had been genetically modified to contain the gene that produces the Bt protein. The target insect pest for Bt corn is the larval stage of the European corn borer, which causes hundreds of millions of dollars worth of damage to crops annually.

Achievement criteria for achieved, merit, and excellence

DNA ligation

recombinant DNA

this requires a lot of effort and leaves potentially harmful chemical residues on the food and in the environment. Using genetic engineering to produce crop plants with their own in-built insect deterrents can result in greater crop yields and reduced chemical use.

USDA

DNA ligase

genetically modified organism (GMO) polymerase chain reaction (PCR)

82 Engineering for Insect Resistance Key Idea: Up to one fifth of the world's crops are lost due to insects each year. Losses can be reduced through the use of genetic engineering to introduce the Bt gene into crop plants. A key goal in horticulture is the reduction of insect crop damage. Normally this is done using sprays. However

Bt toxin

Key terms

gel electrophoresis

Free response questions allow you to use the information provided to answer questions about the content of the activity, either directly or by applying the same principles to a new situation. In some cases, an activity will assume understanding of prior content.

The effects of the Bt toxin on insect deterrence. The plant on the right has been treated with Bt toxin before being exposed to caterpillars. The plant on the left had not been treated with Bt toxin.

Producing a Bt plant Genetic engineering has been used to produce cotton, corn, and potato varieties that produce the Bt toxin. The bacterium Agrobacterium tumefaciens is commonly used to transfer the Bt gene into plants, via recombinant plasmid: Agrobacterium tumefaciens

Transformed plant cells are cultured into the lab and grown into new plants before being planted out.

Bacillus thuringiensis

vector Investigating gene function DNA (gene) probes

Bt gene

DNA chip gene therapy

NIH

Principles of genetic manipulation

Cloning

Some basic techniques are used in some genetic manipulations…

clone embryo splitting genetic diversity somatic cell nuclear transfer (SCNT) tissue culture

artificial insemination

Genetic material can be edited or transferred between species using gene editing 69 - 72 tools, including endonucleases. 76 86 90

PCR is an important tool for amplifying DNA sequences of interest.

DNA probes allow specific genetic sequences of interest to be located.

Genomic markers can be used as a tool in selective breeding programmes.

embryo transfer gene marker

Human manipulations of genetic transfer may involve…

selective breeding

Activity number

Investigation and modification of the expression of existing genes.

Whole organism cloning (plants and animals).

Selective breeding, which could include embryo selection, animal breeding, plant breeding, or the development of new crops.

99 - 108

Explanatory notes: Biological implications

Activity number

Ecosystems.

Genetic biodiversity.

Health and survival of individuals.

Survival and/or evolution of populations.

Recombinant plasmid

2. Why is Bt toxin a useful insecticide?

Transgenesis, being the process of introducing a gene from another species into a living organism. The foreign gene must be transmitted to the offspring.

Biological implications may involve the impact on …

Ti plasmid

1. Name the bacteria that produces Bt toxin:

75 - 83

pre-implantation genetic diagnosis

Corn cell infected with Agrobacterium

Bt gene inserted into Ti plasmid

103 104

in-vitro fertilisation

Agrobacterium transfers DNA into plant cell

Explanatory notes: Manipulations of genetic transfer

DNA profiling embryo selection

Activity number

Selective breeding

Ti plasmid inserted back into Agrobacterium

85 - 92

3. What is the primary target of the Bt toxin in Bt corn?

94 - 97

4. Explain how Bt corn is produced using Agrobacterium tumefaciens:

111 118 99 106 91 92 106 108 WEB

KNOW

A TASK CODE on the page tab identifies the type of activity. For example, is it primarily information-based (KNOW), or does it involve modelling (PRAC)? A full list of codes is given on the following page but the codes themselves are relatively self explanatory.

LINK

WEB tabs at the bottom of the activity page alert the reader to the Weblinks resource, which provides external, online support material for the activity, usually in the form of an animation, video clip, photo library, or quiz. Bookmark the Weblinks page (see next page) and visit it frequently as you progress through the book.

PHOTOCOPYING PROHIBITED

LINK tabs at the bottom of the activity page identify activities that are related in that they build on content or apply the same principles to a new situation.

2. Why is Bt toxin a useful insecticide?

Using the Tab System

vii

3. What is the primary target of the Bt toxin in Bt corn?

The tab system is a useful system for quickly identifying related content and online support. Links generally refer to activities that build on the information in the activity in depth or extent. A link may also reflect on material that has been covered earlier as a reminder for important terms that have already been defined. In the example belowisfor the activity "Engineering 4. Explain how Bt corn produced using Agrobacterium tumef for Insect Resistance", the weblink 82 provides information about genetically modified foods and some ethical considerations surrounding their production and use. Activity 78 directs back to an activity discussing the ethics of genetic modification, and activity 80 provides another example of how genetic modification has been used to enhance the nutritional content of food crops. The weblinks code is always the same as the activity number on which it is cited. On visiting the weblinks page (below), find the number and it will correspond to one or more external websites providing a video or animation of some aspect of the activity's content. Occasionally, the weblink may provide a bank of photographs where images are provided in colour.

WEB

Activities are coded KNOW = content you need to know

KNOW

LINK

DATA = data handling and interpretation PRAC = a paper practical or a practical focus REVISE = review the material in the section TEST = test your understanding

Weblinks

Bookmark the weblinks page: www.biozone.co.nz/weblink/ NZL3I-9612 Access the external URL for the activity by clicking the link

Link

Connections are made between activities in different sections of the syllabus that are related through content or because they build on prior knowledge.

www.biozone.co.nz/weblink/NZL3I-9612 This WEBLINKS page provides links to external websites with supporting information for the activities. These sites are distinct from those provided in the BIOLINKS area of BIOZONE's web site. For the most part, they are narrowly focussed animations and video clips directly relevant to some aspect of the activity on which they are cited. They provide great support to help your understanding of basic concepts.

Chapter in the book

Hyperlink to the external website page. Activity in the book

Bookmark weblinks by typing in the address: it is not accessible directly from BIOZONE's website Corrections and clarifications to current editions are always posted on the weblinks page

PHOTOCOPYING PROHIBITED

ÂŠ 1988-2017 BIOZONE International

viii

Using the Website

BIOZONE's web site should be the first stop for biologists. As well as providing all our product information (including shipping dates) and updates, www.biozone.co.nz provides quick access to the latest RSS newsfeeds and podcasts from around the world. The Resource hub also provides quick links to access the websites of publishers of references cited in the workbooks. Perhaps of greatest value to students and teachers is the BIOLINKS area of BIOZONE's website. The BIOLINKS pages are distinct from Weblinks (which are specific to each workbook edition) and provide a database of well organised hyperlinks pertaining to topics of interest in biology. The database is updated regularly, so that outdated, not operational, or no longer relevant sites are removed and new sites are added as they appear.

Click on a topic to see a list of all its links. Each topic has relevant subtopics to make searching easier and each link has a brief description.

RSS Newsfeeds and Podcasts in the right hand column provide the latest news and information from the world of science.

Click on the link to access the named site. The brief description tells you how the site may be of interest, as well as any country specific bias, if this is relevant.

PHOTOCOPYING PROHIBITED

ÂŠ 1988-2017 BIOZONE International

Practical investigation in a biological context

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

Achievement Standard

3.1

Key terms

Investigating in science will extend your science knowledge and develop your understanding of the relationship between investigations and scientific theories and models. Part of rigorous investigation involves submitting your findings for peer review and debate.

assumptions bias

conclusion

Achievement criteria and explanatory notes

controlled variable

Achievement criteria for achieved, merit, and excellence

data

Carry out a practical investigation in a biological context, with guidance: Involves:

•

Developing a statement of the purpose, linked to a scientific concept or idea, and written as a hypothesis.

•

For a fair test using a method that describes the independent variable and its range, measurement of the dependent variable and the control of some other key variables.

•

For a pattern seeking or modelling activity, describing the data that will be collected, range of data/samples, and consideration of other key factors.

•

Collecting recording, and processing data relevant to the purpose of the investigation.

•

Interpreting the processed data and reporting on the findings of the investigation.

mode

•

Identifying relevant findings from another source.

pattern seeking

•

Stating a conclusion based on interpretation of the processed data, which is relevant to the purpose of the investigation.

dependent variable

descriptive statistics fair test graph

hypothesis

independent variable logbook mean

median

prediction

random sampling raw data

reliability (of data) report

standard deviation standard error statistical test

PASCO

table

validity

variable

Carry out an in depth practical investigation in a biological context, with guidance: Involves:

•

Developing a statement of the purpose, linked to a scientific concept or idea, and written as a hypothesis.

•

For a fair test using a valid method that describes a valid range for the independent variable, the valid measurement of the dependent variable and the control of other key variables.

•

For a pattern seeking or modelling activity, describing a valid collection of data with consideration of factors such as sampling bias and sources of error.

•

Collecting recording, and processing reliable data to enable a trend or pattern (or absence) to be determined.

•

Stating a valid conclusion based on the processed data in relation to the purpose of the investigation.

No Cla t fo ssr r o Us om e

trend

Explaining the biological ideas relating to the investigation. The explanation is based on both the findings of the investigation and those from other sources.

Carry out a comprehensive practical investigation in a biological context, with guidance: Involves:

•

Justifying the choices made throughout the investigation by evaluating the validity of the method or the reliability of the data.

•

Stating a conclusion that discusses the biological ideas relevant to the investigation and either the finds of others, scientific principles, theories, or models.

No Cla t fo ssr r o Us om e

Explanatory notes: A practical investigation

Activity number

PR E V ON IEW LY

A practical investigation…

AKA

Should cover the complete process: planning, execution, processing and interpreting the data, and reporting on the investigation.

Will involve collecting primary data. You will have opportunities to make changes to your initial method as you work through the investigation.

May involve manipulating variables (fair test), investigating a pattern or relationship, or the use of models.

1 - 3 8 -13 16

4 - 7

14 15

With guidance refers to…

Teacher support throughout the investigation.

The teacher negotiates the boundaries of the investigation with the student. This may be related to suitability of organisms, equipment and resources available, and possible modifications or new directions related to the investigation. However, the student drives the investigative process.

What you need to know for this Achievement Standard Hypotheses and design of the investigation Activities 1 - 6, 14 - 16

By the end of this section you should be able to:

Formulate a working hypothesis from which you can generate predictions about the outcome of your investigation.

Describe a method for collecting valid data for an investigation involving: testing: A single variable is changed while keeping other variables the same.  Pattern seeking: Observing and recording natural events or carrying out an investigation in which the variables cannot easily be controlled.  Modelling: Creating a representation of a system or process to investigate how it works. c

 Fair

PASCO

For a fair test, identify your dependent and independent variables, their range, and how you will measure them. Identify controlled variables and their significance.

For a pattern seeking investigation, identify the data that you will collect and the range of the data or samples. Note/record variables and identify patterns that result from these variables.

Determine the amount of data you need to reasonably test your hypothesis and its predictions.

Describe any controls in your investigation (if appropriate). Identify any assumptions made in your investigation. Evaluate any sources of error in your design.

Recording, analysing, and presenting data

Activities 7 - 16 and see Appendix D (Choosing a statistical test) By the end of this section you should be able to:

Use and maintain a thorough and accurate logbook

Present your data appropriately in a table, including any calculated values.

Demonstrate an ability to process raw data e.g. percentages, total, rates (as appropriate).

Present your processed data appropriately in a graph. Recognise any patterns or trends evident.

Demonstrate an ability to analyse and interpret data from a fair test or pattern seeking investigation (including the points noted below).



Calculate basic descriptive statistics (e.g. sample mean, median, mode and standard deviation) to summarise trends or differences in your data.



If appropriate, calculate measures of dispersion for your data, related to the true population parameters, e.g. standard error, 95% confidence intervals, and 95% confidence limits.



If required, perform an appropriate statistical test to test the significance of any trends or differences you have observed, e.g. linear regression, chi-squared test student's t test).

Use information sources to find information relevant to your study, and reference it appropriately.

Write up the findings of your investigation in a scientific report, including methods, results, discussion and conclusion.

Habitat News

No Cla t fo ssr r o Us om e

How Do We Do Science? is not a strict set of rules to be followed, but rather a way of approaching problems in a rigorous, but open-minded way. It involves inspiration and creativity, it is dynamic and context dependent, and usually involves collaboration. The model below is one interpretation of the scientific method.

PR E V ON IEW LY

Key Idea: The scientific method is a rigorous, dynamic process of observation, investigation, and analysis that helps us to explain phenomena and predict changes in a system. Scientific knowledge is gained through a non-linear, dynamic process called the scientific method. The scientific method

TASK: Before studying the diagram below, write a paragraph about what you think science is and what it involves. Then study the diagram and points below and state if your views differ from this and in what way. Staple your response to this page. At the end of your course, reexamine what you wrote. Have your ideas changed? Be honest in your first response!

EXPLORE AND DISCOVER

Ask questions

Find inspiration

Share ideas & information

Make observations

Explore the literature

TEST IDEAS Gathering data

Make hypotheses

Expected results

Actual results

Analysing and interpreting data Supporting, contradictory, or surprising data may…

RESULTS AND BENEFITS Develop technologies

…support a hypothesis

…change assumptions

…oppose a hypothesis

Solve problems

…suggest a new hypothesis

Build knowledge

Satisfy curiosity

Inform society

ANALYSIS AND FEEDBACK Peer review

Repeat investigation

Discussion with peers

Publication

New questions

Theory building

Material adapted from the UC Berkeley's excellent website undsci.berkeley.edu/

Science is just collection of facts

There is a single, linear scientific method

Scientists work without considering applications of their ideas

Science is a process through which we can understand what we see

Science is exciting, dynamic, creative, and collaborative

Science has application and relevance in the modern world

No Cla t fo ssr r o Us om e

Remember what science is and what it is not!

Scientific ideas are absolute and unchanging

Science is a solitary pursuit

Science is ongoing: it moves in a direction of greater understanding

Science is a global human endeavour

WEB

REFER

No Cla t fo ssr r o Us om e

Choosing Your Topic called data related to your topic. Plan to collect quantitative data because it is easier to analyse without bias and this will contribute to the rigour of your findings. Recording the data systematically as you collect it is important too, because it will give an early indication of patterns or trends that may require you to fine tune your design. Familiarity with the qualities of data (below) will help you produce a sound design.

PR E V ON IEW LY

Key Idea: Your choice of topic will depend on the question you are asking and the resources you have available. You should collect quantitative data where possible. When choosing a topic for an investigation, select one that meets the criteria of the achievement standard and design it so that analysis is straightforward and findings are biologically meaningful. In your investigation, you will collect information,

Proposed topic

Does your proposed topic:

Ask yourself

• The effect of pasture type on the

growth or survival of clover weevils.

• The effect of soil type on growth or fruiting of tomato or radish plants.

Am I interested in a difference between treatments (groups) which are chosen to highlight some aspect of the organism’s niche?

• The effect of substrate type on the proportion of caddises in a stream.

• Address your hypothesis and its predictions?

• The effect of temperature on the filtering rate of Daphnia.

Am I interested in a relationship (trend) between an independent variable and the biological response of the organism?

• Meet the requirements for assessment?

• The effect of crowding on leaf production in tomatoes.

• The effect of changes in salinity on the respiration rate of mud crabs.

Types of variables

Qualitative

Ranked

Quantitative

Non-numerical and descriptive, e.g. sex, colour, presence or absence of a feature, viability (dead/alive).

Data for ranked variables can be placed on a scale that represents an order, e.g. abundance (very abundant, common, rare); colour (dark, medium, pale).

Characteristics for which measurements or counts can be made, e.g. height, weight, number.

Discontinuous

A: Leaf shape: qualitative

e.g. number of children in a family (3, 0, 4)

B: Number per litter: quantitative, discontinuous

e.g. height of children in a family (1.5 m, 1.3 m, 0.8 m)

C: Fish length: quantitative, continuous

Use this space to develop some ideas about potential topics. For each, identify the nature of the variables involved: 1.

LINK

KNOW

LINK

The values for monitored or measured variables, collected during the investigation, are called data. Like their corresponding variables, data may be quantitative, qualitative, or ranked. Discontinuous data have a unit of measurement that cannot be split. Continuous data uses units of measurement that can be a part number.

e.g. birth order in a family (1, 2, 3)

No Cla t fo ssr r o Us om e

e.g. sex of children in a family (male, female)

Continuous

Ethics and Safety Issues of Research

No Cla t fo ssr r o Us om e

this could result in harm to yourself or others around you. Ethical considerations also need to be addressed. These include bioethics (the moral implications of new discoveries), animal welfare issues, and your own behaviour in recording reporting results accurately and honestly and acknowledging the work of others.

PR E V ON IEW LY

Key Idea: When designing an investigation all potential health and safety risks must be first identified and steps taken in the design process to reduce or eliminate them. When designing an experiment it is important to identify any potential hazards to health and safety and take steps to eliminate or reduce the risks they pose. A failure to do

Heath and safety considerations

Reducing heath and safety risks

Laboratory hazards fall into three general categories: chemical, biological, and physical. Depending on the hazard, they have potential to cause harm to people, other organisms, or the environment.

►► Chemical: Chemicals could be ingested, absorbed through the skin, or inhaled. Examples include cleaning agents, disinfectants, and reagents (powdered and liquid). Some chemicals can cause fires or explosions if not handled correctly.

►► Biological: All biological material should be treated as potentially hazardous to avoid contamination and possible harm. Examples include microbial samples, animal tissue, fluid samples, and plant samples.

►► Identify potential hazards before you start and become knowledgeable about their risks.

►► Wear appropriate safety gear (lab coat, gloves, safety glasses, ear protection, and a mask as necessary).

►► Physical: There are numerous potential physical hazards ranging from the laboratory environment itself to the equipment you are using. Common hazards include injury caused by not using the equipment correctly (electrical, thermal, or sound hazards), cluttered working spaces, and tripping or slip hazards (e.g. wet floor).

►► Ensure all chemicals and solutions are clearly labelled.

►► Know how to correctly use all equipment and machinery before you begin.

►► Maintain clean work spaces and floors to reduce the risk of slips and spills. Keep access ways to emergency equipment clear.

Janet Stephens

Ethical considerations

It is very important to acknowledge the work of others (e.g. photographs, data, reference material). Failure to do so is plagiarism.

Get a teacher to review the design of your investigation for ethical approval prior to beginning. Minimise the impact of your research on the environment.

No Cla t fo ssr r o Us om e

Report your true data and findings, even if they are not the results you were expecting. Changing results to fit your hypothesis is misleading and unethical.

1. (a) Identify potential health and safety issues associated with the dissection of the pig kidney being carried out in the photo (left):

(b) What has been done to reduce one of these risks?

LINK

KNOW

No Cla t fo ssr r o Us om e

Designing a Fair Test full methodology, but offers some points to consider. The analysis for this experiment would include a calculation of the mean for each treatment group and a plot of the data with a calculated measure of spread (e.g. 95% confidence intervals). Depending on trends indicated by the plotted data, a regression might also be appropriate.

PR E V ON IEW LY

Key Idea: When designing an experiment to be a fair test, consider the variables (dependent, independent, and controlled), assumptions, and what analysis may be required. The figure below provides a basic experimental design to investigate the effect of pH on the growth of a plant species adapted to living in a bog. It is not intended as a

Observation

Two students noticed an abundance of a common plant (species A) in a boggy area of land near their school. They tested the soil pH in the area and found it to be quite low (around pH 5). Garden soil was about pH 6.5-7.0.

Research hypothesis

If species A is well adapted to grow in soil pH of ~5, then it will grow more vigorously (as measured by wet weight after 20 days) at pH 5 than at higher or lower pH.

Fluorescent strip lighting

Experiment

The students designed an experiment to test the prediction that the plants would grow best at pH 5. The basic design is described but it is not intended to be a full methodology.

Control of variables

Fixed (controlled) variables: These are controlled and the same across all treatments. `` Lighting regime (quantity and quality) `` Age and history of plants `` Type and volume of soil `` Pot size and type (dimensions, material) `` Watering regime (volume per day, frequency) Dependent variable: This is the biological response.

`` Plant growth rate (g day-1) calculated from wet weight

Watering regime

150 mL per day water at pH 3

150 mL per day water at pH 5

of entire plants (washed and blotted) after 20 days.

Independent variable: This is the factor that is being manipulated in the experiment. The range of the independent variable should be sufficient to obtain meaningful data for the biological response. `` pH of the water provided to the plants.

Control: In this experiment, one treatment with the assumed ideal pH for plant growth (pH 7) serves as the control. For other experimental designs, the control is the treatment that lacks the variable of interest. Other variables: Factors that cannot be controlled.

`` Genetic variation between plants (uncontrollable but assessed by having six plants per treatment).

Watering regime 150 mL per day water at pH 9

`` Temperature (all plants received the same room

temperature regime but this was not controlled).

Assumptions

Notes on preparation and data collection `` 60 seeds were germinated on damp blotting paper.

Features of the experiment assumed to be true but were not (or could not be) tested. `` A pH of 7 is a good indicator of the ideal growth pH for most non-acid adapted plants. `` All plants are essentially no different to each other in their growth response at different pH levels. `` The soil mix, light quality and quantity, and temperature are adequate for healthy continued growth. `` Watering volume is adequate. This could be tested with a trial experiment beforehand.

Of these, 24 in a similar stage of germination (10 mm shoot) were chosen for the experiment.

`` Each seedling was weighed to the nearest 0.1 g before planting into each of the 24 test pots..

`` All treatments were arranged on a lab bench in the centre of an internal lab (no windows).

`` Growth rate per day was estimated from the total wet weight of each plant at the end of 20 days.

WEB

KNOW

LINK

No Cla t fo ssr r o Us om e

Watering regime (control) 150 mL per day water at pH 7

LINK

APPB APPC

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

The importance of sample size

PR E V ON IEW LY

Choosing an appropriate sample size (the number of samples you will take) is very important in the design of any investigation.

`` The sample size must be large enough to provide enough

Replication in experiments

Replication refers to the number of times you repeat your entire experimental design (including controls), at the same time. It is not the same as increasing the sample size (n).

Replication is an important feature of rigorous scientific studies. Variation between the replicates are analysed and accounted for statistically. Replication accounts for unforeseen effects operating in the set-up. It is important when the response to treatments is likely to vary because of uncontrollable nuisance factors (e.g. in plant field trials).

Yohan euan o4

unbiased, reliable data to test your hypothesis and its predictions. `` The sample size will be limited by the time and resources available to collect and analyse the data (the sampling effort).

In this experiment of the effects of nutrient level on plant growth (above), the sample size is 5 (n = 5), there are three treatments (three nutrient levels) and four replicates (12 pots in all; not all are visible). The plot is randomised.

1. With reference to the experiment described opposite, explain the importance of each of the following:

(a) Only one plant in each pot:

(b) Obtaining sample plants from germination, not directly from the field:

2. (a) The 12 pots in the experiment opposite were arranged on a bench in the lab. In the space right, show how you might organise the pots to maximise the collection of unbiased data:

(b) What is the sample size in this experiment:

n =

(d) What was the rationale for using treatment of pH 7 as the control?

4. (a) Explain the purpose of replication in experiments:

No Cla t fo ssr r o Us om e

3. Explain the best way to take account of the natural genetic variability between individuals when designing an experiment:

(b) Describe factors that would limit your ability to replicate your experimental design:

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

Designing a Pattern Seeking Investigation for designing a pattern seeking investigation in the field. It provides a framework, which can be modified for most simple comparative field investigations.

PR E V ON IEW LY

Key Idea: A field-based study should be based on random sampling and collection of enough data to test the hypothesis. The figure below provides an example and some ideas

Observation

A student read that a particular species of native pill millipede is extremely abundant in forest leaf litter, but a search in the litter of a redwood conifer forest near his home revealed only very low number of millipedes.

Hypothesis and aim

Hypothesis: If native millipedes are adapted to a niche in the leaf litter of native forests, more should be found in the middle of the native forest than in the litter of exotic redwood conifer forests.

Giant pill millipede Procyliosoma tuberculata

Mixed podocarp hardwood forest

Plantation redwood conifer forest

Sampling sites

A sampling programme was designed to test the prediction that native millipedes are more abundant in the leaf litter of native forests than in conifer forests.

20 m

Sampling programme

Aim: to determine if data collected from invertebrate populations in two forest types support this hypothesis, and to attempt to explain any patterns evident in the data.

Sampling sites numbered 1-8 at evenly spaced intervals on a 2 x 2 m grid within an area of 20 m x 8 m. In m pattern or transect is situations like this, where20 a grid used, the choice of grid or transect position must be made randomly.

Sampling equipment: leaf litter light trap

Light from a battery operated lamp drives the invertebrates down through the leaf litter.

Equipment and procedure

Sites: For each of the two forests, an area 20 m x 8 m was randomly chosen and marked out in a 2 x 2 m grid. Eight sampling sites were selected, evenly spaced along the grid. `` The general area for the study chosen was selected on the basis of the large amounts of leaf litter present.

`` Eight sites were chosen as the largest number feasible to collect and analyse in the time available.

`` The two forests were sampled on sequential days.

Capture of millipedes: At each site, a 0.4 x 0.4 m quadrat was placed on the forest floor and the leaf litter within the quadrat was collected. Millipedes and other leaf litter invertebrates were captured using a simple gauze lined funnel containing the leaf litter from within the quadrat. A lamp was positioned over each funnel for 2 hours and the invertebrates in the litter moved down and were trapped in the collecting jar.

`` After 2 hours each jar was labelled with the site number and returned to the lab for analysis.

`` The litter in each funnel was bagged, labelled with the site number and returned to the lab for weighing.

`` The number of millipedes at each site was recorded. `` The numbers of other invertebrates (classified into major taxa) were also noted for reference.

No Cla t fo ssr r o Us om e

Large (diameter 300 mm) funnel containing leaf litter resting on a gauze platform.

ffAverage (mean) millipede abundance was calculated

Gauze allows invertebrates of a certain size to move down the funnel.

from the counts from the eight sites.

Ethical considerations

• Minimise damage to the habitat when sampling.

Collecting jar placed in the litter on the forest floor traps the invertebrates that fall through the gauze and prevents their escape.

WEB

KNOW

LINK

• Minimise handling to reduce stress to the organism. • Where possible, return all the collected organisms to the sites they were collected from. • Do not sample from the same site continually as this may affect population size.

9 Sampling strategies

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

In most ecological studies, it is not possible to measure or count all the members of a population. Instead, information is obtained through sampling in a manner that provides a fair (unbiased) representation of the organisms present and their distribution. This is usually achieved through random sampling. Sometimes researchers collect information by non-random sampling, a process that does not give all the individuals in the population an equal chance of being selected. While faster and cheaper to carry out than random sampling, non-random sampling may not give a true representation of the population.

Group 1

Group 2

Systematic sampling

Stratified sampling

Opportunistic sampling

Samples from a larger population are selected according to a random starting point and a fixed, periodic sampling interval. For the example above, the sampling period is every fourth individual. Systematic sampling is a random sampling method, provided the periodic interval is determined beforehand and the starting point is random. Example: Selecting individuals from a patient list.

Stratified sampling divides the population into subgroups before sampling. The strata should be mutually exclusive, and individuals must be assigned to only one stratum. Stratified sampling is used to highlight a specific subgroup within the population. Individuals are then randomly sampled from the strata to study. Example: Dividing the population into males and females.

A non-random sampling technique in which subjects are selected because of they are easily accessible to the researcher. Opportunistic sampling excludes a large proportion of the population and is usually not representative of the population. It is sometimes used in pilot studies to gather data quickly and with little cost. Example: Selecting 13 people at a cafe where you are having lunch.

1. (a) Explain the importance of recognising assumptions when designing a field study:

(b) List assumptions that may have been made during this study regarding:

The location of the areas sampled:

Size of the areas sampled:

Accuracy of the results:

No Cla t fo ssr r o Us om e

2. A student wants to investigate the incidence of asthma in their school. Describe how they might select samples from the school population using:

(a) Systematic sampling:

(b) Stratified sampling:

No Cla t fo ssr r o Us om e

Variables and Controls quantitative practical task should be recorded systematically, with due attention to safe practical techniques, a suitable quantitative method, and accurate measurements to an appropriate degree of precision. If your quantitative practical task is executed well, and you have taken care throughout, your evaluation of the experimental results will be much more straightforward and less problematic.

PR E V ON IEW LY

Key Idea: Practical work carried out in a careful and methodical way makes analysis of the results much easier. A major part of any practical investigation is collecting the data. Practical work may be laboratory or field based. Typical laboratory based experiments involve investigating how a biological response is affected by manipulating a particular variable, e.g. temperature. The data collected for a

Carrying out your practical work

Execution and recording

Preparation

Analysis and reporting

Know how you will take your Familiarise yourself with the equipment measurements and how often. Record and its set it up. Calibrate equipment if necessary to give accurate measurements. your results systematically in a log book as you go. You could record results a hand-written table or in a spreadsheet. If Read through the methods and identify using a data logger, data will be logged. key stages and how long they will take.

Identifying variables

A variable is any characteristic or property able to take any one of a range of values. Investigations often look at the effect of changing one variable on another. It is important to identify all variables in an investigation: independent, dependent, and controlled, although there may be nuisance factors of which you are unaware. In all fair tests, only one variable is changed by the investigator.

Dependent variable

• Factors that are kept the same or controlled. • List these in the method, as appropriate to your own investigation.

ffIt is the same as the experimental (test) group, except that it lacks the one variable being manipulated by the experimenter.

ffControls are used to demonstrate that the

response in the test group is due a specific variable (e.g. temperature).

Independent variable

• Set by the experimenter. • Recorded on the graph's x axis. • Should include at least four different values.

LINK

No Cla t fo ssr r o Us om e

Dependent variable

Controlled variables

KNOW

treatment or group in an experiment.

experimental conditions, observations, measurements, and analysis as the test group. This helps to ensure that responses observed in the treatment groups can be reliably interpreted.

Independent variable

LINK

Experimental controls ffA control refers to a standard or reference

ffThe control undergoes the same preparation,

• Measured during the investigation. • Recorded on the y axis of the graph.

WEB

Analyse the data. Tables can summarise data. Graphs present the data to show patterns and trends. Statistical tests can determine the significance of results. Present your findings, e.g. as a poster, a digital presentation, or an oral report.

The experiment above tests the effect of a certain nutrient on microbial growth. All the agar plates are prepared in the same way, but the control plate does not have the test nutrient applied. Each plate is inoculated from the same stock solution, incubated under the same conditions, and examined at the same set periods. The control plate sets the baseline; any growth above that seen on the control plate is attributed to the presence of the nutrient.

No Cla t fo ssr r o Us om e

Investigation: effect of light on rate of photosynthesis Distance from direct light source (cm)

Background

PR E V ON IEW LY

The aquarium plant, Cabomba aquatica, will produce a stream of oxygen bubbles when illuminated. The oxygen bubbles are a waste product of the process of photosynthesis (overall equation below right), which produces glucose (C6H12O6) for the plant. The rate of oxygen production provides an approximation of photosynthetic rate.

No direct light

The method ff6 x 1.0 g of Cabomba stems were placed into each of 6 test-tubes filled with 10 mL room temperature solution containing 0.2 molL-1 sodium hydrogen carbonate (to supply carbon dioxide).

ffTest tubes were placed at distances (20, 25, 30, 35, 40

cm) from a 60W light source (light intensity reduces with distance at a predictable rate). One test tube was not exposed to the light source.

ffBefore recording, the Cabomba stems were left to

acclimatise to the new light level for 5 minutes. The bubbles emerging from the stem were counted for a period of three minutes at each distance.

1.0 g Cabomba

0.2 molL-1 NaHCO3

6CO2 + 12H2O

Oxygen bubbles

Light

Stems were cut and inverted to ensure a free flow of oxygen bubbles.

C6H12O6 + 6O2 + 6H2O

1. Write a suitable aim for this experiment:

2. Write a possible hypothesis for this experiment:

3. (a) What is the independent variable in this experiment?

(b) What is the range of values for the independent variable?â&#x20AC;&#x2C6;

(d) How could you better quantify the independent variable? 4. (a) What is the dependent variable in this experiment?

(b) Name the unit for the dependent variable:

(c) What equipment might have made it easier to record the response of the dependent variable accurately? Predict when it would have been most needed:

(d) What is the sample size for each treatment?

(e) What could you change in the design of the experiment to guard against unexpected or erroneous results?

5. Which tube is the control for this experiment?

6. Identify two assumptions being made about this system: (a) (b)

No Cla t fo ssr r o Us om e

7. Identify one variable that might have been controlled in this experiment, and how it could have been monitored:

8. How might you test the gas being produced is oxygen:

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

Maintaining a Logbook must be dated and it should show in detail how you carried out your experiment or research project. The logbook provides proof that you have carried out certain activities on specific dates, and records the results of your work. Logbooks can be used to verify the authenticity and originality of your ideas.

PR E V ON IEW LY

Key Idea: A logbook records your ideas and results throughout your scientific investigation. It provides a record of work and proof that you have carried out that work. A logbook provides a complete record of the ideas and work you have carried out during your investigation. Each entry

Find a notebook to use that will suit your purposes (e.g. if the logbook is to be used in a field a waterproof book is useful). A hardback A4 lined exercise book is a good choice, anything smaller will make it difficult to include photos or extra pages later on.

Name your logbook in a prominent location. Number the pages so you can create a good table of contents. Creating sections in your logbook with tabs helps you keep track of ideas, methods, and results easily.

Date and sign every entry. Entries should be concise, but contain enough information that you can understand them later on. Short notes and bullet points are often used.

You must be able to read your entries at a later date, but don't worry too much about neatness. Logbooks are a record of your work, not the final report. It is more important to accurately record information during lab trials or field studies than to have a nice looking logbook!

Your logbook should be used in all phases of your investigation, from planing to write up. Record ideas on methods or analysis, as well as results.

Date your entries

Glue, staple, or tape any loose paper or photos into your logbook. Loose papers are an annoyance, both for you to keep track of and your teacher to sort through.

Include any mishaps, failed experiments, or changes in methodology in your logbooks. Where possible, explain the reasons for the failure or change. Sometimes failed experiments can be just as valuable as successful experiments in understanding a result.

Include all observations made during your investigation and any calculations and transformations of the data.

Remember, systematically recording your ideas, observations, and analyses during your investigation will pay off when you have to organise the material for the final write up. It will also help to clarify any parts of your study that your teacher or marker may find confusing or incorrect, meaning you could still get credit for your work.

Staple or fix loose paper and photos

Calculations should be included

No Cla t fo ssr r o Us om e

Include sketches and ideas

1. Why is it important to keep a detailed logbook during a scientific investigation?

WEB

KNOW

LINK

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

Which Graph to Use?

No Cla t fo ssr r o Us om e

Key Idea: The type of graph you choose to display your data on depends on the type of data you have collected. Before you graph your data, it is important to identify what type of data you have. Choosing the correct type of graph can

PR E V ON IEW LY

highlight trends or reveal relationships between variables. Choosing the wrong type of graph can obscure information and make the data difficult to interpret. Examples of common types of graphs and when to use them are provided below.

`` One variable is a category

Use a pie graph

`` One variable is a count

Water use key

23% 17%

Cooling

Irrigation

27%

33%

Commercial

Drinking

`` One variable is a category

`` One variable is continuous data (measurements)

Use to compare proportions in different categories.

Use a bar or column graph

Mangrove area in NZ harbours Herekino

Whangape

What type of data have you collected?

`` One variable is continuous data (measurements)

Kaipara

Manakau

Raglan

2000 4000 Area (ha)

6000

Use a histogram

Use to show a frequency distribution for a continuous variable.

Frequency

`` One variable is a count

Use to compare different categories (or treatments) for a continuous variable.

Hokianga

`` The points are connected point to point

Use a line graph

Temperature vs metabolic rate

`` A line of best fit can be drawn through the points

Temperature (Â°C)

Body length vs brood size

Line of best fit

Use to illustrate the relationship between two correlated variables.

40 20

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

Use a scatter plot

Number of eggs in brood

`` The two variables are inter-dependent but there is no manipulated variable

Use to illustrate the response to a manipulated variable.

`` Both variables are continuous

Line connecting points

No Cla t fo ssr r o Us om e

`` The response variable is dependent on the independent variable

Weight (g)

Metabolic rate

`` Both variables are continuous

1 2 3 Body length (mm)

REFER

No Cla t fo ssr r o Us om e

Describing Relationships Between Variables

Key Idea: The relationship between two variables is indicated by the shape and slope of a line drawn between the points. Scatter plots and line graphs show the relationship between two variables (how y is changing relative to x). The relationship may be linear, exponential, or parabolic (U-shaped). Where there is a positive correlation between variables, the line

PR E V ON IEW LY

between the plotted points will slope upward and to the right. A negative correlation is shown by a line that slopes downwards and to the right. A horizontal line indicates no relationship between variables. Terms indicating the rate of change between variables, such as sharply, gradually, or constantly, help describe the nature of the relationship.

Windspeed

(f) Population number vs time

Population number

(e) Enzyme activity vs pH

Enzyme activity

Rate of photosynthesis

Air temperature

Relative humidity

(d) Photosynthetic rate vs light intensity

Light intensity

Mammalian body temperature

(b) Root uptake vs relative humidity

Root water uptake

Transpiration rate

(a) Transpiration rate vs windspeed

Time

1. For each of the graphs (b-f) above, give a description of the slope and an interpretation of how one variable changes with respect to the other. For the purposes of your description, call the independent variable (horizontal or x-axis) “variable X” and the dependent variable (vertical or y-axis) “variable Y”. (a) Slope: Positive linear relationship, with constantly rising slope

Interpretation: Variable

Y (transpiration rate) increases regularly with increase in variable X (windspeed)

(b) Slope:

Interpretation:

(d) Slope:

Interpretation:

(e) Slope:

Interpretation: (f) Slope: Interpretation: WEB

KNOW

LINK

No Cla t fo ssr r o Us om e

Interpretation:

No Cla t fo ssr r o Us om e

10 Mean, Median, and Mode four treatments). In field studies, each individual may be a sampling unit, and the sample size can be very large (e.g. 100 individuals). It is useful to summarise data using descriptive statistics. Descriptive statistics, such as mean, median, and mode, can identify the central tendency of a data set. Each of these statistics is appropriate to certain types of data or distribution (as indicated by a frequency distribution).

PR E V ON IEW LY

Key Idea: Mean, median, and mode are measures of the central tendency of data. The distribution of the data will determine which measurement of central tendency you use. Measures of a biological response are usually made from more than one sampling unit. In lab-based investigations, the sample size (the number of sampling units) may be as small as three or four (e.g. three test-tubes in each of

Variation in data

25 20

Frequency

Whether they are obtained from observation or experiments, most biological data show variability. In a set of data values, it is useful to know the value about which most of the data are grouped, i.e. the centre value. This value can be the mean, median, or mode depending on the type of variable involved (see below). The main purpose of these statistics is to summarise important features of your data and to provide the basis for statistical analyses.

A: Normal distribution

15 10 5

Type of variable sampled

Weight (g)

The shape of the distribution when the data are plotted

Ranked

Qualitative

B: Skewed distribution

Mode

Frequency

Quantitative (continuous or discontinuous)

15 10

Negative skew: the left tail is longer

5 0

Weight (g)

Skewed peak or outliers present

Two peaks (bimodal)

Mean Median

Median

Modes

C: Bimodal (two peaks)

Frequency

Symmetrical peak

The shape of the distribution will determine which statistic (mean, median, or mode) best describes the central tendency of the sample data.

15 10 5 0

Weight (g)

Mean

Median

Definition and use

• The average of all data entries.

• Add up all the data entries.

• Measure of central tendency for normally distributed data.

• Divide by the total number of data entries.

• The middle value when data entries are placed in rank order.

• Arrange the data in increasing rank order. • Identify the middle value. • For an even number of entries, find the mid point of the two middle values.

• A good measure of central tendency for skewed distributions.

Mode

• The most common data value.

• Suitable for bimodal distributions and qualitative data.

Range

Method of calculation

• The difference between the smallest and largest data values.

• Provides a crude indication of data spread.

When NOT to calculate a mean:

In some situations, calculation of a simple arithmetic mean is not appropriate.

No Cla t fo ssr r o Us om e

Statistic

• Identify the category with the highest number of data entries using a tally chart or a bar graph. • Identify the smallest and largest values and find the difference between them.

• DO NOT calculate a mean from values that are already means (averages) themselves.

• DO NOT calculate a mean of ratios (e.g. percentages) for several groups of different sizes. Go back to the raw values and recalculate. • DO NOT calculate a mean when the measurement scale is not linear, e.g. pH units are not measured on a linear scale.

LINK

WEB

DATA

No Cla t fo ssr r o Us om e

Total of data entries

5221

180

Case study: height of swimmers

Data (below) and descriptive statistics (left) from a survey of the height of 29 members of a male swim squad.

PR E V ON IEW LY

Number of entries

Mean

Height of swimmers (in rank order)

174 175 175 175 176 176 176 176 176 177

Height (cm)

Tally

Total

Mode 174 175 185 176 185 177 185 178 186 179 186 180 186 181 188 182 188 183 189 184 185 Median 186 187 188 189

177 177 178 178 178 178 180 180 180 181

Raw data: Height (cm)

1 3 5 3 4 0 3 1 0 0 0 3 3 0 2 1

178 180 180 178 176

177 188 176 186 175 181 178 178 176 175 185 185 175 189 174 186 176 185 177 176 188 180 186 177

1. Give a reason for the difference between the mean, median, and mode for the swimmers' height data:

Case study: fern reproduction

Raw data (below) and descriptive statistics (right) from a survey of the number of sori found on the fronds of a fern plant.

Total of data entries Number of entries

1641 25

sori

Mean

Raw data: Number of sori per frond 60 70 69 64

64 63 59 63

62 70 70 64

68 70 66 63

66 63 61 62

Fern spores

2. Give a reason for the difference between the mean, median, and mode for the fern sori data:

3. Calculate the mean, median, and mode for the data on ladybird masses below. Draw up a tally chart and show all calculations:

Ladybird mass (mg) 10.1 8.0 6.7 9.8 6.2

8.2 8.8 7.7 8.8 8.8

7.7 7.8 8.8 8.9 8.4

Number of sori per frond (in rank order)

Sori per frond

59 66 60 66 61 67 62 68 62 69 63 69 63 70 Median 63 70 63 70 Mode 64 70 64 70 64 71 64

59 60 61 62 63 64 65 66 67 68 69 70 71

Tally

Total

1 1 1 2 4 4 0 2 1 1 2 5 1

No Cla t fo ssr r o Us om e

64 69 71 67

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

11 Spread of Data spread of data around the central measure. The variance (s2) or its square root, standard deviation (s) are often used to give a simple measure of the spread or dispersion in data. In general, if the spread of values in a data set around the mean is small, the mean will more accurately represent the data than if the spread of data is large.

PR E V ON IEW LY

Key Idea: Standard deviation is used to quantify the variability around the central value and evaluate the reliability of estimates of the true mean. While it is important to know the central tendency (e.g. mean) of a data set, it is also important to know how well the mean represents the data set. This is determined by measuring the

Standard deviation

The standard deviation is a frequently used measure of the variability (spread) in a set of data. It is usually presented in the form x̄ ± s. In a normally distributed set of data, 68% of all data values will lie within one standard deviation (s) of the mean (x̄ ) and 95% of all data values will lie within two standard deviations of the mean (left).

Normal distribution

Frequency

20 15

68%

2.5%

95%

x-2s

x -1s

Size class

x +1s

Two different sets of data can have the same mean and range, yet the distribution of data within the range can be quite different. In both the data sets pictured in the histograms below, 68% of the values lie within the range x̄ ± 1s and 95% of the values lie within x̄ ± 2s. However, in B, the data values are more tightly clustered around the mean.

x+2s

Histogram A has a larger standard deviation; the values are spread widely around the mean.

Histogram B has a smaller standard deviation; the values are clustered more tightly around the mean.

Both plots show a normal distribution with a symmetrical spread of values about the mean.

Frequency

Calculating s Standard deviation is easily calculated using a spreadsheet.

2.5%

68%

2.5%

95%

x -1s

x +1s

x+2s

NOTE: you may sometimes see the standard deviation equation written as:

Birth weights (kg)

3.740

3.810

3.220

3.830

2.640

3.135

3.530

2.980

3.090

3.350

3.830

1.560

3.780

3.840

3.910

3.260

4.710

4.180

3.800

4.050

3.095

x-2s

∑(x – x̄)2

x -1s

1. Two data sets have the same mean. The first data set has a much larger standard deviation than the second data set. What does this tell you about the spread of data around the mean in each case? Which data set would be most reliable?

2. The data on the left are the birth weights of 40 newborn babies.

(a) Calculate the mean for the data:

(b) Calculate the standard deviation (s) for the data:

4.560

3.150

4.400

3.380

3.400

3.770

3.690

3.380

3.825

1.495

3.260

(d) What percentage of values are within 1s of the mean?

(e) What does this tell you about the spread of the data?

2.660

3.130

3.840

3.400

3.630

3.260

x+2s

This equation will give you the same answer as the first equation (above), but the first equation is often used because it is easier to calculate.

4.170

3.570

x +1s

No Cla t fo ssr r o Us om e

x-2s

95%

LINK

APPC 12

WEB

DATA

12 Detecting Bias in Samples

No Cla t fo ssr r o Us om e

relative to others in the population. Small sample sizes can also bias the results, which may then not accurately reflect the population as a whole. Bias can be reduced by random sampling (sampling in which all members of the population have the same chance of being selected). Using appropriate collection methods and apparatus can also reduce bias.

PR E V ON IEW LY

Key Idea: Sampling method can affect the results of a study, especially if it has an unknown bias. Bias refers to the selection for or against one particular group in such as way it can influence the findings of an investigation. Bias can occur when sampling is not random, and certain members of a population are under- or over-represented

Figure 1. Frequency histogram for the complete perch data set (N= 689) x

x +1s

x+2s

Figure 1. Frequency histogram for the complete perch data set (N= 689)

50 30

x -1s x histogram x +1s x+2s Figurex-2s 1. Frequency for the complete perch data set (N= 689) x -1s

x-2s

40 50 20

x +1s

x+2s

30 20 0

29 33 37 41

20 10

45 49 53 57 61 65 69

Length (mm)

Mean: 48 mm

Frequency

Frequency Frequency

Frequency

Frequency Frequency

Figures 2 and 3 show results for two smaller sample sets drawn from the same population. The data collected in Figure 2 were obtained by random sampling but the sample was relatively small (N = 30). The person gathering the data displayed in Figure 3 used a net with a large mesh size to collect the perch.

1. What do the histogram and summary statistics of figure 1 tell you about the distribution of perch from this sample:

40 30 10

Median: 47 mm

10 Figure 2. Frequency histogram for the7.81 N=30 0 Mode: 45 mm Standard deviation: 41 set 49 53 sampling) 57 61 65 69 45(random 33 37data 25 29 perch Length (mm)

29 33 37 41

Lengthhistogram (mm) Figure 2. Frequency for the N=30 perch data set (random sampling)

1 3

Figure 2. Frequency histogram for the N=30 perch data set (random sampling)

0 2 3

1 2

0 1

2. (a) Compare the results for the two small data sets (Figures 2 and 3). How close are the mean and median to each other in each sample set?

45 49 53 57 61 65 69

40 45 50 Length (mm)

(b) Compare the standard deviation for each sample set:

25 Figure 30 3. 35Frequency 40 45 histogram 50 55for the 60 N=50 65 Length (mm) perch data set (biased sampling)

0 14 25 45 5049.555mm 60 65 Mean:30 49.2335 mm 40 Median: 12 Mode: 38 mm Standard Length (mm) deviation: 11.37 10 Figure 3. Frequency histogram for the N=50 8 perch data set (biased sampling) 6 14 Figure 3. Frequency histogram for the N=50 4 12 perch data set (biased sampling) 2 10 14 0 8 1246 48 50 52 54 56 58 60 62 64 66 68 6 10 Length (mm) 4 8 2 6 0 4 46 48 50 52 54 56 58 60 62 64 66 68 2 Length (mm) 0 46 48 50 52 54 56 58 60 62 64 66 68 Length (mm)

Mean: 61.44 mm Mode: 64 mm

WEB

DATA

Figure 1 shows the results for the complete data set. The sample set was large (N= 689) and the perch were randomly sampled.

LINK

Median: 63 mm Standard deviation: 3.82

LINK

No Cla t fo ssr r o Us om e

Frequency

Frequency Frequency

x -1s

x-2s

This exercise illustrates how random sampling, large sample size, and sampling bias affect our statistical assessment of variation in a population. In this exercise, perch were collected and their body lengths (mm) were measured. Data are presented (left) as a frequency histogram and with descriptive statistics (mean, median, mode and standard deviation).

(d) Why do you think the two smaller sample sets look so different to each other?

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

13 Analysis and Interpretation There are many ways to analyse and present data and your choice must be appropriate for the data you have collected. A statistical analysis is sometimes necessary but for simple, well designed experiments basic descriptive statistics (e.g. means) may be all that is needed. Finally you must choose the best way to display your results (e.g. table or graph) so that you can present your data in an organised way.

Review your initial data

How do I analyse my data?

PR E V ON IEW LY

Key Idea: Once you have collected your data you must select an appropriate form of analysis to establish if your hypothesis is supported and identify any trends or patterns in the data. Data analysis involves examining and processing the data you have collected to identify trends and patterns and establish whether or not the data support your hypothesis and help to answer the questions you posed in your investigation.

►► After you have collected your first set of data (or your preliminary data) it is a good idea to spend a short period of time analysing it.

►► Check your data to see that it makes sense. Do the results seem logical? Are there any outliers? If so, you must decided whether to include them in your analysis.

►► You may discover that you need to collect your data differently to how you first planned (e.g. taking more measurements or changing the way you collect your data, such as automation for rapidly occurring changes or prolonged time series data).

►► Raw data may need to be transformed to see trends and patterns. Recall that these transformations are often quite simple (e.g. percentages, rates, ratios). Other transformations are used to normalise the data so that it can undergo further analysis (e.g. log transformations when working with large numbers).

►► Take some time to plot the data or calculate summary statistics as these will allow you to see trends and patterns more easily than when the data is recorded in a log book. Once you are satisfied that your methods of data collection are adequate you can continue with your investigation.

►► Descriptive statistics (e.g. mean and standard deviation) provide a way to summarise your data, and provide results that can easily be presented and compared across groups. Summary statistics are also useful in identifying trends and patterns in the data.

►► Sometimes an appropriate statistical analysis is required to test the significance of results. However, with simple experiments, if the design is sound, the results are often clearly shown in a plot of the data.

Presenting your data

Tables and graphs provide a way to organise and visualise data in a way that helps to identify trends. Each has a different purpose. Tables provide an accurate record of numerical values and allow you to organise your data so that relationships and trends are apparent. Graphs provide a visual representation of trends in the data in a minimum of space and are an excellent choice for displaying results in a poster or report. Histograms, line graphs, and scatter graphs are common ways to graphically display data. The graph and table below display the same data.

Temperature (°C)

Rate of reaction (mg product formed per minute)

1.0

2.1

3.2

3.7

4.1

3.7

2.7

Enzyme A reaction rate vs temperature

No Cla t fo ssr r o Us om e

Activity of enzyme A at different temperatures

Reaction rate (mg product formed min-1)

Temperature ( C) o

LINK

APPC 11

LINK

KNOW

A student carried out an experiment to measure the activity of enzyme A at three temperatures. They measured the amount of product formed to determine the enzyme activity at each temperature. They performed one trial (n = 1) for each temperature. The results are shown below.

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

Effect of temperature on volume of product formed by enzyme A (mg ml-1)

Time (min)

2°C

40°C

80°C

The student noticed an outlier in their data.

1. Why is it a good idea to review your preliminary data before proceeding with the investigation?

2. The student noticed they had an outlier in the data for enzyme activity at 40°C. (a) They decided not to include the outlier in their results. Do you agree with their decision?

(b) Why or why not?

3. (a) The student tested enzyme activity at each temperature once. What are the limitations of carrying out a single trial?

(b) What additional data analysis could the student carry out if they ran multiple trials?

4. (a) Why are data often presented as tables or graphs?

No Cla t fo ssr r o Us om e

(b) How would you recommend the student presents their data on their scientific poster?

No Cla t fo ssr r o Us om e

14 Interpreting Results of a Fair Test Key Idea: A fair test is when only one variable is changed and all other variables are kept constant. Conclusions based on results are more likely to be valid when the test is fair.

PR E V ON IEW LY

The experiment below describes a fair test for analysing the effect of urea on duckweed growth. Use this activity to test your knowledge about how to analyse and interpret results.

The aim

To investigate the effect of urea concentration on the growth of duckweed (Lemna minor).

Background

Leaves

Duckweed is a small plant commonly found floating in the water of drains and pond edges. There are many species of duckweed. The most common species in New Zealand is Lemna minor. It is a small (1-3 mm), freefloating plant with 2-4 leaves held flat against the water's surface and a single root. Lemna minor grows very rapidly. In ideal conditions doubling time is as little as three days.

Image: Kjetil Lenes

Roots

Lemna minor (common duckweed)

Experimental method

Solutions of urea were made up to concentrations of 3 x 10-2, 3 x 10-3, 3 x 10-4, and 3 x 10-5 mol L-1. For each urea concentration, 80 mL of the appropriate solution was pipetted into three separate beakers. Ten duckweed plants, each with one leaf, were placed in each beaker. The beakers were arranged randomly and placed together in direct sunlight. The number of plants in each beaker was counted and recorded eight times over the next three weeks.

No. of leaves

3 x10-2

3 x10-3

3 x10-4

3 x10-5

Ten plants, each with one leaf, in each beaker

Day 9

No. of leaves

Dilute urea solution

Day 5

No. of leaves

3 x10-3

3 x10-4

3 x10-5

Day 8

3 x10-2

3 x10-3

3 x10-4

3 x10-5

Day 12

3 x10-2

Day 18

100 mL

3 x10-3

3 x10-4

3 x10-5

No. of leaves

Day 15

3 x10-3

3 x10-4

3 x10-5

No. of leaves

3 x10-2

3 x10-3

3 x10-4

3 x10-5

Day 21

No. of leaves

3 x10-2

3 x10-3

3 x10-4

3 x10-5

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

3 x10-2

No. of leaves

No Cla t fo ssr r o Us om e

Day 1

Duckweed plants

3 x10-2

3 x10-3

3 x10-4

3 x10-5

LINK

Data provided by F. Hicks

WEB

DATA

1. Use the raw data on the previous page to complete the table below:

No Cla t fo ssr r o Us om e

Day 1

Day 5

Day 8

Day 9

Day 12

Day 15

Day 18

Day 21

PR E V ON IEW LY

Concentration of urea

Mean number of leaves

3 x 10-2 mol L-1

3 x 10-3 mol L-1 3 x 10-4 mol L-1 3 x 10-5 mol L-1

2. Plot the average number of leaves per day for each concentration on the grid below:

3. (a) Describe the results of the investigation:

(b) How could you test if the results are significant?

No Cla t fo ssr r o Us om e

4. Write a brief discussion for the investigation. Include discussion on the biological relevance of the investigation and an evaluation of the reliability of the results:

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

15 Pattern-seeking: Investigating Distribution Key Idea: Sampling populations in-situ can reveal patterns of distribution, which can be attributed to habitat preference. These investigations are common in ecological studies.

PR E V ON IEW LY

Use this activity to practise analysing data from a field study in which the aim was to identify and describe an existing pattern of species distribution.

The aim

To investigate the effect of fallen tree logs on the distribution of pill millipedes in a forest.

Background

Millipedes consume decaying vegetation and live in the moist conditions beneath logs and in the leaf litter of forest floors. The moist environment protects them from drying out as their cuticle is not a barrier to water loss.

Experimental method

Giant pill millipede (Procyliosoma tuberculata)

The distribution of millipede populations in relation to fallen tree logs was investigated in a small forest reserve. Six logs of similar size were chosen from similar but separate regions of the forest. Logs with the same or similar surrounding environment (e.g. leaf litter depth, moisture levels) were selected. For each log, eight samples of leaf litter at varying distances from the fallen tree log were taken using 30 cm2 quadrats. Samples were taken from two transects, one each side of the log. The sample distances were: directly below the log (0 m), 1.5 m, 2.5 m, and 3.5 m from the log. It was assumed that the conditions on each side of the log would be essentially the same. The leaf litter was placed in Tullgren funnels and the invertebrates extracted. The number of millipedes in each sample was counted. The raw data are shown below.

Experimental setup

3.5

TRANSECT 1

TRANSECT 2

Distance from log / m

2.5

1.5

2.5

3.5

Tree log

Centre-line of log (where possible)

cm2

30 quadrats

Environmental conditions for each transect position either side of the log were assumed to be equal.

Raw data for tree log and millipede investigation

Distance from log (m)

Transect

1.5

2.5

3.5

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

Tree log Transect 4

1.5

2.5

3.5

No Cla t fo ssr r o Us om e

Tree log

LINK

APPC 10

LINK

DATA

No Cla t fo ssr r o Us om e

1. Plot column graphs on the grids below to show the distribution of millipedes at each log. Plot transect 1 and 2 data separately but side by side for each graph: Log 2

Log 3

PR E V ON IEW LY

Log 1

Log 4

Log 5

Log 6

2. (a) Is there a relationship between distance from the tree log and the number of millipedes found?

(b) What physical factors might account for this?

(a) Do you think this assumption is valid?

(b) Explain you reasoning:

No Cla t fo ssr r o Us om e

3. During this study, an assumption was made that the environmental factors were the same on each side of the log.

4. (a) Using pooled data at each distance, how could you use the data to test if the differences in millipede numbers with distance from the log were significant? Explain your choice:

(b) Complete your test using a spreadsheet or on a separate sheet of paper and attach it to this page.

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

16 A Template for Your Investigation It may be a lab based fair test or a field study. For each of the stages of your investigation, create notes to help provide a structure to your final report. They will act as a checklist to ensure you have not forgotten anything.

PR E V ON IEW LY

Key Idea: Careful planning and execution are essential to carrying out a valid scientific investigation. Use the following template as a guide to help you carry out your own investigation relating to the survival of an organism.

Aim:

What do you want to investigate? Talk to your teacher about your project. Do you have the equipment and time to do this topic?

Background research:

Research hypothesis:

Prepare well so that you have a good knowledge of the topic before you begin. Consult the web, journals, textbooks and people with expertise in your topic.

This is a proposed explanation for your observations that is usually stated along with a testable prediction, e.g. if plants need light to photosynthesise, they will grow more vigorously in the light than in the dark.

Design of the investigation and method:

No Cla t fo ssr r o Us om e

Outline the basic design of your investigation. If your investigation is an experiment, make sure it a fair test, in which you change only one independent variable to see the effect on the dependent variable (response) you are interested in.

Write the method out as a procedure that someone else could follow to get the same results. If your investigation is an experiment, think about sample size and controls. If it is field based, consider sample size and size of your sampling unit (e.g. quadrat size). What type of data will you collect?

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

WEB

KNOW

26 Record your data in a table, logbook, or spreadsheet as you collect it. Does the data make sense (does it help answer the question you have asked)?

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

Data collection:

Results (data analysis and presentation):

Note any problems with the method, or any changes you made as you worked through the investigation.

Decide how to present and summarise your results (e.g. table or graph). Are there any outliers? If so, should you include these in the analysis? Why or why not? Include measures of variability to help you evaluate the reliability of your data. Will you use a statistical test?

Discussion:

Discuss your findings. Use key facts from the background information to explain your results (including unexpected ones). How could your method have been improved?

References & acknowledgements:

Your conclusions summarise how your results support or contradict your hypothesis.

No Cla t fo ssr r o Us om e

Conclusion:

Include all of your sources of information as a reference list or bibliography. Your teacher will tell you what format to use.

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

Response to a socioscientific issue

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

Achievement Standard

3.2

Key terms bias

Socio-scientific issues are controversial social issues relating to science. They are open-ended problems with (potentially) multiple solutions. Developing a coherent understanding of a socioscientific issue involves applying both scientific and moral reasoning to a real-world situation.

biological implication

Achievement criteria and explanatory notes

reliability

Achievement criteria for achieved, merit, and excellence

socio-scientific issue

Integrate biological knowledge to develop an informed response to a socio-scientific issue: Present a personal position, developed using relevant biological knowledge and propose action(s) at a personal and/or societal level.

Integrate biological knowledge to develop a reasoned informed response to a socio-scientific issue: Explain why the position and the action(s) have been chosen.

Integrate biological knowledge to develop a comprehensive informed response to a socioscientific issue: Justify the personal position and proposed action(s) by analysing and evaluating the biological knowledge relating to the issue. This may include: Comparing the significance of implications of the proposed action(s) Considering the likely effectiveness of the proposed action(s) Commenting on sources and information, considering validity (currency, peer review status, scientific acceptance) and bias (attitudes, values, beliefs).

validity

iii

Explanatory notes: Response to a socio-scientific issue An informed response requires you to understand these termsâ&#x20AC;Ś

Integrate means to select and collate relevant biological knowledge to develop an informed response (presenting a personal position and proposing actions).

A socio-scientific issue has both biological and social implications. It is one about which people hold different opinions or viewpoints. Social implications may be economic, ethical, cultural, or environmental.

Biological knowledge includes (i) biological concepts and processes relating to the issue, (ii) biological and social implications (iii) differing opinions or viewpoints.

What you need to know for this Achievement Standard Activities 17â&#x20AC;&#x2030;-â&#x20AC;&#x2030;20

No Cla t fo ssr r o Us om e

social implication

By the end of this chapter you should be able to:

Choose an issue that has a range of current, published material available from people or groups with different viewpoints. It should be relevant to New Zealand or the Pacific region.

Use a range of sources to acquire current information on the issue of your choice.

Determine the relevant biological and social implications of your chosen issue.

Present your research notes and copies of research material if required. These should be organised in a logbook (or similar). Record all sources of information in a bibliography.

Critically evaluate sources of information for validity and bias.

Use your biological knowledge to present and justify a personal position and to propose and justify actions that you and/or society could take to address the problems raised by this issue.

No Cla t fo ssr r o Us om e

17 Examples of Socio-Scientific Issues Some examples of socio-scientific issues are presented below.

PR E V ON IEW LY

Key Idea: Socio-scientific issues are topics which have both biological and social implications.

Consequences of socioscientific issues:

Socio-Scientific Issues are often controversial subjects and can be very emotive topics because they deal not only with the scientific issues, but also involve ethical, societal, cultural, and environmental considerations.

ffSocial impact: The effects on cultural

beliefs, lifestyle choices, or confidence in the scientific basis of a process.

ffEconomic impact: Fear that the

issue may have negative impact on the nation’s economy as a whole, or disadvantage a particular region or segment of the population.

ffEthical implications: Effect on the

cultural beliefs or lifestyle choices.

ffEnvironmental impact: Concern

that the issue creates detrimental implications for the health of the environment, such as a toxic effect, destruction of habitat, or loss of biodiversity.

ffBiological implications: Concern

Immunisation: Immunisation reduces the incidence of specific diseases. Some people worry about the side effects. Should vaccination be compulsory?

Global warming: Atmospheric pollution from some human activities causes the greenhouse effect. This may impact on ecosystems, society, and economies.

GMO crops / food: Concern over the safety of GMO products entering the human food chain. Danger of GM crops spreading genes into wild populations.

Possum control: 1080 is used to control possum numbers. Its use has biological, environmental, and social issues that must be considered.

Xenotransplantation: Pigs are being used as organ donors for humans. Concerns relate to disease transmission and animal welfare issues.

Hormone growth promoters (HGPs): HGPs are used to enhance meat production. Some people worry there may be adverse health effects.

Fish farming: Provides food for a growing population, but issues include animal welfare, drug use to control disease, and gross feed inefficiencies.

Whaling: Concern over depletion of whale species. How could depletion of whale numbers affect New Zealand's marine ecosystem?

Stem cell research: New tissues may be grown from embryonic stem cells. This offers possibilities for many medical treatments, but raises ethical issues.

Cloning: Cloning may meet human needs or improve commercial gain, but raises animal welfare issues.

Reproductive technology: New technologies give better control over the reproductive process, but raise many ethical issues.

WEB

REFER

LINK

No Cla t fo ssr r o Us om e

EII

that biological systems may become unbalanced (e.g. biodiversity, ecological stability).

No Cla t fo ssr r o Us om e

18 Genetic Screening lead to disease. Genetic screening can provide information to diagnose, treat, and prevent some diseases. It is controversial because it can be used on embryos, fetuses, children, and adults and so has many moral, ethical, and scientific issues associated with its use.

PR E V ON IEW LY

Key Idea: Genetic screening involves analysing a person's DNA to determine if they have the gene (or genes) associated with a particular inherited disorder. Genetic screening (or genetic testing) involves examining a person's DNA to look for altered genes (mutations) that may

USAF

Dr David Wells - Ag Research

Why carry out genetic screening?

Preimplantation testing: Embryos produced by in vitro fertilisation (IVF) are tested for genetic abnormalities to ensure only healthy embryos are transplanted into the mother.

Prenatal testing: A fetus can be tested for genetic disorders. Disorders such as Down syndrome and trisomy 18 are often first detected by ultrasound, and then confirmed using genetic testing.

Newborn screening: New-born babies are screened for a range of metabolic disorders, such as phenylketonuria (PKU). If a disease is detected, treatment can begin immediately and the outcome is improved.

Carrier testing: A person with a family history for a disease (e.g. cystic fibrosis) may want to be tested to see if they carry the gene for that disease. The result may influence whether they have children or not.

Diagnostic testing: A person may have symptoms typical of a particular genetic disorder. Genetic screening is used to determine if the person has the gene associated with a particular disease or not.

Pharmacogenetics: Genetic screening can be used to help decide what type, or dose, of medicine will be best for an individual. Targeted treatment can increase the chances of the medicine working.

Genetic screening in New Zealand

When a chromosomal abnormality (such as Down syndrome) is suspected from the results of a prenatal ultrasound, the parent(s) may elect to have a chromosome test (karyotype) to confirm the diagnosis. In the case of Down syndrome, there would be an extra chromosome 21 present (far right).

Some cancers (such as breast cancer) have a strong familial (inherited) link. The Genetic Health Service may conduct surveys and genetic tests in families where there may be a heredity link. If women test positive for a breast cancer gene, they may undergo more frequent screening to increase the chance of early detection. In some cases they may opt to have their breasts surgically removed to reduce their chance of developing cancer.

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

The karyotype (right) shows this individual has Down syndrome (Trisomy 21).

No Cla t fo ssr r o Us om e

In New Zealand, genetic screening tests, like the ones described above, are carried out by the Genetic Health Service and the National Screening Unit.

Tumour

This mammogram (left) shows the presence of a tumour in the breast. Women with increased genetic risk of getting breast cancer may be screened more often than the general population.

LINK

WEB

REFER

19 Evaluating the Information

No Cla t fo ssr r o Us om e

because there are two or more, often very different, opinions involved, and it can sometimes be difficult to determine which information is based on scientific data and which is not. The information in this activity outlines some of the main arguments about genetic screening and provides links to other resources. While evaluating the information you must use your biological knowledge to evaluate the quality of the information. Some points to consider are presented below.

PR E V ON IEW LY

Key Idea: The evaluation of biological information requires critical analysis of its validity and bias. Biology Achievement Standard 3.2 requires you to develop an informed response to a socio-scientific issue, and present your personal view on the topic using your biological knowledge to justify your position. In order to do this, you must review a range of information related to your chosen topic. Socio-scientific issues can be very difficult to research

Points to consider when evaluating biological information

ffIn order to form an opinion about a socio-scientific issue, you must use your biological knowledge to critically evaluate information. Some points to consider include:

ffValidity of the information.

• The currency of the information. Is it up to

date?

• Is the information peer reviewed? • Has the information been accepted by the

scientific community?

ffDoes the information present an unbiased view? • Is information presented in a fair and unbiased way?

• Is the information presented clouded by the attitudes, beliefs, or values of the person or group providing the information? • The information presented must be based on fact and not emotions.

Keep a log book or portfolio of the information you have reviewed. This will be used by your teacher to verify you have sufficiently researched the topic, and that the work you submit is your own.

It is important to remember that not all biological information presented to the public is peer reviewed (reviewed by experts). Sometimes the information presented may be inaccurate (containing scientific errors) or biased (only one view is presented). It is important to use your own biological knowledge to critically review and analyse information for biological validity.

The socio-scientific issues of genetic screening

Arguments against genetic screening

Testing allows potential carriers to be screened for a disease so they can decide whether they have children or not. This is important for diseases that do not show any symptoms until later in life (e.g. Huntington's disease).

Genetic tests can only tell you if you carry a gene for an associated disorder. They cannot predict when and if you will develop the disease, or to what extent. Testing therefore carries the risk of causing unnecessary anxiety.

Researchers can study individuals with the gene(s) associated with a disease and this may help them to develop a treatment or cure for that disease.

An individual's privacy may be compromised by testing. The knowledge that you may develop a genetic disorder in the future could be used against you (e.g. medical insurance could be declined or an employer may no longer want to employ you).

Knowing a person's genetic make-up can be used to optimise drug therapies and improve treatment outcomes.

Knowing the risk of developing a disease allows informed decisions to be made about medical options. For example, breast cancer can be treated, so an individual may decide to increase screening to increase the chance of early detection. They may choose to reduce risk factors (e.g. breast removal if they are at high risk of developing breast cancer).

The discovery of a genetic defect in an unborn child provides an opportunity to come to terms with the situation and prepare for the delivery and ongoing care of a special needs baby/child.

WEB

REFER

No Cla t fo ssr r o Us om e

Arguments for genetic screening

Designer babies could be produced where parents pick certain characteristics they want their child to have. This is already seen in countries where more value is placed on the birth of a boy child than a girl, and unwanted female fetuses are terminated.

The discovery of a genetic defect in an unborn child may lead to the decision to terminate the pregnancy, an action some people believe is morally wrong because they feel it devalues human life.

No Cla t fo ssr r o Us om e

Searching for genetic screening information Genetic screening http://www.youtube.com/watch?v=ICdWvlZFkdE

PR E V ON IEW LY

There are many resources (journal articles, blogs, news articles, and videos) available on the internet about genetic screening. The video clips listed on the right provide some background information as well as introducing some of the ethical issues associated with this topic. Some New Zealand clips have been included. Use the search tips below to streamline your internet search.

Background information on genetic screening can be obtained by typing "genetic screening" or "genetic testing" into your search engine. For specific information about genetic screening in New Zealand, use the search term "genetic screening in New Zealand" or "genetic testing in New Zealand".

To search for articles relating to the ethics of genetic screening, use the search term "ethics of genetic screening".

As genetic screening becomes more commonplace, news relating to it is often reported in mainstream media such as television, internet, and print. The newspaper article below is fictitious, but is based on information that has appeared recently in mainstream media. It will give you an idea of the type of information you are likely to find during your research. Use this article to practise your

Living with uncertainty The Newspaper

The View: genetic testing http://www.youtube.com/watch?v=nPxTOIpcOm4 Benefits and limitations of genetic testing https://www.youtube.com/ watch?v=MuoXaZ4LHtU Benefits and limitations of genetic testing https://www.youtube.com/watch?v=M7XbrwdGws

Genetic test could screen for asthma http://www.3news.co.nz/Genetic-test-couldscreen-for-asthma/tabid/423/articleID/303116/ Default.aspx#.Uo1L_-Dxbrk

critical evaluation of information about genetic screening. Read the article and decide whether you think the view it presents is balanced or biased. Use your biological knowledge to determine if the information contained in the article is based on scientific evidence, or statements that are unsupported by fact.

The newspaper, author name, and names used in this article are fictitious, but the text is based on real events and information.

By Sarah McKinney: 09 February 2013

People who are told they have genes for potentially fatal diseases, but don't show any symptoms, are called patientsin-waiting. This situation is causing many unforeseen consequences. In New Zealand, new-born babies are routinely screened for a number of genetic disorders, including cystic fibrosis (CF), a disease that affects one in every 3500 New Zealand babies. In 2009, newborn Amy Jones' blood sample tested positive for genetic changes associated with CF. She was intensely monitored, and attended regular checkups at the hospital to assess her condition. For over two years no symptoms developed, so further tests were ordered which came back negative for the CF gene. However it hasn't stopped her parents worrying that CF could still develop. Amy's mother did not return to paid work after Amy's diagnosis. She and her husband worried that if Amy was

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

placed in daycare she would pick up normal childhood infections, which could develop into life-threatening respiratory infections if a person had CF. Amy is now four years old, and still has no symptoms, but her parents feel like they are sitting on a time bomb, constantly wondering if she will develop CF.

Amy's tests were carried out by an approved laboratory using accredited tests, but many direct-to-consumer tests being sold over the internet are not clinically validated. These tests may not accurately predict disease, and the result may mean many people are making decisions based on the occurrence of a disease that may never eventuate.

No Cla t fo ssr r o Us om e

Genetic testing, analysis of a person's DNA to detect the presence of a gene associated with a particular disease, was once limited to medical professionals. Today, access to gene testing is widespread and relatively inexpensive. Many companies sell gene testing kits directly to the public. A customer sends a cheek or saliva swab to the laboratory for analysis, and they receive a report about their genetic risk of a certain disease. However, as more people find that they carry potentially dangerous genes, many are left in limbo, waiting for a disease that may not occur.

Ryan Anderson, a bioethics expert in the field of genetic screening, urges consumers to consider the confidentiality and privacy issues associated with genetic testing. Mr Anderson has concerns that health and life insurance providers will soon be able to ask their clients to routinely undergo genetic testing, and use the information to grant or deny cover and set the cost of that cover. This approach will disadvantage many people who may have a gene for a specific disease, but who will not develop that disease. Until researchers find a way to accurately predict the occurrence and onset of genetic diseases, many people like Amy are waiting in limbo looking for signs of a disease that may not emerge .

20 Presenting Your Findings

No Cla t fo ssr r o Us om e

 How does your topic affect New Zealand or the Pacific region?

PR E V ON IEW LY

Key Idea: You must use evidence to justify the stance you have taken on your topic. Once you have analysed the information on your chosen socioscientific issue, you must plan your presentation. You must include your personal views on the topic, and justify why you have taken the stance you have. You must propose actions on how to deal with the issue both at a personal level, and at societal level.

WEB

REFER

 Using your biological knowledge, present you personal opinion on the subject. • Propose actions that could be taken by you, or society, to address the problems raised by this socio-scientific issue.

 Use evidence to explain why you have taken the position you have.

 Critically analyse and evaluate the information related to your issue: • Compare the biological and social implications. • Consider the effectiveness of the proposed actions. • Is the information you have reviewed valid and unbiased?

No Cla t fo ssr r o Us om e

Use bullet points to capture your ideas in the space below. These will provide the scaffold on which to structure your presentation. The list (right) provides key points that should be included in your presentation.

 Outline the relevant biological knowledge: • What are the biological implications of the topic? • What are the social implications? Consider the economic, ethical, cultural, and environmental effects. • What opinions do New Zealanders have about the topic? Is there any bias associated with different people's/group's opinions?

Maintaining a stable internal environment

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

Achievement Standard

3.4

Key terms

Homeostatic mechanisms help the body maintain a constant internal environment, even when external conditions are changing. Homeostasis makes it possible to carry out essential life processes.

Common terms effectors

homeostasis

Achievement criteria and explanatory notes

hormones

Achievement criteria for achieved, merit, and excellence

hypothalamus

Demonstrate understanding of how an animal maintains a stable internal environment: Use biological ideas to describe a control system by which an animal maintains a stable internal environment. Use annotated diagrams or models to support your description.

Demonstrate in-depth understanding of how an animal maintains a stable internal environment: Use biological ideas to explain how or why an animal maintains a stable internal environment. Include reference to how a specific disruption results in responses that reestablish homeostasis.

Demonstrate comprehensive understanding of how an animal maintains a stable internal environment: Link biological ideas about maintaining a stable internal environment in an animal. Include at least one of: • The significance of the control system in terms of adaptive advantage. • The processes underpinning the mechanism (e.g. metabolic pathways). • An example of how environmental influences result in system breakdown.

negative feedback neurones

positive feedback receptors

Thermoregulation hyperthermia hypothermia

thermoregulation Blood glucose regulation blood glucose

diabetes mellitus glucagon insulin

EII

Osmotic balance and blood pressure

Principles of homeostasis

acid-base balance

Homeostatic systems involve the following biological principles

adrenal cortex

Several mechanisms are common to homeostatic systems. An understanding of these will help you describe and explain your chosen examples.

aldosterone ADH

blood pressure

Negative feedback mechanisms have a stabilising effect and are self correcting.

electrolyte

Positive feedback mechanisms amplify a response to achieve a specific outcome.

kidney

Nervous and hormonal controls are both involved in homeostatic systems.

osmoreceptors

You must choose at least one homeostatic system

osmotic balance

For the system you choose, describe the role of the system, its components, and the mechanisms involved in regulation. Homeostatic systems include:

Body temperature (thermoregulation).

renin-angiotensin system

bicarbonate

breathing rate

chemoreceptors haemoglobin heart rate

21 - 23 24

25 35

Activity number

No Cla t fo ssr r o Us om e

Explanatory notes: Control systems

osmoregulation

Regulation of respiratory gases

Activity number

27 - 29

35 - 38

Blood glucose.

Blood pressure.

Osmotic balance (fluid and electrolytes).

Level and balance of respiratory gases in tissues.

55 - 59 61

For the homeostatic system of your choice, describe the effects of disruption to normal regulation by internal or external influences. These may include extreme environmental conditions, exertion, infection, drugs or toxins, or internal failures such as genetic conditions or metabolic disorders.

30 - 33 39 - 42 50 52 53 60 62 - 65

44 51

45 - 49

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

What you need to know for this Achievement Standard Principles of homeostasis Activities 21 - 26, 35

By the end of this section you should be able to:

Explain what is meant by homeostasis and describe why it is important.

Define negative feedback and explain how it stabilises systems against excessive change.

Use examples to explain the role of receptors, effectors, and negative feedback in homeostasis.

Define positive feedback and explain its destabilising effect and its role in some physiological processes. Describe an example of positive feedback and explain how the feedback loop ends.

Use examples to explain how homeostatic processes are regulated through hormones and/or nerves. Contrast the action of nerves and hormones in physiological processes.

Regulating body temperature Activities 27 -34, 62 - 63

By the end of this section you should be able to:

Explain what is meant by thermoregulation and explain why it is necessary.

Explain thermoregulation in humans in response to changing conditions (including exercise). Include the role of the hypothalamus, skin, blood vessels, hormones, and muscular activity.

Describe disruptions to normal thermoregulation, including hyperthermia, hypothermia, and thyroid malfunctions. Identify causes and describe factors that may increase risk in each case.

Regulating blood glucose Activities 35 -43, 62 - 63

By the end of this section you should be able to:

Explain what is meant by blood glucose and why it needs to be regulated within narrow limits.

Explain how blood glucose is regulated, with reference to the hormones insulin and glucagon.

Explain how cells take up and respond to insulin.

Describe the role of the liver in carbohydrate metabolism and blood glucose regulation.

Describe disruptions to normal blood glucose regulation, e.g. types 1 and 2 diabetes mellitus, and the effect of recreational drugs such as alcohol and nicotine.

Regulating blood pressure and osmotic balance Activities 44 -54, 62 - 63

By the end of this section you should be able to:

Define the terms osmoregulation and osmotic balance. Explain why regulating fluid levels (including blood volume) and electrolytes is so important.

Explain what is meant by blood pressure and describe its main determinants with reference to cardiac (heart) output, resistance of the blood vessels (peripheral resistance) and blood volume.

Outline the homeostatic role of the kidney in regulating the body's levels of fluid and electrolytes.

In more detail, describe the structure and function of the kidney nephron, including the role of ultrafiltration, secretion, and reabsorption in formation and modification of the filtrate (urine).

Explain how urine volume, blood volume, and levels of electrolytes are regulated in response to the demands of normal activity (eating, drinking, exercise), including: i The role of hypothalamic osmoreceptors and antidiuretic hormone (ADH). ii The role of aldosterone and its regulation through the renin-angiotensin system.

Describe disruptions to the normal mechanisms regulating osmotic balance and blood pressure.

Regulating respiratory gases Activities 55 -61, 62 - 66

By the end of this section you should be able to:

No Cla t fo ssr r o Us om e

Identify respiratory gases in humans and state how they are exchanged with the environment.

Explain why levels of respiratory gases in the tissues must be regulated. Explain how this is achieved with reference to transport of both oxygen and carbon dioxide.

Explain the connection between gas transport and blood pH. Explain how the body's acid-base balance is regulated through the bicarbonate buffer system, respiratory, and renal controls.

No Cla t fo ssr r o Us om e

21 Homeostasis

PR E V ON IEW LY

Key Idea: Homeostasis refers to the (relatively) constant physiological state of the body despite fluctuations in the external environment. Organisms maintain a relatively constant physiological state, called homeostasis, despite changes in their environment. Any change in the environment to which an organism responds is called a stimulus and, because environmental stimuli are not static, organisms must also adjust their behaviour and physiology constantly to maintain homeostasis. This requires the coordinated activity of the body's organ systems. Homeostatic mechanisms prevent deviations from the steady state and keep the body's internal conditions within strict limits. Deviations from these limits can be harmful. An example of homeostasis occurs when you exercise (right). Your body must keep your body temperature constant at about 37.0Â°C despite the increased heat generated by activity. Similarly, you must regulate blood sugar levels and blood pH, water and electrolyte balance, and blood pressure. Your body's organ systems carry out these tasks. To maintain homeostasis, the body must detect stimuli through receptors, process this sensory information, and respond to it appropriately via effectors. The responses provide new feedback to the receptor. These three components are illustrated below.

How homeostasis is maintained Muscles and glands

Sense organ (e.g. eye)

Receptor

Effector

Detects change and sends a message to the control centre.

Responds to the output from the control centre.

Brain and spinal cord

Control centre

Receives the message and coordinates a response. Sends an output message to an effector.

The analogy of a thermostat on a heater is a good way to understand how homeostasis is maintained. A heater has sensors (a receptor) to monitor room temperature. It also has a control centre to receive and process the data from the sensors. Depending on the data it receives, the control centre activates the effector (heating unit), switching it on or off. When the room is too cold, the heater switches on. When it is too hot, the heater switches off. This maintains a constant temperature.

2. What is the role of the following components in maintaining homeostasis:

(a) Receptor:

(b) Control centre:

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

1. What is homeostasis?

LINK

WEB

KNOW

22 Maintaining Homeostasis

No Cla t fo ssr r o Us om e

organ systems working together to ensure proper functioning of the whole organism. Most of the time an organism's body systems are responding to changes at the subconscious level, but sometimes homeostasis is achieved by changing a behaviour (e.g. finding shade if the temperature is too high).

PR E V ON IEW LY

Key Idea: The body's organ systems work together to maintain homeostasis. Homeostasis relies on monitoring all the information received from the internal and external environment and coordinating appropriate responses. This often involves many different

Regulating respiratory gases

Oxygen demand changes with activity level and environment (e.g. altitude).

Coping with pathogens Lymph tissue

CO2 production changes with activity level and environment.

Attack by pathogens inhaled or eaten with food and drink.

Capacity for O2 transport depends on blood haemoglobin.

Infections of the reproductive system (STIs) from yeasts, viruses, and bacteria.

Muscular activity increases oxygen demand and carbon dioxide production.

Attack on skin and mucous membranes from fungal pathogens.

All of us are under constant attack from pathogens (disease-causing organisms). Several body systems help to prevent the entry of pathogens and limit the damage they cause if they do enter the body. The skin, digestive system, and immune system are all involved in internal defence, while the cardiovascular and lymphatic systems circulate the immune cells and antimicrobial substances involved.

Maintaining nutrient supply and removing wastes

Digestion in the gut provides the building materials for the body to grow and repair tissue.

Water must be reabsorbed from the digested material.

The solid waste products of digestion must be eliminated. Nitrogenous wastes from protein metabolism are excreted by the kidney in the urine.

Food and drink provides energy and nutrients, but supply is pulsed at mealtimes with little in between. Metabolism generates waste products, including urea, which is formed in the liver and excreted by the kidneys.

Food and drink are taken in to maintain energy supplies. The digestive system makes these nutrients available and the cardiovascular system distributes them to the tissues. Food intake is regulated largely through nervous mechanisms, while hormones control the cellular uptake of glucose. The liver metabolises proteins to form urea, which is excreted by the kidneys. WEB

KNOW

Repairing injuries

Wounds result in bleeding. Clotting begins soon after and phagocytes prevent the entry of pathogens.

Muscle and tendon injuries through excessive activity.

Hernias can be caused by strain as in heavy lifting.

No Cla t fo ssr r o Us om e

Oxygen must be delivered to all cells and carbon dioxide (a waste product of cellular respiration) must be removed. Breathing brings in oxygen and expels CO2, and the cardiovascular and lymphatic systems circulate these respiratory gases (the oxygen mostly bound to haemoglobin). The rate of breathing is varied according to oxygen demands (as detected by CO2 levels in the blood).

Bone fractures caused by falls and blows.

Damage to body tissues triggers an inflammatory response and white blood cells move to the injury site. The inflammatory response is started by chemical signals (e.g. histamine and prostaglandins) released when tissue is damaged. The cardiovascular and lymphatic systems distribute the cells and molecules involved. ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

37 Coordinating responses The brain monitors and regulates hormone levels and coordinates complex movements.

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

Regulating temperature, fluid and electrolytes

Water and ions taken in with food and drink. Metabolism generates heat

Water loss through breathing.

Loss of water and ions via sweat.

Environmental stimuli bombard the senses through ears, nose, eyes, skin, and mouth.

Glands (e.g. the adrenals) respond to messages from the brain to produce regulatory hormones.

Changes in heat losses and gains

Simple reflexes, such as pain withdrawal, allow rapid responses to stimuli.

Loss of urea, water, and ions via urine. Loss of water and ions via faeces.

The balance of fluid and electrolytes (and excretion of wastes) is the job of the kidneys. Osmoreceptors monitor blood volume and bring about the release of the hormones ADH and aldosterone, which regulate reabsorption of water and sodium from blood via the kidneys. The cardiovascular and lymphatic systems distribute fluids around the body. The circulatory system and skin both help to maintain body temperature.

The body is constantly bombarded by stimuli from the environment. The brain sorts these stimuli into those that require a response and those that do not. Responses are coordinated via nervous or hormonal controls. Simple nervous responses (reflexes) act quickly. Hormones, which are distributed by the cardiovascular and lymphatic systems, take longer to produce a response and the response is more prolonged.

1. Describe two mechanisms that operate to restore homeostasis after infection by a pathogen: (a) (b)

2. Describe two mechanisms by which responses to stimuli are brought about and coordinated: (a)

(b)

No Cla t fo ssr r o Us om e

3. Explain two ways in which water and ion balance are maintained. Name the organ(s) and any hormones involved: (a)

4. Explain two ways in which the body regulates its respiratory gases during exercise: (a)

(b)

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

23 Negative Feedback

No Cla t fo ssr r o Us om e

state provides the specific conditions of temperature, pH, and osmolarity required for the billions of enzyme-catalysed reactions that constitute metabolism. Enzymes work correctly within very narrow limits. Outside those limits they break down or denature and are unable to catalyse reactions in the body. For example, most enzymes in the body denature above 40°C. If the body's internal environment reaches this temperature for any prolonged time it may result in death.

PR E V ON IEW LY

Key Idea: Negative feedback mechanisms detect departures from a set point norm and act to restore the steady state. Most physiological systems achieve homeostasis through negative feedback. In negative feedback systems, movement away from a steady state is detected and triggers a mechanism to counteract that change. Negative feedback has a stabilising effect, dampening variations from a set point and returning internal conditions to a steady state. This steady

Negative feedback and control systems

Corrective mechanisms activated, e.g. sweating

Stress is detected by receptors and corrective mechanisms (e.g. sweating or shivering) are activated.

Return to optimum

Stress, e.g. exercise generates excessive body heat

A stressor, e.g. exercise, takes the internal environment away from optimum.

Stress, e.g. cold weather causes excessive heat loss

Corrective mechanisms act to restore optimum conditions.

Normal body temperature

–

Corrective mechanisms activated, e.g. shivering

Negative feedback acts to counteract departures from steady state. The diagram shows how stress is counteracted in the case of body temperature.

1. How do negative feedback mechanisms maintain homeostasis in a variable environment?

Negative feedback in stomach emptying

Empty stomach. Stomach wall is relaxed.

ch receptors are de Stret act iva te

Smooth muscle in the stomach wall contracts. Food is mixed and emptied from the stomach.

Food enters the stomach, stretching the stomach wall.

tre tch

re c

e p to

rs are activated

Food is eaten

2. On the diagram of stomach emptying, state:

The stimulus at: A:

The response at B:

No Cla t fo ssr r o Us om e

3. Explain why maintaining a constant body temperature is important for enzyme function:

4. Identify two examples in the body where negative feedback is important other that the two examples above:

WEB

KNOW

LINK

No Cla t fo ssr r o Us om e

24 Positive Feedback involve positive feedback. Normally, a positive feedback loop is ended when a natural resolution is reached (e.g. baby is born, pathogen is destroyed, blood clot forms). Very few physiological processes involve positive feedback because such mechanisms are unstable. If left unchecked, they can be dangerous or even fatal.

PR E V ON IEW LY

Key Idea: Positive feedback results in the escalation of a response to a stimulus. It causes system instability and is used where a particular outcome or resolution is required. Positive feedback mechanisms amplify a physiological response. Their usual purpose is to achieve a particular outcome. Labour, lactation, fever, and blood clotting all

Fever, positive feedback and response escalation Positive feedback causes large deviations from the original levels

Fever peaks and body temperature then begins to fall

Labour and lactation: During childbirth (above), receptors in the cervix detect stretching and signal the hypothalamus to release the hormone oxytocin. Oxytocin intensifies uterine contractions, moving the infant further into the birth canal and causing further stretching of the cervix, which in turn causes the release of more oxytocin. The birth itself restores the system by removing the initiating stimulus.

Pathogen enters body

Normal body temperature 36.2 to 37.2°C

Pathogen detected. Body temperature begins to rise

Body temperature fluctuates on a normal, regular basis around a narrow set point.

Pathogen enters the body.

The body detects the pathogen and macrophages attack it. Macrophages release interleukins which stimulate the hypothalamus to increase prostaglandin production and reset the body’s thermostat to a higher ‘fever’ level by shivering (the chill phase).

The fever breaks when the infection subsides. Levels of circulating interleukins (and other fever-associated chemicals) fall, and the body’s thermostat is reset to normal. This ends the positive feedback escalation and normal controls resume. If the infection persists, the escalation may continue, and the fever may intensify. Body temperatures in excess of 43oC are often fatal or result in brain damage.

CDC

Normal temperature cycle (fluctuations around a set point)

Positive feedback also occurs in blood clotting. A wound releases signal chemicals that activate platelets in the blood. Activated platelets release chemicals that activate more platelets, so a blood clot is rapidly formed.

1. (a) What is the biological role of positive feedback loops? Describe an example:

(b) Why is positive feedback inherently unstable (compare with negative feedback)?

(d) Describe a situation in which this might not happen. What would be the result?

No Cla t fo ssr r o Us om e

WEB

KNOW

25 Nervous Regulatory Systems

No Cla t fo ssr r o Us om e

which are specialised to transmit information in the form of electrochemical impulses (action potentials). The nervous system is a signalling network with branches carrying information directly to and from specific target tissues. Impulses can be transmitted over considerable distances and the response is very precise and rapid. The basic plan of the nervous system in a human is described below, left.

PR E V ON IEW LY

Key Idea: The nervous and endocrine systems work together to maintain homeostasis. The nervous system has three basic components: sensory receptors, central nervous system, and effectors to bring about the response. In mammals, the nervous and endocrine (hormonal) systems work together to maintain homeostasis. The nervous system contains cells called neurones (nerve cells)

Coordination by the nervous system

The mammalian nervous system consists of the central nervous system (brain and spinal cord), and the nerves and receptors outside it (peripheral nervous system). Sensory input to receptors comes via stimuli. Information about the effect of a response is provided by feedback mechanisms so that the system can be readjusted. The basic organisation of the nervous system can be simplified into a few key components: the sensory receptors, a central nervous system processing point, and the effectors which bring about the response (below):

External stimuli

Motor cortex coordinates appropriate response

Eye perceives the stimulus and sends messages via sensory neurones to the brain

Internal stimuli

Receptors (sense organs)

e.g. eyes, ears, taste buds, stretch and pressure receptors

Sensory input is received by the sensory structures (via stimuli) and converted into an electrical response.

Motor neurones carry the message to effectors (the muscles of hand and arm)

Impulses are transmitted by sensory nerve cells (neurones) to the central nervous system.

Central nervous system (CNS) processing sensory input and coordinating a response (brain and spinal cord)

Feedback information

Brain

In the example above, the approach of the frisbee is perceived by the eye. The motor cortex of the brain integrates the sensory message. Coordination of hand and body orientation is brought about through motor neurones to the muscles.

Comparison of nervous and hormonal control Nervous control

Effectors (muscles and glands)

RESPONSE

Communication

Impulses across synapses

Hormones in the blood

Speed

Very rapid (within a few milliseconds)

Relatively slow (over minutes, hours, or longer)

Duration

Short term and reversible

Longer lasting effects

Target pathway

Specific (through nerves) to specific cells

Hormones broadcast to target cells everywhere

Causes glands to secrete or muscles to contract

Causes changes in metabolic activity

Action

No Cla t fo ssr r o Us om e

Muscles and glands bring about appropriate action

Motor output: impulses are transmitted by motor neurones to effectors

Hormonal control

1. Identify the three basic components of a nervous system and describe their role in maintaining homeostasis: (a)

(b)

KNOW

LINK

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

41 Linking the nervous and endocrine systems

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

The hypothalamus is central to many homeostatic processes, with an important role in linking the nervous system to the endocrine system via the pituitary. The hypothalamus is responsible for synthesising and secreting several neurohormones from specialised neurosecretory cells, which function as both nerve cells and endocrine cells. Input from brain and other body systems

Neurosecretory cells

Hypothalamus

Neurosecretory cells in the hypothalamus secrete hormones into blood vessels serving the anterior pituitary.

The anterior pituitary is connected to the hypothalamus by blood vessels and receives hypothalamic neurohormones via capillaries. These neurohormones control release of anterior pituitary hormones.

Releases at least seven peptide hormones, including growth hormone, and hormones regulating the activity of the thyroid and adrenal glands.

Hypothalamus sends nerve impulses direct to the posterior pituitary.

The posterior pituitary is essentially an extension of the hypothalamus. Its neurosecretory cells release hormones into the blood in response to nerve impulses.

Stores and releases oxytocin and antidiuretic hormone (ADH) produced by the hypothalamus

2. Describe two differences between nervous control and endocrine (hormonal) control of body systems: (a)

(b)

3. (a) How do the anterior and posterior pituitary differ with respect to their relationship to the hypothalamus?

(b) Explain how these differences relate to the nature of the hormonal secretions for each region:

No Cla t fo ssr r o Us om e

4. Why do the adrenal and thyroid glands atrophy if the pituitary gland ceases to function?

5. Although the anterior pituitary is often called the master gland, the hypothalamus could also claim that title. Explain:

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

26 What You Know So Far: Principles of Homeostasis

No Cla t fo ssr r o Us om e

Feedback mechanisms

PR E V ON IEW LY

HINT: Compare and contrast negative feedback and positive feedback mechanisms.

Homeostasis

HINT: Provide examples of how the body must regulate the internal environment.

The hypothalamus

HINT: Name and describe the roles of the three basic components of the nervous system.

HINT: Describe how the hypothalamus links the nervous and hormonal systems.

No Cla t fo ssr r o Us om e

Nervous regulatory systems

REVISE

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

27 Thermoregulation in Humans nerve impulses from receptors in the skin. It then coordinates appropriate nervous and hormonal responses to counteract any deviations from its 'set point' temperature of 36.7°C. Like a thermostat, the hypothalamus detects a return to normal temperature and the corrective mechanisms are switched off (negative feedback regulation).

PR E V ON IEW LY

Key Idea: In humans, the temperature regulation centre is in the hypothalamus. Thermoregulation relies on negative feedback mechanisms and involves several body systems. In humans and other mammals, the temperature regulation centre of the body is in the hypothalamus. The hypothalamus responds directly to changes in core temperature and to

The hypothalamus regulates temperature ffThe hypothalamus acts as a thermostat. It detects changes in core body

temperature and also receives information about temperature change from thermoreceptors in the skin. It then coordinates nervous and hormonal responses to counteract changes and restore normal body temperature (illustrated in the diagram below).

ffWhen normal temperature is restored, the corrective mechanisms are switched off. This is an example of a negative feedback regulation.

ffInfection can reset the set-point of the hypothalamus to a higher temperature. Homeostatic mechanisms then act to raise the body temperature to the new set point, resulting in a fever (right). This speeds up the body's immune response to infection.

Fever is an important defence against infection, but if the body temperature rises much above 42°C, a dangerous positive feedback loop can begin, making the body produce heat faster than it can get rid of it.

Blood vessels in the skin dilate. Heat is lost from the warm blood at the skin surface.

Breakdown of glycogen to glucose in the liver.

pe rat ure

too hig h

Imb

ala

y Bod

nce

Stimulus: Decreased body temperature, e.g. cold environments.

Normal body temperature, 35.6-37.8°C

d tore res e r u rat pe m te

Body temperature increases and the hypothalamus heatpromoting centre shuts off.

er tur a r pe tem

Imb

Bod y te mp era tur e

ala

nce

to o

w lo

Bo dy

Thyroid gland releases hormones to increase metabolic rate.

Rapid contractions of the skeletal muscles causes reflex shivering, which expends energy to generate heat.

No Cla t fo ssr r o Us om e

Stimulus: Increased body temperature, e.g. when exercising or in a hot climate.

Activates heat-loss centre in hypothalamus

Body temperature decreases and the hypothalamus heatloss centre shuts off.

Sweat glands are activated. Sweating cools the body by evaporation. Hairs on the skin are flattened reducing insulating layer and promoting heat loss.

Activates heatpromoting centre in hypothalamus

Blood vessels in the skin constrict. Blood is diverted from the skin so heat is not lost.

LINK

WEB

KNOW

No Cla t fo ssr r o Us om e

Factors causing heat loss

Factors causing heat gain

PR E V ON IEW LY

 Wind chill factor accelerates heat loss through conduction.

 Heat loss due to temperature difference between the body and the environment.

Adorabutton CC 4.0

 Excessive fat deposits make it harder to lose the heat that is generated through activity.

 Heavy exercise, especially with excessive clothing.

K.Suter

 The rate of heat loss from the body is increased by being wet, by inactivity, dehydration, inadequate clothing, or shock.

 Gain of heat directly from the environment through radiation and conduction.

1. (a) Where is the temperature regulation centre in humans located?

(b) How does it carry out this role?

2. Describe the role of the following in maintaining a constant body temperature in humans:

(a) The skin:

(b) The muscles:

3. How is negative feedback involved in keeping body temperature within narrow limits?

(b) What is the purpose of this?

5. Identify two factors that cause heat loss:

6. Identify two factors that cause heat gain:

No Cla t fo ssr r o Us om e

4. (a) Why does infection result in an elevated core body temperature?

No Cla t fo ssr r o Us om e

28 Thermoregulation in Newborns number of significant physiological changes, including those associated with thermoregulation. A number of physical and physiological features prevent newborn babies from fully regulating their body temperature until six months of age. As a result, they can lose or gain heat very quickly, often with life-threatening consequences.

PR E V ON IEW LY

Key Idea: Several physical and physiological features of newborn babies prevent them from fully regulating their body temperature until six months of age. While in the uterus, many of the physiological processes of a fetus are supported by the mother. Once delivered, the newborn must function independently. This requires a Increased brown fat activity and general metabolic activity generate heat.

Newborns have thin skin, and blood vessels that run close to the skin, these features allow heat to be lost easily.

Newborns have very little subcutaneous (white) fat to insulate them against heat loss. The smaller the baby, the less white fat they have.

A baby's body surface is three times greater than an adult's. There is greater surface area for heat to be lost from.

The head is very large compared to the rest of the body. The skull is about 1/4 of the total body length. Heat losses from the head are high.

Newborns can reduce their body temperature by sweating, however their sweat glands are not fully functional until four weeks after birth.

Physiological mechanisms of thermoregulation

Newborns cannot shiver to produce heat, and have limited capacity to generate heat from large body movements (because their ability to move is limited). Therefore, much of an infant's heat production comes from the metabolic activity of brown fat, a mitochondrial rich organ abundant in newborns. Heat is also generated by metabolic activity.

Premature babies have less ability to thermoregulate than full-term newborns. Premature babies are placed in an enclosed temperature controlled incubator to help them maintain a stable temperature (above). Newborns are often dressed in a hat to reduce heat loss from the head, and tightly wrapped to trap heat next to their bodies.

Newborns alter the blood flow to the skin to help regulate body temperature. Newborns minimise heat loss by reducing the blood supply to the periphery (skin, hands, and feet). This helps to maintain the core body temperature. Newborns lower their temperature by increasing peripheral blood flow. This allows heat to be lost, cooling the core temperature.

1. Why do babies in the womb not have any difficulty thermoregulating?

No Cla t fo ssr r o Us om e

2. What features of a newborn make it susceptible to rapid heat loss?

3. How does altering the blood flow to the skin help newborns to control their body temperature?

4. Why do you think premature babies have less ability to thermoregulate than a full term newborn?

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

LINK

KNOW

No Cla t fo ssr r o Us om e

29 The Role of the Skin in Thermoregulation from wear and tear. The lower dermis contains the skin's sensory receptors and hairs. Blood vessels in the layer immediately below the skin (the hypodermis) help to regulate body temperature by promoting heat loss or retention through vasodilation or vasoconstriction respectively.

Dermis

Epidermis

PR E V ON IEW LY

Key Idea: The skin plays an important part in regulating body temperature due to its large surface area from which heat from the environment is gained or lost. The skin is made of two layers. The outer epidermis is made up of layers of simple cells that protect the deeper cell layers

Hair erector muscle raises and lowers hair

Sweat (eccrine) gland Blood vessels

The skin provides a large surface area for heat loss or gain. To regulate this, the blood vessels beneath the surface constrict (vasoconstriction) to reduce blood flow or dilate (vasodilation) to increase the blood flow. When blood vessels are fully constricted there may be as much as a 10°C temperature gradient from the outer to inner layers of the skin. Extremities such the hands and feet have additional vascular controls which can reduce their blood flow in severe cold.

Graham Crumb CC 2.0

Ildar Sagdejev CC 3.0

Thermoreceptors (free nerve endings) in the dermis detect changes in skin temperature and send nerve impulses to the hypothalamus, which mediates an appropriate response. Hot thermoreceptors detect an increase in skin temperature above 37.5°C. Cold thermoreceptors detect a fall below 35.8°C.

Constriction of a small blood vessel. An erythrocyte (E) (red blood cell) is in the centre of the vessel.

RM Hunt CC 3.0

Hypodermis

Hair root

Vasoconstriction and goosebumps in response low temperature

Vasodilation and sweating in response high temperature

The hair erector muscles, sweat glands, and blood vessels are the effectors for mediating a response to information from thermoreceptors. Temperature regulation by the skin involves negative feedback because the output is fed back to the skin receptors and becomes part of a new stimulus-response cycle.

Vanuatu boy

No Cla t fo ssr r o Us om e

People are born with an excess of sweat glands, but if they spend the first years of their life in a cold climate most of these become permanently inactive. People acclimatised to a warm climate (right) produce sweat in a more uniformly distributed way than those who are not, and they may sweat up to 3 L h-1. This increases the efficiency of heat loss. People not acclimatised to warm climates often only sweat up to 1 L h-1 and the sweat usually beads up and drips off the body.

1. How do the blood vessels help to regulate the amount of heat lost from the skin and body?

2. Why is a person from a cool climate and exposed to a tropical climate unable to regulate their body temperature as easily as someone who is native to that climate?

WEB

KNOW

LINK

No Cla t fo ssr r o Us om e

30 Hypothermia below 35°C. Hypothermia is caused by exposure to low temperatures, and results from the body's inability to replace the heat being lost to the environment. The severity depends on how low the body temperature has dropped.

PR E V ON IEW LY

Key Idea: Hypothermia (low body temperature) occurs when the body cannot thermoregulate effectively, and the core body temperature drops below 35°C. Hypothermia occurs when the core body temperature drops

Maintaining a body temperature of around 37oC allows the body's metabolism to function optimally. At temperatures below 35oC, metabolic reactions slow, causing a loss of coordination, difficulty in moving, and mental fatigue. Hypothermia can result from exposure to very low temperatures for a short time or to moderately low temperatures for a long time. Exposure to cold water (even just slightly cold) will produce symptoms of hypothermia far more quickly than exposure to the same temperature of air. This is because water is much more effective than air at conducting heat away from the body.

39° 37°

Normal body temperature

35°

Mild hypothermia: Shivering. Vasoconstriction reduces blood flow to the extremities. Hypertension (high blood pressure) and cold diuresis (increased urine production due to the cold).

33° 31° 29°

Moderate hypothermia: Muscle coordination becomes difficult. Movements slow or laboured. Blood vessels in ears, nose, fingers, and toes constrict further resulting in these turning a blue colour. Mental confusion sets in.

27°

°C

Severe hypothermia: Speech fails. Mental processes become irrational, victim may enter a stupor. Organs and heart eventually fail resulting in death.

Treating hypothermia

Hypothermia is treated by rewarming the body. This must be done with care because rewarming the body too quickly or with the wrong method can actually cause the body to attempt to remove the sudden excess of heat and so cause more heat loss and/or death.

Body shape influences heat loss ffBody shape influences how heat is retained or lost.

Warmer climate

Animals with a lower surface area to volume ratio will lose less body heat per unit of mass than animals with a high surface area to volume ratio. In humans there is a negative relationship between surface area and latitude.

Cooler climate

Taller, thinner body shape.

Shorter, stocky (wider) body shape.

ffIndigenous people living near the equator tend to have a

higher surface area to volume ratio so they can lose heat quickly. In contrast, people living in higher latitudes near the poles have a lower surface area to volume ratio so that they can conserve heat (below). Relationship between ratio of surface area to body mass and latitude

Data source: C.B Ruff (1994) Morphological Adaptation to Climate in Modern and Fossil Hominids.

Body surface area/mass (cm2 kg-1)

300

280

260

Equator

Pole

Increasing latitude

No Cla t fo ssr r o Us om e

Shorter limbs reduce the surface area for heat loss.

320

240

Longer limbs to increase the surface area for heat loss.

Proportionately longer legs for their height.

Proportionately shorter legs for their height.

Like all organisms, human populations have evolved in response to environment. Human populations in tropical regions tend to have higher surface area to volume ratios than population in colder regions, where a squatter body shape assists in heat retention. LINK

LINK

WEB

KNOW

The Inuit people of Arctic regions are stocky, with relatively short extremities. This body shape is well suited to reducing the surface area over which heat can be lost from the body.

NASA

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

The indigenous peoples of equatorial Africa, such as these young Kenyan men, and tall and slender, with long limbs. This body shape increases the surface area over which heat can be lost.

Humans lose a lot of heat through the head. One of the reasons humans still have head hair is to help thermoregulate. In the image above, the bright face but dark hair shows the hair is insulating the head.

1. What conditions might cause a person to become hypothermic?

2. An experiment was performed with three volunteers with the same body shape and dimensions. Volunteer A was given good insulated clothing, including an insulated knit hat, volunteer B was also given well insulated clothing but no insulated hat, volunteer C wore only a light shirt and pants. The three stood in a freezer room (-18°C) for five minutes while their core body temperature was monitored.

Explain what will happen to the body temperature of these three volunteers and explain why:

3. Inuits (latitude 70°N) average about 1.63 m tall. Sudanese (latitude 13°N) average about 1.85 m tall. How tall would you expect a person from France (latitude 46°N) to be and why?

(a) Which body shape has best survival at 15°C? (b) Explain your choice:

10 8

Body shape: short and stocky

e ag er Av

4 2 0

No Cla t fo ssr r o Us om e

Water exposure and survival times

Survival time (hours)

4. Hypothermia is a condition that occurs when the body cannot generate enough heat and the core body temperature drops below 35°C. Prolonged hypothermia is fatal. Exposure to cold water results in hypothermia more quickly than exposure to the same temperature of air because water is much more effective than air at conducting heat away from the body. In the graph (right), hypothermia resulting in death is highly likely in region 1 and highly unlikely in region 2.

Body shape: tall and thin

Water temperature (°C)

No Cla t fo ssr r o Us om e

31 Hyperthermia more heat than it can dissipate, the heat regulating systems can become overwhelmed and body temperature will rise uncontrollably. Prolonged hyperthermia can be fatal. It is important to note that hyperthermia is different from a fever, which involves resetting the body's thermostat to a higher level in response to infection.

PR E V ON IEW LY

Key Idea: Hyperthermia (high body temperature) occurs when the body cannot thermoregulate properly, and the core body temperature rises above 38.5°C. Hyperthermia occurs when the core body temperature exceeds 38.5°C (without a change to the set-point of the heat control centre in the hypothalamus). When the body produces

Causes of hyperthermia:  Dehydration  Hot environment  Exercise  Response to some drugs

Treating hyperthermia

Phases in heat exhaustion and hyperthermia

Phase 1 Overexertion is usually accompanied with a flushed red face and rapid short breaths. Correction is by seeking shade and drinking plenty of fluid.

Treating hyperthermia involves rapidly lowering the core body temperature. However, care must be taken to avoid causing vasoconstriction and shivering, as these produce heat and make the hyperthermic condition worse.

Phase 2 Heat exhaustion is a more serious problem. It is indicated by profuse sweating, a dry mouth, cramps, and nausea. The skin will appear red as blood is directed to the skin to reduce core temperature. Physical activity should be stopped immediately and shade should be sought. Cool drinks and ice packs on the skin may be needed.

Phase 3 Heat stroke is the final and most serious stage. The body's core temperature may have risen to 41oC. Thermoregulatory mechanisms fail. Sweat is no longer produced and the skin becomes hot and dry. Disorientation is followed by collapse and unconsciousness. Metabolic processes become uncoupled and enzymes denature. Death follows.

1. (a) What is hyperthermia?

(b) How does hyperthermia differ from a fever?

3. Explain why untreated heat stroke can rapidly lead to death:

4. In what situations is there a likelihood of someone getting hyperthermia?

No Cla t fo ssr r o Us om e

2. Why would bringing down a hyperthermia patient's temperature so fast that they began to shiver be dangerous?

LINK

KNOW

No Cla t fo ssr r o Us om e

32 Drugs and Thermoregulation in the brain. These effects include changes to temperature regulation, heart rate, blood pressure, and appetite control. The effects of ecstasy start 20-60 minutes after taking it and last for six hours. Serotonin levels may take days or weeks to return to normal.

PR E V ON IEW LY

Key Idea: Drugs, such as ecstasy, can interfere with thermoregulatory process and cause hyperthermia. Ecstasy, or MDMA, is an illegal stimulant that produces feelings of euphoria. It has psychological and physiological effects, brought about by an increase in the levels of serotonin

Ecstasy induced hyperthermia

Physiological effect of ecstasy Reduces blood flow to skin

DEA

Decreases sweating

Increases metabolic rate

Increases heat generation

Decreases thirst recognition

Increases dehydration

Other contributing factors: Hot environment Dancing (= heat generation) A

Ecstasy and hyperthermia in rabbits

Fall in ear pinna blood flow (cm s-1)

To understand how humans may be affected by ecstasy, researchers investigated how it causes hyperthermia in rabbits. The data (right) shows a clear positive relationship between the ecstasy dose and body temperature (figure A). The same research also showed that blood flow to the skin decreases (due to vasoconstriction) after ecstasy is taken (figure B). One of the body's main cooling mechanisms is to increase blood flow to the skin, so that heat can be lost. Ecstasy shuts down this mechanism, so it becomes more difficult to lose heat. In humans, the problem is exacerbated because ecstasy use is associated with dance parties or clubs, where the environment is hot and crowded and the physical effort of dancing generates heat. The combination of these behavioural and physiological factors results in abnormal increases in body temperature, heat exhaustion, and heat stroke.

Increase in body temperature (Â°C)

Hyperthermia (high body temperature) is one of the major side effects of ecstasy use and can result in organ failure and death if it is not treated. It has been implicated in the deaths of people attending danceparties.

Reduces heat loss

-25

-50

1.5

3.0

Ecstasy dose (mg kg-1)

6.0

Data source: N. P. Pedersen and W. W. Blessing The Journal of Neuroscience, 1 November 2001, 21(21).

Hyperthermia

Consequence

1. (a) Describe the effects of ecstasy on body temperature in rabbits:

(b) What conclusions can you draw about how ecstasy affects blood flow to the skin in rabbits?

2. How can ecstasy cause hyperthermia in humans?

LINK

KNOW

LINK

No Cla t fo ssr r o Us om e

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

33 Hyperthyroidism and Thermoregulation involved in regulating many aspects of metabolism, including temperature regulation. Hyperthyroidism (overactive thyroid) is a medical condition in which the thyroid gland produces too much of the hormone thyroxine. One of the effects of too much thyroxine is that it increases body temperature.

PR E V ON IEW LY

Key Idea: Hyperthyroidism refers to over-production of the hormone thyroxine by the thyroid gland. This in turn can affect the body's ability to thermoregulate properly. The thyroid gland is a large endocrine gland found in the neck. The thyroid gland produces a number of hormones

The thyroid gland

The thyroid gland is a butterfly shaped endocrine gland located just below the Adam's apple at the front of the wind pipe (trachea). The thyroid secretes several hormones, collectively called thyroid hormones, but the main hormone produced is thyroxine. Thyroxine is also called T4. Thyroid hormones have many functions including regulating metabolism, growth and development, and body temperature.

Voice box (larynx)

Thyroid gland

Wind pipe (trachea)

Hyperthyroidism and temperature regulation

Thyroxine levels are regulated by negative feedback

Thyroxine (T4) production is controlled by negative feedback. This mechanism involves two parts of the brain, the hypothalamus and the pituitary gland. Low body temperature stimulates the hypothalamus to secrete thyroid releasing hormone (TRH), which in turn stimulates cells in the anterior pituitary to secrete thyroid stimulating hormone (TSH).

TSH acts on the thyroid gland, causing it to produce thyroid hormones, including thyroxine. Thyroxine binds to target cells, increasing their metabolic activity, resulting in heat production. High levels of circulating thyroid hormones inhibit production of TRH and TSH. As a result, thyroid secretion is reduced. When the level of thyroid hormones drops below a certain threshold, TRH and TSH production begins again.  Temperature

One of the effects of thyroxine is that it speeds up metabolic activity in cells. The increase in metabolic activity also results in the production of heat and, under normal conditions, this is one of the mechanisms by which the body raises body temperature. The negative feedback mechanism for thyroxine production can be disrupted by hyperthyroidism, a condition where too much thyroxine is produced by the thyroid gland. As a result this can disrupt temperature regulation.

The most common cause of hyperthyroidism is Graves disease. In Graves disease, the negative feedback loop is bypassed because a protein called thyroid stimulating immunoglobulin (TSI) binds directly to the thyroid and stimulates thyroxine production. In this instance, thyroxine production is independent of thyroid stimulating hormone (TSH) production, so the negative feedback regulation of its production is ineffective. Photo above: People with hyperthyroidism often have goitre, an enlarged thyroid gland.

Hypothalamus

TRH

Anterior pituitary

TSH

Target cells

 Metabolic activity  Temperature

No Cla t fo ssr r o Us om e

1. Briefly outline how negative feedback of thyroxine production is involved in temperature regulation:

2. Why do high levels of thyroxine not inhibit its production from the thyroid gland in a person with Graves disease?

LINK

KNOW

34 What You Know So Far: Thermoregulation

No Cla t fo ssr r o Us om e

Thermoregulatory problems and disorders

PR E V ON IEW LY

HINT: Describe factors that may disrupt normal thermoregulation and their effects.

Thermoregulation in humans

No Cla t fo ssr r o Us om e

HINT: Include definitions and reference to mechanisms involved (including the role of the hypothalamus).

REVISE

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

35 Hormonal Regulatory Systems produce. Hormones are potent chemical regulators. They are produced in very small quantities but exert a large effect on metabolism. Endocrine glands secrete hormones directly into the blood rather than through a duct or tube. The basis of hormonal control is described below.

PR E V ON IEW LY

Key Idea: The endocrine system regulates physiological processes by releasing chemical messengers (hormones) into the bloodstream to interact with target cells. The endocrine system is made up of endocrine cells (organised into endocrine glands) and the hormones they

The mechanism of hormone action

Antagonistic hormones

Endocrine cells produce hormones and secrete them into the bloodstream where they are distributed throughout the body. Although hormones are transported throughout the body, they affect only specific target cells. These target cells have receptors on the plasma membrane which recognise and bind the hormone (see inset, below). The binding of hormone and receptor triggers the response in the target cell. The response may be long lasting as the hormone continues to circulate in the blood. Cells are unresponsive to a hormone if they do not have the appropriate receptors.

Endocrine cell secretes hormone into bloodstream

Insulin secretion

Raises blood glucose

Target cells

Hormone travels in the bloodstream throughout the body

Blood glucose rises: insulin is released

Blood glucose falls: glucagon is released

Lowers blood glucose

Glucagon secretion

The effects of one hormone are often counteracted by an opposing (antagonistic) hormone. Negative feedback adjusts the balance of the two hormones to maintain a particular physiological function.

Cytoplasm of cell

The stimulus for hormone production and release can be: • Hormonal: another hormone • Humoral: a blood component • Neural: a nerve impulse

Plasma membrane

Hormone receptor

Hormone molecule

Receptors on the target cell receive the hormone

Example: insulin acts to decrease blood glucose and glucagon acts to raise it.

1. (a) What are antagonistic hormones? Describe an example of how two such hormones operate:

(b) Describe the role of feedback mechanisms in adjusting hormone levels (use an example if this is helpful):

No Cla t fo ssr r o Us om e

2. How can a hormone influence only the target cells even though it is transported throughout the body?

3. Explain why hormonal control differs from nervous system control with respect to the following:

(a) The speed of hormonal responses is slower:

(b) Hormonal responses are generally longer lasting:

LINK

WEB

KNOW

No Cla t fo ssr r o Us om e

PR E V ON IEW LY

Blood sugar (mmol L-1)

7.0

6.0

5.0

4.0

Blood insulin levels Blood glucose levels

3.0

7:00

9:00

11:00

meal

13:00

15:00

17:00

19:00

meal

21:00

23:00

1:00

3:00

5:00

Time

meal

Negativeinfeedback in blood glucose regulation Negative feedback blood glucose regulation

Blood glucose can be tested using a finger prick test. The glucose in the blood reacts with an enzyme electrode, generating an electric charge proportional to the glucose concentration. This is displayed as a digital readout.

beta cells

alpha cells

Stimulates α cells to secrete glucagon

Stimulates β cells to secrete insulin

Uptake of glucose by cells. Conversion of glucose to stored glycogen or fat in the liver.

Rise in BG

Normal blood glucose (BG) level 3.9-5.6 mmol

Decreases blood glucose

Fall in BG

Breakdown of glycogen to glucose in the liver.

L -1

Release of glucose into the blood

(b) Identify the stimulus for the release of glucagon:

(d) How does insulin decrease blood glucose level?

No Cla t fo ssr r o Us om e

1. (a) Identify the stimulus for the release of insulin:

2. Explain the pattern of fluctuations in blood glucose and blood insulin levels in the graph above:

3. The stimulus for the production and release of insulin and glucagon is: hormonal / humoral / neural (circle one): WEB

KNOW

LINK

No Cla t fo ssr r o Us om e

37 Insulin and Cellular Uptake of Glucose (including death). Too little insulin results in elevated blood glucose levels (hyperglycaemia), whereas too much insulin results in low blood glucose levels (hypoglycaemia). The insulin receptors are surface-bound protein kinase receptors. They facilitate a cellular response by catalysing the transfer of a phosphate group from ATP to a target protein.

PR E V ON IEW LY

Key Idea: Activation of the insulin receptor by insulin causes a signal cascade that results in cellular glucose uptake. Insulin is a peptide hormone secreted by the pancreas. Its primary role is in maintaining blood glucose homeostasis. Insulin production is tightly regulated because over- or underproduction has serious physiological consequences

Extracellular environment

Bound insulin

Glucose uptake pathway

1 Two molecules of insulin must bind

to the extracellular domain of the insulin receptor to activate it.

Glucose

Unbound insulin

Insulin receptors are made up of four subunits: 2 α-subunits and 2 β-subunits.

Glut4 glucose transporter

2 Once the insulin is bound,

phosphate groups are added to the receptor in a process called autophosphorylation.

Inactive molecules

Active molecules

5 Glut4 glucose transporters

insert into the membrane allowing the uptake of glucose.

Glut4 secretory vesicle

3 The autophosphorylation of the

4 The cascade sequence results in

receptor begins a signal cascade, in which several other proteins are phosphorylated in sequence. Each can activate many other proteins.

the activation of many Glut4 secretory vesicles, which produce the Glut4 glucose transporters.

Intracellular environment

1. Where is insulin produced?

2. (a) What is the consequence of high insulin levels?

(b) What is the consequence of low glucose levels?

No Cla t fo ssr r o Us om e

3. Describe the process by which insulin signalling causes the uptake of glucose in to cells:

4. How does the signal cascade increase the response of the insulin receptor?

LINK

WEB

KNOW

No Cla t fo ssr r o Us om e

38 The Liver's Role in Carbohydrate Metabolism stimulates the conversion of glucose to glycogen whereas glucagon stimulates the release of glucose from stored glycogen. In addition, adrenaline, released by the adrenal glands, also plays a role in the release of glucose into the blood, although it targets muscle cells more the liver cells.

PR E V ON IEW LY

Key Idea: The interconversion of glycogen and glucose occurs in the liver in response insulin, glucagon and adrenaline. Insulin and glucagon are antagonistic hormones secreted by a and b cells of the pancreas. The liver has a central role in the body's carbohydrate metabolism. In the liver, insulin

Overview of carbohydrate metabolism in the liver

Lipids

+ INSULIN

Hexose sugars

Glycerol + amino acids

+ GLUCAGON

Fats

+ ADRENALINE GLUCOCORTICOIDS

Glycogen

Fatty acids

Glucose

Glycerol

Glucose

BLOOD

 Glycogenolysis Conversion of stored glycogen to glucose (glycogen breakdown). The free glucose is released into the blood. The hormones glucagon and adrenaline stimulate glycogenolysis in response to low blood glucose.  Gluconeogenesis Production of glucose from noncarbohydrate sources (e.g. glycerol, pyruvate, lactate, and amino acids). Adrenaline and glucocorticoid hormones (e.g. cortisol) stimulate gluconeogenesis in response to fasting, starvation, or prolonged periods of exercise when glycogen stores are exhausted. It is also part of the general adaptation syndrome in response to stress.

Liver cells

Jpogi

SMALL INTESTINE

 Glycogenesis Excess glucose in the blood is converted to glycogen (a glucose polysaccharide). Insulin stimulates glycogenesis in response to high blood glucose. Glycogen is stored in the liver and muscle tissue.

Glycogen is stored within the liver cells. Glucagon stimulates its conversion to glucose.

WMRCVM

Carbohydrate and lipid metabolism

Glycogen

Glycogen is also stored in muscle, where it is squeezed out to the periphery of the cells.

1. Explain the three important processes of carbohydrate metabolism in the liver, including how these are regulated: (a)

(b)

No Cla t fo ssr r o Us om e

(c)

2. Identify the processes occurring at each numbered stage on the diagram above, right:

(a) Process occurring at point 1:

(b) Process occurring at point 2:

3. Explain why it is important that the body can readily convert and produce different forms of carbohydrates:

WEB

KNOW

LINK

No Cla t fo ssr r o Us om e

39 Type 1 Diabetes Mellitus characterised by absolute insulin deficiency. It usually begins in childhood as a result of autoimmune destruction of the insulin-producing cells of the pancreas. For this reason, it was once called juvenile-onset diabetes. It is a severe, incurable condition, and is treated with insulin injections.

PR E V ON IEW LY

Key Idea: In type 1 diabetes, the insulin-producing cells of the pancreas are destroyed and insulin cannot be made. A disruption in the insulin-glucagon system causes the disease diabetes mellitus. Diabetes mellitus is characterised by high blood sugar (hyperglycemia). Type 1 diabetes is

Cause

Incidence: About 10-15% of all diabetics.

a cells produce glucagon, which promotes glucose release from the liver.

Age at onset: Early; often in childhood.

Symptoms: The cells cannot take up glucose so blood glucose is high. The glucose in the blood exceeds the reabsorption capacity of the kidney and glucose spills over in the urine resulting in large volumes of sweet (high glucose) urine, thirst, hunger, weight loss, fatigue, and infections.

Cause: Absolute deficiency of insulin due to lack of insulin production (pancreatic beta cells are destroyed in an autoimmune reaction). There is a genetic component but usually a childhood viral infection triggers the development of the disease. Mumps, coxsackie, and rubella are implicated.

b cells (most of the cells in this field of view) produce insulin, the hormone promoting cellular uptake of glucose. Cells are destroyed in type 1 diabetes mellitus.

Cell types in the endocrine region of a normal pancreas

Effects on the body

Without insulin, cells cannot take up glucose and so lack an energy source for metabolism.

Inability to utilise glucose leads to muscle weakness and fatigue.

Production of urine from the kidneys increases to clear the body of excess blood glucose. Glucose is present in the urine.

Fats are metabolised for energy leading to a fall in blood pH (diabetic ketoacidosis). This is potentially fatal.

There is constant thirst. Weight is lost despite hunger and overeating.

High sugar levels in blood and urine promote bacterial and fungal infections of the bladder and urinogenital tract.

Present treatments Regular insulin injections (right) are combined with dietary management to keep blood sugar levels stable. Blood glucose levels are monitored regularly with testing kits to guard against sudden, potentially fatal, falls in blood glucose (hypoglycemia). Insulin was once extracted from dead animals, but animal-derived insulin produces many side effects. Genetically engineered microbes now provide low cost human insulin, without the side effects associated with animal insulin.

Newer treatments Cell therapy involves transplanting islet cells into the patient where they produce insulin and regulate blood sugar levels. The islet cells may be derived from stem cells or from the pancreatic tissue of pigs. New technology developed by New Zealand company Living Cell Technologies Ltd, encapsulates the pig islet cells within microspheres so they are protected from destruction by the patient's immune system. Cell therapy promises to be an effective way to provide sustained relief for diabetics. ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

Treatments

LINK

WEB

KNOW

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

1. (a) What is the function of a cells?

(b) What is the function of b cells?

2. What is type 1 diabetes?

3. Describe the symptoms of type 1 diabetes mellitus and relate these to the physiological cause of the disease:

4. Explain why someone with type 1 diabetes is often thirsty:

5. Explain why an untreated type 1 diabetic will lose weight despite hunger and overeating:

No Cla t fo ssr r o Us om e

6. Explain how regular insulin injections help the type 1 diabetic to maintain their blood glucose homeostasis:

7. Explain why transplanting living islets could be a more effective treatment than regular injections of insulin:

8. Why are bladder infections common in type 1 diabetes?

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

40 Type 2 Diabetes Mellitus 2 diabetes is sometimes called insulin resistance diabetes. Type 2 diabetes is a chronic, progressive disease, and become worse with age if not managed. The long-term effects of high blood sugar include heart disease, strokes, loss of vision, and kidney failure.

PR E V ON IEW LY

Key Idea: In type 2 diabetes, the pancreas produces insulin, but the body does not respond to it appropriately. In type 2 diabetes, the pancreas produces insulin, but the quantities are insufficient or the body's cells do not react to it, so blood glucose levels remain high. For this reason, type

Effects on the body

Symptoms may be mild at first. The body’s cells do not respond appropriately to the insulin that is present and blood glucose levels become elevated. Normal blood glucose level is 3.9-5.6 mmol L-1. In diabetics, fasting blood glucose level is 7 mmol L-1 or higher.

Symptoms occur with varying degrees of severity: ffCells are starved of fuel. This can lead to increased appetite and overeating and may contribute to an existing obesity problem.

ffUrine production increases to rid the body of the excess glucose. Glucose is present in the urine and patients are frequently very thirsty.

ffThe body’s inability to use glucose properly leads to muscle weakness and fatigue, irritability, frequent infections, and poor wound healing.

Uncontrolled elevated blood glucose eventually results in damage to the blood vessels and leads to: ffcoronary artery disease

ffperipheral vascular disease

ffretinal damage, blurred vision and blindness ffkidney damage and renal failure ffpersistent ulcers and gangrene

The beta cells of the pancreatic islets (left) produce insulin, the hormone responsible for the cellular uptake of glucose. In type 2 diabetes, the body’s cells do not utilise the insulin properly.

Fat cell

Insulin

Cellular uptake of glucose is impaired and glucose enters the bloodstream instead.

Treatments and management

Obesity: BMI greater than 27. Distribution of weight is also important.

Diabetes is not curable but can be managed to minimise the health effects:

Age: Risk increases with age, although the incidence of type 2 diabetes is increasingly reported in obese children.

Sedentary lifestyle: Inactivity increases risk through its effects on body weight. Family history: There is a strong genetic link for type 2 diabetes. Those with a family history of the disease are at greater risk.

Ethnicity: Certain ethnic groups, e.g. Pacific Islanders, are at higher risk of developing of type 2 diabetes because of their genetic makeup. High blood pressure: Up to 60% of people with undiagnosed diabetes have high blood pressure.

High blood lipids: More than 40% of people with diabetes have abnormally high levels of cholesterol and similar lipids in the blood.

No Cla t fo ssr r o Us om e

Risk factors

ffRegularly check blood glucose level

ffManage diet to reduce fluctuations in blood glucose level

ffExercise regularly ffReduce weight

ffReduce blood pressure

ffReduce or stop smoking

ffTake prescribed anti-diabetic drugs ffInsulin therapy may be required

LINK

WEB

KNOW

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

1. Distinguish between type 1 and type 2 diabetes, relating the differences to the different methods of treatment:

2. Contrast the blood glucose levels of a fasting non-diabetic and a fasting diabetic:

3. Why might type 2 diabetes contribute to a person's existing obesity problem?

4. The graphs below show the prevalence of diabetes and overweight or obesity in New Zealand in 2015.

Adults overweight or obese in New Zealand

5 0

Age group

60 45 30 15 0

-1 18 7 -2 25 4 -3 35 4 -4 45 4 -5 55 4 -6 65 4 -7 4 75 +

15 10

Percentage of population

40 35 30 25 20

-1 20 9 -2 4 25 -3 35 4 -4 45 4 -5 55 4 -6 65 4 -7 75 4 -8 4 85 +

Percentage of population

Prevalence of diabetes in New Zealand

Age group

(a) Describe the data in the graphs:

(b) Is there a correlation between the data presented on the two graphs and if so how might it be explained:

No Cla t fo ssr r o Us om e

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

41 Alcohol and Blood Glucose the blood, it has less capacity to regulate blood glucose (by converting glycogen into glucose). Alcohol lowers blood glucose levels by stimulating insulin production. Low to moderate alcohol intakes don't affect the body's response to insulin. However, long-term alcohol consumption damages the liver and interferes with many aspects of metabolism, including metabolism of glucose.

PR E V ON IEW LY

Key Idea: The ability of the body to regulate blood glucose is impaired by the consumption of alcohol. Alcohol affects blood glucose levels and its regulation. The alcohol in alcoholic beverages acts as a preservative and adds to its flavour. Alcohol is toxic and its metabolism reduces the body's capacity to regulate blood glucose levels. The liver metabolises alcohol, so while there is alcohol in

Pancreas

Alcohol stimulates insulin secretion.

Alcohol inhibits glucagon secretion.

Low blood glucose (hypoglycemia)

Long term consumption of large amounts of alcohol can lead to liver disease, due to the release of inflammatory proteins by liver cells.

The liver eventually metabolises all the blood alcohol.

Liver

Pancreas

Low blood glucose levels inhibit insulin secretion. Cellular uptake of glucose from the blood is inhibited.

Normal blood glucose

Low blood glucose levels stimulate glucagon secretion. Glucose is produced by the liver, and released into the blood.

Alcohol not only reduces blood glucose but also acts as a diuretic. Drinking alcohol can reduce performance in sports or physical activity due to dehydration and reduced ability to access glucose for energy (not to mention impairing decision making).

No Cla t fo ssr r o Us om e

1. (a) How does drinking alcohol result in low blood glucose?

(b) The liver prioritises the metabolism of alcohol before restoring blood glucose. Suggest why this is the case:

2. Why does drinking alcohol reduce sports performance?

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

LINK

KNOW

No Cla t fo ssr r o Us om e

42 Nicotine and Blood Glucose and a potent carcinogen (cancer causing agent). It is also responsible for depressing appetite in smokers, partly through its indirect effect on the liver and the regulation of blood glucose levels.

PR E V ON IEW LY

Key Idea: Regulation of blood glucose levels is affected nicotine, which acts indirectly to increase blood glucose. Nicotine also affects blood glucose levels and its regulation. Nicotine is the highly addictive component of tobacco,

Adrenal gland

Nicotine from a cigarette enters the bloodstream

Red blood cell

Nicotine

Kidney

Increased heart rate

Adrenaline

Nicotine stimulates the production of adrenaline from the adrenal glands. Adrenaline stimulates an increase in blood glucose levels by acting on the liver and pancreas.

Liver

Pancreas

Insulin production is inhibited

Increased blood glucose (hyperglycemia)

The brain down-regulates hunger signals in response to increased blood glucose, so smokers do not get hunger signals so often.

Liver produces glucose by glycogenolysis (breakdown of glycogen) and gluconeogenesis (the generation of glucose from non-carbohydrate sources)

Brain

(b) Why do people often put on weight when they stop smoking?

2. Explain why nicotine acts as a stimulant:

WEB

KNOW

LINK

No Cla t fo ssr r o Us om e

1. (a) How does nicotine reduce appetite?

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

43 What Your Know So Far: Blood Glucose Diabetes mellitus

PR E V ON IEW LY

HINT: Compare and contrast the differences between type 1 and type 2 diabetes and their treatments.

Blood glucose regulation

HINT: Describe the role of the antagonistic hormones insulin and glucagon in regulating blood glucose levels.

Drugs and blood glucose regulation

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

HINT: Effects of alcohol and nicotine on BG.

REVISE

No Cla t fo ssr r o Us om e

44 What Determines Blood Pressure? the walls of the blood vessels. Blood pressure is closely regulated and goes up and down depending on the volume of blood, the amount of vasoconstriction (peripheral resistance), and the beating rate and power of contraction of the heart.

PR E V ON IEW LY

Key Idea: Blood pressure is regulated by four main determinants: blood volume, cardiac output, peripheral resistance, and overall compliance. Blood pressure refers to the pressure the blood exerts on

Determinants of blood pressure

Cardiac output

Cardiac output is a product of heart rate and stroke volume (the number of beats per minutes x the volume of blood pumped per beat). Heart rate Stroke volume

Cardiac output

Blood pressure

Blood volume

When blood volume increases, more blood returns to the heart with each cycle of heart beats (venous return), and so the heart pumps more blood with each beat (the stroke volume). The increase in stroke volume then increases cardiac output and thus arterial blood pressure. Blood volume is regulated by the reninangiotensin system, which operates through the kidneys. Blood volume

Blood pressure

Overall compliance

The elastic characteristics of the blood vessels contributes to the overall pressure in the vessels. The more elastic the blood vessels are, the lower the blood pressure. Blood vessel elasticity

Blood pressure

Peripheral resistance

The resistance of the arteries to blood flow. Vasoconstriction increases resistance whereas vasodilation decreases resistance. Consider the analogy of a bicycle tyre. The more air you pump into the tyre, the great resistance and the harder you have to work to pump more air in. Peripheral resistance

Overall compliance

Blood pressure

1. Provide an explanation for each of the following:

(a) Why increasing blood volume increases blood pressure:

(b) Why increasing cardiac output increases blood pressure:

No Cla t fo ssr r o Us om e

2. State whether blood pressure would initially go up or down in the following situations:

(a) Standing up suddenly after lying down for a significant time:

(b) Sprinting 50 m:

KNOW

LINK

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

45 Water Budget in Humans Body water content varies between individuals, and with age and sex. Men need more water than women due to their higher (on average) fat-free mass and energy expenditure. Infants and young children need more water in proportion to their body weight because they cannot concentrate their urine as efficiently as adults. Water losses from the skin are greater due to their greater surface area to weight ratio.

PR E V ON IEW LY

Key Idea: Water is required for physiological processes to function. Water needs vary depending on age and sex. Water is a requirement for physiological function and health and we cannot live without it for more than 100 hours. Water budget (intake and output) are closely matched to less than 0.1% over an extended period. Typical values for water gains and losses, as well as daily water transfers are given below.

Daily water transfers in an adult

From tract lumen

To tract lumen

Ingested: 2200 mL Saliva: 1500 mL

Gastric secretion: 1500 mL Bile: 700 mL

Intestinal absorption: 8000-8400 mL

About 63% of our daily requirement for water is met through drinking fluids, 25% is obtained from food, and the remaining 12% comes from metabolism (the oxidation of glucose to ATP, carbon dioxide, and water).

Pancreatic juice: 1500 mL Intestinal secretion: 1500 mL

Colonic salvage: 400 mL

Total: 8800 mL

Total: 8900 mL

100 mL water (200 mL faeces)

Metabolism Eating

Water losses

Urination Faeces Skin Breathing

Food and drink: 2200 mL per day

Skin and lungs: 900 mL per day

Metabolism: 300 mL per day

Urine: 1500 mL per day Faeces: 100 mL per day

Water gains

Drinking

Typically, we lose 60% of body water through urination, 36% through the skin and lungs, and 4% in faeces. Losses through the skin and from the lungs (breathing) average about 900 mL per day or more during heavy exercise. These are called insensible losses.

2. Describe four common causes of physiological dehydration: (a)

(c)

(b)

(d)

No Cla t fo ssr r o Us om e

1. Explain how metabolism provides water for the body's activities:

3. Some sports events have received media coverage because athletes have collapsed after excessive water intakes. This condition, called hyponatremia or water intoxication, causes nausea, confusion, diminished reflex activity, stupor, and eventually coma. From what you know of fluid and electrolyte balances in the body, explain these symptoms:

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

LINK

WEB

KNOW

No Cla t fo ssr r o Us om e

46 The Homeostatic Role of the Kidney balance, blood pressure, and red blood cell production. Blood pH is regulated by the secretion or retention of H+ ions. Blood pressure is regulated through the production of the hormone renin, while the production of red blood cells is stimulated by the production of the hormone erythropoietin.

PR E V ON IEW LY

Key Idea: The kidneys' roles are in excretion, and fluid and ion homeostasis. The functional unit of the kidney is the nephron. The kidneys are bean-shaped organs made up of many individual functional units called nephrons. The kidneys excrete the body's wastes and regulate fluid and electrolyte

The urinary system

Water provided by drinking and/or from food. Water provided by Some drinking mammals, such as koalas, are and/or from food. able to meet their water needs from the diet alone.

Mammalian kidney showing orientation of the nephrons.

Ureters: Conduct urine to

Tubule

Cortex

Kidneys: Production Kidneys: Production of of concentrated urine concentrated urine containing containing urea, excess urea, excess salts, and salts, and bicarbonate. bicarbonate.

Ureters: bladderConduct urine to bladder.

Capsule and glomerulus

Medulla

Collecting duct

Tubule

Loop of Henle

Ureter

Bladder: Urinestorage. storage Bladder: Urine

Urine flow

Nephron

Urethra: Conducts Urethra: Conducts urine to the Mammalian kidneys each contain more than one million nephrons, urine to the outside. outside selective filter elements which regulate the composition of the blood The human urinary system consists of the kidneys (bean and excrete wastes. In the nephron, the initial urine (excretory fluid) shaped organs that lie at the back of the abdominal cavity is formed by filtration in the glomerulus and Bowmanâ&#x20AC;&#x2122;s capsule. The either side of the spine), and bladder, and their associated filtrate is modified by secretion and reabsorption of ions and water. blood vessels and ducts (ureters and urethra). The These processes create a salt gradient in the fluid around the nephron, functional unit of the kidney is the nephron (right). which allows water to be withdrawn from the urine in the collecting duct.

Water loss is a major problem for most mammals. Human kidneys are very efficient, producing a urine that is concentrated to varying degrees depending on requirements. The urine is very concentrated when the body is dehydrated.

Blood pressure is regulated by the production of renin in the juxtaglomerular cells of the kidney. Renin secretion leads to the retention of sodium ions and stimulation of thirst, and results in an increase in blood volume and pressure.

At high altitude O2 pressure is very low. The kidneys assist the body in acclimatising to high altitude by producing erythropoietin which stimulates red blood cell production, increasing the oxygen carrying capacity of the blood.

2. Describe how the kidneys might respond in the following situations: (a) A person drinks a large volume of tap water:

(b) A person spends the afternoon lying in the hot sun without drinking:

3. Describe two other homeostatic roles of the kidney:

WEB

KNOW

LINK

No Cla t fo ssr r o Us om e

1. Describe how the kidneys help to maintain water balance in mammals:

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

47 The Structure of a Nephron Key Idea: The nephron is the functional unit of the kidney creating and using a salt gradient in the kidney to modify the composition of the urine it produces. The kidney nephron, is a selective filter element, made up of a renal corpuscle (glomerulus and capsule) and its associated tubules and ducts. Ultrafiltration, i.e. forcing fluid and dissolved substances through a membrane by pressure,

PR E V ON IEW LY

occurs in the first part of the nephron, across the membranes of the capillaries and the glomerular capsule. The formation of the glomerular filtrate depends on the pressure of the blood entering the renal corpuscle and is precisely regulated so that filtration rate per day stays constant. After formation of the initial filtrate, the urine is modified through secretion and reabsorption according to physiological needs at the time.

Renal corpuscle: Blood is filtered and the filtrate enters the convoluted tubule (enlargement below). The filtrate contains water, glucose, urea, and ions, but lacks cells and large proteins.

Nephron structure and function

Distal convoluted tubule: Further modification of the filtrate by active reabsorption and secretion of ions.

cap sule

Glomerulus

n's

Blood Filtrate (urine) Blood vessels around nephron

a Bowm

Renal corpuscle = Glomerulus + Bowman's capsule

Proximal convoluted tubule: Reabsorption of ~ 90% of filtrate, including glucose and valuable ions.

Loop of Henle: Transport of salt and passive movement of water creates a salt gradient through the kidney. The water is transported away by blood vessels around the nephron.

Collecting duct: Water leaves the filtrate (urine) by osmosis, making it more concentrated. The salt gradient established by the loop of Henle allows water to be removed along the entire length of the collecting duct.

(b) Proximal (near) convoluted tubule:

(d) Distal (far) convoluted tubule:

(e) Collecting duct:

2. Why are the nephrons all aligned in the same way in the kidney?

3. Explain the importance of the salt gradient in the kidney:

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

1. Summarise the main activities in each of the five regions of the nephron: (a) Renal corpuscle:

LINK

WEB

KNOW

No Cla t fo ssr r o Us om e

48 How the Kidney Regulates Fluid and Electrolytes Key Idea: The primary role of the kidneys is to regulate blood volume and composition so that homeostasis is maintained. The kidneys produce an excretory fluid called urine. By varying the volume and composition of the urine, the body is able to regulate its fluid and electrolyte balance, while excreting nitrogenous wastes. Urine formation begins by ultrafiltration

PR E V ON IEW LY

of the blood, as fluid is forced through the capillaries of the glomerulus, forming a filtrate similar to blood but lacking cells and proteins. The filtrate is then modified by secretion and reabsorption to add or remove substances (e.g. ions). The processes involved in urine formation are summarised below for each region of the nephron.

Summary of activities in the kidney nephron

2 Proximal tubule

1 Renal corpuscle

Filtrate

NaCl

Some drugs and poisons

Blood

H2O Salts (e.g. NaCl) HCO3- (bicarbonate) H+ Urea Glucose, amino acids Some drugs

HCO3-

H2O

Glucose and amino acids

H+

4 Distal tubule

HCO3-

NaCl

K+ and some drugs

H+

5 Collecting duct

Cortex

Medulla

3 Loop of Henle

H2O

NaCl

H2O

Reabsorption

Active transport

NaCl

Direction of filtrate flow

Passive transport Secretion (active transport)

NaCl

The loop of Henle has varying permeability to salt and water. The transport of salts and passive movement of water establish and maintain the salt gradient across the medulla necessary for the concentration of the urine in the collecting duct. Water leaving the filtrate is removed by capillaries to the venous circulation so that the high interstitial salt gradient is maintained.

Urea H2O

Urine (to renal pelvis)

1. (a) What is a nephron?

(b) What is its role in excretion?

No Cla t fo ssr r o Us om e

2. Explain the importance of the following in the production of urine in the kidney nephron:

(a) Filtration of the blood at the glomerulus:

(b) Active secretion:

WEB

KNOW

LINK

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

The Loop of Henle and water conservation

Glomerulus

Shorter loop of Henle = moderate interstitial salt gradient through the kidney

The capacity of the nephron to produce a concentrated urine depends on the length of the loop of Henle; the longer the loop, the larger the salt gradient through the interstitial fluid of the kidney. This can be seen when comparing humans, who are adapted to environments with plentiful water, and kangaroo rats, which are desert dwelling mammals adapted to limited water. A higher salt gradient allows more water to be withdrawn osmotically from the urine as it passes down the collecting duct.

(d) Osmosis:

Longer loop of Henle = very large interstitial salt gradient through the kidney

Collecting duct: water withdrawn from the urine

Nephron of non-desert living mammal (e.g. human)

Nephron of kangaroo rat

3. (a) What is the purpose of the salt gradient in the kidney?

(b) How is this salt gradient produced?

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

4. Discuss the a central role of the kidney in homeostatic regulation in mammals:

No Cla t fo ssr r o Us om e

49 ADH and Water Balance urine produced. This involves a hormone called antidiuretic hormone (ADH). Osmoreceptors in the hypothalamus monitor blood osmolarity (water content) and send messages to the pituitary gland which regulates the amount of ADH released. ADH promotes the reabsorption of water from the kidney collecting ducts, producing a less or more concentrated urine.

PR E V ON IEW LY

Key Idea: Antidiuretic hormone (ADH) helps maintain water balance by regulating water absorption by the kidneys. The body regulates water balance in response to fluctuations in fluid gains and losses. One mechanism by which fluid balance is maintained is by varying the volume of water absorbed by the kidneys and thereby the concentration of the Too little water in blood

Receptors in the hypothalamus detect there is not enough water in the blood (blood volume is too low and blood is too concentrated).

ADH is secreted from the pituitary gland. The amount released depends on how concentrated the blood is (the more concentrated the blood, the more ADH is released).

Too much water in blood

Receptors in the hypothalamus detect there is too much water in the blood (blood volume is too high and blood is too dilute). ADH secretion from the pituitary reduces or stops.

ADH travels via the circulatory system to the kidneys.

 ADH

 ADH

 Kidney permeability to water

 Kidney permeability to water

 Water absorption from urine

 Water absorption from urine

 Urine volume

 Urine volume

 Urine concentration

 Urine concentration

Blood volume increases until the levels return to normal.

Blood volume decreases until the levels return to normal.

1. What effect does ADH have on the kidneys?

No Cla t fo ssr r o Us om e

2. How do negative feedback mechanisms operate to regulate blood volume and urine output?

3. Predict whether a high fluid intake would increase or decrease ADH production:

4. (a) Diabetes insipidus is a type of diabetes caused by the a lack of ADH. Based on what you know about the role of ADH in kidney function, describe the symptoms of this disease:

(b) How would diabetes insipidus be treated?

WEB

KNOW

LINK

No Cla t fo ssr r o Us om e

50 Caffeine and the Body physiological changes it causes can affect the body's ability to maintain fluid and electrolyte homeostasis. Caffeine is found in many foods and beverages Moderate consumption rarely poses a health risk, but higher doses have negative effects including anxiety, insomnia, and rapid heart beat.

PR E V ON IEW LY

Key Idea: Caffeine is a stimulant. Its effects on metabolism can lead to disruption of fluid and electrolyte levels. Caffeine is a recreational drug found in many foods and beverages, including tea, coffee, cola drinks, chocolate, and energy drinks. It is a potent metabolic stimulant and the

The effects of caffeine on fluid and electrolyte levels

Caffeine is a stimulant drug and acts on the central nervous system. In high doses it can be lethal, while in lower doses it can produce a stimulatory effect, and is often used to reduce feelings of drowsiness and restoring alertness. The effects of caffeine begin less than an hour after consumption and take about five hours to wear off.

Caffeine and athletic performance

Caffeine has several metabolic effects. These include: Increased blood pressure

Increased metabolic rate

Increased heart and breathing rate

Increased adrenaline

Decreased ability to absorb Na+ and water in kidneys.

A maximum daily caffeine intake of 210 mg is recommended for adults (three cups of coffee). Caffeine

William Rafti Public Domain

Increased urination frequency

Caffeine can disrupt the body's ability to maintain balanced fluid and electrolyte levels. ffCaffeine decreases the kidney's ability to reabsorb sodium, potassium, and water. This can lead to electrolyte and fluid imbalances.

ffCaffeine increases heart rate so the kidneys

must filter a higher volume of blood and they may not be able to reabsorb electrolytes and water efficiently. Blood chemistry may become altered.

ffCaffeine is a diuretic, increasing urine volume

and urination frequency by inhibiting ADH secretion. Dehydration can occur if the lost fluids are not replenished.

Caffeine can improve athletic performance. It causes release of adrenaline, increasing heart rate and blood flow to the muscles. Glucose is released from the liver to provide energy. However, caffeine's negative effects (e.g. increased urine production and dehydration) may negate its positive effects for endurance sports.

No Cla t fo ssr r o Us om e

1. How does caffeine affect the body's ability to regulate fluid and electrolyte levels?

2. What is the physiological mechanism by which caffeine increases fluid loss?

3. (a) Caffeine was once on the International Olympic Committee list of banned substances in sport. Briefly explain why:

(b) Why do you think it is no longer banned?

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

KNOW

No Cla t fo ssr r o Us om e

51 Control of Blood Pressure Blood pressure and fluid volume are regulated by the juxtaglomerular (JG) apparatus, which is a specialised region of the nephron where the incoming arteriole and the distal convoluted tubule come into contact. The JG cells release a hormone called renin, which activates the renin-angiotensin system and leads to increased blood pressure. The release of renin is regulated through negative feedback (below).

PR E V ON IEW LY

Key Idea: The renin-angiotensin system is a hormone system that regulates blood pressure and fluid balance. Failure to maintain normal blood pressure and fluid volume can be fatal. High blood pressure can damage the walls of blood vessels leading to bulging blood vessels (aneurysms) and heart failure. When blood pressure is too low, insufficient blood is delivered to the organs and their function is impaired.

The renin-angiotensin system

Loss of blood pressure or volume

Distal convoluted tubule retains Na+ and H2O

Blood flow in

Reduction of filtrate volume or solute content in renal tubules

The effects of angiotensin II:

The blood vessels constrict, raising blood pressure by increasing peripheral resistance.

Juxtaglomerular cells stimulated

â&#x20AC;&#x201C;

When blood volume is restored, negative feedback stops continued response

Aldosterone

Aldosterone is released from the adrenal cortex. Aldosterone causes the distal convoluted tubules to retain sodium and therefore also water. Potassium is also retained. As a result, blood volume and pressure increase.

Blood flow out

The enzyme renin is produced

Stimulation of the thirst centre, promoting the urge to drink and thus replacing lost water.

Angiotensin II production

Adrenal cortex stimulated

Vasoconstriction of blood vessels increases peripheral resistance

Thirst centre in the hypothalamus is stimulated, promoting drinking

Aldosterone production by adrenal cortex leads to retention of sodium ions and water

Blood volume and pressure increase

2. (a) Suggest a situation that could cause a fall in blood volume:

No Cla t fo ssr r o Us om e

1. Why is it important to maintain normal blood pressure and volume?

(b) Explain how the renin-angiotensin system responds to a loss of blood volume:

WEB

KNOW

LINK

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

52 Hypertension beats. Normal blood pressure in an adult is given as 120/80. Hypertension is a reading of 140/90. Hypertension may present no symptoms but long term hypertension can lead to strokes, eye damage, damage to the small blood vessels, kidney damage, and heart disease. Hypertension may only be noticed during unrelated visits to a doctor.

PR E V ON IEW LY

Key Idea: Hypertension is defined as persistent long term high blood pressure, above 120/80. Blood pressure is given by two measurements (systolic/ diastolic). The first (systolic) is the pressure exerted by the heart during contraction (in mg of Hg). The second (diastolic) is the blood pressure when the heart is resting between

Blood pressure and hypertension Blood pressure category

Blood pressure

Normal

120/80 to 129/84

Pre-hypertension

130/85 to 139/89

Hypertension stage 1

140/90 to 159/99

Hypertension stage 2

160/100 to 179/109

Effects of hypertension

High blood pressure can cause damage to the fine capillaries in the retina, causing blindness.

High blood pressure puts stress on the walls of arteries and blood vessels. This can cause damage, leading to plaques that can cause blockages of blood vessels.

Hypertension crisis > 180/110 (emergency care required)

Hypertension causes and risk factors

Age: The risk of hypertension increases with increasing age. Family history: People with a family history of hypertension tend to be more at risk. Weight: Hypertension is more common in people who are overweight or obese. Physical inactivity increases the risk of hypertension.

Narrow or stiffened blood vessels force the heart to pump harder. The heart tends to enlarge with the extra effort needed, which reduces efficiency and can lead to heart failure.

High blood pressure can cause damage to the blood vessels in the kidneys, which interferes with their function.

Smoking increases blood pressure and damage to artery walls. It also stiffens artery walls.

Excessive salt and alcohol consumption increase the risk of hypertension.

Stress is a common cause of hypertension and is common in developed countries.

1. Identify three causes of hypertension:

3. Explain why consuming excess salt would lead to hypertension:

4. Explain why carrying excessive weight can cause hypertension:

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

2. How is hypertension diagnosed?

LINK

WEB

KNOW

No Cla t fo ssr r o Us om e

53 The Consequences of Kidney Failure kidneys no longer function properly. It leads to loss of fluid and electrolyte homeostasis and accumulation of toxic waste products in the blood and organs.

PR E V ON IEW LY

Key Idea: The kidneys have many important homeostatic roles, so kidney failure is a very serious medical condition. Kidney (renal) failure is a medical condition where the

Causes and consequences of kidney failure

Dehydration

Medications and drugs

Disease

Dehydration (not enough fluid in the body) can damage the kidneys. Causes of dehydration include: ffLoss of body fluids (for example from vomiting, diarrhoea, sweating, fever).

Some medications and drugs can cause kidney damage. Examples include: ffNon-steroidal anti-inflammatory drugs (e.g. ibuprofen).

Several diseases, medical or health conditions may reduce kidney function. Examples include: ffObstructions reducing blood flow to and from the kidneys.

ffSome antibiotics.

ffSepsis, a blood infection causing

ffInadequate fluid intake.

ffOveruse of diuretics (substances

that increase the rate of urination). Examples include some diet pills and caffeinated food and drinks.

ffIodine-containing medications used in radiology.

kidney inflammation and shutdown.

ffSome cancers.

ffDiuretic medications.

ffHigh blood pressure.

ffRecreational drugs such as alcohol,

ffDiabetes.

heroin, cocaine, and ecstasy.

ffKidney stones.

Kidney failure

Kidney failure may be acute or chronic. Acute kidney failure occurs when the kidneys suddenly stop functioning properly. Causes include dehydration, sudden illness or infection, or trauma. Chronic kidney failure is the progressive loss of kidney function over a period of months or years. Causes often include untreated diabetes or high blood pressure, or kidney disease.

The consequences of kidney failure

Anna Frodesiak: public domain

Patient undergoing kidney dialysis. The blood is run through a dialysis machine, which takes over the function of the kidney, removing wastes and excess water.

When the kidneys fail, toxins accumulate in the blood, electrolyte and fluid levels become unbalanced. Kidney failure results in anaemia, decreased bone density (calcium is leached from the bones to restore blood calcium), cardiovascular disease, and nerve damage. End-stage kidney failure, when 90% of kidney function is lost, is the result of untreated kidney failure. Without appropriate treatment, e.g. dialysis or a kidney transplant, end-stage kidney failure is fatal.

1. What does kidney failure mean?

WEB

KNOW

LINK

No Cla t fo ssr r o Us om e

2. Discuss the consequences of kidney failure to the homeostasis of the body's organ systems:

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

54 What Your Know So Far: Osmotic Balance The kidney's homeostatic role

PR E V ON IEW LY

HINT: Include its role in excretion and in fluid and electrolyte homeostasis. How is urine volume regulated and what is the significance of this?

Structure and function of the kidney

HINT: Include definitions and relate structural features to physiological role.

Blood pressure

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

HINT: Regulation of blood pressure and volume and the factors affecting this.

REVISE

55 Gas Transport in Humans

Air movement

No Cla t fo ssr r o Us om e

Key Idea: Haemoglobin is a respiratory pigment in red blood cells, which binds oxygen and increases the efficiency of its transport and delivery to tissues throughout the body. The transport of respiratory gases around the body is the role of the blood and its respiratory pigment. Most of the carbon dioxide in the blood is carried as bicarbonate in the plasma. Oxygen does not easily dissolve in blood, so in vertebrates, e.g humans, it is transported throughout the body chemically bound to the respiratory pigment haemoglobin (Hb) inside the red blood cells.

PR E V ON IEW LY

Bronchiole

In the muscles, oxygen from haemoglobin is transferred to and retained by myoglobin, a molecule that is chemically similar to haemoglobin except that it consists of only one haem-globin unit. Myoglobin has a greater affinity for oxygen than haemoglobin and acts as an oxygen store within muscles, releasing the oxygen during periods of prolonged or extreme muscular activity.

Alveoli

Capillary

Area of contact with lung capillary enlarged below

CO2

Most CO2 in the blood (85%) is carried as bicarbonate (HCO3-) formed in the red blood cells from CO2 in a reversible, enzymecatalysed reaction. HCO3diffuses out of the red blood cells and into the plasma where it contributes to the buffer capacity of the blood.

Gas exchange membrane: Formed by the epithelial cells of the alveolus and capillary together. It is only 0.5 µm thick so gases diffuse rapidly across.

HCO3-

HbO2

Most oxygen in the blood (97%) is carried in the red blood cells by the protein haemoglobin (Hb). Hb is a respiratory pigment and increases the amount of oxygen the blood can carry by binding oxygen in a reversible reaction.

When CO2 levels rise too quickly, H+ can accumulate in the blood, reducing pH. This provides a strong stimulus to increase breathing rate.

CO2

Carbon dioxide diffuses from the body’s cells into the capillary.

CO2

When oxygen levels are high (lungs and surrounding blood vessels) haemoglobin binds with a lot of oxygen (the Hb is saturated).

Body tissue capillary: The capillaries in the tissues are very close to the body’s cells,allowing for rapid diffusion back and forth.

HbO2

Each alveolus is a cupshaped pouch surrounded by lung capillaries.

When carbon dioxide levels are high (body tissues) haemoglobin releases its oxygen. Oxygen diffuses into the body’s cells from the capillary.

Body cells

5% dissolved in the plasma

75-85% as bicarbonate in cells and plasma

CO2

Respiring body cell

WEB

KNOW

Carbonic anhydrase

CO2 + H2O

LINK

Carbonic acid

Red blood cell

H2CO3

HCO3– + H+

Carried by Hb

10-20% carried bound to Hb (HbCO2); called carbaminohaemoglobin

Chloride diffuses into the red blood cell to counter the loss of bicarbonate ions. This is called the chloride shift.

No Cla t fo ssr r o Us om e

Transport of carbon dioxide in the blood

Cl-

Na+ + HCO3–

NaCl in blood

NaHCO3

H+ is picked up by Hb to form haemoglobinic acid (HHb). In this way, Hb acts as a blood buffer. Bicarbonate diffuses into the plasma where it combines with sodium.

77 Respiratory pigments and the transport of oxygen

ffThe100 most important factor determining how much

PR E V ON IEW LY

100

Fig.2: Oxyhaemoglobin dissociation curves for human blood at normal body temperature at different blood pH.

Percentage saturation of haemoglobin with oxygen

No Cla t fo ssr r o Us om e

Fig.1: Dissociation curves for haemoglobin and myoglobin at normal body temperature for fetal and adult human blood.

oxygen is Difference carried bybetween Hb is the level of oxygen in the 90 TheHb O 2) more saturation high tension, blood. greater theatoxygen Cthe (low and low pH H oxygen will combine with Hb. p O)

bin oglo aem h Globin ult Ad protein Iron

Each red blood cell contains iron-bearing haemoglobin molecules, which transport oxygen

6 8 10 4 PO2 (oxygen tension) (kPa)

Oxygenated blood

Deoxygenated blood

Hi gh

blo od

lobi n

mog

al C

50 ffMyoglobin in skeletal muscle has a very high affinity

hae

oxyhaemoglobin dissociation curve (left). In the pH ) 70 2 CO is picked up lung capillaries (high O2), a lot of oxygen h and60 bound by Hb. In the tissues (lowigO2), oxygen is released.

70 60

o m ffThis relationship can be illustrated inoran (n

No rm al

Feta l

Percentage saturation of haemoglobin or myoglobin with oxygen

for oxygen and will take up oxygen from Hb in the 40 It can therefore act as an oxygen store. blood. Lo w

n lobi og

ffFetal30Hb has a high affinity for oxygen and carries 20-30% more than maternal Hb. 20

ffThe release of oxygen to the tissues is enhanced by

the 10 effect of pH. As pH increases (lower CO2), more oxygen combines with Hb. As the blood pH decreases (higher CO2), Hb binds less oxygen and releases 6 8 Bohr10 more to0 the tissues. This the effect. 12 2 4 is called PO2 (oxygen tension) (kPa)

1. (a) Identify two regions in the body where oxygen levels are very high:

(b) Identify two regions where carbon dioxide levels are very high:

2. Explain the significance of the reversible binding of oxygen by haemoglobin (Hb):

3. (a) How is haemoglobin saturation affected by the oxygen level in the blood?

(b) What is the significance of this relationship to oxygen delivery to the tissues?

4. (a) How is the behaviour of fetal Hb different to adult Hb?

(b) Explain the significance of this difference:

(b) What is its significance?

6. Why is the high very affinity of myoglobin for oxygen important:

7. (a) How is most CO2 carried in the blood?

(b) Identify the two main contributors to the buffer capacity of the blood:

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

5. At low blood pH, less oxygen is bound by haemoglobin and more is released to the tissues: (a) Name this effect:

56 Responding to Changes in Oxygen Demand

No Cla t fo ssr r o Us om e

Key Idea: Control centres in the brain stem alter breathing and heart rates in response to exercise. Increased heart and breathing rates during exercise are brought about by control centres in the brainstem and occur in response to changes in blood pH caused by changes in the blood's concentration of CO2. A drop in blood pH indicates a

PR E V ON IEW LY

rise in CO2 and an increased demand for oxygen. The control centres are the respiratory and cardiovascular centres and their output influences the muscles responsible for breathing and heart contraction respectively. They monitor sensory information from cells in the lungs and the vessels of the heart and adjust the breathing and heart rates as required. Higher brain centres influence the cardiovascular centre, e.g. excitement or anticipation of an event.

Respiratory control

Cardiovascular control

+ –

Increase in rate

Decrease in rate

The respiratory centre can be voluntarily controlled by input from the cerebrum, e.g. holding your breath. Stretch receptors in the bronchioles and bronchi monitor lung inflation and send impulses to respiratory centre to inhibit inflation (end the breath in).

Sensory receptors in aorta, carotid arteries, and vena cava give feedback to cardiovascular centre on blood chemistry and pressure.

Respiratory centre coordinates response.

Cardiovascular centre coordinates responses.

–

Chemoreceptors in the aorta and carotid arteries give feedback on blood pH to the respiratory centre. The chemoreceptors respond to pH and are relatively insensitive to oxygen.

Output to heart via cardiac nerve increases heart rate.

Output to heart via vagus nerve decreases heart rate.

–

Respiratory centre sends impulses to the diaphragm and intercostal muscles to contract (and bring about inhalation).

The heart muscle has an intrinsic rhythm but this basic rate is influenced by the cardiovascular centre.

Influences on heart rate

Influences on breathing rate

Increase

Decrease

Increase

Decrease

Voluntary control

Increased physical activity

Decreased physical activity

H+

or CO2 Increase in concentrations in blood

Decrease in or CO2 concentrations in blood

Increased body temperature

Decrease in body temperature

Decrease in blood pressure

Increase in blood pressure

Increased physical activity

Decreased physical activity

H+

Increase in or CO2 concentrations in blood

Decrease in H+ or CO2 concentrations in blood

Secretion of adrenaline

Re-uptake and metabolism of adrenaline

No Cla t fo ssr r o Us om e

H+

Decrease in blood pressure

Increase in blood pressure

1. What is the benefit of being able to consciously control some aspects of breathing?

2. How is the oxygen concentration in the blood kept relatively constant?

LINK

KNOW

LINK

No Cla t fo ssr r o Us om e

57 Homeostasis During Exercise demands for oxygen increase, and there are more waste products produced, which must be transported away and metabolised. Maintaining homeostasis during exercise is principally the job of the circulatory and respiratory systems, although the skin, kidneys, and liver are also important.

PR E V ON IEW LY

Key Idea: Maintaining homeostasis during exercise is principally the job of the circulatory and respiratory systems. During exercise, greater metabolic demands are placed on the body and it must work harder to maintain homeostasis. Extra heat generated during exercise must be dissipated,

Physiological changes during exercise

Increased body temperature During exercise, the extra heat produced by muscle contraction must be dispersed to prevent overheating. Thermoregulatory mechanisms, such as sweating and increased blood flow to the skin, release excess heat into the surrounding environment and help cool the body.

Working muscles need more ATP than muscles at rest.

Increased heart rate An increased heart rate circulates blood around the body more quickly. This increases the rate at which exchanges can be made between the blood and the working tissues. Oxygen and glucose are delivered and metabolic wastes (e.g. carbon dioxide) are removed.

Increased breathing rate Exercise increases the body's demand for energy (ATP). Oxygen is required for cellular respiration and ATP production. Increasing the rate of breathing delivers more oxygen to working tissues and enables them to make the ATP they need to keep working. An increased breathing rate also increases the rate at which carbon dioxide is expelled from the body.

Increased glucose production During exercise, working muscles quickly use up freely available blood glucose. Glucose is mobilised from glycogen stores in the liver and supplies the body with fuel to maintain ATP production.

1. Describe the general physiological changes that occur during exercise:

2. (a) Name the body systems primarily responsible for maintaining homeostasis during exercise:

(b) Briefly describe how these systems respond to maintain homeostasis:

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

LINK

KNOW

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

The body has an immediate response to exercise but also, over time, responds to the stress of repeated exercise (called training) by adapting and improving its capacity for exercise and the efficiency with which it performs. This concept is illustrated below. Training causes tissue damage and depletes energy stores, but the body responds by repairing the damage, replenishing energy stores, and adjusting its responses in order to minimise the impact of exercise in the future.

Other body parts

5.5 litres total: muscle 0.8-1 litre

Resting man

20-25 litres total: muscle 15-20 litres

Heavy exercise: average man

0.25 litres total: muscle 0.05 litre

Oxygen consumption

Cardiac output (total blood flow)

Muscle

Resting man

3-3.5 litres total: muscle 2.8-3.3 litres

Heavy exercise: average man

30-35 litres total: muscle 26-31 litres

5-6 litres total: muscle 4.8-5.8 litres

Heavy exercise: trained athlete

3. The graph above shows the change in cardiac output (a measure of total blood flow) and oxygen consumption between resting and exercise in an athlete and an average man. The different shading on the bars indicates the proportion of oxygen or blood flow in skeletal muscle compared to other body parts.

(a) Describe what happens to the output of the heart (total blood flow) during heavy exercise:

(b) Why does this happen?

4. (a) What happens to oxygen consumption during heavy exercise?

(b) Why does this change occur?

No Cla t fo ssr r o Us om e

5. Explain the difference in oxygen consumption and blood flow between a trained athlete and an average person:

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

58 Exercise and Heart Rate enables them to make the ATP they need to keep working. An increased breathing rate also increases the rate at which carbon dioxide is expelled from the body. Heart rate also increases so blood can be moved around the body more quickly. This allows for faster delivery of oxygen and removal of carbon dioxide.

PR E V ON IEW LY

Key Idea: Breathing rate and heart rate both increase during exercise to meet the body's increased metabolic demands. During exercise, the body's metabolic rate increases and the demand for oxygen increases. Oxygen is required for cellular respiration and ATP production. Increasing the rate of breathing delivers more oxygen to working tissues and In this practical, you will work in groups of three to see how exercise affects breathing and heart rate. Choose one person to carry out the exercise and one person each to record heart rate and breathing rate. Heart rate (beats per minute) is obtained by measuring the pulse (right) for 15 seconds and multiplying by four. Breathing rate (breaths per minute) is measured by counting the number of breaths taken in 15 seconds and multiplying it by four.

Gently press your index and middle fingers, not your thumb, against the carotid artery in the neck (just under the jaw) or the radial artery (on the wrist just under the thumb) until you feel a pulse.

Measuring the radial pulse

CAUTION: The person exercising should have no known pre-existing heart or respiratory conditions.

Procedure

Measuring the carotid pulse

Resting measurements

Have the person carrying out the exercise sit down on a chair for 5 minutes. They should try not to move. After 5 minutes of sitting, measure their heart rate and breathing rate. Record the resting data on the table (right).

Heart rate (beats minute-1)

Breathing rate (breaths minute-1)

Resting

Exercising measurements

Choose an exercise to perform. Some examples include step ups onto a chair, skipping rope, jumping jacks, and running in place. Begin the exercise, and take measurements after 1, 2, 3, and 4 minutes of exercise. The person exercising should stop just long enough for the measurements to be taken. Record the results in the table.

1 minute

2 minutes 3 minutes 4 minutes

Post exercise measurements

After the exercise period has finished, have the exerciser sit down in a chair. Take their measurements 1 and 5 minutes after finishing the exercise. Record the results on the table.

1 minute after

5 minutes after

1. (a) Graph your results on separate piece of paper. You will need to make left and right vertical axes, one for heart rate and another for breathing rate. When you have finished answering the questions below, attach it to this page. (b) Analyse your graph and describe what happened to heart rate and breathing rate during exercise:

No Cla t fo ssr r o Us om e

2. (a) Describe what happened to heart rate and breathing rate after exercise:

(b) Why did this change occur?

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

LINK

PRAC

59 Fight or Flight

No Cla t fo ssr r o Us om e

the release of the hormones adrenaline and noradrenaline. These hormones help to prepare the body to cope with shortterm stressful situations. The interactions of the hypothalamus, pituitary and adrenal glands control the body's reactions to stress and regulate many of the body's processes, including digestion, immune function, mood, sexuality, and energy storage and expenditure.

PR E V ON IEW LY

Key Idea: The fight or flight response is an adaptive response, which prepares the body to deal with stress. The stress response, also known as the fight or flight response, is a physiological reaction that occurs when someone is confronted with a short-term stressful situation. It is triggered through sympathetic stimulation of the central medulla region of the adrenal glands. This stimulation causes

Short term response to stress

Stress

Hypothalamus

Spinal cord

Synapse

Nerve impulses

Sympathetic nerve fibres

Anterior pituitary

Adrenal medulla

The flight or fight response is activated during times of shortterm stress. Examples of shortterm stress include dangerous situations, when a high level of performance is required, or during competition (above).

Adrenaline

Short term stress response (fight or flight syndrome)

1. Increased heart rate

2. Increased blood pressure

3. Liver converts glycogen to glucose; blood glucose levels increase 4. Dilation of bronchioles

5. Blood flow to gut and kidney reduced

Blood flow to muscles and brain increased

6. Increased metabolic rate

The physiological changes occurring as part of the short term stress response provide the body with increased strength and speed. After the stress has passed, it takes about 20 to 60 minutes for the body to return to normal levels of activity.

2. How is the body's short term response to stress adaptive?

WEB

KNOW

LINK

No Cla t fo ssr r o Us om e

1. Briefly outline what occurs during the flight or fight response:

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

60 The Effects of High Altitude of the physiological effects of high altitude arise from the low oxygen pressure, not the low air pressure in itself. Humans can make both short and long term physiological adjustments (acclimation) to altitude.

Physiological adjustments to altitude

Time scales of physiological changes at altitude

The body makes several physiological adjustments to compensate for the low oxygen pressure at altitude. However, sudden exposure to an altitude of 2000 m causes breathlessness, and ascending above 4500 m too rapidly results in mountain sickness. The symptoms include breathlessness and nausea. Continuing to ascend with mountain sickness can result in fatal accumulation of fluid on the lungs and brain.

Some physiological adjustments to altitude take place almost immediately (e.g. increased breathing and heart rates). Other adjustments, such as increasing the number of red blood cells (RBCs) and associated haemoglobin level, may take weeks. These responses all improve the rate oxygen is supplied to the body's tissues. When more permanent adjustments to physiology are made (increased blood cells and capillaries), heart and breathing rates return to normal.

PR E V ON IEW LY

Key Idea: Short and long term physiological changes help the body adjust to the low oxygen conditions at high altitude. Air pressure decreases with altitude so the pressure (therefore amount) of oxygen in the air also decreases. Many

The kidneys produce the hormone erythropoietin (EPO). This stimulates an increase in the production of RBCs.

Increase in heart rate. Heart rate at altitude increases up to 50% above the rate at sea level, although the stroke volume (the amount of blood pumped per contraction) remains the same.

Effect

Minutes

Days

Weeks

Increased heart rate Increased breathing

Concentration of blood Increased red blood cell production

Increased capillary density

170

Effects of altitude on haemoglobin levels

Acid-base readjustment and an increase in red blood cells (RBCs) are longer term changes. Hyperventilation increases O2 in the blood, but it also reduces CO2. This makes body fluids more alkaline. The kidneys respond to this by removing bicarbonate from the blood.

Increased rate of breathing (hyperventilation). Normally, the rate of breathing is regulated by a sensitivity to blood pH (CO2 level). However, low oxygen pressures (pO2) in the blood induce a hypoxic response, stimulating oxygen-sensitive receptors in the aorta and inducing hyperventilation.

Haemoglobin / g L-1

160

Increased haemoglobin allows more O2 to be transported to the tissues.

150 140 130 120

Prealtitude

Days at altitude

Postaltitude

(b) What name is given to describe these effects?

No Cla t fo ssr r o Us om e

1. (a) Describe the initial effects of high altitude on the body in people who are not acclimated:

2. (a) Name one short term and long term physiological adjustment that humans make to high altitude:

(b) How do these adjustments help to increase the amount of oxygen the body receives?

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

LINK

KNOW

61 Cooperating Systems: Acid–Base Balance

No Cla t fo ssr r o Us om e

throughout the body to maintain the pH of blood plasma close to 7.40. The body maintains the buffer by eliminating either the acid (carbonic acid) or the base (bicarbonate ions). The blood buffers, the lungs, and the kidneys interact to maintain pH homeostasis. Changes in breathing rate bring about rapid changes in pH. The renal system acts more slowly, controlling pH by either excreting or retaining ions.

PR E V ON IEW LY

Key Idea: The body's acid-base balance is maintained by interactions between three body systems. Normal functioning of the body requires that the pH of the body's fluids are maintained between pH 7.35 and 7.45. The products of metabolic activity are generally acidic and could alter pH considerably without a buffer system to counteract pH changes. The carbonic acid-bicarbonate buffer works

The blood buffer system

A buffer is able to resist changes to the pH of a fluid when either an acid or base is added to it. The bicarbonate ion (HCO3–) and its acid, carbonic acid (H2CO3), work in the following way:

H+ + HCO3– H2CO3

Strong base neutralised to weak base

OH–

HCO3–

H+

H2CO3

H+ + HCO3–

If a strong acid (such as HCl) is added to the system a weak acid is formed and thus the pH falls only slightly.

The respiratory system

Carbon dioxide (CO2) in the blood, an end-product of cellular respiration, forms carbonic acid (H2CO3) which dissociates to form H+ and bicarbonate (HCO3–).

Strong acid neutralised to weak acid

The blood also contains proteins, such as serum albumin (above) which contain basic and acidic groups that may accept or donate H+ to help maintain blood pH.

Signal to brain

CO2 + H2O

H2CO3

As CO2 rises in the blood so too does the H+ concentration. Chemoreceptors in the brain detect the rise in H+ ions and increase the rate of breathing to expel the CO2.

A net loss of HCO3– effectively results in the gain of H+. Bicarbonate is reabsorbed by the kidney tubules all the time so pH is regulated mainly through retaining or secreting H+. When blood pH rises, H+ is retained by the tubule cells. When blood pH falls, H+ is actively secreted into the kidney tubules. The kidneys can also produce HCO3– which enters the body fluids. Urine pH normally varies from 4.5 to 8.0, reflecting the ability of the renal tubules to lose or retain ions to maintain blood pH homeostasis.

LINK

KNOW

Increase in breathing rate

H2CO3

Rise in pH stimulates:

The renal system

LINK

Anxiety can make some people hyperventilate. They breathe too deeply and quickly and breathe out more CO2 than their body is producing, raising their blood pH. They can reverse the effects by breathing into a paper bag.

Retain H+

H+ + HCO3–

Fall in pH stimulates:

Removal H+

No Cla t fo ssr r o Us om e

Low levels of CO2 have the effect of depressing the respiratory system so that H+ builds up and the pH is once again restored.

Urine has a slightly acid pH 6 but can range from pH 4.5-8.0. Diet, and certain disease processes and medications can alter urine pH showing that the kidneys are working to retain or excrete H+ to regulate blood pH.

Equates to removal of HCO3–

Equates to gain of HCO3–

No Cla t fo ssr r o Us om e

PR E V ON IEW LY

1. Why must the blood must be kept at a pH between 7.35 and 7.45?

2. A drop in the blood pH to below 7.35 is called metabolic acidosis. If prolonged, it can be life threatening: (a) From information on the previous page, explain how metabolic acidosis might arise:

(b) What would you expect the levels of bicarbonate ions to be in the blood of someone with metabolic acidosis? 3 (a) How does the blood buffer system maintain blood pH?

(b) What happens when a base (e.g. ingestion of alkaline substances) is added to the system?

4. (a) Describe the respiratory response to excess H+ in the blood:

(b) Where do these H+ ions come from?

5. An abnormal increase in blood CO2 is called respiratory acidosis.

(a) Explain the consequences to blood pH of increased CO2:

(b) Explain how respiratory acidosis might arise:

No Cla t fo ssr r o Us om e

6. (a) What would happen to the blood pH of someone who was hyperventilating during an anxiety attack?

(b) Why does breathing into a paper bag help someone who is hyperventilating?

7. Explain the role of the renal system in maintaining the pH of the blood:

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

Key Idea: Endurance sport places many stresses on the body and makes it harder for the body to maintain steady state conditions.

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

62 The Challenges of the Coast to Coast Kumara Beach

Tasman sea

The Coast to Coast is one of New Zealand's premier multisport events. It traverses the South Island from Kumara Beach, south of Greymouth, across the Southern Alps and Canterbury Plains to Sumner Beach on the outskirts of Christchurch. The race covers 243 km over either one or two days and involves 36 km of running, 140 km cycling, and 67 km of kayaking. Day 1 of the two day event starts with a 3 km run, then a 55 km cycle, and finishes with a 33 km mountain run over the Southern Alps. Day 2 begins with a 15 km cycle, followed by the 67 km kayak down the Waimakariri River, and a 70 km cycle to Sumner Beach. The one day event includes all of these stages. The race takes about 11 hours for the fastest competitors. In addition to requiring extensive training, fitness, and determination, the race requires competitors to manage their clothing, food and liquid intake throughout the race and avoid dehydration, exhaustion, heat stroke, or hypothermia (if the weather turns very cold).

Lake Brunner

Cycle Run

Kayak

Stage profiles

Kumara Beach

300

Aickens

Altitude (m)

Sumner Beach

Stage 2

Klondyke Corner

Stage 3

Photo: NASA

Waimakariri River Bridge

400

Stage 2 requires a physically demanding off-road mountain run over the MinghaDeception Route via Goat Pass (the highest point at about 1100 m). Air temperatures can vary widely, rising to 15 oC on a warm day and dropping below 0 oC on a cold day. Wind speeds may be gentle to gale force. A competitor's core body temperature will be elevated by this point in the race (around 3-4 hours). Some competitors may drink directly from the streams, which will be very cold, cooling the core body temperature.

"...about 14 km into the run, so the race has been going for about three hours at this stage. The first bike ride has taken a lot of effort, so the focus by this point in the day was to try and keep drinking and eating to keep myself in the race. Twelve hours is a long time if you don't eat and drink well..." James Kuegler: Coast to Coast 2011.

LINK

Photo: James Kuegler

KNOW

LINK

Sumner Beach

No Cla t fo ssr r o Us om e

Stage 2: Mountain run

The first stage includes a 3 km run and 55 km cycle. On a cold day, there is an initial delay in performance. Cold temperatures cause vasoconstriction, reducing blood flow to the muscles which reduces their capacity to produce movement (and waste heat which can help warm the body). Initially, warm layers and wind-breaking clothing may be worn to keep warm but too many layers may make it difficult to cool down later in the stage by hampering heat loss by convection. On a warm day, competitors must be careful not to over-exert themselves without replacing fluids and electrolytes. They may use 2 L of water in this stage. Warm air temperatures make it harder for the body to lose heat to the air because of the reduced thermal gradient. It is likely competitors will be using glucose energy and fluid faster than they can be replaced so they must be careful to replace these when they can.

LINK

Stage 4

Distance (km)

Stage 1: Run and cycle

WEB

Waimakariri River Bridge

Klondyke Corner

700

Pacific Ocean

Aickens

1200

Banks Peninsula

Stage 1

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

87 Stage 3: Cycle and Kayak

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

The weather conditions on the western side of the Southern Alps of New Zealand can be very different to those on the eastern side. Conditions can range from very cold and wet to very hot and dry. The kayaking requires a lot of effort from upper body muscles. The water temperature of the Waimakariri River will be very cold as it is fed from high alpine streams and the route through the Waimakariri River Gorge is narrow and parts of the river may be shadowed by the high cliffs. Competitors will be wearing extra layers as well as the compulsory helmet, which keeps heat in, and a life vest.

"... Throughout the course of the bike ride I was unable to consume enough food due to the intensity that we were riding though I did consume 5 bottles (3.5 L) of water. By the time we reached the start of the kayak I had an 11 minute lead on the rest of the field. Unfortunately, as I had thought it would be cold on the kayak, I had only prepared 1 L of water in my hydration system in my kayak. By that stage in the race I was severely dehydrated, severely undernourished, tired and battling to hold onto my lead..." James Kuegler: Coast to Coast 2010

" ...how many extra layers I should put on, the Waimakaririri is always cold, made colder by one accidental swim... ...paddle jacket on, which means that I will be hot, though it is much easier to cool yourself down by splashing water on yourself than heat up on the river..." James Kuegler: Coast to Coast 2011

Photo: James Kuegler

Stage 4: Cycle

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

Photo: James Kuegler

The final run through the sand to the finish line (right). Exhaustion may overwhelm a competitor moments after they cross the line. Warming down (keeping moving) and replacing energy and fluids is crucial. Endorphins may provide some natural pain relief, which may lead to athletes ignoring injuries.

No Cla t fo ssr r o Us om e

Photo: James Kuegler

The final stage requires a 70 km cycle to Sumner Beach (left). The altitude drops 250 m over the 70 km, with roads mostly flat on the final 30 km, but it comes on the end of more 150 km of racing, and energy and fluid levels will be low. High temperatures and winds make the stage physically demanding. Glucose energy and fluids must be replenished to avoid exhaustion. Glucose provides the energy required by the muscles to produce work. Fluids (and electrolytes) help the body regulate temperature and maintain the ionic balance required for cell functioning (e.g. sodium for nerve cell function). High electrolyte losses at this stage may result in cramping, while high fluid losses may contribute to heat stroke from an inability to dissipate the heat energy produced by the muscles.

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

1. Why is it important the competitors choose the right kinds of clothing at the start of the race?

2. How do competitors remain cool during the mountain run?

3. Why do competitors need to keep eating and drinking throughout the race?

4. Why should a competitor wear extra layers of clothing in the kayak section even though this will probably result in them being too hot?

No Cla t fo ssr r o Us om e

5. Why is maintaining electrolyte levels so important?

6. A 70 kg person uses approximately 293 kJ km-1 while running, 118 kJ km-1 while cycling, and 208 kJ km-1 while kayaking.

(a) Calculate the energy usage of a 70 kg person during the Coast to Coast:

(b) A 70 kg person needs about 8700 kJ per day for normal activity. How many times more energy is needed to complete the Coast to Coast in one day and how might this intake be achieved?

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

63 The Ultramarathon: A Personal Account What follows is a personal account of the Tarawera Ultramarathon by Dawn Tuffery, an ultra-distance runner. At the time of this race in 2012, she was still breastfeeding and lacking in training. It wasn't the easiest ultra she'd run.

PR E V ON IEW LY

Key Idea: Many adverse physiological responses can occur when fluid and electrolyte intakes are inadequate, and homeostasis is disrupted.

"Attempting an 85 km race on only 4 weeks training is a bit of a gamble. Training overall was a very mixed bag, and 90% behind the stroller. This is good for core strength, but bad for off-road and hill skills. A ‘peak’ running day consisted of 30 minutes to playgroup in the morning, two hours around the river paths, lunch in town, an hour home and 90 minutes after Alba had gone to bed. Less than ideal, but I crossed my fingers that enthusiasm and momentum would see me through.

Race morning unfolded well. I fed my daughter and made the final systems check – number, toe socks, five-fingers, gels, pack, plasters, electrolytes, water, headlamp? Good to go! The first stage went fast, as I enjoyed the relaxed pace of the bottlenecks. Cheering at the first of the aid stations had me running tall and fast, but not actually remembering to eat. I barrelled through the first of many water crossings. First leg done, check. Feet and legs undamaged, check.

1. What physiological challenges did Dawn face during the race?

Dawn - having fun at this stage. Use this account as a basis for a group discussion. Read it, then make some brief notes under the headings below. On a separate sheet, write a discussion about the homeostatic challenges facing an athlete during an ultra-marathon. Think about the time involved, and the demands of high intensity exercise over difficult terrain with limited access to food and water. There are only four aid stations along the course. What factors might have been involved in Dawn's dizziness and blackout at the end of the race? Why do you think her milk supply was reduced for 24 hours after the race?

No Cla t fo ssr r o Us om e

It didn’t help that I started feeling dizzy, and was distracted with trying to fix it. More electrolytes? Fewer electrolytes? Caffeine? Sugar? Salt? Pizza? Ginger? Coke? Nothing seemed to really fix it, so I just stood still for a bit if it seemed I was about to fall over. The run became a point to point survival mission. ' How far?' I asked one volunteer desperately as the brain fog spells increased. ‘About 8 k?’ he said, knocking my hopes. Then seemingly around the corner was another aid station, and a volunteer suggested 3 km at the most. I was going to make it after all. Finish lines are always magic, but they’re especially magic in a challenging ultra. Whanau snuggle! Sitting down! Relief! I wandered across the field and then just keeled over. I’m still not sure what prompted the dizziness and blackout. I recovered, although my daughter received a little less milk for the next 24 hours – prompting a worried text to a friend that I ‘broke my breasts!’ – but that came right too. Strange sport. Bring on 100 km 2013!

Photo: Emma Andrews

The hill after Okareka provided a reminder that I hadn’t run up any hills in four months. Reaching the top of the hill was a high point. Stopping for an extended toilet stop, definitely wasn't. The support at the next aid station was a boost. I refilled with fluids and headed on to the next section. It’s a stunning, roller-coaster playground track amid seriously pretty scenery and the grumpiness didn’t kick in for another hour. A whiny internal monologue started up during the tricky bits, reminding me that this was no fun, and a terrible idea, and we weren’t even going to make 9 hours at this slow speed and it was a stupid run … and so on. At which point something went BANG in my calf and I couldn’t walk. At this rate I wasn’t going to make it to the top of the hill, let alone the finish. I sat down for a while and had a quiet freak. After calming down I discovered I could limp uphill backwards, and over the next ten minutes the pain seemed to ease up gradually until I could jog-limp. Onwards, upwards, downwards, earthwards. Whenever I was feeling fabulous and sure-footed, a toe-stub face-plant wasn’t far away. Why do we do this again, piped up that internal whine? Perhaps for the awe of seeing the Tarawera falls appear suddenly as you round a corner. The falls mean an aid station is coming, which also means there’s only 25 km or so to go! I located my drop bag and decided to push on through. 10 minutes later the monologue was in full swing up a never-ending hill, having dropped some vocabulary in the forest (‘stupid race stupid run stupid stupid’).

2. What possible factors were involved in her dizziness and blackout at the end of the race?

KNOW

64 Smoking and the Gas Exchange System

No Cla t fo ssr r o Us om e

end of World War I because they were cheap, convenient, and easy to smoke. The mild smoke is readily inhaled, allowing nicotine (an addictive poison) to be quickly absorbed into the bloodstream. Cigarette smoke also contains poisonous gases, such as carbon monoxide, and the tar contains many carcinogens. Smoking is associated with a large number of diseases, including cancers and heart and lung diseases.

PR E V ON IEW LY

Key Idea: Tobacco smoking is a major health hazard associated with nicotine addiction, cancer, and chronic diseases of the cardiovascular and gas exchange systems. Tobacco smoking has been accepted as a major health hazard only relatively recently in historical terms, despite its practice in Western countries for more than 400 years, and much longer elsewhere. Cigarettes became popular at the

The effects of tobacco smoking on the gas exchange system All forms of tobacco-smoking increase the risk of mouth cancer, lip cancer, and cancer of the throat (pharynx).

Mucus

Chronic bronchitis: Excess mucus blocks airways, causing inflammation and infection. There is often a persistent cough. Cigarette smoking is the most common cause.

Capillary Inflammation

Smoking and the carcinogens in tobacco smoke is strongly linked to lung cancer. Most cancers that start in the lung derive from uncontrolled growth of epithelial cells. The vast majority of lung cancer cases occur in smokers.

Diagrams show cross sections through a bronchiole with chronic bronchitis (upper) and emphysema (lower). Both are associated with COPD. Bronchitis is a symptom, whereas emphysema is a description of lung changes.

Lung capacity is reduced.

Smoking is also linked to chronic obstructive pulmonary disease (COPD). COPD is a persistent inflammatory lung disease that causes obstructed airflow from the lungs. It causes symptoms, such as shortness of breath and chronic bronchitis, and changes to the lung tissue itself, such as emphysema.

Emphysema: Destruction of capillaries and structures supporting the small airways and lung tissue. Cigarette smoking is the most common cause.

How smoking damages the lungs

Cavities lined by heavy black tar deposits.

Non-smoker

Normal alveolar arrangement

Smoker

Coalesced alveoli

Cells lining airways

Smoke particles

Extra mucus produced

Smoke particles indirectly destroy the walls of the lungâ&#x20AC;&#x2122;s alveoli

WEB

KNOW

LINK

64 55

Cancerous cell

CDC

Thin layer of mucus

No Cla t fo ssr r o Us om e

Cilia

Lung tissue from a patient with emphysema. Tobacco tar deposits can be seen. Tar is a toxic resinous, residue of tobacco smoke and contains at least 17 known carcinogens (cancer-causing agents) including benzene, acrylamide and acrylonitrile. Tar damages the teeth and gums, desensitises taste buds, and accumulates in the lung tissue (above). The carcinogenic components of tar cause DNA mutations in the delicate epithelial cells of the lung, leading to lung cancer.

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

Normal lung tissue

Normal tissue

PR E V ON IEW LY

Coalesced alveoli

Nephron

Emmanueim

Cancerous tissue

Emphysema is typical of COPD. It is characterised by narrowing of the small airways and breakdown of lung tissue. The breakdown of the lung tissue causes the formation of large air pockets (in the left of the photo above). Air flow and gas exchange rates are very poor.

Most lung cancers begin in the epithelial cells of the lung. DNA damage from exposure to the carcinogens in tar leads to cell proliferation and tumour formation. Lung cancer is the second most common form of cancer in the UK and the vast majority of cases are associated with cigarette smoking.

Chronic bronchitis is associated with COPD although there are other causes. It is accompanied by a persistent, productive cough, where sufferers attempt to cough up the mucus that accumulates in the airways, and leads to inflammation. The poor airflow is not improved with bronchodilator therapy.

1. Discuss the physical changes to the lung that result from long-term smoking:

2. COPD is a chronic inflammatory disease associated with smoking:

(a) What does chronic mean?

(b) What symptoms are associated with COPD:

(a) Explain why a long term study was important:

(b) The study made a link between cigarette consumption and mortality from lung cancer. What else did it show?

4000

Cigarette consumption (men)

3000

100

2000

1000

Data NIH, US

1900

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

150

Lung cancer (men)

1920

1940 Year

1960

1980

Lung cancer deaths per 100 000

No Cla t fo ssr r o Us om e

4. A long term study showed the correlation between smoking and lung cancer, providing supporting evidence for the adverse effects of smoking (right):

Cigarettes smoked per person per year

3. Describe how the inhalation of the particulates, such as tar, in tobacco smoke can lead to lung cancer:

65 Smoking and the Cardiovascular System

No Cla t fo ssr r o Us om e

to constrict arteries, increase blood pressure and heart rate, mobilise fat stores, and increase metabolic rate. Carbon monoxide is also toxic, displacing oxygen from haemoglobin and reducing the oxygen content of the blood. The effects of nicotine and carbon monoxide increase the workload of the heart and increase the risk of heart disease, peripheral vascular disease, and stroke.

PR E V ON IEW LY

Key Idea: The nicotine and carbon monoxide in tobacco smoke have immediate and long term effects on the cardiovascular system. These effects are associated with increased blood pressure and elevated heart rate. Together with the carcinogens in tar, nicotine and carbon monoxide are among the most harmful components of tobacco smoke. Nicotine is an addictive poison acting quickly

Short term effects of smoking

Long term effects of smoking

After inhaling, nicotine enters the bloodstream rapidly and reaches the brain within 8 s where it increases the release of many chemical messengers including acetylcholine and dopamine and stimulates the brain's reward centres.

The nicotine and carbon monoxide in tobacco smoke increase the viscosity of the blood, which increases the risk of fatty plaques forming in the coronary and carotid arteries. These plaques increase the risk of heart attack and stroke.

Nicotine raises blood pressure (10-30 points). Chronic high blood pressure is the single most important risk factor for stroke (cell death in the brain as a result of impaired blood flow).

Plaque within a coronary artery

Heart attacks usually result when blood flow to the heart muscle is interrupted, often following rupture of a plaque. The muscle becomes starved of oxygen and dies. Chronic high blood pressure and elevated heart rate, coupled with high levels of CO make the heart work harder to deliver the oxygen needed by the cells and tissues of the body.

Surface blood vessel constriction drops skin temperature by up to 5Â°C. Very sharp rise in carbon monoxide levels in the lungs contributing to breathlessness.

Nicotine causes a rapid increase in heart rate by up to 20 beats per minute.

Capillary

Without nicotine

Nicotine

With nicotine

Response

Alveolus O2

Haem group

Transmitter

Inhaled smoke contains high levels of carbon monoxide, which crosses the gas exchange membrane along with oxygen to enter the blood with the capillaries of the lung. Here, the carbon monoxide (CO) is preferentially picked up by the haemoglobin in the red blood cells, which normally transport oxygen.

The blood protein haemoglobin (Hb) binds and carries oxygen within the red blood cells to supply the cells and tissues of the body. However, CO has a much higher affinity for Hb than oxygen, so when CO is inhaled, it displaces oxygen from Hb. As a result, less oxygen is supplied to the tissues. High levels of CO are fatal.

No Cla t fo ssr r o Us om e

Nicotine affects communication between nerve cells and between nerve cells and muscles. It interacts with cell receptors, stimulating greater release of transmitter substance and increased response in target cells. It causes an immediate and longer term increase in blood pressure and heart rate and causes the body to mobilise fat stores.

1. Describe the short and long term effects of nicotine and carbon monoxide on the cardiovascular system:

WEB

KNOW

LINK

65 55 56

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

66 What You Know So Far: Respiratory Gases Factors affecting homeostasis of blood gases

PR E V ON IEW LY

HINT: What factors alter the balance of respiratory gases in the tissues? How are these imbalances corrected?

Regulation of levels of respiratory gases in the tissues

HINT: How are the levels and balance of respiratory gases in the tissues regulated?

The effects of smoking

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

HINT: What is the effect of smoking and the efficiency of gas exchange and why?

REVISE

67 Essay Question: Homeostasis

No Cla t fo ssr r o Us om e

PR E V ON IEW LY

1. Homeostasis refers to the (relatively) constant physiological state of the body despite fluctuations in the external environment. Using the control of blood glucose as an example, discuss why it is important that animals maintain a constant internal environment. You may use extra paper if needed. Your answer should include: • The components of the control system involved • The role of hormones and negative feedback in maintaining blood glucose levels • Reference to factors (e.g. disease and drugs) that might disrupt blood glucose homeostasis

TEST

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

2. Discuss the different physiological mechanisms that humans use to thermoregulate. Use the examples of hypothermia and hyperthermia to illustrate the importance of thermoregulation and the consequences of its failure.

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

3. Discuss the role of the kidneys in osmoregulation. Explain how ADH helps to regulate the body's fluid and electrolyte balance and describe how normal regulation can be affected by drugs.

No Cla t fo ssr r o Us om e

68 KEY TERMS AND IDEAS: Homeostasis 1. Test your vocabulary by matching each term to its definition, as identified by its preceding letter code.

PR E V ON IEW LY

effector

A Regulation of the internal environment to maintain a stable physiological state.

homeostasis

B Organ or body part that responds to signals from a control centre (e.g. brain).

hormone

C A destabilising mechanism in which the output of the system causes an escalation in the initial response.

hypothalamus

D Chemical messenger that induces a specific physiological response.

E Cells that transmit information in the form of electrochemical impulses.

negative feedback neurones

F A mechanism in which the output of a system acts to oppose changes to the input of the system. The net effect is to stabilise the system and dampen fluctuations.

positive feedback

G The region of the brain that coordinates the nervous and endocrine systems via the pituitary gland.

receptor

H A structure that detects changes and sends a message to a control centre.

2. Study the graph below, and answer the questions following it. In your answers, use biological terms appropriately to show your understanding. Type of feedback mechanism:

Mode of action:

–

Biological examples of this mechanism:

3. (a) Name the excretory organ of vertebrates:

(b) Name the selective filtering element of the kidney:

(d) Name the hormone involved in controlling urine output:

4. (a) The hormones secreted by a and b cells together act to…

(b) What mechanism controls the secretion of these hormones?

No Cla t fo ssr r o Us om e

5. (a) Distinguish between glycogenesis and glycogenolysis and describe the effect of each of each of these processes?

(b) Where do these metabolic processes occur?

TEST

Human manipulation of genetic transfer

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

Achievement Standard

3.7

Key terms

Transgenesis annealing

DNA amplification

Achievement criteria and explanatory notes

DNA ligase

Achievement criteria for achieved, merit, and excellence

DNA ligation

gel electrophoresis

gene marker

genetically modified organism (GMO) polymerase chain reaction (PCR) plasmid

recombinant DNA

restriction enzyme transgenesis vector

Investigating gene function

CRISPR-Cas9 system

NIH

DNA (gene) probes DNA chip

Principles of genetic manipulation

gene therapy

Some basic techniques are used in some genetic manipulations…

Activity number

Genetic material can be edited or transferred between species using gene editing 69 - 72 tools, including endonucleases. 76 86 90

clone

PCR is an important tool for amplifying DNA sequences of interest.

embryo splitting

DNA probes allow specific genetic sequences of interest to be located.

genetic diversity

Genomic markers can be used as a tool in selective breeding programmes.

Cloning

Explanatory notes: Manipulations of genetic transfer

somatic cell nuclear transfer (SCNT)

Activity number

No Cla t fo ssr r o Us om e

Human manipulations of genetic transfer may involve…

tissue culture

103 104

Transgenesis, being the process of introducing a gene from another species into a living organism. The foreign gene must be transmitted to the offspring.

75 - 83

Selective breeding

Investigation and modification of the expression of existing genes.

85 - 92

artificial insemination

Whole organism cloning (plants and animals).

94 - 97

DNA profiling

Selective breeding, which could include embryo selection, animal breeding, plant breeding, or the development of new crops.

99 - 108

embryo selection embryo transfer

Explanatory notes: Biological implications

marker gene

Biological implications may involve the impact on …

Activity number

in-vitro fertilisation pre-implantation genetic diagnosis

selective breeding

Ecosystems.

Genetic biodiversity.

Health and survival of individuals.

Survival and/or evolution of populations.

111 118 99 106

91 92

106 108

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

What you need to know for this Achievement Standard Transgenesis Activities 69 - 84

By the end of this section you should be able to:

Describe how a small number of basic tools are used to manipulate DNA for different purposes, including creating a transgenic organism. These include:  Insertion of a gene into a vector (e.g. bacterial plasmid) using restriction enzymes, DNA ligation and annealing using DNA ligase.  Introduction of the recombinant plasmid into a bacterium, which then expresses the gene (called molecular or gene cloning).  The use of gel electrophoresis to sort fragments according to length.  The polymerase chain reaction (PCR) to amplify DNA fragments (genes) of interest. c

Describe and explain transgenesis, including the role of vectors, such as plasmids.

Describe the applications of transgenic organisms in medicine, industry, and agriculture. Discuss the biological implications of their use.

Investigation and modification of gene expression Activities 85 - 93

By the end of this section you should be able to:

Describe the techniques used to determine gene function, including gene knockdown and gene knockout. Explain how gene function can be modified to provide a health benefit.

Outline how new techniques, e.g. Crispr gene editing technology, make it possible to edit genes more precisely and efficiently than has previously been possible.

Explain how DNA probes are used to identify the presence and location of individual genes and explain how this information can be used.

Explain how DNA chips can be used to investigate gene expression and how this information can be used, e.g. to study the effects of certain treatments or diseases on gene expression.

Explain how the knowledge of gene structure and function is being applied to benefit the health and survival of individuals through gene therapy.

Whole organism cloning Activities 94 - 98

By the end of this section you should be able to:

Define the term cloning and explain why clones are genetically identical.

Describe natural clones in plants and explain how the vegetative properties of plant tissue are used by humans to produce plant clones.

Describe plant tissue culture, its applications, and its biological implications.

Describe how animals are cloned by embryo splitting. Describe applications of the technology and its biological implications.

Describe the production of cloned embryos in animals by somatic cell nuclear transfer (SCNT). Explain the current and potential uses of the technology as well as its biological implications.

Selective breeding Activities 99 - 109

By the end of this section you should be able to:

No Cla t fo ssr r o Us om e

EII

Explain how the universality of the genetic code enables humans to transfer genetic material (DNA) directly between different organisms, even when they are different species.

Define selective breeding and briefly outline its long history. Explain how the nature, tools, and rate of phenotypic change through selective breeding has changed over that time.

Describe the basis of selective breeding in animals and discuss its biological implications.

Explain the role of reproductive technologies (including embryo selection) in current selective breeding programmes for livestock. Explain how these technologies have increased the rate of genetic gain in production animals and discuss the biological implications of their use.

Discuss selective breeding in plants and its biological implications.

Explain how knowledge of selective breeding is being applied to the recovery of threatened species.

No Cla t fo ssr r o Us om e

69 A History of Human Genetic Manipulation Key Idea: Humans have been manipulating the transfer of genetic information between organisms ever since plants and animals were first domesticated over 10,000 years ago. Selective breeding, the breeding together of organisms with desirable traits, was the earliest form of genetic manipulation. In the last few decades, humans have developed sophisticated

PR E V ON IEW LY

methods to manipulate genetic information to produce organisms with beneficial traits or reduce the occurrence or impact of disease. For example, the insertion of a gene from one species into another completely different species, is now common-place. The time-line below outlines significant steps in the history of human genetic manipulation.

~8,000

~3,000

Cultivation of grains and domestication of animals.

Teosinte, a wild maize.

n Joh

bley Doe

3,000

Mules created by crossing donkeys and horses.

BC AD 1800

AD 1850

AD 1920

Breeds of plants and animals refined. Many of today's common varieties and breeds appeared by mid 1800s.

1859 Charles Darwin publishes Origin of Species in which he details the selective breeding of pigeons to produce breeds with radically different appearances.

1926 Hybridisation of plant crops produces higher yielding seeds. 1930 First collection of bovine embryos for transfer to surrogate mothers.

1950

AD 1970

1951 First successful transfer of bovine embryos to surrogate mothers.

1972 First in vitro recombinant DNA. Frozen mouse embryo revived, implanted, and born.

1973 First transgenic bacteria produced.

AD 1980-1990

PCR machine

AD 1991-2000

Flavr savr tomato

2001 onwards AD

www.glofish.com

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

1940 Mutagens used on plants to alter genes and produce new plant varieties.

1953 Structure of DNA proposed by Watson and Crick. 1976 Prenatal genetic diagnosis using DNA.

1978 First human baby from in vitro fertilisation born. 1979 Embryo splitting to produce twin lambs. Insulin produced by GM bacteria.

Achievements include: In vitro fertilisation of bovine ovum, transgenic mice, PCR, transgenic pigs, first transgenic plant resistant to insects, location of gene for Huntington's disease, transgenic maize, transgenic plants for pharmaceuticals.

No Cla t fo ssr r o Us om e

Cloned embryos

1890 Rabbits are born from embryos that were implanted in surrogate mothers.

Achievements include: gene therapy, plant IVF, Flavr savr GE tomato commercially available, cloning produces Dolly the sheep, completion of first draft of the human genome. Achievements include: first gene therapy successes (SCID), genetically modified rhesus monkey, mouse with two female parents born, various cloned animals produced, Glofish - the first genetically engineered pets commercially available, development of CRISPR gene editing technology. LINK

WEB

APPA 69

REFER

100

No Cla t fo ssr r o Us om e

70 What is DNA Manipulation? existing DNA. DNA manipulation aims to produce improved or novel organisms with specific desirable traits. Genetic engineering has wide applications in food technology, industry, agriculture, environmental clean up, pharmaceutical production, and vaccine development. Organisms that have had their DNA altered are called genetically modified organisms (GMOs).

PR E V ON IEW LY

Key Idea: DNA manipulation alters an organism's DNA either by adding new DNA or editing the existing DNA. DNA manipulation (also called genetic modification or genetic engineering) involves direct manipulation of an organism's genome using biotechnology. This can be achieved by introducing new DNA into an organism or by editing its

How are genetically modified organisms produced?

Foreign gene is inserted into host DNA

Existing gene is altered

Host DNA

Gene is deleted or deactivated

Host DNA

Add a foreign gene

Alter an existing gene

Delete or ‘turn off’ a gene

A novel (foreign) gene is inserted from another species. This will enable the GMO to express the trait encoded by the new gene. Organisms genetically altered in this way are referred to as transgenic.

An existing gene may be altered to make it express at a higher level (e.g. growth hormone) or in a different way (in tissue that would not normally express it). The technique may provide a way to fix a malfunctioning gene.

An existing gene may be deleted or deactivated (switched off) to prevent the expression of a trait (e.g. the deactivation of the ripening gene in tomatoes produced the Flavr-Savr tomato).

Tumour

Human insulin, used to treat diabetic patients, is now produced using transgenic bacteria and yeast.

New gene editing technologies, such as CRISPR, are being explored to treat breast cancer (above) and sickle cell disease.

Manipulating gene action is one way in which to control processes such as ripening in fruit.

1. (a) What is DNA manipulation?

(b) Using examples, discuss the ways in which an organism may be genetically modified (to produce a GMO):

2. Describe some of the applications of DNA manipulation:

WEB

KNOW

LINK

No Cla t fo ssr r o Us om e

101

No Cla t fo ssr r o Us om e

71 Making Recombinant DNA made of the same building blocks (nucleotides) and uses the same genetic code. rDNA allows a gene from one organism to be moved into, and expressed in, a different organism. To create rDNA, endonucleases (such as restriction enzymes or the CRISPR-Cas9 system) cut the DNA and the enzyme DNA ligase is used to join the sections of DNA together.

PR E V ON IEW LY

Key Idea: Recombinant DNA (rDNA) is produced by first isolating (or synthesising) a DNA sequence, then inserting it into the genome of a different organism. Recombinant DNA (rDNA) is produced by combining genetic material from two or more different sources. The production of rDNA is possible because the DNA of every organism is

Recognition site

What are restriction enzymes?

A restriction enzyme is an enzyme that cuts a double-stranded DNA molecule at a specific recognition site (a specific DNA sequence). There are many different types of restriction enzymes, each has a unique recognition site.

Restriction enzyme cuts here

cut

G A AT T C

C T TA A G

cut

DNA

Some restriction enzymes produce DNA fragments with two sticky ends (right). A sticky end has exposed nucleotide bases at each end. DNA cut in such a way is able to be joined to other DNA with matching sticky ends. Such joins are specific to their recognition sites.

Some restriction enzymes produce a DNA fragment with two blunt ends (ends with no exposed nucleotide bases). The piece it is removed from is also left with blunt ends. DNA cut in such a way can be joined to any other blunt end fragment. Unlike sticky ends, blunt end joins are non-specific because there are no sticky ends to act as specific recognition sites.

Recognition site

A AT T

C T TA A

Fragment

A AT T C

C T TA

Sticky end

DNA fragment with two sticky ends

A AT T C

C T TA A

Sticky end

Restriction enzyme cuts here

Recognition site

CCCGGG

cut

CDC

The fragments of DNA produced by the restriction enzymes are mixed with ethidium bromide, a molecule that fluoresces under UV light. The DNA fragments are then run on an electrophoresis gel to separate the different lengths of DNA.

DNA Once the DNA fragments are separated, The solution containing the DNA is GGGCCC GGGCCC the gel is placed on a UV viewing platform. centrifuged at high speed to separate cut cut by The area of the gel containing the DNA out the DNA. Centrifugation works fragments of the correct length is cut out and separating molecules of different densities. placed in a solution that dissolves the gel. Once isolated, the DNA can be spliced into The cut by this type of restriction This releases the DNA into the solution. another DNA molecule. enzyme leaves no overhang

2. Distinguish between sticky end and blunt end fragments:

CCC

GGG

CCC

GGG

CCC

GGG

CCC

GGG

CCC

GGG

No Cla t fo ssr r o Us om e

1. What is the purpose of restriction enzymes in making recombinant DNA?

DNA fragment with two blunt ends

3. Why is it useful to have many different kinds of restriction enzymes?

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

LINK

APPA 76

LINK

WEB

KNOW

102 NOTE: This other end of the foreign DNA is attracted to the remaining sticky end of the plasmid

TA A C T

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

Creating a recombinant DNA plasmid

1a Bacteria contain circular pieces

of extrachromosomal DNA called plasmids. These replicate independently of the bacterial chromosome.

1b Plasmid DNA and foreign DNA

containing the gene of interest are cut by the same restriction enzyme (they will produce fragments with matching sticky ends).

Fragments with matching sticky ends can be joined by base-pairing. This process is called annealing. This allows DNA fragments from different sources to be joined. The fragments of DNA can be joined together by the enzyme DNA ligase.

The joined fragments form a recombinant plasmid. This can be used as a vector to transfer the foreign gene to another organism.

The two different DNA fragments are attracted to each other by weak hydrogen bonds

Plasmid DNA fragment

A AT T C

T A

C T TA A

Foreign DNA fragment

Detail of restriction site

A A T T

TA A G C T

Restriction sites on the fragments are attracted by base pairing only

Gap in DNA molecule’s ‘backbone’

Plasmid DNA fragment G

Foreign DNA fragment

A A T T C

T A

DNA ligase

Detail of restriction site

A A T T

TA A G C T

Recombinant plasmid DNA

25kartika

pGLO is a plasmid engineered to contain Green Fluorescent Protein (gfp). pGLO has been used to create fluorescent organisms, including the bacteria above (bright patches on agar plates).

Fragments linked permanently by DNA ligase

No break in DNA molecule

The fragments are joined by the enzyme DNA ligase

A A T T C

T A

(a) Annealing:

(b) DNA ligase:

No Cla t fo ssr r o Us om e

4. Explain in your own words the two main steps in the process of joining two DNA fragments together:

5. Explain why ligation can be considered the reverse of the restriction digestion process:

6. Why can recombinant DNA be expressed in any kind of organism, even if it contains DNA from another species?

103

No Cla t fo ssr r o Us om e

72 Creating and Using Recombinant Bacteria technique is known as molecular cloning (or gene cloning). To be useful, all vectors must be able to replicate inside their host organism, they must have one or more sites at which a restriction enzyme can cut, and they must have some kind of genetic marker that allows them to be identified. Bacterial plasmids are commonly used vectors because they are easy to manipulate, their restriction sites are well known, and they are readily taken up by cells in culture. Molecular cloning is widely used to produce valuable commodities at low cost.

PR E V ON IEW LY

Key Idea: Recombinant plasmids will be taken up by bacterial cells, which will then go on to multiply the gene of interest or produce its protein product. Recombinant DNA techniques can be used to insert a gene into a vector such as a plasmid. The recombinant vector can then be used to transmit the gene to another organism (most commonly an easy-to-grow bacterium such as E. coli). This will generate a population of organisms in which recombinant DNA molecules are replicated along with the host DNA. This

Cloning a human gene

Human cell

Bacterial cell. e.g. E. coli

Plasmid

DNA in chromosome

A gene of interest (DNA fragment) is isolated and prepared by removal of introns (non-protein coding regions).

Chromosome

Restriction enzyme recognition sequence

Human gene

Sticky end

Tetracyclineresistance gene

Sticky end

Ampicillinresistance gene

Plasmid vector

A commercially available plasmid engineered to contain certain restriction sites is used in the cloning process.

Promoter and terminator sequences added

The recombinant plasmid is introduced into a bacterial cell by adding the DNA to a bacterial culture. Under the right conditions, some bacteria will take up the plasmid from solution by the process of transformation.

Sticky ends

Human gene

Recombinant DNA molecule

Colonies of bacteria that carry the recombinant plasmid can be identified by the fact that they are resistant to ampicillin but sensitive to tetracycline. These colonies can be isolated and grown in culture.

The DNA fragments are mixed together and the complementary sticky ends are attracted by basepairing. The enzyme DNA ligase is added to bond the sticky ends.

Insulin is now commonly made using recombinant DNA. The gene for insulin is placed into a bacterial plasmid. As the bacteria replicates it also replicates the plasmid. Huge vats of insulin producing bacteria can quickly be grown. Other human proteins, e.g. factor VII and adenosine deaminase, are produced the same way.

Agar plate with bacterial colonies. Only some have the plasmid with the human gene.

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

The restriction enzyme cuts the plasmid DNA at its single recognition sequence, disrupting, for example, the tetracycline resistance gene.

No Cla t fo ssr r o Us om e

Both the human DNA and the plasmid are treated with the same restriction enzyme to produce identical sticky ends.

LINK

APPA 81

LINK

WEB

KNOW

104 gfp as a gene marker

Antibiotic resistant marker genes may be used to identify the bacteria that have taken up the foreign DNA. The plasmid used often carries two genes that provide the bacteria with resistance to the antibiotics ampicillin and tetracycline. Without this plasmid, the bacteria have no antibiotic resistance genes. A single restriction enzyme recognition sequence lies within the tetracycline resistance gene. A foreign gene, spliced into this position, will disrupt the tetracycline resistance gene, leaving the bacteria vulnerable to this antibiotic. It is possible to identify the bacteria that successfully take up the recombinant plasmid by growing the bacteria on media containing ampicillin, and transferring colonies to media with both antibiotics.

Most often today, another gene acts as a marker instead of the tetracycline resistance gene. The gene for Green Fluorescent Protein (gfp above), isolated from the jellyfish Aequorea victoria, has become well established as a marker for gene expression in the recombinant organism. The gfp gene is recombined with the gene of interest and transformed cells can then be detected by the presence of the fluorescent product (cells with gfp present glow green under fluorescent light).

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

Antibiotic resistance as a marker

1. (a) When would it be most useful to use bacteria to produce multiple gene copies?

(b) When would it not be useful to use bacteria to produce multiple gene copies?

2. Explain how a human gene is removed from a chromosome and placed into a plasmid:

3. A bacterial plasmid replicates at the same rate as the bacteria. If a bacteria containing a recombinant plasmid replicates and divides once every thirty minutes, calculate the number of plasmid copies there will be after 24 hours:

No Cla t fo ssr r o Us om e

4. When cloning a gene using plasmid vectors, the bacterial colonies containing the recombinant plasmids are mixed up with colonies that have none. All the colonies look identical, but some have taken up the plasmids with the human gene, and some have not. Explain how the colonies with the recombinant plasmids are identified:

5. Explain why the gfp marker is a more desirable gene marker than genes for antibiotic resistance:

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

105

No Cla t fo ssr r o Us om e

73 Gel Electrophoresis the gel depends primarily on their size and the strength of the electric field. The gel they move through is full of pores (holes). Smaller DNA molecules move through the pores more quickly than larger ones. At the end of the process, the DNA molecules can be stained and visualised as a series of bands. Each band contains DNA molecules of a particular size. The bands furthest from the start of the gel contain the smallest DNA fragments.

PR E V ON IEW LY

Key Idea: Gel electrophoresis is used to separate DNA fragments on the basis of size. Gel electrophoresis is a tool used to isolate DNA of interest for further study. It is also used for DNA profiling (comparing individuals based on their unique DNA banding profiles). DNA has an overall negative charge, so when an electrical current is run through a gel, the DNA moves towards the positive electrode. The rate at which the DNA molecules move through

DNA solutions: Mixtures of different sizes of DNA fragments are loaded in each well in the gel.

(-ve)

DNA markers, a mixture of DNA molecules with known molecular weights (size) are often run in one lane. They are used to estimate the sizes of the DNA fragments in the sample lanes. The figures below are hypothetical markers (bp = base pairs).

(-ve)

DNA is negatively charged because the phosphates (blue) that form part of the backbone of a DNA molecule have a negative charge.

5 lanes

Negative electrode (–)

Wells: Holes are made in the gel with a comb, acting as a reservoir for the DNA solution.

Large fragments

DNA fragments: The gel matrix acts as a sieve for the negatively charged DNA molecules as they move towards the positive terminal. Small fragments move easily through the matrix, whereas large fragments don't.

50,000 bp 20,000 bp 10,000 bp 5000 bp 2500 bp

As DNA molecules migrate through the gel, large fragments will lag behind small fragments. As the process continues, the separation between larger and smaller fragments increases.

Small fragments

1000 bp

500 bp

Tray: The gel is poured into this tray and allowed to set.

Positive electrode (+)

Gel: A gel is prepared, which will act as a support for separation of the fragments of DNA. The gel is a jelly-like material, called agarose.

Steps in the process of gel electrophoresis of DNA

1. The gel is placed in an electrophoresis chamber and the chamber is filled with buffer, covering the gel. This allows the electric current from electrodes at either end of the gel to flow through the gel. 2. DNA samples are mixed with a “loading dye” to make the DNA sample visible. The dye also contains glycerol or sucrose to make the DNA sample heavy so that it will sink to the bottom of the well. 3. The gel is covered, electrodes are attached to a power supply and turned on. 4. When the dye marker has moved through the gel, the current is turned off and the gel is removed from the tray. 5. DNA molecules are made visible by staining the gel with methylene blue or ethidium bromide which binds to DNA and will fluoresce in UV light. 6. The band or bands of interest are cut from the gel and dissolved in chemicals to release the DNA. This DNA can then be studied in more detail (e.g. its nucleotide sequence can be determined).

No Cla t fo ssr r o Us om e

1. What is the purpose of gel electrophoresis?

2. Describe the two forces that control the speed at which fragments pass through the gel: (a)

(b)

3. Why do the smallest fragments travel through the gel the fastest?

LINK

104 103

LINK

WEB

KNOW

106

No Cla t fo ssr r o Us om e

74 DNA Amplification Using PCR chain reaction) is a technique for reproducing large quantities of DNA in the laboratory from an original sample. For this reason, it is often called DNA amplification. The technique is outlined below for a single cycle of replication. Subsequent cycles replicate DNA at an exponential rate, so PCR can produce billions of copies of DNA in only a few hours.

PR E V ON IEW LY

Key Idea: PCR uses a polymerase enzyme to copy a DNA sample, producing billions of copies in a few hours. Many procedures in DNA technology, e.g. DNA sequencing and profiling, require substantial amounts of DNA yet, very often, only small amounts are obtainable (e.g. DNA from a crime scene or from an extinct organism). PCR (polymerase

DNA polymerase: A thermally stable form of the enzyme is used (e.g. Taq polymerase). . This is extracted from thermophilic bacteria.

A single cycle of PCR

Primer annealed

Nucleotides

Primer moving into position

The sample is cooled to 60oC. Primers are annealed (bonded) to each DNA strand. In PCR, the primers are short strands of DNA; they provide the starting sequence for DNA extension.

A DNA sample (called target DNA) is obtained. It is denatured (DNA strands are separated) by heating at 98oC for 5 minutes.

Direction of synthesis

Free nucleotides and the enzyme DNA polymerase are added. DNA polymerase binds to the primers and, using the free nucleotides, synthesises complementary strands of DNA.

After one cycle, there are now two copies of the original DNA.

Repeat for about 25 cycles

Repeat cycle of heating and cooling until enough copies of the target DNA have been produced

Loading tray Prepared samples in PCR tubes are placed in the loading tray and the lid is closed.

Temperature control Inside the machine are heating and refrigeration mechanisms to rapidly change the temperature.

Dispensing pipette Pipettes with disposable tips are used to dispense DNA samples into the PCR tubes.

Thermal cycler

Amplification of DNA can be carried out with machines called thermal cyclers. Once a DNA sample has been prepared, the amount of DNA can be increased billions of times in just a few hours.

No Cla t fo ssr r o Us om e

DNA quantitation The amount of DNA in a sample can be determined by placing a known volume in this quantitation machine. For many genetic engineering processes, a minimum amount of DNA is required.

Controls The control panel allows a number of different PCR programmes to be stored in the machineâ&#x20AC;&#x2122;s memory. Carrying out a PCR run usually just involves starting one of the stored programmes.

Reducing contamination

The PCR process will amplify all the DNA within the sample including unwanted DNA from contamination. Therefore great care must be taken not to contaminate the sample with unwanted DNA (e.g from microbes in the environment, from dirty equipment, or from the researcher). Contamination is reduced by following strict protocols. The researcher must make sure that they are wearing appropriate clothing (hair net, gloves, coat) to stop their DNA contaminating the sample. In addition clean work surfaces, sterile solutions, and use of disposable equipment (e.g. pipettes and tubes) will help reduce contamination.

WEB

KNOW

LINK

103 105 APPA

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

107

PR E V ON IEW LY

1. What is the purpose of PCR?

2. Describe how the polymerase chain reaction works:

3. Describe two situations where only very small DNA samples may be available for sampling and PCR could be used: (a)

(b)

4. After only two cycles of replication, four copies of the double-stranded DNA exist. Calculate how much a DNA sample will have increased after:

(a) 10 cycles:

(b) 25 cycles:

5. The risk of contamination in the preparation for PCR is considerable.

(a) Describe the effect of having a single molecule of unwanted DNA in the sample prior to PCR:

(b) Describe two possible sources of DNA contamination in preparing a PCR sample:

No Cla t fo ssr r o Us om e

Source 1:

Source 2: (c) Describe two precautions that could be taken to reduce the risk of DNA contamination: Precaution 1:

Precaution 2:

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

108

No Cla t fo ssr r o Us om e

75 What is Transgenesis? Transgenesis allows direct modification of a genome to introduce traits to an organism in which they are not naturally present. To be successful, the transgenes must be transmitted to the offspring. The genes are inserted using vectors or by direct insertion of the DNA. The first successful transgenic animal was a mouse, produced using DNA microinjection.

PR E V ON IEW LY

Key Idea: Transgenesis is the insertion of a gene from one species into another, so its protein product is expressed in the second species and the gene is transferred to its offspring. Transgenesis is the insertion of a gene from one species into another that does not normally carry the gene. An organism modified in this way is called a transgenic organism.

Creating transgenic mice using pronuclear injection

Pronuclear injection

A gene that has been transferred into another organism is called a transgene. Genes can be introduced directly into an animal cell by microinjection. Multiple copies of the desired transgene are injected via a glass micropipette into a recently fertilised egg cell, which is then transferred to a surrogate mother. Transgenic mice and livestock are produced in this way. However, the process is inefficient: only 2-3% of eggs give rise to transgenic animals and only a proportion of these animals express the transgene adequately. Micropipette injects gene

This example outlines a successful experiment that used DNA microinjection technology to produce the worldâ&#x20AC;&#x2122;s first transgenic animal.

2b Micropipette injects rat growth hormone gene into a fertilised egg.

Transformed egg is cultured to an embryo, then implanted in a surrogate mother.

Mouse B Weight 44 g

1 Two eggs are removed

from a single female mouse and are fertilised artificially in a test tube.

Egg cell

Mouse A Weight 29 g

2a This fertilised

egg is unaltered.

Egg nucleus

Normal egg is cultured to

3a an embryo, then implanted

Blunt holding pipette

The two mice above are siblings, but mouse B is a transgenic organism. A rat growth hormone gene was introduced into its genome.

in a surrogate mother.

1. (a) What is transgenesis?

(b) How can transgenesis be used to produce organisms with desirable traits?

No Cla t fo ssr r o Us om e

2. Briefly describe how a transgenic mouse can be produced using pronuclear injection:

WEB

KNOW

LINK

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

109

No Cla t fo ssr r o Us om e

76 Vectors for Transgenesis requires a vector (carrier), such as a virus, liposome, or plasmid. The vector (with its foreign gene) must also be delivered somehow to the host cell. This may occur easily, as in bacteria, or may require tools such as gene guns.

PR E V ON IEW LY

Key Idea: Several different carriers, called vectors, can be used to introduce a gene into a cell. There are advantages and disadvantages associated with each type of vector. The transfer of a gene to the cell of another organism usually

Viral vectors

Liposome vectors

Plasmid vectors

Retrovirus

Recombinant plasmids contain DNA from one or more other organisms

Adenovirus

ffViruses are well known for their ability

to insert DNA into a host cell. For this reason they have become a favoured tool in transgenesis.

Lipid bilayer

ffLiposomes are spherical

ffPlasmids are circular lengths of DNA up

ffThey can be quite large and

ffRecombinant plasmids are frequently

bodies of lipid bilayer.

targeted to specific types of cells by placing specific receptors on their surfaces.

ffDifferent types of viruses integrate their

DNA into the host in different ways. This allows scientists to control where and for how long the new DNA is expressed in the host. However, the size of the piece of DNA that can be transferred is limited to about 8 kb.

Novel gene

ffLiposomes can carry

plasmids 20 kb or more.

ffThey do not trigger immune

ffIntegration of the DNA into the host

DNA can cause unexpected (sometimes harmful) side effects depending on where in the host's chromosome the DNA inserts itself.

responses when used in gene therapy, but are less efficient than viruses at transferring the plasmid into a target cell.

to 1000 kb long (1 kb = 1000 bp).

used to produce transgenic organisms, especially bacteria. The bacteria may be the final target for the recombinant DNA (e.g. transgenic E. coli producing insulin) or it can be used as a vector to transfer the DNA to a different host (e.g. Agrobacterium tumefaciens is used to transfer the Ti plasmid to plants).

ffIn gene therapy, plasmids by

themselves, as naked DNA, are unstable and not particularly efficient at integrating DNA into a target cell.

Transformation is the direct uptake of foreign DNA and is common in bacteria. Recombinant DNA plasmids are mixed with bacteria and the bacteria that take up the DNA are used.

Transduction is the transfer of DNA into a bacterium by a virus. Bacteriophages (viruses that infect bacteria) are commonly used to integrate recombinant DNA into a target bacterium.

Transfection is the deliberate, often non-viral, introduction of foreign DNA into a cell. There are numerous methods including electroporation and the use of the gene gun (above).

Zephyris cc 3.0

BioRad/RA

EII

Dr Graham Beards, cc 3.0

Transferring the DNA

Electroporation cuvettes

Electroporation is a method in which an electric field is applied to cells, causing the plasma membrane to become more permeable. This allows DNA to cross the plasma membrane.

2. (a) Why are viruses often the preferred vector?

(b) Identify two problems with using viral vectors for DNA transfer:

No Cla t fo ssr r o Us om e

1. What is the role of a vector in transgenesis?

3. What type of vector would be most suitable for transferring a 400 kb length of DNA to a plant: ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

LINK

WEB

APPA 76

KNOW

77 The Applications of Transgenesis

No Cla t fo ssr r o Us om e

110

used GMOs, with applications ranging from pharmaceutical production and Â vaccine development to environmental clean-up and rehabilitation. Crop plants are also commonly genetically modified because they are easily propagated and the potential gains are great. However their use is controversial because transgenes are easily spread between plant species.

PR E V ON IEW LY

Key Idea: GMOs are used in the food industry, agriculture, horticulture, medicine, and environmental practices. Techniques for genetic manipulation are now widely applied throughout modern biotechnology: in food and enzyme technology, in industry and medicine, and in agriculture and horticulture. Microorganisms are among the most widely

Extending shelf life: Shelf life in fresh produce (e.g. tomatoes) can be extended by switching off the genes for specific enzymes involved in the fruit ripening process (e.g. the enzymes involved in softening of the fruit wall or controlling the production of ethylene).

1. Suggest one economic advantage of extending shelf life in fresh produce:

Pest or herbicide resistance: Plants

2. Suggest one disadvantage of engineering crop plants to be herbicide resistant:

can be engineered to carry and express genes for insect toxins or herbicide resistance. Pest resistant crops do not require spraying and herbicide resistance allows the grower to control weeds without damaging the crops.

3. What is the advantage of using GE bacteria to produce a human hormone like insulin?

Biofactories: Transgenic bacteria

are widely used to produce desirable commodities, such as hormones or proteins. Large quantities of a product can be produced using bioreactors. One example includes injectable human insulin produced by recombinant bacteria or yeast (above).

Vaccine development: Genes encoding antigenic components (e.g. viral proteins) from multiple pathogens can be inserted into bacteria, which are then used to express the proteins in culture. The proteins are purified and included in a vaccine to provide immunity to several pathogens.

4. Why might it be safer to produce a vaccine using gene technology, rather than the pathogen itself?

5. What advantages could be gained by developing a GE crop that produces more protein?

Environmental clean-up: Bacteria

technology is now an integral part of the development of new crop varieties. Crops can be engineered to produce higher protein or vitamin levels (e.g. golden rice) or to grow in inhospitable conditions (e.g. salty or arid land).

can be engineered to thrive on waste products, such as liquefied newspaper pulp or oil. They degrade pollutants and wastes, and minerals (e.g. mercury) may also be recovered from the bacteria after the cleanup.

Livestock improvement using transgenic animals: Transgenic sheep have been used to enhance wool production in flocks (above, left). The keratin protein of wool is largely made of a single amino acid, cysteine. Injecting developing sheep with the genes for the enzymes that generate cysteine produces woollier sheep. Transgenic sheep carrying the human gene for a protein, Îą-1-antitrypsin, produce the protein in their milk. The antitrypsin is extracted from the milk and can be used to treat hereditary emphysema.

WEB

KNOW

LINK

6. Using animals as live biofactories to produce a valuable product (e.g. a human protein) is controversial. What welfare issues could be associated with such practices?

No Cla t fo ssr r o Us om e

Crop improvement: Gene

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

111

No Cla t fo ssr r o Us om e

78 Ethics of Transgenesis Currently a matter of concern to consumers is the adequacy of government regulations for labelling food products with GM content. In some countries GM products must be clearly labelled, while other countries have no requirements for GM labelling at all. This can remove consumer choice about the products they buy. The use of GMOs may also have trade implications for countries trading in GMO produce.

PR E V ON IEW LY

Key Idea: There are potential benefits, risks, and ethical issues associated with using genetically modified organisms. The use of genetically modified organisms (GMOs) has many potential benefits in terms of production efficiencies and reduced costs, but their use raises a number of biological and ethical concerns. Some of these include risk to human health, animal welfare issues, and environmental safety.

Potential benefits of GMOs

Potential risks of GMOs

1. Increase in crop yields, including crops with more nutritional value and that store for longer.

1. Possible spread of transgenes into other species. 2. Concerns that the release of GMOs into the environment may be irreversible.

2. Decreased use of pesticides, herbicides and animal remedies.

3. Production of drought tolerant or salt tolerant crops.

3. Animal welfare and ethical issues: GM animals may suffer poor health and reduced life span.

4. Improvement in the health of the human population and the medicines used to achieve it.

4. GMOs may cause the emergence of pest, insect, or microbial resistance to traditional control methods.

5. Development of animal factories for the production of proteins used in manufacturing, the food industry, and health.

5. May create a monopoly and dependence of developing countries on companies who are seeking to control the world’s commercial seed supply.

Issue: A new gene or genes may disrupt normal gene function.

Issue: Targeted use of transgenic organisms in the environment.

Problem: Recombinant DNA may be taken up by non-target organisms. These have the potential to become pests or cause disease.

Problem: Gene disruption may trigger cancer. Successful expression of the desired gene is frequently very low.

Problem: Once their desired function, e.g. environmental clean-up, is completed, they may be undesirable invaders in the ecosystem.

Solution: Rigorous controls on the production and release of GMOs. GMOs could have specific genes deleted so that their growth requirements are met only in controlled environments.

Solution: A combination of genetic engineering, cloning, and genetic screening so that only those cells that have been successfully transformed are used to produce organisms.

Solution: GMOs can be engineered to contain “suicide genes” or metabolic deficiencies so that they do not survive for long in the new environment after completion of their task.

CDC

Issue: The accidental release of GMOs into the environment.

Genetically modified soya bean plant

Cancerous kidney

Issues and solutions

Protest against GMOs in the environment

No Cla t fo ssr r o Us om e

1. Discuss the biological implications of using genetically modified organisms and state whether you think the benefits outweigh the potential problems (you may use more paper if required):

WEB

KNOW

79 Using Recombinant Plasmids in Industry

No Cla t fo ssr r o Us om e

112

The issue

PR E V ON IEW LY

Key Idea: Inserting useful genes into bacteria to produce biofactories can solve the problem of shortages in the manufacturing and food industries.

Concept 1

Enzymes are proteins made up of amino acids. The amino acid sequence of chymosin can be determined and the mRNA coding sequence for its translation identified.

►► Recombinant DNA technology can be used to produce industrially important enzymes in large quantities. ►► Chymosin (also known as rennin) is an enzyme that digests milk proteins. It is the active ingredient in rennet, a substance used by cheesemakers to clot milk into curds. ►► Traditionally rennin is extracted from "chyme", i.e. the stomach secretions of suckling calves (hence its name of chymosin).

►► By the 1960s, a shortage of chymosin was limiting the volume of cheese produced.

►► Enzymes from fungi were used as an alternative but were unsuitable because they caused variations in the cheese flavour.

Concept 2

Concept 3

Concept 4

Reverse transcriptase can be used to synthesise a DNA strand from the mRNA. This process produces DNA without the introns, which cannot be processed by bacteria.

DNA can be cut at specific sites using restriction enzymes and rejoined using DNA ligase. New genes can be inserted into self-replicating bacterial plasmids.

Under certain conditions, bacteria are able to lose or take up plasmids from their environment. Bacteria are readily grown in vat cultures at little expense.

Concept 5

The protein in made by the bacteria in large quantities.

Techniques

The amino acid sequence of chymosin is first determined and the RNA codons for each amino acid identified.

Plasmid isolated from E. coli bacteria.

mRNA matching the identified sequence is isolated from the stomach of young calves. Reverse transcriptase is used to transcribe mRNA into DNA. The DNA sequence can also be made synthetically once the sequence is determined. The DNA is amplified using PCR.

Initially, the gene coding for chymosin was isolated from the stomach of a milk-fed suckling calf (less than 10 days old). Now genes are produced by PCR.

Plasmids from E. coli bacteria are isolated and cut using restriction enzymes. The DNA sequence for chymosin is inserted using DNA ligase.

Plasmid

Plasmids are returned to E. coli by placing the bacteria under conditions that induce them to take up plasmids.

Outcomes

The transformed bacteria are grown in vat culture. Chymosin is produced by E. coli in packets within the cell that are separated during the processing and refining stage.

The recombinant plasmid is taken up by the bacteria.

Transformed bacterial cells are grown in a vat culture

WEB

KNOW

LINK

77 APPA

Recombinant chymosin entered the marketplace in 1990. It established a significant market share because cheesemakers found it to be cost effective, of high quality, and in consistent supply. Most cheese is now produced using recombinant chymosin such as CHY-MAX.

No Cla t fo ssr r o Us om e

Recombinant plasmid

Restriction enzyme cuts the plasmid and DNA ligase joins the chymosin gene into the plasmid DNA.

Further applications

A large amount of processing is required to extract chymosin from E.coli. There are now a number of alternative bacteria and fungi that have been engineered to produce the enzyme. Most chymosin is now produced using the fungi Aspergillus niger and Kluyveromyces lactis. Both are produced in a similar way as that described for E. coli.

Enzymes from GMOs are widely used in the baking industry. Maltogenic a-amylase from Bacillus subtilis bacteria is used as an anti-staling agent to prolong shelf life. Hemicellulases from B.Â subtilis and xylanase from the fungus Aspergillus oryzae are usedto improve dough, crumb structure, and volume during the baking process.

Lipase from Aspergillus oryzae is used to process palm oil to produce substitutes for cocoa butter (above), which have similar textural qualities but lower cost.

Dual Freq

Romain Behar

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

113

Acetolactate decarboxylase from B. subtilis is an enzyme used in the brewing industry. It reduces maturation time of the beer by by-passing a rate-limiting step.

1. Describe the main use of chymosin:

2. What was the traditional source of chymosin?

3. Summarise the key concepts that led to the development of the technique for producing chymosin:

(a) Concept 1:

(b) Concept 2:

(d) Concept 4:

(e) Concept 5:

4. Discuss how the gene for chymosin was isolated and how the technique could be applied to isolating other genes:

5. Describe three advantages of using chymosin produced by GM bacteria over chymosin from traditional sources:

(b)

(c)

No Cla t fo ssr r o Us om e

(a)

6. Explain why the fungus Aspergillus niger is now more commonly used to produce chymosin instead of E. coli:

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

80 Engineering for Improved Nutrition The issue

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

114

Key Idea: The use of recombinant DNA to build a new metabolic pathway has greatly increased the nutritional value of a variety of rice.

Concept 1

Rice is a staple food in many developing countries. It is grown in large quantities and is available to most of the population, but it lacks many of the essential nutrients required by the human body for healthy development. It is low in b-carotene.

 Beta-carotene (β-carotene) is a precursor to vitamin A which is involved in many functions including vision, immunity, fetal development, and skin health.  Vitamin A deficiency is common in developing countries where up to 500,000 children suffer from night blindness, and death rates due to infections are high due to a lowered immune response.  Providing enough food containing useful quantities of β-carotene is difficult and expensive in many countries.

Concept 2

Concept 3

Concept 4

Rice plants produce b-carotene but not in the edible rice endosperm. Engineering a new biosynthetic pathway would allow b-carotene to be produced in the endosperm. Genes expressing enzymes for carotene synthesis can be inserted into the rice genome.

The enzyme carotene desaturase (CRT1) in the soil bacterium Erwinia uredovora, catalyses multiple steps in carotenoid biosynthesis.

DNA can be inserted into an organism's genome using a suitable vector. Agrobacterium tumefaciens is a gall-forming bacterial plant pathogen that is commonly used to insert novel DNA into plants.

Phytoene synthase (PSY) overexpresses a colourless carotene in the daffodil plant Narcissus pseudonarcissus.

The development of golden rice

Techniques

The PSY gene from daffodils and the CRT1 gene from Erwinia uredovora are sequenced.

Gene for the enzyme phytoene synthase (PSY) extracted from the daffodil plant Narcissus pseudonarcissus

Ti plasmid

PSY is needed for the synthesis of a colourless carotene.

PSY

T1 CR

The tumour-inducing Ti plasmid is modified to delete the gallforming gene and insert the genes of interest. The parts of the Ti plasmid required for plant transformation are retained.

Gene for the enzyme carotene desaturase (CRT1) extracted from the soil bacterium Erwinia uredovora.

CRT1 can catalyse multiple steps in the synthesis of carotenoids. These steps require many enzymes in plants.

Recombinant plasmid

Agrobacterium is incubated with rice plant embryo. Transformed embryos are identified by their resistance to hygromycin.

Outcomes

No Cla t fo ssr r o Us om e

SGR1

KNOW

Modified Ti plasmid is inserted into the bacterium.

Further applications

Modified plants are identified by resistance to hygromycin.

LINK

The Ti plasmid from Agrobacterium is modified using restriction enzymes and DNA ligase to delete the gall-forming gene and insert the synthesised DNA packages. A gene for resistance to the antibiotic hygromycin is also inserted so that transformed plants can be identified later. The parts of the Ti plasmid required for plant transformation are retained.

The rice produced had endosperm with a distinctive yellow colour. Under greenhouse conditions golden rice (SGR1) contained 1.6 µg per g of carotenoids. Levels up to five times higher were produced in the field, probably due to improved growing conditions.

Recombined plasmid is inserted into Agrobacterium. This is then mixed with rice plant embryos.

WEB

DNA sequences are synthesised into packages containing the CRT1 or PSY gene, terminator sequences, and endosperm specific promoters (these ensure expression of the gene only in the edible portion of the rice).

LINK

77 APPA

Further research on the action of the PSY gene identified more efficient methods for the production of β-carotene. The second generation of golden rice now contains up to 37 µg per g of carotenoids. Golden rice was the first instance where a complete biosynthetic pathway was engineered. The procedures could be applied to other food plants to increase their nutrient levels.

Golden rice: A controversial solution

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

115

Golden rice (top bowl) is promoted as one way to increase the beta-carotene (and thus vitamin A) intake in countries where rice is a staple part of the diet. However there are many groups that actively resist its promotion and use (e.g. Greenpeace).

Many of these anti-GM groups believe there is no need for golden rice because people can obtain enough beta-carotene by eating a variety of fruits and vegetables. They are also worried about the possibility of golden rice contaminating ordinary rice crops.

In June 2016 the The National Academies of Sciences, Engineering, and Medicine released the results of an extensive study, reporting there was no evidence to suggest GM crops were unsafe and that GM crops are as safe to eat as non-GM crops

1. Describe the basic methodology used to create golden rice:

2. Explain how scientists ensured b-carotene was produced in the endosperm:

3. What property of Agrobacterium tumefaciens makes it an ideal vector for introducing new genes into plants?

4. (a) How could this new variety of rice reduce disease in developing countries?

(b) Absorption of vitamin A requires sufficient dietary fat. Explain how this could be problematic for the targeted use of golden rice in developing countries:

5. Explain why golden rice is a controversial product:

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

81 Using Recombinant Plasmids in Medicine The Issue

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

116

►► Type I diabetes mellitus is a metabolic disease

Key Idea: By using microorganisms to make human insulin, problematic issues of cost, allergic reactions, and ethics have been addressed.

caused by a lack of insulin. Around 25 people in every 100,000 suffer from type I diabetes.

►► It is treatable only with injections of insulin. ►► In the past, insulin was taken from the

pancreases of cows and pigs and purified for human use. The method was expensive and some patients had severe allergic reactions to the foreign insulin or its contaminants.

Insulin A chain

Insulin B chain

Concept 1

Concept 2

Concept 3

DNA can be cut at specific sites using restriction enzymes and joined together using DNA ligase. Genes can be inserted into self-replicating bacterial plasmids at the point where the cuts are made.

Plasmids are small, circular pieces of DNA found in some bacteria. They usually carry genes useful to the bacterium. E. coli plasmids can carry promoters required for the transcription of genes.

Under certain conditions, Bacteria are able to lose or pick up plasmids from their environment. Bacteria can be readily grown in vat cultures at little expense.

Concept 4

The DNA sequences coding for the production of the two polypeptide chains (A and B) that form human insulin can be isolated from the human genome.

Techniques

The gene is chemically synthesised as two nucleotide sequences, one for the insulin A chain and one for the insulin B chain. The two sequences are small enough to be inserted into a plasmid.

The nucleotide sequences for each insulin chain are synthesised separately and placed into separate plasmids

Plasmids are extracted from Escherichia coli. The gene for the bacterial enzyme b-galactosidase is located on the plasmid. To make the bacteria produce insulin, the insulin gene must be linked to the b-galactosidase gene, which carries a promoter for transcription.

Restriction enzymes are used to cut plasmids at the appropriate site and the A and B insulin sequences are inserted. The sequences are joined with the plasmid DNA using DNA ligase.

The recombinant plasmids are introduced into the bacterial cells

b-galactosidase + chain A

The gene is expressed as separate chains

b-galactosidase + chain B

The recombinant plasmids are inserted back into the bacteria by placing them together in a culture that favours plasmid uptake by bacteria.

The bacteria are then grown and multiplied in vats under carefully controlled growth conditions.

Outcomes

Insulin A chain

No Cla t fo ssr r o Us om e

The product consists partly of b-galactosidase, joined with either the A or B chain of insulin. The chains are extracted, purified, and mixed together. The A and B insulin chains connect via disulfide cross linkages to form the functional insulin protein. The insulin can then be made ready for injection in various formulations.

Further applications

Disulfide bond

Insulin B chain

WEB

KNOW

LINK

77 APPA

The techniques used to produce human insulin from genetically modified bacteria can be applied to a range of human proteins and hormones. Proteins currently being produced include human growth hormone, interferon, and factor VIII.

117

No Cla t fo ssr r o Us om e

Yeast cells are eukaryotic and hence are much larger than bacterial cells. This enables them to accommodate much larger plasmids and proteins within them.

The gene for human insulin is inserted into a plasmid. The yeast plasmid is larger than that of E.coli, so the entire gene can be inserted in one piece rather than as two separate pieces.

Cleavage site

The proinsulin protein that is produced folds into a specific shape and is cleaved by the yeast's own cellular enzymes, producing the completed insulin chain.

By producing insulin this way, the secondary step of combining the separate protein chains is eliminated, making the refining process much simpler.

PR E V ON IEW LY

Insulin production in Saccharomyces yeast

Cleavage site

1. Describe the three major problems associated with the traditional method of obtaining insulin to treat diabetes: (a) (b) (c)

2. Explain the reasoning behind using E. coli to produce insulin and the benefits that GM technology has brought to diabetics:

3. Explain why, when using E. coli, the insulin gene is synthesised as two separate A and B chain nucleotide sequences:

4. Why are the synthetic nucleotide sequences (â&#x20AC;&#x2DC;genesâ&#x20AC;&#x2122;) 'tied' to the b-galactosidase gene?

(b) Secretion and purification of the protein product:

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

5. Yeast (Saccharomyces cerevisiae) is also used in the production of human insulin. Discuss the differences in the production of insulin using yeast and E. coli with respect to: (a) Insertion of the gene into the plasmid:

82 Engineering for Insect Resistance

No Cla t fo ssr r o Us om e

118

PR E V ON IEW LY

Key Idea: Up to one fifth of the world's crops are lost due to insects each year. Losses can be reduced through the use of genetic engineering to introduce the Bt gene into crop plants. A key goal in horticulture is the reduction of insect crop damage. Normally this is done using sprays. However

Bt toxin

USDA

In 1996 the seed company Monsanto released its first version of Bt corn. This corn had been genetically modified to contain the gene that produces the Bt protein. The target insect pest for Bt corn is the larval stage of the European corn borer, which causes hundreds of millions of dollars worth of damage to crops annually.

The effects of the Bt toxin on insect deterrence. The plant on the right has been treated with Bt toxin before being exposed to caterpillars. The plant on the left had not been treated with Bt toxin.

Producing a Bt plant

Genetic engineering has been used to produce cotton, corn, and potato varieties that produce the Bt toxin. The bacterium Agrobacterium tumefaciens is commonly used to transfer the Bt gene into plants, via recombinant plasmid: Agrobacterium tumefaciens

Transformed plant cells are cultured into the lab and grown into new plants before being planted out.

Bacillus thuringiensis

Bt gene

Ti plasmid inserted back into Agrobacterium

Corn cell infected with Agrobacterium

Bt gene inserted into Ti plasmid

Ti plasmid

Agrobacterium transfers DNA into plant cell

Recombinant plasmid

1. Name the bacteria that produces Bt toxin:

3. What is the primary target of the Bt toxin in Bt corn?

4. Explain how Bt corn is produced using Agrobacterium tumefaciens:

WEB

KNOW

LINK

80 APPA

No Cla t fo ssr r o Us om e

2. Why is Bt toxin a useful insecticide?

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

119

No Cla t fo ssr r o Us om e

What's killing the monarchs? It's not the corn

Above: North American populations of monarchs migrate (above) to overwintering sites in Mexico and California.

Right: Monarch caterpillars feed exclusively on milkweed.

It now appears that there is a related but quite different reason for the Monarch butterfly decline. In 1996, Monsanto also began selling "Roundup Ready" corn, engineered to withstand glyphosate herbicide. Corn crops could be sprayed with herbicide and while the weeds die the corn would keep on growing, allowing less targeted spraying applications. As a result milkweed, which often grew in or near corn crops, was also killed, leaving no food for monarch caterpillars.

Total area occupied by monarch colonies at overwintering sites in Mexico.

22 20 18 16

Hectares (ha)

So... What's killing the monarchs?

Scott McDougall

By 1999 monarch butterfly populations in the American Midwest began declining. During that year, Cornell University published a paper showing that the Bt toxin could be dispersed to other plants by the corn's pollen. Pollen landing on milkweed near corn crops could potentially kill the monarch caterpillars that feed exclusively on the milkweed. This resulted in a backlash against Bt corn by environmental activists. However, in 2001 a study was released that argued the toxin in pollen was not causing monarch decline. The toxicity in pollen was due mainly to the Bt 176 variety which was used in less than 2% of the corn grown and was in the process of being phased out. Other Bt corn varieties did not develop enough toxin, or their pollen density was too low to affect monarch caterpillars.

David R. Tribble

PR E V ON IEW LY

Bt corn was developed by the company Monsanto and sales began in 1996. There are many different types of Bt corn, each one engineered to produce the toxin in slightly different ways. One of the first produced was Bt 176.

14 12 10 8 6 4 2

Crystals of Bt toxin

-1

-0

-9

Winter season (year)

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

5. As a group, discuss the ethical issues surrounding GM corn and monarch declines. Who is to blame for the decline of monarchs and what can be done to help the population recover? Summarise the main points of your discussion below:

83 Food for the Masses

No Cla t fo ssr r o Us om e

120

the Earth's land area, leaving little room to grow more crops or farm more animals. Development of new fast growing and high yield crops appears to be part of the solution, but many crops can only be grown under a narrow range of conditions or are susceptible to disease. Moreover, the farming and irrigation of some areas is difficult, costly, and can be environmentally damaging. Genetic modification of plants may help to solve some of these looming problems by producing plants that will require less intensive culture or that will grow in areas previously considered not arable.

Useful organisms

Enzymes

PR E V ON IEW LY

Key Idea: Genetic engineering has the potential to solve many of the world's food shortage problems by producing crops with greater yields than those currently grown. Currently 1/6 of the world's population are undernourished. If trends continue, 1.5 billion people will be at risk of starvation by 2050 and, by 2100 (if global warming is taken into account), nearly half the world's population could be threatened with food shortages. The solution to the problem of food production is complicated. Most of the Earth's arable land has already been developed and currently uses 37% of

Restriction enzyme

Fungus that is able to survive dry conditions using two enzymes WA-UT1 and Ter-UT2 to facilitate water uptake.

Reverse transcriptase

Plant identified for modification

Engineering your solution

Bacterium known to thrive in dry conditions using a single enzyme DRI-X1 to catalyse multiple reactions.

A solution to the possible future food crisis is to genetically engineer food crops so that they can maximise their growth under adverse conditions. Standard selective breeding techniques could be used to do this, but in some plants this may not be possible or feasible and it may require more time than is available. A selection of genetic tools and organisms with useful characteristics are described. Your task is to use the items shown to devise a technique to successfully create a plant that could be successfully farmed in semi-desert environments such as sub-Saharan Africa. The following page will take you through the procedure. Not all the items will need to be used.

Petri dish

DNA ligase

Plasmid

No Cla t fo ssr r o Us om e

Adenovirus

Retrovirus

Agrobacterium

Liposome

Incubator

Possible vectors

Equipment

WEB

KNOW

LINK

80 APPA

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

1. Identify the organism you would chose as a 'donor' of drought survival genes and explain your choice:

2. Describe a process to identify and isolate the required gene(s) and identify the tools to be used:

3. Identify a vector for the transfer of the isolated gene(s) into the crop plant and explain your decision:

4. Explain how the isolated gene(s) would be integrated into the vector's genome:

5. (a) Explain how the vector will transform the identified plant:

(b) Identify the stage of development at which the plant would most easily be transformed. Explain your choice:

No Cla t fo ssr r o Us om e

6. Explain how the transformed plants could be identified:

7. Explain how a large number of plants can be grown from the few samples that have taken up the new DNA:

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

121

84 What You Know So Far: Transgenesis

No Cla t fo ssr r o Us om e

122

Applications of transgenesis

PR E V ON IEW LY

Summarise what you know about this topic so far under the headings provided. You can draw diagrams or mind maps, or write short notes to organise your thoughts in preparation for the essay question that follows. Use the points in the introduction and the hints provided to help you:

HINT: Describe some agricultural, medical, and industrial applications of transgenesis.

Tools and techniques for genetic engineering

HINT: Outline the tools and techniques used to manipulate DNA sequences.

Ethics of transgenesis

HINT: Define transgenesis and describe how transgenic organisms can be produced.

HINT: Summarise the biological implications of transgenesis.

No Cla t fo ssr r o Us om e

Transgenesis

REVISE

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

123

No Cla t fo ssr r o Us om e

85 Determining Gene Function development of the normal and altered individuals. In classical genetics, this is done using mutant organisms with defects in particular genes. However, natural mutations may not occur in the gene being studied, so a modern solution is required. One technique for doing this is called gene knockout in which the target gene is altered to become non-functional. A second technique is called gene knockdown where the mRNA of the gene is altered to become non-functional.

PR E V ON IEW LY

Key Idea: Removing a gene or suppressing its expression are two techniques to determine gene function. Determining the function of a gene provides an understanding of how organisms develop. This helps develop treatments for genetic diseases, or to improve livestock and crops. One of the best ways to determine the function of a gene is to produce an individual with a non-functional version of the gene. The gene's function can be determined by comparing the

Creating gene knockout mice

Embryonic stem cells (ESCs) are grown in culture.

A non-functional version of the target gene is constructed in vitro and introduced to ESCs via a suitable vector.

ESCs injected into 3 day old blastocysts.

A colony of ESCs is grown.

NIH

Fertilised eggs collected from female mouse.

Gene knockout mice are commonly used to determine the effect of genes that humans and mice both have in common. Mice are used because they are the most closely related laboratory animal species to humans to which the gene knockout technique can easily be applied.

Cells are tested to see which have the non-functional gene. This is often done by looking for an associated marker gene.

Blastocysts implanted into surrogate female.

Lexicon Genetics/HGRI

Cells incorporated into blastocysts.

Several thousand strains of knockout mice have now been bred. The knockout mouse above left was created as a model for obesity.

ESCs with copy of non-functional gene.

Second generation offspring have one copy of the non-functional gene (they are heterozygous). Selective breeding produces third generation offspring homozygous for the non-functional gene (they have two copies of the non-functional gene).

Recently, gene knockout has been used to knockout the BCL11A gene that would usually cause sickle cell disease to develop in mice. The research is helping to develop a drug treatment for human sufferers of sickle cell disease.

No Cla t fo ssr r o Us om e

First generation offspring are tested for the presence of the non-functional gene. Those with the non-functional gene are bred.

1. (a) Describe how gene function was studied before the development of gene knockout:

(b) Why was this method not as efficient as gene knockout?

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

LINK

WEB

KNOW

124

Gene knockdown Targeted gene in nucleus

Introduced dsRNA

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

Gene knockdown is a technique where the mRNA product of a gene is targeted and disrupted so it can't carry out its normal function. Double stranded RNA (dsRNA) is introduced into the cells being studied. The dsRNA is processed to produce small interfering RNA (siRNA). These bind to the mRNA product of the target gene, and inactivate it (right).

Organisms can be engineered so that their DNA is modified to carry the code for the dsRNA. A vector is used to introduce the new DNA code into the zygote of the organism. All the cells of the individual will carry the DNA code for the dsRNA. This is important because it means the gene knockdown can produce its effects in the very first generation (unlike gene knockout). However, gene knockdown is not always 100% effective (hence its name).

RNAi pathway processes dsRNA into siRNA

mRNA

Affected pathway

siRNA (in association with other proteins) inactivates mRNA

Unaffected (normal) pathway

No protein formed

Protein formed

2. In the process of creating a gene knockout mouse:

(a) Where does the non-functional gene come from?

(b) How is the non-functional gene introduced into the blastocysts?

(d) Explain how a mouse that is homozygous for the non-functional gene is produced:

3. (a) Explain how gene knockout produces its effects compared to gene knockdown:

(b) Describe two other differences between gene knockout and gene knockdown:

4. Describe some uses of gene knockout and gene knockdown:

No Cla t fo ssr r o Us om e

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

125

No Cla t fo ssr r o Us om e

86 New Tools: Gene Editing with CRISPR for CRISPR to work: an RNA guide that locates and binds to the target piece of DNA and the Cas9 endonuclease that unwinds and cuts the DNA. The technology has potential applications in correcting mutations responsible for disease, switching faulty genes off, adding new genes to an organism, or studying the effect of specific genes. It represents a major advance because it allows more precise and efficient gene editing at much lower cost than ever before.

PR E V ON IEW LY

Key Idea: CRISPR is a complex comprising Cas9 endonuclease and sgRNA. The CRISPR complex cuts DNA at very specific sequences and can be used to edit genes. CRISPR-Cas9 (shortened to CRISPR and pronounced crisper) is an endonuclease complex occurring naturally in bacteria, which use it to edit the DNA of invading viruses. CRISPR is able to target specific stretches of DNA and edit it at very precise locations. Two key components are required

Single guide RNA (sgRNA) is a short synthetic RNA sequence designed to guide Cas9 to the site of interest (e.g. a faulty gene sequence). It contains a nucleotide section which is complementary to the DNA of interest.

Cas9 is guided to the target site by sgRNA. Cas9 unwinds the DNA and cuts both strands at a specific point.

Cutting point

Target DNA sequence

3' 5'

The PAM sequence (NGG)* lies directly downstream of the target sequence on the non-target DNA strand. Recognition of PAM by Cas9 destabilises the DNA allowing the sgRNA to be inserted. Cas9 will not function if PAM is absent.

*N can be any nucleotide

5' The cut DNA can be repaired using one of the following methods:

Gene knock in "gene editing"

A new DNA sequence is inserted into the DNA break. For example allows a faulty gene sequence can be replaced with the correct sequence to restore normal gene function.

Gene knock out "gene silencing"

As the cell's normal repair process mend the broken DNA, errors occur resulting in the insertion or deletion of nucleotide bases. The resulting frame-shift mutation changes the way the nucleotide sequence is read, either disabling gene function or producing a STOP signal. This technique can be used to silence a faulty gene.

1. What are the roles of the following in CRISPR gene editing: (a) Cas9:

(b) sgRNA:

2. Outline two ways CRISPR can be used to edit genes:

3. What benefits are offered by CRISPR technology?

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

LINK

WEB

KNOW

126

No Cla t fo ssr r o Us om e

87 Gene Probes be used to determine whether a person has a gene for a specific genetic disease, or to construct a gene map of a chromosome. DNA probes have either a radioactive label (e.g. 32P) or a fluorescent dye so that they can be visualised on an electrophoresis gel or X-ray film.

PR E V ON IEW LY

Key Idea: DNA probes use attached markers (tags) to identify the presence and location of individual genes. A DNA probe is a single stranded DNA sequence, with a base sequence that is complementary to a gene of interest. DNA probes target specific DNA sequences so they can

Phe

Ser

Leu

Making and using a DNA probe

A tag is added. This can be one of two types:

Fluorescent dye: Shows up as a fluorescent band when exposed to ultraviolet light.

Arg

Phe

ATTTTT

Ala

Radioactive tag: Shows up as a dark band when exposed to X-ray film.

Ala

Val

Iso

Probe

ATTTTT

The protein product of a gene is isolated and its amino acid sequence is determined.

The DNA sequence for the protein product is identified from the amino acid sequence. The DNA sequence is artificially manufactured.

The DNA sequence being probed is cut into fragments using restriction enzymes.

Probe identifies gene of interest

The DNA fragments are denatured, forming single stranded DNA. The probe is added to the DNA fragments.

If a complementary sequence is present, the probe will bind to it by base pairing.

ATTTTT

CGTTTTGCTGATAAAAA

The gel is viewed by fluorescent light or on X-ray film (depending on the type of probe used). If the probe has bound to a gene, the tag makes it visible.

The DNA fragments are run on an electrophoresis gel. The fragments are separated by size.

Target DNA strand (contains the complementary sequence to that of the probe).

1. What is the purpose of a DNA probe?

3. Why does the DNA have to be denatured before adding the probe?

4. How is the presence of a specific DNA sequence or gene visualised?

LINK

KNOW

LINK

No Cla t fo ssr r o Us om e

2. Explain why a DNA probe can be used to identify a gene or DNA sequence:

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

127

No Cla t fo ssr r o Us om e

88 Studying Gene Expression DNA (cDNA) using the enzyme reverse transcriptase. The DNA chip itself is covered with thousands of dots each containing thousands of copies of a unique DNA sequence which corresponds to a known gene from the genome being probed. When the cDNAs are applied to the chip, they will only bind to their complementary sequence. Computer analysis of the chip determines which dots have DNA bound, and this tells researchers which genes are being expressed.

PR E V ON IEW LY

Key Idea: DNA chips (also called microarrays or gene chips) are a progression of the technology in DNA probes. They allow thousands of DNA sequences to be probed at once. DNA chips allow researchers to study which genes are expressed (turned on) in a cell. It is done by probing the mRNA content of a cell. If certain mRNA is present, then a specific gene is turned on and being expressed. The mRNA is extracted from a cell and then copied into complementary

What is a DNA chip?

A DNA chip consists of DNA probes fixed to a small solid support such as a glass slide or a nylon filter. Each spot on the DNA chip has thousands to millions of copies of a different DNA probe. The probes are single stranded DNA molecules, each representing a gene. T TA G

GCGG T T

GAA CC

DNA chip

Normal cell

Cancerous cell

Segment of a chip

Spot containing copies of a single sequence of DNA

How DNA chips work

mRNA is extracted from cellsâ&#x20AC;Ś

Cellular mRNA

A microarray (DNA chip) contains thousands of DNA probes. Each tiny spot on the microarray has many copies of a different single stranded DNA probe.

Reverse transcription in the presence of a labelled nucleotide produces more stable cDNA molecules, each with a fluorescent tag. Molecules of cDNA representing more than one tissue, or the same tissue under different conditions can be tested together using a different coloured label for each.

Labelled cDNA molecules from cancerous cell

Hybridisation

A microarray can be constructed with thousands of different probes, so the activity of thousands of different genes can be investigated simultaneously. Gene from normal cell being expressed

Labelled cDNA molecules (single stranded) from normal cell

Gene from cancerous cell being expressed

The labelled cDNAs are applied to the chip. The tagged cDNA will only bind with its complementary probe. Binding indicates that the gene represented by the chip DNA was expressed, or active, in the sample.

No Cla t fo ssr r o Us om e

Part of one DNA strand

No gene being expressed

After hybridisation, the colour of the spot indicates the relative amount of mRNA in the samples. The microarray is scanned and a computer quantifies the amount of gene activity in the sample and generates a colour-coded read-out.

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

mRNA from both cells being expressed

LINK

WEB

KNOW

128

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

1. Describe one purpose of DNA chips:

2. (a) Identify the basic principle by which DNA chips work:

(b) Identify the role of reverse transcription in DNA chip technology:

3. DNA chips (microarrays) can be used to determine which genes are being expressed in a cell. In one type of microarray, hybridisation of the cDNA from cell 1 turns the dot red while hybridisation of the cDNA from cell 2 turns the dot green. Hybridisation of cDNA from both cells turns the dot yellow. In an experiment, cDNA derived from a strain of antibiotic resistant bacteria (cell 1) was labelled with a red fluorescent tag and cDNA derived from a nonresistant strain of the same bacterium (cell 2) was labelled with a green fluorescent tag. The cDNAs were mixed and hybridised to a chip containing spots of DNA from genes 1-25. The results are shown on the right.

No colour colour (no expression) expression)

Red (Expression Red (overexpression) cell 1)

Green (Expression cell 2) (underexpression)

Yellow (Expression Yellow (equal expression) in cell 1 and 2)

(a) Discuss the conclusions you could make about which genes might be implicated in antibiotic resistance in this case:

(b) Suggest how this information could be used to design new antibiotics that are less vulnerable to resistance:

No Cla t fo ssr r o Us om e

4. DNA chips are frequently used in diagnostic medicine to compare gene expression in cancerous and non-cancerous tissue. Suggest how this information could be used:

5. Suggest how the study of gene expression might help a genetic engineer produce new crops or manipulate model animals for further research:

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

129

No Cla t fo ssr r o Us om e

89 Gene Therapy transfers the DNA into the patient’s cells (transfection). The vector is introduced into an in-vitro sample of the patient’s cells, which are cultured to amplify the correct gene. The cultured cells are then transferred back to the patient. The treatment of somatic cells is therapeutic (provides a benefit) but the changes are not inherited. Germline therapy (modification of the gametes or zygote) would enable the changes to be passed on to the offspring. Gene therapy has had limited success because transfection of targeted cells is inefficient and the side effects can be severe or even fatal.

PR E V ON IEW LY

Key Idea: Gene therapy applies an understanding of gene function by introducing a correctly functioning gene into a patient to counteract the effect of a faulty gene. Once the function of a gene has been identified and the gene has been isolated, there is a potential for it to be used in gene therapy. Gene therapy uses gene technology to treat disease by correcting or replacing faulty genes so that the correct protein product is made and normal function is restored. All gene therapies are based around the same technique. The correct non-faulty gene is inserted into a vector, which

Modified DNA inserted into vector

Vector (adenovirus)

Nuclear membrane

Cytoplasm

Vesicle membrane

Viral vector containing corrected DNA is introduced to cell culture

DNA is passed into cell nucleus

Nuclear pores

Virus is taken in by the cell and packaged in vesicle

Nucleus

Virus makes its way to the cell nucleus where vesicle breaks down

Plasma membrane

Encoded protein is produced by the cell

Corrected DNA is integrated with the patient's DNA

No Cla t fo ssr r o Us om e

1. Describe the general principle of gene therapy:

2. Explain the biological implications of transfecting germline cells rather than somatic cells:

3. What is the purpose of gene amplification in gene therapy?

LINK

WEB

KNOW

130

No Cla t fo ssr r o Us om e

90 Vectors for Gene Therapy into the vector (the insert size), the efficiency of the uptake and expression, and the vector's potential to cause harm to the host are some factors to be considered when choosing a suitable vector for transferring genes to a human patient.

PR E V ON IEW LY

Key Idea: The properties of different vectors make them more or less suitable for use in gene therapy. Gene therapy requires a vector to introduce the DNA to a cell. The amount of genetic material that can be inserted

Vectors that can be used for gene therapy

Retrovirus

Adenovirus

Liposome

Naked DNA

Insert size

8000 bases

>20,000 bases

Integration into host’s DNA

Yes

Transfer to host

Poor

Good

Variable

Poor

Advantages

 Integrate genes into the chromosomes of the human host cell so will be replicated each time the cell divides. .  Offers chance for long-term stability.

 Modified, they infect human cells and express the normal gene.  Most do not cause disease.  Have a large capacity to carry foreign genes.

 Liposomes seek out target cells using sugars in their membranes that are recognised by cell receptors.  They have no viral genes that may cause disease.

 They have no viral genes that may cause disease.  Expected to be useful for vaccination.

Disadvantages

 Many infect only cells that are dividing.  Genes integrate randomly into chromosomes, so might disrupt useful genes in the host cell.

 May have poor survival due to attack by the host’s immune system.  Genes may function only sporadically because they are not integrated into the host cell’s chromosome.

 Less efficient than viruses at transferring genes into cells, but recent work on using sugars to aid targeting have improved success rate.

 Unstable in most tissues of. the body.  Inefficient at gene transfer.

1. (a) Which vectors are able to have the most DNA inserted into them?

(b) Suggest why being able to insert large pieces of DNA into a vector would be beneficial:

2. (a) Explain why it might be useful for corrective genes to be integrated into the host's chromosome:

(b) Explain why this property might be detrimental:

WEB

KNOW

LINK

No Cla t fo ssr r o Us om e

3. Haemophilia is a bleeding disorder caused by a deficiency in one of the genes for a blood-clotting factor. The blood clotting factors are produced in the liver and then released into the blood. The liver cells divide infrequently. The therapeutic gene needed to treat haemophilia is 2800 base pairs long. Using this information and the information in the table, decide which vector would be the most appropriate to deliver this gene therapy and justify your decision:

131

No Cla t fo ssr r o Us om e

91 Treating SCID with Gene Therapy A common treatment for SCID is bone marrow transplant, but this is not always successful and runs the risks of infection (and death) if undetected viruses are introduced. SCID was the first condition to be treated with gene therapy. It was a good candidate because it is caused by single, known mutation. Gene therapies for this disease have so far proved promising. However, it is not without complications (below).

PR E V ON IEW LY

Key Idea: SCID was the first disease treated using gene therapy. It has had mixed results, but more recent trials using improved technologies appear to be successful. SCID (Severe combined immune deficiency) is a rare genetic disorder affecting the immune system. It is also known as “bubble boy” disease, since affected people must live in a sterile environment to prevent contracting deadly infections.

SCID can be treated with gene therapy ffThere are several different types of SCID. The

most common form is X-linked SCID, which results from mutations to a gene on the X chromosome encoding a protein that forms part of a receptor complex for numerous types of leucocytes (white blood cells). A less common form of the disease, (ADA-SCID) is caused by a defective gene that codes for the enzyme adenosine deaminase (ADA).

Stem cells are isolated from the patient’s bone marrow.

ffBoth of these types of SCID lead to immune

The correct protein product is expressed.

system failure. Gene therapy appears to hold the best chances of producing a cure for SCID because the mutation affects only one gene, which has a known location.

Bone marrow cells. These are stem cells and give rise to all other blood cell types.

ffInitial treatments inserted the corrected gene into a gutted retrovirus and introduced it to a sample of the patient’s bone marrow (these are rapidly dividing stem cells).

ffThe treated cells (containing a correctly functioning version of the gene) were then returned to the patient (right). This treatment was successful in treating SCID but had the unfortunate side effect of causing leukaemia in some patients when the corrected gene was inserted next to a gene regulating cell growth, activating cancer genes.

Cells containing the corrected gene are transfused back into the patient.

Normal gene is inserted into the cells.

ffMore recent treatment has used a particular type

of retrovirus called a lentivirus. Lentiviruses can be modified to reduce the risk of cancer genes being activated. Gene therapy using this method have had some success in trials.

1. Why is SCID a good candidate for gene therapy?

No Cla t fo ssr r o Us om e

2. (a) Briefly outline the gene therapy process used to treat SCID:

(b) What problems were encountered in early SCID gene therapy treatments?

LINK

WEB

KNOW

132

No Cla t fo ssr r o Us om e

92 Treating Cystic Fibrosis with Gene Therapy correctly. The lungs are the most commonly affected organ. There is no cure for CF, and CF patients have a reduced lifespan. In most cases CF is caused by a single gene mutation, making it a good candidate for gene therapy. However, gene therapy treatment has only shown small, variable improvements, and scientists have not yet found a way to permanently fix the faulty gene.

PR E V ON IEW LY

Key Idea: Cystic fibrosis seems to be a good candidate for treatment with gene therapy but its success has been limited. Cystic fibrosis (CF) is an inherited genetic disease affecting a protein called CFTR. CFTR is involved in the production of sweat, digestive fluids, and mucus. When CFTR is not functional, secretions become very thick, accumulating in affected organs and preventing them from functioning

Gene therapy: potential treatment for cystic fibrosis? ffThe identification and isolation of the CF

Airway delivery to patient

gene in 1989 meant that scientists could look for ways in which to correct the genetic defect rather than just treating the symptoms using traditional therapies.

ffThe main target of CF gene therapy is the

Adenovirus

Liposome

Viral DNA Normal human allele

Normal human allele

lung because the progressive lung damage associated with the disease is eventually lethal and because delivering the treatment to the lungs was relatively easy.

ffIn trials, normal genes were isolated and

inserted into patients using vectors such as adenoviruses and liposomes, and delivered via inhalers and nebulisers to the airways (right).

average, there was only a 25% correction, the effects were short lived, and the benefits were quickly reversed. Alarmingly, the adenovirus used in one of the trials led to the death of one patient.

ffMore recent trials delivered a liposome

vector by nebuliser every 28 days over 12 months. Patients receiving the treatment showed a 3.7% improvement in lung function compared to patients receiving the placebo treatment. Longer trials are planned based on this modest success.

ffThe results of trials were disappointing: on

An adenovirus that normally causes colds is genetically modified to make it safe and to carry the normal (unmutated) CFTR gene.

Liposomes are tiny fat globules. Normal CF genes are enclosed in liposomes, which fuse with plasma membranes and deliver the genes into the cells.

1. (a) Why are the lungs the main target for CF gene therapy treatment?

(b) Outline some of the problems so far encountered with gene therapy for CF:

No Cla t fo ssr r o Us om e

2. (a) Explain why both CF and SCID are good candidates for gene therapy:

(b) Given this suggest why gene therapy for SCID has been much more successful than gene therapy for CF:

3. (a) Gene therapy for SCID and CF are both somatic cell gene therapy / germline gene therapy (delete one) (b) Explain your decision:

WEB

KNOW

LINK

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

133

No Cla t fo ssr r o Us om e

93 What You Know So Far: Gene Function Investigating gene expression

PR E V ON IEW LY

Summarise what you know about this topic so far under the headings provided. You can draw diagrams or mind maps, or write short notes to organise your thoughts in preparation for the essay question that follows. Use the points in the introduction and the hints provided to help you:

HINT: How are gene probes and DNA chips used to investigate gene expression?

Determining gene function

HINT: Describe the techniques used to determine gene function.

Gene therapy

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

HINT: Describe how gene therapy can be used to benefit the health and survival of individuals.

REVISE

94 Vegetative Propagation in Plants

No Cla t fo ssr r o Us om e

134

induce vegetative propagation to quickly produce many identical plants (clones) with desirable qualities. Many plants have the ability to develop roots or shoots wherever a part of the plant is touching the ground or where it may have been wounded. This comes from the plant's cells being able to de-differentiate (initiate new cell divisions and form new undifferentiated tissue). Multiple clones can therefore be produced by taking multiple cuttings from a single plant.

PR E V ON IEW LY

Key Idea: The ability of plants to reproduce vegetatively can be exploited to produce large numbers of identical plants. Many plants are able to reproduce asexually to produce new plants that are genetically identical to the parent plant. This process is called vegetative propagation and it is a natural process in many plants, which will often grow easily from cuttings and can produce various vegetative structures including rhizomes and runners. However, humans can also

Propagating plants from cuttings

A cutting that includes a leaf bud is made (left). The plant hormone auxin travels down the stem and accumulates at the base of the stem triggering the formation of roots. Adding synthetic auxins to the end of the cutting promotes greater root development.

Plants can be propagated using a technique called "cutting". The cutting (a piece of plant cut off a parent plant) is stimulated to grow by placing it in suitable growing conditions, often in the presence of growth hormones. Stems or roots are most often used for this technique.

Meristems (growing regions) contain undifferentiated totipotent cells that can potentially differentiate into any cell in the plant. The application of the hormone auxin initiates their development into root cells.

Meristems are the growing regions in plants. Normally these are the root meristem, shoot meristem, and cambium.

Phloem Xylem

Vascular bundle

Cambium

The roots that form at the base of the cutting are called adventitious roots. Adventitious roots form from cells that would not normally develop into roots.

Root initials

At the basal cut a plate of corky material seals the wound. Behind it cells begin to dedifferentiate and form root initials (areas of root meristems). In herbaceous plants the roots initials form from areas between the vascular bundles (left). In woody plants the root initials form from cells in the secondary phloem.

Section through dicot stem

Plant propagation by grafting

Grafting involves joining structures from two or more plants together. Typically a stem piece (called a scion) from one plant is grafted on to a piece of plant that has roots (called root stock). Grafting is used for many fruit and landscape trees and can be used to produce fruit trees that produce more than one type of fruit (e.g. peaches and nectarines). The technique is shown below and right.

Root stock

Scion

Incision into parent plant

Scion

Root stock

A scion preparedby by taking a A scion is is prepared cutting. The scion is then grafted taking a cutting. The scion to another plant (root stock). is then grafted to another plant (the root stock).

WEB

KNOW

LINK

Theis graft is covered The graft covered in in wax to infection and held wax toprevent prevent infection together with twine or raffia. and held together with twine or raffia.

LINK

106

Scion being grafted onto the stem of the root stock.

No Cla t fo ssr r o Us om e

A scion is removed from the parent plant prior to grafting.

A leaf and accompanying axial bud is cut from the parent stock. and covered The graft is sealed

2 The cutting is placed in a growth medium containing The rooting graft ishormones. then labelled

to prevent water loss and infection.

for future reference and monitoring.

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

135

By 1945 goats had eaten all but one of each of the Three Kings vine (left) and Three Kings kaikomako, found on the Three Kings Islands. Taking cuttings to grow new plants has contributed to saving these plants from extinction.

Advantages of plant propagation ffPlants are clones of the parent, so many plants with desirable traits to be produced.

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

Applications of plant propagation in conservation

ffVegetative propagation maintains a consistent quality for commercial growers.

ffPropagated plants reach maturity sooner than

Kahuroa

plants raised from seed. This reduces the cost and time to produce plants for commercial purposes.

The Poor Knights lily (left) is listed as a vulnerable species as it is endemic to only two locations, the Poor Knights Islands and Taranga (Hen) Island. Vegetative propagation has been used to successfully cultivate the plant on the New Zealand mainland.

Plants produced by propagation

Disadvantages of plant propagation

ffCloned plants have less genetic diversity than

plants produced via sexual reproduction. This may make them susceptible to changes in environmental conditions (e.g. drought) or plant diseases.

1. What is vegetative propagation?

2. Distinguish between cutting and grafting and their uses:

3. (a) Explain how vegetative propagation of plant material can be used as a strategy in species conservation:

(b) Suggest why stocks of rare plants would be reproduced this way, rather than using seed:

No Cla t fo ssr r o Us om e

4. Describe the biological implications of vegetative propagation of endangered plants:

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

95 Plant Tissue Culture The issue ffIndividuals vary in characteristics, even within specific

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

136

Key Idea: Large numbers of genetically identical plants can be grown from a small amount of tissue.

Concept 1

Plants can be cut into many pieces, almost all of which have the potential to grow into new plants.

varieties of the same species.

ffPlants that are uniform are easier to manage, but are difficult to produce in large numbers from naturally pollinated stock.

ffIt is advantageous for crop management, quality control,

and dissemination of transgenics to be able to produce large numbers of genetically uniform plants. The technology can also be applied in the recovery of endangered species.

Concept 2

Plants propagated from the same tissues will all have the same genetic make up. They will all be clones.

Stock plant in sterile conditions

Explant (axial bud)

Concept 3

Concept 4

Different growth hormones in plants cause the development of different parts of the plant, e.g. the shoots or roots.

If desirable plants are used for the original tissue then all the plants propagated from them will also be desirable.

Techniques

Pest free stock plants have small pieces cut (excised) from them. These pieces, called explants, may be stem tissue, nodes, flower buds, leaves or sections of shoot tip meristem. The surface of the explants are sterilised using a solution of sodium hypochlorite.

The explants are transferred to a culture vessel under sterile conditions.

Small pieces called explants are removed

Hypochlorite solution

Growth hormones are added. By changing the concentrations of different hormones, the explants can be made to grow shoots, roots, stems, or an undifferentiated cell mass (callus).

Transferred to growth medium

Growth medium contains nutrients and plant hormones.

Plants induced to grow shoots and roots are transferred to growing containers under controlled greenhouse conditions to be acclimatised before planting outside.

Calluses are mechanically broken up into separate cells and placed into a growth medium where they can be maintained indefinitely.

New shoots can be recut and transferred to new medium many times to produce many plants.

Plants are acclimatised in special greenhouses.

Incubation of cultures Duration: 3-9 weeks Temperature: 15-30oC Light regime: 14 hours per day

WEB

KNOW

LINK

Plant cell culture. Cells maintained in nutrient solution.

LINK

106

Outcomes

Plants propagated in this way may be genetically unstable or infertile, with chromosomes structurally altered or in unusual numbers. The success of tissue culture is affected by factors such as selection of explant material, the composition of the culturing media, plant hormone levels, lighting, and temperature. New genetic stock may be introduced into cloned lines periodically to prevent reduction in genetic diversity.

No Cla t fo ssr r o Us om e

Further applications

Plant tissue culture is extensively used in forestry to produce trees of uniform height and diameter. It has a number of advantages, including the ability to generate large numbers of plants from one explant and rapid propagation of species that have a long generation times or low seed production.

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

Micropropagation of Pinus radiata

Micropropagation methods must be carried out in a sterile environment. The embryo tissue is cut up and placed on a growth media.

Photos: FRI

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

137

The shoots above are from one seed. The nutrient medium provides all the necessary ingredients for shoot multiplication and growth. These shoots are further cut up to produce more plants.

After sufficient shoot growth, the shoots are treated with plant hormones to induce root production. The plantlets are then transferred to a greenhouse before being planted outside.

ffPinus radiata is New Zealand's major forestry tree. P. radiata plantations cover around 1.79 million hectares, much of it in the

North Island and includes the Kaingaroa forest, the largest P. radiata plantation in the Southern Hemisphere. The industry is worth close to $5 billion in export earnings.

ffIn order to make sure the wood harvested from the forests is of consistent quality, intensive seed and seedling production

programmes are used to produce seedlings for planting. Seeds from a desired plant are sterilised in bleach. The seed embryo is removed and cultured in a growth medium where it produces shoots. The shoots are removed and cut into multiple pieces, each of which is further cultured. In this way many thousands of genetically identical (and desirable) plants are quickly produced.

1. What is the purpose of plant tissue culture (micropropagation)?

2. (a) What is a callus?

(b) How can a callus be stimulated to initiate root and shoot formation?

3. Describe a potential problem with micropropagation in terms of long term ability to adapt to environmental changes:

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

4. Discuss the advantages and disadvantages of micropropagation compared with traditional methods of plant propagation:

96 Cloning by Embryo Splitting

No Cla t fo ssr r o Us om e

138

in-vitro, and the genetically identical embryos are implanted into surrogate mothers to complete development. The individuals produced by embryo splitting will have many of the same characteristics as the parents, although their exact phenotype is not known until after birth. Cloning provides genetically identical animals for studying disease processes. It can also be used (controversially) to produce embryos from which undifferentiated stem cells can be isolated for use in therapeutic medicine.

Livestock are selected on the basis of desirable qualities such as wool, meat, or milk production. Multiple eggs are taken from chosen individuals. These are then fertilised and grown in-vitro to produce multiple embryos for implantation into surrogates.

Dr David Wells, AgResearch

PR E V ON IEW LY

Key Idea: Cloning by embryo splitting replicates the natural twinning process, but enables multiple clones to be produced from just one high-value individual. Clones are organisms that are genetically identical. Livestock may only produce one or two offspring a year, so cloning makes it possible to produce animals with desirable characteristics more quickly. Embryo splitting (also called artificial twinning) is the simplest and least problematic way to create a clone. It replicates the natural twinning process

The photo above shows cloned embryos immediately prior to implantation into a surrogate. These are at the blastocyst stage (50 - 150 cells). A single livestock animal may provide numerous eggs and therefore many blastocysts for implantation.

Embryo splitting produces clones, but these are derived from an embryo whose physical characteristics are not completely known. This represents a limitation for practical applications when the purpose is to produce high value livestock.

Stages in embryo splitting

The cloning process (forming the twin) begins here

Artificial zona pellucida

Egg

Sperm

Zona pellucida: a coating that promotes normal cell division.

Egg cells are removed from an animal and fertilised in a petri dish.

Zona pellucida

At the first stage of development, one of these fertilised eggs divides in two.

The zona pellucida is removed with an enzyme and the two cells are separated.

An artificial zona is added, allowing development to proceed.

The cells continue to divide, forming genetically identical embryos. These are implanted into surrogates.

2. Describe the benefits gained from cloning:

No Cla t fo ssr r o Us om e

1. How does embryo splitting enable breeders to increase the number of progeny from a single high value animal?

3. Why would it be undesirable to produce all livestock using embryo splitting?

WEB

KNOW

LINK

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

139

No Cla t fo ssr r o Us om e

97 Cloning by Somatic Cell Nuclear Transfer a somatic (body) cell (from an individual of known phenotype) to a dormant state and then fusing it with an egg cell in which the nucleus is removed. Embryonic development is triggered and the resulting embryo is implanted into a surrogate mother. The primary aim of the new cloning technologies is to provide an economically viable way to rapidly produce transgenic animals with very precise genetic modifications.

PR E V ON IEW LY

Key Idea: Clones can be made by fusing an empty egg cell with a cell from the organism to be cloned. Clones produced using traditional embryo-splitting must mature before their phenotype is known. Scientists wanted to speed up the selection process and produce clones directly from a proven phenotype. The technique developed to do this is called somatic cell nuclear transfer. It involves returning

Concept 1

Concept 2

Concept 3

Concept 4

Somatic cells can be made to return to a dormant or embryonic state so that their genes will not be expressed.

The nucleus of a cell can be removed and replaced with the nucleus of an unrelated cell. Cells can be made to fuse together.

Fertilised egg cells produce embryos. Egg cells that contain the nucleus of a donor cell will produce embryos with DNA identical to the donor cell.

Embryos can be implanted into surrogate mothers and develop to full term with seemingly no ill effects.

Somatic cell nuclear transfer (SCNT)

Techniques

Donor cells taken from udder of a Finn Dorset ewe

Donor cell

Unfertilised egg cell from a Scottish blackface ewe has nucleus removed. Egg cell

Finn Dorset ewe

Micropipette

Blunt holding pipette

First electric pulse

Donor cells from the udder of a Finn Dorset ewe are taken and cultured in a low nutrient media for a week. The nutrient deprived cells stop dividing and become dormant. An unfertilised egg from a Scottish blackface ewe has the nucleus removed using a micropipette. The rest of the cell contents are left intact. The dormant udder cell and the recipient denucleated egg cell are fused using a mild electric pulse. A second electric pulse triggers cellular activity and cell division, jump starting the cell into development. This can also be triggered by chemical means. After six days the embryo is transplanted into a surrogate mother, another Scottish blackface ewe. After a 148 day gestation 'Dolly' is born. DNA profiling shows she is genetically identical to the original Finn Dorset cell donor.

Cells are fused

Outcomes

A time delay improves the process by allowing as yet unknown factors in the cytoplasm to activate the chromatin.

Second electric pulse

Fused cells

Birth of Dolly the sheep

Dolly, a Finn Dorset lamb, was born at the Roslin Institute (near Edinburgh) in July 1996. She was the first mammal to be cloned from non-embryonic cells, i.e. cells that had already differentiated into their final form. Dolly's birth showed that the process leading to cell specialisation is not irreversible and that cells can be 'reprogrammed' into an embryonic state. Although cloning seems relatively easy there are many problems that occur. Of the hundreds of eggs that were reconstructed only 29 formed embryos and only Dolly survived to birth.

No Cla t fo ssr r o Us om e

Cell division triggered

PHOTO: Courtesy Roslin Institute ÂŠ

Further applications

Blackface ewe

Dolly

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

Embryo transplanted into surrogate mother, another Scottish black face ewe.

In animal reproductive technology, cloning has facilitated the rapid production of genetically superior stock. These animals may then be dispersed among commercial herds. The primary focus of the new cloning technologies is to provide an economically viable way to rapidly produce transgenic animals with very precise genetic modifications.

LINK

WEB

KNOW

140 Cloning and conservation

No Cla t fo ssr r o Us om e

Advantages and disadvantages of animal cloning Advantages

PR E V ON IEW LY

ffRapid production of animals with desirable qualities, e.g. high wool quality. ffApplications for production of disease-resistant livestock, conservation (right), or treatment of disease.

Lady

Disadvantages

ffSCNT can be inefficient (e.g. many hundreds of attempts were made before Dolly was successfully cloned).

ffMany cloned animals are much bigger at birth than their natural

counterparts. This is called large offspring syndrome (LOS). Clones with LOS have abnormally large organs, and can suffer from breathing or circulatory problems.

Elsie ("L-C" Lady clone)

ffEthical and moral issues are associated with the destruction of embryos.

Dr David Wells, AgResearch

Donor cow

10 cloned calves

Cloning allows a rapid spread of valuable livestock into commercial use. It also allows the livestock industry to respond rapidly to market changes in the demand for certain traits in livestock products (e.g. lean meat). Photo above: Ten healthy clones were produced from a single cow (differences in coat colour patterns arise from the random migration of pigment cells in early embryonic development).

Enderby Island is part of the Auckland Islands group, south of New Zealand. A distinct cattle breed arose there after 90 years of isolation following their abandonment on the island in the early 1900s. In attempts to restore the island ecology, most of the cattle were destroyed, but semen and egg cells were taken and stored. In 1992, it was discovered that two cattle remained on the island, a cow (Lady) and her calf (which later died). Lady produced a bull calf by in vitro fertilisation and implantation in a surrogate mother and Lady herself was cloned using SCNT. Two surviving clones were bred to the bull calf and the small population is now in its third generation. The Enderby Island cattle remain the only rare breed to be saved from extinction using SCNT.

1. (a) What is SCNT?

(b) How does SCNT differ from embryo splitting?

3. Discuss the biological implications of SCNT:

No Cla t fo ssr r o Us om e

2. What are the benefits of using SCNT to produce livestock with desirable traits?

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

141

Cloning by SCNT

PR E V ON IEW LY

Summarise what you know about this topic so far under the headings provided. You can draw diagrams or mind maps, or write short notes to organise your thoughts in preparation for the essay question that follows. Use the points in the introduction and the hints provided to help you:

HINT: Describe how clones are produced by SCNT. Describe its biological implications.

Cloning by embryo splitting

HINT: What is a clone? How does embryo splitting produce clones?

PHOTO: Courtesy Roslin Institute ÂŠ

No Cla t fo ssr r o Us om e

98 What You Know So Far: Cloning

Plant cloning techniques

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

HINT: Describe the techniques used to clone plants. Describe the biological implications of these techniques.

REVISE

142

No Cla t fo ssr r o Us om e

99 What is Selective Breeding? now often uses reproductive technologies, such as artificial insemination, so that the desirable characteristics of one male can be passed onto many offspring. This increases the rate at which the desirable trait is passed to progeny. There are problems associated with selective breeding. The gene pool becomes smaller and some alleles may be lost. A reduction in genetic diversity decreases the ability of a species to adapt to changes in the environment.

PR E V ON IEW LY

Key Idea: Selective breeding is the process of breeding together organisms with desirable qualities (e.g. high milk yield) so the trait is reliably passed on to the next generation. Selective breeding (or artificial selection) is the process by which humans select organisms with desirable traits and breed them together so the trait appears in the next generation. The process is repeated over many generations until the characteristic becomes common. Selective breeding

Producing the perfect dairy cow

ffIn the past,fixing a desirable trait into the herd could

take a long time because a single bull could only impregnate a limited number of cows. Today, selective breeding allows for desirable traits to be established far more quickly, and it often uses genetic information for selection rather than waiting on desirable traits to become obvious. The use of reproductive techniques (e.g. artificial insemination) means the traits can quickly be passed on to many offspring. These factors have increased the rate at which stock improvements are made.

Placid

ffMost of the economically important traits in dairy cattle

are quantitative traits, i.e. they are traits that are affected by many genes, as well as the environment. The most important traits (right) are expressed only in females, but the main opportunity for selection is in males. Intense selection of the best bulls, combined with their worldwide use through artificial insemination and frozen semen has seen a rapid genetic gain in dairy cattle since the 1970s (genetic gain is the increase in performance as a result of selective breeding).

ffBulls are assigned breeding values based on the

performance of their daughters and granddaughters. In this way, the bulls and cows with the best genetics can be selected to produce the next generation. More recent genetic techniques include marker selected selection and pre-implanation genetic diagnosis. Such techniques have enabled farmers to improve the accuracy of their herd records and the certainty with which they select their breeding stock.

Correct conformation: avoids injury, walks and stands comfortably

High milk yield, resists mastitis.

Few metabolic disorders, maintains body condition on inexpensive rations.

Shows when on heat and conceives easily. Produces a live calf without assistance.

Breeding programmes select not only for milk production, but also for fertility, udder characteristics, and good health and disposition. In addition, selection can be based on milk composition, e.g. high butterfat content (a feature of the Jersey breed, above).

(b) Describe one advantage of selective breeding:

2. How has selective breeding changed over time?

WEB

KNOW

LINK

100 101

No Cla t fo ssr r o Us om e

1. (a) What is the basis of selective breeding?

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

143

No Cla t fo ssr r o Us om e

100 Selective Breeding in Dogs example herding dogs have been bred to have a modified predatory behaviour, which means they will herd the animals they work with rather than attack them. However, selective breeding often involves inbreeding from a limited gene pool. Inbreeding combined with the linkage of some traits (the coupled inheritance of genes on the same chromosome) means many dog breeds have detrimental health issues.

PR E V ON IEW LY

Key Idea: Selective breeding in dogs has produce the wide range of different breeds seen today. The selection for some traits has also produced detrimental traits in some breeds. The wide variety of dog breeds seen today is a result of selective breeding. Humans have selected and bred animals with desirable traits to produce dogs with a range of appearances and temperaments suited to particular jobs. For

The origins of domestic dogs

Problems with selective breeding

All breeds of dog are members of the same species, Canis familiaris and provide an excellent example of selective breeding. The dog was the first domesticated species and, over centuries, humans have selected for desirable traits, so extensively that there are now more than 400 breeds of dogs. Until very recently, the grey wolf was considered to the ancestor of the domestic dog. However, 2015 genetic studies provide strong evidence that domestic dogs and grey wolves are sister groups and shared a now extinct wolf-like common ancestor, which gave rise to the dog before the agricultural revolution 12,000 years ago. Based on genetic analysis, four major clusters of ancient dog breeds are recognised (below). Through selective breeding, all other breeds are thought to have descended from these clusters.

Selection for a desirable phenotype can lead to a consequential emphasis of undesirable traits, often because genes for particular characteristics are linked and selection for one inadvertently selects for the other. For example, the German shepherd is a working dog, originally bred for its athleticism and ability to track targets. However in German shepherds bred to meet the appearance criteria of show dogs, some traits have been exaggerated so much that it causes health issues. The body shape of the show German shepherd has been selected for a flowing trot and has a pronounced sloping back. This has resulted in leg, hip, and spinal problems. In addition, selective breeding has increased the incidence of some genetic diseases such as epilepsy and blood disorders.

1: Older lineages

2: Mastiff-type

3: Herding

4: Hunting

The oldest lineages, including Chinese breeds, basenji, huskies, and malamutes.

An older lineage that includes the mastiffs, bull terriers, boxers, and rottweilers.

Includes German shepherd, St Bernard, borzoi, collie, corgi, pug, and greyhound

Most arose in Europe. Includes terriers, spaniels, poodles, and modern hounds.

Modern dog breeds exhibit a huge variety of physical and behavioural phenotypes. Selective breeding has produced breeds to meet the specific requirements of humans.

Straight-backed German shepherd

Sloped-backed German shepherd

(b) How could this problem be solved?

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

1. (a) Why do purebred dogs (such as the German shepherd) often have detrimental health issues?

LINK

WEB

100

KNOW

144

No Cla t fo ssr r o Us om e

101 Selective Breeding in Dairy Cattle production and fertility. Since the 1960s, the University of Minnesota has maintained a Holstein cattle herd that has not been subjected to any selection. They also maintain a herd that was subjected to selective breeding for increased milk production between 1965 and 1985. They compared the genetic merit of milk yield in these groups to that of the USA Holstein average.

PR E V ON IEW LY

Key Idea: Selective breeding is capable of producing very rapid change in the phenotypic characteristics of a population. Humans may create the selection pressure for evolutionary change by choosing and breeding together individuals with particular traits. The example of milk yield in Holstein cows (below) illustrates how humans have directly influenced the genetic makeup of Holstein cattle with respect to milk

Gain in genetic merit of milk yield

2200

200

-800

-1800

-2800

Selection of sires with the desirable traits is critical to breeding programmes in dairy cattle.

-4800

-5800

-6800

4 3 2 1 0

-4

Birth year

UMN control cows U.S. average UMN selection cows

Milk production in the University of Minnesota (UMN) herd subjected to selective breeding increased in line with the U.S. average production. In real terms, milk production per cow per milking season increased by 3740 kg since 1964. The herd with no selection remained effectively constant for milk production.

-2

-7800

Daughter pregnancy rate

Based on data from T.S. Sonstegard et al

Genetic merit of milk yield

1200

-3800

Fertility in holstein cows

UMN control cows U.S. average UMN selection cows

Along with increased milk production there has been a distinct decrease in fertility. The fertility of the University of Minnesota (UMN) herd that was not subjected to selection remained constant while the fertility of the herd selected for milk production decreased with the U.S. fertility average.

1. (a) Describe the relationship between milk yield and fertility on Holstein cows:

(b) What does this suggest about where the genes for milk production and fertility are carried?

2. What limits might this place on maximum milk yield?

No Cla t fo ssr r o Us om e

3. Why is sire selection important in selective breeding, even if the characters involved are expressed only in the female?

4. Natural selection is the mechanism by which organisms with favourable traits become proportionally more common in the population. How does selective breeding mimic natural selection? How does the example of the Holstein cattle show that reproductive success is a compromise between many competing traits?

WEB

KNOW

101

LINK

102

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

145

No Cla t fo ssr r o Us om e

102 IVF and Embryo Transfer Technologies in Cattle insemination is now a well established technology and has allowed breeders to maximise offspring from superior sires to improve their herds. More recently, in-vitro fertilisation and embryo transfer (ET) technologies have accelerated these genetic gains. ET also permits screening and embryo selection technologies to be used to select for sex and superior genetic profiles, and screen out defective progeny. IVF and ET are currently used to improve herd genetics in other livestock too,including goats and horses.

PR E V ON IEW LY

Key Idea: Rapid production of high quality livestock is possible using reproductive techniques such as artificial insemination (AI), embryo transfer (ET), and in-vitro fertilisation (IVF). The selection and breeding of cattle for dairy and beef production is a huge industry. Assisted by rapid advancements in reproductive technologies, breeders have been able to capitalise on the reproductive potential of superior individuals to improve the genetics of herds (genetic gain) more rapidly than would occur by conventional selection methods. Artificial

Multiple ovulation embryo transfer (MOET)

Semen is taken from a high quality bull. Semen may be sexed prior to use.

Within 24 hours, the embryos are transplanted to the uteruses of foster mothers.

Cow is artificially inseminated with sperm. Multiple eggs are fertilised.

Several embryos form in the cow (in-vivo). At 7 days, they are flushed from the uterus.

High quality cow is given hormones to induce multiple ovulations.

Embryos are split into several smaller embryos.

Up to 20 high quality offspring per donor cow per year are produced.

Embryos are screened for defects and allelic markers and may be sex selected.

In-vitro fertilisation (IVF) and embryo transfer

Eggs are allowed to mature in maturation medium (20-24 hours).

Eggs are selected on the basis of appearance.

Eggs in fluid

High quality offspring (~ 40 per donor cow per year).

Foster cow

No Cla t fo ssr r o Us om e

Eggs are collected by ultrasound guided aspiration of ovarian follicles without the need for hormones (ovum pick up). Eggs can be collected from pregnant, pre-reproductive, or even dead cows and the procedure can be repeated every two weeks. Embryos are screened.

In-vitro fertilisation of eggs with sperm from a high quality sire. Less sperm is needed than for in-vivo production of embryos.

Embryos develop ~7 days. Blastocyst stage embryo is transferred to foster cow 8 days after ovum pick up. Embryos are screened before transfer.

1. Compare and contrast the biological features of MOET and embryo transfer after IVF in cattle:

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

LINK

WEB

104 103 102

KNOW

146 Pre-implantation genetic diagnosis (PGD) and embryo selection in cattle

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

Genetic testing of embryos prior to their transfer to the uterus (PGD) is an established feature of human reproductive technology as it enables parents to select only healthy embryos for transfer. Technical advances in PGD in cattle embryos is now allowing the procedure to be integrated into embryo transfer programmes in the dairy and beef industries too. PGD allows embryos to be selected on the basis of their allelic makeup, as identified by markers. It can be used to select (or reject) embryos on the basis of their sex or valuable production traits (using Marker Assisted Selection).

Eggs (ova) are collected by aspiration of donor cows and mature in-vitro before IVF.

The genetic material is tested using PCR or fluorescent in situ hybridisation (FISH). FISH is a technique for probing DNA for specific genes or nucleotide sequences. Different probes are used to test for specific genetic disorders, to determine sex, or to locate markers of favourable alleles.

Female embryos that carry markers for favourable alleles are transplanted into the uteruses of foster mothers.

Egg

In-vitro fertilisation of eggs by sperm from a high quality sire.

Sperm

Embryo 8-cell

The egg is fertilised in vitro. When the embryo reaches the eight cell stage, one cell is removed and its genome screened.

Male embryos and those that show genetic abnormalities are not implanted.

2. How do IVF and embryo transfer technologies increase the rate of genetic gain relative to natural breeding practices (bull with a herd) and artificial insemination of individuals in a herd?

No Cla t fo ssr r o Us om e

3. Young male calves (bobby calves) are often seen as a 'waste product' of the dairy industry and most go to slaughter. How could techniques such as sexing of sperm and embryo selection improve animal welfare in the dairy industry?

4. Discuss the genetic consequences of the rapid genetic gains in one direction achieved through IVF and ET technologies:

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

147

No Cla t fo ssr r o Us om e

103 Genetic Tools for Selective Breeding are short (2-6 base pairs) and are called microsatellites or short tandem repeats (STRs) and can repeat up to 100 times. Equivalent sequences in different individuals vary considerably in the numbers of the repeating unit. This phenomenon has been used to develop DNA profiling which identifies the natural variations found in every individual's DNA. DNA profiling can also be used to investigate genetic relatedness (e.g. pedigree), to search for the presence of a particular gene (e.g. screening for disease), or to determine the genetic diversity of small populations of endangered species, e.g kakapo, or black robin.

PR E V ON IEW LY

Key Idea: Short units of DNA that repeat a different number of times in different individuals can be used to produce individual genetic profiles. In any species, about 99.9% of the DNA between individuals will be the same. The remaining 0.1% accounts for the variation we see, e.g. blue and brown eyes in humans. These DNA differences can be used to genetically identify individuals. Some of this genetic variation is due to simple, repetitive nucleotide sequences. These non-coding nucleotide sequences repeat themselves many times and are found scattered throughout the genome. Some repeating sequences

elomeres T

Microsatellites (Short Tandem Repeats)

Microsatellites consist of a variable number of tandem repeats of a 2 to 6 base pair sequence. In the example below it is a two base sequence (CA) that is repeated.

Centromeres

Homologous pair of chromosomes

For example, the human genome contains ~100,000 separate blocks of tandem repeats of the dinucleotide: CA. One such block at a known location on a chromosome is shown below: DNA

CA CA CA CA CA CA CA CA CA CA CA

Microsatellites are found throughout the genome: within genes (introns) and between genes, and particularly near centromeres and telomeres.

How short tandem repeats are used in DNA profiling

DNA

Flanking regions to which PCR primers can be attached

DNA from individual A

The tandem repeat may exist in two versions (alleles) in an individual; one on each homologous chromosome. Each of the strands shown left is a double stranded DNA, but only the CA repeat is illustrated.

DNA from individual B

This diagram shows how three individuals can have quite different microsatellite arrangements at the same point (locus) in their DNA. Each will produce a different DNA profile using gel electrophoresis:

DNA from individual C

Microsatellite

Extract DNA from sample

A sample collected from the tissue of a living or dead organism is treated with chemicals and enzymes to extract the DNA, which is separated and purified.

Microsatelllite from individual A

Primers

Microsatelllite from individual B

Microsatelllite from individual C

Flanking STR region DNA

Amplify microsatellite using PCR

Visualise fragments on a gel

The fragments are separated by length, using gel electrophoresis. DNA, which is negatively charged, moves toward the positive terminal. The smaller fragments travel faster than larger ones.

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

The results of PCR are many fragments

No Cla t fo ssr r o Us om e

Specific primers (arrowed) that attach to the flanking regions (light grey) either side of the microsatellite are used to make large quantities of the microsatellite and flanking regions sequence only (no other part of the DNA is amplified/replicated).

Largest fragments

The products of PCR amplification (making many copies) are fragments of different sizes that can be directly visualised using gel electrophoresis.

Smallest fragments

LINK

WEB

103

KNOW

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

148

The photo above shows a film output from a DNA profiling procedure. Those lanes with many regular bands are used for calibration; they contain DNA fragment sizes of known length. These calibration lanes can be used to determine the length of fragments in the unknown samples.

DNA profiling can be automated. Powerful computer software is able to display the results of many samples that are run at the same time. In the photo above, the sample in lane 4 has been selected and displays fragments of different length on the left of the screen.

1. Describe the properties of short tandem repeats that are important to the application of DNA profiling technology:

2. Explain the role of each of the following techniques in the process of DNA profiling:

(a) Gel electrophoresis:

(b) PCR:

3. Describe the three main steps in DNA profiling using PCR: (a)

(c)

No Cla t fo ssr r o Us om e

(b)

4. Explain why as many as 10 STR sites are used to gain a DNA profile for an individual:

149

No Cla t fo ssr r o Us om e

104 Marker Assisted Selection appear for some time or its expression may be sex limited (e.g. high milk production in dairy cattle). Marker assisted selection (MAS) is a molecular technique in which the genotype of the individual is screened for genetic markers associated with genes for desirable traits. The technique can identify individuals with desirable genes early on and help direct breeding programmes by breeding only those individuals with the most desirable combination of genes.

PR E V ON IEW LY

Key Idea: Marker assisted selection is a molecular technique used to screen a genome for genetic markers that indicate desirable traits. Selective breeding is a relatively easy way to produce individuals with the desired phenotype in organisms that can be bred in large numbers, have short generation times, or have easily identified phenotypic traits. However, not all traits are easily identified and, in some cases, the trait may not

Quantitative trait loci

A quantitative trait is a phenotype (characteristic) that varies in its appearance, e.g. height, and is controlled by two or more genes.

Quantitative trait: Milk production

The genetic analysis of a quantitative trait requires a researcher to identify the genes associated with the trait. The locations of these genes (or their markers) are called quantitative trait loci.

For any given individual from a breeding stock, there will be many phenotypic traits that have been identified as desirable. Each of these traits may have many QTLs and so will require many gene markers to identify them all.

What is a gene marker?

A gene marker is a length of DNA that is associated with a particular gene. It is not necessarily the gene itself, but it is linked to and inherited with the gene. A number of markers are used in marker assisted selection, each with advantages and disadvantages:

QTL

Restriction Fragment Length Polymorphisms (RFLPs): This was one of the first markers used to identify genes. It is a simple digestion of DNA using a restriction enzyme. The fragments are separated on a electrophoresis gel.

Microsatellites: Microsatellites are short repeated sequences of DNA e.g. CACACA. They are highly variable between individuals, making them useful as markers. Single Nucleotide Polymorphisms (SNPs): SNPs are changes to one base pair in a DNA sequence. They are useful when they occur within a gene (thereby producing a new allele). SNPs act as direct markers if they are directly related to a desired gene.

Marker

Gene

Marker

1. What is a gene marker?

2. (a) What is a quantitative trait?

(b) Explain why a quantitative trait may have many gene markers:

No Cla t fo ssr r o Us om e

3. Explain why marker assisted selection can speed up the process of selective breeding for particular traits:

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

LINK

WEB

APPA 103 102 104

KNOW

150 Why MAS? Why not just use phenotypes?

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

There are two problems with using only phenotypic traits to choose individuals for selective breeding. Firstly, a breeder may have to wait many years before a trait becomes apparent in an individual. Secondly, some phenotypes are associated with multiple genes, and many of those genes have multiple alleles (versions of the gene). The effect of the alleles may not always be obvious. For example, a harmful allele may be hidden until it pairs up with another. Such a situation occurred with the holstein bull Osborndale Ivanhoe, as outlined below.

Profile of CD18 genes digested with Taq1

In 1988 a problem was affecting the US dairy industry. A disease specific to holstein cattle, called BLAD, was becoming common in calves. The disease affected their immune system's ability to fight off infection, and calves with the disease died. BLAD is a hereditary disease, caused by a recessive allele.

One bull named Osborndale Ivanhoe, produced offspring with high milk yields. He sired 79,000 daughters and 1200 sons, which were then used to sire many more holstein calves. However, Osborndale Ivanhoe was a carrier for BLAD. By the time it was discovered, 20,000 calves with BLAD were being born in the United States each year. The disease spread quickly because artificial insemination was used to impregnate thousands of cows with Osborndale Ivanhoe's semen. This example demonstrates that undesirable, as well as desirable traits, can quickly spread through a population using selective breeding.

In 1991 a gene marker was developed for BLAD. It was found that two mutations in the CD18 gene were responsible. One mutation affected the recognition site for the restriction enzyme Taq1. In the normal gene, Taq1 produces two fragments 26 bp and 32 bp long. In the affected gene, a recognition site is missing and only one 58 bp fragment is produced. MAS has identified BLAD carriers, and they have been removed from the breeding population. BLAD has virtually been eliminated from holstein cattle.

4. (a)

(b)

(c)

Section of DNA and amino acids from normal CD18 Gene

DNA Strand 5’…GGC TAC CCC ATC GAC CTG TAC TAC … 3’ Amino Acids … Gly Tyr Pro Lle Asp Leu Tyr Tyr …

Section of DNA and amino acids from the BLAD CD18 Gene DNA Strand 5’…GGC TAC CCC ATC GGC CTG TAC TAC … 3’ Amino Acids … Gly Tyr Pro Lle Gly Leu Tyr Tyr …

4. The DNA sequences below show a single DNA strand for each allele of the CD18 gene. The three sequences show (in no particular order) a genotype that is homozygous normal, a heterozygous genotype (one normal, one BLAD allele), and a genotype that is homozygous for the BLAD allele. The Taq1 restriction enzyme cuts the DNA at the recognition sequence TCGA (cutting between the T and C). For each of the sequences below circle the recognition sequence on both DNA strands (if necessary). Then simulate an electrophoresis gel in the blue gel box (Question 4 (a), (b), and (c)) above showing the two homozygotes (NN, BB) and the heterozygote (NB), and the approximate positions of the bands on the gel: (a)

GTGACCTTCCGGAGGGCCAAGGGCTACCCCATCGACCTGTACTACCTGATGGACCTCT GTGACCTTCCGGAGGGCCAAGGGCTACCCCATCGACCTGTACTACCTGATGGACCTCT

(b)

GTGACCTTCCGGAGGGCCAAGGGCTACCCCATCGGCCTGTACTACCTGATGGACCTCT GTGACCTTCCGGAGGGCCAAGGGCTACCCCATCGGCCTGTACTACCTGATGGACCTCT

(c)

GTGACCTTCCGGAGGGCCAAGGGCTACCCCATCGACCTGTACTACCTGATGGACCTCT GTGACCTTCCGGAGGGCCAAGGGCTACCCCATCGGCCTGTACTACCTGATGGACCTCT

No Cla t fo ssr r o Us om e

5. Why might it be risky to base a selective breeding programme solely on phenotypic traits?

6. Explain how marker assisted selection helped to remove BLAD from the holstein breed:

151

No Cla t fo ssr r o Us om e

105 Identifying Pedigrees developed by selective breeding, older breeds become less profitable and are eventually replaced. These older breeds are important because they carry traits that could be valuable but are now absent in more recent breeds. The relationships between the older and newer breeds are important as they show the development of breeds and help farmers and breeders to plan the future direction of their livestock breeding.

PR E V ON IEW LY

Key Idea: Using specific DNA sequences to identify breeds and the relationships between them can be useful in developing breeding programmes for livestock. In New Zealand, there are a number of different sheep breeds, each of which has been bred for a specific purpose (e.g. meat of wool production). While some of these breeds are very old, others are recent developments. As new sheep breeds are

UV tagged DNA primer 1

Romney

UV tagged DNA primer 2

Connecting the disconnected

Merino

Your task is to use the items illustrated on this page to outline a technique to identify the genetic relationships between the following sheep breeds: Merino, Romney, Suffolk, Border Leicester, and Lincoln.

Electrophoresis gel

UV tagged DNA primer 3

UV tagged DNA primer 4

Taq polymerase

PCR machine

1. Identify the sections of the sheep DNA used to produce a DNA profile: 2. Explain the purpose of the DNA primers:

No Cla t fo ssr r o Us om e

3. Briefly describe how identifiable pieces of DNA are isolated:

4. Explain the purpose of the electrophoresis gel in relation to this investigation:

5. Explain how the DNA profile produced can be used to identify relationships between the breeds of sheep:

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

LINK

KNOW

152

No Cla t fo ssr r o Us om e

106 Conservation and Genetic Diversity Both of these factors can result in inbreeding depression (i.e. reduced fitness of individuals as a result of inbreeding), and can cause reduced fertility and an increase in genetic disorders. Human intervention through conservation genetics (i.e. applying genetic methods to the conservation and restoration of biodiversity) can help maintain high genetic diversity and aid the survival of endangered populations. Techniques involve careful documentation of pedigree, selection of breeding pairs, and often translocation of animals.

PR E V ON IEW LY

Key Idea: Monitoring breeding and increasing genetic diversity are important strategies for restoring and conserving viable populations of endangered species. Genetic techniques can be used to monitor and influence the genetic diversity of endangered populations. Genetic diversity is the number of different genes in a population. If population numbers decline there is almost always a loss of genetic diversity and an increase in the relatedness between individuals because there are fewer individuals to breed with.

The Florida panther

The introduction of new individuals (and therefore new genetic material) has been important in the survival of the Illinois prairie chicken (right).

The Florida panther, a subspecies of cougar, is an example of how conservation genetics has been used to restore genetic diversity in an endangered population.

Until 1992, the Illinois prairie chicken was virtually destined for extinction. The population had fallen from millions before European arrival to 25,000 in 1933, and then to 50 in 1992. The dramatic decline in the population in such a short time resulted in a huge loss of genetic diversity, which led to inbreeding and in turn resulted in a decrease in fertility and an ever-decreasing number of eggs hatching successfully. In 1992, a translocation programme began, bringing in 271 birds from Kansas and Nebraska. There was a rapid population response, as fertility and egg viability increased. The population is now recovering .

90 80 70

100

Translocation

1975

1980

1985

ffIn 1995, eight female panthers were translocated from Texas to increase genetic diversity. Over the last two decades there has been an increase in the population growth rate and an improvement in the survival and health of individuals (graph, below).

1990

1995

Change in Florida panther population

100

Population

Number of male birds

150

1970

Florida panther population had become critically low and occupied just 5% of its historical range. Population models showed it would be extinct within a few decades. Individuals often had several abnormalities including kinked tails, heart defects, and sperm defects. It was determined that these were due to inbreeding depression.

100

Eggs hatched

ffIn the late 1970s, the

120

Male birds

Eggs hatched (%)

200

: Dept. of Natural Resources, Illinois

The Illinois prairie chicken

Texan panthers translocated

80 60 40

1980

Year

1985

1990

1995 Year

2000

2005

No Cla t fo ssr r o Us om e

1. Why is it important to maintain genetic diversity in a breeding population?

2. (a) How can conservation genetics improve the survival prospects of an endangered species?

(b) How might conservation genetics influence the ability of an endangered species to respond to future environmental change (i.e. their future evolution):

LINK

KNOW

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

153

No Cla t fo ssr r o Us om e

Maintaining genetic diversity in kakapo

PR E V ON IEW LY

In 1976, the kakapo was thought to be close to extinction as only a handful of birds from Fiordland were known, and all were males. One bird (named Richard Henry) was transferred to Maud Island. In 1977, a small population was found on Stewart island. In 1995, there were only 50 kakapo left. The low number of birds from a small, closely related population, has resulted in very low genetic diversity within the kakapo population. In addition, kakapo have a lek mating system, where one male may mate with several females. This has the potential to further reduce genetic diversity. A major part of the recovery plan for the kakapo is to manage future matings so that their genetic diversity is maximised. Breeding records are kept so that future pairings or transfers reduce the possibility of inbreeding. In 2012 there were just 126 kakapo left.

Hoki: daughter of Felix (m) and Zephyr (f)

Identifying diversity and parentage

Genetic diversity in kakapo has been measured using microsatellite DNA profiling. The Stewart Island population had very low genetic diversity. In addition, the genetic profile of Richard Henry, the single Fiordland kakapo, was very different to that of the Stewart Island population. The development of genetic profiles has been able to identify lineages within the original Stewart Island birds. The ability to identify paternity through DNA profiling has also allowed conservation managers to maximise genetic diversity. Between 1991 and 1999, thirteen chicks were hatched to four adult males of a possible thirty. Of these thirteen, seven were fathered by the kakapo Felix. Sexing male and female kakapo can be difficult, but is needed for obtaining correct sex ratios (important in breeding and transfers between populations). Molecular techniques provide the most accurate way to sex kakapos. It is also important for identifying the sex of embryos that die before hatching, or of chicks that die, so that any trends in breeding failure can be noted. An important finding from sexing was that well fed females produce more male chicks than females.

Sinbad: son of Richard Henry (m) and Flossie (f)

All photos this page: DoC

Sexing kakapo

3. Why were panthers from Texas translocated to Florida?

4. Explain the effect that translocating new prairie chickens into Illinois had on the survival of the Illinois prairie chicken:

No Cla t fo ssr r o Us om e

5. (a) Why is the genetic diversity of kakapo is so low?

(b) Explain how the recording of breeding pairs helps maintain genetic diversity in the kakapo population:

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

154

No Cla t fo ssr r o Us om e

107 Selective Breeding in Plants diversity can be exploited by humans to develop new crops. Brassica oleracea is a good example of the variety that can be produced by selectively growing plants with desirable traits. There six varieties of Brassica oleracea, and each of those has a number of sub-varieties. Although brassicas have been cultivated for several thousand years, cauliflower, broccoli, and brussels sprouts appeared only in the last 500 years.

PR E V ON IEW LY

Key Idea: The genetic diversity within different crop varieties provides opportunities to develop, through selection, new and more productive crop plants. For thousands of years, farmers have used the variation in wild and cultivated plants to develop crops. Genetic diversity gives species the ability to adapt to new environmental challenges, such as new pests, diseases, or growing conditions. This

Broccoli (inflorescence: A cluster of flowers on a stem)

Cauliflower (flower)

Cabbage (terminal buds)

Brussels sprout (lateral buds)

Kale

(leaf)

Domestication of Brassica

At about 3750 BC in China, the cabbage was probably the first domesticated variety of its wild form to be developed. Selective breeding by humans has produced six separate vegetables from this single species: Brassica oleracea. The wild form of this species is shown in the centre of this diagram. Different parts have been developed by human selection. In spite of the enormous visible differences, if allowed to flower, all six can cross-pollinate. Kale is closer to the wild type than the other related breeds.

Wild form (Brassica oleracea)

Kohlrabi (stem)

No Cla t fo ssr r o Us om e

1. Study the diagram above and identify which part of the plant has been selected for to produce each of the vegetables:

(a) Cauliflower:

(d) Brussels sprout:

(b) Kale:

(e) Cabbage:

(f) Kohlrabi:

2. Describe the feature of these vegetables that suggests they are members of the same species:

3. Describe the method used to develop broccoli and the features one would look for when doing so:

WEB

KNOW

107

LINK

108

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

USDA

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

155

The number of apple varieties is now a fraction of the many hundreds grown a century ago. Apples are native to Kazakhstan and breeders are now looking back to this centre of diversity to develop apples resistant to the bacterial disease that causes fire blight.

In 18th-century Ireland, potatoes were the main source of food for about 30% of the population, and farmers relied almost entirely on one very fertile and productive variety. That variety proved susceptible to the potato blight fungus which resulted in a widespread famine.

Hybrid corn varieties have been bred to minimise harm inflicted by insect pests such as corn rootworm (above). Hybrids are important because they recombine the genetic characteristics of parental lines and show increased heterozygosity and hybrid vigour.

4. The genetic processes involved in selective breeding and natural selection are essentially no different. Explain how this has changed with the advent of technologies for genetic modification and why it is particularly relevant to crop plants:

5. Describe a phenotypic characteristic that might be desirable in an apple tree and explain your choice:

6. (a) Explain why genetic diversity might decline during selective breeding for particular characteristics:

(b) With reference to an example, discuss why retaining genetic diversity in crop plants is important for food security:

7. Cultivated American cotton plants have a total of 52 chromosomes (2N = 52). In each cell there are 26 large chromosomes and 26 small chromosomes. Old World cotton plants have 26 chromosomes (2N = 26), all large. Wild American cotton plants have 26 chromosomes, all small. How might cultivated American cotton have originated from Old World cotton and wild American cotton:

No Cla t fo ssr r o Us om e

8. The Cavendish is the variety of banana most commonly sold in world supermarkets. It is seedless, sterile, and under threat of extinction by Panama disease Race 4. Explain why Cavendish banana crops are so endangered by this fungus:

9. Discuss the need to maintain the biodiversity of wild plants and ancient farm breeds:

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

156

No Cla t fo ssr r o Us om e

108 Selective Breeding in Modern Wheat visible phenotypes but now desirable characteristics can be identified using genetic techniques such as marker assisted selection. This is an indirect selection process where a trait of interest is selected on the basis of a marker linked to it. Increasingly, research is focused on enhancing the genetic diversity of wheat to provide for future crop development. With this in mind, there is renewed interest in some of the lower yielding, ancient wheat varieties, which possess alleles no longer present in modern inbred varieties.

USDA

PR E V ON IEW LY

Key Idea: Wheat has been selectively bred to enhance commercially desirable traits. Once wheat became domesticated (around 9000 years ago), selective breeding has been used to select for desirable characteristics such as high protein (gluten) content, high yield, and pest and disease resistance. Hybrid vigour in wheat cultivars (i.e. improved phenotype of hybrid offspring) is produced by crossing inbred lines and selecting for desirable traits in the progeny. Initially selection was made on

Stripe rust

Ancient cereal grasses had heads which shattered easily so that the seeds were widely scattered. In this more primitive morphology, the wheat ear breaks into spikelets when threshed, and milling or pounding is needed to remove the hulls and obtain the grain. Cultivation and repeated harvesting and sowing of the grains of wild grasses led to domestic strains with larger seeds and sturdier heads. Modern selection methods incorporate genetic techniques to identify and isolate beneficial genes, e.g. the RHt dwarfing gene, which gave rise to shorter stemmed modern wheat varieties.

Modern bread wheat has been selected for its non-shattering heads, high yield, and high gluten (protein) content (important to give dough elasticity and shape when baked). The grains are larger, increasing yield per seed, and the seeds (spikelets) remain attached to the ear by a toughened rachis during harvesting. On threshing, the chaff breaks up, releasing the grains. Selection for these traits by farmers may not have been deliberate, but occurred because these traits made it easier to gather the seeds. Such 'incidental' selection was an important part of crop domestication. Hybrid vigour in cultivars is generated by crossing inbred lines.

Some of the most important characteristics selected for in wheat varieties are related to resistance to disease and to insect pests. Fungal diseases such as rusts and mildews can reduce crop yields. There are many different wheat varieties, which vary in their resistance to certain diseases. If a certain disease is more common in an area, e.g. stripe rust in cooler areas, then a wheat variety resistant to that disease in grown. Continual development of disease resistance in wheat (through selection) is necessary because of continual evolution of the plant pathogens.

(a) High gluten content:

(b) Disease resistance:

2. Study the graph for wheat production and yield at the top of the next page:

No Cla t fo ssr r o Us om e

1. Describe why the following phenotypic characteristics would be desirable in a wheat plant:

(a) Describe the trend in global wheat production and yield since the 1960s:

(b) Why has it been important that yield has increased?

WEB

KNOW

LINK

108 107

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

157

Global wheat production and yield

3.5

Wheat is made into flour and used to make many commonly consumed foods such as bread and pasta. As the human population grows, the demand for food has also increased. Selective breeding has enabled farmers to produce more wheat per hectare than was previously possible (graph, left). Modern plant breeding techniques, including the use of genetic markers to identify desirable traits, has been an important factor in improving wheat yields.

PR E V ON IEW LY

800

3.0

600

2.5

500

2.0

400

1.5

300

KEY

200 100

0 1960

1970

1980 1990 Year

1.0

Production Yield

2000

0.5

2010

Data source: http://www.fao.org/faostat/en/#data/QC

Yield (tonnes per hectare)

Production (million tonnes)

700

High yielding wheat crop

3. Seed banks store seeds of important varieties of wheat including ancient varieties which are not deemed to be high yielding. With reference to genetic diversity and disease resistance, explain why it is important to keep these seeds:

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

4. A commercial company wants to produce a strain of wheat that is drought resistant and able to grow and produce high yields in hot, dry conditions. Suggest how they would go about producing such a variety using selective breeding:

109 What You Know So Far: Selective Breeding

No Cla t fo ssr r o Us om e

158

Selective breeding in animals

PR E V ON IEW LY

Summarise what you know about this topic so far under the headings provided. You can draw diagrams or mind maps, or write short notes to organise your thoughts in preparation for the essay question that follows. Use the points in the introduction and the hints provided to help you: What is selective breeding?

HINT: How is selective breeding used to produce desirable traits in animals? Explain the role of genetic techniques in selective breeding.

HINT: Define selective breeding. How have techniques changed over time?

Conservation genetics

HINT: Describe how selective breeding produces desirable traits in plants, including the role of vegetative propagation.

HINT: How is selective breeding used to maintain populations of endangered species?

No Cla t fo ssr r o Us om e

Selective breeding in plants

REVISE

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

159

No Cla t fo ssr r o Us om e

110 Essay Question: Genetic Transfer

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

No Cla t fo ssr r o Us om e

PR E V ON IEW LY

1. Discuss how the yield and nutritional value of a plant crop may be improved using genetic techniques. Your answer should outline the techniques used and explain the biological implications of any genetic manipulation, including reference to the environment and the crop's genetic diversity. You may use extra paper if needed.

TEST

160

No Cla t fo ssr r o Us om e

111 KEY TERMS AND IDEAS: Genetic Transfer

PR E V ON IEW LY

1. Match each term to its definition, as identified by its preceding letter code. annealing

CRISPR/cas9 system DNA probe

A A reaction that is used to amplify fragments of DNA using cycles of heating and cooling.

B An organism that has had part of its DNA sequence altered either by the removal or insertion of a piece of DNA.

C A method of cloning in which an ovum is created using a donor nucleus.

embryo splitting

D An organism or artificial vehicle that is capable of transferring a DNA sequence to

gel electrophoresis

E A small circular piece of DNA commonly found in bacteriaa and often used as a

gene marker

F The process of inserting of a gene from one species into another that would not

gene therapy

G The pairing (by hydrogen bonding) of complementary single-stranded nucleic

GMO

another organism.

vector n genetic modification.

normally contain the gene. The gene is then expressed in the next generation.

acids to form a double-stranded polynucleotide. The term is applied to making recombinant DNA, to the binding of a DNA probe, or to the binding of a primer to a DNA strand during PCR.

H The insertion of a correct, normally functioning gene into a patient in an attempt to

marker gene

cure a genetic disease.

I The process by which humans breed individuals with desirable traits together so

plasmid

that they appear in the next generation. Also called artificial selection.

J A process that is used to separate different lengths of DNA by placing them in

polymerase chain reaction recombinant DNA

restriction enzyme selective breeding

a gel matrix placed in a buffered solution through which an electric current is passed.

K A technique used to grow cells in a sterile medium separately from the organism from which they were obtained.

L DNA that has had a foreign sequence added so that the original sequence has been changed.

M An enzyme that is able to cut a length of DNA at a specific sequence or site.

N A gene with an identifiable effect, such as fluorescence, used to determine if a piece of DNA has been successfully inserted into the host organism.

somatic cell nuclear transfer (SCNT)

O A method of cloning where which a single early-stage embryo is manually divided

tissue culture

P A short sequence of DNA that is used as a molecular probe to detect a specific

transgenesis

Q A tool in genetic modification that uses a prokaryotic sequence of DNA and its

vector

R A length of DNA associated with a gene of interest that is linked to and inherited

into two individual cells and then grows as two identical embryos. DNA sequence of interest.

associated protein to edit the base pairs of a gene.

with the gene and so can be used to follow its inheritance.

(a) The biological father is:

(b) Why do profiles B and D only have 9 bands?

TEST

No Cla t fo ssr r o Us om e

2. The electrophoresis gel (below, right) shows four profiles containing five STR sites: the mother (A) her daughter (B) and two possible fathers (C and D). Which of the possible fathers is the biological father?

ÂŠ 1988-2017 BIOZONE International ISBN: 978-1-927309-61-2 Photocopying Prohibited

161

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

Answers

CHAPTER

PAGE

Investigating in a Biological Context: Socio-Scientific Issues Maintaining a Stable Internal Environment Manipulating Genetic Transfer

161 155 155 160

Investigating in a Biological Context 2. Choosing Your Topic (page 4)

There is no solution to this exercise. Students may use the space provided to develop any ideas they have for topics and identify the variables involved. Students should attempt to deal with quantitative data, at least for their response (dependent) variable, since these are more easily analysed meaningfully, using descriptive and inferential statistics.

3. Ethics and Safety Issues of Research (page 5)

1. (a) Potential health and safety issues could be: cutting yourself with the scalpel, possible bacterial contamination from the kidneys, safe disposal of the dissected tissue. (b) The person is wearing gloves and dissecting on a tray to lessen the risk of contamination and help safe disposal.

5. Designing a Pattern Seeking Investigation (page 8)

1. (a) Recognising assumptions allows you to recognise the limitations of the investigation. (b) Location of sample areas: The areas contain millipedes. Size of the areas sample: The areas are large enough to collect representative numbers of millipedes. Accuracy of results: The data collected will be truly representative of the populations present.

2. (a) A student might use the school roll and select every 4th person on the roll, or select every 3rd person in every classroom roll. (b) A student might divide the school students into males and females or into year groups, before conducting a random survey. (c) The student may stop students in the hall between classes or at lunch break to gather information.

6. Variables and Controls (page 10)

1. Aim: To investigate the effect of light on the rate of photosynthesis in Cabomba aquatica.

2. Hypothesis: If photosynthetic rate is dependent on light intensity, bubble production (as an approximation of rate of photosynthesis) should be higher in plants closest to the light.

(a) (b) (c) (d)

Independent variable: light intensity. 20, 25, 30, 35, 40. Unit: cm A light meter could be used to provide a measured value for light intensity at each distance.

4. Designing a Fair Test (page 6)

1. (a) Growing just one plant per pot removes the effects of competition between plants (this would occur if plants were grown together). (b) By growing plants from seed, you can choose plants of a similar age, all subjected to the same growth environment. This reduces the amount of variability that can't be accounted for.

4. (a) Dependent variable: Photosynthetic rate. (b) Unit: Number of oxygen bubbles produced in 3 minutes. (c) Equipment: A hand-held counter. It would have been most useful for the tubes closest to the light where photosynthetic rate was the highest. (d) Sample size for each treatment: 1 (e) Extra tubes at each distance could be added to test the consistency and therefore likely validity of the results.

2. (a) A possible arrangement of pots:

5. The tube not exposed to the light source is the control.

7. The light intensity could have been better monitored using a light meter.

8. The gas could be collected and a test for oxygen applied (e.g. a glowing splint test in which a splint will reignite in the presence of oxygen).

(b) Sample size: n= 6 (c) There are 4 treatments (pH 3, 5, 7, and 9). (d) pH 7 is used as the control because it is the ideal growth pH more most non-acid adapted plants.

3. The best way to account for natural variability between individuals is to increase the number of individuals you use in each treatment (the sample size, n).

4. (a) Replication accounts for any unusual or unforeseen effects in your set-up, i.e. allows you to evaluate the effects of nuisance variables over which you have no control. (b) Replication is limited by the amount of equipment, space, and/or time you have available. (c) You can compensate, to a degree, for a lack of true replication, by repeating the experiment several times over successive trials. This may be practicable only if the investigation does not involve lengthy growth responses.

ÂŠ 1988-2017 BIOZONE International

7. Maintaining a Logbook (page 12)

1. Logbooks are a record of all parts of the investigation. They are important in that they allow an experimenter to record results and observations for later analysis. For experiments that take many weeks or months recording results every day is important so that information is not lost of forgotten. A logbook also provides a record of the work for scrutiny or reference by peers.

No Cla t fo ssr r o Us om e

3 = pH 3, 5 = pH 5, 7 = pH 7, 9 = pH 9.

6. Two assumptions being made about this system: (a) That the bubbles being produced are oxygen. (b) That photosynthetic rate increases with light intensity.

9. Describing Relationships Between Variables (page 14)

1. (b) Slope: Negative linear relationship, with constantly falling slope. Interpretation: Variable Y decreases steadily with increase in variable X. (c) Slope: Constant, with slope = 0 Interpretation: Increase in variable X does not affect variable Y. (d) Slope: Slope rises and then rate of increase slows to 0 Interpretation: Variable Y initially increases with increase in variable X, then levels out (no further increase with increase in variable X). (e) Slope: Rises, peaks, and then falls (parabolic). Interpretation: Variable Y initially increases with increase PHOTOCOPYING PROHIBITED

162 13. Analysis and Interpretation (page 19)

1. You may discover that you need to collect data differently to how you originally planned. You may find different and more efficient ways to carry out the investigation. 2. (a) Yes (b) The trend in the data is regular. We would not expect the product to be so high at that point based on the rest of the data collected. We can therefore say with reasonable accuracy that the result is not a accurate reading (it is probably closer to 34).

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

(f)

in variable X, peaks and then declines with further increase in variable X. Slope: Exponentially increasing slope. Interpretation: As variable X increases, variable Y increases exponentially.

1. The modal value and associated ranked entries indicate that the variable being measured (swimmers' height) has a bimodal distribution; the data are not normally distributed. Therefore the mean and median are not accurate indicators of central tendency. Note: the median differs from the mean; also an indication of a skewed (non-normal) distribution.

2. The modal value and associated ranked entries indicate that the variable being measured (sori per frond) has a bimodal distribution i.e. the data are not normally distributed. Therefore the mean and median are not accurate indicators of central tendency. Note also that the median differs from the mean; also an indication of a skewed (non-normal) distribution.

Ladybird Tally mass (mg)

6.2 6.7 7.7 7.8 8.0 8.2 8.4 8.8 8.9 9.8 10.1

Total 1 1 2 1 1 1 1 4 1 1 1

Median = 8th value when in rank order = 8.4 Mode

= 8.8

Mean

= 124.7 ÷ 15 = 8.3

Note: To plot a histogram, missing weight classes would have to be included with values of 0.

3. (a) There is no way of telling if the results are accurate or if they are chance events. For example if the test was carried out again and a product volume close to 45 was obtained again we might suspect that it may not be an outlier. (b) They would be able to find means (averages) across the trials at each moment in time. Scatter plots and regression analysis (line of best fit) could be used. (c) Multiple trials would increase reliability and validity of the findings by decreasing the risk that chance events would influence the results or produce unrecognised erroneous data. The ability to calculate means also enables measures of spread to be calculated (e.g. standard deviation), so that confidence in the data can be quantified.

4. (a) Tables organise data and graphs help to visualise any trends in the data. (b) A line graph would be the best way to display the data. (c) The data are continuous which can be displayed on a line graph. A line graph provides a visual representation of the data using the minimum space.

14. Interpreting Results of a Fair Test (page 21) 1.

Average number of leaves

Conc urea mol L-1

11. Spread of Data (page 17)

1. The larger standard deviation for the first data set indicates the spread of values around the mean is greater than in the second set. The second data set is likely to be more reliable.

(a) 139.31 ÷ 40 = 3.483 (b) 0.647 (c) 2.836 - 4.13 (3.483 ± 0.647) (d) 75% (30 out of 40) (e) It is normally distributed around the mean.

12. Detecting Bias in Samples (page 18)

1. The data are close to being normally distributed about the mean (normal = 67% of values within 1 sd of mean and 95% of values between 2 sd of mean).

3 x 10-2

9.3

8.6

10.6

9.3

7.3

6.3

3 x 10-3

17.6 23.6 25.3 27.3

29.3 29.6

3 x 10-4

15.6

3 x 0-5

Mean number of leaves per beaker

2. (a) The mean and median are very close to each other for the N=30 data set. There is a larger difference between the mean and median values obtained in the N=50 data set. (b) The standard deviation obtained for the N=30 set is much larger (11.37) compared to only 3.82 for the larger N=50 data set. (c) The N=30 data set more closely resembles the complete data set. The mean and median are quite close to those of the original data set. The mean, median and mode for the N=50 data set are considerably higher than those statistics for the complete data set. (d) The person who collected the sample in the N=30 data set used equipment and techniques designed to collect fish randomly. As a result, a normal distribution of fish sizes was obtained by their sampling methods. Fish collection for the N=50 sample set was biased. The mesh size used did not retain smaller fish, so a larger proportion of bigger fish were collected. When plotted on a frequency histogram the data presented as a negative skew.

Days

22.6 28.3 25.6 23

27.3

25.3 25.3 27.3 29.3

Effect of urea on duckweed (Lemna) growth

30 25

3 x10-2

3 x10-3

3 x10-4 3 x10-5

5 0

No Cla t fo ssr r o Us om e

10. Mean, Median, and Mode (page 15)

Days

3. (a) In three of the beakers (concentrations 3 x 10-3, 3 x 10-4, and 3 x 10-5) the number of leaves per beaker increased over the course of the experiment. In the beaker containing 3 x 10-2 mol L-1 of urea, the number of leaves decreased over the course of the experiment. (b) The data collected on the final day (day 21) could be tested for significance using a chi-squared test. This would determine if there was any difference from an expected value. Alternately, the 95% confidence interval could be calculated for the day 21 results.

PHOTOCOPYING PROHIBITED

163 Log 4

Number of millipedes

Transect 1 Transect 2

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

4. Points to include in discussion: The investigation shows the effect of urea concentration on the growth of duckweed. Very high urea concentration (3 x 10-2 mol L-1) had a negative effect on the growth of the duckweed, while lower concentrations promoted growth.

It appears that at a concentration of 3 x 10-2 mol L-1 urea had a toxic effect. At lower concentrations the urea acts as a fertiliser causing an increase in growth.

There is a significant difference between growth at 3 x 10-2 mol L-1 urea and the other concentrations. There is no significant difference between growth at the other three urea concentrations.

Poor quality urea can contain a toxic urea derivative called biuret. The purity of the urea could be checked to eliminate this as a cause of poor growth at high urea concentrations. Duckweed is often used to strip nitrogen from effluent or enriched water, so a toxic effect is unexpected.

10 5 0

0 1.5 2.5 3.5 Distance from log (m)

Log 6

Transect 1 Transect 2

Number of millipedes

Transect 1 Transect 2

0 1.5 2.5 3.5 Distance from log (m)

Log 2

Transect 1 Transect 2

20 15

0 1.5 2.5 3.5 Distance from log (m)

10 5

Transect 1 Transect 2

(c)

0 1.5 2.5 3.5 Distance from log (m)

Physical conditions such as temperature, light levels, or relative humidity could be measured. This would test the assumption that nutrient and moisture levels are higher close to the log and allow comparison of the physical conditions of equivalent transects each side of the log.

3. (a) There are valid reasons for saying either yes or no. (b) For no: The data from the study show that in some cases, but not all, the left side of the log (transect 1) generally has more millipedes than the right side (transect 2).

0 1.5 2.5 3.5 Distance from log (m)

2. (a) Yes. In most cases, there is a larger number of millipedes closer to the log. (b) It is likely that the nutrient and moisture levels are higher close to the rotting log, which would form a microclimate.

Log 3

Number of millipedes

Log 5

Log 1

Number of millipedes

0 1.5 2.5 3.5 Distance from log (m)

15. Pattern Seeking: Investigating Distribution (page 23) 20

No Cla t fo ssr r o Us om e

As there is no significant difference between the 3 x 10-3, 3 x 10-4, and 3 x 10-5 mol L-1 concentrations it is difficult to determine the extent to which the urea acted as a fertiliser, or if some other factor was also involved. To investigate this, the experiment could be repeated using distilled water and tap water without urea.

Number of millipedes

For yes: Logs 1, 2, and 4 are close to even or even. Log 6 has greater numbers on the right than the left and 3 and 5 have more on the left than the right. The differences are not consistent and may not be statistically significant.

4. (a) With pooled data at each distance you could a chi squared test for goodness of fit to see if there is a significant difference between numbers of millipedes at different distances from the log. The observed numbers can be compared to expected numbers that are the PHOTOCOPYING PROHIBITED

164

No Cla t fo ssr r o Us om e

same at each distance (the null hypothesis of no difference with distance). (b) Student's own response.

PR E V ON IEW LY

16. A Template for Your Investigation (page 25)

CO2 leaves. It also increases the rate of loading and unloading of oxygen and CO2 into and out of the blood. (b) Increasing the heart rate. This increases blood flow, which facilitates the loading and unloading of oxygen and CO2 into and out of the blood. It also increases the speed of delivery of oxygen to working tissues (e.g. muscles) and speeds up the removal of CO2 and other products of metabolism.

Student's own response.

Socio-Scientific Issues

20. Presenting Your Findings (page 32)

Report to be completed by the student following the guidelines provided in the chapter.

23. Negative Feedback (page 38)

1. Negative feedback mechanisms are self-correcting (the response counteracts changes away from a set point) so that fluctuations are reduced. This stabilises physiological systems against excessive change and maintains a steady state.

2. A: Eating or food entering the stomach. B: Emptying of stomach contents.

Maintaining a Stable Internal Environment

3. Enzymes operate within a narrow temperature range. A constant body temperature is therefore needed to maintain the activity of the enzymes that control metabolism.

21. Homeostasis (page 35)

4. Examples include: osmoregulation, pH balance in the blood, blood volume and pressure, blood glucose levels etc.

2. (a) Detects a change in the environment and sends a message (electrical impulse) to the control centre. (b) Receives messages send from the receptor, processes the sensory input and coordinates an appropriate response by sending a message to an effector. (c) Responds to the message from the control centre and brings about the appropriate response, e.g. muscle contraction or secretion from a gland.

22. Maintaining Homeostasis (page 36)

1. Two mechanisms operating to restore homeostasis after infection (a and b any two of): • Immune system response with the production of antibodies against the antigens of the pathogen (humoral response). • Immune system response with the production of T cells which recognise the antigens of the pathogen and destroy them directly (cell-mediated response). • Local inflammatory response (redness, pain, swelling, heat) at the site of infection. • Fever (widespread increase in body temperature). • The production of antimicrobial substances such as interferon and interleukin-1. • Phagocytosis of pathogen by white blood cells. All the above aim to destroy the pathogen and/or its toxins and assist a return to homeostasis.

2. Two mechanisms by which responses to stimuli are brought about and coordinated (a and b in any order): (a) Hormonal response to stimuli: endocrine glands respond to a stimulus (e.g. a nerve impulse or another hormone or metabolite) by producing hormones which bring about an appropriate physiological response. (b) Nervous response to stimuli: direct stimulation of nerves from a sensory receptor causes a reaction to the stimulus. This may be a response requiring interpretation of the message by the brain or it may be a reflex.

3. Two ways in which water and ion balance are maintained, and the organs and hormones involved: (a) Water and ions are taken in with food and drink, helping to replace that lost through urine, faeces, and sweat. The digestive organs and digestive hormones are all involved in digestion and absorption processes. (b) The kidneys are the primary regulator of fluid and ions. When large quantities of fluid must be excreted, the kidney produces large amounts of dilute urine. When water must be conserved, small amounts of concentrated urine are produced. ADH (antidiuretic hormone) causes more water to be reabsorbed from the kidney (concentrating the urine). ADH secretion increases when blood volume is low. Essential ions (and glucose) are retained by active reabsorption from the kidney tubules. Another hormone, aldosterone from the adrenal glands, increases the absorption of Na+ ions. 4. Two ways in which the body regulates its respiratory gases during exercise: (a) Increasing the rate of breathing. This increases both the rate of oxygen entering the lungs and the rate at which © 1988-2017 BIOZONE International

24. Positive Feedback (page 39)

1. (a) Positive feedback has a role in amplifying a physiological process to bring about a particular response. Examples include (1) elevation in body temperature (fever) to accelerate protective immune responses, (2) positive feedback between oestrogen and LH to leading to an LH surge and ovulation, (3) positive feedback between oxytocin and uterine contractions: oxytocin causes uterine contraction and stretching of the cervix, which causes more release of oxytocin and so on until the delivery of the infant, (4) positive feedback in fruit ripening where ethylene accelerates ripening of nearby fruit. (b) Positive feedback is inherently unstable because it causes an escalation in the physiological response, pushing it outside the tolerable physiological range. Compare this with negative feedback, which is self correcting and causes the system to return to the (normal) steady state. (c) Positive feedback loops are normally ended by a resolution of situation causing the initial stimulation. For example, the positive feedback loop between oestrogen and LH leading to ovulation is initiated by high oestrogen levels and ended when these fall quickly after ovulation, prompting a resumption of negative feedback mechanisms. In childbirth, once the infant is delivered, the stretching of the cervix ceases and so too does the stimulation for more oxytocin release. (d) When positive feedback continues unchecked, it can lead to physiological collapse. One example includes unresolved fever. If an infection is not brought under control (e.g. by the body's immune system mechanisms or medical intervention), body temperature will continue to rise and can lead to seizures, neurological damage, and death.

25. Nervous Regulatory Systems (page 40)

1. (a) The sensory receptors receive sensory information (information about the environment) and respond by generating an electrical response (message). (b) The central nervous system (CNS) processes the sensory input and coordinates an appropriate response (through motor output). (c) A system of effectors bring about an appropriate response. Together these systems function to bring about appropriate (adaptive) responses to the environment so that homeostasis is maintained.

No Cla t fo ssr r o Us om e

1. Homeostasis is the relatively constant internal state of an organism, even when the external environment is changing.

2. (a) and (b) any two in any order: • Nervous control involves transmission across synapses, hormonal control involves transport of chemicals in the blood. • Nervous control is rapid, hormonal control is slower. • Nervous control acts in the short term and its effects are short lived, hormonal control is longer acting. • Nervous control is direct and through specific pathways, hormonal control is widespread, affecting target cells throughout the body (these may be quite specific). • Nervous control causes muscular action directly, hormonal control generally acts by changing metabolic

PHOTOCOPYING PROHIBITED

165 activity.

29. The Role of the Skin in Thermoregulation (page 46)

1. Blood vessels can constrict (reduce blood flow) or dilate (increase blood flow) to regulate the amount of blood flowing from the body to the skin and back. This regulates temperature by regulating the amount of heat moving from the body's core to the skin's surface where heat is lost.

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

3. (a) The anterior pituitary is glandular and secretes hormones in response to releasing hormones from the hypothalamus. The posterior pituitary is neural in origin and simply stores and releases neurohormones that originate in the hypothalamic neurosecretory cells. (b) The posterior pituitary secretes neurohormones from modified secretory neurones, whereas the anterior pituitary secretes peptide hormones when influenced by other hormonal signals. The anterior pituitary is influenced by hormones from the hypothalamus.

5. The hypothalamus controls the activity of the hormonal secretion from the pituitary. Without its regulatory input, the pituitary would cease to function.

26. What You Know So Far: Principles of Homeostasis (page 42) There are no answers. Summary is entirely student based.

27. Thermoregulation in Humans (page 43)

1. (a) In the hypothalamus. (b) The hypothalamus acts as a thermostat, registering changes in body temperature and coordinating responses to maintain its set point.

2. (a) The skin: Receptors in the skin detect changes in skin temperature and relay the information to the hypothalamus. In response to hypothalamic output, muscles and capillaries in the skin bring about an appropriate response (e.g. shivering or sweating). (b) The muscles: Muscles begin rapid contractions (shivering) when the body temperature drops too far. The activity generates heat which warms the body. (c) The thyroid gland: When the body temperature becomes too low the thyroid gland releases hormones that increase the body's metabolic rate (generating heat).

3. Negative feedback acts to counteract deviations from the set point temperature of 36.7°C. Movement away from the set point in either direction triggers corrective mechanisms, which then return the body temperature to the set point.

4. (a) An infection causes the thermoregulatory set point in the hypothalamus to be reset to a higher temperature, resulting in a higher body temperature. (b) It is a defence against infection (helps to speed up the immune response and kills the infectious organism more quickly). (c) Fever raises the body above the normal set point temperature. Prolonged elevated body temperature can result in a positive feedback loop, which causes body temperature to escalate, denaturing enzymes and detrimentally affecting normal metabolic processes. 5. Wind chill, very low temperatures, being wet, inactivity, inadequate clothing (reduced insulation).

6. Excessive activity, excessive clothing (too much insulation), being excessively overweight, high temperature environment.

28. Thermoregulation in Newborns (page 45)

1. Thermoregulation is controlled by the mother via blood flow through the umbilical cord.

2. Newborns cannot shiver, and have limited capacity to generate internal heat from large muscle movements. They have very large body surface area compared to their volume, a large number of blood vessels that run close to the skin surface, and only a small amount of fat for insulation.

3. Constricting blood vessels close to the skin reduces heat loss from the core to the extremities. Dilating the skin's blood vessels directs excess heat to the extremities and heat is lost to the environment.

4. Premature babies are less developed than full term babies and thus thermoregulatory systems are not as developed as a full term newborn. They have less fat to insulate them against heat loss.

30. Hypothermia (page 47)

1. Exposure to low temperatures even for a short time without insulation will lead to hypothermia. Even temperatures of 15 to 20°C may cause hypothermia if a person is exposed long enough without protection. Exposure to water will cause hypothermia far more quickly than the same temperature in air as heat is more easily conducted away from the body.

2. It would be expected that the core body temperature of volunteer A will remain relatively unchanged as the insulated clothing would keep them warm. Volunteer B will lose head through their head (hair will reduce this loss but not as much as a hat) and thus their body temperature will decrease slightly as the insulated clothing will keep the rest of the body warm. Volunteer C will lose the most amount of heat and depending on the temperature of the freezer their core temperature may become low enough to reach the first stages of hypothermia. This is because the light clothing provides little insulation.

3. About 1.74 cm tall. This is because France is at about 45° latitude so the temperature is generally mild and a body shape between Inuits and Sudanese would be expected. (The average height in France is actually about 1.77 cm).

4. (a) Short and stocky (b) A short, stocky shape has a lower SA:V ratio and so loses heat more slowly.

31. Hyperthermia (page 49)

1. (a) Hyperthermia is the condition in which the core body temperature rises without a rise in the body's set-point temperature. (b) During a fever, the body's set-point temperature is elevated by the hypothalamus.

2. (a) Shivering is a mechanism that produces heat, thus heat loss would actually be slowed. (b) Core body temperatures above 40oC are likely to rapidly lead to death if not treated. Internal cooling allows rapid reduction of the core temperature. 3. Untreated heat stroke leads to death because the excessive internal core temperature causes metabolic reactions to stop working as enzymes denature.

4. Hyperthermia may occur through prolonged vigorous activity in a hot environment, some drugs cause hyperthermia, dehydration and prolonged exercise can cause hyperthermia.

32. Drugs and Thermoregulation (page 50)

No Cla t fo ssr r o Us om e

4. The functioning of the adrenal and thyroid glands relies on the influence of regulatory hormones from the anterior pituitary. Without the input of these hormones, there is no stimulation of the glands and they become underactive and atrophy.

2. People who have grown up in cold climates have a reduced ability to sweat. Instead of sweating evenly over their bodies, they tend to produce their larger volume of sweat from a small number of glands (e.g. the forehead). This causes sweat to bead which results in it dripping from the body rather than evaporating and removing excess heat energy. As a result they over-heat easily.

1. (a) Ecstasy causes an increase in body temperature in rabbits. There is a positive relationship between the ecstasy dose and the increase in body temperature. (b) Ecstasy decreases blood flow to the skin of rabbits. There is a negative relationship, as ecstasy dose increases, blood flow to the skin decreases.

2. Ecstasy causes a number of physiological effects that increase body temperature. It causes vasoconstriction of the blood vessels, limiting the amount of blood flow to the skin. This reduces the body's ability to cool down, and results in an increased core temperature. It also increases metabolic rate, which generates additional heat. Ecstasy may also inhibit feelings of thirst, so people do not feel the need to drink. Sweat production is reduced, so the body's ability to cool itself down is further reduced.

PHOTOCOPYING PROHIBITED

166

No Cla t fo ssr r o Us om e

33. Hyperthyroidism and Thermoregulation (page 51)

38. The Liver's Role in Carbohydrate Metabolism (page 56)

PR E V ON IEW LY

1. Thyroid stimulating hormone (TSH) simulates the release of thyroxine from the thyroid gland. Thyroxine binds to target cells and stimulates them to increase metabolic activity, which increases body temperature. High levels of thyroxine in the blood inhibit the production of TSH (via the hypothalamus), reducing the release of thyroxine.

(insulin) many proteins are activated and many Glut4 secretory vesicles (each producing transporters) are made.

2. In Graves disease, the protein thyroid stimulating immunoglobulin (TSI) binds directly to the cells of the thyroid, stimulating thyroxine production no matter what the levels of TSH are in the blood.

1. In any order: (a) Glycogenesis: the production of glycogen from glucose in the liver, stimulated by insulin. (b) Glycogenolysis: breakdown of glycogen to produce glucose, stimulated by adrenaline and glucagon. (c) Gluconeogenesis: the production of glucose from noncarbohydrate sources, stimulated by adrenaline and glucocorticoid hormones.

34. What You Know So Far: Thermoregulation (page 52)

2. (a) 1: Glycogenesis (formation of glycogen from glucose). (b) 2: Glycogenolysis (glycogen breakdown). (c) 3: Gluconeogensis (formation of glucose from noncarbohydrate sources).

35. Hormonal Regulatory Systems (page 53)

3. Interconversion of carbohydrates is essential to regulating blood glucose levels and maintaining a readily available supply of glucose as fuel without incurring the homeostatic problems of high circulating levels of glucose.

There are no answers. Summary is entirely student based.

1. (a) Antagonistic hormones are two hormones that have contrasting (counteracting) effects on metabolism. Examples: insulin (lowers blood glucose) and glucagon (raises blood glucose). Parathormone (increases blood calcium) and calcitonin (lowers blood calcium). (b) In general principle, the product of a series of (hormone controlled) reactions controls its own production by turning off the pathway when it reaches a certain level. If there is too little of the product, its production is switched on again.

2. Only the target cells have the appropriate receptors on the membrane to respond to the hormone. Other (nontarget) cells will not be affected.

3. (a) Hormones must circulate in the blood to reach the target cells and a metabolic response must be initiated. This takes some time. (b) Hormones bring about a metabolic change and often start a sequence of cascading, interrelated events. Once started, these events take time to conclude. Nervous responses continue only for the time that the stimulation continues.

36. Control of Blood Glucose (page 54)

1. (a) Stimulus: Rise in the levels of glucose in the blood above a set level (about 5.5 mmol per L). (b) Stimulus: Fall in blood glucose levels below a set level (about 3.5 mmol per L). (c) Glucagon brings about the production (and release) of glucose from the liver by the breakdown of glycogen and the synthesis of glucose from amino acids. (d) Insulin increases glucose uptake by cells (thereby lowering blood glucose) and brings about production of glycogen and fat from glucose in the liver.

2. Fluctuations in blood glucose (BG) and blood insulin levels are closely aligned. Following a meal, BG rises sharply and there is a corresponding increase in blood insulin, which promotes cellular glucose uptake and a subsequent fall in BG. This pattern is repeated after each meal, with the evening meal followed by a gradual decline in BG and insulin over the sleep (fasting) period. Negative feedback mechanisms prevent excessive fluctuations in blood glucose (BG) throughout the 24 hour period.

39. Type 1 Diabetes Mellitus (page 57)

1. (a) a cells produce glucagon (which promotes glucose release from the liver and raises blood glucose) (b) b cells produce insulin (which promotes glucose uptake in cells and lowers blood glucose).

2. Type 1 diabetes is a condition in which there is an absolute deficiency of insulin as a result of auto-immune destruction of the insulin-producing cells of the pancreas.

3. Symptoms include hyperglycaemia (high blood glucose) which results from the inability of cells to take up glucose. Glucose is normally reabsorbed in the kidney tubule, but when blood glucose is too high, the it exceeds the kidney's ability to reabsorb it from the filtrate and so glucose is excreted in the urine (glucosuria). The high urine volumes associated with the excretion of excess glucose result in excessive thirst. Hunger, fatigue and weight loss result from the inability to utilise glucose. Ketosis results from the metabolism of fats (used because glucose is not entering the cells so on-carbohydrate sources are metabolised in an attempt to produce energy).

4. A person with type 1 diabetes is often thirsty because of increased urination (to remove excess glucose from the blood). To replace the fluid they have to drink more.

5. The body's cell are not taking up glucose from food and it is excreted from the body. Thus food energy is not available as fuel and non-carbohydrate fuels (e.g. fats and proteins) are metabolised as fuels for cellular respiration (and the person loses weight).

6. Regular injections of insulin restore the levels of insulin in the blood, allowing the cells to take up glucose.

7. Islet transplants would mean that insulin could be made as needed (i.e. normal function of insulin secretion would be restored). There would be less/nil reliance on insulin injections, depending on the effectiveness of the transplant.

8. High levels of glucose in the urine can promote bacterial infections.

37. Insulin and Cellular Uptake of Glucose (page 55) 1. Insulin is secreted by the b cells of the pancreatic islets.

2. (a) Too much insulin results in low blood glucose levels (hypoglycaemia). (b) Too little insulin results in elevated blood glucose levels (hyperglycaemia). 3. Two molecules of insulin must bind to the extracellular domain of the insulin receptor to activate it. Once the insulin is bound, phosphate groups are added to the receptor. This phosphorylation begins a signal cascade resulting in the activation of Glut4 secretory vesicles, which produce the Glut4 glucose transporters. The Glut4 glucose transporters insert into the membrane allowing the uptake of glucose.

4. In a signal cascade, the sequence (chain reaction) of phosphorylations results in the activation of an increasing number of other proteins. Thus for two signal molecules ÂŠ 1988-2017 BIOZONE International

No Cla t fo ssr r o Us om e

40. Type 2 Diabetes (page 58)

3. Humoral.

1. Type 1 diabetes results from a non-production of insulin and must be treated with insulin injection. Type 2 results from the body's cells becoming insensitive to normal levels of insulin. It is treated first with dietary management and exercise. Insulin therapy is usually not involved except in severe cases.

2. A fasting non diabetic has a blood glucose level of between 3.3 and 6.1 mg dL-1. A diabetic has a blood glucose level of about 7 mg dL-1.

3. Cells don't respond correctly to insulin and are thus starved of fuel, leading to overeating, exacerbating an existing weight problem (obesity is a risk factor for development of type 2 diabetes in the first place).

4. (a) The percentage of people with diabetes increases with age until age 85. The percentage of people overweight or obese increases with age until age 74. (b) There is a correlation between the prevalence of diabetes and adults overweight or obese. Percentages of the population overweight or obese are higher than

PHOTOCOPYING PROHIBITED

167 47. The Structure of a Nephron (page 67)

1. (a) Renal corpuscle: Blood is filtered through the capillaries of the glomerulus. (b) Proximal convoluted tubule: ~90% of the glomerular filtrate is reabsorbed (including glucose and ions). (c) Loop of Henle: Transport of salt and osmosis produce a salt gradient through the kidney. (d) Distal convoluted tubule: Modification of filtrate by active reabsorption and secretion of ions. (e) Collecting duct: Osmotic withdrawal of water and concentration of filtrate (urine).

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

the prevalence of diabetes, but they follow a similar trend. This would be expected as it has been shown in studies that type 2 diabetes is linked with being overweight.

1. (a) Alcohol has a two fold effect. 1) Stimulates insulin production, promoting glucose uptake from the blood into the cells. 2) Inhibits glucagon production so the liver does not produce and release glucose in response to low blood glucose levels. (b) Alcohol is a metabolic toxin, so its detoxification is prioritised by the body.

2. Alcohol reduces blood glucose and so reduces the body's access to fuel. It also impedes decision making.

42. Alcohol, Nicotine, and Blood Glucose (page 62)

1. (a) Nicotine stimulates release of adrenaline, which acts on the liver to stimulate glucose production and on the pancreas to inhibit insulin release. The resulting increase in blood glucose reduces the normal hunger signals to the brain. (b) The nicotine in cigarettes reduces hunger (see above). When a smoker stops, the hunger inhibition of nicotine is removed and smokers find they are hungry more often, eat more, and put on weight.

2. Nicotine stimulates the release of adrenaline which increases heart rate and blood glucose levels, readying the body for activity.

43. What You Know So Far: Blood Glucose (page 63) There are no answers. Summary is entirely student based.

44. What Determines Blood Pressure? (page 64)

1. (a) A greater blood volume increases blood pressure because it increases venous return and cardiac output. More blood (fluid) is being forced into the same space (blood vessels). (b) Increased cardiac output increases the volume of blood being pumped out of the heart and into the arteries. The arteries feed smaller blood vessels (capillaries) so flow out of the arteries is delayed and pressure increases in the arteries. The heart is also pumping harder which also increases the pressure at which the blood is pumped into the arteries. (c) Vasoconstriction reduces the space that the blood can fit into and so increase the pressure.

2. (a) Down (b) Up (c) Up

45. Water Budget in Humans (page 65)

1. Metabolism involves the oxidation of glucose to produce ATP. A by-product of this process is water (6O2 + C6H12O6 â&#x2020;&#x2019; 6CO2 + 6H2O)

(a) (b) (c) (d)

Intestinal infection resulting in diarrhoea. Inadequate access to fluids. Excessive vomiting. Excessive sweating.

3. Excessive water intake, without associated intake of electrolytes, has a diluting effect where there is an increase in total body water relative to the total amount of exchangeable sodium. This causes an osmotic shift of water from the plasma into the cells, particularly the brain cells. Typical symptoms include nausea, vomiting, headache and malaise.

46. The Homeostatic Role of the Kidney (page 66)

1. The kidneys can regulate (to a degree) the amount of water lost in the urine. When water needs to be conserved the urine is concentrated. When water needs to be removed, the urine is dilute.

2. (a) The kidneys will produce a large volume of dilute urine. (b) The kidneys will produce a small volume of concentrated urine. 3. The kidneys excrete nitrogenous wastes and toxins, help to maintain blood pressure and blood pH, and regulate the production of red blood cells.

ÂŠ 1988-2017 BIOZONE International

2. Alignment of nephrons (through the salt gradient in the kidney) allows urine to be concentrated as it flows towards the renal pelvis and ureter.

3. The salt gradient allows water to be withdrawn from the urine (allows the urine to be concentrated). Explanatory detail: Because the salt gradient increases through the medulla, the osmotic gradient is maintained and water can be continually withdrawn from the urine.

48. How the Kidney Regulates Fluids and Electrolytes (page 68)

1. (a) A nephron is a selective filtering element in the kidney. It has a region that makes the initial filtrate and then regions to modify the filtrate to form the final urine. (b) The nephrons produce the excretory fluid, urine.

2. (a) Produces an initial filtrate of the blood that is similar in composition to blood and can be modified to produce the urine. (b) Secretion allows the body to get rid of unwanted substances into the urine. (c) Essential process that allows the useful substances to be retained from the filtrate (particularly the initial filtrate). The body would waste energy if these substances were not retained. (d) Osmotic loss of water allows the urine to be concentrated (via loss of water).

3. (a) The salt gradient allows water to be withdrawn from the urine (allows the urine to be concentrated). (b) Salt gradient is produced by the active and passive movement of salt from the filtrate into the extracellular fluid in the medulla. (c) The longer the loop of Henle, the greater the salt gradient between the urine and the body fluids, allowing a greater withdrawal of water from the urine.

4. The kidneys play a central part in the homeostasis. Blood is filtered though the glomerulus and Bowman's capsule, resulting in a filtrate that contains nitrogenous wastes, toxins, water, ions, and glucose. Valuable ions, water, and glucose are reabsorbed from the filtrate. Transport of salt in the loop of Henle produces salt gradient which can be used for the selective reabsorption of water. By regulating the amount of water and ions in the urine, the kidneys help adjust blood pressure and volume to the homeostatic needs of the body.

49. ADH and Water Balance (page 70)

1. ADH promotes the reabsorption of water from the kidney collecting ducts, producing a more concentrated urine.

2. Blood volume is kept within narrow limits by adjusting urine volume and concentration. When osmoreceptors in the hypothalamus detect low blood volume, urine volume decreases and urine concentration increases. When receptors in the hypothalamus detect high blood volume, urine volume increases and urine concentration decreases.

No Cla t fo ssr r o Us om e

41. Alcohol, and Blood Glucose (page 61)

3. High fluid intake would decrease ADH production.

4. (a) Individuals with diabetes insipidus would produce large volumes of dilute (insipid) urine. (b) Individuals with diabetes insipidus would have to take a synthetic form of ADH to compensate for the lack of natural ADH.

50. Caffeine and the Body (page 71)

1. Caffeine decreases the body's ability to reabsorb sodium and water. As a result, it increases the frequency of urination. This can lead to a loss of water and electrolytes, which can cause an imbalance that must be rectified.

2. Caffeine increases fluid losses by inhibiting the secretion of antidiuretic hormone (ADH). ADH promotes removal of water PHOTOCOPYING PROHIBITED

168

No Cla t fo ssr r o Us om e

from the urine and reduces urine volume. With its secretion inhibited, large volumes of fluid are voided.

– Many metabolic pathways are interconnected and disturbance to electrolyte levels in particular has knockon effects because the negative feedback mechanisms normally stabilising body systems are impaired. For example, impaired kidney function also impairs the final step in vitamin D synthesis, leading to a drop in levels of vitamin D in the blood. The body compensates by increasing levels of parathyroid hormone (PTH), which is involved in vitamin D metabolism but also increases calcium leaching.

PR E V ON IEW LY

3. (a) As a stimulant caffeine could be abused by athletes in order to enhance their performance in a sport (especially those that require quick reflexes and alertness). (b) Caffeine is common in food and drinks, making it difficult for athletes to avoid and for officials to conclusively prove that an athlete took caffeine to purposely enhance performance.

1. A normal blood pressure maintains optimum balance between circulating fluid volume and cardiac output and maintains the health of the heart and blood vessels. High blood pressure increases the risk of blood vessel damage and can lead to aneurysms and heart failure. Low blood pressure can cause heart damage, low kidney filtration rates, and fatigue.

2. (a) Fall in blood volume can be caused by blood loss (as a result of trauma), a sudden loss of blood pressure, or dehydration. (b) A drop in blood volume is detected by the juxtaglomerular cells of the kidney which monitor the blood in the afferent (incoming) arteriole of the glomerulus. They respond by producing the enzyme renin, which catalyses the formation of angiotensin II in the blood. It is angiotensin II that causes blood vessels to constrict (which raises blood pressure) and stimulates the adrenal cortex to release aldosterone (which causes tubular reabsorption of sodium and water by osmosis). Angiotensin II also stimulates the thirst centre of the hypothalamus to promote drinking. When blood volume increases, the juxtaglomerular cells cease to be stimulated and renin production falls. (c) Blood volume is influenced by daily activities, (e.g. drinking, sweating) and negative feedback allows for its constant adjustment through the renin-angiotensin system. The renin-angiotensin system is activated when blood volume and pressure fall. This results in responses to counteract that fall. When blood volume and pressure are restored, the JG cells are no longer stimulated, renin production stops, and the motor responses that raise blood pressure are no longer stimulated.

52. Hypertension (page 73)

1. Causes of hypertension include (any three of): increasing age, family history, increased weight, physical inactivity, smoking, excessive salt and alcohol consumption, stress.

2. Hypertension is usually diagnosed when visiting a doctor for unrelated reasons as hypertension itself usually presents no immediate symptoms. The doctor often takes a patient's blood pressure and a reading above 140/90 will indicate that the person has a hypertension problem.

3. Excess salt (over the ability of the kidneys to process it) increases the electrolytes in the blood and causes retention of water in the blood vessels, increasing blood volume and therefore blood pressure.

4. Carrying excessive weight increases the body mass and the blood vessels the heart has to supply. The heart therefore has to work harder and blood pressure increases as a result.

53. The Consequences of Kidney Failure (page 74)

1. Kidney failure is a condition in which the kidneys no longer carry out the function of blood filtration, urea excretion, and electrolyte balance.

A discussion could include the following points: – Kidney failure can result in the build up of toxic substances, including nitrogenous wastes, in the blood and an imbalance of electrolyte levels. – Build up of metabolic wastes and toxins results in impaired organ function, and eventually failure across all body systems. – Impaired fluid regulation leads to fluid retention and oedema. Venous return is impaired and cardiac function is compromised. – Impaired kidney function/electrolyte management leads to an increase in blood phosphorus levels and this results in calcium leaching from the bones. Bone density declines and calcium is deposited in blood vessels, organs, and tissues, causing damage. © 1988-2017 BIOZONE International

54. What You Know So Far: Osmotic Balance (page 75) There are no answers. Summary is entirely student based.

55. Gas Transport in Humans (page 76)

1. (a) O2 high: lung alveoli and in capillaries leaving the lung. (b) CO2 high: capillaries leaving the tissues and in the cells of the body tissues.

2. Reversible binding of oxygen enable Hb to take up oxygen when oxygen tensions are high (lungs), transport it, and then release it when oxygen tensions are low (the tissues).

3. (a) As oxygen level in the blood increases, more oxygen combines with haemoglobin. However, the relationship is not linear: Hb saturation remains high even when blood oxygen levels fall very low. (b) When oxygen level (partial pressure) in the blood or tissues is low, haemoglobin saturation declines markedly and oxygen is released (to the tissues).

4. (a) Fetal Hb has a higher affinity for oxygen than adult Hb (it can carry 20-30% more oxygen). (b) This higher affinity is necessary because it enables oxygen to pass from the maternal Hb to the fetal Hb across the placenta.

5. (a) The Bohr effect. (b) Actively respiring tissue consumes a lot of oxygen and generates a lot of carbon dioxide. This lowers tissue pH causing more oxygen to be released from the haemoglobin to where it is required.

6. Myoglobin preferentially picks up oxygen from Hb and is able to act as an oxygen store in the muscle.

7. (a) As bicarbonate in the red blood cells and plasma (b) Any two of: Haemoglobin, which picks up H+ generated by the dissociation of carbonic acid. Bicarbonate alone (from this dissociation), and combined with Na+ (from the dissociation of NaCl). Blood proteins.

56. Responding to Changes in Oxygen Demand (page 78)

1. Being able to consciously control breathing allows a person to hold their breath in situations where inhaling would be harmful (e.g. near noxious or poisonous gases) or allows a stronger inhalation when desired (e.g. sniffing or smelling, larger inhalation before holding breath).

2. Oxygen concentration is kept constant indirectly by monitoring CO2 levels in the blood via changes in blood pH and adjusting breathing and heart rates accordingly. A fall in blood pH indicates a rise in CO2 levels and thus a increase in O2 demand (breathing and heart rates increase). An increase in pH indicates a drop in CO2 levels and a decrease in oxygen demand (reduction in breathing and heart rates).

No Cla t fo ssr r o Us om e

51. Control of Blood Pressure (page 72)

57. Homeostasis During Exercise (page 79)

1. Increase in heart rate, breathing rate, glucose production, and body temperature. Blood flow to active muscles is increased and breakdown of stored glycogen increases to provide glucose for the working muscles.

2. (a) The circulatory system and the respiratory system. (b) Circulatory system responds by increasing heart rate and diverting blood flow to the areas that need faster delivery of oxygen and glucose and removal of CO2 and other metabolic wastes. Respiratory system responds by increasing breathing rate to increase oxygen delivery and CO2 removal. 3. (a) Output of the heart increases more than five times. (b) Cardiac output increases to respond to the increased demand of the working muscles. Increased blood flow delivers oxygen and transports wastes away at a higher

PHOTOCOPYING PROHIBITED

169 rate than at rest.

5. (a) An increase in CO2 reduces the pH of the blood. (b) Respiratory acidosis is the result of decreased ventilation of the pulmonary alveoli. This can arise as a result of airway obstruction (e.g. asthma), depression of the respiratory centre (e.g. as a result of trauma), certain diseases (e.g. muscular dystrophy), and obesity.

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

4. (a) Oxygen consumption increases twenty times or more. Most of this increase occurs in the muscle. (b) An increase in metabolic activity associated with working muscles increases the requirements for oxygen (and need to remove metabolic waste products). (c) Resting muscles use about the same amount of O2 as other tissues. During exercise, the muscles account for most of the total increase in O2 consumption because metabolic activity of working muscles increases.

(b) The excess H+ comes from the dissociation of carbonic acid (H2CO3), which arises as a result of carbon dioxide combining with water.

58. Exercise and Heart Rate (page 81)

1. (a) The graph depends on student's response to exercise. (b) Students should see an increase in both heart rate and breathing rate during the exercise period.

2. (a) After 1 min of rest, there should be a fall in heart and breathing rate. After 5 min, both should have decreased further, and may have returned to pre-exercise levels. (b) Once exercise is completed, the body's metabolic rate falls. The demand for energy and oxygen falls, and the heart rate and breathing rate will fall accordingly.

59. Fight or Flight (page 82)

1. Heart rate and blood pressure both increase. Liver converts glycogen to glucose. Adrenal medulla secretes adrenaline. Blood flow to muscles and brain increases. Blood flow to gut and kidney decreases. Metabolic rate increases.

2. The body's short term response to stress is adaptive because it readies the body for the extra work it might have to do in terms of increased breathing rate, heart rate, and muscular activity. It prepares the body to efficiently flee or defend itself.

60. The Effects of High Altitude (page 83)

1. (a) Less oxygen is available for metabolism so people become breathless and often dizzy. Associated effects are headache, nausea, fatigue, and coughing. (b) Altitude sickness or mountain sickness.

2. (a) Short term: Heart and breathing rates increase. Long term: Increase in red blood cells, readjustment of blood pH balance by kidneys. (b) Short term: Increased breathing rate increases the rate at which new air is brought into the lungs. Increased heart rate pumps blood more rapidly to tissues. Long term: A increase in red blood cells increases the amount of oxygen that can be carried in the blood. The kidneys return the pH of the blood to normal, avoiding blood alkalosis.

61. Cooperating Systems: Acid Base Balance (page 84) 1. Metabolic processes depends on blood pH staying within the narrow range required by the enzymes catalysing metabolic processes. Blood is continuously circulating and carrying with it the products of metabolic activity (which are generally acidic and could potentially alter pH considerably if the blood were not buffered).

2. (a) Metabolic acidosis is caused by increased production of H+ by the body or the inability of the body to form bicarbonate (HCO3-) in the kidney. Causes can be varied but include diarrhoea (loss of HCO3--), renal failure, starvation, and poisoning. (b) Low

3. (a) Chemical buffers in the blood tie up excess H+ or bases temporarily. The HCO3- ion and its acid (carbonic acid) are in a dynamic equilibrium to mop up excess H+ and OH–. The system is supported by the charged groups on blood proteins, acting as H+ acceptors or donors. (b) If a base is added to the system, the OH– is neutralised to a weak base (HCO3–)

6. (a) The blood pH would increase (become more basic). (b) Breathing into a paper bag causes a build up of CO2 in the bag from the air breathed out. This acts to raise CO2 in the blood as it is breathed in and lowers blood pH. 7. It is only through the renal system that excess acids and bases can be permanently eliminated from the body. The main ways this is achieved is through excretion of hydrogen ions and reabsorption of hydroxide ions (since most metabolic wastes are acidic).

62. The Challenges of the Coast to Coast (page 86)

1. Clothing is very important in the energetics of thermoregulation during the race. The Coast to Coast involves demanding physical activity through a range of environmental conditions. High speed cycling increases the wind chill factor but also increases the heat energy produced by the body. Kayaking exposes the body to cold water, and mountain running may expose the body to low temperatures and rain, or to high temperatures and sunlight (UV). The correct kind of clothing will protect the core from chilling early on in the race, but allow excess heat to be dissipated later. This will allow the body to warm quickly to maximise performance levels, but will prevent over-heating (which would impair performance).

2. The large muscles used during running produce a lot of excess heat, which increases body temperature. Keeping cool during the mountain run (on a warm day) requires sweating. Excess heat is lost by evaporation of the sweat. Drinking will replace the water. Some athletes may drink water from the stream. This will lower their core temperature and help bring the overall body temperature down. Blood vessels near the skin may dilate to bring more blood to the surface and help cool the body.

3. During a long, physically demanding sports event, the body uses its stores of energy to produce work in the muscles and loses water and electrolytes via sweat. Eating can replace both energy (carbohydrates) and electrolytes. Drinking replaces lost water. Properly measured sports drinks can help to replace electrolytes and energy stores. Without these the body will eventually run out of fuel to do work, fatigue sets in, and low electrolyte levels (particularly magnesium) can result in cramping, making it impossible to continue.

4. Extra layers of clothing keep competitor warm. Air temperatures near the river, especially in the gorge, can be low and, combined with splashing cold water, can lower the body's temperature. Without warm clothing, it would very difficult to rewarm the body to peak performance temperature. It is typically easier to cool down than to warm up when in cold conditions.

5. Electrolytes are required by the body to maintain a stable cellular environment. Imbalances in (or low) electrolyte levels impair the cellular transport processes (e.g. active transport of ions, particularly Na+, Ca2+, Cl-, K+) required to maintain optimum cardiac, nerve and muscle function.

No Cla t fo ssr r o Us om e

5. A trained athlete has a greater cardiac output (total blood flow) and a greater total O2 consumption during exercise than an average man. The athlete's muscles adjust during training to working at a higher rate and demand more O2 (and a higher blood flow) than the muscles of the average man. Note also that a trained athlete diverts slightly more blood (and O2) to the muscles at the expense of other tissues during exercise. This is a physiological adjustment made as a result of training to increase the working capacity of the muscles.

6. (a) 293 x 36 + 118 x 140 + 208 x 67 = 41,004 kJ. (b) During the Coast to Coast a person will use about 4.7 times more energy than is normally needed in a day. To achieve this intake a competitor will normally eat and drink high energy supplements such as energy gels e.g. Leppin squeezy.

63. The Ultramarathon: A Personal Account (page 89) 1. Physiological challenges include maintaining hydration, electrolytes, energy (nutrient) levels, and thermal stability. The muscles use a lot of energy that must be replaced, and produce a lot of heat the must be removed. Removing the heat via sweating requires the replacement of water and electrolytes.

2. Factors might include lack of water/electrolytes, lack of energy (glucose), or possibly heat exhaustion.

PHOTOCOPYING PROHIBITED

170 64. Smoking and the Gas Exchange System (page 90)

inhibition of insulin production and stimulating glucose production by the liver. In both cases, BG levels do not return to normal until the body has finished metabolising the drug. 2. Humans thermoregulate using a variety of involuntary mechanisms including shivering, sweating, vasoconstriction and vasodilation of blood vessels, increasing or decreasing metabolic rate, and raising and lowering hairs on the skin. They can also use voluntary behavioural mechanisms such as exercising, seeking shade, or changing clothing to help regulate body temperature

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

1. Long-term smoking results in increased production of mucus (in an attempt to trap and rid the lungs of smoke particles). This lung tissue is irritated and a cough develops associated with removing the excess mucus. The smoke particles indirectly destroy the alveolar walls, leading to coalescing of the alveoli and a substantial loss of lung surface area. The toxins in the smoke and tar damage the DNA of cells and lead to cancerous cells and tumours.

Shivering is the rapid contraction and relaxation of the muscles. It serves to increase body temperature from the excess heat produced by the muscle movement. Sweating lowers the body temperature by the removal of heat from the skin as the sweat evaporates. Vasoconstriction serves to reduce heat loss by restricting blood to the core of the body whereas vasodilation allows blood to flow to extremities, e.g. the skin of arms and legs and ears, where heat will be to conducted to the air, reducing body temperature. An increase in metabolic rate (via the activity of the thyroid gland) increases body temperature as a result of increased heat production. A voluntary increase in physical activity has a similar effect.

During hypothermia, the body is losing heat faster than it is producing it and so the core temperature drops. This can be exacerbated by the failure of body systems during late stages, including a cessation of shivering and confused behaviour, including undressing, which further increases heat loss. If the core temperature is too low, organ systems begin to fail and death follows. During hyperthermia, the body is not losing heat fast enough and a person overheats. This can lead to failure of organs through heat exhaustion and dehydration (as water is lost through sweating). When body temperature exceeds 41Â°C thermoregulatory mechanisms fail and sweating stop. Collapse and death follow shortly after.

3. Tar contains many cancer-causing components which can cause DNA mutations in the lung cells. These can cause uncontrolled cell growth and the development of lung cancer.

4. (a) A long term study is important with a chronic disease that develops slowly because it may take many years for convincing relationships to become evident in the data. (b) The study also showed that there was a convincing 20 year lag in the development of lung cancer in smokers.

65. Smoking and the Cardiovascular System (page 92)

1. In the short term, nicotine elevates blood pressure and heart rate. CO binds preferentially to haemoglobin in place of O2, so O2 transport is reduced (causing breathlessness and low oxygen saturation in the blood). In the long term, both nicotine and CO increase blood viscosity and, with increased blood pressure and mobilisation of fats, increase the risk of plaques forming and breaking off. This, in turn, increases the risk of heart attack and stroke. Long term elevated CO levels mean the heart must work harder to (attempt to) supply adequate oxygen to the tissues.

66. What You Know So Far: Respiratory Gases (page 93) There are no answers. Summary is entirely student based.

67. Essay Question (page 94)

1. Animals need to maintain a stable internal environment so that normal cellular reactions, essential to supporting life, can be carried out. To maintain homeostasis, the body must detect changes in the environment (through receptors), process this sensory information (brain and CNS), and respond to it appropriately via effectors (muscles and glands).

Glucose is needed by cells for cellular respiration (to produce ATP, which provides the cell's energy), so providing a constant supply of glucose is essential to maintain metabolism. Blood glucose (BG) levels are controlled by negative feedback. Negative feedback has a stabilising effect and acts to discourage variations from a set point. It works by returning internal conditions back to a steady state when variations are detected. Two hormones, insulin and glucagon, secreted by the pancreatic islet cells, control BG levels. Insulin is secreted by beta cells in the pancreas and decreases BG levels by causing cellular uptake of glucose. Glucagon is secreted by alpha cells and increases BG levels by causing mobilisation of glucose from stores. When BG levels rise (e.g. after eating a meal) insulin is secreted causing cells to take up glucose from the blood and store it as glycogen in the liver. Low BG levels (e.g. from fasting or exercising) stimulates the secretion of glucagon. Glucagon stimulates the conversion of glycogen in the liver to glucose, which is released into the blood to raise BG levels. Several factors can disrupt BG homeostasis. Diabetes mellitus is a disease in which blood glucose is too high because the body's cells cannot take up glucose in the normal way. In type 1 diabetes, the insulin producing cells of the pancreas are damaged and no longer produce insulin. In type 2 diabetes, the pancreas produces insulin, but the body does not respond to it. Type 1 diabetics require regular insulin injections to control BG levels. Type 2 diabetics can often control BG by lifestyle factors (e.g. losing weight, and exercising) but in some cases, insulin therapy may be required. Common recreational drugs such as alcohol and nicotine can disrupt BG homeostasis. Alcohol lowers BG by stimulating insulin production and inhibiting glucagon secretion. Nicotine increases BG indirectly (through adrenaline) causing ÂŠ 1988-2017 BIOZONE International

3. The kidneys help maintain osmotic balance by regulating the level of electrolytes and fluid in the blood. Blood flows through the glomerulus where ultrafiltration (forcing the fluid through capillary walls) produces a filtrate. The filtrate (now urine) passes into Bowman's capsule and then to the convoluted tubules where water and ions are reabsorbed to the blood to maintain correct ion and water balance. Excess water and ions are passed to the urine.

ADH is involved in this process. ADH is secreted from the pituitary gland and promotes water reabsorption in the kidney. If there is too little water in the blood (low blood volume), ADH is secreted and water is reabsorbed. When blood volumes are high (a lot of water in the blood), ADH secretion is switched off and more water is voided in the urine (negative feedback). As well as regulating the amount of water in the blood, the kidney also constantly adjusts the balance of electrolytes by secreting and reabsorbing ions, including Na+, Cl-, and K+.

Drugs such as caffeine interfere with the normal regulation of water and electrolytes. Caffeine inhibits the secretion of ADH, increasing urine volume and frequency of urination so that fluids are lost. It also decreases the kidney's ability to reabsorb sodium and potassium, so it increases teh excretion of these valuable ions and can lead to electrolyte imbalances.

68. KEY TERMS AND IDEAS: Homeostasis (page 96)

1. effector (B), homeostasis (A), hormone (D), hypothalamus (G), negative feedback (F), neurones (E), positive feedback (C), receptor (H).

No Cla t fo ssr r o Us om e

2. (a) A chronic condition is one which has persisted for a long time or is constantly recurring. (b) Symptoms of COPD include shortness of breath, chronic bronchitis, and emphysema (breakdown of lung tissue). (c) Breakdown of the lung tissue causes large air pockets to form in the lungs (coalescing of alveoli) and reduces the surface area for gas exchange. The smaller airways may become narrow and restrict airflow to the lungs.

2. Type: Negative feedback.

Mode of action: Has a stabilising effect, Maintains a steady state by counteracting variations from the normal set point.

Examples: Regulation of body temperature, blood glucose, and blood pressure.

(a) The kidney (b) The nephron (c) Loop of Henle (d) ADH

4. (a) Regulate blood glucose levels. (b) Negative feedback (c) The pancreas

5. (a) Glycogenesis is the production of glycogen from glucose and it helps to lower blood glucose. Glycogenolysis is the breakdown of glycogen to glucose PHOTOCOPYING PROHIBITED

171 and it helps to raise blood glucose. (b) The liver.

No Cla t fo ssr r o Us om e

PR E V ON IEW LY

Human Manipulation of Genetic Transfer

agar, taking care to mark the paper’s position relative to the agar plate. Press the paper onto another agar plate containing tetracycline and mark the position of the paper relative to the plate. Any colonies that do not grow on this new agar must contain the recombinant DNA (as they have been killed by tetracycline). Match the position of colonies between the first and second agar plates. Those on the first plate that are missing from the second are isolated and cultured.

1. (a) DNA manipulation is the altering of an organism's DNA either by adding new DNA or by editing existing DNA. (b) Organisms may be genetically modified through: • The addition of a foreign gene, e.g. human insulin gene inserted into bacteria or yeast for the commercial production of human insulin. • Alteration of an existing gene so that a protein is expressed at a higher rate or in a different way. This technique can be used to fix a malfunctioning gene. • Deletion or inactivation of an existing gene, e.g. the Flavr-Savr tomato which has had its ripening gene switched off. Gene inactivation also produces 'knock-out mice' which are used to study the physiological effects of particular genes.

2. Applications of DNA manipulation include: • Producing proteins as medicines or pharmaceuticals, e.g. insulin (also blood clotting factors). • Treating cancers through gene editing • Deleting or switching off genes to prevent the expression of a trait, e.g. switching off the gene that causes fruit ripening to improve shelf life of fruit.

71. Making Recombinant DNA (page 101)

1. Restriction enzymes cut DNA into lengths or to isolate genes by cutting at specific recognition sites.

2. Sticky ends on DNA allow different DNA strands cut with the same restriction enzyme to be joined (via the complementary overhanging base pairs. Blunt ends on DNA strands allow DNA strands of any other blunt end fragments to be joined. The strands do not have to be complementary.

3. Having many different kinds of restriction enzymes allows DNA to be cut at many different recognition sites and so produce a variety of sticky or blunt ends. This allows for a better ability to isolate and join different regions of the DNA.

4. (a) The two single-stranded DNA molecules are recombined into a double-stranded molecule. This is achieved by H-bonding between complementary bases. (b) DNA ligase joins two adjacent pieces of DNA by linking nucleotides in the sticky ends. 5. It joins together DNA molecules, while restriction digestion (by restriction enzymes) cuts them up.

6. All organisms on Earth use the same DNA code to store information and the same cellular machinery to read the information and express it. Any DNA from any organism can therefore be read and expressed by the cellular machinery of any other organism into which the DNA is spliced.

72. Creating and Using Recombinant Bacteria (page 103)

1. (a) It is most useful to use bacteria to produce multiple gene copies when the aim is to produce a large amount of the protein product (which will be expressed by the transformed cells). (b) It would not be useful to use bacteria to produce multiple gene copies when the aim is simply to amplify the DNA, e.g. for forensic or diagnostic purposes, and protein expression is not required (PCR is used for this).

2. The gene is prepared by removal of introns. At the same time, an appropriate vector (e.g. plasmid) is isolated. Both the gene and plasmid are treated with the same restriction enzyme to produce identical sticky ends. The DNA fragments are mixed in the presence of DNA ligase and anneal (DNA ligation).

3. 2 x 24 = 48 replications in twenty four hours. Number of bacteria and therefore plasmids = 248 or 2 multiplied by itself 48 times = 281,474,976,710,656 copies.

4. Recombinant colonies can be identified by their ability to grow on agar with ampicillin but not tetracycline.

ii)

iii)

5. A gfp marker is preferable over antibiotic resistance genes because antibiotic resistance genes encourage the undesirable spread of antibiotic resistance through bacterial populations. Apart from this, a gfp marker system is much simpler, as the marked colonies can be quickly identified by fluorescence under UV light.

73. Gel Electrophoresis (page 105)

1. Gel electrophoresis separates mixtures of molecules (proteins, nucleic acids) on the basis of size and other physical properties.

2. (a) The frictional (retarding) force of each fragment’s size (larger fragments travel more slowly than smaller ones). (b) The strength of the electric field (movement is more rapid in a stronger field). Teacher's note: The temperature and ionic strength of the buffer can be varied to optimise separation.

3. The gel is full of pores (holes) through which the fragments must pass. Smaller fragments pass through these pores more easily (with less resistance and therefore faster) than larger ones.

74. DNA Amplification Using PCR (page 106)

1. To produce large quantities of ‘cloned’ DNA from very small samples. Large quantities are needed for effective analysis. Small quantities are often unusable.

2. A double stranded DNA is heated to 98°C for 5 min, causing the two strands to separate. Primers, free nucleotides, and DNA polymerase are added to the sample. The sample is then cooled to 60°C for a few minutes, and the primers anneal to the DNA strands. The sample is incubated and complementary strands are created (by the DNA polymerase) using each strand of the DNA sample as a template. (Incubation temperature depends on the particular polymerase used; it is ~72°C for heat tolerant Taq polymerase, but lower for other polymerases). The process is repeated about 25 times, each time the number of templates doubles over the previous cycle.

3. (a) and (b) any of: - Forensic samples taken at the scene of a crime (e.g. hair, blood, semen). - Archaeological samples from human remains. - Samples taken from the remains of prehistoric organisms preserved in ice, mummified, preserved in amber, tar pits etc. 4. This exercise can be done on a calculator by pressing the 1 button (for the original sample) and then multiplying by 2 repeatedly (to simulate each cycle).

(a) 1024 (b) 33 554 432 (33.5 million)

5. (a) It would be amplified along with the intended DNA sample, thereby contaminating the sample and rendering it unusable. (b) Sources of contamination (any two of): Dirty equipment (equipment that has DNA molecules left on it from previous treatments). DNA from the technician (dandruff from the technician is a major source of contamination!) Spores, viruses and bacteria in the air. (c) Precautions to avoid contamination (any two of): Using disposable equipment (pipette tips, gloves). Wearing a head cover (disposable cap). Use of sterile procedures. Use of plastic disposable tubes with caps that seal the contents from air contamination.

No Cla t fo ssr r o Us om e

70. What is DNA Manipulation? (page 100)

75. What is Transgenesis? (page 108)

1. (a) Transgenesis is the insertion of a gene from one species into the DNA of another species. The changes in the DNA are heritable. (b) Transgenesis can be used to produce organisms with desirable traits by inserting the genes coding for those PHOTOCOPYING PROHIBITED

172 2. Traditional source of chymosin was from the stomachs of young (suckling) calves. 3. (a) Restriction enzymes can be used to cut DNA at specific sites and joined again with DNA ligase. Genes of interest can be isolated and inserted into a plasmid. (b) Bacteria can take up modified plasmid DNA and replicate it in culture. (c) The amino acid sequence of a gene protein product and its mRNA sequence can be determined. (d) Reverse transciptase can synthesise DNA from mRNA to construct a protein-coding gene. (e) The bacteria can make the protein in large quantities.

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

traits into a target organism. For example a gene that codes for a growth hormone can be injected into the nucleus of fish egg cells. Those cells that take up the DNA may produce fish that grow quickly and can be harvested early. The methods of transgenesis are not efficient, with only a small percentage of eggs taking up the new DNA and expressing it. Transgenesis, especially in animals, is also expensive and time consuming.

(c)

2. The fragments of injected DNA may be taken up by the egg cell's DNA. The egg cell develops into a embryo which is implanted into a surrogate mother. If the DNA was taken up by the egg cell (incorporated into its genome) then the individual will be born expressing the foreign gene.

76. Vectors for Transgenesis (page 109)

1. A vector is used to transport DNA into a target cell.

2. (a) Viruses are preferred vectors because they are adapted to gain entry into a host’s cells and integrate their DNA into that of the host. (b) Viral vectors can cause problems because (two of): • The host can develop a strong immune response to the viral infection. In patients disadvantaged (immune suppressed) by their disorder, this could severely undermine their health. • Viruses may not survive if attacked by the host’s immune system. • Only short sequence of DNA can be carried by the virus. • The genes may integrate randomly into chromosomes and disrupt the functioning of normal genes

4. Chymosin gene was isolated by first determining its amino acid sequence and from that, the mRNA coding sequence. Once this is known, a gene probe can be constructed and used to locate the mRNA of interest. Reverse transcriptase is used to produce DNA strand, which can then be amplified using PCR. This technique can be applied to isolating any gene of interest, once its protein product is known.

5. Advantages of using GE chymosin, (a)-(c) any 3 of: - The chymosin produced is identical to chymosin from its natural source. - The chymosin can be produced without the unnecessary slaughter of calves and is suitable for vegetarians. - The chymosin is 80-90% active ingredient and is thereby significantly purer as natural rennet, which contains only between 4-8% active chymosin. - The chymosin can be produced on demand, in the quantities required. This makes it cost effective.

3. A plasmid

6. Fungi are eukaryotes. The cells are larger and the secretory pathways are more similar to those of humans than those of E.coli.

77. The Applications of Transgenesis (page 110)

80. Engineering for Improved Nutrition (page 114)

2. Herbicide resistance in crops encourages the overuse of sprays. This can lead to resistance in weeds and result in the need to use more spray in the future.

3. The correct human hormone can be made in large quantities and thus be made cheaply. It also increases supply. In the past, animal insulin was used, which causes side effects.

4. Using a GM vaccine improves efficiency and safety of vaccine production (you don't have to handle the pathogen) and can produce resistance to multiple pathogens at once.

5. Can reduce protein deficiency diseases in regions where animal protein is not eaten. Reduces the need to farm livestock, saving land for crop production.

6. The health of the animal could suffer because producing foreign proteins has the potential to cause immune responses in the animal much like tissue rejection. The animal may put also so much effort into making the protein that its own health is compromised by lack of adequate nutrients or energy.

78. Ethics of Transgenesis (page 111) 1. Discussion could include:

Concerns

- Possible spread of genes from one species to another. - Once genes have escaped into the environment they cannot be recovered. - Ethics of using animals as GE models. They may suffer poor health. - Possible evolution of resistance in pest population to toxins in modified crops rendering the modification useless. - Possible monopolies on GE crops and organisms

Concerns should be weighed against the possible benefits which include higher crop yields, more nutritious crops, decreased pesticide use, increased range for crop growing (as a result of altered environmental tolerances), and more effective medicines.

79. Using Recombinant Plasmids in Industry (page 112)

1. The genes for two different enzymes involved in beta carotene synthesis are taken from two different sources and inserted into the nuclear genome of a rice plant. Expression of the gene under the control of an endosperm specific promoter results in production of beta carotene in the edible portion of the rice plant.

2. The expression of the genes is controlled by a promoter specific to the endosperm, so the genes will only be expressed in that tissue.

3. Agrobacterium tumefaciens is a natural plant pathogen and can transfer genes as a consequence of infecting a host plant. The tumour-inducing Ti plasmid can be modified to delete the tumour-forming gene and insert a gene for a desirable trait.

4. (a) Production and consumption of beta-carotene rich rice could alleviate or prevent diseases related to vitamin A deficiency (e.g. night blindness and susceptibility to infection as a result of low immunity). Beta carotene is a precursor to vitamin A. (b) Improved nutrition through GM rice will be viable only if the diet in targeted regions is also adequate with respect to fat intake. In some impoverished regions this will not be the case, as diet is inadequate across a wide range of food groups, including fat and protein. 5. Golden rice is a GM product, which many people believe is unnecessary. Anti-GM groups believe people can get enough beta-carotene by eating the right kinds of vegetables.

No Cla t fo ssr r o Us om e

1. Produce can be kept on display for sale longer. Produce can be shipped greater distances without spoilage. Both result in lower costs to growers and to consumers.

81. Using Recombinant Plasmids in Medicine (page 116)

1. (a) High cost (extraction from tissue is expensive). (b) Non-human insulin is different enough from human insulin to cause side effects. (c) The extraction methods did not produce pure insulin so the insulin was often contaminated.

2. Mass production of human proteins using E. coli facilitates a low cost, reliable supply for consumer use. The insulin protein is free of contaminants and, because it is a human protein, the side effects of its use are minimised.

3. The insulin is synthesised as two (A and B) nucleotide sequences (corresponding to the two polypeptide chains) because a single sequence is too large to be inserted into the bacterial plasmid. Two shorter sequences are small enough to be inserted (separately) into bacterial plasmids.

PHOTOCOPYING PROHIBITED

173

No Cla t fo ssr r o Us om e

4. The β-galactosidase gene in E.coli controls the transcription of genes, so the synthetic genes must be tied to that gene in order to be transcribed.

2. (a) The nonfunctional gene is produced in vitro (in the laboratory). (b) The non-functional gene is introduced into the ESC by a vector. Those that take up the non-functional gene are injected into the blastocyst via microinjection. (c) Only some cells in the first generation mice will have the non-functional gene because these are the cells that are descended from the ESCs injected into the early blastocyst. (d) The first generation of mice are chimaeras (some cells have the non-functional gene). These are crossbred to produce second generation mice, which are heterozygous. These heterozygous mice are cross-bred to produce third generation homozygous mice.

PR E V ON IEW LY

5. (a) Insertion of the gene: The yeast plasmid is larger and can accommodate the entire synthetic nucleotide sequence for the A and B chains as one uninterrupted sequence. (b) Secretion and purification: Yeast, a eukaryote, has secretory pathways that are more similar to humans than those of a prokaryote and β-galactosidase is not required for gene expression. Secretion of the precursor insulin molecules is therefore less problematic. Purification is simplified because removal of β-galactosidase is not required and the separate protein chains do not need to be joined.

produce the same mutation. In addition some genes may be highly conserved and not mutate often.

1. Bacillus thuringiensis

2. Bt toxin is useful as a specific insecticide for caterpillars.

3. The primary target is the European corn borer.

4. The Bt gene is added to the Ti plasmid that is then added to Agrobacterium tumefaciens. Agrobacterium is mixed with corn plant cells in the lab where it transfers the plasmid into the plant cells. The cells are grown into plants in the lab before being planted out.

5. Students generate their own answers. Students could discuss where in the production pathway blame should reasonably be attributed or how production can be maximised without harming the environment.

83. Food for the Masses (page 120)

1. The bacterium. This bacterium uses only one enzyme to facilitate multiple reactions. It is therefore simpler to use in the production of the modified plant.

2. The gene can be isolated by first identifying the associated enzyme and its amino acid sequence. From this the mRNA sequence can be identified. The correct mRNA molecules can then be extracted from the cell and reverse transcriptase used to copy the mRNA into DNA, which is then amplified.

Or - Once the DNA sequence is identified, PCR primers can be produced that will anneal to the start sequences of the gene. The PCR product will be the targeted gene.

Or - The gene can be identified from its protein product (as above). This can then be cut from the chromosome using restriction enzymes and amplified.

3. Agrobacterium. This bacterium can transfer DNA into plants, so that the cells will contain recombinant DNA.

4. A plasmid (the Ti plasmid) is removed from the Agrobacterium. Using restriction enzymes the plasmid is cut and the target DNA inserted (the tumour forming gene is removed). DNA ligase is used to attach the target DNA to the plasmid. The plasmid is then replaced into the Agrobacterium.

5. (a) Agrobacterium transfers the recombinant plasmid to the cells of the target plant. (b) The best stage of development for transformation is while the plant is an embryo. In this way, a larger proportion of the plant cells will take up the new DNA. This will cause a much better result in the adult plant.

6. Transformed plants can be identified if an extra gene is inserted along with the target gene. This is normally a gene for drug resistance. Plants grown on agar impregnated with the chemical will grow only if they have taken up the new DNA. Those without won't grow.

7. A large number of plants can be produced using plant tissue culture or vegetative propagation. In this way many plants can be produced, which will lead to rapid dissemination of the transgenic stock.

84. What You Know So Far: Transgenesis (page 122) There are no answers. Summary is entirely student based.

85. Determining Gene Function (page 123)

1. (a) Gene function could be studied using mutations that produced genes that were non-functional. (b) Mutations are random. This makes it difficult to identify which gene has the mutation and to reproduce the mutation. Even the use of mutagens will not always

3. (a) Gene knockout produces a non-functional gene. The gene cannot be expressed. Gene knockdown disrupts the mRNA of a gene so that the product is not expressed. (b) Gene knockout takes a number of generations to produce a homozygous animal and thus fully produce the effect of the non-functional gene, whereas gene knockdown can produce its result immediately. Gene knockout is 100% effective at silencing a gene while gene knockdown is not always 100% effective at silencing gene expression.

4. Gene knockdown and knockout can be used to produce organisms as models of human disease (e.g. obesity). Gene knockout has been used to prevent sickle cell disease in mice models. Gene knockdown has been recently used by New Zealand researchers to produce cows that do not produce the protein β-lactoglobulin (an allergen) in their milk.

86. New Tools: Gene Editing with CRISPR (page 125) 1. (a) Cas9: Unwinds the DNA and cuts both strands at a specific point. (b) sgRNA: guides Cas9 to the target site.

2. CRISPR can be used to edit genes by gene knock in, which involves inserting a new sequence of DNA, and gene knock out, which involves removing DNA from genes to cause them to produce non-functional proteins.

3. The benefits of CRISPR include the ability to precisely and easily edit genes at low cost. The entire process is very quick relative to other gene editing tools.

87. Gene Probes (page 126)

1. A DNA probe allows a region of DNA to be marked and identified.

2. The DNA probe is a sequence of DNA that is complementary to the target region of DNA. It is therefore able to bond to the target DNA allowing that region to be identified.

3. Double stranded DNA must be denatured to a single strand so that the base pairs are exposed and the complementary base pairs on the DNA probe can bond to the target region.

4. Genes are visualised using fluorescent light or X-ray film, depending on the tag that has been added to the probe being used. The target DNA sequence will appear as a band on the electrophoresis gel.

No Cla t fo ssr r o Us om e

82. Engineering for Insect Resistance (page 118)

88. Studying Gene Expression (page 127)

1. Purpose: To determine the presence or sequence of genes in a sample, and their expression or activity level.

2. (a) The gene probes making up the microarray fluoresce when cDNA binds to them. This indicates that the RNA product has been expressed in the cell it was taken from. A quantitative amount of gene activity can be computer generated. (b) Reverse transcriptase makes a single-stranded copy (cDNA) of the RNA extracted from a cell.

3. (a) Genes that turned red in the microarray (2 and 24) are being expressed in cell 1 and therefore may produce antibiotic resistance in the bacteria. (b) New antibiotics would be designed to silence these antibiotic resistant genes. Alternatively, new antibiotics could be developed to affect those bacterial genes that are not antibiotic resistant (e.g. genes 4, 17, and 22).

PHOTOCOPYING PROHIBITED

174

No Cla t fo ssr r o Us om e

4. The information gained from the chip could be used to identify which tissue was cancerous and to what degree the cancer was present. This would then enable specialists to advise the best treatment for a particular cancer.

PR E V ON IEW LY

5. By knowing which genes are being expressed in which cells, genetic engineers can develop procedures to remove those genes for cells. This helps in understanding the function of those genes. It may also help in developing procedures to add genes that will complement those being expressed and thus develop new crop plants or biochemical models.

2. (a) Both diseases involve an identified mutation to a single gene and the location of the mutation is known. (b) Gene therapy for SCID has been more successful than gene therapy for CF because when bone marrow cells are transformed (corrected), they go on to differentiate and give rise to functional immune cells, so the correction is long lived. Delivery of vectors via the airways in CF gene therapy results in poor uptake into the cells and, because the cells are not progenitor cells, the effect is short lived.

1. The principle of gene therapy is to correct a genetic disorder of metabolism by correction, replacement, or supplementation of a faulty gene with a corrected version.

2. Transfection of (and correction of the genes in) germline cells allows the genetic changes to be inherited. In this way, a heritable disorder can be corrected so that future generations will not carry the faulty gene(s). Transfection of somatic cells only corrects those cells for their lifetime.

3. Gene amplification is used to make multiple copies of the normal (corrective) allele.

90. Vectors for Gene Therapy (page 130)

1. (a) Liposomes and naked DNA (plasmids) (b) Being able to insert large pieces of DNA into a vector would be beneficial if a large amount of DNA was to be transferred (if the corrective gene was large).

2. (a) If genes are integrated into the host's chromosome, they will be more stable in the long term, are more likely to function normally, and can be replicated along with the rest of the host's genome every time the cell divides. (b) This can be detrimental if the integration disrupts the functioning of existing genes. 3. One could argue for either an adenoviral or retroviral vector based on insert size and efficiency of delivery. Retroviral vectors do offer greater stability when integrated into the host's chromosome provided they don't disrupt existing genes. However, uptake of a retroviral vector might be low as liver cells divide infrequently and retroviruses typically infect dividing cells. An adenoviral vector would be less stable but also less risky in terms of causing disease or interrupting existing functional genes. On balance, an adenovirus is probably the most suitable vector.

91. Treating SCID with Gene Therapy (page 131)

1. The two most common causes of SCID are caused by a single, known mutation, so the target for correction is known and defined.

2. (a) Stem cells are isolated from the patient's own bone marrow and a corrected version of the gene is introduced into the cells using a viral vector. The vector infects the stem cells and the cells that have taken up the corrected gene are transfused back into the patient. Because bone marrow cells are stem cells, the corrected cells will go on to form the blood cell types involved in immune function. (b) Early SCID gene therapy involved a retroviral vector, which was very effective in correcting the nonfunctioning gene, but inserted next to a gene regulating cell growth, triggering blood cell cancer (leukaemia). (c) More recent treatments have used a different viral vector (a lentivirus) modified to reduce the risk of triggering cancer.

92. Treating Cystic Fibrosis with Gene Therapy (page 132)

1. (a) The lungs are the main target for CF gene therapy because the progressive lung damage associated with the disease is lethal (so treatment there can be life saving) and delivering the treatment via the airways to the lungs is relatively straightforward. (b) Correction rate has been low (25%), and the effects of correction have been short lived and the benefits quickly reversed. These problems are related to the poor survival of the viral vector in the body and the sporadic functioning of the gene because it is not integrated into the host's (human) chromosome. Patients suffer problems with immune reaction to the vector. In one patient, treatment was fatal. ÂŠ 1988-2017 BIOZONE International

3. (a) Somatic cell gene therapy. (b) The correction is made only to somatic cells, not the gametes, zygote, or embryo, and the changes are not inherited.

93. What You Know So Far: Gene Function (page 133) There are no answers. Summary is entirely student based.

94. Vegetative Propagation in Plants (page 134)

1. Vegetative propagation is the the asexual reproduction of a plant. Natural means include rhizomes, tubers and runners. Artificial means include grafting and cuttings.

2. A cutting is a portion of the parent plant that is removed and induced to grow into a new individual. Cuttings are used when one wants to merely propagate the features of the plant from which the cutting was taken. Grafting is a more complicated procedure where a scion from one individual is joined to the shoot of another plant (the rootstock). Grafting is used to incorporate the (favourable) features of two individual plants and produce a superior variety.

3. (a) Vegetative propagation is a useful conservation strategy because it enables large numbers of plants to be produced without having to wait for them to set seed and reproduce sexually. (b) If plants are rare, vegetative propagation can boost numbers so that they are in a more viable population position. When less at risk, sexual propagation (pollination and fertilisation) methods can be included. 4. If endangered plants are propagated solely through vegetative mechanisms, all plants in the population will be clones and their genetic diversity will be limited to whatever the genetic (allelic) diversity of the original plant(s). Without introducing sexual reproduction, the plants will be vulnerable to poor survival in the face of environmental challenges, e.g. changing soil or climate, because they won't have a wider pool of genetic variations to draw on to adapt.

95. Plant Tissue Culture (page 136)

1. The purpose of tissue culture is to produce large numbers of clones (with identical phenotypic and genetic traits as the parent) in a short space of time.

2. (a) A callus is a mass of undifferentiated cells. (b) Several plant hormones are added to the culture in sequence. These will stimulate each phase of plant development.

3. Continued culture of a limited number of cloned varieties leads to a change in the genetic composition of the population (the amount of genetic variation decreases). This reduces the amount of variation upon which the gene pool can draw in times of change. This in turn reduces the ability (of the gene pool) to adapt.

No Cla t fo ssr r o Us om e

89. Gene Therapy (page 129)

4. Compared with traditional propagation methods, tissue culture has a number of advantages. Tissue culture enables the production of many clones from a single seed/explant and allows the selection of desirable traits directly from culture. It facilitates rapid propagation, with no wait for seed production and is ideal for plants with long generation times, low seed production, or seeds that are difficult to germinate. Tissue culture also facilitates the international exchange of plants without quarantine and allows researchers to eliminate plant diseases from propagation lines. It is also space saving and overcomes seasonal restrictions to propagation. However, there are several disadvantages to this technology. Tissue culture is very labour intensive and trial and error is necessary to determine the ideal culturing conditions. Cultured plants may be genetically unstable/infertile and, over time, there may be a loss of genetic diversity (see Q3.).

PHOTOCOPYING PROHIBITED

175 96. Cloning by Embryo Splitting (page 138)

next generation/crop. This process was slow but created significant change in varieties and breeds over centuries. In more recent times, humans have gained the ability to accelerate this genetic gain through technologies such as artificial insemination and plant cloning. This allows the traits of favourable phenotypes to be spread ore widely and more quickly through subsequent generations.

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

1. Embryo splitting duplicates the twinning process (sometimes multiple times) so multiple identical embryos (offspring) can be produced from a single zygote (fertilised egg) produced by a high value animal.

3. Continued use of embryo splitting will reduce the total pool of genetic diversity from which to select new breeds/strains/ varieties.

97. Cloning by Somatic Cell Nuclear Transfer (page 139)

1. (a) SCNT is the transfer of the nucleus of a somatic (body) cell into an egg cell which has had its nucleus removed. The hybrid cell can then be grown to produce a new (cloned) organism. (b) Embryo splitting produces twins that are genetically identical to each other but not to the parent or any other animal. SCNT produces an animal that is genetically identical to the one that donated the somatic cell.

2. Producing clones using SCNT has the benefit that the clones produced will be identical to the parent so their phenotype is known from the start. All the superior phenotypic features of the parent will be present in the clones.

3. The biological implications of SCNT are associated with its advantages and disadvantages:

Advantages include: – It can be useful in the conservation of rare breeds. It is hoped that cloning will be integrated into rare breed management programmes. By retaining the tissues of individuals before they die, some of the genetic diversity of rare species can be retained. It may even be possible to restore species that are on the verge of extinction using cloning technology. – It can be used to develop treatments for genetic diseases (all responses to treatments should be the same). – It rapidly produces superior animals of known phenotype so is also useful for cloning transgenic animals (which themselves are technically difficult to produce).

Disadvantages include: – Loss of genetic diversity is a concern for long term viability of genetically adaptable populations. – Efficiency of producing live clones is very low - the process is still technically difficult. – Ethical/welfare issues arise from the destruction of embryos and the potential health problems (such as LOS) experienced by clones.

98. What You Know So Far: Cloning (page 141)

There are no answers. Summary is entirely student based.

99. What is Selective Breeding? (page 142)

1. (a) Selective breeding is the process of breeding together organisms with desirable qualities in order to fix those qualities in the breed and have them reliably passed on from generation to generation. (b) Selective breeding allows breeders to improve the reliability with which favourable traits are inherited and obtain gains in targets such as appearance, yield (e.g. of milk, meat, or grain), or disease resistance at a more rapid rate than breeding randomly. (c) Selective breeding can result in the loss of alleles that are deemed 'not desirable' at the time. Other alleles become fixed in the population. This loss of genetic diversity is a problem if environmental changes produce challenges (e.g. disease) to which the inbred lines cannot adapt. In cropping, complete reliance on a few high yielding varieties leaves humans vulnerable if those varieties are lost (this happened with the potato famine when the single-variety crops were lost to blight). 2. In its early development, selective breeding was a rather laborious process in which breeders/farmers selected their best progeny/seeds and kept those to breed the © 1988-2017 BIOZONE International

100. Selective Breeding in Dogs (page 143)

1. (a) Creating purebred lines involves breeding together animals that both show the qualities you are seeking leading to increased homozygosity (desirable alleles become fixed). When these alleles are linked to less desirable traits, these will also become fixed in the inbred population. Continued crossing of inbred lines can rapidly fix both desirable and undesirable alleles to the detriment of the animal. (b) This problem can be solved by outcrossing to increase the amount of heterozygosity and reduce the amount of inbreeding depression. Although there may be a reduction in the reliability at which desirable traits are passed, it will also reduce the influence of detrimental alleles (of course as soon as an animal is no longer homozygous for a gene, it will no longer be truebreeding for that trait).

101. Selection in Dairy Cattle (page 144)

1. (a) As milk yield in Holstein cows increases fertility decreases. (b) It suggests the genes for high milk yield and low fertility (or low milk yield and high fertility) are carried on the same chromosome (linked) and are very close together so that no crossing over and recombination occurs.

2. Milk yield will ultimately be limited by fertility (very high yield cows will have lower fertility and produce fewer offspring).

3. The sire must carry the genes for the desirable traits, as these will be inherited by his daughters. In addition, one sire has enormous influence as he potentially services many females (through artificial insemination).

4. Selective breeding is an artificial form of natural selection usually based around the improvement of one or two traits desired by humans, in this case high milk yield. Natural selection favours traits that will increase reproductive success but this may result in a compromise (best balance) between correlated (genetically linked) traits, e.g. milk production and offspring production (fertility) are both costly in terms of energy expenditure so in nature there will be a balance. Humans have selected for milk yield over fertility to the detriment of the latter (probably because low fertility can be overcome with the use of administered hormones and other reproductive technologies).

102. IVF and Embryo Transfer Technologies in Cattle (page 145)

1. MOET involves using hormones to induce multiple ovulations in a high quality cow, then inseminating all those eggs with high quality sperm using artificial insemination. After a short period of development in vivo, the embryos are flushed from the uterus, screened for sex and/or quality, and split (embryo splitting) to increase the embryo yield. The embryos are then transferred (transplanted) into surrogates. IVF also involves embryo transfer but the eggs are fertilised and the embryos grown to the 7 day stage in-vitro, not in the cow. Hormones are not required to induce multiple ovulation because multiple eggs are taken directly from the cow. IVF has a greater embryo/offspring yield because the entire procedure can be repeated a number of times through the season.

No Cla t fo ssr r o Us om e

2. Cloning allows the production of multiple offspring from one superior animal. Although the exact phenotype of the clones will not be known until they mature, their phenotypes can be predicted on the basis of the parental phenotypes. The number of offspring per breeding season can be at least twice what it would be normally and superior herds can be developed much more quickly.

2. IVF and ET technologies offer great genetic gains because the number of offspring that can be produced in one season from one 'desirable' cow is much greater than with either AI or natural breeding. AI can disseminate the genes of a high producing sire to many cows but the procedure is still based on one cow/one pregnancy. ET and IVF enable one cow/multiple pregnancies in surrogates so the high quality genetics of both parents (sire and cow) can spread rapidly though herds.

3. Sexed sperm and embryo selection offer a viable way to ensure that only female calves are born (unless high quality sires are required). Male embryos can be discarded before they develop, so unwanted bobby calves would not be born. PHOTOCOPYING PROHIBITED

176 remove them from the breeding population so that the BLAD allele was not passed to the next generation.

105. Identifying Pedigrees (page 151)

1. Microsatellite DNA sequences will be used.

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

4. Although IVF and ET technologies can produce very rapid genetic gains, these will populate herds with many offspring from a small number of animals with specific genetic profiles. Without outbreeding, some allelic diversity will be lost. Unless selection criteria are very rigorous for a wide range of traits, inadvertent selection for detrimental traits (or ones that won't necessarily be tested for such as ease of calving) can create breed problems and detrimental homozygosity.

1. STRs (microsatellites) are non-coding nucleotide sequences (2-6 base pairs long) that repeat themselves up to 100 times. Equivalent sequences in different individuals vary considerably in the numbers of the repeating unit. This property can be used to identify the natural variation found in every individual's DNA since every individual will have a different combination of STRs of different repeat length.

2. (a) Gel electrophoresis: Used to separate the DNA fragments (STRs) according to size to create the fingerprint or profile. (b) PCR: Used to make many copies of the STRs. Only the STR sites are amplified by PCR, because the primers used to initiate the PCR are very specific.

3. (a) Extract the DNA from sample. Treat the tissue with chemicals and enzymes to extract the DNA, which is then separated and purified. (b) Amplify the microsatellite using PCR. Primers are used to make large quantities of the STR. (c) Run the fragments through a gel to separate them. The resulting pattern represents the STR sizes for that individual (different from that of other individuals). 4. To ensure that the number of STR sites, when compared, will produce a profile that is effectively unique (different from just about every other individual. It provides a high degree of statistical confidence when a match occurs.

104. Marker Assisted Selection (page 149)

1. A gene marker is a length of DNA that can be probed for and is associated and inherited with a particular gene.

2. (a) A quantitative trait is a trait which varies in its appearance. A example is height. The trait is controlled by two or more genes (it is polygenic). (b) Because quantitative traits are controlled by many genes a number of markers are required. Each gene will require a marker, and many will have two or more. Hence a trait many have several markers that need to be tested for. 3. Marker assisted selection can identify the best animals to breed from and eliminate undesirable animals from the breeding population. This ensures the majority of the next generation of animals will have the desirable traits. MAS saves the need to evaluate numerous phenotypic traits. In reality, it is used in conjunction with traditional selective breeding as a way of refining trait selection.

4. (a) NN (b) BB (c) NB See diagram and gel at the bottom of page Taq1 cutting and electrophoresis gel:

5. Selective breeding by observing phenotypes only makes it difficult to identify any animals that are carriers of genes that may be undesirable. This can only be found when two heterozygous animals are crossed and a homozygous animal is produced.

6. By using the marker for BLAD and the normal gene breeders were able to identify cattle that were heterozygous and

3. Primers are annealed to the beginning of the target sequence of DNA. DNA (Taq) polymerase then copies the target sequence. After many cycles, a large number of copies of the target DNA are produced.

4. Electrophoresis is used to separate the lengths of microsatellite DNA. Different lengths of DNA will appear as bands in different places on the electrophoresis gel.

5. Profiles that have similar banding indicate relatedness in the breeds. The more disparate the banding the less related breeds are. Banding patterns can be computer analysed and a dendrogram produced.

106. Conservation and Genetic Diversity (page 152)

1. Genetic diversity reduces inbreeding depression which most often reduces fertility. High genetic diversity increases the ability to survive and adapt to environmental changes.

2. (a) Conservation genetics can enhance the viability of endangered species populations by ensuring that pairings maximise allelic diversity. By selecting matings on the basis of pedigree and translocating breeding stock between populations genetic diversity can be enhanced, reducing inbreeding depression, increasing heterozygosity, and producing more vigorous, less disease-prone offspring. (b) The increased genetic diversity occurring as a result of conservation genetics will enable populations of threatened species to more easily adapt to environmental changes. Genetic diversity results in a larger number of phenotypic variants with varying suitability to the (changing) environmental conditions. 3. Texan panthers are not closely related to the Florida panther and so were able to add genetic diversity to the Florida panther population (reducing the risk of inbreeding depression).

4. Translocating new (unrelated) prairie chickens into Illinois dramatically increased populations fertility and the number of eggs successfully hatched.

5. (a) All the original breeding birds (50), except one, come from Stewart Island, which was a small population with low genetic diversity to begin with. (b) Recording breeding pairs helps to manage matings and transfers so that the possibility of inbreeding is reduced. With inbreeding reduced, genetic diversity is maximised. (c) Conservation genetics applied to kakapo helps to maximise genetic diversity within the remaining birds, which will contribute to their long term viability. Even if numbers increase, genetic diversity needs to be maximised to ensure long term persistence.

107. Selective Breeding in Plants (page 154)

(a) (b) (c) (d) (e) (f)

Cauliflower: flowers Kale: leaf Broccoli: inflorescence Brussels sprout: lateral buds Cabbage: apical (terminal) bud Kohlrabi: stem (swollen)

No Cla t fo ssr r o Us om e

103. Genetic Tools for Selective Breeding (page 147)

2. The DNA primers are used as starting points for the PCR process. They enclose the section of DNA that will be isolated and amplified.

(a) GTGACCTTCCGGAGGGCCAAGGGCTACCCCAT / CGACCTGTACTACCTGATGGACCTCT

GTGACCTTCCGGAGGGCCAAGGGCTACCCCAT / CGACCTGTACTACCTGATGGACCTCT Homozygote normal

(b) GTGACCTTCCGGAGGGCCAAGGGCTACCCCATCGGCCTGTACTACCTGATGGACCTCT

26 BP

32BP

GTGACCTTCCGGAGGGCCAAGGGCTACCCCATCGGCCTGTACTACCTGATGGACCTCT Homozygote BLAD

PHOTOCOPYING PROHIBITED

58BP

177 2. If allowed to flower, all six can cross-pollinate.

109. What You Know So Far: Selective Breeding (page 150)

There are no answers. Summary is entirely student based.

110. Essay Question: Genetic Transfer (page 151)

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

3. Broccoli is an inflorescence, therefore breeders would have selected for plants exhibiting clumps of many small flowers. They would also have selected for plants with thick fleshy flower buds. These two characteristics, selected together over generations, eventually produced modern broccoli.

4. Natural and artificial selection work on an organism's own genome. Genetic engineering involves the insertion of foreign genes into a genome. Plants can reproduce vegetatively, so new traits can quickly be introduced into the population.

5. Desirable characteristics of apple trees (any of): development of sweet fruit, with crisp, juicy flesh, fruit that remains on the tree until picked (ripe), trees that grow to a uniform shape and size, trees that produce fruit of a uniform shape and size, etc.

6. (a) Selective breeding for specific traits generally reduces genetic diversity by increasing homozygosity in the offspring. When selection is focussed on specific traits, other phenotypes (therefore genotypes) are rejected and their genes are lost from the gene pool. This is particularly the case when the genes for desirable traits are associated, e.g. a genotype for heavy fruiting might also be associated (e.g. through linkage) to lower seed production. Selection for one trait will select for another. (b) Retention of genetic diversity is particularly important in crop plants because it provides a pool of genes from which to improve strains and guard against loss of adaptability in crops. In terms of food security, it is dangerous to rely on only a restricted number of strains for most of our food. A good example is the Irish potato famine where potatoes were the main food crop and farmers relied almost exclusively on one high yielding potato variety. When this variety proved vulnerable to blight, most of the country's crop was lost and there was a huge famine. The country lost food security by relying on one variety and by not having a readily available store of diversity on which to draw. 7. Cultivated American cotton would have originated from the interspecific hybridisation of Old World cotton and wild American cotton.

8. Cavendish bananas do not produce seed and therefore must be reproduced by asexual propagation. As a result, all Cavendish banana plants are genetically identical and all will be vulnerable to the Panama disease strain. Moreover, it is not possible to breed into it any more genetic diversity and it will not be able to naturally produce resistance to the disease within the population (except perhaps in the unlikely event of a favourable mutation).

9. Wild plants and ancient breeds possess alleles that may have been lost from inbred lines. Retaining these ancient cultivars provides a gene bank and a buffer of genetic diversity, which can be used to improve inbred cultivars in the future.

1. Yields and nutritional value of a plant crop can be improved by selective breeding and/or by transgenesis (transferring genes from another species into the target plant) and/or tissue culture.

Selective breeding involves choosing plants with desirable qualities (in this case nutritional value) and breeding them together, over successive generations. A limit with this method is that (unless there is a spontaneous beneficial mutation) no new variation can be brought into the species. Selective breeding works only with the variation that was already present in the plant, and refines the variation that is expressed. Therefore, a selectively bred crop's genetic diversity is reduced overall.

Transgenesis involves using genetic recombination to place genes from other organisms into a target organism. In plants, the tumour-forming bacterium Agrobacterium is often used to transfer genes into the plant. The genes are spliced into a plasmid, which is placed into the bacterium. The bacterium then infects the plant, transferring the genes from the plasmid to the plant, causing a callus like growth. Cells from the growth are then taken and grown into new plants using tissue culture (i.e. adding hormones to induce root and stem production). In this way, novel genes (producing a protein never before produced by that plant type) can be introduced, increasing the genetic diversity in the plant.

The biological implications of these manipulations extend to effects on the environment. A plant with novel genes may be more (or less) able to survive and reproduce in the wild (increase or decrease fitness). If the new plant is more successful in the wild (and if it escapes containment) it will proliferate and alter species diversity in the natural environment. The risk is that such plants will become invasive and successful weeds.

111. KEY TERMS AND IDEAS: Genetic Transfer (page 152)

1. annealing (G), CRISPR-cas9 system (Q), DNA probe (P), embryo splitting (O), gel electrophoresis (J), gene marker (R), gene therapy (H), GMO (B), marker gene (N), plasmid (E), polymerase chain reaction (A), recombinant DNA (L), restriction enzyme (M), selective breeding (I), somatic cell nuclear transfer (SCNT) (C), tissue culture (K), transgenesis (F), vector (D).

2. (a) C is the father. (b) These two individuals are homozygous for one allele so for that allele one band shows instead of two.

108. Selective Breeding in Modern Wheat (page 156)

2. (a) Yield has increased steadily since the 1960s. (b) Increased yields have been important in supplying the increasing needs of a growing human population. (c) Genetic techniques are enabling rapid genetic gains and increase in yield.

3. Ancient varieties are sources of genetic diversity that has been lost from modern cultivars. Retaining a seed bank of ancient varieties enables breeders to draw on their diversity to improve the propoerties of modern cultivars in response to changing environmental conditions.

4. The company would select seeds from wheat varieties naturally growing in more arid regions. The could then apply genetic techniques to identify markers for alleles or allele combinations associated with drought and heat tolerance and cultivate those plants with the desired allelic profiles. Over time, selection of plants with the greatest drought tolerance will produce a uniformly drought tolerant cultivar (the allele will be fixed).

ÂŠ 1988-2017 BIOZONE International

No Cla t fo ssr r o Us om e

1. (a) High gluten: Gives elasticity and shape to baked products. (b) Disease resistance: Increases in crop yield (reduced losses to disease): (c) Large grain size: Increases the yield per seed and the seeds are more easily harvested and processed.

PHOTOCOPYING PROHIBITED

178

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

Appendix A

SOME COMMON TOOLS IN GENETIC MODIFICATION

Tool

Reverse transcriptase

Tools used in genetic modification

Description

An enzyme that catalyses the formation of a complementary DNA (cDNA) from an RNA template by reverse transcription.

Application

ffUsed in reverse transcription

PCR where the polymerase chain reaction is applied to RNA.

ffCan be used to create a gene for use in transgenesis.

Restriction enzymes

Enzymes that cut DNA at specific nucleotide sequences. The recognition sequences are usually about six nucleotides long.

ffAllows DNA to be cut at

DNA ligase

An enzyme that joins two DNA strands together by catalysing the formation of a phosphodiester bond.

ffJoins DNA sequences

specific locations, and produces sticky ends that can later be joined to other sequences.

DNA is cut at a specific sequence

that were cut with a restriction enzyme. Allows DNA fragments to be joined together to produce recombinant DNA.

No break in DNA molecule

Plasmids

A small circular DNA strand that can replicate independently of the chromosomes. Found in bacteria and some yeasts.

ffUsed in genetic

Taq polymerase

A thermostable DNA polymerase isolated from the thermophilic bacterium Thermus aquaticus. Stable at 95Â°C.

ffUsed in polymerase

engineering as vectors for the insertion of a target gene to produce recombinant DNA.

chain reaction (PCR), to amplifying short segments of DNA.

Polymerase chain reaction (PCR)

Single-Nucleotide Polymorphism (SNPs)

No Cla t fo ssr r o Us om e

Nucleotides

A technique used to amplify selected sections of DNA or RNA. It generates thousands to millions of identical copies of the sequence.

ffGenerates many identical

SNPs (pronounced snips) represents a difference in a single nucleotide between individuals in a population.

ffUsed for creating genetic

ÂŠ 1988-2017 BIOZONE International

copies of a nucleotide sequence.

ffCan be used instead of in vivo gene cloning.

maps.

Variation in a single nucleotide between individuals in a population

ffCan be used to see how

likely it is individuals may get certain diseases, or how they might respond to drugs and medicines.

PHOTOCOPYING PROHIBITED

GATTCTTATTAACTACGA GATTCTTCTTAACTACGA

179

TERMS AND NOTATION

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

Appendix B

The definitions for some commonly encountered terms related to making biological investigations are provided below. Use these as you would use a biology dictionary when planning your investigation and writing up your report. It is important to be

General terms

Data: Facts collected for analysis.

Qualitative: Not quantitative. Described in words or terms rather than by numbers. Includes subjective descriptions in terms of variables such as color or shape.

Quantitative: Able to be expressed in numbers. Numerical values derived from counts or measurements.

Hypothesis: A tentative explanation of an observation, capable of being tested by experimentation. Hypotheses are written as clear statements, not as questions.

The design of investigations

Control: A standard (reference) treatment that helps to ensure that responses to other treatments can be reliably interpreted. There may be more than one control in an investigation. Dependent variable: A variable whose values are determined by another variable (the independent variable). In practice, the dependent variable represents the biological response. Independent variable: A variable whose values are set, or systematically altered, by the investigator.

Controlled variables: Variables that may take on different values in different situations, but are controlled (fixed) as part of the design of the investigation. Experiment: A contrived situation designed to test (one or more) hypotheses and their predictions. It is good practice to use sample sizes that are as large as possible for experiments.

consistent with the use of terms i.e. use the same term for the same procedure or unit throughout your study. Be sure, when using a term with a specific statistical meaning, such as sample, that you are using the term correctly.

(e.g. quadrat size), or a volume. The size of the sampling unit is an important consideration in studies where the area or volume of a habitat is being sampled.

Statistic: An estimate of a parameter obtained from a sample (e.g. the mean height of all 17 year-old males in your class). A precise (reliable) statistic will be close to the value of the parameter being estimated. Treatments: Well defined conditions applied to the sample units. The response of sample units to a treatment is intended to shed light on the hypothesis under investigation. What is often of most interest is the comparison of the responses to different treatments. Variable: A factor in an experiment that is subject to change. Variables may be controlled (fixed), manipulated (systematically altered), or represent a biological response.

Reliability, validity, and significance

Accuracy: The correctness of the measurement (the closeness of the measured value to the true value). Accuracy is often a function of the calibration of the instrument used for measuring. Measurement errors: When measuring or setting the value of a variable, there may be some difference between your answer and the 'right' answer. These errors are often as a result of poor technique or poorly set up equipment.

Objective measurement: Measurement not significantly involving subjective (or personal) judgment. If a second person repeats the measurement they should get the same answer.

Investigation: A very broad term applied to scientific studies; investigations may be controlled experiments or field based studies involving population sampling.

Precision (of a measurement): The repeatability of the measurement. As there is usually no reason to suspect that a piece of equipment is giving inaccurate measures, making precise measurements is usually the most important consideration. You can assess or quantify the precision of any measurement system by taking repeated measurements from individual samples.

Parameter: A numerical value that describes a characteristic of a population (e.g. the mean height of all 17 year-old males).

Precision (of a statistic): How close the statistic is to the value of the parameter being estimated. Also called reliability.

Prediction: The prediction of the response (Y) variable on the basis of changes in the independent (X) variable.

Repeat / Trial: The entire investigation is carried out again at a different time. This ensures that the results are reproducible. Trials are not true replicates unless they are run at the same time.

Replicate: A duplication of the entire experimental design run at the same time.

Sample: A sub-set of a whole used to estimate the values that might have been obtained if every individual or response was measured. A sample is made up of sampling units, In lab based investigations, the sampling unit might be a test-tube, while in field based studies, the sampling unit might be an individual organism or a quadrat. Sample size (n): The number of samples taken. In a field study, a typical sample size may involve 20-50 individuals or 20 quadrats. In a lab based investigation, a typical sample size may be two to three sampling units, e.g. two test-tubes held at 10Â°C.

Sampling unit: Sampling units make up the sample size. Examples of sampling units in different investigations are an individual organism, a test tube undergoing a particular treatment, an area ÂŠ 1988-2017 BIOZONE International

The expression of units

The value of a variable must be written with its units where possible. Common ways of recording measurements in biology are: volume in liters (L), mass in grams (g), length in metres (m), time in seconds (s). The following example shows different ways to express the same term. Many quantitative terms are equivalents. For example, oxygen consumption measured in milliliters per gram per hour could be expressed as mL g -1 h -1 or cm 3 g -1 h -1 .

No Cla t fo ssr r o Us om e

Random sample: A method of choosing a sample from a population that avoids any subjective element. It is the equivalent to drawing numbers out of a hat, but using random number tables. For field based studies involving quadrats or transects, random numbers can be used to determine the positioning of the sampling unit.

Reliability: The degree to which an assessment tool produces stable and consistent results.

Statistical significance: An assigned value that is used to establish the probability that an observed trend or difference represents a true difference that is not due to chance alone. If a level of significance is less than the chosen value (usually 1-10%), the difference is regarded as statistically significant. Remember that in rigorous science, it is the hypothesis of no difference or no effect (the null hypothesis, H0) that is tested. The alternative hypothesis (your tentative explanation for an observation) can only be accepted through statistical rejection of H0. Validity: Whether or not you are truly measuring what you are claiming to measure. PHOTOCOPYING PROHIBITED

180

CHOOSING A STATISTICAL TEST

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

Appendix C

►► How you analyse your data will depend on the type of data you have collected. Plotting your processed data can help you to determine if you need to apply a statistical test and, if so, which test is appropriate.

►► Use the flow chart below to determine which test might be appropriate for the type of data you have collected. Examples of the tests you might commonly use are provided on a spreadsheet workbook on the weblinks page for this appendix.

Trend

Plot a scatter graph

Testing for a relationship between variables

Calculate mean and 95% CI from replicates

Finding how one factor affects another

Normal data

Testing for a correlation

START HERE

Non-normal data

More than two groups of data

Unpaired t-test

Different individuals

Data must be ranked in order of increasing size. Example: Size of fruit from a plant species grown in two different habitats.

No Cla t fo ssr r o Us om e

Comparing observed counts to an expected count

Key to Abbreviations:

Example: Suitability of clay pots and plastic pots for plant growth.

Mann-Whitney U-test

Non-normal data

Test for goodness of fit

Paired t-test

Example: Comparison of ratios of arm to leg length in chimpanzees and gorillas.

Normal data

Two groups of data

Frequencies

Example: Frequency of occurrence of different species at two sites.

ANOVA (Analysis of variance)

Plot a bar graph

(counts only, not measurements)

Example: Wing length vs tail length in birds.

Example: Survival of weevils in different pasture types.

Difference

What kind of data are you recording?

Pearson correlation coefficient

Spearman correlation coefficient

Same individuals

Measurements or counts

Linear: The data plot in a straight line (uncommon biologically). Example: clutch size vs body size in Daphnia.

Non-Linear: The data do not plot in a straight line (i.e. curved). Example: oxygen consumption at different temperatures.

What kind of test?

Testing for a difference between groups (e.g. habitats or treatments)

Regression

Testing an association between groups of counts

PHOTOCOPYING PROHIBITED

Chi-squared test

Example: An expected genetic ratio, or preference for different habitats.

Chi-squared test for association Example: Association of one plant with another in an area.

181

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

Appendix D

Photo credits

The following terms are often used when asking questions in examinations and assessments. Analyse:

Interpret data to reach stated conclusions.

Annotate:

Add brief notes to a diagram, drawing or graph.

Apply:

Use an idea, equation, principle, theory, or law in a new situation.

Calculate: Find an answer using mathematical methods. Show the working unless instructed not to.

Compare: Give an account of similarities between two or more items, referring to both (or all) of them throughout.

Construct: Represent or develop in graphical form.

Contrast:

Show differences. Set in opposition.

Define:

Give the precise meaning of a word or phrase as concisely as possible.

Derive:

Manipulate a mathematical equation to give a new equation or result.

Describe: Define, name, draw annotated diagrams, give characteristics of, or an account of. Design:

Produce a plan, object, simulation or model.

Determine: Find the only possible answer.

Discuss:

Show understanding by linking ideas. Where necessary, justify, relate, evaluate, compare and contrast, or analyse.

Distinguish: Give the difference(s) between two or more items. Draw:

Represent by means of pencil lines. Add labels unless told not to do so.

Estimate:

Find an approximate value for an unknown quantity, based on the information provided and application of scientific knowledge.

Evaluate:

Assess the implications and limitations.

Explain:

Provide a reason as to how or why something occurs.

Identify:

Find an answer from a number of possibilities.

Illustrate:

Give concrete examples. Explain clearly by using comparisons or examples.

Interpret:

Comment upon, give examples, describe relationships. Describe, then evaluate.

List:

Give a sequence of answers with no elaboration.

Measure:

Find a value for a quantity.

Outline:

Give a brief account or summary. Include essential information only.

Predict:

Give an expected result.

Solve:

Obtain an answer using numerical methods.

State:

Give a specific name, value, or other answer. No supporting argument or calculation is necessary.

Suggest:

Propose a hypothesis or other possible explanation.

Summarise: Give a brief, condensed account. Include conclusions and avoid unnecessary details.

We acknowledge the generosity of those who have provided photographs for this edition: PASCO for photographs of probeware • Greenpeace for photos used in the topic Socio-scientific Issues • Emma Andrews for the photo of Dawn Tuffery running • DEA for image of the ecstasy tablets • David Wells at Agresearch for photos on cloning • Roslin Institute for their photos of Dolly • Dept. of Natural Resources, Illinois, for the photograph of the prairie chicken • James Kuegler for information and photographs used in the Coast to Coast activities • K Suter • Scott McDougall We also acknowledge the photographers that have made their images available through Wikimedia Commons under Creative Commons Licences 2.0, 2.5. or 3.0: • Dual Freq • Romain Behar • Kjetil Lenes • Rudolph89 • www.glofish.com • NHGRI/ Lexicon Genetics • Georgetown University Hospital • Jacoplane • Robert M Hunt • Graham Crumb • Solimena lab • Anna Frodesiak • William Rafti • Ildar Sagdejev • Mountaineer • Dario • 25kartika • Jpodgi • Emmanueim • Nephron • Dr Graham Beards • Zephyris • R. Tribble • Kahuroa Contributors identified by coded credits are: BH: Brendan Hicks (Uni. of Waikato), CDC: Centers for Diseases Control and prevention, Atlanta, USA, DoC: Department of Conservation (NZ), EII: Education Interactive Imaging, FRI: Forest Research Institute, NASA: National Aeronautics and Space Administration, NIH: National Institute for Health, RA: Richard Allan, TG: Tracey Greenwood, USDA: United States Department of Agriculture, USAF: United States Air Force, WMRCVM: VA Maryland Regional Veterinary College of Medicine, DW: David Wells Royalty free images, purchased by Biozone International Ltd, are used throughout this workbook and have been obtained from the following sources: iStock, Corel Corporation from their Professional Photos CD-ROM collection; IMSI (Intl Microcomputer Software Inc.) images from IMSI’s MasterClips® and MasterPhotos™ Collection, 1895 Francisco Blvd. East, San Rafael, CA 94901-5506, USA; ©1996 Digital Stock, Medicine and Health Care collection; © 2005 JupiterImages Corporation www.clipart.com; ©Hemera Technologies Inc, 1997-2001; ©Click Art, ©T/Maker Company; ©1994., ©Digital Vision; Gazelle Technologies Inc.; PhotoDisc®, Inc. USA, www.photodisc.com. • TechPool Studios, for their clipart collection of human anatomy: Copyright ©1994, TechPool Studios Corp. USA (some of these images were modified by Biozone) • Totem Graphics, for their clipart collection • Corel Corporation, for use of their clipart from the Corel MEGAGALLERY collection • 3D images created using Bryce, Vue 6, Poser, and Pymol • Bone clones for some skull images.

No Cla t fo ssr r o Us om e

Questioning terms in biology

PHOTOCOPYING PROHIBITED

182

PR E V ON IEW LY

No Cla t fo ssr r o Us om e

Index

B Bias, in samples 18 Blood glucose homeostasis 53-56 - disruptions to 57, 59, 61-62 Blood pressure, control of 64, 72-73 Blood-buffer system 84 Blunt end restriction enzyme 101 Body shape, and heat loss 47-48 Brassicas, selective breeding 156 Breathing rate, influences on 78, 81 Bt toxin 118-119 C Caffeine, effect on homeostasis 71 Carbohydrate metabolism 56 Carbon dioxide, transport 76 Cardiovascular system 78-82 - effects of smoking 92 Central nervous system 40 Chymosin, production using GM 112 Cloning 134-140 Coast to Coast race 86-88 Column graph 13 Conservation - and genetic diversity 152-153 - role of cloning in 140 Continuous data 4 Control centre 35 Control, experimental 10 Controlled variable 10 CRISPR-cas9 125 Cutting 134 Cystic fibrosis, gene therapy 132

D Dairy cattle, selective breeding 142, 144-147 Data, analysis 19 Dependent variable 10 Descriptive statistics 15 Designing experiments 6-9 Diabetes mellitus 57, 59, 116 Discontinuous data 4 Displaying data 19 Distribution, of data 15 DNA amplification 106 DNA chip 127 DNA ligase 101-103 DNA manipulation, definition 100 DNA probe 126-127 DNA transfer 109 DNA, recombinant 101-104, 108 DNA, sheep pedigrees 151 Dogs, selective breeding 143 Drugs - effect on blood glucose 61-62 - effect on homoeostasis 71 - effect on thermoregulation 50 E Ecstasy, and thermoregulation 50 Effector 35, 40 Electrolyte balance 68 Electrophoresis, of DNA 105 Embryo splitting 138 Endocrine system 53

Endonuclease 101, 125 Ethics of research 5 Ethics, of transgenesis 111 Exercise, effect of 81 - and homeostasis 78-80, 86-89 Experimental control 10 Experimental design 6-9, 21-24

F Fair test 6-7, 21-22 Fever, positive feedback 39 Fight or flight response 82 Fluid balance 68 Food, GM 114-115, 120

G Gas exchange system 76-78 - and smoking 90-91 Gas transport 76-77 Gel electrophoresis 105 Gene cloning 103 Gene editing tool, CRISPR 125 Gene expression, study of 127 Gene function, determining 123-124 Gene knockdown 123-124 Gene knockout 123 Gene marker 103-104 Gene probe 126 Gene therapy 129, 131-132 Genetic diversity 152-153 Genetic engineering, defined 100 Genetic gain, in diary cattle 144 Genetic manipulation, history 99 Genetic modification 112-119 - common tools in 178 Genetic screening 29-31 Genetically modified organism 100 Germline therapy 129 gfp, gene marker 104 Glucagon, homeostatic role 53-54 Glucose, cellular uptake of 55 Golden rice 114-115 Grafting 134 Graph, types 13 Graphs 19

H Haemoglobin 76-77 Heart rate, effects of 78-82 Heat gains and losses 44 Histogram 13 Homeostasis 35-38 - and exercise 79-80, 86-89 - and oxygen demand 78 - and thermoregulation 38 - blood glucose 53 - blood pressure 72 - during exercise 78 - electrolytes 66-69 - fluid 65-70 - gas transport 74-84 - temperature 43-51 Hormonal regulation 40, 53 - in blood glucose regulation 53-54 - role in stress response 82 Hyperglycemia 57 Hypertension 73 Hyperthermia 49-50 Hyperthyroidism, effect of 51 Hypothalamus 41, 82 - in thermoregulation 43 Hypothermia 47-48 I Independent variable 10 Insect resistance in corn 118-119 Insulin resistance 59 Insulin 53-55 - recombinant 103, 116-117 Interpretation, of data 19 Investigation template 25-26

ÂŠ 1988-2017 BIOZONE International

IVF, role in selective breeding 145 JK Kakapo, genetic diversity of 153 Kidney failure, causes 74 Kidney, and homeostasis 66, 68-69 L Line graph 13 Liposomes 109, 130 Liver, homeostatic role 56 Logbook 12 Loop of Henle, role 69 Lungs, effect of smoking 90-91

M Marker assisted selection 149-150 Marker gene 149-150 Mean, of data 15 Median, of data 15 Microarray 127 Micropropagation 136-137 Microsatellites 147-148 Mode, of data 15 Molecular clone 103 Mountain sickness 83 Multiple ovulation embryo transferâ&#x20AC;&#x2030; 145 Myoglobin 76-77

N Naked DNA 130 Negative feedback 38 - and blood glucose control 54 - in thermoregulation 43, 51 Nephron 66-69 Nervous regulation 40-41 Neurohormone 41 Newborns, thermoregulation in 45 Nicotine, and blood glucose 61 Non-random sampling 9 Notation 179

O Osmoregulation 65-70 Osmoregulation, disruptions to 71 Oxygen demand, responses to 78 Oxygen, transport of 76-77

P Pancreas, in homeostasis 54, 57 Pattern seeking 23-24 Pattern seeking investigation 8-9 PCR 106, 147 Pedigrees, sheep 151 Pie graph 13 Pituitary, roles of 41 Plant cloning 134-137 Plant tissue culture 136-137 Plants, selective breeding 154-157 Plasmid DNA 102 Plasmid vector 102-103, 109, 130 Polymerase Chain Reaction 106 Positive feedback 39 Preimplantation genetic diagnosis 146 Pronuclear injection 108 Q Quadrats 8 Qualitative data 4 Quantatitive data 4

- hormonal 40 - nervous 40-41 Renal failure, causes 74 Renal system 84 Renin-angiotensin system 72 Replication, experimental 7 Research, ethics and safety 5 Respiratory pigment 76-77 Respiratory system 76, 78, 84 Restriction enzymes 101

S Safety, during research 5 Sample bias 18 Sample size 7 Sampling methods 9 Scatter plot 13-14 SCID, gene therapy 131 Scientific method 3 SCNT 139-140 Selective breeding 142-157 Sheep breed relationships 151 Short tandem repeats 147-148 Skin, role in thermoregulation 46 Smoking - and cardiovascular system 92 - effect on gas transport 90-91 Socio-scientific issues 28-31 Somatic cell nuclear transfer 139-140 Spread, of data 17 Standard deviation 17 Statistical tests, choosing 180 Sticky end restriction enzyme 101, 103 Stress response 82 T Tables 19 Thermoreceptor 46 Thermoregulation 38, 43-46 - disruptions to 47-51 Thryroid, in thermoregulation 51 Transgenesis 108 - applications 110, 114-120 - ethics 111 - vectors 109 Type 1 diabetes 57, 116 Type 2 diabetes 59 U Ultrafiltration, kidney 68 Urinary system 66 Urine output, control of 70

V Variables, relationships between 14 Variables, types of 4, 10 Vasoconstriction 46 Vasodilation 46 Vector 109 Vectors, gene therapy 130 Vegetative propagation 134-135 Viral vector 109, 130

No Cla t fo ssr r o Us om e

A Acid-base balance 84 ADH, and water balance 70 Adrenaline, and blood glucose 61 Adrenaline, and fight or flight 82 Alcohol, and blood glucose 61 Altitude, physiological effects of 83 Analysis, of data 19 Animal cloning 138-140 Animals, selective breeding 142-153 Antagonistic hormones 53 Antibiotic resistance marker 104 Antidiuretic hormone 70 Artificial selection 142-157

R Random sampling 9, 18 Range, of data 15 Ranked data 4 Receptor 35, 40 Recombinant bacteria 103-104 Recombinant DNA 101-104 Recombinant plasmid 102-103, 109, 112-119, 130 Recombinant technology, applications of 112-119 Regulatory systems PHOTOCOPYING PROHIBITED

WXYZ Water balance, role of ADH 70 Water budget 65 Water, regulation of 65-70 Wheat, selective breeding 156157