Issuu on Google+

ISSN 1679-4508

volume 9, número 1, janeiro/março 2011 Editorial vii Haiti’s earthquake: the magnitude of needs ix

Reprocessing hemodialysis filters – beyond clinical issues

1

Special Article Haiti’s earthquake: a multiprofessional experience

8

Original Article Impact of a program to promote health and quality of life of elderly

14 Impact of screening and monitoring of capillary blood glucose in the detection of hyperglycemia and hypoglycemia in non-critical inpatients

Haiti’s earthquake: a multiprofessional experience

18 Potentially inappropriate medication prescribed to elderly outpatients at a general medicine unit 24 Mother/child bond in mothers of overweight and eutrophic children: depression and socioeconomic factors 31 Habituation of the blink reflex in the neonatal period and development of auditory processing 36 Role of adipose tissue-derived stem cells in the progression of renal disease 46 Contrasting roles of donor and recipient TGFB1 and IFNG gene polymorphic variants in chronic kidney transplant rejection 52 Procalcitonin in patients with influenza A (H1N1) infection and acute respiratory failure 56 Immunological induction with thymoglobulin: reduction in the number of doses in renal transplant from deceased donor 66 Sterilization of single-use helical stone baskets: an experimental study

Health Economics and Management 70 A new spectrophotometric method to detect residual amounts of peroxide after reprocessing hemodialysis filters

Case report

75 Perforated diverticulitis of the appendix: ultrasonographic diagnosis

v olum e 9 , nú me ro 1, j ane i ro/ m ar ço 2 01 1 , pá g i na s 1 -1 1 8

78 A newborn with neck mass 81 A rare case of hematuria

Review

84 Aquatic physical therapy as a treatment modality in healthcare for non-institutionalized elderly persons: a systematic review 90 Noninvasive ventilation for acute respiratory failure in children – a systematic review

Reviewing basic sciences

95 Molecular aspects of bladder cancer

Learning by images

100 Low-energy femoral shaft fracture in elderly patient with prolonged use of alendronate

Medical Developments

102 Hearing rehabilitation through telemedicine to enhance public policies in Brazil 105 Agenda 110 Instruções aos Autores 113 Lista de itens para conferência de artigos 114 Instructions to authors 117 Check List

Camp map with the tents


• Cursos Pré-Simpósio • Workshop • Palestrantes Internacionais já confirmados!

22 a 25 de junho de 2011 • São Paulo - Brasil - Hotel Transamérica Andrew Rhodes - Inglaterra Charles Brudney - EUA Daniel de Backer - Bélgica Derek Angus - EUA Edward Abraham - EUA Jean-Daniel Chiche - França Jean-Louis Vincent - Bélgica John Marini - EUA Luciano Gattinoni - Itália Michael Niederman - EUA Michael Pinsky - EUA Niranjan Kissoon - Canadá Paolo Pelosi - Itália Rui Moreno - Portugal

Temas a serem abordados

• Acidente vascular cerebral • Aplicação de protocolos à beira-do-leito • Controle metabólico • Diagnóstico de infecção à beira-leito • Distúrbios de coagulação • Epidemiologia da sepse • Estratégias de ventilação mecânica • Infecções fúngicas • Infecções por bactérias multi-resistentes • Insuficiência cardíaca avançada • Insuficiência coronariana • Insuficiência renal aguda • Mecanismos fisiopatológicos da sepse • Monitorização hemodinâmica à beira-leito • Novos alvos terapêuticos na sepse • Nutrição enteral no paciente gravemente enfermo • Qualidade e segurança em terapia intensiva • Reposição volêmica: novas soluções • Sedação e analgesia • Síndrome abdominal compatimental • Surviving Sepsis Campaign • Trauma • Via aérea difícil

Cursos Pré-Simpósio Educação e Treinamento em Via Aérea Difícil 21 de junho de 2011 Local: Hospital Israelita Albert Einstein • Horário: 8h às 17h Número máximo de participantes: 40 Coordenadores: Luiz Francisco Poli de Figueiredo e Ruy Guilherme Rodrigues Cal Doppler-Echocardiography in Intensive Care Medicine 21 de junho de 2011 Local: Hospital Israelita Albert Einstein • Horário: 8h às 17h Número máximo de participantes: 40 Coordenadores: Daniel de Backer, Danilo Teixeira Noritomi e Haggéas da Silveira Fernandes Severe Sepsis and Septic Shock: From the Emergency Room to the Intensive Care Unit 21 de junho de 2011 Local: Hospital Israelita Albert Einstein • Horário: 8h às 18h Número máximo de participantes: 40 Coordenador: Eduardo Juan Troster Público Alvo: Pediatras Designing and Publishing Clinical Research in Critical Care 21 de junho de 2011 Local: Hospital Israelita Albert Einstein • Horário: 8h às 17h Número máximo de participantes: 40 Coordenadores: Antonio Capone Neto, Marcelo Katz e Marcio Soares

Workshop

(É necessário inscrição no Simpósio) Ventilação Mecânica 23 e 24 de junho de 2011 Local: Salas Ilhéus, Uma e Canavieiras do Hotel Transamérica Horário: 12h10 às 13h30 Número máximo de participantes: 80 Coordenador: Carmen Silvia Valente Barbas

Pontuação do Evento

• EMC - Programa de Educação Médica Continuada do HIAE: 40 créditos • CNA – Comissão Nacional de Acreditação

Presidentes Prof. Dr. Elias Knobel Diretor Emérito e Fundador do Centro de Terapia Intensiva Hospital Israelita Albert Einstein Prof. Dr. Jean Louis Vincent Diretor do Departamento de Terapia Intensiva do Hospital Erasme Universidade Livre de Bruxelas - Bruxelas - Bélgica

Local

Hotel Transamérica Av. das Nações Unidas, 18.591 - São Paulo - SP - Brasil Fone: (55-11) 5693-4511 - Fax: (55-11) 5693-4990

Inscrição

As inscrições poderão ser feitas através do site www.einstein.br/isicem

Mais informações

www.einstein.br/isicem • Fone: +55 11 2151.1001 Opção 1

www.einstein.br/isicem

Não é permitido gravar, filmar ou fotografar sem prévia autorização expressa da comissão organizadora do evento.

Convidados Internacionais Confirmados


einstein

ISSN 1679-4508 Indexada na Base de Dados LILACS

Publicação Oficial do Instituto Israelita de Ensino e Pesquisa Albert Einstein Instituto Israelita de Ensino e Pesquisa Albert Einstein Sociedade Beneficente Israelita Brasileira Albert Einstein Av. Albert Einstein, 627/701 - Piso Chinuch - Morumbi - CEP 05651-901 - São Paulo - SP - Brasil e-mail: revista@einstein.br Site: www.einstein.br/revista Tel.: (11) 2151-1233 - ramal 70635/70904

Periodicidade: trimestral

EDITOR RESPONSÁVEL Sidney Glina

EDITOR CIENTÍFICO Jacyr Pasternak

EDITORA EXECUTIVA Conceição Aparecida de Mattos Segre

EDITORA TÉCNICA Edna Terezinha Rother

einstein, São Paulo, v. 9 , n. 1, Pt 1. p. 1-118, jan./mar. 2011

EDITORES ASSOCIADOS PEDIATRIA Eduardo Juan Troster

CLÍNICA MÉDICA Eliézer Silva

CLÍNICA CIRÚRGICA Pedro Puech Leão

MULTIPROFISSONAL Sonia Maria Oliveira de Barros

GESTÃO E ECONOMIA Miguel Cendoroglo Neto

PESQUISA BÁSICA Manoel Barral Netto

GINECOLOGIA/OBSTETRÍCIA Eduardo Sergio Fonseca

CONSELHO EDITORIAL NACIONAL Abraham Pfeferman - SP Ana Claudia Latronico - SP Ana Maria Malik - SP Andy Petroianu - MG Ângela Tavares Paes - SP Anis Rassi Junior - GO Armênio Costa Guimarães - BA Ayrton Pires Brandão - RJ Beni Olej - RJ Bruno Caramelli - SP Cláudia Regina Furquim de Andrade - SP Daniel Herchenhorn - RJ Dario Birolini - SP Dora Selma Fix Ventura - SP Edson Duarte Moreira Jr - BA Edward Tonelli - MG Emmanuel de Almeida Burdmann - SP Erney Felicio Plessmann de Camargo - SP Fábio Pasqualotto - RS Francisco José Barcellos Sampaio - RJ Glauco Westphal - SC Helena Bonciani Nader - SP João David de Souza Neto - CE José Eduardo Aguilar Nascimento - MT José Luiz Gomes do Amaral - SP Linamara Rizzo Battistella - SP Luis Roberto Medina dos Santos - SC Luiz Fernando Onuchic - SP Marco Akerman - SP Marco Antônio Zago - SP Marcos Bosi Ferraz - SP Mauro Waldermar Keiserman - RS Miguel Srougi - SP Nelson Augusto Rosário Filho - PR Nelson de Assis Barros - BA Nestor Schor - SP Oddone Braghiroli Neto - BA

Einstein v9n1.indb i

Osvaldo Augusto Brazil Esteves Sant’ Anna - SP Osvaldo Malafaia - PR Paulo Toscano - PA Pedro Celiny Ramos Garcia - RS Ricardo Nitrini - SP Roger Chammas - SP Rolf Gemperli - SP Romeu Krause - PE Rubens Belfort Mattos Junior - SP Ruy Laurenti - SP Saul Goldenberg - SP Sérgio Pereira Novis – RJ Tarcísio Eloy Pessoa de Barros Filho - SP Valter Duro Garcia - RS Walter Antonio Pereira - MG Wilson Jacob Filho - SP

CONSELHO EDITORIAL INTERNACIONAL Abul K. Abbas - USA Adelaide Arruda-Olson - USA Antônio Marques Valido - Portugal Cleide Suguihara - USA Daniel De Backer - Bélgica Fernando Kim - USA Itamar Raz - Israel João Manuel Videira do Amaral - Portugal John Patrick Mulhall - USA Jon A. Vanderhoof - USA Marcos de Lima - USA Michael O’Leary - USA Paulo Cesar Maciag - USA Raymond Sawaya - USA René Sotelo Noguera - Venezuela Ricardo Zubieta - Chile Robert Nussenblat - USA Suzana de Souza Queiroz – Portugal Uri Seligsohn - Israel

24.03.11 19:32:49


einstein Instituto Israelita de Ensino e Pesquisa Albert Einstein Sociedade Beneficente Israelita Brasileira Albert Einstein - SBIBHAE Av. Albert Einstein, 627/701 - Piso Chinuch - Morumbi - CEP 05651-901 - São Paulo - SP - Brasil Site: www.einstein.br/revista e-mail: revista@einstein.br Tel.: (11) 2151-1233 - ramal 70635/70904

EXPEDIENTE einstein - ISSN 1679-4508 é uma publicação trimestral do Instituto Israelita de Ensino e Pesquisa Albert Einstein - IIEP. Publica suplementos. A responsabilidade por conceitos emitidos nos artigos é exclusiva de seus autores. Permitida a reprodução total ou parcial dos artigos, desde que mencionada a fonte. Presidente da Sociedade Beneficente Israelita Brasileira Hospital Albert Einstein: Cláudio Luiz Lottenberg Vice-Presidente da Sociedade Beneficiente Israelita Brasileira Albert Einstein: Claudio Schvartsman Diretor Superintendente do Instituto Israelita de Ensino e Pesquisa Albert Einstein: Luiz Vicente Rizzo Projeto Editorial: Eric Roger Wroclawski Redação e Administração: os manuscritos deverão ser encaminhados à: Biblioteca Lieselotte Adler Z’L - Av. Albert Einstein, 627/701 - Piso Chinuch - Morumbi - CEP 05651-901 - São Paulo - SP - Brasil ou enviados on-line para a revista einstein pelo endereço www.einstein.br/revista Secretaria executiva Toda a correspondência deve ser enviada à Secretaria, no endereço abaixo: All mail should be send to the address below: Av. Albert Einstein, 627/701 - Piso Chinuch - Morumbi - CEP 05651-901 - São Paulo - SP - Brasil Secretária Janaína Freire Antunes e-mail: revista@einstein.br Tradução Suzana Gontijo e-mail: suzanaga@terra.com.br Assinaturas/Subscriptions Pedidos de assinatura ou permuta devem ser encaminhados à Secretaria Executiva Assinatura anual: R$ 80,00 Fascículos avulsos: R$ 20,00 Instituições: R$ 140,00 Subscription or exchange orders should be addressed to Executive Secretary Annual subscription: US$ 30.00 Single issue: US$ 10.00 Institutions: US$ 50.00 Tiragem: 7.000 exemplares Produção: ZEPPELINI EDITORIAL Ltda. Rua Dr. César, 530 – sala 1308 – Santana – São Paulo – SP CEP 02013-002 – São Paulo – SP Fone/Fax: (11) 2978-6686 E-mail: zeppelini@zeppelini.com.br Capa: Centro de Informação e Comunicação – CENIC – Instituto Israelita de Ensino e Pesquisa Albert Einsten – e-mail: cenic@einstein.br Impressão: Vox Editora (www.voxeditora.com.br) © 2010 Instituto Israelita de Ensino e Pesquisa Albert Einstein

Einstein v9n1.indb ii

24.03.11 19:32:51


Contents Quarterly

einstein, São Paulo, v. 9 , n. 1, Pt 1. p. 1-118, jan./mar. 2011

EDITORIAL vii

Haiti’s earthquake: the magnitude of needs O terremoto do Haiti: a magnitude das necessidades

ix

Reprocessing hemodialysis filters – beyond clinical issues Reprocessando filtros de hemodiálise – além de questões clínicas SPECIAL ARTICLE

1

Haiti’s earthquake: a multiprofessional experience Terremoto no Haiti: uma experiência multiprofissional Milton Steinman, Melissa Simon Gumera, Mario Ferrett, Cristiane Isabela de Almeida,Maria Tereza Augusto Ioshimoto, Silvia Gusman, Miguel Cenderoglo, Oscar Fernando Pavão dos Santos,Alberto Hideki Kanamura, Claudio Luiz Lottenberg

ORIGINAL ARTICLE 8

Impact of a program to promote health and quality of life of elderly Impacto de um programa de promoção da saúde na qualidade de vida do idoso Silvia Affini Borsoi Tamai, Sergio Márcio Pacheco Paschoal, Julio Litvoc, Adriana Nunes Machado, Pedro Kallas Curiati, Luis Felipe Prada, Wilson Jacob-Filho

14

Impact of screening and monitoring of capillary blood glucose in the detection of hyperglycemia and hypoglycemia in non-critical inpatients Impacto do rastreamento e monitoramento de glicemia capilar na detecção de hiperglicemia e hipoglicemia em pacientes não graves internados Rogerio Silicani Ribeiro, Ricardo Botticini Peres, Magda Tiemi Yamamoto, Ana Paula Novaes, Claudia Regina Laselva, Adriana Caschera Leme Faulhaber, Miguel Cendoroglo Neto, Simão Augusto Lottenberg, Jairo Tabacow Hidal, Jose Antonio Maluf de Carvalho

18

Potentially inappropriate medication prescribed to elderly outpatients at a general medicine unit Medicamentos potencialmente inapropriados prescritos a pacientes idosos ambulatoriais de clínica médica Christine Grützmann Faustino, Milton de Arruda Martins, Wilson Jacob-Filho

24

Mother/child bond in mothers of overweight and eutrophic children: depression and socioeconomic factors Vínculo mãe/filho de mães de crianças com excesso de peso e eutróficas: depressão e fatores socioeconômicos Patricia Vieira Spada, Maria Arlete Meil Escrivão, Fernando José de Nóbrega, Yára Juliano

iii

Einstein v9n1.indb iii

24.03.11 19:32:52


31

Habituation of the blink reflex in the neonatal period and development of auditory processing Habituação do reflexo cócleo-palpebral no período neonatal e desenvolvimento auditivo Celina Rech Maggi, Luciane da Costa Pacheco, Tânia Tochetto, Maiara Santos Gonçalves, Fleming Salvador Pedroso

36

Role of adipose tissue-derived stem cells in the progression of renal disease Papel das células-tronco derivadas do tecido adiposo na progressão da doença renal Cassiano Donizetti-Oliveira, Patricia Semedo, Marina Burgos-Silva, Marco Antonio Cenedeze, Denise Maria Avancini Costa Malheiros, Marlene Antônia dos Reis, Alvaro Pacheco-Silva, Niels Olsen Saraiva Câmara

46

Contrasting roles of donor and recipient TGFB1 and IFNG gene polymorphic variants in chronic kidney transplant rejection Papéis contrastantes das variantes polimórficas dos genes TGFB1 e IFNG do doador e do receptor na rejeição crônica de transplantados renais Verônica Porto Carreiro de Vasconcellos Coelho, Rafael Ioschpe, Cristina Caldas, Monica Spadafora-Ferreira, João Americo Fonseca, Maria Regina Alves Cardoso, Selma Aliotti Palacios, Jorge Kalil, Anna Carla Goldberg

52

Procalcitonin in patients with influenza A (H1N1) infection and acute respiratory failure Pró-calcitonina em pacientes com infecção por influenza A (H1N1) e insuficiência respiratória aguda Péricles Almeida Delfino Duarte, Carla Sakuma de Oliveira Bredt, Gerson Luís Bredt Jr, Amaury César Jorge, Alisson Venazzi, Leônidas Gustavo Tondo, Luciana Schmidt Cardon de Oliveira, Marcela Maria Jorge, Roberta Marchiori, Thiago Simões Giancursi, Marcelo Coradin, Anderson Gustavo Alexandrino

56

Immunological induction with thymoglobulin: reduction in the number of doses in renal transplant from deceased donor Indução imunológica com timoglobulina: redução no número de doses em transplante de rim com doador falecido Lucio Roberto Requião Moura, Eduardo José Tonato, Érika Arruda Ferraz, Thiago Corsi Filliponi, Rogério Chinen, Ana Cristina Carvalho Matos, Maurício Rodrigues Fregonesi da Silva, Marcelino de Souza Durão, Alvaro Pacheco-Silva

66

Sterilization of single-use helical stone baskets: an experimental study Esterilização de cestas helicoidais descartáveis extratoras de cálculo: um estudo experimental Fernando Korkes, Alex Menezes, Cely Barreto da Silva, Roni de Carvalho Fernandes, Marjo Deninson Cardenuto Perez

HEALTH ECONOMICS AND MANAGEMENT 70

A new spectrophotometric method to detect residual amounts of peroxide after reprocessing hemodialysis filters Um novo método espectrofotométrico para detectar níveis residuais de peróxido após o reprocessamento de filtros de hemodiálise Moacir de Oliveira, Maria Aparecida Dalboni, Ilson Jorge Iizuka, Silvia Regina Manfredi, Nadia Karina Guimarães, Maria Claudia Cruz Andreoli, Ana Cristina Carvalho Matos, Marcelo Costa Batista, Bento Fortunato Cardoso Santos, Miguel Cendoroglo Neto

iv

Einstein v9n1.indb iv

24.03.11 19:32:53


CASE REPORT 75

Perforated diverticulitis of the appendix: ultrasonographic diagnosis Diverticulite perfurada do apêndice cecal: diagnóstico ultrassonográfico Rafael Burgomeister Lourenço, Marco da Cunha Pinho, Vladimir Schraibman, Antônio Luiz de Vasconcellos Macedo, Miguel José Francisco Neto, Marcelo Buarque de Gusmão Funari

78

A newborn with neck mass Recém-nascido com massa cervical Rita Calado Pereira, Laura Martins Barroso, Maria José Mendes, Isabel Fernandes Joaquim, Helder Ornelas

81

A rare case of hematuria Um caso raro de hematúria Andreia Mascarenhas, Isabel Castro

REVIEW 84

Aquatic physical therapy as a treatment modality in healthcare for non-institutionalized elderly persons: a systematic review Fisioterapia aquática como modalidade de tratamento em idosos não institucionalizados: uma revisão sistemática Gisele da Silveira Sarmento, Andréa Sanchez Navarro Pegoraro, Renata Cereda Cordeiro

90

Noninvasive ventilation for acute respiratory failure in children – a systematic review Ventilação não invasiva em crianças com insuficiência respiratória aguda – uma revisão sistemática Carolina Silva Gonzaga, Dafne Cardoso Bourguignon da Silva, Carolina Figueira Rabello Alonso, Carlos Augusto Cardim de Oliveira, Lara de Araújo Torreão, Eduardo Juan Troster

REVIEWING BASIC SCIENCES 95

Molecular aspects of bladder cancer Aspectos moleculares do câncer de bexiga Gelbert Luiz Chamon do Carmo Amorim, Denny Fabricio Magalhães Veloso, José Carlos Vieira, Paulo Roberto Alves

LEARNING BY IMAGES 100

Low-energy femoral shaft fracture in elderly patient with prolonged use of alendronate Fraturas diafisárias do fêmur por baixa energia nos pacientes idososcom uso prolongado de alendronato José Ricardo Negreiros Vicente, Daniel Seguel Rebolledo, Marcos Camargo Leonhardt, Mauricio Bernstein

v

Einstein v9n1.indb v

24.03.11 19:32:53


MEDICAL DEVELOPMENTS 102

Hearing rehabilitation through telemedicine to enhance public policies in Brazil Reabilitação auditiva por meio da Telemedicina para a melhoria das políticas públicas no Brasil Silvio Pires Penteado, Ricardo Ferreira Bento

105

AGENDA

110

INSTRUÇÕES AOS AUTORES

113

LISTA DE ITENS PARA CONFERÊNCIA DE ARTIGOS

114

INSTRUCTIONS TO AUTHORS

117

CHECK LIST

vi

Einstein v9n1.indb vi

24.03.11 19:32:54


Editorial Haiti’s earthquake: the magnitude of needs O terremoto do Haiti: a magnitude das necessidades

No matter how cruel it seems to be, overwhelming catastrophes always teach a lesson to humankind. Men have not learned to avoid them, as in wars or major African starvation periods, but there are great technological advances after dire calamities. The Second Great War, as well as the Korean and Vietnam Wars, were followed by incalculable developments in surgical techniques, metabology knowledge and development of Intensive Care. The current medical literature has many articles on the last cataclysms our planet suffered. Searching the keywords “Katrina hurricane”, 731 scientific articles are found reporting the experiences during and after the great natural disaster that destroyed New Orleans; and under the terms “Tsunami” and “Thailand”, there are 170 articles about the severe natural phenomenon. Recently an earthquake virtually shattered Haiti, where the binomial poverty and unpreparedness exponentially raised the causalities and destruction.

details of the action made by Brazilian healthcare professionals in delivering care to survivors. The humanitarian aid in such situation implies in emergence multidisciplinary action. The article shows how action planning is paramount for success. Among several aspects addressed, it draws attention to the fact that one third of the patients who had received some orthopedic care just after the earthquake, were unsatisfactorily treated and required further assistance. The major lesson of this report is the perception that medical preparedness is only one of the many instruments these professionals need to mitigate suffering of individuals in such an unfavorable situation. The ability to improvise, the opportunity to donate and not fail in face of human pain are other essential requirements for the good development of this humanitarian action.

In this issue of einstein we bring a special article by Steiman et al., giving

Sidney Glina Editor-in-Chief

vii

Einstein v9n1.indb vii

24.03.11 19:32:55


viii

Einstein v9n1.indb viii

24.03.11 19:32:55


Editorial Reprocessing hemodialysis filters – beyond clinical issues Reprocessando filtros de hemodiálise – além de questões clínicas

In this issue of einstein, Oliveira et al. present an article on methods to detect residues of peroxide used in reprocessing hemodialysis filters(1). In a glance, the analysis is a simple description of a technique used in hemodialysis services. However, its relevance exceeds the limits of this description, and relates to the clinical progression of chronic renal patients submitted to this renal replacement therapy. Dialysis, together with renal transplant, is a well-established and successful therapy for chronic renal patients. In Brazil, most of these patients (approximately 90%) undergo hemodialysis and the remaining is submitted to outpatient peritoneal dialysis(2). The practice of reusing these materials is common in Brazil and the United States and complies with wellestablished legal norms. The main reason for reprocessing is economic issues(3-4). Due to stricter supervision of dialysis centers in the past years, they have installed new pieces of equipment, water treatment by reverse osmosis, as well as reuse and care practices to assure good quality in services rendered. This fact is demonstrated by lower mortality rates in Brazil as compared to those in the United States. Hence, the role of reuse in clinical progression of renal patients has been discussed for some years. There is a consensus that it is a safe practice provided it is conducted according

to the standards established(5-6). However, more recently, with the adoption of singleuse and disposable materials in dialysis centers, the matter raised more debates on reprocessing. Some studies suggest a longer survival of patients submitted to hemodialysis with no reuse(7-9). This fact may be related to agents employed in reuse (formaldehyde and peracetic acid) that may cause or exacerbate inflammatory processes during treatment. Thus a more accurate determination of the undetectable levels by the methods currently employed may be clinically relevant, considering the complete removal of these substances is assured in dialysis systems, avoiding inflammation activation and its deleterious consequences. In an article recently published(10), the authors demonstrated that replacing reuse with peracetic acid by single-use devices in dialysis centers in the U.S., resulted in longer survival and lower levels of inflammatory markers, showing the importance of reassuring the complete elimination of this substance in dialysis systems in the centers that still have this practice, like most centers in Brazil. Luis Yu Nephrology Department, Hospital das Clinicas, Faculdade de Medicina, Universidade de São Paulo – USP, Sao Paulo (SP), Brazil.

ix

Einstein v9n1.indb ix

24.03.11 19:32:56


REFERENCES 1.

Oliveira M, Dalboni MA, Ilzuka IJ, Manfredi SR, Guimaraes NK, Andreoli MC, et al. A new spectrophotometric method to detect residual amounts of peroxide after reprocessing of hemodialysis filters. einstein. 2011;9(1):70-4.

2.

Sociedade Brasileira de Nefrologia [Internet]. Censo 2008.[citado 2011 Fev 21]. DisponĂ­vel em: http://www.nefrologiaonline.com.br/Censo/2008/ censoSBN2008.pdf

3.

National Kidney Foundation report on dialyzer reuse. Task Force on Reuse of Dialyzers, Council on Dialysis, National Kidney Foundation. Am J Kidney Dis. 1997;30(6): 859-71.

4.

Lacson E Jr, Lazarus JM. Dialyzer best practice: single use or reuse? Semin Dial. 2006;19(2):120-8.

5.

Medicare program; standards for reuse of hemodialyzer filters and other dialysis supplies--HCFA. Final rule. Fed Regist. 1987;52(191):36926-35.

6.

Reuse of Hemodialyzers. ANSI/AAMI RD47 (amended March 21, 2003). Washington, DC: American National Standards Institute; 2002.

7.

Held PJ, Wolfe RA, Gaylin DS, Port FK, Levin NW, Turenne MN. Analysis of the association of dialyzer reuse practices and patient outcomes. Am J Kidney Dis. 1994;23(5):692-708.

8.

Feldman HI, Kinosian M, Bilker WB, Simmons C, Holmes JH, Pauly MV, et al. Effect of dialyzer reuse on survival of patients treated with hemodialysis. JAMA. 1996;276(8):620-5.

9.

Feldman HI, Bilker WB, Hackett MH, Simmons CW, Holmes JH, Pauly MV, et al. Association of dialyzer reuse with hospitalization and survival rates among U.S. hemodialysis patients: do comorbidities matter? J Clin Epidemiol. 1999;52(3):209-17

10. Lacson E Jr, Wang W, Mooney A, Ofsthun N, Lazarus JM, et al. Abandoning peracetic Acid-based dialyzer reuse is associated with improved survival. Clin J Am Soc Nephrol. 2011;6(2):297-302.

x

Einstein v9n1.indb x

24.03.11 19:32:56


SPECIAL ARTICLE

Haiti’s earthquake: a multiprofessional experience Terremoto no Haiti: uma experiência multiprofissional Milton Steinman1, Melissa Simon Gumera1, Mario Ferrett1, Cristiane Isabela de Almeida1, Maria Tereza Augusto Ioshimoto1, Silvia Gusman1, Miguel Cenderoglo1 , Oscar Fernando Pavão dos Santos1, Alberto Hideki Kanamura2, Claudio Luiz Lottenberg3

INTRODUCTION On January 12, 2010 an earthquake of 7.0 on the Richter scale struck Haiti, the poorest country in America. The quake’s epicenter was in Leogane with extension to almost all the country also hitting Portau-Prince, the country’s capital. This disaster caused a huge destruction and devastated more than 250,000 of houses and commercial buildings and left more than a million of homeless people. In the aftermath, this catastrophe caused 230,000 deaths and more than 30,000 wounded people (1). (Figures 1 A and B) After the disaster medical institutions, government and non-governmental organizations from around the world geared up to help. Many volunteer health professionals from different areas came together to perform this task. Previous studies described the severity and epidemiology of injuries post-earthquakes (2-3). The Wenchuan 2008 earthquake in China presented, based on the Injury Severity Score (ISS), 45% of cases with less than eight injuries (minor injuries), 41% between 9 and 14 (moderate injuries) and 13.9% over 15 (severe injuries) (2). Of the injuries of the Kashemir 2005 earthquake in Pakistan, 64.9% were superficial lacerations, 22.2% were fractures and 5.9% were contusions and sprains (3). These studies pointed out the need of a coordinated action and a well equipped hospital to take care of the victims. We believe that huge disasters are the greatest threat facing mankind. On account of Haiti limited resources and the great number of patients who needed care, a multi-professional action after the earthquake became

Figura 1. A. Aerial view of a popular housing development after the earthquake. B. Example of destruction of a building after the earthquake

This study was carried out at Hospital Israelita Albert Einstein – HIAE – São Paulo (SP), Brasil. 1

Hospital Israelita Albert Einstein – HIAE, São Paulo (SP), Brazil.

2

Instituto Israelita de Responsabilidade Social da Sociedade Beneficente Israelita Brasileira Albert Einstein – SBIBAE, São Paulo (SP), Brazil.

3

Sociedade Beneficente Israelita Brasileira Albert Einstein – SBIBAE, São Paulo (SP), Brazil. Corresponding author: Milton Steinman – Avenida Albert Einstein, 627 - Consultório 116B, Bloco A1 – 1º andar – Morumbi - CEP 05651-901 – São Paulo (SP), Brasil - Tel.: 11 2151-0116 e-mail: miltons@einstein.br Received: Aug 1, 2010 - Accepted: Dec 8, 2010 * There is no conflict of interest

einstein. 2011; 9(1 Pt 1):1-7

Einstein v9n1.indb 1

24.03.11 19:32:57


2

Steinman M, Gumera MS, Ferrett M, Almeida CI, Ioshimoto MTA, Gusman S, Cenderoglo M , Santos OFP, Kanamura AH, Lottenberg CL

crucial to deliver adequate medical care. Some studies reported the multi-professional action of specific groups after this quake, superficially showing organizational aspects, dividing experiences and learned lessons (4,5) . However, few data presented results of multiprofessional team actions after earthquakes. Because of the diversity of clinical pictures after catastrophes we believe that a multi-professional team can promote better medical care and improve humanitarian service in such situations. We aim to describe qualitative and quantitatively the humanitarian and multi-professional action of Hospital Israelita Albert Einstein (HIAE) to assist the victims of the Haiti earthquake that enrolled surgeons, orthopedist, psychologists, physiatrists, occupational therapists, physiotherapists and managers.

ACTIONS Organization, planning and early action Hours after the earthquake, HIAE a Brazilian beneficent organization, offered to the devastated country a prompt and consistent response. To plan the actions we promptly organized a meeting including several areas of the hospital. Despite the fact that, at that moment, we did not have data on the medical consequences of the disaster, our board of directors, and the departments of critical care, radiology, nursing, pharmacy, engineering, the laboratory, the surgical center and human resources made a list of the resources that could be useful in such a catastrophic situation. Few hours later a multi-professional team was set up and a huge amount of equipment and critical care medications were made available. Adequate measures were taken so that all participants were vaccinated against yellow fever, hepatitis and tetanus. Because of the logistical difficulties and because the airport of Port-au-Prince, hit by the quake, had been closed, we decided to send at first a medical team to get the exact diagnosis of the situation, to choose a workspace in order to fulfill our sustainability plan and to deliver medical care. A group of leaders of our medical and social responsibility areas worked together to give logistic support for the physicians that were sent abroad and also to set up diplomatic issues in order to perform the main action. The main action Our main action was to send a multi-professional team to the previously appointed place to attend the earthquake victims.

The teams were set up according to demands and needs. Initially, physicians, nursing, laboratory technicians, pharmaceutics and maintenance engineers were sent. The subsequent teams were set up based on these previous ones. Our proposal was to stay for 40 days in alternate days of labor, rotating every 10 to 15 days of activities. We decided to send younger volunteer professionals with an adequate psychological profile, skilled and ready to face any adverse emergency situation.

The multi-professional action The multi-professional team was composed by general surgeons, orthopedists, anesthesiologists, pediatricians, obstetricians, primary physicians and intensivists. The rehabilitation team included physiatricians, occupational therapists, psychologists and physiotherapists. The nursing team worked together with the medical team at the surgical center and with the rehabilitation team. A support group was composed by maintenance technicians, pharmaceutics. Laboratory and radiology technicians were also included. Our multi-professional team had the goal to deliver direct care to a specific group of patients, as well as to attend the requests from the camp. Activities began daily at 7 a.m. after a meeting with the camp coordination to update the professionals on the activities, admission and discharge of patients. - Clinical action: patients were assessed daily by using clinical data and prescriptions were made and put into practice together with the nursing team. - Surgical action: included visits to patients to apply or remove wound dressings and to schedule the procedures that needed sedation and anesthesia in the camp surgical centers. Eventual interappointments were also performed. - Orthopedic action: the camp orthopedic team had one HIAE orthopedist, one orthopedist of the University of Chicago and two more orthopedists of a charity organization named Operation Smile. The Operation Smile had two mobile operating rooms and a team of anesthesiologists and nurses. The orthopedic action was intended to make a complete diagnosis of skeletal and muscle lesions in the camp patients and then decide upon the adequate procedures. The diagnosis of lesions was made considering the previous history of the current disease and the patient’s physical examination both performed inside the tents. If a radiography was needed, it was done using a hand-

einstein. 2011; 9(1 Pt 1):1-7

Einstein v9n1.indb 2

24.03.11 19:33:08


Haiti earthquake

held portable X-ray machine (Nomad Pro, Aribex , USA) which is habitually used to X-ray dental or small bones of animals. After a diagnosis was made at the evaluation moment, treatments which did not require a surgical intervention were classified as satisfactory and those that needed immediate or late surgical treatment were classified as unsatisfactory. - Pediatric action: was performed by clinical evaluation and inter-appointments performed in the tents and in the screening area. - Nursing team action: this action was performed by broad interaction with the other teams. The nursing team was daily attending all the camp patients according to the needs from the tents, delivering direct care, giving support at the operating rooms, to the pharmacy or to the rehabilitation teams. - Rehabilitation team action: the evaluation of patients included diagnosis and prognosis of the handicaped, prescription of prosthesis, and locomotor rehabilitation equipments, therapeutic plans for physical rehabilitation and a local workspace for organization duties (either internal or external) together with other therapists (physiotherapists, occupational therapists and psychologists). These professionals also prescribed medication for acupuncture and auricular-acupuncture, and gave support to the nursing team. - Physicological action: evaluation and psychological interventions were performed focusing on symptoms of post-traumatic stress disorders of patients and their families, some playful activities were done everyday with children (either patients or patients’ children). These professionals also supported the nursing team.

RESULTS According to the described actions, we highlight the following results. Organization, planning and previous action About a hundred professionals who were willing to participate at any time in the mission were gathered through volunteer mobilization. The initial period lasted 10 days and was characterized by visits and work at different places between the Jimani county bordering the Dominican Republic and Port-au-Prince, besides a number of contacts with governmental organizations. The Love a Child orphanage at Fond Parisien, 37 km from Portau-Prince was chosen as our headquarters, because this place offered safety and basic conditions for the team.

3

During this initial period it was possible to identify the most frequent diagnosis and figure out elements to set up teams and elaborate the needs for material resources. Because the official language of the country is French and the majority of Haitians speak creole only, we had a translator during the day time. A total of 52 professionals had the opportunity to take part in this mission.

The main action Two hundred and forty patients were distributed among the various care teams (from The United States of America, Ecuador and Brazil). Our group was responsible for 40 patients placed in tents designed for two or three patients each (Figures 2A, B and C). However, our action covered all patients according to the diversity of the professionals in the groups and the huge demand of victims requiring care. The official records of care included: the clinical picture, the daily planning, an electronic prescription and drug delivery. Every four days a medical and nursing team was on duty overnight to give support in case of the occurrence of an emergency at the camp. The patients’ mean age was 27.00 years +19.88 (Figure 3), most of them were women (80%). Regarding schooling, 55% had the equivalent to Brazilian’s basic education. Among patients the most common physical injuries were fractures of lower limbs followed by contusions and sprains. (Figure 4) Of the 40 patients under our responsibility, 13 had suffered amputations mainly on the left lower limb (Figure 5). Activities The team activities included visits to all patients, prescription and drug administration, wound dressing changes and specific actions depending on the special care needed. - Clinical activity: two visits were done daily. All patients were visited in the morning to evaluate their follow-up and prescription and in the afternoon, to verify pending problems and to re-evaluate more severe cases. - Surgical activity: twenty per cent of patients required wound dressings which were performed daily under medical supervision inside the tents. One to two surgical procedures were carried out in the surgical center, using narcosis or sympathetic block. The most common diagnosis were: infected wounds, decubitus ulcers and reconstruction of amputation stumps. einstein. 2011; 9(1 Pt 1):1-7

Einstein v9n1.indb 3

24.03.11 19:33:09


4

Steinman M, Gumera MS, Ferrett M, Almeida CI, Ioshimoto MTA, Gusman S, Cenderoglo M , Santos OFP, Kanamura AH, Lottenberg CL

Age range 30 25 20 15 10 5 0 21 - 40 years

0 - 20 years

41 - 60 years

> 60 years

Figure 3. Age distribution

Diagnosis 25 20 15 10 5 plex us hial Brac

Hea

d tra uma

Strok e

jury Spin

ains

/ co

al co

ntus

rd in

ions

s utee Amp

Spre

Low

Upp

er li

er li

mbs

mbs

frac

frac

ture

ture

s

s

0

Figure 4. Injury distribution in 40 pacients

Amputation level

lux Hal

b r lim we Lef t lo

Rig

ht l ow

lim b Lef

t up

per

lim b per t up Rig h

er l imb

8 7 6 5 4 3 2 1 0

Figure 5. Distribution of the amputation level Figura 2. A. View of the tents. B. Camp map with the tents positioned as they were ordered. C. Camp map with the tents (in reverse L) under the responsibility of HIAE (arrow)

- Orthopedic activity: the number of patients assessed by our orthopedist exceeded the initial number assigned to us (40 patients). In fact, the orthopedist assessed 103 patients, being 59 (57.3%) women and 44 (42.7%) men. These patients’ mean age was 28 years, varying from 2 to 82 years. From this total, 40 patients (38.8%) were under 18 years of age and only 10 (9.7%) were more than 60 years old. The majority

of patients had already been treated, however, after three weeks of injuries’ occurrence, a census describing the complete orthopedic diagnosis and the adequate behavior was not yet been performed. Of the 103 cases, 79 (76.6%) were fractures, 3 (2.9%) dislocation or severe sprains and 18 (18%) were cases of amputation. After the orthopedic evaluation, 71 patients (68.9%) were considered satisfactorily treated and 32 patients (31.06%) unsatisfactorily. Among these

einstein. 2011; 9(1 Pt 1):1-7

Einstein v9n1.indb 4

24.03.11 19:33:10


Haiti earthquake

32 cases, 10 required early surgery and the other 22 cases had vicious consolidation of fractures (shortening or angular deviations), or late consolidation of fractures because the inadequate treatment previously given (Figure 6 A, B, C e D). Six children who had diaphyseal femur fracture and one child with hip dislocation had the spica cast removed after five weeks of the injury. One child with fracture of tibia also had the plaster removed.

5

physical rehabilitation. We organized sites for care (both internal and external). Drugs for acupuncture and auricular-acupuncture were prescribed, and in this latter case, the care team was also involved. An outside area for group therapy, living and leisure was created (Figure 7).

Figure 7. Group of amputees realizing group physiotherapy

A. Child with diaphyseal femoral fracture with a spica cast. B. Shortening of a diaphyseal femoral fracture in a 18 year old girl, an unacceptable case. C. A case of disphyseal tibial and femoral (floating knee) with skin lesions. D. Patient with a diaphyseal femoral fracture inadequately treated because the fixator did not provide enough stability for weight discharge. However, the fracture was aligned and was considered satisfactory for the moment.

Figura 6. Orthopedic patients

- Nursing activities: the nursing team performed evaluations everyday, drug administration and insertion of peripheral venous access. All 40 patients received advice on skin hydration and hands cleaning. Bladder and bowel training was needed for spinal cord injury patients. - Rehabilitation team activities: all victims of the quake required some kind of rehabilitation. More than three weeks after the disaster many patients were staying in their tents for several days, and immobilism become a common characteristic either related or not to trauma. The patients under our responsibility were evaluated in relation to this aspect and we also assisted patients from the other teams. This work included: diagnosis and prognosis of disabilities, prescription of prosthesis, locomotor rehabilitation equipments and a therapeutic plan of

The physical rehabilitation team (physiotherapy and occupational therapy) treated the 40 patients with single or multiple sequels of fractures of lower limbs and upper limbs, brachial plexus injury, traumatic injury without fractured limbs, head trauma and patients who underwent amputations. All professionals frequently stimulated the patients to leave their tents to joint social activities. - Psychological evaluation: patients who presented symptoms of post-traumatic stress disorders were submitted to psychological interventions daily besides playful activities with children (either patients or patients’ children). Some dynamics were performed with teenagers who survived from the crumbling of an orphanage in Port-au-Prince. From the total, 5% reported traumatic memories on the disaster moment. After clinical and psychological evaluation we identified that 22 patients (55%) have symptoms of depression and 6 (40%) of anxiety.

COMMENTS In a massive earthquake of such territorial proportion it is impossible to calculate losses. The disrupting of communication systems, the difficulties to access the quake local, the collapse of health buildings and the scarcity of water, food and power associated to the great number of wounded turned the humanitarian mission extremely difficult to handle (2). einstein. 2011; 9(1 Pt 1):1-7

Einstein v9n1.indb 5

24.03.11 19:33:49


6

Steinman M, Gumera MS, Ferrett M, Almeida CI, Ioshimoto MTA, Gusman S, Cenderoglo M , Santos OFP, Kanamura AH, Lottenberg CL

Although we did not have previous experience in earthquakes, other previous accomplishments of HIAE facing epidemics (meningococcal meningitis in the 70’s and dengue in 2008) our philanthropic basis motivated us to respond to the disaster. A private organization of excellence that has a large skilled staff could provide a sustainable voluntary response in disasters. The cooperation with the local government and/or nongovernmental organizations was extremely important for the collaborative actions. The diagnosis of the situation associated to a continuous interchange of information with our headquarters in Brazil were essential to recruit, select and provide the specialty teams and the resources needed. To choose a workspace was a critical part of the mission and the following premises were taken into account in this regard: the assurance of the team’s safety, the need of a place for basic hygiene and rest, as well as a basic infrastructure with electricity, water and place to perform surgeries. For the aftershocks, a place without edifications was fundamental. In addition, the self-sufficiency in food and water is highly important in such situations of catastrophe (6). The chosen workspace was adequate because it was near the Dominican Republic border which made easier the arrival of teams and material resources, as the displacement to nearby sites in order to get supplies and food for the team. Besides being a broad place, there was a helipad that was eventually used for patient transfer. The initial period of evaluation provided information on most common diagnosis: trauma, open and closed fractures, lesions associated to body segments of medium and small complexity, post-operative patients transferred from hospitals in Jimani and Port-au-Prince, and other clinical situations not directly related to the earthquake. This period was extremely important to help to set up subsequent teams. The length of stay of the mission proposed by HIAE (40 days) involved different aspects of those habitually seen in the initial phases after massive disasters. The majority of patients in the camp were homeless (90%) and the tents became their home. The collapse of families, the endless number of homelesses and orphans characterized a common profile of the patients. Besides millions of deaths, the wounded people had single or multi-systemic lesions of diverse complexities that required a broad approach. In addition, emotional sequels started precociously. A multi-professional team can provide an efficient, prompt and coordinated care(3). To evaluate the quality of care in the first days of a disaster is not an easy job, considering a scenario of

huge catastrophe that lacks the necessary resources for orthopedic care l(7). Patients in the camp were real survivors. However, many procedures took place at the initial phases and required complementary treatment or revision. The absence or data scarcity on clinical diagnosis and treatment was quite common (Figure 8). When our team started this evaluation we did not have an X-ray machine, and many patients were submitted to a radiologic evaluation for the first time only three weeks after the earthquake.

Figure 8. Patient with a cast in the left leg over which descriptive data on the clinical course and management were written

It was not only a post-operative evaluation, as it required a re-screening of cases to separate patients according to additional procedures as needed, so we decided to classify care plainly as satisfactory and unsatisfactory. Probably, the number of orthopedic lesions not appropriately treated was higher than the satisfactory ones. However, in such an adverse situation and for the scarcity of available resources for surgical procedures, this management was the best way we have found to keep treatments going on. A subsequent analysis will be fundamental to evaluate the functional results. Among the challenges this catastrophe brought, delivering health care to the survivors was the most problematic situation (4,5). The complexity and variety of cases required different answers that had to consider not only the clinical aspects, but also the social, psychological and economical impacts. Indeed, a preview of demands allows the development of a working process which could be better accomplished in a cooperative way among the various professionals who were involved. A prompt response has a huge impact to the victim’s recovery after an earthquake. In addition, an efficient

einstein. 2011; 9(1 Pt 1):1-7

Einstein v9n1.indb 6

24.03.11 19:34:25


Haiti earthquake

emergency response requires the patient to be in the right place at the right time and in a catastrophic situation this is hard to achieve. Finally, we verified that demands and needs of patients after an earthquake may vary broadly day by day, which implies that the teams and the place for care delivery must have as maximum as possible flexibility and versatility. The medical priorities can change from actions to preserve life to procedures to save limbs of amputations or start rehabilitation, from a debridement to nursing care of wounds, from clinical treatment to psychological support. Therefore, we believe that the multi-professional approach constitutes the ultimate strategy to delivery care for victims after an earthquake.

7

Sandra Cristina Shiramizo; Tais Rodrigues de Lara; Tania Maria Russo Zamataro; William Abrão Saad Jr; Felipe Camilo Val; Coroacy dos Santos Jr; Débora Puntel; Fabio Jorge Racy; Graziele de Paula Jimenes; Gustavo Janot; Haggeas Fernandes; Jorge Luis Saraiva; Luiz Alexandre de Castro; Marcele Pesavento; Maria Paula Vilela; Michael Medeiros; Tatiana Castagnari; Adriana Ferreira; Adriana Marcos; Alexandre Marra; Arnaldo Felix; Daniela Takito; Eduardo Cordioli; Fabio Ferracini; Isaura Maria; Marcilio Mendonça; Marcio Damascena; Maria Beatriz Perondi; Mauro Ribas; Thais Caprera Carvalho; Waldenira Rocha.

REFERENCES 1. Gamulin A, Villiger Y, Hagon O. [Disaster medicine: mission in Haiti]. Rev Med Suisse. 2010;6(248):973-7.

ACKNOWLEDGES This paper would not be possible to accomplish without idealization, planning, collaboration and actions done by this huge team of Professional from Sociedade Beneficente Israelita Brasileira Albert Einstein (SBIBAE) whom we would like to acknowledge: Nelson Akamine; Luciana Guastelli; Wladimir Mendes Borges Filho; Alex Sandro Gomes; Dov Smaletz; Valdeci Alves Ferreira; Renato P. da Conceição; Patricia Sousa Machado; Ana Carolina Martins Pereira da Silva; Barbara de Oliveira Manoel; Carolina SantAnna Azevedo; Claudia Candido da Luz; Clesio Nepomuceno; Joper Fonseca Jr; Marcelo de Oliveira Anhê; Maria Christina M. A. Fleury; Maria Roza de Jesus S. Oliveira; Mariana Perroni de Oliveira; Reginaldo Rogerio de Campos; Ronildo Galdino Guimaraes; Rosana Ravagnani Campedelli;

2. Yang C, Wang HY, Zhong HJ, Zhou L, Jiang DM, Du DY, et al. The epidemiological analyses of trauma patients in Chongqing teaching hospitals following the Wenchuan earthquake. Injury. 2009;40(5):488-92. 3. Mulvey JM, Awan SU, Qadri AA, Maqsood MA. Profile of injuries arising from the 2005 Kashmir earthquake: the first 72 h. Injury. 2008;39(5): 554-60. 4. Jaffer AK, Campo RE, Gaski G, Reyes M, Gebhard R, Ginzburg E, et al. An Academic centers delivery of care after the Haitian earthquake. Ann Intern Med. 2010;153(4):262-5. 5. Babcock C, Baer C, Bayram JD, Chamberlain S, Chan JL, Galvin S, et al. Chicago medical response to the 2010 earthquake in Haiti: translating academic collaboration into direct humanitarian response. Disaster Med Public Health Prep. 2010;4(2):169-73. 6. Water and sanitation on health emergencies: the role of WHO to the earthquake in Haiti, 12 January 2010. Wkly Epidemiol Rec. 2010;85(36): 349-54. 7. Hirshberg A, Holcomb J, Mattox K. Hospital trauma care in multiple casualty incidents: A critical view. Ann Emerg Med. 2001;37(6):647-52.

einstein. 2011; 9(1 Pt 1):1-7

Einstein v9n1.indb 7

24.03.11 19:34:43


ORIGINAL ARTICLE

Impact of a program to promote health and quality of life of elderly Impacto de um programa de promoção da saúde na qualidade de vida do idoso Silvia Affini Borsoi Tamai1, Sergio Márcio Pacheco Paschoal1, Julio Litvoc2, Adriana Nunes Machado1, Pedro Kallas Curiati2, Luis Felipe Prada1, Wilson Jacob-Filho1

ABSTRACT Objective: To evaluate the effect on quality of life of elderly people enrolled in GAMIA – Multidisciplinary Care Group to Outpatient Elderly Subjects (Grupo de Assistência Multidisciplinar ao Idoso Ambulatorial) of the Geriatric Department, Hospital das Clinicas, Faculdade de Medicina, Universidade de Sao Paulo. Methods: Between 2000 and 2002, 83 elderly participants of GAMIA were assessed by the World Health Organization Quality of Life scale (WHOQOL-bref) at the beginning and the end of the program. Functionality was assessed by Katz and Lawton scales and sociodemographic data were obtained from medical charts. Results: Females predominated (79.5%) and overall mean age was 69.30 years. Data analysis showed a reduction in the physical domain of WHOQOL-bref (p = 0.014) and increased psychological health and environment domains (p = 0.029 and p = 0.007, respectively), detecting a trend of increase in social relationships and in general domains (p = 0.062 and p = 0.052, respectively). Conclusions: The clinical evaluation of the elderly detected previously unknown diseases and determination of the use of new drugs, which might have been the predominant factor for the deterioration of their perception in the physical domain. Improvement in psychological health and the environment can be related to psychological and social support that the elderly received from peers and professionals and the benefits of group activities, as well as the upward trend observed in social relationships and general domains. Participation in a program to promote healthy aging was effective in improving the quality of life of the elderly. Keywords: Aged; Quality of life; Health promotion; Questionnaires; Aging

RESUMO Objetivo: Avaliar os efeitos na qualidade de vida de idosos matriculados no Grupo de Assistência Multidisciplinar ao Idoso Ambulatorial (GAMIA) do Serviço de Geriatria do Hospital das Clínicas da Faculdade de Medicina da Universidade de São Paulo. Métodos: Nos 83 idosos participantes do grupo entre 2000 e 2002, a qualidade de vida foi avaliada pelo World

Health Organization Quality of Life (WHOQOL-bref) no início e no fim do programa. A funcionalidade foi avaliada pelas Escalas de Katz e Lawton e os dados sociodemográficos foram obtidos nos prontuários. Resultados: Houve predomínio do sexo feminino (79,5%) e a média geral de idade foi de 69,30 anos. A análise dos dados mostraram uma redução no domínio físico do WHOQOL-bref (p = 0,014) e a elevação dos domínios psicológico e meio ambiente (p = 0,029 e p = 0,007, respectivamente), detectando-se tendência de elevação nos domínios relações sociais e geral (p = 0,062 e p = 0,052, respectivamente). Conclusões: Como a avaliação clínica desses idosos revelou doenças desconhecidas previamente e determinou a utilização de novos medicamentos, a percepção que os idosos tinham, em relação à sua saúde, pode ter sido o fator preponderante para a piora no domínio físico. A melhora dos domínios psicológico e meio ambiente pode estar relacionada ao suporte psicológico e social que o idoso recebeu dos colegas e profissionais e dos benefícios das atividades em grupo, bem como às tendência de elevação observada nos domínios relações sociais e geral. A participação em um programa de promoção do envelhecimento saudável mostrou-se eficaz na melhora da qualidade de vida do idoso. Descritores: Idoso; Qualidade de vida; Promoção da saúde; Questionários; Envelhecimento

INTRODUCTION Live longer, but with quality: this is what most people who understand aging as a process and realize elderly age is a fact want to have, based on demographic studies that have suggested a 25-year increase in life expectancy for Brazilians in the past 50 years (1). As a result of the epidemiological transition that follows demographic transition, there has been a reduction in infectious and contagious diseases and an increase in prevalence of chronic non-communicable

Study carried out at Geriatriacs Outpatient Clinic, Hospital das Clínicas, Faculdade de Medicina, Universidade de São Paulo – USP, Sao Paulo (SP), Brazil. 1

Hospital das Clinicas, Faculdade de Medicina, Universidade de São Paulo – USP – São Paulo (SP), Brasil.

2

Faculdade de Medicina, Universidade de São Paulo – USP – São Paulo (SP), Brasil. Corresponding author: Silvia Affini Borsoi Tamai - Rua Dr Tirso Martins 100 - Conjunto 510 - Vila Mariana - CEP 04120-050 - São Paulo (SP), Brasil - Tel.: 11 5539-3417 - e-mail: silviatamai@hotmail.com Received: Jul 08, 2010 – Accepted: Jan 24, 2011 There is no conflict of interest.

einstein. 2011; 9(1 Pt 1):8-13

Einstein v9n1.indb 8

24.03.11 19:34:43


Impact of a program to promote health and quality of life of elderly

diseases, which has led to a greater proportion of elderly people with these diseases. In view of this picture, longevity provides an ambiguous situation experienced by many people (less for non-elderly people), which is the will to live longer and, at the same time, the fear to live with disability and dependence (2). Aware of this change and the importance of planning public policies for this population, professionals who work with aging have started to plan and to develop global actions that fostered health of the elderly within the perspective of health promotion. According to the Ottawa Charter for Health Promotion (3), “health promotion is the political and social process that encompasses not only actions to strengthen skills and capabilities, but also those directed to changing social, environmental and economic status, to attenuate the impact on public and individual health.” Ten years after the publication of the Ottawa Charter, the Fourth International Conference on Health Promotion was held in Jakarta. The Jakarta Declaration on Leading Health Promotion (4) reinforced the concept of health promotion and encouraged the participation of the community. The proposal was to train the population to lead and to access available health resources. Two years before the Ottawa Charter, the activities of GAMIA - Multidisciplinary Care Group to Outpatient Elderly Subjects of the Geriatrics Department, Hospital das Clinicas, Faculdade de Medicina, Universidade de Sao Paulo (FMUSP) were started, formed by a multidisciplinary team. At that time, the program creator, Prof Dr Wilson Jacob Filho, came up with the term senesculture (5) as being the “set of interdisciplinary

9

actions whose results contribute to promoting the health in the elderly”, a concept that was used to characterize the whole activities of this professional group. Therefore, o Grupo de Assistência Multidisciplinar ao Idoso Ambulatorial (GAMIA) structured a pioneer work at the time, designing group sessions for previously selected elderly subjects who would come to the Geriatric Outpatient Center weekly to perform activities that aimed to promote health and comprised medical visits, specialized guidance and physical, social and leisure activities. GAMIA is a group searching for knowledge about health. The activities are based on the fact that the elderly need to know about their health status and alternative treatment options and to be able to decide about their health (6). Providing instruments for the elderly to learn about their rights and duties means to develop citizenship and promote access to the integrated health model. Currently, the team counts on a group of professionals formed by nurses, pharmacists, physical therapists, physicians, psychologists, social workers and occupational therapists. GAMIA selects 30 elderly subjects to take part in the annual program based on a screening tool applied to those that are interested in participating, incorporating the following inclusion criteria: both sexes, age equal or over 60 years, independent locomotion, communication skills that enable group participation, and interest in and commitment to the program (7). The 30 selected elderly subjects are divided into two groups of 15 people and start to come to the Geriatric Outpatient Center every wednesday, from 8 am to 3 pm. All activities are in group, except for medical visits. The

Chart 1. Flowchart of activities of GAMIA in 2010 - Groups Yellow and Green TIME 8 am – 9 am 9 am – 10 am 10 am – 11 am 11 am – 12:30 pm 12:30 pm – 1:30 pm 1:30 pm – 3 pm

SEQUENCE A NUTRITION SOCIAL WORKER PHYSICAL THERAPY LUNCH NURSING OCCUPATIONAL THERAPY

MARCH Data 03 10 17 24 31

APRIL

YELLOW GREEN Introduction A B B A A B B A

Data 07 14 21 28

AUGUST Data 04 11 18 25

YELLOW B A B A

MAY

YELLOW GREEN A B B A Holiday A B

Data 05 12 19 26

SEPTEMBER GREEN A B A B

Data 01 8 15 22 29

YELLOW B A B A B

TIME 8 am – 9 am 9 am – 10 am 10 am – 11 am 11 am – 12 pm 12 pm – 1 pm 1 pm – 2 pm YELLOW GREEN B A A B Outing B A

JUNE Data 02 09 16 23 26 30

OCTOBER GREEN A B A B A

Data 01 06 13 20 27

YELLOW GREEN Elderly Day A B B A Outing A B

SEQUENCE B PHARMACY PHYSICAL THERAPY PSYCHOLOGY LUCH OCCUPATIONAL THERAPY MEDICAL APPOINTMENT JULY

YELLOW GREEN A B B A A B B A Folk Party A B

Data YELLOW GREEN 07 B A 14 A B 17 GAMIA anniversary day 21 and 28 - Vacations

NOVEMBER Data 03 10 17 24

YELLOW B A B A

DECEMBER GREEN A B A B

Data 01 11

YELLOW GREEN AGG Christmas Party

einstein. 2011; 9(1 Pt 1):8-13

Einstein v9n1.indb 9

24.03.11 19:34:44


10

Tamai SAB, Paschoal SMP, Litvoc J, Machado AN, Curiati PK, Prada LF, Jacob-Filho W

two groups happen concomitantly on wednesdays. The areas of physical therapy and occupational therapy see the groups on a weekly basis and the other areas take turns in each group every fifteen days. A sample of the scheduled activities can be seen in Chart 1. The elderly take part in social and leisure activities together with the elderly subjects in the Post-GAMIA group, formed by elderly subjects who had participated in GAMIA before, including sight visiting, parties and trade fairs. Since 2002, the elderly have been editing the GAMIA News, of which committee is formed by elderly from GAMIA, Post-GAMIA and the social worker. The objective of this activity is to stimulate and provide the opportunity for the elderly to participate, while the professional works as facilitator and collaborator. GAMIA News is an open space for interviews, articles on prevention and health, topics related to the elderly, hints, recipes, jokes, news about the groups; in other words, a vehicle for participation. Thinking about aging as a positive experience shows the position that the World Health Organization (WHO) calls active aging (8): “the process of optimizing healthcare opportunities, participation and safety, to improve quality of life as people get older”. Quality of life should be understood (9) as “the perception that the subject has about life within the context of culture and the value system where he lives and in relation to his objectives, expectations, standards and concerns”.

OBJECTIVE The purpose of the present study was to check whether there had been any changes to quality of life of the elderly who participated in GAMIA. METHODS The study was carried out at the Geriatric Outpatient Center, Hospital das Clinicas, FMUSP, with elderly patients who took part in GAMIA program during the years 2000, 2001 and 2002. There were 83 people observed for one-year follow-up using the quality of life tool World Health Organization Quality Of Life (WHOQOL-bref), applied at the beginning and at the end of the program. The study was concluded with 83 out of 90 people with two completed assessments. The selected tool, the WHOQOL-bref, is an abbreviated version of WHOQOL-100, both validated for the Brazilian population (10, 12). WHOQOL-Bref comprises the 26 best questions in the psychometric performance, covering four specific domains (physical, psychological, social relations and environment) and one general domain. This tool was developed by the WHO in a multicenter study, based on the assumption that quality of life is a multidimensional subjective construction (perception

of the subject) and comprises positive elements (such as mobility) and negative elements (pain) (13). Social demographic data were extracted from a questionnaire designed by the author and by information included in the patient charts. To measure the indexes that assessed daily living activities we used Katz Basic Activities of Daily Living (ADL) and Instrumental Activities of Daily Living (IADL) by Lawton. Katz scale assesses basic ADL (14,15). The activities are divided into items such as showering, eating, personal hygiene, getting dressed, movement and continence. The total score is determined by the sum of affirmative answers and a maximum of six points means full independence for basic ADLs. Lawton scale assesses instrumental activities of daily living (16). The activities are divided into using the phone, going to distant places, going shopping, preparing the meals, cleaning the house, doing domestic errands, washing and ironing the clothes, taking medication, and taking care of money. For each question, the first answer means independence, the second one means the person can do it with help, and the third one is dependence. The maximum score is 27 points and the score is meaningful only to the individual patient, serving as a basis for progressive comparisons. To meet the objectives of the study, we used differences in quality of life of WHOQOL domains using matched Wilcoxon tests (17) and the differences were calculated for each domain (final – baseline). The normal distribution of differences in domains was tested using KolmogorovSmirnov test (17), which accepts the assumption of data distribution normal range (p > 0.05). The tests were carried out with a significance level smaller than 5%. The study was approved by the Ethics Committee for Research Projects (CAPPesq), Clinical Director, Hospital das Clinicas, Universidade de Sao Paulo, and the informed consent term was signed by all participants.

RESULTS Out of 83 subjects, 79.5% were female and 20.5% were male and the mean age was 69.30 years. Katz scale showed that all elderly subjects obtained maximum score, whereas in Lawton scale, 92.8% obtained maximum score (Table 1). Table 1. Description of activities of daily living scores Scale KATZ LAWTON

N 83 1 2 3 77

Score 6 24 25 26 27

% 100 1.2 2.4 3.6 92.8

einstein. 2011; 9(1 Pt 1):8-13

Einstein v9n1.indb 10

24.03.11 19:34:45


Impact of a program to promote health and quality of life of elderly

11

Table 2. Description of quality of life scores at baseline and end of the program and result of comparison of the two timeframes Domain Physical Psychological Social relations Environment General

Time Baseline One year Baseline One year Baseline One year Baseline One year Baseline One year

Mean 71.08 68.46 66.41 70.08 65.75 69.07 58.04 62.16 63.86 67.62

SD 16.31 15.76 15.65 13.00 16.36 14.52 15.87 12.62 16.68 15.38

Median 75.0 67.9 66.7 70.8 66.7 75.0 56.3 62.5 62.5 75.0

Minimum 28.6 32.1 29.2 41.7 25.0 25.0 25.0 34.4 25.0 25.0

Maximum 100.0 100.0 100.0 100.0 100.0 100.0 93.8 96.9 100.0 100.0

N 83 83 82 83 82 83 82 83 83 83

p value 0.014 0.029 0.062 0.007 0.052

SD: Standard deviation.

Table 2 shows that people participating in GAMIA program had statistically significant reduction in physical domain (p = 0.014) and improved psychological and environment domains (p = 0.029 and p = 0.007, respectively). Social relations and general domains showed improvement trends.

DISCUSSION Considering the selection criteria, participants in GAMIA program were characterized as being independent elderly subjects in relation to daily living activities and they were cognitively preserved, showing full autonomy. Kalache et al.(18) observed that the maintenance of autonomy was closely related with quality of life and a way to quantify this variable would be the level of autonomy with which the subject performed his everyday activities, making him independent in his cultural and social economic context. In practice, an appropriate way to measure these characteristics would be the performance of daily living activities. Physical domain assesses the aspects related with pain and discomfort, energy and fatigue, sleep and rest, daily living activities, dependency on medication or treatment, in addition to capacity to work. The decrease observed in scores of physical domain may be related with the perception the elderly acquired of their health status owing to the discovery and the awareness of new diagnoses, and consequently, of the need for new treatments. However, it is not indicative that their health status had worsened in the period. A study by Xavier et al.(19) showed that elderly subjects dissatisfied with their quality of life had more health problems according to the Cumulative Illness Rating Scale (CIRS) and more depressive symptoms when assessed by the Geriatric Depression Scale (GDS); the reason for this dissatisfaction was lack of physical health. It was concluded that the concept of negative quality of life would be equivalent to loss

of health, whereas the concept of positive quality of life would be equivalent to a multitude of categories, such as activity, income, social life and relationship with the family, categories that varied from subject to subject. The revision by Fortin et al.(20) showed that there is an inverse relation between multiple morbidities and quality of life, observed also in the study by Miranda et al.(21). In both studies, people had stabilized chronic diseases, did not show functional limitations, pain or complications. Data suggested that the patients with this profile, when aware of their real health status, changed their perception in relation to physical health and, consequently, their assessment of quality of life. Owing to multidisciplinary care, the elderly have learned that there are other approaches, such as healthy nutrition, physical activities, care with the health, psychotherapy, and occupational therapy, that work as a powerful support to medical treatment. Non-medication approaches require the adoption of new habits and behavioral changes, modifying their routines. These changes may be difficult because they depend on compliance of the elderly and the multidisciplinary team plays a key role in this aspect. The psychological domain assesses the aspects related with positive and negative feelings, thinking, learning, memory and concentration, self-esteem, body image and appearance, spirituality/religiousness/ personal beliefs. The improvement observed in this domain may be related with many different factors. Upon joining GAMIA, the elderly feel welcome owing to the support that the group work provides and the feeling that there are professionals available and interested in helping them address different aspects related with aging. There is also the possibility of making new friends, contributing to self-esteem and positive feelings related with aging. The dynamics resulting from the multidisciplinary care enhanced the relationship between the professional team and collaborated to make the elderly subjects einstein. 2011; 9(1 Pt 1):8-13

Einstein v9n1.indb 11

24.03.11 19:34:46


12

Tamai SAB, Paschoal SMP, Litvoc J, Machado AN, Curiati PK, Prada LF, Jacob-Filho W

change their concepts and behaviors in relation to the aging process and their condition as old people. Similarly, group sessions also influence the environment domain, which assesses the aspects related with physical safety and protection, home environment, financial resources, health and social care (availability and quality), opportunities to acquire new information and skills, participation/opportunities of recreation/ leisure, physical environment (pollution/noise/traffic/ weather) and transportation. The commitment to participate periodically in GAMIA program activities made the elderly realize the importance of having time for themselves. Knowledge and the perception of these flaws provided adaptive and strengthening responses, capable of maximizing the performance of the elderly in their social world and providing active and acting permanence in it (22). The elderly share their own perceptions and the perceptions of others, which may expand their family, friend and social relationships (22). The domain of social relations assesses the aspects concerning personal relations, social support and sexual activity. It is believed that the improvement trend observed in this domain resulted from greater perception of the elderly concerning their possibility of articulation and affective relationships acquired by the group activities, a fundamental support of GAMIA program. The literature (23-25) points to a key issue observed in personal relations in large cities. Factors such as high demographic density, heterogeneity of the population, poor security and adaptation of public spaces do not stimulate personal and social growth of their members, because they hinder interaction and leisure opportunities. It is difficult to organize spaces where the elderly can practice citizenship and interaction, encouraging their social participation. Therefore, group activities contribute to the performance of new roles and the readaptation of others that had been abandoned throughout life. According to Lima and Pasetchny(23), difficulties in interpersonal and social interactions in large cities, associated with lack of public spaces and increase in number of elderly subjects, require the creation of elderly groups because they support social inclusion of the elderly. Similarly, in the general domain, which refers to selfperception of quality of life and level of satisfaction with health, it is believed that the improvement trend was owed to better knowledge of their skills and capabilities, but in agreement with the recently acquired awareness

of diseases and limitations, resulting from the accurate process of global geriatric assessment. The longitudinal study carried out by Rudinger and Thomae (apud Neri)(26) provided valuable information about adjustment and satisfaction in elderly life, emphasizing that the perceived health and the way people handle their health problems were more predictive than objective health conditions, assessed according to medical parameters. The fact that elderly subjects were referred to GAMIA screening program by former GAMIA elderly subjects, dispensing communication efforts by the Geriatric Department, shows the positive influence of the program on the elderly routine, which started to play a role as multiplying agent. Post-GAMIA elderly patients want their family members, neighbors and friends to benefit as much as they have. According to Melo et al.(27), in any healthcare system, no action plan shall be designed without taking into account the assumptions of the educative planning. The WHO states that the objective of health education is to develop in people the notion of responsibility for their own health and for the health of the community they belong, and the capacity to take part in the community life in a constructive fashion. These assumptions transform health education into one of the most important links between wishes and expectations of the population for a better life, in addition to projections and estimates of government authorities when providing more efficient health programs (28). The group work with elderly serves as a tool to autonomy and continuous development of health and life conditions, promoting the health of elderly subjects (27). The care model proposed by the professional team at GAMIA may be reproduced in the public health network, because its structure is simple and low cost, considering that it has worked for 26 years in the Geriatric Center, at Hospital das Clinicas, FMUSP. Therefore, actions directed to promoting healthy aging break with the elderly care paradigm, which has focused primarily on symptomatic management of diseases. We believe in the importance of models that allow aging people to take active roles in the construction of their future, concepts that have been well synthesized by Litvoc and Brito (29), highlighting that prevention and health promotion actions that include the measures referring to diseases and aspects of social and cultural wellbeing are essential for the elderly with preserved functional capability, as well as for those already disabled. In the case of elderly subjects with preserved function, these actions are necessary to maintain intact functional status.

einstein. 2011; 9(1 Pt 1):8-13

Einstein v9n1.indb 12

24.03.11 19:34:46


Impact of a program to promote health and quality of life of elderly

CONCLUSION Even though the literature relates the importance of physical health in the development of good quality of life in the elderly, this study has shown that despite the decrease in physical domain scores, the elderly had improvement in quality of life owing to the development of psychological, social and environmental support. REFERENCES 1. Ramos LR. Epidemiologia do Envelhecimento. In: Freitas EV, PY L, Cançado FAX, Gorzoni ML. Tratado de geriatria e gerontologia. Rio de Janeiro: Guanabara Koogan; 2002. p.72. 2. Paschoal SMP. Qualidade de vida na velhice. In: Freitas EV, PY L, Cançado FAX, Gorzoni ML. Tratado de geriatria e gerontologia. Rio de Janeiro: Guanabara Koogan; 2002. p.79. 3. World Health Organization (WHO). The Otawa Charter for Health Promotion, 17-21 November 1986. 4. World Health Organization (WHO). Jacarta Declaration on Leading Health Promotion into the 21 st century, 21-25 July, 1997.

13

12. Fleck MPA. O instrumento de avaliação de qualidade de vida da Organização Mundial da Saúde (WHOQOL-100): características e perspectivas. Ciência e Saúde Coletiva. 2000;5(1):33-8. 13. Minayo MCS, Hartz ZMA, Buss PM. Qualidade de vida: um debate necessário. Ciência e Saúde Coletiva. 2000;5(1):7-18. 14. Katz S, Akpomk CA. A measure of primary sociobiological functions. Int J Health Serv. 1976;6(3):493-508. 15. Katz S, Ford AB, Moskowitz RW, Jackson BA, Jaffee MW. Studies of ilness in the aged. The Index of ADL: a standardized measure of biological and psychosocial function. JAMA. 1963;185:914-9. 16. Lawton MP, Brody EM. Assessment of older people: Self maintaining and instrumental activities of daily living. Gerontologist. 1969;9: 179-86. 17. Conover W J . Practical nonparametric statistics. New York, Wiley, 1980. 18. Kalache A, Veras RP, Ramos LR. O envelhecimento da população mundial. Um desafio novo. Rev Saúde Públ. 1987;21(3):200-10. 19. Xavier FMF, Ferraz MPT, Marc N, Escosteguy NU, Moriguchi EH. Elderly peoples definition of quality of life. Rev Bras Psiquiat. 2003;25(1):37-49. 20. Fortin M, Lapoint L, Hudon C, Vanasse A, Ntetu ATL, Maltais D. Multimorbidity and quality of life in primary care: a systematic review. Health Qual Life Outcomes. 2004;2:51.

5. Jacob-Filho W. Promoção da saúde do idoso. São Paulo: Lemos; 1998.

21. Miranda de Nóbrega TC, Jaluul O, Machado AN, Paschoal SMP, Jacob Filho W. Quality of life and multimorbidity of elderly outpatients. Clinics. 2009;64(1): 45-50.

6. Viude A. Atividade de fonoaudiologia. In: Jacob-Filho W. Prática a caminho da senecultura – Grupo de Assistência Multidisciplinar ao Idoso Ambulatorial, GAMIA. São Paulo, Atheneu, 2003. p.49.

22. Izzo H. Atividade de fisioterapia. In: Jacob-Filho W. Prática a caminho da senecultura – Grupo de Assistência Multidisciplinar ao Idoso Ambulatorial, GAMIA. São Paulo: Atheneu; 2003.

7. Jacob-FIlho W. Prática a caminho da senecultura – Grupo de Assistência Multidisciplinar ao Idoso Ambulatorial, GAMIA. São Paulo: Atheneu; 2003.

23. Lima LJC, Pasetchny. Atividades em grupo: uma alternativa para inclusão social na terceira idade. Rev Ter Ocup Univ São Paulo. 1998;9(1):37-42.

8. World Health Organization (WHO). Active Ageing. A Policy Framework. Madrid, Spain, 2002.

24. Schicchi MC. A arquitetura e os idosos: considerações para elaboração de projetos. SESC. 2000;xi(19):63-79.

9. The WHOQOL Group. The World Health Organization Quality of Life assessment (WHOQUOL): position paper from the World Health Organization. Soc Sci Med. 1995;10(41):1403-9.

25. Rolnik R. A cidade e o idoso. SESC. 1998:X(14):45-50.

10. Fleck MPA, Chachamovich E, Louzada S, Pinzon V, Vieira G. Aplicação da versão em português do instrumento de avaliação de qualidade de vida da Organização Mundial de Saúde (WHOQOL – 100). Rev Saúde Púb. 1999;33(2): 198-205.

27. Melo MC, Souza AL, Leandro EL, Mauricio HA, Silva ID, Oliveira JMO. A educação em saúde como agente promotor da qualidade de vida para o idoso. Ciência e Saúde Coletiva. 2009;14(Supl.1):1579-86.

11. Fleck MPA, Louzada S, Chachamovich E, Vieira G, Santos L, Pinzon V. Aplicação da versão em português do instrumento abreviado de avaliação de qualidade de vida “WHOQOL-Bref”. Rev. Saúde Públ. 2000;34(1)0: 178-83.

26. Neri AL. Qualidade de vida e idade madura. Campinas: Papirus; 1993.

28. Levy SN, Silva JJC, Cardoso IFR, Werberich PM, Moreira LLS, Montiani H, et al. Educação em saúde: histórico, conceitos e propostas. Brasília, DF: Ministério da Saúde, 1997. 29. Litvoc J, Brito C. Prevenção e promoção da saúde. São Paulo: Atheneu; 2004.

einstein. 2011; 9(1 Pt 1):8-13

Einstein v9n1.indb 13

24.03.11 19:34:47


ORIGINAL ARTICLE

Impact of screening and monitoring of capillary blood glucose in the detection of hyperglycemia and hypoglycemia in non-critical inpatients Impacto do rastreamento e monitoramento de glicemia capilar na detecção de hiperglicemia e hipoglicemia em pacientes não graves internados Rogerio Silicani Ribeiro 1, Ricardo Botticini Peres 1, Magda Tiemi Yamamoto 1, Ana Paula Novaes 1, Claudia Regina Laselva 1, Adriana Caschera Leme Faulhaber 1, Miguel Cendoroglo Neto 1, Simão Augusto Lottenberg 1, Jairo Tabacow Hidal 1 Jose Antonio Maluf de Carvalho 1

ABSTRACT Objective: To evaluate the impact of screening hyper and hypoglycemia measured by capillary glycemia and standard monitorization of hyperglycemic patients hospitalized in regular care units of Hospital Israelita Albert Einstein. Methods: The capillary glycemia was measured by the Precision PCx (Abbott) glucosimeter, using the PrecisionWeb (Abbott) software. The detection of hyper and hypoglycemia during the months of May/June were compared to those of March/April in 2009 and to the frequency of the diagnosis of diabetes in 2007. Results: There was an increase in the glycemia screening from 27.7 to 77.5% of hospitalized patients (p < 0.001), of hyperglycemia detection (from 9.3 to 12.2%; p < 0.001) and of hypoglycemia (from 1.5 to 3.3%; p < 0.001) during the months of May/June 2009. According to this action 14 patients for each additional case of hyperglycemia and 26 cases for each case of hypoglycemia were identified. The detection of hyperglycemia was significantly higher (p < 0.001) than the frequency of registered diagnosis related do diabetes in the year of 2007. Conclusions: the adoption of an institutional program of glycemia monitorization improves the detection of hyper and hypoglycemia and glycemia control in hospitalized patients in regular care units. Keywords: Blood glucose/diagnosis; Hyperglycemia/diagnosis; Hypoglycemia/diagnosis; Inpatients

RESUMO Objetivo: Analisar o impacto do rastreamento de hiper e hipoglicemia mensurada por glicemia capilar e da monitorização padronizada em pacientes hiperglicêmicos internados em unidades não graves do Hospital Israelita Albert Einstein. Métodos: A glicemia capilar foi mensurada com glucosímetro Precision PCx (Abbott), rastreada com

software PrecisionWeb (Abbott). A detecção de hiper e hipoglicemia no bimestre Maio/Junho foi comparada ao bimestre Março/Abril de 2009 e ainda quanto à frequência de diagnósticos relacionados ao diabetes no ano de 2007. Resultados: Houve um aumento do rastreamento de glicemia de 27,7 para 77,5% dos pacientes internados (p < 0,001), na detecção de hiperglicemia (de 9,3 para 12,2%; p < 0,001) e de hipoglicemia (de 1,5 para 3,3%; p < 0,001) no bimestre Maio-Junho de 2009. Com essa iniciativa, foram rastreados 14 pacientes para cada caso adicional de hiperglicemia e 26 pacientes para cada caso de hipoglicemia. A detecção de hiperglicemia foi significantemente maior (p < 0,001) que a frequência de registros de diagnósticos relacionados ao diabetes no ano de 2007. Conclusões: a adoção de um programa institucional de monitoramento de glicemia melhora a detecção de hiper e hipoglicemia e o controle de glicemia em pacientes internados em unidades não graves. Descritores: Glicemia/diagnóstico; Hiperglicemia/diagnóstico; Hipoglicemia/diagnóstico; Pacientes internados

INTRODUCTION Diabetes is a disease of growing prevalence all over the world(1). Population data of cities in São Paulo State indicate an increase prevalence of diabetes in the region, estimated to be approximately 12%(2). In its initial stage, diabetes is frequently asymptomatic, and it is generally diagnosed through routine tests. Considering the low compliance to screening tests in the population, about half of the individuals affected are not aware of their diagnosis(3). In hospitals, the prevalence of diabetes is higher than in the overall population, accounting for

Study carried out at Centro de Medicina Preventiva do Hospital Israelita Albert Einstein – HIAE, São Paulo (SP), Brazil. 1

Hospital Israelita Albert Einstein – HIAE – São Paulo (SP), Brazil.

Corresponding author: Rogerio Silicani Ribeiro – Rua Mediterrâneo, 590, sala 63 – Jardim do Mar – CEP 09750-420 – São Bernardo (SP), Brasil – Tel.: (11) 4121-2913 – e-mail: rribeiro@einstein.br The authors declare there is no conflict of interest. Received on Aug 1, 2010 – Accepted on Dec 20, 2010

einstein. 2011; 9(1 Pt 1):14-7

Einstein v9n1.indb 14

24.03.11 19:34:48


Impact of screening and monitoring of capillary blood glucose in the detection of hyperglycemia and hypoglycemia in non-critical inpatients

25 to 35% of inpatients(4,5). The prevalence is greater in high complexity units, varying between 10 and 12% in non-intensive units up to about 50% in intensive care units(5). The higher prevalence can be explained by the association between diabetes and cardiovascular, metabolic and infectious complications that require hospitalization for treatment. Of the diabetic patients hospitalized, 4 to 10% do not know the diagnosis(5,6). Despite the high prevalence, the diagnosis of diabetes is frequently omitted in the admission records, clinical progression reports and in hospital discharge summaries(5-7). Additionally, transient blood glucose abnormalities associated to stress may occur in up to 12% of individuals with no past history of diabetes(8). The presence of hyperglycemia due to diabetes or triggered by stress has a negative influence in the clinical course of patients admitted for any other reason. Every rise by 50 mg/dL in an inpatient increases perioperative mortality in non-cardiac and non-vascular surgeries by 52%, increases four times the risk of complications (renal failure, sepsis and death) in patients receiving parenteral nutrition, makes hospital stays 0.76 day longer and rises the cost by US$ 1,769.00 in those undergoing revascularization. On the other hand, the treatment of hyperglycemia in inpatients is facilitated by nursing continued care and it can reduce the incidence of complications and mortality(4,9-11). Hypoglycemia has been recently associated with higher hospital mortality both in critical and noncritical patients(12-14). Given the variety of symptoms associated to hypoglycemia and the presence of several comorbidities that cause symptoms in patients, blood glucose monitoring is fundamental in the diagnosis and treatment of hypoglycemia. Treatment of hypoglycemia requires oral administration of glucose in conscious patients (majority of cases) or intravenous administration in unconscious patients(14). Glucose can be assessed in plasma or through capillary blood glucose test devices at the bedside complying with quality controls necessary for reliable measurements. According to recommendations and guidelines, blood glucose values in inpatients should not be higher than 180 mg/dL or lower than 60 mg/dL. The assistance of professionals trained in diabetes care, nutritional orientations and the use of standardized insulin therapy regimens lead to efficient and safe control of hyper and hypoglycemia and the costs of treatment are lower than those of complications(14). Considering the high frequency of blood glucose abnormalities in inpatients, the asymptomatic character of the condition and the patientâ&#x20AC;&#x2122;s lack of knowledge about hyperglycemia or diabetes, underreport of diabetes in medical charts, the influence of hyperglycemia in morbidity/mortality of inpatients, the availability of

15

diagnostic test with well defined normalcy limits and of treatment, screening of the glucose abnormalities by means of capillary blood glucose could be an interesting improvement in quality of care, thus reducing duration and cost of hospitalization(14). As from May 2009, the nursing coordinator and the medical director of Hospital Israelita Albert Einstein (HIAE) standardized the screening of glucose abnormalities in all inpatients and monitoring of blood glucose in four periods (before main meals and at 9:00 pm) in patients with abnormal glucose levels.

OBJECTIVE To assess the impact of screening and monitoring of capillary blood glucose in diagnosis of hyper and hypoglycemia in patients at non-severe units. METHODS To evaluate the detection of diabetes at the HIAE, the medical charts of patients admitted between 2002 and 2007 were analyzed; a patient was considered diabetic if he or she had a record of diagnosis of the condition, complications due to diabetes (neuropathy or retinopathy), gestational diabetes according to the international classification of diseases (ICD-10) and prescription of insulin. To evaluate the impact of blood glucose screening, the data of capillary blood glucose of all patients admitted to the Internal Medicine-Surgery units at HIAE, where non-critical patients were considered, from March 1st to June 30, 2009, a period during which the screening of capillary blood glucose was implemented. Patients were identified from their medical chart number during capillary blood glucose test. Those who did not undergo capillary blood glucose test were identified through discharge summary data provided by the hospital management system. Capillary blood glucose was measured using a glucometer (Precision PCx (AbbottÂŽ). The quality control of this device is performed based on the coefficient of variation of measures in control solutions of standardized high and low concentrations of glucose, and is done every 24 hours. All glucose measurements were sent to the software PrecisionWeb by synchronization units (dock stations) at the admission units, allowing reports organized by patient, site of admission and blood glucose ranges. The occurrence of hyperglycemia was defined as the measurement of at least one capillary blood glucose â&#x2030;Ľ 200 mg/dL, regardless of fasting status or after a meal anytime during hospital stay. In outpatients, one measurement of plasma glucose higher than 200 mg/ einstein. 2011; 9(1 Pt 1):14-7

Einstein v9n1.indb 15

24.03.11 19:34:48


16

Ribeiro RS, Peres RB, Yamamoto MT, Novaes AP, Laselva CR, Faulhaber ACL, Cendoroglo Neto M , Lottenberg SA, Hidal JT, Carvalho JAM

dL allows diagnosis of diabetes(14). The detection of hyperglycemia was defined as the ratio between the total number of charts and the respective blood glucose abnormality during admission and the total number of patients discharged during this period according to the following formula. Analysis of hypoglycemia used the same principles of hyperglycemia, and hypoglycemia was defined as capillary blood glucose ≤ 60 mg/dL. Detection of hyperglycemia = (total number of medical charts with hyperglycemia) / total number of medical charts of patients discharged during this period The software Excel (Microsoft) was used for descriptive analysis of data, and GraphPad (Prism) software for statistical analysis.

RESULTS According to the analysis of recording diagnosis of diabetes and related complications in the medical charts, there was a significant increase in notification in patients hospitalized between 2002 and 2007, as described in table 1. Table 1. Estimated frequency of diabetes according to patients’ records at hospital admission, follow-up and discharge 2002 Register of diabetes 977 Total of inpatients 30,687 Estimated frequency (%) 3.2

2003 1,028 32,346 3.2

2004 1,175 33,985 3.5

2005 1,172 35,246 3.3

2006 1,398 35,454 3.9

2007 2,344 35,224 6.7

According to the analysis of occurrence of hyper and hypoglycemia, a total of 8,365 patients were admitted to the Internal Medicine-Surgery units at HIAE from March to June 2009, of which 4,490 (53.7%) underwent capillary blood glucose measurement. In that, 907 presented hyperglycemia (10.8% of inpatients) and 206 had hypoglycemia (2.4% of inpatients). As described in table 2, before standardization of blood glucose screening and monitoring, in March/April 2009, capillary blood glucose was measured in 1,115 out of 4,014 inpatients (27%), of which 373 presented hyperglycemia and 60 presented hypoglycemia. After starting screening and monitoring, in May/June 2009, capillary blood glucose was measured in 3,375 out of 4,350 inpatients (77.5%). A total of 535 patients were identified with hyperglycemia (12.3% of inpatients) and 146 with hypoglycemia (3.4% of inpatients). The increased blood glucose screening of inpatients was associated to a significant rise in detection of hyperglycemia by 32% (160 additional cases diagnosed) as well as in the detection of hypoglycemia by 124%

(86 additional cases). For each additional case of hyper and hypoglycemia detected, 14 and 26 more patients, respectively, were screened as compared to the previous bimester. The detection of hyperglycemia was significantly higher (p < 0.001) than the frequency of records of diagnoses related to diabetes in the last year of analysis (2007). Table 2. Descriptive and comparative analysis of screened inpatients and detection of hyper or hypoglycemia from March to June 2009 Screening Screening coverage – screened/inpatients (%) Hyperglycemia** – patients (%) Hypoglycemia** – patients (%) Proportion hypo/hyper

March/April 1,115/4,014 (27.7) 373 (9.3) 60 (1.5) 1/6.2

May/June 3,375/4,350 (77.5) 534 (12.2) 146 (3.3) 1/3.6

p value* < 0.001 < 0.001 < 0.001 < 0.01

* χ2 test; ** frequency in relation to total of inpatients.

DISCUSSION In this study, standardization of screening and monitoring in four periods increased the detection of hyper and hypoglycemia in patients admitted to non-severe units. The frequency of blood glucose abnormalities was significantly higher than the proportion of patients diagnosed with diabetes, with complications associated to diabetes or with insulin prescription recorded in previous years in inpatients at all admission units of HIAE. Screening of diabetes has been indicated to individuals with some risk factors, such as age over 45 years, overweight or high blood pressure – population subgroups with diabetes prevalence around 35%. Screening of individuals with risk factors for diabetes increases the sensitivity and specificity of the exams and reduces the number of individuals to be screened in each case found, thus diminishing costs. In the population aged over 45 years and hypertensive, it is necessary to screen between 13 and 48 individuals (median age group = 22.7 individuals) to identify one person with diabetes. In patients admitted to non-severe units, 14 additional individuals were screened compared to the previous bimester to identify an individual with hyperglycemia(14-18). In population groups at risk for diabetes, the costeffectiveness of screening is favorable even taking into account the long-term use of monitoring supplies and medications to prevent later outcomes, and the benefit of screening has been demonstrated(14-18). Although there are no cost-effectiveness analyses of screening at the hospital, it is known that up to half of the expenses in patients with diabetes occur in hospital admissions and the protocols of blood glucose control reduce the chance of complications and mortality with favorable cost-effectiveness ratio(4). Even with this data, analyses of cost-effectiveness of the blood glucose screening

einstein. 2011; 9(1 Pt 1):14-7

Einstein v9n1.indb 16

24.03.11 19:34:49


Impact of screening and monitoring of capillary blood glucose in the detection of hyperglycemia and hypoglycemia in non-critical inpatients

are necessary for better understanding of the role of screening in the hospital setting. Although most studies are focused on the influence of hyperglycemia in hospitalization outcomes, hypoglycemia is also associated to increased morbidity and mortality, both in patients at intensive care units and in lower complexity units(12-14). Hypoglycemia generally occurs in individuals receiving oral medication or insulin to control hyperglycemia and it can be asymptomatic or manifest with unspecific symptoms. In this study, an increased detection of hypoglycemia was observed, which may be caused by greater use of oral hypoglycemic agents and insulin; however, since the increased proportion of cases of hypoglycemia was significantly higher than the rise in cases of hyperglycemia, this is probably due to the higher frequency of blood glucose monitoring in inpatients.

CONCLUSION Screening of blood glucose in all patients upon admission and blood glucose monitoring at four periods lead to a significant increase in the detection of patients with hyper and hypoglycemia, which are frequently underdiagnosed conditions that influence the clinical course of inpatients in an unfavorable manner. REFERENCES 1. International Diabetes Federation. Global Burden: Prevalence and Projections, 2010 and 2030. Diabetes Atlas. [cited 2010 Jul 28]. Available from: http:// www.diabetesatlas.org/content/diabetes-and-impaired-glucose-tolerance 2. Bosi PL, Carvalho AM, Contrera D, Casale G, Pereira MA, Gronner MF, et al. Prevalência de diabetes melito e tolerância à glicose diminuída na população urbana de 30 a 79 anos da cidade de São Carlos, São Paulo. Arq Bras Endocrinol Metab. 2009;53(6):726-32. 3. Malerbi DA, Franco LJ. Multicenter Study of the Prevalence of Diabetes Mellitus and Impaired Glucose Tolerance in the Urban Brazilian Population Aged 30-69yr. The Brazilian Cooperative Group on the Study of Diabetes Prevalence. Diabetes Care. 1992;15(11):1509-16.

17

4. Moghissi ES, Korytkowski MT, DiNardo M, Einhorn D, Hellman R, Hirsch IB, Inzucchi SE, Ismail-Beigi F, Kirkman MS, Umpierrez GE; American Association of Clinical Endocrinologists; American Diabetes Association. American Association of Clinical Endocrinologists and American Diabetes Association consensus statement on inpatient glycemic control. Endocr Pract. 2009;15(4):353-69. 5. Wexler DJ, Nathan DM, Grant RW, Regan S, Van Leuvan AL, Cagliero E. Prevalence of elevated hemoglobin A1c among patients admitted to the hospital without a diagnosis of diabetes. J Clin Endocrinol Metab. 2008;93(11):423844. 6. Lisbôa HRK, Souilljee M, Cruz CS, Zoletti L, Gobbato DO. Prevalência de hiperglicemia não diagnosticada nos pacientes internados nos hospitais de Passo Fundo, RS. Arq Bras Endocrinol Metab. 2000;44(3):220-6. 7. Carral F, Olveira G, Aguilar M, Ortego J, Gavilán I, Doménech I, et al. Hospital discharge records under-report the prevalence of diabetes in inpatients. Diabetes Res Clin Pract. 2003;59(2):145-51. 8. Umpierrez GE, Isaacs SD, Bazargan N, You X, Thaler LM, Kitabchi AE. Hyperglycemia: an independent marker of in-hospital mortality in patients with undiagnosed diabetes. J Clin Endocrinol Metab. 2002;87(3):978-82. 9. Thompson CL, Dunn KC, Menon MC, Kearns LE, Braithwaite SS. Hyperglycemia in the hospital. Diabetes Spectrum. 2005;18:20-7 10. Cheung NW, Napier B, Zaccaria C, Fletcher JP. Hyperglycemia Is Associated with adverse outcomes in patients receiving total parenteral nutrition. Diabetes Care. 2005;28(10);2367-71. 11. McAlister FA, Man J, Bistritz L, Amad H, Tandom P. Diabetes and coronary artery bypass surgery. Diabetes Care. 2003;26(5)1518-24. 12. Turchin A, Matheny ME, Shubina M, Scanlon JV, Greenwood B, Pendergrass ML. Hypoglycemia and clinical outcomes in patients with diabetes hospitalized in the general ward. Diabetes Care. 2009;32(7):1153-7. 13. Mechanick JI, Handelsman Y, Bloomgarden ZT. Hypoglycemia in the intensive care unit. Curr Opin Clin Nutr Metab Care. 2007;10(2):193-6. 14. American Diabetes Association. Standards of medical care in diabetes-2010. Diabetes Care. 2010;33 Suppl 1:S11-61. 15. American Diabetes Association. Screening for diabetes. Diabetes Care. 2002;25 Suppl:S1-S24. 16. Ealovega MW, Tabaei BP, Brandle M, Burke R, Herman WH. Opportunistic screening for diabetes in routine clinical practice. Diabetes Care. 2004;27(1):912. 17. Centers for Disease Control and Prevention. The cost-effectiveness of screening for type 2 diabetes. CDC Diabetes Cost-Effectiveness Study Group, Centers for Disease Control and Prevention. JAMA. 1998;280(20):1757-63. 18. Hoerger TJ, Harris R, Hicks KA, Donahue K, Sorensen S, Engelgau M. Screening for type 2 diabetes mellitus: a cost-effectiveness analysis. Ann Intern Med. 2004;140(9):689-99.

einstein. 2011; 9(1 Pt 1):14-7

Einstein v9n1.indb 17

24.03.11 19:34:50


ORIGINAL ARTICLE

Potentially inappropriate medication prescribed to elderly outpatients at a general medicine unit Medicamentos potencialmente inapropriados prescritos a pacientes idosos ambulatoriais de clínica médica Christine Grützmann Faustino1, Milton de Arruda Martins1, Wilson Jacob-Filho1

ABSTRACT

RESUMO

Objective: To establish the prevalence of potentially inappropriate medications prescribed for elderly patients, to identify the most commonly involved drugs, and to investigate whether age, sex and number of medications were related with the prescription of these drugs. Methods: Prescriptions for 1,800 elderly patients (≥ 60 years) were gathered from a database. These prescriptions were written by general physicians at a tertiary level university hospital in the city of Sao Paulo, Brazil, from February to May 2008. Only one prescription per patient was considered. The prescriptions were classified according to sex and age (60-69, 70-79 and ≥ 80). The Beers criteria (2003 version) were used to evaluate potentially inappropriate medications. Results: Most of the sample comprised women (66.6%) with a mean age of 71.3 years. The mean prevalence of potentially inappropriate medication prescriptions was 37.6%. The 60-69 age group presented the highest prevalence (49.9%). The most frequently prescribed potentially inappropriate medications to women were carisoprodol, amitriptyline, and fluoxetine; amitriptyline, carisoprodol, fluoxetine and clonidine were prescribed more often to men. The female sex (p<0.001; OR=2.0) and number of medications prescribed (p<0.001) were associated with prescription of potentially inappropriate medications. The chance of having a prescription of these drugs was lower among patients aged over 80 years (OR=0.7). The mean number of prescribed medications for both sexes and all age groups was 7.1. The mean number of medications per patient was higher among females (p<0.001); this result was not age-dependent (p=0.285). Conclusion: The prevalence of potentially inappropriate medications was similar to previously reported values in the literature and was correlated with the female sex. The chance of having a potentially inappropriate medication prescription was lower among patients aged over 80 years. The chance of having a potentially inappropriate medications prescription increased proportionally with the number of medications prescribed (≥ 5).

Objetivo: Determinar a prevalência de medicamentos potencialmente inapropriados em idosos ambulatoriais; identificar os mais comumente envolvidos; e verificar se a idade e o sexo do paciente, além do número de medicamentos, estão relacionados à prescrição de medicamentos potencialmente inapropriados. Métodos: Foram coletadas prescrições de 1.800 pacientes idosos (≥ 60 years) em banco de dados. As prescrições foram realizadas por clínicos gerais de hospital universitário de atenção terciária em São Paulo entre Fevereiro e Maio de 2008; foi considerada apenas uma prescrição por paciente. As prescrições foram divididas de acordo com o sexo e faixa etária (60-69; 70-79 e ≥ 80). Os critérios de Beers versão 2003 foram utilizados para a avaliação de medicamentos potencialmente inapropriados. Resultados: A maior parte da casuística foi composta por mulheres (66,6%) e a média de idade foi de 71,3 years. A prevalência média de prescrição de medicamentos potencialmente inapropriados foi de 37,6%, sendo que a faixa etária de 60-69 years apresentou a maior prevalência (49,9%). Os medicamentos potencialmente inapropriados mais prescritos para as mulheres foram o carisoprodol, a amitriptilina e a fluoxetina e, para os homens, foram a amitriptilina, o carisoprodol, a fluoxetina e a clonidina. O sexo feminino (p < 0,001; RC = 2,0) e o número de medicamentos prescritos (p < 0,001) foram associados à prescrição de medicamentos potencialmente inapropriados. A chance de prescrição de um medicamentos potencialmente inapropriados foi menor em pacientes com ≥ 80 years (RC = 0,7). A média de medicamentos prescritos foi 7,1, considerando ambos os sexos e todas as faixas etárias. A média do número de medicamentos por paciente foi maior no sexo feminino (p < 0,001), sendo que esse resultado não dependeu da faixa etária (p = 0,285). Conclusão: A prevalência de medicamentos potencialmente inapropriados encontrada foi semelhante ao relatado na literatura e está correlacionada ao sexo feminino. A chance de prescrição de medicamentos potencialmente inapropriados foi menor em pacientes com ≥ 80 years e observou-se que é maior à medida que aumenta o número de medicamentos prescritos (≥ 5).

Keywords: Aged; Drug prescriptions; Pharmacoepidemiology; Outpatient clinics, hospital; Internal medicine

Descritores: Idoso; Prescrições de medicamentos; Farmacoepidemiologia; Ambulatório hospitalar; Medicina interna

Study carried out General Medicine Unit - Instituto Central do Hospital das Clínicas da Faculdade de Medicina, Universidade de São Paulo – USP, Sao Paulo (SP), Brazil. 1

Faculdade de Medicina, Universidade de São Paulo – USP, Sao Paulo (SP), Brazil. Corresponding author: Christine Grützmann Faustino - Rua Gomes Freire, 279 – apto. 07 - Lapa - CEP 05075010 - São Paulo (SP), Brasil - Tel.: 11-3832-7261 - e-mail: tine@usp.br Received: Aug 08, 2010 – Accepted: Jan 24, 2011 Conflict of interest: none.

einstein. 2011; 9(1 Pt 1):18-23

Einstein v9n1.indb 18

24.03.11 19:34:50


Potentially inappropriate medication prescribed to elderly patients

INTRODUCTION Concern with the impact of prescriptions in aging populations has led to several strategies to deal with this situation, such as detecting potentially inappropriate medications (PIMs). Drugs are potentially inappropriate in elderly patients when there is no evidence-based indication for their use, when they increase the risk of adverse effects compared to younger patients, or when they are not cost-effective. These drugs may also be associated with increased morbidity, mortality, and the cost of health services(1-3). Avoiding high-risk medication is an important strategy for reducing adverse events to drugs – particularly the adverse reactions(2). OBJECTIVE Aiming to support interventions for promoting the rational use of drugs, the purposes of this study were as follows: to describe the prevalence of PIMs prescribed to elderly patients according to age and sex at a General Medicine Unit within a tertiary care hospital in the city of Sao Paulo; to identify the most commonly prescribed drugs; and to verify whether age, sex, and number of medications were related with the prescription of PIMs. METHODS An observational descriptive study was undertaken of outpatient prescriptions from February to May 2008 at the General Medicine Unit of the Central Institute of the Hospital das Clínicas - Faculdade de Medicina da Universidade de São Paulo (FMUSP). Data were gathered by generating reports from the Hospital Management and Information System (HIS) database used by the outpatient pharmacy of the aforementioned hospital. This HIS, which is used for dispensing and controlling inventory of medications, was established and is maintained by a data-processing company - Companhia de Processamento de Dados do Estado de São Paulo - PRODESP [Sao Paulo State Data Processing Company], a state-owned information technology company in Sao Paulo. Prescriptions were classified by sex and age (patients aged 60-69 years, 70-79 years, and over 80 years). Elderly persons were adults aged 60 years or above at the time data was gathered (as defined by the World Health Organization, WHO, for developing countries). Age was calculated based on the date of the prescription form; only the first prescription for each patient was taken into account. The hospital consists of several general or specific subspecialty units. Patients requiring special care – such as homecare – are referred to specific subspecialty units; the remaining patients are sent to general care subspecialty

19

units. This study included only the latter patients, to reduce the confounding factors in the analysis of results. Prescriptions made for patients seen in the context of brief outpatient visits and prescriptions for patients that were not registered at the institution were not taken into account in this study. The 2003 version of the Beers criteria was applied for evaluating the PIMs; only drugs that did not depend on diagnosis were included(3). The PIMs digoxin, ferrous sulphate and lorazepam were excluded because their dose could not be calculated. Clonazepam and nitrazepam were considered PIMs because of their over 20-hour half-life, although they are not included in the Beers criteria(4-5). Nitrazepam is sold in Brazil, but not in the United States(5). Primidone is a barbiturate anticonvulsivant drug that is also not included in the Beers criteria, but that is standardized at our institution. It is a highly addictive drug and causes more adverse effects in the elderly than most other sedative or hypnotic drugs; thus it was also included as a PMI(6). Drugs were classified according to the Anatomical Therapeutic Chemical (ATC) classification of the WHO(7). A logistic regression model was used for the statistical analysis; references were male sex and age 60-69 years. The number of drugs was categorized into the quartile intervals 1-4, 5-6, 7-8, and ≥ 9. The Hosmer and Lemeshow test was applied to assess model adjustment(8). The term odds ratio (OR) was translated into Portuguese to razão de chances (RC) as was used in this study. The significance level for hypothesis testing was 0.05. The statistical analysis was done using the Minitab software version 15 and the Statistical Package for the Social Sciences version 11.

RESULTS Characteristics of the study population The analysis comprised 1800 prescription forms. The majority of elderly patients were female (66.6%); there were more females than males at all age groups. Female elderly patients aged 60-69 years comprised most of the sample of women in this study (Table 1). The mean age of patients was 71.3 years; the mean age of female subjects was 71.6 years and the mean age of male subjects was 70.9 years. Table 1. Frequencies and percentages of patients by gender and age in relation to total of patients Gender Age

Female n (%) 559 (31.0)

Male n (%) 287 (15.9)

70-79

410 (22.8)

218 (12.1)

628 (34.9)

≥ 80

230 (12.8)

96 (5.3)

326 (18.1)

Total

1,199 (66.6)

601 (33.3)

1,800 (100.0)

60-69

Total n (%) 846 (47.0)

einstein. 2011; 9(1 Pt 1):18-23

Einstein v9n1.indb 19

24.03.11 19:34:51


20

Faustino CG, Martins MA, Jacob-Filho W

The mean number of drugs prescribed was 7.1 (standard deviation: 3.5) for both sexes at all age groups. The mean in the 60-69-year age group was 7.3; the mean for the 70-79-year and over-80-year age groups was 6.9. There were no differences among the drug number means in the three age groups (p = 0.370); this result applied to both sexes (p = 0.285). The mean number of drugs prescribed for females was 7.6 (standard deviation: 3.5), and for males, 6.0 (standard deviation: 3.1) in all age groups. The mean number of drugs per patients was higher in females (p < 0.001). This results was independent of age (p = 0.285).

Table 3. Potentially inappropriate medications most prescribed according to patient’s gender

PIMs The mean prevalence of PIM prescription was 37.6% (677 prescription orders). The highest prevalence (49.9%) was found in the 60-69-year age group, followed by the 70-79-year (34.7%) and ≥ 80-year (15.4%) age groups. The group with the highest prevalence of PIMs was that of elderly females aged 60-69 years (Table 2).

* Produced by the Pharmacotechnic Unit of Pharmacy Division of the Science Institute of Instituto Central do Hospital das Clínicas da Faculdade de Medicina da Universidade de São Paulo (HC-FMUSP). It contains carisoprodol 100 mg (potentially inappropriate mediation), dipirona 200 mg and paracetamol 200 mg. PMIs: potentially inappropriate medications.

Table 2. Frequencies and percentages considering only the universe of prescriptions of potentially inappropriate medications Age

Gender

60-69

F M F M F M

70-79 ≥ 80 Total

Prescription of PIMs n (%) 270 (39.9) 68 (10.0) 179 (26.4) 56 (8.3) 77 (11.4) 27 (4.0) 677 (100.0)

PIMs: potentially inappropriate medications; F: female; M: male.

The mean number of PIMs indicated per prescription form was 1.31. The PIMs ketorolac, diphenhydramine, nitrazepam, indomethacin, amfepramone, fenproporex, mazindol, sibutramine, chlorpheniramine and dipyridamole were absent in all prescription forms. Except for clonidine, all PIMs that were encountered are among the most harmful in the Beers criteria version 2003 (Table 3). Female sex and prescription of over five drugs were associated with PIM prescription orders; this was not observed in the over-80-year age group (Table 4). The Hosmer and Lemeshow test indicated a good adjustment of the model (p = 0.198).

DISCUSSION The prevalence of PIMs in this study (37.6%) is within the range found in studies in other countries where

Female n (%) 193 (27.2) 192 (27.1) 140 (19.7) 46 (6.5) 32 (4.5) 30 (4.2) 17 (2.4) 16 (2.3) 11 (1.6) 32 (4.5) 709 (100.0)

PMIs Muscle relaxant HC* Amytriptyline Fluoxetine Clonidine Naproxen Methyldopa Mineral oil Amiodarone Hydroxyzine Others Total

Male n (%) 34 (19.1) 42 (23.6) 16 (9.0) 16 (9.0) 9 (5.0) 10 (5.6) 6 (3.4) 14 (7.9) 9 (5.0) 22 (12.4) 178 (100.0)

Table 4. Associated factors to prescription of potentially inappropriate medication Characteristics Women Age 70 to 79 ≥ 80 Medications 5 or 6 7 or 8 9 or +

p-value <0.001 0.027 0.481 0.007 <0.001 <0.001 <0.001 <0.001

RC 2.0 0.7

IC95% [1.6-2.5] [0.5-0.9]

2.0 2.1 4.5

[1.5-2.8] [1.6-2.9] [3.4-6.1]

RC = razão de chances = odds ratio (OR)

researchers applied the 2003 version of Beers criteria to evaluate prescription orders (13 to 40.7%)(1,9-11). Buck et al. studied the database of two hospitals in the United States and found that the prevalence of PIMs in elderly outpatients was 23% in both cases(12). Maio et al. evaluated 50 registries of elderly patient at a Geriatric Unit and found a prevalence of PIMs in 26% of patients(13). As in the present study, researchers chose and adapted the instruments according to data availability and the list of drugs used at each institution or approved in each country. In Brazil, Carvalho found that the prevalence was around 15.4% in a population sample from the year 2000, based on the Beers criteria version 2003(14). Coelho Filho et al. found that 20% of drugs were inadequate according to the indications for which they had been prescribed(15). Gorzoni et al. applied the Beers criteria version 2003 and found that 41% of elderly patients in their study used one or two PIMs(16). If on the one hand similar percentages to other published results were found, on the other hand comparisons are difficult. The prevalence in different populations varies according to the time and site of data

einstein. 2011; 9(1 Pt 1):18-23

Einstein v9n1.indb 20

24.03.11 19:34:52


Potentially inappropriate medication prescribed to elderly patients

gathering, as well as other aspects such as the criteria, study design and data gathering period(17). The possibility of prescribing a PIM was lower in patients aged over 80 years – a trend that has been seen by other authors(17-20). Piecoro et al. found that elderly patients aged over 85 years in the United States were less likely to be prescribed PIMs(17). Passarelli et al. found that use of PIMs was significantly lower in patients aged over 80 years admitted into a Brazilian hospital(20). There is no consensus in the literature about increased or decreased prescription orders of PIMs as patients get older(21-23). Stuck et al. found that patients aged over 80 years were more likely to use PIMs(21); Lechevallier-Michel et al. noted that the frequency of PIM use increased with age(22). In our study women were more likely to be prescribed a PIM compared to men; other investigations, including the only Brazilian article on this topic(15), reported the same finding(17,18,22). It is not clear why female patients are more likely to be prescribed PIMs; our findings show that the mean number of drugs prescribed to women was higher (7.6) compared to men (6.0), which may have influenced this association. Further studies are needed to clarify the dynamics of sex differences in interactions between healthcare providers and patients, as well as the setting of healthcare systems, which increases the likelihood of women being given more medication(24). For instance, if women tend to report pain and symptoms of depression more often than men, they are more likely to be diagnosed and treated for these conditions; male patients may be less exposed to these drugs by not having reported their symptoms(24). It is possible that women are more concerned with their health than men, which would in itself increase the mean number of drugs prescribed to them(24). The majority of results in studies that reported different prevalences in PIM prescription orders at various medical institutions were not statistically different(18,25). For instance, Maio et al.(13) found a prevalence of 26% of PIMs in one hundred registries of elderly patients at a Geriatrics Unit; the prevalence was 22% in patients seen by family doctors, although no difference was found in the odds of using PIMs in both units(13). Pugh et al.(26) suggested that geriatric health care has a protective effect over the quality of drug therapy provided to elderly patients; in such cases, statistical differences were found in the prevalence of PIMs between specialists (geriatricians) and nonspecialists. The reasons whereby geriatric specialists had a “protective” effect remained unclear, although their training was thought to have been a possible explanation. Our study showed that the likelihood of prescribing PIMs increases with the number of prescribed items,

21

as follows: the odds ratio was two times higher if the prescription order form had 5 to 6 drugs, 2.1 times higher if there were 7 to 8 drugs, and 4.5 times if there were more than 9 drugs. Most studies have shown an association between use of multiple drugs and prescription of PIMs(9,17,18). The most frequently prescribed PIMs for female patients were carisoprodol, amitriptyline, and fluoxetine. Amitriptyline, carisoprodol, fluoxetine, and clonidine were the most frequently prescribed drugs to male patients. Carisoprodol and amitriptyline are thus common to both sexes as the most prevalent PIMs. Adverse effects of carisoprodol include lethargy, agitation, delirium, psychosis, and liver toxicity(27). Carisoprodol is available at our institution as a mixed preparation with other drugs, which results in further issues for elderly patients. No clinical studies were found demonstrating the efficacy of this mixture in elderly patients. Thus, when carisoprodol is prescribed, patients in fact are given three different drugs, compounding the problem of polypharmacy and increasing the risk for patients allergic to any of the components. Furthermore, the adverse effects of each drug – such as hypotension and liver failure – may reinforce those of others(27). When analgesics and muscle relaxants are prescribed, drugs with a similar therapeutic effect may overlap. Tricyclic antidepressants affect several neurotransmitters and may cause several pharmacological effects, including adverse reactions. The most common result from cholinergic receptor blocking, such as dry mouth, constipation, blurred vision, urinary retention, tachycardia, and delirium, if at high dosages(27); furthermore, this category has a long list of drug interactions(27). In studies based on the Beers criteria version 2003, long-acting benzodiazepines, propoxyphene, amitriptyline, and antihistamines were the most frequently prescribed PIMs(9,10,12,23). Estrogens, muscle relaxants, ticlopidine, chlordiazepoxide, and antiinflammatory drugs were also mentioned(10,23). In Brazil, Carvalho found that anti-inflammatory drugs, methyldopa, digoxin, and long-acting benzodiazepines were the PIMs used most frequently by elderly patients in the city of Sao Paulo(14). Gorzoni et al. found that benzodiazepines, methyldopa, ergot derivatives, and cyclandelate were encountered more frequently in patient records(16). Passarelli et al. noted that the most frequently found PIMs in elderly patients admitted to hospital wards were diazepam, amiodarone, nifedipine, methyldopa, and cimetidine(20). PIM prescription differences among studies may occur for several reasons. Some drugs in the Beers criteria are not standardized at our institution, such as chlorpropamide, guanethidine, reserpine, and einstein. 2011; 9(1 Pt 1):18-23

Einstein v9n1.indb 21

24.03.11 19:34:53


22

Faustino CG, Martins MA, Jacob-Filho W

cimetidine. Others have not been registered at the Brazilian drug administration office (National Health Surveillance Agency, or ANVISA); these include oxazepam, quazepam, halazepam, and doxepin, which are not available commercially in Brazil. There are limits to the Beers criteria. Its list of PIMs is inflexible, does not take into account individual differences, and may yield false-positive results (for instance, signaling non-existent issues). Problems that have not been described are not mentioned; thus, it may fail to provide a complete evaluation of patients(28). A few drugs are not absolutely contraindicated in the elderly, especially in patients with a short life expectation; these drugs include amitriptyline, bisacodyl, and naproxen(29). The Beers criteria do not mention underuse of medication, drug interactions, or duplicated therapeutic classes. The list is confusing, because drugs are not listed alphabetically, or by action site or therapeutic class(29). The advantages of the Beers criteria are that they may be adapted to computer systems, they support pharmacoepidemiological studies of large populations, gather information from the literature and from specialist consensuses, and may be used readily for educational purposes(1). A database electronic spreadsheet was used to collect results of this study. The advantages of using computerized databases for verifying prescribed medications are the accuracy of the prescription registry and the fact it did not depend on information from patients. The sample of prescription order forms was gathered over a considerable time period (four months); and care was taken to evaluate only the general healthcare subspecialties. On the other hand, adapting a businessoriented spreadsheet into a research form required complex formulae and standardization of alphanumeric data. These steps hinder pharmacoepidemiological studies by healthcare professionals at the organization. There are some caveats to this study. Because of the number of comorbidities, elderly subjects may have been seen by other specialists, which may have influenced the prescription profile. Incorrect or unmade diagnoses may have also affected the prescription orders. There may have been typing errors; we believe that these were few because of triple verification of prescription typing at the outpatient clinic pharmacy. The system used to generate the spreadsheet for this study does not interface with the electronic medical record system; therefore, there was no information about diagnoses or other medical data on which physicians based their prescriptions. Thus, it was not possible to check whether drugs considered as PIMs in this study were really potentially inappropriate for specific patients. Furthermore, when using the Beers

criteria, it is not possible to state if or which adverse effects occurred if the outcomes of therapy are not monitored. The criteria only suggest that adverse effects have a higher probability of occurring in the elderly(17). There are limitations to generalizing the results to the general population; this study focused on the profile of prescription orders for patients at a tertiary healthcare organization. Many of these patients were referred to that hospital because of complex comorbidities. A few authors suggested that profiles of patients, comorbidities, and drug or therapeutic classes related more frequently with unfavorable outcomes are required to deal with the complexity of medication use in the elderly; the idea being to prioritize risk groups for drug-related issues. Otherwise, medication use in the elderly is an ample issue that requires a multidisciplinary approach. For this purpose, it is essential to improve the recording systems and information access to medication use. Healthcare professionals should be able to easily access prescription order profiles. Adequately filled in electronic medical records, which are connected to the prescription database, make it possible to systematically make in depth analyses of medication use(30). Secondly, healthcare professionals that treat elderly patients should learn the appropriate prescription practices, by accessing medication use guidelines and continue education. Knowledge about good practices reduces the possibility of potentially inappropriate practices. Third, we underline the need for generating a PIM list for the Brazilian context. Such a list, based on medication use, consensuses, and evidence-based literature, could guide drug selection and guidelines for using drugs in elderly patients(30).

REFERENCES 1. Fick DM, Mion LC, Beers MH, L Waller J. Health outcomes associated with potentially inappropriate medication use in older adults. Res Nurs Health. 2008;31(1):42-51. 2. Gallagher P, Barry P, O’Mahony D. Inappropriate prescribing in the elderly. J Clin Pharm Ther. 2007; 32(2):113-21. Review. 3. Fick DM, Cooper JW, Wade WE, Waller JL, Maclean JR, Beers MH. Updating the beers criteria for potentially inappropriate medication use in older adults: results of a us consensus panel of experts. Arch Intern Med. 2003;163(22):2716-24. 4. Micromedex Drugdex® Evaluations. Clonazepam. Montvale: MICROMEDEX Healthcare Series, c2009 [Accessed 2009 Nov. 10]. Available from URL: http://www.thomsonhc.com/hcs/librarian 5. Micromedex Drugdex® Evaluations. Nitrazepam. Montvale: MICROMEDEX Healthcare Series, c2009 [Accessed 2009 Nov. 10]. Available from URL: http://www.thomsonhc.com/hcs/librarian 6. Micromedex Drugdex® Evaluations. Primidone. Montvale: MICROMEDEX Healthcare Series, c2009 [Accessed 2009 Nov. 10]. Available from URL: http://www.thomsonhc.com/hcs/librarian

einstein. 2011; 9(1 Pt 1):18-23

Einstein v9n1.indb 22

24.03.11 19:34:53


Potentially inappropriate medication prescribed to elderly patients

7. World Health Organization Collaborating Centre for Drug Statistics Methodology. Anatomical Therapeutic Chemical (ATC) classification - ATC/DDD Index. Oslo: Norwegian Institute of Public Health, 2009 [on line]. Available from URL: http://www.whocc.no/atcddd/ 8. Neter J, Kutner MH, Nachtsheim CJ, Li W. Applied Linear Statistical Models. 5th ed.Chicago: Irwin; 2005. 9. Viswanathan H, Bharmal M, Thomas J 3rd. Prevalence and correlates of potentially inappropriate prescribing among ambulatory older patients in the year 2001: comparison of three explicit criteria. Clin Ther. 2005;27(1):88-99.

23

Project Research Group. Potentially inappropriate medication use among elderly home care patients in Europe. JAMA. 2005;293(11):1348-58. 20. Passarelli MC, Jacob-Filho W, Figueras A. Adverse Drug Reactions in an Elderly Hospitalised Population Inappropriate Prescription is a Leading Cause. Drugs Aging. 2005;22(9):767-77. 21. Stuck AE, Beers MH, Steiner A, Aronow HU, Rubenstein LZ, Beck JC. Inappropriate medication use in community-residing older persons. Arch Intern Med. 1994;154(19): 2195-200.

10. van der Hooft CS, Jong GW, Dieleman JP, Verhamme KM, van der Cammen TJ, Stricker BH, et al. Inappropriate drug prescribing in older adults: the updated 2002 Beers criteria – a population-based cohort study. Br J Clin Pharmacol. 2005;60(2):137-44.

22. Lechevallier-Michel N, Gautier-Bertrand M, Alpérovitch A, Berr C, Belmin J, Legrain S, Saint-Jean O, Tavernier B, Dartigues JF, Fourrier-Réglat A; 3C Study Group. Frequency and risk factors of potentially inappropriate medication use in a community-dwelling elderly population: results from the 3C Study. Eur J Clin Pharmacol. 2005;60(11):813-9.

11. De Oliveira Martins S, Soares MA, Foppe van Mil JW, Cabrita J. Inappropriate drug use by Portuguese elderly outpatients – effect of the Beers criteria update. Pharm World Sci. 2006;28(5):296-301.

23. Gallagher PF, Barry PJ, Ryan C, Hartigan I, O’Mahony D. Inappropriate prescribing in an acutely ill population of elderly patients as determined by Beers’ Criteria. Age Ageing. 2008;37(1):96-101.

12. Buck MD, Atreja A, Brunker CP, Jain A, Suh TT, Palmer RM, et al. Potentially inappropriate medication prescribing in outpatient practices: prevalence and patient characteristics based on electronic health records. Am J Geriatr Pharmacother. 2009;7(2):84-92.

24. Bierman AS, Pugh MJ, Dhalla I, Amuan M, Fincke BG, Rosen A, et al. Sex Differences in Inappropriate Prescribing Among Elderly Veterans. Am J Geriatr Pharmacother. 2007;5(2):147-61.

13. Maio V, Hartmann CW, Poston S, Liu-Chen X, Diamond J, Arenson C. Potentially inappropriate prescribing for elderly patients in 2 outpatient settings. Am J Med Qual. 2006;21(3):162-8. 14. Carvalho MFC. A polifarmácia em idosos no município de São Paulo - Estudo SABE – Saúde, Bem-estar e Envelhecimento [dissertação]. São Paulo: Faculdade de Saúde Pública da Universidade de São Paulo, 2007. 15. Coelho-Filho JM, Marcopito LF, Castelo A. [Medication use patterns among elderly people in urban area in Northeastern Brazil]. Rev Saúde Pública. 2004;38(4):557-64. 16. Gorzoni ML, Fabbri RMA, Pires SL. Medicamentos em uso à primeira consulta geriátrica. Diagn Tratamento. 2006;11(3):138-42. 17. Piecoro LT, Browning SR, Prince TS, Ranz TT, Scutchfield FD. A database analysis of potentially inappropriate drug use in an elderly medicaid population. Pharmacotherapy. 2000;20(2):221-8. 18. Goulding MR. Inappropriate medication prescribing for elderly ambulatory care patients. Arch Intern Med. 2004;164(3):305-12. 19. Fialová D, Topinková E, Gambassi G, Finne-Soveri H, Jónsson PV, Carpenter I, Schroll M, Onder G, Sørbye LW, Wagner C, Reissigová J, Bernabei R; AdHOC

25. Saltvedt I, Spigset O, Ruths S, Fayers P, Kaasa S, Sletvold O. Patterns of drug prescription in a geriatric evaluation and management unit as compared with the general medical wards: a randomised study. Eur J Clin Pharmacol. 2005;61(12):921-8. 26. Pugh MJ, Rosen AK, Montez-Rath M, Amuan ME, Fincke BG, Burk M, et al. Potentially inappropriate prescribing for the elderly: effects of geriatric care at the patient and health care system level. Med Care. 2008;46(2): 167-73. 27. DiPiro JT, Talbert, RL, Yee GC, Matzke, Wells BG, Posey LM, editors. Pharmacotherapy: a pathophysiologic approach. 6ª ed. USA: McGraw-Hill; 2005. 28. Shelton PS, Fritsch MA, Scott MA. Assessing medication appropriateness in the elderly: a review of available measures. Drugs Aging. 2000:16(6); 437-50. 29. O’Mahony D, Gallagher PF. Inappropriate prescribing in the older population: need for new criteria. Age Ageing. 2008;37(2):138-41. Review. 30. Ribeiro AQ, Araújo CM, Acurcio FA, Magalhães SMS, Chaimowicz F. Qualidade do uso de medicamentos por idosos: uma revisão dos métodos de avaliação disponíveis. Ciência & Saúde Coletiva. 2005;10(4);1037-45.

einstein. 2011; 9(1 Pt 1):18-23

Einstein v9n1.indb 23

24.03.11 19:34:54


ORIGINAL ARTICLE

Mother/child bond in mothers of overweight and eutrophic children: depression and socioeconomic factors Vínculo mãe/filho de mães de crianças com excesso de peso e eutróficas: depressão e fatores socioeconômicos Patricia Vieira Spada1, Maria Arlete Meil Escrivão2, Fernando José de Nóbrega3, Yára Juliano4

ABSTRACT

RESUMO

Objective: To verify the presence of depression, age, level of schooling, occupation, marital status, number of children and nutritional status (maternal and of the child) in mothers of overweight and eutrophic children and relate the data to mother/child bonding. Methods: A total of 120 mothers of children aged up to 10 years participated; 30 of them were overweight and 30 were eutrophic (low-income bracket); 30 were overweight and 30 eutrophic (high-income bracket). The control group was composed of eutrophic children paired according to sex, age, level of schooling, and social condition. Data collection was made through interviews. The assessment instruments were: Mother/ Child Bonding Assessment Protocol and Beck Depression Inventory. The nutritional classification was defined by calculation of the body mass index, as per the curves of the World Health Organization. For statistics, McNemar, χ2, and Fisher’s exact tests were used. A 5% level of rejection of the null hypothesis was set. Results: There was no significant result between mother/child bonding and the variables studied, or between the presence of depression and level of schooling, marital status, occupation, and maternal nutritional status. Nevertheless, mothers of eutrophic children (high-income bracket) showed less depression than mothers of eutrophic children (low-income bracket). Mothers with three or more children displayed more depression than mothers with less than three children. Mothers under 30 years of age showed more depression than mothers aged 30 years or older. Conclusion: There was no significant result between mother/child bonding and the variables studied, but the bond was compromised in all mothers of the sample. There was a significant result regarding the presence of depression.

Objetivo: Verificar presença de depressão, idade, escolaridade, ocupação, condição marital, número de filhos e condição nutricional (materna e da criança) em mães de crianças com excesso de peso e eutróficas e relacionar dados ao vínculo mãe/filho. Métodos: Participaram 120 mães de crianças (até 10 anos): 30 com excesso de peso e 30 eutróficas (baixa condição econômica); 30 com excesso de peso e 30 eutróficas (alta condição econômica). O Grupo Controle foi composto por crianças eutróficas pareadas por sexo, idade, escolaridade e condição social. A coleta de dados foi realizada por meio de entrevistas. Os instrumentos para avaliação foram: Protocolo de Avaliação do Vínculo Mãe/Filho, Inventário Beck de Depressão. A classificação nutricional foi definida pelo cálculo do índice de massa corporal, de acordo com as curvas da Organização Mundial de Saúde. Para estatística, foram utilizados os testes de McNemar, χ2 e exato de Fisher. Fixou-se em 5% o nível de rejeição da hipótese de nulidade. Resultados: Não houve resultado significante entre vínculo mãe/filho e as variáveis estudadas, bem como entre presença de depressão e escolaridade, condição marital, ocupação e condição nutricional materna. Entretanto, mães de crianças eutróficas (alta condição econômica) apresentaram menos depressão que mães de crianças eutróficas (baixa condição econômica). Mães com 3 filhos ou mais apresentaram mais depressão que mães com menos de 3 filhos. Mães com menos 30 anos apresentaram mais depressão que mães com 30 anos ou mais. Conclusão: Não houve resultado significante entre vínculo mãe/filho e as variáveis estudadas, mas seu comprometimento foi alto em todas as mães da amostra. Houve resultado significante de presença de depressão.

Keywords: Mother-child relations; Maternal age; Depression

Descritores: Relações mãe-filho; Idade materna; Depressão

Study carried out at Department of Graduate Courses in Nutrition, Escola Paulista de Medicina, Universidade Federal de São Paulo – UNIFESP, Sao Paulo (SP), Brazil; Outpatient Clinics – Einstein in Paraisopolis Community Program and Einstein Nutrition Program in Paraisopolis Community. Mothers and children who were evaluated came from these outpatient clinics as well as from high-income areas in the city of Sao Paulo (SP), Brazil. 1

Graduate Program in Nutrition, Escola Paulista de Medicina, Universidade Federal de São Paulo – UNIFESP, Sao Paulo (SP), Brazil.

2

Obesity Sector, Nutrition Division, Department of Pediatrics, Escola Paulista de Medicina, Universidade Federal de São Paulo – UNIFESP, Sao Paulo (SP), Brazil.

3

Coordinator of Research on Human Nutrition, Instituto Israelita de Ensino e Pesquisa Albert Einstein – IIEPAE, Sao Paulo (SP),

4

Faculdade de Medicina, Universidade de Santo Amaro – UNISA, Sao Paulo (SP), Brazil. This research is part of the thesis for Doctorate in Sciences from the Escola Paulista de Medicina, Universidade Federal de São Paulo (UNIFESP), of the first author, supervised by the third author, with the support of the Coordination for the Improvement of Higher Education Personnel (CAPES). Corresponding author: Patricia Vieira Spada – Rua Júlio Diniz, 145, apto. 181 – Vila Olímpia – CEP 04547 090 – Sao Paulo (SP), Brazil – Tel.: 11 3845-5598 – E-mail: patspada@ig.com.br Received: Jul 27, 2010 - Accepted: Feb 08, 2011 The authors declare there is no conflict of interest.

einstein. 2011; 9(1 Pt 1):24-30

Einstein v9n1.indb 24

24.03.11 19:34:54


Mother/child bond in mothers of overweight and eutrophic children: depression and socioeconomic factors

INTRODUCTION The mother/child bond has been considered of primary importance for the overall development of a child (1). It is in the first years of life that the foundation that will support the pillars of the child’s personality and character are formed (2). Spitz (3) showed, by means of practical observations of the clinical pictures of a statistically significant number of children, that inappropriate and/or insufficient maternal attitudes could generate, in their children, conditions ranging from coma in the newborn to marasmus and death, evidencing the serious physical and psychic damage resulting from the privation of elements vital for survival, in other words, maternal affection. He highlighted the influence of maternal depression on the etiology of various physical and emotional diseases in the child. Klaus and Kennel (4) emphasized that the bond of affection between parents and their baby would be the basis for future relationships of the child, and that these would be influenced by the strength and quality of this bond. They acknowledge, in their extensive observation work of parents/babies a few indicators that may strengthen, alter, distort, or compromise the formation and quality of this bond. Other authors added that equally important aspects should be taken into consideration, such as the child’s temperament, its “affective place” within the family dynamics, number of siblings, the family’s socioeconomic condition, and maturity of the mother, among others (5-8). In Brazil, it is important to point out the work done by Nóbrega et al. (9) about strengthening the mother/ child bond. Nóbrega et al. were initially dedicated to creating the first Pediatric Practice Obesity Outpatient Clinic, at the Department of Pediatrics of the Medical School of Botucatu, Universidade Estadual Paulista “Júlio de Mesquita Filho”, in 1969, and later, to outpatient clinics for malnourished, low-height, and obese patients, breastfeeding and clinical nutrition of the extinct Núcleo de Nutrição, Alimentação e Desenvolvimento Infantil (NUNADI) [Center of Child Nutrition, Diet and Development], of the Secretariat of Health of the State of Sao Paulo. On this occasion, he and his team created a unique instrument that is systematic, objective, and easy to use so that new indicators of compromised mother/child bonding – which have been observed by professionals – might be identified, grouped, and organized. It was composed of 18 items divided into groups referring to past and current history of the mother (her childhood, parental models, personal, professional, and conjugal life, family environment, and gestation), quality of the mother/ infant relationship (birth, maternity, breastfeeding, and

25

first relations), and issues specifically related to the baby (first days of life, health conditions, and characteristics), in which, in order to facilitate reading and understanding of the terms, all items were strictly defined so that this instrument could be used by other professionals as well, after training, besides psychologists. In the year 2000, with the establishment of the Einstein Nutrition Program in the Paraisópolis Community (PENC-P), in the city of Sao Paulo, coordinated by professor Nóbrega – with the objective of identifying risk factors for malnutrition and intervening with an interdisciplinary team, treating the mother/ child pair, the Mother/Child Bonding Assessment Protocol was updated to include 16 items. Based on its statistical study and validation (10), it now has 13 items with respective subitems (11). Due to its great usefulness and the fact that it can be applied in Primary Healthcare Units (UBS), hospitals, clinics, daycare centers, preschools, and outpatient clinics, it was adopted and utilized by other authors in several investigations performed at the Federal Universities of the states of Sao Paulo (UNIFESP), Minas Gerais (UFMG), Rio de Janeiro (UFRJ), Espirito Santo (UFES), Santa Catarina (UFSC), and at the Universidade de São Paulo (USP), as well as in other studies that are still ongoing, including overseas. It is important to point out that the application of this instrument in pediatric outpatient clinics is of vital importance, since, as a primary care service, its aim is to promote health both of the mother and of the child, allowing early detection of possible failures in the mother/child bond, which could lead to significant deficits in the child global development. Therefore, there are no scientific studies in literature covering the quality of the mother/child bond, since this instrument was created based on the abovementioned experiences. Consequently, this study proposed the identification of the conditions in which there may be a compromise of the bond between mother and child, in order to prevent damage and strengthen the bond, considering that the quality of the affection between the members of this pair may instigate, maintain, and/or contribute towards various nutritional and affective disorders, leading to significant impairment of the child’s overall development.

OBJECTIVE To verify, in the mothers, factors such as presence of depression, economic conditions, age, level of schooling, occupation, marital condition, number of children, and nutritional status of the pair, besides relating these factors to the mother/child bond.

einstein. 2011; 9(1 Pt 1):24-30

Einstein v9n1.indb 25

24.03.11 19:34:55


26

Spada PV, Escrivão MAM, Nóbrega FJ, Juliano Y

METHODS This is a cross-sectional quantitative study in which 120 mothers of children aged under 10 years participated. The mothers were divided into four groups: 30 mothers of overweight children from a low-income bracket; 30 mothers of eutrophic children from a lowincome bracket; 30 mothers of overweight children from a high-income bracket; and 30 mothers of eutrophic children from a high-income bracket. Of the total 120 mothers in the sample, 60 were a part of the control group, which was divided into 30 mothers of eutrophic children from a low-income bracket and 30 mothers of eutrophic children from a high-income bracket. The control group was paired as to sex, age, level of schooling, and economic condition. Overweight and eutrophic mothers of low-income bracket were interviewed by the researcher of this study at the outpatient clinic of the PEC-P, located in the city of Sao Paulo (12). Adjacent to this outpatient clinic, the Einstein Nutrition Program in Paraisopolis Community (PENC-P) operated, which treated mothers and children with nutritional risks referred to the institution after identification and capture of data made by healthcare agents of the community itself through home visits and other methods. At this location, the following services were offered: specialized multiprofessional care, orientation, treatment and referral, whenever necessary. The first 30 eutrophic mothers from high-income bracket who were a part of the control group were recruited by the researcher at a swimming school in the neighborhood of Vila Nova Conceicao, in the city of Sao Paulo (SP State), and the other mothers, by means of snowballing (13) – a sampling technique that consists of indications on the part of the subject themselves for the capture of additional subjects, and which includes those with a rich information potential. The interviews of these groups were carried out in the homes of the mothers. In the same way, 30 mothers of overweight children from a high-income bracket were captured and interviewed. The inclusion criteria for mothers of overweight children coming from low-income bracket were mothers of children up to 10 years of age, who were overweight, resided in the Paraisopolis community, and who presented with no underlying diseases. The inclusion criteria for mothers of eutrophic children from low-income bracket were mothers of children up to 10 years of age who were eutrophic, healthy, resided in the Paraisopolis community, and who presented with no chronic diseases. The inclusion criteria for mothers of overweight children from high-income bracket were mothers who lived in high-class regions of the city of Sao Paulo, owned their own vehicle, had overweight children up

to 10 years of age who studied at private schools and presented with no underlying diseases. The inclusion criteria for mothers of eutrophic children from high-income bracket were mothers who lived in high-class regions of the city of Sao Paulo, owned their own vehicle, and whose children up to 10 years of age were eutrophic, healthy, studied at private schools, and presented with no chronic diseases. Non-inclusion criteria for both economic and nutritional status were children who were overweight due to endogenous causes, eutrophic children with chronic diseases, and mothers presenting with serious mental disorders. Data were collected by the researcher by means of interviews carried out during the period from March 2004 to July 2006. The interviews included the application of the Mother/Child Bonding Assessment Protocol(11), Beck Depression Inventory (14), and nutrition classification (15). The instruments used for the assessment of the mother/child bond (11) and of the presence of depression – Beck Depression Inventory (13) were: - Mother/Child Bonding Assessment Protocol (11) composed of 13 questions with yes/no answers, in which “yes” was the answer positive for the presence of an attribute or indicator of a weak bond. Adding up the “yes” responses, a score is obtained, which may vary from 1 to 13. A positive classification for a weak bond occurs when the number of positive answers ≥ 5. The instrument was validated with the objective of making it reliable and useful for other healthcare professionals, besides psychologists, who should be trained for its use; - the Beck Depression Inventory (14) comprises 21 items, with intensity varying from 0 to 3, in reference to symptoms and attitudes, such as sadness, pessimism, feeling of failure, lack of satisfaction, feeling of guilt, feeling of punishment, self-depreciation, selfaccusation, suicidal ideas, crying spells, irritability, social retraction, indecision, body image distortion, inhibition for work, sleep disturbances, fatigue, loss of appetite, weight loss, somatic preoccupations, and decreased libido. This inventory may be self-applied, used individually, or in a group. The total sum of these scores shows the degree of intensity of depression. It is recommended that the term “depression” be used only for individuals whose scores are over 20. In this study, this value was the cutoff point. For measurements of the mothers’ and children’s weights, a Health-O-Meter® digital scale was used with a 150-kg capacity and a variation of 0.1 kg. For measurements of height, a non-elastic measuring tape was used, with an extension of 2 m, divided into centimeters

einstein. 2011; 9(1 Pt 1):24-30

Einstein v9n1.indb 26

24.03.11 19:34:56


Mother/child bond in mothers of overweight and eutrophic children: depression and socioeconomic factors

and subdivided into millimeters, with variations of 0.5 cm, affixed to a smooth wall with no baseboard. Mothers and children were evaluated with heels together, no shoes, and wearing light clothing. The values collected were written down on the identification chart of each mother/ child pair. The nutritional classification of all mothers was made using the body mass index (BMI) calculation as weight (kg)/height2(m2), using the cutoff points proposed by the World Health Organization (WHO) (15). Since the difference between the cutoff points was small and there were no children with morbid obesity, it was decided to pool the children with excess weight and obesity into one single group, characterized, in this study, as the group of overweight children. The same procedure was used with the mothers.

Statistical method Data were analyzed quantitatively by means of statistical techniques and presented as tables, considering the interpretation criteria for the test results. For analysis of the results, χ2 or Fisher’s exact tests were used (16) in order to detect association among the variables studied; the McNemar test (16) was used to confront the groups studied relative to quantitative variables. The level of rejection of the null hypothesis was set at 0.05 or 5%, with an asterisk marking the significant values. All mothers signed informed consent forms. This study was approved by the Ethics Committee of the Escola Paulista de Medicina of UNIFESP and by the Instituto de Ensino e Pesquisa do Hospital Israelita Albert Einstein (IIEPAE). RESULTS According to Table 1, mothers of eutrophic children from high-income bracket displayed less depression

27

than mothers of eutrophic children from low-income bracket. Table 2 shows that mothers with three or more children showed more depression than mothers with less than three children. Additionally, mothers under the age of 30 years showed more depression than did those 30 years of age or older (Table 3). According to Table 4, all mothers showed greater compromise in bonding than the presence of depression. Although the bond proved to be hindered in all mothers of the sample, there was no statistically significant result among the mother/child bond and the variables analyzed. Similarly, there was no statistically significant result between the presence of depression and level of schooling, marital condition, occupation, and maternal nutritional status.

Table 2. Study of the association of mothers of eutrophic and overweight children of low and high-income brackets according to number of children (< 3; ≥ 3) and the result of the Beck Depression Inventory. Number of children <3 ≥3 Total

Depression with 8 17 25

w/o 65 30 95

Total 73 47 120

% with 11.0 36.2 47.2

Chi-square test χ2 = 11.019*

Table 3. Study of the association of mothers of eutrophic and overweight children of low and high-income brackets according to age (< 30; ≥ 30 years) and the result of the Beck Depression Inventory. Maternal age < 30 ≥ 30 Total

Depression with 12 13 25

w/o 10 85 95

Total 22 98 120

% with 54.5 13.2 67.7

Fisher’s exact test p=0.000094*

Table 1. Mothers of eutrophic and overweight children of high and low-income brackets according to the result of the Beck Depression Inventory. Children Eutrophic Overweight Total Chi-square test Eutrophic vs. Overweight High χ2 = 0.31 (NS) High vs. Low Eutrophic χ2 = 13.41* (p<0.001) high < low NS = non-significant

High-income bracket with 1 3 4

w/o 29 27 56

Total 30 30 60

Low-income bracket % with 3.3 10.0 6.7

with 13 8 21

w/o 17 22 39

Total 30 30 60

% with 43.3 26.7 35.0

Low χ2 = 1.83 (NS) Overweight χ2 = 2.78 (NS)

einstein. 2011; 9(1 Pt 1):24-30

Einstein v9n1.indb 27

24.03.11 19:34:56


28

Spada PV, Escrivão MAM, Nóbrega FJ, Juliano Y

Table 4. Mothers of eutrophic and overweight children of low and high-income brackets according to result (adequate or compromised) of the evaluations of the Mother/ Child Bonding Assessment Protocol and of Beck Depression) Eutrophic of high-income bracket Bond Adequate Adequate 10 Compromised 19 Total 29 Mc Nemar test p = 0.0000 % of agreement 11/30 = 36.7% % of disagreement 19/30 = 63.3%

Eutrophic of low-income bracket Compromised 0 1 1

Total 10 20 30

Bond Adequate Adequate 8 Compromised 9 Total 17 Mc Nemar test p = 0.0019 % of agreement 21/30= 70.0% % of disagreement 9/30 = 30.0%

Compromised 0 3 3

Total 8 22 30

Bond Adequate Adequate 9 Compromised 13 Total 22 Mc Nemar test p= 0.0036 % of agreement 15/30= 50% % of disagreement 15/30= 50%

Mothers of high-income overweight children Bond Adequate Adequate 8 Compromised 19 Total 27 Mc Nemar test p= 0.0000 % of agreement 11/30 = 36.7% % of disagreement 19/30 = 63.3%

Compromised 0 13 13

Total 8 22 30

Compromised 2 6 8

Total 11 19 30

Mothers of low-income overweight children

DISCUSSION In this study, there was no significant difference in the results between the presence of depression and level of schooling, marital status, occupation, and maternal nutritional status or between the mother/child bond and the variables analyzed, although the bond was significantly compromised in the entire sample. However, in associating variables (presence of depression in mothers of high- and low-income brackets and nutritional status), it was noted that those with high economic conditions showed less depression than those of low-income bracket. This may easily be understood, since it is known that a precarious economic condition may be a factor of risk to the well-being of families, generating suffering for mothers, besides interfering negatively in verbal and cognitive stimulation, which results from a good mother/child relationship (5,10,16). Nevertheless, the association between the bond and the mothers’ economic condition showed no significant result, that is, income was not a determining factor for a good mother/child bond. The fact of the mother having better economic conditions does not determine the quality of her relationships. Good financial conditions, however, may help in the provision of the family’s basic needs, which can generate in the mother a feeling of physical and emotional comfort. In addition, it enables her to have better access to medical care, when necessary. To become ill without having the resources to care for oneself and one’s children is a stress factor that can lead to depression. It can be assumed, then, that the good financial status allowed mothers to invest in good quality of life, thus justifying the result found (17).

Another finding of the present study refers to mothers with three or more children showing more depression than mothers with less than three children. It can be supposed that depression found may be tied to stress and concerns with rearing one’s children satisfactorily. This concern is always dependent on financial conditions. Today, regardless of the economic bracket, the number of women who work outside the home to guarantee the support of their families has grown expressively. On the one hand, women feel responsible for tending to their homes, their children, and their husbands, and are constantly trying to conciliate activities outside and inside the home (18). On the other hand, their partners do not always show appreciation for their efforts, which leads to feelings of abandonment, loneliness, and possibly, depression. Depressed mothers show less affection, play less with their children, are more hostile, dissatisfied, and adopt more punitive and controlling attitudes with their children; they may become more introverted and even insensitive to their children’s health and safety (19). Actually, mothers with compromised bonding with their child, lack of support from their companion, stress due to the work load, with three or more children to tend to, caring for their physical/psychological needs and still having to care for themselves, their homes, and their husbands, probably will be less available emotionally. The pleasure that they could have in their affective relationships, especially with their children, is transformed into obligation as a result of an accumulation of tasks, and this is one of the factors that may justify the result found; additionally, the fact that most mothers have a companion is not sufficient, in and of itself, for them to feel understood, loved, and valued (20,21).

einstein. 2011; 9(1 Pt 1):24-30

Einstein v9n1.indb 28

24.03.11 19:34:57


Mother/child bond in mothers of overweight and eutrophic children: depression and socioeconomic factors

On the other hand, mothers with less than three children (and less depressed) may have found more time to dedicate to pleasurable activities and to themselves, which favors this relationship. They also may have encountered more room for tending to their relationship with their partner and to their own emotional lives (19). Possibly, the points mentioned may be an explanation for the results obtained in the present investigation. Also found in this study, were mothers under 30 years of age who displayed more depression than mothers 30 years of age or older. One of the possible explanations may be the fact that they had not been adequately stimulated by their own mothers or that they were unable to establish a safe affective bond, which may have been reflected negatively in their feeling of security when facing difficulties in life. Knowing that maternal depression interferes in childhood development and may cause negative effects, mothers under 30 years of age, possibly daughters of depressed mothers, are more susceptible to affective disorders and a negative self-image, besides feeling incompetent as mothers, and, consequently, they also evaluate their children in a negative way (3,19,20). In contrast mothers 30 years of age or more showed less depression. Maturity brought by life experience may have made them feel more effective. Nevertheless, it is possible that the genesis of this feeling is found in the first affective relationship, when their self-confidence and autonomy received the necessary investment for a healthy development (4,20). These are possibilities that may give meaning to the results obtained. As to the mother/child bonding study, no significant result was found among the variables analyzed, although, as mentioned, the bond was significantly compromised in all mothers. Regardless of economic and nutritional status, the mothers displayed greater impairment in this bonding than in the presence of depression. One of the hypotheses that can be made is in regard to the mother’s experiences during her own childhood, of situations of privation of affection from her own mother, which interfered in her capacity to adequately perform her own maternal roles. The quality of affection and behaviors adopted by parents significantly influences those to be adopted by their children in their current and future relationships, and which will be transmitted from generation to generation (21) . It is probable, therefore, that the mothers in this sample had relational problems with their own mothers, which compromised not only their own bonding with their mothers, but with their children as well, and this could be one of the reasons for the given finding. It is not possible, however, to avoid discussing the fact that no association was found in the statistical analysis between the compromised bond and the presence of depression. The mother who is impaired in her bonding with her child might not have had, among other aspects,

29

positive parental models that allowed her to develop a secure bond with her child. Perhaps she experiences more moments of tension than moments of pleasure when she is with the child, which may be reflected in other factors of her life, such as her marital relationship. If one considers that it is in family relations that meaning for our emotional experiences is formed, on which one can test one’s ability to perform well the role of parenthood, which is a place where feelings of fulfillment and failure are most evident, both in the man and in the woman (22), then it is unlikely that this mother will be insensitive to a lack of harmony in her own home, unless she is depressed. In this condition, she may deny the child her affection, thus hindering good bonding between the two and the child’s healthy development (8-10,17- 23). The fact that no association was found between the compromised bond and depression might be justified by the fact that many women do not fit the diagnostic criteria for depression, as per the Diagnostic and Statistical Manual of Mental Disorders - DSMIV(24) and may present with symptoms that provoke a functional incapacity comparable to or worse than what is seen in clinical pictures with established chronicity. Such symptoms may be classified as Common Mental Disorders (CMD) (25) and their prevalence is greater in women. The symptoms include insomnia or excessive sleep, irritability, fatigue, agitation, memory and concentration difficulties, feeling of unworthiness or guilt, and somatic complaints. Even presenting with this picture, there is no search for the necessary treatment, and when it occurs, the patients may be underdiagnosed due to the variation in presentation and intensity of symptoms. Many times they are neglected by the women herself, by her husband, or by family members, who attribute the symptoms to being tired due to housework and taking care of the children (26). In this sense, the result found is comprehensible. It is probable that the mothers in this sample, who presented with compromised bonding, had also presented with CMD. Maybe, if the Self-Reporting Questionnaire, SRQ (27) had been applied, a screening instrument for non-psychotic mental disorders, it would have been possible to positively associate CMD and compromised bonding. We do not believe that this represents a limitation to this study, since it answers important questions and raises other equally intriguing issues that merit and justify continuous scientific investigation.

CONCLUSION We gather from the results found that the presence of maternal depression and of compromised mother/child bonding, even though not incapacitating in some cases for infant care, may negatively interfere in the child’s social, einstein. 2011; 9(1 Pt 1):24-30

Einstein v9n1.indb 29

24.03.11 19:34:58


30

Spada PV, Escrivão MAM, Nóbrega FJ, Juliano Y

cognitive, physical, and psychological development, as well as in its future affective relationships.

Programa-Einstein-na-Comunidade-Paraisopolis/Paginas/programa-einsteinna-comunidade-paraisopolis.aspx 13. Patton M. Qualitative evaluation and research methods. California: Sage Publications, Newbury Park; 1990.

ACKNOWLEDGMENTS The Coordination for the Improvement of Higher Education Personnel (CAPES). REFERENCES

14. Goreinstein C, Andrade L, Vieira Filho AHG, Tung TC, Artes R. Psychometric properties of the Portuguese version of the Beck Depression Inventory on Brazilian College Students. J Clin Psychol. 1999;55(5):553-62. 15. World Health Organization. Obesity. Preventing and managing the global epidemic. Geneva: WHO; 1998. 16. Siegel S, Castellan JRNJ. Estatística não paramétrica para ciências do comportamento. Porto Alegre: Artmed; 2006.

2. Bowlby J. Some pathological processes set in train by early mother-child separation. F Ment Sci. 1953;99(415):265-72.

17. Weber LND, Prado PM, Viezzer AP, Brandenburg OJ. Identificação de estilos parentais: o ponto de vista dos pais e dos filhos. Psicol Reflex Crit. 2004;17(3):323-31.

3. Spitz RA. O primeiro ano de vida. São Paulo: Martins Fontes; 1983.

18. Winnicott DW. Os bebês e suas mães. São Paulo: Martins Fontes; 1994.

4. Klaus MH, Kennel JH. Pais/bebê: a formação do apego. Porto Alegre: Artes Médicas; 1992.

19. Paniz VMV, Fassa AG, Silva MC. Conhecimento sobre anticoncepcionais em uma população de 15 anos ou mais de uma cidade do sul do Brasil. Cad Saúde Pública. 2005;21(6):1747-60.

1. Bowlby J. Apego – a natureza do vínculo. São Paulo: Martins Fontes; 2002.

5. Cicco MF, Paiva MC, Gomes IC. Família e conjugalidade: o sintoma dos filhos frente à imaturidade do casal parental. Psicologia Clínica. 2005;17(2):53-63. 6. Piccinini CA, Moura MLS, Ribas AFP, Bosa CA, Oliveira EA, Pinto EB, et al. Diferentes perspectivas na análise da interação pais-bebê/criança. Psicologia Reflexão e Crítica. 2001;14(3):469-83. 7. Fleck AC, Wagner A. A mulher como a principal provedora do sustento econômico familiar. Psicol Estud. 2003;8(no. esp.):31-8. 8. Gomes IC, Paiva MLSC. Casamento e família no século XXI: possibilidade de holding. Psicol Estud. 2003;8(no. esp):3-9. 9. Nóbrega FJ, Campos AL, Nascimento CFL. Distúrbios nutricionais e fraco vínculo mãe/filho. Rio de Janeiro: Revinter; 2000. 10. Colugnati F, Taddei CJAA. Propriedades psicométricas do Instrumento de Avaliação do Vínculo Mãe/Filho. In: Nóbrega FJ, organizador. Distúrbios da nutrição na infância e na adolescência. Rio de Janeiro: Revinter; 2007. p. 151-65. 11. Nóbrega FJ. Vínculo mãe/filho. Rio de Janeiro: Revinter; 2004. 12. Programa Einstein na Comunidade de Paraisópolis [Internet]. Brasil: Sociedade Beneficente Israelita Brasileira [updated 2007; cited 2009 Feb 17]. Available at: http://www.einstein.br/responsabilidade-social/Programas-Comunitarios/

20. Brum EHM, Schermann L. O impacto da depressão materna nas interações iniciais. Psico. 2006;37(2):151-8. 21. Cruz EBS, Simões GL, Cury AF. Rastreamento da depressão pós-parto em mulheres atendidas pelo programa de Saúde da Família. Rev Bras Ginecol Obstet 2005;27(4):181-188. 22. Brazelton TB, Cramer BG. As primeiras relações. São Paulo: Martins Fontes; 1992. 23. Bretherton, I. The origins of attachment theory: John Bowlby and Mary Ainsworth. Developmental Psychology 1992;28:759-775. 24. DSM IV – Manual diagnóstico e estatístico de transtornos mentais. Trad Dayse Batista. Porto Alegre: Artes Médicas; 1995. 25. Maragno L, Goldbaum M, Gianini RJ et al. Prevalência de transtornos mentais comuns em populações atendidas pelo Programa Saúde da Família (QUALIS) no Município de São Paulo, Brasil. Cad Saúde Pública 2006;22(8):1639-1648. 26. Carvalhaes MABL, Benício MHA. Capacidade materna de cuidar e desnutrição infantil. Rev Saúde Pública 2002;36(2):188-97. 27. World Health Organization. AUser’s Guide to the Self Reporting Questionnaire (SRQ), WHO/MNH/PSF/98.1. WHO, Geneva, 1994.

einstein. 2011; 9(1 Pt 1):24-30

Einstein v9n1.indb 30

24.03.11 19:34:58


ORIGINAL ARTICLE

Habituation of the blink reflex in the neonatal period and development of auditory processing Habituação do reflexo cócleo-palpebral no período neonatal e desenvolvimento auditivo Celina Rech Maggi1, Luciane da Costa Pacheco2, Tânia Tochetto1, Maiara Santos Gonçalves1, Fleming Salvador Pedroso3

ABSTRACT Objective: To check the existence of an association between the presence/absence of the blink reflex habituation in the neonatal period and auditory processing development. Methods: The occurrence of blink reflex habituation was studied in 33 neurologically normal neonates, aged between 9 and 25 months, who had their behavioral responses analyzed and classified according to Azevedo (1993). Habituation of the blink reflex was verified using 90-dB sound stimulus. The stage of auditory processing development was evaluated through 41-dB sound stimulus. Statistical data were analyzed with Fischer and χ2 tests. Results: Out of the 33 studied children, 22 presented blink reflex habituation in the first stage of the study. In 7 of them, the auditory processing stage matched their chronological age, while in 15 of them the auditory processing stage was not in accordance with their chronological age. Eleven children failed to present habituation of the blink reflex in the first stage of the study. From this group, eight children presented auditory responses that were appropriate to their chronological age, whereas three had inappropriate responses. A statistically significant association between the presence of blink reflex habituation and auditory processing delay was verified, in addition to an association between the absence of the blink reflex habituation and chronologically suitable responses. Conclusions: The presence of blink reflex habituation in the neonatal period does not seem to be a predictive factor of suitable auditory processing. Keywords: Habituation, psychophysiology; Blink reflex; Infant, newborn; Hearing; Auditory perception; Language

RESUMO Objetivo: Verificar a existência de associação entre presença/ ausência de habituação do reflexo cócleo-palpebral no período neonatal bem como o desenvolvimento do processamento auditivo. Métodos: Pesquisou-se a ocorrência de habituação do reflexo cócleopalpebral em 33 neonatos neurologicamente normais, os quais, entre 9 e 25 meses de idade, tiveram suas respostas comportamentais

avaliadas e classificadas segundo Azevedo (1993). A habituação do reflexo cócleo-palpebral foi verificada utilizando-se estímulo sonoro de aproximadamente 90 dB. A etapa do desenvolvimento do processamento auditivo foi avaliada com estímulo sonoro aproximado de 41 dB. A análise estatística dos dados foi realizada por meio dos testes Fischer e χ2. Resultados: Das 33 crianças estudadas, 22 evidenciaram habituação do reflexo cócleo-palpebral na primeira etapa do estudo. A etapa do processamento auditivo de 7 delas foi considerada adequada à idade cronológica e de 15 inadequada. Onze crianças não evidenciaram habituação do reflexo cócleo-palpebral na primeira etapa do estudo. Desse grupo, oito crianças manifestaram respostas auditivas adequadas para a idade cronológica e três inadequadas. Verificou-se associação estatisticamente significante entre presença de habituação do reflexo cócleo-palpebral e atraso nas etapas do processamento auditivo, e também entre ausência de habituação do reflexo cócleo-palpebral e respostas adequadas à idade cronológica. Conclusões: A presença de habituação do reflexo cócleo-palpebral no período neonatal parece não ser fator preditivo do adequado desenvolvimento do processamento auditivo. Descritores: Habituação psicofisiológica; Reflexo cócleo-palpebral; Recém-nascido; Audição; Percepção auditiva: Linguagem

INTRODUCTION Habituation is the decrease or the interruption of a response after repeated applications of the same stimulus(1), which is conditioned to the integrity of the central nervous system (CNS)(2). One of the responses that tend to develop habituation is cochleopalpebral reflex or blink reflex(3). This is one of the most significant reflexes found in neonates submitted to loud sound stimuli(4). Auditory processing involves reception and interpretation of sound stimuli. Auditory processing

Study carried out at Research Laboratory for Pediatric Development at the Center of Speech and Audiology, Universidade Federal de Santa Maria – UFSM – Santa Maria (RS), Brazil. 1

Universidade Federal de Santa Maria – UFSM – Santa Maria (RS), Brazil.

2

Graduate Program of Human Communication Disorders of Universidade Federal de Santa Maria – UFSM – Santa Maria (RS), Brazil.

3

Pediatric Departamento of Universidade Federal de Santa Maria – UFSM – Santa Maria (RS), Brazil. Received: Sep 07, 2009 – Accepted: Jan 24, 2011 Corresponding author: Celina Rech Maggi - Av. Silva Jardim, 34/703 – Centro – CEP: 95560-000 – Torres (RS), Brazil – Tel.: 51 3664-2119 – e-mail: crechfono@yahoo.com.br

einstein. 2011; 9(1 Pt 1):31-5

Einstein v9n1.indb 31

24.03.11 19:34:59


32

Maggi CR, Pacheco LC, Tochetto T, Gonçalves MS, Pedroso FS

disorder in children could result from neurological disorder, morphological disorganization or maturational delay(5). During the first year of life, the skill to identify the sound source enables assessing the auditory processing development(6). Habituation to sound stimulus and auditory processing may be interconnected, which depends on appropriate operation of the CNS. In 1985, absence of habituation to repeated sound stimuli was associated with future auditory processing disorders in a study carried out with 32 newborns with normal hearing and 32 who failed hearing screening that were reassessed eight years later(7). In 1995, such findings were confirmed by a habituation study on startle reflex in neonates(8). There was no literature evidence associating blink reflex habituation in the neonatal period and later auditory processing development. Therefore, based on previously conducted studies, the present investigation aimed to define the correlation between the blink reflex habituation phenomenon observed during the first month of life and the development of auditory processing skills. Better understanding of this correlation may support early detection and prevention of auditory processing deficits.

OBJECTIVE The purpose of the study was to check the existence of an association between blink reflex habituation during the neonatal period and suitability of auditory processing development to chronological age, six months later.

Thus, a total of 33 children were assessed, and 13 were males. At the time, age ranged from 9 to 25 months. Data collection was made between May and August 2006 in the Research Laboratory for Pediatric Development (Laboratório de Pesquisa em Desenvolvimento Infantil - LaPeDI), at the Center of Speech and Audiology, Universidade Federal de Santa Maria -UFSM. Informed consent was obtained from the parents/ guardians of the children. To determine the auditory processing stage, the distraction technique (10) was used, observing behavioral responses to non-calibrated sounds produced by a plastic rattle with broad frequency spectrum and approximate intensity of 41 dB. To expand the distraction technique and to observe behavioral responses, the child was positioned seated on the lap of adults, away from their body and held by the waist, in an audiometric booth. An examiner attracted the attention of the child using visual stimulus. At the same time, another examiner (not within the child’s visual field) presented the sound stimulus at the positions lateral to the ear pinna, above and below the head. The expected response was localization of the sound source. The responses were considered appropriate in accordance with the chronological age, as shown below: - Between 6 and 9 months of age: lateral localization (right/left), indirect localization from below; - Between 9 and 12 months of age: lateral localization, directly localization from below and indirectly from above; - Between 12 and 15 months of age: lateral localization, direct localization from below and indirect from above (11).

METHODS A longitudinal study was carried out and the first stage comprised the occurrence of blink reflex habituation in 85 neonates with no evidence of neurological disorders. To that end, blink reflex was elicited using sound stimuli of about 90 dB produced by agog bells. Habituation was confirmed when the child had no response to blink reflex for three consecutive times(9). It was noticed that 56 of them developed habituation to sound stimuli, whereas 29 did not(9). The present study refers to the second stage, performed six months later. The parents or guardians of 44 children out of 85 who had participated in the first stage were contacted over the telephone. Two of them refused to take part in the second study; six did not come for the scheduled visit, and three were not assessed because they were crying and they did not come for the new schedule that was made to them.

The responses that were not within the parameters set as reference were considered to be inappropriate. Moreover, the variables that could generate false results, such as visual, tactile and/or olfactory cues were controlled. The association between the variables was checked using the chi-squared test (χ2). When one of the expected frequencies was below 5%, the Fischer exact test was used for tables 2 x 2. To test the association between gender and auditory processing stage and the frequency of habituation and auditory processing stage, we used the χ2 test. Fischer exact test was used to test the association between gender and frequency of habituation and also gender and auditory processing. The acceptable significance level was 5%. This study is part of the activities of the research project named “Preventive medicine in rooming-in babies at HUSM based on early detection of risk factors

einstein. 2011; 9(1 Pt 1):31-5

Einstein v9n1.indb 32

24.03.11 19:35:00


Habituation of the blink reflex in the neonatal period and development of auditory processing

for children developmentâ&#x20AC;?, approved by the Ethics Committee of UFSM, under number 095/04.

RESULTS Figure 1 shows the occurrence of blink reflex habituation checked in neonatal period according to child gender (first step of the study). There were no statistically significant differences between boys and girls concerning presence or absence of blink reflex habituation(9). In the second stage of the study, upon assessing auditory processing, there were no statistically significant differences between the genders (Figure 2). Thus, the results obtained for both genders were analyzed together. Figure 3 shows the results of the auditory processing assessment without gender differentiation. Considering the children who showed habituation of blink reflex in the first step of the study, there was predominance of inappropriate results according to age in the assessment of auditory processing. Among those that did not show blink reflex habituation in the first stage, there was predominance of appropriate performance in auditory processing (Figure 4). DISCUSSION The occurrence of blink reflex habituation during the neonatal period was similar in both genders (Figure 1), even though habituation to repeated auditory stimuli occurs more rapidly in girls(12). The performance of girls and boys in the assessment of auditory processing stage did not show statistically significant differences (Figure 2), as reported by other authors(6,13). The absence of association between presence of blink reflex habituation and appropriate behavioral responses for chronological age was observed, as expected. Similarly, children who have not manifested blink reflex habituation in the neonatal period predominantly had auditory responses appropriate for their age (Figure 4). Such results are not in accordance with the literature studied, which states that absence in habituation to repeated sound stimuli may predict future abnormalities of auditory processing(7,8). The correlation between repeated auditory stimuli habituation and auditory processing may be understood based on many studies that correlate both functions to CNS integrity, since the first years of life(14-20). Habituation is a basic learning skill linked with CNS integrity(16), a phenomenon that belongs to stimuli processing(17). Such phenomenon would depend on

14 12 10 8 6 4 2 0

33

Female Male

Habituated

Non habituated

Figure 1. Occurrence of habituation of the blink reflex in the neonatal period, according to gender. p = 1.00 - Fisher exact test

10 8 6

Female Male

4 2 0 Adequated auditory processing

Non adequated auditory processing

Figure 2. Performance in assessment of auditory processing according to gender; p = 0.515 - Fisherâ&#x20AC;&#x2122;s exact test

45.50% 54.50%

Non adequated auditory processing Adequated auditory processing Figure 3. Results of assessment of auditory processing.

16 14 12 10 8 6 4 2 0

Presence of habituation of the blink reflex

Absence of habituation of the blink reflex

Adequated auditory processing Non adequated auditory processing Figure 4. Occurrence of habituation of the blink reflex and performance in assessment of auditory processing. p = 0.026* - Chi-squared test

einstein. 2011; 9(1 Pt 1):31-5

Einstein v9n1.indb 33

24.03.11 19:35:01


34

Maggi CR, Pacheco LC, Tochetto T, Gonçalves MS, Pedroso FS

active cortical inhibition of response(14) and it would be a common neuron reaction, involving physiology of the neurons, as well as the interneural, intercortical and probably cortical-subcortical connections(19). The habituation phenomenon could identify possible deficits in CNS operation(18). Conditions that affect this system would act similarly over habituation(15). Auditory processing is also related with central auditory functions(7, 21,22). Auditory processing disorder in children can result from neurological disorder, morphological disorganization, maturational delay(5), neuromorphological dysfunction, delay in central nervous system maturation, and neurological and otological disorders, diseases or lesions(23). Based on literature data, children who did not show blink reflex habituation in the first step of the study were expected to present inappropriate auditory responses to their chronological age, which did not prove to be true. A possible maturation of the central auditory system between the first and the second tests was considered. Abnormalities of auditory assessment found in high-risk children may disappear in the second half of the first year. This fact could be attributed to the CNS maturation process. When this normalization does not take place, auditory processing abnormalities may have resulted from neurological impairment(7). According to some authors, the auditory system is immature at birth and goes through many changes during the postnatal period(24). Others argue that the baby auditory system, being plastic, could be modified by acoustic stimuli(25). Sound localization skills depend on innate biological capability and environmental experiencing(26). Poor acoustic stimulation could be responsible for the high percentage of inappropriate responses to chronological age (54%). It should also be taken into account that there are slight differences in auditory development stages according to different authors(11,21,25). The sample in the present study could have differed concerning the environmental and regional characteristics of the sample taken as a parameter for this study(11). Habituation should be analyzed in the neonatal hearing assessment to detect early signs of auditory processing deficit(7,8). However, results present in this study make us believe that the occurrence of blink reflex habituation in the neonatal period does not seem to be a predictive factor for appropriate auditory processing development. The influence of auditory processing abnormalities over the development of language skills has been highlighted in many studies(22,27-30). Therefore, further investigations about early manifestations of auditory

processing disorders are required to minimize and prevent occasional linguistic difficulties. Other studies may clarify possible causes of abnormalities to auditory processing, considering differences in environmental stimulation and neurodevelopment conditions.

CONCLUSION Based on the results found in this study, the presence of blink reflex habituation in the neonatal period does not seem to be a predictive factor of the appropriate development of auditory processing between 9 and 25 months of age. REFERENCES 1. Morokuma S, Fukushima K, Kawai N, Tomonaga M, Satoh S, Nakano H. Fetal habituation correlates with functional brain development. Behav Brain Res. 2004;153(2): 459-63. 2. James D. Fetal behaviour. Current Obst Gynaecol. 1997;7:30-5. 3. Hodgson WR. Avaliação de bebês e crianças pequenas. In: Katz J. Tratado de Audiologia Clínica. São Paulo: Manole; 1999. p. 461-72. 4. Azevedo MF, Vieira RM, Vilanova LCP. Desenvolvimento auditivo de crianças normais e de alto risco. São Paulo: Plexus; 1995. 5. Musiek FE, Baran JA, Pinheiro ML. Central auditory processing disorders in children and adults with learning disabilities. In: Musiek FE, Baran JA, Pinheiro ML. Neuroaudiology case studies. San Diego: Singular; 1993. 6. Costa AS, Azevedo MF, Fukuda Y. Localização sonora em crianças: grau de movimentação da cabeça e latência de resposta. Pró-Fono. 2003;15(2): 160-80. 7. Mencher GT. Hearing screening programs and identifications of central auditory disorders. Hum Commun Can. 1985;9(4):45-9. 8. Zanchetta S, Suzuki MR, Azevedo MF, Vilanova LC, Goulart AL. Identificação de alterações auditivas centrais em crianças de alto risco. Acta Awho. 1995;25(2):65-8. 9. Maggi CR, Tochetto T, Pacheco LC, Gonçalves MS, Pedroso FS. Habituação do reflexo cócleo-palpebral em neonatos. Temas Desenvolv. 2006;15 (85-86):35-7. 10. Ewing I, Ewing AWG. The ascertainment of deafness in infancy and early childhood. J Laryngol Otol. 1944;59:309-33. 11. Azevedo MF. Avaliação subjetiva da audição no primeiro ano de vida. Temas sobre Desenvolvimento. 1991;3:11-4. 12. Mencher GT, Mencher LS, Rohland SL. Maturation of behavioral response. Ear Hear. 1985;6(1):10-4. 13. Soares CD. Habilidades de sequencialização sonora não verbal e verbal e de localização sonora em pré-escolares. Pró-Fono. 1998;10(2): 34-40. 14. Fitzgerald HE. Desenvolvimento dos sistemas de percepção. In: Fitzgerald HE. Psicologia do desenvolvimento: o bebê e a criança pequena. Rio de Janeiro: Campus; 1986. 15. Gandhavadi B, Melvin JL. Electrical blink reflex habituation in mentally retarded adults. J Ment Defic Res. 1985;29(Pt 1):49-54. 16. Kisilevsky BS, Muir DW. Neonatal movement response decrement and recovery to sounds as a function of stimulus intensity. Can J Exp Psychol. 1993;47(4):639-56.

einstein. 2011; 9(1 Pt 1):31-5

Einstein v9n1.indb 34

24.03.11 19:35:02


Habituation of the blink reflex in the neonatal period and development of auditory processing

35

17. Broersen LM, Uylings HB. Visual attention task performance in Wistar and Listar hooded rats: response inhibition deficits after medial prefrontal lesions. Neuroscience. 1999;94(1):47-57.

24. Sharma A, Dorman MF, Kral A. The influence of a sensitive period on central auditory development in children with unilateral and bilateral cochlear implants. Hear Res. 2005;203(1-2):134-43.

18. van Heteren CF, Boekkooi APF, Jongsma HW, Nijhuisc JG. Fetal habituation to vibroacoustic stimulation in relation to fetal states and fetal heart rate parameters. Early Hum Dev. 2001;61(2):135-45.

25. Northern JL, Downs MP. Desenvolvimento do comportamento auditivo. In: Northern JL, Downs MP. Audição em crianças. São Paulo: Manole; 1989. p. 101-41.

19. Backes D apud Pfleiderer B, Ostermann J, Michael N, Heindel W. Visualization of auditory habituation by fMRI. Neuroimage. 2002;17(4):1705-10. 20. Bellieni CV, Severi F, Bocchi C, Caparelli N, Bagnoli F, Buonocore G, et al. Blink-startle reflex habituation in 30-34-week low-risk fetuses. J Perinat Med. 2005;33(1):33-7. 21. Murphy KP. Development of hearing in babies. Child Fam. 1962;1(1):16-27. 22. Jaffe M, Tirosh E, Orian D, Shenhave R. Immature sound localisation and abnormal development. Arch Dis Child. 1986;61(9):858-61. 23. Alvarez AMMA, Ballen S, Misorelli MIL, Sanchez ML. Processamento auditivo: proposta de avaliação e diagnóstico diferencial. In: Munhoz MSL, Silva MLG, Ganança MM, Caovilla HH. Audiologia clínica. São Paulo: Atheneu; 2000. p. 103-20.

26. Pereira LD, Cavadas M. Processamento auditivo central. In: Frota S. Fundamentos em fonoaudiologia: audiologia. Rio de Janeiro: Guanabara Koogan; 2003. 27. Downs MP, Roeser RJ. Auditory disorders in school children. New York: Thieme Medical Publishers; 1988. 28. Flores MAG, Miaciro CV. Estudio de la vía auditiva central por medio de las respuestas evocadas auditivas del tronco encefálico (ABR) en niños con retraso en el lenguaje. An Fac Med. 2003;64(1):27-33. 29. Bishop DVM, Mcarthur GM. Immature cortical responses to auditory stimuli in specific language impairment: evidence from ERPs to rapid tone sequences. Dev Sci. 2004;7(4): 11-8. 30. Kaminski JM, Tochetto T, Mota HB. Maturação da função auditiva e desenvolvimento de linguagem. Rev Soc Bras Fonoaudiol. 2006;11(1):17-21.

einstein. 2011; 9(1 Pt 1):31-5

Einstein v9n1.indb 35

24.03.11 19:35:03


ORIGINAL ARTICLE

Role of adipose tissue-derived stem cells in the progression of renal disease Papel das células-tronco derivadas do tecido adiposo na progressão da doença renal Cassiano Donizetti-Oliveira1*, Patricia Semedo1*, Marina Burgos-Silva1, Marco Antonio Cenedeze1, Denise Maria Avancini Costa Malheiros2, Marlene Antônia dos Reis3, Alvaro Pacheco-Silva1, Niels Olsen Saraiva Câmara4

ABSTRACT Objective: To analyze the role of adipose tissue-derived stem cells in reducing the progression of renal fibrosis. Methods: adipose tissue-derived stem cells were isolated from C57Bl/6 mice and characterized by cytometry and differentiation. Renal fibrosis was established after unilateral clamping of the renal pedicle for 1 hour. Four hours after reperfusion, 2.105 adipose tissue-derived stem cells were administered intraperitoneally and the animals were followed for 24 hours during 6 weeks. In another experimental group, 2.105 adipose tissue-derived stem cells were administered only after 6 weeks of reperfusion, and they were euthanized and studied 4 weeks later. Twenty-four hours after reperfusion, the animals treated with adipose tissue-derived stem cells displayed reduced renal and tubular dysfunction and an increase of the regenerative process. Renal expression of IL-6 and TNF mRNA were decreased in the animals treated with adipose tissue-derived stem cells, while the levels of IL-4, IL-10, and HO-1 were increased, despite the fact that adipose tissue-derived stem cells were not observed in the kidneys via SRY analysis. Results: In 6 weeks, the kidneys of non-treated animals decreased in size, and the kidneys of the animals treated with adipose tissue-derived stem cells remained at normal size and display less deposition of type 1 collagen and FSP-1. The renal protection observed in animals treated with adipose tissue-derived stem cells was followed by a drop in serum levels of TNF-α, KC, RANTES, and IL1a. Treatment with adipose tissue-derived stem cells after 6 weeks, when the animals already displayed established fibrosis, demonstrated an improvement in functional parameters and less fibrosis analyzed

by Picrosirius stain, as well as a reduction of the expression of type 1 collagen and vimentin mRNA. Conclusion: Treatment with adipose tissue-derived stem cells may deter the progression of renal fibrosis by modulation of the early inflammatory response, likely via reduction of the epithelial-mesenchymal transition. Keywords: Mesenchymal stem cells; Renal insufficiency, acute; Reperfusion injury; Fibrosis; Inflammation

RESUMO Objetivo: Analisar o papel das células-tronco derivadas do tecido adiposo na redução da progressão da fibrose renal. Métodos: célulastronco derivadas do tecido adiposo foram isoladas de camundongos C57Bl/6 e caracterizadas por citometria e diferenciação. Fibrose renal foi instaurada após clampeamento unilateral do pedículo renal por 1 hora. Após 4 horas de reperfusão, 2.105 células-tronco derivadas do tecido adiposo foram administradas por via intraperitoneal, e os animais foram acompanhados por 24 horas e 6 semanas. Em outro grupo de experimentos, 2.105 células-tronco derivadas do tecido adiposo foram administradas somente após 6 semanas de reperfusão, e os animais foram sacrificados e estudados 4 semanas mais tarde. Após 24 horas da reperfusão, animais tratados com células-tronco derivadas do tecido adiposo apresentaram reduzida disfunção renal e tubular, além de aumento do processo regenerativo. Expressão renal de RNAm de IL-6 e TNF foi diminuída nos animais tratados com células-tronco derivadas do tecido adiposo, enquanto

Study carried out at Laboratório de Imunologia Clínica e Experimental, na Disciplina de Nefrologia - Departamento de Medicina da Universidade Federal de São Paulo – UNIFESP – São Paulo (SP), Brazil. 1

Clinical and Experimental Immunology Laboratory of the Discipline of Nephrology, Department of Medicine, Escola Paulista de Medicina, Universidade Federal de São Paulo – UNIFESP, São Paulo (SP), Brazil.

2

Department of Pathology of Faculty of Medicine, Universidade de São Paulo – USP, São Paulo (SP), Brazil.

3

Discipline of Pathology of Faculty of Medicine, Universidade Federal do Triângulo Mineiro – UFTM, Uberaba (MG), Brazil.

4

Clinical and Experimental Immunology Laboratory of the Discipline of Nephrology, Department of Medicine, Escola Paulista de Medicina, Universidade Federal de São Paulo – UNIFESP, São Paulo (SP), Brazil. Transplant Immunology Laboratory of the Department of Immunology, Faculty of Medicine, Universidade de São Paulo – USP, São Paulo (SP), Brazil. Corresponding author: Cassiano Donizetti de Oliveira – Rua Borges Lagoa, 678 – Vila Clementino – CEP 04038-001 – São Paulo (SP), Brazil – Tel.: 11 9862-3810 – e-mail: cdo.oliveira@gmail.com Niels Olsen Saraiva Câmara – Escola Paulista de Medicina – Universidade Federal de São Paulo – Rua Botucatu, 740 – Vila Clementino – CEP 04023-900 – São Paulo (SP), Brazil – Tel.: (11) 5904-1699 – Fax: (11) 5904-1894; e-mail: niels@nefro.epm.br This work was supported by the Fundação Brasileira; São Paulo Research Foundation (FAPESP), protocols n°. 09/13251-6 and 07/07139-3; National Council for Research and Development (CNPq), protocol n°. 473844/2009-5; Departamento de Ciência e Tecnologia (DECIT)/Ministério da Saúde e The National Institute of Science and Technology on Complex Fluids (INCT-FCx).

* Both authors contributed equally to the study. The authors declare there is no conflict of interest. Received: Jul 31, 2010 - Accepted: Dec 20, 2010

einstein. 2011; 9(1 Pt 1):36-45

Einstein v9n1.indb 36

24.03.11 19:35:03


Role of adipose tissue-derived stem cells in the progression of renal disease

IL-4, IL-10 e HO-1 foram aumentadas, apesar de células-tronco derivadas do tecido adiposo não serem observadas nos rins por meio da análise SRY. Resultados: Em 6 semanas, os rins dos animais não tratados diminuíram; no entanto, os rins dos animais tratados com células-tronco derivadas do tecido adiposo permaneceram com o tamanho normal e apresentaram menor deposição de colágeno tipo 1 e FSP-1. Proteção renal observada em animais tratados com células-tronco derivadas do tecido adiposo foi seguida por redução nos níveis séricos de TNF-α, KC, RANTES e IL-1a. O tratamento com células-tronco derivadas do tecido adiposo após 6 semanas, quando os animais já apresentavam fibrose instalada, demonstrou melhora em parâmetros funcionais e menos fibrose, analisada pela coloração de Picrosirius, e redução da expressão de RNAm de colágeno tipo I e vimentina. Conclusão: A terapia com células-tronco derivadas do tecido adiposo pode deter a progressão da fibrose renal, pela modulação da resposta inflamatória precoce, provavelmente por meio da redução da transição epitelial-mesenquimal. Descritores: Células-tronco mesenquimais; Insuficiência renal aguda; Traumatismo por reperfusão; Fibrose; Inflamação

INTRODUCTION Despite all efforts in treating acute renal failure (ARF), this syndrome is still associated with high rates of mortality and morbidity. Additionally, it displays a high incidence and may affect about 7% of all hospitalized patients, with a mortality rate close to 50% in patients in Intensive Care Units (ICUs)(1). Among the long-term (1 to 10 years) ARF survivors, approximately 12.5% are dialysis-dependent and 19 to 31% develop chronic renal disease (CRD). This scenario may be due to incomplete reparation and persistent tubulointerstitial inflammation, leading to an increase in proliferation of fibroblasts and activation of myofibroblasts, resulting in excessive deposition of extracellular matrix(2). The epithelial-mesenchymal transition (EMT) has been suggested as the key factor for the development of fibrosis in the progression from ARF to CRD(3-5). EMT may be seen as an adaptive response of epithelial cells after chronic stress or lesion. Hypoxia, oxidative stress, and inflammation may produce and release various chemokines and cytokines that attract and direct the influx of inflammatory cells to the tubulointerstitial space. This cellular infiltrate is activated and produces a mix of soluble factors, including proinflammatory agents, profibrotic cytokines, and metallopeptidase-9 matrix (MMP-9)(6), creating a hostile microenvironment for epithelial and endothelial cells. During the early phase of the inflammatory process in renal fibrosis, cytokines produced by the cell infiltrate such as IL-1, TNF-α, and IFNγ, potentiate tubular EMT triggered by TGF-β, inducing the expression of the TGF-β receptor(7). TGF-β is the primary profibrotic factor, since it promotes the proliferation of fibroblasts, synthesis of the extracellular

37

matrix, and inhibition of collagenase in multiple organs, events that are characteristic of EMT(8,9). Activation of NF-kB-dependent TNF-α also stabilizes the Snail transcription factor (a potent EMT inducer) blocking its ubiquitination and providing another molecular link between inflammation and EMT(10,11). The importance of renal inflammation in initiating and promoting EMT is also manifested by many observations that renal fibrosis is always preceded by and intimately associated with chronic interstitial inflammation(12-14). Adipose tissue-derived stem cells (ADSCs) are adult mesenchymal stem cells(15) that are easily isolated and, when influenced by the extracellular environment, have the capacity, in vitro, to differentiate into other cell types, such adipocytes, myocytes, osteoblasts and neurons. They are known to secrete various growth factors, and therefore, to possess a cytoprotective effect in different lesion models(16). Gimble et al. demonstrated that when present in damaged tissues, ADSCs can secrete cytokines and growth factors that stimulate the recovery and cleansing of toxic substances released at the site of injury, promoting recovery of the surviving cells(17). Various studies demonstrated that ADSCs also have the capacity to regulate responses of the immune system(18,19). They can suppress activation of T-cells by inhibiting expression of cyclin D2(20), by inducing regulator T-cells(21), or by interfering with dentritic cells(21, 22). Additionally, ADSCs may act by means of an anti-apoptotic effect on targetcells, increasing recovery of renal function. Recently, therapies with stem cells have proved to be a new strategy to reduce the progression of CRD. Semedo et al. demonstrated that the administration of mesenchymal stem cells (MSCs) improved histological and functional parameters, besides reducing fibrosis in a model of serious renal ablation. The renal protection resulting from the administration of MSCs also attenuated the chronic hypoxia, oxidative stress, and inflammatory cytokines that lead to EMT and are present during CRD(23,24). Several other studies described the beneficial effects of ADSCs administration. Treatment with ADSCs leads to better vascularization(25), cranial bone regeneration, cardiac wall regeneration, infarcted myocardium function repair, and functional improvement after a cerebrovascular accident. In this study, we proposed that ADSCs may interrupt the progression of renal fibrosis in an animal model of CRD by modulating inflammatory events.

METHODS Isolation of ADSCs Adipose tissue from the inguinal region of the mouse was isolated from male C5Bl/6 mice and digested with 0.075% collagenase IA (Sigma Aldrich, St Louis, MO, einstein. 2011; 9(1 Pt 1):36-45

Einstein v9n1.indb 37

24.03.11 19:35:04


38

Oliveira CD, Semedo P, Silva MB, Cenedeze MA, Malheiros DMAC, Reis MA, Silva AP, Câmara NOS

USA) at 37ºC for 30 minutes. The cell suspension was filtered through a 70 μm filter (BD Biosciences, San Jose, CA, USA) in order to remove tissue debris. The collagenase was then inactivated with fetal bovine serum (FBS) and the cell suspension was washed with a phosphate buffer (PBS) and centrifuged twice, for 5 minutes, at 260 xg each time. The pellet formed was suspended in 0.84% NH4Cl to remove red blood cells. The cells were then washed and centrifuged twice with PBS and cultivated in plastic jars (TPP, Trasadingen, Switzerland) in low-glucose Dulbecco’s modified Eagle medium (DMEM, Gibco, Invitrogen Corporation, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (Emcare, Campinas, SP, Brazil). The cells were cultured for 4 weeks.

ADSCs immunophenotyping The suspension of ADSCs (1 × 105 cells) was incubated for 40 minutes in saturated concentrations of antibodies CD34-FITC, CD105-FITC, CD73-CD45-PE, and PerCP, and controls (all antibodies were acquired from BD PharMingen Biosciences, San Diego, CA, USA). After three washings, the cells were centrifuged at 200 xg during 5 minutes and the resulting pellet was resuspended in a cold phosphate buffer (PBS). Cellular fluorescence was assessed with the use of a flow cytometer (FACSCanto, Becton Dickinson, Franklin Lakes, NJ, USA). ADSCs differentiation The ADSCs were differentiated into adipocytes by treatment with low glucose DMEM, supplemented with 10% FBS and dexamethasone (1 µM), isobutylmethylxanthine (0.5 µM), insulin (10 mg/mL), and indomethacin (100 µM) for 14 days. Differentiated into osteoblasts, the ADSCs were treated with low glucose DMEM FBS, supplemented with 10% dexamethasone (0.1 µM), ascorbic acid (0.2 µM), and beta glycerol phosphate (10 mM) for 28 days. All the reagents were acquired from Sigma-Aldrich. Animal model of CKD Female C57BL/6J mice with 8 weeks of age coming from Centro de Desenvolvimento de Modelos Experimentais (CEDEME) of the Universidade Federal de São Paulo (UNIFESP) were submitted to unilateral renal ischemia, as described by Burne-Taney et al (26). The animals were submitted to abdominal incisions, and their right renal pedicles were dissected. A microvascular clamp (Rocca, São Paulo, SP, Brazil) was placed on the left renal pedicle for 60 minutes, and the animals were maintained at an

approximate temperature of 37ºC. The animals were monitored and maintained for 24 hours, and for 6 and 10 weeks before being euthanized. Sham animals were submitted to the same surgical procedure, but without renal artery clamping. All experimental procedures were approved by the Research Ethics Committee of UNIFESP (CEP process # 1915/2008).

Treatment with ADSCs Four hours after the surgical procedure, one group of animals received ADSCs intraperitoneally and was euthanized 24 hours and 6 weeks after surgery. Another group received ADSCs intraperitoneally 6 weeks after surgery, and was euthanized at the 10th week. About 2x105 cells were administered to each animal. Evaluation of the renal function Serum creatinine was measured by the modified Jaffé method. Serum urea was measured using the Labtest kit (Labtest, Lagoa Santa, MG, Brazil). Morphology The kidneys of the animals euthanized at the 6th and 10th weeks after ischemia were analyzed with the use of Masson and Picrosirius stains. For histological tests, the kidneys were fixed in buffered 10% formaldehyde for 24 hours, washed with 70% ethanol for 24 hours, and then immersed in paraffin. The histological slices were 4 µm thick. In order to assess the degree of expansion of the renal interstitium, the fraction of the renal cortex occupied by the interstitial tissue stained positively for components of the extracellular matrix (collagen) was evaluated quantitatively using Masson staining and a technique of counting consecutive points in microscopic fields, with a final magnification of 100x on a 176point grid. Picrosirius staining was measured with 20x magnification using the NIS-Element Nikon, program of microscopy elements, with at least 20 consecutive fields. Acute tubular necrosis (ATN) was evaluated by a blind reviewer in slices of kidneys stained with hematoxylin and eosin. Real-time polymerase chain reaction Samples of renal tissue were rapidly frozen in liquid nitrogen. The total RNA was isolated using the Trizol reagent (Invitrogen, Carlsbad, CA, USA), and concentrations of RNA were determined by Nanodrop. First, cDNAs were synthesized from MML-V reverse transcriptase (Promega, Madison, USA). Reverse transcriptase and polymerase chain reaction (PCR)

einstein. 2011; 9(1 Pt 1):36-45

Einstein v9n1.indb 38

24.03.11 19:35:05


Role of adipose tissue-derived stem cells in the progression of renal disease

were performed using TaqMan (Applied Biosystem, USA) for molecules: Col-1 (00801666_g1), CTGF (Mm01192931_g1), IL-1β (Mm01336189_m1), IL-4 (Mm00445259_m1), IL-6 (00561420_m1), IL-10 (Mm00439616_m1), iNOS (Mm01309902_m1), HO-1 (Mm00516004_m1), HPRT (Mm00446968_m1), Sry (Mm00441712_s1), TNF-α (Mm00443258_m1), VEGF (Mm01281449-m1), and Vimentin (00449201_m1). The cycles obeyed the following conditions: 10 minutes at 95ºC, followed by 45 cycles of 20 seconds each at 95ºC, 20 seconds at 58ºC, and 20 seconds at 72ºC. RT-PCR was carried out using SYBR Green real-time PCR (Applied Biosystem, USA) for HPRT (sense) 5-CTC ATG GAC TGA TTA ACA TGG GGA C-3 (antisense) 5-GCA GGT CAG CAA AGA TAT ACT AGC C-3; BMP-7 (sense) 5-ATT AGA CTT CCA CCC TCG ATA CC-3 (antisense) 5-TCC TTA TAG ATC CTG TCG AAT GCT-3 and TGF-β (sense) 5-AAC TAT TTC TGC AGC TCC ACA GAG A-3 (antisense) 5-TGG AGT ATG GTA GCC TTG G-3. Sequence detection software 1.9 (SDS) was utilized for the analysis, and mRNA expression was normalized by HPRT. Values are expressed relative to a reference sample (calibrator): samples from the Sham animals. The Ct (limit cycle) for the target-gene and the Ct for the internal control were determined for each sample. Triplicate samples were used. The relative expression of mRNA was calculated by 2ΔΔCT. All experimental samples were expressed as a difference n times the calibrator.

Bioplex The assay kit Bioplex for use in mice with 23 plex of cytokines (Bio-Rad Laboratories, Inc., Hercules, CA, USA) was employed to test samples for the presence of 23 cytokines. The assay was read on the Bioplex matrix suspension system, and data were analyzed using BioPlex software Manager 4.0. Standard curves varied from 32.000 to 1.95 pg/mL. Immunohistochemistry Collagen I (diluted at 1:200; COL-1, Abcam, Cambridge, MA, USA), FSP-1 (diluted at 1:400, S100A4, DAKO), PCNA (diluted at 1:300; clone PC10, DAKO), and Hypoxyprobe (diluted at 1:500; 121 Turnpike Middlesex, Burlington, MA, USA) were carried out on histological slices fixed in paraffin. The slides were previously deparaffinized, rehydrated, and submitted to a solution for Tris-EDTA antigen recovery, with pH 9 and at 95°C. For the Hypoxyprobe, antigen recovery was performed with 10 mM citrate buffer, with pH 6, at 55°C. The activity of endogenous peroxidase was blocked by 3% hydrogen peroxide, besides the

39

blockage with the Protein Block Solution (DAKO, Carpinteria, CA, USA). Next, the slides were incubated with a primary antibody or negative control reagent, followed by incubation with Envision (DAKO), using sequential 30-minute incubations at room temperature. Staining was completed by a 1 to 3-minute incubation with 3.3-diaminobenzidine (DAB) + chromogenic substrate, which resulted in a brown precipitate in the presence of antigen. Counter-staining with hematoxylin was performed. For the analysis of tissue hypoxia, intraperitoneal HypoxyprobeTM_1 (pimonidazole HCl) was administered, at the dose of 60 mg/kg of body weight, approximately 25 minutes before euthanization. After inoculation, HypoxyprobeTM_1 (121 Turnpike Middlesex, Burlington, MA, USA) was distributed throughout all tissues, but it adhered only to certain proteins from cells that had an oxygen concentration lower than 14 micromolar – the equivalent of a partial pressure pO2 = 10 mmHg at 37ºC.

Statistical analysis Data were expressed with mean ± SD. The differences between the two groups were assessed as to statistical significance with Student’s t-test and ANOVA. Differences were considered significant for p < 0.05. RESULTS ADSC isolation and characterization ADSCs were characterized by immunophenotypical assays using a few cell surface markers described in literature(20). CD34, CD73, CD105, and CD45 were evaluated. The expression of CD73 was 24.9 ± 0.9%; CD105: 71.2% ± 19.7; CD34: 6.0 ± 3.8%; and CD45: 6.9% ± 1.9. These results were expected in regard to the immunophenotypical profile described for ADSCs. First passage cells were characterized by differentiation into adipocytes in parallel assays. In cells differentiated into adipocytes, it was possible to visualize red drops of lipids inside the cells stained with Oil Red. The differentiation into osteocytes was performed, and after 28 days, calcium deposits were observed using Von Kossa staining (data not shown). Treatment with ADSCs leads to tissue and systemic immunomodulation In this model, serious ischemia and reperfusion occurred in only one kidney. However, due to the prolonged time of ischemia (1 hour), renal functional parameters were altered. Serum levels of urea were increased in animals subjected to severe ischemia when compared to Sham einstein. 2011; 9(1 Pt 1):36-45

Einstein v9n1.indb 39

24.03.11 19:35:05


40

Oliveira CD, Semedo P, Silva MB, Cenedeze MA, Malheiros DMAC, Reis MA, Silva AP, Câmara NOS

animals. Treatment with ADSCs displayed inferior renal dysfunction (Figure 1A). These results correlated with ATN. Kidneys submitted to ischemia after 24 hours showed a larger area of necrosis (Figure 1B), while ATN was decreased in animals treated with ADSCs. Additionally, the pattern of regeneration was superior in animals treated with ADSCs (Figures 1C and 1E) confirmed by PCNA marking (Figures 1F to 1H). Inflammation plays a significant role in the results of renal ischemia and reperfusion. In addition, it is known that ADSCs lead to immunomodulation. In this sense, we analyzed the expression of mRNA of various cytokines after treatment with ADSCs. The expression of IL-6 mRNA was reduced in the renal tissue of animals treated with ADSCs (Figure 1I). The expression of TNF-α and IL-1β mRNA was also quantified, but no statistical differences were noted (Figures 1J and 1K), although the animals treated with ADSCs showed greater expression. Surprisingly, the expression of the mRNA of anti-inflammatory cytokines IL-4 and IL-10 was increased in the renal tissue of animals treated with ADSCs (Figures 1L and 1M). Systemically, we identified the same immunomodulation pattern found in renal tissue. Serum proinflammatory cytokines, such as IL-1α, IL1β, KC, and IL-12 (p70), were reduced in the group of animals treated with ADSCs (Figures 1N, 1P, 1R, 1T). The levels of IL-6 and IL-13 were also evaluated, but no significant differences were observed (Figures 1O and 1S). RANTES levels were also reduced in animals treated with ADSCs (Figure 1T). In this multiplex assay, G-CSF, GM-CSF, IL-12 (p40), MCP-1, MIP-1β, and levels of TNF-α in animals treated with ADSCS did not differ from untreated animals. Additionally, IL-12, IL-3, IL-4, IL-10, IL-17, MIP-1a and IFNg were not detected in this assay. In order to verify the presence of ADSCs within the kidneys after treatment, the expression of SRY mRNA was amplified by PCR in real-time (Figure 1U). No intensities of SRY mRNA were detected, indicating the absence of these cells within the tissue at this time of the study.

ADSC ceases the progression of fibrosis resulting from severe ischemia After 6 weeks, in this model of reperfusion ischemia, it was noted that the kidney submitted to ischemia was smaller in comparison to the contralateral kidney in non-treated animals. Surprisingly, the ischemic kidney of the animals treated with ADSCs was not reduced in size (Figure 2A). Even so, the levels of creatinine and urea did not change under treatment with ADSCs, possibly due to the presence of the contralateral kidney,

which gradually compensates the functional loss of the damaged kidney (Figures 2B and 2C). This reducedsize kidney also showed a larger area of fibrosis, as demonstrated with Masson trichrome and Picrosirius staining (Figures 2D to 2F). No relevant fibrosis was observed in the sham group. We also quantified the expression of mRNA of a few profibrotic molecules in order to ratify our data as to collagen deposition. Type 1 collagen (Col-1), vimentin, and connective tissue growth factor (CTGF) were evaluated in renal tissue after 6 weeks. Once again, a reduced expression of the mRNA of these molecules was noted in the renal tissue of the animals treated with ADSCs (Figures 3A to 3C). In addition, in order to confirm these results, protein analyses were performed by means of immunohistochemistry for FSP-1 (fibroblastspecific protein 1) and Col-1 (Figure 4).

Immunomodulation of inflammation by ADSCs As early as 24 hours after serious ischemia and reperfusion, a significant modulation of the inflammatory response was noted in animals treated with ADSCs. Since this reduced inflammation at the initial time point could be related to the progression of fibrosis, we investigated the inflammatory pattern inside the kidney and, systemically, 6 weeks after the treatment. Additionally, we quantified a few protective and angiogenic molecules related to tissue repair. In 6 weeks, the expressions in the kidney of proinflammatory cytokines, such as TNF-α and IL-6, were still reduced in the animals submitted to severe ischemia and treated with ADSCs (Figures 3D and 3E). Also, heme oxygenase 1 (HO-1) and the BMP-7/TGFb ratio were increased in the animals treated with ADSCs compared to those not treated (Figures 3F and 3G). Therapy with ADSCs also led to systemic immunomodulation. Serum levels of cytokines were reduced in animals treated with ADSCs. The levels of IL-1α, TNF-α, KC, and RANTES were significantly reduced in treated animals when compared to those not treated (Figures 3K, 3M, 3N, and 3O). IL-6 and other cytokines (IL-1β, IL-10, and IL-17) did not differ between the groups, although a tendency of reduction in animals treated with ADSCs was observed (Figure 3L and supplementary data). Chronic hypoxia, due to rarefied capillaries, is a possible theory to explain the continued progression of renal fibrosis, since low oxygen pressure is an important factor for EMT. Therefore, we analyzed whether tissue hypoxia was reduced in renal tissue by using a probe that detects areas of low pO2. The ischemic kidneys of animals treated with ADSCs demonstrated areas of lower hypoxia (Figure 3J). Additionally, the expression of iNOS mRNA was increased in the kidneys of animals

einstein. 2011; 9(1 Pt 1):36-45

Einstein v9n1.indb 40

24.03.11 19:35:06


Role of adipose tissue-derived stem cells in the progression of renal disease

A

B

C

F

S

D

G

41

E

H

I

J

K

L

M

N

O

P

Q

R

T U

Figure 1. Effects of administration of adipose tissue-derived stem cells after 24 hours of unilateral ischemia.

einstein. 2011; 9(1 Pt 1):36-45

Einstein v9n1.indb 41

24.03.11 19:35:06


Oliveira CD, Semedo P, Silva MB, Cenedeze MA, Malheiros DMAC, Reis MA, Silva AP, C창mara NOS

42

treated with ADSCs, despite significant differences not having been found in the expression of VEGF (Figures 3H and 3I).

A

a B

Reversal of renal fibrosis after treatment with ADSCs We tested the role of ADSCs in reversing an established fibrotic condition. ADSCs were administered 6 weeks after ischemia, and the animals were observed until the 10th week. Amazingly, the kidneys of animals treated with ADSCs showed reduced areas of fibrosis, as per analysis with Picrosirius staining (Figures 5C and 5D). A functional improvement was also noted and correlated with the reduction of these areas of fibrosis (Figures 5A and 5B). Confirming these data, the expression of vimentin mRNA was reduced in animals treated with ADSCs when compared to those not treated (Figure 6). The expression of Col-1 mRNA was also diminished in animals treated with ADSCs, but no significant difference was observed (Figure 6B). In addition, the immunohistochemical test for Col-1 and FSP-1 correlates with the studies of the genes analyzed (Figure 6E). The mRNA expression of protective cytokines such as IL-10 and BMP-7 increased after treatment with ADSCs (Figures 6C and 6D). Once again, despite this functional and histological improvement, ADSCs were not found in the kidney, according to analysis of the expression of SRY mRNA (Figure 6F).

b C

D

E

F

Figure 2. Effects of administration of adipose tissue-derived stem cells in mice after 6 weeks of unilateral ischemia.

DISCUSSION ADSCs were first described by Zuk et al.(27) in 2002. Since then, studies with ADSCs have been growing exponentially. The regenerative properties of ADSCs are greatly attractive for many diseases(28). Fibroproliferative diseases call our attention because the tissue destruction caused by deposition of extracellular matrix leads to functional loss of the organ. This is very important for the kidneys since the balance between cells and extracellular matrix determines their function. CRD is emerging as a worldwide health problem. The plausible therapies for the final stage of renal failure today are dialysis and transplantation. Nevertheless, these treatments do not solve this problem(29). Various comorbidities may cause CRD, but one aspect is always forgotten: persistent inflammation after ARF events(30, 31) . Inflammation is the primary factor in the progression of renal fibrosis. It leads to the transformation of epithelial cells into myofibroblasts, known as EMT(4). There is no consensus as to whether EMT occurs in vivo. However, the role of inflammation in scar formation is not questionable.

einstein. 2011; 9(1 Pt 1):36-45

Einstein v9n1.indb 42

24.03.11 19:35:15


Role of adipose tissue-derived stem cells in the progression of renal disease

A

B

C

F

D

G

43

E

H

I

J

K

L

M

N

O

Figure 3. Expression of cytokines in serum and renal tissue of animals sacrified 6 weeks after reperfusion.

einstein. 2011; 9(1 Pt 1):36-45

Einstein v9n1.indb 43

24.03.11 19:35:34


44

Oliveira CD, Semedo P, Silva MB, Cenedeze MA, Malheiros DMAC, Reis MA, Silva AP, Câmara NOS

B

A

C

D

E Figure 4. Immunohistochemistry of renal tissue after 6 weeks.

A

B

C

D F

Figure 6. Expression of cytokines in renal tissue of animals 10 weeks after reperfusion.

Figure 5. Effects of administration of adipose tissue-derived stem cells in week 6 after ARF, analyzed after 10 weeks.

Despite the functional improvement after acute kidney damage, a residual inflammation may contribute to epithelial stress that leads to fibrosis. In this model of serious unilateral ischemia, residual inflammation leads the kidney to decrease in size due to the cicatricial fibrosis formed. The primary mechanism of action of adult stem cells is immunoregulation(23,24). This occurs by means of a predominantly paracrine effect of the ADSCs, via a “touch and go” phenomenon in which these cells are attracted to the site of the lesion, secrete immune factors, and then leave that tissue or die. This may

explain why ADSCs were not seen in the kidneys of treated animals. In this project, we proposed that ADSCs may inhibit EMT by acting on inflammation. In 24 hours, the animals treated with ADSCs had better functional results correlated with immunomodulation, which is reflected after 6 weeks when smaller areas of fibrosis are observed. In our results, over 10 weeks of analyses we were able to observe that, besides the fibrotic process, ADSCs were capable of reversing this condition of fibrosis. This opens an incredible opportunity for clinical treatment. We focus, then, on inflammatory results. Once again, the animals treated with ADSCs had low levels of inflammation, which might be reflected in the reduced progression of extracellular matrix deposition. In summary, we propose that treatment with ADSCs may lead to a halt in the progression or even to the reversal of the fibrotic process by downregulation of the inflammation, via systemic administration.

einstein. 2011; 9(1 Pt 1):36-45

Einstein v9n1.indb 44

24.03.11 19:35:44


Role of adipose tissue-derived stem cells in the progression of renal disease

REFERENCES 1. Mehta RL, Pascual MT, Soroko S, Savage BR, Himmelfarb J, Ikizler TA, et al. Spectrum of acute renal failure in the intensive care unit: the PICARD experience. Kidney Int. 2004;66(4):1613-21. 2. Levy EM, Viscoli CM, Horwitz RI. The effect of acute renal failure on mortality. A cohort analysis. JAMA. 1996;275(19):1489-94. 3. Kalluri R. EMT: when epithelial cells decide to become mesenchymal-like cells. J Clin Invest. 2009;119(6):1417-9. 4. Kalluri R, Weinberg RA. The basics of epithelial-mesenchymal transition. J Clin Invest 2009;119(6):1420-8. 5. Okada H, Inoue T, Suzuki H, Strutz F, Neilson EG. Epithelial-mesenchymal transformation of renal tubular epithelial cells in vitro and in vivo. Nephrol Dial Transplant. 2000;15 Suppl 6:44-6. 6. Strutz F, Neilson EG. New insights into mechanisms of fibrosis in immune renal injury. Springer Semin Immunopathol. 2003;24(4):459-76. 7. Liu X. Inflammatory cytokines augments TGF-beta1-induced epithelialmesenchymal transition in A549 cells by up-regulating TbetaR-I. Cell Motil Cytoskeleton. 2008;65(12):935-44.

45

17. Gimble JM, Katz AJ, Bunnell BA. Adipose-derived stem cells for regenerative medicine. Circ Res. 2007;100(9):1249-60. 18. Yañez R, Lamana ML, García-Castro J, Colmenero I, Ramírez M, Bueren JA, et al. Adipose tissue-derived mesenchymal stem cells have in vivo immunosuppressive properties applicable for the control of the graft-versushost disease. Stem Cells. 2006;24(11):2582-91. 19. Fang B, Song Y, Zhao RC, Han Q, Lin Q. Using human adipose tissue-derived mesenchymal stem cells as salvage therapy for hepatic graft-versus-host disease resembling acute hepatitis. Transplant Proc. 2007;39(5):1710- 3. 20. Rasmusson I, Ringdén O, Sundberg B, Le Blanc K. Mesenchymal stem cells inhibit lymphocyte proliferation by mitogens and alloantigens by different mechanisms. Exp Cell Res. 2005;305(1):33-41. 21. Aggarwal S, Pittenger MF. Human mesenchymal stem cells modulate allogeneic immune cell responses. Blood. 2005;105(4):1815-22. 22. Ivanova-Todorova E, Bochev I, Mourdjeva M, Dimitrov R, Bukarev D, Kyurkchiev S, et al. Adipose tissue-derived mesenchymal stem cells are more potent suppressors of dendritic cells differentiation compared to bone marrow-derived mesenchymal stem cells. Immunol Lett. 2009;126(1-2): 37-42.

9. Zeisberg M, Yang C, Martino M, Duncan MB, Rieder F, Tanjore H, et al. Fibroblasts derive from hepatocytes in liver fibrosis via epithelial to mesenchymal transition. J Biol Chem. 2007;282(32):23337-47.

23. Semedo P, Correa-Costa M, Antonio Cenedeze M, Maria Avancini Costa Malheiros D, Antonia dos Reis M, Shimizu MH, et al. Mesenchymal stem cells attenuate renal fibrosis through immune modulation and remodeling properties in a rat remnant kidney model. Stem Cells. 2009; 27(12): 3063-73.

10. Bachelder RE, Yoon SO, Franci C, de Herreros AG, Mercurio AM. Glycogen synthase kinase-3 is an endogenous inhibitor of Snail transcription: implications for the epithelial-mesenchymal transition. J Cell Biol. 2005;168(1):29-33.

24. Semedo P, Palasio CG, Oliveira CD, Feitoza CQ, Gonçalves GM, Cenedeze MA, et al. Early modulation of inflammation by mesenchymal stem cell after acute kidney injury. Int Immunopharmacol. 2009;9(6):677-82.

11. Wu Y, Deng J, Rychahou PG, Qiu S, Evers BM, Zhou BP. Stabilization of snail by NF-kappaB is required for inflammation-induced cell migration and invasion. Cancer Cell. 2009;15(5):416-28.

25. Moon MH, Kim SY, Kim YJ, Kim SJ, Lee JB, Bae YC, et al. Human adipose tissue-derived mesenchymal stem cells improve postnatal neovascularization in a mouse model of hindlimb ischemia. Cell Physiol Biochem. 2006;17 (5-6):279-90.

8. Leask A, Abraham DJ. TGF-beta signaling and the fibrotic response. Faseb J. 2004;18(7):816-27.

12. Guijarro C, Egido J. Transcription factor-kappa B (NF-kappa B) and renal disease. Kidney Int. 2001;59(2):415-24. 13. Segerer S, Nelson PJ, Schlöndorff D. Chemokines, chemokine receptors, and renal disease: from basic science to pathophysiologic and therapeutic studies. J Am Soc Nephrol. 2000;11(1):152-76. 14. Lange-Sperandio B, Trautmann A, Eickelberg O, Jayachandran A, Oberle S, Schmidutz F, et al. Leukocytes induce epithelial to mesenchymal transition after unilateral ureteral obstruction in neonatal mice. Am J Pathol. 2007;171(3):861-71. 15. Zuk PA, Zhu M, Mizuno H, Huang J, Futrell JW, Katz A, et al. Multilineage cells from human adipose tissue: implications for cell-based therapies. Tissue Eng. 2001;7(2):211-28. 16. Bi B, Schmitt R, Israilova M, Nishio H, Cantley LG. Stromal cells protect against acute tubular injury via an endocrine effect. J Am Soc Nephrol. 2007;18(9):2486-96.

26. Burne-Taney MJ, Yokota N, Rabb H. Persistent renal and extrarenal immune changes after severe ischemic injury. Kidney Int. 2005; 67(3):1002-19. 27. Zuk PA, Zhu M, Ashjian P, De Ugarte DA, Huang JI, Mizuno H, et al. Human adipose tissue is a source of multipotent stem cells. Mol Biol Cell. 2002; 13(12):4279- 95. 28. Zuk PA. The Adipose-derived stem cell: looking back and looking ahead. Mol Biol Cell. 2010;21(11):1783-7 29. Levey AS, Stevens LA, Coresh J. Conceptual model of CKD: applications and implications. Am J Kidney Dis. 2009;53(Suppl 3):S4-16. 30. Rodríguez-Iturbe B, García GG. The role of tubulointerstitial inflammation in the progression of chronic renal failure. Nephron Clin Pract. 2010;116(2):c81-8 31. Wynn TA. Cellular and molecular mechanisms of fibrosis. J Pathol. 2008;214(2):199-210.

einstein. 2011; 9(1 Pt 1):36-45

Einstein v9n1.indb 45

24.03.11 19:36:33


ORIGINAL ARTICLE

Contrasting roles of donor and recipient TGFB1 and IFNG gene polymorphic variants in chronic kidney transplant rejection Papéis contrastantes das variantes polimórficas dos genes TGFB1 e IFNG do doador e do receptor na rejeição crônica de transplantados renais Verônica Porto Carreiro de Vasconcellos Coelho1,2,3, Rafael Ioschpe1, Cristina Caldas1, Monica Spadafora-Ferreira1,4, João Americo Fonseca5, Maria Regina Alves Cardoso3,6, Selma Aliotti Palacios1, Jorge Kalil1,2,3, Anna Carla Goldberg3,7

ABSTRACT Objective: To assess the long-term impact (minimum of 3 years follow-up) of polymorphisms in cytokine genes in donor:recipient pairs on the results of the transplant. Methods: We compared genetic cytokine polymorphisms and the primary factors of risk for the development of chronic rejection in paired groups of renal transplant patients with and without chronic allograft nephropathy [CAN]. Results: Multivariate analysis indicated that the presence of the highproduction TT genotype (codon 10) of the transforming growth factor beta-1 (TGFB1) was protective in receptors (p=0.017), contrasting with the increased risk when present in donor samples (p=0.049). On the other hand, in the case of the gamma interferon studied, the greater frequency of the high production allele was protective in the analysis of the donor group (p=0.013), increasing the risk of chronic nephropathy of the allograft when present in the recipients (p=0.036). Conclusion: Our results highlight the importance of TGFB1 genotyping in donors, and indicate that polymorphisms in the gene of this cytokine in donor cells might contribute to the development of chronic allograft nephropathy Keywords: Chronic renal allograft dysfunction; Genetic polymorphism; Donor genotype; Transforming growth factor-beta 1; Interferon-gamma

RESUMO Objetivo: Avaliar o impacto de longo prazo (com seguimento mínimo de 2 anos) de polimorfismos em genes de citocinas em pares doador:receptor sobre os resultados do transplante. Métodos:

Comparamos os polimorfismos genéticos das citocinas e os principais fatores de risco para o desenvolvimento de rejeição crônica em grupos pareados de pacientes transplantados renais com e sem nefropatia crônica do aloenxerto [CAN]. Resultados: A análise multivariada indicou que a presença do genótipo TT (códon 10) de alta produção do fator de crescimento transformador beta-1 (TGFB1) era protetor nos receptores (p=0,017), em contraste com o risco aumentado quando presente nas amostras de doadores (p=0,049). Por outro lado, no caso do interferon gama estudado, a maior frequência do alelo de alta produção foi protetora na análise do grupo de doadores (p=0,013), mas aumentava o risco de nefropatia crônica do aloenxerto quando presente nos receptores (p=0,036). Conclusão: Nossos resultados ressaltam a importância da genotipagem de TGFB1 também em doadores, e indicam que polimorfismos no gene desta citocina em células do doador podem contribuir no desenvolvimento da nefropatia crônica do aloenxerto. Descritores: Disfunção renal crônica do aloenxerto; Polimorfismo genético; Genótipo do doador; Fator de crescimento transformador beta-1; Interferon-gama

INTRODUCTION In spite of accumulated knowledge, the reasons why some patients, but not others, with similar clinical backgrounds, develop chronic rejection after renal transplantation are still unclear. The inflammatory nature of rejection has led to the query on the

Study carried out at Instituto do Coração, Faculdade de Medicina, Universidade de São Paulo, - USP - São Paulo (SP), Brazil 1

Instituto do Coração, Faculdade de Medicina, Universidade de São Paulo - USP - São Paulo (SP), Brazil

2

Divisão de Imunologia Clínica e Alergia, Faculdade de Medicina, Universidade de São Paulo, - USP - São Paulo (SP), Brazil

3

Instituto de Investigação em Imunologia - Institutos Nacionais de Ciência e Tecnologia, Brazil

4

Laboratório de Imunogenética, Instituto Butantan, São Paulo, Brazil

5

Unidade de Transplante Renal, Faculdade de Medicina, Universidade de São Paulo - USP - São Paulo (SP), Brazil

6

Departamento de Epidemiologia, Faculdade de Saúde Pública, Universidade de São Paulo - USP - São Paulo (SP), Brazil

7

Instituto Israelita de Ensino e Pesquisa Albert Einstein - IIEPAE - São Paulo (SP), Brazil Autor correspondente: Anna Carla Goldberg - Av. Albert Einstein 627, 2SS, Bloco A - Morumbi - CEP 05652-000 - São Paulo (SP), Brasil. - Tel.: 2151-0941 - e-mail: goldberg@einstein.br Received: Aug 16, 2010 - Accepted: Jan 24, 2011 * Conflicts of interest? none

einstein. 2011; 9(1 Pt 1):46-51

Einstein v9n1.indb 46

24.03.11 19:36:34


TGFB1 and IFNG gene polymorphism in chronic allograft nephropathy

contribution of cytokine gene polymorphisms to the outcome of solid organ grafting, especially in the case of kidneys. Initial studies starting over 10 years ago, in renal transplanted patients, highlighted an association between the high production -308 TNFA allele and a low production IL10 genotype with acute rejection (1, 2) and polymorphic IFNG CA repeat and IL10 genotype in chronic rejection (2). Chronic allograft nephropathy (CAN) is identified by a progressive decline in renal function, and presents with typical histological features. These include the hallmarks of inflammatory processes, such as mononuclear cell infiltration, perivascular and interstitial inflammation, fibrosis, hyperplasia of the intima leading to partial or total decrease of the vascular lumen, tubular atrophy, and even glomerulosclerosis and ischemia. After 10 years, over 50% of patients will have developed CAN (3) culminating with a loss of the graft itself. In spite of the ever-increasing improvement of immunosuppressive protocols, CAN still remains a major problem partly as a result of the use of calcineurin inhibitors. In addition, a variety of factors have been reported associated with the development and progression of CAN. Donor/recipient HLA (Human Leukocyte Antigen) disparity, the basis of alloreactivity and acute rejection, is a major risk factor; donor age, graft cold ischemia time, the number of acute rejection episodes, hyperlipoproteinemia, hypertension, and CMV infection episodes have also been established as factors in the progression of chronic allograft dysfunction (reviewed in detail in (4, 5). In the initial phases of CAN, increased HLA expression and inflammatory cytokines such as IL-1 (Interleukin 1), IFN-γ (Interferon gamma), and TNF-α (Tumor necrosis factor alpha), in addition to MCP-1 (Monocyte chemotactic protein 1) are present, as mononuclear cells infiltrate the kidney and adhere to the endothelium. At a later stage, concomitant to the proliferation of myofibroblasts and intimal hyperplasia, cytokines shift to a type 2 profile, which includes IL-4, IL-10, and TGF-β1 (transforming growth factor beta 1), as well as PDGF (platelet-derived growth factor) and EGF (epidermal growth factor)(6). This combination of factors is responsible for the phenotypic transformation of fibroblasts into myofibroblasts (7). Endothelium and smooth muscle cells stain brightly for TNF-α, PDGF, and TGF-β1 (8). TGF-β1 is also expressed on fibroblasts and areas of fibrosis (9). Though immunohistochemistry studies show that TGF-β1 is present in biopsies from kidneys with either acute or chronic rejection, a clearly enhanced staining of the interstitium is observed in chronic rejection (10). Finally, cyclosporine A, the major immunosuppressant drug used in renal transplanted

47

patients, has been shown to induce TGF-β1 production in a proximal tubular cell line (11), and a similar effect has been described for tacrolimus (12). On the other hand, TGF-β1 has been repeatedly reported as a regulatory cytokine playing an important role in many models of tolerance, contributing to the immunosuppressive capacity of circulating CD4+CD25+ T lymphocytes in vivo (13) .

OBJECTIVE In this study, we investigated genetic polymorphisms of some cytokine genes involved in the first steps and in the progression of atherosclerosis, in addition to known effector-phase and regulatory cytokines, aiming to identify susceptibility genes for CAN (14). Polymorphisms of candidate cytokine genes were compared between groups of donor/recipient pairs with or without CAN, which were matched as best possible for major risk factors for CAN, such as level of HLA disparities, type and age of donor, number of acute rejection episodes, presence of hypertension, and cytomegalovirus (CMV) infection. METHODS Subjects and follow-up This retrospective case:control study comparing two groups of patients, included patients who underwent renal transplantation and their respective donors at Hospital das Clínicas, University of São Paulo School of Medicine. The Ethics Committee approved this study and subjects gave their informed consent for blood sampling. Renal biopsies were performed according to clinical indications and classified according to Banff criteria (15). DNA samples from 102 donor/recipient kidney transplant pairs were analyzed. Most patients received their transplant between 1995 and 2000. Of these, 56 recipients experienced biopsy-proven CAN and 46 were free of CAN with a minimum follow-up of 39 months. The two groups were comparable for major risk factors such as HLA compatibility (with two exceptions, all donor:recipient pairs were haploidentical or non-identical), level of previous sensitization, number of transfusions, and number of acute rejection episodes. Groups were also matched for progression factors such as donor type (living-related or unrelated) and age, presence of hypertension, hypercholesterolemia, and presence of anti-CMV IgG antibodies. The majority of patients were treated with conventional triple immunosuppressive therapy with cyclosporine, azathioprine, and prednisone. However, 68% of the patients were switched to MMF upon diagnosis of CAN, einstein. 2011; 9(1 Pt 1):46-51

Einstein v9n1.indb 47

24.03.11 19:36:35


48

Coelho VPCV, Ioschpe R, Caldas C, Spadafora-Ferreira M, Fonseca JA, Cardoso MRA, Palacios SA, Kalil J, Goldberg AC

Table 1. Demographic and clinical features of the patients with and without chronic allograft nephropathy (CAN) Characteristics Patients with CAN Patients without CAN Pairs 56 46 Gender M/F 26/30 24/22 39 (69.6%)b 35 (76.0%) Living donorsa c 38.37 ± 12.05 34.38 ± 12.13 Donor age 3 (5.4%) 0 Histocompatiblity –ID d 25 (44.6%) 23 (50.0%) Histocompatiblity -HAd 28 (50.0%) 23 (50.0%) Histocompatiblity –NI d Months of follow-up 118.9 ± 35.8 94.4 ± 31.0 Acute rejection episodes (present) 33 (58.9%) 20 (43.5%) CMV positive post-transplant 3 4 28 (50.0%) 20 (30.0%) Hyperuricemia (present) e Graft loss due to CAN 26 (46.4%) 4.27 {1.1-22.0} 1.84 {0.6 - 7.8} Mean of creatinine values (mg/dL) (last measurement)f Pre-transplant transfusions (n≥2) 24 (54,5%) 26 (61,9%) Dyslipidemia 33 (71.7%) 20 (54.1%) Hypertension 40 (81.6%) 31 (81.6%) n for multivariate analysis 44 42 a

Obs: 4 (with CAN) and 9 (without CAN) living donors were unrelated (difference not significant) Values in parenthesis are percentage of total number of patients in the group Values are mean ± standard deviation ( difference not significant by the Student t test for unpaired samples) d ID - HLA identical donor (sibling; 0/6 mismatches) HA - haploidentical donor 1-3/6 mi’smatches NI - nonidentical donor 4-6/6 mismatches e Information not available in 16 CAN and 6 no CAN patients f Values in brackets correspond to the span of values found in the group b c

and some of the more recently transplanted patients received MMF from early on. Demographic features are shown in Table 1.

DNA extraction and genotyping Blood samples were drawn and DNA extracted by DTAB/CTAB (Dodecyltrimethylammonium bromide/ Cetyltrimethylammonium bromide)(16) or alternatively by salting-out methods (17) as described elsewhere. Unless otherwise mentioned, cytokine genotyping of 24 SNPs (single nucleotide polymorphisms) in 18 genes was performed by PCR-SSP (polymerase chain reaction with sequence-specific primers) on ready trays designed for the 13th International Histocompatibility Workshop on Cytokine Polymorphism by the Collaborative Transplant Study center in Heidelberg (http://www.ctstransplant. org/public/reagents.shtml). Briefly, PCR-SSP typing by the Heidelberg kit consisted of 48 PCR primer mixes dispensed in 96-well PCR trays. Master mix (MgCl2 buffer, dNTPs, and glycerol) was combined with 20 U Taq polymerase and 1.2 - 3.0 µg DNA, and dispensed onto the trays. Products were electrophoresed on 2% agarose gel and interpreted as defined by the Workshop protocol. The Heidelberg kit allowed SNP haplotyping for IL1B (-511 C/T and +3692 C/T), TGFB1 (codon 10 C/T and 25 G/C), TNFA (-238 G/A , and -308 G/A) ,

IL2 (-330 T/G and +160 G/T), IL4 (-1098 T/G, -590 C/T and -33 C/T), IL6 (-174 G/C, nt565 G/A), IL10 (-1082 G/A,-819 T/C and -590 A/C), and ICAM1 (G6241R and E465D) genes. The tray also permitted typing for single SNPs in genes coding for IFNG (3´UTR5644 A/T), IL1A (-889 C/T), IL1R (pst1970 C/T), IL1RN (mspa111100 C/T), IL12B (-1188 A/C), and IL4RA (+1902 G/A). MCP1 SNP at position -2518 (A/G) was analyzed by PCR-RFLP, using the following primers: forward CCGAGATGTTCCCAGCACAG and reverse CTGCTTTGCTTGTGCCTCTT (18).

Statistical analysis Bivariate analyses were carried out, using CAN as the dependent variable and the different gene polymorphisms investigated as independent variables. Variables significant in the bivariate analyses were the first entered into the multiple logistic regression models, but all other variables were tested. Two criteria were used to keep variables in the final model: statistical significance (p<0.05) or a clear change in the estimates of the effects of some polymorphisms produced by those not selected in the first step of the analysis (19). The analyses were performed using STATA software, version 8.0. RESULTS We analyzed 17 different gene polymorphisms, mostly cytokines associated with inflammation and/ or atherosclerosis, in both donor and recipient DNA samples. There was no deviation from expected HardyWeinberg proportions in any of the genes analyzed. Most SNPs analyzed, including those from IL1B (2 SNPs), IL4 (3 SNPs), IL10 (3 SNPs), ICAM1 (2 SNPs), and MCP1, were equally distributed in groups with and without CAN, in donor and in recipient samples. Preliminary analyses led us to discard TNFA, IL2, IL6, and IL12B as non-informative in our population due to their very low frequency in the healthy population, and were not tested further. A summary of the allele and haplotype frequencies in all groups is shown in Table 2. In the case of IL1A and IL1B, which are neighboring genes only about 60 kb apart, typing of IL1A alleles in position -889, and IL1B SNPs at -511 and +3962, disclosed at least 6 different haplotypes. However, in almost half of the cases, joint IL1A/IL1B haplotypes could not be unambiguously defined. In other words, a comparison of IL1A/IL1B haplotype distribution in the two groups was not possible. Of all genes analyzed, the sole significant difference disclosed upon Chi-square analysis was the presence of the high producer TT genotype in codon 10 of the

einstein. 2011; 9(1 Pt 1):46-51

Einstein v9n1.indb 48

24.03.11 19:36:36


TGFB1 and IFNG gene polymorphism in chronic allograft nephropathy

Table 2. Summary of allele and haplotype frequencies in groups with and without chronic allograft nephropathy (CAN) Allele/Haplotype Frequency (%)1 Recipient

Donor

Gene SNP position IL1A -889 IL1B -511 IL1B 3962 IL1R PstI 1970 IL1RA Mspa1 11100 IFNG UTR 5644 IL4* -1098/ - 590/ - 33

IL10 -1082/ -819/ -590 MCP1 -2518 ICAM1 G6241R/E465D

TGFB1** cdn10 TGFB1 cdn25 TGFB1 cdn10/cdn25

Allele C T C T C T C T C T A T TTT TCC GTT GCC TTC ACC ATA GCC A G GG GA AG AA T C G C CG TG CC

No CAN 71.1 28.9 57.7 42.3 80.0 20.0 63.3 36.7 35.5 64.5 58.9 41.1 36.0 51.2 1.2 11.6 0.0 30.2 37.7 32.1 73.0 27.0 45.0 48.3 5.0 1.7 56.7 43.3 96.6 3.4 38.9 56.7 4.4

CAN 69.8 30.2 63.0 37.0 80.5 19.5 57.4 42.6 37.7 62.3 59.8 40.2 32.1 58.0 1.2 4.9 3.8 36.7 27.7 35.6 72.0 28.0 37.5 53.6 8.9 0.0 52.8 47.2 92.5 7.5 39.6 52.9 7.5

No CAN 69.6 30.4 59.8 40.2 84.8 15.2 58.7 41.3 30.4 69.6 60.0 40.0 39.1 52.2 1.1 7.6 0.0 34.8 33.7 31.5 67.4 32.6 31.7 56.7 11.6 0.0 44.6 55.4 93.5 6.5 48.9 44.6 6.5

CAN 67.9 32.1 64.8 35.2 83.0 17.0 57.5 42.5 33.6 66.4 63.2 36.8 29.8 55.8 4.8 7.7 1.9 39.6 26.4 34.0 73.6 26.4 37.5 53.6 8.9 0.0 57.6 42.5 91.5 8.5 34.0 57.5 8.5

1 According to the literature, alleles associated with high production are: IL1A (-889*T), IL1B (-511*T; +3962*T), IL1RA (C), IFNG (T), TGFB1 (codon 10*T; codon 25*G), IL4 (-590*T; -33*T), IL10 (-1082*G, -819*C, -590*C), MCP1 (-2518*G) UTR = untranslated region ; Pst1 and Mspa1 = restriction enzymes; cdn = codon * IL4, IL10, ICAM1 data are shown in the form of haplotypes ** TGFB1 data are shown as both allele and haplotype frequencies. TT Genotype (cdn 10) χ2 = 6.547, p = 0.0379

TGFB1 gene (χ2 = 6.547, p = 0.0379), present in almost 40% of transplant recipients with CAN, compared to 15% in the group free of CAN. In the multivariate analysis, the IL1A low production allele was shown to be marginally protective when present in the graft (p=0.052). Results of the multivariate analysis can be seen in Table 3. More importantly, the high production TGFB1 TT genotype (codon 10) was protective in recipients (p=0.017) but conferred increased risk when present in donor samples (p=0.049). Conversely, in the case of IFNG polymorphism, the high production allele

49

was protective in the donor analysis (p=0.013), but increased the risk of CAN when present in recipients (p=0.036). Finally, in spite of our careful matching of groups with and without CAN, and in accordance with published literature, acute rejection was confirmed as a risk factor for CAN (p=0.024). Hyperuricemia was analyzed in a smaller sample (67 instead of 86 pairs) and was also shown to be a risk factor for CAN (p=0.013, C.I. 1.628-63.437, data not shown). On the other hand, donor type, donor age, number of HLA Table 3. Multivariate analysis of gene polymorphisms significantly associated with CAN Chronic rejection (CAN)

OR

ORadj

95%CIadj

p-value

Acute cellular rejection TGFB codon 10 TT recipient genotype TGFB codon 10 TT donor genotype IFNG UTR5644 TT recipient genotype IFNG UTR5644 TT donor genotype

1.87 0.72 2.71 1.16 0.72

4.12 0.07 7.21 5.83 0.16

1.20 - 14.13 0.007 - 0.61 1.01 - 51.29 1.12 - 30.19 0.04 - 0.68

0.024 0.017 0.049 0.036 0.013

ORadj = adjusted for HLA pairing, MCP1 at position -1025 recipient genotype, MCP-1 at position -1025 donor genotype, IL1B SNP at position -511 (T allele) recipient genotype, IL1B SNP at position -511 (C allele) donor genotype, IL1R (pstl 1970) recipient genotype, IL1R (pstl 1970) donor genotype, IL1B at position +3962 (C allele) recipient genotype and the other genotypes in this table.

disparities, presence of hypertension, dyslipidemia, number of pre-transplant transfusions, and months of follow-up, also included in the multivariate analysis, were equally distributed, and thus did not impact the result of the analysis.

DISCUSSION Our case:control analysis of individual gene polymorphisms disclosed a significant increase of the TGFB1 high production genotype in donors from the group with CAN. There was a trend toward significance in several other cytokine gene polymorphisms analyzed, however the relatively low number of patients in this study impacts upon this type of analysis. Thus, in order to counterbalance the lower power of the individual analysis we employed a multivariate analysis where all variables were taken into account. This analysis brought forth clear-cut results, confirming known risk factors like acute rejection episodes, as well as discriminating protective and risk-conferring cytokine gene polymorphisms. This was the case for TGFB1 and IFNG. Donor high production TGFB1 TT genotype (codon 10) was confirmed in a multivariate analysis to be associated with CAN, but the same genotype when present in the recipients conferred protection. In fact, despite TGF-β1´s short-term tubule-repairing effect in the graft, its dominant intra-graft increased production seems to have an overall negative effect adding to progression of chronic rejection, enhancing

einstein. 2011; 9(1 Pt 1):46-51

Einstein v9n1.indb 49

24.03.11 19:36:36


50

Coelho VPCV, Ioschpe R, Caldas C, Spadafora-Ferreira M, Fonseca JA, Cardoso MRA, Palacios SA, Kalil J, Goldberg AC

myofibroblast proliferation and fibrosis. There is growing recognition of the importance of increased TGF-β1 not only when CAN is already present, but also during acute rejection episodes and occurrence of cyclosporine nephrotoxicity, situations clearly associated with the development of CAN (20-22). An enhancement of TGFB1 transcription post-transplantation in the donor graft as a result of genetic polymorphism would partly explain these observations. This outcome contrasts with TGF-β1 production by the recipients´ T lymphocytes, where it is linked to suppression and down-regulation of inflammatory responses, as is largely reported in literature (23). Accordingly, Park et al. (24) found the frequency of TGFB1 lower and of intermediateproducing genotypes (codon 10 CC and codon 25 GG) to be significantly higher in patients with recurrent acute rejection episodes, whereas high producer genotypes were increased in donors of patients with chronic renal allograft dysfunction. It is interesting to point out that this same high producer TGFB1 codon 10 T allele, when present in homozygosis in renal transplant recipients, was reported to be a potential risk for allograft function decline (25). These heterogeneous data may, at least in part, reflect the effect of other relevant factors in CAN, including the positive or negative effect of other gene polymorphisms. The presence of the TT genotype associated with a high production of IFN-γ in the recipient group sample was identified as a risk factor in recipients, whereas when present in donor grafts it conferred protection. We do not have, at present, a good explanation for this last observation. IFN-γ is produced almost exclusively by NKT, NK, and activated T lymphocytes, and thus the only source of donor IFN-γ would be donor lymphocytes still present within the grafts at early time points after transplantation. Supporting a protective role for IFN-γ, a possible explanation has been put forth by Halloran et al. (26) in a study with recipient IFN-γ knockout mice, where it was shown that IFN-γ was essential to protect allografts locally from massive necrosis occurring upon grafting. Probably due to the functional redundancy of immune responses, cytokine gene polymorphisms have repeatedly been shown to have a modest impact on overall disease susceptibility, acute rejection, and development of CAN, despite their significant roles in autoimmune and inflammatory conditions. Risks conferred by variant cytokine alleles rarely reach values of 2.5. The low impact of these polymorphic variants added to their low frequencies can render a study design underpowered to identify relevant targets with certainty. The relatively small number of donor/ recipient pairs, allied to the low genetic risk conferred by the cytokine polymorphisms we studied, requires that these results be confirmed. Matching groups for

known variables when looking into multi-factorial susceptibility helps highlight hidden differences. Thus, our study groups were matched for donor type and age, HLA compatibility, presence of hypertension, dyslipidemia, number of pre-transplant transfusions, CMV positivity, and immunosuppressive regimen. Not unexpectedly, however, we were not able to control two well-known risk factors, namely the number of acute rejection episodes and hyperuricemia (27), which were significantly increased in the CAN group. However, the data we have obtained are generally in accordance with the published literature on the subject (28-30).

CONCLUSION Our results highlight the importance of donor cytokine genotyping and show that cytokine polymorphisms present in the grafted tissue might, indeed, contribute to the development of CAN. The combination of recipient and donor genotyping may help choose additional or alternative therapeutic approaches for renal transplant patients at higher risk, such as the early introduction of MMF or other drugs with a potential curbing effect on the development of CAN. ACKNOWLEDGMENTS: This work was supported by FAPESP (São Paulo State Research Foundation, grant # 01/09850-0) and CNPq (National Council for Scientific and Technological Development, grant # 0062/2001-0). ACG, MRAC, JK, and VC are recipients of personal grants from CNPq. REFERENCES 1. Sankaran D, Asderakis A, Ashraf S, Roberts IS, Short CD, Dyer PA, et al. Cytokine gene polymorphisms predict acute graft rejection following renal transplantation. Kidney Int. 1999;56(1):281-8. 2. Asderakis A, Sankaran D, Dyer P, Johnson RW, Pravica V, Sinnott PJ, et al. Association of polymorphisms in the human interferon-gamma and interleukin10 gene with acute and chronic kidney transplant outcome: the cytokine effect on transplantation. Transplantation 2001;71(5):674-7. 3. Nankivell BJ, Borrows RJ, Fung CL, O’Connell PJ, Allen RD, Chapman JR. The natural history of chronic allograft nephropathy. N Engl J Med. 2003;349(24):2326-33. 4. Joosten SA, Sijpkens YW, van Kooten C, Paul LC. Chronic renal allograft rejection: pathophysiologic considerations. Kidney Int. 2005;68(1):1-13. 5. Li C, Yang CW. The pathogenesis and treatment of chronic allograft nephropathy. Nat Rev Nephrol. 2009;5(9):513-9. 6. Shirwan H. Chronic allograft rejection. Do the Th2 cells preferentially induced by indirect alloantigen recognition play a dominant role? Transplantation. 1999;68(6):715-26. 7. Desmouliere A, Geinoz A, Gabbiani F, Gabbiani G. Transforming growth factorbeta 1 induces alpha-smooth muscle actin expression in granulation tissue

einstein. 2011; 9(1 Pt 1):46-51

Einstein v9n1.indb 50

24.03.11 19:36:37


TGFB1 and IFNG gene polymorphism in chronic allograft nephropathy

myofibroblasts and in quiescent and growing cultured fibroblasts. J Cell Biol.1993;122(1):103-11. 8. Noronha IL, Daniel V, Rambausek M, Waldherr R, Opelz G. Soluble interleukin-2 receptor (sIL-2R) and tumor necrosis factor plasma levels in renal allograft recipients. Transplant Proc. 1990;22(4):1859-60. 9. Cuhaci B, Kumar MS, Bloom RD, Pratt B, Haussman G, Laskow DA, et al. Transforming growth factor-beta levels in human allograft chronic fibrosis correlate with rate of decline in renal function. Transplantation. 1999;68(6):785-90. 10. Shihab FS, Yamamoto T, Nast CC, Cohen AH, Noble NA, Gold LI, et al. Transforming growth factor-beta and matrix protein expression in acute and chronic rejection of human renal allografts. J Am Soc Nephrol. 1995;6(2): 286-94. 11. Wolf G, Zahner G, Ziyadeh FN, Stahl RA. Cyclosporin A induces transcription of transforming growth factor beta in a cultured murine proximal tubular cell line. Exp Nephrol. 1996;4(5):304-8. 12. Shihab FS, Bennett WM, Tanner AM, Andoh TF. Mechanism of fibrosis in experimental tacrolimus nephrotoxicity. Transplantation. 1997;64(12): 1829-37. 13. Chen W, Jin W, Hardegen N, Lei KJ, Li L, Marinos N, et al. Conversion of peripheral CD4+CD25- naive T cells to CD4+CD25+ regulatory T cells by TGF-beta induction of transcription factor Foxp3. J Exp Med. 2003;198(12): 1875-86. 14. Smith AJ, Humphries SE. Cytokine and cytokine receptor gene polymorphisms and their functionality. Cytokine Growth Factor Rev. 2009;20(1):43-59. 15. Racusen LC, Solez K, Colvin RB, Bonsib SM, Castro MC, Cavallo T, et al. The Banff 97 working classification of renal allograft pathology. Kidney Int. 1999;55(2):713-23. 16. Gustincich S, Manfioletti G, Del Sal G, Schneider C, Carninci P. A fast method for high-quality genomic DNA extraction from whole human blood. Biotechniques 1991;11(3):298-300- 2. 17. Bignon JD, Vi単a MF. HLA class II typing by PCR-SSOP. Charron D, Fauchet R, editors. Paris: EDK Medical and Scientific International Publisher; 1995. 18. Rovin BH, Lu L, Saxena R. A novel polymorphism in the MCP-1 gene regulatory region that influences MCP-1 expression. Biochem Biophys Res Commun. 1999;259(2):344-8.

51

19. Clayton D, Hills M. New York: Oxford University Press; 1996. 20. Sharma VK, Ding R, Li B, Bologa RM, Lagman M, Eduafo A, et al. Molecular correlates of human renal allograft rejection. Transplant Proc. 1998;30(5): 2364-6. 21. Pribylova-Hribova P, Kotsch K, Lodererova A, Viklicky O, Vitko S, Volk HD, et al. TGF-beta1 mRNA upregulation influences chronic renal allograft dysfunction. Kidney Int. 2006;69(10):1872-9. 22. Palomar R, Mayorga M, Ruiz JC, Cuevas J, Rodrigo E, Cotorruelo JG, et al. Markers of fibrosis in early biopsies of renal transplants. Transplant Proc. 2005;37(3):1468-70. 23. Huber S, Schramm C, Lehr HA, Mann A, Schmitt S, Becker C, et al. Cutting edge: TGF-beta signaling is required for the in vivo expansion and immunosuppressive capacity of regulatory CD4+CD25+ T cells. J Immunol. 2004;173(11):6526-31. 24. Park JY, Park MH, Park H, Ha J, Kim SJ, Ahn C. TNF-alpha and TGF-beta1 gene polymorphisms and renal allograft rejection in Koreans. Tissue Antigens. 2004 ; 64(6):660-6. 25. Chow KM, Szeto CC, Poon P, Lau WY, Lai FM, Li PK. Transforming growth factor-beta1 gene polymorphism in renal transplant recipients. Ren Fail. 2005;27(6):671-5. 26. Halloran PF, Miller LW, Urmson J, Ramassar V, Zhu LF, Kneteman NM, et al. IFN-gamma alters the pathology of graft rejection: protection from early necrosis. J Immunol. 2001;166(12):7072-81. 27. Perico N, Codreanu I, Caruso M, Remuzzi G. Hyperuricemia in kidney transplantation. Contrib Nephrol. 2005;147:124-31. 28. Hoffmann S, Park J, Jacobson LM, Muehrer RJ, Lorentzen D, Kleiner D, et al. Donor genomics influence graft events: the effect of donor polymorphisms on acute rejection and chronic allograft nephropathy. Kidney Int. 2004;66(4): 1686-93. 29. Hutchinson IV. The role of transforming growth factor-beta in transplant rejection. Transplant Proc. 1999;31(7A):9S-13S. 30. Awad MR, El-Gamel A, Hasleton P, Turner DM, Sinnott PJ, Hutchinson IV. Genotypic variation in the transforming growth factor-beta 1 gene: association with transforming growth factor-beta 1 production, fibrotic lung disease, and graft fibrosis after lung transplantation. Transplantation. 1998;66(8): 1014-20.

einstein. 2011; 9(1 Pt 1):46-51

Einstein v9n1.indb 51

24.03.11 19:36:37


ORIGINAL ARTICLE

Procalcitonin in patients with influenza A (H1N1) infection and acute respiratory failure Pró-calcitonina em pacientes com infecção por influenza A (H1N1) e insuficiência respiratória aguda Péricles Almeida Delfino Duarte1, Carla Sakuma de Oliveira Bredt2, Gerson Luís Bredt Jr2, Amaury César Jorge2, Alisson Venazzi2, Leônidas Gustavo Tondo2, Luciana Schmidt Cardon de Oliveira2, Marcela Maria Jorge2, Roberta Marchiori2, Thiago Simões Giancursi2, Marcelo Coradin2, Anderson Gustavo Alexandrino2

ABSTRACT Objective: To verify serum procalcitonin levels of patients with acute respiratory failure secondary to influenza A (H1N1) upon their admission to the Intensive Care Unit and to compare these results to values found in patients with sepsis and trauma admitted to the same unit. Methods: Analysis of records of patients infected with influenza A (H1N1) and respiratory failure admitted to the General Intensive Care Unit during in a period of 60 days. The values of serum procalcitonin and clinical and laboratory data were compared to those of all patients admitted with sepsis or trauma in the previous year. Results: Among patients with influenza A (H1N1) (n = 16), the median serum procalcitonin level upon admission was 0.11 ng/ mL, lower than in the sepsis group (p < 0.001) and slightly lower than in trauma patients. Although the mean values were low, serum procalcitonin was a strong predictor of hospital mortality in patients with influenza A (H1N1). Conclusion: Patients with influenza A (H1N1) with severe acute respiratory failure presented with low serum procalcitonin values upon admission, although their serum levels are predictors of hospital mortality. The kinetics study of this biomarker may be a useful tool in the management of this group of patients. Keywords: Pneumonia, viral; Sepsis; Intensive care units; Biomarkers, pharmacological; Calcitonin; Infection

RESUMO Objetivo: Verificar os níveis de pró-calcitonina sérica em pacientes com insuficiência respiratória aguda secundária à influenza A (H1N1) admitidos à Unidade de Terapia Intensiva, e comparar esses resultados com valores encontrados em pacientes com sepse e trauma admitidos na mesma unidade. Métodos: Análise de prontuários de pacientes infectados com influenza A (H1N1) e insuficiência respiratória aguda

admitidos na Unidade de Terapia Intensiva Geral em um período de 60 dias. Os valores de pró-calcitonina sérica e os dados clínicos e laboratoriais foram comparados com todos pacientes admitidos com sepse ou trauma no ano anterior. Resultados: Entre os pacientes com influenza A (H1N1) (n = 16), a mediana de pró-calcitonina sérica na admissão foi 0,11 ng/mL, menor do que o grupo de sepse (p < 0,01) e levemente menor do que os com trauma. Embora os valores médios tenham sido baixos, o nível sérico de pró-calcitonina foi um poderoso preditor de mortalidade hospitalar em pacientes com influenza A (H1N1). Conclusão: Pacientes com influenza A (H1N1) com insuficiência respiratória aguda grave tiveram baixos níveis de pró-calcitonina à admissão, embora seu nível sérico seja preditor de mortalidade hospitalar. A cinética desse biomarcador poderia ser uma ferramenta útil para o manejo desses pacientes. Descritores: Pneumonia viral; Sepse; Unidades de terapia intensiva; Biomarcadores farmacológicos; Calcitonina; Infecção

INTRODUCTION A major challenge in clinical practice of intensive care and emergency medicine is early detection and prognosis of severe community respiratory infections, as well as the differentiation between viral and bacterial infections, with a consequent impact on the inappropriate use of antibiotics, bacterial resistance, mortality, and costs(1). The recent pandemic by influenza A (H1N1) virus(2) has reinforced the importance of biomarkers that might assist the clinician in diagnosis and management of patients with severe community-acquired pneumonia and acute respiratory failure. Procalcitonin (PCT) has been studied and has shown itself to be useful in the

Study carried out at Hospital Universitário do Oeste do Paraná – HUOP, Cascavel (PR), Brazil. 1

Departament of Emergency and Intensive Medicine, Universidade Estadual do Oeste do Paraná – UNIOESTE, Cascavel (PR), Brazil.

2

Department of Internal Medicine, Universidade Estadual do Oeste do Paraná – UNIOESTE, Cascavel (PR), Brazil. Corresponding author: Péricles Almeida Delfino Duarte – Rua Castro Alves, 2.283, apto. 72 – Centro – CEP 85810-100 – Cascavel (PR), Brasil – Tel.: 45 3219-6400 – e-mail: padduarte@unioeste.br Received: Sep 8, 2010 – Accepted: Jan 31, 2011 The authors declare there is no conflict of interest.

einstein. 2011; 9(1 Pt 1):52-5

Einstein v9n1.indb 52

24.03.11 19:36:38


Procalcitonin in patients with influenza A (H1N1) infection and acute respiratory failure

differential diagnosis(3), prognosis(4), and antimicrobial management(5) of both community and hospitalacquired infections, proving to be an exclusion marker of viral infections exclusion, particularly in patients with severe community-acquired infections(6,7).

OBJECTIVE To analyze the profile of serum PCT collected upon admission at the Intensive Care Unit (ICU) from patients with severe acute infection with influenza A (H1N1), comparing it to patients with sepsis and trauma. METHODS This was a retrospective cohort study. A total of 16 patients admitted to a special unit installed in July/2009, at the Hospital Universitário do Oeste do Paraná (HUOP), in Cascavel, (PR, Brazil), with respiratory failure secondary to influenza A (H1N1) infection, between July 1 and August 31, 2009, were studied. All of them were included in the study. The medical charts, clinical and epidemiological data, and laboratory tests upon ICU admission were analyzed, as well as oxygen and mechanical ventilation parameters and ICU outcomes. The study data were compared to the ICU database by analyzing all the patients admitted due to trauma or sepsis, during one year before this study. The diagnostic test for influenza A (H1N1) was performed through with the real-time polymerase chain reaction (RT-PCR) method of nasopharynx or tracheal aspirates secretion with Kit Superscript III Platinum One-Step Quantitative RT-PCR System® (Invitrogen, Carlsbad, USA). The diagnosis of influenza A (H1N1) was defined as clinical symptoms plus a positive RT-PCR test. The diagnostic test for PCT used a quantitative immunoassay method (Brahms MiniVidas, Roche/BioMérieux). Sepsis was defined according to criteria of the ACCP/ SCCM Consensus Conference(8). Obesity was defined as body mass index (BMC) > 30. Previous comorbidities were defined according to clinical diagnosis, by medical charts. Descriptive statistics were prepared with calculations of percentage, mean, median, and standard deviation. The comparison between the percentages was performed using the χ2 test. Quantitative variables were compared by the means with Student’s t test for independent samples and the median with the Mann-Whitney’s test. Any p-value lower than 0.05 was recognized as significant. All statistical analyses were performed with Statistical Package for the Social Sciences (SPSS), version 15.0. The study was approved by the Research Ethics Committee of the Universidade Estadual do Oeste do Paraná (UNIOESTE).

53

RESULTS The epidemiological and clinical data of the 16 patients are presented in table 1. In general, patients were young, predominantly female, and with few comorbidities – except obesity. The respiratory involvement was significant; one third of the patients had a very severe oxygen exchange disorder (PaO2/FiO2 < 100), with a high use of the Table 1. Clinical and epidemiological profile and laboratory data upon admission of patients with influenza A(H1N1) (n=16) Variable Descriptive Statistics Male gender, n (%) 03 (18.7%) Age 34.4 ± 14.82 Time between onset of symptoms and ICU admission, days 5.6 ± 4.73 APACHE II in the first 24 hours 9.2 ± 6.29 Obesity (BMI ≥30), n (%) 04 (25.0%) Chronic diseases*, n (%) 02 (12.5%) COPD, n (%) 01 (6.2%) AIDS, n (%) 01 (6.2%) Cancer or immune suppression 0 Pregnancy, n (%) 04 (25.0%) 01 (6.2%) 1st trimester 01 (6.2%) 2nd trimester 02 (12.5%) 3rd trimester 8,452.5 ± 3,023.71 WBC, cells/mm3 Hematocrit, % 36.3 ± 3.68 196,000 ± 83,700.0 Platelets, cells/mm3 02 (12.5%) Platelets <100.000 cells/mm3, n (%) Lactate, mOsm/L 2.39 ± 1.86 Creatinine, mg/dL 1.02 ± 0.38 Creatinine > 1.5 mg/dL, n (%) 01 (6.2%) Total bilirubin > 2.0 mg/dL, n (%) 0 LDH, UI/mL 875.8 ± 772.7 CPK, UI/mL 416.7 ± 300.0 Vasopressor use in the first 4 h, n (%) 06 (37.5%) Lowest PaO2/FiO2, in the first 24 h 137.9 ± 101.5 PaO2/FiO2 < 100, n (%) 05 (31.2%) PaCO2, mm Hg 43.3 ± 10.1 Need of IMV, n (%) 08 (50.0%) Length of IMV, days 8.6 ± 7.93 Prone position, n (%) 03 (37.5%) Highest PEEP in the first 12 h, cm H2O 17.1 ± 5.33 NIMV use for > 2 h, n (%) 02 (12.5%) Oseltamivir use, n (%) 16 (100.0%) PCT, ng/mL 1.79 ± 3.27 PCT ≤ 0.05, ng/mL, n (%) 07 (43.7%) All variables are described as mean ± SD (standard deviation), unless when indicated. * Except obesity. Vasopressor: norepinephrine (any dose) or dopamine (> 5 µg/kg/min). APACHE: acute physiology and chronic health evaluation; BMI: body mass index; COPD: chronic obstructive pulmonary disease; AIDS: acquired immunodeficiency syndrome; WBC: white blood cell; LDH: lactate dehydrogenase; CPK: creatine phosphokinase; PaO2: arterial oxygen pressure; FiO2: inspired oxygen fraction; IMV: invasive mechanical ventilation; PEEP: positive end-expiratory pressure; NIMV: noninvasive mechanical ventilation; PCT: procalcitonin.

Table 2. Clinical outcome (n=16) Outcome Hospital LOS, average ± SD Hospital mortality, n (%)

Descriptive Statistics 7.31 ± 4.43 07 (43.7%)

LOS: Length of stay; SD: Standard deviation

einstein. 2011; 9(1 Pt 1):52-5

Einstein v9n1.indb 53

24.03.11 19:36:39


54

Duarte PAD, Bredt CSO, Bredt Jr GL , Jorge AC, Venazzi A, Tondo LG, Oliveira LSC, Jorge MM, Marchiori R, Giancursi TS, Coradin M, Alexandrino AG

Table 3. Predictors of hospital mortality (n=16) Predictors of hospital mortality APACHE II LDH, UI/mL

Vasopressor use, in the first 4 h, n (%) Lowest PaO2/FiO2, in the first 24 h PaCO2, mmHg Need of IMV, n (%) Highest PEEP in the first 12 h, cmH2O PCT, ng/mL PCT ≤ 0.05 ng/mL, n (%)

Result 9.2 ± 6.29 875.80 ±

Alive 6.22 ± 4.55 458.57±

Dead 13.13 ± 6.31 1362.6 ±

p-value 0.02* 0.03*

772.70 06 (37.5%) 137.97 ± 101.50 43.31 ± 10.09 08 (50.0%) 15.0 ± 6.50 0.11 07 (43.7%)

306.13 0 (0.0%) 206.67 ± 112.29 36.33 ± 5.16 01 (11.1%) 8.0 ± 2.83 0.02 07 (77.8%)

890.19 06 (85.6%) 79.09 ± 36.50 49.29 ± 9.55 07 (100.0%) 16.8 ± 5.97 2.89 0 (0.00%)

<0.01* 0.02* 0.01* <0.01* 0.085* 0.02* <0.01*

All variables are described as mean ± SD (standard deviation), unless when indicated. Vasopressor: norepinephrine (any dose) or dopamine (> 5 µg/kg/min). APACHE: acute physiology and chronic health evaluation; LDH: lactate dehydrogenase; PaO2: arterial oxygen pressure; FiO2: inspired oxygen fraction; IMV: invasive mechanical ventilation; PEEP: positive end-expiratory pressure; PCT: procalcitonin.

Table 4. Comparison between influenza A (H1N1) group and patients with other diagnoses Non-influenza A(H1N1) patients

Influenza A (H1N1) N APACHE II Male gender, n (%) Age, years Hospital length of stay (days) Hospital mortality, n (%) PCT, admission, ng/mL PCT ≤ 0.05 ng/mL, n (%)

16 9.2 ± 6.29 03 (18.7%) 34.4 ± 14.82 6.81 ± 7.35 07 (43.7%) 0.11 07 (43.7%)

Sepsis 25 19.52 ± 8.29 15 (60.0%) 46.16 ±18.81 6.20 ± 5.92 08 (32.0%) 6.70 02 (8.0%)

Trauma p-value <0.01* 0.01* 0.04* 0.77 0.45 <0.01* 0.02*

33 22.06 ± 6.68 23 (69.7%) 38.30 ± 18.59 9.84 ± 6.53 07 (21.1%) 1,01 09 (27.3%)

p-value <0.01* <0.01* 0.47 0.15 0.10 0,10 0.33

All variable are described as mean ± SD (standard deviation), unless when indicated. * Significant at level of 5%. PCT: procalcitonin.

prone position. On the other hand, renal and circulatory systems were not as intensely impaired, at least during the initial phase. Mortality was high (Table 2); mortality predictors (Table 3) were mainly related to clinical severity (such as APACHE II) or respiratory involvement (e.g., PaO2/ FiO2). All patients required invasive mechanical ventilation. Serum LDH and CPK values were very high, and there was a great incidence of obesity. Admission serum PCT levels were strongly predictive of hospital mortality in H1N1 patients (Table 3); however, these values were lower than non-H1N1 patients (with sepsis or trauma), according to table 4.

DISCUSSION The use of biomarkers has given support to the management of sepsis and respiratory failure patients, including the decision to use antibiotics(9-11). In the present study, serum PCT levels upon ICU admission were markedly different between the groups with infection by influenza A (H1N1) and the patients with presumed bacterial sepsis. The difference in trauma patients was less pronounced, and did not reaching statistical difference. Billeter et al.(3) studied 1,032

patients with moderate and severe trauma, and serum PCT in the first days of the patients with no associated infection was 0.81 ng/mL, showing higher values in patients with sepsis and infection. Similar results were obtained by other researchers(12). Castelli et al.(13) also found that PCT values correlated with the severity and outcome of trauma. Moreover, in sepsis patients, particularly bacterial, initial PCT values proved to be far higher. The mean values ranged from 4.3 (nonsevere sepsis) to 21.3 ng/mL (septic shock)(5,14,15). In the present study, the median PCT values in patients with sepsis and trauma were similar to those found by Castelli et al.(13) and Billeter et al.(3), respectively. Although the initial values of PCT in patients with sepsis are usually higher in more severe patients, the correlation with mortality is not as clear(5,14). However, specifically in patients with pneumonia, apparently its efficiency as a marker of adverse outcome is greater(4,16). Despite low mean levels, initial serum PCT showed good efficacy as a mortality predictor among patients with influenza A (H1N1). Although this biomarker is practically considered almost the specific one for severe bacterial infections, it is partially elevated in other acute conditions (e.g., trauma, cardiac, fungal infections). In these situations, initial PCT values are prognostic of severity and outcome(12,17-19). Therefore,

einstein. 2011; 9(1 Pt 1):52-5

Einstein v9n1.indb 54

24.03.11 19:36:39


Procalcitonin in patients with influenza A (H1N1) infection and acute respiratory failure

it is not surprising that initial serum PCT levels in patients with severe influenza A (H1N1) infection were predictive of mortality, although they were much lower than in patients with sepsis and even than in those with trauma. The majority of patients with PCT ≥ 0.1 µg/l L died at the hospital, whereas none of the patients with PCT <0.1 µg/L progressed to death. This study has several limitations. The number of patients studied is small and may lead to difficulty in interpreting collected data. Only the initial value (upon ICU admission) of serum PCT was analyzed. The dynamics of PCT in patients with sepsis(5), in postoperative care(15), with ventilator-associated pneumonia(4), and with trauma(3,13) prove to be more useful than the initial dosage. Heterogeneity among the non-H1N1 patients hinders comparisons between the groups. It must be emphasized that the “sepsis” group included patients with presumed bacterial sepsis, although they did not necessarily had microbiological identification. Patients included in the group with influenza A (H1N1) were very seriously ill, particularly with severe respiratory failure(2,9). Analysis of patients with milder cases (without severe respiratory failure) could further emphasize the importance of this biomarker in the management of these patients in the emergency room.

CONCLUSIONS In an observational study, it was found that initial serum levels of PCT in patients with severe respiratory infection for influenza A (H1N1) were strongly predictors of a poor outcome and mortality, although they are significantly lower than those of patients with sepsis or trauma. The study of PCT kinetics of PCT may better define better its usefulness in managing patients with severe respiratory infection with influenza A (H1N1). REFERENCES

55

of survival in ventilator-associated pneumonia. Crit Care. 2006;10(5): R125. 5. Charles PE, Tinel C, Barbar S, Aho S, Prin S, Doise JM, et al. Procalcitonin kinetics within the first days of sepsis: relationship with the appropriateness of antibiotic therapy and the outcome. Crit Care. 2009;13(2):R38. 6. Daubin C, Parienti JJ, Vabret A, Ramakers M, Fradin S, Terzi N, et al. Procalcitonin levels in acute exacerbation of COPD admitted in ICU: a prospective cohort study. BMC Infect Dis. 2008;8:145. 7. Kristoffersen KB, Søgaard OS,, Wejse C, Black FT, Greve T, Tarp B, et al. Antibiotic treatment interruption of suspected lower respiratory tract infections based on a single procalcitonin measurement at hospital admission-a randomized trial. Clin Microbiol Infect. 2009;15:481-7. 8. Bone RC, Balk RA, Cerra FB, Dellinger RP, Fein AM, Knaus WA, et al. Definitions for sepsis and organ failure and guidelines for the use of innovative therapies in sepsis. The ACCP/SCCM Consensus Conference Committee. American College of Chest Physicians/Society of Critical Care Medicine. Chest. 1992;101(6):1644-55. 9. Rello J, Rodríguez A, Ibañez P, Socias L, Cebrian J, Marques A, Guerrero J, Ruiz-Santana S, Marquez E, Del Nogal-Saez F, Alvarez-Lerma F, Martínez S, Ferrer M, Avellanas M, Granada R, Maraví-Poma E, Albert P, Sierra R, Vidaur L, Ortiz P, Prieto del Portillo I, Galván B, León-Gil C; H1N1 SEMICYUC Working Group. Intensive care adult patients with severe respiratory failure caused by Influenza A (H1N1) virus in Spain. Crit Care. 2009;13(5):R148. 10. Shapiro NI, Trzeciak S, Hollander JE, Birkhahn R, Otero R, Osborn TM, et al. A prospective, multicenter derivation of a biomarker panel to assess risk of organ dysfunction, shock, and death in emergency department patients with suspected sepsis. Crit Care Med. 2009;37(1):96-04. 11. Hausfater P, Juillien G, Madonna-Py B, Haroche J, Bernard M, Riou B. Serum procalcitonin measurement as diagnostic and prognostic marker in febrile adult patients presenting to the emergency department. Crit Care. 2007;11(3):R60. 12. Maier M, Wutzler S, Lehnert M, Szermutzky M, Wyen H, Bingold T, et al. Serum procalcitonin levels in patients with multiple injuries including visceral trauma. J Trauma. 2009;66(1):243-9. 13. Castelli GP, Pognani C, Cita M, Paladini R. Procalcitonin as a prognostic and diagnostic tool for septic complications after major trauma. Crit Care Med. 2009;37(6):1845-9. 14. Harbarth S, Holeckova K, Froidevaux C, Pittet D, Ricou B, Grau GE, Vadas L, Pugin J; Geneva Sepsis Network. Diagnostic value of Procalcitonin, Interleukin-6, and Interleukin-8 in critically ill patients admitted with suspected Sepsis. Am J Respir Crit Care Med. 2001;164(3):396-402. 15. Hochreiter M, Köhler T, Schweiger AM, Keck FS, Bein B, von Spiegel T, et al. Procalcitonin to guide duration of antibiotic therapy in intensive care patients: a randomized prospective controlled trial. Crit Care. 2009;13(3):R83.

1. Brown SM, Dean NC. Defining and predicting severe community-acquired pneumonia. Curr Opin Infect Dis. 2010;23(2):158-64.

16. Haeuptle J, Zaborsky R, Fiumefreddo R, Trampuz A, Steffen I, Frei R, et al. Prognostic value of procalcitonin in Legionella pneumonia. Eur J Clin Microbiol Infect Dis. 2009:28(1):55-60.

2. Duarte PAD, Venazzi A, Youssef NCM, Oliveira MC, Tannous LA, Duarte CB, et al. Outcome of influenza A (H1N1) patients admitted to intensive care units in the Paraná state, Brazil. Rev Bras Ter Intensiva. 2009;21(3):231-6.

17. Prat C, Ricart P, Ruyra X, Domínguez J, Morillas J, Blanco S, et al. Serum concentrations of procalcitonin after cardiac surgery. J Card Surg. 2008;23(6):627-32.

3. Billeter A, Turina M, Seifert B, Mica L, Stocker R, Keel M. Early serum procalcitonin, interleukin-6, and 24-hour lactate clearance: useful indicators of septic infections in severely traumatized patients. World J Surg. 2009;33(3):558-66.

18. Madershahian N, Wittwer T, Strauch J, Wippermann J, Rahmanian P, Franke UF, et al. Kinetic of procalcitonin in the early postoperative course following heart transplantation. J Card Surg. 2008;23(5):468-73.

4. Seligman R, Meisner M, Lisboa TC, Hertz FT, Filippin TB, Fachel JMG, et al. Decreases in procalcitonin and C-reactive protein are strong predictors

19. Nakamura A, Wada H, Ikejiri M, Hatada T, Sakurai H, Matsushima Y, et al. Efficacy of procalcitonin in the early diagnosis of bacterial infections in a critical care unit. Shock. 2009;31(6):586-91.

einstein. 2011; 9(1 Pt 1):52-5

Einstein v9n1.indb 55

24.03.11 19:36:40


ORIGINAL ARTICLE

Immunological induction with thymoglobulin: reduction in the number of doses in renal transplant from deceased donor Indução imunológica com timoglobulina: redução no número de doses em transplante de rim com doador falecido Lucio Roberto Requião Moura1, Eduardo José Tonato1, Érika Arruda Ferraz1, Thiago Corsi Filliponi1, Rogério Chinen1, Ana Cristina Carvalho Matos1, Maurício Rodrigues Fregonesi da Silva1, Marcelino de Souza Durão1, Alvaro Pacheco-Silva1

ABSTRACT Objective: To compare three different regimens of thymoglobulin induction. Methods: One hundred seventy two patients submitted to renal transplantation from a dead donor were divided into three groups according to the total number of thymoglobulin doses used in the post-transplantation surgery: Group 1, until 14 doses – May 2002 to June 2004 (n = 48); Group 2, until 7 doses – July 2004 to December 2006 (n = 57); Group 3, until 4 doses – January 2007 to July 2009 (n = 67). The three groups were compared according to the main outcomes. Results: The main demographic differences among the groups were: greater dialysis time in Group 3 (p < 0.001 for Group 1; and p = 0.04 for Group 2); donor age, greater in Groups 2 and 3 (p = 0.02; p = 0.01, respectively); and cold ischemia time progressively greater from Group 1 to 3: 19.5 ± 5.1 to 24.6 ± 5.7 hours (p < 0.001). In relation to the inhibitor of calcineurin, the relation Tac/Csa was 14.6/66.7% in Group 1, 78.9/12.3% in Group 2 and 100/0% in Group 3. Reflecting the increase in cold ischemia time, the incidence of delayed graft function was 64.6%, 68.4% e 82.1% in Groups 1, 2 and 3, respectively (p = ns). The incidence of acute rejection was similar in the three groups: 16.7% (1); 16.3% (2) and 16.4 (3) – p = ns. The prevalence of viremia for cytomegalovirus was 61.7% in Group 1, 66.1% in Group 2 and 83.3% in Group 3 (p = ns). There were no difference related to the number of infected cells with cytomegalovirus in antigenemia, according to the groups, however, patients in Group 3 had an earlier diagnosis: from 64.3 ± 28.5 days in Grup 2, to 47.1 ± 22.5 days, in Group 3, p < 0.001. Survival of the graft in one year was 89.6%, 92.9% and 91.0%, in Groups 1, 2 and 3, respectively (p = ns). The graft function was much better with the lower doses of thymoglobulin: Group 1: 57.0 ± 20.0 mL/min; Group 2: 67.0 ± 18.4 mL/min (p = 0.008); Group 3: 71.2 ± 18.4 mL/min (p < 0.001, Group 1 versus Group 3; p = 0.06, Group 1 versus Group 2). There was a significant reduction in the costs of induction protocol from U$ 7,567.02 to U$ 3,485.56 (p < 0.001). Conclusions: The total number of thymoglobulin doses for immunologic induction could be reduced in a safe and effective way, without a negative im-

pact in graft rejection or survival, preserving renal function and being significantly cheaper. Keywords: Antibodies/administration & dosage; Immune system/ drug effects; Graft rejection; Survival RESUMO Objetivo: Comparar três regimes diferentes de indução com timoglobulina. Métodos: Cento e setenta e dois pacientes submetidos a transplante de rim com doador falecido foram divididos em três grupos, de acordo com o número total de doses de timoglobulina utilizada no pós-operatório: Grupo 1, até 14 doses – Maio de 2002 a Junho de 2004 (n = 48); Grupo 2, até 7 doses – Julho de 2004 a Dezembro de 2006 (n = 57); Grupo 3, até 4 doses – Janeiro de 2007 a Julho de 2009 (n = 67). Os três grupos foram comparados de acordo com os principais desfechos. Resultados: As principais diferenças demográficas entre os três grupos foram: tempo em diálise, que foi maior no Grupo 3 (p < 0,001 para o Grupo 1; p = 0,04 para o Grupo 2); idade do doador, maior nos Grupos 2 e 3 (p = 0,02; p = 0,01, respectivamente); e o tempo de isquemia fria, progressivamente maior do Grupo 1 ao 3: 19,5 ± 5,1 para 24,6 ± 5,7 horas (p < 0,001). Em relação ao inibidor de calcineurina utilizado, a relação entre Tac/Csa foi de 14,6/66,7% no Grupo 1, 78,9/12,3% no Grupo 2 e de 100/0% no Grupo 3. Refletindo o aumento no tempo de isquemia fria, a incidência de delayed graft function foi de 64,6%, 68,4% e 82,1% nos Grupos 1, 2 e 3, respectivamente (p = ns). A incidência de rejeição aguda foi semelhante nos três grupos: 16,7% (1), 16,3% (2) e 16,4% (3) – p = ns. A prevalência de viremia para citomegalovírus foi de 61.7% no Grupo 1; 66,1% no Grupo 2; e 83,3% no Grupo 3 (p = ns). Não houve diferenças quanto ao número de células infectadas com o citomegalovírus na antigenemia, de acordo com os grupos; entretanto, os pacientes do Grupo 3 tiveram diagnóstico mais precoce: de 64,3 ± 28,5 dias no Grupo 2, para 47,1 ± 22,5 dias no Grupo 3 (p < 0,001). A sobrevida do enxerto em um ano foi de 89,6%, 92,9% e 91,0%, nos Grupos 1, 2 e 3, respectivamente (p = ns). A função do enxerto foi substancialmente melhor com menor número de doses de timoglobu-

Study carried out at Transplant Service - Hospital Israelita Albert Einstein - H.A.E. - São Paulo (SP), Brazil. 1

Hospital Israelita Albert Einstein – HIAE – Sao Paulo (SP), Brazil. Corresponding author: Lucio Roberto Requião Moura - Rua Agostinho Gomes, 1326, Ap 1062 - Ipiranga - CEP 04206000 - Sao Paulo (SP), Brasil - Tel.: 11 9577-1568 - e-mail: lrequiao@einstein.br Received: Jul 31, 2010 - Accepted: Jan 24, 2011 * Conflict of interests: none.

einstein. 2011; 9(1 Pt 1):56-65

Einstein v9n1.indb 56

24.03.11 19:36:41


Immunological induction with thymoglobulin

lina: Grupo 1: 57,0 ± 20,0 mL/min; Grupo 2: 67,0 ± 18,4 mL/min (p = 0,008); Grupo 3: 71,2 ± 18,4 mL/min (p < 0,001, Grupo 1 versus Grupo 3; p = 0,06, Grupo 1 versus Grupo 2). Houve uma redução significativa no custo do protocolo de indução de U$ 7.567,02 para U$ 3.485,56 (p < 0,001). Conclusão: O número total de doses de timoglobulina para indução imunológica pôde ser reduzido de forma segura e eficaz, sem impacto negativo na incidência de rejeição ou sobrevida do enxerto, com preservação da função renal, sendo significativamente mais barato. Descritores: Anticorpos/administração & dosagem; Sistema imunológico/efeito de drogas; Rejeição de enxerto; Sobrevida

INTRODUCTION Human anti-lymphocyte antibodies have been used ever since the 1960’s in organ and tissue transplantations(1). Initially, these preparations were indicated for the conditioning of bone marrow receptors, treatment of graft versus host disease and acute rejection (AR). Recently, they have played a major role in prophylaxis of AR, especially in kidney transplantations(2). The use of lymphocytedepleting antibodies with the purpose of reducing immunological events is known as immunological induction and is indicated in high-risk receptors(3). Besides AR, another early event in kidney transplantation with a negative impact on the evolution of the graft is ischemia-reperfusion injury (IRI), which is clinically characterized by delayed graft function (DGF)(4,5). Patients with DGF are at increased risk for AR because, after reperfusion, an up-regulation of immunogenic molecules and an increase in HLA molecule expression occurs on the surface of the renal tissue cells (6,7). It has already been demonstrated that DGF and AR interfere in the prognosis of the graft, so that patients who are more susceptible to the effects of IRI are, per se, considered at high immunological risk (8). Current knowledge about the pathophysiology of IRI shows that the immune system, especially lymphocyte CD4+, is fundamental for the occurrence of the injury, and that the lymphocyte surface molecules with cell activation, endothelial adhesion and migration to the site of the injury functions play an essential part in this process(9). Polyclonal antilymphocyte antibodies are capable of blocking these molecules, besides promoting intense lymphopenia, which significantly reduces the effects of IRI(10). Thus, the objectives of immunological induction with polyclonal antibodies are to reduce the risk of AR and to attenuate the effects of IRI. Currently, about 70% of the kidney transplant recipients are under some kind of induction therapy, either with thymoglobulin, a human antithymocyte

57

globulin produced from rabbit serum, which is a powerful lymphocyte-depleting polyclonal antibody that targets the multiple immunological epitopes, or with non-lymphocyte-depleting monoclonal antibodies(2), such as basilixmab or daclizumab, which target the interleukin-2 receptor(11). The use of immunological induction with thymoglobulin is related with a reduction in the incidence of AR and DGF(12). Historically, different protocols with intravenous doses varying from 7 to 14 days have been described(12). Recently, a study comparing a short, three-day treatment with thymoglobulin with a historical control that used a greater number of doses demonstrated that the short treatment was as effective and safe as the longer one, besides reducing the post-transplantation hospital stay(13). The current protocols focus mainly on an accumulated dose, using varying frequencies and administration times, and there is even a protocol with a single 5.0 mg/kg dose, shown to be able to produce an intense and lasting lymphopenia and to be as effective as all the others (14).

OBJECTIVE The aim of the study was to compare three different thymoglobulin immunological induction regimens in renal transplant from deceased donors. METHODS This research was designed as a monocentric, prospective, non-randomized and non-blind study, with renal transplants from deceased donors, using three historical groups which employed an intraoperative dose of thymoglobulin followed by sequential doses, based on the circulating CD3+ lymphocyte count. The outcomes evaluated were graft survival, prevalence of DGF, AR and cytomegalovírus (CMV) infection, besides the renal graft function a year after the transplantation. Study population This is a longitudinal, observational study on a historical cohort, including all patients who underwent cadaveric renal transplantation at the Hospital Israelita Albert Einstein from May 2002 through July 2009. Data collection was carried out in July 2010, so that all patients enrolled had at least a one-year follow-up. Two distinct populations were considered (Figure 1): initially, all patients submitted to a cadaveric renal transplantation (n = 186), but, for the analysis of the number of thymoglobulin doses, patients who einstein. 2011; 9(1 Pt 1):56-65

Einstein v9n1.indb 57

24.03.11 19:36:42


58

Moura LRR, Tonato EJ, Ferraz EA, Filliponi TC , Chinen R1, Matos ACC, Silva MRF, Durão MS, Pacheco-Silva A

Figure 1. Population distribution according to the induction protocol used. Group 1 – up to 14 doses of thymoglobulin, and the main calcineurin inhibitor was cyclosporin; Group 2 – up to 7 doses, and the main calcineurin inhibitor was tacrolimus; Group 3 – up to 4 doses, and the only calcineurin inhibitor was tacrolimus

progressed toward loss of the renal graft or early death (still hospitalized for the transplantation), as well as those who could not receive the induction protocol under study (n = 14) were excluded.

Immunological induction and immunosuppression protocol Immunological induction with thymoglobulin is used according to protocol for all patients submitted to a cadaveric renal transplantation in the service where the study was conducted. The induction protocol consists of one intraoperative Thymoglobulin® dose of 1.5 mg/kg, followed by sequential doses of 1.0 mg/kg, according to the circulating CD3+ lymphocyte count, done by flow cytometry, and indicated whenever the CD3+ count exceeds 20 cells(15,16). The antibody was administered by slow continuous infusion, during 6 hours, by central line or arteriovenous fistula, and 30 minutes after one 0.5 mg/kg dose of SoluMedrol, dipirone and diphenhydramine. The total amount of thymoglobulin doses used in the protocol varied according to the time when the transplantation was performed. Immunosuppression was completed with mycophenolate and a calcineurin inhibitor, the latter being introduced only after the last dose of antibody, provided the CD3+ count was higher than 20 cells. The calcineurin inhibitors were cyclosporin or tacrolimus. The calcineurin inhibitor dose was adjusted according to the serum level, and that of mycophenolate according to the side effects (diarrhea or leucopenia). All patients received prophylaxis with albendazol for 5 days after the transplantation and with sulfamethoxazole trimethoprim up to 6 months from the transplantation.

Division of groups according to total number of thymoglobulin doses During the period going from May 2002 to June 2004, the induction protocol consisted of a maximum of 14 doses of thymoglobulin, being interrupted earlier if the patient recovered graft function: urine volume higher than 2.0 L/day and/or serum creatinine lower than 5.0 mg/dL. During this period, 48 patients who received 9.0 ± 3.8 doses of thymoglobulin on average were enrolled. An analysis of the results obtained with this protocol was published, showing that patients who received up to 7 doses of the antibody progressed in a similar way to those who received more than 7 doses; therefore, from July 2004 through December 2006, the maximum amount of thymoglobulin doses was reduced from 14 to 7. During this second period, 57 patients were enrolled and received, in average, 4.9 ± 1.5 doses of the antibody. Based on the results obtained by other studies, as from January 2007, the maximum number of doses was further reduced from 7 to 4, and the antibody administration was discontinued after the fourth dose, regardless of the recovery of the renal graft function. During this third period, 67 transplantations were performed and an average of 3.9 ± 0.8 doses was used. Seven patients received more than 4 doses, due to specific indications of the assisting team: five patients received 5 doses, and two patients received 6 doses. These patients were not excluded from Group 3 because, although they received more than 4 doses, they did not receive all 7 doses of the patients in the second period. For the purposes of analysis and comparison, the patients who underwent transplantations during the first period were included in Group 1, those of the second period in Group 2, and those of the third period in Group 3 (Figure 1). Definitions and outcomes DGF was considered whenever patients needed dialysis in the first week after transplantation. Patients with persisting DGF after one week were submitted to a renal graft biopsy. The AR diagnoses were all confirmed by graft biopsy, according to the Banff classification in force at the time of the transplantation. Biopsies which did not meet the criteria defining AR, but displayed borderline alterations (borderline rejection) were also considered as acute rejection. The strategy adopted to reduce the risk of CMV infection was a preemptive treatment. Thus, all patients were followed-up with a regular CMV viremia test between 30 and 90 days after transplantation. Viremia was detected by antigenemia, using immunofluorescence

einstein. 2011; 9(1 Pt 1):56-65

Einstein v9n1.indb 58

24.03.11 19:36:42


Immunological induction with thymoglobulin

for the pp65 antigen (17). Treatment with ganciclovir was indicated in patients with antigenemia above 4 cells or in patients with antigenemia below 4 cells but with symptoms or altered laboratory findings defining CMV infection considered as acute. Initially the outcomes in the whole population of transplanted patients (n = 186) were evaluated: graft loss, defined as a return to dialysis; death; accumulated incidence of AR in the first year after transplantation; CMV infection and renal graft survival over the first year after transplantation, not censored for deaths. Among patients divided into groups according to the number of thymoglobulin doses used, the evaluated outcomes were: prevalence of DGF, AR and CMV; survival of the renal graft after a one-year follow-up, not censored for deaths; renal graft function, estimated by calculating creatinine clearance by means of the Cockroft-Gault formula. The thymoglobulin cost was estimated based on the number of vials used for each patient, where the accumulated dose coefficient was calculated based on the 25 mg dose per vial. The value per thymoglobulin vial used in this study was recorded in US dollars, as the institution charges for it.

Statistical analysis The numerical variables were summarized as mean and standard deviation, added by the median, with a variation from the minimum to the maximum value if the distribution of the values followed a non-normal pattern. In presentation of results, the medians were described following the means as follows: (med- [Min – Max]). The categorical variables were summarized as frequencies and presented as percentages. The numerical variables were compared using Student’s t test or the U-Mann-Whitney test, for normal and nonnormal distributions, respectively. The categorical variables were compared using the chi-square (χ2) or Fischer’s exact test, according to the number of events on a 2x2 table. The accumulated incidence of AR and CMV and graft survival were calculated using KaplanMeier actuarial method and compared by means of the Wilkoxon and Tarone-Ware tests. A database with all pieces of patient’s information was constructed in Excel 2007, and the statistical analysis was made using the Statistical Package for Social Science (SPSS), both for Windows. For statistical significance, the value considered was p < 0.05, with a 95% confidence interval. This study was conducted as a partial analysis of the project entitled “Functional and Morphological Impact of Cytomegalovirus Infection in Renal Grafts”, approved by the Research Ethics Committee of the Hospital Israelita Albert Einstein.

59

RESULTS Results concerning the general population of the study From May 2002 through July 2009, 186 cadaveric renal transplantations were performed, with a mean followup time of 42.9 ± 26.8 months. Of these patients, 6.4% (12/186) progressed with graft loss within a mean time of 16.6 ± 23.2 months (med-9.6 [0-79.5]), and 8.6% (16/186) died within a mean time of 14.0 ± 16.3 months (med-9.0 [0-44.5]). The accumulated incidence of AR after one year from transplantation was 15.9% (Figure 2A), and of CMV infection 73.2% (Figure 2B). In this cohort, graft survival after one year from transplantation, not censored for deaths, was 90.3% (Figure 2C). Demographic data of patients enrolled by groups, according to the induction protocol The main variables, according to the group under study, are presented in Table 1. The patients who underwent transplantation more recently (Group 3) were of younger age than those in the other groups, but the difference was not significant. The time on a waiting list increased significantly, form 34.3 ± 26.2 months (med-25 [0-93]) in Group 1 to 55.6 ± 48.2 months (med-39 [1-237]) in Group 2 (p = 0.02, Group 1 versus Group 2), and was 67.3 ± 42.3 months (med60 [6-209]) in Group 3 (p < 0.001, Group 1 versus 3; p = 0.04, Group 3 versus Group 2). Similarly, there was a significant increase in cold ischemia time (CIT) over the evaluated period (Figure 3A). In Group 1 patients, the mean CIT was of 19.5 ± 5.1 hours, while in those of Group 2 it was 21.6 ± 6.3 hours (p = 0.07, Group 1 versus Group 2), and in those of Group 3 it was 24.6 ± 5.7 hours (p < 0.001, Group 1 versus Group 3; p = 0.002, Group 2 versus Group 3). On the other hand, there was a significant reduction in the number of HLA mismatches: 3.2 ± 1.2 in Group 1; 2.7 ± 1.4 in Group 2 (p = 0.02, Group 1 versus Group 2); 2.7 ± 1.3 in Group 3 (p = 0.01, Group 1 versus Group 3; p = ns, Group 2 versus Group 3). In Group 1, 75% of the patients made use of cyclosporin as a calcineurin inhibitor and 14.6% made use of tacrolimus, while in Group 2 an inversion in the choice of the calcineurin inhibitor occurred; in that, 12.3% were on cyclosporin and 78.9% on tacrolimus (p < 0.001, Group 1 versus Group 2). In Group 3, all patients used tacrolimus (p < 0.001, Group 1 versus Group 3; p = 0.77, Group 2 versus Group 3). In Groups 1 e 2, respectively, 10.4% e 8.8% of patients used only two drugs or sirolimus instead of a calcineurin inhibitor. einstein. 2011; 9(1 Pt 1):56-65

Einstein v9n1.indb 59

24.03.11 19:36:44


60

Moura LRR, Tonato EJ, Ferraz EA, Filliponi TC , Chinen R1, Matos ACC, Silva MRF, Durão MS, Pacheco-Silva A

A

B

C

Figure 2. A – Accumulated incidence of acute rejection throughout the first year of transplantation; B – Accumulated incidence of CMV infection throughout the first year of transplantation; C – Renal graft survival, not censored for death. Data related to total number of transplanted patients in the period (N=196)

Complications after renal transplantation: DGF, AR and CMV The main post-transplantation complication was DGF, which occurred in 72.7% of patients in this cohort. Along with the progressive increase of the CIT (Figure 3A), there was a 5.9% rise in the incidence of DGF from Group 1 to Group 2, going from 64.6% to 68.4%, and of 17% from Group 1 to Group 3, in which it was 82.1% (Figure 3B). Despite this clinically significant increase, no statistically significant differences were found when the prevalence in the three groups was compared. And even though the CIT increased, there were no statistically significant differences in the time the patient remained on dialysis after transplantation: Group 1: 11.0 ± 7.3 days (med-19 [8-34]); Group 2: 12.6 ± 8.5 days (med-20.5 [7-34.1]) (p = 0.38, Group 1 versus Group 2); Group 3: 13.5 ± 9.6 days (med-23.8 [12.5-38]) (p = 0.19, Group 1 versus Group 3; p = 0.76, Group 2 versus Group 3). There were 33 episodes of AR, corresponding to a prevalence of 19.2%; twenty-six of them occurred during the first year after transplantation, 16 of them in the first 3 months. There were no differences regarding the prevalence of AR in relation to the maximum amount of thymoglobulin doses used (Figure 4): 16.7% in Group 1; 16.3% in Group 2 (p = 0.99); 16.4% in Group 3 (p = 0.88, Group 1 versus Group 3; p = 0.88, Group 2 versus Group 3). Taking into consideration only the AR episodes in the first year, once the objective of this analysis was the occurrence of adverse events in that period, it was observed that the reduction of the number of thymoglobulin doses produced a significant shortening of the time to occurrence of AR, which was earlier in patients submitted to the induction protocol with up to four doses: 139.9 ± 135.6 days (med-78 [10357]) in Group 1; 163.71 ± 44.9 (med-191 [7-298]) in Group 2 (p = 0.05, Group 1 versus Group 2); 44.9 ± 49.3 (med-18 [9-137]) no Group 3 (p = 0.08, Group 1 versus Group 3; p=0.01, Group 2 versus Group 3). CMV infection was the main infectious complication, and positive antigenemia was detected, independently of clinical symptoms, in 68.7% of patients. There was a substantial increase in the prevalence of CMV in Group 3 compared to Groups 1 and 2. As shown in Figure 4, the prevalence of CMV in Group 1 was 61.7%, while in Group 2 it was 66.1%, and in Group 3 83.3%. However, these differences are statistically not significant: p = 0.85, Group 1 versus Group 2; p=0.37, Group 1 versus Group 3; p=0.48, Group 2 versus Group 3. The viremia diagnosis, on the other hand, was made significantly earlier in Groups 2 and 3 compared to Group 1 (Figure 5A). In Group 1, the CMV diagnosis was made after 64.3 ± 28.5 days

einstein. 2011; 9(1 Pt 1):56-65

Einstein v9n1.indb 60

24.03.11 19:36:44


Immunological induction with thymoglobulin

61

Table 1. Demographic data per group of patients Variable Age (years) Gender (male) - % Time in dialysis (months) Donor age (years) Donor gender (male) - % Mismatches (number) CIT (hours) Tac / Csa (% / %)

Group 1

Group 2

Group 3

n = 48 43.7 ± 14.1 60.4 34.3 ± 26.2* 34.8 ± 12.9 66.7 3.2 ± 1.2† 19.5 ± 5.1‡ 14.6/75.0#

n = 57 43.9 ± 12.4 54.4 55.6 ± 48.2* 38.9 ± 12.5 40.4 2.7 ± 1.4† 21.6 ± 6.3‡ 78.9/12.3#

n = 67 46.3 ± 13.5 50.7 67.3 ± 42.3* 39.2 ± 13.8 54.5 2.7 ± 1.3† 24.6 ± 5.7‡ 100/0#

CIT: cold ischemia time; Tac: tacrolimus; Csa: cyclosporin. *Group 1 versus Group 2: p = 0.02; Group 1 versus Group 3: p < 0.001; Group 3 versus Group 2: p = 0.04; †Group 1 versus Group 2: p = 0.02; Group 1 versus Group 3: p = 0.01; Group 3 versus Group 2: p = 0.77; ‡Group 1 versus Group 2: p = 0.07; Group 1 versus Group 3: p < 0.001; Group 3 versus Group 2: p = 0.002; #Group 1 versus Group 2: p < 0.001; Group 1 versus Group 3: p < 0.001; Group 3 versus Group 2: p = 0.44.

Figure 4. Cytomegalovirus (CMV) infection: Group 1- 61.7%; Group 2- 66.1% (p=0.85) and Group 3- 83.3% (p=0.37, 1 vs. 3; p=0.48, 2 vs. 3). Acute rejection (AR): Group 1- 16.7%; Group 2- 16.3% (p=0.99); Group 3- 16.4% (p=0.88, 1 vs. 3; p=0.88, 2 vs. 3)

(med-57 days [34-179]), with a reduction to 56.8 ± 63.1 days (med-42 [10-410]) in Group 2 (p = 0.005, Group 1 versus Group 2) and to 47.1 ± 22.5 days (med-41 [18115]) in Group 3 (p < 0.001, Group 1 versus Group 3; p = 0.55, Group 2 versus Group 3). As shown in Figure 5B, the viral load detected by the number of cells infected by the virus using antigenemia was similar in all three groups: Group 1: 61.1 ± 66.5 cells (med-23 [2-243]); Group 2: 56.91 ± 118.8 cells (med-20 [3-680]) (p = 0.25, Group 1 versus Group 2); Group 3: 61.9 ± 103.9 (med-15 [2-480]) (p = 0.19, Group 1 versus Group 3; p = 0.76, Group 2 versus Group 3).

Figure 3. A – Range of cold ischemia time per group: Group 1- 19.5 ± 5.1 hours. Group 2- 21.6 ± 6.3 hours (p=0.07) and Group 3- 24.6 ± 5.7 hours (p<0.001, 1x3; p=0.002, 2x3). B. Prevalence of delayed graft function according groups: Grupo 1 – 64.6%, Grupo 2 – 68.4% (p=0.97) e Grupo 3 – 82.1% (p=0.50, 1x3; p=0.60, 2x3)

Survival and renal graft function Renal graft survival one year after transplantation, not censored for deaths, was similar in all three groups (Figure 6): 89.6%, 92.9% and 91.0%, in Groups 1, 2 einstein. 2011; 9(1 Pt 1):56-65

Einstein v9n1.indb 61

24.03.11 19:36:49


62

Moura LRR, Tonato EJ, Ferraz EA, Filliponi TC , Chinen R1, Matos ACC, Silva MRF, Durão MS, Pacheco-Silva A

Figure 6. Renal graft survival

Figure 5. A – Time after transplant for diagnosis of cytomegalovirus (CMV) infection: Group 1- 64.3 ± 28.5 days, Group 2- 56.8 ± 63.1 days (p=0.005) and Group 3- 47.1 ± 22.5 days (p<0.001, 1x3; p=0.55, 2x3). B – Antigenemia to Cytomegalovirus (CMV): group 1 – 61.1±66.5 cells, group 2 – 56.9±118.8 cells (p=0.25) and group 3 – 61.9±103.9 cells (p=0.19, 1x3; p=0.76, 2x3). Figure 7. Group 1- 57.0 ± 20.0 mL/min; Group 2- 67.0 ± 18.4 mL/min (p=0.008); Group 3- 71.2 ± 18.4 mL/min (p<0.001, 1x3; p=0.06, 1x2).

e 3, respectively. Of the patients whose graft was still functioning by the end of the first year, renal graft function during this period, as shown in Figure 7, was better in Group 3, where it attained a mean value of 71.2 ± 18.4 mL/min, compared to 67.0 ± 18.4 mL/min in Group 2 (p = 0.06, Group 3 versus Group 2) and 57.0 ± 20.0 mL/min in Group 1 (p < 0.001, Group 1 versus Group 3; p = 0.008, Group 1 versus Group 2).

Cost of thymoglobulin As expected, there was a substantial reduction in the cost of thymoglobulin (Table 2) as the induction

protocol was modified over time. As reported earlier, Group 1 used a mean number of 9.0 ± 3.8 doses, at an estimated mean cost of US$ 7,925.87 ± 4,493.83 (med- 7,576.02 [1,681.96-21,024.50]). Group 2, in turn, used a total of 4.9 ± 1.5 doses, with an estimated cost of US$ 4,409.87 ± 1,772.71 (med-4,060.73 [1,547.4010,308.01]) (p < 0.001, Group 1 versus Group 2). Group 3 used 3.9 ± 0.8 doses, with an estimated cost of US$ 3,564.76 ± 1,046.76 (med-3,485.56 [468.55-5,406.30]) (p < 0.001, Group 1 versus Group 3; p=0.006, Group 2 versus Group 3).

einstein. 2011; 9(1 Pt 1):56-65

Einstein v9n1.indb 62

24.03.11 19:37:03


Immunological induction with thymoglobulin

63

Table 2. Cost estimate per group of patients Variable Mean ± SD Median Min-Max

Group 1 7,925.87 ± 4,493.83 7,567.02 1,681.96 -21,024.50

Group 2 4,409.87 ± 1,772.71 4,060.73 1,547.40 -10,308.01

Group 3 3,564.76 ± 1,046.76 3,485.56 468.55 -5,406.30

SD: standard deviation; Min: minimum value; Max: maximum value. p<0.001 (Group 1 versus Group 2); p<0.001 (Group 1 versus Group 3); p=0.006 (Group 2 versus Group 2). Values in US dollars

DISCUSSION Immunological induction with antilymphocyte antibodies has been widely used as a strategy for reducing the risk of AR in renal transplantation. Lymphocyte-depleting polyclonal antibodies, such as thymoglobulin, are related to a lower incidence of severe rejection in high-risk patients as compared to non-lymphocyte-depleting monoclonal antibodies, such as basilixmab(12). Among the lymphocytedepleting polyclonal antibodies, thymoglobulin is the most effective, without presenting an increase in side effects, when compared to ATGAM or antilymphocyte antibodies(18). Therefore, immunological induction with thymoglobulin has been considered one of the most adequate strategies for reducing the risk of AR and for a better long-term survival in high-risk patients. Patients who are candidates for a kidney transplantation and have a history of sensitization, especially those submitted to a retransplantation, are considered highrisk patients; however, IRI has also been implicated as a triggering factor for cellular immune response, with the consequent risk of rejection and poorer graft survival(6,19). It has already been demonstrated that the use of thymoglobulin before reperfusion is associated with a reduction in the incidence of DGF, as well as with a faster recovery of renal function(15). In this context, patients submitted to kidney transplantation with a high risk of DGF benefited from the use of thymoglobulin, with a reduction of adverse clinical events. The Transplantation Service involved in this study started the use of thymoglobulin in 2002 for all patients receiving a kidney from a deceased donor, not only aiming to reduce the risk of AR, but also with the purpose of reducing the effects of IRI. During the evaluated period, there was a significant increase in CIT, bringing about a proportional increase in the prevalence of DGF, which reached 80% in the most recent period. Although a reduction in the prevalence of DGF was expected with the use of the intraoperative dose of thymoglobulin(15), some authors stated that, in transplantations performed with a very high CIT, especially over 24 hours, very little strategies are effective for reducing the prevalence of DGF(12). Nevertheless, even with the increase in CIT and the DGF rate, no increase in the incidence of AR or any impact on the renal graft function was observed in

up to one year follow-up, suggesting that, even without reducing the risk of DGF, the use of thymoglobulin may be associated with protection from the late effects of IRI on the renal graft(20). Although many clinical trials demonstrated that immunological induction with thymoglobulin is safe and effective(12-16), the best regimen with regard to number of doses, frequency and accumulated antibody dose has not been established yet. A great part of the experience with the use of antibodies in kidney transplantation was acquired by its use for the treatment of AR, which, in some protocols, reached a total of 14 doses. Ever since, several studies compared a number of induction protocols, in order to define how many doses or how many days of treatment would be necessary to establish a safety profile for the use of thymoglobulin for immunological induction(13,14). In this study, in Group 1, a protocol extrapolating from the one indicated for the treatment of AR was used, allowing the use of up to 14 doses, provided the patients remained in DGF. As of 2004, after analyzing the results obtained in a first phase, it was demonstrated that the use of 7 doses was as safe as the use of up to 14 doses(21). Later on, some published clinical trials comparing thymoglobulin induction protocols confirmed that the use of five to seven doses was safe and effective. Recently, new published data have indicated that an accumulated thymoglobulin dose between 4.0 e 7.0 mg/kg warranted excellent results, regardless of the frequency of antibody administration(1216) . In the last period analyzed, defined as Group 3, four doses were used, amounting to an accumulated dose of 4.5 mg/kg. The results presented here demonstrate that the reduction of the total number of doses to up to four thymoglobulin doses did not increase the prevalence of AR, nor did it alter the survival of the graft by the end of one-year follow-up. Brennan et al., in a study that used 5 to 7 days of thymoglobulin induction, found an incidence of AR confirmed by biopsy (15.6%) similar to that found in Group 3(12). The increase in the prevalence of DGF was attributed to the progressive increase in CIT and not to the reduction in the number of antibody doses; there was, however, no significant increase in the time the patient remained in DGF. An interesting observation of this study was the better function of the renal graft by the end of one einstein. 2011; 9(1 Pt 1):56-65

Einstein v9n1.indb 63

24.03.11 19:37:19


64

Moura LRR, Tonato EJ, Ferraz EA, Filliponi TC , Chinen R1, Matos ACC, Silva MRF, Durão MS, Pacheco-Silva A

year in Group 3. The study design does not allow attributing this improvement to the modification of the induction protocol, especially because it is not possible to compare the several variables that may interfere in the progression of the renal function with the period when the transplantation was performed. However, an important clinical study using thymoglobulin in highrisk patients demonstrated that the induction associated to the use of tacrolimus at low doses was the regimen associated with the best graft function, as compared to tacrolimus at the usual doses or sirolimus(22). Recently, the Transplantation Service of the Hospital Israelita Albert Einstein adopted the strategy of using lower doses of calcineurin inhibitor, aiming at intermediary levels. Another difficulty in comparing the renal function results of each of the groups evaluated here with those of other studies is that only a few of them defined renal function as a primary outcome(23). Another important outcome evaluated in this study was CMV infection. The use of lymphocyte-depleting antibodies is clearly associated with an increase in the risk of CMV infection. Patients using lymphocytedepleting antibodies, both for immunological induction and for treatment of AR, may present a CMV viremia prevalence of up to 80%(17). Therefore, whenever the choice to use these antibodies is made, one of the two risk-reduction strategies for cytomegalic inclusion disease should be adopted: preemptive treatment or prophylaxis(24). In the protocol under discussion, the strategy adopted was preemptive treatment, which does not reduce the incidence of viremia, but is as effective as prophylaxis to reduce the risk of developing the disease. Although not mentioned in the results of the present work, the prevalence of invasive disease was of 6% to 8%, which is similar to the results of other studies, and there were no differences among the groups. Contrary to expectations, patients receiving a lower accumulated dose of thymoglobulin (Group 3) had a higher prevalence of viremia, besides an earlier diagnosis. A partial analysis of the impact of immunosuppression on the prevalence of CMV was made in a cohort of patients included in this study and demonstrated that tacrolimus was related to a two-fold increase in viremia risk, as compared to cyclosporin(25). All patients of Group 3 used tacrolimus, while it was given to 78.9% in Group 2 and to only 14.6% in Group 1. This may have been one of the reasons why there was a significant increase in the prevalence of CMV among the patients who received a smaller number of thymoglobulin doses. In populations of patients at high risk of DGF and AR, the use of immunological induction is an effective and safe strategy for reducing the short- and long-term adverse effects(12-16). The analysis presented

here demonstrates that adjusting the thymoglobulin induction protocol to a reduced number of doses, with an accumulated dose of 4.5 mg/kg did not change the prevalence of AR or the survival of the graft in oneyear follow-up. In spite of the difference in the type of calcineurin inhibitor used (cyclosporin or tacrolimus), it can be stated that minimizing the number of thymoglobulin doses in association with the use of tacrolimus is safe and effective in this kind of patient. Besides observing a substantial improvement in renal graft function after one year, which, as already discussed, cannot be attributed to the modification made in the induction protocol, an undisputable benefit that is also directly related to the appropriateness of number of thymoglobulin doses is the cost of transplantation. Although, in the long run, renal replacement therapy is cheaper than dialysis, the expenses during the first year after transplantation are still substantially higher, especially due to cost of transplantation itself(26). Regarding the use of immunological induction, it was demonstrated here that there is a significant reduction in the cost of the initial treatment, evaluated by estimating the expense with thymoglobulin, which can be considered an additional benefit.

REFERÊNCIAS 1. Starzl TE, Marchioro TL, Hutchinson A, Porter KA, Cerilli GJ, Brettschneider L. The clinical use of antilymphocyte globulin in renal homotransplantations. Transplantation. 1967;5(4):1100-5. 2. Mueller TF. Thymoglobulin: an immunologic overview. Curr Opin Organ Transplant. 2003;8:305-12. 3 Lebranchu Y, Bridoux F, Büchler, M Le Meur Y, Etienne I, Toupance O, et al. Immunoprophylaxis with Basiliximab compared with Antithymocyte Globulin in renal transplant patients receiving MMF-containg triple therapy. Am J Transplant. 2002;2(1):48-56. 4. Chertow GM, Milford EL, Mackenzie HS, Brenner BM. Antigenindependent determinants of cadaveric kidney transplant failure. JAMA. 1996;276(21):1732-6. 5. Cecka JM, Cho YW, Terasaki PI. Analyses of the UNOS Scientific Renal Transplant Registry at three years--early events affecting transplant success. Transplantation. 1992;53(1):59-64. 6. Ojo AO, Wolf RA, Held PJ, Prot FK, Schmouder RL. Delayed graft function: risk factors and implications for renal allograft survival. Transplantation. 1997;63(7):968-74. 7. Lemay S, Rabb H, Postler G, Singh AK. Prominent and sustained up-regulation of gp130-signalin cytokines and the chemokine MPI-2 in murine renal ischemiareperfusion injury. Transplantation. 2000;69(5):959-63. 8. Shokes DA, Cecka JM. Deleterious effects of delayed graft function in cadaveric renal transplant recipients independent of acute rejection. Transplantation. 1998;66(12):1697-701. 9. Burne MJ, Daniels F, El Ghandour A, Mauiyyedi S, Colvin RB, ODonnell MP, et al. Identification of the CD4+ T Cell as a major pathogenic factor in ischemic acute renal failure. J Clin Invest. 2001;108(9):1283-90. 10. Yokota N, Daniles F, Crosson J, Rabb H. Protective effect of T cell depletion in murine renal ischemia-reperfusion injury. Transplantation. 2002;74(6): 759-63.

einstein. 2011; 9(1 Pt 1):56-65

Einstein v9n1.indb 64

24.03.11 19:37:19


Immunological induction with thymoglobulin

11. Woodside KJ, Hu M, Meng T, Hunter GC, Sower LE, Daller JA. Differential effects of interleukin-2 blokade on apoptosis in naïve and active human lymphocytes. Transplantation. 2003;75(10):1631-5. 12. Brennan DC, Daller JA, Lake KD, Cibrik D, Del Castillo DD; Thymoglobulin Induction Study Group. Rabbit antithymocyte globulin versus basiliximab in renal transplantation. N Eng J Med. 2006;355(19):1967-77. 13. Agha IA, Rueda J, Alvarez A, Singer GG, Miller BW, Flavin K, et al. Short course induction immunosuppression with Thymoglobulin for renal transplant recipients. Transplantation. 2002;73(3):473-5. 14. Stevens RB, Mercer DF, Grant WJ, Freifeld AG, Lane JT, Groggel GC, et al. Randomizes trial of single-dose versus divided dose rabbit anti-thymocyte globulin induction in renal transplantation: an interim report. Transplantation. 2008;85(10):1391-9. 15. Goggins WC, Pascual MA, Powelson JA, Magee C, Tolkoff-Rubin N, Farrell ML, et al. A prospective, randomized, clinical trial of intraoperative versus postoperative Thymoglobulin in adult cadaveric renal transplant recipients. Transplantation.2003;76(5):798-802. 16. Peddi VR, Bryant M, Roy-Chaudhury P, Woodle S, First MR. Safety, efficacy, and cost analysis of Thymoglobulin induction therapy with intermittent dosing based on CD3+ lymphocyte counts in kidney and kidney-pancreas transplant recipients. Transplantation. 2002;73(9):1514-8. 17. Ozaki KS, Pestana JOM, Granato CFH, Pacheco-Silva A, Camargo LFA. Sequential cytomegalovirus antigenemia monitoring in kidney transplant patients treated with antilymphocyte antibodies. Transplant Infect Dis. 2004;6(2):63-8. 18. Hardinger KL, Schnitzler MA, Miller B, Lowell JA, Shenoy S, Koch MJ, et al. Five-years follow up of Thymoglobulin versus ATGAM induction in adult renal transplantation. Transplantation. 2004;78(1):136-41.

65

19. Goes N, Urmson J, Ramassar V, Halloran PF. Ischemic acute tubular necrosis induces an extensive local cytokine response. Evidence for induction of interferon-gamma, transforming growth factor-beta 1, granulocytemacrophage colony-stimulating factor, interleukin-2, and interleukin-10. Transplantation. 1995;59(4):565-72. 20. Moura LR, Pereira MG, Durão M, Tonato EJ, Matos AC, Wroclawski ER, et al. Thymoglobulin as an induction therapy: protection against ischemia and reperfusion injury. Einstein. 2006;4(4):315-20. 21. Requião-Moura LR, Durão MS, Tonato EJ, Pereira MG, Wroclawski ER, Matos AC, et al. Effect of Thymoglobulin in graft survival and function 1 year after kidney transplantation using deceased donors. Transplant Proc. 2006;38(6):1895-7. 22. Ekberg H, Tedesco-Silva H, Demirbas A, Vítko S, Nashan B, Gürkan A, Margreiter R, Hugo C, Grinyó JM, Frei U, Vanrenterghem Y, Daloze P, Halloran PF; ELITE-Symphony Study. Reduced exposure to calcineurin inhibitors in renal transplantation. N Eng J Med. 2007;357(25):2562-75. 23. Demirbas A, Hugo C, Grinyó J, Frei U, Gürkan A, Marcén R, et al. Low toxicity regimens in renal transplantation: a country subset analysis of the Symphony study. Transplant International. 2009;22(12):1172-81. 24. Kalil AC, Levitsky J, Lyden E, Stoner J, Freifeld A. Meta-analysis: the efficacy of strategies to prevent organ disease by Cytomegalovirus in solid organ transplant recipients. Ann Intern Med. 2005;143(12):870-80. 25. Requião-Moura LR, Arruda EF, Tonato EJ, Chinen R, Durão MS, PachecoSilva A. Effect of Cytomegalovirus Viremia in Early Tubular Proximal Injury and Late Renal Graft Function. Am J Transplant. 2010;10:332 [abstract]. 26. Zelmer JL. The economic burden of end-stage renal disease in Canada. Kidney Internat. 2007;72(1):1122-9. doi:10.1038/sj.ki.5002459.

einstein. 2011; 9(1 Pt 1):56-65

Einstein v9n1.indb 65

24.03.11 19:37:20


ORIGINAL ARTICLE

Sterilization of single-use helical stone baskets: an experimental study Esterilização de cestas helicoidais descartáveis extratoras de cálculo: um estudo experimental Fernando Korkes1, Alex Menezes2, Cely Barreto da Silva3, Roni de Carvalho Fernandes4, Marjo Deninson Cardenuto Perez4

ABSTRACT Objectives: To experimentally evaluate the efficacy of a standard sterilization protocol employed during reuse of disposable helical stone baskets. Methods: Study performed on 20 helical stone baskets: 10 were used in the initial validation process, contaminated with Escherichia coli ATCC 25922 and imprinted on Müeller-Hinton media; 10 catheters were contaminated with Geobacillus stearothermophilus ATCC 7953, processed, inoculated in TSB and incubated in a water bath at a temperature of 55ºC. Bacterial growth was evaluated after 1, 3, 5 and 7 days. After sterilization, stone baskets were also opened and closed 40 times to check for functional problems. All plastic and basket parts were carefully checked for damages. Results: After the 72-hour incubation period, there was growth of E. coli ATCC 25922 in 100% of imprints. After the sterilization process and up to 7 days incubation period on a blood agar plate, there was no growth of G. stearothermophilus ATCC 7953 or any other bacteria. There were no functional problems or damage to baskets after the sterilization process. Conclusion: The ethylene oxide system is efficacious and safe for sterilization of disposable helical stone baskets. However, further clinical studies are required and should provide more safety information. Keywords: Catheterization; Equipment reuse/standards; Sterilization/ methods; Disposable equipment; Ethylene oxide

RESUMO Objetivo: Avaliar experimentalmente a eficácia de um protocolo padrão de esterilização de cestas helicoidais descartáveis extratoras de cálculo. Métodos: Estudo realizado com 20 cestas helicoidais descartáveis extratoras de cálculo: 10 foram utilizadas no processo inicial de validação do método, contaminadas com Escherichia coli

ATCC 25922 e semeadas em meio de Müeller-Hinton; 10 foram contaminadas com Geobacillus stearothermophilus ATCC 7953, processadas, inoculadas em TSB e incubadas em banho maria, a 55 ºC. O crescimento bacteriano foi avaliado depois de 1, 3, 5 e 7 dias. Após a esterilização, as cestas helicoidais descartáveis extratoras de cálculo foram abertas e fechadas 40 vezes para avaliar problemas funcionais. Todas as partes plásticas foram avaliadas quanto a danos. Resultados: Após as 72 horas de incubação, observouse crescimento de E. coli ATCC 25922 em todos os meios. Após a esterilização e até 7 dias de incubação, não houve crescimento de G. stearothermophilus ATCC 7953 ou de qualquer outra bactéria. Não foram observados problemas funcionais ou danos nas cestas após a esterilização. Conclusão: O processo de esterilização com óxido de etileno é seguro e eficaz para re-esterilizar cestas helicoidais descartáveis extratoras de cálculo descartáveis. Contudo, são necessários mais estudos clínicos para fornecer mais informações sobre segurança. Descritores: Cateterismo; Reutilização de equipamento/normas; Esterilização/métodos; Equipamentos descartáveis; Óxido de etileno

INTRODUCTION The past decades have seen an explosion in the use of single-use medical devices, stemming from the desire to improve product performance and minimize the potential for disease transmission. However, single-use devices are typically more expensive. Because of the rising costs of health care, the practice of reusing various disposable medical devices has been adopted by many hospitals(1,2). It is very common

Study carried out at Disciplines of Urology and Microbiology of Faculdade de Ciências Médicas, Santa Casa de São Paulo – FCMSCSP, São Paulo (SP), Brazil. 1

Discipline of Urology of Faculdade de Medicina do ABC – FMABC, Santo André (SP), Brazil.

2

Faculdade de Ciências Médicas of Santa Casa de Misericórdia de São Paulo – SCMSP, São Paulo (SP), Brazil.

3

Discipline de Microbiology of Faculdade de Ciências Médicas, Santa Casa de São Paulo – FCMSCSP, São Paulo (SP), Brazil.

4

Discipline of Urology of Faculdade de Ciências Médicas, Santa Casa de São Paulo – FCMSCSP, São Paulo (SP), Brazil. Corresponding author: Fernando Korkes – Rua Pirapora, 167 – Ibirapuera – CEP 04008-060 – São Paulo (SP), Brazil – Tel.: 11-3884-2233 – e-mail: fkorkes@terra.com.br Received on Jul 13, 2010 – Accepted on Jan 24, 2011

*The authors declare there is no conflict of interest.

einstein. 2011; 9(1 Pt 1):66-9

Einstein v9n1.indb 66

24.03.11 19:37:20


Sterilization of single-use helical stone baskets: an experimental study

in Brazilian public hospitals to reuse these devices, mainly for urinary calculi surgeries. Sterilization can be performed using ethylene oxide or glutaraldehyde. Heat sterilization is not performed given these devices have plastic parts. Glutaraldehyde has not been recommended because Mycobacteriae can be resistant(3). The major concerns in reusing single-use items regard the several potential risks to patients such as infection, toxicity, contamination and device breakage. Urosepsis from manipulation of the urinary tract during stone surgery can be catastrophic despite antibiotic prophylaxis(4). Stone baskets are the most often single-use devices used in most of the ureteroscopy procedures. As they cost several hundred dollars, in a subset of hospitals these procedures are only available through sterilization and reuse. Even though this is a common practice, no previous studies have evaluated its safety.

OBJECTIVE The aim of the present study was to experimentally evaluate the efficacy of a standard cleaning and sterilization protocol employed during reuse of disposable helical stone baskets. METHODS This study was carried out at the Disciplines of Urology and Microbiology of Faculdade de Ciências Médicas da Santa Casa de São Paulo (FCMSCSP) between 2008/09. The study was performed on 20 helical stone baskets (Handle Cook®, Helical Stone Extractor, 4 wire basket, length 115 cm) and comprised three phases: 1. validation process, aiming to demonstrate that baskets were contaminated with bacteria after usage; 2. test for sterility, to evaluate ethylene oxide sterilization process efficacy; 3. functional test, to evaluate if the disposable devices could resist reutilization. Standard suspensions of bacterial strains from the American Type Culture Collection (ATCC) were inoculated: Escherichia coli ATCC 25922 (concentration around 1.5 x 108 CFU/mL, 0.5 on the McFarland scale) and Geobacillus stearothermophilus ATCC 7953.

Validation process Ten helical stone baskets were used in this initial validation process. The helical baskets had their tip

67

inserted in the E. coli ATCC 25922 suspension, and were opened and closed 40 times, guaranteeing that the entire inner part of the catheter was also contaminated. The wire and the plastic handle were also contaminated with a swab. The baskets were allowed to dry for 24 hours on a clean bench. The catheters were than detached and imprinted on Müeller-Hinton media. Individual analysis of media was assessed for the following imprints: (1) plastic handle, (2) basket, (3) proximal internal steel wire, (4) medium internal steel wire, (5) distal internal steel wire and (6) external plastic sheet. Müeller-Hinton media were incubated at 35 ± 2 ºC, and bacterial growth was evaluated at days 1, 3, 5 and 7.

Testing for sterility Ten catheters were contaminated with G. stearothermophilus ATCC 7953 according to the previously described protocol. These bacteria were used in this part of the study, as they are more resistant to high temperatures(5,6). After air-drying, the bacteriainfected catheters were sent to the hospital’s Sterile Service Department. They were separated into their parts and manually cleaned with hot water. The internal parts were cleaned with a syringe. The water was drained, and parts were left in an enzyme solution for 10 minutes. They were then cleaned with water again and put into an 80% alcohol solution for 15 minutes. They were air-dried and the catheter was hermetically sealed in a sterilization pouch, allowing penetration of sterilization gases but providing a barrier against penetration by microorganisms. Ethylene oxide gas sterilization was done in a twostage cycle of 24 hours by using the 100% ethylene oxide sterilizer. After the sterilization process, catheters’ parts – (1) plastic handle, (2) basket, (3) proximal internal steel wire, (4) medium internal steel wire, (5) distal internal steel wire, (6) external plastic sheet – were inoculated in tubes with Tryptic Soy Broth (TSB) and incubated in a water bath at 55ºC. Bacterial growth was evaluated after 1, 3, 5 and 7 days. Acceptable test results were to be indicated by an absence of microbial growth in all sterility tests. Functional aspects after sterilization After sterilization, stone baskets were opened and closed 40 times to check for problems in function. All plastic and basket parts were carefully checked for damages.

einstein. 2011; 9(1 Pt 1):66-9

Einstein v9n1.indb 67

24.03.11 19:37:21


68

Korkes F, Menezes A, Silva CB, Fernandes RC, Perez MDC

RESULTS During the experimental basket contamination and validation process and after the 72-hour incubation period, there was growth of E. coli ATCC 25922 in 100% of imprints. After the sterilization process and up to 7 days incubation period in a TSB tube, there was no growth of G. stearothermophilus ATCC 7953 or any other bacteria. There were no functional problems or damage to baskets after the sterilization process. DISCUSSION Disposable devices used in the endourology setting have a higher percentage of plastic in their construction than similar reusable devices(7-9). Moreover, singleuse catheters not necessarily have flushable lumens and removable parts to allow cleaning solutions and sterilization to reach all areas of the device. In this study, lumens were submitted to a gross contamination, after the baskets were immersed, opened and closed several times in bacterial broths. In the first part of the present study, we tested an experimental model of stone basket contamination. E. coli ATCC 25922 was chosen as it is easily manipulated and has a low virulence(5,6). In the second part, G. stearothermophilus ATCC 7953 was used, as it has a high resistance to sterilizing methods( 5,6,10). After sterilization, there were no detectable bacteria in any of the segments of the internal wire (proximal, medium or distal). The ethylene oxide sterilization process can therefore be considered efficient in eliminating bacteria from disposable helical stone baskets. Since these devices get in contact with urine, major concerns are related to bacterial infection. To reduce the risk of mycobacteria, it was our option to use ethylene oxide sterilization. Another important issue would also be to test destructibility or breakdown in reprocessing procedures. Ethylene oxide can be considered a flexible sterilization process, meaning cycles can be tailored to handle complex devices. It can be used with a wide range of plastics and other materials without affecting the integrity of the device(10,11). According to the US Food and Drug Administration (FDA), urological baskets and catheters are class II semi-critical devices(2,12). This means that they are not products that intend to support or sustain human life, and therefore can be considered for reprocessing(2,12). We did not found any product damage after the sterilization process, suggesting that patients’ safety would not be threatened.

We are aware of several limitations of this study; for example, we did not test for viral infection or sterilization. However, previous studies have demonstrated that appropriate cleaning and sterilization of reused disposable devices inactivates blood-borne viruses, and the risk of infection is virtually zero(13). The policy on the reprocessing and reuse of single-use helical stone basket devices is affected by several factors such as health costs, equipment manufacturers’ interests, hospitals’ interests and thirdparty reprocessors. However, policy should be based mainly on patient safety concerns. The present study and available data show that single-use stone baskets can be reprocessed with a reasonable assurance of safety and effectiveness, and reused without increasing patients’ risk.

CONCLUSION This experimental study demonstrated that ethylene oxide system is efficacious and safe for sterilizing disposable helical stone baskets contaminated with bacteria. However, further clinical studies are required and might bring more safety information. REFERENCES 1. Yang M, Deng X, Zhang Z, Julien M, Pelletier F, Desaulniers D, et al. Are intraaortic balloons suitable for reuse? A survey study of 112 used intraaortic balloons. Artif Organs. 1997;21(2):121-30. 2. Smith JJ, Henderson JA, Baim DS. The Food and Drug Administration and reprocessing of single-use medical devices: a revised policy and new questions. J Vasc Interv Radiol. 2002;13(12):1179-82. 3. ANVISA. Ocorrências de casos de infecções por MCR (Mycobacterium de Crescimento Rápido) pós videocirurgia. Nota Técnica n.º 2/2007 e n.º 5/2008. ANVISA; 2008. 4. Mariappan P, Tolley DA. Endoscopic stone surgery: minimizing the risk of postoperative sepsis. Curr Opin Urol. 2005;15(2):101-5. 5. Kralovic RC. Use of biological indicators designed for steam or ethylene oxide to monitor a liquid chemical sterilization process. Infect Control Hosp Epidemiol. 1993;14(6):313-9. 6. Bielanski A. Experimental microbial contamination and disinfection of dry (vapour) shipper dewars designed for short-term storage and transportation of cryopreserved germplasm and other biological specimens. Theriogenology. 2005;63(7):1946-57. 7. Rodríguez García N, Fernández González I, Pascual Mateo C, Chiva Robles V, Luján Galán M, Llanes González L, et al. [Stone Cone: a device that prevents ureteral stone migration during intracorporeal lithotripsy.] Arch Esp Urol. 2005; 58(4):329-34. Spanish. 8. Sánchez de Badajoz E, Jiménez Garrido A. [Microlaparoscopic varicocelectomy]. Arch Esp Urol. 2002;55(6):659-64. Spanish. 9. Valdivia Uria JG, Sánchez Elipe MA, Sánchez Zalabardo M. [Laparoscopic approach through optic trocars]. Arch Esp Urol. 2000;53(10):905-16. Spanish. 10. Rutala WA, Weber DJ. Disinfection and sterilization in health care facilities: what clinicians need to know. Clin Infect Dis. 2004;39(5):702-9.

einstein. 2011; 9(1 Pt 1):66-9

Einstein v9n1.indb 68

24.03.11 19:37:22


Sterilization of single-use helical stone baskets: an experimental study

11. Rutala WA, Gergen MF, Weber DJ. Comparative evaluation of the sporicidal activity of new low-temperature sterilization technologies: ethylene oxide, 2 plasma sterilization systems, and liquid peracetic acid. Am J Infect Control. 1998;26(4):393-8. 12. Schultz, D. Reprocessing of Single-Use Devices: Statement of Daniel Schultz, M.D., Director CDRH, Before the Committee on Government Reform - September 26, 2006. Center for Devices and Radiological Health (CDRH)

69

at the Food and Drug Administration (FDA or the Agency) 2006; Available from: http://www.fda.gov/MedicalDevices/DeviceRegulationandGuidance/ ReprocessingofSingle-UseDevices/ucm121067.htm 13. Druce JD, Russell JS, Birch CJ, Vickery K, Harper RW, Smolich JJ.. Cleaning and sterilization protocol for reused cardiac electrophysiology catheters inactivates hepatitis and coxsackie viruses. Infect Control Hosp Epidemiol. 2005;26(8):720-5.

einstein. 2011; 9(1 Pt 1):66-9

Einstein v9n1.indb 69

24.03.11 19:37:22


HEALTH ECONOMICS AND MANAGEMENT

A new spectrophotometric method to detect residual amounts of peroxide after reprocessing hemodialysis filters Um novo método espectrofotométrico para detectar níveis residuais de peróxido após o reprocessamento de filtros de hemodiálise Moacir de Oliveira1, Maria Aparecida Dalboni2, Ilson Jorge Iizuka1, Silvia Regina Manfredi2, Nadia Karina Guimarães1, Maria Claudia Cruz Andreoli1, Ana Cristina Carvalho Matos1, Marcelo Costa Batista1, Bento Fortunato Cardoso Santos1, Miguel Cendoroglo Neto3

ABSTRACT

RESUMO

Objective: Reuse of hemodialysis filters is a standard practice and the sterilizing chemical most often employed is peracetic acid. Before starting the dialysis session, filters and lines are checked for residual levels of peracetic acid by means of a non-quantitative colorimetric test that is visually interpreted. The objective of this study was to investigate a new quantitative spectrophotometric test for detection of peracetic acid residues. Methods: Peracetic acid solutions were prepared in concentrations ranging from 0.01 to 10 ppm. A reagent (potassium-titanium oxide + sulfuric acid) was added to each sample in proportions varying from 0.08 to 2.00 drops/mL of solution. Optical densities were determined in a spectrophotometer using a 405-nm filter and subjected to visual qualitative test by different observers. Results: A relation between peroxide concentrations and respective optical densities was observed and it was linear with R2 > 0.90 for all reagent/substrate proportions. The peak optical densities were obtained with the reagent/substrate ratio of 0.33 drops/mL, which was later standardized for all further experiments. Both qualitative and quantitative tests yielded a specificity of 100%. The quantitative test was more sensitive than the qualitative test and resulted in higher positive and negative predictive values. There was a difference between observers in the qualitative test and some samples with significant amounts of peroxide were not detected. Conclusion: A quantitative spectrophotometric test may improve detection of residues of peracetic acid when compared to the standard visual qualitative test. This innovation may contribute to the development of safer standards for reuse of hemodialysis filters.

Objetivo: A reutilização de filtros de hemodiálise é uma prática disseminada e a substância química esterilizante mais empregada é o ácido peracético. Antes de iniciar a sessão de diálise, os filtros e as linhas são verificados em relação a níveis residuais de ácido peracético por meio de teste colorimétrico não quantitativo, com interpretação visual. O objetivo deste trabalho foi investigar um novo teste espectrofotométrico quantitativo para detecção de resíduos de ácido peracético. Métodos: As soluções de ácido peracético foram preparadas em concentrações que variam de 0,01 a 10 ppm. O reagente (óxido de potássio-titânio + ácido sulfúrico) foi acrescentado a cada amostra em proporções que variaram de 0,08 a 2,00 gotas/mL de solução. As densidades ópticas foram determinadas em um espectrofotômetro com filtro de 405 nm e submetidas a um teste visual qualitativo por diferentes observadores. Resultados: Observouse a relação linear entre as concentrações de peróxido e as respectivas densidades ópticas com R2 > 0,90 para todas proporções de reagente/ substrato. As maiores densidades ópticas foram obtidas com a proporção reagente/substrato de 0,33 gotas/mL, que foi padronizada para todos os experimentos posteriores. Os testes qualitativo e quantitativo apresentaram especificidade de 100%. O teste quantitativo foi mais sensível do que o qualitativo e apresentou maiores valores preditivos positivo e negativo. Houve uma diferença entre os observadores no teste qualitativo e algumas amostras com quantidade significativa de peróxido não foram detectadas. Conclusão: O teste espectrofotométrico quantitativo pode melhorar a detecção de resíduos de ácido peracético em comparação ao teste visual qualitativo padrão. Essa inovação pode contribuir para o desenvolvimento de padrões mais seguros na reutilização de filtros de hemodiálise.

Keywords: Renal dialysis/instrumentation; Renal dialysis/methods; Peracetic acid; Spectrophotometry /methods; Peroxides

Descritores: Diálise renal/instrumentação; Diálise renal/métodos; Ácido peracético; Espectrofotometria/métodos; Peróxidos

Study carried out at Laboratório de Uremia da Universidade Federal de São Paulo – UNIFESP, São Paulo (SP), Brazil. 1

Discipline of Nephrology, Universidade Federal de São Paulo – UNIFESP, São Paulo (SP), Brasil; Dialysis Center, Hospital Israelita Albert Einstein – HIAE, São Paulo (SP), Brazil.

2

Discipline of Nephrology, Universidade Federal de São Paulo – UNIFESP, São Paulo (SP), Brazil.

3

Discipline of Nephrologiy, Universidade Federal de São Paulo – UNIFESP, São Paulo (SP), Brazil; Dialysis Center, Hospital Israelita Albert Einstein – HIAE, São Paulo (SP), Brazil; Division of Nephrology of Tufts University School of Medicine – Boston, USA. Corresponding author: Moacir Oliveira – Avenida Albert Einstein, 627 – Morumbi – CEP 05651-901 – São Paulo (SP), Brazil - Tel.: 11 2151-1233 - e-mail: moacir@einstein.br Received on Dec 13, 2010 – Accepted on Feb 8, 2011 The authors declare there is no conflict of interest.

einstein. 2011; 9(1 Pt 1):70-4

Einstein v9n1.indb 70

24.03.11 19:37:23


A new spectrophotometric method to detect residual amounts of peroxide

INTRODUCTION Hemodialysis (HD) is a relatively safe procedure but several complications may occur due to side effects related to normal extracorporeal circuit, technical errors, or to abnormal reactions of patients to the procedure(1,2). From inception, maintenance HD therapy has been a challenge because of its many bioincompatible components. Besides complement activation by the HD membrane, water contaminants and residues of sterilizing agents may also have an impact in the internal milieu(1-4). Reuse of HD filters is a common practice in Brazil and in the United States(5). Major advantages of this practice include cost reduction and a decrease in the incidence of first use syndrome(6-9). Major disadvantages include exposure of the internal milieu to germicides, risk of pyrogenic reactions and infections, reduced efficiency of the dialyzers, and possibly increased oxidative stress(8-14). In accordance with the Association for the Advancement of Medical Instrumentation (AAMI) and the Centers for Disease Control and Prevention (CDC), peracetic acid (PA) is currently the most frequently used sterilizer for reprocessing of dialyzers(15). Standards for reuse of dialyzers have been set by these agencies. The basic procedure for dialyzer reprocessing comprises four steps: rinsing, cleaning, performance testing, and disinfection and sterilization(8,9) Before starting a new dialysis session, the clinical staff must assure that no residue of PA is present within the HD filter and its lines. Indeed, the presence of very small amounts of PA can induce a strong host response with severe respiratory distress and hypotension(10). In Brazil, similar rules are enforced by the National Health Surveillance Agency (ANVISA), which is the regulatory agency(16). The current technique to address presence of residual amounts of peroxide and PA in HD filter and lines is a non-quantitative colorimetric assay. This test is performed by adding a titanium-salt-based reagent to a sample of the saline remaining in the HD system after rinsing. A concentration of peroxide of at least one part per million (ppm) yields a light yellow color to the sample in the test tube. One major pitfall of this method is that it depends on the observer. Moreover, there is no evidence that smaller concentrations of peroxide, inferior to 1 ppm, may not be harmful for the patient. In order to improve safety of this procedure, we developed a quantitative test including a spectrophotometric reading of this reaction. To that end, the ideal concentration ratio was established between reagent and substrate, sensitivity and specificity of the

71

test were determined, and sensitivity and specificity of the qualitative visual test were compared to the new quantitative spectrophotometric test.

METHODS Sterilizing agent and test reagent Proxitane® (Fresenius Medical Care, Frankfurt, Germany) was the sterilizing solution used in all reuses and tests performed in this study. It consists of an aqueous solution of PA at 2%, hydrogen peroxide at 6.3%, acetic acid at 19% and stabilizers. All tests were prepared by adding Proxitane® to a saline solution. For the visual detection of PA, Allper™ reagent (Peróxidos do Brasil, Curitiba, Paraná, Brazil) was used and it consists of water solution of a titanium salt (C4K2O9Ti) and sulfuric acid. After reacting with peroxide, it yields a light yellow color. According to the supplier, this test enables detection of concentrations of peroxide above 1 ppm. An initial Proxitane® solution, with 2,000 ppm peroxide, was made as a base for all other test solutions. Serial dilutions were made into 15-mL translucid tubes. Allper™ reagent was added and color development was attained after less than 5 minutes and was stable for at least 12 hours. Standardizing the reagent to substrate proportion According to the supplier, one drop of Allper™ reagent should be added to each 3 mL of substrate (0.33 drop per mL) in order to allow detection of concentrations of peroxide as low as 1 ppm. In order to determine the best reagent/substrate (R/S) proportion for the different concentrations of peroxide tested in this study, PA solutions with concentrations of 0.01, 0.1, 0.5, 1, 5 and 10 ppm were prepared in 15 mL tubes, with 3, 6, 9 and 12 mL of these solutions. To the test tubes, 1, 3 and 6 drops of the Allper™ reagent were added to obtain the proportions of 0.08, 0.11, 0.17, 0.25, 0.33, 0.5, 1 and 2 drops of Allper™ reagent per milliliter of peroxide solution at each study concentrations. In the end, there was a matrix of test tubes with six different concentrations of peroxide (0.01 to 10 ppm) and eight R/S proportions (0.08 to 2 drops/mL). Qualitative visual test After determining the ideal R/S proportion, samples of peroxide at concentrations of 0.01, 0.1, 0.5 and 1 ppm were prepared, tested and read by 6 staff members of the Dialysis Center at the Hospital

einstein. 2011; 9(1 Pt 1):70-4

Einstein v9n1.indb 71

24.03.11 19:37:24


72

Oliveira M, Dalboni MA, Iizuka IJ, Manfredi SR, Guimarães NK, Andreoli MCC, Matos ACC, Batista MC, Santos BFC, Cendoroglo Neto M

Israelita Albert Einstein (HIAE), 6 working at the Fundação Oswaldo Ramos (FOR) Dialysis Center and 6 from the FOR Research Laboratory. They were asked to identify the samples presenting with a yellow color. The study was approved by the Internal Review Board at UNIFESP.

Quantitative spectrophotometric test After color development, aliquots of 300 µl were transferred to 96-well polystyrene plaques. Optical densities (OD) were quantified by a spectrophotometer (ASYS Hitech GmbH, Engendorf, Austria) with a 405-nm filter. Statistical analysis The software True Epistat (Tracy L Gustaffson, Richardson, Texas, USA) was used to carry out the statistical analysis of data. Continuous variables were expressed as mean ± standard deviation. Student’s t test was used to compare continuous data and χ2 test to compare categorical data. Sensitivity, specificity, positive and negative predictive values were determined for the qualitative test (visual detection) and the quantitative colorimetric assay. Spearman coefficient was used for correlation analyses. The level of statistical significance was 5% (p < 0.05). RESULTS Within the range of 0.01 to 1 ppm of peroxide concentration, correlations between peroxide concentration and OD were always linear, with R2 > 0.90 (Table 1). Sensitivity of the quantitative method was analyzed according to the R/S proportion (Table 2). It was observed that for concentrations lower than 0.5 ppm, OD yielded the highest values for R/S of 0.33 drops/mL

(1 drop to each 3 mL of substrate). For concentrations of 0.1 and 0.5 ppm, OD increased as the R/S rose from 0.08 drops/mL to 0.33 drops/mL, and then decreased with higher R/S (0.5 to 2 drops/mL). Analyzing the concentration of 5 ppm of peroxide, there was no increase in OD with R/S above 0.33 drops/mL. For the concentration of peroxide of 10 ppm, the OD continued to increase until the highest R/S (2 drops/ mL) was reached (Table 2). When the ratio R/S of 1 drop to 3 mL was used, correlations between OD and peroxide concentration yielded R2 > 0.99, 0.97 and 0.92, respectively, for the OD ranges of 0.01 to 1 ppm; 0.01 to 5 ppm and 0.01 to 10 ppm (p = 0.0002, p < 0.00001 and p = 0.0004). After these results it was decided to standardize the R/S of 0.33 drops/mL for all further tests. For the visual test, 18 individuals, 6 laboratory personnel and 12 dialysis staff members were recruited. Concentrations ranging from 0.01 to 1 ppm were tested and their results were compared with those of the quantitative test (Table 3). Moreover, both groups of volunteers were compared (Table 4). Comparing the quantitative test with the visual colorimetric test and calculating the positive and negative predictive values, as well as sensitivity and specificity of both techniques (Table 3), it was observed that both tests yielded a specificity of 100%. Sensitivity, however, was higher for the quantitative test in all concentrations considered. The quantitative test also yielded higher positive predictive value and negative predictive value when compared to the visual test. Both groups of observers were submitted to comparison. The sensitivity rate of the test was similar between the groups (100%) for the highest concentration of peroxide (1 ppm). It decreased with lower concentrations of peroxide and was different between the groups for concentrations of 0.5 and 0.1 ppm. It was similar between the groups and very low (5%) at the concentration of 0.01 ppm of peroxide (Table 4).

Table 1. Correlations between concentrations of peroxide and optical densities for the different proportions of reagent/substrate. Analyses were performed considering three different ranges of peroxide concentration: 0.01 to 1 ppm, 0.01 to 5 ppm e 0.01 to 10 ppm (n = 18) Reagent (drops) Substrate (mL) 1 1 1 3 1 3 3 6

12 9 6 12 3 6 3 3

Proportion R/S (drops/mL) 0.08 0.11 0.17 0.25 0.33 0.5 1 2

0.01-1 ppm R2 0.96 0.99 0.99 0.99 0.99 0.99 0.98 0.92

p - value 0.004 < 0.00001 0.0001 < 0.00001 0.0002 0.00004 0.0003 0.004

0.01-5 ppm R2 0.32 0.93 0.99 0.99 0.97 0.99 0.99 0.99

p - value 0.19 0.002 0.0003 < 0.000001 < 0.000001 < 0.000001 < 0.000001 0.000004

0.01-10 ppm R2 0.64 0.76 0.85 0.90 0.92 0.99 0.99 0.98

p-value 0.02 0.008 0.003 0.0007 0.0004 < 0.00001 < 0.00001 < 0.00001

R/S: reagent/substrate; ppm: parts per million.

einstein. 2011; 9(1 Pt 1):70-4

Einstein v9n1.indb 72

24.03.11 19:37:24


A new spectrophotometric method to detect residual amounts of peroxide

73

Table 2. Optical densities obtained with different reagent/substrate proportions (0.08 to 2 drops/mL) at different concentrations of peroxide (0.01; 0.5; 1; 5 and 10 ppm) (n = 18) Reagent (drops) Substrate (mL) 1 1 1 3 1 3 3 6

12 9 6 12 3 6 3 3

Proportion R/S (drops/mL) 0.08 0.11 0.17 0.25 0.33 0.5 1 2

Optical densities 0.01 ppm 0 0 0.001 0 0.003 0 0 0

0.1 ppm 0.002 0.004 0.003 0.004 0.008 0.003 0.002 0

0.5 ppm 0.014 0.021 0.020 0.023 0.022 0.022 0.019 0.009

1 ppm 0.020 0.043 0.045 0.045 0.045 0.048 0.044 0.032

5 ppm 0.017 0.094 0.120 0.195 0.204 0.230 0.238 0.204

10 ppm 0.029 0.091 0.126 0.228 0.254 0.430 0.532 0.539

R/S: reagent/substrate; ppm: parts per million.

Table 3: Positive predictive value, negative predictive value, sensitivity and specificity for the different observers in the visual test and the quantitative test (n = 18) PPV (%)

NPV (%)

Sensitivity (%)

Specificity (%)

5 0 78 100

47 100 22 0

5 0 78 100

100 100 100 100

5 11 44 100

47 88 56 0

5 11 44 100

100 100 100 100

88 100 100 100

12 100 100 100

88 100 100 100

100 100 100 100

Laboratory personnel (n = 6) 0.01 ppm 0.1 ppm 0.5 ppm 1 ppm Dialysis staff (n = 12) 0.01 ppm 0.1 ppm 0.5 ppm 1 ppm Quantitative test 0.01 ppm 0.1 ppm 0.5 ppm 1 ppm

PPV: positive predictive value; NPV: negative predictive value; ppm: parts per million.

Table 4. Sensitivity rates with the visual test taken by laboratory personnel (n = 6) and dialysis staff (n = 12) for different concentrations of peroxide (0.01 to 1 ppm) Concentration (ppm) Laboratory personnel (%) Dialysis staff (%) 0.01 5 5 0.1 0 11 0.5 78 44 1 100 100

p-value 1 < 0.0001 0.01 1

DISCUSSION In this study it was found that the quantitative test could increase patientâ&#x20AC;&#x2122;s safety in the reuse process of HD filters after performing quantitative test with the visual colorimetric test and calculating the positive and negative predictive values, sensitivity and specificity. Reuse of HD filters is a common practice in Brazil, Unites States and other countries. An ANVISA ruling, RDC N.° 154, provides and regulates the good practices of reuse of dialysis filters(16). It states that dialysis filters must be submitted to rinsing after disinfection and an appropriate test is performed in order to make sure that there is no residual amount of the disinfecting agent after rinsing. However, it does not specify

the disinfecting agent, or the routine of rinsing and testing, and each dialysis unit has to establish its own routines. The lack of evidence-based routines and protocols in the literature prompted us to study the efficacy of current tests for the detection of peroxide after reprocessing with PA. In the beginning of the study, an important limitation was observed, that is, absence of a gold-standard quantitative test to detect PA residues. Therefore, it was decided to develop and standardize a quantitative, spectrophotometric test, and that became the first goal of this study. The new quantitative test showed to be superior to the standard visual test with respect to sensitivity and positive predictive value. In other words, the quantitative test was safer than the standard visual test. The details of these results merit some discussion and interpretation. First, it was observed that there was a linear and strong correlation between optical densities in spectrophotometry and peroxide concentration, with a detectable reaction for concentrations as low as 0.001 ppm. Then, the optimal ratio between reagent and

einstein. 2011; 9(1 Pt 1):70-4

Einstein v9n1.indb 73

24.03.11 19:37:25


74

Oliveira M, Dalboni MA, Iizuka IJ, Manfredi SR, Guimarães NK, Andreoli MCC, Matos ACC, Batista MC, Santos BFC, Cendoroglo Neto M

substrate was determined and the ideal proportion was 0.33 drops/mL. It was decided to measure the reagent in drops since this is the current standard for nursing practitioners in dialysis units in Brazil. Compared with the standard visual method, the quantitative method yielded higher positive predictive value, lower negative predictive value and higher sensitivity. A great variability of results was also found between the different observers in the visual test, which could be due to subjectivity of the visual test as well as to the lower detection threshold of the visual test compared to the quantitative test. The present results suggest that the quantitative test could increase patient’s safety in the reuse process. Indeed, severe hypersensitivity reactions to PA were described after reprocessing of HD filters with peroxide, which may manifest as dizziness, headache, nausea, bronchospasm and even death(8,9,17). On the other hand, it is possible that small amounts of peroxide residue could go unnoticed in the beginning of the dialysis session, yielding no symptoms. While not impacting the patients’ comfort during HD, this should be of concern because it is well known that HD patients have evidence of increased oxidative stress. Oxidative stress in such patients was ascribed mostly to chronic inflammation. However, the role of direct injections of small amounts of peroxide after inappropriate rinsing of reused filters is yet to be ruled out. The likelihood of this hypothesis is heightened when one considers that, in Brazil, HD patients are usually subjected to 13 sessions per month, from which, up to 12 (according to RDC N.° 54) are performed with reused filters(18-20). Currently, when zero tolerance and absolute compliance to good practices in prevention of nosocomial infections are being discussed by the CDC and the World Health Organization (WHO), the dialysis community should probably be more and more intolerant to the possible presence of residues of toxic compounds in dialysis filters. This study offers a new, effective and reliable technology to increase patients’ safety during the process of reuse in HD. As far as feasibility is concerned, the new quantitative test requires a spectrophotometer at the bedside. While this is not a complicated technology, the regular spectrophotometers are expensive and require some skills and specific filters that are changed according to the wavelength of interest. However, it is possible that a point of care spectrophotometer with a fixed filter could be shown to be relatively cheap, safe and costeffective.

REFERENCES 1. Vanholder R. Relationship between biocompatibility and neutrophil function in hemodialysis patients. Adv Ren Replace Ther. 1996;3(4):312-4. 2. Cohen G, Haag-Weber M, Hörl WH. Immune dysfunction in uremia. Kidney Int Suppl. 1997;62:S79-82. 3. Feldman HI, Bilker WB, Hackett M, Simmons CW, Holmes JH, Pauly MV, et al. Association of dialyzer reuse and hospitalization rates among hemodialysis patients in the US. Am J Nephrol. 1999;19(6):641-8. 4. Held PJ, Wolfe RA, Gaylin DS, Port FK, Levin NW, Turenne MN. Analysis of the association of dialyzer reuse practices and patient outcomes. Am J Kidney Dis. 1994;23(5):692-708. 5. Finelli L, Miller JT, Tokars JI, Alter MJ, Arduino MJ. National surveillance of dialysis-associated diseases in the United States, 2002. Semin Dial. 2005;18(1):52-61. 6. Vinhas J, Pinto dos Santos J. Haemodialyser reuse: facts and fiction. Nephrol Dial Transplant. 2000;15(1):5-8. 7. Robinson BM, Feldman HI. Dialyzer reuse and patient outcomes: what do we know now? Semin Dial. 2005;18(3):175-9. 8. Maidment HJ, Petersen J. The dialysis prescription: reuse. Am J Nephrol. 1996;16(1):52-9. 9. Miles AM, Friedman EA. A review of hemodialyzer reuse. Semin Dial. 1997;10(1):32-7. 10. Twardowski ZJ. Dialyzer reuse--part II: advantages and disadvantages. Semin Dial. 2006;19(3):217-26. 11. Lacson E Jr, Lazarus JM. Dialyzer best practice: single use or reuse? Semin Dial. 2006;19(2) :120-8. 12. Rao M, Guo D, Jaber BL, Sundaram S, Cendoroglo M, King AJ, Pereira BJ, Balakrishnan VS; HEMO Study Group. Dialyzer membrane type and reuse practice influence polymorphonuclear leukocyte function in hemodialysis patients. Kidney Int. 2004;65(2):682-91. 13. Feldman HI, Kinosian M, Bilker WB, Simmons C, Holmes JH, Pauly MV, et al. Effect of dialyzer reuse on survival of patients treated with hemodialysis. JAMA. 1996;276(8):620-5. 14. Jaar BG, Hermann JA, Furth SL, Briggs W, Powe NR. Septicemia in diabetic hemodialysis patients: comparison of incidence, risk factors, and mortality with nondiabetic hemodialysis patients. Am J Kidney Dis. 2000;35(2): 282-92. 15. Association for Advancement of Medical Information (AAMI). Standards and recommended practices for reuse of hemodialyzers. AAMI. ANSI/AAMI RD 47, 2005. 16. Agência Nacional de Vigilância Sanitária (ANVISA) [Internet]. Resolução da Diretoria Colegiada - RDC N.º 154, de 15 de junho de 2004. Estabelece o Regulamento Técnico para o Funcionamento de Serviços de Diálise. Publicada em 31 de maio de 2006 [citado 2011 Mar 9]. Disponível em: http://www. adreterj.org.br/rdc_154.pdf 17. Centers for Disease Control (CDC). Acute allergic reactions associated with reprocessed hemodialyzers--Virginia, 1989. MMWR Morb Mortal Wkly Rep. 1989;38(50):873-4. 18. Trznadel K, Luciak M, Pawlicki L, Kedziora J, Blaszczyk J, Buczyński A. Superoxide anion generation and lipid peroxidation processes during hemodialysis with reused cuprophan dialyzers. Free Radic Biol Med. 1990;8(5):429-32. 19. Köse K, Doğan P, Gündüz Z, Düşünsel R, Utaş C. Oxidative stress in hemodialyzed patients and the long-term effects of dialyzer reuse practice. Clin Biochem. 1997;30(8):601-6. 20. Gündüz Z, Düşünsel R, Köse K, Utas C, Doğan P. The effects of dialyzer reuse on plasma antioxidative mechanisms in patients on regular hemodialysis treatment. Free Radic Biol Med. 1996;21(2):225-31.

einstein. 2011; 9(1 Pt 1):70-4

Einstein v9n1.indb 74

24.03.11 19:37:25


CASE REPORT

Perforated diverticulitis of the appendix: ultrasonographic diagnosis Diverticulite perfurada do apêndice cecal: diagnóstico ultrassonográfico Rafael Burgomeister Lourenço1, Marco da Cunha Pinho1, Vladimir Schraibman1, Antônio Luiz de Vasconcellos Macedo1, Miguel José Francisco Neto1, Marcelo Buarque de Gusmão Funari1

ABSTRACT Appendiceal diverticulitis is an uncommon condition, mimicking appendicitis, but with greater risk of perforation and complications. Preoperative diagnosis is rare, but can be achieved by ultrasonography as identification of the diverticulum and classical signs of appendicitis. We report a case of ultrasonographic diagnosis of a perforated appendiceal diverticulitis in an adult male and discuss this condition. Keywords: Appendix; Diverticulum; Diverticulitis/ultrasonography; Diverticulitis/diagnosis; Case reports

RESUMO A diverticulite do apêndice é uma patologia incomum, eventualmente confundida com a apendicite cecal, tendo, porém, maior risco de perfuração e de outras complicações. Seu diagnóstico pré-cirúrgico é raramente realizado, mas pode ser obtido pela ultrassonografia com a demonstração de um divertículo associado a sinais clássicos de apendicite. Relatamos o caso de um homem adulto em que foi possível o diagnóstico ultrassonográfico de diverticulite do apêndice cecal e revisamos os principais aspectos relacionados a essa condição. Descritores: Apêndice; Divertículo; Diverticulite/ultrassonografia; Diverticulite/diagnóstico; Relatos de casos

INTRODUCTION Appendiceal diverticulitis is an uncommon, but not exceedingly rare condition, usually overlooked by the diagnostic imaging methods. The clinical picture mimics appendicitis, but it has some differences with implications in treatment and prognosis. We report a case of ultrasonographic diagnosis of a perforated

appendiceal diverticulitis in an adult male and discuss this condition.

CASE REPORT A 61-year-old male, previously hypertensive, sought medical care with a history of 36 hours of low fever (38.4°C), constipation and tenderness in the lower right abdominal quadrant. Laboratory studies demonstrated leukocytosis (white blood cell count of 15700 cells/μl), without other abnormal results. He was referred to the diagnostic imaging center, where ultrasonography was performed in an ATL HDI 5000 ultrasound scanner (Philips Medical Systems – Erlangen) with a high resolution linear-array multifrequency 7-12 MHz transducer. The ultrasonography showed a diffusely thickened and non-compressible appendix, with two saccular outpouchings (0.4 and 0.5 cm) projecting beneath the muscular layer (Figure 1). A small perforation and fluid collection was identified adjacent to the larger diverticulum. A regional inflammatory reaction was identified by a “ground glass” hiperecogenicity of the fat and reactive thickening of the terminal illeum and cecum (Figure 2). The patient underwent surgery. Surgical finding was a profuse inflammatory reaction in the distal ileum, appendix, cecum and ascending colon, associated with a small abscess. As malignancy could not be excluded from the macroscopic appearance, a right hemicolectomy was performed. The postoperative period was uneventful and the patient returned to his activities a few days

Study carried out at Hospital Israelita Albert Einstein – HIAE, São Paulo (SP), Brazil. 1

Hospital Israelita Albert Einstein – HIAE, São Paulo (SP), Brazil. Corresponding author: Rafael Burgomeister Lourenço – Serviço de Medicina Diagnóstica de Preventiva – Departamento de Imagem – Hospital Albert Einstein – Rua Albert Einstein, 627/701, 4º andar – Morumbi – CEP 05651-901 – São Paulo (SP), Brasil – Tel.: 11 3061-3009 – e-mail: rafaburgo@hotmail.com Received on Aug 21, 2008 – Accepted on Dec 20, 2010 The authors declare there is no conflict of interest.

einstein. 2011; 9(1 Pt 1):75-7

Einstein v9n1.indb 75

24.03.11 19:37:26


76

Lourenço RB, Pinho MC, Schraibman V, Macedo ALV, Neto MJF, Funari MBG

Figure 1. Right parasagittal panoramic image. Thickening of the cecum wall (bold arrow) with a rigid thickened appendix, curved anteriorly (open arrow = base). Two small outpouchings can be seen at the mesoappendiceal margin (curved arrows). Note difuse “ground glass” hyperechogenicity of the adjacent fat.

Figure 2. Localized parasagittal image. Small fluid collection (*) adjacent the perforated diverticulum. Another non-perforated diverticulum (open arrow) was identified near the tip (T). B: base.

after the procedure. Pathologic examination showed multiple acquired diverticula in the colon, cecum and appendix. One of the appendiceal diverticulum showed suppurative diverticulitis, with perforation and reactive appendicitis. There were also intense reactive inflammatory signs in the colon and terminal ileum, without evidence of malignancy.

DISCUSSION Diverticulitis of the appendix is a rare condition that results from inflammation of an appendiceal diverticulum. Appendicceal diverticula may be associated with colonic diverticulosis or occur like a local phenomenon, being unique or multiple, and occurring along the entire length of the organ(1). Congenital (or true) diverticula are exceedingly rare (less than 50 cases have been reported)(2). Acquired pseudodiverticula, characterized by herniation of the mucosa and submucosa through a defect in the muscular layer, have a reported incidence ranging from 0.04 to 2.8%(1,3). Although diverticulosis of the appendix can present symptoms, as recurrent episodes of vague spontaneously resolving lower right abdominal quadrant pain(4), most cases will not present symptoms until acute inflammation occurs (diverticulitis), typically associated to a fecalith impactation. Diverticula create a structural change on the appendix and increase the possibility of infection. Up to two-thirds of the patients with diverticula will develop diverticulitis, occurring as an isolated process, or associated with secondary appendicitis. Some authors estimate that up to 2% of clinical appendicitis are in fact appendiceal diverticulitis with secondary periappendicitis(5). Some cases will develop complications as perforation and abscess(6). Most patients will present atypical forms of appendicitis: the patient is over 30 years old, the abdominal pain is milder, the clinical course is longer and there is a history of previous attacks(7,8). The patient does not seek medical care often until the symptoms become more pronounced, increasing the risk of perforation. It is important to note that acquired diverticula have a thin wall, which contributes to perforation. Actually, the incidence of perforation in appendiceal diverticulitis is four times greater than in usual appendicitis(8). The appendiceal diverticulitis is rarely identified preoperatively by imaging. Some case reports showed that double-contrast barium enema can demonstrate diverticulosis(3,8,9), but not diverticulitis. The computed tomography may overlook the diverticula because of their small size. On the other hand, the literature suggest that diagnosis can be achieved by ultrasound, especially due to its higher spatial resolution(6,10). The ultrasound findings during graded compression include a focal or diffusely thickened appendiceal wall (> 3 mm), and a non-compressible rigid dilated organ. The diverticula usually appear as well-defined hypoechoic round or oval-shaped nodular lesions abutting the muscular layer of the appendix, usually near the tip. The diverticulum neck may be identified at the level of the vascular hiatus under optimal conditions(6). An adjacent inflammatory reaction may appear as echogenic “ground glass” fat stranding

einstein. 2011; 9(1 Pt 1):75-7

Einstein v9n1.indb 76

24.03.11 19:37:27


Perforated diverticulitis of the appendix: ultrasonographic diagnosis

and a thickened cecum or terminal ileum. Perforation is common, and may be characterized by discontinuity of the diverticulum wall and fluid collection. In the complicated advanced cases the diverticulum and even the appendix may no longer be visible. The suggested management of appendiceal diverticulitis is early appendectomy whenever possible. Complicated cases may need more aggressive approach as in our case. Incidentally discovered diverticula have a controversial approach: some authors recommend elective appendectomy(9), but this has not been widely accepted.

CONCLUSION Appendiceal diverticulitis is an uncommon condition, probably underestimated and commonly overlooked. Clinical picture varies, frequently manifested as atypical appendicitis forms, with a greater risk of perforation than isolated appendicitis. Preoperative imaging diagnosis is possible by ultrasonography. Early surgical intervention is the preferred management to prevent complications.

77

REFERENCES 1. Esparza AR, Pan CM. Diverticulosis of the appendix. Surgery. 1970;67(6):922-8. 2. Phillips BJ, Perry CW. Appendiceal diverticulitis. Mayo Clin Proc. 1999;74(9):890-2. 3. Lawler LJ, Jackson R. Diverticulosis of the appendix: a case report. Australas Radiol. 1994;38(3):227. 4. Majeski J. Diverticulum of the vermiform appendix is associated with chronic abdominal pain. Am J Surg. 2003;186(2):129-31. 5. Bianchi A, Heredia A, Hidalgo LA, GarcĂ­a-CuyĂ s F, Soler MT, del Bas M, et al. Diverticular disease of the cecal appendix. Cir Esp. 2005;77(2):96-8 6. Barc RM, Rousset J, Maignien B, Lu M, Prime-Guitton CH, Garcia JF. [Diverticula of the appendix and their complications: value of sonography (review of 21 cases)]. J Radiol. 2005;86(3):299-309. 7. Palmer G, Seidal T, Weibull H. Perforated diverticulum of the appendix. Eur J Surg. 1992;158(9):507-8. 8. Beswick JS, Desai S. Diverticular disease of the vermiform appendix and its clinical relevance. Australas Radiol. 1994;38(4):260-1. 9. Triadacilopoulos G. Image of the month. Appendiceal and sigmoid diverticulosis. Gastroenterology. 1997;113(4):1062, 1424. 10. Macheiner P, Hollerweger A, Gritzmann N. Sonographic features of diverticulitis and diverticulosis of the vermiform appendix. J Clin Ultrasound. 2002;30(7):456-7.

einstein. 2011; 9(1 Pt 1):75-7

Einstein v9n1.indb 77

24.03.11 19:37:28


CASE REPORT

A newborn with neck mass Recém-nascido com massa cervical Rita Calado Pereira1, Laura Martins Barroso1, Maria José Mendes1, Isabel Fernandes Joaquim1, Helder Ornelas1

ABSTRACT Congenital goiter is a rare cause of neonatal neck mass and may result from a fetal defectin synthesis of thyroxine, or administration of antithyroid drugs or iodides during pregnancy. The thyroid dysfunction often accompanies it. This report describes a case of a male term newborn with congenital goiter and primary hypothyroidism. Hormonal replacement treatment was started leading to normal levels of free thyroxine and triiodothyronine. In face of a maternal negative investigation, dyshormonogenesis was considered to be the most probable cause of hypothyroidism. Keywords: Infant, newborn; Goiter; Congenital hypothyroidism; Case reports

RESUMO O bócio congênito é uma causa rara de massa cervical no recémnascido podendo resultar de um defeito na síntese de tiroxina pelo feto, ou administração de antitiroidianos ou substâncias contendo iodo durante a gravidez. Na maioria das vezes, acompanha-se de disfunção tireoidiana. É descrito o caso de um recém-nascido a termo, de sexo masculino, com bócio congênito e hipotireoidismo primário. Foi iniciada terapia hormonal de reposição com normalização dos níveis de tiroxina e triiodotironina. Como a investigação materna foi negativa, disormonogênese foi considerada a causa mais provável do hipotiroidismo. Descritores: Recém-nascido; Bócio; Hipotireoidismo congênito; Relatos de casos

INTRODUCTION Congenital goiter (CG) is a rare cause of neonatal neck mass and may result from maternal ingestion of antithyroid drugs or goitrogens, transplacental passage of maternal antibodies or inborn errors of thyroid

hormone production (dyshormonogenesis). Other rarer causes include activating mutations of the TSH receptor (congenital nonautoimmune hyperthyroidism), activating mutations of the G protein alpha subunit (McCune-Albright syndrome), thyroid hemiagenesis and thyroid tumors. Even in hereditary forms, goiter and thyroid dysfunction that often accompanies it, may not be evident at birth(1). Dyshormonogenesis of the thyroid system represents about 10 to 20% of all cases of congenital hypothyroidism, and most neonates would exhibit a relatively large goiter(2).

CASE REPORT A full-term male neonate, first child of nonconsanguineous parents, was admitted to the Neonatology Unit for weak weeping, feeding difficulty, hypoglycemia and an enlarged anterior cervical mass present at birth (Figure 1). The examination on admission revealed mild hypotonicity in addition to central swelling in the neck. The mass felt soft, mobile, non-cystic, without associated inflammatory signs and no bruit was audible. The remainder of the examination was unremarkable. There was no record of thyroid disease or deafness in the family. The newborn’s mother was a healthy young woman, who had an uncomplicated pregnancy, with no history of alcohol, illicit drugs, use of thiourea derivatives/ antithyroid drugs (propiltiouracil, methimazole, carbimazole), iodine-rich drugs (amiodarone, antiasthmatic agents, expectorants), lithium or any other goitrogens during gestation. She had no goiter and her thyroid function was normal with negative thyroid antibodies.

Study carried out at Hospital do Espírito Santo – EPE, Evora, Portugal 1

Hospital do Espírito Santo – EPE, Evora, Portugal. Corresponding author: Rita Margarida Calado Pereira – Rua Ladislau Patrício, 8, 1ºB – Lumiar – CEP 1750-136 – Lisboa, Portugal Received on Sep 24, 2010 – Accepted on Feb 11, 2011 The authors declare there is no conflict of interest.

einstein. 2011; 9(1 Pt 1):78-80

Einstein v9n1.indb 78

24.03.11 19:37:29


A newborn with neck mass

79

The child was discharged on the 18th day of life with thyroid volume barely palpable, no changes in physical and neurological examination and normal neonatal hearing screening. He has continued to receive treatment with L-thyroxine and has been followed-up in the Pediatric Department of the Hospital Espírito Santo de Évora (EPE), with the support of a consultant pediatric endocrinologist. His evolution seemed to be favorable with appropriate growth and psychomotor development.

Figure 1. Enlarged anterior neck mass (2nd day of life).

An ultrasonography was performed showing a marked diffuse enlargement of the thyroid gland (Figure 2). The findings of low serum free thyroxine (FT4 = 1.7 μg/dL) and high serum levels of thyroid stimulating hormone (TSH > 150 μUI/mL) confirmed the diagnosis of primary hypothyroidism. Hormonal replacement treatment with L-thyroxine (25 μg/day) was immediately started. Three days later, having a serum TSH of 16.6 μUI/mL, the child was able to eat, had good sucking and feeding tolerance.

Figure 2. Neck ultrasonography - diffuse enlargement of the thyroid gland.

By the 12th day of hospitalization, it could be noticed the reduction of the goiter size along with muscular tonus improvement. Its course remained thereafter relatively uneventful. After 2 weeks of treatment, his free thyroxine and triiodothyronine levels normalized and his thyroid stimulating hormone decreased to almost normal values. Therapeutic adjustment was performed.

DISCUSSION Although the diagnosis of neonatal neck mass can be made on both clinical grounds and different imaging modalities available, sometimes recognizing a mass in this region may not be easy due to the difficulty of examining the neck of neonates and to the insidious growth of some lesions that remain unnoticed. Neck masses in newborns may be differentiated by their location and include the following: cystic hygroma; lymphangioma that is the most common lymphatic malformation in children, typically presented as a painless, transilluminated, soft mass located superior to the clavicle; branchial cleft cysts, palpated along the anterior margin of the sternocleidomastoid muscle; hematomas, which that may be the cause of masses in the lower portion of the neck; and finally thyroglossal duct cyst or enlarged thyroid that may present with a midline mass(3). Isolated palpable cervical lymph nodes, up to 12 mm in diameter, are common in healthy newborns. However, lymphadenopathy may also result from congenital infection(3). The clinical findings presenting with goiter vary from asymptomatic to enlarged thyroid volume causing stridor, cyanosis and respiratory distress by airway obstruction that can be a serious emergency. While sporadic CG is a rare clinical entity, thiourea drugs and other goitrogens administered during pregnancy can induce thyroid hyperplasia in the fetus causing goiter in infants of treated mothers. Women with chronic autoimmune thyroiditis or Graves disease may also produce antibodies that cross the placenta, resulting in fetal and neonatal goiter and thyroid dysfunction, depending upon the type of antibody(1). Among other etiologies for CG are colloid goiter of iodine deficiency (less common in iodine-sufficient areas of the world) and a variety of inborn errors of thyroid hormone production. These defects are inherited as autosomal recessive traits. All result in varying degrees of hypothyroidism, and may be detected by newborn screening (4). The prevalence of congenital hypothyroidism, an important preventable cause of mental retardation, einstein. 2011; 9(1 Pt 1):78-80

Einstein v9n1.indb 79

24.03.11 19:37:30


80

Pereira RC, Barroso LM, Mendes MJ, Joaquim IF, Ornelas H

is approximately 1:4,000 births. Abnormal thyroid development (dysgenesis or agenesis) or a defect in thyroid hormonogenesis are the most frequent causes of permanent congenital hypothyroidism. Less commonly, the altered neonatal thyroid function is transient, attributable to the transplacental passage of maternal medication, maternal blocking antibodies (typically resolving in 3 to 6 months), or iodine deficiency or excess(5). The presence of goiter in a newborn with primary hypothyroidism suggests transient hypothyroidism or an intrinsic defect in thyroid hormone synthesis(6). In the present case, patientâ&#x20AC;&#x2122;s mother was a healthy young woman, with no goiter. Her thyroid function tests were normal and there were no circulating autoantibodies. She was taking no medications. Therefore, dyshormonogenesis was considered to be the most probable cause of the hypothyroidism. In a newborn with a defect in thyroid hormone synthesis, a hearing screening must be performed to rule out Pendred syndrome (iodide organification defect and deafness)(7). The overall goals of treatment are to assure normal growth and development and psychometric outcome similar to genetic potential, by restoring the serum T4 concentration as rapidly as possible to a normal range followed by continued clinical and biochemical euthyroidism(8). In this case, diagnosis and treatment of hypothyroidism occurred even earlier than most of other reported cases in which the diagnosis of congenital hypothyroidism was made by the usual screening. Occasionally this disorder may be identified prenatally with the chance of prenatal treatment of such cases by injecting T4 into the amniotic fluid. Thus it is important to highlight the role of strict ultrasound

monitoring during future pregnancies in order to detect fetal goiter. Compliance to treatment plan, periodic followup care and adjustment of therapy are essential pieces for a good outcome. Genetic counseling is also recommended. Goiters in newborn infants are not seen frequently but all pediatricians who deal with neonates should be in a position to recognize the syndrome, understand its cause and prognosis and to advise therapy(9).

REFERENCES 1. La Franchi S, Kirkland JL, Ross D, Hoppin A, Mulder J. Congenital and acquired goiter in children. UpToDate, Waltham, MA, 2010. 2. Medeiros-Neto GA, Stanbury JB. Inherited disorders of the thyroid system. Boca Raton, FL: CRC Press; 1994. 3. Southgate WM, Pittard WB. Classification and physical examination of the newborn infant. In: Klaus MH, Fanaroff AA, editors. Care of the high-risk neonate. 5th ed. Philadelphia: WB Saunders; 2001. p. 100. 4. Muir A, Daneman D, Daneman A, Ehrlich R. Thyroid scanning, ultrasound and serum thyroglobulin in determining the origin of congenital hypothiroidism. Am J Dis Child. 1988;142(2):214-6. 5. American Academy of Pediatrics, Rose SR; Section on Endocrinology and Committee on Genetics, American Thyroid Association, Brown RS; Public Health Committee, Lawson Wilkins Pediatric Endocrine Society, Foley T, Kaplowitz PB, Kaye CI, Sundararajan S, Varma SK. Update of newborn screening and therapy for congenital hypothyroidism. Pediatrics. 2006;117(6): 2290-303. 6. Felner EI. A newborn with a goiter and thyroid dyshormonogenesis. J MaternalFetal & Neonatal Med. 2002;12(3):207-8. 7. Everett LA, Glaser B, Beck JC, Idol JR, Buchs A, Heyman M, et al. Pendred syndrome is caused by mutations in a putative sulphate transporter gene (PDS). Nature Genet. 1997;17(3):411-22. 8. LaFranchi S. Treatment and prognosis of congenital hypothyroidism. In: Rose BD, editors. UpToDate. Waltham, MA; 2010. 9. Crawford JD. Goiters in childhood. Pediatrics. 1956;17(3):437-41.

einstein. 2011; 9(1 Pt 1):78-80

Einstein v9n1.indb 80

24.03.11 19:37:38


CASE REPORT

A rare case of hematuria Um caso raro de hematúria Andreia Mascarenhas1, Isabel Castro1

ABSTRACT The infestation by Schistosoma haematobium is common in African countries and West Asia. Its chronic phase is characterized by the deposition of eggs of the parasite in various tissues of the body causing inflammatory response, formation of granulomas and fibrosis. The disease often affects the urinary tract, presenting with hematuria and, in the terminal stage, renal failure by urinary obstruction and bladder squamous neoplasia. Since chronic infection can lead to significant morbidity, it is imperative that the physicians who serve this immigrant population become familiar with this disease. A case of an immigrant boy from Guinea-Bissau seen in a Nephrology appointment for monosymptomatic terminal hematuria is presented. The diagnosis of urinary schistosomiasis was confirmed by parasitological examination of urine and the pathological examination of bladder biopsies. After therapy with praziquantel, the patient became asymptomatic. Keywords: Hematuria; Schistosoma haematobium; Case reports

INTRODUCTION Schistosomiasis is an endemic parasitic disease in Africa, South America, Middle East, China, The Philippines and in some Caribbean islands. Approximately 200 million people in 74 countries are infected (1-2). There are three species of Schistosoma that are relevant for human pathology: S. manson, S. japonicum and S. haematobium. The clinical presentation varies depending on the infecting species and S. haematobium is mainly responsible for urinary tract infection. In Europe, schistosomiasis remains as a rare cause of hematuria in children(3). However, considering the close relation between Portugal and African countries (International Cooperation Agreement between Portugal and Portuguese Speaking African Countries), the differential diagnosis should always be considered in face of a child coming from that continent and presenting hematuria.

RESUMO A infestação por Schistosoma haematobium é comum em países africanos e no oeste asiático. Sua fase crónica é caracterizada pela deposição de ovos do parasita em vários tecidos do organismo com resposta inflamatória, formação de granulomas e fibrose. Afecta frequentemente as vias urinárias, apresentando-se com hematúria, e, em fases terminais, com insuficiência renal por obstrução urinária e, em último caso, neoplasia escamosa da bexiga. Dado que a infecção crónica pode resultar em elevada morbilidade, é imperativo que os médicos que assistem essa população de imigrantes se familiarizem com tal doença. Apresentou-se aqui o caso clínico de uma criança natural da Guiné-Bissau observado em consulta de Nefrologia por hematúria terminal monossintomática. O diagnóstico de schistosomíase urinária foi confirmado por exame parasitológico da urina e pelo exame anatomopatológico das biópsias vesicais. Após terapêutica com praziquantel, o doente ficou assintomático. Descritores: Hematuria; Schistosoma haematobium; Relatos de casos

CASE REPORT The authors presented a clinical case of a 10-year-old male child coming from Guinea-Bissau, who had been for 8 months in Portugal with the diagnosis of macroscopic hematuria and nephrotic syndrome. The family history comprised a paternal uncle with nonspecific renal disease. Since the age of 4, he referred occasional episodes of monosymptomatic terminal macroscopic hematuria and facial edema of spontaneous resolution, with use of nonspecific therapy. He presented no other relevant past history. In the visit to the pediatric nephrologist he showed general good status, weight 35.3 Kg (P50-75), height 1.38 meters (P50-75) and blood pressure of 113/57 (complete blood count showed 12.7% eosinophilia), renal function and ionogram within normal range for

Study carried out at Hospital Dona Estefânia – HDE, Lisboa, Portugal. 1

Unit of Pediatric Nephrology, Hospital de Dona Estefânia – Centro Hospitalar Lisboa Central, EPE, Lisboa, Portugal. Corresponding author: Andreia Mascarenhas – R. Jacinta Marto, 1169-045 Lisboa. – CEP 2750-611 – Lisboa, Portugal – 213126600. Fax: 213126667 – e-mail: amascarenhas22@yahoo.com Received: Aug 14, 2010 - Accepted: Feb 15, 2011 Conflict of interest: none.

einstein. 2011; 9(1 Pt 1):81-3

Einstein v9n1.indb 81

24.03.11 19:37:39


82

Mascarenhas A, Castro I

age. Urine analysis showed pH 6, density 1.017, proteins 150 mg/dL, hemoglobin +++, leukocytes 25 mg/dL, and sediments with many erythrocytes. Twelve-hour proteinuaria was 28 mg/m2/hour. Uric acid, calcium, oxalate and 24-hour urinary phosphorus presented normal range for age. HIV-1 and HIV-2 serology and AgHBs were negative. The echogram showed right kidney with echogenic finding compatible with scar, bladder with echo in suspension and lobulated and vascularized wall thickness. To define the etiology, an urethrocystoscopy was performed and revealed trabeculated bladder with disperse, nodular, cottonlike and vascularized formations. Urine parasite test and bladder biopsies were positive for Schistosoma haematobium. Clinical pathology of renal biopsy showed abnormalities suggestive of segmental focal glomerulosclerosis. After beginning therapy with praziquantel (40 mg/ kg) single dose there was resolution of hematuria. About six months later, he remained asymptomatic with normal urinary results and 12-hour proteinuria of 3.4 mg/m2/h.

DISCUSSION Urinary schistosomiasis is a serious public health problem in tropical countries and it is particularly common in Sub-Sahara Africa, resulting in high morbidity, especially in situations of chronic infection. It is estimated that about 200 million people are infected, out of which 88 million are aged less than 15 years (4). The peak of incidence and prevalence occurs in schoolaged children, between 8 and 12 years (5). Male gender is the most affected owing to greater recreational exposure to water (5). Schistosoma haematobium is responsible for the infestation of the urinary tract leading to fibrosis, stenosis and calcification (1). The life cycle of this parasite is complex and includes sexual reproduction of adult parasites in humans, in addition to a stage of asexual reproduction in the intermediate host, the fresh water snail Bulinus(6). Infection in humans is acquired by direct contact with water that contains free larva forms (cercaria) released by the infected snails. Considering the preference for the venous plexus of the urinary tract, adult worms of S. haematobium live and lay their eggs there. The pathogenesis of the disease caused by this parasite is normally related with immune reactions of the body against the presence of the eggs in the tissues, which induce granulomatous inflammatory reactions (7). Adult worms are recovered by host cells (many blood groups, major histocompatibility complex molecules, immunoglobulins and albumin), which mask their own antigens, escaping from the action of the immune system and they may continue to produce an incredible number of eggs for many years (8). About 10 to 12 weeks

after the contact with the parasite, there is terminal or total hematuria, which may be accompanied by dysuria, pollakiuria, or fever (1). Late manifestations (chronic schistosomiasis), in addition to hematuria, include proteinuria (many times as nephrotic manifestation), calcifications, renal cramps, hydronephrosis, urethral obstruction, renal failure and, possibly, bladder neoplasm (4) . Less frequently, there is the formation of immune complexes that contain specific parasite antigens that when deposited on the glomerular capillaries induce schistosomic glomerulopathy of variable degree. This renal impairment is frequent in infestation by Schistosoma mansonii and the most severe forms of the disease (glomerulonephritis grades III and IV) are normally associated with hepatic-splenic involvement and progress to chronic renal failure (9). The definite diagnosis of urinary schistosomiasis is made by identification of eggs in the urine or bladder biopsies. Considering that egg elimination is constant during the whole day, it is recommended the collection of three urine samples between 10 am and 2 pm (greater excretion period) or after physical exercise (2). Serological studies for schistosoma are equally useful in the diagnosis, but they do not differentiate previous from recent infection. Renal and vesical echographies are non-invasive tests that enable detection of advanced disease. In an initial stage, cystoscopy normally reveals granuloma and mucosa congestion, and later it shows sandy patches (rugous areas of vesical mucosa involving the egg deposits) (10). In the chronic stages, egg elimination in the urine is significantly lower and it may not be present, and the diagnosis is made based on radiological tests and clinical pathology of biopsied lesions (6). Radiography of the urinary tract shows calcifications at urethral and vesical level resulting from egg laying on the mucosa (10) . Excretory urography aims to identify possible complications in advanced stages, such as distal urethral stenosis and superior urinary tract dilation (10). The treatment of choice is praziquantel, a single dose of 40 mg/kg(8). This therapy provides 80% cure rate and substantial reduction of number of parasites and egg excretion when cure is not effective (1,4). The treatment with this antihelminthic eradicates the parasite and terminates the inflammatory response responsible for the chronic manifestations of the disease (5). In the reported case, the patient had monosymptomatic macroscopic hematuria with moderate proteinuria and previous episodes of generalized poorly characterized edema. Despite the fact that the investigation of Schistosoma eggs in the urine was positive, since a more complicated disease was suspected of, it was decided to use cytoscopy and renal biopsy as well. The histology abnormalities

einstein. 2011; 9(1 Pt 1):81-3

Einstein v9n1.indb 82

24.03.11 19:37:40


A rare case of hematuria

found – segmental focal glomerulosclerosis – are not normally associated with infestation by Schistosoma haematobium and they do not seem to respond to antiparasitic or immunosuppressant therapy, such as in this case. Moreover, the patient did not present liver or renal disease, which is normally associated with this type of glomerulopathy. However, the clinical resolution of the edema and the elimination of proteinuria, with no other therapy than praziquantel, seemed to confirm the diagnosis of schistosoma glomerulopathy. Considering the favorable progression (maintained after 6 months), the renal biopsy was not repeated. The report of this clinical case aimed to build awareness of healthcare professionals who work with children coming from the African continent because it is a rare cause of hematuria in Portugal, but if it is diagnosed and treated immediately, chronic manifestations may be prevented, reducing urinary symptoms that lead to high morbidity and mortality, especially severe complications, such as renal failure and bladder neoplasm.

83

REFERENCES 1. Ross AG, Bartley PB, Sleigh AC, Olds GR, YueshengL, Williams GM, et al. Schistosomiasis. N Engl J Med. 2002;346(16):1212-20. 2. Gryseels B, Polman K, Clerinx J, Kestens L. Human schistosomiasis. Lancet. 2006;368(9541):1106-18. 3. Samuel M, Misra D, Larchever V, Price E. Schistosoma haematobium infection in children in Britain. BJU International. 2000;85(3):316-8. 4. Moudugil A, Kosut J. Urinary schistosomosis: an uncommon cause of gross hematuria in the industrialized countries. Pediatr Nephrol. 2007;22(8):1225-7. 5. Summer A, Staufer W, Marouschek SR, Nevins TE. Hematuria in children due to Schistosomiasis in a nonendemic setting. Clin Pediatrics (Phila). 2006;45(2):177-81. 6. Huerta L, Alacalá J, Lecumberri SN, Dorronsoro MG, Piédrola JIP. Bilharziasis: presentación de un caso clínico. Arch Esp Urol. 2007;60(7):795-9. 7. Murinello A, Gonçalves A, Loureiro C, van-Dunen F, Alvarenga J, Campos C, et al. Schistosomíase - aspectos clínicos e histo-patológicos da doença. Rev Gastrenterol Cir. 1998;15(76):53-69. 8. Danso-Appiah A, Utzinger J, Liu J, Olliaro P. Drugs for treating urinary schistosomiasis. Cochrane Database Syst Rev. 2008;(3):CD000053. 9. Barsoum RS. Schistosomiasis and the kidney. Semin Nephrol. 2003;23(1):34-41. 10. Moreno MJ, Pastor Navarro H, Giménez Bachs JM, Carrión López P, Segura Martín M, Salinas Sánchez AS, et al. Esquistosomiasis vesical, aportación de un caso y revisión de la literatura española. Actas Urol Esp. 2006;30(7):714-9.

einstein. 2011; 9(1 Pt 1):81-3

Einstein v9n1.indb 83

24.03.11 19:37:40


REVIEW

Aquatic physical therapy as a treatment modality in healthcare for non-institutionalized elderly persons: a systematic review Fisioterapia aquática como modalidade de tratamento em idosos não institucionalizados: uma revisão sistemática Gisele da Silveira Sarmento1, Andréa Sanchez Navarro Pegoraro1, Renata Cereda Cordeiro2

ABSTRACT Objective: To review scientific literature pertaining to aquatic physical therapy in the elderly and institutionalized population. Methods: A qualitative systematic review of electronic databases MEDLINE and LILACS, with the topic index terms: “hydrotherapy”, “homes for the aged or residential facilities”, and “aged. In light of the lack of studies carried out on the institutionalized population, we opted for reviewing literature on the effectiveness of this modality of physical therapy treatment on the non-institutionalized elderly population in order to produce knowledge that can be critically analyzed according to its potential applicability for the institutionalized population. The methodological quality of the studies was assessed using the Delphi listing. Results: Of the 27 studies analyzed by their abstracts, 10 studies were excluded since they did not correspond to the eligibility criteria. We analyzed the subject characteristics of each study, as well as the quality of the methods (good methodological quality in 47% of the studies), the result measurements considered, the intervention strategies, the sites where they took place, and the professionals involved (76% by physical therapists). Conclusion: Although a large part of the studies demonstrated good results with aquatic physical therapy practice, none of them had been applied on long-stay institution for the elderly. Therefore, more studies are needed in this area for a model of assistance to long-stay institution for the elderly to be proposed. Keywords: Hydrotherapy; Homes for the aged; Treatment outcome

RESUMO Objetivo: Revisar a literatura científica acerca da efetividade da fisioterapia aquática na população idosa e institucionalizada. Métodos: Revisão sistemática qualitativa nas bases de dados eletrônicas MEDLINE

e LILACS, com os descritores de assunto: “hidroterapia” (“hidrotherapy”), “instituição de longa permanência para idoso” (“homes for the aged, residential facilities”) e “idoso” (“aged”). Diante da inexistência de estudos realizados na população institucionalizada, optou-se por revisar a literatura acerca da efetividade dessa modalidade de tratamento fisioterapêutico na população idosa não institucionalizada, a fim de se produzirem conhecimentos que pudessem ser analisados criticamente conforme sua aplicabilidade potencial na população institucionalizada. A qualidade metodológica dos estudos foi avaliada por meio da lista Delphi. Resultados: Foram excluídos 10 estudos dos 27 analisados a partir do resumo, por não corresponderem aos critérios de elegibilidade. Foram analisadas as características dos sujeitos de cada estudo, bem como a qualidade metodológica (boa qualidade metodológica em 47% dos estudos), as medidas de resultado consideradas, as estratégias de intervenção, os locais onde ocorreram e os profissionais envolvidos (76% por fisioterapeutas). Conclusão: Embora, grande parte dos estudos tenha demonstrado bons resultados com a prática da fisioterapia aquática, nenhum deles foi aplicado em instituição de longa permanência para idoso. Sendo assim, são necessários mais estudos nessa área para que seja proposto um modelo assistencial em instituição de longa permanência para idoso. Descritores: Hidroterapia; Instituição de longa permanência para idosos; Resultado de tratamento

INTRODUCTION With the progressive demand on the part of a population in constant growth – the population of elderly people – an increase is expected in the offer of beds in hospitals and long-stay institutions for the elderly (LSIEs) over the next few years(1).

Study carried out at Residencial Israelita Albert Einstein – São Paulo (SP), Brazil. 1

Hospital Israelita Albert Einstein – HIAE, São Paulo (SP), Brazil.

2

Geriatric Rehabilitation Sector, Lar Escola São Francisco – São Paulo (SP) Brazil. Corresponding author: Gisele da Silveira Sarmento – Rua Capital Federal, 208, apto. 71 – Sumaré – CEP 01259 010 – São Paulo (SP), Brasil – e-mail: gisele.sarmento@hotmail.com Received: 20/5/2010 – Accepted: 20/12/2010 The authors declare there is no conflict of interest.

einstein. 2011; 9(1 Pt 1):84-9

Einstein v9n1.indb 84

24.03.11 19:37:41


Aquatic physical therapy as a treatment modality in healthcare for non-institutionalized elderly persons: a systematic review

These LSIEs may be governmental or nongovernmental, with a residential atmosphere, destined to be the collective residence for persons aged 60 years or more, with or without family support, under conditions of freedom, dignity, and citizenship(2). The elderly citizens who live in these institutions or at geriatric homes and clinics have unique characteristics, such as mean age of about 80 years, sedentarism, low autonomy, and absence of family members. These factors contribute towards the increase in prevalence of morbidities and comorbidities related to autonomy(1). One of the most important complications in this age group is the occurrence of falls, a public health problem due to its frequency, associated morbidities, and high social and economic costs, especially when it causes increased dependency and the beginning of life in an institution(3). Physical activity for the elderly person is able to provide beneficial organic effects, including general well-being, preservation of independence, prevention of diseases, control of special situations (stress and obesity, for example), and a decrease in chronic pain(4). Aquatic physical therapy programs have frequently been indicated for the elderly population since they are carried out in a safe environment, with less susceptibility to falls, and with good acceptance of and compliance with treatment(5). This resource is applied in a thermalheated pool by means of techniques developed especially with objectives of preventing diseases, promoting and maintaining, treating, curing and rehabilitating health(6). The present study aimed to search scientific literature regarding effectiveness of aquatic physical therapy in the elderly and institutionalized population.

METHODS Type of study Systematic narrative review was carried out. Data collection procedures Bibliographic search was carried out using LILACS and MEDLINE databases in reference to publications of clinical trials in the last 10 years. The following index terms were used: “hydrotherapy”, “homes for the aged”, “residential facilities”, and “aged”. No studies were found on hydrotherapy in this specific population. In light of this fact, we decided to review the literature on effectiveness of this modality of physical therapy treatment in the non-institutionalized aged population in order to produce knowledge that may be critically analyzed concerning its potential applicability in the institutionalized population.

85

The intersection of sets was used (index terms, type of publication, and 10-year period). The terms used for this new search were “hydrotherapy” and “aged. Twenty-seven articles resulted from the search with the mentioned criteria. All of them underwent analysis of the abstract by a single evaluator, and only those with the following inclusion criteria were selected: - clinical controlled/randomized trials; - treatment with any type of intervention protocol, as long as with complete immersion in a therapeutic pool. The articles meeting these criteria had their entire content reviewed and underwent critical analysis, being confronted with other publications on the topic. For evaluation of the methodological quality, Delphi’s Listing, comprising eight items, was used. The answers are presented in the form of “yes/no/I don’t know”, in which one of the alternatives must be chosen for each item; the greater the quantity of affirmative answers, the better the quality of the study(7) (Figures 1 and 2).

RESULTS AND DISCUSSION Ten of the 27 studies analyzed by their abstracts were excluded since they did not present the desired association between aquatic physical therapy and the elderly. These studies addressed local application techniques (without immersion in the pool) and they were not experimental, besides using a population under 60 years of age.

Electronic databases Medline and Lilacs

Subject descriptors: hydrotherapy + LSIEs + aged

Zero

LSIEs = long stay instituitions for the elderlies

Figure 1. Flowchart of the first review.

einstein. 2011; 9(1 Pt 1):84-9

Einstein v9n1.indb 85

24.03.11 19:37:41


86

Sarmento GS, Pegoraro ASN, Cordeiro RC

out that the study conducted by Silva et al.(23) was the only one that had sample with a mean age of 59 years. Regarding exclusion criteria, 41% of the articles excluded those individuals who had pathologies that limited exercise(4,10,11,13,17,23,25), those dependent on help for daily activities, and those who engaged in other exercises besides what was proposed in the given study. As to the sample, 23% had fewer than 25 participants(4,10,19,21).

Electronic databases Medline and Lilacs

Subject descriptors: Hydrotherapy + Aged

Medline = 481 Lilacs=77

MEDLINE Hydrotherapy+aged=347 Limits: human, last 10 years, language English, type of study practice guideline and randomized = 19

LILACS Hydrotherapy + aged = 77 Limits: language Portuguese + Spanish + English = 8

27 studies

10 excluded: they were not intervention studies, had no complete immersion, age under 60 years

Methodological quality Of the 17 studies, 47% were randomized and with a control group, i.e., with good methodological quality(1114,17,22,24,25) . On the other hand, 29% were merely intervention studies, with no randomization or control groups(4,10,18,19,21), while 23% of the studies were controlled trials with randomization, but with no control group(15,16,20,23). In 47% of the studies, the outcome evaluators were blinded(4,13-17,20,23). This methodological decision is very important, because when this is not the case, the results may be biased. Applegate and Curb(8) stated that many studies do not allow a true double-blind characteristic, but even so, it is possible to carry out successful randomized trials without complete blinding if the outcome evaluators are blind to the proposed treatment.

FINAL=17 studies

Figure 2. Flowchart of the second review.

The remaining 17 articles were comprehensively analyzed. The classifications and characteristics of these articles are included in this review and presented in chart 1. All studies presented specified eligibility criteria, intention to treat, and most reported primary outcome measurements, thus providing better quality studies. With this discussion, we intended to describe the findings of the articles searched and to associate them to the dynamics of institutionalized aged persons.

Subject characteristics As to subject characteristics of the articles analyzed, 29% of the articles had as inclusion criterion patients diagnosed with osteoarthritis of the hip and/or knee(13,14,17,23-24). As to gender, 23% of the studies involved aged women(10,12,18,21), and the mean age of all study subjects was 68 years. However, it is important to point

Result measurements As to measurements of results, 35% of the articles(13-16,20,23) applied the Western Ontario McMaster Universities (WOMAC) quality of life questionnaire specific for osteoarthritis, which is capable of assessing intensity of pain, joint stiffness, and functional difficulties resulting from hip or knee osteoarthritis(9). In 23% of the studies(11,12,14,25), the questionnaire used to evaluate quality of life was the Short Form Health Survey (SF-36). Another prevalent fact was pain assessment, also performed in 23% of the studies by means of the Visual Analog Scale (VAS)(16,17,23-24). Blood pressure (BP) was mentioned as an outcome measurement by Candeloro and Caromano et al.(10) along with heart rate. On the other hand, for Gimenes et al.(4), only BP was used as a result. In order to avoid biases, it is important to identify all resulting variables and to report hypotheses before beginning the study. Nevertheless, investigators conduct trials with aged individuals, many times confronted with the problem of various results. For example, quality of life or physical function may have more important

einstein. 2011; 9(1 Pt 1):84-9

Einstein v9n1.indb 86

24.03.11 19:37:42


Aquatic physical therapy as a treatment modality in healthcare for non-institutionalized elderly persons: a systematic review

87

Chart 1. List of articles resulting from bibliographic search on effectiveness of aquatic physical therapy in the elderly. Author

Candeloro et al., 2007 (8)

Cider et al., 2003(9)

Devereux et al., 2005(10)

Subject number

16

Twice a week, for 60 minutes, during 14 weeks

25 (HT= 15) and (Control=10)

3 times/week, for 45 minutes, during 8 weeks

50 (HT= 25 and (Control = 25

Fransen et al., 2007(11)

152 (HT=55, Tai Chi=56 and control=41)

Foley et al., 2003(12)

105 (HT=35,gymnastics=35 and Control=35)

Gill et al., 2009(13)

Gimenes et al., 2008(4)

Harmer et al., 2009(14)

Lund et al., 2008(15)

Madureira et al., 1998(16)

Medeiros et al., 2008(17)

Rahmann et al., 2009(18)

Frequency of therapy

86 (Floor=40 and HT= 42)

20

102 (floor=49 and HT=53)

Twice a week, for 60 minutes, during 10 weeks

Twice a week, for 60 minutes, during 12 weeks

3 times/week, during 6 weeks

Twice a week, during 6 weeks

Twice a week, for 45’, during 12 weeks

Twice a week, for 60 minutes, during 6 weeks

79 (HT=27, Floor=25 and Control=27)

Twice a week, for 50 minutes, during 8 weeks

25

3 times/week, 50 minutes, during 4 months

9

65 (HT = 24, water exercise = 21 and exercises in the inpatients unit = 20)

10 sessions, 45 minutes each

40 minutes, during 6 months, daily

Delphi list

Intervention

Medical indication, women, aged, no use of medication, sedentary

Disease that would limit hydrotherapy (HT), such as, arterial hypertension, cardiac, respiratory, musculoskeletal or neurological diseases

3

Activities in pairs, warming up, physical activities for flexibility, muscle strength (MS) and relaxation, with increasing difficulty

HT= 70.2 Control=75

Patients with stable congestive heart failure (CHF), functional class II-III, ejection fraction of 45%, ≥ 60 years, stable medication in the previous 3 months

Diabetes, peripheral arterial disease, chronic pulmonary disease, after stroke or other diseases that limit exercise

4

73.3

Elderly women ≥ 60 years, diagnosis of osteopenia or osteoporosis, residing in a metropolitan region in Australia

Do not reside close to the study area, age < 65 years, unable to read, write or understand English, impaired cognition (MEEN < 23), with no hearing or visual aid, had Meniére disease, benign paroxysmal positional vertigo, Parkinson or neurological dysfunction

70

Age 59 – 85 years, diagnosis of osteoarthritis (OA) in the hip or knee, according to the American College of Rheumatology, chronic pain > 1 year

Physical activity for leisure more than twice a week, incapacity to walk at home, instability of severe heart and lung conditions, incontinence, fear of water, epilepsy, low back pain and lower limb pain, joint replacement surgery

70.9

Age ≥ 50 years, with radiological diagnosis of OA of the hip or knee, able to read, write and speak English, to give consent, to have his/ her own transportation means

Patients who received physical therapy or HT in the last 6 weeks, had group gymnastics class, joint replacement in the last 12 months or cognitive deficit

Floor=71.6 HT=69.2

Patients waiting for elective hip or knee arthroplasty

If undergoing only tibia osteotomy, if surgery was scheduled before conclusion of supervised program of 6 weeks, if they were not able to complete exercises or if they were not able to understand English

68.05

Age ≥ 60 years, both sexes, with no cognitive impairment and were not exercising regularly for one year

Dependent on hearing/visual aid use of walking aid and no medical permission for activity in the swimming pool

Mean age

Inclusion criteria

Exclusion criteria

66.9

Follow up

Measurements result

Significance

No

BP = blood pressure and HR=r heart rate

The mean rest HR was not statistically significant. There was a decrease by 5.6 mm Hg in mean SBP and by 9.7 mm Hg in mean DBP

Moderate exercises, 40-70% of maximum HR, resistance exercises and MS

No

Tolerance to exercise, muscular function, QoL = quality of life

Physical training in water was well tolerated and it seems to improve exercise capacity as well as MS in CHF patients

5

Warming up, stretching, aerobic exercises and based on Tai Chi, strength, posture, gait, vestibular, proprioception and balance. The control group received no intervention

No

Balance, fear of falling down and QoL

Water exercise produced significant changes in equilibrium and QoL, but not in fear of falling down

6

HT: warming up, MS, flexibility and resistance exercises. Tai Chi classes: given by trained instructors throughout the study

12 and 24 weeks

Pain, physical function, general health status (WOMAC)

The HT and Tai Chi group demonstrated clinical benefits for over 12 weeks

6

HT: walks, active hip and knee exercises and bicycle. Gymnastics: 4 minutes of stationary bicycle, MS exercises, sitting down and getting up, knee exercises and double leg press. Control: no intervention

No

MS of quadriceps, AO index (WOMAC), walking for 6’, QoL

The functional gains were observed in both exercise programs as compared to the control group

6

Floor: warming up, stationary bicycle and muscle resistance of calf and hamstring muscles, and quadriceps stretching. HT: walks and active exercises of calf and hamstring muscles, and quadriceps stretching

6 and 8 weeks

Pain and self-reported function and global evaluation (WOMAC)

There were not major differences in effects after intervention. However exercises in swimming pool seemed to have a more favorable effect on pain immediately after treatment

4

10 minutes warming up (walking), 20 minutes of aerobic exercises (MS of upper and lower limbs and abdominal muscles, jumping, dancing and cycling, besides respiratory work and playful activities of balance and coordination) and 15 minutes of relaxation

No

BP before and after immersion in the swimming pool

The mean SBP after protocol in the first and last day showed statistically significant decrease

5

Floor: stationary bicycle, climbing stairs, range of motion (ROM) of knee, balance and sit on chairs of different heights. HT: walk in several directions, run, jump, kick, exercises with the knee, squatting and combined exercises with upper limbs

6 and 26 weeks

6-minute walk, climbing stairs, WOMAC (AO index), VAS for pain in operated knee, passive movements of knee and edema

Both floor and water exercises had evident improvement in nearly all measures of result up to 6 months in the postoperative period of total knee arthroplasty

6

Both water and floor exercises comprised warming up, MS, resistance, balance and stretching

8 weeks and 3 months

Pain, OA questionnaire (KOOS), balance and strength

Floor exercise showed discreet relief in pain and improvement in strength as compared to control. No alteration was detected after water exercise in comparison with the control group. However, there were less adverse events in water

No

Anthropometric data, cardiorespiratory function, flexibility of the spine and hip, strength, localized muscle resistance, abdominal and strength of palmar prehension

Significant improvement in abdominal muscle strength and resistance and in cardiorespiratory capacity

Floor=67.8 HT=68.7

Patients who went to the clinic in the preoperative period of total knee arthroplasty

Deep infection in the preoperative period, documented dementia or other neurological condition and with no informed consent

68

Diagnosis of OA of knee, according to the American College of Rheumatology

Hydrophobia, urinary incontinence, wounds, language or intellectual problem, history of knee fracture, total knee replacement, inflammatory joint disease, lung or heart disease, or other diseases, contraindication for exercises and participation in other studies

65

Elderly women, aged 57-77, with no contraindication fro water exercises

They could not participate in other training programs

3

Activities of stretching, calisthenics exercises and displacement

Age over 65 years, walking with no assistance, preserved cognitive functions, no history of falls with trauma

Age under 65 years, not participating in the Programa Gostar de Viver [Enjoy Life Program], neurological disorders with stroke, head trauma, Parkinson, neoplasm, cardiac arrhythmias, water-borne diseases, high fever, heart failure, infectious diseases, fecal and urinary incontinence, open wounds, epilepsy and low vital lung capacity

3

All exercises proposed in the swimming pool were performed as 3 series of 15 repetitions each, with 30 seconds intervals

No

Static and dynamic balance

Significant improvement in balance, gait and Tinetti evaluation

6

Inpatients unit: exercises of active flexion of the hip and knee, exercises for circulation, respiratory exercises, active exercises of lower limbs, transfers, gait training, stretching and step. HT (fast rhythm): active exercises of hip, mini squatting, walking with and without floats in the lower limbs, combined exercises with upper limbs. Water exercises (slow rhythm): active exercises of hip and knee with and without floats, lateral trunk exercises, relaxation

14, 90 and 180 days

Strength, gait speed and functional ability (WOMAC)

After 14 days, abducting strength of the hip was significantly greater after HT as compared to hospital physical therapy and water exercises

74.1

69.6

Patients who would undergo the first hip or knee arthroplasty were selected

Neurological disorders, muscularskeletal problem with altered mobility, cognitive dysfunction, those who were not willing to be randomized, if residing outside the metropolitan region

einstein. 2011; 9(1 Pt 1):84-9

Einstein v9n1.indb 87

24.03.11 19:37:43


88

Sarmento GS, Pegoraro ASN, Cordeiro RC

Chart 1. Continuation Author

Ramos et al., 2007(19)

Ritomy Ide et al., 2005(20)

Silva et al., 2008(21)

Victorin et al., 20049(22)

Wadell et al., 2003(23)

Subject number

Frequency of therapy

Mean age

Inclusion criteria

Exclusion criteria

Delphi list

Intervention

Follow up

Measurements result

Significance

No

Densitometry values before and 8 months after HT

No significant increase in values

13

3 times/week, for 50 minutes, during 8 weeks

64

Elderly women aged â&#x2030;Ľ 60 years, Caucasian, with no other physical activity

Over 6% absences, recent fractures, joint replacement (femur), use of calcium supplement or hormone replacement

3

Warm-up exercises during 5 minutes, increased global MS without floats for upper and lower limbs, relaxation and stretching

59 (HT=19, Floor = 19 and Control=21)

3 times/week, for 50 minutes, during 10 weeks

62.1

Socially active, but not practicing any type of physical activity more than once a week

Having not smoked for the past 10 years, no respiratory and muscular-skeletal dysfunctions

4

The intervention program was similar and followed the sequence: warm-up, conditioning, MS and cooling down

No

Anterior flexibility of trunk/pelvis

A respiratory physical therapy program to practice range of motion of the rib cage has no effect in anterior flexibility of trunk/pelvis of healthy elderly

59

Clinical and radiological criteria of OA of knee according to American College of Rheumatology, and knee pain ranging from 30 to 90 millimeters in VAS

Neurological disease, symptomatic heart disease and severe pulmonary condition, systemic disease or psychiatric disorder that could interfere with evaluations, epilepsy, skin disease or inability to walk. Patients who received intra-articular injections of steroids in the last 3 months and those who performed physical activity 6 months before

5

Both groups performed similar exercises of MS, stretching of lower limbs and gait training

9 and 18 weeks

Pain, WOMAC, 6-minute walk test

Pain reduced in both groups throughout time, but water exercises significantly decreased pain as compared to floor exercises, before and after walk at week 18

EA = 65.7 HT = 70.3 Control=65.5

All patients were in a waiting list for hip arthroplasty, with radiological alterations compatible with OA of hip, pain associated to movement and/or load and/or rest

Hepatitis B, epilepsy or rheumatoid diseases

5

EA: acupuncture needles in sites of pain in the hip and attached to an electrical stimulator, not causing painful muscle contractions. HT: small groups, with warm-up, mobility, MS for hip and stretching. Lecture: meetings about anatomy, disease process and pain relief

10 sessions, 1 month and 6 months

Disability rating Index (DRI), Global severity index (GSI) and Visual analogic scale (VAS)

EA and HT, combined with education of patients, led to last-longing effects, and demonstrated reduced pain, functional pain and reducing QoL. In the EA group, pain relief lasted longed, up to 6 months. The group receiving only education did not improve in any variable

65

Outpatients, moderate to severe COPD, FEV1 < 80% of predict, FEV1/VC < 70%, stable medication and no infection in the last month

Heart diseases, orthopedic, neurological, psychological disorders or conditions that may interfere in performance of exercise

4

In both groups: aerobic training during 45 minutes with same intensity (warm up, flexibility, resistance, strength of upper limbs, trunk and lower limbs) and stretching

No

Physical capacity and health; QoL related to health

Both groups of high-intensity training showed benefits in COPD patients, but water exercises had additional benefits in physical capacity as compared to floor

64 (HT and floor)

3 times/week, for 50 minutes, during 18 weeks

45 (HT and education = 15, Electroacupuncture (EA) and education=15 and only education=15)

Twice a week, for 30 minutes, during 5 weeks

30 (Floor = 15, HT= 15 and Control=13)

3 times/week, for 45 minutes, during 12 weeks

results than mortality, despite the latter being easier to measure(8). Since intervention in these studies had a curative character, large groups of diagnoses related to specific functional losses were selected. In institutionalized elderly persons, studies such as these, with intention to treat, could use more generic outcome measurements such as functional capacity and quality of life, since this population has a higher degree of functional fragility.

Intervention strategies In general, the protocol of exercises performed in the therapeutic pool obeyed the following sequence: warmup, strengthening of lower limbs, flexibility, resistance, and stretching, all with increasing degrees of difficulty and in groups. In addition to these, Devereux et al.(12) also proposed water exercises based on Tai Chi and demonstrated that exercises in the water produced significant changes in balance and quality of life, but not in the fear of falling. Fransen et al.(13) compared groups in hydrotherapy, Tai Chi exercises, and a control group and verified clinical benefits in both intervention groups. In 23% of the articles, exactly the same intervention group was used(14,17,22,25), which consisted of hydrotherapy, floor exercises, and a control group. Stener-Victorin et al.(24) compared hydrotherapy, electroacupuncture, combined with educational talks and a group that received only the educational

talk. The authors were able to affirm that the two intervention groups produced lasting effects, and demonstrated reduced movement pain and quality of life. Only this latter study used combined therapy. In cases in which the objective was the recovery of functionality, elderly patients were benefited by combined therapy, e.g., by hydrotherapy and floor exercises. The duration of intervention varied from only 10 sessions, in Medeiros et al.(19), to a 6-month follow-up, in Rahmann et al.(20). Almost all studies applied their protocols with a frequency of 2 to 3 times a week, with 30 minutes to 1 hour duration of each session. Of the 17 studies, 41% of them showed follow-up even after the end of the intervention(13,15-17,20,23,24).

Intervention sites and professionals involved in application of the method Of all articles reviewed, none of them had an LSIE as the site of the intervention. Of these, 52% were conducted in teaching clinics of universities(4,10,15,16,19,2124) , while 23% were held in therapeutic pools within hospitals(13,14,20,25). Only 11% made no mention as to where they were carried out(11,17). There was also a study conducted in a community aquatic center and gym(12,18). The vast majority (76%) was applied by physical therapists(4,12-17,19,20,22-25); only two were performed by physical education professionals(18,21). In two articles, the professional involved was not mentioned(4,11).

einstein. 2011; 9(1 Pt 1):84-9

Einstein v9n1.indb 88

24.03.11 19:37:43


Aquatic physical therapy as a treatment modality in healthcare for non-institutionalized elderly persons: a systematic review

Lund et al.(17) reported in their study that the professionals involved were, in reality, senior year Physical Therapy students, while Rahmann et al.(20) mentioned that the professional in their study had 5 years of experience in orthopedic postoperative care. Only 17% of the articles declared the experience of their professionals(14,20,24).

CONCLUSION Even though a large part of the studies demonstrated results with the practice of aquatic physical therapy, none of them was applied in an LSIE environment. Based on these studies in community elderly persons, a model of aquatic physical therapy assistance can be proposed, with well-defined inclusion and exclusion criteria. Thus, further studies are needed in this area to propose a model of assistance in LSIEs. REFERENCES 1. Gorzoni ML, Pires SL. Idosos asilados em hospitais gerais. Rev Saúde Pública. 2006;40(6):1124-30.

89

10. Candeloro JM, Caromano FA. Efeitos de um programa de hidroterapia na pressão arterial e freqüência cardíaca de mulheres idosas sedentárias. Fisioter Pesqui. 2008;15(1):26-32. 11. Cider A, Schaufelberger M, Sunnerhagen KS, Andersson B. Hydrotherapy-a new approach to improve function in the older patient with chronic heart failure. Eur J Heart Fail. 2003;5(4):527-35. 12. Devereux K, Robertson D, Briffa NK. Effects of a water-based program on women 65 years and over: a randomized controlled trial. Aust J Physiother. 2005;51(2):102-8. 13. Fransen M, Nairn L, Winstanley J, Lam P, Edmonds J. Physical activity for osteoarthritis management: a randomized controlled clinical trial evaluating hydrotherapy or Tai Chi classes. Arthritis Rheum. 2007;57(3):407-14. 14. Foley A, Halbert J, Hewitt T, Crotty M. Does hydrotherapy improve strength and physical function in patients with osteoarthritis--a randomised controlled trial comparing a gym based and hydrotherapy based strengthening programme. Ann Rheum Dis. 2003;62(12):1162-7. 15. Gill SD, McBurney H, Schulz DL. Physio. Land-based versus pool-based exercise for people awaiting joint replacement surgery of the hip or knee: results of a randomized controlled trial. Arch Phys Med Rehabil. 2009;90(3):388-94. 16. Harmer AR, Naylor JM, Crosbie J, Russel T. Land-based versus water-based rehabilitation following total knee replacement: a randomized, single-blind trial. Arthritis Rheum. 2009;61(2):184-91. 17. Lund H, Weile U, Christensen R, Rostock B, Downey A, Bartels EM, et al. A randomized controlled trial of aquatic and land-based exercise in patients with knee osteoarthritis. J Rehabil Med. 2008;40(2):137-44.

2. Brasil. Ministério da Saúde. Agência Nacional de Vigilância Sanitária. Resolução RDC n. 283, de 26 de setembro de 2005. Aprova o regulamento técnico que define normas de funcionamento para as instituições de longa permanência para idosos. Diário Oficial da República Federativa do Brasil, Brasília (DF) 2005 Set 27.

18. Madureira AS, Lima SM. Influência do treinamento físico no meio aquático para mulheres na terceira idade. Rev Bras Ativ Fís Saúde. 1998;3(3):59-66.

3. Gonçalves LG, Vieira ST, Siqueira FV, Hallal PC. Prevalência de quedas em idosos asilados do município de Rio Grande, RS. Rev Saúde Pública. 2008;42(5):938-45.

20. Rahmann AE, Brauer SG, Nitz JC. A specific inpatient aquatic physiotherapy program improves strength after total hip or knee replacement surgery: a randomized controlled trial. Arch Phys Med Rehabil. 2009;90(5):745-55.

4. Gimenes RO, Carvalho NT, Farelli BC, Mello TW. Impacto da fisioterapia aquática na pressão arterial de idosos. Mundo Saúde. 2008;32(2):170-5.

21. Ramos JM, Mansoldo AC. Efeito de 8 meses de hidroginástica em idosas com osteoporose. Motriz (Online). 2007;13(2):114-9.

5. Perracini MR, Fló CM, organizador. Funcionalidade e envelhecimento. Rio de Janeiro: Guanabara Koogan; 2009.

22. Ide MR, Belini MA, Caromano FA. Efeito de um programa de cinesioterapia respiratória na flexibilidade do tronco e da pélvis em idosos saudáveis, desenvolvido em dois meios diferentes: aquático e solo. Arq Ciências Saúde UNIPAR. 2005;9(2):71-7.

6. Jakaitis F, Pegoraro AS, Gusman S, Abrantes CV, Santos DG, Nascimbem D. Estudo epidemiológico da Fisioterapia Aquática do Hospital Israelita Albert Einstein. Rev Neurocienc. 2008;16(3):204-8. 7. Verhagen AP, de Vet HC, de Bie RA, Kessels AG, Boers M, Bouter LM, et al. The Delphi list: a criteria list for quality assessment of randomized clinical trials for conducting systematic reviews developed by Delphi consensus. J Clin Epidemiol. 1998;51(12):1235-41. 8. Applegate WB, Curb D. Designing and executing randomized clinical trials involving elderly persons. J Am Geratr Soc.1990;38(8):943-50. 9. Fernandes MI. Tradução e validação do questionário de qualidade de vida específico para osteoartrose WOMAC (Western Ontario and McMaster Universities) para a língua portuguesa [dissertação]. São Paulo: Universidade Federal de São Paulo; 2002.

19. Medeiros RR, Bacchi MH, Padilha RF, Carvalho PT, Rosa AS. Influência da hidroterapia no equilíbrio estático e dinâmico em idoso. Ter Man. 2008;6(24):96-101.

23. Silva LE, Valim V, Pessanha AP, Oliveira LM, Myamoto S, Jones A, et al. Hydrotherapy versus conventional land-based exercise for the management of patients with osteoarthritis of the knee: a randomized clinical trial. Phys Ther. 2008;88(1):12-21. 24. Stener-Victorin E, Kruse-Smidje C, Jung K. Comparison between electroacupunture and hydrotherapy, both in combination with patient education and patient education alone, on the symptomatic treatment of osteoarthritis of the hip. Clin J Pain. 2004;20(3):179-85. 25. Wadell K, Sundelin G, Henriksson-Larsén K, Lundgren R. High intensity physical group training in water--an effective training modality for patients with COPD. Respir Med. 2004;98(5):428-38.

einstein. 2011; 9(1 Pt 1):84-9

Einstein v9n1.indb 89

24.03.11 19:37:44


REVIEW

Noninvasive ventilation for acute respiratory failure in children – a systematic review Ventilação não invasiva em crianças com insuficiência respiratória aguda – uma revisão sistemática Carolina Silva Gonzaga1, Dafne Cardoso Bourguignon da Silva2, Carolina Figueira Rabello Alonso3, Carlos Augusto Cardim de Oliveira4, Lara de Araújo Torreão5, Eduardo Juan Troster6

ABSTRACT Objective: To assess the role of noninvasive ventilation in the treatment of children with acute respiratory failure. Methods: A systematic review of literature on noninvasive ventilation in MEDLINE, LILACS, EMBASE, and Cochrane databases, besides references in articles. The outcomes evaluated were responses in blood oxygenation and ventilation, and patient survival. Results: A total of 120 studies on noninvasive ventilation were found as of May, 2010. Of these, only 19 were about noninvasive ventilation in children. On the other hand, there are prospective and cohort clinical trials leading to a level II quality of evidence concerning the use of noninvasive ventilation in children. Conclusion: There is scientific evidence for proposing the use of noninvasive ventilation, with a B-II degree of recommendation. Keywords: Pulmonar ventilation; Anoxia; Hypercapnia; Respiratory insufficiency; Child

RESUMO Objetivo: Avaliar o papel da ventilação não invasiva no tratamento de crianças com insuficiência respiratória aguda. Métodos: Revisão sistemática da literatura sobre ventilação não invasiva nas bases MEDLINE, LILACS, EMBASE e Cochrane, além de referências de artigos. Os desfechos avaliados foram resposta sobre a oxigenação e ventilação sanguínea, e a sobrevida dos pacientes. Resultados: Foram encontrados 120 estudos sobre ventilação não invasiva até Maio de 2010. Destes, apenas 19 eram sobre ventilação não invasiva em crianças. Já há ensaios clínicos prospectivos e de coorte, levando a uma qualidade de evidência nível II sobre o uso de ventilação não invasiva

em crianças. Conclusão: Já há evidência científica para recomendar o uso da ventilação não invasiva, com um grau de recomendação B-II. Descritores: Ventilação pulmonar; Anóxia; Hipercapnia; Insuficiência respiratória; Criança

INTRODUCTION Among the diseases that place at risk the life of a pediatric patient, and especially, its future quality of life, acute respiratory failure (ARF) is one of the most important. A child’s respiratory system has several particularities that facilitate the development of respiratory insufficiency. In addition, respiratory diseases occur frequently in the pediatric age range. The use of invasive mechanical ventilation allows a more adequate treatment of patients with ARF; but positive pressure in the patients’ airways acts inversely to normal respiratory physiology. This may result in complications due to lack of pressure. Additionally, the intubation procedure and the presence of the cannula in the airway may promote local lesions and predispose to pulmonary infections. As an alternative to tracheal intubation, noninvasive ventilation (NIV) is a technique in which positive pressure is applied to the patient’s airway by means of masks or interfaces without tracheal cannulation.

Study carried out at Instituto da Criança Professor Pedro de Alcântara, Universidade de São Paulo – USP, Sao Paulo (SP), Brazil. 1

Physical therapist; Hospital Aliança de Salvador, Bahia (BA), Brazil.

2

Intensive Care Unit, Instituto de Oncologia Pediátrica, Escola Paulista de Medicina, Universidade Federal de São Paulo – UNIFESP, Sao Paulo (SP), Brazil.

3

Instituto de Oncologia Pediátrica, Escola Paulista de Medicina, Universidade Federal de São Paulo – UNIFESP, Sao Paulo (SP), Brazil.

4

Universidade da Região de Joinville – UNIVILLE, Joinville (SC), Brazil.

5

Universidade Federal da Bahia – UFBA, Salvador (BA), Brazil.

6

Pediatric Intensive Care Unit, Hospital Israelita Albert Einstein – HIAE, Sao Paulo (SP), Brazil. Autor correspondente: Eduardo Juan Troster – Avenida Albert Einstein, 627 – Cons.113 – BL. A1 - Morumbi – CEP 05651-901 – São Paulo (SP), Brasil – Tel./Fax: 11 2151-5113 – E-mail: troster@einstein.br Received: Jun 12, 2010 - Accepted: Feb 15, 2011 There is no conflict of interest.

einstein. 2011; 9(1 Pt 1):90-4

Einstein v9n1.indb 90

24.03.11 19:37:44


Noninvasive ventilation for acute respiratory failure in children

The use of NIV in selected groups of adult patients, such as those with acute exacerbation of chronic obstructive pulmonary disease (COPD), reduces the need for intubation, mortality, and costs of treatment (1). In 1987, the first use of NIV with a nasal mask was recorded in a six-year-old child with a primary diagnosis of alveolar hyperventilation (2). Over the last 20 years, the number of experiences with the use of NIV in children has been increasing.

OBJECTIVE To discuss the accumulated experience on NIV in clinical trials with the purpose of evaluating its role in the treatment of ARF in pediatric patients. METHODS Identification of studies The bibliographical survey was made systematically, seeking publications in Portuguese, English, and Spanish. The following databases were used, from the onset to May, 2010: MEDLINE (as of 1966); LILACS (as of 1983); EMBASE (as of 1974); Cochrane Library (as of 1993). Also used were the references cited in reviews and articles. The terms used for the investigation were “noninvasive ventilation;” “acute respiratory failure;” “BIPAP;” “CPAP;” “hypoxemia;” “hypercapnia.” Selection criteria The following criteria were considered for study selection: A. Study design • Randomized clinical trials. • Case series. • Systematic reviews. B. Population Children and adolescents up to 18 years of age with ARF. C. Exclusion criteria

91

• Articles published in languages other than Portuguese, English, or Spanish. • Articles that covered the use of NIV in chronic patients and in those with obstructive sleep apnea syndrome. • Studies that covered the use of NIV in newborns and terminal patients. D. Type of intervention Utilization of NIV by means of masks, with comparative analysis (pre- and post-NIV in the same individual, or with controls submitted to conventional treatment). E. Types of outcomes evaluated • Primary outcomes 1. Need for intubation. 2. Survival. • Secondary outcomes 1. Effects on heart rate and breathing rate. 2. Effects on oxygenation and ventilation (alteration of arterial oxygen pressure (PaO2), arterial carbon dioxide pressure (PaCO2), and oxygen saturation). F. Classification of the level of scientific evidence The GRADE System was used, recognized by the foremost societies and specialties and by the Public Health Service of the United States, as per Table 1(3).

RESULTS Systemic search in publications One hundred and twenty studies on NIV were found during the study period. Of these, only 19 satisfied the established selection criteria, and they are shown on Chart 1. In a systematic review of NIV with negative pressure, only one study, in which 33 children with bronchiolitis were studied, was considered eligible. The experimental group treated with negative pressure NIV displayed a reduced need for oxygen in one hour and none of the children in this group required CPAP or invasive mechanical ventilation. The authors concluded that there was information lacking and that controlled

Table 1. Score system of recommendations, according to the Public Health Service of the United States Stregth of recommendation A. Good evidence supporting recommendation for use B. Moderate evidence supporting the recommendation of use C. Weal evidence supporting recommendation D. Moderate evidence supporting against recommendation of use E. Good evidence supporting against recommendation of use

Quality of evidence 1. Evidence of at least one appropriate randomized controlled trial, 2. Evidence of at least one well designed trial, not randomized; of cohort or case-control studies (preferably from more than one center); of several temporal series or of significant results of non-controleed trials 3. Evidence of experts in the subject, based on clinical experience, descriptive studies or reports of experts

Source: Guyatt GH, Oxman AD, Vist GE, Kunz R, Falck-Ytter Y, Alonso-Coello P, Schünemann HJ; GRADE Working Group. GRADE: an emerging consensus on rating quality of evidence and strength of recommendations. BMJ. 2008;336(7650):924-6 (3)

einstein. 2011; 9(1 Pt 1):90-4

Einstein v9n1.indb 91

24.03.11 19:37:45


92

Gonzaga CS, Silva DCB, Alonso CFR, Oliveira CAC, Torreão LA, Troster EJ

Chart 1. Studies about noninvasive ventilation in children with acute respiratory failure, 1993-2010 Author Akingbola et al.(4) Fortenberry et al.(5) Padman et al.(6) Sprague et al.(7)

Study (n) Case report (2) Case series (28) Case series (34) Case series (5)

Year of publication 1993 1995 1998 2000

Akingbola et al.(8) Shah et al.(9) Thill et al.(10) Piastra et al.(11)

Case report (3) Systematic review Randomized crossover clinical trial (16) Case series (4)

2002 2003 2004 2004

Villanueva et al.(12) Chin et al.(13)

Case series (23) Case series (15)

2005 2005

Prado et al.(14)

Case series (14)

2005

Carroll e Schramm(15)

Case series (5)

2006

Essouri et al.(16) Yañez et al.(17)

Retrospective cohort (114) Prospective randomized clinical trial

2006 2008

Essouri et al.(18)

Prospective clinical trial

2008

Pancera et al.(19)

Retrospective study

2008

Ottonello et al.(20)

Retrospective study

2007

Codazzi et al.(21) Piastra et al.(22)

Case series (15) Viability study prospective cohort

2006 2009

Population Children with atelectasis Children with ARF Patients aged between 6 months and 18 years with ARF Patients aged between 12 years and 18 years with ARF secondary to cystic fibrosis Children with asthma and hypercapnia Children with bronchiolitis in ARF Children with lower airways obstruction Children aged between 9 and 17 years with acute leukemia and hypoxemic ARF Hypoxemic and hypercapnic ARF or respiratory failure after extubation Children aged 5 months and 14 years, submitted to liver transplant, that progressed with ARF and atelectasis Children aged between 1 month and 13 years, with ARF, reduced oxygenation (saturation < 93% with FiO2 > 40%) and ventilation (pH < 7,25), besides radiological impairment Children aged between 2 years and 18 years, with acute asthma, hypoxemia and increased respiratory work Patients aged 15 to 17 years 50 patients with ARF, 25 received NIV and 25 received conventional treatment with medication and O2 nebulization Patients aged 1 to 18 years, weighting more than 10 kg, admitted to the ICU with ARF, moderate hypercapnia as defined by a respiratory frequency equal or more than the 97 percentile for age associated to a PCO2 ≥ 40 mmHg Children amitted to the ICU of Hospital do Câncer between June 1997 and May 2005. Two hundred thirty nine patients were included And 120 of them received NIV as the first ventilation technique Twenty patients with mean ages of 7.4 years, with ARF, received NIV and were divided into two groups for analysis: hypoxic and hypercapneic group. Fifteen children from 1 month to 5 years with hypoxemic ARF Twenty three immunocompromised patients with ARDS

ARF = acute respiratory failure, ICU = intensive care unit, NIV = non invasive ventilation, ARDS = acute respiratory distress syndrome

studies would be necessary which could support the use of negative pressure NIV in children with ARF (9). The first crossover randomized clinical trial assessed the effects of NIV in 16 children with obstruction of the lower airways, characterized by increased breathing work and dyspnea, using the Clinical Asthma Score (CAS). Patients were randomized to two groups: Group 1, which received NIV in addition to conventional treatment (high flow oxygen, inhalation with bronchodilator, and corticoids) for two hours; and Group 2, which during the first two hours received only conventional treatment. After two hours, treatment between the groups was inverted (crossover): Group 1 began to receive only conventional treatment and Group 2 received NIV in addition to conventional treatment. There was significant improvement in respiratory rate (p < 0.0001) and CAS (p < 0.0001) in the NIV group (10). In the study by Villanueva, the effects of NIV were evaluated in 23 patients with hypoxemic respiratory insufficiency, hypercapnia, or postextubation respiratory

insufficiency. After the start of NIV, there was significant improvement of the respiratory rate (p < 0.001), heart rate (p = 0.001), and of the PaO2/FiO2 ratio (p=0.010). Of the 23 patients who received NIV, five required intubation and invasive mechanical ventilation (12). At a single center, 15 children aged one month to five years with hypoxemic respiratory insufficiency were evaluated. NIV was performed with additional sedation, when necessary, and the mask was well tolerated by all patients. Of the 15 children, 10 had multiple organ dysfunction and 9 were under one year of age. None of them experienced complications. Oxygenation improved after two hours of NIV, and no hemodynamic variation was detected (21). The efficacy of NIV was evaluated in an Italian Intensive Care Unit (ICU) with 24 beds, during two years, analyzing pH, CO2, SatO2, respiratory rate, and need for oxygen. Twenty patients with a mean age of 7.4 years (± 0.28 years), with ARF, received NIV, and for the analysis they were divided into two groups:

einstein. 2011; 9(1 Pt 1):90-4

Einstein v9n1.indb 92

24.03.11 19:37:46


Noninvasive ventilation for acute respiratory failure in children

hypoxic group and hypercapnic group. Of these 20 patients, 15 displayed an improvement in oxygenation and ventilation; five required invasive mechanical ventilation; and two experienced pressure ulcers on nasal bridges, which were rapidly reversible (20). Essouri et al. (16) carried out a retrospective cohort study with patients aged 15 to 17 years treated with NIV for two hours or more, between January 1st, 2000, and December 31st, 2004. Included were 114 patients, and of these, 83 (77%) were successfully treated with NIV, with no intubation. The success of NIV use was significantly lower (22%) in the group with acute respiratory distress syndrome (ARDS). PRISM II and the Pediatric Logistic Organ Dysfunction (PELOD) at admission were clearly higher in patients who did not have success with NIV. In the group of responders to NIV, there was a distinct drop in respiratory rate and PCO2 within the first two hours of NIV. A multivariate analysis showed that the diagnosis of ARDS and the high value of PELOD were predictive factors for treatment failure with NIV. YaĂąez et al.(17) conducted a controlled randomized prospective multicentric study in Santiago, Chile. Fifty patients with ARF were studied; 25 received NIV and 25 received conventional treatment with medication, inhalation, and O2 nebulization. Comparing the values to those of admission, the PaO2/FiO2 ratio and cardiac and breathing rates after our hour of treatment improved significantly in the group that received NIV. The improvement continued to be observed over time, with a drop in heart rate after six hours of therapy. Use of intubation was 28% lower in the group that received NIV relative to controls. Essouri et al.(18) published a second study in 2008, which was prospective, carried out from December 2004 to January 2007. Patients from one to 18 years of age were evaluated who weighed more than 10 kg, admitted to the ICU with moderate hypercapnic respiratory insufficiency (defined by respiratory rate equal to or greater than the 97th percentile for the age group, associated with PCO2 â&#x2030;Ľ 40 mmHg). Only patients treated with NIV for less than 12 hours were included. NIV was associated with an improvement in the breathing pattern, better gas exchange, and less use of accessory muscles. The improvement in alveolar ventilation was translated as a partial reduction in PCO2 from 48 to 40 mmHg, and in a respiratory rate between 48 and 41. A national retrospective cohort study evaluated children admitted to the ICU at the Cancer Hospital between June 1997 and May 2005. Included were 239 patients: 120 of them received NIV as the first technique for ventilation and 119 received conventional mechanical ventilation. Of the patients submitted to NIV, 25.8% required intubation. The groups were not paired,

93

and the patients who received invasive mechanical ventilation were in more serious clinical condition. The values of arterial PCO2, hypoxemia, arterial pH, and respiratory rate were no different between the two groups. The study results encourage the use of NIV as the first treatment in oncologic children with respiratory insufficiency, and without hemodynamic instability (19). Piastra et al.(22) developed a prospective cohort study with 23 immunocompromised patients with ARDS admitted to the ICU of a university hospital and treated with NIV. There was no difference in the scores of severity between the NIV responders and non-responders. The improvement in the PaO2/ FiO2 ratio was significant and precocious. Of the 23 patients, 13 were able to avoid intubation and were discharged from the ICU. Ten required intubation, and of these, two survived and eight died (two due to refractory hypoxemia, three due to septic shock, and three due to multiple organ failure). The mortality of non-responders to NIV was high both in the ICU and in the hospital, in general. ICU stay was shorted for those responsive to NIV, who also showed an improvement in heart and respiratory rates at the end of the treatment. It was concluded that NIV is well tolerated and feasible in children immunocompromised with ARDS, but a randomized controlled study is necessary to confirm the efficacy of this method.

DISCUSSION The clinical evaluation of the benefits of NIV was performed by means of a randomized clinical trial with the general pediatric population (17) and a trial in the subpopulation with asthma (10). Such studies were not completely appropriate since they did not compare NIV with the invasive treatment, but with conventional treatment. The other studies included in this review showed clinical improvement in children and adolescents treated with NIV. With ventilatory support provided via masks, the patients showed reduced respiratory discomfort, in addition to improved oxygenation and ventilation, assessed by arterial gasometry or by noninvasive monitoring methods, such as pulse oximetry. Controlled studies in adults demonstrated similar results: reduction in respiratory rate, reduction in respiratory discomfort, and improvement in oxygenation (23,24). The studies carried out by Essouri et al.(16,18) and Ottonello et al.(20) allow rating and recommendation of use of NIV at the B-II level. NIV proved particularly feasible in oncologic patients (19,22). einstein. 2011; 9(1 Pt 1):90-4

Einstein v9n1.indb 93

24.03.11 19:37:46


94

Gonzaga CS, Silva DCB, Alonso CFR, Oliveira CAC, Torreão LA, Troster EJ

CONCLUSION There is currently scientific evidence to recommend the routine use of NIV, with a B-II degree of recommendation, due to the reduced number of controlled and randomized studies. The articles published to date suggest beneficial physiological effects. New randomized studies with larger numbers of cases to better define the role of NIV in treating respiratory insufficiency in the pediatric population are welcome. REFERENCES 1. Schettino GP, Reis MA, Galas F, Park M, Franca S, Okamoto V. [Mechanical ventilation noninvasive with positive pressure]. J Bras Pneumol. 2007;33 Suppl 2S:S92-105. 2. Ellis ER, McCauley VB, Mellis C, Sullivan CE. Treatment of alveolar hypoventilation in a six-year-old girl with intermittent positive pressure ventilation through a nose mask. Am Rev Respir Dis. 1987;136(1):188-91. 3. Guyatt GH, Oxman AD, Vist GE, Kunz R, Falck-Ytter Y, Alonso-Coello P, Schünemann HJ; GRADE Working Group. GRADE: an emerging consensus on rating quality of evidence and strength of recommendations. BMJ. 2008;336(7650):924-6. 4. Akingbola OA, Servant GM, Custer JR, Palmisano JM. Noninvasive bi-level positive pressure ventilation: management of two pediatric patients. Resp Care. 1993;38:1092-8. 5. Fortenberry JD, Del Toro J, Jefferson LS, Evey L, Haase D. Management of pediatric acute hypoxemic respiratory insufficiency with bi-level positive pressure (BiPAP) nasal mask ventilation. Chest. 1995;108(4):1059-64. 6. Padman R, Lawless ST, Kettrick RG. Noninvasive ventilation via bi-level positive airway pressure support in pediatric practice. Crit Care Med. 1998;26(1): 169-73. 7. Sprague K, Graff G, Tobias DJ. Noninvasive ventilation in respiratory failure due to cystic fibrosis. South Med J. 2000;93(10):954-61. 8. Akingbola OA, Simakajornboon N, Hadley Jr EF, Hopkins RL. Noninvasive positive-pressure ventilation in pediatric status asthmaticus. Pediatr Crit Care Med. 2002;3(2):181-4. 9. Shah PS, Ohlsson A, Shah JP. Continuous negative extrathoracic pressure or continuous positive airway pressure for acute hypoxemic respiratory failure in children. Cochrane Database Syst Rev. 2003(3):CD003699. 10. Thill PJ, McGuire JK, Baden HP, Green TP, Checchia PA. Noninvasive positivepressure ventilation in children with lower airway obstruction. Pediatr Crit Care Med. 2004;5(4):337-42. 11. Piastra M, Antonelli M, Chiaretti A, Polidori G, Polidori L, Conti G. Treatment of acute respiratory failure by helmet-delivered noninvasive pressure support

ventilation in children with acute leukemia: a pilot study. Intensive Care Med. 2004;30(3):472-6. 12. Villanueva AME, Los Arcos Solas M, Galán CR, Torre AC, Cuervo SM, et al. Aplicación de ventilación no invasiva em una unidad de cuidados intensivos pediátricos. An Pediatr. 2005;62(1):13-9. 13. Chin K, Uemoto S, Takahashi K, Egawa H, Kasahara M, Fujimoto Y, et al. Noninvasive ventilation for pediatric patients including those under 1-year-old undergoing liver transplantation. Liver Transpl. 2005;11(2): 188-95. 14. Prado F, Godoy MA, Godoy M, Boza ML. [Pediatric noninvasive ventilation for acute respiratory failure in an Intermediate Care Unit]. Rev Med Chil. 2005;133(5):525-33. 15. Carroll CL, Schramm CM. Noninvasive positive pressure ventilation for the treatment of status asthmaticus in children. Ann Allergy Asthma Immunol. 2006;96(3):454-9. 16. Essouri S, Chevret L, Durand P, Haas V, Fauroux B, Devictor D. Noninvasive positive pressure ventilation: five years of experience in a pediatric intensive care unit. Pediatr Crit Care Med. 2006;7(4):329-34. 17. Yañez LJ, Yunge M, Emilfork M, Lapadula M, Alcántara A, Fernández C, et al. A prospective, randomized, controlled trial of noninvasive ventilation in pediatric acute respiratory failure. Pediatr Crit Care Med. 2008;9(5): 484-9. 18. Essouri S, Durand P, Chevret L, Haas V, Perot C, Clement A, et al. Physiological effects of noninvasive positive ventilation during acute moderate hypercapnic respiratory insufficiency in children. Intensive Care Med. 2008;34(12): 2248-55. 19. Pancera CF, Hayashi M, Fregnani JH, Negri EM, Deheinzelin D, de Camargo B. Noninvasive ventilation in immunocompromised pediatric patients: eight years of experience in a pediatric oncology intensive care unit. J Pediatr Hematol Oncol. 2008;30(7):533-8. 20. Ottonello G, Villa G, Doglio L, Pedemonte M, Diana MC, Casciaro R, et al. Noninvasive ventilation with positive airway pressure in paediatric intensive care. Minerva Pediatr. 2007;59(2):85-9. 21. Codazzi D, Nacoti M, Passoni M, Bonanomi E, Sperti LR, Fumagalli R. Continuous positive airway pressure with modified helmet for treatment of hypoxemic acute respiratory failure in infants and a preschool population: a feasibility study. Pediatr Crit Care Med. 2006;7(4):455-60. 22. Piastra M, De Luca D, Pietrini D, Pulitanò S, DArrigo S, Mancino A, et al. Noninvasive pressure-support ventilation in immunocompromised children with ARDS: a feasibility study. Intensive Care Med. 2009;35(8):1420-7. 23. Soroksky A, Stav D, Shpirer I. A pilot prospective, randomized, placebocontrolled trial of bi-level positive airway pressure in acute asthmatic attack. Chest. 2003;123(4):1018-25. 24. Park M, Sangean MC, Volpe Mde S, et al. Randomized, prospective trial of oxygen, continuous positive airway pressure, and bi-level positive airway pressure by face mask in acute cardiogenic pulmonary edema. Crit Care Med. 2004;32(12):2407-15.

einstein. 2011; 9(1 Pt 1):90-4

Einstein v9n1.indb 94

24.03.11 19:37:47


REVIEWING BASIC SCIENCES

Molecular aspects of bladder cancer Aspectos moleculares do câncer de bexiga Gelbert Luiz Chamon do Carmo Amorim1, Denny Fabricio Magalhães Veloso1, José Carlos Vieira1, Paulo Roberto Alves1

ABSTRACT One of the most important objectives of genetic markers of cancer will be the possible identification of individuals at greatest risk in order to allow better management and prognosis. Many urological tumors were associated to various types of gene alterations with a great number of genes involved in the process, hindering gene therapy. This treatment uses specific techniques and one or several genes are manipulated in the laboratory in order to induce molecular alterations that may block the oncogenic process. The article addresses these issues emphasizing the importance of the new molecular biology techniques. Keywords: Urinary bladder neoplasms/genetics; Urinary bladder/ pathology

RESUMO Um dos mais importantes objetivos dos marcadores genéticos para o câncer será a possível identificação do indivíduo com maior risco de doença, permitindo melhor conduta e prognóstico. Nos casos dos tumores urológicos, vários tumores têm sido relacionados a vários tipos de alterações genéticas, com um grande número de genes envolvidos, que dificulta muito a terapia gênica que é o processo no qual, por meio de técnicas específicas, gene ou genes são manipulados em laboratório para provocar alterações moleculares capazes de bloquear o processo oncogênico. O presente artigo aborda essas questões enfatizando a importância do advento das novas técnicas de biologia molecular. Descritores: Neoplasias da bexiga urinária/genética; Bexiga urinária/ patologia

INTRODUCTION The importance of genetics greatly increased in the past years and its study has become necessary to understand several diseases(1). Biological processes have some genetic influence; investigating their determining

molecular mechanisms is the object of numerous approaches, possibly due to the development of technologies allowing the study of DNA. Despite the progress of surgical techniques, effective treatment still requires understanding the phenomena that determine cancer. Genetic and environmental factors are causes of genome lesions leading to cancer, a genetic disease at somatic level resulting from sequential mutations in genes responsible for cell proliferation, death and differentiation, resulting in genomic instability. Therefore, the cell where the cascade of mutations was initiated starts multiplying, evolving in sublineages with varied grades of abnormalities and malignancy and generating tumor heterogeneity. Some of the mechanisms affecting the normal sequence of cell cycle involve mutations in two groups of genes, the oncogenes that are related to the induction of cell division and the tumor suppressor genes that act in oncogenes in proliferation control. Mutations in suppressor genes can lead to malignant transformation of cells when the allele function is lost, thus causing uncontrolled cell division, abnormal differentiation and deficient apoptosis. The gene most frequently mutated in different types of cancer in humans, including bladder tumors, is the protein p53(2). Chromosome instability must be considered in tumor cells, suggesting that cancer could be the result of an imbalance in number of chromosomes, therefore, in the amount of functional genetic information in the cell. There is still a marked variation in susceptibility to carcinogens among individuals; likewise, several genetically determined factors seem to be related to the risk of cancer, without a correlation with carcinogens. Exogenous factors, such as lifestyle, can determine the

Study carried out at Santa Casa de Belo Horizonte (MG), Brazil. 1

Department of Urology, Santa Casa de Belo Horizonte (MG), Brazil. Correspondence to: Gelbert Luiz Chamon do Carmo Amorim – Rua: Manaus, 645 – Santa Efigênia – CEP: 30150-350 – Belo Horizonte – Minas Gerais (MG), Brazil. Tel.: (31) 3774 7500 – e-mail: gelbertchamon@hotmail.com Received: Jan 13, 2010 – Accepted: Dec 20, 2010

einstein. 2011; 9(1 Pt 1):95-9

Einstein v9n1.indb 95

24.03.11 19:37:47


96

Amorim GLCC, Veloso DFM, Vieira JC, Alves PR

intake of vitamins, antioxidants and compounds that modulate the risk of developing neoplasms. One of the most important objectives of genetic markers of cancer will be possible identification of individuals at higher risk of developing the disease, allowing better management and prognosis. Several urological tumors were associated to various types of genetic abnormalities, with a large number of genes involved, which hinders gene therapy. Gene therapy is the process in which one or more genes are manipulated in a laboratory by specific techniques to cause molecular changes that are able to block the oncogenic process.

BLADDER CANCER Bladder cancer, especially transitional cell carcinoma (TCC), is the fourth most common tumor in males, in the United States. This cancer has a variable clinical course and prognosis, and 70% presenting as a superficial tumor upon diagnosis. However, over 60% of patients have recurrence after endoscopic resection, and a major concern is that in 30% of them it will occur in a more advance grade and/or stage, showing disease progression. About 5% to10% of patients with initially superficial tumors will develop invasive disease with involvement of bladder muscles(3-7). Among patients with radically treated local invasive disease, 50% will develop metastatic disease. Several prognostic markers have been studied to predict which superficial tumors would become invasive and which invasive tumors tend to produce metastases. Gene p53 Upon development of DNA analysis, by means of cloning techniques, a large number of genes were found to be involved in the onset and progression of several types of cancer. Special importance has been given to mutations in the suppressor gene p53, considered to be the most studied genetic defect in bladder cancer(2). This gene, located in the short arm of chromosome 17, seems to act in encoding a nuclear protein of 53kDa, which has an effect in transcriptional regulation of cell cycle. Mutations of p53 cause increased expression and half-life of this non-functioning protein, with consequent loss of its suppressing activity, so that this is now detected by immunohistochemistry. Detection of nuclear accumulation of protein p53 by immunohistochemistry is strongly associated to p53 mutations; however, the absence of immunoreactivity does not exclude this genetic abnormality. Reactivity of this protein was demonstrated in 50% of patients

with bladder cancer (TCC), specially in high grade and advanced stage tumors. Higher occurrence of mutations in p53 was also demonstrated in invasive tumors when compared to superficial ones. Fujimoto et al.(8) found mutant p53 in 50% of patients with invasive tumors and only 7.6% in superficial tumors. Several authors studied p53abnormalities and observed a direct relation between the occurrence of genetic abnormalities and the chances of disease progression and death. Observation of mutations in superficial tumors was reported in 22% to 64% of patients, with a direct relation between likelihood of recurrence and decreased survival. Hudson et al. demonstrated 71% of progression to invasive disease in p53 positive patients compared to 22% in patients with undetectable protein(9). Another important factor is decreased survival related to disease in patients treated by radical cystectomy due to localized disease who present increased p53 expression, demonstrating it is an important indicator, regardless of the grade and stage of the disease. It is known that superficial recurrences usually occur with diploid tumors and negative p53 mutants and tumors with metastases are aneuploid and p53-positive, but both have no prognostic advantages considering cell proliferation rates. In regard to carcinoma in situ, a strong associated was observed between increased expression of p53 expression and chances of disease progression and decreased disease-specific survival. In this analysis, 48% showed increased p53 expression and 86.7% of them progressed. More recently, some authors demonstrated that p53 positivity can be converted after immunotherapy with BCG; therefore, it was also demonstrated that the likelihood of disease progression would be higher when failure to BCG treatment occurs. In p53-negative patients, approximately 20% presented disease progression. By and large, we observe that p53 expression is directly related to prognosis of patients with bladder cancer (TCC), and those with superficial disease and increased p53 expression must be carefully followed up. Patients with carcinoma in situ treated with BCG who relapse and have positive p53 must be considered candidates to radical cystectomy. Those who underwent radical cystectomy and have positive p53 should be considered as at higher risk for progression, with a strict control. It is worth mentioning that the immunohistochemical expression of gene p53 does not change the importance of traditional prognostic factors of bladder cancer, especially the histological grade of cancer. Additionally, there are conflicting data in the literature when analyzing

einstein. 2011; 9(1 Pt 1):95-9

Einstein v9n1.indb 96

24.03.11 19:37:48


Molecular aspects of bladder cancer

the role of gene p53 expression as an independent factor in prognosis of bladder carcinomas. A possible explanation for the conflicting results about this gene would be difficult standardization of different techniques to detect gene p53 mutations, since none of them has 100% sensitivity. Another explanation for the controversies would be the different expression of several antibodies, if compared to antibody pab 1801, which present poorer results in detection of mutations in tissues fixed in formalin. On the other hand, agreement of pab 1801 in fresh specimen and paraffin-treated material is approximately 92 to 96%. However, when comparing three antibodies - CM1, Pab 1801 and D07 - in fresh material and in paraffin, it was observed that the main disagreement factor is the variable expression of protein p53 in the same tumor sample, regardless of the antibody used. Hence, the relation between the several agents acting in tumor biology should be better understood, and the detection techniques should be improved and standardized to determine the clinical role of gene p53 expression(10,11).

GENOMIC INSTABILITY Genomic instability, particularly in transitional cell carcinoma of the bladder with two types, is detected in six out of 200 cases of TCC. Genomic instability in cancer could be divided into two types: microsatellite instability (MSI) and microsome instability (CIN). MSI is related to defects in mismatch repair (MMR) and CIN is related to abnormalities in chromosome segregation. Considering bladder cancer, 50% is related to CIN and presents worse prognosis and 9% is characterized as MSI with better prognosis; moreover, bladder cancer associated to MSI is more frequent in young patients(12-17). GSTM1 AND CYP2D6 Susceptibility to bladder cancer depends on the correlation between genetic factors and the environment. Recent researches aimed at associations of susceptibility to bladder cancer and variance in polymorphism of genes CYP2D6 and GSTM1(18). Gene CYP2D6 is related to cytochrome P450 whose substrata include aromatic amines and nitrosamines of tobacco. GSTM1 is related to enzymes with several functions, including deintoxication of the aromatic cycle of hydrocarbons of cigarettes and aromatic amines. Some studies carried out in patients with bladder cancer analyzed the occurrence of both genes and showed that the gene GSTM1 is more associated to

97

the occurrence of bladder cancer, especially in those patients with superficial tumors and the association is stronger in smokers. Gene CYP2D6 did not present the same significance of association.

Amplification/over-expression of a mitotic gene in bladder cancer Genomic instability has been suggested as a cause of malignant transformation and progression to cancer; some studies indicate that several genetic instabilities are associated to different mechanisms leading to human cancer. The best characterized genomic instability is inactivation of gene-repairing DNA; however, this mode of instability can be verified in a small proportion of tumors. Gene STK15/BTAK/AuroraA is associated with aneuploidy and transformation when overexpressed in cells; when this occurs there is activation of an oncogen involving the amplification of a centrometer and resulting in miscegenation of chromosomes. This aneuploidy, when added to prognostic clinical factors is associated to bladder tumor. Although high expression of STK15 seems to be frequent in bladder tumors, approximately 30% of aneuploidy in aggressive bladder tumors does not evidence STK15 with overexpression. This suggests that, in a fraction of bladder tumors, other genes are associated to aneuploidy. In fact, two discoveries of members of the Aurora kinase family, Aurora-B and Aurora-C, were reported as responsible for the increased expression of some human cancers. It is important to note that STK15 is located in chromosome 20q13 and it was identified by the search of sequences with over-expression in chromosome 20. The 20q region is typically amplified in high grade bladder cancer. Therefore, while analyzing the occurrence of genomic instability, especially in regard to aneuploidy and the occurrence of bladder tumors, it is observed that they are strongly related. Tumors with a minimum deviation of chromosome copy are clinically less aggressive than those with more deviation of chromosome copies. Recent investigations showed that STK15/BTAK/ AuroraA is involved in the regulation of centrometer and it is linked to frequent amplification and overexpression of human tumors and, therefore, it would be a regulating component of chromosome segregation, and it can cause aneuploidy and transformation. Hence, it is confirmed that STK15 is associated to increased expression of mitoses and aneuploidy, einstein. 2011; 9(1 Pt 1):95-9

Einstein v9n1.indb 97

24.03.11 19:37:48


98

Amorim GLCC, Veloso DFM, Vieira JC, Alves PR

and consequently more aggressive feature of bladder cancer(19).

Loss of chromosome 3 allele, microsatellite abnormalities and bladder cancer Studies indicated that deletions in chromosome 3, especially three discreet ones in regions 3p are identified in bladder cancer, suggesting that the gene suppressor is in these regions. Detection of the loss of alleles in these regions would also be associated to higher severity of bladder tumor, suggesting its relation with cancer progression. Other studies indicated that allele loss could occur in chromosomes 17p13, 3p25-26,9q32-33. Higher occurrence of allele deletion is in chromosome 9p and 9q; molecular maps showeddseveral suppressing genes in chromosome 9 and higher likelihood of loss of chromosome 9 would be an early event in onset of cancer. The other genetic abnormalities that frequently occur are located in chromosomes 1, 8, 16,14 and 21. Thus, loss of alleles in multiple sites of the genoma frequently occurs in bladder cancer. Upon isolate analysis of carcinoma in situ patients, it was observed that this type of tumor contains cells with non-specific loss of chromosome 9; however, neoplasm in situ with synchronous carcinoma showed lesions with loss in chromosome 9. Mutations in p53 precede the losses of alleles in chromosome 9, and 9p21 in in situ carcinoma is a precursor of bladder cancer invasiveness, whereas non-invasive carcinomas where chromosome 9 with losses (9p11-9q12) are early and frequently combined to homozygotic deletions of 9p21(20). Hyperamplification of centrometer as a predictive factor in progression and recurrence of bladder cancer Several pieces of evidence suggest that overexpression of STK15/BTAK/AuroraA, a gene located in 20q13, induces aneuploidy, microsome instability and centrometer amplification (CH). Data suggest that there is a strong association between CH and overexpression of Aurora-A. A large number of copies of 20q13 would be associated to several fractions of chromosomes 7, 9 and 17, as well as CH. It is suspected that half of the cases of CH could be caused by amplification or gain of gene STK15/BTAK/AuroraA. Recent studies demonstrated that hyperamplification of centrometer (CH) goes along with chromosome instability during the development of bladder cancer, which confers the tumors increased characteristics of malignancy; therefore, it would be an independent

and important prognostic factor for the recurrence of cancer; however, when progression of bladder cancer is analyzed, it is still not possible to conclude that CH could influence its occurrence.

CONCLUSION With the emergence of new molecular biology techniques, cell abnormalities occurred in carcinogenesis could be studied in more details. Nowadays, as a general concept, it is accepted that the carcinogenic process results from a complex path involving the combination of inactivation of tumor-inhibiting genes and activation of tumor-promoting genes (oncogenes). Several stages must be reached in the formation of a tumor, starting with tumor inhibition, then proliferation, loss of inhibition by contact, invasion and metastasis of the cancer cell. Accumulation of mutations in essential genes can transform a normal cell into a cancer cell. This transformed cell then grows in a disorganized manner until it forms the tumor with additional mutations occurring during this process. When cancer is diagnosed, it is a mix of cancer cells with subclones, making it difficult to establish the order of occurrence of genetic abnormalities. Bladder cancer, however, allows a different and unique study of mutations because the different tumor subclones grow in separate sites and allow independent studies. Several studies were and are being carried out in an attempt to relate the biological characteristics of bladder cancer, its occurrence, histology and its severity with the different types of mutations and chromosome instability. It should be kept in mind that molecular biology and genetics are in the path to new knowledge about tumor molecular pathophysiology and that gene therapy stopped being fiction to be transformed in a real hope. REFERENCES 1. Gattás N. Terapia gênica: o urologista de olho no futuro: Sinopse de Urologia [Internet] 1998 [citado 2010 Jan 20]; 2(5). Disponível em: http://www. uronline.unifesp.br/uronline/ed1098/terapia.htm 2.

Almeida SHM, Derrose D, Freitas MA, Liboni M, Dinardi R, Moreira H. Marcadores em Câncer de bexiga - importância da expressão do p53 como indicador prognóstico. Braz J Urol. 2000;26:378-384.

3. Yoshiaki Y, Hideyasu M, Tomoko F, Atsunori O, Saturo Y, Masaru O, Higeto K, Kohsuke S, Katsusuke N. Centrossome hyper amplification predicts progression and tumor recurrence in bladder cancer. Clin Cancer Res. 2004;10(19): 6449-55. 4. Yamamoto Y, Matsuyama H, Kawauchi S, Furuya T, Liu XP, Ikemoto K, et al. Biological characteristics in bladder cancer depend on the type of genetic instability. Clin Cancer Res. 2006;12(19):2752-8.

einstein. 2011; 9(1 Pt 1):95-9

Einstein v9n1.indb 98

24.03.11 19:37:49


Molecular aspects of bladder cancer

5. van Tilborg AA, de Vries A, de Bont M, Groenfeld LE, van der Kwast TH,Zwarthoff EC. Molecular evolution of multiple recurrent cancers of the bladder. Hum Mol Genet. 2000;9(20):2973-80. 6. Hoque MO, Lee CC, Cairns P, Schoenberg M, Sidransky D. Genome-wide genetic characterization of bladder cancer: a comparison of high-density single-nucleotide polymorphism arrays and PCR-based microsatellite analysis. Cancer Res. 2003; 63(9):2216-22.

99

13. Hopman AH, Kamps MA, Speel EJ, Schapers RF, Sauter G, Ramaekers FC. Identification of chromosome 9 alterations and p53 accumulation in isolated carcinoma in situ of the urinary bladder versus carcinoma in situ associated with carcinoma . Am J Pathol. 2002;161(4):1119-25. 14. Cheng L, Gu J, Ulbright TM, MacLennan GT, Sweeney CJ, Zhang S, et al. Precise microdissection of humam bladder carcinomas reveals divergent tumor subclones in the same tumor. Cancer 2002;94(1):104-10.

7. Cafe LE, Arruda H. Novos marcadores no câncer de bexiga. Sinopse Urol. 1999;1(1): 3-4.

15. Matsuda H, Uejima S, Kurita T. [Microsatellite instability in renal cell carcinoma and bladder tumors]. Hinyokika Kiyo. 1996;42(1):27-31. Japanese

8. Fujimoto K, Yamada Y, Okajima E, Kakizoe T, Sasaki H, Sugimura T, Terada M. Frequent association of p53 gene mutation in invasive bladder cancer. Cancer Res. 1992;52(6):1393-8.

16. Catto JW, Meuth M, Hamdy FC. Genetic instability and transitional cell carcinoma of the bladder. BJU Int. 2004;93(1):19-24.

Hudson MA, Humphrey PA, Swanson PE, Wick MR, Vollmer RT. Use of p53, MIB-1, EGFR, c-erb B-2, bcl-2 as prognostic markers in bladder cancer patients. Proc Am Urol Assoc. 1996; 155(Suppl A): 615A.

17. Erill N, Colomer A, Verdú M, Román R, Condom E, Hannaoui N, Banús JM, Cordon-Cardo C, Puig X. Genetic and inmunophenotype analyses of TP53 in bladder cancer: TP53 alterations are associated with tumor progression. Diagn Mol Pathol. 2004;13(4):217-23.

10. Li M, Zhang ZF, Reuter VE, Cordon-Cardo C. Chromosome 3 allelic losses and micro satellite alterations in transitional cell carcinoma of the urinary bladder: Am J Pathol. 2006;149(1):229-35.

18. Figueiredo AJ, Coimbra HB, Sobral FT, Martins J, Linhares-Furtado AJ, Regateiro FJ. Genetic polymorphisms of genes GSTM1 and CYP2D6 and bladder cancer. Braz J Urol. 2000;l26(3): 250-5.

11. Halachmi S, Madeb R ,Kravtsov A, Moskovitz B, HalachmiN, Nativ O. Bladder cancer-genetic overview. Med Sci Monit. 2001;7(1):164-8.

19. Sen S, Zhou H, Zhang RD, Yoon DS, Vakar-Lopez F, Ito S, et al. Amplification/ overexpression of a mitotic kinase gene in human bladder cancer. J Natl Cancer Inst. 2002 94(17):1320-9.

9.

12. Turyn J,Matuszewski M,Schlichtholz B. Genomic instability analysis of urine sediment versus tumor tissue in transitional cell carcinoma of urinary bladder. Oncol Rep. 2006;15(1):259-65.

20. Li M, Zhang ZF, Reuter VE, Cordon-Cardo C. Chromosome 3 allelic losses and microsatellite alterations in transitional cell carcinoma of urinary bladder. Am J Pathol. 1996;149(1):229-35.

einstein. 2011; 9(1 Pt 1):95-9

Einstein v9n1.indb 99

24.03.11 19:37:49


LEARNING BY IMAGE

Low-energy femoral shaft fracture in elderly patient with prolonged use of alendronate Fraturas diafisárias do fêmur por baixa energia nos pacientes idosos com uso prolongado de alendronato José Ricardo Negreiros Vicente1, Daniel Seguel Rebolledo2, Marcos Camargo Leonhardt3, Mauricio Bernstein4

Figure 1. Stress fracture in the lateral córtex.

Study carried at Hospital Israelita Albert Einstein – HIAE, São Paulo (SP), Brasil. 1

Othopedic Oncology Group, Faculdade de Medicina, Universidade de São Paulo – USP, São Paulo (SP), Brazil.

2

Orthopedic Oncology Group, Faculdade de Medicina do ABC – FMABC, Santo André (SP), Brazil; Master’s degree student at the Department of Orthopedics and Trauma, Faculdade de Medicina, Universidade de São Paulo – USP, São Paulo (SP), Brazil.

3

Hip Group, Department of Orthopedics and Trauma, Faculdade de Medicina, Universidade de São Paulo – USP, São Paulo (SP), Brazil.

4

Department of Cardiopneumology, Faculdade de Medicina, Universidade de São Paulo – USP, São Paulo (SP), Brazil; Cardiologist at the Hospital Israelita Albert Einstein – HIAE, São Paulo (SP), Brazil. Corresponding author: José Ricardo Negreiros Vicente – Rua Afonso de Freitas, 488, apto. 22 - Paraíso – CEP 04006-052 – São Paulo (SP), Brasil – Tel.: 11 3884-0665 – e-mail: jrnegreiro@einstein.br Received on Jun 30, 2009 – Accepted on Apr 12, 2010 The authors declare there is no conflict of interest.

einstein. 2011; 9(1 Pt 1):100-1

Einstein v9n1.indb 100

24.03.11 19:37:50


Low-energy femoral shaft fracture in elderly patient with prolonged use of alendronate

Fractures in the proximal femur occur in female and male elderly population due to low-energy trauma in osteoporotic bones. In order to prevent these fractures, treatment of osteoporosis has been indicated, particularly using biphosphonates(1). Alendronate was the first drug approved by the Food and Drug Administration (FDA), in 1995, to treat osteoporosis(2). This drug acts in bone metabolism, inhibiting osteoclasts, inducing their apoptosis(3), raising the bone mineral density and reducing the incidence of osteoporotic fractures(4). In the past years, some authors described an unusual shaft femoral fracture in elderly women undergoing prolonged treatment of osteoporosis with biphosphonates. These fractures were associated with low-energy trauma or no evidence of any trauma event(5,6). Femoral structure submitted to physiological stress results in microdamages to bone microstructure. The inhibition of osteoclasts may also lead to severe suppression in bone turnover, leading to accumulation of microdamage(7-9). These processes may make bone brittle and cause unexpected and uncommon femoral fractures. A recent increase in the incidence of such fractures in patients on alendronate therapy led some authors to conduct a retrospective review of these cases. A characteristic fracture configuration suggestive of an insufficiency stress fracture was identified on plain radiographs. This consists of a cortical thickening in the lateral side of the subtrochanteric region, a transverse or short oblique fracture, and a medial cortical spike (Figure 1).

101

A retrospective study evaluating 19 patients with this fracture pattern among 70 patients with low-energy shaft fractures was 98% specific to alendronate users(6). Thus, alendronate treatment might be stopped for a while after five years to prevent severe suppression of bone turnover and subsequent stress fractures(7).

REFERENCES 1. Dinรงel E, Sepici-Dinรงel A, Sepici V, ร–zsoy H, Sepici B. Hip fracture risk and different gene polymorphisms in the Turkish population. Clinics. 2008;63(5): 645-50. 2. FDA- approved Drugs. USA Food and Drug Administration 1995 (date last accessed 1st February 2007). 3. Fleisch H, Reszka A, Rodan G, Rogers M. Bisphosphonates: mechanisms of action. In: Bilezikian JP. Principles of bone biology. 2nd ed. San Diego: Academic Press; 2002. Vol. 1. p. 1361-85. 4. Wells GA, Cranney A, Peterson J, Boucher M, Shea B, Robinson V, Coyle D et al. Alendronate for the primary and secondary prevention of osteoporotic fracture in postmenopausal women. Cochrane Database Syst Rev. 2008;(1):CD001155 5. Lenart BA, Lorich DG, Lane JM. Atypical fractures of the femoral diaphysis in postmenopausal women taking alendronate. N Engl J Med. 2008;358(12)1304-6. 6. Neviaser AS, Lane JM, Lenart BA, Edobor-Osula F, Lorich DG. Low-energy femoral shaft fractures associated with alendronate use. J Orthop Trauma. 2008;22(5):346-50. 7. Yamaguchi T, Sugimoto T. [New development in bisphosphonate treatment. When and how long should patients take bisphosphonates for osteoporosis?]. Clin Calcium. 2009;19(1):38-43. [Japanese]. 8. Goh SK, Yang KY, Koh JSB, Wong MK, Chua DT, Howe TS. Subtrochanteric insufficiency fractures in patients on alendronate therapy: A CAUTION. J Bone Joint Surg Br. 2007;89(3):349-53. 9. Visekruna M, Wilson D, McKiernan FE. Severely suppressed bone turn over and atypical skeletal fragility. J Clin Endocrinol Metab. 2008;93(8):2948-52.

einstein. 2011; 9(1 Pt 1):100-1

Einstein v9n1.indb 101

24.03.11 19:37:51


MEDICAL DEVELOPMENTS

Hearing rehabilitation through telemedicine to enhance public policies in Brazil Reabilitação auditiva por meio da Telemedicina para a melhoria das políticas públicas no Brasil Silvio Pires Penteado1, Ricardo Ferreira Bento2

ABSTRACT Since 2004, the Brazilian government has run one of the most allinclusive hearing rehabilitation program based on hearing aids worldwide. In 2007 this investment in hearing aids topped U$ 68 million, apart from covering the cost of physicians and audiologists. Nearly 140 centers are certified by the government to dispense fitted hearing aids, figures which are still low when one considers the size of the country. Telemedicine can represent a field of knowledge which broadens hearing rehabilitations services in Brazil, for it may help increase the number of hearing rehabilitation centers, enable remote training and provide for an “online second opinion”. As far as public administration is concerned, it may enable process standardization and the very control over this hugely complex operation. The present article aimed to consider Telemedicine a powerful ally to improve hearing health care policies in Brazil. Keywords: Telemedicine; Information technology; Public policies; Health economics; Diffusion of innovation; Quality assurance, health care; Rehabilitation of the hearing impaired; Hearing aids

RESUMO O governo brasileiro possui um dos mais abrangentes programas de reabilitação auditiva com base em próteses auditivas acústicas de todo o mundo, que foi iniciado em 2004. Em 2007, foi realizado um investimento social de cerca de R$ 146 milhões somente nessas próteses, além dos investimentos nos atendimentos médico e fonoaudiológico. São cerca de 140 centros credenciados pelo Sistema Único de Saúde – número que pode ser considerado modesto considerando as extensões territoriais do país. A Telemedicina pode emergir como área do conhecimento que amplia os serviços de reabilitação auditiva no Brasil, por permitir, entre outros, que seja aumentado o número de centros credenciados, além de disponibilizar treinamentos à distância e obter a segunda opinião formativa online. No âmbito da administração pública, pode permitir a padronização dos processos e o controle de toda essa complexa operação. Este

trabalho teve como objetivo inscrever a Telemedicina como poderoso aliado na melhoria das políticas públicas da saúde auditiva no Brasil. Descritores: Telemedicina; Tecnologia da informação; Políticas públicas; Economia da saúde; Difusão de inovações; Garantia da qualidade dos cuidados de saúde; Reabilitação de deficientes auditivos; Auxiliares de audição

In a review about Telemedicine, Bashshur et al.(1) stressed the first reports associated with the topic: in 1957, the transmission of radiographic images from the Dieu Hotel in Montreal; and in 1959, the use of closed circuit television to conduct therapy sessions between the Nebraska Psychiatric Institute and the Norfolk State Hospital, 180 km apart. DeBakey carried out an aortic valve exchange surgery in the Texas Methodist Hospital, being observed by his colleagues at the Geneva University Medical Faculty(2). The spread of medical sciences innovation together with progresses in engineering and information technology promoted the very foundations of Telemedicine. The United States Department of Health and Human Services(3) defines Telemedicine as “the use of telecommunications technology for medical diagnosis, monitoring and treatment when distance separates the users”. As far as its functions are concerned, Tohme et al.(4) reported that Telemedicine “must help patients and medical practitioners, even when located in remote regions, providing the possibility of having primary care or specialized care, with high quality and low costs”. Belardinelli et al.(5) noted that the goal of Telemedicine is to increase people’s access to a high quality medical care system, at reasonable prices” and “that Telemedicine Technologies may play an important

Study carried out at Department of Otorhinolaringology, Faculdade de Medicina, Universidade de São Paulo – USP, Sao Paulo (SP), Brazil. 1

Fundação Otorrinolaringologia – ORL, Sao Paulo (SP), Brazil.

2

Department of Otorhinolaringology, Faculdade de Medicina, Universidade de São Paulo – USP, Sao Paulo (SP), Brazil. Correspondence: Silvio Pires Penteado – Rua Dr Eneas Carvalho de Aguiar 255, sala 6.167 – Pinheiros – CEP 05403-000 – Sao Paulo (SP), Brazil – Tel.: 11 3068-9855 – E-mail: penteadosp@gmail.com Received: Jul 31, 2010 - Accepted: Feb 11, 2011

*Conflict of interest: none.

einstein. 2011; 9(1 Pt 1):102-4

Einstein v9n1.indb 102

24.03.11 19:37:51


role in the exchange of medical information between different departments and professionals”. The World Health Organization (WHO) described hearing loss as epidemics(6). Everyone with a hearing loss is a potential user of a hearing aid – an electronic device of selective sound amplification, designed to reduce the effects of hearing deprivation when drug treatment or surgery are not possible or indicated (7). An acoustic hearing aid, known as individual sound amplification device (ISAD), is capable of dealing even with severe sensorineural hearing losses(8). In October 2004, the Brazilian government established its national hearing rehabilitation program, through Ordinance 587, donating hearing aids to the population by means of its public healthcare system (SUS), with investments of up to US$68 million in 2007. There are about 140 centers registered at the SUS to serve the population. Despite being free of charge to the patients, there are still complaints, which cause low levels of satisfaction regarding the use of ISADs. Interested in this topic, researchers from the Department of Otorhinolaryngology of the Medical School of the Universidade de São Paulo (FMUSP) studied such phenomenon and plotted the results in Environment

Speech and hearing therapists

a cause-effect diagram (Ishikawa Diagram), and the main causes were broken down into: patient-related, speech-and-hearing-related, environment-related, process-related and ISAD/fitting-program related, as per depicted on figure 1. Among patient-related causes there were difficulties to commute to the clinic”. As to the causes associated with speech and hearing, it was found that there are many ISADs of “complex adjustments”, that “many ISADs require continuous training”, and also that “the professional seemed to be in a hurry when seeing the patient”. As far as the environment goes, amongst others, it was reported that “the certified clinics were very far away”. Among ISAD-related causes, it was reported that the fitting programs are complex and require constant training”. As to the process-related causes, the following were listed: “lack of an online technical support”, “lack of a training program”, “very few SUS-certified centers”, besides “non-standard procedures”, “non-computerized system” and that “there are no follow-ups concerning ISADs occurrences”, and others. Telemedicine can be seen as a policy for improvement, or even a solution, for the issues stressed in the previous paragraph. Pioneering work from our group provided ISAD remote training and fitting, between the cities

Patient Central processing difficulty

Low training level Distant certified clinics

Long-term privation

Many ISAD require continued training

Cognitive impairment Etiology of level/hearing loss

Reasonably adjusted to the patient

Road/railroad networks in poor conditions

Other associated diseases

Complex adjustment ISAD

Restrictions in auditory canal anatomy

Fast appointments

Few road/railroad networks

Resistance to use ISAD

Many patients to be seen

Low income to pay for post-warranty maintenance

ISAD reasonably adjusted to patients

Large territory country

Absence of performance rates

Demand for constant visits to the clinic

Few certified SUS centers Non-standardized procedures Non-automated system No follow-up of ISAD events

Lack of training plan Lack of online technical support

Processes

Difficult commuting to the clinic

Poor ISAD adjustments in SUS patients

Slow

Lack of specialized equipment

Lack of family support

Limited by definition Inappropriate resources Not well adjusted earmould/shell Incompatible with patient’s hearing loss Constant breaking Complex handling ISAD Many programming cables/many adjustment programs

Complex adjustment programs that require constant trainings High maintenance cost of ISAD

ISAD / Adjustment program

Figure 1. Cause and effect diagram to study the poor adjustments in hearing aids in patients seen by the SUS

einstein. 2011; 9(1 Pt 1):102-4

Einstein v9n1.indb 103

24.03.11 19:37:52


104

Penteado SP, Bento RF

of Sao Paulo (Specialized Unit) and Pouso Alegre and Campinas (Remote Units), which simplified program is depicted on figure 2. Ordinance no. 402 from the Brazilian Ministry of Health– February 2010, established the Brazilian Telehealth Program, organized in the form of Telemedicine, with the goals of quantifying and broadening treatment power and to strengthen family health strategies. The Federal Board of Speech and Hearing Therapy published the Resolution no. 366, in April 2009, which defined Telehealth as a legal practice in Speech and Hearing therapy, with the use of information technology (IT). Thus, a way to improve public health policies is seen associated with hearing rehabilitation, based on the principles of general knowledge, the existing technology, as well as the current legislation. With the implementation of Telemedicine, more centers can be certified, thus increasing patient access to SUS centers closer to their homes, being more comfortable. The complaints stated that continuous training is needed may be solved through teleconference training, or even when a second opinion is needed. Except for these technical issues, it must be stressed the importance of health economics and organization, because when Telemedicine is employed in auditory health rehabilitation, it is possible to manage all the qualified centers together, in such a way as to systematically encompass all its events. Wesendahl(9) used technology resources from the year 2003 to describe fittings and fine tuning of ISADs, and stressed that “Telemedicine helps a highly experienced speech and hearing therapist to be “present” in remote areas without time and geographic restrictions”. As results from pioneering studies, the researchers concluded that by using Internet resources, the speech

and hearing therapists from the Remote Unit could receive training from the Specialized Unit in regards of the characteristics of a new ISAD and its fitting program. The Specialized Unit presented and discussed the electroacoustic resources and characteristics of this ISAD at the Remote Unit. The patients interacted with the speech and hearing therapists from both units and approved the remote fitting, stressing the good subjective quality of the ISAD they tried.

ACKNOWLEDGEMENTS Research support source: Fundação Otorrinolaringologia – ORL, Sao Paulo (SP), Brazil. REFERENCES 1. Bashshur RL, Reardon TG, Shannon GW. Telemedicine: a new health care delivery system. Annu Rev Public Health. 2000;21:613-37. 2. DeBakey ME. Telemedicine has now come of age. Telemed J. 1995;1(1):3-4. 3. U.S. Department of Health and Human Services. Telemedicine for the Medicare Population: Evidence Report/Technology Assessment Number 24. July 2001. 4. Tohme WG, Hayes WS, Mun SK, Komo D, Meissner MC. Designing a telemedicine platform for three different medical applications. Proceedings of 4th International Conference on Image Management and Communication (IMAC’s 95),1995:86. 5. Belardinelli A, Franchi D, Bedini R, Ripoli A, Palagi G. Ward informative system: hospital application of telemedicine. Computers in Cardiology.1999;26: 413-6. 6. World Health Organization. Situation review and update on deafness, hearing loss and intervention programmes: proposed plans of actions for prevention and alleviation of hearing impairment in countries of the South-East Asia Region. SEA-Deafness-10;Dec. 2007. 7. World Health Organization. Deafness and hearing impairment survey: Report of the consultative meeting of principal investigators. SEA-Deaf-4; 2001. 8. Bento RF, Miniti A, Marone SAM. Tratado de otologia. São Paulo: EDUSP; 1998. 9. Wesendahl T. Hearing aid fitting: application of Telemedicine in Audiology. Int Tinnitus J. 2003;9(1):56-8.

Site A

Site B

Video camera

Internet

Video camera ISAD

Speech and hearing therapist Specialized Unit (SU)

Microphone

Speech and hearing therapist Remote Unit (RU)

Patient

Microphone

Figure 2. Simplified diagram of a Telemedicine session on hearing rehabilitation

einstein. 2011; 9(1 Pt 1):102-4

Einstein v9n1.indb 104

24.03.11 19:37:53


105

AGENDA

Congressos – Fóruns – Simpósios – Cursos – Feiras – Exposições Hospital Israelita Albert Einstein VIII Simpósio de Fisioterapia em Terapia Intensiva – Envio de Pôster + Inscrição 20 a 22 de maio de 2010

Organização: Centro de Educação em Saúde Abram Szajman do Instituto Israelita de Ensino e Pesquisa Albert Einstein Local: Auditório Moise Safra Av. Albert Einstein, 627 1º Andar - Bloco A, Morumbi, São Paulo, SP Público Alvo: FISIOTERAPEUTAS E GRADUANDOS Comissão Científica: Celso Bella Júnior, Cilene Saghabi ,Corinne Taniguchi, Fernanda Domingues, José Aparecido de Souza Junior Karina Tavares Timenetsky, Leny Vieira Cavalheiro, Mary Kiomi Nagano, Pedro Veríssimo da F. Neto, Raquel Afonso Caserta, Informações: (11) 2151.1233 Ramal 73450- http://ensino.einstein.br/ portal

2011_CSR_Segurança do Paciente no Centro de Simulação Realística Albert Einstein 02 de maio de 2011

Organização: Instituto Israelita de Ensino e Pesquisa - Centro de Simulação Realística Albert Einstein Local: Centro de Simulação Realística Albert Einstein, Avenida Albert Einstein, 627 1º SS Bloco A Morumbi - São Paulo – SP Público-alvo: enfermeiros Informações: (11) 2151 4501- http://ensino.einstein.br/portal

Pacote: Curso Pré Simpósio + VIII Simpósio de Fisioterapia em Terapia Intensiva 19 a 22 de maio de 2011

Organização: Centro de Educação em Saúde Abram Szajman do Instituto Israelita de Ensino e Pesquisa Albert Einstein Local: Auditório Moise Safra Av. Albert Einstein, 627 1º Andar - Bloco A, Morumbi, São Paulo, SP Público-alvo: FISIOTERAPEUTAS Comissão Científica: Celso Bella Júnior, Cilene Saghabi, Corinne Taniguchi, Fernanda Domingues, José Aparecidode Souza Junior, Karina Tavares Timenetsky, Leny Vieira Cavalheiro, Mary Kiomi Nagano, Pedro Veríssimo da F. Neto, Raquel Afonso Caserta Informações: (11) 2151.1001 Opção 1- http://ensino.einstein.br/portal

VIII Curso de Capacitação em Cateter Central de Inserção Periférica (PICC) Adulto e Pediátrico – 2011 27 a 29 de maio de 2011

Organização: Instituto Israelita de Ensino e Pesquisa - Treinamento em Saúde Centro de Educação em Saúde Abram Szajman Local: CESAS - 1°SS Bloco A e Centro de Simulação Realistica - 1°SS Bloco A ,Av. Albert Einstein, 627 1º Andar - Bloco A, Morumbi, São Paulo, SP Público-alvo: Enfermeiros que possuam Coren e vivência teórica e/ ou prática na área de acessos vasculares. Informações: (11) 2151.1233 Ramal 73450 http://ensino.einstein.br/ portal

2011_CSR_Competências Comportamentais Assistenciais no Centro de Simulação Realística Albert Einstein 13 de junho de 2011

Organização: Instituto Israelita de Ensino e Pesquisa - Centro de Simulação Realística Albert Einstein Local: Centro de Simulação Realística Albert Einstein, Avenida Albert Einstein, 627 1º SS Bloco A Morumbi - São Paulo – SP Público-alvo: Enfermeiros, Fisioterapeutas, Nutricionistas, Fonoaudiólogos, Farmacêuticos, Psicólogos, Terapeutas Ocupacionais, Biomédicos e Analistas em Neurociência Informações: (11) 2151 4501 - http://ensino.einstein.br/portal

Curso Pré- Simpósio: Educação e Treinamento em Via Aérea Difícil 21 de junho de 2011

Organização: Centro de Educação em Saúde Abram Szajman do Instituto Israelita de Ensino e Pesquisa Albert Einstein Local: IIEP - Instituto Israelita de Ensino e Pesquisa, Av. Albert Einstein, 627 - 1º SS - Piso Chinuch, Morumbi - São Paulo – SP Público-alvo: Médicos e Profissionais da Saúde Comissão Científica: Dr. Luiz Francisco Poli de Figueiredo, Dr. Ruy Guilherme Rodrigues Cal Informações: (11) 2151.1233 Ramal 73450 - http://ensino.einstein.br/portal

einstein. 2011;9(1 Pt 1):105

Einstein v9n1.indb 105

24.03.11 19:37:54


106

AGENDA

Curso Pré-simpósio: Severe Sepsis and Septic Shock: From the Emergency Room to the Intensive Care Unit - The Leading Global Killer of Children 21 de junho de 2011

Organização: Centro de Educação em Saúde Abram Szajman do Instituto Israelita de Ensino e Pesquisa Albert Einstein Local: IIEP - Instituto Israelita de Ensino e Pesquisa, Av. Albert Einstein, 627 - 1º SS - Salas do CESAS, Morumbi - São Paulo – SP Público-alvo: Pediatras Comissão científica: Dr. Eduardo Juan Troster Informações: (11) 2151.1233 Ramal 53450 - http://ensino.einstein.br/portal

Curso Pré-Simpósio: Doppler-Echocardiography in Intensive Care Medicine 21 de junho de 2011

Organização: Centro de Educação em Saúde Abram Szajman, do Instituto Israelita de Ensino e Pesquisa Albert Einstein Local: IIEP - Instituto Israelita de Ensino e Pesquisa, Av. Albert Einstein, 627 - 1º SS - Bloco A, Morumbi - São Paulo – SP Público-alvo: Médicos e Profissionais da Saúde Comissão científica: Dr. Danilo Teixeira Noritomi, Dr. Daniel De Backer, Dr. Haggeas da Silveira Fernandes Informações: (11) 2151.1233 Ramal 53450 - http://ensino.einstein.br/portal

Pacote: Workshop de Ventilação Mecânica + 6th International Symposium on Intensive Care and Emergency Medicine For Latin America 22 a 25 de junho de 2011

Organização: Centro de Terapia Intensiva – Adultos, Centro de Educação em Saúde Abram Szajman do Instituto Israelita de Ensino e Pesquisa Albert Einstein, São Paulo – Brasil, Departamento de Terapia Intensiva do Hospital Erasme da Universidade Livre de Bruxelas Bélgica Local: Hotel Transamérica, Av. das Nações Unidas, 18.591, São Paulo - SP – Brasil Público-alvo: Médicos e Profissionais da Saúde Comissões científica e organizadora: Dr. Eliézer Silva, Dr. Antonio Capone Neto – Brazil, Dra. Carmem Silvia Valente Barbas – Brazil, Dr. Daniel de Backer – Belgium, Dr. Edward Abraham – USA, Dr. Eliézer Silva – Brazil, Dr. Homero Bagnulo – Brazil, Dr. Luis Fernando Aranha Camargo – Brazil, Dr. Luiz Francisco Poli de Figueiredo – Brazil, Dr. Marcos Knobel – Brazil, Dr. Michael Pinsky – USA, Dr. Oscar Fernando Pavão dos Santos – Brazil, Dr. Rui Moreno – Portugal, Dr. Antônio Capone Neto , Dr. Bruno Franco Mazza, Dr. Eliézer Silva, Dr. Haggeas da Silveira Fernandes, Dr. Luiz Francisco Poli de Figueiredo, Dr. Marcelo Katz , Dr. Murillo Santucci Cesar de Assunção, Dr. Oscar Fernando Pavão dos Santos Setor de Eventos Científicos - IIEP Informações: (11) 2151.1233 Ramal 73450 http://ensino.einstein.br/portal

6th International Symposium on Intensive Care and Emergency Medicine for Latin America 22 a 25 de junho de 2011

Organização: Centro de Terapia Intensiva – Adultos, Centro de Educação em Saúde Abram Szajman do Instituto Israelita de Ensino e Pesquisa Albert Einstein, São Paulo – Brasil, Departamento de Terapia Intensiva do Hospital Erasme da Universidade Livre de Bruxelas Bélgica Local: Hotel Transamérica, Av. das Nações Unidas, 18.591, São Paulo SP – Brasil Público-alvo: Médicos intensivistas, enfermeiros, fisioterapeutas e profissionais relacionados à área da saúde, incluindo formadores de opinião, líderes universitários e de instituições privadas, do Brasil e da América Latina. Comissões científicas e Organizadora: Dr. Eliézer Silva, Dr. Antonio Capone Neto – Brazil, Dra. Carmem Silvia Valente Barbas – Brazil, Dr. Daniel de Backer – Belgium, Dr. Edward Abraham – USA, Dr. Eliézer Silva – Brazil, Dr. Homero Bagnulo – Brazil, Dr. Luis Fernando Aranha Camargo – Brazil, Dr. Luiz Francisco Poli de Figueiredo – Brazil, Dr. Marcos Knobel – Brazil, Dr. Michael Pinsky – USA, Dr. Oscar Fernando Pavão dos Santos – Brazil, Dr. Rui Moreno – Portugal, Dr. Antônio Capone Neto , Dr. Bruno Franco Mazza, Dr. Eliézer Silva ,Dr. Haggeas da Silveira Fernandes, Dr. Luiz Francisco Poli de Figueiredo, Dr. Marcelo Katz, Dr. Murillo Santucci Cesar de Assunção, Dr. Oscar Fernando Pavão dos Santos Setor de Eventos Científicos - IIEP Informações: (11) 2151.1233 Ramal 73450 http://ensino.einstein.br/ portal

V Board Review - Curso de Revisão em Hematologia e Hemoterapia - V Simpósio de Transplante de Medula Óssea - I Simpósio de Neoplasias Mieloides 23 a 25 de junho de 2011

Organização: Centro de Educação em Saúde Abram Szajman do Instituto Israelita de Ensino e Pesquisa Albert Einstein Local: Hospital Israelita Albert Einstein, Auditório Moise Safra, Av. Albert Einstein, 627 1º Andar - Bloco A - Estacionamento I 1º Andar Bloco A - Estacionamento I Morumbi SÃO PAULO SP Público-alvo: Médicos e Profissionais da Saúde Comissão Científica: Andréa Tiemi Kondo, Andreza Alice Feitosa Ribeiro, Araci Massami Sakashita, Elvira Deolinda R. P. Velloso Fabio Pires de Souza Santos, Jacques Tabacof, Jairo José do Nascimento Sobrinho, José Mauro Kutner, Leonardo Raul Morelli, Marcos de Lima, Nelson Hamerschlak, Vicente Odone Filho Informações: (11) 2151.1001 opção 1 - http://ensino.einstein.br/portal

2011_CSR_Assistência de Enfermagem no Centro de Simulação Realística Albert Einstein* 8 de julho de 2011

Organização: Instituto Israelita de Ensino e Pesquisa - Centro de Simulação Realística Albert Einstein Local: Centro de Simulação Realística Albert Einstein, Avenida Albert Einstein, 627 1º SS Bloco A, Morumbi - São Paulo – SP Público-alvo: Enfermeiros e Técnicos de Enfermagem Informações: (11) 21514501 - http://ensino.einstein.br/portal

einstein. 2011;9(1 Pt 1):106

Einstein v9n1.indb 106

24.03.11 19:37:55


107

AGENDA

Congressos – Fóruns – Simpósios – Cursos – Feiras – Exposições Nacionais IV Jornada Sudeste de Dermatologia 29 a 30 de abril de 2011

Local: Hotel Atlântico Búzios Convention e Resort Cidade: Búzios – RJ Coordenação: Dra. Maria Alice Gabay

IX Jornada de Obstetrícia e Ginecologia de Vale do Paraíba 02 a 04 de junho de 2011

Local: Orotour Garden Hotel Cidade: Campos do Jordão Coordenação: Dr. Lauro Mascarenhas

V Jornada de Obstetrícia e Ginecologia da SOGESP – Regional São José do Rio Preto 16 a 18 de junho de 2011

Local: Sociedade de Medicina e Cirurgia de São José do Rio Preto Cidade: São José do Rio Preto Coordenação: Dra. Regina Bedone e Dr. Edilberto Araújo Filho

3º Forúm Internacional do Câncer do Reto - FICARE 2011 17 a 19 de novembro de 2011

Local: Centro de Convenções do Sheraton WTC Hotel Cidade: São Paulo - SP Telefone: (11) 3889-0515 Fax: (11) 3884-8845 E-mail: info@ficare.com.br Página da web: www.ficare.com.br

einstein. 2011;9(1 Pt 1):107

Einstein v9n1.indb 107

24.03.11 19:37:55


108

AGENDA

Congressos – Fóruns – Simpósios – Cursos – Feiras – Exposições Internacionais FAMILY MEDICINE GENERAL MEDICINE OTHER SPECIALTIES

Joint Eans Annual Meeting 4th World ICH Conference 2011 May 02, 2011 May 05, 2011

Orthpaedics and Sports Medicine for Primary Care Practitioners Bermuda CruiseMay 01, 2011- May 08, 2011

New York - New York Contact: Continuing Education, Inc. Phone: 800-422-0711/727-526-1571 Fax: 727-522-8304 Email: contactus@continuingeducation.net Website: http://www.continuingeducation.net/coursedetails. php?program_number=832

Canadian Refugee Health Conference June 01, 2011 June 03, 2011

Ontario – Toronto Contact: , Office of Continuing Medical and Professional Development , University of Toronto Phone: 416-978-2719 / 888-512-8173 Email: info-int1133@cepdtoronto.ca Website: http://crh.cepdtoronto.ca/

1ST Asia Pacific Congress on Controversies to Consensus in Diabetes Obesity and Hipertension June 02, 2011 June 05, 2011

China - Shanghai Contact: Comtec International Medical Congresses , Conference Organisers Phone: 011-972-3-566-6166 Fax: 011-972-3-566-6177 Email: Info@comtecmed.com Website: http://www.comtecmed.com/

NEUROLOGY Annual Interdisciplinary Brain Injury Course- The continuum of Care in Brain Injury Rehabilitation May 02 ,2011 May 03 ,2011

United Kingdom - Newcastle Upon Tyne Contact: Secretariat , EANS , Kenes International Phone: 011-41-22-908-0488 ext. 592 Fax: 011-41-22-906-9140 Email: eans@kenes.com Website: http://www.kenes.com/eans-ich

53RD Annual Scientific Meeting of the American Headache Society June 02, 2011 June 05, 2011

District of Columbia – Washington Contact: , American Headache Society Phone: 856-423-0043 Fax: 856-423-0082 Email: ahshq@talley.com Website: http://www.americanheadachesociety.org/

ANESTHESIOLOGY Clinical Anesthesia UPDATE May 02, 2011 May 05, 2011

California - San Francisco Contact: , Northwest Anesthesia Seminars, Inc. Phone: 800-222-6927 - Outside U.S. 509-547-7065 Email: info@nwas.com Website: http://www.nwas.com/1sch.html

2011 Annual Meeting the European Cardiothoracic Anaesthesiologists (EACTA) June 01, 2011 June 04, 2011

Austria - Vienna Contact: Jean Evans , Conference Director , Mci Dublin, 1 Clarinda Park, Dun Laoghaire, Co. Dublin Phone: 011-353-1-280-2641 Email: david.mcmahon@mci-group.com Website: http://www.eacta.org/page-11-03-00.shtml

Illinois - Chicago Contact: Feinberg School of Medicine, Northwestern University Phone: 312-238-4251 Fax: 312-503-4531 Email: nums-cme@northwestern.edu Website: http://www.cme.northwestern.edu/conferences

einstein. 2011;9(1 Pt 1):108

Einstein v9n1.indb 108

24.03.11 19:37:56


109

AGENDA

MEDICINA INTERNA

XXXII Portuguese Congress of Cardiology April 08, 2011 April 10, 2011

Controversies in Internal Medicine May 02, 2011 May 06, 2011

South Carolina- Hilton Head Island Contact: Claire Grimble , Conference Manager , Boston University Continuing Medical Education Department Phone: 617-638-4605 Fax: 617-638-4905 Email: cme@bu.edu Website: http://www.bumc.bu.edu/cme/educational-opportunities/livemeetings/conhh11/

GERIATRICS Care of the Erderly: Petspectives for Primary Care June 01, 2011

Ontario - Hamilton Contact: Angela Silla , Event Coordinator , McMaster University Phone: 905-525-9140 ext. 26327 Fax: 905-572-7099 Email: silla@mcmaster.ca Website: http://www.fhs.mcmaster.ca/conted/documents/ MYKCareofElderly2011.pdf

Local: Centro de Congressos de Lisboa (antiga FIL) - Lisboa – Portugal Fax: (+351) 217 931 095 E-mail: congresso@spc.pt

XXIII Peruvian Congress of Cardiology April 27, 2011 April 30, 2011

Local: Lima- Peru Phone: 441-5932 or 421-6999 Fax: 440-5395 E-mail: peru@sopecard.org

ONCOLOGY XXXV Congress of the Spanish Society of Immunology Clinic and Pediatric Allergy May 05, 2011 May 07, 2011

Granada - Espanha Phone: 34 963 107 189 Fax: 34 963 411 046 E-mail: seicap2011@viajeseci.es

TRANSPLANT SURGERY RADIOLOGY/ IMAGING American Transplant Congress 2011 Canadian Association of Medical Radiation Technologists 69TH Annual General Conference June 02, 2011 June 05, 2011

Saskatchewan - Saskatoon Contact: Lise Hodgson , Manager, Conference and Events , CAMRT Phone: 800-463-9729 ext. 235 Website: http://www.camrt.ca/english/pro_dev/agc2011.asp

April 30, 2011 May 04, 2011

Filadelfia - EUA Phone: 856-439-0880 Fax: (856)439-0525

CARDIOLOGY International Academy of Cardiology- 16th World Congress on Heart July 23, 2011 July,2011

Vancouver – Canadá Phone: 1 310 657 8777 Fax: 1 310 659 4781 E-mail: Klimedco@ucla.edu

ACC 11 - Annual Scientific Session April 02, 2011 April 05, 2011

Local: Estados Unidos - New Orleans Phone: (202) 375-6000 or (800) 253-4636 E-mail: resource@acc.org

einstein. 2011;9(1 Pt 1):109

Einstein v9n1.indb 109

24.03.11 19:37:57


110

INSTRUÇÕES AOS AUTORES

einstein Publicação Oficial de Divulgação Científica do Instituto Israelita de Ensino e Pesquisa Albert Einstein, ISSN 1679-4508, é publicada trimestralmente com o objetivo de registrar a produção científica e contribuições da comunidade científica na área de Saúde. São aceitos trabalhos originais, em português e/ou inglês. Todos os trabalhos, após aprovação dos Editores, serão encaminhados para análise e avaliação de dois revisores, sendo o anonimato garantido em todo o processo de julgamento Os comentários serão devolvidos aos autores para modificações no texto ou justificativas de sua conservação. Somente após aprovações finais dos revisores e editores os trabalhos serão encaminhados para publicação. A responsabilidade pelos conceitos emitidos nos artigos é exclusiva dos autores. A revista einstein possui as seguintes seções: Artigos Originais, Relato de Caso, Revisão, Revendo Ciências Básicas, Aprendendo por Imagem e Avanços Médicos, Cartas ao Editor e Agenda.

ARTIGOS ORIGINAIS

APRENDENDO POR IMAGEM

Destinada à divulgação de resultados da pesquisa científica. Os trabalhos devem ser originais e inéditos e sua estrutura deverá conter os seguintes itens: Resumo, Introdução, Métodos, Resultados, Discussão, Conclusão e Referências e Abstract. Deverá ter no máximo 3000 palavras e até 30 referências.

Uma imagem patognomônica, típica, de US, CT, RX, RNM, foto de cirurgia, microscopia, sinal clínico, etc, seguida de um texto curto, explicativo, de no máximo 300 palavras e dez referências.

GESTÃO E ECONOMIA DA SAÚDE Artigos destinados à divulgação de conhecimento que expressem conceitos e reflita as práticas vigentes em gerenciamento, administração e economia em Saúde. Deverá ter no máximo 3000 palavras e até 30 referências.

RELATO DE CASO Relata casos de uma determinada situação médica, especialmente rara, descrevendo seus aspectos, história, condutas, etc, incluindo breve revisão da literatura, descrição do caso e discussão pertinente. Deverá ter no máximo 1000 palavras e até dez referências.

REVISÃO Artigos de revisão, incluindo avaliação crítica e sistematizada da literatura sobre determinado assunto, devendo descrever os procedimentos adotados, a delimitação e os limites do tema, apresentar conclusões e referências. O texto deverá ter no máximo 2500 palavras e até 40 referências.

REVENDO CIÊNCIAS BÁSICAS Artigos de revisão sobre temas de ciência básica cujo conhecimento tem repercussão clínica relevante. Deverá ter no máximo 2000 palavras e 30 referências.

AVANÇOS MÉDICOS Destinada à publicação, nas diferentes áreas, de novidades diagnósticas e/ou terapêuticas de aplicação corrente. Discutem-se progressos já incorporados. O texto é livre e deverá conter no máximo 1000 palavras e dez referências.

CARTAS AO EDITOR Tem por objetivo comentar ou discutir trabalhos publicados na revista ou relatar pesquisas originais em andamento, achados científicos, etc. Com no máximo 150 palavras e cinco referências. As normas que se seguem devem ser obedecidas para todos os tipos de trabalhos e foram baseadas no formato proposto pelo International Committee of Medical Journal Editors e publicado no artigo: Uniform requirements for manuscripts submitted to biomedical journals. Ann Intern Med 1997;126:36-47, e atualizado em fevereiro de 2006. Disponível no endereço eletrônico: http://www.icmje.org

Requisitos técnicos Os autores devem enviar os artigos: a) online para einstein pelo endereço http://www.einstein. br/revista ou cópia do artigo em CD para o endereço: Instituto Israelita de Ensino e Pesquisa Biblioteca Lieselotte Adler Z ‘L Avenida Albert Einstein, 627/701 – Piso Chinuch – 2º Subsolo – Morumbi – CEP 05651-901 – São Paulo – SP;

einstein. 2011;9(1 Pt 1):110

Einstein v9n1.indb 110

24.03.11 19:37:57


111

b) permissão para reprodução do material e carta de transferência dos direitos autorais para a einstein; c) declaração dos autores de que o manuscrito não foi nem será submetido a publicação em outro periódico, contendo assinatura de todos os autores; d) aprovação do Comitê de Ética da Instituição onde foi realizado o trabalho e Termo de Consentimento Livre Informado, quando referente a artigos de pesquisa envolvendo seres humanos. Após as correções sugeridas pelos revisores, a forma definitiva do trabalho deverá ser re-encaminhada para a Revista einstein através do Sistema Gerenciador da Revista, www. einstein.br/. Os originais não serão devolvidos. Somente o Editor da einstein poderá autorizar a reprodução em outro periódico, dos artigos nela contidos.

Agradecimentos: inclui colaborações de pessoas que merecem reconhecimento mas que não justificam sua inclusão como autor; agradecimentos por apoio financeiro, auxílio técnico, etc. Deve ser apresentado em página separada, em seguida ao texto. Referências: devem ser numeradas consecutivamente, na mesma ordem que foram citadas no texto e identificadas com números arábicos. A apresentação deverá estar baseada no formato denominado “Vancouver Style”, conforme exemplos abaixo, e os títulos de periódicos deverão ser abreviados de acordo com o estilo apresentado pela List of Journal Indexed in Index Medicus, da National Library of Medicine e disponibilizados no endereço: http://www. ncbi.nlm.nih.gov/entrez/journals loftext_noprov.html

Para todas as referências, citar todos os autores até seis. Acima de seis, citar os seis primeiros, seguidos da expressão et al., conforme os seguintes modelos.

PREPARO DO MANUSCRITO Página de identificação: deve conter: a) título do artigo, em português e inglês, que deverá ser conciso, porém informativo; b) título abreviado com 40 palavras; c) nome completo de cada autor, com o seu grau acadêmico e afiliação institucional. Se houver mais de uma, indicar em seqüência; d) nome do Departamento e Instituição aos quais o trabalho deve ser atribuído; e) nome, endereço, fax e e-mail do autor responsável e a quem deve ser encaminhada correspondência, f) fontes de auxílio à pesquisa, se houver. g) declaração de inexistência de conflitos de interesse de cada autor. Segunda página: Deve conter: a) Resumo e descritores: resumo, em português e inglês, de não mais que 250 palavras. Para os artigos originais, deverá ser estruturado (Objetivo, Métodos, Resultados, Conclusões), contendo resumidamente as principais partes do trabalho ressaltando os dados mais significativos. Para Relato de Caso, Revisões e Avanços Médicos, o resumo não deverá ser estruturado. Abaixo do resumo, especificar no mínimo cinco e no máximo dez descritores (keywords) que definam o assunto do trabalho. Os descritores deverão ser baseados no DeCS (Descritores em Ciências da Saúde) publicado pela Bireme, que é uma tradução do MeSH (Medical Subject Headings) da National Library of Medicine e disponível no endereço eletrônico: http://www.decs.bvs.br Abaixo do Resumo, indicar, para os Ensaios Clínicos, o número de registro na base de Ensaios Clínicos (http:// clinicatrials.gov)* Terceira página: Deve conter: • Texto: deverá obedecer aestrutura exigida para cada categoria de artigo. Em todas as categorias de artigos, a citação dos autores no texto deverá ser numérica e seqüencial, utilizando algarismos arábicos entre parênteses e sobrescritos.

ARTIGOS DE PERIÓDICOS IMPRESSOS Tobo PR, Barbosa AS, Barbosa LG, Spinola-Castro AM, Moreira-Filho CA. Three novel mutations in the androgen receptor gene associated with partial androgen insensitivity syndrome: H570R, G589E and S759T. einstein. 2003;1(1):1-3.

ARTIGOS DE PERIÓDICOS ELETRÔNICOS Babcoc HM, Fraser V. Clinical experience with linezolid: A case series of 53 patients. Infect Dis Clin Pract [Internet]. 2003 [cited 2003 Feb 18];11(4):[about 20 p.]. Avaliable from: http://gateway2.ovid.com/ovidweb.cgi

LIVROS Ratnoff OD, Forbes Ch D. Disorders of hemostasis. 3rd ed. Philadelphia: Saunders; 1996.

CAPÍTULO DE LIVROS Marcus AJ. Platelets and their disorders. In: Ratnoff OD, Forbes Ch D. Disorders of hemostasis. 3rd ed. Philadelphia: Saunders; 1996. p. 79-137.

TRABALHOS APRESENTADOS EM CONGRESSOS Mioni G, Vallone C, Franzon R, Messa P. Hypercloremic acidosis and base balanced in renal transplant [abstract]. Kidney Int. 1993;44(6):1397. [Presented at 34º. Congress of the Italian Society of Nephrology; 1993 May 18-22; Pisa, Italy].

TESES Ramos MLT. Avaliação das análises ergonômicas em home care para idoso publicadas na literatura médica de 1980 a 2001 [tese]. São Paulo:Universidade de São Paulo; 2001.

einstein. 2011;9(1 Pt 1):111

Einstein v9n1.indb 111

24.03.11 19:37:58


112

respondendo a cada ilustração e na ordem em que foram citadas no trabalho.

IMAGENS •

Tabelas: imprimir cada tabela (máximo quatro) em folha separada, com espaço duplo. A numeração deve ser seqüencial, em algarismos arábicos, na ordem que foram citadas no texto. Todas as tabelas deverão ter título e cabeçalho para todas as colunas. No rodapé da tabela deve constar legenda para abreviaturas e testes estatísticos utilizados. Figuras (gráficos, fotografias, ilustrações): as figuras devem ser apresentadas conforme citadas no trabalho (máximo de 4). Quando gravadas em arquivos digitais, deverão estar no formato JPG ou TIF, com 300dpi de resolução.

Se as ilustrações já tiverem sido publicadas, deverão vir acompanhadas de autorização por escrito do autor/editor e constando, na legenda da ilustração, a fonte onde foi publicada. •

Legendas: imprimir as legendas para as ilustrações usando espaço duplo, uma em cada página separada. Cada legenda deve ser numerada em algarismos arábicos, cor-

Abreviaturas e siglas: devem ser precedidas do nome completo quando citadas pela primeira vez no texto. Nas legendas das tabelas e figuras devem ser acompanhadas de seu significado. Não devem ser usadas no título e no resumo.

ENVIO DO MANUSCRITO Os documentos deverão ser enviados online para http://www. einstein.br/revista ou cópia do artigo em CD para o endereço: Instituto Israelita de Ensino e Pesquisa Biblioteca Lieselotte Adler Z ‘L Avenida Albert Einstein, 627/701 – Piso Chinuch – 2º Subsolo – Morumbi – CEP 05651-901 – São Paulo – SP Submissão online Os artigos também podem ser enviados online para a revista einstein pelo endereço: http://www.einstein.br/revista

* Nota importante: “A einstein em apoio às políticas para registro de ensaios clínicos da Organização Mundial de Saúde (OMS) e do International Commitee of Medical Journal Editors (ICMJE), reconhecendo a importância dessas iniciativas para o registro e divulgação internacional de informação sobre estudos clínicos, em acesso somente aceitará para publicação, a partir de agosto de 2007, os artigos de pesquisas clínicas que tenham recebido um número de identificação em um dos Registros de Ensaios Clínicos validados pelos critérios estabelecidos pela OMS e ICMJE, disponíveis no endereço: http://clinicatrials.gov ou no site do Pubmed, no item <clinicatrials.gov>. O número de identificação deverá ser registrado ao final do resumo.

einstein. 2011;9(1 Pt 1):112

Einstein v9n1.indb 112

24.03.11 19:37:58


113

LISTA DE ITENS PARA CONFERÊNCIA DE ARTIGOS

1. Leia atentamente as “Instruções aos autores” antes de responder a esta lista. 2. ANEXE ao artigo original e, posteriormente, à versão revisada.

Nome completo do autor que recebe a correspondência: Data de envio do artigo: Telefone: Fax/e-mail: Página de rosto: Título completo do trabalho em inglês e português Nome completo dos autores, seguido das credenciais e da instituição onde foi realizado o trabalho Endereço completo, telefone, fax, e-mail do autor que recebe as correspondências

Corpo do artigo Resumo em português e inglês e sem apresentar abreviaturas Descritores em português e inglês Tabelas, figuras numeradas em algarismos arábicos Abreviaturas das tabelas explicadas em legenda Fonte de origem das tabelas e figuras quando não pertencem ao autor O texto apresenta as divisões principais, conforme a categoria a que pertence No texto, termos abreviados estão escritos por extenso na primeira vez que são citados Os pacientes estão identificados por iniciais ou números

Referências As referências estão em página separada Estão todas citadas no texto e em números arábicos Estão formatadas conforme os exemplos das “Instruções aos autores” Os nomes de todos os autores estão listados nas referências. Quando há mais de seis, os seis primeiros estão listados seguidos da expressão et al.

Formato e apresentação geral O texto está digitado em folha A4 com espaço duplo fonte 12, margem de 2,5 cm de cada lado Cada seção inicia em nova página conforme seqüência estabelecida nas Instruções Inclui permissão para reprodução dos materiais Inclui aprovação do Comitê de Ética, quando necessário Inclui nome de agências financiadoras, se for o caso As três cópias estão sendo enviadas Esta lista foi preenchida, assinada por todos os autores e anexada ao trabalho

einstein. 2011;9(1 Pt 1):113

Einstein v9n1.indb 113

24.03.11 19:37:59


114

INSTRUCTIONS TO AUTHORS

einstein einstein is the official scientific journal published trimonthly by the Instituto Israelita de Ensino e Pesquisa Albert Einstein, ISSN 1679-4508. It aims at recording scientific production and contributions by the healthcare community. Original papers may be submitted in English and/or Portuguese. After approval by the Editors, the papers are sent to two reviewers for analysis and assessment, and anonymity is assured during the entire judging process. The comments are sent to the authors so that they may modify the text or give reasons for not altering it. The papers are sent for publication only after final approval by reviewers and editors. The authors are solely responsible for the concepts provided in the articles. The journal einstein has the following sections: Original Articles, Case Report, Review, Reviewing Basic Sciences, Learning by Images and Medical Developments, Letters to the Editor and Agenda.

ORIGINAL ARTICLE

LEARNING BY IMAGES

Designed to report results of scientific studies. The article must be original and unpublished and it must contain the following items: Abstract in Portuguese and English, Introduction, Methods, Results, Discussion, Conclusion and References. It must have at most 3000 words and up to 30 references.

A typical patognomonic image, be it an US, CT, X-ray, MRI, surgical photograph, microscopy, clinical sign image, etc., followed by a short explanatory text, with a maximum of 300 words and 10 references.

HEALTH ECONOMICS AND MANAGEMENT Designed to report knowledge that expresses concepts and reflects efective pratices in management, administration and economy in Health. It must have at most 3000 words up to 30 references.

CASE REPORT Reporting cases of a certain medical condition, particularly rare situations, describing its aspects, history, management, etc., including a brief literature review, case description and respective discussion. It must have at most 1000 words and up to 10 references.

REVIEW Review articles, including critical and systematic review of the literature on a given subject; it must describe the procedures adopted, the topic and its limits, and include conclusions and references. The text must have at most 2500 words and up to 40 references.

REVIEWING BASIC SCIENCES It includes review articles on basic science topics with relevant clinical impact. It must have at most 2000 words and 30 references.

MEDICAL DEVELOPMENTS Designed for publication of diagnostic and/or therapeutical novelties currently applied to different areas. The section discusses developments already in use. The text is free and must have at most 1000 words and 10 references.

LETTERS TO THE EDITOR The purpose is to comment on or discuss papers published in the journal or to report ongoing original research, scientific findings, etc. It must have a maximum of 150 words and 5 references. Any type of material must comply with the following instructions, which are based on the format proposed by the International Committee of Medical Journal Editors and published in the article: Uniform requirements for manuscripts submitted to biomedical journals. Ann Intern Med 1997;126:36-47, and updated in October 2004. It is available at http://www.icmje.org.

Technical requirements: The authors must send articles: a) online to the following address: http://www.einstein.br/ revista or a CD copy to the following address: Instituto Israelita de Ensino and Pesquisa Biblioteca Lieselotte Adler Z ‘L Av. Albert Einstein, 627/701 – Piso Chinuch – 2º Subsolo – Morumbi – CEP 05651-901 – São Paulo – SP – Brazil;

einstein. 2011;9(1 Pt 1):114

Einstein v9n1.indb 114

24.03.11 19:38:00


115

b) permission to reproduce materials as well as stating that the authors transfer to einstein all rights of the manuscript; c) a declaration signed by all authors stating that the manuscript has not been and will not be submitted for publication in another journal; d) approval by the Ethics Committee of the Institution the study and, Requirement for Informed Consent was carried out, in case of articles related to studies involving humans. After making the corrections suggested by the reviewers, the definitive material should be submitted to the journal einstein by the address: www.einstein.br/revista. The original copies will not be returned. Only the Editor of einstein may authorize reproduction of the articles in another journal.

References: they must be numbered consecutively, in the same order in which they are mentioned in the text and identified by Arabic numerals. They must be based on a format called “Vancouver Style”, as shown in the examples below, and the titles of journals must be abbreviated according to the List of Journal Indexed in Index Medicus, by the National Library of Medicine and available at http://www.ncbi.nlm.nih.gov/entrez/journals/ loftext_noprov.html

For any references, mention up to six authors. In case of more than six authors, mention the first six, followed by et al., as demonstrated in the following models.

ARTICLES IN PRINTED JOURNALS

PREPARING THE MANUSCRIPT Identification page it should contain: a) the title of the article, in Portuguese and English, which should be concise and informative; b) abbreviated title with 40 words; c) the complete name of the author, academic degree, institutional affiliations. In case of more affiliations, provide in sequence; d) the name of the Department and Institution to which the work should be attributed; e) the name, address, fax number and e-mail of the author responsible for correspondence; f) sponsors, if any; g) declaration of no conflict of interest by each author.

Tobo PR, Barbosa As, Barbosa LG, Spinola-Castro AM, Moreira-Filho CA. Three novel mutaions in the androgen receptor gene associated with partial androgen insensitivity syndrome: H570R, G589E and S759T. einstein. 2003;1(1):1-3.

ARTICLES IN ELECTRONIC JOURNALS Babcoc HM, Fraser V. Clinical experience with linezolid: A case series of 53 patients. Infect Dis Clin Pract [Internet]. 2003 [cited 2003 Feb 18];11(4):[about 20 p.]. Avaliable from: http://gateway2.ovid.com/ovidweb.cgi

BOOKS rd

Second page it should contain: a) Abstract and descriptors: abstract in Portuguese and English containing a maximum of 250 words. The original articles must follow the structure (Objective, Methods, Results, Conclusions) and briefly describe the main parts of the work highlighting the most significant data. Case Report, Reviews and Medical Developments do not require a structured abstract. After the abstract, specify at least five and at most ten descriptors (keywords) that define the subject. The descriptors must be based on DeCS (Descriptors in Health Sciences) published by Bireme and translated from MeSH (Medical Subject Headings) by the National Library of Medicine and available at http://www.decs.bvs.br. Followingthe abstract, indicate, for clinicaltrials,the registration number in a clinical trials base (http://clinicaltrials.gov)*.

Ratnoff OD, Forbes Ch D. Disorders of hemostasis. 3 ed. Philadelphia: Saunders; 1996.

Third page: It should contain: • Text: it must comply with the structure required for each category. In all article categories, any citation of authors in the text must be numbered consecutively in Arabic numerals in parentheses and superscript. • Acknowledgements: they include collaborations that deserve acknowledging but do not justify authorship; acknowledgements for financial and/or technical support, etc. They must be presented in a separate page, after the text.

DISSERTATIONS

CHAPTER IN A BOOK Marcus AJ. Platelets and their disorders. In: Ratnoff OD, Forbes Ch D. Disorders of hemostasis. 3rd ed. Philadelphia: Saunders; 1996. p. 79-137.

CONFERENCE PAPERS Mioni G, Vallone C, Franzon R, Messa P. Hypercloremic acidosis and base balanced in renal transplant [abstract] th Kidney Int 1993;44:1397. [Presented at 34 Congress of the Italian Society of Nephrology; 1993 May 18-22; Pisa, Italy].

Ramos MLT. Avaliação das análises ergonômicas em home care para idoso publicadas na literatura médica de 1980 a 2001 [tese].São Paulo: Universidade de São Paulo; 2001.

IMAGES •

Tables: print out each table (at most 4) with double spacing on a separate sheet. They must be numbered

einstein. 2011;9(1 Pt 1):115

Einstein v9n1.indb 115

24.03.11 19:38:00


116

consecutively using Arabic numerals, in the order they appear in the text. All tables must contain the title and heading for all columns. The table footnote should have the key for abbreviations and statistical tests used. •

Figures (charts, photographs, and illustrations): the figures must be presented as mentioned in the text (at most 4). When saved in digital files, they must be formatted as JPG or TIF, with a 300-dpi resolution.

Abbreviations and Acronyms: the full termfor whichabbreviations and acronyms stand for should precede their first use in the text. In table and figure legends, they must be followed by the full term. They must not be used in the title and abstract.

SUBMITTING MANUSCRIPTS

If the illustrations have already been published, submit a written permission by the author/editor and acknowledge the source in the legend.

The documents must be sent to http://www.einstein.br/revista or a CD copy to the following address: Instituto Israelita de Ensino and Pesquisa Biblioteca Lieselotte Adler Z ‘L Avenida Albert Einstein, 627/701 – Piso Chinuch – 2º Subsolo – Morumbi – CEP 05651-901 – São Paulo – SP

Legends: print out the legends for illustrations using double spacing, on separate pages. Each legend must be numbered in Arabic numerals corresponding to each illustration and in the order they are mentioned in the work.

Online submission The articles can also be sent online to the following address:

http://www.einstein.br/revista. * Important note: “einstein in support to the rules of World Health Organization (WHO) and the International Committee of Medical Journal Editors (ICMJE) for clinical trials registration, recognizing the importance of register and the international publishing of clinical trials information, from August 2007 on, only shall accept for publication clinical research articles that had received an identification number in one of the Clinical Trials validated by WHO and ICMJE protocols, available at http:// clinicaltrials. gov or Pubmed database via the link ClinicalTrials.gov. The identification number must be registered at the end of abstract.

einstein. 2011;9(1 Pt 1):116

Einstein v9n1.indb 116

24.03.11 19:38:01


117

CHECKLIST FOR AUTHORS

1. Read carefully the “Instructions to authors” before completing this checklist. 2. Attach this checklist to the original article and later to the revised version.

Full name of the corresponding author: Date the article was submitted: Telephone: Fax/e-mail: Identification page: Full title of the article in Portuguese and English Full name of the authors, followed by their academic degree and institutional affiliations, and the institution where the work was carried out Full address, telephone, fax and e-mail of the corresponding author

Article text: Abstract in Portuguese and English with no abbreviations Keywords in Portuguese and English Tables and figures numbered consecutively using Arabic numerals Abbreviations used in tables are written in full in the key Source of tables and figures that do not belong to the author The text has the main divisions, according to its category The abbreviated terms in the text are written in full the first time they are used Patients are identified by initials or numbers

References The references are in a separate page All references are mentioned in the text and numbered in Arabic numerals They are formatted according to the examples given in the “Instructions to authors” The names of all authors are listed in the references. In case of more than six authors, mention the first six followed by et al.

Format and general layout The text is typed in A4 paper using double-spacing, font size12, with 2.5 cm margins in each side Each section is in a separate page and in the sequence provided in the Instructions It includes permission to reproduce materials It includes approval by the Ethics Committee, if necessary It includes the names of financing agencies, if applicable There are three copies to submit This list has been filled in, signed by all authors and attached to the article

einstein. 2011;9(1 Pt 1):117

Einstein v9n1.indb 117

24.03.11 19:38:01


Anote já na sua agenda! A comissão organizadora tem o prazer de anunciar o 3º Fórum Internacional de Câncer do Reto FICARE 2011, a ser realizado de 17 a 19 de novembro de 2011 em São Paulo. Mais uma vez reuniremos grande número de palestrantes internacionais, para discutir os recentes avanços no diagnóstico, estadiamento e tratamento do câncer colo-retal. Não perca a oportunidade de participar deste evento único na América Latina! Local: Sheraton São Paulo WTC Hotel - Informações: info@ficare.com.br Angelita Habr-Gama Presidente

Convidados Internacionais confirmados: Anders Jakobsen (Dinamarca) Anders Mellgren (EUA) Antonio Lacy (Espanha) Bill Heald (Inglaterra) Conor Delaney (EUA) Constantinos Spanos (Grécia) Corrie Marijnen (Holanda) Eduardo Parra (EUA) Emanuele Lezoche (Itália) Gerald Marks (EUA) Gina Brown (Inglaterra)

Gregory Wynn (Inglaterra) Hermann Kessler (Alemanha) Jean - Pierre Gerard (França) Jean - Marc Regimbeau (França) John Marks (EUA) Jose Guillem (EUA) Julio Garcia - Aguilar (EUA) Lars Pahlman (Suécia) Mariana Berho (EUA) Martin Weiser (EUA) Philip Quirke (Inglaterra)

Phillip Paty (EUA) Rob Glynne - Jones (Reino Unido) Robert Madoff (EUA) Rudolf Schiessel (Austria) Sergio Larach (EUA) Seon Hahn Kim (Korea) Stanley Goldberg (EUA) Steven Wexner (EUA) Werner Hohenberger (Alemanha)

www.ficare.com.br

Einstein v9n1.indb 118

24.03.11 19:38:02


• Cursos Pré-Simpósio • Workshop • Palestrantes Internacionais já confirmados!

22 a 25 de junho de 2011 • São Paulo - Brasil - Hotel Transamérica Andrew Rhodes - Inglaterra Charles Brudney - EUA Daniel de Backer - Bélgica Derek Angus - EUA Edward Abraham - EUA Jean-Daniel Chiche - França Jean-Louis Vincent - Bélgica John Marini - EUA Luciano Gattinoni - Itália Michael Niederman - EUA Michael Pinsky - EUA Niranjan Kissoon - Canadá Paolo Pelosi - Itália Rui Moreno - Portugal

Temas a serem abordados

• Acidente vascular cerebral • Aplicação de protocolos à beira-do-leito • Controle metabólico • Diagnóstico de infecção à beira-leito • Distúrbios de coagulação • Epidemiologia da sepse • Estratégias de ventilação mecânica • Infecções fúngicas • Infecções por bactérias multi-resistentes • Insuficiência cardíaca avançada • Insuficiência coronariana • Insuficiência renal aguda • Mecanismos fisiopatológicos da sepse • Monitorização hemodinâmica à beira-leito • Novos alvos terapêuticos na sepse • Nutrição enteral no paciente gravemente enfermo • Qualidade e segurança em terapia intensiva • Reposição volêmica: novas soluções • Sedação e analgesia • Síndrome abdominal compatimental • Surviving Sepsis Campaign • Trauma • Via aérea difícil

Cursos Pré-Simpósio Educação e Treinamento em Via Aérea Difícil 21 de junho de 2011 Local: Hospital Israelita Albert Einstein • Horário: 8h às 17h Número máximo de participantes: 40 Coordenadores: Luiz Francisco Poli de Figueiredo e Ruy Guilherme Rodrigues Cal Doppler-Echocardiography in Intensive Care Medicine 21 de junho de 2011 Local: Hospital Israelita Albert Einstein • Horário: 8h às 17h Número máximo de participantes: 40 Coordenadores: Daniel de Backer, Danilo Teixeira Noritomi e Haggéas da Silveira Fernandes Severe Sepsis and Septic Shock: From the Emergency Room to the Intensive Care Unit 21 de junho de 2011 Local: Hospital Israelita Albert Einstein • Horário: 8h às 18h Número máximo de participantes: 40 Coordenador: Eduardo Juan Troster Público Alvo: Pediatras Designing and Publishing Clinical Research in Critical Care 21 de junho de 2011 Local: Hospital Israelita Albert Einstein • Horário: 8h às 17h Número máximo de participantes: 40 Coordenadores: Antonio Capone Neto, Marcelo Katz e Marcio Soares

Workshop

(É necessário inscrição no Simpósio) Ventilação Mecânica 23 e 24 de junho de 2011 Local: Salas Ilhéus, Uma e Canavieiras do Hotel Transamérica Horário: 12h10 às 13h30 Número máximo de participantes: 80 Coordenador: Carmen Silvia Valente Barbas

Pontuação do Evento

• EMC - Programa de Educação Médica Continuada do HIAE: 40 créditos • CNA – Comissão Nacional de Acreditação

Presidentes Prof. Dr. Elias Knobel Diretor Emérito e Fundador do Centro de Terapia Intensiva Hospital Israelita Albert Einstein Prof. Dr. Jean Louis Vincent Diretor do Departamento de Terapia Intensiva do Hospital Erasme Universidade Livre de Bruxelas - Bruxelas - Bélgica

Local

Hotel Transamérica Av. das Nações Unidas, 18.591 - São Paulo - SP - Brasil Fone: (55-11) 5693-4511 - Fax: (55-11) 5693-4990

Inscrição

As inscrições poderão ser feitas através do site www.einstein.br/isicem

Mais informações

www.einstein.br/isicem • Fone: +55 11 2151.1001 Opção 1

www.einstein.br/isicem

Não é permitido gravar, filmar ou fotografar sem prévia autorização expressa da comissão organizadora do evento.

Convidados Internacionais Confirmados


ISSN 1679-4508

volume 9, número 1, janeiro/março 2011 Editorial vii Haiti’s earthquake: the magnitude of needs ix

Reprocessing hemodialysis filters – beyond clinical issues

1

Special Article Haiti’s earthquake: a multiprofessional experience

8

Original Article Impact of a program to promote health and quality of life of elderly

14 Impact of screening and monitoring of capillary blood glucose in the detection of hyperglycemia and hypoglycemia in non-critical inpatients

Haiti’s earthquake: a multiprofessional experience

18 Potentially inappropriate medication prescribed to elderly outpatients at a general medicine unit 24 Mother/child bond in mothers of overweight and eutrophic children: depression and socioeconomic factors 31 Habituation of the blink reflex in the neonatal period and development of auditory processing 36 Role of adipose tissue-derived stem cells in the progression of renal disease 46 Contrasting roles of donor and recipient TGFB1 and IFNG gene polymorphic variants in chronic kidney transplant rejection 52 Procalcitonin in patients with influenza A (H1N1) infection and acute respiratory failure 56 Immunological induction with thymoglobulin: reduction in the number of doses in renal transplant from deceased donor 66 Sterilization of single-use helical stone baskets: an experimental study

Health Economics and Management 70 A new spectrophotometric method to detect residual amounts of peroxide after reprocessing hemodialysis filters

Case report

75 Perforated diverticulitis of the appendix: ultrasonographic diagnosis

v olum e 9 , nú me ro 1, j ane i ro/ m ar ço 2 01 1 , pá g i na s 1 -1 1 8

78 A newborn with neck mass 81 A rare case of hematuria

Review

84 Aquatic physical therapy as a treatment modality in healthcare for non-institutionalized elderly persons: a systematic review 90 Noninvasive ventilation for acute respiratory failure in children – a systematic review

Reviewing basic sciences

95 Molecular aspects of bladder cancer

Learning by images

100 Low-energy femoral shaft fracture in elderly patient with prolonged use of alendronate

Medical Developments

102 Hearing rehabilitation through telemedicine to enhance public policies in Brazil 105 Agenda 110 Instruções aos Autores 113 Lista de itens para conferência de artigos 114 Instructions to authors 117 Check List

Camp map with the tents


Einstein