Page 1

Universidad Autónoma De Ciudad Juárez Instituto De Ciencias Biomédicas Química Computacional Secuencia de bases nitrogenadas de proteínas, Dogma central de la biología molecular, definición de gen y descripción de NCBI Yadira Flores Bustamante 129203 Albumina: AAATGTCGTATTATTAGAGAATTTCCAGATATAGTTTTTAAAGGACTAACACTAGTTCAAGTCTCCCAAA AGTTTGGTAAGGCAGGGTTTGAAGATGTGAAAAAAGTCACCGAGGAAATTGTACATTTGAATGAAGACTG TTGCAAAGGTGATGCTGTGGAATGTATGATGGAAAGGATGGAAGCCACCGATCATATTTGTGAGGCTAAG GACAAATTATCATCCAAACTAGCTGACTGCTGTGCTAAAAGTATTCTAGAGCGAACACCCTGTCTTCTTG CCCTGCCAAACGATGAATCTGACTTGTCCAAAGAACTGAAAAATTATTATGAAGATGAACGTGTGTGTGA GAACTATAAAAAAGACAAGTTATTATTCCTTGCCCACTTTACACACGATTATGCCAGAAGCCACCAGGAA TCATCACCTCAGTCTTGTCTACGAGTTTCTAAAGGATTTGAAGGGTTGCTCGAAAAGTGCTGTGCTAGTG AAAACCATGCCGAGTGTCTCAAGCAAGCCCCTATTTTGTTAGAGGCTGCACTGAAAGAAATTGAAGAGCT AAGGAAACAGAACTGTGGTGCCTTGCAGCTGCTCGGGTTCAGAGATTATAATATTCAGCTGCTTTTTCGA TACTTTTTTAAGATGCCTCAGGTAACGGCCCCAACGCTTGTTGAATTAGCTGGTAGAATGACCAAGGTTG CAGTCTACTGCTGTGGCTTGGCTGAGAACAAACAGCAAACCTGTGCTGAAGAAAAGCTGGATATTCTTTT GGGAGAGATGTGCGAAAAGGAAAAGCATACATTCGTAAATGACAATGTTCGCCATTGTTGCGTCGACTCA TATGCTAATAGAAGAAAATGCTTCACTGATCTTCAACGTTATCCTAATTATGTAGCGCCCAAGTGGGATG AAAGTAAGCTCCACTTTAATGAGGACTTATGTAAAGGTTCCGAAGATGACCAGATAAAGAAGAAACTGGA AGTGTTGGTTGAATACATGAAAATGAAGCCTGACTGTGGGCCAGAAAAACTTAAAGAGGTTGTTGAAGCC TTTAGAAAAATAGATATAAAATGCTGCGCAGCAGAGGACCACCAGAAATGCTTTGATGACGAGAAAGCAG GCCTTCTTCAAATAATTGAGGCCCATTAACATGGAACAGGCCACAAGCTAATATAACAAGACAGCCTTGA GCCACTAGGTTAAATCATCATCAACTGGTCACTGAATACATGTTGCTGATACATGTCTCTGAAGACTCAA GTAGAAAAAAACTACCATCGTTTTACTGCAAAATAATAAAAAAATAAATTCTTTATGACCAGAAAAAAA

Fibrinógeno: GGCCCCGGGCCCGCCGACACCATGAGTTGGTCCTCGCACCCTCCGAGTGTAATCTTCTACATTCTTTCAT TGCTTTCTTCAGCATGCCTGGCATATGTTGCTACCCGAGACAACTGCTGCATCTTAGATGAAAGATTTGG TAGTTATTGCCCAACTACCTGTGGAATTGCAGATTTCCTGAATAATTACCAAACCAGTGTAGACAAAGAT CTACGAACTTTGGAAGGCATCTTATATCAGGTTGAGAACAAAACATCAGAAGCCAGAGAGCTGGTCAAAG CAATCCAAATCAGCTATAACCCTGATCAACCATCAAAGCCAAATAACATAGAGAGTGCTACCAAGAATTC CAAGAGTATGATGGAAGAAATTATGAAATATGAAACACTGATATCAACACATGAATCAACAATTCGATTT TTGCAAGAGGTATATAACTCAAATAGTCAAAAAATCGTTAACCTAAGAGATAAAGTGGTCCAGCTTGAAG CAAACTGTCAAGAGCCTTGTCAAGATACAGTGAAAATACATGATGTAACTGGGAGAGATTGCCAAGATGT TGCCAATAAGGGGGCCAAAGAGAGTGGACTTTACTTTATCAGACCTCTGAAAGCTAAGCAGTTCTTAGTC TACTGTGAAATTGATGGGTCTGGAAATGGATGGACTGTGTTTCAGAAGAGGCTTGATGGCAGTCTGGATT TCAAGAAAAACTGGATTCAATATAAAGAAGGGTTTGGACATCTGTCTCCTACTGGTACTGGAAACACAGA ATTTTGGCTGGGAAATGAGAAGATTCATTTGATAAGCACACAGTCATCCATCCCTTATGTATTAAGAATA CAGTTGGAGGACTGGAATGGCAGAACCAGCACTGCAGATTATGCTTCATTCAAGGTGACAGGTGAAAATG ACAAATACCGCCTGACATATGCTTACTTCATTGGTGGAGATGCTGGAGATGCATTTGATGGCTACGATTT TGGCGATGATTCTAGTGACAAGTTTTTCACATCCCATAATGGCATGCAGTTCAGTACTTGGGACAGTGAC AATGATAAGTATGATGGCAACTGTGCTGAACAGGTAGGTATCGGTTGGTGGATGAACAAATGTCACGCTG GCCACCTCAATGGAGTTTATTATCAAGGTGGCACTTACTCAAAAACATCTACTCCTAATGGTTATGATAA TGGCATTATTTGGGCCACATGGAAATCCCGGTGGTATTCCATGAAGAAAACCACCATGAAGATAATCCCA CTTAACAGACTTGCCATCGGAGAAGGACAGCAGCACCAACTGGGGGGAGCCAAACAGGTCGGAGTAGAAC ATCACGTTGAAATAGAATATGACTAAGTCATTTTGCCCTGAGCTGTTCATTCTGTTAACACACAAACTTT CCTGAAATTTTCTTCTCGTTTTCTCTTACCGTATTTATTAATTTTAAGTCTTTCTTTAAGGATATTTAGC TCTGAATGGCAATTAAAACTCACTTTGGACTGTATTCCCAAGTTACTAAACACAGAGTTATTATAAATTT GTCTATTTGATGAGATAATATTTTAGCTTATTTCCTAAATATATAATAAATTGTGATATTTAAAAA


Melanina: ATGATATACTGCGCATATTGTGGAAAAAAGTTTACTAGAAAGGAACATCTAGAGAGGCATTTGCCGACCC GTAAGTGATATTTCAGTTGTAATGACGACCCCAGGGATGCTAATCATAACTAAGACACGAACGTGAAACC GTATCGCTGCACAGAGTGCCAACTTGCGTTTTCCAGAAGGTATTGCCTGCCGTATTCATTACCCTCATCA GCTCCATGATGTTCGGCTTGTGTTAACGAACCCTTTACTTCAGAGATCTCCTGCAGAGACACTATAACAC ATACCACCAACCCAAAAGTCCGATGGGGACTGATACGGGCGACGTTAAATCAATCGAAGGTCCGAATCGT ATTGCTTGCACCGAGTGCTCGCAAGCGAAGACGGGATGTGACAAACAAGAGCCGTGTGGGAGGTGTCGAG AGAAGAACCTGCCATGCAAGCAGCGCTTCGCTAAGCGGCTGTCAAAGAAGGCCAATATCCGACGGGCGAA CGCAGCGGCAAGCACATCGGCAAATGGCCAGACTAGGCCGGCCCCCGTTCAACCGGCCACGCCAGCGTCA GTGCAATTGCCTTTGCCCTCACCCTCGCCGGCGCTAGTGCCTACGGCGGTGGCCACCTCGTTCATCAACA TGGACCCCAGTGCTGGTATTTACAACATGCATATGAAAGCTACAGCGCCGCATGATGATATCCTTATGTC TACGGACAACCAAATGAAACTATACGATGGTGGGATTGATCACATGTCACCGATCGCAATGCACATCAGC CCTGCGAACTTCGGTCACACGCAAGCTCCCGATATAGGCGGGGTTAACGAAGCCATGCAAGTAGGAGCCG ACTACACAATAGGCAACGAGCTGCCAGGATGGGAATCCTATTTCGATAATTATGGGAATGGATACACTGT GAGCATGGACCCGATAGTTGATATCTCGATACCGCCGTTTCCGGATTACACCCCGAATTCGACCCCGAAT CTAGAGCAATCCTCAAGCGCGGTGTCGACACCCTTGTCAGTGCATTCTCCCAACCCGGTGGACGGTGCCA TCCCGGAATTTGAGGCAATGATGGTTGCCGAGTCCGGCTGGCCGCTGGTCCGGTGTAATCCCGTGAGGTA CTCGGGAAGCTGCCCACGCACTGCTAGGATTCATCTGGAGTGCTTGGAACAGAAGCTGAGGCAGGTGGGC GTTTGGACAACGTTAGCGGCATCTCTGGAGACGGCCCGGCGAGACAACGCTGGTATAGCGGCAGTGGTGC CCATGACGGGGCAGACCCGGGACAGCATGCTTGCCATTGCCCAGACATTCCTGCACAAGGCTCTGGACAT CCACCGCGAAGGTCCTCCCGACCGAAACCACCGGTACAGGCCAGCCGCCTTCCTCACCCTGCCCCCATCT GGGATCCTCGACTACTTCTTACAGAACTACGCTCGCAACCTCTCCCTTTTCTACTCACTCGTGTCTACTA GCCGTGTCGATCCCAACCAAATGATCGAAGATAATCAGACCTCTACCCTATTGGTCCTACTGATGATCGC GCAGGGCGCCTCCGTTGTCCCGATCGATGAAGCACGAGTGCTCTCTACGGGCCTCATCGAGACCTGCCGA ATATCACTACTCGACATCGTTGAGAAGAATGTCGAGATGTGCGCCGACCCGACGGTACACCGCTCTGCCC TACTTTTCACTCTATCGGGGGCCTGGAGCGGCGATAAGTGGCTGATGGACATTGCCATGGGCCAGCGGGG GATGTACATTTCCGTAAGATACTCTCACACTCTTCTAAGACGATGCATTTCCTGCCTCGGCTCATACACG AACGGAACTAACCGGGAGCATTAAATGACAGATGTTAACGCATGCCGGGATGTTCGAGTCGCAGCAATCC TGGTTGCCAACTACCTCGTACAACGACGTGAACAATAGGGAGAAGGAATGGCGCTCTTGGCTCGAGCAGG AAACGAAAAATAGGTACGTGCTCATTGGCGCTTCTCGTGGGCTGTGCGATTTCCCCTCCCTCTCCTCTCC TCCCCTCCCCCACGCAAGCTGCAGGCACTCTCGAATAGCTGAAAGCGTCAGCCCGCGCTGATACGTACTT TCTCGCCTAGGCTCGTATACAACTGGGTTATGGTCGACCAGGAGCTCAGCTTGTTCCACGACACGGCACC CATGCTGGCCACCAGCAAAATCTACGCGCCGCTGCCCGGTCCCGAACAGTTGTGGGCATCGGAGAGCGCT GACCAGTGGGTGGCCGCGGTGCAAGCCATGTCCAACCTCCCGGCCGATGCCGGCCTCCAGCAGCTACGCA GTACCCCGGCGCTGCTGACGCCCTCCCTGAGCGTGCTATTCCAGGAGTTCGTGTGCGATAACACGGCCTC CCAACAGATGTCTAGCCTAACGCCCTGCCAGCTGCGGCTGCTCCTCCATCCCCTGCATGCTCTGCAATGG CATCAGCAGGAGATATCGAACTACTTCGCTAACATCTCGAGCATGCCGGCCATGTCCCCAATCGCAGGCA ACAGCAACACCAATGATAACGGCGGCGCTAGCAATGCACAGAACAACCACGCGGGGATGCGCCAGCAGCA TGATGTGCAAAGTCTGCTCCAAAAATGGTTCCGCACCGTCACCGTTCACCTCAGCGCGGACCCTACGTGC GTCGCGAGCATGACCAATCTAGTGCTCTACCACCTCATCGCGCTCAACGGCCTCACCAACTTCCCCGCGA TCGAGGCGCTCGCGCGGCTGCACGGCAGCATATGGGAGCAGTCGCCGGGGCGCGCGCACTGCATCCGCCA CGGCGGCGAGGCCGTGTACCACTGCGGCCAGGTGATACGGCTAATACGGACGATCCCGGCGAACCGGCTA CCCGTGTGGTGGAGCGCGGCCGTCTACCGCGCGATCATGATCCTCTGGGCCGATAGCATCCTGCGGAAGC AGCAGCAGCAGTCGAGCCAGGGCGGCATCGGCATGGGTCTGCCGATGGGCGTGGGCGGGATGATGACCGG ATCGTCCCAGCTCTCCCCCATCGCCATCGACCAGGTCGGCCCCGAGGACCCGGGCCTGTGGATGGTGTGG AATCATAAGGGCACCGCCGTGCTGTCCAACCCCAACGGCACCAACACGAACCTCGATAATCCCCCGGAGA TCCTCACCTTCGCCCTGAACCTCCTGGGCTCCGGCGCCGCCTCCCGCTTCACGGACGGTATTAAGCGCAA GATCGGTCGGCTGGCTCAGGCCTGGGGCGTATAA Mioglobina: TGTCAAATATCTGGAGGTATGGAAAAGGGCAGAGAGTCTCAGTGTCTGATGTGTAGTGAATGTGTGTAAG ACAGATGTGTGAGAGTTGGGCTTTCATTTATTGATGACTAGTTGGACTTCAGTGAGCTCTCCCTCAAGTC CAGGGTCTGTGTGTTCAAGCAGGAGGAGGCACAGAAAGGGCTCATGGTATGCAAATGGTATGTGAATATC CAAGTTTAGATTTCCCATTCCAAACACCACATGCAGTCTGACCAACCCTTGATAACAACAAACCAGCCCA TGCAGCCTATGCATGCCTGGGAAACTGTATTACATAAGGACTGTCAGTGACTGGACACAAGGGACATACA


ATTTTAGAGTAAGCCCTGGAGGATCCATTGGAGACCAAGACCCATAAAAGTAAGTGTTATACAAACACAG GGCATGAATTTGCAGTCTTAATGGATGAGGCTGACAAAAAGTGGAAAGGGCCATGGTCTRCTCAAGGTCA TGAAGCAGATCAGCGTCAGAGCTAGGAATAGAGCCCAGTGCTTCTGCCTAGCCCAGACTCCTTGCATACT AGACCTCACTGTCTCTCCAGAGGCAGCAGGAAGGCCTACTGAATTAGCTCAGAGATATTTCCAGGCTCTG CAACCTATTTCTTAGTCTGGCTTTTCTGAAAATAAACCTTGAGTGTCCCTTCAGTTTTTCTTTCTCTCTT TCCTTTCTCATAGTTCATTTCTG

Prion: ATGGTGAAAAGCCACATAGGCAGCTGGCTCCTGGTTCTCTTTGTGGCCACATGGAGTGACATTGGCTTCT GCAAGAAGTGGCCAAAGCCTGGAGGAGGCTGGAACACTGGGGGGAGCCGATACCCAGGGCAGGGCAGTCC TGGAGGCAACCGCTACCCACCCCAGGGTGGTGGCGGCTGGGGCCAGCCCCACGGGGGTGGCTGGGGACAG CCCCACGGGGGTGGCTGGGGTCAGCCCCACGGGGGTGGCTGGGGACAGCCGCATGGTGGCGGTGGCTGGG GTCAAGGTGGTGGGAGCCACGGTCAGTGGGGCAAGCCCAGTAAGCCCAAAACCAACATGAAGCATGTGGC GGGAGCCGCAGCAGCCGGGGCGGTCGTGGGGGGCCTGGGCGGCTACATGCTGGGGAGCGCCATGAGCAGG CCCCTCATTCATTTTGGCAACGACTATGAGGACCGCTACTACCGTGAGAACATGTACCGCTACCCCAACC AAGTGTACTACAAGCCGGTGGATCAGTACAGCAACCAGAACAACTTCGTGCATGACTGCGTCAACATCAC GGTCAAGCAGCACACGGTGACCACCACCACCAAGGGCGAGAACTTCACGGAGACCGACATGAAGATCATG GAGCGCGTGGTGGAGCAGATGTGTGTCACCCAGTACCAGCGAGAGTCCGAGGCTTACTACCAGAAGGGGG CGAGCGCCATCCTCTTCTCGCCCCCTCCCGTGATCCTCCTCATCTCACTGCTCATTCTCCTGATAGTGGG ATGA

Amilasa: CCACGCGTCCGCGGCTGTTGGACAGGGACAGCATGAGGTTCTTCATTTTGGTAACCTTGTTTGGGCTCAG CCTCGCCCAGCACACTCCCCATTTCAAACACGGAAGGACATCCATTGTCCACCTGTTTGAGTGGCGCTGG ACAGATATCGCTGCTGAGTGCGAGCGCTTCCTGGGTCCAAATGGCTTCGCTGGTGTTCAGATTTCTCCTC CAAATGAGCACATCATTCTAGACAGCCCCTGGAGGCCCTGGTGGCAGAGATATCAGCCAATCGGCTACAA CCTGTGCTCCAGATCAGGTAGTGAGAATGAGCTGAGAGACATGATCACCAGGTGCAACAATGTTGGGGTC AACATCTATGTGGATGTTGTCATTAACCACATGTGCCGTGCCAGCAGTGGTGAGGGGACACACTCCTCCT GTGGAAGCTGGTTCAATGCAGGCACGAAAGACTTTCCCTCTGTCTCCTACTCCTACTTGGACTTCAATGA TCACAAATGCAGAACTGGCAGTGGAAACATTGAAAGTTATGATGCTGATGTGAATCAGGTGCGGGATTGT CGTTTGGAGAATCTGCTGGATCTCGCCCTGGAGAAAGATTACGTGAGAGGGAAGGTGGCTGACTACATGA ACAGGCTTGTCGACATGGGCGTGGCTGGATTCAGAGTGGATGCCTGCAAACACATGTGGCCTGGTGACCT GTCTGCCGTCTACGGTCGACTGAACAACCTCAACACCAACTGGTTCCCTGGAGGTTCAAGACCATTTATC TACCAGGAGGTTATTGATCTGGGAAGTGAACTTATTACCGCTAAGGAATACTTCCATCTGGGCAGGGTGA CTGAGTTTAAGTATGGTGCCAAACTGGGAACCGTCTTCAGAAAATGGAATAACGAGAAGTTGATGTACAC CAAGAACTGGGGAGAGGGTTGGGGTTTCATGCCAAATGGCAACGCGGTCGTCTTCATTGATAACCATGAC AACCAGAGAGGACATGGTGCTGGTGGAGCAGCCATTGTGACCTTCTGGGACTTCAGGCTCCACAAGATGG CTGTAGCATACATGCTGGCTCACCCTTATGGAGTAACCAGAGTGATGTCAAGCTTCCGATGGAACCGCCA CATTGTCAATGGAAAGGATCAGAACGACTGGATGGGCCCTCCCAGCCACCCTGATGGATCAACCAAATCT GTTCCCATCAACCCAGATGAGACTTGTGGTGATGGATGGGTGTGTGAGCACAGATGGCGTCAGATCAAGA ACATGGTCATTTTCCGCAATGTTGTGAATGGTCAACCTCATTCCAACTGGTGGGACAACAACAGCAACCA GGTTGCTTTTGGCCGTGGAAATCGTGGTTTCATCATTTTCAACAATGATGACTGGGACCTGGATGTGACT CTTAACACAGGCTTGCCTGCTGGCACCTACTGTGATGTCATTTCTGGCCAGAAAGAAGGAGGCCGCTGTA CTGGCAAGCAGATCCATGTGGGCGCTGATGGTCGCGCACACTTCAGGATCAGCAACCGAGATGAGGACCC CTTTGTTGCTATTCATGCTGAATCCAAGCTGTAAAACAACCACAATTATTAACAGACAATAAAGTACAAG CTGCTTTTTTTAA

Fructoquinasa: TCGATTTATTCAAAAGGCCTTTTGGACAGAAGAAAAATCGAGGTCATCGTCATAATTTAAAGCGAATGGA CAGCATATACCTCCGTATTACGGGGGGATTTTGTGAGTGGTGAGAATAATGAAAAACGATAAAAAAATTT ATGGATGCATTGAAGGCGGCGGAACGAAATTTATGCTCGCCCTTATTGATTCTGACCGGAAGATGCTGGC


TGTGGAACGTGTTCCGACCACAACCCCTGAAGAAACGCTTGGTAAAAGTGTTGAATTCTTCAAAAAAGCG CTTCCTCAATACGCTGATTCTTTTGCGTCTTTTGGTATCGCGTCATTTGGCCCGCTTTGCCTCGATCGCA AAAGCCCGAAATGGGGCTATATCACCAACACCCCGAAACCTTTCTGGCCGAATACGGACGTTGTAACGCC CTTTAAAGAAGCTTTTGGTTGCCCGGTTGAAATCGACACCGATGTGAATGGCGCAGCTTTGGCTGAAAAC TTCTGGGGCGCATCAAAAGGCACCCATACATCTGTTTATGTCACGGTTGGCACCGGCTTCGGCGGTGGCG TACTGATTGATGGTAAACCGATTCATGGTCTGGCTCACCCTGAAATGGGTCATGGTATTCCGATCCGTCA TCCTGATGATCGTGATTTCGAAGGTTGCTGCCCTTATCATGGCGGTTGCTATGAAGGTCTCGCCAGCGGC ACGGCTATCCGTAAACGTTGGGGCAAGGCTCTGAACGAAATGGAACCGGCCGAATTTGAAAAAGCCAGAG AAATCATTGCTTTCTATTTGGCTCACTTCAACGTCACGCTTCAGGCCTTTATTTCACCGGAACGTATTGT TTTCGGCGGCGGCGTTATGCATGTTGACGGTATGCTGGCTTCTGTTCGTCGTCAGACGGCTGAAATTGCC AATAGTTATTTTGAAGGTGCTGACTTCGAAAAAATTATCGTATTACCAGGGTTAGGTGATCAGGCCGGTA TGATGGGTGCCTTCGCCTTGGCATTGGCTGCAGAAAATAAATAATGTGGATAAATCTTCCAAAAATCAAT TTTCTTAACCGAAAAGGGATTTTGGAAAAT Casein: ACCTGGCCTTCTTGTCTTCCACTTGGGAAATAAGGACTCAGTAACCATGAAGCTCTTCATCTTCACCTGC CTCTTGGCTGTGGCTCTCGCAAAGCACAAGTCAGAGCAACAGTCCTCCAGTGAGGAATCTGTCAGCATCT CCCAGGAAAAATTTAAGGACAAGAATATGGACACTATTTCTAGTGAGGAGACCATTTGTGCCTCCCTCTG CAAGGAAGCTACAAAGAACACACCTAAAATGGCATTCTTTAGCAGATCTTCTAGCGAGGAATTTGCTGAC ATTCACAGAGAGAACAAAAAAGATCAACTTTATCAGAAGTGGATGGTACCCCAGTATAACCCGGATTTTT ACCAACGTCCCGTTGTCATGAGCCCGTGGAATCAGATTTACACAAGACCCTACCCCATTGTGCTTCCCAC TTTGGGCAAAGAACAGATCTCCACCATTGAGGACATCCTAAAGAAGACTACTGCTGTGGAATCCTCTAGC AGTTCATCTACGGAGAAATCCACTGACGTATTTATTAAGAAAACTAAGATGGATGAAGTACAAAAGCTTA TCCAAAGTCTCCTGAACATAATTCATGAATATTCCCAGAAGGCCTTCTGGTCCCAGACCCTAGAAGATGT TGACCAGTATCTGAAATTTGTAATGCCGTGGAATCACTATAATACAAATGCTGACCAAGTCGATGCCTCT CAGGAGAGACAAGCTTGATTCTTGGATTAACTGTTTTTACCTTGTCTTGGTTTAACTGGAAAATCTACCC TCTACAGTCTCTTTCTCTGCCTTTTAACTTCACGCTCCCAGCATATTTAGACAGACTTACAGACAAGACA GAAATCCTGAGCCAAAGAAGACCCCACAGGGCGCCTTCGGAATTCCAGTCTTTCTGCTGGTCCGTGTCAA ATCTGTTGGATCCGTATTGTTGCATAGGAGCTGCGTTGATAACTAATTTAACGTGTTTCTGCAACTTTTT TTTCTGTTAAACCACATTACTTTTCCTCGCAAAATAAAACTCTAAGTGCATCCCTT

Mielina: AAGCTTAACTCTGGTTATGTAGACATTCCAAACATCTCCCTTTGTTTGTTGAGATGGTCTCTGATAGCCC AGGCTAGCTTTGAACTCCTGACCTTCCTGCTTCCTGCTTCCACCTCCCAAGCACTAGAAAGAGAGGCATA AACCACAGTTGACTTTCTAGTTCTTCCCCACAATTCTTCAGGAGATGCTTACAGCACACGAGATTAACTT CACCCTCTTCAGTCATCTAAGACCTTCACACTTCCTGTTCAGACTTCTTTCCTAGTGAACCCTTTCAAGA GCCACACCAAATCAAACATGGATGGCACAAACATGGATGCTCTAAATCTACACAGAGCTTCACAAATGTC ACACGTGCACACACTTTCACCTCAGCTCTTACCTTTGCTGTTCCATCTAGCCATTGCCCCTCCCGTTCCC TTTTTCAAAATGGCTGCTCCTTCAAGGTCTCTAGACAACACTGCTTCCTAGACCTGATTCCTCTTTCCTC TGAACTTCCTGTATTAAGTGGCATTCCCACCGTTCTGTGCATTGGCAGTTGATGAGTTTCCCTCTGTTTC TCCCCTCTGCCTCCTCCAACTAGATCTTGAGCTTGTAGAAAGAACGGAATTACCATTCTAATATGAGCAT TCGCATTCCCCAATGTTTCAAATAGCCACCAGGCAGGCCAATACGCAGTCTTGATCATTTAAACTGCTGC ATTGCATAAGGTACCCTAACAGACGGGAGAAATTTGGGCTTCTTCCTGGAAGTTTCCTGGTAGAGAAAAT CTTCTATCTGGGTAGAATCTCCCAGATACAGGGAGGTGGAAAAAGTTGTTCCAAAGGGCTTTATAGTCTA CAGTGTTGCCTTAGCAATCAGAACAACAGACACCCTAATTTGGGAGTGCTCTGAAAGAAACTTGCCTCTA GGTCCTAGGGCTCTCAGGCAAGGAGACCAAGAAGGATTCCTTTGCCATGGCCTTTTGGATTTAGGTTTCT CAGCTTGTCTATTCCTCAGAGAAGTGTGTCTATGCCCCTTTTCTGTCCCTCTGCCTCACCCTACCCCAAC ATTCCAACCTAGGGTAGGGGGAGGTCAGTATACACAAAGCCCTCTGTGTAAGGGGTGGTATGTGTCCCCC CACCCCTCCACCCACCGTATACAATGCCCCTTCTGCTCCATGCCCCCTGCCACCCTCCCCACCACCTCTC CATTGCACATGCCAGGCTGCAATTGGTCACTGGCTCAGGACAGCCCCCTCATGCTGGGGATCCAGGGGAT TTTAAGCAGGTTCCAGAAAACACAGCTCAGTTCCTTGTCCCCCGCTCTCTCCACCCCACAGACACTCTGG GCCTTTGCCCTACCCCAGCTATGGCTCCCGGGGCTCCCTCCTCCAGCCCCAGCCCTATCCTGGCTGCCCT GCTCTTCTCTTCTTTGGGTAAGTGAAGCCACTGAGTCCCAGAAACCTGAGATTCGGTGGTCTCTCAGCAA CTTCCCCCATCCTCTCACCCTTCACTGCTAAGAGCCAGCAAGGGAGAACGAGAAGATGATGTCCTGTTTA GGTGTGGGGAAGGAAGGTATAGATCATTCAAGGGAAGGAGCAAAGGTATTTCACGCAGATACATAGTAAA


AGAGATCACAGAGAGCTCCCTGAAAAACCAGTCAGTGACTCCTCAGATCCATGCTAACAGCCTGTCAGGA AGCAAAAAGATCTTGGGAAGAGTGGGATCACACCCTGGGTCCCCTTTCATCCCCTAGTGGCACAAGAAGT ACCTAACCTTGATTACCCAGAAGAGACAAGTTAGGGAGTATGAATTAATGAATGAGTTCACTCTCTGTGG TTTCAGCTTCTCAGATGGAATTTCTGTCTGTGGCCTCTCATCTATACTGTGAGTGAACCCTAGGATCTTG TCCCAGTAGAGCCATCTTTTTAAACTGGTCAGCCATTTCCCCTTACCTTTGGCAGGTGTCAAGTGAGCAA GAGACCATCAAAGCAAGGTTAGTTAAGTAGAGCCTTCCAAAGCGCCTGGCATCCTGTGTAAGCAGTAGGT ATGATGGGGTAAGATCGAGGTTGGGCAGCAGGAGAGAGGAGCAGTTAGAAAGCCCAAGCTTNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNTCTAGAATCCTAAAGAAAATCTAGGATTCCATTTCCTCTACACTGCAGA CTGCCCATCCAGGTACTGACCAGAGTTGACCCTGCTTAGCTTTAAGAGATATGACAAAATTGGATATCCA GTGTGATATAGCTATGAACTTGAGGGACATTCTTTATGCTGAGACCTTGAGCAGATACAACATTTACATT TACCAACTGAGTTAGTCCCAGACAGATGTAGGCCTCCCAACATTTGTTTCTTTGCTAAGACCTTTCCAGT ACCTTAGCCCTGACTGCTGGTTGGCCTCATGTTCTCTATAACTGGCTGGGCCACTGTGTGCATCTCATTT CCCTCTTTACAGTGCTGTCTCCAGCCCTGGCCATTGTGGTTTACACGGACAGGGAAATCTATGGTGCTGT GGGCTCCCAGGTGACCCTGCACTGCTCCTTCTGGTCCAGTGAATGGGTCTCAGATGACATCTCTTTTACC TGGCGCTACCAGCCTGAAGGGGGCCGAGATGCCATTTCGGTGAGTGCGGGGGCGGGGAGGGGCGCAGGAG GGGGTTTGTCCTGGGGTTAGACAACAGATAGGTACTTAAAACAACGGAAAAGAGAACCTGGGCTACAGAA GGGAAAATGTTTTATGCTCATAAACTCAACTGTAGAAAGGTAATCTGNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNGGATCCTGAGTCTGGAGCCAAGTCTTGGGAGCTTTTCACACTAGGATTCTTTCACACAATTTC CATCATTCTTCATAGATTTTCCACTATGCCAAGGGACAACCTTACATCGATGAGGTGGGGGCCTTCAAAG AGCGCATCCAGTGGGTAGGGGACCCTCGCTGGAAGGATGGCTCCATTGTCATACACAACCTAGACTACAG TGACAATGGCACTTTCACATGTGATGTCAAAAACCCACCAGACATAGTGGGCAAGACCTCTCAGGTCACG CTCTATGTCTTTGAAAAAGGTATGAGAAGGAACAAGGGACAGGGTTCTGGGAGGCATTTCAAAGAGGGTG TCAGGGAGGGCTGACAGACTGAGAAGGGCAAATAGCTTCAACCAACAGGTGGTGCAAGCCTTTAACCCCA GCGCTGGGGAGGCTAAGGAAGGGATTGCTTGGGTTGAATAATGAATTCAAGAGCAGCCTGGGGTATATAG CAAAACTGAAGGATGAGGGAGACCGGCAGATAAGCAAGGCTGTAATCCTAATACTGCAAAGGTGGAAGTG ACCTTTGTAATCTGAAGCAAGTTAGCCAGACTACTTAAAGACCAATCTGGGCCACGTGAGACACCCCCCC CCCAAAAAAAAAAAGTGAAAACCAAAGATGCCGAGAAGAGAAGGCATCCTGGCTAAAATTTTCACATTTC CAATGATTGGAAATAGGTGTAGAGAAGCAACATAGATATAGGTTTCTGCTTCCAACCCACTGCGTGCGAA CCGCGTATCTCTTCTCCCTCCCCTCCTAGTGCCCACTAGGTATGGGGTGGTGTTGGGAGCAGTGATCGGG GGCATCCTCGGGGTGGTGCTGTTGCTGCTGTTGCTCTTCTACCTGATTCGGTACTGCTGGCTGCGCAGGC AGGCTGCCCTGCAGAGAAGGCTCAGGTAAGGGGCGGAGCCTGACTCCCCACCTTTANNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNGGATCCCCTAGACTGCTTCAGTGGTGGGAGGGCCAAAGGAAAGAGGGAAGTTGA GTATACTGGGTTTCAGGGAGGCCAATCCTTCTACAACCTCTCTTGCCACAGTGCCATGGAGAAGGGGAGA TTTCACAAATCTTCGAAGGACTCCTCGAAGCGAGGGCGGCAGGTTAGTAGGGCTTGGGACTGGGGAGGAG AACGCTGGGAATCCGGGACAGCAGTGAGGGACGGGTGGGCGTGGTCAAGCCCAAGGCTGACCTGTACAAT CCCCGCAGACGCCAGTGCTGTATGCCATGCTGGACCACAGCCGAAGCACCAAAGCTGCCAGTGAGAAGAA ATCAAAAGGGCTGGGGGAGTCTCGCAAGGATAAGAAATAGCGGTTAGCGGCCGGGCGGGGGGTCGGGGGT CTGCGACGGAGTCCTCCAAAGGCTCTCAGGTGGTGGTCATCGAGATGGAGCTTCGCAAAGATGAGCAGAG CTCGGAGCTCCGGCCTGCAGTCAAGTCCCCAGTAGAACCAGCCTCAAGAACGCCTCAAGAACATGATGGG CCTGGACTCGGACAAGTGACCGTCACATCCAGGCCCTGTCAGAGCAGGGGACCTAGGCTCCTCTTTTTCC CGGGTCTAGGTGCTTTCCTCTTGCTCCTCAGCCCTGCCCTGCCCTTACCTCCCAATGAGATGTAAAGTTT CATTCCAACCTTCCTTTCCAAGTCTTGTACTCCTCCTTCGCCTTTACCCCTCGGCTTTCCAGGAGCCTAG GGACTAACCCTACTCCTCGCCTGCCCCAAGGGCTGTGTGTTTGGTGCCTGTCCCTCAGACACCGAGAAGA AAGGGACCTTGATAGCCTCTGCCCAACTCCAGGCCACTTGGCTTCCCATCTCTCCCCCCCCCCCCCAGCT GTCCCCTGGCTCCTTCCTGCTCTCCCTTTCCTACCTTCTGGTGGCCCAGCTCCACACTCTGTCCTCGGGC TCAAATCCACATCGTGCAGAGCAGACTCTCCATCAGGGTTTATTTAGGTTGCTGAGTATTTTTTATTTGC CCATCCATTCTTTCGTTTGTTTACCTGAGCCCAGGCCCCATGACCGAGGACCAATGACGTCATGTAACTT TTGCAGTTCCCACTAAGTCTTTACTGGAGAGCCAGGCAGGCAAGCAGCGCATAATCGATGCCTCTGACCA CTCGGAGCACAGTTCTGGACTCCGAGATTTGGGGAAGGAAAGAAAAAAATGGATCC

Hormona de crecimiento humana:


GTCGACCTTTATTTCAGAATTCAGTTTAATGACTGAATGTTCAGTCAACAAAAGGTGATTGTGAGTCATC AAAGCGAGCACTACTGTCTGTCACCATGAAAACCTGAACACATGTCAAACTGTCGGTGTGAACATTTCTG TCCCGACTCATTCGTGAGCATGTGCGTTCAAAGTGACTTCTCTGTGGATGAAAGCTCGAATAAAATCTTT TCACCTGAAAAATTTGATTTGATGTAAATATTTTGGAGTTTTTGAAAACTTTACATTAGATCTCCTTTTA AATGTTAACAAACATGTTGGATGTCAGAGCACTTTAGTCACCAGCGGTGTGTTTTTCATGTAGCATCAAT ATGATGATTGAGGTGTTAATGTTAATTAGACTTAGACACACGTGTTTGCTCATGTCACGTTTCTCCTGAT GAATTTAAACATCTAGTTTTCAACTATAAAAGCAAAAACTCTGAGCTGAAAACATCAGAACCACCGACTC ACATCATAATCATCTGAGCCGCAAACAGAGCCTGAACTGATGCCAGCCATGAACTCAGGTAAGACATCTG GGCTCCCCCACGAGAAGGGACCACTGCTTTATGATGTTTAACAAAGTCTGAAACTGTCTGTCTGTCTGTC TGTCTGTCTGTCAGTCGTCCTCCTGCTGTCGGTTGTGTGTTTGGGCGTCTCCTCTCAGCAGATCACAGAC AGCCAGCGTTTGTTCTCCATTGCAGTCAACAGAGTCACGCACCTGCACCTGCTCGCCCAGAGACTCTTCT CGGACTTTGTAAGCCTGCAGCAGCTCAACAATCTTTCTTCTTTCTGAAAAAGACCAAATGTTACCTAAAT CAAAGCTAATGCACAGGACAGAAACTAGGTTCAAAATACGTTCAACAAAATGTTCTGGATATTCAGTGTG TGCAGTGAGTTTAGATGCACACAGACATATGGACACATTTCACATTTGATGTCAAGGGAACCGAGACACT TTGTAGACTGTCACTGCTAAAAACACAGCAGACGTTTACACTTTACATTTTAATGACAGTCAGCTATAAT CTCAGGATATTCAGTTAAGAATTATGAAACGATATTAAAATTTGCTGTCAGTCAATAAAACACAGGTATT CCTGTGTATTTTGTGTATTTCTGTATGCACCTGTGTATTTTTGTGTGTTACCATTCTTTAATTCTACACA TGTCATAGGAGAGCTCTCTGCAGACGGAGGAGCAACGTCAGCTCAACAAAATCTTCCTGCAGGACTTCTG CAACTCTGATTACATCATCAGCCCGATCGACAAACACGAGACGCAGCGCAGCTCGGTCATTAAACTACAC AGTACTACGCAACACTGCACAGCAGTACACAGTACTACACAGTACCAGAGGTACTCTGCCCATGCGATAA TCTTCTGAAGCTGTTGTCTGCTTATTGATGGGTCACAGGTCCTGAAGCTGCTGTCGATCTCCTATGGACT GGTTGAGTCCTGGGAGTTTCCCAGTCGCTCTCTGTCTGGAGGTTCCTCTCTGAGGAACCAGATTTCACCA AGGCTGTCTGAGCTTAAAACGGGAATCTTGCTGCTGATCAGGGTGAGAAGATAAATTGCACAAACATATT GCTCCATGCATGGTACCAATGCGACTAACCACCTGACTCTACAGGCCAATCAGGATGAAGCAGAGAATTA TCCTGACACCGACACCCTCCAGCACGCTCCTTACGGAAACTATTATCAAAGTCTGGGAGGCAACGAATCG CTGAGACAAACTTATGAATTGCTGGCTTGCTTCAAGAAGGACATGCACAAGGTGAGGTAGTGGATAATGG TGATGTCACTGTGATGATGACAATGATGTAATGATGGTGAAGATGACATTTTTGTTGCAGGTGGAGACCT ACCTGACGGTAGCTAAATGTCGACTCTCTCCAGAAGCAAACTGCACTCTGTAGCTCCACCTAATATTGAT ACTGATACGTGCTCTGTAGCCCCACCCTCATGTTGGCAAACTCTGCTTACATGTGTTAGCATTAGCAATA GGATAATAATAGCAGTGGTAATCGTGACATCAGAAGTTTTTCTGACATAACTGTGATGCAAGGTGTGAAC GGGAATAATGTTATTCTGTGAAATAAATGTGTTGCATTGATGTGTGGAGTCTGTTCTTTCTGATTTATTT GGAGAATTTATTCTCTATCCTGTGACTTCTTACACAGAAACACATGCTGACGTGAGCTGAGGTCCATATC GATGGCAGAAAAACTGACTCGAACATGTCAGCTTAGAAATGATCCTCTTATGGCCTCTGACAGTGGACTC GTCTCTGTGCTTGTCCTGCTAGACCTCAGTGCAGCGTTCAATACTGTCGAC

 

Dogma central de la biología molecular: la información siempre va del AND al ARN y posteriormente a las proteínas. Aunque existen algunos virus que toman el RNA como molde para formar una DNA-polimerasa, la transcriptasa inversa (Prats 2005). Gen: es un segmento de ADN que contiene un código para secuenciar y regular la expresión de aminoácidos de una cadena de polipéptidos, aunque para la mayoría de los genomas en las células eucariotas hay pocos genes que codifican de forma continua, están interrumpidos por secuencias que no codifican llamados intrones (Nussbaum 2008).

NCBI o “The National Center for Biotechnology” se podría decir que es una base de datos la cual proporciona información biomédica y genómica que tiene por objetivo promover la ciencia y la salud proporcionando información biomédica y genómica. Proporciona a los investigadores un mejor acceso de herramientas de análisis e informática para avanzar en la comprensión de la genética y su rol en la salud y la enfermedad. Tiene sistemas automatizados para almacenar y analizar conocimientos de biología molecular, bioquímica y genética, facilita el uso de bases de datos y software, recopila información sobre biotecnología a nivel nacional e internacional, realiza investigaciones sobre métodos avanzados de procesamiento de información en computadora con el objetivo de analizar la estructura y función de moléculas que son importantes biológicamente. Algunos de los temas y herramientas que proporciona son análisis de genomas completos, bio programación neurolingüística, grupos de ortólogos (especialistas en


la gramática que establecen normas de pronunciación correcta de los sonidos de una lengua), software de análisis genético, base de datos de variantes de histonas 2.0 ( para explorar diversidad de proteínas histonas y sus variantes de secuencia en muchos organismos), IBIS (servidor de interacciones biomoleculares inferidas), LogOddsLogo (aplicación basada en web diseñada para simplificar la generación de logotipos de secuencia a partir de alineaciones de secuencias biológicas), MutaBind (evalua los efectos de las variaciones y mutaciones de l enfermedad en las interacciones proteína-proteína solo para complejos solubles), MutaGene (herramientas de investigación para el análisis de mutaciones) SNPDelScore (combina múltiples métodos para anotar los efectos nocivos de las mutaciones no codificantes en el genoma humano) y estructura (estructuras tridimensionales de biomoléculas que proporcionan mucha información sobre su función biológica y las relaciones evolutivas). Bibliografías:   

Nussbaum R, McInnes R y Willard H, “Thompson y Thompson Genética en Medicina”. 7ª. Edición. Editorial Elsevier Masson 2008. Prats G, “Microbiología Clínica”. 1ª. Edición. Editorial Medica Panamericana 2005. Centro Nacional de Información Biotecnológica.

Secuencia de bases nitrogenadas de proteínas%2c dogma central de la biología molecular%2c definición  
Secuencia de bases nitrogenadas de proteínas%2c dogma central de la biología molecular%2c definición  
Advertisement