Issuu on Google+

Belg ie-Belg ique

P.B. 8700 TIELT 1 3/4615

ONZ£

VOOROUD£RS Website VVF- Tielt http://www34.brinkster.com/vvftielt

cL

onzevoor voorouders. ~. ons

Driemaandelijks tijdschrift van de Vlaamse Vereniging voor Familiekunde Afdeling Tielt. 9de jaargang ·nr. 1 - januari 2006 Afgiftekantoor Verantwoordelijke

8700 TIELT 1

uitgever: Lucien Ailliet, Schuiferskapelsesteenweg

29 - 8700 TIEL T

*~Tlelt


ONZE VOOROUDERS Is een genealogisch tijdschrift en informatieblad verschijnt, telkens bij het begin van het kwartaaL

uitgegeven door de WF

- afdeling Tielt, dat driemaandelijks

Ons werkgebied valt samen met de (deel)gemeenten van het vroeger bestuurlijk en kiesarrondissement Tielt (Aarsele, Ardooie, Dentergem, Egem, Kanegem, Kooiskamp, Markegem, Meulebeke, Oeselgem, Ooigem, Oostrozebeke, Pittem, Ruiselede, Schuiferskapelie, Sint-Baafs-Vijve, Tielt, Wakken, Wielsbeke, Wingene en Zwevezele) daarbij aansluitend Gottem, Lotenhulle, Poeke, Vinkt en Wontergem. De abonnementsprijs bedraagt 4,00 Euro per jaargang voor de leden van WF-Nationaal die inwoner zijn van ons werkgebied en voor aile leden van de Heemkundige Kring de Roede van Tielt. WF-Ieden uit andere arrondissementen en niet-WF-Ieden ontvangen onstijdschrift voor minimum 6,50 Euro (voor leden uit het buitenland 10,00 Euro). Het abonnementsgeld kan gestort worden op rekening 800-7026810-14 van WF Schuiferskapelsesteenweg 29 te 8700 Tielt. Een vrijwillige surplus als steun is zeer welkom !!!!

-

Afdeling

Tielt,

Redactieadres: Fons Das, Luxemburglaan 18, 8700 Tielt, tel.: 051/40.22.83, fons.das@telenet.be Voorzitter: Luc Neyt, Luxemburglaan 21, 8700 Tielt, tel.: 051/40.60.75, Ineyt@belgacom.net Secreta riaat: Lucien Ailliet, Schuiferskapelsestwg. 29, 8700 Tielt, teL/fax.: 051/40.11.36, I.ailliet@tiscali.be l.okaal: Huyse Aleydis, vroegere Sint-Lucaskliniek, Beerneg em stra at 5, 8700 Tielt Openingsuren: elke eerste en derde zaterdag van de maand van 9 tot 12 uur, of na telefonische afspraak met de heer Lucien Ailliet, secretaris. Voor verdere informatie in verband met de opgenomen artikels en bijdragen, gelieve contact op te nemen met de redactie. Elke auteur is verantwoordelijk voor de inhoud van zijn artikel. Overname van teksten toegestaan met vermelding van bron en auteur.

Inhoud: - Huwelijksdispensaties uit het Decanaal Archief Tielt - deel 3 (slot) Luc Neyt, Luxemburglaan 21, 8700 Tielt

3

- Onze Voorouders - Onze Familienamen, slot Paul Callens, Waterstraat 18, 8740 Pittem

7

- De Masschelins: steeds herbeginnen Dirk De Wever, IJzerlaan 26, 2500 Lier

12

- Nieuwe publicaties

16

- Vraag en antwoord

17

- Activiteitenagenda

18

Een gelukkig nieuwjaar wensen we aan al onze trouwe WF-Ieden. Moge 2006 een vruchtbaar jaar zijn voor uw opzoekingen, hetzij in een archief, hetzij in een documentatiecentrum van een van de afdelingen van de Vlaamse Vereniging voor Familiekunde.

2


Huwelijksdispensaties

uit het Decanaal Archief Tielt - deel 3 (slot)

31. Verzoekschrift van Marie Therese De La Houttre fa Joan nes bij Marie Therese De Rynck (fa Jacobus) jonge dochter .ontrent 21 jaar wonende tot Tielt - appendante vrijlaeteresse van Ardooie, mits het overlijden van haar moeder en dies haeren vader nu al hedent acht jaeren is gemist ofte absent, als niemand wetende waer hij is vetirocken, om te mogen huwen met Joannes Claeijs fs Jacobus jongman wonende te Tielt. Francies De La Reu (fs Joseph) landsman tot Tielt en Sieur Remisius De La Houttre koopman garensnijder tot Kortrijk beide voogden pater en materneel gaan akkoord. Baronie en heerlijkheid van Ardooie 12 april 1788. 32. Verzoekschrift van Lucas Galant fs Bernardus 24 jaar jongman poorter van Kortrijk en wonende op Tielt-Buiten om te moqen huwen met Catharina De Blaere ook tot Tielt. Carolus Joannes Vermeulen en. Jeanes Baptiste Goethals voogden pater en materneel respectievelijk wonende in Meulebeke en in Tielt gaan akkoord, mils suppliants vader en grootvader overleden zijn. Stad Kortrijk 2 mei 1788 - 7 mey hora 9掳 (om 9 uur) 1788 E.L. Vijvens pastoor 33. Verzoekschrift van Francis Van Houtte fs wijlen Pieter bij Goddelieve Verkindere minderjarig tot Tielt-Buiten, buitenpoorters van Kortrijk om te mogen huwen met Caroline Vercoutere ook tot Tielt-Buiten wiens vader Judocus en moeder nog in leven zijn. Sieur Pieter Verkindere grootvader en voogd materneel en Frans Vanhoutte voogd paterneel tot Houthave gaan akkoord. De suppliant (= Francis Van Houtte) brengt 350 pond groten binnen het huwelijk en dit volgens de staat van goed gepasseerd over acht a tien jaar en de inbreng van de future bruid bedraagt 50 pond groten. Stad Kortrijk :3 mei 1788 - 3 mei 1788 Vijvens pastoor in Tielt. 34. Verzoekschrift van Goddelieve Goethals fa wijlen路 Pieter 22 jaar jonge dochter poorteresse van Kortrijk wonende op Tielt-Buiten, om te mogen huwen met Franciscus Dobbels meerderjarige zoon van Joannes totMeulebeke. Suppliants moeder, Joannes Baptiste Goethals haar broer en Joannes Baptiste Goethals haar rechtsweer pater E~n maternele voogd respectievelijk wonende op Tielt-Buiten en Wingene, mits suppliants vader en grootvader overleden zijn, gaan akkoord. Stad Kortrijk 29 april 1788 - 6 mei 1788 pastoor Vijvens. 35. Verzoekschrift van Cecilia Vercruijce fa wijlen Jacobi (overleden Tielt) ongeveer 25 jaar bij Marie Jacoba Vande Kerckhove; om te mogen huwen met Franciscus Emanulel Juts geboren te Zwevezele en woonachtig te Tielt. Haar moeder en haar twee voogden Philippus Jacobus Vercruijce en Joseph Vande Kerckhove haar broer en oom gaan akkoord. Stad Kortrijk 28 juni 1788. . 36. Petrus Maria, zoon van Guillelmi, eertijds geboren uit Ludovici Betaz en Marie Philiberta, eertijds dochter van Stephani Perron en zijn echtgenote, is gedoopt geweest op de 29ste maart in hetjaar 1764, waarvan Petrus Maria, zoon van Guillelmi Vierin, 19t Agata, echtgenote van Joannis Pantaleonis Darbelley, 'beschermers' geweest zijn. Ter waarmerking, ten bewijze. .Joannes Franciscus Bovet, 'verzorger van de eeredienst' (=curatus)

3


Ik bezweer daarenboven dat de voormelde Petrus Maria Betaz, mijn parochiaan, atkomstig van vrome, rechtschepen en orthodoxe ouders, wiens vader sinds 3 jaren uit het leven 'weggerukt' is, vrij is en van elke huwelijksband, voor zover die kan bekend worden, losgemaakt en dat hij door zijn eigen moeder persoonlijk onder deze zaak ondervraagd, toegelaten is een echtgenote aan zich te binden, waar hij ook wil. 1 ste Ter waarmerking daarvan gegeven teVailisgrisenchiae op de 20 dag van de maand juli in het jaar 1788. Joannes Franciscus Bovet, vertegenwoordiger van de genoemde 2 . plaats (=parochus) . 37. Verzoekschrift van Francis Dominicus De Meijer fs Guillaeme weduwnaar wonende tot Meigem en Pieter Decock tot Ruiselede en Pieter Blancke tot Tielt als voogden over de minderjarige weze Marie Isabelle Blancke fa Joannes bij Angeline De Cock beide overleden, oud 20 jaar en wonende tot Tielt, om te mogen huwen met Marie Isabelle Blancke. "De apparenten bruijdegom vint sigh geplaceert op eene hofstede groot meer dan seventhien bunderen ... ende elsoo grooteJijckx is gepresseert ende het huweJijck nootsaecke/ijck is hebbende ende ten anderen dat het selve huywelyck grooteJijckx voordee/ig ende profitig voor de geme/de weese moet aansien worden verhopende dat UE geene difficulteij en sullen maecken over d'absentie van den tweeden suppliant Pieter de Cock voogd materneel vermits hij door syne gedeurighe quellinge ende sieckte geensints capabel is de voiage te ondernemen". Stad Kortrijk 25 juli 1788. 38. Verzoekschrift van Brigitta Vande Wyngaerde fa wijlen Jacobus buitenpoorter van Kortrijk bij Marianne Vanhulle, nog in leven, jonge dochter 24 jaar tot Tielt-Buiten, om te mogen huwen met Guillelmus Vergote fs wijlen Guillelmus oud 28 jaar en wonende tot Meulebeke. Haar moeder Marianne Vanhulle samen met Pieter Verstraete tot Pittem en Pieter Vanhulle tot Tielt-Buiten ondertekenen het huwelijkscontract en gaan met het huwelijk akkoord. Stad Kortrijk 18 oogst 1788. 39. Ferdinandus Sigers J: V: L: Canonicus ecclesia Cathedralis Sti Bavonis Officialis Gandensis'' etc. Noe De Clerck en Catharine Van Maele vragen op 18 december 1711 dispensatie aan, wat zij op 7 januari 1712 verkrijgen. 40. Vertaling van de aanvraag van pastoor Van Herreweghe van Bellem om dispensatie te bekomen voor een van zijn parochianen (de naam van deze parochiaan wordt niet vermeld), 20 juni 1740. De bisschop verleent dispensatie op 22 juni 1740. Een stukje uit de vertaling: "De genoemde, in het huwelijk verbonden en berouw hebbend over zijn schulden (zonden),. en in ruil voor redding (vergiffenis) door boetedoening zijn toevluchl nemend tot het heilige en zo de rechtspraak ontvluchtend, bekent (erkent) dat hij ge/eid werd door waanzinninge (ontzaglijke) lust. Hij heeft de moeder van zijn eigen echtgenote v/eseJijk (Iichamelijk) leren kennen, omwille waarvan hij het recht op het vragen (eisen) van de echte/ijke verplichting ver/oren heeft4.

Wie kan de plaats "Vallisgrisenchiae" lokaliseren? De originele Latijnse tekst is te raadplegen in het documentatiecentrum Betaz, G 377. Met dank aan de heer Wim Popelier uit Tielt voor de vertaling 3 Kanunnik van de kathedrale kerk van Sint-8aafs in Gent. 4 De intergrale Latijnse tekst kun je raadplegen in het documentatiecentrum Van Herreweghe, G 378. Met dank aan Wim Popelier uit Tielt voor de Latijnse tekst en de nag minder 'traditionele' inhoud. 1 2

4

van WF-Tielt, fonds Desomviele van deze tekst. van WF-Tielt, fonds Oesomviele vertaling van deze niet klassieke


41. Verzoekschrift van Isabelle Valcke fa wijlen Joseph bij wijlen Catharine Rigolje, buitenpoorters van Kortrijk, 24 jaar tot Tielt, om te mogen huwen met Joannes van Ryckegem meerderjarige timmerman tot Tielt. Jacobus Vande Kerckhove voogd paterneel tot Tielt en Pieter Rigole voogd materneel tot Pittem gaan akkoord. Er werd een huwelijkscontract afgesloten. Stad Kortrijk 18 november 1788 - 25 november 1788 E. L. Vijvens pastoor 42. Verzoekschrift van Agnes Wulfvaert fa wijlen Joannes buitenpoorter van Kortrijk bij Monica Bauwens nog in leven, 21 jaar tot Tielt-Buiten, om te mogen huwen met Francis Van Houtte wiens beide ouders nog leven. Voogd (uniquen): Pieter De Backere materneel tot Tielt-Buiten. Stad Kortrijk 27 oktober 1788 - 30 oktober 1788 E. L. Vijvens pastoor 43. Rekening ten sterfhuis van Joanna Lambert die hem moeten valideren jegens den disch van Thie/t over het derde van het goet bij dito Joanna ge/aten. Aansluitend bij deze rekening stamboom van Petrus Snauwaert en Isabelle Lambert om dispensatie te bekomen: Joanna Vander Ougstrate en haar zus Maria Vander Ougstrate huwt Franciscus Bauwens huwt Arnaut Lambert waarvan Judocus Bauwens waarvan Petrus Lambert huwt Elisabeth Vermeersch huwt Joanna Vermeersch waarvan Jacoba Bauwens waarvan Petrus Josephus Lambert huwt Cornelis Snauwaert huwt Barbara Eijns waarvan Petrus Snauwaert waarvan Isabelle Lambert Dispensatie van 6 september 1782 .: 44. Verzoekschrift van Jacobus Frans David tot Ruiselede fs wijlen Pieter bij wijlHn Pieternelle Scheirens 23 jaar, om te mogen huwen met Isabelle Rosa Desauw weduwe van Andries Van Laere. Emanuel David voogd paterneel en Augustin David voogd materneel gaan akkoord. Stad Kortrijk 23 december 1788 - 27 december 1788 E.L. Vijvens pastoor. 45. Verzoekschrift van Catharina Poelvoorde fa Pieter bij Marie Anna Sevenhanck tot Tielt 24 jaar, am te mogen huwen met Augustinus de Conynck fs Lodewyck oak tot Tielt en nag minderjarige jonge man. Charel Sevenhanck voogd paterneel tot Wingene en Pieter Vercruyce voogd materneel tot Tielt gaan akkoord. Heerlijkheid Tomme in Tielt-Buiten 9 april 1789. 46. Verzoekschrift van Rosalia Vanderstraete fa wijlen Benedictus bij Anne Mariie Eeckhaut, 24 jaar, am te mogen huwen met Franciscus De Ruddere fs Adriaen wonende te Tielt-8uiten. Haar maeder, Joannes Francis Vanderstraete oom en voogd paterneel en Joseph Bonte naaste bestaande vriend en voogd materneel gaan akkoord met dit huwelijk. Heerlijkheid Gruythuyse 16 april 1789 - 2 april 1789 pastoor Vijvens. 47. Verzoekschrift van Marie Anne Wille fa wijlen Pieter bij Jacoba Magdelena Degrandle nog in leven 23 jaar tot Tielt-Buiten, om te mogen huwen met Pieter Vandewalle tot Kanegem. Haar moeder Jacoba Magdelena Degrande, Francis Vandergucht voogd materneel en haar stiefvader Frans Merhaege gaan akkoord. Appointernent'' stad Kortrijk van4 mei 1789. 5

Appointement

= overeenkomst. 5


48. Verzoekschrift van Catherina Callens fa wijlen Martinus overleden buiten poorter op Tielt-Buiten bij Godelieve Theresia Van Kersbilck (fa Joannes) 25 jaar, om te mogen huwen met Joseph Van de Vijvere fs Joannes weduwnaar zonder kinderen landsman tot Tielt-Buiten. Haar rnoeder Godelieve Theresia Van Kersbilck, Gillis Callens fs Martinus tot Roosebeke voogd paternaal en Emanuel De Backere tot Tielt voogd 6 ' materneel geven hun consent. ' , Appointement Stad en Kasselni Kortriik 20 juni 1789. 49. Verzoekschrift van Livinus Hoste tot Tielt aan pastoor Vijvens tot Tielt die zich verzet tegen een eventuele ondertrouw van Brigita Masgou met een zekeren N.... Ondertekend met het merk van Livinus Hoste in aanwezigheid van Thomas Apers en Joseph De Witte. 1 april 1790 Wauters - 17 april 1790.

50. Afstarnrnelingen van Anna de Meulenaere en van Maria D'Haene. Anna de Meulenaere huwt Jaspari de Smedt waarvan Judocus de Smedt huwt Catharine Seroels waarvan Anne Marie de Smet Starn boom Franciscum

Maria D'Hane 7 Joannes Baptiste Vaerman waarvan Maria Theresia Vande Piete huwt Ludovicus Vaerman waarvan Franciscum Ludovicum Vaerman

Ludovicum

Vaerman en Annam Mariam De Smedt

is de zuster van Marie Vande Keere huwt Jaspart de Smet waarvan Jaspart de Smet huwt Anne De Meulenaere waarvan Judocus de Smet huwt Catharine Seroels waarvan Anne Marie de Smet Dispensatie van 10 februari 1766.

Judoca Vande Keere huwt Joannes Vander Piete waarvan Maria Vande Piete huwt Ludovicus Vaerman waarvan Franciscus Ludovicus Vaerrnan

t.uc Neyt

Vierde Familiekundige

Wandelzoektocht,in

Wingerie

i.s.m. Gemeentebestuur Wingene en de Heemkundige Kring "Ons Wingene" Mooie prijzen voor de winnaars Start op 6 december 2005 tot 7 maart 2006 Deelnameformulieren

gratis te verkrijgen tijdens de openingsuren:

Gemeentehuis, bibliotheek en cafetaria zwembad Wingene, Kantoor Bolliou, Kerkplein 16, Wingene, Lokaal WF-afdeling Tielt, Beernegemstraat 5, Tielt.op zaterdagen 17 december 2005, 7 en 21 januari, 4 en 18 februari en 4 maart 2006 van 9 tot 12 uur. Bekendmaking

6 7

Consent

= toestemming.

, Verkeerdelijk

6

winnaars op zondag 12 maart 2006 tijdens de teTielt '

-

genoteerd, in plaats van Vaerman lees je Vande Piete.

t"

familiekundige

boekenbeurs


Onze Voorouders - Onze Familienamen Slot. Van Hamme: ~ Ham(me) van; van der Ham, van Hame, Wanham, Vahamme, Ham: 1. plaatsnaam Ham bij路 Aarschot of Diest, in Neerwaasten, Gent, Hoepertingen of Hamme.1321 Wolterus de Ham. 2. Korte vorm (zonder lidwoord) voor Van den Hamme, plaatsnaam Ham, met de zelfde betekenis: landtong, uitspringend in inundatiegebied. 1424 Adaem van Hamme ... metser = Adaem van den Hamme ... metser, Kortrijk. Zie ook Verhamme. ~ Verham(me),. Veramme, Veremme, Voorharnrne, Verheem: uit Van der Hamme, naast Van (den) Hamme. In 1319 ter Hamme bij Menen. 1398 jan van der Hamme, Wevelgem. Beele: Hem, arr. Rijsel, voor 1225 steeds Ham gespeld. Van Kammen (0 Spijkenisse): ~ ? Overeenkornstiqe narnen : ~ Kam, (de); de Cam, Kamm: 1. Beroepsbijnaam van de kammaker of kammer. 1375 here Michiel den Cam, leper. 2. Decam kan een spelling zijn van Descamps, Decamp(s). Zie Deschamp(s). ~ Kam, van (der); van (der) Cam, van der Cam(m)e, van der Cammen, Vercamme(n), Vercam, Verkammen, Verkem. 1. plaatsnaam, Middelnederlands camme: brouwerij. 1331 Ghisel van der Kammen, St.-Pieters-Leeuw. 2. Van Kam I Van Gam kan best een variante zijn van Van Chaam. ~ Deschamp(s), Deshand, Deschamp(s), de Schamp, Des(s)chans, Tusschans, de Schans, ... Deschanck, Derschamp, Duchamp(s), Duchampt(s), Duchant, Dichamp, -ant, Decamp(s), Decams, Descamp(s), Decarnpis), .Descampe, Descampt, Decam, de Kam(p), Decanck, Decan(c)q, Decang, Decamk, Decant, de Gang, de Can(d)t, Descan(s), Ducamp(s), Dequan(t), Dequand, Le Cam, Le Quan(g), Lescan: plaatnaam Frans champ, Pikardisch camp: veld, vergelijk met (van de) Kamp, van de Velde. De vormen met -anck, -ancq of -ang zijn te verklaren uit de Westvlaamse uitspraak van Descamps als "de(s)kang:". Verspreide plaatnaam. 1230 Rogero des Cans 1242 Rogero de Camp is.

=

-7 Keersbilck, (van); (van) Keersebilck, van Keersbulck, van Keirsbil(c)k, -

Vankeirsbilck:

bilcke, -belck, van Kiersbilck, (van) Keirsbulck, Keirs(e)bilck, Keirsbelik, Keirsebilk, van Kersbilck, Kiersebilck, (van) Kersbulck, van Kesbeulque, van Keirsebinck, van Keisdelck, Kisbilcke, Kesbulg, Kisbulck, Verkeersbilck: ..plaatsnaam in Koolkamp, Lissewege, Waardamme; in Roeselare: 1584 den Keersebilck. 1368 Jhan van Kersbelc Jhan Kersbelck, Kortrijk.

=

Van Laecke: ~

Lake(n), van; van Lae(c)ken, van Lacken, van La(e)rken, van Larken. 1. plaatsnaam Laken; 1295 Janne van Laken, Antwerpen. 2. Korte vorm voor Van der Laeken, zie van de Laak. ~ Laak, van (detrj); van Lae(c)ke, van Lae(c)ken, van Lake(n), van La(e)rken, Lake, van der Laeken, Verlaecke(n), Verlaeken, Verlaak, Verlaek,

7


Verlaeckt, Verlack(t), Verlaet, Verlat: plaatsnaam ten/ter Lake: poel, plas, waterloop in moerassig terrein; Laak in Gelderland, Drente, Overijsel en Nederlands-Limburg. ter Lake in Dinslake (bij Dusseldorf), in Assebroek, Knesselare, Premesques (arrond. Rijsel, Auelmes (arrond. St.-Omaars), lulte, La Laque in Arlen en Isbergues. 1248 Walterus de Lake, Oostrozebeke. Van Loocke:

-7 Look, van; van Looch, van Loock(e) , van Lake, van Looke(n), van Locke, van Leuken, van de(r) Loo(c)k, van Loco, Verloock: plaatnaam look: omheining, omheinde ruimte. 1394 Gielijs vanden Loeke, Aartselaar. Beele: Look: 1281 Griela Loec. Waarschijnlijk, evenals de toenaam lac, te verklaren uit het Middelnederlands Looe, lake: look; vergelijk de toenaam Locashouad en Locshouet, uit Middelnederlands Loocshovet: lookbol. Semantisch te vergelijken met de toenaam CibeliChibole. lie ook de Looketere en vergelijk de toenaam Loocmante Sint-Winoksbergen.

Van Maele: -7 Maele, van de; van de(r) Maele, van de(r) Maile, van Mael(e), (van) Male, van Maile, Vanmale, Vermael(e(n)), Vermal(en): plaatsnaam Male: zak, depressie. Male in St.-Kruis, De Ma(e)le in Deerlijk, Kemmel, Tielt, Vlamertinge, Voormezele, lwevezele. 1392 Heinricks landt van den Male, Kortrijk. 1394 Grielkin van den Male, Egem. lie ook Van (de) Maile, De Maele. -7 Maile, van (de(r); van Mal: 1. plaatsnaam Oostmalle of Westmalle. 2. plaatsnaam Mal. 3. zie ook Van de Maele. -7 Demal, Demalle, Mal, de Mael(e): 1. Franse vorm voor Van Ma(e)le of van Mal(le). 1280 Lambertus de Male, leper. 2. zie de Mal Beele: Male, van (der/den): Naam van een heerlijkheid te Voormezele, Vlamertinge en Kemmel. Van Oost: -7 Oost, van; van Oosts, van Oist, van Hoost: 1. plaatsnaam Oost(Noord-Brabant, Noord-Holland). 2. naar de woonplaats ten oosten van een plaats, van een dorp; naar de herkomst uit het oosten. Vergelijk Van Oosten. 1366 ver Margrieten van Oest, Kortrijk. -7 Oosten, van; van Hooste(n): naar de woonplaats ten oosten, naar de herkomst uit het oosten. Of variante voor Van Oost. 1565 Hans van Oosten, Oost-Antwerpen. Van Overbeke:

-7 Overbeke, (van); (van) Overbeek(e),

van Overbeck(e), Overbeck, van Overbecque, van Heuverbeke, (van) Hoverbeke, Houderbeke: plaatsnaam Overbeke: over de beek, bijvoorbeeld in Kortrijk, Dottenijs, Asper, Markegem, Melsen, Wetteren, Overbeek in Dilbeek, Geebets, Overbeken in Petegem-Deinze; Overbeek in Riksingen, Vliermaal; Overde-Beek in Reppel, Steenhuffel. 1396 Gillis van Overbeke, Geraardsbergen.

Van Parys: -7 Paris, Pary{s), Parij(s), Parie, Paries, Parisse: 1. Patroniem Paris is Frans voor Latijnse Sigerius Paris, Gent.

8

heiligennaam

Patricius.

1242


2. plaatsnaam Paris (Nederlands Parijs); zie (van) Parijs. 1607 Urbaen van Parys = 1608 Urbanus Parys, Schelle. ~ Parijs, (van); (van) Parys, van Parrys, -ijs, Vamparys: plaatsnaam Parijs, hoofdstad van Frankrijk. 1368 Sare van Parijs, Kortrijk. Van

Renterghem:

Van Robaeys:

~

Renterghem (van); van Rentergem, -ghen, van Reterghem: plaatsnaam Rentergem in Landegem. 1477 Arendt van Renterg hem, Lovendegem-Gent.

7

Robaeys, van; van Robais, van Robays, van Robaijs, Verbaeys, Verb(e)ijs, Verbays(t): plaatsnaam Roubaix (Robeke, Nord): 11Ei6 Robais. 1209 Bernardo de Rosbais, Kortrijk. lie ook Oeroubaix. ~ Oeroubaix, de Roubaix, Oroubaix, O'Roubaix, Oerobaix, Oerubaix, de Rubeis, Roubaix: plaatsnaam Roubaix. 1256 Johannes de Roubais. ~ Ook : Robaey(s), -aeyst, -aeijs, -aye, ays, Robaey(s), -aeij(s), Rabbay, Rubay, -ais, Robey, -eys(t): de 1. patroniem, Romeinse vleivorm van voornaam Robert. 14 eeuwse voornaam Robbais in Beveren-Leie. 2. Robaeys (met s) kan ook wei de plaatsnaam Robaais = Roubaix zijn. lo kunnen Rubais en Rubay varianten zijn van Roubaix (zie ook Oeroubaix).

Van Voisem: -7 Voisem, (van); van Volcem, van Voisen, van Voisom, van Volsum, van Volxem, van Volcksom: plaatsnaam Volsern. 1356 Heinrec van Volcshem = Heinrec van Volxhem, Anderlecht. Van Vooren:

7 Vooren, van: zie Voorn. & Vooren, van (de(rÂť, zie van de(r) Voorde. ~ Voorn, van Vo(o)rn: 1. plaatsnaam Voorde (Zuid-Holland). 2. lie ook van Voorden, Van derVoorde. 7 Voorde, van de(r); van de(r) Voor(d)en, van de Vorden, van de(r) Vorde, van deWo(o)rde, van de(r) Vo(o)r(d)t, van den Voort, van der Voodt, Wandervorde, Wandevoir, van Vo(o)ren, van Vuuren, Vervoor(d)t, Vervoert, Vervort, Vervuurt, Vervoir, Vervoode, Vervoot, Vervo{i)tte, Tenvoorde(n), Tenvooren, Tervoort, Tervoert, Tervooren: verspreicle plaatsnaam Ten Voorde, ter Voort: doorwaadbare plaats. Ook Voorde bij Aalst. 1368 Heinric van der Voirt opt goet ter Voirt, Turnhout. * Voorde(n), van; van Vo(o)ren: plaatsnaam Voorde bij Aalst. 1201 Vorde.

Ver

Eecke:

-7

Vereeke(n), Vereecke(n), Vereecque, Vereque, Verecke, -en(s), Verhee(c)ke(n): 1. samentrekking Van der Ee(c)ke(n). Zie Van der Eyken. 2. Soms eventueel korte vorm van Van der Vereecke. lie Van der Vreken. 7 Van der Eyken: Eyken, van der; van der Eijk, van (der) Ey(c)ke(n), van (der) Eij(c)ke(n), van der Reycken, van den Reijken, -Reyken, van der Ick(en), van der lckx, van der leck, Vanderic, van (der) Ee(c)kel1, Vonderhecken, van der Reken, van (der) Ecken, (van) Heecke, van Heek(e), Verheijke, Vereyck(em), Vereij(c) ken , Verreijke(n), Verre ijcke 11, Ver(r)ey(c)ken, van derYkem, - Ycke(n), van der Ryken, van der Rijk(en), van de(r) Rijck(e), van de Rijke(n), van de Ryck(e), van de Ry(c)ken, Van Orick, van Oriken, Veryke, Verijke(n), Verrijck, Verryck, Verrijcke(n), 9


Verrycke(n), Verrijke(n), Verryke(n), Vereeke(n), Vereeck, Vere(e)cke(n), Verre(c)k, Verrecken, Vereckens, Vereecque, Vereque, Vreeke(n), Vrey(c)ken, Vreijken, Verhee(c)ke(n), Verheck(en), (van den) Eycken, (van) Eyck, van Eecke: verspreide plaatsnaam ter Eeke, ter Eik, ten Eeke: eik. 1245 Henrico de Eke, Harelbeke. -7 Van der Vreken : Vreken, van de(r); van den Vreken, van der Vrecken, Vereeke(n), Vereecke(n), Verhee(c)ke(n), Vereecque, Vereque. 1. plaatsnaam ter Vereeke: steeneik. 2. Van der Vreken soms uit Van den Vreeckere, uit van den Vreeackere (zie Vleeracker). Vergote:

-7 Vergo(o)te, Vergotte, zie van der Goten. Daar: Goten, van der; van der Ghote(n), van der Goot(en), van der Gothen, van der Goeten, Vergo(o)te, Verghote, Vergothe, Verhote: verspreide plaatsnaam (ter) Gote: goot, riool, greppel. Variante Verhote in Noord-Frankrijk. 1378 Calle van der Gote.

Verhelst:

-7 Elst, (van der); van (den) Elst, Ter Elst, van der Est, van (der) Heist, Ver(r)elst, Verelest, Verhelst, Verest, Voorhelst: sterk verspreide plaatsnaam Elst: plaats waar elzen groeien, elzenbos. Eist bij Oudenaarde, ter Eist in Heverlee; Eist in Millen, Schepdaal, Steenhuffel, Zele; Reist in Kampenhout. 1274 Willaume del Aunoi 1281 WilJelmo de Elst, Waregem. Beele: 1268 Johannes de Alneto.

=

Verkinderen:

-7 Kinder(en), de; de Kindere, (de) Kinders, Kinder, Derkindere(n), (van) der Kindere(n), van de Kinderen, Verkinder(e(nÂť, Verkindre, Verkind(er)t, Verkyndere(n), Verkyndt, Verkainder(e): Derkindere(n) is een genetief de meervoud: van de Kinderen. 13 eeuw Aleydis Puerorum, Anderlecht. De naam werd naderhand als een plaatsnaam opgevat zodat het voorzetsel "van" ervoor kwam te staan en uit Van der Kinderen de vorm VerkinderenNerkindert ontstond. Vergelijk met het Franse Desenfan(t)s, Lesenfants, Auxenfans.

Vermeersch:

-7 Meersch, van der; van der Meers(en), van der Mersch, van der Mers(s)che, van der Meers(s)che(n), van Meers(s)che, Vandremeersch, van de(n) Meersch(e), van de(n) Meerssche, van den Meersshe, van den Mersch, van den Meessch, van der Meir(s)ch, van de(r) Meir(s)sche, van der Meirtsche, van der Meesch, van der Mesche, van Meessche, van der Messe(n), -Misse(n), van der Meets, van der Meys/Meijs, van der Mest, van der Miers, van der Mies, van der Mies(e), van der Miege, Miege, Vermeers, Verm(e)rsch, Vormers, Vermeerschen, Vermeerch, Vermeers(e)h, Vermeirs(ch), Vermeirsche, Vermei(r)ssen, Vermeers(s)en, Verme(e)sen, Verme(e)s(ch), Vermeys, Vermiesch, Vermes, Vermesse, Vermis(sen), Me(e)rs: verspreide plaatsnaam ter/de Meers(ch): beemd, alluviaal land, vooral langs een waterloop. 1316 Gillis van der Mersch, Kortrijk. 1750 Emerentia Vermeers(ch) = Vermis, Aarsele.

Verstuyft:

10

-7

Stuyf(t) van der; van der Stuijf(t), van der Struyft, Verstuyf(t), Verstuyff, Verstuijf(t), Verstuft, Verstruyft, Verstuyven: plaatsnaam Stuive, Stuif(t): zandverstuiving, stuifzand. Vergelijk met Stuyvesant. 1629 de Stuyve, Kooiskamp. 1631 Joos van der Stuyve, Kortrijk.


Vertriest:

~

Vervaeke:

Tries(t), Trist(e), van (der) Triest, Vertriest, Verthriest, De Triest: plaatsnaam (ter) Triest, Driest: onbebouwd land. In Assenede, Rekkem, Wielsbeke, Bavikhove, Oostnieuwkerke, Ooigem, Moortsel, Wieze, Koningshooikt, Tisselt, Ukkel, Boechoute. 1267GiHes del Triest. ~

Vervaek(e), Verva(e)ck(e), Vervaekt, Vervackt, Vervaque, Vervalcke, Vervarcke. 1. Vander Vake. Plaatsnaam Vake. lie Van Vaek. 1544 Antheunis van der Vake, Kortrijk. 2. Adaptatie van plaatsnaam Fervaqeus. lie Farvaque. 1291 Biertous dHS Farvakes, Flines. Daar: Van Vaek: Vaek, van, van Va(e)ck: plaatsnaam Vake: vlechtwerk als afdamming in een beek. Va(e)ke in Maldegem, Wielsbeke, Vaeken in SintLaureins; 1568 Wouteren van Vaken = 1575 Wouter van Vaecken, Schelle. Farvaque: Farvaque, Farvacque(s): plaatsnaam Farvacq in Ellignies-Ste-Anne (Henegouwen) of Fervaques in Fonsommes (Aisne); ook La Fervaque in Peronne (Somme). 1291 Biertous des Farvakes.

~

Vroman:

~ Vromant, Vromand(t), Vroman(s), Vromanne, Vromen, Vroeman(s), Vroumans, Vroomans, Vrommant, Vromman(d), Fraumont, Fromond, -ont, Vrammont, Vermand, Vermant, Vermang: patroniem, Germaanse voornaam fr6da - rnundo "wijs - bescherming". De vormen met -man zijn door remterpretatie te verklaren; 1348 Jehans Vroemont, Kortrijk.

Vyncke:

~ Vink, Vinke(n), Vinck(e), Vincken(s), Vincke, Vynck(e), Vijncke, de Vinckte), de Vynck, (de) Vijnck, (de) Vincq, Vinc(k)x, Vincze, Vinks, Vin(k)x, Ven(c)ken: 1. beroepsnaam naar de vogelnaam, de vink. Naar de karaktereiqenschappen (wakker als een vink) of voor de vogelvanger. 2. Middelnederlands vinke: klok die het aanmaken en uitdoven van het vuur regelde. Beroepsbijnaam voor de klokluider. 1180 Dodin Vinc, Brugge.

Ysebaert:

~

Isenbaert, lsernbaert, Isebaert, Ysebaert, IJsebaert, Ysenbaer(d)t, Ysenbaard(t), Ysembaert, Yzenbaert, Eisbart, lesberts: patroniem, Germaanse voornaam isan - barda "ijzer - baarde, bijl". eeuw Isenbardus, Hillegem.

iz"

Zutterman:

~

lutterman(s), Sutterman, Siterman, Cyterman: beroepnaam van de (Middelnederlands) sutter: schoen maker, naaier, kleermaker. 1450 Jehane Suttermans, Hansbeke-Brugge. PaulCaller1ls

Heemkundige

Kring de Roede van Tielt

Lidmaatschapsbijdrage: 17,5 euro., te betalen op rekening 000-0398411-32 van De Roede van Tielt, Stoktmolenstraat 32/3, Tielt. Secretariaat: Ph. De Gryse, Stoktmolenstraat 32/3, Tielt - (051) 40 18 38. Bibliotheek: vroegere Sint-Lucasziekenhuis, thans Huyse Aleydis, Beernegemstraat 5, Tielt. Open elke zaterdag van 10 tot 11 u 30.

11


De Masschelins: steeds herbeginnen

Ivo Masschelin ziet het levenslicht in Ardooie op 16 maart 1858 als tweede kind van Petrus, 37 jaar, smid en landbouwer, afkomstig van Wielsbeke, en Amelie Desimpelaere, 37 jaar, van St. Eloois-Vijve. Het gezin woont er in de Kasteelstraat. Petrus en zijn vrouw Amelie overlijden beiden al vroeg, respectievelijk in 1872 en in 1875, zodat Ivo op zijn 17 jaar volle wees is. Gelukkig huwt zijn zus Julie, die 3 jaar ouder is, datzelfde jaar 1875 met Constant Quequin, een jonge hoefsmid, die de zaak van zijn overleden schoonvader kan heropstarten. De jonge Ivo bekwaamt zich thuis verder in hetzelfde yak. Enkele jaren later, in 1883 trouwt Ivo in Meulebeke met Elodie Landuyt, de 20-jarige dochter van boswachter Henri Landuyt en Rosalia Amelia Pieters. In Meulebeke worden hun eerste twee kinderen geboren, Victor (1884) en Celina Maria (1886), die echter op de leeftijd van 23 maanden overlijdt. Het gezin verhuist in1886 naar Ingelmunster op de Brugse steenweg, waar ze een smidse met herberg "In de nieuwe Smis" starten. Aldaar worden nog vier kinderen geboren, Albert, geb. 1887, Achiel, geb. 1889, Remi, geb.1890 en Joannes, geb. 13juni 1891, Tot dan toe loopt alles naar wens, maar enkele dagen na de geboorte van deze kleine Joannes slaat het noodlot toe. Zowel moeder als baby overlijden ... Ivo, als van de hand Gods geslagen, staat van de ene op de andere dag aileen in voor de zorg van vier jonge kinderen, de smidse, de herberg ... Ivo ziet het op den duur niet meer zitten ... Het bevolkingsregister van Ingelmunster vermeldt begin 1892 dat hij "zijn kinderen overlaat aan het armenbestuur en naar Frankrijk vertrekt". Hij wordt er fabrieksarbeider, in Tourcoing. Zijn kinderen worden geplaatst, deels bij verwanten. In Tourcoing werken en huizen nog heel wat West-Vlamingen en Ivo leert er Elodie Coussement kennen. Het klikt tussen hen, Elodie wordt zwanger en gaat in 1893 in Meulebeke bevallen van een dochter, Celina. Daarna zal Elodie definitief in Tourcoing gaan wonen en zullen aldaar nog twee kinderen van hen heiden geboren worden, Adolf, in 1896, en Clement, in 1898. Enkele jaren later - in 1902 - trouwt het koppel in Tourcoing, waarbij Ivo de drie kinderen erkent. Weer enkele jaren later besluiten ze terug te keren naar Meulebeke. Ivo's kinderen uit zijn eerste huwelijk vervoegen een na een terug het gezin. Niet voor lang echter. Victor, de oudste, smid van opleiding, neemt in 1905 dienst in het 8elgisch Leger, en trekt naar Antwerpen. Albert, de tweede, gaat in 1909 in Emelgem huwen met Elisabeth Callens, van Oostrozebeke, en emigreert het jaar daarop naar de V.S. Hij deelt zowel bij zijn vertrek in de haven van Antwerpen als bij zijn aankomst in New York aan de officiele instanties mee dat hij "naar zijn kozijn Patrick Lefevre gaat, in Medix Run, Pennsytvenie" 1

Medix Run is een gebied van bosontginning in de staat Pennsylvania

12


Is Albert succesvol met zijn erniqratie? Op 27 juli 1911 schrijft hij aan zijn broer in Antwerpen "ik kom u een kaart te zenden am te wefen als ge leeft of niet of als ge nag voott kwaad zijt ik peis nag altijd op hulder maar gij niet Victor gij hebl gevraagd aan Remi hoe dat wij hier nag stel/en wij stel/en het hier goed wij kunnen aile maanden 20 dol/ars naar de bank dragen tat teiet". Zulk een bericht uit het verre Amerika mist zijn effect niet, en doet diegenen die in Meulebeke zijn achtergebleven dromen ... Er worden verder plannen gesmeed. . In 1912 voigt vader Iva het voorbeeld van zijn zoon. Van Pennsylvania is er dan al geen sprake meer; Venesoen rapporteert in Antwerpen dat Iva gaat "naar zijn zoon Albert die in East Moline, Illinois, werkt bij de spoorwegen". Nog maar eens een leuqentie om bestwil? In gespreide 'slagorde' volgen de andere gezinsleden, vrouw Elodie en de kinderen (behalve Victor). Halfweg het jaar 1913 zijn ze allen in East-Moline beland. De 'Directories' van dit stadsdeel vermelden zowel vader Ivo als meerdere van zijn zonen als tewerkgesteld in de 1 fabrieken van John Deere , bekende grootproducent van landbouwgereedschap. Smeden zijn er welkom. Foto:

Eerste rij van I. naar r.: Celina (4), Arthur De Cammer, . haar man (6) - Tweede rij: Iva (1), Elodie zijn vrouw (2) -:Laatste rij: Adolphe (5)- Vooraan geknield: Remi (5)

Doch eens te meer slaat het noodlot toe, Betekent het woonklimaat in het gebied van de vier zogeheten Quad Cities (Davenport, Rock Island, Moline en East-Moline) met hun sterke concentratie van grote fabrieken een gevaar voor de gezondheid? Het valt te vrezen, want inderdaad, Elodie, Ivo's tweede vrouw, is gaan lijden aan astma. Haar kwaal gaat van kwaad naar erger, en tenslotte overlijdt zij in 1917 aan de verwikkelingen. Voor Ivo staat plots eens te rneer de tijd stil. Hij is intussen bijna 60 geworden. Zijn kinderen zijn gelukkig allen aan de slag. Beschouwt hij zjjn taak als voltooid? In ieder geval, eenrnaal de oorlog in Europa uitgewoed, in 1919, keert hij aileen naar Meulebeke terug. Het jaar daarop neemt hij echter een nieuwe start en trouwt in Meulebeke met Melanie Verbrugghe, een 61-jarige weduwe zonder kinderen. De gemeente registreert hem als 'smid'. Heeft hij zijn vroeger beroep inderdaad terug uitgeoefend? Had hij nog contact met zijn Amerikaanse kinderen? We kennen het antwoord niet. Wanneer Iva overlijdt in 1936 is hij 78 jaar geworden. Zijn vrouw Melanie zal hem overleven; zij zal 86 jaar oud worden. Eindigt hier het verhaal van Ivo Masschelin?

Ja ... Of toch niet?

Anno 2002 raakt een Vlaamse achterkleinzoon van Ivo Masschelin geboeid door dit familieverhaal. Hij pint zich allengs vast op de vraag waar in Gods naam die Amerikaanse afstammelingen van Ivo wei zouden kunnen uithangen.

1

Deze onderneming

is tot vandaag wereldwijd bekend voor haar landbouwmachines.

13


Maandenlang volgehouden speurwerk op het World Wide Web levert tenslotte in 2004 een .. enthousiast mailtje op vanuit Colorado Springs, daarna een uit Illinois, nog een uit Virginia, en recent nog een uit Alaska. Ze kunnen ginder hun ogen niet geloven. Wat een blijde verrassing! Eindelijk - 100 jaar na de gewaagde grote overstap van hun voorvader - is er iemand in het oude continent die belangstelling heeft voor hun leven en hun bestaan als farnille van Vlaamse Amerikanen ... Niet te geloven! En dan volgen de stories van werken, trouwen, kinderen hebben, ziek worden en overlijden elkaar aan vlot tempo op ... Eem verhaal ult de grabbelton wil ik u niet onthouden. Dit van Ivo's kleinzoon, Elmer. Maar hiervoor moeten we even terug naar Adolphe. Adolphe, de tweede jongste zoon van Ivo, is zeals hoger gezegd geboren in 1896. Hij is 17 wanneer hij in East Moline toekomt met zijn moeder en zus. AI vlug gaat hij bij de US Post werken, en op zijn 21 trouwt hij ginder met een Vlaamse meisje, Marie Vermeulen, ook van Meulebeekse afkomst. Zij krijgen zes kinderen, drie jongens en drie meisjes. In .de dertiger jaren is het gezin verhuisd naar Tipton, Kansas. Wanneer op een avond Adolphe een van zijn kinderen per auto heeft weggebracht naar school raakt hij betrokken in een botsing ... hij laat er het leven. Mary met zes kinderen staat voor een reuzentaak. Hun oudste zoon Elmer staat op het punt zijn muziekstudies af te maken, maar hij besluit omzo vlug als mogelijk mede voor het gezin te zorgen ... Maar alsof de maat nog niet vol is. Negen maand later raakt Elmer op zijn beurt betrokken in een zwaar verkeersongeval. Zijn vriend - aan het stuur - is op slag dood, hijzelf wordt voor dood opgeraapt, want is volledig verlamd. Pas twaalf dagen later wordt vastgesteld dat hij drie nekwervels gebroken heeft. Men leqt hem in tractie en strikte immobilisatie, doch na vier maanden is er quasi geen verbetering. Niemand durfi de geparalyseerde patient enige hoop geven. Dan maar naar het universitair ziekenhuis in St. Louis, enkele 100-en kilometers zuidelijk... Het verdict luidt: de wervels "staan niet goed en de deels genezenfracturen moeten terug gebroken worded'. Zo gezegd, zo gedaan. Ditmaal wordthij na de zware ingreep van kop tot teen ge'immobiliseerd, opnieuw voor maanden. En ... er komt langzaam verbetering. Consult in de befaamde Mayo Kliniek (Rochester) versterkte de hoop; er is kans op een volledige genezing, mits een stevig-volgehouden revalidatie met massages en oefeningen. Elmer "wil" genezen, en het lukt. .. eerste twee krukken, dan een kruk... hij herstelt "zo goed als enigszins mogelijk is" Hij vindt tenslotte werk, als "announcer" bij een lokaal radiostation, voor 23 Dollar de week. Dat soort werk blijft hij doen tijdens de oorlogsjaren, tot na de capitulatie van Japan het Amerikaanse Leger zich organiseert voor de militaire bezetting van een aantal Aziatisch landen en o.a. een aantal vacatures bekent maakt voor hun radiozenders in dat deelcontinent. Elmer zet hier zijn zinnen op en solliciteert. Hij mag deelnemen aan de voorziene testen, scoort goed, maar ... moet ook een medische keuring passeren. Niet zo eenvoudig met ziin voorgeschiedenis. Aile bezwaren die hem voorqeleqd worden pareert hij met zijn ongebreideld enthousiasme. "Please, give me a chance". En hij krijgt zijn kans; hij grijpt ze met twee hand en. Manilla, Kwangjoe, Poesan, Seoul, Tokio ... 14


AI vlug kennen aile Amerikaanse soldaten en officieren in het Verre Oosten hem als 'Ed Masters'. De top van zijn loopbaan bereikt hij tijdens de Koreaanse oorloq, waar hij en zijn collega's bekend raken als "thevoice of the United Nations Command", niets minder dan dat. Zijn moeder Mary is hem intussen met de drie jongste kinderen nagekomen naar Tokio. Ze kunnen er op de Amerikaanse school. Veellater keert het gezin naar Illinois terug. Over de jaren heen demonstreert Elmer een spreekwoordelijke inzet voor de goede zaak. Zijn oversten zijn rneer dan tevreden en steken hun waardering niet onder stoelen of banken. Elmer, gestart op het niveau van eerste luitenant, brengt het als "burger in dienst van het leger" tens lotte tot luitenant-kolonel. Als 20-jarige volledig verlamd na een zwaar verkeersongeval hadden de artsen Elmer Masschelin praktisch opgegeven, maar hijzelf versaagde niet, was koppig en vastberaden ... en haalde het. Zijn grootvader Ivo, geboren Ardooiehaar;. heeft het niet rneer mogen meernaken, en wij, in . Europa, hebben er ook nu pas van gehoord. .

.

.

.

P. S. Een plezierig detail. De verp/eger, die Elmer in 1941 vergezelde tijdens de ambu/ancerit van East-Moline naar St. Louis vergezelde, was ene Kenneth Brooks. Deze zal later huwen met Elmer$s oudste zus Anne, ook een verpleegster. Kenneth is over/eden in 1974, Anne (87 jaar) stelt het weI. . . Dirk De Wevln

Hoe word ik lid van de . Vlaamse Vereniging voor Familiekunde ? Je stort gewoon het lidgeld 30,00 euro als gewoon lid, 45 euro als steunerid lid, 70 euro minimum als beschermend lid oprekening 414-1171221-79 van WF Antwerpen-Merksem. leder lid ontvangt maandelijks het tijdschi"ift VLAAM5E STAM . De leden kunnen ook uitgaven en formulieren 'aan goedkopere tarieven verkrijgen (zie omslag Vlaamse Stam). Aile briefwisseling in verband met lidmaatschap. bemiddeling, familieverenigingen, heraldisch college enz ... : . CENTRUM VOOR FAMILIEGESCHIEDENIS VVF Dienst. •......... : . Van Heybeeckstraat 3 2170 ANTWERPEN - MERKSEM Tel. 03/646 99 88

I

Dank Wij danken hartelijk voor wat ze schon ken aan ons archief, zoals: bidprentjes, rouwbrieven, rouwberichten, communieprentjes, documenten, huwelijksaankondigingen, foto's, tijdschriftEm familiegeschiedenissen, familiepapieren, genealogische uitgaven, enz ... Eric Desmet, Dentergem - Milo Saert, Tielt - Stefan Desmet, Tielt - Dirk Lefevre, Leie - De. Geert Debrabandere, Rotsalaar

Beveren-

15


V.V.F. - Tielt : nieuwe publicaties

Etienne Cappel/e: De naam "Cappel/e" in Oostnieuwkerke van v66r 1729 tot 1980, Tielt, WF- Tielt, vier delen, deell (A-E) 233 biz. met index op de aangetrouwden, deel 1/. (F-L) 223 blz., deellll (M-P) 230 btz., deellV (P-Z) 215 blz., prijs per deel12 euro (+ 2,50 euro verzendingskosten per deel) Dertig jaar lang verzamelde de auteur Etienne Cappelle zeer geduldig alle informatie betreffende de "Cappelies" van Oostnieuwkerke maar ook van talrijke omliggende parochies en gemeenten. Aan de hand van de geboorte-, huwelijks- en overlijdensregisters werd van iedere "Cappelle" een gezinsfiche opgemaakt, voor zover de persoon een bepaalde administratieve akte bij de pastoor of bij de Burgerlijke Stand van Oostnieuwkerke (Ox+) liet optekenen. Deze gegevens werden in de loop der jaren aangevuld met de informatie die geput werd uit een tachtigtal uitgaven van heemkundige en genealogische kringen van geheel Vlaanderen maar in het bijzonder van de provincie WestVlaanderen. Het naslagwerk zal ongetwijfeld een zeer nuttig en belangrijk instrument zijn voor al wie met zijn voorouders "Cappelle" (en varianten) in de streek Roeselare terechtkomt. Zoals geweten zijn sowieso de bronnen uit de streek al zeer beperkt zowel in de tijd als in hoeveelheid. Deze uitgave werd voor het eerst voorgesteld naar aanleiding van de 33ste West~Vlaamse Ontmoetingsdag te Roeselare (Rumbeke).

Luc Neyt: "Cohier van Thielt buuten vanden Jaere 1571", Tielt, WF-Tielt, 2005, 109 blz., prijs 7 aura (+ 1,50euro verzendingskosten) Op 21 maart 1569 roept Alva de Staten-Generaal voor een dag bijeen en stelt een tweetal belastingen voor. Een eenmalige en uitzonderlijke bede van 1% op aile roerende en onroerende goederen. Een tweede, bestendige contributie, in de vorm van de 10de penning (10 %) op de verkoopprijs van roerende goederen en de 20ste penning (5 %) op de verkoopprijs van onroerende goederen. Beide penning en vallen ten laste van de verkoper. Voor Tielt bevinden zich in het stadsarchief van Gent in de reeks xxste penning twee lijsten: TieltBinnen en Tielt-Buiten, beide lijsten dateren van 1571. De lijst van Tielt-Binnen verscheen in 2003. Deze van Tielt-Buiten is vanaf heden te verkrijgen. De transcriptie omvat twee delen: het kohler van de pachters en de eigenaars - gebruikers. Dit werk sluit af met een uitgebreide index op de persoonsnamen, plaatsnamen, trefwoorden en toponiemen. Deze uitgave is een onmisbaar document voor de familiekundige die zijn voorouders zoekt tot in de 16de eeuw. Ze vormt immers een aanvulling op het werkvan Robert Tanghe "De poorters van Tielt van voor 1550 tot 1614" en de "Stadsrekeningen van Tielt" door Frans Hollevoet.

Marcel A. Defever: Zoon van Oorlog en Vrede, Tielt, WF- Tielt, 2005, 247 bIz. met talrijke foto's, prijs 19 euro (+ 2,50 euro venendingskosten) De Nederlandstalige versie van het boek "Son of War and Peace" is eveneens van de hand van Marcel A. Defever. Marcel is geboren te Merken in 1930 en is 50 jaar geleden uitgeweken naar de Nieuwe Wereld. Hij vertelt zijn levensverhaal. Het eerste deel zijn jeugd in Vlaanderen en het tweede deel als Vlaamse emigrant in Amerika. Met eigen woorden beschrijft hij zijn verhaal. Dit werk is niet enkel belangrijk voor de familieleden in Vlaanderen en Wallonie maar eveneens voor de geschiedschrijving van de emigratie in het alqemeen. Bij ons weten is dit het eerste werk in het Vlaams-Nederlands dat de persoonlijke ervaringen rond de emigratie na WO II in het daglicht stelt.

Bestellingen: af te halen bij WF-Tielt, p.a. Schuiferskapelsesteenweg 29, 8700 Tielt (051/40 11 36) ofwel door overschrijving van de kostprijs + verzendings-kosten op rekening WF-Tielt: • 800-7026810-14 met vermelding van de gewenste uitgave.

16


Vraag - Antwoord Stuur allevragen en antwoorden naar de Redactie, "Onze Voorouders", p.a. Fons Das, Luxemburglaan 18,8700 Tielt. Indien u rechtstreeks antwoordt aan de vraagsteller, gelieve de Redactie een dubbel te bezorgen.

~

~ __ ~~

1 - 06

~_v_ra_g_e_n

_]

(Andre Van den Berghe, Langenberg 12, 2460 Lichtaart)

Ik zoek de overlijdensplaats en -datum alsook de huwelijksdatum van de ouders van Martens Joseph. Deze werd omstreeks 1709 geboren te Beernem en overleed te Wingene op 28 februari 1759.

Zaterdag 11 maart 2006 om 20 uur In het Jeugd Ontmoetingscentrum,

Generaal Maczekplein,

Tielt

Dhr. Jan Diebrink zal op deze avond een uiteenzetting geven over de nieuwe versie van HAZA-DATA, namelijk HAZA-21 ledereen is van harte welkom Dhr. Diebrink zal ook aanwezig op dezelfde lokatie

zijn op onze boekenbeurs

die doorgaat

op zondag 12 maart

Vlaamse Vereniging voor Familiekunde Afdeling Tielt

ZEVENDE FAMILIEKUNDIGE BOEKENBEURS TIEL T zondag 12 maart 2006 van 9 tot 12 uur 30 Jeugd Ontmoetingscentrum, (dit is de nieuwe Europahal

Generaal Maczekplein, Tielt kant zwembad/sportvelden)

Er is een ruime keuze aan talrijke standen: * genealogische computersoftware * genealogische werken * formulieren * heruitgaven van naslagwerken Tevens is er gelegenheid tot contactname met andere vorsers uit de ons omringende WF-afdelingen en kunnen er gegevens uitgewisseld worden Om 11 uur bekendmaking van de prijzen

van de winnaaars

van de Wandelzoektocht

in Wingene en ultrelklnq

17


activiteitenagenda

WF - Tielt: januari - februari - maart 2006

Ons lokaal is open op elke eerste en derde zaterdag van de maand. Aile activiteiten, tenzij anders vermeld, gaan door in ons lokaal. 1. Werkgroep genealogie op zaterdag 7 januari van 9 tot 12 uur, gelegenheid tot opzoeken. 2. Nieuwjaarsreceptie op zaterdag 7 januari van 14 tot 17 uur, gelegenheid tot opzoeken. 3. Werkgroep opzoeken.

genealogie

op zaterdag 21 januari van 9 tot 12 uur, gelegenheid

tot

4. Werkgroep opzoeken.

genealogie

op zaterdag 4 februari van 9 tot 12 uur, gelegenheid

tot

5. Werkgroep opzoeken.

genealogie op zaterdag

18 februari van 9 tot 12 uur, gelegenheid

tot

6. Werkgroep genealogie op zaterdag 4 maart van 9 tot 12 uur, gelegenheid tot opzoeken. 7. Zevende familiekundige boekenbeurs op zondag 12 maart (zie aparte aankondiging). 8. Werkgroep genealogie op zaterdag 18 maart van 9 tot 12 uur, gelegenheid tot opzoeken. 9. Werkgroep genealogie op zaterdag 1 april van 9 tot 12 uur, gelegenheid tot opzoeken.

Zaterdag 7 januari van 14 tot 17 uur in ons lokaal: Nieuwjaarsreceptie aangeboden door het bestuur aan de leden van onze afdeling Aile leden zijn van harte welkom ! Gelegenheid tot opzoeken

Inzenden van vragen, antwoorden, teksten en activiteitenkalender Voor de eerstvolgende nummers worden de belanghebbenden dringend gevraagd rekening te houden met de hierna volgend uiterste data voor het inzenden van hun vragen, antwoorden, teksten, mededelingen en activiteitenkalender. (Steeds een maand v66r de maand van verschijnen!): . Nummer 2 1 april - mei - juni 2006: v66r 28 februari 2006 Nummer 31 juli - augustus - september 2006: v66r 31 mei 2006 Nummer 41 oktober - november - december 2006: v66r 31 augustus 2006 Nummer 1 / januari - februari - maart 2007: v66r 30 november 2006 De redactie kan om bepaalde redenen, zoals bijvoorbeeld plaatsgebrek, artikels, vragen en antwoorden, naar een later nummer verplaatsen, ook al werden ze tijdig ingestuurd. 18


Belgii-Belgi.que P.B. 8700 TIELT 1

3/4615

ONZE

VOOROUDÂŁRS Website VVF- Tielt home.scarlet.be/vvftielt

~

onzevoorons voorouders

:dJ

Driemaandelijks tijdschrift van de Vlaamse Vereniging voor Familiekunde Afdeling Tielt. 9de jaargang nr. 2 - april 2006 Afgiftekantoor

8700 TIELT 1

Verantwoordelijke uitgever: Lucien Ailliet, Schuiferskapelsesteenweg 29 - 8700 TIELT

West"::.'V1aand~n; Door mensen gedreven

*~Tn!lt


ONZE VOOROUDERS !

Is een genealogisch tijdschrift en informatieblad verschijnt, telkens bij net begin van het kwartaal,

uitgegeven door de WF

- afdeling Tielt, dat driemaandelijks

Ons werkgebied valt samen met de (deel)gemeenten van het vroeger bestuurlijk en kiesarrondissement Tielt (Aarsele, Ardooie, Dentergem, Egem, Kanegem, Kooiskamp, Markegem, Meulebeke, Oeselgem, Ooigem, IOostrozebeke, Pittem, Ruiselede, Schuiferskapelle, Sint-Baafs-Vijve, Tielt, Wakken, Wielsbeke, Wingene en Zwevezele) daarbij aansluitend Gattem, Latenhulle, Paeke, Vinkt en Wantergem.

I

De abonnementsprijs bedraagt 4,00 Euro per jaargang voor de leden van WF-Nationaal die mwoner zijn vanons werkgebied en voor aile leden van de Heemkundige Kring de Roede van Tielt. WF-Ieden uit andere arrondissementen en niet-WF-Ieden ontvangen ons tijdschrift voor minimum 6,50 Euro (voor leden uit het buitenland 10,00 Euro).

~Het abonnementsgeld kan gestort worden op rekening 800-7026810-14 van WF II Schuiferskapelsesteenweg 29 te 8700 Tielt. Een vrijwillige surplus als steun is zeer welkom !!!!

-. Afdeling

Tielt,

Redactieadres: Fons Das, Luxemburglaan 18, 8700 Tielt, tel.: 051/40.22.83, fons.das@telenet.be Voorzitter: Luc Neyt, Luxemburglaan 21, 8700 Tlelt, tel.: 051/40.60.75, Ineyt@belgacom.i1et Secretarlaat: Lucien Ailliet, Schuiferskapelsestwg. 29, 8700 Tielt, tel.lfa.x.: 051/40.11.36, I.ailliet@skynet.be Lokaal: Huyse Aleydis, vroegere Sint-Lucaskliniek, Beernegemstraat 5, 8700 Tielt Openingsuren: elke eerste en derde zaterdag van de maand van 9 tot 12 uur, of na telefonische afspraak met de heer Lucien Ailliet, secretaris. Voor verdere informatie in verband met de opgenomen artikels en bijdragen, gelieve contact op te nemen met de redactie. Elke auteur is verantwoordelijk voor de inhoud van zijn artikel. Overname van teksten toegestaan met vermelding van bran en auteur.

Inhoud: - Wandelzoektocht in Wingene 2006: de antwoorden

22

Lieven Lams, Tieltstraat 46,8750 Wingene

- Gabrielle Hammond - Van Eeckhout, overleden in Florida op 18 februari 2006, eerste deel .

28

Paul Callens, Waterstraat 18, 8740 Pittem

- Voor u gelezen: een onweder met dodelijke gevolgen te Dentergem

31

Fons Das, Luxemburglaan 18, 8700 Tielt

- Erfgoeddag: zondag 23 april 2006

32

- Tentoonstelling 0 CANADA!

33

Het verhaal van een Vlaamse emigratie

- Archief en bibliotheek: aanwinsten 2005

34

Fons Das

22

- Bestuursleden WF-Tielt

36

- Nieuwe publicaties

37

- Activiteitenagenda en vi'aag

38


Wandelzoektocht in Wingene 2006: de antwoorden

Thema: familiekundige indicaties 0D straat Deze familiekundige wandelzoektocht was esn organisatie van de Vlaamse Vereniging voor Familiekunde. afdeling Tielt i.s.m. het gemeentebestuur van Wingene en heemkundige kring Ons Wingene. We starten de zoektocht op het kerkhof waar we onmiddellijk links een aantal graven zien van oorlogsslachtoffers. Vraag 1: Hoeveel van ons werden in West-Vlaanderen geboren ? Oat zijn er in totaal 12, namelijk: Jules J., 0 Comines': Emiel Questier, 0 Oudenburg; Cyriel Seerlandt, 0 Klerken; Camiel Lefever, 0 Staden; Robert Vandelannoote, 0 Seselare; Gaston Dedeurwaerder, 0 Reninge; Alfons Jacques, 0 leper; Valeer Huyghe, 0 Wijtschate; Hendrik Coopman, 0 Nieuwpoort; Julius Goudron, 0 Zillebeke; Julius Vanthuyne, 0 Westrozebeke en Julius Groenweghe, o Rekkem. Vraag 2: Noteer het beroep en de functie die de man die hier begraven ligt uitoefende in Wingene.

Even verderop links naast de calvarieberg bevindt zich het graf van Gustave Carton", Deze geboren Wingenaar, die beroepshalve geneesheer was, en van 1885 tot aan zijn dood in 1896 ook het schepenambt in Wingene uitoefende, is de eerste plaatselijke heernkundige geweest. Hij wou de volledige geschiedenis van Wingene uitgeven, maar die is er, wegens zijn vroegtijdig overlijden nooit gekomen. Vraag 3: In welk jaar werd dit huis aan de overkant gebouwd ?

De datum op de foto is te vinden op de rand van de betonplaat op het einde van de H. Sakramentstraat die gegoten werd op 25 januari 1994.

Recht tegenover ziet men de woning .die het echtpaar Adolf Van Walleghem-Anseeuw liet bouwen in Canadese stijl 1912. Uit heimwee waren ze na een kort verblijf in Canada naar Belqie teruggekeerd, maar in 1914. ~ingen ze er zich opnieuw en nu definitief vestigen.

23


Vraag 4: In mijn ruime omgeving kan je een gedenkplaat vinden waar naar mijn Wingense moeder verwezen wordt. Welke is mijn familienaam ? De familienaam is Gezelle. De moeder, Monica Devriese, werd geboren te Wingene op 31 maart 1804 als dochter van Jozef en Isabelle-Rosa Deriemaecker. Zij huwde op 1 juni 1829 met Petrus-Johannes Gezelle en werd zo moeder van de bekende priester-dichter. Guido Gezelle. Ter gelegenheid van Gezellefeesten in 1930, een eeuw na de geboorte van Guido, kreeg dit deel van de Markt de naam Guido Gezelleplein en werd deze gedenkplaat met het gedicht 'Moederken' in de kerkgevel ingewerkt. Op de foto ziet men de gedenkplaat die vorig jaar tegen de gevel werd aangebracht. Deze herinnert eraan dat hier vroeger de zg. wekelijkse 'vikkemarkt' plaats had. Vraag 5: Noteer de familienaam van de persoon die hier ooit verbleef. Op het einde van de Tweede Wereldoorlog verbleef in het toenmalig cafe "t Oud Gmeentehuis' de Pooise generaal Maczek. Met zijn Pooise pantserdivisie zorgde hij voor de bevrijding van Wingene op 8 september 1944.

Vraag 6: Welke is de familienaam die je hieronder kunt lezen ?

De familienaam 'Neirijnck' staat boven de poort van het atelier van Remi en zoon Roger Neirynck te lezen, In 1930 startte Remi Neirynck op deze plaats zijn meubelatelier, dat later werd verdergezet door zijn zoon Roger. Ter gelegenheid van Open Monumentendag 2005 werd het atelier dat zich nag in originele staat bevindt, opengesteld voor het ruime publiek. Vraag 7: Welke is de familienaam van mijn bewoner ? Sedert 1989 is deze imposante herenwoning eigendom van dokter Jo Vandewiele. De woning dateert van 1883, toen gemeentesecretaris Henri Sengier er de woning liet bouwen. In 1906 werd het huis verkocht aan dokter Juliaan Terlinck, die trouwde met Aline Callemeyn. Hun dochter Marie-Andre, trouwde met Andre Christiaens en bouwde er vanaf 1949 tot hij met pensioen ging, zijn praktijk uit.'

24


Vraag 8: Welke is de familienaam van degene die mij heeft gegoten ? De ontwerper van dit H. Hartbeeld is Michiel Poppe, doch het beeld werd gegoten bij de Gentse firma Minne. Op 10 juni 1951 werd het bronzen beeld onder massale belangstelling ingehuldigd, dit ter gelegenheid van de H. Hartfeesten, waarbij de gemeente aan het Heilig Hart toegewijd werd. Oorspronkelijk beyond het beeld zich in het midden van het Kerkplein, tegen het monument voor de gesneuvelden van de beide wereldoorlogen. Na de dorpskemvernieuwing werd het tegen de kerkgevel geplaatst.5 Vraag 9: In mijn directe omgeving kan je een Wingense familienaam vinden die begint met de letter Q. Noteer deze familienaam. Het gaat om de familie Quissens. Christian Quissens, zetelde immers in de gemeenteraad als lid van de C.V.P.meerderheidsfractie toen het vemieuwde cultureel centrum op 5 september 1997 ingehuldigd werd. De familienaam Quissens kwam al in Wingene voor op het einde van de 17de eeuw.

Vraag 10: In welk jaar werd deze woning gebouwd ? In 1925 liet smid Amand Vandewiele dit burgerhuis bouwen. Na zijn dood bleven er zijn drie dochters wonen. Momenteel is het huis bewoond door Gilberte Vandewiele, nicht en erigename van haar tantes."

Vraag 11: Ais je voor me staat en rechts naast mij kijkt, kan je op de achtergrond eeri familienaam zien van Spaanse origine. Noteer deze familienaam. De naam Deserranno is in grote letters te zien op de . garage van de gelijknamige vogelhandel in de Kaplotestraat. Aile naamdragers Deserranno gaan terug op dezelfde persoon : Franciscus Matheus Serrano die in deze streek in de 17de eeuw toekwam, wellicht als Spaanse soldaat. Hij kreeg een mannelijke nakomeling met Anna Maria Vanquathem. Franciscus Serrano werd geboren op 27 juni 1679 te Dentergem. Een week later overlijdt zijn moeder in het kraambed. Hij zal ervoor zorgen dat het geslacht Deserranno tot op heden verder gezet wordt. In vele oude akten wordt de naam trouwens geschreven als di serano, de oorspronkelijke Spaanse versie van de naam.

25


Vraag 12: Welke is de familienaam van mijn ontwerper ?

Het beeld 'Geborgenheid' werd in 1992 ontworpen en vervaardigd door Jean-Claude Vanhaecke. Deze Beernemse kunstenaar was jaren lang spelend lid van de plaatselijke fanfare St.-Cecilia.

Vraag 13: Noteer de naam van dit gebouw. Hoewel de woning al vele tientallen jaren geen cafe meer is, kan men nog steeds de naam "t Hof van Vlaanderen' boven de voordeur lezen. Dit cafe moet zowat een eeuw geleden begonnen zijn door de familie Vroman. Achter het cafe stond destijds de staande wip van de schuttersgilde en ook het voetbalveld van Hoger Op Wingene lag vlak achter dit etablissement.

Vraag 14: Noteer de voor- en familienaam van mijn ontwerpster. In 1974 ontwierp Elisabeth Vandeweghe dit beeldje in keramiek ter gelegenheid van de opening van het sport- en cultuurcentrum.

Vraag 15: Welke Wingense familienaam is hier met mij verbenden ? De diamant op de gevel van deze woning is het embleem van juwelier en goudsmid Walter Vancauwenberghe. Het was Ludovicus Vancauwenberghe, geboren in 1660 in Ename,路 die zich na zijn huwelijk met Catharina Guusse op het Goed te Lentakker in Wingene kwam vestigen .en zorgde voor heel wat nakomelingen die tot op vandaag in Wingene en ruime omgeving wonen _7

26


Vraag 16: Hoeveel verschillende familienamen tel je rondom mij ? In 1994 werd deze gedenkplaat in de kerkgevel ingemetseld ter vervanging van het oorlogsgedenkteken dat in 1920 op het Kerkplein geplaatst werd, maar na de dorpskernvernieuwing verdween. De plaat 'Hulde aan onze gesneuvelden voor het vaderland' bevat de 31 namen van oorlogsslachtoffers van de beide wereldoorlogen. Het zijn A. Baesen, J. Blesseel, J. Claeys, C. Deblaere, A. Debruyne, J. en O. Demaeght, F. Desoete, F. Desseyn, A. D'Hooghe, G. Jodts, E. en J. Locqenueux, C. Meeuws, G. Ornelis, J. Rotty, A. Sap, Baron C. vander Bruggen, F. Houtekier, T. Vanderhaeghen, R. Vandewalle, J. Vandoorne, J. Vanlaere, U. Vanmaeie., G. Verhelst, J. Verhoye, D. Verkain, C. Verkest en R. Weyts als slachtoffers van de Eerste Wereldoorlog en M. Bonne, G. De Meester, G. Depauw en J. Vancauwenberghe als slachtoffers van de Tweede Wereldoorlog. Vraag 17-18 : Noteer de voor- en familienaam van de man en de vrouw op de grafsteen rechtsonder mij. De tekst van de grafsteen luidt als voigt : "Hietvooren light begraeven Pieter Ver/eye fs. Gillis en van Susanna Van Ixe ln Houwel. Geweest met Susanna Denolf overleden den 22 April 17870udt 75 jeeren Bid voor de Ziele op dat sy Ruste in Vrede". De naam van de man is Petrus of Pieter Verleye, geboren te Win gene op ~ november 1711 als zoon van Egidius en Susana Van Ixe / Van Uxem. Petrus trouwde op 18 januari 1735 met de Pittemse Susanna Denolf, dochter van Jacobus en Elisabeth De Cagny. Suzanna stierf op 70-jarige leeftijd op 19 februari 1785 en Petrus overleed te Wingene op 22 april 1787. Waarom precies hun zerk in de kerkgevel ingemetseld werd, is ons niet bekend. Vraag 19-20 : Noteer de familienaam

en het jaartal die je kan vinden op de voorgevel.

Recht tegenover de pastorie zist men het huis waarvan het vroegere nummer (A 397) naast de deur nog zichtbaar is. De woning werd gebouwd door Desire Sarteel in 1873, wat at te lezen va It op de kleine zwarte steen boven een van de ramen. Na het vroegtijdig overlijden van Sarteel werd schoenmaker Louis 8aert de nieuwe eigenaar. Momenteel woont er Agnes Coopman weduwe van Antoon Baert, kleinzoon van Louis." Lieven Lams Tijdens WO 1 hoorde Comines (Komen) bij West-Vlaanderen. Vanaf 1962 bij Henegouwen. Lams L. " Orner Vanfaere 90 jaar", in "Ons Wingene", jaarboek 6 (2003), p. 9 - 15. 3 Zie ook "Markante gevels van woningen te Wingene en Zwevezele", in "Ons Wingene", jaarboek (2003), p. 31. 4 Ibidem, p. 19. 5 Lams G. & L., Patteeuw R., "Wingene aan het H. Hart", in "Ons Wingene", jaarboek 4 (2001Âť), p. 53 6 Zie oak "Markante gevels van woningen te Wingene en Zwevezele", in "Ons Wingene", jaarboek (2003), p. 24. 7 Zie oak "Markante gevels van woningen te Wingene en Zwevezele", in "Ons Wingene", jaarboek (2003), p. 24. 8 Zie ook "Markante gevels van woningen te Wingene en Zwevezele", in "Ons Wingene", jaarboek (2003), p. 24. 1 2

6, deel 2

71. 6, deel 2 6, deel 2 6, deel 2

27


Gabriella Hammond - Van Eeckhout overleden in Florida op 18 februari 2006 Eerste deel. Gabriella Hammond is geboren op 14 januari 1903 te Koolskamp als dochter van Camiel .Van Eeckhout en Elodie Verstraete. Zoals de meeste andere gehuwde vrouwen in Amerika nam zij, bij haar huwelijk, de naam van haar echtgenoot aan. Gabriella huwde in de St. Matheuskerk te Flint, Michigan op 18 mei 1922 met Earl Hammond. Earl was geboren te Seattle, Washington op 14 juni 1902. Hij overleed te Oxnard, California op 23 februari 1980. Earl werkte op verschillende plaatsen voor de US Navy. Van 1949 tot 1952 woonde de familie in Japan tijdens de bezetting van dit land. Samen met haar man woonden ze hun laatste jaren in Oxnard California. Een deel van de familie kwam van Michigan naar California, een ander deel trok naar Florida. Begin de jaren negentig trok Gabriella naar Florida waar ze nog steeds woont in haar eigen huisje niet ver van enkele van haar kinderen en schoonkinderen. Tegenwoordig wonen familieleden in verschillende staten en zelfs in het buitenland. Tot haar laatste levensdagen woonde ze in haar eigen huisje.

Gabriella, 102 jaar oud Gabriella is de trotse moeder van acht kinderen: Earl (°1923), Mary (0 1924), Eva (°1925), Daniel (°1928), Edith (°1929), David (°1933), Anna (°1934) en Theresa (°1937). Er zijn reeds talrijke verdere nakomelingen die o.a. leven in verschillende staten van de US. Een zoontje van Gabriella, John stierf in 1932 enkele dagen na de geboorte. Recent stierven haar dochter Mary en haar zoon David. Op zaterdag 4 januari 2003 kreeg zij van de familie reeds een groot feest aangeboden naar aanleiding van haar honderdste verjaardag. Het samenkomen van de familie was weer eens een van de hoogtepunten uit haar leven. De reporter van de locale krant The East County Observer schrijft in zijn artikel van 9 januari 2003 dat Gabriella nog van elk van haar nakomelingen de tweede naam en de geboortedatum wist op te noemen. Bij onze opzoekingen in haar familie hadden we voordien ook al dezelfde vaststelling kunnen maken.. Een andere bedenking dat ze maakte in het bijzijn van de reporter was: "It's just another day, she says, decidedly. But, I will say that the first 100 years are the berdest".

28


vader Carniel en moeder Elodie De vader van Gabriella, Carniel, vertrok reeds op 14 mei 1904 met de boot "Finland" van Antwerpen naar New York. Hij ging zich vestigen bij zijn broer Jules Van Eeckhout die vroeger reeds naar Moline trok. Camile nam 50 frank mee. Zijn jongste dochter Apollonia was maar twee maanden oud toen hij vertrok. . Terwijl Carniel wat geld probeerde te verdienen om de familie te kunnen laten overkomen moest moeder Elodie het hier aileen redden. Op 23 september 1905 scheepte zij tenslotte ook in aan boord van de "Vaderland" in Antwerpen met bestemming New York. Naast vier kleine kinderen nam Elodie de rest van het familiebezit mee, zo een 400 frank. Vader Carniel werkte ondertussen in een mijn en verdiende er 2 a 3 $ per dag. In 1991 schrijft Gabriella: de overtocht was lang en lastig voor een moeder aileen met haar kleine kinderen. Er waren veel andere emigranten op de boot en velen werden zeeziek..." Het moet nogal iets geweest zijn als vrouw aileen met het gehele familiebezit op weg naar een onbekende locatie. Ondertussen zorgen voor vier kleine kinderen die zeeziek zijn. Kinderen die nog te klein zijn om hun plan te trekken en waarschijnlijk ook nog niet geheel proper zijn. Op de boot tot de vaststelling komen dat het Vlaamse dialect soms al problemen geeft om te spreken tegen de andere Vlamingen op de boot. .:'Vader en nonkel waren in New York toen we daar aankwamen...''. Een eerste opluchting maar nog een lange weg te gaan naar de nieuwe woonplaats waar er voor hen toch de wetenschap is dat daar veel 8elgen zitten waar men raad kan aan vragen. "...Vandaar trokken we met de stoomtrein naar East Moline dwars door de staten New York, Pennsylvania, Ohio, Indiana en Illinois. II

Vier broers van Gabriella werden in East Moline geboren (raar maar waar vier meisjes werden geboren in Kooiskamp en na emigratie werden vier jongens geboren in Arnerika).

29


De vier dochters die toen ze klein waren de overtocht naar Amerika maakten met hun moeder. Vooraan: Urbanie (Bena in de USA), achteraan: Appollonia (Plone in de USA), .Mary en Gabriella. Foto genomeri in Flint, Michigan op 10 augustus 1916. De drie jongens: onderschrift foto: Aschel, Henry en Julius. Foto genomen in Albo's Photo Shop, Flint, Michigan. De famllie woonde toen in 1410 Ackerman Court, Flint Michigan. Aangekomen in East Moline woonden we eerst in een kelderverdieping van een andere familie. Het eerste huis dat wij zelf introkken was gelegen aan de 7de straat. Het was een groot huis en moeder verhuurde de twee voorkamers aan twee Grieken om het inkomen aan te vullen. De goede geur van het Griekse eten hing in het ganse huis terwijl moeder ook de was en de strijk deed om het inkomen nog verder aan te vullen. Rond 1912 verhuisden we naar een huis met een grote tuin niet ver van de Mississippi. We kweekten als bijverdienste wat groenten. Nog wat later verhuisden we opnieuw waar moeder een winkel opende. Het waren harde tijden voor zowat iedereen. Later vertrok de gehele familie naar Michigan waar er mits hard werken een beter bestaan kon gevonden worden". In oktober 1987 bezocht Gabriella voor het eerst haar geboortedorp Kooiskamp, later deden nog een paar van haar kinderen haar dit na. Ware het niet geweest van het feit dat een kleinzoon in Duitsland in het Amerikaans leger was, dan was ze waarschijnlijk nooit in haar geboorteland terug geweest. ' Voor deze Amerikanen is dit als het ware een thuiskomst. Enkel de graven van de hier gebleven voorouders konden ze niet meer bezoeken gezien alles verdwenen is door gebruiken die nu eenmaal anders zijn in Vlaanderen dan in Amerika. Op haar 100ste verjaardag kreeg Gabrielle de gelukwensen van de gouverneur van Florida (Jeb Bush, zoon van ." broer van ".) en ook van het gemeentebestuur van haar geboortedorp. Een gebaar dat een complete verrassing was voor haar en dat zij ten zeerste kon waarderen.... I

Enkele voorouders: -,

-;: ,',.,. '

..... "': .: ',.:-'-::

..... ..

".

""

. ,'.:

"

1 Gabriella Sidonia Van Eeckhout werd op 14 januari 1903, in Koolskamp geboren. Zij huwde Earl Elgie Hammond 18 mei 1922, in Flint, Michigan, USA. . '

....

2 Camillus Van Eeckhout werd op 11 februari 1863, in Egem geboren. Hij huwde Elodie Verstraete op 10 januari 1900, in Kooiskamp. Hij emigreerde in 1905. Camillus stierf op 18 mei 1947, in Flint 3 Elodie Verstraete werd op 3 mei 1873, in Pittem geboren en stierf op 26 januari 1953, in Flint, Michigan.

'GEll1eratipfl3(grot$tpudersl 4

\ ...•..•............... ,:> ...•..•........•....

Felix Van Eeckhoutte werd op 13 augustus 1832, in Ardooie geboren. Hij huwde Juliana Dewitte op 1 april 1862

5 Juliana Dewitte werd op 21 januari 1834, in Kooiskamp geboren. 6 30

Bruno Verstraete werd op 1 april 1838, in Tielt geboren. Hij huwde Melania Van Ooteghemp 8 mei 1867, in Pittem. Bruno stierf op 25 januari 1924, in Tielt.


7 Melania Van Ooteghem werd op 5 juni 1840, in Pittem geboren en stierf op 2 maart 1894, in Pittem. " ': ::. -c

~.

.

:'~ "

"'.'

.' : ,~': .: ,-.

. _' ..... ::: _'.:, .">.:. ..'~.-..:" _',

.

,

:.'~.,:;::,'

.:. :, .'~ ..

:,'

. ..... ~:. .... ,',." "

.

',-"

..

.:':.-

:

_-','

8 Franc;ois Van Eeckhoutte werd op 22 augustus 1802, in Ardooie geboren. Hij huwde Rosalia De Clerck op 28 april 1830, in Kooiskamp. 9 Rosalia De Clerck werd op 19 juni 1807, in Kooiskamp geboren. 10 Jan Dewitte werd circa 1792, in Kooiskamp geboren. 11 Angela Alliet werd op circa 1793, in Kooiskamp geboren. 12 Machaire Verstraete werd op 30 november 1805, in Tielt geboren. Hij huwde Eugenie Simoens op 8 augustus 1835, in Tielt. Machaire stierf op 12 mei 1846, in Tielt. . 13 Eugenie Simoens werd op 24 december 1810, in Tielt geboren. Zij huwde een eerste maal met Machaire Verstraete op 8 augustus 1835, in Tielt. Zij huwde een tweede maal met Antonius Van Coillie op 6 juli 1848, in Tielt. Eugenie stierf op 31 mei 1885, in Kanegem. 14 Joannes Baptist Van Ooteghem werd op 26 december 1795, in Grammene geboren. Hij huwde Godelieve De Rudder op 15 september 1827, in Tielt. Hij stierf op 31 juf 1872, in Pittem. 15 Godelieve De Rudder werd op 27 december 1803, in Tielt geboren, Zij stierf op 24 december 1853, in Pittem. Verder gegevens over de voorouders langs moederlijke zijde van Gabriella zijn terug te vinden in "Onze Families - Deel I" Uitgave VVF Afdeling Tielt. Paul Callens

V~~r u gelezen: een onweder met dodelijke gevolgen te Dentergem Uit de Nieuwe Gazette van Thielt van zondag 20 augustus 1850. Men schryft uit Denderghem aen de Nieuwe Gazette, 15 oogst: Heden omtrent 10 Y2ure, met het eindigen der hoogmis, een dertigtal persoonen, gedurende het onweder dat alhier heerschte, waren gaen schuilen onder den molen van de weduwe Vangaver, niet verre van het dorp naer Wonterghem toe gelegen. Een donderslag heett een der einden van den molen afgeslagen en al de persoonen er onder schuilende omver geworpen. Een twaelftal hebben kneuzingen ontvangen; dry van hun zyn dood opgenomen geweest. De gedoodde zyn: Karel Biebuyck, 48 jaer oud, timmerman; Florentin Scholiers, 30 jaer oud, landbouwer, Leo Deconinck, 26 jaer oud, landbouwer. Deze dry waren inwooners van Wonterghem. De overige gekwetsten zyn buiten gevaer. Fons Das 31


I

Erfgoeddag: zondag 23 april 2006

THEMA:KLEUR TENTOONSTELLING: Didactische schoolplaten en rolkaarten zondag 23 april 2006 van 10 tot 18 uur in de bibliotheek, Lakenmarkt, Tielt OFFICIELE OPENING TENTOONSTELLING: zondag 23 april 2006 om 11 uur in de polyvalente zaal van de bibliotheek, Lakenmarkt. De heer Martin Descheemaker heett het in zijn toespraak over het belang en het gebruik van didactische schoolplaten en rolkaarten in tunctie van het aanschouwelijk kleuter- en lager onderwijs. Daarna biedt het stadsbestuur een receptie aan. Vorige jaren hebben we op de erfgoeddag aandacht besteed aan ons onroerend en immaterieel erfgoed. Dit jaar willen we uw aandacht vragen voor een facet van ons roerend erfgoed. Om deze tentoonstelling op te bouwen hebban we volledig gebruik gemaakt van het archief van de Vrije Basisschool 't Nieuwland afdeling Regina Pacis. Zij bezit immers een waardevolle ge'inventariseerde collectie oude didactische schoolplaten en rolkaarten op linnen. Met het 'Intergemeentelijk Erfgoedproject Pittem-Ruiselede- Tielt' is het voor de eerste maal dat in onderling overleg de erfgoeddag in de drie locaties over hetzelfde onderwerp handelen. Er is immers voldoende materiaal voorhanden om het thema in een grote verscheidenheid aan bod te laten komen. De tentoonstelling is opgebouwd rond een aantal thema's. Naast de platen voor Gewijde en Vaderlandse geschiedenis maakt de bezoeker ook kennis met thema's als: beroepen, kleutervertelplaten, ons koningshuis, het verkeer, enz... Het is de bedoeling dat de bezoeker op de erfgoeddag van 23 april de drie tentoonstelling bezoekt. In elke locatie is immers iets anders te zien. In Pittem loopt de tentoonstelling in de Vrije Gemengde Basisschool, Molenakker 97 Egem, in Ruiselede in de Hostens molen en in Tielt, de Bibliotheek, Lakenmarkt 4.

Om de leerlingen van de lagere school de kans te geven kennis te maken met het rijke aanschouwelijk materiaal van hun ouders en grootouders blijft de tentoonstelling in Tielt open tot zaterdag 20 meL Je kan ze dagelijks bezoeken tijdens de openingsuren van de bibliotheek. Voor leerlingen van de lagere school is aan de tentoonstelling in Tielt een wedstrijd verbonden. Mits de juiste oplossing op een aantal vragen, kunnen de leerlingen een mooie prijs winnen. Dus allen daarheen!!!! De organisatie van dit initiatief berust bij de Vlaamse Vereniging voor Familiekunde afdeling Tielt met de medewerking van de Stedelijke Raad voor Cultuurbeleid Sectorale Deelraad Erfgoed, de Cultuurbeleidscoordinator, de Bibliotheek en de logistieke en financiste steun van het Stadsbestuur Tielt. Uit het archief van de Vrije Basisschool't

32

Nieuwland afdeling Regina Pacis (foto's Luc Neyt)


Tentoonstelling 0 CANADA!

Het verhaal van een Vlaamse emigratie

Van zaterdag 13 mei tot en met zondag 6 augustus 2006 in het Provinciaal Hof, op de Grote Markt te Brugge. Van vrijdag 18 augustus tot en met zondag 29 oktober 2006 is er een verlenging van de tentoonstelling op een nog nader te bepalen locatie in Oost-Vlaanderen

Programma historische debatavond dinsdag 16 mei 2006 om 20 uur Provinciaal Hot. Markt Brugge

o

o o o o

o o

Start om 20 uur: 'anchorwoman' van de avond is Evelien Van Walleghem (FocusNVTV), die de sprekers inleidt en de onderdelen aan elkaar praat. Inleiding historische debatavond door Marc .Joumee, projectleider van de tentoonstelling 'Vlaamse landverhuizers naar Canada' Vertoning Film Frank Polet (voorzitter VLAKAN - Vlaamse-Canadese Vriendenkring). Lezing door Prof. Emeritus Cornelius Jaenen (Canada) over de Vlaamse emigratie naar West-Canada - met vragenronde. Getuigenis van enkele emigranten - met vragenronde. --------------Pauze 20 min. ------------------ Mogelijkheid tot bezoek tentoonstelling op de benedenverdieping. Frank Polet stelt devereniging VLAKAN voor Op zoek naar een familielid in Noord-Amerika? Paul Callens (Pittem - WF-afdeling Tielt) en Ludwig Vandenbussche (Leke - Gazette van Detroit - Monument "De Vlaamse Emigrant") leggen uit hoe je te werk kunt gaan om een familielid in Canada of USA op te sporen met vragenronde.

Eventueel nag in te lassen in dit programma: prof. Verdoodt over de samenstelling van een speciaal archief over de emigratie van de Vlamingen, als onderdeel van het ADVN in Antwerpen.

Dank Wij danken hartelijk voor wat ze schonken aan ons archief, zoals: bidprentjes, rouwbrieven, rouwberichten, communieprentjes, documenten, huwelijksaankondigingen, foto's, tijdschriften familiegeschiedenissen, familiepapieren, genealogische uitgaven, enz ... Eric Desmet, Dentergem - Milo Baert, Tielt - Robert Hoste, Tielt - Zusters van het Geloot, Tielt - Dirk Lefevre, Beveren-Leie - Geert De Brabandere, Rotselaar - Arnold Schaubroeck, Schuiferskapelle - Marc Bruyneel, Kanegem

33


Archief en bibliotheek: aanwinsten 2005

Eerste deel.

Tellingen:

-

De volkstelling 1748 van de proch ie's Beerst, Bovekerke, Koekelare, Ichtegem De volkstelling 1748 van de proch ie's Woumen, Wijnendale (Torhout buiten), Zerkegem, Aartrijke De Volkstelling te Kortemark in het jaar 1748 De volkstelling te Lichtervelde in het jaar 1748 De Volkstelling te Loppem 1748 De volkstelling te Oostkamp in het jaar 1748 De volkstelling te Werken anna 1748 Doodhalmen van de heerlijkheden Moorslede & Acquets Status Animarum Sijsele 1902-1905 Volksteling 1701 van de Kasselrij Veurne Volkstelling 1748 Beernem, Sint-Joris-Ten-Distel Volkstelling 1748 de parochie Adegem (+ jurisdictie Eecloo) Volkstelling 1748 de parochies Bekegem, Eernegem, Moere, Roksem, Snaaskerke, Zande Volkstelling 1748 de parochies Gistel, Schore, Slijpe, Stene, Wilskerke, Oudenburghoek, Oudenburg, Zandvoorde, Zandvoorde Polder, Zevekote Volkstelling 1748 de prochie Beveren (Roeselare) Volkstelling 1748 de prochie Gits Volkstelling 1748 de prochie Lembeke (+ vryheerlyckhede van averschoot) Volkstelling 1748 de prochie Sint-Laureins (+ jurisdictie Eecloo), Sint-Jan-in-Eremo Volkstelling 1748 de prochies Ardooie, Kooiskamp Volkstelling 1748 de prochies Klemskerke, Leffinge, Mannekensvere, Mariakerke, Middelkerke, Ettelgem Volkstelling 1748 de prochies Maldegem, Middelburg Volkstelling 1748 Groot-Damme Volkstelling 1748 Jabbeke, Keiem, Koolkerke, Leke, Vlissegem,Wenduine Volkstelling 1748 Oedelem Volkstelling 1748 Ramskapelle, Westkapelle, Knokke, Heist Volkstelling 1748 van de prochie's Houthave, Meetkerke, Stalhille, Uitkerke, Sint-Jan-Opden-dijk, Zuienkerke Voikstelling 1794 Waarschoot Volkstelling 1748 de prochies Sinte-Margriete, Ursel, Waterland

Staten van Goed: - Staten van goed van het ambacht Boekhoute (Boekhoute, Bassevelde en Oosteeklo) deellV 1621-1670 staten van goed, 1750-1782 wezenrekeningen, 1616-1786 wezenrekeningen, staten van goed, liquidaties - Staten van goed van het ambacht Boekhoute (Boekhoute, Bassevelde en Oosteeklo) deel V, Ambacht Boekhoute: 1540-1620 staten van goed, Waterdijk: 1557-1790 staten van goed, wezenrekeningen en testamenten - Klapper op de Parckemynen index van de Kortrijkse weeskamer, inleiding en deel 1: Stad Kortrijk - Klapper op de Parckemynen index van de Kortrijkse weeskamer, deel 2: Kasselrij Kortrijk - Staten van goed van Lembeke deell Heerlijkheid Aveschoot 1607-1794, deelll Heerlijkheid Lembeke 1567-1794 (1 boekdeel) - Staten van goedZomergem, 1634-1793 (drie boekdelen)

34


Encyclopedie: Winkler Prins, zesde druk, Elsevier, 18 delen, 2 supplementen, 2 registers

Parochiereg isters: Bissegem:

indices geboorten, huwelijken en overlijdens, 1606-1797

Orongen:

Drongen Sint-Gerolf, begraafakten 1800-1833 en 1891-1900

Heule:

indices geboorteakten,

1614-1797

Kortrijk,

O.L.Vrouw:

indices geboorten, huwelijken en overlijdens

Kortrijk,

St. Maartens:

indices indices indices indices indices indices indices indices indices

Kortrijk,

5t. Michiels:

indices geboorten, huwelijken en overlijdens, 1785-1796 indices geboorten, huwelijken en overlijdens, 1796-1802

geboorteakten, 1796-1802 huwelijksakten, 1796-1802 huwelijksakten, deel 1 huwelijksakten, deel 2 overlijdensakten, 1796 - 1797 overlijdensakten, deel 1 overlijdensakten, deel 3 overlijdensakten, deel 4 overlijdensakten, deel 5

Lembeke:

Sint-Egidiusparochie Sint-Egidiusparochie

dopen, 1610-1722 huwelijken en overlijdens, 1610-1722

Marke:

indices geboorten, huwelijken en overlijdens, 1623 - 1797

Moorsele:

indices geboorteakten, 1604 - 1797 indices huwelijksakten, indices overlijdensakten, 1679 - 1797

Oeselgem:

indices geboorten, huwelijken en overlijdens, 1628 - 1792

Ooigem:

indices geboorten, huwelijken en overlijdens, 1628 - 1792

Oostrozebeke:

indices geboorteakten en huwelijksakten, 1797 - 1802 indices huwelijken en overlijdens, 1666 - 1797

Sint-Eloois-Vijve:

indices indices indices indices

Sint-Eloois-Winkel:

indices geboorten, huwelijken en overlijdens, 1747 - 1796

Waregem:

indices geboorteakten, 1602 - 1797 indices huwelijksakten, 1602 - 1797 indices overlijdensakten, 1602 - 1797

Zwevezele:

indices geboorteakten, 1651 - 1802 indices huwelijksakten, 1651 - 1802 indices overlijdensakten, 1651 - 1802

geboorteakten, 1634 - 1659 geboorten, huwelijken en overlijdens, 1659 - 1797 huwelijksakten, 1634 - 1659 overlijdensakten, 1650 - 1659

Fons Das

35


r L=========B=es=t=u=u=rs=l=e=d=e=n=W=F=-=T=ie=lt=========:==dJ Gezien de laatste tijd heel wat adressen, vooral dan e-mail adressen, veranderden geven we nog eens de lijst van onze bestuursleden.

luc NEYT, Luxemburglaan 21, 8700 Tielt 051/406075 Ineyt@belgacom.net Voorzitter

Lucien AILlIET, Schuiferskapelsesteenweg

29,8700 Tielt

051/401136 Lailliet@skynet.b~ Secretaris - Penningmeester

Fans DAS, Luxemburglaan 18, 8700 Tielt 051/402283 fans. das@telenet.be Redactiesecretaris - Bibliothecaris

Andre BRAET, Kruishoutemseweg

131,8790 Waregem

056/443532 braetandre@pandora.be Verantwoordelijke vorming

Jan CALLENS, Tieltstraat 15, 8740 Pittem 051/465411 ~an-Ca liens@telenet. be Emigratie Noord-Frankrijk

Paul CALLENS; Waterstraat 18, 8740 Pittem 051/467190 Raul.callens@tiscali.be Emigratie Noord- en Zuid-Amerika

Claude MOORS, Kerkstraat 5,8700 Tielt 051/401942 claude.moors@scarlet.be Website - Archivaris

Frank VANEENOOGHE,

Biermanstraat 55, 8700 Schuiferskapelle

051/403906 vaneenooghe.nemegheer@belgacom.net Schuiferskapelle - Persverantwoordelijke

Robert VANNESTE, leperstraat 84,8700 Telt 051/406018 [Yanneste 3@hotmail,com Heraldiek

36


I

V.V.F. - Tielt : nieuwe publicaties Claude Moors: Huwelijken Tielt 1671 - 1683, WF-Tielt, 2006,46 blz., prijs 6 euro (+ 1,50 euro verzendingskosten) Deze "Alfabetische tafel op de huwelijken in Tielt" sluit aan op de "Klapper op de huwelijksakten van Tielt 1666-1683" die reeds eerder verscheen (WF-Afdeling Tielt - 1997). Van de huwelijksbeloften en de akten van de jaren 1666-1671 en van 1679-1683 van de parochie Sint-Pieter, ingeschreven in het notitieboekje of kladboek van de jaren 1666-1683, is geen enkele akte ingeschreven in de parochieregisters en komen de namen ook niet voor in de tafels. Hetzelfde is geldig voor de geboorteakten voor dezelfde periode. Het is bijna onbegonnen werk om in dit klein register, notitieboekje of kladboek, opzoekingen te doen. Alles staat dooreen en onderste boven, men loopt er gewoonweg in verloren. Daarom heeft wijlen onze voorzitter van WF-Tielt, dhr. A. Robert Tanghe, van deze akten een volledig afschrift gemaakt en ze gerangschikt in een duidelijke volgorde en ze genummerd. Onderaan elke bladzijde wordt verwezen naar de bladzijde(n) van het notitieboekje, waar u de originele akte kan terugvinden. (zie de bovenvermelde klapper). In de hier voorliggende tafel zijn de huwelijken alfabetisch gerangschikt op de naam van zowel de bruid als de bruidegom. Verder krijgt men, indien gekend, de afstamming, de naam van de huwelijkspartner en de al dan niet vermoedelijke datum van het huwelijk of ondertrouw. Van eind juli 1671 tot eind 1678 bestaan er geen huwelijksakten. R. Tanghe heeft de huwelijken aan de hand van doop- en overlijdensakten kunnen afleiden. Deze huwelijken zijn ook in de tafel opgenomen. Het is te begrijpen dat de vermelde data van de huwelijksvoltrekking maar benaderend kunnen zijn. Niettemin is het een belangrijke hulp bij de opzoekingen naar voorouders ult deze periode. De namen van de vrouwen die voorkomen in de kolom afstamming zijn opgenomen in een alfabetische index.

Etienne Cappel/e: De naam "Cappelle" in Oastnieuwkerke van v66r 1729 tot 1980, Tielt, WF- Tielt, vier delen, deell (A-E) 233 biz. met index op de aangetrouwden, deelll (F-L) 223 biz., deellll(M-P) 230 biz., deellV (P-Z) 215 btz., prijs perdee/12 euro (+ 2,50 euro verzendingskasten per deel) Dertig jaar lang verzamelde de auteur Etienne Cappel Ie zeer geduldig aile informatie betreffende de "Cappelles" van Oostnieuwkerke maar ook van talrijke omliggende parochies en gemeenten. Aan de hand van de geboorte-, huwelijks- en overlijdensregisters werd van iedere "Cappelle" een gezinsfiche opgemaakt, voor zover de persoon een bepaalde administratieve akte bij de pastoor of bij de Burgerlijke Stand van Oostnieuwkerke Cx+) liet optekenen. Deze gegevens werden in de loop der jaren aangevuld met de informatie die geput werd uit een tachtigtal uitgaven van heemkundige en genealogische kringen van geheel Vlaanderen maar in het bijzonder van de provincie WestVlaanderen. Het naslagwerk zal ongetwijfeld een zeer nuttig en belangrijk instrument zijn voor al wie met zijn voorouders "Cappelle" (en varianten) in de streek Roeselare terechtkomt. Zoals geweten zijn sowieso de bronnen uit de streek al zeer beperkt zowel in de tijd als in hoeveelheid.

Etienne Capel/e: De Naam "Capel/e" in Westrozebeke van v66r 1681 tot 1980, Tielt, WF- Tielt, ca 330 biz. Prijs 15 eura (+ 2,50 euro verzendingskosten)

stellingen: af te halen bij WF-Tielt, p.a. Schuiferskapelsesteenweg 29, 8700 ielt (051/4011 ofwel door overschrijving van de kostprijs + verzendings-kosten op rekening WF-Tielt: -7026810-14 met vermelding van de gewenste uitgave. T.

37


VVF - Tielt: activiteitenagenda april - mei - juni 2006 Ons lokaal is open op elke eerste en derde zaterdag van de maand. Aile activiteiten, tenzij anders vermeld, gaan door in ons lokaal. ---1~-Werkgroep-genealogie op zaterdag 1 april van 9 tot 12 uur, gelegenh~id tot opzoeken.2. Toelichting bij doel en werking van het 20 uur in ons lokaal.

SWF door Dhr. D. Vandecandelaere op vrijdag 7 april am "

3. Werkgroep genealogie op zaterdag 15 april van 9 tot 12 uur, gelegenheid tot opzoeken. 4. 23 april: "Erfgoeddag

met als thema kleur" (zie aparte aankondiging).

5. Werkgroep genealogie op zaterdag 6 mei van 9 tot 12 uur, gelegenheid tot opzoeken. 6. Werkgroep genealogie op zaterdag 20 mei van 9 tot 12 uur, gelegenheid tot opzoeken. 7. Werkgroep genealogie op zaterdag 3 juni van 9 tot 12 uur, gelegenheid tot opzoeken. 8. Werkgroep genealogie op zaterdag 17 juni van 9 tot 12 uur, gelegenheid tot opzoeken.

Vraag Stuur aile vragen en antwoorden naar de Redactie, "Onze Voorouders", p.a. Fons Das , Luxemburglaan 18, 8700 Tielt. Indien u rechtstreeks antwoordt aan de vraagsteller, gelieve de Redactie een dubbel te bezorgen. 2 - 06 (Fans Das, Luxemburglaan 18, 8700 Tielt)

Op 27 mei 1906 waren er Verkiezingen voor de Kamer de Volksvertegenwoordigers maar op 25 maart 1906 waren er reeds verkiezingen geweest, in Tielt althans, - voor de "Goedenmannenraad" . Weet iemand meer te vertellen over deze "Goedenmannenraad" voor wat Tielt betreft en waren er nog steden of gemeenten in ons werkgebied waar deze verkiezingen doorgingen. Aile info hieromtrent is welkom.

Inzenden van vragen, antwoorden, teksten en activiteitenkalender Voor de eerstvolgende nummers worden de belanghebbenden dringend gevraagd rekening te houden met de hierna volgend uiterste data voor het inzenden van hun vragen, antwoorden, teksten, mededelingen en activiteitenkalender. (Steeds een maand v66r de maand van verschijnen!): - Nummer Nummer Nummer Nummer

3 / juli - augustus - september 2006: v66r 31 mei 2006 4/ oktober - november - december 2006: v66r 31 augustus 2006 1 / januari - februari - maart 2007: v66r 30 november 2006 2 / april - mei - juni 2007: v66r 28 februari 2007

De redactie kan om bepaalde redenen, zoals bijvoorbeeld plaatsgebrek, artikels, antwoorden, ...... naar een later nummer verplaatsen, ook al werden ze tijdig ingestuurd. 38

vragen

en


Belgie-Belgique P.B. 8700 TIELT 1

3/4615

ONZ£

VOOROUD£RSS Website VVF- Tielt home.scarlet.be/vvftielt

~

onzevoorons voorou.ders

\JJ

Driemaandelijks tijdschrift van de Vlaamse Vereniging voor Familiekunde Afdeling Tielt.

Verantwoordelijke

9de jaargang

nr. 3 - jull 2006

Afgiftekantoor

8700 TIELT 1

uitgever: Lucien Ailliet, Schuiferskapelsesteenweg

•..

29 - 8700 TIEL T

~Tielt


ONZE VOOROUDERS Is een genealogisch tijdschrift en informatieblad verschijnt, telkens bij het begin van het kwartaal.

uitgegeven door de WF

- afdeling Tielt, dat driemaandelijks

Ons werkgebied valt samen met de (deel)gemeenten van het vroeqer bestuurlijk en kiesarrondissement Tielt (Aarsele, Ardooie, Dentergem, Egem, Kanegem, Kooiskamp, Markegem, Meulebeke, Oeselgem, Ooigem, Oostrozebeke, Pittem, Ruiselede, Schuiferskapelle, Sint-Baafs-Vijve, Tielt, Wakken, Wielsbeke, Wingene en Zwevezele) daarbij aansluitend Gottem, Lotenhulle, Poeke, Vinkt en Wontergem. De abonnementsprijs bedraagt 4,00 Euro per jaargang voor de leden van WF-Nationaal die inwoner zijn van ons werkgebied en voor aile leden van de Heemkundige Kring de Raede van Tielt. WF-Ieden uit andere arrandissementen en niet-WF-Ieden antvangen ons tijdschrift voor minimum 6,50 Euro (voor leden uit het buitenland 10,00 Euro). Het abannementsgeld kan gestort worden op rekening 800-7026810-14 van WF Schuiferskapelsesteenweg 29 te 8700 Tielt Een vrijwillige surplus als steun is zeer welkom I!!!

-

Afdeling

Tielt,

Redactieadres: Fons Das, Luxemburglaan 18, 8700 Tielt, tel.: 051/40.22.83, fons.das@telenet.be Voorzitter: Luc Neyt, Luxemburglaan 21, 8700 Tielt, tel.: 051/40.60.75, Ineyt@belgacom.net Secretariaat: Lucien Ailliet, Schuiferskapelsestwg. 29, 8700 Tielt, tel./fax.: 051/40.11.36, Lailliet@skynet.be Lokaal: Huyse Aleydis, vroegere Sint-Lucaskliniek, Beernegemstraat 5,8700 Tielt Openingsuren: eJke eerste en derde zaterdag van de maand van 9 tot 12 uur, of na telefonische afspraak met de heer Lucien Ailliet, secretaris. Voor verdere informatie in verband met de opgenomen artikels en bijdragen, gelieve contact op te nemen met de redactie. Elke auteur is verantwoordelijk voor de inhoud van zijn artikel. Overname van teksten toegestaan met vermelding van bron en auteur.

Inhoud:

42

- Lijkschouwingen, eerste deel Luc Neyt, Luxemburglaan 21,8700 Tielt

43

- Gabrielle Hammond - Van Eeckhout, overleden in Florida op 18 februari 2006, tweede deel Paul Callens, Waterstraat 18, 8740 Pittem

46

- Totaalindex, Genealogische databank, digitala bestanden Claude Moors, Kerkstraat 5, 8700 Tielt

49

~ Archief en bibliotheek: aanwinsten 2005, slot Dank Fans Das

52

- Voor u gelezen: Mishandeling en poging tot moord te Tielt Fans Das, Luxemburglaan 18, 8700 Tielt

56

- Wandelzoektocht in Wingene 2006: de winnaars Nieuwe publicaties

57

- Activiteitenagenda

58

en vraag


Lijkschouwingen Eerste deel. In het stadsarchief van Tielt bevindt zich een bundel met een viertal 18de eeuwse lijkschouwingen. Het ene medisch verslag is al uitgebreider dan het andere. Naast de naam van de overledene worden ook de namen vermeld van de wethouders die een of meerdere chirurgijns aanstellen om het dode lichaam te onderzoeken en de doodsoorzaak vast te leggen. Naast de familiekundige gegevens, is vooral de woordenschat bij de beschrijving van de wonde of wonden en de doodsoorzaak zeer typisch. Daarom geven we u de integrale transcriptie van de tekst. "Opden xiitm April 1677 ontrent den middernacht is bij ons onderschreven respectivel(ijck) Bailliu der Stede, en(de) Roede van Thielt, metg(aeders) Burgm(eest)re en(de) voorschepenen der selve Stede van Thielt [den greffier indispoot wesen(de)] anschauw ghedaen van het doode lichaem van mre (meester) Charles Lafontaine inwoonen(de) chirurgin binnen der selve Stede, vers/eghen ontrent den voors(eiden) tijde van(de) voorn(oemde) daghe door het schieten van twee schooten waerschijnel(lijck) met fusicque, of cerebin, en (de) eene pistole, d'eene schote inden buijck, en(de) d'andere in het hooft, t'voors(schreven) anschauw ghedaen fer assistentie van mre (meesler) Jan Camelis chirurgin binnen der voor(sijde) stede, den wel(ken) bijden onderscntteven) Bailliu te voorent naer costume behoorel(ijcke) in eede ghestell gheweest sijnde, ons verclaert heeft de voors(ijde) naar eoperentie t'schote in (den) buijck wat boven den affel, waerschijnelic ghedaen met drie cooghelkens ofte ballekens hebben(de) ghemaecl drie diversche openen wonden, en (de) ghepenetreert de maeghe tot de spina dorsi, bijdien lethael te wesen, soo ooc lethael te sijn de voors(ijde) tweede schote in(de) slincker sijde van het voorhooft, mils de slincker ooghe vutgheschoten en(de) de hersenen gherocht sijn gheworden, so dal elck van(de) voors(ijde) schoten rathale wesen(de) a/svooren, hebben ghecauseert de dooi van(de) voorn(oemde) mre (meesler) Charles la fontaine, en(de) daerdoore ter plae/sen ghevallen aldaere is com(m)en t'overlijden, oversu/cx heert den voorn(oemde) chirurgin mre (meester) Jan Comelis dese acte neff ens ons onderschreven, onderteekent, tooncon(de) dach en (de) daete eisboven"

B. Arents (merk) 1677

Zantvaorde et Jan Vander piete 1677 meesier Jan Camelis, chirurgijn anna 1677

In het begrafenisregister van Tiett vinden we onder de naam Lafontaine niemand terug die op of kort na 13 april 1677 beg raven wordt. Dan maar zoeken onder de naam Delafontaine en Fontaine. Ook hier vinden we geen enkele Charles terug. In de stadsrekening van 1675-76 wordt Carel Fontaine wei vermeld als cherusyn. Uit het doopregister van Tielt kennen we een zekere ongehuwde Carolus Fonteyne die een kind heeft bij Joanna De Raes of De Ras. Hun enige zoon genoemd naar zijn vader Carolus wordt in Tielt geboren op 17 september 16752. Ook uit deze gegevens kunnen we geen enkel verband leggen met de verongelukte chirurgijn Charles Lafonteine. Wei weten we dat onze Charles een prachtige bibliotheek naliet". Over meester Jan of Joannes Cornelis, chirurgijn, weten we dat hij op 50-jarige leeftijd in Tielt op 6 december 1687 overlijdt. Hij huwt tweemaal. Bij zijn eerste vrouw Elisabeth Van Gampelaere afkomstig van Kanegem heeft hij drie kinderen: Ludovicus, Barbara huwt in 1693 met Georgius 4 Bruneel en Georgius huwt in 1692 met Joanna Alliet , Nog geen twee maand na het overlijden van zijn eerste vrouw Elisabeth op 27 juni 1663 hertrouwt hij op 7 augustus met de Tieltse Suzanna Van Ackere. Samen hebben ze zeven kinderen: Joannes, Adriana Margareta, Judocus huwt Joanna Defour, Maria huwt Judocus Saelens, Suzanna, Petrus en Judoca". 1

SAT, OA, 1629, akte 1. A. R. TANGHE, WF-Tielt, cocumentatiecentrum, gezinsfiches Tielt 1671-1700, map 10. Voor meer informatie over de familie Delafontaine: gezinsfiches Tielt 1671-1700 map 9 en 1701-1740 map 12. 3 D. DE SOMVIELE, La bibfiotMque d'un chirurgien de Tieit en 1677, in Genootschap voor Geschiedenis (Societe d'Ernulation), Brugge 5e reeks 8,1896, p.211-230 4 A. R. TANGHE, WF-Tielt, documentatiecentrum, gezinsfiches Tielt 1641-1670, map 5. 5 A. R. TANGHE, WF-Tielt, documentatiecentrum, gezinsfiches Tielt 1641-1670, map 5. 2

43


Een tweede lijkschouwing is deze van Francois Roose zoon van Joos of Judocus. Op 25 september 1725 hebben Jaspart de Smet en Carel Hughens meester chirurgijns op verzoek van Jo' Charles Louis Arents baljuw van de stad Tielt en in aanweziqheid van Jan De Bosschere, Matthijs Tack en Jacques Van Caneghem schepenen de eed afgelegd en een lijksch6uwing uitgevoerd op het dood lichaam van Francois Roose,· "die hedent ontrent den een tire naer de middagh op de neermarckt a/hier, in het schieten salvo ter oorsaecke van het arrivement van den heere hooghbailliu aer stede ende casse/rije van Cortrijck tot het presenteeren van sijnen eedt, ter presentie van menighte van menschen was ter aerden ghevallen ende ghestorven venae quetsure (soo men can jugieren) van een stuck van een canontien t'gonne tersi/vere tijdt was ghecreveert ende ghespronghen, ende naer visitae(tie) van dien verclaeren sij bevonden thebben dat de lijncker . ceecke, een deel van den hals ende het achterhoof was gemurselt ende ten deele weghgenomen, ende d'herssens gansch geoffenseert, t'we/eke hem de doot he eft ghecauseert". Opqernaakt op 25 6 september 1725 en ondertekend door Jaspart de Smet, Carel Huughe vrij meester chirugijn . In het overlijdensregister terug.

(begrafenisregisters)

van de parochie

Tielt vinden we onderstaande

akte

Hierin lezen we: "Die 25° 7bris 1725 sepultus est Franciscus Roose, improviso et infelice casu, 7 sacramentali tamen absolutione premuntus, e vivis diseessitaetatis ennorum 45 ". Op 25 september 1725 is Franciscus Roose begraven. Hij is uit de levenden weggegaan in de leeftijd van 45 jaar, ria een onverwacht en ongelukkig ongeval, evenwel voorzien van het sacrament . van de absolutie". Franciscus Roose wordt geboren rond 1680 als zoon van Judocus en Catharina Herbaut. Hij huwt in 1711 met Maria Crop. Een jaar later overlijdt zijn vrouw Maria en hetjaar daarop hertrouwt hij met Petronella Christjaens met wie hi] zes kinderen heeft die allen in Tielt gebciren zijn: 1. Joannes Roose geboren 26 maart 1714 2. Ludovicus Josephus Roose geboren 2 februari 1716 en overleden in Tielt 25 augustus 1720. 3. Judoca Roose geboren 14 september 1718 en ongehuwd overleden in Tielt 21 februari 1752 4 Jacobus Roose geboren 31 mei 1722. In 1747 huwt hij in MeuJebeke met Petronella Niere. 4. Maria Catharina Roose geboren 4maart 1724 enoverleden in Tielt 15 februari 1730 9 5. Petronelle Roose geboren 29 november 1725 • Uit deze gegevens blijkt dat Franciscus een weduwe achterlaat met nog vier kinderen dat PetronellaChrlstlaens in verwachtinq is van haar zesde kind Petronelle.

in leven en

Over chirurgijn Carel Huughe vinden we geen gegevens terug, wei over zijn collega Jaspart of Gaspar De Smet. Als zoon van Jaspar en Maria Vande Keere wordt hij in Tielt in 1664 geboren en overlijdt er op 70-jarige teeftijd, Hij huwt in 1692 met de Tieltse Anna De Meulenaere. Sarnen hebben ze .tien kinderen: Anna Francisca, Maria Joanna, Ludovicus Constant huwt Maria Catharina Serroels, Franciscus Dominicus, Maria Joanna huwt Comelis Rapaliere, Philippus Jacobus, Joanna Theresia, Judoca Augustina, Catharina Theresia huwt Jacobus Vande Keere en ten slotte Maria Elisabeth. Vijf kinderen overlijden voor de leeftijd van een jaar'". tn 1692 wordt SAT, OA, 1629, akte 2. WF-Tielt, documentatiecentrum, doos 15, boek 3, f. 243 v. 8 Met dank aan de heer Hector Lievens uit Rumbeke voor de transcriptie en de vertaling van deze begrafenisakte. 9 A. R TANGHE, WF-Tielt, documentatiecentrum, gezinsfiches Tielt 1701-1740, map 13. 10 A. R. TANGHE, WF-Tielt, documentatiecentrum, gezinsfiches Tielt 1671-1700, map 10. 6

7

44


Gaspar betaald door de wethouders van de Stad Tielt voor het "cureren diversche soldaten,,11en in 1716 wordt hij met de gehele familie ingeschreven als poorter van Tielt 12.

gequetste

Een derde lijkschouwing gebeurt op 13 april 1782 door Marcq Laurent .Junque gezworen chirurgijn van de stad Tielt. Hij heeft "gevisiteert ende geexamineert het doodt licham van N: van Nieuwenhuyse synde hel kint van Frans verongeluckt inde prochiale kercke deser stede door het afvalfen van een groot pJomp stuck bout vanden torre ofte beettroor'". Het stuk hout is op het hoofd van van Nieuwenhuyse gevallen en heeft "daer door gecauseert twee grootte wonden en dat hel crenium" geheel gefractueert is waerdoor de doodl absolutelijck is gevolght15. Uit het overlijdensregister van Tielt vernemen we dat "net kint" van Franciscus van Nieuwenhuijse Petrus heet, 16 [aar is en op 12 april 1782 am 11 uur in de morgen overlijdt. Petrus wordt beg raven door pastoor Ludovicus Wauters 16. Onze chirurgijn Marq Laurent Junque, poorter in 1779, koopt een "huys ende erfve in de Crommewal" van Jacobus Francies Eggermont voor 8 pond. leven jaar later verkoopt hij dit huis aan Rogier Bouckaert voor 12 pond". Een maand later, op 19 juli 1783 overlijdt hij in de leeftijd van 44 jaar. Junque is geboren in Oostende als zoon van Antonius. Na dispensatie verkregen te hebben, huwt hij in Tielt op 6 mei 1761 met Maria Francisca Eleonora Josepha Caignaert afkomstig van Brugge. Pastoor Ludovicus Wauters zegent het huwelijk in. Bij zijn overlijden in 1783 is hij weduwnaar van Isabella Theresia Carton uit Pittem 18.

Het vierde en laatste document behandelt de lijkschouwing van het dood lichaam van molenaar Jacobus Gernay. In 1741 is hij reeds pachter van de helft van de stadsmolen. Hij betaalt daarvoor jaarlijks 20 pond 5 schellingen groten. In de stadsrekening van 1743-1748 wordt vermeld dat Jacobus Gernay na het "ommewaeyen" van de molen akkoord gaat om de helft van de herstellingskosten voor zijn rekening nemen, zijnde 53 pond. De molen blijft nog in pacht bij de familie Gernay tot eind april 1754. Daarna is Joannes de Munster pachter". Maar op 31 augstus 1752 slaat het noodlot toe, Jacobus verongelukt op zijn molen. Op verzoek van baljuw Guilliame van Zantvoorde wordt het dood lichaam van Jacobus Gernay "verongeluckl gevonden opden bovensoJder vanden meulen, ghenaemt den Stedemeulen" onderzocht door "dheer ende meesler Guillielmus Francies Vande Vondellicenliat in de medicijnen ende Ludovicus de Smet m(eeste)re chirurgijn" in aanwezigheid van Joncker Ferdinande Anthoine de Decquer, heere van ten Doghen, Leopold de Caigny ende Francois Thooft burgemeester en schepen en Philippe Eugene Narbonne, grittier, in vervanging van Joannes de Roo, allen leenmannen van de stad en Roede van Tielt. De beide chirurgijns verklaren dat ze na grondlg onderzoek "bevonden hebben eene infonsatie van het beekeneel des hoofs soo danig geimprimeert door de dura ende pramaler dat de doodt daer door absolut ende sonder eenig twijffel heeft subet moeten gecauseert worden". Deze verklaring wordt door aile partijen op 31 augustus 1752 ondertekend". wordt vervolgd

Luc Neyt

F. HOLLEVOET, Stadsrekeningen Tielt: 1610-1794, p. 349 en 358. L. AILUET, de poortersboeken van Tielt, afschrift 1700 & 1716, deelll, p. 66 nummer 115. 13 beelfroot of belfroot: kasteel met een toren, belangrijk gebouw met een toren, wachttoren, toren, hier in de betekenis van klokkentoren. 14 Cranium, in het Frans cranien wat schedelkas betekent. 15 SAT, OA, 1629, akte 5. 16 WF-Tielt, documentatiecentrum, doos 15, boek 9, f. 93 r. 17 F. HOLLEVOET, Stadsrekeningen Tielt: 1610-1794, p. 476, 484 en 510. 18 A. R. TANGHE, WF-Tielt, documentatiecentrum, gezinsfiches Tielt 1741-1770, map 16. 19 F. HOLLEVOET, Stadsrekeningen Tielt: 1610-1794, p. 426, 428, 432 en 440. 20 SAT,OA, 1629, akte 3. 11 12

45


Gabriella Hammond - Van Eeckhout overleden in Florida op 18 februari 2006-03-03 Tweede deel. Overzicht

van de familie in Amerika

voor een groot deel opgemaakt

met de hulp van Gabrielle

Hammond

Eerste Generatie 1. Camillus Van Camillus Van + 2 i. + 3 ii. + 4 iii. + 5 iv. + 6 v. + 7 vi. 8 VII. 9 VIII.

Eeckhout, de zoon van Felix Van Eeckhoutte en Juliana Dewitte Eeckhout en Elodie Verstraete hadden volgende kinderen: Urbania Maria Van Eeckhout Maria Leontina Van Eeckhout Gabriella Sidonia Van Eeckhout Apolonia Margaretha Van Eeckhout Achiel Joseph Van Eeckhoutte Julius Van Eeckhoutte Frank Charles Van Eeckhoutte Henry Albert Van Eeckhoutte

Tweede Generatie 2. Urbania Maria Van Eeckhout (Camillus) Urbania Maria Van Eeckhout en George Archibald + 10 I. Richard Alfred McMillan Sr. 3. Maria Leontina Van Eeckhout (Camillus) Maria Leontina Van Eeckhout en George kinderen: + 11 I. George David Zimmerman + 12 Ii. John Robert Zimmerman 13 iii. Charles Henry Zimmerman 4. Gabriella Sidonia Van Eeckhout (Camillus) Gabriella Sidonia Van Eeckhout en Earl kinderen: + 14 I. Earl Joseph Hammond Sr. + 15 ii. Mary Margaret Hammond + 16 III. Eva May Hammond + 17 IV. Daniel Glen Hammond Sr. + 18 v. Edith Ester Hammond 19 VI. John Stanley Hammond + 20 vii. David Benjamin Hammond + 21 viii. Anna Marie Hammond + 22 IX. Theresa Aplonia Hammond

McMillan had volgend kind:

W. Zimmerman

Elgie

Hammond

had den volgende

hadden

volgende

5. Apolonia Margaretha Van Eeckhout (Camillus) Apolonia Margaretha Van Eeckhout en eyrie I Persyn hadden volgende kinderen: 23 i. David Cyril Persyn + 24 Ii. Kathleen Mary Persyn

46


6. Achiel Joseph Van Eeckhoutte (Camillus) Achiel Joseph Van Eeckhoutte en Evelene Wilda kinderen: + 25 i. Carole Elaine Van Eeckhoutte + 26 II. Joan Mae Van Eeckhoutte + 27 iii. Norman Lee Joseph Van Eeckhoutte + 28 IV. William Henry Van Eeckhoutte + 29 v. Janet Eileen Van Eeckhoutte + 30 vi. Cheryl Ann Van Eeckhoutte + 31 vii. John Brian Van Eeckhoutte

Hoose

had den . volqende

7. Julius Van Eeckhoutte (Camillus) Julius Van Eeckhoutte en Hazel Loraine Delong hadden volgende kinderen: + 32 i. Patrick Lewis Van Eeckhoutte + 33 ii. Ronald Thomas Van Eeckhoutte Derde Generatie 10. Richard Alfred McMillan Sr. (Urbania Maria Van Eeckhout, Camillus) Richard Alfred McMillan Sr. en Irma Irene Rooke hadden volgende kinderen: 34 i. Richard Alfred McMillan Jr. 35 II. Diane Elaine McMillan 11. George David Zimmerman (Maria Leontina Van Eeckhout, Camillus) George David Zimmerman en Delphine Rosamary Daugherty hadden volgende kinderen: 36 i. Thomas Michael Zimmerman 37 ii. John William Zimmerman 12. John Robert Zimmerman (Maria Leontina Van Eeckhout, Camillus) John Robert Zimmerman en Mary Grace Philpott hadden volgende kinderen: 38 i. Marc Alan Zimmerman 39 ii. Scott Lee Zimmerman 40 iii. Thomas Robert Zimmerman 41 iv. Chris Alan Zimmerman 14. Earl Joseph Earl Joseph 42 i. 43 ii. 44 III. 45 iv. 46 v. 47 vi. 路48 vii.

Hammond Sr. (Gabriella Sidonia Van Eeckhout, Camillus) Hammond Sr. en LaVelle Pearl VVenzig hadden volgende kinderen: Earl Joseph Hammond Jr. John Eric Hammond Karen Anne Hammond Gayle Anne Hammond Penny Jean Hammond Craig Lee Hammond Gary Jay Hammond

15. Mary Margaret Hammond (Gabriella Sidonia Van Eeckhout, Camillus) Mary Margaret Hammond en Richard Parker Huffman Sr. hadden volgende kinderen: 49 i. Peggy Ann Huffman 50 II. Richard Parker Huffman Jr. 51 iii. Mary Gay Huffman. 52 iv. Susan Edith Huffman 53 v. Michael David Huffman

47


. 16. Eva May Hammond (Gabriella Sidonia Van Eeckhout, Camillus) Eva May Hammond en Donald Clair Kingsbury hadden volgende kinderen: 54 I. Donna Irene Kingsbury 55 II. Paul Anthony Kingsbury 56 iii. Mark Allen Kingsbury 17. Daniel.Glen Hammond Sr. (Gabriella Sidonia Van Eeckhout, Camillus) Daniel Glen Hammond Sr. en Elisabeth Gschlossl hadden volgend kind: 57 i. Maria Elisabeth Hammond Daniel 58 59 60 61 62 18. Edith Edith 63 64 65 66 67 68

Glen Hammond Sr. en Elizabeth Gage hadden volgende kinderen: ii. Daniel Lee Hammond Jr. It I. Alan Carl Hammond IV. William Jack Hammond v. Pamela Renee Hammond vi. Kelly Edward Hammond

Ester Hammond (Gabriella Sidonia Van Eeckhout, Camillus) Ester Hammond en Billy Gene Sims hadden volgende kinderen: I. Billy Michael Sims II. Mark Allan Sims iii. Monica lynn Sims iv. Vanessa Kim Sims v. Diana Jean Sims vi. John David Sims

20. David Benjamin Hammond (Gabriella Sidonia Van Eeckhout, Camillus) . David Benjamin Hammond en Ellen Joanne Donlon hadden volgende kinderen: 69 I. Ellen Marie Hammond . 70 ii. David Michael Hammond 71 iii. Patricia Ann Hammond 72 iv. Mary louise Hammond路 73 v. Timothy John Hammond 21. Anna Marie Hammond (Gabriella Sidonia Van Eeckhout, Camillus) .Anna Marie Hammond en John Paul Allison hadden volgende kinderen: 74 i. Stephen Paul Allison 75 ii. Donald Michael Allison 76 iii. Mark Alan Allison 77 IV. Janna Marie Allison 22. Theresa Aplonia Hammond (Gabriella Sidonia Van Eeckhout, Camillus) . Theresa Aplonia Hammond en Alvin Joseph Madruga hadden volgende kinderen: 78 i. Jeffrey Michael Madruga 79路 ii. Matthew Scott Madruga 24. Kathleen Mary Persyn (Apolonia Margaretha Van Eeckhout, Camillus) Kathleen Mary Persyn en Harley Donald Jackson hadden volgend kind'. 80 i. Barbara Jane Jackson wordt vervolgd

48

Paul Callens


Totaalindex,

Genealogische

databank, digitale bestanden

Voor wie werkt aan een stamboom of een familiegeschiedenis, opzoekmogelijkheden ter beschikking in ons lokaal:

staan er drie nieuwe

1. De totaalindex op de parochieregisters van gans Vlaanderen 2. Een genealogische databank met computerbestanden van genealogen. 3. Digitale bestanden: rouwbrieven, bidprentjes, tellingen, gezinsreconstructies afkomstig uit diverse bronnen. Deze bestanden kunnen geraadpleegd worden op de Personal Computer. We gaan het nu hebben over de totaalindex. Volgende maal bespreken we de andere databanken. De totaalindex

op de Parochieregisters

Dit is een databank die namen bevat uit bijna aile parochieregisters van Vlaanderen. Hij is onderverdeeld in de bestuurlijke arrondissementen, die op hun beurt zijn onderverdeeld in de parochies. Er kan gezocht worden in gans Vlaanderen, maar de opzoeking kan zich ook beperken tot een bepaald arrondissement of zelfs tot een parochie. Geeft men een naam op dan krijgt men een Ijjst van aile parochies waar deze voorkomt en in welke registers: doop, huwelijk of overlijden. Tevens toont het programma ook een reeks namen die alfabetisch v66r de gezochte naam komen of een reeks namen die erna komen. Zodat men meteen afwijkende schrijfwijzen heeft en eventueel daar terug kan opzoeken. Er kunnen ook twee namen opgegeven worden zodat er kan nagegaan worden in welke parochies ze zich beide in eenzelfde huwelijksakte bevinden, wat nog niet betekent dat de twee personen ook werkelijk gehuwd zijn! Om de opzoeking nag te verfijnen, kan bij het opgeven van twee namen ook gecontroleerd worden waar deze namen zich samen tegelijkertijd in de huwelijksakte en overlijdensakte bevinden. De totaalindex bevat 1.077.806 namen. De parochies van de grote steden (Brussel, Antwerpen, Gent, Brugge en Kortrijk) zijn er echter nog niet in opgenomen, wellicht gebeurt dit nog in de toekomst. Van eender welke parochie kan een alfabetische lijst getoond worden met aile personen die daar gedoopt, gehuwd, of overleden zijn. De resultaten van de opzoeking kunnen afgedrukt worden. Ontstaan van parochieregisters Tijdens het concilie van Trente tussen 1545-1563 werd tijdens een van de zittingen besloten tot het invoeren van de parochieregisters. Hiermee werd de basis gelegd am persoonsgegevens op een georganiseerde manier te registreren over een groot gebied vermits dit concilie de steun had van de twee grote toenmalige machthebbers namelijk de ons welbekende Karel V en de franse koning Frans I. Aanvankelijk werden eerst doop- en huwelijksregisters ingevoerd omdat hiermee de kerkelijke overheid een telling kon doen van zijn gelovigen. Later werden dan ook de overlijdens (meestal echter de begrafenisdatum) geregistreerd. Het aanvangsjaar van deze registers is niet hetzelfde voor aile parochies en zal afhankelijk geweest zijn van plaatselijke omstandigheden. Meestal echter zullen de doop- en huwelijksregisters van rond 1600 dateren.

49


De overlijdens- of begraafregisters zijn iets recenter omdat de verplichting om tot registratie over te gaan afhankelijk was van het bisdom. In het bisdom Namen vanaf 1604, in Luik vanaf 1612-1646 en in Kamerijk vanaf 1716. Toen men onder de regering van Albrecht en Isabella het bestuurlijk nut van zulke registers inzag werden de kerken verplicht een dubbel te deponeren bij de schepenen van de betrokken parochies. Bij wet van 20-25 september 1792 werd door de overheid de burgerlijke stand ingevoerd en toegepast met een dekreet van 29 prairiallV (17 juni 1796). De inhoud van de aktes moest . nu uitgebreider zijn dan in de parochieregisters. De parochieregisters waren immers in eerste instantie opgesteld om het aantal gelovigen te tellen. In de registers van de burgerlijke stand echter werden ook uitgebreide gegevens van de ouders bijgehouden zoals ouderdom, adres en beroep. Vanaf de invoering van de burgerlijke stand is dit de bron bij uitstek voor genealogen en overheidsinstanties en zullen de parochieregisters aan belang inboeten. Klappers De inhoud van de aktes van de parochieregisters was duidelijk niet voldoende omschreven en was bijgevolg nogal eens afhankelijk van de dienstdoende pastoor en bevat in sommige gevallen niet veel meer dan een naam. Bovendien zijn de aktes in het kerklatijn opgesteld, uiteraard in het toenmalig gangbare geschrift en bijgevolg niet zo eenvoudig leesbaar, zelfs niet voor de latere administraties (rechterlijke en bestuurlijke) die soms van deze registers moesten gebruik maken. Rond de jaren 1860 toen de bevoegde Kamer- en Senaatscommissies het financieel aandeel van de staat moesten bepalen voor het aanmaken van de tienjaarlijkse naamtafels op de registers van de burgerlijke stand voor 1851-1860 werden ook voorstellen ingediend om alfabetische naamindexen ('klappers') op de parochieregisters aan te maken. Oorspronkelijk werden volgens de voorschriften in deze indices niet de namen van de ouders opgenomen en het is pas in 1876 dat deze voorschriften en de financiele consequenties aangepast werden. Het opstellen van de indices is echter nooit een verplichting geworden, maar toch zijn het grootste deel van de oude parochieregisters tussen 1865 en 1890 geklapperd geworden. Wanneer we echter het werk van H. DOUXCHAMPSEN R. TEFNIN, Repertorium der oude parochieregisters in Belgie, - des anciens registres paroissiaux en Belgique, - der ehemaligen Pfarregisterin Be/gie, Brussel 1985,er op na slaan kunnen we vaststellen dat er toch nog veel leemtes ziin in de klappers die te wijten kunnen zijn aan allerhande oorzaken zoals slecht beheer van archief, natuurrampen en oorlogen, tenslotte hebben deze geschriften een 400 jaar moeten overleven in allerlei omstandigheden. Het project Totaalindex

(Genealogie

en Computer)

Terwijl in de registers van de burgerlijke stand bij een verhuis gemakkelijk is vast te stellen van waar en naar waar een persoon ging, is dit in de parochieregisters vrij zelden opgenomen. Om dus een bepaalde persoon terug te vinden zou men een groot aantal klappers moeten raadplegen uit een groot gebied. Daarbij kwam nog dat de mensen geen enkel persoonlijk document hadden waarop hun naam vermeld stond. Wanneer dus iemand naar een andere parochie trok kon ook nog eens de schrijfwijze van zijn naam veranderen, want de pastoor en schepenen aldaar schreven op wat zij meenden te horen uit de mond van de betrokkene. Een lijst met familienamen met vermelding van de plaats van voorkomen in de doop- huwelijks- en begraafregisters uit aile parochies van een groot gebied zou hier dus de oplossing zijn en veel zoekwerk kunnen besparen.

50


Oit is precies waar het in het Project Tolaa/index Klappers Parochieregisters om gaat: het opnemen van al de famiJienamen niet uit een enkele parochie in een alfabetische lijst, maar in een grote alfabetische lijst de familienamen voor ALLE parochies van een groot gebied ineens. Talloze vrijwilligers hebben de namen uit de parochieregisters op computerbestanden ingebracht. Het werk was na twaalf jaar beeindiqd in 2002. Het gaat dus om cumulatieve naamindexen of Totaalindexen. Op die manier kan men door consultatie de van een lijst op slag voor een groot gebied ineens weten waar een familienaam in de 17 en de 1S eeuwse parochieregisters is voorgekomen en waar niet. Zo bakent men de gebieden af waar men best gaat zoeken. Om het verder verwerken zoals alfabetisch sorteren en samenvoegen van de ingevoerde gegevens te vergemakkelijken werden wei een aantal bewerkingen met de familienamen doorgevoerd. Zo werden accenten en trema's weggelaten (e en e werden e, werd a), de spatierinq tussen naamdelen werd weggewerkt en de ij werd vervangen door y.

a

De verschillende schrijfwijzen van familienamen werd wei aangehouden zodat men zich een idee kan vormen hoe een naam ge'fnterpreteerd kan worden door verschillende personen. We voegen er wei meteen aan toe: met uitzondering van de parochies van de grote steden Antwerpen, Brugge, Brussel, Gent en Kortrijk. Onze redenering is dat in die grootsteden tach praktisch aile namen voorkomen uit het wijde omliggende gebied, wegens de aantrekkingskracht van de steden op dit gebied, die er in aile tijden geweest is en nog is. Zodat een genealoog sowieso toch steeds moet zoe ken in de grote steden van een gebied. Gezien enerzijds het erg grote werk voor die omvangrijke parochieregisters van de steden en anderzijds de geringe meerwaarde aan informatie zijn deze daarom nietopgenomen. Volgende aflevering: genealogische databank en digitate bestand Claude Moors

Cursus: oud schrift Je besliste op te klimmen in je stamboom, de geschiedenis van je woning, je straat, je stad ... boeit je mateloos. Dan zit je geregeld met je neus in oude papieren. Je ontdekt plots dat het lezen van oude teksten heel wat moeizamer verloopt dan een snelle kijk in hedendaags drukwerk of op het internet. Oude teksten lezen is sen must voor elke onderzoeker en verrijkend voor familie-onderzoek, maar het vergt oefening en kennis van vele verkortingen, specifieke tekens, maten, geldwaarden enz ... Deze cursus neemt je mee van de zestiende tot de negentiende eeuw, door parochieregisters, nalatenschappen, tellingen en akten van burgerlijke stand, notariaat, grondgebruik, belasting en rechtspraak. Data: zaterdagvoormiddag 23, 30 september, 7, 14 en 21 oktober 2006 9.30-12.00 uur Locatie: Cultuurcentrum Gildhof, Sint-MichieJstraal 9, 8700 Tielt Inschrijven: enkel via CC Gildhof: telefoon (051140 29 35), fax (051140 83 29) of email (frederik. vanlaere@tielt.be) Prijs: 25 euro Organisatie en begeleiding: Vlaamse Vereniging voor Familiekunde afdeling Tielt i.s.m. net CC Gildhof Tielf.

51


Archief en bibliotheek: aanwinsten 2005 Slot.

Emigratie: -

-

Amerikaanse lantingen deelll Death Memorial Caards deel VIII Death Memorial Cards deel IX Death Memorial Cards deel X Death Memorial Cards deel XI Death Memorial Cards deel XII Death Memorial Cards deel XIII Death Memorial Cards deel XIV Belgian Laces 1976 - 1986 Bevolkingsregisters uitwijking naar Amerika vanuit Wakken en Dentergem 1847-1866 De Flandes a Montiel . EI Influjo de Pedro de Gante en la Cultura de Sudamerica Institutions Officielles de la Belgique Kwartierstaten Pedigree Chart 1991 Les Belges au Manitoba et dans les territoires d'Assinsiboia avant 1901 Passagers Belges partis vers L'Amerique en 1856 Presencia Flamenca en la Sudamerica Colonia Que Fue de Ellos. Hechos protagonizados por immigrantes Belgas lIegados a Villaguay a partir de 1882 The history of the Congregation of the Sisters, Servants of the Immaculate Heart of Mary, Monroe, Michigan Vercoutere ancestors ascending Vocabulaire orthographique Larousse Wisconsin's Belgian Community, Peninsula Historical Review, Vol. VII, 1933

Familiegeschiedenissen: - De naam "Cappelle" te Oostnieuwkerke (van veer 1729 tot 1980) Deellindex & Cappelle A tot E. - De naam "Cappelle" te Oostnieuwkerke (van veer 1729 tot 1980) Deelllindex & Cappelle F. tot L. - De naam "Cappelle" te Oostnieuwkerke (van veer 1729 tot 1980) Deel III Index & Cappelle M. tot P. Joa. - De naam "Cappelle" te Oostnieuwkerke (van v66r 1729 tot 1980) DeeliV Index & Cappelle P. Jos. totZE. - Son of War and Peace - Stamboom van de familie Traen - Van Renterghem Camiel - Emma Viaene en Mattelin Petrus - Juliana Bruynooghe - Vijf eeuwen familie Van den Abeele te Brugge - Zoektocht naar de nakomelingen van ene Livinus Braems - loon van Oorlog en Vrede

Penningkohieren: - Cohier van Thielt Buuten vande jaere 1571 - kopie origineel in SAG - Cohier van Thielt Buuten vande jaere 1571 - transcriptie van het penningkohier - De penningkohieren van de 20ste (1571) en 5de penning (1577 en 1578) van Meulebeke

52


Inventarissen: - Archief De Panne, onbezet Belgie 1914 - 1918 - Augustij nenklooster te Gent, 14de eeuw - 1796 - Basisbibliografie over kloostergeschiedenis Basisbibliografie over kloostergeschiedenis II, 3. De kloostergemeenschap, Vol. 1 Basisbibliografie over kloostergeschiedenis II, 3. De kloostergemeenschap, Vol. 3, interne structuren Basisbibliografie over kloostergeschiedenis II, 3. De kloostergemeenschap, Vol. 4, dagelijks leven, deel 1 Basisbibliografie over kloostergeschiedenis II, 3. De kloostergemeenschap, Vol. 4, dagelijks leven, deel 2 Basisbibliografie over kloostergeschiedenis II, 3. De kloostergemeenschap, Vol. 5, VII externe relaties, deel 1 Basisbibliografie over kloostergeschiedenis II, 3. De kloostergemeenschap, Vol. 5, VII externe relaties, deel 2 en 3 Cornite van afgeschafte kloosters, 1782 - 1787 De archieven van de Heer, het leenhof en de schepenbank van Zulzeke Dominikanenklooster te Gent, 1352 eeuw Gemeentearchieven Supplement II Het archief van de Congregatie der Gentse Parochiepastoors Inventaris v/h archief v/d officialitiet van het bisdom Gent (1445) 1559-1801 Inventaris v/h archief van Sint-Baafs en bisdom Gent tot eind 1801, deel VI, kerkelijk beleid v/h bisdom . Inventaris v/h archief van Sint-8aafs en bisdom Gent tot eind 1801, deel VII, kerkelijk beleid v/h bisdom Inventaris v/h archief van Sint-8aafs en bisdom Gent tot eind 1801, deel VIII, kerkelijk beleid v/h bisdom - Inventaris van de archieven van de Vredegerechten van Antwerpen - Inventaris van de inventarissen Stadsarchief van Tielt (kopie) - Inventaris van de microfilms van de registers van de Burgerlijke Stand van de gemeenten in de . provincie Antwerpen, 1796 - 1890 - Inventaris van het Adelsarchief Piers de Raveschoot - Inventaris van het archief der familie De Preudhomme D'Hailly en aanverwante families - Inventaris van het archief van de families De Schietere, Van Caloen, De Beaucourt De Noortvelde - Inventaris van het archiefvan de gevangenis te Oudenaarde (overdracht 1999),1912 -1975 - Inventaris van het archief van de Raad van Brabant, deel 1, Archief van de griffies - Inventaris van het Archief van de Raad van Vlaanderen, deel 1 - Inventaris van het Archief van de Raad van Vlaanderen, deel 2 - Inventaris van het Archief van de Raad van Vlaanderen, deel 4 - Inventaris van het Archief van de Raad van Vlaanderen, deel 5 - Inventaris van het Archief van de Raad van Vlaanderen, dee I 6 - Inventaris van het Archief van de Raad van Vlaanderen, deel 7 - Inventaris van het Archief van de Raad van Vlaanderen, deel 9 - Inventaris van het archief van de Rechtbank van koophandel te Gent, 1799 - 1980 - Inventaris van het archief van het Hof van Assisen van West-Vlaanderen en rechtsvoorgangers, 1794 - 1929 - Inventaris van het gemeentearchief Zulte, 1657 - 1971 - Inventaris van het gemeentearchief Assenede (hedendaagse periode), 1792 - 1926 - Inventaris van het gemeentearchief Bellem (hedendaagse periode) - Inventaris van het gemeentearchief Boekhoute (hedendaagse periode), 1792 - 1937 - Inventaris van het gemeentearchief Hansbeke (hedendaagse periode), 1799 - 1948 - Inventaris van het gemeentearchief Sieidinge (hedendaagse periode), 1794 - 1890 - Inventaris van Kaarten en Plans uit het archief van de Provincie Oost-Vlaanderen - Inventaris van Kaarten en Plattegronden

-e=

53


- Inventarissen v/h archief v/d Centrale Gevangenis en v/d Hulpgevangenis te Leuven (overdrachten 1997-'1998) - Inventarissen van de archieven van de gevangenis te Antwerpen, van het interneringscentrum te Antwerpen en van de comissie ter bescherming van de Maatschappij te Antwerpen (overdrachten 1999), 1856 - 1979 - Inventarissen van de archieven van de gevangenis te Brugge en te Sint-Andries-Brugge - Inventarissen van de archieven van de Vredegerechten Ardooie, Ruiselede en Tielt, overdracht 1998 - Inventarissen van de archieven van de vredegerechten Avelgem, Kortrijk eerste kanton, Kortrijk tweede kanton, Kwaremont, Leuven eerste kanton, Menen, Moorsele en Oudenaarde en van de politierechtbank te Kortrijk (overdracht 1999) - Inventarissen van de archieven van de vredegerechten Duffel, Gent derde kanton, Halle, Halle tweede kanton, Hasselt, Heist-op-den-Berg, Herk-oe-Stad, Lier, Lokeren, Oostende, Peer en Wetteren (overdracht 1999) - Inventarissen van de archieven van de Vredegerechten Geraardsbergen en Aalst, overdracht 1998 - Inventarissen van de archieven van het Rijksopvoedingsgesticht te Ruiselede en van het Penitentiair Landbouwcentrum te Ruiselede met daarin opgenomen de archieven van de verschillende interneringscentra te Kortrijk en van het interneringscentrum te Moorsele - Jezuretenklooster te Gent, 1956 - 1986 - Karmelietenkloosters te Gent, 1311 ..,1775 - Onze-Lieve-Vrouwparochie te Deinze, inventaris van het neergelegd archief, 1280 - 1839 - Rijke-Klarenklooster te Gent en Arme-Klarenklooster te Gent, 1585 - 1866 - Toegang op de verzameling microfilms en microfiches der parochieregisters van het Rijksarchief te Brugge - Toegang op de verzameling microfilms van het Rijksarchief te Ronse - Vredegerecht te Evergem, repertorium van de minuten van akten en vonnissen - Vredegerecht te Zomergem, repertorium van de minuten van akten en vonnissen

Kiezerslijsten: Kooiskamp:

Kiezerslijst, 1954 - 1956 Kiezerslijst, 1960 - 1962 Kiezerslijst, 1962 - 1964 Kiezerslijst, 1964 - 1966 Kiezerslijst, 1972 - 1974 Kiezerslijst, mannen, 1948 - 1950 Kiezerslijst, vrouwen, 1946 - 1948

Kerkgeschiedenis: -

54

De Congregatie van de Zusters Augustinessen - Zwarte Zusters - te Gent De geschiedenis van de Kapucijnen in Belgie, 1585 - 2000 De Orde van de Dominicanen: monasticon De Orde van de Dominicanessen: monasticon De zegels op het Vatikaans archief Den godtvruchtigen regel van de Apostelinen Encyclopedieen en Bio-bibliografische naslagwerken Eremieten in de provincies Oost- en West-Vlaanderen tijdens het Ancien Regime: Monasticon Geschiedenis der Zusters van St-Vincentius te Deinze Lexikon van de Belgische Minderbroederskloosters, dee I 1 Lexikon van de Belgische Minderbroederskloosters, deel 2 Monasticon van devote gemeenschappen in de prav. Oost-Vlaanderen tijdens Ancien Regime Monasticon v. devote gemeenschappen in de prov, West-Vlaanderen tijdens Ancien Regime Reeksen over KJoostergeschiedenis Tijdschriften LV.m. Kloostergeschiedenis


Catalogi: - Catalogus van de verzameling kaarten en plannen van het Rijksarchief te Brugge - Oude affiches en kranten affiches Europafeesten catalogus tentoonstelling 900 jaar naam Tielt - Oude geschreven documenten uit Tieltse archieven en oudste document 1105 catalogus tentoonstelling 900 jaar

Boeken: - Bezet Belgie 1914 - 1918 - Boudewijn 1930 1993 - De Brugse drukkersfamilie DAVELUY - De Gentse Floralien 1808-1975 - Gulden Sporen 1302-1977 - Henri Lannoye - Het huisraad in de Vlaamse volkskunde - Jan Frans Willems - La correspondance des Belges pendant la premiere guerre mondiale - Monumentenzorg - Numismatiek munten, penningen en medailles - Omer Tanghe Priester, biografie - Rockoxhuis Burgemeester Rockox 1560-1640 - Vlaamse Begijnhoven - Vlaamse schilders in het Noorden in het begin van de Gouden Eeuw - Albert De Clerck gedenkboek

Archieven: - Het archief Oorkonden - Het archief Oorkonden

van de Abdij van Boudelo te Sinaai-Waas (Band 1) van de Abdij van Boudelo te Sinaai-Waas (Band 2)

en te Gent, deel II, Regesten der en te Gent, deel II, Regesten der

Diversen: -

Gemeente Ruiselede Rouwbrieven peri ode 1951-1999 Gemeente Ruiselede Rouwbrieven periode 1951-1999 Gemeente Ruiselede Rouwbrieven periode 1951-1999 Burgerlijke stand Tielt geboorten overlijden huwelijken Zomergemse families in de 17de eeuw Notariaat Pullincx Karel 1738-1790

deel 1 dee I 2 deel 3 2004

Fons Das

[

Dank

I

Wij danken hartelijk voor wat ze schonken aan ons archief, zoals: bidprentjes, rouwbrieven, rouwberichten, communieprentjes, documenten, huwelijksaankondigingen,. foto's, tijdschriften familiegeschiedenissen, familiepapieren, genealogische uitgaven, enz ... Milo Baert, Tielt - Marie Therese Strobbe, Tielt - Arsene Dinneweth, Tielt - Agnes Devolder, Tielt - Daniel Vandewalle, Tielt - Lydie De Buck, Tielt - Gerda Verkinderen, Tielt - Bart Braekevelt, Tielt - Eugene Vanassche, Jabbeke - Geert De Brabandere, Rotselaar - Arnold Schaubroeck, Schuiferskapelle - Marc Bruyneel, Kanegem - Eric Desmet, Dentergem Eric Biebauw, Hertsberge - Chris Strobbe, Meulebeke - Guido Lams, Wingene - Hubert Bolliou, Wingene - Noel De Vriese, Roeselare

55


Voor u gelezen:

Mishandeling en poging tot moord te Tielt

Uit de nieuwe Gazette van Thielt, 1 mei 1851.

Regtbanken Korrektonele Regtbank van Brugge Coleta de Rock, spinster, en Carolina Teerlynck, vrouw Desmedt, vischverkoopster te Thielt, die zich op het banksken nederzetten, zyn verdacht van rnishandelinqen en verdreigingen van moord. Men roept de aenklaegster, weduwe Mestdagh, by de' 70 jaren . oud, en die schynt aile hare geestvermogens nog te bezitten, als getuige. De voorzitter - Waer over hebt gy u te beklagen ? Weduwe Mestdagh - De 4 february passerende voorby de wooning van Pieter de Rock, wierd ik binnen geroepen: ik yond aldaer dezens dochter Coleta en de vrouw Desmet. Coleta begon met my eenige stokslagen toe te brengen en my haer kind dat ziek in zyne wiege lag, toonende, zegde zy dat ik hetzelve betooverd had, en moest ontdoen waf ik gedaen had, of dat zy my gingen levendig verbranden. Inderdaed, niettegenstaende myn schoonspreken en gemep, namen zy my vast en legden my in den heerd aen het vuer, waerin zy my hielden; myne kleederen waren reedss gedeeltelyk opgebrand en ik had eene wonde bekomen, toen gelukkiglyk een gebuerman op myn gekerm toekwam en my uit hunne handen v.erlostte. De verdachte houden staen dat de weduwe Mestdagh uit eigen beweging binnen gekomen.is; dat zy het kind uit de wieg heeft willen nemen, en dat zy haer wegstootende in het vuer gevallen is. De voorzitter - Hebt gy iets aen het kind van Coleta verrigt ? Weduwe Mestdagh - Neen. Een gebeur (1) komt verklaren dat algemeenlyk in de omstreken van Thielt de weduwe Mestdagh gekend is als tooveres, de magt hebbende van, naer behagen, de menschen en beesten van aile soorten ziekten en kwalen te overladen of hen van dezelve te verlossen. Hy zegt verders dat hy deze vrouw gevonden heeft liggende in het vuer, dat hare kieederen reeds gedeeltelyk opgebrand waren en datzy eene wonde had. De voorzitter aen Coleta - Is uw kind nu nog ziek ? Coleta met hevigheid en als te vreden over hetgeen zy gedaen heeft路 - 'T is toch beter sedert dien. . De regtbank in overweging nemende het vorige gaaf gedrag van de twee beschuldigde, verwyst haer slechts ieder tot 14 dagen gevang. Fons Das 1

De tekst werd letterlijk overgenomen.

56

Hier schrijft men "gebeur", enkele regels voordien is het "gebuerman".


Wandelzoektocht

in Wingene 2006: de winnaars

Uit de.Weekbode van 31 maart 2006.

De Vlaamse Vereniging voor Familiekunde atdeling Tielt organiseerde in het JOC een genealogische boekenbeurs. Tijdens de boekenbeurs werden de winnaars bekend gemaakt van de vierde Familiekundige Wandelzoektocht in Wingene. Er waren 224 deelnemers waarvan 108 uit Wingene. In totaal kreeg WF 106 juiste antwoorden binnen. Als eerste van Wingene en van zijn school kwam Tijl Vandevijvere (Wingene) uit de bus Hij kreeg zijn prijs naast de 10 hoofdwinnaars: Jeffrey Tanghe (Torhout), Tim Reynaert (Melsele), Astrid Cauewaert (Heule), Mathias Vanooteghem (Menen), NoellVanhaverbeke (Wevelgem), Pieter Boury (Waregetn), Kristien Loose (Torhout), Wout Verdest (Beveren-Leie), Rat Vanhaverbeke (Kuurne) en Marcel Derho (Oostkamp). Daarnaast werden nog tien troostprijzen uitgedeeld aan Pepijn Braeckevelt, Martijn Kerckaert, Rhea Haeck, Matthijs Devriese en Robin AJlaert . uit Wingene. Aari Milo Baert, Carine Billiet, Paul Van den Meersche en Wilfried Debever uit Tielt en Georges .Wullaert uit Pittem. (GOP - foto Ronny Neirinck)

V.V.F. - Tielt : nieuwe publicaties Luc Neyt: "Erfgoeddag 2006, Tentoonstelling KLEUR IN DIDACTISCHE SCHOOLWANDPLATEN" met bijhorende CD-Rom, Tielt, WF-Tielt, 2006, 45 blz., prijs boek 5 euro, CD-Rom 15 euro, samen 20 euro + 3,50 euro verzendingskosten. Beide uitgaven zijn ook afzonderlijk te verkrijgen. Gelegenheiduitgave naar aanleiding van de erfgoeddag 2006. - Overzicht van 533 didadische schoolwandplaten bewaard in het archief van de Vrije Basisschool't Nieuwland afdeling Regina Pacis (zwart/wit "thumbnails" van de platen) met de titel of het onderwerp van de schoolwandplaat, gevolgd door de afrnetinq van de plaat en eventuele opmerkingen. 8ij sommige reeksen vind je ook een woordje uitleg over de kunstenaar van de . wandplaat, dedrukker en de uitgever. Het boek bevat een zevental onderdelen verwiizend naar de box (8) met nummers 1 tot 7 in het archief van de school. - 8ijhorende CD-Rom met 533 foto's van de didactische schoolwandplaten en rolkaarten. Deze CD is opgemaakt zeals het boek en bevat dus ook zeven onderdelen of mappen.

Bestellingen: af te halen bij WF-Tielt, p.a. Schuiferskapelsesteenweg 29, 8700 Tielt (051/40 11 36) of we I door overschrijving van de kostprijs + verzendingskosten op rekening WF-Tielt: 800-7026810-14met vermelding van de gewenste uitgave.

57


activiteitenagenda

VVF - Tielt: juli - augustus - september

2006

Ons lokaal is open op elke eerste en derde zaterdag van de maand. Aile activiteiten, tenzij anders vermeld, gaan door in ons lokaal. 1. Werkgroep genealogie op zaterdag 1 juli van 9 tot '12 uur, gelegenheid tot opzoeken. 2. Werkgroep genealogie op zaterdag 15 juli van 9 tot 12 uur, gelegenheid tot opzoeken. 3. Werkgroep genealogie op zaterdag 5 augustus van 9 tot 12 uur, gelegenheid tot opzoeken. 4. Werkgroep genealogie op zaterdag 19 augustus van 9 tot 12 uur, gelegenheid tot opzoeken. 5. Werkgroep genealogie op zaterdag 2 september van 9 tot 12 uur, gelegenheid tot opzoeken. 6. Werkgroep genealogie op zaterdag 16 september van 9 tot 12 uur, gelegenheid tot opzoeken. 7. Zaterdag 23 september van 9u30 tot 12 uur: cursus oud schrift - zie aparte aankondiging. 8. Zaterdag 30 september van 9u30 tot 12 uur: cursus oud schrift - zie aparte aankondiging.

Vraag en antwoord Stuur aile vragen en antwoorden naar de redactie, "Onze Voorouders",

met vermelding van uw lidnummer van VVF-Tielt. p.a. Fons Das , Luxemburglaan 18, 8700 Tielt. Indien u rechtstreeks antwoordt aan de vraagsteller, gelieve de redactie een dubbel te bezorgen.

Door plaatsgebrek

zullen de- volgens datum van ontvangst - binnengekomen in een volgend nummer verschijnen.

Inzenden van vragen, antwoorden,

vragen

teksten en activiteitenkalender

Voor de eerstvolgende nummers worden de belanghebbenden dringend gevraagd rekening te houden met de hierna volgend uiterste data voor het inzenden van hun vragen, antwoorden, teksten, mededelingen en activiteitenkalender. (Steeds een maand v66r de maand van verschijnen!): Nummer 4/ oktober - november - december 2006: veer 31 augustus 2006 Nummer 1 / januari - februari - maart 2007: v66r 30 november 2006 Nummer 2 I april - mei - juni 2007: veer 28 februari 2007 Nummer 3 / juli - augustus - september 2007: veer 31 mei 2007 De redactie antwoorden,

58

kan om bepaalde redenen, zoals bijvoorbeeld plaatsgebrek, artikels, naar een later nummer verplaatsen, ook al werden ze tijdig ingestuurd.

vraqen

en


Belgie-Belgique P.B. 8700TlELT 1 3/4615

ONZ£

VOOROUDERS Website WF- Tielt home.scartet.beJvvftielt

Driemaandelijks tijdschrift van de Vlaamse Vereniging voor Familiekunde Afdeling Tielt. 9de jaargang nr. 4 - oktober 2006 Afgiftekantoor

8700 TIELT 1

Verantwoordelijke uitgever: Lucien Ailliet, SchuHerskapelsesteenweg 29 - 8700 TIELT

• .

.

DON mensen gedreven

• a

~Tielt


ONZE VOOROUDERS Is een genealogisch tijdschrift en informatieblad uitgegeven door de WF verschijnt. telkens bij het begin van het kwartaaL

- afdeling Tielt, dat driemaandeHjks

Ons werkgebied valt samen met de (deel)gemeenten van het vroeger bestuurlijk en kiesarrondissement Tielt (Aarsele. Ardooie, Dentergem, Egem, Kanegem, Koolskamp, Markegem, Meulebeke, Oeselgem, Ooigem, Oostrozebeke, Pittem, Ruiselede, Schuiferskapelle, Sint-Baafs-Vijve, Tielt, Wakken, Wielsbeke, Wingene en Zwevezele) daarbij aansluitend Gottem, lotenhulle, Poeke, Vinkt en Wontergem. De abonnementspriJs bedraagt 4,00 Euro per jaargang voor de leden van WF-Nationaal die inwoner zijn van ons werkgebied en voor aile leden van de Heemkundige Kring de Roede van Tielt WF-Ieden uit andere arrondissementen en niet-WF-Ieden ontvangen ens tijdschrift voor minimum 6,50 Euro (voor leden uit het buitenland 10,00 Euro). Het abonnementsgeld kan gestort worden op rekening 800-7026810-14 van WF Schuiferskapelsesteenweg 29 te 8700 Tielt. Een vrijwillige surplus als steun is zeer welkom !!!!

- Afcleling Tlelt,

Redactieadres: Fons Das, Luxemburglaan 18. 8700 Tielt, tel.: 051/40.22.83, fons.das@telenet.be Voorzitter: Luc Neyt, Luxemburgtaan 21, 8700 Tielt, tel.: 051/40.60.75, Inevt@belgacom.net Secretariaat: Lucien Ailliet, Schuiferskapelsestwg. 29, 8700 Tielt, tel.lfax.: 051/40.11.36, I.ailliet@skynet.be Lokaal: Huyse A1eydis, vroegere Sint-Lucaskliniek, Beemegemstraat 5, 8700 Tiett Openingsuren: etke eerste en derde zaterdag van de maand van 9 tot 12 uur. of na telefonische afspraak met de heer Lucien Ailliet, secretaris. Voor verdere informatie in verband met de opgenomen artikets en bijdragen, gelieve contact op te nemen met de redactie. Elke auteur is verantwoordelijk voor de inhoud van zijn artikel . .Ovemame van teksten toegestaan met vermelding van bron en auteur. Inhoud: - Lijkschouwingent slot Luc Neyt, Luxemburglaan 21. 8700 Tielt Dank

63

- Gabrielle Hammond- Van Eeckhout,overledenin Florida op 18 februari 2006, slot Paul Callens, Waterstraat 18, 8740 Pittem ZoektochtArdooie

66

- HenriWierckx vertrok naarAmerika(1907),eerste deel Guido Buermans, Meidoom 16/bus2. 2640 Mortsel

68

- Genetischonderzoekalgemeenaanvaard,eerste deel Guido Deboeck

71

Voor u gelezen:Mishandelingen poging tot moord te Tielt, aanvulling Luc Neyt Nieuwepublicaties

62

75

- Voor u gelezen: Oproepvan erfgenamen: Nalatenschapvan Isabella- Clara Mestdagh Fans Das, Luxemburglaan 18, 8700 Tielt Vragen

76

- Activiteitenagenda

78


I

I

Lijkschouwingen

Slot. Jacobus Gernay wordt 's anderendaags op 1 september 1752 in Tielt begraven, 47 jaar oud. Hij is geboren in Kanegem op 14 februari 1707 als zoon van Petrus Gernay en Alexandrine De Raet. Hij huwt met Godeliva Vanoverbeke afkomstig van Aarsele. Zij hebben geen kinderen. Zijn weduwe hertrouwt in Tielt op 6 juni 1753 met Bernardus Franciscus De Rinck.21 Op 31 augustus 1752 wordt een "informatiepreparatoire22" gehouden door de burgemeester, schepenen en leenmannen van de stad en Roede van Tielt in aanwezigheid van Philippe Eugene Narbonne en in opdracht van baljuw van Zantvoorde. Er worden drie getuigen opgeroepen die elk afzonderlijk en onder eed een verklaring afleggen over de omstandigheden waarin Jacobus Gernay verongelukt is "heden ontrent den een ure snaghts". De eerste getuige is de zestienjarige Jacobus Lams zoon van Judocus en dienstknecht van molenaar Jacobus.路 Hij verklaart: "dat het waerachtigh is dat hij benevens Jacobus Gemaij sijnen meijster ende Pieter de Rijcker oock mulder van sijn ambaght woonende op den Calchie meulen binnen de stede van Thielt op gisteren ontrent den ses uren naer middagh hebben open gheleijt de steenen ligghende inden meulen bij den selven Jacobus Genaij ghebruijckt ende naer dies sij den selve steenen ghesamentlijkc ghescherpt hebben is het ghebeurt (lat dito Gemaij benevens hem deposant ende den selven de Rijcke hebben laeten lossen den steen om in te legghen, hij Gemaij aen hem deposant gheordonneert heeft vande reep waeranne den ghemelden steen vast was hanghende aen ofte eenen toris los te maecken hij Gemaij den reep vast ghenomen heeft ende den voomomden den steen willende beweghen hij deposant heeft willen den voomomden reep vast houden, den ghes(eijdenJ Gemaij niet wetende den ghemelden reep hun is ontsnapt ende onder den steen ghevallen, dat hij daermede ghedeckt was tot aen sijnen beenen, den deposant seght voorts dat hij met den voomomden Pro De Rijcke aile moghe/ijcke devoeren heeft ghedaen om met den meerghemelden reep den voom(omden) steen vande selven Gemaij te lossen t'gonne onmoghel(ick) was hij deposant sigh begheven heeft ten huyse van Frans de Rocq om hulpe, hij den selven steen heeft he/pen af/ossen van het lichaem van dito Gemaij ende ghes;en heeft dat hij Gernaij doodt was en thooft gheplettert".

taxatie joume

1 schelling 8 groten.

Jacobus Lams ondertekent zijn verklaring met een kruisje, teken dat hij ongeletterd is.

21

A. R. TANGHE, WF-Tielt,

22

Gerechtelijk onderzoek.

documentatiecentrum,

gezinsfiches Tielt 1741-1770, map 16.

63


Jacobus Lams is de zoon van brouwer Judocus uit de Nieuwstraat in Tielt. Hij heeft nog zes broers en vijf zussen allen in Tielt geboren tussen 1723 en 1740. Samen bewonen ze het huis "De Muizennest" dat later de Drie Koningen wordt genoemd. Vader Judocus overlijdt in 1742 amper 45 jaar oud. Zijn weduwe, de Pittemse Brigitta Demeurisse, hertrouwt in Tielt met Jan Baptiste Verlinde. Op dat ogenblik zijn er nog tien kinderen in leven. Onze Jacobus is tweemaal gehuwd en overliidt in Brugge op 10 februari 1805 als molenaar.23 Getuige Pieter De Rijckere zoon van Gillis, geboren in Kanegem en 26 jaar, is dienstknecht van Frans de Raedt, molenaar op de "Ca/chiet!molen in Tielt. Hij verklaart dat hij op verzoek van Jacobus Gemaij "is aensoght gheworden op den 2gen deser loopende maendt ougst 1752 om te gaen he/pen scherpen de steenen /igghende inden stede meulen ghebruijckt bijden selven Jacobus Gemaij hij desposant seght opgestaen ten dien effecte heeft laeten vinden inden selven mue/en ontrent den ses uren naer middagh hij deposant benevens den meer ghemelden Jacobus Gemaij ende Jacobus Lams sijnen knecht hebben open gheleijt de steenen ligghende inden coorenwintmeulen bij den voomomd(en) Gemaij gheocupeert ende naer dies sij de selve sfeenen ghesemant/ijkc ghescherpt hadden is het gheschiet dat dito Gemay benevens hem deposant ende den selven Jacobus Lams hebben laeten lossen den steen om in fe legghen, hi] Gemaij aen den voorschreven sijnen knecht gheseijt heeft dat hij den reep waeranne den ghemelden steen was hanghende aenden hasse eenen tour saude /osmaecken, waer op dito Lams gheseyt heeft dat hij den reep saude vasthauden ende den voors(chreven) Gemaij heeft gheantwoort ick sal den reep wei vasthauden, hij Gemay den reep vast ghenomen heeft, ende den voomom(den) steen willende beweghen den voorseijden reep aen hem Gemaij is ontsnapt ontrent hedent ten een ure snaghts ende onder den steen ghevaJ/endat hy daermede ghedeckt was tot aen sijnen beenen". Verder getuigt Pieter De Rijcke dat hij alles in het werk heeft gesteld am Gernaij te redden maar er niet in slaagde. Daarop is Jacobus Lams "uyt den meulen gheloopen" om Frans Rock te halen en samen hebben ze nog een poging ondernomen om "den selven steen te he/pen lossen van net Iichaem van dito Gemaij ende hij deposant ghesien heeft dat den selven Gemaij doodt was ende thooft gheplettert".

taxatie ourne

3 schellingen graten

handtekening van Pieter de Rijckere

Francois de Rocq "saegher van sijnen stijle" woont op Tielt-Buiten. Hij bracht rond middernacht (31 augustus) een bezoek aan de Stedemolen alwaar Jacobus Gernaij, Jacobus Lams en Pieter De Rijcke nag aan het werk waren om te "scherpen de steenen liggende inden selven steden meulen". Rond helzelfde uur verlaat Francois de molen en begeeft zich naar het woonhuis van Jacobus Gernay. Onmiddellijk daama komt Jacobus Lams aangelopen zeggende "dat sijn meester onder den steen lagh ende dat hij benevens Pieter de Rijcke niet bequaem en was om den selven steen te connen aflossen dat hij deposant saude willen hebben commen he/pen". Francois de Rocq gaat onmiddellijk mee en helpt samen met de Rijcke en Lams molenaar Gernaij van onder de steen. Maar helaas, ook Francois moet vaststellen dat "den voom(omden) Gemaij doodt was ende thooft ghemorsselt". 23

A R. TANGHE, WF-Tielt,

64

dacumentatiecentrum,

gezinsfiches Tielt 1701-1740, map 13.


,

'

:

"

"

,

. .

,

,

, ~ '" ltv,"

taxatie journe

6 schelling en 8 groten

handtekening Jean Francois

:~~,:,',

"

i""

I"

••••

:',

~,

>,/.: '~''':i:_.':;·:;:

',.'; :'~; .:.:~ .~~~~

de Rock

Franciscus De Roques (De Rock) ook soms Joannes Franciscus genoemd wordt geboren in Nupkercke als zoon van Joannes Baptiste. Franciscus huwt Maria Catharina Beels uit Wijtschate. Samen hebben ze vier kinderen: Maria Josepha geboren in Tielt op 13 januari 1741 en er overleden op 9 mei 1806; Jacobus eveneens geboren in Tielt op 9 april 1746 en er overleden op 30 oktober 1761. Petronelle en Joannes Baptiste worden in Wijtschate geboren en huwen in Tielt, respectievelijk met Franciscus Van Daele op 24 april 1760 en Joanne Marie Hoste op 5 april 1761. Franciscus De Rock overlijdt in Tielt op 28 januari 1781 in de leeftijd van 77 jaar, zijn weduwe overlijdt op 23 maart 1784, ze is 85 jaar.24 GuUlielmus Franciscus Vande Vondel komt in de stadsrekeningen van Tielt meerdere malen voor als licentiaat in de medicijnen.25 In de parochieregisters van Tielt vinden we hem niet terug, waarschijnlijk woonde hij buiten Tielt. Over zijn collega Ludovicus Constantin us De Smet weten we dat hij de zoon is van Gaspar en Anna De Meulenaere.26 Hi; huwt in Tielt op 4 mei 1731 met de Meulebeekse Maria Catharina Serroels. Samen hebben ze tien kinderen allen te Tielt geboren en gedoopt: Catharina Jacoba, Anna Marie huwt Franciscus Ludovicus Vaerman, Florentia Cornelia, Maria Joanna, Ludovicus Franciscus, Franciscus Arnoldus, Petrus Josephus, Joannes Josephus, Eleonora en Clara Josepha. huwt Guilielmus Josephus Rapaliere.27 In 1745 wordt dit gezin ingeschreven als poorter van Tielt. 28 Luc Neyt A. R. TANGHE, WF-Tielt, documentatiecentrum, gezinsfi.ches Tielt 1701-1740, map 12. F. HOLLEVOET, Stadsrekeningen Tielt: 1610-1794, p. 414, 415, 435 en 453. . 26 Voor meer informatie: zie tweede lijkschouwing van Francois Roose. 27 A. R. TANGHE, WF-Tielt, documentatiecentrum, gezinsfiches Tielt 1701-1740, map 12. 28l. AILLIET, de poortersboeken van Tielt, afSchrift 1745, deellll, p. 15 nummer 86. 24

25

Dank

Wij danken hartelijk voor wat ze schon ken aan ons archief, zoals: bidprentjes, rouwbrieven, rouwberichten, communieprentjes, documenten, huwelijksaankondigingen, foto's, tijdschriften familiegeschiedenissen, familiepapieren, genealogische uitgaven, enz ... Andre Lippens, Dentergem - Rika Verbaeys, Marialoop - Jules Desmet, Wakken - Rita Wanssele, Kanegem - Stephanie Bastijns, Halen - Jacqueline Das, Linkhout - E.Z. Cecile Van QUickelberghe, St. Kruis, Brugge - Milo Baert, Tielt - Philippe De Gryse, Tielt - Daniel Vandewalle, Tielt - Agnes Devolder, Tielt - Paul De Soete, Tielt - E.H. Gabriel Buysse, Tielt

65


Gabriella Hammond - Van Eeckhout overleden in Florida op 18 februari 2006 Slot. 25. Carole Elaine Van Eeckhoutte (Achiel Joseph, Camillus Van Eeckhout) Carole Elaine Van Eeckhoutte en Vincent McGeough hadden volgende kinderen: 81 i. Lynn Marie McGeough 82 ii. Joseph Gerard McGeough 83 iii. John Vincent McGeough 84 iv. James Michael McGeough 85 v. Colleen Marie McGeough 86 vi. Kathryn Marie McGeough 26. Joan Mae Van Eeckhoutte (Achiel Joseph, Camillus Van Eeckhout) Joan Mae Van Eeckhoutte en Kenneth Raymond Allison hadden volgende kinderen: 87 i. Elaine Jean Allison 88 ii. Ronald Craig Allison 89 iii. Renee Lynn Allison 90 iv. Brian Keith Allison 27. Norman Lee Joseph Van Eeckhoutte (Achiel Joseph, Camillus Van Eeckhout) Norman Lee Joseph Van Eeckhoutte en Jo Ann Parker hadden volgende kinderen: 91 i. James Van Eeckhoutte 92 ii. Christopher Scott Van Eeckhoutte 93 iii. Sean Michael Van Eeckhoutte 94 iv. Michael David Van Eeckhoutte 28. William Henry Van Eeckhoutte (Achiel Joseph, Camillus Van Eeckhout) William Henry Van Eeckhoutte en Charlene Elizabeth Root hadden volgend kind: 95 i. Galem Joseph Van Eeckhoutte 29. Janet Eileen Van Eeckhoutte (Achiel Joseph, Camillus Van Eeckhout) Janet Eileen Van Eeckhoutte en Lee Woodworth hadden volgende kinderen: 96 i. Chris Tina Woodworth 97 ii. Stephanie Kay Woodworth 30. Cheryl Ann Van Eeckhoutte (Achiel Joseph, Camillus Van Eeckhout) Cheryl Ann Van Eeckhoutte en Robert Kalesch hadden votgende kinderen: 98 i. Sabrina Kalesch 99 ii. Forrest Kalesch 31. John Brian Van Eeckhoutte (Achiel Joseph, Camillus Van Eeckhout) John Brian Van Eeckhoutte en Kathy Austin hadden volgend kind: 100 i. Tammie Marie Van Eeckhoutte 32. Patrick Lewis Van Eeckhoutte (Julius, Camillus Van Eeckhout) Patrick Lewis Van Eeckhoutte en Phillis ..(Van Eeckhoutte) hadden volgende kinderen: 101 i. Dawn Van Eeckhoutte 102 ii. Rodney Van Eeckhoutte 103 iii. Scott Van Eeckhoutte 66


33. Ronald Thomas Van Eeckhoutte (Julius, Camillus Van Eeckhout) Ronald Thomas Van Eeckhoutte en Helen Elaine Hummel hadden volgende kinderen: 104 i. Debra Lynn Van Eeckhoutte 105 ii. Robin Maria Van Eeckhoutte 106 iii. Helen Loraine Van Eeckhoutte 107 iv. Patricia Kim Van Eeckhoutte 108 v. Chance Alan Van Eeckhoutte Ronald Thomas Van Eeckhoutte en Deborah Sue McFarlin hadden volgend kind: 109 vi. Heather Renee Van Eeckhoutte Paul Callens

Zoektocht Ardooie Van zaterdag 11 november 2006 tot en met dinsdag 27 februari 2007 organiseert de WF (Vlaamse Vereniging voor Familiekunde) afdeling Tielt een wandelzoektocht in Ardooie. Deze zoektocht loopt in samenwerking met het Gemeentebestuur Ardooie en de Heemkundige Kring Ardooie-Koolskamp. Het thema van de zoektocht is ''familie- en heemkundige indicaties op straat". De deelname is gratis. Gratis deelnemingsformulieren zullen beschikbaar zijn vanaf ZATERDAG 11 NOVEMBER 2006 tijdens de openingsuren van: • • •

het gemeentehuis en de bibliotheek in Ardooie het Cultureel Centrum 't Hofland in Ardooie het documentatiecentrum van de VVF-afdeling Tielt, Beernegemstraat 5, Tielt op zaterdagen: 18 november, 2 en 16 december 2006,6 en 20 januari, 3 en 17 februari 2007 van 9 tot 12 uur.

De zoektocht start aan het nieuw gemeentehuis, Polenplein 15 in Ardooie en eindigt na een tocht van ongeveer 3,5 kilometer door de centrumstraten op het Marktplein. Naast een doorlopende tekst en bijhorende foto's worden twintig vragen gesteld over familiale en heemkundige gegevens uit het heden en het verre verleden van Ardooie. Voorkennis van Ardooie is niet noodzakelijk, dit maakt de zoektocht ook zeer toegankelijk en leerrijk voor niet-Ardooienaars. Ook leerlingen van de lagere school zullen er pret aan beleven. Aan de zoektocht zijn talrijke mooie prijzen verbonden. De uitreiking van de prijzen gaat door tijdens de achtste genealogische boekenbeurs in Tielt op zondag 4 maart 2007 om 11 uur in het Jeugdontmoetingscentrum (J.O.C.) op het Generaal Maczekplein. De winnaars worden verwittigd.

67


Henri Wierckx vertrok naar Amerika (1907) Eerste deel. Op onze zoektocht naar emigranten uit de regio, welke bij het einde van de 19de - begin van de 20ste eeuw vertrokken naar Amerika, kwam ons toevallig de familiekroniek van het geslacht Wierckx uit Kalmthoutsehoek onder ogen; deze familiegeschiedenis is van de hand van mevrouw Joanna Wierckx (1910-?). Ons verhaal begint op 24 december 1845, toen in het gezin van Joannes Wierckx, getrouwd met Adriana Van Loon, na dertien jaar wachten een kerstkindje werd geboren dat de naam Joannes Antonius werd gegeven; het was de derde generatie waar aan de oudste zoon de naam Jan werd gegeven, zodat men destijds sprak van de oude Jan, de jonge Jan en de jonge Jan zijn Jantje. Door zijn laattijdige komst is Janlje ook het enig kind gebleven. Joannes Antonius Wierickx is getrouwd te Essen op woensdag 7 april 1869, op 23-jarige leeftijd met Joanna Norbertina Bruynseels (27 jaar oud), geboren te Essen (Moerkant) op woensdag 8 juni 1841. (Cf. volledige gezinsstaat als bijlage). Sinds generaties oefenden de Wierckx'en op Kalmthoutsehoek het beroep van timmerman uit. Jan (Antonius) was niet aileen timmerman, maar ook aannerner van gebouwen. Zo werkte hij onder meer voor de heer Calmeyn en de paters Redemptoristen, en in Heide voor de families Bareel en Van Damme. Meerdere zonen hebben hun vader gevolgd in de stiel van timmerman: Jaak (째1873), Alois (째1874), Henri e1875) en Frans (째1876). Maar Henri mikte verder en vertrok in 1907 naar Amerika, waar drie aanstaande 1 schoonbroers ook timmerman waren in Detroit, Michigan (VSA). Zo begon hij ginder ook al te bouwen en huwde met Maria Vande Weghe, een meisje van Tielt, in dienst bij de heer Calmeyn. Henri vertrok dus naar de grootstad en ging niet, zoals de andere emigranten uit de Essense regio naar Hart, Michigan, waar een kleine kolonie afkomstig uit de Noorderkempen gevestigd was, en er werkzaam waren als landbouwer. 2

1

Die schoonbroers waren:

Joseph Francis (Joseph Sr.) Van de Weghe, geboren te Tielt op 16 februari 1879, en is overleden te Detroit op 28 mei 1930. Hij vertrok uit Antwerpen op 5 januari 1903 met het S5 Pfalz naar Buenos Ayres, om zich te begeven naar Detroit, Michigan bij zijn kozijn Louis De Jonckheere, Arndt Street nr. 209. (Cf. Venesoenrapporten, volgnr. 10857).Hij vertrok andermaal uit Antwerpen met het 55 Lapland, en kwam op 24 maart 1914 aan in New York; volgens de gegevens van de immigratiedienst van Ellis Island was zijn verblijfplaats Detroit, Michigan, en hij was gehuwd.Hij was inderdaad gehuwd met Augusta Ervinck. Adilus Franciscus Van de Weghe, geboren te Tielt op 18 december 1881. Hij vertrok uit Antwerpen op 24 juni 1905 met het ss Finland naar New York, waar hij aankwam op 5 juli 1905; hij begaf zich naar Detroit, Michigan bij zijn broer, Joseph Vande Weghe, Belvedere Avenue nr; 491. Deze is er werkzaam als schrijnwerker. (Cf. Venesoenrapporten, volgnr. 18805). Mauritius Adilus Josephus (Adiel) Van de Weghe, geboren te Tielt op 11 oktober 1887, en is overleden te Detroit, Mich. op 11 januari 1980. Hij is vertrokken uit Antwerpen met het ss Zeeland, en kwam toe te New York op 3 februari 1909; hij was op dat ogenblik ongehuwd. Waarschijnlijk is hij in 1912 opnieuw vertrokken naar Amerika. Hij was gehuwd met Flavie Vanderbeke, geboren op 7 mei 1895, en overleden te Detroit, Mich. in oktober 1980. 2

Cf. Guido Buermans, Petrus en Philomena Van Agtmael-Buermans 2000, biz. 52 en volgende.

68

in Amerika, in: 'De Spycker', Jaarboek


Zijn vrouw Marie Sylvie Vande Weghe, Maria genaamd, is geboren te Tielt op 25 juni 1871, dochter van Adolphe Vande Weghe (meester meubelmaker) en Leonie Marie Bourgeois. Voor zover als bekend werden uit dit huwelijk twee dochters geboren:

1. Marceline. 2. Hilda, geboren op 24 april 1911, en overleden te Macomb, Michigan, op 24 juli 2000.

3

De zoektocht naar de juiste plaats en datum van het vertrek van Henri Wierckx verliep moeizaam, in de eerste plaats omdat er in de Venesoenrapporten voor het jaar 1907 geen volledige passagierslijsten beschikbaar waren, en voorts dat bij de consultatie van de passagierslijsten van Ellis Island de naam 'Wierckx' onvindbaar bleek; eerder toevallig vonden wij dat die naam gespeld was als 'Wurick'. De webstek van Ellis lsland" vermeldt de volgende gegevens:

First Name:

Henry

Last Name:

Wurick

Ethnicity:

Belgium Flemish

Last Place of ResidenceEsschen Date of Arrival: ~ge at Arrival: 32y Status: S

January 30, 1907 Gender: M

Ship of Travel:

Kroon/and

Port of Departure:

Antwerp

Manifest Line Number:

0008

Marital

Uit die informatie blijkt dat Henri Wierckx, op het tijdstip van zijn emigratie, nog ongehuwd was; hij is meer dan waarschijnlijk later getrouwd in Detroit.

3

Gegevens U.S. Social Security Death Index.

4

Voor de geTnteresseerden: httpJleiiisisiandrecords.org/

69


Gebouwd in Amerika vertrok de Kroonland, onder Amerikaanse vlag, op 28 juni 1902 uit Antwerpen. Van 1908 tot 1912 droeg zij de Belgische vlag. In 1914 deed zij nog vanuit New York een plezierreis naar de Middellandse zee. De oorlog is intussen uitgebroken in Europa maar de U.S.A. zijn er nog niet bij betrokken. Er is geen reizigersverkeer naar Europa meer en dus werd dit schip ter beschikking gesteld van de Panama Pacific Line (een zustermaatschappij van de Red Star line) en zij verzekerde nu een verbinding met San Francisco, via het Panama kanaal. In 1916 vaarde ze nog op Londen, tot ze in 1917 (Amerika is nu in oorlog) als troepentransportschip Yankees naar Europa voerde. Na de oorlog werd zij nog verbouwd en komt in 1920 naar Antwerpen. In 1923 werd zij terug overgenomen door de Panama Pacific Line om ten slotte in 1928 in Genua gesloopt te worden. Commissaris Venesoen vermeldt dat de Kroonland onder Amerikaanse vlag voer, met als bevelhebber Doxrud, op 20 januari 1907 vertrok uit Antwerpen, en aankwam te New York op 29 januari 1907. Over het verblijf van Henri Wierckx in de Verenige Staten is ons niet veel gekend. Wei blijkt dat de gewezen inwoners van Essen elkaar niet loslieten en contact hielden: op 29 december 1936 schrijft Christ Van Agtmael (welke in 1922 uit Essen was vertrokken en sindsdien als landbouwer was gevestigd in Hart, Michigan)5 naar zijn schoonbroer Frans Broos-Nelen in Essen dat hij v66r drie weken op bezoek was bij Henri Wirks (sic): deze was ook maar ziekelijk, en heeft hem beloofd in de zomer enige tijd naar de buiten te komen. Henri Wierckx is overleden te Detroit, Michigan (VSA) op donderdag 14 april 1949,73 jaar oud; zijn vrouw Maria Vandeweghe is overleden te Grosse Pointe (VSA) op maandag 1 augustus 1955.

We have 10"e(\ her (lurIng life: let _. " .-. us not 8ba~d.on ber unui' we hA.\"e :: conducted her by our 'prayers mY" the- House 01 the Lord. , '_'

, "iN MEMORIAM

, Mary

Wierickx'

Beloved Wile' of HENRY WJEUICKX Died Grosse l'omte, lIlicb. '.'AUgust ]~ 19.55 PRAYER

', 0 Gentlest H~art of Jesus, ever ", present 'In the :Blessed c3.Crament, ever cousumeet With burnlng love ror tno poor captive souls In purgato;"', ha:v~ mBrcy on the soul Thy depo.rte<i servant, Be not severe , I.. "Thy, judimellt, but let some drops or Thy precious blood tall upon the devouring tIrones, 'and do , : 'I'hcm, 0 Merclful Savior, send Thy "':, angels' -to conduct Thy departed ":" "servan t ' to a place or refreshment, , , llght and peace. . Amen.

or

VAN

OEWEGHE:

t":f {~.:._ ,~~ _~_~~_~

~UNk:RAL

CHAPEL"

5

Cf. Guido Buermans, Ook Christ en Trien Van Agtmael-Nelen Jaarboek 2003

70

' .

,: ",;.

.... ; "

.~:.-- '_"~-:...;.,"":

Noot: De naam 'Wierckx' wordt afwijkend gespeld als 'Wierickx', deV.S.A. wordt vervolgd

,

en in elk geval in Guido Buermans

vertrokken naar Amerika, in: 'De Spycker',


Genetisch onderzoek algemeen aanvaard

Door Guido Oeboeck, Ph. D" Bestuurder van het Vlaamse DNA-Project Eerste deel. De auteur: e

Een woordje over de auteur: Guido J Deboeck is de12 generatie afstammeling van Mattheus de Bock, geboren in 1580 in St Amands. Na jarenlange reizen heeft de auteur ontdekt dat terugreizen in de tijd met behulp van genetisch onderzoek nog meer opwindend is dat rond de wereld reizen. Hij publiceerde verschillende boeken over gevorderde financiele technieken (Trading on the Edge, John Wiley & Sons, NY, 1994; Visual Explorations in Finance, Springier-Verlag, London, 1998) evenals een kookboek met recepten voor koken met bier (Un 'beer'ably Delicious: Cooking with artisan and craft beers, Dokus Publishing, Arlington, VA, 2001). Vertaling: Aranka Callens, Oudenaarde. Dit artikel verscheen in het Engels in Flemish American Heritage, Volume XXIV, Issue 1, Februari 2006.

Is genetisch onderzoek de norm geworden? "Ats dit nag niet het gevat is; zal het dat binnenkort wei zijn ...", sprak Bennett Greenspan, hoofd van het bedrijf Family Tree DNA, op de 2e Internationale Conferentie in Washington over genetisch onderzoek op 4 en 5 november 2005. Bekijken we eens het bewijs.

Family Tree DNA biedt net zoals talrijke andere bedrijven DNA-testen aan. Bij de oprichting in 2000 werden een 300 tal DNA-stalen onderzocht, een jaar later al 1.700, in 2002 maar liefst 4.800 en in 2003 waren het er al 10.0001 Het aantal onderzochte stalen steeg tot 18.000 in 2004. In april 2005 begonnen National Geography en IBM 64.000 DNA-stalen te onderzoeken voor het Genographics- Project die de migraties van je verre voorouders in een kaart brengt. Family Tree DNA ondersteunde deze onderzoeken tussen mei en oktober 2005. Sinds eind 2005 kunnen we op de website van Family Tree DNA ongeveer 2.651 vaak voorkomende familienamen en 28.697 unieke familienamen terugvinden. Daarnaast kan men een database raadplegen met 51.120 Y-chromosoom-profielen en 15.212 mitochondriale DNA-profielen (zle hoofdstuk 1). Genetisch stamboomonderzoek is dus goed op weg om algemeen aanvaard te worden!

Oit artikel bevat een kort overzicht van enkele basisconcepten van genetisch onderzoek, zoals "wat houdt een DNA-test in, welke testen zijn er momenteel op de markt?". We gaan dieper in op projecten die familienamen en geografische achtergronden onderzoeken. We zullen in het bijzonder aandacht besteden aan een Vlaams DNA-project. Onze doelstelling is de lezers bewust te maken van de vooruitgang en de voordelen van genetisch onderzoek en hen aan te moedigen om een DNA路test te bestellen. DNA-testen verrijken ieders persoonlijk stamboomonderzoek en dragen bij aan familienaam en/of Vlaamse DNA-projecten.

71


1. Korte introductie tot genetisch onderzoek Stamboomonderzoek berust op documenten. Is er een document, dan kan men dit onderzoeken om de familiegeschiedenis en de relaties tussen mensen te achterhalen. Sommige documenten kunnen bewust of per ongeluk, bijvoorbeeld door brand of aardbeving, vernietigd zijn. Andere documenten kunnen fouten bevatten of geschreven zijn om te misleiden. Sommige relaties tussen mensen zijn zelden neergepend bijvoorbeeld adopties, naamsveranderingen of onwettige kinderen. Wat echter noch veranderd noch vernietigd kan worden, en nooit verkeerd gelnterpreteerd kan worden is DNA, het erfelijke materiaal dat ieder individu onderscheid van een ander. Genetisch onderzoek baseert zich op DNA om vondsten te ondersteunen, te bevestigen, te ontkennen, gewoon stamboomonderzoek steunt enkel op documenten. Mannen hebben zowel een X als een Y chromosoom (dus Xy), vrouwen 2 X chromosomen (dus XX). Terwijl de moeder een X chromosoom doorgeeft aan haar kinderen zal de vader aileen het Y-chromosoom doorgeven aan zijn zonen en het X chromosoom aan de dochters. Hierdoor kan men enkel de mannelijke tak van een familie bestuderen. Naast de chromosomen die zich in de kern van de eel bevinden hebben mannen en vrouwen ook nog een tweede type DNA dat in de mitochondrien ("energiecentrales") van de eel bevindt. Dit mitochondriaal DNA (mt-DNA genoemd), wordt enkel via de moeder aan al haar kinderen doorgegeven. Aldus is het mt-DNA voor zowel mannen als vrouwen erg bruikbaar om de uitsluitend vrouwelijke vertakking van een familie te achterhalen om een grondige analyse van de voorouders te maken. Het volgende stuk kan overgeslagen worden als u al een basiskennis heeft van DNA of als u meer interesse heeft in de meer praktische aspecten van DNA-testen (zie hoofdstuk 2). Het menselijke genoom bestaat uit drie miljard nucleotide basenparen terwijl het mt-DNA ongeveer 16.500 basenparen bevat. DNA bestaat uit vier nucleotiden: adenine (A), guanine (G), cytosine (C) en thymine (T). C hecht zich steeds vast aan G en A aan T. Zo vinden we op het DNA een lange reeks basenparen in wisselende volgorde. In een eerste fase controleert een DNA-test enkele plaatsen op het genoom. Vervolgens telt de test hoe vaak dezelfde basenparen voorkomen. Zo kan een DNA-streng als volgtgelezen worden: CTTCTAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATCCTAG Vanaf de 5e letter is het duidelijk dat dezelfde lettercombinatie TAGA 12x opduikt alvorens TCCTAG begint. Short Tandem Repeats (STR) zijn opgebouwd uit korte stukjes DNA van 4 of 5 nucleotiden die meerdere keren achter elkaar verschijnen. Deze DNA-streng toont 12 x TAGA, waardoor de waarde die wordt toegekend aan deze plaats op het DNA (DNA-merker genaamd) 12 zou zijn. DNA-merkers zijn dus gebieden binnen het DNA die bestaan uit een reeks zich voortdurend herhalende bouwstenen en die aldus gemakkelijk te herkennen zijn. Vroeger bestudeerden de DNA-testen enkel 12 merkers, maar meer specifieke details kunnen we halen als we meer merkers testen, bijv. 25,37,59 of 66. Hoe meer DNA-merkers gebruikt zijn, hoe betrouwbaarder de test. Een gen is een zeer specifiek deel van de dubbele helix DNA (zie figuur 1) en bevat informatie voor aile erfelijke eigenschappen, Onze lichaamscellen bevatten van chromosoom 2 exemplaren (1 van de moeder, 1 van de vader). Elk chromosoom bestaat duizenden genen. Van de in totaal 46 chromosomen erven we er de helft van vader (23), andere helft van moeder (23). Het 23e chromosoom bepaalt het geslacht.

72

de elk uit de


Figuur 1: dubbele helix van menselijk DNA Bij iedere celdeling wordt er een kopie gemaakt van het erfelijke materiaa!. Nu en dan kan er hierbij een mutatie optreden, waardoor de kopie lichtjes verschilt van het oorspronkelijke DNA. We spreken van een SNP (uitgesproken snip), wat staat voor single nucleotide polymorphism, als er een enkele letter van de genetische code verschilt: bijvoorbeeld van CTTCAGGGTC naar CnCAGGGCC (verandering voorlaatste letter). Dergelijke mutaties komen erg zelden voor en kunnen zowel plaatsvinden op het Y-chromosoom als op het mtDNA. De mutatiesnelheid van het mt-DNA is echter 10-maal groter dan voor het Ychromosoom waardoor de kans groter is dat we in de loop van de generaties veranderingen zullen zien op het mt-DNA. Aan de hand van snips kunnen we een fylogenetische stamboom opstellen, een grafische voorstelling van de relaties tussen groepen van mensen, met hetzelfde Y-chromosoom of mtDNA, doorheen de tijd. ledere mutatie betekent een nieuwe vertakking van de stamboom. De fylogenetische stamboom van het Y~chromosoom werd in 2005 op punt gesteld en is te vinden op http://www.familytreedna.com/haplotree.html Bijvoorbeeld: via mijn Y-chromosoom (zie figuur 2) zit ik in de R1b haplogroep. Haplogroepen worden ingedeeld volgens genetische mutaties die optreden in het Ychromosoom. De leden van een haplogroep vertonen gelijkaardige herhaalpatronen in basenparen als de meest recente gemeenschappelijke voorouder van de haplogroep. Haplogroepen kunnen vaak geografisch ingedeeld worden. De leden van de R1b haplogroep zouden de afstammelingen zijn van de eerste mensen die tussen de 35.000 en 40.000 jaar geleden in Europa arriveerden. Het waren die mensen die prachtige muurschilderijen maakten in de Spaanse en Franse grotten. Zij waren eveneens de tijdsgenoten van de Europese Neanderthalers en zorgden misschien wei voor het uitsterven van deze laatste groep. DNA Test Results (Alleles) for Project Members G,C C ''\AA

n a

II

Kil

Most DistaDI ADn'Sl!>C

.1

3"

pll .'I~:;4lr 1'J,}19S5l8J. .. 3 0 'J I " r.

6

II

I

'Il~" !\bllll~U'J~!l,>.;l;.",,;~.I~~'I~1 -. Amaads, H-.:."lfilHin!at

_

411>22"\bl1h~'"'~~faf.'k"Il"··I~~OSt

• l.I ~'I I~ II II. 151.1,11

.} maces,

EX!

~llJm I - ~

- II

l( ',1 [,I 11II I~ II I'

. . ...

- -

l 8 9 I ,_' I

3 9 !

(1'1,

...,

3 Ji 9

,

T ..f. -5'"

"' .. s

5 \j '} 1 a b

<',I

II LI u:to

~

s

1- 'I IiI II .t"

4

s s

..

.. ,1

4 3

7

7

11'''['~ -_.

-

..

;1 ·t I;

.. f' ,"

-r

g

ii

CC

,I ·1 'A'l I :.1.1 u ri (;,4 ll.i6S:;YY-I· .; ., 6 n ~1107 , -I ~ dO·"':II b:!~-7-r~i)·i.:" b'l

I'~>q"I·1 l~ I~ I~ -.

_...

17') to 11 1125 If' I') 2il H 15 15 I~

Figuur 2: De test resultaten via Y-chrornosoom onderzoek van 2 afstammelingen van Mattheus de Bock.

73


R1b is de meest voorkomende Y haplogroep in Europa: meer dan de hetft van aile Europeanen behoren tot de R1b groep. Dit betekent dat ik net dezelfde mutatie heb in mijn DNA als de hoofdvertakking van de R1b groep. ledere vertakking in de stamboom komt immers overeen met 1 SNP (1 enkele verandering van de oorspronkelijke lettercode verschilt). Bekijken we naar mijn mt-DNA, dan behoor ik tot de 16519C groep. De vertakking 16519 begint volgens de Cambridge Reference Sequence (CRS) met de nucleotide T, terwijl bij mij de nucleotide C aanwezig is. De Cambridge Reference Sequence is gebaseerd op het DNA van iemand dat werd getest in 1990. Dit DNA dient als referentiepunt voor de classificatie van aile mt-DNA.(1) Het testen van zowel het Y- chromosoom als het mt-DNA bepaald tot welke haplogroep iernand behoort. Aldus kunnen we een specifieke tak van de fylogenetische stamboom vinden en zien hoe de relatie tussen de onderlinge groepen doorheen de tijd is verlopen. DNA-tests op het rnt-DNA tonen verschillende varianten aan tegenover de intemationaal gebruikte referentiesequentie (Cambridge Reference Sequence). 2. Uw-DNA testen in minder dan een minuut en..â&#x20AC;˘ pijnloos Een DNA-test ondergaan is zeer eenvoudig. Er zijn ongeveer een tiental commerciele bedrijven in de USA die tests aanbieden. U kunt bij hen een test kit bestellen via de telefoon of on-line (voor meer details: zie referenties). Wanneer U uw kit ontvangt, volg de bijgevoegde gebruiksaanwijzingen. De test zeit neernt minder dan een minuut van uw tijd in beslag, het volstaat dat u een uitstrijkje neemt van het wangslijmvlies. Vervolgens stuurt u de test terug. U ontvangt na een tweetal weken het resultaat. Uw DNA-resultaten kunnen aan eren of meerdere openbare databases toegevoegd worden om vergeleken te worden met andere resultaten (hierbij wordt de privacy gerespecteerd want men werkt met testkitnummers en niet met namen). Een 'familienaam project' vergelijkt personen met dezelfde of gelijkaardige familienarnen. Geografische projecten onderzoeken of personen met dezelfde geografische achtergrond een gemeenschappelijke afkomst hebben. Beide projecten worden verder besproken in hoofdstukken 3 en 4. Hoe kiest U best tussen de gespecialiseerde bedrijven die DNA-testen aanbieden? Er bestaan slechts 6 bedrijven die standaard Y-chromosomen testen aanbieden voor familienaam onderzoeken. Daarvan zijn er drie bedrijven die precies datgene aanbieden waarin genealogen ge"interesseerd zijn. Het gaat om DNA Heritage, Family Tree DNA en Relative Genetics. Deze uiterst bekwame bedrijven meten tussen de 9 en 66 merkers, afhankelijk van de prijs die u wenst te betalen. De prijs varieert tussen 3.63 euro en 10.37 euro per DNA-merker. De vuistregel is dat een 24merker test geldt als minimum om betrouwbare resultaten te geven. (2) wordt vervolgd

1

2

Guido Oeboeck

De volledig herziene CRS http://www.mitomap.org/mftoseg.htmlrij 16505 kolom 19 ziet u een T verschijnen in 16519 in plaats van mijn C. Dit wil zeggen dat mijn mt-DNA 1651 C varieert van de CRS met een T. Vooral in Puurs in 1157 ~Arnold us Hircus et filius Boidius en Gozuinus Hircus" (Cat1ularium of Grimbergen, hs Hoevenaers #7); in 1162 "Arnoldus Boc and avunculus suus Arcturus de Puderce" (zelfde #9); in 1262 "Arnold us Rufus Hyrcus, Arnoldus Bac, Gosuin Boc (zelfde #10); en in Grimbergen in 1280 "Henrieus Bouc villicus de Grimbergis"; in 1286 "Henricus dictus Bach" (zelfde #230, 252).

74


Aanvulling op het artikel "Voor u gelezen: Mishandeling en poging tot moord te Tielt" Op bladzijde 56 van nummer 3 -juli 2006 van Onze Voorouders verscheen van de hand van Fons Das een krantenartikel uit de Nieuwe Gazette van Thielt van 1 mei 1851 over een verslag van de 'Korrektionele Regtbank van Brugge'. Hierin worden een viertal personen vermeld: Pieter en Coleta de Rock, Carolina Teerlynck vrouw Desmedt en weduwe Mestdagh. Het leek mij interessant om na te gaan waar deze personen in Tielt woonden. Aileen over Caroline Teerlynck en haar man vonden we enkele gegevens.1 Caroline Terlinck2 'herbergierster' geboren in Elst3, 42 jaar en haar man Philippe De Smet 'Ieerzenmaker' geboren in Aarsele en 40 jaar verlaten Aarsele en vestigen zich op 18 januari 1851 in Tielt, 8ste wijk4 huis 18. Het gezin telt vier kinderen: Acke Henricus, 11 jaar en Acke Leonardus, 9 jaar, beiden geboren in Machelen. Hieruit kunnen we veronderstellen dat Caroline Teerlynck waarschijnlijk weduwe is van een zekere Acke. De twee andere kinderen zijn: Marie en Camillus De Smet, respectievelijk 3 jaar en 4 maand, geboren in Aarsele, en kinderen uit haar tweede huwelijk met Philippe De Smet. Het hele gezin verhuist op 6 mei 1852 naar Orongen. Inmiddels is Camillus De Smet overleden. Samengevat kunnen we stellen dat Caroline Teerlynck achtereenvolgens in Elst, Machelen, Aarsele, Tielt en Deinze woonde. Luc Neyt 1 2 3

4

SAT, Bevolkingsregister Tielt, 1848~1856, boek 8 f. 16 In het bevolkingsregister wordt Teerlynck, Terlinck Elst, gelegen in Oost-V/aanderen, is een deelgemeente van Brakel De 8ste wijk van Tielt Jigt in de driehoek gevormd door de steenweg van Tielt-Wakken, Marialoop en de grens met de gemeente Meulebeke en Oostrozebeke.

de steenweg van Tielt-

V.V.F. - Tielt : nieuwe publicaties Etienne Cappelle: De naam "Cappelle" (en varianten) in STADEN van v66r 1752 tot 1980, Tielt, WF- Tielt, drie delen, deell (A-G) 217 biz. met index, deelll (H-O) 232 bIz., deellll (P-ZJ 219 biz., prijs per deel12 euro (+ 2,50 euro verzendingskosten per deel) Dertig jaar lang verzamelde de auteur Etienne Cappelle zeer geduldig aile informatie betreffende de "Cappelles" van Staden maar ook van talrijke omliggende parochies en gemeenten. Aan de hand van de geboorte-, huwelijks路 en overlijdensregisters werd van iedere "Cappelle" een gezinsfiche opgemaakt, voor zover de persoon een bepaalde administratieve akte bij de pastoor of bij de Burgerlijke Stand van Staden (Ox+) liet optekenen. Deze gegevens werden in de loop der jaren aangevuld met de informatie die geput werd uit een tachtigtal uitgaven van heemkundige en genealogische kringen van geheel V1aanderen maar in het bijzonder van de provincie WestVlaanderen. Het naslagwerk zal ongetwijfeld een zeer nuttig en belangrijk instrument zijn voor al wie met zijn voorouders "Cappelle" (en varianten) in de streek Roeselare terechtkomt. Zoals geweten zijn sowieso de bronnen uit de streek al zeer beperkt zowel in de tijd als in hoeveelheid. Oit werk zal voor het eerst worden aangeboden op de boekenbeurs in Rumbeke. Van dezelfde auteur zijn verschenen: De naam "Cappelle" in Oostnieuwkerke van v66r 1729 tot 1980, vier delen, 12 euro per deel en de naam "Cappelle" in Westrozebeke van v66r 1681 tot 1980, 15 euro (+ 2,50 euro verzendingskosten).

75


Voor u gelezen:

Oproeping van erfgenamen

Nalatenschap van Isabella-Clara Mestdagh

Uit de Nieuwe Gazette van Thielt, 25 juli 1850. Den 18 july 1850, is te Eeghem overleden Isabella-Clara Mestdagh, geboren te Eeghem den 20 november 1763, ongehuwde dogter van Franciscus en Joanna-Marie Steyaert. Genoemden Franciscus Mestdagh is geboren te Ruysselede, zoo men denkt, in het jaer 1726 en is overleden te Eeghem, omtrent hetjaer 1805. Genoemde Joanna-Marie Steyaert is geboren te RuysseJede,den 18 september 1731 en is oveneden te Eeghem den 1 mey 1791. Daer er geenen universelen erfgenaem is aengesteJd,zyn het dus de afstammelingen van den vader en moeder van genoemden Franciscus Mestdagh, dewelke volgens wet in deze nalatenschap geregtigd zyn, voor wat betrett de vaderlyke zyde. En voor wat betreft de moederlyke zyde het zyn de afstammelingen van de vader en de moeder van genoemde Joanna-Marie Steyaert, dewelke volgens de wet in deze nalatenschap geregtigd zyn. Nogtans voor wat deze moederlyke zyde aengaet, men doet alhier bemerken dat de gene die in den vyfden graed bloedverwantschap zyn met de overledene, mogen komen in plaets van hunnen vader ofte moeder die in den vierden graed gestorven is, en dit als by representatie na luyd van haer testament. Dus degene die vermeenen erfgenaem te zyn van de genoemde Isabella-Clara Mestdagh, worden verzocht hunne schriftelyke bewysstukken in te leveren by Charles Wille, timmerman te Eeghem, executeur van het testament van de gezeyde Joufvrouw Mestdagh, binnen de dry maenden te rekenen van 18 july lestleden. Meergemelden executeur testamentaire daertoe bemagtig zynde, heeft de eer hare vrienden uyt te noodigen tot een eerlyke maeltyd, die zal gehouden worden te Eeghem, den dyssendag 3(fn july 1850, onmiddelyk na het uytvaerd, dus omtrent den middag ELK ZEGGE HET VOORT

Fons Das

Vraag .. Antwoord Stuur aile vragen en antwoorden naar: Redactie, "Onze Voorouders", p.a. Fons Oas, Luxemburglaan 18,8700 Tiell Voorwaarden zijn: de vraagsteller dient lid te zijn van WF-Tielt, dus steeds uw lidnr. vermelden bij de vraag. - de vraag dient rechtstreeks verband te hebben met de gemeenten van ons werkgebied. Dus vragen betreffende het kadaster van Uitkerke bijvoorbeeld zullen niet worden opgenomen. Indien u rechtstreeks antwoordt aan de vraagsteller, gelieve de redactie een dubbel te bezorgen.

Vragen

76


3 - 06

(Jacques Wiseur, Diksmuidsesteenweg 299,8800 Roeselare)

Wie weet meer over de afkomst van: Jacobus Wiseure, geboorteplaats en -datum niet gekend, overleden te Ruddervoorde op 16 juni 1742. Jacobus is gehuwd te Brugge op Sint Salvator op 27 november 1722 (waarom te Brugge ?) met Rosa Steculorum. Zij was de dochter van Simon en Judoca Poorten en geboren te Damme in juli 1695 en overleden te Ruddervoorde op 26 februari 1765. 4 - 06

(Jacques Wiseur, Diksmuidsesteenweg

299, 8800 Roeselare)

Wie weet meer over de afkomst van: Glaude Wyseur, zoon van Jacques ex Lauwe, ca 1680, + ca. 1750. Hij trouwde een eerste keer met Joanna Van Daele, ca. 1668 en + te Ruiselede op 6 mei 1705. Hij hertrouwde met Maria Franco vermoedelijk geboren te Oostkamp en overleden ca. 1750. Op 16 april 1712 trouwde hij te Meulebeke met Joanna Petronelle Bruyneel, geboren ca. 1682 en overleden te Ruiselede op 8 april 1762. 0

0

5 - 06

(Jacques Wiseur, Diksmuidsesteenweg 299, 8800 RoeseIare)

Is er een genealogisch verband tussen Jacobus Wiseure en Glaude Wyseur ? 6 - 06

(Andre Saenen, Engerstraat 65, 3071 Erps-Kwerps)

Pieter De Ceuninck werd geboren te Wingene op 30 september 1744. Op 13 augustus 1777 trouwde hij te Wingene met Maria Theresia Corteborst. Zij werd geboren te Wingene op 5 september 1756 en overleed aldaar op 11 november 1787. Pieter overleed na 1787. Waar en wanneer Ouistedatum) overleed hij ? 7 - 06 (Andre Saenen, Engerstraat 65, 3071 Erps-Kwerps)

Johannes Augustinus De Ceuninck werd geboren te Wingene op 28 december 1705. Op 29 april 1731 trouwde hij te Wingene met Isabella Van Bruaene. Zij werd geboren te Wingene op 16 maart 1702 en overleed aldaar op 24 augustus 1778. Pieter overleed na1778. Waar en wanneer Ouiste datum) overleed hij? 8 - 06

(Josette Mestdag, 340 rue sadi camot, 59790 Ronchin, France)

Je suis Frant;aise et je recherche mes ancstres nes dans votre region: Pieter Marcus Mestdagh, ne a Tielt vers 1737 et marie Ie 10 novembre 1764 avec Helena Josephina Latruwe. Quelqu'un peut il m'aider pour: la date de naissance, la date et lieu de deces de Marcus la date et lieu de naissance de son epouse ainsi que sa date de deces et j'aimerais connaitre leur parents

Inzenden van vragen, antwoorden, teksten en activiteitenkalender V~~r de eerstvolgende nummers worden de belanghebbenden dringend gevraagd rekening te houden met de hierna volgend uiterste data voor het inzenden van hun vragen, antwoorden, teksten, mededelingen en activiteitenkalender. (Steeds een maand v66r de maand van verschijnen!): Nummer 1 1 januari - februari - maart 2007: voor 30 november 2006 Nummer 21 april - mei - juni 2007: v66r 28 februari 2007 Nummer 31 juli - augustus - september 2007: v66r 31 mei 2007 Nummer 41 oktober - november - december 2007: v66r 31 augustus 2007 De redactie kan om bepaalde redenen, zoals bijvoorbeeld plaatsgebrek, naar een later nummer verplaatsen, ook al werden ze tijdig ingestuurd.

artikels, vragen en antwoorden,

....

77


activiteitenagenda

WF - Tielt: - oktober - november - december 2006

Ons lokaal is open op elke eerste en derde zaterdag van de maand. Aile activiteiten, tenzij anders venneld, gaan door in ons lokaal. 1. Werkgroep genealogie op zaterdag 7 oktober van 9 tot 12 uur, gelegenheid tot opzoeken. 2. Werkgroep genealogie op zaterdag 21 oktober van 9 tot 12 UUf, gelegenheid tot opzoeken. 3. Werkgroep genealogie op zaterdag 4 november van 9 tot 12 uur, gelegenheid tot opzoeken. 4. Start zoektocht in Ardooie: meer info op pag. 67. 5. Werkgroep genealogie op zaterdag 18 november van 9 tot 12 uur, gelegenheid tot opzoeken. 6. Werkgroep genealogie op zaterdag 2 december van 9 tot 12 uur, gelegenheid tot opzoeken. 7 Werkgroep genealogie op zaterdag 16 december van 9 tot 12 UUf, gelegenheid tot opzoeken. 8. Werkgroep genealogie op zaterdag 6 januari 2007 van 9 tot 12 uur, gelegenheid tot opzoeken.

Zaterdag 6 januari 2007 van 14 tot 17 uur in ons lokaal: Nieuwjaarsreceptie aangeboden door het bestuur aan de leden van onze afdeling aile leden zijn van harte welkom ! gelegenheid tot opzoeken

Vlaamse Vereniging voor Familiekunde Afdeling Tielt

ACHTSTE FAMILIEKUNDIGE BOEKENBEURS TIEL T zondag 4 maart 2007 van 9 tot 12 our 30 Jeugd Ontmoetingscentrum, Generaal Maczekplein, Tielt (dit is de nieuwe Europahal kant zwembad/sportvelden) Er is een ruime keuze aan talrijke standen: * genealogische computersoftware * genealogische werken * formulieren * heruitgaven van naslagwerken Tevens is er gelegenheid tot contactname met andere vorsers uit de ons omringende WF-afdelingen en kunnen er gegevens uitgewisseld worden. Om 11 uur bekendmaking van de winnaars van de Wandelzoektocht van de prijzen.

78

in Ardooie en uitreiking


ONZE VOOROUDERS Jaargang 2006