Issuu on Google+


PANORAMA MÉDICO

Diagramación y Diseño Gráfico

Revista Científica Universidad Católica de Cuenca Volumen VI, 2012

Imprime

Departamento Técnico ALEXXIA PHARMA S.A.

Jennifer Villagómez, Dirección General.

Editores Sr. Galo Vega Cobo, Presidente EjecutivoALEXXIA PHARMA S.A. UNIDAD ACADÉMICA DE MEDICINA, ENFERMERÍA Y CIENCIAS DE LA SALUD DE LA UNIVERSIDAD CATÓLICA DE CUENCA

Consejo Directivo Dr. Calos Darquea López DECANO Dr. Francisco Calderón Cordero SUBDECANO Dr. Cristian Cordero Jaramillo I VOCAL Dra. Ma. Isabel Herrera Jaramillo II VOCAL Dr. José Manuel Maestre Guzmán III VOCAL Lic. Jenny Chica Gutiérrez IV VOCAL Ing. Bolívar Pulla Guerrero COORDINADOR Dr. Mario Rubio Auquilla BIENESTAR ESTUDIANTIL Sr. Andrés Bermeo Pacheco REPRESENTANTE ESTUDIANTIL

Departamento de Investigación Dra. María Isabel Herrera Jaramillo

Comisión Editora Dr. Francisco Calderón Cordero Dra. María Isabel Herrera Jaramillo Ing. Bolívar Pylla Guerrero Dr. Franz Guerrero Ramírez

Propiedad Intelectual Para reimpresión o reproducción parcial se requiere autorización del Consejo Directivo y de la Comisión Editoria, o directamente de los autores. La Revista Panorama Médico, difunde lo expresado por los autores y entrevistados para conocimiento de sus lectores.


INDICE DE AUTORES Y COAUTORES

Dr. Héctor Alajo Dra. Eduviges Álvarez Lindao Dr. Claudio Arias Argudo Dr. Carlos Ávila Gamboa

32 45 81 45

Dra. Alexandra Calle Dr. Carlos Darquea Arias Dr. Carlos Darquea López Dr. Elvis Erreyes Macas

32 39 5, 39 72

Dr. Pedro Espinoza Dr. Julio Guamán Dr. Franz Guerrero Dra. María Isabel Herrera

55 55 13, 15, 59 15, 59

Dr. Jorge Martínez Dra. Jéssica Martínez Cantos Dr. Leonardo Morales Vanegas Dr. Cristian Fabricio Pérez

32 51 25, 67 41

Dra. Carmen Rosa Rivas Dra. Jossette Tello Dra. Yolanda Vanegas Cobeña

41 32 25, 67

Int. Jacinto Pérez Ramírez Sr. Francisco Calderón Cordero

45 7

PANORAMA MÉDICO 2012

1


CONTENIDO

EDITORIAL Dr. Carlos Darquea López

VIRUS AH1N1: CARACTERÍSTICAS Y DIAGNÓSTICO MOLECULAR Dra. Yolanda Vanegas Cobeña

PRESENTACIÓN

Dr. Leonardo Morales Vanegas

Francisco Calderón Cordero

HOMENAJE DE BODAS DE ORO

COMPLICACIONES ASOCIADAS AL CATÉTER VENOSO CENTRAL: PERIODO ENERO 2010 - MARZO 2011

Dr. Héctor Alajo RECONOCIMIENTO

Dr. Jorge Martínez Dra. Alexandra Calle Dra. Jossette Tello

POSTGRADO DE OTORRINOLARINGOLOGÍA

ESQUIZENCEFALIA: CASO CLÍNICO Dr. Carlos Darquea López

LA TECNOLOGÍA Y EL DESARROLLO DE HABILIDADES MÉDICAS DENTRO DE LA FORMACIÓN ACADÉMICA Dr. Franz Guerrero R.

Dr. Carlos Darquea Arias

FETO PAPIRÁCEO: CASO CLÍNICO Dr. Cristian Fabricio Pérez Dra. Carmen Rosa Rivas

DIAGNÓSTICO NUTRICIONAL Y ELABORACIÓN DE CURVAS DE CRECIMIENTO

ACRETISMO PLACENTARIO: CASO CLÍNICO

Dra. María Isabel Herrera

Dr. Carlos Ávila Gamboa

Dr. Franz Guerrero R.

Dra. Eduviges Álvarez Lindao Int. Jacinto Pérez Ramírez

2

PANORAMA MÉDICO 2012


CONTENIDO

DIABETES MELLITUS

“PROMETO SOLEMNEMENTE CONSAGRAR…..”

Dra. Jéssica Martínez Cantos Dr. Claudio Arias Argudo FRACTURA DE TERCIO DISTAL DE TIBIA

NORMAS DE PUBLICACIÓN

Dr. Julio Guamán T. Dr. Pedro Espinoza G.

DIAGNÓSTICO DE ASMA EN PACIENTES PEDIÁTRICOS MEDIANTE LA MEDICIÓN DE ÓXIDO NÍTRICO INHALADO Y ESPIROMETRÍA Dra. María Isabel Herrera Dr. Franz Guerrero R.

ANTÍGENOS LEUCOCITARIOS DE HISTOCOMPATIBILIDAD EN TRASPLANTES DE MÉDULA ÓSEA POR EL MÉTODO PCR-SSP Dra. Yolanda Vanegas Cobeña Dr. Leonardo Morales Vanegas

SHOCK HIPOVOLÉMICO Dr. Elvis Erreyes Macas

PANORAMA MÉDICO 2012

3


4

PANORAMA MÉDICO 2012


EDITORIAL

Al recorrer los múltiples caminos abiertos en décadas pasadas y continuar la trayectoria trazada por la Universidad Católica de Cuenca,

ha fundado Escuelas, Colegios y varias Facultades Universitarias con el afán de ser pioneros y garantes del servicio a la comunidad, sin apartarse de las normas de la moral, ciencia y tecnología.

La Entidad Educativa avanza al ritmo del siglo XXI, al tiempo que las justas exigencias de los educandos constituyen un verdadero reto para los propósitos catedráticos, que incita a reforzar los espacios que las exigencias de la modernidad lo realizan con el propósito de que los egresados y graduados estén a la altura en formación y conocimientos de otras universidades del país y extranjero. Lógicamente, para lograr este cometido se ha modificado mallas curriculares, planes y programas de estudio en las distintas carreras que se dictan en nuestra Alma Mater. Para hacer realidad este objetivo, se ha dotado a las áreas básicas de la Unidad Académica de Medicina, Enfermería y Ciencias de la Salud de la Universidad Católica de Cuenca de elementos didácticos modernos, como laboratorios, áreas de prácticas y estudio basados en la tecnificación y modernización del laboratorio de anatomía, química, parasitología, patología; y el moderno equipamiento del laboratorio de simulación, en el que se brinda el aprendizaje práctico bajo la dirección de maestros con amplios conocimientos y experiencia para lograr la excelencia científica. De la misma manera, para los cursos superiores se han implementado locales de práctica para brindar una enseñanza técnica y versada con la discusión de historias clínicas, presentación de casos y su análisis en juntas médicas a la cabecera del paciente. Recientemente y para beneficio de los egresados se dió inicio al postgrado médico en Otorrinolaringología que se lleva a efecto en prestigiosos hospitales de la ciudad y país, para lo que se firmaron Convenios con el Instituto Ecuatoriano de Seguridad Social, Ministerio de Defensa, Ministerio de Salud, y otros acuerdos gracias a los cuales nuestros internos y egresados realizan su práctica en los Hospitales de las Instituciones antes mencionadas.

EDITORIAL

5


Con estas técnicas de formación y estudio, los egresados y futuros profesionales ejercerán su profesión de acuerdo a las actuales exigencias de la sociedad dentro de un marco científico en constante evolución. El logro y avance científico mundial en diferentes aéreas es evidente, esto nos obliga a permanente actualización en conocimientos, y enseguida compartirlos a los alumnos y formarlos versados en atención primaria, que es el tipo de profesional que hoy necesita la sociedad, para contribuir de esta manera a que el médico moderno se sujete a las exigencias científicas del siglo XXI y se motive para seguir los programas de educación médica contínua que le permitan aprobar sin dificultad el proceso periódico de certificación de conocimientos. Con este preámbulo, queridos lectores, me permito presentarles el sexto número de la Revista Panorama Médico, Órgano Oficial de la Unidad Académica de Medicina, Enfermería y Ciencias de la Salud de la Universidad Católica de Cuenca en la que se insertan artículos de calidad científica escritos por profesores y egresados de esta Unidad Académica, en los que se exponen conocimientos y experiencias obtenidas en años de ejercicio profesional. Todos los exitosos logros han sido posibles por el constante apoyo y estímulo del Rector Fundador, filántropo y demiurgo, Doctor César Cordero Moscoso, nombre que constituye un hito fundamental en la vida religiosa, científica, cultural y educativa de la Ciudad - Patrimonio Cultural de la Humanidad, que por su gran labor marca el ritmo sobresaliente de la historia comarcana, pues ha sido de su interés sembrar a través de la educación indiscutibles principios y valores espirituales, morales y éticos como único camino que nos guíe la formación integral de la persona, volcando su esfuerzo en el servicio a la colectividad, producto del humanismo que piensa, medita y crea la inquietud espiritual que crece y se engrandece con el tiempo.

DR. CARLOS DARQUEA LÓPEZ Rector Asociado de la Universidad Católica de Cuenca Decano de la Unidad Académica de Medicina, Enfermería y Ciencias de la Salud

6

PANORAMA MÉDICO 2012


PRESENTACIÓN

La Universidad Católica de Cuenca, en el ineludible proceso de cambio, afronta con gran responsabilidad el reto de investigar y potencializar el

proceso de enseñanza-aprendizaje, para que el estudiante actual y profesional del mañana sea un triunfador.

Con esa visión, la Unidad Académica de Medicina, Enfermería y Ciencias de la Salud, en su permanente compromiso de actualizar el saber presenta la Revista “PANORAMA MÉDICO” Volumen VI, órgano de difusión de la investigación y conocimiento. Investigar... es buscar, indagar, introducirse e iniciar el viaje en el complejo campo de lo que se consideran “VERDADES” médicas, incluso a riesgo de que en poco tiempo, por el vertiginoso e impredecible avance de la medicina, los “conceptos actuales” pasen al ámbito de lo desactualizado. La investigación científica no es un proceso al azar, tampoco depende de decisiones personales sino de la necesidad de una comunidad para resolver un problema que lo afecta, es una acción plenamente coordinada y reflexiva en la que predomina la intuición, conocimiento y experiencia del investigador. “El que quiera saber un poco más tiene que investigar”. La investigación comprende algunos pasos: obtención de resultados, análisis, recopilación de informes finales, etc., que culminan con su publicación en una revista científica para que su difusión incremente e incentive el conocimiento y siembre inquietudes en cada lector. Un artículo cumplirá su objetivo cuando su contenido se divulgue con lenguaje fácil de entender. “El éxito es poder y saber comunicar el conocimiento”. Investigar... es sistematizar, establecer un orden y deducir prioridades, tener la visión clara de la dificultad a solucionar a través de un método científico para que el resultado sea válido y no represente pérdida de tiempo y recursos. Es un acto de complejidad que implica leer y comprender lo leído, proponer una idea a discutir y expresar con claridad y acierto la propuesta. La única manera de investigar es investigando, reto que nos proponemos. “Las locuras que se piensan, se descubren; lo que nunca se especula, jamás se revela”. “La investigación es la moderna herramienta que destruye paradigmas”.

PRESENTACIÓN

7


Investigar... es preguntar, una pasión íntima que impulsa a averiguar el enigma planteado, una extraña curiosidad para saber y conocer algo, descubrir las respuestas ocultas en nuestras dudas, fusionar la teoría con la práctica. Investigar es leer, leer, leer mucho, y obtener conclusiones valederas, comparar experiencias, contrastar resultados.

FRANCISCO CALDERÓN CORDERO Subdecano de la Unidad Académica de Medicina, Enfermería y Ciencias de la Salud

8

PANORAMA MÉDICO 2012


HOMENAJE BODAS DE ORO MATRIMONIALES

Hacemos llegar nuestra cálida felicitación al señor Doctor Carlos Darquea López, Rector Asociado de la Universidad Católica de Cuenca y Decano de la Unidad Académica de Medicina, Enfermería y Ciencias de la Salud, y a su distinguida esposa señora Doña María Esther Arias Argudo al celebrar sus BODAS DE ORO MATRIMONIALES.

PANORAMA MÉDICO 2012

9


RECONOCIMIENTO

La Universidad Católica de Cuenca, por resolución del Honorable Consejo Universitario, a través de la Unidad Académica de Medicina, Enfermería y Ciencias de la Salud, otorga el reconocimiento de “PROFESOR HONORARIO” al señor Galo Vega Cobo, Presidente Ejecutivo de Laboratorios ALEXXIA, por su invalorable colaboración y apoyo en los diversos actos académicos y científicos.

10

PANORAMA MÉDICO 2012


POSTGRADO EN OTORRINOLARINGOLOGÍA

El mundo globalizado exige del profesional mayor y mejor formación en el campo en que se ha educado, que sea más competitivo...

y que su saber se complemente con el afecto indispensable en la consulta para lograr un nivel de excelencia en la atención al paciente.

La actual “revolución” en el conocimiento médico desborda la capacidad intelectual de cualquier profesional, al tiempo que se multiplican investigaciones y descubrimientos que obligan al recién graduado a realizar posgrados de especialidad o subespecialidad en las diversas áreas. Por estas razones la Unidad Académica de Medicina, Enfermería y Ciencias de la Salud de la Universidad Católica de Cuenca advirtió la importancia de fomentar la ilustración a través del Posgrado de Otorrinolaringología, con la participación docente de los Hospitales José Carrasco Arteaga de Cuenca, de la Armada de Guayaquil y Carlos Andrade Marín y Fuerzas Armadas de la Ciudad de Quito, con lo que se ofrece mejor servicio y solución educativa a los recién graduados de las diversas facultades de medicina del país. Este proceso se inició con la Resolución del CONESUP RCP. SO7. No.177.10 del 13 de mayo de 2010, en el mes de junio se publicó a nivel nacional la Convocatoria a Concurso y en los meses de agosto y septiembre se llevaron a efecto los procesos de calificación de méritos, oposición y apelación. Se inscribieron 87 profesionales, declararon idóneos a 47 y rindieron el examen 40 aspirantes. Es de señalada importancia resaltar que todo el desarrollo del Concurso se realizó con absoluta HONORABILIDAD y TRANSPARENCIA, con lo que se garantizó la igualdad de derechos de cada uno de los participantes y ratificó, una vez más, el recto proceder de la Universidad Católica de Cuenca y de nuestra Unidad Académica, en particular.

PANORAMA MÉDICO 2012

11


12

PANORAMA MÉDICO 2012


LA TECNOLOGÍA Y EL DESARROLLO DE HABILIDADES MÉDICAS DENTRO DE LA FORMACIÓN ACADÉMICA Autor: DR. FRANZ GUERRERO R. Catedrático de la Unidad Académica de Medicina, Enfermería y Ciencias de la Salud Coordinador del Centro de Simulación Médica y Director del Laboratorio de Anatomía.

Comienza el año académico y nuevos desafíos para la educación universitaria se presentan, donde la calidad de la formación se fortalece en los diferentes ejes fundamentales del sistema educativo nacional y el compromiso académico profesional de cada centro educativo. Como respuesta al entorno cambiante de las condiciones sociales, económicas, políticas, culturales y tecnológicas del mundo moderno, la educación médica ha tenido que adaptarse rápidamente para satisfacer las necesidades de la sociedad. Es así como la enseñanza magistral clásica del aula de clase y el abordaje directo del paciente en la práctica clínica, se ven hoy complementados con nuevas formas de enseñanza, como las herramientas basadas en el uso de la informática, utilización de simuladores para la adquisición de habilidades prácticas, implementación de metodologías centradas en el estudiante que propicien su capacidad de autoformación. El uso de simuladores en la educación médica, no pretende reemplazar el contacto del estudiante con el paciente sino prepararlo adecuadamente para el encuentro con la realidad, dándole mayor seguridad y habilidad en la realización de procedimientos clínicos en sus pacientes.

Un simulador es otra cosa que un medio para recrear y reproducir un fenómeno que se pretende explicar al estudiante. De esta manera tiene la oportunidad de interactuar creativamente con un modelo simulado, exponerse a una situación clínica real y construir desde esta interactividad el conocimiento y desarrollo de habilidades y destrezas que buscan alcanzar una respuesta competente ante pacientes o escenarios en situaciones reales.

Este entrenamiento puede desarrollarse con la práctica de diferentes protocolos clínicos y técnicas disponibles que se las puede actualizar constantemente, creando diferentes escenarios de estudio con el catadrático guía, grupos de trabajo o estudios individuales. Los modelos de simulación presuponen el concepto del aprendizaje por descubrimiento y crean la oportunidad de solucionar problemas en un ambiente de motivación e interés por parte del estudiante,

LA TECNOLOGÍA Y EL DESARROLLO DE LAS HABILIDADES MÉDICAS

13


facilitando el desarrollo de estructuras cognitivas superiores (Teoría constructivista del aprendizaje).

Entre los beneficios de la Simulación Médica se encuentran: • Adiestramiento en situaciones complicadas o infrecuentes. • Desarrollar entornos en los cuales los errores se permiten y se aprende de ellos. • Se promueve el trabajo en equipo y el perfeccionamiento del liderazgo. En medio siglo de historia de los simuladores médicos se ha logrado una revolución para la educación clínica. Estos complejos instrumentos permiten entrenar y practicar en el error-acierto sin riesgos para los pacientes reales, también evalúan el conocimiento clínico y la toma de decisiones, en estudiantes, y en médicos en ejercicio. La necesidad legal y social de garantizar la seguridad de los pacientes, el auge de la cultura de la reclamación, y los movimientos contra la experimentación médica con animales pueden abrir el camino para la implantación de programas de simulación médica como una de las vías para reducir los casos de errores médicos, y es una inversión que retorna con beneficios en seguridad, eficiencia y eficacia en las organizaciones sanitarias.

Los primeros simuladores, estaban diseñados para experimentar habilidades técnicas básicas, sin embargo los avances informáticos permiten desarrollar modelos con la anatomía y fisiología humana que alcanzan a simular casos clínicos complejos y de alto riesgo, en condiciones similares a la vida real. Los nuevos maniquíes se mueven, respiran, viven y fallecen como un ser humano. Para ello desde hace algunos meses atrás con la intención de desarrollar múltiples habilidades en los “educandus” de la Unidad Académica de Medicina, Enfermería y Ciencias de la Salud, de la Universidad Católica de Cuenca, gracias al apoyo brindado por el Dr. César Cordero Moscoso, Rector Fundador de la Comunidad Educativa Católica, y la dirección de las autoridades universitarias, se adquirió una serie de herramientas tecnológicas en el campo de la simulación médica con lo que se implementó el “Centro de Simulación Médica de la Universidad”, donde en primera instancia se pueden desarrollar diferentes procedimientos básicos con miras a ampliar formas más complejas acordes a los avances tecnológicos y algoritmos actuales en el tratamiento que se promueven en la formación médica. Este compromiso con las futuras generaciones permiten a la Universidad Católica de Cuenca planificar una serie de proyectos encaminados a fortalecer las actitudes prácticas de los nuevos profesionales, desarrollar una serie de estaciones de trabajo que abarcan distintos procedimientos cardio – respiratorios, habilidades Clínicas y EKG, procesos de atención de enfermería, habilidades gineco – obstétricas, procedimientos vasculares, urogenitales y gastrointestinales. Todos estos proyectos se ponen al servicio de las generaciones presentes y futuras al permitir unir esfuerzos con las instituciones del estado donde se busca el buen vivir, logros que poco a poco se alcanzan por el constante apoyo del Rector Fundador, Dr. César Cordero Moscoso, cuya visión en beneficio de la comunidad educativa permite contribuir con distintos profesionales en el área de la salud.

14

PANORAMA MÉDICO 2012


DIAGNÓSTICO NUTRICIONAL Y ELABORACIÓN DE CURVAS DE CRECIMIENTO en estudiantes de las instituciones anexas a la Universidad Católica de Cuenca AUTORES: DRA. MARÍA ISABEL HERRERA JARAMILLO, DR. FRANZ GUERRERO R. Catedráticos de la Unidad Académica de Medicina, Enfermería y Ciencias de la Salud. Departamento de Investigación

RESUMEN Dada la alta prevalencia de desnutrición, así como sobrepeso y obesidad en escolares y adolescentes en el país que no han sido debidamente diagnosticados, es necesario implementar la evaluación periódica de este grupo etáreo, el que tradicionalmente no se controla en forma regular en consultorio, ya que el riesgo de permanecer con este problema en la vida adulta y presentar patologías cardiovasculares aumenta en forma directa con la edad cuando el problema se presenta. Para realizar la evaluación nutricional periódica de esta población, las escuelas y colegios parecen ser el lugar más adecuado. El parámetro recomendado internacionalmente para ello es el índice de masa corporal (IMC) según edad y sexo, comparado con la referencia CDC-NCHS. PALABRAS CLAVES Nutrición, desnutrición, sobrepeso, índice de masa corporal.

SUMMARY Given the high prevalence of malnutrition, as well as overweight and obesity in schoolchildren and adolescents in our country that have not been properly diagnosed, it seems necessary to implement the periodic evaluation of this age group, which traditionallyis monitored regularly in office, as the risk of staying with this problem in adulthood and cardiovascular diseases present increases directly with the age at which the problem arises. To perform periodic nutritional assessment of this population, schools and colleges seem to be the most appropriate place. The internationally recommended parameter that is thebody mass index by age and sex, compared with CDC-NCHS reference. KEYWORDS Nutrition, malnutrition, overweight, body mass index

DIAGNÓSTICO NUTRICIONAL Y ELABORACIÓN DE CUR VAS DE CRECIMIENTO

15


OBJETIVO Actualizar y estandarizar los criterios para la evaluación nutricional del niño entre 5 y 18 años, creando nuestras propias medidas antropométricas, acorde a la realidad, que permita mantener vigilancia epidemiológica de esta población y proponer acciones que contribuyan a la promoción de la salud y prevenir enfermedades crónicas no transmisibles del adulto.

INTRODUCCIÓN La Vigilancia Nutricional es un proceso permanente de recolección, análisis e interpretación de información. Debe estar insertada en el marco de políticas de Prevención y Promoción de la Salud. En el mundo el 50% de mortalidad pediátrica se relacionada directa o indirectamente con la malnutrición. La mortalidad infantil e incluso consecuencias negativas en la salud en la etapa aguda son debido a malnutrición temprana, y se pueden reducir en un 30% mediante la implementación de intervenciones nutricionales simples. En la década de 1960 se estimaba que, en el mundo, 300 millones de niños estaban afectos de malnutrición; en los 1980 esta cifra se redujo a la mitad, en el año 2000 las cifras dadas por la OMS son 150 millones, ello implica una reducción por el incremento poblacional de los países en desarrollo. (1) El Ecuador exhibe una compleja perspectiva en el campo de la salud, la mortalidad infantil es elevada. Se estima que mueren alrededor de 33 niños por cada 1000 que nacieron vivos, estos inconvenientes ocurren en un marco de pobreza que impide a la población satisfacer sus necesidades básicas y lleva principalmente a los niños a condiciones de mala nutrición en general y deficiencia de micronutrientes críticos que los vuelven

16

PANORAMA MÉDICO 2012

vulnerables frente a enfermedades de naturaleza infecciosa y transmisible principalmente. Ecuador es un país del cono sur de las Américas, con una extensión territorial de 256.370 Km2 y población de 14´306.876 Está dividido en cuatro habitantes. (2) regiones: costa e insular, sierra y región amazónica, cada una con diversidad de microclimas y grupos étnicos culturalmente bien diferenciados. (3) Un tercio de la población (31%) está representada por los menores de 15 años, a la que adicionalmente se integran los (as) adolescentes (10 - 19 años), que constituyen la quinta parte. Como se puede ver, el país está compuesto por una gran proporción de población joven, que si bien se convierte en una oportunidad demográfica como aporte a la fuerza laboral y potencial intelectual, también ejerce una fuerte presión, en cuanto a demanda, por los servicios educativos y salud. (4) El problema nutricional asociado a carencias en la población menor de 5 años, continúa a pesar de que ha disminuido lentamente, es un serio problema que se agudiza en ciertas regiones del país. Según la encuesta de Condiciones de Vida del INEC, (2005-2006) (4), la prevalencia del déficit de talla para la edad (desnutrición crónica) fue 18%, mientras este valor en la sierra se eleva hasta 24%, en la región costa este valor baja a la mitad: 12%. En relación al déficit de peso para la edad (desnutrición Global) en la misma población y de la misma fuente, las variaciones por región no son sustanciales, no obstante son significativas como problema de salud pública en todo el país, donde alcanza el 8.6%, lo que en términos reales afectó en el 2006, aproximadamente a 124 mil infantes.


Según AMIE las Instituciones Educativas Escolarizadas con alumnos para el año 20092010 fue 307 unidades educativas, con 98.639 alumnos inscritos, entre las edades de 5 a 18 años, de los cuales 51.467 eran mujeres y 47.172 hombres. En nuestro país se han realizado a través del tiempo, muchos esfuerzos por mejorar la nutrición especialmente de niños y madres de bajos recursos económicos, y existen varios programas.

Asombrosamente el Ecuador cuenta con datos de morbi-mortalidad tan solo en niños menores de un año, no se dispone de datos en niños menores de 5 años, ni adolescentes. Pese a los estudios y programas casi nada se conoce de la salud nutricional de los niños mayores de 5 años, y se carece de curvas de crecimiento propias para nuestro país, y ya que se ha adoptado las de otros países con características diferentes al nuestro.

En la década de 1960 se estimaba que, en el mundo, 300 millones de niños estaban afectos de mal nutrición; en los 1980 esta cifra se redujo a la mitad, en el año 2000 las cifras dadas por la OMS son 150 millones, ello implica una reducción por el incremento poblacional de los países en desarrollo.

Desayuno Escolar que consiste en otorgar una colación nutritiva diaria a los niños estudiantes de las escuelas a través del Ministerio de Educación.

Un sistema de vigilancia nutricional para el escolar y el adolescente no funciona en ninguna ciudad del Ecuador. Solamente en algunas escuelas se controla el peso y altura, actividad que se realiza en forma puntual y que no se considera para hacer intervención, ni como base fundamental para planear acciones en alimentación y nutrición.

Muchos investigadores coinciden en tomar la relación altura - edad como indicador del desarrollo de un país.

Programa Nacional de Alimentación y Nutrición Infantil “Pann 2000” mediante el cual se contribuye a prevenir los daños de la malnutrición y deficiencia de micronutrientes en los menores de 2 años.

El indicador altura - edad está bastante relacionado con el índice de desenvolvimiento de un país. A través del acompañamiento de la altura de los escolares, es posible evaluar el impacto producido por los planes de desarrollo adoptados.

Sin embargo, a pesar de todos los esfuerzos realizados las infecciones respiratorias agudas, enfermedades diarreicas y desnutrición continúan ubicados entre las cinco primeras causas de defunción en la mayoría de países en desarrollo.

El control de peso y talla es un gran aporte para la salud escolar. Sin embargo, es necesario considerar otras variables, ya que la información obtenida con respecto a la malnutrición ha demostrado cambios relevantes a través del tiempo.

El 45% de niños menores de 5 años son desnutridos, de ellos 30% sufren de desnutrición crónica (Talla - edad), y 15% sufren de desnutrición global (peso - edad).

Existe una importante disminución de la desnutrición y, por otro lado, el sobrepeso y obesidad se manifiestan entre los grupos más pobres.

DIAGNÓSTICO NUTRICIONAL Y ELABORACIÓN DE CURVAS DE CRECIMIENTO

17


En países como Estados Unidos y México en el 2010, uno de cada dos niños en etapa escolar tienen sobrepeso, lo cual se ha convertido en una pandemia, pues es la enfermedad pediátrica más común. Otras cifras nos indican que el 10%de los jóvenes entre 5 y 17 años de edad tienen sobrepeso (155 millones de niños). Más de 1.7 billones de personas en el mundo tienen sobrepeso, de esta cifra 310 millones son obesos. (4) En el Ecuador se desconoce si hay estudios de malnutrición por exceso. Este trabajo se orienta a realizar un diagnóstico nutricional, al valorar tanto los aspectos clínicos como de laboratorio, considerando que en la actualidad además de la desnutrición se tiene un problema igualmente grave llamado sobrepeso, en los estudiantes que acuden a los principales centros educativos, primarios y secundarios de la ciudad de Cuenca.

Se pretende desarrollar un sistema de información con los componentes de salud, antropometría y nutrición, apoyándose en información sobre salud, ambiente familiar y escolar. Con este sistema se quiere ofrecer elementos suficientes para generar acciones y programas de educación, promoción de la salud que conlleva el mejorar la calidad de vida de los escolares y sus familias.

PANORAMA MÉDICO 2012

Es el componente primordial en la vigilancia de salud y nutrición de los escolares y adolescentes. Proporciona indicadores que miden una determinada situación y a su vez son un reflejo de las condiciones socioeconómicas de una comunidad. El componente de antropometría permite conocer la magnitud de los problemas de nutrición, caracterizando la población en riesgo y ofreciendo elementos para la planeación de intervenciones nutricionales y acciones en promoción de la salud.

El componente de antropometría permite a conocer la magnitud de los problemas de nutrición, caracterizando la población en riesgo... y ofreciendo elementos para planear intervenciones nutricionales y acciones en la salud.

Al elaborar un patrón de crecimiento en escolares y adolescentes y con los resultados obtenidos se elaboran tablas de crecimiento (percentiles de talla, peso, índice de masa corporal y medición de pliegues cutáneos según la edad), que estén más acorde a la realidad nutricional en nuestro país.

18

Antropometría

El módulo de antropometría comprende: recolección, proceso y análisis de un conjunto de medidas corporales como peso, estatura, índice de masa corporal, circunferencia del brazo y evaluación bioquímica. Se considera que las medidas corporales son afectadas en dirección y magnitud, por las variaciones de factores determinantes del bienestar nutricional como ingestión de alimentos y condiciones de salud. Se asume que las medidas antropométricas siguen una distribución estadística normal entre la población, y determinan un nivel de riesgo para cada individuo. Los indicadores antropométricos son instrumentos de utilidad para el diagnóstico de la desnutrición, sobrepeso y obesidad.


Estos dos últimos son considerados factores de riesgo para las enfermedades crónicas no transmisibles, por lo que se hace necesaria su vigilancia. Con las medidas corporales recolectadas se pretende crear gráficos que se utilizarán en la evaluación antropométrica. Con la elaboración de nuestras propias curvas de crecimiento se puede desarrollar un sistema de información de salud nutricional, y generar acciones de promoción de salud escolar que lleven a mejorar la calidad de vida de los niños.

INSTRUMENTOS DE EVALUACIÓN PESO El peso se debe obtener en condiciones estandarizadas que permitan la comparación entre un control y otro. El niño o adolescente debe estar descalzo, con un mínimo de ropa. Si por razones de fuerza mayor fuese necesario mantener parte de la ropa (falta de privacidad, baja temperatura ambiental) es necesario restar el peso de las prendas del peso obtenido. • Para esto, se elabora una tabla con el peso promedio de las prendas de uso más frecuente. Los estudiantes situarán sus pies en el centro de la plataforma.

TALLA O ESTATURA La talla es un indicador importante en el desarrollo del niño y adolescente. Se sitúa descalzo/a sobre un piso plano y horizontal, de espalda al instrumento que debe tener un ancho mínimo de 50 cm, los pies paralelos o con las puntas levemente separadas. Los talones, nalgas, hombros y cabeza deben estar en contacto con el plano posterior. • La cabeza se debe mantener cómodamente erguida. Una línea horizontal imaginaria debe pasar por el ángulo externo del ojo y el conducto auditivo externo. Los brazos deben colgar a los lados del cuerpo, de manera natural. • El tope superior se hará descender en ángulo recto suavemente aplastando el cabello y en contacto con el vértice de la cabeza. La talla se registrará en centímetros, hasta el 0,5 más próximo. Las balanzas con antropómetro incorporado deben permitir realizar la medición con las indicaciones descritas. ÍNDICE DE MASA CORPORAL El índice de masa corporal (IMC) se obtiene al dividir el peso (en Kg) por el cuadrado de la talla en metros. IMC = peso /talla2 CIRCUNFERENCIA DEL BRAZO

• Se controla la balanza regularmente con pesas patrones o un objeto de peso conocido. Antes de iniciar la jornada se calibra la balanza. • Entre un paciente y otro el instrumento debe estar en cero. La balanza debe estar colocada sobre una superficie lisa, sin objetos extraños bajo ella. El peso se registrará en kilos, hasta los 100 gramos más próximos.

La medición de la circunferencia del brazo es otra herramienta antropométrica que se puede utilizar. Es una medida de masa corporal ya que incluye hueso, músculo, grasa y piel. Se consideran como valores normales aquellos que se ubican entre los percentiles 5 y 95. Esta medición se correlaciona muy bien con las relaciones de peso/edad y peso/talla.

DIAGNÓSTICO NUTRICIONAL Y ELABORACIÓN DE CURVAS DE CRECIMIENTO

19


Se asume que las medidas antropométricas siguen una distribución estadística normal entre la población y determinan un nivel de riesgo para cada individuo. Basta con conocer la distancia en desvío patrón o score de un individuo, en relación con la población de referencia, para saber su nivel de riesgo. Este se expresa en términos de porcentaje de una población sobre determinado punto de corte (prevalencia). Otras medidas pueden ser cálculos estadísticos: media, desvío y distribución de frecuencias. Con las medidas corporales recolectadas se pretende crear gráficos que se utilizarán en la evaluación antropométrica. Aunque en Ecuador existe preocupación sobre la salud nutricional en niños, falta el correcto diagnóstico nutricional en nuestros escolares y adolescentes, debido a que actualmente el problema de malnutrición por exceso, se ha incrementado.

MATERIALES Y MÉTODOS Es un estudio transversal descriptivo de los alumnos que asisten a los institutos anexos de la Universidad Católica de Cuenca en el año lectivo 2010 - 2011, a los cuales se realizó una encuesta, tomó medidas antropométricas, y se realizaron exámenes complementarios para conocer su estado nutricional. En un inicio se tomaron muestra de 501 casos.

CONCLUSIONES Luego de realizar el estudio en los alumnos de los institutos anexos aplicando una encuesta, efectuar estudios antropométricos y exámenes complementarios llegamos a las siguientes conclusiones: • A pesar de que en los últimos años se ha mostrado interés en el aspecto nutricional, un gran porcentaje de los encuestados un 27,94% desconocen sobre nutrición.

Uno de los mayores problemas es la falta de tablas de curvas de crecimiento de nuestro medio, las que se usan actualmente han sido adoptadas de países que tratan de simular las variables del nuestro, sin embargo de ninguna manera serían mejores que las realizadas con nuestros niños. Con la elaboración de nuestras propias curvas de crecimiento se podrá desarrollar un sistema de información de salud nutricional y generar acciones de promoción de salud escolar que lleven a mejorar la calidad de vida de los niños. Al realizar este Plan Piloto en la ciudad de Cuenca se puede transpolar los resultados a la 24 provincias del Ecuador y obtener un condesando, de lo cual se tendrá resultados beneficiosos en todo el país y así lograr estandarizar nuestras propias curvas de crecimiento.

20

PANORAMA MÉDICO 2012

• En relación con el número de veces que se alimentan la mayoría 38,12 % se alimenta correctamente es decir 5 veces al día.


DIAGNÓSTICO NUTRICIONAL

En relación del diagnóstico nutricional se encuentra que en la edad escolar los alumnos presenta déficit ponderal en un 35%, en inicio de la adolescencia mejora encontrando un mayor porcentaje de niños con peso normal, pero de los 14 a 18 años hay un incremento de sobrepeso entre nuestros niños.

• Sin embargo de toda educación nutricional en el refrigerio se ve que consumen mayormente alimentos chatarra 18,63 % y embutidos 15,76%.

• El resto de comidas: almuerzo, merienda y cena parece mejorar con el consumo de carnes e hidratos de carbono en su mayoría, aunque hay un bajo porcentaje que también consume alimentos chatarra.

• En relación a los alimentos incluidos en el desayuno la mayor parte con cereales y frutas 19,4% y 17,8% respectivamente, también se encuentra un porcentaje que incluyen embutidos y alimentos chatarra en el mismo 15,12% y 14,79%.

DIAGNÓSTICO NUTRICIONAL Y ELABORACIÓN DE CURVAS DE CRECIMIENTO

21


• Respecto de si han recibido capacitación sobre nutrición, casi el 50% respondió no haber recibido ningún tipo de instrucción en este aspecto.

• En los exámenes complementarios se encuentra la glucosa normal en 99.4% y glicemia elevada en 0,6%.

• Al analizar las horas dedicadas a la televisión e Internet la mayoría está entre 1 y 3 horas diarias, y de ellos el 46,91% consumen productos recomendados, que incluyen en su mayoría en su mayoría alimentos chatarra.

• Colesterol normal en 95,6%, elevado en 4,4 % con énfasis en el sexo masculino. • Triglicéridos normales en 97,8%, y el 2,2% elevado. El trabajo no concluye aquí, contiene además otros exámenes realizados, elaboración de curvas de crecimiento para nuestra población y lógicamente deberá encontrar los niños de riesgo para tratar de corregir su problema, y educarlos en nutrición junto con sus padres, profesores y personal de los bares escolares.

AGRADECIMIENTO • Al Dr. César Cordero Moscoso por todo el apoyo brindado para la ejecución de este proyecto.

• En el estado nutricional de los niños según el cálculo de índice de masa corporal se encontró que la mayoría 53,49% son normales, no obstante pese a lo realizado el 32,34% tienen bajo peso, el sobrepeso está en 12,38% que los puede llevar a la obesidad y problemas cardiovasculares en la edad adulta, y el 1,20% de los niños ya son obesos.

22

PANORAMA MÉDICO 2012

• A la Dra. María Fernanda Ortiz, Dra. Rosa Solórzano, Dr. Franz Guerrero y alumnos de quinto año de Medicina que colaboraron en la obtención y procesamiento de los datos. • Al personal de los Institutos anexos de la Universidad Católica de Cuenca, por su colaboración desinteresada. • A la Unidad Académica de Bioquímica y Farmacia, quienes realizaron los exámenes complementarios.


Con este artículo se participo con un poster en el I GONGRESO DE CIENCIA Y TECNOLOGÍA, INNOVACIÓN – INVESTIGACIÓN - DESARROLLO.

DIAGNÓSTICO NUTRICIONAL Y ELABORACIÓN DE CUR VAS DE CRECIMIENTO

23


BIBLIOGRAFÍA 1. Ballabriga A., M Moya. Malnutrición y subnutrición. M. Cruz Tratado de Pediatría. Oceano-Ergon 2007 vol. 1, 691. 2. INEC, Censo 2010; Ecuador. 3. Secretaría técnica del Frente Social, SIISE, VR. 4.0, Sistema de Indicadores Sociales del Ecuador, 2005, Quito. 4. INEC, 2006, Modulo de antropometría y nutrición, Encuesta de Condiciones de Vida, resultados preliminares, Quito, 2006. 5. Hernández, C. Tratado de Pediatría. Editorial Ergon. España 2007. 6. INEC, CEPAL, 2004; Ecuador: proyecciones de población por provincias, cantones, áreas, sexo y grupos de edad, período 2001 - 2010. Serie OI, No 205, Agosto, 2004, Quito. 7. INEC, 2006, Modulo de antropometría y nutrición, Encuesta de Condiciones de Vida, resultados preliminares, Quito, 2005. 8. Ogen et al. JAMA 2006: 1549-1555 Pediatric Obesity: Prevention, and treatment strategies for primary care. Ed. Sandra G. Hassink, MD,FAPP. Publ. American Academy of Pediatrics, 2007. 9. B. Sobradillo, A. Aguirre, Curvas Y Tablas de Crecimiento (Estudios Longitudinal y Transversal), Fundación Faustino Orbegozo Eizaguirre. Bilbao Impresión: elkar-mccgraphics I.S.B.N.: 84-607-99670 D.L.: BI-336-04

24

PANORAMA MÉDICO 2012

10. Rodrigo Yépez, Fernando Carrasco, Manuel E. Baldeón. Prevalencia de sobrepeso y obesidad en estudiantes adolescentes ecuatorianos del área urbana. Archivos Latinoamericanos de Nutrición, Órgano Oficial de la Sociedad Latinoamericana de Nutrición Vol. 58 Nº 2, 2008. 11. Fontaine K, Redden D, Wang C, Westfall A, Allison D. Years of life lost due to obesity. JAMA. 2003; 289:187-193. 12. Rodríguez Romeo, S. Urgencias en Pediatría. Editorial Ergon. España, 2008 13. OPS (Organización Panamericana de la Salud). Régimen alimentario, nutrición y actividad física. Washington DC: OPS. 2003. 14. Yépez R. Obesidad. Organización Panamericana de la Salud (OPS/OMS) 2007. La equidad en la mira: la Salud Pública en Ecuador durante las últimas décadas. Quito: OPS/MSP/CONASA. 2007. 15. Valdez R, Elkasabany A, Srinivasan SR, Berenson GS. Time-course of adiposity and fasting insulin from childhood to young adulthood in offspring of parents with coronary artery disease: the Bogalusa Heart Study. Youssef AA, Ann Epidemiol. 2002 Nov;12(8):553-9. 16. Estrada Jiménez G, Matienzo González G, Apollinaire Pennini Js, Martínez Barroso Mt, Gómez Arcila M, Carmouce Cairo H. Perfil antropométrico comparado de escolares deportistas y no deportistas. Medisur]. 2007 [cited 22 Feb 2008]; 5(2): [aprox. 6p]. Available: http://www.medisur.sld.cu/index.php/ medisur/article/view/270.

RESEÑA En Ecuador existe alta preocupación sobre la salud nutricional en niños, falta el correcto diagnóstico nutricional en nuestros escolares y adolescentes, debido a que actualmente el problema de mal nutrición por exceso se ha incrementado...


VIRUS AH1N1: CARACTERÍSTICAS Y DIAGNÓSTICO MOLECULAR

AUTORES: DRA. YOLANDA VANEGAS COBEÑA*, DR. LEONARDO MORALES VANEGAS *Médica especialista en Biotecnología (Mención Biología Molecular e Ingeniería Genética).

RESUMEN

ABSTRACT

La palabra virus viene del latín que significa toxina o veneno. Los virus deben vivir a expensas de una célula, carecen de medios propios de reproducción, por eso invaden el ADN de la célula atacada y se replican a expensas de su material genético. Existen tres tipos, el más frecuente y que afecta a los humanos es el tipo B.

The word comes from the Latin virus meaning toxin or poison. The virus must live at the expense of a cell, lacking their own means of reproduction, why invade the attacked cell's DNA and replicate at the expense of their genetic material. There are three types, the most common and affects humans is type B.

Para algunos expertos, el AH1N1 es como un cóctel genético de los virus de influenza porcina, aviar y humana que evolucionó hasta poder transmitirse de humano a humano

To some experts, the H1N1 is something like a genetic cocktail of swine influenza virus, avian and human evolved to be transmitted from human to human

Asimismo, otro medio que puede resultar propicio para las recombinaciones virales podrían ser los organismos transgénicos que se han manipulado por ingeniería genética.

Similarly, another medium that can be conducive to viral recombination could be genetically modified organisms that have been manipulated by genetic engineering.

Sin embargo hay otras líneas de investigación que atribuyen las mutaciones del virus de la gripe porcina a una manipulación humana. Uno de los métodos de diagnóstico es la prueba molecular RT-PCR en tiempo real que replica el ADN en grandes cantidades y luego lo colorea con un fluorocromo cuya intensidad es proporcional a la cantidad de virus existente en la muestra.

But there are other lines of investigation that attributed mutations swine influenza virus to human manipulation. One method of diagnosis is the RT-PCR molecular test real-time DNA replication in large quantities and then stained with a fluorochrome whose intensity is proportional to the amount of virus in the sample.

VIRUS AH1N1

25


INTRODUCCIÓN Desde que apareció el primer caso confirmado de gripe AH1N1 en México, en el estado de Veracruz (11 de Abril de 2009), la humanidad se preocupó, sin embargo muchos científicos creen que esta nueva cepa es relativamente benigna comparando con aquellas que en el pasado llevaron a pandemias. El 21 de Abril de 2009, la secuencia genética del virus fue publicada por el Centro para el Control y Prevención de Enfermedades (CDC) y los Institutos Nacionales de Salud de Estados Unidos, al parecer la cepa es menos agresiva que las que provocaron catástrofes anteriores y menos que el virus H5N1 de la gripe aviar.

La palabra virus viene del latín virus que significa toxina o veneno. Es una entidad biológica que para multiplicarse necesita de una célula huésped pues aprovecha del metabolismo y funciones vitales de una célula a la cual ha atacado...

Analizados los datos se llegó a la conclusión de que la cepa AH1N1 del virus de la gripe carece de un aminoácido, este cambio genético en relación con los otros virus de la gripe podría ser la razón para que se replique con mayor rapidez y facilidad en los pulmones, haciéndolo más letal. Actualmente constituye una pandemia. En nuestro país, el primer caso de gripe AH1N1 confirmado corresponde al 16 de Mayo de 2009, en Guayaquil*. En el Azuay el 6 de Junio de 2009 se confirmó el primer caso de gripe AH1N1** * Página web del Ministerio de Salud del Ecuador **Departamento de Epidemiología de la Jefatura de Salud del Azuay

ALGUNAS GENERALIDADES SOBRE LOS VIRUS... Y EL VIRUS AH1N1 La palabra virus viene del latín virus que significa toxina o veneno.

26

PANORAMA MÉDICO 2012

Es una entidad biológica que para multiplicarse necesita de una célula huésped, pues aprovecha del metabolismo y funciones vitales de una célula a la cual ha atacado. Los virus contienen sólo un tipo de ácido nucleico, sea este ADN o ARN, nunca los dos al mismo tiempo.

CARACTERÍSTICAS DE LOS VIRUS • No tienen vías metabólicas para la obtención de energía. Es decir, siempre tienen que vivir a expensas de una célula. • No poseen organelas que desarrollan funciones específicas como en las células normales. • Carecen de medios propios de reproducción, por eso invaden el ADN de la célula atacada y se replican a expensas de su material genético.

ETAPAS DE LA INVASIÓN VIRAL Podemos agruparlas en 4 fases: 1. Etapa de adsorción, aquí el virus se pega a un receptor específico de una célula. Si la célula no tiene este receptor no puede ser atacada. 2. Etapa de multiplicación, el virus empieza a replicarse gracias al material genético celular.


3. Etapa de maduración viral, el virus una vez que ha sometido a la célula huésped, elabora sus propias proteínas tomando la energía celular. 4. Etapa de liberación viral, por medio de una proteína específica el virus forma un brote en la membrana celular y sale a invadir nuevas células.

TIPOS DE VIRUS DE LA GRIPE TIPO A Tiene gran capacidad de mutación y sus múltiples subtipos se encuentran en las aves acuáticas salvajes. Los virus pueden transmitirse a otras especies o saltar directamente al hombre provocando pandemias. • Los virus de tipo A son los patógenos más agresivos de los tres géneros que pueden provocar la enfermedad. TIPO B Afecta casi exclusivamente a humanos y en menor escala a focas. Es menos mutante, menos frecuente y menos agresivo que el tipo A. Esta capacidad limitada de infectar especies junto con la baja tasa de cambios genéticos hace que no aparezcan pandemias de virus tipo B. TIPO C

a la familia de los Orthomyxoviridae tipo A, causan enfermedades endémicas en poblaciones porcinas. Este tipo de virus sólo afectaba a los cerdos, sin embargo debido a sus múltiples mutaciones para readaptarse a medios diferentes ha adquirido características de otras cepas, así es posible la trasmisión de la gripe del cerdo al humano y de una persona a otra, la misma que continúa mutando para evadir las defensas del organismo. El brote de gripe A que afecta a la población humana, es una cepa H1N1, que actualmente ha mutado encontrando otras variedades.[] Su material genético proviene de una cepa de gripe aviaria, dos cepas de gripe porcina y una cepa de gripe humana. Así el nuevo virus de influenza contiene ADN de virus de aves, cerdos y humanos.

ESTRUCTURA DE LOS VIRUS Este virus tiene en su interior 8 segmentos de ácido nucleico ARN envueltos por un conjunto de proteínas llamada cápside. Luego se encuentra la matriz y por último la envoltura viral a la que atraviesan proteínas de transmembrana entre las que están la hemaglutinina y la neuraminidasa. Este virus necesita de una enzima que es la ARN polimerasa.

Este tipo infecta a humanos y a cerdos, y puede causar cuadros graves y epidemias locales en animales. El tipo C es menos frecuente que los otros dos tipos.

GRIPE AH1N1 La gripe AH1N, anteriormente conocida como gripe porcina o SIV (swine influenza viruses) es una enfermedad infecciosa causada por un virus de ARN que pertenece

Virus de la gripe porcina

VIRUS AH1N1

27


EL VIRUS AH1N1 Anteriormente se indicó que existen tres tipos de virus de la influenza: A, B y C. Esta clasificación se basa en dos proteínas específicas de estos virus: la proteína NP que es una nucleoproteina (se encuentra dentro del núcleo), y la proteína M que se encuentra en la matriz del virus. Este virus es de tipo A y son los principales responsables de las epidemias anuales de gripe común que sufrimos cada otoño invierno. Este tipo de virus tiene a su vez subtipos que dependen de las características antigénicas de otras dos proteínas que producen una respuesta inmune específica por el organismo. Ambas sobresalen en la superficie externa de la partícula vírica a manera de espículas y tienen funciones esenciales en el ingreso y en la replicación del virus en la célula. Estas proteínas son la hemaglutinina que permite la adherencia del virus al receptor de la célula que va a infectar para luego ingresar su material genético al citoplasma celular. La neuraminidasa se encarga de la salida del virus replicado y la infección a nuevas células. La detención de estos procesos depende de las defensas del huésped.

INGRESO DEL VIRUS A LA CÉLULA El virus de la gripe AH1N1 sólo se transmitía entre cerdos, no obstante en la actualidad se transmite de los animales a los humanos y también de humanos a humanos. El virus ingresa por las vías respiratorias previo a un contacto directo con las secreciones de los animales o personas contaminadas. Se cree que esta transmisión es igual a la de la gripe estacional en las personas, cuando tosen o estornudan libremente estando infectados. En la tos y el estornudo se eliminan gotas en las que se encuentra el virus. Estas gotas no se encuentran en la carne de cerdo por lo que la enfermedad no se contagia de este modo, y además el virus no resiste altas temperaturas como las empleadas para cocinar alimentos. También pueden infectarse al tocar algo que tenga el virus de la gripe y luego llevarse las manos a la boca o nariz. Para que el virus pueda entrar a la célula primero tiene que enlazarse a un receptor de su membrana, iniciando así el proceso de infección.

Se han identificado 16 tipos de proteína H y 9 de proteínas N, todas ellas en virus aviares y algunas de estas variantes han sido aisladas en virus que han infectado a seres humanos. Las características indicadas distinguen en parte el virus H1N1 del H5N1 que causa la gripe aviar y que ha infectado a personas en países del sudeste asiático con resultados graves por su alta letalidad.

28

PANORAMA MÉDICO 2012

Gráfico 1. El virus se adhiere al receptor de la célula del epitelio respiratorio a través de la proteína Hemaglutinina.


El virus se pega a la célula huésped gracias a las propiedades de la hemaglutinina, la misma que ancla el virus a la membrana de la célula sana. Luego ingresa y utiliza a la célula huésped para poder fabricar sus propias proteínas y todos los componentes necesarios para formar partículas virales completas. La proteína neuraminidasa permite que los virus se sigan propagando. Se ha visto que este virus ataca con más fuerza y virulencia a jóvenes, debido a su mayor contacto interpersonal. Esto es contrario a la gripe típica, donde los más afectados son las personas mayores de 65 años y niños menores de 3 años que permanecen más aislados de otras personas, y tienen menores defensas.

PRUEBAS DE LABORATORIO PARA LA DETERMINACIÓN DEL VIRUS Las pruebas para la determinación de este virus son pruebas moleculares, llamadas: 1. RT - PCR 2. RT - PCR Tiempo real La RT-PCR es una prueba derivada de la PCR • RT - PCR significa Reacción en Cadena de la Polimerasa en Transcripción Reversa, pues utiliza la enzima transcriptasa reversa. • La PCR se utiliza para trabajar con ADN • La RT-PCR para ARN.

RT-PCR Esta es una técnica de biología molecular, que sirve para amplificar un fragmento mínimo de ADN; es decir de cantidades muy pequeñas casi no detectables se obtienen niveles totalmente identificables.

Es muy útil, ya que resulta mucho más fácil identificar con una alta probabilidad virus o bacterias causantes de una enfermedad. Es decir si el ácido nucleico del virus está presente aunque sea en muy pequeña cantidad, tras la amplificación aumenta enormemente el número de moléculas, en cambio si no está no hay amplificación. Así pues es un método cualitativo. Esta técnica se fundamenta en la propiedad natural de las enzimas llamadas ADN polimerasas (taq polimerasa) que sirven para multiplicar hebras de ADN, para lo cual emplea ciclos de altas y bajas temperaturas alternadas. Para la detección del virus de la gripe AH1N1 se utiliza la técnica RT- PCR debido a que este virus no contiene ADN sino ARN, es decir primero se debe convertir el ARN en ADN usando una enzima llamada Transcriptasa Reversa, a este nuevo ADN le llamamos ADN complementario o ADNc, pues la enzima Taq en cambio solo replica ADN.

RT-PCR EN TIEMPO REAL El principio es el mismo de la RT-PCR, sin embargo aquí se utiliza una sonda con un fluorocromo que se pega en el material genético del virus dando una coloración cuya intensidad es directamente proporcional a la cantidad del ADNc del virus, la misma que se detecta en ese momento en un fotocolorímetro. Es una prueba cuantitativa, dosifica la carga viral actual. Se la conoce también como RT-PCR cuantitativa, qPCR (del inglés quantitative polimerasa chain reaction).

FLUOROCROMO Un fluorocromo o fluoróforo por analogía con los cromóforos, es una molécula que forma parte de la sonda que hace que ésta sea fluorescente y coloreada permitiendo que el ADN buscado sea fácilmente detectable.

VIRUS AH1N1

29


SONDA La sonda es un elemento de ADN elaborado por ingeniería genética que tiene la propiedad de unirse por complementariedad al ADN que se busca, de esta forma la sonda fluorescente al acoplarse al ADN objetivo da fluorescencia y colorea a la solución en la que se encuentra el virus

3. Hibridación A 55 °C el primer o cebador se pega a los extremos de cada hebra.

CCCGTTTACGTTTAAGGGCGCTA ADN del virus

GGGCAAATGCAAATTCCCGCGAT SONDA elaborada por ingeniería genética

• Fluorocromo

4. Elongación A 72 °C se alarga y se completan las nuevas hebras de ADN con ayuda de la Taqpolimerasa.

CCCGTTTACGTTTTAAGGGCGCTA • GGGCAAATGCAAATTCCCGCGAT FLUOROCROMO unido a la sonda. A su vez la sonda se une al ADN viral y le confiere color, cuya intensidad es detectada en el fotocolorímetro.

PROCESO DE LA PCR PCR son siglas en inglés y significan Reacción en Cadena de la Polimerasa. Se puede agrupar en 4 pasos: 1. Iniciación Se inicia el proceso con la muestra que contiene ADN (doble hebra).

Este proceso se lleva a cabo en un equipo llamado termociclador. • Al final del ciclo se obtienen 2 moléculas de ADN a partir de una sola. En el segundo ciclo se obtienen 4 por el mismo procedimiento. En el tercero 8, en el cuarto 16, y así sucesivamente, hasta llegar a obtener cientos de millones de moléculas idénticas en pocas horas.

TAQ POLIMERASA

2. Desnaturalización A 95°C se separan las 2 hebras del ADN.

30

PANORAMA MÉDICO 2012

La Taq-polimerasa es una enzima obtenida en una bacteria que vive en aguas termales, Termophilus acuaticus (Taq). Esta enzima tienen una temperatura óptima de funcionamiento de 72°C y su termoestabilidad permite que su vida media a 95°C sea de 40 minutos, lo que la hace idónea para este tipo de procesos.


PRIMERS Los primers, cebadores o iniciadores son cortas cadena (oligonucleótidos) de ADN de 18 a 22 nucleótidos.

TERMOCICLADOR Un termociclador, o reciclador térmico de PCR es un aparato usado en Biología Molecular que permite realizar los ciclos de temperaturas necesarios para una reacción en cadena de la polimerasa de amplificación de ADN. Es un equipo en el que se puede programar tiempos diferentes de reacciones con rangos de temperatura de 4°C a 96°C.

OTRA FORMA DE IDENTIFICAR AL VIRUS Se puede replicar el virus mediante un cultivo in vivo por inoculación de las secreciones faríngeas en preparaciones celulares de riñón de mono, o habitualmente en la cavidad amniótica de embriones de pollo. EL VIRUS PUDO HABER SIDO PRODUCIDO EN UN LABORATORIO DE INGENIERÍA GENÉTICA

Por un lado, se cree que el humano mismo ha contribuido a la aparición de este virus mutante al someter a condiciones de vida totalmente crueles, artificiales y antinaturales a los animales; las condiciones insalubres, crueles y de hacinamiento, la proximidad de los criaderos de cerdos a los criaderos de aves, y viceversa, aumentan la probabilidad de recombinación viral y desarrollo de nuevas formas y características evolutivas. Para algunos expertos, el AH1N1 es como un cóctel genético de los virus de influencia porcina, aviar y humana que evolucionó hasta poder transmitirse de humano a humano. Asimismo, otro medio que puede resultar propicio para las recombinaciones virales y podrían ser los organismos transgénicos que se han manipulado por ingeniería genética. No obstante, hay otras líneas de investigación que atribuyen las mutaciones del virus de la gripe porcina a una manipulación humana, pues suponen que las características genéticas AH1N1 son resultado de un cultivo en huevos embrionados, un método utilizado en laboratorio.

BIBLIOGRAFÍA WEB: 1. http://www.diariocolatino.com/es/ 20090425/internacionales/66152/

8. www.taringa.net/posts/apuntes-y-monografias/ 2553881/Mas-mortifero-que-la-influenza-AH1N1.html

2. http://www.bbc.co.uk/mundo/america_latina/2009/ 04/ 090426_1400_gripe_domingo _med.shtml

9. http://es.wikipedia.org/wiki/RT-PCR

3. http://www.rpp.com.pe/2009-04-25- %C2%BFque-esla-gripe-porcina-noticia_177712.html 4. noticias.prodigy.msn.com/ Fotogalerias/brote_influenza.aspx?cpdocumentid=19496183

10. http://books.google.com.ec/books?id=xIx6G7bIv4C&pg=RA5PA180&dq=fluorocromo&source =bl&ots=OpZWkiPUBn&sig=QKMpv6WZDar_ 11. http://www.unilibrebaq.edu.co/ubaq/ Mis%20Webs/PCR.htm

5. www3.diariolibre.com/noticias_det.php?id=198306

12. http://es.wikipedia.org/wiki/Thermus_aquaticus

6. www.elcomercio.com/noticiaEC.asp? id_noticia=275092&id_seccion=5

13. http://es.wikipedia.org/wiki/ Pandemia_de_gripe_A_(H1N1)_de_2009

7. edicion4.com.ar/e4blog/?tag=primer-brote-deinfluenza-porcina-ah1n1

VIRUS AH1N1

31


COMPLICACIONES ASOCIADAS AL CATÉTER VENOSO CENTRAL PERIODO ENERO 2010 - MARZO 2011 AUTORES: DR. HÉCTOR ALAJO, DR. JORGE MARTÍNEZ, DRA. ALEXANDRA CALLE, DRA. JOSSETTE TELLO Hospital Militar Cuenca, Clínica Santa Inés, Clínica Paucarbamba Cuenca - Ecuador

RESUMEN Objetivos Determinar la frecuencia y tipos de complicaciones mecánicas e infecciosas asociadas al catéter venoso central (CVC). Método Se llevó a cabo un estudio, descriptivo y retrospectivo en la Unidad de Cuidados Intensivos del Hospital de División III de Tarqui, en el período Enero - 2010 a Marzo - 2011. Resultados Se colocaron un total de 37 CVC en la Unidad de Cuidados Intensivos de los cuales el 59.46% corresponden a pacientes mayores de 75 años, 54% corresponden al sexo masculino. La mayoría de los pacientes provino de las especialidades de Cirugía, Clínica y Neurología. Se tomaron los valores de APACHE II de ingreso y egreso, de los sitios de

32

PANORAMA MÉDICO 2012

colocación 24 se colocaron en la vena subclavia derecha, y 11 en la vena subclavia izquierda debido a cambios del catéter. El 62% de los catéteres fueron colocados por el médico tratante para monitoreo hemodinámico, y administración de volumen y medicamentos, todos fueron colocados con éxito, de estos sólo 2 presentaron eritema en el sitio de punción. Del total de catéteres el 14% fue cultivado, el 35% presentó algún tipo de complicación; el 73% de nuestros pacientes fueron dados de alta a piso aún con el CVC. Conclusiones La frecuencia de complicaciones mecánicas del cateterismo venoso central en la UCI fue del 35%, siendo punción arterial, mal posición y retiro accidental, entre los más frecuentes. Palabras clave Catéter venoso central, complicaciones.


INTRODUCCIÓN El uso clínico de catéteres venosos centrales (CVC) fue descrito primero por Aubaniac en 1952 para canular la vena subclavia y resucitar soldados heridos en el campo de batalla. (1) La cateterización venosa se define como la inserción de un catéter biocompatible en el espacio intravascular central o periférico, con el fin de administrar soluciones parenterales (medicamentos, nutrición, etc.).(3)

Estas complicaciones se pueden dividir en: • Mecánicas: falla en la ubicación del CVC, punción arterial, hematoma, perforación de vaso, neumotórax, hemotorax, perforación y taponamiento cardiaco). • Complicaciones infecciosas: infección del sitio de inserción del catéter, infección del trayecto y bacteriemia asociada a catéter. • Trombóticas: obstrucción del catéter, trombosis venosa, tromboembolismo pulmonar, entre otras.

Aunque es un tema controversial la mayoría de los centros de referencias y entidades de control La cateterización venosa es la como la Food and Drug inserción de un catéter Administration (FDA) coinciden en sus protocolos en que la punta del biocompatible en el espacio catéter debe ubicarse en el tercio intravascular central o periférico... distal de la vena cava superior para administrar soluciones (VCS), cerca de la unión con la parenterales. aurícula derecha (AD), evitando la ubicación intracardíaca o la migración de esta hacia la cavidad cardiaca, debido al riesgo potencial de disrupción vascular o perforación Los catéteres venosos centrales han llegado cardiaca con taponamiento. (2-7) a ser esenciales en la práctica médica actual y su uso es de rutina en las diferentes unidades de cuidados intensivos (UCI), salas de emergencia y cada vez más frecuente en los pisos de Medicina. En Estados Unidos, los médicos insertan más de 5 millones de CVC cada año y es extremadamente prevalente en las UCI con una tasa de utilización media que va de 32% a 80% entre pacientes adultos. El uso cada vez más frecuente de los CVC ha incrementado la incidencia y severidad de las complicaciones mecánicas, trombóticas y especialmente complicaciones infecciosas. Más del 15% de los pacientes con CVC tienen complicaciones. (1)

Las complicaciones derivadas de los CVC están relacionadas a la técnica de punción, la vía elegida, la enfermedad del paciente, el número de luces del catéter, el medio donde se realiza, el tiempo de permanencia, y la experiencia del personal que la lleva a cabo. Tales factores constituyen puntos estratégicos e importantes para desempeñar actividades preventivas frente a estas infecciones. En Argentina la incidencia de las complicaciones asociadas a los CVC es de 2,92%. A pesar de que las mismas son menos frecuentes que otras infecciones intrahospitalarias como las neumonías, cobran vital importancia ya que son causa de morbilidad, mortalidad y aumento de los costos hospitalarios. (3)

COMPLICACIÓNES ASOCIADAS AL CATÉTER VENOSO CENTRAL

33


Motivados por esto, se propuso realizar un trabajo cuyo objetivo es documentar las complicaciones asociadas a la colocación de la punta del CVC en pacientes adultos internados en la Unidad de Cuidados Intensivos del Hospital de III División de Tarqui.

Gráfico No. 1

MATERIALES Y MÉTODOS Se realiza un estudio retrospectivo y descriptivo de las Complicaciones asociadas al catéter venoso central en la Unidad de Cuidados Intensivos del Hospital de División III de Tarqui entre Enero - 2010 a Marzo - 2011, en pacientes internados en los que fue necesaria la colocación de un CVC, independientemente de su causa. Los datos de los pacientes fueron obtenidos en el formulario de recolección. Las variables observadas fueron edad, sexo, motivo de internación, fecha de la cateterización, índice de Apache II de ingreso y egreso, localización de la punción, personal médico que coloca, tipo de catéter aparición, y tipo de complicaciones en este lapso.

Fuente: Encuestas

De los cuales el 58% correspondió al sexo masculino y el 42 % al sexo femenino. La mayoría de pacientes provino de las especialidades de Cirugía, Clínica y Neurología. Gráfico No. 2

RESULTADOS En el periodo Enero - 2010 a Marzo - 2011 el Hospital de División III de Tarqui tuvo una afluencia de 1383 pacientes, de este total solo 3% necesitó ingreso en la Unidad de Cuidados Intensivos. Del total de ingresos a UCI el 79% se colocó una vía central, ya que los pacientes que no se colocaron el CVC generalmente fueron post-quirúrgicos y hemodinámicamente estables.

Fuente: Encuestas

Gráfico No. 3

Se colocaron un total de 37 CVC en la Unidad de Cuidados Intensivos, de los cuales el 59,46% corresponden a pacientes mayores de 75 años. Fuente: Encuestas

34

PANORAMA MÉDICO 2012


Casi en su totalidad los catéteres insertados fueron Venosos Centrales, sólo contamos con un catéter para Hemodiálisis colocado en la UCI, de los sitios de colocación 24 se colocaron en la vena subclavia derecha y 11 en la vena subclavia izquierda que se debieron a cambios del catéter en su mayoría. Gráfico No. 4

El 35% del total de los catéteres presentó algún tipo de complicación entre las que estuvieron 4 punciones arteriales, 4 posiciones no adecuadas del catéter, 3 retiros accidentales y un neumotórax. El 73% de nuestros, pacientes fueron dados de alta a hospitalización aun con el CVC. Gráfico No. 6

Fuente: Encuestas

El 62% de estos catéteres fueron colocados por el médico tratante mientras que el 38% fueron insertados por el médico residente de UCI, el motivo de colocación fue en su mayoría para monitoreo hemodinámico y administración de volumen y medicamentos. Del total de cateterizaciones el 43% se realizó con una sola punción, el 51% necesitó 2 punciones, y el 6% de estos 3 punciones, todos fueron colocados con éxito, de estos solo uno presentó eritema en el sitio de punción. Del total de los catéteres el 9% fue cultivado. Gráfico No. 5

Fuente: Encuestas

DISCUSIÓN El uso de los dispositivos de acceso venoso central se ha convertido en un componente esencial del tratamiento de afecciones médicas. Se estima que cada año se insertan varios millones de dispositivos que facilitan muchas terapias, y estos dispositivos eliminan los problemas derivados del acceso venoso periférico repetido, aunque no están exentos de complicaciones.(3) Respecto a la técnica de inserción, algunos autores consideran de elección la vena cefálica mediante disección en el surco deltopectoral para evitar complicaciones descritas en la punción subclavia, como neumotórax, hemotórax y lesiones nerviosas. En el estudio, se optó por la vena subclavia porque es más confortable para el paciente y tiene una tasa de complicaciones baja a largo plazo.

Fuente: Encuestas

Al revisar la literatura científica, se encuentra una tasa de complicaciones variable, entre el 6 y el 53% (7).

COMPLICACIÓNES ASOCIADAS AL CATÉTER VENOSO CENTRAL

35


La tasa de infecciones oscila entre el 0,6 y el 27%, en función del tipo, la ubicación del catéter y la constitución del paciente (6). Según el estudio de Bouza et al, las infecciones pueden ser promovidas por los siguientes mecanismos: • Contaminación en la inserción, que se puede evitar con precisas medidas de asepsia. • Migración de los organismos de la piel a lo largo de la superficie externa del catéter • Sustancias que entran y pasan a través de la luz del catéter, que constituye la forma más frecuente de patogénesis. • Contaminación por infusión y finalmente infección hematógena desde un sitio lejano (4-9).

Algunos estudios han encontrado una disminución del riesgo de infección tras la profilaxis, que podría ser beneficioso en grupos específicos de pacientes, como los neutropénicos en el momento de la inserción.

En función del tipo de paciente y de catéter, los principales microorganismos causantes de las infecciones son estafilococos coagulasa-negativos: Staphilococcus aureus y Candida. El retiro de los catéteres en los pacientes infectados con Staphilococcus aureus ha sido asociado con una respuesta más rápida y mayor tasa de curación (5-10). Existe controversia sobre el valor de la administración profiláctica de antibióticos antes de la colocación del dispositivo. Algunos estudios han encontrado una disminución del riesgo de infección tras la profilaxis, que podría ser beneficioso en grupos específicos de pacientes, como los neutropénicos en el momento de la inserción. La terapia antibiótica para tales infecciones debería ser empírica con elección de antimicrobianos dependiendo de la gravedad, y condición clínica de los pacientes (8-10).

36

PANORAMA MÉDICO 2012

Aunque la serie es demasiado pequeña para poder extraer conclusiones definitivas, podrían ser importantes para prevenir la infección del reservorio, las buenas condiciones de asepsia durante su implantación y la situación clínica estable del paciente, antes que la profilaxis antibiótica persé.

Hasta el momento, la anticoagulación profiláctica de rutina no se puede recomendar sobre la base de la evidencia disponible. La experiencia del profesional al momento de la inserción se relaciona con la incidencia de complicaciones en hospitales docentes, como el nuestro; por lo que una estricta supervisión por personal experimentado es fundamental (6). Una vez terminado el trabajo de investigación se concluye que son necesarios más estudios para reducir la morbimortalidad causada por el CVC, y debe realizarse un seguimiento posterior estricto del estado del catéter en los pacientes dados de alta de UCI hacia hospitalización, ya que en muchas ocasiones no se cumple con este tema y se desconoce las condiciones en que se retiran dichas vías.


El estricto cumplimiento de las medidas de asepsia, el tratamiento con terapia antibiótica adecuada y heparinas de bajo peso molecular, en caso de trombosis manifiesta,

para evitar la retirada innecesaria del catéter, son aspectos prioritarios en el manejo diario de los dispositivos.

BIBLIOGRAFIA: 1. Medina R: Complicaciones mecánicas del cateterismo venoso central en pacientes de cuidados intensivos. Rev. Soc. Per. Med. Inter. 2005; 18:11-14. 2. Torres J, et al: Ubicación de la punta del catéter venoso central en aurícula derecha: descripción en 2.348 pacientes críticos. Med Intensiva.2010; 34(9):595– 599. 3. Pasián P, et al: Incidencia de Complicaciones Asociadas a los Catéteres Venosos Centrales. Rev. Hosp. Angela Iglesia de Llano, Asunción. 2005; 5: 24-28. 4. Gómez M, et al: Análisis Retrospectivo de las Complicaciones asociadas a los dispositivos implantables intravasculares. Rev. de la Soc. Esp. del Dolor. 2009 16(5) 12-17. 5. Alonso A, Flores H: Prevalencia de infección en pacientes con catéter venoso central, Rev Enferm IMSS. 2000; 8 (3):139-143.

6. Hamilton HC, Foxcroft DR: Sitios de acceso venoso central para la prevención de trombosis venosa, estenosis e infección en pacientes que requieren tratamiento intravenoso a largo plazo (Revisión Cochrane traducida). En: La Biblioteca Cochrane Plus, 2008 Número 4. 7. Chamorro C, et al: Mal posición de catéteres venosos centrales en pacientes hospitalizados. Medicina clínica. 2001;117: 12–3.

RESEÑA El estricto cumplimiento de las medidas de asepsia, el tratamiento con terapia antibiótica adecuada y heparinas de bajo peso molecular, en caso de trombosis manifiesta, para evitar la retirada innecesaria del catéter, son aspectos prioritarios en el manejo diario de los dispositivos.

8. Flores B, et al: Dispositivos de acceso venoso totalmente implantables para quimioterapia. Resultados y complicaciones. Cir Esp. 2003; 73:288-91. 9. Bouza E, Burillo A, Munoz P: Catheterrelated infections: diagnosis and intravascular treatment. Clin Microbiol Infect. 2002; 8:265-74. 10. Luna C, et al: Tratamiento de las Infecciones causadas por Staphylococcus aureus resistente a meticilina en América Latina. Rev Chil Infec 2010; 27 (2) 94-103.

COMPLICACIÓNES ASOCIADAS AL CATÉTER VENOSO CENTRAL

37


38

PANORAMA MÉDICO 2012


ESQUIZENCEFALIA

AUTORES: DR. CARLOS DARQUEA LÓPEZ, DR. CARLOS DARQUEA ARIAS Hospital Docente Universitario Católico

CASO CLÍNICO

Paciente de 19 años, procedente de Gualaceo, Provincia del Azuay. • Consulta: presenta cefalea frontal gravativa acompañada de mareo, náusea y vómito alimenticio, hemiparesia espástica derecha, con hiperreflexia ósteotendinosa de mismo lado y dificultad para realizar movimientos finos con la mano derecha.

derechos, sensibilidad superficial y profunda normales. • Exámenes complementarios: E.E.G.: normal. • Tomografía simple y contrastada de cráneo: se realizó tomografía simple y contrastada de cráneo, con cortes axiales desde la base a la convexidad observando: • Tejidos blandos de buen grosor y densidad.

Como antecedentes refiere gripes esporádicas y un hermano con retardo mental. • Examen físico: tensión arterial 110/70, pulso 72 latidos por minuto. • Aparato Respiratorio: normal. • Aparato Circulatorio: normal. • Aparato Digestivo normal. • Aparato Génito Urinario: normal. • Sistema Nervioso: Conciencia e inteligencia normales, órganos de los sentidos normales, pares craneales normales. Marcha ligeramente espástica en miembro inferior derecho, hiperreflexia ósteotendinosa en miembros

• Elementos óseos vistos íntegros. • Cerebelo normal

ESQUIZENCEFALIA

39


• Tallo cerebral normal y núcleos de la base normales • Adecuada diferenciación entre sustancia gris y blanca, a nivel parietal izquierdo se observa hendidura desde el espacio subaracnoideo que se comunica con el ventrículo lateral izquierdo, debe tenerse en cuenta la posibilidad de esquizoencefalia de labios abiertos, además hay aumento del calibre del cuarto ventrículo y ventrículos laterales, con aparente ausencia del septum pelúcido.

CORRELACIÓN CLÍNICA Clínicamente, por la sintomatología del paciente y el resultado de la tomografía de cráneo simple y contrastado, la posibilidad de una esquizencefalía es muy digna de tenerse en cuenta, pensando que existió en este paciente alteración de la migración de las neuronas que al situarse estas en los

40

PANORAMA MÉDICO 2012

bordes de la hendidura parietal, indican una interrupción muy temprana en el desarrollo cerebral, compatible con esquizencefalia, que es una malformación cerebral congénita, poco frecuente, en la cual existen hendiduras en la corteza cerebral que comunican el espacio subaracnoideo con el sistema ventricular. Hasta el momento tiene una evolución benigna, pero como la hendidura parietal izquierda se comunica con las cavidades ventriculares que se encuentran aumentadas de calibre, es posible que evolucione a una hidrocefalia. El tratamiento para los pacientes con esquizencefalia consiste de manera general en rehabilitación y fisioterapia, al observar la evolución de la patología será necesario administrar anticonvulsivantes y colocar válvulas de derivación, si se presentan convulsiones o aumenta el calibre ventricular hasta una hidrocefalia.


FETO PAPIRÁCEO CASO CLÍNICO

AUTORES: DR. CRISTIAN FABRICIO PÉREZ ACUÑA DRA. CARMEN ROSA RIVAS ALVARADO Clínica Max Salud Chiclayo - Perú

RESUMEN El término feto papiráceo se utiliza para describir a un feto momificado relacionado con una gestación gemelar o múltiple. El embarazo gemelar es un evento en el cual se incrementa la morbimortalidad fetal, el pronóstico depende en gran parte de la cigocidad y corionicidad a que corresponda. Se denomina feto papiráceo cuando uno de los fetos muere, habitualmente al inicio del segundo trimestre, con sobrevivencia del otro feto. El feto muerto, sufre cambios hísticos secundarios a la compresión mecánica, deshidratación y pérdida de la mayor parte de tejidos blandos, quedando solo con piel y tejido óseo básicamente, constituyendo el feto papiráceo. La frecuencia observada es baja, 1 en 12,000 gestaciones, y 1 en 184 gestaciones gemelares, algunos autores indican a 3.7%.

En muchos de estos casos se recoge el antecedente de hipertensión en el embarazo, como una situación inducida o agravada por las gestaciones múltiples. A veces la muerte del gemelo depende de un accidente funicular, generalmente si es un embarazo monoamniótico o la inserción del cordón es velamentosa. Son mínimas las complicaciones para la embarazada y no existe el riesgo de coagulación intravascular diseminada, aunque se ha reportado disminución leve de los niveles de fibrinógeno. Para el otro gemelo siempre existe el grave peligro de una muerte por coagulación intravascular diseminada debido a la transfusión de tromboplastina desde el otro feto. Palabras clave Embarazo gemelar, feto papiráceo

FETO PAPIRÁCEO

41


Summary The term papiráceo fetus is used to describe to a mummified fetus related to a gestation to gemelar or manifold. The pregnancy to gemelar is an event in which the fetal morbility is increased; the prognosis depends about dizygotic or monozygotic pregnancy. Papyraceous fetus is when one of the fetuses dies, at the beginning of the second trimester denominates itself habitually, and other fetus is life. The dead fetus, undergoes secondary histic changes to mechanical compression, dehydration and loss of most of woven soft, being left with the skin and the bony weave single basically, constituting the papyraceous fetus.

The observed frequency is low, 1 in 12,000 gestations and 1 in 184 twin, some authors indicates 3, 7%; In many of these cases the antecedent takes shelter of hypertension in the pregnancy, a situation induced or aggravated by the multiple gestations; Sometimes the death of the twin depends an funicular accident, if it is an monoamniotic pregnancy or the insertion of the cord is velamentose. The complications for the pregnant woman are minimum and the scattered intravascular coagulation risk does not exist, although slight diminution of the fibrinogen levels has been reported. For the other baby always exist the serious danger of a death by scattered intravascular coagulation for the tromboplastin transfusion exists from the dead fetus.

CASO CLÍNICO Paciente de 21 años de edad, primigesta, FUR 20/09/2007, con controles prenatales en varios centros de salud del Perú y en consultorios particulares de la ciudad de Lima, acude con un resultado ecográfico con diagnóstico de embarazo gemelar con un feto vivo de 25 semanas con bienestar fetal conservado y un óbito que por biometría correspondía a 20 semanas de gestación aproximadamente. La primera y última ecografía en la que ambos gemelos estaban vivos fue a las 14 semanas y reportó gestación doble con fetos activos y biometría similar, no obstante sin dar mayores datos sobre la cigocidad. Nunca se realizó descarte ecográfico de aneuploidías (medida de translucencia nucal, presencia de hueso nasal y valoración del flujo doppler en el ductus venoso).

42

PANORAMA MÉDICO 2012

No tenía antecedentes personales ni familiares de importancia, no alergias, ninguna cirugía. Cuando acudió a consulta con el diagnóstico de un gemelo muerto se solicitó exámenes con los siguientes resultados: Grupo sanguíneo tipo O con factor Rh positivo, Hb 10.8 g, plaquetas 275000 Leucocitos 14200 con 73% de neutrófilos, VIH y VDRL negativos, glicemia de 92mg/dl, tiempo de coagulación 4.4” minutos, y tiempo de sangría 1.35” minutos, examen de orina normal. Se controló el embarazo con ecografía cada mes de acuerdo a las posibilidades de la paciente, y ninguna mostró compromiso del feto vivo, no hubo alteración del perfil biofísico fetal ni de los flujos doppler.


DISCUSIÓN El embarazo gemelar constituye un cuadro importante que linda entre lo fisiológico y lo patológico, por tanto no se exagera al considerar que un embarazo con fetos múltiples es un embarazo complicado, con elevado índice de morbilidad.

La madre tampoco sufrió trastornos de coagulación, ni consumo de fibrinógeno o plaquetas. A las 38,5 semanas se decidió interrumpir el embarazo por vía abdominal, a solicitud de la paciente. Se realizó una cesárea electiva y se obtuvo un feto vivo de 3000g en buen estado, con una placenta normal macroscópicamente, y además se encontró otra bolsa amniótica comprimida en el fondo uterino con su propia placenta, la misma que estaba atrófica, dura, hialinizada, acartonada, color nacarado de 10 cm de diámetro y 5 mm de espesor. Se procedió a disecar el contenido de la bolsa amniótica y se encontró un feto papiráceo de 23 cm de longitud, de aproximadamente 20 semanas con un cordón umbilical que se insertaba normalmente en la placenta, sin lograr apreciar una causa macroscópica que justifique la muerte del mismo.

El embarazo gemelar ocurre con una frecuencia de 1 por cada 90 partos. Con el advenimiento del ultrasonido como método auxiliar diagnóstico, de un estudio de 1000 embarazos en el primer trimestre, se encontró una tasa de embarazo gemelar de 3,29% donde se identificaban los 2 fetos, de estos el 21,2% perdieron uno de los fetos, hecho conocido como fenómeno del gemelo evanescente. Este hecho puede observarse no sólo en el estado embrionario, si no que también puede ocurrir la resorción completa del producto de la concepción, en etapas más avanzadas. El gemelo fallecido puede ser notablemente comprimido junto a la placenta y demás anejos ovulares e identificarse como gemelo compresus o muy aplanado por la pérdida de líquido, que constituye el feto papiráceo. Las gestaciones gemelares se acompañan de mayor frecuencia de defectos placentarios y del cordón, inserción velamentosa y marginal, una sola arteria umbilical y vasos previos; son los gemelos monocoriónicos los más expuestos a dicho peligro, además estos pueden morir por el síndrome de transfusión intergemelar o sufrir lesiones por embolización. La coagulación intravascular diseminada en el sobreviviente se observa cuando existen anastomosis vasculares placentarias intergemelares permitiendo que los productos hemáticos del feto muerto lleguen al vivo, especialmente si se trata de un feto macerado.

FETO PAPIRÁCEO

43


Una vez más estos sucesos ocurren con mayor frecuencia en la placentación monocoriónica. Algunos autores señalan una tasa de mortalidad del gemelo sobreviviente de 50%, en caso de placenta monocoriónica y 0% en placentas dicoriónicas. Otra complicación del embarazo gemelar es la alteración que puede ocurrir en el crecimiento de los gemelos, llamada "discordancia gemelar" y cuya causa más probable es la transfusión intergemelar, este cuadro se puede diagnosticar cuando los pesos fetales difieren en más de 1 kg, más frecuente también en las placentaciones monocoriónicas. El diagnóstico de placenta dicoriónica puede hacerse por examen ultrasonográfico, al detectar gemelos de sexo contrario o 2 placentas, y confirmar las dos bolsas amnióticas.

CONCLUSIONES La frecuencia del feto papiráceo es 1 en 12000 gestaciones y una por cada 184 embarazos gemelares. Las causas de que se presente este evento no son claras, sin embargo reportes en la literatura señalan hacia una fuerte asociación a placentación monocoriónica y preeclampsia severa. La embolización de tromboplastina placentaria o fetal a órganos vascularizados del feto sobreviviente causa entre otros estados ventriculomegalia y aplasia cutis. Dentro de las complicaciones maternas destacan los defectos adquiridos de la coagulación, afortunadamente en este caso todo tuvo una buena evolución gracias en gran parte a la doble cicocidad del embarazo y a la atrofia y hialinización placentaria que no permitió el paso de sustancias perjudiciales a la circulación de la placenta del feto vivo, evitándose una tragedia con el otro gemelo.

BIBLIOGRAFÍA: 1. Rodríguez BI, Reyna VJC, Cura EI. Aplasia cutis congénita y feto papiráceo. Rev Mex Pediatr 1997;64(2):77-79 2. Wagner DS, Klein RI, Robinson HB. Fetus papyraceus : an unusual case with congenital anomaly of the surviving fetus. Obstet Gynecol 1975 feb;45(2):217-20 3. Perla Rocio Arizoca Treviño, Raúl Cortés Flores. Departamento de Medicina Materno Fetal, Hospital Regional de Especialidades No. 23 4. IMSS, Monterrey, N.L. 5. Enbom JA. Twin pregnancy with intrauterine death of one twin. J Obstet Gynecol 1985;152(4):427-9. 6. Gall SA. Embarazo gemelar. Clin Perinatol 1988;15(1). 7. Cunninghom FG, Mac donal PC, Gant NF, et al. Obstetricia de Williams 4ta ed. Barcelona: Masson, 1996:875-900. 8. Roque R. Embarazo múltiple. En: Rigol Ricardo O. Obstetricia y Ginecología. La Habana: Editorial Pueblo y Educación, 1984:88-94.

44

PANORAMA MÉDICO 2012

9. Moore CM, Mac Adams J, Shuterland J. Intrauterine disseminated intravascular coagulation: a syndrome of multiple pregnancy with a dead twin fetus. Pediatr 1969;74(4);523-8. 10. Landy HJ, Wiiner S, Corson SL, et al. The varishing twin: ultrasonographic assessment of fetal disappearance in the third trimester. Am J Obstet Gynecol 1986;155:14-9. 11. Schwarcz RL, Duuerges CA, Díaz GA, et al. Obstetricia. 4ta ed. Editorial El Ateneo, 1989:211-4. 12. Mannino F, Jones KL, Benirschkek Kerner J. Delayed delivery of a fetus papyraceus twin. Am J Obstet Gynecol 1954;68:1185. 13. Robertson JG. Twin pregnancy: morbolity and fetal mortality. Obstet Gynecol 1964;23:330-7. 14. Hanna JH, Hill JM. Single intrauterine fetal mortality dimise in multiple gestation Obstet Gynecol 1984;63:126. 15. Hancy AF, Crenshan MC, Dempsey PJ. Significance of biparietal diameter difference between twins. Obstet Gynecol 1978;51:609-13. 16. Revista Cubana de Obstetricia y Ginecología ISSN 0138-600X versión impresa Rev Cubana Obstet Ginecol V.26 n.2, La Habana, Mayo-ago. 2000.


ACRETISMO PLACENTARIO CASO CLÍNICO

AUTORES: DR. CARLOS ÁVILA GAMBOA, DRA. EDUVIGES ÁLVAREZ LINDAO, INT. JACINTO PÉREZ RAMÍREZ Hospital Teodoro Maldonado Carbo, Universidad Católica de Cuenca

RESUMEN

SUMMARY

El acretismo placentario es una patología que incrementa la morbimortalidad materna.

The placenta accreta is a condition that significantly increases maternal morbidity and mortality.

Gracias a métodos diagnósticos como el ultrasonido, su diagnóstico prenatal es factible.

Thanks to the diagnostic methods such as ultrasound, prenatal diagnosis is feasible.

El manejo del acretismo placentario de forma tradicional supone la realización de histerectomía total. Algunos autores han propuesto el manejo conservador como una solución adecuada en ciertos casos, o bien de forma expectante.

The management of placenta accreta is traditionally performing hysterectomy. Some authors have proposed conservative management as a solution in certain cases, or expectantly.

Sin embargo, aún no se conoce a ciencia cierta si el manejo conservador o tradicional es el mejor. Palabras Clave

Placenta previa, Acretismo placentario, Ultrasonido (US), Histerectomía.

But not yet known for certain whether traditional or conservative management is best. Keywords

Placenta Previa, Placental accreta, Ultrasound (U.S.), hysterectomy.

ACRETISMO PLACENTARIO

45


INTRODUCCIÓN El acretismo placentario es la inserción anormal de parte o toda la placenta, con ausencia total o parcial de la decidua basal y anormalidad de la caduca verdadera con penetración de las vellosidades coriales al miometrio. Es una de las principales causas de hemorragia obstétrica, principalmente del post parto inmediato, que condiciona un importante riesgo de morbimortalidad materna, por la patología misma, así como también por el tratamiento aplicado.

presentes. Se solicitan exámenes complementarios: Biometría hemática, Test de hemostasia, Grupo Sanguíneo y Monitoreo fetal. • Reporte de Biometría: anemia. • Grupo sanguineo: B+. • Monitoreo fetal: Patrón reactivo. Con dichos exámenes se procede al ingreso hospitalario con Dx G: 3, C: 2 y Emb 38 Sg con probable acretismo placentario y anemia. Se programa para cesárea segmentaria, previa transfusión de 2 unidades de paquete de glóbulos rojos.

El principal tratamiento es la histerectomía obstétrica total, debido a su frecuente asociación con placenta previa y cicatrices de cesáreas previas. Este procedimiento es un desafío a las habilidades quirúrgicas del médico obstetra, por lo que es necesario conocer otras alternativas de tratamiento. El objetivo de este caso es la revisión de los factores que predisponen a dicha patología, exámenes a realizar y tratamiento.

CASO CLÍNICO Paciente sexo femenino 29 años de edad, con embarazo de 38 SG, raza mestiza, empleada privada.

Figura 1: ECO Obstétrica, placenta previa oclusiva total con signos de Acretismo.

Se realiza cesárea segmentaria con anestesia epidural, se obtiene producto vivo masculino con Apgar 9/10, peso 3000 g, posteriormente se realiza histerectomía total por acretismo placentario (Fig 5 - 7).

Antecedentes patológicos familiares: madre asmática. Antecedentes personales: quiste de ovario hace 1 año, Gestas: 3, Para: 0, Abortos: 0, Cesárea: 2; FUM: 05/02/11; que acude a emergencia por presentar dolor abdomino pélvico, sangrado transvaginal, presenta además reporte de placenta previa mediante ecografía. (Fig 1). Al examen físico: abdomen globuloso compatible con útero gestante de 38SG, cuello sin modificaciones LCF: 150x´, MF:

46

PANORAMA MÉDICO 2012

Figura 5: Útero en el que se observa cicatriz uterina por cesárea.


La evolución de la paciente fue satisfactoria, se da de alta hospitalaria a las 48 horas.

Figura 6: Corte Sagital del útero

entre la decidua materna y las dos fases de invasión trofoblástica que tienen lugar en etapas tempranas de la placentación (3). La adherencia anormal de la placenta, resulta de una parcial o completa ausencia de la decidua basal y el desarrollo incompleto de la capa de fibrina, capa de Nitabuch; de manera que la línea fisiológica de separación entre la zona esponjosa y la zona basal decidual está ausente; a raíz de esta deficiencia, la adherencia anormal puede afectar a toda la placenta, a varios cotiledones o a uno solo, para constituir las placentas acreta total, acreta parcial y acreta focal respectivamente (4). (Fig 8)

Figura 7: Corte sagital en el que se observa una membrana adherida al miometrio.

DISCUSIÓN Una de las causas de hemorragia del post parto inmediato es el acretismo placentario, el que se describe en 2/3 de los casos de placenta previa. En casos de placenta previa con cicatriz de cesárea anterior, el riesgo de acretismo es directamente proporcional al número de cicatrices y llega hasta 67% con el antecedente de 3 cesáreas previas (1). La frecuencia de acretismo placentario es difícil establecer, ya que en la mayoría de las series sólo se refieren a aquellos casos en los cuales la imposibilidad de separar la placenta del útero culmina en histerectomía. (2) En la actualidad se considera que en la etiopatogenia del acretismo, además del insuficiente desarrollo decidual, también juega un papel importante la falta de interacción

Fig 8: VC: Vellosidades coriales DF: Estrato de Nitabuch DB: Decidua Basal

En el caso presentado los datos ecográficos que demostraron existencia de acretismo placentario fueron: • Parte superior de la placenta, tejido placentario guarda relación con contorno del peritoneo vesical. • Tejidos placentarios presentan grandes lagos.

ACRETISMO PLACENTARIO

47


• Imagen anecoica que corresponde a los vasos. Se conoce además que existe asociación significativa entre acretismo placentario y elevación de niveles de alfa-fetoproteína en el suero materno (6). El acretismo placentario constituye una de las causas más frecuentes de histerectomía postparto (5) y es sin duda su indicación urgente e indiscutible. Actualmente, gracias al progreso médico (anestesia, transfusiones, profilaxis de infección) la morbilidad y mortalidad han disminuido de forma importante. En la literatura se han descrito recientemente casos de acretismo con tratamiento conservador (6); queda por determinar cual será la evolución de estas pacientes a largo plazo.

REVISIÓN BIBLIOGRÁFICA DEFINICIÓN El Acretismo Placentario representa un espectro de anomalías en la placentación, caracterizados por adherencia anormalmente fija a la pared uterina. (7)

CLASIFICACIÓN El acretismo placentario se clasifica según su profundidad de inserción con respecto al miometrio en: • Placenta acreta: adherencia anormal de la placenta a la pared uterina que sobrepasa la capa fibrinoide de Nitabuch sin que el trofoblasto penetre el miometrio. • Placenta increta: el trofoblasto penetra el miometrio. • Placenta percreta: el trofoblasto penetra el miometrio, sobrepasa la serosa del útero y alcanza en algunas oportunidades los órganos vecinos.

48

PANORAMA MÉDICO 2012

Por su extensión se clasifica en tres tipos: • Focal: compromete pequeñas áreas de la placenta. • Parcial: uno o más comprometen la placenta.

cotiledones

• Total: toda la superficie de la placenta se encuentra anormalmente adherida. (5)

FISIOPATOLOGÍA Se piensa que el acretismo placentario se debe a ausencia o deficiencia de la capa de Nitabuch, capa de fibrina que se ubica entre la decidua basal y el corion frondoso. Benirschke y Kaufman et., sugieren que esta situación es consecuencia de falla en la reconstitución del endometrio/decidua basal, especialmente después de la reparación de una operación cesárea. (7)

FACTORES DE RIESGO • Placenta previa • Cesáreas anteriores • Cirugías uterinas previas • Legrados uterinos • Edad materna avanzada • Multiparidad • Alfa-feto-proteina aumentada (8)

DIAGNÓSTICO De forma básica el diagnóstico se limita al empleo de métodos como el ultrasonido. Sin embargo, el diagnóstico definitivo de acretismo placentario es histopatológico, al comprobar la invasión de las vellosidades coriales en el miometrio (9).


El ultrasonido es una herramienta útil para diagnóstico de acretismo placentario, así como sus distintas variantes en el segundo y tercer trimestre del embarazo. Su uso en embarazos más tempranos aún no es concluyente. Finberb y Williams et. establecieron la utilidad de esta técnica de imagen; entre los criterios diagnósticos establecidos fueron: pérdida de la zona hipoecoica miometral retroplacentaria, adelgazamiento o disrupción de la serosa uterina hiperecoica y la interfaz con la vejiga, la presencia de masas exofíticas, presencia de una gran área de sonolucencias placentarias. Chou y cols, emplearon el ultrasonido doppler usando como criterios diagnósticos el flujo lacunar placentario difuso en el parénquima, hipervascularidad en la interfase vejiga-serosa y complejos venosos subplacentarios; con estos criterios se estimó una sensibilidad de 82,4%, especificidad de 96,8%, valor predictivo positivo de 87,5% y valor predictivo negativo de 95,3% (10). Alfa-feto proteína fetal sérica materna. Actualmente se ha propuesto que existe una anormalidad en la interfaz placeta-útero, lo cual promueve una fuga de alfa-feto proteína fetal hacia la circulación materna. Existen algunos estudios como el de Kupferminc y cols, donde revisaron 44 pacientes que se sometieron a cesárea histerectomía, 9 de 20 (45%) pacientes tenían acretismo placentario y elevación de la alfafeto proteína.

A pesar de que los estudios son pequeños todavía queda pendiente valorar la utilidad de la medición de esta proteína como predictor de acretismo placentario, en caso de que tengan elevaciones sin otra causa aparente (5).

TRATAMIENTO Quirúrgico: histerectomía la misma que deberá ser rápida y mientras se administran oxitócicos (7).

COMPLICACIONES • Hemorragia intraoperatoria • Coagulación intravascular diseminada • Reacciones transfusionales • Sobrecarga de líquidos • Infección

CONCLUSIONES El acretismo placentario es una entidad que aumenta con la frecuencia de cesáreas previas, siendo ésta uno de los principales factores de riesgo conjuntamente con la placenta previa oclusiva total. El diagnóstico mediante la ultrasonografía constituye un pilar importante siendo altas las cifras de sensibilidad y especificidad. El diagnóstico y tratamiento oportuno minimizan las probabilidades de compromiso materno, y una cirugía programada disminuye riesgos de posibles complicaciones.

ACRETISMO PLACENTARIO

49


BIBLIOGRAFIA 1. Clark SL, Koomings PP, Pelan JP. Placenta previa/ accreta and previous cesarean section. Obstet Gynecol 1985; 66: 89-92.

6. Oyelese Y, Smulian JC. Placenta previa, placenta accreta, and vasa previa. Obstet Gynecol 2006; 107:927-41.

2. Naeye RL. Disorders of the placenta and decidua. Disorders of the placenta, fetus and neonate. Diagnosis and clinical significance. St. Louis: Mosby Year Book; 1992. p. 155-8.

8. Miller DA, Chollet JA, Goodwin TM. Clinical risk factors for placenta previaplacenta accreta. Am J Obstet Gynecol 1997;177:210-4.

3. Starkey PM. The decidua and factors controlling placentation. Redman CWG, Sargent IL, Starkey PM, Ed. The human placenta. A guide for clinicians and scientists. London: Blackwell Scientific Publications; 1993. p. 362-413.

9. Omar Dueñas G, Hugo Rico O, Mario Rodríguez B. Actualidad en el diagnóstico y manejo del acretismo placentario, Servicio de Obstetricia, Instituto Nacional de Perinatología, Isidro Espinosa de los Reyes, México. 2005; pag 267.

4. Millar W.G.: A Clinical and pathological Study of placenta accreta. J. Obstet Gynaecol. Br. EMP CG: 353.

10. Revista Chilena de Ultrasonografía. Vol. 10, No. 3,⁄ 2007, Diagnóstico prenatal.

5. Dueñas O, Rico H y Rodríguez M. Actualidad en el diagnóstico y manejo del acretismo placentario. Rev Chil Obstet Ginecol 2007: 72 (4): 266 – 271.

50

7. Williams. Obstetricia 22va edición.

PANORAMA MÉDICO 2012

11. Elsevier Prog Obstet Ginecol. 1998;41:173-7. vol. 41 núm. 3, Acretismo placentario.

RESEÑA El acretismo placentario es una entidad que aumenta con la frecuencia de cesáreas previas, siendo ésta uno de los principales factores de riesgo conjuntamente con la placenta previa oclusiva total.


DIABETES MELLITUS

AUTORA: DRA. JÉSSICA MARTÍNEZ CANTOS Catedrática de la Unidad Académica de Medicina, Enfermería y Ciencias de la Salud

RESUMEN En la actualidad la Diabetes se considera una de las patologías crónicas más prevalentes y de mayor morbimortalidad a nivel mundial, por lo que es de suma importancia tener un enfoque adecuado de lo que la

GENERALIDADES El sistema de Salud Público clasifica a la Diabetes Mellitus dentro del grupo de enfermedades crónicas no transmisibles (1). Esta patología engloba un conjunto de síndromes de etiopatogenia multifactorial, en el cual el nexo común es el trastorno metabólico, de manera principal la hiperglicemia crónica y las alteraciones en el metabolismo lipídico y protéico (2); las causas más importantes de morbimortalidad de estos pacientes son las complicaciones cardiovasculares (3).

enfermedad engloba, su prevalencia, criterios diagnósticos, la clínica y las complicaciones tanto agudas como crónicas, además de la instauración de tratamiento adecuado de cada uno de sus tipos, lo que será de gran importancia una vez realizado el diagnóstico.

Sin embargo, existe aumento de su prevalencia - incidencia, la DM1 aumenta en todo el mundo a un ritmo alarmante del 3% anual, hay una epidemia severa de DM2 en niños a partir de 8 años de edad, sobre todo en etnias de alto riesgo incluso de América Latina (3). El número de personas que padecen Diabetes Mellitus se estimó en 35 millones en el 2000, las proyecciones indican que para el 2025 la cifra ascenderá a 64 millones, de los cuales 40 millones (62%) corresponderán a America Latina y el Caribe (4).

EPIDEMIOLOGÍA La DM es la enfermedad endócrina más frecuente y una de las principales causas de morbilidad y mortalidad en la sociedad contemporánea, la verdadera prevalencia es difícil de estimar (2).

La forma más frecuente es la DM tipo 2 que representa de manera aproximada 80 - 90% del total de casos, 5 - 10 % corresponden a casos de DM tipo 1, y el resto está constituido por otras causas.

DIABETES MELLITUS

51


Su prevalencia aumenta de forma rápida debido a los cambios en los hábitos de vida y mayor esperanza de vida de la población, hay que destacar que el 50 % de individuos con DM tipo 2 no han sido diagnosticados por el carácter silente de la enfermedad, mientras que el 20 % de pacientes en los que se determina DM tipo 2 presentan datos de complicaciones crónicas al momento del diagnóstico (2).

DIAGNÓSTICO Los criterios diagnósticos de DM empleados en la actualidad son de la Organización Mundial de la Salud, Federación Internacional de la Diabetes (OMS-FID Modificación Provisional 2010) y Asociación de Diabetología Americana (ADA 2010).

52

PANORAMA MÉDICO 2012

CRITERIOS DIAGNÓSTICOS DE DIABETES MELLITUS El comité de expertos de la ADA establece la siguiente clasificación: • DM Tipo 1: constituye al 5-10% del total, y aparece como resultado del déficit, habitualmente absoluto, de secreción de insulina debido a destrucción de las células B del páncreas (2). • DM Tipo 2: constituye el 80-90% del total, y aparece en sujetos que presentan resistencia a la insulina y déficit relativo de insulina. (2)

CLÍNICA • DM Tipo 1: se presenta a cualquier edad, sin embargo su mayor incidencia se observa en menores de 30 años, con mayor frecuencia en edad preescolar y especialmente prepuberal.


La etiología en el 90% es autoinmune, lo que se determina por la presencia de anticuerpos anti-islotes (ICA), antiGAD y anti-insulina. El 10% de los casos son idiopáticos (5).

cardiovascular, como hipertensión y dislipidemia, por lo que se hacer pesquisa de DM en estos individuos (6).

TRATAMIENTO DM tipo 2: El inicio de la sintomatología suele ser brusca, con síntomas cardinales atribuibles a la hiperglucemia de días o semanas de evolución, tales como poliuria, polidipsia, polifagia, astenia y pérdida de peso; en niños la diabetes puede manifestarse como enuresis secundaria. Los pacientes con DM tipo 1 suelen ser delgados o tener peso normal, no obstante se debe tener en cuenta que ni la edad mayor de 30 años, ni la presencia de obesidad excluyen el diagnóstico de DM tipo 1. (3)

TRATAMIENTO DM tipo 1: El tratamiento con insulina es necesario desde el diagnóstico de la enfermedad, tras su inicio existe con frecuencia un periodo de remisión parcial llamado “luna de miel” en el que las necesidades de insulina son bajas y el control metabólico es fácil de conseguir, este periodo puede durar desde pocos meses hasta incluso 2 años. (3)

CLÍNICA DM tipo 2: Suele comenzar en edades intermedias o avanzadas, la clínica cardinal se presenta de forma insidiosa a lo largo de semanas o meses, incluso es frecuente encontrar hiperglicemia en pacientes asintomáticos, en ocasiones debuta como una descompensación hiperosmolar; la mayoría de pacientes suelen presentar sobrepeso u obesidad (4). La escasa sintomatología clásica determina que, con alta frecuencia, se diagnostique tardíamente y en presencia de complicaciones crónicas. Este tipo de diabetes aumenta con la edad, obesidad e inactividad física, y habitualmente se asocia a otras patologías de alto riesgo

El tratamiento de los pacientes va dirigido a normalizar la glucemia y al control de los factores de riesgo cardiovascular que se asocian con frecuencia a esta enfermedad, como son: obesidad, HTA, hiperlipidemia, etc. Según las últimas recomendaciones el tratamiento de control dietético, actividad física y cambio en los hábitos de vida se deben acompañar, salvo contraindicación, de un sensibilizador de la insulina, la metformina, desde el momento del diagnóstico. En la mayor parte de casos, se produce fracaso secundario a los hipoglucemiantes orales tras varios años de evolución de la diabetes, por lo que es necesario iniciar tratamiento con insulina para controlar las cifras de glucemia (6).

COMPLICACIONES METABÓLICAS AGUDAS DE LA DIABETES MELLITUS: Coma hipoglucémico: se define como el síndrome causado por reducción crítica de aporte de glucosa al encéfalo que se caracteriza por alteración de conciencia y/o signología focal neurológica. Constituye una complicación frecuente del tratamiento hipoglicemiante del diabético, en especial de aquellos insulinodependientes. (7) Síndrome hiperglucémico hiperosmolar: se caracteriza por hiperglicemia, severa deshidratación, hiperosmolaridad asociada a compromiso de conciencia y ausencia de acidosis metabólica significativa. Afecta de preferencia a pacientes sin Diabetes Mellitus previa o con diabetes tipo 2. Tiene una elevada letalidad. (8)

DIABETES MELLITUS

53


Cetoacidosis diabética: síndrome causado por déficit de insulina y/o desenfreno de las hormonas catabólicas, que se caracteriza por hiperglicemia, deshidratación, desequilibrio electrolítico y acidosis metabólica. Afecta de preferencia a diabéticos insulino dependientes, sin embargo no es infrecuente en los no dependientes en condiciones de estrés metabólico. (9)

COMPLICACIONES CRÓNICAS DE LA DIABETES MELLITUS Retinopatía diabética: esta complicación crónica está estrechamente relacionada con el daño que la hiperglicemia es capaz de hacer especialmente en los capilares de la retina. Estos nuevos capilares son frágiles y se rompen con gran facilidad y dan origen a hemorragias mayores de inicio en la retina y luego en el cuerpo vítreo. (10) Es la hemorragia vítrea la responsable final de la ceguera en la mayoría de los diabéticos.

BIBLIOGRAFÍA 1. www.cenave.gob.mx/progacción/diabetes.pdf. 2. American Diabetes Association. Position statement. Standards of medical care in diabetes -2010. Diabetes Care 2010; 33 (Suppl 1): S11-S61. 3. World Health Association / International Diabetes Federation. Definition and diagnosis of diabetes mellitus and intermadiate hyperglicemia. Report of WHO/IDF consultation. 2006. www.who.int/topics/diabetes_mellitus/en/ 4. Entérate Ecuador. Com. Dr. Clemente Orellana Saens: incidencia, prevalencia, 26 de agosto 2010 5. Ministerio de Salud. Guía Clínica Diabetes Mellitus Tipo 1. 1st Ed. Santiago: Minsal, 2005. Clar C, Waugh N, Thomas S. Routine hospital admission versus outpatient and home care in children at diagnosis of type 1 diabetes mellitus (Cochrane Review). The Cochrane Library, 2, 2001. Oxford Update Software. (Ultima versión Miércoles 28 de Mayo, 2003). 6. Recommendations and rationale screening for type 2, diabetes mellitus in adults. U.S. Preventive Services Task Force (USPSTF).

54

PANORAMA MÉDICO 2012

Nefropatía diabética: causa el 44% de todas las insuficiencias renales terminales en el mundo occidental. Después de 5 años de diabetes, la hiperglicemia se traduce en cambios moleculares y estructurales, sobreviene una progresiva disminución del flujo plasmático renal y de filtración glomerular, que llevan al paciente a la insuficiencia renal terminal. (11) Neuropatía diabética: el daño que produce la hiperglicemia en los nervios periféricos no sólo ocurre precozmente en la Diabetes, sino que es extraordinariamente frecuente. También, por su naturaleza, puede producir una variada gama de manifestaciones clínicas. En estas circunstancias se observa disminución en la velocidad de conducción nerviosa. El edema también puede producir compresión de nervios que pasan por canales óseos inextensibles, como los pares craneanos (mononeuropatías), fenómeno reversible que puede ocurrir a poco de diagnosticada la Diabetes. (12)

7. Arteaga A. Maiz A., Olmos P. y Velasco N. Manual de Diabetes y enfermedades metabólicas. Dep. nutrición, diabetes y metabolismo. Escuela de Medicina. P. Universidad Católica de Chile. 1997 8. Sharp P., Johnston D.C., Mechanism of Hyperglicemiae and disorders of intermediarymetabolism. Diabetes. Ed. Pickup, Garreth and Willliams. Blackwell Scientific Pub. Oxford - England 1991, pg. 303 - 312. 9. Zammit V.A., Regulation of ketone body metabolism. A cellular perspective. Diabetes Rev.1994; 2 : 132 – 15 10. Besser GM, Bodansky HJ, Cudworth AG. Diabetes. An Illustrated Text. pp 25.5. 1988. by J.B. Lippincott Company. Philadelphia, U.S.A. 11. The pathogenesis of diabetic retinopathy and cataracts. Pickup J et. al, editors. Textbook of Diabetes. Vol. 2. 1991 by Blackwell Scientific Publications. Oxford, U.K. pp 564. 12. Larkins RJ, Dunlop ME. The hyperglycaemia and diabetic Diabetologia 1992; 35:499-504

link between nephropathy.


FRACTURA DE TERCIO DISTAL DE TIBIA

AUTORES: DR. JULIO GUAMÁN T. DR. PEDRO ESPINOZA G. Hospital Universitario Católico Cuenca - Ecuador

Resumen

presenta fractura radiológicamente.

Se realiza el reporte de un caso de fractura multifragmentaria de tercio distal de Tibia y la revisión bibliográfica de la misma; de un paciente de 41 años de edad que luego de traumatismo

confirmada

Palabra clave Fractura, Tibia, Membrana interósea, arteria nutricia.

INTRODUCCIÓN La tibia, destinada a soportar la carga del peso, tiene extensas áreas desprovistas de inserciones musculares, lo que determina una pobreza vascular; es notorio en la mitad distal del hueso. El rasgo de fractura del 1/3 medio o distal, con frecuencia compromete la arteria nutricia del hueso, agravando más el déficit vascular. La metáfisis inferior presenta una vascularización más empobrecida, si se considera que a ese nivel la arteria nutricia está terminando en su distribución y a ella no alcanza la vascularización epifisiaria distal. Está recubierta por su cara antero-interna sólo por el tegumento cutáneo. El rasgo de fractura oblicuo o helicoidal, con suma frecuencia desagarra la piel como un cuchillo.

Con frecuencia la fractura es el resultado de un traumatismo violento y directo; sorprende a la piel contra el plano óseo, duro, subyacente. Se desgarra la piel y se fractura el hueso. La acción de los músculos de la pierna es muy poderosa. En caso de fracturas de rasgo oblicuo o helicoidal (inestables), los músculos ejercen una acción contracturante intensa; esto determina que las fracturas sean de muy difícil reducción y extremadamente inestables. La membrana interósea, fuerte septum fibroso, fijo a la tibia y peroné desde sus extremos superior al inferior, le confieren una fuerte fijeza a los fragmentos de fractura, limitándose su desplazamiento axial y lateral. Sobre esta concepción anátomo-funcional se sustenta la seguridad de la estabilidad recíproca entre los fragmentos de fractura entre sí y con el peroné.

FRACTURA DE TERCIO DISTAL DE TIBIA

55


La firme solidaridad conferida a los extremos óseos por la membrana interósea, cuando queda intacta después de la fractura, es lo que le confiere la mayor confiabilidad al procedimiento terapéutico.

DEFINICIÓN Se considera como fractura de la diáfisis de la tibia, la que ocurre entre dos líneas imaginarias: la superior coincidente con el plano diáfiso-metafisiario proximal, y la inferior con el plano diáfiso-metafisiario distal. Las fracturas que ocurren por encima de este límite superior, corresponden a fracturas de la metáfisis superior de la tibia, o de los platillos tibiales; cuando ocurren por debajo del límite inferior, corresponden a fracturas de la metáfisis distal o del pilón tibial; y más hacia abajo ya son fracturas epifisiarias (tobillos).

CLASIFICACIÓN Se las clasifica desde 3 puntos de vista: 1. Según su localización: • del tercio superior • del tercio medio • del tercio inferior 2. Según la anatomía del rasgo: • Transversales - rasgo único • Oblícuas - rasgo doble • Espiroídeas - conminuta • Conminutas - con estallido 3. Según hayan sido provocadas por un traumatismo de: • Baja energía • Alta energía

56

PANORAMA MÉDICO 2012

La información dada según estas clasificaciones, unidas a datos clínicos como edad, daño mayor o menor de las partes blandas, mecanismo de la fractura, magnitud de la energía del traumatismo, posible exposición del foco de fractura, desviaciones de los fragmentos, etc., permitirán configurar un cuadro clínico muy exacto del caso en tratamiento, y que puede modificar sustancialmente el pronóstico y terapéutica a seguir.

Reporte del caso Paciente género masculino de 41 años de edad, estado civil soltero, de nacionalidad peruana, ocupación comerciante, religión católica, sin antecedentes quirúrgicos; 22 días antes de su ingreso presenta trauma con objeto contundente a nivel de extremidad inferior derecha luego de lo cual presenta edema, limitación funcional, dolor de moderada intensidad, siendo tratado en otro servicio de salud a base de analgésicos. Acude por consulta externa en donde se reveló: Rx con evidencia de fractura multifragmentaria distal de tibia; biometría y función renal normales, ECG normal. Con este diagnóstico el paciente fue sometido a osteosíntesis de Tibia.

Discusión El tratamiento de las fracturas distales de tibia es complejo y controversial. En la actualidad el de elección es el enclavamiento endomedular. Sin embargo, las fracturas del tercio distal de la tibia no tienen esta indicación específica, pues presentan mayor riesgo de mala unión con tasas que van del 5% al 58%. La información en la literatura especializada no dilucida esto con claridad y los estudios en donde se compara el manejo de las fracturas de tibia distal, muestran un bajo nivel de evidencia.


Zelle y colaboradores en una revisión sistemática de 1.125 fracturas de tibia distal no hallaron una diferencia significativa por la variedad en la metodología, presentando estudios observacionales con múltiples diferencias en los grupos de pacientes y en las indicaciones de cada tratamiento. Se registran fracturas abiertas en 28% con CE y un 4,9% en manejo con PP, sabiendo de antemano que esta condición es un factor determinante en el pronóstico de las fracturas diafisiarias de tibia, en un ensayo clínico aleatorio compararon el enclavamiento endomedular con reducción abierta y la fijación interna con placa utilizando técnica abierta, en el tratamiento de fracturas distales de tibia, concluyendo que es ventajoso el uso de CE cuando el trauma de tejidos blandos es severo y se puede tener mejor resultado con el uso de PP en lo referente al alineamiento postoperatorio. Cabe anotar que en este estudio se realizó la comparación utilizando técnica abierta con PP. Es importante aclarar que en la actualidad el procedimiento indicado para el manejo de fracturas diafisiarias distales de tibia con PP es mínimamente invasiva (MIPPO) dada su ventaja desde el punto de vista de conservación biológica, requerida por la anatomía subcutánea de la tibia y por la especial distribución anatómica de su circulación, que se afecta en mayor forma con la técnica abierta de osteosíntesis. Por lo tanto, actualmente no existen estudios comparativos de alto nivel de evidencia que describan la superioridad entre el CE o PP con técnica mínimamente invasiva. Revisando la estadística específica de las instituciones incluidas en el estudio en un lapso de tres años, se trataron 253 pacientes con fracturas diafisiarias de tibia. Es importante referir que dichas fracturas no estaban especificadas, sin embrgo, se considera que podrían corresponder de 20 a 30% del total de las fracturas de tibia, lo que evidencia una incidencia real baja.

La decisión en estas instituciones de usar clavo o placa se basa en la experiencia y preferencia del cirujano, considerando el estado de los tejidos blandos e inclinándose por el CE en pacientes con trauma de mayor energía y lesión severa de tejidos blandos, y utilizar la PP cuando hay trauma leve de tejidos blandos y evidencia de fractura simple.

Rx Lateral Tibia, Pre-operatorio

Rx A-P Pre-operatorio

Rx A-P Post-quirúrgico

FRACTURA DE TERCIO DISTAL DE TIBIA

57


Conclusión El diagnóstico cuidadoso y el tratamiento rápido y adecuado es recomendable para este tipo de lesión, luego de haber pasado el riesgo de infección, la reducción abierta y la fijación con placa y su posterior inmovilización logra buen resultado a largo plazo a pesar del tiempo transcurrido desde la fractura, al realizar una comparación. Rx lateral Post-quirúrgico

BIBLIOGRAFÍA: 1. Actualizaciones en cirugía Ortopédica y Traumatología, Vol. 7 Secot Ferrandez, Aula Magna. 2. http://alvaro-angel.tripod.com/tibia.htm 3. http://escuela.med.puc.cl/publ/ OrtopediaTraumatologia/Trau_Secc01/ Trau_Sec01_45.html

58

PANORAMA MÉDICO 2012

4. http://sid.usal.es/idocs/F8/ART8621/ fx.pdf 5. http://www.imbiomed.com.mx/1/1/ articulos.php?method=showDetail&id_ articulo=5142&id_seccion=153&id_ ejemplar=561&id_revista=26.

RESEÑA Es importante aclarar que en la actualidad el procedimiento indicado para el manejo de fracturas diafisiarias distales de tibia con PP es la mínimamente invasiva (MIPPO) dada su ventaja desde el punto de vista de conservación biológica...


DIAGNÓSTICO DE ASMA EN PACIENTES PEDIÁTRICOS MEDIANTE LA MEDICIÓN DE ÓXIDO NÍTRICO INHALADO Y ESPIROMETRÍA AUTORES: DRA. MARÍA ISABEL HERRERA JARAMILLO, DR. FRANZ GUERRERO Unidad Académica de Medicina, Enfermería y Ciencias de la Salud Departamento de Investigación

RESUMEN El asma es un proceso crónico inflamatorio de la vía aérea, que funcionalmente se caracteriza por presencia de hiperreactividad bronquial, y clínicamente se expresa por episodios recurrentes de sibilancias, tos y dificultad para respirar. La intensidad y frecuencia de los síntomas viene determinada por el grado de inflamación y obstrucción bronquial existente. Esta obstrucción es característicamente reversible. El diagnóstico inicial de asma es clínico: presencia de síntomas o historia familiar con manifestación de síntomas y atopía. Con el fin de identificar de manera precoz el fenotipo atópico es fundamental evaluar la atopía personal, la atopía en padres y determinar la sensibilización a alergenos alimentarios y respiratorios. Es necesario realizar también al inicio el análisis de sangre y pruebas alérgicas cutáneas frente a los antígenos más comunes o a los sospechados por el interrogatorio.

Una radiografía de tórax es recomendable realizar al principio del estudio para establecer un diagnóstico diferencial con otras potenciales enfermedades respiratorias que cursan con síntomas similares. No obstante, a pesar de los múltiples estudios ninguno de ellos es específico para el diagnóstico de asma. En la actualidad, se dispone de métodos específicos en unidades especializadas en asma, como la determinación del número de eosinófilos en el esputo inducido y la medición de la fracción exhalada de óxido nítrico, para medir el grado de inflamación de las vías aéreas inferiores. PALABRAS CLAVE Asma, diagnóstico, óxido nítrico exhalado.

DIAGNÓSTICO DE ASMA EN PACIENTES PEDIÁTRICOS

59


SUMMARY Asthma is a chronic inflammatory airway functionally characterized by the presence of bronchial hyperresponsiveness and clinically expressed by recurrent episodes ofwheezing, coughing and difficulty breathing . The intensity and frequency of symptoms is determined by the degree of inflammation and airway obstruction exists. This obstruction is characteristically reversible. The initial diagnosis of asthma is clinical: the presence of symptoms or history ofpresence of symptoms. In order to identify early the atopic phenotype is essential to evaluate atopy personal,atopy in parents and determine sensitization to food allergens and respiratory products.

INTRODUCCIÓN El asma es una enfermedad inflamatoria crónica de las vías respiratorias que se caracteriza por hiperreactividad bronquial y obstrucción más o menos reversible al flujo aéreo (1). Los objetivos que debe perseguir el tratamiento del asma están dirigidos tanto a la reducción del deterioro como del riesgo debido a la enfermedad (1). A pesar de que actualmente se dispone de potentes fármacos antiinflamatorios, los estudios epidemiológicos muestran reiteradamente que en todo el mundo, el asma continúa influyendo en forma negativa en la vida de los pacientes (2), sin que se cumplan los objetivos que recomiendan las guías de salud.

60

PANORAMA MÉDICO 2012

Is usual also perform initially blood and allergic tests cutaneous against antigens common orsuspected by interrogation. A chest radiograph is also recommended at baseline to establish a differential diagnosis with other potential respiratory diseases that present with similar symptoms. But despite the many studies none of them is specific for the diagnosis of asthma. Currently available in specialized asthma sophisticated methods, such as identifying the number of eosinophils in induced sputum and measurement of fraction exhaled nitric oxide, to measure the degree of inflammation of the lower airways. KEYWORDS Asthma diagnosis, exhaled nitric oxide.

Se calcula que anualmente 23 millones de estadounidenses acuden al médico debido a tos crónica, que es la tercera causa más común por la que los pacientes acuden a la consulta médica. La tos crónica se define como aquella tos prolongada que dura entre tres y ocho semanas. La mayoría de pacientes acuden al médico debido a que la tos interrumpe sus actividades cotidianas. En Ecuador, el asma se presenta con mayor frecuencia en la costa, principalmente en Guayas (16,7%) y Manabí (18,3%); y en la sierra, Pichincha (11,2%). En el mundo, 30% de la población infantil de entre 6 meses y 5 años pueden sufrir esta enfermedad crónica que inflama las vías respiratorias.


La contaminación ambiental, falta de un diagnóstico, tratamiento oportuno y predisposición genética extienden la enfermedad hasta la edad adulta. Se afirma que si se diagnostica a tiempo, el problema se supera en meses. El objetivo del tratamiento es prevenir las crisis que pordrían causan la muerte por obstrucción de las vías respiratorias. El diagnóstico de asma está dada por la existencia de síntomas compatibles, asociados a limitación del flujo de aire a través de los bronquios. El diagnóstico de asma en niños pequeños se basa sólo en la presencia de síntomas. En edades precoces el único marcador biológico de atopía puede ser la sensibilización a alimentos por lo que antes de los 6 años de vida es un error evaluar solo sensibilización a neumoalergenos. Desde este punto de vista se deben emplear pruebas que evalúen ambos tipos de alergenos, determinación de IgE especificas frente a alergenos prevalentes. Estos índices empleados en el diagnóstico, son inespecíficos. La ausencia de parámetros objetivos conduciría a situaciones indeseables de infra o supratratamiento y podría ser una de las causas del no adecuado control del asma. Se impone la necesidad de disponer de índices objetivos. Sería deseable contar con un parámetro que mida de forma no invasiva la inflamación de las vías respiratorias. Actualmente, es posible ser objetivo en atención primaria, mediante estudios complementarios, la mayor parte en los componentes definitorios del asma: espirometría (obstrucción y reversibilidad), medición de oxido nítrico (inflamación eosinófila) y estudio alérgico (atopía).

La medición objetiva de la función pulmonar es, junto con la clínica, el pilar del diagnóstico de asma, siendo la espirometría forzada el método básico para el estudio de la función pulmonar en la edad pediátrica. Esto permite medir volúmenes y flujos que se generan en el curso de una maniobra voluntaria de espiración forzada. El diagnóstico se confirma realizando una serie de pruebas en función pulmonar. Se debe confirmar la existencia de obstrucción bronquial a realizar la espirometría. Esta prueba se debe completar mediante la administración de un broncodilatador en aerosol y repetición de la espirometría. De esta forma se pone de manifiesto si la obstrucción es o no reversible que, como mencionamos previamente, es una característica que forma parte de la definición de asma. Otra prueba que actualmente se usa para diagnóstico de asma es la medición de Oxido Nítrico exhalado (FENO), que contribuye a identificar la inflamación eosinófila, y por lo tanto, el fenotipo de asma atópico. El óxido Nítrico también llamado monóxido de nitrógeno NO, es un gas producido por las células epiteliales que recubren el interior de las vías aéreas altas. El asma es una enfermedad inflamatoria de las vías aéreas y el óxido nítrico es un parámetro que indica con fidelidad el grado de inflamación. Si bien las personas sin asma tienen niveles de NO en el aire exhalado de 10 - 20 ppb (partículas por billón), en las asmáticas oscila entre 25-80 ppb. La medición de óxido nítrico se realiza a través de un sofisticado dispositivo que con quimioluminiscencia es capaz de determinar en pocos segundo la concentración de este gas en el aire espirado del paciente.

DIAGNÓSTICO DE ASMA EN PACIENTES PEDIÁTRICOS

61


Para ello se tiene que: • Realizar una espiración profunda. • A continuación una inspiración a través de la boquilla del aparato que le proporciona un aire sin NO. • Por último, una espiración mantenida durante 10 segundos. Una aguja indica si el flujo espirado es el adecuado, que en los adultos debe permanecer en la zona verde. En los niños el indicador es un globo que se debe mantener entre 2 líneas. En la actualidad existen medidores portátiles de Oxido Nítrico (NioxMino) que permiten a nivel de atención primaria, determinar el FENO de una forma fiable. La medición requiere de la colaboración del niño y suele ser fiable a partir de los 7-8 años.

La medición de NO con el Niox es fiable, ha sido aprobada por la European Respiratory Society (ERS), American Thoracic Society (ATS) y la FDA.

62

PANORAMA MÉDICO 2012

La prueba del oxido nítrico tiene sensibilidad del 85% y especificidad del 90% para predecir el asma. Completada con la espirometría la sensibilidad es del 94% y la especificidad del 93%. La medición del FENO se indica para el diagnóstico de asma. 1. El oxido nítrico se eleva cuando existe inflamación bronquial, situación típica en el asma. La elevación de oxido nítrico se produce especialmente, en la inflamación eosinófila, es decir, se relaciona con la atopía. Esto quiere decir que es un excelente marcador del asma atópico, el fenotipo de asma infantil. 2. Hasta la fecha, la toma de decisiones terapéuticas relacionadas con tratamiento antiinflamatorio para el asma, se basa en datos indirectos (estado clínico, función pulmonar). En esta situación, el pediatra debe “visualizar" cuando es conveniente la introducción, aumento o disminución de dosis y finalización de corticoides inhalados, antileucotrienos, etc. La medición del oxido nítrico permite establecer si el bronquio está inflamado y por lo tanto ajustar las decisiones de lo que ocurre en realidad en los bronquios del paciente (1-2), permitiendo una valoración no invasiva de la inflamación bronquial. Además, cuando se sigue de forma longitudinal a un paciente, las variaciones en el valor del FENO puede indicar pérdida de control de la enfermedad, el grado de adherencia al tratamiento, etc. Esta técnica posee numerosas ventajas para los pacientes que tienen o han tenido síntomas de asma.


Permite reducir los corticoides: Los corticoides inhalados son en la actualidad el tratamiento más eficaz para controlar la inflamación bronquial. Esta medicación a menudo debe tomarse durante años, de esta forma se consigue prevenir los síntomas, el daño bronquial y la mortalidad. La dosis de corticoides que recibe el paciente varía de 100 a 2000 µg/día en función de la gravedad del asma. Esta dosis es modificada por el médico cada 2-6 meses en función de una serie de parámetros. No obstante, en forma reciente se ha evidenciado que la determinación de NO es más eficaz que todos los parámetros anteriores, lo que permite reducir casi el doble la dosis de corticoides y prevenir en igual cantidad el número de agudizaciones por asma. Este dato es extremadamente importante, pues los corticoides inhalados aunque en general representan una medicación bastante segura, no están exentos de efectos secundarios, como retraso en el crecimiento, hipofunción de las glándulas suprarrenales, descalcificación de los huesos y desarrollo de cataratas, en especial cuando se utilizan en dosis altas. Con el Niox se puede ajustar con precisión la dosis de corticoides necesaria, en general se puede reducirlos a la mitad y así evitar un exceso de medicación que se traduciría en más efectos secundarios y mayor costo. Detecta si toma la medicación: Este hecho es importante para adolescentes que con frecuencia dejan de tomar su medicación preventiva y abusan de la medicación de rescate, lo que desgraciadamente se asocia a agudizaciones graves e incluso a veces mortales. Aunque el adolescente no refiera que su asma está mal y/o que no toma la medicación, el Niox lo detectará.

Previene agudizaciones: Un incremento del NO del 60% se asocia con 80% de posibilidades de sufrir una agudización del asma. Por ello, la medición rutinaria del NO en cada visita permite al especialista adelantarse al ataque aumentando la medicación para prevenir asistencias en urgencias y/o hospitalizaciones por asma. Evita falsos diagnósticos de asma: Muchas enfermedades respiratorias pueden producir síntomas parecidos a los de asma. El diagnóstico diferencial es difícil en los niños donde la tos y sibilancias son muy frecuentes. Si el paciente presenta un NO bajo a pesar de no recibir corticoides, debe dudarse que se trate de asma. Gracias al Niox se han podido suspender tratamientos con corticoides en pacientes erróneamente diagnosticados de asma. Cuando el FENO < 12 ppb, el asma puede ser excluido con un Valor Predictivo Negativo de 81%.

UTILIDADES ADICIONALES DEL ÓXIDO NÍTRICO 1. Predice la pérdida de control de la enfermedad. Si el nivel de FENO de un paciente aumenta más de 60% de una visita a otra, incluso en la ausencia de síntomas de asma, tiene valor predictivo positivo de más de 80% de un inminente empeoramiento del asma (3) . 2. Un valor próximo a 50 ppb identifica alto riesgo de recidiva (4). 3. Ayuda a identificar incumplimiento o inhalatoria (5).

situaciones de mala técnica

La medición de FENO proporciona una herramienta fácil de utilizar y no invasiva para supervisar el cumplimiento del tratamiento con corticoesteroides (5).

DIAGNÓSTICO DE ASMA EN PACIENTES PEDIÁTRICOS

63


VALORES DE REFERENCIA DEL ÓXIDO NÍTRICO • Adultos sanos: entre 5 y 20 ppb • Niños sanos (menores de 12 años): entre 5 y 15 ppb • Criterio de inflamación bronquial: 20 ppb y superior • Criterio de riesgo de reagudización: 49 ppb y superior • Criterio de pérdida de control: aumento de 60% de valor respecto a la vista previa (con un valor predictivo positivo de 80%) • Ningún otro estudio complementario es condición sine quanon para un correcto diagnóstico de asma. La petición de estos se basará en la necesidad de descartar diagnósticos alternativos o concomitantes.

SEGUIMIENTO Se debe proporcionar a niños y adolescentes con asma un seguimiento regular, dentro de un programa previsto a tal fin.

A pesar de todas las bondades de estos métodos, hasta el momento en el Ecuador, no se tienen datos estadísticos de los pacientes asmáticos y su forma de diagnóstico, debido a que según las fichas médicas revisadas los diagnósticos hasta ahora realizados han sido sólo basados en datos inespecíficos como el cuadro clínico que puede ser similar a otra patología respiratoria, al igual que la radiografía de tórax y exámenes complementarios, que pueden dar muchos diagnósticos falsos positivos o negativos y, lo que es más peligroso, en tratamiento.

MATERIALES Y MÉTODOS Se realizó estudio retrospectivo revisando historias clínicas de pacientes que acudieron a consulta externa de Pediatría del Hospital Universitario Católico de Cuenca en un período de seis meses.

RESULTADOS Al examinar las fichas clínicas de los pacientes pediátricos que comprende en la edad de 0 a 16 años se encuentra:

La mayor parte podrán ser seguidos desde la atención primaria pediátrica, quedando el nivel hospitalario la unidad de asma (neumología y/o alergología infantil) para seguimiento de casos concretos (asma grave). En toda situación deberá estar asegurada la coordinación entre niveles, así como las pautas de actuación conjuntas (métodos diagnósticos, educativos y terapéuticos). En cada visita se debe incluir: historia clínica del intervalo, exploración, medición de la función pulmonar cuando la edad lo permita (espirometría preferentemente), valoración de oxido nítrico y las actividades educativas pertinentes.

64

PANORAMA MÉDICO 2012

En el presente cuadro se encuentra que la principal patología por la que acuden los pacientes pediátricos al Hospital Universitario


Católico son las Enfermedades Respiratorias en un 40,71% con lo que se comprueba que la patología respiratoria es la primera causa de morbilidad en edad pediátrica.

El 59,29 % restante corresponde a patologías gastrointestinales, neurológicas, anemias, desnutrición, trastornos hidroelectrolíticos, etc. Los resultados son similares a los de otras partes del mundo, en donde la principal causa de morbimortalidad es la patología respiratoria.

De los pacientes con patologías respiratorias atendidos 24,07% fue diagnosticado de asma, lo que comprueba el porcentaje descrito para ciertas provincias del Ecuador; al revisar las fichas se encuentra que el diagnóstico se realizó solo con datos inespecíficos como manifestaciones clínicas, radiografías de tórax, exámenes de sangre, etc… que se conoce son determinantes para el diagnóstico certero de asma, nos queda duda como Pediatras, si existe o no sobre diagnóstico.

CONCLUSIÓN El adecuado y temprano diagnóstico de asma marca la diferencia en la calidad de vida de los niños, al ser una patología tan frecuente que se debería luchar por adquirir estos métodos que permiten a diagnosticar de una manera precisa y dar tratamientos oportunos y adecuados. La medición del óxido nítrico es un método muy popular en otras partes del mundo, inclusive en países de América Latina, sin embargo se desconoce en nuestro medio, por lo que se hace necesario que las instituciones de salud busquen innovar esta forma de diagnóstico para ser pioneros de un adecuado análisis y tratamiento de una patología tan frecuente en el país.

DIAGNÓSTICO DE ASMA EN PACIENTES PEDIÁTRICOS

65


BIBLIOGRAFÍA: 1. National, Asthma. Education and Prevention Program. Expert Panel Report 3 (EPR-3): Guidelines for the Diagnosis and Management of Asthma [internet]. Bethesda, MD: National Institutes of Health: National Health, Lung and Blood Institute; 2007. Publication No. 07-4051 [accessed 2007 Dec 30] http://www.nhlbi.nih.gov/guidelines/ asthma/asthgdln.htm. 2. Rabe K, Adachi M, Lai C, Soriano J, Vermeire P, Weiss K et al. Worlwide severity and control of asthma in children and adults: the global asthma insights and reality surveys. J Allergy Clin Immunol 2004; 114: 40-47. 3. Global. strategy for asthma management and prevention (GINA). In: National Institute of Health, Lung and Blood, editor. NHLBI/WHO workshop report. Washington DC; Revised 2006. 4. Cabañes Higuero N, Fernández Meléndez S, Vega Chicote J, Jiménez Lara M. Aspectos clínicos del asma: presentación habitual. Formas de presentación atípica y diagnóstico diferencia. En Peláez Hernández A, Dávila González IJ; Tratado de Alergología Vol. 1. ISBN: 978-84-8473576-2; pp 645-654.

66

PANORAMA MÉDICO 2012

5. Fahy JV, Liu J, Wong H, Boushey HA. Cellular and biochemical analysis of induced sputum from asthmatic and from healthy subjects. Am Rev Respir Dis 1993; 147: 1126-1131. 6. Pizzichini E, Pizzichini MM, Efthimiadis A, Hargreave FE, Dolovich J. Measurement of inflammatory indices in induced sputum: effects of selection of sputum to minimize salivary contamination. Eur Respir J 1996; 9: 1174-1180. 7. Olaguíbel J, Álvarez M, García B, Tabar A, Urbiola E. The study of the inflammation of the airway in bronchial asthma by cytological and chemical analysis in the fluid phase of samples taken by sputum induction. An Sist Sanit Navar 1998; 21: 173-186. [ Links ] 8. Álvarez MJ, Olaguíbel JM, García BE, Rodríguez A, Tabar AI, Urbiola E. Airway inflammation in asthma and perennial allergic rhinitis. Relationship with nonspecific bronchial responsiveness and maximal airway narrowing. Allergy 2000; 55: 355-362.

RESEÑA A pesar de todas las bondades de estos métodos, hasta el momento en el Ecuador, no se tiene datos estadísticos de los pacientes asmáticos y su forma de diagnóstico...


ANTÍGENOS LEUCOCITARIOS DE HISTOCOMPATIBILIDAD EN TRASPLANTES DE MÉDULA ÓSEA POR EL MÉTODO PCR-SSP AUTORES: DRA. YOLANDA VANEGAS COBEÑA DR. LEONARDO MORALES VANEGAS Médica Especialista en Biotecnología, Mención Biología Molecular e Ingeniería Genética

RESUMEN Estudio de 50 casos que han ido al laboratorio de Biología Molecular Bioncogen. Cuenca 2009-2010 Objetivo Determinar la similitud de los antígenos leucocitarios de histocompatibilidad en trasplantes de médula ósea entre donantes y receptores hermanos. Universo y muestra Se estudió 50 casos en el Laboratorio de Biología Molecular “Bioncogen” de Cuenca en 2008-2009, 25 donantes y 25 receptores. Métodos Se obtuvo una muestra de sangre periférica de cada persona de la que se separaron los linfocitos por gradiente de densidad mediante centrifugación. Se procedió a la extracción de ADN y tipificación de HLA tipo I y II mediante la técnica molecular PCR-SSP que utiliza primers específicos. Los amplicones se analizaron por medio de electroforesis en gel de agarosa.

Resultados Se demostró que la compatibilidad entre hermanos es baja (28%), lo cual concuerda con los resultados Mendelianos de la herencia, (25% de hermanos son idénticos en su expresión de HLA), y con estudios realizados en Cuba en el “Instituto de Hematología e Inmunología” publicados en la Revista Hematol Inmunol Hemoter 2002 (resultado de la compatibilidad de 33%). Considerando el tipo de leucemia existen leucemia mieloide crónica (LMC) 42.86%; leucemia mieloide aguda (LMA) 50%; leucemia linfoblástica aguda de células B (LLAB) 21.43%; leucemia linfoblástica aguda (LLA) 0%. Según sexo: mujer-mujer 33.33%, hombrehombre 27.27%, mujer-hombre 100%, hombre-mujer 20%. Palabras clave Compatibilidad, antígenos de Histocompatibilidad, moléculas, trasplante, herencia, haplotipos, PCR, genes, linfocitos, alelos, injertos.

ANTÍGENOS LEUCOCITARIOS DE HISTOCOMPATIBILIDAD EN TRASPLANTES

67


ABSTRACT Study of 50 cases that have gone to Bioncogen Molecular Biology Laboratory. basin in Cuenca, 2009-2010 Objective Determining the similarity of the histocompatibility leukocyte antigens in bone marrow transplant donor-recipient brothers. Universe and Sample 50 cases were studied in the Laboratory of Molecular Biology "Bioncogen" Basin in Cuenca in 2008-2009, 25 donors and 25 recipients. Methods We obtained a blood sample from each person from whom the lymphocytes were separated by density gradient centrifugation. We proceeded to DNA extraction and HLA typing of type I and II by PCR-SSP molecular technique using specific primers. The amplicons were analyzed by agarose gel electrophoresis.

INTRODUCCIÓN Este estudio consideró la necesidad creciente de trasplantes de médula ósea en el tratamiento de neoplasia hematológica y su dificultad por el rechazo de receptores a donantes debido a los antígenos de histocompatibilidad, moléculas que varían de individuo a individuo, y por eso se necesita 100% de compatibilidad o al menos un porcentaje elevado (90% o más) para su aceptación. Se tipificó HLA (Antígeno Leucocitario Humano) tipo I y II en el paciente y un hermano donante potencial para determinar

68

PANORAMA MÉDICO 2012

Results It was shown that the compatibility between siblings is low (28%), consistent with the results of Mendelian inheritance (25% of siblings are identical in their expression of HLA), and studies in Cuba in the "Institute Hematology and Immunology" published in Hemoter Hematol Immunol 2002 (result of the compatibility of 33%). Considering the type of leukemia, have chronic myeloid leukemia (CML) 42.86%, acute myeloid leukemia (AML) 50% acute lymphoblastic leukemia B cells (LLAB) 21.43%, acute lymphoblastic leukemia (ALL) 0%. By sex: female-female 33.33%, 27.27% manman, man-woman 100%, 20% male-female. Keywords Compatibility, Histocompatibility antigens, molecules, transplantation, inheritance, haplotypes, PCR, genes, cells, alleles, grafts.

un porcentaje de afinidad que podría servir como guía en la futura selección de donantes. Se recolectó la muestra de sangre periférica del paciente y del donante, de la que se separaron los linfocitos a través de centrifugación para luego proceder a la extracción del ADN (Ácido Desoxirribonucleico) y tipificación de HLA tipo I y tipo II por medio de PCR-SSP (Polimerasa Chain Reaction- Single Strand Primers) que es una reacción que amplifica el ADN de las diferentes tipos de HLA presentes utilizando primers específicos.


Se utilizó un marcador de peso molecular y un ADN patrón, se procedió a identificar los alelos existentes tanto en el donante como en el receptor para luego establecer el porcentaje de compatibilidad entre hermanos.

descubrimiento del MHC se llevó a cabo por estudios de transfusiones sanguíneas y trasplantes de órganos en ratones.

Los primeros genes descubiertos, por técnicas exclusivamente serológicas, fueron HLA-A, HLA-B y HLA-C. Luego a través de técnicas de “Reacción leucocitaria mixta” (MLR) se vio que los Este estudio consideró la necesidad leucocitos del receptor creciente de trasplantes de médula reaccionaban frente a los del ósea en el tratamiento de neoplasia donante; el primer gen identificado hematológica y su dificultad por el con esta técnica se encontraba adyacente al locus del HLA, por lo rechazo de receptores a donantes que se llamó HLA-D, luego se debido a los antígenos de identificó a la molécula de este gen histocompatibilidad, moléculas que y se la bautizó como HLA-DR (HLAvarían de individuo a individuo... D related). Finalmente se descubrieron dos genes más, y se los llamó HLA-DQ y HLA-DP.

REVISIÓN BIBLIOGRÁFICA Descubrimiento del MHC - HLA Durante la embriogénesis se da un proceso de “selección” de células T en el timo: se eliminan las células T que reaccionan contra los antígenos propios con la ayuda de moléculas de MHC; las células T potencialmente capaces de reconocer antígenos extraños se seleccionan para su sobrevivencia. La falla en este proceso (reconocer lo propio como extraño), puede resultar en enfermedad autoinmunitaria, mientras que la falla para reconocer antígenos ajenos puede dar como resultado inmunodeficiencia con infecciones diseminadas y quizá la proliferación incontrolada de tumores. Cuando se trasplanta un tejido o un órgano, pueden ocurrir dos cosas, que el sistema inmunitario reaccione contra éste y lo rechace, o que sea aceptado. El MHC se nomina según la especie animal, en el humano se llama HLA, en el conejo RLA (Rabbit leukocyte antigens), en el cerdo PLA (Pig leukocyte antigens)... En los humanos, el

Los genes en el rechazo a injertos, identificados serológicamente en humanos (HLA-A, HLA-B, HLA-C) se agrupan bajo el nombre de genes de clase I del MHC, en tanto que los genes humanos detectados por MLR (HLA-DP, HLA-DQ, HLA-DR) se conocen como genes de clase II del MHC. Todos estos se encuentran ubicados en el brazo corto del cromosoma 6 y se expresan de modo codominante, de esta manera amplía más la diversidad. Actualmente, se sabe que existen diferencias individuales respecto a los alelos del HLA y que son determinantes importantes de la reacción frente a tejidos extraños, así como en la activación linfocitaria. ORGANIZACIÓN DE LOS GENES DEL MHC El complejo HLA ocupa un segmento de 3,500 kilobases en el brazo corto del cromosoma 6. Los loci genéticos HLA-A, -B y -C determinan las moléculas clase I que llevan los antígenos clase I y las subregiones

ANTÍGENOS LEUCOCITARIOS DE HISTOCOMPATIBILIDAD EN TRASPLANTES

69


genéticas HLA-DR, -DQ y -DP cada una de las cuales contiene varios locis adicionales, determina las moléculas de clase II que llevan los antígenos de tipo II. FUNCIÓN DE LA MOLÉCULA HLA CLASE I Estas moléculas están en todas las células nucleadas y en las plaquetas. Para que un antígeno sea reconocido por un linfocito CD8, el antígeno deberá reconocerse en combinación con una molécula de clase I. Por ejemplo, cuando un virus infecta una célula, ciertos antígenos virales se metabolizan hasta fragmentos peptídicos que se unen a la molécula clase I y los presentan a las células T citotóxicas, las cuales luego del reconocimiento, matan a la célula en diana que lleva el antígeno viral. En condiciones no fisiológicas del trasplante, las moléculas clase I ajenas son reconocidas por el linfocito T tipo CD8 del receptor y se produce el rechazo del injerto. FUNCIÓN DE LAS MOLÉCULAS DE CLASE II Éstas se distribuyen principalmente sobre las células inmunocompetentes: linfocitos B, células presentadoras de antígeno (macrófagos y células dendríticas) y, en humanos, células T activadas. Su función es presentar los péptidos antigénicos procesados a los linfocitos T CD4 al inicio de la respuesta inmunitaria. En condiciones no fisiológicas de trasplante de médula ósea, las moléculas clase II que han unido péptidos antigénicos no identificados sobre la célula del receptor, despiertan una respuesta de la célula T trasplantada del donador, lo que da como resultado una reacción de injerto contra huésped.

70

PANORAMA MÉDICO 2012

GENÉTICA DEL SISTEMA HLA Los genes del sistema HLA se heredan en forma Mendeliana autosómica y codominante. Existen 4 posibilidades genotípicas en la descendencia de una pareja lo que se traduce en una probabilidad de un 25% que dos hermanos sean HLA idénticos, 50% que sean HLA haploidénticos y 25% que no compartan ningún haplotipo. APLICACIÓN CLÍNICA: INMUNOLOGÍA DE LOS TRASPLANTES El trasplante es el proceso de tomar células, tejidos u órganos (injertos), de un individuo (donante) y colocarlos en otro distinto (receptor o huésped). Los injertos pueden ser del mismo individuo (injerto autógeno), de otro de la misma especie (injerto alogénico) o incluso de individuos de distintas especies (injerto xenogénico). La mayor limitación respecto a los trasplantes es la respuesta inmunitaria que desencadena el huésped frente a los tejidos del donante, que lleva al fracaso del injerto por una reacción inflamatoria (rechazo). La mayor frecuencia en nuestro medio es en neoplasias hematológicas: leucemias y trasplante de médula ósea.

MÉTODO Recolección de muestras Se trabajó con 50 muestras de sangre periférica obtenidas de una vena superficial preferentemente del brazo o antebrazo. Tipo de estudio La presente investigación utilizó un estudio descriptivo. Criterios de inclusión 1. Pacientes con neoplasia hematológica. 2. Ser hermanos.


Criterios de exclusión 1. Pacientes que no presenten neoplasia hematológica.

Gráfico 2. Compatibilidad de acuerdo al tipo de leucemia

2. Que no sean hermanos.

RESULTADOS Nota: los casos con rojo significan compatibilidad y los negros no compatibles.

Fuente: Investigación. Elaboración: Autora

Gráfico 3. Compatibilidad de acuerdo al sexo

Fuente: Investigación. Elaboración: Autora

Gráfico 1. Compatibilidad general de todos los casos

Fuente: Investigación. Elaboración: Autora

Fotografía 1. Ortiz G2/218 (receptor) 100% compatibilidad

Fuente: Investigación. Elaboración: Autora

ANTÍGENOS LEUCOCITARIOS DE HISTOCOMPATIBILIDAD EN TRASPLANTES

71


DISCUSIÓN – CONCLUSIONES La compatibilidad entre donadores y receptores hermanos es muy baja, ya sea por el tipo de leucemia o por el sexo. Esto va acorde a la herencia Mendeliana: solo un 25% de hermanos es idéntico en HLA. Cada individuo porta su propia identidad genética manifestada en los diferentes tipos de HLA o antígenos de histocompatibilidad. Estas moléculas difieren entre madre e hijo, padre e hijo, hermanos (excepto gemelos idénticos), de ahí el gran polimorfismo y la dificultad de encontrar donante y receptor compatibles (por lo menos el 90% de identidad HLA).

Comparado con estudios en Cuba, se encuentran cifras cercanas en los resultados pues se halla un porcentaje de 33%. En posteriores trabajos sería importante estudiar un número mayor de casos, para tener un muestreo significativo, para esto se debería trabajar en equipo con varias instituciones de salud, públicas o privadas y con número similar de acuerdo a la muestra a realizarse el diagnóstico. Mediante la técnica de PCR-SSP se ha establecido compatibilidad entre receptor y donante hermanos de una forma sencilla y rápida.

BIBLIOGRAFÍA 1. Regueiro J., López C.,González S.,Martínez E., Biología y patología del sistema inmune. Ed. Médica Panamericana McGraw - Hill. III Ed. España- Madrid. 2008 pp 16, 65 - 67; 69, 70; 167 – 170 2. Rojas William. Inmunología de Rojas. Ed. Corporación para Investigaiones Biológicas. XV Ed. Medellin, Colombia, 2010, pp 107 – 115. 3. Delivery of Exogenous Protein Antigens to Major Histocompatibility Complex Class I Pathway in Cytosol . The Journal of Infectious Disease 185:244-51, 2008. 4. Hematología. Página 187 de Francisco Cuéllar Ambrosi, Francisco Falabella Falabella, 2006, pág. 299.

72

PANORAMA MÉDICO 2012

5. Rev Cubana Hematol Inmunol Hemoter 2006;18(3): Instituto de Hematología e Inmunología, Estudio de la compatibilidad por métodos serológicos (HLA) y celulares (CML) en 22 años de trabajo en el Instituto de Hematología e Inmunología Lic. Luz M. Morera Barrios, Dr. Catalino R. Ustáriz García, Lic. Ana María Guerreiro Hernández, Lic. Lázaro O. del Valle Pérez, Dra. Consuelo Macías Abraham, Dra. Marta Paradoa Pérez y Dra. Elvira Dorticós Balea. http://www.bvs.sld.cu/revistas/hih/ vol18_3_02/hih04302.htm 6. González A., Principios de bioquímica clínica y patología molecular, Barcelona, Ed. Elsevier España, S.L., 2010, pp. 37-38.

RESEÑA La compatibilidad entre donadores y receptores hermanos es muy baja, ya sea por el tipo de leucemia o por el sexo. Esto va acorde a la herencia Mendeliana: solo un 25% de hermanos es idéntico en HLA. Cada individuo porta su propia identidad genética manifestada en los diferentes tipos de HLA o antígenos de histocompatibilidad.


SHOCK HIPOVOLÉMICO

AUTOR: DR. ELVIS ERREYES MACAS Universidad Católica de Cuenca

RESUMEN

SUMMARY

El shock hipovolémico es una patología muy frecuente en la práctica clínica, de pronóstico grave y que la mayoría de veces suele ser secundario a hemorragia, su presencia representa un gran desafío para el médico quien debe estar entrenado en reconocerla clínicamente y tratarla con la mayor rapidez y precisión, empleando soluciones de cristaloides, coloides, sangre o sus derivados; ya que en etapas iniciales el proceso es reversible pero un retraso en el tratamiento es inevitablemente letal. La selección de las soluciones y agentes vasopresores todavía continua en discusión.

Hypovolemic shock is a very common disease in clinical practice and poor prognosis and most of the time is usually secondary to bleeding, their presence represents a major challenge for the physician who must be trained to recognize and treat clinically most quickly and accurately using crystalloid solutions, colloids, blood or blood products, because in early stages the process is reversible but a delay in treatment is inevitably fatal. The choice of vasopressor agents solutions and continuous still under discussion. KEYWORDS Shock, hypovolemia, hemorrhage, trauma, wound.

PALABRAS CLAVE Shock, hipovolemia, hemorragia, trauma, herida.

DESCARGOS DE RESPONSABILIDAD: La presente revisión bibliográfica contiene los datos más relevantes a criterio del autor y ha sido cuidadosamente transcrito tratando de mantener la información original, no obstante ante posibles errores u omisiones no intencionados y debido al constante desarrollo de la ciencia médica el autor no garantiza que el presente artículo contenga la información completa tampoco se hace responsable por los resultados que se obtengan con la presente información, sugiriendo al lector consultar la bibliografía proporcionada u otras fuentes a convenir.

SHOCK HIPOVOLÉMICO

73


INTRODUCCIÓN En la actualidad la patología traumática constituye la primera causa de muerte en personas de edad reproductiva pues el número de muertes aumenta cada vez más, a tal escala que representa la cuarta causa de muerte en la población general seguida de la diabetes mellitus, cáncer y cardiopatía isquémica (1).

CLASIFICACIÓN DEL SHOCK Existen varias formas de clasificarlo, sin embargo de una forma semejante a la concebida por Blalock en 1934 (9), el shock desde el punto de vista etiológico se clasifica en: • Shock Hipovolémico • Shock Cardiogénico • Shock Obstructivo

La Organización Mundial de la Salud para el año 2000 calculó que de la mortalidad anual total el 9% (5 millones) se relaciona con trauma (2), y como es conocido muchos de estos pacientes politraumatizados presentan algún signo de shock (3). Dentro de los tipos de shock, el hipovolémico es el más común (4), y la hemorragia suele ser la causa más frecuente en estos pacientes (5). Estos datos impresionantes son la razón fundamental a efectuar la presente revisión bibliográfica con la finalidad de mantener un constante aprendizaje del shock hipovolémico, cuya correcta aplicación podría influir en las estadísticas actuales.

DEFINICIÓN Es un síndrome clínico multifactorial, agudo y progresivo caracterizado por flujo sanguíneo insuficiente que conlleva al transporte inadecuado de nutrientes y oxígeno hacia la célula alterándo su metabolismo normal (6-7). En su etapa inicial este proceso es reversible no obstante, si cuando la perfusión inadecuada se mantiene, se produce hipoxia celular que conlleva a un metabolismo anaerobio (8) con producción de acido láctico regional, posteriormente el daño se extiende a los órganos diana llevándo al fracaso y finalmente a la muerte celular (7).

74

PANORAMA MÉDICO 2012

• Shock Distributivo* *También denominado vasógeno o de baja resistencia (10).

SHOCK HIPOVOLÉMICO Se denomina así a la disminución del volumen intravascular debido a pérdida de uno de los siguientes: sangre entera (la más común), plasma, agua y electrolitos o una combinación de estos elementos (11); la pérdida puede ser obvia como suele ocurrir durante una hemorragia externa, o puede ser tan sutil como la pérdida de líquido por transferencia hacia un espacio no funcional, “tercer espacio” (12).

ETIOLOGÍA Varios son los factores que pueden originar un shock hipovolémico, de manera general se cita los siguientes: Pérdida de sangre Heridas, trauma, hemoptisis, hematomas, fracturas, hemotórax, hemoperitóneo, hemorragia retroperitoneal, hemorragia digestiva, hematuria, etc. Pérdida de plasma Dermatitis exfoliativa, quemaduras extensas, cirugía abdominal, etc.


Pérdida de agua y electrolitos A través de la piel diaforesis excesiva, golpe de calor; a nivel del tubo digestivo aspiración, vómito, diarrea, íleo, obstrucción intestinal; por vía renal diabetes mellitus, diabetes insípida, diuréticos, etc. (8,12,13). Otros Ciertos fármacos, como los anestésicos (14). En el shock anafiláctico se produce aumento de la permeabilidad microvascular que ocasiona paso importante de volumen plasmático hacia el intersticio (5), es quizá esta la razón por la que a esta clase de shock se le incluye a veces dentro del shock hipovolémico (13).

FISIOPATOLOGÍA Frente a la hipovolemia se activa el sistema de capacitancia provocando vasoconstricción temporal, conforme sigue su curso se activa el sistema neurohumoral (9) liberándo catecolaminas, ACTH y somatotrofina, que aumentan el tono venomotor y estimulan la producción de mineralocorticoides y glucocorticoides (8). A medida que avanza la hipovolemia se activan los barorreceptores cuyo resultado será aumentar la liberación de más catecolaminas dando un efecto inotrópico y cronotrópico positivo sobre el corazón y vasoconstricción generalizada, excepto en cerebro y corazón (9), esta vasoconstricción puede compensar hasta un 15% de la volemia (5). Secundariamente aparecen muchos signos dentro de los cuales se cita la taquicardia por ser el más precozmente medible (3), esta puede alternar con bradicardia sin embargo se restablecerá nuevamente si la hipovolemia es intensa (10); estos efectos contrapuestos son la razón para señalar que la frecuencia del

pulso no es un indicador sensible ni específico de la gravedad de un shock hipovolémico; además ciertos pacientes que no presentan hipovolemia pueden presentar taquicardia, que se debe a liberación de adrenalina por parte de la glándula suprarrenal (5). Conforme disminuye el aporte de oxígeno hacia la célula se activa la vía anaeróbica que produce acido láctico y en consecuencia acidosis láctica (13), que reduce la contracción miocárdica y la respuesta vascular a las catecolaminas(9) que favorece la vasodilatación capilar, secuestro de líquido, circulación lenta, slupge y lesión renal (8). La pérdida de hematíes estimula a los quimiorreceptores, y cuando la presión arterial llega a 70 mmHg se bloquea la descarga barorreceptora y posteriormente la quimiorreceptora lo que agrava el proceso (10). La hipoperfusión debilita la barrera de la mucosa intestinal contra la invasión bacteriana favoreciendo la acumulación de toxinas (9) que pueden pasar a la sangre (8) y junto a la isquemia tisular permite la liberación de enzimas lisosómicas y otras sustancias vasoactivas que afectan la microcirculación y permeabilidad vascular. Si persiste la hipovolemia se agrava la hipoxia que junto a las enzimas liberadas lesionan de manera local e irreversible las células para finalmente llevar a una lesión generalizada (9). Estudios sobre shock hemorrágico señalan que el VLDL y los quilomicrones pueden englobar endotoxinas y evitar la acción sobre las células Kupffer al disminuir el mecanismo inflamatorio, de allí que “se ha descrito que la administración de dietas ricas en grasas incrementan la secreción de sales biliares que actúan como inhibidores de las endotoxinas” (15).

SHOCK HIPOVOLÉMICO

75


MANIFESTACIONES CLÍNICAS Suelen variar y dependen del tipo de paciente, factor etiológico, volumen y velocidad de líquido perdido, etc. (9) pudiendo presentarse de forma súbita a gradual, leve a severa, de minutos de duración a varios días (6).

DIAGNÓSTICO Es básicamente clínico, que puede ser tan obvio o muy sutil, cuyos datos recolectados en una buena historia clínica y examen físico minucioso otorgan al médico la razón suficiente para no detener el tratamiento correspondiente (13), incluso en pacientes que tienen mecanismos compensadores enérgicos que cursan con poca o nula manifestación clínica a pesar de pérdidas importantes de líquido (11).

Inicialmente los pacientes adultos pueden presentar taquicardia, palidez, frialdad, piloerección y viscosidad de la piel, posteriormente se encuentra oliguria, disminución de la presión arterial, síntomas cerebrales y Ciertos grupos de pacientes como cardiacos. La determinación de la presión arterial no es la forma precoz y principal de valorar la función circulatoria ya que puede estar normal o presenta hipotensión en las últimas fases de descompensación (16-17).

jóvenes sanos, atletas y embarazadas no suelen presentar taquicardia a pesar de pérdidas importantes de líquidos ya que tienen gran capacidad fisiológica para compensar (3)...

En el post - operatorio el signo más precoz que sugiere hipovolemia es la presencia de acidosis en las mucosas gástrica o cólica que puede ser medida por sondas cuyo uso está poco difundido, sin embargo la oliguria, creatinina elevada y natriuresis también son orientadoras (14). Ciertos grupos de pacientes sobre todo jóvenes sanos, atletas y embarazadas no suelen presentar taquicardia a pesar de pérdidas importantes de líquidos ya que tienen gran capacidad fisiológica para compensar (3), en tales casos la evaluación de la piel y gasto urinario podrían ayudar a confirmar su presencia (16). En otro grupo se encuentran también las personas que presentan marcapaso cardiaco o ingieren ciertos fármacos como los beta adrenérgicos (3).

76

PANORAMA MÉDICO 2012

LABORATORIO Deben ser solicitados exámenes con la finalidad de monitorizar el curso del shock; dentro de las alteraciones más comunes se puede encontrar: • Poliglobulia y aumento del hematocrito • Hiperglucemia • Hiperlactacidemia hiponatremia • Hiperpotasemia, signos de acidosis metabólica. El nivel de hematocrito y hemoglobina no son fiables para diagnosticar un estado de shock (18). Independientemente de la etiología y tiempo de evolución, la determinación del nivel de lactacidemia constituye un excelente medio para valorar el pronóstico del paciente (13).


TRATAMIENTO Independientemente de su etiología se debe empezar por un soporte vital básico (7) a través de la nemotecnia ABCDE (3) y en el curso de de su desarrollo simultáneo se determinará si requiere alguna prioridad diagnóstica y/o terapéuticas (19), como: intubación endotraqueal u otros procedimientos urgentes; además de agregar oxígeno suplementario se debe proceder a canalizar las vías venosas más adecuadas para recolectar muestras sanguíneas e inmediatamente empezar con la reposición de la volemia y algún suplemento farmacológico, si el caso lo requiere, hasta solucionar el factor causal que es el objetivo (3). Hasta la actualidad existe controversia respecto a la elección, cantidad y eficacia de las soluciones a emplearse en la hipovolemia (20) etiología del shock, así como la disponibilidad del socorrista dé soluciones a utilizarse que pueden ser: cristaloides, coloides, sangre y hemoderivados (7). En el caso de shock hipovolémico, o hemorrágico leve a moderado, se debe utilizar lactato de ringer (L/R) o solución salina isotónica (SSI) (3) ya que estudios han demostrado que estas soluciones tienen eficacia similar cuando se usa para shock hemorrágico moderado, sin embargo si se trata de shock hemorrágico grave la SSI se vincula con mayor alteración fisiológica y mortalidad (20). El volumen óptimo a administrar debe estar basado en el retorno de los signos clínicos a la normalidad (19). Al momento de administrar cristaloides es preferible que sean calentados a 39ºC (102,2ºF) para prevenir la hipotermia debido a que este tipo de pacientes con shock hemorrágico no responden adecuadamente al tratamiento con líquidos y sangre, y pueden desarrollar coagulopatías, sobre

todo si concomitantemente existe traumatismo cráneo encefálico cerrado severo (3). Nakamaya y Cols. demostraron que el cloruro de sodio hipertónico disminuye el edema de las células endoteliales en el transcurso del shock hemorrágico por lo que podría ser una terapéutica interesante en este tipo de shock (14). Ciertos autores recomiendan el uso de coloides en el shock hipovolémico, no obstante una revisión sistemática de 26 estudios aleatorios controlados realizados por Schierhout y Roberts respecto al uso de coloides y cristaloides en pacientes muy enfermos, incluyendo a los que tenían shock hemorrágico, concluyeron que no hay pruebas para respaldar el uso de coloides debido a que incrementaban la mortalidad hasta un 4% (5). Otra revisión de ensayo efectuado para conocer los efectos de la albumina humana y la fracción de proteína plasmática sobre la mortalidad, que incluyeron un total de 8452 participantes en estado crítico con hipovolemia, quemadura, hipoproteinemia, determinó que la albumina humana no disminuyó la mortalidad en los pacientes antes descritos en comparación con SSI, es por ello que concluyen que sería mejor utilizar soluciones más económicas como la SSI (21). Sin embargo, en la actualidad las gelatinas son los coloides más usados en el tratamiento de la hipovolemia debido a que carecen de dosis máxima, no interfieren con los factores de coagulación, y producen expansión volémica similar al volumen perfundido (14). Si se trata de un shock hemorrágico grave o severo reestablece la volemia combinando cristaloides con sangre total, se espera que

SHOCK HIPOVOLÉMICO

77


cada unidad de sangre eleve el hematocrito un 3%; un sustituto de sangre de última generación es la hemoglobina polimerizada y que ha demostrado ser eficaz en pacientes traumatizados que aún sigue en estudios (3,7,20). Los estudios sobre hemorragia y trauma determinan que los pacientes que reciben transfusión masiva de por lo menos 10 unidades de glóbulos rojos incrementan su mortalidad (2).

Un estudio comparativo entre dopamina y norepinefrina para el tratamiento del shock realizado en 1679 pacientes, demostró que no existe diferencia significativa en la tasa de muertes, no obstante si demostró que la dopamina se asocia con una mayor tasa de muertes en pacientes con shock cardiogénico; estos resultados cuestionan las recomendaciones de la Asociación Americana y Colegio Americano de Cardiología que señalan a la dopamina como el vasopresor de primera línea frente a una hipotensión secundaria a infarto agudo de miocardio (22).

Bickell y Cols. estudiaron la ventaja de la reanimación tardía en pacientes con shock y trauma torácico penetrante, y demostraron que Los estudios sobre hemorragia y resulta perjudicial restablecer la trauma determinaron que los volemia con líquidos intravenosos al momento que el pacientes que reciben transfusión paciente llega a la sala de masiva por lo menos 10 unidades de urgencias en comparación con glóbulos rojos incrementan su los que fueron tratados más tarde en el quirófano (5). mortalidad (2). El uso de fármacos simpaticomiméticos no ha demostrado tener utilidad en el shock hemorrágico (17), a pesar de ello ciertos autores señalan que si la hipotensión es marcada y no responde a expansión enérgica se podría considerar el uso de drogas vasoactivas (13).

78

PANORAMA MÉDICO 2012

La administración de antioxidantes y aminoácidos en modelos experimentales de shock hemorrágico han demostrado disminución del daño de órganos y tejidos, es por ésto utilizan en la nutrición de pacientes con o sin isquemia (15).


BIBLIOGRAFÍA 1. Morales R, Gálvez R, López F, Aguilar J. Epidemiología del Trauma en México. Martínez S, editor. Cirugía: Bases del Conocimiento quirúrgico y apoyo en Trauma. 4ta Ed. México: Mc Graw Hill Interamericana; 2009. pp. 344-355. 2. Mejía J, Puentes F, Ciro J, Morales C. Hemorragia y Trauma, avances del estudio CRASH2 en Colombia. Rev.Colomb. Cir. [en línea]. 2009 July [fecha de acceso 06 de marzo de 2011]; 24 (3): [aprox. 14 p.]. Disponible en: http://www.scielo.unal.edu.co/ scielo.php?pid=S201175822009000300006&script=sc arttext 3. American College of Surgeons. Advanced trauma life support. 6a ed. Washington; 1997. 4. Martínez S. Estado de Choque. Martínez S, editor. Cirugía: Bases del conocimiento quirúrgico y apoyo en trauma. 4ta Ed. México: Mc Graw Hill Interamericana; 2009. p. 279-289. 5. Mullins RJ. Shock, electrolitos y líquidos. Townsend CM, Beauchamp RD, Evers BM, Mattox KL, editores. Sabiston Tratado de Cirugía, Fundamentos biológicos de la práctica quirúrgica moderna, Volumen I. 17a ed. Madrid: El Sevier Saunders; 2005. p. 67-112. 6. Navarro RL. González GP. Propedéutica clínica y semiología médica, volumen I. La Habana: Editorial ciencias médicas; 2003. 7. McPhee SJ, Papadakis MA. 2010 Current Medical diagnosis & treatment. 49a ed. Washington: Mc Graw Hill; 2010. 8. Roca R. Shock. Roca R, editor. Temas de Medicina Interna, Tomo I. 4ta Ed. La Habana. Editorial ciencias médicas; 2002. p. 458- 465. 9. Rutherford RB. Fisiopatología de traumatismos y choque. En: Ballinger WF, Rutherford RB, Zuidema GD, editores. Traumatología. 2a ed. México: Interamericana, S. A.; 1977. p. 22-65. 10. Ganong WF. Trastornos Cardiovasculares: enfermedad vascular. McPhee SJ, Ganong WF, editores. Fisiopatología Médica. 5ta Ed. México: Manual Moderno; 2007. p. 319-321. 11. Peitzman AB, Harbrecht BG, Billiar TR. Choque. Brunicardi FC, editor. Schwartz Principios de Cirugía, editores. 8a ed. México: Mc Graw-Hill; 2006. p. 85-108. 12. Fuentes L. Shock. Álvarez G, editor. Temas de guardia clínicos y quirúrgicos. La Habana. Editorial ciencias médicas; 2002. p. 64-79.

13. Mosquera JM. Shock. Rodes J, editor. Medicina Interna, Tomo I. 1ta Ed. Barcelona: Masson S.A.; 1998. p. 157-165. 14. Gómez C. Hipovolemia y Reemplazo de Volumen. Cabo Ed, Gómez C, Álvarez M, Saínz H, Molina R, editores. Anestesiología clínica. La Habana: Editorial ciencias médicas; 2006. p. 333350. 15. Mauriz J, Renedo J, Barrio J, Culebras J, Gonzales P. Modelos Experimentales sobre shock hemorrágico. Nutr. Hosp. [en línea]. 2007 march. Disponible en: http://scielo.isciii.es/scielo.php?pid= S0212-16112007000200008&script= sci_arttext&tlng=en 16. Benatuil R, Orta ML. Shock. Cantele HE, Méndez A, editores. Semiología y patología quirúrgica. 1ta Ed. México: Mc Graw Hill Interameicana; 2003. p. 31-38. 17. Guyton AC, Hall JE. Shock Circulatorio y Fisiología de su tratamiento. Guyton AC, Hall JE, editores. Tratado de Fisiología Médica. 11va Ed. Madrid: El Sevier; 2006. p. 278-288.

RESEÑA El diagnóstico es básicamente clínico, el que puede ser obvio o muy sutil, cuyos datos recolectados en una historia clínica y examen físico minucioso otorgan al médico la razón suficiente para no detener el tratamiento correspondiente (13)...

18. Balcells A. La Clínica y el Laboratorio. 19ta Ed. Barcelona: Masson, S.A.; 2002. 19. Collins JA, Ballinger WF. Tratamiento del Choque. Ballinger WF, Rutherford RB, Zuidema GD, editores. Traumatología. 2ta Ed. México: Interamericana, S. A.; 1977. p. 66-90. 20. Vázquez JA, Vázquez AL, Mejía AF. Estado de Choque: definición, clasificación y tratamiento. Morales JL, editor. Tratado de Cirugía General. 2da ed. México: Manual Moderno; 2008. p. 131-135. 21. The Albumin Reviewers (Alderson P, Bunn F, Lefebvre C, Li Wan Po A, Li L, Roberts I, Schierhout G). Solución de albúmina humana para la reanimación y la expansión de volumen en pacientes críticos (Revisión Cochrane traducida). En: La Biblioteca Cochrane Plus, 2008 Número 4. Oxford: Update Software Ltd. Disponible en: http://www.bibliotecacochrane.com/ BCPGetDocument.asp?SessionID= %201627920&DocumentID=CD001208 22. Backer D, Biston P, Devriendt J, Madl C, Chochrad D, Aldecoa C, Brasseur A, Defrance P, Gottignies P, Vincent J. Comparison of Dopamine and Norepinephrine in the Treatment of Shock. N Engl J Med [en línea]. 2010 March; 362 (9): [779-789]. Disponible en: http://www.nejm.org/doi/full/ 10.1056/NEJMoa0907118

SHOCK HIPOVOLÉMICO

79


80

PANORAMA MÉDICO 2012


“ PROMETO SOLEMNEMENTE CONSAGRAR…..”

El título, simbólicamente inconcluso quiere referirse al párrafo de la Promesa del Médico, una especie de oración aprobada en forma de Resolución...

por la Asociación Médica Mundial en septiembre de 1948 en Ginebra. El alcance de su contenido vuelve insuficiente a las dimensiones conocidas, por que viajan juntas en las rutas de la Humanidad y sus leyes naturales.

Continua así: “prometo solemnemente consagrar mi vida al servicio de la humanidad”. Este instrumento de carácter filantrópico y solidario se integra en la vida del médico a un acto trascendental ejercido, “en nombre de la República del Ecuador y por la Autoridad de la Ley, la Facultad de Ciencias Médicas (representada por su Decano) de la Universidad de… os concede el Título de Doctor en Medicina y Cirugía por lo que se reconocerá como tal y se le guardará los honores y privilegios que le correspondan”. • Es la integración de un nuevo ser social con objetivos, responsabilidades y derechos, dentro de un contexto holístico como parte de un universo. Las leyes de los Estados, la naturaleza biológica de la conducta y la formación ética de las personas comprometidas orientan a los demás pasos contenidos en la oración que advienen desde la profundidad de los siglos y actualmente pretende ser remedo actualizado del juramento Hipocrático difundido en una época en la cual los médicos hablaban con los médicos que eran sacerdotes, astrólogos y astrónomos, tanto como filósofos, afiliados a la integración de la humanidad con la naturaleza universal (physis) de los griegos. Del conocimiento de este primer párrafo se derivan múltiples respuestas de conducta que testimonian el respeto a los maestros, el ejercicio digno y a conciencia de la profesión; la concreción solicita y prioritaria acerca de la salud del paciente; el respeto al secreto profesional; la asistencia sin distinción a todo ser humano, sin consideración de ninguna índole; de mantener incólume y por todos los medios a sus alcance el honor y las nobles tradiciones de la profesión médica; el respeto a la vida humana desde la concepción; la convicción de no utilizar ni bajo amenaza los conocimientos y los medios para contravenir las leyes de la naturaleza.

PROMETO SOLEMNEMENTE CONSAGRAR

81


Dentro de este marco general están incluidas concepciones de carácter económico, social, de compañerismo y de docencia, inquietudes de nivelación científica, de camaradería científica y de conciencia social. • La función histórica del médico ha estado vinculada a la búsqueda de la felicidad de la especie a través de la salud; consecuentes con los cambios y sus consecuencias; problemas trágicos como las pandemias, la pobreza y nuevos alcances filosóficos como el aporte de Darwin sobre el origen de las especies, han conducido el comportamiento profesional dentro del marco previamente trazado. El ámbito de la Declaración crece en su competencia y responsabilidad, cuando en 1974 se pone “a punto la técnica del ADN recombinante” y nace en forma general el término de Bioética junto al de Biotecnología. De aquí han partido ya y crecen nociones revolucionarias en la investigación de la vida en todas sus formas. Se espera que frente a ello la conducta humana pase su prueba de fuego y sus consecuencias redunden en beneficio de la humanidad. El ejercicio de la profesión médica confronta nuevos retos históricos que miran hacia la “Justicia Social” (Todo lo que está entre comillas correspondiente al texto de la presentación de introducción a la bioética de Diego García, Editorial Búho. Bogotá); que comprende “la vida saludable” que sea de acceso universal “para todos”, sin exclusiones. Tales principios afectan no solo a la relación médico-paciente sino también a los que tienen en relación con el área de administración de la salud pública y privada. De allí la trascendencia de las definiciones y el respeto de los principios éticos. La responsabilidad es hacia la humanidad entera, presente y futura. La investigación debe tener por límites la moral, la ética, la religión y servir para el mejoramiento de la vida más no para su exterminio. La Declaración de Ginebra nos convoca a disfrutar del privilegio contraído hacia la humanidad con el aval de la Universidad y de los poderes públicos, bajo la palabra de honor en forma libre y voluntaria.

DR. CLAUDIO ARIAS ARGUDO Presidente de la Cruz Roja Ecuatoriana, Junta Provincial del Azuay Ex Catedrático de la Unidad Académica de Medicina, Enfermería y Ciencias de la Salud

82

PANORAMA MÉDICO 2012


NORMAS DE PUBLICACIÓN

AUTORAS: DRA. MARÍA ISABEL HERRERA J., DRA. ROSA SOLORZANO B. Departamento de investigación de medicina y enfermería

La revista Panorama Médico es la publicación científica de la Unidad Académica de Medicina, Enfermería y Ciencias de la Salud, Universidad Católica de Cuenca. Publica trabajos de los docentes de la Unidad y de otros autores, previa aprobación del Consejo Académico. Su objetivo principal es elevar el nivel científico y la difusión de los artículos y trabajos realizados por los catedráticos, estudiantes, etc. Se aceptan trabajos que no han sido publicados en otras revistas.

SOBRE LOS AUTORES Se publicará un artículo del mismo autor en cada número. El Consejo Editorial decidirá la conveniencia sobre la publicación de otros artículos del mismo autor, tomando en cuenta la importancia del tema. Las opiniones vertidas por los autores son de su exclusiva responsabilidad y no reflejan la posición de la Universidad, de forma que los editores declinan cualquier responsabilidad legal o profesional en esta materia.

PRESENTACIÓN DE LOS MANUSCRITOS Los documentos serán entregados en el Departamento de Investigación de la Unidad Académica de Medicina: 1. Hoja de registro de artículos (anexo) 2. Un manuscrito impreso 3. Archivo electrónico La hoja de registro sirve para obtener la información necesaria, unificar la forma de presentación y seguimiento del artículo, lo que facilitará, tanto para el Departamento como para los autores, su manejo. El contacto con los editores se llevará a través de la dirección: depinvestigacionmedicina@gmail.com

SECCIONES DE LA REVISTA • TRABAJOS ORIGINALES Son investigaciones médicas con un requisito indispensable, ceñirse al método científico. Extensión máxima: 20 páginas. • CASOS CLÍNICOS / QUIRÚRGICOS Análisis de casos especiales de difícil diagnóstico, que aporten al conocimiento y a la práctica diaria, tanto en el área clínica como en la quirúrgica. Se publicará como máximo un caso clínico quirúrgico por Revista.

NORMAS DE PUBLICACIÓN

83


Extensión máxima: 10 páginas. • ARTÍCULOS DE OPINIÓN Los profesionales invitados opinan sobre temas relacionados en la revista. Extensión máxima: 15 páginas. • EDUCACIÓN MÉDICA CONTINUA Sección de revisiones bibliográficas, guías y protocolos de manejo de diferentes patologías, en base a la mejor evidencia científica. Actualización de conocimientos sobre temas de la práctica diaria. Extensión máxima: 15 páginas. • IMAGENOLOGÍA Guías de interpretación, protocolos y discusión de casos de imagen, en relación a la trilogía paciente, patología e imágenes.

• SOSPECHA DIAGNÓSTICA Presenta un caso clínico/quirúrgico que permite interactuar con el lector para su diagnóstico y manejo, al final un comentario de especialidad o subespecialidad. Se publicará como máximo una sospecha diagnóstica por Revista. Extensión máxima: 5 páginas. • HECHOS Y PERSONAJES Artículos sobre temas históricos y personajes relevantes en la historia de la Medicina y/o Enfermería en Ecuador. Las normas a seguir para la redacción de los manuscritos se fundamentan en el estilo “Vancouver”. Este formato fue establecido por el Comité Internacional de Editores de Revistas Médicas.

SECCIONES DE LA REVISTA • BIOÉTICA Descripción, análisis y comentario de temas de bioética, relacionados con la niñez, adolescencia y adulto mayor. • EL POSTGRADO ESCRIBE Espacio dedicado para los artículos investigativos elaborados por los alumnos de pregrado y postgrado.

Indicar los siguientes datos: título del artículo (español e inglés), nombre y dos apellidos de los autores, nombre y dirección del centro donde se llevó a cabo la investigación, dirección para correspondencia y otras especificaciones de importancia.

SEGUNDA SECCIÓN

• DESDE LA WEB

RESUMEN

Recopilación de direcciones electrónicas de un tema determinado en cada edición de la Revista.

Su extensión aproximada será de 250 palabras. Se deberán tomar en cuenta varias consideraciones:

• NOTAS DE INTERÉS Novedades y propuestas nacionales, internacionales e información general sobre las actividades médicas, congresos, eventos próximos, etc.

84

PRIMERA SECCIÓN

PANORAMA MÉDICO 2012

• El resumen debe ser comprendido sin necesidad de leer parcial o totalmente el artículo. • Su redacción será concreta y deberá establecer los puntos esenciales del artículo.


• Sólo se incluirán la información y los datos citados en el texto completo • Es necesario prescindir de tablas, figuras, gráficos y referencias bibliográficas. PALABRAS CLAVE Especificar de tres a seis palabras que identifiquen el contenido del trabajo. Esta información permitirá la inclusión del manuscrito en las bases de datos nacionales e internacionales, por lo que deben ser revisados en el DeCS (Descriptores en Ciencias de la Salud). SUMMARY AND KEYWORDS Traducción del resumen y palabras clave al idioma inglés. Es imprescindible para ingreso a bibliotecas virtuales por lo que será revisado por un consultor de idioma asignado por el Comité editorial, si su calidad es deficiente, será realizado de nuevo por tal consultor, con un costo que deberá ser asumido por los autores.

TERCERA SECCIÓN El siguiente formato desde el numeral 1 al 4 será utilizado para trabajos originales y casos clínicos/quirúrgicos. Para las restantes secciones de la revista los 4 primeros numerales se transforman en texto del artículo que dependerá del enfoque de autor o autores. Los numerales 5 al 9 son para todo artículo presentado.

1.

INTRODUCCIÓN

Consiste en la presentación del tema. Su redacción debe ser clara para resumir los criterios que llevaron a la realización de la investigación (objetivos). Proporcionará el sustrato bibliográfico mínimo indispensable, sin entrar a una revisión extensa del tema.

2. MATERIALES Y MÉTODOS En este punto se expondrá la metodología utilizada, incluyendo la instrumentación y la sistematización seguida con detalles suficientes como para que otros grupos puedan reproducir la investigación. Se hará referencia al tipo de análisis estadístico utilizado y a los criterios de inclusión y exclusión. Si se hace referencia a fármacos o productos químicos, debe identificarse el nombre genérico, la dosificación y la vía de administración. Deben indicarse los aspectos bioéticos de la investigación: autorizaciones y consentimiento informado.

3. RESULTADOS Relatan y describen, sin embargo no interpretan las observaciones efectuadas en la investigación. Estos datos pueden ser presentados en formato de texto o como tablas o figuras, sin repetir la información.

4. DISCUSIÓN Destacar aquí: • El significado y la aplicación práctica de los resultados (conclusiones). • La relación con publicaciones similares y la comparación entre las áreas de acuerdo y desacuerdo. • Las opiniones del autor sobre el tema. • Las indicaciones y directrices para futuras investigaciones (recomendaciones).

5. AGRADECIMIENTO Cuando se considere necesario, se citarán las personas, centros o entidades que colaboraron en la realización de la investigación.

NORMAS DE PUBLICACIÓN

85


6. CONFLICTO DE INTERESES Declarar los potenciales conflictos de interés relacionados con cada autor, los relacionados con el financiamiento; y los relacionados con los editores, el comité editorial o los revisores.

7. BIBLIOGRAFÍA Se aceptará para los apartados que tienen bibliografía un mínimo de 20 a un máximo de 40 bibliografías. Se presentará de acuerdo al orden de aparición en el texto con la correspondiente numeración. Dicha numeración será en orden ascendente estricto y se anotará con formato de superíndice en el manuscrito. • La numeración en superíndice de las citas debe seguir el siguiente formato: • Con comas, si se hace referencia a bibliografía puntual ya citada en el texto. Ejemplo: 2,4, y 7 significa que éstas referencias corresponden a los documentos de la bibliografía 2,4, y 7 • Con guión, si la citación corresponde a un grupo de referencias en secuencia. Ejemplo: 2-7 significa que los documentos citados son los que corresponden a los numerales 2, 3, 4, 5,6 y 7 de la bibliografía. • Para evitar repetir el texto de un documento previamente citado se recomienda utilizar “ibid” y Op.Cit.” • Ibid. Indica que el documento citado es el inminentemente anterior. Ej: Ibid.Pp. 89. • Op.Cit. Indica que el documento citado es uno anterior. Ej: Op. Cit.3. Pp 88. La veracidad de la información de los documentos citados será de exclusiva responsabilidad del autor, quien verificará su calidad científica.

86

PANORAMA MÉDICO 2012

La bibliografía se redactará de acuerdo a las normas del estilo “Vancouver”.

8. GRÁFICOS, FIGURAS Y TABLAS Se presentarán en formato impreso (un gráfico, figura o tabla por hoja) y en formato electrónico. Incluyen: • Denominación precisa: gráfico, figura o tabla. • Numeración correlativa de acuerdo al texto y con números arábigos. • Título explicativo. • Fuente correspondiente, en caso de que los gráficos, figuras o tablas procedan de otra publicación, el autor deberá presentar la correspondiente autorización por escrito. • Las siglas y abreviaturas se acompañarán de una nota explicativa al pie.

9. FOTOGRAFÍAS Se seleccionará cuidadosamente, tomando en cuenta que las fotografías contribuyen a una mejor comprensión del texto y engalanan su presentación. Deberán enviarse en formato electrónico (jpg) y/o en papel fotográfico (impresión) en dimensiones estándar de 9 cm por 12 cm. Se numerarán al dorso con una etiqueta adhesiva además de anotar el nombre del primer autor del artículo e indicar con una flecha la parte superior de la fotografía. Se entregarán en un sobre adjunto al manuscrito.

APROBACIÓN Los documentos entregados serán revisados por el Comité Editorial quien se reserva el derecho de introducir modificaciones al estilo


y/o acortar los textos que lo precisen, comprometiéndose a respetar el contenido original; así como de rechazar los artículos que no juzgue apropiados, de acuerdo a criterios enmarcados en el método científico. Se realizará el seguimiento a través de la hoja de recepción y seguimiento.

BIBLIOGRAFÍA

El Consejo editorial acusará recibo de los trabajos e informará al autor de la decisión a través de la dirección electrónica: depinvestigacionmedicina@gmail.com

3. International Committee of Medical Journal Editors. Uniform requirements for manuscripts submitted to biomedical journals. N Engl J Med. 1997; 336: 309- 315

El autor recibirá, cuando el artículo se halle en prensa unas pruebas impresas para su corrección final. Recibirá cinco separatas del trabajo, posteriormente a su aprobación y publicación.

1. Organización Mundial de la Salud. Organización Panamericana de la Salud. General information and Guidelines for Manuscript Submission. Revista Panamericana de Salud Pública/Pan American Journal of Public Health. 2003; 1-6. Disponible en: htpp:// www.publications.paho.org/English/periguide.cfm 2. International Committee of Medical Journal Editors. Uniform requirements for manuscripts submitted to biomedical journals. JAMA. 1997; 277: 927- 934

4. Universidad Central del Ecuador. Facultad de Ciencias Médicas. Información a los autores y normas de publicación. Revista de la Facultad de Ciencias Médicas. 2004; 29 (1) 74-75

NORMAS DE PUBLICACIÓN

87



Revista Panorama Médico 2011