Page 1

1er. Bloque. Fundamentos de Genética Molecular

Tema 2 Expresión génica

Primera asociación entre gen y proteína Errores congénitos del metabolismo: Garrod y la alcaptonuria (1902)

Enfermedad de la orina negra

2.1

Herencia mendeliana recesiva

Ácido homogentísico Enzima HGO Ácido maleilacetoacético

La alcaptonuria es uno de los primeros ejemplos de enfermedad debida a la ausencia de una actividad enzimática (denominadas por Garrod errores congénitos del metabolismo) La enfermedad tiene un patrón de herencia mendeliana

1


Algunas enfermedades metabólicas 2.1

El dogma central 2.1

ADN replicación transcripción

Gen: secuencia de núcleotidos en el ADN que se transcribe en una molécula de ARN con una función biológica propia

ARN

traducción

ARN funcional Proteína

ARN funcional

2


Transcripción 2.2

ADN

5’-ACGTTTCAGCGCCAATATGGTCGCAATCACCGTCGCGTA-3’! .......................................! 3’-TGCAAAGTCGCGGTTATACCAGCGTTAGTGGCAGCGCAT-5’!

!

Separación de las cadenas

---ACGTTTCA GCGCCAATATGGTCGCAATCACCGTCGCGTA! 5’-ACGTTTCAGCGCCAATAAGGCCGCAATCAC CGTCGCGTA-3’! ........! .........! 3’-TGCAAAGTCGCG5’-GTTATTCCGGCGTTAGGCAGCGCAT-5’! ---TGCAAAGT CGCGGTTATACCAGCGTTAGTG! Transcripción a partir de una de las dos cadenas ---ACGTTTCA GCGCCAATATGGTCGCAATCACCGTCGCGTA! 5’-........ ACGTTTCAGCGCCAATAAGGCCGCAATCAC CGTCGCGTA ! .........-3’! ! 5’-CCAAUAUGGUCG 3’-TGCAAAGTCGCG5’-GTTATTCCGGCGTTAGGCAGCGCAT -5’! ............! ---TGCAAAGT CGCGGTTATACCAGCGTTAGTG! Cadena molde

ARN

Síntesis de ARN 2.2

ARN polimerasa

3


Promotor 2.2

+1: punto de inicio de la transcripción Promotor: secuencia en la región 5’ donde se une la ARN polimerasa. Reconocido por el factor sigma.

Fases de la transcripción 2.2

4


Iniciaci贸n de la transcripci贸n 2.2

Elongaci贸n 2.2

5


Comparación entre replicación y transcripción 2.2

Diferencias Parecidos Fenómeno procesivo Polaridad 5'→3’ Se utiliza como molde una cadena de ADN Complementariedad de bases

Replicación

Transcripción

ADN polimerasa

ARN polimerasa

dATP, dCTP, dGTP, dTTP

ATP, CTP, GTP, UTP

Todo el cromosoma

Segmentos discretos (genes)

Una ronda por ciclo

Varios ARN por gen por ciclo

Dos cadenas

Una de las cadenas

Con cebador

Sin cebador

Con actividad correctora

Sin actividad correctora

Tipos de ARN y su función 2.2

Función informativa: intermediario en la tradución de proteínas •  ARN mensajero (ARNm) Funcional estructural: no se traduce •  ARN ribosómico (ARNr) •  ARN transferente (ARNt) •  Otros ARN de pequeño tamaño Las moléculas de ARN son más flexibles que las de ADN Los ARN suelen formar estructuras terciaciarias por apareamientos internos Ciertos ARN se replican o se retrotranscriben

6


Polimerasa del ARN bacteriana 2.3

Reconocimiento del promotor: el factor sigma Secuencias consenso para Ďƒ70

2.3

Existen otros factores sigma alternativos que reconocen promotores con consensos diferentes

7


Terminación en bacterias 2.3

terminador independiente de ρ

terminador dependiente de ρ

Relación con la traducción: ARNm policistrónico 2.3

ARNm policistrónico: contiene más de un gen La transcripción ocurre de forma simultánea a la traducción

8


Transcripción en eucariontes •  La transcripción ocurre en el núcleo, la traducción en el citoplasma

2.4

•  Los ARNm se procesan antes de la traducción •  No hay acoplamiento transcripción-traducción •  Los ARNm eucariotas son monocistrónicos •  Hay tres polimerasas de ARN Enzima

Localización

Producto

Actividad relativa

Sensibilidad a α-amanitina

ARN polimerasa I

nucleolo

ARNr

50-70%

insensible

ARN polimerasa II

nucleoplasma

ARNm, ARNpn

20-40%

sensible

ARN polimerasa III

nucleoplasma

ARNt ARNr 5S

∼10%

depende de la especie

•  Numerosos factores de transcripción implicados, así como potenciadores y silenciadores •  Terminación peor definida que en procariontes

Promotor eucariota mínimo

TATA

2.4

Unión de TFIID

Unión de TFIIB

Unión de ARN polimerasa y TFIIF

Secuencias consenso del promotor en Drosophila

Unión de TFIIE y H

9


Iniciaci贸n 2.4

Intensificadores y silenciadores 2.4

Modelo general de la formaci贸n de un complejo de iniciaci贸n de la transcripci贸n

10


Flujo de información eucariota y procariota 2.5

Procariontes

Eucariontes

En los años 70, Darnell y colaboradores encuentran el ARN heterogéneo nuclear

Maduración del ARNm: caperuza (“cap”) en 5’ 2.5

11


Maduración del ARNm: poliadenilación en 3’ 2.5

Maduración del ARNm: intrones y exones 2.5

Phillip A. Sharp

Berget, Sharp y Roberts (1977) presentaron las primeras pruebas de la existencia de intrones

Nobel de Fisiología o Medicina Sharp y Roberts, 1993

Richard J. Roberts

12


Procesamiento de intrones de los pre-ARNm 2.5

Maduraci贸n alternativa Ejemplo: gen 伪-tropomiosina

2.5

13


Intrones autoprocesables: grupo I 2.5

Cech (1982) Intr贸n autoprocesable del ARNr de Tetrahymena Concepto de ribozima

Thomas R. Cech

Nobel de Qu铆mica Cech y Altman, 1989

Intrones autoprocesables: grupo II 2.5

14


Principales tipos de intrones 2.5

Tipo de intrón

Tipo de corte y empalme

Localización

Pre-ARNm nuclear

Genes que codifican proteínas en el núcleo

“Spliceosoma”

Grupo I

ARNr, ARNt y ARNm de orgánulos de plantas, hongos y protistas, ARNt y ARNm de bacterias y bacteriófagos, ARNr de protistas y hongos

Autoprocesado

Grupo II

ARNr, ARNt y ARNm de orgánulos de plantas, hongos y protistas, ARNm de bacterias

Autoprocesado

ARNt

Genes del ARNt

Enzimático

Edición del ARN 2.5

Modificación de la secuencia de un ARNm Ejemplo: edición del gen apo-B CAA

5’ 3’

3’ 5’

transcripción 5’

CAA no edición

5’

TAA

UAA

3’

edición

CAA

UAA

3’ 5’

UAA

traducción

Apo-B100 Células de higado

UAA

3’

traducción

Apo-B48 Células de intestino

15


Comparación ARNm procariotaeucariota

Procariota

Eucariota

2.5

31

El ribosoma y el enlace peptídico 2.6

Formación del enlace peptídico

La síntesis se produce añadiendo en el extremo carboxilo

16


Ribosomas procariotas y eucariotas

eucariotas

procariotas

2.6

Procesamiento de ARNr 2.6

17


Hipótesis del adaptador 2.6

Crick, 1955 Debe haber una molécula que sirva para asociar una secuencia de 3 aminoácidos en el ADN a un aminoácido en el proceso de síntesis de una proteína

El adaptador: ARN transferente 2.6

Zamecnik, 1957

Aminoácido

El ARNt actúa de adaptador entre el ARNm y los aminoácidos

18


Procesamiento de ARNt 2.6

Ciertos ARNt poseen un intrón no autocatalítico

Estructura del ARN transferente 2.6

Modelo de hoja de trébol de Holley (1965)

Modelo tridimensional

CCA añadido en el proceso de maduración

Lazo TΨC

Lazo DHU

*

* Brazo extra variable

modificadas * Bases –  Ácido inosínico (I)

* *

*

–  –  –  –  – 

Lleva la purina hipoxantina Metilinosínico (Im), Metilguanílico (Gm) Pseudouridílico (ψ) Ribotimidílico (T) Hidrouridílico (Uh)

R.W. Holley

19


Iniciación de la traducción Procariontes:

2.6

–  El primer codón es AUG (a veces es GUG) –  Secuencia Shine-Dalgarno antes del AUG –  El ARNt iniciador lleva formilmetionina

Eucariontes: –  El primer codón es AUG –  Secuencia de Kozak en torno al AUG –  El ARNt iniciador lleva metionina Extremo 3’ del ARN 16S

Traducción 2.6

En el proceso participan numerosas proteínas auxiliares Factores de iniciación (IF-1, IF-2, IF-3) Factores de elongación (EF-Tu, EF-Ts, EF-G) Factores de liberación del polipéptido (RF1, RF2, RF3)

20


Polisomas: ARNm con numerosos ribosomas 2.6

Polirribosomas procariotas

Polirribosomas eucariotas

0.5 µ m

ADN

ARNm ARNm

Deducciones teóricas sobre la clave genética Se propone, sobre bases teóricas, la existencia de un código de tripletes

2.7

4 x 4 = 16 combinaciones de 2 bases para 20 aminoácidos. INSUFICIENTE 4 x 4 x 4 = 64 combinaciones de 3 bases para 20 aminoácidos. SUFICIENTE

Dos tipos generales de código: Un código solapante impondría restricciones en las secuencias de aminoácidos Si el código fuera solapante, un cambio en un nucleótido podría originar un cambio en aminoácidos adyacentes

Crick, Barnett, Brenner Watss-Tobin, 1961: Mutaciones de inserción y deleción y supresores intragénicos de mutantes rII del fago T4 (Tema 3) Sus resultados apoyan un código de tripletes no solapante

21


Descifrando la clave: traducción de ARN aleatorio 2.7

Nirenberg y Matthaei, Ochoa (1961) (1) Sintesis de heteropolímeros de ARN con polinucleótido fosforilasa (permite la síntesis sin molde de ADN) Ejemplo: 1A:5C (2) Traducción de mensajero in vitro

Severo Ochoa Nobel, 1959

Descifrando la clave: traducción de copolímeros 2.7

Khorana (1960s) Descubrió como sintetizar copolímeros de ARN repetidos de di-, tri- y tetranucleótidos Su traducción produce polipéptidos repetitivos

Copolímero repetido

Nobel de Medicina y Fisiología 1968 Holley, Khorana y Nirenberg

Codones producidos

Aminoácidos en polipéptidos

UC

UCU CUC

Ser Leu

UUC

UUC UCU CUU

Ser Leu Phe

UUAC

UUA UAC ACU CUU

Leu Thr Tyr

Gobind Khorana

Marshall W. Nirenberg

22


Descifrando la clave: ensayo de unión a tripletes 2.7

Nirenberg y Leder (1964) (1) Síntesis de tripletes (2) Incubación de cada triplete con ribosomas y extractos con aminoácidos marcados (20 mezclas con uno de ellos marcado) (3) Determinación de con qué mezcla se queda pegada la radiactividad a los ribosomas No funcionó suficientemente bien con todos los tripletes, pero inicialmente pudieron determinar los 26 de la tabla

Trinucleótidos UGU UGC

Aminoácidos Cisteína

GAA GAG

Ácido glutámico

AUU AUG AUA

Isoleucina

UUA UUG CUU

Leucina

CUC CUA CUG

Leucina

AAA AAG

Lisina

AUG

Metionina

UUU UUC

Fenilalanina

CCU CCC

Prolina

CCG CCA

Prolina

UCU UCC

Serina

UCA UCG

Serina

La clave genética 2ª posición

2.7

anticodón

5’

CUU G AA 123

3ª posición

5’

1ª posición

3’

A C C

3’

codón

23


Reglas del tambaleo 2.7

3’

5’

CUU G AA 3’

5’

5’

3’

5’

CUU GAG

3’

El tambaleo en el apareamiento de la tercera base del codón permite a un mismo ARNt leer distintos codones para un mismo aminoácido

Base en la 1ª posición del ARNt (extremo 5')

Base en la 3ª posición del ARNm (extremo 3')

A

U

C

G

G

CoU

U

AoG

I (inosina)

A, U o C

adenina

inosina

Características de la clave genética 2.7

•  Escrito en forma lineal usando las bases del ARNm •  Cada grupo de tres ribonucleótidos (codón) especifica un aminoácido •  Inequívoco: cada triplete especifica un solo aminoácido •  Degenerado: un aminoácido puede ser codificado por más de un triplete. Sólo Met y Trp están representados por un solo codón •  Contiene señales de inicio y de parada •  No hay "comas" •  El código no es solapante •  El código es prácticamente universal en bacterias, arqueas y eucariontes, pero hay excepciones

24


Excepciones a la clave “universal” 2.7

Triplete

Significado normal

Significado alterado

UGA

FIN

Trp

Mitocondrias humanas y de levaduras Mycoplasma

CUA

Leu

Thr

Mitocondrias de levaduras

AUA

Ile

Met

Mitocondrias humanas

AGA AGG

Arg

FIN

Mitocondrias humanas

UAA

FIN

Gln

Paramecium Tetrahymena Stylonychia

UAG

FIN

Gln

Paramecium

Fuente

protozoos ciliados

Número de codones y frecuencia de aminoácidos Presencia en las proteínas

2.7

25


Pasos de descodificación en la traducción 2.8

Paso 1

Paso 2

La traducción es un proceso de descodificación en dos pasos

Carga del ARNt con un aminoácido 2.8

Aminoacil ARNt sintetasa

Zamecnik y col., 1958: enzima activante de aminoácidos

26


Eficiencia de las aminoacil-ARNt sintetasas 2.8

El código genético es determinado por las aminoacil-ARNt sintetasas La fidelidad de la traducción depende de la carga correcta de cada ARNt con su aminoácido La fidelidad depende de dos reacciones de identificación: 1) Reconocimiento del aminoácido correcto 2) Reconocimiento del ARNt correcto

Tirosina

Fenil alanina

Ejemplo: la tirosil-ARNt sintetasa acila tirosina con una afinidad 104 veces mayor que fenil alanina.

Regulación 2.9

Dienert (1900). Las levaduras tienen enzimas del metabolismo de la galactosa sólo en presencia de lactosa o galactosa Genes constitutivos - Se expresan al mismo nivel en todas las células Genes regulados - Se expresan a distintos niveles según el ambiente o el tipo celular

Objetivos de la regulación Adaptación - Respuestas a cambios o señales ambientales Desarrollo / diferenciación (sección 2.14) - Especialización celular (aunque todas las células tengan el mismo genoma) Armonía estructural / equilibrio celular –  Ejemplo: Ciclo celular

27


Niveles de regulación 2.9

La cantidad de proteína funcional se puede controlar en distintos pasos del proceso de expresión génica

Elementos reguladores y proteínas de unión a ADN 2.9

Gen estructural Codifica una proteína que interviene en el metabolismo celular que o desempeña un papel estructural en la célula

Gen regulador Su producto interacciona con otras secuencias y afecta a su transcripción o expresión

Proteína de unión a ADN Se une a un elemento regulador

Elemento regulador Secuencia de ADN que afecta la expresión de las secuencias a las que está físicamente ligada

28


Proteínas de unión a ADN 2.9

Hélice-lazo-hélice

Hélice-giro-hélice

Cremallera de leucina

Dedo de zinc

Ciclo lítico y lisogenia en virus 2.10

Infección

Lisis

Lisogenia

Replicación

Integración

Síntesis de cápsidas

Mantenimiento como profago

Empaquetamiento y liberación

Fago lambda

29


Cascada regulatoria del fago de T4 2.10

Infección Transcripcion de genes tempranos por la ARN polimerasa bacteriana Síntesis de una proteína que interfiere con el sigma bacteriano

Genes tempranos

Síntesis de un sigma propio para genes intermedios Síntesis de un sigma propio para genes tardíos

Genes intermedios Genes tardios

Lisis Otros mecanismos de cascada:

-  Antiterminadores. Proteínas que permiten que la transcripción produzca un ARNm más largo -  Represores de genes expresados anteriormente - ARN polimerasa propia, que reconoce sus propios promotores

Regulación de la utilización de lactosa en E.coli 2.10 galactosa

β-galactosidasa

lactosa

La lactosa induce la actividad y es sustrato de la enzima

glucosa

Inductor: compuesto a cuya presencia responde la célula con la expresión de uno o más genes

El IPTG induce la actividad pero no es sustrato de la enzima

β-galactosidasa

El X-gal no induce la actividad pero es sustrato de la enzima

Isopropil-tiogalactosido (IPTG) galactosa

reacción espontánea

β-galactosidasa

X-gal

5,5’-dibromo-4,4’-dicloro-índigo

30


El operón lac de E. coli 2.10

Jacob y Monod (1961)

François Jacob

Descubrimiento del primer operón bacteriano La lactosa induce la síntesis de β-galactosidasa, permeasa y transacetilasa, codificados por los genes lacZ, lacY y lacA El operón está formado por un gen regulador (lacI) con su propio promotor, y los tres genes estructurales, lacZ, lacY y lacA, que comparten un promotor (P) y un operador (O). LacI es un represor capaz de bloquear la transcripción del operón uniendose al operador P

lacI

lacZ

P O

lacY

lacA Jacques Monod

Represor

Nobel de Medicina y Fisiología Jacob, Lwoff, Monod, 1965

β-galactosidasa Transacetilasa Permeasa

El mecanismo que regula la expresión del operón se investigó mediante la obtención y análisis de mutantes (Tema 3)

Regulación del operón lac por lactosa 2.10

Ausencia de lactosa

lacI

P

P

O

lacZ

lacY

lacA

Represor

Presencia de lactosa

P

lacI

P

O

lacZ

lacY

lacA

Represor β-galactosidasa

Transacetilasa

Permeasa

31


El represor funciona como tetrámero 2.10

P

lacI

P

lacZ

O

lacY

lacA

La realidad molecular es siempre más compleja El tetrámero se une a dos secuencias operadoras, de las cuales una es el operador “principal”

Secuencia del operador lac

Control catabólico del operón lac El operón de la lactosa solo se expresa eficientemente en ausencia de glucosa

Niveles suficientes de glucosa: adenilato cilcasa inactiva

2.10

ATP Niveles bajos de glucosa: adenilato ciclasa activa

ATP ATP Adenilato ciclasa

La regulación por glucosa del operon lac es llevada a cabo por un activador (CAP), que es operativo solo cuando está unido a AMPc

AMPc Fosfodiesterasa de AMPc

AMP

AMPc

+

La unión de CAP-AMPc estimula la transcripción

32


Regulación del operón lac en E. coli 2.10

dímero CAP-AMPc unido al ADN

Tipos de regulación transcripcional 2.10

En función de la respuesta que dispara la señal: Inducción (la señal induce la transcripción) Represión (la señal reprime la transcripción En función de como actúa la proteína reguladora: Control negativo (interviene un represor) Contol positivo (interviene un activador)

33


Operón del triptófano Yanofsky (1970). Operón para cinco enzimas de la ruta de síntesis de triptófano

2.10

Motivo de la regulación: las enzimas solo hacen falta cuando hay escasez de triptófano

Control negativo (1), reprimible (2) (1) (2)

Se reprime en presencia de la señal (triptófano) Es regulado por un represor El represor es inactivo en ausencia de la señal El triptófano actúa de correpresor Hay suficiente Trp  represión Escasez de Trp  inducción

Atenuación en el operón del triptófano 2.10

+Trp

-Trp

34


Redes de regulación global 2.10

Algunos ejemplos en E. coli Represión catabólica: Inactivación de operones de uso de fuentes de carbono SOS: Inducción de sistemas de reparación en respuesta a daños en el ADN Choque térmico: Respuesta a condiciones de estrés Control estricto:

Respuesta a hambre de aminoácidos

GTP Escasean nutrientes

Carácterísticas del control estricto Señales: Reducción del aporte de cualquier aminoácido Mutación en una aminoacil ARNt sintetasa Entrada de ARNt no cargado en el ribosoma Síntesis de pppGpp por RelA (proteína asociada a aprox. 0.5% ribosomas) Respuesta: Reducción masiva en la síntesis de ARNr y ARNt Disminución de la expresión de numerosos genes Reducción de la actividad metabólica Aumento en la degradación de proteínas

ATP AMP

Señalización del control estricto

GDP + PPi

SpoT Hay nutrientes

RelA

pppGpp

Proteínas ribosómicas

ppGpp

Organización de los genes Los genes procariotas suelen estar organizados en operones

2.11

Inicios de la traducción para más de un gen

ARNm procariota

Las unidades transcripcionales eucariotas son monocistrónicas

ARNm eucariota

Los genes eucariotas se regulan individualmente En eucariontes superiores, predomina la regulación positiva sobre negativa (abundancia de genes inactivos) Al avanzar en complejidad en la escala evolutiva, mayor número de genes cuya expresión es modulada por múltiples señales regulatorias

35


Ejemplo de regulación en eucariontes inferiores 2.11

Regulación por Gal3, Gal80 y Gal4 de los genes de utilización de galactosa de Saccharomyces (genes gal)

Los genes gal solo se expresan si hay galactosa La expresión requiere la activación por Gal4 Gal80p2 impide la activación por Gal4

galactosa

Gal4: activador Gal80: co-represesor Gal3: sensor de galactosa UAS: “upstream activating sequence” No hay transcripción

Hay transcripción

Ensamblaje de la maquinaria de transcripción Los componentes de la maquinaria de transcripción se unen de forma secuencial

2.11

La accesibilidad a los promotores está limitada por la estructura de la cromatina: la activación requiere cambios estructurales

Activadores

Represores

Coactivadores Factores de transcripción basal

36


Regulación múltiple: Elementos de respuesta Un mismo factor puede controlar a muchos genes que comparten secuencias de reconocimiento denominadas elementos de respuesta

Ejemplos de elementos de respuesta

2.11

HRE: elemento de respuesta a choque térmico GRE: elemento de respuesta a glucocorticoides SRE: elemento de respuesta al suero BLE: elemento de nivel basal MRE: elemento de respuesta a metales

Ejemplo de regulacón múltiple de un gen: región reguladora del gen de la metalotioneína

Puntos de regulación postranscripcional 2.12

Una vez sintetizado un ARNm, existen distintas opciones para controlar la cantidad de proteína funcional que se va a sintetizar

37


Regulación por ARN antisentido en E. coli 2.12

Ejemplo: regulación por presión osmótica del gen ompF

Cuando la presión osmótica es alta, se sintetiza un ARN cuya función es unirse al ARNm del gen ampF e impedir su traducción

Maduración alternativa de ARNm 2.12

Ejemplo de regulación: La diferenciación sexual en Drosophila es controlada por un mecanismo de maduración alternativa del gen tra

La ausencia del exón B hace que la proteína TRA sea funcional, y active los genes del desarrollo del sexo masculino

Ejemplo: corte y empalme alternativo del pre-ARNm tra

38


ARN interferente y silenciamiento 2.12

Nobel de Medicina y Fisiolog铆a Craig, Mello, 2006

Regulaci贸n a nivel de estabilidad de ARNm 2.12

39


Regulación de la traducción 2.12

Ejemplo: Regulación de la traducción del ARNm de los genes de la ferritina y la transferrina

En ausencia de hierro, la aconitasa bloquea la traducción del ARNm de la ferritina y estabiliza el ARNm del receptor de trasferrina

Ferritina: proteína almacenadora de hierro Transferrina: proteína transportadora de hierro en el plasma Receotr de trasnferrina: proteína que recibe el hierro de la trasnferrina

Regulación postraduccional (1) 2.12

40


Regulación postraduccional (2) 2.12

Metilación del ADN y transcripción 2.13

En muchos eucariontes el ADN se modifica por metilación de bases y azúcares Niveles altos de metilación en citosina en sitios CpG se asocian con bajos niveles de expresión génica

citosina CH3!

5’-mCG-3’

3’-GCm-5’ 5-metilcitosina

41


Estructura de la cromatina y transcripción La cromatina transcripcionalmente inerte es insensible a DNasa I La cromatina transcripcionalmente activa es sensible a DNasa I

2.13

Remodelación de la cromatina –  Complejos de remodelación: proteínas que reubican nucleosomas –  Acetilación de histonas –  Metilación de histonas

•  HAT: enzimas histona acetiltransferasas •  HDAC: enzimas histona desacetilasas

Modificaciones de las histonas Las histonas modificadas son reconocidas por proteínas remodeladoras de cromatina

2.13

42


Conceptos básicos del desarrollo 2.14

Concepto de desarrollo en Genética Proceso por el que se forma un organismo adulto a partir de una célula única llamada cigoto Programa de cambios estructurales normalmente asociado a proliferación celular y especialización de diferentes tipos celulares (diferenciación) En sentido amplio, cualquier proceso que implique cambio o especialización celular

Diferenciación y determinación

La diferenciación es el cambio en la función, organización y/o morfología celular debido a cambios en la expresión de sus genes. La determinación es el cambio genético sufrido por una célula que conduce inexorablemente a un tipo de diferenciación en el futuro. La diferenciación está asociada a especialización, y es con frecuencia irreversible.

Modelos de desarrollo: Drosophila 2.14

A 25°C

Wolpert Principles of Development

43


Desarrollo temprano del embrión de Drosophila 2.14

Blastodermo sincitial

Blastodermo celular

Segmentación (3+3+10) Asimetría: antero-posterior dorso-ventral

Actuación de genes en cascada 2.14

Genes maternos

Genes “gap” (hueco) Genes de la regla par

Genes cigóticos

Genes de la polaridad segmental Genes homeóticos

44


Desarrollo de 贸rganos 2.14

Discos imaginales

Mutantes home贸ticos (alteraciones en la formaci贸n de estructuras) Concepto de mutaci贸n: Tema 3

Modelos de desarrollo: Caenorhabditis 2.14

45


Desarrollo temprano del embrión de Caenorhabditis 2.14

D

V

Mapas de destino 2.14

horas 0

10

faringe y neuronas

intestino

Línea germinal

20

30

40

50

epidermis

vulva 959 células

gónadas somáticas

46


Otros modelos de desarrollo animal Sapo

Pollo

Rat贸n

Pez cebra

2.14

Similitudes embrionarias pez

reptil

tortuga

pollo

cerdo

ternero

conejo

humano

2.14

47


Señales en el desarrollo 2.14

Zigoto asimétrico

Comunicación intercelular

Difusión de señales

Contacto directo

Conexión directa

Modelo de desarrollo en plantas: Arabidopsis 2.14

48

Tema 2 ~ Genetica  

Tema 2 de genetica ~Segundo cuatrimestre

Read more
Read more
Similar to
Popular now
Just for you