Page 1

‫داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‬ ‫دوره ‪68‬‬

‫ﺷﻤﺎره ‪9‬‬

‫آذر ‪1389‬‬

‫ﺻﺎﺣﺐ اﻣﺘﻴﺎز‪ :‬داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‬ ‫ﻣﺪﻳﺮ ﻣﺴﺆول‪ :‬دﻛﺘﺮ ﺳﻴﺪ ﺣﺴﻦ اﻣﺎﻣﻲرﺿﻮي‬ ‫ﺳﺮدﺑﻴﺮ‪ :‬دﻛﺘﺮ ﻧﺎدره ﺑﻬﺘﺎش‬ ‫ﻣﺪﻳﺮ اﺟﺮاﻳﻲ‪ :‬دﻛﺘﺮ ﻣﺤﻤﺪ ﻋﻠﻲ ﻧﻮﻳﺎن اﺷﺮف‬ ‫ﺷﻮراي دﺑﻴﺮان‬

‫دﻛﺘﺮ ﺷﺎﻫﻴﻦ آﺧﻮﻧﺪزاده‪ ،‬دﻛﺘﺮ ﺻﺪﻳﻘﻪ ﺑﺮﻧﺎ‪ ،‬دﻛﺘﺮ ﺟﻤﺸﻴﺪ ﺣﺎﺟﺘﻲ‪ ،‬دﻛﺘﺮ ﻧﻴﻤﺎ رﺿﺎﻳﻲ‪ ،‬دﻛﺘﺮ ﻧﮕﺎر ﺳﺠﺎدﻳﺎن‪ ،‬دﻛﺘﺮ ﻋﻠﻲ ﻋﺮبﺧﺮدﻣﻨﺪ‪،‬‬ ‫دﻛﺘﺮ ﻧﻌﻤﺖاﷲ ﻋﻄﺎﻳﻲ‪ ،‬دﻛﺘﺮ راﻣﺶ ﻋﻤﺮاﻧﻲﭘﻮر‪ ،‬دﻛﺘﺮ ﻣﺤﻤﻮد ﻗﺎﺿﻲ ﺧﻮاﻧﺴﺎري‪ ،‬دﻛﺘﺮ ﺳﻴﺪﺟﻮاد ﻗﺎﺿﻲ ﻣﻴﺮ ﺳﻌﻴﺪ‪ ،‬دﻛﺘﺮ ﻣﻬﺮي ﻛﺪﺧﺪاﻳﻲ‪،‬‬ ‫دﻛﺘﺮ ﺳﻴﻨﺎ ﻣﺮادﻣﻨﺪ‪ ،‬دﻛﺘﺮ زﻳﻨﺖ ﻧﺎدﻳﺎﺣﺘﻤﻲ‪ ،‬دﻛﺘﺮ ﻣﺤﻤﺪ ﻋﻠﻲ ﻧﻮﻳﺎن اﺷﺮف‬ ‫ﻫﻴﺄت ﺗﺤﺮﻳﺮﻳﻪ‬

‫دﻛﺘﺮ ﻧﺎﺻﺮ اﺑﺮاﻫﻴﻤﻲ درﻳﺎﻧﻲ‪ ،‬دﻛﺘﺮ ﻣﺤﻤﻮد اﻛﺒﺮﻳﺎن‪ ،‬دﻛﺘﺮ ﻓﺮﻧﺎز آﻣﻮزﮔﺎر ﻫﺎﺷﻤﻲ‪ ،‬دﻛﺘﺮ ﺑﺎﺑﻚ ﺑﻬﺎر‪ ،‬دﻛﺘﺮ ﭘﺮوﻳﻦ ﭘﺎﺳﺎﻻر‪ ،‬دﻛﺘﺮ ﭘﺮﻳﭽﻬﺮ ﭘﺎﺳﺒﺨﺶ‪،‬‬ ‫دﻛﺘﺮ زاﻫﺪ ﺣﺴﻴﻦ ﺧﺎن‪ ،‬دﻛﺘﺮ زﻫﺮا ﺣﻼﺟﻲ‪ ،‬دﻛﺘﺮ ﻓﺎﻃﻤﻪ داوري ﺗﻨﻬﺎ‪ ،‬دﻛﺘﺮ ﻣﻬﺮﻧﺎز رﺳﻮﻟﻲﻧﮋاد‪ ،‬دﻛﺘﺮ ﻣﺴﻌﻮد ﺳﺘﻮده‪ ،‬دﻛﺘﺮ ﻋﻠﻴﺮﺿﺎ ﺷﻌﺒﺎﻧﻲ‪،‬‬ ‫دﻛﺘﺮ اﺣﻤﺪرﺿﺎ ﻃﻼﺋﻲﭘﻮر‪ ،‬دﻛﺘﺮ ﻣﺤﻤﺪرﺿﺎ ﻇﻔﺮﻗﻨﺪي‪ ،‬دﻛﺘﺮ ﻣﺤﻤﺪ ﻛﺠﺒﺎفزاده‪ ،‬دﻛﺘﺮ ﺳﻴﺪ ﻣﺤﻤﺪﺟﻮاد ﻣﺮﺗﻀﻮي‪ ،‬دﻛﺘﺮ اﻋﻈﻢاﻟﺴﺎدات ﻣﻮﺳﻮي‪،‬‬ ‫دﻛﺘﺮ ﻣﺤﻤﺪﺟﻮاد ﻣﻴﻜﺎﺋﻴﻠﻲ‪ ،‬دﻛﺘﺮ ﺑﻬﺮوز ﻧﺒﺌﻲ‪ ،‬دﻛﺘﺮ ﻣﺮﺿﻴﻪ وﺣﻴﺪ دﺳﺘﺠﺮدي‪ ،‬دﻛﺘﺮ ﻣﺤﻤﺪرﺿﺎ ﻫﺎدﻳﺎن‬ ‫ﻫﻴﺄت ﺗﺤﺮﻳﺮﻳﻪ ﺑﻴﻦ اﻟﻤﻠﻠﻲ‬

‫دﻛﺘﺮ ﻓﺮﻫﻨﺎك اﺳﺪي )ﺷﻴﻜﺎﮔﻮ(‪ ،‬دﻛﺘﺮ ﺟﻮاد ﭘﺮوﻳﺰي )ﻓﻴﻼدﻟﻔﻴﺎ(‪ ،‬دﻛﺘﺮ ﻣﺤﻤﺪرﺿﺎ ﻛﺸﺘﮕﺮ )ﻟﻨﺪن(‪ ،‬دﻛﺘﺮ اﻓﺸﻴﻦ ﮔﻨﺠﻲ )اﺳﺘﺮاﺳﺒﻮرگ(‪،‬‬ ‫دﻛﺘﺮ ﺷﻬﻼ ﻣﺴﻌﻮد )ﻓﻠﻮرﻳﺪا(‪ ،‬دﻛﺘﺮ ﭘﺮوﻳﺰ ﻫﻨﺠﻨﻲ )ﭘﻨﺴﻴﻠﻮاﻧﻴﺎ(‬ ‫وﻳﺮاﺳﺘﺎران‬

‫دﻛﺘﺮ ﻧﺎدره ﺑﻬﺘﺎش‪ ،‬دﻛﺘﺮ ﻣﺤﻤﺪ ﻋﻠﻲ ﻧﻮﻳﺎن اﺷﺮف‬ ‫ﻫﻤﻜﺎران دﻓﺘﺮ ﻣﺠﻠﻪ‬

‫ﺣﺴﻴﻦ ﭼﺎﻳﭽﻲ‪ ،‬راﺣﻠﻪ رﻣﻀﺎﻧﻲ‪ ،‬ﺳﺤﺮ ﺻﺪﻳﻖ‪ ،‬ﻣﻌﺼﻮﻣﻪ ﻋﺴﮕﺮي‪ ،‬آرزو ﻛﻤﻴﺰاﻧﻲ‬ ‫ﻧﺸﺎﻧﻲ‪ :‬ﺗﻬﺮان‪ ،‬ﺧﻴﺎﺑﺎن ﻗﺪس‪ ،‬ﺧﻴﺎﺑﺎن ﭘﻮرﺳﻴﻨﺎ‪ ،‬داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬ﺳﺎﺧﺘﻤﺎن آﻣﻮزش‪ ،‬ﻃﺒﻘﻪ اول‪ ،‬ﺷﻤﺎره ‪ ،202‬دﻓﺘﺮ ﻣﺠﻠﻪ‬ ‫آدرس اﻟﻜﺘﺮوﻧﻴﻚ‪ http://tumj.tums.ac.ir :‬ﭘﺴﺖ اﻟﻜﺘﺮوﻧﻴﻚ‪medjournal@tums.ac.ir :‬‬ ‫ﺻﻨﺪوق ﭘﺴﺘﻲ ‪ ،14155/6447‬ﺗﻠﻔﻜﺲ‪Online submission: http://journals.tums.ac.ir/login ، 88962510 :‬‬ ‫ﺑﺮاﺳﺎس ﻣﺼﻮﺑﻪ ﻛﻤﻴﺴﻴﻮن ﻧﺸﺮﻳﺎت ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﻛﺸﻮر‪ ،‬ﺑﻪ ﻧﻮﻳﺴﻨﺪﮔﺎن ﻣﻘﺎﻻت اﻳﻦ ﻣﺠﻠﻪ اﻣﺘﻴﺎز ارﺗﻘﺎي ﻋﻠﻤﻲ ﭘﮋوﻫﺸﻲ ﺗﻌﻠﻖ ﻣﻲﮔﻴﺮد‪.‬‬ ‫ﺗﻴﺮاژ‪ 1000 :‬ﻧﺴﺨﻪ‬

‫ﻟﻴﺘﻮﮔﺮاﻓﻲ‪ ،‬ﭼﺎپ و ﺻﺤﺎﻓﻲ‪ :‬ﺑﻬﺮﻧﮓ‬

‫)راﻳﮕﺎن(‬

‫ﻧﻤﺎﻳﻪ ﺷﺪه در‪:‬‬

‫‪SCOPUS, EMBASE, Cambridge Scientific Abstracts (CSA), CAB Abstracts (CABI), Chemical Abstract Service (CAS),‬‬ ‫‪DOAJ, Psych Info, ULRICH΄S, Index Copernicus, IMEMR, EMR Beta, SID, Magiran, Iran Medex‬‬

‫‪http://tumj.tums.ac.ir‬‬


‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‬ ‫دوره ‪68‬‬

‫ﺷﻤﺎره ‪9‬‬

‫آذر ‪1389‬‬

‫ﻓﻬﺮﺳﺖ‬ ‫ﭘﺎراﺗﻮرﻣﻮن ﻧﻮﺗﺮﻛﻴﺐ و ﭘﻮﻛﻲ اﺳﺘﺨﻮان ‪ :‬ﻣﻘﺎﻟﻪ ﻣﺮوري‪497............................................................................... .................................................................‬‬ ‫ﺑﺎﻗﺮ ﻻرﻳﺠﺎﻧﻲ‪ ،‬اﺷﺮف ﻋﻠﻲ ﻣﺪدي‬

‫ﺟﺪاﺳﺎزي ﺳﻠﻮلﻫﺎي ﭘﻴﺶﺳﺎز ﻣﺸﺘﻖ از ﻓﻮر اﺳﻜﻴﻦ اﻧﺴﺎﻧﻲ و ﺗﻤﺎﻳﺰ آنﻫﺎ ﺑﻪ ﻧﻮرون و ﺳﻠﻮل ﮔﻠﻴﺎل‪508......................................................................................‬‬ ‫ﻣﻴﺘﺮا ﺑﺨﺘﻴﺎري‪ ،‬ﻛﺎﻣﺮان ﻣﻨﺼﻮري‪ ،‬ﻋﻠﻲ ﻣﺼﻄﻔﺎﻳﻲ‪ ،‬ﻳﻮﺳﻒ ﺻﺎدﻗﻲ‪ ،‬ﻫﺎدي ﻣﻈﻔﺮي‪ ،‬رﺳﺘﻢ ﻗﺮﺑﺎﻧﻲ‪ ،‬ﻣﺼﻄﻔﻲ رﺿﺎﻳﻲ ﻃﺎوﻳﺮاﻧﻲ‬

‫ﺑﺮوز ﻣﺎرﻛﺮ اﻳﻤﻮﻧﻮﻫﻴﺴﺘﻮﺷﻴﻤﻲ ‪ p16‬در ﺑﺎﻓﺖ ﻃﺒﻴﻌﻲ و ﺗﻮﻣﻮرال ﻣﻴﻮﻣﺘﺮ در ‪ 136‬ﺑﻴﻤﺎر‪516.....................................................................................................‬‬ ‫زﻫﺮا ﻓﺮوﻫﺶ ﺗﻬﺮاﻧﻲ‪ ،‬ﻋﻠﻴﺮﺿﺎ ﭘﺎﻳﻜﺎري‪ ،‬ﻋﻠﻲ ﻣﻼﻳﺮي‬

‫ﺑﺮرﺳﻲ رﻳﺴﻚﻓﺎﻛﺘﻮرﻫﺎي ﻧﻴﺎز ﺑﻪ اﻧﺘﻘﺎل ﺧﻮن در ﺑﻴﻤﺎران ﺗﺤﺖ ﻋﻤﻞ ﺑﺎيﭘﺲ ﺷﺮﻳﺎن ﻛﺮوﻧﺮ ﺑﺪون اﺳﺘﻔﺎده از ﭘﻤﭗ‪522.................................................................‬‬ ‫ﺳﻴﺪ ﺧﻠﻴﻞ ﻓﺮوزانﻧﻴﺎ‪ ،‬ﻣﻬﺪي ﺣﺪادزاده‪ ،‬ﺳﻴﺪ ﺟﻠﻴﻞ ﻣﻴﺮﺣﺴﻴﻨﻲ‪ ،‬ﺣﺒﻴﺐاﻟﻪ ﺣﺴﻴﻨﻲ‪ ،‬ﻣﺤﻤﺪﺣﺴﻦ ﻋﺒﺪاﻟﻬﻲ‪ ،‬ﻣﺤﻤﺪ ﻓﺮاتﻳﺰدي‪ ،‬ﻣﺠﻴﺪ راﺳﺘﻲ‪ ،‬ﺣﻤﺰه دﻫﻘﺎﻧﻲزاده‪ ،‬ﺳﻴﺪ ﻣﺤﻤﺪ ﻗﺮﻳﺸﻴﺎن‬

‫ﺑﺮرﺳﻲ ﺗﺎﺛﻴﺮ ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ ﻣﻮﺿﻌﻲ در ﻛﺎﻫﺶ ﻣﻴﺰان ﺧﻮﻧﺮﻳﺰي ﭘﺲ از ﺟﺮاﺣﻲ ﻻﻣﻴﻨﻜﺘﻮﻣﻲ‪527.......................................................................................‬‬ ‫ﻫﻮﺷﻨﮓ ﺻﺎﺑﺮي‪ ،‬ﺳﻴﺪ ﻣﺠﺘﺒﻲ ﻣﻴﺮي‪ ،‬ﻣﻨﺼﻮر ﭘﺮدل ﻧﺎﻣﺪار‬

‫ﻧﻘﺶ ﻋﻔﻮﻧﺖ اﺳﺘﺮﭘﺘﻮﻛﻮك ﺑﺘﺎﻫﻤﻮﻟﺘﻴﻚ ﮔﺮوه ‪ A‬در ﺑﻴﻤﺎران ﻣﺒﺘﻼ ﺑﻪ ﺗﻴﻚ و ﺗﻮره‪534.............................................................................................................‬‬ ‫ﺛﻤﻴﻠﻪ ﻧﻮرﺑﺨﺶ‪ ،‬ﺑﻬﺮوز ﺟﻠﻴﻠﻲ‪ ،‬اﺣﻤﺪرﺿﺎ ﺷﻤﺸﻴﺮي‪ ،‬اﻟﻬﺎم ﺷﻴﺮازي‪ ،‬آذردﺧﺖ ﻃﺒﺎﻃﺒﺎﺋﻲ‪ ،‬رﺿﺎ ﺗﻘﻲﭘﻮر‪ ،‬اﺣﻤﺪ ﻣﺪرس ﻓﺘﺤﻲ‬

‫ﻧﻘﺶ ﮔﻴﺮﻧﺪهﻫﺎي ﻫﻮرﻣﻮﻧﻲ اﺳﺘﺮوژن و ﭘﺮوژﺳﺘﺮون در درﻣﺎن ﻛﻨﺴﺮواﺗﻴﻮ آدﻧﻮﻛﺎرﺳﻴﻨﻮم ﺧﻮب ﺗﻤﺎﻳﺰﻳﺎﻓﺘﻪ اﻧﺪوﻣﺘﺮ ﻣﺮﺣﻠﻪ ‪ Ia‬ﺑﺎ ﻣﮋﺳﺘﺮول اﺳﺘﺎت‪541.........................‬‬ ‫ﻓﺮﻳﺒﺎ ﻳﺎرﻧﺪي‪ ،‬اﻟﻬﺎم ﺷﻴﺮﻋﻠﻲ‪ ،‬زﻫﺮا اﻓﺘﺨﺎر‪ ،‬زﻫﺮا ﺧﺰاﻋﻲﭘﻮر‬

‫ﻣﻘﺎﻳﺴﻪ ﺗﺎﺛﻴﺮ ﺗﺰرﻳﻖ ﺗﻮﻛﺴﻴﻦ ﺑﻮﺗﻮﻟﻴﻨﻴﻮم و اﺳﻔﻨﻜﺘﺮوﺗﻮﻣﻲ ﺟﺎﻧﺒﻲ‪ -‬داﺧﻠﻲ در درﻣﺎن ﻓﻴﺸﺮآﻧﺎل ﻣﺰﻣﻦ‪547..................................................................................‬‬ ‫ﻣﻬﺪي ﻋﺴﮕﺮي‪ ،‬ﺳﻴﺪ ﻣﺴﻴﺢ ﻣﻴﺮرﻛﻨﻲ‬

‫ﻣﻘﺎﻳﺴﺔ ﻧﺘﺎﻳﺞ ﺗﺮﻣﻴﻢ ﺟﺮاﺣﻲ ﺳﻴﻨﻮس ﭘﺎﻳﻠﻮﻧﻴﺪال ﺑﻪروش ‪‬ﺗﺮﻣﻴﻢ اوﻟﻴﻪ‪ ‬ﺑﺎ ‪‬ﺗﺮﻣﻴﻢ ﺛﺎﻧﻮﻳﻪ‪553..................................................................................................‬‬ ‫ﺑﺎﺑﻚ ﺣﺎﺟﻲ ﺑﺮاﺗﻲ‪ ،‬ﻋﻠﻲ ﻏﻔﻮري‬

‫ﻋﻔﻮﻧﺖ ﻫﻤﺰﻣﺎن آدﻧﻮوﻳﺮوس ﺑﺎ وﻳﺮوس اﻧﻔﻠﻮاﻧﺰاي ﺧﻮﻛﻲ ﻧﻮع ‪ A‬و آدﻧﻮوﻳﺮوس ﺑﺎ وﻳﺮوس ﺳﻴﻨﺴﻴﺸﻴﺎل ﺗﻨﻔﺴﻲ‪ :‬ﮔﺰارش دو ﻣﻮرد‪559.................................................‬‬ ‫ﺳﻤﻴﻪ ﺷﺎﻃﻲ زاده ﻣﻠﻚ ﺷﺎﻫﻲ‪ ،‬ژﻳﻼ ﻳﺎورﻳﺎن‪ ،‬ﻣﺮﻳﻢ ﻧﺎﺻﺮي‪ ،‬ﻓﺮﻫﺎد رﺿﺎﻳﻲ‪ ،‬ﻃﻠﻌﺖ ﻣﺨﺘﺎري آزاد‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬


‫راﻫﻨﻤﺎي ﻧﻮﻳﺴﻨﺪﮔﺎن‬ ‫‪ -1‬اﺻﻮل ﻛﻠﻲ‪ -1-1 :‬آﻳﻴﻦ ﻧﮕﺎرش زﺑﺎن ﻓﺎرﺳﻲ ﺑﻪﻃﻮر ﻛﺎﻣﻞ رﻋﺎﻳﺖ ﺷـﺪه و از‬

‫ﺳﻴﺎه و ﺳﻔﻴﺪ و دوﺑﻌﺪي ﺑﺎﺷﺪ و ﻋﻨﻮان ﺟﺪول ﺑﺎﻻي آن و در ﻧﻤـﻮدار زﻳـﺮ آن ﻗـﺮار‬

‫ﺑﻪﻛﺎر ﺑﺮدن ﻛﻠﻤﺎت ﺧﺎرﺟﻲ ﻛﻪ ﻣﻌﺎدلﻫﺎي دﻗﻴﻖ و رﺳﺎﻳﻲ در زﺑﺎن ﻓﺎرﺳﻲ دارﻧﺪ‪،‬‬

‫ﮔﻴﺮد )ﺑﺎ ذﻛﺮ ﺷﻤﺎره(‪ .‬ﺑﺎ ﺗﻮﺟﻪ ﺑﻪ ﻣﺤﺪودﻳﺖ ﺻﻔﺤﺎت ﻣﺠﻠﻪ‪ ،‬ﺑﺪﻳﻬﻲ اﺳـﺖ از ﺗﻜـﺮار‬

‫ﺧﻮدداري ﺷﻮد‪ -1-2 .‬ﻣﻘﺎﻻت ارﺳﺎﻟﻲ در ﭼﻬﺎر ﻧـﺴﺨﻪ )ﻳـﻚ ﻧـﺴﺨﻪ اﺻـﻞ و ﺳـﻪ‬

‫اراﻳﻪ ﻣﻄﺎﻟﺒﻲ ﻛﻪ در ﻣﺘﻦ آورده ﺷﺪهاﻧﺪ در ﺟـﺪاول و ﺑـﺎﻟﻌﻜﺲ ﺑﺎﻳـﺪ اﺟﺘﻨـﺎب ﻧﻤـﻮد‪،‬‬

‫ﻧﺴﺨﻪ ﻛﭙﻲ( ﺗﻬﻴﻪ و ﺗﺤﻮﻳﻞ دﻓﺘﺮ ﻣﺠﻠﻪ ﮔﺮدﻧـﺪ‪ -1-3 .‬ﻣﻄﺎﻟـﺐ ﻣﻘﺎﻟـﻪ ﻓﻘـﻂ ﺑـﺮ روي‬

‫ﺟﺪاول و ﻧﻤﻮدارﻫﺎ ﻓﺎرﺳﻲ ﺑﺎﺷﻨﺪ‪ .‬ﺑﺤﺚ‪ -1 :‬آﺛﺎر و اﻫﻤﻴﺖ ﻳﺎﻓﺘﻪﻫﺎي ﺑﻪدﺳﺖ آﻣﺪه‬

‫ﻳﻚﻃﺮف ﻛﺎﻏﺬ ‪ A4‬و ﺑﻪﺻﻮرت ﻳﻚ ﺳﺘﻮﻧﻲ و ﻳﻚ ﺧﻂ درﻣﻴـﺎن ﺑـﺎ رﻋﺎﻳـﺖ ﺣﺎﺷـﻴﻪ‬

‫و ﻣﺤﺪودﻳﺖ آنﻫﺎ ‪ -2‬ذﻛﺮ ﻧﺘﺎﻳﺞ ﺗﺤﻘﻴﻖ ﻣـﺸﺎﺑﻪ دﻳﮕـﺮان و ذﻛـﺮ ﻣﻐـﺎﻳﺮات و ﻣـﻮارد‬

‫ﻻزم )ﺣﺪاﻗﻞ دو ﺳﺎﻧﺘﻲﻣﺘﺮ( ﺗﺎﻳﭗ ﮔﺮدﻧﺪ و ﻫﻤﻪ ﺻﻔﺤﺎت ﺷﻤﺎرهﮔﺬاري ﺷﻮﻧﺪ‪-1-4 .‬‬

‫ﻧﻘﺾﻛﻨﻨﺪه ‪ -3‬ﺗﻮﺿﻴﺢ ﻋﻠﺖ ﺗﻔﺎوت ﺑﻴﻦ ﻧﺘﺎﻳﺞ اﻳﻦ ﺗﺤﻘﻴﻖ ﺑﺎ ﺑﻘﻴﻪ ‪ -4‬ﺗﻮﺿـﻴﺢ ﻣـﻮارد‬

‫ﻣﻘﺎﻟﻪ ارﺳﺎﻟﻲ ﺑﻪﻃﻮر ﻫﻤﺰﻣﺎن ﺑﺮاي ﺳﺎﻳﺮ ﻣﺠﻼت ارﺳﺎل ﻧﮕﺮدد و در ﺳﺎﻳﺮ ﻣﺠﻼت‬

‫ﻛﺎرﺑﺮد ﻋﻤﻠﻲ و ﻗﺎﺑﻠﻴﺖ ﺗﻌﻤﻴﻢﭘﺬﻳﺮي ﻧﺘﺎﻳﺞ ﺑﻪدﺳﺖ آﻣـﺪه ‪ -5‬راﻫﻨﻤـﺎﻳﻲ ﺑـﺮاي اداﻣـﻪ‬

‫)ﺣﺘﻲ ﺑﻪ زﺑﺎن اﻧﮕﻠﻴﺴﻲ و ﻏﻴﺮه( ﺑﻪ ﭼﺎپ ﻧﺮﺳﻴﺪه ﺑﺎﺷﺪ‪ -1-5 .‬ﻟـﻮح ﻓـﺸﺮده ﻣﻘﺎﻟـﻪ‬

‫ﺗﺤﻘﻴﻖ ﺧﻮد ﻳﺎ دﻳﮕﺮان‪ ،‬در ﻣﺠﻤﻮع اراﻳﻪ آﻧﭽﻪ ﻛﻪ از اﻳﻦ ﺗﺤﻘﻴﻖ ﺑﻪ ﻋﻠﻢ اﺿـﺎﻓﻪ ﺷـﺪه‬

‫)ﺗﺮﺟﻴﺤﺎً ﺑﺎ ﺑﺮﻧﺎﻣﻪ ‪ Word XP‬ﻳﺎ ﺑﺎﻻﺗﺮ( ﺑﺎ اﻋﻤﺎل آﺧﺮﻳﻦ اﺻﻼﺣﺎت ﻣﻮرد ﻧﻈﺮ‪ ،‬ﭘﺲ از‬

‫اﺳﺖ‪ .‬ﻣﻨﺎﺑﻊ‪ :‬ﺷﻤﺎره ﻣﻨﺎﺑﻊ ﺑﻪﻛﺎر ﮔﺮﻓﺘﻪ ﺷﺪه در ﻣﺘﻦ ﺑﺎﻳﺴﺘﻲ ﻗﻴﺪ ﺷﻮد و ﺑﻪﻃﻮر ﻗﻄﻌـﻲ‬

‫درﻳﺎﻓﺖ ﻧﺎﻣﻪ ﭘﺬﻳﺮش ﻣﻘﺎﻟﻪ‪ ،‬ﺑﻪ دﻓﺘﺮ ﻣﺠﻠﻪ اراﻳﻪ ﮔـﺮدد‪ -1-6 .‬ﻧـﻮع ﻣﻘـﺎﻻت ﭘﺬﻳﺮﻓﺘـﻪ‬

‫ﺑﺎﻳـﺪ از ﻋﺪد ﻳﻚ ﺷﺮوع و ﺑﻪﺗﺮﺗﻴـﺐ اﺿـﺎﻓﻪ ﮔـﺮدد‪ .‬ﺿـﻤﻦ اﻧﻄﺒـﺎق ﻛﺎﻣـﻞ ﺗﻌـﺪاد‬

‫ﺷﺪه ﺷﺎﻣﻞ ﻣﻘﺎﻻت ﺗﺤﻘﻴﻘـﻲ‪ ،‬ﻣﻘـﺎﻻت ﻣـﺮوري )از ﻧﻮﻳـﺴﻨﺪﮔﺎن ﺑـﺎ ﺗﺠﺮﺑـﻪ ﻛـﺎﻓﻲ و‬

‫رﻓﺮاﻧﺲﻫﺎي ﻣﺤﺘﻮاي ﻣﻘﺎﻟﻪ و ﻟﻴﺴﺖ اﻧﺘﻬﺎﻳﻲ آن‪ ،‬ﻣﺘﻦ دﻗﻴﻖ رﻓﺮاﻧﺲﻫﺎ ﺑﻪﺗﺮﺗﻴﺐ ﻇﻬﻮر‪،‬‬

‫ﺻﺎﺣﺐ ﺗﺄﻟﻴﻔﺎت در ﻣﻮﺿﻮع ﻣﻘﺎﻟﻪ( و ﮔـﺰارش ﻣـﻮردي ﻣـﻲﺑﺎﺷـﺪ‪ -1-7 .‬در اﻧﺠـﺎم‬

‫در ﻓﻬﺮﺳﺖ ﻣﻨﺎﺑﻊ آورده ﺷﻮﻧﺪ‪ .‬ﻧﺤﻮه ﺗﻨﻈﻴﻢ ﻣﻨـﺎﺑﻊ ﺑـﻪ ﺷـﺮح ذﻳـﻞ ﻣـﻲﺑﺎﺷـﺪ‪ .‬ﻣﻨـﺎﺑﻊ‬

‫ﭘﮋوﻫﺶ‪ ،‬اﺻﻮل اﻋﻼﻣﻴﻪ ﻫﻠﺴﻴﻨﻜﻲ و ﺿﻮاﺑﻂ اﺧﻼق ﭘﺰﺷﻜﻲ رﻋﺎﻳﺖ ﮔﺮدد‪ -2 .‬ﻧﺤﻮه‬

‫ﺑﻪﺻﻮرت ﻛﺘﺎب‪) :‬ﻧﺎمﺧﺎﻧﻮادﮔﻲ‪ /‬ﻧﺎم ﻧﻮﻳﺴﻨﺪه‪ /‬ﻓﺼﻞ‪ /‬ﻋﻨﻮان‪ /‬ﻓﺼﻞ‪ /‬ﻋﻨﻮان ﻛﺘﺎب‪ /‬ﻧـﺎم‬

‫ﺗﻨﻈﻴﻢ ﻣﻘﺎﻻت ﺗﺤﻘﻴﻘﻲ‪ -2-1 :‬ﺻﻔﺤﻪ اول )ﺻﻔﺤﻪ ﻋﻨـﻮان( ﺑﺎﻳـﺴﺘﻲ ﺷـﺎﻣﻞ‪ :‬ﻋﻨـﻮان‬

‫ﻧﻮﻳﺴﻨﺪﮔﺎن ﻛﺘﺎب‪ /‬ﻧﺎم ﻧﺎﺷﺮ‪ /‬ﻣﺤﻞ اﻧﺘﺸﺎر‪ /‬ﺳﺎل‪ /‬ﺻﻔﺤﺎت‪:‬‬

‫ﻣﻘﺎﻟﻪ‪ ،‬ﻧﺎم و ﻧﺎمﺧﺎﻧﻮادﮔﻲ ﻧﻮﻳﺴﻨﺪﮔﺎن‪ ،‬درﺟﻪ ﻋﻠﻤﻲ و آدرس دﻗﻴﻖ ﻛﻠﻴـﻪ ﻧﻮﻳـﺴﻨﺪﮔﺎن‬ ‫)از ﺟﻤﻠﻪ ﻛﺪ ﭘﺴﺘﻲ‪ ،‬ﺗﻠﻔﻦ‪ ،‬دورﻧﮕﺎر و ‪ (E-mail‬ﻣﺤﻞ اﻧﺠﺎم ﭘﮋوﻫﺶ‪ ،‬ﻣﺴﺌﻮل ﻣﻘﺎﻟﻪ و‬ ‫ﺗﺎرﻳﺦ ارﺳﺎل ﻣﻘﺎﻟﻪ ﺑﺎﺷﺪ‪ -2-2 .‬ﺻﻔﺤﻪ دوم و ﺳﻮم ﺷﺎﻣﻞ ﺧﻼﺻﺔ ﻓﺎرﺳﻲ و اﻧﮕﻠﻴﺴﻲ‬ ‫و ﻛﻠﻤﺎت ﻛﻠﻴﺪي اﻧﮕﻠﻴﺴﻲ ﻣﻲﺑﺎﺷـﺪ‪ .‬ﭼﻜﻴﺪه ﻣﻘﺎﻟﻪ ﻧﻤﻲﺑﺎﻳﺴﺖ از ‪ 250‬ﻛﻠﻤﻪ ﺑﻴـﺸﺘﺮ‬ ‫ﺑﺎﺷﺪ و در ﭼﻬﺎر ﭘﺎراﮔﺮاف ﺑﺎ ﻋﻨﺎوﻳﻦ زﻣﻴﻨـﻪ و ﻫـﺪف‪ ،‬روش ﺑﺮرﺳـﻲ‪ ،‬ﻳﺎﻓﺘـﻪﻫـﺎ‪،‬‬

‫‪Nochols DH, Randall CL. Massive eversion of the vagina. In:‬‬ ‫‪Nichols DH, Randall CL, editors. Vaginal Surgery. 3rd ed. Baltimore:‬‬ ‫‪Williams Wilkins; 1989. p. 328-57.‬‬

‫ﻣﻨﺎﺑﻊ ﺑﻪﺻﻮرت ﻣﻘﺎﻟﻪ‪) :‬ﻧﺎمﺧﺎﻧﻮادﮔﻲ(‪ /‬ﻧﺎم‪ /‬ﻋﻨﻮان ﻣﻘﺎﻟﻪ‪ /‬ﻋﻨﻮان ﻛﺎﻣـﻞ ژورﻧـﺎل‪ /‬ﺳـﺎل‬ ‫اﻧﺘﺸﺎر‪ /‬ﺷﻤﺎره ﻣﺠﻠﻪ‪ /‬ﺻﻔﺤﺎت‪ .‬ﻣﺜﺎل‪ .1 :‬ﻛﺎوﻳــﺎﻧﻲ ﺣــﺴﻴﻦ‪ ،‬ﭘﻮرﻧﺎﺻــﺢ ﻣﻬﺮاﻧﮕﻴــﺰ‪.‬‬ ‫اﻋﺘﺒﺎرﻳﺎﺑﻲ و ﻫﻨﺠﺎرﺳﺎزي ﭘﺮﺳﺸﻨﺎﻣﻪ ﺳﺮﺷـﺖ و ﻣـﻨﺶ ﻛﻠـﻮﻧﻴﻨﺠﺮ ‪ TCI‬در ﺟﻤﻌﻴـﺖ‬ ‫اﻳﺮاﻧﻲ‪ .‬ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪1384 ،‬؛ ﺳﺎل ‪ ،63‬ﺷﻤﺎره ‪ :2‬ﺻﻔﺤﺎت ‪ 89‬ﺗﺎ ‪.98‬‬

‫ﻧﺘﻴﺠﻪﮔﻴﺮي و ﻛﻠﻤﺎت ﻛﻠﻴﺪي )ﺣـﺪاﻗﻞ ‪ 3‬و ﺣـﺪاﻛﺜﺮ ‪ 7‬واژه( ﺳـﺎزﻣﺎﻧﺪﻫﻲ ﺷـﻮد‪.‬‬

‫ﻣﻘﺎﻟﻪ ﻧﺸﺮﻳﻪ در ﻧﺴﺨﻪ اﻟﻜﺘﺮوﻧﻴﻚ‪:‬‬

‫ﺗﻮﺻﻴﻪ ﻣﻲﺷﻮد ﻧﺴﺒﺖ ‪ 1-2-2-1‬در ﺗﻬﻴﻪ ﭼﻜﻴﺪه ﺑﺎ ﭼﻬﺎر ﻋﻨﻮان ﻓـﻮق ﻣـﻮرد ﻟﺤـﺎظ‬

‫‪CDI, Clinical Dermatology Illustrated [monograph on CD-ROM].‬‬ ‫‪Reeves JRT, Maibach H. CMEA Multimedia Group, Producers. 2nd‬‬ ‫‪ed. Version 2.0 Scan Diego: CMEA; 1995.‬‬

‫ﻗﺮار ﮔﻴﺮد‪ .‬ﭼﻜﻴﺪه اﻧﮕﻠﻴﺴﻲ ﺑﺎﻳﺪ ﻛـﺎﻣﻼ ﻣﻨﻄﺒـﻖ ﺑـﺎ ﭼﻜﻴـﺪه ﻓﺎرﺳـﻲ ﺑﺎﺷـﺪ و در‬ ‫ﺑﺨﺶﻫﺎي ‪ Conclusion ،Results ،Methods ،Background‬و ‪Keywords‬‬

‫‪ -‬ﻋﻜﺲﻫﺎ‪ ،‬ﻧﻤﻮدارﻫﺎ و ﺟﺪاول ﻣﺮﺑﻮط ﺑﻪ ﻣﻘﺎﻟﻪ ﺑﻪﻫﻤـﺮاه ﺗﻮﺿـﻴﺤﺎت آنﻫـﺎ ﺑﺎﻳـﺴﺘﻲ‬

‫ﺗﻬﻴﻪ ﮔﺮدد و در ﺣﺪود ‪ 230-250‬ﻛﻠﻤﻪ ﺑﺎﺷﺪ‪ -2-3 .‬اﺻـﻞ ﻣﻘﺎﻟـﻪ ﺑﺎﻳـﺴﺘﻲ ﺷـﺎﻣﻞ‬

‫ﺟﺪاﮔﺎﻧﻪ و در دﻧﺒﺎﻟﻪ ﻣﺘﻦ اﺻﻠﻲ ﻣﻘﺎﻟـﻪ )‪ (text‬آورده ﺷـﻮد و ﺷـﻤﺎرهﮔـﺬاري ﮔـﺮدد‪.‬‬

‫ﻣﻮارد زﻳﺮ ﺑﺎﺷﺪ‪ :‬ﻣﻘﺪﻣﻪ‪ :‬ﻳﻚ ﺻﻔﺤﻪ ﺷﺎﻣﻞ‪ -1 :‬اﻃﻼﻋﺎت ﻗﺒﻠﻲ و زﻣﻴﻨﻪاي اﻧﺠﺎم ﺷﺪه‬

‫ﻛﻴﻔﻴﺖ ﺗﺼﺎوﻳﺮ ارﺳﺎﻟﻲ ﺑﺎﻳﺪ ﻣﻄﻠﻮب ﺑﺎﺷﺪ‪ .‬در اراﻳﻪ ﻋﻜﺲﻫﺎي اﺳﻜﻦ ﺷﺪه اﺳﺘﻔﺎده از‬

‫و ﺳﺎﺑﻘﻪ ﺑﺎ ذﻛﺮ رﻓﺮاﻧﺲ ‪ -2‬ﺿﺮورت اﻧﺠﺎم ﺗﺤﻘﻴﻖ ‪ -3‬ﺳﺆاﻻت ﺑﺪون ﭘﺎﺳﺨﻲ ﻛﻪ اﻳﻦ‬

‫رزوﻟﻮﺷﻦ ﺣﺪاﻗﻞ ‪ 600dpi‬ﺿﺮوري اﺳﺖ‪ .‬ﻋﻜﺲ ﻫﺎي ارﺳـﺎﻟﻲ ﺑﺎﻳـﺴﺘﻲ ﺑـﻪﺻـﻮرت‬

‫ﺗﺤﻘﻴﻖ ﺑﻪ آنﻫﺎ ﭘﺎﺳﺦ ﻣﻲﮔﻮﻳﺪ و ﺑﻴﺎن اﻳﻦ ﻣﻮﺿـﻮع ﻛـﻪ ﭼﮕﻮﻧـﻪ ﻧﺘـﺎﻳﺞ اﻳـﻦ ﺗﺤﻘﻴـﻖ‬

‫اﺻﻞ ﺑﺎﺷﺪ‪ ،‬ﺑﻪ اﻧﻀﻤﺎم ﺳﻪ ﻧـﺴﺨﻪ ﻛﭙـﻲ رﻧﮕـﻲ و در ﭘـﺸﺖ ﻋﻜـﺲ ﺷـﻤﺎره آن‪ ،‬ﻧـﺎم‬

‫ﻣﻲﺗﻮاﻧﺪ ﺑﻪ رﻓﻊ اﺑﻬﺎﻣﺎت ﻛﻤﻚ ﻛﻨﺪ‪ -4 .‬ﺗﻌﺮﻳﻒ اﺻﻄﻼﺣﺎت ﺗﺨﺼﺼﻲ ﻳﺎ اﺧﺘﺼﺎرات‬

‫ﻧﻮﻳﺴﻨﺪه و ﺟﻬﺖ ﻧﺼﺐ ﺗﺼﻮﻳﺮ ﺛﺒﺖ ﮔﺮدد‪.‬‬

‫ﻋﻠﻤﻲ ‪ -6‬ﻫﺪف ﺗﺤﻘﻴﻖ ﺑﻪ ﻧﺤﻮ روﺷﻦ‪ .‬روش ﺑﺮرﺳﻲ‪ :‬ﺑﻪ ﻧﺤﻮي ﺑﺎﻳﺪ ﻧﻮﺷﺘﻪ ﺷﻮد ﻛﻪ‬

‫‪ -3‬ﻧﺤﻮة ﺗﻨﻈﻴﻢ ﻣﻘﺎﻻت ﮔﺰارش ﻣﻮارد ‪ -3-‬ﺻﻔﺤﻪ اول ﺗﻮﺿﻴﺤﺎت اراﻳﻪ ﺷـﺪه در‬

‫ﻫﺮ ﺧﻮاﻧﻨﺪهاي ﺑﺘﻮاﻧﺪ ﺑﺎ آن‪ ،‬ﺗﺠﺮﺑﻪ ﻧﻮﻳـﺴﻨﺪه ﻣﻘﺎﻟـﻪ را ﺗﻜـﺮار ﻛﻨـﺪ‪ ،‬ﺷـﺎﻣﻞ‪ :‬ﻃﺮاﺣـﻲ‬

‫ﻗﺴﻤﺖ ‪ -3-1 ،2-1‬ﺻﻔﺤﻪ دوم و ﺳﻮم ﺷﺎﻣﻞ ﺧﻼﺻﻪ ﻓﺎرﺳﻲ و اﻧﮕﻠﻴﺴﻲ و ﻛﻠﻤـﺎت‬

‫ﺗﺤﻘﻴﻖ‪ :‬ﺟﺰﺋﻴﺎت روش ﻣﻄﺎﻟﻌﻪ و ﻋﻠﺖ اﻧﺘﺨﺎب آن )ﻣـﺜﻼ ﻛﻮﻫـﻮرت(‪ -‬ﻣـﺪت زﻣـﺎن‬

‫ﻛﻠﻴﺪي اﻧﮕﻠﻴﺴﻲ ﻣﻲﺑﺎﺷﺪ‪ .‬ﺧﻼﺻﻪ ﮔﺰارش ﻣﻮردي ﻧﺒﺎﻳـﺴﺘﻲ از ‪ 100‬ﻛﻠﻤـﻪ ﺑﻴـﺸﺘﺮ‬

‫اﺟﺮاي ﻃﺮح و ﭘﻲﮔﻴﺮي‪ -1 .‬زﻣﺎن و ﻣﻜﺎن اﺟﺮاي ﭘﮋوﻫﺶ ‪ -2‬ﺳﻮژهﻫﺎ و ﻧﻤﻮﻧﻪﻫـﺎي‬

‫ﺑﺎﺷﺪ‪ -3-3 .‬اﺻﻞ ﻣﻘﺎﻟﻪ ﺑﺎﻳﺴﺘﻲ ﺷﺎﻣﻞ ﻣﻮارد زﻳﺮ ﺑﺎﺷﺪ‪ :‬ﻣﻘﺪﻣﻪ‪ ،‬ﺷﺮح ﺣـﺎل ﺑﻴﻤـﺎر ﻳـﺎ‬

‫ﻣﻮرد آزﻣﻮن و ﻣﻼك اﻧﺘﺨﺎب‪ .‬روش ﻧﻤﻮﻧﻪﮔﻴﺮي و ﻣﻨﻄﻖ ﺗﻌﺪاد ﻧﻤﻮﻧﻪ )اﻳـﻦ ﻗـﺴﻤﺖ‬

‫ﻣﻮرد‪ ،‬ﺑﺤﺚ‪ :‬ﮔﺰارش ﻣﻮرد و ﺑﺤﺚ ﻣﺠﻤﻮﻋﺎً از ‪ 1500‬ﻛﻠﻤﻪ ﺑﻴﺸﺘﺮ ﻧﺒﻮده و ﺣﺪاﻛﺜﺮ‬

‫ﺑﺴﻴﺎر ﻣﻬﻢ اﺳﺖ و در اﺑﺘﺪاي اﻣﺮ ﻣﻮرد ﻛﺎرﺷﻨﺎﺳﻲ ﻗﺮار ﻣﻲﮔﻴﺮد(‪ -‬ﻣﻼكﻫﺎي ورود و‬

‫دو ﺟﺪول ﻳﺎ ﺗﺼﻮﻳﺮ اراﻳﻪ ﺷﻮد‪ -3-4 .‬ﻣﻨﺎﺑﻊ ﻣﺸﺎﺑﻪ ﻣﻘﺎﻻت ﺗﺤﻘﻴﻘﻲ اﺳﺖ‪.‬‬

‫ﺧﺮوج ﺑﻪ ﻣﻄﺎﻟﻌﻪ‪ -3 .‬ﻧﺤﻮه ﺟﻤﻊ آوري اﻃﻼﻋﺎت‪ -4 .‬رﻋﺎﻳﺖ ﻣـﻮازﻳﻦ اﺧـﻼق در‬

‫‪ -4‬ﻧﺤﻮه ﺗﻨﻈﻴﻢ ﻣﻘﺎﻻت ﻣـﺮوري‪ -4-1 :‬اﻳـﻦ ﮔﻮﻧـﻪ ﻣﻘـﺎﻻت ﺑـﺮاي اراﻳـﻪ آﺧـﺮﻳﻦ‬

‫ﭘﮋوﻫﺶ ‪ -5‬اﺑﺰارﻫﺎي اﻧﺪازهﮔﻴﺮي ‪ -6‬آزﻣﻮنﻫﺎي آﻣﺎري ‪ -7‬ﻧﺎم ﻛـﺸﻮر و ﺷـﺮﻛﺖ‬

‫ﻳﺎﻓﺘﻪﻫﺎي ﻋﻠﻤﻲ درﺑﺎره ﻳﻚ ﻣﻮﺿﻮع ﺧﺎص ﺑﺎﺷﺪ‪ -4-2 .‬ﻧﻮﻳﺴﻨﺪه در زﻣﻴﻨـﻪ ﻣﻮﺿـﻮع‬

‫ﺳﺎزﻧﺪه ﻣﻮاد و دﺳﺘﮕﺎهﻫﺎ‪ .‬ﻳﺎﻓﺘﻪ ﻫﺎ‪ :‬اراﻳـﻪ ﻧﺘـﺎﻳﺞ دﻗﻴـﻖ‪ -1 :‬رﻋﺎﻳـﺖ اﺻـﻮل ﻋﻠﻤـﻲ‬

‫ﻣﻘﺎﻟﻪ ﻣﻲﺑﺎﻳﺴﺖ ﺻﺎﺣﺐ ﻧﻈﺮ و داراي ﻣﻘﺎﻟﻪ ﺑﺎﺷـﻨﺪ‪ -5 .‬ﻫﻴـﺄت ﺗﺤﺮﻳﺮﻳـﻪ ﻣﺠﻠـﻪ در‬

‫)ﮔﺰارش ﻋﺪد ﺑﺎ درﺻﺪ‪ -‬ﮔﺰارش ﻣﻴﺎﻧﮕﻴﻦ ﺑﺎ ﺣﺪود اﻃﻤﻴﻨـﺎن‪ -‬ﻣﻴﺎﻧـﻪ ﺑـﺎ ‪-2 (Range‬‬

‫ﻗﺒﻮل ﻳﺎ ﻋﺪم ﻗﺒﻮل و ﻳﺎ اﺻﻼح ﻣﻘﺎﻟﻪ )ﺑﺎ ﺗﺄﻳﻴﺪ ﻣﺆﻟﻒ( آزاد اﺳـﺖ و از ﭘـﺲ دادن‬

‫ﭘﺮﻫﻴﺰ از ﻧﺸﺎن دادن ﻫﻤﻪ ﻳﺎﻓﺘﻪﻫﺎي ﺑﻪدﺳﺖ آﻣﺪه ﺑﻪﺟﺰ ﻳﺎﻓﺘﻪﻫﺎي ﻣﻬﻢ و ﺗﻌﻴـﻴﻦﻛﻨﻨـﺪه‬

‫ﻣﻘﺎﻟﻪ و ﻣﻠﺤﻘﺎت آن ﻣﻌﺬور ﻣﻲﺑﺎﺷﺪ‪ -6 .‬ﻧﻮﻳـﺴﻨﺪﮔﺎن ﻣﻘـﺎﻻت ﻣـﺴﺌﻮل ﻧﻮﺷـﺘﻪﻫـﺎ و‬

‫‪ -3‬اﺳﺘﻔﺎده ﻣﻨﺎﺳﺐ از ﺟﺪول و ﻧﻤﻮدار ﺑﺎ ﺣﺪاﻗﻞ ﺗﻌﺪاد ﻣﻤﻜﻦ ﺑﻪﻃﻮريﻛﻪ ﺑـﻪ ازاي‬

‫ﻣﺪاﻓﻊ ﻣﻄﺎﻟﺐ ﭼـﺎپ ﺷـﺪه از ﻣﻘﺎﻟـﻪ ﺧـﻮد در ﻣﺠﻠـﻪ ﺧﻮاﻫﻨـﺪ ﺑـﻮد‪ -7 .‬اﺳـﺘﻔﺎده از‬

‫ﻫﺮ ﺳﻪ ﺻﻔﺤﻪ ﺗﺎﻳﭙﻲ ﻳﻚ ﺟﺪول ﻳﺎ ﻧﻤﻮدار اﺳﺘﻔﺎده ﺷﻮد‪ ،‬ﺿﻤﻦ اﻳﻦﻛﻪ ﻧﻤﻮدار ﺑﺎﻳـﺪ‬

‫ﻣﻨﺪرﺟﺎت ﻣﺠﻠﻪ ﺑﺎ ذﻛﺮ ﻛﺎﻣﻞ ﻣﺄﺧﺬ آزاد اﺳﺖ‪.‬‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬


‫اﺳﺘﺨﻮان‬ ‫ﺗﻬﺮان‪،‬ﭘﻮﻛﻲ‬ ‫ﻧﻮﺗﺮﻛﻴﺐ و‬ ‫ﺷﻤﺎره ‪ ،9‬آذر ‪497-507 ،1389‬‬ ‫دوره ‪، 68‬‬ ‫ﭘﺎراﺗﻮرﻣﻮنﭘﺰﺷﻜﻲ‬ ‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم‬

‫ﭘﺎراﺗﻮرﻣﻮن ﻧﻮﺗﺮﻛﻴﺐ و ﭘﻮﻛﻲ اﺳﺘﺨﻮان‪ :‬ﻣﻘﺎﻟﻪ ﻣﺮوري‬

‫ﺗﺎرﻳﺦ درﻳﺎﻓﺖ ﻣﻘﺎﻟﻪ‪ 1389/05/11 :‬ﺗﺎرﻳﺦ ﭘﺬﻳﺮش‪1389/06/15 :‬‬

‫ﭼﻜﻴﺪه‬

‫*‬

‫ﺑﺎﻗﺮ ﻻرﻳﺠﺎﻧﻲ‬

‫اﺳﺘﺌﻮﭘﺮوز ﺑﻴﻤﺎري اﺳﺖ ﻛﻪ ﺑﺎ ﻛﺎﻫﺶ ﺗﻮده اﺳﺘﺨﻮاﻧﻲ و از ﺑﻴﻦ رﻓﺘﻦ ﺳﺎﺧﺘﺎر آن ﻣﺸﺨﺺ ﻣﻲﺷﻮد‪ .‬درﻣﺎن اﻳﺪهآل در‬

‫اﺷﺮف ﻋﻠﻲ ﻣﺪدي‬

‫اﻳﻦ ﺑﻴﻤﺎران ﺑﺮ ﻛﺎﻫﺶ رﻳﺴﻚ ﺑﺮوز ﺷﻜﺴﺘﮕﻲ و در ﻋﻴﻦ ﺣﺎل ﻃﺒﻴﻌﻲ ﻧﻤﻮدن ﺗﻮده و ﺳﺎﺧﺘﺎر اﺳﺘﺨﻮاﻧﻲ اﺳﺘﻮار ﻣﻲﺑﺎﺷﺪ‪.‬‬ ‫)‪(PTH‬‬

‫و آﻧﺎﻟﻮگ اﺻﻠﻲ آن ﺗﺮﻳﭙﺎراﺗﻴﺪ )ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ ﻧﻮﺗﺮﻛﻴﺐ اﻧﺴﺎﻧﻲ( )]‪(rhPTH [1-34‬‬

‫ﻣﺮﻛﺰ ﺗﺤﻘﻴﻘﺎت ﻏﺪد و ﻣﺘﺎﺑﻮﻟﻴﺴﻢ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم‬

‫ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ‬

‫ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬ﺗﻬﺮان‪ ،‬اﻳﺮان‪.‬‬

‫ﻛﻼس ﺟﺪﻳﺪي از داروﻫﺎي آﻧﺎﺑﻮﻟﻴﻚ ﻫﺴﺘﻨﺪ ﻛﻪ ﺑﺎ ﺗﻮﺟﻪ ﺑﻪ اﺛﺮات ﺑﺎﻟﻘﻮهﺷﺎن در ﺗﺴﺮﻳﻊ ﺗﺮﻣﻴﻢ ﺷﻜﺴﺘﮕﻲﻫﺎ ﺑﺎ اﻓﺰاﻳﺶ‬

‫*‬

‫ﺗﺸﻜﻴﻞ اﺳﺘﺨﻮان ﺑﺮاي درﻣﺎن اﺳﺘﺌﻮﭘﺮوز ﺷﺪﻳﺪ ﺑﻪﻛﺎر ﺑﺮده ﻣﻲﺷﻮﻧﺪ‪ .‬اﻳﻦ ﻣﻄﺎﻟﻌﻪ ﻣﺮوري ﺳﻌﻲ ﻣﻲﺷﻮد ﺗﺎرﻳﺨﭽﻪ‪ ،‬اﻧﻮاع‪،‬‬ ‫ﻧﻮﻳﺴﻨﺪه ﻣﺴﺌﻮل‪ :‬ﺗﻬﺮان‪ ،‬ﺑﺰرﮔﺮاه ﺟﻼل آلاﺣﻤﺪ‪،‬‬

‫ﺑﻴﻤﺎرﺳﺘﺎن ﺷﺮﻳﻌﺘﻲ‪ ،‬ﻣﺮﻛﺰ ﺗﺤﻘﻴﻘﺎت ﻏﺪد و ﻣﺘﺎﺑﻮﻟﻴﺴﻢ‬

‫اﺛﺮات آﻧﺎﺑﻮﻟﻴﻚ و ﻛﺎﺗﺎﺑﻮﻟﻴﻚ‪ ،‬ﻋﻮارض‪ ،‬ﻣﻮارد ﻣﺼﺮف و ﻣﻨﻊ ﻣﺼﺮف اﻳﻦ ﻫﻮرﻣﻮن را ﻣﻮرد ﺑﺮرﺳﻲ ﻗﺮار دﻫﺪ‪.‬‬

‫ﺗﻠﻔﻦ‪021-88220037 :‬‬ ‫‪email: emrc@tums.ac.ir‬‬

‫ﻛﻠﻤﺎت ﻛﻠﻴﺪي‪ :‬ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ ﻧﻮﺗﺮﻛﻴﺐ اﻧﺴﺎﻧﻲ‪ ،‬اﺳﺘﺌﻮﭘﺮوز‪ ،‬ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ‪ ،‬ﺗﻮده اﺳﺘﺨﻮاﻧﻲ‪ ،‬درﻣﺎن‪.‬‬

‫اﺳﺘﺌﻮﭘﺮوز )‪ (Osteoporosis‬ﺑﻴﻤﺎري اﺳﺖ ﻛﻪ ﺑﺎ ﻛﺎﻫﺶ ﺗﻮده‬

‫ﺗﺎ ﺣﺪي از ﺛﻘﻞ آن ﺑﻜﺎﻫﺪ‪ .‬درﻣﺎن اﻳﺪهآل در اﻳﻦ ﺑﻴﻤﺎران ﺑﺮ ﻛﺎﻫﺶ‬

‫اﺳﺘﺨﻮاﻧﻲ و از ﺑﻴﻦ رﻓﺘﻦ ﺳﺎﺧﺘﺎر آن ﻣﺸﺨﺺ ﻣﻲﺷﻮد‪ ،‬ﺷﺮاﻳﻄﻲ ﻛﻪ ﺑﻪ‬

‫رﻳﺴﻚ ﺑﺮوز ﺷﻜﺴﺘﮕﻲ و در ﻋﻴﻦ ﺣﺎل ﻃﺒﻴﻌﻲ ﻧﻤﻮدن ﺗﻮده و ﺳﺎﺧﺘﺎر‬

‫ﻛﺎﻫﺶ ﻗﻮاي اﺳﺘﺨﻮاﻧﻲ و اﻓﺰاﻳﺶ اﺣﺘﻤﺎل ﺑﺮوز ﺷﻜﺴﺘﮕﻲ در آنﻫﺎ‬

‫اﺳﺘﺨﻮاﻧﻲ اﺳﺘﻮار ﻣﻲﺑﺎﺷﺪ‪ .‬داروﻫﺎي ﻣﺨﺘﻠﻔﻲ ﻣﺎﻧﻨﺪ اﺳﺘﺮوژن و‬

‫)‪(Remodeling‬‬

‫ﭘﺮوژﺳﺘﺮون‪ ،‬ﺑﻴﺲ ﻓﺴﻔﻮﻧﺎتﻫﺎ )اﺗﻴﺪروﻧﺎت‪ ،‬رزﻳﺪروﻧﺎت‪ ،‬آﻟﻨﺪروﻧﺎت(‪،‬‬

‫اﺳﺘﺨﻮاﻧﻲ ﺑﻪﺻﻮرت اﻓﺰاﻳﺶ ﺑﺎزﺟﺬب و ﻛﺎﻫﺶ ﺗﺸﻜﻴﻞ از ﻣﻬﻢﺗﺮﻳﻦ‬

‫راﻟﻮﻛﺴﻴﻔﻦ‪ ،‬ﻛﻠﺴﻴﻢ و وﻳﺘﺎﻣﻴﻦ‪ -‬د و ﻛﻠﺴﻲ ﺗﻮﻧﻴﻦ ﺑﺎ ﻫﺪف ﻛﺎﻫﺶ‬

‫ﻋﻮاﻣﻞ اﻳﺠﺎدﻛﻨﻨﺪه اﻳﻦ ﺑﻴﻤﺎري ﻣﻲﺑﺎﺷﻨﺪ‪ .‬اﻳﻦ ﺑﻴﻤﺎري ﺣﺪود ‪ 200‬ﻣﻠﻴﻮن‬

‫ﺗﻌﺪاد‪ ،‬ﻓﻌﺎﻟﻴﺖ و ﻃﻮل ﻋﻤﺮ اﺳﺘﺌﻮﻛﻼﺳﺖﻫﺎ ﺑﺎز ﺟﺬب اﺳﺘﺨﻮاﻧﻲ را‬

‫ﻧﻔﺮ را در ﺳﺮاﺳﺮ ﺟﻬﺎن ﮔﺮﻓﺘﺎر ﻛﺮده اﺳﺖ و ﺷﻴﻮع آن در زﻧﺎن ﺳﻔﻴﺪ‬

‫ﻛﺎﻫﺶ داده و ﺑﺪﻳﻦﺗﺮﺗﻴﺐ ﺑﻪﻃﻮر ﻏﻴﺮﻣﺴﺘﻘﻴﻢ ﺑﺎ اﻓﺰاﻳﺶ ﺗﺸﻜﻴﻞ‬

‫ﭘﻮﺳﺖ ﺑﺎﻻي ‪ 30‬ﺳﺎل ﺣﺪود ‪ %30‬ﺗﺨﻤﻴﻦ زده ﻣﻲﺷﻮد‪ 3.‬در ﻣﻄﺎﻟﻌﻪ‬

‫اﺳﺘﺨﻮان و ﻛﺎﻫﺶ رﻳﺴﻚ ﺷﻜﺴﺘﮕﻲ در اﻳﻦ ﺑﻴﻤﺎران ﻣﻮرد اﺳﺘﻔﺎده ﻗﺮار‬

‫‪2‬و‪1‬‬

‫ﻣﻨﺠﺮ ﻣﻲﮔﺮدد‪.‬‬

‫از ﺑﻴﻦ رﻓﺘﻦ ﺗﻌﺎدل در ﺑﺎزﺳﺎزي‬

‫‪7-9‬‬

‫ﺳﺪﻳﻢ ﻓﻠﻮراﻳﺪ ﻧﻴﺰ ﺑﺎ وﺟﻮد داﺷﺘﻦ ﺧﻮاص آﻧﺎﺑﻮﻟﻴﻚ در‬

‫ﺟﺎﻣﻌﻲ ﻛﻪ ﺗﻮﺳﻂ داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان ﺑﺮ روي اﻓﺮاد ﺳﺎﻟﻢ‬

‫ﻣﻲﮔﻴﺮﻧﺪ‪.‬‬

‫ﺳﺎﻛﻦ در ﺷﻬﺮ ﺗﻬﺮان اﻧﺠﺎم ﺷﺪ‪ ،‬ﺷﻴﻮع اﺳﺘﺌﻮﭘﺮوز در رده ﺳﻨﻲ ‪60-69‬‬

‫اﺳﺘﺨﻮانﻫﺎ ﻧﺘﻮاﻧﺴﺘﻪ در ﻣﻄﺎﻟﻌﺎت ﺑﺎﻟﻴﻨﻲ از ﺷﻜﺴﺘﮕﻲ اﺳﺘﺨﻮانﻫﺎ‬

‫ﺳﺎل در زﻧﺎن ‪ %32/4‬و در ﻣﺮدان ‪ %9/4‬ﻧﺸﺎن داده ﺷﺪه اﺳﺖ‪ 4.‬در‬

‫ﺟﻠﻮﮔﻴﺮي ﻧﻤﺎﻳﺪ‪ ،‬ﭼﺮا ﻛﻪ ﺑﻪﻧﻈﺮ ﻣﻲرﺳﺪ اﺳﺘﺨﻮاﻧﻲ ﻛﻪ ﺑﻪدﻧﺒﺎل ﻣﺼﺮف‬

‫ﺑﺮرﺳﻲ دﻳﮕﺮي ﻛﻪ در اﻳﺮان اﻧﺠﺎم ﮔﺮﻓﺘﻪ اﺳﺖ‪ ،‬دﻛﺘﺮ اﺑﻮاﻟﺤﺴﻨﻲ ﻧﺸﺎن‬

‫اﻳﻦ دارو اﻳﺠﺎد ﻣﻲﮔﺮدد ﺳﺎﺧﺘﺎري ﻏﻴﺮ ﻃﺒﻴﻌﻲ دارد‪ 10.‬ﻫﻮرﻣﻮن ﭘﺎرا‪-‬‬

‫داد ﻛﻪ ﻣﺠﻤﻮع ﺳﺎلﻫﺎي از دﺳﺖ رﻓﺘﻪ ﻧﺎﺷﻲ از اﺳﺘﺌﻮﭘﺮوز در ﺟﻤﻌﻴﺖ‬

‫ﺗﻴﺮوﻳﻴﺪ‬

‫و آﻧﺎﻟﻮگ اﺻﻠﻲ آن ﺗﺮﻳﭙﺎراﺗﻴﺪ ‪) Teriparatide‬ﻫﻮرﻣﻮن‬

‫اﻳﺮان در ﺳﺎل ‪ 1380‬ﻣﻌﺎدل ‪ 36026‬ﺑﻮده ﻛﻪ ‪ 18757‬ﺳﺎل آن ﻣﺘﻌﻠﻖ ﺑﻪ‬

‫ﭘﺎراﺗﻴﺮوﻳﻴﺪ ﻧﻮﺗﺮﻛﻴﺐ اﻧﺴﺎﻧﻲ(‬

‫آﻗﺎﻳﺎن و ‪ 17270‬ﺳﺎل آن ﻣﺘﻌﻠﻖ ﺑﻪ ﺧﺎﻧﻢﻫﺎ ﻣﻲﺑﺎﺷﺪ‪ 5.‬اﺳﺘﺌﻮﭘﺮوز ﺳﺎﻻﻧﻪ‬

‫داروﻫﺎي آﻧﺎﺑﻮﻟﻴﻚ ﻫﺴﺘﻨﺪ ﻛﻪ ﺑﺮاي درﻣﺎن اﺳﺘﺌﻮﭘﺮوز ﺷﺪﻳﺪ اﺳﺘﺨﻮاﻧﻲ‬

‫ﻣﻨﺠﺮ ﺑﻪ ‪ 1/3‬ﻣﻴﻠﻴﻮن ﺷﻜﺴﺘﮕﻲ ﺗﻨﻬﺎ در اﻳﺎﻻت ﻣﺘﺤﺪه ﺷﺪه و ﻫﺰﻳﻨﻪ‬

‫ﺑﻪﻛﺎر ﺑﺮده ﻣﻲﺷﻮﻧﺪ‪ 11-13.‬اﻳﻦ داروﻫﺎ ﺑﻪﺧﺼﻮص ﺑﺮاي اﺛﺮات ﺑﺎﻟﻘﻮهﺷﺎن‬

‫ﺳﺎﻻﻧﻪ ﻣﺮاﻗﺒﺖﻫﺎي ﺑﻬﺪاﺷﺘﻲ و از ﻛﺎراﻓﺘﺎدﮔﻲ ﻧﺎﺷﻲ از اﺳﺘﺌﻮﭘﺮوز در‬

‫در ﺗﺴﺮﻳﻊ ﺗﺮﻣﻴﻢ ﺷﻜﺴﺘﮕﻲﻫﺎ ﺑﺎ اﻓﺰاﻳﺶ ﺗﺸﻜﻴﻞ اﺳﺘﺨﻮان ﺷﻨﺎﺧﺘﻪ‬

‫)‪(PTH‬‬

‫‪14-16‬‬

‫)]‪[1-34‬‬

‫‪ (rhPTH‬ﻛﻼس ﺟﺪﻳﺪي از‬

‫اﻳﻦ ﻛﺸﻮر ﻧﺰدﻳﻚ ﺑﻪ ‪ 14‬ﻣﻴﻠﻴﺎرد دﻻر اﺳﺖ‪ 6.‬ﺷﻴﻮع ﺑﻴﻤﺎري ﭘﻮﻛﻲ‬

‫ﺷﺪهاﻧﺪ‪.‬‬

‫اﺳﺘﺨﻮان و ﺑﺎر ﺳﻨﮕﻴﻦ اﻧﺴﺎﻧﻲ و ﻣﺎﻟﻲ ﺗﺤﻤﻴﻞ ﺷﺪه از ﺳﻮي آن ﺑﺮ‬

‫ﻫﺪف اﺻﻠﻲ اﺳﺘﻔﺎده از ﺑﻴﺲ ﻓﺴﻔﻮﻧﺎتﻫﺎ و ﺳﺎﻳﺮ داروﻫﺎي ﺿﺪ ﺟﺬب‬

‫ﺟﻮاﻣﻊ ﺑﺸﺮي ﭘﮋوﻫﺸﮕﺮان را ﺗﺮﻏﻴـﺐ ﺑﻪ اﺑﺪاع داروﻳﻲ ﻧﻤﻮده اﺳﺖ ﻛﻪ‬

‫)‪ (Antiresorptive‬ﺑﻮده‪ ،‬ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ اﺛﺮ ﺧﻮد را ﺑﺎ اﻓﺰاﻳﺶ‬

‫ﺑﻪﻋﺒﺎرت دﻳﮕﺮ در ﺣﺎﻟﻲﻛﻪ ﻛﺎﻫﺶ ﺑﺎزﺟﺬب اﺳﺘﺨﻮاﻧﻲ‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬


‫ﺑﺎﻗﺮ ﻻرﻳﺠﺎﻧﻲ و ﻫﻤﻜﺎران‬

‫‪498‬‬

‫‪18‬و‪17‬و‪12‬‬

‫ﺗﻮﻟﻴﺪ اﺳﺘﺨﻮان ﺑﺮوز ﻣﻲدﻫﺪ‪.‬‬

‫ﺧﻮاص آﻧﺎﺑﻮﻟﻴﻚ ﻫﻮرﻣﻮن ﭘﺎرا‪-‬‬ ‫‪19‬‬

‫‪ 1927 -1950‬ﭘﻲ ﺑﺮدن ﺑﻪ اﻫﻤﻴﺖ ﭘﺎﺗﻮﻓﻴﺰﻳﻮﻟﻮژي اﻓﺰاﻳﺶ ﻳﺎ ﻛﺎﻫﺶ‬

‫ﺗﻴﺮوﻳﻴﺪ ﺑﺮ روي اﺳﺘﺨﻮان از ﺳﺎل ‪ 1932‬ﺷﻨﺎﺧﺘﻪ ﺷﺪ‪ .‬ﺑﺎ اﻳﻦ وﺟﻮد‪،‬‬

‫ﻫﻮرﻣﻮن ﺗﺤﺖ ﻋﻨﻮان ﻫﺎﻳﭙﺮ ﻳﺎ ﻫﺎﻳﭙﻮﭘﺎراﺗﻴﺮوﻳﻴﺪﻳﺴﻢ‬

‫ﺳﺎﺧﺘﻦ ﻫﻮرﻣﻮن ﺳﻨﺘﺘﻴﻚ ﺗﺎ ﺳﺎل ‪ 1974‬ﺑﻪﺗﻌﻮﻳﻖ اﻓﺘﺎد‪ .‬ﻣﻄﺎﻟﻌﺎت ﻧﺸﺎن‬

‫‪ 1929‬اراﻳﻪ ﭘﺎرادوﻛﺲ اﻓﺰاﻳﺶ ﺗﻮده اﺳﺘﺨﻮاﻧﻲ در ﻣﻮشﻫﺎ ﺑﻪدﻧﺒﺎل‬

‫دادهاﻧﺪ ﻛﻪ اﺳﺘﻔﺎده از ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ و ﺑﺮﺧﻲ از ﻣﺸﺘﻘﺎت آن ﺗﻮده‬

‫اﺳﺘﻔﺎده از ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ ﺗﻮﺳﻂ‬

‫‪22‬‬

‫‪Bauer‬‬

‫و ﺳﺎﺧﺘﺎر اﺳﺘﺨﻮاﻧﻲ را ﺑﻬﺒﻮد ﻣﻲﺑﺨﺸﺪ‪18.‬و‪ 14‬ﺑﻪﻋﺒﺎرت دﻳﮕﺮ اﺳﺘﻔﺎده از‬

‫‪ 1932‬ﺗﺎﻳﻴﺪ ﻧﻈﺮﻳﻪ‬

‫اﻳﻦ دارو ﻧﻪ ﺗﻨﻬﺎ ﭘﻮﻛﻲ اﺳﺘﺨﻮان را درﻣﺎن ﻣﻲﻛﻨﺪ‪ ،‬ﺑﻠﻜﻪ ﺑﺎﻋﺚ ﺣﻔﻆ‬

‫‪ 1965 -1972‬ﺟﺪاﺳﺎزي ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ ﺧﺎﻟﺺ‬

‫ﺗﻮده اﺳﺘﺨﻮاﻧﻲ ﺑﻪﺧﺼﻮص در اﺳﺘﺨﻮانﻫﺎي ﺗﺮاﺑﻜﻮﻻر‪ ،‬اﻓﺰاﻳﺶ ﻗﺪرت‬

‫‪ 1970‬اﺛﺒﺎت اﺛﺮات آﻧﺎﺑﻮﻟﻴﻚ ﻫﻮرﻣﻮن ﺑﺮ اﺳﺘﺨﻮانﻫﺎ در ﺣﻴﻮاﻧﺎت‪ ،‬آﻏﺎز‬

‫اﺳﺘﺨﻮاﻧﻲ و ﻣﻬﻢﺗﺮ از ﻫﻤﻪ ﻛﺎﻫﺶ ﺧﻄﺮ ﺷﻜﺴﺘﮕﻲ ﻣﻲﺷﻮد‪21.‬و‪ 20‬ﻫﺪف‬

‫ﻣﻄﺎﻟﻌﺎت ﺑﺎﻟﻴﻨﻲ ﺟﻬﺖ ﺑﺮرﺳﻲ ﻧﻘﺶ آن در درﻣﺎن اﺳﺘﺌﻮﭘﺮوز در اﻧﺴﺎن‬

‫از اﻳﻦ ﻣﻄﺎﻟﻌﻪ ﺑﺮرﺳﻲ ﻣﺮوري ﻣﻄﺎﻟﻌﺎت ﻗﺒﻠﻲ در زﻣﻴﻨﻪ ﻫﻮرﻣﻮن‬

‫‪ 1975‬ﭘﻴﺸﺮﻓﺖ ﺳﺮﻳﻊ در ﺗﻜﻤﻴﻞ روشﻫﺎيدﻗﻴﻖ ارزﻳﺎﺑﻲ ﺗﻮدهاﺳﺘﺨﻮاﻧﻲ‬

‫ﭘﺎراﺗﻴﺮوﻳﻴﺪ و اﺛﺮ آن در درﻣﺎن ﺑﻴﻤﺎري ﭘﻮﻛﻲ اﺳﺘﺨﻮان‪ ،‬ﻣﻲﺑﺎﺷﺪ‪ .‬ﺑﺎ‬

‫‪ 1990‬ﻛﻠﻮﻧﻴﺰاﺳﻴﻮن ﮔﻴﺮﻧﺪه ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ‪ ،‬ﺷﻨﺎﺧﺖ ﻋﻤﻠﻜﺮد‬

‫ﻫﺪف ﺑﺮرﺳﻲ ﻣﺮوري ﻣﻄﺎﻟﻌﺎﺗﻲ ﻛﻪ در زﻣﻴﻨﻪ ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ و‬

‫ﻫﻮرﻣﻮن در ﺳﻄﺢ ﻣﻮﻟﻜﻮﻟﻲ ﺑﻪﺧﺼﻮص در ﺷﺮاﻳﻂ ﺑﻌﺪ از ﺟﺮاﺣﻲ‪ ،‬ﭘﻲ‬

‫اﺛﺮات آن در درﻣﺎن اﺳﺘﺌﻮﭘﺮوز اﻧﺠﺎم ﺷﺪه اﺳﺖ‪ ،‬ﻫﻤﻪ ﻣﻘﺎﻻﺗﻲ ﻛﻪ در‬

‫ﺑﺮدن ﺑﻪﻋﺪم ﺗﻮان ﻫﻮرﻣﻮن ﺗﻠﺨﻴﺺ ﺷﺪه در رﻓﻊ ﻫﻴﭙﻮﻛﻠﺴﻤﻲ و ﻫﺎﻳﭙﺮ‬

‫اﻳﻦ زﻣﻴﻨﻪ در ‪ 10‬ﺳﺎل ﮔﺬﺷﺘﻪ ﺑﻪ زﺑﺎنﻫﺎي ﻓﺎرﺳﻲ و اﻧﮕﻠﻴﺴﻲ در‬

‫ﻓﺴﻔﺎﺗﻤﻲ ﻧﺎﺷﻲ از ﻫﻴﭙﻮﭘﺎراﺗﻴﺮوﻳﻴﺪي ﺑﻪدﻟﻴﻞ ﻧﻴﻤﻪ ﻋﻤﺮ ﻛﻮﺗﺎه آن‬

‫‪Database‬ﻫﺎي ‪The Cochrane Central Register ،Embase ،PubMed‬‬

‫‪ 2001‬اﺛﺒﺎت ﻛﻔﺎﻳﺖ ﻫﻮرﻣﻮن در اﻓﺰاﻳﺶ ﺗﻮده اﺳﺘﺨﻮاﻧﻲ و ﺟﻠﻮﮔﻴﺮي‬

‫‪ of Controlled‬اﻧﺘﺸﺎر ﻳﺎﻓﺘﻪ ﺑﻮد‪ ،‬ﺑﺮرﺳﻲ ﺷﺪ‪ .‬ﺑﺮاي اﻧﺠﺎم اﻳﻦ ﺟﺴﺘﺠﻮ‬

‫از ﺷﻜﺴﺘﮕﻲﻫﺎ در ﻣﻄﺎﻟﻌﺎت ﺑﺎﻟﻴﻨﻲ‬

‫از ﺗﺮﻛﻴﺐ ﻛﻠﻤﺎت ﻛﻠﻴﺪي ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ‪ ،‬ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ‬

‫‪ 2002‬ﺗﺎﻳﻴﺪ درﻣﺎن اﺳﺘﺌﻮﭘﺮوز ﺑﺎ اﻳﻦ ﻫﻮرﻣﻮن ﺗﻮﺳﻂ‬

‫‪Bauer‬‬

‫‪19‬‬

‫‪FDA‬‬

‫ﻧﻮﺗﺮﻛﻴﺐ اﻧﺴﺎﻧﻲ و ﻫﻮرﻣﻮن ﭘﺎراﺗﻮرﻣﻮن ﺑﺎ اﺳﺘﺌﻮﭘﺮوز‪ ،‬ﺗﻮده اﺳﺘﺨﻮاﻧﻲ‬

‫اﺛﺮات آﻧﺎﺑﻮﻟﻴﻚ و ﻛﺎﺗﺎﺑﻮﻟﻴﻚ ﭘﺎراﺗﻮرﻣﻮن‪ :‬ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ اﻧﺴﺎﻧﻲ‬

‫و درﻣﺎن اﺳﺘﻔﺎده ﮔﺮدﻳﺪ‪ .‬از ﻣﻴﺎن ﻣﻄﺎﻟﻌﺎت ﺑﻪدﺳﺖ آﻣﺪه آنﻫﺎﻳﻲ ﻛﻪ ﺑﻪ‬

‫ﻳﻚ ﭘﭙﺘﻴﺪ ‪ -84‬آﻣﻴﻨﻮاﺳﻴﺪي ﻣﻲﺑﺎﺷﺪ ﻛﻪ ﻧﻘﺶ ﻣﺤﻮري در ﺣﻔﻆ و‬

‫ﺑﺮرﺳﻲ ﺗﺎﺛﻴﺮ ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ و ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ ﻧﻮﺗﺮﻛﻴﺐ‬

‫‪23‬و‪20‬‬

‫ﻧﮕﻬﺪاري ﺳﻄﻮح ﻛﻠﺴﻴﻢ و ﺗﻌﺎدل آن در ﭘﺴﺘﺎﻧﺪاران اﻳﻔﺎ ﻣﻲﻧﻤﺎﻳﺪ‪.‬‬

‫)]‪(hPTH [1–84‬‬

‫اﻧﺴﺎﻧﻲ ﺑﺮ روي ﺗﻮده اﺳﺘﺨﻮاﻧﻲ ﻧﻤﻮﻧﻪﻫﺎي اﻧﺴﺎن ﭘﺮداﺧﺘﻪ ﺑﻮد‪ ،‬اﻧﺘﺨﺎب‬

‫ﻣﻄﺎﻟﻌﺎت اوﻟﻴﻪ ﺑﺮ روي ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ ﺧﺎﻟﺺ‬

‫ﮔﺮدﻳﺪ‪ .‬ﻣﻄﺎﻟﻌﺎت ﮔﺮوهﻫﺎي ﺧﺎص ﺧﺼﻮﺻﺎً اﻓﺮاد ﺑﺎ ﺑﻴﻤﺎريﻫﺎي ﻏﻴﺮ‬

‫ﻧﺸﺎن دادﻧﺪ ﻛﻪ ﻓﻌﺎﻟﻴﺖ ﺑﻴﻮﻟﻮژﻳﻚ اﻳﻦ ﻫﻮرﻣﻮن در ﻗﺴﻤﺖ‬

‫ﻣﺮﺗﺒﻂ ﺑﺎ ﭘﻮﻛﻲ اﺳﺘﺨﻮان ﺻﻮرت ﮔﺮﻓﺘﻪ ﺑﻮد از ﻟﻴﺴﺖ ﺧﺎرج ﮔﺮدﻳﺪ‪.‬‬

‫آن ﻗﺮار دارد‪ 24.‬ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ اوﻟﻴﻦ داروي ﺿﺪ ﺷﻜﺴﺘﮕﻲ اﺳﺖ‬

‫ﺑﺪﻳﻦﺗﺮﺗﻴﺐ ﺣﺪود ‪ 110‬ﻣﻄﺎﻟﻌﻪ در اﻳﻦ ﻣﺮور وارد ﮔﺮدﻳﺪ‪.‬‬

‫ﻛﻪ اﺛﺮ ﺧﻮد را ﺑﺎ اﻓﺰاﻳﺶ ﺗﻌﺪاد و ﻓﻌﺎﻟﻴﺖ اﺳﺘﺌﻮﺑﻼﺳﺖﻫﺎ اﻋﻤﺎل ﻣﻲﻛﻨﺪ‪.‬‬

‫ﻫﻮرﻣﻮن ﭘﺎراﺗﻮرﻣﻮن‪:‬‬

‫ﻣﻄﺎﻟﻌﺎت ﺑﺎﻟﻴﻨﻲ ﻛﻪ ﺗﺎﻛﻨﻮن در اﻳﻦ زﻣﻴﻨﻪ اﻧﺠﺎم ﺷﺪه ﻧﺸﺎن دادهاﻧﺪ ﻛﻪ‬

‫‪N-terminal‬‬

‫ﺗﻌﺮﻳﻒ و ﺗﺎرﻳﺨﭽﻪ‪ :‬ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ درﻣﺎﻧﻲ ﺟﺪﻳﺪ ﺑﺮاي ﺑﻴﻤﺎران‬

‫ﻣﺼﺮف ﻣﻘﻄﻌﻲ ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ‪ ،‬ﻛﻪ ﺑﺮاي اوﻟﻴﻦ ﺑﺎر در ‪1980‬‬

‫ﻣﺒﺘﻼ ﺑﻪ اﺳﺘﺌﻮﭘﺮوز ﻣﻲﺑﺎﺷﺪ‪ .‬اﻳﻦ درﻣﺎن آﻧﺎﺑﻮﻟﻴﻚ ﺑﺎ ﺗﻐﻴﻴﺮ ﻣﺪﻟﻴﻨﮓ و‬

‫ﺗﻮﺳﻂ ‪ Reeve‬ﺷﻨﺎﺳﺎﻳﻲ ﺷﺪ‪ ،‬ﻣﻘﺎوﻣﺖ اﺳﺘﺨﻮاﻧﻲ را ﺑﻪواﺳﻄﻪ اﻓﺰاﻳﺶ‬ ‫‪25-27‬‬

‫ﻣﻜﺎﻧﻴﺴﻢ‬

‫ﺑﺎزﺳﺎزي اﺳﺘﺨﻮاﻧﻲ ﺑﻪﻋﻨﻮان روﺷﻲ ﻧﻮﻳﻦ در ﻛﺎﻫﺶ اﺣﺘﻤﺎل ﺷﻜﺴﺘﮕﻲ‬

‫ﺗﻮده اﺳﺘﺨﻮاﻧﻲ و ﺑﻬﺒﻮدي ﺳﺎﺧﺘﺎر آن اﻓﺰاﻳﺶ ﻣﻲدﻫﺪ‪.‬‬

‫در ﻣﺒﺘﻼﻳﺎن ﺑﻪ ﭘﻮﻛﻲ ﺷﺪﻳﺪ اﺳﺘﺨﻮان ﺷﻨﺎﺧﺘﻪ ﺷﺪه اﺳﺖ‪ .‬ﺳﻴﺮ ﺗﺤﻮﻻﺗﻲ‬

‫ﻋﻤﻠﻜﺮد ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ در ﺳﻄﺢ ﺳﻠﻮﻟﻲ ﺑﺎ ﺳﺎﻳﺮ داروﻫﺎ ﻣﺘﻔﺎوت‬

‫ﻛﻪ از ﺷﻨﺎﺧﺘﻦ ﻏﺪه ﭘﺎراﺗﻴﺮوﻳﻴﺪ ﺗﺎ اﺳﺘﻔﺎده از ﻫﻮرﻣﻮن ﭘﺎراﺗﻮرﻣﻮن‬

‫اﺳﺖ‪ .‬داروﻫﺎﻳﻲ ﻛﻪ ﺗﺤﺖ ﻋﻨﻮان داروﻫﺎي ﺿﺪ ﺑﺎزﺳﺎزي‬

‫ﺑﻪﻋﻨﻮان داروﻳﻲ ﻣﻮﺛﺮ ﺑﺮاي درﻣﺎن رخ داده‪ ،‬ﺑﻪ ﺷﺮح ذﻳﻞ ﻣﻲﺑﺎﺷﺪ‪:‬‬

‫‪20‬‬

‫)‪ (Antiremodeling agents‬ﺷﻨﺎﺧﺘﻪ ﻣﻲﺷﻮﻧﺪ‪ ،‬اﺑﺘﺪا ﻋﻤﻞ ﺧﻮد را ﺑﺎ‬

‫‪ 1850 -1900‬ﻛﺸﻒ ﻏﺪه ﭘﺎراﺗﻴﺮوﻳﻴﺪ ﺑﻪﻋﻨﻮان ﻋﻀﻮي ﺟﺪا از ﺗﻴﺮوﻳﻴﺪ‬

‫ﻣﻬﺎر ﺑﺎزﺟﺬب و ﺳﭙﺲ ﺑﺎ ﻣﻬﺎر ﺗﺸﻜﻴﻞ ﻛﻪ در ﺑﻴﺸﺘﺮ ﻣﻮارد ﺑﺎ ﺑﺎزﺟﺬب‬

‫ﺑﺎ ﻋﻤﻠﻜﺮد ﻧﺎﺷﻨﺎﺧﺘﻪ‬

‫ﻫﻤﺰﻣﺎن ﻣﻲﺑﺎﺷﺪ آﻏﺎز ﻣﻲﻛﻨﻨﺪ‪ 28-30.‬اﻳﻦ داروﻫﺎ اﺛﺮ ﺧﻮد را در اﺳﺘﺨﻮان‬

‫‪ 1900 -1925‬ﺗﺸﺨﻴﺺ ﺑﺮوز ﺗﺸﻨﺞ ﺑﻪدﻧﺒﺎل ﭘﺎراﺗﻴﺮوﻳﻴﺪﻛﺘﻮﻣﻲ‬

‫اﺳﻔﻨﺠﻲ ﺑﺎ ﻛﺎﻫﺶ ﺑﺎزﺳﺎزي و ﺑﻬﺒﻮد ﺗﺮاﻛﻢ اﺳﺘﺨﻮاﻧﻲ از ﻃﺮﻳﻖ ﻛﺎﻫﺶ‬

‫‪ 1925‬ﻛﺸﻒ ﻧﻘﺶ ﺗﺮﺷﺢ ﻏﺪه در ﺗﻨﻈﻴﻢ ﺳﻄﺢ ﻛﻠﺴﻴﻢ ﭘﻼﺳﻤﺎ‬

‫ﻓﻀﺎي ﻣﻮرد ﺑﺎزﺳﺎزي و ﺣﻔﺮات ﺑﺎزﺟﺬب )ﺑﻪﻋﻨﻮان ﺟﻤﻊ ﻛﻨﻨﺪهﻫﺎي‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬


‫‪499‬‬

‫ﭘﺎراﺗﻮرﻣﻮن ﻧﻮﺗﺮﻛﻴﺐ و ﭘﻮﻛﻲ اﺳﺘﺨﻮان‬

‫اﺳﺘﺮس ﻣﻜﺎﻧﻴﻜﻲ(‪ ،‬و ﺣﻔﻆ ﺳﺎﺧﺘﺎر آن‪ ،‬و در اﺳﺘﺨﻮان ﻛﻮرﺗﻴﻜﺎل ﺑﺎ‬ ‫‪31-33‬‬

‫اﻓﺰاﻳﺶ ﺗﺮاﻛﻢ اﺳﺘﺨﻮاﻧﻲ و ﻛﺎﻫﺶ ﺣﻔﺮات اﻋﻤﺎل ﻣﻲﻛﻨﻨﺪ‪.‬‬

‫ﺳﺎﺧﺖ و ﺳﺎز اﺳﺘﺨﻮان و ﭘﻲﮔﻴﺮي اﺛﺮ آﻧﺎﺑﻮﻟﻴﻚ‬

‫اﺳﺖ‪ ،‬ﭼﺮاﻛﻪ اﻳﻦ ﺷﻨﺎﺳﻪ ﺑﻴﺸﺘﺮﻳﻦ ﻧﺴﺒﺖ ‪ Signal‬ﺑﻪ ‪ Noise‬را در‬ ‫‪47‬و‪46‬‬

‫ﺑﺎﻟﻌﻜﺲ ﭘﺎراﺗﻮرﻣﻮن ﻋﻤﻞ ﺧﻮد را ﺑﺎ ﺗﺤﺮﻳﻚ ﺗﺸﻜﻴﻞ اﺳﺘﺨﻮان از ﻃﺮﻳﻖ‬

‫ﻣﻄﺎﻟﻌﺔ ‪ Fracture Prevention Trial‬داﺷﺘﻪ اﺳﺖ‪.‬‬

‫اﻓﺰاﻳﺶ ﺳﺮﻋﺖ ﺑﺎزﺳﺎزي اﻧﺠﺎم ﻣﻲدﻫﺪ‪ .‬ﺗﺤﺖ اﺛﺮ ﭘﺎراﺗﻮرﻣﻮن ﺧﺎرﺟﻲ‪،‬‬

‫ﻛﻮﺗﺎه ﻣﺪت در ﺷﻨﺎﺳﻪﻫﺎي واﮔﺮدش اﺳﺘﺨﻮان ﺑﺎ‬

‫ﺿﺨﺎﻣﺖ ‪Osteon‬ﻫﺎ ﻳﺎ اﺳﺘﺨﻮانﻫﺎﻳﻲ ﻛﻪ در ﻫﺮ واﺣﺪ ﺑﺎزﺳﺎزي ذﺧﻴﺮه‬ ‫‪35‬و‪34‬و‪21‬‬

‫‪PTH‬‬

‫اﺳﺘﻔﺎده ﺷﺪه‬

‫اﻓﺰاﻳﺶ ﺑﻴﺸﺘﺮ در‬

‫‪BMD‬‬

‫ﺗﻐﻴﻴﺮات ﺑﺰرگﺗﺮ‬

‫‪PTH‬‬

‫درﻣﺎﻧﻲ‪ ،‬ﺗﻮام ﺑﺎ‬

‫ﺳﺘﻮن ﻓﻘﺮات در زﻧﺎن ﭘﺲ از ﻣﻨﻮﭘﻮز ﺑﻮده‬

‫اﻳﻦ اﻓﺰاﻳﺶ در ﺳﺮﻋﺖ ﺑﺎزﺳﺎزي و‬

‫اﺳﺖ‪ .‬اﻳﻦ ﺷﻨﺎﺳﻪﻫﺎ در ﻃﻲ درﻣﺎن ﻣﻲﺗﻮاﻧﻨﺪ ﺑﻪﻋﻨﻮان ﺟﺎﻧﺸﻴﻦ ‪ BMD‬در‬

‫ﻫﻤﭽﻨﻴﻦ ﻣﻴﺰان اﺳﺘﺨﻮان در ﻫﺮ ﻛﺪام از واﺣﺪﻫﺎي ﺑﺎزﺳﺎزي‪ ،‬ﺑﺎﻋﺚ‬

‫ارزﻳﺎﺑﻲ ﻧﺘﻴﺠﻪ درﻣﺎن ﻣﺤﺴﻮب ﺷﻮﻧﺪ ﺑﺎ اﻳﻦ ﺗﻔﺎوت ﻛﻪ اﻣﻜﺎن اﻳﻦ‬

‫اﻓﺰاﻳﺶ ﭘﻴﺸﺮوﻧﺪه ﺑﺎﻓﺖ اﺳﺘﺨﻮاﻧﻲ ﺑﻪﺻﻮرت اﻓﺰاﻳﺶ ﺿﺨﺎﻣﺖ ﺑﺎﻓﺖ‬

‫ارزﻳﺎﺑﻲ را در زﻣﺎﻧﻲ ﻧﺰدﻳﻚﺗﺮ )‪ 3-6‬ﻣﺎه در ﻣﻘﺎﻳﺴﻪ ﺑﺎ ‪ 12-18‬ﻣﺎه(‬

‫ﺗﺮاﺑﻜﻮﻻر ﻣﻲﺷﻮد‪ 34.‬ﻋﻼوه ﺑﺮ اﻓﺰاﻳﺶ واﺣﺪﻫﺎي ﺑﺎزﺳﺎزي‪ ،‬اﺳﺘﻔﺎده از‬

‫ﻓﺮاﻫﻢ ﻣﻲﺳﺎزﻧﺪ‪ 46.‬اﻳﻦ ﺷﺎﺧﺺﻫﺎ در ﺳﺎل دوم درﻣﺎن ﺑﻪ ﻣﻘﺎدﻳﺮ ﭘﺎﻳﻪ‬

‫ﻣﻲﺷﻮﻧﺪ اﻓﺰاﻳﺶ ﻣﻲﻳﺎﺑﺪ‪.‬‬

‫ﺗﺮﻳﭙﺎراﺗﻴﺪ ﺿﺨﺎﻣﺖ و اﺗﺼﺎﻻت ﻣﻴﺎن ﺑﺎﻓﺖ ﺗﺮاﺑﻜﻮﻻر را ﻧﻴﺰ اﻓﺰاﻳﺶ‬ ‫‪36‬و‪21‬‬

‫ﻣﻲدﻫﺪ‪.‬‬

‫اﻳﻦ ﺧﺎﺻﻴﺖ در ﺑﻴﺲ ﻓﺴﻔﻮﻧﺎتﻫﺎ ﻛﻪ در آنﻫﺎ ﺳﺎﺧﺘﺎر‬ ‫‪37‬‬

‫‪36‬و‪30‬و‪12‬‬

‫ﺧﻮد ﺑﺮ ﻣﻲﮔﺮدﻧﺪ‪.‬‬

‫اﺛﺮات اﻳﻦ ﻫﻮرﻣﻮن در ﭘﻴﺸﮕﻴﺮي از‬ ‫‪48‬و‪25‬و‪21‬‬

‫ﺷﻜﺴﺘﮕﻲ ﺑﻪ ﺳﻄﻮح اوﻟﻴﻪ اﻳﻦ ﺷﺎﺧﺺﻫﺎ واﺑﺴﺘﻪ ﻧﻤﻲﺑﺎﺷﺪ‪.‬‬

‫ﺗﺮاﺑﻜﻮﻻر ﺣﻔﻆ ﺷﺪه و ﺗﻐﻴﻴﺮ ﻧﻤﻲﻳﺎﺑﺪ وﺟﻮد ﻧﺪارد‪ .‬ﺑﺮﺧﻲ ﻣﻄﺎﻟﻌﺎت‬

‫ﭘﺎراﺗﻮرﻣﻮن و ﺗﺮاﻛﻢ اﺳﺘﺨﻮان‪ :‬ﺑﺎ اﺳﺘﻔﺎده ﻣﺘﻨﺎوب از ﻫﻮرﻣﻮن‬

‫ﺑﺮ اﻳﻦ ﺑﺎورﻧﺪ ﻛﻪ اﻓﺰاﻳﺶ ﺑﺎﻓﺖ اﺳﻔﻨﺠﻲ ﺑﻪدﻧﺒﺎل ﻣﺼﺮف اﻳﻦ دارو ﺑﺎ‬

‫ﭘﺎراﺗﻴﺮوﻳﻴﺪ اﻓﺰاﻳﺶ ﺗﻮده اﺳﺘﺨﻮاﻧﻲ ﻫﻢ در اﺳﺘﺨﻮان ﻛﻮرﺗﻴﻜﺎل و ﻫﻢ‬

‫ﺗﺤﻠﻴﻞ اﺳﺘﺨﻮان ﻛﻮرﺗﻴﻜﺎل ﺑﻪدﺳﺖ ﻣﻲآﻳﺪ وﻟﻲ اﻳﻦ ﻣﻮﺿﻮع ﺛﺎﺑﺖ ﻧﺸﺪه‬ ‫‪39‬و‪38‬و‪11‬‬

‫اﺳﺖ‪.‬‬

‫ﺑﺪﻳﻦﺗﺮﺗﻴﺐ ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ اﺛﺮ ﻣﺸﺨﺼﻲ ﺑﺮ اﻧﺪازه‬

‫‪21‬و‪14‬‬

‫ﺗﺮاﺑﻜﻮﻻر ﭘﺪﻳﺪ ﻣﻲآﻳﺪ‪،‬‬

‫اﻣﺎ ﺑﻪﻧﻈﺮ ﻣﻲرﺳﺪ ﻛﻪ اﻳﻦ اﺛﺮ در‬

‫اﺳﺘﺨﻮانﻫﺎي ﺗﺮاﺑﻜﻮﻻر واﺿﺢﺗﺮ ﻣﻲﺑﺎﺷﺪ‪.‬‬

‫‪49-51‬‬

‫ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ در‬

‫اﺳﺘﺨﻮان داﺷﺘﻪ و ﻣﻲﺗﻮاﻧﺪ ﻛﺎﻫﺶ ﺑﺎﻓﺖ اﺳﺘﺨﻮاﻧﻲ ﻧﺎﺷﻲ از اﻓﺰاﻳﺶ‬

‫ﺗﺮاﻛﻢ اﺳﺘﺨﻮان ﻛﻮرﺗﻴﻜﺎل ﻣﭻ دﺳﺖ اﺛﺮات ﻗﺎﺑﻞ ﻣﻼﺣﻈﻪاي ﻧﺪارد‪ .‬اﻳﻦ‬

‫ﺳﻦ را ﺟﺒﺮان ﻧﻤﺎﻳﺪ‪41.‬و‪ 40‬ﺗﻐﻴﻴﺮاﺗﻲ ﻛﻪ ﺗﻮﺳﻂ ﭘﺎراﺗﻮرﻣﻮن اﻳﺠﺎد ﻣﻲﺷﻮد‬

‫ﻫﻮرﻣﻮن ﺑﺎ ﺑﻬﺒﻮدي ﻛﻴﻔﻴﺖ اﺳﺘﺨﻮان ﻣﻨﺠﺮ ﺑﻪﻛﺎﻫﺶ اﺣﺘﻤﺎل ﺷﻜﺴﺘﮕﻲ‪-‬‬ ‫‪52‬و‪50‬و‪39‬‬

‫ﭘﺲ از ‪ 18‬ﻣﺎه ﻣﺼﺮف‬

‫در ﻗﺴﻤﺖﻫﺎي ﻣﺨﺘﻠﻒ اﺳﻜﻠﺖ اﺳﺘﺨﻮاﻧﻲ ﻣﺘﻔﺎوت ﺑﻮده و ﺧﺼﻮﺻﺎً در‬

‫ﻫﺎي ﻣﻬﺮهاي و ﻏﻴﺮﻣﻬﺮهاي ﻣﻲﮔﺮدد‪.‬‬

‫اﺳﺘﺨﻮان ﻛﻮرﺗﻴﻜﺎل ﺑﺎ ﺗﻔﺎوت در ﺗﺤﻤﻞ وزن ﻣﺮﺗﺒﻂ ﻣﻲﺑﺎﺷﺪ‪.‬‬

‫اﮔﺰوژن اﻳﻦ ﻫﻮرﻣﻮن اﺣﺘﻤﺎل ﺷﻜﺴﺘﮕﻲ ﻣﻬﺮهاي ﺗﺎ ‪ %65‬و ﺷﻜﺴﺘﮕﻲ‬

‫ﭘﺎراﺗﻮرﻣﻮن و ﺷﻨﺎﺳﻪﻫﺎي واﮔﺮدش اﺳﺘﺨﻮان‬

‫‪(Bone turnover‬‬

‫)‪ :Biomarkers‬اﺛﺮات اﺳﺘﻔﺎده از اﻳﻦ دارو در ‪ 28‬روز اول اﺳﺘﻔﺎده از‬ ‫‪43‬و‪42‬و‪12‬‬

‫آن آﻏﺎز ﻣﻲﺷﻮد‪.‬‬

‫اﻓﺰاﻳﺶ در ﺷﺎﺧﺺ )ﻣﺎرﻛﺮ(ﻫﺎي ﺗﻮﻟﻴﺪ‬

‫]آﻟﻜﺎﻟﻦ ﻓﺴﻔﺎﺗﺎز اﺳﺘﺨﻮاﻧﻲ‪،(P1NP) N-terminal procollagen 1 ،‬‬ ‫‪1‬‬

‫‪C-‬‬

‫‪ ،(C1NP) terminal procollagen‬اﺳﺘﺌﻮﻛﻠﺴﻴﻦ ﺳﺮم[ و ﺟﺬب‬

‫‪53‬و‪25‬و‪22‬‬

‫ﻏﻴﺮ ﻣﻬﺮهاي ‪ %50‬ﻛﺎﻫﺶ ﻣﻲﻳﺎﺑﺪ‪.‬‬

‫اﻓﺰاﻳﺶ ‪ %10-15‬ﺗﺮاﻛﻢ‬ ‫‪55‬و‪54‬و‪49‬‬

‫اﺳﺘﺨﻮان در ﻛﺎﻫﺶ ﻣﻴﺰان ﺷﻜﺴﺘﮕﻲ ﻧﻘﺶ دارد‪.‬‬

‫اﺛﺮات ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ واﺑﺴﺘﻪ ﺑﻪ دوز اﺳﺖ و در ﻣﻘﺎﻳﺴﻪ ﺑﺎ‬ ‫‪56‬و‪39‬و‪12‬‬

‫آﻟﻨﺪروﻧﺎت‪ ،‬اﻓﺰاﻳﺶ دوز اﺛﺮات آن را ﺗﻘﻮﻳﺖ ﻣﻲﻛﻨﺪ‪.‬‬

‫ﻣﺼﺮف‬

‫دوزﻫﺎي ﺑﺎﻻﺗﺮ اﻳﻦ دارو‪ ،‬اﺛﺮات ﺿﺪ ﺷﻜﺴﺘﮕﻲ آنرا اﻓﺰاﻳﺶ ﻧﻤﻲدﻫﺪ‪.‬‬

‫‪11‬‬

‫اﺳﺘﺨﻮان ]‪ (NTX) N-terminal cross-linking tellopeptide‬ادراري‪،‬‬

‫اﺛﺮﺑﺨﺸﻲ ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ در اﻓﺰاﻳﺶ ﺗﺮاﻛﻢ اﺳﺘﺨﻮان ﺗﺤﺖ ﺗﺎﺛﻴﺮ‬

‫‪C-terminal cross-linking tellopeptide‬‬

‫ﺟﻨﺴﻴﺖ ﻗﺮار ﻧﻤﻲﮔﻴﺮد و زﻧﺎن ﻳﺎﺋﺴﻪو ﻣﺮدان ﺗﺤﺖدرﻣﺎن ﺑﻪﻃﻮر ﻣﺸﺎﺑﻪ‬

‫‪38‬و‪18‬و‪14‬‬

‫از اﺛﺮات درﻣﺎﻧﻲ آن ﺳﻮد ﻣﻲﺑﺮﻧﺪ؛ ﺑﻪﻧﻈﺮ ﻣﻲرﺳﺪ ﻛﻪ ﺑﻌﺪ از ﻗﻄﻊ دارو‪،‬‬

‫‪ deoxypyridinoline‬ادرار و‬

‫)‪ (CTX‬ﺳﺮم[ در ‪ %100‬اﻓﺮاد ﺗﺤﺖ درﻣﺎن ﻣﺸﺎﻫﺪه ﺷﺪه اﺳﺖ‪.‬‬ ‫درﻣﺎن ﻣﺘﻨﺎوب ﺑﺎ‬

‫‪PTH‬‬

‫واﮔﺮدش اﺳﺘﺨﻮان را اﻓﺰاﻳﺶ ﻣﻲدﻫﺪ و ﺗﻌﺎدل‬

‫‪57‬و‪27‬‬

‫ﺳﺮﻋﺖ اﻓﺖ ﺗﺮاﻛﻢ اﺳﺘﺨﻮاﻧﻲ در ﺧﺎﻧﻢﻫﺎ ﺳﺮﻳﻊﺗﺮ از آﻗﺎﻳﺎن ﺑﺎﺷﺪ‪.‬‬

‫ﻣﺜﺒﺖ ﺳﺎﺧﺖ و ﺳﺎز اﺳﺘﺨﻮان‪ ،‬ﻧﺴﺒﺖ ﺑﻪ ﺟﺬب آن اﻳﺠﺎد ﻣﻲﻛﻨﺪ‪ .‬ﺑﻴﻦ‬

‫در ﺳﻪ ﻣﺎه اول اﺳﺘﻔﺎده از ﻫﻮرﻣﻮن ﺗﺸﻜﻴﻞ اﺳﺘﺨﻮان ﺑﺮ ﺑﺎزﺟﺬب آن‬

‫اﻓﺰاﻳﺶ زودرس در ﺷﻨﺎﺳﻪﻫﺎي ﺑﻴﻮﺷﻴﻤﻴﺎﻳﻲ واﮔﺮش اﺳﺘﺨﻮان و ﭘﺎﺳﺦ‬

‫ﺑﺮﺗﺮي داﺷﺘﻪ و در درازﻣﺪت ﺗﻌﺎدل ﺑﻴﻦ آنﻫﺎ ﺑﻪوﺟﻮد ﻣﻲآﻳﺪ؛ ﺑﻪﻫﻤﻴﻦ‬

‫ﺑﻪ درﻣﺎن روزاﻧﻪ ‪ ،PTH‬ارﺗﺒﺎط‬

‫دﻟﻴﻞ ﺑﻴﺸﺘﺮ اﻓﺰاﻳﺶ ﺗﺮاﻛﻢ اﺳﺘﺨﻮاﻧﻲ در ﻣﺎهﻫﺎي اول اﺗﻔﺎق ﻣﻲاﻓﺘﺪ‪ .‬اﻳﻦ‬

‫ﺑﻬﺘﺮﻳﻦ‬

‫در ﺣﺎﻟﻲ اﺳﺖ ﻛﻪ اﺛﺮات ﺿﺪ ﺷﻜﺴﺘﮕﻲ دارو در ﻣﺎهﻫﺎي ﺑﻌﺪ ﺑﺮوز‬

‫در ﭼﻨﺪﻳﻦ ﻣﻄﺎﻟﻌﻪ ﺑﻮده‬

‫ﻣﻲﻛﻨﺪ‪42.‬و‪30‬و‪ 11‬ﺑﺮﺧﻼف ﺑﻴﺲ ﻓﺴﻔﻮﻧﺎتﻫﺎ ﻛﻪ اﺛﺮات آنﻫﺎ ﺑﺮاي ﺳﺎلﻫﺎ‬

‫ﺑﻪﻋﻨﻮان ﺷﻨﺎﺳﻪ اﻧﺘﺨﺎﺑﻲ‬

‫ﺑﻌﺪ از ﻗﻄﻊ ﻣﺼﺮف دارو ﺑﺎﻗـﻲ ﻣﻲﻣﺎﻧﺪ‪ ،‬ﺗﻐﻴﻴﺮات ﺗﺮاﻛـﻢ اﺳﺘﺨﻮاﻧﻲ ﺑﻌﺪ‬

‫ﺑﻌﺪي اﻓﺰاﻳﺶ ﺗﺮاﻛﻢ اﺳﺘﺨﻮان‬

‫)‪(BMD‬‬

‫ﻣﺜﺒﺘﻲ ﻳﺎﻓﺖ ﺷﺪه اﺳﺖ‪ 44.‬اﻓﺰاﻳﺶ زودرس در‬ ‫ﭘﻴﺶﮔﻮﻳﻲﻛﻨﻨﺪه ﭘﺎﺳﺦ‬ ‫‪45‬و‪42‬و‪25‬‬

‫اﺳﺖ‪.‬‬

‫‪BMD‬‬

‫ﺑﻪ‬

‫در اﻛﺜﺮ ﻣﻄﺎﻟﻌﺎت از‬

‫‪PTH‬‬

‫‪P1NP‬‬

‫‪P1CP‬‬

‫و‬

‫‪P1NP‬‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬


‫ﺑﺎﻗﺮ ﻻرﻳﺠﺎﻧﻲ و ﻫﻤﻜﺎران‬

‫‪500‬‬

‫‪58‬و‪51‬و‪11‬‬

‫ﻣﻬﺮهاي در ﺧﺎﻧﻢﻫﺎي ﻳﺎﺋﺴﻪ ﻣﺒﺘﻼ ﺑﻪ اﺳﺘﺌﻮﭘﺮوز و داراي ﺳﺎﺑﻘﻪ‬

‫ﭘﺎراﺗﻮرﻣﻮن ﻧﻮﺗﺮﻛﻴﺐ و اﺷﻜﺎل ﻣﺨﺘﻠﻒ آن‪ :‬در ﭘﻠﻲﭘﭙﺘﻴﺪ ﻛﺎﻣﻞ‬

‫ﺷﻜﺴﺘﮕﻲ ﻗﺒﻠﻲ ﺑﻪﻋﻠﺖ ﺑﻴﻤﺎري ﻣﻲﺑﺎﺷﻨﺪ؛ اﻳﻦ ﺗﺎﺛﻴﺮ ﺑﺎ ﺗﻌﺪاد ﺷﻜﺴﺘﮕﻲ‪-‬‬

‫از دوره ‪ 18‬ﻣﺎﻫﻪ ﻣﺼﺮف ﭘﺎراﺗﻮرﻣﻮن ﺷﺮوع ﺑﻪ ﻛﺎﻫﺶ ﻣﻲﻧﻤﺎﻳﺪ‪.‬‬ ‫ﭘﺎراﺗﻮرﻣﻮن‬

‫)]‪PTH [1-84‬‬

‫‪ ،(Intact‬ﺑﺨﺶ آﻣﻴﻨﻮﺗﺮﻣﻴﻨﺎل آن اﺳﺖ ﻛﻪ‬

‫ﻓﻌﺎﻟﻴﺖ ﺑﻴﻮﻟﻮژﻳﻚ ﻫﻮرﻣﻮن را ﺑﺮ ﻋﻬﺪه دارد‪ .‬ﺑﺮ اﻳﻦ اﺳﺎس‪ ،‬اﺷﻜﺎل‬ ‫ﮔﻮﻧﺎﮔﻮن‬

‫]‪[1–31‬‬

‫‪،PTH‬‬

‫]‪PTH [1–34‬‬

‫]‪PTH [1–84‬‬

‫آﻧﺎﺑﻮﻟﻴﻚ ﻣﺸﺎﺑﻪ‬

‫و‬

‫]‪PTH [1–38‬‬

‫داراي اﺛﺮات‬

‫ﺑﺮ روي اﺳﺘﺨﻮانﻫﺎ ﻣﻲﺑﺎﺷﻨﺪ‪ .‬ﻟﻜﻦ اﻳﻦ‬ ‫‪60‬و‪59‬و‪24‬‬

‫اﺛﺮات در ﻫﻮرﻣﻮنﻫﺎي ﻛﻮﺗﺎهﺗﺮ دﻳﺪه ﻧﻤﻲﺷﻮد‪.‬‬ ‫‪ teriparatida -‬ﻳﺎ‬

‫‪76‬و‪50‬و‪11‬‬

‫ﻫﺎي ﻗﺒﻠﻲ در اﻳﻦ ﺑﻴﻤﺎران راﺑﻄﻪاي ﻧﺪارد‪.‬‬

‫ﻣﻄﺎﻟﻌﺎت ﻣﺘﻌﺪدي اﺛﺮ‬

‫ﺑﺨﺸﻲ ﭘﺎراﺗﻮرﻣﻮن را در ﻣﺮدان ﻧﺸﺎن داده و ﺑﻴﺎن ﻧﻤﻮدهاﻧﺪ ﻛﻪ ﺧﺎﺻﻴﺖ‬ ‫‪43‬و‪29‬و‪12‬‬

‫ﺿﺪ ﺷﻜﺴﺘﮕﻲ دارو در زﻧﺎن و ﻣﺮدان ﻣﺸﺎﺑﻪ ﻣﻲﺑﺎﺷﺪ‪.‬‬

‫‪ -2‬ﺑﻴﻤﺎران )ﺧﺎﻧﻢﻫﺎي ﻳﺎﺋﺴﻪ و ﻣﺮدان( ﺑﺎ داﻧﺴﻴﺘﻪ اﺳﺘﺨﻮاﻧﻲ ﺑﺴﻴﺎر‬ ‫ﭘﺎﻳﻴﻦ‪ .‬ﺗﺴﺮﻳﻊ در اﻓﺰاﻳﺶ داﻧﺴﻴﺘﻪ اﺳﺘﺨﻮاﻧﻲ ﺑﻪدﻧﺒﺎل ﻣﺼﺮف ﺗﺮﻳﭙﺎراﺗﻴﺪ‪،‬‬

‫‪ human recombinant‬آﻧﺎﻟﻮگ‬

‫اﻳﻦ دارو را درﻣﺎﻧﻲ ﻣﻨﺎﺳﺐ ﺑﺮاي ﺑﻴﻤﺎران ﺑﺎ داﻧﺴﻴﺘﻪ اﺳﺘﺨﻮاﻧﻲ ﺑﺴﻴﺎر‬

‫ﻣﻲﺑﺎﺷﺪ‪62.‬و‪61‬و‪ 14‬اﻳﻦ ﻫﻮرﻣﻮن از ﻣﻮﺛﺮﺗﺮﻳﻦ درﻣﺎنﻫﺎي‬

‫ﭘﺎﻳﻴﻦ )‪ T scores‬ﻛﻤﺘﺮ از ‪ 3/5‬در ﻏﻴﺎب ﺷﻜﺴﺘﮕﻲ و ﻳﺎ ﻛﻤﺘﺮ از ‪ 2/5‬در‬

‫اﺳﺘﺌﻮﭘﺮوز ﺑﻮده و ﺗﻨﻬﺎ آﻧﺎﻟﻮﮔﻲ از ﭘﺎراﺗﻮرﻣﻮن ﻣﻲﺑﺎﺷﺪ ﻛﻪ ﻣﺼﺮف آن ﺑﺎ‬

‫ﺣﻀﻮر ﺷﻜﺴﺘﮕﻲ( ﻧﻤﻮده اﺳﺖ‪ .‬در ﺑﻌﻀﻲ ﻣﻄﺎﻟﻌﺎت ﻧﺸﺎن داده ﺷﺪه ﻛﻪ‬

‫ﻃﻮل ﻋﻤﺮ اﻳﻦ‬

‫اﻳﻦ دارو ﻧﺴﺒﺖ ﺑﻪ ﺑﻴﺲ ﻓﺴﻔﻮﻧﺎتﻫﺎ در ﺟﻠﻮﮔﻴﺮي از ﺷﻜﺴﺘﮕﻲ ﺑﺮﺗﺮي‬

‫ﺑﻴﻮﺳﻨﺘﺘﻴﻚ‬

‫‪PTH‬‬

‫]‪PTH [1-34‬‬

‫‪64‬و‪63‬و‪29‬‬

‫ﻛﺎﻫﺶ ﺷﻜﺴﺘﮕﻲﻫﺎي ﻏﻴﺮﻣﻬﺮهاي ﻫﻤﺮاه اﺳﺖ‪.‬‬

‫دارو در ﺗﺰرﻳﻖ زﻳﺮﺟﻠﺪي ﺣﺪود ‪ 75‬دﻗﻴﻘﻪ و در ﺗﺰرﻳﻖ ورﻳﺪي ‪10‬‬ ‫‪67‬و‪66‬‬

‫دﻗﻴﻘﻪ ﻣﻲﺑﺎﺷﺪ‪ 65.‬اﻳﻦ ﻫﻮرﻣﻮن در ﻛﺒﺪ و ﻛﻠﻴﻪﻫﺎ ﻣﺘﺎﺑﻮﻟﻴﺰه ﻣﻲﺷﻮد‪.‬‬ ‫‪-‬‬

‫]‪PTH [1–31‬‬

‫ﻧﻮﺗﺮﻛﻴﺐ‪ :‬ﻗﺪرت ﺑﻴﻮﻟﻮژﻳﻚ اﻳﻦ دارو ﻧﻴﺰ ﻫﻤﺎﻧﻨﺪ‬

‫ﺗﺮﻳﭙﺎراﺗﻴﺪ ﺑﺎ ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ ﻣﺸﺎﺑﻪ ﻣﻲﺑﺎﺷﺪ‪.‬‬

‫‪25‬‬

‫ﻧﺪاﺷﺘﻪ و ﺑﺎ ﺗﻮﺟﻪ ﺑﻪ ﻗﻴﻤﺖ ﺑﺎﻻﻳﺸﺎن ﺗﻮﺻﻴﻪ ﻧﺸﺪهاﻧﺪ‪.‬‬ ‫‪ -3‬ﺑﻴﻤﺎراﻧﻲ ﻛﻪ ﺑﻪ داروﻫﺎي ﺿﺪ ﺟﺬب اﺳﺘﺨﻮان‬

‫‪39‬‬

‫)‪(Antiresorptive‬‬

‫ﻣﻮﺟﻮد ﭘﺎﺳﺦ ﻣﻨﺎﺳﺐ را ﻧﺪادهاﻧﺪ و ﻳﺎ ﺑﺮاي اﺳﺘﻔﺎده از آنﻫﺎ ﻛﻨﺘﺮا‪-‬‬ ‫اﻧﺪﻳﻜﺎﺳﻴﻮن دارﻧﺪ )آﺷﺎﻻزي‪ ،‬اﺳﻜﻠﺮودرﻣﻲ ﻣﺮي‪ ،‬ﺗﻨﮕﻲ ﻣﺮي(‪ .‬ﻋﺪم‬

‫ﻧﻮﺗﺮﻛﻴﺐ‪ :‬ﻣﺼﺮف روزاﻧﻪ ‪ 100g‬از اﻳﻦ ﺷﻜﻞ ﺟﺪﻳﺪ‬

‫ﺗﺤﻤﻞ ﺑﻴﺲ ﻓﺴﻔﻮﻧﺎتﻫﺎ ﺑﻪﻋﻠﺖ ﺣﺴﺎﺳﻴﺖ دﺳﺘﮕﺎه ﮔﻮارش ﻓﻮﻗﺎﻧﻲ‬

‫ﻧﻮﺗﺮﻛﻴﺐ‪ ،‬ﺑﺎ اﻓﺰاﻳﺶ ﺗﺮاﻛﻢ اﺳﺘﺨﻮان و ﻛﺎﻫﺶ ﻗﺎﺑﻞ ﻣﻼﺣﻈﻪ در اﺣﺘﻤﺎل‬

‫ﻳﻜﻲ از اﻧﺪﻳﻜﺎﺳﻴﻮنﻫﺎي ﻣﻬﻢ اﺳﺘﻔﺎده از ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ ﻣﻲﺑﺎﺷﺪ‪.‬‬

‫‪-‬‬

‫]‪PTH [1-84‬‬

‫ﺑﺮوز ﺷﻜﺴﺘﮕﻲ ﻣﻬﺮهاي در ﺑﻴﻤﺎران اﺳﺘﺌﻮﭘﺮوﺗﻴﻚ ﻫﻤﺮاه ﻣﻲﺑﺎﺷﺪ‪.‬‬ ‫‪ -‬ﭘﺎراﺗﻮرﻣﻮن‬

‫]‪[7–84‬‬

‫از ﺷﻜﺴﺘﻪ ﺷﺪن‬

‫]‪PTH [1–84‬‬

‫ﺑﻪدﺳﺖ آﻣﺪه و‬

‫ﺑﺎزﺟﺬب اﺳﺘﺨﻮاﻧﻲ ﺑﻪدﻧﺒﺎل ﻣﺼﺮف ]‪ PTH [7–84‬ﻣﻬﺎر ﻣﻲﺷﻮد‪.‬‬ ‫‪-‬‬

‫)‪PTH-related protein (PTHrP‬‬

‫‪23‬‬

‫ﺑﺮوز ﺷﻜﺴﺘﮕﻲ در ﺣﻴﻦ اﺳﺘﻔﺎده از ﺑﻴﺲ ﻓﺴﻔﻮﻧﺎتﻫﺎ ﺑﻪﻋﻨﻮان‬

‫‪26‬‬

‫ﻳﺎ ]‪ hPTHrP-[1–36‬ﻫﻤﻮﻟﻮگ‬

‫داروﻳﻲ ﻧﻤﻲﺗﻮاﻧﺪ رﻳﺴﻚ ﺷﻜﺴﺘﮕﻲ را ﺑﻪ ﺻﻔﺮ ﻛﺎﻫﺶ دﻫﺪ‪.‬‬ ‫‪PTH‬‬

‫ﺑﻮده و ﻫﻤﺎﻧﻨﺪ اﻳﻦ ﻫﻮرﻣﻮن‪ ،‬و ﺑﺎ ﻫﻤﺎن ﻗﺪرت‪ ،‬ﻓﻌﺎﻟﻴﺖ ﺧﻮد را از‬ ‫‪PTH-1‬‬

‫اﻧﺪﻳﻜﺎﺳﻴﻮن اﺳﺘﻔﺎده از اﻳﻦ دارو ﻣﺤﺴﻮب ﻧﻤﻲﺷﻮد‪ ،‬ﭼﺮاﻛﻪ ﻫﻴﭻ‬ ‫‪ -4‬ﺑﻴﻤﺎراﻧﻲ ﻛﻪ ﺑﻪﺟﻬﺖ اﺳﺘﻔﺎده ﻃﻮﻻﻧﻲ از ﮔﻠﻮﻛﻮرﺗﻴﻜﻮﻳﻴﺪﻫﺎ دﭼﺎر‬ ‫‪25‬‬

‫اﺳﺘﺌﻮﭘﺮوز ﺷﺪهاﻧﺪ‪.‬‬

‫ﺑﺮ روي اﺳﺘﺌﻮﺑﻼﺳﺖﻫﺎ و ﺳﻠﻮلﻫﺎي اﺳﺘﺮوﻣﺎﻳﻲ‬

‫ﻣﻤﻨﻮﻋﻴﺖﻫﺎي درﻣﺎن ﺑﺎ ﭘﺎراﺗﻮرﻣﻮن‪ :‬ﺑﻴﺸﺘﺮ ﻣﻄﺎﻟﻌﺎت ﻣﻮﺟﻮد ﺑﺮ روي‬

‫ﻣﻄﺎﻟﻌﺎت ﻣﺘﻌﺪدي ﻧﺸﺎن دادهاﻧﺪ ﻛﻪ‬

‫زﻧﺎن ﻳﺎﺋﺴﻪ و ﻣﺮدان ﺑﺎﻻي ‪ 50‬ﺳﺎل اﻧﺠﺎم ﺷﺪه وﻟﻲ ﺑﻪﻧﻈﺮ ﻧﻤﻲرﺳﺪ‬

‫ﻣﺼﺮف دوزﻫﺎي ﺑﺎﻻي اﻳﻦ دارو ﺑﻪﺻﻮرت زﻳﺮ ﺟﻠﺪي ﺑﺮاي ﺳﻪ ﻣﺎه ﺑﺎ‬

‫ﻫﻴﭻ ﻣﺤﺪودﻳﺖ ﺳﻨﻲ ﺑﺮاي اﺳﺘﻔﺎده از ﺗﺮﻳﭙﺎراﺗﻴﺪ ﻳﺎ ﭘﺎراﺗﻮرﻣﻮن ﺧﺎﻟﺺ‬

‫اﻓﺰاﻳﺶ داﻧﺴﻴﺘﻪ اﺳﺘﺨﻮاﻧﻲ در ﺧﺎﻧﻢﻫﺎي ﻳﺎﺋﺴﻪ ﻫﻤﺮاه ﻣﻲﺑﺎﺷﺪ‪ 71.‬اﺛﺮات‬

‫وﺟﻮد داﺷﺘﻪ ﺑﺎﺷﺪ؛ ﻫﺮﭼﻨﺪ ﻛﻪ اﺳﺘﻔﺎده از اﻳﻦ داروﻫﺎ ﺑﺮاي زﻧﺎن و‬

‫ﻛﻤﺘﺮ ﺑﻮده و ﺑﻪﻫﻤﻴﻦ دﻟﻴﻞ‬

‫ﻣﺮدان ﺟﻮانﺗﺮ ﺑﺎ داﻧﺴﻴﺘﻪ اﺳﺘﺨﻮاﻧﻲ ﭘﺎﻳﻴﻦ ﺑﻪﻋﻨﻮان ﺗﻨﻬﺎ اﺧﺘﻼل ﻣﻮﺟﻮد‬

‫ﻃﺮﻳﻖ ﮔﻴﺮﻧﺪه‬

‫‪68-70‬‬

‫ﻣﻐﺰ اﺳﺘﺨﻮان اﻋﻤﺎل ﻣﻲﻛﻨﺪ‪.‬‬

‫ﺟﺬﺑﻲ اﻳﻦ دارو ﻧﺴﺒﺖ ﺑﻪ ﻫﻮرﻣﻮن‬

‫‪PTH‬‬

‫‪73‬و‪72‬و‪66‬‬

‫اﺳﺘﻔﺎده از اﻳﻦ دارو ﺑﺎ ﻋﻮارض ﺟﺎﻧﺒﻲ ﻛﻤﺘﺮي ﻫﻤﺮاه ﻣﻲﺑﺎﺷﺪ‪.‬‬

‫اﻓﺮاد ﻛﺎﻧﺪﻳﺪ درﻣﺎن ﺑﺎ ﭘﺎراﺗﻮرﻣﻮن‪ :‬ﻫﺰﻳﻨﻪ ﺑﺎﻻ‪ ،‬ﻧﺤﻮه اﺳﺘﻔﺎده )ﺗﺰرﻳﻖ‬

‫ﺗﻮﺻﻴﻪ ﻧﻤﻲﺷﻮد‪ .‬در ﻣﻄﺎﻟﻌﻪاي در زﻧﺎن ﻏﻴﺮ ﻳﺎﺋﺴﻪ‪ ،‬ﭘﺎراﺗﻮرﻣﻮن ﻣﻮﺟﺐ‬ ‫‪ 2/1‬درﺻﺪ اﻓﺰاﻳﺶ ﺗﺮاﻛﻢ اﺳﺘﺨﻮاﻧﻲ ﻣﻬﺮهﻫﺎي ﻛﻤﺮي ﺷﺪه اﺳﺖ‪.‬‬

‫‪77‬‬

‫زﻳﺮﺟﻠﺪي( و ﻧﮕﺮاﻧﻲ از ﻋﻮارض ﻃﻮﻻﻧﻲﻣﺪت از ﻋﻮاﻣﻠﻲ ﻫﺴﺘﻨﺪ ﻛﻪ‬

‫درﺑﺎره ﻣﻀﺮات اﺳﺘﻔﺎده از اﻳﻦ داروﻫﺎ در زﻧﺎن ﺣﺎﻣﻠﻪ اﻃﻼﻋﺎت زﻳﺎدي‬

‫ﻣﺼﺮف ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ را ﻣﺤﺪود ﻧﻤﻮده اﺳﺖ‪ .‬اﻓﺮادي ﻛﻪ ﻛﺎﻧﺪﻳﺪ‬

‫در دﺳﺖ ﻧﻤﻲﺑﺎﺷﺪ وﻟﻲ اﺳﺘﻔﺎده از ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ در زﻧﺎن در‬

‫‪75‬و‪74‬و‪25‬‬

‫درﻣﺎن ﺑﺎ ﺗﺮﻳﭙﺎراﺗﻴﺪ ﻫﺴﺘﻨﺪ در ﭼﻬﺎر ﮔﺮوه ﺗﻘﺴﻴﻢ ﻣﻲﺷﻮﻧﺪ‪:‬‬

‫ﺳﻨﻴﻦ ﺑﺎروري ﺗﻮﺻﻴﻪ ﻧﻤﻲﺷﻮد‪ .‬ﻫﻤﭽﻨﻴﻦ اﺳﺘﻔﺎده از اﻳﻦ دارو ﺑﺮاي‬

‫‪ -1‬ﺑﻴﻤﺎران ﺑﺎ ﺳﺎﺑﻘﻪ ﺷﻜﺴﺘﮕﻲ ﻧﺎﺷﻲ از اﺳﺘﺌﻮﭘﺮوز‪ .‬ﻣﻄﺎﻟﻌﺎت ﻣﻮﺟﻮد‬

‫ﻣﺪت ﻃﻮﻻﻧﻲﺗﺮ از دو ﺳﺎل ﭘﻴﺸﻨﻬﺎد ﻧﻤﻲﺷﻮد ﭼﺮاﻛﻪ ﻣﻄﺎﻟﻌﺎت ﻗﺒﻠﻲ‬

‫ﻣﻮﻳﺪ ﻧﻘﺶ اﻳﻦ دارو در ﻛﺎﻫﺶ رﻳﺴﻚ ﺷﻜﺴﺘﮕﻲﻫﺎي ﻣﻬﺮهاي و ﻏﻴﺮ‬

‫روي ﻣﻮشﻫﺎ از ﺳﺮﻃﺎنزاﻳﻲ اﻳﻦ دارو در اﺳﺘﻔﺎدهﻫﺎي ﻃﻮﻻﻧﻲﻣﺪت‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬


‫‪501‬‬

‫ﭘﺎراﺗﻮرﻣﻮن ﻧﻮﺗﺮﻛﻴﺐ و ﭘﻮﻛﻲ اﺳﺘﺨﻮان‬

‫ﺧﺒﺮ دادهاﻧﺪ‪ 66.‬از ﻣﻴﺎن ‪ 300,000‬ﺑﻴﻤﺎري ﻛﻪ ﺗﺎﻛﻨﻮن ﺑﺎ اﻳﻦ دارو درﻣﺎن‬

‫ﻃﺒﻴﻌﻲ ﻧﻤﻲﺑﺎﺷﺪ‪.‬‬

‫‪12‬و‪11‬‬

‫ﺷﻴﻮع ﺳﺮدرد و ﮔﻴﺠﻲ در ﺑﻴﻤﺎراﻧﻲ ﻛﻪ‬

‫‪PTH [1-‬‬

‫ﺷﺪهاﻧﺪ‪ ،‬اﺳﺘﺌﻮﺳﺎرﻛﻮم ﺗﻨﻬﺎ در ﻳﻚ ﺧﺎﻧﻢ ﻳﺎﺋﺴﻪ ﻛﻪ ﺗﺮﻳﭙﺎراﺗﻴﺪ درﻳﺎﻓﺖ‬

‫]‪ 84‬را ﺑﻪﺗﻨﻬﺎﻳﻲ و ﻳﺎ ﺗﻮام ﺑﺎ آﻟﻨﺪروﻧﺎت درﻳﺎﻓﺖ ﻧﻤﻮده ﺑﻮدﻧﺪ ﻧﺴﺒﺖ ﺑﻪ‬

‫ﻧﻤﻮده اﺳﺖ ﮔﺰارش ﺷﺪه اﺳﺖ؛ ﺑﺎ اﻳﻦ وﺟﻮد راﺑﻄﻪ ﻗﻄﻌﻲ ﻣﻴﺎن ﻣﺼﺮف‬

‫‪29‬و‪11‬‬

‫ﻛﺴﺎﻧﻲ ﻛﻪ ﺗﺤﺖ درﻣﺎن ﺑﺎ آﻟﻨﺪروﻧﺎت ﺑﻪﺗﻨﻬﺎﻳﻲ ﺑﻮدﻧﺪ ﺑﻴﺸﺘﺮ ﺑﻮد‪.‬‬

‫دارو و ﺑﺮوز اﺳﺘﺌﻮﺳﺎرﻛﻮم در اﻳﻦ ﺑﻴﻤﺎر ﺑﻪ اﺛﺒﺎت ﻧﺮﺳﻴﺪه اﺳﺖ‪ 78.‬در‬

‫اﻓﺰاﻳﺶ ﺳﻄﻮح ﺧﻮﻧﻲ اﺳﻴﺪ اورﻳﻚ و ﺑﺮوز ﻧﻘﺮس ﺣﺎد در اﻓﺮادي ﻛﻪ ﺑﺎ‬

‫ﻣﻄﺎﻟﻌﻪ دﻳﮕﺮي ﻧﻴﺰ ﺑﺮوز اﺳﺘﺌﻮﺳﺎرﻛﻮم در ﭼﻬﺎر ﺑﻴﻤﺎر ﻣﺒﺘﻼ ﺑﻪ‬

‫ﺗﺮﻳﭙﺎراﺗﻴﺪ و ﻳﺎ ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ ﺧﺎﻟﺺ درﻣﺎن ﺷﺪه ﺑﻮدﻧﺪ‪ ،‬ﻧﻴﺰ‬

‫ﻫﺎﻳﭙﺮﭘﺎراﺗﻴﺮوﻳﻴﺪﻳﺴﻢ اوﻟﻴﻪ ﮔﺰارش ﺷﺪه اﺳﺖ‪.‬‬

‫ﮔﺰارش ﮔﺮدﻳﺪه اﺳﺖ‪28.‬و‪ 11‬در ﺑﺮﺧﻲ از ﻣﻄﺎﻟﻌﺎت ﺑﺮوز ﻛﻤﺮدرد ﺑﻪدﻧﺒﺎل‬

‫‪79‬‬

‫ﺑﺎ وﺟﻮد آنﻛﻪ ﺧﻄﺮ ﺑﺮوز اﺳﺘﺌﻮﺳﺎرﻛﻮﻣﺎ ﺑﻪدﻧﺒﺎل ﻣﺼﺮف اﻳﻦ دارو در‬

‫‪82‬‬

‫ﻣﺼﺮف ]‪ PTH [1-34‬ﻣﺸﺎﻫﺪه ﺷﺪه اﺳﺖ‪.‬‬

‫اﻧﺴﺎن ﺛﺎﺑﺖ ﻧﺸﺪه وﻟﻲ اﺳﺘﻔﺎده از ﺗﺮﻳﭙﺎراﺗﻴﺪ در ﺑﻴﻤﺎراﻧﻲ ﻛﻪ در رﻳﺴﻚ‬

‫ﭘﺮوﺗﻜﻞﻫﺎي ﻣﺼﺮف‪ :‬ﺗﺮﻳﭙﺎراﺗﻴﺪ )]‪ (hPTH [1-34‬اوﻟﻴﻦ دارو ﺑﺎ اﺛﺮات‬

‫ﺑﺮوز اﻳﻦ ﺑﻴﻤﺎري ﻫﺴﺘﻨﺪ ﻣﺎﻧﻨﺪ اﻓﺮاد ﺟﻮان ﻛﻪ اﭘﻴﻔﻴﺰ آنﻫﺎ ﺑﺎز اﺳﺖ‪،‬‬

‫آﻧﺎﺑﻮﻟﻴﻚ ﻣﻲﺑﺎﺷﺪ ﻛﻪ اﺳﺘﻔﺎده از آن در اروﭘﺎ و آﻣﺮﻳﻜﺎ ﺑﺮاي درﻣﺎن‬

‫اﻓﺮاد ﻣﺴﻦ ﻣﺒﺘﻼ ﺑﻪ ﺑﻴﻤﺎري ﭘﺎژه‪ ،‬ﺑﻴﻤﺎران ﺑﺎ ﺗﻮﻣﻮرﻫﺎي ﺑﺪﺧﻴﻢ‬

‫اﺳﺘﺌﻮﭘﺮوز در ﺧﺎﻧﻢﻫﺎي ﻳﺎﺋﺴﻪ ﺑﺎ دوز ‪ 20µg/day‬ﺑﺮاي ‪ 18‬ﻣﺎه )در‬

‫اﺳﺘﺨﻮاﻧﻲ‪ ،‬آنﻫﺎﻳﻲ ﻛﻪ ﺳﻄﺢ آﻟﻜﺎﻟﻦ ﻓﺴﻔﺎﺗﺎز ﺧﻮن آنﻫﺎ ﺑﺪون ﻫﻴﭻ‬

‫اروﭘﺎ( ﻳﺎ ‪ 24‬ﻣﺎه )در آﻣﺮﻳﻜﺎ( ﻣﺠﺎز ﺷﻨﺎﺧﺘﻪ ﺷﺪه اﺳﺖ‪.‬‬

‫‪66‬‬

‫ﺗﻮﺟﻴﻪ ﺧﺎﺻﻲ ﺑﺎﻻﺳﺖ و ﻳﺎ ﻗﺒﻼً ﺗﺤﺖ رادﻳﻮﺗﺮاﭘﻲ ﻗﺮار ﮔﺮﻓﺘﻪاﻧﺪ ﺗﻮﺻﻴﻪ‬

‫اﺳﺘﻔﺎده ﻣﻨﻘﻄﻊ از ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ‪ ،‬ﺗﻨﻬﺎ ﺣﺎﻟﺘﻲ اﺳﺖ ﻛﻪ اﺛﺮات‬

‫اﺳﺘﻔﺎده از اﻳﻦ ﻫﻮرﻣﻮن ﻫﻤﭽﻨﻴﻦ در ﺑﻴﻤﺎران ﺑﺎ ﺳﺎﺑﻘﻪ‬

‫‪84‬و‪83‬‬

‫‪80‬و‪78‬‬

‫ﻧﻤﻲﺷﻮد‪.‬‬

‫آﻧﺎﺑﻮﻟﻴﻚ آن ﺑﺮ اﺳﺘﺨﻮان ﺗﻮﺳﻂ‬

‫‪FDA‬‬

‫ﺑﻪ اﺛﺒﺎت رﺳﻴﺪه اﺳﺖ‪.‬‬

‫ﺳﺮﻃﺎن ﻗﺒﻠﻲ و ﻳﺎ ﻣﺒﺘﻼ ﺑﻪ ﺳﻨﮓ ﻛﻠﻴﻪ‪ ،‬ﻧﺎرﺳﺎﻳﻲ ﻛﻠﻴﻪ و ﻧﻘﺮس ﺑﻪﺟﺰ در‬

‫ﺑﻪﻋﺒﺎرت دﻳﮕﺮ در ﺣﺎﻟﻲﻛﻪ ﻣﺼﺮف ﻣﻘﻄﻌﻲ ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ ﺳﺎﺧﺘﻪ‬

‫ﻣﻮاردي ﻛﻪ ﺳﺎﻳﺮ داروﻫﺎ ﺑﻲﻧﺘﻴﺠﻪ ﻣﺎﻧﺪه و ﺧﻮاص دارو ﻧﺴﺒﺖ ﺑﻪ‬

‫ﺷﺪن اﺳﺘﺨﻮان را ﺗﺴﺮﻳﻊ ﻣﻲﻧﻤﺎﻳﺪ‪ ،‬ﻣﺼﺮف داﻳﻢ آن اﺛﺮات ﻛﺎﺗﺎﺑﻮﻟﻴﻚ‬

‫ﻋﻮارض آن ﺑﺮﺗﺮي داﺷﺘﻪ ﺑﺎﺷﺪ‪ ،‬ﺗﻨﻬﺎ ﺑﻌﺪ از ﻛﻨﺘﺮل دﻗﻴﻖ ﺳﻄﻮح ﻛﻠﺴﻴﻢ‬

‫داﺷﺘﻪ و ﺑﺎ ﺑﺎزﺟﺬب اﺳﺘﺨﻮاﻧﻲ )‪ (Bone resorption‬ﻫﻤﺮاه‬ ‫‪86‬و‪85‬و‪27‬‬

‫‪81‬و‪25‬‬

‫ﻣﻲﺑﺎﺷﺪ‪.‬‬

‫و اﺳﻴﺪ اورﻳﻚ ﺳﺮم و ادرار‪ ،‬ﭘﻴﺸﻨﻬﺎد ﻣﻲﺷﻮد‪.‬‬

‫در ﻣﻄﺎﻟﻌﻪاي ﻛﻪ ﺗﻮﺳﻂ ‪ Dobnig‬و ‪(1997) Turner‬‬

‫ﺑﻴﻤﺎران ﺑﺎ ﺳﻄﺢ اﺳﻴﺪ اورﻳﻚ ﺑﺎﻻﺗﺮ از ‪ 7/5‬ﻧﻴﺰ ﻧﺒﺎﻳﺪ ﺗﺎ زﻣﺎﻧﻲ ﻛﻪ ﺳﻄﺢ‬

‫اﻧﺠﺎم ﺷﺪ‪ ،‬ﻧﺸﺎن داده ﺷﺪ ﻛﻪ ﻣﺼﺮف ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ ﺑﺮاي زﻣﺎﻧﻲ‬

‫اﺳﻴﺪ اورﻳﻚ ﻛﻨﺘﺮل ﻧﺸﺪه ﺑﺎﺷﺪ ﺑﺎ ﭘﺎراﺗﻮرﻣﻮن درﻣﺎن ﺷﻮﻧﺪ‪ 28.‬اﺳﺘﻔﺎده از‬

‫ﻛﻤﺘﺮ از دو ﺳﺎﻋﺖ ﺑﺎﻋﺚ ﺗﺤﺮﻳﻚ ﭘﺎﺳﺦ آﻧﺎﺑﻮﻟﻴﻚ در اﺳﺘﺌﻮﺑﻼﺳﺖﻫﺎ‬

‫اﻳﻦ دارو در اﻓﺮاديﻛﻪ دﻳﺠﻴﺘﺎﻟﻴﺲ ﻣﺼﺮف ﻣﻲﻛﻨﻨﺪ ﻧﻴﺰ ﻣﻲﺑﺎﻳﺴﺖ ﺑﺎ‬

‫ﻣﻲﺷﻮد‪ ،‬در ﺣﺎﻟﻲ ﻛﻪ ﺗﻤﺎسﻫﺎي ﻃﻮﻻﻧﻲﻣﺪتﺗﺮ ﺑﺎ ﭘﺎﺳﺦ ﻛﺎﺗﺎﺑﻮﻟﻴﻚ‬ ‫‪87‬‬

‫اﺣﺘﻴﺎط ﺻﻮرت ﮔﻴﺮد‪ .‬در ﻫﻨﮕﺎم اﺳﺘﻔﺎده از اﻳﻦ دارو ﻣﺼﺮف ﻛﻠﺴﻴﻢ‬

‫ﻫﻤﺮاه اﺳﺖ‪ .‬از آﻧﺠﺎ ﻛﻪ درﻣﺎن ﺑﺎ ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ ﺑﺎ ﺗﻐﻴﻴﺮ ﻣﺴﺘﻘﻴﻢ‬

‫روزاﻧﻪ )ﭼﻪ از ﻏﺬا و ﭼﻪ ﻣﻜﻤﻞﻫﺎي ﻏﺬاﻳﻲ( ﻣﻲﺑﺎﻳﺴﺖ در ﺣﺪ‬

‫ﺗﺸﻜﻴﻞ اﺳﺘﺨﻮان ﺟﺪﻳﺪ ﺑﺎﻋﺚ درﻣﺎن ﭘﻮﻛﻲ اﺳﺘﺨﻮان ﻣﻲﺷﻮد‪ ،‬ﺑﺮﺧﻲ‬

‫‪ 1500mg‬ﺑﺎﺷﺪ‪ .‬اﻳﻦ ﺑﻴﻤﺎران ﻣﻲﺑﺎﻳﺴﺖ ﻣﻘﺎدﻳﺮ ﻣﻨﺎﺳﺐ وﻳﺘﺎﻣﻴﻦ‪ -‬د‬

‫ﻣﻌﺘﻘﺪﻧﺪ ﻛﻪ اﺳﺘﻔﺎده از آن ﻣﻲﺑﺎﻳﺴﺖ ﺑﻪﺻﻮرت روزاﻧﻪ ﺑﺎﺷﺪ ﻛﻪ ﺑﺎ ﺗﻮﺟﻪ‬

‫)‪ (1000U/d‬را درﻳﺎﻓﺖ ﻧﻤﺎﻳﻨﺪ‪ .‬اﻳﻦ دارو ﻧﺒﺎﻳﺪ در ﺑﻴﻤﺎران داراي آﻟﺮژي‬

‫ﺑﻪ ﻗﻴﻤﺖ ﺑﺎﻻي دارو ﺑﺎﻋﺚ ﻣﺤﺪود ﺷﺪن اﺳﺘﻔﺎده از اﻳﻦ ﻫﻮرﻣﻮن‬

‫‪66‬و‪25‬‬

‫ﺑﻪ ﺗﺮﻳﭙﺎراﺗﻴﺪ‪ ،‬ﻛﻮدﻛﺎن و ﺧﺎﻧﻢﻫﺎي ﺷﻴﺮده اﺳﺘﻔﺎده ﺷﻮد‪.‬‬

‫ﺑﻪﺻﻮرت روﺗﻴﻦ ﺷﺪه اﺳﺖ‪.‬‬

‫ﺑﺮﺧﻲ ﻣﻄﺎﻟﻌﺎت ﺑﺮاي اﻓﺰاﻳﺶ‬

‫]‪PTH [1–84‬‬

‫ﻣﻘﺒﻮﻟﻴﺖ دارو در ﺟﺎﻣﻌﻪ‪ ،‬روشﻫﺎي ﺟﺪﻳﺪي را ﭘﻴﺸﻨﻬﺎد ﻧﻤﻮدهاﻧﺪ ﻛﻪ‬

‫ﺑﻪﺧﻮﺑﻲ ﺗﺤﻤﻞ ﻣﻲﺷﻮﻧﺪ‪29.‬و‪28‬و‪ 18‬ﻣﻄﺎﻟﻌﻪ ‪ Neer‬ﺗﻨﻬﺎ ﻣﻄﺎﻟﻌﻪ ﺑﺰرﮔﻲ اﺳﺖ‬

‫ﻋﻼوه ﺑﺮ ﺣﻔﻆ ﺧﺎﺻﻴﺖ آﻧﺎﺑﻮﻟﻴﻚ دارو از دﻓﻌﺎت اﺳﺘﻔﺎده از آن ﺑﻜﺎﻫﺪ‪:‬‬

‫ﻛﻪ ﺑﻪ ﺑﺮرﺳﻲ اﺑﻌﺎد و ﻋﻮارض ﺟﺎﻧﺒﻲ ﺗﺮﻳﭙﺎراﺗﻴﺪ ﭘﺮداﺧﺘﻪ اﺳﺖ‪25.‬و‪ 11‬در‬

‫اﺳﺘﻔﺎده از ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ‬

‫]‪[1–84‬‬

‫اﻳﻦ ﻣﻄﺎﻟﻌﻪ آﻧﺘﻲﺑﺎديﻫﺎي ﺗﺮﻳﭙﺎراﺗﻴﺪ در ‪ %3‬ﺧﺎﻧﻢﻫﺎ ﺑﺎ درﻳﺎﻓﺖ روزاﻧﻪ‬

‫آﻟﻨﺪروﻧﺎت ﺑﺮاي دو ﺳﺎل‪ ،‬اﺳﺘﻔﺎده ﻫﻔﺘﮕﻲ از ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ‬

‫‪ 20g‬از دارو ﮔﺰارش ﮔﺮدﻳﺪ؛ اﻳﻦ آﻧﺘﻲﺑﺎديﻫﺎ در ﻳﺎﻓﺘﻪﻫﺎي ﺑﺎﻟﻴﻨﻲ اﻳﻦ‬

‫]‪ [1-34‬در دورهﻫﺎي ﺳﻪﻣﺎﻫﻪ‪ ،‬ﺗﺰرﻳﻖ ﻫﻔﺘﮕﻲ ﻫﻮرﻣﻮن ﺑﻌﺪ از ﻣﺼﺮف آن‬

‫ﻣﻄﺎﻟﻌﻪ ﻧﻘﺸﻲ ﻧﺪاﺷﺘﻨﺪ‪ .‬ﻫﻤﭽﻨﻴﻦ اﻳﻦ آﻧﺘﻲﺑﺎديﻫﺎ در ﺑﻴﻤﺎراﻧﻲ ﻛﻪ‬

‫‪90‬و‪89‬و‪27‬‬

‫ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ ﺧﺎﻟﺺ درﻳﺎﻓﺖ ﻣﻲﻧﻤﻮدﻧﺪ دﻳﺪه ﻧﺸﺪ‪ 18.‬ﺳﺮدرد‪،‬‬

‫ﻣﻄﺎﻟﻌﺎت ﺑﺎﻟﻴﻨﻲ ﺑﺮ روي ﺗﺮﻳﭙﺎراﺗﻴﺪ و ‪ Intact PTH‬ﺷﺎﻣﻞ اﻟﮕﻮرﻳﺘﻢﻫﺎﻳﻲ‬

‫ﺗﻬﻮع‪ ،‬ﮔﻴﺠﻲ و ﻛﺮاﻣﭗ ﻋﻀﻼﻧﻲ ﺷﺎﻳﻊﺗﺮﻳﻦ ﻋﻮارﺿﻲ ﺑﻮد ﻛﻪ در اﻳﻦ‬

‫ﺑﺮاي ﺗﻨﻈﻴﻢ دوز دارو ﺑﺮ اﺳﺎس ﺳﻄﺢ ﻛﻠﺴﻴﻢ ﻣﻲﺑﺎﺷﺪ‪ .‬ﭼﻬﺎر ﺗﺎ ﺷﺶ‬

‫ﺑﻴﻤﺎران ﮔﺰارش ﮔﺮدﻳﺪ ﻫﺮ ﭼﻨﺪ ﻛﻪ ﺷﻴﻮع اﻳﻦ ﻋﻮارض ﺑﻴﺸﺘﺮ از اﻓﺮاد‬

‫ﺳﺎﻋﺖ ﺑﻌﺪ از ﺗﺰرﻳﻖ ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ‪ ،‬ﺳﻄﺢ ﻛﻠﺴﻴﻢ ﺧﻮن ﺣﺪود‬

‫ﻋﻮارض‪ :‬در ﺣﺎﻟﺖ ﻛﻠﻲ ﺗﺮﻳﭙﺎراﺗﻴﺪ‬

‫)]‪[1-34‬‬

‫‪ (PTH‬و‬

‫‪88‬و‪84‬و‪11‬‬

‫ﺑﺮاي ﻳﻚﺳﺎل و اداﻣﻪ درﻣﺎن ﺑﺎ‬

‫ﺑﻪﻣﺪت ﻳﻚﻣﺎه ﺑﻪﺻﻮرت روزاﻧﻪ از ﺟﻤﻠﻪ اﻳﻦ روشﻫﺎ ﻣﻲﺑﺎﺷﺪ‪.‬‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬


‫ﺑﺎﻗﺮ ﻻرﻳﺠﺎﻧﻲ و ﻫﻤﻜﺎران‬

‫‪502‬‬

‫‪ (0/8mg/dl) 0/2mmol/L‬اﻓﺰاﻳﺶ ﻣﻲﻳﺎﺑﺪ وﻟﻲ ﺳﻄﺢ آن ﻫﻤﻮاره در‬ ‫ﺣﺪ ﻃﺒﻴﻌﻲ ﻓﻴﺰﻳﻮﻟﻮژﻳﻚ ﺑﺎﻗﻲ ﻣﻲﻣﺎﻧﺪ‪ 25.‬اﻳﻦ اﻓﺰاﻳﺶ ﺳﻄﺢ ﻛﻠﺴﻴﻢ ﺑﺮاي‬

‫آنﻫﺎ ﺣﺎﺻﻞ ﻧﺸﺪه اﺳﺖ و ﺑﻌﻀﺎً از ﭘﺮوﺗﻜﻞﻫﺎي ﻣﺸﺎﺑﻪ دﺳﺖآوردﻫﺎي‬ ‫‪29‬و‪28‬‬

‫ﻣﺘﻨﺎﻗﻀﻲ ﺑﻪدﺳﺖ آورده اﺳﺖ‪.‬‬

‫ﻣﺪﺗﻲ ﺑﺎﻗﻲﻣﺎﻧﺪه و ﻗﺒﻞ از آنﻛﻪ دوز دوم ﺗﺰرﻳﻖ ﮔﺮدد‪ ،‬ﺑﻪ ﺳﻄﺢ ﻃﺒﻴﻌﻲ‬

‫اﺳﺘﺮوژن‪ :‬ﻣﻄﺎﻟﻌﺎت در زﻧﺎن ﺣﺎﻣﻠﻪاي ﻛﻪ ﺑﺮاي ﻣﺪت ﻃﻮﻻﻧﻲ ﻗﺒﻞ از‬

‫‪FDA‬‬

‫ﺷﺮوع درﻣﺎن ﺑﺎ ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ اﺳﺘﺮوژن و ﻳﺎ ﮔﻠﻮﻛﻮﻛﻮرﺗﻴﻜﻮﻳﻴﺪ‬

‫ﻧﻴﺎزي ﺑﻪ ﭘﺎﻳﺶ ﻣﺪاوم ﺳﻄﺢ ﻛﻠﺴﻴﻢ ﺧﻮن در ﺑﻴﻤﺎران درﻳﺎﻓﺖﻛﻨﻨﺪه‬

‫ﻣﺼﺮف ﻣﻲﻧﻤﻮده و ﻣﺼﺮف آنرا ﺣﺘﻲ ﺑﻌﺪ از ﺷﺮوع درﻣﺎن اداﻣﻪ‬

‫ﻫﻮرﻣﻮن ﻧﻴﺴﺖ؛ ﭼﺮاﻛﻪ ﻫﻴﭙﺮﻛﻠﺴﻤﻲ ﻣﺪاوم در اﻳﻦ ﺑﻴﻤﺎران ﻧﺎدر ﺑﻮده و‬

‫ﻣﻲدادﻧﺪ‪ ،‬ﻧﺸﺎندﻫﻨﺪه ﭘﺎﺳﺦ ﺑﻬﺘﺮ ﺑﻪ درﻣﺎن‪ ،‬اﻓﺰاﻳﺶ ﺑﻴﺸﺘﺮ ﺷﺎﺧﺺﻫﺎي‬

‫اﻳﻦ ﻋﺎرﺿﻪ در‬

‫‪92‬و‪53‬و‪49‬‬

‫ﺑﻴﻤﺎراﻧﻲ ﻛﻪ دوزﻫﺎي ﺑﺎﻻﺗﺮي از ﺗﺮﻳﭙﺎراﺗﻴﺪ را درﻳﺎﻓﺖ ﻣﻲﻛﻨﻨﺪ‬

‫اﺳﺘﻔﺎده از ﺑﺘﺎ‪ -‬ﺑﻠﻮﻛﺮ )‪ (β-blockers‬در اﻳﻦ اﻓﺮاد ﻧﻴﺰ ﺑﺎ ﺑﻬﺒﻮد ﻧﺘﺎﻳﺞ‬

‫ﻫﻤﭽﻨﻴﻦ ﻫﻴﭙﺮﻛﻠﺴﻤﻲ در ﺑﻴﻤﺎران‬

‫ﻫﻤﺮاه ﺑﻮده اﺳﺖ‪ 93.‬از ﻃﺮف دﻳﮕﺮ اﺳﺘﻔﺎده ﻫﻤﺰﻣﺎن از ﻫﻮرﻣﻮن ﭘﺎرا‪-‬‬

‫‪18‬‬

‫ﺗﻴﺮوﻳﻴﺪ و ﻫﻮرﻣﻮن درﻣﺎﻧﻲ )‪ (HRT‬ﻫﻴﭻ ﺑﺮﺗﺮي ﻧﺴﺒﺖ ﺑﻪ ﻫﻮرﻣﻮن ﭘﺎرا‪-‬‬

‫‪91‬و‪25‬‬

‫ﺑﺎز ﻣﻲﮔﺮدد‪.‬‬

‫اﮔﺮﭼﻪ‪ ،‬ﺑﺮاﺳﺎس راﻫﻨﻤﺎﻳﻲﻫﺎي ﺑﺎﻟﻴﻨﻲ اﺧﻴﺮ‬

‫‪28‬و‪18‬و‪11‬‬

‫در ﺻﻮرت وﻗﻮع ﺑﺴﻴﺎر ﺧﻔﻴﻒ ﻣﻲﺑﺎﺷﺪ؛‬ ‫‪29‬و‪11‬‬

‫)‪ (40mcg‬ﺷﺎﻳﻊﺗﺮ اﺳﺖ‪.‬‬ ‫ﻣﺼﺮفﻛﻨﻨﺪه‬

‫]‪PTH [1-84‬‬

‫ﺑﻴﺸﺘﺮ ﮔﺰارش ﺷﺪه اﺳﺖ‪ .‬ﺗﻬﻮع و اﺳﺘﻔﺮاغ‬ ‫‪25‬‬

‫در اﻳﻦ ﺑﻴﻤﺎران ﺷﺪﻳﺪ‪ ،‬وﻟﻲ ﻧﺎﺷﺎﻳﻊ اﺳﺖ‪ .‬ﺑﺴﻴﺎري از ﭘﺰﺷﻜﺎن ﺗﺮﺟﻴﺢ‬

‫زﻳﺴﺖﺷﻨﺎﺧﺘﻲ ﺗﻮﻟﻴﺪ اﺳﺘﺨﻮان و داﻧﺴﻴﺘﻪ اﺳﺘﺨﻮاﻧﻲ ﻣﻲﺑﺎﺷﺪ‪.‬‬

‫ﺗﻴﺮوﻳﻴﺪ ﺑﻪﺗﻨﻬﺎﻳﻲ ﻧﺪاﺷﺖ؛ اﮔﺮﭼﻪ ﻧﺘﺎﻳﺞ ﺑﻪدﺳﺖ آﻣﺪه در اﻳﻦ ﻣﻄﺎﻟﻌﻪ‬ ‫‪91‬‬

‫ﻣﻲدﻫﻨﺪ ﺳﻄﺢ ﺳﺮﻣﻲ ﻛﻠﺴﻴﻢ ﻧﺎﺷﺘﺎ را ﻗﺒﻞ از ﺷﺮوع درﻣﺎن و ﻳﻚﻣﺎه‬

‫ﺑﻬﺘﺮ از ﻣﺠﻤﻮﻋﻪ ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ و آﻟﻨﺪروﻧﺎت ﺑﻮد‪ .‬ﺑﻌﺪ از ﻳﻚ‬

‫ﭘﺲاز ﻣﺼﺮف روزاﻧﻪ ﻫﻮرﻣﻮن اﻧﺪازهﮔﻴﺮي ﻧﻤﺎﻳﻨﺪ‪ .‬در ﺻﻮرت‬

‫ﺳﺎل ﺗﻔﺎوﺗﻲ در ﻧﺘﺎﻳﺞ ﺑﻪدﺳﺖ آﻣﺪه در ﺑﻴﻤﺎراﻧﻲ ﻛﻪ ﺗﺤﺖ درﻣﺎن ﺑﺎ‬

‫ﻫﻴﭙﺮﻛﻠﺴﻤﻲ ﻣﺪاوم ﻛﺎﻫﺶ ﻣﻴﺰان ﻣﺼﺮف ﻣﻜﻤﻞﻫﺎي ﻛﻠﺴﻴﻢ اوﻟﻴﻦ اﻗﺪام‬

‫ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ‪ ،‬ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ و آﻟﻨﺪروﻧﺎت‪ ،‬و آﻟﻨﺪروﻧﺎت‬ ‫‪28‬‬

‫ﻣﻲﺑﺎﺷﺪ و ﺑﺎ ﺗﺪاوم ﻫﻴﭙﺮﻛﻠﺴﻤﻲ ﻛﺎﻫﺶ دﻓﻌﺎت ﺗﺰرﻳﻖ ﻫﻮرﻣﻮن ﺑﻪ ﻧﺤﻮ‬

‫ﺗﻨﻬﺎ ﺑﻮدﻧﺪ ﮔﺰارش ﻧﮕﺮدﻳﺪ‪ .‬اﻓﺰاﻳﺶ ﻃﻮل درﻣﺎن ﺑﺎ ﻫﻮرﻣﻮن ﭘﺎرا‪-‬‬

‫ﻳﻚ روز درﻣﻴﺎن‪ ،‬ﺗﻮﺻﻴﻪ ﻣﻲﺷﻮد‪ .‬ﻫﺎﻳﭙﺮﻛﻠﺴﻴﻮري واﺿﺢ و ﺗﺸﻜﻴﻞ‬

‫ﺗﻴﺮوﻳﻴﺪ در اﻳﻦ اﻓﺮاد از ‪ 18‬ﺑﻪ ‪ 24‬ﻣﺎه ﻧﻴﺰ ﺑﺎ اﻓﺰاﻳﺶ ﻗﺎﺑﻞ ﻣﻼﺣﻈﻪاي در‬

‫ﺳﻨﮓ ﻛﻠﻴﻪ ﺑﻪﻋﻨﻮان ﻳﻚ ﻣﺸﻜﻞ ﺑﺎﻟﻴﻨﻲ در ﺑﻴﻤﺎراﻧﻲ ﻛﻪ ﺗﺮﻳﭙﺎراﺗﻴﺪ‬

‫ﺗﺮاﻛﻢ اﺳﺘﺨﻮاﻧﻲ ﻫﻤﺮاه ﺑﻮد‪ .‬ﺑﺮﺧﻲ ﻣﻄﺎﻟﻌﺎت دﻳﮕﺮ‪ ،‬ﺑﻬﺒﻮد ﻧﺘﺎﻳﺞ ﺑﻪدﻧﺒﺎل‬

‫درﻳﺎﻓﺖ ﻣﻲﻛﻨﻨﺪ ﺑﻪﺣﺴﺎب ﻧﻤﻲآﻳﺪ‪ .‬ﺑﺎ وﺟﻮد ﮔﺰارشﻫﺎﻳﻲ از اﻓﺰاﻳﺶ‬

‫اﺿﺎﻓﻪ ﻧﻤﻮدن ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ ﺑﻪ ‪ HRT‬را ﮔﺰارش ﻧﻤﻮدهاﻧﺪ‪.‬‬

‫‪53‬‬

‫واﺿﺢ ﺳﻄﻮح اﺳﻴﺪ اورﻳﻚ در ﺑﻴﻤﺎران ﺗﺤﺖ درﻣﺎن ﺑﺎ ﺗﺮﻳﭙﺎراﺗﻴﺪ و‬

‫راﻟﻮﻛﺴﻴﻔﻦ‪ :‬ﻣﻄﺎﻟﻌﺎت اﻧﺠﺎم ﺷﺪه در ﺧﺎﻧﻢﻫﺎي ﻳﺎﺋﺴﻪاي ﻛﻪ ﺑﺮاي‬

‫‪ ،Intact PTH‬ﭘﺎﻳﺶ ﺳﻄﺢ اﺳﻴﺪاورﻳﻚ در ﺑﻴﻤﺎران ﺑﺪون ﺗﺎرﻳﺨﭽﻪاي از‬

‫ﺣﺪاﻗﻞ ‪ 12‬ﻣﺎه ﻗﺒﻞ از ﺷﺮوع ﺗﺮﻳﭙﺎراﺗﻴﺪ راﻟﻮﻛﺴﻴﻔﻦ درﻳﺎﻓﺖ ﻧﻤﻮده‬

‫ﺑﻴﻤﺎري ﻧﻘﺮس ﻛﺎرﺑﺮدي ﻧﺪارد‪ .‬اﻓﺖ ﻓﺸﺎر ﺧﻮن و ﺗﺎﻛﻲﻛﺎردي ﻧﻴﺰ‬

‫ﺑﻮدﻧﺪ‪ ،‬ﻧﺸﺎن داد ﻛﻪ اﺳﺘﻔﺎده ﻗﺒﻠﻲ ﻳﺎ ﻫﻤﺰﻣﺎن راﻟﻮﻛﺴﻴﻔﻦ ﺗﺎﺛﻴﺮي در ﻛﻢ‬

‫‪27‬و‪25‬و‪23‬‬

‫ﺑﻪدﻧﺒﺎل ﻣﺼﺮف اوﻟﻴﻦ دوزﻫﺎي دارو دور از اﻧﺘﻈﺎر ﻧﻴﺴﺖ‪.‬‬

‫دﻓﻌﺎت ﺳﻨﺠﺶ ﺗﺮاﻛﻢ اﺳﺘﺨﻮاﻧﻲ در اﻳﻦ ﺑﻴﻤﺎران ﺑﺎ ﺳﺎﻳﺮ ﺑﻴﻤﺎران‬

‫ﻛﺮدن اﺛﺮات آﻧﺎﺑﻮﻟﻴﻚ ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ ﻧﺪاﺷﺘﻪ و ﺣﺘﻲ ﺳﻄﺢ‬ ‫‪95‬و‪94‬‬

‫ﺷﺎﺧﺺﻫﺎي زﻳﺴﺖ ﺷﻨﺎﺧﺘﻲ را اﻓﺰاﻳﺶ ﻣﻲدﻫﺪ‪.‬‬

‫اﺳﺘﺌﻮﭘﺮوزي ﺗﻔﺎوﺗﻲ ﻧﺪارد؛ ﻛﺎﻫﺶ ﻣﺸﺨﺼﻲ در ﺗﺮاﻛﻢ اﺳﺘﺨﻮاﻧﻲ‬

‫ﺑﻴﺲ ﻓﺴﻔﻮﻧﺎتﻫﺎ‪ :‬ﺑﺮﺧﻲ ﻣﻄﺎﻟﻌﺎت ﻧﺸﺎن دادهاﻧﺪ ﻛﻪ ﺑﻴﺲ ﻓﺴﻔﻮﻧﺎتﻫﺎ‬

‫ﺑﺎﻓﺖﻫﺎي ﻛﻮرﺗﻴﻜﺎل )دﻳﺴﺘﺎل رادﻳﻮس( در ﺳﺎل اول درﻣﺎن دور از‬

‫ﺑﻪﺧﺼﻮص آﻟﻨﺪروﻧﺎت اﺛﺮﺑﺨﺸﻲ ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ را ﻛﺎﻫﺶ داده و‬ ‫‪96-98‬‬

‫ﺑﺮﺧﻲ دﻳﮕﺮ از ﻣﻄﺎﻟﻌﺎت ﻧﺸﺎن‪-‬‬

‫اﻧﺘﻈﺎر ﻧﻴﺴﺖ؛ ﻟﻜﻦ اﻳﻦ ﺣﺎﻟﺖ ﺑﺎ اﻓﺰاﻳﺶ رﻳﺴﻚ ﺷﻜﺴﺘﮕﻲ اﻳﻦ‬

‫ﺷﺮوع اﺛﺮ آنرا ﺑﻪ ﺗﺎﺧﻴﺮ ﻣﻲاﻧﺪازد‪.‬‬

‫اﺳﺘﺨﻮان ﻫﻤﺮاه ﻧﻤﻲﺑﺎﺷﺪ‪ 11.‬اﻓﺰاﻳﺶ ﺷﺎﺧﺺﻫﺎي ﺑﻴﻮﺷﻴﻤﻴﺎﻳﻲ واﮔﺮدش‬

‫دﻫﻨﺪه ﻧﺘﺎﻳﺞ ﺑﻬﺘﺮ در ﺧﺎﻧﻢﻫﺎي ﻳﺎﺋﺴﻪاي ﺑﻮد ﻛﻪ ﺣﺪاﻗﻞ ﺑﻪﻣﺪت ﻳﻚﺳﺎل‬

‫اﺳﺘﺨﻮاﻧﻲ در ‪ 1-3‬ﻣﺎه اول درﻣﺎن ﻫﻤﻮاره ﮔﺰارش ﻣﻲﺷﻮد‪.‬‬

‫‪100‬و‪99‬‬

‫‪25‬‬

‫ﻗﺒﻞاز ﺷﺮوع ﭘﺎراﺗﻮرﻣﻮن ﺑﺎ آﻟﻨﺪروﻧﺎت ﺗﺤﺖ درﻣﺎن ﺑﻮدﻧﺪ‪.‬‬ ‫داروﻫﺎي‬

‫)‪ :b-Fibroblastic Growth Factor (bFGF‬درﻣﺎن ﻫﻤﺰﻣﺎن ‪ bFGF‬و‬

‫‪ :Antiresorptive‬ﻛﺎرآزﻣﺎﻳﻲﻫﺎي ﺑﺎﻟﻴﻨﻲ ﻣﺘﻌﺪدي ﺑﺮاي ﻳﺎﻓﺘﻦ راﻫﻜﺎر‪-‬‬

‫ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ ﻧﻴﺰ ﺑﺎ ﺑﻬﺒﻮد ﻗﺪرت اﺳﺘﺨﻮاﻧﻲ در ﻣﻘﺎﻳﺴﻪ ﺑﺎ‬

‫ﻣﺼﺮف‬

‫ﻫﻤﺰﻣﺎن‬

‫ﻫﻮرﻣﻮن‬

‫ﭘﺎراﺗﻴﺮوﻳﻴﺪ‬

‫و‬

‫ﺳﺎﻳﺮ‬

‫ﻫﺎي ﺗﺎزهاي در ﺟﻬﺖ اﻓﺰودن اﺛﺮات درﻣﺎنﻫﺎي ﻣﻮﺟﻮد ﺿﺪ ﭘﻮﻛﻲ‬

‫ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ ﺑﻪﺗﻨﻬﺎﻳﻲ ﻫﻤﺮاه ﻣﻲﺑﺎﺷﺪ‪.‬‬

‫‪101‬‬

‫اﺳﺘﺨﻮان ﺗﺪوﻳﻦ ﮔﺮدﻳﺪه اﺳﺖ‪ .‬اﻛﺜﺮ اﻳﻦ ﭘﮋوﻫﺶﻫﺎ اﺛﺮات ﺗﺮﻛﻴﺒﺎت‬

‫درﻣﺎن ﺑﺎ داروﻫﺎي ﺿﺪ ﺟﺬب اﺳﺘﺨﻮان‪ :‬ﺑﻪدﻧﺒﺎل اﺳﺘﻔﺎده از ﻫﻮرﻣﻮن‬

‫ﻣﺨﺘﻠﻒ داروﻫﺎي آﻧﺎﺑﻮﻟﻴﻚ و ﺿﺪ ﺟﺬب اﺳﺘﺨﻮان را در اﻓﺰاﻳﺶ ﺗﺮاﻛﻢ‬

‫ﭘﺎراﺗﻴﺮوﻳﻴﺪ ﺑﺎ اﻳﻦﻛﻪ اﺛﺮات ﺿﺪ ﺷﻜﺴﺘﮕﻲ ﻫﻮرﻣﻮن ﭘﺎراﺗﻴﺮوﻳﻴﺪ ﺑﺮاي‬

‫اﺳﺘﺨﻮان و ﻛﺎﻫﺶ ﺧﻄﺮ ﺷﻜﺴﺘﮕﻲ آزﻣﻮدهاﻧﺪ؛ ﻟﻜﻦ ﻧﺘﺎﻳﺞ ﻳﻚدﺳﺘﻲ از‬

‫ﻣﺪتﻫﺎ ﺑﻌﺪ از ﻗﻄﻊ درﻣﺎن ﺑﺎﻗﻲ ﻣﻲﻣﺎﻧﺪ وﻟﻲ ﺗﺮاﻛﻢ اﺳﺘﺨﻮاﻧﻲ ﺑﻌﺪ از‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬


‫ﭘﻮﻛﻲ اﺳﺘﺨﻮان‬ ‫ﻧﻮﺗﺮﻛﻴﺐ و‬ ‫ﭘﺎراﺗﻮرﻣﻮن‬ Larijani B. et al.

503

‫ د ﺷﺪﻳﺪ‬-‫ د در اﻓﺮاد ﻣﺒﺘﻼ ﺑﻪ ﻛﻤﺒﻮد وﻳﺘﺎﻣﻴﻦ‬-‫ﻫﺮﭼﻨﺪ ﻛﻪ ﺳﻄﺢ وﻳﺘﺎﻣﻴﻦ‬ 107

،‫ﻟﺬا در ﺑﻌﻀﻲ از ﻣﻄﺎﻟﻌﺎت‬

54‫و‬99‫و‬102

.‫ﻣﺪﺗﻲ ﺷﺮوع ﺑﻪ ﻛﺎﻫﺶ ﻣﻲﻛﻨﺪ‬

.‫ﻗﺒﻞ از ﺷﺮوع درﻣﺎن اﺳﺘﺌﻮﭘﺮوز ﺑﺎﻳﺪ اﺻﻼح ﺷﺪه ﺑﺎﺷﺪ‬

‫ﺗﺠﻮﻳﺰ داروﻫﺎي ﺿﺪ ﺟﺬب اﺳﺘﺨﻮان را ﺑﻪدﻧﺒﺎل ﻣﺼﺮف ﭘﺎراﺗﻮرﻣﻮن‬

‫ﻧﻤﻮدن ﺳﻄﺢ آﻟﻜﺎﻟﻦ ﻓﺴﻔﺎﺗﺎز ﻗﺒﻞ از ﺷﺮوع درﻣﺎن اﺳﺘﺌﻮﭘﺮوز در‬

‫ ﺑﺮﺧﻲ ﻣﻄﺎﻟﻌﺎت ﻧﻴﺰ ﺑﻴﺎن ﻧﻤﻮدهاﻧﺪ‬.‫ﺑﺮاي ﺣﻔﻆ اﺛﺮاتآن ﺗﻮﺻﻴﻪ ﻧﻤﻮدهاﻧﺪ‬

.‫ﻣﻄﺎﻟﻌﺎت زﻳﺎدي ﺗﻮﺻﻴﻪ ﺷﺪه اﺳﺖ‬

‫ رزﻳﺪروﻧﺎت و اﺳﺘﺮوژن‬،‫ ﻛﻠﻮدروﻧﺎت‬،‫ﻛﻪ درﻣﺎن ﻗﺒﻠﻲ ﺑﺎ ﻛﻠﺴﻲ ﺗﻮﻧﻴﻦ‬

‫ﻃﺒﻴﻌﻲ‬

103-105

‫ ﻣﻄﺎﻟﻌﺎت ﻣﺘﻌﺪدي ﻧﺸﺎن دادهاﻧﺪ ﻛﻪ اﺳﺘﻔﺎده‬:‫ﺗﻮﺻﻴﻪﻫﺎ ﺑﻌﺪ از ﻗﻄﻊ دارو‬

.‫ﻣﻴﺰان ﭘﺎﺳﺦ ﺑﻪ درﻣﺎن ﺑﻪ ﭘﺎراﺗﻮرﻣﻮن را ﻛﺎﻫﺶ ﻧﻤﻲدﻫﺪ‬ :‫اﺳﺘﻔﺎده از دارو در ﺷﺮاﻳﻂ ﺧﺎص‬

‫از آﻟﻨﺪروﻧﺎت ﺑﻪدﻧﺒﺎل ﻗﻄﻊ ﭘﺎراﺗﻮرﻣﻮن ﺑﺎ اﻓﺰاﻳﺶ ﻗﺎﺑﻞ ﻣﻼﺣﻈﻪ در ﺗﻮده‬ ‫اﺳﺘﺨﻮاﻧﻲ و ﺳﻄﺢ ﻛﻠﺴﻴﻢ ﻫﻤﺮاه اﺳﺖ؛ در اﻳﻦ ﺑﻴﻤﺎران اﻓﺖ ﺗﺮاﻛﻢ‬

‫ در ﺣﺎﻟﻲﻛﻪ ﻣﺪتﻫﺎ ﺗﺼﻮر ﺑﺮ آن ﺑﻮد ﻛﻪ ﻛﻤﺒﻮد‬:‫ د‬-‫ﻛﻤﺒﻮد وﻳﺘﺎﻣﻴﻦ‬

‫اﺳﺘﺨﻮاﻧﻲ ﮔﺰارش ﮔﺮدﻳﺪه وﻟﻲ ﺳﻄﺢ ﺗﺮاﻛﻢ اﺳﺘﺨﻮاﻧﻲ ﺑﺎﻻﺗﺮ از اﻓﺮادي‬

‫ ﻣﻄﺎﻟﻌﺎت‬،‫ د ﭘﺎﺳﺦ ﺑﻪ درﻣﺎنﻫﺎي اﺳﺘﺌﻮﭘﺮوز را ﻣﺨﺘﻞ ﻣﻲﻧﻤﺎﻳﺪ‬-‫وﻳﺘﺎﻣﻴﻦ‬

17‫و‬91‫و‬108

‫ﻫﻤﭽﻨﻴﻦ درﻣﺎن ﻣﺠﺪد‬

.‫ﺑﻮد ﻛﻪ آﻟﻨﺪروﻧﺎت درﻳﺎﻓﺖ ﻧﻨﻤﻮدهاﻧﺪ‬

‫ﻣﺘﻌﺪدي ﻧﺸﺎن دادهاﻧﺪ ﻛﻪ اﺛﺮ ﺗﺮﻳﭙﺎراﺗﻴﺪ در اﻓﺰاﻳﺶ ﺗﺮاﻛﻢ اﺳﺘﺨﻮاﻧﻲ در‬

‫ﺑﻴﻤﺎر ﺑﺎ ﺗﺮﻳﭙﺎراﺗﻴﺪ ﺑﻪﺻﻮرت روزاﻧﻪ ﺑﻌﺪ از ﻳﻚ دوره ﻳﻚﺳﺎﻟﻪ ﻗﻄﻊ‬

‫ د ﻣﺼﺮف‬-‫زﻧﺎن ﻳﺎﺋﺴﻪ ﺗﺎ وﻗﺘﻲ ﻛﻪ آنﻫﺎ ﻣﻜﻤﻞﻫﺎي ﻛﻠﺴﻴﻢ و وﻳﺘﺎﻣﻴﻦ‬

109‫و‬110

.‫دارو ﺑﺎ ﻧﺘﺎﻳﺞ ﺑﻬﺘﺮ ﺗﺮاﻛﻢ اﺳﺘﺨﻮاﻧﻲ ﻫﻤﺮاه اﺳﺖ‬

47‫و‬106

.‫ د در اﻳﻦ اﻓﺮاد ﺑﺴﺘﮕﻲ ﻧﺪارد‬-‫ ﺑﻪ ﺳﻄﻮح ﭘﺎﻳﻪ وﻳﺘﺎﻣﻴﻦ‬،‫ﻣﻲﻧﻤﺎﻳﻨﺪ‬

References 1. Keramat A, Patwardhan B, Larijani B, Chopra A, Mithal A, Chakravarty D, et al. The assessment of osteoporosis risk factors in Iranian women compared with Indian women. BMC Musculoskelet Disord 2008;27(9):28. 2. Moayyeri A, Soltani A, Larijani B, Naghavi M, Alaeddini F, Abolhassani F. Epidemiology of hip fracture in Iran: results from the Iranian Multicenter Study on Accidental Injuries. Osteoporos Int 2006;17(8):1252-7. 3. Cummings SR, Nevitt MC, Browner WS, Stone K, Fox KM, Ensrud KE, et al. Risk factors for hip fracture in white women. Study of Osteoporotic Fractures Research Group. N Engl J Med 1995;332(12):767-73. 4. Larijani B, Soltani A, Pajouhi M. Changes in BMD values of Tehrani individuals aged between 20 and 60 years. Teb-e-Jonoob 2005;1:41-9. [Persian] 5. Abolhassani F, Mohammadi M, Soltani A. The burden of osteoporosis in Iran 2002. Barvari Nabarvari 2005;6(1):25-37. 6. Ray NF, Chan K, Thamer M. Medical expenditure for treatment of osteoporosis fracture in USA in 1995. J Bone Miner Res 1997;12:24-35. 7. Cranney A, Guyatt G, Griffith L, Wells G, Tugwell P, Rosen C. Meta-analysis of therapies for postmenopausal osteoporosis. IX. Summary of meta-analyses of therapies for postmenopausal osteoporosis. Endocr Rev 2002;23(4):570-8. 8. Ringe JD, Orwoll ES, Daifotis A, Lombardi A. Treatment of male osteoporosis: recent advances with alendronate. Osteoporos Int 2002;13(3):195-9. 9. Trivedi DP, Doll R, Khaw KT. Effect of four monthly oral vitamin D3 (cholecalciferol) supplementation on fractures and mortality in men and women living in the community: randomised double blind controlled trial. BMJ 2003;326(7387):469. 10. Haguenauer D, Welch V, Shea B, Tugwell P, Adachi JD, Wells G. Fluoride for the treatment of postmenopausal osteoporotic fractures: a meta-analysis. Osteoporos Int 2000;11(9):727-38. 11. Neer R, Arnaud C, Zanchetta J, Prince R, Gaich G, Reginster J, et al. Effect of parathyroid hormone (1-34) on fractures and bone mineral density in postmenopausal women with osteoporosis. N Engl J Med 2001;344(19):1434-41. 12. Orwoll E, Scheele W, Paul S, Adami S, Syversen U, Diez-Perez A, et al. The effect of teriparatide [human parathyroid hormone (134)] therapy on bone density in men with osteoporosis. J Bone Miner Res 2003;18:9-17.

1389 ‫ آذر‬،9 ‫ ﺷﻤﺎره‬، 68 ‫ دوره‬،‫ داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‬،‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‬

13. Greenspan SL, Bone HG, Marriott TB, Zanchetta JR, Ettinger MP, Hanley DA, et al. Preventing the first vertebral fracture in postmenopausal women with low bone mass using PTH(1-84): results from the TOP study (Abstract). J Bone Miner Res 2005;20(S56). 14. Greenspan SL, Bone HG, Ettinger MP, Hanley DA, Lindsay R, Zanchetta JR, et al. Effect of recombinant human parathyroid hormone (1-84) on vertebral fracture and bone mineral density in postmenopausal women with osteoporosis: a randomized trial. Ann Intern Med 2007;146(5):326-39. 15. Alkhiary YM, Gerstenfeld LC, Krall E, Westmore M, Sato M, Mitlak BH, et al. Enhancement of experimental fracture-healing by systemic administration of recombinant human parathyroid hormone (PTH 1-34). J Bone Joint Surg Am 2005;87(4):731-41. 16. Komatsubara S, Mori S, Mashiba T, Nonaka K, Seki A, Akiyama T, et al. Human parathyroid hormone (1-34) accelerates the fracture healing process of woven to lamellar bone replacement and new cortical shell formation in rat femora. Bone 2005;36(4):678-87. 17. Rittmaster R, Bolognese M, Ettinger M, Hanley D, Hodsman A, Kendler D, et al. Enhancement of bone mass in osteoporotic women with parathyroid hormone followed by alendronate. J Clin Endocrinol Metab 2000;85(6):2129-34. 18. Hodsman A, Hanley D, Ettinger M, Bolognese M, Fox J, Metcalfe A, et al. Efficacy and safety of human parathyroid hormone-(1-84) in increasing bone mineral density in postmenopausal osteoporosis. J Clin Endocrinol Metab 2003;88(11):5212-20. 19. Selye H. On the stimulation of new bone formation with parathyroid extract and irradiated ergosterol. Endocrinology 1932;16:547-58. 20. Potts JT. Parathyroid hormone: past and present. J Endocrinol 2005;187(3):311-25. 21. Dempster DW, Cosman F, Kurland ES, Zhou H, Nieves J, Woelfert L, et al. Effects of daily treatment with parathyroid hormone on bone microarchitecture and turnover in patients with osteoporosis: a paired biopsy study. J Bone Miner Res 2001;16(10):1846-53. 22. Bauer DC, Garnero P, Bilezikian JP, Greenspan SL, Ensrud KE, Rosen CJ, et al. Short-term changes in bone turnover markers and bone mineral density response to parathyroid hormone in postmenopausal women with osteoporosis. J Clin Endocrinol Metab 2006;91(4):1370-5.


Recombinant andNo. osteoporosis Tehran University Medical parathormone Journal; Vol.‫ و‬68, 9, Dec 2010: 66-71 ‫ﻫﻤﻜﺎران‬

23. Moen MD, Scott LJ. Recombinant full-length parathyroid hormone (1-84). Drugs 2006;66(18):2371-81; discussion 2382-5. 24. Armamento-Villareal R, Ziambaras K, Abbasi-Jarhomi SH, Dimarogonas A, Halstead L, Fausto A, et al. An intact N terminus is required for the anabolic action of parathyroid hormone on adult female rats. J Bone Miner Res 1997;12(3):384-92. 25. Hodsman AB, Bauer DC, Dempster DW, Dian L, Hanley DA, Harris ST, et al. Parathyroid hormone and teriparatide for the treatment of osteoporosis: a review of the evidence and suggested guidelines for its use. Endocr Rev 2005;26(5):688-703. 26. de Paula FJ, Rosen CJ. Back to the future: revisiting parathyroid hormone and calcitonin control of bone remodeling. Horm Metab Res 2010;42(5):299-306. 27. Black DM, Bouxsein ML, Palermo L, McGowan JA, Newitt DC, Rosen E, et al. Randomized trial of once-weekly parathyroid hormone (1-84) on bone mineral density and remodeling. J Clin Endocrinol Metab 2008;93(6):2166-72. 28. Black DM, Greenspan SL, Ensrud KE, Palermo L, McGowan JA, Lang TF, et al. The effects of parathyroid hormone and alendronate alone or in combination in postmenopausal osteoporosis. N Engl J Med 2003;349(13):1207-15. 29. Finkelstein JS, Hayes A, Hunzelman JL, Wyland JJ, Lee H, Neer RM. The effects of parathyroid hormone, alendronate, or both in men with osteoporosis. N Engl J Med 2003;349(13):1216-26. 30. Dobnig H, Sipos A, Jiang Y, Fahrleitner-Pammer A, Ste-Marie LG, Gallagher JC, et al. Early changes in biochemical markers of bone formation correlatewith improvements in bone structure during teriparatide therapy. J Clin Endocrinol Metab 2005 Jul;90(7):39707 31. Boivin GY, Chavassieux PM, Santora AC, Yates J, Meunier PJ. Alendronate increases bone strength by increasing the mean degree of mineralization of bone tissue in osteoporotic women. Bone 2000;27(5):687-94. 32. Roschger P, Rinnerthaler S, Yates J, Rodan GA, Fratzl P, Klaushofer K. Alendronate increases degree and uniformity of mineralization in cancellous bone and decreases the porosity in cortical bone of osteoporotic women. Bone 2001;29(2):185-91. 33. Hernandez C, Beaupre GS, Marcus R, Carter DR. A theoretical analysis of the contributions of remodelling space, mineralization, and bone balance to changes in bone mineral density during alendronate treatment. Bone 2001;29(6):511-6. 34. Bradbeer JN, Arlot ME, Meunier PJ, Reeve J. Treatment of osteoporosis with parathyroid peptide (hPTH 1-34) and oestrogen: increase in volumetric density of iliac cancellous bone may depend on reduced trabecular spacing as well as increased thickness of packets of newly formed bone. Clin Endocrinol (Oxf) 1992;37(3):282-9.. 35. Hodsman AB, Kisiel M, Adachi JD, Fraher LJ, Watson PH. Histomorphometric evidence for increased bone turnover and cortical thickness without increased cortical porosity after 2 years of cyclical hPTH (1-34) therapy in women with severe osteoporosis. Bone 2000;27(2):311-8. 36. Jiang Y, Zhao JJ, Mitlak BH, Wang O, Genant HK, Eriksen EF. Recombinant human parathyroid hormone (1-34) [teriparatide] improves both cortical and cancellous bone structure. J Bone Miner Res 2003;18(11):1932-41. 37. Dufresne TE, Chmielewski PA, Manhart MD, Johnson TD, Borah B. Risedronate preserves bone architecture in early postmenopausal women in 1 year as measured by three-dimensional microcomputed tomography. Calcif Tissue Int 2003;73(5):423-32 38. Kurland E, Cosman F, McMahon D, Rosen C, Lindsay R, Bilezikian J. Parathyroid hormone as a therapy for idiopathic osteoporosis in men: effects on bone mineral density and bone markers. J Clin Endocrinol Metab 2000;85(9):3069-76. 39. Body JJ, Gaich GA, Scheele WH, Kulkarni PM, Miller PD, Peretz A, et al. A randomized double-blind trial to compare the efficacy of teriparatide [recombinant human parathyroid hormone (1-34)] with alendronate in postmenopausal women with osteoporosis. J Clin Endocrinol Metab 2002;87(10):4528-35.

102

504

40. Duan Y, Seeman E, Turner CH. The biomechanical basis of vertebral body fragility in men and women. J Bone Miner Res 2001;16(12):2276-83. 41. Duan Y, Turner CH, Kim BT, Seeman E. Sexual dimorphism in vertebral fragility is more the result of gender differences in agerelated bone gain than bone loss. J Bone Miner Res 2001;16(12):2267-75. 42. Hodsman AB, Fraher LJ, Ostbye T, Adachi JD, Steer BM. An evaluation of several biochemical markers for bone formation and resorption in a protocol utilizing cyclical parathyroid hormone and calcitonin therapy for osteoporosis. J Clin Invest 1993;91(3):113848. 43. Finkelstein JS, Klibanski A, Arnold AL, Toth TL, Hornstein MD, Neer RM. Prevention of estrogen deficiency-related bone loss with human parathyroid hormone (1-34): a randomized controlled trial. JAMA 1998;280(12):1067-73. 44. Chen PL, Satterwhite J, Licata A, Lewiecki M, Sipos A, Misurski D, et al. Early changes in biochemical markers of bone formation predict BMD response to teriparatide in postmenopausal women with osteoporosis. J Bone Miner Res 2005;20(6):962-70. 45. Thomas T. Intermittent parathyroid hormone therapy to increase bone formation. Joint Bone Spine 2006;73(3):262-9. 46. Han B, Copeland M, Geiser AG, Hale LV, Harvey A, Ma YL, et al. Development of a Highly Sensitive, High-Throughput, Mass Spectrometry-Based Assay for Rat Procollagen Type-I N-Terminal Propeptide (PINP) To Measure Bone Formation Activity. J Proteome Res 2007;6(11):4218-29. 47. Dawson-Hughes B, Chen P, Krege J. Response to teriparatide in patients with baseline 25-hydroxyvitamin D insufficiency or sufficiency. J Clin Endocrinol Metab 2007;92(12):4630-6. 48. Hodsman AB, Steer BM. Early histomorphometric changes in response to parathyroid hormone therapy in osteoporosis: evidence for de novo bone formation on quiescent cancellous surfaces. Bone 1993;14(3):523-7. 49. Cosman F, Nieves J, Woelfert L, Formica C, Gordon S, Shen V, et al. Parathyroid hormone added to established hormone therapy: effects on vertebral fracture and maintenance of bone mass after parathyroid hormone withdrawal. J Bone Miner Res 2001;16(5):925-31. 50. Marcus R, Wang O, Sattershite J, Mitlak B. The skeletal response to teriparatide is largely independent of age, initial bone mineral density, and prevalent vertebral fractures in postmenopausal women with osteoporosis. J Bone Miner Res 2003;18(1):18-23. 51. Lindsay R, Nieves J, Formica C, Henneman E, Woelfert L, Shen V, et al. Randomised controlled study of effect of parathyroid hormone on vertebral-bone mass and fracture incidence among postmenopausal women on oestrogen with osteoporosis. Lancet 1997;350(9077):550-5. 52. Lindsay R, Scheele WH, Clancy AD, Hossain A, Mitlak B. Reduction in non-vertebral fragility fractures and increase in spinal bone density is maintained 31 months after discontinuation of recombinant human parathyroid hormone (1-34) in postmenopausal women with osteoporosis (abstract). Endocrine Society, 2002. 53. Fogelman I, Fordham JN, Fraser WD, Spector TD, Christiansen C, Morris SA, et al. Parathyroid hormone(1-84) treatment of postmenopausal women with low bone mass receiving hormone replacement therapy. Calcif Tissue Int 2008;83(2):85-92. 54. Horwitz MJ, Tedesco MB, Gundberg C, Garcia-Ocana A, Stewart AF. Short-Term, High-Dose Parathyroid Hormone-Related Protein as a Skeletal Anabolic Agent for the Treatment of Postmenopausal Osteoporosis. J Clin Endocrinol Metab 2003;88(2):569-75. 55. Finkelstein JS, Klibanski A, Schaefer EH, Hornstein MK, Schiff I, Neer RM. Parathyroid hormone for the prevention of bone loss induced by estrogen deficiency. N Engl J Med 1994;331(24):161823. 56. Sato M, Vahle J, Schmidt A, Westmore M, Smith S, Rowley E, et al. Abnormal bone architecture and biomechanical properties with

1389 ‫ آذر‬،9 ‫ ﺷﻤﺎره‬، 68 ‫ دوره‬،‫ داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‬،‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‬


505

Larijani Vol. B. et68, al. No. 9, Dec 2010: 497-507 Tehran University Medical Journal;

near-lifetime treatment of rats with PTH. Endocrinology 2002;143(9):3230-42. 57. Leder BZ, Neer RM, Wyland JJ, Lee HW, Burnett-Bowie SM, Finkelstein JS. Effects of teriparatide treatment and discontinuation in postmenopausal women and eugonadal men with osteoporosis. J Clin Endocrinol Metab 2009;94(8):2915-21. 58. Rosen CJ, Ackert-Bicknell CL, Adamo ML, Shultz KL, Rubin J, Donahue LR, et al. Congenic mice with low serum IGF-I have increased body fat, reduced bone mineral density, and an altered osteoblast differentiation program. Bone 2004;35(5):1046-58. 59. Whitfield JF, Morley P, Ross V, Isaacs RJ, Rixon RH. Restoration of severely depleted femoral trabecular bone in ovariectomized rats by parathyroid hormone-(1-34). Calcif Tissue Int 1995;56(3):22731. 60. Whitfield JF, Morley P, Willick GE, Ross V, MacLean S, Barbier JR, et al. Comparison of the ability of recombinant human parathyroid hormone, rhPTH-(1-84), and hPTH-(1-31)NH2 to stimulate femoral trabecular bone growth in ovariectomized rats. Calcif Tissue Int 1997;60(1):26-9. 61. Sosa Henriquez M, Diez Perez A. Parathyroid hormone in the treatment of osteoporosis. Ann Intern Med 2007;24(2):87-97. 62. Nevitt MC, Chen P, Dore RK, Reginster JY, Kiel DP, Zanchetta JR, et al. Reduced risk of back pain following teriparatide treatment: a meta-analysis. Osteoporos Int 2006;17(2):273-80. 63. Cosman F, Lane NE, Bolognese MA, Zanchetta JR, GarciaHernandez PA, Sees K, et al. Effect of Transdermal Teriparatide Administration on Bone Mineral Density in Postmenopausal Women. J Clin Endocrinol Metab 2010;95(1):151-8. 64. Brixen KT, Christensen PM, Ejersted C, Langdahl BL. Teriparatide (biosynthetic human parathyroid hormone 1-34): a new paradigm in the treatment of osteoporosis. Basic Clin Pharmacol Toxicol 2004;94(6):260-70. 65. Fraher LJ, Klein K, Marier KR, Freeman D, Hendy GN, Goltzman D, et al. Comparison of the pharmacokinetics of parenteral parathyroid hormone-(1-34) [PTH-(1-34)] and PTH-related peptide-(1-34) in healthy young humans. J Clin Endocrinol Metab 1995;80(1):60-4. 66. Horwitz MJ, Tedesco MB, Sereika SM, Garcia-Ocana A, Bisello A, Hollis BW, et al. Safety and tolerability of subcutaneous PTHrP(1–36) in healthy human volunteers: a dose escalation study. Osteoporos Int 2006;17(2):225-30. 67. Lindsay R, Nieves J, Henneman E, Shen V, Cosman F. Subcutaneous administration of the amino-terminal fragment of human parathyroid hormone-(1-34): kinetics and biochemical response in estrogenized osteoporotic patients. J Clin Endocrinol Metab 1993;77(6):1535-9. 68. Rosen CJ, Bilezikian JP. Anabolic therapy for osteoporosis. J Clin Endocrinol Metab 2001;86(3):957-64. 69. Dempster DW, Cosman F, Parisien M, Shen V, Lindsay R. Anabolic actions of parathyroid hormone on bone. Endocr Rev 1993;14(6):690-709. 70. Strewler GJ. The physiology of parathyroid hormone-related protein. N Engl J Med 2000;342(3):177-85. 71. Stewart AF, Cain RL, Burr DB, Turner CH, Hock JM. Six month daily administration of PTH and PTHrP peptides to adult ovariectomized rats markedly enhances bone mass and biomechanics: a comparison of human PTH(1-34), PTHrP(1-36) and SDZ-PTH-893. J Bone Miner Res 2000;15:1517-25. 72. Plotkin H, Gundberg C, Mitnick M, Stewart AF. Dissociation of bone formation from resorption during 2-week treatment with human parathyroid hormone-related peptide-(1-36) in humans: potential as an anabolic therapy for osteoporosis. J Clin Endocrinol Metab 1998;83(8):2786-91. 73. Henry JG, Mitnick MA, Dann PR, Stewart AF. Parathyroid hormone-related protein(1-36) is biologically active when administered subcutaneously to humans. J Clin Endocrinol Metab 1997;82:900-6.

1389 ‫ آذر‬،9 ‫ ﺷﻤﺎره‬، 68 ‫ دوره‬،‫ داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‬،‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‬

74. Winer KK, Ko CW, Reynolds JC, Dowdy K, Keil M, Peterson D, et al. Long-term treatment of hypoparathyroidism: a randomized controlled study comparing parathyroid hormone-(1-34) versus calcitriol and calcium. J Clin Endocrinol Metab 2003;88(9):421420. 75. Hodsman AB, Papaioannou A, Ann C, Writing Group on the Systematic Review of Parathyroid Hormone for the Treatment of Osteoporosis. Clinical practice guidelines for the use of parathyroid hormone in the treatment of osteoporosis. CMAJ 2006;175(1):48. 76. McClung MR, Geusens P, Miller PD, Zippel H, Bensen WG, Roux C, et al. Effect of risedronate on hip fracture risk in elderly women. N Engl J Med 2001;344:333-40. 77. American College of Rheumatology Ad Hoc Committee on Glucocorticoid-Induced Osteoporosis. Recommendations for the prevention and treatment of glucocorticoid-induced osteoporosis: 2001 update. Arthritis Rheum 2001;44:1496. 78. Vahle JL, Sato M, Long GG, Young JK, Francis PC, Engelhardt JA, et al. Skeletal changes in rats given daily subcutaneous injections of recombinant human parathyroid hormone (1-34) for two years and relevance to human safety. Toxicol Pathol 2002;30:312-21. 79. Betancourt M, Wirfel KL, Raymond AK, Yasko AW, Lee J, Vassilopoulou-Sellin R. Osteosarcoma of bone in a patient with primary hyperparathyroidism: a case report. J Bone Miner Res 2003;18:163-6. 80. Kakaria PJ, Nashel DJ, Nylen ES. Debilitating muscle cramps after teriparatide therapy. Ann Intern Med 2005;142:310. 81. Benson CT, Voelker JR. Teriparatide has no effect on the calciummediated pharmacodynamics of digoxin. Clin Pharmacol Ther 2003;73:87-94. 82. Genant HK, Halse J, Briney WG, Xie L, Glass EV, Krege JH. The effects of teriparatide on the incidence of back pain in postmenopausal women with osteoporosis. Curr Med Res Opin 2005;21:1027-34. 83. Forteo approved for osteoporosis treatment. FDA Consum 2003;37:4. 84. Wada S, Fukawa T, Kamiya S. Parathyroid and bone. Evidence and perspective of parathyroid therapy for patients with osteoporosis. Clin Calcium 2007;17(12):1888-94. 85. Rubin MR, Bilezikian JP. The potential of parathyroid hormone as a therapy for osteoporosis. Int J Fertil Womens Med 2002;47(3):103-15. 86. Kroll MH. Parathyroid hormone temporal effects on bone formation and resorption. Bull Math Biol 2000;62(1):163-88. 87. Compston JE. Skeletal actions of intermittent parathyroid hormone: Effects on bone remodelling and structure. Bone 2007;40(6):144752. 88. Liu H, Michaud K, Nayak S, Karpf DB, Owens DK, Garber AM. The cost-effectiveness of therapy with teriparatide and alendronate in women with severe osteoporosis. Arch Intern Med 2006;166:1209-17. 89. Cosman F, Wermers RA, Recknor C, Mauck KF, Xie L, Glass EV, et al. Effects of teriparatide in postmenopausal women with osteoporosis on prior alendronate or raloxifene: differences between stopping and continuing the antiresorptive agent. J Clin Endocrinol Metab 2009;94(10):3772-80. 90. Black DM, Bilezikian JP, Ensrud KE, Greenspan SL, Palermo L, Hue T, et al. One year of alendronate after one year of parathyroid hormone (1-84) for osteoporosis. N Engl J Med 2005;353(6):55565. 91. Vestergaard P, Jorgensen NR, Mosekilde L, Schwarz P. Effects of parathyroid hormone alone or in combination with antiresorptive therapy on bone mineral density and fracture risk: a meta-analysis. Osteoporos Int 2007;18(1):45-57. 92. Cheng Z, Yao W, Zimmermann EA, Busse C, Ritchie RO, Lane NE. Prolonged Treatments with Anti-Resorptive Agents and PTH Have Different Effects on Bone Strength and the Degree of


Tehran University Medical Journal; Vol.‫ و‬68,and No.osteoporosis 9, Dec 2010: 66-71 Recombinant parathormone ‫ﻫﻤﻜﺎران‬

Mineralization in Old Estrogen Deficient Osteoporotic Rats. J Bone Miner Res 2009:1-43. 93. Pierroz DD, Bouxsein ML, Rizzoli R, Ferrari SL. Combined treatment with a â-blocker and intermittent PTH improves bone mass and microarchitecture in ovariectomized mice. Bone 2006;39(2):260-7. 94. Deal C, Omizo M, Schwartz EN, Eriksen EF, Cantor P, Wang J, et al. Combination teriparatide and raloxifene therapy for postmenopausal osteoporosis: results from a 6-month double-blind placebo-controlled trial. J Bone Miner Res 2005;20(11):1905-11. 95. Ettinger B, San Martin JA, Crans GG, Pavo I. Differential effects of teriparatide after treatment with ralozifene or alendronate. J Bone Miner Res 2004;19:745-51. 96. Cosman F, Lindsay R. Therapeutic potential of parathyroid hormone. Curr Osteoporos Rep 2004;2(1):5-11. 97. Kaji H, Sugimoto T. Treatment of osteoporosis with parathyroid hormone: evidence and perspective. Clin Calcium 2005;15(4):6115. 98. Gasser JA, Ingold P, Venturiere A, Green JR. Chronic subcutaneous, but not single intravenous dosing of rats with bisphosphonates results in reduced bone anabolic response to PTH. J Bone Miner Res 2006;21(Suppl 1):S113. 99. Cosman F, Nieves J, Woelfert L, Shen V, Lindsay R. Alendronate does not block the anabolic effect of PTH in postmenopausal osteoporotic women. J Bone Miner Res 1998;13(6):1051-5. 100. Cosman F, Nieves JW, Luckey MM, Zion M, Woelfert L, Lindsay R. Daily versus cyclic PTH combined with alendronate versus alendronate alone for treatment of osteoporosis (Abstract). J Bone Miner Res 2003;18(Suppl 2):S32. 101. Iwaniec U, Mosekilde L, Mitova-Caneva N, Thomsen J, Wronski T. Sequential treatment with basic fibroblast growth factor and PTH is more efficacious than treatment with PTH alone for increasing vertebral bone mass and strength in osteopenic ovariectomized rats. Endocrinology 2002;143(7):2515-26. 102. Lindsay R, Scheele WH, Clancy AD, Mitlak BH. Incident vertebral fractures during an 18-month observation period

104

506

following discontinuation of LY333334 [recombinant human parathyroid hormone (1-34), rhPTH (1-34)] use in postmenopausal women with osteoporosis (Abstract). J Bone Miner Res 2001;16(Suppl 1):1105. 103. Mosekilde L, Danielsen CC, Gasser J. The effect on vertebral bone mass and strength of long term treatment with antiresorptive agents (estrogen and calcitonin), human parathyroid hormone (138), and combination therapy, assessed in aged ovariectomized rats. Endocrinology 1994;134(5):2126-34. 104. Cheng PT, Chan C, Muller K. Cyclical treatment of osteopenic ovariectomized adult rats with PTH (1-34) and pamidronate. J Bone Miner Res 1995;10(1):119-26. 105. Delmas PD, Vergnaud P, Arlot ME, Pastoureau P, Meunier PJ, Nilssen MHL. The anabolic effect of human PTH (1-34) on bone formation is blunted when bone resorption is inhibited by the bisphosphonate tiludronate-is activated resorption a prerequisite for the in vivo effect of PTH on formation in a remodelling system? Bone 1995;16(6):603-10. 106. Koster J, Hackeng W, Mulder H. Diminished effect of etidronate in vitamin D deficient osteopenic postmenopausal women. Eur J Clin Pharmacol 1996;51(2):145-7. 107. Lips P, Chapuy MC, Dawson-Hughes B, Pols HA, Holick MF. An international comparison of serum 25-hydroxyvitamin D measurements. Osteoporos Int 1999;9(5):394-7. 108. Kurland ES, Heller SL, Cosman F, Diamond B, Lindsay R, Bilezikian JP. The post-PTH experience in men with idiopathic osteoporosis: bisphosphonates versus non-pharmacologic therapy (Abstract). J Bone Miner Res 2001;16(Suppl 1):F363. 109. Finkelstein JS, Wyland JJ, Leder BZ, Burnett-Bowie SM, Lee H, Jüppner H, et al. Effects of teriparatide retreatment in osteoporotic men and women. J Clin Endocrinol Metab 2009;94(7):2495-501. 110. Eastell R, Nickelsen T, Marin F, Barker C, Hadji P, Farrerons J, et al. Sequential treatment of severe postmenopausal osteoporosis after teriparatide: final results of the randomized, controlled European Study of Forsteo (EUROFORS). J Bone Miner Res 2009;24(4):726-36.

1389 ‫ آذر‬،9 ‫ ﺷﻤﺎره‬، 68 ‫ دوره‬،‫ داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‬،‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‬


Tehran University Medical Journal; Vol. 68, No. 9, Dec 2010: 497-507

Recombinant parathormone and osteoporosis: a review article

Bagher Larijani MD.* Ashraf Alimadadi MD. Endocrinology and Metabolism Research Center, Tehran University of Medical Sciences, Tehran, Iran.

Abstract

Received: August 02, 2010 Accepted: September 06, 2010

Osteoporosis is a condition characterized with reduced bone density and destruction of the bone structure. The ideal treatment aims to reduce the risk of fracture while improving the density and structure of the bone. Parathormone (PTH) and its main analogue triparatide (rhPTH [1-34]) is a new class of anabolic medications which accelerates the healing process in the fractured bone through improving bone formation and therefore is used for treating severe osteoporosis. The present review article was designed to report the history, different types, anabolic and catabolic effects, complications, indications and contraindications of the hormone. Keywords: Human recombinant parathyroid hormone, osteoporosis, parathyroid hormone, bone mass, treatment.

*

Corresponding author: Endocrine and Metabolism Research Institute, Shriati Hospital, Jalal-e-Al-e-Ahmad Highway, Tehran, Iran. Tel: +98-21-88220037 email: emrc@tums.ac.ir

1389 ‫ آذر‬،9 ‫ ﺷﻤﺎره‬، 68 ‫ دوره‬،‫ داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‬،‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‬


‫‪-515‬ﮔﻠﻴﺎل‬ ‫‪،1389‬ﺳﻠﻮل‬ ‫ﻧﻮرون و‬ ‫ﺗﻤﺎﻳﺰ آنﻫﺎ‬ ‫اﻧﺴﺎﻧﻲ‬ ‫ﻓﻮراﺳﻜﻴﻦ‬ ‫ﻣﺸﺘﻖ‬ ‫ﭘﻴﺶﺳﺎز‬ ‫ﺳﻠﻮلﻫﺎي‬ ‫ﺟﺪاﺳﺎزي‬ ‫‪508‬‬ ‫ﺑﻪ‪ ،‬آذر‬ ‫ﺷﻤﺎره ‪9‬‬ ‫دورهو ‪، 68‬‬ ‫ﺗﻬﺮان‪،‬‬ ‫ﻋﻠﻮمازﭘﺰﺷﻜﻲ‬ ‫داﻧﺸﮕﺎه‬ ‫ﭘﺰﺷﻜﻲ‪،‬‬ ‫داﻧﺸﻜﺪه‬ ‫ﻣﺠﻠﻪ‬

‫ﺟﺪاﺳﺎزي ﺳﻠﻮلﻫﺎي ﭘﻴﺶﺳﺎز ﻣﺸﺘﻖ از ﻓﻮر اﺳﻜﻴﻦ اﻧﺴﺎﻧﻲ و ﺗﻤﺎﻳﺰ آنﻫﺎ ﺑﻪ ﻧﻮرون و ﺳﻠﻮل ﮔﻠﻴﺎل‬

‫‪2‬‬

‫ﻣﻴﺘﺮا ﺑﺨﺘﻴﺎري‪ ،1‬ﻛﺎﻣﺮان ﻣﻨﺼﻮري‬

‫ﻋﻠﻲ ﻣﺼﻄﻔﺎﻳﻲ‪ ،*3‬ﻳﻮﺳﻒ ﺻﺎدﻗﻲ‬

‫‪1‬‬

‫‪5‬‬

‫ﻫﺎدي ﻣﻈﻔﺮي‪ ،4‬رﺳﺘﻢ ﻗﺮﺑﺎﻧﻲ‬ ‫‪6‬‬

‫ﻣﺼﻄﻔﻲ رﺿﺎﻳﻲ ﻃﺎوﻳﺮاﻧﻲ‬

‫‪ -1‬ﮔﺮوه آﻧﺎﺗﻮﻣﻲ و ﺑﻴﻮﻟﻮژي‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم‬ ‫ﭘﺰﺷﻜﻲ ﺷﻬﻴﺪ ﺑﻬﺸﺘﻲ‪ ،‬ﺗﻬﺮان‪ ،‬اﻳﺮان‪.‬‬ ‫‪ -2‬ﻛﺎرﺷﻨﺎس ارﺷﺪ ﻫﻤﺎﺗﻮﻟﻮژي‬ ‫‪ -3‬ﮔﺮوه اﻳﻤﻮﻧﻮﻟﻮژي‬ ‫‪ -4‬ﻛﺎرﺷﻨﺎس ارﺷﺪ ﺑﻴﻮﺷﻴﻤﻲ‬ ‫ﻣﺮﻛﺰ ﺗﺤﻘﻴﻘﺎت ﺑﻴﻮﻟﻮژي ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم‬ ‫ﭘﺰﺷﻜﻲ ﻛﺮﻣﺎﻧﺸﺎه‪ ،‬ﻛﺮﻣﺎﻧﺸﺎه‪ ،‬اﻳﺮان‪.‬‬ ‫‪ -5‬ﮔﺮوه آﻧﺎﺗﻮﻣﻲ و ﺑﻴﻮﻟﻮژي‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم‬ ‫ﭘﺰﺷﻜﻲ ﻛﺮﻣﺎﻧﺸﺎه‪ ،‬ﻛﺮﻣﺎﻧﺸﺎه‪ ،‬اﻳﺮان‪.‬‬ ‫‪ -6‬ﻣﺮﻛﺰ ﺗﺤﻘﻴﻘﺎت ﭘﺮوﺗﺌﻮﻣﻴﻜﺲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم‬ ‫ﭘﺰﺷﻜﻲ ﺷﻬﻴﺪ ﺑﻬﺸﺘﻲ‪ ،‬ﺗﻬﺮان‪ ،‬اﻳﺮان‪.‬‬ ‫*‬

‫ﻧﻮﻳﺴﻨﺪه ﻣﺴﺌﻮل‪ :‬ﻛﺮﻣﺎﻧﺸﺎه‪ ،‬ﻣﺮﻛﺰ ﺗﺤﻘﻴﻘﺎت ﺑﻴﻮﻟﻮژي‬ ‫ﭘﺰﺷﻜﻲ‪ ،‬ﺳﺮﺧﻪ ﻟﻴﮋه‪ ،‬ﻛﺪ ﭘﺴﺘﻲ‪6714869914 :‬‬ ‫ﺗﻠﻔﻦ‪0831-4276473 :‬‬ ‫‪email: amostafaie@kums.ac.ir‬‬

‫ﺗﺎرﻳﺦ درﻳﺎﻓﺖ ﻣﻘﺎﻟﻪ‪ 1389/06/14 :‬ﺗﺎرﻳﺦ ﭘﺬﻳﺮش‪1389/08/01 :‬‬

‫ﭼﻜﻴﺪه‬

‫زﻣﻴﻨﻪ و ﻫﺪف‪ :‬ﺳﻠﻮلﻫﺎي ﭘﻴﺶﺳﺎز ﻣﺸﺘﻖ از ﭘﻮﺳﺖ ﻧﻮﻋﻲ ﺳﻠﻮل ﭘﻴﺶﺳﺎز ﻫﺴﺘﻨﺪ ﻛﻪ از ﻛﺸﺖ درم ﭘﺴﺘﺎﻧﺪاران ﺑﻪدﺳﺖ‬ ‫آﻣﺪه و در ﻣﺤﻴﻂ ﻛﺸﺖ دو ردة ﻧﻮروﻧﻲ و ﻣﺰودرﻣﻲ را ﺗﻮﻟﻴﺪ ﻣﻲﻛﻨﻨﺪ‪ .‬دﺳﺘﻴﺎﺑﻲ ﺑﻪ اﻳﻦ ﺳﻠﻮلﻫﺎ ﺑﻪﻋﻨﻮان ﻳﻚ ﻣﻨﺒﻊ‬ ‫اﺗﻮﻟﻮگ و در دﺳﺘﺮس ﺳﻠﻮلﻫﺎي ﭘﻴﺶﺳﺎز ﻋﺼﺒﻲ‪ ،‬ﮔﺰﻳﻨﻪﻣﻨﺎﺳﺒﻲ در درﻣﺎن ﺑﻴﻤﺎريﻫﺎيﻣﺨﺘﻠﻒ ﺳﻴﺴﺘﻢ ﻋﺼﺒﻲ ﻣﻲﺑﺎﺷﺪ‪.‬‬ ‫اﻳﻦ ﻣﻄﺎﻟﻌﻪ ﺑﻪﻣﻨﻈﻮر راهاﻧﺪازي ﻧﺤﻮه ﺟﺪاﺳﺎزي‪ ،‬ﻛﺸﺖ‪ ،‬ﺗﻜﺜﻴﺮ و ﺗﻤﺎﻳﺰ ﺳﻠﻮلﻫﺎي ﭘﻴﺶﺳﺎز ﻣﺸﺘﻖ از ﭘﻮﺳﺖ اﻧﺴﺎﻧﻲ در‬ ‫ﻛﺸﻮر اﻧﺠﺎم ﺷﺪه اﺳﺖ‪ .‬روش ﺑﺮرﺳﻲ‪ :‬اﺑﺘﺪا ﻧﻤﻮﻧﻪﻫﺎي ﭘﻮﺳﺖ ﻓﻮر اﺳﻜﻴﻦ اﻧﺴﺎﻧﻲ ﺑﻪ ﻗﻄﻌﺎت ﻛﻮﭼﻚ ﺗﻘﺴﻴﻢ و ﭘﺲ از‬ ‫ﻫﻀﻢ آﻧﺰﻳﻤﻲ در ﻣﺤﻴﻂ ﺗﻜﺜﻴﺮي ﻛﺸﺖ داده ﺷﺪﻧﺪ‪ .‬ﭘﺲ از ﭘﺎﺳﺎژ ﭘﻨﺠﻢ ﺑﺎ ﻛﺸﺖ ﺳﻠﻮلﻫﺎي ﺣﺎﺻﻠﻪ در ﺷﺮاﻳﻂ ﺗﻤﺎﻳﺰي‬ ‫ﻋﺼﺒﻲ‪ ،‬ﺗﻤﺎﻳﺰ اﻧﺠﺎم ﺷﺪ‪ .‬ﺑﺮاي ﺷﻨﺎﺳﺎﻳﻲ ﻫﻮﻳﺖ ﺳﻠﻮلﻫﺎ از ﺗﻜﻨﻴﻚﻫﺎي اﻳﻤﻮﻧﻮﺳﻴﺘﻮﺷﻴﻤﻲ و‬

‫‪RT-PCR‬‬

‫اﺳﺘﻔﺎده ﺷﺪ‪.‬‬

‫ﺗﻮاﻧﺎﻳﻲ ﺗﻤﺎﻳﺰ ﺑﻪ ﻧﻮرون و ﺳﻠﻮل ﮔﻠﻴﺎل ﭘﺲ از رﻧﮓآﻣﻴﺰي ﺑﺎ آﻧﺘﻲﺑﺎديﻫﺎي اﺧﺘﺼﺎﺻﻲ در ﺳﻪ ﺗﻜﺮار ﺑﻴﻮﻟﻮژﻳﻚ ﺑﺮرﺳﻲ‬ ‫ﺷﺪ‪ .‬ﻳﺎﻓﺘﻪﻫﺎ‪ :‬ﭘﺲ از ﺗﻤﺎﻳﺰ‪ ،‬ﺳﻠﻮلﻫﺎي‬

‫‪β- III‬‬

‫ﺗﻮﺑﻮﻟﻴﻦ ﻣﺜﺒﺖ و ﻧﻮروﻓﻴﻼﻣﻨﺖ‪-‬‬

‫‪M‬‬

‫ﻣﺜﺒﺖ ﻣﺸﺎﻫﺪه ﺷﺪﻧﺪ ﻛﻪ ﻣﺎرﻛﺮﻫﺎي‬

‫اﺧﺘﺼﺎﺻﻲ ﺳﻠﻮل ﻋﺼﺒﻲ ﻫﺴﺘﻨﺪ‪ .‬ﻫﻤﭽﻨﻴﻦ ﺳﻠﻮلﻫﺎي )‪ Glial fibrillary acid protein (GFAP‬ﻣﺜﺒﺖ و ‪ S100‬ﻣﺜﺒﺖ دﻳﺪه‬ ‫ﺷﺪﻧﺪ ﻛﻪ اﻳﻦ ﻣﺎرﻛﺮﻫﺎ ﺑﻪﻃﻮر اﺧﺘﺼﺎﺻﻲ در ﺳﻠﻮلﻫﺎي ﮔﻠﻴﺎل ﺑﻴﺎن ﻣﻲﺷﻮﻧﺪ‪ .‬ﺧﺼﻮﺻﻴﺎت ﻣﻮرﻓﻮﻟﻮژﻳﻚ ﻧﻴﺰ ﻣﺎﻫﻴﺖ‬ ‫ﺳﻠﻮلﻫﺎي ﺗﻤﺎﻳﺰ ﻳﺎﻓﺘﻪ را ﺑﻪﻋﻨﻮان ﻧﻮرون و ﺳﻠﻮل ﮔﻠﻴﺎل ﺗﺎﻳﻴﺪ ﻧﻤﻮد‪ .‬ﻧﺘﻴﺠﻪﮔﻴﺮي‪ :‬ﺳﻠﻮلﻫﺎي ﺑﻪدﺳﺖ آﻣﺪه از ﭘﻮﺳﺖ‬ ‫ﻓﻮر اﺳﻜﻴﻦ اﻧﺴﺎﻧﻲ در ﻣﺤﻴﻂ ﻛﺸﺖ‪ ،‬ﺑﺴﺘﻪ ﺑﻪ ﺷﺮاﻳﻂ اﻟﻘﺎﻳﻲ ﻣﺤﻴﻂ ﺗﻮاﻧﺎﻳﻲ ﺗﻤﺎﻳﺰ ﺑﻪ ﻧﻮرون و ﺳﻠﻮل ﮔﻠﻴﺎل را دارﻧﺪ‪.‬‬ ‫ﻛﻠﻤﺎت ﻛﻠﻴﺪي‪ :‬ﭘﻴﺶﺳﺎز ﻣﺸﺘﻖ از ﭘﻮﺳﺖ اﻧﺴﺎﻧﻲ‪ ،‬ردة ﻋﺼﺒﻲ‪ ،‬ﻧﻮرون‪ ،‬ﺳﻠﻮل ﮔﻠﻴﺎل‪ ،‬ﺗﻤﺎﻳﺰ ﻋﺼﺒﻲ‪.‬‬

‫ﻣﻘﺪﻣﻪ‬

‫ﺑﺮرﺳﻲ ﺷﺪه و ﻣﻨﺠﺮ ﺑﻪ ﺷﻨﺎﺳﺎﻳﻲ ﺳﻠﻮلﻫﺎي ﭘﻴﺶﺳﺎز ﻣﺸﺘﻖ از ﭘﻮﺳﺖ‬

‫ﺑﺎ ﺗﻮﺟﻪ ﺑﻪ ﺷﻴﻮع ﻧﺴﺒﺘﺎً ﺑﺎﻻي آﺳﻴﺐﻫﺎي ﺳﻴﺴﺘﻢ ﻋﺼﺒﻲ‪ ،‬ﭘﻴﺪا ﻛﺮدن‬

‫)‪ Skin derived Precursors (SKP‬ﮔﺮدﻳﺪ‪ 4-6.‬اﻳﻦ ﺳﻠﻮلﻫﺎ ﻧﻮﻋﻲ ﺳﻠﻮل‬

‫ﻳﻚ ﻣﻨﺒﻊ ﺑﺎﻓﺘﻲ ﻣﻨﺎﺳﺐ ﺑﺎ ﻗﺎﺑﻠﻴﺖ دﺳﺘﺮﺳﻲ آﺳﺎن ﻛﻪ ﺣﺎوي ﻳﻚ ﺳﻠﻮل‬

‫ﭘﻴﺶﺳﺎز ﭼﻨﺪ ﻇﺮﻓﻴﺘﻲ درونزا ﻫﺴﺘﻨﺪ ﻛﻪ از اﻧﻮاع دﻳﮕﺮ ﭘﻴﺶﺳﺎزﻫﺎي‬

‫ﭘﻴﺶﺳﺎز )‪ (Precursor‬ﻣﻮﻟﺪ ﺳﻠﻮلﻫﺎي ﻋﺼﺒﻲ ﺑﺎﺷﺪ‪ ،‬ﻣﻲﺗﻮاﻧﺪ ﺑﻪﻋﻨﻮان‬

‫ﺷﻨﺎﺧﺘﻪ ﺷﺪه در ﭘﻮﺳﺖ ﻗﺎﺑﻞ اﻓﺘﺮاق ﻣﻲﺑﺎﺷﻨﺪ‪ .‬ﺳﻠﻮلﻫﺎي‬

‫‪SKP‬‬

‫ﺑﻪدﻧﺒﺎل‬

‫‪1‬‬

‫ﻛﺸﺖ درم از ﭘﻮﺳﺖ ﭘﺴﺘﺎﻧﺪاران ﻧﻮزاد و ﺑﺰرﮔﺴﺎل ﺑﻪدﺳﺖ آﻣﺪﻧﺪ و ﺑﺎ‬

‫راﻳﺞﺗﺮﻳﻦ ﻣﻨﺒﻊ ﺑﺎﻓﺘﻲ ﺟﻬﺖ ﺗﻬﻴﺔ ﺳﻠﻮلﻫﺎي ﺑﻨﻴﺎدي ﻋﺼﺒﻲ‪ ،‬ﺑﺎﻓﺖ‬

‫ﭘﺘﺎﻧﺴﻴﻞ ﺗﻤﺎﻳﺰي ﭼﻨﺪ دودﻣﺎﻧﻲ‪ ،‬در ﻣﺤﻴﻂ ﻛﺸﺖ دو ردة ﻧﻮروﻧﻲ و‬

‫راﻫﻜﺎري ﻣﻨﺎﺳﺐ در درﻣﺎن ﺑﻴﻤﺎريﻫﺎي ﺳﻴﺴﺘﻢ ﻋﺼﺒﻲ ﻣﻄﺮح ﺑﺎﺷﺪ‪.‬‬

‫‪7-10‬‬

‫ﺳﻠﻮلﻫﺎي ﭘﻴﺶﺳﺎز ﻣﺸﺘﻖ از ﭘﻮﺳﺖ‬

‫ﺟﻨﻴﻨﻲ اﺳﺖ ﻛﻪ اﺳﺘﻔﺎده از آن ﻋﻼوه ﺑﺮ ﻣﺤﺪودﻳﺖﻫﺎي اﺧﻼﻗﻲ‬

‫ﻣﺰودرﻣﻲ را ﺗﻮﻟﻴﺪ ﻛﺮدﻧﺪ‪.‬‬

‫ﻣﺸﻜﻼت ﭘﻴﻮﻧﺪ ﻫﺘﺮوﻟﻮگ را ﺑﻪدﻧﺒﺎل دارد‪ 2.‬داﻧﺴﺘﻦ اﻳﻦﻛﻪ ﺳﻠﻮل ﻣﺮﻛﻞ‬

‫اﻧﺴﺎﻧﻲ‪ ،‬ﺗﻮاﻧﺎﻳﻲ ﺗﻤﺎﻳﺰ ﺑﻪ ﻧﻮرون )ﺳﻠﻮلﻫﺎﻳﻲ ﺑﺎ ﻓﻨﻮﺗﻴﭗ ﻧﻮرونﻫﺎي‬

‫)ﻧﻮﻋﻲ ﮔﻴﺮﻧﺪة ﺣﺴﻲ ﺑﺎ ﺧﺼﻮﺻﻴﺎت ﺳﻠﻮل ﻋﺼﺒﻲ(‪ ،‬در ﭘﻮﺳﺖ‬

‫ﻣﺤﻴﻄﻲ(‪ ،‬ﺳﻠﻮلﻫﺎي ﮔﻠﻴﺎل )ﺳﻠﻮل ﺷﻮان(‪ ،‬ﺳﻠﻮلﻫﺎي ﻋﻀﻠﺔ ﺻﺎف و‬

‫ﺑﺰرﮔﺴﺎل ﺗﻮﻟﻴﺪ ﻣﻲﺷﻮد‪ ،‬اﺣﺘﻤﺎل وﺟﻮد ﻳﻚ ﻧﻮع ﺳﻠﻮل ﭘﻴﺶﺳﺎز در‬ ‫ﭘﻮﺳﺖ را ﻛﻪ ﻗﺎدر ﺑﻪ ﺗﻮﻟﻴﺪ اﻧﻮاع ﺳﻠﻮلﻫﺎي ﻋﺼﺒﻲ ﺑﺎﺷﺪ ﻣﻄﺮح ﻧﻤﻮد‪.‬‬

‫‪3‬‬

‫ﺳﻠﻮل ﭼﺮﺑﻲ را دارا ﻣﻲﺑﺎﺷﻨﺪ‪ ،‬اﺧﻴﺮاً ﮔﺰارﺷﺎﺗﻲ در ﺧﺼﻮص ﮔﺴﺘﺮش‬ ‫‪12‬و‪11‬‬

‫ﻣﺤﺪودة ﭘﺘﺎﻧﺴﻴﻞ ﺗﻤﺎﻳﺰي آنﻫﺎ وﺟﻮد دارد‪.‬‬

‫از ﻣﻮارد ﻛﺎرﺑﺮد اﻳﻦ‬

‫اﻳﻦ ﻓﺮﺿﻴﻪ ﻛﻪ ﭘﻮﺳﺖ ﻣﻲﺗﻮاﻧﺪ ﺑﻪ ﻋﻨﻮان ﻳﻚ ﻣﻨﺒﻊ اﺗﻮﻟﻮگ ﺑﺎﻟﻘﻮه و در‬

‫ﺳﻠﻮلﻫﺎ ﻣﻲﺗﻮان ﺑﻪ اﻣﻜﺎن ﭘﻴﻮﻧﺪ ﺳﻠﻮل اﺗﻮﻟﻮگ در ﺑﻴﻤﺎريﻫﺎي ﻣﺨﺘﻠﻒ‬

‫دﺳﺘﺮس ﺟﻬﺖ دﺳﺘﻴـﺎﺑﻲ ﺑﻪ ﺳﻠﻮلﻫﺎي ﭘﻴﺶﺳﺎز ﻋﺼـﺒﻲ ﻣﻄﺮح ﺑـﺎﺷﺪ‪،‬‬

‫ﺳﻴﺴﺘﻢ ﻋﺼﺒﻲ از ﺟﻤﻠﻪ اﺳﺘﻔﺎده از ﺳﻠﻮلﻫﺎي ﺷﻮان ﺗﻤﺎﻳﺰ ﻳﺎﻓﺘﻪ از‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬


‫ﻣﻴﺘﺮا ﺑﺨﺘﻴﺎري و ﻫﻤﻜﺎران‬

‫‪509‬‬

‫‪SKP‬ﻫﺎ در ﺗﺮﻣﻴﻢ ﺿﺎﻳﻌﺎت ﻧﺨﺎﻋﻲ و ﺑﻴﻤﺎري ﻣﻮﻟﺘﻴﭙﻞ اﺳﻜﻠﺮوزﻳﺲ‬

‫‪ ،M‬ﭘﺮوﺗﻴﻴﻦ اﺳﻴﺪ رﺷﺘﻪاي ﮔﻠﻴﺎل‬

‫اﺷﺎره ﻧﻤﻮد‪14.‬و‪ 13‬از آﻧﺠﺎﻳﻲ ﻛﻪ اﻣﻜﺎن ﺗﻤﺎﻳﺰ اﻳﻦ ﺳﻠﻮلﻫﺎ ﺑﻪ ﻧﻮرونﻫﺎﻳﻲ‬

‫‪ IgG‬ﻣﻮﺷﻲ ﻛﻮﻧﮋوﮔﻪ ﺑﺎ‬

‫ﺑﺎ ﺧﺼﻮﺻﻴﺎت دوﭘﺎﻣﻴﻨﺮژﻳﻚ ﮔﺰارش ﺷﺪه‪ ،‬ﻟﺬا اﺳﺘﻔﺎده از ﻧﻮرونﻫﺎي‬

‫ﭘﺰﺷﻜﻲ ﻛﺮﻣﺎﻧﺸﺎه(‪ ،‬آﻧﺘﻲﺑﺎديﻫﺎي ﺿﺪ وﻳﻤﻨﺘﻴﻦ‪ ،‬اﻛﺘﻴﻦ ﻋﻀﻠﻪ ﺻﺎف و‬

‫ﺗﻤﺎﻳﺰ ﻳﺎﻓﺘﻪ در درﻣﺎن ﭘﺎرﻛﻴﻨﺴﻮن ﻣﻄﺮح ﺷﺪه اﺳﺖ‪ 15.‬از ﺳﻮي دﻳﮕﺮ در‬

‫‪) S100‬داﻛﻮ داﻧﻤﺎرك(‪ ،‬ﻛﻴﺖ ‪ RNaxPlus‬ﺟﻬﺖ اﺳﺘﺨﺮاج ‪) RNA‬ﺳﻴﻨﺎژن‬

‫ﻣﻄﺎﻟﻌﺎت ﭘﺎﻳﻪ ﺑﺮ روي ﺳﻠﻮلﻫﺎي ﻋﺼﺒﻲ و ﮔﻠﻴﺎل ﻣﻲﺗﻮان از ﻣﺸﺘﻘﺎت‬

‫اﻳﺮان(‪ ،‬ﻛﻴﺖ ﺳﻨﺘﺰ ‪) cDNA‬ﻛﻴﺎژن آﻟﻤﺎن( و ﭘﺮاﻳﻤﺮﻫﺎي ژنﻫﺎي‬

‫‪Snail,‬‬

‫ﺗﻤﺎﻳﺰ ﻳﺎﻓﺘﻪ اﻳﻦ ﺳﻠﻮلﻫﺎ ﺑﻪﻋﻨﻮان ﻳﻚ ﻣﺪل ﺗﺤﻘﻴﻘﺎﺗﻲ در ﻣﺤﻴﻂ ﻛﺸﺖ‬

‫‪) Slug, P75NTR Pax3‬ﻧﺪاي ﻓﻦ اﻳﺮان(‪.‬‬

‫‪FITC‬‬

‫)‪R&D‬‬

‫آﻣﺮﻳﻜﺎ(‪ ،‬آﻧﺘﻲﺑﺎدي ﺛﺎﻧﻮﻳﻪ ﺿﺪ‬

‫)ﺗﻬﻴﻪ ﺷﺪه در ﻣﺮﻛﺰ ﺗﺤﻘﻴﻘﺎت ﺑﻴﻮﻟﻮژي‬

‫ﺑﻬﺮهﻣﻨﺪ ﮔﺮدﻳﺪ‪SKP 6.‬ﻫﺎي اﻧﺴﺎﻧﻲ در ﺗﻤﺎم ﻃﻮل ﻋﻤﺮ ﺣﻀﻮر دارﻧﺪ وﻟﻲ‬

‫ﺗﻬﻴﻪ ﻧﻤﻮﻧﻪﻫﺎي ﭘﻮﺳﺘﻲ‪ :‬در اﻳﻦ ﻣﻄﺎﻟﻌﻪ ﺗﻌﺪاد ‪ 10‬ﻧﻤﻮﻧﻪ ﭘﻮﺳﺖ ﻓﻮر‬

‫ﺗﻌﺪاد و ﭘﺘﺎﻧﺴﻴﻞ ﺗﻤﺎﻳﺰي آنﻫﺎ در اﻓﺮاد ﺑﺰرﮔﺴﺎل ﺑﻪﻃﻮر واﺿﺤﻲ ﻧﺴﺒﺖ‬

‫اﺳﻜﻴﻦ اﻧﺴﺎﻧﻲ‪ ،‬اﻃﻔﺎل ﻣﺬﻛﺮ در ﻣﺤﺪوده ﺳﻨﻲ ‪ 1-12‬ﻣﺎﻫﻪ ﺣﺎﺻﻞ از‬

‫ﺑﻪ ﻧﻮزادان ﻛﻤﺘﺮ اﺳﺖ‪ 5.‬ﺑﺪﻳﻦ ﻟﺤﺎظ ﻣﺮاﺣﻞ ﺟﺪاﺳﺎزي‪ ،‬ﻛﺸﺖ و ﺗﻤﺎﻳﺰ‬

‫اﻋﻤﺎل ﺟﺮاﺣﻲ داوﻃﻠﺒﺎﻧﻪ ﺧﺘﻨﻪ ﻛﻪ ﺑﻪﻋﻨﻮان دوررﻳﺰ ﺟﺮاﺣﻲ ﻣﻲﺑﺎﺷﺪ‪،‬‬

‫آنﻫﺎ در اﻓﺮاد ﻣﺴﻦ ﻣﺸﻜﻞ اﺳﺖ‪ .‬ﻧﮕﻬﺪاري ‪SKP‬ﻫﺎي اﻧﺴﺎﻧﻲ ﺑﻪﺻﻮرت‬

‫ﻣﻮرد اﺳﺘﻔﺎده ﻗﺮار ﮔﺮﻓﺖ‪ .‬ﺑﻪ واﻟﺪﻳﻦ ﺑﻴﻤﺎران اﻃﻼﻋﺎت ﻛﺎﻓﻲ داده و‬

‫ﺑﺎﻧﻚﻫﺎي ﺳﻠﻮﻟﻲ در ﻣﺮاﺣﻞ اوﻟﻴﺔ زﻧﺪﮔﻲ ﺑﻪﻣﻨﻈﻮر ﻛﺎرﺑﺮد ﻛﻠﻴﻨﻴﻜﻲ‬

‫رﺿﺎﻳﺖﻧﺎﻣﻪ ﮔﺮﻓﺘﻪ ﺷﺪ‪ .‬ﻣﻄﺎﻟﻌﻪ ﺗﺤﺖ ﺷﺮاﻳﻂ رﻋﺎﻳﺖ ﻛﺎﻣﻞ ﻧﻜﺎت‬

‫آنﻫﺎ در ﻣﺮاﺣﻞ ﺑﻌﺪي ﻣﻲﺗﻮاﻧﺪ ﺑﺴﻴﺎر ﺳﻮدﻣﻨﺪ ﺑﺎﺷﺪ‪17.‬و‪ 16‬اﻳﻦ ﺳﻠﻮلﻫﺎ‬

‫اﺧﻼﻗﻲ و ﺑﺎ ﺗﺎﻳﻴﺪ ﻛﻤﻴﺘﻪ اﺧﻼﻗﻲ ﭘﮋوﻫﺸﻲ داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ‬

‫ﺑﻪﻋﻨﻮان ﻳﻚ ﻣﻨﺒﻊ ﻣﻨﺎﺳﺐ در دﺳﺘﺮس و اﺗﻮﻟﻮگ ﺟﻬﺖ ﺣﺼﻮل ﺑﻪ‬

‫ﻛﺮﻣﺎﻧﺸﺎه اﻧﺠﺎم ﺷﺪ‪ .‬ﻫﺰﻳﻨﻪﻫﺎي اﻧﺠﺎم اﻳﻦ ﻣﻄﺎﻟﻌﻪ از ﻃﺮﻳﻖ ﻣﻌﺎوﻧﺖ‬

‫ﭘﻴﺶﺳﺎزﻫﺎي ﻋﺼﺒﻲ ﺑﺎ ﺗﻮان ﺗﻤﺎﻳﺰي ﺑﺎﻻ در درﻣﺎن ﺑﻴﻤﺎريﻫﺎي ﺳﻴﺴﺘﻢ‬

‫ﭘﮋوﻫﺸﻲ داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﻛﺮﻣﺎﻧﺸﺎه ﺗﺎﻣﻴﻦ ﮔﺮدﻳﺪ‪ .‬ﻗﻄﻌﺎت ﭘﻮﺳﺖ‬

‫ﻋﺼﺒﻲ از ﺟﻤﻠﻪ ﺗﺮﻣﻴﻢ ﺿﺎﻳﻌﺎت ﻧﺨﺎﻋﻲ‪ ،‬ﻣﻮﻟﺘﻴﭙﻞ اﺳﻜﻠﺮوزﻳﺲ و‬

‫ﻓﻮر اﺳﻜﻴﻦ اﻧﺴﺎﻧﻲ در ﻟﻮﻟﻪﻫﺎي ﻓﺎﻟﻜﻦ ﺣﺎوي‬

‫ﺑﺎ ‪ 7/4 pH‬در‬

‫ﭘﺎرﻛﻴﻨﺴﻮن‪ ،‬اﻫﻤﻴﺖ ﺑﺴﻴﺎر دارﻧﺪ‪.‬‬

‫ﺷﺮاﻳﻂ اﺳﺘﺮﻳﻞ و ﺑﺎ ﺣﻔﻆ زﻧﺠﻴﺮه ﺳﺮد )ﺣﻤﻞ ﻟﻮﻟﻪﻫﺎ ﻗﺒﻞ و ﺑﻌﺪ از‬

‫در ﻣﻄﺎﻟﻌﻪ ﺣﺎﺿﺮ ﺑﺮاي اوﻟﻴﻦﺑﺎر در ﻛﺸﻮر ﺟﺪاﺳﺎزي ﺳﻠﻮلﻫﺎي‬

‫‪SKP‬‬

‫از ﻓﻮر اﺳﻜﻴﻦ ‪ Foreskin‬اﻧﺴﺎﻧﻲ و ﺗﻤﺎﻳﺰ آنﻫﺎ ﺑﻪ ردة ﻋﺼﺒﻲ ﺷﺎﻣﻞ‬ ‫ﻧﻮرون و ﺳﻠﻮلﻫﺎي ﮔﻠﻴﺎل اﻧﺠﺎم ﮔﺮﻓﺘﻪ اﺳﺖ‪.‬‬

‫‪HBSS‬‬

‫اﻧﺘﻘﺎل ﻓﻮر اﺳﻜﻴﻦ روي ﻳﺦ( از اﺗﺎق ﻋﻤﻞ ﺑﻴﻤﺎرﺳﺘﺎن ﺣﻀﺮت ﻣﻌﺼﻮﻣﻪ‬ ‫)س( ﻛﺮﻣﺎﻧﺸﺎه ﺑﻪ آزﻣﺎﻳﺸﮕﺎه ﻛﺸﺖ ﺳﻠﻮل ﻣﻨﺘﻘﻞ ﮔﺮدﻳﺪ‪.‬‬ ‫ﻛﺸﺖ ﺳﻠﻮل‪ :‬ﻧﻤﻮﻧﻪﻫﺎي ﭘﻮﺳﺘﻲ ﺑﻪدﺳﺖ آﻣﺪه ﺑﻪ ﻗﻄﻌﺎت ﻛﻮﭼﻚ‬ ‫ﻣﺴﺘﻄﻴﻞ ﺷﻜﻞ ﺑﻪ اﺑﻌﺎد ‪ 2 3mm‬ﺑﺮﻳﺪه ﺷﺪﻧﺪ و ﻳﻚ ﺷﺐ در ﻣﺤﻠﻮل‬

‫روش ﺑﺮرﺳﻲ‬

‫ﺗﺮﻣﻮﻻﻳﺰﻳﻦ )‪ 250µg/ml‬در ﺑﺎﻓﺮ ‪ (HBSS‬در دﻣﺎي ‪ 4 °C‬ﻗﺮار داده‬

‫ﻣﻄﺎﻟﻌﻪ ﺣﺎﺿﺮ از ﻧﻮع ﺗﺠﺮﺑﻲ ﺑﻮده و در آزﻣﺎﻳﺸﮕﺎه ﻛﺸﺖ ﺳﻠﻮلﻫﺎي‬

‫ﺷﺪﻧﺪ‪ .‬روز ﺑﻌﺪ‪ ،‬ﺑﺎ اﺳﺘﻔﺎده از ﻳﻚ ﻓﻮرﺳﭙﺲ رﻳﺰ اﭘﻴﺪرم ﺑﺎ دﻗﺖ از درم‬

‫ﺑﻨﻴﺎدي‪ ،‬ﻣﺮﻛﺰ ﺗﺤﻘﻴﻘﺎت ﺑﻴﻮﻟﻮژي ﭘﺰﺷﻜﻲ ﻛﺮﻣﺎﻧﺸﺎه ﻃﻲ ﺳﺎلﻫﺎي‬

‫ﺟﺪا ﺷﺪ‪ .‬ﻗﻄﻌﺎت درم ﺟﺪا ﺷﺪه ﭘﺲ از رﻳﺰ ﺷﺪن ﺑﻪ ﻗﻄﻌﺎت ﻛﻮﭼﻚﺗﺮ‬

‫‪ 1388-89‬اﻧﺠﺎم ﮔﺮدﻳﺪ‪ .‬ﻧﻤﻮﻧﻪ ﭘﻮﺳﺖ اﻧﺴﺎﻧﻲ ﻣﻮرد اﺳﺘﻔﺎده در اﻳﻦ‬

‫در آﻧﺰﻳﻢ ﻛﻼژﻧﺎز ‪ ،ΙV‬در ﻏﻠﻈﺖ ‪ 1mg/ml‬ﺑﻪﻣﺪت ‪ 45‬دﻗﻴﻘﻪ ﺗﺤﺖ ﻫﻢ‬

‫ﺗﺤﻘﻴﻖ از ﭘﻮﺳﺖ ﻧﺎﺣﻴﻪ ﻓﻮر اﺳﻜﻴﻦ ﺑﻪدﻧﺒﺎل ﻋﻤﻞ ﺟﺮاﺣﻲ ﺧﺘﻨﻪ‬

‫زدن در دﻣﺎي ‪ 37 °C‬ﻗﺮار داده ﺷﺪﻧﺪ‪ .‬ﺳﭙﺲ آﻧﺰﻳﻢ‬

‫)‪ (Circumcision‬ﺗﻬﻴﻪ ﮔﺮدﻳﺪ‪ .‬ﻣﻮاد ﻣﻮرد اﺳﺘﻔﺎده ﻋﺒﺎرت ﺑﻮدﻧﺪ از‪:‬‬

‫ﻧﻬﺎﻳﻲ ‪ %0/1‬ﺑﻪ ﺳﻮﺳﭙﺎﻧﺴﻴﻮن ﺳﻠﻮﻟﻲ ﻓﻮق اﺿﺎﻓﻪ ﺷﺪه و ﭘﻨﺞ دﻗﻴﻘﻪ دﻳﮕﺮ‬

‫‪،Hank’s Buffered Salt Solution‬‬

‫اﻧﻜﻮﺑﻪ ﮔﺮدﻳﺪ‪ .‬ﻣﺨﻠﻮط ﺑﻪدﺳﺖ آﻣﺪه از ﻫﻀﻢ ﺑﺎﻓﺖ درم‪ ،‬ﻓﻴﻠﺘﺮ و در‬

‫ﻛﻼژﻧﺎز ﻧﻮع ‪ ،LIF ،DNase ،IV‬آﻣﻔﻮﺗﺮﻳﺴﻴﻦ‪،poly-D-lysine ،‬‬

‫‪ 700g‬ﺑﻪﻣﺪت ﭘﻨﺞ دﻗﻴﻘﻪ ﺳﺎﻧﺘﺮﻳﻔﻴﻮژ ﺷﺪ‪ .‬رﺳﻮب ﺳﻠﻮﻟﻲ در ﻣﺤﻴﻂ‬

‫)ﺳﻴﮕﻤﺎ آﻣﺮﻳﻜﺎ(‪،‬‬

‫‪bFGF‬‬

‫آﻧﺰﻳﻢ ﺗﺮﻣﻮﻻﻳﺰﻳﻦ‪ ،‬ﻣﺤﻠﻮل‬ ‫ﭘﺎراﻓﺮﻣﺎﻟﺪﻫﺎﻳﺪ‪ ،‬ﺗﺮﻳﺘﻮن‬

‫)‪(HBSS‬‬

‫‪X100‬‬

‫و ﻫﻮﺧﺴﺖ‬

‫‪33258‬‬

‫‪DMEM/F12‬‬

‫ﺗﻜﺜﻴﺮي‬

‫ﺣﺎوي‬

‫‪B27‬‬

‫‪A‬‬

‫)‪،(%2‬‬

‫ﻣﺤﻴﻂﻫﺎي ﻛﺸﺖ ‪ ،DMEM/F12‬ﭘﻨﻲﺳﻴﻠﻴﻦ و ﺟﻨﺘﺎﻣﺎﻳﺴﻴﻦ‪ ،‬ﺳﺮم ﺟﻨﻴﻦ‬

‫)‪،(40ng/ml‬‬

‫ﮔﺎو )‪ ،(FCS‬ﺳﺮم ﺑﺰ و آﻟﺒﻮﻣﻴﻦ ﺳﺮم ﮔﺎوي )‪) (BSA‬ﮔﻴﺒﻜﻮ ﻫﻠﻨﺪ(‪ ،‬ﻣﺤﻴﻂ‬

‫)‪ ،(100u/ml‬ﺟﻨﺘﺎﻣﺎﻳﺴﻴﻦ )‪ (25µg/ml‬و آﻣﻔﻮﺗﺮﻳﺴﻴﻦ )‪ (1μg/ml‬ﺷﻨﺎور‬

‫ﺑﺪون ﺳﺮم )اﻳﻨﻮﻳﺘﺮوژن اﻣﺮﻳﻜﺎ(‪،‬‬

‫ﺷﺪﻧﺪ‪ .‬در اﻳﻦ ﻣﺮﺣﻠﻪ ﺳﻠﻮلﻫﺎ را ﺑﺎ ﺗﺮاﻛﻢ زﻳﺎد )‪ 0/8-1/2 ×106‬ﺳﻠﻮل‬

‫‪B27‬‬

‫ﺑﺪون وﻳﺘﺎﻣﻴﻦ‬

‫‪A‬‬

‫و‬

‫‪B27‬‬

‫‪2‬‬

‫‪EGF‬‬

‫)‪،(20ng/ml‬‬

‫ﺑﺪون وﻳﺘﺎﻣﻴﻦ‬

‫‪DNase‬‬

‫ﺑﺎ ﻏﻠﻈﺖ‬

‫‪LIF‬‬

‫)‪ ،(10ng/ml‬ﭘﻨﻲﺳﻴﻠﻴﻦ‬

‫‪2‬‬

‫ﻓﺎﻛﺘﻮرﻫﺎي رﺷﺪ ‪ EGF ،bFGF‬و ‪ NGF‬و آﻧﺘﻲﺑﺎدي ﺿﺪ ﺑﺘﺎ‪ III-‬ﺗﻮﺑﻮﻟﻴﻦ‬

‫در ﻫﺮ ‪ (cm‬در ﻓﻼﺳﻚﻫﺎي ‪ 25cm‬ﻛﺸﺖ داده ﺷﺪﻧﺪ‪ .‬در ﻫﺮ ﻫﻔﺘﻪ‬

‫)آﻛﺴﻮرا آﻟﻤﺎن(‪ ،‬آﻧﺘﻲﺑﺎديﻫﺎي ﺿﺪ ﻧﺴﺘﻴﻦ‪ ،‬ﻓﻴﺒﺮوﻧﻜﺘﻴﻦ‪ ،‬ﻧﻮروﻓﻴﻼﻣﻨﺖ‬

‫ﺳﻪ ﺑﺎر ﻣﺤﻴﻂ ﺗﻜﺜﻴﺮي ﺑﻪ ﻓﻼﺳﻚﻫﺎي ﻛﺸﺖ اﺿﺎﻓﻪ ﺷﺪ‪.‬‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬


‫‪510‬‬

‫ﺟﺪاﺳﺎزي ﺳﻠﻮلﻫﺎي ﭘﻴﺶﺳﺎز ﻣﺸﺘﻖ از ﻓﻮراﺳﻜﻴﻦ اﻧﺴﺎﻧﻲ و ﺗﻤﺎﻳﺰ آنﻫﺎ ﺑﻪ ﻧﻮرون و ﺳﻠﻮل ﮔﻠﻴﺎل‬

‫ﭘﺎﺳﺎژ ﺳﻠﻮلﻫﺎ‪ :‬در روز ﻫﻔﺘﻢ ﭘﺲ از ﻛﺸﺖ‪ ،‬ﻣﺠﻤﻮﻋﻪﻫﺎي ﺳﻠﻮﻟﻲ ﻛﻪ‬ ‫ﺑﻪﺻﻮرت ﻛﺮوي )‪ (Sphere‬ﺷﻨﺎور ﺑﻮدﻧﺪ‪ ،‬ﭘﺎﺳﺎژ داده ﺷﺪﻧﺪ‪ .‬ﺑﻪ اﻳﻦ‬

‫واﻛﻨﺶ زﻧﺠﻴﺮه ﭘﻠﻴﻤﺮاز ﻣﻌﻜﻮس‪:‬‬

‫‪RNA‬‬

‫ﺳﻠﻮﻟﻲ ﺑﺎ ﻛﻴﺖ‬

‫‪RNaxPlus‬‬

‫از ﻧﻤﻮﻧﻪﻫﺎ ﺗﻬﻴﻪ ﮔﺮدﻳﺪ و ‪ cDNA‬ﺑﺎ روش ﻧﺴﺨﻪﺑﺮداري ﻣﻌﻜﻮس‬

‫ﺗﺮﺗﻴﺐ ﻛﻪ ﻣﺤﺘﻮاي ﻓﻼﺳﻚﻫﺎ در ‪ 700g‬ﺑﻪﻣﺪت ﭘﻨﺞ دﻗﻴﻘﻪ ﺳﺎﻧﺘﺮﻳﻔﻴﻮژ‬

‫)‪(RT‬‬

‫ﺷﺪﻧﺪ‪ .‬دوﺳﻮم ﻣﺎﻳﻊ روﻳﻲ دور رﻳﺨﺘﻪ و اﺳﻔﻴﺮﻫﺎ در ﺛﻠﺚ ﺑﺎﻗﻴﻤﺎﻧﺪة آن‬

‫ﺷﺪ‪ :‬دو دﻗﻴﻘﻪ در ‪ 30 ،92 °C‬اﻟﻲ ‪ 35‬ﺳﻴﻜﻞ ‪ 94 °C‬ﺑﻪﻣﺪت ‪60‬‬

‫ﺷﻨﺎور ﺷﺪﻧﺪ‪ .‬ﺑﺎ ﭘﻴﭙﺖ ﻛﺮدن‪ ،‬ﺳﻠﻮلﻫﺎي ﺗﺸﻜﻴﻞ دﻫﻨﺪة اﺳﻔﻴﺮﻫﺎ‬

‫ﺗﻮﻟﻴﺪ ﺷﺪ‪ .‬واﻛﻨﺶ زﻧﺠﻴﺮة ﭘﻠﻴﻤﺮاز‬

‫‪PCR‬‬

‫ﺑﻪ اﻳﻦ ﺗﺮﺗﻴﺐ اﻧﺠﺎم‬ ‫‪4‬‬

‫ﺛﺎﻧﻴﻪ )ذوب( و ‪ 72 °C‬ﺑﻪﻣﺪت ‪ 60‬ﺛﺎﻧﻴﻪ )اﻧﻴﻠﻴﻨﮓ(‪ .‬ﭘﺮاﻳﻤﺮﻫﺎ ﺟﻬﺖ‬

‫ﺑﻪﺻﻮرت ﻣﻨﻔﺮد از ﻫﻢ ﺟﺪا ﺷﺪﻧﺪ‪ .‬ﻛﺸﺖ ﻣﺠﺪد ﺳﻠﻮلﻫﺎي ﭘﺎﺳﺎژ داده‬

‫‪PCR‬‬

‫ﺷﺪه در وﺿﻌﻴﺖ ﺗﺮاﻛﻢ زﻳﺎد در ﻣﺤﻴﻂ ﺗﻜﺜﻴﺮي ﺗﺎزه در ﻓﻼﺳﻚﻫﺎي‬

‫‪ tgggcccagaaggttgcgatgaa‬و ‪ ،aaaggggccccagaaccaaacaca‬ژن‬

‫ﻛﺸﺖ اﻧﺠﺎم ﮔﺮدﻳﺪ‪ .‬ﻣﺮاﺣﻞ ﭘﺎﺳﺎژ ﻫﺮ ﻫﻔﺖ روز ﻳﻚ ﺑﺎر ﺗﻜﺮار ﺷﺪ‪.‬‬

‫‪ Pax3‬ﭘﺮاﻳﻤﺮﻫﺎي ‪ catccggccctgcgtcatctc‬و ‪،tggccttcttctcgctttcctctg‬‬

‫ﺗﻤﺎﻳﺰ ﺳﻠﻮل ﻋﺼﺒﻲ و ﮔﻠﻴﺎل‪ :‬ﺑﺮاي اﻳﺠﺎد ﺗﻤﺎﻳﺰ‪ ،‬ﻫﺮ ﺑﺎر اﺳﻔﻴﺮﻫﺎي‬

‫ﺑﻪﺗﺮﺗﻴﺐ زﻳﺮ اﻧﺘﺨﺎب ﺷﺪﻧﺪ‪ :‬ﺑﺮاي ژن‬

‫‪P75NTR‬‬

‫ژن ‪ Snail‬ﭘﺮاﻳﻤﺮﻫﺎي ‪ tggcctgtctgcgtgggtttttgt‬و‬

‫ﺣﺎﺻﻞ از ﭘﺎﺳﺎژ ﭘﻨﺠﻢ اﻧﺘﺨﺎب ﮔﺮدﻳﺪ‪ .‬اﺳﻔﻴﺮﻫﺎ ﭘﺲ از ﭘﻨﺞ دﻗﻴﻘﻪ‬

‫‪ tctca‬و ژن ‪ Slug‬ﭘﺮاﻳﻤﺮﻫﺎي‬

‫ﺳﺎﻧﺘﺮﻳﻔﻴﻮژ در ‪ 700g‬ﺑﻪﺻﻮرت ﻣﻜﺎﻧﻴﻜﻲ ﺑﺎ ﺗﻜﺮار ﻋﻤﻞ ﭘﻴﭙﺖ ﻛﺮدن در‬

‫‪ agtttctaatgtgtc‬اﻧﺘﺨﺎب ﺷﺪﻧﺪ‪.‬‬

‫ﭘﺮاﻳﻤﺮﻫﺎي‬

‫‪cctgggctcggggca-‬‬

‫‪ catctttggggcgagtgagtcc‬و ‪cccccgtgtg-‬‬

‫ﻣﺤﻴﻂ ﺗﻤﺎﻳﺰي از ﻳﻜﺪﻳﮕﺮ‪ ،‬ﺑﻪﺻﻮرت ﺳﻠﻮلﻫﺎي ﻣﻨﻔﺮد ﺷﻨﺎور ﺷﺪﻧﺪ‪.‬‬ ‫ﻣﺤﻴﻂ ﺗﻤﺎﻳﺰي ﺷﺎﻣﻞ‬

‫‪DMEM/F12‬‬

‫ﺑﺎ ﻧﺴﺒﺖ ﺳﻪ ﺑﻪ ﻳﻚ ﺣﺎوي‬

‫‪FCS‬‬

‫ﻳﺎﻓﺘﻪﻫﺎ‬

‫)‪ ،(10ng/ml‬ﭘﻨﻲﺳﻴﻠﻴﻦ‬

‫ﺟﺪاﺳﺎزي‪ ،‬ﻛﺸﺖ و ﺗﻌﻴﻴﻦ ﻣﺎﻫﻴﺖ ﭘﻴﺶﺳﺎزﻫﺎي ﻋﺼﺒﻲ ﻣﺸﺘﻖ از‬

‫)‪ ،(100u/ml‬ﺟﻨﺘﺎﻣﺎﻳﺴﻴﻦ )‪ (25µg/ml‬و آﻣﻔﻮﺗﺮﻳﺴﻴﻦ )‪ (1μg/ml‬ﺑﻮد‪.‬‬

‫ﭘﻮﺳﺖ‪ :‬ﭘﺲ از ﺟﺪاﺳﺎزي درم و ﻫﻀﻢ ﺑﺎﻓﺖ آن‪ ،‬ﺳﻠﻮلﻫﺎي ﺟﺪا ﺷﺪه‬

‫ﺳﭙﺲ ﺳﻠﻮلﻫﺎ ﺑﺎ ﻏﻠﻈﺖ ‪ 5×105‬ﺳﻠﻮل در ﻫﺮ ‪ cm2‬در ﻇﺮوف ﻛﺸﺖ‬

‫در ﺗﺮاﻛﻢ زﻳﺎد ﻛﺸﺖ داده ﺷﺪﻧﺪ )ﺷﻜﻞ ‪ .(1.A‬ﺳﻪ روز ﭘﺲ از ﻛﺸﺖ‬

‫ﭘﻮﺷﺶ داده ﺷﺪه ﺑﺎ ‪ poly-D-lysine‬ﻛﺸﺖ داده ﺷﺪﻧﺪ و ﻫﺮ ﻫﻔﺘﻪ ﺳﻪ‬

‫اوﻟﻴﻪ‪ ،‬ﺳﻠﻮلﻫﺎي ﻣﻨﻔﺮد ﺷﻨﺎور ﺷﺮوع ﺑﻪ ﺗﺸﻜﻴﻞ اﺳﻔﻴﺮﻫﺎي ﻣﻌﻠﻖ ﻛﺮدﻧﺪ‬

‫)‪،(%1‬‬

‫‪B27‬‬

‫ﺑﺪون ﺳﺮم )دو درﺻﺪ(‪،‬‬

‫‪NGF‬‬

‫ﺑﺎر‪ ،‬ﻧﺼﻒ ﻣﺤﻴﻂ ﻛﺸﺖ ﺑﺎ ﻣﺤﻴﻂ ﺗﻤﺎﻳﺰي ﺗﺎزه ﺗﻌﻮﻳﺾ ﮔﺮدﻳﺪ‪.‬‬

‫‪4‬‬

‫)ﺷﻜﻞ ‪ .(1.B‬در روز ﻫﻔﺘﻢ اﺳﻔﻴﺮﻫﺎ ﻛﺎﻣﻼً ﺑﺰرگ ﺷﺪﻧﺪ )ﺷﻜﻞ ‪ (1.C‬و‬

‫اﻳﻤﻮﻧﻮﺳﻴﺘﻮﺷﻴﻤﻲ )‪ :Immuno Cytochemistry (ICC‬ﺳﻠﻮلﻫﺎي ﻣﻮرد‬

‫ﺑﺮﺧﻲ از اﺳﻔﻴﺮﻫﺎ ﻧﻴﺰ ﺑﻪ ﻳﻜﺪﻳﮕﺮ ﻣﺘﺼﻞ ﺷﺪﻧﺪ‪ .‬ﺑﻼﻓﺎﺻﻠﻪ در روز اول‬

‫ﻧﻈﺮ ﺟﻬﺖ رﻧﮓآﻣﻴﺰي ‪ ICC‬در ﭘﻠﻴﺖﻫﺎي ‪ 96‬ﺧﺎﻧﻪ ﻛﺸﺖ داده ﺷﺪﻧﺪ و‬

‫ﭘﺲ از ﻫﺮ ﭘﺎﺳﺎژ‪ ،‬اﺳﻔﻴﺮﻫﺎي ﺟﺪﻳﺪ ﺗﺸﻜﻴﻞ ﺷﺪﻧﺪ و ﺑﺎ ﺳﺮﻋﺖ ﺑﻴﺸﺘﺮي‬

‫ﻫﺮ ﺑﺎر در روزﻫﺎي ﻣﻮرد ﻧﻈﺮ ﺑﺎ ﭘﺎراﻓﺮﻣﺎﻟﺪﻳﻴﺪ ‪ %4‬ﺑﻪﻣﺪت ‪ 20‬دﻗﻴﻘﻪ در‬

‫ﺷﺮوع ﺑﻪ رﺷﺪ ﻛﺮدﻧﺪ‪ .‬ﺑﺎ ﺗﻜﺮار ﭘﺎﺳﺎژﻫﺎ ﻫﺮ ﺑﺎر اﻧﺪازه اﺳﻔﻴﺮﻫﺎ ﻧﺴﺒﺖ ﺑﻪ‬

‫‪0/1‬‬

‫ﭘﺎﺳﺎژﻫﺎي ﻗﺒﻠﻲ ﺑﺰرﮔﺘﺮ ﺷﺪ ﺑﻪ ﻃﻮريﻛﻪ از ﭘﺎﺳﺎژ ﭘﻨﺠﻢ )ﺷﻜﻞ ‪ (1.D‬ﺑﻪ‬

‫درﺻﺪ در دﻣﺎي اﺗﺎق ﺑﻪﻣﺪت ‪ 15‬دﻗﻴﻘﻪ اﻧﺠﺎم ﺷﺪ‪ .‬ﺑﺮاي ﺟﻠﻮﮔﻴﺮي از‬

‫ﺑﻌﺪ اﺳﻔﻴﺮﻫﺎ ﺑﻪدﻟﻴﻞ ﺑﺰرﮔﻲ و ﺳﻨﮕﻴﻨﻲ ﺗﻤﺎﻳﻞ ﺑﻪ ﭼﺴﺒﻴﺪن ﺑﻪ ﻛﻒ ﻇﺮف‬

‫اﺗﺼﺎﻻت ﻏﻴﺮاﺧﺘﺼﺎﺻﻲ‪ ،‬ﻧﻤﻮﻧﻪﻫﺎ ﺑﻪﻣﺪت ﻳﻚ ﺳﺎﻋﺖ در دﻣﺎي اﺗﺎق ﺑﺎ‬

‫ﻛﺸﺖ را ﻧﺸﺎن دادﻧﺪ‪ .‬در اﻳﻦ ﻣﻄﺎﻟﻌﻪ ﻣﺎ ﻣﻮﻓﻖ ﺷﺪﻳﻢ اﺳﻔﻴﺮﻫﺎ را ﺑﻪ‬

‫‪ 0/1‬درﺻﺪ ﺑﻠﻮﻛﻪ ﺷﺪﻧﺪ‪ .‬ﺳﭙﺲ ﻧﻤﻮﻧﻪﻫﺎ‬

‫ﻣﺪت ﺣﺪود ﭼﻬﺎر ﻣﺎه )ﺗﻘﺮﻳﺒﺎً ﻣﻌﺎدل ‪ 10‬ﭘﺎﺳﺎژ ﻣﺘﻮاﻟﻲ( در ﻣﺤﻴﻂ ﻛﺸﺖ‬

‫ﺑﺎ اﻓﺰودن آﻧﺘﻲﺑﺎدي اوﻟﻴﻪ در ‪ 4 °C‬ﺷﺒﺎﻧﻪ آﻧﻜﻮﺑﻪ ﺷﺪﻧﺪ‪ .‬آﻧﺘﻲﺑﺎديﻫﺎي‬

‫ﮔﺴﺘﺮش دﻫﻴﻢ‪ .‬ﺑﺮرﺳﻲ‬

‫اﺳﻔﻴﺮﻫﺎ ﻧﺸﺎن داد ﻛﻪ ‪SKP‬ﻫﺎي اﻧﺴﺎﻧﻲ‬

‫اوﻟﻴﻪ ﻣﻮرد اﺳﺘﻔﺎده ﻋﺒﺎرت ﺑﻮدﻧﺪ از‪ :‬آﻧﺘﻲ ﻧﺴﺘﻴﻦ‪ ،‬آﻧﺘﻲ وﻳﻤﻨﺘﻴﻦ‪ ،‬آﻧﺘﻲ‬

‫ﺑﻪدﺳﺖ آﻣﺪه ﻧﺴﺘﻴﻦ )ﻣﺎرﻛﺮي ﻛﻪ در ﺳﻠﻮلﻫﺎي ﺑﻨﻴﺎدي ﻋﺼﺒﻲ ﺑﻴﺎن‬

‫ﻓﻴﺒﺮوﻧﻜﺘﻴﻦ‪ ،‬آﻧﺘﻲ ﻧﻮروﻓﻴﻼﻣﻨﺖ ‪ ،M‬آﻧﺘﻲ ﭘﺮوﺗﻴﻴﻦ اﺳﻴﺪ رﺷﺘﻪاي ﮔﻠﻴﺎل‪،‬‬

‫ﻣﻲﺷﻮد( )ﺷﻜﻞ ‪ (2.A‬وﻳﻤﻨﺘﻴﻦ )ﺷﻜﻞ ‪ (2.B‬و ﻓﻴﺒﺮوﻧﻜﺘﻴﻦ )ﺷﻜﻞ ‪(2.C‬‬

‫ﺗﻮﺑﻮﻟﻴﻦ‪ ،‬آﻧﺘﻲ‬

‫‪S100‬‬

‫و آﻧﺘﻲ اﻛﺘﻴﻦ ﻋﻀﻠﻪ ﺻﺎف‪ .‬آﻧﺘﻲﺑﺎدي‬

‫ﻣﺜﺒﺖ ﻫﺴﺘﻨﺪ‪ .‬ﺑﻴﺎن ﻫﻤﺰﻣﺎن اﻳﻦ ﺳﻪ ﻣﺎرﻛﺮ ﺑﻪﻋﻨﻮان وﺟﻪ ﺗﻤﺎﻳﺰ ‪SKP‬ﻫﺎ از‬

‫ﺛﺎﻧﻮﻳﻪ ﻣﻨﺎﺳﺐ ﻛﻮﻧﮋوﮔﻪ ﺑﺎ‬

‫‪FITC‬‬

‫ﺑﻪﻣﺪت ﻳﻚ ﺳﺎﻋﺖ در دﻣﺎي اﺗﺎق ﺑﻪ‬

‫ﺳﺎﻳﺮ ﺳﻠﻮلﻫﺎي ﺑﻨﻴﺎدي ﻣﻮﺟﻮد در ﭘﻮﺳﺖ ﻣﺤﺴﻮب ﻣﻲﺷﻮد‪ .‬در اﻳﻦ‬

‫ﭼﺎﻫﻚﻫﺎ اﺿﺎﻓﻪ ﺷﺪ‪ .‬ﻛﻨﺘﺮل ﻣﻨﻔﻲ ﺑﺎ ﺣﺬف آﻧﺘﻲﺑﺎدي اوﻟﻴﻪ اﻧﺠﺎم ﺷﺪ‪.‬‬

‫ﻣﻄﺎﻟﻌﻪ ﭼﻨﺪ ﻓﺎﻛﺘﻮر روﻧﻮﻳﺴﻲ ﺷﻨﺎﺧﺘﻪ ﺷﺪه ﻛﻪ ﺑﻴﺎن آنﻫﺎ در ‪SKP‬ﻫﺎ‬

‫ﺟﻬﺖ رﻧﮓآﻣﻴﺰي ﻫﺴﺘﻪ ﺗﻤﺎم ﺳﻠﻮلﻫﺎ از ﻣﻌﺮف ﻫﻮﺧﺴﺖ ‪33258‬‬

‫ﮔﺰارش ﺷﺪه ﺑﻮد‪ ،‬اﻧﺘﺨﺎب ﮔﺮدﻳﺪﻧﺪ‪ .‬اﻳﻦ ﻓﺎﻛﺘﻮرﻫﺎي روﻧﻮﻳﺴﻲ ﻫﻤﺮاه‬

‫اﺳﺘﻔﺎده ﺷﺪ‪ .‬ﻫﺮ آزﻣﻮن ﺣﺪاﻗﻞ ﺳﻪ ﺑﺎر ﺗﻜﺮار ﮔﺮدﻳﺪ‪ .‬آﻧﺘﻲژنﻫﺎي ﺳﻄﺢ‬

‫ﺑﺎ ﺳﻠﻮلﻫﺎي ﺑﻨﻴﺎدي ﺳﺘﻴﻎ ﻋﺼﺒﻲ ﺟﻨﻴﻨﻲ ﺑﻮده و در ﺑﺮﺧﻲ از ﻣﺸﺘﻘﺎت‬

‫ﺳﻠﻮل ﺑﺎ اﺳﺘﻔﺎده از ﻧﺮماﻓﺰار ‪ SPSS‬وﻳﺮاﺳﺖ ‪ ،13‬اﻧﺠﺎم ﺷﺪ‪.‬‬

‫ﺟﻨﻴﻨﻲ در ﺣﺎل ﺗﻜﺎﻣﻞ آنﻫﺎ دﻳﺪه ﻣﻲﺷﻮﻧﺪ‪ .‬ﻧﺘﺎﻳﺞ ‪ RT-PCR‬ﻧﺸﺎن داد ﻛﻪ‬

‫دﻣﺎي اﺗﺎق ﻓﻴﻜﺲ ﺷﺪﻧﺪ‪ .‬ﻧﻔﻮذﭘﺬﻳﺮي ﺑﺎ اﺳﺘﻔﺎده از ﺗﺮﻳﺘﻮن‬

‫ﺳﺮم ﺑﺰ ﺷﺶ درﺻﺪ و‬

‫آﻧﺘﻲ‬

‫ﺑﺘﺎ‪III-‬‬

‫‪BSA‬‬

‫‪X-100‬‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬

‫‪ICC‬‬


‫ﻣﻴﺘﺮا ﺑﺨﺘﻴﺎري و ﻫﻤﻜﺎران‬

‫‪511‬‬

‫ﺷﻜﻞ‪ :1-‬ﻣﺮاﺣﻞ ﻛﺸﺖ اوﻟﻴﻪ و ﺗﻤﺎﻳﺰ ‪SKP‬ﻫﺎ‪ -A :‬ﺳﻮﺳﭙﺎﻧﺴﻴﻮن ﺳﻠﻮﻟﻲ ﻛﺸﺖ داده‬ ‫ﺷﺪه‪ ،‬ﺑﻼﻓﺎﺻﻠﻪ ﭘﺲ از ﻫﻀﻢ ﺑﺎﻓﺖ درم‪ -B ،‬ﺳﻪ روز ﭘﺲ از ﻛﺸﺖ اوﻟﻴﻪ‪ ،‬ﻇﺎﻫﺮ ﺷﺪن‬ ‫اﺳﻔﻴﺮﻫﺎي ﻛﻮﭼﻚ‪ -C ،‬روز ﻫﻔﺘﻢ ﭘﺲ از ﻛﺸﺖ اوﻟﻴﻪ‪ ،‬اﺳﻔﻴﺮﻫﺎ ﺑﺰرگﺗﺮ ﺷﺪه و ﺑﻌﻀﻲ‬ ‫از اﺳﻔﻴﺮﻫﺎي ﻛﻮﭼﻚ ﺑﻪ ﻳﻜﺪﻳﮕﺮ ﭼﺴﺒﻴﺪهاﻧﺪ‪ .‬ﭘﺎﺳﺎژ ﺳﻠﻮﻟﻲ در اﻳﻦ ﻣﺮﺣﻠﻪ اﻧﺠﺎم ﺷﺪ‪.‬‬ ‫‪ -D‬روز ﻫﻔﺘﻢ ﭘﺲ از ﭘﺎﺳﺎژ ﭘﻨﺠﻢ‪ ،‬اﺳﻔﻴﺮﻫﺎ ﺑﺰرگﺗﺮ و ﺳﻨﮕﻴﻦ ﺷﺪه و ﺗﻤﺎﻳﻞ ﺑﻪ‬ ‫ﭼﺴﺒﻴﺪن ﺑﻪ ﻛﻒ ﻇﺮف دارﻧﺪ‪ -E .‬روز ﻫﻔﺘﻢ ﭘﺲ از ﺗﻤﺎﻳﺰ و ‪ -F‬روز ﭼﻬﺎردﻫﻢ ﭘﺲ از‬ ‫ﺗﻤﺎﻳﺰ‪ .‬ﺗﻌﺪاد زﻳﺎدي از ﺳﻠﻮلﻫﺎي ﺗﻤﺎﻳﺰﻳﺎﻓﺘﻪ زواﻳﺪ ﺳﻴﺘﻮﭘﻼﺳﻤﻲ ﻛﺸﻴﺪه ﺳﻠﻮلﻫﺎي‬ ‫ﻋﺼﺒﻲ را دارا ﻣﻲﺑﺎﺷﻨﺪ‪) .‬دورﺑﻴﻦ‬

‫‪ELWD‬‬

‫‪ ،Nikon‬ﻣﻴﻜﺮوﺳﻜﻮپ‬

‫‪TS100‬‬

‫‪،Nikon‬‬

‫ﺷﻜﻞ‪ :2-‬ﺑﺮرﺳﻲ ‪SKP‬ﻫﺎ ﺑﺎ ‪ ICC‬و ﺳﻠﻮلﻫﺎي ﺗﻤﺎﻳﺰ ﻳﺎﻓﺘﻪ‪ -A .‬ﺑﻴﺎن ﻣﺎرﻛﺮ ﻧﺴﺘﻴﻦ در‬ ‫اﺳﻔﻴﺮﻫﺎ‪ -B .‬ﺑﻴﺎن ﻣﺎرﻛﺮ وﻳﻤﻨﺘﻴﻦ در اﺳﻔﻴﺮﻫﺎ‪ -C .‬ﺑﻴﺎن ﻣﺎرﻛﺮ ﻓﻴﺒﺮوﻧﻜﺘﻴﻦ در اﺳﻔﻴﺮﻫﺎ‪.‬‬

‫ﺑﺰرﮔﻨﻤﺎﻳﻲ ﻋﻜﺲﻫﺎي ‪ A,B,E‬و ‪ C ،20 ،F‬و ‪ D‬ﺑﺰرﮔﻨﻤﺎﻳﻲ ‪.(40‬‬

‫‪ -D‬ﺳﻠﻮل ﺑﺘﺎ‪ III-‬ﺗﻮﺑﻮﻟﻴﻦ ﻣﺜﺒﺖ ‪ 14‬روز ﭘﺲ از ﺗﻤﺎﻳﺰ ‪ -E‬ﺑﻴﺎن آﻧﺘﻲﺑﺎدي ﻧﻮروﻓﻴﻼﻣﻨﺖ‬ ‫‪ M‬در ﻧﻮرون ﺗﻤﺎﻳﺰ ﻳﺎﻓﺘﻪ در روز ‪ 14‬ﭘﺲ از ﺗﻤﺎﻳﺰ ‪ -F‬ﺳﻠﻮل ‪ GFAP‬ﻣﺜﺒﺖ ﺗﻤﺎﻳﺰ ﻳﺎﻓﺘﻪ‬

‫در ﺳﻠﻮلﻫﺎي‬

‫‪SKP‬‬

‫ﺑﻪدﺳﺖ آﻣﺪه از ﻓﻮر اﺳﻜﻴﻦ اﻧﺴﺎﻧﻲ ﻫﺮ ﭼﻬﺎر‬

‫ﻓﺎﻛﺘﻮر روﻧﻮﻳﺴﻲ ﻣﻮرد ﻣﻄﺎﻟﻌﻪ ﻣﺮﺑﻮط ﺑﻪ ژنﻫﺎي‬

‫‪Snail, Pax3, Slug,‬‬

‫ﺑﺮرﺳﻲ‬

‫آﻧﺘﻲﺑﺎدي‬

‫‪SMA‬‬

‫در ﺳﻠﻮل ﻋﻀﻠﻪ ﺻﺎف ﺗﻤﺎﻳﺰ ﻳﺎﻓﺘﻪ ﺑﺎ روش آﻧﺰﻳﻢ ﭘﺮاﻛﺴﻴﺪاز و دي‬

‫آﻣﻴﻨﻮﺑﻨﺰﻳﺪﻳﻦ‪ ،‬رﻧﮓآﻣﻴﺰي ﻫﺴﺘﻪﻫﺎي ﺳﻠﻮﻟﻲ‪ :‬ﻫﻤﺎﺗﻮﻛﺴﻴﻠﻴﻦ‪) .‬دورﺑﻴﻦ ‪،Nikon ELWD‬‬

‫‪ P75NTR‬ﺑﻴﺎن ﺷﺪﻧﺪ )ﺷﻜﻞ ‪.(3‬‬ ‫‪ICC‬‬

‫رﻧﮓآﻣﻴﺰي‪ -G .‬ﺑﻴﺎن آﻧﺘﻲﺑﺎدي‬

‫‪S100‬‬

‫در ﺳﻠﻮلﻫﺎي ﮔﻠﻴﺎل ﺗﻤﺎﻳﺰ ﻳﺎﻓﺘﻪ‪ -H .‬ﺑﻴﺎن‬

‫ﺳﻠﻮلﻫﺎي ﺗﻤﺎﻳﺰ ﻳﺎﻓﺘﻪ‪ :‬ﺟﻬﺖ ﺑﺮرﺳﻲ‬

‫‪ICC‬‬

‫ﺳﻠﻮلﻫﺎي‬

‫ﻣﻴﻜﺮوﺳﻜﻮپ ‪.(40 ،Nikon TS100‬‬

‫ﺗﻤﺎﻳﺰ ﻳﺎﻓﺘﻪ‪ ،‬اﺑﺘﺪا ﺳﻠﻮلﻫﺎي ﻣﻨﻔﺮد ﺣﺎﺻﻞ از ﻫﻢﮔﺴﻴﺨﺘﮕﻲ اﺳﻔﻴﺮﻫﺎ در‬ ‫ﻣﺤﻴﻂ ﺗﻤﺎﻳﺰي اﺧﺘﺼﺎﺻﻲ ﻛﺸﺖ داده ﺷﺪﻧﺪ‪ .‬ﺳﭙﺲ در ﻣﻘﺎﻃﻊ زﻣﺎﻧﻲ‬ ‫ﻣﺘﻔﺎوت‪ ،‬ﺳﻠﻮلﻫﺎ ﻓﻴﻜﺲ ﺷﺪه و ﻣﺮاﺣﻞ‬

‫‪ICC‬‬

‫اﻧﺠﺎم ﮔﺮدﻳﺪ‪ .‬ﺗﺎ ﭼﻬﺎر‬

‫روز ﭘﺲ از ﺗﻤﺎﻳﺰ‪ ،‬ﺳﻠﻮلﻫﺎي ﻣﻨﻔﺮد ﻫﻤﮕﻲ داراي ﻣﺎرﻛﺮ ﻧﺴﺘﻴﻦ ﺑﻮدﻧﺪ‪.‬‬ ‫از روز ﭼﻬﺎرم ﺑﺮﺧﻲ از ﺳﻠﻮلﻫﺎي‬

‫ﺑﺘﺎ‪III-‬‬

‫ﺗﻮﺑﻮﻟﻴﻦ ﻣﺜﺒﺖ )ﻣﺎرﻛﺮ‬

‫ﻣﺨﺼﻮص ﺳﻠﻮل ﻋﺼﺒﻲ ﻧﻮزاد( ﻧﻴﺰ دﻳﺪه ﺷﺪﻧﺪ‪ .‬در روز ﻫﻔﺘﻢ ﺗﻤﺎﻳﺰ‪،‬‬ ‫اﻛـﺜﺮ ﺳﻠﻮلﻫﺎ ﺑﺘﺎ‪ III-‬ﺗﻮﺑﻮﻟﻴﻦ ﻣﺜﺒﺖ ﺑـﻮدﻧﺪ و ﺗﻌـﺪاد ﺳﻠﻮلﻫﺎي ﻧﺴﺘﻴﻦ‬

‫ﺷﻜﻞ‪ :3-‬ﺑﻴﺎن ژنﻫﺎ ﺑﺎ روش ‪ RT-PCR‬ﺳﻠﻮلﻫﺎي ‪ SKP‬اﻧﺴﺎﻧﻲ‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬


‫‪512‬‬

‫ﺟﺪاﺳﺎزي ﺳﻠﻮلﻫﺎي ﭘﻴﺶﺳﺎز ﻣﺸﺘﻖ از ﻓﻮراﺳﻜﻴﻦ اﻧﺴﺎﻧﻲ و ﺗﻤﺎﻳﺰ آنﻫﺎ ﺑﻪ ﻧﻮرون و ﺳﻠﻮل ﮔﻠﻴﺎل‬

‫ﻣﺜﺒﺖ ﻛﺎﻫﺶ ﻳﺎﻓﺘﻨﺪ‪ .‬اﻳﻦ روﻧﺪ ﺗﺎ روز ‪ 14‬ﺗﻤﺎﻳﺰ ﺳﻠﻮلﻫﺎي ﻋﺼﺒﻲ اداﻣﻪ‬

‫ﻫﻤﭽﻨﻴﻦ ﻛﺎﻫﺶ واﺑﺴﺘﻪ ﺑﻪ ﺳﻦ ‪SKP‬ﻫﺎي اﻧﺴﺎﻧﻲ ﮔﺰارش ﺷﺪه ﺑﻮد‪ ،‬ﻟﺬا‬

‫ﺗﻮﺑﻮﻟﻴﻦ ﻣﺜﺒﺖ‬

‫ﻣﺎ در اﻳﻦ ﻣﻄﺎﻟﻌﻪ از ﺑﺎﻓﺖ ﻓﻮر اﺳﻜﻴﻦ اﻧﺴﺎﻧﻲ ﺣﺎﺻﻞ از ﺟﺮاﺣﻲ‬

‫از روز ﻫﻔﺘﻢ‬

‫داوﻃﻠﺒﺎﻧﻪ ﺧﺘﻨﻪ در ﻣﺤﺪودة ﺳﻨﻲ ‪ 1-12‬ﻣﺎﻫﻪ اﺳﺘﻔﺎده ﻧﻤﻮدﻳﻢ‪ .‬اﻳﻦ‬

‫ﺗﻤﺎﻳﺰ ﺷﺮوع ﺷﺪ و ﺗﺎ روز ‪ 14‬اﻓﺰاﻳﺶ ﻳﺎﻓﺖ )ﺷﻜﻞ ‪ .(2.E‬در واﻗﻊ از‬

‫ﻣﻄﺎﻟﻌﻪ ﻧﺸﺎن داد ﻛﻪ ‪SKP‬ﻫﺎ را ﻣﻲﺗﻮان ﺑﻪﺻﻮرت روﺗﻴﻦ از ﻗﻄﻌﺎت‬

‫ﺗﻮﺑﻮﻟﻴﻦ و‬

‫ﻛﻮﭼﻚ ﻓﻮر اﺳﻜﻴﻦ اﻧﺴﺎﻧﻲ ﺟﺪا ﻧﻤﻮده و در ﻣﺤﻴﻂ آزﻣﺎﻳﺸﮕﺎه ﺑﺮاي‬

‫ﻛﻪ ﻣﺎرﻛﺮﻫﺎي ﻣﺮﺑﻮط ﺑﻪ ﺳﻠﻮلﻫﺎي ﻋﺼﺒﻲ ﻫﺴﺘﻨﺪ‪،‬‬

‫ﻣﺪت ﭼﻨﺪﻳﻦ ﻣﺎه ﻛﺸﺖ داد‪ .‬ﻫﻤﭽﻨﻴﻦ ‪SKP‬ﻫﺎي اﻧﺴﺎﻧﻲ ﺑﻪدﺳﺖ آﻣﺪه‬

‫در ﺳﻠﻮلﻫﺎي ﺗﻤﺎﻳﺰ ﻳﺎﻓﺘﻪ ﺑﻪﻣﻴﺰان زﻳﺎدي ﺑﻴﺎن ﺷﺪﻧﺪ‪ .‬ﺿﻤﻦ اﻳﻦﻛﻪ اﻳﻦ‬

‫ﺗﻮاﻧﺎﻳﻲ ﺗﻤﺎﻳﺰ ﺑﻪ دو ردة ﻋﺼﺒﻲ و ﻣﺰودرﻣﻲ را دارﻧﺪ‪ .‬اﻳﻦ ﻣﻮﺿﻮع ﻣﻮﻳﺪ‬

‫ﺳﻠﻮلﻫﺎ ﻣﻮرﻓﻮﻟﻮژي ﻛﻤﭙﻠﻜﺲ ﻣﺮﺑﻮط ﺑﻪ ﻧﻮرونﻫﺎ را ﻧﻴﺰ داﺷﺘﻨﺪ‪.‬‬

‫ﻣﻨﺸﺎ ﺳﺘﻴﻎ ﻋﺼﺒﻲ اﻳﻦ ﺳﻠﻮلﻫﺎ ﻣﻲﺑﺎﺷﺪ‪ Toma .‬ﺟﺪاﺳﺎزي ﺳﻠﻮلﻫﺎي‬

‫ﺑﻪﻣﻨﻈﻮر ﺗﺨﻤﻴﻦ درﺻﺪ ﺳﻠﻮلﻫﺎﻳﻲ ﻛﻪ ﺑﻪ ﻧﻮرون ﺗﻤﺎﻳﺰ ﻳﺎﻓﺘﻪاﻧﺪ در ﻫﺮ‬

‫‪ SKP‬را از ﭘﻮﺳﺖ ﺟﻮﻧﺪﮔﺎن ﻧﻮﺟﻮان و ﺑﺰرﮔﺴﺎل و از ﭘﻮﺳﺖ اﺳﻜﺎﻟﭗ‬

‫ﻧﻤﻮﻧﻪ ﺑﻴﻮﻟﻮژﻳﻚ در روز ‪ 14‬ﭘﺲ از ﺗﻤﺎﻳﺰ ﻣﺤﺪودهﻫﺎﻳﻲ ﺑﻪﻃﻮر‬

‫اﻧﺴﺎن ﺑﺰرﮔﺴﺎل ﮔﺰارش ﻛﺮد‪ .‬اﻳﻦ ﺳﻠﻮلﻫﺎ از درم اﺳﺘﺨﺮاج ﺷﺪﻧﺪ و‬

‫ﺗﺼﺎدﻓﻲ )در ﻫﺮ ﻧﻤﻮﻧﻪ ﺳﻪ ﺗﻜﺮار( اﻧﺘﺨﺎب ﺷﺪ‪ .‬ﺳﭙﺲ ﺗﻌﺪاد ﺳﻠﻮلﻫﺎﻳﻲ‬

‫ﺑﻪﺻﻮرت ﺳﻠﻮلﻫﺎي ﻣﺠﺰاﻳﻲ ﻛﻪ ﺗﻮاﻧﺎﻳﻲ ﺗﻜﺜﻴﺮ و ﺗﻤﺎﻳﺰ را در ﻣﺤﻴﻂ‬

‫ﻛﻪ ﺑﺘﺎ‪ III-‬ﺗﻮﺑﻮﻟﻴﻦ ﻣﺜﺒﺖ ﻳﺎ ﻧﻮروﻓﻴﻼﻣﻨﺖ‪ M -‬ﻣﺜﺒﺖ ﺑﻮدﻧﺪ ﺑﻪ ﺗﻌﺪاد ﻛﻞ‬

‫ﻛﺸﺖ داﺷﺘﻨﺪ ﻛﻠﻮن ﺷﺪﻧﺪ و ﭘﺲ از ﺗﻤﺎﻳﺰ ﺗﻮاﻧﺴﺘﻨﺪ ﻧﻮرون‪ ،‬ﺳﻠﻮل‬

‫ﺳﻠﻮلﻫﺎي ﻣﻮﺟﻮد )از ﻃﺮﻳﻖ ﺷﻤﺎرش ﻫﺴﺘﻪﻫﺎي رﻧﮓ ﺷﺪه ﺑﺎ‬

‫ﮔﻠﻴﺎل‪ ،‬ﺳﻠﻮل ﻋﻀﻠﺔ ﺻﺎف و ﺳﻠﻮل ﭼﺮﺑﻲ را اﻳﺠﺎد ﻧﻤﺎﻳﻨﺪ‪ .‬ﻫﻤﭽﻨﻴﻦ در‬

‫ﻫﻮﺧﺴﺖ( ﻣﺤﺎﺳﺒﻪ ﮔﺮدﻳﺪ‪ .‬ﻣﻴﺎﻧﮕﻴﻦ ﺑﻪدﺳﺖ آﻣﺪه ‪ %0/6±17/7‬ﻧﺸﺎن‬

‫اﻳﻦ ﺗﺤﻘﻴﻖ ﺳﻪ ﺑﺨﺶ از ﭘﻮﺳﺖ ﻛﻪ اﺣﺘﻤﺎل ﻣﻲرﻓﺖ ﺣﺎوي ‪ SKP‬ﺑﺎﺷﻨﺪ‬

‫دﻫﻨﺪة درﺻﺪ ﺗﻤﺎﻳﺰ ﻧﻮرونﻫﺎ ﺑﻮد‪ .‬ﺗﺤﺖ ﻫﻤﻴﻦ ﺷﺮاﻳﻂ ﺗﻤﺎﻳﺰي ﺑﻴﺎن‬

‫ﺷﺎﻣﻞ درم‪ ،‬اﭘﻲ درم و اﻧﺘﻬﺎي ﻋﺼﺐ ﺑﺮرﺳﻲ ﺷﺪ‪ .‬ﭘﺲ از اﻧﺠﺎم ﻛﺸﺖ‬

‫داﺷﺖ ﺑﻪ ﻃﻮريﻛﻪ در روز ‪ 14‬ﻓﻘﻂ ﺳﻠﻮلﻫﺎي‬

‫ﺑﺘﺎ‪III-‬‬

‫دﻳﺪه ﺷﺪﻧﺪ )ﺷﻜﻞ ‪ .(2.D‬ﺑﻴﺎن ﻣﺎرﻛﺮ ﻧﻮروﻓﻴﻼﻣﻨﺖ‪-‬‬ ‫روز ﻫﻔﺘﻢ ﺗﺎ ‪ 14‬ﭘﺲ از ﺗﻤﺎﻳﺰ ﻫﺮ دو ﻣﺎرﻛﺮ‬ ‫ﻧﻮروﻓﻴﻼﻣﻨﺖ‪-‬‬

‫‪M‬‬

‫ﻣﺎرﻛﺮﻫﺎي ﭘﺮوﺗﻴﻴﻦ اﺳﻴﺪ رﺷﺘﻪاي ﮔﻠﻴﺎل و‬

‫‪S100‬‬

‫‪M‬‬

‫ﺑﺘﺎ‪III-‬‬

‫ﻧﻴﺰ ﻛﻪ در ﺳﻠﻮلﻫﺎي‬

‫ﺗﺤﺖ ﻫﻤﺎن ﺷﺮاﻳﻄﻲ ﻛﻪ ﺑﺮاي‬

‫‪SKP‬‬

‫ذﻛﺮ ﺷﺪ‪ ،‬ﻓﻘﻂ درم اﺳﻔﻴﺮ ﺗﻮﻟﻴﺪ‬

‫ﮔﻠﻴﺎل ﺑﻴﺎن ﻣﻲﺷﻮﻧﺪ‪ ،‬ﺑﺮرﺳﻲ ﺷﺪ‪ .‬ﺗﻌﺪادي از ﺳﻠﻮلﻫﺎي ﺗﻤﺎﻳﺰ ﻳﺎﻓﺘﻪ ﺑﺎ‬

‫ﻛﺮد‪ ،‬از اﭘﻲ درم ﺳﻠﻮل زﻧﺪه ﺑﻪدﺳﺖ ﻧﻴﺎﻣﺪ و ﻋﺼﺐ ﺳﻴﺎﺗﻴﻚ ﻳﻚ‬

‫ﻣﻮرﻓﻮﻟﻮژي ﺳﻠﻮلﻫﺎي دوﻗﻄﺒﻲ‪ ،‬واﺟﺪ ﻣﺎرﻛﺮﻫﺎي ﭘﺮوﺗﻴﻴﻦ اﺳﻴﺪ‬

‫ﺟﻤﻌﻴﺖ ﻫﺘﺮوژن ﻛﻮﭼﻚ از ﺳﻠﻮلﻫﺎﻳﻲ ﻛﻪ ﺗﻜﺜﻴﺮ ﻧﺪاﺷﺘﻨﺪ اﻳﺠﺎد ﻧﻤﻮد‪.‬‬

‫‪1‬‬

‫رﺷﺘﻪاي ﮔﻠﻴﺎل )ﻣﺮﺑﻮط ﺑﻪ ﺳﻠﻮل ﺷﻮان و آﺳﺘﺮوﺳﻴﺖ( )ﺷﻜﻞ ‪ (2.F‬و‬

‫در اﻳﻦ ﻣﻄﺎﻟﻌﻪ ﻧﺘﺎﻳﺞ ﻣﺸﺎﺑﻪ ﺑﻪدﺳﺖ آﻣﺪ ﺑﻪ اﻳﻦ ﺗﺮﺗﻴﺐ ﻛﻪ ﭘﺲ از ﻫﻀﻢ‬

‫‪) S100‬در ﺳﻠﻮلﻫﺎي ﮔﻠﻴﺎل ﻣﻴﻠﻴﻦ ﺳﺎز ﺷﺎﻣﻞ اﻟﻴﮕﻮدﻧﺪروﺳﻴﺖ و ﺳﻠﻮل‬

‫آﻧﺰﻳﻤﻲ درم‪ ،‬ﺳﻠﻮلﻫﺎي ﺷﻨﺎور اﺳﻔﻴﺮﻫﺎ را ﺗﺸﻜﻴﻞ دادﻧﺪ ﻛﻪ ﺑﻌﺪ از‬

‫ﺷﻮان( )ﺷﻜﻞ ‪ (2.G‬ﺑﻮدﻧﺪ‪ .‬ﺑﺮاي ﺗﺨﻤﻴﻦ درﺻﺪ ﺳﻠﻮلﻫﺎي ﺗﻤﺎﻳﺰ ﻳﺎﻓﺘﻪ‬

‫ﭘﺎﺳﺎژ اول ﺑﻪﻃﻮر ﻓﻌﺎل ﺗﻜﺜﻴﺮ ﭘﻴﺪا ﻛﺮدﻧﺪ‪ .‬ﺑﺎ اﻓﺰاﻳﺶ ﺗﻌﺪاد ﭘﺎﺳﺎژﻫﺎ‪،‬‬

‫ﻣﺜﺒﺖ ﻳﺎ‬

‫اﻧﺪازة اﺳﻔﻴﺮﻫﺎ اﻓﺰاﻳﺶ ﻳﺎﻓﺖ ﺿﻤﻦ اﻳﻦﻛﻪ ﺳﺮﻋﺖ ﺗﻜﺜﻴﺮ ﻛﺎﻫﺶ ﭘﻴﺪا‬

‫ﻣﺜﺒﺖ ﻧﺴﺒﺖ ﺑﻪ ﺗﻌﺪاد ﻛﻞ ﺳﻠﻮلﻫﺎ ﻣﺤﺎﺳﺒﻪ ﺷﺪ و ﻣﻴﺎﻧﮕﻴﻦ‬

‫ﻛﺮد‪ .‬ﺑﻪﻧﻈﺮ ﻣﻲرﺳﺪ دﻟﻴﻞ اﻳﻦ ﻛﺎﻫﺶ‪ ،‬ﻛﻢ ﺷﺪن رﺷﺪ ﺳﻠﻮﻟﻲ در ﻣﺮﻛﺰ‬

‫‪ 23±0/3‬درﺻﺪ ﺗﻤﺎﻳﺰ ﺑﻪ ﺳﻠﻮلﻫﺎي ﮔﻠﻴﺎل ﺑﻪدﺳﺖ آﻣﺪ‪ .‬ﺑﺎ ﺗﻮﺟﻪ ﺑﻪ‬

‫اﺳﻔﻴﺮﻫﺎ ﺑﻪدﻧﺒﺎل ﻛﺎﻫﺶ اﻧﺘﺸﺎر اﻛﺴﻴﮋن و ﻣﻮاد ﻏﺬاﻳﻲ ﺑﺎﺷﺪ‪ .‬در اﻳﻦ‬

‫ﺑﻪ ردة ﻣﺰودرﻣﻲ از ﺟﻤﻠﻪ ﺳﻠﻮل ﻋﻀﻠﺔ‬

‫ﻣﻄﺎﻟﻌﻪ زﻣﺎﻧﻲﻛﻪ ﺳﻠﻮلﻫﺎي ﭘﻴﺶﺳﺎز ﻋﺼﺒﻲ در ﺷﺮاﻳﻂ ﺗﻤﺎﻳﺰي ﻗﺮار‬

‫ﺻﺎف‪ ،‬ﺑﻴﺎن آﻧﺘﻲژن اﻛﺘﻴﻦ ﻋﻀﻠﺔ ﺻﺎف ﻧﻴﺰ ﺑﺮرﺳﻲ و ﺟﻤﻌﻴﺖ ﻛﻮﭼﻜﻲ‬

‫داده ﺷﺪﻧﺪ‪ ،‬اﻟﮕﻮي ﺑﻴﺎن ﺗﺮﺗﻴﺒﻲ ﭘﺮوﺗﻴﻴﻦﻫﺎ ﻧﺸﺎن دﻫﻨﺪة ﻣﺮاﺣﻞ ﺗﻜﺎﻣﻠﻲ‬

‫از ﺳﻠﻮلﻫﺎي ﺗﻤﺎﻳﺰ ﻳﺎﻓﺘﻪ ﺑﺎ ﻣﻮرﻓﻮﻟﻮژي ﻣﻴﻮﻓﻴﺒﺮوﺑﻼﺳﺖ دﻳﺪه ﺷﺪ ﻛﻪ‬

‫ﺗﻤﺎﻳﺰ ﺳﻠﻮل ﻋﺼﺒﻲ ﺑﻮد‪ 18.‬در ﻃﻲ دو ﻫﻔﺘﻪ اﺑﺘﺪا ﻓﻘﻂ ﻧﺴﺘﻴﻦ ﺳﭙﺲ‬

‫ﺑﻪ ﺳﻠﻮل ﮔﻠﻴﺎل ﻫﻤﺎﻧﻨﺪ ﻣﻮرد ﻗﺒﻞ‪ ،‬ﺗﻌﺪاد ﺳﻠﻮلﻫﺎي‬ ‫‪GFAP‬‬

‫ﺗﻮاﻧﺎﻳﻲ ﺗﻤﺎﻳﺰ ﺳﻠﻮلﻫﺎي‬

‫‪SKP‬‬

‫‪S100‬‬

‫‪ SMA‬ﻣﺜﺒﺖ ﺑﻮدﻧﺪ )ﺷﻜﻞ ‪ .(2.H‬درﺻﺪ ﺗﻤﺎﻳﺰ ﺑﻪ ﺳﻠﻮل ﻋﻀﻠﺔ ﺻﺎف ﺑﺎ‬ ‫ﺗﻮﺟﻪ ﺑﻪ ﻧﺴﺒﺖ ﺳﻠﻮلﻫﺎي‬

‫‪SMA‬‬

‫ﻣﺜﺒﺖ ﺑﻪ ﺗﻌﺪاد ﻛﻞ ﺳﻠﻮلﻫﺎ )ﺗﻌﺪاد‬

‫ﻫﺴﺘﻪﻫﺎي رﻧﮓآﻣﻴﺰي ﺷﺪه ﺑﺎ ﻫﻤﺎﺗﻮﻛﺴﻴﻠﻴﻦ( ‪ %4/3±0/5‬ﺑﻮد‪.‬‬

‫ﻧﺴﺘﻴﻦ و‬

‫ﺑﺘﺎ‪III-‬‬

‫ﺗﻮﺑﻮﻟﻴﻦ و در ﻣﺮﺣﻠﺔ آﺧﺮ ﻓﻘﻂ‬

‫ﺑﺘﺎ‪III-‬‬

‫ﺗﻮﺑﻮﻟﻴﻦ ﺑﻴﺎن‬

‫ﺷﺪﻧﺪ‪ .‬اﻳﻦ اﻟﮕﻮي ﺗﺮﺗﻴﺒﻲ ﺑﻴﺎن ﭘﺮوﺗﻴﻴﻦﻫﺎ ﺑﻪﺧﻮﺑﻲ ﻣﺮاﺣﻞ اوﻟﻴﺔ ﺗﻤﺎﻳﺰ‬ ‫ﺳﻠﻮلﻫﺎي ﭘﻴﺶﺳﺎز ﻋﺼﺒﻲ را ﺑﻪ ﺳﻤﺖ ﻧﻮرون رﺳﻴﺪه ﻧﺸﺎن ﻣﻲدﻫﺪ‪.‬‬

‫‪19‬‬

‫در واﻗﻊ ﻧﺴﺘﻴﻦ اوﻟﻴﻦ ﭘﺮوﺗﻴﻴﻦ رﺷﺘﻪاي ﺣﺪواﺳﻂ اﺳﺖ ﻛﻪ در ﺟﺮﻳﺎن‬

‫ﺑﺤﺚ‬ ‫ﺑﺎ ﺗﻮﺟﻪ ﺑﻪ اﻳﻦﻛﻪ در ﻣﻄﺎﻟﻌﺎت ﻗﺒﻠﻲ ﺑﻴﺸﺘﺮ ﺑﻮدن ﺗﻌﺪاد ‪SKP‬ﻫﺎي‬ ‫ﺑﻪدﺳﺖ آﻣﺪه از ﭘﻮﺳﺖ ﺟﻮﻧﺪﮔﺎن ﻧﻮزاد ﻧﺴﺒﺖ ﺑﻪ ﺑﺰرﮔﺴﺎﻻن و‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬

‫ﺗﻜﺎﻣﻞ ﺳﻠﻮلﻫﺎي ﻋﺼﺒﻲ در ﺳﻠﻮلﻫﺎي ﻧﻮرواﻛﺘﻮدرم ﺑﻪﻣﻴﺰان زﻳﺎدي‬ ‫‪20‬‬

‫ﺑﻴﺎن ﻣﻲﺷﻮد‪ .‬ﺿﻤﻦ ﻛﺎﻫﺶ ﺑﻴﺎن ﻧﺴﺘﻴﻦ و اﻓﺰاﻳﺶ ﺑﻴﺎن ﺑﺘﺎ‪ III-‬ﺗﻮﺑﻮﻟﻴﻦ‬ ‫ﺑﻴﺎن ﻣﺜﺒﺖ ﭘﺮوﺗﻴﻴﻦ ﻧﻮروﻓﻴﻼﻣﻨﺖ‪-‬‬

‫‪M‬‬

‫دﻳﺪه ﺷﺪ ﻛﻪ اﻳﻦ اﻟﮕﻮي ﺑﻴﺎن‬


‫ﻣﻴﺘﺮا ﺑﺨﺘﻴﺎري و ﻫﻤﻜﺎران‬

‫‪21‬و‪4‬‬

‫‪513‬‬

‫ﻧﺘﺎﻳﺞ‬

‫ﭘﺎرﻛﻴﻨﺴﻮن ﺟﻮﻧﺪﮔﺎن ﺑﻪﻛﺎر ﻣﻲروﻧﺪ‪ .‬ﺑﻪﻧﻈﺮ ﻣﻲرﺳﺪ ‪SKP‬ﻫﺎي اﻧﺴﺎﻧﻲ‬

‫اﻳﻦ ﻣﻄﺎﻟﻌﻪ و ﻣﻄﺎﻟﻌﺎت ﻣﺸﺎﺑﻪ ﻣﻮﻳﺪ اﻳﻦ ﻧﻜﺘﻪ اﺳﺖ ﻛﻪ ‪SKP‬ﻫﺎ از اﻧﻮاع‬

‫‪15‬و‪7‬و‪4‬‬

‫ﻳﻚ ﻣﻨﺒﻊ ﺳﻠﻮﻟﻲ ﻣﻨﺎﺳﺐ و در دﺳﺘﺮس درﻣﺎن ﭘﺎرﻛﻴﻨﺴﻮن ﺑﺎﺷﻨﺪ‪.‬‬

‫دﻳﮕﺮ ﭘﻴﺶﺳﺎزﻫﺎي ﺷﻨﺎﺧﺘﻪ ﺷﺪه در ﭘﻮﺳﺖ ﻗﺎﺑﻞ اﻓﺘﺮاق ﻣﻲﺑﺎﺷﻨﺪ و‬

‫در ﺗﺤﻘﻴﻖ ﺣﺎﺿﺮ ﺣﺪود ‪ 18‬درﺻﺪ از ﺳﻠﻮلﻫﺎ ﺑﻪ ﻧﻮرون ﺗﻤﺎﻳﺰ ﻳﺎﻓﺘﻪاﻧﺪ‪.‬‬

‫‪2‬و‪1‬‬

‫ﺑﻨﺎﺑﺮاﻳﻦ ‪SKP‬ﻫﺎي اﻧﺴﺎﻧﻲ ﻣﻨﺒﻊ ﻣﻨﺎﺳﺐ ﻧﻮرونﻫﺎي دوﭘﺎﻣﻴﻨﺮژﻳﻚ در‬

‫ﺳﻠﻮلﻫﺎي ﺑﻨﻴﺎدي ﻋﺼﺒﻲ ﺑﺰرﮔﺴﺎل ﺗﻤﺎﻳﻞ زﻳﺎدي دارﻧﺪ ﻛﻪ ﺑﻪ ﺳﻤﺖ‬

‫درﻣﺎن ﭘﺎرﻛﻴﻨﺴﻮن ﻣﻲﺑﺎﺷﻨﺪ‪ .‬اﻫﻤﻴﺖ ﻛﺎرﺑﺮدي دﻳﮕﺮ ﺳﻠﻮلﻫﺎي ‪،SKP‬‬

‫ﺳﻠﻮل ﻋﺼﺒﻲ ﺗﻤﺎﻳﺰ ﻳﺎﺑﻨﺪ‪ .‬اﻳﻦ ﺳﻠﻮلﻫﺎ ﻓﻴﺒﺮوﻧﻜﺘﻴﻦ را ﺑﻴﺎن ﻧﻤﻲﻛﻨﻨﺪ و‬

‫ﺑﻪﻋﻨﻮان ﻳﻚ ﻣﻨﺒﻊ ﺳﻠﻮلﻫﺎي اﻧﺴﺎﻧﻲ در ﻏﺮﺑﺎﻟﮕﺮي ﻳﺎ ﺗﺤﻘﻴﻘﺎت اﻛﺘﺸﺎﻓﻲ‬

‫ﻫﺮﮔﺰ دﻳﺪه ﻧﺸﺪه ﻛﻪ ﺑﻪ ﺳﻠﻮل ردة ﻣﺰودرﻣﻲ ﺗﻤﺎﻳﺰ ﻳﺎﺑﻨﺪ‪22.‬و‪ 1‬در ﻣﻘﺎﻳﺴﻪ‬

‫اﺳﺖ‪ .‬ﻫﻤﺎنﻃﻮر ﻛﻪ ﻣﻲداﻧﻴﻢ ﺑﻪدﺳﺖ آوردن ﺳﻠﻮل ﻋﺼﺒﻲ در ﻣﺮاﺣﻞ‬

‫‪PSA-‬‬

‫ﺗﻘﺴﻴﻤﺎت ﻣﻴﺘﻮزي از ﻳﻚ ﻓﺮد زﻧﺪه ﻏﻴﺮ ﻣﻤﻜﻦ اﺳﺖ وﻟﻲ ‪SKP‬ﻫﺎي‬

‫را ﺗﻮﻟﻴﺪ ﻧﻤﻲﻛﻨﻨﺪ و ﺑﻪ ﻧﻮرونﻫﺎي ﺗﻴﺮوزﻳﻦ ﻫﻴﺪروﻛﺴﻴﻼز‬

‫اﻧﺴﺎﻧﻲ آﻣﺎدة ﺗﻮﻟﻴﺪ ﺳﻠﻮل ﻋﺼﺒﻲ ﻫﺴﺘﻨﺪ‪ .‬ﻣﻲﺗﻮان از ‪SKP‬ﻫﺎ ﺑﻪﻋﻨﻮان‬

‫ﻣﺜﺒﺖ ﺗﻤﺎﻳﺰ ﻧﻤﻲﻳﺎﺑﻨﺪ ﻛﻪ وﺟﻪ ﺗﻤﺎﻳﺰ اﻳﻦ ﺳﻠﻮلﻫﺎ از ﺳﻠﻮلﻫﺎي ﺑﻨﻴﺎدي‬

‫ﻳﻚ ﻣﻨﺒﻊ زﻧﺪه و ﻗﺎﺑﻞ ﮔﺴﺘﺮش ﻧﻮرونﻫﺎي اوﻟﻴﻪ اﻧﺴﺎﻧﻲ اﺳﺘﻔﺎده ﻛﺮد‪.‬‬

‫ﺳﺘﻴﻎ ﻋﺼﺒﻲ )‪ (NCSCs‬ﻣﻲﺑﺎﺷﺪ‪2.‬و‪ 1‬ﻫﻤﭽﻨﻴﻦ ‪SKP‬ﻫﺎ ﺑﻪﻃﻮر واﺿﺤﻲ از‬

‫در اﻓﺮاد ﺑﺎ زﻣﻴﻨﺔ ژﻧﺘﻴﻚ ﺑﻴﻤﺎري ﻋﺼﺒﻲ ﻣﺜﻞ آﻟﺰاﻳﻤﺮ و ﺷﻴﺰوﻓﺮﻧﻲ‪،‬‬

‫ﺳﻠﻮلﻫﺎي ﺑﻨﻴﺎدي ﻣﺰاﻧﺸﻴﻤﻲ ﭼﺴﺒﻨﺪة ﻣﻐﺰ اﺳﺘﺨﻮان ﻣﺘﻔﺎوت ﻫﺴﺘﻨﺪ‪ .‬از‬

‫ﻣﻲﺗﻮان ‪SKP‬ﻫﺎي ﺳﻠﻮلﻫﺎي ﻋﺼﺒﻲ ﺑﻴﻤﺎر را ﺟﺪاﺳﺎزي و ﻛﺸﺖ داده و‬

‫ﭘﺮوﺗﻴﻴﻨﻲ‪ ،‬ﻛﺎﻣﻼً ﺑﺎ اﻟﮕﻮي ﺗﻜﺎﻣﻠﻲ ﻧﻮرونﻫﺎ ﻫﻤﺎﻫﻨﮓ اﺳﺖ‪.‬‬

‫ﺗﻔﺎوتﻫﺎي ﻗﺎﺑﻞ ﺗﻮﺟﻬﻲ ﺑﺎ ﺳﻠﻮلﻫﺎي ﺑﻨﻴﺎدي ﻋﺼﺒﻲ دارﻧﺪ‪.‬‬

‫ﺑﺎ ﺳﻠﻮلﻫﺎي ﺑﻨﻴﺎدي ﺳﺘﻴﻎ ﻋﺼﺒﻲ‪SKP ،‬ﻫﺎ ﻣﺎرﻛﺮﻫﺎي‬ ‫‪NCAM‬‬

‫‪P75‬‬

‫و‬

‫‪4-7‬و‪2‬‬

‫آﺧﺮﻳﻦ ﻛﺎرﺑﺮد درﻣﺎﻧﻲ ‪SKP‬ﻫﺎ در راﺑﻄﻪ ﺑﺎ‬

‫ﺟﻤﻠﻪ ﺗﻔﺎوت در ﻧﻮع ﻓﺎﻛﺘﻮرﻫﺎي رﺷﺪ ﻣﻮرد ﻧﻴﺎز‪ ،‬ﻣﻮرﻓﻮﻟﻮژي ﺳﻠﻮلﻫﺎ‬

‫ﻣﻮرد ﺑﺮرﺳﻲ ﻗﺮار داد‪.‬‬

‫و ﺗﻮاﻧﺎﻳﻲ رﺷﺪ ﺑﻪﺻﻮرت ﺷﻨﺎور‪ .‬ﻋﻼوه ﺑﺮ اﻳﻦ‪ ،‬ﺳﻠﻮلﻫﺎي ﺑﻨﻴﺎدي‬

‫ﭘﺘﺎﻧﺴﻴﻞ ﺗﻤﺎﻳﺰ دوﮔﺎﻧﺔ اﻳﻦ ﺳﻠﻮلﻫﺎ ﺑﻪ دو ردة ﻣﺰودرﻣﻲ و ﻋﺼﺒﻲ‬

‫ﻣﺰاﻧﺸﻴﻤﻲ ﻗﻮﻳﺎ ﺗﻤﺎﻳﻞ دارﻧﺪ ﻛﻪ ﺳﻠﻮلﻫﺎﻳﻲ از ﻣﻨﺸﺎ ﻣﺰودرﻣﺎل اﻳﺠﺎد‬

‫ﻣﻲﺑﺎﺷﺪ‪ .‬ﺑﺎ ﺗﻮﺟﻪ ﺑﻪ اﻳﻦﻛﻪ ﺑﺮﺧﻲ ﺗﻮﻣﻮرﻫﺎي ﭘﻮﺳﺘﻲ ﺣﺎوي ﻫﺮ دو ﺟﺰ‬

‫‪23‬و‪1‬‬

‫ﻋﺼﺒﻲ و ﻣﺰودرﻣﻲ ﻣﻲﺑﺎﺷﻨﺪ و ﺣﺘﻲ ﮔﺎﻫﻲ دﻳﺪه ﺷﺪه ﻛﻪ در ﭘﻮﺳﺖ‬

‫ﭘﺘﺎﻧﺴﻴﻞ ﻧﻮرال و ﻣﺰودرﻣﺎل ‪SKP‬ﻫﺎ اﻳﻦ اﺣﺘﻤﺎل را ﻣﻄﺮح ﻣﻲﻛﻨﺪ ﻛﻪ اﻳﻦ‬

‫ﺗﻮﻣﻮرﻫﺎي ﻋﺼﺒﻲ اﻳﺠﺎد ﻣﻲﺷﻮﻧﺪ از ﺟﻤﻠﻪ ﻧﻮروﺑﻼﺳﺘﻮﻣﺎ ﻛﻪ در ﭘﻮﺳﺖ‬

‫ﺳﻠﻮلﻫﺎ در اﻫﺪاف درﻣﺎﻧﻲ ﻣﺘﻌﺪد ﻗﺎﺑﻞ اﺳﺘﻔﺎده ﺑﺎﺷﻨﺪ‪SKP .‬ﻫﺎ ﻳﻚ ﻣﻨﺒﻊ‬

‫اﻃﻔﺎل ﺑﺮوز ﻣﻲﻛﻨﺪ‪ .‬ﺑﻨﺎﺑﺮاﻳﻦ ﺑﻪﻧﻈﺮ ﻣﻲرﺳﺪ ﻛﻪ ﻳﻚ ﺳﻠﻮل ﺷﺒﻪ‬

‫‪SKP‬‬

‫در دﺳﺘﺮس از ﭘﻴﺶﺳﺎزﻫﺎي ﻋﺼﺒﻲ ﺑﺰرﮔﺴﺎل ﻫﺴﺘﻨﺪ ﻛﻪ ﻣﻲﺗﻮاﻧﻨﺪ ﺑﺮاي‬

‫درونزا ﻣﻲﺗﻮاﻧﺪ در ﺑﺮﺧﻲ از اﻳﻦ ﺗﻮﻣﻮرﻫﺎ ﺑﻪﻋﻨﻮان ﺳﻠﻮل ﺑﻨﻴﺎنﮔﺬار‬

‫ﭘﻴﻮﻧﺪ ﺳﻠﻮﻟﻲ در درﻣﺎن آﺳﻴﺐﻫﺎي ﺳﻴﺴﺘﻢ ﻋﺼﺒﻲ ﺑﻪﻛﺎر روﻧﺪ‪ .‬در‬

‫ﻋﻤﻞ ﻛﻨﺪ‪ .‬ﮔﻮاه ﻣﺎ ﺑﺮ اﻳﻦ ادﻋﺎ ﻧﺘﺎﻳﺞ ﻣﻨﺘﺸﺮﺷﺪهاي اﺳﺖ ﻛﻪ ﻫﻤﮕﻲ ﺑﺮ‬

‫ﮔﺰارش ‪ Mckenzie‬و ‪ ،Biernaskie‬ﺳﻠﻮلﻫﺎي ﺷﻮان ﺗﻤﺎﻳﺰ ﻳﺎﻓﺘﻪ از‬

‫اﻳﻦ ﻧﻜﺘﻪ دﻻﻟﺖ دارﻧﺪ ﻛﻪ ﺳﻠﻮل ﺑﻨﻴﺎدي ﻣﻲﺗﻮاﻧﺪ ﺳﻠﻮل ﺑﻨﻴﺎنﮔﺬار ﺑﺮاي‬

‫‪SKP‬ﻫﺎي ﺟﻮﻧﺪﮔﺎن ﺗﻮاﻧﺴﺘﻪاﻧﺪ آﻛﺴﻮنﻫﺎ را در ﻣﺤﻴﻂ ﻛﺸﺖ و در ﺑﺪن‬

‫ﻛﺎﻧﺴﺮﻫﺎي ﺧﻮن‪27‬و‪ 26‬ﻋﺼﺒﻲ‪29‬و‪ 28‬و ﭘﺴﺘﺎن‪ 30‬ﺑﺎﺷﻨﺪ‪ 2.‬ﻧﻈﺮ ﺑﻪ اﻳﻦﻛﻪ ﻧﺘﺎﻳﺞ‬

‫‪ Toma‬ﺷﻮاﻫﺪي ﺑﻪدﺳﺖ آورد ﻛﻪ‬

‫ﻣﻄﺎﻟﻌﺎت اﻧﺠﺎم ﺷﺪه ﺑﻪ ﭘﺘﺎﻧﺴﻴﻞ ﻛﺎرﺑﺮدي ﻓﺮاوان ‪SKP‬ﻫﺎي اﻧﺴﺎﻧﻲ در‬

‫‪SKP‬ﻫﺎي اﻧﺴﺎﻧﻲ ﻧﻴﺰ ﻣﻲﺗﻮاﻧﻨﺪ ﺳﻠﻮل ﺷﻮان ﺗﻮﻟﻴﺪ ﻧﻤﺎﻳﻨﺪ‪ .‬ﻫﻤﺎنﻃﻮر ﻛﻪ‬

‫درﻣﺎن ﺑﻴﻤﺎريﻫﺎي ﺳﻴﺴﺘﻢ ﻋﺼﺒﻲ و اﻣﺘﻴﺎزات اﺳﺘﻔﺎده از آنﻫﺎ ﺑﻪﻋﻨﻮان‬

‫ﻛﻨﻨﺪ و ﺑﻪ آﺳﺎﻧﻲ ﺟﻬﺖ ﺗﻮﻟﻴﺪ ﭘﺮوﺗﻴﻴﻦﻫﺎي ﻧﻮروﻧﻲ اﻟﻘﺎ ﻧﻤﻲﺷﻮﻧﺪ‪.‬‬

‫‪14‬و‪13‬‬

‫ﻣﻮﺟﻮد زﻧﺪه ﻣﻴﻠﻴﻨﻪ ﻧﻤﺎﻳﻨﺪ‪.‬‬

‫ﻣﻲداﻧﻴﻢ ﺗﻨﻬﺎ روش ﺗﻬﻴﺔ ﺳﻠﻮل ﺷﻮان اﻧﺴﺎﻧﻲ از ﻃﺮﻳﻖ ﺑﻴﻮﭘﺴﻲ ﻋﺼﺒﻲ‬

‫‪4-7‬و‪2‬‬

‫ﻳﻚ ﻣﻨﺒﻊ اﺗﻮﻟﻮگ ﺑﺎ ﻗﺎﺑﻠﻴﺖ دﺳﺘﺮﺳﻲ آﺳﺎن دﻻﻟﺖ دارﻧﺪ‪.‬‬

‫ﻫﻤﭽﻨﻴﻦ‬

‫‪25‬و‪24‬‬

‫ﺑﺎ ﺗﻮﺟﻪ ﺑﻪ ﻛﺎﻫﺶ ﺗﻌﺪاد و ﭘﺘﺎﻧﺴﻴﻞ ﺗﻤﺎﻳﺰي ‪SKP‬ﻫﺎي اﻧﺴﺎﻧﻲ ﺑﺎ اﻓﺰاﻳﺶ‬

‫ﺑﻨﺎﺑﺮاﻳﻦ ‪SKP‬ﻫﺎ ﻳﻚ ﻣﻨﺒﻊ ﺟﺎﻳﮕﺰﻳﻦ اﺗﻮﻟﻮگ زﻧﺪة ﺑﺎﻟﻘﻮه را ﺑﺮاي ﺗﻬﻴﺔ‬

‫ﺳﻦ و اﻫﻤﻴﺖ ﻧﮕﻬﺪاري آنﻫﺎ ﺑﻪﺻﻮرت ﺑﺎﻧﻚﻫﺎي ﺳﻠﻮﻟﻲ در ﻣﺮاﺣﻞ‬

‫اﺳﺖ و اﻳﻦ ﺳﻠﻮلﻫﺎ ﺑﻪﺳﺨﺘﻲ در ﻣﺤﻴﻂ ﻛﺸﺖ ﮔﺴﺘﺮش ﻣﻲﻳﺎﺑﻨﺪ‪.‬‬ ‫‪14‬و‪13‬و‪7‬‬

‫ﺳﻠﻮل ﺷﻮان ﻓﺮاﻫﻢ ﻧﻤﻮدهاﻧﺪ‪.‬‬

‫ﻣﻄﺎﻟﻌﻪ ﻣﺎ درﺻﺪ ﻗﺎﺑﻞ ﺗﻮﺟﻬﻲ‬

‫ﺗﻤﺎﻳﺰ ﺳﻠﻮلﻫﺎي ﮔﻠﻴﺎل ‪ 23±0/3‬را ﻧﺸﺎن داد ﻛﻪ ﺑﺎ ﺑﺮرﺳﻲﻫﺎي‬

‫اوﻟﻴﺔ زﻧﺪﮔﻲ‪،‬‬

‫اﻳﻦ ﻣﻄﺎﻟﻌﻪ ﺑﺮاي اوﻟﻴﻦ ﺑﺎر در ﻛﺸﻮر در ﺟﻬﺖ‬

‫و‬

‫ﺟﺪاﺳﺎزي‪ ،‬ﻛﺸﺖ و ﺗﻤﺎﻳﺰ ‪SKP‬ﻫﺎ از ﻓﻮر اﺳﻜﻴﻦ اﻧﺴﺎﻧﻲ اﻧﺠﺎم ﺷﺪ‪.‬‬

‫ﻣﻲﺗﻮاﻧﺪ ﺑﻪﻋﻨﻮان ﻳﻚ ﻣﻨﺒﻊ در‬

‫ﻧﺘﺎﻳﺞ ﺑﻪدﺳﺖ آﻣﺪه ﻧﺸﺎن داد ﻛﻪ ﻓﻮر اﺳﻜﻴﻦ اﻧﺴﺎﻧﻲ ﻳﻚ ﻣﻨﺒﻊ ﻣﻨﺎﺳﺐ‬

‫دﺳﺘﺮس اﻳﻦ ﺳﻠﻮلﻫﺎ در درﻣﺎن ﺑﻴﻤﺎريﻫﺎﻳﻲ ﻧﻈﻴﺮ آﺳﻴﺐﻫﺎي ﻃﻨﺎب‬

‫ﺑﺮاي ﺳﻠﻮلﻫﺎي ﭘﻴﺶﺳﺎز ﻋﺼﺒﻲ اﺳﺖ ﻛﻪ ﻣﻲﺗﻮاﻧﻨﺪ ﺑﻪ ﻧﻮرون و ﺳﻠﻮل‬

‫ﻧﺨﺎﻋﻲ و ﻣﻮﻟﺘﻴﭙﻞ اﺳﻜﻠﺮوزﻳﺲ ﻣﻮرد ﺗﻮﺟﻪ ﻗﺮار ﮔﻴﺮد‪ .‬ﻛﺎرﺑﺮد ﺑﺎﻟﻘﻮة‬

‫ﮔﻠﻴﺎل ﺗﻤﺎﻳﺰ ﻳﺎﺑﻨﺪ‪ .‬ﺑﺎ ﺗﻮﺟﻪ ﺑﻪ ﻣﻮارد ذﻛﺮ ﺷﺪه ﻟﺰوم ﻣﻄﺎﻟﻌﻪ در زﻣﻴﻨﺔ‬

‫دﻳﮕﺮ ‪SKP‬ﻫﺎي ﺟﻮﻧﺪﮔﺎن ﺗﻤﺎﻳﺰ ﺑﻪ ﻧﻮرونﻫﺎي ﻛﺎﺗﻜﻮل آﻣﻴﻨﺮژﻳﻚ‬

‫ﺑﻬﺒﻮد ﺗﻜﻨﻴﻚ ﺗﻤﺎﻳﺰي ‪SKP‬ﻫﺎي اﻧﺴﺎﻧﻲ در ﺟﻬﺖ اﻓﺰاﻳﺶ درﺻﺪ ﺗﻤﺎﻳﺰ‬

‫ﻣﻲﺑﺎﺷﺪ ﻛﻪ ﺧﺼﻮﺻﻴﺎت ﻧﻮرونﻫﺎي دوﭘﺎﻣﻴﻨﺮژﻳﻚ را دارﻧﺪ و در درﻣﺎن‬

‫آنﻫﺎ ﺿﺮوري ﺑﻪﻧﻈﺮ ﻣﻲرﺳﺪ‪ .‬ﻫﻤﭽﻨﻴﻦ اﻧﺠﺎم ﺑﺮرﺳﻲﻫﺎي ﺑﻴﺸﺘﺮ در‬

‫ﺑﻴﺎن ﻣﺜﺒﺖ ﻣﺎرﻛﺮ ﺳﻠﻮل ﺷﻮان‬

‫)‪(GFAP‬‬

‫‪ICC‬‬

‫‪17‬و‪16‬‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬


‫ و ﺗﻤﺎﻳﺰ آنﻫﺎ ﺑﻪ ﻧﻮرون و ﺳﻠﻮل ﮔﻠﻴﺎل‬Bakhtiari ‫ﻓﻮراﺳﻜﻴﻦ اﻧﺴﺎﻧﻲ‬ M. et ‫از‬ al.‫ﺟﺪاﺳﺎزي ﺳﻠﻮلﻫﺎي ﭘﻴﺶﺳﺎز ﻣﺸﺘﻖ‬

.‫ ﻣﻲﺗﻮاﻧﺪ راهﮔﺸﺎي ﺳﺎﻳﺮ ﻋﻼﻗﻤﻨﺪان ﺑﺎﺷﺪ‬،‫و ﺗﺤﻘﻴﻘﺎﺗﻲ‬

514

‫ آﺷﻨﺎﻳﻲ ﺑﺎ اﻟﮕﻮي ﺑﻴﺎن ﭘﺮوﺗﻴﻴﻦ‬SKP ‫ﺷﻨﺎﺳﺎﻳﻲ ﻫﻮﻳﺖ واﻗﻌﻲ ﺳﻠﻮلﻫﺎي‬

‫ ﺑﺎ ﺗﺸﻜﺮ از ﻣﻌﺎوﻧﺖ ﭘﮋوﻫﺸﻲ داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ‬:‫ﺳﭙﺎﺳﮕﺰاري‬

‫در آنﻫﺎ و ﺷﻨﺎﺧﺖ ﻣﻨﺎﺳﺒﻲ از ﭼﮕﻮﻧﮕﻲ دﺧﺎﻟﺖ ﻓﺎﻛﺘﻮرﻫﺎي ﻣﻮﺛﺮ در‬

‫ ﻛﻪ ﺑﺎ ﺣﻤﺎﻳﺖ ﻣﺎﻟﻲ ﻣﻨﺎﺳﺐ اﻣﻜﺎن اﻧﺠﺎم اﻳﻦ ﻣﻄﺎﻟﻌﻪ را ﻓﺮاﻫﻢ‬،‫ﻛﺮﻣﺎﻧﺸﺎه‬

‫ در اﻳﻦ‬.‫ﻫﺎ ﺑﻪ دودﻣﺎنﻫﺎي ﺧﺎص ﺣﺎﺋﺰ اﻫﻤﻴﺖ اﺳﺖ‬SKP ‫اﻳﺠﺎد ﺗﻤﺎﻳﺰ‬

‫ از ﻣﺴﺎﻋﺪت ﺑﻲدرﻳﻎ دﻛﺘﺮ اﻳﺰدي در ﺟﻬﺖ اﺟﺮاي اﻳﻦ ﺗﺤﻘﻴﻖ‬.‫ﻧﻤﻮد‬

‫ﻫﺎ ﺑﺮاي اوﻟﻴﻦﺑﺎر‬SKP ‫ ﺗﻜﺜﻴﺮ و ﺗﻤﺎﻳﺰ‬،‫ﻣﻄﺎﻟﻌﻪ ﻣﺮاﺣﻞ ﺟﺪاﺳﺎزي ﻛﺸﺖ‬

‫ ﻧﻮﻳﺴﻨﺪﮔﺎن ﻣﺮاﺗﺐ ﺳﭙﺎس ﺧﻮد را از ﻣﺴﺎﻋﺪت‬.‫ﻛﻤﺎل اﻣﺘﻨﺎن را دارﻳﻢ‬

‫ ﺑﺎ ﻣﻮﻓﻘﻴﺖ اﻧﺠﺎم ﺷﺪ و ﺑﻪﻋﻨﻮان اوﻟﻴﻦ ﮔﺎم در اﺳﺘﻔﺎده از اﻳﻦ‬،‫در اﻳﺮان‬

:‫ ﺷﻴﺎﺳﻲ و ﻣﻬﻨﺎم و آﻗﺎﻳﺎن‬،‫ ﺣﺼﺎري‬،‫ ﺳﻬﺮاﺑﻲ‬،‫ ﻛﺸﺎورز‬،‫ ﻛﻴﺎﻧﻲ‬:‫ﺧﺎﻧﻢﻫﺎ‬

‫ﺳﻠﻮلﻫﺎ ﺑﻪﻋﻨﻮان ﻳﻚ ﻣﻨﺒﻊ اﺗﻮﻟﻮگ ﺑﺎ دﺳﺘﺮﺳﻲ آﺳﺎن ﺟﻬﺖ دﺳﺘﻴﺎﺑﻲ ﺑﻪ‬

.‫ ﭘﺮواﻧﻪ و ﻳﺎري اﻋﻼم ﻣﻲﻧﻤﺎﻳﻨﺪ‬،‫ ﻣﺤﻤﺪي ﻣﻄﻠﻖ‬،‫ﻣﻴﺮ آﻗﺎﻳﻲ‬

‫ﭘﻴﺶﺳﺎزﻫﺎي ﻋﺼﺒﻲ ﺑﻪ ﻣﻨﻈﻮر ﻛﺎرﺑﺮد در زﻣﻴﻨﻪ اﻫﺪاف ﻣﺨﺘﻠﻒ درﻣﺎﻧﻲ‬

References 1. Toma JG, Akhavan M, Fernandes KJ, Barnabé-Heider F, Sadikot A, Kaplan DR, et al. Isolation of multipotent adult stem cells from the dermis of mammalian skin. Nat Cell Biol 2001;3(9):778-84. 2. Fernandes KJ, Toma JG, Miller FD. Multipotent skin-derived precursors: adult neural crest-related precursors with therapeutic potential. Philos Trans R Soc Lond B Biol Sci 2008;363(1489):18598. 3. Nurse CA, Macintyre L, Diamond J. Reinnervation of the rat touch dome restores the Merkel cell population reduced after denervation. Neuroscience 1984;13(2):563-71. 4. Gingras M, Champigny MF, Berthod F. Differentiation of human adult skin-derived neuronal precursors into mature neurons. J Cell Physiol 2007;210(2):498-506. 5. Fernandes KJ, McKenzie IA, Mill P, Smith KM, Akhavan M, Barnabé-Heider F, et al. A dermal niche for multipotent adult skinderived precursor cells. Nat Cell Biol 2004;6(11):1082-93. Erratum in: Nat Cell Biol 2005;7(5):531. 6. Fernandes KJ, Kobayashi NR, Gallagher CJ, Barnabé-Heider F, Aumont A, Kaplan DR, et al. Analysis of the neurogenic potential of multipotent skin-derived precursors. Exp Neurol 2006;201(1):3248. 7. Toma JG, McKenzie IA, Bagli D, Miller FD. Isolation and characterization of multipotent skin-derived precursors from human skin. Stem Cells 2005;23(6):727-37. 8. Lavoie JF, Biernaskie JA, Chen Y, Bagli D, Alman B, Kaplan DR, et al. Skin-derived precursors differentiate into skeletogenic cell types and contribute to bone repair. Stem Cells Dev 2009;18(6):893-906. 9. Kawase Y, Yanagi Y, Takato T, Fujimoto M, Okochi H. Characterization of multipotent adult stem cells from the skin: transforming growth factor-beta (TGF-beta) facilitates cell growth. Exp Cell Res 2004;295(1):194-203. 10. Wong CE, Paratore C, Dours-Zimmermann MT, Rochat A, Pietri T, Suter U, et al. Neural crest-derived cells with stem cell features can be traced back to multiple lineages in the adult skin. J Cell Biol 2006;175(6):1005-15. 11. Linher K, Dyce P, Li J. Primordial germ cell-like cells differentiated in vitro from skin-derived stem cells. PLoS One 2009;4(12):e8263. 12. Guo W, Miao C, Liu S, Qiu Z, Li J, Duan E. Efficient differentiation of insulin-producing cells from skin-derived stem cells. Cell Prolif 2009;42(1):49-62. 13. Biernaskie J, Sparling JS, Liu J, Shannon CP, Plemel JR, Xie Y, et al. Skin-derived precursors generate myelinating Schwann cells that promote remyelination and functional recovery after contusion spinal cord injury. J Neurosci 2007;27(36):9545-59. 14. McKenzie IA, Biernaskie J, Toma JG, Midha R, Miller FD. Skinderived precursors generate myelinating Schwann cells for the injured and dysmyelinated nervous system. J Neurosci 2006;26(24):6651-60.

15. Kubo A, Yoshida T, Kobayashi N, Yokoyama T, Mimura T, Nishiguchi T, et al. Efficient generation of dopamine neuron-like cells from skin-derived precursors with a synthetic peptide derived from von Hippel-Lindau protein. Stem Cells Dev 2009;18(10):1523-32. 16. Gago N, Pérez-López V, Sanz-Jaka JP, Cormenzana P, Eizaguirre I, Bernad A, et al. Age-dependent depletion of human skin-derived progenitor cells. Stem Cells 2009;27(5):1164-72. 17. Zouboulis CC, Adjaye J, Akamatsu H, Moe-Behrens G, Niemann C. Human skin stem cells and the ageing process. Exp Gerontol 2008;43(11):986-97. 18. Hoffman PN, Cleveland DW. Neurofilament and tubulin expression recapitulates the developmental program during axonal regeneration: induction of a specific beta-tubulin isotype. Proc Natl Acad Sci U S A 1988;85(12):4530-3. 19. Lee MK, Cleveland DW. Neuronal intermediate filaments. Annu Rev Neurosci 1996;19:187-217. 20. Lendahl U, Zimmerman LB, McKay RD. CNS stem cells express a new class of intermediate filament protein. Cell 1990;60(4):585-95. 21. Chuckowree JA, Vickers JC. Cytoskeletal and morphological alterations underlying axonal sprouting after localized transection of cortical neuron axons in vitro. J Neurosci 2003;23(9):3715-25. 22. Gage FH. Mammalian neural stem cells. Science 2000;287(5457):1433-8. 23. Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, Mosca JD, et al. Multilineage potential of adult human mesenchymal stem cells. Science 1999;284(5411):143-7. 24. Casella GT, Bunge RP, Wood PM. Improved method for harvesting human Schwann cells from mature peripheral nerve and expansion in vitro. Glia 1996;17(4):327-38. 25. Rutkowski JL, Kirk CJ, Lerner MA, Tennekoon GI. Purification and expansion of human Schwann cells in vitro. Nat Med 1995;1(1):80-3. 26. Al-Hajj M, Becker MW, Wicha M, Weissman I, Clarke MF. Therapeutic implications of cancer stem cells. Curr Opin Genet Dev 2004;14(1):43-7. 27. Bonnet D, Dick JE. Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nat Med 1997;3(7):730-7. 28. Singh SK, Clarke ID, Terasaki M, Bonn VE, Hawkins C, Squire J, et al. Identification of a cancer stem cell in human brain tumors. Cancer Res 2003;63(18):5821-8. 29. Singh SK, Hawkins C, Clarke ID, Squire JA, Bayani J, Hide T, et al. Identification of human brain tumour initiating cells. Nature 2004;432(7015):396-401. 30. Al-Hajj M, Wicha MS, Benito-Hernandez A, Morrison SJ, Clarke MF. Prospective identification of tumorigenic breast cancer cells. Proc Natl Acad Sci U S A 2003;100(7):3983-8. Epub 2003 Mar 10. Erratum in: Proc Natl Acad Sci U S A 2003;100(11):6890.

1389 ‫ آذر‬،9 ‫ ﺷﻤﺎره‬، 68 ‫ دوره‬،‫ داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‬،‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‬


Tehran University Medical Journal; Vol. ‫و‬68, No. 9, Dec 2010: 508-515 ‫ﻫﻤﻜﺎران‬

102

Isolation of skin-derived precursors from human foreskin and their differentiation into neurons and glial cells

1

Mitra Bakhtiari PhD. Kamran Mansouri MSc.2 Ali Mostafaie PhD.3* Yousef Sadeghi MD. PhD.1 Hadi Mozafari MSc.4 Rostam Ghorbani PhD.5 Mostafa Rezaei Tavirani PhD.6 1- Department of Anatomical Sciences & Biology, Shaheed Beheshti University of Medical Sciences, Tehran, Iran. 2- MSc. of Hematology, Medical Biology Research Center, Kermanshah University of Medical Sciences, Kermanshah, Iran. 3- Department of Immunology, Medical Biology Research Center, Kermanshah University of Medical Sciences, Kermanshah, Iran. 4- MSc. of Biochemistry, Medical Biology Research Center, Kermanshah University of Medical Sciences, Kermanshah, Iran. 5- Department of Anatomical Sciences & Biology, Kermanshah University of Medical Sciences, Kermanshah, Iran. 6- Proteomics Research Center, Shaheed Beheshti University of Medical Sciences, Tehran, Iran.

Abstract

Received: September 05, 2010 Accepted: October 23, 2010

Background: Skin-derived precursors (SKPs) are a type of progenitor cells extracted from mammalian dermal tissue and can be differentiate to neural and mesodermal lineage in vitro. These cells can introduce an accessible autologos source of neural precursor cells for treatment of different neurodegenerative diseases. This research was done in order to set up isolation, culture, proliferation and differentiation of human skin derived precursors (hSKPs). Methods: Human foreskin samples were cut into smaller pieces and cultured in proliferation medium after enzymatic digestion. To induce neural differentiation, cells were cultured in neural differentiation medium after fifth passage. We used immunocytochemistry and RT-PCR for characterization of the cells. Neuron and glial cell differentiation potential was assessed by immunofloresence using specific antibodies. The experiments were carried out in triplicate. Results: After differentiation, βΙΙΙ- tubulin and neurofilament-M positive cells were observed that are specific markers for neurons. Moreover, glial fibrillary acid protein (GFAP) and S100 positive cells were identified that are markers specifically express in glial cells. Detected neurons and glials were also confirmed by their morphologic characterizations. Conclusion: Our results demonstrated that skin-derived precursors obtained from human foreskin can exhibit neuronal and glial differentiation potential in vitro, depending on the protocols of induction. Keywords: Skin-derived precursor, neural lineage, neuron, glial cell, differentiation.

*

Corresponding author: Medical Biology Research Center, Kermanshah University of Medical Sciences, Sorkheh Lizheh, Kermanshah, Iran, PO. Box: 6714869914 Tel: +98-831-4276473 email: amostafaie@kums.ac.ir

1389 ‫ آذر‬،9 ‫ ﺷﻤﺎره‬، 68 ‫ دوره‬،‫ داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‬،‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‬


‫ﻃﺒﻴﻌﻲ‬ ‫‪، 68‬و ﺑﺎﻓﺖ‬ ‫ﻟﻴﻮﻣﻴﻮﺳﺎرﻛﻮم‬ ‫‪ IHC‬در‬ ‫ﻲ‪P16،‬‬ ‫ﻣﺎرﻛﺮ‬ ‫ﻣﻴﻮﻣﺘﺮ‪516-521 ،‬‬ ‫آذر ‪1389‬‬ ‫ﺷﻤﺎره ‪،9‬‬ ‫ﻟﻴﻮﻣﻴﻮم‪ ،‬ﺗﻬﺮان‪ ،‬دوره‬ ‫ﻋﻠﻮم ﭘﺰﺷﻜﻲ‬ ‫داﻧﺸﮕﺎه‬ ‫ﺑﺮوزﭘﺰﺷﻜ‬ ‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه‬

‫ﺑﺮوز ﻣﺎرﻛﺮ اﻳﻤﻮﻧﻮﻫﻴﺴﺘﻮﺷﻴﻤﻲ ‪ p16‬در ﺑﺎﻓﺖ ﻃﺒﻴﻌﻲ و ﺗﻮﻣﻮرال ﻣﻴﻮﻣﺘﺮ در ‪ 136‬ﺑﻴﻤﺎر‬

‫ﺗﺎرﻳﺦ درﻳﺎﻓﺖ ﻣﻘﺎﻟﻪ‪ 1389/03/23 :‬ﺗﺎرﻳﺦ ﭘﺬﻳﺮش‪1389/05/04 :‬‬

‫ﭼﻜﻴﺪه‬

‫*‬

‫زﻫﺮا ﻓﺮوﻫﺶ ﺗﻬﺮاﻧﻲ‬

‫زﻣﻴﻨﻪ و ﻫﺪف‪ :‬ﺗﻮﻣﻮرﻫﺎي ﻋﻀﻠﻪ ﺻﺎف رﺣﻢ ﺑﻪ ﺳﻪ ﮔﺮوه ﻟﻴﻮﻣﻴﻮم‪ ،‬ﻟﻴﻮﻣﻴﻮﺳﺎرﻛﻮم و ﺗﻮﻣﻮرﻫﺎي ﻋﻀﻠﻪ ﺻﺎف ﺑﺎ ﭘﺘﺎﻧﺴﻴﻞ‬

‫ﻋﻠﻴﺮﺿﺎ ﭘﺎﻳﻜﺎري‬

‫ﻧﺎﻣﺸﺨﺺ ﺑﺪﺧﻴﻤﻲ ﺗﻘﺴﻴﻢ ﻣﻲﺷﻮﻧﺪ‪ .‬ﻟﻴﻮﻣﻴﻮم و ﻟﻴﻮﻣﻴﻮﺳﺎرﻛﻮم ﺗﻮﻣﻮرﻫﺎي ﺟﺪاﮔﺎﻧﻪاي ﻫﺴﺘﻨﺪ و اﻋﻀﺎي ﻳﻚ ﻃﻴﻒ‬

‫ﻋﻠﻲ ﻣﻼﻳﺮي‬

‫ﺑﻴﻮﻟﻮژﻳﻚ ﻧﻤﻲﺑﺎﺷﻨﺪ‪ .‬ﺗﻮﻣﻮرﻫﺎي ﻋﻀﻠﻪ ﺻﺎف ﺑﺎ ﭘﺘﺎﻧﺴﻴﻞ ﻧﺎﻣﺸﺨﺺ ﺑﺪﺧﻴﻤﻲ از ﻟﺤﺎظ ﻫﻴﺴﺘﻮﭘﺎﺗﻮﻟﻮژﻳﻚ دﺳﺘﻪاي از‬ ‫ﮔﺮوه ﭘﺎﺗﻮﻟﻮژي‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪،‬‬

‫ﺗﻮﻣﻮرﻫﺎ را ﺷﺎﻣﻞ ﻣﻲﺷﻮﻧﺪ ﻛﻪ ﺑﻪﻃﻮر ﻣﺸﺨﺺ در دو دﺳﺘﻪ دﻳﮕﺮ ﻗﺮار ﻧﻤﻲﮔﻴﺮﻧﺪ ﻛﻪ اﻳﻦ ﻣﺸﻜﻞ ﺑﺰرﮔﻲ در ﻧﺤﻮه‬

‫ﺗﻬﺮان‪ ،‬اﻳﺮان‪.‬‬

‫ﺑﺮﺧﻮرد و درﻣﺎن اﻳﻦ ﮔﺮوه اﻳﺠﺎد ﻣﻲﻛﻨﺪ‪ .‬ﻟﺬا ﻣﻌﺮﻓﻲ روشﻫﺎﻳﻲ ﻛﻪ ﺑﺘﻮاﻧﺪ ﻣﻌﻴﺎرﻫﺎي ﺑﻬﺘﺮي ﺗﻌﺮﻳﻒ ﻛﺮده و ﻣﻮاردي را‬ ‫ﻛﻪ در ﮔﺮوه ﺳﻮم ﻗﺮار ﻣﻲﮔﻴﺮﻧﺪ ﻛﺎﻫﺶ دﻫﺪ‪ ،‬ارزﺷﻤﻨﺪ اﺳﺖ‪.‬‬

‫‪p16‬‬

‫ﻳﻚ ﻣﻬﺎرﻛﻨﻨﺪه ﺗﻘﺴﻴﻢ ﺳﻠﻮﻟﻲ اﺳﺖ ﻛﻪ اﺧﺘﻼل در‬

‫ﻋﻤﻠﻜﺮد آن در ﭘﺎﺗﻮژﻧﺰ ﺑﺮﺧﻲاز ﺑﺪﺧﻴﻤﻲﻫﺎ ﺛﺎﺑﺖ ﺷﺪهاﺳﺖ‪ .‬در اﻳﻦ ﻣﻄﺎﻟﻌﻪ ﺑﺮوز اﻳﻦ ﻣﺎرﻛﺮ در ﺳﻪ ﮔﺮوه ﻣﺬﻛﻮر ﺑﺮرﺳﻲ‬ ‫ﺷﺪ‪ .‬روش ﺑﺮرﺳﻲ‪ :‬ﺑﻠﻮكﻫﺎي ﭘﺎراﻓﻴﻨﻲ ‪ 62‬ﻣﻮرد ﻣﻴﻮﻣﺘﺮ ﻃﺒﻴﻌﻲ )‪ 62 ،(%45/6‬ﻣﻮرد ﻟﻴﻮﻣﻴﻮم )‪ (%45/6‬و ‪ 12‬ﻣﻮرد‬ ‫ﻟﻴﻮﻣﻴﻮﺳﺎرﻛﻮم )‪ (%8/8‬ﺑﺮاي ﻣﺎرﻛﺮ اﻳﻤﻮﻧﻮﻫﻴﺴﺘﻮﺷﻴﻤﻲ ‪ p16‬رﻧﮓآﻣﻴﺰي ﺷﺪه و ﺑﺮرﺳﻲ ﺷﺪﻧﺪ‪ .‬ﻳﺎﻓﺘﻪﻫﺎ‪ :‬ﺗﻤﺎﻣﻲ ‪ 62‬ﻣﻮرد‬ ‫ﺑﺎﻓﺖﻃﺒﻴﻌﻲ ﻣﻴﻮﻣﺘﺮ ﺑﺮايﻣﺎرﻛﺮ ‪ p16‬ﻣﻨﻔﻲﺷﺪﻧﺪ‪ ،‬اﻳﻦﻣﺎرﻛﺮ در ﺗﻌﺪاد ﻛﻤﻲاز ﻟﻴﻮﻣﻴﻮمﻫﺎ )ﭼﻬﺎر از ‪ 62‬ﻣﻮرد( ﺗﻨﻬﺎ ﺑﻪﺻﻮرت‬ ‫ﻣﻮﺿﻌﻲو ﺿﻌﻴﻒ ﻣﺜﺒﺖ ﺷﺪ وﻟﻲ در ﻟﻴﻮﻣﻴﻮﺳﺎرﻛﻮمﻫﺎ‪،‬‬

‫‪p16‬‬

‫ﻫﻤﻮاره ﺑﻪﺷﻜﻞ ﺷﺪﻳﺪ ﻣﺜﺒﺖ ﺑﻮد )در دو ﻣﻮرد ﺑﻪﺻﻮرت‬

‫ﻧﻴﻤﻪ ﻣﻨﺘﺸﺮ و در ‪ 10‬ﻣﻮرد ﺑﺎﻗﻲﻣﺎﻧﺪه ﺑﻪﺻﻮرت ﻣﻨﺘﺸﺮ(‪ .‬ﻧﺘﻴﺠﻪﮔﻴﺮي‪ :‬اﮔﺮ اﻳﻤﻮﻧﻮراﻛﺘﻴﻮﻳﺘﻲ ﺑﺮاي ﻣﺎرﻛﺮ‬ ‫ﺷﺪﻳﺪ و در ﺑﻴﺸﺘﺮ از ﻣﻮﺿﻌﻲ ﻣﺜﺒﺖ در ﻧﻈﺮ ﮔﺮﻓﺘﻪ ﺷﻮد‪ ،‬ﻟﻴﻮﻣﻴﻮﺳﺎرﻛﻮم ﺑﺮاي‬ ‫*‬

‫‪p16‬‬

‫‪p16‬‬

‫ﺑﻪﺻﻮرت‬

‫ﻣﺜﺒﺖ وﻟﻲ ﻟﻴﻮﻣﻴﻮم و ﺑﺎﻓﺖ ﻃﺒﻴﻌﻲ‬

‫ﻣﻴﻮﻣﺘﺮ ﻣﻨﻔﻲ اﺳﺖ و اﻳﻦ ﻣﻲﺗﻮاﻧﺪ ﺑﻪﻋﻨﻮان راﻫﻨﻤﺎي ﺧﻮﺑﻲ ﺑﺮاي دﺳﺘﻪﺑﻨﺪي ﺗﻮﻣﻮرﻫﺎي ﻋﻀﻠﻪ ﺻﺎف رﺣﻢ ﺑﻪﻛﺎر رود‪.‬‬ ‫ﻧﻮﻳﺴﻨﺪه ﻣﺴﺌﻮل‪ :‬ﺗﻬﺮان‪ ،‬ﺑﺰرﮔﺮاه ﺟﻼل آل اﺣﻤﺪ‪،‬‬

‫ﺑﻴﻤﺎرﺳﺘﺎن دﻛﺘﺮ ﺷﺮﻳﻌﺘﻲ‪ ،‬آزﻣﺎﻳﺸﮕﺎه ﻣﺮﻛﺰي‬ ‫ﺗﻠﻔﻦ‪0912-3705811 :‬‬ ‫‪email: forouhesh_z@yahoo.com‬‬

‫ﻛﻠﻤﺎت ﻛﻠﻴﺪي‪ :‬ﺗﻮﻣﻮرﻫﺎي ﻋﻀﻠﻪ ﺻﺎف رﺣﻢ‪ ،p16 ،‬اﻳﻤﻮﻧﻮﻫﻴﺴﺘﻮﺷﻴﻤﻲ‪ ،‬ﻟﻴﻮﻣﻴﻮم‪ ،‬ﻟﻴﻮﻣﻴﻮﺳﺎرﻛﻮم‪ ،‬ﺗﻮﻣﻮر ﻋﻀﻠﻪ ﺻـﺎف‬ ‫ﺑﺎ ﭘﺘﺎﻧﺴﻴﻞ ﻧﺎﻣﺸﺨﺺ ﺑﺪﺧﻴﻤﻲ‪.‬‬

‫ﻣﻘﺪﻣﻪ‬ ‫ﺗﻮﻣﻮرﻫﺎي ﻋﻀﻠﻪ ﺻﺎف رﺣﻢ ﺷﺎﻳﻊﺗﺮﻳﻦ ﻧﺌﻮﭘﻼﺳﻢﻫﺎي دﺳﺘﮕﺎه‬

‫و اﻳﻦ ﻧﻜﺘﻪ ﻛﻪ ﻟﻴﻮﻣﻴﻮﺳﺎرﻛﻮم ﺑﺴﻴﺎر ﺑﻪﻧﺪرت ﺣﺎﺻﻞ ﺗﺮاﻧﺴﻔﻮرﻣﺎﺳﻴﻮن‬ ‫ﻳﻚ ﻟﻴﻮﻣﻴﻮم اﺳﺖ ﻣﻄﻠﺐ ﻓﻮق را ﺗﺎﻳﻴﺪ ﻣﻲﻛﻨﺪ‪.‬‬

‫‪4-6‬‬

‫ﮔﺮوه ﺗﻮﻣﻮرﻫﺎي‬

‫ﺗﻨﺎﺳﻠﻲ زﻧﺎﻧﻪ ﻫﺴﺘﻨﺪ‪ 1‬ﻛﻪ ﺑﺮ اﺳﺎس ﺗﻌﺪاد ﻣﻴﺘﻮز‪ ،‬آﺗﻴﭙﻲ ﻫﺴﺘﻪ‪ ،‬ﻧﻜﺮوز‬

‫ﻋﻀﻠﻪ ﺻﺎف ﺑﺎ ﭘﺘﺎﻧﺴﻴﻞ ﻧﺎﻣﺸﺨﺺ ﺑﺪﺧﻴﻤﻲ دﺳﺘﻪ ﻏﻴﺮﻫﻤﮕﻮن از‬

‫اﻧﻌﻘﺎدي و ﺳﺎﻳﺮ ﺧﺼﻮﺻﻴﺎت ﻣﻮرﻓﻮﻟﻮژﻳﻚ ﻣﻲﺗﻮان آنﻫﺎ را ﺑﻪ ﺳﻪ‬

‫ﺗﻮﻣﻮرﻫﺎي ﻋﻀﻠﻪ ﺻﺎف رﺣﻢ ﻫﺴﺘﻨﺪ ﻛﻪ از ﻟﺤﺎظ ﻫﻴﺴﺘﻮﭘﺎﺗﻮﻟﻮژﻳﻚ‬

‫دﺳﺘﻪ ﻟﻴﻮﻣﻴﻮم ‪ ،Leiomyoma‬ﺗﻮﻣﻮرﻫﺎي ﻋﻀﻠﻪ ﺻﺎف ﺑﺎ ﭘﺘﺎﻧﺴﻴﻞ‬

‫ﺑﻪﻃﻮر ﻣﺸﺨﺺ در ﮔﺮوه ﻟﻴﻮﻣﻴﻮم و ﻳﺎ ﻟﻴﻮﻣﻴﻮﺳﺎرﻛﻮم ﻗﺮار ﻧﻤﻲﮔﻴﺮﻧﺪ و‬

‫ﻧﺎﻣﺸﺨﺺ ﺑﺪﺧﻴﻤﻲ و ﻟﻴﻮﻣﻴﻮﺳﺎرﻛﻮم ‪ Leiomyosarcoma‬ﺗﻘﺴﻴﻢ‬

‫ﺗﻨﻬﺎ ﮔﺬﺷﺖ زﻣﺎن و ﺳﻴﺮ ﻋﻼﻳﻢ ﺑﺎﻟﻴﻨﻲ ﻧﺸﺎن ﺧﻮاﻫﺪ داد ﻛﻪ ﺟﺰو ﻛﺪام‬

‫‪3‬و‪2‬‬

‫‪7‬‬

‫ﺗﺤﻘﻴﻘﺎت ﻧﺸﺎن داده اﺳﺖ ﻛﻪ ﻟﻴﻮﻣﻴﻮمﻫﺎ و ﻟﻴﻮﻣﻴﻮﺳﺎرﻛﻮمﻫﺎ‬

‫ﮔﺮوه ﺑﻮدهاﻧﺪ‪ .‬ﺑﺎ ﺗﻮﺟﻪ ﺑﻪ اﻳﻦﻛﻪ ﻟﻴﻮﻣﻴﻮم ﺑﺎ ﺳﻴﺮ ﻛﻠﻴﻨﻴﻜﻲ ﺧﻮشﺧﻴﻤﻲ‬

‫ﺗﻮﻣﻮرﻫﺎﻳﻲ ﺟﺪاﮔﺎﻧﻪ ﺑﻮده و اﻋﻀﺎي ﻳﻚ ﻃﻴﻒ ﺑﻴﻮﻟﻮژﻳﻚ ﻧﻤﻲﺑﺎﺷﻨﺪ‬

‫ﻫﻤﺮاه اﺳﺖ و ﻟﻴﻮﻣﻴﻮﺳﺎرﻛﻮم ﺳﻴﺮ ﺗﻬﺎﺟﻤﻲ ﺑﺪﺧﻴﻢ و ﻛﺸﻨﺪهاي دارد‪،‬‬

‫ﺑﻪﻃﻮري ﻛﻪ از ﻟﺤﺎظ ﻛﺮوﻣﻮزوﻣﻲ اﻛﺜﺮ ﻟﻴﻮﻣﻴﻮمﻫﺎ ﻛﺎرﻳﻮﺗﻴﭗ ﻧﺮﻣﺎل‬

‫ﻧﺎﻣﺸﺨﺺ ﺑﻮدن ﺳﻴﺮ ﻛﻠﻴﻨﻴﻜﻲ ﺗﻮﻣﻮرﻫﺎي ﻋﻀﻠﻪ ﺻﺎف ﺑﺎ ﭘﺘﺎﻧﺴﻴﻞ‬

‫داﺷﺘﻪ و ﺗﻨﻬﺎ ‪ %40‬آنﻫﺎ ﺗﻐﻴﻴﺮات ﺳﺎده ﻛﺮوﻣﻮزوﻣﻲ ﻧﺸﺎن ﻣﻲدﻫﻨﺪ در‬

‫ﻧﺎﻣﺸﺨﺺ ﺑﺪﺧﻴﻤﻲ‪ ،‬اﻗﺪاﻣﺎت درﻣﺎﻧﻲ ﺑﻬﻴﻨﻪ را ﺑﺎ ﻣﺸﻜﻞ ﻣﻮاﺟﻪ ﻣﻲﻛﻨﺪ‬

‫ﺣﺎﻟﻲ ﻛﻪ ﻟﻴﻮﻣﻴﻮﺳﺎرﻛﻮمﻫﺎ ﺗﻐﻴﻴﺮات ﭘﻴﭽﻴﺪة ﻛﺮوﻣﻮزوﻣﻲ ﻧﺸﺎن ﻣﻲدﻫﻨﺪ‬

‫ﻟﺬا ﻛﺎﻫﺶ ﺗﻌﺪاد ﻣﻮاردي ﻛﻪ در اﻳﻦ ﮔﺮوه ﻗﺮار ﻣﻲﮔﻴﺮﻧﺪ و ﺗﻌﻴﻴﻦ‬

‫ﻛﺮد‪.‬‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬


‫زﻫﺮا ﻓﺮوﻫﺶ ﺗﻬﺮاﻧﻲ و ﻫﻤﻜﺎران‬

‫‪517‬‬

‫دﻗﻴﻖﺗﺮ و ﻳﺎ ﺑﻬﺘﺮ ﺗﻌﺎرﻳﻒ ﻟﻴﻮﻣﻴﻮم و ﻟﻴﻮﻣﻴﻮﺳﺎرﻛﻮم ارزﺷﻤﻨﺪ ﺑﻮده و از‬

‫ﻣﻴﻮﻣﺘﺮ ﻃﺒﻴﻌﻲ‪ ،‬ﻟﻴﻮﻣﻴﻮم و ﻟﻴﻮﻣﻴﻮﺳﺎرﻛﻮم ﻣﻮﺟﻮد در ﺑﺨﺶ ﭘﺎﺗﻮﻟﻮژي‬

‫اﻳﻦ ﻃﺮﻳﻖ ﻣﻲﺗﻮان ﺑﺎ ﺑﺮﺧﻮرد درﻣﺎﻧﻲ ﻣﻨﺎﺳﺐ از وﻗﻮع ﻣﺘﺎﺳﺘﺎزﻫﺎي‬

‫ﺑﻴﻤﺎرﺳﺘﺎن دﻛﺘﺮ ﺷﺮﻳﻌﺘﻲ از اﺑﺘﺪاي ﺳﺎل ‪ 1372‬ﻟﻐﺎﻳﺖ اﻧﺘﻬﺎي ﺳﺎل‬

‫ﻛﺸﻨﺪه‪ ،‬ﻋﻮارض ﺑﺎﻟﻘﻮه ﺧﻄﺮﻧﺎك و ﻧﻴﺰ ﺻﺮف ﻫﺰﻳﻨﻪﻫﺎي اﺿﺎﻓﻲ ﺟﻬﺖ‬

‫‪ 1387‬ﺟﻤﻊآوري ﺷﺪه و ﺑﺮرﺳﻲ ﺷﺪﻧﺪ‪ .‬از ﻣﻴﺎن ﺗﻤﺎم ﻧﻤﻮﻧﻪﻫﺎي رﺣﻢ‬

‫‪Cyclin-‬‬

‫ﻃﺒﻴﻌﻲ و ﻧﻤﻮﻧﻪﻫﺎي ﻟﻴﻮﻣﻴﻮم از ﻫﺮ ﻛﺪام ‪ 62‬ﻣﻮرد ﺑﻪﺻﻮرت اﺗﻔﺎﻗﻲ‬

‫‪ dependent kinase-4‬اﺳﺖ اﻳﻦ ﭘﺮوﺗﻴﻴﻦ در ارﮔﺎﻧﻞﻫﺎي ﺳﻴﺘﻮﭘﻼﺳﻤﻲ‬

‫اﻧﺘﺨﺎب ﺷﺪﻧﺪ و از ﻣﻴﺎن ‪ 14‬ﻣﻮرد ﺑﺎ ﺗﺸﺨﻴﺺ ﻟﻴﻮﻣﻴﻮﺳﺎرﻛﻮم ﭘﺲ از‬

‫ﺳﺎﺧﺘﻪ ﺷﺪه و ﭘﺲ از اﻧﺘﻘﺎل ﺑﻪ ﻫﺴﺘﻪ ﺑﺎ ﺑﻠﻮك ﻛﺮدن ﻓﺴﻔﺮﻳﻼﺳﻴﻮن‬

‫ﺑﺮرﺳﻲ ﻣﺠﺪد دو ﻣﻮرد ﻓﺎﻗﺪ ﻣﻌﻴﺎرﻫﺎي ﻻزم ﺑﺮ اﺳﺎس ﻃﺒﻘﻪﺑﻨﺪي‪-‬‬

‫ﭘﻲﮔﻴﺮي ﺑﻴﻤﺎران ﺧﻮشﺧﻴﻢ ﺟﻠﻮﮔﻴﺮي ﻛﺮد‪ p16 .‬ﻣﻬﺎرﻛﻨﻨﺪة‬

‫ﺳﻮﺑﺴﺘﺮاي ‪ Cdk4‬ﺳﺒﺐ ﺗﻮﻗﻒ ﭼﺮﺧﻪ ﺳﻠﻮل در ﻣﺮﺣﻠﻪ‬

‫‪G1‬‬

‫ﻣﻲﺷﻮد‪،‬‬

‫ﻫﺎي ﺣﺎﺿﺮ ﺷﻨﺎﺧﺘﻪ ﺷﺪه و از ﻣﻄﺎﻟﻌﻪ ﺧﺎرج ﺷﺪﻧﺪ و ‪ 12‬ﻣﻮرد ﺑﺎﻗﻲ‬

‫‪8-10‬‬

‫وارد ﻣﻄﺎﻟﻌﻪ ﺷﺪﻧﺪ‪ .‬ﺳﭙﺲ از ﻫﺮ ﻧﻤﻮﻧﻪ‪ ،‬ﺑﻠﻮكﻫﺎي ﻣﻨﺎﺳﺐ ﺟﻬﺖ‬

‫و‬

‫ﺑﺮرﺳﻲ اﻳﻤﻮﻧﻮﻫﻴﺴﺘﻮﺷﻴﻤﻲ ﻳﻌﻨﻲ ﺑﻠﻮكﻫﺎﻳﻲ ﻛﻪ ﺑﺎﻓﺖ ﻛﺎﻓﻲ داﺷﺘﻪ و‬

‫ﻧﻘﺺ در ﺗﻮﻟﻴﺪ و ﻋﻤﻠﻜﺮد اﻳﻦ ﭘﺮوﺗﻴﻴﻦ در ﻛﺎﻧﺴﺮﻫﺎي ﻛﻮﻟﻮرﻛﺘﺎل‪،‬‬ ‫‪11‬‬

‫ﭘﺴﺘﺎن‪،‬‬

‫‪12‬‬

‫رﻳﻪ‪،‬‬

‫‪13‬‬

‫ﻣﻐﺰ و ﺳﻴﺴﺘﻢ ﻋﺼﺒﻲ ﻣﺮﻛﺰي‪،‬‬

‫‪14‬‬

‫ﺳﺮوﮔﺮدن‬

‫‪15‬‬

‫ﺗﺮوﻓﻮﺑﻼﺳﺘﻴﻚ ﻧﻘﺶ داﺷﺘﻪ اﺳﺖ‪ .‬در اﻳﻦ ﻣﻄﺎﻟﻌﻪ ﺳﻌﻲ ﺷﺪه اﺳﺖ ﺑﺎ‬

‫ﺗﺮﺟﻴﺤﺎً ﻛﻤﺘﺮﻳﻦ ﻧﻜﺮوز و ﻳﺎ ﻫﻤﻮراژي را داﺷﺘﻪ ﺑﺎﺷﻨﺪ اﻧﺘﺨﺎب ﺷﺪﻧﺪ‪.‬‬

‫ﺑﺮرﺳﻲ ﻣﻴﺰان و ﻧﺤﻮه ﺑﺮوز ﻣﺎرﻛﺮ اﻳﻤﻮﻧﻮﻫﻴﺴﺘﻮﺷﻴﻤﻲ ‪ p16‬ﺑﺘﻮان ﻣﻌﻴﺎر‬

‫اﻳﻦ ﺑﻠﻮكﻫﺎ ﺟﻬﺖ رﻧﮓآﻣﻴﺰي اﻳﻤﻮﻧﻮﻫﻴﺴﺘﻮﺷﻴﻤﻲ ﺑﻪ ﻗﻄﺮ ﺳﻪ‬

‫ﺑﻬﺘﺮي ﺟﻬﺖ ﻃﺒﻘﻪﺑﻨﺪي دﻗﻴﻖﺗﺮ ﺗﻮﻣﻮرﻫﺎي ﻋﻀﻠﻪ ﺻﺎف رﺣﻢ ﺑﻪدﺳﺖ‬

‫ﻣﻴﻜﺮوﻣﺘﺮ ﺑﺮش ﻣﺠﺪد ﺧﻮرده و ﺑﺮ روي ﻻم ﭘﻠﻲﻻﻳﺰﻳﻦ ﻗﺮار ﮔﺮﻓﺘﻨﺪ‪.‬‬

‫آورد و ﺑﻴﻤﺎران در رﻳﺴﻚ ﺑﺎﻻي ﺑﺪﺧﻴﻤﻲ را ﭘﻲﮔﻴﺮي دﻗﻴﻖ ﻧﻤﻮد‪.‬‬

‫ﭘﺲ از اﻧﺠﺎم ‪ ،Antigen retrieval‬آﻧﺘﻲﺑﺎدي ﻣﻮﻧﻮﻛﻠﻮﻧﺎل ﺑﺮ ﻋﻠﻴﻪ‬

‫‪p16‬‬

‫)‪ (Mouse monoclonal IgG2, Santacruz co. Germany‬ﻛﻪ ﺑﻪ ﻧﺴﺒﺖ‬

‫روش ﺑﺮرﺳﻲ‬

‫ﻳﻚ ﺑﻪ ﻫﺰار و ﺷﺸﺼﺪ رﻗﻴﻖ ﺷﺪه ﺑﻮد اﺿﺎﻓﻪ ﺷﺪه و ﺑﻌﺪ از ﺷﺴﺘﺸﻮ‪،‬‬

‫ﺑﺮاي اﻧﺠﺎم اﻳﻦ ﻣﻄﺎﻟﻌﻪ ﻛﻪ از ﻧﻮع ﻣﻘﻄﻌﻲ )‪ (Cross sectional‬ﻣﻲﺑﺎﺷﺪ‪،‬‬

‫ﻛﺮوﻣﻮژن ﺑﺎ ﻓﺎﺻﻠﻪ زﻣﺎﻧﻲ ﺗﻮﺻﻴﻪ ﺷﺪه در راﻫﻨﻤﺎي ﻛﻴﺖ ﻣﺮﺑﻮﻃﻪ اﺿﺎﻓﻪ‬

‫ﻛﻠﻴـﻪ ﺑﻠﻮكﻫﺎي ﭘﺎراﻓﻴـﻨﻲ ﻣﺮﺑﻮط ﺑﻪ ﻣﻮارد ﻫﻴـﺴﺘﺮﻛﺘﻮﻣﻲ ﺑـﺎ ﺗﺸﺨﻴـﺺ‬

‫ﺷﺪ‪ .‬ﺑﺮاي ﺗﺎﻳـﻴﺪ ﺻﺤﺖ و دﻗﺖ رﻧﮓآﻣﻴـﺰي ﻫﻤﺰﻣﺎن ﻛـﻨﺘﺮل ﻣﻨﻔﻲ ﻫﻢ‬

‫ﺷﻜﻞ‪ :1-‬رﻧﮓﭘﺬﻳﺮي ﻣﻨﺘﺸﺮ و ﻗﻮي ﻣﺎرﻛﺮ ‪ p16‬در ﺗﻮﻣﻮر ﺑﺪﺧﻴﻢ ﻣﻴﻮﻣﺘﺮ‬

‫ﺷﻜﻞ‪ :3-‬ﻋﺪم رﻧﮓﭘﺬﻳﺮي ﻣﺎرﻛﺮ ‪ p16‬در ﺗﻮﻣﻮر ﺧﻮشﺧﻴﻢ ﻣﻴﻮﻣﺘﺮ‬

‫ﺷﻜﻞ‪ :2-‬رﻧﮓﭘﺬﻳﺮي ﻣﻮﺿﻌﻲ و ﺿﻌﻴﻒ ﻣﺎرﻛﺮ ‪ p16‬در ﺗﻮﻣﻮر ﺧﻮشﺧﻴﻢ ﻣﻴﻮﻣﺘﺮ‬

‫ﺷﻜﻞ‪ :4-‬ﻋﺪم رﻧﮓﭘﺬﻳﺮي ﻣﺎرﻛﺮ ‪ p16‬در ﺑﺎﻓﺖ ﻃﺒﻴﻌﻲ ﻣﻴﻮﻣﺘﺮ‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬


‫ﺑﺮوز ﻣﺎرﻛﺮ ‪ IHC P16‬در ﻟﻴﻮﻣﻴﻮم‪ ،‬ﻟﻴﻮﻣﻴﻮﺳﺎرﻛﻮم و ﺑﺎﻓﺖ ﻃﺒﻴﻌﻲ ﻣﻴﻮﻣﺘﺮ‬

‫‪518‬‬

‫ﺑﻪﺻﻮرت ﻛﻨﺘﺮل ﺧﺎرﺟﻲ و ﻫﻢ ﻛﻨﺘﺮل داﺧﻠﻲ )دﻳﻮاره ﻋﺮوق( و ﻛﻨﺘﺮل‬

‫رﻧﮓﭘﺬﻳﺮي ﻣﺸﺎﻫﺪه ﻧﺸﺪ )ﺟﺪول ‪ .(1‬از ﻟﺤﺎظ ﺷﺪت رﻧﮓﭘﺬﻳﺮي ﺑﺮاي‬

‫ﻣﺜﺒﺖ ﻧﻴـﺰ ﺑﻪ ﺻﻮرت ﻛﻨﺘﺮل ﺧﺎرﺟـﻲ اﻧﺠﺎم ﺷﺪ‪ .‬در ﻧﻬﺎﻳـﺖ ﻛﻠﻴﻪ ﻻمﻫﺎ‬

‫ﻣﺎرﻛﺮ ‪ p16‬از ‪ 12‬ﻣﻮرد ﻟﻴﻮﻣﻴﻮﺳﺎرﻛﻮم ﻫﻤﺔ آنﻫﺎ ﺑﻪﺻﻮرت ﺷﺪﻳﺪ رﻧﮓ‬

‫ﺑﻪﻃﻮر ﺟﺪاﮔﺎﻧﻪ ﺑﺮرﺳﻲ ﺷﺪه و از ﻟﺤﺎظ ﻣﻴﺰان ﺑﺮوز ‪ p16‬ﺑﻪ ﭼﻬﺎر ﮔﺮوه‬

‫ﮔﺮﻓﺘﻪ ﺑﻮدﻧﺪ وﻟﻲ از ‪ 62‬ﻣﻮرد ﻟﻴﻮﻣﻴﻮم ﺗﻨﻬﺎ ﭼﻬﺎر ﻣﻮرد رﻧﮓﭘﺬﻳﺮي‬

‫ﻣﻨﻔﻲ‪ ،‬ﻣﻮﺿﻌﻲ )‪ %1-33‬ﺳﻠﻮلﻫﺎ(‪ ،‬ﻧﻴﻤﻪ ﻣﻨﺘﺸﺮ )‪ %34‬ﺗﺎ ‪ %66‬ﺳﻠﻮلﻫﺎ(‬

‫ﺑﻪﺻﻮرت ﺿﻌﻴﻒ را ﻧﺸﺎن دادﻧﺪ و ﻫﻴﭻﻳﻚ از ﻣﻮارد ﺑﺎﻓﺖ ﻃﺒﻴﻌﻲ‬

‫و ﻣﻨﺘﺸﺮ )‪ %67‬ﺗﺎ ‪ %100‬ﺳﻠﻮلﻫﺎ( و از ﻟﺤﺎظ ﺷﺪت رﻧﮓﭘﺬﻳﺮي ﺑﻪ ﺳﻪ‬

‫ﻣﻴﻮﻣﺘﺮ رﻧﮓﭘﺬﻳﺮي ﻧﺪاﺷﺘﻨﺪ )ﺟﺪول ‪ .(2‬ﺑﺎ ﺗﻮﺟﻪ ﺑﻪ ﻳﺎﻓﺘﻪﻫﺎي ﻓﻮق ﻫﻢ‬

‫ﮔﺮوه ﺿﻌﻴﻒ )اﮔﺮ رﻧﮓﭘﺬﻳﺮي ﺗﻨﻬﺎ ﺑﺎ ﺑﺰرﮔﻨﻤﺎﻳﻲ ‪ 400‬ﺑﺮاﺑﺮ ﻗﺎﺑﻞ‬

‫ﺑﺮاي ﺷﺪت رﻧﮓﭘﺬﻳﺮي و ﻫﻢ ﺑﺮاي درﺻﺪ رﻧﮓﭘﺬﻳﺮي از ﻟﺤﺎظ آﻣﺎري‬

‫ﺷﻨﺎﺳﺎﻳﻲ ﺑﺎﺷﺪ(‪ ،‬ﻣﺘﻮﺳﻂ )اﮔﺮ رﻧﮓﭘﺬﻳﺮي ﺑﺎ ﺑﺰرﮔﻨﻤﺎﻳﻲ ‪ 100‬ﺑﺮاﺑﺮ ﻗﺎﺑﻞ‬

‫اﺧﺘﻼف ﻣﻌﻨﻲداري ﻣﻴﺎن ﻟﻴﻮﻣﻴﻮﺳﺎرﻛﻮم و ﻟﻴﻮﻣﻴﻮم وﺟﻮد دارد‬

‫ﺷﻨﺎﺳﺎﻳﻲ ﺑﺎﺷﺪ( و ﺷﺪﻳﺪ )رﻧﮓﭘﺬﻳﺮي ﺑﺎ ﺑﺰرﮔﻨﻤﺎﻳﻲ ‪ 40‬ﺑﺮاﺑﺮ ﻗﺎﺑﻞ‬

‫)‪ (p<0/001‬و ﻣﻴﺎن ﻟﻴﻮﻣﻴﻮﺳﺎرﻛﻮم و ﺑﺎﻓﺖ ﻃﺒﻴﻌﻲ ﻣﻴﻮﻣﺘﺮ ﻧﻴﺰ از ﻟﺤﺎظ‬

‫‪SPSS‬‬

‫آﻣﺎري اﺧﺘﻼف ﻣﻌﻨﻲدار اﺳﺖ )‪ (p<0/001‬وﻟﻲ اﺧﺘﻼف ﻣﻴﺎن ﻟﻴﻮﻣﻴﻮم‬

‫ﺷﻨﺎﺳﺎﻳﻲ ﺑﺎﺷﺪ( ﺗﻘﺴﻴﻢﺑﻨﺪي ﺷﺪﻧﺪ‪ .‬ﺳﭙﺲ ﺑﺎ اﺳﺘﻔﺎده از ﻧﺮماﻓﺰار‬

‫وﻳﺮاﺳﺖ ‪ ،17‬آﻧﺎﻟﻴﺰ دادهﻫﺎي ﻛﻤ‪‬ﻲ و ﻛﻴﻔﻲ اﻧﺠﺎم ﺷﺪ‪ .‬ﺟﻬﺖ ﻣﻘﺎﻳﺴﻪ‬ ‫ﻣﺘﻐﻴﺮﻫﺎ از آزﻣﻮن‬

‫‪2‬‬

‫‪‬‬

‫و ﺑﺎﻓﺖ ﻃﺒﻴﻌﻲ ﻣﻴﻮﻣﺘﺮ از ﻟﺤﺎظ آﻣﺎري ﻣﻌﻨﻲدار ﻧﻤﻲﺑﺎﺷﺪ )‪.(p= 3/6‬‬

‫اﺳﺘﻔﺎده ﺷﺪ‪ .‬ﻧﻤﻮدارﻫﺎ و ﺟﺪاول ﺗﻬﻴﻪ ﺷﺪه و در‬

‫ﻧﻬﺎﻳﺖ ارﺗﺒﺎط ﺑﻴﻦ ﻣﺘﻐﻴﺮﻫﺎي واﺑﺴﺘﻪ و ﻣﺴﺘﻘﻞ ﺳﻨﺠﻴﺪه ﺷﺪﻧﺪ‪.‬‬

‫‪p<0/05‬‬

‫ﺑﺤﺚ‬ ‫ﺑﺮ اﺳﺎس ﻳﺎﻓﺘﻪﻫﺎي اﻳﻦ ﻣﻄﺎﻟﻌﻪ ﻣﺎرﻛﺮ اﻳﻤﻮﻧﻮﻫﻴﺴﺘﻮﺷﻴﻤﻲ ‪ p16‬در‬

‫از ﻟﺤﺎظ آﻣﺎري ﻣﻌﻨﻲدار در ﻧﻈﺮ ﮔﺮﻓﺘﻪ ﺷﺪ‪.‬‬

‫ﺑﺎﻓﺖ ﻃﺒﻴﻌﻲ ﻣﻴﻮﻣﺘﺮ )‪ 62‬ﻣﻮرد( ﻛﺎﻣﻼً ﻣﻨﻔﻲ ﻣﻲﺑﺎﺷﺪ و در ﺗﻌﺪاد ﻛﻤﻲ‬

‫ﻳﺎﻓﺘﻪﻫﺎ‬

‫از ﻟﻴﻮﻣﻴﻮمﻫﺎي رﺣﻤﻲ )ﭼﻬﺎر ﻣﻮرد از ‪ 62‬ﻣﻮرد( ﺗﻨﻬﺎ ﺑﻪﺻﻮرت‬

‫از ﻟﺤﺎظ ﻣﻴﺰان و درﺻﺪ رﻧﮓﭘﺬﻳﺮي ﺑﺮاي ﻣﺎرﻛﺮ ‪ p16‬از ‪ 12‬ﻣﻮرد‬

‫ﻣﻮﺿﻌﻲ )‪ %1-33‬ﺳﻠﻮلﻫﺎ( و ﺿﻌﻴﻒ ﻣﺜﺒﺖ ﻣﻲﺷﻮد وﻟﻲ در ﺗﻤﺎﻣﻲ‬

‫ﻟﻴﻮﻣﻴﻮﺳﺎرﻛﻮم‪ 10 ،‬ﻣﻮرد ﺑﻪﺻﻮرت ﻣﻨﺘﺸﺮ )‪ (%67-100‬و دو ﻣﻮرد‬

‫ﻣﻮارد ﻟﻴﻮﻣﻴﻮﺳﺎرﻛﻮم اﻳﻦ رﻧﮓﭘﺬﻳﺮي ﺑﻴﺸﺘﺮ اﺳﺖ ﺑﻪﻃﻮري ﻛﻪ در دو‬

‫ﺑﻪﺻﻮرت ﻧﻴﻤﻪ ﻣﻨﺘﺸﺮ )‪ %60‬و‪ (%50‬رﻧﮓﭘﺬﻳﺮي ﻧﺸﺎن دادﻧﺪ‪ .‬ﻫﻤﻪ آنﻫﺎ‬

‫ﻣﻮرد ﺑﻪﺻﻮرت ﻧﻴﻤﻪ ﻣﻨﺘﺸﺮ )‪ (%34-66‬و در ‪ 10‬ﻣﻮرد ﺑﺎﻗﻲ ﻣﺎﻧﺪه‬

‫رﻧﮓﭘﺬﻳﺮي ﻫﺴﺘﻪاي و ﺳﻴﺘﻮﭘﻼﺳﻤﻲ را ﺑﻪﻃﻮر ﻫﻤﺰﻣﺎن و ﺑﻪ ﻧﺴﺒﺖﻫﺎي‬

‫ﺑﻪﺻﻮرت ﻣﻨﺘﺸﺮ )‪ (%67-100‬و آن ﻫﻢ ﻫﻤﻮاره ﺑﻪﺷﻜﻞ ﺷﺪﻳﺪ ﻣﺜﺒﺖ‬

‫ﻣﺘﻔﺎوت ﻧﺸﺎن دادﻧﺪ از ‪ 62‬ﻣﻮرد ﻟﻴﻮﻣﻴﻮم‪ ،‬در ‪ 58‬ﻣﻮرد ﻫﻴﭻﻳﻚ از‬

‫اﺳﺖ‪ .‬اﻳﻦ ﻧﺘﺎﻳﺞ ﻧﺸﺎندﻫﻨﺪه اﺧﺘﻼف ﻣﻌﻨﻲدار آﻣﺎري ﻫﻢ از ﻟﺤﺎظ ﻣﻴﺰان‬

‫ﺳﻠﻮلﻫﺎ رﻧﮓ ﻧﮕﺮﻓﺘﻨﺪ و ﭼﻬﺎر ﻣﻮرد ﺑﻪﺻﻮرت ﻣﻮﺿﻌﻲ )‪(%1-33‬‬

‫و درﺻﺪ رﻧﮓﭘﺬﻳﺮي و ﻫﻢ از ﻟﺤﺎظ ﺷﺪت رﻧﮓﭘﺬﻳﺮي ﻣﻴﺎن‬

‫رﻧﮓﭘﺬﻳﺮي ﻧﺸﺎن دادﻧﺪ و از ‪ 62‬ﻣﻮرد ﺑﺎﻓﺖ ﻃﺒﻴﻌﻲ ﻣﻴﻮﻣﺘﺮ در ﻫﻴﭻﻳﻚ‬

‫ﻟﻴﻮﻣﻴﻮﺳﺎرﻛﻮم و ﻟﻴﻮﻣﻴﻮم و ﻳﺎ ﻣﻴﺎن ﻟﻴﻮﻣﻴﻮﺳﺎرﻛﻮم و ﺑﺎﻓﺖ ﻃﺒﻴﻌﻲ ﻣﻴﻮﻣﺘﺮ‬

‫ﺟﺪول‪ :1-‬ﻣﻴﺰان و درﺻﺪ رﻧﮓﭘﺬﻳﺮي ﺑﺮاي ﻣﺎرﻛﺮ ‪ p16‬در ﻟﻴﻮﻣﻴﻮم‪ ،‬ﻟﻴﻮﻣﻴﻮﺳﺎرﻛﻮم و ﺑﺎﻓﺖ ﻃﺒﻴﻌﻲ ﻣﻴﻮﻣﺘﺮ‬ ‫ﻣﺠﻤﻮع‬

‫ﻣﻨﻔﻲ‬

‫ﻣﻮﺿﻌﻲ )‪(%1-33‬‬

‫ﻧﻴﻤﻪ ﻣﻨﺘﺸﺮ )‪(%34 -66‬‬

‫ﻣﻨﺘﺸﺮ )‪(%67 -100‬‬

‫ﻧﻮع ﺑﺎﻓﺖ‬ ‫ﻟﻴﻮﻣﻴﻮﺳﺎرﻛﻮم‬

‫‪12‬‬

‫ﺻﻔﺮ‬

‫ﺻﻔﺮ‬

‫‪2‬‬

‫‪10‬‬

‫ﻟﻴﻮﻣﻴﻮم‬

‫‪62‬‬

‫‪58‬‬

‫‪4‬‬

‫ﺻﻔﺮ‬

‫ﺻﻔﺮ‬

‫ﻣﻴﻮﻣﺘﺮ ﻃﺒﻴﻌﻲ‬

‫‪62‬‬

‫‪62‬‬

‫ﺻﻔﺮ‬

‫ﺻﻔﺮ‬

‫ﺻﻔﺮ‬

‫ﺟﺪول‪ :2-‬ﺷﺪت رﻧﮓﭘﺬﻳﺮي ﺑﺮاي ﻣﺎرﻛﺮ ‪ p16‬در ﻟﻴﻮﻣﻴﻮم‪ ،‬ﻟﻴﻮﻣﻴﻮﺳﺎرﻛﻮم و ﺑﺎﻓﺖ ﻃﺒﻴﻌﻲ ﻣﻴﻮﻣﺘﺮ‬ ‫ﻣﺠﻤﻮع‬

‫ﻣﻨﻔﻲ‬

‫ﺿﻌﻴﻒ‬

‫ﻣﺘﻮﺳﻂ‬

‫ﻗﻮي‬

‫ﻧﻮع ﺑﺎﻓﺖ‬ ‫ﻟﻴﻮﻣﻴﻮﺳﺎرﻛﻮم‬

‫‪12‬‬

‫ﺻﻔﺮ‬

‫ﺻﻔﺮ‬

‫ﺻﻔﺮ‬

‫‪12‬‬

‫ﻟﻴﻮﻣﻴﻮم‬

‫‪62‬‬

‫‪58‬‬

‫‪4‬‬

‫ﺻﻔﺮ‬

‫ﺻﻔﺮ‬

‫ﻣﻴﻮﻣﺘﺮ ﻃﺒﻴﻌﻲ‬

‫‪62‬‬

‫‪62‬‬

‫ﺻﻔﺮ‬

‫ﺻﻔﺮ‬

‫ﺻﻔﺮ‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬


‫ﺗﻬﺮاﻧﻲ و ﻫﻤﻜﺎران‬ ‫ﻓﺮوﻫﺶ‬ ‫زﻫﺮا‬ ‫‪Forouhesh‬‬ ‫‪Tehrani‬‬ ‫‪Z. et‬‬ ‫‪al.‬‬

‫‪519‬‬

‫ﻣﻲﺑﺎﺷﺪ‪ .‬وﻟﻲ اﺧﺘﻼف ﻣﻌﻨﻲداري ﻣﻴﺎن ﻟﻴﻮﻣﻴﻮم و ﺑﺎﻓﺖ ﻃﺒﻴﻌﻲ ﻣﻴﻮﻣﺘﺮ‬

‫داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ زﻧﺠﺎن‪ 21 ،‬ﻣﻮرد ﻟﻴﻮﻣﻴﻮم و ‪ 21‬ﻣﻮرد‬

‫از ﻟﺤﺎظ آﻣﺎري ﻳﺎﻓﺖ ﻧﺸﺪ‪ .‬ﻧﺘﺎﻳﺞ ﺣﺎﺻﻞ از ﻣﻄﺎﻟﻌﻪ ‪ O'Neill‬در ﺳﺎل‬

‫ﻟﻴﻮﻣﻴﻮﺳﺎرﻛﻮم از ﻟﺤﺎظ ﻣﺎرﻛﺮﻫﺎي ﻣﺨﺘﻠﻒ اﻳﻤﻮﻧﻮﻫﻴﺴﺘﻮﺷﻴﻤﻲ از ﺟﻤﻠﻪ‬

‫‪ 2007‬ﺑﺮ روي ‪ 37‬ﻣﻮرد ﻟﻴﻮﻣﻴﻮم و ‪ 22‬ﻣﻮرد ﻟﻴﻮﻣﻴﻮﺳﺎرﻛﻮم اﻧﺠﺎم ﺷﺪ‬

‫‪ p16‬ﺑﺮرﺳﻲ ﺷﺪﻧﺪ‪ .‬ﻣﻄﺎﻟﻌﻪ آنﻫﺎ ﻧﺸﺎن داد ﻛﻪ ‪ p16‬در ﻫﻴﭻﻳﻚ از‬

‫ﻧﻴﺰ ﻧﺸﺎندﻫﻨﺪه اﺧﺘﻼف آﻣﺎري ﻣﻌﻨﻲدار ﺑﺮاي رﻧﮓﭘﺬﻳﺮي ﻣﺎرﻛﺮ‬

‫ﻟﻴﻮﻣﻴﻮمﻫﺎي رﺣﻤﻲ ﻣﺜﺒﺖ ﻧﺒﻮد وﻟﻲ ﺗﻨﻬﺎ در ‪ %42/1‬از ﻟﻴﻮﻣﻴﻮﺳﺎرﻛﻮمﻫﺎ‬

‫اﻳﻤﻮﻧﻮﻫﻴﺴﺘﻮﺷﻴﻤﻲ ‪ p16‬ﻣﻴﺎن اﻳﻦ دو ﮔﺮوه ﺑﻮد‪ 16‬ﻛﻪ ﺑﺎ ﻧﺘﺎﻳﺞ ﺑﻪدﺳﺖ‬

‫ﻣﺜﺒﺖ ﺑﻮد‪ .‬ﺗﻔﺎوت ﻣﻮﺟﻮد در ﻧﺘﺎﻳﺞ اﻳﻦ ﻣﻄﺎﻟﻌﻪ و ﻣﻄﺎﻟﻌﻪ ﻣﺎ ﻣﻲﺗﻮاﻧﺪ‬

‫آﻣﺪه از ﻣﻄﺎﻟﻌﻪ ﻣﺎ ﻫﻤﺨﻮاﻧﻲ داﺷﺖ‪ .‬در ﺳﺎل ‪ Kristen 2008‬ﺑﻪ ﺑﺮرﺳﻲ‬

‫ﺑﻪدﻟﻴﻞ آن ﺑﺎﺷﺪ ﻛﻪ آنﻫﺎ رﻧﮓآﻣﻴﺰي ﻫﺴﺘﻪاي را ﺑﻪﻋﻨﻮان ﻣﺜﺒﺖ در ﻧﻈﺮ‬

‫ﻣﺎرﻛﺮ ‪ p16‬در ﺗﻮﻣﻮرﻫﺎي ﻋﻀﻠﻪ ﺻﺎف رﺣﻢ ﭘﺮداﺧﺖ و آن را ﺑﺮ روي‬

‫ﮔﺮﻓﺘﻨﺪ وﻟﻲ در ﺑﺮرﺳﻲ ﻣﺎ‪ ،‬ﻫﻢ رﻧﮓﭘﺬﻳﺮي ﺳﻴﺘﻮﭘﻼﺳﻤﻲ و ﻫﻢ‬

‫‪ 22‬ﻣﻮرد ﻟﻴﻮﻣﻴﻮم‪ 15 ،‬ﻣﻮرد ﻟﻴﻮﻣﻴﻮﺳﺎرﻛﻮم و ﻫﺸﺖ ﻣﻮرد ﺗﻮﻣﻮر ﻋﻀﻠﻪ‬

‫رﻧﮓﭘﺬﻳﺮي ﻫﺴﺘﻪاي ﺑﻪﻋﻨﻮان ﻣﺜﺒﺖ در ﻧﻈﺮ ﮔﺮﻓﺘﻪ ﺷﺪ‪) .‬زﻳﺮا اوﻻً ﻣﺤﻞ‬

‫ﺻﺎف رﺣﻢ ﺑﺎ ﭘﺘﺎﻧﺴﻴﻞ ﻧﺎﻣﺸﺨﺺ ﺑﺪﺧﻴﻤﻲ و ‪ 10‬ﻣﻮرد ﻣﻴﻮﻣﺘﺮ ﻃﺒﻴﻌﻲ‬

‫ﺗﻮﻟﻴﺪ اﻳﻦ ﭘﺮوﺗﻴﻴﻦ در ارﮔﺎﻧﻞﻫﺎي ﺳﻴﺘﻮﭘﻼﺳﻤﻲ ﺑﻮده و ﭘﺲ از ﺗﻮﻟﻴﺪ ﺑﻪ‬

‫ﺑﺮرﺳﻲ ﻛﺮد و ﻧﺸﺎن داد در ‪ 12‬ﻣﻮرد از ‪ 15‬ﻣﻮرد ﻟﻴﻮﻣﻴﻮﺳﺎرﻛﻮم اﻳﻦ‬

‫ﻫﺴﺘﻪ ﻣﻨﺘﻘﻞ ﻣﻲﺷﻮد و در ﺛﺎﻧﻲ در ﺳﺎﻳﺮ ﻣﻄﺎﻟﻌﺎت ﻣﺸﺎﺑﻪ ﻧﻴﺰ ﻫﻢ‬

‫ﻣﺎرﻛﺮ ﺑﻪﻃﻮر ﻗﻮي و ﻣﻨﺘﺸﺮ ﻣﺜﺒﺖ ﺑﻮد‪ ،‬ﺳﻪ ﻣﻮرد از ﻟﻴﻮﻣﻴﻮمﻫﺎ ﺑﻪﻃﻮر‬

‫رﻧﮓﭘﺬﻳﺮي ﺳﻴﺘﻮﭘﻼﺳﻤﻲ و ﻫﻢ رﻧﮓﭘﺬﻳﺮي ﻫﺴﺘﻪاي ﭘﺬﻳﺮﻓﺘﻪ ﺷﺪه‬

‫ﻣﻮﺿﻌﻲ رﻧﮓ ﮔﺮﻓﺘﻨﺪ و ﻫﻴﭻﻳﻚ از ﻣﻴﻮﻣﺘﺮﻫﺎي ﻃﺒﻴﻌﻲ ﺑﺮاي اﻳﻦ ﻣﺎرﻛﺮ‬

‫اﺳﺖ(‪ ،‬ﻫﻤﭽﻨﻴﻦ ﻋﺪم ﺗﻮاﻓﻖ ﻛﺎﻓﻲ ﻣﻴﺎن ﭘﺎﺗﻮﻟﻮژﻳﺴﺖﻫﺎ ﺑﺮاي ﺑﺮرﺳﻲ‬

‫ﻣﺜﺒﺖ ﻧﺸﺪﻧﺪ و ﺳﻪ ﻣﻮرد از آنﻫﺎﻳﻲ ﻛﻪ ﺗﺤﺖ ﮔﺮوه ﺗﻮﻣﻮر ﻋﻀﻠﻪ ﺻﺎف‬

‫ﻣﻌﻴﺎرﻫﺎي ﻻزم ﺟﻬﺖ ﺗﻘﺴﻴﻢﺑﻨﺪي ﺗﻮﻣﻮرﻫﺎ ﺑﻪﻋﻨﻮان ﻟﻴﻮﻣﻴﻮﺳﺎرﻛﻮم و‬

‫ﺑﺎ ﭘﺘﺎﻧﺴﻴﻞ ﻧﺎﻣﺸﺨﺺ ﺑﺪﺧﻴﻤﻲ ﻃﺒﻘﻪﺑﻨﺪي ﺷﺪه ﺑﻮدﻧﺪ ﺑﻪﺻﻮرت ﺷﺪﻳﺪ و‬

‫ﻟﻴﻮﻣﻴﻮم ﻣﻲﺗﻮاﻧﺪ ﻋﺎﻣﻠﻲ ﺑﺎﺷﺪ ﻛﻪ اﻳﻦ ﺗﻔﺎوت را ﺗﻮﺟﻴﻪ ﻛﻨﺪ‪ .‬ﺑﺮ اﺳﺎس‬

‫ﻣﻨﺘﺸﺮ رﻧﮓ ﺷﺪﻧﺪ ﻛﻪ ﺑﻌﺪﻫﺎ دو ﻣﻮرد از آنﻫﺎ ﺷﻮاﻫﺪ ﻣﺘﺎﺳﺘﺎز را ﻧﺸﺎن‬

‫ﻳﺎﻓﺘﻪﻫﺎي ﻣﻄﺎﻟﻌﻪ ﻣﺎ اﮔﺮ اﻳﻤﻮﻧﻮراﻛﺘﻴﻮﻳﺘﻲ ﻫﺴﺘﻪ و ﻳﺎ ﺳﻴﺘﻮﭘﻼﺳﻢ ﺑﺮاي‬

‫دادﻧﺪ‪ ،‬اﻳﻦ ﻳﺎﻓﺘﻪﻫﺎ ﺑﺎ ﻧﺘﺎﻳﺞ ﺣﺎﺻﻞ از ﻣﻄﺎﻟﻌﻪ ﻣﺎ ﻣﻨﻄﺒﻖ اﺳﺖ‪ 17.‬در‬

‫ﻣﺎرﻛﺮ ‪ p16‬ﺑﻪﺻﻮرت ﻗﻮي و در ﺑﻴﺸﺘﺮ از ‪ %33‬ﺳﻠﻮلﻫﺎ ﺑﻪﻋﻨﻮان ﻣﺜﺒﺖ‬

‫ﻣﻄﺎﻟﻌﻪاي ﻛﻪ در ﺳﺎل ‪ 2005‬ﺗﻮﺳﻂ ‪ Calsteren‬ﺑﺎ ﻫﺪف ﺑﺮرﺳﻲ‬

‫در ﻧﻈﺮ ﮔﺮﻓﺘﻪ ﺷﻮد ﻟﻴﻮﻣﻴﻮﺳﺎرﻛﻮم ﺑﺮاي ‪ p16‬ﻣﺜﺒﺖ وﻟﻲ ﻟﻴﻮﻣﻴﻮم و ﺑﺎﻓﺖ‬

‫ﻣﺎرﻛﺮﻫﺎي ﻣﺨﺘﻠﻒ ﺑﺮاي اﻓﺰاﻳﺶ اﻃﻼع از ﺗﻐﻴﻴﺮات ﻣﻮﻟﻜﻮﻟﻲ ﻛﻪ در‬

‫ﻃﺒﻴﻌﻲ ﻣﻴﻮﻣﺘﺮ ﻣﻨﻔﻲ اﺳﺖ و اﻳﻦ ﻣﻲﺗﻮاﻧﺪ ﺑﻪﻋﻨﻮان راﻫﻨﻤﺎي ﺧﻮﺑﻲ‬

‫ﭘﺎﺗﻮژﻧﺰ ﺗﻮﻣﻮرﻫﺎي ﻋﻀﻠﻪ ﺻﺎف رﺣﻤﻲ ﻧﻘﺶ دارﻧﺪ و ﻫﻤﻴﻦﻃﻮر ﺑﺮاي‬

‫ﺟﻬﺖ دﺳﺘﻪﺑﻨﺪي ﺗﻮﻣﻮرﻫﺎي ﻋﻀﻠﻪ ﺻﺎف رﺣﻢ ﺑﻪﻛﺎر رود‪ .‬اﻟﺒﺘﻪ از آﻧﺠﺎ‬

‫اﻓﺰاﻳﺶ ﺗﻮاﻧﺎﻳﻲ ﺑﺮاي ﭘﻴﺶﺑﻴﻨﻲ ﭘﻴﺶآﮔﻬﻲ اﻳﻦ ﺑﻴﻤﺎران از ﻟﺤﺎظ‬

‫ﻛﻪ ﺗﻌﺪاد ﻣﻮارد ﻟﻴﻮﻣﻴﻮﺳﺎرﻛﻮم ﺑﺮرﺳﻲ ﺷﺪه در اﻳﻦ ﻣﻄﺎﻟﻌﻪ و ﻣﻮارد‬

‫ﺧﻮشﺧﻴﻤﻲ ﻳﺎ ﺑﺪﺧﻴﻤﻲ ﺗﻮﻣﻮرﻫﺎي ﻋﻀﻼت ﺻﺎف رﺣﻤﻲ اﻧﺠﺎم ﺷﺪ‪.‬‬

‫ﻣﺸﺎﺑﻪ ﻛﻢ ﻣﻲﺑﺎﺷﺪ‪ ،‬ﭘﻴﺸﻨﻬﺎد ﻣﻲﺷﻮد ﻣﻄﺎﻟﻌﺎت ﺑﻴﺸﺘﺮ ﺑﺎ ﺣﺠﻢ ﻧﻤﻮﻧﻪ‬

‫در اﻳﻦ ﻣﻄﺎﻟﻌﻪ ‪ 2360‬ﻣﻮرد ﺗﻮﻣﻮر ﻋﻀﻠﻪ ﺻﺎف رﺣﻤﻲ اﺑﺘﺪا ﺑﺮ اﺳﺎس‬

‫ﺑﺰرﮔﺘﺮ اﻧﺠﺎم ﺷﻮد‪ .‬ﻫﻤﭽﻨﻴﻦ از آﻧﺠﺎ ﻛﻪ ﮔﺮوه ﻋﻀﻠﻪ ﺻﺎف رﺣﻢ ﺑﺎ‬

‫ﻣﻮرﻓﻮﻟﻮژي ﻃﺒﻘﻪﺑﻨﺪي ﺷﺪه و ﺳﭙﺲ ﺑﺮاي ﻣﺎرﻛﺮﻫﺎي ﻣﺘﻔﺎوت ﺑﺮرﺳﻲ‬

‫ﭘﺘﺎﻧﺴﻴﻞ ﻧﺎﻣﺸﺨﺺ ﺑﺪﺧﻴﻤﻲ )‪ (STUMP‬در اﻳﻦ ﻣﻄﺎﻟﻌﻪ ﺑﺮرﺳﻲ ﻧﺸﺪﻧﺪ‬

‫ﺷﺪﻧﺪ ﻫﻤﭽﻨﻴﻦ ﺗﻤﺎﻣﻲ ﺑﻴﻤﺎران از ﻟﺤﺎظ ﻋﻮد ﭘﻲﮔﻴﺮي ﺷﺪﻧﺪ‪ .‬اﻳﻦ‬

‫ﭘﻴﺸﻨﻬﺎد ﻣﻲﺷﻮد ﺗﻌﺪاد ﻛﺎﻓﻲ از اﻳﻦ ﮔﺮوه‪ ،‬از ﻟﺤﺎظ ﻫﻤﺮاﻫﻲ ﻣﺎرﻛﺮ‬

‫‪p16‬‬

‫ﻣﻄﺎﻟﻌﻪ ﻧﺸﺎن داد ﻛﻪ ‪ p16‬در ﻫﻤﺮاﻫﻲ ﺳﺎﻳﺮ ﻣﺎرﻛﺮﻫﺎ ﻓﺎﻛﺘﻮر ارزﺷﻤﻨﺪي‬

‫ﺑﺎ ﻳﺎﻓﺘﻪﻫﺎي ﻛﻠﻴﻨﻴﻜﻲ دال ﺑﺮ ﺑﺪﺧﻴﻤﻲ ﻣﺎﻧﻨﺪ ﻣﺘﺎﺳﺘﺎز در ﭘﻲﮔﻴﺮيﻫﺎي‬

‫‪18‬‬

‫ﺑﺮاي ﭘﻴﺶﺑﻴﻨﻲ ﭘﻴﺶآﮔﻬﻲ ﺑﻴﻤﺎران اﺳﺖ‬

‫ﻛﻪ اﻳﻦ ﻧﺘﻴﺠﻪﮔﻴﺮي ﺑﺎ‬

‫ﻳﺎﻓﺘﻪﻫﺎي ﺣﺎﺻﻞ از ﻣﻄﺎﻟﻌﻪ ﻣﺎ ﻣﻨﻄﺒﻖ اﺳﺖ‪ .‬در ﻣﻄﺎﻟﻌﻪ ‪ Madani‬در‬

‫‪19‬‬

‫ﺑﻌﺪي ﺑﺮرﺳﻲ ﺷﻮﻧﺪ ﺗﺎ ﺗﻮاﻧﺎﻳﻲ اﻳﻦ ﻣﺎرﻛﺮ در دﺳﺘﻪﺑﻨﺪي و ﭘﻴﺶﺑﻴﻨﻲ‬ ‫ﭘﺘﺎﻧﺴﻴﻞ ﺑﺪﺧﻴﻤﻲ اﻳﻦ ﮔﺮوه از ﺗﻮﻣﻮرﻫﺎ‪ ،‬ﺑﻴﺶ از ﭘﻴﺶ آزﻣﻮده ﺷﻮد‪.‬‬

‫‪References‬‬ ‫‪review with emphasis on recent advances. Int J Gynecol Pathol‬‬ ‫‪2000;19(1):39-55.‬‬ ‫‪4. Esposito NN, Hunt JL, Bakker A, Jones MW. Analysis of allelic‬‬ ‫‪loss as an adjuvant tool in evaluation of malignancy in uterine‬‬ ‫‪smooth muscle tumors. Am J Surg Pathol 2006;30(1):97-103.‬‬ ‫‪5. Quade BJ, Wang TY, Sornberger K, Dal Cin P, Mutter GL, Morton‬‬ ‫‪CC. Molecular pathogenesis of uterine smooth muscle tumors from‬‬ ‫‪transcriptional‬‬ ‫‪profiling.‬‬ ‫‪Genes‬‬ ‫‪Chromosomes‬‬ ‫‪Cancer‬‬ ‫‪2004;40(2):97-108.‬‬

‫‪1. Zhai YL, Nikaido T, Toki T, Shiozawa A, Orii A, Fujii S.‬‬ ‫‪Prognostic significance of bcl-2 expression in leiomyosarcoma of‬‬ ‫‪the uterus. Br J Cancer 1999;80(10):1658-64.‬‬ ‫‪2. Mittal K, Demopoulos RI. MIB-1 (Ki-67), p53, estrogen receptor,‬‬ ‫‪and progesterone receptor expression in uterine smooth muscle‬‬ ‫‪tumors. Hum Pathol 2001;32(9):984-7.‬‬ ‫‪3. Clement PB. The pathology of uterine smooth muscle tumors and‬‬ ‫‪mixed endometrial stromal-smooth muscle tumors: a selective‬‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬


Expression of IHC marker “p16” in normal and tumoral myometrium

6. Kumar V, Abbas A, Fausto N. Robbins and Cotran Pathologic Basis of Disease. 7th ed. 2004. Philadelphia: W.B. Saunders Co.; 2005. p. 1089-91. 7. Peters WA 3rd, Howard DR, Andersen WA, Figge DC. Uterine smooth-muscle tumors of uncertain malignant potential. Obstet Gynecol 1994;83(6):1015-20. 8. Jie G, Zhixiang S, Lei S, Hesheng L, Xiaojun T. Relationship between expression and methylation status of p16INK4a and the proliferative activity of different areas' tumour cells in human colorectal cancer. Int J Clin Pract 2007;61(9):1523-9. 9. King-Yin Lam A, Ong K, Ho YH. Colorectal mucinous adenocarcinoma: the clinicopathologic features and significance of p16 and p53 expression. Dis Colon Rectum 2006;49(9):1275-83. 10. Tadokoro H, Shigihara T, Ikeda T, Takase M, Suyama M. Two distinct pathways of p16 gene inactivation in gallbladder cancer. World J Gastroenterol 2007;13(47):6396-403. 11. Yu E, Ahn YS, Jang SJ, Kim MJ, Yoon HS, Gong G, et al. Overexpression of the wip1 gene abrogates the p38 MAPK/p53/Wip1 pathway and silences p16 expression in human breast cancers. Breast Cancer Res Treat 2007;101(3):269-78. 12. Blanco D, Vicent S, Fraga MF, Fernandez-Garcia I, Freire J, Lujambio A, et al. Molecular analysis of a multistep lung cancer model induced by chronic inflammation reveals epigenetic regulation of p16 and activation of the DNA damage response pathway. Neoplasia 2007;9(10):840-52. 13. Jeon YK, Park K, Park CK, Paek SH, Jung HW, Park SH. Chromosome 1p and 19q status and p53 and p16 expression

520

patterns as prognostic indicators of oligodendroglial tumors: a clinicopathological study using fluorescence in situ hybridization. Neuropathology 2007;27(1):10-20. 14. Karsai S, Abel U, Roesch-Ely M, Affolter A, Hofele C, Joos S, et al. Comparison of p16(INK4a) expression with p53 alterations in head and neck cancer by tissue microarray analysis. J Pathol 2007;211(3):314-22. 15. Mao TL, Seidman JD, Kurman RJ, Shih IeM. Cyclin E and p16 immunoreactivity in epithelioid trophoblastic tumor: an aid in differential diagnosis. Am J Surg Pathol 2006;30(9):1105-10. 16. O'Neill CJ, McBride HA, Connolly LE, McCluggage WG. Uterine leiomyosarcomas are characterized by high p16, p53 and MIB1 expression in comparison with usual leiomyomas, leiomyoma variants and smooth muscle tumours of uncertain malignant potential. Histopathology 2007;50(7):851-8. 17. Atkins KA, Arronte N, Darus CJ, Rice LW. The Use of p16 in enhancing the histologic classification of uterine smooth muscle tumors. Am J Surg Pathol 2008;32(1):98-102. 18. van Calsteren K, Debiec-Rychter M, Moerman Ph, Tulunay G, Verbist G, Caluwaerts S, et al. Clinicopathologic markers of uterine leiomyosarcoma originating from smooth muscle tumors of low malignancy. Eur Clinics Obstet Gynaecol 2005;1:164-70. 19. Madani H, Javadi Ras E, Khazai S. Evaluation of IHC marker value in diagnosis of uterine smooth muscle tumors. Zanjan Sci Res J 2009;69:62-9.

1389 ‫ آذر‬،9 ‫ ﺷﻤﺎره‬، 68 ‫ دوره‬،‫ داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‬،‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‬


Tehran University Medical Journal; Vol. ‫و‬68, No. 9, Dec 2010: 516-521 ‫ﻫﻤﻜﺎران‬

100

p16 immunohistochemistric marker in normal and tumoral myometrium: a study on 136 cases

Zahra Forouhesh Tehrani MD.* Alireza Paikari MD. Ali Malaieri MD. Department of Pathology, Tehran University of Medical Sciences, Tehran, Iran.

Abstract

Received: June 13, 2010 Accepted: July 26, 2010

Background: Uterine smooth muscle tumors classified as leiomyoma, leiomyosarcoma and tumors with uncertain malignant potential. The leiomyoma and leiomyosarcoma are separated tumors biologically. Uterine smooth muscle tumors with uncertain malignant potential include a group of tumors which are not specifically placed into two others groups which result in a serious problem in a way of their treatment. In the present study expression of marker “p16” in smooth muscle tumors of uterine and normal myometrium has been investigated. Methods: The entire paraffin blocks related to hysterectomy cases with diagnosis of normal myometrium, leiomyoma and leiomyosarcoma (3768 cases) available in pathology lab. in Shariati Hospital in Tehran, Iran from 1372 to 1387 were investigated. Among them 62 normal myometrium, 62 leiomyoma and 12 leiomyosarcoma had been chosen and after staining for marker “p16” were investigated separately. Results: There were a statistically significant difference in both intensity and percentage of staining for this marker between leiomyoma and leiomiosarcoma (p< 0.001) and between leiomyosarcoma and normal myometrium (p< 0.001) but not between leiomyoma and normal myometrium (p= 3.6). Conclusion: Based on this study if strong and more than focal immunoreactivity for marker “p16” suppose as positive then leiomyosarcoma will be positive for this marker but leiomyoma and normal myometrium will not be and this could be considered as a good guide for categorizing the uterine smooth muscle tumors. Keywords: Leiomyosarcoma, leiomyoma, normal myometrium, uterine smooth muscle tumors with uncertain malignant potential, marker “p16”, immunohistochemistry.

*

Corresponding author: Dept. of Pathology, Central Laboratory, Shariati Hospital, Jalal Al Ahmad Highway, Tehran, Iran. Tel: +98-21-912-3705811 email: forouhesh_z@yahoo.com

1389 ‫ آذر‬،9 ‫ ﺷﻤﺎره‬، 68 ‫ دوره‬،‫ داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‬،‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‬


‫ﺟﺮاﺣﻲ‪ ،‬ﺑﺎي‬ ‫ﺗﻬﺮان‪،‬در‬ ‫اﻧﺘﻘﺎل ﺧﻮن‬ ‫ﻋﻠﻮم ﺑﻪ‬ ‫ﺘﻮرﻫﺎي ﻧﻴﺎز‬ ‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه رﻳﺴ‬ ‫ﺮوﻧﺮ‪522-526 ،1389‬‬ ‫ﭘﺎس‪،9‬ﻛ آذر‬ ‫ﺷﻤﺎره‬ ‫دوره ‪68‬‬ ‫ﭘﺰﺷﻜﻲ‬ ‫ﭘﺰﺷﻜﻚﻲ‪،‬ﻓﺎﻛداﻧﺸﮕﺎه‬

‫ﺑﺮرﺳﻲ رﻳﺴﻚﻓﺎﻛﺘﻮرﻫﺎي ﻧﻴﺎز ﺑﻪ اﻧﺘﻘﺎل ﺧﻮن در ﺑﻴﻤﺎران ﺗﺤﺖ ﻋﻤﻞ ﺑﺎيﭘﺲ ﺷﺮﻳﺎن ﻛﺮوﻧﺮ‬ ‫ﺑﺪون اﺳﺘﻔﺎده از ﭘﻤﭗ‬

‫ﺳﻴﺪ ﺧﻠﻴﻞ ﻓﺮوزانﻧﻴﺎ‬

‫ﺗﺎرﻳﺦ درﻳﺎﻓﺖ ﻣﻘﺎﻟﻪ‪ 1389/05/02 :‬ﺗﺎرﻳﺦ ﭘﺬﻳﺮش‪1389/07/24 :‬‬

‫ﭼﻜﻴﺪه‬

‫*‬

‫ﻣﻬﺪي ﺣﺪادزاده‪ ،‬ﺳﻴﺪ ﺟﻠﻴﻞ ﻣﻴﺮﺣﺴﻴﻨﻲ‬ ‫ﺣﺒﻴﺐاﻟﻪ ﺣﺴﻴﻨﻲ‪ ،‬ﻣﺤﻤﺪﺣﺴﻦ ﻋﺒﺪاﻟﻬﻲ‬

‫زﻣﻴﻨﻪ و ﻫﺪف‪ :‬از ﻣﻬﻢﺗﺮﻳﻦ ﻋﻮارض ﻋﻤﻞ ﺑﺎيﭘﺲ ﺷﺮﻳﺎن ﻛﺮوﻧﺮ ﺷﻴﻮع ﺑﺎﻻي ﻧﻴﺎز ﺑﻪ اﻧﺘﻘﺎل ﺧﻮن اﺳﺖ ﻛﻪ ﺑﺎﻋﺚ‬ ‫اﻓﺰاﻳﺶ ﻋﻮارض و ﻣﺮگ و ﻣﻴﺮ ﻣﻲﮔﺮدد‪ .‬ﻫﺪف اﻳﻦ ﻣﻄﺎﻟﻌﻪ ﺑﺮرﺳﻲ ﻓﺎﻛﺘﻮرﻫﺎي ﻣﺮﺗﺒﻂ ﺑﺎ ﻧﻴﺎز ﺑﻪ اﻧﺘﻘﺎل ﺧﻮن در ﻃﻲ‬ ‫ﻋﻤﻞ ﺑﺎيﭘﺲ ﺷﺮﻳﺎن ﻛﺮوﻧﺮ ﺑﺪون اﺳﺘﻔﺎده از ﭘﻤﭗ ﻣﻲﺑﺎﺷﺪ‪ .‬روش ﺑﺮرﺳﻲ‪ :‬اﻳﻦ ﻣﻄﺎﻟﻌﻪ ﺗﻮﺻﻴﻔﻲ ﻣﻮرد‪ -‬ﺷﺎﻫﺪي ﺑﺮ‬

‫ﻣﺤﻤﺪ ﻓﺮاتﻳﺰدي‪ ،‬ﻣﺠﻴﺪ راﺳﺘﻲ‬ ‫ﺣﻤﺰه دﻫﻘﺎﻧﻲزاده‪ ،‬ﺳﻴﺪ ﻣﺤﻤﺪ ﻗﺮﻳﺸﻴﺎن‬

‫روي ‪ 923‬ﺑﻴﻤﺎر ﻛﻪ از ﻣﺮداد ‪ 1387‬ﺗﺎ دي ‪ 1388‬در ﺑﻴﻤﺎرﺳﺘﺎن اﻓﺸﺎر ﻳﺰد ﺗﺤﺖ ﻋﻤﻞ ﺑﺎيﭘﺲ ﺷﺮﻳﺎن ﻛﺮوﻧﺮ ﺑﺪون‬ ‫اﺳﺘﻔﺎده از ﭘﻤﭗ ﻗﺮار ﮔﺮﻓﺘﻨﺪ اﻧﺠﺎم ﺷﺪ‪ .‬اﻃﻼﻋﺎت ﺑﻴﻤﺎران ﺑﺎ ﺗﻮﺟﻪ ﺑﻪ رﻳﺴﻚ ﻓﺎﻛﺘﻮرﻫﺎي ﻧﻴﺎز ﺑﻪ اﻧﺘﻘﺎل ﺧﻮن از ﭘﺮوﻧﺪه‬

‫ﮔﺮوه ﺟﺮاﺣﻲ ﻗﻠﺐ و ﻋﺮوق‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم‬

‫ﭘﺰﺷﻜﻲ آنﻫﺎ اﺳﺘﺨﺮاج و ﺗﺤﻠﻴﻞ آﻣﺎري ﺷﺪ‪ .‬ﻳﺎﻓﺘﻪﻫﺎ‪ %54 :‬ﻣﺮدان و ‪ %79‬زﻧﺎن در اﻳﻦ ﻣﻄﺎﻟﻌﻪ ﻧﻴﺎز ﺑﻪ اﻧﺘﻘﺎلﺧﻮن داﺷﺘﻨﺪ‬

‫ﭘﺰﺷﻜﻲ ﺷﻬﻴﺪ ﺻﺪوﻗﻲ ﻳﺰد‪ ،‬ﻣﺮﻛﺰ ﺗﺤﻘﻴﻘﺎت ﻗﻠﺐ‬

‫)‪ .(p<0/0001‬ﻣﻴﺎﻧﮕﻴﻦ ﺳﻨﻲ ﺑﻴﻤﺎران ﻧﻴﺎزﻣﻨﺪ ﺑﻪ اﻧﺘﻘﺎلﺧﻮن ‪ 61/86±11/11‬ﺳﺎل و در ﮔﺮوه ﻏﻴﺮ ﻧﻴﺎزﻣﻨﺪ ‪60/27±10/98‬‬

‫و ﻋﺮوق‪ ،‬ﻳﺰد‪ ،‬اﻳﺮان‪.‬‬

‫ﺳﺎل ﺑﻮد )‪ 563 .(p=0/08‬ﺑﻴﻤﺎر )‪ (%61‬ﻧﻴﺎز ﺑﻪ اﻧﺘﻘﺎلﺧﻮن داﺷﺘﻨﺪ و ﻣﺘﻮﺳﻂ ﺧﻮن ﺗﺰرﻳﻖ ﺷﺪه دو واﺣﺪ ﺑﻮد‪ .‬ﻧﻴﺎز ﺑﻪ‬ ‫اﻧﺘﻘﺎلﺧﻮن در ﺟﻨﺲ ﻣﺆﻧﺚ )‪ ،(p<0/0001‬ﻫﻤﺎﺗﻮﻛﺮﻳﺖ ﭘﺎﻳﻴﻦ ﻗﺒﻞ از ﻋﻤﻞ )‪ ،(p<0/0001‬ﺳﺎﺑﻘﻪ دﻳﺎﺑﺖ )‪،(p<0/001‬‬ ‫ﻓﺸﺎرﺧﻮن ﺑﺎﻻ )‪ (p<0/025‬و ﺗﻌﺪاد ﮔﺮاﻓﺖ )‪ (p<0/027‬اﻓﺰاﻳﺶ داﺷﺖ‪ .‬ﺑﻴﻦ ﮔﺮوه اﻧﺘﻘﺎل ﺧﻮن و ﺑﺪون اﻧﺘﻘﺎلﺧﻮن از‬ ‫ﻧﻈﺮ ﺗﺴﺖﻫﺎي اﻧﻌﻘﺎدي ﻗﺒﻞ از ﻋﻤﻞ‪ ،‬ﺳﺎﺑﻘﻪ ﻫﻴﭙﺮﻟﻴﭙﻴﺪﻣﻲ‪ ،‬ﺣﻮادث ﻋﺮوﻗﻲ ﻣﻐﺰ و ﻧﺎرﺳﺎﻳﻲ ﻛﻠﻴﻮي و ﻣﺼﺮف داروﻫﺎي‬ ‫ﺿﺪ ﭘﻼﻛﺘﻲ و اﺳﺘﻔﺎده از ﺷﺮﻳﺎن ﭘﺴﺘﺎﻧﻲ داﺧﻠﻲ ﭼﭗ ﺗﻔﺎوت ﻣﻌﻨﻲداري وﺟﻮد ﻧﺪاﺷﺖ‪ .‬ﻧﺘﻴﺠﻪﮔﻴﺮي‪ :‬ﺟﻨﺲ ﻣﺆﻧﺚ‪،‬‬

‫*‬

‫ﻫﻤﺎﺗﻮﻛﺮﻳﺖ ﭘﺎﻳﻴﻦ ﻗﺒﻞ ﻋﻤﻞ‪ ،‬ﺗﻌﺪاد ﮔﺮاﻓﺖ ﺑﻴﺸﺘﺮ‪ ،‬دﻳﺎﺑﺖ و ﻓﺸﺎر ﺧﻮن ﺑﺎﻻ ﺳﺒﺐ اﻓﺰاﻳﺶ ﻧﻴﺎز ﺑﻪ اﻧﺘﻘﺎل ﺧﻮن در‬ ‫ﻧﻮﻳﺴﻨﺪه ﻣﺴﺌﻮل‪ :‬ﻳﺰد‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺷﻬﻴﺪ‬

‫ﺟﺮاﺣﻲ ﺑﺎيﭘﺲ ﺷﺮﻳﺎن ﻛﺮوﻧﺮ ﺑﺪون اﺳﺘﻔﺎده از ﭘﻤﭗ ﻣﻲﺷﻮد‪.‬‬

‫ﺻﺪوﻗﻲ ﻳﺰد‪ ،‬ﺑﻴﻤﺎرﺳﺘﺎن اﻓﺸﺎر‬ ‫ﺗﻠﻔﻦ‪0351-5255011-18 :‬‬ ‫‪email: drforouzan_nia@yahoo.com‬‬

‫ﻛﻠﻤﺎت ﻛﻠﻴﺪي‪ :‬ﻋﻤﻞ ﺑﺎيﭘﺲ ﺷﺮﻳﺎن ﻛﺮوﻧﺮ ﺑﺪون ﭘﻤﭗ‪ ،‬اﻧﺘﻘﺎل ﺧﻮن‪ ،‬رﻳﺴﻚ ﻓﺎﻛﺘﻮر‪ ،‬ﺟﺮاﺣﻲ ﻗﻠﺐ‪.‬‬

‫ﻣﻘﺪﻣﻪ‬

‫ﻳﻚﺳﻮم ﺑﻴﻤﺎران اﻧﺘﺨﺎب ﺷﺪه ﺑﺮاي ﻋﻤﻞ‬

‫اﻣﺮوزه ﺑﺎ اﺑﺪاع روشﻫﺎي ﻧﻮﻳﻦ در ﺟﺮاﺣﻲ ﻗﻠﺐ و ﭘﻴﺸﺮﻓﺖﻫﺎي‬

‫‪CABG‬‬

‫ﻧﻴﺎز ﺑﻪ اﻧﺘﻘﺎل ﺧﻮن‬

‫‪4‬‬

‫دارﻧﺪ و ﺑﻴﺶ از ‪ %10‬ﻛﻞ اﻧﺘﻘﺎل ﺧﻮن در ﺑﻴﻤﺎران ﺗﺤﺖ ﻋﻤﻞ ﺑﺎيﭘﺲ‬ ‫‪5‬‬

‫ﺻﻮرت ﮔﺮﻓﺘﻪ در ﻣﺪﻳﺮﻳﺖ ﺑﻴﻤﺎران ﺑﻌﺪ از ﻋﻤﻞ‪ ،‬ﭘﻴﺶآﮔﻬﻲ ﺑﻴﻤﺎران‬

‫ﺷﺮﻳﺎن ﻛﺮوﻧﺮ ﺻﻮرت ﻣﻲﮔﻴﺮد‪ .‬ﻧﻴﺎز ﺑﻪ اﻧﺘﻘﺎل ﺧﻮن در ﺑﻴﻤﺎران ﺗﺤﺖ‬

‫‪Coronary Artery Bypass Graft‬‬

‫‪6‬‬

‫ﺗﺤﺖ ﻋﻤﻞ ﺑﺎيﭘﺲ ﻋﺮوق ﻛﺮوﻧﺮ‬ ‫)‪(CABG‬‬

‫ﺑﻬﺒﻮد ﻳﺎﻓﺘﻪ اﺳﺖ‪ 1.‬از ﻣﻬﻢﺗﺮﻳﻦ اﻳﻦ روشﻫﺎ ﺟﺮاﺣﻲ ﺑﺎيﭘﺲ‬

‫ﻋﻤﻞ ‪ ،CABG‬ﻋﻮارض و ﻣﺮگو ﻣﻴﺮ اﻳﻦ ﺑﻴﻤﺎران را اﻓﺰاﻳﺶ ﻣﻲدﻫﺪ‪.‬‬ ‫ﻧﮕﺮاﻧﻲﻫﺎﻳﻲ ﺑﻪﻋﻠﺖ ﺧﻄﺮ اﻧﺘﻘﺎل ﻋﻔﻮﻧﺖﻫﺎي ‪ ،HIV‬ﻫﭙﺎﺗﻴﺖ‬

‫‪B‬‬

‫و ‪،C‬‬

‫‪Off Pump Coronary‬‬

‫اﻳﺠﺎد واﻛﻨﺶﻫﺎي اﻳﻤﻮﻧﻮﻟﻮژﻳﻚ‪ ،‬اﻓﺰاﻳﺶ ﻣﺪت ﺗﻬﻮﻳﻪ ﻣﻜﺎﻧﻴﻜﻲ‪،‬‬

‫)‪ Artery Bypass (OPCAB‬ﻣﻲﺑﺎﺷﺪ ﻛﻪ در ﻣﻘﺎﻳﺴﻪ ﺑﺎ روش ﻣﺮﺳﻮم ﻳﺎ‬

‫اﻓﺰاﻳﺶ ﻃﻮل ﻣﺪت ﺑﺴﺘﺮي در ﺑﻴﻤﺎرﺳﺘﺎن و ﻧﻴﺰ اﻓﺰاﻳﺶ ﻫﺰﻳﻨﻪﻫﺎ و در‬

‫ﺷﺮﻳﺎن ﻛﺮوﻧﺮ ﺑﻪروش ﺑﺪون اﺳﺘﻔﺎده از ﭘﻤﭗ‬ ‫ﺑﺎ اﺳﺘﻔﺎده از ﭘﻤﭗ‬

‫‪CAB‬‬

‫‪ On-pump‬روﺷﻲ ﻓﻴﺰﻳﻮﻟﻮژﻳﻚ اﺳﺖ‪ 2.‬در‬

‫روش ﻣﺮﺳﻮم از دﺳﺘﮕﺎه ﺑﺎيﭘﺲ ﻗﻠﺒﻲ رﻳﻮي‬

‫‪CPB pump‬‬

‫اﺳﺘﻔﺎده‬

‫‪7‬و‪1‬‬

‫دﺳﺘﺮس ﻧﺒﻮدن ﺧﻮن آﻟﻮژن وﺟﻮد دارد‪.‬‬

‫وﺟﻮد ﺑﻌﻀﻲ از رﻳﺴﻚ‬

‫ﻓﺎﻛﺘﻮرﻫﺎ ﻗﺒﻞ و ﺣﻴﻦ ﻋﻤﻞ ﻧﻴﺎز ﺑﻴﻤﺎران ﺑﻪ اﻧﺘﻘﺎل ﺧﻮن را اﻓﺰاﻳﺶ‬ ‫‪8‬و‪7‬و‪4‬و‪1‬‬

‫در اﻳﻦ ﻣﻄﺎﻟﻌﻪ ﺑﻪ ﺑﺮرﺳﻲ اﻳﻦ رﻳﺴﻚ ﻓﺎﻛﺘﻮرﻫﺎ و‬

‫ﻣﻲﺷﻮد و ﻋﺎرﺿﻪ ﻋﻤﺪه آن اﻳﺠﺎد اﺧﺘﻼل اﻧﻌﻘﺎدي و ﻋﻤﻠﻜﺮد ﭘﻼﻛﺘﻲ‬

‫ﻣﻲدﻫﻨﺪ‪.‬‬

‫ﻣﻲﺑﺎﺷﺪ ﻛﻪ ﻣﻨﺠﺮ ﺑﻪ اﻓﺰاﻳﺶ ﺧﻮﻧﺮﻳﺰي ﺣﻴﻦ و ﺑﻌﺪ از ﻋﻤﻞ و اﻓﺰاﻳﺶ‬

‫ﻫﻤﭽﻨﻴﻦ ﻣﻴﺰان ﻧﻴﺎز ﺑﻪ اﻧﺘﻘﺎل ﺧﻮن در ﺑﻴﻤﺎران ﺗﺤﺖ ﻋﻤﻞ‬

‫ﻧﻴـﺎز ﺑﻪ اﻧﺘـﻘﺎل ﺧﻮن ﻣﻲﮔـﺮدد‪ 3.‬ﻋﻠﻴـﺮﻏﻢ ﭘﻴـﺸﺮﻓﺖﻫﺎي اﺧﻴـﺮ ﺣـﺪود‬

‫ﻣﺮﻛﺰ ﺟﺮاﺣﻲ ﻗﻠﺐ ﺑﻴﻤﺎرﺳﺘﺎن اﻓﺸﺎر ﻳﺰد ﻣﻲﭘﺮدازﻳﻢ‪.‬‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬

‫‪OPCAB‬‬

‫در‬


‫ﺳﻴﺪ ﺧﻠﻴﻞ ﻓﺮوزانﻧﻴﺎ و ﻫﻤﻜﺎران‬

‫‪523‬‬

‫روش ﺑﺮرﺳﻲ‬

‫ﻳﺎﻓﺘﻪﻫﺎ‬

‫اﻳﻦ ﻣﻄﺎﻟﻌﻪ ﺗﻮﺻﻴﻔﻲ ﻣﻮرد ﺷﺎﻫﺪ روي ‪ 923‬ﺑﻴﻤﺎر ﻛﻪ از ﻣﺮداد ﻣﺎه‬

‫از ‪ 923‬ﺑﻴﻤﺎر ﻣﻮرد ﻣﻄﺎﻟﻌﻪ ‪ 563‬ﺑﻴﻤﺎر )‪ (%61‬ﻧﻴﺎز ﺑﻪ اﻧﺘﻘﺎل ﺧﻮن‬

‫‪ 1387‬ﺗﺎ ديﻣﺎه ﺳﺎل ‪ 1388‬در ﺑﻴﻤﺎرﺳﺘﺎن اﻓﺸﺎر ﻳﺰد ﺗﺤﺖ ﻋﻤﻞ‬

‫داﺷﺘﻨﺪ )ﮔﺮوه ﻣﻮرد( و ﻳﻚ ﻳﺎ ﭼﻨﺪ واﺣﺪ ﺧﻮن ﺑﻌﺪ از ﻋﻤﻞ درﻳﺎﻓﺖ‬

‫ﻗﺮار ﮔﺮﻓﺘﻨﺪ اﻧﺠﺎم ﺷﺪ‪ .‬ﺑﻴﻤﺎراﻧﻲ ﻛﻪ ﺣﻴﻦ و ﺑﻌﺪ از ﻋﻤﻞ ﻧﻴﺎز‬

‫ﻛﺮده ﺑﻮدﻧﺪ و ‪ 360‬ﺑﻴﻤﺎر )‪ (%39‬ﻧﻴﺎز ﺑﻪ اﻧﺘﻘﺎل ﺧﻮن ﻧﺪاﺷﺘﻨﺪ )ﮔﺮوه‬

‫ﺑﻪ ﻳﻚ ﻳﺎ ﭼﻨﺪ واﺣﺪ اﻧﺘﻘﺎل ﺧﻮن داﺷﺘﻨﺪ در ﮔﺮوه ﻣﻮرد و ﺑﻴﻤﺎراﻧﻲ ﻛﻪ‬

‫ﺷﺎﻫﺪ(‪ .‬ﻣﺸﺨﺼﺎت ﺑﻴﻤﺎران در ﺟﺪول ‪ 1‬ذﻛﺮ ﮔﺮدﻳﺪه اﺳﺖ‪ .‬ﻣﻴﺎﻧﮕﻴﻦ‬

‫ﺑﻌﺪ از ﻋﻤﻞ ﻧﻴﺎز ﺑﻪ اﻧﺘﻘﺎل ﺧﻮن ﻧﺪاﺷﺘﻨﺪ در ﮔﺮوه ﺷﺎﻫﺪ ﻗﺮار ﮔﺮﻓﺘﻨﺪ‪.‬‬

‫ﺳﻨﻲ ﺑﻴﻤﺎران در ﮔﺮوه ﻣﻮرد ‪ 61/58‬و در ﮔﺮوه ﺷﺎﻫﺪ ‪ 60/27‬ﺑﻮد ﻛﻪ‬

‫ﻣﻌﻴﺎرﻫﺎي ﺗﺠﻮﻳﺰ ﺧﻮن ﺑﺮ اﺳﺎس راﻫﻨﻤﺎي اﺧﻴﺮ ﻛﺎﻟﺞ ﺑﻴﻬﻮﺷﻲ آﻣﺮﻳﻜﺎ‬

‫اﺧﺘﻼف آﻣﺎري ﻣﻌﻨﻲداري وﺟﻮد ﻧﺪاﺷﺖ )‪ %54 .(p=0/08‬ﺑﻴﻤﺎران‬

‫ﺑﻮد ﻛﻪ ﻋﺒﺎرﺗﻨﺪ از‪ :‬ﺳﻄﺢ ﻫﻤﻮﮔﻠﻮﺑﻴﻦ ﻛﻤﺘﺮ از ﻫﻔﺖ‪ ،‬ﺧﻮﻧﺮﻳﺰي ﺣﺎد‬

‫ﻣﺬﻛﺮ و ‪ %79‬ﺑﻴﻤﺎران ﻣﺆﻧﺚ ﻧﻴﺎز ﺑﻪ اﻧﺘﻘﺎل ﺧﻮن داﺷﺘﻨﺪ ﻛﻪ اﺧﺘﻼف‬

‫ﺑﻴﺶ از ‪ 1500ml‬ﻳﺎ ﺑﻴﺸﺘﺮ از ‪ %30‬ﺣﺠﻢ ﺧﻮن‪ ،‬ﺷﻮاﻫﺪ ﺧﻮﻧﺮﻳﺰي ﺧﻴﻠﻲ‬

‫ﻣﻌﻨﻲداري ﺑﻴﻦ دو ﺟﻨﺲ ﻣﺸﺎﻫﺪه ﺷﺪ )‪ .(p<0/0001‬ﻣﺤﺪوده‬

‫ﺳﺮﻳﻊ ﻛﻪ اﻣﻜﺎن ﻛﻨﺘﺮل ﻓﻮري وﺟﻮد ﻧﺪارد‪ .‬ﻣﻌﻴﺎرﻫﺎي ﺧﺮوج از ﻣﻄﺎﻟﻌﻪ‬

‫ﻫﻤﻮﮔﻠﻮﺑﻴﻦ ﻗﺒﻞ از ﻋﻤﻞ در ﺑﻴﻤﺎران ﻣﻮرد ﺑﺮرﺳﻲ ‪ 7/6‬ﺗﺎ ‪ 19‬ﺑﻮد و‬

‫ﺷﺎﻣﻞ ﻋﻤﻞ ﺟﺮاﺣﻲ اورژاﻧﺲ‪ ،‬ﺳﺎﺑﻘﻪ ﺑﻴﻤﺎريﻫﺎي ﻋﺮوق ﻣﺤﻴﻄﻲ‪ ،‬ﻧﻴﺎز‬

‫ﻣﻴﺎﻧﮕﻴﻦ ﻫﻤﻮﮔﻠﻮﺑﻴﻦ در ﮔﺮوه ﻣﻮرد ‪ 13/05‬و در ﮔﺮوه ﺷﺎﻫﺪ ‪14/42‬‬

‫‪ ،Intra-Aortic Balloon Pump‬اﻧﻔﺎرﻛﺘﻮس اﺧﻴﺮ ﻣﻴﻮﻛﺎرد‪،‬‬

‫‪Hct‬‬

‫‪OPCAB‬‬

‫ﺑﻪ‬

‫)‪(IABP‬‬

‫ﺑﻮد ﻛﻪ اﺧﺘﻼف ﻣﻌﻨﻲداري داﺷﺖ )‪ .(p<0/0001‬ﻣﻴﺎﻧﮕﻴﻦ‬

‫‪RBC‬‬

‫و‬

‫ﻋﻤﻞ ‪ CABG‬ﻣﺠﺪد‪ ،‬ﻋﻤﻞ ﻣﻨﺠﺮ ﺑﻪ ﻓﻮت‪ ،‬اﺧﺘﻼل اﻧﻌﻘﺎدي ﻗﺒﻞ از ﻋﻤﻞ‬

‫ﻗﺒﻞ از ﻋﻤﻞ ﺑﻴﻦ دو ﮔﺮوه اﺧﺘﻼف ﻣﻌﻨﻲداري ﻧﺸﺎن داد )‪.(p<0/0001‬‬

‫و اﻗﺪاﻣﺎت ﺟﺮاﺣﻲ دﻳﮕﺮ ﻗﻠﺒﻲ ﻋﺮوﻗﻲ ﺑﻮد‪ .‬در ﻣﺠﻤﻮع ‪ 923‬ﺑﻴﻤﺎر از‬

‫ﺷﻴﻮع آﻧﻤﻲ )ﺑﺮ اﺳﺎس ﺗﻌﺮﻳﻒ ‪ :WHO‬ﻫﻤﻮﮔﻠﻮﺑﻴﻦ ﻛﻤﺘﺮ از ‪ (12/5‬در‬

‫ﻧﻈﺮ رﻳﺴﻚﻓﺎﻛﺘﻮرﻫﺎ و ﻧﻴﺎز ﺑﻪ اﻧﺘﻘﺎل ﺧﻮن ﺑﺮرﺳﻲ ﺷﺪﻧﺪ‪ .‬روشﻫﺎي‬

‫ﮔﺮوه ﺑﺎ اﻧﺘﻘﺎلﺧﻮن ‪ %37/2‬و در ﮔﺮوه ﺑﺪون اﻧﺘﻘﺎلﺧﻮن ‪ %11/9‬ﺑﻮد ﻛﻪ‬

‫ﺣﻔﻆ ﺧﻮن در اﻳﻦ ﻣﺮﻛﺰ ﻋﺒﺎرﺗﻨﺪ از ﻏﺮﺑﺎﻟﮕﺮي ﺑﻴﻤﺎران از ﻧﻈﺮ اﺧﺘﻼل‬

‫اﺧﺘﻼف ﻣﻌﻨﻲداري ﺑﻴﻦ دو ﮔﺮوه ﻣﺸﺎﻫﺪه ﺷﺪ )‪ .(p<0/0001‬ﻣﻴﺎﻧﮕﻴﻦ‬ ‫‪PT‬‬

‫اﻧﻌﻘﺎدي‪ ،‬ﻗﻄﻊ داروﻫﺎي ﺿﺪ ﭘﻼﻛﺘﻲ ﻗﺒﻞ از ﻋﻤﻞ و ﺧﻨﺜﻲ ﻛﺮدن‬

‫ﺷﻤﺎرش ﭘﻼﻛﺖ‪ ،‬زﻣﺎن‬

‫ﻫﭙﺎرﻳﻦ ﺗﻮﺳﻂ داروي ﭘﺮوﺗﺎﻣﻴﻦ ﻣﻲﺑﺎﺷﺪ و ﻣﻴﺰان ﺧﻨﺜﻲ ﻛﺮدن ﻫﭙﺎرﻳﻦ‬

‫‪ 228‬ﻫﺰار‪ 218 -‬ﻫﺰار‪ (p=0/81) 13/43 -13/51 ،‬و ‪37/1 -36/33‬‬

‫‪Activated Clotting Time‬‬

‫)‪ (p=0/45‬ﺑﻮدﻧﺪ ﻛﻪ ﺗﻔﺎوت دو ﮔﺮوه از ﻧﻈﺮ آﻣﺎري ﻣﻌﻨﻲدار ﻧﺒﻮد‪231 .‬‬

‫ﺻﻮرت ﻣﻲﮔﻴﺮد ﻛﻪ از ﺻﻔﺮ ﺗﺎ ‪ %100‬ﻣﺘﻐﻴﺮ اﺳﺖ‪ .‬داروي‬

‫ﺑﻴﻤﺎر )‪ (%40/8‬از ﮔﺮوه ﻣﻮرد و ‪ 106‬ﺑﻴﻤﺎر )‪ (%29/8‬از ﮔﺮوه ﺷﺎﻫﺪ‬

‫آﺳﭙﻴﺮﻳﻦ ﻳﻚ ﻫﻔﺘﻪ ﻗﺒﻞ از ﻋﻤﻞ و داروي ﻛﻠﻮﭘﻴﺪوﮔﺮل‪ 72 ،‬ﺳﺎﻋﺖ ﻗﺒﻞ‬

‫ﺳﺎﺑﻘﻪ دﻳﺎﺑﺖ ﻗﻨﺪي‬

‫داﺷﺘﻨﺪ )‪ 287 .(p=0/001‬ﺑﻴﻤﺎر )‪ (%50/7‬از‬

‫از ﻋﻤﻞ ﻗﻄﻊ ﻣﻲﺷﻮد و در ﺻﻮرت ﻋﺪم ﻗﻄﻊ اﻳﻦ دو دارو‪ ،‬ﺑﻪﻋﻨﻮان‬

‫ﮔﺮوه ﻣﻮرد و ‪ 153‬ﺑﻴﻤﺎر )‪ (%43‬از ﮔﺮوه ﺷﺎﻫﺪ ﺳﺎﺑﻘﻪ ﻫﻴﭙﺮﺗﺎﻧﺴﻴﻮن‬

‫ﻳﻚ رﻳﺴﻚ ﻓﺎﻛﺘﻮر ﺗﻠﻘﻲ ﻣﻲﺷﻮد‪ .‬ﻫﻴﭻﮔﻮﻧﻪ داروي آﻧﺘﻲ ﻓﻴﺒﺮﻳﻨﻮﻟﻴﺘﻴﻚ‬

‫‪HTN‬‬

‫داﺷﺘﻨﺪ )‪ .(p=0/02‬ﺳﺎﺑﻘﻪ ‪ ،HLP‬ﺳﺎﺑﻘﻪ ﻣﺼﺮف آﺳﭙﺮﻳﻦ و ﺳﺎﺑﻘﻪ‬

‫)ﺗﺮاﻧﮕﺰاﻣﻴﻚ اﺳﻴﺪ و آﭘﺮوﺗﻴﻨﻴﻦ( در ﺣﻴﻦ ﻋﻤﻞ ﺑﻪ ﺑﻴﻤﺎران داده‬

‫ﻗﺒﻠﻲ ﺣﺎدﺛﻪ ﻋﺮوﻗﻲ ﻣﻐﺰ ‪ CVA‬در دو ﮔﺮوه اﺧﺘﻼف ﻣﻌﻨﻲداري ﻧﺪاﺷﺖ‬

‫ﻧﻤﻲﺷﻮد‪ .‬ﭘﺮوﺗﻜﻞ ﺗﺠﻮﻳﺰ ﺧﻮن در اﻳﻦ ﺑﻴﻤﺎرﺳﺘﺎن در ﺷﺮاﻳﻂ ﻋﺎدي‬

‫)ﺟﺪول ‪ .(1‬ﻧﺎرﺳﺎﻳﻲ ﻛﻠﻴﻮي در ‪ 15‬ﺑﻴﻤﺎر )‪ (%2/7‬ﺑﺎ اﻧﺘﻘﺎل ﺧﻮن و ﺳﻪ‬

‫ﻫﻤﻮﮔﻠﻮﺑﻴﻦ ﭘﺎﻳﻴﻦﺗﺮ از ‪ 10g/dl‬ﻣﻲﺑﺎﺷﺪ‪ .‬ﺟﻬﺖ ﺟﻤﻊآوري اﻃﻼﻋﺎت‬

‫ﺑﻴﻤﺎر )‪ (%0/8‬ﺑﺪون اﻧﺘﻘﺎل ﺧﻮن وﺟﻮد داﺷﺖ )‪ 359 .(p=0/08‬ﺑﻴﻤﺎر‬

‫ﻓﺮم ﻣﺨﺼﻮﺻﻲ ﻃﺮاﺣﻲ ﮔﺮدﻳﺪ ﻛﻪ ﺗﻤﺎﻣﻲ ﻣﺘﻐﻴﺮﻫﺎي ﻣﻮرد ﺑﺮرﺳﻲ ﻗﺒﻞ‪،‬‬

‫)‪ (%63/3‬از ﮔﺮوه ﻣﻮرد و ‪ 198‬ﺑﻴﻤﺎر )‪ (%55/8‬از ﮔﺮوه ﺷﺎﻫﺪ ﺳﻪ و‬

‫ﺣﻴﻦ و ﺑﻌﺪ از ﻋﻤﻞ ﺑﺎ ﺗﻮﺟﻪ ﺑﻪ ﺷﺮح ﺣﺎل و ﭘﺮوﻧﺪه ﭘﺰﺷﻜﻲ ﺑﻴﻤﺎران‬

‫ﭼﻬﺎر ﮔﺮاﻓﺖ داﺷﺘﻨﺪ )‪ .(p=0/027‬در ‪ 476‬ﺑﻴﻤﺎر )‪ (%84‬از ﮔﺮوه ﻣﻮرد‬

‫ﺑﺮ اﺳﺎس وﺿﻌﻴﺖ ﮔﺮاﻓﺖﻫﺎ و ﻣﻘﺪار‬ ‫)‪(ACT‬‬

‫در آن ﺛﺒﺖ ﺷﺪ‪ .‬در ﻧﻬﺎﻳﺖ دادهﻫﺎي ﺟﻤﻊآوري ﺷﺪه ﻛﺪﮔﺬاري ﺷﺪه و‬ ‫ﺑﺎ ﻧﺮماﻓﺰار‬

‫‪SPSS‬‬

‫)‪(DM‬‬

‫و‬

‫‪PTT‬‬

‫در ﮔﺮوه ﻣﻮرد و ﺷﺎﻫﺪ ﺑﻪ ﺗﺮﺗﻴﺐ‪:‬‬

‫و ‪ 305‬ﺑﻴﻤﺎر )‪ (%85/9‬از ﺷﺮﻳﺎن ﭘﺴﺘﺎﻧﻲ داﺧﻠﻲ ﭼﭗ‬

‫)‪(LIMA‬‬

‫اﺳﺘﻔﺎده‬

‫وﻳﺮاﺳﺖ ‪ ،13‬ﺗﺤﻠﻴﻞ آﻣﺎري ﺷﺪ‪ .‬ﺗﺴﺖ آﻣﺎري‬

‫ﺷﺪه ﺑﻮد ﻛﻪ ﺑﻴﻦ دو ﮔﺮوه اﺧﺘﻼف آﻣﺎري ﻣﻌﻨﻲداري وﺟﻮد ﻧﺪاﺷﺖ‬

‫‪ Student’s t-test‬و ‪ Mann-Whitney test‬ﺟﻬﺖ آﻧﺎﻟﻴﺰ اﻃﻼﻋﺎت ﻛﻤ‪‬ﻲ‬

‫)‪ %6/8 .(p=0/23‬ﺑﻴﻤﺎران ﺑﺎ اﻧﺘﻘﺎل ﺧﻮن و ‪ %4/8‬ﺑﻴﻤﺎران ﺑﺪون اﻧﺘﻘﺎل‬

‫ﺑﺮاي آﻧﺎﻟﻴﺰ اﻃﻼﻋﺎت ﻛﻴﻔﻲ ﻣﻮرد اﺳﺘﻔﺎده ﻗﺮار ﮔﺮﻓﺖ‪.‬‬

‫ﺧﻮن ﻛﺴﺮ ﺟﻬﺶ )‪ (Ejection fraction‬ﻛﻤﺘﺮ از ‪ %30‬داﺷﺘﻨﺪ ﻛﻪ از ﻧﻈﺮ‬

‫و ﺗﺴﺖ‬

‫‪2‬‬

‫‪‬‬

‫‪ p<0/05‬ﻣﻌﻨﻲدار در ﻧﻈﺮ ﮔﺮﻓﺘﻪ ﺷﺪ‪.‬‬

‫آﻣﺎري اﺧﺘﻼف ﻣﻌـﻨﻲداري وﺟـﻮد ﻧـﺪاﺷﺖ )‪ .(p=0/25‬ﺟﻬـﺖ ﺧﻨـﺜﻲ‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬


‫‪524‬‬

‫رﻳﺴﻚﻓﺎﻛﺘﻮرﻫﺎي ﻧﻴﺎز ﺑﻪ اﻧﺘﻘﺎل ﺧﻮن در ﺟﺮاﺣﻲ ﺑﺎيﭘﺎس ﻛﺮوﻧﺮ‬

‫ﺟﺪول‪ :1-‬ﻣﺸﺨﺼﺎت ﺑﻴﻤﺎران ﺑﺎ ﻋﻤﻞ ‪ OPCAB‬ﻣﻮرد ﻣﻄﺎﻟﻌﻪ‬ ‫ﮔﺮوه‬

‫ﻣﺘﻐﻴﺮ‬ ‫ﺳﻦ‬ ‫ﺟﻨﺲ ﻣﺆﻧﺚ‬

‫ﻣﻴﺰان آن ﺑﻪﺗﺮﺗﻴﺐ در ﺟﻨﺲ ﻣﺆﻧﺚ و ﻣﺬﻛﺮ ‪ %79‬در ﻣﻘﺎﺑﻞ ‪ %54‬ﺑﻮد ﻛﻪ‬

‫ﻣﻮرد‬

‫ﺷﺎﻫﺪ‬

‫*‪p‬‬

‫‪61/58‬‬

‫‪60/27‬‬

‫‪0/08‬‬

‫)‪200 (%35/3‬‬

‫)‪52 (%14/6‬‬

‫‪0/0001‬‬

‫‪9‬‬

‫ﻣﻄﺎﻟﻌﺎت دﻳﮕﺮ ﻧﻴﺰ ﻧﺘﺎﻳﺞ ﻣﺸﺎﺑﻪ را ﻧﺸﺎن دادهاﻧﺪ‪ .‬در ﻣﻄﺎﻟﻌﻪ‬

‫‪Magovern‬‬

‫ﺟﻨﺲ ﻣﺆﻧﺚ ﻧﻴﺎز ﺑﻪ اﻧﺘﻘﺎل ﺧﻮن را در ﺑﻴﻤﺎران ﺗﺤﺖ ﻋﻤﻞ‬

‫‪CABG‬‬

‫اﻓﺰاﻳﺶ داده و ﺑﻪﻋﻨﻮان ﻳﻚ ﻣﺘﻐﻴﺮ ﻣﺴﺘﻘﻞ ﻛﻪ ﺑﻪ ﻋﻠﻠﻲ ﻏﻴﺮ از ﻛﺎﻫﺶ‬

‫ﻫﻤﻮﮔﻠﻮﺑﻴﻦ ﻗﺒﻞ از ﻋﻤﻞ‬

‫‪13/05‬‬

‫‪14/42‬‬

‫‪0/0001‬‬

‫ﻫﻤﺎﺗﻮﻛﺮﻳﺖ ﻗﺒﻞ از ﻋﻤﻞ‬

‫‪39/43‬‬

‫‪42/9‬‬

‫‪0/0001‬‬

‫ﺣﺠﻢ ﺧﻮن ﺑﺎﻋﺚ اﻓﺰاﻳﺶ ﻧﻴﺎز ﺑﻪ اﻧﺘﻘﺎل ﺧﻮن ﻣﻲﺷﻮد در ﻧﻈﺮ ﮔﺮﻓﺘﻪ‬

‫ﮔﻠﺒﻮل ﻗﺮﻣﺰ ﻗﺒﻞ از ﻋﻤﻞ‬

‫‪4/66‬‬

‫‪4/96‬‬

‫‪0/0001‬‬

‫ﺷﺪه اﺳﺖ‪ 10.‬از ﺑﻴﻤﺎريﻫﺎي ﻫﻤﺮاه ‪ DM‬و ‪ HTN‬در اﻓﺰاﻳﺶ ﻧﻴﺎز ﺑﻴﻤﺎران‬

‫ﭘﻼﻛﺖ ﻗﺒﻞ از ﻋﻤﻞ‬

‫‪227/74‬‬

‫‪218‬‬

‫‪0/058‬‬

‫ﺑﻪ اﻧﺘﻘﺎل ﺧﻮن ﻣﻮﺛﺮ ﺑﻮد‪ .‬ﺳﺎﺑﻘﻪ ﻗﺒﻠﻲ ‪ HLP ،CVA‬و ﺑﻴﻤﺎريﻫﺎي ﻛﻠﻴﻮي‬

‫‪ PT‬ﻗﺒﻞ از ﻋﻤﻞ‬

‫‪13/51‬‬

‫‪13/43‬‬

‫‪0/81‬‬

‫ﺑﻪﻃﻮر ﻣﻌﻨﻲداري ﻧﻴﺎز ﺑﻪ اﻧﺘﻘﺎل ﺧﻮن را اﻓﺰاﻳﺶ ﻧﺪادﻧﺪ‪ .‬در ﻣﻄﺎﻟﻌﻪ‬

‫‪ PTT‬ﻗﺒﻞ از ﻋﻤﻞ‬

‫‪36/33‬‬

‫‪37/1‬‬

‫‪0/45‬‬

‫‪ Frankel‬ﺳﺎﺑﻘﻪ ﺑﻴﻤﺎريﻫﺎي‬

‫آﻧﻤﻲ ﻗﺒﻞ از ﻋﻤﻞ‬

‫)‪208 (%37/2‬‬

‫)‪42 (%11/9‬‬

‫‪0/0001‬‬

‫ﻫﻴﭙﺮﺗﺎﻧﺴﻴﻮن‬

‫)‪289 (%50/7‬‬

‫)‪153 (%43‬‬

‫‪0/025‬‬

‫‪DM‬‬

‫و ﻧﺎرﺳﺎﻳﻲ ﻛﻠﻴﻮي ﺑﺎ اﻓﺰاﻳﺶ ﻧﻴﺎز ﺑﻪ‬

‫اﻧﺘﻘﺎل ﺧﻮن ارﺗﺒﺎط داﺷﺖ‪ 1.‬ﺧﻨﺜﻲ ﻛﺮدن ﻫﭙﺎرﻳﻦ ﺑﺎ اﺳﺘﻔﺎده از داروي‬ ‫ﭘﺮوﺗﺎﻣﻴﻦ ﺑﺎﻋﺚ ﻛﺎﻫﺶ ﻧﻴﺎز ﺑﻴﻤﺎران ﺑﻪ اﻧﺘﻘﺎل ﺧﻮن ﺷﺪ‪ .‬ﺑﻴﻤﺎراﻧﻲ ﻛﻪ ﺳﻪ‬

‫ﻫﻴﭙﺮﻟﻴﭙﻴﺪﻣﻲ‬

‫)‪246 (%43/5‬‬

‫)‪150 (%42/1‬‬

‫‪0/73‬‬

‫دﻳﺎﺑﺖ‬

‫)‪231 (%40/8‬‬

‫)‪106 (%29/8‬‬

‫‪0/001‬‬

‫ﻳﺎ ﭼﻬﺎر ﮔﺮاﻓﺖ داﺷﺘﻨﺪ ﺑﻴﺸﺘﺮ ﻧﻴﺎز ﺑﻪ اﻧﺘﻘﺎل ﺧﻮن ﭘﻴﺪا ﻛﺮدﻧﺪ‪ ،‬ﻛﻪ در‬

‫ﺣﺎدﺛﻪ ﻋﺮوﻗﻲ ﻣﻐﺰ‬

‫)‪30(%5/3‬‬

‫)‪10 (%2/8‬‬

‫‪0/09‬‬

‫ﻣﻄﺎﻟﻌﺎت ﻗﺒﻠﻲ ﻧﻴﺰ ﺗﻌﺪاد ﮔﺮاﻓﺖ ﺑﻪﻋﻨﻮان ﻳﻜﻲ از رﻳﺴﻚ ﻓﺎﻛﺘﻮرﻫﺎي‬

‫ﻧﺎرﺳﺎﻳﻲ ﻣﺰﻣﻦ ﻛﻠﻴﻪ‬

‫)‪15 (%2/7‬‬

‫)‪3 (%0/8‬‬

‫‪0/08‬‬

‫اﻧﺘﻘﺎل ﺧﻮن در ﻧﻈﺮ ﮔﺮﻓﺘﻪ ﺷﺪه اﺳﺖ‪ .‬ﻧﺘﺎﻳﺞ ﻣﻄﺎﻟﻌﻪ ﻣﺎ ﻧﺸﺎن داد ﻛﻪ‬

‫ﺗﻌﺪاد ‪ 3‬و ‪ 4‬ﮔﺮاﻓﺖ‬

‫)‪359 (%63/3‬‬

‫)‪198 (%55/8‬‬

‫‪0/027‬‬

‫اﺳﺘﻔﺎده از داروي آﺳﭙﺮﻳﻦ ﻗﺒﻞ از ﻋﻤﻞ ﺑﺎ اﻓﺰاﻳﺶ ﻧﻴﺎز ﺑﻪ اﻧﺘﻘﺎل ﺧﻮن‬

‫)‪476 (%84‬‬

‫)‪305 (%85/9‬‬

‫‪0/23‬‬

‫ﻣﺼﺮف آﺳﭙﻴﺮﻳﻦ‬

‫)‪251 (%51/3‬‬

‫)‪156 (%51/3‬‬

‫‪0/53‬‬

‫ﻫﻤﺮاه ﻧﻴﺴﺖ و ﻣﻄﺎﻟﻌﺎت دﻳﮕﺮ ﻧﻴﺰ ﻧﺘﺎﻳﺞ ﻣﺸﺎﺑﻬﻲ را ﻧﺸﺎن ﻣﻲدﻫﺪ‪ 1.‬در‬

‫ﻛﺴﺮ ﺟﻬﺸﻲ ﻛﻤﺘﺮ از ‪%30‬‬

‫)‪38 (%6/18‬‬

‫)‪17 (%4/8‬‬

‫‪0/25‬‬

‫ﺗﺠﻮﻳﺰ ﭘﺮوﺗﺎﻣﻴﻦ‬

‫)‪116 (%43/4‬‬

‫)‪113 (%59/8‬‬

‫‪0/001‬‬

‫اﺳﺘﻔﺎده از‬

‫‪** LIMA‬‬

‫‪11‬‬

‫اﻳﻦ ﻣﻄﺎﻟﻌﻪ ﻣﻴﺎﻧﮕﻴﻦ ﺗﺠﻮﻳﺰ ﺧﻮن دو واﺣﺪ ﺑﻪ ازاي ﻫﺮ ﺑﻴﻤﺎر ﺑﻮد‪ .‬اﻛﺜﺮ‬ ‫ﺑﻴﻤﺎراﻧﻲ ﻛﻪ ﻧﻴﺎز ﺑﻪ اﻧﺘﻘﺎل ﺧﻮن داﺷﺘﻨﺪ ﻛﻤﺘﺮ ﻳﺎ ﻣﺴﺎوي ﺳﻪ واﺣﺪ ﺧﻮن‬ ‫درﻳﺎﻓﺖ ﻛﺮده ﺑﻮدﻧﺪ‪ .‬اﻳﻦ اﻣﺮ ﻧﺸﺎن دﻫﻨﺪة ﻋﺪم وﺟﻮد ﺷﺮاﻳﻂ ﺑﺴﻴﺎر ﺣﺎد‬

‫* آزﻣﻮن آﻣﺎري ﻣﻮرد اﺳﺘﻔﺎده ‪ Independent Samples t-test‬و ‪ p<0/05‬ﻣﻌﻨﻲدار ﺗﻠﻘﻲ ﺷﺪ‬ ‫‪** LIMA= Left Internal Mammary Artery‬‬

‫از ﻧﻈﺮ ﺳﺮﻋﺖ ﺗﺰرﻳﻖ ﺧﻮن و ﻣﻴﺰان ﺧﻮن از دﺳﺖ رﻓﺘﻪ ﻣﻲﺑﺎﺷﺪ‪.‬‬ ‫ﺗﺼﻤﻴﻢ ﺟﻬﺖ اﻧﺘﻘﺎل ﺧﻮن اﻏﻠﺐ ﺑﺮ اﺳﺎس ﻛﻠﻴﻨﻴﻚ ﺑﻴﻤﺎر و ‪ Hct‬و‬

‫ﻛﺮدن ﻫﭙﺎرﻳﻦ ﺑﻌﺪ از ﻋﻤﻞ ﺑﻪ ‪ 116‬ﺑﻴﻤﺎر )‪ (%43/4‬در ﮔﺮوه ﺑﺎ اﻧﺘﻘﺎل‬

‫ﻫﻤﻮﮔﻠﻮﺑﻴﻦ ﺑﻴﻤﺎر اﻧﺠﺎم ﻣﻲﺷﻮد‪ 12.‬ﺳﻄﺢ ﻫﻤﻮﮔﻠﻮﺑﻴﻦ دﻗﻴﻖﺗﺮﻳﻦ روش‬

‫ﺧﻮن و ‪ 113‬ﺑﻴﻤﺎر )‪ (%59/8‬در ﮔﺮوه ﺑﺪون اﻧﺘﻘﺎل ﺧﻮن ﭘﺮوﺗﺎﻣﻴﻦ داده‬

‫ﺟﻬﺖ ﭘﻴﺶﺑﻴﻨﻲ ﻧﻴﺎز ﺑﻴﻤﺎران ﺑﻪ اﻧﺘﻘﺎل ﺧﻮن ﻣﻲﺑﺎﺷﺪ‪ .‬راﻫﻨﻤﺎي اﺧﻴﺮ‬

‫ﺷﺪه ﺑﻮد )‪ .(p=0/001‬در اﻳﻦ ﻣﻄﺎﻟﻌﻪ ‪ %90/5‬ﺑﻴﻤﺎران ﺑﻪ ﻛﻤﺘﺮ ﻳﺎ ﻣﺴﺎوي‬

‫اﻧﺘﻘﺎل ﺧﻮن ﻛﻪ ﺗﻮﺳﻂ ﻛﺎﻟﺞ ﺑﻴﻬﻮﺷﻲ اﻣﺮﻳﻜﺎ اراﻳﻪ ﺷﺪه ﺑﻪ ﭘﺰﺷﻜﺎن اﺟﺎزه‬ ‫ﻣﻲدﻫﺪ ﻛﻪ در رﻧﺞ ﻫﻤﻮﮔﻠﻮﺑﻴﻦ ‪ 6-10gr/dl‬ﺗﺠﻮﻳﺰ ﺧﻮن اﻧﺠﺎم ﺷﻮد‪.‬‬

‫ﺳﻪ واﺣﺪ و ‪ %9/5‬ﺑﻪ ﺑﻴﺶ از ﺳﻪ واﺣﺪ ﺧﻮن ﻧﻴﺎز داﺷﺘﻨﺪ‪.‬‬

‫‪13‬‬

‫در ﻳﻚ ﻣﻄﺎﻟﻌﻪ ﻛﻪ اﺧﻴﺮاً ﺻﻮرت ﮔﺮﻓﺘﻪ ﮔﺰارش ﺷﺪه ﻛﻪ ﺑﻴﻤﺎراﻧﻲ ﻛﻪ‬

‫ﺑﺤﺚ‬

‫آﻧﺎﺗﻮﻣﻲ ﺷﺮﻳﺎن ﻛﺮوﻧﺮ ﻧﺮﻣﺎل دارﻧﺪ آﻧﻤﻲ ﻧﻮرﻣﻮوﻟﻤﻴﻚ ﺣﺎد ﻛﻤﺘﺮ از‬ ‫‪14‬‬

‫ﻫﺪف اﻳﻦ ﻣﻄﺎﻟﻌﻪ ﺑﺮرﺳﻲ رﻳﺴﻚ ﻓﺎﻛﺘﻮرﻫﺎي ﻧﻴﺎز ﺑﻴﻤﺎران ﺗﺤﺖ ﻋﻤﻞ‬

‫‪ 5gr/dl‬را ﻧﻴﺰ ﻣﻲﺗﻮاﻧﻨﺪ ﺗﺤﻤﻞ ﻛﻨﻨﺪ‪ .‬در ﺑﺮرﺳﻲ ﻣﺎ ‪ %61‬ﺑﻴﻤﺎران ﻧﻴﺎز‬

‫ﺑﻪ اﻧﺘﻘﺎل ﺧﻮن ﻣﻲﺑﺎﺷﺪ‪ .‬در اﻳﻦ ﻣﻄﺎﻟﻌﻪ ﻫﻤﺎﺗﻮﻛﺮﻳﺖ ﻗﺒﻞ از‬

‫ﺑﻪ اﻧﺘﻘﺎل ﺧﻮن ﭘﻴﺪا ﻛﺮدﻧﺪ و ﻣﻴﺰان ﻣﺼﺮف ﺧﻮن در ‪ %90‬ﻣﻮارد ‪1-3‬‬

‫ﺑﻮد‬

‫واﺣﺪ ﺑﻮد‪ .‬ﻳﻜﻲ از ﻋﻠﻞ ﺑﺎﻻ ﺑﻮدن ﻣﻴﺰان ﻧﻴﺎز ﺑﻪ اﻧﺘﻘﺎل ﺧﻮن در اﻳﻦ‬

‫‪OPCAB‬‬

‫‪OPCAB‬‬

‫ﻋﻤﻞ ﻣﻬﻢﺗﺮﻳﻦ رﻳﺴﻚ ﻓﺎﻛﺘﻮر اﻧﺘﻘﺎل ﺧﻮن در ﺑﻴﻤﺎران‬

‫ﺗﺴﺖﻫﺎي‬

‫ﻣﺮﻛﺰ در ﻧﻈﺮ ﮔﺮﻓﺘﻦ آﺳﺘﺎﻧﻪ ﺑﺎﻻي ﻫﻤﻮﮔﻠﻮﺑﻴﻦ )‪ (10 gr/dl‬ﺟﻬﺖ ﺗﺰرﻳﻖ‬

‫اﻧﻌﻘﺎدي ﻗﺒﻞ از ﻋﻤﻞ ﺷﺎﻣﻞ ‪ PTT ،PT‬و ﭘﻼﻛﺖ ﺗﺄﺛﻴﺮي ﺑﺮ ﻧﻴﺎز ﺑﻪ اﻧﺘﻘﺎل‬

‫ﺧﻮن ﻣﻲﺑﺎﺷﺪ‪ .‬ﺑﻨﺎﺑﺮاﻳﻦ ﺑﺎ ﭘﺎﻳﻴﻦ آوردن آﺳﺘﺎﻧﻪ ﺗﺰرﻳﻖ ﺧﻮن ﺑﺮ اﺳﺎس‬

‫ﺧﻮن در اﻳﻦ ﺑﻴﻤﺎران ﻧﺪاﺷﺘﻨﺪ‪ .‬ﻣﻴﺰان ﻧﻴﺎز ﺑﻪ اﻧﺘﻘﺎل ﺧﻮن در ﺟﻨﺲ‬

‫ﻫﻤﻮﮔﻠﻮﺑﻴﻦ ﻣﻲﺗﻮان ﻣﻴﺰان ﻧﻴﺎز ﺑﻪ اﻧﺘﻘﺎل ﺧﻮن را ﺑﻪ ﻣﻘﺪار زﻳﺎدي‬

‫ﻣﺆﻧﺚ ﺑﻪﻃﻮر ﻣﻌﻨﻲداري ﺑﻴﺸﺘﺮ از ﺟﻨﺲ ﻣﺬﻛﺮ ﺑﻮد )‪ (p<0/0001‬و‬

‫ﻛﺎﻫﺶ داد‪ Bracey .‬در ﻳﻚ ﻣﻄﺎﻟﻌﻪ ﺑﺎ در ﻧﻈﺮ ﮔﺮﻓﺘﻦ آﺳﺘﺎﻧﻪ ﭘﺎﻳﻴﻦﺗﺮي‬

‫‪6‬و‪2‬‬

‫)‪ (p<0/0001‬ﻛﻪ در ﻣﻄﺎﻟﻌﺎت ﻗﺒﻠﻲ ﻧﻴﺰ ﺛﺎﺑﺖ ﺷﺪه اﺳﺖ‪.‬‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬


‫ﻫﻤﻜﺎران‬ ‫ﻧﻴﺎ و‬nia ‫ﻓﺮوزان‬ ‫ﺧﻠﻴﻞ‬et‫ﺳﻴﺪ‬ Forouzan S.Kh. al.

525

‫ﻫﻤﭽﻨﻴﻦ ﺑﻴﻤﺎراﻧﻲ ﻛﻪ ﭼﻨﺪ ﻣﺘﻐﻴﺮ ﻣﻔﻘﻮد ﺷﺪه داﺷﺘﻨﺪ از ﻣﻄﺎﻟﻌﻪ ﺧﺎرج‬

‫ در‬12.‫ ﻛﺎﻫﺶ داد‬%20 ‫ ﻣﻴﺰان اﻧﺘﻘﺎل ﺧﻮن را‬،‫ ﺟﻬﺖ ﺗﺰرﻳﻖ ﺧﻮن‬Hb ‫از‬

‫ از آﻧﺠﺎﻳﻲﻛﻪ ﻣﻄﺎﻟﻌﻪ‬-3 .‫ ﺑﻪ ﻫﻤﻴﻦ دﻟﻴﻞ ﺟﺎﻣﻌﻴﺖ ﻛﺎﻓﻲ را ﻧﺪارد‬،‫ﺷﺪﻧﺪ‬

‫ در ﻧﻈﺮ ﮔﺮﻓﺘﻪ ﺷﺪ و‬8gr/dl ،‫ ﺟﻬﺖ ﺗﺰرﻳﻖ ﺧﻮن‬Hb ‫اﻳﻦ ﻣﻄﺎﻟﻌﻪ آﺳﺘﺎﻧﻪ‬

‫ ﻧﻤﻲﺗﻮان ﻧﺘﺎﻳﺞ آن را ﺑﻪ ﻣﺮاﻛﺰ دﻳﮕﺮ ﺗﻌﻤﻴﻢ‬،‫ﺗﻨﻬﺎ در ﻳﻚ ﻣﺮﻛﺰ اﻧﺠﺎم ﺷﺪ‬

‫ﻧﺘﺎﻳﺞ ﻧﺸﺎن داد ﻛﻪ ﻛﺎﻫﺶ آﺳﺘﺎﻧﻪ ﻫﻤﻮﮔﻠﻮﺑﻴﻦ ﺟﻬﺖ ﺗﺰرﻳﻖ ﺧﻮن ﺑﺮ‬

‫ ﭘﺮوﺗﻜﻞ اﻧﺘﻘﺎل ﺧﻮن در اﻳﻦ ﻣﺮﻛﺰ ﻣﻤﻜﻦ اﺳﺖ ﺑﺎ ﻣﺮاﻛﺰ دﻳﮕﺮ‬-4 .‫داد‬

‫ ﻫﻤﭽﻨﻴﻦ ﻧﺸﺎن داد ﻛﻪ ﺑﺎ ﺑﻪﻛﺎر‬.‫ﭘﻴﺶآﮔﻬﻲ ﺑﻴﻤﺎران ﺗﺄﺛﻴﺮ ﺳﻮﻳﻲ ﻧﺪارد‬

‫ ﻧﺘﻴﺠﻪﮔﻴﺮيﻛﻠﻲ اﻳﻦﻛﻪ ﺑﺎ ﭘﺎﻳﻴﻦ آوردن آﺳﺘﺎﻧﻪ ﻫﻤﻮﮔﻠﻮﺑﻴﻦ‬.‫ﻣﺘﻔﺎوت ﺑﺎﺷﺪ‬

-‫ دﻻر ﺻﺮﻓﻪ‬150000 ‫ واﺣﺪ ﺧﻮن و‬800 ‫ ﺳﺎﻟﻴﺎﻧﻪ‬،‫ﺑﺮدن اﻳﻦ ﭘﺮوﺗﻜﻞ‬

‫ﺑﺮاي ﺷﺮوع اﻧﺘﻘﺎل ﺧﻮن و ﻫﻤﭽﻨﻴﻦ ﺑﺮرﺳﻲ و ﺣﺬف رﻳﺴﻚﻓﺎﻛﺘﻮرﻫﺎي‬

-1 :‫ ﻣﺤﺪودﻳﺖﻫﺎي اﻳﻦ ﻣﻄﺎﻟﻌﻪ ﻋﺒﺎرﺗﻨﺪ از‬.‫ﺟﻮﻳﻲ ﺻﻮرت ﮔﺮﻓﺖ‬

‫ ﻣﻲﺗﻮان ﻧﻴﺎز ﺑﻪ اﻧﺘﻘﺎل ﺧﻮن را در ﺑﻴﻤﺎران ﺑﺎيﭘﺲ‬،‫ﻧﻴﺎز ﺑﻪ اﻧﺘﻘﺎل ﺧﻮن‬

‫ ﺑﺴﻴﺎري از ﺑﻴﻤﺎران‬-2 ،‫ﺑﺮرﺳﻲ رﻳﺴﻚ ﻓﺎﻛﺘﻮرﻫﺎ ﺑﻪﺻﻮرت ﮔﺬﺷﺘﻪﻧﮕﺮ‬

.‫ﻋﺮوق ﻛﺮوﻧﺮ ﺑﻪروش ﺑﺪون ﭘﻤﭗ ﺑﻪ ﻣﻴﺰان ﻗﺎﺑﻞ ﺗﻮﺟﻬﻲ ﻛﺎﻫﺶ داد‬

،‫ﺑﻪدﻟﻴﻞ داﺷﺘﻦ ﻳﻜﻲ از ﻣﻌﻴﺎرﻫﺎي ﺧﺮوج در ﻣﻄﺎﻟﻌﻪ وارد ﻧﺸﺪﻧﺪ‬

References 1. Frankel TL, Stamou SC, Lowery RC, Kapetanakis EI, Hill PC, Haile E, et al. Risk factors for hemorrhage-related reexploration and blood transfusion after conventional versus coronary revascularization without cardiopulmonary bypass. Eur J Cardiothorac Surg 2005;27(3):494-500. 2. Raja SG, Dreyfus GD. Impact of off-pump coronary artery bypass surgery on postoperative bleeding: current best available evidence. J Card Surg 2006;21(1):35-41; discussion 42-3. 3. Wan S, LeClerc JL, Vincent JL. Inflammatory response to cardiopulmonary bypass: mechanisms involved and possible therapeutic strategies. Chest 1997;112(3):676-92. 4. Scott BH, Seifert FC, Glass PS, Grimson R. Blood use in patients undergoing coronary artery bypass surgery: impact of cardiopulmonary bypass pump, hematocrit, gender, age, and body weight. Anesth Analg 2003;97(4):958-63, table of contents. 5. Ascione R, Williams S, Lloyd CT, Sundaramoorthi T, Pitsis AA, Angelini GD. Reduced postoperative blood loss and transfusion requirement after beating-heart coronary operations: a prospective randomized study. J Thorac Cardiovasc Surg 2001;121(4):689-96. 6. Scott BH, Seifert FC, Grimson R. Blood transfusion is associated with increased resource utilisation, morbidity and mortality in cardiac surgery. Ann Card Anaesth 2008;11(1):15-9. 7. Shehata N, Naglie G, Alghamdi AA, Callum J, Mazer CD, Hebert P, et al. Risk factors for red cell transfusion in adults undergoing coronary artery bypass surgery: a systematic review. Vox Sang 2007;93(1):1-11.

1389 ‫ آذر‬،9 ‫ ﺷﻤﺎره‬، 68 ‫ دوره‬،‫ داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‬،‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‬

8. Nuttall GA, Erchul DT, Haight TJ, Ringhofer SN, Miller TL, Oliver WC Jr, et al. A comparison of bleeding and transfusion in patients who undergo coronary artery bypass grafting via sternotomy with and without cardiopulmonary bypass. J Cardiothorac Vasc Anesth 2003;17(4):447-51. 9. Litmathe J, Boeken U, Feindt P, Gams E. Predictors of homologous blood transfusion for patients undergoing open heart surgery. Thorac Cardiovasc Surg 2003;51(1):17-21. 10. Magovern JA, Sakert T, Benckart DH, Burkholder JA, Liebler GA, Magovern GJ Sr, et al. A model for predicting transfusion after coronary artery bypass grafting. Ann Thorac Surg 1996;61(1):2732. 11. Dial S, Delabays E, Albert M, Gonzalez A, Camarda J, Law A, et al. Hemodilution and surgical hemostasis contribute significantly to transfusion requirements in patients undergoing coronary artery bypass. J Thorac Cardiovasc Surg 2005;130(3):654-61. 12. Bracey AW, Radovancevic R, Riggs SA, Houston S, Cozart H, Vaughn WK, et al. Lowering the hemoglobin threshold for transfusion in coronary artery bypass procedures: effect on patient outcome. Transfusion 1999;39(10):1070-7. 13. Consensus conference. Perioperative red blood cell transfusion. JAMA 1988;260(18):2700-3. 14. Weiskopf RB, Viele MK, Feiner J, Kelley S, Lieberman J, Noorani M, et al. Human cardiovascular and metabolic response to acute, severe isovolemic anemia. JAMA 1998;279(3):217-21.


Tehran University Medical Journal; Vol. 68, No. 9, Dec 2010: 522-526

Risk factors of blood transfusion in patients undergoing off-pump coronary artery bypass

Abstract Seyed Khalil Forouzan Nia MD.* Mehdi Hadadzadeh MD. Seyed Jalil Mirhosseini MD. Habibolah Hosseini MD. Mohammad Hasan Abdollahi MD. Mohammad Forat Yazdi MD. Majid Rasti MD. Hamzeh Dehghanizadeh MD. Seyed Mohammad Ghoreishian MD. Department of Cardiovascular Surgery, Afshar Hospital, Shahid Sadooghi University of Medical Sciences, Yazd, Iran.

Received: July 24, 2010 Accepted: October 16, 2010

Background: One of the most important components of coronary artery bypass graft surgery is need for blood transfusion that increases morbidity and mortality. The aim of this study was to evaluate the factors affecting the need for blood transfusion during off pump coronary artery bypass (OPCAB) surgery. Methods: In this descriptive case control study 923 patients who had undergone OPCAB at Afshar Hospital in Yazd, Iran, from July 2008 to January 2010 were evaluated. The data was gathered from their records and was analyzed. Results: 54% of male and 79% of female patient need blood transfusion. Mean age in patients needed transfusion was 61.58±11.11 years and in other group was 60.27±10.98 years of the patients that needed transfusion (p= 0.08). 563 (61%) of the patients needed transfusion with the average of two units. The need for blood transfusion was higher in female gender (p< 0.0001), low hematocrit (p< 0.0001), diabetes (p< 0.001), hypertension (p< 0.025) and multiple grafts (p< 0.027). There were no significant differences in preoperative hemostasis tests, affection to hyperlipidemia, CVA or renal failure, antiplatelet drug administration and the application of left internal mammary artery between the transfusion and non transfusion groups. Conclusion: In this study preoperative hematocrit was most important risk factor in transfusion in patients that underwent OPCAB. Female gender, preoperative low hematocrit, multiple grafts, diabetes and hypertension increased the rate of blood transfusion. According to the high prevalence of blood transfusion in OPCAB, considering factors that affect the transfusion rate is essential. Keywords: Off-pump, coronary artery bypass, transfusion, risk factor, cardiac surgery.

*

Corresponding author: Dept. of Cardiovascular Surgery, Cardiovascular Research Center, Afshar Hospital, Yazd, Iran. Tel: +98-351-5255011-18 email: drforouzan_nia@yahoo.com

1389 ‫ آذر‬،9 ‫ ﺷﻤﺎره‬، 68 ‫ دوره‬،‫ داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‬،‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‬


‫ﻻﻣﻴﻨﻜﺘﻮﻣﻲ‬ ‫ﺧﻮﻧﺮﻳﺰي ﭘﺲ‬ ‫اﺳﻴﺪ‬ ‫ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ‬ ‫‪527-533 ،1389‬‬ ‫ﺷﻤﺎرهاز ‪ ،9‬آذر‬ ‫ﻛﺎﻫﺶدوره ‪، 68‬‬ ‫ﻣﻮﺿﻌﻲﻜﻲدرﺗﻬﺮان‪،‬‬ ‫ﻋﻠﻮم ﭘﺰﺷ‬ ‫داﻧﺸﮕﺎه‬ ‫ﺗﺎﺛﻴﺮﭘﺰﺷﻜﻲ‪،‬‬ ‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه‬

‫ﺑﺮرﺳﻲ ﺗﺎﺛﻴﺮ ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ ﻣﻮﺿﻌﻲ در ﻛﺎﻫﺶ ﻣﻴﺰان ﺧﻮﻧﺮﻳﺰي ﭘﺲ از ﺟﺮاﺣﻲ ﻻﻣﻴﻨﻜﺘﻮﻣﻲ‬

‫ﺗﺎرﻳﺦ درﻳﺎﻓﺖ ﻣﻘﺎﻟﻪ‪ 1389/05/18 :‬ﺗﺎرﻳﺦ ﭘﺬﻳﺮش‪1389/08/01 :‬‬

‫ﭼﻜﻴﺪه‬

‫‪*1‬‬

‫ﻫﻮﺷﻨﮓ ﺻﺎﺑﺮي‬

‫زﻣﻴﻨﻪ و ﻫﺪف‪ :‬ﻧﺸﺎن داده ﺷﺪه ﻛﻪ ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ ﻣﻮﺿﻌﻲ ﻣﻮﺟﺐ ﻛﺎﻫﺶ ﻣﻴﺰان ﺧﻮﻧﺮﻳﺰي در اﻋﻤﺎل ﺟﺮاﺣﻲ‬

‫‪2‬‬

‫ﺳﻴﺪ ﻣﺠﺘﺒﻲ ﻣﻴﺮي‬

‫ﺑﺰرگ ﺳﺘﻮن ﻓﻘﺮات ﻣﻲﺷﻮد‪ .‬ﻫﺪف اﻳﻦ ﻣﻄﺎﻟﻌﻪ‪ ،‬ﺑﺮرﺳﻲ ﺗﺎﺛﻴﺮ ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ ﻣﻮﺿﻌﻲ در ﻓﻀﺎي اﭘﻴﺪورال در‬

‫‪2‬‬

‫ﻣﻨﺼﻮر ﭘﺮدل ﻧﺎﻣﺪار‬

‫ﺧﻮﻧﺮﻳﺰي ﭘﺲاز ﺟﺮاﺣﻲ ﻻﻣﻴﻨﻜﺘﻮﻣﻲ ﻣﻲﺑﺎﺷﺪ‪ .‬روش ﺑﺮرﺳﻲ‪ 100 :‬ﺑﻴﻤﺎر ﻛﻪ در ﺑﺨﺶ ﺟﺮاﺣﻲ اﻋﺼﺎب ﺑﻴﻤﺎرﺳﺘﺎن‬ ‫‪ -1‬ﮔﺮوه ﺟﺮاﺣﻲ ﻣﻐﺰ و اﻋﺼﺎب‪ ،‬ﺑﻴﻤﺎرﺳﺘﺎن اﻣﺎم‬

‫اﻣﺎمﺧﻤﻴﻨﻲ در ﺳﺎل ‪ 1385-88‬ﻛﺎﻧﺪﻳﺪ ﻻﻣﻴﻨﻜﺘﻮﻣﻲ ﺑﻮدﻧﺪ ﺑﻪ ﻳﻚ ﻣﻄﺎﻟﻌﻪ ﻛﺎرآزﻣﺎﻳﻲ ﺑﺎﻟﻴﻨﻲ وارد ﺷﺪﻧﺪ‪ .‬ﺑﻴﻤﺎران ﺑﺮ ﺣﺴﺐ‬

‫ﺧﻤﻴﻨﻲ‪ ،‬ﻣﺮﻛﺰ ﺗﺤﻘﻴﻘﺎت ﺗﺮﻣﻴﻢ آﺳﻴﺐﻫﺎي ﻣﻐﺰي و‬

‫وﺳﻌﺖ ﻋﻤﻞ ﺟﺮاﺣﻲ ﺑﻪ دو ﮔﺮوه ﻻﻣﻴﻨﻜﺘﻮﻣﻲ ﻳﻚﻃﺮﻓﻪ در ﻳﻚ ﺳﻄﺢ )‪ (n=50‬و دو ﻃﺮﻓﻪ در دو ﺳﻄﺢ )‪ (n=50‬ﺗﻘﺴﻴﻢ‬

‫ﻧﺨﺎﻋﻲ‪ ،‬داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‬ ‫‪ -2‬ﮔﺮوه ﺟﺮاﺣﻲ ﻣﻐﺰ و اﻋﺼﺎب‪ ،‬ﺑﻴﻤﺎرﺳﺘﺎن اﻣﺎم‬ ‫ﺧﻤﻴﻨﻲ‬

‫ﺷﺪﻧﺪ‪ .‬ﺳﭙﺲ ﺑﻴﻤﺎران ﻫﺮ ﮔﺮوه ﺑﻪﺻﻮرت ﺗﺼﺎدﻓﻲ ﺑﻪ دو ﮔﺮوه ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ )‪ (n=25‬و ﮔﺮوه ﺷﺎﻫﺪ )‪(n=25‬‬ ‫ﺗﻘﺴﻴﻢ ﺷﺪﻧﺪ‪ .‬ﭘﺲ از اﺗﻤﺎم ﻋﻤﻞ ﻻﻣﻴﻨﻜﺘﻮﻣﻲ و اﻃﻤﻴﻨﺎن از ﺳﻼﻣﺖ دورا‪ ،‬ﺑﺮﺣﺴﺐ ﮔﺮوه ﺑﻴﻤﺎر‪ 250mg ،‬ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ‬ ‫اﺳﻴﺪ ﺑﺎ ﺣﺠﻢ ﻛﻠﻲ ‪) 5ml‬در ﮔﺮوه ﻣﻮرد( ﻳﺎ ‪ 5ml‬آب ﻣﻘﻄﺮ )در ﮔﺮوه ﺷﺎﻫﺪ( در ﻣﺤﻞ ﻋﻤﻞ اﺳﭙﺮي ﻣﻲﺷﺪ‪ .‬ﻣﻴﺰان ﺧﻮن‬

‫داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬ﺗﻬﺮان‪ ،‬اﻳﺮان‪.‬‬

‫داﺧﻞ ﻫﻤﻮﺑﮓ در ‪ 24‬ﺳﺎﻋﺖ اول و ‪ 24‬ﺳﺎﻋﺖ دوم و در ﻛﻞ ﻃﻮل ﻣﺪت اﻗﺎﻣﺖ در ﺑﻴﻤﺎرﺳﺘﺎن در دو ﮔﺮوه ﺳﻨﺠﻴﺪه و‬ ‫ﺑﺎ ﻳﻜﺪﻳﮕﺮ ﻣﻘﺎﻳﺴﻪ ﻣﻲﺷﺪ‪ .‬ﻳﺎﻓﺘﻪﻫﺎ‪ :‬ﺣﺠﻢ ﺧﻮﻧﺮﻳﺰي در ‪ 24‬ﺳﺎﻋﺖ اول ﺑﻪﻣﻴﺰان ﻣﻌﻨﻲداري در ﮔﺮوه ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ‬ ‫ﻛﻤﺘﺮ ﺑﻮده اﺳﺖ )‪ .(p=0/001‬ﻫﻤﭽﻨﻴﻦ ﺣﺠﻢ ﺧﻮﻧﺮﻳﺰي در ‪ 24‬ﺳﺎﻋﺖ دوم ﻧﻴﺰ ﺑﻪﻣﻴﺰان ﻣﻌﻨﻲداري در ﮔﺮوه‬ ‫ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ ﻧﺴﺒﺖ ﺑﻪ ﮔﺮوه ﺷﺎﻫﺪ ﻛﻤﺘﺮ ﺑﻮده اﺳﺖ )‪ ،(p=0/001‬ﺿﻤﻦ اﻳﻦﻛﻪ ﻃﻮل ﻣﺪت ﺑﺴﺘﺮي ﻧﻴﺰ در ﮔﺮوه‬ ‫ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ ﻛﻮﺗﺎهﺗﺮ ﺑﻮده اﺳﺖ )‪ 2/16±0/37‬در ﺑﺮاﺑﺮ ‪ 2/96±0/89‬روز‪ .(p=0/001 ،‬ﻧﺘﻴﺠﻪﮔﻴﺮي‪ :‬در ﻧﻬﺎﻳﺖ‬

‫*‬

‫اﻳﻦﻛﻪ ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ ﻣﻮﺿﻌﻲ در ﻓﻀﺎي اﭘﻴﺪورال ﻣﻮﺟﺐ ﻛﺎﻫﺶ ﻣﻌﻨﻲدار ﺧﻮﻧﺮﻳﺰي ﭘﺲ از ﻋﻤﻞ ﺟﺮاﺣﻲ‬ ‫ﻧﻮﻳﺴﻨﺪه ﻣﺴﺌﻮل‪ :‬ﺗﻬﺮان‪ ،‬اﻧﺘﻬﺎي ﺑﻠﻮار ﻛﺸﺎورز‪،‬‬

‫ﻻﻣﻴﻨﻜﺘﻮﻣﻲ در روزﻫﺎي ﻳﻚ و دو و ﺧﻮﻧﺮﻳﺰي ﻛﻠﻲ ﻣﻲﺷﻮد و ﻣﺪت ﺑﺴﺘﺮي ﺑﻴﻤﺎر را ﻛﺎﻫﺶ ﻣﻲدﻫﺪ‪.‬‬

‫ﺑﻴﻤﺎرﺳﺘﺎن اﻣﺎم ﺧﻤﻴﻨﻲ )ره(‪ ،‬ﮔﺮوه ﺟﺮاﺣﻲ ﻣﻐﺰ و‬ ‫اﻋﺼﺎب‬

‫ﺗﻠﻔﻦ‪021-66939330 :‬‬ ‫‪email: hgsaberi@yahoo.com‬‬

‫ﻛﻠﻤﺎت ﻛﻠﻴﺪي‪ :‬ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ‪ ،‬ﻣﻮﺿﻌﻲ‪ ،‬ﺧﻮﻧﺮﻳﺰي‪ ،‬ﻻﻣﻴﻨﻜﺘﻮﻣﻲ‪.‬‬

‫ﻣﻘﺪﻣﻪ‬

‫ﺑﻪﺻﻮرت ﻣﻮﺿﻌﻲ ﺗﻮﺻﻴﻪ ﺷﺪه ﻛﻪ ﺑﺎ اﻳﻦ روش ﻣﻲﺗﻮان از ﺑﺮوز ﺑﻴﺸﺘﺮ‬

‫در ﻣﻄﺎﻟﻌﺎت ﻣﺨﺘﻠﻒ ﻧﺸﺎن داده ﺷﺪه ﻛﻪ اﺳﺘﻔﺎده از داروﻫﺎي آﻧﺘﻲ‬

‫اﻳﻦ ﻋﻮارض اﺟﺘﻨﺎب ﻛﺮد‪ 2.‬ﺑﻪﻋﺒﺎرت دﻳﮕﺮ ﺗﺎﻛﻨﻮن ﻫﻴﭻ ﻋﺎرﺿﻪ ﺟﺎﻧﺒﻲ‬ ‫‪3‬‬

‫ﻓﻴﺒﺮﻳﻨﻮﻟﻴﺘﻴﻚ )‪ (Antifibrinolytic‬ﺿﻤﻦ ﻋﻤﻞ ﺟﺮاﺣﻲ ﺑﻪﻃﻮر ﻣﻮﻓﻘﻴﺖ‪-‬‬

‫در اﺳﺘﻔﺎده ﻣﻮﺿﻌﻲ از اﻳﻦ دﺳﺘﻪ از داروﻫﺎ ﮔﺰارش ﻧﺸﺪه اﺳﺖ زﻳﺮا‬

‫آﻣﻴﺰي ﺧﻮﻧﺮﻳﺰي ﺣﻴﻦ و ﭘﺲ از ﻋﻤﻞ را ﻛﺎﻫﺶ ﻣﻲدﻫﻨﺪ‪ .‬ﺳﻪ ﺗﺮﻛﻴﺒﻲ‬

‫ﻧﺸﺎن داده ﺷﺪه ﻛﻪ اﺳﺘﻔﺎده ﻣﻮﺿﻌﻲ از اﻳﻦ داروﻫﺎ ﻣﻮﺟﺐ ﺳﻄﻮح‬

‫ﻛﻪ ﺑﻴﺸﺘﺮ ﻣﻮرد اﺳﺘﻔﺎده ﻗﺮار ﮔﺮﻓﺘﻪاﻧﺪ ﺑﺮاﺳﺎس ﻗﺪرت ﻋﻤﻞ ﺑﻪﺗﺮﺗﻴﺐ‬ ‫آﭘﺮوﺗﻴﻨﻴﻦ ‪ ،Aprotinin‬ﺗﺮاﻧﺲ آﻣﻴﻦ ﻳﺎ ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ‬ ‫‪ acid‬و آﻣﻴﻨﻮﻛﺎﭘﺮوﻳﻴﻚ اﺳﻴﺪ‬

‫ﺳﺮﻣﻲ ﺑﺴﻴﺎر ﭘﺎﻳﻴﻦﺗﺮي ﻧﺴﺒﺖ ﺑﻪ ﺗﺠﻮﻳﺰ داﺧﻞ ورﻳﺪي آنﻫﺎ ﻣﻲﺷﻮد‪.‬‬

‫‪4‬‬

‫‪Tranexamic‬‬

‫ﺑﻪﻫﻤﻴﻦ ﻣﻨﻈﻮر ﺗﺎﻛﻨﻮن در ﺑﺮﺧﻲ ﻣﻄﺎﻟﻌﺎت ﺑﻪ ﺑﺮرﺳﻲ اﺛﺮات اﺳﺘﻔﺎده‬

‫‪Episolone aminocaproic acid‬‬

‫ﻣﻮﺿﻌﻲ از اﻳﻦ داروﻫﺎ در رﺷﺘﻪﻫﺎي ﻣﺨﺘﻠﻒ ﭘﺮداﺧﺘﻪ ﺷﺪه اﺳﺖ‪.‬‬

‫ﻣﻲﺑﺎﺷﻨﺪ‪ .‬اﻣﺎ ﺑﻪ ﺗﺎزﮔﻲ‪ ،‬اﺑﻬﺎﻣﺎﺗﻲ در ﺧﺼﻮص ﻋﻮارض ﺟﺎﻧﺒﻲ و اﻳﻤﻨﻲ‬

‫‪5‬‬

‫ﺑﻪﻋﻨﻮان ﻣﺜﺎل در رﺷﺘﻪ زﻧﺎن‪ ،‬در ﻛﺎﻫﺶ ﺧﻮﻧﺮﻳﺰي ﭘﺲ از ﻛﺸﻴﺪن‬ ‫‪7‬و‪6‬‬

‫‪8‬‬

‫آرﺗﺮوﭘﻼﺳﺘﻲ و در ﺟﺮاﺣﻲ ﻗﻠﺐ‬

‫‪9-11‬و‪3‬‬

‫اﻳﻦ داروﻫﺎ‪ ،‬ﺑﻪﺧﺼﻮص ﻣﺤﺒﻮبﺗﺮﻳﻦ آنﻫﺎ ﻳﻌﻨﻲ آﭘﺮوﺗﻴﻨﻴﻦ‪ ،‬در ﻫﻨﮕﺎم‬

‫دﻧﺪان در ﻛﻮدﻛﺎن ﻫﻤﻮﻓﻴﻠﻲ‪،‬‬

‫اﺳﺘﻔﺎده ﺳﻴﺴﺘﻤﻴﻚ ﻣﻄﺮح ﺷﺪه اﺳﺖ‪ 1.‬ﺑﻪﻣﻨﻈﻮر اﺟﺘﻨﺎب از ﻋﻮارض‬

‫اﺳﺘﻔﺎده ﻣﻮﺿﻌﻲ از اﻳﻦ داروﻫﺎ ﻣﻮﺛﺮ ارزﻳﺎﺑﻲ ﺷﺪه اﺳﺖ‪ .‬اﻣﺎ در ﺑﺮﺧﻲ‬

‫ﺟﺎﻧﺒﻲ در ﺣﻴﻦ اﺳﺘﻔﺎده از داروﻫﺎي آﻧﺘﻲ ﻓﻴﺒﺮﻳﻨﻮﻟﻴﺘﻴﻚ‪ ،‬اﺳﺘﻔﺎده از آنﻫﺎ‬

‫ﻣﻄﺎﻟﻌﺎت اﺛﺮات اﺳﺘﻔﺎده ﻣﻮﺿﻌﻲ از داروﻫﺎي آﻧﺘﻲ ﻓﻴﺒﺮﻳﻨﻮﻟﻴﺘﻴﻚ را‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬


‫ﻫﻮﺷﻨﮓ ﺻﺎﺑﺮي و ﻫﻤﻜﺎران‬

‫‪528‬‬

‫‪13‬و‪12‬‬

‫اﺳﺘﻔﺎده از ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ ﺑﺎ ﺧﻄﺮ‬

‫ﻛﺮدن و ﺳﭙﺲ در ﺻﻮرت ﻧﻴﺎز ﺑﺎ ﻛﻮﺗﺮ ﻛﻨﺘﺮل ﻣﻲﺷﺪ‪ .‬در ﻣﺮﺣﻠﻪ ﺑﻌﺪي‬

‫ﻣﻌﺎدل داروﻧﻤﺎ ذﻛﺮ ﻛﺮدهاﻧﺪ‪.‬‬

‫ﻛﻤﺘﺮ ﺑﺮوز ﻋﻮارض ﺟﺎﻧﺒﻲ ﻧﺴﺒﺖ ﺑﻪ داروﻫﺎي ﻓﻮق ﻫﻤﺮاه اﺳﺖ‪ .‬از‬

‫از ﻋﺪم ﺻﺪﻣﻪ ﺑﻪ دورا ﻣﻄﻤﺌﻦ ﻣﻲﺷﺪﻳﻢ‪ .‬ﺑﺎز ﺑﻮدن دورا ﺑﻪ ﻫﺮ ﻋﻠﺘﻲ از‬

‫ﻃﺮف دﻳﮕﺮ ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ ﺑﻪﻃﻮر ﻣﻌﻤﻮل ﺑﺮاي ﻛﺎﻫﺶ ﺧﻮﻧﺮﻳﺰي‬

‫ﻛﻨﺘﺮااﻧﺪﻳﻜﺎﺳﻴﻮنﻫﺎي ﺗﺰرﻳﻖ ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ ﻣﺤﺴﻮب ﻣﻲﺷﻮد‪.‬‬

‫در ﺟﺮاﺣﻲ ﻗﻠﺐ‪ ،‬اﺳﺘﺨﻮان و ﻣﻔﺎﺻﻞ‪ ،‬و ﺟﺮاﺣﻲﻫﺎي ﻛﺒﺪي‪ ،‬اﺳﺘﻔﺎده‬

‫ﺑﻪﻫﻤﻴﻦ ﻋﻠﺖ ﺑﺮاي ﻣﻄﻤﺌﻦ ﺷﺪن از اﻳﻦﻛﻪ دوراي ﺑﻴﻤﺎران در ﺣﻴﻦ‬

‫ﻣﻲﺷﻮد ﺑﺎ اﻳﻦ ﺣﺎل‪ ،‬اﺳﺘﻔﺎده از آن در ﺟﺮاﺣﻲ ﻣﻐﺰ و اﻋﺼﺎب ﻏﻴﺮ‬

‫ﻋﻤﻞ ﺑﻪﺻﻮرت اﺗﻔﺎﻗﻲ دﭼﺎر ﭘﺎﻧﻜﭽﺮ ﻧﺸﺪه اﺳﺖ‪ ،‬در اﻧﺘﻬﺎي ﻋﻤﻞ‪،‬‬

‫ﻣﻌﻤﻮل اﺳﺖ‪ 14.‬ﺑﺎ ﺗﻮﺟﻪ ﺑﻪ اﻳﻦﻛﻪ ﺑﺮ اﺳﺎس ﺟﺴﺘﺠﻮي ﻣﺎ ﻣﻄﺎﻟﻌﺎت‬

‫ﺗﻮﺳﻂ ﻣﺘﺨﺼﺺ ﺑﻴﻬﻮﺷﻲ ﺑﻪ ﺑﻴﻤﺎران دو ﻣﺎﻧﻮر واﻟﺴﺎﻟﻮا داده ﻣﻲﺷﺪ و‬

‫ﺟﺪﻳﺪي در زﻣﻴﻨﻪ ﺑﺮرﺳﻲ ﺗﺎﺛﻴﺮ ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ ﻣﻮﺿﻌﻲ ﮔﺰارش‬

‫ﻣﺤﻞ ﻋﻤﻞ از ﻧﻈﺮ ﻧﺸﺖ ﻣﺎﻳﻊ ﻣﻐﺰي ﻧﺨﺎﻋﻲ ‪ CSF leakage‬ﺑﺮرﺳﻲ ﺷﺪ‪.‬‬

‫ﮔﺮدﻳﺪه و ﻛﺎﻫﺶ ﺧﻮﻧﺮﻳﺰي ﭘﺲ از ﺟﺮاﺣﻲ ﻻﻣﻴﻨﻜﺘﻮﻣﻲ ﻣﻲﺗﻮاﻧﺪ از‬

‫ﭘﺲ از اﻃﻤﻴﻨﺎن از ﺳﺎﻟﻢ ﺑﻮدن دورا ﺑﻪ روش ﻓﻮق‪ ،‬ﺑﺮ ﺣﺴﺐ ﮔﺮوه‬

‫ﻧﻈﺮ ﺑﺎﻟﻴﻨﻲ ﺟﺎﻟﺐ ﺗﻮﺟﻪ ﺑﺎﺷﺪ اﻳﻦ ﻣﻄﺎﻟﻌﻪ ﻃﺮاﺣﻲ و اﺟﺮا ﮔﺮدﻳﺪ‪ .‬اﻣﻴﺪ‬

‫ﺑﻴﻤﺎر در ﮔﺮوه ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ‪ 250 ،‬ﻣﻴﻠﻲﮔﺮم ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ )ﺑﺎ‬

‫اﺳﺖ ﻛﻪ ﺑﺎ ﺗﻜﻴﻪ ﺑﺮ ﻧﺘﺎﻳﺞ اﻳﻦ ﺗﺤﻘﻴﻖ ﺑﺘﻮان ﺗﺎﺛﻴﺮ اﺳﺘﻔﺎده ﻣﻮﺿﻌﻲ از اﻳﻦ‬

‫ﻧﺎم ﺗﺠﺎري ‪ ،Transec‬ﺳﺎﺧﺖ ﻛﺎرﺧﺎﻧﻪ داروﺳﺎزي رﺷﺖ‪ ،‬اﻳﺮان( ﻫﻤﺮاه‬

‫دارو را ﺑﻪﺻﻮرت دﻗﻴﻘﺘﺮ ﺑﺮ اﻋﻤﺎل ﺟﺮاﺣﻲ ﻻﻣﻴﻨﻜﺘﻮﻣﻲ ﻧﺸﺎن داد‪.‬‬

‫ﺑﺎ آب ﻣﻘﻄﺮ رﻗﻴﻖ ﺷﺪه و ﺣﺠﻢ ﻛﻠﻲ ﺑﻪ ‪ 5ml‬رﺳﺎﻧﺪه ﻣﻲﺷﺪ و ﭘﺲ از‬ ‫ﺧﺎرج ﻧﻤﻮدن ﮔﺎزﻫﺎ در ﻣﺤﻞ ﻋﻤﻞ‪ ،‬ﻓﻀﺎي اﭘﻴﺪورال‪ ،‬ﻋﻀﻼت و ﻓﺎﺷﻴﺎ‬

‫روش ﺑﺮرﺳﻲ‬

‫اﺳﭙﺮي ‪ Pouring‬ﻣﻲﺷﺪ و ﻣﺎﺳﺎژ داده ﻣﻲﺷﺪ‪ .‬در ﮔﺮوه ﺷﺎﻫﺪ ﻧﻴﺰ از‬

‫ﭘﺲ از ﺗﺎﻳﻴﺪ ﻃﺮح ﺗﻮﺳﻂ ﻛﻤﻴﺘﻪ اﺧﻼق ﭘﺰﺷﻜﻲ‪ 100 ،‬ﻧﻔﺮ از ﺑﻴﻤﺎراﻧﻲ‬

‫‪ 5ml‬ﺳﺎﻟﻴﻦ ﻧﺮﻣﺎل اﺳﺘﻔﺎده ﻣﻲﺷﺪ‪ .‬ﭘﺲ از ﮔﺬﺷﺖ ﭘﻨﺞ دﻗﻴﻘﻪ ﺑﺮاي ﺗﺎﺛﻴﺮ‬

‫ﻛﻪ ﻛﺎﻧﺪﻳﺪ ﻋﻤﻞ ﺟﺮاﺣﻲ اﻧﺘﺨﺎﺑﻲ ﻻﻣﻴﻨﻜﺘﻮﻣﻲ در ﺑﺨﺶ ﺟﺮاﺣﻲ‬

‫ﻛﺎﻣﻞ دارو‪ ،‬دوﺧﺘﻦ ﻣﺤﻞ ﻋﻤﻞ آﻏﺎز ﻣﻲﺷﺪ‪ .‬ﺗﺎ ‪ 30‬ﺗﺎ ‪ 60‬دﻗﻴﻘﻪ ﺑﻌﺪ از‬

‫اﻋﺼﺎب ﺑﻴﻤﺎرﺳﺘﺎن اﻣﺎم ﺧﻤﻴﻨﻲ از ﺳﺎل ‪ 1385‬ﻟﻐﺎﻳﺖ ‪ 1388‬ﺑﻮدﻧﺪ‪ ،‬ﭘﺲ‬

‫ﻋﻤﻞ ﺟﺮاﺣﻲ ﻧﻴﺰ ﻫﻴﭻﮔﻮﻧﻪ ﺧﻼء از ﻃﺮﻳﻖ درن ﺻﻮرت ﻧﻤﻲﮔﺮﻓﺖ ﺗﺎ‬

‫از اﻧﺠﺎم ﺑﺮرﺳﻲﻫﺎي اوﻟﻴﻪ و اﻋﻤﺎل ﻣﻌﻴﺎرﻫﺎي ورود و ﺧﺮوج‪ ،‬وارد ﻳﻚ‬

‫دارو ﻛﺎﻣﻼً در ﻣﺤﻞ ﺑﺎﻗﻲ ﺑﻤﺎﻧﺪ و اﺛﺮ ﻛﻨﺪ‪ .‬ﭘﺲ از اﻳﻦ ﻣﺪت ﺳﺎﻛﺸﻦ از‬

‫ﻣﻄﺎﻟﻌﻪ از ﻧﻮع ﻛﺎرآزﻣﺎﻳﻲ ﺑﺎﻟﻴﻨﻲ ‪ Clinical trial‬ﺷﺪﻧﺪ‪ .‬ﻣﺼﺮف داروﻫﺎي‬

‫ﻃﺮﻳﻖ درن ﺻﻮرت ﻣﻲﮔﺮﻓﺖ و ﺑﻴﻤﺎر ﺑﻪ ﺑﺨﺶ ﻣﻨﺘﻘﻞ ﻣﻲﺷﺪ‪ .‬ﻣﻴﺰان‬

‫‪PTT‬‬

‫ﺧﻮن داﺧﻞ ﻫﻤﻮﺑﮓ در ‪ 24‬ﺳﺎﻋﺖ اول و ‪ 24‬ﺳﺎﻋﺖ دوم ﺗﻮﺳﻂ ﻓﺮدي‬

‫ﺑﻴﻤﺎر ﺑﻪ ﻫﺮ ﻋﻠﺘﻲ‪ ،‬ﺳﺎﺑﻘﻪ ﺑﺮوز ﻫﺮ ﮔﻮﻧﻪ وﻗﺎﻳﻊ ﺗﺮوﻣﺒﻮﺗﻴﻚ و ﺳﺎﺑﻘﻪ‬

‫ﻛﻪ ﻣﺴﺌﻮل ﭘﻲﮔﻴﺮي ﺑﻴﻤﺎران در ﺑﺨﺶ ﺑﻮد و از ﮔﺮوه ﺑﻴﻤﺎران ﺑﻲاﻃﻼع‬

‫اﺧﺘﻼﻻت ﺧﻮﻧﺮﻳﺰي دﻫﻨﺪه ﻣﻮﺟﺐ ﺧﺮوج ﺑﻴﻤﺎر از ﻣﻄﺎﻟﻌﻪ ﻣﻲﺷﺪ‪ .‬ﭘﺲ‬

‫ﺑﻮد اﻧﺪازهﮔﻴﺮي ﻣﻲﺷﺪ‪ .‬در ﻧﻬﺎﻳﺖ ﻧﻴﺎز ﺑﻪ ﺗﺰرﻳﻖ ﺧﻮن و ﻃﻮل ﻣﺪت‬

‫از اﺧﺬ رﺿﺎﻳﺖﻧﺎﻣﻪ ﺗﻔﻬﻴﻤﻲ ﺟﻬﺖ ورود ﺑﻪ ﻃﺮح‪ ،‬و ﺗﻜﻤﻴﻞ ﭘﺮﺳﺸﻨﺎﻣﻪ‪،‬‬

‫اﻗﺎﻣﺖ در ﺑﻴﻤﺎرﺳﺘﺎن در دو ﮔﺮوه ﺑﺎ ﻳﻜﺪﻳﮕﺮ ﻣﻘﺎﻳﺴﻪ ﺷﺪ‪ .‬ﭘﺲ از ﺗﻜﻤﻴﻞ‬

‫ﺑﻴﻤﺎران ﺑﺮ ﺣﺴﺐ وﺳﻌﺖ ﻋﻤﻞ ﺟﺮاﺣﻲ ﺑﻪ دو ﮔﺮوه اﺻﻠﻲ ﻻﻣﻴﻨﻜﺘﻮﻣﻲ‬

‫ﻓﺮم ﻣﺨﺼﻮص ﻫﺮ ﺑﻴﻤﺎر اﻃﻼﻋﺎت ﻣﺮﺑﻮﻃﻪ در ‪ Code Sheet‬ﻛﻪ ﺑﻪﻫﻤﻴﻦ‬

‫ﻳﻚﻃﺮﻓﻪ در ﻳﻚ ﺳﻄﺢ و ﻻﻣﻴﻨﻜﺘﻮﻣﻲ دو ﻃﺮﻓﻪ در دو ﺳﻄﺢ ﺗﻘﺴﻴﻢ‬

‫ﻣﻨﻈﻮر ﻃﺮاﺣﻲ ﮔﺮدﻳﺪه وارد ﻣﻲﮔﺮدﻳﺪ و در ﻣﺤﻴﻂ ﻧﺮماﻓﺰار‬

‫‪SPSS‬‬

‫ﻣﻲﺷﺪﻧﺪ‪ .‬ﺳﭙﺲ ﺑﻴﻤﺎران ﺑﺮ اﺳﺎس ﺟﺪول اﻋﺪاد ﺗﺼﺎدﻓﻲ ﺑﻪ دو ﮔﺮوه‬

‫)‪ (SPSS Inc Chicago, IL‬وﻳﺮاﺳﺖ ‪ 12‬وارد ﻣﻲﮔﺮدﻳﺪ و ﺑﺮرﺳﻲﻫﺎي‬

‫ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ ‪ n=25‬و ﺷﺎﻫﺪ ‪ n=25‬ﺗﻘﺴﻴﻢ ﺷﺪﻧﺪ‪ .‬ﺑﻴﻤﺎران ﭘﺲ از‬

‫ﻻزم روي آنﻫﺎ اﻧﺠﺎم ﻣﻲﮔﺮﻓﺖ‪ .‬ﺑﺮاي ﻣﻘﺎﻳﺴﻪ داده ﻛﻤﻲ در دو ﮔﺮوه‬

‫ورود ﺑﻪ اﺗﺎق ﻋﻤﻞ ﺗﺤﺖ ﺑﻴﻬﻮﺷﻲ ﻋﻤﻮﻣﻲ ﻗﺮار ﻣﻲﮔﺮﻓﺘﻨﺪ و ﺳﭙﺲ ﺑﻪ‬

‫ﻏﻴﺮ واﺑﺴﺘﻪ‪ ،‬از آزﻣﻮن ‪ Independent samples t-test‬اﺳﺘﻔﺎده ﺷﺪ و‬

‫ﺿﺪ اﻧﻌﻘﺎد ﻣﺎﻧﻨﺪ آﺳﭙﻴﺮﻳﻦ و دي ﭘﻴﺮﻳﺪاﻣﻮل و ﻳﺎ ﺑﺎﻻ ﺑﻮدن‬

‫‪PT‬‬

‫و‬

‫‪2‬‬

‫ﺣﺎﻟﺖ ‪ Prone‬در ﻣﻲآﻣﺪﻧﺪ ﺗﻤﺎﻣﻲ اﻋﻤﺎل ﺟﺮاﺣﻲ ﺗﻮﺳﻂ ﻳﻚ ﺗﻴﻢ‬

‫ﺑﺮاي ﻣﻘﺎﻳﺴﻪ دادهﻫﺎي ﻛﻴﻔﻲ ﻧﻴﺰ از آزﻣﻮن ‪ ‬ﻳﺎ ‪ Fisher’s exact test‬ﺑﻪ‬

‫ﺟﺮاﺣﻲ ﺻﻮرت ﻣﻲﮔﺮﻓﺖ و ﺗﻜﻨﻴﻚ ﺑﻪﻛﺎر رﻓﺘﻪ ﻣﺸﺎﺑﻪ ﺑﻮد‪ .‬ﻫﻤﭽﻨﻴﻦ در‬

‫ﺗﻨﺎﺳﺐ اﺳﺘﻔﺎده ﺷﺪ‪ p<0/05 .‬ﻣﻌﻨﻲدار در ﻧﻈﺮ ﮔﺮﻓﺘﻪ ﺷﺪ‪.‬‬

‫ﺣﻴﻦ ﻋﻤﻞ از ﺳﺮﺟﻲ ﺳﻞ ﻣﺘﻴﻞ ﺳﻠﻮﻟﺰي ﻳﺎ ژل ﻓﻮم ‪ Gel foam‬اﺳﺘﻔﺎده‬ ‫ﻧﺸﺪ‪ .‬ﺑﻌﺪ از اﻧﺠﺎم ﻻﻣﻴﻨﻜﺘﻮﻣﻲ و ﻫﻤﻮﺳﺘﺎز ﻛﺎﻣﻞ‪ ،‬اﺑﺘﺪا ﻣﺤﻞ ﻋﻤﻞ‬

‫ﻳﺎﻓﺘﻪﻫﺎ‬

‫‪Pack‬‬

‫‪ 100‬ﺑﻴﻤﺎر ﻣﻮرد ﺑﺮرﺳﻲ ﻧﻬﺎﻳﻲ ﻗﺮار ﮔﺮﻓﺘﻨﺪ‪ .‬ﻣﻴﺎﻧﮕﻴﻦ ﺳﻦ ﺑﻴﻤﺎران‬

‫ﻣﻲﺷﺪ‪ .‬در ﭘﺎﻳﺎن ﻋﻤﻞ ﺑﻪﻣﻨﻈﻮر ﻫﻤﻮﺳﺘﺎز‪ ،‬در ﺻﻮرﺗﻲ ﻛﻪ ﺧﻮﻧﺮﻳﺰي‬

‫ﻣﻮرد ﺑﺮرﺳﻲ ‪ 41/24±10/18‬ﺳﺎل و ‪ %61‬از آنﻫﺎ ﻣﺬﻛﺮ ﺑﻮدﻧﺪ‪ .‬ﻧﺘﺎﻳﺞ‬

‫ﺷﺮﻳﺎﻧﻲ ﺑﻮد ﺗﻮﺳﻂ ﻛﻮﺗﺮ ﻛﻨﺘﺮل ﻣﻲﺷﺪ و ﺧﻮﻧﺮﻳﺰي ورﻳﺪي اﺑﺘﺪا ﺑﺎ ﭘﻚ‬

‫ﺣﺎﺻﻞ از ﻣﻘﺎﻳﺴﻪ ﻣﺘﻐﻴﺮﻫﺎي دﻣﻮﮔﺮاﻓﻴﻚ و ﺑﺎﻟﻴﻨﻲ ﺑﻴﻦ دو ﮔﺮوه‬

‫ﺟﺮاﺣﻲ و ﺑﺨﺶﻫﺎي ﻣﺨﺘﻠﻒ ﻋﻀﻼت و ﻓﺎﺷﻴﺎ ﺑﺎ ﮔﺎز ﻛﺎﻣﻼ ﭘﻚ‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬


‫‪529‬‬

‫ﺗﺎﺛﻴﺮ ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ ﻣﻮﺿﻌﻲ در ﻛﺎﻫﺶ ﺧﻮﻧﺮﻳﺰي ﭘﺲ از ﻻﻣﻴﻨﻜﺘﻮﻣﻲ‬

‫‪BMI‬‬

‫اﺧﺘﻼف‬

‫ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ و ﺷﺎﻫﺪ در ﮔﺮوه ﻻﻣﻴﻨﻜﺘﻮﻣﻲ ﻳﻚﻃﺮﻓﻪ ﻳﻚ ﺳﻄﺢ‬

‫ﻗﺮار ﮔﺮﻓﺘﻨﺪ ﺑﻴﻦ ﻣﻴﺎﻧﮕﻴﻦ ﺳﻦ‪ ،‬ﻓﺮاواﻧﻲ دو ﺟﻨﺲ و‬

‫در ﺟﺪول ‪ 1‬و ﻧﺘﺎﻳﺞ ﺣﺎﺻﻞ از ﻣﻘﺎﻳﺴﻪ ﻣﺘﻐﻴﺮﻫﺎي دﻣﻮﮔﺮاﻓﻴﻚ و ﺑﺎﻟﻴﻨﻲ‬

‫ﻣﻌﻨﻲداري در دو ﮔﺮوه دﻳﺪه ﻧﺸﺪ‪ .‬اﻣﺎ ﺑﻴﻦ دو ﮔﺮوه ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ‬

‫ﺑﻴﻦ دو ﮔﺮوه ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ و ﺷﺎﻫﺪ ﮔﺮوه ﻻﻣﻴﻨﻜﺘﻮﻣﻲ دوﻃﺮﻓﻪ در‬

‫و ﺷﺎﻫﺪ ﺧﻮﻧﺮﻳﺰي در ‪ 24‬ﺳﺎﻋﺖ اول )ﺑﻪﺗﺮﺗﻴﺐ ‪ 55/8±10/07‬در ﺑﺮاﺑﺮ‬

‫دو ﺳﻄﺢ در ﺟﺪول ‪ 2‬آورده ﺷﺪه اﺳﺖ‪ .‬ﺑﺮ اﺳﺎس ﻳﺎﻓﺘﻪﻫﺎي ﻣﻄﺎﻟﻌﻪ‬

‫‪ 78/8±20/07‬ﻣﻴﻠﻲﻟﻴﺘﺮ‪ (p=0/001 ،‬و در ‪ 24‬ﺳﺎﻋﺖ دوم )‪35±32/47‬‬

‫ﺣﺎﺿﺮ در ﺑﻴـﻦ ﺑﻴـﻤﺎراﻧﻲ ﻛﻪ ﺗﺤﺖ ﻻﻣﻴﻨﻜﺘﻮﻣﻲ ﻳﻚﻃﺮﻓﻪ در ﻳﻚ ﺳﻄﺢ‬

‫در ﺑﺮاﺑﺮ ‪ 116/4±34/05‬ﻣﻴﻠﻲﻟﻴﺘﺮ‪ (p=0/001 ،‬و در ﻛﻞ )‪90/8±30/88‬‬ ‫در ﺑﺮاﺑﺮ ‪ 195/2±52/51‬ﻣﻴﻠﻲﻟﻴﺘﺮ؛ ‪ (p=0/001‬ﺑﻪﻣﻴﺰان ﻣﻌﻨﻲداري در‬

‫ﺟﺪول‪ :1-‬ﻣﻘﺎﻳﺴﻪ ﻣﺘﻐﻴﺮﻫﺎي دﻣﻮﮔﺮاﻓﻴﻚ و ﺑﺎﻟﻴﻨﻲ ﺑﻴﻦ دو ﮔﺮوه ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ و‬

‫ﮔﺮوه ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ ﻛﻤﺘﺮ ﺑﻮد‪ .‬ﻫﻤﭽﻨﻴﻦ در ﮔﺮوه ﻻﻣﻴﻨﻜﺘﻮﻣﻲ‬

‫ﺷﺎﻫﺪ در ﻻﻣﻴﻨﻜﺘﻮﻣﻲ ﻳﻚﻃﺮﻓﻪ ﻳﻚ ﺳﻄﺢ‬

‫دوﻃﺮﻓﻪ در دو ﺳﻄﺢ ﻧﻴﺰ ﺿﻤﻦ اﻳﻦﻛﻪ ﺳﻦ ﺑﻴﻤﺎران اﺧﺘﻼف ﻣﻌﻨﻲداري‬ ‫ﺷﺎﻫﺪ‬

‫*‪p‬‬

‫ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ‬

‫ﻣﺘﻐﻴﺮ‬

‫)‪(n=37‬‬

‫)‪(n=37‬‬

‫‪35/6±9/73‬‬

‫‪32/72±8/31‬‬

‫‪0/266‬‬

‫ﺟﻨﺲ )ﻣﺮد‪ /‬زن(‬

‫)‪(10/15‬‬

‫)‪(8/17‬‬

‫‪0/769‬‬

‫‪) BMI‬ﭼﺎق‪ /‬ﻧﺮﻣﺎل(‬

‫)‪(21/4‬‬

‫)‪(22/3‬‬

‫‪0/999‬‬

‫‪55/8±10/07‬‬

‫‪78/8±20/07‬‬

‫‪0/001‬‬

‫ﺳﻦ )ﺳﺎل(‬

‫ﺧﻮﻧﺮﻳﺰي در ‪ 24‬ﺳﺎﻋﺖ‬ ‫اول ﭘﺲ از ﻋﻤﻞ‬

‫دوم ﭘﺲ از ﻋﻤﻞ‬

‫ﻣﻌﻨﻲداري ﺑﻴﻦ دو ﮔﺮوه ﻧﺸﺎن ﻧﺪادﻧﺪ‪ .‬ﻫﻤﭽﻨﻴﻦ ﺧﻮﻧﺮﻳﺰي در ‪24‬‬

‫‪35±32/47‬‬

‫‪116/4±34/05‬‬

‫‪0/001‬‬

‫)‪* (ml‬‬

‫ﺧﻮﻧﺮﻳﺰي ﻛﻠﻲ ﭘﺲ از ﻋﻤﻞ‬

‫‪ (p=0/001‬و در ‪ 24‬ﺳﺎﻋﺖ دوم )‪ 115/4±12/49‬در ﺑﺮاﺑﺮ‬ ‫‪ 205/8±17/66‬ﻣﻴﻠﻲﻟﻴﺘﺮ‪ (p=0/001 ،‬و ﺧﻮﻧﺮﻳﺰي ﻛﻠﻲ )‪212/8±20/06‬‬ ‫ﮔﺮوه ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ ﻧﺴﺒﺖ ﺑﻪ ﮔﺮوه ﺷﺎﻫﺪ ﻛﻤﺘﺮ ﺑﻮد‪ ،‬ﺿﻤﻦ اﻳﻦﻛﻪ‬ ‫ﻣﺪت ﺑﺴﺘﺮي ﻧﻴﺰ در ﮔﺮوه ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ ﻛﻮﺗﺎهﺗﺮ ﺑﻮد )‪ 2/16±0/37‬در‬

‫‪90/8±30/88‬‬

‫‪195/2±52/51‬‬

‫‪0/001‬‬

‫ﺑﺮاﺑﺮ ‪ 2/96±0/89‬روز‪ .(p=0/001 ،‬ﻫﻴﭻ ﺑﻴﻤﺎري از ﻣﻄﺎﻟﻌﻪ ﺧﺎرج ﻧﺸﺪ‬

‫‪2/0±0/0‬‬

‫‪2/0±0/0‬‬

‫‪0/999‬‬

‫و ﺑﺮ اﺳﺎس ﻧﺘﺎﻳﺞ ﺑﻪدﺳﺖ آﻣﺪه‪ ،‬ﺧﻮﻧﺮﻳﺰي در ‪ 24‬ﺳﺎﻋﺖ اول و دوم‬

‫)‪* (ml‬‬

‫ﻃﻮل ﻣﺪت ﺑﺴﺘﺮي )روز(‬

‫ﺳﺎﻋﺖ اول )ﺑﻪﺗﺮﺗﻴﺐ ‪ 97/4±13/39‬در ﺑﺮاﺑﺮ ‪ 179/6±21/79‬ﻣﻴﻠﻲﻟﻴﺘﺮ‪،‬‬

‫در ﺑﺮاﺑﺮ ‪ 385/4±37/8‬ﻣﻴﻠﻲﻟﻴﺘﺮ؛ ‪ (p=0/001‬ﻧﻴﺰ ﺑﻪﻣﻴﺰان ﻣﻌﻨﻲداري در‬

‫)‪* (ml‬‬

‫ﺧﻮﻧﺮﻳﺰي در ‪ 24‬ﺳﺎﻋﺖ‬

‫ﻧﺸﺎن داد‪ ،‬اﻣﺎ ﻓﺮاواﻧﻲ دو ﺟﻨﺲ و ﺷﺎﺧﺺ ﺗﻮده ﺑﺪن‬

‫‪BMI‬‬

‫اﺧﺘﻼف‬

‫* ﺗﻔﺎوت ﻣﻌﻨﻲدار )‪ .(p<0/05 Independent samples t-test‬ﻣﻘﺎدﻳﺮ ﺑﻪﺻﻮرت اﻧﺤﺮاف‬

‫ﻣﻌﻴﺎر‪±‬‬

‫ﻣﻴﺎﻧﮕﻴﻦ ﻳﺎ ﺗﻌﺪاد ﺑﻴﺎن ﺷﺪهاﻧﺪ‪.‬‬

‫ﭘﺲ از ﻋﻤﻞ و ﺧﻮﻧﺮﻳﺰي ﻛﻠﻲ ﭘﺲ از ﻋﻤﻞ در ﻫﺮ دو ﮔﺮوه ﻻﻣﻴﻨﻜﺘﻮﻣﻲ‬ ‫ﻳﻚﻃﺮﻓﻪ ﻳﻚ ﺳﻄﺢ )ﻧﻤﻮدار ‪ (1‬و دوﻃﺮﻓﻪ در دو ﺳﻄﺢ )ﻧﻤﻮدار ‪ (2‬در‬ ‫ﮔﺮوه ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ ﺑﻪﻣﻴﺰان ﻣﻌﻨﻲداري از ﮔﺮوه ﺷﺎﻫﺪ ﻛﻤﺘﺮ ﺑﻮد‪.‬‬

‫ﺟﺪول‪ :2-‬ﻣﻘﺎﻳﺴﻪ ﻣﺘﻐﻴﺮﻫﺎي دﻣﻮﮔﺮاﻓﻴﻚ و ﺑﺎﻟﻴﻨﻲ ﺑﻴﻦ دو ﮔﺮوه ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ و‬

‫ﻫﻤﭽﻨﻴﻦ ﻃﻮل ﻣﺪت ﺑﺴﺘﺮي ﻧﻴﺰ در ﮔﺮوه ﻻﻣﻴﻨﻜﺘﻮﻣﻲ دوﻃﺮﻓﻪ در دو‬

‫ﺷﺎﻫﺪ در ﻻﻣﻴﻨﻜﺘﻮﻣﻲ دوﻃﺮﻓﻪ در دو ﺳﻄﺢ‬

‫ﺳﻄﺢ ﻛﻮﺗﺎهﺗﺮ ﺑﻮد‪ .‬ﻣﻮردي از ﺗﺰرﻳﻖ ﺧﻮن و ﻋﻮارض ﺟﺎﻧﺒﻲ ﻧﺪاﺷﺘﻴﻢ‪.‬‬

‫ﻣﺘﻐﻴﺮ‬

‫)‪(n=37‬‬

‫)‪(n=37‬‬

‫)ﺳﺎل(*‬

‫‪49/96±4‬‬

‫‪46/68±5/36‬‬

‫‪0/018‬‬

‫ﺟﻨﺲ )ﻣﺮد‪ /‬زن(‬

‫)‪(11/14‬‬

‫)‪(10/15‬‬

‫‪0/999‬‬

‫‪) BMI‬ﭼﺎق‪ /‬ﻧﺮﻣﺎل(‬

‫)‪(15/10‬‬

‫)‪(12/13‬‬

‫‪0/571‬‬

‫‪97/4±13/39‬‬

‫‪179/6±21/79‬‬

‫‪0/001‬‬

‫ﺳﻦ‬

‫ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ‬

‫ﺧﻮﻧﺮﻳﺰي در ‪ 24‬ﺳﺎﻋﺖ اول‬ ‫ﭘﺲ از ﻋﻤﻞ‬

‫‪200/00‬‬ ‫‪180/00‬‬

‫)‪* (ml‬‬

‫ﺧﻮﻧﺮﻳﺰي در ‪ 24‬ﺳﺎﻋﺖ دوم‬ ‫ﭘﺲ از ﻋﻤﻞ‬

‫‪220/00‬‬

‫‪160/00‬‬

‫‪115/4±12/49‬‬

‫‪205/8±17/66‬‬

‫‪0/001‬‬

‫‪140/00‬‬ ‫‪120/00‬‬

‫)‪* (ml‬‬

‫ﺧﻮﻧﺮﻳﺰي ﻛﻠﻲ ﭘﺲ از ﻋﻤﻞ‬

‫‪212/8±20/06‬‬

‫‪385/4±37/8‬‬

‫‪0/001‬‬

‫‪2/16±0/37‬‬

‫‪2/96±0/89‬‬

‫‪0/001‬‬

‫‪100/00‬‬ ‫‪80/00‬‬

‫)‪* (ml‬‬

‫ﻃﻮل ﻣﺪت ﺑﺴﺘﺮي‬

‫)روز( *‬

‫* ﺗﻔﺎوت ﻣﻌﻨﻲدار )‪ .(p<0/05 Independent samples t-test‬ﻣﻘﺎدﻳﺮ ﺑﻪﺻﻮرت اﻧﺤﺮاف‬ ‫ﻣﻴﺎﻧﮕﻴﻦ ﻳﺎ ﺗﻌﺪاد ﺑﻴﺎن ﺷﺪهاﻧﺪ‪.‬‬

‫ﻣﻌﻴﺎر‪±‬‬

‫ﮔﺮوه ﻛﻨﺘﺮل‬

‫)‪95% CI Total Postop Hemorrhage (ml‬‬

‫ﺷﺎﻫﺪ‬

‫*‪p‬‬

‫ﮔﺮوه ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ‬

‫ﻧﻤﻮدار‪ :1-‬ﻣﻘﺎﻳﺴﻪ ﻣﻴﺎﻧﮕﻴﻦ ﺧﻮﻧﺮﻳﺰي ﻛﻠﻲ ﭘﺲ از ﻋﻤﻞ ﺑﻴﻦ دو ﮔﺮوه ﺗﺮاﻧﻜـﺴﺎﻣﻴﻚ‬ ‫اﺳﻴﺪ و ﺷﺎﻫﺪ در ﻻﻣﻴﻨﻜﺘﻮﻣﻲ ﻳﻚﻃﺮﻓﻪ و ﻳﻚ ﺳﻄﺢ )‪(p<0/05‬‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬


‫ﻫﻮﺷﻨﮓ ﺻﺎﺑﺮي و ﻫﻤﻜﺎران‬

‫‪530‬‬

‫‪400/00‬‬ ‫‪350/00‬‬ ‫‪300/00‬‬ ‫‪250/00‬‬ ‫‪200/00‬‬ ‫ﮔﺮوه ﻛﻨﺘﺮل‬

‫)‪95% CI Total Postop Hemorrhage (ml‬‬

‫‪450/00‬‬

‫آﭘﺮوﺗﻴﻨﻴﻦ ﻳﺎ ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ ﻣﻮﺟﺐ ﻛﺎﻫﺶ ﻣﻴﺰان ﺧﻮﻧﺮﻳﺰي در ‪24‬‬ ‫ﺳﺎﻋﺖ اول ﺑﻌﺪ از ﻋﻤﻞ ﻣﻲﺷﻮد و ﻣﻨﺠﺮ ﺑﻪ ﺻﺮﻓﻪﺟﻮﻳﻲ در ﺗﺰرﻳﻖ ﻳﻚ‬ ‫‪9‬‬

‫واﺣﺪ ﺧﻮن اﻳﺰو ﮔﺮوپ در ﻫﺮ ﺑﻴﻤﺎر ﻣﻲﮔﺮدد‪ De Bonis .‬ﻧﻴﺰ ﻧﺸﺎن‬ ‫داد ﻛﻪ اﺳﺘﻔﺎده ﻣﻮﺿﻌﻲ از ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ )ﻳﻚ ﮔﺮم ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ‬ ‫اﺳﻴﺪ رﻗﻴﻖ ﺷﺪه در ‪ 100‬ﻣﻴﻠﻲﻟﻴﺘﺮ ﻧﺮﻣﺎل ﺳﺎﻟﻴﻦ ﺑﻪﺻﻮرت ﻣﻮﺿﻌﻲ( در‬ ‫ﭘﺮﻳﻜﺎرد ﭘﺲ از ﻋﻤﻞ ﺟﺮاﺣﻲ ﻋﺮوق ﻛﺮوﻧﺮ در ﺑﻴﻤﺎراﻧﻲ ﻛﻪ ﺗﺤﺖ ﻋﻤﻞ‬ ‫اوﻟﻴﻪ ﺑﺎيﭘﺲ ﻋﺮوق ﻛﺮوﻧﺮ ﻗﺮار ﻣﻲﮔﻴﺮﻧﺪ ﻣﻮﺟﺐ ﻛﺎﻫﺶ ﻣﻌﻨﻲداري‬

‫ﮔﺮوه ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ‬

‫‪10‬‬

‫ﻧﻤﻮدار‪ :2-‬ﻣﻘﺎﻳﺴﻪ ﻣﻴﺎﻧﮕﻴﻦ ﺧﻮﻧﺮﻳﺰي ﻛﻠﻲ ﭘﺲ از ﻋﻤﻞ ﺑﻴﻦ دو ﮔﺮوه ﺗﺮاﻧﻜـﺴﺎﻣﻴﻚ‬

‫ﺧﻮﻧﺮﻳﺰي ﺑﻌﺪ از ﻋﻤﻞ در ﻣﻘﺎﻳﺴﻪ ﺑﺎ ﮔﺮوه داروﻧﻤﺎ ﻣﻲﺷﻮد‪.‬‬

‫اﺳﻴﺪ و ﺷﺎﻫﺪ در ﻻﻣﻴﻨﻜﺘﻮﻣﻲ دوﻃﺮﻓﻪ و دو ﺳﻄﺢ )‪(p<0/05‬‬

‫‪ Abul-Azm‬ﻧﻴﺰ ﻧﺸﺎن داد ﻛﻪ اﺳﺘﻔﺎده ﻣﻮﺿﻌﻲ از ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ )دو‬ ‫ﮔﺮم در ‪ 100‬ﻣﻴﻠﻲﻟﻴﺘﺮ ﻧﺮﻣﺎل ﺳﺎﻟﻴﻦ ﻛﻪ ﻗﺒﻞ از ﺑﺴﺘﻦ اﺳﺘﺮﻧﻮم ﺑﻪ ﻓﻀﺎي‬

‫ﺑﺤﺚ‬

‫ﭘﺮﻳﻜﺎرد اﺳﭙﺮي ﻣﻲﺷﺪ( در ﺑﺎﻟﻐﻴﻨﻲ ﻛﻪ ﺗﺤﺖ ﻋﻤﻞ اوﻟﻴﻪ ﺟﺮاﺣﻲ ﻗﻠﺐ‬

‫ﺑﺮ اﺳﺎس ﺟﺴﺘﺠﻮي ﻣﺎ ﺗﺎﻛﻨﻮن در ﺟﺮاﺣﻲ اﻋﺼﺎب ﺗﻨﻬﺎ در ﻳﻚ‬

‫ﺑﺎز ﻗﺮار ﻣﻲﮔﻴﺮﻧﺪ ﻣﻮﺟﺐ ﻛﺎﻫﺶ ﻣﻌﻨﻲدار ﺧﻮﻧﺮﻳﺰي ﻣﺪﻳﺎﺳﺘﻴﻨﺎل و ﻧﻴﺎز‬

‫ﻣﻄﺎﻟﻌﻪ از ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ ﺑﻪﺻﻮرت ﻣﻮﺿﻌﻲ ﺑﺮاي ﻛﺎﻫﺶ ﺧﻮﻧﺮﻳﺰي‬

‫‪11‬‬

‫ﺑﻪ ﺑﺎز ﺑﻴﻨﻲ ﻣﺠﺪد ﺑﺮاي ﻫﻤﻮﺳﺘﺎز ﻣﻲﺷﻮد‪ .‬ﻧﺘﺎﻳﺞ ﻣﺸﺎﺑﻬﻲ در ﻣﻄﺎﻟﻌﺎت‬ ‫‪11‬و‪10‬‬

‫اﻣﺎ از ﻃﺮﻓﻲ ﻣﻄﺎﻟﻌﺎﺗﻲ ﻧﻴﺰ وﺟﻮد‬

‫اﺳﺘﻔﺎده ﺷﺪه اﺳﺖ‪ Krohn .‬در ﻳﻚ ﻣﻄﺎﻟﻌﻪ ﺑﻪﻣﻨﻈﻮر ﺑﺮرﺳﻲ اﺛﺮات‬

‫دﻳﮕﺮ ﻧﻴﺰ ﺑﻪدﺳﺖ آﻣﺪه اﺳﺖ‪.‬‬

‫اﺳﺘﻔﺎده ﻣﻮﺿﻌﻲ از ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ ﺑﺮ ﺧﻮﻧﺮﻳﺰي ﭘﺲ از ﻋﻤﻞ‬

‫دارﻧﺪ ﻛﻪ ﺑﻪ ﻧﺘﺎﻳﺞ ﻣﺨﺎﻟﻒ رﺳﻴﺪهاﻧﺪ‪ .‬ﺑﻪﻋﻨﻮان ﻣﺜﺎل ‪ Hanif‬ﻧﻴﺰ در ﻳﻚ‬

‫ﺟﺮاﺣﻲ و ﻣﻴﺰان ﻓﻴﺒﺮﻳﻨﻮﻟﻴﺰ ‪ Fibrinolysis‬در ﺧﻮن درﻧﺎژ ﺷﺪه ﭘﺲ از‬

‫ﻣﻄﺎﻟﻌﻪ ﺑﻪ ﺑﺮرﺳﻲ ﺗﺎﺛﻴﺮ اﺳﺘﻔﺎده ﻣﻮﺿﻌﻲ از ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ در ﺑﺮوز‬

‫‪Low back pain‬‬

‫ﺧﻮﻧﺮﻳﺰي ﻣﺪﻳﺎﺳﺘﻦ ﺑﻌﺪ از ﻋﻤﻞ ﭘﺮداﺧﺖ و ﭘﺲ از ﺑﺮرﺳﻲ ‪ 511‬ﻣﻘﺎﻟﻪ‬

‫ﺗﻮﺳﻂ ﻓﻴﻜﺲ ﻛﺮدن ﺑﺎ ﭘﻴﭻ ‪ Screw fixation‬ﺑﺮاي ﻣﻬﺮهﻫﺎي ﻛﻤﺮي ﻗﺮار‬

‫ﺗﻨﻬﺎ ﻳﻚ ﻣﻄﺎﻟﻌﻪ ﺑﻪﻧﻈﺮ آنﻫﺎ ﺑﻪ درﺳﺘﻲ ﺑﻪ اﻳﻦ ﺳﺌﻮال ﭘﺎﺳﺦ داده ﺑﻮد و‬

‫ﮔﺮﻓﺖ ﻧﺸﺎن داد ﻛﻪ در ﮔﺮوه ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ ﻣﻴﺎﻧﮕﻴﻦ ﺧﻮن از دﺳﺖ‬

‫در آن ﻧﺸﺎن داده ﺷﺪه ﻛﻪ ﻣﻨﻔﻌﺖ ﺑﺎﻟﻴﻨﻲ ﻛﻮﭼﻜﻲ ﺑﻪ ﻧﻔﻊ اﺳﺘﻔﺎده‬

‫رﻓﺘﻪ ﺑﻪ ﻧﺼﻒ ﻛﺎﻫﺶ ﻳﺎﻓﺖ )‪ 525‬ﺑﻪ ‪ 252‬ﻣﻴﻠﻲﻟﻴﺘﺮ‪ 15.(p=0/02 ،‬اﻳﻦ‬

‫ﻣﻮﺿﻌﻲ از ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ در ﺑﻴﻤﺎران ﻛﻢ ﺧﻄﺮ در ﺟﺮاﺣﻲ ﻗﻠﺐ‬

‫ﻧﺘﺎﻳﺞ ﺑﻪ ﻳﺎﻓﺘﻪﻫﺎي ﺑﻪدﺳﺖ آﻣﺪه از اﻳﻦ ﻣﻄﺎﻟﻌﻪ ﺑﺴﻴﺎر ﻧﺰدﻳﻚ اﺳﺖ‪.‬‬

‫وﺟﻮد دارد‪ Yasim 12.‬ﻧﻴﺰ ﻧﺸﺎن داد ﻛﻪ ﺑﻪﻛﺎر ﺑﺮدن ﻣﻮﺿﻌﻲ آﭘﺮوﺗﻴﻨﻴﻦ و‬

‫ﺗﺎﻛﻨﻮن در ﻣﻄﺎﻟﻌﺎت دﻳﮕﺮ ﻧﻴﺰ از ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ ﻣﻮﺿﻌﻲ ﺑﻪﻣﻨﻈﻮر‬

‫ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ در ﻃﻲ ﻋﻤﻞ ﺟﺮاﺣﻲ ﻗﻠﺐ ﻣﻮﺟﺐ ﻛﺎﻫﺶ ﺧﻮﻧﺮﻳﺰي‬

‫ﺑﺮرﺳﻲ ‪ 30‬ﺑﻴﻤﺎر ﻛﻪ ﺗﺤﺖ ﺟﺮاﺣﻲ ﺑﺮاي درد ﻛﻤﺮ‬

‫‪13‬‬

‫ﻛﻨﺘﺮل ﺧﻮﻧﺮﻳﺰي ﻣﻮﺿﻌﻲ اﺳﺘﻔﺎده ﺷﺪه اﺳﺖ‪ .‬ﺑﻪﻋﻨﻮان ﻣﺜﺎل در ﺑﻴﻤﺎران‬

‫ﺑﻌﺪ از ﻋﻤﻞ ﻣﻲﺷﻮد‪ ،‬اﻣﺎ اﻳﻦ اﺧﺘﻼف‪ ،‬از ﻧﻈﺮ آﻣﺎري ﻣﻌﻨﻲدار ﻧﻴﺴﺖ‪.‬‬

‫ﻣﺒﺘﻼ ﺑﻪ اﺧﺘﻼﻻت ﺧﻮﻧﺮﻳﺰيدﻫﻨﺪه ﻛﻪ ﺗﺤﺖ اﻋﻤﺎل ﺟﺮاﺣﻲ زﻧﺎن ﻗﺮار‬

‫ﻫﻤﭽﻨﻴﻦ ﺗﻔﺎوت ﻧﺎﭼﻴﺰ ﻣﻴﺎن اﺛﺮ آﭘﺮوﺗﻴﻨﻴﻦ و ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ در‬

‫ﻣﻲﮔﻴﺮﻧﺪ ﻧﺸﺎن داده ﺷﺪه ﻛﻪ اﺳﺘﻔﺎده از ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ ﺑﻪﺻﻮرت‬

‫ﻛﺎﻫﺶ ﻧﻴﺎز ﺑﻪ ﺗﺰرﻳﻖ ﺧﻮن ﻧﻴﺰ ﻣﻌﻨﻲدار ﻧﺒﻮد‪ .‬در ﻣﻮرد ﻋﻠﺖ اﻧﺘﺨﺎب‬

‫ﻣﻮﺿﻌﻲ ﻣﻲﺗﻮاﻧﺪ ﺑﻪﻛﻨﺘﺮل ﺧﻮﻧﺮﻳﺰي ﻣﻨﺠﺮ ﮔﺮدد‪ 5.‬ﻫﻤﭽﻨﻴﻦﺗﺎﺛﻴﺮ اﺳﺘﻔﺎده‬

‫ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ ﺑﺮاي ﻣﻄﺎﻟﻌﻪ ﺣﺎﺿﺮ در ﻣﻄﺎﻟﻌﺎت ﻗﺒﻠﻲ ﻧﺸﺎن داده‬

‫ﻣﻮﺿﻌﻲ از اﻳﻦ دارو در ﻛﺎﻫﺶ ﺧﻮﻧﺮﻳﺰي ﭘﺲ از ﻛﺸﻴﺪن دﻧﺪان در‬

‫ﺷﺪه ﻛﻪ اﺳﺘﻔﺎده ﻣﻮﺿﻌﻲ از ﻫﺮ ﻛﺪام از ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ ﻳﺎ آﭘﺮوﺗﻴﻨﻴﻦ‬

‫در ﺧﻮﻧﺮﻳﺰي ﺑﻌﺪ از اﻋﻤﺎل ﺟﺮاﺣﻲ آرﺗﺮوﭘﻼﺳﺘﻲ‬

‫ﺑﻪﻃﻮر ﻛﺎرآﻣﺪي ﺧﻮﻧﺮﻳﺰي ﺑﻌﺪ از ﻋﻤﻞ ﺟﺮاﺣﻲ ﻗﻠﺐ را ﻛﺎﻫﺶ‬

‫ﻛﻮدﻛﺎن ﻫﻤﻮﻓﻴﻠﻲ‬

‫‪7‬و‪6‬‬

‫‪8‬‬

‫ﻣﺜﺒﺖ ارزﻳﺎﺑﻲ ﺷﺪه اﺳﺖ‪ .‬در اﻋﻤﺎل ﺟﺮاﺣﻲ ﻗﻠﺐ ﻧﻴﺰ ‪ Fawzy‬در ﻳﻚ‬

‫ﻣﻲدﻫﺪ‪ .‬اﻣﺎ ﺑﻪﻧﻈﺮ ﻣﻲرﺳﺪ ﻗﺪرت ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ ﻣﻮﺿﻌﻲ ﻣﺸﺎﺑﻪ‬

‫ﻣﻄﺎﻟﻌﻪ ﻧﺸﺎن داد ﻛﻪ ﻛﺎرﺑﺮد ﻣﻮﺿﻌﻲ ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ در ﺑﻴﻤﺎراﻧﻲ ﻛﻪ‬

‫ﻗﺪرت آﭘﺮوﺗﻴﻨﻴﻦ ﻣﻮﺿﻌﻲ در ﻛﺎﻫﺶ ﺧﻮﻧﺮﻳﺰي ﺑﺎﺷﺪ‪ ،‬در ﺣﺎﻟﻲﻛﻪ‬ ‫‪2‬‬

‫ﺗﺤﺖ ﻋﻤﻞ ﺑﺎيﭘﺲ ﻋﺮوق ﻛﺮوﻧﺮ ﻗﺮار ﻣﻲﮔﻴﺮﻧﺪ ﺑﺪون اﻓﺰودن ﺧﻄﺮ‬

‫ﺑﻪﻃﻮر ﺑﺎﻟﻘﻮه اﻳﻤﻦﺗﺮ و ﺑﺎ ﻗﻴﻤﺖ ﻛﻤﺘﺮ ﻣﻲﺑﺎﺷﺪ‪ .‬اﻟﺒﺘﻪ ﺑﺎﻳﺪ در ﻧﻈﺮ‬

‫اﺿﺎﻓﻲ ﺑﻪ ﺑﻴﻤﺎر ﻣﻮﺟﺐ ﻛﺎﻫﺶ ﻣﻌﻨﻲدار در از دﺳﺖ دادن ﺧﻮن ﭘﺲ از‬

‫داﺷﺖ در اﻋﻤﺎل ﺟﺮاﺣﻲ ﻛﻪ ﻣﺎﻧﻨﺪ ﺟﺮاﺣﻲ ﻗﻠﺐ ﻛﻪ ﺑﺎ ﺧﻄﺮ ﺑﺎﻻي‬

‫ﻋﻤﻞ ﺟﺮاﺣﻲ ﻣﻲﺷﻮد‪ Abrishami 3.‬ﻧﻴﺰ در ﻳﻚ ﻣﻄﺎﻟﻌﻪ ﺳﻴﺴﺘﻤﺎﺗﻴﻚ‬

‫ﺧﻮﻧﺮﻳﺰي ﻫﻤﺮاه ﻫﺴﺘﻨﺪ‪ ،‬ﻣﻤﻜﻦ اﺳﺖ آﭘﺮوﺗﻴﻨﻴﻦ ﺑﺮ ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ‬

‫ﻧﺸﺎن داد ﻛﻪ اﺳﺘﻔﺎده ﻣﻮﺿﻌﻲ ﻋﻮاﻣﻞ آﻧﺘﻲ ﻓﻴﺒﺮﻳﻨﻮﻟﻴﺘﻴﻚ و ﺑﻪﻃﻮر اﺧﺺ‬

‫ﺗﺮﺟﻴﺢ داﺷﺘﻪ ﺑﺎﺷﺪ‪ 1.‬وﻟﻲ در ﺟﺮاﺣﻲ ﻣﻬﺮهﻫﺎ ﺑﻪﻧﻈﺮ ﻧﻤﻲرﺳﺪ ﻣﻴﺰان‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬


‫‪Saberi‬ﺧﻮﻧﺮﻳﺰي ﭘﺲ از ﻻﻣﻴﻨﻜﺘﻮﻣﻲ‬ ‫در ﻛﺎﻫﺶ‬ ‫ﻣﻮﺿﻌﻲ ‪H.‬‬ ‫ﺗﺎﺛﻴﺮ ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ ‪et al.‬‬

‫ﺧﻮﻧﺮﻳﺰي ﺑﻪﻣﻘﺪار ﺟﺮاﺣﻲ ﻗﻠﺐ ﺑﺎﺷﺪ و ﺑﻨﺎﺑﺮاﻳﻦ ﺗﺮﺟﻴﺢ داده ﺷﺪ ﻛﻪ از‬

‫‪531‬‬

‫ﻧﻤﻲﺗﻮاﻧﺪ اﺛﺮات ﻣﺜﺒﺖ ﻟﺨﺘﻪ ﺑﺮ اﻳﺠﺎد ﺑﺎﻓﺖ ﮔﺮاﻧﻮﻻﺳﻴﻮن را از ﺑﻴﻦ‬ ‫‪17‬‬

‫ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ اﺳﺘﻔﺎده ﺷﻮد‪ .‬ﻫﻤﭽﻨﻴﻦ ﺑﻪﻧﻈﺮ ﻣﻲرﺳﺪ ﻗﺪرت‬

‫ﺑﺒﺮد‪ .‬ﻫﻴﭻ ﻋﺎرﺿﻪ ﺟﺎﻧﺒﻲ در اﺳﺘﻔﺎده ﻣﻮﺿﻌﻲ از اﻳﻦ دﺳﺘﻪ از داروﻫﺎ‬

‫ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ ﻣﻮﺿﻌﻲ ﻣﺸﺎﺑﻪ ﻗﺪرت آﭘﺮوﺗﻴﻨﻴﻦ ﻣﻮﺿﻌﻲ در ﻛﺎﻫﺶ‬

‫ﺗﺎﻛﻨﻮن ﮔﺰارش ﻧﺸﺪه اﺳﺖ‪ .‬آنﻫﺎ در ﻧﻬﺎﻳﺖ ﻧﺘﻴﺠﻪﮔﻴﺮي ﻧﻤﻮدهاﻧﺪ ﻛﻪ‬

‫‪2‬‬

‫ﺑﻪﻛﺎرﮔﻴﺮي ﻣﻮﺿﻌﻲ آﻧﺘﻲ ﻓﻴﺒﺮﻳﻨﻮﻟﻴﺘﻴﻚﻫﺎ ﻣﻲﺗﻮاﻧﺪ از ﺧﻮﻧﺮﻳﺰي ﺑﻌﺪ از‬

‫اﮔﺮﭼﻪ اﻳﻦ ﻣﻮرد ﺗﻮاﻓﻖ ﻫﻤﻪ ﻣﺤﻘﻘﻴﻦ ﻧﻤﻲﺑﺎﺷﺪ‪ 13.‬ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ‪،‬‬

‫ﻋﻤﻞ و اﻟﺰام ﺗﺰرﻳﻖ ﺧﻮن در ﺑﻴﻤﺎراﻧﻲ ﻛﻪ ﺗﺤﺖ ﻋﻤﻞ ﺟﺮاﺣﻲ ﻗﻠﺐ‬

‫ﻣﺸﺘﻤﻞ ﺑﺮ ﻣﻮﻟﻜﻮلﻫﺎي ﻛﻮﭼﻚ )وزن ﻣﻮﻟﻜﻮﻟﻲ ‪ 157‬داﻟﺘﻮن( اﺳﺖ ﻛﻪ‬

‫ﺑﻪﺻﻮرت ‪ On-pump‬ﻗﺮار ﻣﻲﮔﻴﺮﻧﺪ را ﻛﺎﻫﺶ دﻫﺪ‪ 3.‬در ﻣﻄﺎﻟﻌﻪ ﺣﺎﺿﺮ‬

‫ﺑﺎ ﻣﺤﻞ اﺗﺼﺎل ﻟﻴﺰﻳﻦ ﺑﻪ ﭘﻼﺳﻤﻴﻨﻮژن ‪ Plasminogen‬و ﻣﺤﺼﻮل ﺗﺒﺪﻳﻞ‬

‫ﻧﻴﺰ ﻫﻴﭻ ﻣﻮردي از ﻋﻮارض ﺟﺎﻧﺒﻲ دﻳﺪه ﻧﺸﺪ‪ .‬ﻣﺘﺎ آﻧﺎﻟﻴﺰﻫﺎي ﺟﺪﻳﺪي‬

‫آنﻫﺎ ﺑﻪﻧﺎم ﭘﻼﺳﻤﻴﻦ ‪ Plasmin‬ﺗﺪاﺧﻞ ﻣﻲﻛﻨﺪ و ﺑﻪﻃﻮر ﺧﺎص ﻣﺎﻧﻊ از‬

‫در ارﺗﺒﺎط ﺑﺎ ﻛﺎرﺑﺮد ﺗﺮاﻧﺲ آﻣﻴﻦ ﺟﻬﺖ ﻛﺎﻫﺶ ﺣﺠﻢ ﺧﻮﻧﺮﻳﺰي ﻣﻨﺘﺸﺮ‬

‫دﺳﺘﺮﺳﻲ ﭘﻼﺳﻤﻴﻦ ﺑﻪ ﻓﻴﺒﺮﻳﻦ ﻣﻲﺷﻮد و ﻫﻴﭻ ﺗﺎﺛﻴﺮ ﻣﺴﺘﻘﻴﻤﻲ دﻳﮕﺮي ﺑﺮ‬

‫ﮔﺮدﻳﺪه‪ 18‬و در ﻛﻨﺎر آن ﻣﻄﺎﻟﻌﺎت ﺑﺎﻟﻴﻨﻲ‪ ،‬ﺑﻲﺧﻄﺮ ﺑﻮدن آن را در اﻋﻤﺎل‬

‫ﺧﻮﻧﺮﻳﺰي ﺑﺎﺷﺪ‪ ،‬اﻣﺎ ﺑﻪﻃﻮر ﺑﺎﻟﻘﻮه اﻳﻤﻦﺗﺮ و ﺑﺎ ﻗﻴﻤﺖ ﻛﻤﺘﺮ ﻣﻲﺑﺎﺷﺪ‪.‬‬

‫‪19‬‬

‫ﻫﻤﻮﺳﺘﺎز ﻧﺪارد‪ .‬در ﻣﻘﺎﺑﻞ‪ ،‬آﭘﺮوﺗﻴﻨﻴﻦ ﻛﻪ ﻳﻚ ﻣﻬﺎرﻛﻨﻨﺪه ﻏﻴﺮ اﺧﺘﺼﺎﺻﻲ‬

‫ﺟﺮاﺣﻲ ﺑﺰرگ ﺳﺘﻮن ﻓﻘﺮات ﺑﻪ اﺛﺒﺎت ﻣﻲرﺳﺎﻧﻨﺪ‪.‬‬

‫‪ Serine‬ﻣﻲﺑﺎﺷﺪ ﺑﻪﻃﻮر ﻣﺴﺘﻘﻴﻢ ﭘﻼﺳﻤﻴﻦ را در ﻏﻠﻈﺖﻫﺎي ﭘﺎﻳﻴﻦﺗﺮ‬

‫ﺑﺎﻟﻴﻨﻲ دوﺳﻮﻛﻮر ﻧﻴﺰ ﻛﺎرﺑﺮد آنرا در ﻛﺎﺳﺘﻦ ﺣﺠﻢ ﺧﻮﻧﺮﻳﺰي ﭘﺲ از‬

‫ﻛﺎرآزﻣﺎﻳﻲﻫﺎي‬

‫‪20‬‬

‫ﻣﻬﺎر ﻣﻲﻛﻨﺪ‪ ،‬در ﺣﺎﻟﻲﻛﻪ در ﻏﻠﻈﺖﻫﺎي ﺑﺎﻻﺗﺮ ﻣﻮﺟﺐ ﺗﺴﻬﻴﻞ ﻓﺎز‬

‫اﻋﻤﺎل ﺟﺮاﺣﻲ ﺳﺘﻮن ﻓﻘﺮات ﻣﺆﺛﺮ داﻧﺴﺘﻪاﻧﺪ‪ .‬در ﻧﻬﺎﻳﺖ اﻳﻦﻛﻪ در اﻳﻦ‬

‫ﺗﻤﺎﺳﻲ راه داﺧﻠﻲ ﻫﻤﻮﺳﺘﺎز ﻣﻲﺷﻮد ﻛﻪ ﻣﻨﺠﺮ ﺑﻪ اﺛﺮات ﺿﺪ اﻧﻌﻘﺎدي‬

‫ﻣﻄﺎﻟﻌﻪ ﺗﻼش ﺷﺪ ﺗﺎ ﻓﺎﻛﺘﻮرﻫﺎي دﺧﻴﻞ در ﻛﺎﻫﺶ ﺧﻮﻧﺮﻳﺰي از ﺟﻤﻠﻪ‬

‫ﺧﻔﻴﻒ ﻣﻲﺷﻮد‪ 16.‬در ﻣﻮرد ﻣﻜﺎﻧﻴﺴﻢ ﻋﻤﻞ ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ ﻣﻮﺿﻌﻲ‬

‫ﺗﻜﻨﻴﻚ ﺟﺮاﺣﻲ‪ ،‬ﮔﺮوه ﺟﺮاﺣﻲ ﺷﺎﻣﻞ ﺟﺮاح و ﻛﻤﻚ ﺟﺮاح‪ ،‬ﺗﻌﺪاد‬

‫ﻧﻴﺰ ﻧﺸﺎن داده ﺷﺪه اﺳﺖ ﻛﻪ در ﺧﻮن درﻧﺎژ ﺷﺪه ﻳﻚ ﺳﺎﻋﺖ ﭘﺲ از‬

‫ﺳﻄﻮح ﻋﻤﻞ ﺷﺪه‪ ،‬ﺑﻴﻤﺎريﻫﺎي ﻫﻤﺮاه و از ﺟﻤﻠﻪ اﺧﺘﻼﻻت ﺧﻮﻧﺮﻳﺰي‬

‫‪plasmin/alpha2-antiplasmin‬‬

‫دﻫﻨﺪه دو ﮔﺮوه ﻳﻜﺴﺎن ﺷﻮﻧﺪ‪ .‬اﻣﺎ ﺑﺎﻳﺪ در ﻧﻈﺮ داﺷﺖ ﻛﻪ در اﻳﻦ ﻣﻄﺎﻟﻌﻪ‬

‫و ‪ D-dimer‬در ﮔﺮوه ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ دﻳﺪه ﺷﺪه اﺳﺖ‪ .‬اﻳﻦ ارﻗﺎم در‬

‫اﺧﺘﻼﻻت ﻋﻤﻠﻜﺮد ﭘﻼﻛﺘﻲ و اﻧﻌﻘﺎدي ﻫﻤﺰﻣﺎن‪ ،‬در ﻣﻴﺰان ﻛﻞ ﺧﻮﻧﺮﻳﺰي‬

‫ﮔﺮوه ﺷﺎﻫﺪ ﻫﺮ ﻛﺪام ﺑﻪﺗﺮﺗﻴﺐ ‪ %320‬و ‪ %260‬ﺑﻮدﻧﺪ‪ .‬ﺑﺪﻳﻦﺗﺮﺗﻴﺐ ﺑﻪﻧﻈﺮ‬

‫ﺗﺎﺛﻴﺮ دارد‪ .‬ﻟﺬا ﻣﺜﻼً آﻧﺴﺘﺰي ﻫﻴﭙﻮﺗﺎﻧﺴﻴﻮ‪ ،‬ﭘﻮزﻳﺸﻦ ﺻﺤﻴﺢ ﺑﻴﻤﺎر و‬

‫ﻣﻲرﺳﺪ ﻛﻪ اﺳﺘﻔﺎده از ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ ﻣﻮﺿﻌﻲ در ﻣﺤﻞ زﺧﻢ‬

‫ﺗﺼﺤﻴﺢ ﺣﺠﻢ ﺑﻴﻤﺎر در ﻛﺎﻫﺶ ﺧﻮﻧﺮﻳﺰي ﺑﻲﻣﻮرد ﻧﻘﺶ ﺑﺴﺰاﻳﻲ دارﻧﺪ‬

‫ﻣﻮﺟﺐ ﻛﺎﻫﺶ ﺧﻮﻧﺮﻳﺰي ﺑﻪ ﻧﺼﻒ در اﻋﻤﺎل ﺟﺮاﺣﻲ وﺳﻴﻊ ﺳﺘﻮن‬

‫ﻛﻪ ﻻزم اﺳﺖ در ﻣﻄﺎﻟﻌﺎت ﺑﻌﺪي ﻣﻮرد ﺑﺮرﺳﻲ ﺑﻴﺸﺘﺮي ﻗﺮار ﮔﻴﺮﻧﺪ‪.‬‬

‫ﻓﻘﺮات ﻣﻲﺷﻮد و ﺷﺎﻳﺪ اﻳﻦ اﺛﺮ ﺑﺪﻳﻦدﻟﻴﻞ اﺳﺖ ﻛﻪ از ﻓﻴﺒﺮﻳﻨﻮﻟﻴﺰ اﺿﺎﻓﻲ‬

‫ﺗﻮﺻﻴﻪ ﻣﻲﺷﻮد از ﺗﻔﺎوت ﻏﻠﻈﺖ و درﺻﺪ ﺗﻐﻴﻴﺮات ﻫﻤﻮﮔﻠﻮﺑﻴﻦ و‬

‫ﺟﻠﻮﮔﻴﺮي ﻣﻲﻛﻨﺪ‪ .‬ﻫﻤﭽﻨﻴﻦ ﻧﺸﺎن داده ﺷﺪه ﻛﻪ ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ اﺳﻴﺪ‬

‫ﻫﻤﺎﺗﻮﻛﺮﻳﺖ ﺑﻪﻋﻨﻮان ﻳﻜﻲ از ﻧﺸﺎﻧﮕﺮﻫﺎي ﻣﻴﺰان ﺧﻮﻧﺮﻳﺰي در ﺣﻴﻦ و‬

‫ﺑﻪﻣﻴﺰان ﻣﻌﻨﻲداري ﻣﻮﺟﺐ ﻛﺎﻫﺶ ﻓﻌﺎﻟﻴﺖ ﻓﻴﺒﺮﻳﻨﻮﻟﻴﺘﻴﻚ در ﺑﺎﻓﺖ‬

‫ﭘﺲ از ﻋﻤﻞ اﺳﺘﻔﺎده ﺷﻮد‪ .‬ﺳﭙﺎﺳﮕﺰاري‪ :‬ﻣﺆﻟﻔﻴﻦ از زﺣﻤﺎت ﺑﻲﺷﺎﺋﺒﻪ و‬

‫ﮔﺮاﻧﻮﻻﺳﻴﻮن و ﺗﺎﺧﻴﺮ ﻟﻴﺰ ﻟﺨﺘﻪ ﻓﻴﺒﺮﻳﻦ ﻣﻲﺷﻮد‪ .‬ﻫﻤﭽﻨﻴﻦ ﺗﺮاﻧﻜﺴﺎﻣﻴﻚ‬

‫دﻗﺖ ﻧﻈﺮ در اﺻﻼح دﺳﺖﻧﻮﻳﺲ ﺗﻮﺳﻂ دﻛﺘﺮ اﻋﻈﻢ ﻣﺮداﻧﻲ و‬

‫اﺳﻴﺪ ﻣﻲﺗﻮاﻧﺪ ﻣﻮﺟﺐ ﻛﺎﻫﺶ ﭘﻴﺸﺮﻓﺖ ﺑﺎﻓﺖ ﮔﺮاﻧﻮﻻﺳﻴﻮن ﮔﺮدد وﻟﻲ‬

‫ﺑﺎزﻧﻮﻳﺴﻲ آن ﺗﻮﺳﻂ ﺧﺎﻧﻢ ﻓﺎﻃﻤﻪ ﺳﺎﻟﻚ ﺗﺸﻜﺮ ﻣﻲﻧﻤﺎﻳﻨﺪ‪.‬‬

‫ﻋﻤﻞ ﺟﺮاﺣﻲ اﻓﺰاﻳﺶ ‪ %150‬در ﻏﻠﻈﺖ‬

‫‪References‬‬ ‫‪al. Topical versus intravenous administration of tranexamic acid: a‬‬ ‫‪comparison of intraocular and serum concentrations in the rabbit.‬‬ ‫‪Can J Ophthalmol 1998;33(6):308-13.‬‬ ‫‪Sarris I, Arafa A, Konaris L, Kadir RA. Topical use of tranexamic‬‬ ‫‪acid to control perioperative local bleeding in gynaecology patients‬‬ ‫‪with clotting disorders: two cases. Haemophilia 2007;13(1):115-6.‬‬ ‫‪Waly NG. Local antifibrinolytic treatment with tranexamic acid in‬‬ ‫‪hemophilic children undergoing dental extractions. Egypt Dent J‬‬ ‫‪1995;41(1):961-8.‬‬ ‫‪Sindet-Pedersen S, Stenbjerg S. Effect of local antifibrinolytic‬‬ ‫‪treatment with tranexamic acid in hemophiliacs undergoing oral‬‬ ‫‪surgery. J Oral Maxillofac Surg 1986;44(9):703-7.‬‬ ‫‪Benoni G, Lethagen S, Fredin H. The effect of tranexamic acid on‬‬

‫‪5.‬‬ ‫‪6.‬‬ ‫‪7.‬‬ ‫‪8.‬‬

‫‪1. Henry DA, Carless PA, Moxey AJ, O'Connell D, Stokes BJ,‬‬ ‫‪McClelland B, et al. Anti-fibrinolytic use for minimising‬‬ ‫‪perioperative allogeneic blood transfusion. Cochrane Database Syst‬‬ ‫‪Rev 2007;(4):CD001886.‬‬ ‫‪2. Baric D, Biocina B, Unic D, Sutlic Z, Rudez I, Vrca VB, et al.‬‬ ‫‪Topical use of antifibrinolytic agents reduces postoperative‬‬ ‫‪bleeding: a double-blind, prospective, randomized study. Eur J‬‬ ‫‪Cardiothorac Surg 2007;31(3):366-71; discussion 371.‬‬ ‫‪3. Fawzy H, Elmistekawy E, Bonneau D, Latter D, Errett L. Can local‬‬ ‫‪application of Tranexamic acid reduce post-coronary bypass surgery‬‬ ‫‪blood loss? A randomized controlled trial. J Cardiothorac Surg‬‬ ‫‪2009;4:25.‬‬ ‫‪4. Damji KF, Noël LP, Peterson RG, Ma PE, Clarke WN, Gilberg S, et‬‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬


Topical tranexamic acid on reduction of post-laminectomy hemorrhage ‫ﻫﻤﻜﺎران‬ ‫و‬

local and plasma fibrinolysis during total knee arthroplasty. Thromb Res 1997;85(3):195-206. 9. Abrishami A, Chung F, Wong J. Topical application of antifibrinolytic drugs for on-pump cardiac surgery: a systematic review and meta-analysis. Can J Anaesth 2009;56(3):202-12. 10. De Bonis M, Cavaliere F, Alessandrini F, Lapenna E, Santarelli F, Moscato U, et al. Topical use of tranexamic acid in coronary artery bypass operations: a double-blind, prospective, randomized, placebo-controlled study. J Thorac Cardiovasc Surg 2000;119(3):575-80. 11. Abul-Azm A, Abdullah KM. Effect of topical tranexamic acid in open heart surgery. Eur J Anaesthesiol 2006;23(5):380-4. 12. Hanif M, Nourei SM, Dunning J. Does the use of topical tranexamic acid in cardiac surgery reduce the incidence of post-operative mediastinal bleeding? Interact Cardiovasc Thorac Surg 2004;3(4):603-5. 13. Yasim A, Aşik R, Atahan E. Effects of topical applications of aprotinin and tranexamic acid on blood loss after open heart surgery. Anadolu Kardiyol Derg 2005;5(1):36-40. 14. Elwatidy S, Jamjoom Z, Elgamal E, Zakaria A, Turkistani A, ElDawlatly A. Efficacy and safety of prophylactic large dose of tranexamic acid in spine surgery: a prospective, randomized, double-blind, placebo-controlled study. Spine (Phila Pa 1976)

100

532

2008;33(24):2577-80. 15. Krohn CD, Sørensen R, Lange JE, Riise R, Bjørnsen S, Brosstad F. Tranexamic acid given into the wound reduces postoperative blood loss by half in major orthopaedic surgery. Eur J Surg Suppl 2003;(588):57-61. 16. Landis RC, Asimakopoulos G, Poullis M, Haskard DO, Taylor KM. The antithrombotic and antiinflammatory mechanisms of action of aprotinin. Ann Thorac Surg 2001;72(6):2169-75. 17. Hedelin H, Teger-Nilsson AC, Peterson HI, Pettersson S. Effects of tranexamic acid and local fibrin deposition of fibrinolysis and granulation tissue formation in preformed cavities. Thromb Res 1984;33(1):31-8. 18. Gill JB, Chin Y, Levin A, Feng D. The use of antifibrinolytic agents in spine surgery. A meta-analysis. J Bone Joint Surg Am 2008;90(11):2399-407. 19. Neilipovitz DT. Tranexamic acid for major spinal surgery. Eur Spine J 2004;13 Suppl 1:S62-5. 20. Elwatidy S, Jamjoom Z, Elgamal E, Zakaria A, Turkistani A, ElDawlatly A. Efficacy and safety of prophylactic large dose of tranexamic acid in spine surgery: a prospective, randomized, double-blind, placebo-controlled study. Spine (Phila Pa 1976) 2008;33(24):2577-80.

1389 ‫ آذر‬،9 ‫ ﺷﻤﺎره‬، 68 ‫ دوره‬،‫ داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‬،‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‬


Tehran University Medical Journal; Vol. 68, No. 9, Dec 2010: 527-533

The effects of topically applied tranexamic acid on reduction of postlaminectomy hemorrhage

Hoshang Saberi MD. MPH.1* Seyed Mojtaba Miri MD.2 Mansoor Poordel Namdar MD.2 1- Department of Neurosurgery, Tehran University of Medical Sciences, Tehran, Iran. 2- Brian And Spinal Cord Injury Repair Research Center, Tehran University of Medical Sciences, Tehran, Iran.

Abstract

Received: August 09, 2010 Accepted: October 23, 2010

Background: Topically applied tranexamic acid has been shown to decrease the amount of blood loss associated with major spinal surgical procedures. The aim of this study was to evaluate the effects of locally applied tranexamic acid in epidural space on post-laminectomy blood loss. Methods: One hundred patients who were scheduled to undergo laminectomy in Imam Khomeini Hospital in Tehran, Iran were enrolled in a clinical trial. Patients were divided into two groups of unilateral one level (n=50) and bilateral two level (n=50) laminectomy according to the extent of surgery. Each group was randomly allocated into two groups of tranexamic acid (n=25) and control (n=25). At the end of the operation, 250mg tranexamic acid, with volume of 5ml or 5ml of normal saline were poured on the site of surgery. The blood volume drained during first and second 24hr, and overall hemorrhage, plus the duration of post operative hospitalization were compared between the two groups. Results: The bleeding volume in the 1st 24hr was significantly less in tranexamic acid than control group (p=0.001). The bleeding volume in the 2nd 24hr was significantly less in tranexamic acid than control group (p=0.001). The hospital stay was less in tranexamic acid compared to control group (2.16±0.37 Vs. 2.96±0.89 days, p=0.001) respectively. Conclusion: Locally applied tranexamic acid in epidural space significantly reduces the amount of the 1st day, 2nd day and overall post-laminectomy blood loss, and duration of hospital stay. Keywords: Topical, tranexamic acid, laminectomy, hemorrhage.

*

Corresponding author: Dept. of Neurosurgery, Keshavarz Blvd., Imam Khomeini Hospital, Brian And Spinal cord Injury Repair Research Center, Tehran, Iran. Tel: +98-21-66939330 email: hgsaberi@yahoo.com

1389 ‫ آذر‬،9 ‫ ﺷﻤﺎره‬، 68 ‫ دوره‬،‫ داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‬،‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‬


‫ﺗﻴﻚآذرو ﺗﻮره‬ ‫ﻣﺒﺘﻼﻳﺎن‬ ‫ﮔﺮوه ‪A‬‬ ‫ﺑﺘﺎﻫﻤﻮﻟﺘﻴﻚ‬ ‫اﺳﺘﺮﭘﺘﻮﻛﻮك‬ ‫ﻋﻔﻮﻧﺖ‬ ‫‪534-540 ،1389‬‬ ‫ﺑﻪ ‪،9‬‬ ‫ﺷﻤﺎره‬ ‫دورهدر‪، 68‬‬ ‫ﺗﻬﺮان‪،‬‬ ‫ﻠﻮم ﭘﺰﺷﻜﻲ‬ ‫ﻲ‪ ،‬داﻧﺸﮕﺎه ﻋ‬ ‫ﻧﻘﺶ ﭘﺰﺷﻜ‬ ‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه‬

‫ﻧﻘﺶ ﻋﻔﻮﻧﺖ اﺳﺘﺮﭘﺘﻮﻛﻮك ﺑﺘﺎﻫﻤﻮﻟﺘﻴﻚ ﮔﺮوه ‪ A‬در ﺑﻴﻤﺎران ﻣﺒﺘﻼ ﺑﻪ ﺗﻴﻚ و ﺗﻮره‬

‫ﺗﺎرﻳﺦ درﻳﺎﻓﺖ ﻣﻘﺎﻟﻪ‪ 1389/06/30 :‬ﺗﺎرﻳﺦ ﭘﺬﻳﺮش‪1389/07/28 :‬‬

‫ﭼﻜﻴﺪه‬

‫‪*1‬‬

‫ﺛﻤﻴﻠﻪ ﻧﻮرﺑﺨﺶ‬

‫زﻣﻴﻨﻪ و ﻫﺪف‪ :‬اﺧﻴﺮاً ﺑﻪﻋﻮارض ﺳﺎﻳﻜﻮﻟﻮژﻳﻚ و ﻧﻮروﻟﻮژﻳﻚ ﻣﺘﻌﺎﻗﺐ اﺑﺘﻼ ﺑﻪﻋﻔﻮﻧﺖ اﺳﺘﺮﭘﺘﻮﻛﻮك ﮔﺮوه‬

‫‪3‬‬

‫ﺑﻬﺮوز ﺟﻠﻴﻠﻲ‪ ،2‬اﺣﻤﺪرﺿﺎ ﺷﻤﺸﻴﺮي‬

‫‪(PANDAS) A‬‬

‫‪4‬‬

‫ﺑﻪواﺳﻄﻪ ﺗﻮﻟﻴﺪ آﻧﺘﻲﺑﺎديﻫﺎي اﺗﻮاﻳﻤﻴﻮن اﺷﺎره ﻣﻲﺷﻮد‪ .‬ﻫﺪف اﻳﻦ ﻣﻄﺎﻟﻌﻪ ﻣﻘﺎﻳﺴﻪ ﺗﻴﺘﺮ آﻧﺘﻲﺑﺎديﻫﺎي ﺑﺮﻋﻠﻴﻪ‬

‫‪6‬‬

‫اﺳﺘﺮﭘﺘﻮﻛﻮك ﺑﺘﺎ ﻫﻤﻮﻟﻴﺘﻴﻚ ﮔﺮوه ‪ (GABHS) A‬در ﻛﻮدﻛﺎن ﻣﺒﺘﻼ ﺑﻪ اﺧﺘﻼﻻت ﺣﺮﻛﺘﻲ ﺗﻴﻚ و ﺗﻮره )‪ (PANDAS‬ﺑﺎ ﮔﺮوه‬

‫اﻟﻬﺎم ﺷﻴﺮازي‪ ،2‬آذردﺧﺖ ﻃﺒﺎﻃﺒﺎﺋﻲ‬

‫رﺿﺎ ﺗﻘﻲﭘﻮر‪ ،5‬اﺣﻤﺪ ﻣﺪرس ﻓﺘﺤﻲ‬

‫ﺳﺎﻟﻢ )ﺷﺎﻫﺪ( ﺑﻮد‪ .‬روش ﺑﺮرﺳﻲ‪ :‬ﺑﺮرﺳﻲ ﻣﻘﻄﻌﻲ‪ -‬ﺗﺤﻠﻴﻠﻲ ﻃﻲ دو ﺳﺎل )‪ (1387-89‬در ‪ 52‬ﺑﻴﻤﺎر ﺑﺎ اﺧﺘﻼﻻت‬ ‫‪ -1‬ﮔﺮوه ﻋﻔﻮﻧﻲ ﻛﻮدﻛﺎن‪ ،‬ﻣﺮﻛﺰ ﺗﺤﻘﻴﻘﺎت‬

‫ﺣﺮﻛﺘﻲ ﺗﻴﻚ و ﻳﺎ ﺗﻮره ﻣﺮاﺟﻌﻪﻛﻨﻨﺪه ﺑﻪ درﻣﺎﻧﮕﺎه اﻋﺼﺎب و رواﻧﭙﺰﺷﻜﻲ ﻛﻮدﻛﺎن در دو ﺑﻴﻤﺎرﺳﺘﺎن رﺳﻮلاﻛﺮم و‬

‫ﺑﻴﻤﺎريﻫﺎي ﻋﻔﻮﻧﻲ ﻛﻮدﻛﺎن‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم‬

‫ﻋﻠﻲاﺻﻐﺮ داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ اﻳﺮان اﻧﺠﺎم ﺷﺪ‪ .‬ﻣﻴﺰان آﻧﺘﻲ ﻫﻴﺎﻟﻮروﻧﻴﺪاز‪ ،‬آﻧﺘﻲ اﺳﺘﺮﭘﺘﻮﻟﻴﺰﻳﻦ و آﻧﺘﻲ ديانآز ﺑﺎ روش‬

‫ﭘﺰﺷﻜﻲ اﻳﺮان‪،‬‬

‫‪ -2‬ﮔﺮوه رواﻧﭙﺰﺷﻜﻲ ﻛﻮدﻛﺎن‪،‬‬

‫اﻟﻴﺰا در ﺳﺮم ‪ 53‬ﺑﻴﻤﺎر و ‪ 76‬ﺷﺎﻫﺪ ﻣﻘﺎﻳﺴﻪ ﮔﺮدﻳﺪ‪ .‬ﺑﺎ ﻣﻌﻴﺎر‬

‫ﻣﺮﻛﺰ ﺗﺤﻘﻴﻘﺎت ﺑﻴﻤﺎريﻫﺎي ﻋﻔﻮﻧﻲ ﻛﻮدﻛﺎن‪،‬‬ ‫داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ اﻳﺮان‪،‬‬

‫ﺷﺪ‪ .‬ﺳﻄﺢ زﻳﺮ ﻣﻨﺤﻨﻲ راك ﺗﻌﻴﻴﻦ و ﺣﺴﺎﺳﻴﺖ و وﻳﮋﮔﻲ‪ ،‬ارزش اﺧﺒﺎري ﻣﺜﺒﺖ ﺗﺴﺖﻫﺎ ﻣﺸﺨﺺ ﮔﺮدﻳﺪ‪ .‬ﻳﺎﻓﺘﻪﻫﺎ‪ :‬ﺳﻦ‬

‫‪ -3‬ﮔﺮوه‬

‫اﭘﻴﺪﻣﻴﻮﻟﻮژي و آﻣﺎر‪ ،‬داﻧﺸﻜﺪه ﺑﻬﺪاﺷﺖ‪ ،‬داﻧﺸﮕﺎه‬ ‫ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪،‬‬

‫‪2‬‬

‫‪‬‬

‫و ﺿﺮﻳﺐ اﻃﻤﻴﻨﺎن ‪ (p<0/05) ،CI=95%‬ﻣﻘﺎﻳﺴﻪ اﻧﺠﺎم‬

‫ﺑﻴﻤﺎران ﺑﻴﻦ ‪ 4-16‬ﺳﺎل‪ 38) %71/7 ،‬ﻧﻔﺮ( ﻣﺬﻛﺮ ﺑﻮدﻧﺪ‪ .‬ﺗﻴﺘﺮ ﻫﺮ ﺳﻪ آﻧﺘﻲﺑﺎدي در ﺑﻴﻤﺎران ﺑﻴﺸﺘﺮ از ﮔﺮوه ﺷﺎﻫﺪ ﺑﻮد‬

‫‪ -4‬ﮔﺮوه ﻣﻴﻜﺮوب‪-‬‬

‫)‪ .(p<0/001‬ﺗﻴﺘﺮ‬

‫ﺷﻨﺎﺳﻲ‪ ،‬ﻣﺮﻛﺰ ﺗﺤﻘﻴﻘﺎت ﺑﻴﻤﺎريﻫﺎي ﻋﻔﻮﻧﻲ‬

‫‪off<170) Anti-DNase‬‬

‫‪off<200) ASOT‬‬

‫‪ (Cut‬ﺣﺴﺎﺳﻴﺖ ‪ ،%70‬وﻳﮋﮔﻲ ‪ ،%99‬ارزش اﺧﺒﺎري ﻣﺜﺒﺖ ‪ ،90‬ﺑﺮاي ﺗﻴﺘﺮ‬

‫‪ (Cut‬ﺣﺴﺎﺳﻴﺖ ‪ ،%75‬وﻳﮋﮔﻲ ‪ ،%84‬ارزش اﺧﺒﺎري ﻣﺜﺒﺖ ‪ %80‬ﺗﻌﻴﻴﻦ ﺷﺪ‪ .‬ﺗﻴﺘﺮ آﻧﺘﻲ‬

‫ﻛﻮدﻛﺎن‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ اﻳﺮان‪ -5 ،‬ﮔﺮوه‬

‫آﻧﺘﻲﺑﺎدي‬

‫ﺑﻴﻤﺎريﻫﺎي ﻛﻮدﻛﺎن‪ ،‬ﻣﺮﻛﺰ ﺗﺤﻘﻴﻘﺎت ﺑﻴﻤﺎريﻫﺎي‬

‫اﺳﺘﺮﭘﺘﻮﻛﻴﻨﺎز )‪ (Cut off<332IU/ml‬ﺣﺴﺎﺳﻴﺖ ‪ ،%34‬وﻳﮋﮔﻲ ‪ %85‬داﺷﺖ‪ .‬ﻧﺘﻴﺠﻪﮔﻴﺮي‪ :‬در ﻣﺒﺘﻼﻳﺎن اﺧﺘﻼﻻت ﺣﺮﻛﺘﻲ‬

‫‪ -6‬ﮔﺮوه ﺑﻴﻤﺎريﻫﺎي ﻛﻮدﻛﺎن‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم‬

‫ﻣﺜﻞ ﺗﻴﻚ و ﺗﻮره ﻫﺮ ﺳﻪ ﻧﻮع آﻧﺘﻲﺑﺎدي ﺑﺮ ﻋﻠﻴﻪ اﺳﺘﺮﭘﺘﻮﻛﻮك ﺑﻪﻃﻮر ﻣﻌﻨﻲداري ﺑﺎﻻﺗﺮ از ﮔﺮوه ﻛﻨﺘﺮل اﺳﺖ‪ .‬اﺣﺘﻤﺎﻻً‬

‫ﭘﺰﺷﻜﻲ اﻳﺮان‪ ،‬ﺗﻬﺮان‪ ،‬اﻳﺮان‪.‬‬

‫ﻋﻔﻮﻧﺖ اﺳﺘﺮﭘﺘﻮﻛﻮك ﻧﻘﺶ واﺿﺤﻲ در ﺳﻨﺪرم ﭘﺎﻧﺪاس ﻛﻮدﻛﺎن دارد‪ .‬درﻣﺎن ﻋﻔﻮﻧﺖﻫﺎي اﺳﺘﺮﭘﺘﻮﻛﻮﻛﻲ ﺑﺎ ﭘﻨﻲﺳﻴﻠﻴﻦ‬

‫ﻋﻔﻮﻧﻲ ﻛﻮدﻛﺎن‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ اﻳﺮان‬

‫*‬

‫درازﻣﺪت اﻣﻜﺎنﭘﺬﻳﺮ اﺳﺖ‪ .‬ﺗﺼﻤﻴﻢﮔﻴﺮي ﺑﺮاي اﺳﺘﻔﺎدهاز درﻣﺎنﻫﺎي ﺗﻬﺎﺟﻤﻲﺗﺮ ﺑﺮاي ﭘﺎﻧﺪاس )ﺗﻌﻮﻳﺾ ﭘﻼﺳﻤﺎ و ﻏﻴﺮه(‬ ‫ﻧﻮﻳﺴﻨﺪه ﻣﺴﺌﻮل‪ :‬ﺗﻬﺮان‪ ،‬ﺳﺘﺎرﺧﺎن‪ ،‬ﻧﻴﺎﻳﺶ‪ ،‬ﻣﺠﺘﻤﻊ‬

‫ﻧﻴﺎز ﺑﻪﻣﻄﺎﻟﻌﻪ ﺑﺎﻟﻴﻨﻲ ﺗﺼﺎدﻓﻲ ﺷﺎﻫﺪدار ﻣﻲﺑﺎﺷﺪ‪.‬‬

‫رﺳﻮل اﻛﺮم )ص(‪ ،‬ﻃﺒﻘﻪ ﭼﻬﺎرم‪ ،‬ﻣﺮﻛﺰ ﺗﺤﻘﻴﻘﺎت‬ ‫ﺑﻴﻤﺎريﻫﺎي ﻋﻔﻮﻧﻲ ﻛﻮدﻛﺎن‬

‫ﺗﻠﻔﻦ‪021-66525328 :‬‬

‫‪email: samileh_noorbakhsh@yahoo.com‬‬

‫ﻛﻠﻤﺎت ﻛﻠﻴﺪي‪ :‬اﺳﺘﺮﭘﺘﻮﻛﻮك ﺑﺘﺎ ﻫﻤﻮﻟﻴﺘﻴﻚ ﮔﺮوه ‪ ،GABHS ،A‬ﭘﺎﻧﺪاس‪ ،‬ﺗﻴﻚ‪ ،‬ﺳﻨﺪرم ﺗﻮره‪.‬‬

‫ﻣﻘﺪﻣﻪ‬

‫ﻋﻮارﺿﻲ ﻣﺜﻞ ﺗﺐ روﻣﺎﺗﻴﺴﻤﻲ و ﻛﺮه ﺳﻴﺪﻧﻬﺎم و ﺿﺎﻳﻌﺎت ﭘﻮﺳﺘﻲ و‬

‫ﻋﻔﻮﻧﺖ اﺳﺘﺮﭘﺘﻮﻛﻮﻛﻲ )‪ (Streptococcal infection‬ﺑﻪﺻﻮرت آﻧﮋﻳﻦ‬

‫ﻣﻔﺼﻠﻲ ﻗﺒﻼً ﺑﻪ وﺿﻮح ﺷﻨﺎﺧﺘﻪ ﺷﺪهاﻧﺪ‪ 2.‬اﺧﻴﺮاً ﻋﻮارض دﻳﮕﺮي‬

‫ﭼﺮﻛﻲ ﻳﺎ ﻋﻔﻮﻧﺖﻫﺎي ﭘﻮﺳﺘﻲ ﺗﻈﺎﻫﺮ ﭘﻴﺪا ﻣﻲﻛﻨﺪ ﻛﻪ ﺷﺎﻳﻊﺗﺮﻳﻦ ﺳﻮش‬

‫ﺗﺤﺖ ﻋﻨﻮان ﻋﻮارض ﺳﺎﻳﻜﻮﻟﻮژﻳﻚ و ﻧﻮروﻟﻮژﻳﻚ ﻣﺘﻌﺎﻗﺐ اﺑﺘﻼ‬

‫آن اﺳﺘﺮﭘﺘﻮﻛﻮك ﺑﺘﺎ ﻫﻤﻮﻟﺘﻴﻚ ﮔﺮوه‬

‫‪A‬‬

‫ﻣﻲﺑﺎﺷﺪ‪ 1.‬در ﺻﻮرت وﺟﻮد‬

‫ﺑﻪ ﻋﻔﻮﻧﺖ اﺳﺘﺮﭘﺘﻮﻛﻮك ﮔﺮوه‬

‫‪A‬‬

‫ﺑﻪواﺳﻄﻪ ﺗﻮﻟﻴﺪ آﻧﺘﻲﺑﺎديﻫﺎي اﺗﻮ‬

‫‪Pediatric Autoimmune Neuropsychiatric Disorders‬‬

‫ﻋﻼﻳﻢ ﺑﺎﻟﻴﻨﻲ ﻣﻲﺗﻮان اﻳﻦ ﻋﻔﻮﻧﺖ را ﺑﺮ اﺳﺎس ﻛﺸﺖ ﻣﺜﺒﺖ اﺛﺒﺎت‬

‫اﻳﻤﻴﻮن‬

‫ﻧﻤﻮد‪ 1.‬اﮔﺮ ﻣﺪﺗﻲ از اﺑﺘﻼي ﺑﻪ اﻳﻦ ﻋﻔﻮﻧﺖ ﮔﺬﺷﺘﻪ ﺑﺎﺷﺪ ﺑﺎﻳﺪ از ﻃﺮﻳﻖ‬

‫)‪(PANDAS‬‬

‫ﺑﺮرﺳﻲ آﻧﺘﻲﺑﺎديﻫﺎﻳﻲ ﻛﻪ ﺑﺮ ﻋﻠﻴﻪ اﺟﺰاي اﻳﻦ ﻣﻴﻜﺮوب ﺳﺎﺧﺘﻪ ﻣﻲﺷﻮد‬

‫ﻣﻲﺷﻮد‪ 3.‬ﻋﻮارﺿﻲ ﻣﺜﻞ رﻓﺘﺎرﻫﺎي وﺳﻮاﺳﻲ از ﻣﻮارد ﺟﺪﻳﺪاً ﺗﺎﻳﻴﺪ‬

‫رد ﭘﺎي ﻋﻔﻮﻧﺖ را ﺛﺎﺑﺖ ﻧﻤﻮد‪ 2.‬از ﻃﺮﻓﻲ ﻋﻔﻮﻧﺖ اﺳﺘﺮﭘﺘﻮﻛﻮﻛﻲ ﺑﺘﺎ‬ ‫ﻫﻤﻮﻟﺘﻴﻚ ﮔﺮوه‬

‫‪A‬‬

‫ﺑﻪروش ﺗﺤﺮﻳﻚ ﺗﻮﻟﻴﺪ آﻧﺘﻲﺑﺎديﻫﺎ و ﺗﻮﻟﻴﺪ‬

‫ﻛﻤﭙﻠﻜﺲ اﻳـﻤﻨﻲ ﺳﺒﺐ ﻋﻮارض ﻣﺘﻌﺪدي در اﻓـﺮاد ﻣﺨﺘﻠﻒ ﻣﻲﺷﻮد ﻛﻪ‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬

‫ﺷﺪهاﻧﺪ‪.‬‬

‫‪4-7‬‬

‫‪ Associated with Streptococcal infection‬اﻳﺠﺎد‬

‫در ﺑﺮﺧﻲ ﻣﻘﺎﻻت ﻋﻮد ﻋﻼﻳﻢ ﺗﻴﻚ و ﺗﻮره‬

‫‪Tic & Tourette‬‬

‫ﺑﻪدﻧﺒﺎل ﻋﻔﻮﻧﺖ ﻣﺠﺪد ﺑﺎ اﺳﺘﺮﭘﺘﻮﻛﻮك ﺑﺘﺎ ﻫﻤﻮﻟﺘﻴﻚ ﮔﺮوه‬

‫‪A‬‬

‫دﻳﺪه‬

‫ﻣﻲﺷﻮد ﻛﻪ ﺑﺎ درﻣﺎن ﺑﻪ ﻣﻮﻗﻊ و ﻣﻨﺎﺳﺐ آﻧﺘﻲ ﺑﻴﻮﺗﻴﻜﻲ ﻣﻲﺗﻮان اﻳﻦ‬


‫ﺛﻤﻴﻠﻪ ﻧﻮرﺑﺨﺶ و ﻫﻤﻜﺎران‬

‫‪9‬و‪8‬‬

‫ﻋﻼﻳﻢ را ﺑﻬﺒﻮد ﺑﺨﺸﻴﺪ‪.‬‬

‫‪535‬‬

‫درﻣﺎنﻫﺎي ﺟﺪﻳﺪي ﺷﺎﻣﻞ ﭘﻼﺳﻤﺎ ﻓﺮز و‬

‫ﺿﻤﻴﻤﻪ( ﭘﺮ ﺷﺪ و ﻧﺘﺎﻳﺞ ﻣﻌﺎﻳﻨﺎت ﺑﺎﻟﻴﻨﻲ ﺑﻪوﻳﮋه ﻣﺮﺑﻮط ﺑﻪ اﺧﺘﻼﻻت‬

‫‪ IvIg‬ﻧﻴﺰ ﺑﺎ ﺗﻮﺟﻪ ﺑﻪ ﻣﻜﺎﻧﻴﺴﻢ ﺗﻮﻟﻴﺪ ﻛﻤﭙﻠﻜﺲ آﻧﺘﻲژن‪ -‬آﻧﺘﻲﺑﺎدي و‬

‫ﺣﺮﻛﺘﻲ ﺑﻴﻤﺎر درج ﮔﺮدﻳﺪ‪ .‬ﺗﻌﺪاد ‪ 52‬ﺑﻴﻤﺎر ﻣﺒﺘﻼ ﺑﻪ اﺧﺘﻼﻻت ﺣﺮﻛﺘﻲ‬

‫اﺗﻮاﻳﻤﻴﻮن در اﻳﻦ ﺑﻴﻤﺎران ﻣﻄﺮح ﺷﺪه ﻛﻪ در ﺑﺮﺧﻲ ﻣﻘﺎﻻت ﻣﺆﺛﺮ ﺑﻮدن‬

‫ﺗﻴﻚ و ﻳﺎ ﺗﻮره ﻣﺮاﺟﻌﻪﻛﻨﻨﺪه ﺑﻪ درﻣﺎﻧﮕﺎه اﻋﺼﺎب و رواﻧﭙﺰﺷﻜﻲ ﻛﻮدﻛﺎن‬

‫آنﻫﺎ ﺗﺎﻳﻴﺪ ﺷﺪه اﺳﺖ‪11.‬و‪ 10‬ﻧﺘﺎﻳﺞ ﻳﻚ ﻣﻄﺎﻟﻌﻪ در اﻳﺮان ﻧﻴﺰ ﻧﺸﺎن داد ﻛﻪ‬

‫و ‪ 76‬ﻛﻮدك ﺷﺎﻫﺪ )ﺳﺎﻟﻢ( اﻧﺘﺨﺎب ﺷﺪﻧﺪ‪ .‬ﺑﻴﻤﺎراﻧﻲ ﻛﻪ ﻣﻌﻴﺎرﻫﺎي‬

‫در ﻣﺒﺘﻼﻳﺎن ﺑﻪ ﺑﻪﺣﻤﻠﻪ ﻧﺎﮔﻬﺎﻧﻲ ﻳﺎ ﺗﺸﺪﻳﺪ دورهاي ﺗﻴﻚ‪ ،‬ﻣﻤﻜﻦ اﺳﺖ‬

‫ﺗﺸﺨﻴﺼﻲ ﺑﻪ ﻧﻔﻊ ﺗﻴﻚ و ﻳﺎ ﺗﻮره داﺷﺘﻨﺪ ﺑﻌﺪ از ﻣﻌﺎﻳﻨﻪ ﺗﻮﺳﻂ ﭘﺰﺷﻚ‬

‫ﻋﻔﻮﻧﺖﻫﺎي اﺳﺘﺮﭘﺘﻮﻛﻮﻛﻲ ﻓﺎﻛﺘﻮر اﺗﻴﻮﻟﻮژﻳﻚ ﺑﺎﺷﻨﺪ‪ ،‬ﻫﺮ ﭼﻨﺪ ﻛﻪ‬

‫ﻣﻌﺎﻟﺞ اﻧﺘﺨﺎب ﺷﺪﻧﺪ‪ .‬ﭘﺮﺳﺸﻨﺎﻣﻪاي از ﺑﻴﻤﺎران و ﺷﺎﻫﺪ‪ ،‬ﺣﺎوي‬

‫ﻧﺪاﺷﺘﻦ ﮔﺮوه ﻛﻨﺘﺮل ﺑﻪﻋﻨﻮان ﻧﻘﺺ اﻳﻦ ﻣﻄﺎﻟﻌﻪ ﻣﻮرد ﻧﻈﺮ ﺑﻮده و‬

‫ﻣﺸﺨﺼﺎت ﻓﺮدي و ﻏﻴﺮه ﺗﻜﻤﻴﻞ ﮔﺮدﻳﺪ‪ .‬ﻧﺘﺎﻳﺞ ﻣﻌﺎﻳﻨﺎت ﺑﺎﻟﻴﻨﻲ ﺑﻪوﻳﮋه‬

‫در ﻣﺠﻤﻮع در ﻣﻮرد‬

‫ﻧﻮع اﺧﺘﻼﻻت ﺣﺮﻛﺘﻲ در ﭘﺮﺳﺸﻨﺎﻣﻪ ﺑﻴﻤﺎران ذﻛﺮ ﮔﺮدﻳﺪ‪ .‬ﮔﺮوه ﺑﻴﻤﺎر‬

‫اﺧﺘﻼﻻت ﺣﺮﻛﺘﻲ ﺷﺎﻣﻞ ﺗﻴﻚ و ﺗﻮره ﻛﻪ اﺧﻴﺮاً ﻣﻄﺮح ﺷﺪهاﻧﺪ اﺗﻔﺎق‬

‫ﺷﺎﻣﻞ ﻛﻮدﻛﺎن ﻣﺒﺘﻼ ﺑﻪ ﺗﻴﻚ و ﺗﻮره ﺑﺎ ﺳﻦ ﻛﻤﺘﺮ از ‪ 18‬ﺳﺎل ﺑﻮد ﻛﻪ‬

‫در ﺻﻮرﺗﻲﻛﻪ‬

‫ﻋﻠﺖ ارﮔﺎﻧﻴﻜﻲ ﺑﺮاي ﺑﻴﻤﺎري آنﻫﺎ وﺟﻮد ﻧﺪاﺷﺖ‪ .‬ﻣﻌﻴﺎرﻫﺎي ﺧﺮوج‬

‫ﺑﺘﻮان ارﺗﺒﺎط ﺑﻴﻦ ﻋﻔﻮﻧﺖ اﺳﺘﺮﭘﺘﻮﻛﻮﻛﻲ و ﺑﻴﻤﺎريﻫﺎي ﺣﺮﻛﺘﻲ ﻣﺜﻞ ﺗﻴﻚ‬

‫ﺑﻴﻤﺎران ﺷﺎﻣﻞ ﻣﺸﺨﺺ ﺷﺪن ﺳﺎﻳﺮ ﻋﻠﻞ ﺑﺮاي اﺧﺘﻼﻻت ﺣﺮﻛﺘﻲ ﺑﻴﻤﺎر‪،‬‬

‫و ﺗﻮره را ﺛﺎﺑﺖ ﻛﺮد راهﻫﺎي ﻣﺆﺛﺮ ﺟﻬﺖ ﭘﻴﺸﮕﻴﺮي و درﻣﺎن اﻳﻦ‬

‫وﺟﻮد ﺳﺎﻳﺮ ﻋﻠﻞ ﻋﻔﻮﻧﻲ ﺷﻨﺎﺧﺘﻪﺷﺪه )ﻣﺎﻧﻨﺪ ارﻳﻮن‪ ،‬آﺑﻠﻪ ﻣﺮﻏﺎن‪ ،‬ﻫﺮﭘﺲ‪،‬‬

‫از ﻃﺮﻓﻲ ﺑﻴﻤﺎريﻫﺎي اﺳﺘﺮﭘﺘﻮﻛﻮﻛﻲ‬

‫ﺳﺎﻳﺘﻮﻣﮕﺎﻟﻮوﻳﺮوس و ﻏﻴﺮه( و ﻳﺎ ﻋﻠﻞ ﻏﻴﺮ ﻋﻔﻮﻧﻲ و ﻏﻴﺮ ﺣﺎد درﮔﻴﺮي‪-‬‬

‫ﺑﺘﺎ ﻫﻤﻮﻟﺘﻴﻚ ﮔﺮوه ‪ A‬در اﻳﺮان ﺷﺎﻳﻊ ﺑﻮده و ﺟﻠﻮﮔﻴﺮي از ﻋﻮارض آن‪،‬‬

‫ﻫﺎي ﺳﻴﺴﺘﻢ ﻋﺼﺒﻲ ﻣﺮﻛﺰي ﻣﺎﻧﻨﺪ ﺧﻮﻧﺮﻳﺰي ﻣﻐﺰي‪ ،‬ﺗﻮﻣﻮر‪ ،‬ﺑﻴﻤﺎريﻫﺎي‬

‫آﺛﺎر ﻗﺎﺑﻞ ﻣﻼﺣﻈﻪاي از ﻧﻈﺮ ارﺗﻘﺎ ﺳﻼﻣﺖ ﺟﺎﻣﻌﻪ ﺑﻪوﻳﮋه ﻣﺸﻜﻼت‬

‫دژﻧﺮاﺗﻴﻮ‪ ،‬ﻣﺘﺎﺑﻮﻟﻴﻚ و ﻏﻴﺮه ﻛﻪ ﻣﻨﺠﺮ ﺑﻪ ﻋﻼﻳﻢ ﻋﺼﺒﻲ ﻣﻲﺷﻮﻧﺪ و ﻧﻴﺰ‬

‫‪23-26‬‬

‫ﻣﻮارد ﻣﺒﺘﻼ ﺑﻪ ﻧﻘﺺ اﻳﻤﻨﻲ و ﻳﺎ ﻋﺪم رﺿﺎﻳﺖ ﺑﻪ ﺧﻮنﮔﻴﺮي و‬

‫ﺣﺪاﻗﻞ دو ﺑﺮرﺳﻲ ﺟﺪاﮔﺎﻧﻪ ﺑﺎ ﻓﺎﺻﻠﻪ ‪ 10‬ﺳﺎل در ﺗﻬﺮان از ﻧﻈﺮ ﻓﺮاواﻧﻲ‬

‫ﭘﻲﮔﻴﺮيﻫﺎ ﺑﻮد‪ .‬ﮔﺮوه ﻛﻨﺘﺮل ﺷﺎﻣﻞ اﻓﺮاد ﻛﻤﺘﺮ از ‪ 18‬ﺳﺎل ﺑﻮد ﻛﻪ ﺑﺮاي‬

‫ﻋﻔﻮﻧﺖﻫﺎي اﺳﺘﺮﭘﺘﻮﻛﻮﻛﻲ اﻧﺠﺎم ﮔﺮﻓﺘﻪ ﻛﻪ ﻧﺸﺎن ﻣﻲدﻫﺪ ﻋﻔﻮﻧﺖﻫﺎي‬

‫ﻋﻤﻞ ﺟﺮاﺣﻲ اﻟﻜﺘﻴﻮ )ﻫﺮﻧﻲ‪ ،‬اﻋﻤﺎل ارﺗﻮﭘﺪﻳﻚ‪ ،‬ﺗﺮﻣﻴﻤﻲ( در ﺑﺨﺶﻫﺎي‬

‫ﻟﺬا ﺑﺮ آن‬

‫اﻃﻔﺎل ﺑﺴﺘﺮي ﺑﻮدﻧﺪ‪ .‬اﻳﻦ ﮔﺮوه ﺑﻪﻃﻮر ﻣﻌﻤﻮل ﻗﺒﻞ از ﻫﺮ ﮔﻮﻧﻪ ﺟﺮاﺣﻲ‬

‫ﺷﺪﻳﻢ ﺗﺎ در ﺑﻴﻤﺎران دﭼﺎر اﺧﺘﻼﻻت ﺣﺮﻛﺘﻲ ﺷﺎﻣﻞ ﺗﻴﻚ و ﺗﻮره‪ ،‬ردﭘﺎي‬

‫ﺗﻮﺳﻂ ﻣﺘﺨﺼﺺ ﻛﻮدﻛﺎن ازﻧﻈﺮ ﻧﺪاﺷﺘﻦ ﺑﻴﻤﺎريﻫﺎي زﻣﻴﻨﻪاي و ﻋﻔﻮﻧﺖ‬

‫ﻋﻔﻮﻧﺖ اﺳﺘﺮﭘﺘﻮﻛﻮﻛﻲ را ﺟﺴﺘﺠﻮ ﻛﻨﻴﻢ‪ .‬در ﺻﻮرت اﺛﺒﺎت ارﺗﺒﺎط ﺑﻴﻦ‬

‫و ﺳﺎﻳﺮ اﺧﺘﻼﻻت وﻳﺰﻳﺖ ﻣﻲﺷﺪﻧﺪ و ﺳﭙﺲ ﻣﻮرد ﺗﺄﻳﻴﺪ ﺑﺮاي ﺟﺮاﺣﻲ‬

‫آن دو ﻣﻲﺗﻮان راهﺣﻞ ﻣﻨﺎﺳﺐ ﺑﺮاي درﻣﺎن ﻋﻮارض ﻧﻮروﻟﻮژﻳﻚ ﻳﺎﻓﺖ‬

‫ﻗﺮار ﻣﻲﮔﺮﻓﺘﻨﺪ‪ .‬ﻣﻌﻴﺎرﻫﺎي ورود ﺑﻪ ﻣﻄﺎﻟﻌﻪ در ﮔﺮوه ﺷﺎﻫﺪ‪ ،‬ﻋﺪم وﺟﻮد‬

‫و از اﺑﺘﻼي ﺑﻪ ﻋﻔﻮﻧﺖ اﺳﺘﺮﭘﺘﻮﻛﻮﻛﻲ ﺑﻪﺻﻮرت ﻣﺆﺛﺮ ﺟﻠﻮﮔﻴﺮي ﻛﺮد‪.‬‬

‫ﻣﺸﻜﻞ ﻋﻔﻮﻧﻲ و ﻳﺎ اﺧﺘﻼﻻت ﻋﺼﺒﻲ و رواﻧﻲ ﻛﻪ ﭘﺲ از ﻣﻌﺎﻳﻨﻪ ﺗﻮﺳﻂ‬

‫‪12‬‬

‫ﺑﺮرﺳﻲ دﻗﻴﻖ و ﺟﺎﻣﻊﺗﺮي ﻻزم ﻣﻲﺑﺎﺷﺪ‪.‬‬

‫ﻧﻈﺮ وﺟﻮد ﻧﺪاﺷﺘﻪ و ﻧﻴﺎز ﺑﻪ ﺑﺮرﺳﻲ ﻛﺎﻣﻞﺗﺮ دارد‪.‬‬

‫‪22‬و‪21‬‬

‫ﺑﻴﻤﺎريﻫﺎ ﻧﻴﺰ ﺣﺎﺻﻞ ﻣﻲﺷﻮد‪.‬‬

‫‪13-20‬‬

‫ﻋﺼﺒﻲ و اﺧﺘﻼﻻت ﺣﺮﻛﺘﻲ ﻣﺜﻞ ﺗﻮره و ﺗﻴﻚ ﺧﻮاﻫﺪ داﺷﺖ‪.‬‬

‫‪26‬و‪23‬‬

‫اﺳﺘﺮﭘﺘﻮﻛﻮﻛﻲ در ﻛﻮدﻛﺎن ﻧﻘﺶ ﻣﻬﻤﻲ را اﻳﻔﺎ ﻣﻲﻛﻨﻨﺪ‪.‬‬

‫ﻣﺘﺨﺼﺼﻴﻦ ﺑﻪﻋﻨﻮان ﮔﺮوه ﻛﻨﺘﺮل اﻧﺘﺨﺎب ﺷﺪﻧﺪ‪ .‬ﺑﻪﻃﻮر روﺗﻴﻦ ﻗﺒﻞ از‬

‫روش ﺑﺮرﺳﻲ‬

‫ﺟﺮاﺣﻲ ﺑﺮاي آزﻣﺎﻳﺸﺎت روﺗﻴﻦ )ﻗﻨﺪ‪ ،‬اﻟﻜﺘﺮوﻟﻴﺖﻫﺎ‪ ،‬آزﻣﺎﻳﺶ ﻛﺎﻣﻞ‬

‫اﻳﻦ ﻣﻄﺎﻟﻌﻪ ﻣﻘﻄﻌﻲ‪ -‬ﺗﺤﻠﻴﻠﻲ در ﻃﻲ دو ﺳﺎل )‪ (1387-89‬در دو‬

‫ﺧﻮن( از اﻳﻦاﻓﺮاد ﺧﻮنﮔﻴﺮي اﻧﺠﺎم ﻣﻲﺷﺪ ﻛﻪ ﺑﺮاي ﻣﻄﺎﻟﻌﻪ ﺣﺎل ﺣﺎﺿﺮ‬

‫ﻣﺮﻛﺰ آﻣﻮزﺷﻲ ﺑﻴﻤﺎرﺳﺘﺎن رﺳﻮل اﻛﺮم)ص( و ﻋﻠﻲاﺻﻐﺮ ﺗﻬﺮان واﺑﺴﺘﻪ‬

‫از ﺑﺎﻗﻴﻤﺎﻧﺪه ﺧﻮن ﮔﺮﻓﺘﻪ ﺷﺪه ﻣﻮﺟﻮد در آزﻣﺎﻳﺸﮕﺎه اﺳﺘﻔﺎده ﺷﺪ‪ .‬روش‬

‫ﺑﻪ داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ اﻳﺮان اﻧﺠﺎم ﮔﺮﻓﺖ‪ .‬اﻳﻦ ﻃﺮح ﺑﻌﺪ از ﺗﺎﻳﻴﺪ در‬

‫ﺑﺮرﺳﻲ ﻧﻤﻮﻧﻪﻫﺎ ﺑﻪروش اﻳﻤﻮﻧﻮﻟﻮژﻳﻚ و اﻻﻳﺰا ﺑﻮد ﻛﻪ آﻧﺘﻲﺑﺎديﻫﺎ ﺑﺮ‬ ‫‪A‬‬

‫)آﻧﺘﻲ اﺳﺘﺮﭘﺘﻮﻟﻴﺰﻳﻦ و آﻧﺘﻲ اﺳﺘﺮﭘﺘﻮﻛﻴﻨﺎز و‬

‫ﻛﻤﻴﺘﻪ اﺧﻼق ﻣﺮﻛﺰ ﺗﺤﻘﻴﻘﺎت ﻋﻔﻮﻧﻲ ﻛﻮدﻛﺎن داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ‬

‫ﻋﻠﻴﻪ اﺳﺘﺮﭘﺘﻮﻛﻮك ﮔﺮوه‬

‫اﻳﺮان اﻧﺠﺎم ﮔﺮﻓﺖ‪ .‬اﻧﺘﺨﺎب ﺑﻴﻤﺎران ﺑﺎ روش ﻧﻤﻮﻧﻪﮔﻴﺮي آﺳﺎن اﻧﺠﺎم‬

‫‪ Anti-DNase‬ﺑﻪﻃﻮر ﻛﻤ‪‬ﻲ‬

‫ﺷﺪ‪ .‬ﺑﻌﺪ از ﮔﺮﻓﺘﻦ رﺿﺎﻳﺖ ﻛﺘﺒﻲ از واﻟﺪﻳﻦ‪ ،‬ﺧﻮنﮔﻴﺮي از ﺑﻴﻤﺎران و‬

‫)‪ (ABCam, ELISA, USA‬ﺗﻌﻴﻴﻦ ﺷﺪ‪ .‬ﺑﺮاي ﻣﻘﺎﻳﺴﻪ ﻧﺴﺒﺖ اﺳﺘﺮﭘﺘﻮﻛﻮك‪-‬‬

‫ﮔﺮوه ﺷﺎﻫﺪ )ﻛﻨﺘﺮل ﺳﺎﻟﻢ( اﻧﺠﺎم ﺷﺪ‪ .‬اﻧﺠﺎم ﺗﺴﺖﻫﺎي آﻧﺘﻲﺑﺎدي ﺑﺪون‬

‫ﻫﺎي ﻣﺜﺒﺖ ﺷﺪه دو ﮔﺮوه از ﻓﺮﻣﻮل ﻣﻘﺎﻳﺴﻪ دو ﻧﺴﺒﺖ ﺑﺎ ﻓﺮض‬

‫‪=%5‬‬

‫درﻳﺎﻓﺖ ﻫﻴﭻ ﻫﺰﻳﻨﻪاي اﻧﺠﺎم ﮔﺮﻓﺖ‪ .‬ﺑﺎ ﻧﻈﺮ ﭘﺰﺷﻚ ﻣﻌﺎﻟﺞ از ﻛﻮدﻛﺎﻧﻲ‬

‫و ‪ β=%20‬و اﺣﺘﻤﺎل اﺳﺘﺮﭘﺘﻮﻛﻮك ﮔﺮوه ‪ A‬در ﺑﻴﻤﺎران ‪ %30‬و در ﮔﺮوه‬

‫ﻛﻪ ﻣﻌﻴﺎرﻫﺎي ﺗﺸﺨﻴﺼﻲ ﺑﻪ ﻧﻔﻊ ﺗﻴﻚ و ﻳﺎ ﺗﻮره داﺷﺘﻨﺪ ﭘﺮﺳﺸﻨﺎﻣﻪ )ﻓﺮم‬

‫ﺳﺎﻟﻢ ‪ ،%10‬ﺣﺠﻢ ﻧﻤﻮﻧﻪﻫﺎ ‪ 45‬ﻧﻔﺮ ﺗﻌﻴﻴﻦ ﮔﺮدﻳﺪ‪ .‬آﻣﺎر ﺗﻮﺻﻴﻔﻲ )ﺷﺎﻣﻞ‬

‫‪IU/ML‬‬

‫ﺑﺎ اﺳﺘﻔﺎده از ﻛﻴﺖﻫﺎي آزﻣﺎﻳﺸﮕﺎﻫﻲ‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬


‫ﻧﻘﺶ ﻋﻔﻮﻧﺖ اﺳﺘﺮﭘﺘﻮﻛﻮك ﺑﺘﺎﻫﻤﻮﻟﺘﻴﻚ ﮔﺮوه ‪ A‬در ﻣﺒﺘﻼﻳﺎن ﺑﻪ ﺗﻴﻚ و ﺗﻮره‬

‫‪536‬‬

‫ﻣﻴﺎﻧﮕﻴﻦ و اﻧﺤﺮافﻣﻌﻴﺎر( ﺑﺮاي ﻣﺘﻐﻴﺮﻫﺎي ﻛﻤ‪‬ﻲ ﻣﺎﻧﻨﺪ ﺳﻄﺢ آﻧﺘﻲﺑﺎدي‪-‬‬

‫ﺗﺎ ‪ %84‬اﻓﺰاﻳﺶ ﻣﻲﻳﺎﺑﺪ‪ .‬ارزش اﺧﺒﺎري ﻣﺜﺒﺖ ‪ %80‬ﺗﻌﻴﻴﻦ ﺷﺪ‪ .‬ﺟﺪول ‪3‬‬ ‫‪ASOT‬‬

‫ﻫﺎي اﻧﺪازهﮔﻴﺮي و ﺑﺮاي ﻣﺘﻐﻴﺮﻫﺎي ﻛﻴﻔﻲ ﻣﺎﻧﻨﺪ ﺟﻨﺲ و ﻧﻮع ﺑﻴﻤﺎري‬

‫ﻧﺸﺎن ﻣﻲدﻫﺪ ﻛﻪ ﻣﻴﺰان‬

‫ﭘﺎﻧﺪاس و ﻏﻴﺮه اﺳﺘﻔﺎده ﺷﺪ‪ .‬از ﻓﺮاواﻧﻲ ﺧﺎم و ﻧﺴﺒﻲ )درﺻﺪ(‪ ،‬ﺟﻬﺖ‬

‫‪ 53‬ﻧﻔﺮ ﮔﺮوه ﻣﻮرد در ﻣﻘﺎﺑﻞ ‪ 10‬ﻧﻔﺮ از ‪ 76‬ﻧﻔﺮ ﮔﺮوه ﻛﻨﺘﺮل( داراي‬

‫ﻣﻘﺎﻳﺴﻪ ﻣﻴﺎﻧﮕﻴﻦ ﻣﺘﻐﻴﺮﻫﺎي ﻛﻤ‪‬ﻲ ﺑﻴﻦ دو ﮔﺮوه از ‪ Student’s t-test‬و‬

‫ﺗﻔﺎوت آﻣﺎري ﻣﻌﻨﻲدار ﺑﻮد )‪ .(Pearson 2= 51/080 ،p<0/0001‬در‬

‫ﻳﺎ ‪ Fisher’s exact test‬اﺳﺘﻔﺎده ﺷﺪ‪.‬‬

‫ﺟﺪول ‪ 4‬ﻣﻘﺎدﻳﺮ ﻣﺮﺑﻮط ﺑﻪ آﻧﺘﻲ اﺳﺘﺮﭘﺘﻮﻛﻴﻨﺎز ﻧﺸﺎن داده ﺷﺪه اﺳﺖ‪.‬‬

‫‪Mann-Whitney u‬‬

‫‪ ،(149 Cut off) Anti- streptokinase‬ﺣﺴﺎﺳﻴﺖ ﺗﺴﺖ ‪ %98‬و وﻳﮋﮔﻲ‬

‫و ﺟﻬﺖ ﺗﻌﻴﻴﻦ‬

‫‪ %46‬ﺑﻮد‪ .‬ارزش اﺧﺒﺎري ﻣﺜﺒﺖ ‪ %90‬ﺗﻌﻴﻴﻦ ﺷﺪ‪ .‬اﮔﺮ ‪ Cut off‬ﻣﺸﺎﺑﻪ‬

‫ﺟﻬﺖ ﻣﻘﺎﻳﺴﻪ ﻣﺘﻐﻴﺮ ﻛﻴﻔﻲ از‬

‫‪2‬‬

‫‪‬‬

‫ﺳﻄﺢ ﻣﻌﻨﻲدار ﻛﻤﺘﺮ از ‪ 0/05‬ﺑﻮده و از ‪ 2<0/05‬و‬ ‫‪ test‬اﺳﺘﻔﺎده ﺷﺪ‪ .‬آﻣﺎر ﺗﺤﻠﻴﻠﻲ ﺷﺎﻣﻞ‬

‫‪2‬‬

‫‪‬‬

‫ﺑﺎ‬

‫)‪(CI=95%‬‬

‫راﺑﻄﻪ ﺑﻴﻦ ﻣﺜﺒﺖﺷﺪن ﺗﺴﺖ ﺑﺎ ﺳﺎﻳﺮ ﻣﺘﻐﻴﺮﻫﺎي ﻛﻴﻔﻲ از‬

‫‪2‬‬

‫‪‬‬

‫و ﻳﺎ‬

‫ﺑﻴﻦ ﮔﺮوه ﻣﻮرد و ﻛﻨﺘﺮل )‪ 40‬ﺑﻴﻤﺎر از‬

‫‪IU/ml‬‬

‫اﺳﺘﺎﻧﺪارد ﻛﻴﺖ ﺑﺎﻻﺗﺮ از‬

‫‪ 332‬ﻣﺤﺎﺳﺒﻪ ﺷﻮد ﺣﺴﺎﺳﻴﺖ ﺗﺴﺖ ﺑﻪ‬

‫‪ Fisher’s exact test‬اﺳﺘﻔﺎده ﺷﺪ‪ .‬ﺣﺴﺎﺳﻴﺖ و وﻳﮋﮔﻲ‪ ،‬ارزش اﺧﺒﺎري‬

‫‪ %34‬ﻛﺎﻫﺶ ﻣﻲﻳﺎﺑﺪ اﻣﺎ وﻳﮋﮔﻲ آن ﺗﺎ ‪ %85‬اﻓﺰاﻳﺶ ﻣﻲﻳﺎﺑﺪ‪ .‬ﺟﺪول ‪4‬‬

‫ﻣﺜﺒﺖ و ﻣﻨﻔﻲ ﺗﺴﺖ ﺑﺎ ﺗﻌﻴﻴﻦ ﺳﻄﺢ زﻳﺮ ﻣﻨﺤﻨﻲ راك ﻣﺸﺨﺺ ﺷﺪ‪.‬‬

‫ﻧﺸﺎن ﻣﻲدﻫﺪ ﻛﻪ ‪ 18‬از ‪ 52‬ﺑﻴﻤﺎر ‪ Anti- streptokinase‬ﻣﺜﺒﺖ )ﺑﺎﻻﺗﺮ از‬ ‫‪ (332IU/ml‬و در ﮔﺮوه ﻛﻨﺘﺮل ﻓﻘﻂ ﻫﻔﺖ از ‪ 76‬ﻧﻔﺮ‬

‫ﻳﺎﻓﺘﻪﻫﺎ‬

‫‪Anti‬‬

‫‪ streptokinase‬ﻣﺜﺒﺖ داﺷﺘﻨﺪ ﻛﻪ ﻛﺎﻣﻼً ﺗﻔﺎوت ﻣﻌﻨﻲدار ﺑﻮد‬

‫وﻳﮋﮔﻲﻫﺎي دﻣﻮﮔﺮاﻓﻴﻚ ‪ 52‬ﺑﻴﻤﺎر در ﮔﺮوه ﻣﻮرد ﺑﺎ ﻣﻴﺎﻧﮕﻴﻦ ﺳﻦ‬

‫‪2‬‬

‫)‪ .(Pearson  = 12/679 ،p<0/0001‬ارﺗﺒﺎط ﺑﻴﻦ ﺷﺎﺧﺺﻫﺎي آﻣﺎري‬

‫‪ 7/90±2/97‬ﺳﺎل )ﺣﺪاﻗﻞ= ‪ ،4‬ﺣﺪاﻛﺜﺮ= ‪ (16‬و ‪ 76‬ﻧﻔﺮ در ﮔﺮوه ﻛﻨﺘﺮل‬ ‫ﺑﺎ ﻣﻴﺎﻧﮕﻴﻦ ﺳﻦ ‪ 9/06±2/69‬ﺳﺎل )ﺣﺪاﻗﻞ= ‪ ،5‬ﺣﺪاﻛﺜﺮ= ‪ (13‬ﻗﺮار‬

‫ﺟﺪول‪ :1-‬ﻣﻴﺎﻧﮕﻴﻦ آﻧﺘﻲﺑﺎديﻫﺎي ﻣﻮرد ﺑﺮرﺳﻲ )‪ (IU/ml‬در ﮔﺮوه ﺑﻴﻤﺎر و ﻛﻨﺘﺮل‬

‫داﺷﺘﻨﺪ‪ .‬در ﮔﺮوه ﻣﻮرد ‪ %71/7‬ﭘﺴﺮ‪ %28/8 ،‬دﺧﺘﺮ و در ﮔﺮوه ﻛﻨﺘﺮل‬

‫وﻳﮋﮔﻲ‬

‫‪ %69/7‬ﭘﺴﺮ و ‪ %30/3‬دﺧﺘﺮ ﺑﻮدﻧﺪ‪ .‬ﻓﺼﻞ ﻣﺮاﺟﻌﻪ ﺑﻴﻤﺎران ‪ 9) %17‬ﻧﻔﺮ(‬

‫ﻣﻴﺎﻧﮕﻴﻦ‬

‫ﮔﺮوه ﻣﻮرد‬

‫ﮔﺮوه ﻛﻨﺘﺮل‬

‫*‪p‬‬

‫‪203/7‬‬

‫‪103/56‬‬

‫‪<0/001‬‬

‫)اﻧﺤﺮاف ﻣﻌﻴﺎر(‬

‫)‪(69/7‬‬

‫)‪(28/9‬‬

‫)‪ 20‬ﻧﻔﺮ( در زﻣﺴﺘﺎن ﺑﻮد‪ .‬ﻓﻘﻂ در ﺳﻪ ﺑﻴﻤﺎر ﺳﻨﺪرم ﺗﻮره ﺗﺸﺨﻴﺺ داده‬

‫ﻣﻴﺎﻧﮕﻴﻦ آﻧﺘﻲ اﺳﺘﺮﭘﺘﻮﻟﻴﺰﻳﻦ‬

‫‪302/7‬‬

‫‪172/7‬‬

‫)اﻧﺤﺮاف ﻣﻌﻴﺎر(‬

‫)‪(106/2‬‬

‫)‪(23/8‬‬

‫ﺷﺪ و ﺑﻘﻴﻪ ﺑﻴﻤﺎران دﭼﺎر ﺗﻴﻚ ﺑﻪﺗﻨﻬﺎﻳﻲ و ﻳﺎ ﺗﻮام ﺑﺎ ﺑﻴﻤﺎري وﺳﻮاس‪-‬‬

‫ﻣﻴﺎﻧﮕﻴﻦ آﻧﺘﻲ اﺳﺘﺮﭘﺘﻮﻛﻴﻨﺎز‬

‫‪286/05‬‬

‫‪197/05‬‬

‫)اﻧﺤﺮاف ﻣﻌﻴﺎر(‬

‫)‪(104/1‬‬

‫)‪(106/5‬‬

‫در ﺑﻬﺎر ‪ 9) %17‬ﻧﻔﺮ( در ﺗﺎﺑﺴﺘﺎن‪ 15) %28/3 ،‬ﻧﻔﺮ( در ﭘﺎﻳﻴﺰ و ‪%37/7‬‬

‫اﺟﺒﺎر‬

‫)‪(OCD‬‬

‫)‪ 15‬ﻧﻔﺮ( ﺑﻮدﻧﺪ‪ .‬در دو ﮔﺮوه ﻣﻮرد و ﻛﻨﺘﺮل ﻣﻘﺎدﻳﺮ ﺳﻪ‬

‫ﻧﻮع ﻣﺨﺘﻠﻒ آﻧﺘﻲﺑﺎدي ﺳﺮﻣﻲ ﺷﺎﻣﻞ‬

‫‪ASOT ،Anti-DNase‬‬

‫و‬

‫‪Anti-‬‬

‫‪Anti-DNase‬‬

‫‪<0/001‬‬

‫‪<0/001‬‬

‫* آزﻣﻮن ﭘﻴﺮﺳﻮن ‪ 2‬و ﻣﻘﺎدﻳﺮ ‪ p<0/05‬ﻣﻌﻨﻲدار در ﻧﻈﺮ ﮔﺮﻓﺘﻪ ﺷﺪ‬

‫‪ streptokinase‬اﻧﺪازهﮔﻴﺮي و ﻣﻘﺎﻳﺴﻪ ﺷﺪ ﻛﻪ در ﺟﺪول ‪ 1‬اراﻳﻪ ﮔﺮدﻳﺪه‬ ‫اﺳﺖ‪ .‬ﻣﻘﺎﻳﺴﻪ ﺳﻪ ﻧﻮع آﻧﺘﻲﺑﺎدي ﺑﺎ اﺳﺘﻔﺎده از ﻣﻨﺤﻨﻲ راك اﻧﺠﺎم ﺷﺪ‬ ‫)ﻧﻤﻮدار ‪ .(1‬در راﺑﻄﻪ ﺑﺎ ﺳﻄﺢ ‪ ،(103 Cut off) Anti-DNase‬ﺣﺴﺎﺳﻴﺖ‬ ‫ﺗﺴﺖ ‪ %94‬و وﻳﮋﮔﻲ آن ‪ %70‬ﺑﻮد‪ .‬اﮔﺮ ‪ Cut off‬ﻣﺸﺎﺑﻪ اﺳﺘﺎﻧﺪارد ﻛﻴﺖ‬

‫ﺟﺪول‪ :2-‬ﺳﻄﺢ ﺑﺎﻻﺗﺮ از ‪ Anti-DNase 170IU/ml‬در ﮔﺮوه ﻣﻮرد و ﻛﻨﺘﺮل‬ ‫ﺳﻄﺢ‬

‫‪Anti-DNase‬‬

‫ﺑﺎﻻﺗﺮ از ‪170 IU/ml‬‬

‫ﺑﺎﻻﺗﺮ از ‪ 170‬ﻣﺤﺎﺳﺒﻪ ﺷﻮد ﺣﺴﺎﺳﻴﺖ ﺗﺴﺖ ﺑﻪ ‪ %70‬ﻛﺎﻫﺶ ﻣﻲﻳﺎﺑﺪ اﻣﺎ‬ ‫وﻳﮋﮔﻲ آن ﺗﺎ ‪ %99‬اﻓﺰاﻳﺶ ﻣﻲﻳﺎﺑﺪ‪ .‬ارزش اﺧﺒﺎري ﺗﺴﺖ ﻣﺜﺒﺖ ‪%90‬‬

‫ﮔﺮوه ﺑﻴﻤﺎران‬ ‫ﻣﻮرد‬

‫ﺷﺎﻫﺪ‬

‫دارد‬

‫‪41‬‬

‫‪5‬‬

‫ﻧﺪارد‬ ‫ﻣﺠﻤﻮع‬

‫ﻣﺠﻤﻮع‬ ‫‪46‬‬

‫‪12‬‬

‫‪71‬‬

‫‪83‬‬

‫‪53‬‬

‫‪76‬‬

‫‪129‬‬

‫ﺗﻌﻴﻴﻦ ﺷﺪ‪ .‬ﺟﺪول ‪ 2‬ﻧﺸﺎن ﻣﻲدﻫﺪ ﻛﻪ ‪ 41‬ﻧﻔﺮ از ‪ 53‬ﺑﻴﻤﺎر داراي‬ ‫‪ Anti-DNase‬ﻣﺜﺒﺖ )ﺑﺎﻻﺗﺮ از ‪ (170‬و در ﮔﺮوه ﻛﻨﺘﺮل ﭘﻨﺞ ﻧﻔﺮ از ‪76‬‬

‫ﺟﺪول‪ :3-‬ﺳﻄﺢ آﻧﺘﻲ اﺳﺘﺮﭘﺘﻮﻟﻴﺰﻳﻦ ﺑﺎﻻﺗﺮ از ‪ 200IU/ml‬در ﮔﺮوه ﻣﻮرد و ﻛﻨﺘﺮل‬

‫ﻧﻔﺮ ‪ Anti-DNase‬ﻣﺜﺒﺖ داﺷﺘﻨﺪ ﻛﻪ داراي ﺗﻔﺎوت آﻣﺎري ﻣﻌﻨﻲدار ﺑﻮد‬

‫ﻣﺠﻤﻮع‬

‫)‪68/180 ،p<0/0001‬‬

‫‪2‬‬

‫=‪‬‬

‫‪ .(Pearson‬ﺳﻄﺢ‬

‫‪ASOT‬‬

‫)‪(181 Cut off‬‬

‫ﺣﺴﺎﺳﻴﺖ ﺗﺴﺖ ‪ %94‬و وﻳﮋﮔﻲ ‪ %60‬ﺑﻮد‪ .‬اﮔﺮ ‪ Cut off‬ﻣﺸﺎﺑﻪ اﺳﺘﺎﻧﺪارد‬ ‫ﻛﻴﺖ ﺑﺎﻻﺗﺮ از ‪ 200‬ﻣﺤﺎﺳﺒﻪ ﺷﻮد ﺣﺴﺎﺳﻴﺖ ﺗﺴﺖ ‪ %75‬اﻣﺎ وﻳﮋﮔﻲ آن‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬

‫ﺳﻄﺢ آﻧﺘﻲ اﺳﺘﺮﭘﺘﻮﻟﻴﺰﻳﻦ‬ ‫ﺑﺎﻻﺗﺮ از ‪200 IU/ml‬‬ ‫ﻣﺠﻤﻮع‬

‫ﮔﺮوه ﺑﻴﻤﺎران‬ ‫ﻣﻮرد‬

‫ﺷﺎﻫﺪ‬

‫دارد‬

‫‪40‬‬

‫‪10‬‬

‫‪50‬‬

‫ﻧﺪارد‬

‫‪13‬‬

‫‪66‬‬

‫‪79‬‬

‫‪53‬‬

‫‪76‬‬

‫‪129‬‬


‫ﺛﻤﻴﻠﻪ ﻧﻮرﺑﺨﺶ و ﻫﻤﻜﺎران‬

‫ﺟﺪول‪ :4-‬ﺳﻄﺢ آﻧﺘﻲ اﺳﺘﺮﭘﺘﻮﻛﻴﻨﺎز ﺑﺎﻻﺗﺮ از ‪ 332IU/ml‬در ﮔﺮوه ﻣﻮرد و ﻛﻨﺘﺮل‬ ‫ﮔﺮوه ﺑﻴﻤﺎران‬

‫ﺳﻄﺢ آﻧﺘﻲ اﺳﺘﺮﭘﺘﻮﻛﻴﻨﺎز‬

‫ﺑﺎﻻﺗﺮ از ‪332 IU/ml‬‬

‫ﺑﺤﺚ‬

‫ﻣﺠﻤﻮع‬

‫ﻣﻮرد‬

‫ﺷﺎﻫﺪ‬

‫دارد‬

‫‪19‬‬

‫‪7‬‬

‫‪25‬‬

‫ﻧﺪارد‬

‫‪34‬‬

‫‪69‬‬

‫‪103‬‬

‫‪53‬‬

‫‪76‬‬

‫‪129‬‬

‫ﻣﺠﻤﻮع‬

‫‪537‬‬

‫ﻫﻤﺎنﻃﻮر ﻛﻪ در ﻧﺘﺎﻳﺞ دﻳـﺪه ﺷﺪ ﺑﻴﺸﺘﺮ ﺑﻴـﻤﺎران ﻣﺎ ﻣﺬﻛـﺮ )‪ (%71/7‬و‬ ‫اﻏﻠﺐ ﺑﻴﻦ ﺳﻨﻴﻦ ﭘﻨﺞ ﺗﺎ ﻫﻔﺖ ﺳﺎل ﺑﻮدهاﻧﺪ )ﻣﻴﺎﻧﮕﻴﻦ ﺳﻨﻲ ‪ 5/7‬ﺳﺎل(‪.‬‬ ‫ﺑﻴﺸﺘﺮ ﺑﻴﻤﺎران در ﻓﺼﻮل ﺳﺮد ﺳﺎل ﻣﺮاﺟﻌﻪ و ﺗﺤﺖ ﺑﺮرﺳﻲ ﻗﺮار‬ ‫ﮔﺮﻓﺘﻨﺪ‪ .‬اﻳﻦ ﻧﺘﺎﻳﺞ ﻧﺸﺎﻧﮕﺮ ارﺟﺤﻴﺖ ﻧﺴﺒﻲ اﺑﺘﻼ در ﭘﺴﺮﻫﺎ ﻣﻲﺑﺎﺷﺪ ﻛﻪ‬ ‫ﻧﻴﺎزﻣﻨﺪ ﺑﺮرﺳﻲ ﺑﻴﺸﺘﺮ ﺑﺎ ﺣﺠﻢ ﻧﻤﻮﻧﻪ ﻛﺎﻓﻲ ﻣﻲﺑﺎﺷﺪ‪ Murphy .‬در ‪25‬‬

‫ﺟﺪول‪ :5-‬ارﺗﺒﺎط ﺑﻴﻦ ﺷﺎﺧﺺﻫﺎي آﻣﺎري و ﺳﻄﺢ آﻧﺘﻲﺑﺎديﻫﺎي ﺳﺮﻣﻲ )‪(IU/ml‬‬

‫ﺑﻴﻤﺎر ﻣﺒﺘﻼ ﺑﻪ ﺑﻴﻤﺎري وﺳﻮاس‪ ،‬اﺟﺒﺎر و ﻳﺎ ﺗﻴﻚ در ﻣﻘﺎﻳﺴﻪ ﺑﺎ ﮔﺮوه‬

‫‪Anti-DNase‬‬

‫‪ASOT‬‬

‫‪Anti‬‬ ‫‪streptokinase‬‬

‫ﻛﻨﺘﺮل ﻛﻪ در ﻓﻮاﺻﻞ ﺷﺶ ﻫﻔﺘﻪاي اﻧﺠﺎم ﺷﺪ ﻣﺘﻮﺟﻪ اﻓﺰاﻳﺶ و ﺗﻐﻴﻴﺮات‬

‫‪170‬‬

‫‪200‬‬

‫‪332‬‬

‫ﻣﺘﻐﻴﺮ‬ ‫ﺳﻄﺢ ‪Cut off‬‬

‫وﺳﻴﻊ در آﻧﺘﻲﺑﺎديﻫﺎي ﺿﺪ اﺳﺘﺮﭘﺘﻮﻛﻮك در ﻫﻨﮕﺎم ﻓﻌﺎﻟﻴﺖ ﺑﻴﻤﺎري‬ ‫ﺷﺪﻧﺪ‪ .‬ﺑﻴﻤﺎران ﻣﺒﺘﻼ ﺑﻪ ﺗﻴﻚ در ﻓﺼﻮل ﺳﺮد ﺳﺎل ﺗﻐﻴﻴﺮات واﺿﺢﺗﺮ‬

‫آﻧﺘﻲﺑﺎدي‬

‫‪8‬‬

‫ﺣﺴﺎﺳﻴﺖ )‪(%‬‬

‫‪70‬‬

‫‪75‬‬

‫‪34‬‬

‫ﺑﻮد‪ .‬در ﻣﻄﺎﻟﻌﻪ ‪ Rizzo‬در اﺳﺘﺮاﻟﻴﺎ ﻛﻪ ﺑﺮ روي ‪ 62‬ﻛﻮدك ﻣﺒﺘﻼ ﺑﻪ ﺗﻮره‬

‫وﻳﮋﮔﻲ )‪(%‬‬

‫‪99‬‬

‫‪84‬‬

‫‪85‬‬

‫اﻧﺠﺎم ﺷﺪ ﻧﺘﺎﻳﺞ ﺗﻴﺘﺮ اﺳﺘﺮﭘﺘﻮﻻﻳﺰﻳﻦ در ‪ %59‬ﺑﻴﻤﺎران ﻣﺒﺘﻼ ﺑﻪ ﺗﻴﻚ در‬

‫ارزش اﺧﺒﺎري‬

‫‪90‬‬

‫‪80‬‬

‫‪72‬‬

‫ﻣﻘﺎﻳﺴﻪ ﺑﺎ ‪ %19‬ﮔﺮوه ﻛﻨﺘﺮل ‪ p<0/0001‬ﻣﺜﺒﺖ ﺷﺪ ﻛﻪ ﺗﻘﺮﻳﺒﺎً ﺳﻪ ﺑﺮاﺑﺮ‬ ‫‪20‬‬

‫ﻣﺜﺒﺖ )‪(%‬‬

‫ﮔﺮوه ﻛﻨﺘﺮل ﺑﻮد‪ .‬اﻣﺎ در ﻣﻄﺎﻟﻌﻪ ﻣﺎ اﻳﻦ ﻧﺴﺒﺖ ﺑﺎﻻﺗﺮ و ﺗﻘﺮﻳﺒﺎً ‪ 5/5‬ﺑﺮاﺑﺮ‬ ‫‪0/62‬‬

‫‪0/62‬‬

‫‪0/79‬‬

‫‪0/970-0/907‬‬

‫‪0/969-0/839‬‬

‫‪0/868-0/709‬‬

‫اﻧﺪﻛﺲ ﻛﺎﭘﺎ‬ ‫ﺳﻄﺢ زﻳﺮ‬

‫در ﺑﻴﻤﺎران ﻣﺒﺘﻼ ﺑﻪ ﺗﻴﻚ ﺑﻴﺸﺘﺮ از ﮔﺮوه ﻛﻨﺘﺮل ﺑﻮد )‪ %75‬ﺑﻴﻤﺎران و ‪%14‬‬

‫ﻣﻨﺤﻨﻲ راك‬ ‫‪ASOT: Anti streptolysin O‬‬

‫ﻛﻨﺘﺮل(‪ .‬اﮔﺮﭼﻪ ﻓﺮاواﻧﻲ‬

‫‪ASOT‬‬

‫ﺑﻴﻤﺎران در ﻣﻄﺎﻟﻌﻪ اﺳﺘﺮاﻟﻴﺎﻳﻲ ﺣﺪود‬

‫ﭼﻬﺎر ﺑﺮاﺑﺮ ﻣﻄﺎﻟﻌﻪ ﻣﺎﺳﺖ اﻣﺎ ﻧﺴﺒﺖ آن ﻛﻤﺘﺮ از ﻣﻄﺎﻟﻌﻪ ﻓﻌﻠﻲ اﺳﺖ‪.‬‬ ‫ﺑﻨﺎﺑﺮاﻳﻦ ﻫﺮ دو ﻣﻄﺎﻟﻌﻪ ﺑﻪ ﻧﻔﻊ ﻓﺮاواﻧﻲ ﻋﻔﻮﻧﺖ اﺳﺘﺮﭘﺘﻮﻛﻮك در ﺑﻴﻤﺎران‬ ‫ﻣﺒﺘﻼ ﺑﻪ اﺧﺘﻼﻻت ﺣﺮﻛﺘﻲ اﺳﺖ اﻣﺎ در ﻛﻮدﻛﺎن ﻣﻮرد ﻣﻄﺎﻟﻌﻪ ﻣﺎ ﺑﻴﺶﺗﺮ‬ ‫از اﻓﺮاد ﻧﺮﻣﺎل دﻳﺪه ﺷﺪه و اﺣﺘﻤﺎﻻً ﻧﻘﺶ آن ﺑﻴﺸﺘﺮ اﺳﺖ‪ 20.‬ﻧﺘﺎﻳﺞ ﻣﻄﺎﻟﻌﻪ‬

‫‪ROC‬‬

‫‪1/00‬‬

‫‪ Müller‬ﻣﺸﺎﺑﻪ ﻣﻄﺎﻟﻌﻪ ﻓﻌﻠﻲ ﺗﻴﺘﺮ ﺑﺎﻻي‬

‫‪ASOT‬‬

‫را در ﺗﻌﺪاد زﻳﺎدي از‬ ‫‪21‬‬

‫ﻛﻮدﻛﺎن ﻣﺒﺘﻼ ﺑﻪ ﺳﻨﺪرم ﺗﻮره در ﻣﻘﺎﻳﺴﻪ ﺑﺎ ﮔﺮوه ﻛﻨﺘﺮل ﻧﺸﺎن داد‪ .‬اﻳﻦ‬

‫‪0/75‬‬

‫‪21‬‬

‫‪Reference Line‬‬

‫ﺣﺴﺎﺳﻴﺖ‬

‫‪0/50‬‬

‫ﻣﺴﺌﻠﻪ در ﻣﻮرد ﺑﺎﻟﻐﻴﻦ ﻫﻢ ﺻﺎدق ﺑﻮد‪ .‬ﻣﻄﺎﻟﻌﻪ ‪ Murphy‬ﻧﺸﺎن داد ﻛﻪ‬ ‫ﺑﻴﻦ ﺷﺪت ﻋﻼﻳﻢ ﭘﺎﻧﺪاس )ﺗﻴﻚ و ‪ (OCD‬ﺑﺎ آﻧﺘﻲﺑﺎديﻫﺎي اﺳﺘﺮﭘﺘﻮﻛﻮك‬ ‫ارﺗﺒﺎط واﺿﺤﻲ دارد اﻣﺎ ﻣﻄﺎﻟﻌﻪ ﻓﻌﻠﻲ ﺷﺪت ﺑﻴﻤﺎري را ﺑﺮرﺳﻲ ﻧﻜﺮده‬

‫‪Sreptokinase‬‬

‫‪0/25‬‬

‫‪ASOT‬‬

‫اﺳﺖ‪ 8.‬در ﻣﻄﺎﻟﻌﻪ ﻣﺎ ﺑﻴﺸﺘﺮ ﻋﻼﻳﻢ ﺗﻴﻚ در ﻓﺼﻮل ﺳﺮد ﺳﺎل دﻳﺪه ﺷﺪ‬ ‫اﻣﺎ در ﻣﻄﺎﻟﻌﻪ ‪ Murphy‬ﺗﺸﺪﻳﺪ ﻋﻼﻳﻢ ﺗﻴﻚ در ﻓﺼﻞﻫﺎي زﻣﺴﺘﺎن و‬

‫‪Anti-DNase‬‬

‫‪1/00‬‬

‫‪0/75‬‬

‫‪0/50‬‬

‫‪0/25‬‬

‫‪0/00‬‬ ‫‪0/00‬‬

‫وﻳﮋﮔﻲ‬

‫‪8‬‬

‫ﭘﺎﻳﻴﺰ ﺑﻴﺸﺘﺮ ﺑﻮده اﺳﺖ‪ .‬ﻣﻄﺎﻟﻌﻪ ‪ ،Luo‬ﻧﺸﺎن داد ﻛﻪ ﺗﻴﺘﺮ ﺑﺎﻻ روﻧﺪه‬ ‫آﻧﺘﻲﺑﺎديﻫﺎي ﺿﺪ اﺳﺘﺮﭘﺘﻮﻛﻮك ﻛﻪ دال ﺑﺮ ﻋﻔﻮﻧﺖ اﺳﺘﺮﭘﺘﻮﻛﻮﻛﻲ ﺟﺪﻳﺪ‬

‫ﻧﻤﻮدار‪ :1-‬ﻣﻨﺤﻨﻲراك ﻣﺮﺑﻮطﺑﻪ وﺟﻮد ﺳﻪﻧﻮع آﻧﺘﻲﺑﺎدي در دو ﮔﺮوه ﺑﻴﻤﺎر و ﺷﺎﻫﺪ‬

‫ﻣﻲﺑﺎﺷﺪ در ﺑﻴﻤﺎران ﻣﺒﺘﻼ ﺑﻪ ﺗﻴﻚ دو ﺑﺮاﺑﺮ ﮔﺮوه ﻛﻨﺘﺮل ﺳﺎﻟﻢ اﺳﺖ‪ 9.‬اﻣﺎ‬ ‫ﻋﻔﻮﻧﺖ ﺟﺪﻳﺪ اﺳﺘﺮﭘﺘﻮﻛﻮﻛﻲ )ﺗﻴﺘﺮ ﺑﺎﻻ روﻧﺪه آﻧﺘﻲﺑﺎديﻫﺎي ﺿﺪ‬

‫و ﺳﻄﺢ آﻧﺘﻲﺑﺎديﻫﺎي ﺳـﺮﻣﻲ ‪ ASOT‬و ‪ Anti- streptokinase‬و‬ ‫‪ DNase‬در ﺟﺪول ‪ 5‬اراﻳﻪ ﮔﺮدﻳﺪه اﺳﺖ‪.‬‬

‫‪Anti-‬‬

‫اﺳﺘﺮﭘﺘﻮﻛﻮﻛﻲ( در ﺑﻴﻤﺎراﻧﻲ ﻛﻪ ﻋﻼﻳﻢ ﺑﻴﻤﺎري ﺗﻴﻚ در آﻧﺎن ﺷﺪت ﻳﺎﻓﺘﻪ‬ ‫ﻫﻤﺮاﻫﻲ اﺗﻔﺎﻗﻲ داﺷﺖ‪ .‬ﻧﺘﻴﺠﻪﮔﻴﺮي ﺷﺪ ﻛﻪ در ﺑﻴﻤﺎران ﻣﺒﺘﻼ ﺑﻪ ﺗﻴﻚ و‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬


‫‪Noorbakhsh‬در ﻣﺒﺘﻼﻳﺎن ﺑﻪ ﺗﻴﻚ و ﺗﻮره‬ ‫ﺑﺘﺎﻫﻤﻮﻟﺘﻴﻚ ﮔﺮوه ‪A‬‬ ‫ﻧﻘﺶ ﻋﻔﻮﻧﺖ اﺳﺘﺮﭘﺘﻮﻛﻮك‬ ‫‪S. et al.‬‬

‫‪538‬‬

‫ﻳﺎ‬

‫‪OCD‬‬

‫ﻋﻔﻮﻧﺖﻫﺎي ﺟﺪﻳﺪ اﺳﺘﺮﭘﺘﻮﻛﻮك ﺑﺎ ﺗﺸﺪﻳﺪ ﻋﻼﻳﻢ ﺑﻴﻤﺎري‬

‫ﺣﻠﻖ ﻛﻪ در ﻧﺎﻗﻠﻴﻦ ﺳﺎﻟﻢ ﻣﻲﺗﻮاﻧﺪ ﻣﺜﺒﺖ ﺷﻮد ﺑﺪون اﻳﻦﻛﻪ ﻋﻔﻮﻧﺖ ﻓﻌﺎل‬

‫ارﺗﺒﺎط واﺿﺤﻲ ﻧﺪارد‪ Mabrouk .‬از ﻋﺮﺑﺴﺘﺎن در ﭘﻨﺞ ﺑﻴﻤﺎر ﻣﺒﺘﻼ ﺑﻪ‬

‫اﺳﺘﺮﭘﺘﻮﻛﻮﻛﻲ ﺑﺎﺷﺪ‪ .‬ﺗﺴﺖﻫﺎي ﺳﺮوﻟﻮژﻳﻚ ﻧﺸﺎندﻫﻨﺪه ﻋﻔﻮﻧﺖ اﺧﻴﺮ ﺑﺎ‬

‫اﺳﺘﻔﺎده از‬

‫اﺳﺘﺮﭘﺘﻮﻛﻮك ﺑﻮده و در ﺻﻮرت اﺛﺒﺎت اﻓﺰاﻳﺶ ﺗﻴﺘﺮ در ﻣﻘﺎﻳﺴﻪ ﺑﺎ ﻛﺸﺖ‬

‫ﭘﻨﻲﺳﻴﻠﻴﻦ در ﻓﺎز ﺣﺎد و ﻫﻤﭽﻨﻴﻦ ﺑﺮاي ﭘﺮوﻓﻴﻼﻛﺴﻲ‪ ،‬ﺗﻮﻧﺰﻳﻠﻜﺘﻮﻣﻲ و‬

‫ﺣﻠﻖ ﻧﺘﺎﻳﺞ ﻗﺎﺑﻞ ﻗﺒﻮلﺗﺮي اراﻳﻪ ﻣﻲدﻫﺪ‪ .‬اﺷﻜﺎل ﻣﻄﺎﻟﻌﻪ ﻓﻌﻠﻲ‬

‫درﻣﺎنﻫﺎﻳﻲ ﻣﺎﻧﻨﺪ ﺗﻌﻮﻳﺾ ﭘﻼﺳﻤﺎ و اﻳﻤﻮﻧﻮﮔﻠﻮﺑﻮﻟﻴﻦﻫﺎي داﺧﻞ ورﻳﺪي‬

‫ﻣﺤﺪودﻳﺖ در زﻣﺎن اﺟﺮا و ﻋﺪم ﺗﻮزﻳﻊ ﺑﻴﻤﺎران در ﺗﻤﺎم ﻓﺼﻮل ﺳﺎل و‬

‫را در ﺑﻴﻤﺎران ﺗﻮﺻﻴﻪ ﻛﺮد‪ .‬ﺑﺮﻋﻜﺲ ﻣﻄﺎﻟﻌﺎت ﻓﻮق‪ Morer ،‬در ﺑﺎﻟﺘﻴﻤﻮر‬

‫ﻧﻴﺰ ﻋﺪم اﻃﻼع دﻗﻴﻖ ﺑﻴﻤﺎران از زﻣﺎن ﺑﺮوز ﻋﻼﻳﻢ ﻋﺼﺒﻲ ﻣﺘﻌﺎﻗﺐ اﺑﺘﻼ‬

‫آﻣﺮﻳﻜﺎ ﻧﺸﺎن داد ﻛﻪ ارﺗﺒﺎط ﺑﻴﻦ آﻧﺘﻲﺑﺎديﻫﺎي اﺳﺘﺮﭘﺘﻮﻛﻮﻛﻲ و ﺳﻨﺪرم‬

‫ﺑﻪ ﻋﻔﻮﻧﺖ اﺳﺘﺮﭘﺘﻮﻛﻮﻛﻲ اﺳﺖ‪ .‬ﻣﻄﺎﻟﻌﻪ ﻣﺎ ﻧﺸﺎن داد در ﺑﻴﻤﺎران ﻣﺒﺘﻼ ﺑﻪ‬

‫ﺗﻮره وﺟﻮد ﻧﺪارد و ﺗﻮﺻﻴﻪ ﻛﺮد ﻛﻪ ﺑﻪﺟﺎي آزﻣﺎﻳﺸﺎت در ﻳﻚ زﻣﺎن‬

‫اﺧﺘﻼﻻت ﺣﺮﻛﺘﻲ ﻣﺜﻞ ﺗﻴﻚ و ﺗﻮره در ﻣﻘﺎﻳﺴﻪ ﺑﺎ ﮔﺮوه ﺳﺎﻟﻢ ﻫﺮ ﺳﻪ‬

‫ﺑﻬﺘﺮ اﺳﺖ ﻣﻄﺎﻟﻌﺎت ﻃﻮﻟﻲ )ﺗﻴﺘﺮ ﺑﺎﻻروﻧﺪه( ﺑﺮاي ﭘﻲ ﺑﺮدن ﺑﻪ ارﺗﺒﺎط‬

‫ﻧﻮع آﻧﺘﻲﺑﺎدي ﺑﺮ ﻋﻠﻴﻪ اﺳﺘﺮﭘﺘﻮﻛﻮك ﺑﻪﻃﻮر ﻣﻌﻨﻲداري ﺑﺎﻻﺗﺮ از ﮔﺮوه‬

‫‪Shulman‬‬

‫ﻛﻨﺘﺮل اﺳﺖ‪ .‬ﺷﺎﻳﺪ ﺑﺘﻮان ﭼﻨﻴﻦ ﺑﺮداﺷﺖ ﻧﻤﻮد ﻛﻪ ﺣﺪاﻗﻞ در ﺑﻌﻀﻲ‬

‫‪OCD‬‬

‫ﻣﻨﺎﻃﻖ ﻛﻪ ﻫﻨﻮز ﻋﻔﻮﻧﺖ اﺳﺘﺮﭘﺘﻮﻛﻮﻛﻲ ﻧﺴﺒﺘﺎً ﺷﺎﻳﻊ اﺳﺖ‪ ،‬ﺗﻴﻚ ﺗﻮرت‬

‫ارﺗﺒﺎﻃﻲ ﺑﺎ ﻋﻔﻮﻧﺖ اﺳﺘﺮﭘﺘﻮﻛﻮك ‪ A‬ﻧﺪارﻧﺪ و ﻧﺘﻴﺠﻪﮔﻴﺮي ﻛﺮد ﻛﻪ ارﺗﺒﺎط‬

‫ﻣﻲﺗﻮاﻧﺪ ﺑﺎ اﻳﻦ ﻋﻔﻮﻧﺖ در ارﺗﺒﺎط ﺑﺎﺷﺪ‪ .‬اﺣﺘﻤﺎﻻً ﻋﻔﻮﻧﺖ اﺳﺘﺮﭘﺘﻮﻛﻮك‬

‫و ﭘﺎﻧﺪاس ﻋﻠﻲرﻏﻢ ﻣﻄﺎﻟﻌﺎت ﻓﺮاوان ﻫﻨﻮز‬

‫ﻧﻘﺶ واﺿﺢﺗﺮي در ﺳﻨﺪرم ﭘﺎﻧﺪاس ﻛﻮدﻛﺎن اﻳﺮان ﻣﺸﺎﺑﻪ ﻛﺸﻮرﻫﺎي‬

‫ﻣﺸﺨﺺ ﻧﻴﺴﺖ و ﻧﻴﺎز ﺑﻪ ﺑﺮرﺳﻲﻫﺎي ﺑﻴﺸﺘﺮ دارد‪ 17.‬ﺑﻌﻀﻲ ﻣﻄﺎﻟﻌﺎت‬

‫ﻣﺠﺎور )ﻋﺮﺑﺴﺘﺎن( دارد‪ .‬درﻣﺎن ﻋﻔﻮﻧﺖﻫﺎي اﺳﺘﺮﭘﺘﻮﻛﻮﻛﻲ ﺑﻪراﺣﺘﻲ ﺑﺎ‬

‫ﺗﻮﺻﻴﻪ ﺑﻪ درﻣﺎنﻫﺎي ﻣﺘﻌﺪد ﻣﺎﻧﻨﺪ درﻣﺎن ﻋﻔﻮﻧﺖ اﺳﺘﺮﭘﺘﻮﻛﻮك ﺑﺎ ﻫﺪف‬

‫ﭘﻨﻲﺳﻴﻠﻴﻦ درازﻣﺪت ﻗﺎﺑﻞ دﺳﺘﺮﺳﻲ اﺳﺖ‪ .‬اﺳﺘﻔﺎده از داروﻫﺎي‬

‫‪ Perlmutter‬ﺗﻌﻮﻳﺾ ﭘﻼﺳﻤﺎ و‬

‫ﭘﻴﺸﮕﻴﺮيﻛﻨﻨﺪه ﻣﻲﺗﻮاﻧﺪ از اﻳﺠﺎد ﺗﻴﻚ و ﻳﺎ ﺷﻌﻠﻪور ﺷﺪن ﻋﻼﻳﻢ‬

‫‪ IvIg‬را ﺑﻪﻋﻨﻮان ﺧﻂ درﻣﺎﻧﻲ ﻣﻮرد ﺑﺮرﺳﻲ ﻗﺮار داده و اﻋﻼم ﻧﻤﻮد اﻓﺮاد‬

‫ﺟﻠﻮﮔﻴﺮي ﻛﻨﺪ‪ .‬ﺑﻨﺎﺑﺮاﻳﻦ در ﺑﻴﻤﺎراﻧﻲ ﻛﻪ ﻛﺮاﻳﺘﺮيﻫﺎي ﭘﺎﻧﺪاس و ﺗﻴﺘﺮ‬

‫‪10‬‬

‫آﻧﺘﻲﺑﺎدي ﺑﺎﻻ دارﻧﺪ ﺣﺪاﻗﻞ در ﻓﺼﻮل ﺳﺮد ﺳﺎل ﻣﺎﻧﻨﺪ ﭘﺎﻳﻴﺰ و زﻣﺴﺘﺎن‬

‫‪ Batuecas‬درﻣﺎن‬

‫ﭘﻴﺸﮕﻴﺮي و درﻣﺎن ﻋﻔﻮﻧﺖﻫﺎي اﺳﺘﺮﭘﺘﻮﻛﻮﻛﻲ ﺑﺎ ﭘﻨﻲﺳﻴﻠﻴﻦ درازﻣﺪت را‬

‫ﻣﻮﻓﻘﻴﺖآﻣﻴﺰ ﻳﻚ ﭘﺴﺮ ‪ 14‬ﺳﺎﻟﻪ ﺑﺎ ﺳﻨﺪرم ﭘﺎﻧﺪاس را ﺑﺎ ﻋﻤﻞ‬

‫ﺗﻮﺻﻴﻪ ﻣﻲﻛﻨﻴﻢ‪ .‬ﺗﺼﻤﻴﻢﮔﻴﺮي ﺑﺮاي اﺳﺘﻔﺎده از درﻣﺎنﻫﺎي ﺗﻬﺎﺟﻤﻲﺗﺮ‬

‫ﺗﻮﻧﺰﻟﻜﺘﻮﻣﻲ ﮔﺰارش ﻛﺮده اﺳﺖ‪ 18.‬از ﻧﻘﺎط ﻗﻮت ﻣﻄﺎﻟﻌﻪ ﻓﻌﻠﻲ ﻣﻘﺎﻳﺴﻪ‬

‫ﺑﺮاي ﭘﺎﻧﺪاس‪ ،‬ﻣﺎﻧﻨﺪ ﺗﻌﻮﻳﺾ ﭘﻼﺳﻤﺎ و ﻏﻴﺮه ﻧﻴﺎز ﺑﻪ ﻛﺎرآزﻣﺎﻳﻲﻫﺎي‬

‫ﺗﻴﺘﺮ آﻧﺘﻲﺑﺎدي ﺑﺮ ﻋﻠﻴﻪ ﺳﻪ ﻧﻮع ﻣﺘﻔﺎوت آﻧﺘﻲژن اﺳﺘﺮﭘﺘﻮﻛﻮك ﺑﻴﻦ ﮔﺮوه‬

‫ﺑﺎﻟﻴﻨﻲ ﺗﺼﺎدﻓﻲ ﺷﺎﻫﺪدار آﻳﻨﺪه دارد اﻣﺎ در ﻣﻮرد درﻣﺎنﻫﺎي ﺗﻬﺎﺟﻤﻲﺗﺮ‬

‫ﺑﻴﻤﺎر ﺑﺎ ﮔﺮوه ﺳﻨﻲ ﻣﺸﺎﺑﻪ )ﺑﺪون ﻋﻼﻳﻢ ﺑﺎﻟﻴﻨﻲ( اﺳﺖ‪ .‬ﺑﺮ ﺧﻼف ﻛﺸﺖ‬

‫ﻣﺎﻧﻨﺪ ﺗﻌﻮﻳﺾ ﭘﻼﺳﻤﺎ در اﻳﺠﺎد ﭘﺎﻧﺪاس ﻧﻘﺶ دارد‪.‬‬

‫‪7. Snider LA, Swedo SE. Childhood-onset obsessive-compulsive‬‬ ‫‪disorder and tic disorders: case report and literature review. J Child‬‬ ‫‪Adolesc Psychopharmacol 2003;13 Suppl 1:S81-8.‬‬ ‫‪8. Murphy TK, Sajid M, Soto O, Shapira N, Edge P, Yang M, et al.‬‬ ‫‪Detecting pediatric autoimmune neuropsychiatric disorders‬‬ ‫‪associated with streptococcus in children with obsessive‬‬‫‪compulsive disorder and tics. Biol Psychiatry 2004;55(1):61-8.‬‬ ‫‪9. Luo F, Leckman JF, Katsovich L, Findley D, Grantz H, Tucker‬‬ ‫‪DM, et al. Prospective longitudinal study of children with tic‬‬ ‫‪disorders and/or obsessive-compulsive disorder: relationship of‬‬ ‫‪symptom exacerbations to newly acquired streptococcal infections.‬‬ ‫‪Pediatrics 2004;113(6):e578-85.‬‬ ‫‪10. Perlmutter SJ, Leitman SF, Garvey MA, Hamburger S, Feldman E,‬‬ ‫‪Leonard HL, et al. Therapeutic plasma exchange and intravenous‬‬ ‫‪immunoglobulin for obsessive-compulsive disorder and tic‬‬ ‫‪disorders in childhood. Lancet 1999;354(9185):1153-8.‬‬ ‫‪11. Garvey MA, Perlmutter SJ, Allen AJ, Hamburger S, Lougee L,‬‬ ‫‪Leonard HL, et al. A pilot study of penicillin prophylaxis for‬‬

‫‪1. Gereber MA. Group A streptococcus. In: Nelson Textbook of‬‬ ‫‪Pediatrics. 17th ed. Philadelphia, Pa: WB Saunders Co; 2004. p.‬‬ ‫‪870-9.‬‬ ‫‪2. Betriu C, Redondo M, Palau ML, Sánchez A, Gómez M, Culebras‬‬ ‫‪E, et al. Comparative in vitro activities of linezolid, quinupristin‬‬‫‪dalfopristin, moxifloxacin, and trovafloxacin against erythromycin‬‬‫‪susceptible and -resistant streptococci. Antimicrob Agents‬‬ ‫‪Chemother 2000;44(7):1838-41.‬‬ ‫‪3. Cunningham MW. Pathogenesis of group A streptococcal‬‬ ‫‪infections. Clin Microbiol Rev 2000;13(3):470-511.‬‬ ‫‪4. Arnold PD, Richter MA. Is obsessive-compulsive disorder an‬‬ ‫‪autoimmune disease? CMAJ 2001;165(10):1353-8.‬‬ ‫‪5. Swedo SE, Garvey M, Snider L, Hamilton C, Leonard HL. The‬‬ ‫‪PANDAS subgroup: recognition and treatment. CNS Spectr‬‬ ‫‪2001;6(5):419-22, 425-6.‬‬ ‫‪6. Bryńska A, Wolańczyk T. Pediatric autoimmune neuropsychiatric‬‬ ‫‪disorders associated with streptococcal infections (PANDAS). A‬‬ ‫‪report of two cases. Psychiatr Pol 2004;38(1):105-23.‬‬

‫‪16‬‬

‫ﭘﺎﻧﺪاس ارﺗﺒﺎط ﺑﺎ ﻋﻔﻮﻧﺖ اﺳﺘﺮﭘﺘﻮﻛﻮك را ﻧﺸﺎن داد‪.‬‬

‫ﻋﻔﻮﻧﺖ اﺳﺘﺮﭘﺘﻮﻛﻮك و ﭘﺎﻧﺪاس اﻧﺠﺎم ﺷﻮد‪ 13.‬آﺧﺮﻳﻦ ﻣﻘﺎﻟﻪ‬

‫در ﺷﻴﻜﺎﮔﻮ ﻧﺸﺎن داد در ﻣﻄﺎﻟﻌﻪ ﻛﻮﻫﻮرت ﺑﻴﺸﺘﺮ از ‪ %85‬ﺗﻴﻚ و‬ ‫ﺑﻴﻦ اﺳﺘﺮﭘﺘﻮﻛﻮك ﮔﺮوه‬

‫‪A‬‬

‫‪18‬و‪11‬و‪10‬‬

‫ﺑﻬﺒﻮد ﻋﻼﻳﻢ ﭘﺎﻧﺪاس ﻛﺮدهاﻧﺪ‪.‬‬

‫ﻣﺒﺘﻼ ﺑﻪ ﭘﺎﻧﺪاس ﺳﻮد ﻣﺨﺘﺼﺮي از اﻳﻦ درﻣﺎنﻫﺎ ﺧﻮاﻫﻨﺪ داﺷﺖ‪.‬‬ ‫‪11‬‬

‫‪ Garvey‬درﻣﺎن ﭘﺮوﻓﻴﻼﻛﺴﻲ را ﺗﺎﻳﻴﺪ ﻛﺮد‪.‬‬

‫‪References‬‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬


539

Role of group A beta hemolytic streptococcal infections in tic and tourett's disorders ‫ﻫﻤﻜﺎران‬ ‫و‬

neuropsychiatric exacerbations triggered by streptococcal infections. Biol Psychiatry 1999;45(12):1564-71. 12. Saadat AR. GABHS infection: A cause for Obsessive-Compulsive Disorder (OCD) and Tic in children. Book of Abstract: Annual Congress of Iranian Society of Pediatrics Infectious Disease. Iran: Shiraz, 2003. [Persian] 13. Morer A, Lázaro L, Sabater L, Massana J, Castro J, Graus F. Antineuronal antibodies in a group of children with obsessivecompulsive disorder and Tourette syndrome. J Psychiatr Res 2008;42(1):64-8. 14. ReferencesLoiselle CR, Wendlandt JT, Rohde CA, Singer HS. Antistreptococcal, neuronal, and nuclear antibodies in Tourette syndrome. Pediatr Neurol 2003;28(2):119-25. 15. Loiselle CR, Wendlandt JT, Rohde CA, Singer HS. Antistreptococcal, neuronal, and nuclear antibodies in Tourette syndrome. Pediatr Neurol 2003;28(2):119-25. 16. Mabrouk AA, Eapen V. Challenges in the identification and treatment of PANDAS: a case series. J Trop Pediatr 2009;55(1):468. 17. Shulman ST. Pediatric autoimmune neuropsychiatric disorders associated with streptococci (PANDAS): update. Curr Opin Pediatr 2009;21(1):127-30. 18. Batuecas Caletrío A, Sánchez González F, Santa Cruz Ruiz S, Santos Gorjón P, Blanco Pérez P.PANDAS Syndrome: a new tonsillectomy indication? Acta Otorrinolaringol Esp 2008;59(7):362-3. 19. Mell LK, Davis RL, Owens D. Association between streptococcal infection and obsessive-compulsive disorder, Tourette's syndrome, and tic disorder. Pediatrics 2005;116(1):56-60. 20. Rizzo R, Gulisano M, Pavone P, Fogliani F, Robertson MM. Increased antistreptococcal antibody titers and anti-basal ganglia

1389 ‫ آذر‬،9 ‫ ﺷﻤﺎره‬، 68 ‫ دوره‬،‫ داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‬،‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‬

100

antibodies in patients with Tourette syndrome: controlled crosssectional study. J Child Neurol 2006;21(9):747-53. 21. Müller N, Riedel M, Straube A, Günther W, Wilske B. Increased anti-streptococcal antibodies in patients with Tourette's syndrome. Psychiatry Res 2000;94(1):43-9. 22. Leonard HL, Swedo SE. Paediatric autoimmune neuropsychiatric disorders associated with streptococcal infection (PANDAS). Int J Neuropsychopharmacol 2001;4(2):191-8. 23. Noorbakhsh S, Rahbarimanesh AA, Siadati SA. Culture of children with pharyngitis with healthy children 1370-1373 in survey of antibiotic resistance pattern in hospitalized patients: thesis for pediatrics infection disease. Iran: Tehran Med Sci 1378-1379. [Persian] 24. Sadegh E, Obodi B. Pharyngitis in children: value of rapid strep antigen In DX of GABHS pharyngitis. Book of Abstract: The Annual Congress of Iranian Society of Pediatrics Infectious Disease. Iran: Shiraz, 2006. [Persian] 25. Kohan J, Panjeshahin, Sadegh E. Determination the pattern of antibiotic sensitivity for GABHS and S. Pneuomnia. Book of Abstract: Annual Congress of Iranian Society of Pediatrics Infectious Disease. Iran: Shiraz, 2006. [Persian] 26. Noorbakhsh S, Tabatabaei A, Barati M, Ebrahimi T. Comparsion between culture and rapid test for diagnosis of GABHS in children. Book of Abstract: Annual Congress of Iranian Society of Pediatrics Infectious Disease. Iran: Shiraz, 2008. [Persian]


Tehran University Medical Journal; Vol. 68, No. 9, Dec 2010: 534-540

The role of group A beta hemolytic streptococcal infections in patients with tic and tourett's disorders

Samileh Noorbakhsh MD.1* Behrooz Jalili MD.2 Ahmad Reza Shamshiri MD.3 Elham Shirazi MD.2 Azardokht Tabatabaei MSc.4 Reza Taghipour MD.5 Ahmad Modares Fathi MD.6 1- Department of Pediatric Infectious Disease, Research Center of Pediatric Infectious Diseases, Iran University of Medical Sciences, Tehran, Iran. 2- Department of Pediatric Psychology , Research Center of Pediatric Infectious Diseases, Iran University of Medical Sciences, Tehran, Iran. 3- Department of Epidemiology and Biostatistics, School of Public Health, Tehran University of Medical Sciences, Tehran, Iran. 4- Department of Microbiology, Research Center of Pediatric Infectious Diseases, Iran University of Medical Sciences, Tehran, Iran. 5- Department of Pediatrics, Research Center of Pediatric Infectious Diseases, Iran University of Medical Sciences, Tehran, Iran. 6- Department of Pediatrics, Iran University of Medical Sciences, Tehran, Iran.

Abstract

Received: September 21, 2010 Accepted: October 20, 2010

Background: Recently, many cases diagnosed as pediatric autoimmune neuropsychiatric disorders associated with group A beta hemolytic streptococcus infection (PANDAS) due to production of autoimmune antibodies. Object of this study was comparison the titer of antibodies against group A beta hemolytic streptococcus (ASOT, Anti-DNase B, and Anti streptokinase) between children with movement disorders (tic and tourett’s disorders; pediatric autoimmune psychiatric disorders) and healthy control. Methods: A cross sectional/ cases control study in pediatric neuropsychology ward and clinics in two referral hospitals (Rasoul & Aliasghar) affiliated by IUMS had done in Tehran, Iran (2008-2010). We selected 53 children with tic disorder and 76 healthy controls (age matched children). The antibody titers (IU/ml) in their area were compared and analyzed statistically. The area under ROC, sensitivity, specificity and positive predictive value of tests calculated. Results: Age of cases was between 4-16 years. All antibody titers had significant difference between two groups (p<0.0001; p=0.05; p=0.002 for ASOT, Anti-DNase and Antihyaloronidase respectively). ASOT (cut off level> 200IU/ml) had 75% sensitivity; 84% specificity and 80% PPV; Anti- streptokinase (cut off level> 332IU/ml) had 34% sensitivity; 85% specificity, and 90% PPV; Anti-DNase (cut off level> 140IU/ml) had 70% sensitivity; 99% specificity and PPV 90%. Conclusion: Patients with tic disorder had a significant high antibody titer against streptococcal infection in comparison with healthy children. It presents possible role for streptococcal infection in tic disorders. Treatment of streptococcal infection is achievable by using of long acting Penicillin in our country. Use of aggressive treatment like plasmaphresis etc needs future RCT studies. Keywords: Group A streptococcus, Pediatric Autoimmune Neuropsychiatric Disorders Associated with Streptococcal infection (PANDAS), tic disorders, tourett’s syndrome.

*

Corresponding author: Research Center of Pediatric Infectious Diseases, 4th Floor Hazrat Rasul Hospital, Niayesh St., Satarkhan Ave., Tehran, 14455 Iran. Tel: +98-21-66525328 email: Samileh_noorbakhsh@yahoo.com

1389 ‫ آذر‬،9 ‫ ﺷﻤﺎره‬، 68 ‫ دوره‬،‫ داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‬،‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‬


‫ﻫﻮرﻣﻮﻧﻲ‬ ‫ﮔﻴﺮﻧﺪه‬ ‫ﻣﺮﺣﻠﻪ‬ ‫اﻧﺪوﻣﺘﺮ‬ ‫آدﻧﻮﻛﺎرﺳﻴﻨﻮم‬ ‫درﻣﺎن‬ ‫اﺳﺘﺎت در‬ ‫ﻣﮋﺳﺘﺮول‬ ‫ﻫﺎي ‪541-546‬‬ ‫‪،1389‬‬ ‫ارﺗﺒﺎط‪،9‬ﺑﺎ آذر‬ ‫‪، Ia‬وﺷﻤﺎره‬ ‫‪68, G1‬‬ ‫دوره‬ ‫ﺗﻬﺮان‪،‬‬ ‫ﭘﺰﺷﻜﻲ‬ ‫داﻧﺸﮕﺎه ﻋﻠﻮم‬ ‫ﭘﺰﺷﻜﻲ‪،‬‬ ‫داﻧﺸﻜﺪه‬ ‫ﻣﺠﻠﻪ‬

‫ﻧﻘﺶ ﮔﻴﺮﻧﺪهﻫﺎي ﻫﻮرﻣﻮﻧﻲ اﺳﺘﺮوژن و ﭘﺮوژﺳﺘﺮون در درﻣﺎن ﻛﻨﺴﺮواﺗﻴﻮ آدﻧﻮﻛﺎرﺳﻴﻨﻮم ﺧﻮب ﺗﻤﺎﻳﺰﻳﺎﻓﺘﻪ‬ ‫اﻧﺪوﻣﺘﺮ ﻣﺮﺣﻠﻪ ‪ Ia‬ﺑﺎ ﻣﮋﺳﺘﺮول اﺳﺘﺎت‬

‫ﺗﺎرﻳﺦ درﻳﺎﻓﺖ ﻣﻘﺎﻟﻪ‪ 1389/04/23 :‬ﺗﺎرﻳﺦ ﭘﺬﻳﺮش‪1389/07/28 :‬‬

‫ﭼﻜﻴﺪه‬

‫‪1‬‬

‫ﻓﺮﻳﺒﺎ ﻳﺎرﻧﺪي‪ ،1‬اﻟﻬﺎم ﺷﻴﺮﻋﻠﻲ‬

‫زﻣﻴﻨﻪ و ﻫﺪف‪ :‬ﺟﺮاﺣﻲ درﻣﺎن ﻣﻮﺛﺮ و اﺻﻠﻲ در ﻣﺮاﺣﻞ اوﻟﻴﻪ ﺑﻴﻤﺎري ﻛﺎرﺳﻴﻨﻮم اﻧﺪوﻣﺘﺮ اﺳﺖ وﻟﻲ درﺻﻮرت ﺿﺮورت‬

‫‪*2‬‬

‫زﻫﺮا اﻓﺘﺨﺎر‪ ،1‬زﻫﺮا ﺧﺰاﻋﻲﭘﻮر‬

‫ﺣﻔﻆ ﺑﺎروري‪ ،‬درﻣﺎنﻫﺎي ﻫﻮرﻣﻮﻧﻲ )ﭘﺮوژﺳﺘﻴﻦﻫﺎ( ﺑﺮرﺳﻲ ﺷﺪهاﺳﺖ‪ .‬ﻫﺪف اﻳﻦ ﻣﻄﺎﻟﻌﻪ ﺑﺮرﺳﻲ اﺛﺮ ﻣﮋﺳﺘﺮول اﺳﺘﺎت‬ ‫‪ -1‬ﮔﺮوه زﻧﺎن و ﻣﺎﻣﺎﻳﻲ‪ ،‬ﺑﻴﻤﺎرﺳﺘﺎن زﻧﺎن )ﻣﻴﺮزا‬

‫در درﻣﺎن آدﻧﻮﻛﺎرﺳﻴﻨﻮم اﻧﺪوﻣﺘﺮ و ارﺗﺒﺎط آن ﺑﺎ ﮔﻴﺮﻧﺪه ﻫﻮرﻣﻮﻧﻲ ﻣﻲﺑﺎﺷﺪ‪ .‬روش ﺑﺮرﺳﻲ‪ :‬ﻣﻄﺎﻟﻌﻪ از ﻧﻮع ﻣﺪاﺧﻠﻪاي‬

‫ﻛﻮﭼﻚﺧﺎن(‬

‫ﺑﺪون ﺷﺎﻫﺪ در ‪ 16‬ﺧﺎﻧﻢ ﺳﻨﻴﻦ ﻗﺒﻞ از ﻳﺎﺋﺴﮕﻲ ﺑﺎ ﭘﺎﺗﻮﻟﻮژي آدﻧﻮﻛﺎرﺳﻴﻨﻮم ﺧﻮب ﺗﻤﺎﻳﺰ ﻳﺎﻓﺘﻪ ﻣﺮﺣﻠﻪ ‪ I‬ﻣﺮاﺟﻌﻪﻛﻨﻨﺪه ﺑﻪ‬

‫‪ -2‬ﻣﺘﺨﺼﺺ ﭘﺰﺷﻜﻲ اﺟﺘﻤﺎﻋﻲ‪ ،‬ﺣﻮزه ﭘﮋوﻫﺸﻲ‬ ‫ﻣﺠﺘﻤﻊ ﺑﻴﻤﺎرﺳﺘﺎن اﻣﺎم ﺧﻤﻴﻨﻲ )ره(‬

‫ﺑﻴﻤﺎرﺳﺘﺎن زﻧﺎن )ﻣﻴﺮزا ﻛﻮﭼﻚﺧﺎن(‪ ،‬در ﻓﺎﺻﻠﻪ ﺳﺎلﻫﺎي ‪ 1378-88‬اﺳﺖ‪ .‬درﻣﺎن ﺑﺎ ‪ 160mg/d‬ﻣﮋﺳﺘﺮول اﺳﺘﺎت ﺷﺮوع‬ ‫ﺷﺪ‪ .‬ﺳﭙﺲ ﺑﺎ ‪ 320mg/d‬در اﻓﺮادي ﻛﻪ ﺑﻪدرﻣﺎن ﭘﺎﺳﺦ ﻧﺪادﻧﺪ اداﻣﻪ ﻳﺎﻓﺖ‪ .‬ﺑﻴﻤﺎران ﺑﺎ ﻛﻮرﺗﺎژ ﺗﺸﺨﻴﺼﻲ و ﻫﻴﺴﺘﺮوﺳﻜﻮﭘﻲ‬ ‫ﭘﻲﮔﻴﺮي ﺷﺪﻧﺪ‪ .‬ﺑﻴﻤﺎراﻧﻲ ﻛﻪ ﺑﻪ درﻣﺎن ﭘﺎﺳﺦ دادﻧﺪ‪ ،‬ﺟﻬﺖ ‪ IVF‬ﻣﻌﺮﻓﻲ و ﺳﻪ ﻣﺎه ﭘﻲﮔﻴﺮي ﺷﺪﻧﺪ‪ .‬ﻳﺎﻓﺘﻪﻫﺎ‪ :‬از ‪ 9‬ﺑﻴﻤﺎري‬

‫داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬ﺗﻬﺮان‪ ،‬اﻳﺮان‪.‬‬

‫ﻛﻪ از ﻓﺎز اول ﻣﻄﺎﻟﻌﻪ ﭘﻲﮔﻴﺮي ﺷﺪﻧﺪ‪ ،‬ﭼﻬﺎر ﻣﻮرد )‪ (%25‬ﺣﺎﻣﻠﻪ و در ﻧﻬﺎﻳﺖ ﻫﺸﺖ ﺑﻴﻤﺎر ﻫﻴﺴﺘﺮﻛﺘﻮﻣﻲ ﻫﻤﺮاه ﺑﺎ‬ ‫ﺑﺮداﺷﺘﻦ دو ﻃﺮﻓﻪ ﺗﺨﻤﺪان ﺷﺪﻧﺪ و ﺗﻨﻬﺎ ﻳﻚ ﺑﻴﻤﺎر ﺗﺤﺖ درﻣﺎن ﻣﺠﺪد اﺳﺖ و از ﻫﻔﺖ ﺑﻴﻤﺎري ﻛﻪ از ﻓﺎز دوم ﻣﻄﺎﻟﻌﻪ‬ ‫ﭘﻲﮔﻴﺮي ﺷﺪﻧﺪ‪ ،‬ﭘﻨﺞ ﺑﻴﻤﺎر ﺗﺤﺖ درﻣﺎن )ﺳﻪ ﻧﻔﺮ ﻣﻌﺮﻓﻲ ﺑﻪ ‪ IVF‬و دو ﻧﻔﺮ درﻣﺎن ﻣﺮﺣﻠﻪ دوم(‪ ،‬ﻳﻚ ﺑﻴﻤﺎر ﻫﻴﺴﺘﺮﻛﺘﻮﻣﻲ‬ ‫ﻫﻤﺮاه ﺑﺎ ﺑﺮداﺷﺘﻦ دو ﻃﺮﻓﻪ ﺗﺨﻤﺪان ﺷﺪ و ﻳﻚ ﺑﻴﻤﺎر ﺑﻪدﻟﻴﻞ ﻧﺎزاﻳﻲ ﻫﻤﺴﺮ از ﻣﻄﺎﻟﻌﻪ ﺧﺎرج ﺷﺪه اﺳﺖ‪ .‬ﻫﻤﻪ ﻣﻮارد‬ ‫ﮔﻴﺮﻧﺪه ﭘﺮوژﺳﺘﺮون داﺷﺘﻨﺪ‪ .‬ﺗﻨﻬﺎ ﻳﻚ ﻣﻮرد ﮔﻴﺮﻧﺪه اﺳﺘﺮوژن ﻣﻨﻔﻲ ﺑﻮد‪ .‬ﻧﺘﻴﺠﻪﮔﻴﺮي‪ :‬اﺳﺘﻔﺎده از درﻣﺎن ﺑﺎ ﭘﺮوژﺳﺘﻴﻦ ﺑﺮاي‬ ‫*‬

‫درﻣﺎن ﺳﺮﻃﺎن اﻧﺪوﻣﺘﺮ ﺧﻮب ﺗﻤﺎﻳﺰﻳﺎﻓﺘﻪ اوﻟﻴﻪ ﺑﺎﻳﺪ ﺑﺎ اﺣﺘﻴﺎط ﺻﻮرت ﮔﻴﺮد و ﻧﻴﺎز ﺑﻪ ﺑﺮرﺳﻲ ﺑﺴﻴﺎر دﻗﻴﻖ ﺑﺎﻟﻴﻨﻲ ﭘﻴﺶ و‬ ‫ﻧﻮﻳﺴﻨﺪه ﻣﺴﺌﻮل‪ :‬ﺗﻬﺮان‪ ،‬ﺣﻮزه ﭘﮋوﻫﺸﻲ ﻣﺠﺘﻤﻊ‬

‫ﺑﻴﻤﺎرﺳﺘﺎﻧﻲ اﻣﺎم ﺧﻤﻴﻨﻲ)ره(‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‬

‫ﭘﺲ از درﻣﺎن دارد‪ .‬ﺑﺮرﺳﻲ اﺛﺮ ﮔﻴﺮﻧﺪهﻫﺎ در ﭘﺎﺳﺦ ﺑﻪ درﻣﺎن‪ ،‬ﻧﻴﺎز ﺑﻪ ﻣﻄﺎﻟﻌﺎت ﺑﻴﺸﺘﺮ ﺑﺎ ﺣﺠﻢ ﻧﻤﻮﻧﻪ ﺑﺎﻻﺗﺮ دارد‪.‬‬

‫ﺗﻠﻔﻦ‪0912-5146752 :‬‬ ‫‪email: khazaeipour@razi.tums.ac.ir‬‬

‫ﻛﻠﻤﺎت ﻛﻠﻴﺪي‪ :‬آدﻧﻮﻛﺎرﺳﻴﻨﻮﻣﺎي اﻧﺪوﻣﺘﺮ‪ ،‬ﺧﻮب ﺗﻤﺎﻳﺰﻳﺎﻓﺘﻪ‪ ،‬ﻣﮋﺳﺘﺮول اﺳﺘﺎت‪ ،‬ﮔﻴﺮﻧﺪه ﭘﺮوژﺳﺘﺮون‪ ،‬ﮔﻴﺮﻧﺪه اﺳﺘﺮوژن‪.‬‬

‫ﻣﻘﺪﻣﻪ‬

‫درﻣﺎن در ﺧﺎﻧﻢﻫﺎﻳﻲ ﻛﻪ ﺑﺎروري ﻧﺪاﺷﺘﻪ و ﻳﺎ در اﻓﺮاديﻛﻪ ﺗﺤﻤﻞ ﻋﻤﻞ‬ ‫‪2‬‬

‫ﺳﺮﻃﺎن اﻧﺪوﻣﺘﺮ )‪ (Endometrial cancer‬ﺿﺎﻳﻌﻪاي اﺳﺖ ﻛﻪ ﻋﻤﺪﺗﺎً در‬

‫ﺟﺮاﺣﻲ را ﻧﺪارﻧﺪ ﻗﺎﺑﻞ ﻗﺒﻮل ﻧﻴﺴﺖ‪ .‬در ﺣﺎل ﺣﺎﺿﺮ ﻧﻴﺰ ﺑﺎ ﺑﺎﻻ رﻓﺘﻦ‬

‫دوران ﺑﻌﺪ از ﻳﺎﺋﺴﮕﻲ رخ ﻣﻲدﻫﺪ و ﺑﻴﻤﺎريزاﻳﻲ آن ﺑﺎ ﺑﺎﻻ رﻓﺘﻦ ﺳﻦ‬

‫ﺳﻦ ازدواج‪ ،‬ﺑﻴﻤﺎران ﺑﻴﺸﺘﺮي ﻫﺴﺘﻨﺪ ﻛﻪ ﺑﺎ وﺟﻮد ﺳﺮﻃﺎن اﻧﺪوﻣﺘﺮ‪،‬‬

‫اﻓﺰاﻳﺶ ﻣﻲﻳﺎﺑﺪ‪ 1.‬ﺗﻘﺮﻳﺒﺎً ‪ %5‬ﺧﺎﻧﻢﻫﺎ ﻗﺒﻞ از ‪ 40‬ﺳﺎﻟﮕﻲ و ‪ %20-25‬ﻗﺒﻞ‬

‫ﺗﻤﺎﻳﻞ ﺑﻪ ﺣﻔﻆ ﺑﺎروري دارﻧﺪ‪ .‬ﻫﺮ ﭼﻨﺪ ﺟﺮاﺣﻲ درﻣﺎن ﻣﻮﺛﺮ و اﺻﻠﻲ در‬

‫ﻧﻘﺶ اﺳﺘﺮوژن در اﻳﺠﺎد اﻛﺜﺮ‬

‫ﻣﺮاﺣﻞ اوﻟﻴﻪ ﺑﻴﻤﺎري ﻣﻲﺑﺎﺷﺪ ﻟﻴﻜﻦ در ﺻﻮرت ﺿﺮورت ﺣﻔﻆ ﺑﺎروري‬

‫ﺳﺮﻃﺎنﻫﺎي اﻧﺪوﻣﺘﺮ ﺑﻪ ﺧﻮﺑﻲ ﺑﻪ اﺛﺒﺎت رﺳﻴﺪه اﺳﺖ و ﻫﺮ ﻋﺎﻣﻠﻲ ﻛﻪ‬

‫ﻣﻲﺗﻮان درﻣﺎنﻫﺎي ﻫﻮرﻣﻮﻧﻲ را ﺟﺎﻳﮕﺰﻳﻦ ﻧﻤﻮد‪ .‬درﻣﺎن ﻣﻮﻓﻖ ﻫﻮرﻣﻮﻧﻲ‬

‫ﺗﻤﺎس ﺑﺎ اﺳﺘﺮوژن را اﻓﺰاﻳﺶ دﻫﺪ )ﻧﻮﻟﻲ ﭘﺎرﻳﺘﻲ‪ ،‬ﻧﺎﺑﺎروري‪ ،‬ﺳﺎﺑﻘﻪ‬

‫)ﭘﺮوژﺳﺘﻴﻦﻫﺎ( ﺑﺮاي ﻣﺮاﺣﻞ اوﻟﻴﻪ ﺳﺮﻃﺎن اﻧﺪوﻣﺘﺮ ﻣﻮرد اﺳﺘﻔﺎده ﻗﺮار‬

‫ﻗﺎﻋﺪﮔﻲﻫﺎي ﻧﺎﻣﻨﻈﻢ‪ ،‬ﺳﻴﻜﻞﻫﺎي ﺑﺪون ﺗﺨﻤﻚﮔﺬاري‪ ،‬ﭼﺎﻗﻲ‪ ،‬ﺳﻨﺪرم‬

‫ﻣﻲﮔﻴﺮد‪ .‬ﻣﺪت ﭘﻲﮔﻴﺮي ﭘﺲ از درﻣﺎن ﺑﺮاي اﻳﻦ ﻣﻮارد ﻣﺘﻐﻴﺮ ﺑﻮده و‬

‫درﻣﺎن‬

‫اﺗﻔﺎق ﻧﻈﺮ در اﻳﻦ ﻣﻮارد وﺟﻮد ﻧﺪارد‪ .‬ﻃﺒﻖ ﮔﺰارشﻫﺎي ﻣﺘﻌﺪد‪ ،‬ﻧﺸﺎن‬

‫اﻧﺘﺨﺎﺑﻲ در ﺳﺮﻃﺎن اﻧﺪوﻣﺘﺮ ﻫﻴﺴﺘﺮﻛﺘﻮﻣﻲ و ﺑﺮداﺷﺘﻦ ﺗﺨﻤﺪانﻫﺎ و‬

‫داده ﺷﺪه اﺳﺖ ﻛﻪ ﺑﻴﻤﺎران ﺑﺎ درﺟﻪ ﭘﺎﻳﻴﻦ اﺑﺘﻼ ﺑﻪ ﺳﺮﻃﺎن اﻧﺪوﻣﺘﺮ‬

‫ﺑﺮداﺷﺘﻦ ﻏﺪد ﻟﻨﻔﺎوي ﻟﮕﻨﻲ و ﭘﺎراآﺋﻮرﺗﻴﻚ و ﺳﻴﺘﻮﻟﻮژي ﭘﺮﻳﺘﻮان‬

‫ﺑﻪﻃﻮر ﻣﺤﺎﻓﻈﻪﻛﺎراﻧﻪ ﺑﺎ ﻫﻮرﻣﻮن درﻣﺎن ﻣﻲﺷﻮﻧﺪ و ﻣﻴﺰان ﭘﺎﺳﺦ ﺑﻪ‬

‫ﻣﻲﺑﺎﺷﺪ‪ .‬درﻣـﺎنﻫﺎي ﻣﻜﻤﻞ ﺑﺴﺘـﮕﻲ ﺑﻪ ﻣﺮﺣﻠﻪﺑﻨـﺪي آن دارد‪ .‬اﻣـﺎ اﻳﻦ‬

‫درﻣﺎن ﻫﻮرﻣﻮﻧﻲ ﺑﺎ اﻓﺰاﻳﺶ ﺗﻤﺎﻳﺰ ﺗﻮﻣﻮر اﻓﺰاﻳﺶ ﻣﻲﻳﺎﺑﺪ و ﺑﻘﺎ ﺑﻴﻤﺎر‬

‫‪3‬و‪2‬‬

‫از ﻳﺎﺋﺴﮕﻲ ﺗﺸﺨﻴﺺ داده ﻣﻲﺷﻮﻧﺪ‪.‬‬

‫‪4‬و‪3‬‬

‫ﺗﺨﻤﺪان ﭘﻠﻲ ﻛﻴﺴﺘﻴﻚ( ﺑﺮ ﺧﻄﺮ ﺳﺮﻃﺎن اﻧﺪوﻣﺘﺮ ﻣﻲاﻓﺰاﻳﺪ‪.‬‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬


‫ﻓﺮﻳﺒﺎ ﻳﺎرﻧﺪي و ﻫﻤﻜﺎران‬

‫‪542‬‬

‫واﺑﺴﺘﻪ ﺑﻪ درﺟﻪ ﺗﻤﺎﻳﺰ ﺗﻮﻣﻮر ﻣﻲﺑﺎﺷﺪ‪ 2.‬ﺗﻘﺮﻳﺒﺎً ‪ %70‬ﻛﺎرﺳﻴﻨﻮم اﻧﺪوﻣﺘﺮ‪،‬‬

‫)‪(FD&C‬‬

‫ﺗﻐﻴﻴﺮات ﻣﻮرﻓﻮﻟﻮژﻳﻚ در ﭘﺎﺳﺦ ﺑﻪ درﻣﺎن ﺑﺎ ﭘﺮوژﺳﺘﻴﻦﻫﺎ دارﻧﺪ‪ .‬ﻳﻜﻲ از‬

‫ﭘﺎﺗﻮﻟﻮژي آدﻧﻮﻛﺎرﺳﻴﻨﻮم ﺧﻮب ﺗﻤﺎﻳﺰﻳﺎﻓﺘﻪ اﻧﺪوﻣﺘﺮ ﻣﺮﺣﻠﻪ ‪ Ia‬وارد‬

‫دﻻﻳﻞ اوﻟﻴﻪ ﺑﺮاي اﻳﻦ ﭘﺎﺳﺦ ﺣﻀﻮر ﮔﻴﺮﻧﺪهﻫﺎي ﭘﺮوژﺳﺘﺮون در ﺳﻄﺢ‬

‫ﻣﻄﺎﻟﻌﻪ ﺷﺪﻧﺪ‪ .‬ﺑﻴﻤﺎران ﺑﻴﺶ از ﻣﺮﺣﻠﻪ ‪ ،Ia‬ﺑﻴﻤﺎري ﻣﺘﺎﺳﺘﺎﺗﻴﻚ‪ ،‬ﮔﺮﻳﺪ دو‬

‫ﺳﻠﻮلﻫﺎي ﺳﺮﻃﺎﻧﻲ ﻣﻲﺑﺎﺷﺪ‪6.‬و‪ 5‬ﺑﻪﻃﻮر ﻛﻠﻲ اﺛﺮ ﭘﺮوژﺳﺘﻴﻦﻫﺎ در ﺳﺮﻃﺎن‬

‫و ﺳﻪ‪ ،‬ﻧﺎﻣﺸﺨﺺ ﺑﻮدن درﺟﻪ ﺗﻮﻣﻮر‪ ،‬ﭘﺎﺗﻮﻟﻮژي ﻏﻴﺮ اﻧﺪوﻣﺘﺮﻳﻮﻳﻴﺪ‪،‬‬

‫اﻧﺪوﻣﺘﺮ ﺑﻪﻃﻮر اوﻟﻴﻪ ‪ 10‬ﻫﻔﺘﻪ ﺑﻌﺪ از ﺷﺮوع درﻣﺎن ﻇﺎﻫﺮ ﻣﻲﺷﻮد و‬

‫ﺳﺎﺑﻘﻪ رادﻳﻮﺗﺮاﭘﻲ‪ ،‬ﻛﻤﻮﺗﺮاﭘﻲ ﻳﺎ ﺟﺮاﺣﻲ و ﺳﺎﺑﻘﻪ درﻳﺎﻓﺖ روﺷﻲ ﻏﻴﺮ از‬

‫ﺗﻤﺎس اوﻟﻴﻪ ﺑﻪ دارو ﺑﺮاي ﺑﺮرﺳﻲ ﭘﺎﺳﺦ ﺑﻪ درﻣﺎن ﺑﺎﻳﺪ ﺣﺪاﻗﻞ ‪ 12‬ﻫﻔﺘﻪ‬

‫ﺧﻮراﻛﻲ ﻳﺎ درﻳﺎﻓﺖ داروي ﭘﺮوژﺳﺘﻴﻨﻲ ﻏﻴﺮ از ‪ Megace‬از ﻣﻄﺎﻟﻌﻪ‬

‫ﻣﻌﻤﻮﻻً ﺑﺮاي درﻣﺎن از ﻣﺪروﻛﺴﻲ ﭘﺮوژﺳﺘﺮون اﺳﺘﺎت ﻳﺎ‬

‫ﺧﺎرج ﺷﺪﻧﺪ‪ .‬در ﺑﻴﻤﺎران ﻣﻮرد ﻣﻄﺎﻟﻌﻪ‪ ،‬ﺳﻮﻧﻮﮔﺮاﻓﻲ اﺑﺪوﻣﻴﻨﺎل و واژﻳﻨﺎل‬

‫ﻣﮋﺳﺘﺮول اﺳﺘﺎت )دوز ‪ 160‬ﻣﻴﻠﻲﮔﺮم روزاﻧﻪ( ﺑﺮاي ﺳﻪ ﻣﺎه اﺳﺘﻔﺎده‬

‫ﺟﻬﺖ ﺗﻌﻴﻴﻦ ﺿﺨﺎﻣﺖ اﻧﺪوﻣﺘﺮ و اﺛﺒﺎت ﻋﺪم ﺗﻬﺎﺟﻢ ﺑﻪ ﻣﻴﻮﻣﺘﺮ‪ ،‬اﻧﺠﺎم و‬

‫ﺑﺎﺷﺪ‪.‬‬

‫‪5-7‬‬

‫‪7‬و‪4‬‬

‫ﻣﻲﺷﻮد‪.‬‬

‫ﺑﻌﺪ از ﺳﻪ ﻣﺎه ﺑﺮاي ﺑﺮرﺳﻲ ﭘﺎﺳﺦ ﺑﻪ درﻣﺎن ﻛﻮرﺗﺎژ‬

‫‪D&C‬‬

‫‪ Fractional Dilatation & Curettage‬ﺷﺪﻧﺪ‪ .‬ﺑﻴﻤﺎران ﺑﺎ‬

‫ﻫﻤﭽﻨﻴﻦ ﺳﻄﺢ‬

‫‪CA125‬‬

‫ﺳﺮم اﻧﺪازهﮔﻴﺮي ﺷﺪ‪ .‬ﭘﺲ از اﺧﺬ رﺿﺎﻳﺖ‬ ‫‪(Apo- Megestrol‬‬

‫اﻧﺠﺎم ﻣﻲﺷﻮد‪ .‬ﻃﻮل ﻣﺘﻮﺳﻂ درﻣﺎن ﺑﺮاي رﺳﻴﺪن ﺑﻪ ﭘﺎﺳﺦ ﺣﺪود ﺷﺶ‬

‫ﻛﺘﺒﻲ از ﺑﻴﻤﺎران‪ ،‬درﻣﺎن ﺑﺎ ﻣﮋﺳﺘﺮول اﺳﺘﺎت‬

‫ﻣﺎه اﺳﺖ )‪ 3-12‬ﻣﺎه(‪ .‬در ﻳﻚ ﻣﻘﺎﻟﻪ ﻣﺮوري )‪ 62(%76‬ﺑﻴﻤﺎر ﺑﻪ درﻣﺎن‬

‫)‪ Canada‬ﺑﺎ دوز ‪ 160‬ﻣﻴﻠﻲﮔﺮم روزاﻧﻪ ﺷﺮوع ﺷﺪ‪ .‬ﭘﺲ از ﺳﻪ ﻣﺎه‪،‬‬

‫ﻫﻮرﻣﻮﻧﻲ ﭘﺎﺳﺦ دادهاﻧﺪ‪ .‬ﻣﻴﺎﻧﻪ زﻣﺎن ﭘﺎﺳﺦ ‪ 12‬ﻫﻔﺘﻪ ﺑﻮده اﺳﺖ )داﻣﻨﻪ‪،‬‬

‫‪FD&C‬‬

‫‪ 4-60‬ﻫﻔﺘﻪ(‪ 2.‬ﻫﻤﻪ اﻳﻦ ﺑﻴﻤﺎران ﻓﻘﻂ ﻳﻚ دوره درﻣﺎن ﺷﺪهاﻧﺪ و‬

‫ﮔﺰارش ﭘﺎﺗﻮﻟﻮژي درﻣﺎن ﺳﻪ ﻣﺎه دﻳﮕﺮ ﺑﺎ ﻫﻤﺎن دوز اداﻣﻪ ﻣﻲﻳﺎﻓﺖ و‬

‫اﺣﺘﻴﺎﺟﻲ ﺑﻪ دوره دوم ﻧﺪاﺷﺘﻪاﻧﺪ‪ 15(%24) .‬ﺑﻴﻤﺎر ﻛﻪ در اﺑﺘﺪا ﺑﻪ درﻣﺎن‬

‫ﺑﻴﻤﺎر در ﮔﺮوه ﭘﺎﺳﺦ ﺑﻪ درﻣﺎن ﻗﺮار ﻣﻲﮔﺮﻓﺖ‪ .‬در ﺻﻮرت ﻋﺪم ﭘﺎﺳﺦ‬

‫ﭘﺎﺳﺦ داده ﺑﻮدﻧﺪ ﻋﻮد ﻛﺮدهاﻧﺪ ﻛﻪ ﻣﻴﺎﻧﻪ زﻣﺎن ﻋﻮد ‪ 19‬ﻣﺎه ﺑﻮده اﺳﺖ‬

‫ﺑﻪ درﻣﺎن ﭘﺲ از اﺧﺬ رﺿﺎﻳﺖ‪ ،‬دوز دارو دو ﺑﺮاﺑﺮ ﺷﺪه و در ﺻﻮرت‬

‫)داﻣﻨﻪ‪ 6-44 ،‬ﻫﻔﺘﻪ(‪ .‬از ‪ 15‬ﺑﻴﻤﺎر ﻛﻪ ﻋﻮد ﻛﺮدﻧﺪ )‪ 7(%47‬ﺑﻴﻤﺎر درﻣﺎن‬

‫ﭘﺎﺳﺦ ﺑﻪ درﻣﺎن ﻣﺠﺪداً ﺗﺎ ﺳﻪ ﻣﺎه دﻳﮕﺮ ﺑﺎ ﻫﻤﺎن دوز درﻣﺎن اداﻣﻪ‬

‫ﻫﻮرﻣﻮﻧﻲ ﻣﺠﺪد ﺷﺪﻧﺪ ﻛﻪ )‪ 5(%72‬ﺑﻴﻤﺎر ﺑﻪ درﻣﺎن ﭘﺎﺳﺦ دادﻧﺪ و ﺑﻘﻴﻪ‬

‫ﻣﻲﻳﺎﻓﺖ‪ .‬در ﺻﻮرت ﻋﺪم ﭘﺎﺳﺦ ﺑﺎ رﺿﺎﻳﺖ ﺑﻴﻤﺎر ﭘﺲ از اﻧﺠﺎم‬

‫‪MRI‬‬

‫ﻫﻴﺴﺘﺮﻛﺘﻮﻣﻲ ﺷﺪﻧﺪ‪ 2.‬درﻣﺎن ﻫﻮرﻣﻮﻧﻲ ﺳﺮﻃﺎن اﻧﺪوﻣﺘﺮ‪ ،‬ﺑﺎ ﺗﻮﺟﻪ ﺑﻪ‬

‫ﺳﻪ ﻣﺎه دﻳﮕﺮ ﺑﺎ دوز ‪ 320‬ﻣﻴﻠﻲﮔﺮم درﻣﺎن را اداﻣﻪ داده ﻳﺎ ﻫﻴﺴﺘﺮﻛﺘﻮﻣﻲ‬

‫ﺗﻌﻮﻳﻖ اﻧﺪاﺧﺘﻦ ﺟﺮاﺣﻲ ﻣﻲﺗﻮاﻧﺪ ﻋﻮارض ﻧﺎﻣﻄﻠﻮﺑﻲ ﺑﺮ ﺑﻴﻤﺎر داﺷﺘﻪ‬

‫ﺷﺪﻧﺪ‪ .‬اﻳﻦ اﻓﺮاد‪ ،‬در ﮔﺮوه ﻋﺪم ﭘﺎﺳﺦ ﺑﻪ درﻣﺎن ﻗﺮار ﮔﺮﻓﺘﻨﺪ‪ .‬درﻣﺎن‬

‫ﺑﺎﺷﺪ‪ .‬از ﺟﻤﻠﻪ اﻳﻦ ﻋﻮارض ﻣﻲﺗﻮان اﺣﺘﻤﺎل اﻳﺠﺎد ﺗﻮﻣﻮرﻫﺎي ﺗﺨﻤﺪان‬

‫ﻧﻬﺎﻳﻲ اﻳﻦ ﺑﻴﻤﺎران ﻫﻴﺴﺘﺮﻛﺘﻮﻣﻲ ﻣﻲﺑﺎﺷﺪ‪ .‬در دوز ‪ 320‬ﻣﻴﻠﻲﮔﺮم دارو‪،‬‬

‫و ﺗﻬﺎﺟﻢ ﺧﺎرج رﺣﻤﻲ ﺗﻮﻣﻮر را ذﻛﺮ ﻧﻤﻮد‪ 8.‬ﺑﻪﻫﻤﻴﻦدﻟﻴﻞ در اﻧﺘﺨﺎب‬

‫ﺟﻬﺖ ﺟﻠﻮﮔﻴﺮي از آﻣﺒﻮﻟﻲ‪ ،‬آﺳﭙﻴﺮﻳﻦ )ﭘﺎرس دارو‪ ،‬اﻳﺮان( ‪ 80‬ﻣﻴﻠﻲﮔﺮم‬

‫ﺑﻴﻤﺎران ﺑﺮاي اﻳﻦ ﻧﻮع درﻣﺎن دﻗﺖ ﻛﺎﻓﻲ ﻻزم اﺳﺖ‪ .‬ﻫﻮرﻣﻮن درﻣﺎﻧﻲ‬

‫در روز ﺗﺠﻮﻳﺰ ﻣﻲﺷﻮد‪ .‬ﻧﺘﻴﺠﻪ ﻫﻴﺴﺘﻮﭘﺎﺗﻮﻟﻮژﻳﻚ ﻧﻤﻮﻧﻪ ﻫﻴﺴﺘﺮوﺳﺘﻮﻣﻲ‬

‫در ﻛﺎﻧﺴﺮ اﻧﺪوﻣﺘﺮ ﺑﺮرﺳﻲ ﺷﺪه وﻟﻲ ﺗﺎﺛﻴﺮ ﮔﻴﺮﻧﺪهﻫﺎي ﻫﻮرﻣﻮﻧﻲ‬

‫ﺷﺪه ﺑﺎ ﭘﺎﺗﻮﻟﻮژي اوﻟﻴﻪ ﻣﻘﺎﻳﺴﻪ ﺷﺪه ﺗﺎ وﺟﻮد ﺑﺎﻗﻴﻤﺎﻧﺪه ﺗﻮﻣﻮر ﺛﺎﺑﺖ‬

‫و ﻫﻴﺴﺘﺮوﺳﻜﻮﭘﻲ اﻧﺠﺎم ﮔﺮﻓﺘﻪ‪ ،‬در ﺻﻮرت ﻃﺒﻴﻌﻲ ﺑﻮدن‬

‫‪IVF‬‬

‫ﻣﻌﺮﻓﻲ و از ﻧﻈﺮ‬

‫اﺳﺘﺮوژن و ﭘﺮوژﺳﺘﺮون در ﭘﺎﺳﺦ ﺑﻪ درﻣﺎن ﺑﻪ ﺧﻮﺑﻲ ﺑﺮرﺳﻲ ﻧﺸﺪه‬

‫ﺷﻮد‪ .‬ﺑﻴﻤﺎران ﮔﺮوه ﭘﺎﺳﺦ ﺑﻪ درﻣﺎن‪ ،‬ﺑﻪ ﺑﺨﺶ‬

‫اﺳﺖ‪ 4-8.‬در اﻳﺮان ﻧﻴﺰ ﻣﻄﺎﻟﻌﻪاي در اﻳﻦ ﻣﻮرد اﻧﺠﺎم ﻧﺸﺪه اﺳﺖ‪ .‬ﻫﺪف‬

‫اﺣﺘﻤﺎل ﺑﺎرداري ﺑﻌﺪي و ﺗﻮﻟﺪ ﻧﻮزاد زﻧﺪه ﺑﺮرﺳﻲ ﻣﻲﮔﺮدﻧﺪ‪ .‬ﻗﺒﻞ از‬

‫اﻳﻦ ﭘﮋوﻫﺶ‪ ،‬ﺑﺮرﺳﻲ اﺛﺮ ﻣﮋﺳﺘﺮول اﺳﺘﺎت در درﻣﺎن آدﻧﻮﻛﺎرﺳﻴﻨﻮم‬

‫درﻣﺎن ﻓﺮم رﺿﺎﻳﺖﻧﺎﻣﻪ از ﺑﻴﻤﺎر و ﻫﻤﺴﺮ ﺑﻴﻤﺎر ﮔﺮﻓﺘﻪ ﻣﻲﺷﻮد‪ .‬در اﻳﻦ‬

‫ﺧﻮب ﺗﻤﺎﻳﺰﻳﺎﻓﺘﻪ اﻧﺪوﻣﺘﺮ ﻣﺮﺣﻠﻪ ‪ Ia‬و ارﺗﺒﺎط آن ﺑﺎ ﮔﻴﺮﻧﺪهﻫﺎي‬

‫ﻃﺮح‪ ،‬ﺳﻦ ﺑﻴﻤﺎران ﻣﺒﺘﻼ‪ ،‬روش ﺗﺸﺨﻴﺼﻲ ارﺟﺢ‪ ،‬ﻣﺪت درﻣﺎن‪ ،‬زﻣﺎن‬

‫ﻫﻮرﻣﻮﻧﻲ اﺳﺘﺮوژن و ﭘﺮوژﺳﺘﺮون ﻣﻲﺑﺎﺷﺪ‪.‬‬

‫ﻋﻮد‪ ،‬درﺻﺪ ﻋﻮد‪ ،‬روش درﻣﺎن در ﻋﻮد ﺑﻴﻤﺎران‪ ،‬ﺗﺸﺨﻴﺺ ﻫﻴﺴﺘﻮﭘﺎﺗﻮ‪-‬‬ ‫ﻟﻮژﻳﻚ ﻧﻤﻮﻧﻪ ﻫﻴﺴﺘﺮوﺳﺘﻮﻣﻲ ﺷﺪه‪ ،‬اﺣﺘﻤﺎل ﺑﺎرداري در ﮔﺮوه ﭘﺎﺳﺦ ﺑﻪ‬

‫روش ﺑﺮرﺳﻲ‬

‫درﻣﺎن ﺑﺮرﺳﻲ ﻣﻲﮔﺮدد‪ .‬ﺑﺮرﺳﻲ ﮔﻴﺮﻧﺪهﻫﺎي اﺳﺘﺮوژن و ﭘﺮوژﺳﺘﺮون‬

‫ﻣﻄﺎﻟﻌﻪ از ﻧﻮع ﻣﺪاﺧﻠﻪاي ﺑﺪون ﺷﺎﻫﺪ )‪ (Quasiexperimental‬اﺳﺖ‬

‫ﺗﻮﺳﻂ ﻣﺘﺨﺼﺺ ﭘﺎﺗﻮﻟﻮژي در ﻧﻤﻮﻧﻪ ﭘﺎﺗﻮﻟﻮژي اﻧﺠﺎم ﺷﺪ‪ .‬اﻳﻦ ﺗﺤﻘﻴﻖ‬

‫ﻛﻪ در اداﻣﻪ ﻣﻄﺎﻟﻌﻪ ‪ Eftekhar‬اﻧﺠﺎم ﺷﺪ‪ 9.‬در ﺳﺎلﻫﺎي ‪ 1377-87‬در‬

‫ﺑﺎ در ﻧﻈﺮ ﮔﺮﻓﺘﻦ اﺻﻮل ﺑﻴﺎﻧﻴﻪ ﻫﻠﺴﻴﻨﻜﻲ و ﭼﻚ ﻟﻴﺴﺖ اﺧﻼق در‬

‫ﺑﻴﻤﺎرﺳﺘﺎن زﻧﺎن )ﻣﻴﺮزا ﻛﻮﭼﻚﺧﺎن( ﺗﻬﺮان ﺧﺎﻧﻢﻫﺎي ﺟﻮان ﺑﺎ‬

‫ﭘﮋوﻫﺶ اراﻳﻪ ﺷﺪه ﺗﻮﺳﻂ ﻣﻌﺎوﻧﺖ ﻣﺤﺘﺮم ﭘﮋوﻫﺶ داﻧﺸﮕﺎه ﻋﻠﻮم‬

‫ﺧﻮنرﻳﺰي ﻏﻴﺮ ﻃﺒﻴﻌﻲ رﺣﻤﻲ )‪،Abnormal Uterine Bleeding (AUB‬‬

‫ﭘﺰﺷﻜﻲ و ﺧﺪﻣﺎت ﺑﻬﺪاﺷﺘﻲ درﻣﺎﻧﻲ ﺗﻬﺮان ﺻﻮرت ﭘﺬﻳﺮﻓﺘﻪ اﺳﺖ‪.‬‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬


‫ﻣﮋﺳﺘﺮول اﺳﺘﺎت در درﻣﺎن آدﻧﻮﻛﺎرﺳﻴﻨﻮم اﻧﺪوﻣﺘﺮ ﻣﺮﺣﻠﻪ ‪ Ia, G1‬و ارﺗﺒﺎط ﺑﺎ ﮔﻴﺮﻧﺪهﻫﺎي ﻫﻮرﻣﻮﻧﻲ‬

‫اﻃﻼﻋﺎت ﺟﻤﻊآوري ﺷﺪه در ﺑﺮﻧﺎﻣﻪ ‪ SPSS‬وﻳﺮاﺳﺖ ‪ 16‬ﻣﻮرد ﺗﺠﺰﻳﻪ و‬ ‫‪Independent‬‬

‫ﺗﺤﻠﻴﻞ ﻗﺮار ﮔﺮﻓﺖ‪ .‬ﺑﺮاي ﻣﻘﺎﻳﺴﻪ دادهﻫﺎي ﻛﻤ‪‬ﻲ از‬ ‫‪2‬‬

‫‪ Sample t-test‬و ﺑﺮاي ﻣﻘﺎﻳﺴﻪ دادهﻫﺎي ﻛﻴﻔﻲ از آزﻣﻮن ‪ ‬اﺳﺘﻔﺎده ﺷﺪ‪.‬‬ ‫ﻣﻘﺎدﻳﺮ ‪ p<0/05‬از ﻧﻈﺮ آﻣﺎري ﻣﻌﻨﻲدار ﺗﻠﻘﻲ ﮔﺮدﻳﺪ‪.‬‬ ‫ﻣﺸﻜﻼت و ﻣﺤﺪودﻳﺖﻫﺎ‪ :‬ﻋﺪم ﻫﻤﻜﺎري ﺑﻴﻤﺎران در ﻣﺼﺮف دوز‬ ‫ﺑﺎﻻي دارو ﺑﻪدﻟﻴﻞ ﺗﺮس از ﻋﻮارض آن‪ ،‬ﻋﺪم ﻫﻤﻜﺎري در اﻧﺠﺎم‬

‫‪FD&C‬‬

‫‪543‬‬

‫ﺟﺪول‪ :1-‬ﻓﺮاواﻧﻲ ﮔﻴﺮﻧﺪه اﺳﺘﺮوژن در ﺑﻴﻤﺎران ﺑﺎ ﭘﺎﺗﻮﻟﻮژي آدﻧﻮﻛﺎرﺳﻴﻨﻮم ﺧـﻮب‬ ‫ﺗﻤﺎﻳﺰ ﻳﺎﻓﺘﻪ ﻣﺮﺣﻠﻪ‬

‫‪I‬‬

‫ﺗﻌﺪاد )درﺻﺪ(‬

‫ﮔﻴﺮﻧﺪه اﺳﺘﺮوژن‬ ‫ﻣﻨﻔﻲ‬

‫)‪1 (6/3‬‬

‫ﻣﺜﺒﺖ ﺿﻌﻴﻒ‬

‫)‪4 (25‬‬

‫ﻣﺜﺒﺖ ﻣﺘﻮﺳﻂ‬

‫)‪2 (12/5‬‬

‫ﻣﺜﺒﺖ ﻗﻮي‬

‫)‪9 (56/3‬‬

‫ﻫﻤﻪ ﻣﻮارد‬

‫)‪16 (100‬‬

‫ﻫﺮ ﺳﻪ ﻣﺎه ﻳﻚﺑﺎر و ﺗﺮس از ﭘﻴﺸﺮﻓﺖ ﺑﻴﻤﺎري ﺑﻪ ﻣﺮاﺣﻞ ﺑﺎﻻﺗﺮ‪.‬‬ ‫ﮔﻴﺮﻧﺪه اﺳﺘﺮوژن‬

‫ﻳﺎﻓﺘﻪﻫﺎ‬

‫‪10‬‬

‫اﻳﻦ ﻣﻄﺎﻟﻌﻪ در اداﻣﻪ ﻣﻄﺎﻟﻌﻪاي اﺳﺖ ﻛﻪ ‪ 21‬ﺑﻴﻤﺎر ﺗﺤﺖ درﻣﺎن ﻗﺮار‬

‫‪8‬‬

‫ﮔﺮﻓﺘﻨﺪ ﻛﻪ از آنﻫﺎ اﻣﻜﺎن ﭘﻲﮔﻴﺮي ‪ 9‬ﺑﻴﻤﺎر ﻓﺮاﻫﻢ ﺷﺪ و ﻫﻔﺖ ﺑﻴﻤﺎر‬

‫‪6‬‬

‫ﺟﺪﻳﺪ ﻧﻴﺰ وارد ﻣﻄﺎﻟﻌﻪ ﺷﺪﻧﺪ‪ 9.‬ﺗﻌﺪاد ‪ 16‬ﺑﻴﻤﺎر ﻣﺒﺘﻼ ﺑﻪ آدﻧﻮﻛﺎرﺳﻴﻨﻮم‬

‫‪4‬‬

‫ﺧﻮب ﺗﻤﺎﻳﺰ ﻳﺎﻓﺘﻪ اﻧﺪوﻣﺘﺮ ﻣﺮﺣﻠﻪ ‪ ،Ia‬ﻣﻮرد ﺑﺮرﺳﻲ ﻗﺮار ﮔﺮﻓﺘﻨﺪ‪.‬‬ ‫ﻣﻴﺎﻧﮕﻴﻦ و اﻧﺤﺮاف ﻣﻌﻴﺎر ﺳﻦ ﺑﻴﻤﺎران ﻣﻮرد ﺑﺮرﺳﻲ )ﺑﻴﻤﺎران ﻣﺒﺘﻼ ﺑﻪ‬

‫‪0‬‬

‫آدﻧﻮﻛﺎرﺳﻴﻨﻮم ﺧﻮب ﺗﻤﺎﻳﺰ ﻳﺎﻓﺘﻪ اﻧﺪوﻣﺘﺮ ﻣﺮﺣﻠﻪ ‪ (Ia‬ﺑﻪﺗﺮﺗﻴﺐ‬ ‫‪ 33/12±5/22‬ﺳﺎل و ﻣﻴﺎﻧﻪ ‪ 32‬ﺳﺎل ﺑﻮد )ﺣﺪاﻗﻞ ‪ 24‬ﺳﺎل و ﺣﺪاﻛﺜﺮ ‪42‬‬ ‫ﺳﺎل(‪ .‬ﻣﻴﺎﻧﮕﻴﻦ و اﻧﺤﺮاف ﻣﻌﻴﺎر‬

‫‪CA125‬‬

‫ﺑﻴﻤﺎران ﻣﻮرد ﺑﺮرﺳﻲ )ﺑﻴﻤﺎران‬

‫ﺗﻌﺪاد‬

‫‪2‬‬

‫ﻣﺜﺒﺖ ﻣﺘﻮﺳﻂ ﻣﺜﺒﺖ ﺿﻌﻴﻒ‬

‫ﻣﺜﺒﺖ ﻗﻮي‬

‫ﻣﻨﻔﻲ‬

‫ﻧﻤﻮدار‪ :1-‬ﺗﻮزﻳﻊ ﻓﺮاواﻧﻲ ﮔﻴﺮﻧﺪه اﺳﺘﺮوژن در ﺑﻴﻤﺎران ﺑﺎ ﭘﺎﺗﻮﻟﻮژي آدﻧﻮﻛﺎرﺳﻴﻨﻮم‬ ‫ﺧﻮب ﺗﻤﺎﻳﺰ ﻳﺎﻓﺘﻪ ﻣﺮﺣﻠﻪ‬

‫‪I‬‬

‫ﻣﺒﺘﻼ ﺑﻪ آدﻧﻮﻛﺎرﺳﻴﻨﻮم ﺧﻮب ﺗﻤﺎﻳﺰ ﻳﺎﻓﺘﻪ اﻧﺪوﻣﺘﺮ ﻣﺮﺣﻠﻪ ‪ (Ia‬ﺑﻪﺗﺮﺗﻴﺐ‬ ‫‪ 52/33±81/52U/L‬و ﻣﻴﺎﻧﻪ ‪ 24/5‬ﺑﻮد )ﺣﺪاﻗﻞ ‪ 2/6‬و ﺣﺪاﻛﺜﺮ ‪ .(320‬دو‬

‫داﺷﺘﻨﺪ‪ .‬ﻫﻤﻪ ﻣﻮارد ﮔﻴﺮﻧﺪه ﭘﺮوژﺳﺘﺮون داﺷﺘﻨﺪ و ﺗﻨﻬﺎ ﻳﻚ ﻣﻮرد ﮔﻴﺮﻧﺪه‬

‫ﺑﻴﻤﺎر )‪ (%22/5‬دﭼﺎر اﻓﺰاﻳﺶ ‪ 55<CA125‬ﺑﻮدﻧﺪ‪ .‬ﻣﻴﺎﻧﮕﻴﻦ و اﻧﺤﺮاف‬

‫اﺳﺘﺮوژن ﻣﻨﻔﻲ ﺑﻮد ﻛﻪ ﺑﻪ درﻣﺎن ﭘﺎﺳﺦ داده ﺑﻮد )ﺟﺪول و ﻧﻤﻮدار ‪ .(1‬از‬ ‫‪9‬‬

‫ﻣﻌﻴﺎر ‪ BMI‬ﺑﻴﻤﺎران ﻣﻮرد ﺑﺮرﺳﻲ )ﺑﻴﻤﺎران ﻣﺒﺘﻼ ﺑﻪ آدﻧﻮﻛﺎرﺳﻴﻨﻮم ﺧﻮب‬

‫‪ 9‬ﺑﻴﻤﺎري ﻛﻪ از ﻣﻄﺎﻟﻌﻪ ‪ Eftekhar‬ﭘﻲﮔﻴﺮي ﺷﺪﻧﺪ‪ ،‬ﭼﻬﺎر ﺑﻴﻤﺎر )‪(%25‬‬

‫ﺗﻤﺎﻳﺰ ﻳﺎﻓﺘﻪ اﻧﺪوﻣﺘﺮ ﻣﺮﺣﻠﻪ ‪ (Ia‬ﺑﻪﺗﺮﺗﻴﺐ ‪ 28/93±3/19‬و ﻣﻴﺎﻧﻪ ‪ 30/0‬ﺑﻮد‬

‫ﺣﺎﻣﻠﻪ ﺷﺪﻧﺪ ﻛﻪ ﻫﻤﮕﻲ ﺑﻪ درﻣﺎن ﭘﺎﺳﺦ داده ﺑﻮدﻧﺪ ﻛﻪ در ﭘﻲﮔﻴﺮي ﺑﻪ‬

‫)ﺣﺪاﻗﻞ ‪ 23‬و ﺣﺪاﻛﺜﺮ ‪ .(34‬از ﺑﻴﻤﺎران ﻣﺒﺘﻼ ﺑﻪ آدﻧﻮﻛﺎرﺳﻴﻨﻮم ﺧﻮب‬

‫ﻋﻤﻞ آﻣﺪه ﻳﻚ ﻣﻮرد ﺣﺎﻣﻠﮕﻲ ﻣﻮﻻر‪ ،‬دو ﻣﻮرد ﺳﻘﻂ و در ﻧﻬﺎﻳﺖ ﻳﻚ‬

‫ﺗﻤﺎﻳﺰ ﻳﺎﻓﺘﻪ اﻧﺪوﻣﺘﺮ ﻣﺮﺣﻠﻪ ‪ 10 ،Ia‬ﻣﻮرد )‪ ،(%62/5‬ﺗﺤﺖ درﻣﺎن ﺑﺎ‬

‫ﻣﻮرد ﺳﻨﺪرم داون دﻳﺪه ﺷﺪ‪ .‬در ﻛﻞ از ‪ 9‬ﺑﻴﻤﺎري ﻛﻪ از ﻓﺎز اول ﻣﻄﺎﻟﻌﻪ‬

‫ﻣﮋﺳﺘﺮول اﺳﺘﺎت ﺑﺎ دوز ‪ 160mg‬و ﺷﺶ ﻣﻮرد )‪ (%37/5‬ﺗﺤﺖ درﻣﺎن‬

‫ﭘﻲﮔﻴﺮي ﺷﺪﻧﺪ‪ ،‬در ﻧﻬﺎﻳﺖ ﻫﺸﺖ ﺑﻴﻤﺎر ﻫﻴﺴﺘﺮﻛﺘﻮﻣﻲ ﻫﻤﺮاه ﺑﺎ ﺑﺮداﺷﺘﻦ‬

‫ﺑﺎ ﻣﮋﺳﺘﺮول اﺳﺘﺎت ﺑﺎ دوز ‪ 320mg‬ﻗﺮار ﮔﺮﻓﺘﻨﺪ‪ .‬ﺷﺶ ﻣﻮرد )‪،(%37/5‬‬

‫دو ﻃﺮﻓﻪ ﺗﺨﻤﺪان ﺷﺪﻧﺪ و ﺗﻨﻬﺎ ﻳﻚ ﺑﻴﻤﺎر ﺗﺤﺖ درﻣﺎن ﻣﺠﺪد اﺳﺖ و‬

‫ﺗﺤﺖ درﻣﺎن ﺳﻪ ﻣﺎه‪ ،‬ﭘﻨﺞ ﻣﻮرد )‪ (%31/3‬ﺗﺤﺖ درﻣﺎن ﺷﺶ ﻣﺎه و ﭘﻨﺞ‬

‫از ﻫﻔﺖ ﺑﻴﻤﺎري ﻛﻪ از ﻓﺎز دوم ﻣﻄﺎﻟﻌﻪ ﭘﻲﮔﻴﺮي ﺷﺪﻧﺪ‪ ،‬ﭘﻨﺞ ﺑﻴﻤﺎر ﺗﺤﺖ‬

‫ﻣﻮرد )‪ ،(%31/3‬ﺗﺤﺖ درﻣﺎن ‪ 9‬ﻣﺎه ﻗﺮار ﮔﺮﻓﺘﻨﺪ‪ .‬در ﻛﻞ ﺑﺮرﺳﻲ دو‬

‫درﻣﺎن )ﺳﻪ ﻧﻔﺮ ﻣﻌﺮﻓﻲ ﺑﻪ ‪ IVF‬و دو ﻧﻔﺮ درﻣﺎن ﻣﺮﺣﻠﻪ دوم(‪ ،‬ﻳﻚ ﺑﻴﻤﺎر‬

‫ﻣﻮرد )‪ ،(%12/5‬ﺑﻪ درﻣﺎن ﻫﻮرﻣﻮﻧﻲ ﭘﺎﺳﺦ ﻧﺪادﻧﺪ در ﺣﺎﻟﻲﻛﻪ ‪ 9‬ﻣﻮرد‬

‫ﻫﻴﺴﺘﺮﻛﺘﻮﻣﻲ ﻫﻤﺮاه ﺑﺎ ﺑﺮداﺷﺘﻦ دو ﻃﺮﻓﻪ ﺗﺨﻤﺪان و ﻳﻚ ﺑﻴﻤﺎر از‬

‫)‪ (%56/3‬ﭘﺎﺳﺦ دادﻧﺪ و ﭼﻬﺎر ﻣﻮرد )‪ (%25‬از ﻣﻄﺎﻟﻌﻪ ﺧﺎرج ﺷﺪﻧﺪ و‬

‫ﻣﻄﺎﻟﻌﻪ ﺧﺎرج ﺷﺪه اﺳﺖ‪.‬‬

‫ﻳﻚ ﻣﻮرد )‪ (%6/3‬ﻫﻨﻮز ﺗﺤﺖ درﻣﺎن اﺳﺖ‪ .‬دو ﻣﻮرد )‪ ،(%12/5‬دﻳﺎﺑﺖ‬ ‫و ﻫﺸﺖ ﻣﻮرد )‪ (%50‬ﺗﺨﻤﺪان ﭘﻠﻲﻛﻴﺴﺘﻲ )‪ (PCO‬داﺷﺘﻨﺪ و ﻫﺸﺖ ﻣﻮرد‬ ‫)‪،(%50‬‬

‫‪PCO‬‬

‫ﻧﺪاﺷﺘﻨﺪ‪ .‬ﻫﻴﭻﻛﺪام از ﻣﻮارد ﻫﻴﭙﺮﺗﺎﻧﺴﻴﻮن‬

‫‪HTN‬‬

‫ﻧﺪاﺷﺘﻨﺪ‪.‬‬

‫‪ 14‬ﻣـﻮرد )‪ MRI ،(%87/5‬ﻧﺮﻣـﺎل و دو ﻣـﻮرد )‪ ،(%12/5‬ﺗـﻮده رﺣـﻤﻲ‬

‫ﺑﺤﺚ‬ ‫اﻳﻦ ﻣﻄﺎﻟﻌﻪ در اداﻣﻪ ﻣﻄﺎﻟﻌﻪ دﻛﺘﺮ اﻓﺘﺨﺎر اﺳﺖ ﻛﻪ ‪ 21‬ﺑﻴﻤﺎر ﺗﺤﺖ‬ ‫‪9‬‬

‫درﻣﺎن ﻗﺮار ﮔﺮﻓﺘﻨﺪ ﻛﻪ از آنﻫﺎ اﻣﻜﺎن ﭘﻲﮔﻴﺮي ‪ 9‬ﺑﻴﻤﺎر ﻓﺮاﻫﻢ ﺷﺪ و‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬


‫ﻓﺮﻳﺒﺎ ﻳﺎرﻧﺪي و ﻫﻤﻜﺎران‬

‫‪544‬‬

‫ﻫﻔﺖ ﺑﻴﻤﺎر ﺟﺪﻳﺪ ﻧﻴﺰ وارد ﻣﻄﺎﻟﻌﻪ ﺷﺪﻧﺪ‪ .‬ﺗﻌﺪاد ‪ 16‬ﺑﻴﻤﺎر ﻣﺒﺘﻼ ﺑﻪ‬

‫ﺑﺎﺷﺪ‪ .‬اﺳﺘﻔﺎده از درﻣﺎن ﺑﺎ ﭘﺮوژﺳﺘﻴﻦ ﺑﺮاي درﻣﺎن ﺳﺮﻃﺎن اﻧﺪوﻣﺘﺮ ﺧﻮب‬

‫آدﻧﻮﻛﺎرﺳﻴﻨﻮم ﺧﻮب ﺗﻤﺎﻳﺰ ﻳﺎﻓﺘﻪ اﻧﺪوﻣﺘﺮ ﻣﺮﺣﻠﻪ ‪ ،Ia‬ﻣﻮرد ﺑﺮرﺳﻲ ﻗﺮار‬

‫ﺗﻤﺎﻳﺰ ﻳﺎﻓﺘﻪ اوﻟﻴﻪ ﺑﺎﻳﺪ ﺑﺎ اﺣﺘﻴﺎط ﺻﻮرت ﮔﻴﺮد و ﻧﻴﺎز ﺑﻪ ﺑﺮرﺳﻲ ﺑﺴﻴﺎر‬ ‫‪8‬‬

‫ﮔﺮﻓﺘﻨﺪ‪ Kim .‬در ﻳﻚ ﻣﻄﺎﻟﻌﻪ ﺑﻪ ﺑﺮرﺳﻲ ‪ 21‬ﺑﻴﻤﺎر ﻣﺒﺘﻼ ﺑﻪ ﺳﺮﻃﺎن‬

‫دﻗﻴﻖ ﺑﺎﻟﻴﻨﻲ ﭘﻴﺶ و ﭘﺲ از درﻣﺎن دارد‪ Ota .‬ﻧﻴﺰ در ﻳﻚ ﻣﻄﺎﻟﻌﻪ ﺑﻪ‬

‫ﭘﺮداﺧﺖ ﻛﻪ ﻧﺸﺎن داد )‪ 13(%62‬ﺑﻴﻤﺎر ﺑﻪﺻﻮرت اﺑﺘﺪاﻳﻲ ﺑﻪ درﻣﺎن ﭘﺎﺳﺦ‬

‫ﺑﺮرﺳﻲ و روﺷﻦﺳﺎزي ﻛﻔﺎﻳﺖ درﻣﺎن در ‪ 31‬زن ﻛﻤﺘﺮ ﻳﺎ ﻣﺴﺎوي ‪40‬‬

‫دادهاﻧﺪ‪ 10.‬در ﺳﻪ ﻣﻮرد از ﭘﺎﺳﺦ دﻫﻨﺪهﻫﺎي اﺑﺘﺪاﻳﻲ ﺑﻌﺪاً ﻋﻮد ﭘﺪﻳﺪار‬

‫ﺳﺎل ﻣﺒﺘﻼ ﺑﻪ ﺳﺮﻃﺎن اﻧﺪوﻣﺘﺮ ﭘﺮداﺧﺖ‪ 12 .‬ﺑﻴﻤﺎر از آنﻫﺎ ﻛﻪ ﮔﺮﻳﺪ‬

‫ﺷﺪ‪ %38 .‬ﺑﻴﻤﺎران ﺑﻪ ﭘﺮوژﺳﺘﻴﻦ ﭘﺎﺳﺦ ﻧﺪادﻧﺪ‪ .‬ﺷﺶ ﻧﻮزاد زﻧﺪه از ﺳﻪ‬

‫ﻳﻚ ﺑﺎ ﺗﻤﺎﻳﺰ ﺧﻮب ﺑﻮدﻧﺪ ﺷﻮاﻫﺪي از ﺗﻬﺎﺟﻢ ﺑﻪ رﺣﻢ ﻧﺪاﺷﺘﻨﺪ ﺑﺎ‬

‫ﺑﻴﻤﺎر ﺑﻪ دﻧﻴﺎ آﻣﺪ‪ .‬در ﻧﻬﺎﻳﺖ ﻧﺘﻴﺠﻪ ﮔﺮﻓﺖ ﻛﻪ در زﻧﺎن ﭘﺮهﻣﻨﻮﭘﺎز‬

‫ﻣﺪروﻛﺴﻲ ﭘﺮوژﺳﺘﺮون اﺳﺘﺎت ﺑﻪﻋﻨﻮان درﻣﺎن اﺻﻠﻲ ﻣﺪاوا ﺷﺪهاﻧﺪ و‬

‫‪ Premenopausal‬ﻣﺒﺘﻼ ﺑﻪ ﺳﺮﻃﺎن اﻧﺪوﻣﺘﺮ ﻣﻲﺗﻮان ﺑﺎ ﻣﻮﻓﻘﻴﺖ از درﻣﺎن‬

‫‪ 19‬ﺑﻴﻤﺎر ﺟﺮاﺣﻲ ﺷﺪﻧﺪ‪ 19 .‬ﺑﻴﻤﺎر ﮔﺮوه ﺟﺮاﺣﻲ ﻫﻤﮕﻲ زﻧﺪه ﻫﺴﺘﻨﺪ و‬

‫‪Childbearing‬‬

‫ﻫﻴﭻﻳﻚ ﺷﻮاﻫﺪي از ﻋﻮد ﻧﺪاﺷﺘﻨﺪ‪ .‬در ‪ 12‬ﺑﻴﻤﺎر ﮔﺮوه اول ﻫﺸﺖ ﺑﻴﻤﺎر‬

‫ﺑﺎ ﭘﺮوژﺳﺘﻴﻦﻫﺎ ﺑﻪﺗﻨﻬﺎﻳﻲ اﺳﺘﻔﺎده ﻛﺮد ﺗﺎ ﺗﻮاﻧﺎﻳﻲ ﺑﺎروري‬

‫‪15‬‬

‫در اﻳﻦ دﺳﺘﻪ از ﺑﻴﻤﺎران ﺣﻔﻆ ﺷﻮد‪ 10.‬در ﻣﻄﺎﻟﻌﻪ ‪ ،Yahata‬در ﻫﺸﺖ‬

‫ﺑﻪدﻟﻴﻞ ﻋﻮد ﻳﺎ ﻋﺪم ﭘﺎﺳﺦ ﺑﻪ درﻣﺎن ﺑﻪ‬

‫ﺑﻴﻤﺎر ﺳﺮﻃﺎن اﻧﺪوﻣﺘﺮ ﺧﻮب ﺗﻤﺎﻳﺰ ﻳﺎﻓﺘﻪ ﮔﺮﻳﺪ ‪ Ia‬ﻛﻪ ﺷﺶ ﻣﺎه درﻣﺎن ﺑﺎ‬

‫ﺷﺪﻧﺪ‪ .‬از اﻳﻦ ﻫﺸﺖ ﺑﻴﻤﺎر ﺗﻬﺎﺟﻢ ﺑﻪ ﻣﻴﻮﻣﺘﺮ در ﺳﻪ ﺑﻴﻤﺎر ﺗﺸﺨﻴﺺ داده‬

‫دوز اﺳﺘﺎﻧﺪارد )‪ Medroxyprogesterone Acetate (MPA‬ﮔﺮﻓﺘﻪ ﺑﻮدﻧﺪ‪،‬‬

‫ﺷﺪ و ﻳﻜﻲ از آنﻫﺎ ﺑﻪدﻟﻴﻞ ﻣﺘﺎﺳﺘﺎز ﺑﻪ ﻛﺒﺪ و ﻣﻐﺰ ﭘﺲ از ﻫﻴﺴﺘﺮﻛﺘﻮﻣﻲ‬

‫اﻣﺎ ﺑﻪ درﻣﺎن ﭘﺎﺳﺦ ﻧﺪاده ﺑﻮدﻧﺪ و ﻫﻤﭽﻨﺎن ﻗﺼﺪ ﺑﺎردار ﺷﺪن داﺷﺘﻨﺪ‬

‫ﻓﻮت ﻛﺮد ﻛﻪ در ﻳﻜﻲ از آنﻫﺎ ﮔﻴﺮﻧﺪهﻫﺎي ﭘﺮوژﺳﺘﺮوﻧﻲ ﻣﻨﻔﻲ ﺑﻮد‪ .‬در‬

‫اﻧﺠﺎم ﺷﺪ‪12.‬و‪ 11‬ﻣﻴﺎﻧﻪ زﻣﺎن ﭘﺎﺳﺦ ﺑﻪ درﻣﺎن ‪ 8/7‬ﻣﺎه ﺑﻮد‪ .‬ﻫﻔﺖ ﺑﻴﻤﺎر در‬

‫ﭼﻬﺎر ﺑﻴﻤﺎر دﻳﮕﺮ ﻫﻨﻮز ﺷﻮاﻫﺪي از ﻋﻮد وﺟﻮد ﻧﺪارد و دو ﺑﻴﻤﺎر ﻓﺮزﻧﺪ‬

‫اﺑﺘﺪا ﺑﻪ درﻣﺎن ﭘﺎﺳﺦ دادﻧﺪ اﻣﺎ ﺑﻴﻤﺎري دوﺑﺎره ﻋﻮد ﻛﺮد‪ .‬در ﺗﻤﺎم ﺑﻴﻤﺎران‬

‫زﻧﺪه دارﻧﺪ‪ .‬در ﻧﻬﺎﻳﺖ ﻧﺘﻴﺠﻪ ﮔﺮﻓﺖ ﻛﻪ ﺗﻮﺟﻪ ﺧﺎﺻﻲ ﺑﺎﻳﺪ ﺑﻪ ﺑﻴﻤﺎراﻧﻲ‬ ‫‪MPA‬‬

‫‪MPA‬‬

‫ﺑﻪﺗﺪرﻳﺞ ﻫﻴﺴﺘﺮﻛﺘﻮﻣﻲ‬

‫ﺑﺮاي درﻣﺎن ﻣﺤﺎﻓﻈﻪﻛﺎراﻧﻪ ﺳﺮﻃﺎن‬

‫ﮔﻴﺮﻧﺪه اﺳﺘﺮوژن وﺟﻮد داﺷﺖ و ﺗﻨﻬﺎ ﻳﻚ ﺑﻴﻤﺎر ﮔﻴﺮﻧﺪه ﭘﺮوژﺳﺘﺮون‬

‫ﻛﻪ ﺗﺤﺖ درﻣﺎن ﻫﻮرﻣﻮﻧﻲ‬

‫ﻧﺪاﺷﺖ‪12.‬و‪ Lai 11‬ﻧﻴﺰ در ﻳﻚ ﻣﻄﺎﻟﻌﻪ ﺑﻴﺎن ﻛﺮد ﻛﻪ ﻣﻴﺰان ﻋﻮد در ﺑﻴﻤﺎران‬

‫اﻧﺪوﻣﺘﺮ ﻗﺮار ﻣﻲﮔﻴﺮﻧﺪ ﻣﻌﻄﻮف ﮔﺮدد ﺑﻪﻋﻼوه‬

‫ﻣﺒﺘﻼ ﺑﻪ ‪ stage I, grade I‬ﺳﺮﻃﺎن اﻧﺪوﻣﺘﺮ ﻛﻪ ﺑﺮاي ﺣﻔﻆ ﺑﺎروري ﺗﺤﺖ‬

‫ﺛﺎﺑﺖ ﺑﺮاي ﺗﻤﺎم ﺑﻴﻤﺎران ﻣﺒﺘﻼ ﺑﻪ ﺳﺮﻃﺎن اﻧﺪوﻣﺘﺮ ﻧﺒﺎﻳﺪ در ﻧﻈﺮ ﮔﺮﻓﺘﻪ‬

‫ﻫﻮرﻣﻮن درﻣﺎﻧﻲ ﻗﺮار ﻣﻲﮔﻴﺮﻧﺪ ﺑﺎﻻﺳﺖ‪ Boing 13.‬ﻧﻴﺰ در ﻳﻚ ﻣﻄﺎﻟﻌﻪ‬

‫ﺷﻮد‪ Niwa 15.‬ﻧﻴﺰ ﺑﻪﻣﻨﻈﻮر ﺑﺮرﺳﻲ ﭘﻴﺎﻣﺪ درﻣﺎن ﻣﺤﺎﻓﻈﺖﻛﻨﻨﺪه ﺑﺎرداري‬

‫ﺑﻴﺎن ﻛﺮد ﻣﻴﺰان ﭘﺎﺳﺦ ﻛﻠﻲ ﺑﻪ ﭘﺮوژﺳﺘﻴﻦ در ‪ 9‬ﻣﻄﺎﻟﻌﻪ ﮔﺬﺷﺘﻪﻧﮕﺮ ‪%79‬‬

‫در زﻧﺎن ﺟﻮان ﻣﺒﺘﻼ ﺑﻪ ﺳﺮﻃﺎن ‪ 12‬زن ﻣﺒﺘﻼ ﺑﻪ ﺳﺮﻃﺎن اﻧﺪوﻣﺘﺮ را‬

‫ﺑﻮده اﺳﺖ‪ 6.‬ﻋﻮد در ‪ %36-40‬از ﺑﻴﻤﺎراﻧﻲ ﻛﻪ ﺗﺤﺖ درﻣﺎن‬

‫ﺑﺮرﺳﻲ ﻧﻤﻮد‪ .‬ﺑﻴﻤﺎران ﺑﺎ‬

‫ﻣﺤﺎﻓﻈﻪﻛﺎراﻧﻪ ﻗﺮار ﮔﺮﻓﺘﻪ ﺑﻮدﻧﺪ و در اﺑﺘﺪا ﺑﻪ درﻣﺎن ﭘﺎﺳﺦ داده ﺑﻮدﻧﺪ‬

‫ﺑﻮدﻧﺪ و ‪ D&C‬ﻫﺮ ﭼﻬﺎر ﻫﻔﺘﻪ ﻳﻚﺑﺎر اﻧﺠﺎم ﻣﻲﺷﺪ‪ .‬در ﺗﻤﺎم ﻣﻮارد ﻣﻮرد‬

‫دﻳﺪه ﺷﺪ‪ Yang .‬ﻧﻴﺰ در ﻳﻚ ﻣﻄﺎﻟﻌﻪ در ﻓﺎﺻﻠﻪ ﺳﺎل ‪ 1993 -2004‬ﺑﻪ‬

‫ﻣﻄﺎﻟﻌﻪ ﻋﻮد ﻛﺎﻣﻞ در ﺧﻼل ‪ 6-10‬ﻣﺎه درﻣﺎن ﺑﺮوز ﻛﺮد‪ .‬ﻫﻔﺖ ﺑﻴﻤﺎر از‬

‫ﺑﺮرﺳﻲ اﻳﻤﻨﻲ روش ﻫﻮرﻣﻮن درﻣﺎﻧﻲ ﺑﺎ ﺣﻔﻆ ﻗﺪرت ﺑﺎروري در‬

‫‪ 10‬ﺑﻴﻤﺎر ﻛﻪ ﻓﺮزﻧﺪ ﻣﻲﺧﻮاﺳﺘﻨﺪ ﺑﺎردار ﺷﺪﻧﺪ و ﭘﻨﺞ ﺑﻴﻤﺎر ﻛﻮدﻛﺎن‬

‫ﺑﻴﻤﺎران ﻣﺒﺘﻼ ﺑﻪ ﺳﺮﻃﺎن اﻧﺪوﻣﺘﺮ ﺧﻮب ﺗﻤﺎﻳﺰ ﻳﺎﻓﺘﻪ ﮔﺮﻳﺪ ‪ Ia‬ﻛﻪ ﺗﺤﺖ‬

‫ﻓﻮلﺗﺮم ﺑﻪدﻧﻴﺎ آوردﻧﺪ‪ .‬ﻫﺸﺖ ﻣﻮرد از ‪ 9‬ﻣﻮرد ﭘﻲﮔﻴﺮي ﻃﻮﻻﻧﻲﻣﺪت‬

‫درﻣﺎن ﺑﺎ ‪ megace‬ﺑﺎ دوز ‪ 160mg‬ﻗﺮار ﮔﺮﻓﺘﻪ ﺑﻮدﻧﺪ ﭘﺮداﺧﺖ و ﭘﺲ از‬

‫ﺷﺪﻧﺪ ﻛﻪ دﭼﺎر ﻋﻮد ﺑﻴﻤﺎري ﺷﺪﻧﺪ و ﭼﻬﺎر ﺑﻴﻤﺎر ﻧﻴﺎز ﺑﻪ ﻫﻴﺴﺘﺮﻛﺘﻮﻣﻲ‬

‫ﺑﺮرﺳﻲ ﺷﺶ ﺑﻴﻤﺎر ﻧﺸﺎن داد ﻛﻪ در ﭼﻬﺎر ﺑﻴﻤﺎر ﭘﺲ از ﻣﻴﺎﻧﮕﻴﻦ ‪ 3/5‬ﻣﺎه‬

‫ﭘﻴﺪا ﻛﺮدﻧﺪ‪ .‬در ﻫﻴﭻ ﺑﻴﻤﺎري ﻣﺘﺎﺳﺘﺎز دور دﺳﺖ رخ ﻧﺪاد‪ .‬آنﻫﺎ در‬

‫اﺛﺮات درﻣﺎﻧﻲ دﻳﺪه ﺷﺪ ﻛﻪ دو ﺑﻴﻤﺎر آن در ﻣﻴﺎﻧﮕﻴﻦ ‪ 4/5‬ﻣﺎه ﭘﺲ از‬

‫ﻧﻬﺎﻳﺖ ﻧﺘﻴﺠﻪ ﮔﺮﻓﺘﻨﺪ ﻛﻪ درﻣﺎنﻫﺎي ﻣﺤﺎﻓﻈﻪﻛﺎراﻧﻪ در ﺑﻴﻤﺎران ﻣﺒﺘﻼ ﺑﻪ‬

‫ﺷﺮوع درﻣﺎن ﻋﻮد ﻛﺮدﻧﺪ‪ 8.‬دو ﺑﻴﻤﺎر ﻧﻴﺰ ﺑﻪ درﻣﺎن ﭘﺎﺳﺦ ﻧﺪادﻧﺪ‪ .‬در زﻣﺎن‬

‫ﺳﺮﻃﺎن اﻧﺪوﻣﺘﺮ ﻛﻪ دﻗﺖ اﻧﺘﺨﺎب ﺷﺪه ﺑﺎﺷﻨﺪ درﻣﺎن ﻣﻨﺎﺳﺒﻲ اﺳﺖ‪.‬‬

‫ﺟﺮاﺣﻲ اﻳﻦ ﭼﻬﺎر ﺑﻴﻤﺎر ﻣﺸﺨﺺ ﮔﺮدﻳﺪ ﻛﻪ ﻫﻤﮕﻲ ﺗﻮﻣﻮرﻫﺎي اﻧﺪوﻣﺘﺮ‬

‫ﻣﻴﺰان ﻋﻮد در درازﻣﺪت ﺣﺘﻲ ﭘﺲ از ﺑﻬﺒﻮد ﻛﺎﻣﻞ ﭘﺎﺗﻮﻟﻮژﻳﻚ ﺑﺎﻻﺳﺖ‪.‬‬

‫و ﺗﺨﻤﺪان ﻫﻤﺰﻣﺎن داﺷﺘﻨﺪ ﻛﻪ دو ﻣﻮرد ﻓﺎﻗﺪ ﮔﻴﺮﻧﺪهﻫﺎي ﭘﺮوژﺳﺘﺮوﻧﻲ‬

‫ﺑﻨﺎﺑﺮاﻳﻦ ﭘﻲﮔﻴﺮي از ﻧﺰدﻳﻚ اﻳﻦ ﺑﻴﻤﺎران ﺗﻮﺻﻴﻪ ﻣﻲﺷﻮد‪ .‬در ﻣﻄﺎﻟﻌﻪ ﻣﺎ‪،‬‬

‫و ﻳﻚ ﻣﻮرد ﻓﺎﻗﺪ ﮔﻴﺮﻧﺪه اﺳﺘﺮوژن ﺑﻮدﻧﺪ‪ .‬ﻫﻤﮕﻲ اﻳﻦ ﺑﻴﻤﺎران زﻧﺪه‬

‫ﻫﻤﻪ ﻣﻮارد ﮔﻴﺮﻧﺪه ﭘﺮوژﺳﺘﺮون داﺷﺘﻨﺪ‪ .‬ﺗﻨﻬﺎ ﻳﻚ ﻣﻮرد ﮔﻴﺮﻧﺪه اﺳﺘﺮوژن‬

‫ﻣﺎﻧﺪﻧﺪ و دو ﺑﻴﻤﺎر ﻧﻮزادان ﺳﺎﻟﻢ ﺑﻪدﻧﻴﺎ آوردﻧﺪ‪ .‬در ﻧﻬﺎﻳﺖ ﻧﺘﻴﺠﻪ ﮔﺮﻓﺖ‬

‫ﻣﻨﻔﻲ ﺑﻮد‪ .‬در ﻣﻄﺎﻟﻌﻪ ‪ ،Yahata‬در ﺗﻤﺎم ﺑﻴﻤﺎران ﮔﻴﺮﻧﺪه اﺳﺘﺮوژن وﺟﻮد‬

‫ﻛﻪ ﻓﻘﺪان ﮔﻴﺮﻧﺪهﻫﺎي ﭘﺮوژﺳﺘﺮوﻧﻲ ﺷﺎﻳﺪ ﺑﺎ ﺷﻜﺴﺖ در درﻣﺎن ﻣﺮﺗﺒﻂ‬

‫داﺷﺖ و ﺗﻨﻬﺎ ﻳﻚ ﺑﻴﻤﺎر ﮔﻴﺮﻧﺪه ﭘﺮوژﺳﺘﺮون ﻧﺪاﺷﺖ‪12.‬و‪ 11‬در ﻣﻄﺎﻟﻌﻪ ﻣﺎ‪،‬‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬

‫‪16‬‬

‫‪MPA‬‬

‫ﻫﻤﻴﺸﻪ ﺑﻪﻋﻨﻮان‬

‫‪MPA‬‬

‫ﺑﺮاي ﺷﺶ ﺗﺎ ‪ 10‬ﻣﺎه ﺗﺤﺖ درﻣﺎن‬


545

‫ و ارﺗﺒﺎط ﺑﺎ ﮔﻴﺮﻧﺪهﻫﺎي ﻫﻮرﻣﻮﻧﻲ‬Ia, G1 ‫ﻣﺮﺣﻠﻪ‬ ‫اﻧﺪوﻣﺘﺮ‬ ‫ﻣﮋﺳﺘﺮول اﺳﺘﺎت در درﻣﺎن‬ Yarandi .F et‫آدﻧﻮﻛﺎرﺳﻴﻨﻮم‬ al.

،‫ ﺳﻪ ﺑﻴﻤﺎر ﻣﺒﺘﻼ ﺑﻪ ﻛﺎﻧﺴﺮ اﻧﺪوﻣﺘﺮ‬،Mousavi ‫ در ﮔﺰارش‬.‫ﺧﺎرج ﺷﺪ‬ 17

‫ ﺣﺎﻣﻠﻪ ﺷﺪﻧﺪ ﻛﻪ ﻫﻴﭻﻛﺪام ﻣﻨﺠﺮ ﺑﻪ ﺗﻮﻟﺪ ﻧﻮزاد ﺳﺎﻟﻢ‬،(%25) ‫ﭼﻬﺎر ﻣﻮرد‬

‫ اﺳﺘﻔﺎده از ﭘﺮوژﺳﺘﻴﻦ در درﻣﺎن ﺳﺮﻃﺎن اﻧﺪوﻣﺘﺮ ﺧﻮب‬.‫ﺑﺎردار ﻧﺸﺪﻧﺪ‬

‫ در ﻧﻬﺎﻳﺖ‬،‫ ﺑﻴﻤﺎري ﻛﻪ از ﻓﺎز اول ﻣﻄﺎﻟﻌﻪ ﭘﻲﮔﻴﺮي ﺷﺪﻧﺪ‬9 ‫ از‬.‫ﻧﺸﺪ‬

‫ﺗﻤﺎﻳﺰ ﻳﺎﻓﺘﻪ ﺑﺎﻳﺪ ﺑﺎ اﺣﺘﻴﺎط ﺻﻮرت ﮔﺮﻓﺘﻪ و ﻧﻴﺎز ﺑﻪ ﺑﺮرﺳﻲ ﺑﺴﻴﺎر دﻗﻴﻖ‬

‫ﻫﺸﺖ ﺑﻴﻤﺎر ﻫﻴﺴﺘﺮﻛﺘﻮﻣﻲ ﻫﻤﺮاه ﺑﺎ ﺑﺮداﺷﺘﻦ دو ﻃﺮﻓﻪ ﺗﺨﻤﺪان ﺷﺪﻧﺪ و‬

‫ ﺑﺎ ﺗﻮﺟﻪ ﺑﻪ اﻳﻦﻛﻪ ﻫﻤﻪ ﻣﻮارد ﮔﻴﺮﻧﺪه‬.‫ﺑﺎﻟﻴﻨﻲ ﭘﻴﺶ و ﭘﺲ از درﻣﺎن دارد‬

‫ﺗﻨﻬﺎ ﻳﻚ ﺑﻴﻤﺎر ﺗﺤﺖ درﻣﺎن ﻣﺠﺪد ﻗﺮار ﮔﺮﻓﺖ و از ﻫﻔﺖ ﺑﻴﻤﺎري ﻛﻪ از‬

‫ﭘﺮوژﺳﺘﺮون ﻣﺜﺒﺖ داﺷﺘﻨﺪ و ﺗﻨﻬﺎ ﻳﻚ ﻣﻮرد ﮔﻴﺮﻧﺪه اﺳﺘﺮوژن ﻣﻨﻔﻲ ﺑﻮد‬

‫ ﭘﻨﺞ ﺑﻴﻤﺎر ﺗﺤﺖ درﻣﺎن )ﺳﻪ ﻧﻔﺮ ﻣﻌﺮﻓﻲ‬،‫ﻓﺎز دوم ﻣﻄﺎﻟﻌﻪ ﭘﻲﮔﻴﺮي ﺷﺪﻧﺪ‬

‫ ﺑﺮاي ﺗﺼﻤﻴﻢﮔﻴﺮي در ﻣﻮرد اﺛﺮ ﮔﻴﺮﻧﺪهﻫﺎ‬،‫ﻛﻪ ﺑﻪ درﻣﺎن ﭘﺎﺳﺦ داده ﺑﻮد‬

‫ ﻳﻚ ﺑﻴﻤﺎر ﻫﻴﺴﺘﺮﻛﺘﻮﻣﻲ ﻫﻤﺮاه ﺑﺎ‬،(‫ و دو ﻧﻔﺮ درﻣﺎن ﻣﺮﺣﻠﻪ دوم‬IVF ‫ﺑﻪ‬

.‫ ﻧﻴﺎز ﺑﻪ ﻣﻄﺎﻟﻌﺎت ﺑﻴﺸﺘﺮ ﺑﺎ ﺣﺠﻢ ﻧﻤﻮﻧﻪ ﺑﺎﻻﺗﺮ ﻣﻲﺑﺎﺷﺪ‬،‫در ﭘﺎﺳﺦ ﺑﻪدرﻣﺎن‬

‫ﺑﺮداﺷﺘﻦ دو ﻃﺮﻓﻪ ﺗﺨﻤﺪان و ﻳﻚ ﺑﻴﻤﺎر ﺑﻪدﻟﻴﻞ ﻧﺎزاﻳﻲ ﻫﻤﺴﺮ از ﻣﻄﺎﻟﻌﻪ‬

References 1. Bakkum-Gamez JN, Gonzalez-Bosquet J, Laack NN, Mariani A, Dowdy SC. Current issues in the management of endometrial cancer. Mayo Clin Proc 2008;83(1):97-112. 2. Ramirez PT, Frumovitz M, Bodurka DC, Sun CC, Levenback C. Hormonal therapy for the management of grade 1 endometrial adenocarcinoma: a literature review. Gynecol Oncol 2004;95(1):133-8. 3. Key TJ, Pike MC. The dose-effect relationship between 'unopposed' oestrogens and endometrial mitotic rate: its central role in explaining and predicting endometrial cancer risk. Br J Cancer 1988;57(2):205-12. 4. Setiawan VW, Doherty JA, Shu XO, Akbari MR, Chen C, De Vivo I, et al. Two estrogen-related variants in CYP19A1 and endometrial cancer risk: a pooled analysis in the Epidemiology of Endometrial Cancer Consortium. Cancer Epidemiol Biomarkers Prev 2009;18(1):242-7. 5. Frumovitz M, Gershenson DM. Fertility-sparing therapy for young women with endometrial cancer. Expert Rev Anticancer Ther 2006;6(1):27-32. 6. Böing C, Kimmig R. Fertility-preserving treatment in young women with endometrial cancer. Gynakol Geburtshilfliche Rundsch 2006;46(1-2):25-33. 7. Podczaski E, Mortel R. Hormonal treatment of endometrial cancer: past, present and future. Best Pract Res Clin Obstet Gynaecol 2001;15(3):469-89. 8. Yang YC, Wu CC, Chen CP, Chang CL, Wang KL. Reevaluating the safety of fertility-sparing hormonal therapy for early endometrial cancer. Gynecol Oncol 2005;99(2):287-93.

1389 ‫ آذر‬،9 ‫ ﺷﻤﺎره‬، 68 ‫ دوره‬،‫ داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‬،‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‬

9. Eftekhar Z, Mohagheghi S, Yarandi F, Izadi Mood N, Moghaddami Tabrizi N, Rezaee Z. Efficacy of megestrol acetate in treatment of 21 young patients with endometrial adenocarcinoma. TUMJ 2007;64(11):51-6. 10. Kim YB, Holschneider CH, Ghosh K, Nieberg RK, Montz FJ. Progestin alone as primary treatment of endometrial carcinoma in premenopausal women. Report of seven cases and review of the literature. Cancer 1997;79(2):320-7. 11. Yahata T, Fujita K, Aoki Y, Tanaka K. Long-term conservative therapy for endometrial adenocarcinoma in young women. Hum Reprod 2006;21(4):1070-5. 12. Yahata T, Kurabayashi T, Ueda H, Kodama S, Chihara T, Tanaka K. Laparoscopic management of rudimentary horn pregnancy. A case report. J Reprod Med 1998;43(3):223-6. 13. Lai CH, Huang HJ. The role of hormones for the treatment of endometrial hyperplasia and endometrial cancer. Curr Opin Obstet Gynecol 2006;18(1):29-34. 14. Markman M. Hormonal therapy of endometrial cancer. Eur J Cancer 2005;41(5):673-5. 15. Ota T, Yoshida M, Kimura M, Kinoshita K. Clinicopathologic study of uterine endometrial carcinoma in young women aged 40 years and younger. Int J Gynecol Cancer 2005;15(4):657-62. 16. Niwa K, Tagami K, Lian Z, Onogi K, Mori H, Tamaya T. Outcome of fertility-preserving treatment in young women with endometrial carcinomas. BJOG 2005;112(3):317-20. 17. Mousavi A.S, Behtash N, Karimi Zarchi M, Modarres Gilani M, Ghaemmaghami F. Fertility preservation in young women with endometrial carcinoma; report of three cases. TUMJ 2007;65(2):827.


Tehran University Medical Journal; Vol. ‫و‬68, No. 9, Dec 2010: 541-546 ‫ﻫﻤﻜﺎران‬

100

The role of estrogen and progesterone receptors in response rate to megestrol acetate: conservative treatment of stage Ia endometrial adenocarcinoma

1

Fariba Yarandi MD. Elham Shirali MD.1 Zahra Eftekhar MD.1 Zahra Khazaeipour MD. MPH.2* 1- Department of Obstetrics and Gynecology, Women Hospital Mirza Koochackhan, Tehran University of Medical Sciences, Tehran, Iran. 2- Preventive and Community, Medicine Specialist, Research Deputy of Imam Khomeini Hospital Complex, Tehran University of Medical Sciences, Tehran, Iran.

Abstract

Received: July 14, 2010 Accepted: October 20, 2010

Background: Surgery is the most effective treatment of well-differentiated endometrial cancer. But using systemic progestins, have been evaluated to treat the young patients with well-differentiated endometrial cancer who wish to preserve their fertility. The aim of this study was the evaluation of megestrol acetate on endometrial adenocarcinoma with regard to the receptors. Methods: This was a quasi-experimental study. In 16 infertile patients with stage Ia well-differentiated endometrial adenocarcinoma. The treatment initiated with 160mg/d of megestrol acetate and continued with 320mg/d for non-responsive cases. All of the patients followed with FD&C and hysteroscopy. The responsive patients were referred to IVF group and they were followed for three years. Results: Of nine patient in the first step of the study, 4 (25%) became pregnant. Eight patients underwent Total Abdominal Hysterectomy (TAH), and one was retreated conservatively. Of seven patient of second step of the study, five are under treatment at the time of closing the paper (three cases candidate for IVF and two are under 320 mg/d megestrol acetate), one patient is a candidate for hysterectomy, and one exited of study because of male infertility. All of the patients were progesterone receptor positive, and only one was estrogen receptor negative. Conclusion: Conservative treatment of early stage well-differentiated endometrial adenocarcinoma with progestins may be used in highly selected young patients who have not completed their family. Close long- term follow up in this special group of patients is necessary. The evaluation of estrogen and progesterone receptors assay may be useful in predicting response to the treatment. Keywords: Endometrial adenocarcinoma, megestrol acetate, well.

*

Corresponding author: Research Deputy of Imam Khomeini Hospital Complex, Tehran University of Medical Sciences, Tehran, Iran. Tel: +98-912-5146752 email: khazaeipour@razi.tums.ac.ir

1389 ‫ آذر‬،9 ‫ ﺷﻤﺎره‬، 68 ‫ دوره‬،‫ داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‬،‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‬


‫‪،1389‬ﻣﺰﻣﻦ‬ ‫ﻓﻴﺸﺮآﻧﺎل‬ ‫ﺟﺎﻧﺒﻲ‪-‬‬ ‫دﻳﺴﭙﻮرت‬ ‫ﻣﻘﺎﻳﺴﻪﺪهﺗﺰرﻳﻖ‬ ‫‪547-552‬‬ ‫درﻣﺎن‪ ،9‬آذر‬ ‫داﺧﻠﻲ ‪،‬درﺷﻤﺎره‬ ‫دوره ‪68‬‬ ‫اﺳﻔﻨﻜﺘﺮوﺗﻮﻣﻲﺗﻬﺮان‪،‬‬ ‫داﻧﺸﮕﺎهو ﻋﻠﻮم ﭘﺰﺷﻜﻲ‬ ‫ﭘﺰﺷﻜﻲ‪،‬‬ ‫ﻣﺠﻠﻪ داﻧﺸﻜ‬

‫ﻣﻘﺎﻳﺴﻪ ﺗﺎﺛﻴﺮ ﺗﺰرﻳﻖ ﺗﻮﻛﺴﻴﻦ ﺑﻮﺗﻮﻟﻴﻨﻴﻮم و اﺳﻔﻨﻜﺘﺮوﺗﻮﻣﻲ ﺟﺎﻧﺒﻲ‪ -‬داﺧﻠﻲ در درﻣﺎن ﻓﻴﺸﺮآﻧﺎل ﻣﺰﻣﻦ‬

‫ﺗﺎرﻳﺦ درﻳﺎﻓﺖ ﻣﻘﺎﻟﻪ‪ 1389/03/23 :‬ﺗﺎرﻳﺦ ﭘﺬﻳﺮش‪1389/05/19 :‬‬

‫ﭼﻜﻴﺪه‬

‫‪1‬‬

‫ﻣﻬﺪي ﻋﺴﮕﺮي‬

‫زﻣﻴﻨﻪ و ﻫﺪف‪ :‬ﺳﻢ ﺑﻮﺗﻮﻟﻴﻨﻴﻮم )دﻳﺴﭙﻮرت( ﻧﻮﻋﻲ ﺳﻢ ﻗﻮي و ﻧﻴﻤﻪ ﺑﻴﻮﻟﻮژﻳﻚ اﺳﺖ‪ .‬اﻳﻦ ﻣﺎده در ﺷﻜﻞ داروﻳﻲ ﺧﻮد‬

‫‪*2‬‬

‫ﺳﻴﺪ ﻣﺴﻴﺢ ﻣﻴﺮرﻛﻨﻲ‬

‫ﺑﻪﻋﻨﻮان ﻳﻚ روش درﻣﺎﻧﻲ ﻗﺎﺑﻞ ﻗﺒﻮل ﺑﺮاي اﺧﺘﻼﻻت ﺧﻮشﺧﻴﻢ آﻧﺎل ﻣﻮرد اﺳﺘﻔﺎده ﻗﺮار ﻣﻲﮔﻴﺮد‪ .‬ﻫﺪف از اﻧﺠﺎم اﻳﻦ‬ ‫‪ -1‬ﮔﺮوه ﺟﺮاﺣﻲ ﻋﻤﻮﻣﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ‬

‫ﻣﻄﺎﻟﻌﻪ ارزﻳﺎﺑﻲ ﺗﺎﺛﻴﺮ داروي دﻳﺴﭙﻮرت ﺗﺰرﻳﻖ ﺷﺪه در اﺳﻔﻨﻜﺘﺮ آﻧﺎل در درﻣﺎن ﻓﻴﺸﺮ ﻣﺰﻣﻦ آﻧﺎل در ﻣﻘﺎﻳﺴﻪ ﺑﺎ روش‬

‫اﻫﻮاز‪ ،‬ﺑﻴﻤﺎرﺳﺘﺎن رازي اﻫﻮاز‪ ،‬اﻫﻮاز‪ ،‬اﻳﺮان‪.‬‬

‫ﺟﺮاﺣﻲ اﺳﻔﻨﻜﺘﺮوﺗﻮﻣﻲ ﻟﺘﺮال اﻳﻨﺘﺮال اﺳﺖ‪ .‬روش ﺑﺮرﺳﻲ‪ 36 :‬ﺑﻴﻤﺎر در دو ﮔﺮوه ﻣﺴﺎوي ‪ 18‬ﻧﻔﺮه وارد ﻣﻄﺎﻟﻌﻪ ﺷﺪﻧﺪ‪.‬‬

‫‪ -2‬ﮔﺮوه ﺟﺮاﺣﻲ ﻋﻤﻮﻣﻲ‪ ،‬ﺑﻴﻤﺎرﺳﺘﺎن رازي اﻫﻮاز‪،‬‬ ‫اﻫﻮاز‪ ،‬اﻳﺮان‪.‬‬

‫در ﮔﺮوه دﻳﺴﭙﻮرت‪ 25 ،‬واﺣﺪ ﺳﻢ ﺑﻮﺗﻮﻟﻴﻨﻴﻮم ﺑﻪ داﺧﻞ اﺳﻔﻨﻜﺘﺮ در ﺳﺎﻋﺖﻫﺎي ‪ 3‬و ‪ 9‬در وﺿﻌﻴﺖ ﻟﻴﺘﻮﺗﻮﻣﻲ )در‬ ‫ﻣﺠﻤﻮع ﺑﻪﻣﻴﺰان ‪ 50‬واﺣﺪ( ﺗﺰرﻳﻖ ﺷﺪ و در ﮔﺮوه ﺟﺮاﺣﻲ ﻋﻤﻞ اﺳﻔﻨﻜﺘﺮوﺗﻮﻣﻲ ﻛﻨﺎري‪ -‬داﺧﻠﻲ در ﺳﻤﺖ ﭼﭗ اﻧﺠﺎم‬ ‫ﺷﺪ‪ .‬ﻧﺘﻴﺠﻪ ﺟﺮاﺣﻲ و ﺗﺰرﻳﻖ دﻳﺴﭙﻮرت ﺷﺎﻣﻞ ﻛﺎﻫﺶ درد‪ ،‬ﺑﻬﺒﻮدي ﻓﻴﺸﺮ و ﺑﺮوز ﻋﺎرﺿﻪ ﺑﻲاﺧﺘﻴﺎري دﻓﻊ ﮔﺎز و ﻣﺪﻓﻮع‬ ‫در دو ﮔﺮوه و در ﻳﻚ دورة ﭘﻲﮔﻴﺮي ﺷﺶ ﻣﺎﻫﻪ ﺑﺎ ﻳﻜﺪﻳﮕﺮ ﻣﻘﺎﻳﺴﻪ ﺷﺪ‪ .‬ﻳﺎﻓﺘﻪﻫﺎ‪ :‬ﻣﻴﺎﻧﮕﻴﻦ ﺳﻨﻲ و ﻧﺴﺒﺖ ﺟﻨﺴﻲ دو‬ ‫ﮔﺮوه ﺗﻔﺎوت آﻣﺎري ﻣﻌﻨﻲداري ﻧﺪاﺷﺖ‪ .‬ﺷﺪت درد ﭘﺲ از درﻣﺎن در ﮔﺮوه ﺟﺮاﺣﻲ ﭘﺎﻳﻴﻦﺗﺮ از ﮔﺮوه دﻳﺴﭙﻮرت ﺑﻮد‬ ‫)‪ 0/4±0/7‬در ﻣﻘﺎﺑﻞ ‪ .(p<0/001 ،3/2±2/6‬ﻣﻴﺰان ﺑﻬﺒﻮدي در ﮔﺮوه ﺟﺮاﺣﻲ ﺑﺎﻻﺗﺮ از ﮔﺮوه دﻳﺴﭙﻮرت ﺑﻮد )‪ %95‬در‬ ‫ﻣﻘﺎﺑﻞ ‪ .(p<0/001 ،%44/6‬ﻋﺎرﺿﻪ ﺑﻲاﺧﺘﻴﺎري ﭘﺲ از ﺷﺶ ﻣﺎه در ﻫﺮ دو ﮔﺮوه دﻳﺪه ﻧﺸﺪ‪ .‬ﻧﺘﻴﺠﻪﮔﻴﺮي‪ :‬ﺑﺎ ﺗﻮﺟﻪ ﺑﻪ‬ ‫ﻧﺘﺎﻳﺞ اﻳﻦ ﻣﻄﺎﻟﻌﻪ ﺑﻪﻧﻈﺮ ﻣﻲرﺳﺪ ﺗﺰرﻳﻖ ﺗﻮﻛﺴﻴﻦ ﺑﻮﺗﻮﻟﻴﻨﻴﻮم روش درﻣﺎﻧﻲ ﻣﻨﺎﺳﺒﻲ در ﻣﻘﺎﻳﺴﻪ ﺑﺎ ﺟﺮاﺣﻲ اﺳﻔﻨﻜﺘﺮوﺗﻮﻣﻲ‬

‫*‬

‫ﻧﻮﻳﺴﻨﺪه ﻣﺴﺌﻮل‪ :‬اﻫﻮاز‪ ،‬ﺑﻴﻤﺎرﺳﺘﺎن رازي‪ ،‬ﮔﺮوه ﺟﺮاﺣﻲ‬

‫در درﻣﺎن ﻓﻴﺸﺮ آﻧﺎل ﻣﺰﻣﻦ ﻧﻤﻲﺑﺎﺷﺪ‪ .‬اﻧﺠﺎم ﻣﻄﺎﻟﻌﺎت ﺑﻴﺸﺘﺮ ﺑﺮاي رﺳﻴﺪن ﺑﻪ ﻧﺘﺎﻳﺞ ﻗﻄﻌﻲﺗﺮ ﺿﺮوري اﺳﺖ‪.‬‬

‫ﺗﻠﻔﻦ‪0913-3546144 :‬‬ ‫‪email: smmirrokni@live.com‬‬

‫ﻛﻠﻤﺎت ﻛﻠﻴﺪي‪ :‬ﺳﻢ ﺑﻮﺗﻮﻟﻴﻨﻴﻮم‪ ،‬اﺳﻔﻨﻜﺘﺮوﺗﻮﻣﻲ داﺧﻠﻲ‪ ،‬ﻓﻴﺸﺮ آﻧﺎل‪.‬‬

‫ﻣﻘﺪﻣﻪ‬

‫از داروﻫﺎﻳﻲ ﻛﻪ ﺳﺒﺐ ﻛﺎﻫﺶ ﺗﻮﻧﻴﺴﻴﺘﻪ ﻋﻀﻠﻪ اﺳﻔﻨﻜﺘﺮ ﻣﻲﺷﻮﻧﺪ‬

‫ﻓﻴﺸﺮ آﻧﺎل )‪ (Anal fissure‬ﻳﻚ زﺧﻢ ﻃﻮﻟﻲ و دردﻧﺎك در آﻧﻮدرم ﺗﺎ‬

‫ﺑﻪوﺟﻮد آﻣﺪه اﺳﺖ‪ 7.‬در ﻣﻴﺎن داروﻫﺎي ﻣﻮرد اﺳﺘﻔﺎده ﺑﺮاي درﻣﺎن‬

‫ﺧﻂ دﻧﺪاﻧﻪاي اﺳﺖ‪ 1‬ﻛﻪ ﺷﺎﻳﻊ ﺑﻮده و ﻣﻮﺟﺐ ﻧﺎراﺣﺘﻲ ﺷﺪﻳﺪ ﺑﻴﻤﺎر و‬

‫ﻏﻴﺮﺟﺮاﺣﻲ و ﻣﻮﺿﻌﻲ‪ ،‬ﺗﻮﺟﻪ وﻳﮋهاي ﺑﻪ ﺗﻮﻛﺴﻴﻦ ﺑﻮﺗﻮﻟﻴﻨﻴﻮم ﺷﺪه ﻛﻪ‬

‫اﺧﺘﻼل ﻋﻤﻠﻜﺮد ﻓﺮدي و اﺟﺘﻤﺎﻋﻲ وي ﻣﻲﺷﻮد و ﻫﺰﻳﻨﻪﻫﺎي ﻗﺎﺑﻞ‬

‫دﻟﻴﻞ آن ﻋﻮد و ﻋﻮارض ﺟﺎﻧﺒﻲ ﻛﻤﺘﺮ در ﺑﻴﻤﺎران ﺗﺤﺖ درﻣﺎن ﺑﻮده‬ ‫‪8‬‬

‫ﺗﻮﺟﻬﻲ را ﻧﻴﺰ ﺑﻪ ﺑﻴﻤﺎران و ﺳﻴﺴﺘﻢﻫﺎي ﺑﻬﺪاﺷﺘﻲ و درﻣﺎﻧﻲ ﺗﺤﻤﻴﻞ‬

‫اﺳﺖ‪ .‬ﺑﺎ اﻳﻦ ﺣﺎل ﺑﺮﺧﻲ از ﻣﻄﺎﻟﻌﺎت ﻧﻴﺰ در ﺧﺼﻮص اﺛﺮﺑﺨﺸﻲ‬

‫ﻣﻲﻛﻨﺪ‪ 2.‬ﺷﻮاﻫﺪ اﺧﻴﺮ ﻧﺸﺎن ﻣﻲدﻫﺪ ﻓﻴﺸﺮ آﻧﺎل ﺑﻪﺗﻨﻬﺎﻳﻲ ﻣﻲﺗﻮاﻧﺪ‬

‫ﺗﻮﻛﺴﻴﻦ ﺑﻮﺗﻮﻟﻴﻨﻴﻮم ﻧﺘﺎﻳﺞ ﻣﺘﻔﺎوﺗﻲ را ﻧﺸﺎن داده و آن را داروي ﭼﻨﺪان‬

‫ﺑﻪﻋﻠﺖ ﻓﺸﺎر ﺑﺎﻻي اﺳﻔﻨﻜﺘﺮ آﻧﺎل و اﻳﺴﻜﻤﻲ ﺛﺎﻧﻮﻳﻪ ﻣﻮﺿﻌﻲ اﻳﺠﺎد‬ ‫ﺷﻮد‪،‬‬

‫‪3-5‬‬

‫از اﻳﻦرو روشﻫﺎي درﻣﺎﻧﻲ ﻛﻪ ﻣﻮﺟﺐ ﻛﺎﻫﺶ ﺗﻮن اﺳﻔﻨﻜﺘﺮ‬ ‫‪6‬‬

‫‪10‬و‪9‬‬

‫ﻣﻮﺛﺮي ﻧﺪاﻧﺴﺘﻪاﻧﺪ‪.‬‬

‫ﺑﻪﻫﻤﻴﻦ دﻟﻴﻞ ﺑﻪﻧﻈﺮ ﻣﻲرﺳﺪ ﻛﻪ اﻧﺠﺎم ﻣﻄﺎﻟﻌﺎت‬

‫ﺑﻴﺸﺘﺮ ﺑﺮاي رﺳﻴﺪن ﺑﻪ ﻧﺘﺎﻳﺞ ﻗﻄﻌﻲﺗﺮ ﺿﺮوري ﺑﺎﺷﺪ‪ .‬ﻫﺪف از اﻳﻦ‬

‫داﺧﻠﻲ آﻧﺎل ﺷﻮﻧﺪ‪ ،‬ﻣﻲﺗﻮاﻧﻨﺪ ﻣﻮﺟﺐ ﺑﻬﺒﻮدي آن ﺷﻮﻧﺪ‪ .‬اﺳﺘﺎﻧﺪارد‬

‫ﻣﻄﺎﻟﻌﻪ ﻣﻘﺎﻳﺴﻪ ﺗﺎﺛﻴﺮ روش ﺟﺮاﺣﻲ اﺳﻔﻨﻜﺘﺮوﺗﻮﻣﻲ داﺧﻠﻲ‪ -‬ﺟﺎﻧﺒﻲ و‬

‫ﻃﻼﻳﻲ درﻣﺎن ﻓﻴﺸﺮ آﻧﺎل‪ ،‬اﺳﻔﻨﻜﺘﺮوﺗﻮﻣﻲ داﺧﻠﻲ ﺟﺎﻧﺒﻲ ﺑﺎ اﺛﺮﺑﺨﺸﻲ ﺑﻴﻦ‬

‫ﺗﺰرﻳﻖ ﺗﻮﻛﺴﻴﻦ ﺑﻮﺗﻮﻟﻴﻨﻴﻮم ﺑﺎ ﻳﻜﺪﻳﮕﺮ در درﻣﺎن ﻓﻴﺸﺮ آﻧﺎل ﻣﺰﻣﻦ اﺳﺖ‪.‬‬

‫‪ 94‬ﺗﺎ ‪ 100‬درﺻﺪ ﻣﻲﺑﺎﺷﺪ‪ .‬ﺑﺎ اﻳﻦ ﺣﺎل‪ ،‬ﻧﮕﺮاﻧﻲ در ﻣﻮرد ﻋﻮارض‬ ‫ﻏﻴﺮﻗﺎﺑﻞ ﺑﺎزﮔﺸﺖ اﺳﻔﻨﻜﺘﺮ‪ ،‬اﻳﻦ روش را ﺑﺎ ﻣﺤﺪودﻳﺖ ﻫﻤﺮاه ﺳﺎﺧﺘﻪ‬

‫روش ﺑﺮرﺳﻲ‬

‫اﺳﺖ‪ 2.‬ﺑﻪ ﻫﻤﻴﻦ دﻟﻴـﻞ روﻳﻜﺮد ﺟﺪﻳﺪي از ﺳﻮي ﭘﺰﺷﻜﺎن ﺑﺮاي اﺳﺘﻔﺎده‬

‫در ﻳـﻚ ﻣﻄﺎﻟﻌﻪ ﻛﺎرآزﻣﺎﻳﻲ ﺑﺎﻟﻴـﻨﻲ ﺗﺼﺎدﻓﻲ ﻛﻪ ﻃﻲ ﺑﻬـﺎر و ﭘﺎﻳﻴﺰ ﺳﺎل‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬


‫‪548‬‬

‫ﻣﻬﺪي ﻋﺴﮕﺮي و ﻫﻤﻜﺎران‬

‫‪ 1388‬در ﺑﻴﻤﺎرﺳﺘﺎن رازي اﻫﻮاز اﻧﺠﺎم ﺷﺪ‪ 36 ،‬ﺑﻴﻤﺎر ﻣﺒﺘﻼ ﺑﻪ ﻓﻴﺸﺮآﻧﺎل‬

‫ﻳﻚ ﺳﺮﻧﮓ ﻳﻚ ﻣﻴﻠﻲﻟﻴﺘﺮي ﺑﺎ ﻧﻴﺪل ‪ 25) 0/5ml ،27gauge‬واﺣﺪ( از‬

‫ﻣﺰﻣﻦ ﻛﻪ ﺑﺎﻻي ‪ 18‬ﺳﺎل ﺳﻦ داﺷﺘﻪ و ﺑﻪ درﻣﺎﻧﮕﺎه ﺟﺮاﺣﻲ ﺑﻴﻤﺎرﺳﺘﺎن‬

‫ﻣﺤﻠﻮل ﺑﻪداﺧﻞ اﺳﻔﻨﻜﺘﺮ داﺧﻠﻲ در ﻫﺮ ﻃﺮف )ﺳﺎﻋﺖﻫﺎي ﺳﻪ و ‪ 9‬در‬

‫ﻣﺬﻛﻮر ﻣﺮاﺟﻌﻪ ﻛﺮده ﺑﻮدﻧﺪ اﻧﺘﺨﺎب ﺷﺪﻧﺪ‪ .‬ﻣﻌﻴﺎر ورود ﺑﻪ ﻣﻄﺎﻟﻌﻪ‬

‫وﺿﻌﻴﺖ ﻟﻴﺘﻮﺗﻮﻣﻲ( ﺟﻤﻌﺎً ﺑﻪﻣﻴﺰان ‪ 50‬واﺣﺪ ﺑﺎ ﻓﺎﺻﻠﻪ ﻛﻮﺗﺎﻫﻲ از ﻓﻴﺸﺮ‬

‫ﻋﺒﺎرت ﺑﻮد از ﺳﭙﺮي ﺷﺪن ﺣﺪاﻗﻞ ﺷﺶ ﻫﻔﺘﻪ از ﻋﻼﻳﻢ و ﻋﺪم ﺑﻬﺒﻮد ﺑﺎ‬

‫ﺗﺰرﻳﻖ ﻣﻲﺷﺪ‪ .‬در ﮔﺮوه ﺟﺮاﺣﻲ ﺑﻴﻤﺎران ﺗﺤﺖ ﺑﻴﻬﻮﺷﻲ ﻋﻤﻮﻣﻲ ﻳﺎ‬

‫درﻣﺎنﻫﺎي ﻧﮕﻬﺪارﻧﺪه و ﻣﻌﻴﺎرﻫﺎي ﺧﺮوج از ﻣﻄﺎﻟﻌﻪ ﻋﺒﺎرﺗﻨﺪ ﺑﻮدﻧﺪ از‬

‫ﺑﻲﺣﺴﻲ اﺳﭙﺎﻧﻴﺎل ﻗﺮار ﮔﺮﻓﺘﻪ و در وﺿﻌﻴﺖ ﻟﻴﺘﻮﺗﻮﻣﻲ ﺑﻪروش ﺑﺎز ﺗﺤﺖ‬

‫ﻋﻤﻞ ﺟﺮاﺣﻲ ﻗﺒﻠﻲ ﺑﺮ روي ﻧﺎﺣﻴﻪ آﻧﺎل‪ ،‬ﺳﺎﺑﻘﻪ اﺑﺘﻼ ﺑﻪ ﻫﻤﻮروﻳﻴﺪ و‬

‫اﺳﻔﻨﻜﺘﺮوﺗﻮﻣﻲ ﻛﻨﺎري‪ -‬داﺧﻠﻲ آﻧﺎل در ﺳﻤﺖ ﭼﭗ ﻗﺮار ﮔﺮﻓﺘﻪ و ﺳﭙﺲ‬

‫ﻓﻴﺴﺘﻮل آﻧﺎل‪ ،‬ﺳﻞ ﻳﺎ ﺑﻴﻤﺎريﻫﺎي اﻟﺘﻬﺎﺑﻲ روده‪ ،‬ﺑﻴﻤﺎران ﺗﺤﺖ درﻣﺎن ﺑﺎ‬

‫ﺑﺪون ﺳﻮﭼﻮر ﺑﻪ ﻣﺪت ﭘﻨﺞ دﻗﻴﻘﻪ ﺑﺎ ﻓﺸﺎر ﻣﺴﺘﻘﻴﻢ دﺳﺖ ﻣﺤﻞ ﻋﻤﻞ‬

‫داروﻫﺎي ﺿﺪ اﻧﻌﻘﺎدي‪ ،‬رادﻳﻮﺗﺮاﭘﻲ ﻟﮕﻦ ﻳﺎ ﺷﻴﻤﻲدرﻣﺎﻧﻲ‪ ،‬ﺑﻴﻤﺎران ﻗﻠﺒﻲ‪،‬‬

‫ﻓﺸﺮده ﺷﺪه و در ﻧﻬﺎﻳﺖ ﺑﻪﻣﻨﻈﻮر ﺗﺎﻣﭙﻮن ﭘﺎﻧﺴﻤﺎن ﻓﺸﺎري اﻧﺠﺎم ﻣﻲﺷﺪ‪.‬‬

‫ﺑﺎردار‪ ،‬دﻳﺎﺑﺘﻲ و ﻛﺴﺎﻧﻲ ﻛﻪ از ورود ﺑﻪ ﻣﻄﺎﻟﻌﻪ و ﻳﺎ ﭘﻲﮔﻴﺮي ﭘﺲ از‬

‫ﭘﺲ از درﻣﺎن و در ﻃﻲ دوره ﭘﻲﮔﻴﺮي ﺑﻪ ﺑﻴﻤﺎران آﻣﻮزشﻫﺎي ﻻزم در‬

‫‪Arroyo‬‬

‫ﺧﺼﻮص ﻣﺼﺮف ﻏﺬاﻫﺎي ﭘﺮﻓﻴﺒﺮ و ﻧﺸﺴﺘﻦ در ﺣﻤﺎم آﺑﮕﺮم اراﺋﻪ‬

‫‪ 36‬ﻧﻔﺮ ﻣﺤﺎﺳﺒﻪ ﺷﺪ‪ 8.‬ﺑﻴﻤﺎران ﺑﻪ دو ﮔﺮوه ﻣﺴﺎوي ‪ 18‬ﻧﻔﺮه ﺗﻘﺴﻴﻢ‬

‫ﻣﻲﺷﺪ و درﺧﻮاﺳﺖ ﻣﻲﺷﺪ ﺗﺎ در ﻫﻔﺘﻪ اول و ﺳﭙﺲ ﻣﺎه اول‪ ،‬دوم‪،‬‬

‫ﺷﺪﻧﺪ‪ .‬روش اﻧﺘﺨﺎب ﺑﻴﻤﺎران ﺑﻪﺻﻮرت ﺗﺼﺎدﻓﻲ ﺳﺎده ﺑﻮد‪ .‬ﺑﺎ‬

‫ﭼﻬﺎرم و ﺷﺸﻢ ﻣﺮاﺟﻌﻪ و ﻣﻮرد ﺑﺮرﺳﻲ و ﻣﻌﺎﻳﻨﻪ ﻗﺮار ﮔﺮﻓﺘﻪ و ﻣﻴﺰان‬

‫ﻗﺮﻋﻪﻛﺸﻲ اوﻟﻴﻦ ﺑﻴﻤﺎر در ﮔﺮوه ﺟﺮاﺣﻲ و ﺑﻴﻤﺎر ﺑﻌﺪي در ﮔﺮوه‬

‫درد‪ ،‬ﺑﻲاﺧﺘﻴﺎري دﻓﻊ ﮔﺎز و ﻣﺪﻓﻮع و ﺑﻬﺒﻮدي ﻣﺸﺨﺺ ﮔﺮدد‪ .‬ﻧﺘﺎﻳﺞ‬

‫درﻣﺎن ﻣﻨﺼﺮف ﺷﺪﻧﺪ‪ .‬ﺣﺠﻢ ﻧﻤﻮﻧﻪ ﻣﻮرد ﻧﻴﺎز ﺑﺮاﺳﺎس ﻣﻄﺎﻟﻌﻪ‬

‫‪SPSS‬‬

‫وﻳﺮاﺳﺖ ‪ 14‬ﻣﻮرد ﺗﺠﺰﻳﻪ و ﺗﺤﻠﻴﻞ ﻗﺮار ﮔﺮﻓﺖ‪.‬‬

‫دﻳﺴﭙﻮرت ﻗﺮار ﻣﻲﮔﺮﻓﺖ‪ .‬ﺳﭙﺲ ﺑﻴﻤﺎران ﺗﺤﺖ ﻣﺸﺎوره ﻗﺮار ﮔﺮﻓﺘﻪ و‬

‫ﺗﻮﺳﻂ ﻧﺮماﻓﺰار‬

‫اﻃﻼﻋﺎت ﻛﺎﻓﻲ و ﻛﺎﻣﻠﻲ در ﺧﺼﻮص روش‪ ،‬ﻣﺰاﻳﺎ و ﻣﻌﺎﻳﺐ روش‬

‫ﺑﺮاي ﺑﻴﺎن دادهﻫﺎي ﻛﻤ‪‬ﻲ )ﻣﻴﺎﻧﮕﻴﻦ و اﻧﺤﺮاف ﻣﻌﻴﺎر( و ﻛﻴﻔﻲ )ﻓﺮاواﻧﻲ و‬

‫ﺟﺮاﺣﻲ ﻳﺎ ﺗﺰرﻳﻖ دﻳﺴﭙﻮرت در اﺧﺘﻴﺎر آنﻫﺎ ﻗﺮار ﮔﺮﻓﺘﻪ و در ﺻﻮرت‬

‫ﻧﺴﺒﺖ( از آﻣﺎر ﺗﻮﺻﻴﻔﻲ و ﺑﺮاي ﻣﻘﺎﻳﺴﺔ ﻧﺴﺒﺖﻫﺎ در دو ﮔﺮوه از آزﻣﻮن‬

‫رﺿﺎﻳﺖ و ﭘﺲ از اﻣﻀﺎ رﺿﺎﻳﺖﻧﺎﻣﻪ ﻛﺘﺒﻲ‪ ،‬وارد ﻣﻄﺎﻟﻌﻪ ﻣﻲﺷﺪﻧﺪ‪ .‬ﺑﻪ‬

‫‪2‬‬

‫ﺑﻴﻤﺎران ﺗﻮﺿﻴﺢ داده ﻣﻲﺷﺪ در ﻫﺮ ﻣﺮﺣﻠﻪ ﻛﻪ ﻣﺎﻳﻞ ﺑﺎﺷﻨﺪ ﻣﻲﺗﻮاﻧﻨﺪ از‬

‫ﻣﻌﻨﻲدار در اﻳﻦ ﻣﻄﺎﻟﻌﻪ ‪ p<0/05‬ﺑﻮد‪.‬‬

‫‪‬‬

‫و ﺑﺮاي ﻣﻘﺎﻳﺴﺔ ﻣﻴﺎﻧﮕﻴﻦﻫﺎ از ‪ Student’s t-test‬اﺳﺘﻔﺎده ﺷﺪ‪ .‬ﺳﻄﺢ‬

‫ﻣﻄﺎﻟﻌﻪ ﺧﺎرج ﺷﺪه‪ ،‬اﻃﻼﻋﺎت ﺷﺨﺼﻲ آنﻫﺎ ﻣﺤﺮﻣﺎﻧﻪ ﻣﺎﻧﺪه و ﻧﺘﺎﻳﺞ‬ ‫ﺑﻪﺻﻮرت ﻛﻠﻲ و ﺑﺪون درج ﻧﺎم ﺑﻴﻤﺎر ﻣﻨﺘﺸﺮ ﻣﻲﺷﻮد‪ .‬ﻣﺸﺨﺼﺎت‬

‫ﻳﺎﻓﺘﻪﻫﺎ‬

‫ﺑﻴﻤﺎران ﺷﺎﻣﻞ ﺳﻦ و ﺟﻨﺲ ﻣﺸﺨﺺ و وارد ﭘﺮﺳﺸﻨﺎﻣﻪ ﺷﺪه و ﺳﭙﺲ‬

‫در اﻳﻦ ﻣﻄﺎﻟﻌﻪ ‪ 36‬ﺑﻴﻤﺎر ﻣﻮرد ﺑﺮرﺳﻲ ﻗﺮار ﮔﺮﻓﺘﻨﺪ ﻛﻪ ﺑﻪ دو ﮔﺮوه ‪18‬‬

‫اﻃﻼﻋﺎت ﺑﺎﻟﻴﻨﻲ آنﻫﺎ ﺷﺎﻣﻞ ﻣﺤﻞ ﻓﻴﺸﺮ و ﺷﺪت درد ﺑﺮ ﻣﺒﻨﺎي ﻣﻌﻴﺎر‬

‫ﻧﻔﺮه دﻳﺴﭙﻮرت و ﺟﺮاﺣﻲ ﺗﻘﺴﻴﻢ ﺷﺪﻧﺪ‪ .‬ﻣﻴﺎﻧﮕﻴﻦ ﺳﻨﻲ ﺑﻴﻤﺎران در ﮔﺮوه‬

‫)‪ Visual Analog Scale (VAS‬ﺗﻌﻴﻴﻦ ﻣﻲﮔﺮدﻳﺪ‪ .‬ﺳﭙﺲ درﻣﺎن ﻣﻮرد ﻧﻈﺮ‬

‫دﻳﺴﭙﻮرت ‪ 33/5±7/8‬ﺳﺎل و در ﮔﺮوه ﺟﺮاﺣﻲ ‪ 33/3±7/9‬ﺳﺎل ﺑﻮده‬

‫اﻧﺠﺎم ﻣﻲﺷﺪ‪ .‬ﭘﺮ ﻛﺮدن ﭘﺮﺳﺸﻨﺎﻣﻪ و ﻋﻤﻞ ﺟﺮاﺣﻲ ﺗﻮﺳﻂ دو ﭘﺰﺷﻚ‬

‫اﺳﺖ )‪ 10 .(p=0/933‬ﺑﻴﻤﺎر )‪ (%55/6‬در ﮔﺮوه دﻳﺴﭙﻮرت و ‪ 11‬ﺑﻴﻤﺎر‬

‫ﻣﺨﺘﻠﻒ اﻧﺠﺎم ﻣﻲﺷﺪ‪ .‬ﺑﺮاي ﺑﻴﻤﺎران ﮔﺮوه دﻳﺴﭙﻮرت از وﻳﺎل ‪500‬‬

‫در ﮔﺮوه ﺟﺮاﺣﻲ )‪ (%61/1‬ﻣﺬﻛﺮ ﺑﻮدﻧﺪ )‪ .(p=0/746‬در ﮔﺮوه‬

‫واﺣﺪي اﻳﻦ دارو ﺳﺎﺧﺖ ﺷﺮﻛﺖ ‪ Ispen Biopharm‬اﻧﮕﻠﺴﺘﺎن اﺳﺘﻔﺎده‬

‫دﻳﺴﭙﻮرت ﺳﻪ ﺑﻴﻤﺎر )‪ (%16/7‬داراي ﻓﻴﺸﺮ در ﻗﺪام و ‪ 15‬ﺑﻴﻤﺎر‬

‫ﺷﺪ‪ .‬ﻧﺤﻮه ﺗﺰرﻳﻖ دارو ﺑﻪ اﻳﻦ ﺗﺮﺗﻴﺐ ﺑﻮد ﻛﻪ اﺑﺘﺪا ﻳﻚ ﻣﻴﻠﻲﻟﻴﺘﺮ از‬

‫)‪ (%83/3‬داراي ﻓﻴﺸﺮ در ﺑﺨﺶ ﺧﻠﻔﻲ ﺑﻮدﻧﺪ‪ .‬در ﮔﺮوه ﺟﺮاﺣﻲ ﭼﻬﺎر‬

‫ﺳﺎﻟﻴﻦ ‪ %0/9‬ﺑﻪ ﻳﻚ وﻳﺎل ‪ 500‬واﺣﺪي دارو اﺿﺎﻓﻪ و دارو ﻛﻪ‬

‫ﺑﻴﻤﺎر )‪ (%22/2‬داراي ﻓﻴﺸﺮ در ﻗﺪام و ‪ 14‬ﺑﻴﻤﺎر )‪ (%77/8‬داراي ﻓﻴﺸﺮ‬

‫ﺑﻪﺻﻮرت ﭘﻮدر اﺳﺖ در ﺳﺎﻟﻴﻦ ﺣﻞ ﻣﻲﮔﺮدﻳﺪ‪ .‬ﺳﭙﺲ ﻣﺤﻠﻮل ﻓﻮق ﺑﻪ‬

‫در ﺑﺨﺶ ﺧﻠﻔﻲ ﺑﻮدﻧﺪ )‪ .(p=0/674‬ﺟﺪول ‪ 1‬ﻣﻴﺎﻧﮕﻴﻦ ﺷﺪت درد در‬

‫داﺧﻞ ﻳﻚ ﺳﺮﻧﮓ ‪ 10‬ﻣﻴﻠﻲﻟﻴﺘﺮي ﻛﺸﻴﺪه ﺷﺪه و ﺣﺠﻢ آن ﺗﻮﺳﻂ‬

‫دو ﮔﺮوه ﻣﻮرد و ﺷﺎﻫﺪ را ﺑﺮ ﺣﺴﺐ زﻣﺎن ﺑﺮرﺳﻲ ﻧﺸﺎن ﻣﻲدﻫﺪ‪.‬‬

‫ﻣﺤﻠﻮل ﺳﺎﻟﻴﻦ ‪ %0/9‬ﺑﻪ ‪ 10‬ﻣﻴﻠﻲﻟﻴﺘﺮ رﺳﺎﻧﺪه ﻣﻲﺷﺪ‪ .‬ﺑﻪ اﻳﻦ ﺗﺮﺗﻴﺐ‬

‫ﻣﺸﺎﻫﺪه ﻣﻲﺷﻮد ﻛﻪ در ﻫﺮ دو ﮔﺮوه ﭘﺲ از درﻣﺎن ﻣﻴﺎﻧﮕﻴﻦ ﺷﺪت درد‬

‫ﻣﺤﻠﻮﻟﻲ ﺑﻪدﺳﺖ ﻣﻲآﻣﺪ ﻛﻪ ﻫﺮ ﻳﻚ ﻣﻴﻠﻲﻟﻴﺘﺮ آن ﺣﺎوي ‪ 50‬واﺣﺪ دارو‬

‫ﻛﺎﻫﺶ ﭘﻴﺪا ﻛﺮده اﺳﺖ‪ .‬ﻛﺎﻫﺶ درد در ﭘﺎﻳﺎن ﻣﺎه اول ﭘﺲ از درﻣﺎن ﺑﻴﻦ‬

‫ﺑﻮد‪ .‬ﺳﭙﺲ در ﺷﺮاﻳﻂ اﺗﺎق ﻋﻤﻞ و ﺑﺪون ﻧﻴﺎز ﺑﻪ ﺑﻲﻫﻮﺷﻲ ﻋﻤﻮﻣﻲ و ﻳﺎ‬

‫دو ﮔﺮوه از ﻧﻈﺮ آﻣﺎري ﺗﻔﺎوت ﻣﻌﻨﻲدار داﺷﺘﻪ و اﻳﻦ ﺗﻔﺎوت ﺗﺎ ﭘﺎﻳﺎن‬

‫ﺑﻲﺣﺴﻲ اﺳﭙﺎﻳﻨﺎل ﺑﻴﻤﺎر در وﺿﻌﻴﺖ ﻟﻴﺘﻮﺗﻮﻣﻲ ﻗﺮار ﮔﺮﻓﺘﻪ و ﺑﻪﻛﻤﻚ‬

‫ﻣﺎه ﺷﺸﻢ از ﺷﺮوع درﻣﺎن ﺣﻔﻆ ﺷﺪه اﺳﺖ ﺑﻪ ﻋﺒﺎرت دﻳﮕﺮ ﺟﺮاﺣﻲ در‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬


‫‪549‬‬

‫ﻣﻘﺎﻳﺴﻪ ﺗﺰرﻳﻖ دﻳﺴﭙﻮرت و اﺳﻔﻨﻜﺘﺮوﺗﻮﻣﻲ ﺟﺎﻧﺒﻲ‪ -‬داﺧﻠﻲ در درﻣﺎن ﻓﻴﺸﺮآﻧﺎل ﻣﺰﻣﻦ‬

‫ﺟﺪول‪ :1-‬ﻣﻴﺎﻧﮕﻴﻦ ﺷﺪت درد در دو ﮔﺮوه دﻳﺴﭙﻮرت و ﺟﺮاﺣﻲ‬ ‫زﻣﺎن ﺑﺮرﺳﻲ‬

‫ﮔﺮوه ﺗﺤﺖ ﻣﻄﺎﻟﻌﻪ‬

‫ﺟﺪول‪ :3-‬ﻣﻘﺎﻳﺴﻪ ﻧﺘﺎﻳﺞ درﻣﺎن ﺑﺎ دﻳﺴﭙﻮرت و ﺟﺮاﺣﻲ ﺑﻪ ﻟﺤﺎظ ﺑﻲاﺧﺘﻴﺎري دﻓﻊﮔﺎز‬

‫ﻣﻴﺎﻧﮕﻴﻦ‬

‫*‪p‬‬

‫دﻳﺴﭙﻮرت‬

‫‪5/78±1/06‬‬

‫‪0/817‬‬

‫ﺟﺮاﺣﻲ‬

‫‪5/67±1/71‬‬

‫دﻳﺴﭙﻮرت‬

‫‪3/72±0/75‬‬

‫ﺟﺮاﺣﻲ‬

‫‪3/50±1/33‬‬

‫دﻳﺴﭙﻮرت‬

‫‪3/39±0/60‬‬

‫ﺟﺮاﺣﻲ‬

‫‪1/94±0/72‬‬

‫دﻳﺴﭙﻮرت‬

‫‪3/33±1/18‬‬

‫ﺟﺮاﺣﻲ‬

‫‪1/56±0/70‬‬

‫ﺷﺪت درد‬ ‫ﻗﺒﻞ از درﻣﺎن‬ ‫ﻳﻚ ﻫﻔﺘﻪ ﭘﺲ از درﻣﺎن‬ ‫ﻳﻚ ﻣﺎه ﭘﺲ از درﻣﺎن‬ ‫دو ﻣﺎه ﭘﺲ از درﻣﺎن‬ ‫ﭼﻬﺎر ﻣﺎه ﭘﺲ از درﻣﺎن‬ ‫ﺷﺶ ﻣﺎه ﭘﺲ از درﻣﺎن‬

‫دﻳﺴﭙﻮرت‬

‫‪2/17±2‬‬

‫ﺟﺮاﺣﻲ‬

‫‪0/61±1/24‬‬

‫دﻳﺴﭙﻮرت‬

‫‪2±0‬‬

‫ﺟﺮاﺣﻲ‬

‫‪0/39±0/77‬‬

‫زﻣﺎن ﭘﺲ از درﻣﺎن‬

‫ﮔﺮوه ﺗﺤﺖ ﻣﻄﺎﻟﻌﻪ‬

‫ﺗﻌﺪاد ﺑﻴﻤﺎر )درﺻﺪ(‬

‫*‪p‬‬

‫دﻳﺴﭙﻮرت‬

‫)‪2(%11/1‬‬

‫‪0/630‬‬

‫ﻳﻚ ﻫﻔﺘﻪ‬ ‫ﻳﻚ ﻣﺎه‬ ‫‪0/543‬‬ ‫دو ﻣﺎه‬ ‫‪0‬‬ ‫ﭼﻬﺎر ﻣﺎه‬ ‫‪0‬‬

‫ﺟﺮاﺣﻲ‬

‫)‪3(%16/7‬‬

‫دﻳﺴﭙﻮرت‬

‫)‪2(%11/1‬‬

‫ﺟﺮاﺣﻲ‬

‫)‪2(%11/1‬‬

‫دﻳﺴﭙﻮرت‬

‫)‪1(%5/6‬‬

‫ﺟﺮاﺣﻲ‬

‫‪0‬‬

‫دﻳﺴﭙﻮرت‬

‫‪-‬‬

‫‪-‬‬‫‪0/310‬‬ ‫‪--‬‬

‫ﺟﺮاﺣﻲ‬ ‫دﻳﺴﭙﻮرت‬

‫ﺷﺶ ﻣﺎه‬ ‫‪0/008‬‬

‫‪--‬‬

‫‪-‬‬

‫ﺟﺮاﺣﻲ‬ ‫‪2‬‬

‫* آزﻣﻮن ﻣﻮرد اﺳﺘﻔﺎده ‪  -test‬ﺑﻮد و ﺳﻄﺢ ﻣﻌﻨﻲدار ‪ p<0/05‬در ﻧﻈﺮ ﮔﺮﻓﺘﻪ ﺷﺪ‪.‬‬

‫‪0‬‬ ‫‪7‬‬

‫* آزﻣﻮن ﻣﻮرد اﺳﺘﻔﺎده ‪ Student’s t-test‬ﺑﻮد و ﺳﻄﺢ ﻣﻌﻨﻲدار ‪ p<0/05‬در ﻧﻈﺮ ﮔﺮﻓﺘﻪ ﺷﺪ‪.‬‬

‫‪6‬‬ ‫‪5‬‬

‫ﺟﺪول‪ :2-‬ﻣﻘﺎﻳﺴﻪ ﻧﺘﺎﻳﺞ درﻣﺎن ﺑﺎ دﻳﺴﭙﻮرت و ﺟﺮاﺣﻲ ﺑﻪ ﻟﺤﺎظ ﺑﻬﺒﻮد ﻓﻴﺸﺮ‬ ‫زﻣﺎن ﭘﺲ از‬

‫ﮔﺮوه ﺗﺤﺖ ﻣﻄﺎﻟﻌﻪ‬

‫درﺻﺪ ﺑﻬﺒﻮد‬

‫‪4‬‬

‫*‪p‬‬

‫‪3‬‬

‫ﺗﺰرﻳﻖ ﻳﺎ ﺟﺮاﺣﻲ‬ ‫ﻳﻚ ﻫﻔﺘﻪ‬ ‫ﻳﻚ ﻣﺎه‬ ‫دو ﻣﺎه‬ ‫ﭼﻬﺎر ﻣﺎه‬ ‫ﺷﺶ ﻣﺎه‬

‫دﻳﺴﭙﻮرت‬

‫‪0‬‬

‫ﺟﺮاﺣﻲ‬

‫‪0‬‬

‫دﻳﺴﭙﻮرت‬

‫‪0‬‬

‫‪0/016‬‬

‫ﺟﺮاﺣﻲ‬

‫)‪5(%27/8‬‬

‫دﻳﺴﭙﻮرت‬

‫)‪5(%27/8‬‬

‫‪0/091‬‬

‫ﺟﺮاﺣﻲ‬

‫)‪10(%55/6‬‬

‫دﻳﺴﭙﻮرت‬

‫)‪10(%55/6‬‬

‫ﺟﺮاﺣﻲ‬

‫)‪14(%77/8‬‬

‫دﻳﺴﭙﻮرت‬

‫)‪8(%44/4‬‬

‫ﺟﺮاﺣﻲ‬

‫)‪17(%95/4‬‬

‫‪2‬‬

‫‪-‬‬

‫‪1‬‬ ‫‪VAS 6m‬‬

‫‪VAS 4m‬‬

‫‪VAS 2m‬‬

‫‪VAS 1m‬‬

‫‪VAS 1w‬‬

‫‪VAS before‬‬

‫‪0‬‬

‫ﻧﻤﻮدار‪ :1-‬ﻣﻘﺎﻳﺴﻪ ﺗﺎﺛﻴﺮ ﺗﺰرﻳﻖ دﻳﺴﭙﻮرت و ﺟﺮاﺣﻲ در ﻛﺎﻫﺶ درد ﻣﺒﺘﻼﻳﺎن ﻓﻴﺸﺮ‬ ‫آﻧﺎل ﻣﺰﻣﻦ ﻃﻲ ﺷﺶ ﻣﺎه ﭘﻲﮔﻴﺮي‬

‫‪0/157‬‬ ‫‪0/001‬‬

‫* آزﻣﻮن ﻣﻮرد اﺳﺘﻔﺎده ‪ 2 -test‬ﺑﻮد و ﺳﻄﺢ ﻣﻌﻨﻲدار ‪ p<0/05‬در ﻧﻈﺮ ﮔﺮﻓﺘﻪ ﺷﺪ‪.‬‬

‫ﺟﺮاﺣﻲ ﺑﻲاﺧﺘﻴﺎري دﻓﻊ ﮔﺎز ﮔﺰارش ﮔﺮدﻳﺪ وﻟﻲ اﻳﻦ ﺗﻔﺎوت از ﻧﻈﺮ‬ ‫آﻣﺎري ﺑﻴﻦ دو ﮔﺮوه ﻣﻌﻨﻲدار ﻧﺒﻮد‪ .‬در ﭘﺎﻳﺎن ﻳﻚ ﻣﺎه ﭘﺲ از درﻣﺎن‬ ‫ﻫﻤﺎن دو ﺑﻴﻤﺎر از ﮔﺮوه دﻳﺴﭙﻮرت ﻛﻪ از ﺑﻲاﺧﺘﻴﺎري دﻓﻊ ﮔﺎز ﺷﺎﻛﻲ‬ ‫ﺑﻮدﻧﺪ ﻫﻤﭽﻨﺎن از اﻳﻦ ﻣﺸﻜﻞ رﻧﺞ ﻣﻲﺑﺮدﻧﺪ وﻟﻲ ﻳﻚ ﺑﻴﻤﺎر از ﺳﻪ ﺑﻴﻤﺎر‬

‫ﻛﺎﻫﺶ ﺷﺪت درد ﻣﻮﺛﺮﺗﺮ از ﺗﺰرﻳﻖ ﺑﻮده اﺳﺖ‪ .‬ﺟﺪول ‪ 2‬ﻣﻘﺎﻳﺴﻪ ﻧﺘﺎﻳﺞ‬

‫ﮔﺮوه ﺟﺮاﺣﻲ ﺑﻬﺒﻮد ﻳﺎﻓﺘﻪ ﺑﻮد و از ﻧﻈﺮ آﻣﺎري ﺑﻴﻦ دو ﮔﺮوه ﺗﻔﺎوت‬

‫درﻣﺎن ﺑﺎ دﻳﺴﭙﻮرت و ﺟﺮاﺣﻲ را ﺑﻪ ﻟﺤﺎظ ﺑﻬﺒﻮد ﻓﻴﺸﺮ ﻧﺸﺎن ﻣﻲدﻫﺪ‪.‬‬

‫ﻣﻌﻨﻲداري وﺟﻮد ﻧﺪاﺷﺖ‪ .‬در ﭘﺎﻳﺎن دو ﻣﺎه ﭘﺲ از درﻣﺎن از دو ﺑﻴﻤﺎر‬

‫ﻣﺸﺎﻫﺪه ﻣﻲﺷﻮد ﻛﻪ در ﭘﺎﻳﺎن ﻣﺎه اول و ﺷﺸﻢ ﭘﺲ از ﺷﺮوع درﻣﺎن از‬

‫ﮔﺮوه دﻳﺴﭙﻮرت ﻳﻜﻲ ﺑﻬﺒﻮد ﻳﺎﻓﺘﻪ ﺑﻮد وﻟﻲ از ﮔﺮوه ﺟﺮاﺣﻲ ﺳﻪ ﺑﻴﻤﺎر‬

‫ﻧﻈﺮ ﺑﻬﺒﻮد ﺑﺎﻟﻴﻨﻲ ﺑﻴﻦ دو ﮔﺮوه ﺗﻔﺎوت آﻣﺎري ﻣﻌﻨﻲدار ﺷﺪه اﺳﺖ‪ .‬در‬

‫ﺑﻬﺒﻮد ﻳﺎﻓﺘﻪ ﺑﻮدﻧﺪ ﺑﻪﻋﺒﺎرت دﻳﮕﺮ ﭘﺲ از دو ﻣﺎه ﻋﺎرﺿﻪ ﻓﻮق در ﮔﺮوه‬

‫ﺟﺪول ‪ 3‬ﻣﻘﺎﻳﺴﻪ ﻧﺘﺎﻳﺞ درﻣﺎن ﺑﺎ دﻳﺴﭙﻮرت و ﺟﺮاﺣﻲ ﺑﻪ ﻟﺤﺎظ‬

‫ﺟﺮاﺣﻲ ﺑﻪﻃﻮر ﻛﺎﻣﻞ ﺑﺮﻃﺮف ﺷﺪه ﺑﻮد‪ .‬از ﻧﻈﺮ آﻣﺎري در اﻳﻦ زﻣﺎن ﻧﻴﺰ‬

‫ﺑﻲاﺧﺘﻴﺎري ﻧﺸﺎن داده ﺷﺪه اﺳﺖ‪ .‬ﻣﺸﺎﻫﺪه ﻣﻲﺷﻮد ﻛﻪ در ﭘﺎﻳﺎن ﻳﻚ‬

‫ﺑﻴﻦ دو ﮔﺮوه ﺗﻔﺎوت ﻣﻌﻨﻲداري وﺟﻮد ﻧﺪاﺷﺖ‪ .‬در ﭘﺎﻳﺎن ﭼﻬﺎر ﻣﺎه در‬

‫ﻫﻔﺘﻪ ﭘﺲ از درﻣﺎن در دو ﺑﻴﻤﺎر از ﮔﺮوه دﻳﺴﭙﻮرت و ﺳﻪ ﺑﻴﻤﺎر از ﮔﺮوه‬

‫ﮔﺮوه دﻳﺴﭙﻮرت ﻧﻴﺰ ﻋﺎرﺿﻪ ﻓﻮق ﺑﻪﻃﻮر ﻛﺎﻣﻞ ﺑﺮﻃﺮف ﺷﺪه ﺑﻮد‪ .‬ﻧﺴﺒﺖ‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬


‫‪550‬‬

‫ﻣﻬﺪي ﻋﺴﮕﺮي و ﻫﻤﻜﺎران‬

‫ﻋﻮد در ﮔﺮوه دﻳﺴﭙﻮرت دو ﺑﻴﻤﺎر )‪ (%11/1‬و در ﮔﺮوه ﺟﺮاﺣﻲ ﻳﻚ‬

‫ﻛﺮواﺳﻲ ‪ 60‬ﺑﻴﻤﺎر ﻣﺒﺘﻼ ﺑﻪ ﻓﻴﺸﺮ ﻣﺰﻣﻦ آﻧﺎل را ﺑﻪﻃﻮر راﻧﺪوم ﺑﻪدو ﮔﺮوه‬

‫ﺑﻴﻤﺎر )‪ (%5/6‬ﻣﻲﺑﺎﺷﺪ ﻛﻪ ﺗﻔﺎوت آﻣﺎري ﻣﻌﻨﻲداري ﻧﺪارﻧﺪ )‪.(p=0/546‬‬

‫‪ 30‬ﻧﻔﺮي ﺗﻘﺴﻴﻢ ﻛﺮده و ﮔﺮوه اول را ﺗﺤﺖ درﻣﺎن ﺑﺎ ﺗﺰرﻳﻖ ﺑﻮﺗﻮﻛﺲ و‬ ‫ﮔﺮوه دوم را ﺗﺤﺖ درﻣﺎن ﺑﺎ اﺳﻔﻨﻜﺘﺮوﺗﻮﻣﻲ داﺧﻠﻲ آﻧﺎل ﻗﺮار داد‪ .‬اﻳﻦ‬

‫ﺑﺤﺚ‬

‫ﻣﺤﻘﻘﻴﻦ ﺑﻴﻤﺎران را ﻗﺒﻞ و ﺳﻪ ﻣﺎه ﺑﻌﺪ از درﻣﺎن ﺗﺤﺖ ارزﻳﺎﺑﻲ‬

‫ﻧﺘﺎﻳﺞ دادهﻫﺎي ﻣﺎ ﻧﺸﺎن داده اﺳﺖ ﻛﻪ در دو ﮔﺮوه دﻳﺴﭙﻮرت و‬

‫ﻣﺎﻧﻮﻣﺘﺮﻳﻚ و ﺗﺎ ﺷﺶ ﻣﺎه ﺗﺤﺖ ﭘﻲﮔﻴﺮي ﺑﺎ ﻣﻌﺎﻳﻨﻪ ﺑﺎﻟﻴﻨﻲ ﻗﺮار دادﻧﺪ و‬

‫ﺟﺮاﺣﻲ ﺗﻔﺎوﺗﻲ ﺑﻪ ﻟﺤﺎظ ﺳﻦ و ﺟﻨﺴﻴﺖ وﺟﻮد ﻧﺪاﺷﺘﻪ و ﻧﺘﺎﻳﺞ ﺑﻪدﺳﺖ‬

‫ﺑﻪ اﻳﻦ ﻧﺘﻴﺠﻪ رﺳﻴﺪﻧﺪ ﻛﻪ اﻳﻦ دو روش درﻣﺎﻧﻲ ﺗﻘﺮﻳﺒﺎً ﺑﻪ ﻳﻚ ﻣﻴﺰان در‬ ‫‪16‬‬

‫آﻣﺪه ﺗﺤﺖ ﺗﺎﺛﻴﺮ ﻋﻮاﻣﻞ ﺳﻨﻲ و ﺟﻨﺴﻲ ﻗﺮار ﻧﮕﺮﻓﺘﻪ اﺳﺖ )ﻣﺸﺎﺑﻪ ﺑﺎ‬

‫درﻣﺎن ﻓﻴﺸﺮ آﻧﺎل ﻣﻮﺛﺮ ﻫﺴﺘﻨﺪ‪ Fernández .‬در ‪ 76‬ﺑﻴﻤﺎر ﻣﺒﺘﻼ ﺑﻪ ﻓﻴﺸﺮ‬

‫ﻣﻄﺎﻟﻌﺎت‪ (8-10‬ﻫﻤﭽﻨﻴﻦ ﻣﺤﻞ ﻓﻴﺸﺮ ﺑﻪ ﻟﺤﺎظ ﻗﺪاﻣﻲ ﻳﺎ ﺧﻠﻔﻲ ﺑﻮدن در‬

‫ﻏﻴﺮﻛﻤﭙﻠﻴﻜﻪ آﻧﺎل ﻧﺸﺎن داد ﺑﺎ ﺗﺰرﻳﻖ ‪ 40‬واﺣﺪ از ﺗﻮﻛﺴﻴﻦ ﺑﻮﺗﻮﻟﻴﻨﻮم در‬

‫دو ﮔﺮوه ﺗﻔﺎوﺗﻲ ﻧﺪاﺷﺘﻪ اﺳﺖ‪ .‬در ﻫﺮ دو ﮔﺮوه ﻓﻴﺸﺮ ﺑﻪﻃﻮر ﺷﺎﻳﻊﺗﺮ در‬

‫ﻫﺮ ﻃﺮف از ﻓﻴﺸﺮ آﻧﺎل و ﺗﻜﺮار دوز ﻳﺎد ﺷﺪه در ﺑﻴﻤﺎراﻧﻲﻛﻪ ﭘﺲ از ‪30‬‬

‫‪Gorden‬‬

‫روز ﺑﻪ اﻳﻦ دوز ﭘﺎﺳﺦ درﻣﺎﻧﻲ ﻧﺪاده ﺑﻮدﻧﺪ ﭘﺲ از ﺳﻪ ﻣﺎه ‪ 51‬ﺑﻴﻤﺎر‬

‫ﺻﻮرت ﮔﺮﻓﺖ ﻓﻴﺸﺮ ﻗﺪاﻣﻲ در زﻧﺎن ﺷﺎﻳﻊﺗﺮ از ﻣﺮدان ﺑﻮد‪ 11.‬ﻳﺎﻓﺘﻪﻫﺎي‬

‫)‪ (%67‬ﺑﻬﺒﻮد ﻛﺎﻣﻞ‪ 19 ،‬ﺑﻴﻤﺎر )‪ (%25‬ﺑﻬﺒﻮد ﻧﺴﺒﻲ و ﺷﺶ ﺑﻴﻤﺎر )‪(%8‬‬

‫ﻣﻄﺎﻟﻌﻪ ﻣﺎ ﺑﻪ ﻟﺤﺎظ وﺿﻌﻴﺖ درد ﺣﺎﻛﻲ از آن اﺳﺖ ﻛﻪ ﻳﻚ‪ ،‬دو‪ ،‬ﭼﻬﺎر‬

‫ﻋﺪم ﺑﻬﺒﻮد را ﻧﺸﺎن دادﻧﺪ‪ .‬در دو ﺑﻴﻤﺎر )‪ (%2/6‬ﺑﻲاﺧﺘﻴﺎري ﻣﻮﻗﺖ دﻓﻊ‬

‫ﺧﻠﻒ ﻗﺮار داﺷﺘﻪ اﺳﺖ‪ .‬در ﻣﻄﺎﻟﻌﻪاي ﻛﻪ ﺗﻮﺳﻂ ‪ Hananel‬و‬

‫‪12‬‬

‫و ﺷﺶ ﻣﺎه ﭘﺲ از درﻣﺎن ﺷﺪت درد در ﮔﺮوه ﺟﺮاﺣﻲ ﺑﻪﻃﻮر‬

‫ﮔﺎز و در ﻳﻚ ﺑﻴﻤﺎر ﻫﻤﻮروﻳﻴﺪ ﺗﺮوﻣﺒﻮزه ﮔﺰارش ﺷﺪ‪ Stanković .‬ﺑﺎ‬

‫ﻣﻌﻨﻲداري ﭘﺎﻳﻴﻦﺗﺮ ﺑﻮده اﺳﺖ ﻛﻪ ﻧﺸﺎن ﻣﻲدﻫﺪ روش ﺟﺮاﺣﻲ درد را‬

‫ﺗﺰرﻳﻖ ‪ 100‬واﺣﺪ از دارو ﺑﻪداﺧﻞ اﺳﻔﻨﻜﺘﺮ داﺧﻠﻲ آﻧﺎل در ﻫﺮ ﻃﺮف‬

‫ﺑﻬﺘﺮ از روش دﻳﺴﭙﻮرت ﻛﻨﺘﺮل ﻛﺮده اﺳﺖ‪ .‬ارﺟﺤﻴﺖ روش ﺟﺮاﺣﻲ در‬

‫ﺑﺮ روي ‪ 12‬ﺑﻴﻤﺎر )ﻫﺸﺖ زن و ﭼﻬﺎر ﻣﺮد( ﻣﺒﺘﻼ ﺑﻪ ﻓﻴﺸﺮ آﻧﺎل آنﻫﺎ را‬

‫ﻛﺎﻫﺶ ﺷﺪت درد در ﻣﻄﺎﻟﻌﺎت ﻗﺒﻠﻲ ﻧﻈﻴﺮ ﻣﻄﺎﻟﻌﺔ ‪ Arroyo‬ﻧﻴﺰ دﻳﺪه‬

‫ﺑﻪﻓﻮاﺻﻞ ﺳﻪ روز‪ ،‬ﻫﻔﺖ روز‪ 30 ،‬روز‪ ،‬ﺳﻪ ﻣﺎه و ﺷﺶ ﻣﺎه ﺑﻌﺪ از‬

‫ﻣﻲﺷﻮد‪ 8.‬ﻳﺎﻓﺘﻪﻫﺎي ﻣﻄﺎﻟﻌﺔ ﻣﺎ ﻧﺸﺎن ﻣﻲدﻫﺪ ﻛﻪ ﻣﻴﺰان ﺑﻬﺒﻮدي ﻓﻴﺸﺮ در‬

‫ﺗﺰرﻳﻖ ﻣﻮرد ﻣﻌﺎﻳﻨﻪ ﺑﺎﻟﻴﻨﻲ ﻗﺮار دادﻧﺪ‪ .‬ﻧﺘﻴﺠﻪ اﻳﻦ ﺑﻮد ﻛﻪ در ﺳﻪ ﺑﻴﻤﺎر‬

‫اﺛﺮ ﺟﺮاﺣﻲ ﺑﻪﻃﻮر واﺿﺢ و ﻣﻌﻨﻲداري ﺑﻴﺸﺘﺮ از روش ﺗﺰرﻳﻖ‬

‫ﻓﻴﺸﺮ آﻧﺎل ﭘﺲ از ﻳﻚ ﻣﺎه و در ﻫﻔﺖ ﺑﻴﻤﺎر ﭘﺲ از ﺳﻪ ﻣﺎه ﺑﻬﺒﻮد ﻳﺎﻓﺘﻪ‬

‫دﻳﺴﭙﻮرت ﺑﻮده اﺳﺖ ﺑﻪ ﮔﻮﻧﻪاي ﻛﻪ ﺷﺶ ﻣﺎه ﭘﺲ از درﻣﺎن ‪%95‬‬

‫ﺑﻮدﻧﺪ‪ ،‬در دو ﺑﻴﻤﺎر ﻓﻴﺸﺮ ﺑﻬﺒﻮد ﻧﻴﺎﻓﺘﻪ وﻟﻲ آﺳﻤﭙﺘﻮﻣﺎﺗﻴﻚ ﺑﻮد‪ .‬ﻃﻲ ﺳﻪ‬

‫ﺑﻴﻤﺎران در ﮔﺮوه ﺟﺮاﺣﻲ و ﻓﻘﻂ ‪ %44/4‬در ﮔﺮوه دﻳﺴﭙﻮرت ﺑﻬﺒﻮدي‬

‫ﻣﺎه ﭘﻲﮔﻴﺮي ﻫﻴﭻﮔﻮﻧﻪ ﺑﻲاﺧﺘﻴﺎري دﻓﻊ ﮔﺎز ﻳﺎ ﻣﺪﻓﻮع ﮔﺰارش ﻧﺸﺪ‪ .‬در‬

‫ﻣﺸﺎﻫﺪه ﺷﺪ‪ .‬اﻳﻦ ﻳﺎﻓﺘﻪ ﻣﺸﺎﺑﻪ ﻣﻄﺎﻟﻌﺔ ‪ Arroyo‬اﺳﺖ‪ 8.‬ﺑﻪ ﻟﺤﺎظ ﻋﺎرﺿﻪ‬

‫دو ﺑﻴﻤﺎر از ﺑﻴﻤﺎراﻧﻲﻛﻪ ﺑﻪدرﻣﺎن ﺟﻮاب داده ﺑﻮدﻧﺪ ﭘﺲ از ﺷﺶ ﻣﺎه ﻋﻮد‬

‫ﺑﻲاﺧﺘﻴﺎري دﻓﻊ ﮔﺎز و ﻣﺪﻓﻮع ﻳﺎﻓﺘﻪﻫﺎي ﻣﻄﺎﻟﻌﻪ ﻣﺎ ﻧﺸﺎن دادﻧﺪ ﻛﻪ ﻣﻴﺰان‬

‫ﻓﻴﺸﺮ دﻳﺪه ﺷﺪ‪ .‬در ﭘﺎﻳﺎن ﺷﺶ ﻣﺎه از دوران ﭘﻲﮔﻴﺮي ﻧﻴﺰ ﻫﻴﭻﮔﻮﻧﻪ‬

‫ﻳﻜﺴﺎﻧﻲ )ﺣﺪوداً ‪ (%10‬از اﻳﻦ ﻋﺎرﺿﻪ در دو ﮔﺮوه دﻳﺪه ﺷﺪ ﻛﻪ ﭘﺲ از‬

‫ﻋﺎرﺿﻪاي در ﺑﻴﻤﺎران ﻳﺎﻓﺖ ﻧﺸﺪ‪ .‬ﻧﺘﻴﺠﻪاي ﻛﻪ اﻳﻦ ﻣﺤﻘﻘﻴﻦ از ﻣﻄﺎﻟﻌﻪ‬

‫ﭼﻬﺎر ﻣﺎه در ﻫﺮ دو ﮔﺮوه اﻳﻦ ﻋﺎرﺿﻪ‪ ،‬ﺑﻪﻃﻮر ﻛﺎﻣﻞ ﺑﺮﻃﺮف ﮔﺮدﻳﺪه‬

‫ﮔﺮﻓﺘﻨﺪ اﻳﻦ ﺑﻮد ﻛﻪ ﺗﺰرﻳﻖ ﺑﻮﺗﻮﻛﺲ در درﻣﺎن ﻓﻴﺸﺮ آﻧﺎل ﺿﻤﻦ اﻳﻦﻛﻪ‬ ‫‪13‬‬

‫اﺳﺖ‪ .‬از اﻳﻦ ﻟﺤﺎظ ﻳﺎﻓﺘﻪﻫﺎي ﻣﻄﺎﻟﻌﺔ ﻣﺎ ﻣﺸﺎﺑﻪ ﻳﺎﻓﺘﻪﻫﺎي ﻣﻄﺎﻟﻌﻪ‬

‫ﻧﺘﺎﻳﺞ ﻗﺎﺑﻞ ﻗﺒﻮل درﻣﺎﻧﻲ دارد ﻋﺎرﺿﻪ ﻗﺎﺑﻞ ﺗﻮﺟﻪاي ﻧﻴﺰ ﺑﻪدﻧﺒﺎل ﻧﺪارد‪.‬‬

‫‪ Stankovic ،Fernández‬و ‪ Witte‬ﻣﻲﺑﺎﺷﺪ‪ 12-14.‬از ﻧﻈﺮ ﺣﺠﻢ ﻧﻤﻮﻧﻪ ﻣﺎ‬

‫‪ Nelson‬در ﻳﻚ ﻣﻄﺎﻟﻌﻪ ﺳﻴﺴﺘﻤﺎﺗﻴﻚ‪ ،‬ﻧﺘﺎﻳﺞ ﻣﻄﺎﻟﻌﺎت در درﻣﺎن ﻓﻴﺸﺮ‬

‫ﺑﻪﻃﻮر راﻧﺪوم ‪ 36‬ﺑﻴﻤﺎر را ﺑﻪ دو ﮔﺮوه ‪ 18‬ﻧﻔﺮي ﺗﻘﺴﻴﻢ ﻛﺮده و ﺑﻴﻤﺎران‬

‫آﻧﺎل ﻣﺰﻣﻦ را ﺟﻤﻊآوري و ﺑﺮرﺳﻲ ﻧﻤﻮد و ﺑﻪ اﻳﻦ ﻧﺘﻴﺠﻪ رﺳﻴﺪ ﻛﻪ در‬

‫را ﺗﺎ ﺷﺶ ﻣﺎه ﭘﻲﮔﻴﺮي ﻧﻤﻮدﻳﻢ‪ Brisinda .‬در اﻳﺘﺎﻟﻴﺎ ﺑﻪﻃﻮر راﻧﺪوم ‪50‬‬

‫ﻣﻘﺎﻳﺴﻪ ﺑﻴﻦ روشﻫﺎﻳﻲ ﻛﻪ ﻳﻚ درﻣﺎن ﻣﺪﻳﻜﺎل را ﺑﺎ ﺟﺮاﺣﻲ ﻣﻮرد‬

‫ﺑﻴﻤﺎر ﻣﺒﺘﻼ ﺑﻪ ﻓﻴﺸﺮ ﻣﺰﻣﻦ آﻧﺎل را ﺑﻪ دو ﮔﺮوه ‪ 25‬ﻧﻔﺮي ﺗﻘﺴﻴﻢ ﻛﺮده‪،‬‬

‫ﻗﻴﺎس ﻗﺮار دادهاﻧﺪ درﻣﺎنﻫﺎي ﻣﺪﻳﻜﺎل ﻣﻦ ﺟﻤﻠﻪ ﺗﺰرﻳﻖ ﺗﻮﻛﺴﻴﻦ‬

‫ﮔﺮوه اول را ﺑﺎ ﺗﺰرﻳﻖ ﺑﻮﺗﻮﻛﺲ ﺑﺎ دوز ‪ 20‬واﺣﺪ در ﻫﺮ ﻃﺮف از‬

‫ﺑﻮﺗﻮﻟﻴﻨﻮم ﺗﻨﻬﺎ ﻛﻤﻲ ﺑﻬﺘﺮ از داروﻧﻤﺎﻫﺎ ﻳﺎ ‪ placebo‬ﺑﻮدهاﻧﺪ اﻣﺎ ﺗﺎﺛﻴﺮ آنﻫﺎ‬ ‫‪17‬‬

‫اﺳﻔﻨﻜﺘﺮ داﺧﻠﻲ آﻧﺎل و ﮔﺮوه دوم را ﺗﺤﺖ درﻣﺎن ﻣﻮﺿﻌﻲ ﺑﺎ ﭘﻤﺎد ‪%0/2‬‬

‫در ﻧﻬﺎﻳﺖ ﺑﺴﻴﺎر ﻛﻤﺘﺮ از ﺟﺮاﺣﻲ ﺑﻮده اﺳﺖ‪ .‬ﻣﺠﻤﻮع ﻳﺎﻓﺘﻪﻫﺎي اﻳﻦ‬

‫ﻧﻴﺘﺮوﮔﻠﻴﺴﻴﺮﻳﻦ ﺗﺤﺖ درﻣﺎن ﻗﺮار داد و ﺑﻴﻤﺎران را ﺗﺎ ‪ 15‬ﻣﺎه ﭘﻲﮔﻴﺮي‬

‫ﻣﻄﺎﻟﻌﻪ ﻧﺸﺎن ﻣﻲدﻫﻨﺪ ﻛﻪ روش ﺟﺮاﺣﻲ ﺑﺮاي درﻣﺎن ﻓﻴﺸﺮآﻧﺎل ﻧﺘﺎﻳﺞ‬

‫ﻧﻤﻮد و ﺑﻪ اﻳﻦ ﻧﺘﻴﺠﻪ رﺳﻴﺪ ﻛﻪ در ﮔﺮوه اول ‪ 24‬ﺑﻴﻤﺎر )‪ (%96‬و در‬

‫ﺑﻬﺘﺮي را ﺑﻪدﻧﺒﺎل داﺷﺘﻪ و ﺑﻴﻤﺎران در ‪ %95‬ﻣﻮارد ﺑﺪون ﻋﺎرﺿﺔ ﺧﺎﺻﻲ‬

‫ﮔﺮوه دوم ‪ 15‬ﺑﻴﻤﺎر )‪ (%60‬ﺑﻪﻃﻮر ﻛﺎﻣﻞ درﻣﺎن ﺷﺪﻧﺪ‪ Suknaić 15.‬در‬

‫‪Nelson‬‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬

‫درﻣﺎن ﺷﺪهاﻧﺪ و اﻳﻦ ﻧﺘﻴﺠﻪ ﺑﺎ ﻳﺎﻓﺘﻪﻫﺎي ﻣﻄﺎﻟﻌﺎت ‪ Arroyo‬و‬


551

‫ داﺧﻠﻲ در درﻣﺎن ﻓﻴﺸﺮآﻧﺎل ﻣﺰﻣﻦ‬Asgari -‫اﺳﻔﻨﻜﺘﺮوﺗﻮﻣﻲ ﺟﺎﻧﺒﻲ‬ ‫ﻣﻘﺎﻳﺴﻪ ﺗﺰرﻳﻖ دﻳﺴﭙﻮرت و‬ M. et al.

8‫و‬17

‫ اﻟﺒﺘﻪ در ﺑﺮﺧﻲ ﻣﻄﺎﻟﻌﺎت ﺗﺰرﻳﻖ دﻳﺴﭙﻮرت ﻣﻴﺰان ﻗﺎﺑﻞ ﻗﺒﻮﻟﻲ‬.‫اﻧﺠﺎم ﺷﻮد‬

‫ﺑﺎ ﺗﻮﺟﻪ ﺑﻪ اﻳﻦﻛﻪ داروي دﻳﺴﭙﻮرت داراي ﻋﻮارض‬

.‫ﻣﻄﺎﺑﻘﺖ دارد‬

‫ ﺑﻪﻧﻈﺮ ﻣﻲرﺳﺪ روش ﺟﺮاﺣﻲ ﻫﻨﻮز ﺑﺮ‬.‫از درﻣﺎن را ﻧﺸﺎن داده اﺳﺖ‬

‫ ﻻزم‬،‫ﻣﺘﻌﺪدي ﺑﻮده و ﺣﺘﻲ ﻣﻤﻜﻦ اﺳﺖ ﻣﻨﺠﺮ ﺑﻪ اﺧﺘﻼل ﺗﻨﻔﺴﻲ ﮔﺮدد‬

.‫ﺳﺎﻳﺮ روشﻫﺎي درﻣﺎﻧﻲ ارﺟﺢ ﺑﺎﺷﺪ‬

‫اﺳﺖ ﺑﻴﻤﺎر در ﺑﻴﻤﺎرﺳﺘﺎن ﺑﺴﺘﺮي و ﺗﺰرﻳﻖ ﺗﻮﺳﻂ ﭘﺰﺷﻜﻲ آﻣﻮزش دﻳﺪه‬

1. Lysy J, Israelit-Yatzkan Y, Sestiery-Ittah M, Weksler-Zangen S, Keret D, Goldin E. Topical nitrates potentiate the effect of botulinum toxin in the treatment of patients with refractory anal fissure. Gut 2001;48(2):221-4. 2. Essani R, Sarkisyan G, Beart RW, Ault G, Vukasin P, Kaiser AM. Cost-saving effect of treatment algorithm for chronic anal fissure: a prospective analysis. J Gastrointest Surg 2005;9(9):1237-43; discussion 1243-4. 3. Greenfield LJ, Mulholland MW, Oldham KT, Zelenock GB, editors. Surgery: Scientific Principles and Practice. Philadelphia, PA: JB Lipponcott; 1993. p. 1071-3. 4. Klosterhalfen B, Vogel P, Rixen H, Mittermayer C. Topography of the inferior rectal artery: a possible cause of chronic, primary anal fissure. Dis Colon Rectum 1989;32(1):43-52. 5. Schouten WR, Briel JW, Auwerda JJ. Relationship between anal pressure and anodermal blood flow. The vascular pathogenesis of anal fissures. Dis Colon Rectum 1994;37(7):664-9. 6. Giral A, Memisoglu K, Gültekin Y, Imeryüz N, Kalayci C, Ulusoy NB, et al. Botulinum toxin injection versus lateral internal sphincterotomy in the treatment of chronic anal fissure: a nonrandomized controlled trial. BMC Gastroenterol 2004;4:7. 7. Utzig MJ, Kroesen AJ, Buhr HJ. Concepts in pathogenesis and treatment of chronic anal fissure: a review of the literature. Am J Gastroenterol 2003;98(5):968-74. 8. Arroyo A, Pérez F, Serrano P, Candela F, Lacueva J, Calpena R. Surgical versus chemical (botulinum toxin) sphincterotomy for chronic anal fissure: long-term results of a prospective randomized clinical and manometric study. Am J Surg 2005;189(4):429-34.

9. Maria G, Cassetta E, Gui D, Brisinda G, Bentivoglio AR, Albanese A. A comparison of botulinum toxin and saline for the treatment of chronic anal fissure. N Engl J Med 1998;338(4):217-20. 10. Iswariah H, Stephens J, Rieger N, Rodda D, Hewett P. Randomized prospective controlled trial of lateral internal sphincterotomy versus injection of botulinum toxin for the treatment of idiopathic fissure in ano. ANZ J Surg 2005;75(7):553-5. 11. Hananel N, Gordon PH. Re-examination of clinical manifestations and response to therapy of fissure-in-ano. Dis Colon Rectum 1997;40(2):229-33. 12. Fernández López F, Conde Freire R, Rios Rios A, García Iglesias J, Caínzos Fernández M, Potel Lesquereux J. Botulinum toxin for the treatment of anal fissure. Dig Surg 1999;16(6):515-8. 13. Stanković N, Mirković D. Botulinum toxin A in the treatment of anal fissure. Vojnosanit Pregl 2004;61(5):531-5. 14. Witte ME, Klaase JM. Favourable results with local injections of botulinum-A toxin in patients with chronic isosorbide dinitrate ointment-resistant anal fissures. Ned Tijdschr Geneeskd 2006;150(27):1513-7. 15. Brisinda D, Maria G, Fenici R, Civello IM, Brisinda G. Safety of botulinum neurotoxin treatment in patients with chronic anal fissure. Dis Colon Rectum 2003;46(3):419-20. 16. Suknaić S, Patrlj L, Steresinić M, Skopljanac Macina A, Erdelez L. Surgical or biologic sphincterotomy in the treatment of chronic anal fissure. Acta Med Croatica 2008;62(1):73-80. 17. Nelson R. Non surgical therapy for anal fissure. Cochrane Database Syst Rev 2006;(4):CD003431.

References

1389 ‫ آذر‬،9 ‫ ﺷﻤﺎره‬، 68 ‫ دوره‬،‫ داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‬،‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‬


Tehran University Medical Journal; Vol. ‫و‬68, No. 9, Dec 2010: 547-552 ‫ﻫﻤﻜﺎران‬

100

Treatment of chronic anal fissure: Botulinum toxin (Dysport) versus lateral internal anal sphincterotomy

1

Mehdi Asgari MD. S.Masih Mirrokni MD.2* 1- Department of Surgery, Razi Hospital, Jondishapur University of Medical Sciences, Ahvaz, Iran. 2- Department of General Surgery, Razi Hospital, Jondishapur University of Medical Sciences, Ahvaz, Iran.

Abstract

Received: June 13, 2010 Accepted: August 10, 2010

Background: Botulinum toxin (Dysport) is a powerful semi-biological toxin. It has proved to be a remarkable therapeutic agent for treatment of benign anal disorders. Different results have been achieved from injection of botulinum toxin in order to treatment of anal fissure since 1993. The aim of this study was to evaluate the efficacy of botulinum toxin injection in the treatment of chronic anal fissure Comparing with lateral internal anal sphincterotomy (LIS). Methods: 36 patients entered into two groups, Dysport injection and Lateral Internal Sphincterotomy, randomly. Dysport group were treated by injection of 50 units of botulinum toxin, 25 units of drugs in each side, and LIS was done in surgery group by open method in left side. Pain, recovery and incontinency were compared between two groups during six months of follow up. Results: Based on this study, treatment of anal fissure does not affected by age and gender. Regarding to location of fissure, there was no difference between two different genders. Mean of age and ratio of gender were similar in both groups. The severity of pain in surgery group was lower than Dysport group six months after treatment (0.4±0.7 and 3.2±2.6 respectively, p<0.001). Recovery ratio in surgery group was higher than Dysport after six months (95% Vs. 44.4% p<0.001). Gas or fecal incontinency did not reported after six months in both groups. Conclusion: Botulinum toxin is not efficacious in patients with chronic anal fissure, comparing with LIS. More future studies are necessary for final judgement. Keywords: Anal sphincterotomy, anal fissure, botulinum toxin.

* Corresponding author: Dept. of Surgery, Razi Hospital, Ahvaz, Iran Tel: +98-913-3546144 email: smmirrokni@live.com

1389 ‫ آذر‬،9 ‫ ﺷﻤﺎره‬، 68 ‫ دوره‬،‫ داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‬،‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‬


‫آذرﺛﺎﻧﻮﻳﻪ‬ ‫اوﻟﻴﻪ«‪،9‬و »‬ ‫ﺗﺮﻣﻴﻢ »‬ ‫ﭘﺎﻳﻠﻮﻧﻴﺪال‬ ‫ﺳﻴﻨﻮس‬ ‫ﻧﺘﺎﻳﺞ ﺟﺮاﺣﻲ‬ ‫ﻣﻘﺎﻳﺴﺔ‬ ‫‪553-558 ،«1389‬‬ ‫ﺷﻤﺎره‬ ‫روش ‪، 68‬‬ ‫ﺗﻬﺮان‪،‬ﺑﻪ دوره‬ ‫ﭘﺰﺷﻜﻲ‬ ‫داﻧﺸﮕﺎه ﻋﻠﻮم‬ ‫ﭘﺰﺷﻜﻲ‪،‬‬ ‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه‬

‫ﻣﻘﺎﻳﺴﺔ ﻧﺘﺎﻳﺞ ﺗﺮﻣﻴﻢ ﺟﺮاﺣﻲ ﺳﻴﻨﻮس ﭘﺎﻳﻠﻮﻧﻴﺪال ﺑﻪروش ‪‬ﺗﺮﻣﻴﻢ اوﻟﻴﻪ‪ ‬ﺑﺎ ‪‬ﺗﺮﻣﻴﻢ ﺛﺎﻧﻮﻳﻪ‪‬‬

‫ﺗﺎرﻳﺦ درﻳﺎﻓﺖ ﻣﻘﺎﻟﻪ‪ 1389/03/18 :‬ﺗﺎرﻳﺦ ﭘﺬﻳﺮش‪1389/06/13 :‬‬

‫ﭼﻜﻴﺪه‬

‫*‬

‫ﺑﺎﺑﻚ ﺣﺎﺟﻲ ﺑﺮاﺗﻲ‬

‫زﻣﻴﻨﻪ و ﻫﺪف‪ :‬اﺧﺘﻼف ﻓﺎﺣﺶ ﺑﻴﻦ ﺑﺎزﮔﺸﺖ ﺑﻪﻛﺎر ﺑﻴﻤﺎران ﺳﻴﻨﻮس ﭘﺎﻳﻠﻮﻧﻴﺪال ﻋﻤﻞ ﺷﺪه ﺑﺎ دو روش ﺗﺮﻣﻴﻢ اوﻟﻴﻪ و‬

‫ﻋﻠﻲ ﻏﻔﻮري‬

‫ﺛﺎﻧﻮﻳﻪ‪ ،‬اﻧﮕﻴﺰه ﻣﻄﺎﻟﻌﻪ ﺑﻮد‪ .‬ﻫﺪف اﻳﻦ ﻣﻄﺎﻟﻌﻪ ﺑﺮرﺳﻲ ﻧﺘﺎﻳﺞ ﺟﺮاﺣﻲ ﺳﻴﻨﻮس ﭘﺎﻳﻠﻮﻧﻴﺪال ﺑﺎ دو روش »ﺗﺮﻣﻴﻢ اوﻟﻴﻪ« ﺑﺎ‬ ‫ﮔﺮوه ﺟﺮاﺣﻲ ﻋﻤﻮﻣﻲ‬

‫»ﺗﺮﻣﻴﻢ ﺛﺎﻧﻮﻳﻪ« ﻣﻲﺑﺎﺷﺪ‪ .‬روش ﺑﺮرﺳﻲ‪ :‬ﻣﺮاﺟﻌﻴﻦ ﺑﺎ ﺳﻴﻨﻮس ﭘﺎﻳﻠﻮﻧﻴﺪال ﺑﻪ ﺑﻴﻤﺎرﺳﺘﺎن ﺷﺮﻳﻌﺘﻲ در ﺳﺎل ‪ 1386-87‬وارد‬

‫داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬ﺗﻬﺮان‪ ،‬اﻳﺮان‪.‬‬

‫ﻣﻄﺎﻟﻌﻪ ﻛﺎرآزﻣﺎﻳﻲ ﺑﺎﻟﻴﻨﻲ ﺗﺼﺎدﻓﻲ‪ ،‬ﺷﺪﻧﺪ‪ .‬ﺗﺨﻠﻴﻪ ﺑﺎﻓﺖﻫﺎي ﻧﺎﺳﺎﻟﻢ ﺑﻪﻋﻼوه ﺗﺮﻣﻴﻢ ﻓﻮري زﺧﻢ )ﺗﺮﻣﻴﻢ اوﻟﻴﻪ‪ (n=40 ،‬ﻳﺎ‬ ‫ﺑﺮداﺷﺘﻦ ﺑﺎﻓﺖﻫﺎ ﺑﺪون ﺗﺮﻣﻴﻢ )ﺗﺮﻣﻴﻢ ﺛﺎﻧﻮﻳﻪ‪ (n=40 ،‬ﺻﻮرت ﮔﺮﻓﺖ‪ .‬ﺑﻴﻤﺎران ﺑﺎ آﺑﺴﻪ از ﻣﻄﺎﻟﻌﻪ ﺧﺎرج ﺷﺪﻧﺪ‪ .‬ﭘﻴﺎﻣﺪﻫﺎي‬ ‫ﻣﻬﻢ‪ ،‬ﻣﺪت ﺑﺴﺘﺮي‪ ،‬ﻣﺪت ﺑﻬﺒﻮدي زﺧﻢ‪ ،‬ﻣﺪت دوري از ﻛﺎر‪ ،‬درد ﭘﺲ از ﻋﻤﻞ‪ ،‬ﻣﻴﺰان رﺿﺎﻳﺖ ﺑﻴﻤﺎران و ﻣﻴﺰان ﻋﻮد‬ ‫ﺑﻮدﻧﺪ‪ .‬ﻳﺎﻓﺘﻪﻫﺎ‪ :‬اﻛﺜﺮ )‪ (%87/50‬ﺑﻴﻤﺎران ﻣﺬﻛﺮ ﺑﻮدﻧﺪ و ﻣﻴﺎﻧﮕﻴﻦ ﻣﺪت دوري از ﻛﺎر در ﺗﺮﻣﻴﻢ اوﻟﻴﻪ )‪ 8/65±1/73‬در‬ ‫ﺑﺮاﺑﺮ ‪ 11/53±2/33‬روز‪ (p=0/001 ،‬و ﻣﺪت ﺑﻬﺒﻮدي ﻛﺎﻣﻞ )‪ 3/43±0/92‬در ﺑﺮاﺑﺮ ‪ 5/3±0/79‬روز‪ (p=0/001 ،‬ﺑﻪﻃﻮر‬ ‫ﻣﻌﻨﻲداري ﻛﻮﺗﺎه ﺑﻮدﻧﺪ اﻣﺎ اﺧﺘﻼف ﻣﻌﻨﻲداري در ﻣﺪت ﺑﺴﺘﺮي و وﻳﺰﻳﺖﻫﺎ ﻣﺸﺎﻫﺪه ﻧﺸﺪ‪ .‬در ﺗﺮﻣﻴﻢ اوﻟﻴﻪ‪ ،‬ﻣﻴﺎﻧﮕﻴﻦ‬ ‫ﺷﺪت درد در روزﻫﺎي اول )‪ 37/75±6/5‬در ﺑﺮاﺑﺮ ‪ ،(p=0/001 ،43/63±5/06‬دوم )‪ 26/75±6/66‬در ﺑﺮاﺑﺮ‬ ‫‪ ،(p=0/001 ،34/63±5/48‬ﺳﻮم )‪ 18/25±6/05‬در ﺑﺮاﺑﺮ ‪ (p=0/001 ،27/88±6/88‬و ﻫﻔﺘﻢ )‪ 8/45±3/85‬در ﺑﺮاﺑﺮ‬ ‫‪ (p=0/001 ،17/88±6/19‬ﭘﺲ از ﻋﻤﻞ ﻛﻤﺘﺮ ﺑﻮد‪ .‬ﻓﺮاواﻧﻲ ﻋﻮارض و ﻧﻴﺎز ﺑﻪ ﺗﻜﺮار ﻋﻤﻞ در دو ﮔﺮوه اﺧﺘﻼف‬ ‫ﻣﻌﻨﻲداري ﻧﺪاﺷﺘﻨﺪ‪ .‬ﻣﻴﺎﻧﮕﻴﻦ ﻣﻴﺰان رﺿﺎﻳﺖ ﺑﻴﻤﺎران در ﮔﺮوه ﺗﺮﻣﻴﻢ اوﻟﻴﻪ )‪ 4/15±0/53‬در ﺑﺮاﺑﺮ ‪(p=0/001 ،3/6±0/5‬‬

‫*‬

‫ﺑﻴﺸﺘﺮ ﺑﻮد‪ .‬ﻧﺘﻴﺠﻪﮔﻴﺮي‪ :‬ﺗﺨﻠﻴﻪ و ﺗﺮﻣﻴﻢ اوﻟﻴﻪ روش ﺑﺮﺗﺮ اﺳﺖ‪ .‬ﻣﺰاﻳﺎ ﺷﺎﻣﻞ ﻣﻴﺎﻧﮕﻴﻦ ﻛﻮﺗﺎهﺗﺮ ﻣﺪت دوري از ﻛﺎر‪ ،‬ﺑﻬﺒﻮد‬ ‫ﻧﻮﻳﺴﻨﺪه ﻣﺴﺌﻮل‪ :‬ﺗﻬﺮان‪ ،‬ﺑﺰرﮔﺮاه ﺟﻼل آل اﺣﻤﺪ‪،‬‬

‫ﺑﻴﻤﺎرﺳﺘﺎن ﺷﺮﻳﻌﺘﻲ‪ ،‬ﮔﺮوه ﺟﺮاﺣﻲ‬

‫ﺳﺮﻳﻊﺗﺮ زﺧﻢ‪ ،‬درد ﻛﻤﺘﺮ ﭘﺲ از ﻋﻤﻞ و رﺿﺎﻳﺖ ﺑﻴﺸﺘﺮ ﺑﻴﻤﺎران ﻋﻠﻲرﻏﻢ ﻋﻮارض و ﻋﻮد ﻣﺴﺎوي ﺑﺎ روش ﺗﺮﻣﻴﻢ ﺛﺎﻧﻮﻳﻪ‪.‬‬

‫ﺗﻠﻔﻦ‪021-84902450 :‬‬ ‫‪email: babakhb@yahoo.com‬‬

‫ﻛﻠﻤﺎت ﻛﻠﻴﺪي‪ :‬ﺳﻴﻨﻮس ﭘﺎﻳﻠﻮﻧﻴﺪال‪ ،‬ﺗﺮﻣﻴﻢ اوﻟﻴﻪ‪ ،‬ﺗﺮﻣﻴﻢ ﺛﺎﻧﻮﻳﻪ‪.‬‬

‫ﻣﻘﺪﻣﻪ‬

‫ﻛﺎﻣﻞ ﻣﺴﻴﺮ اﻳﺠﺎد ﺷﺪه ﺑﻪوﺳﻴﻠﻪ ﺳﻴﻨﻮس ﺑﻪ ﭘﻮﺳﺖ‪ ،‬ﺑﻬﺒﻮد ﻛﺎﻣﻞ ﭘﻮﺳﺖ‬

‫ﺳﻴﻨﻮس ﭘﻴﻠﻮﻧﻴﺪال )‪ (Pilonidal sinus‬ﺑﻴﻤﺎري اﺳﺖ ﻛﻪ اﻛﺜﺮاً در ﻧﺎﺣﻴﻪ‬

‫ﭘﻮﺷﺎﻧﻨﺪه و ﭘﻴﺸﮕﻴﺮي از ﻋﻮد اﺳﺖ‪ 1.‬زﺧﻢ ﺟﺮاﺣﻲ ﻣﻤﻜﻦ اﺳﺖ ﺑﺎز‬

‫دﻧﺒﺎﻟﭽﻪاي ‪ Sacrococcygeal‬اﻳﺠﺎد ﻣﻲﺷﻮد‪ .‬ﺷﻴﻮع آن ‪ 26‬در ‪100,000‬‬

‫ﮔﺬاﺷﺘﻪ ﺷﻮد ﺗﺎ ﺗﺮﻣﻴﻢ ﺻﻮرت ﮔﻴﺮد )‪.(Secondary intention‬‬

‫ﻧﻔﺮ اﺳﺖ‪ .‬ﺳﻴﻨﻮس ﭘﻴﻠﻮﻧﻴﺪال ﻣﻌﻤﻮﻻً ﺧﻮد را ﺑﻪﺷﻜﻞ ﻳﻚ آﺑﺴﻪ ﻳﺎ ﺑﺎ‬

‫ﻃﺮﻓﺪاران اﻳﻦ روش ﻣﻌﺘﻘﺪﻧﺪ ﻛﻪ ﻛﺎﻫﺶ ﻓﺸﺎر ﺑﺮ زﺧﻢ‪ ،‬ﻣﻮﺟﺐ ﺗﺴﺮﻳﻊ‬

‫ﻳﻚ ﻣﺠﺮاي ﺗﺨﻠﻴﻪﺷﻮﻧﺪه )‪ (Sinus tract‬دردﻧﺎك ﻛﻪ ﺑﻪﻃﻮر ﻣﺰﻣﻦ ﺗﺮﺷﺢ‬

‫ﺑﻬﺒﻮد زﺧﻢ ﺑﺪون ﻫﻴﭻ ﻣﺸﻜﻞ و ﺟﻠﻮﮔﻴﺮي از ﻋﻮد آن ﻣﻲﺷﻮد‪ 2.‬ﻧﻈﺮ‬

‫دارد‪ ،‬ﻧﺸﺎن ﻣﻲدﻫﺪ‪ .‬ﺻﺮفﻧﻈﺮ از ﺗﻈﺎﻫﺮ‪ ،‬ﻃﺒﻴﻌﺖ دردﻧﺎك اﻳﻦ ﺣﺎﻟﺖ‬

‫دﻳﮕﺮ آن اﺳﺖ ﻛﻪ زﺧﻢ ﺑﺴﺘﻪ ﺷﻮد ﺗﺎ ﺑﻬﺒﻮدي آن ﺑﻪﺻﻮرت ﺑﺴﺘﻪ ﺷﺪن‬

‫ﺳﺒﺐ ﻣﻮرﺑﻴﺪﻳﺘﻲ ﭼﺸﻤﮕﻴﺮ ﻣﻲﺷﻮد ﻛﻪ اﻏﻠﺐ ﺑﺎ اﺧﺘﻼل ﻃﻮﻻﻧﻲ‬

‫اوﻟﻴﻪ ﺻﻮرت ﮔﻴﺮد )‪ .(Primary intention‬در اﻳﻦ روشﻫﺎ ﺗﻜﻨﻴﻚﻫﺎ را‬

‫ﻓﻌﺎﻟﻴﺖﻫﺎي ﻋﺎدي ﻫﻤﺮاه اﺳﺖ‪ .‬درﻣﺎن اﻳﺪهآل درﻣﺎﻧﻲ اﺳﺖ ﻛﻪ ﺑﻪ‬

‫ﻣﻲﺗﻮان ﺑﻪاﻧﻮاع ﺑﺴﺘﻦ در ﺧﻂ ﻣﻴﺎﻧﻲ و ﺑﺴﺘﻦ زﺧﻢ ﺧﺎرج از ﺧﻂ ﻣﻴﺎﻧﻲ‬

‫ﺑﻴﻤﺎران اﺟﺎزه دﻫﺪ ﺳﺮﻳﻌﺎً ﺑﻪ ﻓﻌﺎﻟﻴﺖﻫﺎي ﻋﺎدي ﺧﻮد ﺑﺮﮔﺮدﻧﺪ و ﺑﺎ‬

‫ﻃﺒﻘﻪﺑﻨﺪي ﻛﺮد‪ .‬ﻃﺮﻓﺪاران ﺑﺴﺘﻦ اوﻟﻴﻪ ﻣﻌﺘﻘﺪﻧﺪ ﻛﻪ در آن ﺗﺮﻣﻴﻢ ﺑﺎﻓﺖ‬

‫ﺣﺪاﻗﻞ ﻣﻮرﺑﻴﺪﻳﺘﻲ و ﻋﻮارض ﻫﻤﺮاه ﺑﺎﺷﺪ‪ .‬درﻣﺎن ﺑﻴﻤﺎري ﭘﻴﻠﻮﻧﻴﺪال‬

‫ﺳﺮﻳﻊﺗﺮ ﺻﻮرت ﻣﻲﮔﻴﺮد‪ 1.‬ﺑﻨﺎﺑﺮاﻳﻦ ﻣﺸﺎﻫﺪه ﻣﻲﺷﻮد ﻛﻪ ﻫﻨﻮز در‬

‫ﻣﺰﻣﻦ‪ ،‬ﺿﺪ و ﻧﻘﻴـﺾ‪ ،‬ﻣﺘﻐﻴـﺮ و دﺷﻮار اﺳﺖ‪ .‬اﺻﻮل درﻣﺎن ﺷـﺎﻣﻞ رﻓﻊ‬

‫اﻧﺘﺨﺎب روش درﻣﺎﻧﻲ ارﺟﺢ ﺟﺮاﺣﻲ در ﻣﻮرد درﻣﺎن ﺳﻴﻨﻮس‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬


‫ﺑﺎﺑﻚ ﺣﺎﺟﻲ ﺑﺮاﺗﻲ و ﻫﻤﻜﺎران‬

‫‪554‬‬

‫‪4‬و‪3‬‬

‫ﭘﺎﻳﻠﻮﻧﻴﺪال اﺗﻔﺎق ﻧﻈﺮ وﺟﻮد ﻧﺪارد‪.‬‬

‫ﻟﺬا ﺑﺮرﺳﻲ ﻳﻚ روش ﺳﺮﻳﻊ و‬

‫ﻧﺮماﻓﺰار‬

‫)‪SPSS (SPSS Inc., Chicago, IL‬‬

‫وﻳﺮاﺳﺖ ‪ 17‬اﺳﺘﻔﺎده ﺷﺪ‪.‬‬

‫ارزان ﻛﻪ رﺿﺎﻳﺖ ﺑﻴﻤﺎر را ﺟﻠﺐ ﻧﻤﺎﻳﺪ‪ ،‬ارزﺷﻤﻨﺪ ﺧﻮاﻫﺪ ﺑﻮد‪ .‬ﻫﺪف از‬

‫اﻃﻼﻋﺎت ﺑﻪﺻﻮرت اﻧﺤﺮاف ﻣﻌﻴﺎر‪ ±‬ﻣﻴﺎﻧﮕﻴﻦ ﻳﺎ )درﺻﺪ( ﺗﻌﺪاد در ﻫﺮ‬

‫اﻧﺠﺎم اﻳﻦ ﻣﻄﺎﻟﻌﻪ ﻣﻘﺎﻳﺴﻪ ﻧﺘﺎﻳﺞ ﺗﺮﻣﻴﻢ ﺟﺮاﺣﻲ ﺳﻴﻨﻮس ﭘﺎﻳﻠﻮﻧﻴﺪال ﺑﺎ دو‬

‫ﮔﺮوه ﺑﻴﺎن ﺷﺪﻧﺪ‪ p<0/05 .‬ﻣﻌﻨﻲدار در ﻧﻈﺮ ﮔﺮﻓﺘﻪ ﺷﺪ‪.‬‬

‫روش »ﺗﺮﻣﻴﻢ اوﻟﻴﻪ« ﺑﺎ »ﺗﺮﻣﻴﻢ ﺛﺎﻧﻮﻳﻪ« ﻣﻲﺑﺎﺷﺪ‪.‬‬

‫ﻳﺎﻓﺘﻪﻫﺎ‬ ‫روش ﺑﺮرﺳﻲ‬

‫ﻫﻴﭻ ﺑﻴﻤﺎري از ﻣﻄﺎﻟﻌﻪ ﺧﺎرج ﻧﺸﺪ و اﻃﻼﻋﺎت ﺣﺎﺻﻞ از ‪ 80‬ﺑﻴﻤﺎر‬

‫ﭘﺲ از ﺗﺎﺋﻴﺪ ﻃﺮح ﺗﻮﺳﻂ ﻣﻌﺎوﻧﺖ ﭘﮋوﻫﺸﻲ و ﻛﻤﻴﺘﻪ اﺧﻼق ﭘﺰﺷﻜﻲ‬

‫ﺗﺠﺰﻳﻪ و ﺗﺤﻠﻴﻞ آﻣﺎري ﺷﺪ‪ .‬ﻣﻴﺎﻧﮕﻴﻦ ﺳﻦ ﺑﻴﻤﺎران ﻣﻮرد ﺑﺮرﺳﻲ‬

‫داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬در ﻳﻚ ﻛﺎرآزﻣﺎﻳﻲ ﺑﺎﻟﻴﻨﻲ ﺗﺼﺎدﻓﻲ ‪80‬‬

‫‪ 25/47±7/93‬ﺳﺎل ﺑﻮد و ‪ %87/5‬ﺑﻴﻤﺎران ﻣﺬﻛﺮ ﺑﻮدﻧﺪ‪ .‬ﻣﻘﺎﻳﺴﻪ ﻣﻴﺎﻧﮕﻴﻦ‬

‫ﺑﻴﻤﺎر ﺑﺎﻟﻎ )ﺑﺎﻻي ‪ 18‬ﺳﺎل( ﻛﻪ ﻣﺒﺘﻼ ﺑﻪ ﺳﻴﻨﻮس ﭘﺎﻳﻠﻮﻧﻴﺪال ﺑﻮده و ﺑﻪ‬

‫ﻣﺘﻐﻴﺮﻫﺎي دﻣﻮﮔﺮاﻓﻴﻚ و ﺑﺎﻟﻴﻨﻲ ﭘﻴﺶ از ﻋﻤﻞ در ﺑﻴﻤﺎران ﻋﻤﻞ ﺷﺪه ﺑﻪ‬

‫درﻣﺎﻧﮕﺎه ﺟﺮاﺣﻲ ﺑﻴﻤﺎرﺳﺘﺎن دﻛﺘﺮ ﺷﺮﻳﻌﺘﻲ در ﺳﺎل ‪ ،1386-87‬ﻣﺮاﺟﻌﻪ‬

‫دو روش ﺗﺮﻣﻴﻢ اوﻟﻴﻪ و ﺗﺮﻣﻴﻢ ﺛﺎﻧﻮﻳﻪ در ﺟﺪول ‪ 1‬آورده ﺷﺪه اﺳﺖ‪.‬‬

‫ﻧﻤﻮدهاﻧﺪ‪ ،‬ﭘﺲ از ﺗﻮﺿﻴﺢ ﻛﺎﻣﻞ در ﻣﻮرد ﻧﺤﻮه اﺟﺮاي ﭘﮋوﻫﺶ و اﺧﺬ‬

‫ﻣﻄﺎﺑﻖ ﻧﺘﺎﻳﺞ ﺣﺎﺻﻞ‪ ،‬ﺑﻴﻦ ﻫﻴﭻﻳﻚ از ﻣﺘﻐﻴﺮﻫﺎي دﻣﻮﮔﺮاﻓﻴﻚ و ﺑﺎﻟﻴﻨﻲ‪ ،‬ﺑﻪ‬

‫رﺿﺎﻳﺖﻧﺎﻣﻪ ﻛﺘﺒﻲ‪ ،‬ﺑﻪ ﻳﻚ ﻣﻄﺎﻟﻌﻪ ﻛﺎرآزﻣﺎﻳﻲ ﺑﺎﻟﻴﻨﻲ ﺗﺼﺎدﻓﻲ ﺷﺪه‪ ،‬وارد‬

‫ﻏﻴﺮ از ﺳﻦ در دو ﮔﺮوه اﺧﺘﻼف ﻣﻌﻨﻲداري ﻣﺸﺎﻫﺪه ﻧﺸﺪ‪ .‬در ﺟﺪول ‪،2‬‬

‫ﺷﺪﻧﺪ‪ .‬ﺑﻴﻤﺎران ﺑﺎ آﺑﺴﻪ ﭘﻴﻠﻮﻧﻴﺪال ﺣﺎد ﺑﻪﻃﻮر اورژاﻧﺲ ﻋﻤﻞ ﺷﺪه و ﺑﻪ‬

‫ﻣﻘﺎﻳﺴﻪ ﻣﻴﺎﻧﮕﻴﻦ ﻣﺘﻐﻴﺮﻫﺎي ﻧﺘﺎﻳﺞ ﻋﻤﻞ‪ ،‬ﻓﺮاواﻧﻲ ﺑﺮوز ﻋﻮارض و ﻳﺎ ﻧﻴﺎز‬

‫ﻣﻄﺎﻟﻌﻪ وارد ﻧﺸﺪﻧﺪ‪ .‬ﺳﺎﻳﺮ ﺑﻴﻤﺎران ﺑﻪﺻﻮرت ﺗﺼﺎدﻓﻲ و ﺑﻪﻛﻤﻚ‬

‫ﺑﻪ ﻋﻤﻞ ﻣﺠﺪد و ﻣﻴﺰان رﺿﺎﻳﺖ ﺑﻴﻤﺎران در دو ﮔﺮوه ﻋﻤﻞ ﺷﺪه ﺑﻪ دو‬

‫ﻧﺮماﻓﺰار ‪ ،Randomization‬ﺑﻪ دو ﮔﺮوه ﺗﺮﻣﻴﻢ ﺑﻪروش اوﻟﻴﻪ )‪ (n=40‬و‬

‫روش ﺗﺮﻣﻴﻢ اوﻟﻴﻪ و ﺛﺎﻧﻮﻳﻪ آورده ﺷﺪه اﺳﺖ‪ .‬ﻫﻤﺎنﻃﻮر ﻛﻪ ﻣﻼﺣﻈﻪ‬

‫ﺛﺎﻧﻮﻳﻪ )‪ (n=40‬ﺗﻘﺴﻴﻢ ﺷﺪﻧﺪ‪ .‬در ﮔﺮوه ﺗﺮﻣﻴﻢ ﺑﻪروش اوﻟﻴﻪ‪ ،‬ﺳﻴﻨﻮسﻫﺎ‬

‫ﻣﻲﺷﻮد در روش ﺗﺮﻣﻴﻢ اوﻟﻴﻪ ﻃﻮل ﻣﺪت دوري از ﻛﺎر )‪8/65±1/73‬‬

‫و ﺗﺮاﻛﺖﻫﺎ و ﻛﻴﺴﺖﻫﺎي ﻣﻮﺟﻮد ﭘﺲ از ﺷﻨﺎﺳﺎﻳﻲ ﺑﺎ ﺑﻠﻮدوﻣﺘﻴﻠﻦ‪ ،‬ﺑﺮ‬

‫در ﺑﺮاﺑﺮ ‪ 11/53±2/33‬روز‪ (p=0/001 ،‬و ﻃﻮل ﻣﺪت ﺑﻬﺒﻮدي ﻛﺎﻣﻞ‬

‫اﺳﺎس ﻗﻀﺎوت ﺟﺮاح ﺑﺎ ﺣﺎﺷﻴﻪ ﺑﺎﻓﺖ ﺳﺎﻟﻢ ﺣﺪود دو ﺗﺎ ﺳﻪ ﺳﺎﻧﺘﻲﻣﺘﺮ‬

‫)‪ 3/43±0/92‬در ﺑﺮاﺑﺮ ‪ 5/3±0/79‬روز‪ (p=0/001 ،‬ﺑﻪﻣﻴﺰان ﻣﻌﻨﻲداري‬

‫از ﻫﺮ ﻃﺮف )ﺑﺎ رﻋﺎﻳﺖ ﻋﺪم آﺳﻴﺐ ﺑﻪ ﻧﺎﺣﻴﻪ آﻧﻮرﻛﺘﺎل( ﺑﺮداﺷﺘﻪ ﻣﻲﺷﺪ‬

‫ﻛﻮﺗﺎهﺗﺮ ﺑﻮدﻧﺪ اﻣﺎ اﺧﺘﻼف ﻣﻌﻨﻲداري در ﻃﻮل ﻣﺪت ﺑﺴﺘﺮي و ﺗﻌﺪاد‬

‫و ﻧﻘﺺ اﻳﺠﺎد ﺷﺪه ﺑﻪﺷﻜﻞ اوﻟﻴﻪ ﺑﺪون ﻓﻼپ ﺑﺎ ﻧﺦ ﻧﺎﻳﻠﻮن در ﺧﻂ‬

‫وﻳﺰﻳﺖﻫﺎ ﻣﺸﺎﻫﺪه ﻧﺸﺪ‪ .‬ﻫﻤﭽﻨﻴﻦ در ﮔﺮوهﺗﺮﻣﻴﻢ ﺑﻪروش اوﻟﻴﻪ‪ ،‬ﻣﻴﺎﻧﮕﻴﻦ‬

‫وﺳﻂ ﺗﺮﻣﻴﻢ ﻣﻲﺷﺪ‪ .‬ﺿﻤﻨﺎً در ﻓﻀﺎي ﻣﺬﻛﻮر ﻳﻚ درن ﻫﻤﻮوك ﺗﻌﺒﻴﻪ‬

‫ﺷﺪت درد در روزﻫﺎي اول )‪ 37/75±6/5‬در ﺑﺮاﺑﺮ ‪،43/63±5/06‬‬

‫ﻣﻲﺷﺪ ﻛﻪ ﻃﻲ ‪ 24‬ﺗﺎ ‪ 48‬ﺳﺎﻋﺖ ﺧﺎرج ﻣﻲﮔﺮدﻳﺪ‪ .‬در ﮔﺮوه ﺗﺮﻣﻴﻢ‬

‫‪ ،(p=0/001‬دوم )‪ 26/75± 6/66‬در ﺑﺮاﺑـﺮ ‪،(p=0/001 ،34/63± 5/48‬‬

‫ﺛﺎﻧﻮﻳﻪ )‪ (n=40‬ﺑﺮداﺷﺘﻦ ﺑﺎﻓﺖﻫﺎ ﺑﺪون ﺗﺮﻣﻴﻢ ﺻﻮرت ﻣﻲﮔﺮﻓﺖ و ﻧﻘﺺ‬ ‫اﻳﺠﺎد ﺷﺪه ﺑﺎ ﮔﺎز آﻏﺸﺘﻪ ﺑﻪ ﺑﺘﺎدﻳﻦ و ﭘﻤﺎد ﺗﺘﺮا ﺳﻴﻜﻠﻴﻦ ﭘﺮ ﺷﺪه و در‬

‫ﺟﺪول‪ :1-‬ﻣﻘﺎﻳﺴﻪ ﻣﻴﺎﻧﮕﻴﻦ ﻣﺘﻐﻴﺮﻫﺎي دﻣﻮﮔﺮاﻓﻴﻚ و ﺑﺎﻟﻴﻨﻲ ﭘﻴﺶ از ﻋﻤﻞ در ﺑﻴﻤﺎران‬

‫روزﻫﺎي آﺗﻲ ﻣﻜﺮراً ﺷﺴﺘﺸﻮ ﺷﺪ‪ .‬در ﻫﺮ دو ﮔﺮوه ﺑﻴﻤﺎر در روز ﺑﻌﺪ از‬

‫ﻋﻤﻞ ﺷﺪه ﺑﻪ دو روش ﺗﺮﻣﻴﻢ اوﻟﻴﻪ و ﺗﺮﻣﻴﻢ ﺛﺎﻧﻮﻳﻪ‬

‫ﺟﺮاﺣﻲ در ﺻﻮرت ﻋﺪم وﺟﻮد ﻣﺸﻜﻞ ﺧﺎص ﻣﺮﺧﺺ ﻣﻲﺷﺪ‪.‬‬

‫روش ﺗﺮﻣﻴﻢ ﺛﺎﻧﻮﻳﻪ‬

‫*‪p‬‬

‫)‪(n=40‬‬

‫)‪(n=40‬‬

‫‪23/45±4/57‬‬

‫‪27/5±9/91‬‬

‫‪0/021‬‬

‫ﺟﻨﺲ )ﻣﺬﻛﺮ(‬

‫)‪5(%12/5‬‬

‫)‪5(%12/5‬‬

‫‪0/99‬‬

‫ﭘﺲ از ﻋﻤﻞ در روزﻫﺎي ﻳﻚ )ﺣﻀﻮري(‪ ،‬دو و ﺳﻪ و ﻫﻔﺖ )ﺗﻠﻔﻨﻲ(‪،‬‬

‫ﻃﻮل ﻣﺪت ﺑﻴﻤﺎري‬

‫‪1/61±0/83‬‬

‫‪1/81±0/73‬‬

‫‪0/256‬‬

‫ﻣﻴﺰان رﺿﺎﻳﺖ ﺑﻴﻤﺎران و ﻋﺎرﺿﻪ و ﻧﻴﺎز ﺑﻪ ﺗﻜﺮار ﻋﻤﻞ ﺟﺮاﺣﻲ‪ .‬رﺿﺎﻳﺖ‬

‫ﻋﻔﻮﻧﺖ ﻓﻌﻠﻲ‬

‫)‪1(%2/56‬‬

‫)‪2(%5‬‬

‫‪0/571‬‬

‫ﺑﻴﻤﺎران ﺑﺎ ﻣﻘﻴﺎس ﻧﺴﺒﻲ از ﭘﻨﺞ )ﺑﺴﻴﺎر راﺿﻲ( ﺗﺎ ﻳﻚ )ﺑﺴﻴﺎر ﻧﺎراﺿﻲ(‬

‫ﺗﻌﺪاد ﻋﻔﻮﻧﺖﻫﺎي‬

‫‪1/74±0/85‬‬

‫‪1/8±0/91‬‬

‫‪0/777‬‬

‫)‪2(%5‬‬

‫)‪1(%2/56‬‬

‫‪0/556‬‬

‫ﭘﻴﺎﻣﺪﻫﺎي ﻣﻬﻢ ﺷﺎﻣﻞ ﻣﻮارد زﻳﺮ ﺑﻮدﻧﺪ‪ :‬ﻣﺪت ﺑﺴﺘﺮي در ﺑﻴﻤﺎرﺳﺘﺎن‪،‬‬ ‫ﻣﺪت ﺑﻬﺒﻮدي ﻛﺎﻣﻞ زﺧﻢ‪ ،‬ﻣﺪت دوري از ﻛﺎر‪ ،‬ﺗﻌﺪاد وﻳﺰﻳﺖﻫﺎ‪ ،‬درد‬

‫ﺑﺮرﺳﻲ ﺷﺪ‪ .‬ﺑﺮاي ﻣﻘﺎﻳﺴﻪ ﻣﻴﺎﻧﮕﻴﻦﻫﺎ از آزﻣﻮن آﻣﺎري‬

‫‪Student’s t-test‬‬

‫ﺑﺮاي ﻧﻤﻮﻧﻪﻫﺎي ﻏﻴﺮ واﺑﺴﺘﻪ ‪ ،Independent samples t-test‬و ﺑﺮاي‬ ‫ﻣﻘﺎﻳﺴﻪ دادهﻫﺎي ﻛﻴﻔﻲ از آزﻣﻮن‬

‫‪2‬‬

‫‪‬‬

‫ﻳﺎ ‪ Fisher’s exact test‬ﻣﺘﻨﺎﺳﺐ ﺑﺎ‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬

‫ﻣﺘﻐﻴﺮ‬ ‫ﺳﻦ*‬

‫ﻗﺒﻠﻲ‬ ‫آﺑﺴﻪ‬

‫روش ﺗﺮﻣﻴﻢ اوﻟﻴﻪ‬

‫* اﺧﺘﻼف ﻣﻌﻨﻲدار ﺑﺮ اﺳﺎس آزﻣﻮن آﻣﺎري ‪ .Independent samples t-test‬ﻣﻘﺎدﻳﺮ ﺑﻪﺻـﻮرت‬ ‫اﻧﺤﺮافﻣﻌﻴﺎر‪ ±‬ﻣﻴﺎﻧﮕﻴﻦ ﻳﺎ )درﺻﺪ( ﺗﻌﺪاد ﺑﻴﺎن ﺷﺪهاﻧﺪ‪ p<0/05 .‬ﻣﻌﻨﻲدار اﺳﺖ‪.‬‬


‫‪555‬‬

‫ﻣﻘﺎﻳﺴﺔ ﻧﺘﺎﻳﺞ ﺟﺮاﺣﻲ ﺳﻴﻨﻮس ﭘﺎﻳﻠﻮﻧﻴﺪال ﺑﻪروش ﺗﺮﻣﻴﻢ »اوﻟﻴﻪ« و »ﺛﺎﻧﻮﻳﻪ«‬

‫ﺟﺪول‪ :2-‬ﻣﻘﺎﻳﺴﻪ ﻣﻴﺎﻧﮕﻴﻦ ﻣﺘﻐﻴﺮﻫﺎي ﻧﺘﺎﻳﺞ ﻋﻤﻞ‪ ،‬ﻓﺮاواﻧﻲ ﺑﺮوز ﻋﻮارض و ﻳـﺎ ﻧﻴـﺎز‬

‫ﺑﺤﺚ‬

‫ﺑﻪ ﻋﻤﻞ ﻣﺠﺪد و ﻣﻴﺰان رﺿﺎﻳﺖ ﺑﻴﻤﺎران در دو روش ﺗﺮﻣﻴﻢ اوﻟﻴﻪ و ﺛﺎﻧﻮﻳﻪ‬ ‫ﻣﺘﻐﻴﺮ‬

‫روش ﺗﺮﻣﻴﻢ اوﻟﻴﻪ‬

‫روش ﺗﺮﻣﻴﻢ ﺛﺎﻧﻮﻳﻪ‬

‫)‪(n=40‬‬

‫)‪(n=40‬‬

‫*‪p‬‬

‫ﻧﺘﺎﻳﺞ ﺑﻪدﺳﺖ آﻣﺪه از اﻳﻦ ﻣﻄﺎﻟﻌﻪ ﻧﺸﺎن داد ﻛﻪ ﻣﻴﺎﻧﮕﻴﻦ ﺳﻦ ﺑﻴﻤﺎران‬

‫ﻃﻮلﻣﺪت ﺑﺴﺘﺮي‬

‫‪1/13±0/33‬‬

‫‪1/23±0/42‬‬

‫‪0/245‬‬

‫ﻣﻮرد ﺑﺮرﺳﻲ ‪ 25/47±7/93‬ﺳﺎل ﺑﻮد و اﻛﺜﺮ آﻧﺎن اﻓﺮاد ﻣﺬﻛﺮ )‪(%87/50‬‬

‫ﻃﻮلﻣﺪت دوري‬

‫‪8/65±1/73‬‬

‫‪11/53±2/33‬‬

‫‪0/001‬‬

‫ﺑﻮدﻧﺪ‪ .‬در ﻣﻄﺎﻟﻌﺎت ﻗﺒﻠﻲ ﻧﻴﺰ ﻣﺮدان دو ﺑﺮاﺑﺮ ﺑﻴﺸﺘﺮ از زﻧﺎن ﻣﺒﺘﻼ‬

‫از ﻛﺎر‬

‫‪5‬‬

‫*‬

‫‪1‬‬

‫ﻣﻲﺷﻮﻧﺪ و ﺑﻴﺸﺘﺮ در ﺟﻮاﻧﺎن ﺳﻨﻴﻦ ﻛﺎر دﻳﺪه ﻣﻲﺷﻮد‪ .‬در ﻣﻄﺎﻟﻌﻪ‬

‫ﺗﻌﺪاد وﻳﺰﻳﺖ‬

‫‪2/68±0/53‬‬

‫‪2/87±0/52‬‬

‫‪0/12‬‬

‫‪ Ommer‬ﻣﻴﺎﻧﮕﻴﻦ ﺳﻨﻲ ﺑﻴﻤﺎران ‪ 32±13‬ﺳﺎل ﺑﻮد و ﻋﻤﻮﻣﺎً‪ ،‬ﻣﺮد ﺑﻮدﻧﺪ‪.‬‬

‫ﻃﻮلﻣﺪت ﺑﻬﺒﻮدي‬

‫‪3/43±0/92‬‬

‫‪5/3±0/79‬‬

‫‪0/001‬‬

‫‪ McCallum‬ﺑﻴﺎن ﻛﺮد ﻛﻪ ﻣﻴﺎﻧﻪ ﺳﻦ ﺑﻴﻤﺎران ﻣﺒﺘﻼ ﺑﻪ ﺳﻴﻨﻮس ﭘﻴﻠﻮﻧﻴﺪال‬

‫ﻛﺎﻣﻞ زﺧﻢ‬

‫*‬

‫ﻋﺎرﺿﻪ‬

‫)‪4(%10‬‬

‫)‪2(%5‬‬

‫‪0/396‬‬

‫ﻧﻴﺎز ﺑﻪ ﺗﻜﺮار‬

‫)‪1(%2/5‬‬

‫)‪1(%2/56‬‬

‫‪0/986‬‬

‫در آﻗﺎﻳﺎن ‪ 21‬ﺳﺎل و در ﺧﺎﻧﻢﻫﺎ ‪ 19‬ﺳﺎل ﻣﻲﺑﺎﺷﺪ‪ 4.‬ﺑﺮ اﺳﺎس ﻣﻄﺎﻟﻌﻪ‬ ‫ﺣﺎﺿﺮ‪ ،‬ﺑﻴﻦ ﻣﺘﻐﻴﺮﻫﺎي دﻣﻮﮔﺮاﻓﻴﻚ و ﻣﺘﻐﻴﺮﻫﺎي ﺑﺎﻟﻴﻨﻲ ﻣﺎﻧﻨﺪ ﻣﺪت‬ ‫ﺑﻴﻤﺎري‪ ،‬وﺟﻮد ﻋﻔﻮﻧﺖ ﻓﻌﻠﻲ و آﺑﺴﻪ‪ ،‬اﺧﺘﻼف ﻣﻌﻨﻲداري دﻳﺪه ﻧﺸﺪ‪.‬‬

‫ﻋﻤﻞ ﺟﺮاﺣﻲ‬ ‫‪4/15±0/53‬‬

‫ﻣﻴﺰان رﺿﺎﻳﺖ‬ ‫ﺑﻴﻤﺎران‬

‫‪6‬‬

‫‪3/6±0/5‬‬

‫‪0/001‬‬

‫*‬

‫ﻫﻤﭽﻨﻴﻦ ﻣﻄﺎﺑﻖ ﻧﺘﺎﻳﺞ ﺑﻪدﺳﺖ آﻣﺪه از اﻳﻦ ﻣﻄﺎﻟﻌﻪ‪ ،‬اﺧﺘﻼف ﻣﻌﻨﻲداري‬ ‫در ﻣﺪت ﺑﺴﺘﺮي و ﺗﻌﺪاد وﻳﺰﻳﺖﻫﺎ ﻣﺸﺎﻫﺪه ﻧﺸﺪ‪ .‬اﻳﻦ در ﺣﺎﻟﻲ اﺳﺖ‬

‫* اﺧﺘﻼف ﻣﻌﻨﻲدار ﺑﺮ اﺳﺎس آزﻣﻮن آﻣﺎري ‪ .Independent samples t-test‬ﻣﻘﺎدﻳﺮ ﺑﻪﺻـﻮرت‬ ‫اﻧﺤﺮافﻣﻌﻴﺎر‪ ±‬ﻣﻴﺎﻧﮕﻴﻦ ﻳﺎ ﺗﻌﺪاد )درﺻﺪ( ﺑﻴﺎن ﺷﺪهاﻧﺪ‪ p<0/05 .‬ﻣﻌﻨﻲدار اﺳﺖ‪.‬‬

‫ﻛﻪ در اﻛﺜﺮ ﻣﻄﺎﻟﻌﺎت ﻗﺒﻠﻲ‪ ،‬ﻣﺪت ﺑﺴﺘﺮي در ﮔﺮوه ﺑﺴﺘﻪ ﻛﻮﺗﺎهﺗﺮ اﺳﺖ‪.‬‬ ‫ﺑﻪﻋﻨﻮان ﻣﺜﺎل ‪ Al-Salamah‬در ﻳﻚ ﻣﻄﺎﻟﻌﻪ ﺑﻪﻣﻨﻈﻮر ﺑﺮرﺳﻲ دو روش‬ ‫ﺗﺮﻣﻴﻢ ﺑﺴﺘﻪ و ﺑﺎز اوﻟﻴﻪ ﻧﺸﺎن داد ﻛﻪ ﻃﻮل ﻣﺪت اﻗﺎﻣﺖ در ﺑﻴﻤﺎرﺳﺘﺎن در‬ ‫ﮔﺮوه اوﻟﻴﻪ ﺑﻪﻣﻴﺰان ﻣﻌﻨﻲداري ﺑﻴﺸﺘﺮ اﺳﺖ )‪ 3/6±1/4‬روز در ﺑﺮاﺑﺮ‬

‫‪60‬‬

‫روش ﺗﺮﻣﻴﻢ ﺛﺎﻧﻮﻳﻪ‬ ‫روش ﺗﺮﻣﻴﻢ اوﻟﻴﻪ‬

‫‪7‬‬

‫‪50‬‬

‫‪ 4±1/1‬روز(‪ Ertan .‬ﻧﻴﺰ ﺑﻪ ﻧﺘﺎﻳﺞ ﻣﺸﺎﺑﻬﻲ دﺳﺖ ﻳﺎﻓﺖ‪ .‬اﮔﺮﭼﻪ‬

‫‪40‬‬

‫ﻣﻄﺎﻟﻌﺎﺗﻲ‪ ،‬ﻣﻐﺎﻳﺮ ﺑﺎ ﻧﺘﺎﻳﺞ ﺑﺎﻻ ﻧﻴﺰ ﻣﻮﺟﻮد اﺳﺖ ﻛﻪ ﻧﺸﺎن ﻣﻲدﻫﻨﺪ ﻃﻮل‬ ‫ﺷﺪت درد‬

‫‪30‬‬ ‫‪20‬‬

‫روز ﻫﻔﺘﻢ‬

‫روز ﺳﻮم‬

‫روز دوم‬

‫روز اول‬

‫‪3‬‬

‫ﻣﺪت ﺑﺴﺘﺮي در ﮔﺮوه ﺑﺴﺘﻪ ﻃﻮﻻﻧﻲﺗﺮ اﺳﺖ‪ .‬ﺑﻪﻋﻨﻮان ﻣﺜﺎل‬

‫‪Fuzun‬‬

‫ﻧﺸﺎن داد ﻛﻪ در ﺑﻴﻤﺎران ﺑﺎ ‪ Primary closure‬ﻃﻮل ﻣﺪت ﺑﺴﺘﺮي در‬ ‫ﺑﻴﻤﺎرﺳﺘﺎن ﺑﻪﻣﻴﺰان ﻣﻌﻨﻲداري ﺑﺎﻻﺗﺮ اﺳﺖ وﻟﻲ ﺳﺮﻳﻊﺗﺮ ﺑﻪﻛﺎر‬

‫‪10‬‬

‫ﺑﺮﮔﺸﺘﻪاﻧﺪ‪ 8.‬ﻣﻴﺰان ﻋﻔﻮﻧﺖ و ﻋﻮد در دو ﮔﺮوه ﻧﻴﺰ اﺧﺘﻼف ﻣﻌﻨﻲداري‬

‫‪0‬‬

‫ﻧﺪاﺷﺖ‪ .‬ﺷﺎﻳﺪ ﻳﻜﻲ از دﻻﻳﻞ آن اﺳﺘﻔﺎده از ﻣﻌﻴﺎرﻫﺎي ﻣﺘﻔﺎوﺗﻲ ﺑﺮاي‬

‫ﻧﻤﻮدار‪ :1-‬ﻣﻘﺎﻳﺴﻪ ﻣﻴﺎﻧﮕﻴﻦ ﺷﺪت درد در روزﻫﺎي اول‪ ،‬دوم‪ ،‬ﺳﻮم و ﻫﻔﺘﻢ ﭘـﺲ از‬

‫ﺗﺮﺧﻴﺺ ﺑﻴﻤﺎران ﺑﺎﺷﺪ‪ .‬ﺑﻪﻫﻤﻴﻦ دﻟﻴﻞ ﻣﺪت ﺑﺴﺘﺮي در ﻣﻄﺎﻟﻌﺎت‬

‫ﻋﻤﻞ در ﺑﻴﻤﺎران ﻋﻤﻞ ﺷﺪه ﺑﻪ دو روش ﺗﺮﻣﻴﻢ اوﻟﻴﻪ و ﺗﺮﻣﻴﻢ ﺛﺎﻧﻮﻳﻪ‬

‫ﻣﺨﺘﻠﻒ‪ ،‬ﻣﺘﻔﺎوت ﮔﺰارش ﺷﺪه اﺳﺖ‪ .‬ﺑﺎ اﻳﻦ وﺟﻮد ﺑﻪﻧﻈﺮ ﻣﻲرﺳﺪ ﻛﻪ‬

‫* اﺧﺘﻼف ﻣﻌﻨﻲدار ﺑﺮ اﺳﺎس آزﻣﻮن آﻣﺎري‬

‫‪Independent samples t-test‬‬

‫ﻣﺪت ﺑﺴﺘﺮي در روش ﺑﺎز ﻧﺴﺒﺖ ﺑﻪ روش ﺑﺴﺘﻪ ﻛﻮﺗﺎهﺗﺮ ﺑﺎﺷﺪ‪ .‬اﮔﺮﭼﻪ‬ ‫اﻳﻦ اﺧﺘﻼف ﻣﻌﻨﻲدار ﻧﺒﻮده اﺳﺖ‪.‬‬

‫‪8-11‬و‪2‬‬

‫در ﻣﻄﺎﻟﻌﻪ ﺣﺎﺿﺮ ﻧﻴﺰ اﮔﺮﭼﻪ‬

‫ﺳـــﻮم )‪ 18/25±6/05‬در ﺑﺮاﺑـــﺮ ‪ (p=0/001 ،27/88±6/88‬و ﻫﻔـــﺘﻢ‬

‫ﻃﻮل ﻣﺪت ﺑﺴﺘﺮي در ﮔﺮوه اوﻟﻴﻪ ﻛﻮﺗﺎهﺗﺮ ﺑﻮد اﻣﺎ اﺧﺘﻼف‪ ،‬ﻣﻌﻨﻲدار‬

‫)‪ 8/45±3/85‬در ﺑﺮاﺑﺮ ‪ (p=0/001 ،17/88±6/19‬ﭘﺲ از ﻋﻤﻞ ﺑﻪﻣﻴـﺰان‬

‫ﻧﺒﻮد‪ .‬در ﻣﻮرد دﻓﻌﺎت وﻳﺰﻳﺖﻫﺎ ‪ Perruchoud‬ﻧﺸﺎن داد ﻛﻪ در ﮔﺮوه‬

‫ﻣﻌﻨﻲداري ﻛﻤﺘﺮ ﺑﻮد )ﻧﻤﻮدار ‪ .(1‬ﻓﺮاواﻧﻲ ﺑﺮوز ﻋﺎرﺿﻪ و ﻧﻴﺎز ﺑﻪ ﺗﻜـﺮار‬

‫ﺑﺴﺘﻦ اوﻟﻴﻪ دﻓﻌﺎت ﻣﺮاﺟﻌﻪ ﺑﻌﺪ از ﻋﻤﻞ ﺑﻪﻣﻴﺰان ﻣﻌﻨﻲداري ﻛﻤﺘﺮ اﺳﺖ‬ ‫‪12‬‬

‫ﻋﻤـﻞ ﺟﺮاﺣــﻲ در دو ﮔــﺮوه اﺧـﺘﻼف ﻣﻌﻨــﻲداري ﻧﺪاﺷــﺘﻨﺪ‪ .‬رﺿــﺎﻳﺖ‬

‫)ﻣﻴﺎﻧﮕﻴﻦ ﺷﺶ در ﺑﺮاﺑﺮ ‪ 40‬ﺑﺎر(‪ .‬ﻳﺎﻓﺘﻪﻫﺎي اﻳﻦ ﻣﻄﺎﻟﻌﻪ ﻣﻲﮔﻮﻳﺪ ﻛﻪ‬

‫ﺑﻴﻤــﺎران در ﮔــﺮوه ﺗــﺮﻣﻴﻢ اوﻟﻴــﻪ )‪ 4/15±0/53‬در ﺑﺮاﺑــﺮ ‪،3/6±0/5‬‬

‫ﻣﻴﺎﻧﮕﻴﻦ ﻣﺪت دوري از ﻛﺎر و ﻣﺪت ﺑﻬﺒﻮدي ﻛﺎﻣﻞ زﺧﻢ ﺑﻪﻣﻴﺰان‬

‫‪ (p=0/001‬ﺑﻴﺸﺘﺮ ﺑﻮد )ﺟﺪول ‪.(2‬‬

‫ﻣﻌﻨﻲداري در ﮔﺮوه ﺗﺮﻣﻴﻢ ﺷﺪه ﺑﻪروش اوﻟﻴﻪ از ﮔﺮوه ﺗﺮﻣﻴﻢ ﺷﺪه‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬


‫ﺑﺎﺑﻚ ﺣﺎﺟﻲ ﺑﺮاﺗﻲ و ﻫﻤﻜﺎران‬

‫‪556‬‬

‫ﺑﻪروش ﺛﺎﻧﻮﻳﻪ ﻛﻮﺗﺎهﺗﺮ اﺳﺖ‪ .‬ﻧﺘﺎﻳﺞ ﺳﺎﻳﺮ ﻣﻄﺎﻟﻌﺎت ﺑﻪ اﻳﻦ ﻧﺘﺎﻳﺞ ﻧﺰدﻳﻚ‬

‫درﻣﺎن ﻣﻲﺷﻮﻧﺪ ‪ %58‬از ﺑﻴﻤﺎران ﮔﺮوه ﺗﺮﻣﻴﻢ ﺛﺎﻧﻮﻳﻪ ﻛﻤﺘﺮ اﺳﺖ‪) .‬ﺧﻄﺮ‬ ‫‪1‬‬

‫اﺳﺖ‪ .‬ﺑﻪﻋﻨﻮان ﻣﺜﺎل ‪ Ommer‬ﻧﺸﺎن داد ﻛﻪ ﻣﻴﺎﻧﮕﻴﻦ ﻃﻮل ﻣﺪت ﺑﻬﺒﻮدي‬

‫ﻧﺴﺒﻲ ‪ 0/42‬ﺑﺎ ﻣﺤﺪوده از ‪ 0/26‬ﺗﺎ ‪ .(0/66‬در ﻣﺘﺎآﻧﺎﻟﻴﺰ ﻣﻄﺎﻟﻌﺎﺗﻲ ﻛﻪ‬

‫ﭘﺲ از ﻋﻤﻞ در ﮔﺮوه ﺑﺴﺘﻪ ‪ 15±3‬روز و در ﮔﺮوه ﺑﺎز ‪ 66±15‬روز‬

‫ﺻﺮﻓﺎً ﺑﻪ ﺑﺮرﺳﻲ ﺗﺮﻣﻴﻢ ﺑﻪروش ﺑﺎز در ﻣﻘﺎﻳﺴﻪ ﺑﺎ روش ﺑﺴﺘﻦ اوﻟﻴﻪ در‬

‫ﺑﻮد‪ 6.‬ﻫﻤﭽﻨﻴﻦ ﻧﺸﺎن داد ﻛﻪ زﻣﺎن دوري از ﻛﺎر‪ ،‬در ﮔﺮوه ﺑﺴﺘﻪ ‪19±10‬‬

‫ﺧﻂ وﺳﻂ ﭘﺮداﺧﺘﻪاﻧﺪ ﻧﺸﺎن داده ﺷﺪه ﻛﻪ ﻣﻴﺰان ﻋﻮد در روش ﺑﺎز‬

‫روز و در ﮔﺮوه ﺑﺎز ‪ 52±19‬روز ﺑﻮد‪ .‬ﻫﻤﭽﻨﻴﻦ ‪ Al-Salamah‬ﻧﺸﺎن داد‬

‫ﺑﻪﻣﻴﺰان ﻣﻌﻨﻲداري ﻧﺴﺒﺖ ﺑﻪ ﮔﺮوه ﺑﺴﺘﻪ ﻛﻤﺘﺮ اﺳﺖ )‪ 0/39‬ﺑﺎ ﻣﺤﺪوده‬

‫ﻛﻪ ﻃﻮل ﻣﺪت ﺑﻬﺒﻮدي و ﻣﺮﺧﺼﻲ از ﻛﺎر ﻧﻴﺰ در ﮔﺮوه ﺑﺴﺘﻪ ﻛﻮﺗﺎهﺗﺮ‬

‫‪ 0/23‬ﺗﺎ ‪ Ommer 1.(0/66‬ﻧﺸﺎن داد ﻛﻪ ﻋﻮد ﺗﻨﻬﺎ در ﮔﺮوه ﺑﺴﺘﻪ و‬

‫ﺑﻮد‪ Fuzun 7.‬ﻧﺸﺎن داد ﻛﻪ در ﺑﻴﻤﺎران ﺑﺎ ﺑﺴﺘﻦ اوﻟﻴﻪ ﺳﺮﻳﻊﺗﺮ ﺑﻪﻛﺎر‬

‫ﺑﻪﻣﻴﺰان ‪ %18‬ﺑﻮده اﺳﺖ و در ﮔﺮوه ﺑﺎز دﻳﺪه ﻧﺸﺪ‪ .‬ﻋﻔﻮﻧﺖ ﻣﻮﺿﻊ‪،‬‬

‫ﺑﺮﮔﺸﺘﻪاﻧﺪ‪ 8.‬ﻫﻤﭽﻨﻴﻦ ﻣﻄﺎﻟﻌﺎت دﻳﮕﺮ ﻧﺸﺎن ﻣﻲدﻫﺪ زﻣﺎن ﺑﺎزﮔﺸﺖ ﺑﻪ‬

‫ﺑﻪﻋﻨﻮان ﻳﻜﻲ از ﻋﻮارض ﭘﺲ از ﻋﻤﻞ‪ ،‬در ﮔﺮوه ﺑﺎز اﻧﺪﻛﻲ ﺑﻴﺶ از‬

‫ﻛﺎر در ﮔﺮوه ﺗﺮﻣﻴﻢ ﺑﻪروش ﺑﺎز ﺑﻪﻣﻴﺰان ﻣﻌﻨﻲداري ﻧﺴﺒﺖ ﺑﻪ آنﻫﺎ ﻛﻪ‬

‫ﮔﺮوه ﺑﺴﺘﻪ ﮔﺰارش ﺷﺪه اﺳﺖ اﻣﺎ اﻳﻦ اﺧﺘﻼف‪ ،‬ﻣﻌﻨﻲدار ﻧﺒﻮده‬

‫ﺗﺤﺖ روش ﺑﺴﺘﻪ ﻗﺮار ﮔﺮﻓﺘﻪاﻧﺪ ﻃﻮﻻﻧﻲﺗﺮ اﺳﺖ‪ .‬ﻣﻴﺎﻧﮕﻴﻦ اﻳﻦ اﺧﺘﻼف‬ ‫‪13‬و‪11‬و‪9‬و‪8‬و‪2‬‬

‫ﺣﺪوداً ‪ 10/48‬روز اﺳﺖ‪.‬‬

‫ﻧﺘﺎﻳﺞ ﻣﺸﺎﺑﻬﻲ در ﺳﺎﻳﺮ ﻣﻄﺎﻟﻌﺎت‬

‫ﻣﺸﺎﻫﺪه ﺷﺪه اﺳﺖ‪12.‬و‪ 3‬اﻣﺎ در ﻣﻮرد ﺑﻬﺒﻮدي زﺧﻢ‪ ،‬ﻧﺘﺎﻳﺞ ﺿﺪ و ﻧﻘﻴﻀﻲ‬ ‫وﺟﻮد دارد‪ ،McCallum .‬در ﻳﻚ ﻣﻄﺎﻟﻌﻪ ﻣﺮور ﺳﻴﺴﺘﻤﺎﺗﻴﻚ‪ ،‬ﻧﺘﺎﻳﺞ ﻓﻮق‬ ‫‪13-16‬و‪3‬و‪1‬‬

‫‪6‬‬

‫‪15‬و‪13‬و‪11‬و‪8‬‬

‫اﺳﺖ‪.‬‬

‫‪ Fuzun‬ﻧﺸﺎن داد ﻛﻪ ﻣﻴﺰان ﻋﻔﻮﻧﺖ و ﻋﻮد در ﺑﻴﻤﺎران‬

‫ﺑﺎ ﺗﺮﻣﻴﻢ ﺑﺴﺘﻪ در ﻣﻘﺎﻳﺴﻪ ﺑﺎ ﺗﺮﻣﻴﻢ ﺑﺎز ﻓﺎﻗﺪ اﺧﺘﻼف ﻣﻌﻨﻲدار ﺑﻮده‬ ‫‪8‬‬

‫اﺳﺖ‪ .‬در ﻣﻄﺎﻟﻌﺎت دﻳﮕﺮ ﻧﻴﺰ ﺑﺮ ﻋﺪم وﺟﻮد اﺧﺘﻼف ﻣﻌﻨﻲدار ﺑﻴﻦ دو‬ ‫‪17‬و‪14‬و‪13‬و‪11‬و‪9‬و‪2‬‬

‫اﻳﻦ ﻣﻮرد در‬

‫ﮔﺮوه ﺗﺮﻣﻴﻢ ﺑﺎز و ﺑﺴﺘﻪ ﺻﺤﻪ ﮔﺬاﺷﺘﻪاﻧﺪ‪.‬‬

‫ﻃﻲ ﺳﻪ ﻣﻄﺎﻟﻌﻪ ﻧﻴﺰ ﻧﺸﺎن داده ﺷﺪه ﻛﻪ‬

‫ﻳﻚ ﻣﺘﺎآﻧﺎﻟﻴﺰ ﻧﻴﺰ ﺗﺎﻳﻴﺪ ﺷﺪه اﺳﺖ‪ 1.‬ﻣﻴﺎﻧﮕﻴﻦ ﻣﻴﺰان رﺿﺎﻳﺖ ﺑﻴﻤﺎران‬

‫ﺑﻬﺒﻮدي ﺳﺮﻳﻊﺗﺮ در ﮔﺮوه ﺗﺮﻣﻴﻢ اوﻟﻴﻪ دﻳﺪه ﺷﺪه اﻣﺎ از ﻧﻈﺮ آﻣﺎري ﺗﺴﺖ‬

‫ﺑﻪﻣﻴﺰان ﻣﻌﻨﻲداري در ﮔﺮوه ﺗﺮﻣﻴﻢ ﺑﻪروش اوﻟﻴﻪ از ﮔﺮوه ﺗﺮﻣﻴﻢ ﺛﺎﻧﻮﻳﻪ‬

‫در ﺑﺮﺧﻲ ﻣﻄﺎﻟﻌﺎت ﻧﻴﺰ اﺧﺘﻼف ﻣﻌﻨﻲداري در ﺑﻴﻦ‬

‫‪Ertan‬‬

‫را ﺗﺎﻳﻴﺪ ﻛﺮده اﺳﺖ‪.‬‬ ‫‪18‬و‪17‬و‪9‬‬

‫ﻧﺸﺪه اﺳﺖ‪.‬‬

‫‪18‬و‪13‬و‪9‬و‪2‬‬

‫ﻣﻴﺰان ﺑﻬﺒﻮد زﺧﻢ در دو ﮔﺮوه ﺑﺎز و ﺑﺴﺘﻪ ﮔﺰارش ﻧﺸﺪه اﺳﺖ‪.‬‬

‫ﺑﻴﺸﺘﺮ اﺳﺖ )‪ 4/15±0/53‬در ﺑﺮاﺑﺮ ‪.(p=0/001 ،3/6±0/5‬‬

‫رﺿﺎﻳﺖﻣﻨﺪي را ﻛﻪ ﺷﺎﻣﻞ ﺳﻄﺢ ﺳﻼﻣﺘﻲ ﺑﺎﻻﺗﺮ و ﻋﻤﻠﻜﺮد اﺟﺘﻤﺎﻋﻲ‬ ‫‪3‬‬

‫‪McCallum‬‬

‫ﺑﺮ اﺳﺎس ﻳﺎﻓﺘﻪﻫﺎي ﻣﻄﺎﻟﻌﻪ ﺣﺎﺿﺮ‪ ،‬ﻣﻴﺎﻧﮕﻴﻦ ﺷﺪت درد در روزﻫﺎي‬

‫ﻣﻄﻠﻮبﺗﺮ و درد ﻛﻤﺘﺮ ﺑﻮد را در ﮔﺮوه ﺑﺴﺘﻪ ﮔﺰارش ﻛﺮد‪.‬‬

‫ﻳﻚ‪ ،‬دو و ﻫﻔﺖ ﭘﺲ از ﻋﻤﻞ ﺑﻪﻣﻴﺰان ﻣﻌﻨﻲداري در ﮔﺮوه ﺗﺮﻣﻴﻢ اوﻟﻴﻪ‬

‫ﺑﺎ ﻣﻄﺎﻟﻌﻪ ﻣﺮور ﺳﻴﺴﺘﻤﺎﺗﻴﻚ ﻧﺸﺎن داد‪ ،‬ﻣﻴﺎن ﻣﻴﺰان رﺿﺎﻳﺖ ﺑﻴﻤﺎران در‬ ‫‪4‬‬

‫از ﮔﺮوه ﺗﺮﻣﻴﻢ ﺛﺎﻧﻮﻳﻪ ﻛﻤﺘﺮ اﺳﺖ‪ Rao .‬ﻧﺸﺎن داد ﻛﻪ ﺷﺪت درد ﭘﺲ از‬

‫دو ﮔﺮوه‪ ،‬اﺧﺘﻼف ﻣﻌﻨﻲداري وﺟﻮد ﻧﺪارد‪ .‬ﻧﻬﺎﻳﺘﺎً ﻧﺘﺎﻳﺞ اﻳﻦ ﻣﻄﺎﻟﻌﻪ‬

‫ﻋﻤﻞ در روز ﭼﻬﺎرم ﺑﻪﻣﻴﺰان ﻣﻌﻨﻲداري در ﮔﺮوه ﺑﺎز ﻧﺴﺒﺖ ﺑﻪ ﮔﺮوه‬

‫ﻧﺸﺎن داد‪ ،‬ﺗﺮﻣﻴﻢ اوﻟﻴﻪ ﺑﺎ ﻛﺎﻫﺶ ﻣﺪت دوري از ﻛﺎر‪ ،‬ﻣﺪت ﺑﻬﺒﻮدي‬

‫ﺑﺴﺘﻪ ﭘﺎﻳﻴﻦﺗﺮ اﺳﺖ‪ Ertan 16.‬ﻧﻴﺰ ﻣﻴﺎﻧﮕﻴﻦ ﺷﺪت درد ﭘﺲ از ﻋﻤﻞ‬

‫ﻛﺎﻣﻞ زﺧﻢ و ﻣﻴﺎﻧﮕﻴﻦ ﺷﺪت درد ﭘﺲ از ﻋﻤﻞ و اﻓﺰاﻳﺶ ﻣﻴﺰان رﺿﺎﻳﺖ‬

‫ﻛﻤﺘﺮي را در ﮔﺮوه ﺑﺴﺘﻪ ﻧﺸﺎن داد )‪ 6/5±1/7‬در ﺑﺮاﺑﺮ ‪ 3.(7/4±1/4‬اﻣﺎ‬

‫ﺑﻴﻤﺎران ﻫﻤﺮاه اﺳﺖ در ﺣﺎﻟﻲﻛﻪ ﻓﺮاواﻧﻲ ﺑﺮوز ﻋﺎرﺿﻪ و ﻧﻴﺎز ﺑﻪ ﺗﻜﺮار‬

‫در ﻳﻚ ﻣﻄﺎﻟﻌﻪ ﻣﺮوري ﺗﻮﺳﻂ ‪ McCallum‬اﺧﺘﻼف ﻣﻌﻨﻲداري ﺑﻴﻦ‬

‫ﻋﻤﻞ ﺟﺮاﺣﻲ را اﻓﺰاﻳﺶ ﻧﺪاده و ﻃﻮل ﻣﺪت ﺑﺴﺘﺮي را ﻧﻴﺰ ﺑﺎﻻ ﻧﻤﻲﺑﺮد‪.‬‬

‫ﺷﺪت درد دو ﮔﺮوه ﮔﺰارش ﻧﺸﺪه اﺳﺖ‪ 4.‬ﻣﻄﺎﻟﻌﻪ ﺣﺎﺿﺮ ﻫﻤﭽﻨﻴﻦ‬

‫‪ Toccaceli‬ﭘﺲ از ‪ 20‬ﺳﺎل ﺗﺠﺮﺑﻪ ﺗﺮﻣﻴﻢ ﺑﺴﺘﻪ‪ ،‬ﻧﺸﺎن داد ﻛﻪ اﻳﻦ روش‬

‫ﻧﺸﺎن داد ﻛﻪ ﺑﻴﻦ ﻓﺮاواﻧﻲ ﺑﺮوز ﻋﺎرﺿﻪ و ﻧﻴﺎز ﺑﻪ ﺗﻜﺮار ﻋﻤﻞ ﺟﺮاﺣﻲ در‬

‫از ﻧﻈﺮ ﻣﻴﺰان ﺑﻬﺒﻮدي‪ ،‬ﻣﻮرﺑﻴﺪﻳﺘﻲ‪ ،‬ﺑﺎزﮔﺸﺖ ﺳﺮﻳﻊ ﺑﻪﻛﺎر و ﻣﻴﺰان ﻋﻮد و‬

‫دو ﮔﺮوه ﻋﻤﻞ ﺷﺪه ﺑﻪ دو روش ﺗﺮﻣﻴﻢ اوﻟﻴﻪ و ﺛﺎﻧﻮﻳﻪ اﺧﺘﻼف‬

‫رﺿﺎﻳﺖ ﺑﻴﺸﺘﺮ ﺑﻴﻤﺎران ﺑﺎ ﻧﺘﺎﻳﺞ ﺧﻮﺑﻲ ﻫﻤﺮاه اﺳﺖ و ﻣﻲﺗﻮان آنرا‬

‫ﻣﻌﻨﻲداري وﺟﻮد ﻧﺪارد‪ .‬ﻋﻮد ﺷﺎﻳﻊﺗﺮﻳﻦ ﻣﺘﻐﻴﺮي اﺳﺖ ﻛﻪ در ﻣﻄﺎﻟﻌﺎﺗﻲ‬

‫ﺑﻪﻋﻨﻮان درﻣﺎن اﻧﺘﺨﺎﺑﻲ ﺑﺮاي ﺳﻴﻨﻮس ﭘﻴﻠﻮﻧﻴﺪال در ﻧﻈﺮ ﮔﺮﻓﺖ‪.‬‬

‫‪19‬‬

‫ﻛﻪ ﺑﻪ ﺑﺮرﺳﻲ اﻳﻦ دو روش ﻣﻲﭘﺮدازﻧﺪ‪ ،‬ﮔﺰارش ﺷﺪه اﺳﺖ‪ .‬اﻣﺎ ﺑﻪدﻟﻴﻞ‬

‫اﺳﺘﻔﺎده از اﻳﻦ روش در ﺻﻮرﺗﻲﻛﻪ ﺑﺎ ﺑﺮداﺷﺖ وﺳﻴﻊ ﺑﺎﻓﺖ ﻫﻤﺮاه‬

‫اﺧﺘﻼف زﻣﺎن ﭘﻲﮔﻴﺮي ﺑﻴﻤﺎران در ﻣﻄﺎﻟﻌﺎت ﻣﺨﺘﻠﻒ‪ ،‬ﺑﻪﺻﻮرت ﻛﻤﺘﺮ و‬

‫ﻧﺒﺎﺷﺪ‪ ،‬و ﺑﺴﺘﻦ اوﻟﻴﻪ آن‪ ،‬از دوره ﻧﻘﺎﻫﺖ ﻛﺎﺳﺘﻪ ﻣﻲﺷﻮد‪.‬‬

‫ﺑﻴﺸﺘﺮ از ﻳﻚ ﺳﺎل ﻃﺒﻘﻪﺑﻨﺪي ﻣﻲﺷﻮﻧﺪ‪ .‬ﻋﻮد ﺑﻴﻤﺎري ﻧﺎدر اﺳﺖ و در‬

‫در اﻳﻦ ﺑﻴﻤﺎران روزﻫﺎي ﻏﻴﺒﺖ از ﻛﺎر ﻛﺎﻫﺶ ﻣﻲﻳﺎﺑﺪ و ﺑﺎر اﻗﺘﺼﺎدي‬

‫ﺣﺪود ‪ %8‬ﻣﻮارد دﻳﺪه ﻣﻲﺷﻮد‪ 1.‬در ﺑﺴﻴﺎري از ﻣﻄﺎﻟﻌﺎت ﺣﺘﻲ ﻳﻚ‬

‫ﻧﺎﺷﻲ از اﻳﻦ ﻏﻴﺒﺖﻫﺎ ﻧﻴﺰ ﻛﻢ ﻣﻲﺷﻮد‪ .‬ﻫﻤﭽﻨﻴﻦ‪ ،‬ﻫﺰﻳﻨﻪ اﺿﺎﻓﻪ ﺑﻪدﻟﻴﻞ‬

‫ﻣﻮرد‪ ،‬ﮔﺰارش ﻧﺸﺪه اﺳﺖ‪ 1.‬ﻣﺘﺎآﻧﺎﻟﻴﺰ ﻣﻄﺎﻟﻌﺎﺗﻲ ﻛﻪ در اﻳﻦ زﻣﻴﻨﻪ ﺻﻮرت‬

‫ﻋﻮد ﺑﻴﻤﺎري )ﺑﻴﺶ از آنﻛﻪ در ﻛﺎﻫﺶ دوره ﻧﻘﺎﻫﺖ از آن ﺻﺮﻓﻪﺟﻮﻳﻲ‬

‫ﮔﺮﻓﺘﻪ‪ ،‬ﻧﺸﺎن داد ﻛﻪ ﻣﻴﺰان ﻋﻮد در ﺑﻴﻤﺎراﻧﻲ ﻛﻪ ﺑﻪروش ﺗﺮﻣﻴﻢ اوﻟﻴﻪ‬

‫ﻣﻲﺷﻮد( ﺑﺮ ﺑﻴﻤﺎر ﺗﺤﻤﻴﻞ ﻧﻤﻲﺷﻮد‪.‬‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬


557

«‫روش ﺗﺮﻣﻴﻢ »اوﻟﻴﻪ« و »ﺛﺎﻧﻮﻳﻪ‬ ‫ﭘﺎﻳﻠﻮﻧﻴﺪال‬ ‫ﺳﻴﻨﻮس‬ Haji‫ﺑﻪ‬Barati B. et al. ‫ﻣﻘﺎﻳﺴﺔ ﻧﺘﺎﻳﺞ ﺟﺮاﺣﻲ‬

References 1. McCallum IJ, King PM, Bruce J. Healing by primary closure versus open healing after surgery for pilonidal sinus: systematic review and meta-analysis. BMJ 2008;336(7649):868-71. 2. Testini M, Piccinni G, Miniello S, Di Venere B, Lissidini G, Nicolardi V, et al. Treatment of chronic pilonidal sinus with local anaesthesia: a randomized trial of closed compared with open technique. Colorectal Dis 2001;3(6):427-30. 3. Ertan T, Koc M, Gocmen E, Aslar AK, Keskek M, Kilic M. Does technique alter quality of life after pilonidal sinus surgery? Am J Surg 2005;190(3):388-92. 4. McCallum I, King PM, Bruce J. Healing by primary versus secondary intention after surgical treatment for pilonidal sinus. Cochrane Database Syst Rev 2007;(4):CD006213. 5. Sondenaa K, Andersen E, Nesvik I, Soreide JA. Patient characteristics and symptoms in chronic pilonidal sinus disease. Int J Colorectal Dis 1995;10(1):39-42. 6. Ommer A, Pitt C, Albrecht K, Marla B, Peitgen K, Walz MK. Pilonidal Sinus: Primary Closure also in Case of Abscess? Zentralbl Chir 2004;129(3):216-9. 7. Al-Salamah SM, Hussain MI, Mirza SM. Excision with or without primary closure for pilonidal sinus disease. J Pak Med Assoc 2007;57(8):388-91. 8. Fuzun M, Bakir H, Soylu M, Tansug T, Kaymak E, Harmancioglu O. Which technique for treatment of pilonidal sinus: open or closed? Dis Colon Rectum 1994;37(11):1148-50. 9. al-Hassan HK, Francis IM, Neglen P. Primary closure or secondary granulation after excision of pilonidal sinus? Acta Chir Scand 1990;156(10):695-9. 10. Mohamed HA, Kadry I, Adly S. Comparison between three therapeutic modalities for non-complicated pilonidal sinus disease. Surgeon 2005;3(2):73-7. 11. Fazeli MS, Adel MG, Lebaschi AH. Comparison of outcomes in Zplasty and delayed healing by secondary intention of the wound

1389 ‫ آذر‬،9 ‫ ﺷﻤﺎره‬، 68 ‫ دوره‬،‫ داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‬،‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‬

after excision of the sacral pilonidal sinus: results of a randomized, clinical trial. Dis Colon Rectum 2006;49(12):1831-6. 12. Perruchoud C, Vuilleumier H, Givel JC. Pilonidal sinus: how to choose between excision and open granulation versus excision and primary closure? Study of a series of 141 patients operated on from 1991 to 1995. Swiss Surg 2002;8(6):255-8. 13. Sondenaa K, Andersen E, Soreide JA. Morbidity and short term results in a randomised trial of open compared with closed treatment of chronic pilonidal sinus. Eur J Surg 1992;158(6-7):3515. 14. Gencosmanoglu R, Inceoglu R. Modified lay-open (incision, curettage, partial lateral wall excision and marsupialization) versus total excision with primary closure in the treatment of chronic sacrococcygeal pilonidal sinus: a prospective, randomized clinical trial with a complete two-year follow-up. Int J Colorectal Dis 2005;20(5):415-22. 15. Hameed KK. Outcome of surgery for chronic natal cleft pilonidal sinus: A randomized trial of open compared with closed technique. Medical Forum Monthly 2001;12(5):20-23. 16. Rao MM, Zawislak W, Kennedy R, Gilliland R. A prospective randomised study comparing two treatment modalities for chronic pilonidal sinus with a 5-year follow-up. Int J Colorectal Dis 2010;25(3):395-400. 17. Khawaja HT, Bryan S, Weaver PC. Treatment of natal cleft sinus: a prospective clinical and economic evaluation. BMJ 1992;304(6837):1282-3. 18. Kronborg O, Christensen K, Zimmermann-Nielsen C. Chronic pilonidal disease: a randomized trial with a complete 3-year followup. Br J Surg 1985;72(4):303-4. 19. Toccaceli S, Persico Stella L, Diana M, Dandolo R, Negro P. Treatment of pilonidal sinus with primary closure. A twenty-year experience. Chir Ital 2008;60(3):433-8.


Tehran University Medical Journal; Vol. ‫و‬68, No. 9, Dec 2010: 553-558 ‫ﻫﻤﻜﺎران‬

100

Surgical management of pilonidal sinus patients by primary and secondary repair methods: a comparative study

Babak Haji Barati MD.* Ali Ghafuri MD. Department of General Surgery Tehran University of Medical Sciences, Tehran, Iran.

Abstract

Received: June 08, 2010 Accepted: September 04, 2010

Background: Gross difference in return to work exists in pilonidal sinus patients operated by primary and secondary repair. This survey was to evaluate the results of surgical management of pilonidal sinus with primary or secondary closure. Methods: In a randomized clinical trial, patients with pilonidal sinus referring to the surgical clinic of Shariati Hospital in Tehran, Iran between March 2007 and March 2009 were underwent either excision with midline closure (primary, n=40), or excision without closure (secondary, n=40). The recorded outcomes were hospital stay, healing time, time off work, postoperative pain, patient’s satisfaction and the recurrence rate. Results: Majority of the patients were male (87.50%). There was no significant difference in the hospital stay. Time off work (8.65±1.73 Vs. 11.53±2.33 days, p=0.001) and healing time (3.43±0.92 Vs. 5.3±0.79 days, p=0.001) were shorter in primary group; but, there were no significant differences in hospital stay and number of visits. Intensity of postoperative pain in the 1st (37.75±6.5 Vs. 43.63±5.06, p=0.001), 2nd (26.75±6.66 Vs. 34.63±5.48, p=0.001), 3rd (18.25±6.05 Vs. 27.88±6.88, p=0.001), and 7th (8.45±3.85 Vs. 17.88±6.19, p=0.001) days were lower in primary closure group. There was not significant difference in complication rates in groups. Patients’ satisfaction was higher in primary group (4.15±0.53 Vs. 3.6±0.5, p=0.001). Conclusion: According to this study excision and primary closure is the preferred procedure in patients with pilonidal sinus. It has the advantages of shorter time off work; earlier wound healing, lesser postoperative pain, higher patients satisfaction and comparable complication and recurrence rates with excision and open wound. Keywords: Pilonidal sinus, primary closure, secondary closure, results, complications.

*

Corresponding author: Dept. of General Surgery, Shariati Hospital, Jalal Al Ahmad Ave., Tehran, Iran. Tel: +98-21-84902450 email: babakhb@yahoo.com

1389 ‫ آذر‬،9 ‫ ﺷﻤﺎره‬، 68 ‫ دوره‬،‫ داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‬،‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‬


‫آذر ﺷﺪه‬ ‫زودرس‪،9‬ﻣﻬﺎر‬ ‫اﻧﺪاﺧﺘﻦ‬ ‫ﻋﻠﻮم ﺑﻪ‬ ‫‪ MVM‬در‬ ‫ﭘﺮوژﺳﺘﺮون‬ ‫‪559-562 ،1389‬‬ ‫زاﻳﻤﺎن ‪ ،‬ﺷﻤﺎره‬ ‫دوره ‪68‬‬ ‫ﺗﻌﻮﻳﻖﺗﻬﺮان‪،‬‬ ‫ﭘﺰﺷﻜﻲ‬ ‫داﻧﺸﮕﺎه‬ ‫اﺛﺮ ﭘﺰﺷﻜﻲ‪،‬‬ ‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه‬

‫ﻋﻔﻮﻧﺖ ﻫﻤﺰﻣﺎن آدﻧﻮوﻳﺮوس ﺑﺎ وﻳﺮوس اﻧﻔﻠﻮاﻧﺰاي ﺧﻮﻛﻲ ﻧﻮع ‪ A‬و آدﻧﻮوﻳﺮوس ﺑﺎ وﻳﺮوس‬ ‫ﺳﻴﻨﺴﻴﺸﻴﺎل ﺗﻨﻔﺴﻲ‪ :‬ﮔﺰارش دو ﻣﻮرد‬

‫ﺗﺎرﻳﺦ درﻳﺎﻓﺖ ﻣﻘﺎﻟﻪ‪ 1389/04/01 :‬ﺗﺎرﻳﺦ ﭘﺬﻳﺮش‪1389/07/24 :‬‬

‫ﭼﻜﻴﺪه‬

‫ﺳﻤﻴﻪ ﺷﺎﻃﻲزاده ﻣﻠﻚﺷﺎﻫﻲ‬

‫ﻣﻘﺪﻣﻪ‪ :‬ﻋﻔﻮﻧﺖﻫﺎي ﺗﻨﻔﺴﻲ ﺑﻪﻋﻠﺖ ﮔﺴﺘﺮش ﺟﻬﺎﻧﻲ‪ ،‬ﺳﺮﻋﺖ ﺑﺎﻻي اﻧﺘﺸﺎر در ﺟﺎﻣﻌﻪ‪ ،‬ﺑﻴﻤﺎري و ﻣﺮگ وﻣﻴﺮ ﺑﺎﻻي ﻧﺎﺷﻲ‬

‫ژﻳﻼ ﻳﺎورﻳﺎن‪ ،‬ﻣﺮﻳﻢ ﻧﺎﺻﺮي‬ ‫*‬

‫ﻓﺮﻫﺎد رﺿﺎﻳﻲ‪ ،‬ﻃﻠﻌﺖ ﻣﺨﺘﺎري آزاد‬

‫از آنﻫﺎ ﺑﻪﻋﻨﻮان ﻳﻚ ﻣﺸﻜﻞ ﺑﻬﺪاﺷﺘﻲ ﻣﻬﻢ ﻣﻲﺑﺎﺷﻨﺪ‪ .‬در ﺿﻤﻦ آنﻫﺎ ﻳﻜﻲ از ﻋﻠﻞ ﺷﺎﻳﻊ ﺑﺴﺘﺮي ﺷﺪن ﻛﻮدﻛﺎن زﻳﺮ ﺷﺶ‬ ‫ﺳﺎل ﻣﻲﺑﺎﺷﻨﺪ‪ .‬در ﺑﺮﺧﻲ ﻣﻮارد درﮔﻴﺮي ﺑﺎ دو وﻳﺮوس ﻣﺨﺘﻠﻒ ﻣﻨﺠﺮ ﺑﻪ ﺗﺸﺪﻳﺪ ﻋﻼﻳﻢ ﺑﻴﻤﺎري و ﻟﺬا ﺑﺴﺘﺮي ﺷﺪن‬

‫ﮔﺮوه وﻳﺮوسﺷﻨﺎﺳﻲ‪ ،‬داﻧﺸﻜﺪه ﺑﻬﺪاﺷﺖ‪ ،‬داﻧﺸﮕﺎه‬ ‫ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬ﺗﻬﺮان‪ ،‬اﻳﺮان‪.‬‬

‫ﻣﻲﮔﺮدد‪ .‬ﻣﻌﺮﻓﻲ ﺑﻴﻤﺎران‪ :‬در اﻳﻦ ﻣﻘﺎﻟﻪ دو ﻣﻮرد ﻋﻔﻮﻧﺖ ﻫﻤﺰﻣﺎن آدﻧﻮوﻳﺮوس ﺑﺎ دﻳﮕﺮ وﻳﺮوسﻫﺎي ﺗﻨﻔﺴﻲ را ﻛﻪ از‬ ‫‪ 202‬ﻧﻤﻮﻧﻪ ﺟﻤﻊآوري ﺷﺪه از ﻛﻮدﻛﺎن زﻳﺮ ﺷﺶ ﺳﺎل ﻣﺒﺘﻼ ﺑﻪ ﻋﻔﻮﻧﺖ ﺗﻨﻔﺴﻲ ﺑﻪ روش ﻣﻮﻟﻜﻮﻟﻲ‬

‫‪PCR‬‬

‫ﺷﻨﺎﺳﺎﻳﻲ‬

‫ﺷﺪهاﻧﺪ‪ ،‬ﮔﺰارش ﻣﻲﺷﻮد‪ .‬ﻧﺘﻴﺠﻪﮔﻴﺮي‪ :‬ﻋﻔﻮﻧﺖﻫﺎي ﺗﻮام ﺗﻨﻔﺴﻲ ﮔﺎﻫﻲ ﻣﻨﺠﺮ ﺑﻪ ﺑﻴﻤﺎري ﺷﺪﻳﺪ ﻣﻲﺷﻮد ﻛﻪ اﻳﻦ ﻣﺴﺌﻠﻪ‬ ‫اﻫﻤﻴﺖ ﺷﻨﺎﺳﺎﻳﻲ ﻋﻔﻮﻧﺖﻫﺎي ﻫﻤﺰﻣﺎن را ﺑﻴﺸﺘﺮ ﻛﺮده اﺳﺖ‪ .‬ﻋﻔﻮﻧﺖ ﻫﻤﺰﻣﺎن وﻳﺮوس ﺳﻴﻨﺴﻴﺸﻴﺎل ﺗﻨﻔﺴﻲ ﺑﺎ آدﻧﻮوﻳﺮوس‬ ‫*‬

‫ﻧﻮﻳﺴﻨﺪه ﻣﺴﺌﻮل‪ :‬ﺗﻬﺮان‪ ،‬ﺑﻠﻮار ﻛﺸﺎورز‪ ،‬ﺧﻴﺎﺑﺎن ﻗﺪس‪،‬‬

‫ﺧﻴﺎﺑﺎن ﭘﻮرﺳﻴﻨﺎ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬داﻧﺸﻜﺪه‬ ‫ﺑﻬﺪاﺷﺖ‪ ،‬ﺑﺨﺶ وﻳﺮوسﺷﻨﺎﺳﻲ‬

‫و وﻳﺮوس‬

‫‪A/H1N1‬‬

‫ﭘﺎﻧﺪﻣﻲ اﺧﻴﺮ )وﻳﺮوس اﻧﻔﻠﻮاﻧﺰاي ﺧﻮﻛﻲ ﻧﻮع ‪ (A‬ﺑﺎ آدﻧﻮوﻳﺮوس ﻳﺎﻓﺖ ﺷﺪ ﻛﻪ ﺷﻮاﻫﺪ ﻧﺸﺎﻧﮕﺮ‬

‫ﺗﺸﺪﻳﺪ ﻋﻼﻳﻢ در ﻋﻔﻮﻧﺖ ﺗﻮام وﻳﺮوس ﭘﺎﻧﺪﻣﻲ اﺧﻴﺮ )‪ (S-OIV‬ﺑﺎ آدﻧﻮوﻳﺮوس ﺑﻮد ﻛﻪ ﻣﻨﺠﺮ ﺑﻪ ﺑﺴﺘﺮي ﻛﻮدك ﺷﺪه ﺑﻮد‪.‬‬

‫ﺗﻠﻔﻦ‪021-88962343 :‬‬ ‫‪email: mokhtari@sina.tums.ac.ir‬‬

‫ﻛﻠﻤﺎتﻛﻠﻴﺪي‪ :‬ﻋﻔﻮﻧﺖﻫﺎيﺗﻨﻔﺴﻲ‪ ،‬وﻳﺮوس ﺳﻴﻨﺴﻴﺸﻴﺎلﺗﻨﻔﺴﻲ‪ ،‬آدﻧﻮوﻳﺮوس‪ ،‬وﻳﺮوس‪ A/H1N1‬ﺑﺎ ﻣﻨﺸﺎ ﺧﻮﻛﻲ )‪.(S-OIV‬‬

‫ﻣﻘﺪﻣﻪ‬

‫ﺷﺪ ﻛﻪ از آن زﻣﺎن ﺗﺎﻛﻨﻮن ﻣﻮارد ﺑﺴﻴﺎر زﻳﺎدي از درﮔﻴﺮيﻫﺎي اﻧﺴﺎﻧﻲ‬

‫آدﻧﻮوﻳﺮوسﻫﺎي اﻧﺴﺎﻧﻲ )‪ ،(Human adenovirus‬وﻳﺮوسﻫﺎي ﺑﺪون‬

‫از ﺑﻴﺶ از ‪ 124‬ﻛﺸﻮر ﺑﻪ ﺳﺎزﻣﺎن ﺑﻬﺪاﺷﺖ ﺟﻬﺎﻧﻲ ﮔﺰارش ﺷﺪ‪.‬‬ ‫‪S-OIV‬‬

‫ﭘﻮﺷﺶ و ﻣﺘﻌﻠﻖ ﺑﻪ ﺟﻨﺲ ﻣﺎﺳﺘﺎدﻧﻮوﻳﺮوس از ﺧﺎﻧﻮاده آدﻧﻮوﻳﺮﻳﺪه‬

‫وﻳﺮوسﻫﺎي‬

‫ﻣﻲﺑﺎﺷﻨﺪ‪ .‬ﺗﺎﻛﻨﻮن ‪ 52‬ﺳﺮوﺗﻴﭗ از اﻳﻦ وﻳﺮوسﻫﺎ ﺷﻨﺎﺳﺎﻳﻲ و ﺑﻪ ﻫﻔﺖ‬

‫ﺧﻔﻴﻒ دﺳﺘﮕﺎه ﺗﻨﻔﺴﻲ ﺑﺎ ﻳﺎ ﺑﺪون ﺗﺐ و ﺣﺘﻲ ﻋﻔﻮﻧﺖ ﺷﺪﻳﺪ و ﭘﻨﻮﻣﻮﻧﻲ‬

‫ﺗﻘﺴﻴﻢﺑﻨﺪي ﺷﺪهاﻧﺪ‪ .‬اﻳﻦ وﻳﺮوسﻫﺎ ﻋﺎﻣﻞ‬

‫و درﮔﻴﺮي دﺳﺘﮕﺎه ﺗﻨﻔﺴﻲ ﺗﺤﺘﺎﻧﻲ ﻣﻲﺷﻮﻧﺪ‪ .‬در ﺑﺮﺧﻲ ﻣﻮارد ﻋﻮارض‬

‫زﻳﺮﮔﺮوه ﻳﺎ ﮔﻮﻧﻪ‬

‫‪HAd-A-G‬‬

‫ﺑﺎﻋﺚ اﻳﺠﺎد ﻋﻔﻮﻧﺖﻫﺎي ﺑﺪون ﻋﻼﻣﺖ‪ ،‬درﮔﻴﺮي‬

‫‪4‬و‪3‬‬

‫اﻳﺠﺎد ﻃﻴﻒ وﺳﻴﻌﻲ از ﺑﻴﻤﺎريﻫﺎ از ﻋﻔﻮﻧﺖﻫﺎي ﺧﻮد ﻣﺤﺪود ﺷﻮﻧﺪه‬

‫ﮔﻮارﺷﻲ از ﺟﻤﻠﻪ اﺳﻬﺎل و ﻳﺎ اﺳﺘﻔﺮاغ ﻫﻢ دﻳﺪه ﺷﺪه اﺳﺖ‪.‬‬

‫ﺗﺎ ﺑﻴﻤﺎري ﺧﻔﻴﻒ ﺷﺎﻣﻞ اﻟﺘﻬﺎب ﻣﻠﺘﺤﻤﻪ‪ ،‬ﺑﻴﻤﺎريﻫﺎي ﮔﻮارﺷﻲ و در‬

‫ﺑﻴﻤﺎران ﻣﺒﺘﻼ ﺑﻪ اﻳﻦ وﻳﺮوس ﺣﺪود ‪ %2-6‬ﻧﻴﺎز ﺑﻪ ﺑﺴﺘﺮي ﭘﻴﺪا ﻣﻲﻛﻨﻨﺪ‬

‫ﻧﻬﺎﻳﺖ ﺑﺮﺧﻲ ﻋﻔﻮﻧﺖﻫﺎي ﺗﻬﺪﻳﺪﻛﻨﻨﺪه زﻧﺪﮔﻲ ﻣﻲﺷﻮﻧﺪ‪ .‬اﻳﻦ وﻳﺮوسﻫﺎ‬

‫ﻛﻪ ﺑﭽﻪﻫﺎي زﻳﺮ ﭘﻨﺞ ﺳﺎل از ﺟﻤﻠﻪ ﻣﻮارد ﺑﺎ رﻳﺴﻚ ﺧﻄﺮ ﺑﺎﻻ ﻣﻲﺑﺎﺷﻨﺪ‪.‬‬

‫ﺑﺎﻋﺚ درﮔﻴﺮي دﺳﺘﮕﺎه ﺗﻨﻔﺴﻲ ﻓﻮﻗﺎﻧﻲ و ﺗﺤﺘﺎﻧﻲ ﻣﻲﺷﻮﻧﺪ ﻛﻪ ‪ %5-10‬از‬

‫وﻳﺮوس ﺳﻴﻨﺴﻴﺸﻴﺎل ﺗﻨﻔﺴﻲ )‪ Respiratory Syncytial Virus (RSV‬ﻛﻪ‬

‫ﺑﻴﻤﺎريﻫﺎي ﺗﻨﻔﺴﻲ ﻛﻮدﻛﺎن ﺑﻪوﺳﻴﻠﻪ آدﻧﻮوﻳﺮوسﻫﺎي ﻧﻮع ﻳﻚ‪ ،‬دو‪،‬‬

‫ﻣﺘﻌﻠﻖ ﺑﻪ ﺧﺎﻧﻮاده ﭘﺎراﻣﻴﻜﺴﻮوﻳﺮﻳﺪه اﺳﺖ‪ ،‬ﻧﻴﺰ ﭘﺎﺗﻮژن ﺗﻨﻔﺴﻲ اﺻﻠﻲ در‬

‫ﭘﻨﺞ و ﻫﻔﺖ اﻳﺠﺎد ﺷﺪه و ﻛﻮدﻛﺎن آﻟﻮده وﻳﺮوس را ﻣﺎهﻫﺎ ﺑﻌﺪ از‬

‫ﻛﻮدﻛﺎن ﻛﻢﺳﻦ و اﺻﻠﻲﺗﺮﻳﻦ ﻋﺎﻣﻞ ﺑﻴﻤﺎري ﺗﻨﻔﺴﻲ ﺗﺤﺘﺎﻧﻲ و ﻓﻮﻗﺎﻧﻲ در‬

‫‪2‬و‪1‬‬

‫ﻋﻔﻮﻧﺖ ﻣﻨﺘﺸﺮ ﻣﻲﻛﻨﻨﺪ‪.‬‬

‫وﻳﺮوسﻫﺎي اﻧﻔﻠﻮاﻧﺰاي‬

‫‪A‬‬

‫وﻳﺮوسﻫﺎي‬

‫ﻛﻮدﻛﺎن اﺳﺖ‪ .‬ﺗﻘﺮﻳﺒﺎً ﺗﻤﺎم ﻛﻮدﻛﺎن ﺗﺎ ﺳﻦ دو ﺳﺎﻟﮕﻲ ﺑﺎ‬

‫‪RSV‬‬

‫از‬

‫آﻟﻮده‬

‫ﭘﻮﺷﺶدار ﻣﺘﻌﻠﻖ ﺑﻪ ﺧﺎﻧﻮاده ارﺗﻮﻣﻴﻜﺴﻮوﻳﺮﻳﺪه ﻣﻲﺑﺎﺷﻨﺪ‪ .‬اﻳﻦ‬

‫ﻣﻲﺷﻮﻧﺪ‪ .‬وﻳﺮوس ﺳﻴﻨﺴﻴﺸﻴﺎل ﺗﻨﻔﺴﻲ داراي ﻳﻚ ﺳﺮوﺗﻴﭗ و دو زﻳﺮ‬

‫وﻳﺮوسﻫﺎ ﺑﺮ اﺳﺎس ﻧﻮع ﮔﻠﻴﻜﻮﭘﺮوﺗﻴﻴﻦﻫﺎي ﺳﻄﺤﻲ ﺑﻪ ﺳﺎبﺗﺎﻳﭗﻫﺎي‬

‫ﮔﺮوه آﻧﺘﻲ ژﻧﻲ ‪ A‬و ‪ B‬اﺳﺖ‪ .‬در ﺑﺴﻴﺎري ﻣﻨﺎﻃﻖ‪ RSV ،‬ﺑﺮ دﻳﮕﺮ ﻋﻮاﻣﻞ‬

‫در ﺣﺎل‬

‫ﭘﺎﺗﻮژن ﻣﻴﻜﺮوﺑﻲ ﺑﻪﻋﻨﻮان ﻋﺎﻣﻞ ﭘﻨﻮﻣﻮﻧﻲ و ﺑﺮوﻧﺸﻴﻮﻟﻴﺖ در ﻧﻮزادان‬

‫ﮔﺮدش در ﺟﻤﻌﻴﺖ اﻧﺴﺎﻧﻲ ﻣﻲﺑﺎﺷﻨﺪ ﻛﻪ از ﻓﻮرﻳﻪ ‪ 2009‬وﻳﺮوس‬

‫ﻛﻤﺘﺮ از ﻳﻚ ﺳﺎل ارﺟﺤﻴﺖ دارد‪ .‬اﮔﺮﭼﻪ ﺑﻪﻃﻮر اوﻟﻴﻪ ﺑﻪﻋﻨﻮان ﭘﺎﺗﻮژن‬

‫ﻣﺨﺘﻠﻒ ﺗﻘﺴﻴﻢ ﻣﻲﺷﻮﻧﺪ‪ .‬وﻳﺮوسﻫﺎي‬

‫‪A/H1N1‬‬

‫و‬

‫‪A/H3N2‬‬

‫‪ A/H1N1‬ﺑﺎ ﻣﻨﺸﺎ ﺧﻮﻛﻲ )‪ (S-OIV‬ﺑﺮاي اوﻟﻴـﻦ ﺑﺎر در ﻣﻜﺰﻳﻚ ﺷﻨﺎﺳﺎﻳﻲ‬

‫‪5‬‬

‫ﻧﻮزادان اﺳﺖ‪ RSV ،‬ﻣﻲﺗﻮاﻧﺪ ﻫﻤﻪ ﮔﺮوهﻫﺎي ﺳﻨﻲ را آﻟﻮده ﻛﻨﺪ‪ .‬در اﻳﻦ‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬


‫ﺳﻤﻴﻪ ﺷﺎﻃﻲزاده ﻣﻠﻚﺷﺎﻫﻲ و ﻫﻤﻜﺎران‬

‫‪560‬‬

‫ﺑﺮرﺳﻲ ﻋﻔﻮﻧﺖ ﺗﻮام ﻳﻚ ﻛﻮدك ﭘﻨﺞ ﺳﺎﻟﻪ ﺑﺎ‬

‫‪S-OIV‬‬

‫و آدﻧﻮوﻳﺮوس و‬

‫‪ -2‬ﻋﻔﻮﻧﺖ ﺗﻮام آدﻧﻮوﻳﺮوس ﺑﺎ ‪ :RSV‬ﺑﻴﻤﺎر ﭘﺴﺮﺑﭽﻪ ﺷﺶ ﺳﺎﻟﻪ از‬

‫ﻳﻚ ﻛﻮدك ﺷﺶ ﺳﺎﻟﻪ ﺑﺎ آدﻧﻮوﻳﺮوس و‬

‫‪RSV‬‬

‫ﮔﺰارش ﻣﻲﺷﻮد‪.‬‬

‫ﺷﻬﺮﺳﺘﺎن ري ﻛﻪ از ﺗﺎرﻳﺦ ‪ 86/10/20‬ﺑﺎ ﻋﻼﻳﻢ ﺳﺮﻓﻪ‪ ،‬ﺗﺐ و ﺑﺪن درد‬

‫ﺑﺪﻳﻦﻣﻨﻈﻮر از ﺗﻌﺪاد ‪ 897‬ﻧﻤﻮﻧﻪ ﺑﺎﻟﻴﻨﻲ )ﺳﻮاب ﮔﻠﻮ‪ ،‬ﺷﺴﺘﺸﻮي ﮔﻠﻮ(‬

‫در ﺗﺎرﻳﺦ ‪ 86/11/1‬ﺑﻪ درﻣﺎﻧﮕﺎه ﺑﻴﻤﺎرﺳﺘﺎن ﻣﺮاﺟﻌﻪ ﻧﻤﻮده ﺑﻮد ﻛﻪ ﭘﺲ از‬

‫ﻛﻪ در ﻃﻲ زﻣﺎن اﻧﺠﺎم اﻳﻦ ﭘﮋوﻫﺶ از اﺑﺘﺪاي ﺑﻬﻤﻦﻣﺎه ‪ 1386‬ﺗﺎ اواﺧﺮ‬

‫ﻣﻌﺎﻳﻨﻪ ﺳﺮﭘﺎﻳﻲ ﻧﻤﻮﻧﻪ ﺳﻮاب ﮔﻠﻮي ﺑﻴﻤﺎر ﺗﻬﻴﻪ ﺷﺪه و در ﺗﺎرﻳﺦ‬

‫ﺷﻬﺮﻳﻮرﻣﺎه ‪ 1388‬از اﺳﺘﺎنﻫﺎي ﻣﺨﺘﻠﻒ ﻛﺸﻮر ﺑﻪ ﻣﺮﻛﺰ ﻣﻠﻲ اﻧﻔﻠﻮاﻧﺰا‬

‫‪ 86/11/2‬ﺑﻪ ﻣﺮﻛﺰ ﻣﻠﻲ اﻧﻔﻠﻮاﻧﺰا از ﻧﻈﺮ ﺑﺮرﺳﻲ وﺟﻮد وﻳﺮوسﻫﺎي‬

‫ارﺳﺎل ﺷﺪه ﺑﻮد‪ ،‬ﺗﻌﺪاد ‪ 202‬ﻧﻤﻮﻧﻪ ﺑﺎﻟﻴﻨﻲ ﻣﺮﺑﻮط ﺑﻪ ﻛﻮدﻛﺎن زﻳﺮ ﺷﺶ‬

‫اﻧﻔﻠﻮاﻧﺰا ارﺳﺎل ﺷﺪه ﺑﻮد وﻟﻲ ﺑﺎ ﺗﻮﺟﻪ ﺑﻪ ﻋﺪم ﺷﺪت ﻋﻼﻳﻢ ﺑﻴﻤﺎري‬

‫ﺳﺎل ﻣﺒﺘﻼ ﺑﻪ ﻋﻔﻮﻧﺖ ﺗﻨﻔﺴﻲ اﻧﺘﺨﺎب ﺷﺪ‪ .‬ﺑﺮ روي ﻫﺮ ﻧﻤﻮﻧﻪ‬

‫ﻛﻮدك ﻧﻴﺎز ﺑﻪ ﺑﺴﺘﺮي ﻧﺪاﺷﺖ‪ .‬آزﻣﺎﻳﺸﺎت اﻧﺠﺎم ﺷﺪه ﺟﻬﺖ ﺷﻨﺎﺳﺎﻳﻲ‬

‫‪ Multiplex Hemi Nested RT-PCR‬ﺑﺮاي ﺷﻨﺎﺳﺎﻳﻲ‬

‫‪RSV‬‬

‫و‬

‫‪Human‬‬

‫)‪Multiplex Hemi Nested RT-PCR ،metapneumovirus (hMPV‬‬

‫ﺑﺮاي ﺷﻨﺎﺳﺎﻳﻲ ﭘﺎرااﻧﻔﻠﻮاﻧﺰاي ﺗﻴﭗ ‪1-4‬‬ ‫‪RT-PCR‬‬

‫)‪Multiplex Nested ،(PIV 1-4‬‬

‫ﺑﺮاي ﺷﻨﺎﺳﺎﻳﻲ اﻧﻔﻠﻮاﻧﺰاي ﺗﻴﭗ‬

‫‪A‬‬

‫و‬

‫‪B‬‬

‫وﻳﺮوسﻫﺎي اﻧﻔﻠﻮاﻧﺰاي‬

‫‪A‬‬

‫و‬

‫‪B‬‬

‫ﻣﻨﻔﻲ ﮔﺰارش ﺷﺪ وﻟﻲ ﺑﻪدﻧﺒﺎل اﻧﺠﺎم‬

‫ﺑﺮرﺳﻲ ﺟﻬﺖ ﻳﺎﻓﺘﻦ وﻳﺮوسﻫﺎي ﺗﻨﻔﺴﻲ دﻳﮕﺮ ﻫﻤﺎنﻃﻮر ﻛﻪ در ﺑﺎﻻ‬ ‫اﺷﺎره ﺷﺪ آدﻧﻮوﻳﺮوس و ‪ RSV‬در اﻳﻦ ﻛﻮدك ﻣﺜﺒﺖ ﺑﻮدﻧﺪ‪.‬‬

‫و ﺳﺎبﺗﺎﻳﭗﻫﺎي‬

‫ﻣﺮﺑﻮﻃﻪو ‪ Hemi Nested PCR‬ﺑﺮاي ﺷﻨﺎﺳﺎﻳﻲ آدﻧﻮوﻳﺮوس اﻧﺠﺎمﮔﺮﻓﺖ‪.‬‬

‫ﺑﺤﺚ‬ ‫وﻳﺮوسﻫﺎي ﺗﻨﻔﺴﻲ ﻳﻜﻲاز ﻋﻠﻞ ﺷﺎﻳﻊ ﺑﺴﺘﺮي ﺷﺪن ﻛﻮدﻛﺎن زﻳﺮ ﺷﺶ‬

‫ﻣﻌﺮﻓﻲ ﺑﻴﻤﺎران‬

‫ﺳﺎل ﺑﻪﺧﺼﻮص در ﻓﺼﻮل ﺳﺮد ﻣﻲﺑﺎﺷﻨﺪ‪ .‬در ﻣﻴﺎن وﻳﺮوسﻫﺎي ﺗﻨﻔﺴﻲ‬

‫در اﻳﻦ ﻣﻄﺎﻟﻌﻪ ﻣﻘﻄﻌﻲ از ﺗﻌﺪاد ‪ 202‬ﻧﻤﻮﻧﻪ ﺟﻤﻊآوري ﺷﺪه از‬

‫آدﻧﻮوﻳﺮوسﻫﺎ‪،‬‬

‫‪RSV‬‬

‫و اﻧﻔﻠﻮاﻧﺰا ﻣﺴﺌﻮل اﻳﺠﺎد ﺑﻪﺗﺮﺗﻴﺐ ‪،%5-10‬‬

‫ﻛﻮدﻛﺎن زﻳﺮ ﺷﺶ ﺳﺎل ﻣﺒﺘﻼ ﺑﻪ ﻋﻔﻮﻧﺖ ﺗﻨﻔﺴﻲ از ﺑﻬﻤﻦ ‪ 1386‬ﺗﺎ‬

‫‪ %10-20 %26-47‬از ﺑﻴﻤﺎريﻫﺎي ﺗﻨﻔﺴﻲ ﻛﻮدﻛﺎن ﻣﻲﺑﺎﺷﻨﺪ‪ .‬در ﺳﺎل‬

‫ﺷﻬﺮﻳﻮر ‪ 1388‬دو ﻣﻮرد ﻋﻔﻮﻧﺖ ﺗﻮام آدﻧﻮوﻳﺮوس ﺑﺎ دﻳﮕﺮ وﻳﺮوسﻫﺎي‬

‫اﺧﻴﺮ ﺑﻪدﻧﺒﺎل ﭘﺎﻧﺪﻣﻲ ﻧﺎﺷﻲ از‬

‫‪S-OIV‬‬

‫ﺗﻨﻔﺴﻲ ﻣﺸﺎﻫﺪه ﺷﺪ‪ .‬ﺗﻤﺎم ﻣﺮاﺣﻞ اﻳﻦ ﻣﻄﺎﻟﻌﻪ در ﺑﺨﺶ وﻳﺮوسﺷﻨﺎﺳﻲ‬

‫وﻳﺮوس درﮔﻴﺮي در ﺑﭽﻪﻫﺎ ﻫﻢ ﺷﺎﻳﻊ ﺑﻮد ﻛﻪ ﺑﭽﻪﻫﺎي زﻳﺮ دو ﺳﺎل از‬

‫داﻧﺸﻜﺪه ﺑﻬﺪاﺷﺖ در داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان اﻧﺠﺎم ﺷﺪه اﺳﺖ‪.‬‬

‫ﺟﻤﻠﻪ اﻓﺮاد ﭘﺮﺧﻄﺮ از ﻧﻈﺮ اﻳﺠﺎد ﻋﻮارض ﺗﻨﻔﺴﻲ ﺑﻮدﻧﺪ‪ .‬ﺑﺮاﺳﺎس‬

‫اﻃﻼﻋﺎت ﻣﺤﺪودي در ﻣﻮرد ﺑﻴﻤﺎران در دﺳﺘﺮس ﻧﺒﻮد وﻟﻲ اﻃﻼﻋﺎت‬

‫اﻃﻼﻋﺎت ﻣﺮﺑﻮط ﺑﻪ اﻧﻔﻠﻮاﻧﺰاي ﻓﺼﻠﻲ و ﭘﺎﻧﺪﻣﻲ ﻗﺒﻠﻲ ﻣﻲداﻧﻴﻢ ﻛﻪ‬

‫ﻛﻠﻲ ﻛﻪ در ﻣﻮرد اﻳﻦ ﺑﻴﻤﺎران ارﺳﺎل ﺷﺪه ﺑﻮد ﺑﻪ ﺷﺮح زﻳﺮ ﻣﻲﺑﺎﺷﺪ‪-1 :‬‬

‫ﻛﻮدﻛﺎن ﻛﻢﺳﻦ و ﺳﺎل ﺧﺼﻮﺻﺎً زﻳﺮ ﭘﻨﺞ ﺳﺎل و ﻛﻮدﻛﺎﻧﻲ ﻛﻪ داراي‬

‫ﻋﻔﻮﻧﺖ ﺗﻮام آدﻧﻮوﻳﺮوس ﺑﺎ ‪ :S-OIV‬ﺑﻴﻤﺎر ﭘﺴﺮﺑﭽﻪ ﭘﻨﺞ ﺳﺎﻟﻪ از‬

‫ﺑﻴﻤﺎري ﻃﺒﻲ ﭘﺮﺧﻄﺮ ﻫﺴﺘﻨﺪ‪ ،‬ﺷﺎﻧﺲ ﺑﻴﺸﺘﺮي ﺑﺮاي اﺑﺘﻼ ﺑﻪ ﻋﻮارض‬

‫ﺷﻬﺮﺳﺘﺎن ﻗﻢ ﻛﻪ ﺑﺎ ﺷﺮوع ﻋﻼﻳﻢ ﺑﻪﺻﻮرت ﺗﺐ و ﺳﺮﻓﻪ ﺧﺸﻚ در‬

‫ﻣﺮﺑﻮط ﺑﻪ اﻧﻔﻠﻮاﻧﺰا دارﻧﺪ‪ .‬اﻓﺘﺮاق ﺑﻴﻤﺎري ﻧﺎﺷﻲ از وﻳﺮوس اﻧﻔﻠﻮاﻧﺰا از‬

‫ﺗﺎرﻳﺦ ‪ 88/5/31‬ﺑﻪ ﺑﻴﻤﺎرﺳﺘﺎن ﻣﺮاﺟﻌﻪ ﻧﻤﻮده و ﺑﺎ ﺗﺸﺨﻴﺺ اﺣﺘﻤﺎﻟﻲ‬

‫ﺑﻴﻤﺎري اﻳﺠﺎد ﺷﺪه ﺗﻮﺳﻂ ﺳﺎﻳﺮ ﻋﻔﻮﻧﺖﻫﺎي رﻳﻮي‪ ،‬ﺗﻨﻬﺎ ﺑﺮاﺳﺎس ﻋﻼﻳﻢ‬

‫ﺑﺴﺘﺮي ﺷﺪه ﺑﻮد‪ .‬ﻧﻤﻮﻧﻪ ﺳﻮاب ﮔﻠﻮ ﺑﻴﻤﺎر در ﺗﺎرﻳﺦ‬

‫ﺑﺎﻟﻴﻨﻲ ﻣﺸﻜﻞ اﺳﺖ‪ .‬ﻛﻮدﻛﺎن ﻛﻢﺳﻦ و ﺳﺎل ﺑﻪ اﺣﺘﻤﺎل ﻛﻤﺘﺮي ﻋﻼﻳﻢ‬

‫‪ 88/6/3‬ﺗﻬﻴﻪ ﺷﺪه و در ﺗﺎرﻳﺦ ‪ 88/6/4‬ﺑﻪ آزﻣﺎﻳﺸﮕﺎه ﻣﺮﻛﺰ ﻣﻠﻲ اﻧﻔﻠﻮاﻧﺰا‬

‫ﻛﻼﺳﻴﻚ اﻧﻔﻠﻮاﻧﺰا را دارﻧﺪ )ﺳﺮﻓﻪ و ﺗﺐ(‪ .‬از ﻃﺮﻓﻲ ﺷﻴﺮﺧﻮاران ﺑﻴﻤﺎري‬

‫ارﺳﺎل ﺷﺪه ﺑﻮد‪ .‬ﻧﻤﻮﻧﻪ ﺑﻴﻤﺎر ﺑﺮ اﺳﺎس‬

‫را ﺑﻪﺻﻮرت ﺗﺐ و ﺧﻮابآﻟﻮدﮔﻲ ﺑﺮوز ﻣﻲدﻫﻨﺪ و ﻣﻤﻜﻦ اﺳﺖ ﺳﺮﻓﻪ‬

‫و ﺳﺎبﺗﺎﻳﭗﻫﺎي‬

‫ﻳﺎ ﺳﺎﻳﺮ ﻋﻼﻳﻢ و ﻧﺸﺎﻧﻪﻫﺎي ﺗﻨﻔﺴﻲ را ﻧﺪاﺷﺘﻪ ﺑﺎﺷﻨﺪ‪ .‬در ﺑﺮرﺳﻲ اﻧﺠﺎم‬

‫ﻣﺮﺑﻮﻃﻪ و اﻧﻔﻠﻮاﻧﺰاي ‪ B‬ﻣﻮرد ﺑﺮرﺳﻲ ﻗﺮار ﮔﺮﻓﺖ و ﻧﺘﻴﺠﻪ ﺣﺎﺻﻠﻪ ﻧﺸﺎن‬

‫ﺷﺪه ﺑﺮ روي ‪ 202‬ﻧﻤﻮﻧﻪ دو ﻣﻮرد ﻋﻔﻮﻧﺖ ﺗﻮام ﻳﺎﻓﺖ ﺷﺪ ﻛﻪ ﻋﻔﻮﻧﺖ‬

‫ﻣﺜﺒﺖ ﺑﻮد‪ .‬ﺳﭙﺲ اﻳﻦ ﻧﻤﻮﻧﻪ ﺑﻪﻋﻨﻮان‬

‫ﺗﻮام در ﻳﻚ ﻛﻮدك ﺑﺎﻋﺚ ﺑﺴﺘﺮي ﺷﺪن ﮔﺸﺖ‪ .‬ﺑﺎ ﺗﻮﺟﻪ ﺑﻪ اﻳﻦﻛﻪ ﻣﻴﺰان‬

‫اﻧﻔﻠﻮاﻧﺰاي‬

‫‪S-OIV‬‬

‫ﺟﻬﺖ ﺑﺮرﺳﻲ از ﻧﻈﺮ‬ ‫ﭘﺮوﺗﻜﻞ‬

‫‪CDC‬‬

‫‪S-OIV‬‬

‫در آزﻣﺎﻳﺸﮕﺎه از ﻧﻈﺮ اﻧﻔﻠﻮاﻧﺰاي‬

‫داد ﻛﻪ ﻧﻤﻮﻧﻪ از ﻧﻈﺮ‬

‫‪S-OIV‬‬

‫‪A‬‬

‫و ﻗﺪرت ﺳﺮاﻳﺖ ﺑﺎﻻ در اﻳﻦ‬

‫ﻗﺴﻤﺘﻲ از ﻳﻚ ﭘﺮوژه ﺟﻬﺖ ﻳﺎﻓﺘﻦ وﻳﺮوسﻫﺎي ﺗﻨﻔﺴﻲ ﺷﺎﻳﻊ در‬

‫ﺑﺴﺘﺮي ﺷﺪن در ﻣﺒﺘﻼﻳﺎن ﺑﻪ ‪ ،S-OIV‬آدﻧﻮوﻳﺮوس و‬

‫ﻛﻮدﻛﺎن زﻳﺮ ﺷﺶ ﺳﺎل از ﺟﻤﻠﻪ آدﻧﻮوﻳﺮوس‪ ،‬ﭘﺎرااﻧﻔﻠﻮاﻧﺰاي ﺗﻴﭗ ‪،1-4‬‬

‫‪ ،%10-20 ،%2‬و ‪ %33‬ﻣﻲﺑﺎﺷﺪ ﻣﻲﺗﻮان ﺑﻪ اﻳﻦ ﻧﺘﻴﺠﻪ رﺳﻴﺪ ﻛﻪ ﺣﻀﻮر‬

‫ﻣﺘﺎﭘﻨﻮﻣﻮوﻳﺮوس اﻧﺴﺎﻧﻲ و‬

‫‪RSV‬‬

‫ﻣﻮرد ﺑﺮرﺳﻲ ﻗﺮار ﮔﺮﻓﺖ ﻛﻪ ﻣﺸﺨﺺ‬

‫ﺷﺪ ﻧﻤﻮﻧﻪ از ﻧﻈﺮ آدﻧﻮوﻳﺮوس ﻧﻴﺰ ﻣﺜﺒﺖ ﺑﻮده اﺳﺖ‪.‬‬

‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‪ ،‬داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‪ ،‬دوره ‪ ، 68‬ﺷﻤﺎره ‪ ،9‬آذر ‪1389‬‬

‫ﺗﻮام‬

‫‪S-OIV‬‬

‫‪RSV‬‬

‫ﺑﻪﺗﺮﺗﻴﺐ ‪-6‬‬

‫ﺑﺎ آدﻧﻮوﻳﺮوس ﺑﺎﻋﺚ وﺧﻴﻢ ﺷﺪن وﺿﻊ ﺑﻴﻤﺎر ﻣﻲﮔﺮدد در‬

‫ﺣﺎﻟﻲﻛﻪ ﻋﻔﻮﻧﺖ ﺗﻮام آدﻧﻮوﻳﺮوس ﺑﺎ‬

‫‪RSV‬‬

‫از ﺷﺪت زﻳﺎدي ﺑﺮﺧﻮردار‬


‫زودرس ﻣﻬﺎر ﺷﺪه‬ ‫اﻧﺪاﺧﺘﻦ زاﻳﻤﺎن‬ ‫در ﺑﻪ ﺗﻌﻮﻳﻖ‬S.MVM Shatizadeh Malekshahi et al.‫اﺛﺮ ﭘﺮوژﺳﺘﺮون‬

561

‫ ﻛﻮدك ﻣﺒﺘﻼ ﺑﻪ ﻋﻔﻮﻧﺖ‬117 ‫ ﻛﻮدك ﺑﺴﺘﺮي ﺷﺪه‬4927 ‫ﺷﻴﻠﻲ از ﺑﻴﻦ‬

‫ اﻟﺒﺘﻪ ﺑﺎ ﺗﻮﺟﻪ ﺑﻪ اﻳﻦﻛﻪ اﻃﻼﻋﺎت‬.‫ﻧﻴﺴﺖ ﻛﻪ ﻣﻨﺠﺮ ﺑﻪ ﺑﺴﺘﺮي ﺷﺪن ﮔﺮدد‬

‫ ﻣﺒﺘﻼ ﺑﻪ ﻋﻔﻮﻧﺖ ﺗﻮام آدﻧﻮوﻳﺮوس و‬،‫ ﻣﻮرد‬81 ‫ﻣﻨﻔﺮد آدﻧﻮوﻳﺮوس و‬

‫زﻳﺎدي در ﻣﻮرد اﻳﻦ دو ﺑﻴﻤﺎر ﻧﺪارﻳﻢ و ﺗﻌﺪاد ﻧﻤﻮﻧﻪﻫﺎي ﻣﺎ از ﻧﻈﺮ‬

‫ ﺑﻮدﻧﺪ و در اﻳﻦ ﺑﺮرﺳﻲ ﻧﺸﺎن داده ﺷﺪ ﻛﻪ ﻋﻼﻳﻢ ﻛﻮدﻛﺎن ﻣﺒﺘﻼ ﺑﻪ‬RSV

‫ردﻳﺎﺑﻲ ﻧﺘﺎﻳﺞ و ﻋﻮارض ﻋﻔﻮﻧﺖﻫﺎي ﺗﻮام ﺗﻨﻔﺴﻲ در ﻛﻮدﻛﺎن زﻳﺎد‬

RSV

‫ﻧﻤﻲﺑﺎﺷﺪ ﺷﺎﻳﺪ ﺗﻌﻤﻴﻢ اﻳﻦ ﻳﺎﻓﺘﻪ ﭼﻨﺪان ﻣﻨﺎﺳﺐ ﻧﺒﺎﺷﺪ وﻟﻲ ﺑﻪ ﻫﺮ ﺣﺎل ﺑﺎ‬

‫ﺷﺪﻳﺪﺗﺮ از ﻛﻮدﻛﺎن ﻣﺒﺘﻼ ﺑﻪ‬

‫ﻋﻔﻮﻧﺖ ﺗﻮام آدﻧﻮوﻳﺮوس و‬ 7

‫ ﺑﺮﺧﻲ ﻣﻄﺎﻟﻌﺎت ﻧﺸﺎن دادهاﻧﺪ ﻛﻪ ﻋﻔﻮﻧﺖﻫﺎي ﺗﻮام‬.‫آدﻧﻮوﻳﺮوس ﻧﺒﻮد‬

‫ﺗﻮﺟﻪ ﺑﻪ اﻳﻦ ﻣﺴﺎﻟﻪ ﮔﺰارش اﺳﭙﻮرادﻳﻚ ﻣﻮارد ﻣﺸﺎﻫﺪه ﺷﺪه ﺧﺎﻟﻲ از‬

‫ از ﻫﻤﻜﺎري‬:‫ ﺳﭙﺎﺳﮕﺰاري‬8.‫ﺗﻨﻔﺴﻲ ﻣﻲﺗﻮاﻧﺪ ﻣﻨﺠﺮ ﺑﻪ ﺗﺸﺪﻳﺪ ﻋﻼﻳﻢ ﺷﻮد‬

‫ در ﻣﻄﺎﻟﻌﺎت اﻧﺠﺎم ﮔﺮﻓﺘﻪ روي ﻋﻔﻮﻧﺖ ﺗﻮام‬.‫ارزش ﻧﻤﻲﺑﺎﺷﺪ‬

‫ ﻛﺎرﻛﻨﺎن و داﻧﺸﺠﻮﻳﺎن ﺑﺨﺶ وﻳﺮوسﺷﻨﺎﺳﻲ داﻧﺸﻜﺪه‬،‫ﺻﻤﻴﻤﺎﻧﻪ اﺳﺎﺗﻴﺪ‬

S-OIV

‫ ﺑﻮدﺟﻪ اﻳﻦ‬.‫ﺑﻬﺪاﺷﺖ داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان ﺗﺸﻜﺮ ﻣﻲﺷﻮد‬

‫ ﻳﻚ ﻛﻮدك‬،‫ﺑﺎ آدﻧﻮوﻳﺮوس ﻳﺎﻓﺖ ﻧﺸﺪ وﻟﻲ در ﻳﻚ ﮔﺰارش از ﺑﺮزﻳﻞ‬

‫ﺗﺤﻘﻴﻖ از ﻣﺤﻞ اﻋﺘﺒﺎرات ﭘﮋوﻫﺸﻲ داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان ﺑﻪﻃﺮح‬

‫ ﺑﺎ ﺗﺸﺨﻴﺺ ﺑﺮوﻧﺸﻴﻮﻟﻴﺖ ﺑﺴﺘﺮي ﺷﺪه ﺑﻮد درﮔﻴﺮي‬ICU ‫ ﻣﺎﻫﻪ ﻛﻪ در‬13

.‫ ﺗﺎﻣﻴﻦ ﮔﺮدﻳﺪه اﺳﺖ‬9670/27488 ‫ﻣﺼﻮب‬

‫وﻳﺮوسﻫﺎي ﺗﻨﻔﺴﻲ در ﻛﻮدﻛﺎن ﮔﺰارﺷﻲ ﻣﺒﻨﻲ ﺑﺮ ﻋﻔﻮﻧﺖ ﺗﻮام‬

‫ در ﻳﻚ ﻣﻄﺎﻟﻌﻪ دﻳﮕﺮ در‬6.‫ﻳﺎﻓﺖ ﺷﺪه ﺑﻮد‬

RSV

‫ﺗﻮام ﺑﺎ آدﻧﻮوﻳﺮوس و‬

References 1. Arabzadeh SAM, Daie Parizi MH, Molaie HR, Aghaie Afshar A. The frequency distribution of parainfluenza, adeno and respiratory syncytial virus infections in children below 2 years-old with bronchiolititis by multiplex Polymerase Chain Reaction method Afzalipoor Hospital, Kerman, Iran. J Kerman Uni Med Sci 2006;15(4):305-11. 2. Henquell C, Boeuf B, Mirand A, Bacher C, Traore O, Déchelotte P, et al. Fatal adenovirus infection in a neonate and transmission to health-care workers. J Clin Virol 2009;45(4):345-8. 3. Dawood FS, Jain S, Finelli L, Shaw MW, Lindstrom S, Garten RJ, Novel Swine-Origin Influenza A (H1N1) Virus Investigation Team et al. Emergence of a novel swine-origin influenza A (H1N1) virus in humans. N Engl J Med 2009;360(25):2605-15. 4. Cheng VC, Lau YK, Lee KL, Yiu KH, Chan KH, Ho PL, et al. Fatal co-infection with swine origin influenza virus A/H1N1 and

1389 ‫ آذر‬،9 ‫ ﺷﻤﺎره‬، 68 ‫ دوره‬،‫ داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‬،‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‬

5.

6. 7.

8.

community-acquired methicillin-resistant Staphylococcus aureus. J Infect 2009;59(5):366-70. Epub 2009 Sep 9. Coiras MT, Pérez-Breña P, García ML, Casas I. Simultaneous detection of influenza A, B, and C viruses, respiratory syncytial virus, and adenoviruses in clinical samples by multiplex reverse transcription nested-PCR assay. J Med Virol 2003;69(1):132-44. Hirschheimer M, Silva PS, Giudici R, Carrilho M, Mauad T, Ishida M. Simultaneous viral infection and childhood bronchiolitis obliterans. Braz J Infect Dis 2002;6(3):146-8. Palomino MA, Larrañaga C, Villagra E, Camacho J, Avendaño LF. Adenovirus and respiratory syncytial virus-adenovirus mixed acute lower respiratory infections in Chilean infants. Pediatr Infect Dis J 2004;23(4):337-41. Paranhos-Baccalàa G, Komurian-Pradel F, Richard N, Vernet G, Lina B, Floret D. Mixed respiratory virus infections. J Clin Virology 2008;43(4):407-10.


Tehran University Medical Journal; Vol. ‫و‬68, No. 9, Dec 2010: 559-562 ‫ﻫﻤﻜﺎران‬

98

Co-infection of adenovirus with swine origin influenza A (H1N1) and report of adenovirus with respiratory syncytial virus: report of two cases

Abstract Somayeh Shatizadeh Malekshahi MSc. Jila Yavarian MD. PhD. Maryam Naseri MSc. Farhad Rezaei PhD. Student Talat Mokhtari Azad PhD.* Department of Virology, School of Public Health Tehran University of Medical Sciences, Tehran, Iran.

Received: June 22, 2010 Accepted: October 16, 2010

Background: Respiratory virus infections represent a major public health problem because of their worldwide occurrence, ease of spread in the community and considerable morbidity and mortality. They are one of the most common reasons for hospitalization of children under the age of six. In some cases, infection with two different viruses increase the severity of disease which lead to the hospitalization. Case presentation: Among 202 samples related to children under the age of six with respiratory infections, two dual infections of Adenovirus with other respiratory viruses with PCR test were detected. Conclusion: Mixed respiratory viral infections are sometimes associated with severe disease and recognition of coinfection is important. Dual infections of Adenovirus with respiratory syncytial virus (RSV) and Swine origin influenza A (H1N1) virus were demonstrated. The evidence showed that the co-infection of Adenovirus with swine origin influenza A (H1N1), has increased the severity of disease which lead to the hospitalization. Keywords: Respiratory infections, RSV, adenovirus, swine, influenza A, H1N1, virus.

*

Corresponding author: Dept. of Virology, School of Public Health, Tehran University of Medical Sciences, Porsina St., Keshavarz Blvd., Tehran, Iran. Tel: +98-21-88962343 email: mokhtari@sina.tums.ac.ir

1389 ‫ آذر‬،9 ‫ ﺷﻤﺎره‬، 68 ‫ دوره‬،‫ داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‬،‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‬


experimental animals complies with National Institutes of Health guidelines for the humane use of laboratory animals, or those of your Institute or agency. 18. Conflicts of interest: Authors must acknowledge and declare any sources of funding and potential conflicting interest, such as receiving funds or fees by, or holding stocks and shares in, an organization that may profit or lose through publication of your paper. Declaring a competing interest will not lead to automatic rejection of the paper, but we like to be made aware of it. 19. Page charges: There are no charges for publication in this Journal. 20. Copyright: Accepted manuscripts become the permanent property of the TUMJ and may not be reproduced, in whole or in part, without the written permission of the Editor. 21. Peer review process: All manuscripts are considered to be confidential. They are peerreviewed by at least 2 anonymous reviewers selected by the Editorial Board. The corresponding author is notified as soon as possible of the editor decision to accept, reject, or require modifications. If the manuscript is completely acceptable according to the criteria set forth in these instructions, it is scheduled for the next available issue. 22. Disposal of material: Once published, all copies of the manuscript, correspondence and artwork will be held for 6 months before disposal. The Final Checklist The authors must ensure that before submitting the manuscript for publication, they have taken care of the following: 1. Title page should contain title, name of the author/co-authors, their qualifications, designation & institutions they are affiliated with and mailing address for future correspondence, E-mail address, Phone & Fax number. 2. Abstract in Structured format up to 250 words. 3. References mentioned as stated in the Instruction to Authors section. 4. Tables should be typed on separate pages. 6. Make sure for Headings of Tables, their numbers and Captions of illustrations. Donâ&#x20AC;&#x2122;t repeat the information in tables if it is covered in the text. 7. Photographs / illustrations along with their captions. 8. Manuscript in Triplicate 9. Letter of Undertaking signed by all the authors. 10. Disclosure regarding source of funding and conflict of interest if any besides approval of the study from respective Ethics Committee/Institution Review Board. 11. Covering Letter 12. Floppy disk (latest version of windows) for on-line edition Nadereh Behtash M.D. Editor-in-Chief, Tehran University Medical Journal P.O. Box: 14155-6447, Tehran, Iran. Tel/Fax: + 98-21-88962510 Email: medjournal@tums.ac.ir URL: http://tumj.tums.ac.ir and http://www.tumj.ir

The Editorial Board of the journal, reserves the right to accept or reject the article in any stage and any time or delete a part of the text, tables or figures, if necessary.


9. Acknowledgement: All contributors who do not meet the criteria for authorship should be covered in the acknowledgement section. It should include persons who provided technical help, writing assistance and departmental head who only provided general support. Financial and material support should also be acknowledged [in Persian]. 10. Tables in limited numbers should be submitted with the captions placed above. Do not submit tables as photograph. Place explanatory matters in footnotes, not in the heading [in Persian]. 11. Figures should be in limited numbers, with high quality art work and mounted on separate pages. The captions should be placed below. 12. The same data should not be presented in tables, figures and text, simultaneously. 13. References: Personal communications, manuscripts in preparation and other unpublished data are not cited in the reference list but may be mentioned in the text in parentheses. Identify references in the text by Farsi numerals in parentheses on the line. References should be typed, double-spaced, and separate from the text and numbered consecutively in the order in which they are mentioned in the text. (References cited in figures and tables, but not in the text, should be numbered consecutively following the text references.) Journal references should contain inclusive page numbers; book references specific page numbers. Indicate abstracts by the abbreviation ‘Abst’ and letters by ‘Lett’ in parentheses. Abbreviations of journals should conform to those used in Index Medicus, National Library of Medicine. The references should observe the following style: Periodicals: List all authors if six or fewer; otherwise, list first six and add ‘et al’. Do not use periods after the authors initials 1. Vimala N, Mittal S, Kumar S. Sublingual misoprostol versus oxytocin infusion to reduce blood loss at cesarean section. Int J Gynaecol Obstet 2006; 92(2): 106-10. 2. Patted SS, Goudar SS, Naik VA, Bellad MB, Edlavitch SA, Kodkany BS, et al. Side effects of oral misoprostol for the prevention of postpartum hemorrhage: results of a community-based randomised controlled trial in rural India. J Matern Fetal Neonatal Med 2009; 22(1): 24-8. Books: Basmajian JV. Grant's Method of Anatomy. 11th ed. Baltimore: Williams Wilkins; 1989. Chapter in book: Monks R. Psychotropic drugs. In: Wall PD, Melzack RA, editors. Textbook of Pain. 3rd ed. Edinburgh: Churchill Livingstone; 1994: p. 963-89. 14. Proof Reading: A computer printout is sent to the corresponding author for proof reading before publication in order to avoid any mistakes. Corrections should be marked clearly and sent immediately to the Journal office. 15. Abbreviations and symbols: use only standard abbreviations. Avoid using them in the title and abstract. The full term for which an abbreviation stands should precede its first use in the text unless it is a standard unit of measurement. Short communication when possible; follow the same structure as original papers. 16. The corresponding author will be supplied with 3 free issues. 17. Ethics: Ethical considerations must be addressed in the Materials and Methods section. 1) Please state that informed consent was obtained from all human adult participants and from the parents or legal guardians of minors. Include the name of the appropriate institutional review board that approved the project. 2) Indicate in the text that the maintenance and care of


INSTRUCTION FOR AUTHORS: 1. Aims and Scope: The “Tehran University Medical Journal” (TUMJ) is the official scientific and clinical monthly publication of the Tehran University of Medical Sciences. It accepts Original Papers, Review Articles, Short Communications and Letters to the Editor in the fields of basic science and medicine. All correspondences should be addressed to: The Editor-in-Chief, Tehran University Medical Journal. P.O. Box: 14155-6447. Tehran, Iran Tel/Fax: + 98-21-88962510 2. Submission: Papers submitted for publication should describe original work, not previously published elsewhere, totally or partly. Manuscripts must be submitted only in Persian with English abstracts and should be written according to sound grammar and proper terminology. Submission is acceptable via Journal URL: http://journals.tums.ac.ir/login. The Manuscript must be accompanied by a covering letter to the Editor-in-Chief, including title and author(s) name and undertaking that it has not been published or submitted elsewhere, and should include: Title; No author(s) name; the Abstract; Introduction; Materials & Methods; Results; Discussion; Acknowledgement and References. 3. The title page: The complete title of the manuscript, the name of all the authors with their highest qualifications, the department or institution to which they are attached, address for correspondence with telephone numbers, e-mail, and Fax number. 4. The abstract (no more than 250 words) in structured format as Background, Methods, Results and Conclusion followed by 3 to 6 Keywords must be presented. Use terms from the Medical Subject Headings (MeSH) list of index medicus: (http://www.nlm.nih.gov/mesh/MBrowser.html ). 5. Introduction: This should summarize the purpose and the rationale for the study. It should neither review the subject extensively nor should it have data or conclusions of the study [in Persian]. 6. Materials & Methods: This should include exact method or observation or experiment. If an apparatus is used, its manufacturer’s name and address should be given in parenthesis. If the method is established, give reference but if the method is new, give enough information so that another author is able to perform it. If a drug is used, its generic name, dose and route of administration must be given. For patients, age, sex with mean age ± standard deviation must be given. Statistical method must be mentioned and specify any general computer program used. The Info system used should be clearly mentioned [in Persian]. 7. Results: It must be presented in the form of text, tables and illustrations. The contents of the tables should not be all repeated in the text. Instead, a reference to the table number may be given. Long articles may need sub-headings within some sections (especially the Results and Discussion parts) to clarify their contents [in Persian]. 8. Discussion: This should emphasize the present findings and the variations or similarities with other work done in the field by other workers. The detailed data should not be repeated in the discussion again. Emphasize the new and important aspects of the study and the conclusions that follow from them. It must be mentioned whether the hypothesis mentioned in the article is true, false or no conclusions can be derived [in Persian].


14-21 Tehran University Medical Journal; Vol.Journal 64, No. 8, Nov 2006: Tehran University Medical Tehran University Medical Journal

Tehran UniversityMedical Medical Journal Tehran University Journal Volume 68 Number 9 December 2010 Volume 1 April 2007 Volume6468 Number. Number 7 October 2010 Volume 64, Number 8, November 2006

Contents Recombinant parathormone and osteoporosis: a review article.....................................................................497 Larijani B, Alimadadi A.

Isolation of skin-derived precursors from human foreskin and their differentiation into neurons and glial cells…...............................................................................................................................................508 Bakhtiari M, Mansouri K, Mostafaie A, Sadeghi Y, Mozafari H, Ghorbani R, Rezaei Tavirani M.

p16 immunohistochemistric marker in normal and tumoral myometrium: a study on 136 cases............516 Forouhesh Tehrani Z, Paikari A, Malaieri A.

Risk factors of blood transfusion in patients undergoing off-pump coronary artery bypass.....................522 Forouzan Nia S.Kh, Hadadzadeh M, Mirhosseini S.J, Hosseini H, Abdollahi M.H, Forat Yazdi M, Rasti M, Dehghanizadeh H, Ghoreishian S.M.

The effects of topically applied tranexamic acid on reduction of post-laminectomy hemorrhage..............527 Saberi H, Miri S.M, Poordel Namdar M.

The role of group A beta hemolytic streptococal infections in patients with tic and tourett's disorders....534 Noorbakhsh S, Jalili B, Shamshiri A.R, Shirazi E, Tabatabaei A, Taghipour R, Modares Fathi A.

The role of estrogen and progesterone receptors in response rate to megestrol acetate: conservative treatment of stage Ia endometrial adenocarcinoma..................................................................................541 Yarandi F, Shirali E, Eftekhar Z, Khazaeipour Z.

Treatment of chronic anal fissure: Botulinum toxin (Dysport) versus lateral internal anal sphincterotomy.........................................................................................................................................547 Asgari M, Mirrokni S.M.

Surgical management of pilonidal sinus patients by primary and secondary repair methods: a comparative study....................................................................................................................................553 Haji Barati B, Ghafuri A.

Co-infection of adenovirus with swine origin influenza A (H1N1) and report of adenovirus with respiratory syncytial virus: report of two cases.................................................................................................................559 Shatizadeh Malekshahi S, Yavarian J, Naseri M, Rezaei F, Mokhtari Azad T.

1389 ‫ آذر‬،9 ‫ ﺷﻤﺎره‬، 68 ‫ دوره‬،‫ داﻧﺸﮕﺎه ﻋﻠﻮم ﭘﺰﺷﻜﻲ ﺗﻬﺮان‬،‫ﻣﺠﻠﻪ داﻧﺸﻜﺪه ﭘﺰﺷﻜﻲ‬


TUMJ

TEHRAN UNIVERSITY MEDICAL JOURNAL The Official Publication of Medical School, Tehran University of Medical Sciences Volume 68

Number 9

December 2010

Chairman: S.H. Emami Razavi Editor in Chief: N. Behtash Executive Editor: M.A. Noyan Ashraf Associate Editors: SH. Akhondzadeh, A. Arab Kheradmand, N. Ataei, S. Borna, M. Ghazi Khansari, S.J. Ghazi Mirsaeed, J. Hajati, M. Kadkhodaei, S. Moradmand, Z. Nadiya Hatmi, M.A. Noyan Ashraf, R. Omranipoor, N. Rezaei, N. Sajjadian Editorial Board: M. Akbarian, F. AmoozegarHashemi, B. Bahar, F. Davari Tanha, N. Ebrahimi Daryani, M.R. Hadiyan, Z. Hallaji, Z. Hussain Khan, M. Kajbaf Zadeh, M.J Mikaeli, A. Mousavi, S.M.J. Mortazavi, B. Nabaei, P. Pasalar , P. Pasbakhsh, M. Rasooli Negad, A. Shaabani, M. Sotoodeh, A.R. Talaeipoor, M. Vahid Dasjerdi, M.R. Zafarghandi International Board: F. Assadi (Chicago), J. Parvizi (Philadelphia), A. Gangi (Strasbourg), M.R. Keshtgar (London), Sh. Masood (Florida), P. Hanjani (Pennsylvania) Editors: N. Behtash, M.A. Noyan Ashraf Office staff: M. Asgari, H. Chaychi, A. Kamizani, R. Ramezani, S. Sadigh Publisher: Tehran University of Medical Sciences Office: Tehran University Medical Journal, Medical School, 202 Amouzesh building, Poursina Ave., Ghods St., Keshavarz Blvd., Tehran, Iran, P.o. Box: 14155-6447, Tel: +98(21)88962510, Fax: +98(21)88962510, Online submission: http://journals.tums.ac.ir/login, and http://tumj.tums.ac.ir, Email: medjournal@tums.ac.ir

TUMJ is indexed/ abstracted in: SCOPUS, EMBASE, Cambridge Scientific Abstracts (CSA), CAB Abstracts (CABI), Chemical Abstract Service (CAS), DOAJ, Psych Info, ULRICHÎ&#x201E;S, Index Copernicus, IMEMR, EMR Beta, SID, Magiran and Iran Medex

http://tumj.tums.ac.ir

Tehran University Medical Journal (TUMJ), Vol.68, No.9  

TUMJ, Vol.68, No. 9, December 2010

Read more
Read more
Similar to
Popular now
Just for you