Page 1

International Journal of Hyperthermia

rP Fo Journal: Manuscript ID: Manuscript Type:

THTH-2009-0124 Original Article 19-Sep-2009

Yu, Jin; Beijing University of Agriculture Yin, Peng; China Agricultural University, College of Veterinary Medicine Yin, Jingdong; China Agricultural University, College of Veterinary Medicine Liu, Fenghua; Beijing University of Agriculture, Department of Animal Science and Technology Zhu, Xiaoyu; China Agricultural University, College of Veterinary Medicine Xu, Jianqin; China Agricultural University, College of Veterinary Medicine

w

ie

Complete List of Authors:

International Journal of Hyperthermia

ev

Date Submitted by the Author:

rR

ee

Involvement of ERK1/2 Signaling and Growth Factor Expression in Response to Heat Stress-Induced Damage in Rat Jejunum and IEC-6 Cells

On

Physiological effects of hyperthermia (i.e., perfusion effects, hypoxia, pH, metabolism, microenvironment, redox), Targets of cellular thermal response (i.e., cytoskeleton, nuclear matrix, cell membranes, signal transductions)

ly

Keywords:

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


Page 1 of 48

1

Running title: ERK1/2 pathway and growth factors in heat stress

2

Involvement of ERK1/2 Signaling and Growth Factor Expression in

3

Response to Heat Stress-Induced Damage in Rat Jejunum and

4

IEC-6 Cells 1

5

Fo

Jin Yu a, Peng Yin b, Jingdong Yin b, Fenghua Liu a, *, Xiaoyu Zhu b, c Jianqin Xu b, c, *

6 7

a

8

Beijing 102206, P. R. China

9

b

Department of Animal Science and Technology, Beijing University of Agriculture,

ee

rP

College of Veterinary Medicine, China Agricultural University, Beijing 100193,

10

PR China

11

c

12

for Animal Use, Ministry of Agriculture, Beijing 100193, P. R. China

13

*

14

Fenghua Liu, NO. 7, Beinong Road, Beijing, 102206, P. R. China. (Tel.:

15

+86-10-80794699; Fax: +86-10-80794699; E-mail: liufenghua1209@126.com)

16

Jianqin Xu, NO. 2, Yuanmingyuan West Road, Beijing, 100193, P. R. China. (Tel.:

17

+86-10-62733017; Fax: +86-10-62734111; E-mail: jianqinxucau@126.com)

18

1

19

of China (No.30771566; No. 30771591), Beijing Natural Science Foundation

20

(No.6082007) and the National Eleventh Five-Year Scientific and Technological

21

Support Plan (No. 2008BADB4B01, 2008BADB4B07).

rR

Key Laboratory of Development and Evaluation of the Chemical and Herbal drugs

iew

Corresponding authors:

ev

ly

On

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

International Journal of Hyperthermia

This work was supported by grants from the National Natural Science Foundation

1

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


International Journal of Hyperthermia

22

Abstract: Our previous studies found small intestine epithelial tissues from

23

different animals (rats, pigs and chickens) became significantly damaged following

24

exposure to heat stress. Damaged tissue was rapidly repaired or regenerated in the

25

following few days. Growth factors are critical for cellular survival and promote

26

endothelial cell proliferation and migration. The ERK1/2 signaling pathway is

27

reported to regulate the growth and adaptation of endothelial cells to both

28

physiological and pathological stimuli. However, few studies have investigated the

29

role of ERK1/2 and growth factor expression in response to heat stress. Herein, we

30

hypothesized that growth factor mRNA expression and ERK1/2 signaling are

31

critical regulatory factors in heat stress-induced cellular damage and regeneration.

32

We employed both live rats and rat IEC-6 cells to test this hypothesis. Results

33

revealed heat stress caused significant morphological damage to rat intestines and

34

IEC-6 cells, reduced cell growth and proliferation, induced apoptosis, altered

35

growth factor mRNA expression and phosphorylated ERK1/2. Addition of an

36

ERK1/2 inhibitor combined with heat stress exacerbated morphological damage and

37

apoptosis. Using an ERK1/2 inhibitor revealed the dependence of growth factor

38

mRNA expression in IEC-6 cells during heat stress.

iew

ev

rR

ee

rP

Fo

ly

On

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 2 of 48

39

In conclusion, both ERK1/2 and growth factors were significantly altered in

40

response to heat stress. The activation of ERK1/2 represents stimulation of a

41

potential survival mechanism in rat IEC-6 cells during heat stress. ERK1/2 was also

42

found to modulate growth factor mRNA expression of Pdgfa, Fgfr2, Egfr, Ctgf,

43

Gdf-9 and Gdf-15 in rat IEC-6 cells in response to heat stress.

2

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


Page 3 of 48

44

Keywords: Heat Stress, Growth Factors, ERK1/2, Cell Viability, Apoptosis,

45

Microarray, Real-Time PCR, FACS, MTT, Western Blot, Small Intestine, IEC-6

46

Cell, Rat

iew

ev

rR

ee

rP

Fo ly

On

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

International Journal of Hyperthermia

3

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


International Journal of Hyperthermia

47

INTRODUCTION

48

With the presence of global warming, heat stress is becoming the greatest

49

stressor influencing animal health and growth, especially during the summer

50

months [1]. The intestinal epithelium is directly exposed to a large assortment of

51

nutrients, microbes and exogenous toxins providing both a barrier and absorptive

52

function [2]. However, when animals become exposed to environmental

53

temperatures greater than their thermoneutral temperature, their peripheral blood

54

flow is increased to dissipate internal body heat, thereby resulting in a significant

55

reduction in blood flow to the intestine [3, 4]. During this time, the epithelial tissue

56

of the small intestine can experience ischemic and hypoxic conditions, resulting in

57

tissue damage which, in turn, can lead to diarrhea and an increased risk of

58

morbidity and mortality [5]. Previous studies have demonstrated that damaged

59

epithelial cells are constantly and rapidly replaced by new cells, crucial for

60

maintaining sufficient intestinal function [6]. A growth factor refers to a naturally

61

occurring substance capable of stimulating cellular growth, proliferation and

62

cellular differentiation which is important in regulating a variety of cellular

63

processes [7]. Growth factors can promote endothelial proliferation and migration,

64

as well as act as critical survival factors for endothelial cells [8]. The

65

extracellular-regulated kinase 1/2 (ERK1/2) signaling pathway is known as a

66

critical regulator of cellular differentiation, proliferation, stress responsiveness, and

67

apoptosis [9]. ERK1/2 activation is understood to regulate cellular growth and

iew

ev

rR

ee

rP

Fo

ly

On

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 4 of 48

4

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


Page 5 of 48

68

adaptation in response to both physiological and pathological stimuli [10]. Thus, we

69

hypothesize that growth factor expression and ERK1/2 signaling are critically

70

involved in heat stress-induced intestinal epithelial cell damage and regeneration.

71

The rat intestinal epithelial cell line (IEC-6), a homogenous population of

72

epithelial-like cells commonly used as a model to elucidate the mechanism of

73

intestinal epithelial cell differentiation, growth, and wound healing was employed

74

[11]. Using the rat IEC-6 cell line, we investigated cell morphology, viability,

75

apoptosis, growth factor mRNA and expression, as well as ERK1/2 signaling in

76

response to heat stress.

77

MATERIALS AND METHODS

78

In Vivo studies

79

Ethical approval

iew

ev

rR

ee

rP

80

Fo

All experimental protocols were approved by the Committee for the Care and

On

81

Use of Experimental Animals, Beijing University of Agriculture.

82

Animal experimental groups

ly

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

International Journal of Hyperthermia

83

Forty-eight male Sprague-Dawley rats weighing 200 Âą 20 g (obtained from

84

Beijing Vital River Laboratory, Animal Technology Co., Beijing, China) were

85

acclimated to 25 ÂşC, 60% relative humidity (RH) and maintained under a 12 h : 12 h

86

light : dark cycle. Food and water were provided ad libitum for 7 days. Upon the

87

eighth day rats were randomly assorted into control or heat-stressed groups. Each 5

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


International Journal of Hyperthermia

88

group consisted of 24 rats, which were housed in plastic cages (400 mm × 300 mm ×

89

180 mm) with a layer of soft woodchips. Feed (200 g) and water (400 mL) were

90

provided daily.

91

Treatment

Fo

92

Rats in the control group were housed in a regulated environment (25 ºC, 60%

93

RH); while rats in the heat-stressed group were also housed under control group

94

conditions, but exposed to 40 ºC and 60% RH between 11:00am and 1:00pm daily

95

for ten consecutive days. On the 1st, 3rd, 6th and 10th days, six rats from each

96

group were sacrificed immediately following the 2 hr heat exposure time period.

97

Sampling

ev

rR

ee

rP

98

Rat body temperature was recorded daily before and after heat exposure using a

99

thermistor probe connected to a digital thermometer. The probe was inserted 4 cm

100

into the rectum of each rat and the animal held stationary for 30 sec to record the

101

true rectal temperature. Body surface temperature was also recorded daily before

102

and after heat exposure using both an infrared and contact thermometer (Fluke 561,

103

USA). Blood samples collected were stored at 37 ºC for 60 min, prior to being

104

centrifuged at 3000 g for 10 min; sera was collected and stored at -80 ºC until

105

required. Following removal of the intestine, it was immediately irrigated with

106

physiological saline to remove the intestinal contents, before being separated into

107

the duodenum (15 mm from the pylorus), the distal jejunum–ileum (half of the

108

remaining small intestine up to the cecum) and the ileum (20 mm proximal to the

iew

ly

On

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 6 of 48

6

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


Page 7 of 48

109

cecum). Each intestinal section was divided into three pieces: one fixed in 10%

110

buffered formalin phosphate for histological analysis; one for cDNA microarray

111

analysis; and one stored at -80 ºC. Total serum cortisol concentration was

112

determined using an iodine [I125] cortisol radioimmunoassay kit, performed

113

according to the manufacturer’s instructions (Beijing Chemclin Biotech Co., Ltd,

114

China).

115

Fixing intestinal sections and staining

rP

Fo

116

Small intestine tissue samples were promptly rinsed with physiologic saline and

117

immediately fixed in 10% buffered formalin phosphate following removal from the

118

animal. The formalin-fixed samples were embedded in paraffin and transversely

119

sectioned (5 µm thick). After deparaffinization and dehydration, the sections of

120

duodenum, jejunum and ileum were stained with hematoxylin and eosin (SIGMA,

121

USA). Microstructures of the small intestine were observed using a BH2 Olympus

122

microscope (Olympus, Japan) and analyzed using an Olympus Image Analysis

123

System (Olympus 6.0, Japan).

124

In Vitro studies

125

IEC-6 cell culture

iew

ev

rR

ee

ly

On

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

International Journal of Hyperthermia

126

IEC-6 cells (#CRL21592, obtained from Peking Union Medical College) were

127

cultured in DMEM containing 5% (v/v) fetal bovine serum (HyClone, USA), 2 mg/l

128

insulin, 50 IU/ml penicillin and 50 µg/ml streptomycin at 37 ◦C and 5% (v/v) CO2.

7

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


International Journal of Hyperthermia

129

The medium was changed 24 h following initial cell plating.

130

Treatment and morphology observation

131

The control cells were strictly regulated at 37 ºC and 5% CO2, while heat-stressed

132

cells were exposed to 42 ºC (maintained at 5%, CO2). Changes in cell morphology

133

following heat stress were observed using an inverted biological microscope

134

(IX71/IX2, Olympus, Japan).

135

MTT and FACS assay

ee

rP

Fo

136

To measure cell proliferation, equivalent numbers of IEC-6 cells were plated on

137

96-well multiplates and cultured in DMEM containing 5% fetal bovine serum.

138

Control cells were maintained at 37 ºC, while heat-stressed cells were submitted to

139

42 ºC for 2, 3, 4 or 5 h, respectively. Following the heat stress period, 10 µL of

140

MTT (10 mg/ml) was added to each well then incubated at 37 ºC for 4 hr. Well

141

media was aspirated and the formazan product dissolved using dimethyl sulfoxide.

142

The remaining formazan product was analyzed using a microplate reader

143

(BIO-RAD, USA.) at a fixed absorption wavelength of 570 nm. Using the MTT

144

assay, it was determined that subjecting the intestinal cells to 42 ºC for 3 hrs caused

145

the greatest level of stress.

iew

ev

rR

ly

On

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 8 of 48

146

To analyze the apoptosis, IEC-6 cells were divided into control (37 ºC),

147

heat-stressed (42 ºC for 3h), and ERK1/2 inhibitor (42 ºC for 3h + 20 µmol/L

148

ERK1/2 inhibitor, U0126, #1144, Tocris, USA) groups. Following each specific

149

treatment, all IEC-6 cells were stained with annexin V/propidium iodide (PI) 8

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


Page 9 of 48

150

(Invitrogen, USA), before FACS analysis was performed following manufacturer’s

151

instructions (Beckman, USA).

152

Total RNA expression and reverse transcription (RT)

153

Total RNA was isolated from the small intestine and IEC-6 cells using a

154

phenol and guanidine isothiocyanate-based Trizol reagent (Invitrogen, USA.). The

155

concentration and purity of RNA were assessed using a spectrophotometer

156

(SmartSpec plus, BIO-RAD, USA.) utilizing the OD260/OD280 ratio. Total RNA

157

was reverse transcribed as follows: 2.0 µg of RNA isolated from each sample was

158

added to 25 µL of reaction solution comprising 2.0 µL oligo-dT18, 5.0 µL dNTP,

159

1.0 µL RNase inhibitor, 1.0 µL M-MLV transcriptase, 5.0 µL M-MLV RT reaction

160

buffer (Promega, USA) and 11 µL RNase-free water. The parameters for the

161

reverse-transcription procedure, based on the manufacturer’s instructions (Promega,

162

USA), were: 70 ºC for 5 min followed by 42 ºC for 2 h. The RT products (cDNA)

163

were stored at -20 ºC for subsequent PCR.

164

Hsp70 mRNA expression in rat small intestine and IEC-6 cells

iew

ev

rR

ee

rP

Fo

ly

On

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

International Journal of Hyperthermia

165

PCR amplification of Hsp70 mRNA and β-actin was performed using the

166

primer pairs listed in Table 1. PCR amplification was performed according to

167

manufacturer’s guidelines (Fermentas, USA): 94 ºC for 5 min followed by 30

168

cycles of 94 ºC for 40 sec, 56 ºC for 30 sec, and 72 ºC for 30 sec, with a final

169

extension of 72 ºC for 8 min.

170

15 µL of PCR products were electrophoresed on 1.2% agarose gels containing 9

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


International Journal of Hyperthermia

171

GV (gold view) at a constant 100 V for 40 min, before being photographed using a

172

Digital Gel Imaging Analysis System (IS-2200; Alpha, USA), and analyzed using

173

an Image Analysis System (Olympus 6.0, Japan). The ratio of sample intensities

174

compared with β-actin provided a measure of nucleic acid quantity.

175

DNA Microarray

176

RNA extraction and target labeling

rP

Fo

177

Total RNA was isolated from small intestine tissue using a phenol and guanidine

178

isothiocyanate-based Trizol reagent in accordance with manufacturer’s instructions

179

(Invitrogen, USA.). RNA quality of each sample was determined and recorded

180

using an RNA 6000 LabChip Kit, and the Agilent 2100 Bioanalyzer (Agilent

181

Technologies, Palo Alto, CA). RNA consistently had a 28S/18S ratio of ~1.4. RNA

182

was purified using a QIAGEN RNeasy® Mini Kit (#74106, QIAGEN) and

183

amplified using a low RNA input linear amplification kit (#5184-3523, Agilent).

184

Each RNA sample was annealed with a primer containing a poly-dT and a T7

185

polymerase promoter. Reverse transcriptase produced primary and secondary

186

cDNA strands. T7 RNA polymerase was then used to create cRNA from the double

187

stranded cDNA by incorporating cyanine-3-labeled cytidine 5-triphosphate. The

188

quality of the labeled cRNA was again verified and the absolute concentration was

189

measured using a spectrophotometer (Nanodrop ND1000).

iew

ev

rR

ee

ly

On

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 10 of 48

10

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


Page 11 of 48

190

Hybridization, scanning and feature extraction

191

The cRNA was hybridized in equal amounts to six arrays using a Gene Expression

192

Hybridization Kit (#5188-5242, Agilent, USA). Hybridization was performed at 60 ºC

193

for 17 h with Agilent whole rat genome arrays (#G4131F, Agilent, USA). The arrays

194

were washed using a gene expression wash buffer kit (#5188-5327, Agilent, USA),

195

Stabilization and drying solution was performed (#5185-5979, Agilent, USA). The

196

arrays were scanned on a Microarray (#G2565BA, Agilent, USA) and the subsequent

197

data compiled with Agilent feature extraction software. The steps comprising RNA

198

amplification to the final scanner output data were conducted by a private contractor

199

(Shanghai Biochip Co., Ltd, China).

200

Microarray data analysis

ev

rR

ee

rP

Fo

201

Array normalizations and error detection were carried out using Silicon Genetics’

202

GeneSpring GX Version 10.0 (Agilent, USA), via the enhanced Agilent feature

203

extraction import preprocessor. First, values of poor quality intensities and low

204

dependability were removed using a “filter on flags” feature, where standardized

205

software algorithms determined which spots were “present”, “marginal”, or “absent.”

206

Spots were considered “present” only when the output was uniform, non-saturated

207

and significantly greater than the background. Spots that satisfied these requirements

208

but were deemed outliers relative to the typical values for the other genes were

209

considered “marginal.” Filters were set to retain only the present and marginal values

210

for further analysis. Data were normalized using algorithms supplied with the feature

iew

ly

On

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

International Journal of Hyperthermia

11

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


International Journal of Hyperthermia

211

extraction software. After data normalization, a final quality-control filter was applied,

212

where genes expressing excessive biological variability were discarded.

213

Validation of growth factor mRNA expression using real time PCR

214

To corroborate the relative changes in gene expression in response to heat stress

215

both in vivo and in vitro identified by the oligonucleotide microarrays, we employed

216

real time quantitative reverse transcriptase-PCR (RT-PCR). Quantitative PCR

217

analysis was carried out using the DNA Engine Mx3000P® fluorescence detection

218

system (Stratagene, USA) according to optimized PCR protocols, and using Brilliant

219

SYBR Green QPCR Master Mix (Stratagene, USA), containing a double-stranded

220

DNA-specific fluorescent dye. β-actin was always amplified in parallel with the target

221

gene. The cDNA of each sample was subjected to real-time RT-PCR using the primer

222

pairs listed in Table 1. The PCR reaction system (20 µL in total) comprised of 10 µL

223

SYBR Green qPCR mix, 0.3 µL reference dye, 1 µL of each primer (both 10 µmol/L),

224

and 1 µL of cDNA template (<10 µg/L). Cycling conditions were: 94 ºC for 10 min,

225

followed by 40 cycles of 94 ºC for 30 s, 56 ºC for 30 s and 72 ºC for 40 s.

226

Dissociation was initiated by 95 ºC for 1 min, and the melting curve (from 55 – 95 ºC

227

at 0.2 ºC/ s) was measured continuously by fluorescence. Expression levels were

228

determined using the relative threshold cycle (CT) method as described by the

229

manufacturer (Stratagene, USA). Each gene was calculated by evaluating the

230

expression 2-∆∆CT, where ∆∆CT is the result of subtracting heat-stressed [CT gene – CT

231

β-actin]

iew

ev

rR

ee

rP

Fo

ly

On

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 12 of 48

from control [CT gene – CT β-actin].

12

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


Page 13 of 48

232

Western blot

233

Protein from IEC-6 cells was extracted using a total protein extraction kit

234

(#K3011010, Biochain, USA) and quantified using a BCA protein assay kit (#

235

23225, Pierce, USA). 30 µg of total protein was loaded and electrophoresed for 40

236

min at 200 V, before being transferred onto nitrocellulose membranes (#88585,

237

Pierce, USA). Blots were blocked overnight at 4 ºC in SuperBlock T20 (TBS)

238

blocking buffer (# 37536, Pierce, USA). Phospho-ERK1/2, ERK1/2 (#4376, #4695,

239

CST, USA) and Actin (#SC-1615, SANTA, USA) antibodies were added to the

240

block buffer at 1:1000 dilutions and incubated for 2 h under agitation. Blots were

241

washed in PBST20 for 5 min with shaking. Goat anti-rabbit IgG-HRP (#SC-2004,

242

SANTA) and donkey anti-goat IgG-HRP (#SC-2033, SANTA) secondary antibodies

243

were added at 1:500 dilution and incubated for 2 h under agitation. Blots then were

244

washed in PBST20 for 5 min with shaking and visualized using a SuperSignal (R)

245

West Pico Chem luminescent substrate (#34080, Pierce, USA). Blots then were

246

exposed to x-ray film (Kodak, USA).

247

Statistical Analysis

iew

ev

rR

ee

rP

Fo

ly

On

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

International Journal of Hyperthermia

248

All results are presented as mean ± SD. Statistical analysis was performed by

249

independent-sample T-tests using SPSS 12.0 software. A p-value of less than 0.05

250

was considered to indicate a significant difference. Microarray analysis was

251

conducted using GeneSpring GX_10.0.

13

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


International Journal of Hyperthermia

252

3. RESULTS

253

In Vivo studies

254

Rectal and body surface temperature, serum cortisol concentration and Hsp70

255

expression

Fo

256

Following heat exposure for 2 h, rat rectal and body surface temperatures were

257

significantly elevated above controls (Figure 1- A, Figure 2). Serum cortisol

258

concentration and Hsp70 expression were also found to be significantly higher in the

259

heat-stressed group than that of control (Figures 1-B & 1-C respectively).

260

Histological changes in the small intestine following heat-stress

ev

rR

ee

rP

261

Heat exposure significantly altered the morphology of rat small intestine.

262

Bleeding in the intestinal villi and desquamation at the tips of the intestinal villi

263

were observed. The desquamation of mucosal epithelial cells exposed the lamina

264

propria, with such damage found to be most severe in the jejunum on the 3rd day

265

after heat exposure (Figure 3).

266

Microarray data analysis

iew

ly

On

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 14 of 48

267

The gene expression profiles for the jejunum were obtained using microarrays.

268

Genes known to have a significant role in the defense response and produce growth

269

factors are listed in Table 2. Hierarchical clustering and pathway analysis were

270

conducted by GeneSpring GX_10 (Figure 4 & Figure 5 respectively).

14

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


Page 15 of 48

271

272

Growth factor mRNA expression

Growth factor mRNA expression in the rat jejunum were confirmed by real time

273

PCR and displayed in Figure 6.

274

In Vitro experiment

275

Hsp70 expression, cell proliferation, morphology and apoptosis following heat

276

stress

rP

Fo

277

Hsp70 mRNA expression in heat-stressed IEC-6 cells was significantly

278

upregulated compared with control cells (Figure 1-C). Cellular proliferation and

279

viability were significantly reduced after exposure to 42 ยบC for 3h, 4h, and 5h but

280

not 2h (Figure 7-A). The morphology of heat-stressed IEC-6 cells was markedly

281

altered, differing in cell shape, displaying disruption of intercellular junctions, and a

282

greater dead cell mass was clearly present in the supernatant (Figure 7-B).

283

Apoptosis was significantly increased in IEC-6 cells exposed to heat-stress, which

284

was exacerbated in the presence of the ERK1/2 inhibitor, U0126 (Figure 7-C).

285

Growth factor mRNA expression

iew

ev

rR

ee

ly

On

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

International Journal of Hyperthermia

286

The mRNA expression levels of Alb, Egfr, and Ctgf were significantly

287

down-regulated while Fgfr2, Tgif, Pdgfa, Vegfa, Gdf15, Okl38 and Gdf9 were

288

significantly up-regulated in heat-stressed rat IEC-6 cells when compared with

289

control. The up- or down-regulation of Egfr, Ctgf, Tgif, Vegfa, Okl38 and Gdf15 in

290

response to heat stress were abolished by the addition of an ERK1/2 inhibitor (Figure

15

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


International Journal of Hyperthermia

291

8).

292

Activation of the ERK1/2 signaling pathway

293

Heat-stress significantly increased the phosphorylation of ERK1/2 and activation

294

of its signaling pathway as the effects of heat-stress could be abolished by a selective

295

ERK1/2 inhibitor (U0126) (Figure 9).

296

4. 4. DISCUSSION

297

Heat stress caused morphological damage to rat intestine and IEC-6 cells

ee

rP

Fo

298

The rat small intestine is in direct contact with a large assortment of nutrients,

299

microbes and exogenous toxins. The intestinal epithelial tissue exchanges nutrients

300

between the gut lumen and the systemic circulation, as well as preventing pathogenic

301

organisms and toxic compounds from penetrating into the circulation. The small

302

intestine is the largest â&#x20AC;&#x153;organâ&#x20AC;? of the immune system. Approximately 25% of

303

intestinal mucosa comprises lymphoid tissue, while more than 70% of total body

304

immune cells are located within the intestine [2]. However, many stressors such as

305

radiation, lipopolysaccharides (LPS), pharmacological drugs, endotoxins and heat can

306

cause damage to the gastrointestinal (GI) tract. Focusing on heat stress, when

307

mammals are exposed to environmental temperatures greater than their thermoneutral

308

temperature internal body heat is dissipated by increased peripheral blood flow which,

309

in turn, dramatically reduces blood flow to the GI tract [4]. The ischemia and hypoxia

310

experienced by the small intestine can result in necrosis and shedding of epithelial

311

cells of the intestinal villi. Intestinal epithelial cell damage reduces intestinal barrier

iew

ev

rR

ly

On

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 16 of 48

16

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


Page 17 of 48

312

function, resulting in diarrhea and an increased risk of morbidity and mortality.

313

The rat intestinal epithelial cell line (IEC-6) is a homogenous population of

314

epithelial-like cells exhibiting tightly adherent and closely opposed polygonal cells

315

[11]. However, following heat stress, we found striking structural changes had

316

occurred, with alterations in cell shape, disruption of intercellular junctions and

317

increased apoptosis with a greater dead cell mass clearly present in the supernatant.

318

Heat stress is known to cause oxidative stress in cultured IEC-6 cells which

319

stimulate reactive oxygen species (ROS). Increased ROS causes damage to DNA,

320

RNA, proteins and lipid peroxidation, resulting in cell apoptosis [12].

321

Heat stress reduced cell viability and induced apoptosis

rR

ee

rP

Fo

322

Cell viability was used to evaluate cell damage during environmental stress and

323

provide a measure of cell mortality. The current study employed the classical MTT

324

assay to determine cell viability and growth. We revealed heat stress significantly

325

reduced cultured IEC-6 cell viability and inhibited cell growth. Heat stress is known

326

to damage almost any cellular structure or intracellular molecule, including inhibiting

327

DNA synthesis, transcription, RNA processing, protein translation, and cell cycle

328

progression; as well as causing denaturation, degradation and misaggregation of

329

proteins, disrupt cytoskeletal components, alter metabolism and change plasma

330

membrane permeability. In sum, heat stress can lead to organelle damage and cell

331

cycle arrest, reducing cellular growth, proliferation, viability and apoptosis [13].

iew

ly

On

332

ev

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

International Journal of Hyperthermia

Cells possess the capability to self-induce programmed cell death (apoptosis) in

17

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


International Journal of Hyperthermia

333

response to environment and physical stress [14]. Oxidative stress, heat shock, and

334

irradiation-induced apoptosis have been observed in many different types of cells. The

335

process of cellular adaptation to environmental stresses is initiated and mediated by

336

the activation of specific intracellular signaling pathways. The pathways found to be

337

of greatest importance in this process are the family of mitogen-activated protein

338

kinase (MAPK) pathways (including ERK1/2, JNK and p38). The ERK1/2 signaling

339

pathway regulates cellular differentiation, proliferation, stress responsiveness and

340

apoptosis, critical processes for cellular adaptation and survival [15]. To detect and

341

measure apoptosis, IEC-6 cells were stained with annexin V/propidium iodide (PI)

342

and submitted to FACS analysis. The ratio of apoptotic to healthy cells was found to

343

be significantly increased during the early period of heat stress compared with control

344

(11.9% versus 3.6%, respectively). Moreover, addition of a specific ERK1/2 inhibitor

345

(U0126) augmented heat stress-induced apoptosis to 85% of total cells, suggesting

346

ERK1/2 is vital for cellular survival during heat stress.

347

Heat stress affected growth factor mRNA expression and induced ERK1/2

348

activation

iew

ev

rR

ee

rP

Fo

ly

On

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 18 of 48

349

Heat stress results in a complex cellular response including alterations in gene

350

expression and biochemical adaptations [16]. It is now widely accepted that changes

351

in gene expression are an integral part of the cellular response to heat stress [17].

352

Furthermore, mRNA expression of the genes associated with the stress and defense

353

response, as well as cellular growth and proliferation, were significantly up- or

354

down-regulated after heat stress both in vivo (in the rat jejunum) and in vitro (in rat 18

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


Page 19 of 48

355

IEC-6 cells). Growth factors are a group of biologically active polypeptides which

356

function as hormone-like regulatory signaling molecules, controlling cell growth and

357

differentiation [18]. Growth factors are also reported to regulate and activate cellular

358

mitogenic and stress-associated signaling transduction pathways, leading to changes

359

in gene expression controlling various cellular functions [19]. In this study the mRNA

360

expression of many growth factors were significantly altered by heat stress, in both rat

361

jejunum and IEC-6 cells, including: Egfr, Ctgf, Fgfr2, Pdgfa, Tgif, Vegfa, Gdf15, and

362

Gdf9.

ee

rP

Fo

363

The epidermal growth factor receptor (EGFR) is activated by the phosphorylation

364

of specific amino acid residues in response to binding of ligands commonly associated

365

with cell proliferation (such as EGF, TGF-alpha and amphiregulin). Moreover,

366

exposure to a variety of nonspecific stimuli such as ionizing radiation, UV-radiation,

367

hypoxia and oxidative stress are also capable of activating EGFR [20]. Previous

368

studies have demonstrated that these nonspecific stimuli can induce gastric mucosal

369

damage, and that epidermal growth factors (EGF) were the most important peptides

370

for repairing gastric mucosal injury [21]. Recent research has supported these findings

371

and indicated that EGFR to be strongly associated with healing of damaged gastric

372

mucosa, repairing and regenerating the protective tissue [22]. However, the

373

mechanism underlying EGFR activation in response to heat stress is not fully

374

understood. We found EGFR mRNA expression to be down-regulated, both in

375

heat-stressed rat jejunum and IEC-6 cells, supporting our previous findings in

376

heat-stressed pig jejunum. The transforming growth factor-β (TGF-β) agents are

iew

ev

rR

ly

On

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

International Journal of Hyperthermia

19

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


International Journal of Hyperthermia

377

signaling polypeptides that regulate cell proliferation, differentiation, extracellular

378

matrix formation, and immune defense. Several TGF-β peptides also play important

379

roles in organogenesis and sculpting body shape [23]. Both Growth differentiation

380

factors 9 and 15 GDF-9 and GDF-15 are novel members of the TGF-β superfamily.

381

GDF-9 is known to be essential for normal ovarian folliculogenesis, as ovarian

382

follicles do not develop beyond the primary stage without the presence of GDF-9 [24].

383

GDF-15 is widely expressed in epithelial tissues and throughout the brain. Recently,

384

several reports have provided evidence for a functional association between GDF-15

385

and factors involved in tumorigenesis. GDF-15 has also been reported to provide

386

cardioprotection from ischemia/reperfusion injury [25]. Connective tissue growth

387

factor (CTGF) stimulates broad cellular responses including cell proliferation,

388

chemotaxis, adhesion, migration, and extracellular matrix (ECM) production. CTGF

389

expression is increased in response to elevated growth factors such as TGF-β and

390

endothelin-1 (ET-1), but also by environmental influences such as biomechanical

391

stress and hypoxia [26]. Fibroblast growth factors (FGF) are important regulatory

392

molecules controlling multiple cellular functions through activation of high affinity

393

cell surface FGF receptors (FGFR). FGF activation of FGFR-mediated signaling

394

pathways control cell growth, differentiation and survival. In adults, activation of

395

FGFRs is also reported to play an important role in the control of the nervous system,

396

in tissue repair, wound healing and in tumor angiogenesis [27]. Vascular endothelial

397

growth factor A (VEGFA) is the main angiogenic factor involved in vasculogenesis,

398

angiogenesis, and lymphangiogenesis during embryonic and postnatal development.

iew

ev

rR

ee

rP

Fo

ly

On

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 20 of 48

20

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


Page 21 of 48

399

VEGF has subsequently been implicated in a variety of functions in adult physiology

400

including ovarian angiogenesis, endochondral bone formation, tissue regeneration,

401

hematopoietic stem cell survival, regulation of erythropoietin levels, and pathological

402

processes such as neoplastic, hematologic, ocular, inflammatory, and ischemic

403

diseases. The expression and activity of VEGFA are modulated by several

404

mechanisms including hypoxia, oncogene and tumor suppressor dysregulation,

405

transcription factors, inflammatory mediators, and mechanical forces including shear

406

stress and cell stretching. VEGFA was also found to act as a pro-survival factor for

407

myocytes during ischemic injury [28]. We found VEGFA mRNA expression to be

408

significantly up-regulated both in vivo and in vitro upon microarray and real-time

409

PCR analysis. Platelet-derived growth factors (PDGFs) were originally identified in

410

platelets, however they are now know to be widely expressed in many tissue types.

411

PDGFs stimulate various cellular functions, including cell growth, proliferation, and

412

differentiation. PDGF-A has been demonstrated to have an important role in cell

413

repair following injury [29]. TGIF (TG-interacting factor) regulates activation of gene

414

expression via the Smad proteins, stimulated in response to transforming growth

415

factor β (TGFβ) signaling [30].

416

Inhibition of ERK1/2 phosphorylation augmented heat stress-induced cell

417

apoptosis and altered growth factor mRNA expression

iew

ev

rR

ee

rP

Fo

ly

On

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

International Journal of Hyperthermia

418

ERK1/2 is from the family of classical mitogen-activated protein kinases

419

(MAPK). All MAPKs are serine/threonine-specific protein kinases that respond to

420

extracellular stimuli and regulate various cellular activities, including gene expression, 21

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


International Journal of Hyperthermia

421

mitosis, cell differentiation, cell proliferation, cell survival and apoptosis [31]. The

422

ERK1/2 signaling pathway is preferentially activated in response to elevated growth

423

factor levels, and stress stimuli, such as cytokines, irradiation, heat stress, and osmotic

424

stress. In the present study, ERK1/2 phosphorylation was significantly elevated in rat

425

IEC-6 cells following heat stress. This increase in ERK1/2 activity was completely

426

inhibited by U0126, an ERK1/2 specific inhibitor. Inhibition of ERK1/2

427

phosphorylation during heat stress dramatically induced greater cell apoptosis (85%)

428

indicating cellular dependence on ERK1/2 signaling for cell protection and survival in

429

response to heat stress. Inhibiting ERK1/2 also altered growth factor mRNA

430

expression in cells exposed to heat stress, revealing ERK1/2 may provide a critical

431

regenerative role where heat stress-induced damage has occurred through activating

432

regulated cellular growth, proliferation and cellular differentiation.

ev

rR

ee

rP

Fo

433

In conclusion, the present study assessed the effects of heat stress on rat small

434

intestines in vivo and in IEC-6 cells in vitro. We revealed heat stress caused

435

significant morphological damage to rat intestines and IEC-6 cells, reduced cell

436

growth and proliferation viability, induced cell apoptosis, altered growth factor

437

mRNA expression and elevated ERK1/2 phosphorylation. Administering a specific

438

ERK1/2 inhibitor during heat stress exacerbated apoptosis and altered growth factor

439

mRNA expression. Therefore, we suggest the ERK1/2 signaling pathway provides

440

cellular protection and survival during heat stress, with growth factors also providing

441

a critical component for cell regeneration following heat stress-induced damage.

442

Further studies are required to support the current findings and advance our current

iew

ly

On

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 22 of 48

22

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


Page 23 of 48

443

knowledge into the mechanisms underlying heat stress-induced cellular damage and

444

repair/regeneration.

445

ACKNOWLEDGMENTS

446

We thank Professors Tongquan Yu, Kai Yang, Liu Yang and Ping Lu of the

447

Beijing Key Laboratory of New Technology in Agricultural Application for their

448

technical assistance.

iew

ev

rR

ee

rP

Fo

ly

On

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

International Journal of Hyperthermia

23

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


International Journal of Hyperthermia

449

REFERENCES

450

[1]Lisa R. Leon, David A. DuBose, Clifford W. Mason. Heat stress induces a biphasic

451

thermoregulatory response in mice. Am J Physiol Regul Integr Comp Physiol 2005; 288:

452

197-204.

453

[2]Gaskins, H. Intestinal defense mechanisms. Feed Mix 1997; 5(1):14-16.

454

[3] Yoshitake S, Noguchi T, Hoashi S, Honda N. Changes in intramucosal pH and gut blood flow

455

457

during whole body heating in a porcine model. Int J Hyperthermia 1998; 14: 285-291.

rP

456

Fo

[4]Kregel K.C., Wall P.T. and Gisolfi C.V. Peripheral vascular responses to hyperthermia in the rat. J Appl Physiol 1988; 64: 2582-2588.

ee

458

[5]Hall D.M., Buettner G.R. and Oberley L.W. Mechanisms of circulatory and intestinal barrier

459

dysfunction during whole body hyperthermia. Am J Physiol Heart Circ Physiol 2001; 280:

460

509-521.

rR

461

[6]Liu Fenghua, Yin Jingdong, Min Du, Yan Peishi, Xu Jianqin, Zhu Xiaoyu, Yu Jin. Heat stress

462

induced damage to pig small intestine epithelial tissue via down-regulation of epithelial

463

growth factor (egf) signaling. J. Anim Sci. 2009; 87:1941-1949.

465

iew

464

ev

[7]Ian A. McKay and Kenneth D. Brown. Growth factors and receptors. ISBN13: 9780199636464 Paperback, 288 pages Aug 1998.

466

[8]Maya Schuldiner, Ofra Yanuka, Joseph Itskovitz-Eldor, Douglas A. Melton, and Nissim

467

Benvenisty. Effects of eight growth factors on the differentiation of cells derived from human

468

embryonic stem cells. PNAS 2000; 97 (21): 11307-11312.

470

ly

469

On

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 24 of 48

[9]Eric C. C. Cheung and Ruth S. Slack emerging role for erk as a key regulator of neuronal apoptosis. Sci. STKE 2004; 2004(251): 1-4.

471

[10]Nicole H. Purcell, Benjamin J. Wilkins, Allen York, Marc K. Saba-El-Leil, Sylvain Meloche,

472

Jeffrey Robbins, and Jeffery D. Molkentin. Genetic inhibition of cardiac ERK1/2 promotes

473

stress-induced apoptosis and heart failure but has no effect on hypertrophy in vivo. Proc Natl

474

Acad. Sci. 2007; 104(35): 14074-14079.

475

[11]Wood S. R., Zhao Q., Smith L. H. and Daniel C. K. Altered morphology in cultured rat

24

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


Page 25 of 48

476

intestinal epithelial IEC-6 cells is associated with alkaline phosphatase expression. Tissue and

477

Cell 2003; 35(1): 47-58.

478 479

[12]Evans MD, Dizdaroglu M, Cooke MS. Oxidative DNA damage and disease: induction, repair and significance. Mutat Res. 2004; 567: 1-61.

480

[13]Larry A. Sonna, Jun Fujita, Stephen L. Gaffin, and Craig M. Lilly. Invited Review: Effects of

481

heat and cold stress on mammalian gene expression. J Appl Physiol 2002; 92: 1725-1742.

482

[14]Concordet J. P. and Ferry A. Physiological programmed cell death in thymocytes is induced by

483

Fo

physical stress (exercise). Am J Physiol Cell Physiol 1993; 265: 626–629.

484

[15]Chakrabort Sajal i, and Chakraborti Tapati. Oxidant-mediated activation of mitogen- activated

485

protein kinases and nuclear transcription factors in the cardiovascular system: a brief

486

overview. Cellular Signalling 1998; 10 (10): 675-683.

ee

rP

487

[16]Lindquist, S. The heat-shock response. Annu Rev. Biochem. 1986; 55: 1151-1191.

488

[17]Dietmar Kültz. Molecular and evolutionary basis of the cellular stress response. Annual

489 490

493 494

[18]Daniel J. Drucker. Glucagon-like peptides: regulators of cell proliferation, differentiation, and apoptosis. Molecular Endocrinology 17 (2): 161-171. [19]Rocio Foncea, Cristian Carvajal, Carolina Almarza and Federico Leighton. Endothelial cell

iew

492

Review of Physiology 2005; 67: 225-257.

ev

491

rR

oxidative stress and signal transduction. Biol. Res. 2000; 33( 2 ): 86-96. [20]Maurizio Alimandi,

Ling-Mei Wang,

Donald Bottaro,

Chong-Chou Lee1,

Angera Kuo,

495

Mark Frankel, Paolo Fedi, Careen Tang, Marc Lippman and Jacalyn H. Pierce. Epidermal

496

growth factor and betacellulin mediate signal transduction through co-expressed ErbB2 and

497

ErbB3 receptors. The EMBO Journal1997; 16: 5608-5617.

499

ly

498

On

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

International Journal of Hyperthermia

[21]Babyatsky M. Oral trefoil peptides protect against ethanol- and indomethacin-induced gastric injury in rats. Gastroenterology 1996; 110(2):489-497.

500

[22]Yang Zong-Bao, Jie Yan, Xiao-Ping Zou, Shou-Xiang Yi, Xiao-Rong Chang, Ya-Ping Lin,

501

Xi-Ping. Enhanced expression of epidermal growth factor receptor gene in gastric mucosal

502

cells by the serum derived from rats treated with electroacupuncture at stomach meridian

503

acupoints. World J Gastroenterol 2006; 12(34): 5557-5561.

504

[23]Martina Böttner, Martin Laaff, Birgit Schechinger, Gudrun Rappold, Klaus Unsicker and 25

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


International Journal of Hyperthermia

505

Clemens Suter-Crazzolara. Characterization of the rat, mouse, and human genes of

506

growth/differentiation factor-15/macrophage inhibiting cytokine-1 (GDF-15/MIC-1). Gene

507

1999; 237 (1): 105-111.

508 509

[24]Wu Xuemei and Martin M. Matzuk GDF-9 and BMP-15: Oocyte Organizers 2002; 3(1) 1389-9155.

510

[26]Fiona Furlong, John Crean, Laura Thornton, Ronan O'Leary, Madeline Murphy, and Finian

511

Martin. Dysregulated intracellular signaling impairs CTGF-stimulated responses in human

512

mesangial cells exposed to high extracellular glucose. Am J Physiol Renal Physiol 2007; 292

513

(6): 1691-1700.

rP

Fo

514

[25]Kelly J., M. Scott Lucia, J. Lambert. p53 controls prostate-derived factor/macrophage

515

inhibitory cytokine/NSAID-activated gene expression in response to cell density, DNA

516

damage and hypoxia through diverse mechanisms. Cancer Letters 277(1):38-47.

518 519

Receptors Science 2004; 306 (5701): 1506-1507. [28]Napoleone Ferrara.Vascular Endothelial Growth Factor: Basic Science and Clinical Progress.

ev

520

[27]Joseph Schlessinger. Common and distinct elements in cellular signaling via EGF and FGF.

rR

517

ee

Endocrine Reviews 2004; 25 (4): 581-611.

521

[29]Li Sheng-Hsiang, Robert Kuo-Kuang Lee, Peng-Wu Chen, Chung-Hao Lu, Shu-Huei Wang

522

and Yuh-Ming Hwu. Differential expression and distribution of alternatively spliced

523

transcripts of PDGF-A and of PDGF receptor-Îą in mouse reproductive tissues. Life Sciences

524

2005; 77 (19):2412-2424.

iew

On

525

[30]Laurent Bartholin, Tiffany A. Melhuish, Shannon E. Powers, Sophie Goddard-LĂŠon, Isabelle

526

Treilleux, Ann E. Sutherland, and David Wotton Maternal. Tgif is required for vascularization

527

of the embryonic placenta Dev Biol. 2008; 319 (2): 285-297.

ly

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 26 of 48

528

[31]Alison Hindley and Walter Kolch Extracellular signal regulated kinase (ERK)/mitogen

529

activated protein kinase (MAPK)-independent functions of Raf kinases. Journal of Cell

530

Science 2002; 115: 1575-1581.

26

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


Page 27 of 48

531

ILLUSTRATIONS

532

Figure 1- A: Rat rectal temperature before and after heat stress. Rat rectal temperatures were

533

significantly elevated following heat stress (P < 0.05). B: Cortisol concentrations from the

534

heat-stressed group were significantly higher than that of the control group on the 1st, 3rd and

535

6th day after heat stress. Cortisol concentration was greatest on the 3rd day before returning to

536

levels equal to the control group by the 10th day. C: The relative quantity of nucleic acid in each

537

sample calculated as the ratio of total nucleic acid concentration: β-actin. The expression of

538

Hsp70 in heat-stressed rat jejunum and IEC-6 cells was significantly higher than that of the

539

control group. Values represent the mean ± SE, n=6 rats for each group. *P < 0.05 for the

540

heat-stressed group vs. the control group.

541

Figure 2: Body surface temperature of rats before (Figure 2A) and after (Figure 2B) heat stress.

542

Rat shell body temperature increased from 25 ºC to 40ºC after 2 hours of heat stress.

543

Figure 3: Photomicrographs of hematoxylin and eosin-stained sections of rat small intestine

544

(200 X magnification). A: control; B and C: heat treatment (on the 3 day). Severe damage to rat

545

intestinal villi is apparent, with desquamation at the tips of the intestinal villi and the lamina

546

propria is exposed. Abnormal microstructures are indicated with arrowheads. Scale bar

547

represents 100 µm.

548

Figure 4: Hierarchical clustering of dysregulated genes conducted using GeneSpring GX.

549

Control groups comprise: CONTROL A, CONTROL B and CONTROL C. Heat-stressed

550

groups comprise: SJ G, SJ H, and SJ I. Red and green colors in the heat map represent

551

up-regulation and down-regulation relative to control, respectively.

552

Figure 5: pathway analysis of growth related gene expression which was conducted by

553

GeneSpring GX_10.

554

Figure 6: Relative mRNA expression of growth factors in rat jejunum. Analysis was performed

555

using microarray (N=3) and real-time PCR (N=6).

556

Figure 7: Cell proliferation and viability were measured by MTT analysis after IEC-6 cells were

557

submitted to 42 ºC for 2, 3, 4 and 5 h. Compared with the control group, cell proliferation and

558

viability were significantly reduced following heat stress for 3 h, 4 h, and 5 h, with no

559

significant difference at 2h. Photomicrographs of IEC-6 cells demonstrate gross cell

iew

ev

rR

ee

rP

Fo

ly

On

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

International Journal of Hyperthermia

27

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


International Journal of Hyperthermia

560

morphology (200 x magnification). A: control, B: heat stress (42 ºC for 3 h), C: application of a

561

selective ERK1/2 inhibitor (20 µmol/L U0126) and heat stress (42 ºC for 3 h).

562

Cell apoptosis analysis includes control (left), heat stressed (middle), and application of a

563

selective ERK1/2 inhibitor (20 µmol/L U0126) combined with heat stress at 42 ºC for 3 h

564

(right). Cell apoptosis was significantly increased after heat stress and was augmented by

565

addition of U0126.

566

Figure 8: Relative mRNA expression of growth factors in rat IEC-6 cells analyzed by real-time

567

PCR. Group protocols included: heat stress: exposure to 42ºC for 3h; U0126 + heat stress:

568

addition of ERK1/2 inhibitor U0126 and exposure to 42ºC for 3h (n=6).

569

Figure 9: ERK1/2 phosphorylation in IEC-6 cells was determined using western blotting.

570

Cells underwent the following protocols: control: cultivated in 37 ºC; heat stress: temperature

571

elevated to 42ºC for 3 h; inhibition group: application of a selective ERK1/2 inhibitor (20

572

µmol/L U0126) combined with heat stress (42ºC for 3 h). Heat stress significantly induced

573

ERK1/2 phosphorylation, which was reversible when U0126 was applied.

iew

ev

rR

ee

rP

Fo

ly

On

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 28 of 48

28

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


Page 29 of 48

Table1. Primers used for PCR Description

Accession

Primer Sequence

Product

Number β-actin

(bp)

NM_031144

Forward: TTGTCCCTGTATGCCTCTGG

218

Reverse: ATGTCACGCACGATTTCCC Hsp70

NM_031971

Forward: CGTGCCCGCCTACTTCA

280

Reverse: CACCAGCCGGTTGTCGA Alb Gdf15

NM_019216 NM_021672 NM_031836

Forward: TCTCGAGGACCTAGGTTGGA

320 197

Reverse: TAAGAACCACCGGGGTGTAG Forward: ACGCGTAAAACCACAGCAC

156

Reverse: ACACACTGGTCGTTGCCATA Forward: GATCATGCGGATCAAACCTCACC

ee

Vegfa

Forward: ACTGCCCTGTGTGGAAGAC Reverse: GAAGTCACCCATCACCGTC

rP

Gdf9

NM_134326

Fo

613

Reverse: CCTCCGGACCCAAAGTGCTC

Pdgfa

NM_012801

Forward: CAGTGTCAAGGTGGCCAAAGT

rR

176

Reverse: TGGTCTGGGTTCAGGTTGGA

Egfr

NM_031507

Forward: ACTTCACAATGAGGGTTTCAGG

186

Reverse: TCCTTGTTAACCAGTCATGCTCA

Ctgf

NM_022266

ev

Forward: AAATAAACTGCCTCCCAAACCA

91

Reverse: GAAATGGCTTGCTCAGGGTAAC Okl38

NM_138504

iew

Forward: TGCAGATCTGATGGTGAAAGGT

133

Reverse: AAGGTGGGAGCAGTAGCCATAG Fgfr2

XM_341940

Forward: GCCGCCGGTGTTAACACC

145

Reverse: CTGGCAGAACTGTCAACCA Tgif1

NM_001015020

On

Forward: GGAGTTGGGAGGAGAAGATCA Reverse: TTTGCACATGAGATTGCTCAAA

ly

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

International Journal of Hyperthermia

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu

185


International Journal of Hyperthermia

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47

Page 30 of 48

Table 2. Microarray analysis of the effects of heat stress on cell growth-related gene expression profiles in rat jejunum analyzed on the

Fo

3rd day following heat exposure.. ProbeName

Log2Ratio

Gene Response to Stress A_44_P350108

A_43_P11580

0.879317

1.883691

TTEST

0.004903

0.007395

GeneSymbol

rP Abcb11

Abcc2

Description

GenbankAccession

ATP-binding cassette,

ee

NM_031760

GO biological process response to oxidative stress; response to drug

sub-family B (MDR/TAP)

rR

ATP-binding cassette,

NM_012833

sub-family C

response to oxidative stress; response to heat; organic anion transport; homeostasis

ev

(CFTR/MRP), member 2 A_44_P254238

0.873018

0.002342

Bcl2l1

Bcl2-like 1 (Bcl2l1), transcript variant 3

A_44_P1047924

1.105177

0.000755

Herpud1

homocysteine-inducible, endoplasmic reticulum stress-inducible,

NM_001033670

iew NM_053523

ubiquitin-like domain member 1 A_44_P109342

7.46189

1.46E-05

Hspa1a

heat shock 70kD protein

NM_031971

1A (Hspa1a), mRNA 1.780141

0.003346

Hspa1l

heat shock 70kD protein

negative regulation of survival gene product activity protein modification process; calcium ion homeostasis;

On

response to stress; response to unfolded protein

ly

telomere maintenance; DNA repair; protein folding; anti-apoptosis; defense response; response to heat

[NM_031971] A_42_P541025

apoptosis; response to oxidative stress;

NM_212546

protein folding

NM_153629

response to unfolded protein; response to heat

1-like (mapped) (Hspa1l) A_42_P625181

0.459123

0.002354

Hspa4

heat shock protein 4 (Hspa4)

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


Page 31 of 48

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47

International Journal of Hyperthermia

A_44_P1049055

1.131631

0.00914

Hspa4l_predicted

PREDICTED:

heat shock 70kDa protein 4-like

protein folding; response to unfolded protein;

(predicted) (Hspa4l_predicted) A_44_P1054213

A_43_P12417

A_44_P992908

0.514916

1.830802

3.92618

Fo

Hspa5

9.72E-05

Hspa8

0.005248

0.002892

heat shock 70kDa

NM_013083

protein 5

rP

(glucose-regulated

Hspb1

protein) (Hspa5) NM_024351

heat shock protein 8

ee

1.4521

0.000187

Hspb8

protein folding; response to unfolded protein;

[NM_024351]

chaperone cofactor-dependent protein folding

rR

heat shock 27kDa

NM_031970

2.112075

0.000154

Hspca

ev

heat shock protein 1, alpha

A_44_P116130

1.604813

0.000445

Hspcb

heat shock 90kDa

response to unfolded protein NM_053612

protein folding

NM_175761

protein folding;

iew NM_001004082

protein 1 A_44_P287194

1.297766

0.000329

Hspcb

heat shock 90kDa

NM_001004082

protein 1 A_42_P651962

0.820161

4.9E-05

Hspd1

regulation of translational initiation; anti-apoptosis; cell motility;

heat shock 22kDa protein 8

A_44_P299870

regulation of progression through cell cycle;

(Hspa8), mRNA

protein 1

A_44_P134143

anti-apoptosis; ER overload response

heat shock protein 1

NM_022229

(chaperonin)

positive regulation of nitric oxide biosynthetic

On process

protein folding; response to unfolded protein

ly

protein folding; response to unfolded protein response to hypoxia; protein folding; response to unfolded protein; response to heat; response to organic substance

A_43_P11636

0.613808

0.000105

Hspe1

heat shock 10 kDa

NM_012966

protein folding; caspase activation

protein 1 (chaperonin 10)

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


International Journal of Hyperthermia

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47

A_44_P121374

3.759091

2E-05

Hsph1

heat shock

NM_001011901

105kDa/110kDa protein 1 A_43_P13337 A_44_P445344

A_44_P531758

2.120064 1.709525

1.20065

Fo 0.003865

0.000136

0.000549

Stip1

-1.05559

0.002451

stress-induced

NM_138911

response to stress

NM_024134

regulation of progression through cell cycle;

phosphoprotein 1 Ddit3

rP

DNA-damage inducible

Cryab

transcript 3

transcription response to DNA damage stimulus; response to oxidative stress; cell cycle;

ee

unfolded protein response

crystallin, alpha B

rR

NM_012935

Prkab1

protein kinase,

process;

ev

non-catalytic subunit Gene Related to Growth -2.00334

0.00158

Alb

protein folding; oxygen and reactive oxygen species metabolic

AMP-activated, beta 1

A_44_P1017367

response to unfolded protein; chaperone cofactor-dependent protein folding

(Cryab)

A_44_P1056161

Page 32 of 48

albumin

response to stress; response to heat NM_031976

iew NM_134326

response to stress; protein hetero oligomerization

On

transport;

transforming growth factor beta receptor signaling

pathway;

ly

cellular response to starvation; response to organic

substance A_44_P1013851

-0.60437

0.000238

Bmp2

bone morphogenetic protein 2

NM_017178

osteoblast differentiation; inflammatory response; transforming growth factor beta receptor signaling pathway; negative regulation of cell proliferation; organ morphogenesismineralization;growth

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


Page 33 of 48

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47

International Journal of Hyperthermia

A_44_P530813

-0.86667

0.008874

Casp3

caspase 3, apoptosis

NM_012922

B cell homeostasis;

related cysteine protease

release of cytochrome from mitochondria;

Fo A_42_P695401

-0.7451

0.008983

DNA fragmentation during apoptosis; induction of apoptosis; induction of apoptosis by oxidative stress; response

rP Ccl2

to UV; response to wounding

ee

chemokine (C-C motif)

NM_031530

positive regulation of endothelial cell proliferation;

ligand 2

protein amino acid phosphorylation;

rR

A_44_P507571

-0.79462

0.003609

Ccne1

calcium ion homeostasis; anti-apoptosis; transforming growth factor beta receptor signaling

ev

G1/S-specific cyclin-E1.

pathway;

iew

vascular endothelial growth factor receptor signaling pathway regulation of progression through cell cycle;

[Source:Uniprot/SWISSPROT;Acc:P39949]

G1/S transition of mitotic cell cycle; cell cycle

On

DNA replication initiation; protein amino acid

phosphorylation; cell growth

A_42_P703647

1.290115

0.009738

Cda_predicted

PREDICTED:

cytidine deaminase (predicted)

(Cda_predicted)

ly

cell surface receptor linked signal transduction;

pyrimidine salvage; cytidine deamination; negative regulation of cell growth

A_44_P555253

1.834412

0.000447

Dnaja1

DnaJ (Hsp40) homolog,

NM_022934

subfamily A A_44_P346408

-0.64866

0.004886

Egfr

epidermal growth factor receptor

protein folding; response to unfolded protein; DNA damage response

NM_031507

activation of MAPKK activity; cell morphogenesis; ossification; response to stress;

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


International Journal of Hyperthermia

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47

Page 34 of 48

epidermal growth factor receptor signaling pathway; cell proliferation activity A_43_P10225

A_43_P16529

A_42_P608780

-0.41388

0.729708

2.278219

Fo 0.002691

0.002458

0.000801

Fgfr2

rP

PREDICTED:

Gadd45b

Gdf15

XM_341940

fibroblast growth factor

positive regulation of cell proliferation;

receptor 2

fibroblast growth factor receptor signaling pathway; cell growth; epithelial cell proliferation NM_001008321

growth arrest and

ee

1.413789

0.000663

activation of MAPK activity; apoptosis;

45 beta

response to stress

rR

growth differentiation

Gdf9

NM_019216

-0.57157

0.001065

Igfbp3

ev

insulin-like growth

factor binding protein 3 A_44_P501112

-1.28625

0.001266

Mmp9

matrix metallopeptidase

cell-cell signaling NM_021672

iew NM_012588

NM_031055

9 A_44_P529581

2.227634

0.007915

Okl38

0.969926

0.009512

Pdgfa

transforming growth factor beta receptor signaling pathway regulation of cell growth; positive regulation of apoptosis

On

response to oxidative stress; cell growth;

positive regulation of apoptosis

pregnancy-induced

NM_138504

growth inhibitor A_44_P322910

transforming growth factor beta receptor signaling pathway;

growth differentiation factor 9

A_42_P627998

regulation of progression through cell cycle;

DNA-damage-inducible

factor 15

A_43_P12097

angiogenesis; cell-cell signaling;

platelet derived growth

NM_012801

factor, alpha

negative regulation of cell growth

ly

regulation cell cycle; angiogenesis; response to hypoxia; cell proliferation; transforming growth factor beta receptor signaling pathway

A_44_P432432

0.825118

0.00612

Plat

plasminogen activator,

NM_013151

protein modification process; proteolysis

tissue

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


Page 35 of 48

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47

International Journal of Hyperthermia

A_44_P262229

0.818628

0.000619

Ppid

peptidylprolyl isomerase

NM_001004279

D (cyclophilin D) A_43_P12708

A_44_P157222 A_43_P15572

0.637728

0.529511 1.016927

Fo 0.001747

0.004265 0.004957

Src

stress

Rous sarcoma oncogene

NM_031977

intracellular signaling cascade; cell proliferation

rP Tgif

Vegfa

apoptosis; positive regulation of cell adhesion; platelet-derived growth factor receptor signaling

ee

pathway

TG interacting factor

rR

NM_001015020

2.89E-05

Xrn2_predicted

vascular endothelial

PREDICTED: (predicted)

multicellular organismal development; negative regulation of cell growth

NM_031836

ev

regulation of progression through cell cycle; angiogenesis; blood vessel development;

iew

-0.86238

response to acid; response to stress; epidermal growth factor receptor signaling pathway;

growth factor A

A_44_P1026431

protein folding; anti-apoptosis; response to oxidative

5'-3' exoribonuclease 2

vasculogenesis; response to hypoxia; anti-apoptosis; positive regulation of vascular endothelial growth factor receptor

On

signaling pathway cell growth

ly

Note: Genes which expressions were up- or down-regulated at least two-fold. Genes are categorized based on their biological process.

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


International Journal of Hyperthermia

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47

Page 36 of 48

Figure 1. Rectal temperature, serum cortisol concentration and Hsp70 expression before and after heat stress in rats

Fo

rP

ee

rR

ev

iew

On

ly

Figure 1-A

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


Page 37 of 48

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47

International Journal of Hyperthermia

Fo

rP

ee

rR

ev

iew

On

ly

Figure 1-B

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


International Journal of Hyperthermia

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47

Page 38 of 48

Fo

rP

ee

rR

ev

iew

On

ly

Figure 1-C

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


Page 39 of 48

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47

International Journal of Hyperthermia

Figure 2 Body surface temperatures

Fo

rP

ee

rR

ev

iew

Name

Avg Temperature

Min Temperature

Control

33.6°C

25.1°C

37.4°C

On

1.28

0.91

Heat stress

35.2°C

28.4°C

39.6°C

1.62

0.91

Max

Standard Deviation

ly

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu

Emissivity


International Journal of Hyperthermia

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47

Page 40 of 48

Figure 3. Morphological changes in the rat small intestine

Fo

rP

ee

rR

ev

iew

On

ly

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


Page 41 of 48

Figure 4. Hierarchical clustering of genes related to cellular growth revealing altered expression

iew

ev

rR

ee

rP

Fo ly

On

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

International Journal of Hyperthermia

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


International Journal of Hyperthermia

Figure 5. Gene pathways known to be associated with cellular growth

iew

ev

rR

ee

rP

Fo ly

On

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

Page 42 of 48

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


Page 43 of 48

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47

International Journal of Hyperthermia

Figure 6. Relative mRNA expression levels of specific growth factors measured from rat jejunum 7.0

Fo

6.0

rP

5.0 4.0

ee

3.0 2.0 1.0

Alb 0.0 -1.0

Egfr

Ctgf

rR

Fgfr2

ev Tgif

iew

-2.0 -3.0

Pdgfa

Vegfa

Gdf9

On

ly

-4.0 -5.0 -6.0 -7.0

Microarray

Realâ&#x20AC;?time

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu

Okl38

Gdf15


International Journal of Hyperthermia

Figure 7. The role of ERK1/2 signaling in response to heat stress in IEC-6 cells

0.6

0.5

Fo

rP

ee

*

*

*

rR

0.4 OD (570 nm)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47

Page 44 of 48

ev

0.3

iew

0.2

0.1

On

ly

0 Control

2h

3h

4h

Figure 7-A

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu

5h


Page 45 of 48

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47

International Journal of Hyperthermia

Fo

rP

ee

rR

ev

iew

Figure 7-B

On

ly

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


International Journal of Hyperthermia

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47

Page 46 of 48

Fo

rP

ee

rR

ev

iew

Figure 7-C  

On

ly

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu


Page 47 of 48

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47

International Journal of Hyperthermia

Figure 8. Relative expression levels of growth factors measured in rat IEC-6 cells 8.0

Fo

7.0 6.0

*

rP

5.0

ee

4.0 3.0

*

2.0 1.0

Alb

Egfr

Ctgf

0.0

Fgfr2

-1.0 -2.0 -3.0

*

*

rR Tgif

ev

*

-4.0 -5.0

Pdgfa

Vegfa

iew

Okl38

*

On

ly

-6.0 -7.0 -8.0 -9.0

Gdf-9

*

Heat stress

U0126+Heat stress

-10.0

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu

Gdf15


International Journal of Hyperthermia

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47

Page 48 of 48

Figure F 9. Phosphorylation leveels of ERK1/2 in n IEC-6 cells

Fo

rP

ee

rR

ev

iew

On

ly Â

URL: http://mc.manuscriptcentral.com/thth E-mail: dewhi002@mc.duke.edu

erk12  

Date Submitted by the Author: 19-Sep-2009 Physiological effects of hyperthermia (i.e., perfusion effects, hypoxia, pH, metabolism, microenvi...

Read more
Read more
Similar to
Popular now
Just for you