Page 1

ARTICLE IN PRESS

CBA-08890; No of Pages 10

Comparative Biochemistry and Physiology, Part A xxx (2010) xxx–xxx

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part A j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / c b p a

Effect of heat stress on the porcine small intestine: A morphological and gene expression study Jin Yu a, Peng Yin b, Fenghua Liu a,c,⁎, Guilin Cheng a,c, Kaijun Guo a, An Lu a, Xiaoyu Zhu b, Weili Luan a, Jianqin Xu b,⁎ a b c

Department of Animal Science and Technology, Beijing University of Agriculture, Beijing 102206, PR China College of Veterinary Medicine, China Agricultural University, Beijing 100193, PR China Beijing Key Laboratory of TCVM, Beijing University of Agriculture, Beijing 102206, PR China

a r t i c l e

i n f o

Article history: Received 26 November 2009 Received in revised form 13 January 2010 Accepted 14 January 2010 Available online xxxx Keywords: Heat stress Morphology Gene expression Electron microscope Microarray Small intestine Pig

a b s t r a c t With the presence of global warming, the occurrence of extreme heat is becoming more common, especially during the summer, increasing pig susceptibility to severe heat stress. The aim of the current study was to investigate changes in morphology and gene expression in the pig small intestine in response to heat stress. Forty eight Chinese experimental mini pigs (Sus scrofa) were subjected to 40 °C for 5 h each day for 10 successive days. Pigs were euthanized at 1, 3, 6, and 10 days after heat treatment and sections of the small intestine epithelial tissue were excised for morphological examination and microarray analyses. After heat treatment, the pig rectal temperature, the body surface temperature and serum cortisol levels were all significantly increased. The duodenum and jejunum displayed significant damage, most severe after 3 days of treatment. Microarray analysis found 93 genes to be upregulated and 110 genes to be down-regulated in response to heat stress. Subsequent bioinformatic analysis (including gene ontology and KEGG pathway analysis) revealed the genes altered in response to heat stress related to unfolded protein, regulation of translation initiation, regulation of cell proliferation, cell migration and antioxidant regulation. Heat stress caused significant damage to the pig small intestine and altered gene expression in the pig jejunum. The results of the bioinformatic analysis from the present study will be beneficial to further investigate the underlying mechanisms involved in heat stress-induced damage in the pig small intestine. Crown Copyright © 2010 Published by Elsevier Inc. All rights reserved.

1. Introduction With the presence of global warming, heat stress is now a primary factor influencing animal health and growth, especially during the summer months (Leon et al., 2005). Across the United States heat stress is estimated to be responsible for a loss of between $1.69 and $2.36 billion to livestock industries (St-Pierre et al., 2003). The gastrointestinal (GI) tract of the pig possesses a large surface area, providing a regulatory barrier to which the pig is exposed to a large assortment of nutrients, microbes and exogenous toxins. The intestine permits the exchange of beneficial nutrients into the systemic circulation, while simultaneously preventing penetration of pathogenic organisms and toxic compounds (Cario et al., 2002; Hirata et al., 2007). Thus, maintaining the integrity of the epithelium lining the gastrointestinal tract is of great importance, ensuring its absorptive and protective functions are not compromised (Leon et al., 2005). Extreme heat stress can damage the pig gastrointestinal tract epithelium resulting in low animal yield and performance, as well as increasing morbidity and mortality (Liu et al., 2009).

To investigate the effect of heat stress on the porcine small intestine, the current study placed Chinese mini pigs in an artificial climate chamber for 10 days, simulating the surge in the heat experienced during summer. Morphological changes in the porcine small intestine were examined by light and electron microscopes. Gene expression profiling by DNA microarray has recently been established, enabling the comparison of thousands of genes simultaneously (Trevino et al., 2007). This method was employed to ascertain whole gene expression profiles of the pig small intestine using an Affymetrix DNA microarray. We executed a gene ontology analysis (including molecular function, biological processes, cellular components and KEGG pathway) on genes displaying a differential expression between treatments, providing insight into the potential mechanisms underlying heat stressinduced injury in the pig small intestine.

2. Materials and methods 2.1. Animals

⁎ Corresponding authors. Liu is to be contacted at No. 7, Beinong Road, Beijing, 102206, PR China. Tel./fax: +86 10 80794699. Xu, No. 2, Yuanmingyuan West Road, Beijing, 100193, PR China. Tel.: +86 10 62733017; fax: +86 10 62734111. E-mail addresses: liufenghua1209@126.com (F. Liu), jianqinxucau@126.com (J. Xu).

All experimental protocols were approved by the Committee for the Care and Use of Experimental Animals at Beijing University of Agriculture.

1095-6433/$ – see front matter. Crown Copyright © 2010 Published by Elsevier Inc. All rights reserved. doi:10.1016/j.cbpa.2010.01.008

Please cite this article as: Yu, J., et al., Effect of heat stress on the porcine small intestine: A morphological and gene expression study, Comp. Biochem. Physiol. A (2010), doi:10.1016/j.cbpa.2010.01.008


ARTICLE IN PRESS 2

J. Yu et al. / Comparative Biochemistry and Physiology, Part A xxx (2010) xxx–xxx

Forty eight male, two-month old Chinese mini pigs (body mass 7.6 ± 0.5 kg) were purchased from the Changping Experimental Pig Farm, Chinese Agricultural University. Pigs were randomly assigned to either control or heat treated groups (24 pigs per treatment group) accounting for body weight and litter origin. The two groups were raised in an artificial climate chamber (light, 7:00–19:00 h, humidity 60%) with free access to food and water. Routine immunizations were performed. 2.2. Treatments and sampling Both control and heat treated groups were initially housed for five days at 23 °C. Animals in the heat treated group were then subjected to 40 °C for 5 h, from 04:00 to 09:00 h, before the temperature was lowered back to 26 °C. Heat-treated animals underwent this protocol for ten consecutive days, while control animals were maintained at 23 °C only. Rectal and body surface temperatures were detected before and after each exposure using infrared and contact thermometers (Fluke 561, USA). Six pigs were randomly selected from each group at 1, 3, 6 and 10 days. Pigs were electrically stunned using a head-only electric stun tong (Xingye Butchery Machinery Co. Ltd, Changde, Hunan Province, PR China) and subsequently exsanguinated. Blood samples were collected and centrifuged at 3000 g for 10 min, and the sera stored at − 20 °C until required. Sections of the duodenum, jejunum and ileum were rapidly excised and washed with physiological saline. All intestinal segments were divided into three parts: 1) a 1 cm length section was fixed in 10% neutral formalin for paraffin embedding; 2) a 1 mm2 sample was fixed in 4% glutaraldehyde for electron microscopy; 3) a 3 cm length section was minced and separated into three sample tubes, snap frozen in liquid nitrogen and stored at −80 °C until required. 2.3. Morphological examination and serum cortisol analysis Formalin-fixed samples were embedded in paraffin and sectioned in transverse (5 μm thick). After deparaffinization and dehydration, the sections of the duodenum, jejunum and ileum were stained with hematoxylin and eosin. The structure of the mucosa was observed using a BH2 Olympus microscope (Olympus, Tokyo, Japan) and analyzed using an image analysis system (Olympus 6.0, Tokyo, Japan). Using 40× magnification, Villi height and crypt depth of at least five well-oriented villi were measured and recorded. Intestinal epithelial cells were examined by electron microscopy. Small pieces of the intestine were fixed for 1 h in 4% glutaraldehyde in 0.1-M cacodylate buffer (pH 7.4). Tissue sections were then washed in the same buffer and fixed for 1 h in cold 1% osmium tetroxide in cacodylate buffer. After dehydration in graded ethanol solutions, the preparations were embedded in Araldite (EPON 812, Emicron, Shanghai, China). Ultra-thin sections were stained with saturated uranyl acetate in 50% ethanol and lead citrate, and examined by transmission electron microscopy (JEM, 1230, JEOL, Tokyo, Japan). Serum cortisol concentration was determined using an I125 cortisol radioimmunoassay kit, according to the manufacturer's instructions (Beijing Chemclin Biotech Co., Ltd, China).

Table 1 The villus height and crypt depth of the pig small intestine. Day

Duodenum

Jejunum

Ileum

1 3 6 10 1 3 6 10 1 3 6 10

Villus height(μm)

Crypt depth (μm)

Control

Heat treatment

Control

Heat treatment

328.0 ± 16.2 331.1 ± 14.7 329.2 ± 16.8 327.0 ± 17.5 331.7 ± 13.4 337.0 ± 18.6 332.0 ± 13.5 333.4 ± 20.3 298.8 ± 22.7 305.7 ± 17.1 301.2 ± 15.8 308.5 ± 18.3.

299.1 ± 16.4* 295.7 ± 15.7* 297.5 ± 9.7* 317.5 ± 17.1 261.3 ± 17.5** 261.8 ± 14.3*** 297.3 ± 13.6** 317.2 ± 16.8 289.0 ± 19.4 276.4 ± 16.0** 296.2 ± 20.3 292.0 ± 14.2

206.8 ± 18.6 213.0 ± 17.3 203.2 ± 17.2 211.5 ± 20.5 208.2 ± 17.0 203.4 ± 15.6 212.7 ± 20.2 209.6 ± 14.5 202.3 ± 18.4 204.5 ± 15.8 205.8 ± 21.5 201.0 ± 20.4

208.0 ± 23.7 192.8 ± 16.3 193.2 ± 19.2 208.8 ± 15.1 174.6 ± 12.1** 165.2 ± 16.3** 186.0 ± 20.6 196.0 ± 18.8 182.7 ± 18.5 180.7 ± 19.1 178.2 ± 20.4 203.0 ± 17.2

Notice: Different from control,*P < 0.05, **P < 0.01, ***P < 0.001. Values are means ± SE, n = 6.

procedure was performed based on manufacturer's instructions (Promega, USA); in brief, 70 °C for 5 min followed by 42 °C for 2 h. The RT products (cDNA) were then stored at − 20 °C for PCR. 2.5. DNA microarray 2.5.1. RNA extraction and target labeling Total RNA was isolated from the pig jejunum by TRIzol reagent (Invitrogen Life Technologies, P/N 15596-018) and an RNeasy Mini Kit (QIAGEN, P/N 74104) according to the manufacturer's instructions. RNA integrity of each sample was documented using a RNA 6000 LabChip Kit and an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA). RNA was only processed when it had a 28 S/18 S rRNA ratio of ≥1.8. RNA was purified using a QIAGEN RNeasy® Mini Kit (#74106, QIAGEN) and amplified using a Low RNA Input Linear Amplification kit (#5184-3523, Agilent, USA). Each RNA sample was annealed with a primer containing polydT and T7 polymerase promoters. Reverse transcriptase produced single and double-stranded cDNAs. T7 RNA polymerase then created cRNA from the double-stranded cDNA by incorporating cyanine-3-labeled cytidine 5-triphosphate. The quality of the labeled cRNA was again verified and the absolute concentration determined by spectrophotometry (ND1000, Nanodrop). 2.5.2. Hybridization, scanning and feature extraction The cRNA was hybridized to arrays; equal amounts of cRNA were hybridized using a Gene Expression Hybridization Kit (#5188-5242, Agilent, USA). Hybridization was performed at 60 °C for 17 h on Affymetrix Whole Porcine Genome Arrays (#ATH1-121501, Affymetrix,

2.4. Total RNA isolation and reverse transcription (RT) Total RNA was isolated from the pig small intestine using a phenol and guanidine isothiocyanate-based TRIzol reagent (Invitrogen, USA.) according to the manufacturer's instructions. The concentration and purity of isolated RNA was assessed by a spectrophotometry (SmartSpec plus, BIO-RAD, USA) based on the OD260/OD280 ratio. Total RNA was reverse transcribed as follows: 2.0 μg RNA isolated from each tissue sample was added to 25 μL reaction solution containing 2.0 μL oligo-dT18, 5.0 μL dNTPs, 1.0 μL RNase inhibitor, 1.0 μL M-MLV transcriptase, 5.0 μL M-MLV RT reaction buffer (Promega, USA) and RNase-free water. The reverse-transcription

Fig. 1. Pig rectal temperature before (B) and after (A) heat treatment (5 h at 40 °C). Pig rectal temperature was significantly elevated following heat treatment (P < 0.05). Values represent the mean ± SE, n = 6 pigs for each group. *P < 0.05 before versus after heat stress.

Please cite this article as: Yu, J., et al., Effect of heat stress on the porcine small intestine: A morphological and gene expression study, Comp. Biochem. Physiol. A (2010), doi:10.1016/j.cbpa.2010.01.008


ARTICLE IN PRESS J. Yu et al. / Comparative Biochemistry and Physiology, Part A xxx (2010) xxx–xxx

3

Fig. 2. Pig body surface temperature before (B) and after (A) heat stress. Body surface temperature was significantly increased after heat treatment (40 °C for 5 h). Values represent the mean ± SE, n = 6 pigs for each group. *P < 0.05 before versus after heat stress.

USA). Arrays were washed using a Gene Expression Wash Buffer Kit (#5188-5327, Agilent) before the stabilization and drying solution was applied (#5185-5979, Agilent). Arrays were scanned on a Microarray

Fig. 3. Heat-induced changes in serum corticosterone levels. Cortisol levels of heatstressed animals were significantly higher than control animals on the 1st, 3rd, 6th and 10th day after initial heat stress. Values represent the mean ± SE, n = 6 pigs for each group. *P < 0.05 heat-stressed versus control.

Scanner (Affymetrix® GeneChip® Scanner 3000, USA) and the data compiled with the Affymetrix Feature Extraction Software (Affymetrix GeneChip Operating Software Version 1.4). The processes involving initial RNA amplification through to the final output data were all performed by a private contractor (CapitalBio Co., Ltd, China).

2.5.3. Microarray data analysis Array normalization and error detection analysis were carried out using Affymetrix GeneChip Operating Software Version 1.4 (Affymetrix). First, values of poor intensity and low dependability were removed using a “filter on flags” feature, where standardized software algorithms determined which spots were “present”, “marginal”, or “absent.” Spots were considered “present” only where the output was uniform, not saturated, and significant above background. Spots that satisfied the main requirements but were calculated to be outliers relative to the typical values for the other genes were considered “marginal.” Filters were set to retain only the values that were found to be present or marginal for further analysis. Data were normalized by the algorithms supplied with the feature extraction software. After normalization, one final quality-control filter was applied, where genes showing excessive biological variability were discarded. Bioinformatic analysis including molecular function, biological processes, cellular components and KEGG pathway were conducted using a Molecule Annotation System (http:// bioinfo.capitalbio.com/mas/).

Please cite this article as: Yu, J., et al., Effect of heat stress on the porcine small intestine: A morphological and gene expression study, Comp. Biochem. Physiol. A (2010), doi:10.1016/j.cbpa.2010.01.008


ARTICLE IN PRESS 4

J. Yu et al. / Comparative Biochemistry and Physiology, Part A xxx (2010) xxx–xxx

Fig. 4. Photomicrographs of hematoxylin- and eosin-stained sections of the pig small intestine from heat treated and control animals after 3 days of treatment (200× magnification). A and B) Control and heat treated duodenums, respectively; C and D) control and heat treated jejunums respectively; E and F) control and heat treated ileums, respectively. Severe damage to the intestinal villi is apparent, with desquamation at the tips of the intestinal villi and exposure of the lamina propria. Abnormal microstructures are indicated with arrowheads. Scale bar 100 μm.

2.6. Validation of HSP90, HSP70, HSP27, EGF and EGFR mRNA in the pig jejunum by real-time PCR Expression of HSP70, HSP90, HSP27, EGF and EGFR were quantitatively determined using real-time PCR. Quantitative PCR analysis was carried out using the DNA Engine Mx3000P® fluorescence detection system against a double-stranded DNA-specific fluorescent dye (Stratagene, USA) according to optimized PCR protocols. β-actin was amplified in parallel with the target genes providing a control. The cDNA was subjected to real-time RT-PCR using the primer pairs listed in Table 1. The PCR reaction system (20 μL) contained 10 μL of SYBR Green qPCR mix, 0.3 μL of reference dye, 1 μL of each primer (both 10 μmol/L), and 1 μL of cDNA template. Cycling conditions were 94 °C for 5 min, followed by 40 cycles of 94 °C for 30 s, 56 °C for 30 s and 72 °C for 40 s. Dissociation began with a step of 95 °C for 1 min,

and then the melting curve from 55 to 95 °C at 0.2 °C/s was monitored continuously by measuring fluorescence. Expression levels were determined using the threshold cycle (CT) method as described by the manufacturer of the detection system. This method was applied to each gene by calculating the expression 2− ΔΔCT, where ΔΔCT is the sum of: [CTgene − CTβ-actin](Heat-stressed) − [CTgene − CTβ-actin](Control).

2.7. Statistical analysis All results are presented as the mean ± SD. Statistical analysis was performed by independent-sample T-tests using SPSS 12.0. A P-value of < 0.05 was considered significant. Microarray analysis was conducted using a Molecule Annotation System (http://bioinfo. capitalbio.com/mas/).

Please cite this article as: Yu, J., et al., Effect of heat stress on the porcine small intestine: A morphological and gene expression study, Comp. Biochem. Physiol. A (2010), doi:10.1016/j.cbpa.2010.01.008


ARTICLE IN PRESS J. Yu et al. / Comparative Biochemistry and Physiology, Part A xxx (2010) xxx–xxx Table 2 List of the differentially expressed genes. Probe set ID

Fold change Representative public ID Gene title

Ssc.15939.1.A1_x_at 90.24 Ssc.22483.1.A1_at 44.96 Ssc.15988.1.S1_at 6.41 Ssc.11197.1.S1_at 5.22 Ssc.12191.3.A1_at 5.04 RPTR-Ssc-ECOLOXL_at 4.41 Ssc.22953.1.A1_at 4.25 Ssc.114.1.S1_at 4.15 Ssc.12191.2.A1_at 4.12 Ssc.18563.1.A1_at 4.01 Ssc.4617.1.S1_at 3.72 Ssc.268.1.S1_at 3.48 Ssc.428.10.A1_at 3.43 Ssc.5145.1.S1_a_at 3.26 Ssc.13780.11.S1_x_at 2.63 Ssc.14511.1.S1_at 2.49 Ssc.15947.1.A1_at 2.44 Ssc.26799.1.S1_at 2.39 Ssc.496.1.S1_at 2.39 Ssc.286.1.S1_s_at 2.38 Ssc.23513.1.S1_at 2.37 Ssc.23287.1.A1_at 2.35 Ssc.23986.1.S1_at 2.35 Ssc.15885.1.S1_at 2.34 Ssc.18554.1.S1_x_at 2.30 Ssc.13769.1.S1_at 2.27 Ssc.16335.1.S2_at 2.26 Ssc.12072.1.S1_a_at 2.25 Ssc.3968.1.S1_at 2.23 RPTR-Ssc-ECOLOXL_x_at 2.21 Ssc.17799.1.A1_at 2.12 Ssc.27304.1.S1_at 2.11 Ssc.18773.1.A1_at 2.09 Ssc.21.1.S1_s_at 2.06 Ssc.21283.1.S1_at 2.01 Ssc.24.1.S1_at 2.01 Ssc.10974.1.S1_at − 2.00 Ssc.16234.1.A1_at − 2.01 Ssc.26113.2.S1_at −2.07 Ssc.315.1.S1_at −2.09 Ssc.206.1.S1_at −2.11 Ssc.29175.1.A1_at −2.13 Ssc.18553.1.S1_at −2.13 Ssc.16051.1.S1_at − 2.16 Ssc.10654.1.A1_at − 2.20 Ssc.203.1.S1_at − 2.21 Ssc.22959.1.S1_at − 2.21 Ssc.26321.1.S1_s_at − 2.23 Ssc.10015.1.A1_at − 2.27 RPTR-Ssc-AF292560-1_s_at − 2.30 Ssc.17770.1.S1_at − 2.30 Ssc.710.1.S1_at − 2.32 Ssc.11267.1.S1_at −2.33 Ssc.15949.1.A1_at −2.35 Ssc.11791.1.S1_at −2.38 Ssc.14073.2.S1_at −2.39 Ssc.26326.1.A1_at −2.44 Ssc.714.1.S1_at −2.45 Ssc.14551.1.S1_at −2.52 Ssc.11171.1.S1_at −2.73 Ssc.15996.1.S1_at −2.87 Ssc.55.1.S1_at −3.01 Ssc.15949.1.S1_at −3.20 Ssc.87.1.S1_at −3.37 Ssc.14073.1.S1_at −3.38 Ssc.29911.1.A1_at −3.43 Ssc.16213.1.S1_x_at − 3.45 Ssc.5204.1.S1_at − 3.46 Ssc.645.1.S1_at − 3.47 Ssc.18948.1.S1_at −4.06 Ssc.15995.2.S1_at − 4.68 Ssc.16212.1.S1_x_at − 5.14 Ssc.16203.1.S1_x_at −8.70 Ssc.16169.1.S1_x_at − 9.74 Ssc.27875.1.A1_at −29.12

AF248302.1 CF795103 NM_213818.1 CK461732 BQ604703 RPTR-Ssc-ECOLOXL BX671488 X68213.1 BQ600020 U15459.1 NM_214394.1 NM_214075.1 AB087975.1 NM_213766.1 AB105382.1 Y15010.1 AF248278.1 CN166265 AJ236927.1 NM_213817.1 BP168084 BX672495 CK451737 NM_213804.1 AB105380.1 M81327.1 X62984.1 BI181608 NM_213947.1 RPTR-Ssc-ECOLOXL AB087930.1 BI327092 CF363138 AF319661.1 BI118474 NM_001001535.1 NM_213931.1 CB472702 BX914409 NM_214108.1 NM_214420.1 CO951217 AB105383.1 AJ681165 BQ597543 NM_214422.1 BX676168 U35733.1 CK465404 RPTR-Ssc-AF292560-1 AF334739.1 M31496.1 NM_214413.1 AF248274.1 NM_213967.1 AJ683636 AB052266.1 NM_214235.1 NM_213906.1 CN167008 AJ399510.1 NM_214007.1 AF248274.1 NM_214020.1 CN159960 CO939399 L36579.1 CK463412 NM_213859.1 CB475095 AF233358.1 L36575.1 Z81295.1 CB338040 CO988835

Clone PVA3A Ig heavy chain variable VDJ region Transcribed locus Elafin family member protein Heat shock protein 27 kDa 90-kDa heat shock protein (hsp90) – – Heat shock protein 72 (pot.) mRNA 90-kDa heat shock protein (hsp90) Clone pvg7a Ig heavy chain variable VDJ region Vitamin D3 25-hydroxylase 25-hydroxyvitamin D3-24-hydroxylase T-cell receptor alpha chain mRNA C-region, 3′ end of cds Heat shock protein 70.2 MHC class I PD7 mRNA, partial 3′ UTR CMP-N-acetylneuraminate monooxygenase Clone 6 immunoglobulin heavy chain Clone Clu_10353.scr.msk.p1.Contig1, mRNA sequence Hypothetical protein (5′; clone 2C2) Inflammatory response protein 6 MRNA, clone:THY010204E06, expressed in thymus – MRNA, clone:SPL010080F09, expressed in spleen RNA helicase SLA-1 mRNA for MHC class I antigen, partial cds, allele:SLA-1*02 Lactoferrin Lipoprotein lipase MRNA, clone:UTR010033A11, expressed in uterus Epididymal secretory protein E4 – TCR-a mRNA for T-cell receptor alpha chain, partial cds, clone:PPA151 Thymosin beta-4 (LOC733606), mRNA Clone rski0137_l13.y1.abd, mRNA sequence RNA helicase MRNA, clone:LVRM10044E04, expressed in liver Muscle-specific intermediate filament desmin Arachidonate 12-lipoxygenase Haptocorrin MRNA, clone:LNG010058C07, expressed in lung Dipeptidase Cytochrome P450 2C49 MHC class I PD7 mRNA, partial 3′ UTR SLA-2 mRNA for MHC class I antigen, partial cds, allele:SLA-2*03 Cellular disintegrin precursor MRNA, clone:PBL010089E08, expressed in peripheral blood mononuclear cell cytochrome P450 3A39 MRNA, clone:LVR010098C08, expressed in liver Cytochrome P450 2C34 /// cytochrome P450 2C35 /// cytochrome P450 2C36 /// cytochrome P450 2C49 Vascular endothelial growth factor – Clone 2-4 immunoglobulin kappa light chain VJ region Secretin Cytochrome P450 2B22 Clone 2 immunoglobulin heavy chain Scavenger receptor class B member 1 MRNA, clone:LVRM10122H12, expressed in liver Cytochrome P450 3A46 Motilin Amelogenin 173A MRNA, clone:THY010088A06, expressed in thymus Apolipoprotein B (apoB gene), editing region Epidermal growth factor receptor Clone 2 immunoglobulin heavy chain Epidermal growth factor MRNA, clone:LVRM10122H12, expressed in liver MRNA, clone:TCH010025F03, expressed in trachea MHC class II SLA-DRB2-2D mRNA, exon 2 Clone rnco1933b_j2.y1.abd, mRNA sequence Stefin A1 Serum amyloid A2 (LOC733603), mRNA Slow delayed rectifier K+ channel MHC class II SLA-DRB2-2D mRNA, exon 2 /// MHC class II SLA-DRB2-2A mRNA, exon 2 Hn-RNA, clone h5155 – Transcribed locus

Please cite this article as: Yu, J., et al., Effect of heat stress on the porcine small intestine: A morphological and gene expression study, Comp. Biochem. Physiol. A (2010), doi:10.1016/j.cbpa.2010.01.008

5


ARTICLE IN PRESS 6

J. Yu et al. / Comparative Biochemistry and Physiology, Part A xxx (2010) xxx–xxx

Fig. 5. Morphological alterations in the ultrastructure of the porcine jejunal epithelium following 3 days of heat treatment (50,000× magnification). A and B) control jejunum; C and D) heat treated jejunum. Microvillus height was significantly shorter in the heat treated jejunum compared with the control (2013 ± 18 nm versus 2232 ± 30 nm, respectively). Three days of heat treatment caused the internal cristae of mitochondria to become swollen and shortened, increased the number of mitochondria and secondary lysosomes present, as well as alter tight junction morphology (indicated by arrows).

3. Results

3.2. Morphological analysis

3.1. Rectal temperature, body surface temperature and serum cortisol concentration

Heat treatment clearly caused marked damage to the pig small intestine, found to be most severe in the jejunum after 3 days of heat treatment. Desquamation of mucosal epithelium was exhibited at the tips of the intestinal villi, exposing the lamina propria (Fig. 4). Villi height and crypt depth was shorter in the heat treatment group compared to control animals (Table 2), most evident in the jejunum after 3 days of heat treatment.

Pig rectal and body surface temperatures were significantly elevated after 5 h of chronic heat exposure (Figs. 1 and 2). Serum cortisol concentration of heat treated pigs was also significantly higher than that of the control group (Fig. 3).

Please cite this article as: Yu, J., et al., Effect of heat stress on the porcine small intestine: A morphological and gene expression study, Comp. Biochem. Physiol. A (2010), doi:10.1016/j.cbpa.2010.01.008


ARTICLE IN PRESS J. Yu et al. / Comparative Biochemistry and Physiology, Part A xxx (2010) xxx–xxx Table 3 Primers used for real-time PCR. Description

7

Table 5 Biological process analysis result of the differentially expressed genes.

Accession number

Primer sequence

Product (bp)

β-actin

NM_031144

HSP70

M29506

HSP90

NM_213973

HSP27

NM_001007518

EGF

NM_214020

EGFR

NM_214007

Forward: TTGTCCCTGTATGCCTCTGG Reverse: ATGTCACGCACGATTTCCC Forward: GTGGCTCTACCCGCATCCC Reverse: GCACAGCAGCACCATAGGC Forward: CGCTGAGAAAGTGACCGTTATC Reverse: ACCTTTGTTCCACGACCCATAG Forward: AGGAGCGGCAGGATGAG Reverse: GGACAGGGAGGAGGAGAC Forward : CAGTAACCTGGGAATGTGGC Reverse : GGGCTGTATGGGCAAAGTAT Forward : GCCTTAGCCGTCTTATCCAA Reverse : TGGGCACAGATGACTTTGGT

218 114 126 101 231 299

Ultrastructure examination of the pig jejuna epithelium on day 3 revealed that microvilli height in heat-stressed pigs was significantly shorter than the control (2232 nm ± 30 versus 2013 ± 28 nm, P < 0.05). Jejunal epithelium exhibited an increased number of mitochondria with shortened internal cristae, increased organelle debris within the lysosomes, and enterocyte tight junction morphology was found to be altered (Fig. 5). 3.3. Microarray and bioinformatic analysis Gene expression profiling in the pig jejunum at day 3 was performed using cDNA microarrays. 93 genes were found to be significantly up-regulated and 110 genes down-regulated (T-test P < 0.01 and fold change ≥ 2.0) in the heat treated group compared to the control. Some of the significant genes are listed in Table 3. To further characterize the types of genes altered in response to heat stress, the 203 genes that were significantly altered in response to heat stress (P < 0.01) were classified into gene ontology (GO) slim terms. GO slim assigns high level terms from each of the three major gene ontologies: molecular function, biological processes and cellular components. Molecular function analysis (Table 4) showed GO 0003779 (actin binding), GO 0004497 (monooxygenase activity), GO 0003743

Table 4 Molecular function analysis result of the differentially expressed genes. Molecular function

Total P-value

Q value

GO:0003779 actin binding GO:0004497 monooxygenase activity GO:0003743 translation initiation factor activity GO:0030338 CMP-N-acetylneuraminate monooxygenase a.. GO:0005506 iron ion binding GO:0016712 oxidoreductase activity, acting on pair.. GO:0048503 GPI anchor binding GO:0008199 ferric iron binding GO:0020037 heme binding GO:0004465 lipoprotein lipase activity GO:0015087 cobalt ion transporter activity GO:0004000 adenosine deaminase activity GO:0050897 cobalt ion binding GO:0019239 deaminase activity GO:0005249 voltage-gated potassium channel activit.. GO:0004613 phosphoenolpyruvate carboxykinase (GTP).. GO:0004611 phosphoenolpyruvate carboxykinase activ.. GO:0005006 epidermal growth factor receptor activi..

1 6 1 1

1.6E-5 2.0E-5 3.12E-4 0.001223

1.0E-5 1.2E-5 1.94E-4 7.49E-4

9 6 1 1 6 1 1 1 1 1 1

0.003643 0.006979 0.008528 0.010594 0.010996 0.013369 0.024175 0.031314 0.032498 0.038400 0.039577

0.002207 0.004098 0.004987 0.006184 0.006364 0.007678 0.013770 0.017815 0.018467 0.021795 0.022423

1

0.040751 0.023034

1

0.044267 0.024978

1

0.046603 0.026265

Biological process

Total P-value

Q value

GO:0006986 response to unfolded protein GO:0030334 regulation of cell migration GO:0006457 protein folding GO:0006413 translational initiation GO:0006118 electron transport GO:0006879 iron ion homeostasis GO:0006826 iron ion transport GO:0007173 epidermal growth factor receptor signal.. GO:0006824 cobalt ion transport GO:0046327 glycerol biosynthesis from pyruvate GO:0050730 regulation of peptidyl-tyrosine phospho.. GO:0048595 eye morphogenesis (sensu Mammalia) GO:0050679 positive regulation of epithelial cell .. GO:0009168 purine ribonucleoside monophosphate bio.. GO:0030324 lung development GO:0006813 potassium ion transport GO:0046685 response to arsenic GO:0045187 regulation of circadian sleep/wake cycl.. GO:0008293 torso signaling pathway GO:0007098 centrosome cycle GO:0008595 determination of anterior/posterior axi.. GO:0046777 protein amino acid autophosphorylation GO:0009408 response to heat GO:0048754 branching morphogenesis of a tube GO:0030855 epithelial cell differentiation GO:0007465 R7 cell fate commitment GO:0008284 positive regulation of cell proliferati.. GO:0042462 eye photoreceptor cell development GO:0006811 ion transport GO:0006983 ER overload response GO:0018108 peptidyl-tyrosine phosphorylation GO:0007229 integrin-mediated signaling pathway GO:0007498 mesoderm development GO:0009615 response to virus GO:0007169 transmembrane receptor protein tyrosine GO:0045103 intermediate filament-based process GO:0016042 lipid catabolism GO:0051084 posttranslational protein folding GO:0051085 chaperone cofactor-dependent protein fo.. GO:0001525 angiogenesis GO:0008360 regulation of cell shape GO:0048514 blood vessel morphogenesis GO:0006094 gluconeogenesis GO:0001568 blood vessel development GO:0006163 purine nucleotide metabolism GO:0007010 cytoskeleton organization and biogenesi.. GO:0007283 spermatogenesis GO:0007015 actin filament organization GO:0015671 oxygen transport GO:0009117 nucleotide metabolism GO:0019882 antigen processing and presentation GO:0016477 cell migration GO:0006468 protein amino acid phosphorylation GO:0002474 antigen processing and presentation of .. GO:0019886 antigen processing and presentation of .. GO:0019884 antigen processing and presentation of .. GO:0006916 anti-apoptosis GO:0008283 cell proliferation GO:0007517 muscle development GO:0006461 protein complex assembly GO:0007155 cell adhesion GO:0006629 lipid metabolism GO:0006955 immune response GO:0048002 antigen processing and presentation of .. GO:0006952 defense response GO:0007166 cell surface receptor linked signal tra.. GO:0000074 regulation of progression through cell .. GO:0000902 cell morphogenesis GO:0006950 response to stress GO:0007165 signal transduction GO:0006810 transport GO:0007275 development GO:0030154 cell differentiation

5 1 5 1 8 1 1 2 1 1 2 1 1 1

0.000000 0.000000 0.000000 5.85E-4 0.005031 0.014016 0.020764 0.020980 0.039577 0.040751 0.080068 0.135553 0.149207 0.156470

0.000000 0.000000 0.000000 3.6E-4 0.002991 0.008035 0.011876 0.011971 0.022423 0.023034 0.045047 0.075778 0.083314 0.087219

1 1 2 2 2 2 2 1 3 1 1 2 2 1 3 1 1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 1 2 2 1 1 4 1 1 1 1 1 1 2 1 2 1 2 3 1 3 1 2 1 3 1 3 1 1

0.195823 0.219127 0.354286 0.355078 0.410344 0.413952 0.431667 0.433061 0.453834 0.471393 0.487382 0.548343 0.566955 0.575281 0.580626 0.580990 0.585094 0.637633 0.642068 0.662201 0.719917 0.727416 0.793788 0.807103 0.807103 0.844462 0.853074 0.879798 0.889246 0.905634 0.917381 0.921234 0.923033 0.929363 0.972912 0.975677 0.979551 0.990376 0.990849 0.991021 0.994540 0.994894 0.996809 0.996921 0.996928 0.997131 0.997700 0.998455 0.999731 0.999958 0.999970 0.999976 0.999987 0.999997 1.000000 1.000000 1.000000 1.000000 1.000000

0.108404 0.121097 0.194676 0.194889 0.222943 0.224650 0.234001 0.234494 0.245055 0.254110 0.262437 0.294277 0.303760 0.307708 0.308711 0.308711 0.310550 0.330093 0.332033 0.334293 0.334293 0.334293 0.364448 0.366878 0.366878 0.379772 0.383288 0.383943 0.383943 0.383943 0.383943 0.383943 0.383943 0.383943 0.383943 0.383943 0.383943 0.383943 0.383943 0.383943 0.383943 0.383943 0.383943 0.383943 0.383943 0.383943 0.383943 0.383943 0.383943 0.383943 0.383943 0.383943 0.383943 0.383943 0.383943 0.383943 0.383943 0.383943 0.383943

Please cite this article as: Yu, J., et al., Effect of heat stress on the porcine small intestine: A morphological and gene expression study, Comp. Biochem. Physiol. A (2010), doi:10.1016/j.cbpa.2010.01.008


ARTICLE IN PRESS 8

J. Yu et al. / Comparative Biochemistry and Physiology, Part A xxx (2010) xxx–xxx

4. Discussion

Table 6 Cellular component analysis result of the differentially expressed genes. Cellular component

Total P-value

GO:0043292 contractile fiber 2 GO:0005626 insoluble fraction 2 GO:0005625 soluble fraction 1 GO:0005634 nucleus 3 GO:0005886 plasma membrane 3 GO:0030018 Z disc 2 GO:0030018 Z disc 2 GO:0016599 caveolar membrane 1 GO:0000299 integral to membrane of membrane fracti.. 1 GO:0030139 endocytic vesicle 1 GO:0042627 chylomicron 1 GO:0005792 microsome 5 GO:0016323 basolateral plasma membrane 1 GO:0005788 endoplasmic reticulum lumen 1 GO:0016282 eukaryotic 43S preinitiation complex 1 GO:0042612 MHC class I protein complex 3 GO:0030424 axon 1 GO:0005887 integral to plasma membrane 2 GO:0005813 centrosome 2 GO:0005737 cytoplasm 7 GO:0005882 intermediate filament 1 GO:0005856 cytoskeleton 3 GO:0031965 nuclear membrane 1 GO:0005783 endoplasmic reticulum 6 GO:0005769 early endosome 1 GO:0042613 MHC class II protein complex 1 GO:0005771 multivesicular body 1 GO:0005768 endosome 1 GO:0005794 Golgi apparatus 1 GO:0005615 extracellular space 6 GO:0009897 external side of plasma membrane 1 GO:0005840 ribosome 1 GO:0005829 cytosol 4 GO:0005622 intracellular 2 GO:0005576 extracellular region 2 GO:0016020 membrane 13 GO:0005739 mitochondrion 3 GO:0016021 integral to membrane 6

0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.15647 0.157502 0.191872 0.360593 0.365918 0.524407 0.578923 0.623782 0.695154 0.710077 0.711398 0.711859 0.723935 0.799071 0.811586 0.834532 0.920480 0.933790 0.977664 0.993076 0.998888 0.999398 0.999960 0.999975 0.999979 0.999998 1.000000 1.000000 1.000000 1.000000 1.000000

Q value 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.087219 0.087643 0.106400 0.197692 0.200044 0.281745 0.308711 0.324663 0.334293 0.334293 0.334293 0.334293 0.334293 0.366526 0.366878 0.376006 0.383943 0.383943 0.383943 0.383943 0.383943 0.383943 0.383943 0.383943 0.383943 0.383943 0.383943 0.383943 0.383943 0.383943 0.383943

(translation initiation factor activity), GO 0030338 (CMP-N-acetylneuraminate monooxygenase), GO 0005506 (iron ion binding), GO 0016712 (oxidoreductase activity), and GO 0048503 (GPI anchor binding). Biological processes analysis (Table 5) showed GO 0006986 (response to unfolded protein), GO 0030334 (regulation of cell migration), GO 0006457 (protein folding), GO 0006413 (translational initiation), and GO 0006118 (electron transport). Cellular component analysis (Table 6) showed GO 0043292 (contractile fiber), GO 0005626 (insoluble fraction), GO 0005625 (soluble fraction), GO 0005634 (nucleus), GO 0005886 (plasma membrane), and GO 0030018 (Z disc). To define the biological pathways associated with heat stress in the pig jejunum, analysis of microarray data was conducted by a Molecule Annotation System (http://bioinfo.capitalbio.com/mas/). A KEGG pathway analysis revealed linoleic acid metabolism, MAPK signaling, metabolism of xenobiotics by cytochrome P450, arachidonic acid metabolism, as well as changes in gap junction and focal adhesion molecules were all involved in response to heat stress (Table 7, P < 0.01). 3.4. Real-time PCR HSP70, HSP90 and HSP27 mRNA expression was significantly upregulated, while EGF and EGFR mRNA expression was significantly down-regulated in the pig jejunum after heat exposure. Heat-induced changes in gene expression closely correlated with the corresponding microarray data, although the exact fold change differed between the two assays (Fig. 6).

4.1. Assessment of heat stress In mammals, rectal temperature is used as the best assessment of heat stress (Srikandakumar et al., 2003; Sinha, 2008). Glucocorticoids are critical for environmental adaptation, with increased levels of serum cortisol revealing the occurrence of a stress response (Elez et al., 2000; Mahmoud et al., 2004; Pace et al., 2008). In the present study, pig rectal temperature and serum cortisol levels were significantly increased after 5 h of heat stress, consistent with previous reports (Figs. 1 and 2). Pig body surface temperature was also found to be significantly elevated after 5 h of heat stress which is rarely reported in heat stress studies (Fig. 3). It is now well documented that a strong correlation exists between peripheral blood flow and body surface temperature (Hardy and Soderstrom, 1938). Heat stress causes an increase in peripheral blood flow, allowing increased heat dissipation at the skin, observed by an elevated body surface temperature (Marai et al., 2007). 4.2. Heat stress causes marked injury to the pig small intestine When pigs are exposed to environmental temperatures greater than their thermoneutral temperature, compensatory mechanisms are activated to protect vital organs and dissipate internal heat at the body surface, while reducing blood flow to the GI tract (Kregel et al., 1988; Rowell, 1974). However, shunting of blood flow from the GI tract to the periphery can result in intestinal cellular hypoxia (Hall et al., 2001), ATP depletion, acidosis and cellular dysfunction, resulting in necrosis and shedding of intestinal epithelial cells (Gisolfi, 2000). In our morphological study, we found that heat treatment caused marked damage to the tips of the intestinal villi, inducing epithelial cell shedding, exposing the intestinal mucosa lamina propria, as well as shortening villus height and crypt depth in the small intestine. Intestinal damage was found to be most severe in the jejunum after 3 days of heat treatment (Fig. 4). Ultrastructure examination revealed that the jejunum microvillus height was shorter, mitochondria were swollen, the number of lysosomes was increased and the enterocyte tight junction structure was altered after 3 days of heat treatment (Fig. 5). Mitochondrial swelling is a hallmark of mitochondrial damage, potentially caused by an increase in reactive oxygen species stimulated in response to heat stress (Heise et al., 2003; Hua et al., 2007). The increased number of lysosomes may indicate an increase in the amount of denatured protein and damaged organelles (Sonna et al., 2002). 4.3. Heat stress significantly alters the gene expression profile of the pig jejunum Heat stress triggers a complex cellular response including altering gene expression (Sonna et al., 2002; Kültz, 2005). To gain insight into the molecular mechanisms by which heat stress exerts its complex biological effects, we performed microarray analysis to assess changes in gene expression levels in response to heat stress. The results of microarray found 93 genes to be up-regulated and 110 genes downregulated in the pig jejunum after 3 days of heat stress (Table 3). To further characterize the types of genes altered, we classified the 203 genes into gene ontology (GO) slim terms (Tables 4, 5 and 6). Gene ontology analysis revealed that heat stress alters genes regulating unfolded proteins, the initiation of translation, cell proliferation and cell migration in the pig jejunum. Under conditions of heat stress, denaturation and misaggregation of protein is rapidly increased, which triggers an unfolded protein response. This response characteristically includes an increase in HSP expression (Sonna et al., 2002; Keller et al., 2008; Young et al., 2009). The current study determined HSP70, HSP90 and HSP27 expression were all significantly up-

Please cite this article as: Yu, J., et al., Effect of heat stress on the porcine small intestine: A morphological and gene expression study, Comp. Biochem. Physiol. A (2010), doi:10.1016/j.cbpa.2010.01.008


ARTICLE IN PRESS J. Yu et al. / Comparative Biochemistry and Physiology, Part A xxx (2010) xxx–xxx

9

Table 7 Pathway analysis result of the differentially expressed genes. KEGG

Total

P-value

Q value gene

Linoleic acid metabolism

4

7.8E-5

1.17E-4

MAPK signaling pathway

4

2.98E-4

1.63E-4

Metabolism of xenobiotics by cytochrome P450

4

6.02E-4

2.01E-4

Arachidonic acid metabolism

4

0.002249

5.39E-4

Gap junction

2

0.002606

5.39E-4

Focal adhesion

3

0.004329

7.64E-4

Antigen processing and presentation

3

0.014765

0.002272

Regulation of actin cytoskeleton

2

0.026589

0.00371

Gamma-hexachlorocyclohexane degradation Alzheimer's disease Glycerolipid metabolism mTOR signaling pathway Cell communication VEGF signaling pathway Adherens junction Cytokine–cytokine receptor interaction

1 1 1 1 1 1 1 2

0.040242 0.053302 0.066189 0.066189 0.066189 0.091454 0.103836 0.180692

0.005249 0.006663 0.007637 0.007637 0.007637 0.009799 0.010742 0.017773

Calcium signaling pathway Neuroactive ligand-receptor interaction

1 1

0.338208 0.587815

0.031707 0.053438

regulated after heat stress, consistent with previous reports. Altering gene expression is an integral part of the cellular response to heat stress as this regulates protein translation, and hence cellular function. Heat stress can affect gene transcription via three mechan-

Fig. 6. mRNA expression of HSP90, HSP70, HSP27, EGF and EGFR in the pig jejunum using real-time PCR.

CYP3A39 CYP2C49 ALOX15 EGFR Hsp27 HSP70.2 EGF CYP2B22 CYP3A39 CYP2C49 CYP2B22 CYP2C49 ALOX15 EGFR EGF EGFR VEGFA EGF HSP90 HSP70.2 EGFR EGF CYP3A39 LPL LPL VEGFA LOC396725 Hsp27 EGFR EGFR EGF EGFR MLN

Input symbol

Experiment 1

Ssc.203.1.S1_at Ssc.206.1.S1_at; Ssc.26321.1.S1_s_at Ssc.10974.1.S1_at Ssc.55.1.S1_at Ssc.11197.1.S1_at Ssc.5145.1.S1_a_at Ssc.87.1.S1_at Ssc.11267.1.S1_at Ssc.203.1.S1_at Ssc.206.1.S1_at; Ssc.26321.1.S1_s_at Ssc.11267.1.S1_at Ssc.206.1.S1_at; Ssc.26321.1.S1_s_at Ssc.10974.1.S1_at Ssc.55.1.S1_at Ssc.87.1.S1_at Ssc.55.1.S1_at Ssc.10015.1.A1_at Ssc.87.1.S1_at Ssc.12191.3.A1_at; Ssc.12191.2.A1_at Ssc.5145.1.S1_a_at Ssc.55.1.S1_at Ssc.87.1.S1_at Ssc.203.1.S1_at Ssc.16335.1.S2_at Ssc.16335.1.S2_at Ssc.10015.1.A1_at Ssc.24.1.S1_at Ssc.11197.1.S1_at Ssc.55.1.S1_at Ssc.55.1.S1_at Ssc.87.1.S1_at Ssc.55.1.S1_at Ssc.714.1.S1_at

− 2.21 − 2.23 − 2.0 − 3.01 5.22 3.26 − 3.37 −2.33 −2.21 − 2.23 − 2.33 − 2.23 − 2.0 − 3.01 − 3.37 − 3.01 − 2.27 − 3.37 5.04 3.26 −3.01 −3.37 − 2.21 2.26 2.26 −2.27 2.01 5.22 − 3.01 −3.01 −3.37 − 3.01 − 2.45

isms: 1) alter the level of transcription factors; 2) adjust the activity of transcription factors; and 3) change the cellular location of transcription factors (Sonna et al., 2002; Hahn et al., 2004). In the current study, genes relating to the regulation of translation were found to be significantly altered following heat treatment, in agreement with previous reports. We recently reported that heat stress-induced damage to the pig small intestine epithelial tissue was rapidly repaired within the following few days following heat stress (Liu et al., 2009). The regeneration of the damaged intestine epithelium encourages crypt cell proliferation and migration (Kaushik and Kaur, 2005). Consistent with rapid cellular regeneration, the current study found that the expression of genes related to the regulation of cell proliferation and migration was significantly altered after heat stress. Furthermore, the changes in gene expression following heat stress provided significant insight into the potential biological pathways activated or inhibited in response to heat stress (Table 7) in the pig small intestine. Pathway analysis of genes altered following heat treatment revealed linoleic acid metabolism, MAPK signaling, metabolism of xenobiotics by cytochrome P450 and arachidonic acid metabolism to be involved in the response to heat stress. Linoleic and arachidonic acid are essential for tissue growth and development, and play a critical role in intestinal epithelial cell differentiation and tumor development (Hui et al., 1999; Kawajiri et al., 2002). Metabolism of arachidonic and linoleic acid via prostaglandin H synthases and lipoxygenases generate an array of lipid compounds which serve as potent mediators of several physiological and pathophysiological processes (Zeldin, 2001). Our results found heat stress to stimulate genes regulating arachidonic acid metabolism, potentially in response to oxidative stress in order to alleviate the stress response.

Please cite this article as: Yu, J., et al., Effect of heat stress on the porcine small intestine: A morphological and gene expression study, Comp. Biochem. Physiol. A (2010), doi:10.1016/j.cbpa.2010.01.008


ARTICLE IN PRESS 10

J. Yu et al. / Comparative Biochemistry and Physiology, Part A xxx (2010) xxx–xxx

Mitogen-activated protein kinase (MAPK) signaling pathways are important downstream targets of activated growth factor receptors (such as EGFR and PDGFR) involved in mediating the intracellular response to extracellular stimuli. In mammals, three primary MAPKs exist including extracellular signal-regulated protein kinase (ERK), c-Jun NH2-terminal kinase (JNK), and p38 MAPK (Anderson, 2006). MAPKs are activated in response to extracellular stresses including UV radiation, osmotic shock, heat shock and lipopolysaccharides, in addition to activation by endogenous factors including growth cytokines, autacoids and neurotransmitters (Muthusamy and Piva, 2010). MAPK signaling regulates a wide range of intracellular activity, including gene expression, cell differentiation, cell proliferation, cell survival and apoptosis (Sompallae et al., 2008). We previously reported that heat stress significantly injured the pig small intestine epithelial tissue, and this tissue was rapidly repaired within a few days. Based on our gene expression analysis, we suggest that heat stress-induced alterations in MAPK signaling may regulate the repair and regeneration of the damaged intestinal epithelium by encouraging crypt cell proliferation and migration. In conclusion, the present study investigated the effect of heat stress on morphology and gene expression in the porcine small intestine. Heat stress was found to cause significant morphological damage to the epithelium of the pig small intestine. Gene expression profiling analysis revealed 203 genes to be differentially expressed in response to heat stress. Subsequent bioinformatic analysis of the differentially expressed genes provides significant insight into the potential mechanisms underlying heat stress-induced damage as well as repair/regeneration in porcine small intestines. Acknowledgments We are thankful for the help from the members of CAU-BUA TCVM teaching and research team. This work was supported by grants from the National Natural Science Foundation of China (No. 30771566), the Beijing Education Committee Programs of Academic Innovation Team, Beijing Natural Science Foundation (No. 6082007) and the National Eleventh Five-Year Scientific and Technological Support Plan (No. 2008BADB4B01, 2008BADB4B07). References Anderson, D.H., 2006. Role of lipids in the MAPK signaling pathway. Prog. Lipid Res. 45, 102–119. Cario, E., Gerken, G., Podolsky, D.K., 2002. "For whom the bell tolls!" — innate defense mechanisms and survival strategies of the intestinal epithelium against lumenal pathogens. Z. Gastroenterol. 40, 983–990. Elez, D., Vidovic, S., Matic, G., 2000. The influence of hyperthermic stress on the redox state of glucocorticoid receptor. Stress 3, 247–255. Gisolfi, C.V., 2000. Is the GI system built for exercise? News Physiol. Sci. 15, 114–119. Hahn, J.S., Hu, Z., Thiele, D.J., Iyer, V.R., 2004. Genome-wide analysis of the biology of stress responses through heat shock transcription factor. Mol. Cell. Biol. 24, 5249–5256. Hall, D.M., Buettner, G.R., Oberley, L.W., Xu, L., Matthes, R.D., Gisolfi, C.V., 2001. Mechanisms of circulatory and intestinal barrier dysfunction during whole body hyperthermia. Am. J. Physiol. 280, H509–H521.

Hardy, J.D., Soderstrom, G.F., 1938. Heat loss from the nude body and peripheral blood flow at temperatures of 22 °C to 35 °C: two figures. J. Nutr. 16, 493–510. Heise, K., Puntarulo, S., Pörtner, H.O., Abele, D., 2003. Production of reactive oxygen species by isolated mitochondria of the Antarctic bivalve Laternula elliptica (King and Broderip) under heat stress. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 134, 79–90. Hirata, Y., Broquet, A.H., Menchen, L., Kagnoff, M.F., 2007. Activation of innate immune defense mechanisms by signaling through RIG-I/IPS-1 in intestinal epithelial cells. J. Immunol. 179, 5425–5432. Hua, G., Zhang, Q., Fan, Z., 2007. Heat shock protein 75 (TRAP1) antagonizes reactive oxygen species generation and protects cells from granzyme M-mediated apoptosis. J. Biol. Chem. 282, 20553–20560. Hui, R., Kameda, H., Risinger, J.I., Angerman-Stewart, J., Han, B., Barrett, J.C., Eling, T.E., Glasgow, W.C., 1999. The linoleic acid metabolite, 13-HpODE augments the phosphorylation of EGF receptor and SHP-2 leading to their increased association. Prostaglandins Leukot. Essent. Fatty Acids 61, 137–143. Kaushik, S., Kaur, J., 2005. Effect of chronic cold stress on intestinal epithelial cell proliferation and inflammation in rats. Stress 8, 191–197. Kawajiri, H., Hsi, L.C., Kamitani, H., Ikawa, H., Geller, M., Ward, T., Eling, T.E., Glasgow, W.C., 2002. Arachidonic and linoleic acid metabolism in mouse intestinal tissue: evidence for novel lipoxygenase activity. Arch. Biochem. Biophys. 398, 51–60. Keller, J.M., Escara-Wilke, J.F., Keller, E.T., 2008. Heat stress-induced heat shock protein 70 expression is dependent on ERK activation in zebrafish (Danio rerio) cells. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 150, 307–314. Kregel, K.C., Wall, P.T., Gisolfi, C.V., 1988. Peripheral vascular responses to hyperthermia in the rat. J. Appl. Physiol. 64, 2582–2588. Kültz, D., 2005. Molecular and evolutionary basis of the cellular stress response. Annu. Rev. Physiol. 67, 225–257. Leon, L.R., DuBose, D.A., Mason, C.W., 2005. Heat stress induces a biphasic thermoregulatory response in mice. Am. J. Physiol. 288, R197–R204. Liu, F., Yin, J., Du, M., Yan, P., Xu, J., Zhu, X., Yu, J., 2009. Heat-stress-induced damage to porcine small intestinal epithelium associated with downregulation of epithelial growth factor signaling. J. Anim. Sci. 87, 1941–1949. Mahmoud, K.Z., Edens, F.W., Eisen, E.J., Havenstein, G.B., 2004. Ascorbic acid decreases heat shock protein 70 and plasma corticosterone response in broilers (Gallus gallus domesticus) subjected to cyclic heat stress. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 137, 35–42. Marai, I.F.M., El-Darawany, A.A., Fadiel, A., Abdel-Hafez, M.A.M., 2007. Physiological traits as affected by heat stress in sheep. A review. Small Rumin. Res. 71, 1–12. Muthusamy, V., Piva, T.J., 2010. The UV response of the skin: a review of the MAPK, NFkappaB and TNFalpha signal transduction pathways. Arch. Dermatol. Res. 302 (1), 5–17. Pace, T.W., Gaylord, R.I., Jarvis, E., Girotti, M., Spencer, R.L., 2008. Differential glucocorticoid effects on stress-induced gene expression in the paraventricular nucleus of the hypothalamus and ACTH secretion in the rat. Stress 12, 400–411. Rowell, L.B., 1974. Human cardiovascular adjustments to exercise and thermal stress. Physiol. Rev. 54, 75–159. Sinha, R.K., 2008. Serotonin synthesis inhibition by pre-treatment of p-CPA alters sleepelectrophysiology in an animal model of acute and chronic heat stress. J. Therm. Biol. 33, 261–273. Sompallae, R., Stavropoulou, V., Houde, M., Masucci, M.G., 2008. The MAPK Signaling Cascade is a central hub in the regulation of cell cycle, apoptosis and cytoskeleton remodeling by tripeptidyl-peptidase II. Gene Regul. Syst. Biol. 2, 253–265. Sonna, L.A., Fujita, J., Gaffin, S.L., Lilly, C.M., 2002. Invited review: effects of heat and cold stress on mammalian gene expression. J. Appl. Physiol. 92, 1725–1742. Srikandakumar, A., Johnson, E.H., Mahgoub, O., 2003. Effect of heat stress on respiratory rate, rectal temperature and blood chemistry in Omani and Australian Merino sheep. Small Rumin. Res. 49, 193–198. St-Pierre, N.R., Cobanov, B., Schnitkey, G., 2003. Economic losses from heat stress by US livestock industries. J. Dairy Sci. 86, E52–E77. Trevino, V., Falciani, F., Barrera-Saldana, H.A., 2007. DNA microarrays: a powerful genomic tool for biomedical and clinical research. Mol. Med. 13, 527–541. Young, J.T., Gauley, J., Heikkila, J.J., 2009. Simultaneous exposure of Xenopus A6 kidney epithelial cells to concurrent mild sodium arsenite and heat stress results in enhanced hsp30 and hsp70 gene expression and the acquisition of thermotolerance. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 153 (433), 417–424. Zeldin, D.C., 2001. Epoxygenase pathways of arachidonic acid metabolism. J. Biol. Chem. 276, 36059–36062.

Please cite this article as: Yu, J., et al., Effect of heat stress on the porcine small intestine: A morphological and gene expression study, Comp. Biochem. Physiol. A (2010), doi:10.1016/j.cbpa.2010.01.008

Effect of heat stress on the porcine small intestine A morphological and gene  

Keywords: Heat stress Morphology Gene expression Electron microscope Microarray Small intestine Pig Article history: Received 26 November 20...