Page 1

High- Yield'" Cell and Molecular Biology is designed to: • Provide a succinct review of cell and molecular biology • Help equip you for the cell and molecular biology questions on the USMLE step 1 • Clarify difficult concepts

this is for non-commerdal usage by Russian-speakers only! if you are not a Russian-speaker

delete this file immediately! j\aHHbU1 CKaH npeAHo3Ha'lE'H I1I1Wb AJlJl :

1. PYCCKI1X nOJlb30BaTell€'l1-

epa"'eH 11 }"-IeHblX. 8 a:06eHHOCTI1 2. ceo60AHoro, Het<OMMep..eCKorO 11 6EcnllATHoro pacnpocrpaHeHl1.R CKaHJ.1pOBaHO nOTOM H KpOBblO MYCAH,Il :rr ¢!po>rr _P:l'


High-Yield Cell and Molecular Biology Ronald W. Dudek, Ph.D. Department of Anatomy and Cell Biology East Carolina University School of Medicine Greenville, North Carolina

~~ LIpPINCOTT WILLIAMS & WILKINS â&#x20AC;˘

A Wolters Kluwer Company


Editot-: E1i~be(h A Niegi~i Edirorial Dim:wr, TextbovL: Julie P. Scardil:lia Manu,gir\,l( Editor: [}.,rrin Ki=ling Markt:fill,l( M~: Jennifer Conr.td DndGilll1Dlf EJit0r5: Karl:. M. SchJ'()l..-&"r and ~nne HaUo",dl Il1u:Itrtttor: Kimbr.Tly A. &lIiSla

CoM-Tidu C

1999 UppincOIt Williams &. Willum

]51 WC$lOundmSuttt BaltirooP:', Muybnd 21201-2436 USA 227 EllA Wiahington Sc,..att Fbibdelphi.a. PA 19106

All righll rt5C'I'VC':d. This bed. iii protKIC':d by COJJOj'riglt. No Jl'U1 of thi>; bonI< rtIily be': rqJroducC':d in;my (onn or by any mans, including ~ill3, or utilized by any inbmar.icwl $IOQ{,'<': and retrieval ~~('Ill withour "Till"" (X'rmiSllion (rom the C<JpyTighI 0\\'nI:I".

fu publi>her is lX)I: I"Spon:;iblc (llli a rtIilUeT d prodoxl liability, ncgIigence Of OIncn.i.l<:) f... any injury I'C:SUlting (rum any rnaterilll oontainC':d he....in. This publication oontains information relaling to gcnel'lll principles of rnC':diOlI care which shculd nOl be comrnlCd lIS specific instrueliClm (or individual pRtients. Maru.Jacrurcl"S' producl InlOrtnalion and p"c~'C inscrts should be r.....ie".:d for eUrrt'nl inlOrn"'tioll, including oonll'lllntlicatioI1S, do6:lb't.~ and pn.'ClIulions.

Prinud in the United SIakS of A~ library of Congress c.u.loging-in-Publio:ation Dala Dudek, Ronald

w..

1950High-fleld eeO and mo&ec.uw biology I Ronald W. Dudek.. p. crn.----(High-yidd JCriI:s)

ISEN 0-683-30]59-7 I, Molecular biology Clullines, 1)路1bbi. C':I.C- 2. Patldcgy Outlira, 1)'1Labi, C':I.C- ], Cl'lOq,. Clutlint$, syllabi. C':I.CI, l1t~. IL Sr:ri..... QHS06.D83 1999 572.8--dc21 91)-23]16 CIP

The publishm ~ made WCl)' cffrm lO Irau the CfifryT""l MIden fur ~'ed maIeTiDI. If the, ha", inn4l.vrently Otdl'ltlkd all)'. lhey uoU N pkoscd ro make the lUa禄IIry arT~ llt the frru Gi>flortunil)". To purchase addilional copies of Ihis book, call OUr cUSlomer service departmenl :0Il (BOO) 638-3030 or (ax orders to (301) 824_7390. In~malional cllillomers should call (301) 714-2324. 99OO0102m 12345678910


Dedication ll1is book is affectionately dedicated to my goocl friend Ron Cicinelli. In our 30 years of friendship I have witnessed his dedication to family and friends. Ron brings a unique combination of strength and kindness lO every personal interaction. I am honored [0 know him and wish that all of you could know him roo. His life has been, and continues to be, a "high-yield" Hfe.

,


Contents Preface ••..•.•..••....•••.•....•••.••.••.•••••.•••.•.•

1

2

Packaging of Chromosomal DNA I. II. III.

Nucleic acids J TOe human genome Chromosomes 1

IV. V.

Genes 3 O1romarin 3

II.

V.

3

II. III.

III.

6

Telomere 9 DarMb'C :lIld repair of DNA

10 Clinical importance of DNA repair mecltanisms

10

Inuoduclion 14 Mechanisms of transpo!;ilion

Clinical consideralions

14

14

Tr:.ms~1.ble elements and genetic vari:lbililY

16

18

18

Recombinant DNA Technology ...••..•....••.•...•..•..•... I. louoduction 20 II. Remiclion enzymes 20 III. Gd dectrophorcsi~ 20 IV. EnZ}malic method of DNA se(juend"l 20 V. Soulhem blotting and p£et13tal te:iti~ (or ~ickle cell anemia 20 VI. 150Iaung a human gene with DNA doning 2J VII. Polymerase chain reaction (PCR) 2J VIII. Producing a protein from a clOl:'lffi gene 25 IX.

12

Inuoduclion 12 General recombination 12 Sile_specific recombination 12

Gene Amplification •..•.....................•..•......... I. Introduction 18 II.

6

Replication fork

6

Transposable Elements. . . . . . . . . . . . . . . . . • . . . . . . . . . . . • . . . . . . I. II.

5

1

Genetic Recombination .••..............•....•..•..•..•••.

I.

4

I

Chromosome Replication and DNA Synthesis I. Introduction 6 III. IV.

xi

Site-<lirected nwtagene:ii~ and transgr:nic animals

25

20


viII

7

Conterts

Control of Gene I. II. III.

IV. V. VI.

8

II. III. IV.

II. III.

I.

III. IV.

V. VI. VII. VIII.

II.

51

Silu'll mucnkni 51 Mi~ mutations 51 Nonserue mutations 51 Frameshift mutatX>ns 51 TranslocatKx'l m.u2rions 51 RNA splicing mutations 51 Transposable d~ment mutations 55 Trinucleotide repeat mutations 55

56

Linkage (coinheritance) 56 PopulllliOl1 b'enetics 58

63

Autosomal recessive inheritance 6J X·Linked recessive inheritance 66 Mitochondri:ll inherimnce 66 Multifactaial inheritance 69 Table t:i inherited disordrrs 69

13 Multifactorial Inherited Disease5 I.

48

Organization of the nuckol.us 48 Assembly of the riOOsotne 48 Ultrastructure t:i the nucleolus 48

Inherited Diseases •.....•...........••.•..•..•.....•..•.. I. AutOliOrTlal dominant inheritance 6J II. III. IV. V. VI.

42

42

Molecular Genetics ...•..........•..•.•........••.••.•... I. Polymorphisms 56 II. III.

12

Tnmscription 42 Conv~ning an RNA mmscripllO mRNA Translalion 43 ainial considerations 46

36

41

Mutations of the DNA Sequence .•...•..•.••.••..•..•..•..•. II.

11

Inuoduclion 36 Mechanism of gene reguladon 36 Structure of uanscriptKx'l factors and cene regulatOf)' proteins 36 ainkal consideration: groy.'th hormone deficiency and Pit· 1 trarnaiptiOl1 factor The lac operon 41 Summary 41

The Nucleolus. • . . • . . . . . . . . • . . . . . . . . . . . • . . . • . . • . . • . . • . . • I.

10

..•..••.....•..•..............•.

Protein Synthesis. . . . . . . . . • . . . . . • . . . . . . . • . • • . • • . . • . . • . . • . I.

9

E~1'ression

Definition 71 Example: 1)1Je I diabetes

71

71


Caltents

14 Proto--oncogenes, Oncogenes, and Anti-oncogenes I. II. III.

IV. V.

VI.

II. III.

16

OaWf'lcation of QllCClgttlE:S 73 Mechanism ei action of the 1"OS proto-oncq;me Anli-<lf\~ (Iuroor-suppressor genes) 74 Molecular palhology cJ oolorectal cancer 77

73

17

II. III. IV.

III. IV.

19

Control of the cell cycle

80

Stllb'eSoftheMphase 82

Introduction 85 Human homeotk: genes

III.

IV. V.

VI. VII.

89

Introduction 89 Gene prodocu lhal are encoded by mitochondrial DNA (md)NA) 89 Ckher mitochondrial prlxems 89 Miuxhondrial discase$

89

91

The clonal sdeaion theoty 91 The B lymphocyte (B «II) 91 The T lymphocyte (T cell) 94

Oinical con.sklerotions 97

Receptors and Signal Transduction ..•........•............... I. II.

85

85

Molecular Immunology . . • . . • • . . • . . . . . . . . • . . • • . . • . • • . • • . • • • I. II.

80

80

Mitochondrial Genes ..•........••••..••.••..•.•..••.•••.• I.

18

Phase~ of the cell cycle

Homeotic Genes and Anterior-Posterior Body Pattern Formation .•..•...•..•..•.....•...•.•..••..•..... I. II.

73

Definitions 73 Dl'signations 73

15 The Cell Cycle ....................................•..•. I.

Ix

Ion channel-linked receptOrs

O-protein-linked receptors

99 101

Enzyme-linked receptors 104 Steroid hormone (inua«llularl receptOfli Receptor types 107 Nitric oxide (NO)

107

Receptor-mediated en:loqtoos

110

107

99


Preface The impact of molecular biology today and in the future cannot be underestimated. Gene therapy and cloning of sheep are explained and discussed in the daily newspapers. The clinical and etiological aspeCtS of diseases are now being explained at the molecular biology level. Drugs that will have an impact on molecular biological processes are being designed right now by phannaceutical companies for the treatment of various diseases and conditions (e.g.. cancer, obesity). Molecular biology will be increasingly represented on the USMLE Step I exam. How will medical schools teach the clinical relevance of molecular biology to our future physicians? Medical school curricula are already filled with needed and relevam "traditional" courses. Where will the time needed lO teach a molecular biology course be found! I suspect what will happen is that many of the "uaditional" courses will extend their discussion of various lOpics down 1O the molecular biology level. This approach will work. but it will in effect make molecular biology somewhat disjointed. The studem willieam some molecular biology in a biochemistry course, some in a microbiology course. some in a histology course, and so forth. The problem this presents for the slUdem reviewing for USMLE Step I is that the molecular biology information will be scattered among various course notes. The solution: High-Yield Cell and Molecular Biology. Under one cover I have consolidated the important clinical issues related to molecular biology that are obvious "grist-for-the-mHl" for USMLE Step I questions. It is my feeling that High-Yield Cell and Molecular Biology will be of tremendous benefit to any student seriously reviewing for the USMLE Step I. Please send your feedback comments to me at dudek@brody.med.ecu.edu. Ronald W. Dudek, PhD

..


:L Packaging of Chromosomal DNA

I. NUCLEIC ACIDS (deoxyribonucleic acid (DNA) and ribonocleic acid (RNAÂť consist c:i nudeorides which are composed c:J (Figure I I): #

A. Nitrogenous bases

1. Puri.nes 3. Adenine (Al b. Guanine (0)

2. Pyrimidines a. Cytosine b. Thymine (T)

eel

c. Uracil (Ul. which is found in RNA

B. Sugars

1. Deoxyribose 2. Ribose. which is found in RNA

C. Phosphate II. THE HUMAN GENOME is all of rhe genetic information stored in the chromosomes cf <I human. It contains apprmdmarcly 3 x 1()9 nucleotide pairs organized as 23 chromosomes.

III. CHROMOSOMES contain: A. Spttialired nucleotide sequences

1. The centromere is a nucleolide sequence that binds [0 the mitotic spindle during cell division.

2. The telomere is a nucleaide sequence located at the end cJ a chromosome. It allows replication d the full length of linear DNA (i.e., the DNA does not: shonen with each replication C)'c1e). 3. Replication origins are nucleotide sequences that act as origination sires for replication. A human chromosome contains numerous replication origins. B. Bands. Bands conrain genes and are identified with fluorescent dyes and Giemsa stain. 1. G bands are rich in A-T nucleotide pairs; they stain dark. 2. R bands are rich in G-C nucleotide pairs; they stain lighL

1


.~.....~haPter 1 . ...... .......

.. .....

INil~'~:~'i""""""""""""""""""" ,

Purines

o c

,

C- - \ ':Pi

. / ,__dN N H

HN....... " ... N,....C

N C__ C

'7'

Adenine (A)

I " }:;H

N.................. N/ H Guanine (G)

Sugars

~

â&#x20AC;˘

~~~HOH

I Polynucleotide main I

0

H

H 5' ....

Deoxyribose

I Phosphale I 0-

- 1 0 -p-o-

I

o

?

o=p-oI 0-

""'

?

o=p-oI CH, 0-

?

'V'e O

~ I ""'

Ph~O<lIest.,

N

0

o

I

H

H ; l ThymIne

o=p-o--

b-

N~

3' ....

0


IV. GENES. A gene is a region of DNA that produces a functional RNA molecule.

A. Gene size varies. For example: 1. The insulin gene has 1.7 x t01 (<Ipproximately t 700) nuck-'()tides.

2. The low-density lipoprotein (LDLl receptor gene has 45 x t01 (approximately 45,0(0) nuc1eotides.

3. The d}'Strophin gene has 2000 x 1()l (approximately 200.000,000) nucleoticles. B. Gene regions

1. Noncoding regions (introns; "intervening sequences") make up a majority of the nucleotide sequences of a gene.

2. Coding regions (exons; "expression sequences") make up a minority of the nucleotide sequences of a gene.

V. CHROMATIN (Figure 1.2) is a complex of histone and nonhisrone proteins that is bound mONA.

A. IDA. H2B, HJ, and H4 histone proteins 1. Histone proteins are small and contain a high proponion of lysine and arginine amino acids. Lysine and arginine give the proteins a positive charge that enhances binding to negatively charged DNA.

2. Histone proteins bind [0 DNA regions that are rich in A·T nucleotide pairs. 3. Histone proteins bind ro DNA as twO full rums of DNA wind around a histone octamer (two each of H2A. H2B. H3, and H4 histone proteins) forming a nueleosome (the fundamental unit of chromatin packing).

B. H t histone protein joins nudeosomes to form a 30·nm fiber. C. Types of chromatin. Heterochromatin and euchromatin (active and inactive) are packed in the cell nucleus.

1. Ten percent of the chromatin is highly condensed, transcriptionally inactive heterochromatin.

2. Ninety percent of the chromatin is tess condensed: ten percent is transcriptionally octive euchromatin and eighty percent is transcriptionally inactive euchromatin.

D. Degree of compaction

1. Human chromosome I contains approximately 160.ooo,COO base pairs. 2. The distance between each base pair is 0.34 om. 3. The DNA in chromosome I is 88,OC'O,ooo nm. or 88,000 pm long (260,OOO.0C'0 x 0.34 nm • 88,400.0C'0 nm). 4. During metaphase, the chromosomes condense, and the 88.CXXl pm of DNA is reduced to 10 pm. an 88O()..fold compaction (Figure 1~3) .

Figure 1·1.

o,emical structure ~ the components ~ DNA (purines, pyrimidines, sugars, and phosphate). whkh form a polynucleotide chain. Note the pha;phodiester bond. (Adarx-ed and rt'drawn from Manu DB: Board Raw Series: Bioc:htmisn" Jrd cd. BaltilTlO£e, Williams & Wilkins. 1998, pp. 46, 48. Used by pennission ~ Lippincott Williams & Wilkins. Philadelphia, PA.)


4

Ctlapter 1

Double-helix DNA

Nucleosome

Histones

H2A.H2B.H3,H4

30nm fiber

Exlen_ chrom8tin

Secondary loops

and exlendecl chromatin

Condensed (mitotic)

chromosome

Figure 1路2. Levtls of packllgillg of double-helix deoxyribonucleic add (DNA) within a chromosome Juring me13phase. Double-helix DNA winds around a his(()nc OClI\lller of H2A, H2B. HJ, and H4 histone prO" teins to fonn a nucleoome. Histone H 1 joins the nuc1eosomlz [0 form a 30 nm diameter ftbeT that CQ'lSislS d either extended chromatin a SCCQt"ldary ~ within a condensed (mitoc:ic) chromosome. (Adapted and rcdra\\,'n with permission from A1be:ru B. Bray D. Johnson A et al: &vnrial Cd! Biolog): An Il"lll'Oducrion 10 the Mol芦uIar Biolog:y of the Cell. New York, Carland Publishing, 1998, pJ54.)


Packaging of Chromosomal DNA

5

88,000 pm

I

eaoo-Iokl

t~ction

CIIJIIIIlJIIO]I

H

"pm

1-1

Figure 1-3. Comraction of DNA in chroma;ome 1. When the dollblc-hdix C>f'..IA r:J chromosome I is unraveled, it is BB,OCO JlITI\ong. When chromooome I Conden5Cli (as OC(:U!'S <kJring mitOliis), the DNA is onlr 10 pm long (an 88CX)路fold compaction).


2 Chromosome Replication and DNA Synthesis

I. INTRODUCTION (Figure 2-1) A. Chromosome replication occurs during the S~phase of the cell cycle. In S-phase, deoxyribonucleic acid (DNA) and histoncs arc synthesizc..-d to Conn chromatin. B. The structure of chromatin affects d'lt' timing of replication. 1. DNA packaged as heterochromatin is replicated late in the S-phase. For example, in a female mammalian cdl, the inactive X chromosome (Barr lxxIy) is packaged as het· erochromatin and is replicated late in the S-phase. The active X chromosome is packaged as euchromatin and is n.-plicatcd early in the S·phase. 2. An active gene packaged as euchromatin is replicated early in the S-phase. For example, in the pancreatic beta cell, the insulin gene is replicated early in the S-ph~. However, in other cell types (e.g., hepatClCytcs) in which the insulin gene is an inac· live gene, t'he insulin gene is replicated late in the S-phase. C. DNA po1rrncrases require a ribonucleic acid (RNA) primer- to begin DNA synthesis.

D. DNA polymerascs copy a DNA template in the 3' - 5' direction. New DNA stmnds arc product.x1 in the 5' -. 3' direction.

E. Deoxyribonudeoside 5'.triphosphates (dATP. dTrP. dGTP. dCfP) pair with the corrcspoooing bases (i.e., A-1: G-C; see ClLapter I) on the template strand. They fonn a phosphodiester bond with the 3·..QH group on the deoxyribose sugar, whidl releases a pyrophosphate,

F. Rt.'Plictltion is semiconservative (i.e., tl molecule of double-helix DNA contains one intaCt parental DNA strand and one newly synthesized DNA strand).

II. A REPUCATION FORK (Figure 2.2) is a site at which DNA synthesis occurs.

A. QuomU6Offic repliC<ltion begins at specific nuckotide sequences (replication origins) that are located throughout the chromosome. Human DNA has multiple replication origins to el\'iure rapid DNA synthesis.

B. DNA helicase recognizes tht> replictltion origin. It opens the double helix at that site to fann a replication bubble with a replication fork at each end.

C. A replication fork contains:

1. A leading strand that is synthesized continuously by DNA polymerase S (delta) .


Chromosome Replication and DNA S)'Tlthesis

.'

·'

7

"

• + .....

OH

" A

.'

.....• 6 A,G,C,T

.' Phosphate Pyrophosphate

""""Yribose Ba>es

Rgure 2·1. AdditiOll of a deoJ<yribonucll..uide 5'·tripho;phatC (dGTP, to the 3'-OH WOIJP ci the growing deoxyribonucleic acid (DNA) M:rond and base pairing with cytOlline during DNA ~ynthelli~. Note the release of pyroplu~phate. (Ad~red lind redrawn from Marks DB: Boord Raw Series: Biochemistry, Jrd cd. Baltimore. Williams & Wilkins, 1998. p 56. Used by permi!iSion of Lippincou Williams & Wilkin~, Philadelphia, PA.)


8 O'Iapter 2 ...............................................................................................-

I

A

200.000.000 base pairs

.

b~-----.,.-JI 5' 3'

5'

B 5'

"""""" -C"'(0f)

C

5",- - - - - - ' \ _ _

â&#x20AC;˘

--5'

'----~

Lagging slJam template

OF 5'

~ OF

5'

'\f'.IV' 5' ~


Chromosome Replication <Wld DNA Synthesis

9

2. A lagging strand that is symhl..'Sizcd discontinuously by DNA polymerase a (alpha). a. DNA primase synthesizes short RNA primers ala"!: the lagging strand. b. DNA polymcmse a uses thc RNA primcr to synthesize DNA fragments called Okaz.aki fr.lgments. c. Okazaki frdgments end when thl..)' mect a downstream RNA primer. d. To form a continuous DNA stmnd from the Okazaki fmgments. a DNA repair enz.yme replaces thc RNA primcrs with DNA. e. DNA ligase joins the DNA fragments.

D. IfhllJTlatl chromosome I hoo only one replication origin, the mte of cell division would be severely dccrtascd. 1. Assume that human chromosome I contains 260,0CX).0CX) base pairs. the replication origin is located at the exact center of the chrotllOSOfTlC. and DNA synthesis occurs at a mte ofl 00 base pairs/second.

2. T\.\.'O replic<ltion forks fonn (one at each end of the replication bubble). Each replica· tion fork replic<ltcs 130,0CX),CXXl base pairs because the replication origin is k)Cared at the center of chromosome I. to~1 time nl..'I..-dcd to replicate chromosome I is 1,300,{)()J .seconds, or approximately 15 days (130,OOO,CXXl base pairs + 100 base pairs/second = 1,300,C(X) sc..'conds). The S-phasc of the human cell cycle is normally 8 hours, which means that human DNA has multiple replication origins.

3. The

III. A TELOMERE is a nucleotide sequence (in humans, GGGTIA) at the end of a chromosome. TIle telomere allows replication oflincar DNA to its full length.

A. DNA polymcrascs cannot synthesize in the 3'

-+ 5' direction or initiate synthesis de novo. Therefore. rCITlOV'ing the RNA primers leaves the 5' end of the laggi~ strand shorter th"n the leading strand.

B. If the 5' end of the l<lgging srr.md is not lengthened. the chromosome shortens l..'3Ch time the cell divides. This shorteningc<lllSeS cell death and may be related to the aging process in humans.

C. The enzyme telomerasc recognizes the GGGTTA sequence on the leading strand at¥:! adds repeats of the S(.'<juencc to the leading strand.

D. After the rcpc'.lts arc added to the !Loading strnnd, DNA polymemse a uses them as a remplate to synthesize the complementary repeats on the lagging strand. Thus, the lagging strand is lengthened.

Replicalial fork. (A) Double-helix dool(yril:x:.lucleic add (DNA) fchrornosorrw! II at a replication origin (RO) site. DNA hclicase (H) binds al the RO and unwinds lhe doOOle helix into lWO DNA Slrnnck This site is called a replication bubble (Ra). A replication fork (RF) fQlTIl!j at each end. DNA synthesis ca:tm; bidirectionally fmm eoch replication fak (am)u.5). (B) Enlarged view of a replication fak. TlK- leading strand is a templatc for continllOUS DNA synthesis in thc 5- ..... 3' direction with DNA polymcl'1lSe l) (PO). Thc laa:ing stmnd acts as a template for discontinuolUi [X\JA synrhesis in the S- -. 3- direction with DNA pohTIlCtru;C a (raJ. DNA synthesis on the leading ilnd lagging strands occurs in rhe 5' -. 3' direction, but physically OCCUf'l; in rhc oppo;ite direction. (C) DNA synthe;ison the lagging Mmnd proceeds diffcrently than on the leading mancl. DNA primasc synlhel!Oireli RNA primers. DNA poI}'Illcrase a ~ rhese ribonucleic add (RNA) primm to synthesize DNA, or Okawki, fragments (OF). Okazaki fnlgffiClltSend when they join adownslrcam RNA primer. DNA rcrairenllmt:s replace lhe RNA primers with DNA. f-lnaIl y, DNA lig;uc joins the Okazaki fragments.

Figure 2·2.


10

ChaPter 2 E. DNA ligase juins the repeats to the lagging smuld. A nuclease cleaves the ends to form double路helix DNA with flush ends.

IV. DAMAGE AND REPAIR OF DNA. DNA repair involves DNA excision of the damaged site, DNA synthesis of the correct sequence, and DNA ligation. A. Depurination 1. Each day, the DNA of eHch human cellioscs (lpproximately 50c0 purines (A or G) when the N路g1ycosyl bond betwt.'Cn the purine and the deoxyribose sugar phosphate is broken.

2. {)epurination is the most common type of damage to DNA. When it occurs. the deoxyribose sugar phosphate is missing a purine base.

3. To begin repair, AP (apurinic site) endonuclease recognizes the site of the missing purine and nicks the deoxyribose sugar

~ate.

4. A phosphodiesterase excises the deoxyribose sugar phosphate. 5. DNA polymerase and DNA ligase restore the conect DNA 5e<luence and heal the nick in the strand. B. Deamination of cytosine (C) to uracil (U)

1. Each day, approximately 100 cytosines spontaneously dcaminate to uracil. 2. If the uracil is not restored to cytosine, then at replication, an incorrect U-A base pairing occurs instead of a correct e.G ~ pairing.

3. To begin repair. the enzyme uracil-DNA glycosidase recognizes .nld rcmO\'es uracil It docs not remove thymille lx.'cause thymille is distinguished from uracil by a methyl group on carbon 5, 4. An AP (apyriminic site) endonuclease recognizes the site of the missing base and nicls the dcoxyril:xxse sugar ph05phate. 5. A phosphodiesterase excises the deoxyribose sugar phosphate. 6. DNA polymerase and DNA ligase restore the correct DNA Sl.'quence and heal the nick in lhe strand. C. Pyrimidine dimeriration

1. Sunlight lultr:wiolet (UV) radiationl causes cov(llent linkage of adjacent pyrimidinL'S, fonning, for example, thymine dimers.

2. To begin repair, the 1ftJTABC enryme recognizes the pyrimidine dimer and excises a 12-residue olif:,'OIl.ucleotkle that includes the dimer. 3, DNA polymerase and DNA ligase restore the correct DNA sequence and heal the nick in rhe strand.

v.

THE CUNICAL IMPORTANCE OF DNA REPAIR MECHANISMS" ill"'trntM by the following mtC inherited diseases that involve genetic defects in DNA repair enzymes: A. Xeroderma pigmentosum (XP)

1. XP causes hypersensitivity

to sunlight (UV radiation) and, as a result, severe skin lesions and s1::in cancer. Most patients die before they are 30 years old.


Chromoscme Replication and DNA Synthesis

U

2. XP is probably CAused by an inability to remove pyrimidine dimers, mru;t likely because of a genetic defect in one or more enzymes involved in their removal. In humans, removal of these dimers requires at least eight gene products.

B. Ataxia-telangiectasia 1. Ataxia-telangiectasia causes hypersensitivity to ionizing r-ddiation and, as a result, cerebellar ataxia, oculocutaneous telangiectasia, and immunodeficiency.

2. Ataxia-telangiectasia is probably caused by defects in the enzymes involved in DNA repair. C. Fanconi's anemia 1. Fanconi's anemia causes hypersensitivity to DNA cross--Iinking agents and, as a result, leukemia and Prob>Tcssive aplastic anemia. 2. Fanconi's anemia is probably caused by defects in the enzymes involved in DNA repair. D. Bloom syndrome 1. Bloom syndrome causes hypersensitivity to many DNA-damaging agents and, as a result. immunodeficiency, growth retardation, and predisposition to cancer. 2. Bloom syndrome is probably caused by widespread dcfecL~ in rhe enzymes involved in DNA repair. E. Hereditary nonpolyposis colorectal cancer (HNPCC) 1. Although mosr coloreetal cancers arc not caused by genetic fdctOrs, HNPCC accoums for 15% of all cases of colorcctal cancer. 2. The HNPCC gene (the human homologue to the Escherichia coli mutS and mutL genes that code for DNA repair enzymes) is involved in HNPCC. 3. Idemification of the genes responsible for HNPCC permiL~ early detection by genetic testing. Early diagnosis improves survival because the early stage of HNPCC is the outgrowth of small benign polyps that arc easily removed.


3 Genetic Recombination

I.

INTRODUCTiON. Although DNA rcpliattion and repair is crucial to cell surviv::tl, it does not explain human genetic variability. Some d me variability is imported by DNA rearrangements that arc caused by genetic recombination, either gctlCr'dl or site-specific.

II. GENERAL RECOMBINAnON (Figure 3~IA) involves single~stranded DNA and requires DNA sequence homology.

A. An imponant cx:unplc of general recombination occurs

durin~

"crossing over," when

two homologous chromosomes pair during meiosis (gamete formation). B. RecBCD protein makes singlc-srnmd nicks in DNA to (orm single-stranded "whiskcrs. n

C. Single~strand binding (SS8) protein stabilizes the single-stranded DNA. D. During synapsis. RecA protein allows the single strand to imrdde and internet with the double. helix DNA of the other chromosome. nlis intcrnction requires DNA Sl.'qucn<;c

homology. E. A DNA strand on th~ homologous chromosome repeats this process to fonn an im!XX, tant intermediate structure (crossover exchange, or HolLiday junction) that has 1'\\'0 crossing strands and two noncrossing strnnds.

F. The two crossing str.mds are cut, and DNA repair produces two homologous chromosomes with exchanged DNA segments. III. SITE-SPECIRC RECOMBINATION (Figure 3.. 1B) involves the insenion of double.. stranded DNA. A. An imponam example of site-specific rec.umbination is the insenion of viral D A into hos<DNA. B. Many DNA viruses and other tmnsposablc elements (sec O1aptcr 4) encode for a recom路 bination cnzyme called integra.se or transposase, rI..'Spectivcly. C. Integrase recognizes specific nucleotide sequences

am cuts the viral DNA.

D. The cut ends of the viral DNA atnlck and break the host double-helix DNA. E. The virAl DNA is insertcd into thc hoot DNA.

F. DNA repair occurs to fill the gaps.

12


Genetic Recombination

A

Step 1 RecBCD SSB

A_I

Step 2 A.. '

I

'Whisker"

steps 1 ancl2

r

Synapsis

13

ICut DNA repair ~

Crossover exd1ange (Holliday junction)

B

Inlegrase

~

I DNA repair I.

~

~

Viral DNA

Host DNA

I~

cut or nick sile

~

Figure 3-1. The two types of genetic recombilUltion. (A) General recombilUltion during meiosis. (8) Sitespecific recombirotion during deoxyribonucleic acid (DNA) viral infection. Red3CD", a protein discovered in E_ coli th;'lt is essential for general recombination, SSI3 - single-straml bimling; RecA - <l protein discovered in E. coli that is encoded by rhe recA (recombination) gene.


4 Transposable Elements

I. INTRODUCTION A. Transposable elements are mobile deoxyribonucleic acid (DNA) sequences that jump from one place in the genome to another (transposition). The calR d transposition is unclear. B. Nine percCnl of the human genome consists of two families of transposable elements:

1. Alu sequences account for 5% of the human genome and arc 300 base pairs long.

2. llNE--l sequences account (or 4% of the human genome and arc 6CXX)base pairs long.

C. Trano;po:sablc elements urocrgo kng quics:cnt periods followed by periods cf intenSe movement (transposition bursts). These burstscontribute [0 the genetic variability d the genome. II. MECHANISMS OF TRANSPOSITION. Transposable elements jump either directly as double-stranded DNA or tluough a ribonucleic acid (RNA) intermediate. A. Double-stranded DNA (Fib'Ure 4·1 A)

1. Tr.lJ\SpClSaSC is a recombination enzyme similar to integrase. It cuts the rrarnposable clement. at sites marked by inverted repeal DNA sequences that are approximately 20 base pairs long. Transpa;asc is encoded in the DNA of the transposable element. 2. 1h:: transposable clement is insenoo ata new location, pl)5Sibly on another chromosome. 3. This mechanism is similar to the one that a DNA virus uses to rnmsfOl'Tll host DNA (sec Chaptet 3).

B. RNA intermediate (see FiI.'lIre 4·IB) 1. The tt<lnsposable clement undergoes transcription, which produces an RNA copy that encodes a reverse transcriptase enzyme. 2. Reverse rranscripra.se U5CS the RNA copy to produce a double-stranded DNA ropy of the transposable element. 3. The transposable element is inserted at a new location by a mechani!m similar to the one th:'lt. an RNA virus (retroviruS> uses to transform host DNA.

FIgUre 4-1. Mechanisms cl tr.l~tion(A) T r:lIlSpOSitiofl as doOOIe-5tranded deoxyribonuclcic acid (DNA). (8) Trnnspn6ition through a ribonucleic acid (RNA) inrermediate. TE· ~bIe element; RT .. R,",jA code for reverse tr.ll'lscriprase.

14


Transposable Elements 15 .................................................................................................................................................. A

IT""""""'" I

+

TE

_dYomosome

Target ctromosome

B

I

R~

... transcriptase

TE

RT

I

__-+~ TE

RNA

ropy

I~

cot or nidl site

I

Target chromosome


16

Chapter 4

III. TRANSPOSABLE ELEMENTS AND GENETIC VARIABILITY (F;gu.. 4-2). T",nY posable clements affect the genetic variability of an organism in several ways:

A. Mutation at the former site: of the: transposable element (see Figure 4·2A)

1. After transposasc removes the transposable dement from its site on the host chromosome, Ihe host DNA undergoes DNA repair. 2. A mutation may occur at the re~ir site. B. Lh'el of gene: expression (see FiguTC 4·28)

1. If the transposable clement moves to the target DNA ncar an active gene. the transposable clement may affect the level of gene expression.

2. Most of these changes in the level of gene expression would be detrimental to tmorganism. However, over dme, some changes might be beneficial and spread through the population.

C. Gene inactivation (see Figure 4·2C). If the t.ransposable c1emenr moves to the target DNA in me center of a gene sequence, the gene is mulated and inactivated. D. Gene transfer (see Figure 4.20)

1. If IWO transposable elements arc close together, the transposition mechanism may cut the ends of both of them.

2. The DNA between the twO transposable clements will move 10 a new locatinn. 3. If the DNA contains a gene, the gene is transferred to a new location. 4. Gene transfer is especially important in the de,'elopment of antibiotic resistance in bacteria. Transposable elemenls in bacterial DNA can move to hacteriophage DNA, which can spread to other bacteria. For example. if the bacterial DNA bctw(.'Cn the two transposable clements contains the gene for tetracycline resistance, then the recipient bacterium becomes resistant to tetracycline.

Effect of rm~hie e1emel'\tS on genetic v-lriability. (A) Mutation at the former ~ilc of the u':ll"lSpO&lbk element fYE). (8) Effect on the le,·cl of gene expression. (C) Gene inaclh'ation. (D) Gene D'anSfer. DNA., deoxrril:onucleic: ocKl; Ter'I - gene for tctt3Clcline teSUtance.

Figure 4-2.


A

TE

II

B

c

"11\..11

II

Active

Target DNA

gene

"II\.

----::.::.~

• .,..let Tet

'.

~1

Targel DNA

D

II

A

A

A

~

TE

II

TO!

A

DNA wilh let "'-f--_ gene ~ lers lfl

feria and

I..

Baclerial DNA Phage DNA

ron

--.~. I ~acycine resislcn::e

CtJt or nick sile

I


5 Gene Amplification

I. INTRODUCTION (Figure S~ I). Gene amplification occurs when repeated rounds of dl..'Oxyribonuclcic acid (DNA) synt.hesis yield multiple copies of a gene. The copies arc ammged 3S tandem armys within a chromosome. Gene amplification usually re5ults in increased levels of the protein that the gene encodes. 11. CUNICAL CONSIDERATIONS

A. Drng resistance in cancer cells. Cancer cells may become resistant to methotrexate, a common chcmOthcrnpcutic agent. Methotrexate inhibits dihydrofolate reductase, which is involved in DNA synthesis. Cancer cells often become resistant to methotrexate mrough amplification of the dihydrofolatc n:..--ductase gene. This amplification increases dihydroÂŁolatc reductase levels. which overcome effective inhibition by methouexate.

B. Amplification of b0ene5 io..-oI"OO in the cell cycle (proto-onoogenes). Prot:o-cncogcneamplification oonuibutes to unconuoUed cell growth and wmor developmcnt. (Sec O\arxCf 14.)

1B


Gene Amplification

-

/Dihydrololale reductase

Figure

~1.

Gene amplification.

gene (em B-2)

19


6 Recombinant DNA Technology

I. INTRODUCTION. Laborntol)' procedures to manipulate ddlxyribonucleic acid (DNA) [recombinant DNA technology] drove many important discovcril..'S that affect clinical medicine. Understanding these discoveries requires an unJcrstanding of DNA labor:uory procedures.

rnal

II. RESTRICTION ENZYMES (Figur~ 6- t) arc bacterial enzymes catalyze the hydrolysis of the phosphodiestcr bond in the DNA molc<:Ule (CUI the DNA) at specific nucleotide sequences (4---10 ~ pairs). 1llcse enzymes arc crucial to DNA technology beGlIlSC treating a specific DNA sample with a particular restriction enzyme always produces the same pattern of DNA fragments.

III. GEL ELECTROPHORESIS (Figure &-2). After a DNA sample is fTagmcmed wim a restriction enzyme, the fragments arc separated by size wim gel electrophoresis. The sizes of the DNA fragments are comp\rcd, and a physical (restriction) map of the sample is constructed [0 show each cut site.

IV. ENZYMATIC METHOD OF DNA SEQUENCING (Figure 6,3). RI..'Striction map> pro-. vide useful information about a DNA sample. but the ultimate physical map of DNA is its nucleotide sequence. which is cst3blishcd with DNA sequencing. This method combines DNA synlhesis with dideoxyribonucleoside tripho&phates that lack the 3'-OH group that they normally COfll3in. If a didcoxyribonudcoside triphosphate is incorporated into DNA during DNA synthesis, addition d the next nuclcotide is blocked hccause the 3'-OH group is missing. This blocking is the OOstS {IX the enzymatic method of DNA sequencing. V. SOUTHERN BLOTIING ANO PRENATAL TESTING FOR SICKLE CELL ANEMIA (Figure 6,4), &Iuthcrn blotting uses a DNA probe and the hybridization reaction to identify a specific DNA sequence (e.g., the gene (IX the l}-globin hemoglobin chain).

A. A DNA probe is a single--5lJ3nded DNA segment (an oligonucleotide with 10-120 base pairs) that participates in a hybridization reaction.

B. In a hybridization reaction. a single-stranded DNA segment (e.g., DNA probe) binds to or hybridizes with another single-stranded DNA segment that has a complementary nucleotide sequence. This reaction exploits a fundamental property of DNA t.o denature and renature. The double-helix DNA strands are joined by weak hydrogen bonds mat are broken (denatured) by high temperature (90째 C) or alkaline pH to 20


Recombinant DNA Technology

,

A

5'-ill' tttHfrrrf3' 3'CTTAAG -5'

,

tfH lIlI--5'3'

5"IID 3'TCGA

,

IE_I ~

5'III! , IIAAGCTT[[l'3' I 1111 3'· TTCGAA ·5'

~

S'nnY

~

S'nntY

~

S"nn

IHindlIll

3'-

3'·

3'·

CTTAA +

TC

A

I

TTCGA

21

AATTfml3' G -5'

3 fTIIII- ' ,5' GA

AGC11J]"3' -,5' A

B

5"'-AAGAATTGC_!==~~==~AAGGGCCGCGCCGA,""lg'AAA--'Y 1111111111 111111111111111 11111

3'··-TTCTTAACG

5'---AAGAATTGCGG

11111111111.

TTCCCGGCGCGGCT

AATTCGAG

3'··-TTCTTAACGCCTTAA

ATTT-·-5'

CTTAAGGGCCGCGCCGAAG

CTTTAAA---3'

GAATTCCCGGCGCGGCTTC

GAAATTT-··5'

1111.IIIIIIIIIIIIIIIUII.1I11111

GCTC

I.. CUi or oid< site I Figure 6-1. Acrion of resuietion enzymes. (AJ Hydrol\'Sis of the phu;phodiL'5ter I:ond hy rl~lriclion enzyme; &:ORI, Alul, and Hindll!. The 5pecific nocleo.xidc sequences recognized by e~h rCMrictioll enzyme and me cut sitcs (.0\ ..,) are 5hown. £coR1 and Hindlll produce DNA fraf:ffients th:!t h:l\'e staggered ends ("Slicky~). Alul produces DNA fragmenc:sthat have blunt ends. (8) A long DNA sequence has many cut sites. If the same sequence is treated with both EcoRI am Nul, the 5amt' tl:.ur DNA fragments are alwa\"S produced becaU'iC the resuittion enzymes are ~ifk.

fonn single~strnnded DNA. At low temperature or acid pH, double-helix DNA is refonned (rcnarurcd) from the single-stranded DNA.

C.

Prenatal testing for sickle cdl anemia (sec Figure 6-4B). Gene cloning and sequenc~ ing rcrmirs the creation of a DNA prolx: mat hybridizes with the gene (e.g., prenatal testing for sickle cell anemia). Sickle cell anemia is a recessive genetic disease mat is

caused by a mutation in the ~globin gene. This mutation converts a sirlJ!le amino acid in the l3-globin prot:cin from glutamic acid (nol11\lll) [0 valine (mutam). Because both [he nonnal gene and the mutant gene have been sequenced, DNA probes can locate both genes with Southern blotting.


22

Chapter 6 DNA sample

20

搂 '0

Agsrose gel slab

Bottom

Figure 6-2. Gel elearophoresis of DNA fragmenrs. A DNA sample is cut ",,;m resrric:rion enzymes &oRI and HindJlI. The mixture ci DNA fragments OOtainrd from lhis treaUnenr is placed at the rop ci an <'ll!}I1'OSC gel slab. Un.ltt an electric: fteld, the DNA fragmenrs lllO\'e through the gel r(,Mom! the pt'6itive e1ecmxlc (because ~A is negar."路ely charged). DNA ~rs in the mixture are sepw-ated by site. SI'Tl311 DNA ~T\l'.$ migrare fasrer lhan lal'J,.'e fragments. lllCWfure. small fragments are located at the OOUortl of the ~I. and large fragments aR' located at the ~. To permit vism.liz;ar,ion of the DNA fragments, the gel is ~ in a .lye dlal binds to DNA anJ fluoresces l.lf'ldeI- ulmwiokr IighL (Adapr:ed wirh penniS5ion from Alberts B. Brn)' 0, Johnson A er al: Essenrial Cell BivIoc; An Illtnxlucrion to the MoIocular Bdota<i lheCdl. New Garland Puhl~~hing, 19Q8, p. 317.)

ym.

D. Prenatal testing for other genetic diseases. Several single-gene disortlers are diagnosed prenatally with DNA analysis. including the following:

1. Autosomal dominant disorders

a.

Huntington's disease b. Myotonic dystrophy c. NeurofibromatOSis


RecornbirIMt DNA Tect'noIogy

23

2. Autosomal rc<:cssi,'c disorders a. Sickle cell anemia b. Cystic fibrosis c. Thalassemia a and 13 d. Tay-Sachs discase (GM j gan~li05idosis) e. Phenylkctonuria

3.

X~linkcd disordc1"S a. Hemophilia A and B b. Duchcnne type muscular d~lfophy

VI. ISOLATING A HUMAN GENE WITH DNA CLONING. The tenn "clonillt!" is cmfusing because it is used in I"WO ways. RI'SI, cloning is making identical copies of a DNA molc<:ule. Second, cloning is isolating one j:,'ene from DNA. lsolming. or c1onmg. one gene from the entire human {,,'enome (3 x 109 nucleotide pairs) is a daunting ttlSk. Although the cloning melhod differs from f,'Cne 10 f,'Cne. thc doning of human Factor VIII iIIuslrnlcs Ihe process. DcfeCls in the gene for Faclor Vlll G'lLlSC hemophilil\ A. A. The first, SICP in cloning human Factor VIII is constructing a genomic librdry (Figure 6~5A). A plasmid vector is a circular DNA molccule that infects and rcplicatcs inside <I ooctcrium. Plasmid DNA is combined with human DNA 10 form a rc<:ombi~ nant plasmid. B. The genomic library is screened (Ftgure 6--5B) contains the Factor VIII gene.

to

identify me bacterial colony that

C. The gene is amplified (FiJ,,'Urc 6-5C) by cuhurirlJ! the colony in a nutrient bror:h (wemight m pro:luce millions of copies. D. Another way 10 eliminate nrocodirtJ: f!Cncs is 10 construct a complementary DNA (eDNA) library (Figure 6--6). MOSl of the DNA fragmenrs that are rct:ombined with the pltlSmid vcctor arc eithcr repelitive DNA sequences. imrons (noncoding regions). or sp;!cer DNA sequenccs. These scquencl.'S do nor code for proteins. Therefore, a large libraty must be screened to find Ihe ~ene of imert.'St (e.g., F<lClOt Vlll). The main diffcrcnce bClween a genomic library and a cDNA lihrnry is Ihar a genomic library uscs genomic (chromosomal) DNA, whereas a cDNA library uses DNA copied from messenger ribonucleic acid (RNA) [mRNA]. A eDNA Iibrnry is screened only fot Ihe DNA sequenccs that COOl..' for proteins healUS{' the DNA USl.-d 10 COllSlruCt Ihe library is copied from mRNA. 1nc liver is a good candidme ofl,>an to COllStruCI <I cDNA library beClUSC it synthesizes lal"(,'C amOllnts of Factor VIII. Reverse transcriptasc is the ctitical enzyme in the creation of a cDNA library because it produces DNA from an RNA template.

VII. POLYMERASE CHAIN REACTION (PeR)

A. Mechanism. DNA :unplifiCltion is one step in cloning the Factor VIII gene with either <I genomic librnry or a cDNA library (see VI C). OnÂŁ' mClhod to amplify DNA is to culllIre bacleria in a nutricm broth overnight. PeR is <ltlOlher mcthod (Fif,'Ure 6-7A). peR uses repeated repliUl.tion qdes with specially designed prime1"S, DN A poIy~ merasc, and the dcoxyribonlicieclSide S'-rriphosphalcs dATP. dGTP, dCTP, and dTIP. Some knowledge of the DNA sequence to be amplified is nel..oded to design thc primers. 1"'Cmy to forty peR cycles produce millions of copies of the DNA within a few hours.


ChaPter 6

24

A

--C~-ooldeC"·-c"C"·"""",-c-hC",-to'

r:Deo><yrll>onu<----".

I

Dideoxyribonudeo \Tllhosphate (ddGTP, ddATp, ddTTp, ddCTp)

(dGTp, dATP, dTTP. dCTP)

5'

eeG- O-eH 2

I

I

-

OH

""'"' DNA :r end exlf:!nsO'181

B

5"'rnATGCTGCTCCGGATAACCACTCACTCCTTGm-'3'

3'·5'-3'--

II 11111111 11I111 1111111111111 I

TACGACGAGGCCTATTGGTGAGTGAGGAAC Radiolaooled AlGe 3' primer

I t

IItm£

··5'

TACGACGAGGCCTATTGGTGAGTGAGGAAC---"""5'

IDouble-stranded DNA I ISingle-stranded DNA

- -... ...........

,...------,1- 1- - . 1 - - - - - , 1

....

... CNA ~

-

"""

"""

t

,,c G

-- -- --

-

3'

,cc ,•cc •cc ,•• •G G C C

, , C

G

.. DNA po¥nerase

S

... DNA polymerase


Recomt>inant DNA

Tectlnology

25

B. PCR and viral detection (Figure 6-7B). At1:er a virus is isolated and its DNA (or RNA) sequence is dctctmincd, PCR primers can be designed. Because peR amplifies C\'en minute amoums of DNA, il is a scnsilive method that can det'cct low IC\'el5 of viral DNA early in the course of infection. VIII. PRODUCING A PROTEIN FROM A CLONED GENE. After a gene (e.g., Facror VIII) is cloned with a c100ing vector (sec VI), the c100ed gene is used 10 pnxluec a prOlein (Le., transcribe and translate into the amino acid sequence of a prOlein). This process (gene expression) requires a plasmid (expression) \'CCtor. A. Expression vcctOl"S (Figure 6-8A) ha\'c the followin~ characlcristics:

1.. Unlike cloning \,cctors, lhey contain gene regulalory and gene pt'UffiOIcr DNA sequences mat pennil expression cI a nearby prOI:ein·coding DNA sequence. 2. TIley arc used in ooneria, yeas!:. and mammalian cells. 3. TIley allow the produclion of laq,'C amoullIs of any prmein, even rnrc proteins. 4. TIley arc used

[U

produce Factor VIII, human insulin, and human growth honnone.

B. Expression \·ectors and the nuclear transfer technique (Figure 6.8B)

1.. Expression \'CCtors provide anor:her IllClhod 10 produC<' large amounts cl human proleins in the milk of large fann animals (e.g., transgenic sheep, tranSf,'C'flic cows; scc IX). 2. Human Factor IX, which is used to trear hemophilia B, is proouced in the milk of 1 ransgen ic sheep.

IX. SITE-OIRECTED MUTAGENESIS AND TRANSGENIC ANIMALS (Fib"''" 6.9). The tlbility to express a cloned b'Cnc within a cell opclH.'d a new tlrea of medical resctlrch. A c1oll(.-d gene can be mulaled ar spccific siles (site-directed Illul'tlgencsis), and the funelion of the IIlUI:anl' gene em Ix- tested. The c1oll(.-d gene alll he murtlred so lhat 3S little as onc amino acid in the protein is changed (gene replacement), or a ltlrge deletion can be madc so thal the protein bee01TII.:s nonfunctional (gene knockout). TIle ultimate lest of the function of the mut'lnt gene is to inserr it into an tlnill\tll genome (e.g., mousc) and observe irs effecl: on the allim'll. An animal that has a new b'Cne in irs genomc is c'lllcd transgenic. Transgenic mice arc oftcn used in labornrory expcrimcl1l's.

Figure 6-3. Elllymatic meth<xl of deox)'ribonuclcic add (DNA) scqucncirl$~. (A) The biochemical struCtutC of dc.'OX)'riNlIlucle«;ide triphosphates (dGTP, dATI', d1Tf', deYf') and didcox)'ribonudeosidc triphOlSphatcs (dd(;TP, MAT/', MIT/'. ddCT/'), The 3'-OH J,trOUp on tilC didcox)Tibonucl~KIc lriphosphaU_'S is mis.sil~. (0) Double-strandcd DNA is sep3r.ltcd inro single slrands, ruw one Slr.l''ld i~ used as a tempbte. A radiolabdcd primer (ATGe) initiates DNA s)·nthesis. Fan reaction mixtures ate SCi up ....ith DNA polymerase, dGTP. dATP, JTTP. dCTP. and either ddGTT'. ddATP. Mm, orddCTP. These reaclions produce sc\'Cral DNA frnwncnts of differenl 1ell:th. The fragments tennin3fe in either G. A, T, or C, depcl'ldirIJ: on which dideoxyri. bunucle05idc trip~h3te \\'as pre;ent in [he reoction mixture. The cements of eoch relICtion miXtufC 3re sep3f3too br ~I e1ecuopoofC!iis, l:ascd on DNA ft3WTlent ~e. The J,>el i$ e)(p05l..'d to film, and 'hc radiolabdcd primer idelUifics eoch DNA f~lClll as a band. The bands are 3rr.l11~ as four p3f3l1d columm. Each fraJ;mclU tenninales in eilhet G, A. T. or C. The sequencing ......1 is read from the oouOIn of lhe fdm. lnc 1000CSl baJ'ld (i.e., the mrteM DNA ft3W1tellt; in dlis case. the T column) is loolled. After the fitst nucleotide ill the $Cl(UCIlCC is idclUifJed, lhe next kM'C:Sl band on lhe film (in this CltSC, the G co!U1ml) is k>C3tl-d. By repealing this process for 311 26 banis. the DNA sequenc~ is COnslructed ill 3 S' -0 3' direclion. (Part A adapted wilh permission ftom AlbertS B. Bray D, Johnson A et at £s.seruiaI OIl Btolog): An Inrroduclion to me Mokodar Biot:JgJ of rht CeQ. Na.o.· Yon:, Garland Publishing, 1998, p. 319. Fi~. 1()'5.)


A

Radio!abeled DNA size markers

J

• :. , • - ,• , ,, ;:w. -. ;.: ...,

I

~~

Transfer

.""

-

denature

~

~

=-w.:i •

Agarose gel Nitrocellulose

,.pe,

IAutoradiography

B

Transkl'r

.""

denature

-1 Hvbrid."rlonl~ -l Aul"",dIog<aphy I~

-

DNA probe lor normal ~.globin gene

Fetal DNA (F) Control 1 DNA (C1) Control 2 DNA (C2)

-- Film

ICUlONQ eleclrophoreslS

-

F C1 C2

-FilmA

F C1 C2

I

CutONA electrophoreSIS

I

=="-J -+ -1 Hybri~"""'-J-...-~ -l Aul<_"",~"'" I~ DNA probel lor mutant ~.glol::lin gene

--

F: Sickle cell anemia

C1: Homozygous normal C2: Heterozygous normal

FilmS


Figure 64. (N Southern blotting. Double路stranded deoxyribonucleic acid (DNA) is cut with three restriction enzymes and separated inro three Ian wIth gel c!ectrophoresis. One lane is reserved for radiolabeled DNA si~e markers. The double路stranded DNA is transferred to nitrocellulose paper une allc.aHne conditions so that. the DNA demlO.lJ'Cs inw single mands. The nitrocellulosc paper and the radiolabeJcd DNA probe are placed in a plastic h and incuhated under condiTions rhat ravor hybridimr.ion. When rhe nitrocellulose paIXt is exposed to phl.ltographic film (aumrndiogrnphy), the rndio Ixled probe appears as a series of bands. (8) Prenatal testing for sickle cell anemia. Fetal DNA (FJ is obtained (rom a high-risk ferus and compared wi conTrol DNA (Cl, C2). The DNA IS separaTed into (\1.'0 samples, After each sample is cut with restriction eoz}'mes, gel electrophoresis is performed. T sample is ,hen transferred 1.0 nitrocellulose papcr under denaturing conditions. One sample is hybridi:ed with a DNA probe for the normal p-globin ger The nther sample is hybridized with a DNA probe for the mutant p路glohin gene. After autoradiowaphy is performed, films A and B are anal~-red. Lam (fetal DNA) has no bands in film A (rm normal p路globi.n I,'l.'ne), but one band in film B (mutant P.globin gcf\("). The fetus is homozygous for ,he mum jl-globin ~ne and therefore has sickle cell anemia. Lane Cl (control DNA) has one band in film A, hut 00 bands in film B. This person is homor,llOUS 1 rhe normal p.globin gene and therefore is nOrm3I. Lane C2 (conrrol DNA) has nne band in film A and nne band in film B. This person is heteroz)"~ (i.e., has one COJl"!' of the nomud jl-globin g('l'le and one copy of me mutant P.globin gene). This penon is normal because sickle cell anemia is an auto! mal recessive genetic diseasr (i.e., ir requires fwO copies of the mutant P.globin g('l'le). (Pan A adapted with permission from Alberts B, Rr<'!'I' D, JohftSo A et al: Essential Ceu Bil'llogy: An Introdwcrion to rhe MnlecWaT ~ 0/ rhe CeU. New Yorl<., Garland Publishing. 1998. p. 323.)


2B

O'Iapter 6

A

....

............... Plasmid DNA

-

.................

~..,. '- col,' infected .. .. • .• .....•.•.•with ~~::~~~,. recombinant

O~:>

~o

E,coIi oolony

"0 ~?O .a I I

,

~c~ Ii,.~ °c 0 ,., .....- ';U p"=~ DNA

Recombinant

ff -

Genomic library

Human DNA DNA fragments

B

c

c§:J Incubate in nulrienl broth culture

\

- -- ,- ., o

I ""A_

~--~-'>,

--

-:"-~-,

-

,

-2 -, -

_

-,

Purify plasmid

bacterial DNA

0 °0 o 0

Millions of copies of • "cloned factor VIII Qe.ne

Film

0

-


Recombinant DNA Technology

â&#x20AC;˘

Figure 6-5.

29

(A) Consrrucrion of fl genomic library. A restriction enzyme (RE) is used to cut human deoxyri. bonucleil" acid (DNA) into DNA fragments. A pla:;mid DNA vloctor is cuI with tbe same restriction enzyme, and tbe two types of DNA are mixt:d. Human DNA fr<lgments are insertt:Q into the plflsmid DNA flnd seak'CI with DNA lig;Jsc to (orm a rCl:ombillant plflsmid (I.e., DNA from two SQurct.'S is "recombined"). The rt.,<:ombimlllt pla.smids are mixed with EKMkhia coli bacteria and plated on Petri dishes tv form bacterial colonies and create a genomic library. (B) Scrccning the library. The bacterial colonies are transferred to filter p<lpt.'T and lysed, and the DNA is denatun.:d to single strands undt.'T alkaline conditions_ l3ecausc a portion of the amino acid St.'Qucnce of Factor VIII protein is known, the DNA St.'Quence tbar code; for these <Imino acids can be deduced. A DNA prohl' is made based on the dt.-duced DNA St.'Quence. The r.rliolabek-d DNA probe hyhridizes to the DNA srr"nd of a complementary nuclt.'Orjde Sl.'QuenCe (i.e., FflCtor Vlll gene). The filler J"Ipcr is expused to photographic film to identify the rooiolflbck-d DNA. (C) Amplification. The corresponding bacterial colony is pluckt:d from the Petri dish and plflCed in <I nutrient broth culture overnigbt. The recombinant plasmid DNA is scparatL--d (rUin the bacterifll DNA. Because millions of copiL~ of the recombinant pbslllid contain the gene, the Factor VIII gene is now c1ont:d.


30 Chapter 6 .....................................................................................................................

L:5 ---~ t

5'····

~

Hybridize with poly (T) primer

5'··.

.

mANA

AAAA .... 3'

mANA primer with poly (A) lall

AAAA····3'

I""-',,,-""'" I t TTTT ;5'=---~-';:;;:;;;;:;:;:;:-;:,,;:~TTlrnTTI~~~~ _..3' DNAfmRNA II II

hybrid

_3~'-=--~~~~~~f.LLWW..uTTTT-... 5'

I

Degrade ANA with alkali

I

~am~~-=--~~I--TTTT_---5.

I~-~I

t

~~~;:;:;;n~rr1mTTmm',AAAA _ 1111 ~~~LLIJ~.LLL""""TTTT

I 0'" """""~ I

t

•.. J'

5'

5,··';:;:;:;;n:rrr:nmhmmTTnAAAA-'" 3' 1111 cDfllA

3'__ U.wW.W.w~W""~TTTT

5'

E. coli colony

-

Plasmid DNA

"""""

I Sc""", Ihe ""''Y I Escherichia coli infected with rElCOr'lltinant

""-

t I_nca,ion I


Figure 6-6.

Construction of:l complcmcm:lry DNA (eDNA) library. Mt:SSt:llgcr RNA (mRNA) from the liver is isulated. OJpying of only one mRNA into eDNA is shown. The mRNA is hybridized with a poly.T primer, which act.s as a primer for reverse uanscriptasc. RcvCI'>C transcriptasc copies the mRNA into a eDNA Cmill to Conn a DNNmRNA hybrid. The mRNA is seloctively dt:gradcd "nder alkaline conditions. DNA polymerase copies the single strand of DNA into doublc-strandt:d DNA, which uses. ill this case, the 3' cl¥I of the single. smmdcd DNA. The 3' end folds oock 011 itself to form a few l"hance p<lirings. A DNA nuclease clt.':lves the hairpin loop to form a double-stranded eDNA copy of tilt: origill<ll mRNA. TI'IC newly fOrffit..'" doublc-srrm¥lcd eDNA is inserted into a plasmid vcrtor to create a eDNA library (Sl.-'e Figure 6-5B). RE .. restriction enzyme.

ruSt:

A 3'5'

5'

~erA

OA,P "-1"=OC'---' dGTP deTP dTTP

3'

5'

5<'68"C \3' 1~~rQel

Hybridize primers

94

Denature

~--....

T~~

<rB

3'

5'3' 5'

DNA Template

5'

5'

Aepeatlor 25-30 cydes by changing temperature

3'

\

) I 3'

5'

B

Pellet cells by

centifrugation

DNA

Figure 6-7. (A) Polymerase ch<lin Tt.'<lction (peR). A region of double·~t:mndl-d DNA to be <llllplified is shown undergoing the PCR. E.3ch l'yele of the PeR begins with 94°C heat treatment to scparme (dcnlJture) the duuble-stmmk-d DNA into Single strands. The DNA primers hybridize to single.stranck-d DNA and act <l~ the primer for DNA synthesis by DNA (Taq) polymera~e, dATP, dGTP, dCTP, and dTTP. Of the DNA put into the origilml re;lction, only the DNA scquence bracketed by the two primers is lJmplified because no primers are att:K;hed anywhere else. This is Tt.'PCatl-d fot 25 to 30 cyeles to pnxluce millions of copies of the o~inal region of DNA. (0) PeR and viral dett:ction. A blood S3mple is taken from <l suspect patient, ;Jnd cells <Ire removed by centrifugation. [f even a trace amount of virus is prescnt in the scrum, its DNA can be h;obted and mnplified by PCR. PCR will produl:e enough DNA so th;Jt it can be dcteetl-d by gel electrophoresis. To detct:t <In RNA vinls (e.g., HIV), you must first lISC reverse tnm.SCriptase to CQnWrI: the RNA to eDNA, and then amplify by peR. (part A modified with permission from Jameson JL et 'II [l-dsl: Prim:iples of Molecular Medicine. Totowa, NJ, Humana Press, 1998, p. 15. Part B repnxluced with permission from Alberts B, Bray D, Johnson A ct al: Essential Ceu Biology: An Introduction to the Moleeular Biolqa of the QU. New York, Garland, 1998, pp. 333-334.)


32

Olapter 6

A

Regulatory and promoter sequences

H""",o insulin gene Introcluce

â&#x20AC;˘

I Bad"" f ~ I 1..;;:-;;:....-,1-1

I

Human

~tin

Humon

;"""~ I

Expression vector

B

Regulatory and promoler sequences

Human Fader

,x gene

Expression vector

o

c>"""O O~O

o

â&#x20AC;˘

Remove nucleus

)

hom

O~M ooc~.

Pseudopregnant stleep

t Birth oIlrallSgenic sheep with tunan Factor IX gene

~


..

Figure 6-8.

Producing a protein from:'l cloned l,oeJlC. (N An CXJlr'CMKJtl \'t'Ctor cunmiro n1?\l1alory ard pro. l\t.<atb)' human insulin I."ne. 1bc CXprCS5ton \'er.:tOf is irn:roduced imo OOc'<.'ria. }-east, or mammalian cdls. The human Insulin ~ is transcribed and uanslaloo inro human insulin. This method proJuccs large al\lOl.lms of human insulin f()l" use ",. pati~ms with type I and [)-pe 11 diabetes. This 1ll("1hex! replaced the exttacrion of insulin trom OOvint v.mcrem:a 1Il3! \\1:rt' collecloo from 5IauJJlu:mouscs. (8) D;pression VCCltYS and Ihe nuclear transfCt" rcchnil.Jue. Expre.l;ion \'<.'CIOI$ comain regularory and promoltt DNA sequences drive the eXpres5ion of the nearb\' human FOClot IX gelX', lne expression v«wr is imroduced imo tWine feral (OF) cells rhat are cultun:d ro form colonies. Tbe OF colonr that Calmins the human Focwr IX gene j,; isolated. The nucleus cl an OF cdl (:ontains r~ hunmn Factor IX ~ne is removed and tran5l"crred into an enucleated ovine OOCyte. The "new" oocyte is srimlllau:d to undCfl,'O deav3b'C. Then it is imroduccd to a psclldoprcgnam ~hrtp to pnxluec trn~<enic ~hcL'P' The tmnst,'t:l1ic shL-.::p have [he hUIl1..1.11 r'aCf(lr IX 1,<el1e and produce human fuemr IX protein in their milk. The nuclear transfer rcr:hni<Jl.lc causes conccrn am(ln~ biocrhki~t5 because it It'acls di«:cdy to human cloning. When this tL"Chniquc is pcrft"CtL.J, a nuclew; fll)ln a humrm cdl can be rcmoved, rrnnsfcrrcd inlo an enucleatcd human oocyre, and imroducea into a pseudopregnant woman to producc a hllm,--.n clone. ITIOltt

DNA sequences d'la! dri\'e the expresskJI' of the.-

mat

mal


34

Chaplff 6 Regulatory and promoter sequences

Normal gene

C\

~

Expressk>n

vector

I

GiG

I !Site-dimcted mutagenesis I

ES cells growing in tissue culture

I I

G~e'r~"t ~"''- '(-i-~:e_~+:Jt

â&#x201A;Ź)~(!)~ <!.2~ ~

'C!J~G<!) Let eadl cd

grow 10 Iofm a coIorny Protein nonhn::tionaI

lso!ale ES cells containing

""'"'" gene

TransgenJc mouse


Recombinant DNA Technology

â&#x20AC;˘

3S

Figure 6-9. Site-dirccted mU~'fnesis and mu\St,'CIlic. animals. An cxpI'CR;inn vcetor contllins a IlUm'laI ,-ocne that has regulalDf)' and promoter DNA sequcnccs. The mUClllI gene within lhc expressiou ,'ector is introduced into embryonic. stem (ES) cells. Mer !he Stem cdls are cultured., the cells that incorporatoo the mutllnt jlCne (shadM) are isolated. lncse slem cells are injecr:ed imo an early embryo oIxained from a 3-dal'-pre~lam mouse (female mouse X). The embr)'O contains boI:h cells flOffl female I1"O..ISC X (u.4uU') and embr)'onic stem cells with me mutant gene (shakd). Several early ...'fllbry05 are produced and introduced to a pIt.-udopregnam mouse to produce chimeric mice (produced from a mixture of twO cell types) (lig'lI and dark shodmgJ, If a chimeric mouse incorporaleS the mutant gene into iUi l!l'Tfll cells, when it ma[l~ with a normal mouse, tffil'lSI,'t:l\ic mice are produced (dark shndmg)_ A nm\Sbocnic mouse has onl" copy of the mutant gene in e.'cry cell. (Adapted with pcnnission from AlbertS B, Bray D. Johnson A ('I .11; ESSDlliaI C.l'U Biolog,; An ImroduclK.m to lhe Moleeultrr Biolog, of the Cell, New York, Garland, 1998, p. 341.)


7 Control of Gene Expression

I. INTRODUCTION. All human cells contain a set of hou~eheping genes that produce housekt:cping proteins. TIlCSe prmeins arc used for many funCtioru; that are common [0 all cells (e.g., cru:ymt:S for mcmboltc processes, cytoskeleton proteins. and proteins essent!,,1 to the endoplasmic retteulum and Goigi complex). Each cell also JXoouccs specialized proteins (e.~.â&#x20AC;˘ heparocytes produce Factor VIII; p'l.I\cre:uic beta cells produce insulin). Because all human cells havl' identical dC"Oxyribonuclcic acid (DNA), L!w key cell biologic qucstion is: Why do certain cells produce specific proteins? ntis question is answered by research on the control of b'Cne expression. or gene regulation. The most impornmt level of gene regulation is tranS(;ription.

II. MECHANISM OF GENE REGULATION. Two trpcsofDNA sequences playa role in gene regulation: the gene pfOmoter DNA sequence and the b>ene regulatory DNA sequence.

A. The gene promoter DNA sequem:e (Figure 7-1) has the followin~ charnc:teristics:

1. 11 is usually located near the gene. 2. It i.~ located upsfream of the gene. 3. It is I,he site where ribonucleic acid (RNA) polymerase Il ~nd transcription f...ctots as.'itmhle SO thM a gene c:m be tntnscribed infO messenger RNA (mltNA).

4. 11 is located near the initiation site, where transcription begins. S. It contains a TATA box (DNA sequence: thut or GC box_

i~

rich in T-A base pair.;), CAAT box,

6. It binds transcription factors that link RNA polymerase 1110 rhe promoter to form a transcription-initiation complex. B. The gene regulatory (enhancer) DNA sequence (Figure 7-2) has the following charactcrtstics: 1. h is usually lOOl.ted far a",,'ay (rom the b'eOC. 2. It is located either upstream or downstream of the b'Cne. 3. It binJs gene regulatory proteins that either activllle or repress rhe tntnscriptioniniti:uion complex.

III. STRUCTURE OF TRANSCRIPTION FACTORS ANO GENE REGULATORY PROTEINS. Transcription factors and gene regul:'ltory prOleins hind to DNA through the inlCraction of amino acids (from the protein) and nucleotides (from the DNA). 36


ContrOl of Gene Expression

37

~ ----------.!+<~;;;I;~p'"'m;m.O""·~';;;;;;: ••~1+1;~G"".~O"".~-~->~'~I 't ~ I~

TATA

Transcriptioo

RNA~y~",." ~~ ~ TFIIE

/(

}oomPI..

~

Figure 7-:1.

The gene promoter and action of transcription (flcwn;. The transcription mclOr TFIID binds lo the TATA box, which pcrmitsTFliB binding. The nextsrep involvCl; TFIIE, TFIIH, and TFIIF; and ribonucleic acid (RNA) polymerase II enb<agOO to the prommcr lo fonn a transcriplion-initiarion (Tl) complex. TFlIH phosphorylares RNA polymerase II, which is released from the Tl complex. RNA {Xllymernse II and the transcription mclOn; aTC not sufficient to CflllSC transcription within a cell; other mctors (b~ne regulatory proteins) arc nCCl'SS<1ry. ATP '" adenosine rriphc.;phate. (Adapted with pcmlission from Albens B, Brn\· 0, Johnson A et al: Essential Ceu Biolog): An Introduaion to the Molecular Biolog) of Ihe CeU. Ncw Yl"lTk, Garland Publishing,

1998, p. Z64.)

DNA-binding proteins arc classified into four types: homcodomain proteins, zinc finger proteins, leucine zipper proteins, and helix-loop-helix proteins. A. Homeodomain protein (Figure

7~3A)

.1. This prmein consists of three linked alpha helices (helices I, Z, and 3). Helices Z and 3 arc arranged in a conspicuous helix-tum-helix motif. 2. A 60 amino acid long region (homeodom..ain) within helix 3 binds specifically to DNA segments that comain the sequence 5'~A~T~T-A~3'.


38

Chapter 7

.• -. • .-• :~

•••••

Gener£9.llatofy

,-,:""'r-c'"'-"""'r--' _

• L~G:..,.~~,.~",~'a:Io~'YJ~~,!!!!~ •

+.

proleins

..

TPJAto<

.............iii I" -+1 Upst,eam 1-

I "R"'NA=""""""",==:C'' ,

-.

------_.··l·

"p"'~=eot'~'- _ _

Gene

L.J Star1 ~

,

_

I

1 transcnptJorl

I~ _

Figure 7·2. The ~,'cne regubtor and the action of h'Cne tq,-ularor.,. prnt:cins. Gene regulatory S':<jUCncl'S bind gene rcgu1alOry proteins. These proleirL'; activate Or reprtSl; the tran$(:ription-initiation compk'X. DNA lroping alkJ\\~ gene regulatory proleins mat are bound;ot distanr sites to intcracl with the uaru:.c.rip60n--initiation COfllpIex. RNA ,. rilxlnudeic acKl. (Acbpled with pertnession from Albens 8, Brd.,. D, Johnson A ct al: Essential Ct-.11 ~; An Imnxlucrioo ro w Mulecwar Binlqa of the Ct-U. NI'W York, Garland Publishing, 1998, p. 268.)

Figure 7~.

Transcription metors and b'CI'oC n:l,·ulatory !lrutdrn. (A) TIle Ihrtt-dimcnsion.11 structurc of thc PitI homeooumain prorein is shown. The 60 1IrnilVJ acid l-otneodom.1in ofPit-l pnJtein is co&..-d for bo,' the PIT' l,'COC

OOI'lt3inil"ll a 180 ~ pair scq.tt:ncc calkxl the honteOOox sequence. Pit-I bind~ :u the tr.m5Criptioninitiation (r1) cunpIex ts reQuired b trnmcriJXion ci the j..'CI"lCS for gto"'th hormone (GH), th)'roid-M-imulating hon--ncnc (TS/-IJ. and pulactin (PRL). A mutation In the gene for Pit-I will ~h in the combined dd1Ci~lC\' of GI-I, TSH, and PRl, causing piruiraf)' dwmfrsm. (BJ TIle dm:~-dirncnsional srn.x:tllI"C of a spccifrc zinc fU'lCCr pr0.tein (Le., the glucocl.1flicoid n.:ceplOt thm acts as 11 gene regulatory protcin). The glucoconicoid rt,'o::eptOf hns 11 DNA.bindinJ( region and a horrnonc-bindil1~ l1.'b>ion. In the p«'1ICnce of b~ucocortic.oid hormone, the glllCOCorriccid rco::qxor "ill bind to a 1o't''Ie I'Cj(lIlatof)' SC<luer.ce ktllJ\\11 as the glucocorticoid response element (GRE), which loop; in order 10 Ulleracl \\ilh the TI complex and al\o..'5 Ihe stan of ~ Ir3nICription. (eJ n.e three· dimensional srtueturc ci 11 kucine tiPrCf protcin Qun) fOITllill;; a Icocine zipper homodimcr Qun-Jun). L = Icuci~. (0) 'The dutt- dimenSIOnal stnx:Olrc of 11 helix-Iccp-hdix (HLJ-I) prot"cin ft."flllil'lf; an HLH homodimer.


~

A

I'=-I

c

PfT·, gene

of Gene Expression

CO<><

,1

Pit-l homeodomalo protein

o

+

_.GAO' ..-'

y:-cc!_ honnone

.. _-

CO<><

39


40

Chapler 7

3. Specifk examples of homcodomll.in proteins ll.re: a. Cktanucleotide binding protein~l (ocr~I), which regulatcs the histone gene HZB. the th\'mKline kinase gene, and snRNP gencs b. Octanucleotide binding prolein~Z (OCT~Z), whtch reguhues various immunoglobulin b>cnes c. Pituitary specific factor.! (Pit.}), which rel,'11l:nes the growth hormone gene, the thyroiJ·stimul:ued hormone b>cne, and the pfOll'lctin b'Cne. B. Zinc finger protein (set' Figure 7.3B)

1. It has one alpha helix. 2. It contl'lins one zinc atom round to four cysteine amino acids. 3. It contl'lins l'l hormone~binding region. 4. A 70 amino acid long region near the zinc "tom binds specifiCfllly ro DNA segments. 5. Specific examples of zinc finger proteins "fC: a. Transcription factor iliA (TFllIA), which cnJ::ages RNA polymcrase II to the gene promoter b. Spl (flTh!: described fOf" its action on the SV4Q promOter), which engages RNA IXl\ymcrnse II to the gene prommer by binding to the GC box c. Gluuxorticoid receptor, estrogen recepror, progesterone receptor, thyroid hor~ mone receptor (erbA), retinoic acid receptor, <lnd the vitamin 03 receptor C. Leucine zipper protein (see Figure 7·3C)

1. It consists of fIn alpha helix that contains a region in whkh every seventh amino acid is leucine, which hll.S the effect of lining up ll.1I the leucine residues on one side of the alpM helix.

2. TIle leucinc residucs l'l\low fordimerization of the two leucine zipper protcins and forIllll.tion of a y. shaped dimer. 3. Dimerization lTUl.y occur beru-eetl two of the same proteins (homodimers. <,.g.,Jun-Jun) or two different proteins (heterodimers, e.g., ru-Jun). 4. It contains

fl

ZO amino acid long region thl'll binds specifically

to

DNA segments.

5. Specific examples of leucine zipper proteins are: a. CCAAT/enhaocer binding protein (C/EBP), which regulates the albumin gene and the al-l'lntitf"ypsin gene b. Cyclic AMP response element binding protein (CREB), which regulates the somatostlltin gene and thc proenkephalin gene c. Fin"-el osteogenic sarcorrrn virus (Fos) protein, a ptoduct of the c.{os prolooncogene, which regulates wrious genes involved in the cell cycle and cell transfotlTllltion d. Jun protein, a product of the C.jwl proto-oocogene, which regulates various genes involved in the cell cycle and cell trnnsformation O. Helix-loop-helix: protein (HLH) [Figure 7·3D]

1. It consislS of a shan alpha helix connected by " loop to ll. longer alpha helix. 2. 1ne loop ,,\low for dimerization of two HLH proleins ll.nd fOtlTllltion of ll. Y·shaped dimer. 3. IJimerir.'ltion Illl'ly occur between two of the Sl'lmc proteins (homodimers) or rwo dif· ferenl proteins (heterodimers).


Control of Gene Expression

41

4. Specific examples of HLH proteins are: 8. M}'oD protein, which re~,'u1:Hes various genes involved in muscle development b. Myc protein, a product of the c..myc protooncogene, which reJ::ulates \~rious gcnt."S involvt.-cl in the cell cycle.

IV. CLINICAL CONSIOERATlON: GROWTH HORMONE OEFICIENCY ANO PIT路1 TRANSCRIPTION FACTOR (see Figure 7 ..3A). Approximately I of every IO,OCO newborns has a growth hormone (GH) deficicnq thilt causes pituitary dwarfism. Some of these infants are also deficient in th}'raid-stimulating hormone (TSH) and prolactin (PRL).

A. The combined deficiency ofCH, TSH, and PRL is caused hy a mutation in the gene that encodes for a transcription factor (Pit路!). Pit-I is a homeodomain prorein ..hat is required for GH, TSH, and PRL transcription.. B. Genetic screening for mutations in the PITI gene permits pres}'mprornatic diagn05is. C. Patients arc given injections ofGH that is produced with recombinant DNA technology.

V. THE lac OPERON. An operon is a set of cooroimllcly controlled genes adjacenl to one anod'lt:r in the genome. The detail.s of gene regulation were first discovered by Drs. Jacoh and Monod in E. coli bacteria and the lac operon. A. TI,e lac operon consisrs of three genes:

1. The lac Z J::cme encodes J3.-galactosida.'ie. which splits lactose inro gluCUie and galactose. 2. The lac Y gene encodes lactose permease. which pumps 1:'\C1.ose into the cell. 3. The lac A gene encodes thiogalaclosidase trAnsacetylase, the function of which is not well understood. B. The enz}'me J}--g.'llactosidase is easil}, assareJ using a colOC"less compound common.ly called X..gal, which is hydrolyzed by ~-g:dactosidase into a blue rroducr, providing an easy colorl\1erric assay. C. E. coli grown in g1ucose+ medium t:xpress low levels of the lac Z and lac Y genes. E. coli switched ro a lactose+ medium express high levels of the lac Z and lac Y genes. nlis led to the concept that lactose was an inducer of gene expression. D. E. cOO rnutanu, when lsoIated and grown in glucose+ medium, express high levels of the lac Z and lac Y genes. These mutants arc called constitutive because d'tC}路 fail to repress the lac operon, and thereby continuously (or conslitutivcly) express high levels of the lac Z and lac Y genes even in the presence of glucose. TI1CSC lllutations were mapped to a region on the E. coli chromosome 1.0 the left of the lac Z gene and wt::re 11i.l1lled lac J genes. This discovery led ro the concept that the protein encoded by the lac 1gene was a repressor of gene expression. This pn,xein is called t.he lac repressor.

VI. SUMMARY. Each cell produces:l specialized protein because it con1.<liru. a unique comhi路 nation of transcription factors and gene reyul:ltory proteins to stimular.e transcription of rllat b'Cne. He~tocytes llnd pancreatic beta cdls each have a unique combination of tr:mscription f::lelOrs and gene ~'Ulatory proteins that stimulates the I ranscriprion of the r-actor VIlI gene and the insulin gene. rt$pCClivcly.


8 Protein Synthesis

I. TRANSCRIPTION (Figure 8-1) has the folluwing characteristics: A. It is the mechanism by which cells copy deoxyribonucleic acid (DNA) to ribonucleic acid (RNA).

B. It. occurs in the

nuc1t.:I~~.

C. It is perform~ by one of three enzymes: 1. RNA polymerase I, which produces ribosomal RNA (rRNA).

n.

2. RNA polymer'!'.ยง(' which produces messenger RNA (mRNA) and small nudeaf ribonucleic proteins (snRNPs). 3. RNA polymerase

m, which produces transfer RNA

(tRNA) and 58 rRNA.

D. RNA polymcrnses copy a DNA template strand in the 3' to 5' direction, which produces tin RNA transcript in the S" to 3" direction.

II. CONVERTING AN RNA TRANSCRIPT TO mRNA (Figure 8-2). A cell thaI is io\,olv...-<I in protein synthesis llSt:S RNA polymcr~se II to tnmscribe a prOLcin-coding gene into an RNA transcript that is further processed into mRNA. This processing involves: A. RNA upping (addition of H methylated guanine nucleotide to the 5' end" the RNA transcript). which increases the stability of mRNA and aids its export from the nucleU'i. B. RNA poIyadenylation laddition of repeated adenine nucleotidcs (poIy.A tail) 10 the 3' end of the RNA transcript), which increases the stability of mRNA and aids its exporr from the nucleus. C. RNA splicing 1. RNA splicing is a process that removes all introns and joins all exons within the RN A transcript. 2. This splicing is pcrfomted by snRNPs th:u arc a complex of RNA anJ protein called a spliceosome. The RNA ponion h\'bridizes to a nucleotide sequence that Oltlrks the intron site. The protein parrion removes the intron and rejoins the RNA transcript 3. RNA splicing produces mRNA that Icaves the nuclclls to undcrgo translat.ion in th... cytoplasm.

42


Protein S)Tltl1esis

5'

43

3'

3'

Soon region of DNA/RNA helix Movement 01 RNA polymerase

Figure 8-1.

Tr,u19.:ripfion. One of the stT,II'\lh of lhe DNA double helix acts as a deoxyribonucleic acid (DNA) lcmplm.. sll~nd 10 produce a ribonucleic acid (RNA) tra~ripl. RNA poIYInera5C copies the rNA Icntpl:ltt'Sl!lllld in a l' LO 5' direction (0 produce a RNA tr.mscript i.n the 5- to J- dire<:tion. Short regions d the ONA/RNA helix me tmnsiently produced. The RNA transcript is singlt'-Sl:rnnded. The nucl('()[ides that s\'mht:sizt' RNA are the ribonucleo;:ide uiphospllates (ATP, 1.JTp, CITP, and CTP). (Reprinted with pennission from Alberts B. Brny 0, Juhn'lOl"l A et al: Essential UU ~; An Inmxfuction fa tho! MoIeodar BiokJg:, of tho! Ceu_ New York. Garland, 1998, p. lI5.)

III. TRANSLATION (Figures 8-3 and 8-4) has the following characteristics

A. It is lht:' lIIl-""Chanism by which the mRNA nucleotide sequence is translated into the amino add sequence of a protein.

B_ h OCCUI"ll in lilt: cytoplasm using rough endoplasmic reticulum (rER) and polyribosomes. C. It del;:lXlcs II set of three nucleotides (codon) into one amino add (e.g., GCA codes fOt alimine; UAC l;:odcs for tyrosine). The codon is n.-dundant (i.e., more t.han onc codon specifics one ~l\\ino acid (e.g., GCA, GCC, GCG, and GCU all specify alaninc; UAC and UAU bot.h specify tytosine). D. It

tRNA. which has twO important binding sitl.'S. The first site (anticodon) binds lhe complcmemary codon on the mRNA. The second site binds a pa.rticular amino acid. U.'>C5

to

E. It uses the enZ\'me amino:Kyl.tRNA synthetase. whkh links an amino acid to rRNA. Each amino acid has a specific aminoacyl·tRNA srnthetase. Because there are 20 different <Imino acids. there are 20 different aminoacyl-rRNA synthetase enzymes. F. It llloCS the cnt)'n'lC peptidyl uansferase. which helps to form the peptide bond ~twcen <Imino adili.

G. It R'(luircs an organelle (ribosome), which is:it complcx that contains at leao;c 50 ribosomal protcins and rRNA. Large ribosome assemblies are called poIyribosomes, or polysomcs.

H.

ribosomc moves along the mRNA in a 5' to 3' direction. The NHz-tltrminal end of a protein is synthesized first • .and the COOH·terminal end is synthcsiu..-d last.

TI1C


44

Chapter 8

C.-n

Nucleus Exons

lnlrons

DNA

/),>=

0

5' 3'

tI

Gene ANA transcript

3'

5'

RNA""""""",, III

5'

0=

~

tI t IRl<'f~~1

Add 5' cap and 3'-poly-A tail

ANA cap

.

I,

AUA

AAAA

mANA

mANA

5"

Protein

NH,

t[E"'''~ tI:'"""""':I

AAAA~

C()()t<

FIgure 8-2. Tr.mscriplion and processing of ribonucleic acid (RNA) into r~ngcr RNA (mRNA). All eucaryotic genes conc,in nnncodinf,l TCgaOllS (intrOllS) scparnt(."(1 by coding regions (exons). During tmnscriptiOll, RNA polymerase II ('"Jnscribes l'Olh intron .. nd ('xon Sl•.''Qucnces into an RNA trnnscript. A Y-Cllp and a 3'-poly-A tail are added. 1lw rntrons are spliced oot of dle RNA transcrip: by slOall nuclear ribonucleoprotein lXUt-icies (~nRN"5) Ithe COlllplCX i!i a sph~lfiOIneJ ~ dUit all d the eJ(0Il$ are joinro in sequence. The mRNA, with the 5--cap and dte 3--poly-A clil, exi~ the nucleus through the nuclear pore complex and emen the q'toplasm, when.- it is tr"nslmoo into protein. DNA - deoxyribonucleic acid. (Reprinted with penni$ion from Alberts B, Br...." 0, Johmon A et al: r~uilll Biology: An Illtroductioll ro the Mokcular Biolqa o{!he UU. New York, Garland, 1998, p. ZZ3.)

uu

Figure 8-3.

Tranlilation. Tllrl't 31nino ..ckls are linked ("mino acids 1, 2, and 3). Tr;llu;latiOIl is a three-step process thrt is repeated r",rn~' thues durin~ prOlCin liyntN.'Sis. The L'1lZylue lunil1Ollcyl.tmru;(er ribonucleic llcid (tRNN SynthcClSC linh a specific ~,mino acid with i~ sflCCific tRNA. In step I, the tRNA and llmino acid complex 4 bind to site A on the ribo!iorne. "T'he ribosome 1l'KWC5 310ng the ltlC5SCnger RNA (mRNN in" 5' to 3' direcrion. In 5tep 2, the CIU\'mc pep:kM tr..nsfcrase forn'lS 3 peptide bonJ between ",nino acids 3 3nd 4. The 5mall subunit ~ Ihe ril::nwnlt.' reconfigtJl'C5 and leavC5 MIl' A vacant. III step J, the used tRNA 3 is ejected. The riOCriotne is then re-,.dy fot' tRNA ,md amino ocid COll1tllcx 5. (RCIlrimed with penni5!iiOll. from Alberts B, Br.'!y D, JohnliOll A ct "I: b.~\lial UU Biology: All InrroductiolllO me MoIeCtlIm Biology of the CeU. New York, Carland, 1998, p. 230.)


Growiog aminO add chain

I Step 1 I 3' mANA

I Step 2 I

NH,

I Step 1 I

,. NH,

I Step 2 I


46

Chapter 8

As···· 3""

ATG GCA TAp @~A*.A~A~A;.~A~G~C~~~~~~ TAC CGT ATG CTT tTTT TCG GCA ATT --·5' Direction 01 rTlOY6merrt

DNA

"""TemPlate stmnd

RNA

"""'"""'" B

S'---·~UGIGCAIUAC I GAAIAAAIAGCLCGU UAA

DIrection of movement

---- 3'

c NH2 -

mRNA

met· ala' tyr • glu • Iys • ser • arg -COOH

Protein

Figure 84. Transcription through traru;latl0l1. (A) TIle deoxyribonucleic acid (ON!\) sequence, with tern· plate and nontemplate ~trands. Ril:onudeic llCid (RNA) polyme~ copies the tonplate ~trand in the J' to Y direction and produces rIlCS!lengeJ RNA (mRNA) in the 5' to J' direction. In mRNA. uracil (U) I""il'l! with adenine (A). (8) TIle mRNA nucleotide !;e(JUC.l\ce, which il'odioltes the so," codon (AUG), coden> (or each amino acid, and the MOp codon (UM). TIle ribosome reads the mRNA in as' 10 l' directkfl. TIle NH1-terminal end r:i the prlXein is svnthC5ized first, and the CCX)H-terrnilllli end is wmhesized last. (C) The :lnlino acid sequence r:ithe protein. AUG - methionine (mer); GCA - "Ianine (ala); UAC - tymsmc (I)T); GAA = glutamic acid (gill); AAA -I~inc (I)'$); AGC - S(.'I"ine (ser); C'GU - arginine (arg).

I. It begins with the start codon AUG. which codes fOf methionine. All newl\' s\tnthesizoo proreins have methionine as their first (or NH1 -temlinal) amino acid. Methionine L'I usually removed later by a protease.

J. It terminates at the stop codon (UAA,UAG,UGA). TIle stop codon hinds release factors that cause the ribosome to release the prot.ein int.o t.he cytOplasm.

IV. CLINICAL CONSIDERATiONS A. Systemic lupus erythemata;us (SLE) is a chronic autoimmune disease thai causes rashes. anhrit.is, and kidnc,' disease. to inflammation C3l1SC.-'<i by the Jer-ositiCln of the ami~ I:ody compl~xcs. Patients produce autoantibodies. frequently again.'if components of

1. The symptoms of SLE arc due the nucleus.

2. The snRNPs that (lrC uSt.'<l in RNA splicing were first characterized with antibodies from pat.ients wit.h SLE.


Protein Synthesis

47

B. 13" thalassemia is a genet.ic dise>lse whereby t.he affect.ed individu>ll is unable to synthesize t.he [3-globin prot.ein, and rims produces f>lr t.oo lit.t1e hemoglobin. This causes severe anemia in t.he affect.ed individual.

1. Adult hemoglobin consists of two a--g1obin proteins and two f3-globin proteins. The f3-globin gene has three exons and two introns. The introns contain a G-T sequence that is responsible for the occurrence of correct RNA splicing and the formation of nomlal l3-globin mRNA. 2. In [30 rh>ll>lssemia, [he G-T sequence L~ mutated to A-T such that com:ct RNA splicing does NOT occur, and the defective f3-glubin loRNA cannot be trnllslated into [3-globin protein.


9 The Nucleolus

I. ORGANIZATION OF THE NUCIÂŁOLUS (figure 9.\) A. 1llC." nuclcoluscontains approximately 200 copies of ribosomal ribonucleic acid (rR A) gencs peT haploid b'cno,nc. B. The 200 copies of rRNA genes are arranged in clusters called the nucleolar organizer on chromosomes 13. 14. 15.21, and 22. C. The rRNA genes within the nucleolar organizer are arrangl..-d in a tandem series. D. RNA polymerase I transcrihcs the rRNA genes to (ann 458 RNA. E.

Anllth~r sct of rRNA gem..-s is Icx:.'ued outside the nucleolus. RNA polymerase 111 transcribes these genes to form 58 RNA.

II. ASSEMBLY OF THE RIBOSOME (figure 9.2) A. The 455 RNA joins 55 RNA, riboscxual prolcin, RNA- binding proteins (e.g., olin), and small ribonuclcar proteins (snRNPs) to form a larye complex.

nucle~

B. The 455 RNA in the large complex is CUT into 5.8S RNA, 18S RNA, and 288 RNA. The large complex then split.s into two subunit.s: 1. The 408 subunit, which contains ISS RNA. 2. The 60S suhunit. which contains 55 RNA, 5.85 RNA, ancl28S RNA.

c.

llu..-sc subunits are transported through nuclear pores into the q'tuplasm, where the~' are assembled imo ribosomes.

III. ULTRASTRUCTURE OF THE NUCIÂŁOLUS (sec Figure 9.2) A. The fibrillar center i<; pale,st.'1ining and cootaim transcriptionally inactive DNA. B. The dense fibrillar component is dense-stflining and conlains transcriptionnUy active DNA. RNA polYffierdsc t, and 455 RNA. C. The granular component contains maturing ribosomal PrL'Cursors. including 455 RNA, 55 RNA, ribosomal proteins, RNA-binding proteins. and snRNPs.

48


The NlJ::leoIos

49

A

R-.( protein

B

\ Tandem

series:

I

rANA gene 1

I

~ 1-',R::cNcA gen-,-:1'1

c

Figure 9-1. Org;.milation of the nucleolus. (A) TIle non-membrane-bound nucleolus (dotted lines) contains DNA 10Clp5 from chrolll()l;()ffie5 13, 14, 15, ZI, and ZZ. TIle rRNA genes are organiz:ed on tll('Se DNA loop; as nudoolar organizer!l (small box). The 55 RNA is transcribed by genes dlllt are located OUtlikie the nucleolus. (B) The nuclcolnr organiZl'r. Three rRNA genes are tlIT'J.ngW in a raode,n serie!> al'ld separated by ~r DNA. During uarn;cription of rRNA genes, a Ovist'llllS t~ I~uem is !;e'en ullr-.lStruaural1y. II ptnicle that corresponds to RNA poIymer-M;e I, 45$ RNA ~TlCnts of Vlll)'ing Icngrhs. and a lJartidc that cone;;pcnds to ribOliolllal proteins thllt lire in\"oh路ed in early pocluiging arc sho...,). (e) Electron micrograph of an rRNA gene lhllt is undergoing uan'iCription lind shows the Ouistmtl!l tree IXlttetn. (Courtct>y ,)f Ulrich Scheer. Reprinted with permission from Alberts B, Brny D, Jolmwn II ct al: &senrial Ceu Biology: An IntmducrjOfl to !he Molecular Biology of the CeU. New York. Garland. 1998.)


50

Chapter 9

...... """'"

•• •

• ••• Rbosomal • •

protein

Figure ~2. Assembly of the ribolome. The 455 recombinant riboo.uclck: acid (rRNA) join!; 55 RNA. rim. somal protein§., RNA.binding proteins (e.g.• nude-olin), Hnd small ribonucloorror.cin IXlTtICk:s hnRNPs) III (<<In a large complex. This complex splits into 4<:S and 60S sub.ulits. The subunjll. are tr.m:'l'um.J jnw the cytoplasm individually and as..<embled imo rilx:~,OIlT~. hun: Electron microgrllph of the nucleolus, includillJ: thl.' ~ fibrillar comp(lrftlt. graoolar ~m. and fib-ilbr cel\ttr. (Reprinted with rennission (rom E.G. J«dan and J. ~'ttn. Reprinted with permission from AI~1tS B, Bray D, Johnson A et :.1: Ewonrid Cell BivIogy; An Introduaion lOW Mcucular &oIoD ciw Cell. New York, Garl...x1, 1998, pp916- 917.)


:1.0 Mutations of the DNA Sequence

I. SILENT MUTATIONS (Figure 10.1) occur when a change in rhe nlldeolidcs alters rhe codon, but no phcnolypic change is seen in the individual. These mU[;ltions produce func_ tional proteins and may occur in: A. Spacer DNA, in which no gCnt"$ or proteins arl' altered (sec Figure IO-IA).

B. Introns, in which the protein is not altered because inlrons are spliced out as messenger rioonudeic acid (mRNA) is made (see Fil,'Ure 10-18). A mutation that occurs near a splice site may alter the protein (see VI). C. TIle third nuclCOlidc of the codon (see Fi~:urc 1Q-IC). This nucleotide is often nwtated without changing the amino acid (or which it codes. This silUation, called third nudcotKlc (base) redundancy, occurs because one amino acid has several c.odons.

II. MISSENSE MUTATIONS (Figure to-2A) occur when a change in a single nucleotide alters the codon so that one amino acid in a protein replaces another amino acid. These mlJl~)[ions produce proteins with a compcnsatL-d function if they occur at <In active Of ell路 alytic site or if they alter the three-dimensional Sl"ructure of the protein.

III. NONSENSE MUTATIONS (K'C Figure t()"2B) llccur wh~n a change in a single nucleotide <lIters the codon and producCli a prcnmturc stop codon. These mutations produce nonfunction.... 1 (truncated) proteins tl1<1t arc unstable and readily dcgrocle<l. IV. FRAMESHIFT MUTATIONS (SL'C Figure 10.2C) occur when a delction or an insertion of a single nucleotide alters the codon and shifts the reading frame. These mutations produce nonfunctional ("garbled") proteins hccausc they change all of the amino acids that occur aftcr the deletion or insertion. V. TRANSLOCATION MUTATIONS (Figure 1Q..3A) occur when a section of a gene moves (mm its original location to another location, either on the same chronlOSOme Of on a differenr chmmosome. These mutations 0\.:1\' produce no protein. VI. RNA SPLICING MUTATIONS (SL'C Figure 10路3B) occur when a change in the nucleotide at the 5'路 or 3'. end of an inlron alters the codon and changes a splice site in the RNA transcript. These mutations produce no protein because the mRNA is unstable and rapidly dLl,'taded. 51


52

Chapter 10

A

Spacer DNA

DNA

B

Intron 1

Intron 2

lotron 3

DNA

~ I Transaiplion RNA lranscript

tI

mANA TrallSlation

FlfYr

prolein

c

• 5'

NH 2---

tI tI

TrallSCription

I 3'

Translation

5'

• • ~ I Transaiplion I CAS'

3'

DNA

mANA

I

---COOH

Protein

Figure 10-1. Silem mutlltion widlin (A) t1~ spocer deoxyribonucleic acid (DNA), (B) the intron, or (C) Ihe third nuclt."Ofidc of the cro.:I0n. RNA - ribonucleic ,ocid; mRNA - mcsscnger RNA. x - cite of mutation.

Rgure 10-2. (A) M~, (8) 1'IOn-~, and (C) fl"ltndlift mut.,ttons. DNA - deoxyribonucleic add; mRNA - messenger ribonucleic acId.


Mutations 01 the DNA SeQuence

A

53

, ONA

5'

j

I

..

~

~

mANA

B

,

5 ---1.~~

iJ ,

I

I

5'

DNA

5

5

~ IT""""'''''' I i

aEiJ

I

Protein

fV

Nonfunctional protein (truncated)

c

IF~=~tl 5'

3'

~ IT"""''''''":J 5'

...

3

1IT""""'''''' I NHr

3'

... ~

...

5'

ONA

~

mANA

IT"",""""," I

5'

5

•. COQH

,

3

~ IT",:",""'" I ··COOH

NHt ..

~, 1_"'1 protein

Proiein


54

Chapter 10

A

Chromosome 10

0""'""'000 I

rmiDl~

Chromosome 15

Chromosome , 5

Front 01 Gene 2

Part 011 Gene

!

Bad< 01 Gene 2

No protein produald

B

Intron 1

Intron 2

Intron 3

DNA

~IT~I

RNA """,,"pi

No Translation ~


Mutations of the DNA 5eQuence

55

VII. TRANSPOSABLE ELEMENT MUTATIONS (sec Figure 1O·3C) occur when a transposable clement (see Chapler 4) alters the codon and disrupts a gene. 11lcsc mUlalions produce no protein because they disrupt. the gene. Aldltlugh transposition is common in the human genome, it rarely disruptS a gene. VIII. TRINUCLEOTIDE REPEAT MUTATIONS (sec Figure !Q..3D) occur when a three· nuclcolide sequence (CAG. eGG, or erG) is abnormally repeated, SOIllCtimcsas many as 200 to ICC() times. These mutations cause Kennedy's syndrome, fral,oile X syndrome. myolonic dystrophy, and Hunti~'1:on's disease.

Figure 10.3.

(A) Translocation mutation. (8) Ribonoclcte acid (RNA) splicing mUl:ui(ln. (C) TraNfOSlbk clement murntion. (D) Trinocleotide repeal mutation. DNA '"' deoxyribonucleic acid; mRNA '"' messenger ribonoclcic acid


:1.:1. Molecular Genetics

I. POLYMORPHISMS

A. Definitions 1. A gene is a hereditary factor that in!cracts with the environment to produce a trait.

2. An allclc is an alternative version of

<l

gene or dcoxyribonudt:ic fldd (DNA)

segment.

3. A locus is the location of a gene or DNA segment on a chromosome. Because human chromosomes arc paired. humans have twO alleles at each locus. 4. A polymorphism is £he occurrence of two or more alleles at a specific locus in frequencies greater man can be explained by mutations alone. Polymorphisms arc common in noncoding regions of DNA (introns). A polymorphism is not a ffiUl3tion that causes a genetic disease; hm..'Cvu, a polymorphism can be used as a genetic marker (or a gene (e.g., the dysnophin gene in Duchcnnc type muscular d\'Strophy) when the ro1ymorphism and the dysnophin gene arc closely linked.

B. Types of polymorphisffis (Figure 11.))

1. Restriction frngmcnt Icnb>th polymorphisms (RFLPs) a. RFLPs eiTher create or destroy a restriction enzyme site. b. RFLPs are abundant throughout the hum:m genome and have been widely uscd in genc linkage and gene mapping swdies. 2. Variable number of tandt.'fn repeats (VNTRs) a. ~'TRs leave the restriction entyme site intac•• but altcr the length of the restriction enzyme frab'ffients as determined by rhe number of tandcm rcpeats. b. VNTRs are DNA sequences (11--60 ba'lC pairs long) that are repeated in tandem in the human genome ber....ttn restriction enzyme sites a variable number of times. C. Because VNTRs arc extremely polymorphic. twO unrelated people cannot exhibit the same genotype. d. VNTRs are used in DNA fingcrprintingand forensic medicine locstablish paternity, t}"gosiry, or idcntit), from a blood, semen, or orner DNA sample.

II. LINKAGE (COINHERITANCE) LFib~" L1-2] A. Linkage is the closeness of two or more loci on ~ chromosome. The loci sort together during meiosis.

B. Linkage refers to loci, not alleles.

56


Mole<:tJlar Genetics

57

Norm Poly

A

~I"-

BgII1-

p

~

Q

]

30 kb

22kb

~I"_p

BgIIl __

.... .. -

., " ,

APearose gel e ectrqlhbresis

Bkb

BglII--

Normal

Polymorphism

Norm

B

.,

~

.. - -

32.4 kb

Bgill __

Bgill __ p

Poly

40 tandem

repeals

Q

30kb

32.4 kb Aqarose gel eleclrophOresis

BgIII-Normal

BgIII-Polymorphism

Figure 11-1. (A) RFLPs. At fl I:crtainlOClJS on a chrotl105Ome, two RgllJ restriction enzyme sites produce a 30-kb fragment that is ol"'&"IVflble with <lb"m:x.c gel electrophoresis. A third Rgl II rcSlJ"iCtiOIl COZylllC site produces fl 22-kb fragment and an 8-kb frab'lllcnt. (D) VNTRs. At a cerrain locus on a chroll\OOOll1c, two P.gl II reWietion enzyme sites produce a JO-kb fragment that is ob>ervable with ag;lTosc gel elccnophow.;is. The VNTR has 40 lanclem repeats of ffJ base ~irs (40 x 60 '" 2400 base pairs) inserted to produce a 32.4-kb fragment. RAJ's and VNfR.~ trot atC doscly linked to a ccrt<lin gLue (c.g., the clystrophin gene) provide a genetic marker for the b~ne and allow the inheritance of a mutation to be tr,n;ed in an affL'Cted filmily. VNTRs are usually beneT markers than RAJ's.

C. LinhJge occurs because crossover (the exchange of DNA betwl.'Cn homologous chromo~ SOlllCS that occurs in meiosis I during chiasmaw formation) rarely occurs between loci that are close together.

D. It can be measuTLxl only in family studies (pedigrees) because meiosis that is required to demonstrate linkage occurs only during gamefogenesis. Consequently, only family members can be used to det.ermine linkage.

E. Table II ~ I shows the units of measurement of linkage. 1. Ccntimorgans (eM) 2. Recombination fraction (8)


58

ChaPter 11

I Meiosis I

I

Meiosis II

A

(gameles)

, B

Ao B b

b

, B

Synapsis

B

b

-

, B

b

•b

B

Parentals

Chiasrreta

"'" '"'''''''''' 1-, I

B

,

Meiosis n

t

(gameles)

, B

,

.

.-..,

B b

b

B

• b

B

b

-' B

, •

_... b !

Chiasmata

and CfOSSOller

B

,

b

Parentsls

(II) High linkllgc (0 eM, 0.00 9 '" 0.0%, LODscore 2: '3). In meiosis I, [\.\'0 h01l101o~'Ouschro. mosomes undergo S}'n3llliis (pairing ofhomolqrous chl'()rnO!;Ornes), chia<;mara, and Cr06S0ver. In r:his eliSe, the loci (bars) arc close to(,'Cthcr, and the alleles (A, B. G, and b) are llotscpal".lIed by crossover. In meiosis II, galnetes that are formed have the ~me allcic pattern as ,he paf\-'lllS (~J. (B) No lin~'C (50 dvt, 0.50 9 - 50%, lOOSCOl'e S-Z. In meiosis I, 1\\'0 homologous chromosomei Ul~ synapsis (plIiring of~1ogous chromosomes), chiasmarn. and Cro5IiOvcr. In this 0I5e. the loci (InrsJ ~ far apan, and the alleles (A, B. G, and b) aU' Agure 11-2.

me

rnat

separated by ett:l65O\'er. In mckI6Ls II, the gametCS a~ funned NWC (parenuW) as "..d l as alleles in a different pattern (TtICOI'IlI:mams).

me same allde pattern as the parenc;

3. Logarithm of the odds (LOD) score: Because one pedigree usuaUy docs not provide convincing evidence of linkage, darn from a numlx:r of JX.·digrccs arc combined and

cxpressed

:.IS

a LOD score.

F. Adult polycystic kidney diseasc (APKD) is a clinical example of linkage (figure 11·). III. POPULATION GENETICS

A. According to the Hardy-Weinberg (genetic) equilibrium theory, allele frequency and b'COOtyPC frequency in a f'OPU1alton remain constant from gencrntion to ~ner.nion as long

me

as nooutsidc influence affects frequencies (e.g., no murnlions occur, noscloction occurs, mating is random). This theorem is fundamental to the study c:i population genetics.


Molecular Genetics

59

Table U-1... Measurements of LinhJge Recombination fraction 9 %Recombination (%)

LOD Score

0

0.00 9 = 0.0%*

?: +3

1 5 10

0.01 9 = 1.0%' 0.05 9 = 5.0%' 0.10 e = 10%'

?:'3

50

0.50 e = 50%'

::; -2

centimorgans (eM)

Unkage

High

Intermediate

[I

~

None

-0'l6 chance of crossover belv"een loci. 1% chance of crOSSO\'Cr bc1v>-ew loci. , 5% Chance 01 crossover between loci. ~ 10% chance of crOSSOver betwoon loci. , 50'l6 chance of crossovcr between loci. +

Hardy~\Veinberg law states tMt for:1 locus with two alleles (S and s) with frequencies of p and q. respectively, the genotype frequencies are:

B. The

1. SS=pz 2. Ss

=:

2pq

3.ss=qZ

C. Examples of the

Hardy路\Veinbe~law

using sickle cell anemia

1. Example I

a.

Question: Wlllit is the genotype frequency of homozygous norffi<ll bl<Jck Americ:1OS for sickle cell anemia if the S <lnd s <lUcie frequencies <lre p .. 0.96 <lnd q = 0.04, rcspL'Ctivcly? b. Solution: Homozygous nOO1m! individuals h:1ve a genotype ofSS. The genotype frequency ofSS = pZ. Therefore, 0.961 = 0.9216, or 92.16%. Dividing 100/92.16 = 1.08. 1l1erefore, the frequency of n01"lrul1 individu:11s who :1fC homozygous for sickle cell anemia is 92.16%, or I of 1.08 bl<lck Americ<lns.


APKD

A

K

AI'l<D

,,{ Father

..

,

• k

K

with

APKD

..

,

Normal

mot"',

Normal

A

k

• k

Figure 11-3. Oinical example oflinbgc: adult pol~q~ic kidney clisc3se (APKD). APKD is an autOl\Oll1al dominalll di~. soan)'OOe who has a Kgene has APKD. In mis exampk, the rnriter (Kk) has APKD, but r:hr mother (1Jc) does not. How can polymorphism and lin1:~:c be ~ [OOOUJ\liCI these parcrw; about the likelihood r::i AJ'KD in rheir off!ping~ Assume an RFLP (an A allele or all .. aUck) is fcund aI: a locus that is 10 eM from K or k so the RFlP can be used a'l a l,'I=netic marker. TIle ky 1,0 this question is [() C(lIwe.n me ccmi~l \'a1uc to a percenmgc (sec Table 11-'). lbere are (our po.;stbi.lities roconsider. I) If offspring has the A ..ltele, men r:hcre is a 90% chance that he will inht.'fit the K genII' and have APKD. The 90% fi5,'lJrt' is determinoo by subttaeting the chance of Cl"Cl$SOVl'T b.'t....'CL'1\ loci (10 eM .. )0%) (rom 100% (ICO% - 10% .. 90%). 2) I(,he offspring has the a allde, then mere is only a 10% chance thaI dlC will inherit the K gene and have APKD. The 10% ftbflJTC is dctcnninLxI hy knowing Ih:u me distance bel:Wecn the two lod is 10 eM (10 em .. 10%). The emmec of crQ6S0ver lJctl'.'een the loci is 10%.3) If the off,pring has the /I. allele, then there is only a 10% chanec that he will inherit the k gene and ~ normal. The 10% figure is determined by knowing thaI the distance between the twO loci is 10 eM (10 em" 10%). The chance of cl'l:J!l9)ver bct\\,«n the loci is 10%. 4) If Ihe offspring has the a allele, then there is a 9O'K> chancc rhat she will inherit the k gene and therefore be normal. lr.c 90% fIgUre is detenTlinoo by SUbtractil18 the dl:lllCC of c~ver ~twccn loci (10 eM .. 10%) from 100% (100% - 10% .. 90%). In this way, poI\'fIlOIl)hism 300 linkage can be used to COl1l1SCllhese parents about t~ ~ rhat their offspring will have APKD.

mat

mal

me


Molecular Genetics

61

2. Example 2 a. Question: What is the genotype frequency of heterozygous c~rriers for sickle cell ~nemia among black Americans if the Sand s allele frequencies are p '" 0.96 and q ~ 0.04, respecrivelyr b. Solution: Heterozygous carriers Mve a genotype of Ss. The genOlypc frequency of S~ = 2pq. Therefore, 2 xO.96 x 0.04 = 0.0768, or 7.68%. Dividing 100/7.68 -13.02. Therefore, the frequency of heterozygous c~rders for sickle cell anemill is 7.68%, or 1 of 13 bl~ck Americans. 3. Example 3 a. Question: What is the genotype frequency of sickle cell anemia in the black American population if the S ~nd s allele frequencies ~re p '" 0.96 ~nd q = 0.04, respectively! b. Solution: Bcc~use sickle cell anemia is an autosomal recessive diSClolse, bl~ck American~ who are affl.'Ctcd by this disease Mve 2 genotype of ss. The genotype fTequmcy of ss '" ql. Therefore, 0.04 1 - 0.0016, or 0.16%. Dividing 100/0.16 = 625. Therefore, the frequency of sickle cell anemia is 0.16%, or I of 625 black Americans. 4. Example 4 a. Question: If the ffl.'Quency of sickle cell anemia in the black American population is 1 of 625, what is the ~lIelc frequency (q) of the s allele? b. Solution: If the genotype frequency of the ss genotype (i.e., an individual who has sickle cell anemia) is I of 625, then 1/625 = 0.0016. Because the genotype fTequency of the ss genotype '" ql. then ql = 0.0016. Taking the square root., q = 0.04. Therefore, the allele frequency (q) of the s allele is 0.04. D. According to the mutation-~Icction equilibrium, gene frequencies in a population are maint~inl.'(l in equilibrium by mutation that replaces abnonnal genes that are selectively lost by death (genetically lethal disease) or reproducrive failure.

1. Autosomal dominant disease a. If every carrier of ~n ~bnonnal gene dies or cannot reproduce, then every new case arises fTom ~ new mutation. 1l1erefore, if the number of people with the disease is 0 ~nd the number of (x:ople in the population studied is N. then the disea~ frequency = DIN and the mutation frequency = O/2N. b. Example (1) Question: In a study of ~chondroplasia, 7 new cases were documented ~mong 250,000 births. What are the dise~se frequency ~nd the mut~[ion frequency! (2) Solution: The disease frequency = DIN = 7/250,('00 = 0.00J03, 01'3.0 x 10-\ or 0.003%. Dividing 100/0.003 = 33,333. Therefore, the dise~se frequency is 0.00003, or 3.0 x 10-\ or 0.003%, or 1 of 33,333 people. The mutation frequency = D/2N = 7/2(250,000) - 0.00J014, or 1.4 x 10-\ 01'0.0014%. Dividing 100/0.0014 = 71,428. Therefore, the mutation frequency is 0.000014 or 1.4 x 10-\ or 0.0014%, or 1 of 71,428 people. 2. X-linked recessive disease (genetically lethal in milles) a. If every c~rrier of the abnormal gene dies or cannot rl.l'roduce, then every new case must arise from ~ nl.'W mutation. Therefore, if the number of people with the discR<;e is 0 and the number of people in the population st.udied is N, then the disease frequency = DIN and the mutation frequency = D/3N. (The mut.ation frequency is D/3N because in a population of equal numbers of males and females, only one-third of the X chromosomes occur in the male and two-thirds occur in the female.) b. Example: In a study of fmgile X syndrome, 15 new c~scs in ooys were documented among 250,000 births. (1) Question: Wh~t ~re the disease frequency and the mutat.ion frequency!


62

Chapter 11

(2) Solution: The disease frequency" DIN '" 15/250,OCXJ - 0.0CXXl6. or 6.0 x Io-S, or 0.006%. Dividing 10010.006 â&#x20AC;˘ 16.666. Therefore, the disease frequency is 0.<XXX>6, or 6.0 x 10"-\ or 0.006%. or 1 of 16,666 people. The murntion frequency = D/3N .. 15/3(250,<XXJ) - 0.00002, or 2.0 x Io-S, or 0.002%. Dividing 100/0.002 = 5O,<XXJ. Therefore. me mutation frequency is 0.CJCO)2, or 2.0 x 10-\ or 0.002%, or 1 of 50,<XXJ people.

E. Genetic drift and the founder effect

1. Genetic drift is the nmdom flucmation of allele frequency in a small population 1x.'C:lUSC

the rool of genes pass<.'d from generation

[0

genemtion is small.

2. Founder effect is a type of j.;enetic drift that {X:curs in populations thm descend from a snlllll number of founding individuals. An allele may occur at a high frequency in the population becausc it was prescnt in II high frequency llmong lhe founders. A well-doculllcmed instance is the Afrikaner population in South Africa. which dcs:ended from a few hundred people who migrated from the Netherlands. The Afrikaner population has a high frequency of Hunrington's discllSC, porph)'ria variegam. and lipoid proteinosis.


1.2 Inherited Diseases

I. AUTOSOMAL DOMINANT INHERITANCE A. Introduction. Diseases that have autosomal dominant inheritance affect individuals who have only one defective copy of the gene (from either parent).

B. Example: Huntington's disease (HD) [Figure

12~1]

1. The chumcteristic dysfunction is the cell death of cholinergic neurons and

~

aminobutyric acid (GABA) ,ergic neurons within the caudate nucleus (corpus striatum). This cell deuth causes choreic (dance~like) movements, mood distur, barlces. and progressive loss of mental activity. No treauncnt is available.

2. The HD gene is located on the short (p) arm of chromosome 4 (4p). 3. The HD gene encodes for an unknown protein. 4. The lOechanism that causes neuronal cell death in Huntington's disease may involve a hyperactive N.methyl.d.-aspartate (NMDA) receptor. 3. Because glutamate is the principal excitatory tnmsmitter in the brain, most neurons have glutamate receptors. One of these receptors is called the NMDA receptor because it is selectively activated by the glutmnate agoni~t NMDA. b. In normal synaptic transmission, glutamate levels increase tnmsiently within the s\'naptic cleft. However. neuronal cell death (g1utallUl.te toxicity) occurs us a result of excessive and diffuse release of glutamate. c. Glutamate toxicity is caused by excessive influx of calcium into the neurons. This influx is caused by the sustained action of glutamate on the NMDA receptor. d. The mutation of the HD gene on 4p causes hyperactivity of the NMDA rceep~ tor. This hypcmctivity causes excessive influx of calcium into the neurons of the caudate nucleus, and cell death occurs a~ a result.

II. AUTOSOMAL RECESSIVE INHERITANCE A. Introduction. Diseases that have autosollUl.l recessive inheritance affect only individuals who have two defective copies of the gene (one from each parent). B. Example: cystic fibrosis (CF) [Figure 12.2]

1. The characteristic dysfunction is the production of abnormally thick mucus by the epithelial cells that line the respiratory and gastrointestinal tmcts. This thick mucus obstructs the pulmonary airways and causes recurrent bacterial rcspirdtory infections. 2. The CF gene is located on the long (q) arm of chromosome 7 (7q) between bands q21 and q31.

63


64

Chapter 12

Hh

hh

0

y

A

o

o

••

M,~

Female MaJewilhHD Female with HD

B p HD gene q

Chromooome4

!

Transcription RNA splicing Translation

?~19" L-VV~lified)

Cholinergic neuron or GABA·ergic neuron

Caudate nucleus

Figure 12-1. (A) PLxligrce of Huntington's disease, an example of autosomal dOfnmam inhermmce. HelerozYb'Otes (Hh) arc ..ffected b)· Huntington's disease. Homozygous reccssivcs (M) arc not affccted. (Reprinted with permission from Fricdman LM; Grnelin. Malvcrn, PA, Harwal, 1992, p 46.) (8) Location of the f-lD bocne on chromosome 4 (4p). TIIC HD gene has flOt been cloned, and its prOlein has not been identifiLxI. Howcver, the protein m:ly produce a hyperactivc N-mcthrl.d·aspamlte (NMDA) receptor that causes execssh'e influx of cakium into the ncurons of the caudate nucleus, causing cdl death. RNA • ribonudek acid; GABA - ~-aminobut)TK; ackl.


Inherited Diseases

A

9T2 ~

qTP

o ...... o Female

~cc

ooo~o

65

• •

0

ce CC Cc r-TT--1 Cc cc

Male with CF Female with CF

D.O.

cc cc ce cc B

Inlrons p

T~""",_

q

ANA splicing

1

Tf8nSlaion

~7

Phosptlorylaled

eFTR

Figure 12·2. (A) Pedigree of C)'t;{ic fibrO'iis, an example of aut($)ffi3.1 recessive inheritance, Hcrerozygcxes (0:) are not affcclcd, bul homozygolL'; reccssi,'cs (cc) are. (8) Location of the CF I,oene on ehl"l)rT'X)M)lllC 7 (7q). 1bc CF gene has 21 exons that are sepanucd~' numerous intl'Of\5. The CF gene codes (or iI I~mino acid pnxein called c)"slic fibrosis mmsponer (CF1ll.). CFTR is a 0- channellhat is regulated by phosphorylation. When CFTR is dcp~lated, the channel is clo6ed. When CFTR is p~horylatcd, the a- channel is open. Mutation often occurs al phcnyWan~ JXl5ilion ~ (~508). RNA - ribonudeic acid

a-


66

Chapter 12

3. The CF gene encodes for a protein callcJ protein functions us a CI- ion channel.

cy~tic

fibrosis mlOsporter (CFTR).

Thi~

4. A mutation in the CF gene demoys the CI- trallSf.Crt function of CFTR.

5. In Nonh America. 70% of casb of qstic fibrosis arc caused by a thrcc路basc deletion that codes for the amino acid phenylalanine at position 508. Because of this deletion, phenylalanine is absent from crn~.

6. CFTR has several membr.me-spanning regions and a centml region that binds a. In dcphosphorylatcd CFTR. the a- channel is closed.

PO~--.

b. In phosphorylated CFTR. the a- channel is open.

III. X-UNKED RECESSIVE INHERITANCE A. Introduction. Di.scascs that have X-linked ll.'Ccs.sive inheritance usual1y occur onl\' in males because males ha,re only one X chromosome (i.e., they arc hemizygous for X路linked genes). Heterozygous females arc c1inicall)' normal, bot may ha,'c subtle clinical features (e.g., imemlcdiate enzyme levels). These diseases occur in females when onc of the twO X chromosomes is inactivated Juring the late blasta:yst: stage to form a Barr body. This process is called dosage compensation. Inactivation of eitht:r the matern<llly or paternally derived X chromosome is <l random and permanent event. Dosab'C compensation involves methylation of cytOllinc nuclootidcs. If the X chrolTlOSOme that contains the normal genc is inacti\~d.tcd. the female has one X chromosomc with the abnormal gene and therefore has the disease.

B. Example: Duchennc typc muscular dystrophy (DMD) IFigure 12路3]

1. The char.lcteristic dysfunction is progressive muscle weakness and wasting. Death occurs as a result of cardiac or rcspirdtory failure, usu<llly in the late tcens or twentics.

2. Duchenne muscular d)'st'rophy is caused by X-linked recessive mutations Ii.e., males who have only one defectivc cop\' of the DMD gene (from the mother) havc thc diseasel.

3. The DMD gene is located on _he short (p) arm of chromosome X in band 21 (Xp21). 4. The DMD b"CllC encodes for a prOlcin called dystrophin. This pfOlcin anchors the cytoskeleton (actin) of skeletal muscle cells to the ext:raeellular matrix with a transmembrane protein (a路dystrogl\'Can and 1l-<!ySlroW)'Gltl) and srnbilites the cell membrane. 5. A mutation of thc DMD b>C1lC destroys the ability ci dystrophin to anchur actin to the extracellular matrix.

IV. MITOCHONDRIAL INHERITANCE A. Introduction. r:hscases that ha\'c mitochondrial inheritance arc caused by mutations in the mita:hondrial DNA (mtDNA). TIlCy are inhcrited entirely through maternal trans. mission because spcnn mitochonJria do not pass into the ovum at fenilization.

B. Example: Leber's hereditary optic

nt~uropathy (Figure

12-4)

1. The charactcristic J.,.-sfunction is progressive optic nerve dcgcner..tion that causes blindness. 2. Approximarely 50% of all cases involve thc ND4 gene located on mtDNA and occur when a missense mutation changcs arginine to histidine.


lrtlerited Diseases

A

o

Male

â&#x20AC;˘

Male with OMD

67

0_

B Exons

p

Introns

,

DMD gene q

x

y

Dystrophin

eax:oro:lxJ======

Actio

Figure 12-3.

(A) Pedigree of Ducherme type mU5CUlar dystrophy, an example ci X-linked receR;i\'c inherbe hemil)"f,'0U5 for the DMD gene (dJ becall!ie tM Y chrOIll'106Olne has no COITC5fXlO(Iing DMD gent. Hetnit)'gOlI!i reccMh-e (dJ rnales are affected b}' ~nne type ml8:ular d)'Strophy, but hctet'Ol),gou; (Od) females are not. (B) locar:kJn of the DMD l,'Cl'le on chrotr\O'iOlTll: X (}(P21). TIle DMD gene CQl'"L';r;t!; ci exons thaI are separated by numetOUl' imrons. The DMD gene codes for a 4(X)()...amino acid protein called d}"Sl:rophin. O)'5trophin anchol"S actin filaments 10 the cxt:rllCCllular matrix through a transmembrane protem that ((ITl5iSl:s of a-drsuoglyC8n and IHlrwog1rcdJ\. RNA - ribonucleic acid. ifanCe. Males mal'


68

~er12

o •

A

¥

I

o

0

••

I

Ma~

Female Male with LHON Female with LHON

I

B Matrix

lntermerrbrane

,pace

g

""'gene

(no introns)

. . Subunit 4 of NADH ,..

dehydrogenated

oom"""

Location of NADH dehydrogenase COrll)lex on the cristae


Inherited Diseases

69

3. The ND4 gene encodes (or a pr()[ein called subunit 4 of the NADH dehydrogenase complex (reduced nicotinamide-adenine dinucleotide (NAD)J. This protein fune, tions in the electron transport chain and aids in the production of adenC6ine triphosphate (ATP).

4. A mutation o( the ND4 gene decreases ATP production. As a result, the demands o( "1Il acrivc neuronalmcrabolism cannot be met.

V. MULTIFACTORIAL INHERITANCE is discussed in Chapler 13. VI. TABLE OF INHERITED DISORDERS (T,ble J2-ll

Figure 12-4. (A) Pedigree of Leber's hereditary opt:ic neuropathy, an example of mitochondrial mherilance. Leber's hereditary optic neuropathy is inherited maternally. (Reprinted with pcnnission frum Friedman LM: Grnefics. Malvern, PA, I-larwal, 1992, p 51.) (B) Location of the NO'! gene nn circular rnitochondrial dcoxyribonucleic acid (mIDNA). Like all mitochondrial genes, lhe NO'! gene contains exoos, bUI no introns. The ND<l b'ene codes for subunit 4 of the NADH dehrdrogenase complex lreduced nicotinamideadenine dinucleotide (NADl). The NADH dchrdrogenasc complex (I) is shown on the cristae at the start 0( the respiratory chain (I-IV). The transfer of electrons along the respiratory chain is coopled to adenosine triphosphate (ATP) synthesis. TIlLs c(1lpling is caused by the pumping cI H' into the intennembrnne space. Th~ H' is su~ucntlv used lOdrive ATP synthesis. ATP s\'nthesis is catalyzed b)' ATP synthase (V) as Hflows back into the matrix through pores in ATP synthase. /I • succinate deh\urogena.se; 11/ .. ubiquiT\QOC' cytochrome c oxidon:duc[3!;e; IV • cytochrome oxidase; UQ .. ubiqUinone; ADP .. adenosine diJ)l105J)hate; P, • inorganic phosphate.


Table 12-1. Inherited Disorders Autosomal Dominant Disorders a-\-antitrypsin Acnondroplasia Aetocephalosyndactyly Adult polycystic kidney disease Alport's syndrome Bor Syndrome Brachydactyly Cleidocranial dysplasls Craniostenosis

Crouzon's disease Diabetes associated with

defects in the genes for glucokinase, HNF-1a, and

HNMa Ehlers-Oanlcs syndrome Epidermolysis bullosa

Familial Hypercholesterolemia (type lIa) Goldenhar's syndrome

Heart-hand syndrome Hereditary spherocytosis Huntington's disease Marfan syndrome Myotonic dystrophy

Neurofibromatosis Noonan's syndrome Osteogenesis imperfecta Treacher Collins syndrome

von Willebraoo's disease Waardenburg's syndrome Williams-Beuren syndrome HNF路hepatocy1:e nuclear factor.

Autosomal Recessive Disorders

a-{halassemla Adrenogen~al

syndn>nle

Albinism Alkaptonuria Ataxia telangiectasia I}-thalassemla Branched chain ketonuria CyStiC Fibrosis Cystinuria Dwarfism Erythropoietic porphyria Friedreich's Ataxia GalactosemIa Glycogen storage disease Hemoglobin C disease Hepatolenticular degeneration Histidinemia Homocystlnuria Hypophosphatasia Hypothyroidism Infantile polycystic kidney disease Laurence-Moon syndrome lipidosIs Mucolipidosis Mucopolysaccharidosis Peroxisomal disorders Phenylketonuria Premature senility Pyrwate kinase deficiency Retinitis pigmentosa Sickle cell anemia Tyrosinemia

X-Ilnked Disorders Recessive Ouchenne type muscular dystrophy EctOdermal dysplasia Fabry's disease Fragile X syndrome Hemophilia A and B Hunter's syndrome types A and B IChthyosis Kennedy's syndrome Kinky.tlair syndrome Lesch-Nyhan syndrome

leukocyte G6PD defIciency Testicular feminiZation WiskotMldrich syndrome Dominant GOltz syndrome Hypophosphatemlc rickets Incontinentia pigmentl OrofaciOdigital syndrome

Mitochondrial Disorders Cardiac rhythm disturbance? Cardiomyopathy? Infantile bilateral striated necrosis Kearns-Sayre syndrome Leber's hereditary optic neuropathy

Multifactorial Disorders Cancer Cleft Lip Cleft Palate Clubfoot Congenital heart defect Coronary artery disease Epilepsy Hemochromatosis Hirschsprung Hyperlipoproteinen types I, lib, III, IV Hypertension Legg-Calve-Perthes disease Pyloric stenosis Rheumatic fever Type I diabetes (associated with islet cell antlbodl Type II diabetes (associated with Insulin resistanCE and obesity)


:1.3 Multifactorial Inherited Diseases

I. DEFINITION. Multifactorial inheritance involves genes thut have u smull, equal, and additive effect (genetic component) as well as an environmental component. Both components contribute to the tendency for certain diseases to develop. When only the genetic component of a multifactorial disease is discussed, the [cnn "polygenic" is used.

II. EXAMPLE: TYPE I DIABETES (F;gure 13.1) A. The chamctcristic dysfunction is destruction of the pancre'dtic beta cells tlllit produce insulin. Affected individuals have hyperglycemia, ketoacidosis, and exogenous insulin dependence. Long-tcnn effects include neuropathy, retinopathy that leads to blindness. and nephropathy that leads [0 kidney failure. B. Genetic and environmental components

1. Type I diahch.'S demonstrates human leukocyte antigen (HLA) association, specifically with HLA~DR3 and HLA-DR4 loci. 2. These loci are located on the short (p) arm of chromosome 6 (1'6),

3. The loci code for cell surface proteins that arc srnJctumlly similar to immunoglobulin proteins. TIley arc expressed mainly by B lymphocytes and macmphages.

4. It is hypothesized that genes closely linked to the HLA-DRJ and HLA-DR4 loci may alter the immune response. As a result, affected individuals have an immune response to certain environmental antigens (e.g., a virus). The immune response "spills over" and leads to the destruction of pancreatic beta cells. 5. Markers for this immune destruction of pancreatic beta cells include autoantibodies to glutamic acid decarboxylase (GADM ), insulin, and tyrosine phosphatases IA~2 and IA~2P, The autoantibodies may destroy the pancrc-dtic beta cells, or they may form after these cells are destroyed.


72

Chaptef 13

p

-

q

Chromosome 6

Spilt0\l6r

B_.

Spillover

Figure 13-1. 1-lnJOlhetic;al model of mullifactorial inhemanc::e of type I diabetes. The short (p) arTn of chromollomc 6 cont"dins lhe human leukocyte antigen U-ILA.) complex_ The HLA-DRl and HLA-DR4 loci p'obabI.~' code for cell-surfac:e pll)(eins mal Slrocrurally rf$eInble immW'lO(:lobulins. Genes lhal arc closely linked to t~ loci may alter the immune response. The narurc and role of lhe!.e linked genes arc nor known. In response to an environmental antigen, lhe immune resporue spills o\'er, and pancreatic beta cells arc dcsrro..-cd. Patients with type I diaberes ha\'e serum aUloantibodies to glUlamic add decarboxylase (GAD6S ), insulin, lind tyfO'iinc phosphata;;cs lA-2 and IA-213_


1.4 Proto-oncogenes, Oncogenes, and Anti-oncogenes

I. DEFINITIONS A. A proto.-onCOf,tene is a normal gene thal encodes a protein dul.I stimulates the cell cycle. B. An oncO(,.oene is a rnurnted prom路oncogene. h encodes an oncoprotein thO'll disrupts the nonnal cell cycle and causes cancer. C. An anti-cncogene (tumor.suppressor gene) is a normal gene

dUll

encodes a pnxcin that

suppresses the cell qde. II. DESIGNATIONS A. Proto-oncogenes and

onc~nes

have imlicized mree路letter designations, such as ras.

B. An oncogene that occurs within a virus has the prefix "v." An example is v路ras. C. A proto-oncogene that occurs within a cell has the prefix "c." An example is c-ras. D. The protein that a proto-oncogene or oncogene encodes has the S3me three路lcncr designation as the prow-oncogene or oncogene. However, the lenn is nm italiCized, and the first Icncr is Capi[lllized. An exmnplc is Ras.

III. CLASSIACATION OF ONCOGENES. The cell q'de is regulated at four SGlges (i.e., growth factor, receptor, signal mmsducer, nuclear trnnscription). O1cogenes occur ~l each SGlge and ~re grouped into foUT classes (Table 14~ I). IV. MECHANiSM OF ACTiON OF THE A. The ras prOlQ-oncogene encodes (GTPase) activity.

~

ra. PROTG-DNCDGENE (F;b~"'

14-1)

normal G protein that has guanosine tripha;phat3Se

B. The G protein is anached to the cytoplasmic face of the cell membrane by the lipid far, nesyl isoprenoid. C. When a hormone binds to its receptor, the G protein is activated. D. The activated G protein binds guanosine qcle.

triphosph~te

(GTP), which stimulates the cell

E. The activated G protein splits GTP into gwnosine diphosphate (GOP) ~nd termin~tl~s the stimulation of the cell qcle.

~nd

phosphate

73


74

Chapter 14

Table 14-1Classes of Oncogenes

c.... 1 2

Protein Encoded Stage

by Proto-oncogene

Growth factor

Platelet-derived growth

Receptors

tacto' Epdem1al growth factor

Oncogene

Type of Cancer

sis

Astrocytoma

erlJB1

Squamous ceil carcinoma of the lung Breast, ovarian, lung, and stomach

Osteosarcoma

receptor

eroe2

caOCOffi

Breast cancers

3

Signal transducers

Protein tyrosine kinase

gC

Rous avian sarcoma

Protein tyrosine kinase

abI

Chronic myeloid leukemia, acute l)1TIphoblastic leukemia HOOlan b(adder, luI"€. coIOfl. and pat'lCfeas cancers

G protein with guanosine triphosphatase aetMty

4

Nuclear transailXion

leucine zipper protein

(os

tact", leucine zipper protein Helix-loop-helix protein Helix-loophelix protein Retinoic acid receptor (zinc fif"€er protein)

un

N-m",

"""

pml/rara'

Finkel-Biskes-Jinkins osteosarcoma Avian sarcoma Neuroblastoma But1dtt's lymphoma Acute promyelocytic leukemia

'The ras 0f'lCltlgI!Ill! is found In ~ely 15% of 811 numan CllI'lCef5. IncIl.odi1i 25% of ~ ~ sow. of coton canr:::ers. and 9O'll. of pancreiltic etlnalrs. 'Relinoic acid and the relinolc acid receptor are normally Inl'Olved In the differentiation Of promyelocytes into mature granulocytes. A translocation of the normal retinolc acid receptor gene (RARa) Ii"om ctoromosome 17 to the norm81 pr~e gene (PML) Ol"l etorornosome 15 produoes the pm/raraoncogene. The PMl/RAAa Ol'lC:l;lprotein blocI\$ the dilferenti8Uon of pr~1o­ cytes to rnatJ.n~.TIle result is c:or"ItinJaI proIiferatiotl of ~ (i.e _. ~e ~ leukemia).

F. If the ras proto-oncogene mutates, it forms the ras oncogene. G. The ms oncogene encodes an ~bnormal G protein (Ras oncoprotein) in which glycine changes (Q valine at position 12.

H. Ras OllCOJl«Kein hinds GTP, which stimulates the cell qde. 8ec::luse the Ras OllCOJl«Kein cannot split GYP inw GDP and pho5phale, stimulation of the cell cycle is ne\·er tenninated. V. ANTI-ONCOGENES (TUMOR-SUPRESSOR GENES) A. Retinoblastoma (RB)(Figure 14·2) 1- The RB anti-oncogene is luc.aled on chromosome 13. It encodes (or the normal RB protein that binds to a gene regulatory pnxein (GRP). As a result, there is no exp-e5sian of target genes whose gene products stimulate the cell cycle. 1bere(ore, the cell cycle is suppressed.


""'-

oncogene

Mutation

I â&#x20AC;˘

gy_vaI , ,

oncogene "'"

............. Normal

G protein

,.....-+-

Abnormal G protein (ras onco-protein)

~

Nonn8J G protein

<h~

r=

w'

~ t I St~,,~ctoe''YC~ I ~ t GTP

GTP

1'-4 /,

1:'0

-=......r-------,

'"\:, _Ie

lit.

+0

Sthrulation of cell C)'CIe terminated

GOP

Agure 14-1. Action of the nu prom-oncogt:ne. rJ,y .. r,;hcine; ml ... v..linc; GTP .. guaIlO5ine uipho6phale; GOp ... guanosine diphosphare.


76

Chapter 14

..

~

I

.....--..

Chromosome 13

Abnonnal AS protein

~

()'1::::,

~

:::-.

:::A.

t

+

I No expressiofl genes whose I gene products stirrulate cell cycle

Expressioo a Iarget genes whose gene procb::ts slilTlJlale ceO cycle

01 largel

+

I

No """""""" '" " "

t

~

I I ~\_red~ rif\ aD! \Jt) Retinoblastoma

loheritad """".

COpt 01 AB gene

~

/ I \"'.

/ I \ "'.':.."00

. ®®aXID ClDCJD([)CID j j j j

=~

I

Multiple tumors in both eyes oe:::

I

CID I•

secood

mutalion

j

Single tumor in one eye

Figure 14-2.

Act'ion of the RB anri-oncogcllC. GRP .. ~"'IC regulatOry protein.

I


Proto-oncogeoes, Oncogenes, and Anti<Jncogenes

77

2. A mutation of RB encodes an <'Ibnonnal RB protein th<'lt CHlnot bind to a GRP. As a result, there is expression of target genes whose gene products stimulate the cell cycle. The cell cycle is not suppressed, and a retinoblastoma fOMs. 3. Retinoblastom<'l occurs in childhood and develops from precursor cells in the imm<'lture retina. The Knudson hypothesis states that the development of retinoblastoma requires two separate mutations. There are two types of retinohl<'lStom<l: 3. Hereditary retinoblastoma (1) An affected individual inheritS one mutant copy of the RB gene. (2) L<'Iter, <'I mutation of the second copy of the RB gene occurs within many cells of the retina. As <'I result, multiple tumors develop in both eyes. b. Nonhereditary retinoblastoma (1) The individual does not inherit a mut<'lnt copy of the RB gene. (2) A mut<'ltion of both copies of the RB gene occurs within one cell of the retin<'l. As a result, a single tumor develops in one eye. 4. Although retinobl<'lStoma is rare, the RB gene is involved in many types of hum<'ln cancer. B. p53 (Fij,,1Ure

14~3)

1. The p53 anti-oncogene is loc<'lted on chromosome 17. It encodes for the normal p53 protein (a :zinc finger GRP) that causes the expression of target genes whose gene products suppress the cell cycle at stage G 1 by inhibiting the activity of Cdk2-cyclin D and Cdk2-cyclin E. As a result, the cell cycle is suppressed.

2. A mut<'ltion of p53 encodes <'In abnoM<'I1 p53 protein th<'lt does not cause the expression of L1rget genes whose gene products suppress the cell cycle. As a result, the cell cycle is not suppressed. 3. Normally, p53 <'IrrestS cells that contain damaged deoxyribonucleic acid (DNA) [e.g., by r-irradiationl in st<'lge G 1. 4. The p53 anti-oncogene is the most common tarj"tet for mutation in human cancen>. 5. The p53 <'Inti-oncogene is also associated with Li-Fraumeni syndrome (an inherited susceptibility to a variety of cancers). Cancer develops in 50% of affected individuals by 30 years of age and in 90% of affected individuals by 70 years of age. C. Breast Cancer (BRCA I)

1. The BRCA 1 anri-oncogene is located on chrolllOSOme 17. It encodes for BRCA protein (a zinc finj"ter GRP), which cont<'lins phosphotyrosine and suppresses the cell cycle. 2. Between 5% and 10% of women with breast cancer have a mutation of the aRCA 1 gene. This gene confers a high lifetime risk of breast and ovarian cancers. D. Other anti-oncogenes are shown in Table 14-2.

VI. MOLECULAR PATHOLOGY OF COLORECTAL CANCER A. Most colorectal cancers develop slowly through a series of histopathologic changes. Each change is associ<'lted with a mutation of a specific proto-oncogene or anti-oncogene (Table 14-3). B. Familial adenomatous polyposis coli (APe)

1. In affected individuals., thousands of polyps develop <'Ilong the length of the colon early in adult life. If the polyps <'Ire not surgically removed, they become maHgn<'lnt. Usually, approximately 12 years elap;e from the first detection of polyps to a diagnosis of cancer.


78

Chapter 14 p63

antl-oncogene

~

I M"'''~"

~

Normal p53

~ (Zinc finger GAp)

Chromosome 17

~

8

~~ Abnonnal p63

~

Chromosome 17

-

I

No expression of target genes

I

t No suppression of cell cycle

Suppression of cell cycle at G 1checkpoint (l7f Cdk2 cydn 0 and Cdk2 cydin E)

Agure 14-3.

Action of the r'i3 ami-oncogene. GRP • gene Il'gulalOry fltOlein.

Table 14-2. Other Anti-oncogenes AnUoncogene

Chromosome

Type of Cancer Associated with Mutation

Rb

13

Retinoblastoma, carcinomas of the breast, prostate, bladder, and hJng

p53

17

Most human cancers, U-Fraumeni syndrome

BRCA 1

17

Breast and ovarian cancers

NF-1

17

Schwannoma. neurofibromatosis type 1

WT·1

11

Wilms' tumor

VHL

3

von Hippel-lindau disease, retinal and cerebellar hemangioblastomas

APe

5

Familial adenomatous polyposis coli, carcinomas of the colon

DCC

18

Carcinomas of the colon and stomach


Proto.ancogenes, Oncogenes, and Anti-Oncogenes

79

Table 14-3. Histopathologic Changes Associated with Specific Mutations Histopathotogic Change

Normal epithelium to small polyp

APe anti-Qnoogene

Small polyp to large polyp

ras proto-oncogene

Large polyp to carcinoma to metastasis

DeC anti-oncogene p53 anti-<lncogene

AFC<adonomatous polyposis coli; DCC=>delete<! in coloo carcinoma.

2. APe involves mutation of the APe: anti-uncogene. 3. APC <'IccountS for I % of <'Ill colorectal cancers. C. Hereditary nonpolyposis colorectal cancer (HNPCC)

1. I-INPCC does not involve mutCltions of proto-oncogenes or anti-oncogenes. 2. I-INPCC involves <'I mut<'ltion of the HNPCC gene, which is the hUln<'ln homologue to the Escherichia coli mutS <'Ind mutL genes. These genes code for DNA repair enzymes (see Chapter Z). 3. HNPCC <'IccountS for 15% of colorect<'ll C<'lncers.


15 The Cell Cycle

I. PHASES OF THE CEU CYCLE (Fibrure 15-1)

A. Gap phase 0 (Col is the resting phase ofthecell. During mis~, the cell cycle issuspeoded. B. Gap phase I (G,)

1. G}s. the rime between mitosis (M phase) and the synthesis of deoxyribonucleic acid (UNA)

IS ph"",).

2. Ribonucleic acid <RNA), protein, lipid, and carbohydrate synthesis occurs. 3. G l lasts approximately 5 hours in a typical mammalian cell with a 16-hour cell cycle.

C. S.,.Tllhesis (S) phase

1. DNA and chromosomal protein leg, histooes) synthesis occurs. 2. It lasts approxim:nely 7 hours in a rypical mammalian cell with a 16-hour cell cycle.

D. Gap phase 2 (G z) 1. G l is the imerval between DNA synthesis (5 phase) and mitosis (M phase). 2. Adenosine triphosphate (ATP) synthesis occurs_ 3. It lasts npproxim::nely 3 hours in II typical mamm<'llian cell with lJ 16路hour cell cycle. E. Mitosis (M) phase

1. Cell division occurs during this phase.

2. It has six smges: a. Prophase b. Prometaphase c. Metaphase d. Anaphase e. Telophase f. Cytokinesis 3. It lam approxim:Hely 1 hour in a ll'PiCilI mammalian cell with a 16-hour cell cycle.

II. CONTROL OF THE CEU CYCLE (see Figure 15路1) A. Control prolein.~ The two main prOlein families that control the cell qde are cl'clin, dependent protein kinases (Cdks) ROO cl'clins. "These proteins form Cdk-cyc1in complexes. B. Cdk-cyclin complexes. The Rbility of Cdk to phosphorylRte lHrget proteins is dependent on the cyclin mar foons a complex with it.

so


The tell <:)de

81

G, (5 hIS)

Agure 15-1. The cell cyde with checkpoints. Cdk .. cydin-dependenl prolein kilUl5C; G, '" gap phase .; G t ,", gap pMsc 2; M .. mit05is phase; S '" synthesis phase. C. Checkpoints are points in the cell cycle where Cdk-<yclin complexes mediate conuol.

1.. G. a. b. c. d.

checkpoint This checkpoint occurs at the G. -+ S phase tr.msition. Cdk2-<yclin 0 and Cdk2-cyclin E mediate this mmsition. The pS3 anti-oncogene suppresses the cell cycle at this checkpoint (see Olaprer 14) When this checkpoint operntes properly, a cell in the G 1 phase that has undamaged DNA enters the S phase through the action of Cdk2-<yclin 0 and Cdk2-<ydin E. However. a cell in the G 1 phase that has damaged DNA (i.e., through mutation, trnnslocation, or rearrangement) is prevented from entering the S phase by the action of the 1'53 anti-oncogene. Because the damaged DNA is not replicated, the formation d highly transformed. metastatic cells is pre,'ented.


82

Chapter 15

2. C z checkpoint a. This checkpoint occurs at the C z --? M phase transition. b. Cdkl-cyclin A and Cdkl-eyclin B mediate this tnl1lsition. c. When this checkpoint opcmtes properly, a cell in the G 1 phase rhat has undamaged DNA emers the M phase through the action ofCdkl--cyclin A and Cdkl--cycHn B. However, a cell in the G 2 phase that has damaged DNA (j.e.. through mut.ation, transloc:nion, or rearrangement) is prevented from entering the M phase. Because cell division does not occur, the fonnation of highly trnnsformed, metastatic cells is prevented.

D. Inactivation of cyclins

1. CycHns are inactiv~lted by protein debtradation during anaphase of the M phase. 2. Ubiquitin (a 760-amino acid protein) is covalently attached to the lysine residues of cyclin by the enzyme ubiquitin ligase. This process is called polyubiquitination,

3. Polyubiquitinated cyclins are rapidly degraded by proteolytic enzyme complexes (proteo.~mes).

4. Polyubiquitination occurs widely and marks different types of proteins (e.g., cyclins) for rapid deb>Tadation.

III. STAGES OF THE M PHASE (Figure 15-2) A. Prophase 1. Chromatin condenses to form well-defined chromosomes. 2. Each chromosome is duplicated during the S phase and has a specific DNA sequence (centromere) that is required for proper segregation. 3. A centrosome complex that actS as the microtubule organizing center (MTOC) splits into two halves. The halves move to opposite poles of the cell.

4. The mitotic spindle. which contains microtubules, forms between the centrosomes. B. Prometaphase

1. The nuclear envelope is disrupted, giving the microtubules access to the chromosomes. 2. The nucleolus disappears.

3. Kinetochores (protein complexes) ru;semble at each centromere on the chromosomes. 4. Certain microtubules of the mitotic spindle bind

to the kinetochores (kinetochore

microtubules).

5. Other microtubules of the mitotic spindle are polar microtubules and astral microtubules.

C. Metaphase 1. Chromosomes align at the metaphase plate.

2. Cells can be arrested by microtubule inhibitors (e.g., colchicine). 3. Cells can be isolated for karyotype analysis.

â&#x20AC;˘

Figure 15-2. Stages of the mitosis (M) phase. (Reprinted with permission from Alberts B, Bray D, LewisJ et 31: Molecular Biology of the CCU, 3rd cd. New York, Gltland Publishing, 1994.)


The.. .. ...

I-

Prometaphase

IOn.I<""",,

_los

T-...,.....,

I(jnetochore~--t--!~

IMetaphasel Ch""""""",, at metaphase pia"

f'c?Iar ubules m<<Ql lengthen

Kinetochore,--..,~

microtubules shorten

I .Teloph.::'e I -

-"'"

Chromosomes

Nudeolus

reappears

Polar microtubutes lengthen

I Cytokinesis I

I

Cell C}cle

..

83

.


84

ChaPter 15

D. Anaphase

1. TI1e kinetochores separate, and the chromosome; move to oppa;ite poles. 2. TI1e kinetochore microtubule; shorten. 3. The polar microtubule; lengthen.

E. Telophase 1. Chromosome~decondense to form chrOmatin. 2. The nuclear envelope re路fonns. 3. The nucleolus reappears. 4. The kinetochore microtubules disappear.

5. The polar microtubules continue

to

lengthen.

F. Cytokinesis

1. Cytoplasm divides through the process of cleavage. 2. A cleavage furrow forms around the center of the cell. 3. A contractile ring forms at the cleavage fUlTow. The ring b composed of actin and myo~in filaments.


1.6 Homeotic Genes and Anterior-Posterior Body Pattern Formation

I. INTRODUCTION. In Drosophila, bizarre mlllations in body pattern occur (c.g., legs sproul from the head in place of antennae). Substitution of one body part (or another is called homeotic mutation. The genes involved in these ffilltations are called homeotic genes. 10 Drosophila, eight homeotic genes are located in two c1USlcrs, called amcnnapedia (ANT-C) and bithorax (BX-C). These clusters are collectively called the HOM~complex. All homeotic genes encode for gene regulatory proteins known as homeOOomain proteins (see Chapter 7). Homeotic genes contain a ISO-base pair sequence (homoobox) mar encodes a 6Q....amino acid-long region (homeodomain). The homeodomain binds specifically (Q deoxyribonucleic acid (DNA) segments. Molecular donit1R slUdics show that homeolic genes arc highly conserved. Homologucs to the HOM-eomplex in Drosophila occur in humans.

II. HUMAN HOMEOTIC GENES }6~11. l1lirty-nine clustered homeotic genes have been identified in humans. TIley are organized into four gene clusters (HoxA. HoxB. HoxC. and HoxD). These clusters are collectively called the Hox-complex. This complex is involved in anterior-posterior body pau.crn formation in humans. Specifically, it affects the (ormation of the neuml tube, vertehrae, ~llt tube, genitouril)ary tract (mesonephric and paramesonephric ducts), limbs, hC'<lrt tube, and crnniof.dcial area (inner ear and pharyngeal arch 2).

A. Clustered homeotic genes (Hox-eomplex) ("Figure 16路} and Table

1. HoxA cluster

a.

This cluster is located nn chromosome 7.

b. It contairn 11 genes: HoxA路I, HoxA-2, l-IoxA-J. HnxA路4, HoxA-S, l-IoxA-6. HoxA-7. HoxA-9. HoxA-IO. l-IoxA.I), and HoxA-13.

2. HoxB cluster

a.

This c1U'>tCf is located on chromosome 17.

b. It contains 10 genes: HoxB-l, l-IoxB-2, HoxB-3, HoxB--4. HoxB-S, HoxB-6, HoxB7. HoxB-8. HoxB-9, and HoxB-l3.

3.

Ho~:C e1Ul.ter a. This cluster is located on chromosome 11. b. It contairn nine genes: HoxC4, HoxCS, HoxC6. HoxCS, HoxC9. HoxCIO. HoxC II. HoxC 12, and HoxC 13.

85


86

Chapter 16

Anlerior

Posleno.

-. .

IChromosome I

Ubx abd-A AWB

---""- -

I ~

0-

Al

A2

A3

A4

AS

A.

Ho>B Bl

00 00

II

7

HoxA

E

E ' ,~

3

B2

B3

B4

B5

B6

A7

C5

B7

I R",~" I

B6

C.

C8

2

D3

D4

3

4

5

Craniofacial (inner ear and pharyngeal arch)

BO BIO Bll

7

17

B 13

-

Ho>D 01

A13

• •

Ho>C C4

AO AIO All

-

12 C9 C10 C11 C12 C13

2

DB

DO 010 011 012013

0

10

11

12

13


Horneotic Genes and Anterior-Posterior Body Pattern Formation

87

4. HoxD duster a. This cluster is located on chromosome 2. b. It contains nine genes: HoxD-l, HoxD-3, HoxD-4, HoxD-8, HoxD-9, HoxD-IO, HoxD-II, HoxD-12, and HoxD-13. B. Nonclustert:d (divergt:nt, or disper.;ed) homeotic genes (sec Tahle 16-1) are mndomly dispersed throughout the human genome. Because the l-Iox-complex genes are never expres.'">Cd ant.erior to the rhombencephalon, the mesencephalon and prosencephalon derivatives of the human brain involve nonclusteroo hOlneotic gene".

Figure 16-1. Relation betwecn the Drosophila HOM-complcx and lhe human Hox-complex. E:Jch shaded box represents a homeotic gene on a chromooome. TIle expl"t-'Ssion of the various homeotic {-'elK'S within the Ixxly segments of the Drosophila and human fetus is shown. A striking feature of the HOM-complex and the Hox-eomplex is tlmt the order of geTlt.'S on each chromosome corresponds to the order in which the genes are expn:ssed along the anterior~posterioraxis of the human fetus. In the hum"n ferus, HoxA-l is the homeotic gene that is expressed most anteriorly (up to the rhomhcncLphalon). No Hox-complex h'Cne is expres:scd amerior to lhe rhombcncephlllon. Examin:ltion of the sequence of the Hox-A cluster on chromosome 7 mows tlult HoxA-/ should be expressed mOSt :Interiorly, but it is not. The homeotic genes are expressed out of St."(juence (Hoxl\-l is expressed most anteriorly). Abd-A " alxlominal-A; AIxI-13 - alxlominal-l3; Amp - antenn<Jplxlia; Dfd '" ddonned; lab '" bbial; pb "" proboscipcdia; Ser - sex combs reduced; Ubx - ultrnbithornx. (AdaptL-xI with permission from Mmk M, Rijli FM, Clullnbon P: Homcobox genes in embryogenesis and pathO(,'Cnesis. Pcdiatr Res 42(4):421-429,1997.)


88

Chapter 16

Table 16-1. Clinical Feature; of Clu~tered and Nonclu~tered HomeO(ic Genes in Human~ Homeotic Gene Clustered HoxA-I HoxA-2 HoxA-3

HoxA-9 HoxA-lO HoxA-13 HoxB-2

HoxD-13 Nonclustered Emx-2 Otx-1 En-I and En-2 Pax-3

p",,-6

Msx-1 Msx-2

Rieg Pit-1 Pou3f4

Pbx-! Hox11 Shot and Ogi2x

Gbx and Nkx3_1

Associated Clinical Defect Inner ear anomalies Transformation of pharyngeal arch 2 into pharyrgeal arch 1. with duplication of malleus and incus Hypoparathyroidism. thymic hypoplasia. thyroid hypoplasia; defective aortic and pulmonic valves. persistent truncus arteriosus. hypertrophy of atria. and thickening of left ventricular wall Acute myeloid leukemia In males: hypofertility. cryptorchidism, malformation of vas deferens; In females: malformation of uterus Hand-foot-genital s)1ldrome (malformation of thumb and great toe. bicarnate uterus, ectopic ureter openings. and hypospadias) Facial nerve (CN VII; cranial nerve of phar)1lgeal arch 2) motor nucleus deficiency, resulting in paralysis of facial muscles (similar to Bells palsy and Mobius' syndrome) Synpolydactyly (fusion of fingers or toes) Shizencephaly (absence of large portions of brain and formation of cerebrospinal fluid-filled cleft) Epilepsy associated with cortical dysgenesis Agenesis of cerebellum and cerebellar foliation Type I (malposition of eyelid, hearing impairment, differences in iris coloration. growing together of eyebrows, white forelock of hairs and patchy hypopigmentation) and Waardenburg'S syndrome, rhabdomyosarcoma (skeletal muscle neoplasm; the most common soft tissue sarcoma of childhood and adolescence) Aniridia, Peters anomaly (defect in anterior chamber of eye, with attachment of lens and cornea) Tooth agenesis (absence of second premolars and third molars) Boston-type craniosynostosis (but not the more common craniosynostotic syndromes, such as Crouzon syndrome and Apert syndrome, which are caused by mutations in the bibroblast growth factor receptor give) Rieger's syndrome (hypOdontia, abnormalities of interior chamber of eye and protuberant umbilicuS) Combined pituitary hormone deficiency (dwarfism) Deafness. with fixation of stapes Pre-B-cell acute lymphoblastic leukemia T-cell acute lymphoblastic leukemia de lange's syndrome (mental retardation, growing together of the eyebrows, low fOrehead, depression of the bridge of the nose. and small head with low-set ears) Prostatic cancer


1.7 Mitochondrial Genes

I. INTRODUCTiON. Mitochondrial deoxyribonucleic acid (mtDNA) is a circular segmento( DNA that is maternally inherited. TIle mrDNA contains 16,569 base p:lirs and is located within the mitochondrial matrix. Human mtDNA genes contain only eKons.

II. GENE PRODUCTS THAT ARE ENCODED BY MITOCHONDRIAL DNA (mtDNA) (Figure 17~ t) A. Ribonucleic acid (RNA)

1. Two ribosomal RNAs (rRNA:;;). 2. Twenty-two rransfcr RNAs (,RNAs), corre>paooing [Q each amino acid.

B. Proteins. The 13 proteins t.hat arc encOOaI by mtDNA are not complete emymes, but subunits of multi-merie enzyme complexes. These complexes are used in electron transport and adenosine triphosphate (ATP) synthesis. The 13 proteins are encoded by mtDNA and 5ynLhesized on mitochondrial ribosomes.

1. Seven subunits of the reduced nicotinamide-adenine dinucleotide (NADI-I) dehyâ&#x20AC;˘ drogenase complex.

2. llm.-c subunits of the cytochrome oxidase complex.

3. Two subunits of the

r~ adenaline triph~phate (ATP)

synthase.

4. One subunit (cytochrome b) of the ubiqllinon~ytochmmec oxidoreductase complex. III. OTHER MITOCHONDRIAL PROTEINS A. All orner mitochondrial proteins (e.g., enzymes of the citric .Kid qde, DNA pol},tllemse, RNA pol}'merase) are encoded by nuclear DNA. synthesized on cytoplasmic somes, and imported into the mitochondria.

rioo..

B. Chaperone proteins, such as cytoplasmic hsp70, matrix hsp70, and hsp60, aid in the imponation of proteins into the mitochondria. Chaperone proteins maintain each pretein in an unfolded slate during importation.

C. The unfolded proteins enter the mitochondria through an import channel (lSP42). IV. MITOCHONDRIAL DISEASES. Mitochondrial diseases show a wide degree of sc\'erity. This variability is caused, in pan, by t.he mixture of normal and mutant mt.DNA that is present in a parlicular cell type (heteroplasmy). When a cell undergoes mitosis, the

.9


90

Ctlapter 1.7

3 subUnits of cytochrome oxidase complex

ND6

1 sutunil (cytoctvome b) of ubiquinone-cytochrome c ClkidoreductaSe complex

Figure 17-1.

Loonion of mirnchc.xlrial deoxyribonucleic acid (mrDNA) genes ..

oo their gene products.

1be shaded art.-a5 show 11M.' g\.'tle5 for 22 rran..ÂŤt:r ribooudcic lied hRNAli). ATP - acJeno,;ine tripholphate; F~ '" compont."t ci ATP 5~'1\~ lhat is 5eTl:Siri\'c toohgnmyt::in; NDI-7 '" gent~ for Iht: ~'-Tl AJhunit5 of the mL::t:d nK:(){inam~nillC dinuck"Otidc (NADH) dehydnJt,"CTlaSC complex; rRNA .. ribosomal RNA; tRNA '" transfer RNA.

mitochondria segregate randomly in the daughter cells. Therefore, one daugiller cell may receive mostly mutated mtDNA and the other daughter cell may receh'e mostly normal mtDNA. In addition, mitochondrial diseases affect. tissues that have a high requirement for ATP, like nerve and skeletal muscle. Mit.ochondrial diseases include the following: A. Leber's hereditary optic neuropat.hy (see OUlpter 11) B. Keams-Sayre syndrome. which is characterizcd by ophthalmoplegia (degeneration of thc motor nerves of thc eye), pigmentary degeneration of the retina, complete hean block, short stature, and cerebellar ataxia. C. Myoclonic epilepsy with ragged roo fiocrs syndrome is characterized by myoclonus (muscle twitching), seizures, cerebellar at.axia, and mitochondrial myopathy. The most cOl'L'iistent pathological finding in mitochondrial myopathy is abnormal mitochondria within skeletal muscle that impan an irregular shape and blotchy red appearance 1.0 the muscle cells, hence the tenn ragged red fibers.


1.8 Molecular Immunology

I. THE CLONAL SELECTION THEORY is the IllC6t widely acceplcd theory to explam the immune S\'Stem. The theory has four major points. A. B cells and T cells of all antigen specificities develop before exposure to antigen occurs. B. Each B cell carries on its surface an immunoglobuljn for a single antil.ocn. Each T cell carrics on its surface a T-cell receptor (TcR) for a single anti~cn. C. B cells and T cells are stimulated by antigens to prOOtlce progeny cells that have identical antigen specificity (clones). D. B cells and T cells that react with "self" antigens are eliminated. perhaps dm:)ugh apoplosis, or arc oomehow inactivated so that an autoimmune reaction does not occur.

II. THE 8 LYMPHOCYTE (8 CEU) A. ImmunoglobuJin structure and gene rearrangement (Figure 18路1). An immunoglobulin has fouf prolein subunits thar consist of h\-'o heavy chains and two light chains. The chains arc armngcd in a Y pattern.

1. Heavy chains

a.

The heavy-chain gene segments are 10Cfu~d on chrnmosome 14. b. TIle heavy-chain gene segments include 200 variable sl..'gments (Vii)' 50 diversity segments (DIi ). 6 joining segments UH ). and 5 constant segments (eli)' c. The five C segments are Ii (mu; M), B (delta; D), 'Y (gamma; G), E (epsilon; E), and a ralpha; A). These five segments defirle the five immunoglobulin (lg) clas;cs: IgM, IgD, IgO, IgE, and Igo. d. V H' Oft' J,I' and ~ gene segments t1nder~ gene rearrangement to cont.ribute to immunog ohulin diversity.

2. Light chains

a.

The Ie (kappa) chain (1) The" chain gene segments are located un chrotnu;otnc 2. (2) The " chain gene segments include approximately 200 variable segments (V..,), 5 joining segments 0..'), and 1 constant segment (C,). (3) The:- V"" J..,. and C", gt:ne segments undergo J!ell(" rcarTIlflgCtnCnt to contribute to immunoglobulin diversity. b. The A. (Iamlxla) chain (1) The A chain gene segments are located on chromosome 22. (2) The ), chain gene segments include approximately 100 variable segments (V1 ), 6 joining segments 0.), and 6 constant segments (3) The Vl' J1 , and gene segments undergo gene rcarra~emem to conuibute to immunoglobulin diversity.

c;,

<c;,).

91


92

Chapter 18

A P

q

Chromosome 14

Heavy Chain Gene Segments

\;"if? ,

p

,

J'!:;r-,J c c

light chain (1(01 \)

q I(

Light Chain Gene Segments "

Chromosome 2

plยง q

Immunoglobulin prolein I

~

V),HOO

I

~

I

C"Hl

I

:~:@=::@@:l~r.m:g=::

Chromosome 22

). Light Chain Gene Segments

B ,,",-50 Unrearranged heavy chain gene segments

tI Rearranged heavy chain gene segments

Primary RNA Iranscripl

mRNA

Heavy chain

Generearrangement Excision and Degradation

~:~::~~~

t

Trans<:riplion

::~~:

t

Splicing

~ ~

Translalion

. Heavy chain polypeptide


Molecular InYTlU1Ology

93

3. Genc rcal'Tangcment and antibody divcr.iity. For years, the fundamcor.:al mystcry of me immune systcm was antibody di\'en;ity: How could cells d the immune systcm synthesize a million different immunoglobulins, one for each of the million diffi::rem antigens! If each immuouglobJlin \\UC cnco,k..d by its own gene, then the human genome "'()lI1d consist almost exclusivel)' of genes that are dedicated 1O immunoglobulin synthesis. This is nol: the case. One c:J the answers to this fundamental mystery lies in the pt'OCCSS of gene rearrangement, whereby V, D, J, and C gene segments of the hovy and light chains arc randomly rearranged in a million combinations that code for a million diffcrent immurtOMlohulins.. Other processe5 d13t playa role in antibody diversity arc the presence of multiple V gene segments in the germ line; random assortment of heavy and light chains; jW1etional di\'ersity. whereby DNA deletions occur duri~ ~ne rcammgerncnt that lead to amim acid changes; insertional di\'Crsity, wherc~' a shon scq.JCflce d nuclCOlidcs is irucnoo during gene rearnm~mcnt, leading to amino acid changes; and somatic cell mutations, whcreb)' V gene segments mUGue wong the life daB cell,

B. Development of the B cell before exposure to antigen L

In early fetal development, B-cell differentiation occurs in the fctalli\'cr. In later fetal development and throughOUt adult life, B-<:ell diffcrentiation occurs in the bone marrow. In humans, me bone marrow is the primary liite of B-<ell differentiation.

2. Stcm cclls that originate in the oonc marrow differentiate into pro-B cells. 3. Pro_B cells begin Oil (0 JH heavy-chain gene rcarTanb>cment. 4. Pre,B cells begin Vii' DIP and JIl hcavy-chain gene reammgement.

5. Immature B cells (IgM') begin light-chain gene rearrangemem and express antigen~ specific IgM (i.e., recognize only one antigen) on their surface.

6. Mature (virgin) B cells (IgM· IgD') express amil;:en-spl.'Cifk IgM and IgO on their surface.

7. Mature B cells migrate to the spleen, lymph nodes, and gut-associated lymphoid tissue (e.g., wnsils, Peyer's patches) and await amil;:en exposure.

C. Development of the B cell after exposure to antigen 1. E.·uly in the immune rCSjXlnsc, maturc B cclls bind antil;:cn with IgM and IgD. As a rcsult of this binding, two transmembranc proteins (CD79a and CD79b) that function as signal transducers cause B cells to proliferate and differentiate into plasma cells that secrete either IgM or IgD.

2. Later in the immune reSjXlnse, mature B cells internalize the amigen-lgM complex or antigen-lgO complex. The complex then undergoes lysosomal degradation in the endosomal acid vesicles.

Figure 1.8-1. (A) L.ocationofheavy-chain 3m lidlt-chain gene St:gmcnu on chrot'fIO!;Ol:neli 14.2, and 22. 1ne hcavy-chain and light- c1'1l.lin J:!Cne ~ts are organized inro '~,lric:lu.!i variable (V), din'rsit)' (Dl, joining 0>. and constant (e) gL'Ile segments. These segments undcrgogcne rL'3rrangt'lncnt, tmnscription, ~Iici~, and uanslation to form an immu~l\Ilin protein. An ilolnuncglobulin prott'in has eid'tcr [WQ J( light c1'1l.lins Of [v''O J. light d'll.lins (never ont.' J( tight chain and one). light chain), (8) Rcanangt....nellt and ill\ll1U~lindiv1,.'fliiry with hcavy-chain J,'l,'ne SfJ:rnCllt5. U ~ heavy-chain J:Cfle ~l1C1lU thar ha\'e 200 VH segments. 5{) ~ menu, 6 J1\ qmcnu, and 5 St.-gments wtdcrgo n:-arrnngetnt:nL c:::ermin segmentS (e.g., Vlll , 0J7' and Jy are joined. and dr intervening segmenlS are excised and ~ . The rearranged hcavy-ehain gene segments undergo transcriplion to form a pcimary ribonucleic acid (RNA) tramcript. This rmnscript: undogoes splicing to b-rn IOCSSCngef RNA (mRNA) IV llS' On' Js' and pl. 1llo., InRNA u~ trall51ation to form a heavy-ehain polypeptide ,hat ha.!; a unklue amino acid scqucna: that c.ortnpOrds ro the VIIS' On' J\. and p gene ~nr codons. ~1'It..'Ilt contributes to ilOmuroglOOulin di\usity. Block segment .. 11K' portion tho'll: birds antigen.

c;.

l1\


94

Chapter 18

3. Some antigen peptide fragme.nts join tilt: class II major histocompatibility complex (lvlHC) and arc exJ:OSCd on the surface of the mature B ccU.

4. 1l'IC dcgrddation peptiJe--class II MHC is recognized by CD4' helper T cells that S(.'Cre.te

interleuki.n~2

([l...2).

5. Under the innucnce ofCD4' helper T cells, mature B cells undergo isot)'pe switch~ ing and hypermutation. a. lsotypc switching (1) lsotypc switching is <l b'Cne n:arrnllbJCmenr process whereby the pand S Cit gene st.'gl1lents arc spliced out and replaa.-d with either y, E, or ( l C, gene segments. (2) This switching allows Illature B cells to differentiate into plasma cells that secrete IgG, IgE, or 19A. and appears to be mediated by IL-4 and IFN路(l b. Hypcrmutation (1) Hypcrmut:ation is a process whereby a high mtc of mutations occur in the variable segments of both dle heavy chain (Vu ) and the light chain (V or Vl ). (2) Hypcnnutation allows mature B cells to differentiate into plasma cells that secrete IgO, IgE. or IgA that will bind antigen with increasing affinity. K

III. THE T LYMPHOCYTE (T CEU) A. T-cell receptor (TcR) structure and gene rearrangement (Figure 18-2). A TcR has two protein subunits: one a (alpha) chain and one P(beta) chain or one 'Y (g;tmma) chai.n and one S (delta) chain. 1.. The a chain a. The a chain gene scgrncnts indude 100 variablt: St:gIIlents (V..), 100 joining seg~ mcnts 0 ..), and I constant segment (C..), resembling the immunoglobulin light chams. b. The V"' J". and gene segments undel1'O gene rearrangement to COntribute to TcR diversity.

ere

2. The

Pchain

a. The Pchain gene segments inc1lKle approximately

100 variable segments (Vp)' 2 diversity segment!; (D p)' 15 joining segments Up). and 2 constant segments (C p)' resembling the immunoglobulin heavy chains. b. The Vp' Dp' J~, <lnd C p gene segments undergo gene teammgement to contribute to TcR diversity.

3. The y chain

a. The chain gene segments are complex. ht,t they conmin variable segments fV:). joining segments U). and constant segments (C), resembling the immunoglo'\; ulin light chains.

FIgUre 18-2. (A) The Cl, ~. 1, l) and chain L'COC Sl.'J.'fllCfllS. These gene segmenu are OIRt'-nUed inro 'm1ous '':triable (V). di,路crsiry (0), joining U), aoo constant (C) ilCflC segments. Ihese segments u~ rcmr.mgcmcnr,

transcrilXton, S(llki~. and translation to form a T-cell rt."ClfJIOl" (TcR) protein. The TcR ptOlein oonsisuci either an 0. chain and a J} CNUn (aJ}) or a 1 chain and a l) chain ()6). (8) RearrallJ:CTTletll and TcR dh'CTSiry. Unrearral'lf"U1 ~ chaingenc 5CgtOC"ntli wirh 100 V" segnlCnu, 2 0" liCgIftents, IS J" segments, and 2 segments undergo rcarrangt."fOC"nt. Ccrrdin Sl.1,"IflCnU (e.g., V"", 0" J", and C,) arc joined. aoo inter\'eni~ f!CJlC segments are excised and degraded. The rearranged ~ chain gcnc >egll1ents undergo tmnscription to form a pc-inlllry ribonuclric acid (RNA) rrallSCTipl. This rmnscripl u:ndcrgoes splicing to fonn lIlCS5Crlb'Cr RNA (mRNA) 01'),'" ;mdC1). The I1lRNA rhen underj:t'OCli trm'lSlmion ro form a ~ chain !"olnJl-ptide thaI has a unique amino acid .'iCqUCf1CC that corresronds 10 tht: V4'1' 01' J9, and C 1 gene segmem codons. Blade segrnel1l = the portion Ihal binds amib'Cn.

c;

rV....


.,~

(Jâ&#x20AC;˘ 0

,

A c

.. 0;

p

c

Chain gene segments

L

L flch8 ,n " ch8,n

T-cell receptor

q

.\,

[3 Chain gene segments v~

J~

=

c~

=

=

fl¡, 0

c

c

~ Chain gene segments

I _5::::;;:V~.~1-4=:::-:;;:=J.-,~D~.'~-2~~::::;~J~Ol-1

00

I ICo I

L

'--',,""''-'-fL2",-~.~--~

T-cell receptor

() Chain gene segments

B Unrearranged

V131-1OO I

Dpl-2 I

L,s"h8in

~ch8in

Jpl-15

r

I

I

C131-2 I

i

I

~~~nn~sene~~=GJ{;]:~:~~'~~~ I Gene rearrangement

T Excision and Degradation

Rearranged f3chaingene segments

I

J1o-15

~,

I

.-r.-l-----f:lCl.

~~~-_~~~

I Transcription T J1O-15 I

I

rr~~Yp~NA ~~~:~-..~~

+ mRNA

~

Splicing

~

Translation"

f3 chain polypeptide

95


96

CIlapter 18

b. The V'r' Jr' and C T gene segments undergo gene rearrangement to contribUle to TcR diversity. 4.

Th~ 0 chain a. The chain gene segments include approximately 4 variable segments (Vs)' 2 diver.iity segments (Os), 100 joining segments Us), and I constant segment (Cs)' resembling the immunoglobulin heavy chains. b. The V1>' 01>' h, and Cs gene scgmems undergo gene rearmngemem to comribLlte to TcR diversity.

5. Gene rearrangement and TcR diversity. The fundamental principles of antibody diversity (see II A 3) also apply to TcR diversity.

B. A TcR complex is fanned when TcR is expressed on the surface ofT cells in association with other tmnsmembrane proteins-most notable among these is CD3. which functions as a Signal transducer. C. Con.'ceptor proteins. op' T cells express two other important transmembrane proteins on their surfdce. These proteins strengthen the bonds of the TcR-amigen-MHC complex:

1. C04 binds to the invariant porrion of class II MHC protein and acts as a signal transducer. 2. COB binds transducer.

to

the invariam portion of class 1 MHC protein and acts as a signal

D. Development of the T cell before eXp05ure to antigen

1. In earl\, fetal development and until puberty, Tcell differentiation occurs in the

thy~

mus (derived from pharyngeal JXIuch 3). At puberty, the thymus undergoes thymic im'olution, probably because of increased steroid honnone levels. In humans, the thymus is the primary site of T~cell differentiation. 2. Stem cells that originate in the bone marrow migrate into pharyngeal pouch 3. 3. Stem cells differentiate into pre~T cells within the thymic cortex, where they are prou.'Cu..-d by the blood-thYffius barrier. 4.

Prc~T cells begin TcR gene rearrangement, and T-cell lineages that express either 0(3 TcR or yO TcR arc established. Much morc information is known about the T-celJ lineage that expresses the 0(3 TcR.

5. Immature T cells express 0(3 TcR, CD3. CD4. and COB within the thymic cortex. 6. Immature T cells that express both CD4 and COS (CD4' COB' T cells) are important intermediate cells because they undergo the following processes: a. Positi\'e selection is a process whereby CD4路 COS' T cells bind with a certain affinity to MHC proteins that arc expressed on thymic epithdiocytes. Through this process, the CD4' COS' T cells become "educated" to one's own MHC propcrries. All other CD4' COB' T cells undergo HpoptOSis. As a result, a mature T cell responds to antigen only when the antigen is presented by an MHC protein that it encountered at this stage in its development (MHC restriction of T-<:ell responses), b. Negative selection is a process whereby CD4' COB' T cells interact with thymic dendritic cells at the corricomedullary junction of the thymus. CD4' COB' T cells that recognize "self" antigens undergo apopmsis (or are somehow inactivatL'd), thereby leaving CD4' COB' T cells that recognize only foreign antigens. 7. Mature T cells down-regulate CD4 or COB to form either a(3 TcR, CD3', CD4', CDs- T cells or aj3 TcR, CD)" CD4-, CDs* T cells, Then they leave the thymic medulla. Mature T cells arc never CD4t COS'.


Molecular Immunology

97

8. Mature T cells migrate (Q the thymic~dependent zone of lymph nodes and to the periarterial lymphatic sheath in the splcen, whete they await antigen exposure.

E. Development of the T cell after exposure to antigen 1. Exogenous antigens dmt circulate in the bloodstream ate internalized by cells and undergo lysosomal dq(tadation in endosomal acid vesicles. Antigen proteins degrade into antigen peptide frab<ments that arc presentL-d on the cdl surface in conjunction with class n MHC. CD4' helper T cells that have the antigen-spL~ificTcR on their surface recognize the antigen peptide fragment.

2. Endogenous antigens (viruses or bacteria wilhin a cdl) arc proccssL-d within the cytoplasm Ot rough endoplasmic reticulum into antigen peptide frab'mCnts. These fragments arc prcscnu.-d on the cell surfdce in conjunction with class 1 MHC. CDS' killer T cells that have the antigen-spL~ific TcR on their surface tL~ognize the antigen peptide frdgment.

IV. CUNICAL CONSIDERATIONS

A. X-linked infantile (Bruton's) agammaglobulinemia

1. This disorder affects only male infants. It is characterized bv recurrent bacterial otitis media, septicemia, pneumonia, arthritiS, meningitis, and dennatitis. The most common infections arc caUSL-d by Haernop/uJus inj1uenzae and Sneprococcm pneumoniae.

2. This disorder occurs at 5 to 6 months of age, when there is an absence of all classes of immunoglobulins within the serum.

3. It occurs when pre-B cells cannot differentiate into mature B cells

bL~ausc

VII gene

segments do not undergo gene rearrangement.

B. Congenital thymic aplasia (DiGeorge syndrome)

1. This disorder is charactctiZL'Cllly hypocalcemia and recurrent infections with viruses, bacteria, fungi, and protozoa.

2. It occurs in infants when pharyngeal pouches 3 and 4 do not develop cmbryologically. As a result, affected infants have no tllymus or parathyroid glands.

3. Thcse infants have no T cells. Many cannot even mount an immunoglobulin response because this response requires CD4' helper T cells.

C. Severe combined immunodeficiency disease (SCID) 1. SCID is a hcterogeneous group of disorders. It affects infants and is charactcrizL-d by a high susceptibility to viral, bacterial. fungal, and protozoan infections.

2. SCID occurs whcn stcm cells do not differentiate cmbryologically into B cclls and T cells. 3. Affccted infdnts Ilavc no B cells or T cells. As a rcsult. they seldom sutvive beyond thc first year. 4. Adenosine deaminase (ADA) deficiency is a type of SCiD in which there is a deficiency of the enzymc ADA. As a result, toxic amounts of adcnosine triphosphate (ATP) and deoxyadenosinc ((iphosplmtc (dATP) accumulatc. This accumulation is particularly haffi1ful to lymphoid cells. ADA dcficiency is commonly called the "bubble boy" disordct. It is thc first disordct fot which gene thcrapy was used in humans. D. Acquired immune deficiency syndrome (AIDS) slowly wLwdkens thc immune syStem through sck~tive destruction of CD4' helper T cells.


98

Chapter 18

E. M(modonal gammopathies are a group uf neoplastic diseases d1.at involve abnonnal proIifcn,llion of B cells and plasma cells. As a fCSult, excessive amounts of immunoglobulins or immunoglobulin chains arc produced.

1. Multiple myeloma a. Multiple myeloma is d'lC most common type of monodonal gamffiUlXlthy. It is characterized by high susceptibility ro bacterial and viral infectit.>ns because normal immunoglobulin synthesis is suppressed. b. It occurs as a result of the malignant proliferation of plasma cells. c. It is associatcd with high Ic\'el.. of immunoglobulins (lgM. 19D, IgG. IgE, or IgA), free K chains, or A chains (Bence Jones proteins) in the SCrulll or urine. 2. Waldenstrom's macroglobulinemia a. This condition is characterized by increased viscOSity of the serum, thromboses. disorders of the central nervous system, and bleeding. b. It is associated with high levels of IgM.


19 Receptors and Signal Transduction

I. ION CHANNEL-UNKED RECEPTORS (Fit,'Ur'C 19·) are com~ structurally of mul· tiple subunits that span the cell mcmbrnne. These receptors demonstrntc Km selectivity (i.e., they permit some ions to pass, but nO( others). The)' also have "gates" d13t open brieOy in response to stimuli, and then close. Stimuli that OJ:Cn the g"iHCS include clmnsp in voltage acl"06S the membrane h'oltagc-g;atcd ion channels), mechanical stress (mcchanical-g;ated ton channels), and neurotransmitters (transmiucr·gatcd ion channels). This chapter discus.scs transmincr.gatcd ion channels.

A. Excitatory transmittcr-gatcd ion channels

1. Nicotinic acetylcholine receptor (nAChR) a. TIllS receptor has five subunits. Each subunit has twO binding sites (or ACh. b. When nA01R binds two molecules of ACh, a conformational chanj:1c OCCUI'S, and

the gate opens. c. TIle gate remains open for approximately I mscc. While the gate isopcn, nAChR is nonsclcctivcly penneable to all cations (Na', K', Ca,,), but excludes all anions. TIle inllux of Na' ions (approxirnatcly 30,CXX)Jmscc) is primarily res\Xlnsible for the depolarization of the postsynaptic membrane. d. Nicotine binds to ACh-binding sites and activates nAChR. For this reason, nicotine is considen:d an agoni<;t and may be responsible for thc psychophysical effects of smoking addiction. e. a..-Bungarotoxin and curare binJ to nAChR anJ block its action. Tht:reforc, a-bungarotOxin and cumre arc considert.'d antagonists. They causc muscle pamlysis when they act at the neuromuscular junction of skeletal muscle. 2.

5~Hydroxytryptamine(5~HD) serotonin receptor a. This receptor is permeable to Na' and K' ion<;. b. It is widely distributed in the centr<ll nervous systcm (CNS). c. It is clinically important lxxause its antagonists h.:)\'c important applications as antiemctics, anxiolytics, and antipsychotics.

3. Glutamate receptors a. N~mcthyl~D~aspartate(NMDA) receptor (1) This receptor is penneable to Na', K', and ions. (2) Qx:ning the gate requires both glut3m:i1te binding am) ,·ohagc..cfependent membrane depolarization because the NMDA reccptor is "pllJ8boed" hy extra· cellular Mg" ions at rCSling membrnnc potcntial. (3) TIlC NMDA receptor is clinically impormnt because irs antagonists, such as phencyclidine (PCP) and dizocilpine (MK..BOI), may mediate hallucinogenic behavior. These anmgonists require thc NMDA receptor to Ix: opened to gain access to thcir binding sit~. For this rC-dSOn, Ihcy are called "opcn~ channel blockers."

ea"

..


100

ChaPter 19 100

• (

A

NH,

••

••

•• •• ••

B

am ... •• ••

lIon channeHinked receptor (mutlipie-sWunit transmerrbrane protein)

I

I-G=-""'--,-'ac-.......... --::-.,-,-,-,,_,""'-:,_,,

COO H

j

(seven-pass transmembrane protein) ,

c

o

I

Enzyme--lirVted receptor (on~ transmembfane protein)

-

!

!

"""""""'~

Steroid (intracellular) hormone receptor (Zr1 finger protein)

Figure 19-1.

Four dasseo of rc<:qJt'ors.(A) Ion channel-linked reccpt'or (mulriplc·subunir rnmscncmbr.me

prorein). (8) O-prorem-Iinkcd rc<:epror (se\'cn-pass trarwncl1lbrane prorcin). (C) EnZ)1nc.linkcd recepror (one-pass rrnnsmcmbrane prordn).(D) Stcroid (intracellular) honnonc receptor (zinc fingc-r prorcin). DNA '" dl'Oxyril:xmucicic ;lcid; C '" cystdnc; Zn = zinc,

(4) This receptor is clinically impornlnt because its hyperactivity causes excessive influx orD" ions ("glutamate toxicity"). This influx is implicatt.'<1 in many neurodcgcnerati\'c disorders. (5) This receptor is involved in the leaming Pf'OC('SS through long~tcrm potenti. ation in the hippocampus.

B. Inhibitory transmitter.gated ion channels

1.. a.-Aminobutyric acid (GABA,) receptor a. This l'l'Ccptor ;s pcnneablc to CI- ions.


Receptors and Signal

Transduction

101

b. The influx of CI- ions is primarily IUponsible for hyperpolarizing dlC postsynaptic membrane and moving the membrane potential away from the threshold to allow an action p:>temial to occur. c. It is a major inhibitory rcc.cptor within the brain. d. This receptor is clinically important becaU'!C barbituratcs and bcnzodiarepincs, such as diazepam (Valium), chlordiazepoxide (Librium). and steroid hormone metabolites bind to the GABA... receptor and IXltcntiate OABA binding. As a result, the same amount of GABA causes increased inhibition in the presence c:l t~ drugs. This increaSl..-'d inhibition may partially m<.'<!iate the sedative effccts of th<->sc drugs. e. This rccepror is clinically important because its antagonists, such as picrotoxin, bicuculline. and penicillin, C,-IUse decreased inhibition. ntis dccreased inhibition may mLxliatc the con\'Ulsive and seizure activity of these drUb'S'

2. Glycine receptor a. ntis receptOr IS pcnncablc to CI- ions. b. It is a major inhibitory receptor within the spinal curd.

II. G-PROTEIN-lINKED RECEPTORS (see Figure 19~1) arc composed structurally of a single polypeptide til-'ll spans the cell membrane seven timcs (seven-pass transmembrane rcceptOtll). These R'C<.'(JtOtS arc linh'<! to trimeric guanosine triphosphate (GTl')~binding proteins (G proteins) that h<lve an a chain, <l p chain, and a ),chain. These receptors activate a chain of cellular events through either the cyclic adenosine monophosphate (cAMl') pathway or the Ca" pathway. A. cAMP pathway (Figure

19~ZA)

:L Increased cAMP le\'c1s usc stimulatory G (G ) protei.n. a. When the appropriate signal binds to thc'Gs-protein-linkcd receptor, inacth'e G s protein (which exists as a trimer with guanosine diphosphate (GDP) bound to the Os cimini exchanges its GOP (or GTP to become acth-c G protein. b. This change allows the Os chain to dissociate from the Po;; a;/ )'s chains. The Os clmin stimulatcs adenylalc cyclase to increase cAMP levcls. c. Active G protein is short-lived becausc thc 0;; chain has guanosine triphos-phatasc (l::TPasc) activity that quickly hydrolyzes GTP to GOP to form inactive G s protein. d. cAMP actiWltcs the ernyme cAMP-dcpendent protcin kinase (protein kinase A). which carnl)'2cs d\e covalent phosphorylation of serine and threonine within cenain intrneellular proteins to increase their activity. e. TI1c enzyme serine--threonine protein phosphatase reverses the cffcctS of protein kinase A by dephol;pI-v:>rylating serine and threonine. f. This process is clinically important becausc cholcra toxin, an enzyme that catalyzc:s the adenosine diphosphate (ADP) ribosylation of the Os chain, blocks chain GTl'asc activity and permits the effccts of active Os protein to continuc indefinitely. Within the intestinal epithelium, this dwngc caust.'S Na' ions and Wdter to move into the gut lumen, rcsulting in severe diarrhea.

ÂŤs

2. Decreased cAMP le\'eI5 use inhibitory G (G l ) protein. a. When the appropriate signal binds to the G -protein-link<.>J t(.'Ceptor, macth-c Go protein (which exisrs as a trimer with GDP bJund to the ex, chain) exchanges its GDP fot GTP to become active G, protein. b. exchange allows the a. chain to dissociatc from the ~, and 1. chains and inhibit adcn},late cyclase to decrease cAMP levels. c. This change is clinically import'dnt becausc pertussis toxin, an enzyme that cat~ al)'2cs the ADP ribosyladon of the a. chain, blocks the dissociation of thc a. chain (rom the 11, and )',, chains. As a re~lllt, adcnylate cyclase is not inhibited.

nus

1


102 Chapter 19 ............................. NH

.

..................

2

A

Gi""""",

/receptol

Gs P''?tein (inactive)

COOH

II

~'--....l,ATP cAMP ~

Gis

plOten (active)

----:-;1 Protein kinase A

f _ r~se A (active) _

'~

L~(jn~.~ct~"~.~I_-',

t

-~~"'x-Po,1 IProt"'~ t ..

Ip_hat~·l Angiotensin

B

/,ecept~

Gn protein (inactive) COOH

•Go protem~

Phospholipase C

(active)

l~ ----.,,-;;-j

Plolein kinase C (inactive)

DAG /

f_

~

rProtein kinase C

(active)


RecePtor.; and SIgnal Transduction

B. Ca H pathwolY (see Figure

103

19~2B)

~protein-linked receptor, inacti\1~ Gq • to the "(chain) exchanges irs GDP protein (which exists as a trimer with GDP bciund (ex GTP to become acti\1~ G" protein.

1. When the appropriate signal binds: to the G

2. Active G protein activates phospholipase C. which cleaves phosphatidyl inositol biphospl~te (PIP!) into inositol triphosphate (lp)) and diacylglycerol (DAG).

3. IP I causes the release of CaH (rom the endoplasmic reticulum. This release activates: the eJl..")'me ea""calmodulin-dependcnt protein kinase (CaM.kinase), which cat~ alyzes the co...alent phosphorylation of serine and threonine within certain intrneel~ lular proteins to increase their activity.

4. DAG activates the etlZ)'me protein kinase C. which catal\'les the covalent phospho'1'1<lrion of .serine and threonine within cerrain imracellular proreins to increase [heir octivity.

C. Types o( G~protein-linked receptors 1. Muscarinic ACh receptor (mAChR) a. This receptOt pla\'S a major role in mediating the actions: of AOl in the brain. b. Atropine, N~methylscopolamine.and pirenzepine are antagonisrs o( mAChR. 2. Adrenergic receptors (ARs) are grouped imo three (amilies, all of which bind the catecholamind epinephrine and norepinephrine. a. (XI AR uses the pathway. b. a2 AR (1) 02 AR uses the cAMP pathway and decrea.ses cAMP levels by inhibiting adenylate cyclase. (2) a-Adrenergic receptor ant<l&'OOists include phentolamine, phcnoxybenzamine, pra:zosin, and yohimbine. C. PI, pl, and P3 ARs (1) These ARs: use the cAMP path\.VllY find increase cAMP levels by stiffiulming fldenylate cyclase. (2) 13·Adrenergic receptor antagonists include propranolol, metoprolol, atenolol, pindolol, timolol, nadolol, bctaxolol ••lOd csmolol.

ea"

3. Dopamine receptors

a. Dopamine receptors are grouped into two main c1HSSCS

(01 Hnd 02), both of which bind the catecholamine dopamine. b. D1 receptors use rhe cAMP pathway Hnd incrC'<l.se cAMP levels by stimularing Hdenylate qoclase. c. D2 receprors also lise the cAMP pathway They decrea.se cAMP levels b\' inhibiting adenylate cyclase. d. These receptors are clinically imponanr in Parkinson's dise-olsc. a neurndegenerarive disorder that causes depIction of dopamine within the substantia nigra and corpus striatum. These areas playa role in coordinating muscle movements.

4. Purincrglc receptors

a. These receptors are grouped into t'.\'O main classes (A~type and P~type). b. A-type receptors bind adenosine•

Agure 1s.2. Signal lJ3Nduclion ci G-protein-linked recqxas. (A) C)'dic adena;ine ~Ie (cAMP) pathway. (B) Ca" pathway. G, '" stimulatory G protein; ATP - adenosine tTiphmphate; G '" G pro.. tein that activate'! pho5pholipllSe; IPJ - ircsitol tri~te; P1P1 - phosphatidyl inositol biphospha;e; DAG '" diacylglycerol; ER - endoplasmlC reticulum; CaM-kinase· Ca"/calmodulin~1 prorcin kinase.


104

Chapter 19

c. P-type receptors bind adenosine triphosphate (ATP). d. Adenosine has importam modulatory effects on rhe CNS. Adenosine is highly penneable ro the cell membrane and diffuses into and out of neurons easily. This diffusion establishes a feedback loop through which the metabolic status (high or low ATP activity, which leads to an accumulalion of adenosine) of a neuron is communicated lO surrounding neurons. 5. Metabotropic glutamate receptors (mGluRs) a. There are eight types of mGluRs (mGluRl throuAh mGluR8). b. mGluRs are found throughout the CNS. 6. y-Aminobutyric acid (GABA B ) receptor a. This receptor is folUlCl throughout the CNS. where if colocalizcs with the GABA A receptor (a transminer-gared ion channel). b. Sac10fen is an antagonist of the GABA" receptor. c. B..,c1ofen is an agonist of the GABA B teceptor. 7. Thyrotropin (TSH) receptor. A defect in the TSH receptor gene is implicated in hyperthyroidism (dlyroid adenomas). 8. Lutcinizing hormone (LH) receptor. A defect in the U-I receptor gene is implicated in precocious puberty. 9_ Adrenocorticotropic hormone (ACIli) receptor. A defect in the ACTH receptor gene is implicated in familial glucocorticoid deficiency.

10. Glucagon receptor :L:L Rhodopsin receptor. A defecr in the rhodop;in receplOr gene is implicated in retinitis pigmentosa. a cleh>enerative disease characterized by the development of night blindness (nycralopia) as a f"e5ult of the death of rOO phororeceptor cells in rhe retina.

.12.

europeptidc: receptors. There are many peptide receptors. some of which are reviewed here. a. Vasopressin receptors (1) There are two types (V, and VJ (2) A defect in the VI Wlsopressin receptor {,'Cne is implicated in X~linked nephrogenic diabetes insipidus. b. Angiotensin receplOr c. Bradykinin receptor d. Neuropeptide Y receptor e. Neurotensin receptor f. Opiate receptors g. OxytOCin receptor h. Vasoactive intestinal polypeptide (VlP) receptor

III. ENZYME..LJNKED RECEPTORS (sec Figure 19~1) are composed strucmrally of singlc Of multiplc polypeptides thar span the cell membrane once (one-pass transmembrnne receptOni). These receptors are unique in thar their cytoplasmic domain has intrinsic enzyme activity or associates direcdy ""ith an CIlZ)'me.. Receptor guanylate cyclase activates a chain of cellular events through production of cyclic guanosine monophosphate (GMP) LcGMP1. Receptor l1'rosinc kinase activates a chain of cellular evems through the autophosphorylation of tyrosine. Tyrosine kinasc-associatcd receptor activates a chain of cellular events through the phosphoryliltion of tyrosinc. Receptor tyrosine phosphatase activ<ltes a chain of cellular events through the dephosphorylation of tyrosine. Receptor serine-threonine kinase actiV'<ltes a chain of cellular events through the phosphorylation of serine-threonine.


Receptors and

Signal TranSduetion

105

A. Production of receptor guanylate qclasc (ceMP)

1. When the appropriate signal hinds to receptor guanylate cyclase, its intrinsic emyme guanylate cyclase 'lctivity produces cGMP. 2. cGMP activates ceMP~dependCn.t protein kinase (protein kinase e). which car路 alyzes rhe covalent phosphorylation of serine and rhreonine within certain intracellular proteins to increase their 'lctivity. B. Autophosphorylation of tyrOSine (receptor tyrosine kinase; Figure

19~3)

1. When the 'lppropriate signal binds to teceptor tyrosine kinase, its inrrinsic ryrosine kinase activity catalyzes the autophosphorylation of tyrosine and tyrosine within the teceptor.

prcxluce~ phospho~

2. Many intracellular proteins bind to the phosphotyrosine residue~_ The<;e proteins sh'lre a sequence homology (SH 2 domain) and are c'llleJ SH2-domain proteins. 3. SH2-domain protein interacts with

son-of~sevenJess (50s)

protein_

4. 50s protein activates Ras protein by causing Ras protein to bind GTT>. R'ls prorein is a monomeric G protein rhar is the gene producr of the rlLS prot<Klncob'Cne (see Chapter 14). 5. The 'letivated Ras protein 'lctivates Raf protein kinase. 6. The activared Raf protein kinase activates mitogen路activated protein (MAP) kinase by the covalent phosphoryl'ltion of ryrosine 'lnd rhreonine. 7. The activated MAP kina.<;e leaves the cytoplasm and enters the nucleus, where it phosphorylares gene regulatory proreins. These proreins then cause gene tT".lOscription. C. Phosphorylation of ryrosine {tyrosine kinase-associatoo receptor)

1. When the 'lppropriate sign'll binds to a tyrosine kinase-aS9Xi'lted receptor, rhe ryrosine kin'lse Clt'llyzes the covalent phosphorylation of tyrosine wirhin certain intra路 cellular proteins to increase the activity of the proteins. 2. The Src protein is an important tyrosine kinase rhar is a.~sociar.ed with the receptor. This protein is the gene product of the src proto~oncogene(see Chapter 14). D. Dephosphorylation of tyrosine (receptor tyrosine phosphatase). When the appropriate signal hinds to a receptor tyrosine phosphatase, its intrinsic ryrosine phosphatase C'ltalyzes rhe dephosphorylation of tyrosine wirhin certain inrracellular proteins. As 'l result, the activity of these proteins increa.<;es. E. Phosphorylation of serine-threonine (receptor serine-threonine kinase). When the 'lppropri'lte signal binds to a receptor serine-threonine kin'lse, its intrinsic serinethreonine kin<lSe activity cat'llyze~ the covdlent phosphorylation of serine and rhreonine within certain intracellular proreins. As a result, the activity of these prOleins increase~.

F. Types of elUyme~linked receptors

1. Receptor guanylate cyclase: Atrial natriuretic peptide (ANP) receptor 2. Receptor tyrosine kinase: a. Epidennal growth factor (EeF) receptor b. Platc1et-derivoo growth factor (PDGF) receptor c. Fibroblast growth factor (FeF) receptor d. Nerve growth factor (NGF) receptor e. Vascular endothelial growth factor (VEGF) receptor f. Insulin receptor


106

Chapter 19

GF receptor

.. '

.".r

~f--lnlrinsic tyf05ine kinase

Tyrosine P04

)10

Aas protein-GTP (active)

Figure 19-3. Signal tmnsducnm of enzyme· linked receptors. EGF • epidennal growth facwr; S/-I1 = sequence hoillology protein; Sos - son-of-se\·enless; Ras • r:1I sarcoma; ,.,<fAP = miwgen-octivated protein; DNA - deoxyribonucleic acid.


Receptors and

Signal Transduction

107

3. Tyrosine kinasc"-dssociatcd reccptor: a. Cytokine re(;eptors b. Growth honnone re(;eptor c. Prolaain hormone re(;cptor d. Antib'Cn~spedfk roceptors on Band T Iymphocytcs e. Interlcukin-2 (11--2) receptor 4. Rc(;eptor tyrosine phosphatase: CD45 5. Roceptor serine-threoninc kinase: Tr-dnsfonning growth factor P (TGFP) receptor IV. STEROID HORMONE {INTRACEUUALR} RECEPTORS (see Fib'Ure 19-0 <lrewmposed stnKturally of a polypeptide with a zinc atom that is bound to four cysteine amino acids (zin(; finb'Cr protein; see Chaprer 7). These receplOrs are actually b'Cne regulatory proteins rhar have a honnone-binding region as well as a DNA-binding region th<lt activates gene transcription. A. Activation of gene trdnscription (Figure 19路4)

1.. In<lctive steroid honnone receptors are found in the cytopl<lSm, where rhey are bound to heat shock protcin 90 (hsp90) <lnd immunophilin (hsp56).

2. When rhe appropriate sign<ll (i.e., steroid hormone) diffuses across the cell membrane <lnd binds to the honnone-binding region of the steroid honnone receptor. hsp90 and hsp56 are released, <lnd the DNA-binding region is expo;ed. 3. The steroid-receptor complex is transported to rhe nuelcus. where it binds to DNA <lnd <lcrivates the transcription of <l small number of specific gene~ within approximately 30 minutes (primary response). 4. The gene products of the primary response activate orher genes to produce <l secondary response. B. Types of steroid hormone (intrd(;cllular) reccptors

1. Glucocorticoid roceptor 2. Estrogen receptor 3. PrOb'Csterone reccptor 4. Thyroid honnone receptor 5. Retinoic acid receptor 6. Vitamin D} re(;cptor V. RECEPTOR TYPES. Table 19-1 summarizes the types of receptors.

VI. NITRIC OXIDE (NO) A. NO is a l<lbile, free radical gas with a half-life of about five seconds.

1. It plays <In import<lnt role in the immune fun(;tion of mauophaj:::es. 2. It also plays an important role in blood vessel dilation. 3. Ir. sellles as a neurotransmitter in rhe cenrral nervous system (eNS) <lnd peripheral nervous sysrem (PNS).


108

Olapter 19

Diffusion

Figure 19-4. Signal tr:l.lwuctioo d steroid hormone m::epton. C â&#x20AC;˘ qs.einc; hooudeic acid; hsp ... he:u shod protein.

Zn ... zinc; DNA. deoxyri-

8. NO fonus through the action of nitric oxide synthase (NOS). which catalyzes the reaction that transforms arginine into citrulline and NO. C. NO elicits its action by binding to the heme group of a unique cytoplasmic receptor guanylate cyclase to produce cyclic guanosine monophosphate (cGMP). cGMP activates protein kinase G. ",nich analyzes the covalent phosphurylation of serine and threonine within certai~ intrncellular proteins to increase their activity. D. NO is the active metabolite thar mwiaTes rh~ relaxant effects of many anti-angina organic nitrates such a~ nitroglycerin and nitroprusside; these organic niTT<ltes are metabolized slowly ro produce NO.


Table 19-1. Types of Receptors Ion Channel-llnked Receptors Transmitter-gated ion channel Excitatory nAChR 5-HT3 serotonin receptor Glutamate receptors NMDA receptor Kainate receptor QuisQualate A receptor AMPA receptor Inhibitory GABA A receptor Glycine receptor

G·Proteln·Llnked Receptors

mAChR Adrenergic receptors (al, cQ. ~1, ~2. ~3J

Dopamine receptors (Dl and 02) Purinergic receptors (A-type and p-type)

mGluR

GABA B receptor TSH receptor ACTH receptor

LH receptor

Glucagon receptor Rhodopsin receptor Neuropeptide receptors vasopressin receptors Angiotensin receptor Bradykinin receptor Neuropeptide Y receptor Neurotensin receptor Opiate receptors Oxytocin receptor VIP receptor

Enzyme-Linked Receptcrs Receptor guanylate cyclase ANP receptor Receptor tyrosine kinase EGF receptor PDGF receptor FGF receptor NGF receptor VEGF receptor Insulin receptor

SteroId Hormone (Intracellullar) Receptl Glucocorticoid receptol Estrogen receptor Progesterone receptor Thyroid hormone recep Retinoic acid receptor Vitamin 0 3 receptor

Tyrosine kinase-associated receptor Cytokine receptors Growth hormone receptor Prolactin receptor Antigen-specific receptors IL-2 receptor Receptor tyrosine phosphatase (C045l Receptor serine-threonine kinase (TGFj3l

ACTH .. adrenocorticotropic hormone: AMPA .. r ·amlnO'J.,I)ydrO>;y-5-methyIISOxalOle propionic acid: ANP .. nutrluretic peptide: EGF .. epidermal growth factor; FGF .. fibroblast growth fac GABA .. amlnobutyrlc acid; s.M3 .. s"ydroxytryptamine; IL·2 .. interleukirl-2: LH .. luteiniZ1ng hormone; mACHR .. muscarinic acetylcholine receptor; mGLuR .. metabotropic glutamate receptor; nAChR .. nicotinic acetylcholine receptor; NGF .. nerve growth factor; NMOA .. N·methyi-D-aspartate; POOF .. platelet-dMved growth factor: TGFIHransformlng growth factor ~: TSH .. thyrotropin: VEGF .. vascular endothelial growth factor: VIP .. vasoactl-.e Intestinal polypeiXlde.


UO

Olapter 1.9

E. NO, produced blT endothelial cells within the tunica imi1Tl3 of blood vessels, diffuses to the smooth muscles within the tunica media, and causes smooth muscle relaxation; for example, vasodilation. F. NO is produced by rhe nerve fibers within the tunica adventia of the deep C:1\'ernous artery of the penis. as well as nerve fibers around the sinusoids of the corporol cavemosae of the penis.

1. NO and cCMP rhus playa significant role in penile erection. 2. Viagrn (sildenafil) is an orally active cCMP phosphodiesterolse (Type 5) inhibitor thar promotes high levels of cGMP and vasodilation, and hence, penile erection; Vi<lgJ<.I, therefore, has become a popular dOlg choice for the treatment of penile erectile dysfunction. VII. RECEPTOR-MEDIATED ENDOCYTOSIS

A. Receptor-mediated endocytosis is a process whereby a certain substance le.g.. low density lipoprotein (LDL)J is taken up, or endocytosed by a cell, by means of the action of a specific ret:eptOf" (e.g., LOL receptor). LDL is the principle carrier d serum cholesterol. 8. Receptor-mediated endocytosis occurs when: 1.- The LDL recepwr binds LDL circulating in the blood to form c1athrin-<oated pits in the cell membrane.

2. The c1athrin-eooted pits invaginate to form clathrin-eoated vcsicles th:u fuse with an early endosome Of" compartmenr for uncoupling cJ receptor and ligand (CURL) where the LOL receptor and LDL are disa.ssociated from one another. The early endosome fuses with a late endosome containing active lysosomal en~es. 3. The LDL is IYS060mally degr-.K!ed to cholesterol, which is released into the cytoplasm. 4. The cholesterol inhibits the enzyme 3;hydroxy-3-meth ylglut"olryl-CoA (HMGCoA) reduct"olse. which catalyzes the committed step in cholesterol biosynthesis and thereby suppresses de novo cholesterol biosynthesis. 5. TIle process contributes to keeping senlln cholesterol levels in the norm~l mnge. C. Receptor-mediated endocyt,o;is is clinically relevant in a condition calk-d familial hyper_ cholesterolemia (FH).

1. ITI is a genetic disease involving mltrations in the LDL receptor protein, which causes elevated levels of serum cholesterol and increased incidence of hearr attack early in life. 2_ There are two types of FH路associated LDL receptor prolein mutations: a. The LDL receptor fails to bind LDl.. b. The LDL receptor binds LDL, bur fails to undergo endocytosis. 3. In 1-1-1, HMG-CoA reductase activity and de oovo cholesterol biosynthesis are unchecked.


LippincoB Williams &

Whk~

_

The Science of Review1M WE'VE MADE A SCIENCE OF REVIEW AI Lippincott Williams & Wilkins we',"C made it our goal to help busy mcdil:a! studcnlS review for their COUl~ exams and the USMLE.

Our authors and editors are experienced question wril.e~,

and all of our products provide the jT3.clicc material (nat students cmve. That's why our review series (NMS, MRS, Board Simulator and High-Yield) arc students' first choice.

Boord Review Series IBRS) Behavioral Science Biochemistry Cell Biology & Histology Embryology Gross Anatomy Microbiology & Immunology Neuroanatomy Obslell;cs & Gynecology Pathology Pharmacology Physiology Psychiatry

High-Yield Series Behavioral Science Gross Anatomy

Embryology Neuroanatomy

Biostatistics Histology Inlcrnal Medicine

Saint Francis Guides Illp'dticllI Medicine

National Medicol Series (NMS) Behavioral Science Biochemistry Clinical Analorny Clinical Epidemiology and Biostatistics Clinical Medicine Genetics Hematology Histology Immunology Medicine Microbiology & Infectious Diseases Neuroanatomy Obstetrics & Gynecology Pathology Pediatrics Pharmacology Physiology Preventive Medicine & Public Health Psychiatry

Radiographic Anatomy Review for USMLE. Step I Review for USMLE. Step 2 Surgery

Board Simulotof" Series

Available at your local health science bookstore or call:

'7r u.s. & Canada

General PrincipleS in the Ba<;lc Sciences Nonnal and Abnoonal Processes illlhe Basic Sciences

Body Systems Review I Body Systems Review II Body Systems Review UI

Call: 800-638-0672 International Customers call: UK & Europe: 44-(171) 385-2357 Southeast Asia: 852-2610-2339 All Other Countries: 1-410-528-4223

Lippincott Williams & Wilkins The Science 01 Reviewâ&#x201E;˘


IIlGlI-YIEtD'" GIVES YOU ~10RE This series extracts the most important information on each topic and presents it in a concise, uncluttered fashion to prepare students for the USMLE. High-Yield'" means exactly that!

• Study guides with the barest essentials • Complex ideas presented visually • Lean, efficient text

• Expert authors in their respective fields give

authoritative information

ISBN 0-683-30359-7

A

~.

LIPPINCOIT WIUJAMS &WIu<JN$

High Yield - Cell Molecular Biology  

if you are not a Russian-speaker delete this file immediately! epa"'eH 11 }"-IeHblX. 8 a:06eHHOCTI1 2. ceo60AHoro, Het&lt;OMMep..eCKorO 11 6...

Read more
Read more
Similar to
Popular now
Just for you