Page 1

Volumen 9 Número 1

Enero - Junio 2010

* Editorial (Guías médicas) * Prevalencia de patologías orales en los laboratorios de anatomopatología de la ciudad de Montería, 2002-2008 * Análisis in vitro de la formación de biofilm y sus características moleculares en aislamientos clínicos de S. aureus resistente a meticilina, provenientes de punta de catéter y bacteremia * Éxitos y fracasos del ciclaje de antibióticos para disminuir la resistencia bacteriana * Control del adulto infectado por el virus de la inmunodeficiencia humana (VIH) * Actualización en Medicina Basada en Evidencias * Diarreas bacterianas * Ciencia y Medicina

www.unisinu.edu.co

Montería - Colombia


Revista Medicina Vol. 9 No. 1 Enero - Junio 2010 ISSN 1692-0880

Fundador Dr. Elías Bechara Zainúm Rectora Dra. Adriana Suárez de Lacouture Decano de la Facultad de Ciencias de la Salud Dr. Luciano Lepesqueur Gossaín Jefe del Programa de Medicina Dr. Heiser Arteaga Pautt Coordinador del Área Clínica Dr. Jorge Ordosgoitia Santana Director - Editor Dr. Álvaro Bustos González Consejo Asesor

Comité Editorial

Dr. Jordi Vila Departamento de Microbiología Clínica Universidad de Barcelona, España

Dr. Patricio Herrera Labarca Epidemiólogo Clínico Universidad de Chile

Dr. Jesús Silva Jefe del Laboratorio de Resistencia Bacteriana Instituto Nacional de Salud Pública, México, DF

Dr. Salim Máttar Velilla Microbiólogo, PhD Universidad de Córdoba

Dr. Edgar Prieto Coordinador de Scielo Colombia Universidad Nacional, Bogotá

Dra. Ángela Restrepo Moreno Investigadora, Corporación para Investigaciones Biológicas Medellín, Colombia

Dr. Álvaro Villanueva Internista Infectólogo Universidad Simón Bolivar, Barranquilla, Colombia Dr. Luciano Aponte Gastroenterólogo y Endoscopista Asociación Médica de los Andes, Bogotá

Dr. Xavier Sáez Llorens Pediatra Infectólogo, Hospital de Niños Panamá, República de Panamá Dr. Hugo Trujillo Soto Investigador, Corporación para Investigaciones Biológicas Medellín, Colombia

Dr. Jorge Padrón Cirujano Colo-Proctólogo Universidad del Rosario, Bogotá Dr. Efraín Bonilla Arciniegas Cirujano Infantil, Universidad Nacional, Bogotá

Dra. Carla Odio Pérez Pediatra Infectóloga, Hospital de Niños San José, Costa Rica Dra. Eugenia Espinosa García Pediatra Neuróloga Universidad Militar Nueva Granada, Bogotá

Diseño y Diagramación Ramiro Navarro Pérez publicaciones@unisinu.edu.co


EDITORIAL Editorial

Pag

INDICE

Guías médicas Medical guides TRABAJOS ORIGINALES Original Works Prevalencia de patologías orales en los laboratorios de anatomopatología de la ciudad de Montería, 2008-2008 Prevalence of oral diseases in pathology laboratories in Monteria city, 2002 - 2008 Dres. Luz Hernández, Luis Herrera y Martha Vergara Análisis in vitro de la formación de biofilm y sus características moleculares en aislamientos clínicos de S. aureus resistente a meticilina, provenientes de punta de catéter y bacteremia In vitro analysis of the formation of biofilms and its molecular characteristics in S. aureus meticillin resistant clinical isolation, coming from catheter end and bacteremia Dr. Heisser Artega Pautt y cols.

3

4

12

ARTÍCULOS Articles Éxitos y fracasos del ciclaje de antibióticos para disminuir la resistencia bacteriana Successes and failures of antibiotics cycling to decrease bacterial resistance Dres. Pedro Martínez y Grace Arenas Control del adulto infectado por el virus de la inmunodeficiencia humana (VIH) The control of HIV infected adults Dr. Rodrigo Giraldo Bustos

21

28

Actualización en Medicina Basada en Evidencias (MBE) Update on evidence based medicine (EBM) Dr. Humberto González Calderín

36

Diarreas bacterianas Bacterial diarrhea Dr. Álvaro Bustos González

53

ENSAYO Essay Ciencia y Medicina Science and Medicine Dr. Patricio Herrera Labarca

58

A los Colaboradores

61


Editorial

Guías médicas Medical guides Por muchas razones, pero principalmente porque la medicina no es una ciencia y porque con ella es inútil dogmatizar, he sido remiso a acatar las guías de diagnóstico y tratamiento que, con la mejor buena fe, se divulgan en torno a la necesidad de racionalizar métodos y costos en favor del acto médico y de quienes lo sufragan. Entiendo la necesidad de establecer normas y de amojonar linderos en este campo, pero también me doy buena cuenta de que en ciertos niveles de la práctica, bien tratándose de la formación de estudiantes o de la toma de decisiones frente a problemas de elevada complejidad clínica, los libretos suelen convertirse en estorbos o en camisas de fuerza que en nada contribuyen a que el pensamiento discurra por los cauces, a veces laberínticos, que plantea la diversa expresión del fenómeno biológico llamado enfermedad. Los astrónomos pueden predecir un eclipse con exactitud; los médicos sólo podemos conjeturar. La medicina no es una ciencia porque su naturaleza no es la de problematizar sino la de resolver problemas. Si frente al paciente predominara el criterio científico, éste no tendría empacho en omitir la situación tridimensional del enfermo (definido como un ser bio-psico-social inmerso en una cultura y, por supuesto, subordinado a unos prejuicios), para ocuparse de exaltar, por ejemplo, el brillo aparente de un procedimiento o, en veces, las desmesuradas esperanzas que se ciernen sobre una terapia novedosa. Ciencia y medicina no se contraponen, desde luego, pero el acto médico, llamado a aliviar el sufrimiento y a curar en la medida de lo posible, parte de la relación entre una confianza y una conciencia, entre una fe y una ética, que sólo busca el beneficio concreto de un individuo y no la formulación de leyes generales que sirvan, a posteriori, para interpretar todos los casos por igual. Ahora que las Sociedades Científicas, dentro de las reformas que se han planteado a la Seguridad Social y al Plan Obligatorio de Salud, elaborarán las guías de manejo, no estaría de más que advirtieran sobre la vigencia que tiene la mejor y más sofisticada tecnología con que cuenta el médico: la historia clínica y el examen físico. El olvido de estas cosas es el origen de los abusos y de los palos de ciego que solemos dar cuando no vemos la luz al final del túnel. ¿Cuántas pruebas diagnósticas inútiles y cuántas formulaciones innecesarias atiborran los anaqueles del desgreño médico y de las instituciones prestadoras de salud? Y de otra parte, ¿cuánto tiene que 3

ver el mal uso que los pacientes hacen de sus derechos con el colapso de los recursos que mejor servirían a quienes de verdad los necesitan? No pretendo decir que médicos y pacientes son los responsables de la crisis. La índole de estos asuntos no es tan sencilla. Ya sabemos que entre la burocracia (los funcionarios mentales de que habla el escritor andaluz Antonio Muñoz Molina) y las corruptelas de la administración, se diluye buena parte de los dineros de la salud. Pero es indudable que aquella relación entre una confianza y una conciencia debe fundarse en unos elementos más lógicos y objetivos, más prudentes si se quiere, para que el acto médico resulte más idóneo y para que la comunidad aprenda algo sobre su propia variabilidad genética, sobre su forma individual e intransferible de responder a la enfermedad y sobre el misterio que entraña la evolución inesperada o absurda de un trastorno orgánico, por nimio que parezca. Que la medicina no es una ciencia lo corrobora el hecho de que sus doctrinas y procederes cambian de país a país. Una tal “espasmofilia”, descrita en Francia en 1.948, resultó en una “hiperventilación crónica” en el Reino Unido. En Europa, donde existe una tendencia comprensiva hacia las medicinas alternativas, algunos enfermos buscan alivio en termales y alfaguaras, mientras que en Estados Unidos, donde se prefieren tratamientos alopáticos, aquellos métodos son asimilados a supercherías. Hace 200 años, en plena época de la metromanía, a un doctor Petit se le ocurrió proponer una clasificación mensurable del dolor de acuerdo con los tonos de los gritos, y para el efecto escribió: “Los gritos que arranca la aplicación del fuego pertenecen a los tonos graves, mientras que los que produce el dolor por herida cortopunzante son de tono agudo”. Ojalá que el debate actual concluya como debe ser: en el reconocimiento de que la práctica médica sólo debe atenerse a la mejor de las guías, que surge de las buenas lecturas, de una experiencia sedimentada y autocrítica, y

en especial de las expectativas del enfermo y su familia, que constituyen, en virtud de sus mitologías y anhelos metafísicos, el fin último del humanismo médico. Dr. Álvaro Bustos González Revista Medicina Vol. 9 No. 1 Editorial. Pág. 1 de 1


Vol. 9 No. 1, 2010 (Enero - Junio)

Revista Medicina

Prevalencia de patologías orales en los laboratorios de anatomopatología de la ciudad de Montería, 2002 – 2008. Prevalence of oral diseases in pathology laboratories in Monteria city, 2002 - 2008 Hernandez Luz*, Herrera Luis*, Vergara Martha* e-mail: martho22@hotmail.com *Grupo de investigación del programa de odontología ODIN Universidad del Sinú. Dirección de correspondencia: Calle 38 cra. 1 W bloque 5 piso 2 - tel: 7840340 ext 121. Resumen Objetivo: Identificar la prevalencia de patologías orales reportadas en los laboratorios de anatomopatologia en la ciudad de Montería. Método: Se realizó un estudio cuantitativo retrospectivo tomando como base los estudios de biopsias que se realizan en los laboratorios, registrados en libros y bases de datos sistematizadas. Se procedió a la clasificación de estos estudios, teniendo en cuenta únicamente los realizados en la cavidad oral, donde se tomaron los siguientes datos: sexo, edad, diagnóstico, localización de la patología y procedencia del paciente. Resultados:Se revisaron un total de 79.514 estudios patológicos, de los cuales sólo 43 (0.05%) pertenecen a la cavidad oral en el transcurso de estos siete años en el periodo 2002 - 2008, siendo el carcinoma escamocelular la patología más frecuente con 9 casos (20.9%); el sexo femenino con 26 casos (60%) y el sexo masculino con 17 casos (40%); las edades de 32 a 40 años fueron las más afectadas con 6 casos (13,9%); la localización anatómica más afectada fue la lengua con 11 casos (25,6%). Conclusiones: Son pocos los casos reportados en el transcurso de estos siete años; es importante destacar que los laboratorios no tienen en cuenta la procedencia de los pacientes a los que se realizan los estudios de biopsia y en algunos casos se omiten datos como la edad y la localización anatómica. Además hay que tener en cuenta que muchas veces las personas no se hacen estos estudios por motivos económicos, incultura o ignorancia. Palabras Clave: Cavidad oral, patologías orales, anatomopatología, carcinoma escamocelular. Abstract Objetive: The aim of this study was to identify the prevalence of oral pathology laboratories reported anatomopathologic in Monteria city Method: We performed a quantitative retrospective study based on studies of biopsies that are performed in laboratories, in books and databases systematized. We proceeded to the classification of these studies, taking into account only in the oral cavity where it took the following data: sex, age, diagnosis, anatomic location, the origin of the patients. Results: We reviewed a total of 79,514 pathological studies of which only 43 (0.05%) belong to the oral cavity during these seven years in a period 2002 - 2008, squamous cell carcinoma being the most frequent pathology in 9 patients (20.9 %), females with 26 cases (60%) and male 17 cases (40%); ages 32 to 40 years were the most affected with 6 cases (13.9%), but the anatomic location most affected was the tongue with 11 cases (25.6%). Conclusions: Few cases reported during these seven years; it is important to note that laboratories do not take into account the origin of the patients who performed the studies of biopsies and in some cases omitted data such as age and anatomic location. We also have to take into account that many people do not do these studies for economic reasons, culture, and for ignorance. Key words: Oral cavity, oral pathology, anatomopathological, squamous cell carcinoma.

4

Recibido para publicación el 12 de febrero de 2010. Aceptado el 26 de febrero de 2010.

Revista Medicina Vol. 9 No. 1 Prevalencia de patologías orales en los laboratorios de anatomopatología... Pág. 1 de 8


Prevalencia de patologías orlaes en los laboratorios de anatomopatología...

Introducción La presente investigación se decidió realizar luego de un análisis previo a través del cual se pudo determinar el alcance y el aporte primordial que este estudio traería a la comunidad de Montería, teniendo en cuenta que el trabajo desarrollado es el primero de este género. Las patologías orales son enfermedades, procesos o estados anormales de causa conocida o desconocida que pueden llegar a ser muy agresivas en algunos casos, teniendo una mayor importancia donde existe una progresión tumoral o cancerígena. Los estados anormales en la boca suelen ocasionar problemas estéticos, psicológicos, funcionales, biológicos y socioeconómicos en las personas, afectando su calidad vida. Por tal motivo es de gran importancia conocer cuál es el porcentaje de afectación de una comunidad, sobre todo en un medio donde no se cuenta con informes que indiquen la incidencia y prevalencia de estas alteraciones, como en la ciudad de Montería A través de es este estudio se podrá determinar la morbilidad oral y concientizar a los pobladores, dándoles a conocer las enfermedades orales que más están afectándolos y buscando promover el autoexamen oral, para así disminuir la mortalidad resultante de alguna de estas patologías, mejorando la calidad de vida de la comunidad. Materiales y métodos Se realizó un estudio cuantitativo retrospectivo para determinar la prevalencia de patologías orales, tomando como base los estudios de biopsias que se realizan en los laboratorios anatomopatológicos de Montería, registrados en libros y bases de datos sistematizadas. Se procedió a la clasificación de estos estudios, teniendo en cuenta únicamente los realizados en la cavidad oral, y donde se tomaron los siguientes datos: sexo, edad, diagnóstico y localización de la patología. Resultados Luego de realizar la revisión de los estudios de biopsias que se realizan en los laboratorios anatomopatologicos de Montería, registrados en libros y bases de datos sistematizadas, entre las patologías que pueden producir variaciones tanto clínicas como histológicas y que se encuentran afectando a la población de Córdoba, se encuentran: Las enfermedades periodontales (2.32%), los quistes de revestimiento epitelial (4.65%), los tumores odontógenos (2.32%), las lesiones aisladas de la mucosa (2.32%), 5

Trabajo Original

lesiones hiperplásicas como la hiperplasia inflamatoria (6.9%) , hiperplasia epitelial (6.9%), hiperplasia fibroepitelial (13.9%), hiperplasia gingival (4.65%), épulis granulomatoso (2.32%), granuloma reparativo de células gigantes (2.32%), y granuloma piógeno (2.32%); asi como la neoplasia de tejido conjuntivo (11.6%) y epitelial benigna (4.65%) y maligna (25.5%), por último enfermedades de las glándulas salivales de tipo 16,20 obstructivo con un (2.32%) . La distribución por sexo en número y porcentaje del total de patologías encontradas en los laboratorios anatomopatológicos de Montería, con 26 casos (60%) en mujeres y 17 casos (40%) en hombres, demuestra en la tabla que el sexo femenino es más vulnerable a presentar patologías orales que el sexo masculino. Los laboratorios de anatomopatología de Montería no están teniendo en cuenta la edad del paciente en todos los casos para los respectivos estudios histológicos, ya que se encontraron 8 casos donde no se especificaba la edad. La tabla muestra que la edad de 32 a 40 años fue la más afectada, con 6 casos. Además es muy importante resaltar que el carcinoma escamocelular está afectando con mayor frecuencia a las personas en edades comprendidas entre los 75 a 85 años de edad. La localización de las patologías en cavidad oral, no se está teniendo en cuenta la localización de las patologías en todos los casos para los respectivos estudios histológicos, ya que se encontraron 25 casos (58%) donde no se especificaba la localización. Además esta tabla muestra que en los casos donde se reporta la localización, la lengua fue el sitio más afectado, con 11 casos (25,6%), donde 5 casos pertenecen al carcinoma escamocelular. Discusión La patología más frecuente en Montería es el carcinoma escamocelular con un 20.9%. En relación con el estudio realizado en México por Barrios J.O y col.4 en los años 2001-2005, es similar en cuanto que la patología más frecuente es el carcinoma escamocelular con un 17,8%. Pero los resultados difieren en cuanto al estudio realizado 5 por Ovalle J.W. en 1990-1996 en México, donde el granuloma periapical crónico infectado (9.84%) es el más común, así como con el estudio realizado por Barrios B y col.7 de 1997 a diciembre de 2001 en México, reportando la hiperplasia fibrosa inflamatoria (14.3%), Martínez C y col.24 en España en el año 2001, la pigmentación 1 melánica (24.6%), y Moret Y y col. en Venezuela durante el período 1968-1987 la leucoplasia (15.2%). Revista Medicina Vol. 9 No. 1 Prevalencia de patologías orales en los laboratorios de anatomopatología... Pág. 2 de 8


Trabajo Original

Prevalencia de patologías orlaes en los laboratorios de anatomopatología...

En cuanto al género se encontró que en Montería el sexo femenino fue el más afectado en un 60% y el masculino en un 40%, similar a estudios como los de Barrios B y col., con 61.2% en mujeres y 36.2% en hombres; Martínez C y col. en que 41,5% fueron hombres y 58,5% mujeres; Moret Y y col. 68,6% mujeres y 31,4% hombres; pero difiere con lo encontrado por los autores Barrios J.O donde el masculino predominó con un 64,45% con respecto al femenino, con un 35,55%. Con respecto a la distribución de frecuencia según la localización de la lesión: Barrios J.O y col, observaron tres localizaciones importantes, el labio inferior con una frecuencia de 139 lesiones (26.38 %), en segundo lugar la lengua con 91 lesiones (17.27 %), y la encía en un tercer lugar (10.63 %). Martínez C y col. en la distribución de las localizaciones tuvo mucosa yugal (n=208; 36,1%), labio (n=119; 20,6%), encía (n=76; 22,4%), cara ventral de la lengua y suelo de boca (n=75; 13%), dorso y borde lateral de la lengua (n=33; 5,7%) y paladar (n=11; 1,9%). Moret Y y col. hallaron que la localización anatómica más frecuentemente afectada fue la encía maxilar (n=319; 14,1%). En el estudio realizado en Montería se encontraron cuatro localizaciones importantes: la lengua (25,6%), el paladar (9,3%), la región maxilar (4,6%) y la mucosa gingival (2,3%). En relación a la edad el grupo de 32 a 40 años fue el más afectado en la ciudad de Montería, coincidiendo con Martínez C. y col que reportaron el grupo de edad de 30 a 40 años como el más afectado. Los resultados de esta investigación en Montería también nos muestran 2 neoplasias malignas: el carcinoma escamocelular con 9 casos encontrados y el adenocarcinoma con 2, coincidiendo con autores como Cawson 198320 y Sapp 2005,16 que reportan al carcinoma escamocelular como el más frecuente de todos los 22 cánceres orales. Moreno O. L. y Álvarez J. A. en un estudio sobre frecuencia de patologías orales malignas en la población de Popayán en el periodo enero de 2000 a octubre de 2006 reportan el carcinoma escamocelular con una mayor frecuencia que el adenocarcinoma, similar al estudio realizado en Montería. La leucoplasia es otra lesión que cabe resaltar por ser una lesión premaligna sobre la cuál autores como Sapp y col 16 25 2005 y Roosaar A y col. 2007, informan que un 5,4% acabará siendo un carcinoma escamocelular y su tasa de aparición es de 1,5 al 12%, rango que coincide con la investigación realizada en Montería, donde su incidencia es del 2,32%. 6

Conclusiones Los resultados de esta investigación han puesto de manifiesto que en la ciudad de Montería los estudios patológicos de cavidad oral son muy bajos, correspondiendo a 43 casos de un total de 79.514 estudios revisados durante 7 años en el periodo de 2002 a 2008. Es importante destacar que los laboratorios no tienen en cuenta la procedencia de los pacientes que se realizan los estudios de biopsias y en algunos casos se omiten datos como la edad y la localización anatómica. Cabe resaltar la importancia que tiene la enseñanza del auto-examen de la cavidad oral en los pacientes para prevenir el cáncer oral, puesto que en este estudio el carcinoma escamocelular fue la patología más frecuente con un 20.9%, entendiéndose que el diagnóstico y tratamiento de lesiones premalignas en etapas tempranas puede que tenga mejor resultado para los pacientes. Bibliografía 1. Moret Y, Rivera H, Cartaya M. “Prevalencia de lesiones en la mucosa bucal de pacientes diagnosticados en el laboratorio central de histopatología bucal "dr. Pedro tinoco" de la facultad de odontología de la universidad central de Venezuela durante el período 1968-1987;45(2). 2. Jiménez C y col. Estudio retrospectivo de lesiones patológicas en niños y adolescentes. servicio de clínica estomatológica Facultad de Odontología Universidad Central de Venezuela. período 1992-2006:1 - 10. 3. Beatriz García, Arturo Guerra, C Mikhail Benet, “Lesiones de la mucosa bucal del adulto mayor. Un estudio en cinco consultorios del área III de Cienfuegos”. Rev MS[en línea] 2005 [fecha de acceso noviembre 15 de 2008]; 3(3). URL disponible en: www.medisur.sld.cu/index.php/medisur/article /viewArticle/122 - 37k . 4. Barrios J.O;. Vilas L; Córdova D; Barrios I. Estudio Histológico de Lesiones de la Cavidad Bucal en el quinquenio 2001–2005. Archivo Médico de Camagüey [en línea] 2007. [fecha de acceso noviembre 15 de 2008]; 11(1). URL disponible en: www.amc.sld.cu/amc/2007 /v11n1-2007/2190.htm - 100k 5. Ovalle Castro José Wilbert. Prevalencia de lesiones histopatológicas bucales en la zona del Bajío. Rev ADM [en línea] 2000 [fecha de acceso noviembre 15 de 2008]; LVII (4). U R L d i s p o n i b l e e n : w w w. i m b i o m e d . c o m . m x / 1/1/articulos.php?method=showDetail&id_articulo=632&id_se ccion=144&id... - 47k .

Revista Medicina Vol. 9 No. 1 Prevalencia de patologías orales en los laboratorios de anatomopatología... Pág. 3 de 8


Prevalencia de patologías orlaes en los laboratorios de anatomopatología...

6. Teresita de J y col, “Epidemiología oral de tejidos duros y blandos en escolares del estado de Yucatán, México”. Rev Biomed [en línea] 1997[fecha de acceso noviembre 15 de 2008]; 8:65 - 79. URL disponible en: www.uady.mx/~biomedic/revbiomed/pdf/rb97822.pdf. 7. Barrios B; Martínez G; Legorreta B. “Frecuencia de lesiones bucales histopatológicas en un laboratorio de patología bucal. Rev. Asociación Dental Mexicana [en línea] 2007 [fecha de acceso noviembre 15 de 2008]; 64(2). URL disponible en: www.medigraphic.com/ pdfs/adm/od-2007/od072e.pdf. 8. Espinosa M, loza G, Mondragón R. “Prevalencia de lesiones de la mucosa bucal en pacientes pediátricos. Informe preliminar”. Cir.Ciruj. [en línea] 2006 [fecha de acceso noviembre 15 de 2008]; 74(3). URL disponible en: redalyc.uaemex.mx/redalyc/pdf/662/66274303.pdf. 9. Donohué A. y col, “Distribución de condiciones y lesiones de la mucosa bucal en pacientes adultos mexicanos” Rev Cubana Estomatol. [en línea] 2007 [fecha de acceso noviembre 15 de 2008]; 44(1).URL disponible en: imbiomed.com.mx/1/1/ articulos.php?method=showDetail&id_articulo=46371&id_sec cion=770&id...63 - 46k. 10. López Jornet P, Saura Pérez M. “Prevalencia de lesiones mucosas en población anciana de la Región de Murcia” Av Odontoestomatol [en línea] 2006 [fecha de acceso noviembre 15 de 2008];22 (6). URL disponible en: scielo.isciii. es/scielo.php?pid=S021312852006000600004 &script=sci_arttext - 29k. 11. Cohen R.B Tumores en la boca. Nuevo Manual Merck de información médica general 2007. Océano, p 809-812. 12. John S. Greenspan. Principios de medicina interna. 14ª edición.Mexico: Mc Graw Hill 2000. 13. Gonzalez S, Otero F, Garcia M, Cebrian JL. Lesiones de la mucosa oral.[Sitio en internet]. Disponible en: archivos.secom.org/archivo/pdf/capitulo4.pdf. consultado: enero 26 de 2009.

Trabajo Original

16. Sapp JP, Eversole LR, Wysocki G P. Patología y Oral y Maxilofacial contemporánea. 2ª ed.Madrid:ELSEVIER; 2005. 17. Wood N.k, Goaz P.W. Diagnostico diferencial de lesiones orales y maxilofaciales, 5ª ed. España: Harcourt Brace ; 1998. 18. Regezi J; y Sciubba J. Patología bucal Patología Bucal 2ª. ed. México: McGraw-Hill Interamericana; 1995. 19. Shafer W.G; Levy B.M; Hine M.K; Tomich C.E. Tratado de Patologia Bucal 4ª. ed.lugar :Interamericana; 1986. 20. R.A Cawson. Cirugía y patología odontológicas. 3ª. ed México: El manual moderno; 1983. 21. Joseph M. Aulino, Megan K. Strother, Jason L. Shipman. Imaging of Oral Cavity Squamous Cell Carcinoma. Oral Maxillofacial Surg Clin N Am 18 (2006) 445–463. 22. Moreno O.L., Álvarez J. A. Frecuencia de patologías orales malignas en la población de Popayán en el periodo enero de 2000 a octubre de 2006. Rev fac ciencias de la salud [en línea] 2007 [fecha de acceso noviembre 15 de 2008]; 9(2). URL disponible en: www.facultadsalud.unicauca.edu. co/fcs/2007/junio/RevistaJunio.html - 5k. 23. Kademani D., Dierks E. Management of Loco-regional Recurrence in Oral Squamous Cell Carcinoma.Oral Maxillofacial Surg Clin N Am 18 (2006) 615–625. 24. Martínez C, Garcia M. Epidemiological study of oralmucosal pathology in patients of the Oviedo School of Stomatology. MEDICINA ORAL [en línea] 2002 [fecha de acceso noviembre 15 de 2008]; 7(1) URL disponible en: www.ncbi.nlm.nih.gov/pubmed/11788804. 25. Roosaar A., Yin L., Johansson LV., Sanborgh-Englund G., Nyerén O., Axéll T. A long-term follow up study on the natural couser of oral leukoplakia in Swedish population-based sample. J. Oral Pathol Med 2007.36, p:78 -82.

14. Castellanos J.L. Mucosa bucal. Lesiones rojas. Revista ADM [en línea] 2002 [fecha de acceso noviembre 15 de 2008]; 59 (5). URL disponible en: www.medigraphic.com/ pdfs/adm/od-2002/od025h.pdf. 15. Aguas SC,Lanfranchitizeira HE.Lesiones premalignas o cancerizables de la cavidad oral. Revista de la Facultad de Odontología (UBA) [en línea] 2004[fecha de acceso noviembre 15 de 2008]; 19 (47). URL disponible en: w w w. o d o n . u b a . a r / r e v i s t a / 2 0 0 4 v o l 1 9 n u m 4 7 / d o c s / desglose/AGUAS.pdf. 7

Revista Medicina Vol. 9 No. 1 Prevalencia de patologías orales en los laboratorios de anatomopatología... Pág. 4 de 8


Trabajo Original

Prevalencia de patologías orlaes en los laboratorios de anatomopatología...

ANEXOS Tabla 1.Patologías encontradas en los laboratorios anatomopatológicos Montería 2002 -2008 Diagnostico

8

Total/ cantidad N°

%

Carcinoma escamocelular

9

20.9

Hiperplasia fibroepitelial

6

13.9

Fibroma traumático

5

11.6

Hiperplasia inflamatoria

3

6.9

Hiperplasia epitelial

3

6.9

Hiperplasia gingival

2

4.65

Papiloma

2

4.65

Quiste dentigero

2

4.65

Adenocarcinoma

2

4.65

Granuloma piógeno

2

4.65

Leucoplasia

1

2.32

Gingivitis crónica activa

1

2.32

Granuloma reparativo de celulas gigantes

1

2.32

Papilomatosis florida bucal

1

2.32

Odontoma

1

2.32

Epulis granulomatosos

1

2.32

Mucoceles

1

2.32

Total

43

100

Revista Medicina Vol. 9 No. 1 Prevalencia de patologías orales en los laboratorios de anatomopatología... Pág. 5 de 8


Trabajo Original

Prevalencia de patologías orlaes en los laboratorios de anatomopatología...

Grafico 1 .Distribución por sexo en laboratorios anatomopatológicos Montería 2002 -2008.

40%

HOMBRES

60%

MUJERES

Tabla 2 Distribución por diagnóstico de patologías y sexo en laboratorios anatomopatológicos Montería 2002 -2008. Patología

9

Sexo

Total

Masculino

Femenino

%

%

%

Carcinoma escamocelular

5

29,41

4

15,38

9

20,93

Hiperplasia fibroepitelial

2

11,76

4

15,38

6

13,95

Fibroma

2

11,76

3

11,53

5

11,62

Hiperplasia inflamatoria

2

11,76

1

3,84

3

6,97

Hiperplasia epitelial

1

5,88

2

7,69

3

6,97

Hiperplasia gingival

-

0

2

7,69

2

4,65

Papiloma fibroepitelial

1

5,88

1

3,84

2

4,65

Quiste dentígero

1

5,88

1

3,84

2

4,65

Adenocarcinoma

1

5,88

1

3,84

2

4,65

Granuloma piógeno

-

0

2

7,69

2

4,65

Leucoplasia

-

1

3,84

1

2,32

Gingivitis crónica activa

1

5,88

_

0

1

2,32

Granuloma reparativo de células gigantes

_

0

1

3,84

1

2,32

Papilomatosis

_

0

1

3,84

1

2,32

Odontoma

_

0

1

3,84

1

2,32

Épulis granulomatoso

_

0

1

3,84

1

2,32

Mucoceles

1

5,88

_

0

1

2,32

Total

17

100

26

100

43

100

Revista Medicina Vol. 9 No. 1 Prevalencia de patologías orales en los laboratorios de anatomopatología... Pág. 6 de 8


Trabajo Original

Prevalencia de patologías orlaes en los laboratorios de anatomopatología...

Tabla 5.Distribución de las patologías según su localización en laboratorios anatomopatológicos Montería 2002 -2008. Patología

Localización Total Paladar

10

Lengua

R. maxilar

M. gingival

No especi

%

%

%

%

%

%

C. escamocelular

2

50

5

45,4

1

50

1

100

_

_

9

20,93

H. fibroepitelial

_

_

_

_

_

_

-

-

6

24

6

13,95

Fibroma

-

-

-

-

-

-

-

-

5

20

5

11,62

Hiperplasia inflamatoria

1

25

2

18

-

-

-

-

_

_

3

6,97

Hiperplasia epitelial

-

-

1

9

1

50

-

-

1

4

3

6,97

Hiperplasia gingival

-

-

_

_

-

-

-

-

2

8

2

4,65

Papiloma fibroepitelial

-

-

1

9

-

-

-

-

1

4

2

4,65

Quiste dentígero

-

-

_

_

-

-

-

-

2

8

2

4,65

Adenocarcinoma

1

25

1

9

-

-

-

-

_

_

2

4,65

Granuloma piógeno

-

-

_

_

-

-

-

-

2

8

2

4,65

Leucoplasia

-

_

1

9

-

-

-

-

_

_

1

2,32

Gingivitis crónica activa

_

_

_

_

-

-

-

-

1

4

1

2,32

Granuloma reparativo de células gigantes

_

_

_

_

-

-

-

-

1

4

1

2,32

Papilomatosis

_

_

_

_

-

-

-

-

1

4

1

2,32

Odontoma

_

_

_

_

-

-

-

-

1

4

1

2,32

Épulis granulomatoso

_

_

_

_

-

-

-

-

1

4

1

2,32

Mucoceles

-

_

_

-

-

-

-

1

4

1

2,32

Total

4

11

100

2

100

1

100

25

100

43

100

100

Revista Medicina Vol. 9 No. 1 Prevalencia de patologías orales en los laboratorios de anatomopatología... Pág. 7 de 8


Trabajo Original

Prevalencia de patologías orlaes en los laboratorios de anatomopatología...

Grafico 2. Porcentaje de localización de patologías.

PALADAR (9,3%)

LENGUA (25,6%)

MUCOSA GINGIVAL (2,3%)

11

REGIÓN MAXILAR (4,6%)

NO ESPECIFICADO (58%)

Revista Medicina Vol. 9 No. 1 Prevalencia de patologías orales en los laboratorios de anatomopatología... Pág. 8 de 8


Vol. 9 No. 1, 2010 (Enero - Junio)

Revista Medicina

Análisis “in vitro” de la formacion de biofilm y sus características moleculares en aislamientos clínicos de Staphylococcus aureus resistentes a meticilina (SARM), provenientes de punta de catéter y bacteremia In vitro analysis of the formation of biofilms and its molecular characteristics in S. aureus meticillin resistant clinical isolation, coming from catheter end and bacterimia Heiser Arteaga Pautt .1, Javier Escobar Pérez. 2, Aura Lucía Leal. 3, Natasha Vanegas. 4. 1. Médico -M.Sc Investigador Docente, Universidad del Sinú 2. Químico -M.Sc Instituto de Genética Molecular Bacteriana, Universidad El Bosque. 3. Médico -M.Sc Investigador GREBO 4. Bióloga -PhD Instituto de Genética Molecular Bacteriana, Universidad El Bosque. e-mail: harteaga@unisinu.edu.co Resumen Según la Organización Mundial de la Salud, Staphylococcus aureus resistente a meticilina (SARM), se ha convertido en un grave problema de salud pública a nivel mundial, siendo este uno de los principales patógenos nosocomiales. Actualmente se busca determinar la importancia del biofilm en la virulencia y patogenicidad de los Staphylococcus spp., para proponer mejores alternativas de manejo. Existe evidencia de que diversos factores inducen la formación de biofilm en aislamientos de Staphylococcus spp., como condiciones de anaerobiosis, incremento en la concentración de azúcares y concentraciones subinhibitorias de antibióticos. Se ha demostrado que el biofilm disminuye la acción del sistema inmune y la acción farmacológica de los antibióticos, lo que obliga en muchos casos a retirar el dispositivo (catéter), situación en ocasiones imposible en pacientes en estado crítico, que dependen de la infusión intravenosa para mantener sus condiciones hemodinámicas. Muchas de las cepas de S. aureus contienen el operon ica, encargado de la síntesis del Polisacárido Intercelular de Adhesión (PIA); aunque también hay cepas que no poseen dicho operon y forman biofilm por mecanismos aun no muy claros, por lo tanto la caracterización molecular podría ser útil para desarrollar métodos que busquen disminuir la formación de biofilm, además la detección de genes de resistencia a antibióticos en estos aislamientos favorecerá la adecuada guía de manejo terapéutico en esta clase de pacientes. En el presente trabajo, se estudió la formación de biofilm y su caracterización molecular en aislamientos clínicos de SARM por primera vez en Colombia. Palabras claves: Staphylococcus aureus resistente a meticilina (SARM), biofilm, bacteremia, adhesinas, resistencia antimicrobiana. Abstract According to the World Health Organization, MRSA has become a serious world wide public health problem, being this one of the principal nosocomial pathogens. The importance of biofilm in the virulence and pathogenesis of Staphylococcus spp. is under research, in order to propose better handling alternatives. Evidence shows that diverse factors induce the formation of biofilm in Staphylococcus spp. isolates such as anaerobiosis conditions, increase in sugar concentrations and antibiotic sub-inhibitor concentrations. It has been demonstrated that biofilm diminishes the action of the immune system and the pharmacological action of antibiotics, which in many cases compels to withdraw the catheter, a situation that in critical patients is not viable, since they depend on the intravascular infusion to maintain its hemodynamic conditions. Many of the S. aureus strains contain the ica operon, which is in charge of the synthesis of the Intercellular Adhesion Polysaccharide (IAP); however there are also strains that do not have such operon and which form biofilm by mechanisms that are not yet clear. For this reason the molecular characterization and the detection of antibiotic resistant genes of the clinical strains could be useful to develop methods to diminish the biofilm formation. In this work, the molecular characterization of biofilm was developed, since such related studies do not exist in the country, neither the formation of biofilm in MRSA clinical isolates in Colombia has been studied. Key words: Methicillin resistant Staphylococcus aureus (MRSA), biofilm, bacteriemia, adhesins, antimicrobial resistance. 12

Recibido para publicación el 9 de junio de 2010 Aceptado el 24 de junio de 2010

Revista Medicina Vol. 9 No. 1 Análisis “in vitro” de la formación de biofilm y sus características moleculares ... Pág. 1 de 9


Análisis “in vitro” de la formación de biofilm y sus características moleculares...

Introducción Staphylococcus aureus es una bacteria patogénica y responsable de una amplia gama de enfermedades como lesiones superficiales de la piel, abscesos, osteomielitis, endocarditis e intoxicación alimentaria. Muchas infecciones producidas por Staphylococcus spp. están asociadas a su capacidad de formar biofilm o biopelículas, definido como una comunidad estructurada de bacterias encerradas en una matriz polimérica que ellas mismas producen, la cual se adhiere a una superficie con vida (tejidos), o inerte (diferentes dispositivos médicos, implantes o catéteres)1 Staphylococcus aureus resistente a meticilina (SARM), es uno de los principales microorganismos causantes de infecciones severas adquiridas en los hospitales, particularmente bacteremias, infecciones asociadas a catéteres intravasculares o prótesis, neumonía asociada al ventilador, endocarditis, infecciones quirúrgicas particularmente ortopédicas, cardiotorácicas y asociadas 2 con trasplantes de órganos sólidos . La aparición de SARM y su diseminación a través del mundo ha creado problemas terapéuticos, elevados costos hospitalarios dependientes de largas estancias, uso de antibióticos de amplio espectro y complicaciones 3 inherentes . El biofilm otorga ciertas ventajas a las bacterias que lo conforman, como protección a un ambiente adverso, resistencia a la acción bactericida de los antimicrobianos y de forma indirecta a los mecanismos de defensa del 4 huésped . La formación de biofilm se desarrolla en dos etapas: la primera dada por la unión primaria entre las bacterias y la superficie, proceso mediado en parte por proteínas de adhesión asociadas a la pared celular bacteriana, entre las que se destacan las proteínas de unión a fibronectina, fibrinógeno y factores aglutinantes, implicados en el proceso de colonización, infección valvular e invasión tisular5. La segunda etapa inicia con la producción del Polisacárido Intercelular de Adhesión (PIA), una vez que las bacterias están adheridas a una superficie, éstas se multiplican y forman microcolonias con estructuras que incrementan paulatinamente su organización en forma de mosaicos, llegando a alcanzar una alta organización que requiere de adherencia intercelular1.

13

Trabajo Original

PIA es un polímero de glucosamina con una estructura bioquímica de β-1,6-N-acetil-glucosamina. La producción de PIA se debe a la acción de una compleja cadena de enzimas, codificadas por una región del genoma bacteriano del S. aureus, organizado en un 6 operon llamado ica . Algunos estudios han mostrado que la ausencia o deleción del operon ica en diferentes especies de Staphylococcus, como aureus y epidermidis, inhiben su capacidad para formar biofilm; en contraste la presencia del operon no siempre indica que lo forme; por ejemplo, aislamientos que poseen el operon ica deben ser sometidos a condiciones medio ambientales extremas (como anaerobiosis, bajas concentraciones de sales, azúcares, cambios de pH, entre otras) para que se 7 expresen los genes ica y formen biofilm . Se conocen enfermedades infecciosas relacionadas con biofilm bacterianos, entre las cuales se encuentran: neumonía, osteomielitis y endocarditis de válvulas nativas. Las bacterias pueden interactuar con las válvulas cardíacas; normalmente estas bacterias no se adhieren sobre las válvulas intactas, pero cuando se produce alguna lesión sobre las mismas, las células endoteliales secretan fibronectina, que es utilizada como receptor por adhesinas específicas de la superficie de las bacterias5, 8. No existe reporte en la literatura de una PCR múltiple para detectar los cinco genes del operon ica en S. aureus, contrario para S. epidermidis. Existen estudios en donde utilizan algunos genes del operon (icaA e icaD) y no el operon completo, por esta razón se estandarizó una PCR múltiple para los cinco genes del operon ica no sólo para S. aureus y S. epidermidis, sino para otras especies como S. caprae y S. lugdunensis, que también portan el operon y tienen la capacidad de formar biofilm. Además, no existe suficiente certeza acerca de los componentes de la matriz extracelular del biofilm en S. aureus. En algunos reportes se afirma que PIA es el principal componente, en otros estudios se informa que son proteínas principalmente más que PIA; éstas proteínas hasta la fecha no se conoce a qué familia pertenecen ni cuál es su composición química, y recientemente se ha evidenciado la presencia de un ADN extracelular bacteriano implicado en la formación de la 6, 8, 9 matriz extracelular del biofilm . Revista Medicina Vol. 9 No. 1 Análisis “in vitro” de la formación de biofilm y sus características moleculares ... Pág. 2 de 9


Trabajo Original

Análisis “in vitro” de la formación de biofilm y sus características moleculares...

Este trabajo pretende determinar si los aislamientos hospitalarios y los adquiridos en comunidad de SARM que circulan en el país, asociados a catéteres y bacteremias, tienen la capacidad de formar biofilm “in vitro” y si existe alguna correlación entre sus características genéticas (presencia de genes del operon ica y genes de adhesión celular) y clínicas que puedan servir como posible marcador molecular de severidad. Características moleculares del biofilm. El operon ica está compuesto por los genes icaA, icaD, icaB, icaC, y el gen represor icaR; cada gen cumple funciones específicas en la formación del biofilm; tales como: icaA, que codifica la producción de una enzima Nacetilglucosaminiltranferasa, la cual se encuentra

anclada a la membrana citoplasmática, necesaria para la actividad del gen icaD y fundamental para la síntesis de 1, 11 PIA (Figura 1) . A icaB no se le ha atribuido una función muy clara, se encuentra localizado corriente arriba del gen icaD y contiene una señal de secuencia típica para codificar proteínas extracelulares que son secretadas cuando el microorganismo se encuentra en condiciones especiales de crecimiento (medios de cultivo, superficies de polímeros y otros). Los genes icaC e icaD codifican proteínas y poseen propiedades de proteínas de membrana que ejercen función de antígenos (polisacáridos) o receptores en el biofilm, y también el gen icaC codifica proteínas integrales de membrana1, 11.

Relación entre el operon ica y la formación del biofilm. Organización genómica del operon, estructura de PIA y agregación bacteriana. Modificado de: Götz F, 2002.

14

Revista Medicina Vol. 9 No. 1 Análisis “in vitro” de la formación de biofilm y sus características moleculares ... Pág. 3 de 9


Trabajo Original

Análisis “in vitro” de la formación de biofilm y sus características moleculares...

Proteínas de adhesión relacionados con formación de biofilm. El primer paso en las infecciones por S. aureus es la unión a varias superficies y la colonización de tejidos del huésped; para lograr este propósito estos patógenos portan varias proteínas tipo adhesinas de superficie llamadas en conjunto MSCRAMMs (componentes de la superficie microbiana que reconocen moléculas de adhesión de la matriz); muchas de estas proteínas interactúan con tejidos humanos, proteínas del suero y polipéptidos de la matriz extracelular; cuando ocurren estas interacciones se promueve la invasión y muerte apoptótica de células infectadas, además la habilidad de las proteínas MSCRAMMs para unirse a proteínas del suero del huésped hace que rápidamente cubran dispositivos médicos como catéteres y faciliten la formación de biofilm en estos dispositivos y en tejidos humanos. Algunas de las proteínas del huésped como fibrinógeno y fibronectina sirven como receptores para la unión de bacterias 12, 13. Staphylococcus aureus produce genes de adhesión relacionados con la etapa de formación de biofilm; entre estos genes encontramos los de adhesión a fibronectina (fnbA y fnbB), implicados en el proceso de colonización, infección valvular e infección perivalvular. Staphylococcus aureus produce además genes de adhesión asociados a fibrinógeno como el (fib), el factor aglutinante (factor clumping, clfA y B) y un factor de agregación plaquetaria aún no determinado, elementos importantes en la colonización, infección e invasión tisular, que facilitan la adhesión a sitios específicos en 5, 14 tejidos humanos o implantes médicos . La producción de este grupo de adhesinas está influenciada por dos reguladores: el gen regulador accesorio (agr) y el 15, 16 regulador accesorio staphylococcal (sarA) . Biofilm e infección. Existen evidencias epidemiológicas que relacionan al biofilm con distintos procesos infecciosos. La infección asociada a tejido dañado, cuerpo extraño o presencia de biomaterial incluye una serie de características comunes como: colonización de sustratos por bacterias adhesivas formadoras de biofilm, infecciones persistentes por resistencia al tratamiento antimicrobiano mediada por el biofilm, presencia de inflamación, tejido celular dañado, necrosis en el tejido y alteración de la respuesta celular y humoral del huésped por la presencia del biomaterial y las 7, 17 bacterias . 15

Estrategias de intervención frente a infecciones por biofilm. Los microorganismos pueden colonizar las prótesis en el momento de su colocación, por inoculación directa durante la manipulación del tejido o el implante, o por contaminación aérea de la herida; y después del implante, por diseminación hematógena, durante una bacteremia o por extensión directa, a partir de un foco 8 adyacente de infección . El tratamiento antibiótico sistémico en general no consigue la erradicación del biofilm pero se debe implementar para erradicar las bacterias que pasan al torrente circulatorio. Este tratamiento debe ser inicialmente de amplio espectro y sustituido por antibióticos específicos cuando el laboratorio de microbiología informe la identificación y la susceptibilidad del microorganismo causante de la infección 18, 19. Tratamiento de infecciones asociadas a catéter. La retirada del catéter es el tratamiento más efectivo; sin embargo, en el caso de los catéteres intravasculares centrales la retirada puede resultar problemática y el riesgo quirúrgico que supone esto puede ser mayor que el riesgo asociado a un tratamiento antibiótico ineficaz; en estos casos se recomienda un tratamiento denominado de sellado antibiótico, que consiste en gotear en el interior del catéter una solución de anticoagulante (heparina o EDTA) y antibiótico a una concentración entre 100 y 1.000 veces mayor que la concentración inhibitoria mínima del microorganismo responsable de la infección asociada a catéter, durante al menos 8 horas diarias a lo largo de 1020 14 días . Metodología Aislamientos de Staphylococcus aureus. Los aislamientos clínicos de SARM analizados en este trabajo hacían parte del banco de cepas y aislamientos del Instituto de Genética Molecular Bacteriana de la Universidad el Bosque. Estos aislamientos provenían de hemocultivo y punto de catéter, los cuales fueron previamente identificados como SARM con su perfil de susceptibilidad a varios antibióticos mediante métodos automatizados como Vitek® System o MicroScan® System. Se analizaron 74 aislamientos clínicos de hemocultivo y 26 de punta de catéter provenientes de 74 pacientes, obtenidos de un estudio de vigilancia de SARM, en tres Revista Medicina Vol. 9 No. 1 Análisis “in vitro” de la formación de biofilm y sus características moleculares ... Pág. 4 de 9


Trabajo Original

Análisis “in vitro” de la formación de biofilm y sus características moleculares...

instituciones de tercer nivel en Colombia, tomando como referencia los criterios de los centros para el control y prevención de enfermedades de Atlanta para infecciones 21 nosocomiales por SARM , en el periodo comprendido entre junio de 2006 y diciembre de 2007. Evaluación “in vitro” de la capacidad de formación de biofilm La formación de biofilm“in vitro” para cada aislamiento se realizó por dos métodos: crecimiento en agar rojo congo (cualitativo) y método de microplaca (cuantitativo). Para evaluar cuantitativamente la formación de biofilm, se utilizo el método agar rojo congo descrito por Freeman 22 y colaboradores con algunas modificaciones, de la 7 siguiente manera: Se preparó un inóculo de 1 x 10 bacterias de cada aislamiento, fueron sembradas por agotamiento en cajas de Petri con agar infusión cerebro corazón (BHI) suplementadas con rojo congo al 0.8% y se incubaron a 37ºC por 24 horas. Los resultados fueron expresados de acuerdo a la morfología y color de las colonias formadas, así: colonias negras, formadoras de biofilm (+), colonias rojas, no formadoras (-) y colonias rojas con puntos negros en el centro, indeterminadas. Para medir cuantitativamente la formación de biofilm, se utilizo el método de microplacas de poliestireno de 96 pozos, descrito por Christensen y colaboradores 23, con algunas modificaciones, brevemente: una colonia de cada aislamiento fue incubada en caldo BHI suplementado con glucosa (sin agitación) a 37°C de 18 a 24 horas. A partir de esta suspensión bacteriana se tomó

16

7

1x10 bacterias y se sembraron en cada pozo de la microplaca con 200uL de caldo BHI suplementado con glucosa al 1% por triplicado y se incubó a 37°C durante 48 horas sin agitación. Luego el sobrenadante fue descartado, las bacterias adheridas fueron fijadas, coloreadas con cristal violeta y lavadas para eliminar el exceso de colorante. Se realizó la cuantificación a una longitud de onda de 570 nm por ELISA. Cuando la densidad óptica era menor de 0.120 se consideraba no adherente y no formador de biofilm, si oscilaba entre 0.120 y 0.240 era moderadamente adherente y formador de biofilm, y cuando la densidad óptica era mayor a 0.240 era adherente y fuertemente formador de biofilm. Se utilizaron como controles para los dos ensayos las cepas USA300 (SARM Fuertemente formador de biofilm), ATCC 23829 (SARM Débilmente formador de biofilm) y ATCC 12228 (S. epidermidis No formador de biofilm). Diseño y estandarización de la técnica de PCR múltiple para la detección del operon ica en cuatro especies de Staphylococcus spp. A partir de un análisis bioinformático de la secuencia del operon ica para cuatro especies de S. aureus, S. epidermidis, S. lugdunensis y S.caprae, reportadas en la base de datos del GenBank, se diseñaron 6 oligonucleótidos (primers) en regiones conservadas para los 5 genes que conforman el operon (icaA, icaD, icaB, icaC, y el gen represor icaR) (ver figura Nº 1), utilizando el programa PRIMER. En la tabla 1 se encuentran las características principales de estos oligonucleótidos. Las cepas USA 300 y ATCC 12228 fueron usadas como controles positivo y negativo, respectivamente.

Revista Medicina Vol. 9 No. 1 Análisis “in vitro” de la formación de biofilm y sus características moleculares ... Pág. 5 de 9


Trabajo Original

Análisis “in vitro” de la formación de biofilm y sus características moleculares...

Tabla 1: Secuencia y características de los primers diseñados para la detección del operon ica en las 4 especies de Staphylococcus spp.

Primers

Secuencias

Longitud (nt)

% GC

Tm

Localización en el operon ica

Tamaño del amplicon (pb)

_________________________________________________________________________________________ ________ IcaRA

IcaAD

IcaBC

CGTCATACCCCTTCTCTGAAAA

22

45%

54.4°C

504 - 525

GAACCGACAATCCAGTAAATAG

22

41%

51.0°C

768 - 789

CGCACTCTTTATTGATAGTCGC

22

45%

53.7°C

1774 - 1795

TATTCCCTCTGTCTGGGCTTGA

22

50%

57.6°C

1931 - 1952

AATTAAGAGATGGGACGGATTC

22

41%

52.2°C

3065 - 3086

CGATAAAATAGCCATACCATTG

22

36%

49.4°C

3442 - 3463

286

179

399

Figura Nº 1. a. Alineamiento del gen icaA reportado para las cuatro especies de Staphylococcus spp, Sa: S. aureus, Se: S. epidermidis, Sc: S. caprae y Sl: S. lugdunensis. b. Esquema de la organización del operón ica y la localización de los 6 primers diseñados para su detección (flechas negras).

Evaluación de la transcripción de los genes icaADBC e icaR Se evaluó la transcripción de los genes icaADBC, e icaR, empleando la técnica de RT-PCR. La extracción de RNA se realizó con un estuche comercial de Promega para obtener RNA total (SV Total RNA Isolation System). A partir de este RNA total se hizo la síntesis de cDNA por medio de una transcriptasa reversa, usando un oligo de hexámeros aleatorios. Se utilizaron las cepas USA 300 y la ATCC 12228 como controles positivo y negativo, respectivamente. Detección de genes de adhesión celular Para cada aislamiento de SARM se determinó la presencia de los genes para las proteínas de unión a fibrinógeno y fibronectina fnbA, fnbB, fib, clfA y clfB, involucrados en adhesión celular y formación de biofilm, empleando la técnica de PCR múltiple, descrita por 14 Tristán . Se utilizaron las cepas USA 300 y la ATCC 12228 como controles positivo y negativo, respectivamente. 17

Relación de las características moleculares, clínicas y formación de biofilm. Se realizó un análisis y se relacionaron las características microbiológicas, moleculares y clínicas. Se describieron las características microbiológicas (concentración inhibitoria mínima para 11 antibióticos, ensayos de formación de biofilm in vitro, como agar rojo congo y microplacas de poliestireno, ensayos de dispersión para conocer los componentes de la matriz extracelular del biofilm), características moleculares (PCR para especie, tipo de casete SCCmec, PVL, presencia y transcripción del operon ica, presencia de genes de adhesión a fibrinógeno y fibronectina y patrón de electroforesis en campo pulsado), para correlacionarlas con las características demográficas y clínicas de los pacientes (edad, sexo, condición de base, diagnóstico de infección, presencia en UCI o No UCI, manejo de antibióticos empírico y dirigido, evolución y mortalidad) con el fin de medir la relación entre las características moleculares y el impacto de estos hallazgos con la evolución clínica.

Revista Medicina Vol. 9 No. 1 Análisis “in vitro” de la formación de biofilm y sus características moleculares ... Pág. 6 de 9


Análisis “in vitro” de la formación de biofilm y sus características moleculares...

Análisis estadístico. Se realizó el análisis estadístico de los resultados utilizando el programa STATA versión 8.2, y se hicieron las siguientes pruebas estadísticas: S Wilk, Chi cuadrado, U Mann, K Wallis, con un valor p significativo < 0.05. Resultados Características demográficas y clínicas de los pacientes. Se encontró un cambio en el tratamiento antibiótico después del reporte del cultivo de SARM, pasando del tratamiento con β–lactámicos (Ampicilina/sulbactam) a glicopéptidos (vancomicina), solo o en combinación con otro tipo de antibiótico. Debido a la resistencia de estos aislamientos a todos los β–lactámicos de uso clínico, es recomendable utilizar otras alternativas terapéuticas (vancomicina o linezolid) para tratar este tipo de infecciones. Se presentó una alta mortalidad de los pacientes (48%), que posiblemente se debe a las edades tan altas de los pacientes (mediana de 65 años) y a las condiciones de base que presentaban. Las fuentes de infecciones de los pacientes que ingresaron al estudio fueron: bacteremia secundaria 59 (80%), bacteremias primarias 15 (20%). Las fuentes de las bacteremias secundarias fueron: relacionada a catéter 31 (42%), infecciones del tracto respiratorio 17 (23%), infección de piel y tejidos blandos 4 (5%), infección de sitio operatorio 2 (3%), otras infecciones 5 (7%) (infección cardiovascular, del tracto genitourinario, osteoarticular o gastrointestinal). Se encontró un alto porcentaje de bacteremias relacionadas a catéter, de las cuales en 26 de 31 muestras se analizó la correspondiente punta de catéter y en las restantes no se tuvo acceso a dicha muestra. Todas las bacteremias relacionadas a catéter presentaron patrón nosocomial, a excepción de una muestra. Por el método de agar rojo congo se encontró que 46 aislamientos (62%) fueron rojo congo positivo (formadores de biofilm), 23 (32%) fueron rojo congo indeterminado (débilmente formadores de biofilm) y 5 (6%) fueron rojo congo negativo (no formadores de biofilm). Por el método de microplacas 59 aislamientos (80%) 18

Trabajo Original

fueron formadores de biofilm, 12 (16%) débilmente formadores y sólo 3 (4%) no formaron biofilm. Para demostrar si existía concordancia entre los dos métodos se utilizó el índice de kappa de Cohen, para dicho análisis se tuvieron en cuenta solamente los aislamientos formadores de biofilm (fuertes y débiles por microplaca, y formadores e indeterminados por agar rojo congo) y los no formadores, encontrándose una concordancia casi perfecta entre las dos técnicas (0.971). Con estos dos métodos se comprueba la alta proporción de formación de biofilm “in vitro” en los aislamientos clínicos de SARM. De los 74 aislamientos clínicos de SARM evaluados 71 (96%) amplificaron los cinco genes del operon ica y según los resultados fenotípicos todos fueron formadores de biofilm (fuertes y débiles), y sólo en 3 (4%) aislamientos no fue detectado el operon y no formaron biofilm, lo que demuestra y confirma el papel de ica en la formación de biofilm. Se analizaron 71 aislamientos clínicos de SARM formadores de biofilm (fuertes y débiles) y 3 no formadores para verificar la transcripción del operon ica. Se encontró una relación directa entre la presencia y transcripción del operon en los aislamientos formadores de biofilm, a diferencia de los no formadores, los cuales no poseían ni transcribían el operon. Los aislamientos que poseían el operon lo transcribieron, tanto los débilmente formadores como los fuertemente formadores de biofilm, y se confirmó la ausencia de este operon en los tres aislamientos en los cuales no se detectó biofilm. Los genes de adhesión para fibrinógeno (fib, clfA y clfB) se detectaron en el 100% de los aislamientos, a diferencia de los genes para fibronectina (fnbA y fnbB), los cuales sólo se amplificaron en el 10.8 % Relación entre las características microbiológicas, moleculares y clínicas. Entre las características clínicas y demográficas de los pacientes fallecidos y los que sobrevivieron con infecciones causadas por SARM, se encontró una mediana de las edades más alta. Hay una mayor prevalencia de los genes de adhesión a fibronectina (fnbA y fnbB) en aislamientos colombianos de circulación comunitaria que en aislamientos de circulación intrahospitalaria. Revista Medicina Vol. 9 No. 1 Análisis “in vitro” de la formación de biofilm y sus características moleculares ... Pág. 7 de 9


Trabajo Original

Análisis “in vitro” de la formación de biofilm y sus características moleculares...

De los 3 (4%) aislamientos que no presentaron el operon ica, sólo 1 produjo una bacteremia relacionado a catéter. Dentro de las características microbiológicas y moleculares de los aislamientos clínicos de SARM causantes de infección en los pacientes fallecidos y sobrevivientes, se encontró una mayor formación de biofilm tanto por agar rojo congo, como por microplacas en los aislamientos de los pacientes fallecidos, y además un porcentaje elevado (22%) de genes de adhesión a fibronectina en estos pacientes en comparación con los sobrevivientes (0%). De los 8 aislamientos clínicos de SARM que presentaron genes de adhesión a fibronectina, 7 (87.5%) fueron SARM – AC, fuertemente formadores de biofilm y se presentaron con una mayor frecuencia en pacientes fallecidos. La detección de estos genes podría ser utilizada como un paso inicial para determinar si un aislamiento de S. aureus posiblemente está relacionado con aislamientos de comunidad. Por ser los aislamientos de comunidad emergentes y presentar un alto poder de virulencia, estos se analizaron de forma individual. A los 10 aislamientos clínicos de SARM que por patrón molecular fueron definidos como adquiridos en comunidad, se les evaluó la formación de biofilm por los métodos de microplaca y agar rojo congo; además se les determinó la presencia del operon ica y la presencia de genes de adhesión, encontrándose los siguientes resultados: Todos los aislamientos 10 (100%), formaron biofilm por ambos métodos, al igual que presentaban el operon ica y los genes de adhesión para fibrinógeno; en contraste, todos los aislamientos clínicos de pacientes fallecidos presentaron los genes de adhesión para fibronectina 7 (100%) en comparación con los sobrevivientes (0%). Desde el punto de vista clínico, se encontró una mortalidad elevada 7 (70%), además los pacientes fallecidos presentaron mayor frecuencia en las enfermedades de base (hipertensión arterial y diabetes mellitus) e ingreso a UCI, lo que predispone a una mayor mortalidad (tabla8). Conclusiones El agar rojo congo puede ser considerado como una prueba de selección para la identificación de aislamientos clínicos formadores de biofilm que producen PIA, como S. 19

aureus, debido a la concordancia encontrada entre estos resultados y la caracterización genotípica (presencia del operon ica), pero debe ser complementada con el método de microplaca. El 96% de los aislamientos clínicos de SARM estudiados tiene la capacidad de formar biofilm in vitro (fuerte o débil), y dentro de este grupo todos los aislamientos de SARM- AC son formadores de biofilm. La homología de secuencia existente entre el operon ica presente en aislamientos de S. aureus y S. epidermidis, permitió el diseño y estandarización de la primera PCR múltiple para la detección y amplificación de los cinco genes del operon ica en estas especies, con un posible uso en las especies de S. lugdunensis y S. caprae. La mayoría de los aislamientos clínicos de SARM que circulan en el país poseen y transcriben el operon ica; en contraste, los que no lo portan, no forman biofilm “in vitro”, por lo tanto se requiere fundamentalmente de la presencia del operon ica para formar PIA y biofilm. El 100% de los aislamientos amplificaron los genes de adhesión a fibrinógeno, a diferencia de los genes de adhesión a fibronectina que sólo se encontraron en 22.2% de los aislamientos, los cuales estuvieron más relacionados con aislamientos de SARM – AC. Se presentó alta morbimortalidad en los pacientes del estudio; la detección de estos genes de adhesión a fibronectina en los aislamientos clínicos de pacientes fallecidos podría ser utilizada como un paso inicial para determinar si un aislamiento de S. aureus posiblemente está relacionado con aislamientos de comunidad y con la evolución del paciente. No se encontró una relación directa entre la severidad de las infecciones ni un aumento de la mortalidad y la formación de biofilm de los aislamientos, ya que la mayoría de los aislamientos formaron biofilm independiente de la evolución clínica de los mismos. Bibliografía 1. Götz F. Staphylococcus and Biofilm. Mol Microbiol. 2002; 43: 1367- 1378. 2. Mulligan M, Methicillin-Resistant Staphylococcus aureus: A Consensus Review of the Microbiology, Pathogenesis an Epidemiology with Implications for Prevention an Management. American J. Med., 1993; 94: 313-328. Revista Medicina Vol. 9 No. 1 Análisis “in vitro” de la formación de biofilm y sus características moleculares ... Pág. 8 de 9


Análisis “in vitro” de la formación de biofilm y sus características moleculares...

3. Cosgrove S, Qi Y, Kaye S, Karchmer A, Carmeli Y. The impact of methicillin resistance in Staphylococcus aureus bacteremia on patient outcomes: mortality, length of stay, and hospital charges. Infect control Hosp Epidemiol 2005; 26: 166 – 174. 4. Ziebuhr W, Krimmer V, Rachid S, Loner I, Götz F, Hacker J. A novel mechanism of phase variation of virulence in Staphylococcus epidermidis: evidence for control of the polysaccharide intercellular adhesin synthesis by alternating insertion and excision of the insertion sequence element IS256. Molecular Microbiology. 1999; 32: 345-356. 5. Ferreiros E, Casabé J, Nacinovich F, Swieszkowski S, Cohen H, Cortes C, Modenesi J, Varini S. Endocarditis infecciosa por S. aureus en la Argentina: EIRA 2. Análisis comparativo luego de 10 años de los estudios EIRA 1 y 2. Revista Argentina de cardiología. 2006. 74: 283 -290. 6. Cramton S, Gerke C, Schnell N, Nichols W, Götz F. The intercellular adhesion (ica) locus is present in Staphylococcus aureus and is required for Biofilm formation. Infect Immun. 1999; 67: 5427-5433. 7. Costerton J, Montanaro L, Arciola C. Biofilm in implant infections: its production and regulation. Int J Artif Organs. 2005; Nov; 28: 1062-8. 8. Fluckiger U, Ulrich M, Steinhuber A, Doring G, Mack D, Landmann R, Goerke C, Wolz C. Biofilm formation, icaADBC transcription, and polysaccharide intercellular adhesin synthesis by staphylococci in a device – related infection model. Infection and Immunity. 2005; 1811 – 1819. 9. O'Neill E, Pozzi C, Houston P, Smyth D, Humphreys H, Ashley R, O'Gara J. Association between Methicillin susceptibility and Biofilm Regulation in Staphylococcus aureus isolates from device – related infections. J Clin Microbiol. 2007; 45: 1379 – 1388. 10. Izano E, Amarante M, Kher W, Kaplan J. Diferential roles of Poly-N- Acetylglucosamine surface polysaccharide and extracellular DNA in Staphylococcus aureus and Staphylococcus epidermidis biofilms. Applied and Environmental Microbiology. 2008; 74: 470 – 476. 11. Gerke C, Kraft A, Sussmuth R, Schweitzer O, Götz F. Characterization of the N acetylglucosaminyltransferase activity involved in the biosynthesis of the Staphylococcus epidermidis polysaccharide intercellular adhesin. J Biol Chem. 1998; 273:18586–18593.

Trabajo Original

13. Cucarella C, Tormo M, Knecht E, Amorena B, Lasa I, Foster T, Penades J. Expression of the Biofilm – Asocciated Protein Interferes with host Protein Receptors of Staphylococcus aureus and alters the infective process. Infect Immun. 2002; 70: 3180-3186. 14. Tristan A, Ying L, Bes M, Etienne J, Vandenesch F, Lina G. Use of Multiplex PCR to identify Staphylococcus aureus Adhesins involved in human hematogenous infections. J of clinical microbiology. 2003; 41: 4465 – 4467. 15. Tormo M, Martí M, Valle J, Manna A, Cheung A, Lasa I, Penadés J. SarA is an essential positive regulator of Staphylococcus epidermidis Biofilm development . Journal of Bacteriology. 2005; 187: 2348 – 2356. 16. Beenken K, Blevins J, Smeltzer M. Mutation of sarA in Staphylococcus aureus Limits Biofilm Formation. Infection and Immunity. 2003: 71; 4206 – 4211. 17. Fux C, Costerton W, Stewart P, Stoodley P. Survival strategies of infectious biofilms.. Trends Microbiol. 2005; 13: 34–40. 18. Cosgrove S, Vance G, Fowler J. Management of Methicillin resistant Staphylococcus aureus bacteremia. Clinical Infect Dis. 2008; 46: S386 – 393. 19. Hernández B, Miranda G. Biofilm amenaza latente o factor de protección. Enfermedades Infecciosas y Microbiología. 2007; 27: 22-28. 20. Raad I, Chatzinikolaou I, Chaiban G, Hanna H, Hachem R. In Vitro and Ex Vivo activities of minocycline and EDTA against microorganisms embedded in biofilm on catheter surfaces. Antimicrob Agents Chemother. 2003; 47: 3580-3585. 21. CDC. Centers for Disease and Control Prevention. www.acc.gov/nci/hip/ARESIST/ca-mrsa-ref.htm, 2006. 22. Freeman D, Falkiner F, Keane C. New method for detecting slime production by coagulase negative staphylococci. J Clin Pathol.1989; 42:872-874 23. Christensen G, Simpson A, Younker J, Baddour L, Barret F, Melton D, Beachey E. Adherence of coagulase negative staphylococci to plastic tissue culture plates a quantitative model for the adherence of staphylococci to medical devices. Journal of clinical microbiology. 1985; 22: 996-1006.

12. Fitzpatrick F, Humphreys H, O'Gara J. Environmental regulation of Biofilm development in Methicillin-resistant and methicillin susceptible Staphylococcus aureus clinical isolates. J. Hosp. Infect. 2006; 62:120–122. 20

Revista Medicina Vol. 9 No. 1 Análisis “in vitro” de la formación de biofilm y sus características moleculares ... Pág. 9 de 9


Vol. 9 No. 1, 2010 (Enero - Junio)

Revista Medicina

Éxitos y fracasos del ciclaje de antibióticos para disminuir la resistencia bacteriana Successes and failures of antibiotics cycling to decrease bacterial resistance Pedro Martínez1,2*, Grace Arenas2. Universidad del Sinú1. Universidad de Córdoba2 - Instituto de Investigaciones Biológicas del Trópico. *Correspondencia: Pedro Martínez. M.Sc. Profesor de Microbiología Universidad del Sinú. Profesor de Biología Molecular y Resistencia Bacteriana Universidad de Córdoba Instituto de Investigaciones Biológicas del Trópico, Tel/fax: 57-47-560710. e-mail: pjmartinezr@yahoo.com Resumen Los programas de ciclaje de antibióticos se han aplicado en instituciones hospitalarias como una estrategia para mejorar la prescripción de estos medicamentos, teniendo en cuenta el costo-efectividad de la terapéutica y la reducción de la resistencia antimicrobiana. Los antibióticos son de las categorías más costosas de medicamentos y su uso generalizado en unidades de cuidados intensivos (UCIs) es una importante causa de la emergencia de infecciones nosocomiales causadas por bacterias Gram-negativas multirresistentes. El ciclaje antimicrobiano puede tener un papel en la aparición o el incremento de microorganismos resistentes en los hospitales, debido a que nuevas cepas pueden ser introducidas en un servicio hospitalario por medio de pacientes provenientes de otros servicios de la misma institución, de otro centro de cuidados de salud o también ser introducidos por trabajadores de la salud. Sin embargo, limitar esta estrategia a las UCIs tiene importancia, debido a que es en estos servicios donde la alta resistencia antibiótica y uso de antibióticos tiene gran importancia. Palabras clave: Ciclaje, antibióticos, resistencia, UCI, bacterias. Abstract The antimicrobial cycling programs have been implemented in hospitals as a strategy to improve antimicrobial prescribing, taking into account the cost-effectiveness of therapy and reducing antimicrobial resistance. Antibiotics are among the most expensive categories of drugs and their widespread use in the intensives care units (ICUs), is a major cause of the emergence of nosocomial infections caused by multiresistant gram-negative bacteria. The antimicrobial cycling may have a role in the onset or increase of resistant organisms in hospitals, because new strains may be introduced in an area of a health-care institution by way of a patient from another area of the same institution, from another health center, or also may be introduced by a health care worker. However, limit this strategy to the ICU is important, because it is in these area where high antibiotic resistance and antibiotic use is of great importance. Keywords: Cycling, antibiotics, resistance, ICU, bugs.

Introducción Los programas de ciclaje o rotación de antibióticos se han aplicado en instituciones hospitalarias como una estrategia para mejorar la prescripción de antimicrobianos teniendo en cuenta el costo-efectividad de la terapéutica y la consecuente reducción de la resistencia bacteriana (1). Estos programas se deben acompañar de estrategias de auditorías a las prescripciones con retroalimentación de los resultados a los prescriptores (2). Es importante tener en cuenta que 21

Recibido para publicación el 18 de Mayo de 2010 Aceptado el 31 de mayo de 2010

estos programas de intervención para el control de la resistencia bacteriana, intentan establecer un adecuado tratamiento antibiótico en pacientes críticamente enfermos, evitando la administración excesiva e inapropiada de antibióticos, la cual se estima que es de hasta un 50% (3), y que contribuye en gran medida con el aumento de los costos asistenciales y la resistencia antimicrobiana (3). El ciclaje o rotación de antibióticos pretende la optimización de la selección, la dosis y duración del tratamiento para prevenir y tratar las Revista Medicina Vol. 9 No. 1 Éxitos y fracasos del ciclaje de antibióticos para disminuir la resistencia bactaeriana Pág. 1 de 7


Éxitos y fracasos del ciclaje de antibióticos para disminuir la resistencia...

infecciones. Esta optimización es a menudo alcanzable para unos pocos pacientes, pero más difícil de lograr en una gran población. Sin embargo, los principales factores que impulsan el aumento de la resistencia bacteriana a los antibióticos son el aumento del uso de antibióticos de amplio espectro (4). Para disminuir la incidencia de la resistencia es necesario adoptar medidas eficaces de control de la infección (5). Las bacterias resistentes por lo general emergen en unidades de cuidados intensivos (UCIs) y otras áreas de cuidados hospitalarios. Por lo tanto, las estrategias para el control de estos organismos a menudo se ponen en marcha en las UCIs y otras áreas de cuidados críticos. Las prácticas de control de la infección están dirigidas a estrategias específicas de uso de antibióticos que puedan ayudar a disminuir la resistencia bacteriana como son el ciclaje o rotación de antibióticos. Sin embargo, estrategias como el ciclaje de antibióticos deben ser ajustadas en el contexto de la atención de salud institucional para el control de los organismos resistentes (6). Aunque las prácticas de control de la infección son poco probable que prevengan la emergencia de resistencia, estas son esenciales para disminuir la diseminación de bacterias resistentes a los antibióticos (5). Las prácticas de control de infecciones pueden ayudar a prevenir la transmisión horizontal de bacterias resistentes a través de la identificación precoz y las prácticas de aislamiento apropiado (7). El objetivo de esta revisión es ofrecer una perspectiva de los éxitos y fracasos de la estrategia de ciclaje de antibióticos y su importancia en el uso de la terapéutica empírica en las UCIs para disminuir la resistencia bacteriana. Resistencia bacteriana Las infecciones nosocomiales son una importante causa de mortalidad, morbilidad, larga estancia hospitalaria y alto costo económico en la atención de salud (8,9). La resistencia a los antibióticos incrementa el problema debido a la probabilidad de que un paciente reciba tratamiento inapropiado y por lo tanto aumente los riesgos y costos asociados con la infección nosocomial (10,11). La evolución y diseminación de bacterias resistentes a antibióticos constituye un grave problema, en particular en las UCIs donde el uso de antibióticos es bastante alto al igual que las posibilidades de diseminación de bacterias multirresistentes, además, que muchos pacientes se encuentran inmunocomprometidos o susceptible a la infección por patógenos oportunistas (12). El éxito del control de la 22

Artículo

resistencia antibiótica requiere del desarrollo de nuevos fármacos y el uso prudente de los antibióticos actuales. Se ha sugerido el ciclaje antibiótico, donde el uso empírico de dos o más clases de antibióticos se alterne en una escala de tiempo de meses a años, con lo que se podría retrasar la evolución y diseminación de cepas bacterianas multirresistentes (13,14,15). Los antibióticos hacen parte de una de las categorías más costosas de medicamentos expedidos en los hospitales, y su uso generalizado en las UCIs es una importante causa de la emergencia de infecciones nosocomiales producidas por bacterias Gram-negativas multirresistentes (16,17). El uso de antibióticos favorece el desarrollo y diseminación de resistencia en muchos organismos por selección de bacterias intrínsecamente resistentes (18). Los efectos que un antibiótico en particular tiene en bacterias distintas de la de interés también deben ser considerados. Los organismos que son intrínsecamente resistentes a antibióticos en particular tienen determinantes genéticos necesarios para expresar la resistencia. Sin embargo, altas tasas de mutación espontánea y la capacidad de adquirir ADN por conjugación, transducción y transformación también permiten que otras bacterias previamente sensibles se vuelvan resistentes (16,19). Una vez que los determinantes genéticos de resistencia están presentes en las bacterias, es difícil predecir cuánto tiempo los determinantes persisten después que la presión selectiva provocada por un antibiótico es eliminada. De lo contrario, si el determinante se encuentra en un plásmido multirresistente, la resistencia puede persistir mientras la presión selectiva es mantenida por el uso de otros antibióticos. Todos los factores asociados con la resistencia a los antibióticos deben tenerse en cuenta al considerar las estrategias de uso de antibióticos para controlar la emergencia de resistencia (18,20). Ciclaje de antibióticos como estrategia para reducir la resistencia bacteriana Estrategias para el buen uso de antibióticos en hospitales se han propuesto para reducir la probabilidad de aparición de bacterias resistentes en pacientes críticamente enfermos. Una de esas estrategias consiste en el ciclaje de antibióticos (21,22). Sin embargo, esta estrategia puede tener un papel en la aparición o el incremento de microorganismos resistentes en los hospitales, debido a que nuevas cepas pueden ser introducidas en un servicio hospitalario por medio de Revista Medicina Vol. 9 No. 1 Éxitos y fracasos del ciclaje de antibióticos para disminuir la resistencia bactaeriana Pág. 2 de 7


Éxitos y fracasos del ciclaje de antibióticos para disminuir la resistencia...

pacientes provenientes de otros servicios de la misma institución, de otro centro hospitalario o también ser introducidos por trabajadores de la salud (23). Por esta razón, el impacto de las estrategias del uso de antibióticos debe evaluar todos los antibióticos utilizados en la UCIs, en vez de solo el uso de los antibióticos para los que la estrategia de control se ha diseñado. Existe enorme preocupación de cómo se puede prevenir la aparición de resistencia, y una vez que se ha producido si ésta se puede reducir. Idealmente, los antibióticos que han sido tan beneficiosos para la salud humana, serían utilizados de manera óptima en todo momento para el máximo beneficio de las personas sin comprometer el bienestar general de la población (24,25). Sin embargo, si la resistencia aparece programas de uso de antimicrobianos como la restricción de antibióticos podría resultar en una efectiva forma de control y prevención a futuro de la resistencia bacteriana. El ciclaje de antibióticos puede ser visto como una variación del control antimicrobiano, pero su implementación está dada con motivos de prevención y reducción de la resistencia bacteriana. Sin embargo, existen controversias acerca de la eficacia del ciclaje de antibióticos para prevenir o reducir la resistencia bacteriana, debido a que algunos estudios han mostrado que esta estrategia permite el desarrollo de resistencia en Enterobacteriaceae y P. aeruginosa, lo que ha impedido medir bien su efecto (20,26). Aunque, para el éxito de estas estrategias de control de la resistencia bacteriana, es necesario un buen diseño metodológico en el que se deben tener en cuenta el conocimiento de los mecanismos de resistencia, para lo cual es necesario saber que algunos microorganismos codifican una amplia resistencia conferida por plásmidos R, que incluyen antibióticos beta-lactámicos, aminoglucósidos, tetraciclinas, sulfonamidas y trimetoprim (27), la epidemiologia molecular de los microorganismos, y un completo perfil de resistencia antimicrobiana. No está claro si la estrategia de ciclaje se aplica entre o dentro de clases de antibióticos. Si se trata de estar dentro de una clase de antibióticos, entonces debe responder a cuestiones sobre los mecanismos de acción diferentes, pues de lo contrario la resistencia cruzada haría que el ciclaje fracasara (18). El ciclaje de clases específicas de antibióticos de uso habitual en una población de pacientes puede ser determinado sobre la base de los perfiles de 23

Artículo

susceptibilidad antimicrobiana de la institución hospitalaria. El ciclaje antibiótico consiste en la eliminación deliberada de los antimicrobianos de elección para el tratamiento de un síndrome infeccioso particular en un servicio hospitalario específico con la intención de introducirlo nuevamente en un momento determinado en el futuro, cuando la resistencia a ese antibiótico sea baja como consecuencia de su no uso. Estas estrategias de control del uso de antibióticos buscan mantener o promover la heterogeneidad de los antibióticos con el fin de alterar la presión selectiva ejercida y reducir el problema de la resistencia bacteriana, también para prevenir la aparición de nuevas resistencia a antibióticos en particular (15,18,28). Aunque, el ciclaje implica el uso de sólo el antibiótico en ciclo por un período determinado, en la práctica esto es casi imposible, y la mayoría de estudios de ciclaje utilizan el antibiótico en ciclo de un 10% a 50% del tiempo debido a alergias medicamentosas, efectos secundarios de los fármacos o recomendaciones de las guías publicadas (28). También es importante para el ciclaje de antibióticos asociarlos con diferentes mecanismos de resistencia a fin de realmente modificar la presión selectiva sobre las bacterias. Si bien, el ciclaje antibiótico es atractivo y parece prometedor, es necesario identificar las condiciones óptimas de ciclaje, clases de antibióticos a ciclar, duración del ciclaje, flexibilidad de las opciones de tratamiento por los médicos y controles complementarios o restricción de uso de antibiótico (22,29,30,31). La estrategia de ciclaje antibiótico presenta su mayor probabilidad de éxito en las UCIs hospitalarias, aunque esta estrategia tiene el agravante de seleccionar gérmenes resistentes durante el período de un ciclo que reduce la probabilidad de éxito terapéutico para el siguiente ciclo (30). Sin embargo, el potencial de esta estrategia se ha explorado en unas pocas instituciones para el control de brotes. Por tanto, mayor evidencia de la eficacia del ciclaje de antibióticos necesita ser reunida. No sólo es tratar efectivamente el problema de resistencia, también se trata de responder a preguntas acerca del costo-beneficio. Así, parece prudente proceder con mucho cuidado en los programas de ciclaje antibiótico hasta que estudios clínicos bien diseñados se lleven a cabo. El uso hospitalario de antibióticos no es el único factor que afecta la resistencia bacteriana en gérmenes que causan infección nosocomial. El uso extendido de los antibióticos en otros centros de atención en salud y las consultas externas también representa un Revista Medicina Vol. 9 No. 1 Éxitos y fracasos del ciclaje de antibióticos para disminuir la resistencia bactaeriana Pág. 3 de 7


Éxitos y fracasos del ciclaje de antibióticos para disminuir la resistencia...

importante impacto en la microbiota de los pacientes antes de su hospitalización (19). Además, hay la necesidad de evaluar las clásicas medidas de control como lo es el lavado de manos antes de sacar conclusiones acerca de la importancia del uso de antibióticos (32). Algunos estudios han mostrado una disminución en la resistencia bacteriana con el ciclaje de antibióticos. Así, , Gerding (33,34 ) sustituyó el uso de gentamicina por amikacina para disminuir las tasas de Enterobacteriaceae (Klebsiella y Serratia sp), que portaban plásmidos que codificaban enzimas modificadoras de aminoglucósidos, para lo cual obtuvo una disminución de la resistencia a la gentamicina, sin un aumento en la resistencia a amikacina. En un estudio realizado por Raymond et al. (29), utilizaron una estrategia de ciclaje de antibióticos. El tiempo de ciclo entre el antibiótico empírico de elección fue 3 meses para neumonía en una UCI; los antibióticos ciclados fueron: ciprofloxacina con o sin clindamicina; piperacilinatazobactam, un carbapenem y cefepima con o sin clindamicina. Al mismo tiempo, el antibiótico empírico de elección para la peritonitis o sepsis de origen desconocido fue un carbapenem, y ciprofloxacina fue usado para la neumonía. Después de un año de seguimiento, observaron una disminución de las infecciones causadas por bacilos Gram-negativos resistentes a los antibióticos y una disminución de la mortalidad asociada con la infección. Un estudio similar realizado por Moss et al. (30), mostró ciclos de antibióticos cada 3 meses con un período de seguimiento de 18 meses en una UCI pediátrica. Los antibióticos ciclados fueron: imipenem, piperacilina-tazobactam y ceftazidima más clindamicina, aunque cefepima sustituyo a ceftazidima para la última rotación. Tras 18 meses de seguimiento, la prevalencia de resistencia en aislados de colonización e infección sanguínea se mantuvo estable en la UCI pediátrica, mientras que la resistencia en aislados de infección sanguínea aumento en otras UCIs. Estudios de Hughes et al (35), mostraron que la estrategia de ciclaje de antibióticos en la UCI también puede tener como resultado una disminución en el número total de infecciones nosocomial, en este sentido encontraron un disminución de 19.7 a 9.8 infecciones/ 100 admisiones, p < 0.0001 durante el año de ciclaje de antibióticos, de igual forma encontraron disminución de las tasas de infecciones causadas por cocos Gram-positivos y bacilos Gram-negativos 24

Artículo

resistentes sobre otros servicios hospitalarios (2.5 vs 1.6 infecciones/ 100 admisiones, p = 0.04; 1.0 vs 0.4 infecciones/ 100 admisiones, p = 0.03, respectivamente). Estos estudios proporcionan evidencias de que el ciclaje puede ser una estrategia exitosa para la disminución de resistencia en bacterias Gram-negativas (24). Aunque, algunos estudios muestren que el ciclaje de antibióticos sustituye un problema por otro, en la medida que disminuye la resistencia a determinados antibióticos en una población bacteriana pero a su vez permite la emergencia de resistencia en otras poblaciones bacterianas (20,26). Sin embargo, tiene sentido limitar este tipo de estrategia solo a las UCIs, debido a que es en estos servicios hospitalarios donde la alta resistencia por el uso de antibióticos tiene gran importancia. ¿Aumenta o disminuye la resistencia bacteriana con el ciclaje de antibióticos? Aunque el ciclaje antibiótico se ha recomendado como una estrategia para disminuir la resistencia bacteriana en una determinada unidad o en el hospital (36,37) muchos aspectos con respecto a la estrategia de ciclaje ideal no se han definido. De hecho, algunos estudios han puesto a prueba la práctica del ciclaje de antibióticos en pacientes hospitalizados, incluso fuera de la UCI (29). El número de antibióticos necesario, la duración de la exposición a cada uno de los agentes por separado, y el antibiótico ideal para incluir en la estrategia son inciertas. Sin embargo, varios resultados de interés, muestran que también es posible que la estrategia sea efectiva en algunos escenarios pero no en otros. El programa de ciclaje en una UCI quirúrgica reportado por Raymond et al. (29), parece haber tenido éxito, pero el impacto de ese programa no es claro. En el estudio Raymond estableció un tratamiento empírico por separado para cada uno de los 2 síndromes más frecuentes en la población: peritonitis/ sepsis y neumonía nosocomial. Los antibióticos ciclados fueron: carbapenems (para la peritonitis), y ciprofloxacina y clindamicina (para la neumonía); se rotaron con cefepime y metronidazol (para la peritonitis), y piperacilina/tazobactam (para la neumonía). Sin embargo, los factores del huésped como la estancia en UCI, pacientes sometidos a hemodiálisis, o pacientes con enfermedad hepática grave deben ser considerados cuando se evalúe cualquier cambio en la resistencia antimicrobiana observada en el período de ciclaje.

Revista Medicina Vol. 9 No. 1 Éxitos y fracasos del ciclaje de antibióticos para disminuir la resistencia bactaeriana Pág. 4 de 7


Artículo

Éxitos y fracasos del ciclaje de antibióticos para disminuir la resistencia...

Moss et al. (30), publicaron un estudio en una UCI pediátrica en el que tres clases de antibióticos fueron ciclados cada 3 meses durante un período de 18 meses. Los resultados del estudio mostraron una pequeña pero no significativa disminución de la prevalencia de bacterias resistentes 29 a 24% (p = 0.41) ni selección de nuevos microorganismo, lo que sugiere que el ciclaje antibiótico podría ser una estrategia segura y viable para disminuir la aparición de resistencia antibiótica en la UCI. Sin embargo, un estudio definitivo sería necesario para medir los cambios significativos en la susceptibilidad de los gérmenes. En cuanto, a la exposición a antibióticos de una misma clase puede conducir a una mayor presión de colonización, lo que incrementaría el riesgo de transmisión cruzada (38). En cambio, ciclos cortos de exposición a antibióticos de una misma clase, son menos probables de conducir a aumento en la presión de colonización de un cierto perfil de resistencia. Sin embargo, con un mal cumplimiento del control de las infecciones, el riesgo de transmisión cruzada puede ser el mismo, solo que pasan desapercibidos porque existen diferentes perfiles de resistencia. Sin embargo, algunos estudios han mostrado que el ciclaje de antibiótico podría estimular un fuerte aumento en la adquisición de determinantes de resistencia con la consecuente aparición de resistencia en bacilos Gram negativos (20,22,25). En este contexto estudios de van Loon et al (20), encontraron una alta tasa de adquisición de resistencia durante el tratamiento con levofloxacina (RR: 3.2; 95%IC: 1.4-7.1, p: 0.003) y piperacilina/ tazobactam (RR: 2.4; 95%IC: 1.2-4.8, p: 0.02). Un análisis de regresión multivariado mostró que el tratamiento con levofloxacina fue el único factor de riesgo independiente para la adquisición de resistencia a este antibiótico en bacterias Gram-negativas con proporción de riesgo 12.6 (95%IC: 3.8-41.6, p: 0.0001). De acuerdo a los diferentes resultados obtenidos con el ciclaje de antibiótico hay una necesidad de evaluación crítica a los estudios publicados, debido a los métodos utilizados y las variables de confusión no controladas que pueden haber conducido a un entusiasmo injustificado para este enfoque (39). De otra parte, el posible éxito de esta estrategia podría tener su principal impacto en las UCIs, si se introducen en situaciones en las que todavía no existe un problema serio de resistencia donde el uso a 25

corto plazo de los antibióticos inherentes al ciclaje puede prevenir la aparición y diseminación de determinantes de resistencia. Conclusión El ciclaje puede ser una manera de forzar cambios en la prescripción de los clínicos, en busca de optimizar la terapia empírica en el manejo de infecciones graves, así como también, reducir el uso innecesario e inapropiado de antimicrobianos que podrían contribuir con la resistencia antimicrobiana. Sin embargo, los antibióticos óptimos para ciclar, el orden en el que se deben ciclar, y la duración de cada ciclo son aún desconocidos. El ciclaje antibiótico parece prometedor para el control de la resistencia antibiótica, a pesar de que nuevos mecanismos de resistencia pueden surgir como consecuencia de su uso, para lo que ciclos cortos de exposición a los antibióticos deben ser empleados. Aunque la estrategia de ciclaje de antibióticos podría ser implementada para su uso hospitalario, esta debería simplificarse para su uso en UCIs por representar un escenario particular donde es muy necesaria, debido al elevado uso de antimicrobianos y emergencia de bacterias resistentes a los antimicrobianos. No obstante, los diferentes resultados obtenidos con la implementación de esta estrategia de administración de antimicrobianos podrían ser un obstáculo para el enfoque de la estrategia que es la diminución de la resistencia bacteriana. Los estudios que han tenido éxito con el ciclaje pueden haber estado relacionados con la promoción de la heterogeneidad de antimicrobianos, además de fomentar la administración apropiada de los mismos. Sin embargo, la heterogeneidad antibiótica debe de ser controlada como parte de la estrategia de ciclaje de antibiótico, debido a que podrían conducir a una mayor presión de colonización y aumento en los riesgos de transmisión cruzada. Conflicto de intereses Los autores declaramos que no tenemos conflicto de intereses pertinentes a este artículo.

Bibliografía 1. Owens R. Antimicrobial stewardship: concepts and strategies in the 21st century. Diagn Microbiol Infect Dis. 2008;61:110–128. 2. Dellit T, Owens R, McGowan J, et al. Infectious Diseases Revista Medicina Vol. 9 No. 1 Éxitos y fracasos del ciclaje de antibióticos para disminuir la resistencia bactaeriana Pág. 5 de 7


Éxitos y fracasos del ciclaje de antibióticos para disminuir la resistencia...

Society of America and the Society for Healthcare Epidemiology of America Guidelines for developing an institutional program to enhance antimicrobial stewardship. Clin Infect Dis. 2007;44:159–177. 3. Scheetz M, Bolon M, Postelnick M, Noskin G, Lee T. Costeffectiveness analysis of an antimicrobial stewardship team on bloodstream infections: a probabilistic analysis. J Antimicrob Chemother. 2009;63:816–825.

Artículo

Intensive Care Unit: Advances and Obstacles. Am J Respir Crit Care Med. 2009;179:434-438. 13. Lesprit P, Duong T, Girou E, Hemery F, Brun-Buisson C. Impact of a computer-generated alert system prompting review of antibiotic use in hospitals. J Antimicrob Chemother. 2009;63:1058–1063. 14. Pujol M, Guidol F. Evidence for antibiotic cycling in control of resistance. Curr Opin Infect Dis. 2001;14:711-715.

4. National Nosocomial Infections Surveillance (NNIS) System Report, data summary from January 1992 through June 2003, issued August 2003. Am J Infect Control. 2003;31:481-498.

15. Kollef M. Is Antibiotic Cycling the Answer to Preventing the Emergence of Bacterial Resistance in the Intensive Care Unit?. Clin Infect Dis. 2006; 43:S82–S88.

5. Dellit T, Owens R, McGowan J, et al. Infectious Diseases Society of America and the Society for Healthcare Epidemiology of America guidelines for developing an institutional program to enhance antimicrobial stewardship. Clin Infect Dis. 2007;44:159-177.

16. Sandiumenge A, Diaz E, Rodriguez A, et al. Impact of diversity of antibiotic use on the development of antimicrobial resistance. J Antimicrob Chemother. 2006;57:1197–1204.

6. Cheng V, To K, Li I, et al. Antimicrobial stewardship program directed at broad-spectrum intravenous antibiotics prescription in a tertiary hospital. Eur J Clin Microbiol Infect Dis. 2009;28:12, 1447-1456.

17. Oostdijk E, de Smet A, Blok H, et al. Ecological Effects of Selective Decontamination on Resistant Gram-negative Bacterial Colonization. Am J Respir Crit Care Med. 2010;181:452-457.

7. Warren D, Fraser V. Infection control measures to limit antimicrobial resistance. Crit Care Med. 2001;29(4 suppl):N128-N134

18. Pakyz A, Oinonen M, Polk R. Relationship of Carbapenem Restriction in 22 University Teaching Hospitals to Carbapenem Use and Carbapenem-Resistant Pseudomonas aeruginosa. Antimicrob Agents Chemother. 2009;53:1983-1986.

8. Wenzel R, Edmond M. The Impact of Hospital-Acquired Bloodstream Infections. Emerg Infec Dis. 2001;7:174-177. 9. Niederman M. Impact of antibiotic resistance on clinical outcomes and the cost of care. Crit Care Med. 2001;29: Suppl. N114-N120 10. Berrington A. Antimicrobial prescribing in hospitals: be careful what you measure. J Antimicrob Chemother. 2010;65:163-168. 11. Bruce J, MacKenzie F, Cookson B, et al. Antibiotic stewardship and consumption: findings from a pan-European hospital study. J Antimicrob Chemother. 2009;64:853-860.

19. John J, Rice L. The Microbial Genetics of Antibiotic Cycling. Infect Control Hosp Epidemiol. 2000;21(Suppl.):S22-S31. 20. van Loon H, Vriens M, Fluit A, et al. Antibiotic Rotation and Development of Gram-Negative Antibiotic Resistance. Am J Respir Crit Care Med. 2005;171:480–487. 21. Merz L, Warren D, Kollef M, Fridkin S, Fraser V. The Impact of an Antibiotic Cycling Program on Empirical Therapy for Gram-Negative Infections. Chest. 2006;130;1672-1678. 22. Toltzis P, Dul M, Hoyen C, et al. The Effect of Antibiotic Rotation on Colonization with Antibiotic-Resistant Bacilli in a Neonatal Intensive Care Unit. Pediatrics. 2002;110:707-711.

12. Lawrence K, Kollef M. Antimicrobial Stewardship in the

26

Revista Medicina Vol. 9 No. 1 Éxitos y fracasos del ciclaje de antibióticos para disminuir la resistencia bactaeriana Pág. 6 de 7


Artículo

Éxitos y fracasos del ciclaje de antibióticos para disminuir la resistencia...

23. McGowan J. Strategies for study of the role of cycling on antimicrobial use and resistance. Infect Control Hosp Epidemiol. 2000;21:S36-S43. 24. Masterton R. Antibiotic cycling: more than it might seem?. J Antimicrob Chemother. 2005;55:1-5. 25. Hersh A, BeekmannS, Polgreen P, Zaoutis T, Newland J. Antimicrobial Stewardship Programs in Pediatrics. Infect Control Hosp Epidemiol. 2009;30:1211-1217. 26. Bergstrom C, Lo M, Lipsitch M. Ecological theory suggests that antimicrobial cycling will not reduce antimicrobial resistance in hospitals PNAS. 2004;101:13285-13290. 27. Kollef M. Is there a role for antibiotic cycling in the intensive care unit?. Crit Care Med. 2001;29(Suppl):N135-N142. 28. Fridkin S. Routine Cycling of Antimicrobial Agents as an Infection-Control Measure. Clin Infect Dis. 2003;36:1438-1444.

2000;21(1 suppl): S12-S17. 35. Hughes M, Evans H, Chong T, et al. Effect of an intensive care unit rotating empiric antibiotic schedule on the development of hospital-acquired infections on the nonintensive care unit ward. Crit Care Med. 2004;32:53-60. 36. John J. Antibiotic cycling: is it ready for prime time? Infect Control Hosp Epidemiol. 2000;21:9-11. 37. Curcio D. Applying Antibiotic Stewardship: The “Real World” When Resources Are Limited. Infect Control Hosp Epidemiol. 2010;31:666–668 38. Bonten M, Slaughter S, Ambergen A, et al. The role of "colonization pressure" in the spread of vancomycin-resistant enterococci. An important infection control variable. Arch Intern Med. 1998;158:1127–1132. 39.Levin B, Bonten M. Cycling antibiotics may not be good for your health PNAS. 2004;101:13101-13102.

29. Raymond D, Pelletier S, Crabtree T, et al. Impact of a rotating empiric antibiotic schedule on infectious mortality in an intensive care unit. Crit Care Med. 2001;29:1101-1108. 30. Moss W, Beers C, Johnson E, et al. Pilot study of antibiotic cycling in a pediatric intensive care unit. Crit Care Med. 2002;30:1877-1822. 31. Dominguez E, Smith T, Reed E, Sanders C, Sanders W Jr. A pilot study of antibiotic cycling in a hematology-oncology unit. Infect Control Hosp Epidemiol. 2000;21(Suppl 1):S4-S8. 32. Schneider J, Moromisato D, Zemetra B, et al. Hand hygiene adherence is influenced by the behavior of role Models. Pediatr Crit Care Med. 2009;10:360-363. 33. Gerding D, Larson T, Hughes R, Weiler M, Shanholtzer C, Peterson L. Aminoglycoside resistance and aminoglycoside usage: ten years of experience in one hospital. Antimicrob Agents Chemother. 1991;35:1284-1290. 34. Gerding D. Antimicrobial cycling: lessons learned from the aminoglycoside experience. Infect Control Hosp Epidemiol. 27 35

Revista Medicina Vol. 9 No. 1 Éxitos y fracasos del ciclaje de antibióticos para disminuir la resistencia bactaeriana Pág. 7 de 7


Vol. 9 No. 1, 2010 (Enero - Junio)

Revista Medicina

Control del adulto infectado por el virus de la inmunodeficiencia humana (VIH) The control of HIV infected adults Dr. Rodrigo Giraldo Bustos Especialista en Medicina Interna Universidad CES, Medellín e-mail: rgiraldo@gmail.com Resumen Hace ya más de 25 años se describieron los primeros casos de infección por el virus de la inmunodeficiencia humana (VIH); ha sido mucho el camino recorrido desde el descubrimiento del agente etiológico hasta la aparición de la terapia antirretroviral altamente efectiva (HAART). El pronóstico y la sobrevida de estos pacientes ha mejorado de manera dramática, todo esto basándose en un manejo multidisciplinario y un seguimiento estrecho basado casi siempre en guías de manejo adaptadas de recomendaciones internacionales. A continuación repasaremos las recomendaciones principales para el cuidado y control de adultos infectados por VIH. Palabras Clave: VIH, adultos, control. Summary It has been more than 25 years now that the first cases of HIV infection were brought to light. A lot of time has passed since the discovery of the etiologic agent until the appearing of the highly effective antiretroviral therapy (HAART). The prognosis of these patients have improved drastically, based in a multidisciplinary management and a close monitoring based, almost always, on management guides adapted to international recommendations. Here, we will go through the main recommendations for the care and control of HIV infected adults. Key words: HIV, adults, control.

Hace más de cinco lustros el mundo entero abrió sus ojos a la que se convertiría en la epidemia más devastadora de los últimos siglos, luego del reporte de 5 casos de pacientes con neumonía por Pneumocystis (en ese 1,2 entonces carinii) . Desde ese entonces ha habido muchos cambios en el manejo y la expectancia de vida de los pacientes infectados con el virus de la inmunodeficiencia humana (VIH) con una mejoría significativa en cuanto la mortalidad y morbilidad, además de un mayor tiempo para el desarrollo del Síndrome de Inmunodeficiencia Adquirida (SIDA) luego del amplio uso de antirretrovirales (ARV) y advenimiento de la terapia antirretroviral altamente efectiva (HAART)3. Para el control de estos pacientes se debe contar con programas de atención adecuados. Según la resolución 3442 de 2006 del Ministerio de la Protección Social toda persona con diagnóstico de infección por VIH debe ser atendida de forma interdisciplinaria por parte de un grupo de profesionales de la salud, los cuales deben cumplir con los indicadores de calidad de atención 28

Recibido para publicación el 24 de marzo de 2010 Aceptado el 13 de abril de 2010

4

recomendados . Dentro de cualquier programa, el adecuado control incluye el diagnóstico temprano de la infección, la educación y consejería para evitar la transmisión del virus, la realización de los exámenes pertinentes para identificar o evitar el empeoraramiento de situaciones clínicas relacionadas y del seguimiento de la adherencia. PACIENTE SERONEGATIVO CON RIESGO DE INFECCIÓN En la evaluación de cualquier paciente con conductas de riesgo para infección por VIH cuyo estado serológico es desconocido se debe realizar una prueba de ELISA (Enzyme-Linked ImmunoSorbent Assay) para VIH (prueba presuntiva). La recomendación en Colombia es que toda prueba presuntiva que resulte reactiva se repita, preferiblemente en una muestra diferente; si ésta es reactiva se pasa a una prueba confirmatoria pero, si es negativa, se realiza una tercera prueba presuntiva; la decisión se toma con base en dos resultados de tres, así: dos pruebas reactivas implica la realización de una Revista Medicina Vol. 9 No. 1 Control del adulto infectado por el virus de la inmunodeficiencia humana (VIH) Pág. 1 de 8


Control del adulto infectado por el virus de la inmunodeficiencia humana (VIH)

prueba confirmatoria, dos negativas se considera como no infectado y se remite para consejería, o se cita al paciente para una nueva prueba en 4 semanas. Si en cambio la presuntiva es negativa, se debe tener cuenta que la seroconversión puede tardar entre uno y tres meses, por lo cual esta se debería repetir en un tiempo prudencial. Si el paciente continúa con el riesgo de infección, debe continuar en seguimiento con controles periódicos haciendo énfasis siempre en las medidas 5 preventivas . En general si la prueba de ELISA es positiva se debe confirmar con una prueba más específica como el Western-blot (prueba confirmatoria). Si el paciente tiene síntomas de sugestivos de infección aguda (Síndrome retroviral agudo o SRA), es muy posible que no tenga anticuerpos (ventana inmunológica) por lo cual sería de utilidad determinar la carga viral (CV) del 6 ARN del VIH-1 . Estos síntomas se desarrollan hasta en el 75% de los pacientes infectados por VIH y suelen simular una mononucleosis, influenza u otro tipo de infección viral aguda. Pacientes con pruebas serológicas negativas y cargas virales altas (>100000), pueden considerarse infectados. Sin embargo la carga viral no esta aprobada para el diagnóstico definitivo, de manera que las pruebas para detectar anticuerpos deben repetirse luego para confirmar seroconversión. Una CV baja (<de 1000 copias) usualmente indica un falso positivo ya que este estadio suele asociarse con CV muy altas, no obstante se deberían repetir las pruebas 7,8 serológicas entre 4 y 6 semanas después . CONTROL CLINICO La infección por VIH es un proceso crónico y el control de estos pacientes debe ser periódico por muchos años. La anamnesis, el examen físico y los exámenes complementarios deben enfocarse en conocer el estadio clínico e inmunológico y son muy útiles para definir el inicio de la terapia HAART y la profilaxis para las infecciones oportunistas. Además se debe tener en cuenta los posibles efectos adversos asociados a estos 5 tratamientos . Valoración Inicial Antes de cualquier investigación de debe aclarar al paciente su diagnóstico y explicarle que gracias a los avances en los últimos años en el seguimiento y tratamiento del VIH, esta entidad se ha convertido en una 29 35

Artículo

enfermedad crónica, con una mayor supervivencia. Esta primera evaluación tiene entre sus objetivos, además de una valoración clínica integral, la oportunidad de comenzar una adecuada relación médicopaciente que puede continuar por muchos años. Anamnesis se deben tener en cuenta la fecha del diagnóstico, y si es posible, indagar acerca de la posible fecha de la infección, basando en serologías negativas previas y síntomas sugestivos de SRA. De ser posible intentar identificar la persona causante potencial de la infección y saber si ha recibido o no previamente ARV o si el mismo paciente los ha recibido, teniendo en cuenta la combinación de ARV usados y su respuesta a estos, ya que esto podría hacer sospechar infección por una cepa resistente Conocer las conductas de riesgo del paciente (actividad sexual, uso de drogas intravenosas etc.). Historia médica previa, buscando enfermedades asociadas a VIH como infecciones oportunistas. Hábitos o actividades que lo pongan en riesgo como viajes a regiones con micosis endémicas, tener aves en su domicilio. La presencia de trastornos cognitivos (demencia) u otro tipo de complicaciones asociadas (neoplasias). Es también de mucha importancia saber que otras comorbilidades no asociadas al VIH tiene el paciente que puedan condicionar su manejo, como enfermedad cardiovascular, hepática o renal, enfermedades neoplásicas o trastornos psiquiátricos, así como el uso o 5,8,9 alergia a medicamentos . Examen Físico Se debe realizar un examen físico completo y sistemático: Piel: Los pacientes VIH positivo tienen 15 veces más riesgo de presentar afecciones inflamatorias o infecciosas que comprometan la piel que la población general10. Lesiones sugestivas de dermatitis seborreica, infecciones fúngicas, foliculitis o psoriasis, las cuales pueden presentarse en cualquier tipo de paciente, pero son más frecuentes en los VIH positivo. Sarcoma de Kaposi, molusco contagioso, herpes zoster o simple con compromiso extenso11,12. Sistema Linfático: se debe evaluar la presencia de adenopatías cervicales, axilares o inguinales y seguirlas, Revista Medicina Vol. 9 No. 1 Control del adulto infectado por el virus de la inmunodeficiencia humana (VIH) Pág. 2 de 8


Control del adulto infectado por el virus de la inmunodeficiencia humana (VIH)

ya que estas se pueden asociar a primoinfección (SRA), infecciones oportunistas o neoplasias. Así mismo buscar 4,13 la asociación con hepato o esplenomegalia . Cabeza y Cuello: Casi todos los pacientes con infección por VIH tienen o han tenido alguna manifestación de su enfermedad a nivel de cabeza y cuello, la mayoría por infecciones oportunistas o enfermedades neoplásicas14. Se debe examinar el fondo de ojo en busca de lesiones en la coroides o la retina por toxoplasma, citomegalovirus (CMV) o herpes. Los pacientes en estadios avanzados (SIDA) deben ser remitidos a un oftalmólogo para un examen más detallado con dilatación pupilar. Las diferentes manifestaciones oculares asociadas a VIH incluyen: Alteraciones neuro-oftalmológicas, alteraciones de superficie ocular, cámara anterior y anexos, neoplasias oculares y patologías orbitarias, alteraciones vasculares retinianas o infecciones oculares oportunistas15. La orofaringe se debe examinar cuidadosamente en búsqueda de: candidiasis, leucoplaquia vellosa oral, sarcoma de Kaposi, aftas orales, enfermedad periodontal. Cardiopulmonar: Evaluar el ritmo cardíaco, los ruidos sobreagregados y los soplos, como se haría con cualquier paciente en la consulta. En la actualidad no hay datos que obliguen a evaluar de forma diferente al paciente con VIH a la hora de manejar los factores de riesgo cardiovascular, sin embargo existe evidencia sobre un mayor riesgo de enfermedad cardiovascular en 16,17 pacientes con VIH , ya sea por factores dependientes 18,19 de la infección misma , por factores de riesgo 20 clásicos , o asociados al tratamiento con ATR, por ende se debería incorporar a la rutina clínica diaria la evaluación cuidadosa de estos factores de riesgo y el cálculo del riesgo cardiovascular mediante la aplicación 23 de ecuaciones de riesgo . Los síntomas respiratorios también son una queja frecuente en este tipo de 24 pacientes y los diagnósticos diferenciales muy amplios . En la auscultación pulmonar se pueden encontrar áreas con disminución del murmullo vesicular o con ruidos sobreagregados, alteraciones que al ser correlacionadas con los hallazgos de los rayos x de tórax, como consolidaciones, derrame pleural o pericárdico pueden ayudar a sospechar la presencia de infección o 4,8 enfermedad oportunista . Abdomen: La presencia de hepatomegalia o esplenomegalia, asociada o no a linfadenopatía debe ser 30

Artículo

investigada a fondo y descartar patología infecciosa o neoplásica. Así mismo la presencia de ascitis y/o masas palpables que podrían estar relacionadas a tuberculosis 8,25 (TB), neoplasias o hepatopatía crónica . En cuanto a la presencia de dolor abdominal parece no haber mucha 26 diferencia si se comparan con pacientes VIH negativo . Genitourinario: Se debe hacer énfasis en la región perineal y anal, donde pueden existir nódulos o tumores (condilomas, molusco contagioso, neoplasias), úlceras (sífilis, tuberculosis, CMV, herpes, Chlamydia), vesículas (herpes), secreciones anormales o lesiones inflamatorias (candidiasis). En las mujeres es ideal realizar el examen ginecológico completo4. Musculoesquelético: Los pacientes infectados con VIH son susceptibles al mismo tipo de alteraciones musculoesqueléticas que la población VIH negativo. Sin embargo el VIH, la respuesta inmune y el TAR pueden causar toxicidad directa a los huesos, articulaciones y músculos. Pudiéndose ver osteopenia, osteoporosis y osteonecrosis. En estadios avanzados puede haber compromiso por infecciones oportunistas, por neoplasias 27,29 o por el mismo tratamiento . Neurológico: Los pacientes con VIH pueden presentar una amplia gama de manifestaciones neurológicas, algunas asociadas a enfermedades oportunistas o 30 neoplasias y otras por efecto directo del virus . Se deben buscar lesiones motoras y/o sensitivas además de evaluar cuidadosamente el estado de conciencia. Estas pueden ser por infecciones oportunistas, neoplasias o asociadas al mismo VIH como los desórdenes neurocognitivos asociados a VIH (HAND)31,34. Pruebas de Laboratorio Lo primero que se debe hacer es estar seguro del diagnóstico y en caso de que no se disponga de ellas realizar una prueba presuntiva y luego una confirmatoria. Se deben realizar entre otros:  Paraclínicos básicos como: Hemograma completo y VSG; glucemia, función renal (creatinina, nitrógeno ureico y parcial de orina), perfil hepático (transaminasas, bilirrubinas, fosfatasa alcalina, proteínas totales, deshidrogenasa láctica), perfil lipídico completo.

Revista Medicina Vol. 9 No. 1 Control del adulto infectado por el virus de la inmunodeficiencia humana (VIH) Pág. 3 de 8


Artículo

Control del adulto infectado por el virus de la inmunodeficiencia humana (VIH)

 Pruebas para hepatitis virales: antígeno de superficie VHB (HBsAg), anticuerpos contra el antígeno de superficie (antiHBsAg) y el core (anti-HB core), anticuerpos hepatitis A, anticuerpos hepatitis C.  IgG: para toxoplasma y citomegalovirus (infecciones latentes)  Tuberculina (PPD)–prueba de Mantoux; si es positiva, se debe iniciar quimioprevención.  Electrocardiograma y Rayos X de tórax. Pruebas para conocer el estado inmunológico del paciente y la actividad viral  CV: * Hibridización de la señal de ADN: nivel inferior de detección: 50 copias/ml. * Amplificación del ARN viral PCRRT: detecta desde 40 copias/ml (método ultrasensible) o 400 copias en el método estándar. * Idealmente el seguimiento se debe hacer utilizando el mismo método.

* Aunque en muchos laboratorios reporten el conteo de células CD8 y la relación CD4 a CD8, estas no deben 8 usarse para la toma de decisiones clínicas .  Las guías internacionales recomiendan la realización 8,35,36 de genotipo de VIH cuando se va a iniciar TAR .  Las guías norteamericanas recomiendan realizar una prueba de resistencia (siendo el genotipo la más costoefectiva) desde el inicio del cuidado de estos pacientes a pesar de que no se vaya a iniciar TAR, y repetirlo al momento del inicio de esta terapia. Es importante recalcar que para este tipo de pruebas se recomienda tener al menos una CV > de 1000 copias para 36 aumentar su rendimiento . ESTRATIFICACION El sistema de estadiaje más ampliamente utilizado es el recomendado por el CDC (Centers for Disease Control and Prevention) en 1993 en la cual se tienen en cuenta el conteo de CD4 y 3 categorías clínicas(ver tabla 1) Según esta clasificación cualquier persona mayor de 13 años con un conteo de CD4 < de 200 y/o una condición clínica 37 definidora (categoría clínica C) tiene SIDA .

 CD4 y CD8: * Un conteo de células CD4 por citometría de flujo, con su porcentaje debe obtenerse al principio de la atención.

Tabla 1. Sistema de clasificación del CDC para adultos y adolescentes infectados con VIH

Categorías Clínicas Categoría según conteo de CD4

31

A B C Asintomático, LGP Sintomático no A Condición o infección aguda no C definidora de SIDA

>500

A1

B1

C1

200-500

A2

B2

C2

<200

A3

B3

C3

Revista Medicina Vol. 9 No. 1 Control del adulto infectado por el virus de la inmunodeficiencia humana (VIH) Pág. 4 de 8


Control del adulto infectado por el virus de la inmunodeficiencia humana (VIH)

Decisiones Terapéuticas La TAR está indicada en todo paciente con enfermedad definitoria de SIDA o con un conteo de células CD4 ≤ 36,38 350 . La evidencia para esta recomendación es mayor para conteos de CD4 ≤ 200 por lo que en algunas guías recomiendan en los pacientes con conteos entre 200 y 350 tener en cuenta la carga viral para decidir iniciar la 4 TAR . Según la estratificación también se tomaran decisiones en cuanto a la profilaxis para infecciones oportunistas, en el caso del Pneumocystis jirovecii se recomienda iniciar profilaxis con un conteo de CD4 ≤ 200 o historia de candidiasis orofaringea o alguna enfermedad definitoria de SIDA. Para esto la primer elección es el trimetoprim sulfametoxazol (TMP-SMX) que a su vez protege contra el Toxoplasma gondii. En el caso de la TB latente (PPD >5mm), se recomienda tratar con Isoniazida (INH) más piridoxina por 9 meses. Para el complejo Mycobacterium avium se recomienda profilaxis con Azitromicina semanal o claritromicina diaria cuando los CD4 son ≤ 50. Para la histoplasmosis se recomienda el uso de itraconazol en zonas hiperendémicas (> de 10 casos/100pacientes-año). Para el Cryptococcus neoformans no existe recomendación para profilaxis primaria, aunque en algunas guías recomiendan el uso de fluconazol en pacientes con CD4 menor a 100 que no reciben TAR o están en falla virológica. En cuanto a profilaxis secundaria, luego de recibir tratamiento el paciente debe continuar manejo prolongado con fluconazol hasta que los CD4 estén por encima de 200 39,40 por más de 6 meses y la carga viral sea indetectable . Vacunación Hepatitis B (VHB): todo paciente sin evidencia de exposición y/o vacunación previa debe recibir el esquema completo para VHB independiente del conteo de CD4. Hepatitis A (VHA): pacientes susceptibles con hepatopatía crónica, que utilicen drogas intravenosas u hombres que tengan sexo con hombres (HSH) deberían ser vacunados. La mayoría de expertos recomiendan esperar a tener un conteo de CD4 mayor de 200. Influenza: Se debe aplicar en todos los pacientes, 32

Artículo

continuando luego cada año en la época indicada para tal fin, de acuerdo con su sitio de residencia, independiente del conteo de CD4. Virus Varicela-Zoster (VZV): se recomienda en pacientes con CD≥ 200 que no hayan sido vacunados, sean seronegativos para VZV, no tengan historia de varicela o herpes zoster. Esta recomendación incluye pacientes expuestos y no expuestos. Papiloma virus humano (PVH): recomendado en mujeres entre los 15 y 26 años. Neumococo: debe aplicarse en pacientes con conteos de CD4 mayor a 200 y que no hayan recibido la vacuna en 8,35 los últimos 5 años . PROGRAMACION DE VISITAS Y EVALUACIONES Pacientes asintomáticos con conteos de CD4 y CV adecuados deben ser monitorizados con estos exámenes cada 3 a 4 meses para definir el inicio de TAR y la profilaxis. En pacientes que inician TAR se deber realizar una segunda visita a las 4 semanas para evaluar la adherencia y la respuesta al tratamiento. Una vez la respuesta es adecuada al igual que la adherencia, los controles deben continuar cada 3 a 4 meses5. En general la frecuencia de las evaluaciones depende del estadio y la tasa de progresión de la enfermedad. Los hemogramas y la química sanguínea se deben repetir con relativa frecuencia teniendo en cuanta el tipo de medicamentos que recibe cada paciente para monitorizar efectos adversos. Hay que tener en cuenta la variación que suelen presentar los conteos de CD4 en relación a enfermedades agudas o inmunizaciones para no realizar estas pruebas en las primeras 2 a 3 semanas posteriores8. RECOMENDACIONES GENERALES Prevención de la transmisión: se debe hacer énfasis en los métodos de transmisión para así evitar la reinfección y la transmisión del virus. Del mismo modo insistir en el uso del preservativo que a su vez puede prevenir otras enfermedades de transmisión sexual. Los pacientes drogadictos deben recibir consejería y remitirse a centros de rehabilitación. En caso de persistir el uso de estas sustancias, al menos se debe insistir en el uso de jeringas Revista Medicina Vol. 9 No. 1 Control del adulto infectado por el virus de la inmunodeficiencia humana (VIH) Pág. 5 de 8


Artículo

Control del adulto infectado por el virus de la inmunodeficiencia humana (VIH)

estériles y en no compartirlas. Se debe recordar la importancia de notificar su estado al personal sanitario que lo atienda y sus contactos. Aconsejar sobre buenos hábitos y estilo de vida para prevenir enfermedades e infecciones oportunistas, teniendo en cuenta hábitos alimenticios, ciertas actividades sociales como el tabaquismo y consumo de alcohol, contacto con animales y viajes a zonas endémicas para ciertas infecciones. En el caso del tabaquismo, existe evidencia sobre su estimulo al sistema inmune lo que podría acelerar la progresión de la enfermedad, aunque la evidencia es un poco contradictoria. Se sabe también que es un factor que 5,41,42 se interviene poco en estos pacientes . Se debe ofrecer apoyo psicológico si es necesario, no solo a los pacientes sino a quienes conviven con él. En el caso de las mujeres en edad fértil, su consejería y manejo constituyen un capítulo aparte, es importante hacer énfasis que en la actualidad no existe una contraindicación absoluta para el embarazo, pero en el caso de buscarse debe realizarse un manejo y seguimiento especial5,43,44. A toda mujer embarazada se le debe hace una prueba presuntiva para VIH para conocer su estado. Se debe informar también a la mujer que con las intervenciones y el cuidado adecuado la trasmisión perinatal es menor del 2%, comparada con un 25 a 30% sin estas intervenciones45,47. Así mismo según el resultado de las medidas, teniendo la carga viral como principal meta se harán las recomendaciones necesarias para la 47,48 atención del parto . Por último se debe recordar que el éxito de cualquier intervención realizada en este tipo de pacientes depende principalmente de la adherencia al seguimiento y al tratamiento instaurado. Esto es supremamente importante sobre todo en los pacientes que han iniciado algún régimen antirretroviral ya que es precisamente la falta de adherencia la principal causa de las fallas 8,49,50 terapéuticas . Todo esto debe ser previsto desde la primera visita ya que se ha visto que la falta de asistencia a las citas de control predice la poca adherencia al TAR e incluso se considera un factor asociado a mayor mortalidad51,53. Otra vez se hace énfasis en la relación medico paciente. Establecer una relación de confianza entre el paciente y el trabajador de salud que lo atiende es 54 clave en este sentido . 33

Bibliografía 1. Pneumocystis pneumonia--Los Angeles. MMWR Morb Mortal Wkly Rep 1981;30:250-2. 2. Gottlieb MS. AIDS--past and future. N Engl J Med 2001;344:1788-91. 3. Survival after introduction of HAART in people with known duration of HIV-1 infection. The CASCADE Collaboration. Concerted Action on SeroConversion to AIDS and Death in Europe. Lancet 2000;355:1158-9. 4. ASOCIACIÓN COLOMBIANA DE INFECTOLOGÍA FyMdlPS. Guía de práctica clínica de VIH/SIDA, Recomendaciones basadas en la evidencia, Colombia. Infectio 2006;10:294 - 326. 5. Gatell JM. Guía Practica Del SIDA Clínica, Diagnóstico y Tratamiento. In. 09 ed. Barcelona: 9788445817919; 2007:656. 6. Hecht FM, Busch MP, Rawal B, et al. Use of laboratory tests and clinical symptoms for identification of primary HIV infection. AIDS 2002;16:1119-29. 7. Valenti WM. Acute retroviral syndrome: a challenge for primary care. AIDS Read 2008;18:294-6. 8. Aberg JA, Kaplan JE, Libman H, et al. Primary care guidelines for the management of persons infected with human immunodeficiency virus: 2009 update by the HIV medicine association of the infectious diseases society of America. Clin Infect Dis 2009;49:651-81. 9. Hammer SM. Clinical practice. Management of newly diagnosed HIV infection. N Engl J Med 2005;353:1702-10. 10. Khambaty MM, Hsu SS. Dermatology of the patient with HIV. Emerg Med Clin North Am;28:355-68, Table of Contents. 11. Leal L, Ribera M, Dauden E. [Psoriasis and HIV infection]. Actas Dermosifiliogr 2008;99:753-63. 12. Maurer TA. Dermatologic manifestations of HIV infection. Top HIV Med 2005;13:149-54. 13. Lederman MM, Margolis L. The lymph node in HIV pathogenesis. Semin Immunol 2008;20:187-95. 14. Moayedi S. Head, neck and ophthalmologic manifestations of HIV in the emergency department. Emerg Med Clin North Am;28:265-71. 15. Perez-Blazquez EE, Redondo M, Garcia T. [AIDS and Revista Medicina Vol. 9 No. 1 Control del adulto infectado por el virus de la inmunodeficiencia humana (VIH) Pág. 6 de 8


Control del adulto infectado por el virus de la inmunodeficiencia humana (VIH)

ophthalmology: a contemporary view]. An Sist Sanit Navar 2008;31 Suppl 3:69-81. 16. Lozano F. [Spectrum of cardiovascular disease in HIVinfected patients]. Enferm Infecc Microbiol Clin 2009;27 Suppl 1:3-9. 17. Mishra RK. Cardiac emergencies in patients with HIV. Emerg Med Clin North Am;28:273-82, Table of Contents. 18. Masia M, Gutierrez F. [HIV-related cardiovascular risk factors]. Enferm Infecc Microbiol Clin 2009;27 Suppl 1:17-23. 19. Alonso-Villaverde Lozano C. [Physiopathology of cardiovascular disease in HIV-infected patients]. Enferm Infecc Microbiol Clin 2009;27 Suppl 1:33-9. 20. Portilla J. [Patient-related cardiovascular risk factors in the HIV-infected population]. Enferm Infecc Microbiol Clin 2009;27 Suppl 1:10-6. 21. Perez-Camacho I, Camacho A, Torre-Cisneros J, Rivero A. [Cardiovascular risk factors associated with antiretroviral therapy]. Enferm Infecc Microbiol Clin 2009;27 Suppl 1:24-32.

ArtĂ­culo

30. Ho EL, Jay CA. Altered mental status in HIV-infected patients. Emerg Med Clin North Am;28:311-23, Table of Contents. 31. Letendre SL, Ellis RJ, Everall I, Ances B, Bharti A, McCutchan JA. Neurologic complications of HIV disease and their treatment. Top HIV Med 2009;17:46-56. 32. Ances BM, Ellis RJ. Dementia and neurocognitive disorders due to HIV-1 infection. Semin Neurol 2007;27:86-92. 33. Currier JS, Havlir DV. Complications of HIV disease and antiretroviral therapy. Top HIV Med 2009;17:57-67. 34. Portegies P, Solod L, Cinque P, et al. Guidelines for the diagnosis and management of neurological complications of HIV infection. Eur J Neurol 2004;11:297-304. 35. [Recommendations from the GESIDA/Spanish AIDS Plan regarding antiretroviral treatment in adults with human immunodeficiency virus infection (update February 2009)]. Enferm Infecc Microbiol Clin 2009;27:222-35.

22. Bernardino de la Serna JI, Zamora FX, Montes ML, GarciaPuig J, Arribas JR. [Hypertension, HIV infection, and highly active antiretroviral therapy]. Enferm Infecc Microbiol Clin;28:32-7.

36. Panel on Antiretroviral Guidelines for Adults and Adolescents. Guidelines for the use of antiretroviral agents in HIV-1-infected adults and adolescents. Department of Health and Human Services. December 1, 2009; 1-161. Available at http://www.aidsinfo.nih.gov/ContentFiles/AdultandAdolescent GL.pdf. .

23. Bernardino de la Serna JI, Arribas Lopez JR. [Controversies and future of the approach to cardiovascular disease in HIV patients]. Enferm Infecc Microbiol Clin 2009;27 Suppl 1:48-53.

37. 1993 revised classification system for HIV infection and expanded surveillance case definition for AIDS among adolescents and adults. MMWR Recomm Rep 1992;41:1-19.

24. Everett CK, Fei MW, Huang L. Respiratory emergencies in HIV-infected persons. Emerg Med Clin North Am;28:283-98, Table of Contents.

38. Hammer SM, Eron JJ, Jr., Reiss P, et al. Antiretroviral treatment of adult HIV infection: 2008 recommendations of the International AIDS Society-USA panel. JAMA 2008;300:55570.

25. Sharma MP, Bhatia V. Abdominal tuberculosis. Indian J Med Res 2004;120:305-15. 26. Yoshida D, Caruso JM. Abdominal pain in the HIV infected patient. J Emerg Med 2002;23:111-6. 27. Takhar SS, Hendey GW. Orthopedic illnesses in patients with HIV. Emerg Med Clin North Am;28:335-42, Table of Contents. 28. Glesby MJ. Bone disorders in human immunodeficiency virus infection. Clin Infect Dis 2003;37 Suppl 2:S91-5. 29. Mondy K, Tebas P. Emerging bone problems in patients infected with human immunodeficiency virus. Clin Infect Dis 2003;36:S101-5. 34

39. Kaplan JE, Benson C, Holmes KH, Brooks JT, Pau A, Masur H. Guidelines for prevention and treatment of opportunistic infections in HIV-infected adults and adolescents: recommendations from CDC, the National Institutes of Health, and the HIV Medicine Association of the Infectious Diseases Society of America. MMWR Recomm Rep 2009;58:1-207; quiz CE1-4. 40. [2008 prevention of opportunistic infections in HIV-infected adolescents and adults guidelines. Recommendations of GESIDA/National AIDS Plan AIDS Study Group (GESIDA) and National AIDS Plan]. Enferm Infecc Microbiol Clin 2008;26:43764. 41. Reynolds NR. Cigarette smoking and HIV: more evidence Revista Medicina Vol. 9 No. 1 Control del adulto infectado por el virus de la inmunodeficiencia humana (VIH) PĂĄg. 7 de 8


Control del adulto infectado por el virus de la inmunodeficiencia humana (VIH)

for action. AIDS Educ Prev 2009;21:106-21. 42. Marshall MM, McCormack MC, Kirk GD. Effect of cigarette smoking on HIV acquisition, progression, and mortality. AIDS Educ Prev 2009;21:28-39.

ArtĂ­culo

54. Schneider J, Kaplan SH, Greenfield S, Li W, Wilson IB. Better physician-patient relationships are associated with higher reported adherence to antiretroviral therapy in patients with HIV infection. J Gen Intern Med 2004;19:1096-103.

43. Manavi K. A review on infection with human immunodeficiency virus. Best Pract Res Clin Obstet Gynaecol 2006;20:923-40. 44. Moodley J, Moodley D. Management of human immunodeficiency virus infection in pregnancy. Best Pract Res Clin Obstet Gynaecol 2005;19:169-83. 45. Mofenson LM, Lambert JS, Stiehm ER, et al. Risk factors for perinatal transmission of human immunodeficiency virus type 1 in women treated with zidovudine. Pediatric AIDS Clinical Trials Group Study 185 Team. N Engl J Med 1999;341:385-93. 46. Achievements in public health. Reduction in perinatal transmission of HIV infection--United States, 1985-2005. MMWR Morb Mortal Wkly Rep 2006;55:592-7. 47. Anderson BL, Cu-Uvin S. Pregnancy and optimal care of HIV-infected patients. Clin Infect Dis 2009;48:449-55. 48. Garcia PM, Kalish LA, Pitt J, et al. Maternal levels of plasma human immunodeficiency virus type 1 RNA and the risk of perinatal transmission. Women and Infants Transmission Study Group. N Engl J Med 1999;341:394-402. 49. Paterson DL, Swindells S, Mohr J, et al. Adherence to protease inhibitor therapy and outcomes in patients with HIV infection. Ann Intern Med 2000;133:21-30. 50. Nachega JB, Hislop M, Dowdy DW, Chaisson RE, Regensberg L, Maartens G. Adherence to nonnucleoside reverse transcriptase inhibitor-based HIV therapy and virologic outcomes. Ann Intern Med 2007;146:564-73. 51. Lucas GM, Chaisson RE, Moore RD. Highly active antiretroviral therapy in a large urban clinic: risk factors for virologic failure and adverse drug reactions. Ann Intern Med 1999;131:81-7. 52. Paredes R, Mocroft A, Kirk O, et al. Predictors of virological success and ensuing failure in HIV-positive patients starting highly active antiretroviral therapy in Europe: results from the EuroSIDA study. Arch Intern Med 2000;160:1123-32. 53. Mugavero MJ, Lin HY, Willig JH, et al. Missed visits and mortality among patients establishing initial outpatient HIV treatment. Clin Infect Dis 2009;48:248-56.

35

Revista Medicina Vol. 9 No. 1 Control del adulto infectado por el virus de la inmunodeficiencia humana (VIH) PĂĄg. 8 de 8


Vol. 9 No. 1, 2010 (Enero - Junio)

Revista Medicina

Actualización en medicina basada en evidencias (MBE) Update on evidence based medicine (EBM) Dr. Humberto González Calderín Pediatra Profesor de Pediatría Universidad del Sinú Montería, Colombia e-mail: hogoca2005@hotmail.com

Resumen En buena parte, el conocimiento y la práctica de la medicina se desprenden de los trabajos de investigación provenientes, en la mayoría de los casos, de países anglosajones. Particularmente en Latinoamérica, donde la realidad epidemiológica y socioeconómica es diferente, nos obliga a conocer algunos requisitos mínimos de validez que se le exigen a los estudios en investigación clínica, de pruebas diagnósticas, de etiología o causalidad, de evolución y pronóstico, y de ensayos terapéuticos. De tal forma que, cuando revisemos los artículos de los estudios, analicemos con criterio propio las conclusiones que nos muestran los investigadores. Desde la década del noventa, la Medicina Basada en Evidencias (MBE) ha aprovechado el conocimiento científico y la habilidad clínica del médico para ponerse al servicio del paciente, de una forma honesta, sensata y óptima. Palabras clave: MBE, diseños, diagnóstico, etiología-causalidad, evolución-pronóstico, terapia. Summary In most cases, knowledge and medical practice comes from investigation works in Anglo-Saxon countries. However, in Latin-America, the epidemiological and socioeconomic reality is different. For that reason, it is mandatory to know some of the minimal requirements of validity that demands studies in clinical investigation, diagnostic, etiology, causality tests, evolution, forecast, and therapeutic essays. Every time studies articles are checked, they must be analyzed with a particular criterion, specially the different conclusions shown by investigators. Since the 1990's, the Evidence-Based Medicine (EBM) has taken advantage of the scientific knowledge, and the doctor clinic ability to provide the best service possible in a very honest, sensible, and ideal way. Key Words: EBM, designs, diagnosis, etiology - causality, evolution - forecast, therapy.

El surgimiento de la MBE está fuertemente ligado a un clínico y epidemiólogo británico, el doctor Archie Cochrane, que en 1972 publica el libro "Effectiveness and eficiency: random reflections on the health services" (Efectividad y eficiencia: reflexiones al azar sobre los servicios sanitarios), donde defendió la idea de justificar la eficacia de las intervenciones aplicadas, a partir de la cual surge la propuesta de utilizar los ensayos clínicos aleatorios como base sobre la que se apoyan las decisiones clínicas. El término de “Evidence based medicine” fue acuñado en Canadá en los años 80 para describir la estrategia de aprendizaje utilizada en la Mc Master Medical School, en 36

Recibido para publicación el 27 de mayo de 2010 Aceptado el 15 de Junio de 2010

la que se subraya la importancia de la revisión de las pruebas procedentes de la investigación, y de la interpretación cautelosa de la información clínica derivada de observaciones no sistemáticas. El concepto de “Evidence based medicine”, traducido al castellano como 'medicina basada en la evidencia o en pruebas', se dio a conocer en el año 1991 a través de un editorial en la revista ACP (American College of Physicians) Journal Club, que empezó a publicar resúmenes estructurados de estudios relevantes. Su difusión se amplió con un artículo en JAMA, en el año 1992, por un grupo de internistas y epidemiólogos clínicos, liderado por David Sackett y Gordon Guyatt, vinculados a la citada universidad canadiense. Revista Medicina Vol. 9 No. 1 Actualización en medicina basada en evidencias (mbe) Pág. 1 de 17


Actualización en medicina basada en evidencias

Probablemente no tenga ningún sentido, a día de hoy, plantearse la MEDICINA como un dilema entre ciencia y arte. Puede interpretarse como una tecnología, usuaria del conocimiento científico. Decir que la medicina debe ser científica es la calificación más acertada y la que más se ajusta a lo que intuitiva y clásicamente hemos conocido por "buena medicina". Es científica aquella disciplina que somete sus postulados al método científico, a un proceso de verificación empírica, es decir, basado en los hechos o pruebas, es reproducible. La práctica clínica supone tomar decisiones constantemente, dar consejos y hacer recomendaciones, raras veces con absoluta certeza; convivimos a diario con la incertidumbre. Y ¿qué ocurre con los conocimientos adquiridos durante nuestra formación? No sólo su vigencia, sino también la de la información contenida en los libros de texto, son cuestionables al cabo de un tiempo. La cantidad de publicaciones y fuentes de información es enorme; y nuestro tiempo, conocimientos y medios para localizar, leer, interpretar y asimilar lo publicado no son suficientes. Se publican más de 10,000 ensayos clínicos randomizados cada año. En un artículo publicado en JAMA en el año 2001 se detalla el cálculo de lo que un internista necesitaría leer para mantener su conocimiento, 20 artículos diarios, ¡todos los días del año!. Se asume que los resultados de la investigación se difunden de forma cercana al clínico, y que éste tiene acceso fácil y regular a esta información, además de poseer los conocimientos y capacitación para interpretarla y hacer una valoración crítica sobre ella. Sin embargo, a diario comprobamos que la bibliografía médica todavía no está muy bien organizada y accesible para la toma de decisiones. En este contexto, el principal valor de la MBE es el de ser una herramienta que trata de cuantificar y calificar qué dato o qué estudio tiene mayor validez; una herramienta que nos aclara la mejor forma de usar y aplicar “la evidencia”, facilitando su traslación a la práctica. Por eso, si el médico no está preparado para discernir con juicio crítico la veracidad de las conclusiones que encuentra o plantea, puede llegar a suponer que la última publicación es la mejor y la más actualizada. Así las cosas, “La MBE es la integración de las mejores evidencias de la investigación, la experiencia clínica y los valores del paciente”

37

Artículo

Las mejores evidencias se refieren a la investigación clínica relacionada con la exactitud y precisión de las pruebas diagnósticas (incluyendo la exploración clínica), el poder de los marcadores pronósticos, y la eficacia y seguridad de las pautas terapéuticas, rehabilitadoras y preventivas. La experiencia clínica del médico se utiliza para identificar el estado de salud y el diagnóstico específico de cada paciente. Los valores del paciente son las preferencias, preocupaciones y expectativas de cada uno de ellos. Cuando estos 3 elementos se unen, los clínicos y los pacientes forman una alianza diagnóstica y terapéutica que optimiza los resultados clínicos y la calidad de vida. Para cumplir con el objetivo de la MBE, es necesario hacer un Análisis Sistemático de la Literatura Médica clínica (ASLM), lo cual implica: 1. Identificar una duda del conocimiento que tiene el clínico ante un paciente determinado. 2. Transformar la duda en una pregunta precisa, susceptible de responder. 3. Buscar artículos primarios y secundarios, que puedan responder la pregunta: lo más al día y conveniente para el paciente. 4. Escrutar el resultado de la búsqueda, eliminando rápidamente los artículos con fallas metodológicas que invaliden sus conclusiones y quedarse con los artículos de donde se pueda extraer la respuesta al problema. 5. Evaluar si los resultados obtenidos son aplicables al paciente en cuestión, teniendo en cuenta su realidad clínico-epidemiológica y socio-afectiva. Satisfacer la mejor evidencia sobre un trastorno clínico particular respecto a su diagnóstico, causa, pronóstico, prevención o tratamiento, significa que debemos conocer las bases de los estudios en investigación clínica. Sin embargo, el uso del ASLM y la práctica de la MBE son inútiles y peligrosas, si al enfrentar al paciente no se comienza con una buena historia clínica. Son cuatro las intervenciones en investigación clínica, a saber: * Pruebas diagnósticas. * Etiología o causalidad. * Evolución y pronóstico. * Ensayos terapéuticos o de Terapia Revista Medicina Vol. 9 No. 1 Actualización en medicina basada en evidencias (mbe) Pág. 2 de 17


Actualización en medicina basada en evidencias

PRUEBAS DIAGNÓSTICAS “Los puntos clave de la historia y examen físico, en la mayoría de los trastornos específicos, son mamuts (personajes principales) y aquellos derivados de la mayoría de las excursiones basadas en alta tecnología, son enanos (personajes del coro)”. (Sackett DL. Clinical Epidemiology. Little, Brown & Co. Boston, 1985. p 119). Son los estudios que tratan de establecer la capacidad que tiene una prueba diagnóstica de identificar sanos y enfermos en un grupo de pacientes con sospecha de una enfermedad. Las pruebas diagnósticas son los instrumentos que nos permiten resolver la incertidumbre sobre la condición de salud de un paciente. La mayor ayuda que nos aporta una prueba es cuando la duda diagnóstica es o está cercana al 50% en un paciente, en el que dos entidades se presentan de manera semejante. Pero, cuando la duda la resuelve la historia clínica, las pruebas diagnósticas resultan innecesarias la mayoría de las veces. Además, sirven para evaluar terapias, como el examen del líquido cefalorraquídeo en el tratamiento de la meningitis purulenta, para establecer pronóstico como el ecocardiograma que valora las arterias coronarias en la enfermedad de Kawasaki, y para tamizaje como la prueba VDRL en la detección de la sífilis prenatal. El problema a resolver es, si los resultados de una prueba concuerdan o no con el estado real del paciente, o sea, cuál es la probabilidad de acierto de dichos resultados. Las características de una prueba diagnóstica perfecta (hipotética) serían: * Que identifique con resultado positivo todos los casos en que la enfermedad en cuestión esté presente. * Que identifique con resultado negativo todos los casos en los que la enfermedad esté ausente. Como no hay pruebas perfectas (a lo sumo el patrón estándar), existe un margen de error propio de cada una, por lo que es necesario tener en cuenta los conceptos relacionados con las propiedades de una prueba diagnóstica, a saber: índices fijos (sensibilidad y especificidad) e índices variables (valor predictivo positivo y valor predictivo negativo). Sensibilidad (S): Mide la probabilidad de que la prueba 38

Artículo

resulte positiva cuando la enfermedad existe. Es decir, si la afección está presente, ¿que tan frecuente (en porcentaje, %) es anormal el examen? Un resultado positivo (anormal) en todos los pacientes con una enfermedad tendría una sensibilidad perfecta del 100% para descubrir a un enfermo, o sea, tal prueba no da falsos negativos. Por lo tanto, si el examen es negativo (normal) significa que el paciente no sufre la enfermedad. La proporción de falsos negativos de un examen es el complemento de su sensibilidad. Matemáticamente es la proporción de casos con el trastorno en los que la prueba resulta positiva. Se expresa, entonces, como a / (a+c). Especificidad (E): Mide la probabilidad de que la prueba resulte negativa cuando la enfermedad no existe. Es decir, si la afección está ausente, ¿que tan frecuente (en porcentaje, %) es normal el examen? Un resultado negativo (normal) en todos los pacientes que no tienen una enfermedad tendría una especificidad perfecta del 100% para confirmar un sano, o lo que es igual, esa prueba no da falsos positivos. Por lo tanto, si el resultado es positivo (anormal) confirmará que existe la enfermedad. La proporción de falsos positivos es el complemento de la especificidad de una prueba. Matemáticamente es la proporción de casos sin el trastorno en que la prueba resulta negativa. Se expresa como d / (b+d). La S y la E se basan sobre el total de los pacientes. Valor predictivo positivo (VPP): Representa la probabilidad que tiene el paciente de padecer la enfermedad si el resultado de la prueba es positivo. Es decir, si es anormal el examen, ¿que tan frecuente (en porcentaje, %) está presente la afección?. O lo que es lo mismo, cuán probable es que un caso con la prueba diagnóstica positiva realmente tenga el trastorno. Se expresa como a/(a+b). Valor predictivo negativo (VPN): Expresa la probabilidad que el paciente tiene de estar libre de la enfermedad si el resultado de la prueba es normal. O sea, si es normal el examen, que tan frecuente (en porcentaje, %) está ausente la afección?. Dicho de otra manera, señala la probabilidad que un caso con la prueba negativa se encuentre realmente libre del trastorno en estudio. Corresponde a: d / (c+d). El VPP y el VPN se basan sobre el total de exámenes ordenados. Revista Medicina Vol. 9 No. 1 Actualización en medicina basada en evidencias (mbe) Pág. 3 de 17


Artículo

Actualización en medicina basada en evidencias

En las enfermedades es más grave no tratar los enfermos (falsos negativos) que tratar algunos sanos (falsos positivos), por lo que es deseable que las pruebas tengan máxima S y máximo VPN (ideal 100%). La E y el VPP se pueden tolerar más bajos por el menor riesgo que

representa tratar los falsos positivos. Una prueba diagnóstica debe permitir obtener estos índices, a partir de una tabla de 2x2:

Enfermedad S: a/a+c

Presente Ausente Positiva Prueba

a

b

E: d/b+d

a+b

VPP: a/a+b Negativa

c a+c

a: número de casos con la enfermedad en prueba es positiva (verdaderos positivos). b: número de casos sin la enfermedad en prueba es positiva (falsos positivos). c: número de casos con la enfermedad en prueba es negativa (falsos negativos). d: número de casos sin la enfermedad en prueba es negativa (verdaderos negativos).

d b+d quienes la quienes la quienes la quienes la

Que la sensibilidad y especificidad de una prueba diagnóstica sean llamadas índices fijos, significa que esos valores no varían y le son propios de la experiencia de donde se originan, y a partir de la cual se pueden hacer inferencias de los resultados al aplicar dicha prueba a un paciente. Los valores de sensibilidad y especificidad varían en forma inversa: mientras más sensible una prueba, menor su especificidad, y viceversa. Desde un punto de vista clínico, los valores predictivos de una prueba diagnóstica son sus atributos más importantes. Los valores obtenidos corresponden a la prueba experimental, es decir, de la proporción de enfermos con la entidad de interés presentes en el grupo total de pacientes en los que se hizo dicha prueba. Son llamados variables porque dependen de la prevalencia de la enfermedad en la zona demográfica donde se apliquen los resultados. Cuando la prevalencia es baja, el VPP es menor y aumenta el VPN, y viceversa. Por lo tanto, los valores predictivos derivados de un estudio no son 39

c+d VPN: d/c+d a+c+b+d(N)

Prevalencia (Pr): a+c/N

aplicables a otros pacientes, sino a los que aparecen “en las condiciones del estudio probatorio”. Los cambios en la prevalencia dependen de a) la proporción de enfermos con una condición “x” en una población determinada, y muy especialmente de b) el conjunto de circunstancias clínico-epidemiológicas de cada paciente (historia clínica y, ocasionalmente, otras pruebas realizadas previamente al paciente). CRITERIOS DE VALIDEZ 1. Existencia de un estándar diagnóstico ideal o gold estándar explícito y confiable. 2. Comparación independiente y ciega con el gold estándar. 3. Espectro clínico de la enfermedad y su alternativa. 4. Sitio de la experiencia y referencia de los pacientes. 5. Reproducibilidad del resultado de la prueba y su interpretación. 6. Utilidad de la prueba. 7. Medida de los resultados. 1) Estándar diagnóstico ideal Los resultados de una prueba que se estudia deben ser comparados con un gold estándar o patrón de certeza, que sirva de referencia para apoyar las inferencias derivadas de dichos resultados. El patrón de certeza Revista Medicina Vol. 9 No. 1 Actualización en medicina basada en evidencias (mbe) Pág. 4 de 17


Actualización en medicina basada en evidencias

indica un diagnóstico definitivo obtenido por biopsia, cirugía, autopsia, hallazgo clínico, seguimiento prolongado u otro estándar reconocido. En el artículo debe aparecer explícito, y no dejarlo a la imaginación del lector. Si el patrón no parece confiable y no lo aceptamos dentro de lo razonable, hay que dudar de él y no merece ser reconocido, puesto que la nueva prueba será completamente inadecuada si no se tiene certeza de la presencia o ausencia de la enfermedad; por lo tanto, el artículo que lo propone no servirá a nuestros propósitos y debemos desecharlo. 2) Comparación independiente y ciega con gold estándar Los resultados de una prueba no deben condicionar la realización de la otra (independiente) y que la interpretación de cada una de las pruebas se haya hecho desconociendo los resultados de la otra (ciega). Si se hace conociendo el resultado de la otra es imposible descartar la presencia de sesgos en la misma (sesgos de sospecha diagnóstica). En un estudio en el que se compara la utilidad del diagnóstico de la ecografía de la mama en relación con la tomografía: ¿hará el radiólogo la misma valoración si desconoce el resultado de la tomografía, que si sabe que ésta diagnosticó cáncer?. Por eso, es necesario que los pacientes del estudio sean sometidos tanto a la prueba diagnóstica en cuestión, como al estándar de referencia, y los resultados de uno no deben ser conocidos por las personas que están solicitando e interpretando el otro. Así, se evitaría que los investigadores, consciente o inconscientemente, “sobreestimen” el estándar de referencia cuando la prueba diagnóstica es positiva y lo “subestimen” cuando es negativa. Es decir, si quien hace la prueba conoce el estado del paciente, puede corregir los resultados al término del análisis, porque sabe el beneficio de aplicar el patrón de certeza según convenga a la hipótesis en cuestión. Los autores tienden a eludir que el resultado sea lo contrario (un fracaso) de lo que quieren demostrar; sin embargo, que la prueba “no sirva” puede ser más importante que la intención inicial. 3) Espectro clínico de la enfermedad y su alternativa ¿Incluyó el informe a pacientes que poseen todas las presentaciones comunes del trastorno designado, y a pacientes con otros diagnósticos que suelen confundirse? Los estudios que se limitan a los casos típicos de enfermedades frente a voluntarios asintomáticos no son muy informativos, ya que cuando el diagnóstico es obvio no necesitamos ninguna prueba 40

Artículo

diagnóstica; las pruebas diagnósticas son de mayor utilidad cuanto más precozmente puedan identificar ó descartar la presencia de una alteración. Los artículos útiles son los que presentan pruebas diagnósticas aplicadas a pacientes con un espectro clínico amplio de la enfermedad, formas leves, graves, precoces, avanzadas, y con individuos tratados y no tratados, en quienes la prueba demuestre capacidad para detectarlos. Si se incluyen formas graves de la enfermedad, puede mostrar resultados sobrestimados, pero si son menos graves o poco características, no permitirá conocer las propiedades reales de la prueba. 4) Sitio de la experiencia y referencia de los pacientes Es necesario describir el sitio donde se llevó a cabo el estudio y los mecanismos de referencia de los pacientes, porque influyen sobre el espectro clínico y la prevalencia de la enfermedad. Es claro que los resultados de una prueba obtenidos solo de pacientes de la población general, o exclusivamente de un centro especializado, no hablan de sus bondades por la evidencia del sesgo. Asimismo, como la prevalencia cambia los valores predictivos, el artículo debe permitir el cálculo de los índices variables entre sus propios pacientes. 5) Reproducibilidad del resultado de la prueba (precisión) y su interpretación (variación del observador) Hay que hacer una adecuada descripción de la prueba para permitir su reproducibilidad. Este tópico es importante para posteriormente evaluar su aplicabilidad en el entorno clínico del lector, su reproducibilidad. Aspectos que deben figurar en un artículo: * Preparación del paciente. * Entrenamiento del profesional. Se requiere experiencia. * Variabilidad ínter observador en pruebas que requieren una interpretación. Por ejemplo, la ejecución de un ultrasonido exhibe una variación enorme en la calidad de sus resultados cuando lo efectúan diferentes operadores. La presencia de un solo operador u observador es muy subjetiva y no da garantías, se recomienda la apreciación de 2 personas independientes y estudiar la concordancia entre ambas (medición de error o variación interobservador); en el peor de los casos, puede medirse el grado de concordancia del operador consigo mismo (variación intraobservador). * Descripción detallada de cómo se realiza la prueba. (ej:¿cuánto tiempo debe estar la sangre en contacto con Revista Medicina Vol. 9 No. 1 Actualización en medicina basada en evidencias (mbe) Pág. 5 de 17


Artículo

Actualización en medicina basada en evidencias

la tira reactiva en un nuevo dispositivo que mide glucemia capilar?). Esta información caracteriza la prueba y nos permite decidir sobre si es adecuado adoptarla para nuestros pacientes y en nuestro medio. 6) Utilidad de la prueba Hay que evaluar si los resultados de la nueva prueba diagnóstica poseen utilidad clínica (algunas sólo tienen y explican mecanismos intrínsecos de un fenómeno fisiopatogénico, como ocurre con algunos reactantes de fase aguda) y ventajas sobre los métodos diagnósticos que pretende reemplazar o complementar, y si tiene algo más que ofrecer, como ser más segura, más fácil, más rápida, más barata y menos dolorosa o molesta para el paciente. Para que los resultados de un artículo sean útiles a nuestros pacientes, debe examinarse en qué medida ellos calzan con la población descrita en la prueba bajo análisis. Utilizar una prueba diagnóstica sólo porque es nueva, es jactancioso e irracional. 7) Medida de los resultados Los resultados de estos estudios se miden con la sensibilidad y especificidad, y con los valores predictivos. La precisión de esas proporciones se hace construyendo sus intervalos de confianza del 95%.

causas de un efecto clínico-epidemiológico, y aunque no logre conocer el mecanismo (causa) de cierta condición, por lo menos permite acciones tendientes a detectar y, a veces, a controlar el problema en cuestión. Los estudios clínicos en los que el investigador recoge datos mediante simple observación de los hechos a medida que suceden, sin tener parte activa en ellos, se llaman diseños observacionales, y pueden ser descriptivos o analíticos. Por el contrario, en los diseños experimentales el investigador determina quién se expone y quién no. Los observacionales pueden ser la única manera factible de estudiar la mayoría de las preguntas sobre riesgo, pues en muchos casos no es posible llevar a cabo un experimento en el que se asigne de forma aleatoria a cada grupo para que unos se sometan a un riesgo y otros no, o administrar o no un tratamiento, pues resultaría éticamente inaceptable. Diseños para estudiar etiología: Informe de casos Descriptivos 1) Observacionales

Serie de casos Cohortes Analíticos

ETIOLOGÍA O CAUSALIDAD Son los estudios clínicos que establecen una asociación entre uno o más factores de exposición y un efecto o enfermedad en el individuo o en la población. La determinante de un efecto rara vez es única o monofactorial, como sucede con la enfermedad, la cual es la resultante de la interacción entre el individuo, el agente y el medio. Consecuentemente, estos estudios están dirigidos a identificar factores concurrentes como

41

Casos y controles

2) Experimentales: Ensayo clínico controlado La confiabilidad, la solidez y la dificultad para elaborar estos diseños aumentan en orden ascendente desde el informe de casos hacia el ensayo clínico controlado. Características generales

DISEÑO

PUNTO DE PARTIDA

EVALUACIÓN

Caso control Cohortes Ensayo clínico controlado

Efecto Exposición Exposición

Exposición Efecto Efecto

Revista Medicina Vol. 9 No. 1 Actualización en medicina basada en evidencias (mbe) Pág. 6 de 17


Actualización en medicina basada en evidencias

Informe y serie de casos Son los estudios más simples en la investigación clínica. Sólo se limitan a describir casos raros y formas de presentación infrecuentes de enfermedades, y efectos secundarios de una droga o de un tratamiento no farmacológico. La información es retrospectiva y su fortaleza como diseño es pobre, entre otras cosas porque no tiene grupo control, y no podemos sacar conclusiones válidas puesto que los resultados no establecen si el evento ocurre con más frecuencia de lo que podría esperarse solamente por efecto del azar. Además, no permiten establecer relaciones causales porque no es posible conocer si la probable causa apareció antes que el efecto; y por otra parte, la recolección de los datos está expuesta a múltiples sesgos. Sin embargo, pueden ser útiles como fuente de hipótesis para estudios futuros, y sirven como encuesta de prevalencia de un grupo de individuos con una enfermedad determinada, realizada en un momento único en el tiempo. Estudio de casos y controles El diseño se hace a partir del efecto y se evalúa la exposición (retrospectivo). Consiste en reunir un grupo de “casos” que son personas con el diagnóstico de la enfermedad, y otro de “controles” que no la tienen, pero son similares al de los casos (edad, enfermedades concomitantes, etc.,) y en lo posible diferir sólo en el diagnóstico. Ambos grupos son interrogados o sus historias clínicas examinadas sobre si recibieron o no el tratamiento de interés o estuvieron expuestos al factor de riesgo en estudio. Si los pacientes con el resultado adverso tuvieron mayor probabilidad de haber recibido el tratamiento o haber estado expuestos, constituye una posibilidad, aunque no muy fuerte, de que la exposición pudo causar o al menos precipitar el efecto. Matemáticamente se puede expresar como la probabilidad de ocurrencia del factor de exposición, dado el efecto: P (F/E) El carácter retrospectivo del estudio lo hace vulnerable a los sesgos porque al recolectar los datos, éstos ya han sido definidos, medidos y registrados (u omitidos) por terceros, y por lo tanto, no permite medir el factor de riesgo, ni tampoco la proporción del efecto producido por la exposición (incidencia). Sin embargo, son los diseños descriptivos más populares. Primero, porque son económicos y fáciles de llevar acabo (de grandes bases 42

Artículo

de datos computarizados se pueden reunir muchos pacientes), y segundo porque constituyen el único método real para estudiar enfermedades poco frecuentes, y efectos raros y tardíos de drogas o de otros tratamientos, ya que prospectivamente tomarían demasiado tiempo. Estudios de cohortes El diseño parte de la exposición y se evalúa el efecto (prospectivo). Este método identifica dos grupos (o cohortes) de pacientes, uno que recibe y otro que no recibe el tratamiento o factor de riesgo de interés. Luego, se siguen hacia adelante en el tiempo, contabilizando los eventos adversos que ocurrieron en cada uno de los grupos. También se puede expresar como la probabilidad de ocurrencia del efecto, dado el factor de exposición: P (E/F). Teniendo en cuenta la relación causa efecto, las cohortes pueden ser prospectivas como ya se describió, e históricas como las que se hacen con base en hechos históricos (no por ello “retrospectivo”), identificándose mediante registros pasados y posteriormente, se siguen en el tiempo (ej: secuelas en las gónadas de adolescentes que recibieron radioterapia por leucemia en la primera infancia). Los estudios de cohortes tienen fortalezas y debilidades. Es un diseño poderoso pues los factores potencialmente causales son medidos antes de que ocurra el resultado. Da la oportunidad de medir variables importantes de forma completa y segura, y la incidencia (efecto). La información así recogida, suele ser más confiable que cuando se revisa una historia clínica o se interroga a personas, lo cual hace que las cohortes históricas sean menos sólidas que las prospectivas. En contra posee su costo elevado y largo seguimiento, y cuando se trata de eventos poco frecuentes los que se van a medir, el tamaño de la muestra sería más grande, haciéndolos costosos y difíciles. Ensayos clínicos controlados Es el estudio que cumple casi todos los requisitos de la relación causa-efecto y proporciona las evidencias más sólidas. Pero por razones éticas para establecer esa relación, salvo con fines terapéuticos, no puede llevarse a cabo. Además, si el evento a valorar es de baja incidencia, se necesitarían muchos pacientes en ambos grupos para detectar diferencias significativas, y son Revista Medicina Vol. 9 No. 1 Actualización en medicina basada en evidencias (mbe) Pág. 7 de 17


Actualización en medicina basada en evidencias

costosos. Por esas buenas razones, se recurre a otros tipos de diseños.

Artículo

El principal obstáculo para la conformación de grupos comparables son los sesgos. Los hay innumerables, entre otros:

CRITERIOS DE VALIDEZ 1) 2) 3) 4)

Identificación de la hipótesis y del diseño Comparabilidad de los grupo Seguimiento de los pacientes Definición correcta de los casos y de los controles 5) Medida de los resultados 1) Identificación de la hipótesis y del diseño Lo primero es identificar una hipótesis y luego de qué diseño se trata. En los casos de cohortes, como en todos los inferenciales, siempre debe existir una o más hipótesis, pues no se concibe seguir un grupo de individuos sin indicar para qué. Si está clara una exposición, pero no se sabe cuál será la incidencia del efecto (por ejemplo, secuelas), se trata de un diseño de cohortes (o un ensayo clínico controlado). Los casos y controles exigen una pregunta o una hipótesis central. Si está claro que hay un efecto o consecuencia, y se buscan posibles factores causales, se trata de un diseño de casos y controles. De no ser así, se incurre en las llamadas “expediciones de pesca”, en que se busca “a ciegas” explicación a asociaciones halladas por casualidad en el análisis y que no son resultado de hipótesis verosímiles hechas de antemano. Si aparece alguna asociación, debe considerarse secundario al mero azar. 2) Comparabilidad de los grupos La construcción de un diseño en el que se comparan dos grupos para buscar diferencias específicas entre ellos, está sujeta a numerosos sesgos. Un principio útil al respecto, es considerar que los individuos con cierta característica difieren de los que no la tienen; aunque ello parezca obvio, de lo que se trata es reunir dos cohortes (grupos) para medir sus diferencias hipotéticas alrededor de un factor de interés, una de las cuales ha estado expuesta y la otra no. Por lo tanto, es necesario que los grupos sean comparables, si no lo son, los resultados pueden ser contradictorios, como por ejemplo, que en los no expuestos el daño o efecto valorado sea mayor que en los expuestos. 43

- De voluntariado. Son los individuos que acuden por información a través de los medios de comunicación o que visitan regularmente a controles médicos. - De accesos a servicios de salud. Los que viven cerca de los centros de atención o los que cuenten con derecho a los servicios, tienen mayor oportunidad de hacer parte del estudio. - De selección. Hay tendencia a exponer (si es posible) o a administrar los tratamientos a los que tengan más probabilidad de mejorar (casos) y no lo hacen con los más graves (controles) dando consigo resultados hipertrofiados, lejos de la verdad. - De diagnóstico o pesquisa. Derivan de desconocer la historia natural de la enfermedad, al reunir un grupo de casos (enfermos) y se excluyen aquellos que han fallecido o tienen enfermedad muy leve o también, por inexactitudes en la definición y denominación de la enfermedad, se termina incluyendo o excluyendo erróneamente grupos de pacientes. 3) Seguimiento de los pacientes Es fundamental seguir a los pacientes hasta finalizar el estudio para registrar datos confiables. La pérdida de los pacientes del estudio hace dudar de las conclusiones, porque los perdidos pueden mostrar resultados muy diferentes de aquellos que permanecen en él. En los diseños de cohortes es fácil que se pierdan porque el seguimiento prospectivo, en algunos casos, es largo. Análogamente, puede ocurrir que en los de casos y controles, al elegir los casos, no se incluyan los que no aparecen en los registros hospitalarios, los que han muerto o, por tener enfermedad leve nunca han consultado al médico. 4) Definición correcta de los casos y de los controles El problema de lo incorrecto son los consecuentes sesgos y por supuesto, las conclusiones falsas. Una misma enfermedad puede ser llamada de modo diferente o, lo que es peor, enfermedades diferentes llamadas con el mismo nombre. Para evitarlo, es mejor utilizar las definiciones del código internacional de diagnósticos. Igualmente, se cometen errores con el origen de casos y controles, al comparar pacientes hospitalizados con Revista Medicina Vol. 9 No. 1 Actualización en medicina basada en evidencias (mbe) Pág. 8 de 17


Artículo

Actualización en medicina basada en evidencias

ambulatorios, pues sugieren diferencias que afectan el pronóstico.

El riesgo se expresa como la probabilidad de ocurrencia de un efecto adverso.

5) Medida de los resultados Los estadígrafos utilizados son los riesgos relativos o razones de riesgo.

Los estudios proporcionan una tabla de 2 x 2, que permite calcular los valores a partir de los integrantes de la muestra.

Efecto + + Exposición

Cohortes:

-

a/(a+b) a

b

RR: c/(c+d)

-

c

d

Caso control: axd OR: bxc

En los estudios de cohortes se usa el RR (riesgo relativo), y se define como el riesgo de ocurrencia de un evento o efecto (enfermedad) en los expuestos, comparado con los no expuestos. El valor basal de referencia del RR es de 1. Si es igual a 1, el efecto en los expuestos no es distinto del efecto del control. Para interpretarlo (en términos de efecto beneficioso ó dañino del tratamiento) hay que considerar la magnitud (cantidad absoluta) en relación al tipo de efecto (deseable ó adverso) que se está midiendo. Si el evento es deseable (curación, alivio del dolor, mejora calidad de vida ...) el RR > 1 el efecto es beneficioso y si es < 1 el efecto es perjudicial. Si el evento es adverso (muerte, IAM, ACV ...) el RR > 1 el efecto perjudicial y si es < 1 el efecto es beneficioso. En los de casos y controles, el OR (odds ratio o razón de disparidad. En español pudiese llamarse Oportunidad Relativa), y determina la probabilidad de haber estado expuesto quienes padecen el efecto (enfermedad), comparado con los que no lo padecen (sanos). El OR representa el cociente entre la probabilidad de que un episodio de interés ocurra y la probabilidad de que no ocurra. Es un valor que puede ser interpretado en el sentido de cuántas veces es mas probable ser un caso que un control cuando está presente el antecedente o exposición. Cuando está presente un antecedente (factor de exposición) que se cree relacionado con la patología 44

en estudio debería existir una relación casos/controles mayor que en su ausencia, de suerte que a/b > c/d. O sea que, la relación casos con exposición / casos sin exposición (a/c) se espera que sea mayor que la relación controles con exposición / controles sin exposición (b/d). Entonces, a/c > b/d , y (a/c)/(b/d) también es igual a ad/bc. Luego diríamos: Se espera que en los casos la exposición sea más común que en los controles. La precisión de las dos medidas debe enunciarse con sus respectivos intervalos de confianza del 95%. EVOLUCIÓN Y PRONÓSTICO El concepto evolución y pronóstico se refiere a los posibles desenlaces que una enfermedad puede tener durante su curso y la frecuencia con que ellos podrían ocurrir, incluyendo la muerte. Nos facilita cómo calcular la probable evolución clínica de un paciente, anticipar las posibles complicaciones de su enfermedad y conocer el poder de los marcadores pronósticos. Los factores pronósticos necesariamente no causan el desenlace, sino que se asocian a éste de manera fuerte, como para predecir su ocurrencia. A diferencia de los factores de riesgo, que sí están relacionados directamente con el desarrollo de la enfermedad. Se trata pues, de predecir la evolución de determinada condición, Revista Medicina Vol. 9 No. 1 Actualización en medicina basada en evidencias (mbe) Pág. 9 de 17


Actualización en medicina basada en evidencias

a la cual el médico está enfrentado a responder. Usualmente, éstos estudios se hacen con una cohorte (grupo de individuos) cuando el evento que se mide es poco frecuente en la población general o es muy propio de la enfermedad (sordera post-meningitis o falla renal en diabetes), y cuando el evento es frecuente, se toman dos cohortes, una con la enfermedad de interés y otra “testigo” de la población general de la misma edad y con características semejantes. CRITERIOS DE VALIDEZ 1) 2) 3) 4) 5) 6) 7)

Cohorte incipiente Descripción del patrón de referencia Seguimiento completo de los pacientes Criterios objetivos para los resultados Evaluación ciega de los resultados Ajuste para factores extrínsecos Medida de los resultados

1) Cohorte incipiente El estudio debe comenzar de una “cohorte incipiente”, con el mismo diagnóstico, en el mismo momento evolutivo de la enfermedad y ésta, en sus etapas más tempranas, a partir de la cual se inicia el seguimiento para medir, por ejemplo, el tiempo transcurrido hasta aparecer o no, un evento indeseado. 2) Descripción del patrón de referencia (selección de los pacientes) Las vías por donde ingresan los pacientes al estudio deben ser descritas. ¿Provenían de centros de atención primaria (enfermos no complicados) o de uno de mayor complejidad (enfermos desahuciados y complejos)? Esta aclaración nos revela que los pronósticos no son los mismos. Y es allí, donde tropiezan los estudios del curso y pronóstico de la enfermedad, y el motivo por el cual cobran importancia los sesgos para la elección y derivación de los pacientes. Son varias las situaciones que se propician: * Si los integrantes de la muestra son de centros “especializados”, aumentan las probabilidades de desenlaces adversos o desfavorables, dada las formas graves o poco comunes de la enfermedad que caracterizan a ese grupo de pacientes. Ejemplo: la recurrencia de convulsión no febril en niños con una primera convulsión febril, resulta considerablemente más alta en pacientes de centros especializados, que en los 45

Recibido para publicación el 10 de junio de 2009 Aceptado el 19 de junio de 2009

Artículo

de la población general. * A veces, se “filtran” pacientes en razón a intereses específicos del grupo investigador. * En ocasiones, no se describen pacientes que fallecieron o que emigraron a otra zona diferente a la de la investigación, y se pierden sin conocer su pronóstico. * Las determinaciones pronósticas derivadas de los ensayos terapéuticos controlados, no son los mejores puesto que el paciente ingresado no es representativo de la población general que sufre la enfermedad (los casos no son comparables a los controles). 3) Seguimiento completo de los pacientes Seguimiento completo significa que se pudo obtener la información necesaria en todos los pacientes con que se inició el estudio. Es importante porque los eventos de interés pronóstico pueden ocurrir muchos años después del comienzo de la enfermedad, sobre todo en las de evolución crónica. Los pacientes se pueden perder, por inasistencia a los controles citados, cambio de domicilio, razones económicas, mejor ofrecimiento de otro tratamiento, muerte, etc. Mientras más pacientes se pierdan, menos precisa es la estimación del factor pronóstico estudiado. Si la pérdida es de un 10% debe dudarse de los resultados y si es mayor del 20%, los invalida. En ese sentido, los eventos de baja ocurrencia son los más afectados. Cuando la pérdida de los pacientes cuestiona la validez del estudio, los autores deben dar cuenta de ello en detalle. Si lo hacen, y comparan algunas variables como las demográficas (edad, sexo, etc) y las clínicas, entre los pacientes que abandonaron y los seguidos completamente, y no aparecen diferencias importantes, se le puede dar valor al resultado, es decir, las razones de la desaparición no influyeron en el evento bajo análisis. Pero si no describen el abandono, la validez se debilitaría. 4) Criterios objetivos para los resultados Antes de comenzar el estudio, los investigadores deben hacer una definición clara, inequívoca y no sesgada del evento (variable) que van a medir para definir las variaciones del pronóstico. Las enfermedades afectan a los pacientes de formas diferentes, algunas fáciles de detectar como la muerte y la recuperación completa, y otras más sutiles como la gama que queda entre esos dos extremos. Por eso, los autores deben usar criterios diáfanos para decidir como contar o como confirmar los Revista Medicina Vol. 9 No. 1 Actualización en medicina basada en evidencias (mbe) Pág. 10 de 17


Artículo

Actualización en medicina basada en evidencias

resultados en los que estamos interesados, de modo que el lector sea capaz de relacionarlos con su propia práctica. 5) Evaluación ciega de los resultados El examen de los resultados pronósticos importantes debe ser realizado por médicos que desconozcan las características de los pacientes. Esto es esencial si se quieren evitar dos fuentes adicionales de sesgo. Primero, el médico que conoce a un paciente posee un factor pronóstico de presunta importancia, y puede llevar a cabo indagaciones más frecuentes o detalladas para el resultado pronóstico relevante (sesgo de sospecha clínica). Segundo, los encargados de interpretar los especímenes diagnósticos (patólogos, radiólogos, laboratoristas u otros), pueden tener sus juicios fuertemente influenciados por el conocimiento previo de las características clínicas del caso (sesgo de la expectativa). 6) Ajuste para factores extrínsecos Se trata de otros factores pronósticos importantes a tener en cuenta y que nos ayuden a predecir la evolución de una enfermedad. Cuando se ha establecido un cierto pronóstico, los investigadores están obligados a examinar las cohortes estudiadas para verificar su homogeneidad e identificar aspectos relevantes que puedan modificar tal pronóstico. Por ejemplo, la recurrencia de convulsión febril del 27% se modifica cuando se tienen en cuenta, la duración de la fiebre, la temperatura > de 38ºC, la edad > de 18 meses, los antecedentes personales y familiares de la enfermedad, etc.; o sea, además de los aspectos metodológicos para evitar sesgos, los artículos deben aportar datos para “personalizar” la información adecuándola a casos particulares. 7) Medidas de los resultados Se valora con el RR asociado, y significa el número de veces que el evento o desenlace ocurre, en comparación con el grupo control. Como esa medida sólo proporciona una estimación del riesgo verdadero, es necesario examinar su precisión, es decir, el intervalo de confianza con un 5% de probabilidad de error atribuible al azar o IC del 95%. TERAPIA Los estudios sobre terapia o ensayos terapéuticos están 46

hechos para averiguar los efectos curativos de las drogas, probar vacunas, y hacer programas de educación y prevención que modifiquen situaciones objetivas. Es el diseño más exigente con los requisitos técnicos y principios éticos, ya que aplica el modelo experimental en seres humanos, en oposición a los observacionales, donde el humano no es objeto de manipulación. Los “productos” (drogas, biológicos, procedimientos, etc.) llegan a nuestro conocimiento en 3 categorías: * Suficientemente probados y autorizados por organismos de salud del extranjero. * Ya utilizados e inadecuadamente estudiados en el exterior. * En fases experimentales previas a su autorización y uso en el extranjero. Así las cosas, el médico debe ser capaz de enfrentar la información con criterio propio y certero, antes de aplicarla en sus pacientes, puesto que estos no son necesariamente iguales al objeto del estudio en cuestión. El ensayo clínico controlado, aleatorio y doble ciego (randomized controlled trials), compara un tratamiento que mejora a un grupo de pacientes (control), con otro tratamiento, que se espera sea mejor en otro grupo comparable (grupo experimental). “Desde ya”, los artículos sobre terapia que no sean controlados deben ser descartados, excepto cuando aparezcan las primeras terapias para enfermedades 100% mortales, por ejemplo, la rabia. CRITERIOS DE VALIDEZ 1) 2) 3) 4) 5)

Hipótesis explícita y cuantificada Asignación de los pacientes al azar Seguimiento completo de los pacientes Independencia y doble ciego Medida de los resultados

1) Hipótesis explícita y cuantificada En estos estudios es conveniente prever los resultados de la experiencia que se va realizar en el contexto del “equipoise”(equidistancia o equiparidad), lo cual implica la existencia de una duda razonable alrededor del conocimiento previo del beneficio que se quiere demostrar. Por eso, es inconcebible comparar un tratamiento de efecto conocido, con otro cuyo efecto de antemano, se sabe que es mejor o peor. Revista Medicina Vol. 9 No. 1 Actualización en medicina basada en evidencias (mbe) Pág. 11 de 17


Actualización en medicina basada en evidencias

La hipótesis explícita debe contemplar: 1) El valor del efecto conocido de la intervención en vigencia o convencional o valor de la hipótesis nula Ho ó Po. 2) El valor presunto del efecto de la nueva intervención o valor de la hipótesis alternativa H1 ó P1, y que puede ser expresado como la diferencia entre Po y P1. Es frecuente que una diferencia de interés sea catalogada como superior a 10% y comúnmente, alrededor del 15%. Por ejemplo: la tasa de complicaciones de una enfermedad dado el tratamiento actual es del 30% (Po: 30%). El diseño debe contemplar que dicha tasa con el nuevo tratamiento será del 18% (P1:8%), lo cual se expresaría como la diferencia entre las dos proporciones 30 –18: 12%. 2) Asignación de los pacientes al azar Todo paciente que se incorpora al estudio debe tener la misma probabilidad conocida (teórica del 50%) de recibir uno u otro de los tratamientos a ser comparados. Se contemplan varias situaciones que conllevan a sesgos: * La voluntad y el criterio de los investigadores no debe influir en el ingreso de los pacientes, ya que si tienden a asignar los de mejor pronóstico al grupo que recibe la nueva terapia, el resultado sobrepasará su real eficacia. * Al comparar dos grupos, la única diferencia debe ser la terapia recibida, puesto que si existen factores diferentes que condicionan el pronóstico de los pacientes (llamados covariables, confundidores y covarianzas), como la edad, sexo, etapa de la enfermedad o su gravedad y las terapias previas, pueden influir a favor o en contra de una de las terapias en estudio. Entonces hay que recurrir al sistema del azar para garantizar que ambos grupos queden comparables por distribución balanceada de esos factores. * Los autores deben describir cómo fue hecha la aleatorización, y no sólo decir que la hubo. Es importante porque por ejemplo, el uso de los días pares, impares o de la semana, las letras del apellido, etc., son procedimientos riesgosos ya que tienden a “sistematizar” la aleatorización. Hay varias formas de realizar la mejor distribución al azar, y va desde lanzar una moneda al aire, hasta seguir el orden determinado por una serie de números aleatorios en un computador generado por un ordenador personal, ajeno al trabajo de investigación. * Debe aparecer una tabla donde se comparen las condiciones basales o iniciales de los grupos, es decir, un 47

Artículo

número razonable de variables que incluyan rasgos generales de la muestra (edad, sexo, peso, antecedentes etc.) y algunos “confundidores”. A la vez, no debe existir diferencias significativas (que no haya valor p<0,05) al comparar una variable entre los grupos (casos vs. controles). 3) Seguimiento completo de los pacientes Es conveniente que los pacientes incluidos en el estudio permanezcan en el grupo al que fueron asignados desde el inicio hasta el final, para que la confiabilidad de los resultados sea mayor. Pueden ocurrir 3 inconvenientes al respecto: 1) Pérdida de los pacientes. Ella pone en duda la validez del estudio. Así como el axioma general dice “los pacientes que se pierden difieren de los que no se pierden”, los perdidos tienen pronóstico diferente a los no perdidos, y pueden desaparecer porque sufrieron eventos adversos, porque se sintieron muy bien o por otras razones entendibles. Frente a la pérdida de pacientes, se puede minimizar el efecto que ello produce de la siguiente forma: En los estudios donde la nueva droga parece ser mejor que la vigente, suponer que los pacientes perdidos que pertenecen a la primera, evolucionaron mal, y los que pertenecen a la segunda, evolucionaron bien. Si la nueva droga sigue siendo mejor que la antigua, aún después de recalcular la diferencia del evento de interés entre los dos grupos, se puede decir que la pérdida de los pacientes no cambia las conclusiones, y la consideramos válida. Se concluye lo contrario si el procedimiento anula las diferencias entre los grupos, o peor, si invierte la relación entre ellos. 2) Migración de los pacientes de un grupo a otro (contaminación del estudio). Ocurre especialmente en ensayos hechos en pacientes ambulatorios, sobre los que se tiene poco control clínico. Es el caso de las personas que se inclinan por el aspecto del producto, color, sabor, vía de administración, etc., lo que hace que la diferencia entre los grupos, al examinar los resultados, tienda a desaparecer. Igual sucede con las “cointervenciones”, donde se incentivan a los casos y no a los controles para mantenerlos en el grupo, y así aumentar el efecto de la terapia; pero si es asignada al grupo control, disminuiría el efecto de la misma. 3) La exclusión del análisis de los pacientes (de casos Revista Medicina Vol. 9 No. 1 Actualización en medicina basada en evidencias (mbe) Pág. 12 de 17


Artículo

Actualización en medicina basada en evidencias

y de controles) que incumplen el tratamiento malogra los resultados. Ellos deben tenerse en cuenta en dicho análisis, porque la distribución al azar garantiza y mantiene las covariables como condicionantes pronósticas.

RR (riesgo relativo): probabilidad de ocurrencia de un evento en los expuestos, comparado con los no expuestos. Es el cociente entre el riesgo del grupo tratado y el riesgo del grupo control. Para una interpretación más fácil, se recomienda calcular el cociente entre el grupo de mayor riesgo y el de menor riesgo. RRR (reducción relativa de riesgo): Se calcula a partir del complemento del RR o también, dividiendo la reducción absoluta de riesgo y el riesgo en el grupo control, y se expresa en %. NNT (número necesario a tratar): Representa el número de pacientes que debería recibir el tratamiento experimental, en lugar del tratamiento control, para que un paciente adicional obtenga el beneficio (o de forma equivalente, evite el perjuicio si el episodio en estudio es adverso). Se calcula como el inverso de la RAR (1/RAR). Cuanto mayor sea el efecto del tratamiento menor será el NNT, un tratamiento con el que necesitamos tratar a 5 pacientes para salvar una vida es, en principio, mejor que otro con el que necesitemos tratar a 20.

4) Independencia y doble ciego La independencia se refiere a que, quien mide el efecto de la variable en comparación entre los tratamientos, no debe saber a cual de los dos grupos pertenece el paciente que está valorando. La condición doble ciego significa que ni el paciente, ni quien proporciona la droga, sabe cual de los productos está recibiendo cada individuo. 5) Medidas de los resultados Lo que se busca es establecer una asociación entre una intervención (nuevo tratamiento) y un resultado de beneficio, o lo que es lo mismo, una diferencia en el efecto de mejoría entre dos terapias. Los resultados del estudio pueden expresarse de varias maneras, entre otras: proporciones, porcentajes (proporción x 100) y riesgos relativos. Son más interesantes los riesgos relativos porque siguen el concepto de condicionalidad, comparando riesgos absolutos, y tiene la ventaja de expresar el efecto del tratamiento en unos términos que permiten fácilmente comparar sus ventajas con sus inconvenientes (efectos adversos, costos, etc.), de un modo muy cercano a la toma de decisiones clínicas. RA (riesgo absoluto): probabilidad de ocurrencia de un evento en los individuos expuestos. RAR (Reducción absoluta del riesgo): es la diferencia entre el riesgo absoluto del grupo control y el riesgo absoluto del grupo tratado. Su principal inconveniente es que se expresa con un número pequeño y da la impresión de que el efecto es poco.

A la hora de valorar la magnitud del efecto de un tratamiento, conviene tener muy presente el significado, ventajas e inconvenientes de cada una de estas medidas. En ese sentido, no hay que olvidar que las medidas relativas pueden hacernos sobreestimar los beneficios y las medidas absolutas (RAR Y NNT) nos ayudarán mejor a valorar la magnitud de los resultados. Las medidas se ilustran en el siguiente ejemplo: Efecto de la inmunoglobulina endovenosa (IGEV), comparada con el ácido acetil salicílico (ASA) sobre la proporción de alteraciones (aneurismas) de las arterias coronarias (AAC) en la enfermedad de Kawasaki. La intervención es la administración de IGEV. El evento que se mide, al comparar ASA con IGEV, es la aparición de AAC. Resultado de dos semanas de seguimiento.

AAC Si

No

IGEV

ASA

48

5

69

74: 0.068 (6.8%)

15

60

75: 0.20 (20%)

Revista Medicina Vol. 9 No. 1 Actualización en medicina basada en evidencias (mbe) Pág. 13 de 17


Actualización en medicina basada en evidencias

RA: Los pacientes tienen riesgo de aneurismas coronarios en el 6.8% (5/74) cuando recibieron Ig, y en el 20% (15/75) cuando recibieron ASA. RAR: El riesgo de aneurismas coronarios se redujo en un 13.2% (20.0 – 6.8: 13.2% ó 0.20 – 0.068: 0.132) cuando se trató con Ig comparado con ASA. RR: Los pacientes tratados con ASA tienen 2.9 (0,2/0,068) veces mayor riesgo de padecer aneurismas coronarios que los tratados con Ig venosa. Si se realiza el cociente al revés (0,068/0,2: 0,34), significa que el tratamiento con Ig venosa protege contra los aneurismas, porque el RR <1 es protector en caso de efectos benéficos. RRR: 1– RR: 1 – 0,34: 0,66 (x 100): 66%. Significa que la IGEV reduce el riesgo de ACC en un 66% respecto a los que no la recibieron. NNT: 1/ARR (1/0.132: 7): Habrá un aneurisma menos por cada 7 pacientes tratados con Ig venosa, o dicho de otra manera, hay que tratar 7 pacientes con Ig venosa en lugar de ASA, para evitar que un paciente desarrolle un aneurisma coronario. La disminución del riesgo resultante de un estudio, es sólo una estimación. La precisión la da su intervalo de confianza del 95%. GLOSARIO DE TÉRMINOS Y CONCEPTOS ACLARATORIOS AZAR: Conjunto de factores desconocidos e imponderables que impiden predecir el resultado de una experiencia. Impide al investigador manipular la verdad. Cuando se conoce previamente el resultado, no se está realizando al azar. Ej: en un ensayo clínico controlado la asignación alternante de los dos tratamientos, permite conocer de antemano qué tratamiento va a recibir el próximo paciente. CAUSALIDAD: Asociación que representa las relaciones causa-efecto y que sirve para guiar el concepto de etiología, diagnóstico, prevención y terapia. COHORTE: Grupo de individuos que comparten una experiencia. ESTADÍGRAFOS: Valores que caracterizan una muestra. HIPÓTESIS: Suposición o conjetura verosímil de relaciones entre hechos o fenómenos, sujeta a comprobación. INFERENCIA ESTADÍSTICA: Proceso por medio del cual conociendo las características de la muestra, se 49

Recibido para publicación el 2 de julio de 2009 Aceptado el 7 de julio de 2009

Artículo

conocen las del universo. INTERVALO DE CONFIANZA DEL 95%: Rango de valores entre los cuales se encuentra, con una probabilidad de un 95%, el promedio del universo del cual se obtuvo la muestra en estudio. Es el intervalo dentro del cual se encuentra la verdadera magnitud del efecto (nunca conocida exactamente) con un grado prefijado de seguridad (siempre que el estudio sea válido). Habitualmente se elige un "intervalo de confianza al 95%" (o "límites de confianza al 95%"). Esto quiere decir que tenemos una confianza (grado de seguridad) del 95% de que el verdadero valor se encuentre comprendido dentro de los límites del IC obtenido (si repitiéramos el experimento 100 veces, 95 de los 100 IC obtenidos contendrían el valor verdadero). El estimativo de un IC es más preciso (menor y mejor), mientras mayor sea el tamaño de la muestra. MUESTRA: Parte del universo que debe satisfacer cierto tamaño. POBLACIÓN O UNIVERSO: Cualquier conjunto amplio de integrantes, cuyas características pueden ser medidas. PROPORCIÓN: Medida que expresa la frecuencia con la cual se presenta cierto hecho o evento con respecto al total de unidades observadas. Expresa la relación de una parte con el todo. RAZÓN: Operación mediante la cual se compara por medio de una división dos cantidades de naturaleza diferente con el propósito de expresar una relación existente entre ellas. SESGO: Menor o mayor probabilidad que algunos miembros de la población tienen de ser elegidos para integrar una muestra. Aleja al investigador de la verdad. TASA: Medida que expresa la frecuencia con la cual se presenta determinado evento en el tiempo. VALIDEZ: Grado en que los resultados de una medición corresponden al verdadero estado del fenómeno que se ha medido. VALOR DE “P”: Expresa la probabilidad de error de un resultado al comparar 2 ó más grupos cuando aseguramos que son diferentes, dicho de otra manera, la probabilidad que el resultado obtenido se haya debido al azar. Puede tomar un valor de 0 a 1 (p=0 ninguna probabilidad que el resultado se haya debido al azar, p=1 existe el 100% de probabilidad que el resultado se haya debido al azar). Tradicionalmente se acepta que es menor del 5% (p<0,05). Significa que en 100 veces que se repite un experimento, en 5 ocasiones se debe al azar. Revista Medicina Vol. 9 No. 1 Actualización en medicina basada en evidencias (mbe) Pág. 14 de 17


Artículo

Actualización en medicina basada en evidencias

En el análisis de un estudio, cuando se busca una asociación (relación de fenómenos) de algo, se trata de encontrar una diferencia entre los grupos que se comparan: si el valor de P es alto, significa que la asociación encontrada es producto del azar en más del 5%, en cuyo caso no hay diferencias entre los grupos comparados, y los resultados no son estadísticamente significativos. Si P es bajo, significa que la asociación encontrada es producto del azar en menos del 5%, por lo tanto sí hay diferencias entre los grupos, y los resultados son estadísticamente significativos. Un valor de P que sea estadísticamente significativo, no significa que sea un hallazgo clínicamente importante, porque hay aspectos clínicos sin importancia y son estadísticamente significativos, sólo por el hecho de ser grande la muestra examinada. De igual forma, aspectos clínicos importantes pueden no ser estadísticamente significativos, si la muestra examinada es pequeña.

El tamaño muestral depende de: 1. El riesgo del investigador de obtener un resultado que lo lleve a una conclusión equivocada respecto a la hipótesis. Ese riesgo presenta 2 posibilidades: Error alfa y Error beta. Al intentar disminuirlo, aumenta el tamaño de la muestra. Hipótesis nula (Ho): Afirma que no existe asociación entre las 2 variables propuestas por el investigador. Hipótesis alternativa (Ha): Dice que sí existe la asociación planteada por el investigador.

Cáncer (+) (-)

TAMAÑO MUESTRAL EN LOS ESTUDIOS ANALÍTICOS Consideraciones generales Las relaciones existentes entre la exposición a diferentes factores y la incidencia de las enfermedades se deben buscar en resultados observados en muestras aleatorias que deben representar lo que sucede en la población de donde ellas provienen. Por eso, en la planeación de un estudio el investigador debe decidir acerca del número de sujetos participantes en cada uno de los grupos que se comparan. A mayor tamaño muestral, los resultados obtenidos son más precisos y, al mismo tiempo, aumentan los recursos necesarios para obtener y procesar una mayor información. Debe haber un equilibrio entre los costos y la precisión de las estimaciones que se trata de obtener: una muestra numerosa suele ser bastante precisa, pero también costosa. Intuitivamente se percibe que los resultados obtenidos con muestras pequeñas no son confiables por el comportamiento errático que tienen los resultados aleatorios que se basan en un número escaso de observaciones. Así, si en 5 lanzamientos de una moneda se obtienen 4 caras, decir si es una moneda equilibrada o falsa, tiene menos fundamento si en 50 lanzamientos se obtienen 40 caras. Con el resultado obtenido de una muestra pequeña, el riesgo de tomar una decisión equivocada acerca de la hipótesis que se intenta demostrar es alto. 50

(+)

a

b

c

d

Fumar (-)

Ho: No existe asociación entre fumar y riesgo de cáncer de pulmón, y si se observa alguna diferencia, ésta sólo se debe al azar del muestreo. Ha: Sí existe asociación entre fumar y cáncer de pulmón, y la diferencia observada no es producto del azar del muestreo. Si los hallazgos del estudio tienen significancia estadística, y se ha demostrado que la Ho es falsa, podemos rechazarla y aceptar su opuesta, la Ha.

Revista Medicina Vol. 9 No. 1 Actualización en medicina basada en evidencias (mbe) Pág. 15 de 17


Artículo

Actualización en medicina basada en evidencias

Error tipo I (alfa) y Error tipo II (Beta) Con relación a la Ho.

El valor de p (nivel de significancia) es el nivel más bajo de probabilidades con el que se puede rechazar la Ho. Verdad

Ho verdad

Aceptar Ho

Correcto

Decisión

Si p es menor de 0,05 se puede rechazar la Ho. Si p es mayor de 0,05 se acepta la Ho. Ho falsa

Error tipoII Beta

Rechazar Ho

Error tipo I

Correcto

Alfa

Error alfa: Probabilidad de rechazar la Ho cuando ésta es verdadera (no/si). Es un riesgo que corre el investigador, quien deberá establecer hasta que punto estará dispuesto a aceptar que los hallazgos de interés pudieran ser explicados por variaciones propias del azar, que en estudios clínicos se considera, convencionalmente, un error alfa menor del 5%. Ello significa que los resultados puden ser explicados por el azar en 5 o menos de cada 100 veces que se repitiera la experiencia, por lo tanto se interpretan como no atribuibles al azar (“significativos”). Error beta: Probabilidad de aceptar la Ho cuando esta es falsa (si/no) Este error corresponde a la probabilidad de no detectar un hallazgo como importante y atribuirlo al azar. En estudios clínicos se considera apropiado un nivel de error beta de 20%. Poder de un examen: Probabilidad de rechazar la hipótesis Ho cuando esta es falsa (complemento del error Beta), o sea, probabilidad de detectar correctamente la existencia de una asociación. Es igual a 100 menos el error Beta (1 – Beta). Esto significa que habitualmente se trabaja con un poder de 80%. Es una forma de expresar las probabilidades de que tal examen demuestre las diferencias que existen realmente y que al aplicarlo muchas veces, se repitan los resultados tantas veces como necesitamos darle poder al examen practicado. 51

Para demostrar la existencia de una asociación, y tener una alta probabilidad de detectarla con sus resultados aleatorios, se necesita un alto poder de la prueba estadística lo cual suele ser igual o superior al 80%, o sea que Beta casi nunca excede el 20%. Es fácil advertir que a medida que se desea reducir los riesgos Alfa y Beta de que el azar produzca resultados que lleven a una conclusión falsa, se debe incrementar el tamaño muestral requerido. 2. La magnitud de las diferencias existentes. Para detectar diferencias grandes basta un reducido tamaño muestral, y para pequeñas diferencias es necesario contar con muestras numerosas. Por eso, para calcular el tamaño muestral de un estudio es necesario especificar de antemano la diferencia mínima o el RR mínimo que se considera importante detectar desde una mirada clínica, etiológica o preventiva. Así, en igualdad de otras condiciones, la detección de un RR de 2.0 exige un tamaño muestral mayor que para uno de 5.0. En un ensayo clínico si se desea reducir la proporción de complicaciones de una enfermedad en un grupo de 30% a un 28% con un tratamiento nuevo, y se considera significativa la reducción, para detectarla requeriría el estudio de un gran número de casos. Es frecuente que una diferencia de interés sea catalogada como superior a 10% y comúnmente, alrededor de 15%. Es importante tener presente que una misma diferencia inducirá a tamaños de muestra variables de acuerdo con los valores entre los que tal diferencia se establece. Así, un 15% no opera igual si es entre 20% y 35% o entre 45% y 60%. 3. La frecuencia con que ocurren los eventos observados. La detección de una asociación entre una exposición y la incidencia de una enfermedad frecuente exige un menor tamaño muestral, que el requerido para una enfermedad rara. En la detección de diferencias pequeñas, exige muestras numerosas. Ej: ASA profiláctica en IM, entre los 20 y los 40 años se necesita mayor tamaño que si se realiza entre Revista Medicina Vol. 9 No. 1 Actualización en medicina basada en evidencias (mbe) Pág. 16 de 17


Actualización en medicina basada en evidencias

los 40 y los 60 años, puesto que el evento es menor en los más jóvenes. Esto implica que para la determinación del tamaño muestral requerido en un estudio de seguimiento es necesario especificar la incidencia propia de la población no expuesta (controles) o proporción de exposición propia de los controles. Dado el hecho de que la mayoría de la población total suele estar conformada por sujetos sanos, dicha incidencia puede estimarse adecuadamente por la frecuencia de exposición de la población total.

Artículo

satisfaction. JAMA; 2001; 286(20): 2578-85. 10) Bravo R; La gestión del conocimiento en Medicina: a la búsqueda de la información perdida; Anales Sis San Navarra; 2002; 25: 255-272. 11) Browman G, Gómez de la Cámara A, Haynes B, Jadad A, Gabriel R; Herramientas para la práctica de la medicina basada en la evidencia. Desarrollo de guías de práctica clínica basadas en la evidencia: de abajo-arriba; Med Clin (Barc); 2001 Feb 24; 116(7): 267-70.

Bibliografía 1) Sackett, D.L., Straus, S.E., Richardson, W.S., Rosenberg, W., Haynes, R.B.; Medicina basada en la evidencia. Cómo practicar y enseñar la MBE; 2ª edición; Madrid, España; Ediciones Harcourt; 2.001, 1 – 145. 2) Sackett, D.L., Haynes, R.B., Guyatt, G.H., Tugwell, P.; Epidemiología clínica. Ciencia básica para la medicina clínica; 2ª edición; México D.F; Editorial panamericana; 1.998, 19 – 246. . 3) Londoño Fernández, J.L; Metodología de la investigación epidemiológica; 2ª edición; Medellín; Editorial Universidad de Antioquia; 1.995, 35 – 108. 4) Beaglehole, R., Bonita, R., Kjellström, T; Epidemiología básica; 1ª edición; Washington, D.C; Editorial Organización Panamericana de la Salud; 1.994, 33 – 86. 5) Herrera Labarca, P; Medicina Basada en Evidencias: Análisis sistemático de la literatura clínica; Séptimo curso internacional integrado en investigación clínica básica para pediatras, Santiago de Chile; 2.002, 2 – 173. 6) Duffau, G; Bioestadística para Medicina Basada en Evidencias; Séptimo curso internacional integrado en investigación clínica básica para pediatras, Santiago de Chile; 2.002, 2 – 270. 7) Gol Freixa JM; Bienvenidos a la medicina basada en la evidencia. En: La medicina basada en la evidencia. Guías del usuario de la literatura médica; JAMA (ed. esp.); 1997: 5-14. 8) Evidence-based medicine. A new approach to teaching the practice of medicine. JAMA; 1992 Nov 4; 268(17): 2420-5 [PubMed] 9) Grol R; Improving the quality of medical care: building bridges among professional pride, payer profit, and patient 52

Revista Medicina Vol. 9 No. 1 Actualización en medicina basada en evidencias (mbe) Pág. 17 de 17


Vol. 9 No. 1, 2010 (Enero - Junio)

Revista Medicina

Diarreas Bacterianas Bacterial diarrhea Dr. Álvaro Bustos González Pediatra Infectólogo Docente, Universidad del Sinú Montería, Colombia e-mail: abustos53@hotmail.com

Resumen Se calcula que anualmente ocurren entre 6 y 60 billones de casos de enfermedad diarreica (EDA) en el mundo, 15% de las cuales son de origen bacteriano. La EDA se define como la presencia de 3 o más deposiciones sueltas en un lapso de 24 horas. La población más afectada es la infantil, con un niño muerto por diarrea o sus complicaciones cada 15 segundos en alguna parte del planeta. Aquí se da una visión actualizada de las causas más frecuentes de diarrea bacteriana en niños, haciendo énfasis en aspectos patogénicos y terapéuticos. Palabras clave: Diarreas bacterianas, niños, mecanismos fisiopatogénicos, tratamiento. Summary Each year between 6 and 6 billion cases of diarrheic disease (ADD) occur in the world, 15% of wich have a bacterial origin. ADD is defined by the presence of 3 o more liquid stools within 24 hours. The most affected population is children,s, with a dead child every 15 seconds in any part in the planet. Here we give an update view on the most common causes of bacterial diarrhea in children, making emphasis on pathogenic and therapeutic aspects. Key word: Bacterial diarrhoeas, children, pathogenic mechanism, treatment.

El problema de la gastroenteritis es más acusado en pediatría en virtud de que en los niños se da un mayor recambio intestinal de líquidos, de que los mecanismos de defensa en los desnutridos están reducidos, de que la población infantil tiene menos reservas calóricas y una mayor superficie corporal comparativa que la hace más propensa a las pérdidas insensibles, y de que en ella es más frecuente la contaminación fecal-oral. Sea lo que fuere, e independientemente de la etiología, el tratamiento principal de las diarreas consiste en evitar o corregir la deshidratación, bien por vía oral, o, si la circunstancia lo amerita, por vía intravenosa. Las causas de diarrea bacteriana más comunes son las producidas por las diversas categorías de Escherichia coli diarreogénico, Campylobacter jejuni, Salmonella ssp., Shigella spp., Yersinia enterocolítica, Vibrio cholerae y Clostridium difficile. Actualmente se conocen 171 antígenos somáticos de E. coli y 56 antígenos flagelares, con 6 tipos diferentes productores de diarrea: Enteropatógeno, Enterotoxigénico, Enteroinvasivo, Enterohemorrágico, 53

Recibido para publicación el 30 de abril de 2010 Aceptado el 28 de mayo de 2010

Enteroagregativo y de Adhesividad Difusa (1). Con la excepción de E. coli enterohemorrágico (O157-H7), las pruebas para detección de estos micro-organismos heterogéneos no están disponibles en los laboratorios de rutina. Las cepas de E. coli enteropatógeno (ECEP) se distinguen de otras por su habilidad para adherirse y borrar los enterocitos, y por su incapacidad para producir toxina de Shiga. E. coli enteropatógeno persiste como una causa importante de enfermedad en la mayoría de países en vía de desarrollo, en especial en menores de 6 años, en los que produce una diarrea inespecífica y febril que puede durar más de 14 días. De hecho, es la primera causa de diarrea persistente en el mundo subdesarrollado. En un estudio realizado en Etiopía, la asociación de Trimetoprim-Sulfa y Mecilinam resultó en una significativa rata de curaciones clínicas y bacteriológicas cuando se comparó con placebo (2,3,4,5). La patogenicidad de E. coli enterotoxigénico (ECET) se relaciona con la elaboración de una o más enterotoxinas Revista Medicina Vol. 9 No. 1 Diarreas bacteriana Pág. 1 de 5


Diarreas bacterianas

(termolábil y termoestable), que no invaden ni dañan el epitelio intestinal sino que actúan alterando el mecanismo celular de AMP cíclico y Guanilato-ciclasa, desencadenando una diarrea secretora. Es, junto con Rotavirus, la principal causa de EDA deshidratante en niños de países del Tercer Mundo, en los que suelen inducir 2 a 3 episodios anuales de diarrea en los primeros 24 meses de vida. La toxina termolábil altera el tránsito intestinal; la termoestable aumenta la secreción. Estos gérmenes se asocian a la mitad de los casos de diarrea del viajero. Requieren, al igual que los E. coli enteropatógenos, un inóculo elevado. Tienen un período de incubación corto (14 a 30 horas) (7,8). El grupo de E. coli enteroinvasivo (ECEI) se distingue porque sus características genéticas, bioquímicas y clínicas son muy parecidas a las de Shigella, por lo que causa diarrea sanguinolenta en niños y adultos (cuadros de enterocolitis). Son bacterias móviles, no fermentadoras de lactosa (9). Las cepas de E. coli enterohemorrágico (ECEH) producen potentes citotoxinas (verotoxinas I y II), semejantes a la toxina de Shiga, que causan colitis hemorrágica y eventualmente Síndrome Urémico Hemolítico en 5% a 10% de los afectados (anemia hemolítica microangiopática, insuficiencia renal y trombocitopenia). Estas bacterias se hallan en 20% a 30% de pacientes que presentan diarrea con sangre. La enfermedad se produce de 3 a 9 días después de haber ingerido al menos 100 micro-organismos. El modo predominante de infección es la ingesta de carne cruda (el centro de la carne de hamburguesa, por ejemplo). Al 2º o 3er día de la enfermedad las heces se tornan sanguinolentas, y este cuadro puede durar en promedio 4 días, con poca o nula fiebre, pero la diarrea puede prolongarse hasta por 3 semanas. E. coli O157:H7 no crece en medios de cultivo habituales. Las colonias sorbitol-negativas se analizan con antisuero para detectar la presencia del antígeno O157. En su tratamiento es discutible el uso de antibióticos, con una tendencia mayoritaria actual a prohibirlos. Están contraindicados los inhibidores de la motilidad intestinal (10,11,12,13,14). La E. coli enteroagregativa (ECEAg) se caracteriza por poseer un patrón agregativo de adherencia a células HEp-2 de la mucosa intestinal. Se asocia a casos de diarrea persistente (mayor de 14 días). Los casos agudos 54

Artículo

son autolimitados. Tiene un periodo de incubación de 8 a 18 horas. Típicamente se manifiesta por diarrea secretora, mucosa, con poca fiebre y vómitos ocasionales o inexistentes. Para su detección existen sondas de ADN (15,16,17). E. coli de adhesividad difusa (ECAD) produce una enfermedad indistinguible de la causada por E. coli enterotoxigénico: diarrea acuosa y autolimitada, acompañada de vómitos y dolor abdominal. En un estudio de México se encontró primordialmente en menores de 6 años. Su diagnóstico se basa en el patrón de adherencia del micro-organismo a las células HE-2 y al uso de sondas de ADN (18). Campylobacter jejuni es la primera causa de EDA bacteriana en Estados Unidos. Se transmite por vía fecaloral a través del contacto con deyecciones de aves de corral, leche no pasteurizada y agua contaminada. Su periodo de incubación va de 3 a 6 días. Produce diarrea inflamatoria, fiebre, vómitos y dolor abdominal. Se puede excretar por las heces durante un mes. La eritromicina reduce el tiempo de excreción intestinal de Campylobacter, pero no modifica la evolución natural de la enfermedad. Hay una vacuna en estudio (19,20). Salmonellas enteritidis son gérmenes invasores, de alto riesgo en lactantes menores de 3 meses, en inmunodeficientes y en quienes han recibido previamente antibióticos ineficaces contra estas especies. Su reservorio lo constituyen las aves de corral, los huevos y los animales domésticos. Son la primera causa de EDA secundaria al consumo de alimentos contaminados. Tienen un periodo de incubación de 6 a 48 horas. Dan diarreas de tipo enterocolítico, con fiebre, vómitos y dolor abdominal. No están indicados los antibióticos (excepto en casos de sepsis y de localizaciones extraintestinales) porque pueden prolongar el tiempo de excreción de salmonellas y facilitar recaídas. No existe vacuna (21). Salmonella typhi y S. paratyphi son bacilos Gram negativos que sólo colonizan al ser humano. La Fiebre Tifoidea continúa siendo una grave problema de salud pública en el Hemisferio Sur, donde se presentan más de 12 millones de casos anualmente, con una mortalidad informada que puede llegar al 32%. Su periodo de incubación varía de 5 a 21 días. La enfermedad se caracteriza por fiebre prolongada, manifestaciones Revista Medicina Vol. 9 No. 1 Diarreas bacteriana Pág. 2 de 5


Diarreas bacterianas

digestivas y a veces estados confusionales. Sin terapia antibiótica los síntomas desaparecen en 4 semanas, pero un 12% de pacientes puede sufrir perforación intestinal en la tercera semana de evolución de la enfermedad. Cloramfenicol es el tratamiento de elección. Está probado que reduce la mortalidad y el número de días con fiebre. Una alternativa es el uso de cefalosporinas de 3ª generación (22,23,24). Shigella flexneri y Shigella dysenteriae tipo 1 predominan en países subdesarrollados. Son gérmenes invasores por excelencia, que rompen el epitelio y se acompañan de respuesta inflamatoria polinuclear, ulceración de la mucosa e invasión sanguínea. El bajo inóculo necesario para producir enfermedad (10 micro-organismos) hace que las shigellas sean altamente contagiosas. Causan 250 millones de casos de diarrea y 650.000 muertes anuales en todo el mundo. Después de un periodo de incubación de 1 a 4 días aparece fiebre, malestar, anorexia, vómito ocasional y una diarrea acuosa que progresa a la disentería en un lapso de pocas horas a varios días. Las manifestaciones extraintestinales, como el Síndrome Urémico Hemolítico en los niños y la Púrpura Trombocitopénica Trombótica en adultos, son infrecuentes. La actividad neurotóxica de la toxina de Shiga puede desencadenar estados convulsivos. Esta toxina inhibe la síntesis de proteína y bloquea la absorción de sodio y cloro. La terapia con antibióticos eficaces reduce el tiempo de evolución de la enfermedad a la mitad. Por vía parenteral se usa cefotaxime; por vía oral ácido nalidíxico. La resistencia a Ampicilina y Trimetoprim-Sulfa se ha incrementado en los últimos años (9,25). Yersinia enterocolítica predomina en climas fríos y tiene un periodo de incubación de 3 a 7 días. Se encuentra en el norte de Europa, la península escandinava, Canadá, Estados Unidos y Japón. El cerdo es su mayor reservorio. Causa enterocolitis, diarrea prolongada (de 14 a 22 días) y excreción de la bacteria durante 7 semanas. Puede remedar cuadros de abdomen agudo. Su diseminación se asocia a granulomas en diversos órganos. El tratamiento requiere terapias prolongadas (de 2 a 6 semanas) con cefalosporinas de 3ª generación, a menudo combinadas con aminoglicósidos (26,27). Vibrio cholerae es responsable de la diarrea más rápidamente fatal en seres humanos. En los casos graves se puede perder hasta un litro de líquidos por hora a 55

Artículo

través de los vómitos y la diarrea. El aspecto de la deposición suele ser en “agua de arroz”. La mayoría de las infecciones son asintomáticas o se manifiestan de forma leve. Una de las más intrigantes enterotoxinas del cólera es la zonula occludens (Zot), que incrementa la permeabilidad intestinal por interacción con la célula receptora, desensamblando las uniones intercelulares. La exotoxina colérica es el principal factor de virulencia. Otros factores de virulencia los conforman las adhesinas, el antígeno somático (O), pirógeno del lipopolisacárido, el antígeno H del flagelo, que permite la instalación de la bacteria en la mucosa del intestino delgado, las hemolisinas y la neuraminidasa. La introducción de la hidratación oral redujo la mortalidad del cólera de 50% a 1%. La terapia antibiótica disminuye el volumen de la diarrea y la duración de la enfermedad, limitando la excreción de vibriones a un día. En niños se recomienda administrar Trimetoprim-Sulfa, Furazolidona o Eritromicina. Existe una vacunas por ingeniería genética (CVD 103-HgR) que confiere protección de 82% a 100%; y otra de Vibrio cholerae O139 vivo atenuado, con la que se han obtenido promisorios resultados (28,29,30,31,32,33,34,35). Clostridium difficile es un bacilo Gram negativo, anaerobio estricto, formador de esporas, lo que le permite persistir en el ambiente. Es la causa más frecuente de diarrea bacteriana secretora en pacientes hospitalizados. Puede producir desde una diarrea leve hasta colitis pseudomembranosa y megacolon tóxico fatal. Veinticinco por ciento (25%) de los casos de diarrea asociada al uso de antibióticos se atribuyen a este germen. Se disemina de persona a persona y sus toxinas se pueden hallar en recién nacidos en Unidades de Cuidado Intensivo. La enterotoxina A induce quimiotaxis y producción de citocinas, estimula la hipersecreción de fluidos y lleva a necrosis hemorrágica. La toxina B (citotoxina) provoca la despolimerización de la actina con la pérdida del citoesqueleto celular. El factor de adhesión interviene en la unión a las células colónicas y la hialuronidasa promueve la actividad hidrolítica. Para su diagnóstico se exige la identificación de las toxinas; el germen se puede cultivar o investigar por pruebas de aglutinación de Látex o por el método inmunoenzimático Elisa. Su tratamiento se hace con Vancomicina o Metronidazol (36,37,38,39,40,41,42). Bibliografía 1- Levine MM. Escherichia coli that cause diarrhea:

Revista Medicina Vol. 9 No. 1 Diarreas bacteriana Pág. 3 de 5


Artículo

Diarreas bacterianas

enterotoxigenic, enteropathogenic, enteroinvasive and enteroadherent. J Infect Dis 1987; 155:377-389. 2- Paulozzi LJ, Johnson KE, Kamahele LM, et al. Diarrhea associated with adherent enteropathogenic Escherichia coli in infant and toddler center, Seattle, Washington. Pediatrics 1986; 77:296-300. 3- Donnenberg MS, Kaper JB. Enteropathogenic Escherichia coli. Infect Inmun 1992; 60:3953-3961. 4- Clausen CR, Christie DL. Chronic diarrhea in infants caused by adherent enteropathogenic Escherichia coli. J Pediatr 1982; 100: 358-361. 5- Thoren AL. Antibiotic sensitivity of enteropathogenic Escherichia coli to mecillinam, trimethoprim-sulfamethoxazole and other antibiotics. Acta Pathol Microbiol Scand 1980; 80: 265-268. 6- Macdonald KL, Eidson M, Strohmeyer C et al. A multistate outbreak of gastrointestinal illness caused by enterotoxigenic Escherichia coli in imported semisoft cheese. J Infect Dis 1985; 151: 716–720. 7- DuPont HL, Ericsson CD. Prevention and treatment of traveler's diarrhea. N Engl J Med 1993; 328:1821–1827. 8- DuPont HL, Formal SB, Hornick RB et al. Pathogenesis of Escherichia coli diarrhea. N Engl J Med 1971; 285:1–9. 9- Echeverria P, Sethabutr O, Pitarangsi C. Microbiology and diagnosis of infections with Shigella and enteroinvasive Escherichia coli. Rev Infect Dis 1991; 13:220S–225S. 10- Tarr PI. Escherichia coli O157:H7 clinical, diagnostic and epidemiological aspects of human infection. ClinInfect Dis 1995; 20: 9–10. 11- Karmali MA, Petric M, Lim C et al. The association between idiopathic hemolytic uremic syndrome and infection by verotoxin-producing Escherichia coli. J Infect Dis 1985; 151: 775–782. 12- Centers for Disease Control and Prevention. Isolation of E. coli 157:H7 from sporadic cases of hemorrhagic colitis, United States. Morbid Mortal Weekly Rep 1997; 46: 700–704. 13- Besser RE, Lett SM, Weber JT et al. An outbreak of diarrhea and hemolytic uremic syndrome from Escherichia coli O157:H7 in fresh-pressed apple cider. JAMA 1993; 269: 2217–2220. 14- Watanabe H, Guerrant RL. Summary: Nagasaki enterohemorrhagic Escherichia coli meeting and workshop. J 56

Infect Dis 1997; 176: 247–249. 15- Nataro JP, Deng Y, Cookson S et al. Heterogeneity of enteroaggregative Escherichia coli virulence demonstrated in volunteers. J Infect Dis 1995; 171:465–468. 16- Bhatnagar S, Bhan MK, Sommerfelt H et al. Enteroaggregative Escherichia coli may be a new pathogen causing acute and persistent diarrhea. Scand JInfect Dis 1993; 25: 579–583. 17- Paul M, Tsukamoto T, Ghosh AR et al. The significance of enteroaggregative Escherichia coli in the etiology of hospitalized diarrhoea in Calcutta, India and the demonstration of a new honey-combed pattern of aggregative adherence. FEMS Microbiol Lett 1994; 117:319–326. 18- Giron JA, Jones T, Millan-Velasco F et al. Diffuseadhering Escherichia coli (DAEC) as a putative cause of diarrhea in Mayan children in Mexico. J Infect Dis 1991; 163: 507–513. 19- Deming MS, Tauxe RV, Blake PA et al. Campylobacter enteritis at a university: transmission from eating chicken and from cats. Am J Epidemiol 1987; 126:526–534. 20- Wood RC, Macdonald KL, Osterholm MT. Campylobacter enteritis outbreaks associated with drinking raw milk during youth activities: a 10-year review of outbreaks in the United States. JAMA 1992; 268: 3228–3230. 21- Centers for Disease Control and Prevention: Surveillance for foodborne-disease outbreaks, United States, 1988–1992. Morbid Mortal Weekly Rep 1996; 45: 1S–66S. 22- Edelman R, Levine MM. Summary of an international workshop on typhoid fever. Rev Infect Dis 1986; 8:329–349. 23- Hoffman TA, Ruiz CJ, Counts GW. Water-borne typhoid fever in Dade County, FL: clinical and therapeutic evaluations of 105 bacteremic patients. Am J Med 1975; 59: 481–487. 24- Woodward TE, Smadel JE, Ley HL et al. Preliminary report on the beneficial effect of chloromycetin in the treatment of typhoid fever. Ann Intern Med 1948; 29:131–134. 25- Woodward TE, Smadel JE, Ley HL et al. Preliminary report on the beneficial effect of chloromycetin in the treatment of typhoid fever. Ann Intern Med 1948; 29:131–134. 26- Metchock B, Londway DR, Carter GP et al. Yersinia enterocolitica: a frequent seasonal stool isolate from children at an urban hospital in the southeast United States. J Clin Microbiol 1991; 29: 2868–2869.

Revista Medicina Vol. 9 No. 1 Diarreas bacteriana Pág. 4 de 5


Diarreas bacterianas

27- Marks MI, Pai CH, Lafleur L et al. Yersinia enterocolitica gastoenteritis: a prospective study of clinical, bacteriologic and epidemiologic features. J Pediatr 1980; 96: 26–31. 28- Wachsmuth IK, Blake PA, Olsvik O. Vibrio cholerae and Cholera: Molecular and erspectives, 1st edn. Washington, DC: American Society for Microbiology, 1994. 29- Nataro JP, Levine MM. Enteric bacterial vaccines, Salmonella, Shigella, cholera, Escherichia coli. In Ogra P et al, eds. Mucosal Immunology, 2nd edn. San Diego: Academic Press, 1999: 851–866. 30- Trach DD, Clemens JD, Ke NT et al. Field trial of a locally produced, killed, oral cholera vaccine in Vietnam. Lancet 1997; 349: 231–235.

Artículo

39- Donta ST, Myers MG. Clostridium difficile toxin in asymptomatic neonates, J Pediatr 1982; 100: 431–434. 40- Borriello SP. Pathogenesis of Clostridium difficile infection. J Antimicrob Chemother 1998; 41: 13–19. 41- Batts DH, Martin D, Holmes R et al. Treatment of antibioticassociated Clostridium difficile diarrhea with oral vancomycin. J Pediatr 1980; 97: 151–153. 42- Bolton RP, Culshaw MA. Maecal metronidazole concentrations during oral and intravenous therapy for antibiotic colitis due to Clostridium difficile. Gut 1986; 27: 1169–1172.

31- Levine MM, Kaper JB, Herrington D et al. Safety, immunogenicity, and efficacy of recombinant live oral cholera vaccines, CVD103 and CVD103-HgR. Lancet 1988; 2: 467–470. 32- Suharyono PM, Simanjuntak C, Witham N et al. Safety and immunogenicity of single-dose live oral cholera vaccine CVD103-HgR in 5–9-year-old Indonesian children. Lancet 1992; 340: 689–694. 33- Tacket CO, Losonsky G, Nataro JP et al. Initial clinical studies of CVD112 Vibrio cholerae O139 live oral vaccine: safety and efficacy against experimental challenge. J Infect Dis 1995; 172: 883–886. 34- Coster TS, Killeen KP, Waldor MK et al. Safety, immunogenicity, and efficacy of live attenuated Vibrio cholerae O139 vaccine prototype. Lancet 1995; 345:949–952. 35- Morris JG Jr, Wilson R, Davis BR et al. Non-O group 1 Vibrio cholerae gastroenteritis in the United States: clinical, epidemiologic and laboratory characteristics of sporadic cases. Ann Intern Med 1981; 94: 656–658. 36- McFarland LV, Mulligan ME, Kwok RYY, Stamm WE. Nosocomial acquisition of Clostridium difficile infection. N Engl J Med 1989; 320: 204–210. 37- Kaatz GW, Gitlin SD, Schaberg DR et al. Acquisition of Clostridium difficile from the hospital environment. Am J Epidemiol 1988; 127: 1289–1294. 38- McFarland LV, Surawicz CM, Stamm WE. Risk factors for Clostridium difficile carriage and C. Difficile associated diarrhea in a cohort of hospitalized patients. J Infect Dis 1990; 162: 78–684.

57

Revista Medicina Vol. 9 No. 1 Diarreas bacteriana Pág. 5 de 5


Vol. 9 No. 1, 2010 (Enero - Junio)

Revista Medicina

Ciencia y Medicina Science and Medicine Dr. Patricio Herrera Labarca Pediatra Infectólogo Magister en Epidemiología Clínica, Universidad de Chile e-mail: pherrera@vtr.net

La Medicina es una ciencia perteneciente al grupo de las llamadas fácticas. La Medicina Clínica es otra ciencia fáctica, esencialmente enmarcada en un universo probabilístico, el que rige sus hipótesis, a las que da un carácter particular.

obtendrá información -todo gracias a recursos técnicosque permitirán hacer otra proposición de esta naturaleza: “en Ganimedes hay agua”. Asunto verdadero o falso hasta que la misma sonda u otra, traiga esa agua a la Tierra (acontecimiento, otra vez, técnico).

La presencia o ausencia de dogmas (que debieran llamarse sólo “paradigmas”) no hace ni deshace el carácter de la Medicina –entendida en lo general-: La Ciencia (en general) tiene un dogma que es el motor de su evolución y progreso (Popper). Todas sus “verdades” son cuestionables y susceptibles de probar como falsas. El poder predecir un eclipse (ejemplo utilizado para diferenciar la Astronomía de la Medicina) no es fruto de ciertos dogmas sino la aplicación de ciertos paradigmas que –hoy se acepta- han quedado, también, sometidas a la probabilística (como tal, sin echar mano, simplemente, al azar).

La práctica de la Medicina Clínica es otra cosa: cualquier otra cosa, a veces.

La Ciencia tiene un dogma: jamás conoceremos lo que nos empeñamos en conocer. Digamos, por ahora, cuál es la partícula subatómica primigenia. (En Suiza, ya se sabe que eran muchas más que las contempladas con el artilugio de colisión que se construyó). Este dogma de la Ciencia aplica a la Medicina también. Las ciencias han originado, con base en sus paradigmas1, la posibilidad de derivar de éstos –total o parcialmenteaplicaciones en la práctica: es el mundo de la técnica. [Pocas cosas ilustran mejor la falibilidad del conocimiento científico, como el progreso tecnológico y su vertiginoso cambio]. La llegada de una sonda a una luna de Júpiter no constituye un hecho científico, sino meramente técnico, si bien hay detrás de tal acontecimiento, la puesta a prueba de una hipótesis científica: “en ciertas condiciones, cierto arte construido de cierta manera…. aterrizará en, digamos, Ganimedes”. Es cierto que, a raíz de esto, se

La práctica de la Medicina Clínica exige, como actividad íntimamente ligada al futuro del ser humano individual y colectivo, en el aspecto estrictamente asociado al concepto “salud”, enmarcar toda la interacción entre el “agente” (médico) y el “sujeto” (uno o más paciente) [nótese que el médico está considerado aquí como un “agente”, como un potencial factor que ejercerá influencia en el “sujeto”, que es el que está enfermo o en duda], poniendo en juego todo lo que, independientemente de la Ciencia Médica prevé, hace del “agente” y el “sujeto” seres humanos: empatía, respeto, marco ético, marco estético, etc. El paciente (“sujeto”) merece ser comprendido y enfrentado en una dimensión ética no separable de la antropológica. (Llamémoslo en forma sintética, si se nos permite, “compromiso humanitario”). Pero no es ésta la materia en análisis. Demos por hecho que se cumple todo lo anterior (supuesto que resulta meramente útil y funcional al análisis, pero que sabemos es sólo un supuesto que, generalmente, no es completamente verdadero). En el escenario de este enfoque, un médico no podría cumplir todo su compromiso humanitario si no estuviese diagnosticando, previendo, tratando, controlando, corrigiendo, reparando, el asunto puesto ante él por su paciente, otorgándole el beneficio ineludible de hacerlo sobre la base de los paradigmas (¡no dogmas!) vigentes correspondientes. Dicho en términos coloquiales, debe

1

Paradigma: Conjunto de proposiciones universalmente aceptadas como válidas, pero en forma transitoria hasta su siguiente modificación o eliminación.

58

Recibido para publicación el 27 de enero de 2010 Aceptado el 11 de febrero de 2010

Revista Medicina Vol. 9 No. 1 Ciencia y medicina Pág. 1 de 3


Ciencia y medicina

actuar sobre la base de lo mejor posible para el mayor beneficio de su paciente. Quien desconozca esto, no actúa ni técnica ni éticamente, aunque -a vecesaparezca disfrazado de una espléndida estética. Si todos los médicos pudiésemos actuar –y de hecho lo hiciéramos- dentro de este marco difícil - por exigente-, no se necesitarían “Guías de Procedimientos Clínicos”. Sobre todo si los médicos no estuviésemos atrapados, en el ejercicio de nuestra profesión, en manos de terceros que hacen de intermediarios para lograr beneficios ajenos a la Medicina, que ha adquirido una estructura francamente gansteril. El progreso científico en Medicina Clínica debe buscarse en el producto de la investigación clínica y su metodología, no en el progreso en Ciencias Biológicas, investigación tecnológica ni, menos, en el producto de la investigación industrial. Desde este punto de vista, la interface que existe entre lo técnico y lo científico, en Medicina Clínica, no puede resolverse sin una claridad meridiana respecto a qué es qué. En términos coloquiales, no hay ningún procedimiento aplicable a pacientes, que sea “científico” ni, de por sí, “brillante” (concepto estético): antes, importa saber si es lo mejor. Para que lo anterior se cumpla, el médico tiene que tener y acrecentar el bagaje científico que le permite pensar correctamente como médico. Algunos dirán que es el sentido común –y quizás lo sea, inclusive para la Física y la Astronomía- pero, más cerca de la realidad, debe conocer lo que llegó a llamarse “Epidemiología Clínica” que, más allá de la compartamentalización (pido excusas por el neologismo) de nuestras disciplinas, aporta mucho más de Ciencia Médica que su solo capítulo “Análisis de Lectura Crítica”, “Bioestadística)…etc.”. ¿Qué cosas dice la Epidemiología Clínica –en calidad de paradigmas científicos- sin las cuales la práctica clínica es un albur inaceptable?. “La medición –cualquiera- tiene probabilidades de ser inexactas e imprecisas que, para ser usadas, deben medirse según ciertas reglas a seguir, dadas las pruebas empíricas de su falibilidad”. “En cualquier fase de la inferencia (que va desde el aspecto del paciente hasta el término de la acción clínica) puede influir, para alejar sistemáticamente de la realidad

Ensayo

(verdad) o, lo que es más grave, la ejecución e interpretación de la experiencia (el acto completo) médica: es lo que llama “sesgo”. Para usar el mejor concepto del artículo suyo, “la mejor y más sofisticada tecnología con que cuenta el médico (son): la historia clínica y el examen físico”. Por una razón obvia: es el más antiguo, perfeccionado, científicamente concebido y empíricamente respaldado paradigma del conjunto de instrumentos médicos clínicos. La base científica de tal afirmación está estipulada como la combinación de observar adecuadamente, conocer la prevalencia de las probables causas de la enfermedad del paciente en particular (este “en particular” afecta la dimensión “prevalencia”, ya sea por su sexo, edad, ubicación, antecedentes, etc.) y la aplicación –involuntaria o semiconsciente- del teorema de Bayes. Todo esto en lo que se refiere al diagnóstico y el pronóstico. También la terapia tiene que ver con éste último. La superficialidad, pérdida de la mística, flojera, indiferencia ante lo delictual y, por fin, la estupidez han distorsionado este concepto, que es la puerta de entrada al problema complejísimo de comprender y resolver que implica la práctica médica clínica. La distorsión ha significado alterar el orden y estructura del pensamiento clínico sobre la base errónea que supone que la tecnología es ciencia y más poderosa que la clínica para resolver el problema del ser humano convertido en paciente2. Bueno, ¿y qué de las Guías de Procedimientos Clínicos?. Una confusión esperable: El avance en el método científico aplicado a desarrollar la información en Medicina Clínica, con el fin de mantener actualizados los paradigmas de procedimientos clínicos (propuesta científicamente impecable e indispensable), llevó inexorablemente a los científicos a cargo, a una conclusión falsa (lo que es perfectamente aceptable en Ciencia): que “mantener al día a todo médico era posible, siguiendo ciertas disciplinas” (que, además de resultar falso y para mayor abundamiento, están en evolución permanente). Ellos han seguido el proceso que

2

Se recurre a la tecnología diagnóstica antes que a la terapéutica (lo que suena obvio) cuando está terminada la fase anterior: la anamnesis completa y el examen físico (lo que, a muchos, no les resulta tan obvio). Saltarse o hacer una transposición de esta secuencia implica pretender prescindir de pensar y esperar de un aparato inanimado (la totalidad del recurso paraclínico usado para diagnósticos) que nos haga el milagro de decirnos qué tiene el paciente.

59

Revista Medicina Vol. 9 No. 1 Ciencia y medicina Pág. 2 de 3


Ciencia y medicina

conocimos como “análisis sistemático de la literatura médica clínica”, cayendo en la trampa de construir una verdadera industria de paradigmas (Fundación Cochrane y símiles) que llevaba, ineludiblemente, a la idea de un manual de mejores evidencias, sin percatarse que tal manual se contradiría a sí mismo mes a mes. Los procedimientos para elaborar Guías Clínicas están en la literatura especializada y son, pasando por las 3 Revisiones Clínicas , la desembocadura ineludible de la dirección que llevaba esta técnica que, de paso, se contradijo: estaba diseñada para el médico clínico con poco tiempo para leer y terminó ofreciéndole no leer del todo, ¡sino esperar Guías Clínicas!. ¿Qué nos dice la experiencia?. 1) Las guías clínicas son hechas por quien quiera hacerlas, lo cual no respeta principios técnicos ni científicos. 2) Las Guías Clínicas sólo pueden hacerse bien y mantenerse como componente de una política, si están a cargo de un no muy extenso equipo de expertos dedicados sólo a ello. En la práctica no es así. 3) Las Guías Clínicas -por definicióndeben actualizarse, al menos, cada dos años. En la realidad tampoco es así, pues implica un trabajo enorme y muy especializado. 4) La Guías Clínicas no debieran ser usadas como decretos de acción ante determinados problemas clínicos o de enseñanza clínica que preocupan a políticos o economistas. Pero así se ha hecho. El instrumento “Guías Clínicas” ha sido como una triquiñuela para a) imponer dogmas, b) enmarcar el trabajo clínico en ciertos patrones políticos (electoreros) o economicistas c) asegurar las ganancias derivadas de la atención médica, en el área privada y d) para vanidad de algunos jefes. En suma, se llama “Guías Clínicas” a una cantidad heterogénea de recopilaciones o simples proposiciones que, de hecho, no cumplen los criterios científicos ni técnicos elementales. ¿Qué hacer?. Obtener un documento-guía que sirva a los

Ensayo

objetivos de las Guías Clínicas, no necesariamente autóctono pero de la procedencia más confiable posible (sin que, con ello, se garantice ni su plena validez y aplicabilidad). Una vez seleccionado y, eventualmente, adaptado a la realidad local, ponerlo en vigencia durante un lapso corto, un año, dos a lo sumo. La utilidad marginal de una guía clínica elaborada o elegida por los encargados de usarla (no por simples “jefes”) y luego el seguimiento para asegurarse que se siguen, o se registra cada vez la razón de sus incumplimientos, poder llevar a cabo una auditoría a cargo de los mismos que las hicieron o convinieron, para medir su aplicabilidad y resultados de manera que, eventualmente, se identifique y se pueda modificar lo que corresponda, sobre la base de la evidencia mejor, más reciente, además de la lograda por el uso de dicha Guía Esto requiere algo ya perdido: la integración estrecha entre la Facultad de Medicina (y su Área Clínica, respaldada quizás por algunos básicos) y los servicios de atención, preferentemente públicos4. De esta asociación (que hoy llaman “alianza estratégica”, cambio de nombre para una entidad que ya no existe en la práctica en América Latina), el contingente académico debiera ser el responsable de la elaboración (a ser difundida, discutida y acordada con los médicos “tratantes”, no académicos) y, a su vez, el aparato médico administrativo (Jefes de Servicio, División o Unidad), el encargado de velar porque sus equipos de médicos y enfermeras desarrollen y cumplan labores de auditoría permanente que aseguren una buena retroalimentación al grupo que elabora las Guía, etc.. Parecería obvio que un buen médico clínico, va a tender a coincidir -en gran medida- con Guías Clínicas bien hechas. No habría razones para que así no fuera, salvo la prevalencia de dogmas. Pero la cultura actual no nos lo 5 permitirá: cierta recomendación inservible (parte de una Guía, desde luego), puede significar una ganancia marginal, eventualmente incremental para una institución con fines de lucro cuando en las mismas condiciones, pero en el ámbito público, significa una pérdida, a lo menos marginal.

3

Las Revisiones Clínicas y, sobre todo, el meta análisis son una herramienta muy frágil para el Clínico. Primero, porque los algoritmos matemáticos que frecuentemente utilizan a veces como componente meramente estético pero inextricable- no necesariamente son aplicables a los biológicos (Kleinbaum & Kupper, 1982) y, segundo, porque la información que proporcionan requiere una a veces compleja elaboración antes de extrapolar resultados a las decisiones con nuestros pacientes reales. 4 La razón para especificar “servicios públicos de atención clínica públicos conlleva, quizás, un sesgo, pues se refiere principalmente a los hospitales públicos, no a dispensarios o niveles primarios ni secundarios. Las razones son dos: la primera, la posibilidad de organizar la atención con un contingente lo suficientemente grande de personal médico y de apoyo en trabajo mancomunado y, la segunda, por la concentración de las morbilidades de mayor importancia y complejidad técnica, sea por su aguda gravedad, o por la simple complejidad. Una tercera es que la privacidad que se paga tan caro e las clínicas privadas, incluye la visita de un médico –a lo más dos, ocasionalmente- y otras comodidades como silencio, TV, acompañante, etc. 5 Como es el uso de la Proteína C Reactiva para discernir entre fiebres agudas bacterianas y no bacterianas.

60

Revista Medicina Vol. 9 No. 1 Ciencia y medicina Pág. 1 de 3


Vol. 9 No. 1, 2010 (Enero - Junio)

Revista Medicina

A los colaboradores La revista MEDICINA, de la Universidad del Sinú Elías Bechara Zainúm-, es una publicación semestral sometida a arbitraje por pares, que contiene notas editoriales, artículos originales y trabajos de investigación, revisión de temas, presentación de casos clínicos o quirúrgicos, comunicaciones breves, actualizaciones terapéuticas, ensayos culturales y cartas al editor. Los artículos originales y trabajos de investigación incluyen los estudios inéditos que sean de interés para los lectores de la revista MEDICINA. Las normas de presentación de estos trabajos deben atenerse a las que rigen para la literatura médica científica universal según el Estilo Vancouver del Comité Internacional de Editores de Revistas Médicas. Las revisiones de temas deben ser lo más completas posibles con el objeto primordial de actualizar al lector. Sus autores deben ser profesionales con gran experiencia en el tema, que aporten abundante y reciente bibliografía. Las comunicaciones breves son notas cortas que plantean un asunto específico capaz de suscitar inquietudes o comentarios a un problema de interés. En este caso las referencias bibliográficas no deben exceder la cifra de 10. El Consejo Editorial recomienda que se incluyan referencias de autores colombianos. Los artículos que tengan cabida en la revista son de la plena responsabilidad de su autor o autores y no comprometen el criterio del Consejo Editorial. Se sobreentiende que los artículos que lleguen para publicación en la revista MEDICINA no han sido editados previamente, y se da por sentado que para su reproducción se requiere la autorización de su Consejo Editorial. Los artículos deben remitirse al Editor de la revista MEDICINA en original y dos copias escritas a doble espacio en computador. Una copia debe venir en medio electromagnético. El Consejo Editorial analizará cada artículo y emitirá su juicio sobre la conveniencia de su publicación. El ocasiones el Consejo podrá recomendar modificaciones o ajustes al texto.

61

actual deben aparecer en la primera página, debajo del título del artículo o trabajo. Es deseable que el título sea corto y específico. Cada artículo tendrá un resumen que describa la metodología y los hallazgos más sobresalientes, e irá al comienzo del texto. Es necesario además que haya un summary que no exceda las 150 palabras y que lleve un máximo de 6 palabras claves. Las colaboraciones deben ser dirigidas al Dr. Alvaro Bustos González, a la Facultad de Ciencias de la Salud de la Universidad del Sinú, Montería, Colombia, o a abustos53@hotmail.com REQUISITOS El manuscrito debe incluir el título, el resumen, el texto, las referencias bibliográficas y los cuadros y gráficos con su explicación correspondiente. Cada una de las secciones del manuscrito debe identificarse así: 1.1. Título 1.2. Resumen y palabras claves 1.3. Contenido 1.4. Referencias y Bibliografía 1.5. Cuadros y Gráficos 1.6. Ilustraciones 1.1

TITULO. La página del título debe contener:

1.1.1 1.1.2 1.1.3 1.1.4

1.1.6

El título del artículo Un subtítulo explicativo, si es del caso Nombres y apellidos de los autores Nombre de la Institución donde fue realizado el trabajo Nombre y dirección del autor principal, para efectos de correspondencia Forma de financiación, en caso de que exista

1.2

RESUMEN Y PALABRAS CLAVES

1.1.5

El resumen no podrá exceder 150 palabras. Su fin es explicar los propósitos del estudio, el diseño utilizado, los Revista Medicina Vol. 9 No. 1 A los colaboradores Pág 1 de 2


Vol. 9 No. 1, 2010 (Enero - Junio)

A los colaboradores

resultados principales y las conclusiones más protuberantes. Al final del resumen se colocarán de 3 a 10 palabras claves para facilitar la inclusión del artículo en los índices universales. 1.3

1.5

CUADROS Y GRAFICOS

Cada cuadro debe ir en hoja separada, con título y página numerada. Las notas explicativas se colocan al pie.

CONTENIDO 1.6

Se divide en: -Introducción -Material y Método -Resultados -Discusión La Introducción hará una relación suscinta de los antecedentes que motivan el estudio, sin revisar el tema in extenso, y un enunciado de los objetivos.

ILUSTRACIONES

Las figuras deben ser dibujadas o fotografiadas con la mejor tecnología disponible. Si son fotos se presentarán en papel brillante; si son esquemas, en papel blanco y con tinta china. Para ilustraciones a color, se enviarán las transparencias correctamente señalizadas. El tamaño máximo de las ilustraciones es de 8 x 11 cmts.

En Material y Método se hará una descripción detallada de ambos de manera que se permita su reproducción, y se considerarán los elementos utilizados en la investigación, sus fuentes y filtros, y el diseño del trabajo. Si se trata de una intervención terapéutica, se precisarán las drogas suministradas con sus nombres genéricos, dosis y vías de administración. Los Resultados deben ser presentados en una secuencia lógica, haciendo énfasis en los principales hallazgos, evitando repetir en el texto los contenidos de las tablas y figuras. En la Discusión se destacarán los aspectos más novedosos y trascendentes del estudio, haciendo relación a otras publicaciones similares. No se deben hacer afirmaciones que los datos de la investigación no respalden. Se plantearán nuevas hipótesis cuando sea del caso. 1.4

REFERENCIAS BIBLIOGRAFICAS

Se enumerarán en la secuencia de las citas. En el texto deben aparecer con números arábigos entre paréntesis. Se usará la forma de referencia adoptada por el Index Medicus. Ejemplos: 1.4.1 Revista Científica 1.4.1.1 Artículo Estándar Anote todos los autores cuando son menos de 6; cuando haya 7 o más, se anotarán los 3 primeros y se agregará el sufijo et, al. -Zubieta M., Salgado C., Paya E. Infecciones asociadas al uso de catéteres totalmente implantables en niños con cáncer. Revista Chilena de Infectología 1.996; 13:203-209 Para citas de libros debe señalarse el autor o los autores del capítulo, el nombre del autor del libro, nombre del libro, edición, ciudad de la publicación, editorial, año y página inicial y final del capítulo. 62

Revista Medicina Vol. 9 No. 1 A los colaboradores Pág 2 de 2


CAMPUS UNIVERSITARIO - Elías Bechara Zainúm Cra. 1w Calle 38 Barrio Juan XXIII PBX. (4) 784 0340 FAX. (4) 790 2038 Montería - Córdoba

SECCIONAL CARTAGENA Calle 31 No. 20-71 Pie de la Popa PBX. (5) 658 1688 FAX. (5) 656 3749 Cartagena - Colombia

Revista Medicina Vol 9 No. 1  

Vol 9 No. 1 / Enero - Junio de 2010 Universidad del Sinú @Montería

Read more
Read more
Similar to
Popular now
Just for you