Page 1

Volumen 13 Número 2

Julio - Diciembre 2014

*Editorial -Dudas Makondianas -Staphylococcus aureus resistente a meticilina en un grupo de estudiantes de Medicina. -Técnica de facilitación neuropropioceptiva para mejorar la flexibilidad en jugadores de voleibol de sexo masculino de la Universidad del Sinú año 2014* -Diabetes Mellitus 2: abordaje paso a paso -Self, self verdadero y falso, y su relación con el objeto -Breve memoria del 1er. Simposio Internacional de Enfermedades Infecciosas -¿Es pertinente un Instituto de Investigaciones en Enfermedades Tropicales en el departamento de Córdoba? -No todo lo nuevo es mejor -Melanoma maligno del pie: un tumor común en una presentación inusual -Síndrome de vasoplejía en postoperatorio de cirugía de revascularización miocárdica con circulación extracorpórea (CEC): Utilidad del Azul de metileno. -Sumario de ponencias del 1er Simposio Internacional de Enfermedades Infecciosas -A los colaboradores

www.unisinu.edu.co

Montería - Colombia


Revista Medicina - Facultad de Ciencias de la Salud - Programa de Medicina Vol. 13 No. 1, 2014 (Enero-Junio)

ACUMULADO AÑO 2014

-Una vocación ejemplar An exemplary vocation Dr. Álvaro Bustos González -Broncoobstrucción, eosinofilia periférica y parasitosis intestinal Broncoobstruction, peripheral eosinophilia and intestinal parasitism Dr. Álvaro Bustos González -Riesgo de sepsis neonatal por ruptura prematura de membranas ovulares Risk of neonatal sepsis due to premature rupture of membranes Dr. Humberto González Calderín y cols. -Enfoque y evaluación del dolor abdominal agudo no traumático Approach and evaluation of nontraumatic severe abdominal pain Dr. César Rafael Ensuncho Hoyos -Epidemiología y etiología del aborto Epidemiology and etiology of abortion Dr. César Ensuncho Hoyos -Cuerpo, sujeto y vínculo: Reflexiones en torno al relacionarse y la práctica clínica de hoy Body, subjects and linkages: reflections on relationships and clinical practice today Dr. Camilo Ricardo Rueda Mora. -Magia, pseudociencia y ciencia: Una reflexión desde la Neurobiología Magic, pseudoscience and science: A reflection from neurobiology Dr. Jorge Bergado Rosado y col. -El médico y la cultura The physician and the culture Dr. Álvaro Bustos González A los colaboradores

Revista Medicina - Facultad de Ciencias de la Salud - Programa de Medicina Vol. 13 No. 2, 2014 (Junio- Diciembre) Dudas Makondianas Makondian doubts Dr. Álvaro Bustos González Staphylococcus aureus resistente a meticilina en un grupo de estudiantes de Medicina. Methicillin-resistant Staphylococcus aureus in a group of Medicine students Dra. Dina Ricardo y cols. Técnica de facilitación neuropropioceptiva para mejorar la flexibilidad en jugadores de voleibol de sexo masculino de la Universidad del Sinú Technical neuropropioceptive facilitation to improve the flexibility in male volleyball players in Sinú University Dra. Luis Minelly Beleño Torres y Dra. Luz Kerime Humanez Moreno Diabetes Mellitus 2: abordaje paso a paso Diabetes Mellitus 2: step by step approach Dr. José Alfredo Correa Guerrero y Dra. Leonilde Inés Morelo Negrete Self, self verdadero y falso, y su relación con el objeto Self, true Self and false Self, and its relation to the object Dr. Ricardo Camilo Rueda Mora Breve memoria del 1er. Simposio Internacional de Enfermedades Infecciosas Brief memory of the 1st International Symposium of Infectious Diseases Dr. Álvaro Bustos González ¿Es pertinente un Instituto de Investigaciones en Enfermedades Tropicales en el departamento de Córdoba? How relevant is an institute for research in infectious diseases in the Córdoba department? Dr. Richard Onalbi Hoyos López No todo lo nuevo es mejor The new is not always better Dr. Francisco Rodríguez Yances Melanoma maligno del pie: un tumor común en una presentación inusual Malignant melanoma in the foot: a common tumor in an unusual presentation Dagoberto Duarte Misol, María Merlana Almanza y Joulen Mo Carrascal Síndrome de vasoplejía en postoperatorio de cirugía de revascularización miocárdica con circulación extracorpórea (CEC): Utilidad del azul de metileno. Vasoplegia syndrome in postoperative CABG with cardiopulmonary bypass (CPB): Usefulness of methylene blue Dr. Guillermo Agamenón Quintero y cols. Sumario de ponencias del 1er Simposio Internacional de Enfermedades Infecciosas Abstracts of the 1st International Symposium on Infectious Diseases A los colaboradores


Revista Medicina Vol. 13 No. 2 Julio - Diciembre 2014 ISSN 1692-0880

Fundador Dr. Elías Bechara Zainúm ( ) Rectora Dra. Adriana Suárez de Lacouture Decano de la Facultad de Ciencias de la Salud Dr. Álvaro Bustos González Jefe del Programa de Medicina Dr. José Luis Buelvas Berrocal Coordinador del Área Clínica Dr. Jorge Ordosgoitia Santana Director - Editor Dr. Álvaro Bustos González

Comité Científico

Comité Editorial

Dr. Jordi Vila Estape PhD en Bioquímica Jefe del Departamento de Microbiología Clínica Universidad de Barcelona, España

Dr. Patricio Herrera Labarca Magíster en Epidemiología Clínica Universidad de Chile

Dr. Jesús Silva Sánchez PhD en Genética y Genómica Bacteriana Jefe del Laboratorio de Resistencia Bacteriana Instituto Nacional de Salud Pública, Cuernavaca, México Dr. Edgar Prieto Suárez Magíster en Infecciones y Salud en el Trópico Coordinador de Scielo Colombia Universidad Nacional, Bogotá Dra. Camila González Rosas Bióloga, Magíster en Ciencias Biológicas PhD en Ciencias Biomédicas Universidad de los Andes, Bogotá Doctor Juan Manuel Cordovez Álvarez Magíster y PhD en Ingeniería Biomédica Universidad de los Andes, Bogotá

Dr. Salim Máttar Velilla Microbiólogo, PhD Instituto de Investigaciones Biológicas del Trópico (IIBT) Universidad de Córdoba Dra. Ángela Restrepo Moreno Micóloga, PhD Corporación para Investigaciones Biológicas (CIB) Medellín, Colombia Dr. Xavier Sáez Llorens Pediatra Infectólogo, Hospital de Niños Panamá, República de Panamá Dra. Mónica Trujillo Honeysberg Pediatra Infectóloga, Hospital Pablo Tobón Uribe Postdoctorada en Inmunología Medellín, Colombia

Dra. Lissette Acosta Ulloa Bióloga, PhD en Ciencias Naturales Universidad del Sinú -Elías Bechara Zainúm-

Diseño y Diagramación Ramiro Navarro Pérez publicaciones@unisinu.edu.co


Pág EDITORIAL Dudas Makondianas Makondian doubts Dr. Álvaro Bustos González ARTÍCULOS ORIGINALES Staphylococcus aureus resistente a meticilina en un grupo de estudiantes de Medicina. Methicillin-resistant Staphylococcus aureus in a group of Medicine students Dra. Dina Ricardo y cols. Técnica de facilitación neuropropioceptiva para mejorar la flexibilidad en jugadores de voleibol de sexo masculino de la Universidad del Sinú Technical neuropropioceptive facilitation to improve the flexibility in male volleyball players in Sinú University Dra. Luis Minelly Beleño Torres y Dra. Luz Kerime Humanez Moreno ARTÍCULO DE REVISIÓN Diabetes Mellitus 2: abordaje paso a paso Diabetes Mellitus 2: step by step approach Dr. José Alfredo Correa Guerrero y Dra. Leonilde Inés Morelo Negrete ARTÍCULOS DE REFLEXIÓN Self, self verdadero y falso, y su relación con el objeto Self, true Self and false Self, and its relation to the object Dr. Ricardo Camilo Rueda Mora Breve memoria del 1er. Simposio Internacional de Enfermedades Infecciosas Brief memory of the 1st International Symposium of Infectious Diseases Dr. Álvaro Bustos González ¿Es pertinente un Instituto de Investigaciones en Enfermedades Tropicales en el departamento de Córdoba? How relevant is an institute for research in infectious diseases in the Córdoba department? Dr. Richard Onalbi Hoyos López

3

4

9

13

21

27

29

No todo lo nuevo es mejor The new is not always better Dr. Francisco Rodríguez Yances

32

REPORTE DE CASOS Melanoma maligno del pie: un tumor común en una presentación inusual Malignant melanoma in the foot: a common tumor in an unusual presentation Dagoberto Duarte Misol, María Merlana Almanza y Joulen Mo Carrascal

34

Síndrome de vasoplejía en postoperatorio de cirugía de revascularización miocárdica con circulación extracorpórea (CEC): Utilidad del azul de metileno. Vasoplegia syndrome in postoperative CABG with cardiopulmonary bypass (CPB): Usefulness of methylene blue Dr. Guillermo Agamenón Quintero y cols.

39

RESÚMENES DE ARTÍCULOS CORTOS Sumario de ponencias del 1er Simposio Internacional de Enfermedades Infecciosas Abstracts of the 1st International Symposium on Infectious Diseases

46

A los colaboradores

53


Editorial

Dudas Makondianas Makondian doubts Makondo o Makonde es la lengua africana de la cual se deriva el concepto de hombre torcido o curvado (incapaz de sentarse o de andar sin apoyo), con que se manifiesta la infección por el virus Chikungunya. Macondo también se le llama a un árbol blanquecino de corteza rugosa que tiene un tronco grueso con hendiduras alabeadas, con una cúpula de ramas dispersas y una vegetación, a manera de cabellera, rala y llena de claraboyas. A raíz de la epidemia de Chikungunya que estamos sobrellevando, ya comenzó a crearse toda una mitología que discurre alegremente por las llamadas redes sociales, sembrando dudas sobre el real origen del problema, insinuando que el vector no es el que se dice que es, que la enfermedad afecta el hígado y que por eso no se puede tomar trago en un lapso de seis meses después de haberla padecido y, finalmente, como ya es propio de sus ligerezas, el presidente Santos coronó los desatinos afirmando que el Chikungunya no mata a nadie. Lo primero que debe saber la comunidad es que antes de la primera epidemia de Chikungunya, que ocurrió en Tanzania en 1952, el virus vivía en los primates del sureste africano, una demostración más de lo que nos une a esos cercanos parientes evolutivos. Lo segundo es que cuando se trata de la aparición de un nuevo virus en una zona determinada, nadie tiene defensas inmunológicas (anticuerpos) contra él, y por eso la enfermedad le puede dar a cualquiera. La ventaja comparativa en este caso es que, a diferencia del Dengue, del cual existen cuatro tipos, del Chikungunya sólo existe uno, y por eso no nos puede dar más de una vez, dejándonos inmunizados para siempre. Lo tercero es que en este tipo de epidemias, en una primera oleada suele infectarse el 50% de los susceptibles, quedando el resto expuesto a contagios endémicos o a nuevas arremetidas epidémicas. Sobre los vectores del Chikungunya no hay ninguna duda: son los mismos que transmiten el Dengue, uno urbano y otro semi-rural. Estos son mosquitos citadinos, aburguesados (en realidad la que transmite la infección es la hembra, que se alimenta de sangre para poder poner huevos cada tres días), que se reproducen en aguas limpias y que pican con más frecuencia en la mañana temprano y en la hora vespertina. Viven entre 15 y 30 días y tienen un diámetro de vuelo de 100 metros; no resisten temperaturas inferiores a 4oC ni mayores a 40oC, y con una sola relación de amor a la mosquita le basta para que la semilla que le queda le sirva para fecundar todos los óvulos que es capaz de producir en su corta vida. 3

Recibido para publicación el 03 de Noviembre de 2014. Aceptado el 17 de Noviembre de 2014.

La relación del Chikungunya con el alcohol es la misma que tiene cualquier enfermedad con las bebidas espirituosas: a quien está enfermo no le provoca tomar ni agua. El virus, de hecho, prefiere hacer daño a la piel, los músculos y las articulaciones, y muy poco se dedica a mortificar el cerebro, el corazón o el hígado. Es lo que se llama el tropismo de los virus, que por cierto capricho de la biología prefieren unos tejidos a otros. Lo que pasa con el Chikungunya es que en algunos pacientes las molestias articulares se pueden prolongar durante varias semanas, y a veces el síntoma se prolonga con intermitencias por muchos meses. Es cierto que la mortalidad del Chikungunya es inferior a la del Dengue, pero es necesario decir que hasta octubre del año pasado en las islas del Caribe y algunos países de América del Sur se habían registrado más de 776.000 casos sospechosos de la enfermedad, con 152 muertes atribuibles a ella (0.02%), y que en un estudio con 84 mujeres embarazadas con Chikungunya en cualquier fase de la preñez (The Reunion South Hospital Group), 88% de los hijos tuvieron síntomas, 10 de ellos con manifestaciones graves que requirieron cuidados intensivos. De manera que el presidente Santos está mal informado. ¿La prevención? Matar mosquitos en los domicilios, si los animalistas no han llegado al extremo de malquistarse por esta medida, y utilizar repelentes y toldillos, aparte de acabar con las aguas estancadas en los patios y en la vecindad. Poco puede hacer el Estado en el control del vector. Más hacen los colindantes poniéndose de acuerdo en abolir los reservorios húmedos. ¿Habrá llegado la hora de recuperar el valor y la utilidad del viejo y simpático musengue? Puede que sí. Con el verano que se anuncia, sin embargo, es probable que la intensidad de la epidemia disminuya. A menos agua, menos criaderos de insectos.

Dr. Álvaro Bustos González Decano de la Facultad de Ciencias de la Salud Universidad del Sinú -Elías Bechara ZainúmMontería, Colombia

Revista Medicina Vol. 13 No. 2 Editorial. Pág. 1 de 1


Vol. 13 No. 2, 2014 (Julio-Diciembre)

Revista Medicina

Staphylococcus aureus resistente a meticilina en un grupo de estudiantes de Medicina. Methicillin-resistant Staphylococcus aureus in a group of Medicine students Dra. Dina Ricardo Bacterióloga, Laboratorio de Investigaciones Biomédicas Universidad del Sinú -Elías Bechara ZainúmMontería, Colombia Julián Gandía y Janeth Benjumea Estudiante de Medicina, Universidad del Sinú -Elías Bechara ZainúmMontería, Colombia Dr. Francisco Buelvas, Dra. Catalina Tovar Docentes-Investigadores, Laboratorio de Investigaciones Biomédicas Universidad del Sinú -Elías Bechara ZainúmMontería, Colombia e-mail: ncatalinatv@gmail.com Resumen Introducción: Staphylococcus aureus resistente a meticilina (SARM) inicialmente fue reconocido como un patógeno asociado a la atención en salud, pero hoy en día su epidemiología está cambiando y se ha encontrado colonizando cada vez más a los individuos sanos sin factores de riesgo. Además se ha propuesto que la portación de SARM en el personal de la salud es un factor importante en la diseminación de las infecciones a nivel hospitalario y comunitario. Materiales y Métodos: Se realizó un estudio descriptivo transversal con muestreo aleatorio simple; se recolectaron hisopados nasales y faríngeos de un grupo de 20 estudiantes de medicina de quinto semestre en prácticas clínicas en un hospital de tercer nivel de complejidad en la ciudad de Montería. Los participantes del estudio firmaron el consentimiento informado y diligenciaron una ficha epidemiológica en donde consignaron datos demográficos y variables. Los aislamientos recolectados fueron identificados mediante pruebas microbiológicas convencionales y se realizó detección molecular mediante PCR para cinco genes de virulencia. Resultados: La prevalencia de SARM fue del 10%, no se encontró una relación entre la incidencia del estado de portador y las variables estudiadas; todos los aislamientos portaban el SCCmec de tipo IV y los genes que codifican para la PVL, Sek y BSA. Conclusiones: El hallazgo de SARM en la población de estudiantes sugiere que se implementen estrategias como el lavado de manos y el uso de las barreras primarias de bioseguridad para evitar la propagación de estas cepas. Palabras clave: portadores nasales, SARM, Estudiantes de Medicina. Summary Introduction: Methicillin-resistant Staphylococcus aureus (MRSA) was initially recognized as a pathogen associated with health care, but today its epidemiology is changing and found colonizing increasingly healthy individuals without risk factors. It has also been proposed that carrying MRSA in health personnel is an important factor in the spread of infections in hospitals and the community. Materials and Methods: A transversal descriptive study was performed with simple random sampling; nasal and throat swabs were collected of a group of 20 medicine students from fifth semester in clinical practice in a third level complexity hospital in Montería city. Research participants signed an informed consent and filled out an epidemiological profile with their demographic data and variables. Collected isolates were identified by standard microbiological tests, and molecular detection PCR was performed considering five virulence genes. Results: The prevalence of MRSA was of 10%. A link between the incidence of the carrier's state and the studied variables was not found; all isolates were carrying the SCCmec type IV and the genes coding for PVL, Sek and BSA. Conclusions: The finding of MRSA in the student population suggests that strategies such as hand washing and use of the primary barriers of biosecurity should be implemented to prevent the spread of these strains. Keywords: nasal carriers, MRSA, Medicine Students

Introducción Staphylococcus aureus es un importante patógeno humano que se encuentra colonizando al hombre en zonas como las fosas nasales, manos, periné y faringe, 4

Recibido para publicación el 01 de Septiembre de 2014. Aceptado el 22 de Septiembre de 2014.

siendo la colonización nasal la más frecuente; el hombre portador se considera como uno de los principales reservorios y responsables de la diseminación de infecciones estafilocócicas a nivel nosocomial y Revista Medicina Vol. 13 No. 2 Staphylococcus aureus resistente a meticilina en un grupo de estudiantes... Pág. 1 de 5


Staphylococcus aureus resistente a meticilina en un grupo de estudiantes...

comunitario por la aerolización de éste, desde las fosas nasales anteriores y mediante contacto interpersonal (1,2). S. aureus presenta cepas con resistencia a múltiples antibióticos, entre los que se encuentra la meticilina, producto de su capacidad adquisitiva de elementos genéticos exógenos tales como plásmidos, transposones y secuencias de inserción los cuales le permiten ser un patógeno exitoso (3). Además de la resistencia antibiótica, estas cepas exhiben un gran número de factores de virulencia que son los responsables de las manifestaciones clínicas (4,7). S. aureus resistente a meticilina (SARM) ha emergido ocasionando un problema de salud pública por su diseminación a nivel mundial; inicialmente SARM fue reconocido como un patógeno asociado a la atención en salud, pero hoy en día su epidemiología está cambiando y se ha encontrado colonizando cada vez más a los individuos sanos sin factores de riesgo convencionales para la adquisición de SARM (8). La portación de SARM en el personal de la salud es un factor importante en la diseminación de las infecciones a nivel hospitalario y comunitario, el personal de la salud portador puede convertirse en una fuente importante de infección para los pacientes más susceptibles y generar brotes en las instituciones de salud. En nuestra región son pocos los estudios que se han realizado en personal del área de la salud. Por lo que decidimos determinar la prevalencia de la portación de S. aureus resistente a meticilina en estudiantes de Medicina de la Universidad del Sinú que realizan sus prácticas clínicas en un hospital de la ciudad de Montería. Materiales y Métodos Se realizó un estudio descriptivo transversal con muestreo aleatorio simple; se recolectaron hisopados nasales y faríngeos de un grupo de 20 estudiantes de medicina de quinto semestre de la Universidad del Sinú, los cuales realizaban las prácticas clínicas en un hospital de tercer nivel de complejidad en la ciudad de Montería, durante el primer periodo del año 2012. Los participantes del estudio firmaron el consentimiento informado y diligenciaron una ficha epidemiológica en donde consignaron datos demográficos y variables como uso de tabaco, uso de antibióticos en los últimos tres meses, procedimientos quirúrgicos y hospitalizaciones recientes. Las muestras fueron transportadas en caldo LB (Luria 5

Artículo Original

Bertani) e incubadas a 37 °C por 24 a 48 horas. Posteriormente se realizó una siembra en el medio selectivo agar salado manitol; a las colonias compatibles con el género Staphylococcus se les realizo tinción de Gram y fueron repicadas en agar sangre para la identificación microbiológica mediante pruebas convencionales como catalasa y coagulasa. Se confirmó el género y la especie mediante el sistema MicroScan PC33, que evaluó la concentración inhibitoria mínima (CIM) de los antimicrobianos; para el control de calidad se utilizó la cepa ATCC de S aureus 29213. Los aislamientos resistentes a oxacilina fueron tamizados por el método de difusión del disco con cefoxitina de 30 ug para la predicción de la resistencia a meticilina mediada por el gen mecA. La interpretación de las pruebas de susceptibilidad se realizó teniendo en cuenta los puntos de corte del Clinical and Laboratory standards Institute (CLSI) 2013. Caracterización molecular y detección de factores de virulencia Se realizó extracción de ADN a los aislamientos identificados como Staphylococcus aureus. La extracción de ADN se llevó a cabo mediante el método de fenolcloroformo; el ADN se conservó a – 20°C, y de éste se empleó 1 μL como molde para la mezcla de reacción de la PCR. Para la detección del gen nuc se utilizaron los iniciadores descritos por Lina y colaboradores (9) y para el gen mecA se utilizaron los iniciadores descritos por McClure y colaboradores (10). Para la tipificación de los tipos de cassette se diseñaron iniciadores dirigidos hacia el complejo de genes ccr (Tabla 1). Adicionalmente se realizó la detección de cinco genes de virulencia, como lo son los genes que codifican para la Leucocidina de Panton Valentine (PVL), las enterotoxinas estafilocóccicas (sek, sem, seo) y la bacteriocina B de S. aureus (bsaB); estos fueron detectados mediante la PCR multiplex descrita por Escobar y colaboradores (11). Resultados Se muestrearon 20 estudiantes de medicina de quinto semestre con una edad promedio de 19.5 años, el 55% de los individuos eran de sexo masculino y el 45% restante de sexo femenino. Se aislaron 3 aislamientos de SARM de dos individuos con edades de 18 y 19 años, obteniendo así una tasa de portación del 10%. Todas las cepas se aislaron de individuos de género masculino, que tenían contacto con Revista Medicina Vol. 13 No. 2 Staphylococcus aureus resistente a meticilina en un grupo de estudiantes... Pág. 2 de 5


Artículo Original

Staphylococcus aureus resistente a meticilina en un grupo de estudiantes...

Iniciador

Secuencia (5’ - 3’)

ccrA1-F

GCCCAAGACAAAATTGATGC

ccrB1-R

ACATGCGCTGTAATTCAGGA

ccrA2-F

TCACCAACGGTAAAGGCTGT

ccrB2-R

TGATTGATTTGTCCGTCGAT

ccrA3-F

TGAATGAATCTCGCTTTGTCTG

ccrB3-R

CGACATTTTGACGATGAAGG

ccrA4-F

GCTTATCGTACATGCCCATT

ccrB4-R

TTCTGGACGTTGCATTGTTT

ccrC-F

TCAAAAAGGATATCGCACCA

ccrC-R

CAATAGGTCGACCCGGTTTA

mecI-F

GTGAATTGAAACCGCCTTTG

mecI-R

TCATCTGCAGAATGGGAAGTT

hsdM-F

GGAATACCAAATTGCCAACG

hsdM-R

TTGCGGTTCAGGTGGGATGT

hsdMV-R

TTGTGGTTCAGGGGGTATGT

personas hospitalizadas, personal de la salud y además habían recibido tratamiento antibiótico previo con antimicrobianos como penicilina, amoxicilina y cefradina. Los tres aislamientos de SARM mostraron resistencia al grupo de las penicilinas, susceptibilidad intermedia a ceftriazona y eritromicina; sensibilidad a gentamicina, levofloxacina, linezolid, moxifloxacina, rifampicina, sinercid, tetraciclina, vancomicina y amoxacilina/ácido clavulánico. Dos de los aislamientos presentaron resistencia a clindamicina. La identificación de especie y la resistencia a meticilina se confirmaron por la amplificación de los fragmentos de 106 y 310 pb correspondientes a los genes nuc y mecA respectivamente; todos los aislamientos estudiados portaban el SCCmec de tipo IV y en la detección de los factores de virulencia éstos presentaron los genes que codifican para la PVL, Sek y BSA. En tres de los individuos se aislaron Staphylococcus coagulasa negativos identificados como Staphylococcus capitis, Staphylococcus haemolyticus, Staphylococcus sciuri. Discusión En Colombia se han realizado varios estudios de portación en estudiantes de medicina que asisten a prácticas clínicas, obteniendo tasas de portación de SARM que varían entre el 1,3 % y el 27 ,8 % (12,13). Gaona y colaboradores realizaron un estudio donde compararon poblaciones de estudiantes de preclínica y 6

Producto (pb)

Gen

481pb

ccrA1/ccrB1

959pb

ccrA2/ccrB2

803pb

ccrA3/ccrB3

650pb

ccrA4/ccrB4

260pb

ccrC

268pb

mecI

300pb

hsdM/hsdMV

Referencia

Este estudio

clínica sin que reportaran diferencias significativas en la tasa de portación. Además tomaron muestras de tres sitios anatómicos; fosas nasales, faringe y manos, siendo las fosas nasales las que con mayor frecuencia se encontraba colonizadas, lo que demuestra que las fosas nasales son el sitio anatómico de mayor colonización por SARM. En nuestro estudio sólo se tomó una población que asistía a prácticas clínicas, con tasas de portación similar a las reportadas en Colombia; se tuvieron en cuenta antecedentes como hospitalizaciones previas, uso de antibióticos, cirugías y estado de fumador sin encontrar relación entre la incidencia del estado de portador y los antecedentes estudiados. El porcentaje de colonización nasal fue mayor al porcentaje de la colonización en la faringe, lo que concuerda con estudios realizados en los que informan que el sitio anatómico con mayor colonización son las fosas nasales (1,12). En el presente estudio los aislamientos portaban el SCCmec de tipo IV y los genes que codifican para PVL, Sek y BSA, evidenciando que los aislamientos comparten características de cepas de Staphylococcus aureus resistente a meticilina adquirido en la comunidad (SARMAC); este dato es similar a los obtenidos por Bettin y colaboradores en estudiantes de Cartagena en el año 2012, ya que la población de estudiantes de medicina portaban SCCmec tipo IV y PVL (14). El hallazgo de PVL en estos aislamientos es importante; algunos reportes indican que las cepas que portan esta leucocidina puede generar infecciones severas, como neumonía necrotizante (4). Revista Medicina Vol. 13 No. 2 Staphylococcus aureus resistente a meticilina en un grupo de estudiantes... Pág. 3 de 5


Staphylococcus aureus resistente a meticilina en un grupo de estudiantes...

Además de los aislamientos de SARM también, se aislaron Staphylococcus coagulasa negativos. Estos microorganismos han emergido como especies clínicamente importantes por encontrarse ocasionando infecciones a nivel hospitalario y a su vez adquirir genes que le confieren resistencia a antibióticos como la meticilina y la vancomicina (15,17). Conclusiones Las cepas de SARM tienen gran facilidad para integrar genes de resistencia antibiótica y ocasionar problemas en las instituciones de salud al limitar las opciones terapéuticas, aumentar la estancia hospitalaria de los pacientes y con ello incrementar los costos de la salud, por lo que se hace necesario realizar estudios de portación en personal del área de la salud para monitorear cuales son los microorganismos que están colonizando el personal, conocer su perfil de susceptibilidad y los genes relacionados con la resistencia antibiótica, de tal forma que se puedan prevenir brotes en las instituciones; además de estos estudios implementar estrategias como el lavado de manos y el uso de barreras primarias como tapabocas y guantes en el personal asistencial y los estudiantes de prácticas clínicas. Bibliografía 1. Kluytmans J, Belkum A Van, Verbrugh H. Nasal Carriage of Staphylococcus aureus : Epidemiology , Underlying Mechanisms , and Associated Risks. Clin Microbiol Rev. 1997;10(3):50520. 2. Sanabria R, Laspina F, Balmaceda MA, Samudio M, Fariña N, Campuzano A, et al. Portación nasal de staphylococcus aureus en personal hospitalario . Frecuencia y patron de sensibilidad antimicrobiana. Mem Inst Investig Cienc Salud. 2003;2(1):2933. 3. Jiménez Quiceno J, Ochoa Correa MM. Staphylococcus aureus resistente a meticilina : bases moleculares de la resistencia , epidemiología y tipificación. Iatreia. 2009;22(2): 14758. 4. Labandeira Rey M, Couzon F, Boisset S, Brown EL, Bes M, Benito Y, et al. Staphylococcus aureus Panton-Valentine leukocidin causes necrotizing pneumonia. Science (80- ). 2007 Feb 23;315(5815):11303. 5. Orwin PM, Leung DYM, Donahue HL, Novick RP, Schlievert PM. Biochemical and Biological Properties of Staphylococcal Enterotoxin K. Infect Inmunity. 2001;69(1):3606.

7

Artículo Original

6. Stryjewski ME, Chambers HF. Skin and soft-tissue infections caused by community-acquired methicillin-resistant Staphylococcus aureus. Clin Infect Dis. 2008 Jun 1;46(Suppl 5):S36877. 7. Vandenesch F, Naimi T, Enright MC, Lina G, Nimmo GR, Heffernan H, et al. Community-acquired methicillin-resistant Staphylococcus aureus carrying Panton-Valentine leukocidin genes: worldwide emergence. Emerg Infect Dis. 2003 Aug;9(8):97884. 8. Lamaro Cardoso J, de Lencastre H, Kipnis A, Pimenta FC, Oliveira LSC, Oliveira RM, et al. Molecular epidemiology and risk factors for nasal carriage of staphylococcus aureus and methicillin-resistant S. aureus in infants attending day care centers in Brazil. J Clin Microbiol. 2009 Dec;47(12):39917. 9. Lina G, Piémont Y, Godail-Gamot F, Bes M, Peter MO, Gauduchon V, et al. Involvement of Panton-Valentine leukocidin-producing Staphylococcus aureus in primary skin infections and pneumonia. Clin Infect Dis. 1999 Nov;29(5):112832. 10. Mcclure J, Conly JM, Lau V, Elsayed S, Louie T, Hutchins W, et al. Novel Multiplex PCR Assay for Detection of the Staphylococcal Virulence Marker Panton-Valentine Leukocidin Genes and Simultaneous Discrimination of Methicillin-Susceptible from -Resistant Staphylococci. J Clin Microbiol. 2006;44(3):11414. 11. Portillo BC, Moreno JE, Yomayusa N, Alvarez CA, Cardozo BEC, Pérez JAE, et al. Molecular epidemiology and characterization of virulence genes of community-acquired and hospital-acquired methicillin-resistant Staphylococcus aureus isolates in Colombia. Int J Infect Dis. 2013 Sep;17(9):7449. 12. Gaona M, Rios D, Peña M, Pineda A, Ibañez M, Ramirez G. Variación del estado de portador de Staphylococcus aureus en una población de estudiantes de medicina. Rev Ciencias la Salud. 2009;7(1):3746. 13. Mendez I, Holguin D, Pachon D, Africano F, Gonzalez I, Rojas N. Prevalence and antimicrobial susceptibility of Staphylococcus aureus methicilin resistant isolated from medical students. Rev CES Med. Universidad CES; 2013;27(1):2130. 14. Bettin A, Causil C, Reyes N. Molecular identification and antimicrobial susceptibility of Staphylococcus aureus nasal isolates from medical students in Cartagena, Colombia. Braz J Infect Dis. Elsevier Editora Ltda; 2012;16(4):32934. 15. Rasigade J, Raulin O, Picaud J-C, Tellini C, Bes M, Grando J, et al. Methicillin-resistant Staphylococcus capitis with Revista Medicina Vol. 13 No. 2 Staphylococcus aureus resistente a meticilina en un grupo de estudiantes... Pág. 4 de 5


ArtĂ­culo Original

Staphylococcus aureus resistente a meticilina en un grupo de estudiantes...

reduced vancomycin susceptibility causes late-onset sepsis in intensive care neonates. PLoS One [Internet]. 2012 Jan [cited 2014 Jun 17];7(2):e31548. Available from: http:// www.pubmedcentral.nih. gov/ articlerender. fcgi? artid=3279402&tool=pmcentrez&rendertype=abstract 16. Takano T, Ohtsu Y, Terasaki T, Wada Y, Amano J. Prosthetic valve endocarditis caused by Staphylococcus capitis: report of 4 cases. J Cardiothorac Surg [Internet]. BioMed Central Ltd; 2011 Jan [cited 2014 Jun 17];6(1):131. Available from: http:// www.pubmedcentral. nih. gov/articlerender. fcgi? artid=3199242&tool=pmcentrez&rendertype=abstract 17. Barros EM, Ceotto H, Bastos MCF, Dos Santos KRN, Giambiagi-Demarval M. Staphylococcus haemolyticus as an important hospital pathogen and carrier of methicillin resistance genes. J Clin Microbiol [Internet]. 2012 Jan [cited 2 0 1 4 J u n 1 7 ] ; 5 0 ( 1 ) : 1 6 6 8 . Av a i l a b l e f r o m : h t t p : / / w w w. p u b m e d c e n t r a l . n i h . g o v / a r t i c l e r e n d e r. fcgi?artid=3256717&tool =pmcentrez &rendertype =abstract

78

Revista Medicina Vol. 13 No. 2 Staphylococcus aureus resistente a meticilina en un grupo de estudiantes... PĂĄg. 5 de 5


Vol. 13 No. 2, 2014 (Julio-Diciembre)

Revista Medicina

Técnica de facilitación neuropropioceptiva para mejorar la flexibilidad en jugadores de voleibol de sexo masculino de la Universidad del Sinú en el año 2014* Technical neuropropioceptive facilitation to improve the flexibility in male volleyball players in Sinú University at 2014* Dra. Luisa Minelly Beleño Torres Fisioterapeuta. Universidad del Sinú -Elías Bechara ZainumGrupo de investigación ENFISINS. Montería, Colombia email: luisabeleo2009@hotmail.com Dra. Luz Karime Humanez Moreno Fisioterapeuta. Universidad del Sinú -Elías Bechara ZainumGrupo de investigación ENFISINS. Montería, Colombia e-mail: lkhm@outlook.com Asesor de contenido: MD. José Miguel Chaar Pretel Asesor metodológico: FT. Luis Alfredo Negrete Martínez Resumen Las técnicas de facilitación neuromuscular propioceptiva son métodos terapéuticos utilizados con el fin de obtener respuestas específicas del sistema neuromuscular a partir de la estimulación de los propioceptores orgánicos, así mismo el entrenamiento de la flexibilidad ha sido promovido durante años como parte integral de un programa de entrenamiento físico, con el objetivo de disminuir el riesgo de lesiones, aliviar el dolor muscular y mejorar el rendimiento deportivo. La flexibilidad en términos generales se define como la capacidad de desplazar una articulación o una serie de articulaciones a través de una amplitud de movimiento completa sin restricciones ni dolor, influenciada por músculos, tendones, ligamentos, estructuras óseas, tejido adiposo, piel y tejido conectivo asociado. En este documento encontrará un estudio metodológico en el que la investigación fue de tipo cuantitativa, transversal de tipo correlacionales-causales, cuyo objetivo fue demostrar la eficacia de la técnica de facilitación neuropropioceptiva para mejorar la flexibilidad en los jugadores de voleibol de sexo masculino de la universidad del Sinú. Palabras claves: Facilitación neuromuscular propioceptiva, Principios de facilitación, Estiramiento, flexibilidad. Summary The proprioceptive neuromuscular facilitation techniques are therapeutic methods used to obtain specific responses from system neuromuscular stimulation of organic proprioceptors, also the flexibility training has been promoted for years as an integral part of a training program physical, with the aim of reducing the risk of injury, relieve muscle pain and enhance athletic performance. The flexibility is defined generally as the ability to move a joint or a series of joints through a full range of motion without restriction or pain, influenced by muscles, tendons, ligaments, bone structure, adipose tissue, skin and connective tissue associated. In this document you will find a methodological study in which the research was quantitative, transversal type of correlational - causal, whose objective was to demonstrate the effectiveness of neuropropiceptiva facilitation technique to improve flexibility in the volleyball players of male Sinú University. Keywords: proprioceptive neuromuscular facilitation, Facilitation Principles, stretching, flexibility.

INTRODUCCIÓN La técnica de facilitación neuropropioceptiva (FNP) es un método para la mejora de la flexibilidad de los jugadores de voleibol. Su objetivo primordial es demostrar la eficacia de los ejercicios de estiramiento, para así lograr un mejor rendimiento de los jugadores en las competiciones deportivas. Él concepto FNP fue desarrollado en Estados Unidos entre los años 19401965 por M. Kabat (médico neurólogo) y los 79

Recibido para publicación el 07 de Julio de 2014. Aceptado el 28 de Julio de 2014.

fisioterapeutas Knott y Voss. Este concepto se desarrolló con base en los conocimientos neurofisiológicos de MBE: medicina basada en la evidencia, y PBE: práctica basada en la evidencia de aquella época (Sherrington, Gellhorn, Gsell, Pavlov), y en las observaciones y análisis de los movimientos corporales en la práctica deportiva. La flexibilidad es la única de las Cualidades Físicas cuya evolución es inversa al resto, es decir, se parte de un grado máximo de flexibilidad (en la niñez) para, a medida Revista Medicina Vol. 13 No. 2 Técnica de facilitación neuropropioceptiva para mejorar la flexibilidad... Pág. 1 de 4


Técnica de facilitación neuropropioceptiva para mejorar la flexibilidad...

que avanzan los años, ir disminuyendo hasta poder llegar a limitar de forma considerable cierto tipo de movimientos. Tanto en el ámbito mundial como nacional se ha presentado un incremento en el número de personas que practican alguna actividad deportiva de manera ocasional, lo cual implica que se dé un aumento de la posibilidad de presentar lesiones osteomusculares, disminución en la movilidad o amplitud de movimiento, y flexibilidad durante dicha práctica. 1

Hernández Díaz, P.E ( 2007) , en ”Flexibilidad evidencia científica y metodología del entrenamiento”, describe la importancia del entrenamiento de la flexibilidad. Este afirma que a pesar de la limitada evidencia científica existente, el entrenamiento de la flexibilidad ha sido promovido durante años como parte integral de un programa de entrenamiento físico, con el objetivo de disminuir el riesgo de lesiones, aliviar el dolor muscular post-ejercicio (DOMS) y mejorar el rendimiento deportivo. El grado de desarrollo de esta es uno de los factores más importantes que determinan el nivel del deportista.

Artículo Original

cadera, rodilla y zona lumbar, inasistencia a más de 2 sesiones de entrenamiento, hiperlaxitud. Teniendo en cuenta la evidencia científica se planteó un protocolo de tratamiento tomando como referencia la metodología de entrenamiento de Hernández Díaz, P.E (2006). Se realizó previa valoración fisioterapéutica, test de set and reach, goniometría de miembros inferiores; hecho esto la técnica fue aplicada 3 veces por semana (lunes, miércoles y Viernes), en diferentes horas del día en la ciudad de Montería-Córdoba-Colombia, en 4 series con duración de 30 segundos de repetición en ambas extremidades inferiores y duración total de 4 minutos (dos minutos en cada extremidad); se les aplicó la técnica a los individuos del grupo un tiempo total de 27000 segundos 1 durante 5 semanas . Una vez terminadas las 5 semanas de aplicación de la técnica, se revaloró y arrojó lo siguientes.

Teniendo en cuenta lo expuesto anteriormente, esta investigación se basa en la optimización de la flexibilidad en los jugadores de voleibol de la Universidad del Sinú, para facilitar el rendimiento deportivo con la técnica de facilitación neuropropioceptiva, para que ellos desarrollen una mejor actividad física al momento de enfrentar las exigencias de este deporte2. En nuestro medio el voleibol no es un deporte que se practique frecuentemente, por lo cual es importante resaltar que este deporte desarrolla la técnica, la táctica y la capacidad física e implica una gran capacidad de la movilidad en los diferentes segmentos corporales. MATERIALES Y MÉTODOS El estudio fue realizado en 12 sujetos sanos, pertenecientes al equipo deportivo de voleibol de la Universidad del Sinú -Elías Bechara Zainum-, quienes presentaban disminución de la flexibilidad en miembros inferiores. Los resultados y datos fueron analizados en la herramienta Excel. Se tuvieron en cuenta criterios de inclusión como: pertenecer al equipo de voleibol de la Universidad del Sinú, sexo masculino, edad entre 20 y 27 años, y criterios de exclusión: presentar historia de patología previa en 10

Evidencia Científica y Metodología del Entrenamiento PubliCE Standard · 2006 - Pablo E Hernández Díaz.

Francisco Ayala, * y Pilar Sainz de Barandab. Fiabilidad absoluta de las pruebas sit and reach modificado y back saber sit and reach para estimar la flexibilidad isquiocural en jugadores de fútbol sala. Recibido el 7 de octubre de 2010; aceptado el 3 de enero de 2011. Disponible en línea: http://www.apunts.org/ficheros/eop/S1886-6581(11)00002-8.pdf. Revisado el 25-05-2012. Revista Medicina Vol. 13 No. 2 Técnica de facilitación neuropropioceptiva para mejorar la flexibilidad... Pág. 2 de 4


Técnica de facilitación neuropropioceptiva para mejorar la flexibilidad...

DISCUSIÓN La flexibilidad está también influenciada por una serie de factores intrínsecos y extrínsecos, estos incluyen el nivel o el tipo de actividad que el individuo desarrolle, la temperatura, el género, la edad y la articulación involucrada, entre otros. Existen variadas técnicas de elongación muscular; entre ellas destacan: Elongación balística, pasiva asistida, activa y con Facilitación Neuromuscular Propioceptiva, cada una de ellas con distintas aplicaciones y efectos sobre el sistema neuromuscular. En este documento encontrará un estudio metodológico en el que la investigación fue de tipo cuantitativa,

RESULTADOS

Artículo Original

transversal de tipo correlaciónales-causales, cuyo objetivo general fue demostrar la eficacia de la técnica facilitación neuropropiOceptiva para mejorar la flexibilidad en los jugadores de voleibol de sexo masculino de la Universidad del Sinú. Contiene todo lo relacionado con la flexibilidad en cuanto a los tipos de flexibilidad normal, los beneficios, sus componentes, también enumeran una serie de factores internos y externos que influirán directa o indirectamente en su desarrollo o evolución de los estiramientos. Para los resultados obtenidos se calcularon medidas estadísticas de promedio comparando los resultados iniciales y finales de la investigación. CONCLUSIONES Se constató que según los resultados obtenidos hubo mejoría en un alto promedio de acuerdo a los resultados finales en comparación con los iniciales especificados; lo cual indicó que 30 segundos es un tiempo efectivo de elongación de la musculatura de tronco y miembros inferiores para aumentar la flexibilidad en jugadores de voleibol con edades comprendidas entre 20 y 27 años, por lo que se logró el objetivo principal de la investigación. Este material será útil para todo aquel que decida diversificar su trabajo o conocimiento utilizando la técnica de FNP como uno de los muchos tipos de estiramientos en el área deportiva, y expuesto en este trabajo especialmente en el voleibol, sin temor a producir lesiones y actualizar conocimientos en cuanto a las últimas investigaciones para mejorar el arco de movilidad articular de cada individuo, dependiendo del objetivo que se quiera alcanzar y de las mismas necesidades de este. BIBLIOGRAFÍA 1. Hernández Díaz, P.E.: Flexibilidad: evidencia científica y metodología del entrenamiento. PubliCE. Revisado en línea el 30-04-2014: (http://www. sobreentrenamiento. com /PubliCE/Home.asp). 14/03/07. Pid: 789. 2. MD. Gustavo Ramón Suarez. 2009,Biomecanica Deportiva y Control Del Entrenamiento, Pág. 70. Ed. Funámbulos. Medellín. Revisado en línea: http: //viref. udea. edu. co/contenido/publicaciones/expo2009/biomecanica_2009.pdf, el 30-04-2014. 3. Francisco Ayala, y Pilar Sainz de Barandab. Fiabilidad absoluta de las pruebas sit and reach modificado y back saber sit and reach para estimar la flexibilidad isquiosural en jugadores de fútbol sala. Recibido el 7 de octubre de 2010; aceptado el 3 de enero de 2011. Disponible en línea: http://www.apunts.org/ficheros/eop/S1886-6581(11)000028.pdf. Revisado el 25-05-2012.

11

Revista Medicina Vol. 13 No. 2 Técnica de facilitación neuropropioceptiva para mejorar la flexibilidad... Pág. 3 de 4


Técnica de facilitación neuropropioceptiva para mejorar la flexibilidad...

4. Casáis Martínez, Luis. Conferencia: avances en el entrenamiento de la flexibilidad. V Congreso nacional de las ciencias del deporte y la educación física en España 7-9 de Mayo de 2009. Disponible en: http: //www. altorendimiento. com/es/congresos/entrenamiento/272-avances-en-elentrenamiento-de-la-flexibilidad.

Artículo Original

19. Estudio de la musculatura de la región posterior del muslo tras programa de estiramientos, tesis doctoral presentada por: immaculadaperellótalens dirección: Dr. José Sánchez frutos valencia, 2003.

5. VISMARA, Germán H. Análisis del Entrenamiento de Las Cualidades Físicas en el Rugby, basados en Registros tomados a Jugadores de Primera División en Cuanto al Volumen y las Intensidades Recorridas en un Partido. Año 2000. Disponible en línea: http://www.g-se.com/a/75/analisisdel-entrenamiento-de-las-cualidades-fisicas-en-el-rugby.basados-en-registros-tomados-a-jugadores-de-primeradivision-en-cuanto-al-volumen-y-las-intensidades-recorridasen-un-partido. Revisado el 23-05-2014. 6. Hay, J. y Reíd, J.G. (1988). The Anatomical and Mechanical Bases of Human Motion. EnglewoodCliffs N.J.: Prentice Hall. 7. Ejercicio Terapéutico. Fundamentos y técnicas - 5ª Ed. Kisner / Colby, (aut.) Editorial Médica Panamericana. 8. Flexitest an innovative Flexibility assessment method, Claudio Gil Soares de Araújo, editorial Paidotribo. 9. American College Of Sports Medicine. (2005). Manual ACSM para la valoración y prescripción del ejercicio. Ed. Paidotribo. 10. Acondicionamiento físico en el medio acuático, juan Carlos Colado Sánchez editorial, Paidotribo. 11. Heyward. Evaluación de aptitud física y prescripción del ejercicio, 5ta edición, editorial panamericana. 12. López T. Facilitación Neuromuscular Propioceptiva. Sport y Medicina. 1991; 12:9 -12. 13. Evidencia del trabajo propioceptivo utilizado en la prevención de lesiones deportivas Monografía para optar el título de Especialista en Educación Física: entrenamiento deportivo. Por CarolinNaty Ávalos Ardila. 14. La propiocepción como contenido educativo en primaria y secundaria en educación física, Dr. Juan de Dios Benítez Sillero Universidad de Córdoba Javier Poveda Leal, Licenciado Ciencias de la Actividad física y deporte. Maestro educación física. 15. Evaluación funcional propioceptiva de miembros inferiores en deportistas, tironi, juan cruz. 16. Methods of flexibility training, IAAF @-Letter for CECS Level II Coaches. 17. Therapeutic Exercise Foundations and Techniques F O U R T H E D I T I O N, carolynKisner, MS, pt., lynnallencolby, ms, pt. 18. The effectiveness of 3 stretching techniques on hamstring flexibility using consistent stretching parameters. 12

Revista Medicina Vol. 13 No. 2 Técnica de facilitación neuropropioceptiva para mejorar la flexibilidad... Pág. 4 de 4


Vol. 13 No. 2, 2014 (Julio-Diciembre)

Revista Medicina

Diabetes mellitus 2: abordaje paso a paso Diabetes Mellitus 2: step by step approach Dr. José Alfredo Correa Guerrero Médico Cirujano, Universidad Libre Docente Instructor, Programa de Medicina, Universidad del Sinú -Elías Bechara Zainúm-, Montería Médico de Planta, Hospital San Jerónimo de Montería Dra. Leonilde Inés Morelo Negrete Médica Geriatra y Bioeticista Docente Catedrática, Facultad de Medicina, Universidad de Cartagena Docente, Programa de Medicina, Universidad del Sinú -Elías Bechara Zainúm-, Montería Médica de Urgencias, Hospital San Jerónimo de Montería e-mail: jalfredo379@hotmail.com Resumen La diabetes mellitus en una entidad con repercusiones importantes para la población mundial, que ha alcanzado grandes proporciones por el desmedido aumento en prevalencia e incidencia con matices de ser catalogada como una verdadera pandemia del siglo 21. Un adecuado manejo representa un reto para la medicina actual, siendo fundamental el conocimiento de su tratamiento con los diferentes grupos farmacológicos para evitar sus complicaciones macro y microvasculares, las cuales por tratarse de una enfermedad crónica van a estar directamente relacionadas con discapacidad y alteración en calidad de vida y muerte. Mediante esta revisión se pretende de forma práctica actualizar los tratamientos recomendados según las guías actuales. Palabras claves: Diabetes mellitus, obesidad, microvascular, macrovascular, discapacidad Summary Diabetes mellitus is a disease with great impact on world population reached by major proportions excessive increase prevalence and impact on with shades of it was a real being labeled pandemic century 21. Proper management is a challenge for the current practice being fundamental knowledge of its treatment with different pharmacological groups to prevent their macro and microvascular complications by which it be a chronic illness will be directly related to disability alteration in quality of life and death. Review by this form is intended for practice update recommended treatments according to current guidelines. Keywords: Diabetes mellitus, obesity, microvascular, macrovascular, disability.

INTRODUCCIÓN. Se entiende por Diabetes Mellitus a un grupo de enfermedades metabólicas caracterizadas por la presencia de hiperglicemia crónica, acompañada por alteración del metabolismo de los carbohidratos, grasas y proteínas que resultan como consecuencia del defecto en la secreción o en la acción de la insulina. ETIOLOGÍA En la etiología de la Diabetes tipo 2 juegan papel primordial dos alteraciones: La resistencia a la insulina y el déficit en su secreción. Cualquiera de estos dos defectos puede llevar al desarrollo de la enfermedad pero sin lugar a dudas, el más frecuente es la resistencia a la insulina que desencadena una serie de eventos que finalmente llevan a la aparición de la enfermedad. La resistencia a la insulina sostenida induce una mayor secreción de ésta por parte de la célula beta pancreática, 13 7

Recibido para publicación el 06 de Octubre de 2014. Aceptado el 27 de Octubre de 2014.

la cual con el fin mantener la euglicemia y compensar su déficit relativo, responde progresivamente aumentando la secreción de insulina hasta que falla. Dicho efecto parece ser determinado genéticamente y genera una serie de alteraciones metabólicas representadas inicialmente por hiperglicemia de ayuno (HA) e intolerancia a los hidratos de carbono (IHC), los cuales finalmente llevan al desarrollo de una diabetes manifiesta. La enfermedad puede ser controlada inicialmente con cambios en los hábitos de vida, en especial en el comportamiento alimentario y aumento de la actividad física, con la ingesta de diversos antidiabéticos orales y posteriormente la administración de insulina. La diabetes se presenta como una de las enfermedades más frecuentes en la práctica clínica, con una prevalencia del 7.5 % a nivel mundial. En nuestro medio se ve influenciada en forma importante dependiendo de la Revista Medicina Vol. 13 No. 2 Diabetes mellitus 2: abordaje paso a paso Pág. 1 de 8


Diabetes mellitus 2: abordaje paso a paso

referencia poblacional urbana o rural. La diabetes se puede clasificar básicamente en 3 tipos: · La tipo 1, de origen autoinmune, que requiere insulina (insulinodependiente). · La tipo 2 se asocia a obesidad y sedentarismo (puede o no ser insulinorequiriente). · Y la diabetes secundaria (gestacional, medicamentosa o por pancreatectomia). Es fundamental para su tratamiento conocer los criterios diagnósticos: · Glicemia en ayunas >126mg/dl. · Glicemia poscarga de glucosa 2h de 75 gr >200mg/dl. · Glicemia al azar >200mg/dl sintomática (poliuria, polidipsia, polifagia, pérdida de peso). · HbA1C > 6.5%. Se habla de estado prediabético cuando se tiene glicemia en ayunas de 100 a 125mg/dl, glicemia poscarga entre 140-200mg/dl y HbA1C entre 5,7 y 6,4%. Estos pacientes tienen alto riesgo de desarrollar diabetes, por lo cual se hace énfasis en la importancia de cambios en el estilo de vida y seguimiento. El abordaje de la enfermedad ha evolucionado en los últimos años con significativos avances, recibidos con atención por el personal médico, ante las dificultades existentes en el adecuado control glicémico y tratamiento que obliga a una actualización permanente. El control glucémico, dado por la hemoglobina A1 glicada ha permitido disminuir las complicaciones micro y macro vasculares, sin embargo, mediante estudios a largo plazo se ha podido mostrar mejoría en la mortalidad cardiovascular con los diversos grupos farmacológicos existentes, los cuales además pretenden evitar la hipoglicemia y otros eventos adversos. Idealmente la meta esperada es un control glucémico en un tiempo prudente de 3-6 meses. En esta revisión temática se tiene como objetivo indicar las pautas actualizadas sobre el manejo paso a paso de la hiperglucemia en un ambiente ambulatorio, excluyéndose el manejo hiperglicémico intrahospitalario. Monitorización y seguimiento Después de realizado el diagnóstico y de iniciar el manejo, vamos a encontrar diferentes grupos de 14 7

Artículo de Revisión

pacientes, sin embargo siempre ha de realizarse el tratamiento de forma individualizada. El tratamiento inicial de todo paciente diabético está dirigido a la obtención de un óptimo nivel educativo que le permita tener los conocimientos necesarios para poder llevar a cabo un buen control metabólico de la enfermedad, dirigido a la prevención de las complicaciones agudas y crónicas dentro de los mejores parámetros de calidad de vida posibles. Por una parte la adquisición de un hábito alimenticio adecuado que le permita disminuir de peso, cuando haya sobrepeso u obesidad, o mantenerlo, cuando éste sea normal, y por otra, el incremento de la actividad física con los beneficios que esto conlleva. Son dos de los pilares fundamentales en que se basa el tratamiento de la diabetes. Podríamos dividir para el manejo la población con DM2 en dos grupos. Un primer grupo es el conformado por aquellos paciente inicialmente tratados con dieta, ejercicio y antidiabéticos orales; generalmente éstos no van a requerir monitoreo estricto con glucometrias. Y un segundo grupo, correspondiente a los pacientes que reciben insulina basal, los cuales han de realizarse una glucometría al día. Es por tanto requisito básico para en adecuado control y seguimiento de la enfermedad el suministro y la capacitación en el uso y lectura del glucómetro para la adherencia y el control glucémico. Por otra parte, la hemoglobina glicada debe monitorizarse al menos 2 veces al año o cada 3 meses en aquellos de difícil control. En la actualidad el tratamiento de la diabetes tipo 2 tiene unas metas de control metabólico muy claras y estrictas, tendientes a evitar el desarrollo de complicaciones micro y macroangiopáticas. Metas a tener en cuenta: · HbA1C <7% (se puede tolerar hasta 8% en grupos especiales de pacientes y en ancianos, por el riesgo de hipoglicemia). · Glicemia en ayunas entre 70 y 120 mg/dl. · Postprandial ideal < 140 mg/dl.; aceptable <180mg/dl. · Colesterol LDL <100 mg/dl. · Tensión arterial <130/80.

Revista Medicina Vol. 13 No. 2 Diabetes mellitus 2: abordaje paso a paso Pág. 2 de 8


Diabetes mellitus 2: abordaje paso a paso

Artículo de Revisión

creatinina >1,4mg/dl., condiciones que obligan a suspender su uso. Sería aconsejable utilizar con precaución en estados agudos como la falla cardiaca, renal, hepática, acidosis láctica y en paciente sometidos a estudios con contrastes. En general puede concluirse que no ha de usarse en pacientes hospitalizados o agudamente enfermos.

OBJETIVOS DEL CONTROL DE GLUCEMIAS CUADRO 1. Tomado del Manual de ACME 2013

Grupos farmacológicos para control glucémico. Metformina (Biguanidas) Inhibe la neoglucogénesis hepática. Es el fármaco inicial de elección en todos los pacientes con diabetes tipo 2 (salvo intolerancia o contraindicación). Es el único antidiabético que ha demostrado una reducción de la mortalidad. * Medicamento de primera elección en la diabetes tipo 2. * Activa el sistema AMP-kinasa. * Disminuye la producción hepática de glucosa. * Aumenta las concentraciones de péptido relacionado con el glucagón tipo 1 endógeno. * Aumenta la sensibilidad de la insulina en el músculo. * Interviene con el metabolismo de la glucosa y lactato a nivel gastrointestinal. * Reduce la HbA1C de 1-2%. Presentación farmacológica Tabletas de 800 mg., incluida en el plan obligatorio de salud (POS) colombiano. Otras presentaciones: Tabletas de 500 mg. y 1000 mg., no POS, o combinados con sulfonilureas o con inhibidores de la dipeptidel dipeptidasa IV (iDDP IV). No POS Consideraciones terapéuticas: es una terapia económica, con buen perfil de seguridad y bajos efectos hipoglicemiantes, buena experiencia acumulada en diabéticos con sobrepeso y obesidad mórbida, ya que mejora el perfil lipídico; se puede utilizar en conjunto con otros antidiabéticos orales e incluso combinado con insulina como terapia mixta. Importante inconveniente: en paciente con disfunción renal, con TFG <30ml/min. y 15 7

Por otra parte, presenta en su empleo un problema fundamental dado por intolerancia gastrointestinal, que en ocasiones obliga a la suspensión del medicamento por náuseas, vómitos y diarrea, reportado en un 12 al 53%; el sabor metálico y el dolor abdominal son otros efectos secundarios. Estos síntomas pueden manifestarse al iniciar la medicación y pueden desaparecer en un corto plazo; también puede disminuirse al utilizar la presentación de liberación prolongada o combinarla con los iDDP IV, evidenciándose menos porcentajes de eventos gastrointestinales. Para su dosificación se recomienda iniciar con ½ tab. de 850 mg durante la primera semana con el almuerzo o la cena, y posteriormente aumentar la dosis las 3 primeras semanas hasta llegar a una c/12h con la precaución de la dosis máxima indicada de 850mg c/8h. Si el paciente no logra las metas de hemoglobina A1 glicada debemos combinarlos con otros antidiabéticos. Sulfonilúreas (Secretagogos de Insulina) Estos medicamentos se unen a su receptor (SUR 1) en la célula beta pancreática, lo que resulta en la secreción de insulina por medio de la bomba ATPasa. Se le atribuye también un efecto sobre la inhibición en la formación de glucosa a nivel hepático, reduce la HbA1C en 1-2%. Estimulan la secreción de insulina preformada en el páncreas. Reducen el riesgo de complicaciones microvasculares y a largo plazo también las macrovasculares. Como ventajas tiene la rapidez en el control glucémico, económico y experiencia acumulada. Presentación farmacológica: Glibenclamida 5 mg. (POS) o combinada con otros antidiabéticos orales: Metformina 500 mgs. o de 850 mgs., Glimepirida tab. 2 mg. y 4 mg., y Glicazida tab. 30mg (no POS). Consideraciones terapéuticas: Como desventajas tenemos la pérdida del control glicémico a los 2 años de uso (por agotamiento de las células beta), mayor riesgo de hipoglicemia y aumento de peso alrededor de 2 kg. Revista Medicina Vol. 13 No. 2 Diabetes mellitus 2: abordaje paso a paso Pág. 3 de 8


Diabetes mellitus 2: abordaje paso a paso

Por ser la glibenclamida el grupo con mayor representación de uso en el formulario de nuestro país en el POS, la vida media larga de este medicamento debe tenerse en cuenta, ya que una vez presentada una hipoglicemia grave como efecto adverso, el paciente debe ser hospitalizado por lo menos 72h, evaluar la función hepática y renal, ya que si tenemos una TFG <50ml/min. Se contraindica su uso. La dosis máxima real en la clínica a utilizar es de 10 mg / día. Dosis mayores aumenta el riesgo de hipoglicemia. Moléculas de última generación como glimepirida a dosis de 2 a 8 mg /día y glicazida a dosis de 30 a 120 mg /día tienden a producir menos hipoglicemia, con ventajas favorables a nivel cardiovascular, endotelial y de célula beta. INHIBIDORES DE LA DIPEPTIDIL PEPTIDASA IV Su mecanismo de acción está relacionado con la disminución en el catabolismo de las hormonas incretinas. El efecto incretina es aquel en el cual una carga de glucosa oral produce una mayor elevación de los valores de insulina, comparado con una carga intravenosa. Este efecto se explica por la secreción de las hormonas incretinas gastrointestinales llamadas GLP-1 y polipéptido inhibitorio gástrico o polipéptido insulinotrópico dependiente de glucosa; estas hormonas actúan a nivel de célula pancreática, estimulando la secreción de insulina. Además, actúan en el SNC en las vías de la saciedad y por ende en la orden de suspensión de la alimentación. Los iDDP IV, inhiben la enzima DDP IV, la cual impide la degradación de la GLP-1 lo que aumenta el efecto incretina de esta hormona. Tienen la ventaja de no producir hipoglicemia, tienen efecto neutro en el peso, disminuyen la HbA1C en 0,7% y presentan escasas reacciones alérgicas. Tienen como desventaja su elevado precio comparado con otros antidiabéticos orales, y que aún faltan seguimientos a largo plazo sobre su seguridad para el riesgo de pancreatitis y tumores neuroendocrinos. Se recomienda usar estos medicamentos con precaución en pacientes con disfunción renal y hepática. Presentaciones farmacológicas: Sitagliptina 50mg a 100 mg / dia, Sexagliptina 5mg /dia, Linagliptina 5 mg /dia, Vildagliptina 50 mg 2 veces al dia. Pueden usarse solas o combinados con otros antidiabéticos. Ninguno de ellos está incluida en el POS. 16 7

Artículo de Revisión

INHIBIDORES DE LA SGLT-2 Son polipéptidos con una estructura similar al GLP-1 intestinal, pero con modificaciones en su estructura que impiden su degradación por la enzima DPP-4, por lo que tienen una vida media prolongada. Los SGLT-2 están localizados en el riñón y son responsables de absorber la mayoría de la glucosa filtrada, cerca del 90%; el otro 10% corresponde al SGLT1. Teniendo en cuenta que la glucosuria se presenta cuando se sobrepasa el umbral renal de la glucosa con un valor >180mg/dl., al inhibir el SGLT-2 se puede eliminar glucosa por la orina y de esta forma mejorar las cifras de glicemia. Tales medicamentos permiten eliminar glucosa en un valor de 60 a 90 gr/día, disminuyen la HbA1C en 0.5%, controlan la glicemia en ayunas y posprandial y no aumentan de peso, por el contrario, se considera que lo disminuyen. Además, pueden combinarse con otros hipoglucemiantes. Otros beneficios relacionados conocidos son a nivel cardiovascular; se considera que disminuyen la tensión arterial sistólica en unos 5 mmHg., y mejoran el perfil lipídico. Pero se contraindica su empleo en pacientes con disfunción renal. Presentación farmacológica: Glifozinas: Dapaglicofozinas, Canaglifozinas, Empaglifozina e Ipraglifozina. Ninguna de ellas está disponible en el POS. ANÁLOGOS DE GLP-1 Cuando es muy baja o se ha agotado la disposición y producción de insulina por las células beta o no es posible el control glucémico con antidiabéticos orales, ha de considerarse esta opción de tratamiento, sola o en combinación según sea el caso. Son análogos humanos con un buen control glicémico, por efecto incretina, mejoran el perfil lipídico y disminuyen la tensión arterial sistólica, aumentan la insulina, disminuyen el glucagon y el umbral de la saciedad, lo cual favorece la disminución de peso; reducen la HbA1C en 0,5 a 1 %, y no causan hipoglicemia. La desventaja es el alto costo y la vía de administración; su presentación es inyectable para aplicación subcutánea. Están contraindicados en pacientes con disfunción renal. Los efectos adversos más frecuentes son a nivel gastrointestinal, náuseas, vómitos y diarrea, además Revista Medicina Vol. 13 No. 2 Diabetes mellitus 2: abordaje paso a paso Pág. 4 de 8


Artículo de Revisión

Diabetes mellitus 2: abordaje paso a paso

retardo en el vaciamiento gástrico con las molestias que esto puede acarrear. Presentación farmacológica Exanatide(Byetta) lapicero prellado de 5 mcg; dosis de 5 mcg 2 veces al día por 4 semanas y luego se incrementa 10 mcg 2 veces al día. Liraglutide(Victoza) lapicero prellado de 3 ml con 6 mg/ml; dosis 0,6 mg una vez al día y se aumenta a 1,2 mg después de una semana. Máxima dosis 1.8 mg /día. Son no POS. Otras terapias incluyen medicamentos como las tiazolidinedionas y la acarbosa, con un perfil de riesgo alto y efectos adversos mal tolerados, lo hace que sean antidiabéticos orales poco utilizados en la práctica clínica. Su uso debe establecerse por especialistas ante un perfil particular de pacientes y que ameriten seguimiento estricto.

INSULINAS Son los medicamentos más potentes para el control glucémico, con la ventaja de no tener dosis máxima para alcanzar metas. Ventajas conocidas: * * *

Aumento del uso de glucosa. Disminución de la producción hepática de glucosa. Acciones anabólicas.

Gracias a las insulinas análogas se tiene mayor facilidad en el manejo de la diabetes, especialmente en aquellos que saben hacer conteo de carbohidratos; permiten una disminución en la tasa de hipoglicemias. Las insulinas se clasifican según el inicio de acción en: Rápida, Corta, Intermedia, Larga.

INSULINAS ACCIÓN Y DURACIÓN CUADRO 2 Tomado de Guías ADA 2013

Las indicaciones de insulina son: la DM tipo 1, complicaciones agudas de la diabetes (cetoacidosis y estado hiperosmolar), pobre control glucémico a pesar de tratamiento oral (HbA1C >8% con medicamentos orales a dosis altas) y/o inyectables con DM tipo 2. Insulinizacion: Iniciándose insulina en diabéticos tipo 2 a una dosis de (0,2 u/kg/día ) 100% basal; para efectos 17 7

prácticos se inicia con 10 UI; en los diabéticos tipo 1 se inicia de 0.5u/kg/dia 50% basal y 50% preprandiales. Recomendaciones de la ADA y la AACE. Posteriormente según la evolución se va aumentando o disminuyendo la dosis de insulina cada tres días según la glucometría en ayunas, asi:

Revista Medicina Vol. 13 No. 2 Diabetes mellitus 2: abordaje paso a paso Pág. 5 de 8


Diabetes mellitus 2: abordaje paso a paso

· · · · ·

Glucometría >180mg/dl: adicionar 4ui. Glucometría 140-180mg/dl: adicionar 2ui. Glucometría 110 a 139: adicionar 1ui. Glucometría <70mg /dl: disminuir dosis total 10 a 20% Glucometría <40 mg/dl: disminuir dosis total 20 a 40%

Cuando el paciente ha alcanzado las metas de glicemia en ayunas pero persiste la HbA1C > 7% se adiciona una insulina prandial preferiblemente con el almuerzo; en ocasiones puede llegar a requerir tres aplicaciones prandiales (esquema basal-bolos) distribuidos 50/50, explicado anteriormente. Según el Articulo 39 del POS contenido en el Articulo 1 del acuerdo 029 del 2011 se cubre 1 glucómetro anual, 100 tirillas y 100 lancetas para los diabéticos tipo 1; para los DM tipo 2 1 glucómetro anual, 50 lancetas y 50 tirillas.

Artículo de Revisión

La terapéutica de la hiperglicemia según HbA1C recomendada por la ADA y la AACE puede consultarse en la tabla 3. -HbA1C < 7.5 %: usar como primera línea Metformina, un receptor del GLP -1 o un iDDP IV. En los tres meses siguientes se hace control y si persiste HbA1C >6.5 % se inicia terapia dual. -HbA1C >7.5%: O fracaso de monoterapia. Se continúa Metformina o la monoterapia inicial elegida y se adiciona un receptor GLP-1 o un iDDPIV. Si a los tres meses persiste fuera de las metas pasamos a terapia triple con cualquiera de las combinaciones disponibles. -HbA1C >9%: En estos casos si el paciente está sintomático se inicia insulina sumada según la condición clínica a otros medicamentos, por ejemplo metformina. Si el paciente no tiene síntomas de falla de célula beta se recomienda iniciar terapia dual o terapia triple de entrada. Ver algoritmo de la ADA.

ALGORITMO PARA CONTROL GLUCEMICO CUADRO Tomado Guías ALAD 2013

18 7

Revista Medicina Vol. 13 No. 2 Diabetes mellitus 2: abordaje paso a paso Pág. 6 de 8


Diabetes mellitus 2: abordaje paso a paso

Bibliografía 1. Ismall-Beige F, Moghissi E, Ticktin M, Hirsch IB, Inzucchi SE, Genuth S. Individuallizing glycemic target in tipe 2 diabetes mellitus: Implications of reent clinical trials. Ann Intern Med. 2011: 154(8) 554-9 2. Guia de práctica clínica sobre la diabetes mellitus tipo 2 (DM2), Ministerio de Protección social, Fundación Santa Fe Bogotá. Centro de Estudios de Investigacion en Salud ed. Ministerio de Protección Social; Bogotá; Colombia, 2010.

Artículo de Revisión

Safety of Liraglutide. Diabetes resp. clin. pract. 97 (2012) 2742. 15. Glycemic Management of Type 2 Diabetes Mellitus Engl Med. Ismail-Beigi f. 2012; 366:1319-27. 16. Glycated Hemoglobin, Diabetes, and Cardiovascular Risk in Nondiabetic Adults. Selvin E. Steffmwzhu, et al. N. Engl J Med 2010; 362:800-811.

3. Standards of Medical Care in Diabetes 2012. Diabetes Care 2012; 35 (suppl.1)s11-s63.

17. Alemán JJ, Artola S, Franch J, Mata M, Millaruelo JM y Sangrós J, en nombre de la RedGDPS. Recomendaciones para el tratamiento de la diabetes mellitus tipo 2: control glucémico. 2014. Disponible en: http://www.redgdps.org/

4. Salas-Salvadó J, Bulló M, Estruch R, Ros E, Covas MI, Ibarrola-Jurado N, et al. Prevention of diabetes with Mediterranean diets: a subgroup analysis of a randomized trial. Ann Intern Med. 2014; 160(1):1-10.

18. American Diabetes Association. Standards of medical care in diabetes--2014. Diabetes Care. 2014;37 Suppl 1:S14-80. 19. Trends in Endocrinology and Metabolism 2009; 20: 194.

5. Nathan D. Initial Management of Glycemia in type 2 Diabetes Mellitus. The New England J Med 2002;347:1342137. 6. Subirats Bayego E, Subirats Vila G, Soteras Martínez I. Prescripción de ejercicio físico: indicaciones, posología y efectos adversos. Med Clin (Barc). 2012; 138 (1): 18–24. 7. United Kingdom Prospective Diabetes Study Group (UKPDS) Intensive Blood Glucose Control with Sulphinylurea or Insuline Compared with Conventional Treatment and Risk of Complication Patients with Type 2 Diabetes. Lancet 1998;352 (9131): 837-53. 8. Khan, SE et al. Diabetes Care 2008; 31:845-51. 9. Inzucchi SE, Bergenstal RM, Buse JB, Diamant M, Ferrannini E, Nauck M, et al.; American Diabetes Association (ADA); European Association for the Study of Diabetes (EASD). Management of hyperglycemia in type 2 diabetes: a patientcentered approach: position statement of the American Diabetes Association (ADA) and the European Association for the Study of Diabetes (EASD). Diabetes Care. 2012; 35 (6):1364-79. 10. Endocrine review 2008; 29: 317-333. 11. Albarrán J. Ejercicio físico y diabetes. Endocrinología 2º ed. Actualización Sección IX - Diabetes. 2011: 139-143. 12. Carrillo Fernández L. Dieta y Diabetes. Diabetes Práctica 2011 RedGDPS, suplemento nº 5: 16-18.

20. The ORIGIN Trial investigators. Basal insulin and cardiovascular and other outcomes in dysglycemia. N Engl J med. 2012; 367: 319-28 21. White WB, Cannon CP, Heller SR, Nissen SE, Bergenstal RM, Bakris GL, et al.; EXAMINE Investigators. Alogliptin after acute coronary syndrome in patients with type 2 diabetes. N Engl J Med. 2013;369(14):1327-35. 22. Bi Y Wang T, Xu Y, Li M, Lu J. et al. Advanced research on risk factors of type 2 diabetes Metab Res Rev. 2012; 28 Suppl 2: 32-9. 23. Executive Summary: Standards of Medical Care in Diabetes-2012. Diabetes Care 2012; 35. Supl 1:S11-S63 24. The Diabetes Control and Complications (DCCT) Research Group. Effect of Intensive Therapy on the Development and Progression of Diabetic Nephropathy in the Diabetes Control and Complications Trial. Kidney Int. 1995; 47:1703-1720. 25. American Diabetes Association. Diagnostic and Classification of Diabetes Mellitus. Diabetes Care 2012:35 (suppl 1) : s64-s71. 26. Diabetes Care 2013, vol. 36, supplement 1, January 2013. 27. Dan L. Longo, Dennis L. Kasper, J. Larry Jameson, Anthony S. Fauci, Stephen L. Hauser, Joseph Loscalzo en: Harrison Principios de Medicina Interna 18a edición. McGraw-hill. 28. Khan, SE et al. Diabetes Care 2008; 31:845-51.

13. AACE Comprehensive Diabetes Management Algorithm, Endocr. pract. 2013;19 (no. 2) 14. Bode B. an Overview of Pharmacocinetics, Efficacy and 19 7

29. The ACCORD study group. Effects of intensive blood pressure control in type 2 diabetes mellitus. N Engl J Med 2010;362:1575-85. Revista Medicina Vol. 13 No. 2 Diabetes mellitus 2: abordaje paso a paso Pág. 7 de 8


Diabetes mellitus 2: abordaje paso a paso

30. Saxena R, Elbers CC, Guo Y, Peter I, Guant TR, Mega JL, et al. Large –scale genercentric meta-analysis acroaa 39 studies identifies type 2 diabetes loci. Am J Hum Genet. 2012; 90:41025. 31. Heianza Y, Hara S, Arase Y, Saito K, Fujiwara K, Tsuji H, et al. HbA1c 5·7-6·4% and impaired fasting plasma glucose for diagnosis of prediabetes and risk of progression to diabetes in Japan (TOPICS 3): a longitudinal cohort study. Lancet. 2011;378(9786):147-55. 32. Standars of Medical Care in Diabetes 2014. Diabetes Care 2014; 37: S14-80. 33. Parati B, Bilo G Ochoa JE. Benefits of Tight Blood Pressure Control in Diabetic PatientsWith Hipertensión Importance of early and sustained implementation of effective treatment strategies. Diabetes Care 34(Suppl. 2):S297–S303, 2011. 34. AACE/ACE Consensus Stament by an American Association of Clinical Endocronologists /American Collage of Endocrinology Consensus Pane 1 on type 2 Diabetes Mellitus: An Algorithm for Glycemic Control. Endocrine Practice 2009;15(6). 35. Initial Insulin in Patients with Type 2 Diabetes. Adrian NC, LAU md, Tenrence Tang, Henry Halapy et al. CMAJ 2012; 184 (7). 36. Gómez-Huelgas R, Martínez-Castelao A, Artola S, Górriz JL, Menéndez E; Grupo de Tabajo para el Documento de Consenso sobre el tratamiento de la diabetes tipo 2 en el paciente con enfermedad renal crónica. Documento de Consenso sobre el tratamiento de la diabetes tipo 2 en el paciente con enfermedad renal crónica. Nefrologia. 2014;34(1):34-45. 37. Arguedas JA, Leiva V, Wright JM. Blood pressure targets for hypertension in people with diabetes mellitus. Cochrane Database Syst Rev 2013; 10:CD008277 38. Reboldi G , Gentile G, Angeli F, Ambrosio G, Mancia G, Verdecchia P. Effects of intensive blood pressure reduction on myocardial infarction and stroke in diabetes: a meta-analysis in 73. 913 patients. Journal of Hypertension 2011, 29:1253–1269.

Artículo de Revisión

global perspective on safety, efficacy and patient preference. Clin Med Insights Endocrinol Diabetes. 2011; 4:47-62. 42. Buse JB, Bergenstal RM, Glass LC, Heilmann CR, Lewis MS, Kwan AY, et al. Use of twice-daily exenatide in basal insulin-treated patients with type 2 diabetes: A randomized, controlled trial. Ann Intern Med. 2011; 154: 103-12. 43. Cooper-DeHoff RM, Gong Y, Handberg EM, Bavry AA, Denardo SJ, Bakris GL, et al. Tight blood pressure control and cardiovascular outcomes among hypertensive patients with diabetes and coronary artery disease. JAMA. 2010;304(1):618. 44. Cederholm J, Gudbjörnsdottir S, Eliasson B, Zethelius B, Eeg-Olofsson K, Nilsson PM; NDR. Systolic blood pressure and risk of cardiovascular diseases in type 2 diabetes: an observational study from the Swedish National Diabetes Register. J Hypertens 2010; 28:2026–2035. 45. American Diabetes Association. Standards of medical care in diabetes--2014. Diabetes Care. 2014; 37 Suppl 1:S14-80. 46. Zhang X, Gregg EW, Williamson DF, Barker LE, Thomas W, Bullard KM, Imperatore G, Williams DE, Albright AL. A1C level and future risk of diabetes: a systematic review. Diabetes Care 2010; 33:1665–1673. 47. Menéndez Torre, E. El nuevo «Position statement of the ADA/EASD on the management of hyperglycemia in type 2 diabetes». Perspectiva desde el Grupo de Trabajo de Consensos y Guías Clínicas de la Sociedad Española de Diabetes. Av Diabetol. 2012;28(4): 79-80. 48. Nilson PM, Cederholm J. Diabetes, Hypertension, and Outcome Studies: Overview 2010. Diabetes Care 2011; 34 ( suppl 2): s109-s113. 49. Endocrine Practice Vol 19 (Suppl 2) May/June 2013. 50. Mechanick JI, Garber AJ, Handelsman Y, Garvey WT. American Association of Clinical Endocrinologist´s position statement on obesity and obesity medicine. Endocr Pract. 2012; 18: 642-648.

39. Pedrianes Martin PB de Pablos Velasco PL. Seguridad y tolerabilidad de los antidiabéticos orales en el tratamiento de la diabetes mellitus tipo 2. Med Clin (Barc). 2010; 135 Supl 2: 206. 40. C a n a d i a n Ta s k F o r c e o n P r e v e n t i v e H e a l t h Care.Recommendations on screening for type 2 diabetes in adults. CMAJ 2012; 184(15): 1687-1696. 41. Yabe D, Seino Y. Liraglutide in adults with type 2 diabetes: 20 7

Revista Medicina Vol. 13 No. 2 Diabetes mellitus 2: abordaje paso a paso Pág. 8 de 8


Vol. 13 No. 2, 2014 (Julio-Diciembre)

Revista Medicina

Self, self verdadero y falso, y su relación con el objeto* Self, true Self and false Self, and its relation to the object Dr. Ricardo Camilo Rueda Mora Psicólogo, Magíster en Psicología Clínica Docente Universidad del Sinú -Elías Bechara ZainúmMontería, Colombia e-mail: camilorueda84@gmail.com Resumen Se realiza una delimitación de los conceptos de Self y Self Verdadero y falso, así como una explicación de cómo se encuentran relacionados entre sí. Posteriormente se relacionan estos conceptos con la comprensión psicoanalítica del objeto y sus cualidades y funciones respecto a la estructuración del Self. Se espera que esta revisión conceptual sea un insumo que ayude a la comprensión de las problemáticas actuales relacionadas con el establecimiento de la subjetividad y la relación con el otro. Palabras clave: Concepto de Self, Self verdadero, falso self, objeto, relaciones de objeto, psicoanálisis. Summary A delimitation of the concepts of Self and Self True and false, and an explanation of how they are interrelated is performed. Later these concepts relate to psychoanalytic understanding of the object and its attributes and functions regarding the structuring of Self. It is expected that this conceptual revision is an input to assist the understanding of current issues related to setting the subjectivity and the relationship with the other. Keywords: Concept of Self, Self true, false self, object, object relations, psychoanalysis.

El presente trabajo busca delimitar el concepto de Self, con los conceptos de Self verdadero y falso, así como la relación de estos tres conceptos con los objetos, razón por lo cual también se hace necesario aclarar qué se entiende por objeto desde el psicoanálisis. El propósito de esto es brindar una herramienta conceptual y clínica para comprender una de las problemáticas propias de nuestro tiempo, a saber, el sinsentido, vacío, desazón y desarraigo por la vida, consecuencia de las lógicas relacionales de nuestro tiempo, y de fallas en la vivencia y estructuración del self. De ahí que sea fundamental la comprensión de este concepto y su relación con otros conceptos que lo estructuran. El self verdadero solo puede existir si la madre se lo permite. Recordemos que el self verdadero es el núcleo de la personalidad o potencial heredado, y que solo comienza su existencia cuando la madre es capaz de reconocer su acción, y no solo de reconocerla sino también de permitir que surja. Para esto, es importante que la madre en principio pueda ser un ambiente confiable y tranquilo para el infante, permitiendo que éste pueda empezar a vivir la experiencia de estar a solas en presencia de la madre, ya que él mismo introyecta ese

ambiente confiable. Si esta experiencia puede darse, el infante se encontraría en un estado de relajación, donde puede permanecer por un rato no integrado de forma tranquila y gratificante, y en donde en algún momento puede salir una descarga motora que exprese una necesidad instintiva propia, esto sería el gesto espontáneo (Winnicott, 1958/2009). Este gesto entonces es la acción del self verdadero, que solo adquiere sentido y se afirma cuando la madre se percata y la satisface dotándola de sentido, y de una forma tal que el bebé siente que aquellos que lo gratifica y lo gratificante provienen de él mismo. Diríamos entonces, que una madre capaz de adaptarse de esta forma a su hijo es una madre suficientemente buena, y que logra que su hijo tenga una experiencia ilusoria en donde todo depende de su creatividad y omnipotencia, pero que poco a poco si la madre sigue con su buena adaptación, le permite percatarse del carácter ilusorio de la experiencia y darse cuenta de que se encuentra jugando o imaginando. En este punto, es importante mencionar, que entre la madre y el bebé hay una cosa, actividad o sensación que sirve como puente entre los dos. Si ese elemento intermedio sirve como puente, va a ser la base

*Este trabajo es producto de la investigación titulada: El self y los objetos en los tiempos hipermodernos. Presentada como trabajo de grado para optar al titulo de Magister en Psicología Clínica de la Pontificia Universidad Javeriana (2010). Investigación dirigida por el Doctor en Psicología, Mario Fernando Guerrero.

21 7

Recibido para publicación el 01 de Diciembre de 2014. Aceptado el 15 de Diciembre de 2014.

Revista Medicina Vol. 13 No. 2 Self, self verdadero y falso, y su relación con el objeto Pág. 1 de 6


Self, self verdadero y falso, y su relación con el objeto

de la simbolización (Esto se refiere a los objetos y fenómenos transicionales) (Winnicott, 1960/2009). Por otra parte, una madre que no es suficientemente buena, no puede darse cuenta de las verdaderas necesidades de su hijo, y por el contrario, le impone sus propias demandas y reglas creando una base de sumisión. Lo que se estructura es entonces un self falso que busca proteger y ocultar al self verdadero, generando una vivencia de irrealidad y no existencia. Cuando la disociación o distancia entre el self verdadero y falso es muy grande, no hay cabida para la creatividad y la espontaneidad, e incluso el self falso puede ser tomado como real. Así mismo, si esta experiencia de omnipotencia no se presenta, no solo no se desarrolla el self verdadero, sino que la relación con el mundo y el objeto se vuelve desconfiada e inadecuada, no se da la capacidad de estar a solas, y el fenómeno que debería ser un puente entre el infante y el objeto se convierte más bien en un obstáculo. (Winnicott, 1960/2009).

Artículo de Reflexión

establecido como unidad con una piel. Lo que esta adentro hace parte del self, aunque no esencialmente, y puede ser proyectado. Lo que esta afuera no hace parte del self, o no de forma esencial, pero puede ser introyectado. Cuando hay salud se da un intercambio constante mientras el niño vive y va recogiendo experiencias, de tal forma que el mundo externo se enriquece por el potencial interior, y el mundo interno se enriquece con lo que proviene del exterior. “Finalmente el niño, que se ha convertido en un individuo maduro, puede percibir que existe lo verdaderamente ambiental, y esto incluye las tendencias heredadas así como la provisión ambiental, el mundo pasado y futuro, y el universo hasta ese momento desconocido.” (Winnicott, p.p. 129, 1963/2009).

Pero el self falso también es importante en la salud, pues es él que permite en cierta medida una renuncia a la omnipotencia y la inscripción del niño en los fenómenos sociales. Todo depende del grado de severidad del self falso, pues este cuando no oculta completamente al self verdadero, es el que le permite empezar a vivir. El concepto de self verdadero solo es necesario para explicar el de self falso, ya que en realidad no hace más que explicar todo lo que tiene que ver con la experiencia de estar vivo. (Winnicott, 1960/2009) El self como concepto se encuentra en el intermedio entre el self verdadero y falso. Se constituye cuando el self verdadero se concreta en la experiencia continua de seguir siendo y cuando la distancia no es muy grande con el self falso.

En este orden de ideas como dice Bollas (1987/2009) “El <<self>> de la persona es la historia de muchas relaciones internas. Cada infante, niño, adolescente y adulto (a lo largo de su ciclo de vida) experimenta las partes –en teoría son infinitas- del self articuladas por el juego de mudanzas de realidad interna y externa. Tan pronto como una de esas partes es objetivada (en el pensamiento o el sentimiento), en ese mismo acto adviene la existencia…A lo largo de una vida, objetivamos, conocemos y <<nos allegamos a>> los diferentes y varios estados de nuestro existir. Realidades emocionales y psicológicas traen consigo estados propios que pasan a ser parte de nuestra historia. Parece entonces que el concepto de self denota las posiciones y los puntos de vista desde los cuales percibimos, sentimos, observamos y reflexionamos sobre experiencias distintas y separadas en nuestro existir. Un punto de vista crucial nos viene del otro que nos experimenta.” (p.p. 25).

Por esto es importante en principio el rol de la madre, porque protege el seguir siendo del bebé, ya que las intrusiones o fallas en la adaptación de la madre, crean una reacción que quiebra su estado de seguir siendo. (Winnicott, 1963/2009) “Si la pauta de la vida del infante es reaccionar a las intrusiones, se produce una seria interferencia con la tendencia natural de la criatura a convertirse en una unidad integrada, capaz de seguir teniendo un self con pasado, presente y futuro. “ (Winnicott, pg. 113, 1963/2009).

Ahora bien, si prestamos atención a ésta definición del self podemos encontrar que se encuentra ligada al objeto, pues no solo depende su desarrollo de éste como lo vimos con Winnicott, sino que constantemente es transformado e influenciado por éste, y a su vez influye en ese objeto con el que se relaciona. Por esto resulta importante definir qué entendemos por objeto y qué relación tiene con el self, en cuanto a sus cualidades y funciones, y en cuanto a aquellos aspectos del self a los que transforma y ayuda a desarrollar.

Cuando se establece el self la realidad interior se vuelve un mundo personal en crecimiento, que se encuentra localizado tanto dentro como fuera del self que se ha

Sin embargo, no es sencillo definir el objeto como dice Green (2010) dado a que bajo este término se adscriben una gran multiplicidad de conceptos y a que no existe una

22 7

Revista Medicina Vol. 13 No. 2 Self, self verdadero y falso, y su relación con el objeto Pág. 2 de 6


Self, self verdadero y falso, y su relación con el objeto

concepción unificada del objeto. Sin embargo en este trabajo tomaremos solo algunas de sus acepciones, principalmente la de objeto externo y su representación, el objeto interno, teniendo en cuenta que esos objetos pueden ser percibidos como totales y parciales, y si son parciales de acuerdo a sus cualidades en especial la de bueno o malo (es decir basados en las sensaciones de satisfacción o frustración) (Klein, 1946). También será tomada en cuenta la función que cumplen en relación con el self, y para esto tomaremos como punto de referencia la definición de este concepto. Sin embargo antes de proseguir se hace necesario una breve introducción a la concepción de Klein a cerca de la vida emocional del bebé. Para Klein (1952/2003) durante los tres o cuatro primeros meses de vida el bebé siente una serie de ansiedades provenientes tanto del mundo interior como del exterior. Por un lado se encuentra la acción interna del instinto de muerte que produce temor al aniquilamiento y es fuente de angustias persecutorias, y por el otro el trauma del nacimiento que sería el prototipo de todas las angustias, pues es vivido como un ataque del mundo y por esto la relación de objeto se encuentra enmarcada en esta ansiedad persecutoria. Hay que aclarar que para Klein (1952/2003) la primera relación de objeto es con un objeto parcial, que no es otro que el pecho de la madre, al cual están dirigidas las pulsiones libidinales y destructivas. Las vivencias de gratificación y frustración son estímulos para las pulsiones libidinales y destructivas que Klein (1952/2003) empareja al amor y el odio, de tal forma que el pecho que gratifica se convierte en un objeto amado y bueno, mientras que el pecho que frustra se vivencia como odiado y malo. La antitesis entre el pecho bueno y el malo se debe en parte a la poca integración del yo y a los procesos de escisión que se dan en este y en los objetos. Sin embargo Klein (1952/2003) menciona que el pecho bueno y el malo están unidos por la presencia de la madre y que la relación con ella se va construyendo poco a poco durante este estadio. Algo que contribuye a la relación doble con el objeto (bueno y malo) son los procesos endopsíquicos de proyección e introyección , puesto que el bebé proyecta sus pulsiones amorosas al pecho gratificador mientras que las destructivas se las atribuye al frustrador, al mismo tiempo que por la introyección en el interior del bebé se instalan el pecho bueno y el malo. De esta forma la imagen tanto del objeto externo como interno se 23 7

Artículo de Reflexión

encuentra distorsionada en la mente del bebé por sus fantasías y por la proyección de sus pulsiones en el objeto. De esta forma el pecho bueno se vuelve en el prototipo de todo objeto gratificador y protector mientras que el pecho malo es el prototipo de todos los objetos perseguidores tanto internos como externos (Klein, 1952/2003). Las ansiedades persecutorias se ven aumentadas por la relación con el pecho malo, cuando el bebé dirige ataques fantaseados de destruir o devorar al objeto, estos se convierten en el elemento esencial de la ansiedad persecutoria pues el bebé cree que será destruido y devorado por el pecho malo. No obstante, la ansiedad persecutoria es contrarestada por la relación del bebé con el pecho bueno, que si bien se centran en la función de alimentación también se incluyen la forma en que la madre sostiene al bebé, su voz, su sonrisa y el hecho de que atienda sus necesidades. Todo esto hace que disminuyan las ansiedades persecutorias y que se fortalezca la confianza en el objeto (Klein, 1952/2003). Klein (1952/2003) describe que se da un proceso de escisión para alejar al objeto bueno del malo hasta el punto en que el otro deja de existir, de tal forma que el objeto bueno es idealizado y el malo se vuelve en un perseguidor terrible, esta escisión aumenta la ansiedad de persecución y es causada por ésta. Sin embargo cuando la ansiedad de persecución no es tan grande la distancia entre los dos objetos es menor y se llega a momentos de integración en donde se sintetizan los sentimientos hacia el objeto, pero esto solo puede darse cuando predominan los instintos de vida, es decir que la tendencia a la integración es una expresión de estos instintos. Durante los primeros meses los momentos de integración son breves, pero a medida que el bebé crece y se va desarrollando los momentos de integración son más prolongados y frecuentes. Sin embargo la síntesis de los sentimientos hacia el objeto trae consigo ansiedad depresiva, culpa y necesidad de reparar al objeto dañado. Así pues se entra en la posición depresiva, a partir del segundo trimestre se expresan cambios en el desarrollo intelectual y emocional del bebé; La relación con el mundo exterior es más diferenciada, sus intereses y gratificaciones aumentan, así como su capacidad de comunicarse y expresar sus emociones, cambios que indican el mayor desarrollo del yo. Al mismo tiempo se da un desarrollo psicosexual y empiezan a tomar fuerza las Revista Medicina Vol. 13 No. 2 Self, self verdadero y falso, y su relación con el objeto Pág. 3 de 6


Self, self verdadero y falso, y su relación con el objeto

Artículo de Reflexión

otras zonas erógenas, si bien aun hay un predominio de la oral. Esto trae consigo nuevas ansiedades, cambios en las fantasías, que aumentan y se vuelven más diferenciadas, y por lo tanto también traen consigo cambios en las defensas que se emplean (Klein, 1952/2003).

es decir, cuando el bebé que espera el pecho se encuentra con el pecho, el bebé se percata de que se dio la realización de ese hecho, formándose así una concepción. De esta forma las concepciones siempre estarán unidas a una experiencia de satisfacción (Bion, 2006).

La mayor integración permite un mayor reconocimiento de la realidad psíquica. La madre que se percibe como herida o dañada conduce a una identificación con este aspecto del objeto, lo que fortalece el impulso a reparar y la inhibición de las pulsiones agresivas. Se utiliza entonces la defensa maniaca (la negación, la idealización, la escisión y el control del objeto) para neutralizar ahora la ansiedad depresiva. El control del objeto cuando hay un predominio de la ansiedad depresiva es utilizado para impedir la frustración, inhibir la agresión y proteger a los objetos amados de la ansiedad depresiva. El proceso de escisión también cambia y el bebé ahora divide al objeto en un objeto indemne vivo y un objeto dañado. En la elaboración de la posición depresiva se da un enfrentamiento con la realidad y por lo tanto la imagen de los padres se vuelve más cercana a la realidad. Cuando el bebé introyecta una realidad tranquila, su mundo interno mejora y a su vez por proyección se mejora la imagen que tiene del mundo externo (Klein, 1952/2003).

Los pensamientos por su parte son el resultado de la conjugación de una preconcepción con una frustración, es decir, el bebé que espera el pecho se encuentra con un no-pecho para su satisfacción. Pero necesita de otro paso para convertirse en pensamiento, esto depende de la capacidad del niño para tolerar la frustración. Si el niño tiene una adecuada tolerancia a la frustración deviene un pensamiento, es decir, el niño decide modificar la realidad y por lo tanto puede esperar para posponer su satisfacción, se da lo que Freud (1911/2007) describe, en donde el principio de realidad y la capacidad de espera se ponen al servicio del principio del placer, y surge el pensamiento, todas sus operaciones y la posibilidad de una mayor satisfacción a largo plazo. Por el contrario si la capacidad para tolerar la frustración es inadecuada se intenta eludir la frustración en lugar de modificarla, y en vez de un pensamiento, surge un objeto malo, “indistinguible de una cosa-en-si-misma, adecuada solo para ser evacuada” (Bion, p.p. 154, 2006). Se desarrolla entonces un aparato para la identificación proyectiva en lugar de un aparato para pensar.

De esta forma se pueden sentar las bases para un self y la posibilidad de objetivar las experiencias emocionales y en general la vida psíquica. Sin embargo, para que se pueda dar esa experiencia objetivante es necesario que también se desarrolle un aparato para pensar los pensamientos, es decir, de un aparato que de sentido a la experiencia y la convierta en una verdadera experiencia emocional. Bion (2006) menciona que el pensar depende del resultado exitoso de dos desarrollos fundamentales: El desarrollo de pensamientos y el desarrollo de un aparato para pensar los pensamientos, en este sentido el pensar es un desarrollo impuesto por los pensamientos y no al revés. Los pensamientos pueden ser clasificados según la naturaleza de su desarrollo como preconcepciones, concepciones o pensamientos y conceptos. La preconcepción podría ser equivalente al concepto kantiano de pensamientos vacíos, un ejemplo de esto puede ser la teoría de que el bebé tiene una disposición innata a la expectación del pecho. Cuando la preconcepción se pone en contacto con una realización, 24 7

La intolerancia a la frustración puede obstruir el desarrollo de pensamientos y de la capacidad de pensar, si bien, esta última disminuye la sensación de frustración inherente a la apreciación de la distancia entre el deseo y su satisfacción (Bion, 2006). Con las concepciones se repite de forma más compleja el proceso que sucede con las preconcepciones. “Una concepción no necesariamente encuentra una realización que aproxime lo suficiente como para satisfacer. Si la frustración puede ser tolerada la conjunción de concepción y realización, ya sean positivas o negativas, inicia los procedimientos necesarios para aprender de la experiencia.” (Bion, p.p. 156, 2006). Si la intolerancia a la frustración no es tan grande como para activar los mecanismos de evacuación, pero es suficientemente intensa como para predominar sobre el principio de realidad, la personalidad desarrolla omnipotencia en lugar de la conjunción de la concepción o preconcepción con una realización negativa. Lo que implica que se asume la omnisciencia como sustituto del aprender de la experiencia con ayuda del pensar y los pensamientos. Revista Medicina Vol. 13 No. 2 Self, self verdadero y falso, y su relación con el objeto Pág. 4 de 6


Self, self verdadero y falso, y su relación con el objeto

Por otra parte el aparato preconceptual está adecuado para las realizaciones que caen dentro de las circunstancias adecuadas a la supervivencia del niño, siendo la personalidad del niño, una de las circunstancias que afectan la supervivencia del niño. Generalmente la personalidad del niño y otros elementos ambientales son manejados por la madre. Si la madre y el niño están adaptados el uno al otro, la identificación proyectiva cumple un papel importante en este manejo pues va dotando de un sentido de realidad rudimentario y frágil, y en este sentido la identificación proyectiva que habitualmente es una fantasía omnipotente, en este caso opera realísticamente, es decir en su condición normal y no patológica (Bion, 2006). Esta identificación proyectiva realística se evidencia en una conducta razonable calculada para despertar en la madre sentimientos de los que el niño desea liberarse. Si la madre es equilibrada podrá recibir estos sentimientos, transformándolos de tal modo que se los devuelve al niño en tal forma que sienta que puede manejarlos. Por el contrario cuando la madre no puede recibir estos elementos el niño se ve obligado a continuar utilizando la identificación proyectiva con mayor intensidad y frecuencia al igual que la reintroyección, lo que le queda a estos niños es la sensación de contener un objeto voraz que destruye todo y degenera los otros objetos de tal modo que más adelante son incapaces de recibir lo que les ofrece el ambiente. La habilidad de la madre para recibir estos datos del bebé y traducirlos, tienen como nombre la función alfa y la capacidad de reverie (Bion, 2006). La función alfa opera sobre impresiones sensoriales y las emociones que el paciente acepta. Si la función opera exitosamente se producen elementos alfa que son aptos para ser almacenados y satisfacer requerimientos de los pensamientos oníricos. En cambio si la función es perturbada las impresiones sensoriales y las experiencias emocionales permanecen inmodificadas, y se llaman elementos beta. Estos a diferencia de los elementos alfa no son tratados como fenómenos sino como cosas en si mismas y no pueden ser usados en el pensamiento onírico, aunque si en la identificación proyectiva y el acting out, una forma de pensamiento que depende de la manipulación de las cosas en si mismas, en donde la manipulación sustituye palabras e ideas y por lo tanto estos elementos son aptos principalmente para ser evacuados. Los elementos beta a diferencia de los alfa no son recuerdos, pero pueden ser almacenados 25 7

Artículo de Reflexión

como hechos no digeridos, mientras que los elementos alfa son digeridos por la función alfa y por lo tanto están disponibles para el pensamiento (Bion, 1980) La función alfa necesita de la capacidad de reverie o ensoñación de la madre, esto es, el estado anímico que está abierto a la recepción de cualquier objeto del objeto amado, en el caso de la madre-bebé se refiere a que la madre esta en disposición de recibir las identificaciones proyectivas del bebé, ya sean sentidas por este como buenas o malas. Estos contenidos que en principio son elementos beta, cuando hay reverie son metabolizados y convertidos en elementos alfa, es decir se vuelven experiencias emocionales y recuerdos susceptibles de ser usados como pensamientos. En este sentido la identificación proyectiva realística es no solo una primera forma de pensamiento en la que el niño se sirve de la madre sino el medio por el que en primera instancia se puede dar la función alfa (Bion, 1980). Cuando esta comunicación madre bebé (identificación proyectiva realística y función alfa) se ve obstaculizada podemos ver que se afecta la posibilidad de objetivar las experiencias del seguir siendo pues se afecta el aparato para pensar y se obstruye el fluido intercambio entre el mundo interno y el externo. Por otra parte también se afecta el modo en que percibimos y nos relacionamos con el mundo, es decir, la posición que tomamos frente al mundo, retomando los conceptos de posición esquizoparanoide y posición depresiva, en donde de un lado se percibe al mundo como peligroso y lleno de perseguidores y objetos parciales, mientras que en el otro la culpa y la posibilidad de reparación son lo más importante junto a una percepción del self y del objeto más integrada (Klein, 1946). Sin embargo como dice Bion (1980) en la vida mental sana, la oscilación entre las posiciones o como el llama las tendencias a la integración y desintegración es lo que permite el desarrollo, de tal forma que el estancamiento en uno de los polos lleva a la patología. El buen desarrollo también depende de la posibilidad de la oscilación de la función continente-contenido, que es el modelo de los intercambios entre el mundo interior y el exterior, así como el precursor de la creación de un espacio psíquico propio y de que se pueda dar la tendencia a la integración. En este punto el papel de la madre es fundamental pues es el primer objeto que cumple la función continente y por lo tanto es quien aglutina las partes del yo del infante, de tal manera que como realice esta función, que en cierta Revista Medicina Vol. 13 No. 2 Self, self verdadero y falso, y su relación con el objeto Pág. 5 de 6


Self, self verdadero y falso, y su relación con el objeto

Artículo de Reflexión

medida depende de la función alfa, implicará el como se van integrando tanto los datos sensoriales como el yo del infante, de esta forma, se pueden integrar como contenidos y objetos totales dotados de significado, o se pueden apelmazar siendo cosas en si mismas confusas y por lo tanto trayendo para el niño mayor confusión e imposibilidad de permanecer integrado. Así pues, para que se pueda dar un self con toda la complejidad del concepto se requiere de unos objetos constantes, que sean capaces de cumplir con las diferentes funciones. Es decir, se necesita de un objeto bueno o suficientemente bueno, para que sirva como núcleo de ese self. Bibliografía 1. Bollas, C. (1987/2009). La sombra del objeto. Buenos Aires: Amorrortu editores. 2. Bion, W. (1980). Aprendiendo de la experiencia. Barcelona: Paidós. 3. Bion, W. (2006). Una teoría del pensamiento. En: Volviendo a pensar. Buenos Aires: Ediciones Horme. 4. Freud, S. (1911/2007). Formulaciones sobre los dos principios del acaecer psíquico. En: Sigmund Freud Obras Completas. (Vol. XII). Buenos Aires: Amorrortu Editores. 5. Green, A (2010). El pensamiento clínico. Buenos Aires: Amorrortu Editores. 6. Klein, M. (1946/2003). Notas sobre algunos mecanismos esquizoides. En: Obras completas de M. Klein. (Vol.3). Buenos Aires: Paidós-Horme. 7. Klein, M. (1952/2003). Algunas conclusiones teóricas sobre la vida emocional del bebé. En: Obras completas de M. Klein. (Vol. 3). Buenos Aires: Paidós-Horme. 8. Winnicott, D. (1958/2009). La capacidad para estar solo. En: Los procesos de maduración y el ambiente facilitador. Buenos Aires: Paidós. 9. Winnicott, D. (1960/2009). La distorsión del yo en términos de self verdadero y falso. En: Los procesos de maduración y el ambiente facilitador. Buenos Aires: Paidós. 10. Winnicott, D. (1963/2009). De la dependencia a la independencia en el desarrollo del individuo. En: Los procesos de maduración y el ambiente facilitador. Buenos Aires: Paidós.

26 7

Revista Medicina Vol. 13 No. 2 Self, self verdadero y falso, y su relación con el objeto Pág. 6 de 6


Vol. 13 No. 2, 2014 (Julio-Diciembre)

Revista Medicina

Breve memoria del 1er. Simposio Internacional de Enfermedades Infecciosas Brief memory of the 1st. International Symposium of Infectious Diseases Dr. Álvaro Bustos González Pediatra Infectólogo Decano, Facultad de Ciencias de la Salud Universidad del Sinú -Elías Bechara Zainúm- Montería, Colombia e-mail: abustos53@hotmail.com

La evaluación de los beneficios de un simposio internacional al que asistieron profesionales de la salud de distintas áreas no plantea, per se, mayores dificultades. Podría decirse que un acontecimiento de estas características se justifica por sí mismo. Esta afirmación, sin embargo, que parece obvia, amerita una disección práctica y concreta, puesto que el evento se dio dentro del desarrollo de un proyecto de investigación de gran envergadura, el de Enfermedades Tropicales, que busca impactar positivamente el conocimiento que en el departamento de Córdoba se tiene sobre cuatro enfermedades infecciosas consideradas reemergentes, como el dengue, la malaria, la leishmaniasis y la tripanosomiasis o enfermedad de Chagas. Este evento, desde el punto de vista de las actividades desarrolladas o por desarrollar, estuvo inscrito, por su naturaleza, en el rubro de adquisición y divulgación del conocimiento, y en el de creación de redes académicas, que se establecen espontáneamente por la interacción de los investigadores foráneos con los propios, haciendo del intercambio verbal y conceptual una fuente de relaciones intelectuales perdurables. En el caso del dengue, cuyos virus son bastante mutantes y cuyos 4 serotipos circulan libremente en el país, la posibilidad de diagnóstico serológico a partir de 5º día de evolución de la enfermedad limita el diagnóstico precoz de la misma. En esta circunstancia, la Reacción en Cadena de Polimerasa (PCR) en tiempo real, que se implementará y estandarizará como parte del proyecto, adquiere una importancia capital, ya que con ella se puede hacer un diagnóstico de certeza a partir del primer día del proceso febril. Ahora bien, si se quisiera darle una mayor fuerza al diagnóstico temprano del dengue, existe la opción de combinar la PCR con la identificación del antígeno NS1 del virus, o con la prueba de detección de anticuerpos IgM. En este sentido, el aporte de la doctora Elizabeth Hunsperger fue novedoso y convincente. Igualmente importante y útil, dentro de las presentaciones de la doctora Hunsperger, fue su alusión a la posibilidad de predecir la evolución del dengue hacia la gravedad si se detecta en la sangre del enfermo la vitronectina, una proteína que muchas veces se asocia con las formas complicadas de la enfermedad, vale decir, el choque o la encefalopatía. En definitiva, ante la tendencia hiperendémica del dengue en Colombia, la vigilancia continua y el diagnóstico temprano, algo que se puede hacer a través de la PCR en tiempo real, llevarán a identificar anticipadamente cambios en la abundancia de los serotipos del virus, un fenómeno que por lo general antecede a la aparición de las epidemias, lo que permitiría intensificar los controles domiciliarios sobre el vector y reducir su transmisibilidad. Bien sabido es que la malaria constituye un problema de salud pública en algunas regiones del departamento de Córdoba, y que en áreas endémicas la población porta anticuerpos contra el parásito que no permiten que haya infecciones clínicamente manifiestas. Este hecho puede tener graves repercusiones en el caso de la malaria gestacional, en la que no siempre se visualizan los plasmodium a través de los exámenes habituales de gota gruesa y extendido de sangre periférica, produciéndose un efecto dañino sobre la placenta y, desde luego, sobre la nutrición del feto, llevando a abortos o a partos prematuros. Aquí nuevamente emerge la PCR en tiempo real, en sangre de la madre o del tejido placentario, como la solución a la incertidumbre diagnóstica. Una prueba molecular de diagnóstico rápido, como la que se implementa dentro del proyecto, puede evitar confusiones y preservar el futuro de la criatura. Una información jugosa sobre malaria, expuesta por la doctora María Fernanda Yasnot, y que parecía estar confinada al 27

Recibido para publicación el 23 de Octubre de 2014. Aceptado el 30 de Octubre de 2014.

Revista Medicina Vol. 13 No. 2 Breve memoria del 1er. Simposio internacional de enfermedades... Pág. 1 de 2


Breve memoria del 1er. Simposio internacional de enfermedades...

Artículo de Reflexión

Asia, tiene que ver con la presencia entre nosotros de formas graves o complicadas de la enfermedad por paludismo vivax, las cuales se atribuían casi exclusivamente a la infección por plasmodium falciparum. Lo llamativo de todo esto es que el substrato fisiopatogénico de dichas complicaciones y las complicaciones mismas son similares a las derivadas de la enfermedad por falciparum. De modo que ante un caso de malaria con compromiso de la conciencia, convulsiones o insuficiencia renal, nuestros clínicos deben estar alertas ante la posibilidad de que la causa sea un paludismo vivax y no un falciparum. Más aún, los fenómenos de citoadherencia y formación de rosetas (glóbulos rojos sanos adheridos a glóbulos rojos parasitados), que se aducen como la causa fundamental del paludismo cerebral, también se dan en el caso de los gametocitos de plasmodium vivax, explicando su alta infectividad a los mosquitos vectores. Con la leishmania, para el manejo de la infección cutánea, mucocutánea o visceral, el doctor Luis Rivas hizo énfasis en la toxicidad del tratamiento actual con antimoniales (glucantime). Como alternativa futura, planteó el uso de medicamentos que actúan sobre el metabolismo energético del parásito, en especial sobre la fosforilación oxidativa, y para el efecto mencionó sustancias como aminoquinolinas, miltefosina, estilbenos y B-aminoalcoholes, a la par que se refirió a la posibilidad de actuar selectivamente contra la mitocondria de la leishmania con el propósito literal de asfixiarla. Su enfoque, eminentemente bioquímico, condujo a los péptidos antimicrobianos, que hacen parte de la inmunidad innata, que se ocupa a su vez de frenar o eliminar el ingreso de organismos patógenos al cuerpo, y cuya manipulación podría abrir otra puerta al tratamiento de una infección que, en sus formas invasoras, no está exenta de dificultades terapéuticas. Finalmente, el dato más relevante que dejó el doctor Juan Carlos Dib en torno a la enfermedad de Chagas, de la cual ha habido casos recientemente informados en el departamento de Córdoba, se refiere a la posibilidad de que la infección, que suele penetrar al organismo a través de la piel o las mucosas por el rascado sobre las deyecciones de los pitos (agentes vectores), se dé por maceración del vector en alimentos contaminados, como ocurre en alguna comunidad de Brasil y como ocurrió hace poco en un restaurante caminero de los llanos orientales con una familia colombiana. Los beneficios concretos de un simposio internacional de esta índole, circunscrito a las cuatro enfermedades tropicales que constituyen el propósito de este proyecto de investigación, son innegables. No sólo es el repaso teórico del estado del arte en cada caso lo que infunde confianza y certezas, sino la asistencia masiva de profesionales de diversas disciplinas de la salud y la evidencia de que la Reacción en Cadena de Polimerasa (PCR) es el método diagnóstico rápido más confiable frente a estas enfermedades, lo que permite afirmar que, en cuanto a la difusión de un conocimiento moderno sobre los temas tratados, el objetivo se cumplió con creces.

28

Revista Medicina Vol. 13 No. 2 Breve memoria del 1er. Simposio internacional de enfermedades... Pág. 2 de 2


Vol. 13 No. 2, 2014 (Julio-Diciembre)

Revista Medicina

¿Es pertinente un Instituto de Investigaciones en Enfermedades Tropicales en el departamento de Córdoba? How relevant is an institute for research in infectious diseases in the Córdoba department? Dr. Richard Onalbi Hoyos López Grupo de Investigación en Enfermedades Tropicales y Resistencia Bacteriana Facultad de Ciencias de la Salud, Universidad del Sinú -Elías Bechara ZainúmMontería - Cólombia e-mail: rhoyoslopez@gmail.com

Introducción: La emergencia de nuevos patógenos en salud pública es una realidad mundial debido a la intervención de los ecosistemas naturales que han desequilibrado las comunidades de patógenos, reservorios y vectores, y, en consecuencia, los ecosistemas humanos van a ser escenarios propicios para la emergencia de nuevas enfermedades. Se describe la compleja realidad epidemiológica del departamento de Córdoba en el panorama global y la pertinencia de una institución líder en la investigación de enfermedades emergentes tropicales, discutiéndose los posibles beneficios y perspectivas. Desarrollo: Las enfermedades infecciosas emergentes pueden ser definidas como aquellas que surgen como nueva causa de enfermedad en una población o que presentan una existencia previa pero rápidamente incrementan en incidencia y rango geográfico (Morse, 1995; Morens, 2004). Los mayores patógenos en esta categoría son cepas bacterianas con resistencia a antibióticos (54.3%) y virus (25.4%), con presencia de protozoos, hongos y helmintos en menor porcentaje (Jones et al, 2008); la mayoría de estos microorganismos tienen origen en ecosistemas silvestres y surgen en poblaciones humanas aledañas por la creciente intervención antropogénica que inicia la fragmentación de áreas conservadas (Daszak et al, 2000; Keesing et al, 2010), cambiando la estructura y composición de comunidades de reservorios, hospederos y patógenos (Hoyos et al, 2012). En este sentido, las enfermedades transmitidas por vectores (ETV) son responsables de una alta proporción de enfermedades emergentes en diferentes regiones del mundo en los últimos 60 años, especialmente en las Américas y África (Gubler, 2002; Jones et al., 2008), donde Dengue, Malaria, Leishmaniasis y la Tripanosomiasis americana tienen presencia epidémica anualmente en los países

29

Recibido para publicación el 03 de Diciembre de 2013. Aceptado el 17 de Diciembre de 2013.

americanos del Neotrópico, y arbovirus como Encefalitis Equina Venezolana (VEEV), Nilo del Oeste (WNV), Encefalitis de St. Louis (SLEV), presentan pequeños brotes epidémicos focalizados en algunas regiones y se encuentran influenciados por la dispersión de aves migratorias, mosquitos competentes y poblaciones humanas susceptibles (Weaver, 2005). Recientemente, la introducción explosiva del Chikungunya en las Antillas caribeñas y el norte de Suramérica (Weaver, 2014), evidencia en estas áreas geográficas factores ecológicos y evolutivos que facilitan la emergencia de nuevos patógenos en estos países significativamente biodiversos en mosquitos, reservorios y hospederos (Hoyos et al, 2012); además, desnuda la fragilidad del sistema de salud, la capacidad de respuesta ante eventos de emergencia epidemiológica, la inexistencia de planes de control y/o manejo de nuevos patógenos, así como el impacto que podrían tener en escenarios de cambio climático en la transmisión de enfermedades por insectos hematófagos (Gould et al, 2009). El departamento de Córdoba no es ajeno a estas causas mayores de preocupación en salud pública, dado que los registros de casos para algunas ETV en el año 2014 fueron alarmantes: Dengue (10.266), Leishmaniasis (489), Malaria (1.529) y Chikungunya (3.729) (SIVIGILA, 2014). La tendencia creciente de estas enfermedades no constituye un solitario factor de preocupación en salud pública, puesto que otros patógenos han sido detectados en grupos humanos y animales domésticos como WNV/SLEV (Mattar et al, 2011), Rickettsia spp. (Miranda et al, 2011) y Hantavirus (Aleman et al, 2006), reafirmando las condiciones ecológicas y factores socioeconómicos que favorecen la circulación de microorganismos patógenos emergentes en Córdoba. Los anteriores antecedentes configuran una realidad

Revista Medicina Vol. 13 No. 2 ¿Es pertinente un instituto de investigaciones en enfermedades tropicales...? Pág. 1 de 3


Artículo de Reflexión

El médico y la cultura

epidemiológica particularmente compleja, cuyo conocimiento implica la convergencia de varios factores apreciables: capital humano, transferencia de tecnología y conocimientos, infraestructura física, liderazgo y conectividad con las instituciones estatales de salud, con el fin de generar planes de intervención, manejo y control de eventos emergentes en poblaciones humanas. En este orden de ideas, es claro que un Instituto de Investigaciones en Enfermedades Tropicales, es una iniciativa imperativa para el departamento de Córdoba, cuyos objetivos deberían ser: a) Transferencia de conocimiento y tecnología para el diagnóstico de patologías tropicales de alta prevalencia y aquellas emergentes en baja circulación con técnicas de genética y biología molecular, b) Caracterizar la ecología de las enfermedades en focos activos epidemiológicamente y la identificación de factores de riesgo para las comunidades humanas, c) Formar recurso humano altamente capacitado para los pregrados en ciencias de la salud (Medicina, Enfermería, Bacteriología, Microbiología y Biología) y posgrados (especializaciones, maestrías y doctorados) en salud y medicina tropical. La consecución de estos probables objetivos para un Instituto de Investigaciones en Enfermedades Tropicales debe generar el suficiente liderazgo e información base para la generación de planes de prevención, intervención, control y manejo de padecimientos con alto número de casos anuales (Malaria, Leishmaniasis, Dengue y Chikungunya) y aquellos emergentes que pueden llegar a convertirse en preocupación de la salud pública del departamento: Hantavirus, SLEV, WNV, Rickettsia y cepas resistentes a antibióticos. El establecimiento de una institución de investigación en enfermedades y/o medicina tropical en red con los hospitales, Camus y centros de salud, potenciaría las respectivas capacidades científicas de estas entidades prestadoras de salud, impulsando redes de investigación, capacitando al personal médico en la problemática de salud prevalente en nuestra región, y a largo plazo podría convertirse en un centro de referencia a nivel nacional e internacional, liderando proyectos y programas de investigación, la rotación de investigadores internacionales, el fomento en la formación del recurso humano, y generando la próxima generación de salubristas autóctonos que podrían gestionar, prevenir y/o contener a las enfermedades emergentes del mañana, una forma exitosa de la apropiación social del conocimiento.

30

Finalmente, una institución híbrida con cualidades académicas y redes con entidades estatales en el campo de la salud pública puede proveer información cualificada y relevante para la toma de decisiones a nivel político mientras ejerce vigilancia epidemiológica, analiza los sistemas y servicios de salud para producir una visión panorámica del sector, gestionando el conocimiento para la implementación de políticas públicas que tengan un efecto positivo en los factores sociales determinantes en salud (Gattini, 2009; Castañeda-Orjuela, 2014), en este caso en medicina tropical. Bibliografía 1. Aleman A, Iguaran H, Puerta H, Cantillo C, Mills J, Ariz W, Mattar S. Primera evidencia serológica de Infección por Hantavirus en Roedores, en Colombia. Revista de Salud Pública 2006; 8: 1-12. 2. Castañeda-Orjuela C. Observatorio Nacional de Salud: gestión del conocimiento en salud para la toma de decisions informadas. Biomédica 2014; 34: 1-3. 3. Daszak P, Cunningham A, Hyatt A. Emerging Infectious Diseases of Wildlife – Threats to Biodiversity and Human Health. Science 2000; 287: 443-449. 4. Gattini C. Implementación de observatorios nacionales. Enfoque operacional y recomendaciones estratégicas. Washington, D.C: Organización Panamericana de la Salud. 2009. 5. Gould E, Higgs S (2009) Impact of climate change and other factors on emerging arbovirus diseases. Trans R Soc Trop Med Hyg 103: 109-121. doi: 10.1016/j.trstmh.2008.07.025. 6. Gubler D. The Global Threat of Emergent/Reemergent Vector-Borne Diseases. In: Lemon S, Sparling F, Hamburg M, Relman D, Choffnes E, Mack A, editors. Vector-Borne Diseases: Understanding the Environmental, Human Health, and Ecological Connections, Workshop Summary (Forum on Microbial Threats). Washington D.C, The National Academy of Sciences, The National Academy Press. 2008. pp.43-64. 7. Hoyos R, Usme-Ciro J, Gallego-Gómez JC. Viral Evolutionary Ecology: Conceptual Basis of a New Scientific Approach for Understanding Viral Emergence. In: Nuno L, editor. Epidemiology – Current Perspectives on Research and Practice. Rijeka, University Campus STeP Ri, INTECH. 2012. pp. 119-130. 8. Jones K, Patel N, Levy M, Storeygard A, Balk D, Gittleman J, Daszak P. Global trends in emerging infectious diseases. Nature 2008; 451: 990-994.

Revista Medicina Vol. 13 No. 2 ¿Es pertinente un instituto de investigaciones en enfermedades tropicales...? Pág. 2 de 3


Artículo de Reflexión

El médico y la cultura

9. Keesing F, Belden L, Daszak P, Dobson A, Harvell D, Holt R, Hudson P, Jolles A, Jones K, Mitchell C, Myers S, Bogich T, Ostfeld R. Impacts of biodiversity on the emergence and transmission of infectious disease. Nature 2010; 468: 647-652. 10. Mattar S, Komar N, Young G, Alvarez J, Gonzalez M. Seroconversion for West Nile and St. Louis encephalitis viruses among sentinel horses in Colombia. Memórias do Instituto Oswaldo Cruz 2011; 106: 976-979. 11. Miranda J, Contreras V, Negrete Y, Labruna M, Mattar M. Vigilancia de la infección por Rickettsia sp. en capibaras (Hydrochoerus hydrochaeris) un modelo potencial de alerta epidemiológica en zonas endémicas. Biomédica 2011; 31: 216221. 12. Morens D, Folkers G, Fauci A. The challenge of emerging and re-emerging infectious diseases. Nature 2004; 430: 242249. 13. Morse, S. Factors in the emergence of infectious diseases. Emerging infectious diseases 1995; 1: 7-15. 14. SIVIGILA, 2014. Disponible online [web: http:// www.ins. g o v. c o / l i n e a s - d e - a c c i o n / S u b d i r e c c i o n Vigilancia/sivigila/Paginas/vigilancia-rutinaria.aspx]. 15. Weaver S. Arrival of Chikungunya Virus in the New World: Prospects for Spread and Impact on Public Health. PLOS Neglected Tropical Diseases 2014; 8: e2921. 16. Weaver S. Host range, amplification and arboviral disease emergence. Archives of Virology 2005; 2005: 33-44.

31

Revista Medicina Vol. 13 No. 2 ¿Es pertinente un instituto de investigaciones en enfermedades tropicales...? Pág. 3 de 3


Vol. 13 No. 2, 2014 (Julio-Diciembre)

Revista Medicina

No todo lo nuevo es mejor The new is not always better Dr. Francisco Rodríguez Yances Cirujano General y Endoscopista Docente, Programa de Medicina, Universidad del Sinú -Elías Bechara ZainúmMontería - Colombia e-mail: fcory@hotmail.com

No es prudente asegurar propiedades, categorías, actitudes y menos defectos cuando no se ha experimentado una situación similar. Desafortunadamente la realidad aparente no engrana de manera perfecta con la teoría. Es tal la contundencia de los hechos, la pluralidad y relatividad de sus múltiples factores causales, que las más exactas palabras no son capaces de dar con la esencia y forma precisa la mayoría de las veces. Es así como se recurre al discurso rimbombante, adjetivos superlativos y diversos meandros gramaticales para maquillar la verdad en su afán de sentirse seguro y gratificado en su vanidad de poseer la verdad. Traigo a cuenta esta consideración porque puedo ver que no hay mal mayor en una sociedad que la incoherencia. La coherencia entre el sentimiento mayoritario, la norma y la acción es lo que permite que un número cualquiera de personas sumen y comprometan sus esfuerzos en alcanzar metas, construir caminos, generar procesos respetables, respetarlos, y quebrar prejuicios atávicos. Es lo que permite que la norma se cumpla con libertad y quede introyectada para que se vuelva costumbre. Es fácil el camino de la palabra, lleno de peligros el de la vida real. Parece ser el fariseísmo el estilo predominante en las clases dirigentes colombianas incluyendo los órganos administradores de justicia y la autoridad policiva y militar. El lamento, la descalificación, el ataque mediático, la fabricación de leyes en serie, más de corte circunstancial que impulsadas por el cumplimiento del pacto constitucional. El desgaste de la credibilidad con tanto mensaje y poca acción, nos han vuelto un país de habladurías y “verdulerismo”, fatídico ejemplo para un pueblo ignorante y desnutrido. Molesta sobremanera el panorama que se pinta en una ley para la salud, que se fundamenta en la promoción y prevención, mientras la mayoría de la población padece la ausencia de agua potable y peor aún de adecuada 32

Recibido para publicación el 11 de Diciembre de 2014. Aceptado el 22 de Diciembre de 2014.

eliminación de excretas; ambas responsabilidades básicas casi eludidas por las administraciones locales, regionales y centrales. Paradójico que un territorio productor de alimentos tenga que avergonzarse con índices de desnutrición inocultables. Todo esto sucede mientras se copian reglamentaciones de USA para aplicar a los médicos e IPS en su ejercicio cuando las condiciones son tan diferentes y mientras, se facilita la propaganda de toda clase de alternativas médicas no ajustadas al método científico y el INVIMA remeda funciones de FDA sin la infraestructura ni los científicos necesarios para esa responsabilidad. Todo es como una maraña; un rastrojo intrincado donde se pierde toda orientación y el sistema de salud comienza entonces a parcelar sus objetivos y adecuar sus metas a los apetitos de empresarios y a las extorsiones de los productores de decretos y reglamentaciones motivados por intereses de sus propias ambiciones. La salud nunca fue más discriminatoria que después de la ley 100 y para ilustrar esto es bueno recordar cómo funcionaban las cosas en el sistema anterior. Existía una red de hospitales públicos, centros y puestos de salud, precaria es cierto, pero donde cualquier ciudadano tenía libre acceso y allí se le prestaban todos los servicios con los cuales contaba la institución, excepto la entrega de medicamentos a menos que el paciente perteneciera a un programa especial como TBC, lepra o malaria y otros. Esa red era regionalizada y todas las regionales se centralizaban en una dirección departamental que dependía a su vez del Ministerio de Salud. Lo descrito hasta ahora es de una simpleza hondamente saludable en oposición a la complejidad enfermiza del actual sistema, pero la principal diferencia aparece en los recursos. En aquel entonces no existía el millonario recaudo que hoy llena a las arcas del sistema mediante la cotización de todos los trabajadores del país. Los recursos provenían de los impuestos regulares generando una carga que obligaba a la austeridad en Revista Medicina Vol. 13 No. 2 No todo lo bueno es mejor Pág. 1 de 2


Magia, pseudociencia y ciencia: Una reflexión desde la Neurobiología

todos los sentidos, como salarios muy bajos, dotación hospitalaria mínima, construcciones poco amables y una intromisión politiquera que alcanzaba niveles detestables en algunos centros - defecto que la nueva ley tampoco ha corregido-. No es necesario poseer una muy florida imaginación para dibujar el magnífico cuadro que sería ese antiguo sistema con el dinero con que hoy contamos y sin la injerencia maligna y deshonesta de los políticos en el nombramiento de los administradores. Ontológicamente nada es malo, es el uso o la intención con que se usan los objetos (y esto incluye leyes y reglamentaciones) lo que genera la apariencia de maldad en ellos y por tanto, no hay sistemas malos, hay mala aplicación o administración de ellos. Es muy difícil establecer una cultura de sana competencia en la calidad de los servicios, si seguimos la costumbre feudal de los favores personales, las simpatías, las conveniencias grupales y las electorales. Lo que hoy vivimos – no solo en la salud – es un estado de rabiosa corrupción que recuerda el pillaje de piratas y corsarios, quienes en alianza con los nobles bloqueaban rutas y desvalijaban mercancías de todo orden para favorecer el monopolio y enriquecimiento de ambos. Mientras se rompen las cuadriculadas neuronas los ministros economistas y sus equipos, ahítos de títulos pero sin la experiencia de sentir desde adentro las penurias de pacientes y médicos, las carteras quebradoras de empresas bien intencionadas, las extorsiones para pagar cuentas, las esperas interminables para acceder a consultas, procedimientos o medicamentos y miles de zancadillas, triquiñuelas, manipulaciones y hasta amenazas, no podrán crear un sistema simple, universal y de alta calidad.

Artículo de Reflexión

competencias que requiere un buen médico. Ya no hay laboratorios con animales porque las normas son tan costosas que se arruinarían los dueños de las universidades, con el peligro de someterse al tonto pero implacable escrutinio mediático de las asociaciones protectoras de ratones, ratas, conejos y otras especies con las que se ha construido gran parte de la ciencia de cuyos beneficios hoy disfrutamos. En un país donde la vida -en la práctica- casi no vale, vemos con tristeza cómo los estudiantes intentan aprender la anatomía con simuladores, más parecidos a rompecabezas para niños que herramientas para la comprensión del maravilloso edificio del cuerpo humano. Los cadáveres se pudren en las morgues de medicina legal y los trámites para acceder a ellos alcanzan dimensiones burocráticas que indignan y entorpecen el buen uso de un material que de otra manera no prestará ya un servicio para la sociedad o para su familia que nunca aparece. Los cadáveres valen más que los vivos, qué triste conclusión. En fin esta diatriba no es más que lo que sentimos la mayoría de médicos que no hemos podido entrar del todo al baile de malabares en el cual se convirtió el sistema de salud de los colombianos. Quién esto lea que lo tome como lo que es, un simple desahogo, una catarsis.

En quizá peores condiciones está la formación de profesionales de la salud. El inusitado crecimiento en el número de programas de medicina que pasó de aproximadamente 10 a 70 en 40 años, superando la proporción de cualquier país desarrollado, lo menos que puede crear es suspicacias. No se puede ocultar que la medicina es una profesión muy atractiva para los jóvenes bachilleres y las arcas de las universidades se hinchan cada día con las matrículas y demás negocitos que se hacen con ellos. Asistimos a un desfile de muchachos con precarias bases en ciencias y humanidades que van y vienen de un semestre a otro, aprobando con las uñas, la suerte o las trampas, pero sin adquirir las 33

Revista Medicina Vol. 13 No. 2 No todo lo bueno es mejor Pág. 2 de 2


Vol. 13 No. 2, 2014 (Julio-Diciembre)

Revista Medicina

Melanoma maligno en pie: un tumor común en una presentación inusual Malignant melanoma in the foot: a common tumor in an unusual presentation Duarte-Misol Dagoberto, Merlano-Almanza María, Mo-Carrascal Joulen Estudiantes de pregrado, Facultad de Medicina. Universidad de Cartagena Cartagena, Colombia e-mail: mariajose_265@hotmail.com Resumen Los melanomas son neoplasias relativamente comunes, en su mayoría asociadas a la exposición a los rayos ultravioleta (UV) del sol, que suelen ser mortales a menos que se detecten en etapas tempranas. Crecen preferentemente en la piel, ya sea de novo a partir de determinados tipos de nevus o tumores melanocíticos benignos, aunque también pueden aparecer en membranas mucosas, meninges y ojos. Su localización en el pie es poco frecuente, siendo más predominante en mujeres, muy pocas veces afecta la superficie plantar, sobre todo en pacientes de sexo masculino. Se hace indispensable para su tratamiento oportuno un examen cuidadoso de la piel. Se presenta un caso de paciente masculino de 62 años de edad quien consulta por cuadro de 15 años de evolución, consistente en úlcera en pie izquierdo que inicialmente se manifestó como una mancha y, posteriormente, se transforma en una masa tumoral a la cual se le realiza patología con resultados de melanoma maligno acompañado de síndrome anémico. Palabras clave: Melanoma; Pie; Neoplasias cutáneas Summary Melanomas are relatively common neoplasms, most of them linked to UV radiation from the sun, and they are usually deadly unless they were detected in early stages. Those tumors normally arise in the skin, de novo or from nevi (benign melanocytic tumors), even though they can appear in mucous membranes, meninges and eyes. Its location is rare in the foot , it is most comunly found on female patients and rarely affects the plantar surface, especially in male patients. For appropriate treatment it is essential a careful examination of the skin. A case of a 62-year-old man who was consulted for presenting a left foot ulcer, itinitially appeared as a stain and then transformed into a tumor mass which turn out to be a malignant melanoma ,accompanied by anemic síndrome. Key words: Melanoma; Foot; Skin neoplasms.

INTRODUCCIÓN El melanoma fue descrito en el año 1806 por René Laënnec, es una neoplasia maligna que puede presentarse en cualquier tejido al cual hayan migrado células derivadas de la cresta neural (aparato uveal del ojo, mucosa del sistema gastrointestinal, genitourinario, etc.). El melanoma maligno cutáneo (MMC) se forma en los melanocitos de la capa basal de la epidermis, desde donde se extiende a las capas más superficiales y a la dermis e hipodermis en profundidad. Es un tipo de cáncer considerado en algunos países (Estados Unidos y Australia) como un problema de salud pública, al extremo de catalogarse epidemia, debido a que en los últimos años la incidencia de la enfermedad ha aumentado; según una estimación de la sociedad americana del cáncer muere una persona cada hora por el melanoma. Está considerado entre los tipos de cáncer más agresivos y en Colombia es la causa de aproximadamente 40% de las muertes por cáncer de piel. Para el diagnóstico clínico un grupo cooperativo de estudio del MMC de la Escuela de Medicina de la Universidad de Nueva York, ideó en 1985 una nemotecnia denominada ABCD que incorpora 34 7

Recibido para publicación el 05 de Agosto de 2014. Aceptado el 28 de Agosto de 2014.

en estas 4 letras las características que exponen que una lesión pigmentada de piel sea más susceptible de tratarse de un MMC (asimetría de la lesión, bordes irregulares, cambio de color y diámetro 6 mm). De acuerdo al tipo histológico los melanomas pueden ser: melanoma de extensión superficial (es el tipo más frecuente- 70% de los casos), melanoma nodular (alrededor del 15 a 30% de los casos), melanoma acral lentiginoso (2 a 8% de los pacientes con MMC), melanoma léntigo maligno (4 al 10% de los enfermos presentan este tipo de MMC). Para evaluar el pronóstico de esta entidad se debe estadificar de acuerdo a ciertos parámetros: profundidad de la invasión (niveles de Clarkniveles de Breslow), ulceración, metástasis linfáticas, metástasis a distancia, fase de crecimiento, regresión tumoral, e índice mitótico(1,2 ). CASO CLÍNICO Paciente masculino de 62 años de edad, procedente de Sucre (Sucre), con antecedentes de epilepsia sin especificar, quien consulta por cuadro de tumor maligno en pie izquierdo de 15 años de evolución que inició como Revista Medicina Vol. 13 No. 2 Melanoma maligno en pie: un tumor común en una presentación... Pág. 1 de 5


Melanoma maligno en pie: un tumor común en una presentación...

úlcera manchada y se transformó en una masa neoplásica, de regular tamaño, acompañado de fetidez, dificultad para deambular y secreción, tal como se detectó al examen físico. (Figura N° 1, N°2 y N°3). En centro de salud de residencia en Simití (Bolivar), reportan cuadro hemático en el que se demostró síndrome anémico, dados los siguientes datos: Hemoglobina: 5 g/dL; hematocrito: 15%; eritrocitos: 2.01 6 3 x 10 por mm ; volumen corpuscular medio (VCM): 75 µm; hemoglobina corpuscular media (HCM): 23 pg; concentración de hemoglobina corpuscular media, 30 gr/dL. Los análisis leucocitarios y plaquetaríos no mostraron alteraciones. Se había realizado 7 días antes una prueba de TPT, la cual resultó levemente elevada.

Reporte de Caso

extensión mayor de 1 cm. El diagnóstico final emitido fue de melanoma maligno con patrón nodular infiltrarte, con índice Clark: IV y Breslow: V. (Figura N°3) Melanoma en pie, que evidencia secreción y ulceración del tumor. (Figura N°2), Melanoma nodular en vista plantar. (Figura N° 1), Melanoma en pie izquierdo vista lateral. (Figura N°2), Melanoma nodular en vista plantar. Se le realizaron también pruebas de bioquímica sanguínea y gasometría arterial, en la que se muestra alcalosis (pH sanguíneo en 7.501) y una pCO2 disminuida.

Dos días después es remitido a centro de salud de tercer nivel y se realizan nuevos exámenes, donde se evidenció nuevamente el síndrome anémico, además elevación del número de plaquetas circulantes. Se obtuvieron dos reportes de patología; inicialmente uno del Instituto Nacional de Cancerología en Bogotá, arrojó como resultado que en los cortes de piel se hallaba un tumor maligno, ulcerado y abscedado, compuesto por lóbulos de células grandes, bizarras, de núcleos pleomorfos y algunos vesiculosos, con nucléolo prominente y pigmento pardo en moderada cantidad, con infiltración estromal, fibrosis y mitosis atípicas numerosas, que compromete dermis profunda y una

Figura N°2 Melanoma nodular en vista plantar

Figura N°3 Melanoma en pie, que evidencia secreción y ulceración del tumor

A lo anterior se suma un nuevo cuadro hemático, en el que se observan nuevamente datos que indican síndrome anémico: Hemoglobina: 5.3 g/dL, eritrocitos: 6 3 3 2.38 x 10 /mm ; hematocrito: 17.7%, VCM: 76 µm ; HCM: 30 gr/dL.

Figura N° 1 melanoma en pie izquierdo vista lateral

35 7

Se le realizó al paciente valoración por ortopedia oncológica que solicita exámenes complementarios, y valoración por psicología para amputación. Revista Medicina Vol. 13 No. 2 Melanoma maligno en pie: un tumor común en una presentación... Pág. 2 de 5


Melanoma maligno en pie: un tumor común en una presentación...

Al octavo día de hospitalización el paciente es sometido a tratamiento quirúrgico, realizándose amputación transtibial izquierda; el procedimiento quirúrgico se realiza con torniquete en muslo. Al finalizar el procedimiento se cubre con gasa estéril, algodón laminado y vendaje elástico no compresivo. Se realiza inmovilización con férula posterior. Finaliza el procedimiento sin complicaciones.

Reporte de Caso

DISCUSIÓN Los melanomas cutáneos de la extremidad inferior representan el 30% de todos los melanomas cutáneos primarios con 3-15% de ellos en el pie y el tobillo. Los melanomas nodulares representan alrededor del 15% de los melanomas cutáneos y son el segundo más frecuente subtipo de melanoma cutáneo (3). El melanoma es el tumor maligno más frecuente en el pie. Es más probable que se mal diagnostique que en cualquier otra localización. Tales errores de diagnóstico incluyen cambios en las uñas por hongos, úlcera isquémica y hematoma subungueal. Una lesión en la piel, especialmente si no es dolorosa, puede no ser observada fácilmente por el paciente, particularmente si la ubicación es plantar (4)

Figura N° 4 Amputación transtibial izquierda

El segundo reporte anatomopatológico describe como diagnóstico final melanoma nodular, invasor, ulcerado (26 x 7 cm) con extensión hasta tejidos blandos, con patrón de crecimiento vertical, índice de Clarks: V y Breslow: 4.5 cm, infiltrado acompañante tipo "brisk", Índice mitótico: más de 1 en 10 campos de alto poder, sin evidencia de invasión linfovascular o perineural. Lesiones satélites no evidentes, curetaje óseo en el margen de sección libre de tumor, y margen sección de paquete vascular y tejidos blandos sin compromiso tumoral. Al quinto día de posoperatorio al examen físico se observan signos de infección e inflamación; se inicia protocolo de antibióticos sin mejoría y progresión de sintomatología. Se reportan exámenes con datos positivos: leucocitos: 11.9 x10^3/mm3; neutrofilos: 94.7 x10^3/mm3, linfocitos1.3 x10^3/mm3. Proteína C reactiva: 107.97 mg/L. A los veinte días se realiza nueva intervención quirúrgica. El paciente es sometido a amputación supracondilea de miembro inferior izquierdo; el procedimiento se realiza sin complicaciones. El paciente evoluciona satisfactoriamente. Al cuarto día egresa por alta hospitalaria voluntaria con recomendaciones y cita de control por ortopedia oncológica, rehabilitación y medicina interna. 36 7

Esto da lugar a tumores que son más gruesos y a etapas de la enfermedad más avanzadas para el momento en que el melanoma se diagnostica correctamente. Un tumor más grueso puede haber pasado la fase de crecimiento horizontal y entrar en la fase de crecimiento vertical en la dermis; la vasculatura de esta capa de tejido más profunda proporciona la ruta para las metástasis potenciales (5). La exposición a la radiación ultravioleta; las quemaduras solares graves sufridas durante la infancia; la exposición prolongada al sol, ocupaciones al aire libre o participantes en actividades recreativas al aire libre; color del pelo rubio o individuos de piel clara; una historia familiar o antecedentes personales de melanoma son considerados factores de riesgo relativos para desarrollo de melanoma (6, 8) Es común encontrar en la literatura el retraso del diagnóstico de este tipo de patología y también el poco interés de los pacientes al restar importancia a la forma inicial de presentación en una consulta médica especializada oportuna (9). El melanoma nodular en contraste es principalmente exofítico, marrón-negro, a menudo erosionado o tumor sangrante, que se caracteriza por una fase vertical agresiva, con una fase de crecimiento horizontal corta o ausente. Por lo tanto, es casi imposible una identificación temprana en una etapa intraepidérmica. Cuando está presente, un componente lateral epidérmico se observa histológicamente dentro de las tres crestas epiteliales en el máximo (10) Revista Medicina Vol. 13 No. 2 Melanoma maligno en pie: un tumor común en una presentación... Pág. 3 de 5


Melanoma maligno en pie: un tumor común en una presentación...

Reporte de Caso

Un estudio retrospectivo de 60 pacientes con melanoma pie/tobillo mostró que la localización más frecuente fue en la cara plantar del pie y que es poco frecuente el patrón ulcerado, a diferencia del melanoma acral que no se ajusta al patrón lunar sino que cambia con frecuencia; pudiéndose encontrar amelanótico y ulcerado. El patrón ulcerado por ser poco frecuente en los melanomas, muchas veces es confundido con otros diagnósticos erróneos como las verrugas plantares, trastornos por hongos, úlceras que no cicatrizan entre otras. Se ha encontrado algunos casos en la literatura de patrones ulcerados en pacientes que tenían diabetes y la lesión fue diagnosticada erróneamente inicialmente como una úlcera de pie diabético (11)

respuesta del huésped (es decir, deposición de fibrina, neutrófilos), y adelgazamiento, borramiento o hiperplasia reactiva de los alrededores epidermis (18) 2 · Índice mitótico (número de mitosis/mm ) se presenta como un factor pronóstico independiente en varios estudios de población (19) · Nivel de invasión (nivel de Clark) es sólo de significado independiente para los tumores delgados (<1 mm de espesor). Sin embargo, parece que el índice mitótico es más predictivo en tumores delgados, y ahora está integrado en el sistema de estatificación del AJCC 2009.

Alrededor del 90% de los melanomas se diagnostican como tumores primarios sin ninguna evidencia de metástasis (12,13 )

La localización anatómica del melanoma en el pie es un factor de riesgo independiente para la supervivencia de los pacientes; otros factores como grosor del tumor, ulceración, el tratamiento quirúrgico, sexo, tiempo de evolución y la edad no explican la menor supervivencia (9).

La metástasis se produce a través del sistema linfático, con metástasis inicialmente a los ganglios linfáticos proximales y la posterior invasión de los pulmones, el hígado, el cerebro, la médula, y el tracto gastrointestinal (14, 16) La escisión quirúrgica de melanoma primario, con márgenes adecuados, es el tratamiento fundamental, que conduce a la curación en la mayoría de los casos. La extirpación quirúrgica de los melanomas cutáneos primarios se encuentran en el pie y el tobillo, crea defectos de que el cierre mediante sutura directa de los bordes de la herida no es generalmente factible. El defecto cutáneo resultante debe tratarse normalmente utilizando técnicas de cirugía plástica (17). La supervivencia a 10 años sin tumor para este tipo de tumores es de 75-85%. Los más importantes factores pronósticos histológicos de melanoma primario sin metástasis, como se refleja en los estudios recientes, son (12,13 ): · El grosor del tumor Vertical (profundidad de Breslow) , medida en muestras histológicas con un micrómetro óptico · Presencia histológicamente reconocida de ulceración. Ulceración del melanoma se define como la combinación de las siguientes características: defecto epidérmico de espesor completo (incluyendo la ausencia de estrato córneo y de la membrana basal), pruebas de 37 7

En un estudio realizado en la Universidad de Alabama en Birmingham y la Unidad de Melanoma Sydney en Australia, se evidencio que el grosor del tumor fue el más importante factor pronóstico individual para la supervivencia o la supervivencia libre de enfermedad. En dicha investigación se encontró una supervivencia significativamente menor de pacientes con melanoma localizado del pie (63,3% a 10 años) en comparación con melanoma localizado de la pierna (77,2% a 10 años), controlando por el grosor del tumor, ulceración, la edad, el género, la cirugía y el año de diagnóstico (9). CONFLICTOS DE INTERESES: ninguno que declarar. Estudios de laboratorio, material quirúrgico, insumos hospitalarios y honorarios profesionales fueron aportados dentro de la atención asistencial. FINANCIACIÓN: recursos propios de los autores. Insumos clínicos y honorarios médicos fueron aportados dentro de la atención asistencial. Bibliografía 1.Rendleman J, Shang S, Dominianni C, Shields J, Scanlon P, Adaniel C, et al. Melanoma risk loci as determinants of melanoma recurrence and survival. Journal of Translational Medicine. 2013;279(11). 2.Malone M, Gannass A, Binahmed A, Bowling F, Boulton A. An extensive primary nodular melanoma of the foot with Revista Medicina Vol. 13 No. 2 Melanoma maligno en pie: un tumor común en una presentación... Pág. 4 de 5


Reporte de Caso

Melanoma maligno en pie: un tumor común en una presentación...

associated distant metastases: A case report. The Foot. 2012;22:235-9. 3.Shaikh WR, Xiong M, Weinstock MA. The contribution of nodular subtype to melanoma mortality in the United States, 1978 to 2007. Arch Dermatol. 2012;148(1):30-6. 4.Bennett DR, Wasson D, MacArthur JD, McMillen MA. The effect of misdiagnosis and delay in diagnosis on clinical outcome in melanomas of the foot. J Am Coll Surg. 1994;179(3):279-84. 5.Walsh SM, Fisher SG, Sage RA. Survival of patients with primary pedal melanoma Foot Ankle Surg. 2003;42(4):193-8. 6.Markovic SN, Erickson LA, Rao RD, McWilliams RR, Kottschade LA, Creagan ET, et al. Malignant Melanoma in the 21st Century, Part 1: Epidemiology, Risk Factors, Screening, Prevention, and Diagnosis. Mayo Clin Proc. 2007;82(3):36480. 7.Schade VL, Roukis TS, Homann JF, Brown T. The Malignant Wart: A Review of Primary Nodular Melanoma of the Foot andReport of Two Cases. Foot Ankle Surg. 2010;49(3):263-73.

2000;17(2):347-60. 15.Saida T, Yoshida N, Ikegawa S, Ishihara K, Nakajima T. Clinical guidelines for the early detection of plantar melanoma. J Am Acad Dermatol. 1990;23(1):37-40. 16.Chakera AH, Drzewiecki KT, Eigtved A, Juhl BR. Sentinel node biopsy for melanoma: a study of 241 patients. Melanoma Res. 2004;14(6):521-6. 17.Yiacoumettis A, Mallouris A. Reconstructive Options for Defects after Melanoma Excision in the Foot and Ankle Region. Foot Ankle Surg. 2011;50(4):498-503. 18.Spatz A, Cook MG, Elder DE, Piepkorn M, Ruiter DJ, Barnhill RL. Interobserver reproducibility of ulceration assessment in primary cutaneous melanomas. Eur J Cancer. 2003;39(13):18615. 19.Scolyer RA, Thompson JF, Shaw HM, McCarthy SW, Scolyer RA, Thompson JF, et al. The importance of mitotic rate as a prognostic factor for localized primary cutaneous melanoma. J Cutan Pathol. 2006;33(5):3956.

8.Lemon B, Burns R. Malignant melanoma: a literature review and case presentation. J Foot Ankle Surg. 1998;37(1):48-54. 9.Talley L, Soong S-j, Harrison R, McCarthy W, Urist M, Balch C. Clinical Outcomes of Localized Melanoma of the Foot: A Case-Control Study. J Clin Epidemiol. 1998;51(10):853-7. 10.Garbe C, Peris K, Hauschild A, Saiag P, Middleton M, Spatz A, et al. Diagnosis and treatment of melanoma. European consensus-based interdisciplinary guideline Update 2012. Eur J Cáncer. 2012;48(15):2375 90. 11.Kong M, Jogia R, Jackson S, Quinn M, Mcnally P, Davies M. Malignant melanoma presenting as a foot ulcer. The lancet. 2005;366(12-18). 12.Balch CM, Gershenwald JE, Soong S-j, Thompson JF, Atkins MB, Byrd DR, et al. Final Version of 2009 AJCC Melanoma Staging and Classification. J Clin Oncol. 2009;27(36):6199-206. 13.Thompson JF, Soong S-J, Balch CM, Gershenwald JE, Ding S, Coit DG, et al. Prognostic Significance of Mitotic Rate in Localized Primary Cutaneous Melanoma: An Analysis of Patients in the Multi-Institutional American Joint Committee on Cancer Melanoma Staging Database. J Clin Oncol. 2011;29(16):2199205. 14.John KJ, HayesJr DW, Green DR, Dickerson J. Malignant melanoma of the foot and ankle. Clin Pod Med Surg. 38 7

Revista Medicina Vol. 13 No. 2 Melanoma maligno en pie: un tumor común en una presentación... Pág. 5 de 5


Revista Medicina

Vol. 13 No. 2, 2014 (Julio-Diciembre)

Síndrome de vasoplejía en postoperatorio de cirugía de revascularización miocárdica con circulación extracorpórea (CEC): utilidad del azul de metileno. (Vasoplegia Syndrome in postoperative period after cardiac surgery with extracorporeal circulation: Usefulness of methylene blue). Dr. Guillermo Agamenón Quintero Jefe UCI IMAT. Especialista en Cuidado Crítico, Universidad de la Sabana Jefe de Enseñanza IMAT. Vicepresidente AMCI Dr. Camilo Rodríguez Médico Especialista en Cuidado Intensivo y Medicina Crítica Universidad de Buenos Aires (Argentina) Dr. Orlando Villarreal Médico Especialista en Medicina Crítica y Cuidados Intensivos Universidad de Salvador (Argentina) Dr. José Alfredo Correa Medico General en UCI, IMAT e-mail: quinteroagamenon@gmail.com Resumen La cirugía cardiovascular con circulación extracorpórea, y en ocasiones sin ella, está sujeta a innumerables cuidados y complicaciones peri operatorios que determinan muchas veces el desenlace del enfermo. Una de estas complicaciones, a la que nos enfrentamos en este tipo de intervenciones quirúrgicas, es el shock vasopléjico con fisiopatología fundada en una insuficiencia autonómica asociada a una incapacidad de respuesta endotelial donde parece ser que el actor principal es la activación de un sistema de mediadores neuroendocrinos e inmunológicos que generan injuria endotelial con liberación de citoquinas y otros mediadores de la inflamación (óxido nítrico) que va desde una hipotensión con adecuada respuesta a fluidos hasta una hipotensión refractaria a líquidos y catecolaminas que llega a una falla orgánica múltiple (FOM).Se sabe que hasta en un 10% de los pacientes los niveles de catecolaminas son elevados en detrimento de la respuesta adrenérgica de la vasculatura, como manifestación de un desequilibrio entre componentes vasoconstrictores y componentes vasodilatadores.(1) Si bien hay evidencia de complicaciones y manifestación de síndrome vasopléjico sin ella, un elemento no despreciable, a la hora de asignar nombre a la causa, es la circulación extracorpórea (CEC) como promotor de la activación de numerosas cascadas, como la coagulación y el sistema del complemento con la generación de trombina, la liberación de citoquinas pro inflamatorias y la consecuente respuesta inflamatoria sistémica. (1) Cabe destacar que asociado a estos eventos moleculares y consecuente respuesta inflamatoria sistémica, está demostrado que los niveles de arginina vasopresina son desproporcionadamente bajos en estos pacientes. Ante lo expuesto y frente a una resistencia al tratamiento médico convencional con el uso de vasopresores (de inicio y elección Noradrenalina), a la terapéutica asociada con fluidos, hasta la utilización de vasopresina con el fin de restablecer la presión arterial, nos encontramos con una opción terapéutica con reputación repartida en la literatura como lo es el azul de metileno a dosis de 1,5 mg/kg como alternativa terapéutica con el fin de frenar el accionar del óxido nítrico por inhibición de la guanilato-ciclasa y óxido nítrico sintetasa.(2,3). Palabras claves: Azul de metileno, vasoplejía, cirugía cardiaca, síndrome vasopléjico, shock vasodilatador. Summary Cardiovascular surgery with cardiopulmonary bypass, and sometimes without it, is subject to numerous complications and perioperative care that often determine the outcome of the patient. One of these complications, which we face in this type of surgery is vasoplegic shock with pathophysiology founded in autonomic failure associated with an inability of endothelial response where it seems that the main actor is the activation of neuroendocrine system and immune mediators that generate endothelial injury with release of cytokines and other inflammatory mediators (nitric oxide) ranging from hypotension with fluids until adequate response to hypotension refractory to catecholamines reaching multiple organ failure (FOM). Up to 10% of patients, the elevated catecholamine levels are detrimental to the adrenergic response of the vasculature, such as expression of an imbalance between vasodilators and vasoconstrictors components components (1). 1 Jefe UCI IMAT. Cuidado crítico, Universidad de la Sabana. Jefe de enseñanza IMAT. Vicepresidente AMCI. 2Médico especialista en cuidado Intensivo y medicina crítica, Universidad de Buenos Aires (Argentina). 3Medico especialista en medicina critica y cuidado intensivos, Universidad de salvador (Argentina). 4Medico General de oplanta en UCI. IMAT

39 7

Recibido para publicación el 09 de Noviembre de 2014. Aceptado el 20 de Noviembre de 2014.

Revista Medicina Vol. 13 No. 2 Síndrome de vasoplejía en postoperatorio de cirugía de revascularización... Pág. 1 de 7


Síndrome de vasoplejía en postoperatorio de cirugía de revascularización...

Reporte de Caso

Although the evidence also shows, there are complications and manifestations of vasoplegic syndrome without it, an element not negligible when naming the cause, cardiopulmonary bypass (CPB) as promoter activation of numerous cascades, as coagulation and the complement system with the generation of thrombin, the release of proinflammatory cytokines and consequent inflammatory response. Note that these molecular events associated with systemic inflammatory response and consequent is shown that arginine vasopressin levels are disproportionately low in these patients. Given the above and resistance against conventional medical treatment with vasopressors (noradrenaline start and choice), the fluids associated with therapeutic use of vasopressin to in order to restore blood pressure, we have a choice therapeutics distributed in the literature such as the methylene blue at a dose of 1.5 mg / kg as a therapeutic alternative in order to curb the actions of nitric oxide inhibition of guanylate cyclase and nitric oxide synthase reputation. Keywords: Methylene blue, vasoplegia, cardiac surgery, vasoplegic syndrome, vasodilatory shock.

Presentación de caso Paciente de género femenino de 48 años de edad con el antecedente de hipertensión arterial y antecedentes quirúrgico de exéresis de tumor hipofisario años atrás, remitida de otra institución por un cuadro de dolor torácico retro esternal de tipo opresivo manifestado durante el reposo, con características típicas, de 72 horas de evolución, donde no se especifica el tratamiento recibido en la institución remitente, interpretando el cuadro como un síndrome coronario agudo sin elevación del segmento ST (SCA - SESST). Se realizó ECG de ingreso al servicio de urgencias donde se evidenció negativización de la onda T en precordiales antero-laterales (V2/V3/V4/V5) con biomarcadores de injuria negativos al inicio.

coronaria derecha segmento medio de 80%). Seguido de esto, se realiza ecocardiograma transtorácico (ETT) donde se evidencia fracción de eyección del ventrículo izquierdo de 60%, disfunción diastólica tipo I, valvuloesclerosis mitral y aórtica con trastorno regional de la contractilidad. El día 14 de Abril la paciente ingresa a quirófano sin dolor, hemodinámicamente estable, adecuado ritmo diurético y con GCS 15/15 para cirugía de revascularización miocárdica (CRM) bajo circulación extracorpórea (CEC). Se realizan dos puentes, uno arterial de arteria mamaria interna a arteria descendente anterior (DA) y puente venoso de Safena externa a arteria coronaria derecha (CD) con un tiempo de bomba (CEC) de 136 minutos y clampeo de aorta de 108 minutos.

Se decide la realización de cinecoronariografía (CCG) donde se evidencia lesión de tres vasos con compromiso de la arteria circunfleja (CX), descendente anterior (DA) y coronaria derecha (CD), por lo que se decide remisión a este centro con el fin de ser ingresado para monitoreo cardíaco continuo en el servicio de UCI hasta la valoración por cirugía cardiovascular para presunto tratamiento quirúrgico de revascularización miocárdica. Ingresa a la UCI el día 9 de abril de 2014 en horas de la mañana presentando signos vitales estables, Glasgow 15/15, adecuado ritmo diurético (>0,5 ml/kg/hr) y buen control del dolor sin otros signos ni sintomatología acompañante con un laboratorio que informa: Hto 46% / Hemoglobina 14 gr/dl / 382.000 plaquetas / 10.000 glóbulos blancos / CPK 77 / CPK-MB 19 / Troponina negativa / KPTT 100´´ / INR 1,9 / BUN 10 / Cr plasmática 0,92 / Glucemia 90 / Na+p 139 / K+p 4,8 / Cl – 101 / Ca++p 5,6 / Fosforo plasmático 3,8 / Mg++p 2,2.

La paciente evoluciona, durante el procedimiento, con episodio de sangrado con pérdida aproximada de 3000 ml de sangre por lo que se transfunde con 8 UGR / 6 UPFC / 2 U de plaquetas y recibe reanimación con 7000 ml de fluidos (6000 ml de cristaloides y 1000 ml de coloides) por lo que ingresa a la unidad de cuidados intensivos a las 15:00 hs. por cuadro de shock vasopléjico e hipovolémico, iniciándose protocolo POP de cirugía cardiovascular. Ingresa bajo sedo- analgesia (RASS-4) (bajo efecto de fentanilo (1000 mcg/24 hs) y propofol (1 gr/24 hs)) con tubo endotraqueal 7,5 mm ventilando con bolsa-máscara, con tubo pleural derecho y mediastinal a aspiración continúa con escaso débito inicial. Se lo conecta a monitoreo hemodinámico mínimamente invasivo (Vigileo® - Flow Trac) y a asistencia ventilatoria mecánica (AVM).

A las horas del ingreso se decide repetir la cinecoronariografía por persistir las dudas diagnósticas y nuevo episodio de dolor, donde se evidencia compromiso de tres vasos (arteria DA en el segmento proximal y medio de 99%, arteria CX segmento distal de 90% y arteria

Monitoreo hemodinámico: Gasto cardíaco (GC): 5,3 Índice cardíaco (IC): 2,8 VVS: 22 / IVS: 22 / VS: 41 / PVC: 12 RVS: 1035 (800-1000) / IRVS: 1977 (1970-2390)

40 7

Revista Medicina Vol. 13 No. 2 Síndrome de vasoplejía en postoperatorio de cirugía de revascularización... Pág. 2 de 7


Síndrome de vasoplejía en postoperatorio de cirugía de revascularización...

Reporte de Caso

Signos vitales: TAS 77 mmHg / TAD 43 mmHg / TAM 53 mmHg / Fc 100 lpm / 35,5°C / Fr 20 vpm / SatO2 98% Laboratorio: EAB: 7,35/32/209/18/-7/100 (Pafi: 215) Ac.láctico: 6,4 Hb 8,5 / Hto 26% / 140.000 plaquetas / KPTT 36´´ / TP 23´´ / Na+p 138 / K+p 4,6 / Cl- 106 / Glucemia 286 / CPK 971 / CPK –MB 24 / Troponina positiva. / Fósforo plasmático 3,2 / Mg++ 1,75 /

Figura 2 Resistencias sistémicas durante las primeras 16 horas de evolución del POP. RVS (resistencia vascular sistémica), IRVS (Índice de resistencia vascular sistémica).

Por persistir con cuadro de shock vasopléjico, se decide a las 18:00 hs iniciar Vasopresina 0,03 U/min y suspensión de Dopamina.

Figura 1 Radiografía después de tres horas en POP en UCI, de la cirugía de revascularización miocárdica.

Ca++ 3,9 / Cr plasmática 0,83 / BUN 9,6Delta PCO2: 13 mmHg. Ventilación mecánica: IPPV con Peep 6 / VT 450 ml / Fio2 100%. Se decide continuar con tratamiento médico instaurado en la sala de cirugía, con Noradrenalina a 1,93 mcg/kg/min y Dopamina 2,5 mcg/kg/min. A las 16:00 hs se constata aumento del débito de tipo sanguinolento por el tubo de avenamiento torácico derecho y por el tubo de drenaje mediastinal. (Tubo de tórax: 605 ml/16 hs y el tubo mediastínico: 600 ml/16 hs) con persistencia de la hipotensión y el shock. Se realiza nuevo laboratorio que presenta una Hemoglobina de 5,8 gr/dl (previa de 8,5 gr/dl), acidosis metabólica e hiperlactacidemia con ácido láctico arterial de 11, por lo que se decide transfundir 4 UGRP e iniciar tratamiento con ácido tranexámico.

41 7

A las horas de ingresada la paciente a cuidados intensivos evoluciona con un cuadro asociado de hipoxemia con una PaO2/FiO2 de 96 mmHg y presencia de nuevos infiltrados radiológicos con compromiso predominantemente de ambas bases pulmonares y hacia vértice (Figura 1), donde se manejó el cuadro pensando en un SDRA (Síndrome de Distress Respiratorio Agudo) o un TRALI (Transfution Related Acute Lung Injury), modificación de parámetros ventilatorios y manejo de balance de fluidos. El paciente transitando el shock refractario evoluciona con un patrón de shock de tipo vasopléjico (vasodilatado) manifestado por los parámetros hemodinámicos obtenidos a través del monitoreo bajo Vigileo® y cálculo de las resistencias vasculares sistémicas (RVS / IRVS) disminuídas (Figura2 y 3), por lo que se continuó con la administración de Noradrenalina a 1,54 mcg/kg/min, en descenso, con dosis de vasopresina de 0,3 U/min, por lo que se decide a las 22:00 hs. iniciar como tratamiento adyuvante Azul de Metileno a 1,5 mg/kg/dosis en infusión continua (3). La misma se administró durante 28 hs en infusión continua, al mismo tiempo que la Noradrenalina y la Vasopresina, resultando mejores valores de PAM a partir del mismo y descenso concomitante de la Noradrenalina. (Figura 4) Revista Medicina Vol. 13 No. 2 Síndrome de vasoplejía en postoperatorio de cirugía de revascularización... Pág. 3 de 7


Síndrome de vasoplejía en postoperatorio de cirugía de revascularización...

Reporte de Caso

de la perfusión, del aclaramiento del lactato (y otros parámetros de reanimación) (Figura 6) y en el descenso de las dosis de vasopresores hasta la suspensión de la Noradrenalina a 114 hs de infusión(se suspende el 18/04 a las 10:00 am), de la Vasopresina a las 57 hs de uso ( se suspende el 17/04) y del azul de metileno con 28 horas de infusión continua (se suspende el 16/04 a las 3:00 am) (Figura 7, 8). La paciente durante toda su evolución tuvo un adecuado ritmo diurético (>0,5 ml/kg/hr), una buena evolución de los drenajes torácico y mediastinal y una recuperación importante en la oxigenación y compromiso radiológico con PaO2/FiO2 > 300 mmHg.

Figura 3 Gráfico de barras que muestra la evolución de los diferentes valores del monitoreo hemodinámico mínimamente invasivo (Vigileo®) a lo largo de las primeras 16 horas de evolución del POP. Los valores de GC en un promedio de 5,9 L/min, del IC promedio de 3,1 L/min/m2, VVS de 9,5%, PVC de 17 mmHg y ScVO2 promedio de 89%.

Con la administración de los dos vasopresores (Noradrenalina y Vasopresina) y el complemento del Azul de Metileno, se evidenció una mejoría horas tras hora en la evolución de los valores de PAM, en los valores de resistencias vasculares sistémicas (Figuras 5), mejoría

Se decide su extubación el día 22/04 (día 8 de AVM) con buena tolerancia, por lo que se pasa a servicio de medicina interna, dándose el alta institucional el día 24/04 con un ecocardiograma transtorácico (ETT) que se informa: 1.Fracción de eyección (Fey) de 50% 2.FSVI disminuida 3.Trastorno regional de contractilidad, que favorecen la activación y presencia de la enzima óxido nítrico sintetasa, donde la producción del ON (óxido nítrico) tiene un papel fundamental en la génesis de este trastorno, con la activación de la guanilato-ciclasa, producción de GMP-cíclico y el consecuente potente efecto vasodilatador del músculo liso (4, 5,6) vascular. Entre las causa mencionadas en la literatura, se encuentra la transfusión masiva de hemoderivados (glóbulos rojos, plasma fresco y transfusión de plaquetas) como disparador del síndrome vasopléjico en el post-operatorio de cirugía cardíaca. Se demostró el aumento de la prevalencia del síndrome vasopléjico en la transfusión de cualquier tipo de hemoderivado, donde los glóbulos rojos presentaron una respuesta independiente de la dosis para el (7,8,9) desarrollo de vasoplejía.

Figura 4 Valores de PAM (mmHg) desde el día del ingreso a cuidados intensivos y su comparación hasta la resolución del cuadro de shock vasoplejico secundario a la cirugía de revascularización miocárdica por CEC. La flecha completa indica el inicio del Azul de Metileno (1,5 mg/kg)

42 7

Se sabe que el estándar de oro (¨Gold standard¨) del tratamiento de este síndrome es la optimización del contenido intravascular y la optimización del continente vascular con el objetivo de lograr una hemodinamia óptima y adecuada con el fin de una ¨optima¨perfusión del paciente sujeto a sus necesidades Revista Medicina Vol. 13 No. 2 Síndrome de vasoplejía en postoperatorio de cirugía de revascularización... Pág. 4 de 7


Síndrome de vasoplejía en postoperatorio de cirugía de revascularización...

tan dinámicas

.(10,11)

Con esta finalidad se describe la utilización de fluidos (cristaloides vs coloides) y de agentes vasopresores como lo son la Fenilefrina (10-500 mcg/kg/min) como alfa adrenérgico puro, pasando por la Adrenalina (1-4 mcg/kg/min), la Dopamina (10-12 mcg/kg/min) y la Noradrenalina (2-200 mcg/kg/min), todos estos como .(12) agonistas alfa y beta

Figura 5 Resistencias vasculares sistémicas desde el inicio del shock vasopléjico hasta su resolución. La flecha completa indica el inicio del Azul de metileno. RVS (Resistencia vascular sistémica), IRVS (Índice de resistencia vascular sistémica)

Discusión La cirugía cardiovascular con y sin CEC pone de manifiesto potenciales complicaciones peri operatorias que marcan el camino evolutivo de la enfermedad del paciente. En este caso nos abocamos a aquellas intervenciones llevadas a cabo con circulación extracorpórea (CEC). Esta induce una respuesta inflamatoria debido al contacto de la sangre con el circuito. En algunos pacientes, esta respuesta inflamatoria conduce a una insuficiencia orgánica múltiple y muerte. El síndrome vasopléjico es una complicación común de la circulación extracorpórea, que aparece con una incidencia que oscila entre el 5 y el 25% con una mortalidad que oscila entre el 16% y 21%. Se caracteriza por presentar hipotensión significativa, un gasto cardíaco alto o normal y resistencias vasculares sistémicas bajas, siendo un evento que carece de criterios diagnósticos bien definidos donde la alta sospecha es la piedra angular (13) del diagnóstico. Tanto el trauma quirúrgico y la circulación extracorpórea 43 7

Reporte de Caso

(flujo continuo no pulsátil, hemodilución, la superficie plástica de las cánulas, hipotermia, etc.) son los determinantes de la liberación de agentes (14,15) proinflamatorios y el desarrollo del SIRS. Constituye una forma grave de presentación del síndrome de respuesta inflamatoria sistémica y como expresión clínica del daño endotelial. Hay un componente inflamatorio con liberación de mediadores (16) (citoquinas, etc.) Actualmente de inicio se recomienda la Noradrenalina como droga vasopresora de elección, aunque muchas veces la evolución de la vasoplejía no permite una respuesta adecuada sin llegar así al objetivo de obtener una PAM > 65 mmHg y consigo una adecuada perfusión. En ciertas circunstancias es necesario tener en cuenta terapéuticas que al día de hoy aún no son entendidas como de primera línea, como la Vasopresina IV (0,02 – 0,07 U/min) y el Azul de metileno IV (1,5-2 mg/kg). Estas drogas en general se mantienen en infusión por un período de 36 – 48 hs, siempre subordinado esto a la corrección de la etiología del síndrome de vasoplejía (17,18) como a los efectos adversos de las drogas. El tratamiento tradicional basado en las drogas de reanimación (catecolaminas) y fluidos no es eficaz en un número de pacientes. Se han revisado ensayos clínicos que investigan tanto la vasopresina y el Azul de metileno .(19,20) como rescate adicional o terapia preventiva La vasopresina se sugiere para retener su poder vasoconstrictor en la hipoxemia y la acidosis, reducir las arritmias supraventriculares y acelerar la recuperación en la unidad de cuidados intensivos (UCI). En las preocupaciones de seguridad se incluyen la trombocitopenia frecuente y la perfusión renal. Se sugiere también el Azul de metileno para facilitar el destete vasopresor y el intento de reducir la mortalidad, (21,22) acelerarando la recuperación en la UCI. Deseados, no frecuentes a dosis de 1,5-2 mg/kg, como los son las arritmias cardíacas, la hipertensión pulmonar, la caída del flujo renal y la hiperbilirubinemia secundaria a hemólisis y (23) falla hepática aguda. Varios ensayos y reportes de caso han demostrado la utilidad del azul de metileno ante un síndrome vasopléjico o shock vasopléjico refractario al tratamiento vasopresor y fluidoterapia, obteniendo buenos resultados en cese y destete de las catecolaminas exógenas, claro está no Revista Medicina Vol. 13 No. 2 Síndrome de vasoplejía en postoperatorio de cirugía de revascularización... Pág. 5 de 7


Síndrome de vasoplejía en postoperatorio de cirugía de revascularización...

aún como tratamiento de primera elección.

(24,25,26)

Otros ensayos, como el de Weiner et al. del año 2013, en el que realiza un análisis retrospectivo entre 2007-2008 de los pacientes que había sufrido síndrome vasopléjico después de cualquier tipo de cirugía cardíaca (n=226), y dividieron aquellos que habían recibido Azul de metileno (n=57), intenta concluir que los pacientes que lo habían recibido presentaron mayor mortalidad, y colocando al Azul de metileno como un factor independiente de mortalidad. Sin embargo teniendo en cuenta que es un estudio retrospectivo, será necesario estudiar en forma prospectiva para llegar a una conclusión más acabada. Hasta ahora sí mantenemos inamovible que el Azul de metileno, hasta que haya más estudios, será tomado (27,28) como de segunda línea de tratamiento.

Reporte de Caso

Conclusión. A pesar de existir controversias en la literatura hacia la utilidad y/o futilidad del azul de metileno en el tratamiento de un shock vasopléjico refractario, en el contexto de un post-operatorio de cirugía de revascularización miocárdica, podemos determinar que, utilizado como herramienta co-adyuvante de los vasopreosres de primera línea, contemplando riesgos y beneficios, estando alerta a la causa del síndrome vasopléjico, asegurándonos un óptimo monitoreo hemodinámico con un adecuado manejo de fluidos, es un elemento terapéutico útil y con una respuesta terapéutica rápida y sostenida sin mediar efecto adversos a la dosis utilizada en infusión continua. (29,30) Sin embrago, será necesario e imperioso estudios prospectivos para determinar su utilidad y conocer aún más sus virtudes y sus falencias en diferentes y variadas situaciones clínicas. Bibliografía. 1. Macarena Gilberta, Guillermo Lema; Cirugía cardiaca con circulación extracorpórea: síndrome vasoplégico y vasopresina. Rev Med Chile 2011; 139: 368-372. 2. Bojar, M.B; Manual de cuidados perioperatorios en cirugía cardíaca. Ediciones Journal 2013. Cap.11. 3. Stawicki SP1, Sims C, Sarani B, Grossman MD, Gracias VH. Methylene blue and vasoplegia: who, when, and how?. Mini Rev Med Chem. 2008 May; 8(5):472-90.

Figura 6. Dosis de vasopresores durante las primeras 16 horas de POP de cirugía cardiovascular y sus cambios en el tiempo. Se observa en la flecha como se inicia el descenso de la Noradrenalina con la instalación del Azul de Metileno. (Noradrenalina pasa 1,54 mcg/kg/min a 1,40 mcg/kg/min (22 hs). La Vasopresina se mantiene constante a 0,03 U/min y se observa el inicio del Azul de Metileno a 4,2 ml/hr a las (22 hs.)

4. Kenar M R, Flores L A, Bono J; Cardiología crítica, enfoque de la patología cardiovascular en el paciente grave. Sociedad Argentina de Terapia Intensiva, Parte V, cap. 16. Editorial Panamericana, 2014. 5. Lenglet S1, Mach F, Montecucco F; Methylene blue: potential use of an antique molecule in vasoplegic syndrome during cardiac surgery. Expert Rev Cardiovasc Ther. 2011. 6. Brett, Stephen J. MB, ChB, FRCA; Quinlan; Production of nitric oxide during surgery involving cardiopulmonary bypass. Crit Care Med 1998; 26: 272-278. 7. Boehmer JP, Popjes E. Cardiac failure: mechanical support strategies. Crit Care Med 2006;34:S268-77.

Figura 8. Comportamiento de los vasopresores desde la hora 16 de POP a la hora 40. Las flechas huecas marcan el descenso de la dosis de Vasopresina (0,03 a 0,02 a 0,013 U/min) continuando con dosis de 0,01 U/min hasta suspensión. La flecha rellena marca el descenso de la Noradrenalina (1,4 mcg/kg/min a 1,14 mcg/kg/min hasta una dosis de 1 mcg/kg/min a las 7 am). La estrella marca la suspensión del Azul de Metileno.

44 7

8. Alfirevic A1, Xu M, Johnston D, Figueroa P, Koch CG; Transfusion increases the risk for vasoplegia after cardiac operations. Ann Thorac Surg. 2011. 9. Lavigne D; La vasopresina y azul de metileno: terapias alternativas en shock vasodilatador. Seminarios en Revista Medicina Vol. 13 No. 2 Síndrome de vasoplejía en postoperatorio de cirugía de revascularización... Pág. 6 de 7


Síndrome de vasoplejía en postoperatorio de cirugía de revascularización...

cardiotorácica y anestesia vasculares 14: 3 2010 Sep pg 186-9. 10. Skuza K1, Chmielniak S, Dziuk W, Kucewicz E, Pawlak S, Knapik P; [Methylene blue therapy for vasoplegia after cardiac surgery. Anestezjol Intens Ter. 2009. 11. Paulo Roberto Barbosa EvoraI; Paulo José; Azul de metileno no tratamento da síndrome vasoplégica em cirurgia cardíaca. Quinze anos de perguntas, respostas, dúvidas e certezas. Rev Bras Cir Cardiovasc vol.24 no.3 São José do Rio Preto July/Sept. 2009. 12. Mora-Ordóñez JM1, Sánchez-Llorente F, Galeas-López JL, Hernández Sierra B, Prieto-Palomino MA, Vera-Almazán A; Use of methylene blue in the treatment of vasoplegic syndrome of post-operative heart surgery.Med Intensiva. 2006 AugSep;30(6):293-6. 13. Etienne PY, Papadatos S, Glineur D, Mairy Y, El Khoury E, Noirhomme P, El Khoury G. Reduced mortality in high-risk coronary patients operated off pump with preoperative intraaortic balloon counterpulsation. Ann Thorac Surg 2007;84:498-502. 14. Shanmugam G; Vasoplegic syndrome--the role of methylene blue. Eur J Cardiothorac Surg. 2005 Nov;28(5):70510. Epub 2005 Sep. 15. Dagenais F1, Mathieu P; Rescue therapy with methylene blue in systemic inflammatory response syndrome after cardiac surgery. Can J Cardiol. 2003 Feb;19(2):167-9. 16. Leyh RG1, Kofidis T, Strüber M, Fischer S, Knobloch K, Wachsmann B, Hagl C, Simon AR, Haverich A; Methylene blue: the drug of choice for catecholamine-refractory vasoplegia after cardiopulmonary bypass?. J Thorac Cardiovasc Surg. 2003 Jun;125(6):1426-31. 17. Weiner MM; Methylene blue is associated with poor outcomes in vasoplegic shock J Cardiothorac Vasc Anesth. 2013 Dec.

Reporte de Caso

21. Dunser MW, Werner ER, Wenzel V, et al. Arginine vasopressin and serum nitrite/nitrate concentrations in advanced vasodilatory shock. Acta Anaesthesiol Scand 2004;48:814819. 22. Levin RL, Degrange MA, Bruno GF, et al. Methylene blue reduces mortality and morbidity in vasoplegic patients after cardiac surgery. Ann Thorac Surg 2004;77:496-499. 23. Ozal E, Kuralay E, Yildirim V, et al. Preoperative methylene blue administration in patients at high risk for vasoplegic syndrome during cardiac surgery. Ann Thorac Surg 2005;79:1615-1619. 24. Evora PRB . Should methylene blue be the drug of choice to treat vasoplegias caused by cardiopulmonary bypass and anaphylatic shock? J Thorac Cardiovasc Surg 2000; 119:632633. 25. Bastien O, Vallet B. French multicentre survey on the use of inotropes after cardiac surgery. Crit Care 2005;9:241-2. 26. Allen LA, O'Connor CM. Management of acute decompensated heart failure. Cmaj 2007;176:797-805. 27. Minhaj M, Patel K, Muzic D, Tung A, Jeevanandam V, Raman J, Chaney MA. The effect of routine intraoperative transesophageal echocardiography on surgical management. J Cardiothorac Vasc Anesth 2007;21:800-4. 28. De Hert SG, Lorsomradee S, Cromheecke S, Van der Linden PJ. The effects of levosimendan in cardiac surgery patients with poor left ventricular function. Anesth Analg 2007;104:766-73. 29. Levin RL, Degrange MA, Bruno GF, Del Mazo CD, Taborda DJ, Griotti JJ, Boullon FJ. Methylene blue reduces mortality and morbidity in vasoplegic patients after cardiac surgery. Ann Thorac Surg 2004;77:496-9. 30. Butterworth J. Dobutamine: too dangerous for "routine" administration? Anesthesiology 2008;108:973-4.

18. Byrne JG, Leacche M, Paul S, et al. Risk factors and outcomes for "vasoplegia syndrome" following cardiac transplantation. Eur J Cardiothorac Surg 2004;25:327-332. 19. Dunser MW, Fries DR, Schobersberger W, et al. Does arginine vasopressin influence the coagulation system in advanced vasodila-tory shock with severe multiorgan dysfunction syndrome? Anesth Analg 2004;99:201-206. 20. Dunser MW, Mayr AJ, Stallinger A, et al. Cardiac performance during vasopressin infusion in postcardiotomy shock. Intensive Care Med 2002;28:746-751.

45 7

Revista Medicina Vol. 13 No. 2 Síndrome de vasoplejía en postoperatorio de cirugía de revascularización... Pág. 7 de 7


Vol. 13 No. 2, 2014 (Julio-Diciembre)

Revista Medicina

Sumario de ponencias del 1er Simposio Internacional de Enfermedades Infecciosas Abstracts of the 1st International Symposium on Infectious Diseases

El metabolismo energético de Leishmania como diana terapéutica Luis Ignacio Rivas López, Ph.D

Péptidos activos en membrana como agentes antileishmania Luis Ignacio Rivas López, Ph.D.

Centro de Investigaciones Biológicas (Consejo Superior de Investigaciones Científicas (CSIC). Madrid - España)

Centro de Investigaciones Biológicas (Consejo Superior de Investigaciones Científicas (CSIC). Madrid - España)

Los tripanosomátidos presentan grandes diferencias en la manera como resuelven sus necesidades energéticas. En una primera fase se describirán las dos monedas más comunes en las transacciones bioenergéticas del parásito, los polifosfatos y el ATP, asi como las posibilidades de incidencia farmacológica sobre sus niveles.

Los péptidos antimicrobianos (PAMs) son componentes de la denominada inmunidad innata, encargada de eliminar o enlentecer las invasiones por patógenos. Como tales, su localización preferente anatómica es en las vías de entrada de los mismos: mucosas, epitelios, células fagocíticas y fluidos. Su actuación frente a un amplio rango de patógenos, su síntesis asequible por su pequeño tamaño y escasez de modificaciones postraduccionales, así como la difícil inducción de resistencias, han llamado la atención de la industria farmacéutica como alternativa al creciente número de multiresistencias en clínica.

A continuación se describen las peculiaridades bioenergéticas de Leishmania, con especial detalle sobre la fosforilación oxidativa, al proporcionar el principal aporte de ATP, comparado con la glicolisis. Se describen las peculiaridades bioquímicas del parásito respecto al hospedador sobre las que se basan la explotación de las citadas dianas. A continuación, el campo de actuación de la citada estrategia se ilustra con ejemplos de los diferentes fármacos, tanto en uso como de nueva síntesis, cuya diana de actuación es la fosforilación oxidativa, como aminoquinolinas, miltefosina, estilbenos y β-aminoalcoholes, con los respectivos avances encontrados en cada uno de ellos y el grado de definición logrado de sus dianas. Finalmente se abordan las estrategias de direccionamiento y acumulación preferente de fármacos en la mitocondria, tanto por manipulación de las propiedades fisicoquímicas de los mismos, como por su vehiculación con agentes con tropismo mitocondrial, con el consecuente incremento de selectividad y disminución de daños colaterales que ello conlleva. Finalmente se recapitulará la importancia del metabolismo energético para Leishmania. Financiado con proyectos Fondo de Investigaciones Sanitarias- ISCIII, PI12-02706 y RETICS FEDER, RICET RD12/0018/0007.

46 7

Recibido para publicación el 19 de Octubre de 2014. Aceptado el 19 de Octubre de 2014.

La conferencia se centrará primero en una visión general de las características biológicas y físico-químicas de los PAMs, su posibilidad de optimización y obtención de relaciones estructura-actividad, así como en sus mecanismos de acción. En una segunda parte se abordará su incipiente aplicación en Leishmania , con sus correspondientes pros y contras. Conforme a su interacción con la membrana del parásito, se han dividido en tres grupos generales: 1.- Los péptidos con interacción irreversible con las membranas del parásito, y cuya letalidad se basa en la desestructuración de las mismas, tomando como ejemplo los péptidos híbridos cecropina A-melitina . 2.PAMs que interaccionan con la membrana de manera transitoria,para atravesarla y acceder a sus dianas intracelulares, como la histatina 5 , y 3).-Los péptidos penetrantes, que actúan como elementos de transporte a través de la misma para una amplia variedad de moléculas biológicas, con aplicaciones tan interesantes como la reversión de resistencias por acumulación defectuosa de fármaco o la utilización de agentes biológicos impermeables a la membrana, incluyendo

Revista Medicina Vol. 13 No. 2 Sumario de ponencias del 1er Simposio Internacional de Enfermedades Infecciosas Pág. 1 de 7


Sumario de ponencias del 1er Simposio Internacional de Enfermedades Infecciosas

macromoléculas; este apartado será ilustrado con la reversión de resistencias a miltefosina mediante conjugación a dichos péptidos . El futuro de dichas tecnologías será finalmente resumido. Financiado con proyectos Fondo de Investigaciones Sanitarias- ISCIII, PI12-02706 y RETICS FEDER, RICET RD12/0018/0007 Evaluación de las pruebas disponibles del diagnóstico de dengue para desarrollar un algoritmo de diagnóstico optimo con una sola muestra Elizabeth Hunsperger, Ph.D. Center for Disease Control and Prevention, NCEZID, DVBD, Dengue Branch

Antecedentes: El desafío del diagnóstico de dengue es que no hay una sola prueba detecta todos los analitos necesarios para confirmar el diagnóstico de un caso de dengue por medio de un solo espécimen obtenido durante la fase febril de la enfermedad. Sin embargo, el uso de dos pruebas de diagnóstico; uno para detectar directamente el virus del dengue (DENV) analitos y uno para detectar IgM anti-DENV debe identificar los casos de dengue entre las personas con una enfermedad sospechosa. Este estudio determinó el rendimiento de estas pruebas durante los 10 días después de la aparición de la enfermedad en comparación con IgM antiDENV seroconversión. Métodos: El curso de dengue entre 1 y 10 días después del inicio de la enfermedad (DPO) fue reconstruido utilizando un panel (n = 1.234) de las muestras de suero agudo y convaleciente archivados obtenidos a partir de los casos de dengue confirmados anteriormente en Puerto Rico (PR) entre los años 2005 hasta 2010; un período en el que se habían detectado los cuatro serotipos de DENV en PR. Todas las muestras fueron analizadas por el tiempo real CDC DENV 1-4 RT-PCR y anti-DENV IgM pruebas, y pruebas ELISA comerciales para NS1 antígeno y anti-DENVIgM. Resultados: La evaluación mostró que durante los 3 primeros días de la enfermedad, pruebas de antígeno RTPCR y NS1 realizan con la mejor sensibilidad que van desde 69 hasta 91%. Durante esta fase aguda temprana de la enfermedad (DPO = 0-3) la sensibilidad de las pruebas NS1 varió desde 78 hasta 93% (Panbio) y 8593% (Inbios). Las dos pruebas de IgM anti-DENV (Focus 47 7

Resúmenes de Artículos Cortos

Diagnostics y Inbios, Inc.) tenía una sensibilidad entre de 7-87% y 5-69%, respectivamente, durante la fase aguda (DPO = 0-5), lo que indica que el uso combinado de virus y detección de anticuerpos añade poder de diagnóstico. El efecto acumulativo de RT-PCR y anti-DENV IgM o NS1 y anti-DENV IgM confirmó> 80% de los casos de dengue en comparación con una sola prueba. Conclusión: Los tres analitos (ARN viral, NS1 y IgM) son detectables durante la fase aguda y convaleciente de una infección de DENV por lo tanto el uso de dos pruebas (RTPCR + anti-DENV o NS1 + anti-DENV IgM) en cualquier muestra de suero durante los primeros 10 días de la enfermedad proporciona la más alta probabilidad de confirmar un caso dengue. Para las pruebas individuales en la fase aguda de dengue, las pruebas de RT-PCR y NS1 proporcionan la más alta sensibilidad sin embargo anti-DENV IgM por Focus Diagnostics puede detectar hasta el 87% de los casos de dengue entre los días 4-5 de la enfermedad. RT-PCR y NS1 pueden confirmar 20-45% de casos de dengue durante los días 5-7 de la enfermedad. Sin embargo las pruebas anti-DENV IgM son más propensos a ser positivo tras día 5. Este estudio determina un algoritmo de pruebas de diagnóstico que proporciona la mayor probabilidad de un resultado definitivo en una única muestra de suero obtenidas durante una enfermedad del dengue según la definición de la OMS 2009 Clasificación de los casos de dengue. Descubrimiento y caracterización de biomarcadores para prognosis de Dengue hemorrágico Elizabeth Hunsperger, Ph.D. Center for Disease Control and Prevention, NCEZID, DVBD, Dengue Branch

Medio millón de pacientes son hospitalizados con dengue grave cada año, muchos de los cuales morirían sin la intervención clínica adecuada oportuna. La mayoría de los casos de dengue son sin complicaciones; Sin embargo, 2.5% de avanzan a dengue grave. Casos graves de dengue se han reportado con mayor frecuencia en los últimos 30 años. Para descubrir biomarcadores para dengue grave, se utilizó láser de desorción / ionización de espectrometría de masas de tiempo de vuelo de superficie mayor para analizar el virus del dengue en muestras de suero positivas de la fase aguda de la infección. Usando este método, 16 se identificaron las proteínas como biomarcadores candidatos para dengue grave. De estos 16 biomarcadores, se

Revista Medicina Vol. 13 No. 2 Sumario de ponencias del 1er Simposio Internacional de Enfermedades Infecciosas Pág. 2 de 7


Sumario de ponencias del 1er Simposio Internacional de Enfermedades Infecciosas

seleccionaron 3 candidatos para la confirmación mediante ELISA y Western Blot: vitronectina (Vtn, 55,1 kDa), hemopexina (Hx, 52,4 kDa), y serotransferrin (Tf, 79,2 kDa). Vitronectin, Hx, y Tf diferencia mejor entre el dengue y dengue grave. Diagnóstico de las malaria gestacional y placentaria en Colombia Amanda Maestre1, Olga María Agudelo1, Eliana Arango1, Adriana Correa1, Jaime Carmona-Fonseca1, María Fernanda Yasnot2. 1 Grupo Salud y Comunidad, Universidad de Antioquia, Medellín-Colombia. 2 Grupo GIMBIC, Universidad de Córdoba, Montería-Colombia.

La malaria gestacional y la malaria placentaria son problemas poco estudiados en Colombia, a pesar de ser este un país con alta prevalencia de infección malárica. La prueba de oro para el diagnóstico de las dos entidades es la evaluación microscópica de la gota gruesa de sangre. Sin embargo, el método ofrece graves limitaciones. En la gestante el diagnóstico se dificulta por la alta frecuencia de infección con parasitemia inferior a 1000 parásitos/ul, para lo cual la gota gruesa exhibe importantes falencias. Entretanto, el diagnóstico de la infección placentaria, es frecuentemente desestimado al momento del parto. En consecuencia, en la práctica rutinaria, la gota gruesa no se aplica en mujeres asintomáticas o el método es insuficiente para identificar la infección. Nuestro grupo ha investigado por más de 7 años este problema en la región de Córdoba. Mediante la aplicación de diferentes métodos de diagnóstico como la histopatología de la placenta, las pruebas rápidas de diagnóstico de malaria, y dos pruebas moleculares altamente sensibles: una PCR anidada y una PCR en tiempo real o cuantitativa (qPCR). Todas ellas han confirmado índices de infección entre 10-50%, dependiendo de la prueba y del compartimento que se evalúe (sangre materna o placenta). El problema de la infección frecuente de la placenta en gestantes de zonas endémicas en Colombia, adicionalmente tiene consecuencias importantes en la madre y en el feto. Las más evidentes tienen que ver con el estado inflamatorio del tejido placentario, en donde gran parte de las citoquinas proinflamatorias tipo Th1 (IFNg, TNFa, IL-10) se encuentran aumentadas en la sangre de la placenta y en ocasiones en la sangre materna. Es asi como las placentas de madres que han 48 7

Resúmenes de Artículos Cortos

sufrido la infección durante la gestación, pueden persistir positivas aun después de haber completado el tratamiento antimalárico y encontrarse con signos persistentes de inflamación. Esto enfatiza en la necesidad de encontrar un método eficaz y de fácil aplicación en el campo, que permita la identificación temprana y el tratamiento oportuno de la malaria gestacional y/o placentaria. Las directivas de salud y los investigadores del país deben concentrar sus esfuerzos en el diseño e implementación de estrategias que permitan prevenir la infección malaria en la población gestante. Malaria Complicada por Plasmodium vivax María Fernanda Yasnot Acosta, Ph.D. Grupo de Investigaciones Microbiológicas y Biomédicas de Córdoba, Programa de Bacteriología, Facultad Ciencias de la Salud, Universidad de Córdoba

La Organización Mundial de la Salud (OMS) en el 2000 refería que la malaria complicada era causada por Plasmodium falciparum, sin embargo actualmente, se conoce, que aunque la malaria complicada se presenta con mayor frecuencia en pacientes con Plasmodium falciparum, también Plasmodium vivax y Plasmodium knowlesi producen estados complicados y letales en los pacientes. Hasta el momento no se tiene una pauta clara de expertos de OMS sobre malaria complicada por P. vivax. Apenas en 2009, varios autores de India afirmaban que aunque la malaria por P. vivax genera una enorme carga de enfermedad, la investigación es muy insuficiente porque supuestamente solo causa la malaria terciana benigna y tiene un curso sin complicaciones. Sin embargo, con la implementación del diagnóstico molecular, se ha hecho evidente que la monoinfección por P. vivax también podría estar implicada en la disfunción orgánica múltiple y enfermedad grave que amenaza la vida, tal como sucede con la infección por P. falciparum. Agregan los investigadores de India y otros en Thailandia, Brasil y Perú que las manifestaciones graves reportados por monoinfección P. vivax son similares a las de infección grave por P. falciparum e incluyen malaria cerebral con convulsiones generalizadas, anemia grave, disfunción hepática e ictericia, lesión pulmonar aguda, síndrome de dificultad respiratoria aguda (SDRA) y edema pulmonar, choque, ruptura esplénica, insuficiencia renal aguda y trombocitopenia grave con o sin sangrado de diferentes partes del cuerpo. El número de casos de malaria P. vivax está aumentando

Revista Medicina Vol. 13 No. 2 Sumario de ponencias del 1er Simposio Internacional de Enfermedades Infecciosas Pág. 3 de 7


Sumario de ponencias del 1er Simposio Internacional de Enfermedades Infecciosas

en todo el mundo, incluidos los de la malaria complicada. La evidencia reciente sugiere que la infección con P. vivax induce una respuesta inmune inflamatoria más grave que la inducida por P. falciparum. En el 2010, en el noroeste de la Amazonia de Brasil, se describieron los hallazgos en 17 pacientes con malaria grave por P. vivax, confirmado por PCR y reportando anemia grave, ictericia casos, falla renal aguda, hemoglobinuria, SDRA y choque. Teniendo en cuenta los hallazgos clínicos y parasitológicos, la OMS considera como malaria complicada, independientemente de la especie causal, el cuadro clínico que se presenta con confusión, postración, malaria cerebral, convulsiones generalizadas, anemia normocítica grave, hipo glicemia, acidosis metabólica con compromiso respiratorio, alteraciones hidroelectrolíticas, falla renal aguda, edema pulmonar agudo o síndrome de dificultad respiratoria del adulto, colapso circulatorio, choque, sangrado anormal, ictericia, hemoglobinuria, hiperpirexia o hiperparasitemia. En Colombia, la malaria presenta una alta incidencia, aunque decreciente en los últimos diez años, tendencia vista en general en el mundo, por razones no claras. Entre 2003 y 2013 la cantidad de casos varió entre 59.222 (2013) y 154.077 (2003), según el SIVIGILA. En Colombia son escasos los informes sobre paludismo grave o complicado, en especial aquellos producidos bajo protocolos específicos y bien sustentados. Se hace urgente realizar estudios dirigidos a conocer los factores que contribuyan a causar complicaciones en pacientes con monoinfección por P. vivax que permitan avanzar en el conocimiento para iniciar nuevas estrategias de vigilancia, prevención y control de la enfermedad. Dinámica del Virus del Dengue en Colombia Raquel E Ocazionez J. Ph.D. Centro de Investigaciones en Enfermedades Tropicales (CINTROP) & Grupo de Investigación en Enfermedades Infecciosas y Metabólicas (GINEM)

El Virus del Dengue (VDEN) se mantiene en la naturaleza entre humanos, primates y mosquitos del género Aedes y en cada uno de estos huéspedes tiene mecanismos de adaptación particulares. Existen dos ciclos de transmisión, el epidémico entre humanos y el selvático entre primates. El VDEN posee genoma de ARN y por lo mismo sujeto a mutación continua. Así, las cepas aisladas de esos huéspedes difieren en la secuencia de 49

Recibido para publicación el 03 de Marzo de 2014. Aceptado el 25 de Marzo de 2014.

Resúmenes de Artículos Cortos

nucleótidos de algunos genes y este hallazgo permite afirmar que el VDEN es una población de mutantes o individuos genéticamente disímiles. Los estudios de evolución sugieren que el virus existe hace un poco más de 1000 años y que la población ancestral sufrió mutaciones continuas hasta generar cuatro grupos monofiléticos distintos. Los individuos infectados con cepas de cada uno de estos grupos producen anticuerpos específicos y esto ha permitido clasificar las cepas virales en los cuatro serotipos conocidos: VDEN-1, VDEN-2, VDEN-3 y VDEN-4. Debido a las mutaciones continuas en la población viral, cada serotipo está conformado por 4–5 subtipos conocidos como genotipos. Cada genotipo es a su vez una población de cepas que mutan y estos nuevos individuos conforman linajes distintos. La población de cada serotipo se mantiene en la naturaleza con períodos de abundancia y escasez que se conoce como patrón cíclico de barrido. Por lo general, este patrón coincide con ocurrencia de epidemias durante la abundancia y con emergencia de otro serotipo durante la escasez. A esto contribuye la carga inmune de la población y la introducción de cepas genéticamente distintas de otras áreas endémicas. El estudio de la dinámica del VDEN de Colombia se ha intentado en el Departamento de Santander, área metropolitana de Bucaramanga, por el Grupo de Arbovirus del CINTROP & GINEM. En varios periodos entre 1998 y 2009 se monitoreo la abundancia relativa de cada serotipo y su relación con la divergencia genética de la población viral y estos dos eventos con la ocurrencia de casos. Los cuatro serotipos han circulado con el patrón de barrido característico, en el que abundancia y escasez se repiten en un intervalo de aproximadamente de 6-10 años. El análisis de secuencias del gen E y del genoma completo de virus aislados de pacientes, permitió identificar un único genotipo de cada serotipo. Por otro lado, la población viral de cada serotipo se agrupó en varios linajes, con un patrón temporal de recambio en concordancia con períodos de predominancia o no del virus. El análisis sugiere que los serotipos VDEN-1, -2 y -3 se mueven en fase con respecto al período de abundancia y el DENV-4 por fuera de esta. Así, el cambio simultáneo en predominancia de dos serotipos coincide con ocurrencia de epidemia. En Colombia, dos o tres serotipos estuvieron cocirculando pero desde el 2001 están los cuatro y esto ha contribuido al patrón hiperendémico actual en todo el territorio En consecuencia, las epidemias son más

Revista Medicina Vol. 13 No. 2 Sumario de ponencias del 1er Simposio Internacional de Enfermedades Infecciosas Pág. 4 de 7


Sumario de ponencias del 1er Simposio Internacional de Enfermedades Infecciosas

Resúmenes de Artículos Cortos

frecuentes y de mayor magnitud. El estudio continuo de la dinámica del VDEN en cada área endémica del país es necesario. Esto debido a que el cambio de abundancia de los serotipos por lo general antecede el inicio de la epidemia y por lo mismo la información puede servir para fortalecer las medidas de control y prevención aminorando los efectos de ésta.

Neubauer y un extendido (teñido con Giemsa), respectivamente. La viabilidad fue evaluada por visualización de la exflagelación. Los gametocitos obtenidos fueron utilizados para los ensayos de formación de rosetas y de citoadherencia a los receptores ICAM-1, CD36, VCAM y CSA expresados en células CHO transfectadas.

Estudio de los fenómenos de citoadhesión y formación de rosetas por los gametocitos de Plasmodium vivax: Establecimiento de una metodología de enriquecimiento de gametocitos.

Resultados: Gametocitos viables y purificados fueron obtenidos de la sangre periférica de los pacientes con malaria vivax utilizando esta metodología. Un total de 31 aislados fue evaluado. El 65% (n= 28) de los aislados produjo rosetas a un nivel de entre 5 a 70%. De los aislados que fueron evaluados en su capacidad de citoadhesión (n=14) la mayoría (86%) adhirieron a los receptores estudiados. La citoadhesión fue observada en las células CHO que expresaban los receptores ICAM-1, CD36 y CSA.

Omaira Vera1,2, Stefanie CP Lopes1, Albrecht L1, Paula Brelaz2, Marcus V Lacerda2, Fabio TM Costa1 1 Departamento de Genética, Evolución y Bioagentes, Universidade Estadual de Campinas. Campinas, SP, Brasil. 2 Fundação de Medicina Tropical Dr. Heitor Vieira Dourado, Manaus, AM, Brasil.

Introducción: La presencia de gametocitos en sangre periférica es un factor crucial para la transmisión de malaria. Sin embargo, pacientes con baja densidad de gametocitos infectan eficientemente los mosquitos vectores. En Plasmodium falciparum ha sido evidenciada la adhesión de gametocitos inmaduros (estadios I a IV) en médula ósea y bazo; y circulantes en sangre periférica los gametocitos maduros (estadio V). Pero, esto no ha sido estudiado en Plasmodium vivax. Sin embargo, han sido descritos los fenómenos de citoadhesión y formación de rosetas de los parásitos asexuados de ambas especies. En este estudio establecimos una metodología de obtención de gametocitos de sangre periférica provenientes de pacientes con malaria vivax para estudiar los fenómenos de citoadhesión y formación de rosetas de los gametocitos, bajo la hipótesis que estos fenómenos favorecen la transmisión del parasito en la malaria vivax. Materiales y Métodos: Sangre periférica fue extraída de pacientes con malaria vivax (mantenida a 37°C durante el procedimiento). La sangre fue lavada con RPMI 1640. Los leucocitos fueron removidos usando columnas de celulosa. Posteriormente, los eritrocitos parasitados fueron purificados usando Percoll® 45%. Si era necesario, los eritrocitos infectados colectados da interfase del Percoll® eran pasados por una columna de separación MACS® y los eritrocitos parasitados retenidos por la columna MACS® eran recuperados. Finalmente, el número, la morfología y prevalencia de los gametocitos fueron examinados utilizando cámara de 50

Conclusiones: Esta metodología servirá de herramienta en los estudios de la biología de los gametocitos de Plasmodium vivax y de la transmisión de la malaria vivax. La capacidad de los gametocitos de Plasmodium vivax de citoadherir y formar rosetas resalta la importancia de los estudios sobre la influencia de estos fenómenos en la transmisión del parasito, que en la actualidad está siendo realizado. Agradecimientos: Este proyecto es financiado por CNPq (Proyecto 404154/2012-3/GAMETOMAL) y por la beca postdoctoral de la agencia FAPESP (Proceso 2013/05613-0). Evaluación del efecto de la primaquina según el esquema de administración (dosis diaria y días de uso) sobre los gametocitos de Plasmodium falciparum. María Isabel Arroyo Arroyo, Jaime Carmona Fonseca, Amanda Maestre Buitrago, Eliana Arango Flórez. Grupo Salud y Comunidad - Cesar Uribe Piedrahita. Universidad de Antioquia.

Introducción: Los gametocitos son responsables de la transmisión a los mosquitos. Los estudios que evalúan la terapia combinada con artemisininas reportaron buena eficacia y respuesta al tratamiento en las formas asexuales. Sin embargo, sólo la Primaquina (PQ) de la familia los 8-aminoquinolonas, es eficaz contra los gametocitos maduros, pero no está claro si es mejor dar una sola dosis o fraccionarla para eliminar los

Revista Medicina Vol. 13 No. 2 Sumario de ponencias del 1er Simposio Internacional de Enfermedades Infecciosas Pág. 5 de 7


Sumario de ponencias del 1er Simposio Internacional de Enfermedades Infecciosas

gametocitos circulantes después del tratamiento. Este trabajo evalúa el efecto de dar 0,75 mg/Kg de PQ en la eliminación de los gametocitos variando la dosis diaria y días de uso. Materiales y métodos: Tipo de estudio: Estudio clínico aleatorizado, no ciego y longitudinal. Población de estudio: Personas de los municipios de Puerto Libertador, Córdoba y de Santa Rita del Río Iró y Lloró, Chocó que acudieron a los puestos de malaria y cumplieron con los criterios de inclusión. Grupos de estudio: Los tres grupos de estudio recibieron Artemeter - Lumefantrina por 3 días y PQ así: Grupo 1: dosis única de 45 mg el día 3. Grupo 2: dosis diaria de 15 mg dada los días 1, 2 y 3. Grupo 3: 2 dosis de 15 mg dada el día 1 y 1 dosis de 15 mg dada el día 3 Los días de seguimiento fueron: 1, 3 y 7. Medición de la gametocitemia: Una qPCR específica para los genes Pfs16 y Pfs25 de gametocitos de P. falciparum permitió detectar y cuantificar el número de copias/ul de los genes blancos presentes en muestras de ADN copia de los pacientes. Resultados: Sesenta pacientes fueron ingresados al estudio. En los tres grupos de estudio el día 1 y 3 del seguimiento el número de personas infectadas con gametocitos maduros se mantuvo igual. En el Grupo 1, el día 7, el 5% (1/20) de las personas presentaron gametocitos maduros, mientras que, en los grupos de estudio 2 y 3 donde la PQ fue dada de manera fraccionada ningún paciente presentó gametocitos maduros 0% (0/20). El número de pacientes con gametocitos inmaduros el día 7 en el grupo 2 y 3 fue del 50% (10/20) y del 45% (9/20), respectivamente, mientras que, 15% (3/20) personas del grupo 1 tenían gametocitos inmaduros el día 7. Conclusiones: La dosis de PQ dada de manera fraccionada y con la terapia combinada con artemisininas eliminó los gametocitos circulantes una semana después de iniciado el tratamiento. Sin embargo, los gametocitos inmaduros persisten en la circulación una semana después de iniciado el tratamiento. DIVERSIDAD GENÉTICA DE Plasmodium vivax EN ÁREAS DE ALTO RIESGO DE MALARIA EN CÓRDOBA-COLOMBIA Carlos Castro, Virginia Rodríguez, María F. Yasnot 51

Resúmenes de Artículos Cortos

Grupo de Investigaciones Microbiológicas y Biomédicas de Córdoba, Universidad de Córdoba, Montería, Colombia

La diversidad genética de las poblaciones naturales de parásitos de Plasmodium vivax en áreas de alto riesgo de malaria en Córdoba-Colombia fue estudiada mediante reacción en cadena de la polimerasa – polimorfismo en la longitud de los fragmentos de restricción (PCR-RFLP) de la región variable del gen Pvmsp-3α. Se colectaron 125 muestras de sangre total en papel filtro a partir de pacientes con P. vivax que residían en los municipios de Tierralta, Puerto Libertador, Montelibano, Moñitos y Tuchín. Se realizó extracción de ADN utilizando chelex100. La confirmación de la infección por P vivax se realizó utilizando PCR anidada para amplificar un fragmento de 120pb epecifico de P. vivax, en el caso de P falciparum el tamaño del producto de PCR a obtener fue de 205pb. A las muestras confirmadas como P vivax se le realizo PCR-RFLP para el gen Pvmsp-3α, las enzimas de restricción utilizadas fueron Alu I y Hha I. De las 125 muestras analizadas por PCR anidada para el gen P v m s p - 3 α , 11 6 a m p l i f i c a r o n e x i t o s a m e n t e , confirmándose molecularmente en estas muestras la infección única por P vivax. El tamaño de los productos de PCR del gen Pvmsp-3α permitió evidenciar la circulación de tres genotipos diferentes, tipo A (1900 pb), tipo B (1500 pb) y el tipo C (1100 pb), siendo el genotipo A el más frecuente (88%). El 97,4% (113/116) de las muestras mostraron infecciones simples y el 2, 6% (3/116) infecciones policlonales, una por los tipos A y C y dos por los tipos A y B. Además reportamos el hallazgo de dos bandas en la electroforesis de los productos de amplificación del gen Pvmsp-3α ,en una muestra de un paciente de Puerto Libertador, una banda con un tamaño de1900 pb (tipo A) y otra con un tamaño aproximado de 800 pb que no corresponde con ninguno de los tamaños reportados hasta la fecha para el gen Pvmsp 3α, que puede representar un nuevo alelo del gen Pvmsp 3α, sin embargo estos resultados deben ser interpretados cautelosamente, por lo cual se mandará a secuenciar la banda para confirmar o descartar ésta hipótesis. La digestión de los productos de PCR del gen Pvmsp-3α con la enzima Alu I mostro 10 diferentes patrones de restricción y 9 con la enzima Hha I. Los resultados de la restricción enzimática de las 113 muestras analizadas revelaron que 40/113 (35,3%) y 47/113 (41,6%) de estas muestras, presentaban infecciones policlonales cuando

Revista Medicina Vol. 13 No. 2 Sumario de ponencias del 1er Simposio Internacional de Enfermedades Infecciosas Pág. 6 de 7


Sumario de ponencias del 1er Simposio Internacional de Enfermedades Infecciosas

se les digería con la enzima Alu I y Hha I, respectivamente. El gen Pvmsp-3α exhibió gran polimorfismo y los resultados sugieren que este gen puede ser utilizado en Colombia como un marcador molecular epidemiológico para el genotipado de P. vivax. Daño tisular placentario en infecciones submicroscópicas por Plasmodim spp. Córdoba-Colombia. Olga Agudelo1, Beatriz Aristizabal2, Stephanie K. Yanow3, Jaime Carmona-Fonseca1, Amanda Maestre1 1 Grupo “Salud y Comunidad-César Uribe Piedrahita”, Universidad de Antioquia, Medellín, Colombia. 2 Hospital Pablo Tobón Uribe, Laboratorio de Biología Molecular; Medellín, Colombia. 3 School of Public Health, University of Alberta; Provincial Laboratory for Public Health, Edmonton, Canadá

Resúmenes de Artículos Cortos

diferencia en su expresión comparando ambos grupos. Las placentas con infección positiva presentaron mayor frecuencia de infarto, calcificaciones, deciduitis y depósitos de fibrina. Conclusiones: Nuestros hallazgos histopatológicos y la presencia de pigmento malárico/hemozoína coinciden con lo referido en la literatura sobre la malaria placentaria y su efecto sobre el tejido placentario. La presencia aumentada de células inmunes en el tejido placentario explica la respuesta celular que se activa frente al estímulo de los eritrocitos parasitados y de la hemozoína hallados en las placentas y por ende la activación de vía de señalización celular asociadas a la apoptosis e hipoxia.

Introducción: La anemia materna, el bajo peso al nacer, el aborto y modificación de respuesta inmune en neonatos son algunas consecuencias de la malaria gestacional. En Colombia los reportes indican que, es común y que gran parte de esas infecciones cursan con parasitemias submicroscópicas. Durante la malaria gestacional, la placenta es el donde se acumulan los parásitos, lo que causa infiltrados de células inflamatorias y cambios histológicos. En este se propuso, indagar si existe daño tisular en infecciones plasmodiales submicroscópicas placentarias. Materiales y métodos: Se incluyeron mujeres en los municipios de Puerto Libertador, Tierralta y Montería del departamento de Córdoba. Se usó un diseño descriptivo, transversal y prospectivo. A partir de sangre placentaria y sangre materna de 50 gestantes se realizó qPCR para determinar la infección plasmodial y del tejido placentario se tomó biopsia para el análisis de expresión de Fas, FasL, HIF, VEGF, COX-1 Y COX-2 y para estudios histológicos y de TUNEL. Resultados: Se realizó diagnóstico de la infección plasmodial en sangre placentaria y materna. 25 fueron negativas y 25 positivas para infección plasmodial. La expresión de Fas fue mayor en las placentas positivas (P< 0.05). El porcentaje de células apoptóticas presentó una diferencia estadísticamente significativa entre placentas positivas y negativas, siendo mayor el porcentaje en el grupo con infección plasmodial. Se observó una diferencia estadísticamente significativa en la expresión de HIF, COX-1 y COX-2 siendo mayor en el grupo de placentas positivas. VEGF no presentó ninguna 52

Revista Medicina Vol. 13 No. 2 Sumario de ponencias del 1er Simposio Internacional de Enfermedades Infecciosas Pág. 7 de 7


Vol. 13 No. 2, 2014 (Julio-Diciembre)

Revista Medicina

A los colaboradores La revista MEDICINA, de la Universidad del Sinú Elías Bechara Zainúm-, es una publicación semestral sometida a arbitraje por pares, que contiene notas editoriales, artículos originales y trabajos de investigación, revisión de temas, presentación de casos clínicos o quirúrgicos, comunicaciones breves, actualizaciones terapéuticas, ensayos culturales y cartas al editor. Los artículos originales y trabajos de investigación incluyen los estudios inéditos que sean de interés para los lectores de la revista MEDICINA. Las normas de presentación de estos trabajos deben atenerse a las que rigen para la literatura médica científica universal según el Estilo Vancouver del Comité Internacional de Editores de Revistas Médicas. Las revisiones de temas deben ser lo más completas posibles con el objeto primordial de actualizar al lector. Sus autores deben ser profesionales con gran experiencia en el tema, que aporten abundante y reciente bibliografía. Las comunicaciones breves son notas cortas que plantean un asunto específico capaz de suscitar inquietudes o comentarios a un problema de interés. En este caso las referencias bibliográficas no deben exceder la cifra de 10. El Consejo Editorial recomienda que se incluyan referencias de autores colombianos. Los artículos que tengan cabida en la revista son de la plena responsabilidad de su autor o autores y no comprometen el criterio del Consejo Editorial. Se sobreentiende que los artículos que lleguen para publicación en la revista MEDICINA no han sido editados previamente, y se da por sentado que para su reproducción se requiere la autorización de su Consejo Editorial. Los artículos deben remitirse al Editor de la revista MEDICINA en original y dos copias escritas a doble espacio en computador. Una copia debe venir en medio electromagnético. El Consejo Editorial analizará cada artículo y emitirá su juicio sobre la conveniencia de su publicación. El ocasiones el Consejo podrá recomendar modificaciones o ajustes al texto. El nombre del autor o los autores, su título profesional y cargo 53

actual deben aparecer en la primera página, debajo del título del artículo o trabajo. Es deseable que el título sea corto y específico. Cada artículo tendrá un resumen que describa la metodología y los hallazgos más sobresalientes, e irá al comienzo del texto. Es necesario además que haya un summary que no exceda las 250 palabras y que lleve un máximo de 6 palabras claves. Las colaboraciones deben ser dirigidas al Dr. Alvaro Bustos González, a la Facultad de Ciencias de la Salud de la Universidad del Sinú, Montería, Colombia, o a abustos53@hotmail.com REQUISITOS El manuscrito debe incluir el título, el resumen, el texto, las referencias bibliográficas y los cuadros y gráficos con su explicación correspondiente. Cada una de las secciones del manuscrito debe identificarse así: 1.1. Título 1.2. Resumen y palabras claves 1.3. Contenido 1.4. Referencias y Bibliografía 1.5. Cuadros y Gráficos 1.6. Ilustraciones 1.1

TITULO. La página del título debe contener:

1.1.1 El título del artículo 1.1.2 Un subtítulo explicativo, si es del caso 1.1.3 Nombres y apellidos de los autores 1.1.4 Nombre de la Institución donde fue realizado el trabajo 1.1.5 Nombre y dirección del autor principal, para efectos de correspondencia 1.1.6 Forma de financiación, en caso de que exista 1.2

RESUMEN Y PALABRAS CLAVES

El resumen no podrá exceder 250 palabras. Su fin es explicar los propósitos del estudio, el diseño utilizado, los resultados principales y las conclusiones más protuberantes. Al Revista Medicina Vol. 13 No. 2 A los colaboradores Pág. 1 de 2


Vol. 13 No. 1, 2014 (Enero - Junio)

A los colaboradores

final del resumen se colocarán de 3 a 10 palabras claves para facilitar la inclusión del artículo en los índices universales. resultados principales y las conclusiones más protuberantes. Al final del resumen se colocarán de 3 a 10 palabras claves para facilitar la inclusión del artículo en los índices universales.

Para citas de libros debe señalarse el autor o los autores del capítulo, el nombre del autor del libro, nombre del libro, edición, ciudad de la publicación, editorial, año y página inicial y final del capítulo. 1.5

1.3

CUADROS Y GRAFICOS

CONTENIDO

Se divide en: -Introducción -Material y Método -Resultados -Discusión La Introducción hará una relación suscinta de los antecedentes que motivan el estudio, sin revisar el tema in extenso, y un enunciado de los objetivos.

Cada cuadro debe ir en hoja separada, con título y página numerada. Las notas explicativas se colocan al pie. 1.6

ILUSTRACIONES

Las figuras deben ser dibujadas o fotografiadas con la mejor tecnología disponible. Si son fotos se presentarán en papel brillante; si son esquemas, en papel blanco y con tinta china. Para ilustraciones a color, se enviarán las transparencias correctamente señalizadas. El tamaño máximo de las ilustraciones es de 8 x 11 cmts.

En Material y Método se hará una descripción detallada de ambos de manera que se permita su reproducción, y se considerarán los elementos utilizados en la investigación, sus fuentes y filtros, y el diseño del trabajo. Si se trata de una intervención terapéutica, se precisarán las drogas suministradas con sus nombres genéricos, dosis y vías de administración. Los Resultados deben ser presentados en una secuencia lógica, haciendo énfasis en los principales hallazgos, evitando repetir en el texto los contenidos de las tablas y figuras. En la Discusión se destacarán los aspectos más novedosos y trascendentes del estudio, haciendo relación a otras publicaciones similares. No se deben hacer afirmaciones que los datos de la investigación no respalden. Se plantearán nuevas hipótesis cuando sea del caso. 1.4

REFERENCIAS BIBLIOGRAFICAS

Se enumerarán en la secuencia de las citas. En el texto deben aparecer con números arábigos entre paréntesis. Se usará la forma de referencia adoptada por el Index Medicus. Ejemplos: 1.4.1 Revista Científica 1.4.1.1 Artículo Estándar Anote todos los autores cuando son menos de 6; cuando haya 7 o más, se anotarán los 3 primeros y se agregará el sufijo et, al. -Zubieta M., Salgado C., Paya E. Infecciones asociadas al uso de catéteres totalmente implantables en niños con cáncer. Revista Chilena de Infectología 1.996; 13:203-209

54

Revista Medicina Vol. 13 No. 2 A los colaboradores Pág. 2 de 2


Revista Medicina - Facultad de Ciencias de la Salud - Programa de Medicina Vol. 13 No. 1, 2014 (Enero-Junio) Dudas Makondianas Makondian doubts Dr. Álvaro Bustos González Staphylococcus aureus resistente a meticilina en un grupo de estudiantes de Medicina. Methicillin-resistant Staphylococcus aureus in a group of Medicine students Dra. Dina Ricardo y cols. Técnica de facilitación neuropropioceptiva para mejorar la flexibilidad en jugadores de voleibol de sexo masculino de la Universidad del Sinú Technical neuropropioceptive facilitation to improve the flexibility in male volleyball players in Sinú University Dra. Luis Minelly Beleño Torres y Dra. Luz Kerime Humanez Moreno Diabetes Mellitus 2: abordaje paso a paso Diabetes Mellitus 2: step by step approach Dr. José Alfredo Correa Guerrero y Dra. Leonilde Inés Morelo Negrete Self, self verdadero y falso, y su relación con el objeto Self, true Self and false Self, and its relation to the object Dr. Ricardo Camilo Rueda Mora Breve memoria del 1er. Simposio Internacional de Enfermedades Infecciosas Brief memory of the 1st International Symposium of Infectious Diseases Dr. Álvaro Bustos González ¿Es pertinente un Instituto de Investigaciones en Enfermedades Tropicales en el departamento de Córdoba? How relevant is an institute for research in infectious diseases in the Córdoba department? Dr. Richard Onalbi Hoyos López No todo lo nuevo es mejor The new is not always better Dr. Francisco Rodríguez Yances Melanoma maligno del pie: un tumor común en una presentación inusual Malignant melanoma in the foot: a common tumor in an unusual presentation Dagoberto Duarte Misol, María Merlana Almanza y Joulen Mo Carrascal Síndrome de vasoplejía en postoperatorio de cirugía de revascularización miocárdica con circulación extracorpórea (CEC): Utilidad del azul de metileno. Vasoplegia syndrome in postoperative CABG with cardiopulmonary bypass (CPB): Usefulness of methylene blue Dr. Guillermo Agamenón Quintero y cols. Sumario de ponencias del 1er Simposio Internacional de Enfermedades Infecciosas Abstracts of the 1st International Symposium on Infectious Diseases A los colaboradores

CAMPUS UNIVERSITARIO - Elías Bechara Zainúm Cra. 1w Calle 38 Barrio Juan XXIII PBX. (4) 784 0340 FAX. (4) 790 2038 Montería - Córdoba

EXTENSIÓN BOGOTÁ Calle 6 Mo. 118-60 - Calle 119 No. 5-25 PBX. (1) 6 29 03 44 Bogotá - Colombia

SECCIONAL CARTAGENA Calle 31 No. 20-71 Pie de la Popa PBX. (5) 658 1688 FAX. (5) 656 3749 Cartagena - Colombia

Medicina diciembre 2014-2  

Medicina diciembre 2014 -2