Page 1


El arte y la matemática han estado relacionados desde los inicios de la civilización. Ellos aparecen en todas las culturas. Es una relación profunda en donde se mezclan el sentido de la estética, la búsqueda de un ideal de perfección, la exploración del espacio tiempo y el reconocimiento de formas y patrones de repetición. Con respecto al arte, hubo diferentes estilos y normas sobre las proporciones de las figuras talladas que siguen vigentes hasta la actualidad. Las proporciones de las cuales se cita, están basadas en medidas matemáticas y geométricas tomando como modelo el cuerpo humano, y con esto conseguir un procedimiento que ayude a crear. La relación entre Arte y Matemáticas ha sido esencial para el desarrollo de ambas disciplinas. Los hombres del Renacimiento siguen inspirando a matemáticos que estudian sus obras y las leyes que encierran. También influyen en consideraciones religiosas, estéticas, antropológicas y de "modas". En la pintura medieval, las figuras eran simbólicas más que realistas y las formas planas y sin naturalidad. Por el contrario, la descripción del mundo real se convierte en el renacimiento en el objetivo de la pintura. Es por esto que los artistas deben estudiar la naturaleza para poder representarla en sus lienzos. Debido a esto se enfrentan con el problema matemáticos de representar el mundo real tridimensional en un lienzo bidimensional. Como el pintor no mira a través del lienzo, para determinar una sección especifica debe disponer de reglas basadas en teoremas matemáticos que establezcan la forma de dibujarla. Los matemáticos se han utilizado para diseñar las catedrales góticas, los mosaicos,


las alfombras orientales, etc. Las formas geométricas son fundamentales para los cubistas y para los expresionistas abstractos. Otra de las relaciones entre el arte y las matemáticas, se establece en estudios antropológicos sobre cómo dibujar al hombre en un lienzo. Por ello, se dieron diferentes estudios sobre el cuerpo humano en los que se diferencia el hombre de la mujer. En la mujer la cabeza es más larga en relación al cuerpo que en el hombre además sus formas están vinculadas a cilindros y globos por el contrario en el hombre con líneas y cubos. Los primeros criterios sobre proporción se originan en el antiguo Egipto. La escultura estaba directamente relacionada con las arquitectura, con esto las estatuas se tallan desde un cubo por pertenecer a sillares. Las proporciones eran medidas por un sistema cuadriculado en que la altura del hombre era de 18 a 24 cuadradillos según las épocas y 14 si estaba sentado. Con este método se determinaba la posición exacta de cada parte del cuerpo. Los griegos estudiaron extensivamente el cuerpo humano, durante la época helénica se crearon multitud de estatuas representando la figura humana. Policleto destacó por sus estudios, indicando que la belleza esta directamente relacionada con las proporciones numéricas del cuerpo humano. En su tratado "canon" determina relaciones matemáticas entre las diferentes partes del cuerpo. Vitruvio arquitecto-ingeniero autor del tratado de arquitectura "De Architectura" donde investigó la relación entre las artes y la matemáticas. Dentro del cuerpo humano estableció al ombligo ser el centro del cuerpo. Sabiendo que el hombre con los brazos extendidos tiene una anchura igual a su altura por lo que queda inscrito en un círculo y un cuadrado siendo el ombligo el centro del círculo. Se puede obtener el numero áureo de la relación que hay entre la distancia del ombligo a la punta de la mano y la altura del hombre.


Los bordes que supuestamente definen cada ciencia son cada vez más borrosos y el hombre requiere de poder usar todas las herramientas a su alcance, donde las etiquetas poseen cada vez menos sentido. En lugar de decir: “éste es un problema para un físico o para un ingeniero o un arquitecto o un biólogo o un matemático”, uno debería decir: tengo este problema. ¿Cómo lo resolvemos? Pensemos juntos. Como consecuencia, el avance llega solo. O más fácil. El texto que sigue muestra cómo los vasos comunicantes que generaron biólogos y matemáticos que trabajan en la frontera del conocimiento, permitieron poner en evidencia (una vez más) la existencia de ancestros comunes. Desde el momento en que, en el 2003, se completó el Proyecto Genoma Humano (HGP, de acuerdo con su sigla en inglés, Human Genome Project), comenzó también la carrera por conocer e identificar a nuestros antepasados, y saber con quienes compartimos ese “privilegio”. El proyecto, que duró más de trece años, permitió identificar los (aproximadamente) entre 20.000 y 25.000 genes del genoma humano, y determinar las secuencias de los 3.000 millones de pares de bases químicas que lo componen. Es decir, es como si uno tuviera un alfabeto que consista en nada más que cuatro letras: A, T, C y G (las iniciales de A= Adenina, T= Timina, C= Citosina, G= Guanina). El ADN de una persona es algo así como su cédula de identidad. Ahí esta escrita toda la información necesaria para el funcionamiento de sus células y sus órganos. En esencia, en una molécula de ADN está inscripto todo lo que podemos ser, nuestras particulares aptitudes y capacidades, y algunas de las enfermedades que podemos padecer. No obstante, es la combinación de esa información con el aporte del ambiente lo que hace que cada uno de nosotros sea único.


Esa doble hélice es una especie de serpentina que tiene escritas dos tiras enfrentadas de largas cadenas de esas cuatro letras. Pero, además, posee una particularidad: si en una de las tiras, en un lugar hay una letra A, entonces en el lugar correspondiente de la otra tiene que haber una letra T, y si hay una C, entonces en la otra tiene que haber una G. Ahora bien, ¿a qué viene todo esto que parece más asociado a un artículo sobre biología molecular que a algo que tenga que ver con la matemática? En el libro Algebraic Statistics for Computacional Biology (Cambridge University Press, 2005), los autores estudiaron una situación muy particular. Miren esta porción de ADN:

TTTAATTGAAAGAAGTTAATTGAATGAAAATGATCAACTAAG

Son 42 letras, en el orden en que están escritas. Para decirlo de otra manera, sería como una palabra de 42 letras. Esta “tira” del genoma fue encontrada en algún lugar del ADN de los siguientes vertebrados: hombre, chimpancé, ratón, rata, perro, pollo, rana, peces… Si uno tirara un dado, que en lugar de tener las seis caras convencionales, tuviera sólo cuatro lados, rotulados A, C, G, T, la probabilidad estimada de que esta secuencia de 42 letras apareciera en ese orden es de 1 dividido por 10 elevado a la 50. Es decir, la probabilidad de que esto haya ocurrido por azar es aproximadamente: 10 elevado a la -50= 0, 00000…0001. Para decirlo de otro modo, el número empezaría con un cero, luego de la coma, habría cincuenta ceros, y sólo entonces un número uno. Justamente, la probabilidad de que esto ocurra es tan baja que permite a los autores del libro conjeturar que todos ellos tuvieron un antepasado o un ancestro común (probablemente hace unos quinientos millones de años), que ya poseía esa secuencia de 42 bases, que fue heredada intacta a todos los descendientes de las distintas ramas de vertebrados. Por lo tanto, si bien uno no puede hablar de certeza, la probabilidad de que el hombre tenga el mismo origen que un pollo o un perro, o un ratón (ni hablar de un chimpancé) es altísima.


Para comenzar, es preciso aclarar que en todos los deportes se utilizan la matemática y sus números. Desde el fútbol y otros juegos de pelota hasta deportes como natación, etc. Se utiliza esta ciencia. En este trabajo nos referiremos a la matemática aplicada a los principales deportes de la actualidad: • El fútbol, el deporte más practicado en el mundo. • El tenis, uno de los deportes individuales más entretenidos del mundo. • El básquet, un deporte en equipo, muy estratégico. • Rugby, un deporte basado en el compañerismo entre los jugadores y de los más tácticos del mundo. Como dijimos antes, no nos parece necesario mencionar otros deportes que no son tan practicados, sobre todo en la Argentina, como el “Football” (Fútbol Americano) o el “Baseball”, jugados en países como Estados Unidos.

El fútbol, el deporte más practicado en el mundo En este deporte la matemática es muy utilizada. Desde el número de jugadores por equipo hasta las reglas del descenso del fútbol de nuestro país. A continuación comenzaremos a describir los aspectos donde la matemática es usada. Es necesario comenzar con lo básico, el fútbol es un juego de equipos con 11 jugadores por bando (en cancha) y 7 suplentes. Los partidos de fútbol tienen una duración de 90 minutos, con 2 tiempos de 45 minutos. De la matemática dependen numerosos aspectos de este deporte. El resultado del juego es una expresión matemática; matemática es la determinación de las posiciones temporales y finales de un campeonato, en la cual la suma de puntos obtenidos es la principal operación aritmética. También es importante la diferencia entre goles obtenidos y recibidos. En la Argentina, las reglas del descenso constituyen una complicada operación matemática: el promedio de los puntos obtenidos en los 2 últimos campeonatos y el que se está disputando, y ese total se divide por el número total de partidos disputados en los 3 certámenes. A continuación, daremos un ejemplo de las regla del descenso en el fútbol argentino Supongamos que Talleres de Córdoba obtuvo en la temporada 2007/2008, 36 puntos en 38 partidos, en la temporada 2008/2009, 45 en 38 y finalmente en la temporada 2009/2010 50 su promedio se calculará así: (36 + 45 + 50) / 114 (cantidad de partidos en los 3 últimos campeonatos) = 1.14912 (si llevamos esto a la realidad, el equipo se encontraría en los últimos 5 lugares de la tabla de posiciones)


El tenis, uno de los deportes individuales más entretenidos del mundo En el tenis también se utiliza la matemática, pero no tanto como en el fútbol. En este deporte los números se tienen en cuenta más que todos en el reglamento del partido, pero también, por ejemplo en el ranking de jugadores, llamado Ranking ATP. Los partidos son de 3 o 5 set, y cada uno de los sets tiene 6 juegos. Para ganar cada uno de estos juegos, también llamados “games”, es necesario convertir 4 puntos. En el Ranking ATP se suman los puntos obtenidos en cada torneo profesional en el que el jugador ha participado, desde el comienzo de su carrera. A continuación daremos un ejemplo de la matemática en el tenis: Supongamos que: Nadal tiene 5385 puntos (Segundo en el Ranking de ATP) Djokovic tiene 4470 puntos (Tercero en el Ranking de ATP) Davydenko tiene 3250 puntos (Cuarto en el Ranking de ATP) Los tres jugadores llegaron a la semifinal del Grand Slam de Estados Unidos (720 puntos al semifinalista) pero la final se disputó entre Nadal y Davydenko (1200 puntos al finalista y 2000 al campeón), y fue ganada por Davydenko, entonces, el ranking quedaría así: Nadal: 5385 + 1200 = 6585 puntos Davydenko: 3250 + 2000 = 5250 puntos Djokovic: 4470 + 720 = 5190 puntos El Ranking de ATP quedaría: Nadal tiene 6585 puntos (seguiría estando primero) Davydenko tiene 5250 puntos (pasaría a estar segundo) Djokovic tiene 5190 puntos (pasaría a estar tercero) Para retornar al segundo lugar en el ranking, Djokovic necesitaría: 5250 – 5190 = 60 puntos Si ambos jugadores clasificaran al mismo torneo del siguiente año y: Davydenko se quedara afuera en la segunda ronda (45 puntos) y Djokovic se quedara afuera en la cuarta ronda (180 puntos), el ranking volvería a cambiar: Djokovic: 5190 + 180 = 5370 Davydenko: 5250 + 45 = 5295


Rugby, un deporte basado en el compañerismo entre los jugadores y de los más tácticos del mundo El uso de las matemáticas en el rugby es más parecido al del fútbol, ya que se utilizan los números para múltiples aspectos: cada partido se divide en dos periodos de 40 minutos cada uno; cada equipo cuenta con 15 jugadores en el campo de juego; una sanción o las infracciones deportivas es la amonestación que implica el retiro del jugador sancionado por el término de 10 minutos y la expulsión que representa la salida definitiva del jugador por el resto del partido. Una particularidad del rugby es que otorga diferente puntuación según la categoría de la conversión lograda. El try es premiado con 5 puntos y un adicional de dos puntos más si se logra convertir el tiro a los palos que el try tiene como premio extra. El penal y el drop son otras conversiones que otorgan 3 puntos. Como observamos la matemática está presente de manera permanente en los deportes. En el rugby, también existe el “scrum”: Tras una falta menor (un pase adelantado o una caída involuntaria de la pelota hacia adelante, por ejemplo), o para reiniciar el juego luego de una formación donde la pelota no salió para ninguno de los dos equipos, se realiza un “scrum”. El "scrum", una de las formaciones más reconocibles del rugby, es una puja frente a frente, de un grupo de ocho jugadores de cada equipo, llamado “a.C.”, que se presentan agachados y agarrados, para la recuperación del balón. El grupo que haya obtenido el mismo, debe sacarlo sin tocarlo con la mano por detrás de la formación, donde lo tomará un jugador (usualmente, pero no siempre, el "medio scrum") y continuará el juego 1 . A continuación daremos un ejemplo de la matemática en el “scrum”: Supongamos que el “a.C.” de “Los Pumas” (Argentina) tiene un peso de 875 kilogramos entre los ocho jugadores, es decir, un promedio de 109 kilogramos por jugador y el “a.C.” de los “a.C. Blacks” (Nueva Zelanda), un peso de 859 kilogramos, es decir un promedio de 107 kilogramos por jugador. Traducido a números: Argentina: 875 / 8 = 109 kilogramos Nueva Zelanda: 859 / 8 = 107 kilogramos Si tenemos en cuenta el peso de cada “a.C.”, las probabilidades de que Argentina gane el “scrum” serán mayores, al tener el “a.C.”, un mayor peso que el de su rival. No obstante, la realidad del juego entre estos dos equipos indica que esa supuesta superioridad no se da en la práctica debido a otros factores (fuerza, potencia física, táctica, capacidad individual de cada jugador, etc.).


El básquet, un deporte en equipo, muy estratégico Los números también se presentan en el básquet, o baloncesto. Está presente, como en el rugby, en las conversiones, y en otros aspectos. El básquet tiene 3 tipos de conversiones: el triple (tres puntos), el doble (dos puntos) y los tiros libres que, valen un punto. El tiempo de duración de los partidos es otro aspecto en donde está presente la ciencia. Se podría decir que se utilizan fracciones, ya que el tiempo de duración es de 4 cuartos de diez minutos cada uno. A continuación daremos un ejemplo de probabilidad de ganar en el básquet: Supongamos que Estados Unidos (el mejor equipo del mundo) pasa a octavos de final, luego de avanzar en la fase de grupos. Para nosotros, Estados Unidos tiene un 90 por ciento de posibilidades de ganar partidos contra cualquier equipo al que le toque jugar hasta ganar el campeonato. Para ganar el mismo es necesario ganar 4 partidos, entonces: La probabilidad de ganar el primer partido (octavos de final) es: 9/10 o 0.9 La probabilidad de ganar los dos primeros partidos (cuartos de final) es: 9/10 x 9/10 = 81/100 La probabilidad de ganar los 3 partidos (semifinal) es: 9/10 x 9/10 x 9/10 = 729/1000 La posibilidad de ganar todos los partidos y salir campeón es: 9/10 x 9/10 x 9/10 x 9/10 = 6571/10000 Es decir que la probabilidad que hay de que el equipo salga campeón es: 0.65 o 65 por ciento de posibilidades

Aspectos Generales Además se aplica la matemática en las distancias de por ejemplo: los campos de juego, de los cuales puede obtenerse su perímetro y superficie; la distancia de un penal o una barrera (fútbol) la distancia de tiro de triple (básquet), etc.


Las Matemáticas se encuentran presentes en las plantas, alzados y elementos decorativos de los edificios que nos rodean. Basta con situarnos delante de uno de ellos y contemplarlo con detenimiento, para observar que numerosas figuras geométricas, desde las más elementales a las más complejas, se encuentran presentes en su diseño. Y que el orden que se refleja en su imagen arquitectónica está íntimamente relacionado con la inserción en el mismo de figuras geométricas, y con la existencia de relaciones entre los elementos de éstas, de forma .

que la composición arquitectónica está estrechamente ligada a las matemáticas, y más especialmente a la geometría. Por ello, comentábamos que las proporciones que tienen los elementos arquitectónicos, las relaciones de unas figuras con otras dentro del edificio y las disposiciones que rigen los cánones de la belleza de sus formas, son leyes puramente matemáticas. Saber ver la arquitectura es, en cierto modo, descubrir en ella la perfección que le confiere su diseño geométrico y su ordenamiento matemático


Matemática en la Arquitectura

No extraña a nadie el hecho de que las matemáticas tengan una aplicación directa en arquitectura. Todos nos podemos imaginar que, antes de poner manos a la obra, el arquitecto tiene que comprobar que la estructura que quiere construir es realizable teniendo en cuenta la resistencia de los materiales que empleará, las cargas que tienen que soportar y quizás también el coste económico. Sin embargo parece que esta aplicación se reduce sólo a esto, al cálculo de estabilidades, de tensiones, etc., pero de ninguna forma al diseño del objeto arquitectónico mismo. Pensamos, y es bien cierto, que con respecto a la creación artística, el arquitecto aparta de su mesa de trabajo las matemáticas y deja volar la imaginación en la búsqueda de la forma deseada. Pues bien, esto no es exactamente así. Lo que quizás resulta desconocido es que las matemáticas también pueden ayudar, y de hecho lo hacen, si no en el mismo momento mágico de creación artística, sí en el inmediatamente posterior. “Toda creación arquitectónica es geometría’’ es una máxima que se

puede encontrar en los tratados de geometría descriptiva. Desde siempre, los arquitectos han aprovechado superficies de las que pueden calificarse de clásicas y las combinaban acertadamente. Y en nuestros días, también lo continúan haciendo. Una nueva teoría, la de las superficies de Bézier y sus generalizaciones, engendrada a principios de la década de los 60 en varias empresas automovilísticas y de construcción aeronáutica, permite ayudar al arquitecto a diseñar superficies de manera arbitraria con sencillez y elegancia. En el Renacimiento la arquitectura usaba la simetría como principio de guía. Más adelante Alto renacimiento o Barroco utilizaba formas curvadas y dramáticamente torcidas como contextos variados tales como cuartos, columnas, escaleras y cuadrados. Al igual que evidente, la arquitectura ha intentado siempre alcanzar los extremos que no sólo se relacionan con la función, pero también con la estética, la filosofía y el significado. Y en muchos casos, los medios han sido la belleza y la estructura de las matemáticas.


Geometría en Arquitectura

El círculo y el cuadrado pueden emanar de la geometría social o de la fabricación, pero también son figuras abstractas, puras. Como tales, en ocasiones se les atribuye poderes estéticos o simbólicos. Algunos arquitectos las emplean para infundir a su obra una disciplina que es independiente de las diversas geometrías de la realidad. Pero la geometría no solo comprende el cuadrado y círculo sino también sus derivados tridimensionales, el cubo y la esfera. Las creaciones naturales como las proporciones del cuerpo humano, las relaciones entre los planetas o los intervalos de la armonía musical, obedecían a relaciones geométricas, y que si se quería que las obras de arquitectura tuviese la misma coherencia conceptual, debían a su vez ser proyectados usando figuras perfectas y proporciones matemáticas armónicas. Por otro lado a través de la arquitectura podía conseguirse ese grado de perfección que las creaciones naturales tan solo insinuaban Se consideraba que el uso de la geometría era un medio que tenían los seres humanos para mejorar el imperfecto mundo en el que se encontraba.

Por lo tanto, la pureza geométrica era la piedra de toque de la capacidad humana o la obligación de hacer un mundo mejor. A consecuencia de todo ello, los arquitectos renacentistas hicieron un uso profuso de las figuras perfectas y de las proporciones geométricas en sus edificios. Muchos arquitectos han ideado edificios cuyas plantas se inscribían en cuadrados perfectos. Este tipo de distribución en planta difiere conceptualmente de la composición de una fachada como matriz bidimensional de cuadrados, en que aquí interviene la tercera dimensión y, tal vez, la cuarta: la del tiempo. El arquitecto siempre busca ideas que le ayudan a dar una forma a su obra y una orientación a su proyecto. Y de todas esas ideas, la geometría figura entre la más conveniente.


La Torre Eiffel matemáticamente La Torre Eiffel, construida para conmemorar el centenario de la Revolución Francesa, y una obra arquitectónica portentosa, sigue siendo objeto de estudios y análisis. El profesor Patrick Weidman empezó a indagar el problema cuando recibió una segunda copia de la edición del libro "Matemáticas avanzadas de Ingeniería", en 2001. La cubierta del libro tiene fotos de etapas diversas de construcción de la Torre Eiffel, y el prólogo del libro contiene una ecuación integral no lineal -una fórmula con diversas soluciones posibles- para la forma de la torre. La ecuación fue creada por Christophe Chouard, un estudioso francés de la Torre Eiffel, quien la anunció en su sitio Web y desafió a los ingenieros y matemáticos de todo el mundo a encontrar su solución. En base a funciones matemáticas conocidas, Weidman halló una solución una parábola orientada hacia abajo-, pero no coincidente con la legendaria estructura. Después de contactar con el experto en análisis matemático Losif Pinelis, y con un biógrafo de Eiffel, Henri Loyette, quien le sugirió buscar los escritos del ingeniero francés en los archivos históricos, Weidman finalmente dedujo la base para la construcción de la torre. Un factor crucial para los cálculos que Eiffel tenía en mente pasaba por calibrar el efecto de las fuerzas ejercidas por el viento sobre determinados puntos estructurales de la Torre. Weidman encontró una solución exacta de la ecuación en forma de una función exponencial que se ajusta rigurosamente a la forma de la mitad superior de la torre. El trazado de la forma de la torre revela dos secciones exponenciales separadas que están interconectadas. Ya que Eiffel no pareció fiarse mucho de las estimaciones relativas a la fuerza de torsión del viento sobre la torre, optó por "sobre diseñar" la sección inferior, reforzándola por razones de seguridad. El coeficiente de seguridad estructural es por tanto responsable de la segunda ecuación exponencial que describe la mitad inferior de la torre. Weidman y Pinelis presentaron sus descubrimientos en un artículo titulado "Ecuaciones Modelo para el Perfil de la Torre Eiffel: Perspectiva histórica y nuevos resultados". Se construye con triángulos ya que el triángulo es el único polígono indeformable. Si construimos un paralelogramo, u otro polígono de más lados, con tiras de cartón y alfileres, obtenemos estructuras que se deforman presionando. Realizando la operación con el triángulo, no lo modificamos: es la rigidez del triángulo la que hace que sea utilizado en muchas construcciones.


Sistema binario El sistema binario, en matemáticas e informática, es un sistema de numeración en el que los números se representan utilizando solamente las cifras cero y uno (0 y 1). Es el que se utiliza en las computadoras, pues trabajan internamente con dos niveles de voltaje, por lo que su sistema de numeración natural es el sistema binario. La informática combina los aspectos teóricos y prácticos de la ingeniería, electrónica, teoría de la información, matemáticas, lógica y comportamiento humano. Podemos decir que el Sistema Binario tiene su aplicación en los programas más utilizados en la actualidad. Ejemplo: Word, Excel, etc.

Historia del sistema binario El antiguo matemático indio Pingala presentó la primera descripción que se conoce de un sistema de numeración binario en el siglo tercero antes de nuestra era. En 1605 Francis Bacon habló de un sistema por el cual las letras del alfabeto podrían reducirse a secuencias de dígitos binarios, las cuales podrían ser codificadas como variaciones apenas visibles en la fuente de cualquier texto arbitrario. El sistema binario moderno fue documentado en su totalidad por Leibniz, en el siglo diecisiete, en su artículo "Explication de l'Arithmétique Binaire". En él se mencionan los símbolos binarios usados por matemáticos chinos. Leibniz usó el 0 y el 1, al igual que el sistema de numeración binario actual. En 1854, el matemático británico George Boole publicó un artículo que marcó un antes y un después, detallando un sistema de lógica que terminaría denominándose Álgebra de Boole. Dicho sistema desempeñaría un papel fundamental en el desarrollo del sistema binario actual, particularmente en el desarrollo de circuitos electrónico


Sistema Binario La creación de este sistema de numeración se debe al famoso matemático Fracis Bacon, quien utilizó el concepto de base dos antes del descubrimiento de la electricidad. Para expresar el número en notación binaria, se considera una sucesión de ceros y unos compuesta por ceros, en las posiciones libres, y unos en aquellas en las que se colocó una ficha. Vemos, así, que el binario es un sistema de numeración posicional en base dos, es decir, que emplea sólo dos símbolos (0 y 1), los cuales representan diferentes valores según la posición que ocupen en el número.

El código ASCII Para solucionar los problemas de la comunicación que se dan entre el hombre y la máquina, se emplean códigos. El que utiliza la computadora consiste en una serie de reglas que permite asociar una determinada secuencia de ceros y de unos a un cierto carácter. De esta forma, por ejemplo, se convino asociar la secuencia 01000001 con el carácter “A”. A cada secuencia de ocho números en código binario se le hace corresponder un carácter. Esta correspondencia se denomina codificación ASCII. La existencia del código ASCII permite el intercambio de información entre sistemas distintos y facilita la labor de intercambio entre el hombre y la máquina, por su función estandarizadora. Por cierto, en lugar de diseñar circuitos cada vez más complejos para que la computadora pueda representar un conjunto de caracteres más apropiados para el lenguaje humano, se mantiene el lenguaje binario de los ceros y los unos, que ésta maneja con rapidez y eficacia. El código ASCII permite la rápida decodificación del contenido de la memoria de una computadora repleta de ceros y unos, de difícil comprensión para el hombre.


Las matemáticas son hasta este momento el lenguaje más apropiado para describir la naturaleza. La biología es quizás una de las ciencias que más tardó en beneficiarse de una descripción matemática de sus resultados. Sin embargo, en la actualidad hay gran actividad de investigación en el campo de la biología matemática construyendo modelos para explicar la interacción entre poblaciones de diferentes especies, el crecimiento de células cancerosas y muchas otras cosas. Desde el comienzo la biología se ha caracterizado por ser una disciplina contemplativa y descriptiva. Los avances mas profundos en la biología se han logrado en los últimos 70 años debido al progreso de los métodos de medida. La Biomatemática, por otro lado, data de apenas principios del siglo XX. La meta básica de la ciencia moderna es crear, en torno a los fenómenos reales, modelos que describan y predigan el comportamiento de dichos fenómenos. Esto es justo lo que la Biomatemática hace .Lo hace creando modelos matemáticos de cierto fenómeno biológico para lograr predecir el comportamiento en un futuro. Una de las metas de la Biomatemática es descubrir variables en los fenómenos, elaborando modelos, reglas operacionales que describan el fenómeno biológico estudiado.

Biomatemática Biología Matemática o Biomatemática es un área interdisciplinaria de estudios que se enfoca en modelamiento de los procesos biológicos utilizando técnicas matemáticas. Tiene grandes aplicaciones teóricas y prácticas en la investigación biológica. Debido a la gran diversidad de conocimiento específico involucrado, la investigación biomatemática es a menudo hecha en colaboración entre matemáticos, físicos, biólogos, zoólogos, químicos y fisiólogos, entre otros científicos.

Importancia: •

• •

El incremento explosivo de conjuntos de información debido a la revolución genómica, las cuales son difíciles de entender sin el uso de herramientas analíticas. El reciente desarrollo de herramientas matemáticas (como por ejemplo la teoría del caos) ayuda para el entendimiento de mecanismos complejos y no lineales en biología. Un incremento en la capacidad computacional que permite hacer cálculos y simulaciones que no eran previamente posibles. Un incremento en el interés en la experimentación in silico debido a las complicaciones involucradas en investigación animal y humana.


Áreas de Investigación: A continuación sigue una breve descripción de algunas áreas de investigación de la biológica: Dinámica de poblaciones: La dinámica de poblaciones ha tradicionalmente sido el campo dominante de la biología matemática. Trabajo en esta área se remonta al siglo XIX. Las ecuaciones Lotka–Volterra son un famoso ejemplo. Hacia finales del siglo XIX y en la primera década del siglo XX, la dinámica de la población ha sido complementada por la teoría evolutiva de juegos, desarrollada primero por John Maynard Smith. Bajo estas dinámicas, conceptos de la biología evolucionaria pueden tomar forma determinista y matemática. La dinámica de poblaciones está relacionada con otra área activa de investigación en biomatemática: epidemiología matemática, el estudio de las enfermedades infecciosas afectando las poblaciones. Varios modelos de esparcimiento viral han sido propuestos y analizados, y éstos proveen resultados importantes que pueden ser aplicados a políticas de salud. Modelado en biología celular y molecular Esta área ha recibido un incremento en interesados debido a la creciente importancia de la biología molecular. • Modelado de neuronas y la carcinogénesis • Mecánica de los tejidos biológico • Enzimología teórica y cinética enzimática • Modelado del cáncer y simulación • Modelado del movimiento de poblaciones celulares interactivas • Modelado matemático la formación de un tejido de granulación • Modelado matemático de dinámica intracelular Modelado de sistemas fisiológicos • Modelado de enfermedades arteriales • Modelado multi-escalar del corazón


Modelos Matemáticos: Un modelo de un sistema biológico es convertido a sistemas de ecuaciones, aunque la palabra modelo es a menudo usada como el sistema de las ecuaciones correspondientes. La solución de las ecuaciones, ya sea por medios analíticos o numéricos, describe cómo el sistema biológico se comporta ya sea a en el tiempo o en equilibrio. Hay muchos diferentes tipos de ecuaciones y el tipo de comportamiento que puede ocurrir es dependiente tanto del modelo como de las ecuaciones utilizadas. El modelo a menudo hace suposiciones sobre el sistema. Las ecuaciones pueden también hacer suposiciones sobre la naturaleza de lo que puede ocurrir. En relación a biomatemática: o

herramientas

y

modelos

matemáticos

utilizados

en

Ecuaciones diferenciales: Las ecuaciones de Lotka-Volterra, también conocidas como ecuación predador-presa, son un par de ecuaciones diferenciales de primer orden no lineales que se usan para el modelado de dos poblaciones que interactúan, una presa y un depredador.

Tales ecuaciones se definen como:

Donde • y es el número de algún predador (por ejemplo, un lobo); • x es el número de sus presas (por ejemplo, conejos); • dy/dt y dx/dt representa el crecimiento de las dos poblaciones en el tiempo; • t representa el tiempo; y • α, β, γ y δ son parámetros que representan las interacciones de las dos especies. o

Proceso estocástico:

En estadística, y en concreto teoría de la probabilidad, un proceso aleatorio o proceso estocástico es un concepto matemático que sirve para caracterizar; es una sucesión de variables aleatorias (estocásticas) que evolucionan en función de otra variable, generalmente, el tiempo. Cada una de las variables aleatorias del proceso tiene su propia función de distribución de probabilidad y, entre ellas, pueden estar correlacionadas o no. Cada variable o conjunto de variables sometidas a influencias o impactos aleatorios constituye un proceso estocástico.


o o o o o o

La matemática aplicada a la ciencia Genomas y ancestros comunes La matemática en el deporte Matemática aplicada a la arquitectura La matemática aplicada a la informática Matemática aplicada a la biología

2-3 4-5 6-7-8-9 10-11-12-13 14-15 16-17-18


Hoy en día, la Matemática se usa en todo el mundo como una herramienta esencial en muchos campos, entre los que se encuentran las ciencias naturales, la ingeniería, la medicina y las ciencias sociales, e incluso disciplinas que, aparentemente, no están vinculadas con ella, como la música (por ejemplo, en cuestiones de resonancia armónica). La matemática aplicada, rama de la matemática destinada a la aplicación de los conocimientos matemáticos a otros ámbitos, inspiran y hacen uso de los nuevos descubrimientos matemáticos y, en ocasiones, conducen al desarrollo de nuevas disciplinas. Los matemáticos también participan en la matemática pura, sin tener en cuenta la aplicación de esta ciencia, aunque las aplicaciones prácticas de la matemática puras suelen ser descubiertas con el paso del tiempo.

REVISTA QUINTO AÑO  

REVISTA MATEMATICA QUINTO AÑO

Read more
Read more
Similar to
Popular now
Just for you