Proefschrift manon kerkhof

PELVIC ORGAN PROLAPSE MATRIX, CELLS & GENES

MANON KERKHOF

PELVIC ORGAN PROLAPSE matrix, cells and genes

Manon Kerkhof

The studies in this thesis were supported by grants from the Dutch government to the Netherlands Institute for Regenerative Medicine [FES0908 to A.M.R-Z], Stichting dr.F.E. Posthumus Meyjes Fonds and Advanced Technologies and Regenerative Medicine (ATRM, LLC).

Financial support for printing of the thesis was kindly provided by: American Medical Systems, Astellas, Bard, Bayer, Erbe, Ethicon (Johnson & Johnson Medical BV), Hologic, Medical Dynamics, VU University.

Cover design: Rob Buiter Lay-out: Barbara van der Mast Printing: Gildeprint Drukkerijen ISBN/EAN: 9789461087096 Š Copyright 2014: Manon H. Kerkhof, Heemstede, The Netherlands, 2014 All rights reserved. No part of this thesis may be reproduced, or transmitted in any form or by any means, electronic or mechanical, including photocopying, recording or any information storage or retrieval system, without written permission from the copyright owner.

VRIJE UNIVERSITEIT

PELVIC ORGAN PROLAPSE matrix, cells and genes

ACADEMISCH PROEFSCHRIFT ter verkrijging van de graad Doctor aan de Vrije Universiteit Amsterdam, op gezag van de rector magnificus prof.dr. F.A. van der Duyn Schouten, in het openbaar te verdedigen ten overstaan van de promotiecommissie van de Faculteit der Geneeskunde op dinsdag 16 september 2014 om 15.45 uur in de aula van de universiteit, De Boelelaan 1105

door Manon Heleen Kerkhof geboren te Losser

promotoren: prof.dr.ir. Th.H. Smit prof.dr. H.A.M. Brรถlmann copromotoren:

dr. M.N. Helder dr. B. Zandieh Doulabi

‘The journey of a thousand miles begins with a single step’ (Lao Tzu)

manuscriptcommissie: Prof.dr. S. Gibbs Dr. K.B. Kluivers Prof.dr. H.W.M. Niessen Dr. J.P.W.R. Roovers Prof.dr. B.J. van Royen Dr. G. Pals

Prof.dr. C.H. van der Vaart paranimfen: Drs. H. van der Jagt-Willems Drs. A.M. Ruiz-Zapata

CONTENTS Chapter 1

General introduction

9

Chapter 2 Changes in connective tissue in patients with pelvic organ prolapse 25 Chapter 3

Changes in tissue composition of the vaginal wall of premenopausal women with prolapse 53

Chapter 4 Micro-array analysis of the anterior vaginal wall in pelvic organ prolapse

71

Chapter 5 Fibroblasts from women with pelvic organ prolapse show

differential mechano-responses depending on surface substrates 93 Chapter 6

Functional characteristics of vaginal fibroblasts from premenopausal women with pelvic organ prolapse 111

Chapter 7

General discussion and future perspectives

135

Chapter 8

Summary & Samenvatting

153

Addendum List of abbreviations

Pelvic organ prolapse quantification system Flexercell device

Authors and affiliations

List of publications Dankwoord Curriculum vitae

167 169 173 175 177 179 191

1 General introduction

Chapter 1

PROLOGUE

1

Pelvic organ prolapse (POP) is a condition in women in which pelvic organs, such as the uterus, bladder or intestines, may push the vagina outside the body. This is due to pelvic floor muscle weakness and dysfunctional connective tissue. POP may cause chronic pelvic pain and pressure, urinary or fecal incontinence, sexual dysfunction and social isolation. This affects the quality of life of women with POP considerably.2-4 Age is one of the important risk factors for POP.5 With the worldwide ageing of the population, POP is a growing global health problem. The prevalence of POP in the Dutch population is 11%.6 With approximately 13.000 (www.prismant. nl) surgical procedures each year, prolapse is the most common indication for gynecological surgery. This number is likely to increase approximately 35% over the next three decades, as the number of women over the age of 50 is expected to increase significantly.7;8 Native tissue repair is one of the common surgical therapies in POP. However, almost 30% of women operated for POP by this procedure will need a re-operation because of recurrent prolapse. In an attempt to improve this poor surgical outcome, synthetic implant materials were introduced in 1960 but are frequently used since the beginning of this century. Although the first results of these synthetic implant materials were promising, concerns arose about the safety of these new implants.

Biological materials have not proven to be a realistic alternative. Although they have better tissue compatibility, and thus cause less local complications, the biological materials explored so far do not provide sufficient stability and support.

The urge for an alternative approach in pelvic reconstruction motivated us to start a multidisciplinary project with the aim to elucidate the fundamental problems in women with POP, and, possibly develop a therapy based on the principles of regenerative medicine. This thesis focuses on the necessary basic knowledge for this regenerative medicine approach in the pelvic floor and more specifically the anterior vaginal compartment.

10

Introduction

BACKGROUND Definition Pelvic organ prolapse (POP) is defined as a descent of the female pelvic organs, including the bladder, uterus or vaginal vault after hysterectomy, or the small or large intestine, resulting in protrusion, bulging or herniation of one or more pelvic organs into or even out of the vagina.9;10 POP is a result of mechanical failure in the pelvic floor tissue that supports the abdominal and pelvic organs. Pelvic organ support is maintained by a complex interaction between the levator ani muscles of the pelvic floor, the vagina and the supportive tissues of the vagina, such as ligaments and fascia. Traditionally, this structural support has been categorized in three distinct levels, highlighting support of the upper third of the vagina by the cardinal and uterosacral ligaments (level I), paravaginal attachments of the middle half of the vagina to the arcus tendineus fascia pelvis (level II), and the fusion of the lower third of the vagina to the perineal membrane and perineal body (level III; Figure 1). Endopelvic fascia include these ligaments and a looser areolar tissue that provides resilience and distensibility.1

Figure 1. Levels of support.

Level 1: Suspension; the upper third of the vagina is suspended and supported by the cardinal–uterosacral ligaments and the connective tissue fibers of the upper paracolpium.

Level 2: Attachment; the middle third of the vagina is attached by the paracolpium (pubocervical fascia and recto vaginal fascia) laterally to the pelvic wall (arcus tendineus).

Level 3: Fusion: the lower third of the vagina fuses along the base of the urethra and the distal rectovaginal septum to the perineal body.

Source: DeLancey1

11

1

Chapter 1

1

Depending on the defect at one or more levels, different types of prolapse can occur (Figure 2). The anterior compartment prolapse is the most common prolapse.

It includes the descent of the bladder, the so-called cystocele.11 Prolapse of the apical compartment is referred to as descensus uteri or, after hysterectomy, vaginal vault prolapse. Posterior vaginal wall prolapse involves the rectum (rectocele), but can also include the small and the large intestine. Since 1996, the Pelvic Organ Quantification System (POP-Q) is used to quantify the anatomic degree of pelvic organ prolapse in the three different compartments separately.12 In the POP-Q system, prolapse can be divided in five different stages (stage 0 to stage IV). Stage 0 indicates normal anatomy with no prolapse and stage IV indicates complete eversion of the total length of the vagina (see addendum).

CYSTOCELE

DESCENSUS UTERI

RECTOCELE

Figure 2. Pelvic organ prolapse in different compartments.

Source: International urogynecology Association (IUGA)

Pathophysiology and risk factors The cause of POP is unknown, but the etiology of POP is considered to be multifactorial. Factors contributing to the weakening of the pelvic floor and the subsequent development of POP can be divided into genetic and acquired factors.5;13 As an example of genetics, race predisposes a certain population of women to POP. African women, for example, are less prone to develop POP than Caucasian women. Inciting factors include pregnancy and parity as well as myopathy and neuropathy. Obesity, smoking, pulmonary disease and obstipation are examples of POP-promoting factors. Patients with these risk factors tend to develop POP in a higher frequency, with ageing and menopause as superimposing decompensating factors. Rather than one single factor, it is probable that combinations of anatomical, physiological, genetic, lifestyle, and reproductive factors interact throughout a woman’s lifespan to contribute to mechanical failure of the pelvic floor causing pelvic floor dysfunction.5

12

Introduction

There is growing evidence that genetic factors are indeed important in the development of prolapse. A recent systematic review on hereditary factors in POP demonstrated a substantially increased risk for POP in case of a positive family history14, but the specific genetic defects have not been identified.15-17 Based on a significant increase in prevalence of POP in genetic diseases of the connective tissue such as Ehlers–Danlos, Marfan syndrome, and cutis laxa, as well as in knockout mice that lack extracellular matrix (ECM) molecules, a (genetic) connective tissue disorder is a likely etiological factor in POP.

Table 1. Risk factors involved in the development of pelvic organ prolapse.13

Predisposing

Inciting

Promoting

Decompensating

Genetics

Pregnancy

Obesity

Ageing

Race

Delivery

Smoking

Menopause

Gender

Myopathy

Pulmonary diseases

Neuropathy

Neuropathy

Obstipation

Myopathy

Pelvic surgery

Chronic lifting

General health

The anatomy on a tissue level The connective tissue underlying the vagina is composed of cellular elements, fibroblasts, and smooth muscle cells (SMCs), surrounded by an extracellular matrix (ECM). Although fibroblasts are the main cells responsible for the synthesis and secretion of fibrillar components, also smooth muscle cells can synthesize these molecules. Collagen and elastin are the fundamental components that control the biomechanical properties of the vaginal tissue. Collagen fibers are very rigid and do not easily distort while elastic fibers provide elasticity and resilience. The proper function of connective tissues depends on the appropriate type, rate of synthesis, assembly, cross-linking and remodeling of the collagenous matrix.

The ECM is in a permanent state of remodeling. Its homeostasis depends on the balance between enzymatic synthesis and degradation by matrix metalloproteinases (MMPs) and their inhibitors (TIMPs). Fibroblasts (FBs) are the cells responsible for maintaining extracellular matrix (ECM) homeostasis.18 They produce molecules, and control anabolic and catabolic processes to remodel their surrounding matrix in response to mechanical and biochemical stimuli that originate from the ECM. These stimuli are recognized by transmembrane receptors, such as integrins. In this way there is a complex interaction between cells and the surrounding extracellular

13

1

Chapter 1

1

matrix: the cell-matrix interaction. Changes on one level will affect the other, in order to adapt to changes in the environment.

During the course of a woman’s life, the vaginal wall is one of the soft tissues that is constantly remodeled in reaction to the different forces that are applied to it. Pregnancy and parturition are the most extreme challenges in this respect.

The weakening of the pelvic floor could thus be caused by an imbalance of its remodeling.16;17 This imbalance might be caused by different functional characteristics of vaginal fibroblasts with changes in the concentration of MMPs and TIMPs, or changes in the collagen and elastin metabolism. Also, the quantity and quality of smooth muscle cells may play a crucial role.

Degradation immature collagen

Synthesis immature collagen

Total collagen Glycated collagen

MMP-2 and 9 TIMP-1

Figure 3. Collagen metabolism changes according to the theory of Jackson.19 Women with POP have a reduced total collagen content with an increased concentration of glycated collagen with results in brittle tissue with an impaired mechanical strenght. Also a relatively high content of immature collagen cross-links compared to non-POP patients is seen. Together with an increase in metalloproteinase (MMP) activity and a decrease in tissue inhibitors of metalloproteinases (TIMP), this newly formed collagen is degraded more easily than older glycated tissue. This results in an ongoing process of increased synthesis and degradation of newly formed collagen, leaving behind the old, glycated collagen.

14

Introduction

One of the scarce studies on collagen metabolism in POP was published in 1996 by Jackson et al.19 He found that increased collagenolytic activity by MMPs causes loss of collagen. Consequently, the synthesis of collagen is increased with immature collagen cross-links. This newly formed collagen is degraded more easily than older glycated collagen, resulting in a decrease of collagen content, and a relative increase in glycated collagen, resulting in tissue with an impaired mechanical strength and therefore more susceptible to rupture (Figure 3). Due to the complex cell-matrix interaction and the fact that genital prolapse develops over time, until now the causes and effects of the changes seen in the connective tissue in the supportive tissues of the pelvic floor have not been untwined.

Treatment Treatment options for women with pelvic organ prolapse include observation, pelvic physiotherapy, the use of a pessary or surgery.

Non surgical treatment Some women with advanced stages of prolapse have relatively few symptoms.

If there is no sign of hydronephrosis due to chronic ureteral kinking or chronic bladder infections due to obstructive micturation, a watchful waiting policy can be an appropriate and reasonable treatment option.

Evidence for the efficacy of pelvic floor muscle training in the management of POP is so far minimal.20 Daily pelvic floor muscle training can however slow the progression of anterior vaginal wall prolapse.21 For those who do suffer from symptomatic POP, but do not opt for or are not able to have surgical treatment, pessary treatment can be considered. The use of a pessary is a patient friendly, minimal invasive and safe treatment. It is able to adequately relieve many symptoms of prolapse and may contribute to improvement of quality of life scores in women suffering from POP.22 Surgical treatment The surgical treatment of prolapse is generally focused on restoring the support of the vagina by connective tissue. Depending on the type of prolapse, a different operation or combination of different procedures is indicated. In most countries the conventional native tissue repair is used to treat a cystocele or rectocele, called: anterior or posterior colporrhaphy or fascia plication (Figure 4). During this procedure, the redundant tissue of the pubocervical fascia (anterior) or the rectovaginal septum (posterior) is plicated in the midline with absorbable sutures.

With this type of primary POP surgery the risk of a recurrence or re-operation is 29%, mostly within two years after surgery.23;24

15

1

Chapter 1

Figure 4. Anterior colporrhaphy.

Source: International Urogynecology Association (IUGA)

1

In an attempt to improve surgical outcomes, synthetic and biological implants have been introduced in reconstructive pelvic surgery.25 Primary permanent synthetic implants, as well as absorbable synthetic implants or biological products derived from human cadavers (allografts) or animals (xenografts) have been introduced on the market. However, evidence of efficacy of these products is lacking26 and complication rates are high.27-31 Absorbable synthetic and biological implants appear to be less harmful due to an easy incorporation into native tissue. Their long term efficacy as well as their possible adverse effects are unclear. There is some evidence that absorbable mesh materials over time do not generate sufficiently strong new tissue, decreasing the durability of reconstructive pelvic surgery with these types of implants.32;33 At this moment, permanent synthetic meshes made of polypropylene dominate the market. Despite attempts to increase the biocompatibility for these products34, complications such as erosions, pain, infections, and vaginal shrinkage still exist.30;31;34 Considering this, the US Food and Drug Administration have recently published a public health notification on the serious complications associated with synthetic mesh use for POP procedures (http://www.fda.gov/ medicaldevices/safety/ alertsandnotices/ publichealthnotifications/ucm061976.htm). In reaction to this FDA warning, the International UroGynecology Association (IUGA) has formulated a consensus document for optimizing the safety and appropriateness of mesh use

16

Introduction

in pelvic reconstructive surgery.35 This has been adopted by the Dutch society of pelvic floor with the publication of ‘Nota gebruik van kunststof materiaal bij prolaps chirurgie' version 2.0 (http://nvog-documenten.nl/index.php?pagina=/richtlijn/ pagina.php &fSelectNTG_110=111&fSelectedSub=110).

Regenerative medicine, tissue engineering and cell based therapy It goes without saying that new concepts are urgently needed. Tissue engineering is an emerging field in regenerative medicine that could provide attractive alternatives, alone or as an adjunct to surgical reconstructive surgery for pelvic organ prolapse.36-39 Regenerative medicine is an interdisciplinary field that aims at replacing or regenerating human cells, tissues or organs to restore or establish normal function.

The classical tissue engineering approach consists of the application of a scaffold, seeded with (stem)cells and growth factors. A variety of biomedical approaches, such as the use of stem or progenitor cells (cell based therapies), regeneration induction by biologically active molecules or transplantation of in vitro grown organs and tissues is used.36 The cells involved are preferably autologous to reduce the chances of any immunological reaction. This does, of course, increase the risk of reintroducing a possible genetic cause of the prolapse. The cells can be freshly isolated or cultured in vitro for injection purposes. Cell based injection therapy in urogynecology has focused on the regeneration of the urethral sphincter for the treatment of stress urinary incontinence (SUI).40,41 Animal studies demonstrated that cells (autologous muscle derived stem or progenitor cells) cultured in vitro survive the injection in the urethral sphincter. Also a repair process resembling the normal regenerative process in skeletal muscles is initiated. In clinical studies with using cell based injection therapy patients with SUI are cured in 20-50% of the cases. Only minor complications were observed.40;41 In the treatment for POP, a simple injection of cells to regenerate damaged vaginal tissue is not feasible without anchoring to a biodegradable scaffold that will provide temporary mechanical support to the weakened supportive tissue of the pelvic floor.

Tissue Engineering Approach in Pelvic Organ Prolapse The TEAPOP project (Tissue Engineering Approach in Pelvic Organ Prolapse) started in 2008 and aims at the systematic exploration of the feasibility of applying regenerative medicine concepts to pelvic organ prolapse. The ultimate goal of this project is to develop a new method to successfully repair the fascial tissues in a one-step surgical approach by using a combination of a highly biocompatible and biodegradable scaffold, providing sufficient tensile strength during the replacement of the scaffold, by patient’s own connective tissue, with regeneration-component

17

1

Chapter 1

1

(stem) cells or inductive growth factors. To achieve this goal we first need to obtain more insight into the underlying pathophysiology of pelvic organ prolapse. We therefore performed a multiparameter study (COLPOP study: collagen metabolism in patients with and without Pelvic Organ Prolapse) focusing on anterior vaginal wall tissue (Figure 5).

biomaterial interac6ons

Histology

Matrix composi6on Collagen quality POP/non-­‐POP biopsies

Stretch responses

Func6onal characteris6cs fibroblasts mRNA expression profiling

Contrac6lity

Figure 5. Multiparameter study on anterior vaginal wall tissue of women with a cystocele.

OUTLINE OF THE THESIS The aim of this thesis is to assess to what extent POP is an intrinsic or an acquired disease. We need to know whether the relationship between POP and the changes in the connective tissue is causal and if so, in what direction. In other words: does excessive tissue stretching at the prolapse site lead to aberrant extracellular matrix metabolism or is aberrant extracellular matrix metabolism the cause of prolapse.

This basic understanding is essential when one seeks to develop new therapeutic strategies in POP. Moreover, if (stem) cells are used to contribute to tissue regeneration by proliferation and differentiation into (myo) fibroblasts and by formation of the adequate connective tissue, we need to know which cells are appropriate for the preparation

18

Introduction

of a bio-engineered construct. Therefore, the second aim is to assess the functional characteristics of fibroblasts of women with prolapse. If POP is largely an acquired disease, knowledge of the functional characteristics of fibroblasts will provide information about the possibility to reverse or halt the process of deterioration of the cells and the extracellular matrix. This will help us to determine which kind of strategies can be used in reconstruction of the pelvic floor.

In this thesis the following specific objectives are addressed: •

To provide a systematic review of literature regarding changes in connective tissue in patients with pelvic organ prolapse. (Chapter 2)

•

To identify possible intrinsic and acquired effects in connective tissues of pelvic organ prolapse by comparing (immuno-) histological and biochemical features of the (normal) precervical anterior vaginal wall and the prolapsed anterior vaginal wall of women with pelvic organ prolapse. (Chapter 3)

•

To identify prolapse related dysregulated pathways involved in extracellular matrix metabolism by using micro-array technology. (Chapter 4)

•

To study the heterogeneity of women with prolapse at a molecular level.

(Chapter 4)

•

To investigate the functional characteristics of vaginal fibroblasts derived from women with pelvic organ prolapse compared to healthy vaginal fibroblasts in vitro. (Chapter 5 and chapter 6)

In chapter 2 we provide an overview of our current understanding of changes in pelvic floor connective tissue in women with POP. In chapter 3 we address the question whether the relationship between POP and collagen metabolism is causal, i.e. that excessive tissue stretching at the prolapse site leads to changes in tissue composition. Tissue samples taken from the POP-site and the non-POP site of the vagina in the same POP patient are compared. In addition, comparisons are made with similar samples from non-POP controls. These data will encompass the (immuno-)histological and biochemical characteristics of the specimens. The (immuno-)histochemical evaluation of the tissue will provide information about the structure and composition of the vaginal tissue(s) and the possible differences between prolapsed and not prolapsed sites within POP patients, or between patients and healthy controls. The biochemical analysis will shed light, among

19

1

Chapter 1

1

others, on the amount and quality of the extracellular matrix per se and its building blocks (collagens and non-collagenous proteins).

With whole genome micro-array analysis, we seek to identify prolapse related disregulated pathways by comparing gene expression profiles of prolapsed and non-prolapsed anterior vaginal wall tissue within the same patient (intra-patient comparison). As the population of women with prolapse is characterized by its heterogeneity we additionally study this heterogeneity at the molecular level by comparing the tissue gene expression profiles in the non-prolapsed anterior vaginal wall of these POP women. The findings are described in chapter 4.

Moreover, using primary cultures, we will determine whether fibroblasts derived from prolapsed and non-prolapsed tissues of patients differ in their functional characteristics in vitro. In chapter 5 the effects of cyclic mechanical loading on the gene expression and protein levels of ECM remodeling factors are evaluated in a pilot study of women with different degrees of prolapse. Also we evaluate whether the enzymatic activity of remodeling factors is affected by the presence of artificial polymeric substrates. In chapter 6 we repeat the experiments described in chapter 5 with fibroblasts from the COLPOP trial and expand the experiment with evaluations of the contractile capacity of fibroblasts. Also the phenotype of the cells and the proliferation rate of the cells are determined.

Finally, in chapter 7 the information gathered in this thesis is integrated into a general discussion on the changes seen in the extracellular matrix and the functionality of the cells in this matrix of prolapsed vaginal wall tissue.

20

Introduction

REFERENCE LIST 1.

2.

3.

4.

5.

6.

7.

8.

9.

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

Delancey JO. Anatomic aspects of vaginal eversion after hysterectomy.

Am.J.Obstet.Gynecol. 1992;166:1717-24.

Delancey JO. Anatomy and biomechanics of genital prolapse.

Clin.Obstet.Gynecol. 1993;36:897-909.

Norton PA. Pelvic floor disorders: the role of fascia and ligaments.

Clin.Obstet.Gynecol. 1993;36:926-38.

Jelovsek JE, Maher C, Barber MD. Pelvic organ prolapse. Lancet 2007;369:1027-38.

Delancey JO, Kane LL, Miller JM, Patel DA, Tumbarello JA. Graphic integration of causal factors of pelvic floor disorders: an integrated life span model. Am.J.Obstet.Gynecol. 2008;199:610-15.

Slieker-ten Hove MCP, Pool-Goudzwaard AL, Eijkemans MJC, Steegers-Theunissen RPM, Burger CW, Vierhout ME. Symptomatic pelvic organ prolapse and possible risk factors in a general population. Am.J.Obstet.Gynecol. 2009;200:184-87.

Kirby AC, Luber KM, Menefee SA. An update on the current and future demand for care of pelvic floor disorders in the United States. Am.J.Obstet.Gynecol. 2013;209:584-85.

Boyles SH, Weber AM, Meyn L. Procedures for pelvic organ prolapse in the United States, 1979-1997. Am.J.Obstet.Gynecol. 2003;188:108-15.

Jelovsek JE, Maher C, Barber MD. Pelvic organ prolapse. Lancet 2007;369:1027-38.

Haylen BT, De Ridder D, Freeman RM, Swift SE, Berghmans B, Lee J et al. An International Urogynecological Association (IUGA)/International Continence Society (ICS) joint report on the terminology for female pelvic floor dysfunction. Int.Urogynecol.J. 2010;21:5-26.

Hendrix SL, Clark A, Nygaard I, Aragaki A, Barnabei V, McTiernan A. Pelvic organ prolapse in the Women's Health Initiative: gravity and gravidity. Am.J.Obstet.Gynecol. 2002;186:1160-66.

Bump RC, Mattiasson A, Bo K, Brubaker LP, Delancey JO, Klarskov P et al. The standardization of terminology of female pelvic organ prolapse and pelvic floor dysfunction.

Am.J.Obstet.Gynecol. 1996;175:10-17:10-17.

Bump RC, Norton PA. Epidemiology and natural history of pelvic floor dysfunction.

Obstet.Gynecol.Clin.North Am. 1998;25:723-46.

Lince SL, van Kempen LC, Vierhout ME, Kluivers KB. A systematic review of clinical studies on hereditary factors in pelvic organ prolapse. Int.Urogynecol.J. 2012;23:1327-36.

Cartwright R, Mangera A, Tikkinen KAO, Chapple C. What was hot at the ICS meeting Glasgow, Scotland, 2011. Neurourol.Urodyn. 2012;31:2-6.

Mosier E, Lin VK, Zimmern P. Extracellular matrix expression of human prolapsed vaginal wall.

Neurourol.Urodyn. 2010;29:582-86.

Bortolini MAT, Rizk DEE. Genetics of pelvic organ prolapse: crossing the bridge between bench and bedside in urogynecologic research. Int.Urogynecol.J. 2011;22:1211-19.

Meyer S, Achtari C, Hohlfeld P, Juillerat-Jeanneret L. The contractile properties of vaginal myofibroblasts: is the myofibroblasts contraction force test a valuable indication of future prolapse development? Int.Urogynecol.J.Pelvic.Floor.Dysfunct. 2008;19:1399-403.

Jackson SR, Avery NC, Tarlton JF, Eckford SD, Abrams P, Bailey AJ. Changes in metabolism of collagen in genitourinary prolapse. Lancet 1996;347:1658-61.

Rosenbaum TY. Pelvic floor physiotherapy for women with urogenital dysfunction: indications and methods. Minerva Urol.Nefrol. 2011;63:101-07.

Piya-Anant M, Therasakvichya S, Leelaphatanadit C, Techatrisak K. Integrated health research program for the Thai elderly: prevalence of genital prolapse and effectiveness of pelvic floor exercise to prevent worsening of genital prolapse in elderly women.

J.Med.Assoc.Thai. 2003;86:509-15.

Lamers BHC, Broekman BMW, Milani AL. Pessary treatment for pelvic organ prolapse and health-

21

1

Chapter 1

1

23.

24.

25.

26.

27.

28.

29.

30.

31.

32.

33.

34.

35.

36.

37.

38.

39.

40.

41.

related quality of life: a review. Int.Urogynecol.J. 2011;22:637-44.

Olsen AL, Smith VJ, Bergstrom JO, Colling JC, Clark AL. Epidemiology of surgically managed pelvic organ prolapse and urinary incontinence. Obstet.Gynecol. 1997;89:501-06.

Denman MA, Gregory WT, Boyles SH, Smith V, Edwards SR, Clark AL. Reoperation 10 years after surgically managed pelvic organ prolapse and urinary incontinence.

Am.J.Obstet.Gynecol. 2008;198:555.

Silva WA, Karram MM. Scientific basis for use of grafts during vaginal reconstructive procedures.

Curr.Opin.Obstet.Gynecol. 2005;17:519-29.

Maher CM, Feiner B, Baessler K, Glazener CMA. Surgical management of pelvic organ prolapse in women: the updated summary version Cochrane review. Int.Urogynecol.J. 2011;22:1445-57.

Milani ALF, Vollebregt A, Roovers JP, Withagen MIJ. [The use of mesh in vaginal prolapse].

Ned.Tijdschr.Geneeskd. 2013;157:A6324.

Vollebregt A, Fischer K, Gietelink D, van der Vaart CH. Effects of vaginal prolapse surgery on sexuality in women and men; results from a RCT on repair with and without mesh.

J.Sex Med. 2012;9:1200-11.

Withagen MI, Vierhout ME, Hendriks JC, Kluivers KB, Milani AL. Risk factors for exposure, pain, and dyspareunia after tension-free vaginal mesh procedure. Obstet.Gynecol. 2011;118:629-36.

Sung VW, Rogers RG, Schaffer JI, Balk EM, Uhlig K, Lau J et al. Graft use in transvaginal pelvic organ prolapse repair: a systematic review. Obstet.Gynecol. 2008;112:1131-42.

Abed H, Rahn DD, Lowenstein L, Balk EM, Clemons JL, Rogers RG. Incidence and management of graft erosion, wound granulation, and dyspareunia following vaginal prolapse repair with graft materials: a systematic review. Int.Urogynecol.J. 2011;22:789-98.

Claerhout F, Verbist G, Verbeken E, Konstantinovic M, De Ridder D, Deprest J. Fate of collagenbased implants used in pelvic floor surgery: a 2-year follow-up study in a rabbit model.

Am.J.Obstet.Gynecol. 2008;198:94-96.

Menefee SA, Dyer KY, Lukacz ES, Simsiman AJ, Luber KM, Nguyen JN. Colporrhaphy compared with mesh or graft-reinforced vaginal paravaginal repair for anterior vaginal wall prolapse: a randomized controlled trial. Obstet.Gynecol. 2011;118:1337-44.

Patel H, Ostergard DR, Sternschuss G. Polypropylene mesh and the host response.

Int.Urogynecol.J. 2012;23:669-79.

Davila GW, Baessler K, Cosson M, Cardozo L. Selection of patients in whom vaginal graft use may be appropriate. Consensus of the 2nd IUGA Grafts Roundtable: optimizing safety and appropriateness of graft use in transvaginal pelvic reconstructive surgery.

Int.Urogynecol.J. 2012;23 Suppl 1:S7-14.

Boennelycke M, Gras S, Lose G. Tissue engineering as a potential alternative or adjunct to surgical reconstruction in treating pelvic organ prolapse. Int.Urogynecol.J. 2013;24:741-47.

Olson JL, Atala A, Yoo JJ. Tissue engineering: current strategies and future directions.

Chonnam.Med.J. 2011;47:1-13.

Demirbag B, Huri PY, Kose GT, Buyuksungur A, Hasirci V. Advanced cell therapies with and without scaffolds. Biotechnol.J. 2011;6:1437-53.

Aboushwareb T, McKenzie P, Wezel F, Southgate J, Badlani G. Is tissue engineering and biomaterials the future for lower urinary tract dysfunction (LUTD)/pelvic organ prolapse (POP)?

Neurourol.Urodyn. 2011;30:775-82.

Wang HJ, Chuang YC, Chancellor MB. Development of cellular therapy for the treatment of stress urinary incontinence. Int.Urogynecol.J. 2011;22:1075-83.

Gras S, Lose G. The clinical relevance of cell-based therapy for the treatment of stress urinary incontinence. Acta Obstet.Gynecol.Scand. 2011;90:815-24.

22

Introduction

1

23

2 Changes in connective tissue in patients with pelvic organ prolapse - a review of the current literature -

M.H. Kerkhof L. Hendriks H.A.M. Brรถlmann Int Urogynecol Journal 2009;20(4):461-74 25

Chapter 2

ABSTRACT

2

Objective: Little is known about the pathophysiology of Pelvic Organ Prolapse (POP). In 1996 Jackson presented a hypothesis on pelvic floor connective tissue that tried to explain the development of POP on a molecular level. The objective of this review is to test the hypothesis against recent literature.

Study design: Review of literature.

Results: The association between POP and connective tissue metabolism is well established. However the causality of this association is unclear. The characteristics of the pelvic floor connective tissue of POP patients relate to tissue repair. To resolve the question of cause and effect, the role of fibroblasts in producing the extracellular matrix should be clarified. With these data the use of autologous or allogenic stem cells in the treatment of POP may come in sight.

Conclusion: Recent literature supports the hypothesis of Jackson but does not resolve longstanding questions on the etiology of POP.

BRIEF SUMMARY Recent literature data support the 1996 hypothesis of Jackson – POP patients have more brittle collagen in the pelvic floor connective tissue that is difficult to degrade – but do not resolve longstandig questions on the etiology of pelvic organ prolapse.

26

Connective tissue in POP

INTRODUCTION Pelvic organ prolapse (POP) is a global health problem, affecting adult women of all ages. It decreases their quality of life considerably.1-3 POP is one of the most common reasons for gynecological surgery in women after the fertile period. The failure rate is relatively high: an estimated 30% of women require re-operation.3 Despite the high incidence of POP, little is known about the underlying pathophysiology of POP. Multiparity, old age, overweight, chronic straining and obstructive lung diseases are the most important risk factors.4;5 However, also nulliparous women without any risk factors may develop POP. Therefore, a genetic predisposition may play a role as well.6-8 When a mother has POP, the relative risk for the daughter of developing POP is 3,2. With a sister’s positive medical history this relative risk is 2,4.9 In combination with the finding that women with joint hypermobility have a significant higher prevalence of POP10, it is hypothesized that a connective tissue factor is involved.

In 1996 Jackson found that patients with a descent of the cervix to, or beyond the introitus, with associated cystocele, have a reduced collagen content, with a relatively high content of immature collagen cross-links compared to non-POP patients. This newly formed collagen is degraded more easily than older glycated material, resulting in a decrease of collagen content, leaving behind glycated collagen resulting in tissue with an impaired mechanical strength.11 He also found an increase in metalloproteinase activity suggesting an increased degradation of collagen in patients with POP. He concludes that the bulk of this deficient glycated old collagen, which is brittle and susceptible to rupture, is an important etiologic factor in POP. Up till now the connective tissue metabolism is assessed by biochemical evaluation. The role of fibroblasts that produce the molecules in the extracellular matrix, such as collagen and elastin, needs further elucidation. It has been suggested to treat POP with autologous stemcells.12 These stem cells are stimulated to differentiate into fibroblast-like cells producing collagen and can be seeded on biocompatible material serving as a ‘bioactive scaffold’. Before doing so it is important to know, if there is a defective collagen metabolism at all, caused by an error in the fibroblast, and if so, if this is the result of a genetic or an acquired defect.

The objective of this review is to summarize our current understanding of changes in pelvic floor connective tisssue in women with POP compared to women without POP. Studies concerning collagen metabolism in POP patients will be reviewed in the light of Jackson’s hypothesis.13 Based on subsequent literature we will test this

27

2

Chapter 2

hypothesis against the latest facts. We will also make recommendations for future research. Ultimately this knowledge may lead to preventive measures that could eliminate or delay the onset of prolaps, and improve surgical treatment.

2

MATERIALS AND METHODS The primary investigator and a clinical librarian searched the computerized databases MEDLINE and EMBASE up to 2008, using terms such as 'prolapse', 'uterine prolapse', 'cystocele', 'rectocele', 'pelvic organ support', 'urinary incontinence', 'connective tissue', 'collagen', 'hydroxyproline', 'tropocollagen', 'procollagen', 'protocollagen', 'extracellular matrix', 'elastic tissue', 'supportive tissue', 'extracellular matrix proteins', 'tissue inhibitor of metalloproteinases', 'matrix metalloproteinases' and 'collagenases'. Not only free text terms but also Mesh terms were used. Only data published in full article form were included.

Additionally, articles were obtained by reviewing reference lists of pertinent studies and reviews. Also the Web of Science was searched for ‘citing papers’ and ‘related articles’. No articles written in languages other than English provided additional information.

RESULTS I. ANATOMY AND FUNCTION OF THE VAGINA AND SUPPORTIVE CONNECTIVE TISSUE The pelvic floor is the caudal confinement of the abdominal cavity, which contains the abdominal viscera. In the days when we were quadrupeds, the pelvic floor was supposed to wag the tail. Now, in erect humans, its function is to prevent the viscera from ‘falling out’ and to enable sexual intercourse, birth and the deliberate passage of stools and urine. In case of a sudden increase of the abdominal pressure, e.g. during coughing., all the muscles confining the abdominal cavity will contract. They create a counterforce that maintains the bodily shape. The pelvic floor is lifted at contraction and the genital hiatus is closed, preventing the uterus and vagina, but also the intestines from being pushed out. If the pelvic floor has weakened, e.g. during vaginal delivery, the hiatus may not fully close anymore at contraction of the levator muscle. The counterforce will not come into effect and POP may occur.

A second line of defense is the vaginal support from the connective tissue attachments between the vagina and the pelvic sidewall, and levator ani muscles.

28

Connective tissue in POP

The supportive connective tissue is a continuous, interdependent sheet whichs supports the vagina and the pelvic organs. Based on post mortem data, Delancey et al14 described pelvic floor support at three levels. Level I includes the uterosacral ligaments (USL). The middle part of the vagina (endopelvic fascia) is attached laterally to the arcus tendineus fasciae pelvis (ATFP) and the superior fascia of the levator ani muscles (level II). In the lower third of the vagina the wall is directly attached to the surrounding structures, the perineal membrane and the perineal body (level III). This suspensory system prevents the uterus and vagina from falling out while the hiatus is opened. If the resilience of the connective tissue decreases with age, the ligaments may finally give way and POP may develop.15 Pelvic floor connective tissue The vaginal wall is composed of four layers: a superficial layer of stratified squamous epithelium, a subepithelial dense connective tissue layer, composed primarily of collagen and elastin, a layer of smooth muscle referred to as the muscularis and an adventitia, which is composed of loose connective tissue. The vaginal subepithelium and muscularis together form a fibromuscular layer beneath the vaginal epithelium, providing longitudinal and central support.

The connective tissue underlying the vagina contains relatively few cells: beside fat cells and mast cells, mainly fibroblasts are found, producing components of the extracellular matrix (ECM). The ECM contains fibrillar components (collagen and elastin) embedded in a non-fibrillar ground substance. This ground substance consists of non-collagenous glycoproteins, proteoglycans and hyaluronan. In addition, with the exception of the ATFP, these tissues contain a significant amount of smooth muscle cells.16 The fibrillar component is thought to contribute the most to the biomechanical behaviour of these tissues. The quantity and quality of collagen and elastin are regulated through a precise equilibrium between synthesis, maturation and degradation. This process results in a dynamic process of constant remodeling.

Collagen synthesis In 1954, Ramachandran and Kartha17 discovered the triple helical structure of collagen.

In the endoplasmatic reticulum, Îą chains are formed, followed by posttranslational modifications of proline and lysine residues. Each collagen molecule is made of a precise combination of three Îą-polypeptide chains. Depending on the collagen type the three Îą-polypeptide chains vary. The three helices are twisted together into a triple helix, stabilized by numerous hydrogen bonds. There is some covalent crosslinking within the triple helices, and a variable amount of covalent crosslinking

29

2

Chapter 2

2

between collagen helices, resulting in tissue-residing collagen of different maturity.

Once the triple helix called procollagen is formed intracellularly, it is secreted into the extracellular space. Tropocollagen molecules are formed by the action of carboxy-terminal and amino-terminal peptidases. The tropocollagen molecules undergo self-assembly into collagen fibrils, which in turn associate to form fibers and fiber bundles (Figure 1). The shape and behavior of a tissue are determined in part by the correct positioning of collagen fibrils within a fiber and fibers within a matrix.

Figure 1. Collagen biosynthesis.

Collagen is synthesized as pre-pro-α-chains (1). Following translocation into the rough endoplasmic reticulum, the signal peptides are removed and the individual procollagen α-chains will associate through the C-propeptides.

Figure 1. Collagen biosynthesis. Collagen is synthesized as pre-pro-α-chains (1). Followi After multiple steps of post-translational modifications, which include the translocation into the rough endoplasmic reticulum, the signal peptides are removed and t hydroxylation of specific lysine (Lys) and proline (Pro) residues as well as the individual procollagen α-chains willtriple associate through the After multiple s glycosylation of hydroxylysyl residues (2), the helix propagates fromC-propeptides. the post-translational modifications, include the hydroxylation of specific lysine (Ly C to of N-terminus.

The procollagen is excreted which and is converted extracellularly residuesthe as well as the glycosylation of hydroxylysyl residues (2), the triple into proline collagen(Pro) by cleaving propeptides (3). Subsequently, collagen propagates from C to N-terminus. is excreted and is converted extrac molecules assembly intothe ordered fibrils (4), whichThe are procollagen finally stabilized by the formation interand/or intramolecular cross-links (5). larly of into collagen by cleaving the propeptides (3). Subsequently, collagen molecules asse

into ordered fibrils (4), which are finally stabilized by the formation of inter- and/or intram lecular cross-links (5).

30

Connective tissue in POP

There are 28 types of collagen. The fibrillar collagens I, III and V, present in the vagina and its supportive tissues, are thought to be the principal determinants of soft tissue strength. Collagen I fibers are universally present and are flexible and offer great resistence to tension. Collagen III is predominant in tissues that require increased flexibility and distension and that are subject to periodic stress.18 It is the primary collagen subtype in vagina and supportive tissues. Collagen III is the major collagen in skin at birth before it is replaced by collagen I later in life. Both type I and type III are found in granulation tissue during woundrepair.19;20 Collagen V is of minor quantative importance. It forms small fibers with very low tensile strength and has been found to be also important in wound healing and fibrillogenesis.21 The role of collagen V in the vagina and supportive tissue has not been elucidated yet.

Collagen I copolymerizes with collagen III and V to form fibrils with controlled diameters. These fibrils influence the biomechanical characteristics of a given tissue.21 An increase in collagen III and V decreases the mechanical strength of connective tissue by decreasing fiber size.22 It is generally agreed that a higher I:III ratio in the ligament is indicative of greater strength, whereas a lower ratio may result in tissue laxity.

Maturation and physiological ageing of collagen Age is a risk factor for POP. In the POSST study there was a 10% increased risk of POP for each decade of life.23 Olsen et al.3 found that the cumulative incidence of primary operation for POP and incontinence increased from 0.1% in the age group 20 – 29, up to 11.1% in the age group 70 – 79.

Reay Jones et al.15 assessed the Uterosacral ligament Resilience (UsR) by tensiometry in patients with and without POP, to determine whether it influenced uterine or pelvic floor mobility, or whether it varied with age, vaginal delivery, menopause or histological variations in the ligament. He found that the UsR was significantly reduced (p < 0.02) in symptomatic POP. There was a significant decrease in UsR with menopause (p < 0.009) and older age (p < 0.005), suggesting that where pelvic floor muscles are weakened, a decrease in pelvic connective tissue resilience – related to the age and menopause – may facilitate progression to symptomatic POP. Two mechanisms of maturation of collagen have been identified. The first involves the enzymatically controlled lysine aldehyde cross-links. The initial enzymatic controlled divalent cross-links dehydro-hydroxy lysinonorleucine and

31

2

Chapter 2

Figure 2. Collagen maturation.

As the tissue matures, immature collagen fibers with divalent cross-links (1) are enzymatically converted to mature collagen fibers with stable trivalent cross-links (2).

The mature, slowly metabolising collagen is susceptible to non-enzymatic cross-linking, also known as glycation or Maillard reaction with the formation of advanced glycation endproducts (3).

2

hydroxylysinoketo-norleucine are converted to stable trivalent cross-links: histidinohydroxylysinonorleucine and hydroxylysyl-pyridinoline, as the tissue matures. The relative proportion of the initial divalent cross-links to mature cross-links enables an assessment of the maturation of the tissue. The mechanism of creating strength of the collagen by interfibrillar cross-links is currently under investigation.

Secondly, the mature, slowly metabolising collagen is susceptible to the so called non-enzymatic cross-linking, also known as glycation or Maillard reaction. It involves the fairly random addition of glucose to the collagen as the turnover of collagen is generally rather low. The products of this glycation ultimately react further to form intermolecular cross-links. It has been well established that these advanced glycated endproducts (AGEâ&#x20AC;&#x2122;s) of collagen accumulate with age (Figure 2).

This mechanism is the major cause of substantial dysfunction of the collagenous tissues and is responsible for the complications of connective tissues seen at older age. The "overmature" collagen is stiffer and therefore more fragile than the collagen that exhibit only enzymatic cross-links.24;25 The glycation of other proteins involves the same mechanisms. But the long biological half-life of collagen ensures that it plays an important role in ageing. The nature and relative importance of the cross-links formed in vivo, in comparison to those reported formed in vitro

32

Connective tissue in POP

with model compounds, still needs to be established as the structure of only a few AGE's has been established.

With the knowledge of changes of collagen with age, more research of POP, especially in young women, will elucidate the underlying pathophysiology of the disease.

Degradation of collagen The balance between synthesis and degradation of collagen is important for maintaining tissue integrity and tensile strength during continuous tissue remodeling. Degradation depends upon the combined activity of matrix metalloproteinases (MMP) and their regulation of release, activation or sequestration of growth factors, growth factor binding proteins, cell surface receptors and cellcell adhesion molecules.26 MMP’s are being synthesized intracellularly and secreted as pro-enzymes into the extracellular space, which requires conversion to the active form for enzymatic activity. Twenty three different members of the MMP family have been identified in humans. They all can degrade one or more extracellular matrix components, however with different specificities. The interstitial and neutrophil collagenases (MMP-1, 8, 13) are capable of cleaving fibrillar collagen, while the gelatinases (MMP-2 and 9) degrade the resulting denatured peptides.

Acid cathepsins depolymerise collagen fibers by cleaving near cross-link sites. The combined action of these enzymes is capable of degrading all components of the extracellular matrix.

To limit connective tissue degradation, the activity of MMP’s is regulated by modulation of pro-enzyme production.27 Overdegradation is also regulated by endogenous inhibitors: serum-borne inhibitors and the tissue-derived inhibitors of metalloproteinases (TIMP’s). They bind stoechiometrically to MMP’s to inhibit their activity. TIMP-1 as well as TIMP-3 bind to MMP-1 and MMP-9; TIMP-2 binds to MMP-2.28;29 Recently in vitro have shown that active MMP’s can also be inactivated spontaneously by degradation into smaller fragments. This process is referred to as autocatalysis.30;31 Elastin The mechanical properties of tissues are also dependent on the proportion of elastin, an insoluble polymer that is formed by the assembly of tropo-elastin monomers followed by catalysis of cross-link formation by lysyl oxidases (LOX).

Elastin allows the tissue to stretch and return to its original shape without energy input.32 This property of resilience is presumed important for reproductive tissues.

33

2

Chapter 2

2

It accommodates the enormous expansion in pregnancy and involution after parturition. Production of elastin is unique among connective tissue proteins.

In most organs elastin biosynthesis is limited to a brief period of development.

The assembly of elastic fibers is complete by maturity when tropo-elastin synthesis ceases. In undisturbed tissues, elastic fibers produced in the third trimester of fetal life last the rest of life.33 In the female reproductive tract, however, elastic fiber turnover appears to be continuous. Recently it is found that LOX is essential for elastic fiber homeostasis in many tissues, including the female pelvic organs. Mice lacking LOXL1 are unable to synthesize elastin polymers in adult tissue whereas collagen synthesis appears to proceed normally. These mice also fail to replenish mature elastin fibers in the reproductive tract after parturition. They develop spontaneous prolapse.33;34 Fibulin-5, which is an elastic binding protein crucial for elastic fiber assembly35, is believed to act as a bridge between cells and tropo-elastin for effective cross-linking and assembly of tropo-elastin into mature elastic fibers.

Increased synthesis of tropo-elastin and fibulin-5 may be necessary to counteract for disruption of elastic fibers and to regenerate elastic fibers in the vaginal wall.

In fibulin-5 knock-out mice, POP was similar to that in primates, suggesting that synthesis and assembly of elastic fibes are crucial for recovery of pelvic organ support after damage. Disordered elastic fiber homeostasis seems to be a primary event in the pathogenesis of POP in mice.36

II. PELVIC FLOOR CONNECTIVE TISSUE IN POP Collagen synthesis and subtypes in POP Studies on changes in the quantity and ratios of subtypes of collagen produced inconclusive data. Both increase and reduction of total collagen content of vaginal and pelvic floor supportive tissues in patients with POP have been reported (Table 1). Different methods of quantification of collagen content, and also the lack of information on tissue histology and biopsy site of the vagina or supportive tissue that was analyzed, make direct comparison between studies difficult. Table 1 shows that tissue obtained from uterine ligaments of patients with POP seems to show a decreased total collagen content11;37-39 with a higher concentration of collagen III 40-43 irrespective of age or parity. An increased collagen III content may suggest tissue repair after overstretching of the supportive connective tissue of the pelvic floor. Moalli et al.43 also found a significantly increased expression of active MMP-9 in women with POP relative to controls. An increase in collagen III in combination with an increase in active MMP-9 is typical of tissue that is remodeling after injury or a tissue that is remodeling to accommodate a progressively increasing mechanical

34

Connective tissue in POP

load.44 A higher expression of tenascin, an extracellular matrix glycoprotein that reappears around healing wounds40 supports this theory.

Cross-linking of collagen in POP There is more to collagen than just the total amount and the subtypes. Barbiero et al.45 performed a qualitative analysis of type I collagen in the parametrium of patients with and without POP. It was demonstrated that the parametrium consists of shorter, thinner and more disorderly arranged collagen fibers in patients with uterine prolapse compared to healthy controls.

The maturity of the tissue depends on the relative proportion of the divalent crosslinks to the mature (trivalent) cross-links. Furthermore, mature, slowly metabolising collagen is susceptible to non-enzymatic glycation and some of these AGEâ&#x20AC;&#x2122;s, such as pentosidine, are additional cross-linking compounds that may further inhibit the turnover of collagen.

Jackson13 showed that POP was associated with a significant rise in the immature cross-link. The mature pyridinoline cross-linking was not altered. Pentosidine was increased significantly in the prolapse tissue, and pentosidine concentrations increased with increasing age in both groups, demonstrating that non-enzymatic glycation of collagen occurs slowly over a long time. This greater pentosidine concentration in prolapse tissue makes the tissue less soluble than in controls, reflecting the maturity of the tissue.46 Only two studies describe the cross-linking of collagen fibers in POP.11;47 However, both studies only analyzed a specific subset of cross-links, limiting their conclusions to these subsets. SĂśderberg et al.11 found a decrease in extractability by pepsin digestion at young age in both women with and without POP compared to older women. This is an indicator of cross-links in the collagen molecule. It is considered a physiological effect of normal ageing. Chen et al.47 analysed pyridinoline, the major mature collagen cross-link in fascia, in anterior vaginal wall. There was no difference between the incontinent women with POP and the continent women without POP. This is in accordance with the findings of Jackson.13 Collagen degradation; matrix metalloproteinase and tissue inhibitor of matrix metalloproteinase The majority of studies on MMPâ&#x20AC;&#x2122;s focus on synthesis (proMMP or MMP mRNA).

Although the active form is the most relevant form with respect to tissue degradation, the analysis of the entire expression profile of these enzymes including pro-enzyme,

35

2

Chapter 2

active and autocatalytic forms, should provide a more conclusive insight.48;49

2

Jackson13 suggested an increased metabolic turnover of collagen since MMP-2 and 9 were significantly higher in prolapse tissue than in normal tissue. He did not assess the expression of other MMPâ&#x20AC;&#x2122;s or the TIMPâ&#x20AC;&#x2122;s.41;50As shown in table 2 an increase in proMMP-2 and active MMP-2 was confirmed by two other studies.

Summarizing the data of table 2 concerning the activity of MMP point to a condition in which the degradation of connective tissue is accelerated in the vagina and the supportive tissue of patients with POP by an increased expression of pro- and/or active metalloproteinases in combination with a decrease in TIMP-1 mRNA and active TIMP-1 expression.47 Elastin metabolism in POP The importance of elastic fibers in maintaining vaginal support is demonstrated by genetic connective tissue diseases like Marfanâ&#x20AC;&#x2122;syndrome (mutations in fibrillin-gene) and cutis laxa (mutation in elastin and fibulin-5 genes). An increased incidence of POP is seen in women affected by these connective tissue diseases.51;52 Some changes in elastin expression in relation to POP are reported (Table 3).

But the ways by which elastin is measured also vary: via mRNA level, precursor protein levels or mature elastin levels. Elastin mRNA is a few steps away from the actual elastin. Also the protein precursor of elastin, tropo-elastin can be measured without actually measuring the amount of mature elastin.48;53 A common way to quantify mature elastin used by Jackson, is by indirectly measuring its cross-links with desmosine.54 This measurement could be inaccurate, however, when studying a disease such as POP in which the cross-linking process may be disrupted and desmosine concentration is more reflective of diminished cross-linking than the total amount of elastin.48 The most direct and thus appropriate way to measure elastin is by immunohistochemistry.53 Even though the techniques used to obtain the data vary, and thus provide inconclusive data, there is circumstantial evidence that a deficient synthesis and degradation of elastic fibers may be associated with POP.40;53;55-57 The fibroblast in POP If the collagen content in POP is changed, this may be caused by differences in the number of fibroblasts (cellularity) in the connective tissue.58;59 But also the quality, i.e. functionality of the fibroblast may be important in the pathogenesis of POP. There is some indication that the contractibility of the vaginal (myo)fibroblasts is

36

Connective tissue in POP

decreased in POP patients which may result in deficient collagen.60 In models of wound healing, skin myofibroblasts control the contractile and strength of the tissue, which is regulated by the so called endothelin-1 (ET-1) system. Poncet et al.60 compared cultures of Îą- smooth muscle actin-positive myofibroblasts that were established from POP patients to myofibroblasts from primiparous women with respect to their expression of the ET-1 system and contractile properties.

They found that spontaneous contraction of myofibroblasts from estrogen-treated women with POP was significantly lower than from young primiparous women.

Addition of exogenous endothelin-1 decreased the spontaneous contraction of myofibroblasts, which is opposite to observations in skin myofibroblasts.

Makinen et al.61 studied the rates of collagen synthesis and procollagen mRNA levels in cultured fascia fibroblasts of patients with POP. They found that these fibroblasts exhibited rates of collagen synthesis similar to or slightly higher than those from age-matched controls. This finding suggests that POP is not related to defects in the capacity of vaginal fibroblasts to synthesize or process procollagen.

The existence of a possible qualitative change in type I and or type III collagen could not be ruled out in this study. There are no indications of mutations in the various polypeptides in collagen type I and III. Mutations could produce minor changes in collagen fibers that would make connective tissue less able to withstand the stresses of an individual lifespan and could explain predisposition to common diseases affecting connective tissue.

With respect to the production of elastin, the elastin gene expression and protein synthesis in fibroblasts derived from cardinal ligaments of patients with POP is markedly lower than in non-POP patients.57 This may be a result of a decreased expression of the wild type p53 mRNA and wild type p53 protein in fibroblasts of women with POP. Cells fail to enter quiescence (G0 phase) that may lead to a decrease in synthesis and deposition of elastin.

The synthesis of components of the ECM by fibroblasts are influenced by stretch. Whether it is cause or effect, prolapsed tissue is stretched tissue. Ewies demonstrated recently that mechanical stretch disturbs the fibroblasts ability to maintain the cytoskeleton architecture. The use of estrogens did not reverse the process or protect the cells from the effect of stretch, but significantly increased the rate of fibroblast proliferation, suggesting their role in the healing process.62 These results suggests, in contrast to the findings of collagen production, that functional changes in the fibroblasts of the cardinal ligaments are involved in the

37

2

Chapter 2

mechanism of prolapse development.57;63;64 In relation to POP in which tissue is stretched, it is demonstrated that mechanical stretch disturbs the fibroblastsâ&#x20AC;&#x2122; ability to maintain their cytoskeleton architecture and we speculate that they may disrupt ligamentous integrity and result in clinical prolapse.

2

The role of estrogen in collagen metabolism in POP As estrogen deficiency is a known risk factor for POP65, estrogen replacement therapy traditionally has been used to improve structural integrity of the pelvic tissue with favorable effects on urinary incontinence.66-69 Previously, estrogen receptors (ER) were identified in the nuclei of connective tissue and of the smooth muscle cells of the bladder trigone, urethra, vaginal mucosa, levator ani stromal, and uterosacral ligament. Two different subtypes have been found in human cells: ER-ι is the dominant receptor in the adult uterus whereas ER-β is expressed at high levels in other estrogen-target tissues such as prostate, testis, ovary, smooth muscle, vascular endothelium and immune system. These receptors participate in maintaining the supportive system of the pelvic by a.o. increasing synthesis or by decreasing breakdown of collagen and other extracellular matrix proteins.70 Few studies have been done to assess the tissue expression levels of sex steroid hormone receptors in patients with POP. Lower estrogen receptor expression in patients with POP have been found in combination with lower serum concentrations of estrogen.4;71 In contrast, higher sex steroid hormone receptor expression in POP patients has also been described.72 Several studies report an increase in the mRNA expression for collagen I and III in estrogen replacement therapy.30;73;74 These findings suggest that estrogen increases the turn-over of connective tissues of the pelvic floor. It is also suggested that estrogen restores the collagen metabolism to a premenopausal state.43 In a double blind, placebo controlled trial with postmenopausal women with urinary stress incontinence treated with estradiol therapy, Jackson13 found strong evidence for both new synthesis and degradation. The immature cross-links were increased, indicating newly synthesized collagen. However, the ratio of type I:III collagen was unchanged in the estradiol treated group and the total collagen content was significantly decreased. Also an elevation of both the pro-active and active forms of MMP-2 and MMP-9 in women treated with estradiol compared to controls was found. This resulted in a decrease in total collagen content.75 Also a combination of upregulation of MMPs and supression of TIMP by estrogen resulted in an increase of ECM breakdown.76 Inhibition of MMP by estrogen therapy is also reported.77;78 Zong et al.49;77, found

38

Connective tissue in POP

that only E2 combined with progesterone decreased the active form of MMP-1, which suggests that both hormones are necessary to maintain the integrity of the female pelvic floor.

With respect to elastin, Moalli et al.42 found no differences between premenopausal, postmenopausal and postmenopausal women on hormone therapy.

Estrogens and fibroblasts 17β-estradiol may have a suppressive effect on proliferation of fibroblasts, derived from cardinal ligaments in patients with POP. Therefore 17β-estradiol may have a role in inducing POP by negatively affecting the concentration of fibroblasts in pelvic organ connective tissue.79 Estrogen therapy, thus, induces turnover of collagen, but the precise role of estrogen in collagen metabolism related to POP is still unclear. Data suggest an increased mRNA expression of collagen type I and III as a reaction to hormone replacement therapy, with a concomitant increased synthesis of these collagen types. However, an increased activity of MMP, resulting in an increase in collagen degradation is also reported. Whether sex steroid receptors are a primary cause or a downstream effect of POP remains unknown.

DISCUSSION The development of POP is multifactorial. Factors contributing to the development of POP can be divided into genetic and acquired factors.1 Genetics and race predispose a certain population of women to POP. Inciting factors include pregnancy and parity as well as myopathy and neuropathy. Obesity, smoking, pulmonary disease and obstipation are examples of POP-promoting factors.

Patients with these risk factors tend to develop POP in a higher frequency with ageing and menopause as superimposing decompensation factors.

Several studies have underlined the role of a strength deficit of urogenital tissues, which is attributed to changes in synthesis and degradation of different types of collagen and elastin in POP development.80 Also, the function of supporting and contractile cells, the fibroblasts may be disturbed.60 However, data on the changes in collagen metabolism in patients with POP are conflicting. The differences may partly be due to the analysis of different target tissue in patients with POP. The tissue which supports the vagina and the pelvic organs can be divided into the

39

2

Chapter 2

2

suspensory system part (Delanceysâ&#x20AC;&#x2122; level I and II), and the supportive part (level III).14;81 The quantity, type and organisation of collagen, elastin and smooth muscles cells vary within the different tissues.43 Tissues from all three levels were used to study the possible defects in collagen metabolism in patients with POP without defining and relating them to the type and stage of the prolapse. Beside the variety in biopsy sites, the majority of the studies do not define tissue histology, making it difficult to determine exactly which portion (e.g. epithelium vs. subepithelium) is being analyzed. Histology of the paracolpium and uterosacral and cardinal ligaments demonstrates that these structures have a different composition when compared to the vaginal tissue. Also, variation in biochemical tests that are used for the analysis of vaginal/ pelvic tissues in women with POP and the heterogeneity in the populations studied contribute to the inconsistency of the results in the literature on connective tissue components of vaginal/ pelvic tissue in relation to POP.53 Noteworthy is the way in which collagen and elastin are measured; through mRNA, precursor protein, or mature levels of collagen or elastin. Measuring mRNA that still needs to be translated and will undergo further post-translational modification and turn-over, will not reflect the resulting levels of mature elastin protein. Also the amount of precursor protein may not reflect the actual amount of mature collagen or elastin.48;53 With respect to studies on MMP the focus should not only be on proMMP or MMP mRNA but on the entire expression profile.48;49

SUMMARY AND PERSPECTIVE In 1996, Jackson formulated his theory about the pathogenesis of POP.13 He postulated that in young patients with POP, a higher turn-over of immature collagen11 resulted in a bulk of deficient glycated old collagen, that is difficult to degrade. This glycated collagen, which is brittle and susceptible to rupture, may result in POP. Despite numerous shortcomings in the available literature, the hypothesis of Jackson13 still appears to be valid.11;38;39;42;43;47;49;50;82;83 In prolapsed tissue, the fibroblasts exhibit more collagenproduction, an increased MMP-2 and 9 activity and a decrease of the activity of TIMP-1, resulting in an increased turnover of collagen. In particular the breakdown of immature newly formed collagen is increased. The total collagen content is generally lower in POP patients compared with non-POP patients. The content of AGEâ&#x20AC;&#x2122;s is increased in patients with POP, which makes them susceptible for developing POP over time.

40

Connective tissue in POP

Jackson13 found no change in the type I to type III ratio. Most studies however found an increase in type III40;43;58;83 and/ or a decrease in type I11;38;42 thus resulting in a decreased I/III ratio. An increase in the expression of both collagen type III and MMP-9 expression is typical of tissue that is remodeling after injury84 or accommodating to a progressively increasing mechanical load.44;85 In particular an increase in MMP-9 specifically in women with POP found by Jackson and confirmed

by Moalli43 has been associated with tissue remodeling in bone86, coronary artery87 and healing dermal wounds.88 Parity is the strongest factor in the development of POP with an adjusted relative risk of 10,85 (95% CI 4.65-33.81).5 During childbirth, neuromuscular damage occurs.

It is not only direct injury to the levator ani muscle resulting in mechanical disruption of the entire muscle, but also damage to the nerve supply of the muscle, that could lead to their inability to contract, even though the muscles remain intact.89;90 When the pelvic floor muscles relax or are damaged, the genital hiatus opens and the pelvic organs must be held in place by the suspensory ligaments. Although the ligaments can sustain these loads for short periods of time, the connective tissues will stretch and eventually fail if the pelvic floor muscles do not close the pelvic floor in time. Physiological aging and menopause are decompensating factors in this process.91 It is therefore likely that after an injury such as childbirth, the supporting connective tissue of the vaginal wall will remodel in order to adapt to the tensile stress. It is hard, if not impossible, to determine whether the changes seen in collagen metabolism in women with POP do reflect the cause or the effect of prolapse. Alternatively, it may well be that POP is related to abnormal repair of the injured tissue after the stress of delivery.92 In either case, the increased flexibility, dispensability and decreased tensile strength associated with an increase in collagen III together with a decrease in elastin levels, will very likely contribute to the progression of POP. Whether the change in biomechanical properties is also caused by a change in the concentration of intermolecular cross-linking analysed in only two studies11;47 which both support the findings of Jackson, may need further studies in order to be able to substantiate this conclusion.

In future studies, a better comparison requires standardisation of biopsy sites with histological confirmation. Also standardisation of complementary and confirmatory methods of protein quantification is obligatory.

More knowledge is needed about the roles of the different types of collagen, collagen turnover and breakdown, as well as the interaction between collagen maintenance, elastin metabolism, genetic components and parity in the pathophysiology of POP.

41

2

Chapter 2

2

Also, information about the intrinsic quality of the collagens, collagen crosslinking and the mechanisms by which collagen production and breakdown are out of balance in POP patients, is in general still lacking. It may be postulated that most conclusive answers will be obtained from young POP patients, in which the the genetic component may be expected to be more pronounced compared to older POP-patients.

The focus of research should also be on the mechanism of fibroblasts reacting on mechanical loading, typing of the collagens produced by fibroblasts, and MMP production by fibroblasts in POP- and non-POP patients. This is of particular interest when patientsâ&#x20AC;&#x2122; own stem cells are used as a therapeutic means to restore the collagen homeostasis. Stem cells have been used to create striated sphincter muscle in vitro.93 Also, autologous myoblasts and fibroblasts were injected lateral from the urethra to treat urinary incontinence.94;95 Ideally it should be possible to develop a biocompatible and bioresorbable scaffold with appropriate mechanical properties in which stem cells are able to contribute to tissue regeneration by proliferation and differentiation into (myo)fibroblasts and by formation of the appropriate connective tissue. If, however, autologous fibroblasts of POP patients are unable to produce a good quality extracellular matrix due to their genetic background, the use of allogenic stemcells could be considered.

CONCLUSION Recent literature data support the hypothesis of Jackson formulated in 1996 â&#x20AC;&#x201C; more brittle collagen in pelvic floor connective tissue that is difficult to degrade in POP patients compared to non-POP-patients â&#x20AC;&#x201C; but do not resolve longstanding questions on the etiology of POP.

42

Connective tissue in POP

Table 1. Collagen analysis in biopsy specimens from vaginal or supportive tissue in women with or without POP. Study

Target population and sample size

Tissue analyzed

Analytic methods

Findings: POP versus controls

Makinen ’87 [61] (n=10)

5 women with uterine prolapse 5 controls 8 premenopausal women with POP 10 controls 24 premenopausal women with POP 21 controls

Vaginal fascia

No difference in collagen I mRNA

Liapis ’01 [96] (n=94)

34 women with SUI and POP; 32 women with POP 28 controls

Paravaginal fascia and the uterosacral ligaments

Collagen I mRNA in fibroblasts cultured from vaginal biopsies Hydroxyproline assay, protein analysis of collagen  chains Histology with hematoxylin and eosine, Gomori’s trichome and Verhoeff elastic stains followed by light microscopy Immunohistochemical analysis and light microscopy

Takano ’02 [38] (n=55)

10 premenopausal women with POP 23 postmenopausal women wtih POP 22 controls 33 women with POP 25 controls

Lateral parametrium and vaginal apex

Histology with picrosirius

Cardinal ligaments

Histological confimation immunohistochemistry

Increased collagen III, but suppressed effect by HT

15 postmenopausal women with POP 14 postmenopausal women with POP and SUI

Periurethral ligaments

Immunohistochemistry and light microscopy

Decreased collagen I, III and VI in women with SUI Decreased total collagen in women with POP

ATFP

Laser scanning confocal microscopy and immunofluorescence

Decreased collagen I in postmenopausal women Increased collagen I in postmenopausal women with HT Decreased ratio collagen I/III in postmenopausal women and increased with HT Decreased total collagen

Jackson ’96 [13] (n=18) Kökçü ’01 [58] (n=45)

Ewies’03 [40] Goepel ’03 [97] (n=29)

Moalli ’04 [42] (n=27)

10 premenopausal women 5 postmenopausal women 12 postmenopausal women with HT

Vaginal epithelium Vaginal fascia in precervical region, cardinal, uterosacral and round ligaments

Decreased total collagen No difference in ratio collagen I/III Increased total collagen

Decreased collagen III in SUI and POP, no significant difference in women with POP alone compared with controls Decreased collagen in lateral parametrium in POP in women with POP compared with controls

Wong ’03 [39] (n=31) Soderberg ’04 [11] (n=35)

14 women with POP 17 controls 22 women with POP 13 women without POP

Uterine cervix

Hydroxyproline assay

Paraurethral ligaments

Hydroxyproline assay

Gabriel ’05 [83] (n=41) Moalli ’05 [43]

25 women with POP 16 controls 31 premenopausal women: 16 women with POP, 15 controls

Uterosacral ligaments

Immunohistochemistry

Decreased total collagen in women with POP < 53 yrs; no difference in POP and controls > 53yrs Increased collagen III

Full thickness vaginal apex

Histology, laser scanning confocal microscopy and immunofluorescence, gelatin zymography

Increased total collagen in premenopausal women with POP and postmenopausal women without HT

46 postmenopausal women with POP: 23 women on HT, 23 women without HT

Decreased total collagen in women with POP and SUI Increased collagen III in women with POP No difference in collagen I and V in women with POP

SUI (stress urinary incontinence); HT (hormone therapy).

43

2

Chapter 2

Table 2. Analysis of matrix metalloproteinases and tissue inhibitor of matrix metalloproteinase in biopsy specimens from vaginal or supportive tissue in women with or without POP.

2

Study

Target population and sample size

Tissue analyzed

Analytic methods

Findings: POP versus controls

Jackson 1996 [13]

8 premenopausal women with POP and 10 controls

Vaginal epithelium

Hydroxyproline assay

Increase of pro MMP-2, active MMP-2 and MMP-9

Chen 2002 [47]

7 women with POP and SUI and 15 controls

Anterior vaginal wall

Quantative competive reverse transcription PCR

Decreased TIMP-1mRNA and increased MMP-1 mRNA. No difference in TIMP-2 and TIMP-3 mRNA or MMP-2, MMP-9

Moalli 2005 [43]

31 premenopausal women: 16 women with POP, 15 controls

Full thickness vaginal apex

Histology, laser scanning confocal microscopy and immunofluorescence, gelatin zymography

46 postmenopausal women with POP: 23 women on HT, 23 women without HT Gabriel 2005 [41]

Philips 2006 [50]

Increased active MMP-9 in premenopausal women with POP and in postmenopausal women with HT

No difference in the expression of proMMP-2, active MMP-2 or proMMP 9

17 women with POP and 18 controls

Uterosacral ligaments

14 women with POP and 14 controls

Uterosacral ligaments and vaginal epithelial tissue

Immunohistochemistry

Increased expression of MMP-2 No difference in expression of MMP-1

Immunohistochemistry

In vaginal epithelium: Increased expression of pro-MMP-2 No difference in active MMP-2, MMP9 and TIMP-2

E2 (estradiol); SUI (stress urinary incontinence); HT (hormone therapy).

44

Connective tissue in POP

Table 3. Analysis of elastin in biopsy specimens from vaginal or supportive tissue in women with or without POP. Study

Target population and sample size

Tissue analyzed

Analytic methods

Findings: POP versus controls

Yamamoto’97 [57]

4 postmenopausal women with POP 4 controls

Cultured fibroblasts from cardinal ligaments

mRNA by Nothern blot analysis Tropo-elastin by Western blot analysis

Decreased mRNA and tropoelastin production by fibroblast

Ewies’03 [42]

33 women with POP 25 controls

Cardinal ligaments

Histological confimation immunohistochemistry

Decreased elastin content

Chen ’04 [55]

12 women with SUI and or POP 15 controls

Peri urethral vaginal wall

Quantitative competitive-PCR mRNA and confirmatory Western blot analyses

Decrease in endogenous inhibitors of elastases with increase in elastolytic activity resulting in decrease in elastin content

Goepel ’07 [56]

29 postmenopausal with POP 30 controls

Uterosacral ligaments

Immonofluorescence microscopy elastin/ tenascin

Decreased elastin content, increased tenascin content

Karam ’07 [53]

33 women with POP 10 controls

Anterior vaginal wall

Histological confimation immunohistochemistry

Decreased elastin content

Klütke’08 [98]

31 women with POP 29 controls

Uterosacral ligaments

Desmosine by radioimmunoassay; quantitative real time PCR mRNA levels of LOX, LOXL1, LOXL2 and (FIB-5)

Decreased desmosine content

Lin ’06 [99]

23 women with POP 15 controls

Anterior vaginal wall

Immunohistochemistry

No difference

Jackson ’96 [13]

8 premenopausal women with POP 10 controls

Vaginal epithelium

Desmosine by modified ion-exchange method

No difference

LOX (lysyl oxidase); LOXL1 (lysyl oxidase like-1); FIB-5 (fibulin-5); SUI (stress urinary incontinence).

45

Suppression of mRNA for LOX and two LOX iso-enzymes

2

Chapter 2

REFERENCE LIST

2

1.

2.

3.

4.

5.

6.

7.

8.

9.

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

Bump RC, Norton PA. Epidemiology and natural history of pelvic floor dysfunction.

Obstet.Gynecol.Clin.North Am. 1998;25:723-46.

Dietz HP, Haylen BT, Vancaillie TG. Female pelvic organ prolapse and voiding function.

Int.Urogynecol.J.Pelvic.Floor.Dysfunct. 2002;13:284-88.

Olsen AL, Smith VJ, Bergstrom JO, Colling JC, Clark AL. Epidemiology of surgically managed pelvic organ prolapse and urinary incontinence. Obstet.Gynecol. 1997;89:501-06.

Bai SW, Chung DJ, Yoon JM, Shin JS, Kim SK, Park KH. Roles of estrogen receptor, progesterone receptor, p53 and p21 in pathogenesis of pelvic organ prolapse. International Urogynecology Journal 2005;16:492-96.

Mant J, Painter R, Vessey M. Epidemiology of genital prolapse: observations from the Oxford Family Planning Association Study. Br.J.Obstet.Gynaecol. 1997;104:579-85.

Buchsbaum GM, Duecy EE, Kerr LA, Huang LS, Perevich M, Guzick DS. Pelvic organ prolapse in nulliparous women and their parous sisters. Obstet.Gynecol. 2006;108:1388-93.

Nikolova G, Lee H, Berkovitz S, Nelson S, Sinsheimer J, Vilain E et al. Sequence variant in the laminin gamma 1 (LAMC1) gene associated with familial pelvic organ prolapse.

Human Genetics 2007;120:847-56.

Twiss C, Triaca V, Rodriguez LV. Familial transmission of urogenital prolapse and incontinence.

Curr.Opin.Obstet.Gynecol. 2007;19:464-68.

Chiaffarino F, Chatenoud L, Dindelli M, Meschia M, Buonaguidi A, Amicarelli F et al.

Reproductive factors, family history, occupation and risk of urogenital prolapse.

Eur.J.Obstet.Gynecol.Reprod.Biol. 1999;82:63-67.

Norton PA, Baker JE, Sharp HC, Warenski JC. Genitourinary prolapse and joint hypermobility in women. Obstet.Gynecol. 1995;85:225-28.

Soderberg MW, Falconer C, Bystrom B, Malmstrom A, Ekman G. Young women with genital prolapse have a low collagen concentration. Acta Obstet.Gynecol.Scand. 2004;83:1193-98.

Bhatia NN, Ho MH. Stem cell therapy for urinary incontinence and pelvic floor disorders: a novel approach. Curr.Opin.Obstet.Gynecol. 2004;16:397-98.

Jackson SR, Avery NC, Tarlton JF, Eckford SD, Abrams P, Bailey AJ. Changes in metabolism of collagen in genitourinary prolapse. Lancet 1996;347:1658-61.

Delancey JO. Anatomic aspects of vaginal eversion after hysterectomy.

Am.J.Obstet.Gynecol. 1992;166:1717-24.

Reay Jones NH, Healy JC, King LJ, Saini S, Shousha S, len-Mersh TG. Pelvic connective tissue resilience decreases with vaginal delivery, menopause and uterine prolapse.

Br.J.Surg. 2003;90:466-72.

Goh JT. Biomechanical and biochemical assessments for pelvic organ prolapse 18. Curr.Opin.Obstet.Gynecol. 2003;15:391-94.

Ramachandran GN, Kartha G. Structure of collagen. Nature 1955;176:593-95.

Bailey AJ. Molecular mechanisms of ageing in connective tissues.

Mech.Ageing Dev. 2001;122:735-55.

Haukipuro K. Synthesis of collagen types I and III in reincised wounds in humans.

Br.J.Surg. 1991;78:708-12.

Hibbs MS, Postlethwaite AE, Mainardi CL, Seyer JM, Kang AH. Alterations in collagen production in mixed mononuclear leukocyte-fibroblast cultures. J.Exp.Med. 1983;157:47-59.

Birk DE, Fitch JM, Babiarz JP, Doane KJ, Linsenmayer TF. Collagen fibrillogenesis in vitro: interaction of types I and V collagen regulates fibril diameter. J.Cell Sci. 1990;95 ( Pt 4):649-57.

Birk DE. Type V collagen: heterotypic type I/V collagen interactions in the regulation of fibril assembly. Micron. 2001;32:223-37.

46

Connective tissue in POP

23.

24.

25.

26.

27.

28.

29.

30.

31.

32.

33.

34.

35.

36.

37.

38.

39.

40.

41.

42.

Swift S, Woodman P, O'Boyle A, Kahn M, Valley M, Bland D et al. Pelvic Organ Support Study (POSST): the distribution, clinical definition, and epidemiologic condition of pelvic organ support defects. Am.J.Obstet.Gynecol. 2005;192:795-806.

Bailey AJ, Paul RG, Knott L. Mechanisms of maturation and ageing of collagen.

Mech.Ageing Dev. 1998;106:1-56.

Paul RG, Bailey AJ. Glycation of collagen: the basis of its central role in the late complications of ageing and diabetes. Int.J.Biochem.Cell Biol. 1996;28:1297-310.

Mott JD, Werb Z. Regulation of matrix biology by matrix metalloproteinases.

Curr.Opin.Cell Biol. 2004;16:558-64.

Curry TE, Jr., Osteen KG. The matrix metalloproteinase system: changes, regulation, and impact throughout the ovarian and uterine reproductive cycle. Endocr.Rev. 2003;24:428-65.

Chen B, Wen Y, Wang H, Polan ML. Differences in estrogen modulation of tissue inhibitor of matrix metalloproteinase-1 and matrix metalloproteinase-1 expression in cultured fibroblasts from continent and incontinent women. Am.J.Obstet.Gynecol. 2003;189:59-65.

Gomez DE, Alonso DF, Yoshiji H, Thorgeirsson UP. Tissue inhibitors of metalloproteinases: structure, regulation and biological functions. Eur.J.Cell Biol. 1997;74:111-22.

Clark AL, Slayden OD, Hettrich K, Brenner RM. Estrogen increases collagen I and III mRNA expression in the pelvic support tissues of the rhesus macaque.

40. Am.J.Obstet.Gynecol. 2005;192:1523-29.

Kremer EA, Chen Y, Suzuki K, Nagase H, Gorski JP. Hydroxyapatite induces autolytic degradation and inactivation of matrix metalloproteinase-1 and -3. J.Bone Miner.Res. 1998;13:1890-902.

Ritz-Timme S, Laumeier I, Collins MJ. Aspartic acid racemization: evidence for marked longevity of elastin in human skin. Br.J.Dermatol. 2003;149:951-59.

Liu X, Zhao Y, Pawlyk B, Damaser M, Li T. Failure of elastic fiber homeostasis leads to pelvic floor disorders. Am.J.Pathol. 2006;168:519-28.

Alperin M, Debes K, Abramowitch S, Meyn L, Moalli PA. LOXL1 deficiency negatively impacts the biomechanical properties of the mouse vagina and supportive tissues.

Int.Urogynecol.J.Pelvic.Floor.Dysfunct. 2008.

Nakamura T, Lozano PR, Ikeda Y, Iwanaga Y, Hinek A, Minamisawa S et al. Fibulin-5/DANCE is essential for elastogenesis in vivo. Nature 2002;415:171-75.

Drewes PG, Yanagisawa H, Starcher B, Hornstra I, Csiszar K, Marinis SI et al. Pelvic organ prolapse in fibulin-5 knockout mice: pregnancy-induced changes in elastic fiber homeostasis in mouse vagina. Am.J.Pathol. 2007;170:578-89.

Buchanan S, Robertson GW, Hocking PM. Effects of food restriction or delayed photostimulation on ovarian follicle number, plasma oestradiol concentration and vaginal collagen content in male-line turkeys. Br.Poult.Sci. 2000;41:502-07.

Takano CC, Girao MJ, Sartori MG, Castro RA, Arruda RM, Simoes MJ et al. Analysis of collagen in parametrium and vaginal apex of women with and without uterine prolapse.

Int.Urogynecol.J.Pelvic.Floor.Dysfunct. 2002;13:342-45.

Wong MY, Harmanli OH, Agar M, Dandolu V, Grody MH. Collagen content of nonsupport tissue in pelvic organ prolapse and stress urinary incontinence. Am.J.Obstet.Gynecol. 2003;189:1597-99.

Ewies AA, Al-Azzawi F, Thompson J. Changes in extracellular matrix proteins in the cardinal ligaments of post-menopausal women with or without prolapse: a computerized immunohistomorphometric analysis. Hum.Reprod. 2003;18:2189-95.

Gabriel B, Watermann D, Hancke K, Gitsch G, Werner M, Tempfer C et al. Increased expression of matrix metalloproteinase 2 in uterosacral ligaments is associated with pelvic organ prolapse.

Int.Urogynecol.J.Pelvic.Floor.Dysfunct. 2005;1-5.

Moalli PA, Talarico LC, Sung VW, Klingensmith WL, Shand SH, Meyn LA et al. Impact of menopause on collagen subtypes in the arcus tendineous fasciae pelvis.

Am.J.Obstet.Gynecol. 2004;190:620-27.

47

2

Chapter 2

2

43.

44.

45.

46.

47.

48.

49.

50.

51.

52.

53.

54.

55.

56.

57.

58.

59.

60.

61.

62.

63.

64.

Moalli PA, Shand SH, Zyczynski HM, Gordy SC, Meyn LA. Remodeling of vaginal connective tissue in patients with prolapse. Obstet.Gynecol. 2005;106:953-63.

Chiquet M. Regulation of extracellular matrix gene expression by mechanical stress.

Matrix Biol. 1999;18:417-26.

Barbiero EC, Sartori MG, Girao MJ, Baracat EC, de Lima GR. Analysis of type I collagen in the parametrium of women with and without uterine prolapse, according to hormonal status.

Int.Urogynecol.J.Pelvic.Floor.Dysfunct. 2003;14:331-34.

Yamauchi M, Woodley DT, Mechanic GL. Aging and cross-linking of skin collagen 536. Biochem.Biophys.Res.Commun. 1988;152:898-903.

Chen BH, Wen Y, Li H, Polan ML. Collagen metabolism and turnover in women with stress urinary incontinence and pelvic prolapse. Int.Urogynecol.J.Pelvic.Floor.Dysfunct. 2002;13:80-87.

Alperin M, Moalli PA. Remodeling of vaginal connective tissue in patients with prolapse.

Curr.Opin.Obstet.Gynecol. 2006;18:544-50.

Zong W, Zyczynski HM, Meyn LA, Gordy SC, Moalli PA. Regulation of MMP-1 by sex steroid hormones in fibroblasts derived from the female pelvic floor. Am.J.Obstet.Gynecol. 2007;196:349-11.

Phillips CH, Anthony F, Benyon C, Monga AK. Collagen metabolism in the uterosacral ligaments and vaginal skin of women with uterine prolapse.

Bjog-An International Journal of Obstetrics and Gynaecology 2006;113:39-46.

Carley ME, Schaffer J. Urinary incontinence and pelvic organ prolapse in women with Marfan or Ehlers Danlos syndrome. Am.J.Obstet.Gynecol. 2000;182:1021-23.

Judge DP, Dietz HC. Marfan's syndrome. Lancet 2005;366:1965-76.

Karam JA, Vazquez DV, Lin VK, Zimmern PE. Elastin expression and elastic fibre width in the anterior vaginal wall of postmenopausal women with and without prolapse. BJU.Int. 2007;100:346-50.

Starcher BC. Determination of the elastin content of tissues by measuring desmosine and isodesmosine. Anal.Biochem. 1977;79:11-15.

Chen B, Wen Y, Polan ML. Elastolytic activity in women with stress urinary incontinence and pelvic organ prolapse. Neurourol.Urodyn. 2004;23:119-26.

Goepel C. Differential elastin and tenascin immunolabeling in the uterosacral ligaments in postmenopausal women with and without pelvic organ prolapse. Acta Histochem. 2008;110(3):204-9.

Yamamoto K, Yamamoto M, Akazawa K, Tajima S, Wakimoto H, Aoyagi M. Decrease in elastin gene expression and protein synthesis in fibroblasts derived from cardinal ligaments of patients with prolapsus uteri. Cell Biol.Int. 1997;21:605-11.

Kokcu A, Yanik F, Cetinkaya M, Alper T, Kandemir B, Malatyalioglu E. Histopathological evaluation of the connective tissue of the vaginal fascia and the uterine ligaments in women with and without pelvic relaxation. Arch.Gynecol.Obstet. 2002;266:75-78.

Makinen J, Soderstrom KO, Kiilholma P, Hirvonen T. Histological changes in the vaginal connective tissue of patients with and without uterine prolapse. Arch.Gynecol. 1986;239:17-20.

Poncet S, Meyer S, Richard C, Aubert JD, Juillerat-Jeanneret L. The expression and function of the endothelin system in contractile properties of vaginal myofibroblasts of women with uterovag inal prolapse. Am.J.Obstet.Gynecol. 2005;192:426-32.

Makinen J, Kahari VM, Soderstrom KO, Vuorio E, Hirvonen T. Collagen synthesis in the vaginal connective tissue of patients with and without uterine prolapse 36. Eur.J.Obstet.Gynecol.Reprod.Biol. 1987;24:319-25.

Ewies AA, El-Shafie M, Li J, Stanley A, Thompson J, Styles JA et al. Changes in transcription profile and cytoskeleton morphology in pelvic ligament fibroblasts in response to stretch - the effects of oestradiol and levormeloxifene. Mol.Hum.Reprod. 2008.

Yamamoto M, Aoyagi M, Akazawa K, Tajima S, Yamamoto K. Decrease in p53 protein in cultured cardinal ligament fibroblasts from patients with prolapsus uteri. Cell Biol.Int. 1998;22:31-40.

Yamamoto M, Akazawa K, Aoyagi M, Yamamoto K. Changes in biological characteristics during the cellular aging of ligament fibroblasts derived from patients with prolapsus uteri.

48

Connective tissue in POP

65.

66.

67.

68.

69.

70.

71.

72.

73.

74.

75.

76.

77.

78.

79.

80.

81.

82.

83.

Mech.Ageing Dev. 2000;115:175-87.

Bai SW, Jung YW, Kwon HS, Yoon JM, Shin JS, Kim SK et al. The role of estrogen receptor, progesterone receptor and p53 in development of stress urinary incontinence.

Yonsei Med.J. 2004;45:885-90.

Brincat M, Moniz CF, Kabalan S, Versi E, O'Dowd T, Magos AL et al. Decline in skin collagen content and metacarpal index after the menopause and its prevention with sex hormone replacement.

Br.J.Obstet.Gynaecol. 1987;94:126-29.

Brincat M, Kabalan S, Studd JW, Moniz CF, de TJ, Montgomery J. A study of the decrease of skin collagen content, skin thickness, and bone mass in the postmenopausal woman.

Obstet.Gynecol. 1987;70:840-45.

Moehrer B, Hextall A, Jackson S. Oestrogens for urinary incontinence in women.

Cochrane.Database.Syst.Rev. 2003;CD001405.

Savvas M, Bishop J, Laurent G, Watson N, Studd J. Type III collagen content in the skin of postmenopausal women receiving oestradiol and testosterone implants.

Br.J.Obstet.Gynaecol. 1993;100:154-56.

Chung dJ, Bai SW. Roles of sex steroid receptors and cell cycle regulation in pathogenesis of pelvic organ prolapse. Curr.Opin.Obstet.Gynecol. 2006;18:551-54.

Lang JH, Zhu L, Sun ZJ, Chen J. Estrogen levels and estrogen receptors in patients with stress urinary incontinence and pelvic organ prolapse. Int.J.Gynaecol.Obstet. 2003;80:35-39.

Ewies AA, Thompson J, Al Azzawi F. Changes in gonadal steroid receptors in the cardinal ligaments of prolapsed uteri: immunohistomorphometric data. Hum.Reprod. 2004;19:1622-28.

Falconer C, Ekman-Ordeberg G, Ulmsten U, Westergren-Thorsson G, Barchan K, Malmstrom A. Changes in paraurethral connective tissue at menopause are counteracted by estrogen.

Maturitas 1996;24:197-204.

Rizk DE, Hassan HA, Al Marzouqi AH, Ramadan GA, Al Kedrah SS, Daoud SA et al.

Combined estrogen and ghrelin administration restores number of blood vessels and collagen type I/III ratio in the urethral and anal canal submucosa of old ovariectomized rats.

Int.Urogynecol.J.Pelvic.Floor.Dysfunct. 2008;19:547-52.

Jackson S, James M, Abrams P. The effect of oestradiol on vaginal collagen metabolism in postmenopausal women with genuine stress incontinence. BJOG. 2002;109:339-44.

Helvering LM, Adrian MD, Geiser AG, Estrem ST, Wei T, Huang S et al. Differential effects of estrogen and raloxifene on messenger RNA and matrix metalloproteinase 2 activity in the rat uterus. Biology of Reproduction 2005;72:830-41.

Brincat M, Versi E, Moniz CF, Magos A, de TJ, Studd JW. Skin collagen changes in postmenopausal women receiving different regimens of estrogen therapy. Obstet.Gynecol. 1987;70:123-27.

Moalli PA, Klingensmith WL, Meyn LA, Zyczynski HM. Regulation of matrix metalloproteinase expression by estrogen in fibroblasts that are derived from the pelvic floor.

Am.J.Obstet.Gynecol. 2002;187:72-79.

Liu YM, Choy KW, Lui WT, Pang MW, Wong YF, Yip SK. 17beta-estradiol suppresses proliferation of fibroblasts derived from cardinal ligaments in patients with or without pelvic organ prolapse.

Hum.Reprod. 2006;21:303-08.

Chen B, Wen Y, Zhang ZM, Wang HB, Warrington JA, Polan ML. Menstrual phase-dependent gene expression differences in periurethral vaginal tissue from women with stress incontinence.

American Journal of Obstetrics and Gynecology 2003;189:89-97.

Delancey JO. The anatomy of the pelvic floor. Curr.Opin.Obstet.Gynecol. 1994;6:313-16.

Buchanan S, Robertson GW, Hocking PM. The relationships between vaginal collagen, plasma oestradiol and uterine prolapse in turkeys. Research in Veterinary Science 1999;67:153-57.

Gabriel B, Denschlag D, Gobel H, Fittkow C, Werner M, Gitsch G et al. Uterosacral ligament in postmenopausal women with or without pelvic organ prolapse.

Int.Urogynecol.J.Pelvic.Floor.Dysfunct. 2005;16:475-79.

49

2

Chapter 2

2

84.

85.

86.

87.

88.

89.

90.

91.

92.

93.

94.

95.

96.

97.

98.

99.

Soo C, Shaw WW, Zhang X, Longaker MT, Howard EW, Ting K. Differential expression of matrix metalloproteinases and their tissue-derived inhibitors in cutaneous wound repair.

Plast.Reconstr.Surg. 2000;105:638-47.

Sarasa-Renedo A, Chiquet M. Mechanical signals regulating extracellular matrix gene expression in fibroblasts. Scand.J.Med.Sci.Sports 2005;15:223-30.

Ortega N, Behonick D, Stickens D, Werb Z. How proteases regulate bone morphogenesis.

Ann.N.Y.Acad.Sci. 2003;995:109-16.

Cai WJ, Koltai S, Kocsis E, Scholz D, Kostin S, Luo X et al. Remodeling of the adventitia during coronary arteriogenesis. Am.J.Physiol Heart Circ.Physiol 2003;284:H31-H40.

Gillard JA, Reed MW, Buttle D, Cross SS, Brown NJ. Matrix metalloproteinase activity and immunohistochemical profile of matrix metalloproteinase-2 and -9 and tissue inhibitor of metalloproteinase-1 during human dermal wound healing. Wound.Repair Regen. 2004;12:295-304.

Allen RE, Hosker GL, Smith AR, Warrell DW. Pelvic floor damage and childbirth: a neurophysiological study. Br.J.Obstet.Gynaecol. 1990;97:770-79.

Smith AR, Hosker GL, Warrell DW. The role of partial denervation of the pelvic floor in the aetiology of genitourinary prolapse and stress incontinence of urine. A neurophysiological study.

Br.J.Obstet.Gynaecol. 1989;96:24-28.

Ashton-Miller JA, Delancey JO. Functional anatomy of the female pelvic floor.

Ann.N.Y.Acad.Sci. 2007;1101:266-96.

Meyer S, Schreyer A, De GP, Hohlfeld P. The effects of birth on urinary continence mechanisms and other pelvic-floor characteristics. Obstet.Gynecol. 1998;92:613-18.

Cannon TW, Lee JY, Somogyi G, Pruchnic R, Smith CP, Huard J et al. Improved sphincter contractility after allogenic muscle-derived progenitor cell injection into the denervated rat urethra. Urology 2003;62:958-63.

Strasser H, Marksteiner R, Margreiter E, Pinggera GM, Mitterberger M, Fritsch H et al.

[Stem cell therapy for urinary incontinence]. Urologe A 2004;43:1237-41.

Strasser H, Marksteiner R, Margreiter E, Pinggera GM, Mitterberger M, Frauscher F et al.

Autologous myoblasts and fibroblasts versus collagen for treatment of stress urinary incontinence in women: a randomised controlled trial. Lancet 2007;369:2179-86.

Liapis A, Bakas P, Pafiti A, Frangos-Plemenos M, Arnoyannaki N, Creatsas G. Changes of collagen type III in female patients with genuine stress incontinence and pelvic floor prolapse.

Eur.J.Obstet.Gynecol.Reprod.Biol. 2001;97:76-79.

Goepel C, Hefler L, Methfessel HD, Koelbl H. Periurethral connective tissue status of postmenopausal women with genital prolapse with and without stress incontinence.

Acta Obstet.Gynecol.Scand. 2003;82:659-64.

Klutke J, Ji Q, Campeau J, Starcher B, Felix JC, Stanczyk FZ et al. Decreased endopelvic fascia elastin content in uterine prolapse. Acta Obstet.Gynecol.Scand. 2008;87:111-15.

Lin SY, Tee YT, Ng SC, Chang H, Lin P, Chen GD. Changes in the extracellular matrix in the anterior vagina of women with or without prolapse. Int.Urogynecol.J.Pelvic.Floor.Dysfunct. 2006.

50

Connective tissue in POP

2

51

3 Changes in tissue composition of the vaginal wall of premenopausal women with prolapse M.H. Kerkhof A.M. Ruiz-Zapata H. Bril M.C.G. Bleeker J.A.M. Belien R. Stoop M.N. Helder American J Obstet Gynecol. 2014 Feb;210(2):168.e1-9

Chapter 3

ABSTRACT Objective: The objective of this study was to compare histological and biochemical features of the (normal) precervical anterior vaginal wall and the prolapsed anterior vaginal wall of women with pelvic organ prolapse (POP). These data were compared to tissue of the precervical anterior vaginal wall of age-matched controls without POP to identify possible intrinsic and acquired effects.

3

Study design: Biopsies were collected from the apex of the anterior vaginal cuff after hysterectomy from a control group of 13 premenopausal women undergoing hysterectomy for benign gynecological diseases, and a case group of 13 premenopausal women undergoing prolapse surgery (cystocele POP-Q stage â&#x2030;Ľ 2).

In women with POP an additional full thickness vaginal wall sample was taken from the POP site during anterior colporrhaphy. Histomorphometric and biochemical analysis were performed for different components of the extracellular matrix.

Results: There were no differences between case and control group in the precervical vaginal wall tissue with respect to the different components of the extracellular matrix and the biochemical parameters. However, there was a tendency towards a higher amount of collagen III and elastin, and a significant increase of smooth muscle cells and pyridinoline collagen cross-links in the POP site compared to the non-POP site of the same POP patient.

Conclusion: Our findings suggest that the changes seen in connective tissue in the anterior vaginal wall of women with pelvic organ prolapse are the effect, rather than the cause of pelvic organ prolapse.

BRIEF SUMMARY Fundamental changes in connective tissue of the prolapsed vaginal wall are an acquired effect, rather than an intrinsic defect of the connective tissue.

54

Matrix composition and quality

INTRODUCTION Pelvic organ prolapse (POP) is a global health problem, affecting adult women of all ages. It decreases their quality of life considerably.1,2 POP is one of the most common reasons for gynecological surgery in women after the fertile period. The failure rate of surgery is relatively high: an estimated 30% of women require reoperation.2 Despite this, little is known about the underlying pathophysiology of POP.3,4 For decades it has been speculated that POP occurs due to a structural defect in the vagina and its supportive tissues. Such defects could be a decrease in collagen content and quality, differences in collagen subtypes, changes in the amount and quality of elastin, and the density of smooth muscle cells (SMCs).3,5 Due to different biopsy sites, unclarity of which layers of the vaginal wall are actually being analyzed, and very heterogeneous study populations, data are conflicting. Moreover, by comparing tissue that is prolapsed to one that is not prolapsed, it is impossible to distinguish between causes and effects of POP. In other words it is impossible to distinguish whether the observed changes in the anterior vaginal wall are the result of an intrinsic (genetic) or an acquired (environmental) effect.

The goal of this study was to identify the changes in the non-prolapsed anterior vaginal wall that occur in premenopausal women with POP, compared to age matched women without POP using histologically defined samples. The second goal was to determine whether the observed changes are caused by the prolapse, by comparing the histological and biochemical features of the anterior vaginal wall at the site of the POP with the same features at the non-POP site within the same patient. This approach helps us to identify possible changes in the connective tissue of the vaginal wall due to the increased pressure and stretch of the prolapsing pelvic organs on the vaginal wall. We hypothesize that the precervical anterior vaginal wall (non-POP site) of women with POP is comparable to the precervical anterior vaginal wall of controls, thus allowing us to consider this precervical tissue in POP patients as a proper control site. We expect to find differences in the histological and biochemical features at the POP site compared to the non-POP site within the same woman with prolapse. By testing the hypothesis that the changes seen in the connective tissue of the anterior vaginal wall are an acquired rather than an intrinsic effect causing POP, we hope to provide useful information that should help to develop new approaches in reconstructive pelvic surgery.

55

3

Chapter 3

MATERIALS AND METHODS

3

Patient population Upon medical ethical committee approval and acquired informed consent, biopsies were collected from 26 Caucasian premenopausal women in the Department of Gynecology and Obstetrics of the Kennemer Gasthuis, Haarlem, The Netherlands between March 2009 until March 2011. Eligible women were divided into 2 groups: a control group of 13 women undergoing abdominal or laparoscopic hysterectomy for benign gynecological diseases with no sign of POP during gynecological examination, and a case group of 13 patients undergoing vaginal hysterectomy and reconstructive pelvic surgery of the anterior vaginal compartment because of a cystocele, POP-Q stage 2 or more. Signs of POP were recorded during the pelvic examination by the same urogynecologist (MHK) and were described according to the International Continence Society Pelvic Organ Prolapse Quantification (POP-Q).6 Groups were matched for age, parity, smoking and use of oral contraceptives. Premenopausal status was defined as having a regular period over the preceding 12 months. Women on oral contraception were asked to temporarily stop for 3 months to see whether a spontaneous regular menstrual cycle would occur. Endometrial biopsies were obtained from all women defining the stage of the menstrual cycle at time of operation. Exclusion criteria included the use of progestin-only hormone regimen, a history of pelvic surgery, pelvic malignancy or connective tissue disease affecting collagen or elastin remodeling, adhesions or scarring at the biopsy site, surgeons judgment that a biopsy may harm the patient, a history or presence of endometriosis, morbid obesity (body mass index [BMI]> 35 kg/m2), diabetes, chronic inflammatory disease, chronic infections, steroid use and inability to provide informed consent. Standardized demographic and pertinent clinical information was recorded prospectively and stored in a dedicated database.

Tissue acquisition and preparation The site of tissue collection was standardized because of potential differences in composition of the extracellular matrix throughout the vagina.7 After removal of the uterus in the controls, full thickness samples of the anterior vaginal wall were obtained from the vaginal cuff at the anterior midline portion of the vaginal wall.

In women with POP an additional full thickness anterior vaginal wall (midline) sample was taken from the POP site during anterior colporrhaphy (point Ba POPQuantification).

To minimize harm in the control subjects, only anterior vaginal wall tissue from the vaginal cuff was retrieved. The minimum size of the biopsy was 0.5 x 1.0

56

Matrix composition and quality

cm2. All biopsies were large enough to perform (immuno-)histochemical as well as biochemical analysis. Biopsies were immediately passed off the surgical field and divided into two parts. For biochemical analysis, the biopsies were washed in phosphate buffered saline solution and stored at -80˚C until further processing. For analysis by microscopy the collected tissue was fixed in neutral buffered formalin for 24 hours, dehydrated and processed into paraffin blocks. Serial 3 µm sections were cut from the paraffin blocks, mounted on slides and stored until further processing.

All measurements were performed without knowledge of sample identity.

(Immuno-)histochemistry Hematoxylin and eosin staining was performed to verify that the collected samples represented the vaginal wall containing the epithelial layer, connective tissue and muscularis. To detect the amount of elastin in the connective tissue, the ‘Lawson elastic Van Gieson stain kit’, purchased from Klinipath, Duiven, The Netherlands was used. As positive controls, tissues from lung, appendix and liver were used.

Monoclonal antibodies against desmin and CD 31 were used to identify SMC and blood vessels respectively. Sections were also immunostained for the extracellular matrix proteins collagen I, III and IV (see Table 1).

Table 1. Antibodies used for immuno-histochemical analysis.

Antibody

Company

Preparation

Mouse anti human monoclonal antibody Desmin

DAKO, Copenhagen, Denmark

Peroxidase block Ready to use anti-serum

Appendix

Mouse anti human monoclonal antibody CD 31

DAKO, Copenhagen, Denmark

Peroxidase block Ready to use anti-serum

Tonsil

Rabbit anti human Collagen type I

ABNOVA, Heidelberg, Germany

Citrate pH 6.0

1:100

Kidney

Rabbit anti human Collagen type III

ACRIS, Herford, Germany

Pepsin 0.1%

1:1000

Skin

Mouse anti human IgG1 Collagen type IV

Dako, Copenhagen, Denmark

Citrate pH 6.0

1:150

Skin

Rabbit anti human Collagen type V

ACRIS, Herford, Germany

Pepsin 0.1%

1:1000

Skin

57

Titre

Positive control

3

Chapter 3

3

Morphometric analysis To quantify smooth muscle cells, elastin and microvessels we performed a morphometric analysis. Complete slides where scanned with a digital Mirax slide Scanner system (3DHistech, Budapest, Hungary) equipped with a 20x objective with a numerical aperture of 0.75 and a Sony DFW-X710 Fire Wire 1/3, type progressive camera camera pixel size 4.65 x 4.65 µm (3D Histech Ltd, Budapest, Hungary). The actual scan resolution of all pictures at 20x was 0.23µm. After scanning, representative areas of both the muscularis layer and the lamina propria layer, between 0.55 and 0.64 mm2 were randomly annotated by hand using the Panoramic Viewer software (3D Histech). Resulting annotations were exported in the Tagged Image File Format (TIFF) image-format. A computerized morphometric analysis of the desmin, EvG and CD31 stained slides was executed, using ImageJ 1.44p software (http://rsbweb.nih.gov/ij/) with a modified macro from Hadi et al.8 Analysis was performed for the lamina propria and muscularis layer separately. The amount of SMC was expressed as the total area of desmin positive cells versus the total tissue area. The amount of elastin was expressed by total area of fibers versus total tissue area. The CD 31 staining was used to quantify the amount of microvessels per area as well as the amount of nuclei per area.

Collagen staining was quantified in a blinded fashion using a four grade scoring system (absent, light, moderate or strong) by two independent pathologists (supplementary Figure 1). Slides were scored using a standard light microscopy technique with magnification of 100x. An interrater reliability analysis using the Kappa statistic was performed to determine consistency among the two pathologists and was excellent (Kappa 0.97; p< 0.001).

Biochemical analysis The epithelial layer of the vaginal wall biopsies was removed under a dissecting microscope. The remaining tissues were freeze dried and weighed. Samples were hydrolyzed with 6 M hydrogen chloride at 110°C for 20 h. The amount of hydroxyproline (Hyp) and proline (Pro) were determined by reverse-phase highperformance liquid chromatography (HPLC) of 9-fluorenylmethyl chloroformate(Fluka, Buchs, Switzerland) derivatized amino acids, as described by Bank et al.9 Collagen content was calculated assuming 300 residues hydroxyproline per triple helix and a molecular weight of 300,000 g/mol. The hydroxyproline/ proline ratio was determined by dividing the hydroxyproline content per mM by proline content per mM, resulting in a dimensionless ratio.

For the determination of the collagen cross-links lysylpyridinoline (LP) and

58

Matrix composition and quality

hydroxylysylpyridinoline (HP), acid-hydrolyzed samples were diluted to 50% acetic acid and injected on an HPLC system equipped with on-line sample purification on CC31 cellulose using a Prospekt solid-phase extractor (Separations, The Netherlands). The retained cross-links were eluted from the CC31 material and online chromatographed on a cation exchange column (Whatman Partisil SCX). Eluting cross-links were detected by a Jasco fluorometer (Model FP-920, Separations, The Netherlands). The PYD/DPD HPLC Calibrator (Metra, Palo Alto, CA) was used as standard. Values are expressed as total amount of residues per collagen molecule.

Statistics The primary outcome of the study was to detect a difference in the amount of total collagen (Hyp) or the amount of collagen type III in patients with and without POP. Secondary outcome measurements included a change in the amount of collagen I and IV, the amount of elastin and SMC, the concentration of non-collageneous proteins and the maturity of the cross-links within the collagen fibrils in patients with and without POP. Based on previous studies5, 10 10 women were required in the POP and in the control group to detect a difference of at least 10% in the group specific amounts of total collagen and collagen type III for a power of 80% and a 0.05 significance level, using a one way analysis of variance. The final sample size was increased with at least 10% due to the use of non parametric tests.

All statistical calculations were performed using the SPSS 19.0 statistical software (SPSS Inc, Chicago, IL, USA). Differences between continuous variables were identified using the Mann Whitney U test and differences between categorical variables were identified using Pearson’s χ2-test, or Fisher’s exact test or likelihood ratio according to the expected cell size and number of degree of freedom.

Comparison on paired samples was performed by using Wilcoxon signed-ranks test. Results are expressed as mean ± SD for continuous variables and as median and inter quartile range (IQR) for the ordinal variables. All statistical tests were twosided and differences were considered statistically significant when p-value was less than 0.05.

59

3

Chapter 3

RESULTS

3

Demographics In the present study, patient selection and matching were very strict (Table 2).

Furthermore, there was no difference in stage of menstrual cycle or in risk factors for POP such as heavy lifting, chronic obstructive pulmonary disease, or mean weight of first child and largest child between the groups. Stress urinary incontinence was more common in the POP group (p<0.004, Table 2). In the POP group the median stage of cystocele was 3 (range 2-3). Six women had a cystocele stage II, defined as a mild POP. Seven women were suffering of a severe POP with a cystocele POP-Q stage 3. The median stage of prolapse in the apical compartment and posterior compartment was 0 (range 0-1) and 1 (range 0-3) respectively. Within the control group one sample was lost before immunohistochemical analysis was performed, therefore the data of 12 controls were analyzed.

(Immuno-)histochemical analysis Examination of hematoxylin-eosin stained vaginal biopsies using standard light microscopy techniques confirmed that all layers were present in each biopsy (Figure 1). There was no evidence of inflammation in the subepithelial stroma.

When comparing the lamina propria and muscularis layer of the non-POP site of the POP group with the control group, no statistically significant differences were found with respect to the percentage of SMC, icrovessel density and cellularity (Table 3). Also no statistically significant differences were found in the extracellular matrix proteins evaluated; elastin and collagens I, III and IV. Collagen IV was only detected in the basement membrane in all samples. Precervical tissue of women with POP and precervical tissue of controls seem to maintain a comparable amount and distribution of the different components of the extracellular matrix.

A comparison between the POP site with the non-POP site within the same patient, showed a significantly higher percentage of SMCs in the muscularis layer of the POP site (26.85% vs 19.47%, p < 0.05) (Table 3 and Figure 2). To determine whether the stage of POP influences the different components of the ECM, the case group was divided into a mild and severe POP group. Although no differences were found, the amount of desmin at the POP site in the severe POP group was higher compared to the mild group (mean 26.13% versus 23.44% respectively). A similar pattern was seen for the amount of elastin with a mean 2.27% in the mild and 3.85% in the severe group. No differences were detected in the amount of collagen type I and III between the POP site and the non-POP site within the same patient.

There was a tendency towards an increase of collagen III in the lamina propria and

60

Matrix composition and quality

Table 2. Clinical characteristics.

Characteristics

Control (n=12)

Case (n=13)

p-value

44.5 ± 5.0

42.9 ± 6.0

0.512

24.5 ± 1.7

27.2 ± 6.0

0.574

2.2 (1-3)

2.2 (1-4)

0.852

2.2 (1-3)

2.2 (1-4)

0.820

4 (36%)

4 (31%)

1,000

Never smoked

3 (25%)

4 (31%)

1.000

Current

4 (33%)

3 (23%)

0.673

Previous

5 (42%)

6 (46%)

0.821

Until surgery

4 (33%)

4 (31%)

1.000

Never used)

1 (8%)

1 (8%)

1.000

1 (8%)

9 (69%)

0.004

Anterior

0 (0)

3 (2-3)

Apical

0 (0)

0 (0-1)

Posterior

0 (0)

1 (0-3)

a

Age (y)

2 a

BMI (kg/m )

Parity (births)

b

Vaginal delivery Assisted vaginal delivery

c

d d d d e

c

Smoking status

Oral contraception use

e e f

c

Stress urinary incontinence POP-Q stage of prolapse

c

e e e

b

a

b

c

Data presented as mean ± SD , median (IQR) or number of patients (%) . Mannd e f Whitney ; Fisher's exact ; Chi-square .

61

3

Chapter 3

Figure 1. Histological features of the anterior vaginal wall.

Biopsies from the anterior vaginal wall are full thickness biopsy specimens represented by four layers. The vaginal mucosa consisted of squamous epithelium (epi) and the underlying lamina propria (lp).

The remaining vaginal wall, approximately 70-75% of the total vaginal wall thickness consisted of muscularis and adventitia. Actual scan resolution (effective pixel size in the sample plane) at 20x is 0.23Âľm. The blue bar represents 200Âľm.

3

muscularis layer of the POP site compared to the non-POP site of the same patient.

This pattern was more pronounced in severe POP compared to mild POP patients.

Biochemical analysis Biochemical analysis showed that collagen content (expressed as collagen per dry weight) did not differ between the different harvesting sites within POP patients or between POP patients and healthy controls. This was confirmed by the observation that the hydroxyproline per proline ratio, which represents the amount of collagen per total protein, did not change either. However, a significant increase in collagen cross-linking (expressed as total amount of pyridinolines per collagen molecule) in the prolapsed tissue compared to non-prolapsed tissue within the same women was found (p = 0.047). Such differences were not seen between non-POP site and the age matched healthy controls (Table 4).

62

Matrix composition and quality

Table 3. (Immuno-)histochemical analysis of the anterior vaginal wall.

A Specimen muscularis layer

B

Control

C

A-B

Case non-POPsite Case POP site

B-C

p-value

c

p-value

d

Desmin staining a

Mean % smooth muscle cells

20.99 (7.34)

19.47 (7.73)

26.85 (6.13)

0.553

0.016*

925 (374)

0.908

0.583

47 (12)

0.402

0.844

3.04 (2.97)

0.458

0.859

CD31 staining N nuclei

a

922 (233)

955 (554)

a

51(14)

54 (40)

a

2.17 (1.12)

2.44 (1.51)

4 (4-4)

4 (4-4)

4 (4-4)

1.000

1.000

2 (1.75 -2)

2 (2-2)

2 (2-2)

0.486

0.157

2 (2-2)

2 (1-2)

2 (2-2)

0.254

0.180

1 (1-1)

1 (1-1)

1 (1-1)

0.204

0.546

N microvessels EvG staining Mean % elastin

3

Collagen I Connective tissue Muscularis

b

b

Collagen III Connective tissue Muscularis

b

b

(Immuno-)histochemical analysis comparing different components of the extracellular matrix in the muscularis layer of the precervical anterior vaginal wall (non-POP site) and the prolapsed anterior vaginal wall (POP site) in women with POP and controls. A-B: precervical tissues of women with POP and precervical tissues of controls seem to maintain a comparable amount and distribution of the different components of the extracellular matrix. B-C: comparison between the POP site with the non-POP site within the same patient, showed a significantly higher percentage of SMC in the * a b c muscularis layer of the POP site ( p < 0.05). Data presented as mean (SD) or median (IQR) ; Mann-Whitney test ; d Wilcoxon signed-ranks test .

Table 4. Biochemical analysis of the anterior vaginal wall.

A

B

C

A-B

B-C a

p-value

b

Control

Case non POP site

Case POP site

p-value

% Collagen compared to dry weight

53 (8)

46 (10)

46 (8)

0.068

0.972

Hydroxyproline/proline ratio

0.57 (0.28)

0.62 (0.19)

0.59 (0.18)

0.136

0.117

HP+LP/triple helix

0.29 (0.09)

0.33 (0.08)

0.38 (0.06)

0.339

0.047*

Biochemical analysis comparing the controls and non-POP site with the POP site within the same women with POP. A-B: comparison control group versus case group non POP site. B-C: comparison case group non POP site versus case group POP a b site. All values are presented in mean (SD). Mann- Whitney test ; Wilcoxon signed-ranks test ; p< 0.05*.

63

Chapter 3

3

Figure 2. Smooth muscle cells in the anterior vaginal wall.

A-C full thickness anterior vaginal wall biopsy of respectively a control (A), non POP site (B) and the POP site of a POP patient (C) with corresponding magnification of the muscularis layer (D-F). Desmin positive cells as a marker for smooth muscle cells are colored brown (arrows). In women with POP (C+F) smooth muscle cells are more tightly packed, better organised in fibers and more oriented in a longitudinal direction at the prolapsed site compared to the precervical (non-prolapsed site) anterior vaginal wall of the same patient (B+E). In controls smooth muscle cells are fewer in number and poorly organised (A+D). Morphometric analysis of the amount of smooth muscle cells shows a increased amount of desmin positive cells at the prolapse site (G) (*p =0.016). Actual scan resolution (effective pixel size in the sample plane) at 20x is 0.23Âľm. The blue bar represents 200Âľm.

64

Matrix composition and quality

COMMENT Our results show that the non-POP tissue in the vaginal wall of POP patients does not differ in any of the parameters evaluated from the same tissue in healthy controls.

However, there were marked differences observed between the prolapsed tissue of a POP-patient, compared to non-prolapsed tissue of the same patient. There was a significant increase in mature pyridinoline cross-links in collagen molecules, and in the number of SMCs in the muscularis layer of the anterior vaginal wall. In addition, there was a tendency towards a higher amount of collagen III and elastin.

No differences were found in the amount of collagens I and IV. An increase in mature collagen cross-links has also been reported by Jackson et al.11 Pyridinoline cross-links are the major type of mature cross-links in collagen in the fascia of the anterior vaginal wall.3,4 An increase in cross-link density will result in slower metabolizing collagens, making them susceptible to non-enzymatic glycation, producing advanced glycation endproducts (AGEs). Some of those AGEs, such as pentosidine, are found to be increased in women with POP and inhibit the turnover of collagen resulting in a more glycated collagen which is brittle and susceptible for rupture.11 Furthermore, an increased cross-linked collagen also makes tissues stiffer and the anterior vaginal wall from premenopausal women with POP has been reported to be stiffer than tissues from their healthy counterparts.12 The tendency we found towards a higher amount of collagen III relative to the stronger type I collagen in the anterior vaginal wall of patients with POP is thought to result in thinner collagen fibers with correspondingly diminished biomechanical strength. The increase in collagen III expression in patients with POP, in combination with an increased activation of matrix metalloproteinase-9 (not analyzed in this current study) is typical of tissues that are remodeling after injury or tissues that are remodeling to adapt to a progressively increasing mechanical load.5,13,14 We demonstrate that the amount of SMCs is significantly increased in the prolapsed site and not in the unaffected site of the same patient. This increase in SMCs in the prolapsed tissue may indicate an accommodation of the connective tissue to the increased permanent mechanical load and stretch on the vaginal wall tissue caused by the prolapse. Mechanical forces induce a variety of responses in SMCs depending on the organ, the animal species, the nature of the mechanical forces, and the extent of the stretch.15 In uterine smooth muscle, stretch is the primary stimulus for muscle hypertrophy and increase in force generating capacity.16 In bladder and intestinal smooth muscle, stretch induces an initial response

65

3

Chapter 3

3

that consists of hyperplasia and hypertrophy, but the force generating capacity decreases.17 Data on the response of the vaginal wall ECM to increased mechanical load or to factors that modify this response are lacking. Recent studies focus on the effect of decrease in mechanical load due to the use of synthetic meshes. Liang et al.18 showed that vaginal wall tissue degenerates as a result of the decrease in loading, also known as stress shielding. Tissue degeneration that occurs in this context has been shown to be the result of a deregulation of key structural proteins such as collagens, elastin, and glycosaminoglycans, as well as SMCs19,20. A decrease in vaginal SMCs following vaginal implantation with a polymeric mesh is associated with a loss of smooth muscle contractility.21 It is clear that all tissues throughout the body depend on a certain amount of load to maintain their structure. Loss of load as well as increase of load leads to changes in the cellular and molecular responses. An increase of the number of SMCs at the site of the POP together with an increase in pyridinolines, suggests that the tissue is trying to compensate for a reduced tissue strength. After injury to levator ani muscles and/or the connective tissue attachments at child birth, transient increases in intra-abdominal pressure are directly transmitted to the vaginal wall and its increased mechanical load to the vagina results in tissue stretch.22 Mechanical loading has been shown to change the remodeling of tissues by inducing matrix metalloproteinases produced by the vaginal fibroblasts. Indeed vaginal connective tissue fibroblasts are mechanosensitive with increased enzymatic activity.23, 24 In most cases, the vaginal tissues are able to recover from those rather acute events by proper tissue remodeling. However, when repair mechanisms fail, these patients enter a chronic phase. In this phase, the vaginal wall tries to cope with the increasing biomechanical pressure of the prolapsed tissues organs. This accommodation may be induced by the fibroblastsâ&#x20AC;&#x2122; reaction to increasing continuous mechanical stretch. The changes seen in the connective tissues in the anterior vaginal wall more likely reflect secondary effects of the prolapse on the tissue rather than a host predisposition to prolapse.

Due to our very strict patient selection with only Caucasian, premenopausal women and tightly matched controls, our study size was limited to the minimum according to the power calculation. The fact that we find significant differences underscores that our observations may pinpoint a general phenomenon occurring in POP. Also, one has to realize that this study was designed to examine the connective tissue of the anterior vaginal wall only. As the composition of the connective tissue of the vagina may vary throughout the vagina our data cannot be compared with

66

Matrix composition and quality

connective tissue of the posterior vaginal wall nor with ligaments or other tissues responsible for the level I support.

Our current findings cannot resolve the important questions on the etiology and or pathophysiology of POP. With our current approach with the women with POP being her own control we find that the changes in connective tissue of the prolapsed vaginal wall are an acquired effect, rather than an intrinsic defect in the connective tissue. Further studies investigating the effect of increased mechanical loading and stretch on vaginal tissue at different anatomic levels of support as well as the molecular mechanism resulting in the changes seen in the different components of the extracellular matrix are needed for further understanding of pelvic organ prolapse. This will be of utmost importance in the development of new treatment strategies.

Supplementary Figure 1. Scoring system used for immunohistochemical stainings for collagen.

A scoring system with four grades was used to evaluate the collagen type 1 and 3 stains (positive labelling brown colour) A-D with an increasing amount of collagen in the subepithelial connective tissue layer ranging from 1 (absent) to 4 (strong). E-H with an increasing amount of collagen in the muscularis layer ranging from 1 (absent) to 4 (strong). Magnification 10x objective. The blue bar represents 100Âľm.

67

3

Chapter 3

REFERENCE LIST

3

1.

2.

3.

4.

5.

6.

7.

8.

9.

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

Jelovsek JE, Maher C, Barber MD. Pelvic organ prolapse. Lancet 2007;369:1027-38.

Denman MA, Gregory WT, Boyles SH, Smith V, Edwards SR, Clark AL. reoperation 10 years after surgically managed pelvic organ prolapseand urinary stress incontinence.

Am J Obstet.Gynecol 2008: 198(5); 555.1-5 Kerkhof MH, Hendriks L, Brolmann HAM. Changes in connective tissue in patients with pelvic organ prolapse--a review of the current literature. Int.Urogynecol.J.Pelvic.Floor.Dysfunct. 2009;20:461-74.

Chen B, Yeh J. Alterations in connective tissue metabolism in stress incontinence and prolapse.

J.Urol. 2011;186:1768-72.

Moalli PA, Shand SH, Zyczynski HM, Gordy SC, Meyn LA. Remodeling of vaginal connective tissue in patients with prolapse. Obstet.Gynecol. 2005;106:953-63.

Bump RC, Mattiasson A, Bo K et al. The standardization of terminology of female pelvic organ prolapse and pelvic floor dysfunction. Am.J.Obstet.Gynecol. 1996;175:10-17:10-17.

Jean-Charles C, Rubod C, Brieu M, Boukerrou M, Fasel J, Cosson M. Biomechanical properties of prolapsed or non-prolapsed vaginal tissue: impact on genital prolapse surgery.

Int.Urogynecol.J. 2010;21:1535-38.

Hadi AM, Mouchaers KTB, Schalij I et al. Rapid quantification of myocardial fibrosis: a new macrobased automated analysis. Cell Oncol. 2011;34:343-54.

Bank RA, Beekman B, Verzijl N, de Roos JA, Sakkee AN, TeKoppele JM. Sensitive fluorimetric quantitation of pyridinium and pentosidine crosslinks in biological samples in a single highperformance liquid chromatographic run. J.Chromatogr.B Biomed.Sci.Appl. 1997;703:37-44.

Moalli PA, Talarico LC, Sung VW et al. Impact of menopause on collagen subtypes in the arcus tendineous fasciae pelvis. Am.J.Obstet.Gynecol. 2004;190:620-27.

Jackson SR, Avery NC, Tarlton JF, Eckford SD, Abrams P, Bailey AJ. Changes in metabolism of collagen in genitourinary prolapse. Lancet 1996;347:1658-61.

Feola A, Duerr R, Moalli P, Abramowitch S. Changes in the rheological behavior of the vagina in women with pelvic organ prolapse. Int.Urogynecol.J. 2013;24:1221-27.

Dviri M, Leron E, Dreiher J, Mazor M, Shaco-Levy R. Increased matrix metalloproteinases-1,-9 in the uterosacral ligaments and vaginal tissue from women with pelvic organ prolapse.

Eur.J.Obstet.Gynecol.Reprod.Biol. 2011;156:113-17.

Goepel C. Differential elastin and tenascin immunolabeling in the uterosacral ligaments in postmenopausal women with and without pelvic organ prolapse.

Acta Histochem. 2008;110(3):204-9.

Boreham MK, Wai CY, Miller RT, Schaffer JI, Word RA. Morphometric analysis of smooth muscle in the anterior vaginal wall of women with pelvic organ prolapse.

Am.J.Obstet.Gynecol. 2002;187:56-63.

Word RA, Stull JT, Casey ML, Kamm KE. Contractile elements and myosin light chain phosphorylation in myometrial tissue from nonpregnant and pregnant women. J.Clin.Invest 1993;92:29-37.

Gabella G. Hypertrophy of visceral smooth muscle. Anat.Embryol. 1990;182:409-24.

Liang R, Abramowitch S, Knight K et al. Vaginal degeneration following implantation of synthetic mesh with increased stiffness. BJOG. 2013;120:233-43.

Gamble JG, Edwards CC, Max SR. Enzymatic adaptation in ligaments during immobilization.

Am.J.Sports Med. 1984;12:221-28.

Amiel D, Woo SL, Harwood FL, Akeson WH. The effect of immobilization on collagen turnover in connective tissue: a biochemical-biomechanical correlation. Acta Orthop.Scand. 1982;53:325-32.

Feola A, Abromowitch S, Jallah Z et al. Deterioration in biomechanical properties in the vagina following implantation of high-stiffness prolapse mesh. BJOG. 2013;120(2): 224-32.

O'Dell KK, Morse AN, Crawford SL, Howard A. Vaginal pressure during lifting, floor exercises, jogging, and use of hydraulic exercise machines.

68

Matrix composition and quality

23.

24.

Int.Urogynecol.J.Pelvic.Floor.Dysfunct. 2007;18:1481-89.

Zong W, Jallah ZC, Stein SE, Abramowitch SD, Moalli PA Repetitive mechanical stretch increases extracellular collagenase activity in vaginal fibroblasts.

Female Pelvic Med. Reconstr. Surg. 2010;16:257-62.

Ruiz-Zapata AM, Kerkhof MH, Zandieh-Doulabi B, Brรถlmann HA, Smit TH, Helder MN. Fibroblasts from women with pelvic organ prolapse show differential mechanoresponses depending on surface substrates. Int.Urogynecol.J. 2013;24:567-75.

3

69

4 Micro-array analysis of the anterior vaginal wall in pelvic organ prolapse M.H. Kerkhof A.M. Ruiz-Zapata B. Zandieh-Doulabi H.A.M. Brรถlmann Th.H. Smit S. Vosslamber M.N. Helder Submitted

Chapter 4

ABSTRACT Objective: Pelvic organ prolapse (POP) is a common multifactorial disease in a heterogeneous population of women. Due to this heterogeneity, the underlying molecular mechanisms contributing to the pathogenesis of POP are still unclear.

We sought to identify POP related dysregulated pathways by comparing gene expression profiles of prolapsed and non-prolapsed anterior vaginal wall tissues within the same patient.

4

Study design: Biopsies were collected from 12 premenopausal women undergoing prolapse surgery (cystocele POP-Q stage ≥ 2). A full thickness anterior vaginal wall sample was taken from the POP site during anterior colporrhaphy. An additional sample was taken from the non-prolapsed apex of the anterior vaginal cuff.

Micro-array analysis was performed using whole genome GE 4x44K microarrays.

Beside a paired significance analysis of micro-array (SAM), also cluster analysis of differentially expressed genes were performed.

Results: In both the SAM and the supervised cluster analysis, a set of genes could be identified as being specific for the ‘diseased’ prolapsed anterior vaginal wall.

Ontology analysis revealed that these genes were involved in signal transduction and transcriptional regulation, mainly AP-1 and FRA-related pathways. Cluster analysis showed that patients could be divided in an ‘ECM/ integrin' pathway subgroup and a ‘muscle cell/ contraction' pathway subgroup. This division was already present in the non-prolapsed tissue. Quantitative PCR confirmed results.

Conclusion: Prolapsed anterior vaginal wall tissue shows dysregulation of generic pathways related to signal transduction and transcription. We provided evidence for inter-individual differences in both non-prolapsed and prolapsed tissues reflecting either ECM/integrin or muscle cell/contraction dysfunctioning, potentially implying different failure mechanisms leading to POP.

BRIEF SUMMARY Prolapsed anterior vaginal wall tissues show dysregylation of signal transduction and translational pathways due to mechanical load. Two different biological processes in prolapsed and non-prolapsed connective tissue reflect variance between women with POP.

72

Gene expression profiles

INTRODUCTION With the ageing population in the Western world, pelvic organ prolapse (POP) is a serious public health problem, affecting the quality of life of millions of women.

Women with POP suffer from chronic pelvic pain and pressure, urinary and fecal incontinence, sexual dysfunction and social isolation.1;2 Although pregnancy and vaginal childbirth are considered the major causes for the development of POP, these risk factors do not fully explain the origin and progression of all cases of POP. In fact POP has been observed in nulliparous women whereas on the other hand, many multiparous women do not develop any pelvic floor dysfunction.3;4 Other risk factors like physiological ageing and menopause, factors associated with elevated intra-abdominal pressure (e.g., obesity, chronic constipation and/ or coughing), connective tissue disorders, ethnic background, family history and genetic predisposition, are also thought to be responsible for the development of POP.5;6 This extensive list of risk factors illustrates that POP should be considered a multifactorial disease; many different factors cause or contribute to the development and progression of POP. Inherent to any multifactorial condition in humans, the bias is introduced by individual genetic variation, lifestyle differences and the influence of external environmental factors. Due to this heterogeneity, the underlying affected biological processes contributing to the pathogenesis of POP are still unclear.

Over the past decades, the molecular and biochemical characteristics of POP have been studied extensively. The main observation is a weakening of the connective tissue at the pelvic support level; the ligaments, endopelvic fascia and the levator muscle.7 One hypothesis is that a parturition-related injury, i.e. denervation of the pelvic floor leads to weakning of the levator ani muscles, which in turn results in marked stress on the uterosacral, cardinal ligaments and endopelvic fascia. This may ultimately lead to secondary failure of the fascia and the development of prolapse.8-10 Other studies suggest a primary defect in connective tissue with failure of the fascia may play a role. Conclusive evidence that POP is the result of a defect in the pelvic floor musculature, connective tissue, or a combination of the two is currently lacking. Moreover, there is an ongoing discussion whether the changes in the different components of the connective tissues in POP are a cause or are only an effect of POP.11 A better understanding of the pathophysiology of POP is clinically relevant for identifying women at risk, as well as for the development of interventional therapies.

The advances of micro-array technology offer new opportunities to study molecular

73

4

Chapter 4

mechanisms involved in different physiological and pathophysiological conditions.

The number of microarray studies described in literature with respect to POP is low. These studies have addressed gene expression changes related to POP, focusing on the uterosacral or round ligaments in uterine prolapse in pre- and post menopausal women.12-15 However, due to a lack of standardization of the sample sites and collection technique, as well as the mixed demographic characteristics of the studypopulation regarding menopausal status, age, POP-stage and type, ethnicity and life style, the potential molecular mechanisms behind POP have not been identified yet.

4

The aim of the current study was to identify POP related dysregulated pathways by comparing gene expression profiles of prolapsed and non-prolapsed anterior vaginal wall tissues from women with cystocele, by means of wholegenome microarrays. The study design followed a novel approach where each premenopausal POP patient was her own control to reduce the bias caused by possible differences between patients.

MATERIALS AND METHODS Patient selection This observational study of premenopausal Caucasian women recruited and enrolled patients from the uro-gynecology clinic of the Department of Obstetrics and Gynecology of the Kennemer Gasthuis, Haarlem, The Netherlands between March 2009 until March 2011. Women undergoing vaginal reconstructive pelvic surgery of the anterior vaginal compartment because of cystocele, POP-Q stage 2 or more were included. Exclusion criteria were: previous pelvic surgery, autoimmune and connective tissue disease, history of endometriosis, history or presence of cancer, adhesions or scarring at the biopsy site, diabetes, chronic inflammatory disease, chronic infections and steroid use. Signs of POP were recorded during the pelvic examination by one and the same urogynecologist (MHK) and were described according to the International Continence Society Pelvic Organ Prolapse Quantification (POP-Q).16 Standardized demographic and clinical information was recorded and stored in a dedicated database. The study was approved by the medical ethical committee and all patients signed informed consent before participation.

Tissue collection and histology Tissue collection and histology was performed as described in Kerkhof et al.17

74

Gene expression profiles

Approximately 1 cm2 of full-thickness anterior vaginal (midline) wall biopsy was excised from the vaginal cuff after vaginal hysterectomy (non-POP site). A second full thickness anterior vaginal wall biopsy was taken from the POP site during anterior colporrhaphy (POP-Q, point Ba). All biopsies were large enough to perform (immuno-)histochemistry. Directly after excision, the tissues were divided in two portions; one portion was immediately frozen in liquid nitrogen and stored at -80˚C and the other portion was embedded in paraffin for microscopic evaluation.

The paraffin-imbedded samples were cut into 3 µm sections and stained with hematoxylin and eosin. A pathologist, blinded to the source of the samples confirmed that all samples represented full thickness vaginal wall and were not portions of the cervix or uterus. The menstrual phase was determined by histological evaluation of the endometrium.

Microarray analysis RNA extraction The snap frozen tissues were de-epitheliased and total RNA was extracted with the Trizol reagent according to the manufacturer’s protocol (http://tools. lifetechnologies.com/content/sfs/manuals/trizol reagent.pdf). RNA integrity and concentrations were measured on a Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA, USA) and Nanodrop spectrophotometer ND-1000 (Fisher Scientific, Waltham, MA, USA). All samples were of good quality with an RNA Integrity Number (RIN-value) between 6.3-8.6. cRNA synthesis and probe labeling 200 ng total RNA per sample was used as input for amplification and labeled with the Low Input Quick Amp Labeling kit (Agilent Technologies, Palo Alto, CA, USA), including control spikes according to the manufacturer’s guidelines. Labeled RNA was purified using the RNeasy Mini Kit (QIAGEN Ltd., Venlo, the Netherlands) yielding 4.7 µg or more of labeled cRNA and specific activities greater than 13.2 pg Cye3 dye/µg cRNA and 12.0 pg Cy5 dye/µg cRNA. Hybridization and scanning Labeled cRNA was hybridized onto whole human genome GE 4x44K microarrays according to the manufacturer’s protocol (Agilent Technologies, Palo Alto, CA, USA). Scanning was performed using a microarray scanner G2505C (Agilent Technologies) and data were feature-extracted using Feature Extraction Software (v9.5) according to the manufacturers protocols (Agilent Technologies). Outlier features on the array were flagged by the software.

75

4

Chapter 4

Data pre-processing All analyses of the gene expression microarray data were done within the R statistical software, using the Limma-package. Preprocessing of the gene expression data comprised of RMA background correction, loess within-array normalization and A-quantile between-array normalization.18;19 Obtained expression values were log2 transformed. The microarray data have been submitted to the National Center for Biotechnology Information (NCBI) Gene Expression Omnibus database under accession number GSE53868, http://www.ncbi.nlm.nih.gov/geo/info/linking.html.

4

Quantitative real time PCR To confirm the microarray data, seven differentially expressed genes were chosen for quantitative real time polymerase chain reaction (RT-PCR). Total RNA samples used for microarray analysis with a final concentration of 250 ng/ml were reverse-transcribed using SuperScript VILO cDNA synthesis kit (Life technologies, Paisley, UK). Gene expression of collagen 1α1 (COL1α1), collagen 3α1 (COL 3α1), alpha smooth muscle actin (ACTA2), desmin (DES), interleukin 6 (IL-6), chemokine receptor type 4 (CXCR4) and tumor necrotic factor alpha (TNF-α) were normalized to the housekeeping genes, tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide (Ywhaz), hypoxanthineguanine phosphoribosyltransferase (HPRT) and human ubiquitin C (hUBC). Genes were evaluated using the primers listed in table 1 (Life technologies, Paisley, UK), with the SYBR Green Reaction Kit and measured by RT-PCR in a Light Cycler 480 device following suppliers’ specifications (Roche). Gene expression levels were normalized using a factor derived from the equation (Ywhaz x HPRT x hUBC)^(1/3).

Crossing points were assessed using the Light Cycler software (version 4) and plotted versus serial dilutions of cDNA derived from a human universal reference total RNA (Clontech Laboratories Palo Alto, CA, USA).

76

Gene expression profiles

Table 1. Primer sequences used for RT-PCR. Target gene

Oligonucleotide sequence

Annealing temperature (°C)

Product Size (bp)

Col 1α1

Forward Reverse

5’ TCCAACGAGATCGAGATCC 3’ 5’ AAGCCGAATTCCTGGTCT 3’

57

191

Col 3α1

Forward Reverse

5’ GATCCGTTCTCTGCGATGAC 3’ 5’ AGTTCTGAGGACCAGTAGGG 3’

56

279

TNF-α

Forward Reverse

5’ AGAGGGCCTGTACCTCATCT 3’ 5’ AGGGCAATGATCCCAAAGTAG 3’

56

315

IL-6

Forward Reverse

5’ ACAGCCACTCACCTCTTCA 3’ 5’ ACCAGGCAAGTCTCCTCAT 3’

56

207

CXCR4

Forward Reverse

5' GGCCCTCAAGACCACAGTCA 3' 5' TTAGCTGGAGTGAAAACTTGAAG 3'

57

352

ACTA2

Forward Reverse

5’ CCTGACTGAGCGTGGCTATT 3’ 5’ GATGAAGGATGGCTGGAACA 3’

56

206

Desmin

Forward Reverse

5’ TGTGGAGATTGCCACCTAC 3’ 5’ CGTGTCTCGATGGTCTTGAT 3’

57

165

Ywhaz

Forward Reverse

5’ GATGAAGCCATTGCTGAACTTG 3’ 5’ CTATTTGTGGGACAGCATGGA 3’

56

229

HPRT

Forward Reverse

5’ GCTGACCTGCTGGATTACAT 3’ 5’ CTTGCGACCTTGACCATCT 3’

56

260

hUBC

Forward Reverse

5’ GCGGTGAACGCCGATGATTAT 3’ 5’ TTTGCCTTGACATTCTCGATGG 3’

56

202

Col1α1, α1(I)procollagen; Col3α1, α1(III)procollagen; TNF-α, tumor necrotic factor-α; IL-6, interleukin 6; CXCR4, chemokine receptor type 4; ACTA2, alpha smooth muscle actin; DES, desmin; Ywhaz, tyrosine 3monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide; HPRT, hypoxanthineguanine phosphoribosyltransferase; hUBC, human ubiquitin C.

77

4

Chapter 4

4

Statistical analysis Statistical analysis of the microarray data was performed using Significance Analysis of Microarray (SAM), Stanford University, CA, version 3.09.20 Two class paired analysis using SAM at a false discovery rate (FDR) of less than 1% was applied to search for single genes that were significantly differentially expressed between the POP site and the non-POP site. Cluster analysis was used for the categorization of coordinately differentially expressed genes which were selected by filtering for genes with at least two observations with an absolute of more than 2 and an absolute difference between the maximum and minimum value greater or equal to two. Selected genes were clustered using average linkage clustering.21 Tree View was used to visualize differentially expressed genes (Eisen Software http://rana. lbl.gov/EisenSoftware.htm). Molecular Signatures Database (MSigDB database v4.0 updated May 31, 2013 GSEA/MSigDB web site v4.01, reference Subramanian, Tamayo, et al. 2005, PNAS 102, 15545-15550) was used to compute the overlap of significantly up- and down regulated genes, as well as clusters of genes with gene sets encoding canonical pathways, derived from BIOCARTA (www.biocarta.com), KEGG (www.genome.jp/kegg/pathways.html) and REACTOME (www.reactome. org).

Correlation analyses were performed using Graphpad Prism 4 software. First, data was tested for normal distribution. For normally distributed data, a Pearson correlation was used. A Spearman rank correlation was calculated in case of nonparametric distribution of the data. Baseline characteristics of POP patients were expressed as mean (SD) or median (range), where appropriate. P values less than 0.05 were considered significant.

RESULTS Patient demographics We recruited 12 premenopausal Caucasian women with pelvic organ prolapse, mean age 42.6 ± 6.1 years, average parity 2.3 (0.8) and a mean body mass index (BMI) of 27.2 ± 5.9. All patients had a cystocele POP-Q stage ≥ 2. Five women had a cystocele stage 2, regarded as a mild POP, seven women suffered from severe cystocele stage > 2 (Table 2). The median stage of prolapse in the apical compartment was 0 (range 0-1) and in the posterior compartment 1 (range 0-3).

All women underwent vaginal pelvic reconstructive surgery for the cystocele and tissue from the POP as well as from the non-POP site could be obtained.

78

Gene expression profiles

Table 2. Patient characteristics.

Characteristics

Case (n=12)

a

Age (y)

42.6 ± 6.1 2 a

BMI (kg/ m )

Parity (births)

27.2 ± 5.9 b

2 (1-4)

Vaginal delivery

b

2 (1-4)

Assisted vaginal delivery SUI (%)

c

3 (25%)

c

8 (67%)

Family history of prolapse (%) POP-Q stage of prolapse

c

7 (58%)

b

Anterior

2 (2-3)

Apical

0 (0-1)

Posterior

1 (0-3)

4

c

Menstrual phase

Proliferative phase

7 (58%)

Secretory phase

5 (42%) a

b

Data presented as mean ± SD , median (range) or number c of patients (%) .

Micro-array analysis Differentially regulated processes between POP and non-POP tissues In order to identify POP-related dysregulated molecular processes, gene expression profiles of the prolapsed anterior vaginal wall and the non-prolapsed precervical anterior vaginal wall were compared using paired Significant Analysis of Microarrays (SAM). This analysis revealed 984 significantly different expressed genes with a FDR < 1%; 277 genes were up regulated and 707 down regulated in POP versus non-POP tissue. Ontology analysis of the upregulated genes at the prolapsed anterior vaginal wall revealed a significant enrichment of more than 20 pathways, among which activating transcription factor 2 (ATF2), transforming

79

Chapter 4

growth factor beta (TGF-Ă&#x;) signaling, FRA and activated protein -1 (AP-1) pathways were the most significant (Table 3). Down regulated genes were involved in generic transcription pathway.

Unpaired SAM analysis showed 86 up-regulated and 55 down regulated genes with a FDR < 1%. These genes were involved in the same pathways as in the paired analysis.

Inter-individual variability at the molecular level in POP women Although the above identified pathways are relevant for disease, we found no differences in pathways related to collagen, elastin or SMCs between the POP and the non-POP anterior vaginal wall. Since these processes are believed to play a major role in the development of POP we questioned whether this could be

4

Table 3. Paired statistical analysis of micro-array (SAM) POP versus non-POP tissue.

Upregulated pathways Gene set name

# Genes in gene set (K)

# Genes in overlap (k)

k/K

p-value

FDR q-value

Pid_atf2_pathway

59

6

0.1017

1.79e-7

1.65e-4

Reactome_signaling_by_tgf_beta_receptor_complex

63

6

0.0952

2.66e-7

1.65e-4

Pid_fra_pathway

37

5

0.1351

4.6e-7

1.65e-4

Pid_ap1_pathway

70

6

0.0857

5.01e-7

1.65e-4

Reactome_hemostasis

466

12

0.0258

6.92e-7

1.83e-4

Kegg_chronic_myeloid_leukemia

73

5

0.0685

1.41e-5

3.09e-3

Kegg_mapk_signaling_pathway

267

8

0.0300

1.77e-5

3.15e-3

Reactome_transcriptional_activity_of_smad2_smad3_smad4_heterotrimer

38

4

0.1053

1.91e-5

3.15e-3

Reactome_platelet_activation_signaling_and_aggregation

208

7

0.0337

2.87e-5

3.43e-3

Kegg_hypertrophic_cardiomyopathy_hcm

85

5

0.0588

2.95e-5

3.43e-3

Biocarta_eryth_pathway

15

3

0.2000

3.1e-5

3.43e-3

Kegg_tgf_beta_signaling_pathway

86

5

0.0581

3.12e-5

3.43e-3

Biocarta_tgfb_pathway

19

3

0.1579

6.52e-5

6.15e-3

Reactome_activated_ampk_stimulates_fatty_acid_oxidation_in_muscle

19

3

0.1579

6.52e-5

6.15e-3

Pid_tgfbrpathway

55

4

0.0727

8.35e-5

7.35e-3

Biocarta_nfat_pathway

56

4

0.0714

8.97e-5

7.4e-3

Reactome_signaling_by_hippo

22

3

0.1364

1.03e-4

7.97e-3

Biocarta_ctcf_pathway

23

3

0.1304

1.18e-4

8.18e-3

Reactome_interaction_between_l1_and_ankyrins

23

3

0.1304

1.18e-4

8.18e-3

Kegg_adipocytokine_signaling_pathway

67

4

0.0597

1.81e-4

1.19e-2

Gene set name

# Genes in gene set (K)

# Genes in overlap (k)

p-value

FDR q-value

Reactome_generic_transcription_pathway

352

33

0.0938

0,00e+00

0,00e+00

Kegg_limonene_and_pinene_degradation

10

3

0.3000

6.6e-5

Downregulated pathways

80

k/K

4.36e-2

Gene expression profiles

a consequence of interindividual variation of molecular mechanisms involved in POP. Paired analysis might level-out such interindividual differences. To gain more insight in these potential differences, a hierarchical cluster analysis was performed.

Differentially expressed genes were clustered based on similar expression profiles.

A number of 2502 differentially regulated genes were categorized into three clusters representing different biological themes (Figure 1). In line with the SAM analysis, a cluster of 625 differentially expressed genes showed marked variation between POP and non-POP tissue (indicated by the light blue bar at the right side of the Figure 1). Pathway analysis of these genes revealed pathways related to cytokine and chemokine receptor pathway, AP-1, FRA and ATF2 pathway and nuclear factor of activated T cells (NFAT) signaling pathway as shown in the SAM analysis. Also peptide ligand binding receptor pathway, class A1 rhodopsinlike receptor pathway, GPRC ligand binding pathway and IL6 pathway were upregulated in the prolapsed tissues.

Additionally, two clusters of genes (1073 genes and 804 genes in the dark blue and yellow marked clusters, respectively) reflected variance between patients. Pathway analysis of the genes in the dark blue cluster showed that these genes belong to the processes of ECM organization and collagen formation, the integrin 1 pathway, ECM receptor, cytokine-cytokine receptor interaction and cell adhesion pathways.

The yellow cluster represents genes involved in smooth and striated muscle contraction, focal adhesion and actin cytoskeletal regulation.

This cluster analysis suggests that besides a POP specific gene expression profile, as was also shown in the paired SAM analysis, at least two clusters of genes reflect variance in molecular processes between individuals. A subgroup of patients showed increased expression of genes related to the ECM/ integrin pathway cluster whereas another subgroup of patients was characterized by increased expression of genes related to muscle cell contraction. To verify whether this variability in elevated expression for these pathways was already seen in the non-prolapsed precervical anterior vaginal wall tissue, we additionally performed an unsupervised cluster analysis of non-POP expression profiles. This analysis indeed divided the patient group in two subgroups of patients. One subgroup was characterized by elevated expression of genes involved in the ECM organization, integrin-1 and collagen formation pathways. The other subgroup was characterized by genes like myosin light chain (MYLK), myosin heavy chain 2 and 3 (MYH2 and 3), and desmin (DES) which are also involved in smooth muscle contraction and actin cytoskeleton pathways (Figure 2A). Analysis of the gene expression of Col1α1 and DES – as the representative genes for the ECM cluster and muscle cell cluster respectively –

81

4

Chapter 4

4

Figure 1. Cluster diagrams of genes that were differentially expressed between precervical non-prolapsed and the prolapsed anterior vaginal wall tissue of 12 premenopausal Caucasian women with POP. Supervised (one-way) hierarchical cluster analysis of gene expression levels was performed. Genes (row), that are increased relatively to the mean are indicated in red, decreased in green and genes that show no difference are black colored. Tissues samples were stratified in precervical non-prolapsed tissue (cervix) and prolapsed anterior vaginal wall tissue. The supervised analysis revealed three clusters of which one cluster was associated with diseased prolapsed tissue (aqua blue) and two were reflecting inter-individual variance (dark blue and yellow). The 10 most significant pathways are indicated at the right.

82

Gene expression profiles

4

Figure 2. Cluster diagrams of genes that were differentially expressed in precervicalnonprolapsed tissue between 12 premenopausal Caucasian women (A). The cluster tree dividing the POP patients into two groups is also reflected in the percentage of desmin positive cells found with immunohistochemistry in the non-prolapsed tissues of the same POP patients (B). Correlation between DES gene expression and % of desmin positive cells. (Spearmanâ&#x20AC;&#x2122;s rho = 0.47; p =0.12) (C).

83

Chapter 4

shown in Figure 3, illustrates the subdivision into the two clusters on single gene level. These inter-individual differences were not related to disease severity and menstrual phase (data not shown). The data however, could be correlated to the percentage of desmin positive cells, data originated from our previous study on morfometric analysis of the tissue composition of the vaginal wall tissues of the same studypopulation (Figure 2B and C).17 RT PCR To confirm the array results, RT-PCR based expression analysis was performed for genes representing various processes, e.g. IL-6 and CXCR4 for the POP specific cluster; COL1α1, COL3α1 and TNF-α for the ECM subgroup; and ACTA2 and DES for muscle contraction cluster. qPCR confirmed the elevated steady-state mRNA levels for these seven genes as shown in Table 4.

4

Figure 3. Analysis of the gene expression of Col1α1 and DES as representative genes for the ECM cluster and muscle cell cluster respectively.

84

Gene expression profiles

Table 4. Correlation of the micro-array results and the quantitative polymerase chain reaction (qPCR). The seven genes represent each cluster shown in Figure 1.

Cluster

Genes

Spearman r

p value

COL1α1

0.7687

<0.0001

COL3α1

0.9139

<0.0001

TNF-α

0.8113

<0.0001

IL6

0.9130

<0.0001

CXCR4

0.8009

<0.0001

ACTA2

0.7809

<0.0001

Dark blue

Light blue

Yellow DES 0.9226 <0.0001 Col1α1, α1(I)procollagen; Col3α1, α1(III)procollagen; TNF-α, tumor necrotic factor-α; IL-6, interleukin 6; CXCR4, chemokine receptor type 4; ACTA2, alpha smooth muscle actin; DES, desmin.

COMMENT In this study, disease specific disregulated pathways as well as inter-individual differently regulated pathways were identified. A cluster of genes involved in signal transduction and transcriptional regulation mainly via AP-1 and FRA-related pathways were specifically identified in the prolapsed anterior vaginal wall. Two gene clusters showed variability between patients: an ECM/ integrin pathway cluster and a muscle cell/ contraction pathway cluster. The same variability between patients was observed in the precervical non-prolapsed tissues.

With respect to the disease specific cluster, it appears that the general signal transduction pathways (cytokine-cytokine interaction; peptide ligand binding receptor; class A1rhodopsin like receptor; chemokine receptor and GPCR ligand binding pathway) together with the transcriptional pathways (AP1; FRA; NFAT-TF; ATF2) are in majority involved in the inflammatory process.22-24,25-27 We did not find any inflammatory cell infiltration, though, in our previous histochemical evaluation of the same vaginal wall tissue.17 This phenomenon has been reported before in uterosacral ligaments and round ligaments in women with uterine prolapse.12 It seems fair to hypothesize that alternative functions exists for these pathways, other than inflammation.

85

4

Chapter 4

4

The differences in gene expression and activity of pathways between prolapsed tissues and nonâ&#x20AC;&#x201C;prolapsed tissues may reflect an accommodation of the connective tissue to the permanently increased mechanical load and stretch on the vaginal wall tissue caused by the prolapse. For example, in our study-population, Interleukin-6 (IL-6) (FDR<0.007) is generally known as a cytokine, secreted by T-cells and macrophages to stimulate immune responses. Recent in vitro studies have shown that IL-6 is also produced in soft tissues; e.g. excessive mechanical load on human synovial cells increases IL-6 expression.28 Cytokines and mechanical stretch can also induce smooth muscle de-differentiation, and proliferation by the activation of the transcriptional mediators of the AP-1 and FRA pathway. This is initially beneficial to allow tissue to adapt to increasing pressure. Sustained and prolonged exposure to mechanical load or stretch, however, can lead to aberrant hyperplasia and hypertrophy and loss of contractility.29;30 This phenomenon is also seen in our previous study demonstrating a significant increase in the amount of SMCs in the prolapsed site compared to the unaffected site of the same premenopausal patient.17 Numerous studies have investigated mechanotransduction and show that mechanical loading activates different pathways, affecting the cellular structure and function, causing changes in cell shape, migration, proliferation, contraction and differentiation in order to adapt to changes in the environment.31-36 The activated pathways in the prolapsed anterior vaginal wall tissues are all involved in mechanotransduction, which allow fibroblasts and smooth muscle cells and the surrounding ECM to adapt to the altered mechanics due to exposure to mechanical load and stretch caused by the prolapse.

The current literature remains unclear about which component of the connective tissue (collagens, elastin, SMCs or a combination) is affected most and in what way, i.e decreased or increased by changes in synthesis or degradation.37 The cluster analysis of most dysregulated genes in our study group reveales two clusters of genes reflecting variability between patients: an ECM/ integrin pathway cluster (dark blue in Figure 1) and a muscle cell/ contraction pathway cluster (yellow in Figure 1). Comparing these two different clusters of genes in the non-prolapsed tissues, they seem to be inversely related to one another, i.e. certain patients show upregulation in the ECM/ integrin pathway cluster and down regulation of SMC pathways, while other patients show a reversed pattern. In women with POP the precervical region is exposed to only minor changes in mechanical load and tissue stretch, under physiological circumstances.. All tissues need a certain amount of stretch and load to be able to maintain their structure. We therefore hypothesize that the two different clusters detected in fact may reflect two groups of patients in which either one or the other pathway (ECM organization vs smooth muscle

86

Gene expression profiles

cell contraction) dominates in non-prolapsed tissue to adapt to minor changes in the environment. In the ‘ECM group’ the pathways of integrins and cytokines are biomechanically and biochemically activated by strain or load. They mediate alongside other proteins, such as syndecan 1 pathway, the attachment of cells to the ECM and transduce information from the ECM to the cell and vice versa. This activates many transcription factors that downstream turns on the gene expression of proteins involved in ECM metabolism such as the different types of collagen, elastin, metalloproteinases, allowing for rapid and flexible responses to changes in the environment.

In the ‘muscle contraction group’ minor changes in the ECM mechanics influence myosin-driven, actin-mediated contractility of smooth muscle cells and the modulations of the actin cytoskeleton. The focal adhesion kinase (FAK) pathway is involved in this process and triggers a diverse array of cellular responses by linking to other downstream effectors, including the Rho-family GTPases such as Rho and Rac1and the Ras-MEK-ERK pathways.38;39 All contribute to coordinated cell behaviour in order to maintain tissue homeostasis.40 Recently we reported an increase of desmin positive cells, reflecting the percentage of SMCs in tissue samples from POP compared to the non POP site in the same study population.17 Strikingly, when comparing immunohistochemistry data with the current micro-array data, we could verify that the group of patients that showed an increased percentage of desmin positive cells were all part of the ‘muscle contraction group’ identified in this cluster analysis (yellow cluster, Figure 2B).

In our study we performed genome wide expression analysis based on 44.000 distinct probes, which is the most widespread micro-array analysis possible. We performed an extensive SAM as well as cluster analysis increasing the chance to find significant pathways and patterns. We could compare these results with our previous study into histological and histochemical features of these tissues.

The study set up with each woman being her own control reduces biases by any difference between patients. In a previous description of this study group we already showed that the non-prolapsed site of patients did not differ in either histological or immuno-histochemical characteristics from healthy controls.17 This makes the non-POP site of the patient a true internal control. The study set up, however, does not allow us to determine whether the differential gene expression was a cause or an effect of prolapse. Actually, only a longitudinal study would be able to answer this question. This is not possible to perform in humans; and a good human representative animal model does not exist yet. The apparent small

87

4

Chapter 4

sample size is not an issue in this microarray analysis, as the large number of probes (variables) and a relative small number of samples make the P-value concept and sample size determination based on classical power considerations obsolete.12;41;42 A samples size of 8-15 samples gives near-maximal levels of power and stability.43

4

In conclusion, we applied genome-wide gene expression technology to identify molecular mechanisms underlying POP. We found no clear POP related pathway in the prolapsed tissues other than general pathways related to mechanical loading.

However, we do provide evidence for inter-individual differences in both, control and disease tissue of these patients reflecting ECM/ integrin as well as muscle cell/ contraction dysfunctioning. We therefore hypothesize that women with a predisposition for POP show two different compensatory mechanism to adapt to physiological changes in mechanical load. Future research could provide different sets of biomarkers, i.e. one related to ECM and one related to (smooth) muscle contraction, differentiation and proliferation. This will help individualized management in the treatment of women with POP.

ACKNOWLEDGEMENTS The authors thank Wessel van Wieringen (PhD) and Mark van de Wiel (PhD), Department of Epidemiology and Biostatistics, VU University medical center, Amsterdam, The Netherlands for their contribution to the statistical analysis and Francois Rustenburg, technician (Department of Pathology, VU University medical center, Amsterdam, The Netherlands) for conducting the micro-array procedure.

88

Gene expression profiles

REFERENCE LIST 1.

2.

3.

4.

5.

6.

7.

8.

9.

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

Delancey JO. Anatomy and biomechanics of genital prolapse.

Clin.Obstet.Gynecol. 1993;36:897-909.

Norton PA. Pelvic floor disorders: the role of fascia and ligaments.

Clin.Obstet.Gynecol. 1993;36:926-38.

Harris RL, Cundiff GW, Coates KW, Bump RC. Urinary incontinence and pelvic organ prolapse in nulliparous women. Obstetrics and Gynecology 1998;92:951-54.

Mant J, Painter R, Vessey M. Epidemiology of genital prolapse: observations from the Oxford Family Planning Association Study. Br.J.Obstet.Gynaecol. 1997;104:579-85.

Jelovsek JE, Maher C, Barber MD. Pelvic organ prolapse. Lancet 2007;369:1027-38.

Weber AM, Richter HE. Pelvic organ prolapse. Obstet.Gynecol. 2005;106:615-34.

Delancey JO, Kane LL, Miller JM, Patel DA, Tumbarello JA. Graphic integration of causal factors of pelvic floor disorders: an integrated life span model. Am.J.Obstet.Gynecol. 2008;199:610-15.

Smith AR, Hosker GL, Warrell DW. The role of partial denervation of the pelvic floor in the aetiology of genitourinary prolapse and stress incontinence of urine. A neurophysiological study.

Br.J.Obstet.Gynaecol. 1989;96:24-28.

Allen RE, Hosker GL, Smith AR, Warrell DW. Pelvic floor damage and childbirth: a neurophysiological study. Br.J.Obstet.Gynaecol. 1990;97:770-79.

Weidner AC, Barber MD, Visco AG, Bump RC, Sanders DB. Pelvic muscle electromyography of levator ani and external anal sphincter in nulliparous women and women with pelvic floor dysfunction. Am.J.Obstet.Gynecol. 2000;183:1390-99.

Kerkhof MH, Hendriks L, Brolmann HAM. Changes in connective tissue in patients with pelvic organ prolapse--a review of the current literature. Int.Urogynecol.J.Pelvic.Floor.Dysfunct. 2009;20:461-74.

Brizzolara SS, Killeen J, Urschitz J. Gene expression profile in pelvic organ prolapse.

Mol.Hum.Reprod. 2009;15:59-67.

Visco AG, Yuan L. Differential gene expression in pubococcygeus muscle from patients with pelvic organ prolapse. Am.J.Obstet.Gynecol. 2003;189:102-12.

Tseng LH, Chen I, Lin YH, Chen MY, Lo TS, Lee CL. Genome-based expression profiles study for the pathogenesis of pelvic organ prolapse: an array of 33 genes model.

Int.Urogynecol.J. 2010;21:79-84.

Moon YJ, Bai SW, Jung CY, Kim CH. Estrogen-related genome-based expression profiling study of uterosacral ligaments in women with pelvic organ prolapse. Int.Urogynecol.J. 2013;24:1961-67.

Bump RC, Mattiasson A, Bo K, Brubaker LP, Delancey JO, Klarskov P et al. The standardization of terminology of female pelvic organ prolapse and pelvic floor dysfunction.

Am.J.Obstet.Gynecol. 1996;175:10-17:10-17.

Kerkhof M, Ruiz-Zapata A, Bril H, Bleeker M, Belien J, Stoop R et al. 'Changes in Tissue Composition of the Vaginal Wall of Premenopausal Women with Prolapse'. Am.J.Obstet.Gynecol. 2013.

Smyth GK, Speed T. Normalization of cDNA microarray data. Methods 2003;31:265-73.

Bolstad BM, Irizarry RA, Astrand M, Speed TP. A comparison of normalization methods for high density oligonucleotide array data based on variance and bias. Bioinformatics. 2003;19:185-93.

Tusher VG, Tibshirani R, Chu G. Significance analysis of microarrays applied to the ionizing radiation response. Proc.Natl.Acad.Sci.U.S.A 2001;98:5116-21.

Eisen MB, Spellman PT, Brown PO, Botstein D. Cluster analysis and display of genome-wide expression patterns. Proc.Natl.Acad.Sci.U.S.A 1998;95:14863-68.

Fric J, Zelante T, Wong AYW, Mertes A, Yu HB, Ricciardi-Castagnoli P. NFAT control of innate immunity. Blood 2012;120:1380-89.

Schonthaler HB, Guinea-Viniegra J, Wagner EF. Targeting inflammation by modulating the Jun/AP-1 pathway. Ann.Rheum.Dis. 2011;70 Suppl 1:i109-i112.

89

4

Chapter 4

4

24.

25.

26.

27.

28.

29.

30.

31.

32.

33.

34.

35.

36.

37.

38.

39.

40.

41.

42.

43.

Zanoni I, Granucci F. Regulation and dysregulation of innate immunity by NFAT signaling downstream of pattern recognition receptors (PRRs). Eur.J.Immunol. 2012;42:1924-31.

Heinrich PC, Behrmann I, Haan S, Hermanns HM, Muller-Newen G, Schaper F. Principles of interleukin (IL)-6-type cytokine signalling and its regulation. Biochem.J. 2003;374:1-20.

Kaplanski G, Marin V, Montero-Julian F, Mantovani A, Farnarier C. IL-6: a regulator of the transition from neutrophil to monocyte recruitment during inflammation. Trends Immunol. 2003;24:25-29.

Luyendyk JP, Schabbauer GA, Tencati M, Holscher T, Pawlinski R, Mackman N. Genetic analysis of the role of the PI3K-Akt pathway in lipopolysaccharide-induced cytokine and tissue factor gene expression in monocytes/macrophages. J.Immunol. 2008;180:4218-26.

Akamine Y, Kakudo K, Kondo M, Ota K, Muroi Y, Yoshikawa H et al. Prolonged matrix metalloproteinase-3 high expression after cyclic compressive load on human synovial cells in threedimensional cultured tissue. Int.J.Oral Maxillofac.Surg. 2012;41:874-81.

Halayko AJ, Solway J. Molecular mechanisms of phenotypic plasticity in smooth muscle cells.

J.Appl.Physiol (1985.) 2001;90:358-68.

Ramachandran A, Gong EM, Pelton K, Ranpura SA, Mulone M, Seth A et al. FosB regulates stretchinduced expression of extracellular matrix proteins in smooth muscle.

Am.J.Pathol. 2011;179:2977-89.

Giannone G, Sheetz MP. Substrate rigidity and force define form through tyrosine phosphatase and kinase pathways. Trends Cell Biol. 2006;16:213-23.

MacKenna D, Summerour SR, Villarreal FJ. Role of mechanical factors in modulating cardiac fibroblast function and extracellular matrix synthesis. Cardiovasc.Res. 2000;46:257-63.

Shyu KG. Cellular and molecular effects of mechanical stretch on vascular cells and cardiac myocytes. Clin.Sci.(Lond) 2009;116:377-89.

Anwar MA, Shalhoub J, Lim CS, Gohel MS, Davies AH. The effect of pressure-induced mechanical stretch on vascular wall differential gene expression. J.Vasc.Res. 2012;49:463-78.

Peyton SR, Ghajar CM, Khatiwala CB, Putnam AJ. The emergence of ECM mechanics and cytoskeletal tension as important regulators of cell function. Cell Biochem.Biophys. 2007;47:300-20.

Ruiz-Zapata A, Kerkhof M, Zandieh-Doulabi B, Brolmann H, Smit T, Helder M. Fibroblasts from women with pelvic organ prolapse show differential mechanoresponses depending on surface substrates. Int.Urogynecol.J. 2013. de Landsheere L, Munaut C, Nusgens B, Maillard C, Rubod C, Nisolle M et al. Histology of the vaginal wall in women with pelvic organ prolapse: a literature review.

Int.Urogynecol.J. 2013;24:2011-20.

Wehrle-Haller B, Imhof B. The inner lives of focal adhesions. Trends Cell Biol. 2002;12:382-89.

Wozniak MA, Modzelewska K, Kwong L, Keely PJ. Focal adhesion regulation of cell behavior.

Biochim.Biophys.Acta 2004;1692:103-19.

Hall A. Rho GTPases and the control of cell behaviour. Biochem.Soc.Trans. 2005;33:891-95.

Smyth GK, Yang YH, Speed T. Statistical issues in cDNA microarray data analysis.

Methods Mol.Biol. 2003;224:111-36.

Pawitan Y, Murthy KRK, Michiels S, Ploner A. Bias in the estimation of false discovery rate in microarray studies. Bioinformatics. 2005;21:3865-72.

Pavlidis P, Li Q, Noble WS. The effect of replication on gene expression microarray experiments.

Bioinformatics. 2003;19:1620-27.

90

Gene expression profiles

4

91

5 Fibroblasts from women with pelvic organ prolapse show differential mechano-responses depending on surface substrates A.M. Ruiz-Zapata M.H. Kerkhof B. Zandieh-Doulabi H.A.M. Brรถlmann Th.H. Smit M.N. Helder Int Urogynecol J. 2013 Sep: 24(9):1567-75

Chapter 5

ABSTRACT Objective: Little is known about dynamic cell-matrix interactions in the context of pathophysiology and treatments for pelvic organ prolapse (POP). This study seeks to identify differences between fibroblasts from women with varying degrees of prolapse in reaction to mechanical stimuli and matrix substrates in vitro.

Study design: Fibroblasts from the vaginal wall of three patients with POP-Q stages 0, II and IV, were stretched on artificial polymer substrates coated or not with collagen I. Changes in morphology and anabolic/catabolic compounds that affect matrix remodeling were evaluated at protein and gene expression levels. Statistical analysis was performed using one-way ANOVA followed by Tukey-Kramerâ&#x20AC;&#x2122;s posthoc test.

Results: POP fibroblasts show delayed cell alignment and lower responses to extracellular matrix remodeling factors at both enzymatic and gene expression levels, compared to healthy fibroblasts.

5

Conclusion: POP fibroblasts, when compared to healthy cells, show differential mechano-responses on two artificial polymer substrates. This should be taken into account when designing or improving implants for the treatment of POP.

BRIEF SUMMARY Fibroblasts from women with different degrees of pelvic organ prolapse show in vitro differential mechano-responses to cyclic mechanical loading and two artificial substrates.

94

Fibroblasts mechano-responses

INTRODUCTION Pelvic organ prolapse (POP) is a common multifactorial disease with known risk factors and unclear pathogenesis. POP is characterised by the weakening of the pelvic floor, and is associated with serious inconveniences and a reduced quality of life to almost 50% of women over 50 years of age. Conservative therapies are not always possible or sufficient and reconstructive surgery with native tissue has high failure rates. Of the treated patients 30% will experience recurrent POP within the first two years of treatment.1,2 Since the 1970â&#x20AC;&#x2122;s, urogynecologists started to use polymeric meshes, originally designed to treat inguinal hernia, in an attempt to restore tissue support in POP patients. However, complications such as mesh contraction, exposure or extrusion caused serious health problems to a point that in July 2011 the FDA issued a safety communication about the use of transvaginal meshes in POP repair.3,4 Thus improvement of current therapies is urgently needed but this is hampered by a lack of understanding of the pathophysiology of the disease, along with sparse knowledge of the cause-effect relationships of mesh failures in patient tissues.5,6 In recent years, there has been a growing interest in studying tissue composition of patients with prolapse. Researchers have mainly focused on characterising the extracellular matrix (ECM) of connective tissues that support the pelvic floor such as the vaginal wall2,7-11, the uterosacral ligaments12,13 and the pubocervical fascia.13,14 Different outcomes have been reported, but the overall consensus is that the connective tissue of the vaginal wall is abnormal in women with POP.15 The vaginal wall is one of the soft tissues that is constantly being remodelled in order to withstand the different forces that are applied to it during a womanâ&#x20AC;&#x2122;s lifetime. Thus the weakening of the pelvic floor could be caused by an imbalance of its remodeling.2,7,8 The presence of artificial substrates may very well influence this process.

Tissue remodeling is a well-balanced process involving several factors with different roles, and cells as modulators. In the vaginal wall, fibroblasts (FBs) are the mechanosensitive cells responsible for maintaining ECM homeostasis; they produce molecules, and control anabolic and catabolic processes to remodel their surrounding matrix in response to mechanical and biochemical stimuli. Compounds particularly involved in ECM homeostasis include collagens (mainly type I and III), the collagen degrading matrix metalloproteinases (MMPs), and tissue inhibitors of metalloproteinases (TIMPs).

95

5

Chapter 5

MMPs are involved in both normal and pathological ECM remodeling processes throughout the body, including the pelvic floor. It has been shown that the amounts of active MMP-2 12,13,16 and/or MMP-9 7,17 are increased in tissues from patients with POP in comparison to controls. However we were interested to see if these matrix metalloproteinase are also increased when cells are exposed to cyclic mechanical loading. Furthermore it is the question whether this enzymatic activity is affected by the presence of artificial polymeric substrates.

In order to answer these questions, the present study was designed to evaluate in vitro dynamic cell-matrix interactions which are important for understanding the pathophysiology of and treatments for POP. We hypothesize that fibroblasts from women with different degrees of prolapse, display different mechano-responses depending on the substrate encountered. This hypothesis was tested by subjecting fibroblasts from healthy, mild or severe POP women to cyclic mechanical loading mimicking continuous respiration18 on artificial polymeric membranes uncoated as well as coated with collagen I. Changes in morphology and anabolic/catabolic compounds that may affect the remodeling of the extracellular matrix were analysed.

5

MATERIALS AND METHODS Patient selection, tissue processing, and cell culture Retrieval of biopsies was approved by the medical ethical committees of two hospitals in the Netherlands: VU University Medical Centre (Amsterdam) and Kennemer Gasthuis Hospital (Haarlem), and informed consent was obtained. Full thickness biopsies (1cm2) of the anterior vaginal wall were obtained during vaginal hysterectomy of one patient with mild (with POP-Q stage II) and one patient with severe POP (with POP-Q stage IV). A third woman, who was operated for benign gynecological reasons, was selected as a healthy control. For ethical reasons the biopsy site of the latter patient was the precervical region of the anterior vaginal wall. Tissues were collected in PBS at 4°C and cells were isolated within 24h under sterile conditions. Fascia was scraped, cut into little pieces, and digested with Liberase TM (final concentration: 0.3U/ml; Roche Diagnostics, Mannheim, Germany) for 3h at 37°C and constant agitation. After filtration with a 100µm cell strainer (BD Falcon, Franklin Lakes, NJ, USA), the pellet was re-suspended in culture medium (Dulbecco’s modified Eagle’s medium-DMEM) supplemented with 10% foetal bovine serum (FBS), 100U/ml penicillin, 100µg/ml streptomycin, and 250µg/ ml amphotericin-B. FBS was obtained from HyClone (South Logan, UT, USA), the

96

Fibroblasts mechano-responses

other culture components were obtained from Gibco-Life technologies (Paisley, UK) and Sigma (St. Louis, MO, USA). Subsequently, cells were seeded on 6-well plates, and grown in an incubator at 37°C, 95% humidity and 5% CO2 until they reached 60% confluence. At that point, the cells were considered to be at passage 0. Fibroblasts from passage 3-5 were used for loading experiments.

Cyclic mechanical loading Forty-eight hours before mechanical loading, fibroblasts were seeded at a density of 150.000cells/well on two artificial polymer substrates: 6-well uncoated or collagen I-coated silicone BioflexÂŽ plates (BioFlex, Flexcell International Corp., McKeesport, PA, USA). Just before loading, the cells were refreshed using culture media containing 1% FBS. The loading regime was applied using a Flexercell FX4000 system (Flexcell International Corp.), and consisted of 24 or 48 hours of continuous cyclic mechanical loading (CML) mimicking continuous respiration as described by Blaauboer and colleagues 18 (parameters: sinusoidal wave, frequency of 0.2Hz and maximum elongation of 10%). The Flexercell is a device that is widely used and has a vacuum pump that pulls down the elastic membrane of the bioflex plates stretching the cells that are seeded on top accordingly. Fibroblasts cultured under the same conditions but without loading served as static controls. After the loading period, the cells were imaged using the bright field of an inverted Leica DMIL microscope with a DFC320 digital camera (Leica Microsystems, Wetzlar, Germany) and samples were collected for F-actin staining, MMP activity, protein content and gene expression.

F-actin staining For immunocytochemical staining of F-actin, cells were fixed using 4% formaldehyde, stained for F-actin with Alexa Fluor 488 phalloidin (Molecular Probes, Leiden, The Netherlands) and imaged using an inverted Leica DMIL microscope (Leica Microsystems) as previously described.19 Enzymatic activity After mechanical loading, conditioned media was collected and the gelatinolytic activity of MMP-2 and MMP-9 was evaluated by zymography using Novex zymogram gels (10% zymogram gelatin gel, Life Technologies) following manufacturers protocol. Dark bands of gelatinolytic activity were visualized using an eStain protein staining device (GeneScript, Piscataway, NJ, USA). Images were acquired with Biospectrum AC Imaging System (UVP, Cambridge, UK) and zymogram quantification of the density of the bands was performed using Image J 1.44p software (National Institutes of Health, USA). Quantitative data was normalised to

97

5

Chapter 5

total protein content (section below).

Western blot analysis Conditioned media after 48h of loading were used to detect protein levels of TIMP2 by western blot. Samples were concentrated 2x by freeze drying, denatured for 5min and reduced with dithiothreitol. Samples were separated by electrophoresis on a NuPAGE® Novex 4-12% Bis-Tris gel and transferred to iBlot® PVDF membrane (Life Technologies). For protein detection, monoclonal antibody anti-TIMP-2 mouse (mAb T2-101; Calbiochem®, Merck Millipore, Darmstadt, Germany) was used at a concentration of 1:500. Blots were blocked for 1h at room temperature with a blocking buffer (PBS with 0.5% Tween-20 and 1% bovine serum albumin), then incubated with primary antibody in blocking buffer for 1h at room temperature, and followed by an overnight incubation at 4°C. Bound antibodies were visualized with a horseradish peroxidase-conjugated antibody goat anti-mouse (1:10000) and Supersignal west pico chemiluminescence kit (Thermo Scientific, Rockford, IL, USA). Images were acquired with Biospectrum AC Imaging System (UVP) and quantification of the density of the bands was performed using Image J 1.44p software (NIH).

5

Total protein quantification For total protein quantification cells were lysed in buffer containing 50mM Tris, pH 7.5, 150mM NaCl, 1mM sodium orthovanadate, 1% Nonidet P-40, 0.1% sodium deoxycholate, and EDTA-free protease inhibitor mixture (Sigma-Aldrich). The total protein content was determined using Pierce BCA Protein Assay kit (Thermo Scientific) following the supplier’s specifications. Quantification was performed spectrophotometrically between 540-590nm and using a 1420 multilabel counter VICTOR2 (WALLAC, Turku, Finland).

Gene expression For gene expression cells were lysed in a solution (1:100) of β-mercaptoethanol (Sigma-Aldrich) and RA1 buffer (Macherey-Nagel, Bioke, Leiden, The Netherlands).

According to the manufacturers instructions, total RNA was isolated using NucleoSpin TriPrep kit (Bioke) to a final concentration of 250 ng/ml, and was reverse-transcribed using SuperScript VILO cDNA synthesis kit (Life technologies). Gene expression of Col 1α1, Col 3α1, MMP-2, TIMP-2 and the housekeeping genes Ywhaz and hUBC were evaluated using the primers listed in Table 1 (Life technologies), the SYBR Green Reaction Kit following suppliers’ specifications (Roche) and measured by RTPCR in a Light Cycler 480 device (Roche). Gene expression levels were normalized using a factor derived from the equation √(Ywhaz x hUBC). Crossing points were

98

Fibroblasts mechano-responses

assessed using the Light Cycler software (version 4) and plotted versus serial dilutions of cDNA derived from a human universal reference total RNA (Clontech Laboratories Palo Alto, CA, USA).

Statistical analysis Three independent experiments were performed in duplicate and data are expressed as mean ± standard deviation (SD). Statistical analysis was performed using one-way analysis of variance (ANOVA) followed by Tukey-Kramer’s post-hoc test (Prism version 5.02, GraphPad Software Inc., La Jolla, CA, USA). Differences were considered significant at 5% level (p < 0.05).

5 Table 1. Primer sequences used for RT-PCR. Target gene

Oligonucleotide sequence

Annealing temperature (°C)

Product Size (bp)

Col 1α1

Forward reverse

5’ TCCAACGAGATCGAGATCC 3’ 5’ AAGCCGAATTCCTGGTCT 3’

57

191

Col 3α1

Forward reverse

56

279

MMP-2

Forward reverse

5’ GATCCGTTCTCTGCGATGAC 3’ 5’ AGTTCTGAGGACCAGTAGGG 3’ 5’ GGCAGTGCAATACCTGAACA 3’ 5’ AGGTGTGTAGCCAATGATCCT 3’

56

253

TIMP-2

Forward reverse

5’ CTGAACCACAGGTACCAGAT 3’ 5’ TGCTTATGGGTCCTCGATG 3’

63

237

Ywhaz

Forward reverse

5’ GATGAAGCCATTGCTGAACTTG 3’ 5’ CTATTTGTGGGACAGCATGGA 3’

56

229

hUBC

Forward reverse

5’ GCGGTGAACGCCGATGATTAT 3’ 5’ TTTGCCTTGACATTCTCGATGG 3’

56

202

Col1α1, α1(I)procollagen; Col3α1, α1(III)procollagen; MMP-2, matrix metalloproteinase 2; TIMP-2, tissue inhibitor of metalloproteinases 2; hUBC, human ubiquitin C; Ywhaz, tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide.

99

Chapter 5

RESULTS After 48 hours of cyclic mechanical loading, morphological analysis showed cell alignment perpendicular to the force that was facilitated by collagen-coated surfaces with no apparent differences between healthy (Fig.1b and d) and POP fibroblasts (Fig.2c and d). At an earlier time point (24h) load-induced rearrangement of F-actin fibres was completed for mild but not for severe POP fibroblasts (Fig.2a vs. b). Static control cells displayed random distribution independent of the surface (Fig.1a and b).

5

Figure 1. Cell attachment and alignment is facilitated by collagen I substrates. Representative images of healthy fibroblasts after 48h of cyclic mechanical loading (CML) on uncoated (a and c) or collagen I-coated (b and d) plates. Morphology shows random cell distribution under static conditions (-CML, a and b); whereas stretching induced cell alignment perpendicular to the force (F), especially on collagen I-coated plates (+CML, c and d). Images were acquired with 10x objective of a Leica microscope, bar is 100Âľm.

100

Fibroblasts mechano-responses

To evaluate the effects of the different experimental conditions on the capacity of the fibroblasts to remodel the extracellular matrix, secreted MMP-2 and MMP-9 enzymatic activity were evaluated at two time points (24h and 48h). Total levels of released MMP-2 by POP fibroblasts at 24h were lower than healthy control cells independent of the surface substrate (Fig.3a). At the same time point, but only on uncoated plates, cyclic mechanical loading induced activation of MMP-2 which was more pronounced by healthy fibroblasts. Under static conditions, activation of MMP-2 was only observed in healthy control cells on uncoated plates (Fig.3a left blot). There was no apparent activation of MMP-2 on collagen I-coated plates, with the exception of a very faint band of active MMP-2 on stretched mild POP fibroblasts (Fig 3a middle blot).

5

Figure 2. On collagen I-coated plates, rearrangement of F-actin fibres was completed after 24h of loading for mild but not for severe POP fibroblasts. Representative images of POP fibroblasts F-actin fibres showing cell alignment perpendicular to the force (F) on collagen I-coated plates after 24h (a and b) or 48h (c and d) of loading. F-actin fibres stained with phalloidin, bar is 100Âľm.

101

Chapter 5

5

102

Fibroblasts mechano-responses

← Figure 3. Mechanical loading induced activation over time of MMP-2 by fibroblasts seeded on uncoated plates. Conditioned media of fibroblasts from healthy, mild and severe POP patients after 24h (a) or 48h (b and c) of cyclic mechanical loading (CML) on uncoated or collagen I-coated plates was evaluated. Blots a) and b) are representative zymograms showing MMP-2 activity. c) is a western blot of conditioned media (concentrated 2x) showing that TIMP-2 was released by the cells only on collagen substrates. Blots at 48h of CML were analysed with imageJ and quantitative data was normalised to total protein content. Quantitative data from zymograms show: levels of released pro MMP-2 by fibroblasts on uncoated (d) or collagen I-coated (e) plates; and the ratio between active and inactive MMP-2 forms on uncoated plates (f). Data represent the mean ± SD. **p<0.01 compared to static condition (- CML).

Graph (g) corresponds to release of TIMP-2 by fibroblasts on collagen substrates. Low serum media which was not exposed to cells was used as negative control. Positive controls used: for zymograms was human-recombinant MMP-2 and for western blot was cell lysates from dermal stem cells.

At a later time point (48h), levels of released pro-MMP-2 were similar on collagen I surfaces and no active MMP-2 was found (Fig.3b middle blot). On uncoated plates, stretching of fibroblasts induced activation of MMP-2 that increased from 24h to 48h. Such activation was lower in POP fibroblasts when compared to healthy controls (Fig.3b and b, left blot). Western blot analysis at 48h revealed the presence of TIMP-2 only in the case of cells exposed to collagen coated plates without any apparent regulation by loading (Fig.3c). Released MMP-9 was below detection levels.

Since levels of released MMP-2 were higher after 48 hours, these data were quantified and normalised to total protein content. Quantitative data revealed that under static conditions and regardless of the type of substrate, most cells released similar amounts of pro-MMP-2 into the extracellular environment (Fig.3d and e).

On uncoated plates, mechanical loading induced activation of MMP-2 by all cell populations as the ratios between active and inactive (pro) MMP-2 forms were always greater than 1 and an ANOVA showed that such increment was significant only in the case of healthy fibroblasts (p < 0.01) (Fig.3f). On collagen I-coated plates, quantitative data revealed similar expression profiles of pro-MMP-2 and TIMP-2 in all groups (Fig.3e and g).

To detect differences at gene expression level, the ECM remodeling related genes Col 1α1, Col 3α1, MMP-2 and TIMP-2, were chosen to evaluate the effects of cyclic mechanical loading and surface substrate after 48 hours of treatment. On uncoated plates, both mild and severe POP fibroblasts showed significantly lower

103

5

Chapter 5

gene expression of Col 1α1 and Col 3α1 when compared to healthy controls (Fig.4a and b). On the same substrate, gene expression of Col 1α1 was down-regulated by mechanical loading in healthy but not in POP fibroblasts. MMP-2 expression levels were similar in all fibroblasts independent of loading conditions (Fig.4c and d). On collagen I-coated plates, mild but not severe POP fibroblasts showed lower gene expression levels of Col 1α1, Col 3α1 and MMP-2 when compared to healthy controls (Fig. 4e, f and g). TIMP-2 expression levels were similar in all fibroblasts independent of loading or coating conditions (Fig.4h).

5

Figure 4. Relative expression of extracellular matrix remodeling related genes. Fibroblasts from healthy, mild or severe POP patients were subjected, or not subjected, to cyclic mechanical loading (+/- CML) on uncoated (a, b, c and d) or collagen I-coated plates (e, f, g and h). Each column represents a different gene: Col 1α1 (a) and (e); Col 3α1 (b) and (f); MMP-2 (c) and (g); TIMP-2 (d) and (h). Values are normalized to housekeeping genes (Ywhaz and hUBC), expressed as a percentage of healthy control and represent the mean ± SD. *p<0.05, **p<0.01, ***p<0.001; compared to the first bar unless indicated otherwise.

104

Fibroblasts mechano-responses

DISCUSSION In pelvic organ prolapse tissue strength is lost, stiffness is increased9-11, and quality of the extracellular matrix is compromised.15 Consequently, fibroblasts might be exposed to an abnormal matrix. The biomechanical environment may be further compromised if during pelvic reconstructive surgery stiff, non-resorbable polymeric meshes are used to replace tissue function. We evaluated the possible roles of cyclic mechanical loading and two surface substrates on the functionality of healthy as well as mild and severe POP fibroblasts using an in vitro dynamic model. We found variations of fibroblast responses at morphological, enzymatic and gene expression levels.

Cells respond to mechanical stimuli by remodeling their actin cytoskeleton.20 Our results show that all fibroblasts were mechano-responsive as their actin cytoskeleton aligned perpendicular to the force after 48 hours of cyclic mechanical loading, especially in the presence of collagen I. This finding is consistent with previous reports that fibroblasts from the pelvic floor completely align after being stretched for 48 hours.21 Differences between cell populations were seen after 24 hours of loading on collagen I substrates, when visualization of actin filaments revealed that alignment of severe POP fibroblasts appear delayed in comparison to their mild counterparts, and released MMP-2 was lower in fibroblasts from POP patients compared to healthy control cells. These effects seemed to disappear with time since after 48 hours of stretching there were no apparent differences in cell alignment, there was no activation of MMP-2, TIMP-2 protein levels corresponded to pro MMP-2, and there were no differences in gene expression of MMP-2 or TIMP-2.

Interestingly, when fibroblasts were exposed to artificial polymeric substrates (uncoated plates), clear differences were seen in the production and activation of MMP-2, TIMP-2 could not be detected and mechanical loading promoted activation of MMP-2 over time. After 48 hours of loading, MMP-2 activation was significant only in healthy, and not in POP fibroblasts. Moreover, cells from women with prolapse showed differential gene expression of anabolic but not catabolic compounds: collagens I and III were lower in women with POP and mechanical loading down-regulated collagen I, but only on healthy fibroblasts. Changes seen with catabolic secreted proteins were not correlated at gene expression level. Such discrepancy highlights the importance of using different evaluation parameters because changes at gene expression do not necessarily reflect changes at protein

105

5

Chapter 5

levels and they can occur at different times.

Taken together our data suggest that, although fibroblasts from POP patients seem to have lower mechano-responses, in the presence of collagen I substrate the system eventually reaches a balance. The latter confirms 48 hour data from Zong and colleagues22, who used collagen I-coated plates in their in vitro dynamic model with similar experimental conditions (sinus wave; amplitudes: 8% and 16%; frequency: 1Hz), and did not find differences between healthy, mild and severe POP vaginal fibroblasts.

5

However, it appears that when cells are exposed to artificial polymeric substrates and stress is imposed, this balance is not reached. Fibroblasts from women with POP seem preconditioned by the abnormal prolapsed matrix. Unable to respond in the same way as control cells, POP fibroblasts might not be able to restore ECM homeostasis when artificial polymeric substrates are added to their microenvironment. In such circumstances tissue remodeling might not be restored but instead, may in turn provide a negative feed-back loop that deteriorates the ECM even further leading to an additional loss of strength, increased stiffness and eventually more tissue damage. Such implications at the micro level are in line with findings at macro level. Several studies have reported increased stiffness in prolapsed tissues when assessing biomechanical properties of vaginal wall from patients with POP compared to healthy controls.17-19 Moreover, it has also been shown that polymeric meshes used in genital prolapse surgery are stiffer than the native tissue.23 Feola and colleagues24 recently showed correlation between mesh stiffness and tissue deterioration in a non-primate animal model. Therefore, changes in the vaginal wall at cellular level could be good indicators of tissue behaviour and should be taken into account when treating patients with polymeric meshes. Since surface substrate affects cellular behaviour, and cell-matrix interactions seem to be impaired in POP fibroblasts, improving mesh surface characteristics could enhance implant integration.

Conclusions from the present study should be treated with care: results were obtained in an in vitro set up which allowed us to control certain parameters, but does not fully reflect the in vivo situation. Furthermore, we are aware that our patient population is too small to draw conclusions about all women with POP. The experiments have been repeated three times confirming the first results suggesting our model to be valid. We are currently in the process of expanding our sample size.

106

Fibroblasts mechano-responses

To improve pelvic floor treatments, further studies evaluating the effect of different ECM proteins to fibroblasts in dynamic in vitro systems could provide important clues to improve mesh designs before using animals for in vivo studies and humans for clinical trials. This approach should provide better clinical outcomes by using information from bench to bed side to restore support and improve host-implant integration in treatments for pelvic organ prolapse.

In summary: this study provides a model to evaluate dynamic interactions of fibroblasts from the pelvic floor with artificial substrates in vitro. Unlike previous models21-22, we chose a continuous physiological stretch regimen to compare the fibroblastsâ&#x20AC;&#x2122; mechano-responses to artificial collagen I-coated and uncoated substrates. We thereby show clear differences between POP and healthy fibroblasts on artificial polymer substrates. This highlights the importance of evaluating cellmatrix interactions with different surroundings to better understand the influences of proteins from the ECM on vaginal fibroblast behaviour in dynamic environments.

Such outcomes may provide important clues on how to design biomeshes that mimic the ECM environment appropriately, since it seems that the addition of collagen coating helps to restore the vaginal wall metabolic balance. This new approach may enable the improvement of treatments for pelvic organ prolapse.

107

5

Chapter 5

REFERENCE LIST

5

1. Jelovsek JE, Maher C, Barber MD (2007) Pelvic organ prolapse. The Lancet 369:1027-1038.

2. Mosier E, Lin VK, Zimmern P (2010) Extracellular matrix expression of human prolapsed vaginal wall.

Neurourol Urodyn 29:582-586.

3. U.S. Food and Drug Administration FDA (2011) Urogynecologic surgical mesh: update on the

safety and effectiveness of transvaginal placement for pelvic organ prolapse. IOP FDAWeb. http://www.fda.gov/downloads/medicaldevices/safety/alertsandnotices/UCM262760.pdf.

Accessed 12 November 2012.

4. Keys T, Campeau L, Badlani G (2012) Synthetic mesh in the surgical repair of pelvic organ prolapse:

current status and future directions. Urology 80:237-243.

5. Kerkhof MH, Hendriks L, Brรถlmann HAM (2009) Changes in connective tissue in patients with pelvic

organ prolapse--a review of the current literature.

Int Urogynecol J Pelvic Floor Dysfunct 20:461-474.

6. Feola A, Barone W, Moalli P, Abramowitch S (2012) Characterizing the ex vivo textile and structural

properties of synthetic prolapse mesh products. Int Urogynecol J DOI 10.1007/s00192-012-1901-1.

7. Moalli PA, Shand SH, Zyczynski HM, Gordy SC, Meyn LA (2005) Remodeling of vaginal connective

tissue in patients with prolapse. Obstet Gynecol 106:953-963.

8. Bortolini MA, Shynlova O, Drutz HP et al (2011) Expression of bone morphogenetic protein-1 in

vaginal tissue of women with severe pelvic organ prolapse. Am J Obstet Gynecol 204:544.e1-8.

9. Jean-Charles C, Rubod C, Brieu M, Boukerrou M, Fasel J, Cosson M (2010) Biomechanical properties

of prolapsed or non-prolapsed vaginal tissue: impact on genital prolapse surgery.

Int Urogynecol J 21:1535-1538.

10. Martins P, Silva-Filho AG, Maciel da Fonseca AMR, Santos A, Santos L, Mascarenhas T, Jorge RMN,

Ferreira AJM (2012) Biomechanical properties of vaginal tissue in women with pelvic organ

prolapse. Gynecol Obstet Invest DOI 10.1007/s00192-012-1901-1.

11. Zhou L, Lee JH, Wen Y, Constantinou C, Yoshinobu M, Omata S, Chen B (2012) Biomechanical

properties and associated collagen composition in vaginal tissue of women with pelvic organ

prolapse. J Urol 188(3):875-880.

12. Phillips CH, Anthony F, Benyon C, Monga AK (2006) Collagen metabolism in the uterosacral

ligaments and vaginal skin of women with uterine prolapse. BJOG 113:39-46.

13. Liang CC, Huang HY, Tseng LH, Chang SD, Lo TS, Lee CL (2010) Expression of matrix

metalloproteinase-2 and tissue inhibitors of metalloproteinase-1 (TIMP-1, TIMP-2 and TIMP-3)

in women with uterine prolapse but without urinary incontinence. Eur J Obstet Gynecol Reprod

Biol 153:94-98.

14. Berger MB, Ramanah R, Guire KE, Delancey JOL (2012) Is cervical elongation associated with pelvic

organ prolapse? Int Urogynecol J 23:1095-1103.

15. Word RA, Pathi S, Schaffer JI (2009) Pathophysiology of pelvic organ prolapse.

Obstet Gynecol Clin North Am 36:521-539.

16. Jackson SR, Eckford SD, Abrams P, Avery NC, Tarlton JF, Bailey AJ (1996) Changes in metabolism

of collagen in genitourinary prolapse. The Lancet 347:1658-1661.

17. Budatha M, Roshanravan S, Zheng Q et al (2011) Extracellular matrix proteases contribute to

progression of pelvic organ prolapse in mice and humans. J Clin Invest 121:2048-2059.

18. Blaauboer ME, Smit TH, Hanemaaijer R, Stoop R, Everts V (2011) Cyclic mechanical stretch reduces

myofibroblast differentiation of primary lung fibroblasts. Biochem Biophys Res Commun 404:23-27.

19. Perez-Amodio S, Beertsen W, Everts V (2004) (Pre-)osteoclasts induce retraction of osteoblasts

before their fusion to osteoclasts. J Bone Miner Res 19:1722-1731.

20. Kong D, Ji B, Dai L (2008) Stability of adhesion clusters and cell reorientation under lateral cyclic

tension. Biophys J 95:4034-4044.

108

Fibroblasts mechano-responses

21.

22.

23.

24.

Ewies AAA, Elshafie M, Li J et al (2008) Changes in transcription profile and cytoskeleton morphology in pelvic ligament fibroblasts in response to stretch: the effects of estradiol and levormeloxifene.

Mol Hum Reprod 14:127-135.

Zong W, Jallah ZC, Stein SE, Abramowitch SD, Moalli PA (2010) Repetitive mechanical stretch increases extracellular collagenase activity in vaginal fibroblasts.

Female Pelvic Med Reconstr Surg 16:257-262.

Ozog Y, Kostantinovic M, Werbrouck E, De Ridder D, Mazza E, Deprest J (2011) Persistence of polypropylene mesh anisotropy after implantation: an experimental study. BJOG 118:1180-1185.

Feola A, Abramowitch S, Jallah Z, Stein S, Barone W, Palcsey S, Moally P (2013) Deterioration in biomechanical properties of the vagina following implantation of high-stiffness prolapse mesh.

BJOG 120:224-232.

5

109

6 Functional characteristics of vaginal fibroblasts from premenopausal women with pelvic organ prolapse M.H. Kerkhof* A.M. Ruiz-Zapata* B. Zandieh-Doulabi H.A.M. Brรถlmann Th.H. Smit M.N. Helder * both authors equally contributed to the manuscript

Submitted

Chapter 6

ABSTRACT Objective: Pelvic organ prolapse (POP) remains a great therapeutic challenge with no optimal treatment available. Tissue maintenance and remodeling are performed by fibroblasts, therefore altered cellular functionality may influence tissue quality.

In this study, we evaluated functional characteristics of fibroblasts from tissues involved in POP. Study design: To rule out normal ageing tissue degeneration biopsies from 18 premenopausal women were collected from the precervical region (non-POP site) after hysterectomy of eight healthy and 10 POP cystocele cases (POP-Q stage â&#x2030;Ľ II). Extra tissues from the prolapsed site were taken in the POP cases to identify between intrinsic and acquired cellular defects. 28 primary fibroblast cultures were studied in vitro. A contractility assay was used to test fibroblast-mediated collagen contraction. Cellular mechanoresponses on collagen-coated or uncoated substrates were evaluated by measuring matrix remodeling factors at protein or gene expression levels.

6

Results: No differences were found between fibroblasts from the controls and the non-POP site of the case group. Fibroblasts from the prolapsed site showed delayed fibroblast-mediated collagen contraction and lower production of matrix metalloproteinase-2 (MMP-2) on collagen-coated plates. On uncoated surfaces the gene MMP-2 and its inhibitor (TIMP-2) were up-regulated in POP site fibroblasts.

Conclusion: Fibroblasts derived from prolapsed tissues of patients with cystocele, display altered in vitro functional characteristics depending on the matrix substrate and compared to non-prolapsed site. This implies an acquired rather than an intrinsic defect and should be taken into account when improving treatments for pelvic organ prolapse.

BRIEF SUMMARY Altered mechanoresponses of vaginal fibroblasts from prolapsed tissues are an acquired effect, rather than an intrinsic defect in premenopausal women with POP.

112

Functional characteristics of fibroblasts

INTRODUCTION Pelvic organ prolapse (POP) affects the quality of life of women world-wide, but remains a great therapeutic challenge.1-4 Patients with POP may suffer from urinary and faecal incontinence, sexual dysfunction, chronic pelvic pain, vaginal relaxation, and social isolation.5-7 Environmental factors (parity, physiological ageing and obesity) seem to play a major role in the development of prolapse in most patients.

However, the pathogenesis remains unclear.2,3,8 Within POP, cystocele has the greatest incidence and is characterized by the protrusion of the bladder into the anterior vaginal wall and outside the body.9,10 In the connective tissue layer of the vaginal wall, fibroblasts are the cells in charge of extracellular matrix remodeling and tissue maintenance. These mechanosensitive cells produce anabolic proteins like collagens, and activate catabolic enzymes, like matrix metalloproteinases (MMPs). They remodel their surrounding matrix in response to mechanical and biochemical stimuli. If fibroblasts are affected, extracellular matrix balance could be distorted leading to weak tissues that could fail and eventually prolapse. The biomechanical microenvironment may be further compromised if in surgical treatments for prolapse, non-resorbable polymeric meshes are used to replace tissue function. In spite this fact, little is known about the role of fibroblasts in the pathogenesis of and treatments for POP. It is clear that current treatments are far from optimal and new therapies are needed.10,11 New approaches that promote tissue regeneration are promising alternatives12, including autologous cell-based therapies which would only be feasible to treat acquired (and not genetic) diseases. Therefore, the aims of the present study are: (1) to evaluate vaginal wall fibroblasts contractile capacities; (2) to evaluate vaginal wall fibroblasts mechanoresponses to two different substrates; and (3) to investigate if alterations of fibroblast functions are likely acquired or intrinsic in premenopausal women with cystocele. The study design followed a novel approach that we recently used to identify changes in tissue composition at histological and biochemical levels.13 In that study, each POP patient could be used as her own control because biopsies were taken from the anterior vaginal wall from prolapsed and nonprolapsed sites within the same women. We showed that changes in the connective tissue of the anterior vaginal wall from women with cystocele are an acquired, rather than an intrinsic defect in POP.13 In the present study, we used cells derived from those tissues and we hypothesized that fibroblasts from premenopausal women with cystocele have altered functional characteristics, due to the presence of POP implying that POP in most patients is an acquired condition

113

6

Chapter 6

MATERIALS AND METHODS

6

Patient selection, tissue processing, and cell culture The retrieval of biopsies from patients was approved by the medical ethics committee of Kennemer Gasthuis Hospital (Haarlem, The Netherlands) and informed consent was acquired. Participants were recruited between March 2009 and 2011 following the strict criteria described by Kerkhof et al.13 Exclusion criteria included a history of pelvic surgery or endometriosis, the use of steroids or progestin-only hormone regimen, pelvic malignancy or connective tissue disease affecting tissue remodeling, adhesions or scarring at the biopsy site, surgeons’ judgment that a biopsy may harm the patient, morbid obesity (body mass index [BMI]> 35 kg/m2), diabetes, chronic inflammatory disease or infections, and inability to provide informed consent. Two groups of Caucasian premenopausal women were included: (1) a control group of women undergoing abdominal or laparoscopic hysterectomy (n=8) for benign gynecological diseases with no sign of POP during gynecological examination; and (2) a case group of patients undergoing vaginal hysterectomy and reconstructive pelvic surgery of the anterior vaginal compartment because of a cystocele (n=10). Patients and controls were matched for age and parity (Table 1). Standardized demographic and pertinent clinical information was recorded prospectively and stored in a dedicated database. Full thickness (1 cm2) anterior vaginal wall tissue biopsies were taken from the vaginal cuff at the anterior midline portion of the vaginal wall (non-POP site). From POP cases, extra biopsies were collected from the prolapsed anterior vaginal wall (POP site). Of these 28 samples, primary cell cultures were set-up within 24 hours after tissue extraction and cultured as described previously.14 Cells were grown with cultured medium (Dulbecco’s modified Eagle’s medium-DMEM; Gibco-Life technologies, Paisley, UK) supplemented with 10% fetal bovine serum (FBS, HyClone, South Logan, UT, USA), 100 µg/ml streptomycin, 100 U/ml penicillin, and 250 µg/ml amphotericin-B (Sigma, St. Louis, MO, USA).

Immunohistochemistry The primary cells were characterized by immunohistochemistry with the markers for mesenchymal (vimentin), smooth muscle (desmin), and endothelial cells (Ulex Europaeus Agglutinin-I). A list of antibodies and titrations can be found in Table 2.

Cells were cultured in 96-well plates with a density of 10,000 cells/cm2 for 24 hours and fixed with 4% formaldehyde. Then incubated with blocking buffer (BB: 0.5% BSA, 0.1% Triton-x-100, PBS) for 30 minutes followed by 1 hour incubation with the primary antibody at 4°C. After three washings with BB, secondary antibody was added for 1 hour. Analysis was performed by counting cells in three independent

114

Functional characteristics of fibroblasts

wells using an inverted fluorescent microscope (Leica DMIL Microsystems, Wetzlar, Germany).

Proliferation assay To find differences in the proliferation rate of the studied cells, we seeded fibroblasts in 48-well plates with a starting population of 10,000 cells/cm2 and tested in quadruple at different time points: 1, 2, 3, 4 and 7 days. CyQuant cell proliferation assay kit (Molecular Probes Inc., Life Technologies) was used to evaluate proliferation rate by following manufacturers’ instructions. Fluorescence was measured using a micro-plate reader (SynergyTMHT, Biotek Instruments Inc., Vermont, USA).

Contractility assay A contractility assay was used to evaluate fibroblast-mediated collagen I contraction using a protocol adopted from Lu et al.15 Hydrogels were prepared by mixing: 2.5 mg/ml rat tail collagen type I (BD Biosciences, MA, USA), one part 10x DMEM (Sigma), one part reaction buffer (2.2 g NaHCO3 in 100 ml of 0.05 N NaOH and 200 mM HEPES), and one part cell suspension (1,500,000 cells/ml) in culture media. A mixture volume of 100 µl/well was added to 96-well plates, under sterile conditions and on ice. Polymerization was achieved by incubating for 30 minutes at pH 7.4, 37°C and 5% CO2. Thereafter, gels were covered with culture media and refreshed every 4 days up to 8 days. Pictures were acquired using a BiospectrumAC Imaging System (UVP, Cambridge, UK) at different time points: 0, 2, 3, 4 and 8 days. ImageJ 1.44p software (National Institutes of Health, USA), was used to calculate the percentage of initial surface area which was inversely related to the cells-mediated contraction.

Rheology of collagen hydrogels The viscoelastic properties of the collagen hydrogels were assessed with a stresscontrolled cone-plate rheometer (Paar Physica MCR501; Anton Paar, Graz, Austria) and steel plates. The top cone-plate had 40 mm diameter, an angle of 1° and 49 µm of truncation.16 For the measurements, 300 µl of hydrogel without cells was placed on the bottom plate of the rheometer at constant 37°C and 5% humidity.

Polymerization of the samples was followed under small amplitude oscillating shear measurement with 0.5% strain and 0.5Hz frequency until reaching plateau.

Frequency sweep measurements were performed decreasing from 100 to 0.01 Hz, at constant 0.5% strain amplitude. The elastic (G’) and the viscous modulus (G”) were obtained from values with an angular frequency of 1 Hz (2π rad/sec). The shear modulus (G*) was calculated by the formula: |G*| = √(G’2 + G”2).

115

6

Chapter 6

6

Cyclic mechanical loading A dynamic in vitro model was used to assess the effects of two elastic matrix substrates and cellular mechanoresponses to a continuous loading mimicking continuous respiration: sinusoidal wave, 0.2 Hz, 10% elongation.17 We recently reported that vaginal fibroblasts increase secretion of MMP-2 from 24 to 48 hours, especially when mechanically loaded.14 Based on those results, in the present study we applied the loading regimen for 48 hours. Fibroblasts were seeded at a density of 15,600 cells/cm2 on collagen I-coated or uncoated Bioflex® plates (BioFlex, Flexcell International Corp., McKeesport, PA, USA), and left to attach for 48 hours in culture media supplemented with 10% FBS. Then, 10%-culture media was replaced by culture media containing 1% FBS (HyClone), in order to be able to detect released matrix metalloproteinases (MMPs)-2 and -9. Immediately after, we used a Flexercell FX4000 device (Flexcell International Corp.) to apply continuous cyclic mechanical loading for 48-hours. The Flexercell is a device that uses vacuum force to stretch the cells that are seeded on top of the elastic silicone membranes of the Bioflex plates. Unloaded cells cultured under the same conditions were used to evaluate substrate effect and as static controls. After the loading period cell lysates were collected for total DNA and gene expression; conditioned media was collected and analysed for secreted MMP-2, MMP-9 and TIMP-2. For total DNA and gene expression analysis, cells were lysed in a solution (1:100) of β-mercaptoethanol (Sigma-Aldrich) and RA1 buffer (Macherey-Nagel, Bioke, Leiden, The Netherlands).

According to the suppliers’ specifications, DNA and RNA were isolated using NucleoSpin TriPrep kit (Bioke).

Total DNA Total DNA was measured using a CyQuant kit and following manufacturers’ instructions (Molecular Probes Inc., Life Technologies). Fluorescence was measured with a SynergyTMHT (Biotek Instruments Inc.).

Gene expression analysis Total RNA had a final concentration of 250 ng/ml, and was reverse-transcribed using SuperScript VILO cDNA synthesis kit (Life technologies). Gene expression of KI67, alpha-1(I) procollagen (Col 1α1), alpha-1(III) procollagen (Col 3α1), matrix metalloproteinases (MMP) -2, -9, -14 and tissue inhibitor of metalloproteinases (TIMP)-1, -2 and -3 were normalized to the housekeeping genes tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta popypeptide (Ywhaz) and hypoxanthine-guanine phosphoribosyltransferase (HPRT). Genes were evaluated using the primers listed in Table 3 (Life technologies), with the SYBR Green Reaction Kit following suppliers specifications (Roche,

116

Functional characteristics of fibroblasts

Diagnostics, Mannheim, Germany) and measured by RT-PCR in a Light Cycler 480 device (Roche). Gene expression levels were normalized using a factor derived from the equation √(Ywhaz x HPRT). Crossing points were assessed using the Light Cycler software (version 4) and plotted versus serial dilutions of cDNA derived from a human universal reference total RNA (Clontech Laboratories Palo Alto, CA, USA).

Secreted MMP-2 and MMP-9 The enzymatic activity of MMPs -2 and -9 present in the conditioned media were detected using Novex zymogram gels (10% zymogram gelatin gel, Life Technologies) following manufacturers’ protocol. Visualization of dark bands of gelatinolytic activity was facilitated by eStain protein device (GeneScript, Piscataway, NJ, USA).

Images were acquired with BiospectrumAC (UVP) and zymogram quantification of the density of the bands was performed using ImageJ (NIH). Values were calculated as follows: Total MMP-2 = inactive MMP-2 + active MMP-2; and percentage of active MMP-2 = (active MMP-2 x 100)/Total MMP-2.

Secreted TIMP-2 Tissue inhibitor of metalloproteinase (TIMP)-2 inhibits MMP-2 (or collagenase IV) with a 1:1 stoichiometry (Goldberg et al., 1989). Therefore, we quantified released TIMP-2 using the TIMP-2 Human ELISA kit ab100653 (Abcam plc., Cambridge, UK) following the supplier’s instructions. Colour intensity was measured at 450 nm using SynergyTMHT (Biotek).

Statistical analyses The primary outcome of the study was to detect a difference in fibroblast-mediated collagen contraction from cells derived from prolapsed and non-prolapsed tissues from premenopausal women with cystocele. In a previous study, the average of the contraction factor after 48 hours calculated as the ratio of the diameter of a contracted gel to the initial diameter of the well from pelvic floor myofibroblasts of women with and without severe prolapse was 1.8 ± 0.3 and 4.4 ± 1.9 respectively.18 Based on these data, 8 women were required in each group to detect a difference of at least 25% for a power of 80% at the 0.05 significance level using an independent sample t-test.

Statistical analyses were performed using the software Prism version 5.02 (GraphPad Software Inc., La Jolla, CA, USA). Data were expressed as the mean with either the standard deviation (SD) for individual measurements, or the standard error of the mean (SEM) for grouped values. Comparisons between the control and case nonPOP site were done with unpaired t-test. Paired t-test was used in POP cases to

117

6

Chapter 6

evaluate differences between POP and non-POP sites. One-sample t-test compared to 1 was used to analyze the ratio between percentage of collagen contraction by fibroblasts derived from POP and non-POP site from each case evaluated. One-way analysis of variance (ANOVA) followed by Tukey-Kramer’s post-hoc test was used to test differences between all the groups. Patient characteristics were evaluated by Mann-Whitney or Fisher's exact non-parametric tests. Differences were considered significant at 5% level (p < 0.05).

RESULTS Immunohistochemistry analysis showed that the studied cells were from the mesenchymal lineage (vimentin positive), and none were endothelial cells (UEA-1 negative). Cultures were at least 99% smooth muscle cell free (desmin negative).

Proliferation rates were similar in all cells studied, independent of the biopsy site (Fig. 1).

A contractility assay was performed to evaluate fibroblasts contractile capacities over time. We used collagen I hydrogels with shear modulus (G*) of 12.73 ± 6 Pa, elastic modulus (G’) of 13.73 ± 4.94 Pa, and viscous modulus (G”) of 2.33 ± 0.79 Pa. Fibroblasts-mediated collagen contraction of the POP site within the same patient

6

l C

Figure 1. Proliferation rate of fibroblasts derived from prolapsed (case POP site) and nonprolapsed (control and case non-POP site) tissues. The cells were cultured on 48-well plates at different time points and total DNA was measured by CyQuant. Data represents the mean ± SEM. No differences were found by ANOVA followed by Tukey-Kramer’s post-hoc test.

118

Functional characteristics of fibroblasts

was lower than the non-POP site (Fig. 2B) in 80% of the cases studied (Supplementary Figure 1). No differences were found between contraction of fibroblasts derived from healthy controls and non-POP site from POP cases (Fig. 2A).

The effects of two matrix substrates were evaluated using elastic silicone membranes coated with collagen I or uncoated, and cellular mechanoresponses were tested by stretching fibroblasts for 48 hours. We used total DNA as an indicator of cell attachment and the gene KI67 as an indicator of cell proliferation (Fig. 3). Cell attachment was facilitated by collagen-coated surfaces (Fig. 3A), and proliferation was up-regulated on uncoated plates (Fig. 3D). Cyclic mechanical loading inhibited cell proliferation (Fig. 3E and F) and decreased cell attachment on uncoated (Fig. 3C) but not on collagen-coated plates (Fig. 3B). No apparent differences on cell attachment and proliferation were seen between cells from prolapsed (POP site) and non-prolapsed tissues (control and non-POP site).

To evaluate the effects of the different experimental conditions on the capacity of the fibroblasts to remodel the extracellular matrix (ECM), matrix metalloproteinase (MMP)-2, -9 and tissue inhibitor of metalloproteinase-2 (TIMP-2) protein secretion were evaluated. No differences were found in total levels of released MMP2 between controls and non-POP site fibroblasts from POP cases. Both cell populations secreted significantly more MMP-2 in uncoated than in collagen-

6

Figure 2. Fibroblasts-mediated collagen contraction. The figure shows the percentage (%) of the initial surface area â&#x20AC;&#x201C; which is inversely proportional to the fibroblast-mediated collagen contraction â&#x20AC;&#x201C; at different time points for: (A) non-POP sites (Control vs. Case non-POP), and for (B) POP cases (Case non-POP vs. Case POP). Each bar represents the average of the means of control (n=8) or POP cases (n=10) Âą SEM. *p<0.05, **p<0.01; comparing non-POP vs. POP site by paired t-test.

119

Chapter 6

Figure 3. Effects of surface substrate and loading on fibroblasts attachment and proliferation. Fibroblasts were cultured on collagen (A, B, D and E) or uncoated plates (A, C, D and F) and subjected or not to 48 hours of cyclic mechanical loading (-/+ CML). We used total DNA measured by CyQuant as an indicator of cell attachment, and the gene KI67 as an indicator of cell proliferation. The effect of surface substrate is shown in figures (A) and (D); while the effect of mechanical loading is shown for collagen I in figures (B) and (E), and for uncoated plates in figures (C) and (F). Each bar represents the average of the means Âą SEM. *p<0.05, **p<0.01 or ***p<0.001 by paired t-test.

6

120

Figure 4. Effects of surface substrate and loading on secreted MMP-2 and TIMP-2. Conditioned media released by fibroblasts from controls (- POP site) or POP cases (-/+ POP site) cultured on collagen or uncoated plates after 48 hours of cyclic mechanical loading (-/+ CML) were analysed for: MMP-2, MMP-9 and TIMP-2. (A) Representative zymograms showing MMP-2 and -9.

Figure (B) depicts quantitative data from zymograms comparing released MMP-2 on collagen vs. uncoated plates without loading (- CML). Total MMP-2 = (pro MMP-2 + active MMP-2)/(static pro MMP-2). The effects of mechanical loading on: (C) total MMP-2 and (D) TIMP-2 were evaluated by one sample t-test compared to 1 with *p<0.05. CML on uncoated plates promoted secretion of total MMP-2 and not TIMP-2 by fibroblasts. TIMP-2 was measured by ELISA. Figure (E) shows the percentage (%) of activation of MMP-2 relative to total MMP-2 on uncoated plates. Each bar represents the average of the means Âą SEM. Differences between control vs. POP site (+p<0.05) and between case non-POP vs. POP site (##p<0.01) were identified by ANOVA followed by Tukey-Kramerâ&#x20AC;&#x2122;s post-hoc test. Paired t-test was used to compare collagen I vs. uncoated plates: *p<0.05 or **p<0.01.

Functional characteristics of fibroblasts

121

6

Chapter 6

coated plates. POP site fibroblasts secreted less MMP-2 than control and nonPOP site fibroblasts on collagen-coated plates (Fig. 4B). Stretching fibroblasts on uncoated plates induced production (Fig. 4C) and activation of MMP-2 which was more pronounced in non-POP than in POP fibroblasts (Fig. 4E). Secreted TIMP-2 was not affected by loading (Fig. 4D). Released MMP-9 (Fig. 4A) and active MMP2 on collagen-coated plates (Fig. 4A, left panel), were below detection levels or completely absent.

A panel of ECM remodeling related genes were evaluated and results can be found in Tables 4, 5 and 6. Gene expressions of Col 3Îą1, MMP-9 and TIMP-2 were upregulated in fibroblasts cultured on collagen-coated plates (Table 4). In uncoated plates, cyclic mechanical loading increased gene expression of MMP-14 in all the cells studied, but MMP-2 and TIMP-2 only in fibroblasts from the prolapsed site (Table 6).

DISCUSSION

6

In pelvic organ prolapse (POP) tissue strength is lost and quality of the extracellular matrix (ECM) is compromised.3,13 Alterations in cells derived from prolapsed tissues have also been observed.14,18,19 Whether these changes in fibroblasts are induced by the modified matrix in the vaginal tissue of patients with POP, or whether there is an intrinsic defect of the cells itself, still remains unclear. Basic understanding about cell-matrix interactions in women with POP is necessary to develop new therapeutic strategies. It is important to discriminate between acquired and intrinsic defects because for genetic diseases treatments with autologous cells would not be an appropriate therapy. In the present study, we evaluated the functional characteristics of vaginal wall fibroblasts of healthy controls and POP patients by assessing their contractile properties and their response to cyclic mechanical loading. Furthermore we analyzed whether this response is affected by the presence of artificial polymeric substrates, which is of importance in the development of new scaffolds.

We used a novel approach in which study samples were paired in POP patients (each patient was her own control) and was conducted under strict patient inclusion criteria, ruling out any deterioration due to ageing processes and menopause.

Tissue samples were taken and processed in a very standardized manner, and cell cultures were at least 99% free of smooth muscle cells. No differences were found in proliferation rates of the cells studied, suggesting that the quality, and not the quantity, of the fibroblast was responsible for the results.

122

Functional characteristics of fibroblasts

Our data shows that fibroblast mechanoresponses from the non-POP site of the anterior vaginal wall from patients with prolapse do not differ in any of the parameters evaluated with cells derived from the same site in healthy controls.

However, there were clear differences between fibroblasts derived from prolapsed and non-prolapsed tissues within the same women. Fibroblasts from the POP site showed delayed fibroblast-mediated collagen contraction and lower production of MMP-2 on collagen-coated plates. Mechanoresponses to cyclic mechanical loading on uncoated plates were also different: activation of MMP-2 was more pronounced in cells from non-prolapsed tissues, whereas up-regulation of MMP-2 and TIMP-2 gene expressions were only seen in POP-site fibroblasts.

Aberrant contractile capacities of fibroblasts have been associated with impaired wound healing in soft tissues.20-22 The hydrogels used in the present study had a shear modulus of 12.73 Pa, which is comparable to the elastic modulus of the ECM in early wounds.23 A decreased fibroblast-mediated contraction of collagen gels by cells from the vaginal wall of severe POP patients compared to healthy controls has been reported previously.18,19 By the intra-patient comparisons we could: (1) confirm these findings, and (2) demonstrate that in 80% of cases the lower cellular contractile capacities are an acquired feature in the POP prolapsed tissues.

In concordance with the trend of lower functional characteristics, we found that fibroblasts from the POP site secreted lower total MMP-2 than the non-POP site cells. Previous studies showed no differences on enzymatic activity on collagen coated plates between vaginal fibroblasts from women with prolapse; we suggest that this may be due to the low sample size.24 Recently, our group reported delayed cell alignment and lower activation of MMP-2 by mechanical loading in uncoated silicone plates by severe POP fibroblasts.14 Results were confirmed here as enzymatic activation on uncoated surfaces seemed lower in fibroblasts from the prolapsed site. Interestingly, after 48 hours of cyclic mechanical loading, MMP-2 and TIMP-2 gene expressions were found up-regulated only in POP-site fibroblasts. We speculate that this apparent discrepancy between gene expression and enzymatic activity may be due to the generally delayed mechanoresponses in POP fibroblasts. Mechanoresponsive genes reached plateau levels faster in the non-POP fibroblasts resulting in synthesis and secretion of active enzyme within 48h, and likely concomitant mRNA down-regulation to basal levels in the 24-48h time frame. In contrast, the reduced mechanosensitivity of POP fibroblasts might result in a delayed mRNA up-regulation. Consequently, the peak level of these genes might be reached after 48 hours with concomitant delayed secretion of MMP-2.

123

6

Chapter 6

The surface substrate also appeared to influence fibroblasts responses and cellmatrix interactions. Collagen-coating promotes cell attachment and alignment.14 Coating also increased gene expression of the extracellular matrix remodeling factors: collagen 3Îą1, TIMP-2 and MMP-9, showing that vaginal fibroblasts are mechanoresponsive and can sense and remodel their surrounding matrix.

The current study also indicates that collagen coating improves cell-substrate interactions in vitro.

6

What does this mean for our understanding of POP and the design of optimized treatment modalities? Clinically, development and progression of prolapse has been associated with conditions that overstretch the vaginal wall by excessive mechanical loading like giving birth, chronic coughing or obesity.5,6,7 Proper tissue remodeling, wound healing and repair are fundamental to maintain mechanical stability of the supportive tissues in the pelvic floor. If healing is frustrated, the vaginal tissue would not regain its strength and prolapse could eventually occur after continued excessive mechanical loading. In current clinical practice, increasing numbers and types of surgical implants have been launched over the last decade to restore the biomechanical balance.25 However, evidence of efficacy for these products is lacking and rates of complications as erosions, pain, infection and vaginal shrinkage are unacceptably high at 10%.26 Our findings of delayed cellular mechanoresponses in POP fibroblasts suggest altered functional characteristics of fibroblasts from prolapsed tissues in women with POP. Thus, prolapsed fibroblasts may be unable to respond and restore ECM homeostasis, in the same manner as cells from non-prolapsed tissues to changes in the micro-environment. This may at least partly explain the high failure rate in native tissue repair. In case of artificial polymeric meshes/substrates used in vaginal reconstructive surgery, our data indicate that collagen-coating of meshes may improve treatment outcome. This is supported by recent findings that highly purified collagen coating enhances tissue integration of polypropylene meshes in rats.27 Cell based tissue engineering strategies potentially provide attractive alternatives to current surgical reconstruction of POP.12 Combining biomaterials with unaffected autologous cells (like fibroblasts or stem cells) or even induced pluripotent stem cell (iPSC) lines from vaginal tissue in which the effects of age can be potentially erased28, could stimulate vaginal tissue repair. These new approaches can only be implemented in patients with an acquired defect and not with a genetic condition.

Since our data shows that fibroblasts from prolapsed tissues have altered functional characteristics compared to cells from non-prolapsed tissues within the same patient and that the cells derived from non-prolapsed tissues show similar functional

124

Functional characteristics of fibroblasts

characteristics to healthy controls, we conclude that for most patients the prolapse condition is an acquired rather than an intrinsic defect. This conclusion is in line with our recent findings on tissue samples from the same premenopausal women where we showed that the changes in the ECM composition of those tissues are an acquired defect in POP.13 Therefore, autologous cell-based therapies could be considered as alternative treatments for most cases of cystocele.

Since prolapse affects both tissue components of the anterior vaginal wall â&#x20AC;&#x201C; the extracellular matrix and the cells that are embedded within â&#x20AC;&#x201C; development of new treatments for POP should be supported by research on disease-treatment-specific models both in vitro and in vivo. It is important to note that results from this study were obtained in vitro under controlled experimental set-ups, allowing sound conclusions to be drawn about specific parameters, but they may not reflect entirely the in vivo situation. Nevertheless, our models provide valuable information about the influence of the prolapsed tissue in fibroblasts behaviour and the possible implications for current and future treatments for pelvic organ prolapse.

In conclusion, fibroblasts from the prolapsed anterior vaginal wall from POP patients show altered functional characteristics compared to non-POP site and healthy fibroblasts. Such outcome points in the direction of an acquired, rather than an intrinsic defect and seems to be the effect rather than the cause of the disease, which should be taken into account when improving treatments for pelvic organ prolapse.

ACKNOWLEDGEMENTS Authors would like to thank the AMOLF Institute Amsterdam and Suzanne Detiger from the VU medical centre for assistance with the rheological measurements.

125

6

Chapter 6

Supplementary figure 1. The ratio between collagen I contraction by fibroblasts derived from prolapsed (POP) and non-prolapsed (non-POP) site from each case evaluated. Each bar represents the mean of five measurements Âą SD. No differences = 1; POP site less contractile than non-POP site > 1; POP site more contractile than non-POP site < 1. *p<0.05, **p<0.01, ***p<0.001; by one-sample t-test compared to 1.

6

126

Functional characteristics of fibroblasts

Table 1. Patient characteristics.

Characteristic Age

Case (n = 10)

P-value

45.13 ± 5.4

42.50 ± 6.2

0.360†

2.5 (1-3)

2 (1-4)

0.336†

24.31 ± 5.43

27.86 ± 6.68

0.163†

Current (%)

3 (37.5%)

2 (20%)

0.608‡

Previous (%)

4 (50%)

5 (50%)

0.588‡

a

Parity BMI

Control (n = 8)

b

a

Smoking

c

a

b

c

Data are presented as: mean ± SD , median (range) , or number of patients (%) .

Non-parametric statistical tests: Mann-Whitney†; Fisher's exact‡.

Table 2. List of antibodies for immunohistochemistry.

Antibody

Dilution

Source

Primary

1:150

DakoCytomation, Copenhagen, Denmark

Desmin mouse anti-human clone D33

Primary

1:250

DakoCytomation, Copenhagen, Denmark

Fluorescein labelled Ulex Europaeus Agglutinin – I (UEA-1)

Primary

1:200

Vectro Laboratories, Burlingame, CA, USA

Goat anti-mouse Alexa fluor 555

Secondary

1:800

Life technologies, Paisley, UK

Goat anti-mouse Alexa fluor 488

Secondary

1:800

Life technologies, Paisley, UK

Vectashield mounting medium with DAPI

Nuclei staining

1 drop

Vectro Laboratories, Burlingame, CA, USA

Monoclonal clone V9

mouse

anti-vimentin,

127

6

Chapter 6

Table 3. Primer sequences used for RT-PCR. Target gene

6

Oligonucleotide sequence

Annealing temperature (°C)

Product Size (bp)

Ki-67

Forward Reverse

5’ CCCTCAGCAAGCCTGAGAA 3’ 5’ AGAGGCGTATTAGGAGGCAAG 3’

57

202

Col 1α1

Forward Reverse

5’ TCCAACGAGATCGAGATCC 3’ 5’ AAGCCGAATTCCTGGTCT 3’

57

191

Col 3α1

Forward Reverse

5’ GATCCGTTCTCTGCGATGAC 3’ 5’ AGTTCTGAGGACCAGTAGGG 3’

56

279

MMP-2

Forward Reverse

5’ GGCAGTGCAATACCTGAACA 3’ 5’ AGGTGTGTAGCCAATGATCCT 3’

56

253

MMP-9

Forward Reverse

5’ TGACAGCGACAAGAAGTG 3’ 5’ CGTGGCTCAGGTTCAGG 3’

57

219

MMP-14

Forward Reverse

5’ CTGAGATCAAGGCCAATGTTC 3’ 5’ CTCACGGATGTAGGCATAGG 3’

56

206

TIMP-1

Forward Reverse

5’ CACAGACGGCCTTCTGCAA 3’ 5’ TTGTGGGACCTGTGGAAGT 3’

63

211

TIMP-2

Forward Reverse

5’ CTGAACCACAGGTACCAGAT 3’ 5’ TGCTTATGGGTCCTCGATG 3’

63

237

TIMP-3

Forward Reverse

5’ AGGACGCCTTCTGCAACTC 3’ 5’ GCTTCCGTATGGATGTACTG3’

63

163

Ywhaz

Forward Reverse

5’ GATGAAGCCATTGCTGAACTTG 3’ 5’ CTATTTGTGGGACAGCATGGA 3’

56

229

HPRT

Forward Reverse

5’ GCTGACCTGCTGGATTACAT 3’ 5’ CTTGCGACCTTGACCATCT 3’

56

260

Col1α1, α1(I)procollagen; Col3α1, α1(III)procollagen; MMP, matrix metalloproteinase; TIMP, tissue inhibitor of metalloproteinases; Ywhaz, tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide; HPRT, hypoxanthine-guanine phosphoribosyltransferase.

128

Functional characteristics of fibroblasts

Table 4. Extracellular matrix remodeling related genes on two different substrates after 48 hours of culture.

Control

Case non-POP site

Case POP site

(n=8)

(n=10)

(n=10)

Gene Collagen I

Uncoated

COL 1A1

1.04 ± 0.22

0.75 ± 0.09

COL 3A1

0.74 ± 0.08

0.45 ± 0.04

MMP-2

1.29 ± 0.13

1.10 ± 0.12

MMP-9

0.68 ± 0.11

**

Collagen I

Uncoated

0.90 ± 0.15

0.83 ± 0.21

0.74 ± 0.06

0.46 ± 0.09

1.41 ± 0.10

1.28 ± 0.15

0.39 ± 0.05

*

0.71 ± 0.07

0.35 ± 0.06

*

1.01 ± 0.08

0.74 ± 0.09

0.71 ± 0.09

0.89 ± 0.17

MMP-14

0.95 ± 0.06

0.66 ± 0.07

TIMP-1

0.76 ± 0.13

0.94 ± 0.23

TIMP-2

1.09 ± 0.06

0.71 ± 0.03

TIMP-3

0.53 ± 0.06

0.75 ± 0.11

***

1.24 ± 0.08

0.84 ± 0.09

0.50 ± 0.03

0.66 ± 0.05

**

**

**

Collagen I

Uncoated

0.95 ± 0.12

0.73 ± 0.14

0.78 ± 0.06

0.46 ± 0.05

1.19 ± 0.07

1.13 ± 0.06

0.84 ± 0.17

0.33 ± 0.04

*

0.81 ± 0.05

0.60 ± 0.04

**

0.57 ± 0.05

0.67 ± 0.07

1.06 ± 0.06

0.77 ± 0.04

0.58 ± 0.07

0.81 ± 0.10

***

*

Data are the mean ± SEM. Paired t-test was used to compare collagen I vs. uncoated for control, case nonPOP site or case POP site (* p<0.05, ** p<0.01, *** p < 0.001).

Table 5. Extracellular matrix remodeling related genes on collagen I coated plates after 48 hours of cyclic mechanical loading.

Control

Case non-POP site

Case POP site

(n=8)

(n=10)

(n=10)

Gene - CML

+ CML

- CML

+ CML

- CML

+ CML

COL 1A1

1.04 ± 0.22

1.03 ± 0.20

0.90 ± 0.15

0.94 ± 0.16

0.95 ± 0.12

0.96 ± 0.14

COL 3A1

0.74 ± 0.08

0.75 ± 0.11

0.74 ± 0.06

0.78 ± 0.06

0.78 ± 0.06

0.76 ± 0.11

MMP-2

1.29 ± 0.13

1.22 ± 0.06

1.41 ± 0.10

1.19 ± 0.11

1.19 ± 0.07

1.06 ± 0.11

MMP-9

0.68 ± 0.11

0.72 ± 0.18

0.71 ± 0.07

0.66 ± 0.08

0.84 ± 0.17

0.57 ± 0.13

MMP-14

0.95 ± 0.06

0.94 ± 0.10

1.01 ± 0.08

0.92 ± 0.10

0.81 ± 0.05

0.82 ± 0.07

TIMP-1

0.76 ± 0.13

0.74 ± 0.13

0.71 ± 0.09

0.63 ± 0.08

0.57 ± 0.05

0.50 ± 0.05

1.06 ± 0.06

0.87 ± 0.09

0.58 ± 0.07

0.54 ± 0.08

TIMP-2

1.09 ± 0.06

0.95 ± 0.08

1.24 ± 0.08

0.92 ± 0.09

TIMP-3

0.53 ± 0.06

0.49 ± 0.05

0.50 ± 0.03

0.44 ± 0.04

*

Data are the mean± SEM. * p<0.05; comparing cyclic mechanical loading (CML) - vs. + by paired t-test.

129

6

Chapter 6

Table 6. Extracellular matrix remodeling related genes on uncoated plates after 48 hours of cyclic mechanical loading.

Control

Case non-POP site

Case POP site

(n=8)

(n=10)

(n=10)

Gene - CML

+ CML

- CML

+ CML

- CML

+ CML

COL 1A1

0.75 ± 0.09

0.90 ± 0.11

0.83 ± 0.21

0.86 ± 0.14

0.73 ± 0.14

0.75 ± 0.12

COL 3A1

0.45 ± 0.04

0.47 ± 0.07

0.46 ± 0.09

0.54 ± 0.06

0.46 ± 0.05

0.48 ± 0.06

MMP-2

1.10 ± 0.12

1.14 ± 0.08

1.28 ± 0.15

1.41 ± 0.11

1.13 ± 0.06

1.35 ± 0.09

MMP-9

0.39 ± 0.05

0.31 ± 0.04

0.35 ± 0.06

0.32 ± 0.04

0.33 ± 0.04

0.44 ± 0.12

MMP-14

0.66 ± 0.07

0.96 ± 0.10

*

0.74 ± 0.09

1.04 ± 0.12

0.60 ± 0.04

0.96 ± 0.10

**

TIMP-1

0.94 ± 0.23

1.06 ± 0.27

*

0.89 ± 0.17

0.99 ± 0.16

0.67 ± 0.07

0.77 ± 0.07

*

TIMP-2

0.71 ± 0.03

0.81 ± 0.07

0.84 ± 0.09

0.88 ± 0.03

0.77 ± 0.04

0.92 ± 0.06

*

TIMP-3

0.75 ± 0.11

0.69 ± 0.09

0.66 ± 0.05

0.64 ± 0.09

0.81 ± 0.10

0.89 ± 0.11

***

*

Data are the mean± SEM. * p<0.05, ** p<0.01, *** p < 0.001; comparing cyclic mechanical loading (CML) vs. + by paired t-test.

6

130

Functional characteristics of fibroblasts

REFERENCE LIST 1.

2.

3.

4.

5.

6.

7.

8.

9.

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

Bartoletti R (2006) Genetic influence on stress urinary incontinence and pelvic organ prolapse.

Eur Urol 51, 884-886.

Kerkhof MN, Hendriks L, Brölmann HAM (2009) Changes in connective tissue in patients with pelvic organ prolapse—a review of the current literature.

Int Urogynecol J Pelvic Floor Dysfunct 20, 461-474.

Word RA, Pathi S, Schaffer JI (2009) Pathophysiology of pelvic organ prolapse.

Obstet Gynecol Clin North Am 36, 521-539.

Smith FJ, Holman CDJ, Moorin RE, Tsokos N (2010) Lifetime risk of undergoing surgery for pelvic organ prolapse. Obstet Gynecol 116, 1096-1100.

DeLancey JO (1993) Anatomy and biomechanics of genital prolapse.

Clin Obstet Gynecol 36, 897-909.

Weber AM, Ritcher HE (2005) Pelvic organ prolapse. Obstet Gynecol 106, 615-34.

Jelovsek JE, Maher C, Barber MD (2007) Pelvic organ prolapse. Lancet 396, 1027-1038.

Levin PJ, Visco AG, Shah SH, Fulton RG, Wu JM (2012) Characterizing the phenotype of advanced pelvic organ prolapse. Female Pelvic Med Reconstr Surg 18, 299-302.

Hendrix SL, Clark A, Nygaard I, Aragaki A, Barnabei V, Mc Tiernan A (2002) Pelvic organ prolapse in women’s health initiative: gravity and gravidity. Am J Obstet Gynecol 186, 1160-1166.

Lensen EJM, Withagen MIJ, Kluivers KB, Milani AL, Vierhout ME (2013) Surgical treatment of pelvic organ prolapse: a historical review with emphasis on the anterior compartment.

Int Urogynecol J 24, 1593-1602.

Deprest J, Feola A (2013) The need for preclinical research on pelvic floor reconstruction.

BJOG 120, 141-143.

Boennelycke M, Gras S, Lose G (2013) Tissue engineering as a potential alternative or adjunct to surgical reconstruction in treating pelvic organ prolapse. Int Urogynecol J 24, 741-747.

Kerkhof MH, Ruiz-Zapata AM, Bril H, Bleeker MCG, Belien JAM, Stoop R, Helder MN (2013) Changes in tissue composition of the vaginal wall of premenopausal women with Prolapse.

Am J Obstet Gynecol 210, 168.e1-9.

Ruiz-Zapata AM, Kerkhof MH, Zandieh-Doulabi B, Brölmann HAM, Smit TH, Helder MN (2013) Fibroblasts from women with pelvic organ prolapse show differential mechanoresponses depending on surface substrates. Int Urogynecol J 24, 1567-1575.

Lu Z, Doulabi BZ, Huang C, Bank RA, Helder MN (2010) Collagen type II enhances chondrogenesis in adipose tissue-derived stem cells by affecting cell shape. Tissue Eng Part A 16, 81-90.

Piechocka IK, Van Oosten ASG, Breuls RGM, Koenderink GH (2011) Rheology of heterotypic collagen networks. Biomacromolecules 12, 2797-2805.

Blaauboer ME, Smit TH, Hanemaaijer R, Stoop R, Everts V (2011) Cyclic mechanical stretch reduces myofibroblast differentiation of primary lung fibroblasts.

Biochem Biophys Res Commun 404, 23-27.

Meyer S, Achtari C, Hohlfeld P, Juillerat-Jeanneret L (2008) The contractile properties of vaginal myofibroblasts: is the myofibroblasts contraction force test a valuable indication of future prolapse development? Int Urogynecol J Pelvic Floor Dysfunct 19, 1399-1403.

Poncet S, Meyer S, Richard C, Aubert JD, Juillerat-Jeanneret L (2005) The expression and function of the endothelin system in contractile properties of vaginal myofibroblasts of women with uterovaginal prolapse. Am J Obstet Gynecol 192, 426-432.

Tomasek JJ, Gabbiani G, Hinz B, Chaponnier C, Brown RA (2002) Myofibroblasts and mechanoregulation of connective tissue remodeling. Nat Rev Mol Cell Biol 3, 349-363.

Hinz B, Gabbiani G (2003) Cell-matrix and cell-cell contacts of myofibroblast: role in connective tissue remodeling. Thromb Haemost 90, 993-1002.

131

6

Chapter 6

22.

23.

24.

25.

26.

27.

28.

Li B, Wang JH. Fibroblasts and myofibroblasts in wound healing: force generation and measurement (2011) J Tissue Viability 20, 108-120.

Wipff PJ, Hinz B (2009) Myofibroblasts work best under stress. J Bodyw Mov Ther 13, 121-127.

Zong W, Jallah ZC, Stein SE, Abramowitch SD, Moalli PA (2010) Repetitive mechanical stretch increases extracellular collagenase activity in vaginal fibroblasts.

Female Pelvic Med Reconstr Surg 16, 257-262.

Gupta-Rogo L, Rodrigues LV, Litwin MS, Herzog TJ, Neugut AI, Lu YS, Raz S, Hershman DL, Wright JD (2012) Trends in surgical mesh use for pelvic organ prolapse from 2000 to 2010.

Obstet Gynecol 120, 1105-1115.

Abed H, Rahn DD, Lowenstein L, Balk EM, Clemons JL, Rogers RG (2011) Incidence and management of graft erosion, wound granulation, and dyspareunia following vaginal prolapse repair with graft materials: a systematic review. Int Urogynecol J 22, 789-798.

Siniscalchi RT, Melo M, Palma PC, Fabbro IM, De Campos Vidal B, Riccetto CL (2013) Highly purified collagen coating enhances tissue adherence and integration properties of monofilament polypropylene meshes. Int Urogynecol J 24, 1747-1754.

Wen Y, Wani P, Zhou L, Baer T, Phadnis SM, Reijo Pera RA, Chen B (2013) Reprogramming of fibroblasts from older women with pelvic floor disorders alters cellular behavior associated with donor age. Stem Cells Transl Med 2, 118-128.

6

132

Functional characteristics of fibroblasts

6

133

7 General discussion and future perspectives

Chapter 7

GENERAL DISCUSSION POP is a common, multifactorial disease with relatively high recurrence rates and no optimal treatment. Risk factors are well defined, but the exact pathogenesis is still unclear. Tissue engineering may provide promising alternatives to the current, sub-optimal treatments. Basic understanding of the changes in the connective tissue and cells of the vaginal wall is necessary to develop these new therapeutic strategies. In this thesis we investigated to what extent POP is an intrinsic or an acquired disease. In the following section we have summarized our main results and discuss these findings in a broader perspective.

Changes in connective tissue in pelvic organ prolapse Based on large epidemiological studies, POP is considered to be a multifactorial problem. Numerous environmental factors including, ethnicity, parity, increased abdominal pressure, age, menopause and smoking are important risk factors in developing POP.1 However, genetic predisposition is widely recognized as a contributing factor to the development and progression of POP as well. The high relative risk for the development of POP in women with a positive family history2 and the higher frequency of POP in women with genetic diseases of connective tissues such as Ehlersâ&#x20AC;&#x201C;Danlos, Marfan syndrome, or cutis laxa, point to connective tissue disorders as the most likely etiological factor in POP.

7

In 1996 Jackson3 formulated a hypothesis on the pathogenesis of POP based on his study of collagen in the pelvic floor tissues of premenopausal women with uterine prolapse and cystocele. He postulated that in young patients with POP, a higher turn-over of immature collagen resulted in a bulk of deficient, glycated, old collagen. This glycated collagen is brittle and highly susceptible to rupture, but also difficult to degrade. These conditions may result in a high susceptibility to POP. We performed a literature study to summarize the current understanding of changes in pelvic floor connective tissue in women with POP. We reviewed the literature bearing Jacksonâ&#x20AC;&#x2122;s hypothesis in mind. Despite numerous shortcomings in the available literature, the hypothesis of Jackson still appeared to be valid.

(Chapter 2) In prolapsed tissue, the fibroblasts produce more collagen, and show an increased MMP-2 and MMP-9 activity and a decrease of the activity of TIMP-1, resulting in an increased turnover of collagen. In particular the breakdown of immature newly formed collagen is increased. The total collagen content is generally lower in POP patients compared with non-POP patients. The content of glycated end products

136

General discussion and future perspectives

(AGEs) is increased in patients with POP, which makes them susceptible for developing POP over time. Jackson found no change in the collagen type I to type III ratio. Most studies however found an increase in type III4-6 or a decrease in type I6-8 thus resulting in a decreased I/III ratio. This decrease in the ratio of collagen type I to collagen type III results in thinner, less strong collagen fibers, and is responsible for a decrease in biomechanical strength of the tissues.

Also an increase in the expression of both collagen type III and MMP-9 expression is typical of tissue that is remodeling after injury9 or accommodating to a progressively increasing mechanical load.10;11 In particular, the increase in MMP-9 in women with POP found by Jackson and confirmed by Moalli6 has been associated with tissue remodeling in bone12, coronary artery13 and healing dermal wounds.14 A novel approach In order to shed light on the important question of cause (intrinsic) and effect (acquired) in POP, we introduced a novel research approach. Not only the tissue of premenopausal age-matched women without POP, but also the unaffected tissue of the very same patient is the control for her prolapsed tissue. Biopsies were taken from the prolapsed anterior vaginal wall (POP site) and from the precervical non-prolapsed vaginal wall (non-POP site). Also precervical anterior vaginal wall tissues of age-matched controls were studied. The tissues were subjected to a multiparameter analysis in order to compare gene expression data, functionality of cells and tissue characteristics. Any difference between the non-prolapsed precervical region of women with POP and the precervical region of healthy controls would hint at intrinsic defects or genetic predispositions in the tissue of women with POP. Differences between the POP site and the non-POP site within the same patient, however, would most likely be caused by the prolapse.

Changes in connective tissue under mechanical load The data of the immunohistochemical and biochemical analysis showed no differences between POP and healthy control group in the precervical vaginal wall tissues with respect to the different components of the extracellular matrix (chapter 3). However, we observed differences between the prolapsed tissue of a POP-patient, compared to non-prolapsed tissue of the same patient. There was a significant increase in mature pyridinoline cross-links in collagen molecules, and in the number of smooth muscle cells in the muscularis layer of the anterior vaginal wall. In addition, there was a tendency towards a higher amount of collagen III as previously described. These changes are most likely an effect of the prolapsed and therefore overstrechted vaginal wall.

137

7

Chapter 7

Pyridinoline cross-links are the major type of mature cross-links in collagen in the fascia of the anterior vaginal wall.15 An increase in this cross-link density will result in slower metabolisation of these collagens, making them susceptible to nonenzymatic glycation, producing advanced glycation endproducts (AGEs). Some of these AGEs, such as pentosidine, are found to be increased in women with POP. They inhibit the turnover of collagen resulting in a more glycated collagen, which is brittle and susceptible for rupture. Furthermore, an increase in cross-linked collagen also makes tissues stiff. The anterior vaginal wall from premenopausal women with POP has indeed been reported to be stiffer than tissues from their healthy counterparts.16

7

We demonstrated that the amount of smooth muscle cells (SMCs) was significantly increased in the prolapsed site, but not in the unaffected site of the same patient.

This increase in SMCs in the prolapsed tissue may indicate an accommodation of the connective tissue to the increased permanent mechanical load and stretch on the vaginal wall tissue caused by the prolapse. This phenomenon is also seen in bladder and intestinal smooth muscle, where stretch induces an initial response that consists of hyperplasia and hypertrophy force generating capacity decreases.17 Data on the response of the vaginal wall ECM to increased mechanical load or to factors that modify this response are lacking. Recent studies focus on the effect of decrease in mechanical load due to the use of synthetic meshes. Liang et al.18 showed that vaginal wall tissue degenerates as a result of the decrease in loading, also known as stress shielding. Tissue degeneration that occurs in this context has been shown to be the result of a deregulation of key structural proteins such as collagens, elastin, and glycosaminoglycans, as well as SMCs.19 It is clear that all tissues throughout the body depend on a certain amount of load to maintain their structure. Loss of load as well as increase of load leads to changes in the cellular and molecular responses.

Cell-matrix interaction The effect of ECM mechanics on cells and tissue function has just recently been under investigation. In prolapsed anterior vaginal wall tissue, fibroblasts and smooth muscle cells and the surrounding ECM are subjected to altered mechanics due to exposure to mechanical load. Numerous studies in other fields, have shown that mechanical loading induces different pathways affecting the cellular structure and function, causing changes in cell shape, migration, proliferation, contraction and differentiation.20;21This in turn induces changes to the ECM. Little is known about this dynamic cell-matrix interactions in the context of pathogenesis of POP.

138

General discussion and future perspectives

As the ECM in POP appears to be affected and the vaginal fibroblasts are the most important cells to regulate the balance of synthesis, maturation and degradation, we hypothesized that the functionality of the FBs will be altered in women with POP. To test this hypothesis we performed in vitro studies to evaluate the functionality of the FBs by using the FlexerCellâ&#x201E;˘ device. This device provides a model to evaluate dynamic interactions of fibroblasts from the pelvic floor with artificial substrates in vitro. Analysis of the changes in morphology and secreted remodeling factors were performed under different loadings regimes and in different environments. First we sought to identify differences between fibroblasts from women with varying degrees of prolapse in reaction to mechanical stimuli and matrix substrates in vitro (Chapter 5). This was done by subjecting fibroblasts from healthy and mild and severe POP women to cyclic mechanical loading on artificial polymeric membranes, both uncoated and coated with collagen I. Changes in morphology and anabolic and catabolic compounds that may affect the remodeling of the extracellular matrix were evaluated at protein and gene expression levels. Our results showed that on collagen I coated plates, alignment of fibroblasts from severe POP patients appears delayed in comparison to their mild counterparts. Released MMP-2 was lower in fibroblasts from POP patients compared to healthy control cells. These effects seemed to disappear over time. On non-coated plates, POP fibroblasts showed lower responses to extracellular matrix remodeling factors at both enzymatic and gene expression levels, compared to healthy fibroblasts. These data suggest that, although fibroblasts from POP patients seem to have lower mechano-responses, in the presence of collagen I coated plates, the system eventually reaches a balance.

However, it appeared that when cells are exposed to artificial polymeric substrates and stress is imposed, this balance was not reached. Fibroblasts from women with POP seemed to be preconditioned by the abnormal prolapsed matrix.

The results of chapter 5 indicate that fibroblasts of woman with POP show altered characteristics, possibly due to the changes in the extracellular matrix. Our ultimate goal is to develop new surgical treatment for pelvic organ prolapse, using cell based tissue engineering, combining biomaterials and growth factors with unaffected autologous cells, like fibroblasts or stem cells from vaginal tissue, which could stimulate vaginal tissue repair. These new approaches can only be implemented in patients without intrinsic defects. Therefore, in chapter 6 we aimed to investigate if alterations in fibroblast functions are acquired or intrinsic in premenopausal women with POP. To answer this question fibroblasts of POP tissues were not only compared to fibroblasts from biopsies from non-prolapsed anterior vaginal wall tissues but also to fibroblasts of the same tissue in healthy controls. Additionally, we aimed to confirm the data of the previous pilot experiment (Chapter 5) by evaluation of

139

7

Chapter 7

vaginal wall fibroblasts mechano-responses to different substrates under static or dynamic conditions. First we proved that the cell cultures studied were actually fibroblasts. Also no differences were seen in the proliferation rate of the cells studied, which suggests that the quality and not the quantity of the fibroblast are responsible for the results. The obtained data showed that fibroblast mechanoresponses from the non-POP site of the anterior vaginal wall from patients with prolapse do not differ in any of the parameters evaluated with cells derived from the same tissue site in healthy controls. Moreover, we showed clear differences between fibroblasts derived from prolapsed and non-prolapsed tissues within individuals. Fibroblasts from the POP site showed delayed fibroblast-mediated collagen contraction and lower production of MMP-2 on collagen-coated plates.

Mechano-responses to cyclic mechanical loading on non-coated plates were also different: activation of MMP-2 was more pronounced in cells from non-prolapsed tissues, whereas up-regulation of MMP-2 and TIMP-2 gene expressions was only seen in POP-site fibroblasts.

7

This study supports the findings of the pilot experiment with the FlexerCell device. It also indicates that collagen coating promotes fibroblast attachment and alignment and increased gene expression of the extracellular matrix remodeling factors. This means that vaginal fibroblasts are mechano-responsive and can sense and remodel their surrounding matrix. In the immuno-histochemical analysis of the matrix we state that the changes found in the ECM are a result of the mechanical load due to POP. With the data obtained from the FlexerCell experiments we support this conclusion: in the majority of the patients, the changes in the functionality of the cells in POP is an acquired rather than an intrinsic defect. As the fibroblasts and the matrix are interacting and changes in the one affects the other, we have to regard the ECM and the cells in the connective tissues of the pelvic floor as one interactive system.

Biological processes involved in adaptation of the tissues For a better understanding of the biological processes underlying the changes seen in the different components of the extracellular matrix after increased mechanical loading and stretch on vaginal tissue, we performed micro-array analyses. The advances of gene micro-array technology offer a new opportunity to obtain a gene map with different physiological and pathophysiological conditions, as well as for discovering functional genes of certain diseases. We performed micro-array analysis of POP and non-POP tissues within the same patient. This study design reduces a possible bias between patients. We have to bear I mind, however, that looking at gene expression at the mRNA level provides only a snapshot of the

140

General discussion and future perspectives

current metabolic activities of the cells. It does not trace the long-term history and etiology of the disease. In absence of a healthy control group we are also not able to draw conclusions about the cause-effect relationship.

With cluster analysis we identified a cluster of genes involved in signal transduction (cytokine-cytokine interaction; peptide ligand binding receptor; class A1rhodopsin like receptor; chemokine receptor and GPCR ligand binding pathway) and transcriptional regulation pathways (AP1; FRA; NFAT-TF; ATF2), which were specific for the prolapsed anterior vaginal wall. These pathways are involved in many biological processes a/o inflammation.22-24,25-27 The activated pathways in the prolapsed anterior vaginal wall tissue play an important role in mechanotransduction, which allow fibroblasts and smooth muscle cells and the surrounding ECM to adapt to the altered mechanics due to exposure to mechanical load and strain caused by the prolapse. In our study population the increase in the amount of SMCs in the anterior vaginal wall at the prolapsed site compared to the unaffected site of the same premenopausal patient may be a reflection of this adaptation.

Interestingly, the cluster analysis also reflected the heterogeneity in our study population, for which the POP population in general is known. This was reflected by two inversely related clusters of genes showing variance in molecular processes between individuals. A subgroup of patients showed increased expression of genes related to the ECM/ integrin pathway cluster whereas another subgroup of patients was characterized by increased expression of genes related to muscle cell contraction. To verify whether this variability was already seen in the nonprolapsed precervical anterior vaginal wall tissue, we additionally performed an unsupervised cluster analysis of non-POP expression profiles in the non-prolapsed tissue, and found the same pattern. Certain patients showed up regulation in the ECM/ integrin pathway cluster and down regulation of SMC pathways, while other patients showed a reversed pattern. In women with POP the precervical region that serves as a control region, is under physiological circumstances exposed to only minor changes in mechanical load and tissue stretch. We therefore hypothesize that the two different clusters detected in fact may reflect two groups of patients in which either one or the other pathway (ECM organization vs smooth muscle cell contraction) dominates in non-prolapsed tissue to adapt to minor changes in the environment. This could also imply that different failure mechanisms ultimately lead to a ‘common’ POP disease gene expression pattern in more advanced stages of POP. This also fits in the lifespan model described by DeLancey28 where the different risk factors and life events throughout a woman’s life are integrated.

Different risk factors and events may contribute to the stage up till the threshold

141

7

Chapter 7

to maintain pelvic floor support is reached and symptomatic POP occurs. To test this hypothesis, micro-array analysis in a validation cohort would be the next logical step to take. Future research could provide different sets of biomarkers, i.e. one related to ECM and one related to (smooth) muscle contraction, differentiation and proliferation. This will help individualized management in the identification of pelvic floor disorder risk and thereby possibilities for preventive strategies and therapies in individual women as opposed to universal recommendations for all women.

7

Proposed model The aim of this thesis was to evaluate to what extent the changes observed in the anterior vaginal wall tissues are acquired, i.e. due to the presence of prolapse, or due to intrinsic defects in the ECM and/or cells. From the above we can conclude that the changes seen in the different components of the ECM and the in vitro altered functionality of the FBs in the anterior vaginal wall is a consequence of biomechanical stressing of the vaginal tissues by the pelvic organ descent. This is also reflected by the activated biological processes in the prolapsed anterior vaginal wall.

From recent studies we know that the cells and their matrix form an interactive system in which changes to the one, influences the other. For fibroblasts, the ECM of the vaginal wall determines chemically and mechanically the surroundings of these cells (Figure 1). Cell surface receptors, such as integrins and focal adhesion proteins, allow cells to probe their environment and respond to the composition of the ECM by activation of specific genes and pathways. Under physiological circumstances it appears that inter-individual differences exist in the way the ECM and cells use this information for structurally adapting the tissues to chronic minor changes in mechanical load. (Chapter 3) In this way the different components of the ECM of the pelvic floor are constantly remodeling to bear most of the physical load that act on the pelvic floor. This is a continuous process of synthesis, maturation and degradation.

142

General discussion and future perspectives

Genetics

Parity/ trauma pelvic floor

Smoking Diabetes

COPD Obstipation Obesity

Inadequate/frustrated tissue repair

Ageing

Increased load/ strain

Changes in Extracellular Matrix Architecture

Composition

Mechanical properties

Chemical properties

Cell

Figure 1. Overview of the cell-matrix interaction and risk factors in the development of pelvic organ prolapse.

So what happens in POP? There is increasing evidence supporting a partially genetic etiology of POP with respect to ECM genes, reflected by a number of DNA polymorphisms associated with POP such as collagen, type III, alpha 1,29-32 laminin Îł 1,33 and matrix metalloproteinase-9.34 This may result in abnormal structural proteins in the ECM of women with POP. Other reports stress environmental factors contributing to the variation in risk to POP, with parity as one of the most important risk factor.35-37 If the ECM is damaged, e.g. after injury to levator ani muscles or the connective tissue attachments at child birth, transient increases in intraabdominal pressure are directly transmitted to the vaginal wall and its increased mechanical load to the vagina results in tissue strain. Mechanical loading has been shown to change the remodeling of tissues by inducing matrix metalloproteinases, produced by the vaginal fibroblasts. Indeed, vaginal connective tissue fibroblasts are mechano-sensitive with increased collagenase activity. In most cases, the vaginal tissues are able to recover from those rather acute events by proper

143

7

Chapter 7

tissue remodeling. However, when repair mechanisms fail, and the mechanical load persist, POP patients may have entered a chronic phase of frustrated wound repair also influenced by risk factors like obesity, chronic obstipation, physiological ageing, and menopause. The connective tissue will stay in a loop as indicated by Jackson, not getting the chance to reach the right equilibrium between synthesis, maturation and degradation to restore and maintain tissue strength (Figure 2).

To piece together the existing research we propose a model to explain POP development. The pelvic floor connective tissue of women with a predisposition for POP is suffering of inadequate and frustrated wound repair after damage. This causes chronic abnormal ECM remodeling with increased proteolytic activity, which is further exacerbated by mechanical stress load to the pelvic floor due co-morbidity and life style. Physiological ageing and cyclic changes in ovarian hormones as women progress through the premenopausal and menopausal years, contribute to the progressive, abnormal remodeling. This ultimately destroys normal tissue

Trauma pelvic floor Inadequate tissue repair

Increased load

Synthesis immature collagen Smooth muscle cells Collagen III

Degradation immature collagen

7

Mature crosslinks Advanced glycation endproducts Smooth muscle cells

MMP-2 and 9 TIMP-1

Figure 2. Changes in the extracellular matrix due to increased mechanical load.

144

General discussion and future perspectives

architecture and mechanical properties, resulting in a lack of support and thus prolapse (Figure 1).

General conclusion Pelvic organ prolapse is a multifactorial disease of which the exact pathogenesis is unclear. Genetic predisposition and parity are important risk factors in the development of POP. Published data continue to indicate that an abnormal ECM is associated with POP, and few in vitro and animal studies support a cause-effect relationship. The results of this thesis show that the changes observed in the components of the ECM with an increase of smooth muscle cells and collagen type III and mature crosslinks reflect the adaptation of the connective tissue to increased mechanical load. The fact that the vaginal fibroblasts in POP have altered functional characteristics compared to healthy fibroblasts also supports the theory of acquired changes. Moreover the biological processes activated in the prolapsed tissue are involved in adaptation of tissue and cells to changes in mechanical load.

The heterogeneity of the population of women with POP is reflected by the genetic predispositions and different compensatory mechanisms to adapt to physiological changes in mechanical load. This could imply that there are different failure mechanisms, which ultimately lead to a â&#x20AC;&#x2DC;commonâ&#x20AC;&#x2122; POP disease gene expression pattern in more advanced stages of POP. The indications of intrinsic factors in etiology of POP, like genetic factors, could not be substantiated by our research. We only observe acquired factors. However, the determination of intrinsic factors remains crucial for the possible design of tailored strategies of diagnosis, prevention and treatment in pelvic organ prolapse.

Future perspectives This thesis does not resolve the ongoing question on the pathogenesis of POP. Actually, only a longitudinal study would be able to answer this question. This is not possible to perform in humans and a good human representative animal model does not yet exist.38 Also it may well be that different pathophysiological processes eventually lead to the disease, which explains the heterogeneity in the POP population.

More information about the differences in the pelvic floor and particularly the connective tissue of the pelvic floor between POP and non-POP patients is of importance to understand more about the pathogenesis of the disease. In this perspective it is important to realize that that pelvic organ prolapse is a generic term for prolapse in the different compartments of the vagina. The existence of POP in

145

7

Chapter 7

one compartment will change the biomechanical strength on the supportive tissues (level II and III) and the suspensory ligaments (level I) in other compartments.39 Moreover, the composition and architecture vary within the different tissues resulting in different biomechanical properties.6 The injury, recovery, and disease mechanisms that affect each type of tissue and structure must be individually considered. In future studies it is of utmost importance to have clearly defined tissues and selected patient groups. Also performing multi-parameter analysis taking the gene- cell- matrix- axis into account increases the chance to elucidate underlying pathophysiological processes in the different types of prolapse.

One could argue whether we have to understand in detail what goes wrong in POP before developing new therapeutic strategies. There is an urgent need for new treatment modalities for women with POP. Tissue engineering could potentially provide attractive alternatives to surgical reconstruction of native tissue or the use of surgical implants. So far, this idea has been sparsely explored in preclinical experiments.40-42 Evidence from the closely related field of reconstructive hernia surgery43;44 seems to provide some proof of concept in animal models, but the pelvic floor tissues and anatomy are complex and entirely different from the abdominal wall. The pathological anatomy of POP dictates that a simple injection of cells to regenerate damaged vaginal tissue is not feasible; without a cell adhesion substrate cells will die. A biodegradable scaffold could provide a three dimensional substrate in which cells can be delivered, attach, grow and from new tissue. This biodegradable scaffold will in addition provide temporarily mechanical support to the weakened supportive tissues of the pelvic floor. As the scaffold gradually disappears, it will allow cells to grow and provide permanent support either directly by generating new tissue from transplanted cells or directly by paracrine stimulation of resident tissue stem cells.45

7

So the ideal mesh must be biocompatible, promote good cell attachment, ECM production and achieving mechanical properties in the desirable range for clinical use. When it comes to scaffold integration into the body, the host immune response is extremely important for tissue survival and possibly rapid neovascularisation.

Avoidance of materials that contribute to chronic inflammation and excessive fibrosis seems desirable. Several candidate scaffold have been explored in cell based therapies scaffolds.46 Electrospun polyactic acid and porcine small intestinal submucosa were both found to be promising degradable scaffolds.47 As the current acellular implants give high failure and complication rates it is appropriate to introduce cells into the tissue engineering approach; cells can form new tissue, integrate into the body and achieve biomechanical characteristics similar to healthy

146

General discussion and future perspectives

native tissue.48 Proposed cell types are skeletal muscle derived cells (MDSC), mesenchymal stem cells (MSC) and fibroblasts. MDSC have been used in vitro and small animal models studies and appears to be able to stimulate vaginal repair.40 MSCs are multipotent and their differentiation process is driven by the microenviroment at the implant site. It has been shown that MSCs, when transplanted systemically, are able to migrate to sites of injury in animals, suggesting that MSCs possess migratory capacity. Up to now the underlying mechanisms of this migration and their capacity to home to tissue remains unclear.49 This make MSC and in particulary ADSC which are easy accessible, to interesting candidate cells in POP repair. Vaginal and oral FBs have also successfully been used in combination with scaffolds to induce tissue repair in animal studies.42;47 In our study we focused on the functional characteristics of POP fibroblast and showed that POP vaginal fibroblasts appear to have altered functional characteristics compared to non POP fibroblasts.

If vaginal FBs indeed are not intrinsically affected, autologous cell based therapies could be used. More information about the complex cell-ECM interaction and the ability of affected FBS to recover is necessary to prevent incomplete tissue repair.

Dynamic in vitro models are important tools in which also the effect of bioactive molecules (a.o. growth factors, estrogens and bone morphogenetic protein) to the cell-scaffold complex can be studied. In this way the perfect match of scaffold, cell and trophic factors might be found.

The current tissue engineering approach in vaginal reconstructive surgery for POP is a promising field. From the fast introduction of vaginal mesh we have learned that new techniques should be properly assessed in a controlled way to prevent unexpected adverse effects and reduce the risk to patients. Noteworthy POP is a non lethal condition, serious complications are not acceptable! Professional societies, such as the IUGA, have therefore called for a new cycle of product development, proposing minimum standards for new medical devices in POP surgery.44 They will apply to cell-based tissue engineering concepts as a minimum, but with the use of cells expanded in vitro and/or trophic factors the regulatory demands will increase. After in vitro studies, proof of concept in animal models is unfortunately inevitable. At this stage a perfect animal model, mimicking different human characteristics â&#x20AC;&#x201C; histological, anatomical or hormonal, all at the same time does not exist.38;50 Despite this, animal studies can provide information about host response to the implant, wound healing, tissue ingrowth and biochemical and biomechanical properties of the mesh-tissue complex after implantation in a well controlled environment.51 Putting effort in optimizing the different animal models is of great importance to bring new innovations from bench to bedside.

147

7

Chapter 7

Lastly, developing a new approach for wide spread clinical use, TE must be cost effective and suitable for easy and expedient clinical application. Today in vitro laboratory procedures are time consuming and extremely costly. The rapid development of regulatory environment for cell based therapies will raise the costs even further. Once these procedures are more established prevention of recurrences in POP or even possibilities in primary prevention, may eventually lead to a reduction of public health care costs and for women an increased quality of life.

7

148

General discussion and future perspectives

REFERENCE LIST 1.

2.

3.

4.

5.

6.

7.

8.

9.

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

Weber AM, Richter HE. Pelvic organ prolapse. Obstet.Gynecol. 2005;106:615-34.

Lince SL, van Kempen LC, Vierhout ME, Kluivers KB. A systematic review of clinical studies on hereditary factors in pelvic organ prolapse. Int.Urogynecol.J. 2012;23:1327-36.

Jackson SR, Avery NC, Tarlton JF, Eckford SD, Abrams P, Bailey AJ. Changes in metabolism of collagen in genitourinary prolapse. Lancet 1996;347:1658-61.

Ewies AA, Al-Azzawi F, Thompson J. Changes in extracellular matrix proteins in the cardinal ligaments of post-menopausal women with or without prolapse: a computerized mmunohistomorphometric analysis. Hum.Reprod. 2003;18:2189-95.

Gabriel B, Denschlag D, Gobel H, Fittkow C, Werner M, Gitsch G et al. Uterosacral ligament in postmenopausal women with or without pelvic organ prolapse.

Int.Urogynecol.J.Pelvic.Floor. Dysfunct. 2005;16:475-79.

Moalli PA, Shand SH, Zyczynski HM, Gordy SC, Meyn LA. Remodeling of vaginal connective tissue in patients with prolapse. Obstet.Gynecol. 2005;106:953-63.

Soderberg MW, Falconer C, Bystrom B, Malmstrom A, Ekman G. Young women with genital prolapse have a low collagen concentration. Acta Obstet.Gynecol.Scand. 2004;83:1193-98.

Takano CC, Girao MJ, Sartori MG, Castro RA, Arruda RM, Simoes MJ et al. Analysis of collagen in parametrium and vaginal apex of women with and without uterine prolapse.

Int.Urogynecol.J.Pelvic.Floor.Dysfunct. 2002;13:342-45.

Soo C, Shaw WW, Zhang X, Longaker MT, Howard EW, Ting K. Differential expression of matrix metalloproteinases and their tissue-derived inhibitors in cutaneous wound repair.

Plast.Reconstr.Surg. 2000;105:638-47.

Chiquet M. Regulation of extracellular matrix gene expression by mechanical stress 537. Matrix Biol. 1999;18:417-26.

Sarasa-Renedo A, Chiquet M. Mechanical signals regulating extracellular matrix gene expression in fibroblasts. Scand.J.Med.Sci.Sports 2005;15:223-30.

Ortega N, Behonick D, Stickens D, Werb Z. How proteases regulate bone morphogenesis.

Ann.N.Y.Acad.Sci. 2003;995:109-16.

Cai WJ, Koltai S, Kocsis E, Scholz D, Kostin S, Luo X et al. Remodeling of the adventitia during coronary arteriogenesis. Am.J.Physiol Heart Circ.Physiol 2003;284:H31-H40.

Gillard JA, Reed MW, Buttle D, Cross SS, Brown NJ. Matrix metalloproteinase activity and immunohistochemical profile of matrix metalloproteinase-2 and -9 and tissue inhibitor of metalloproteinase-1 during human dermal wound healing.

Wound.Repair Regen. 2004;12:295-304.

Chen B, Yeh J. Alterations in connective tissue metabolism in stress incontinence and prolapse.

J.Urol. 2011;186:1768-72.

Feola A, Duerr R, Moalli P, Abramowitch S. Changes in the rheological behavior of the vagina in women with pelvic organ prolapse. Int.Urogynecol.J. 2013;24:1221-27.

Gabella G. Hypertrophy of visceral smooth muscle. Anat.Embryol.(Berl) 1990;182:409-24.

Liang R, Abramowitch S, Knight K, Palcsey S, Nolfi A, Feola A et al. Vaginal degeneration following implantation of synthetic mesh with increased stiffness. BJOG. 2013;120:233-43.

Amiel D, Woo SL, Harwood FL, Akeson WH. The effect of immobilization on collagen turnover in connective tissue: a biochemical-biomechanical correlation. Acta Orthop.Scand. 1982;53:325-32.

Giannone G, Sheetz MP. Substrate rigidity and force define form through tyrosine phosphatase and kinase pathways. Trends Cell Biol. 2006;16:213-23.

MacKenna D, Summerour SR, Villarreal FJ. Role of mechanical factors in modulating cardiac fibroblast function and extracellular matrix synthesis. Cardiovasc.Res. 2000;46:257-63.

Fric J, Zelante T, Wong AYW, Mertes A, Yu HB, Ricciardi-Castagnoli P. NFAT control of innate

149

7

Chapter 7

7

immunity. Blood 2012;120:1380-89.

23. Schonthaler HB, Guinea-Viniegra J, Wagner EF. Targeting inflammation by modulating the

Jun/AP-1 pathway. Ann.Rheum.Dis. 2011;70 Suppl 1:i109-i112.

24. Zanoni I, Granucci F. Regulation and dysregulation of innate immunity by NFAT signaling

downstream of pattern recognition receptors (PRRs). Eur.J.Immunol. 2012;42:1924-31.

25. Heinrich PC, Behrmann I, Haan S, Hermanns HM, Muller-Newen G, Schaper F. Principles of

interleukin (IL)-6-type cytokine signalling and its regulation. Biochem.J. 2003;374:1-20.

26. Kaplanski G, Marin V, Montero-Julian F, Mantovani A, Farnarier C. IL-6: a regulator of the

transition from neutrophil to monocyte recruitment during inflammation.

Trends Immunol. 2003;24:25-29.

27. Luyendyk JP, Schabbauer GA, Tencati M, Holscher T, Pawlinski R, Mackman N. Genetic analysis

of the role of the PI3K-Akt pathway in lipopolysaccharide-induced cytokine and tissue factor gene

expression in monocytes/macrophages. J.Immunol. 2008;180:4218-26.

28. Delancey JO, Kane LL, Miller JM, Patel DA, Tumbarello JA. Graphic integration of causal factors

of pelvic floor disorders: an integrated life span model. Am.J.Obstet.Gynecol. 2008;199:610-15.

29. Chen HY, Chung YW, Lin WY, Wang JC, Tsai FJ, Tsai CH. Collagen type 3 alpha 1 polymorphism

and risk of pelvic organ prolapse. Int.J.Gynaecol.Obstet. 2008;103:55-58.

30. Kluivers KB, Dijkstra JR, Hendriks JCM, Lince SL, Vierhout ME, van Kempen LCL.

COL3A1 2209G>A is a predictor of pelvic organ prolapse.

Int.Urogynecol.J.Pelvic.Floor.Dysfunct. 2009;20:1113-18.

31. Jeon MJ, Chung SM, Choi JR, Jung HJ, Kim SK, Bai SW. The relationship between COL3A1 exon

31 polymorphism and pelvic organ prolapse. J.Urol. 2009;181:1213-16.

32. Martins KdF, de Jarmy-DiBella ZIK, da Fonseca AMRM, Castro RA, da Silva IDCG, Girao MJBC

et al. Evaluation of demographic, clinical characteristics, and genetic polymorphism as risk factors

for pelvic organ prolapse in Brazilian women. Neurourol.Urodyn. 2011;30:1325-28.

33. Nikolova G, Lee H, Berkovitz S, Nelson S, Sinsheimer J, Vilain E et al. Sequence variant in the

laminin gamma 1 (LAMC1) gene associated with familial pelvic organ prolapse.

Human Genetics 2007;120:847-56.

34. Chen HY, Lin WY, Chen YH, Chen WC, Tsai FJ, Tsai CH. Matrix metalloproteinase-9 polymorphism

and risk of pelvic organ prolapse in Taiwanese women. Eur.J.Obstet.Gynecol.Reprod.Biol.

2010;149:222-24.

35. Memon HU, Handa VL. Vaginal childbirth and pelvic floor disorders. Womens Health (Lond Engl.)

2013;9:265-77.

36. Altman D, Forsman M, Falconer C, Lichtenstein P. Genetic influence on stress urinary incontinence

and pelvic organ prolapse. Eur.Urol. 2008;54:918-22.

37. Leijonhufvud A, Lundholm C, Cnattingius S, Granath F, Andolf E, Altman D. Risks of stress urinary

incontinence and pelvic organ prolapse surgery in relation to mode of childbirth.

Am.J.Obstet.Gynecol. 2011;204:70-77.

38. Couri B, Lenis A, Borazjani A, Paraiso M, Damaser M. Animal models of female pelvic organ

prolapse: lessons learned. Expert.Rev.Obstet.Gynecol. 2012;7:249-60.

39. Delancey JO. Anatomic aspects of vaginal eversion after hysterectomy. Am.J.Obstet.Gynecol.

1992;166:1717-24.

40. Ho MH, Heydarkhan S, Vernet D, Kovanecz I, Ferrini MG, Bhatia NN et al. Stimulating vaginal

repair in rats through skeletal muscle-derived stem cells seeded on small intestinal submucosal

scaffolds. Obstet.Gynecol. 2009;114:300-09.

41. Boennelycke M, Christensen L, Nielsen LF, Gras S, Lose G. Fresh muscle fiber fragments on a

scaffold in rats-a new concept in urogynecology? Am.J.Obstet.Gynecol. 2011;205:235-4.

42. Hung MJ, Wen MC, Hung CN, Ho ES-C, Chen GD, Yang VC. Tissue-engineered fascia from

vaginal fibroblasts for patients needing reconstructive pelvic surgery.

Int.Urogynecol.J. 2010;21:1085-93.

150

General discussion and future perspectives

43.

44.

45.

46.

47.

48.

49.

50.

51.

Deprest J, Zheng F, Konstantinovic M, Spelzini F, Claerhout F, Steensma A et al. The biology behind fascial defects and the use of implants in pelvic organ prolapse repair. International Urogynecology Journal 2006;17:S16-S25.

Slack M, Ostergard D, Cervigni M, Deprest J. A standardized description of graft-containing meshes and recommended steps before the introduction of medical devices for prolapse surgery.

Consensus of the 2nd IUGA Grafts Roundtable: optimizing safety and appropriateness of graft use in transvaginal pelvic reconstructive surgery. Int.Urogynecol.J. 2012;23 Suppl 1:S15-S26.

Boennelycke M, Gras S, Lose G. Tissue engineering as a potential alternative or adjunct to surgical reconstruction in treating pelvic organ prolapse. Int.Urogynecol.J. 2013;24:741-47.

Olson JL, Atala A, Yoo JJ. Tissue engineering: current strategies and future directions.

Chonnam.Med.J. 2011;47:1-13.

Mangera A, Bullock AJ, Roman S, Chapple CR, MacNeil S. Comparison of candidate scaffolds for tissue engineering for stress urinary incontinence and pelvic organ prolapse repair.

BJU.Int. 2013;112:674-85.

Mangera A, Bullock AJ, Chapple CR, MacNeil S. Are biomechanical properties predictive of the success of prostheses used in stress urinary incontinence and pelvic organ prolapse? A systematic review. Neurourol.Urodyn. 2012;31:13-21.

Chamberlain G, Fox J, Ashton B, Middleton J. Concise review: mesenchymal stem cells: their phenotype, differentiation capacity, immunological features, and potential for homing.

Stem Cells 2007;25:2739-49.

Abramowitch SD, Feola A, Jallah Z, Moalli PA. Tissue mechanics, animal models, and pelvic organ prolapse: a review. Eur.J.Obstet.Gynecol.Reprod.Biol. 2009;144 Suppl 1:S146-S158.

Deprest J, Feola A. The need for preclinical research on pelvic floor reconstruction.

BJOG. 2013;120:141-43.

7

151

8 Summary Samenvatting

Chapter 8

SUMMARY Pelvic organ prolapse (POP) is a common multifactorial disease, affecting adult women of all ages. It decreases their quality of life considerably. In general, a prolapse is the result of mechanical failure in the pelvic floor connective tissues that support and suspense the abdominal and pelvic organs. For decades it has been speculated that a structural defect in the vagina or its supportive tissues predisposes women to POP. These changes can be in collagen content and collagen subtypes, changes in amount and quality of elastin, or in smooth muscle cells. Also the functionality of the vaginal fibroblasts may play a role in the pathophysiology of POP. These fibroblasts are the mechanosensitive cells responsible for maintaining extracellular matrix (ECM) homeostasis. To date is has been impossible to determine the causeeffect relationships in the development of POP. Problems could be induced by changes in the connective tissue, that are in turn induced by mechanical loading or stretch in the damaged vaginal tissue in patients with POP (acquired). Also, it could be that a structural defect of the fibroblasts contribute to changes in the functionality of the ECM (intrinsic).

8

POP is one of the most common reasons for gynecological surgery in women after the fertile period. The failure rate of native tissue repair is relatively high, though. In an attempt to improve surgical outcomes, synthetic meshes and biological grafts have been introduced in reconstructive pelvic surgery for repairing POP. Synthetic meshes significantly reduce POP recurrence compared with no mesh. However, in contrast to this clinical success rates, mesh exposure and dyspareunia are reported. Biological grafts appear to be insufficient for lack of support. Therefore, an alternative approach for reconstruction of the pelvic floor is urgently needed.

This alternative could be sought in tissue engineering. It could provide attractive alternatives alone or as an adjunct to surgical reconstructive procedures in the pelvic floor and more specifically the anterior vaginal wall. Therefore we need additional information about the changes we see in the connective tissue and the functionality of the fibroblasts in women with POP: are they due to an intrinsic or an acquired defect?

In this thesis we seek to evaluate the composition of the anterior vaginal wall tissue and to evaluate the functionality of the fibroblast. This could help us to better understand the pathogenesis of the disease and to determine which kind of strategies can be used in the reconstruction of the pelvic floor, based on a tissue engineered construct.

154

Summary

After a general introduction in chapter 1, in chapter 2 we provide an overview on the current literature on the connective tissue in women with POP. We evaluate literature in the light of an observation by Jackson in 1996 (Jackson, The Lancet 1996) that patients with uterine prolapse and cystocele have a reduced collagen content, with a relatively high content of immature collagen cross-links compared to non-POP patients. This newly formed collagen is degraded more easily than older, glycated tissue, by an increase in metalloproteinase activity, resulting in a decrease of collagen content. The old, glycated collagen that is left behind, results in brittle tissue with an impaired mechanical strength. This could be an important aetiologic factor in POP. Jackson found no change in the type I to type III collagen ratio. Most other studies, however, found an increase in type III or a decrease in type I, resulting in a decreased I/III ratio. This increase in collagen type III, together with an increase in enzyme MMP-9 is a characteristic of tissue that is remodeling after injury or accommodating to a progressively increasing mechanical load. Also, the functionality of the fibroblasts seems to be involved in the pathophysology of POP, with less contractile capacity. This causes changes in interaction between the vaginal fibroblasts and the extracellular matrix. Despite numerous shortcomings in the available literature, the hypothesis of Jackson could still be valid. To date the aetiology of POP is not elucidated yet. More important, the question whether the changes seen in the tissue and the fibroblasts is due to an intrinsic or an acquired defect is not answered.

In order to shed light on the important question of cause and effect, we introduce a novel research approach in POP, in which not only the tissue of premenopausal age-matched women without POP, but also the unaffected tissue of a patient is the control for her prolapsed tissue. Biopsies were taken from the prolapsed anterior vaginal wall (POP site) and from the precervical non-prolapsed vaginal wall (nonPOP site).

In chapter 3 we describe the histological and biochemical features of the different components of the extracellular matrix. Our results show that the non-POP tissues in the vaginal wall of patients do not differ in any of the parameters evaluated from the same tissue in healthy, age- and parity matched controls. This indicates that for these parameters the non-POP precervical vaginal wall of the women with cystocele may be considered as a true control. We did observe marked differences between the prolapsed tissues of a POP-patient, compared to non-prolapsed tissues of the same patient. There was a significant increase in mature pyridinoline cross-links in collagen molecules, and in the number of smooth muscle cells in the muscularis layer of the anterior vaginal wall. These findings suggest that the

155

8

Chapter 8

changes in connective tissue of the prolapsed vaginal wall are an acquired effect, rather than an intrinsic defect in the connective tissue.

We hypothesize that due to increased mechanical load and stretch on the cells in the vaginal tissues different molecular mechanisms come into action. In chapter 4 we aim to identify POP related dysregulated metabolic and signaling pathways by comparing gene expression profiles of prolapsed and non-prolapsed anterior vaginal wall tissues from women with cystocele, by means of whole-genome microarrays. In this so called ‘fishing experiment’, statistical analysis of micro-array and a cluster analysis is executed for the analysis of the 44.000 analysed genes. In the prolapsed anterior vaginal wall, we found dysregulation of general pathways related to signal transduction and transcription. These pathways are activated by mechanical load. The analysis suggests that beside a POP specific gene expression profile, at least two clusters of genes reflect variance in molecular processes between individuals. We therefore performed an additional cluster analysis of non-POP expression profiles. This analysis indeed divided the patient group into two subgroups with reciprocal clusters of genes. One subgroup is characterised by the ECM organization, integrin-1 and collagen formation pathways. The other cluster is characterised by genes involved in (smooth) muscle contraction. We therefore hypothesize that women with a predisposition for POP show two different compensatory mechanisms to adapt to physiological changes in mechanical load. This could also imply that different failure mechanisms ultimately lead to a ‘common’ POP disease gene expression pattern in more advanced stages of POP. To test this hypothesis, micro-array analysis in a validation cohort would be the next logical step to take.

8

The vaginal wall is one of the soft tissues that is constantly being remodelled in order to withstand the different forces that are applied to it during a woman’s lifetime. The weakening of the pelvic floor seen in POP could be caused by an imbalance of this remodeling. Tissue remodeling is a well-balanced process involving several factors with different roles, and different cells as modulators. In the vaginal wall, fibroblasts (FB’s) are the mechanosensitive cells responsible for maintaining homeostasis in the Extra Cellular Matrix (ECM). They produce molecules, and control anabolic and catabolic processes to remodel their surrounding matrix in response to mechanical and biochemical stimuli. Compounds particularly involved in ECM homeostasis include collagens (mainly type I and III), the collagen degrading matrix metalloproteinases (MMPs), and tissue inhibitors of metalloproteinases (TIMPs). It has been shown that the amounts of active MMP-2 or MMP-9 are increased in tissues from patients with POP in comparison to controls. We were interested to

156

Summary

see if these matrix metalloproteinases are also increased when cells are exposed to experimental cyclic mechanical loading in vitro. Furthermore we wondered whether this enzymatic activity is affected by the presence of artificial polymeric substrates.

In chapter 5 we describe an in vitro pilot experiment to test the hypothesis that fibroblasts from women with different degrees of prolapse, display different mechano-responses depending on the substrate encountered. This was done by subjecting fibroblasts from healthy, mild and severe POP women to cyclic mechanical loading on artificial polymeric membranes, uncoated as well as coated with collagen I. Changes in morphology and anabolic and catabolic compounds that may affect the remodeling of the extracellular matrix were evaluated at protein and gene expression levels. Our results show that on collagen I coated plates, alignment of fibroblastst from severe POP patients appears delayed in comparison to their mild counterparts. Released MMP-2 is lower in fibroblasts from POP patients compared to healthy control cells. These effects seem to disappear over time. On non-coated plates, POP fibroblasts show lower responses to extracellular matrix remodeling factors at both enzymatic and gene expression levels, compared to healthy fibroblasts. The data suggest that, although fibroblasts from POP patients seem to have lower mechano-responses, in the presence of collagen I coated plates, the system eventually reaches a balance. However, it appears that when cells are exposed to artificial polymeric substrates and stress is imposed, this balance is not reached. Fibroblasts from women with POP seem preconditioned by the abnormal prolapsed matrix.

The results of chapter 5 indicate that fibroblasts of woman with POP show altered characteristics, possibly due to the changes in the extracellular matrix. Our ultimate goal is to develop new surgical treatment for pelvic organ prolapse, using tissue engineering, combining biomaterials and growth factors with unaffected autologous cells, like fibroblasts or stem cells from vaginal tissue, which could stimulate vaginal tissue repair. These new approaches can only be implemented in patients without intrinsic defects. Therefore, in chapter 6 we aim to investigate if alterations in fibroblast functions are acquired or intrinsic in premenopausal women with POP. To answer this question POP tissue is not only compared to biopsies from non-prolapsed anterior vaginal wall tissue but also to the same tissue in healthy controls. Additionally, we aim to confirm the data of the previous pilot experiment (chapter 5) by evaluation of vaginal wall fibroblasts mechanoresponses to different substrates under static or dynamic conditions. First we prove that the cell cultures studied were actually fibroblasts. Also no differences are seen in the proliferation rate of the cells studied, suggesting that the quality and not the quantity of the fibroblast are responsible for the results. The obtained data show

157

8

Chapter 8

that fibroblasts mechanoresponses from the non-POP site of the anterior vaginal wall from patients with prolapse do not differ in any of the parameters evaluated with cells derived from the same tissue site in healthy controls. Moreover, we show clear differences between fibroblasts derived from prolapsed and non-prolapsed tissues within individuals. Fibroblasts from the POP site show delayed fibroblastmediated collagen contraction and lower production of MMP-2 on collagencoated plates. Mechanoresponses to cyclic mechanical loading on noncoated plates are also different: activation of MMP-2 is more pronounced in cells from nonprolapsed tissues, whereas up-regulation of MMP-2 and TIMP-2 gene expressions are only seen in POP-site fibroblasts. This study also indicates that collagen coating promotes cell attachment and alignment and increased gene expression of the extracellular matrix remodeling factors: collagen 3Îą1, TIMP-2 and MMP-9.

This indicates that vaginal fibroblasts are mechanoresponsive and can sense and remodel their surrounding matrix. The current study also indicates that collagen coating improves cell-substrate interactions in vitro. The results support the results obtained in the previous pilot experiment. More important these results suggest that in the majority of the patients, the prolapse condition is an acquired rather than an intrinsic defect.

In chapter 7 the combined results of the afore mentioned chapters are discussed in a broader perspective and future directions are given.

8

158

Samenvatting

NEDERLANDSE SAMENVATTING PELVIC ORGAN PROLAPSE; MATRIX, CELLEN EN GENEN. Het klinisch probleem: genitale verzakking Tenminste één op de tien Westerse vrouwen wordt op enig moment in haar leven geopereerd vanwege een verzakking. Daarmee is Pelvic Organ Prolapse, kortweg POP, een van de meest voorkomende redenen voor gynaecologische chirurgie, met name voor vrouwen na de vruchtbare leeftijd. Verzakkingen van baarmoeder, blaas en/of darm kunnen klachten geven bij lopen en zitten, maar ook problemen geven bij plassen, ontlasten en bij de coïtus. De klachten worden als sociaal invaliderend ervaren en hebben een grote invloed op de kwaliteit van leven.

Ondanks dat het een veel voorkomend probleem is, moeten urogynaecologen in alle bescheidenheid erkennen dat zij weliswaar de risicofactoren voor POP kennen, maar nog maar weinig weten over het onderliggende pathofysiologische mechanisme, laat staan dat zij een afdoend antwoord hebben op het probleem.

Niet minder dan een derde van de vrouwen die een operatieve ingreep ondergaat krijgt opnieuw een verzakking.

De mogelijke oorzaak In het algemeen kun je zeggen dat een verzakking het gevolg is van een defect in het vaginale weefsel dat de organen uit de buik en het bekken op hun plek moet houden. Die organen zakken dan de vagina in en puilen soms zelfs uit de vagina, zodat de vrouw een balletje voelt of ziet zitten. Een verzakking wordt wel eens vergeleken met een liesbreuk: het uitpuilen van buikorganen (vaak de darm) door een defect in de verzwakte buikwand. Bij een vaginale verzakking puilt de blaas, de darm of de baarmoeder uit in de schede.

De exacte oorzaak van het ontstaan van een POP is onbekend. Uit grote epidemiologische studies kennen we de risicofactoren zoals een belaste familie anamnese, genetische gevoeligheid; zwangerschap en bevalling; ziekten als diabetes, longproblemen en obstipatie; menopauze en normale veroudering. Ook de kwaliteit van het bindweefsel in en rond de vagina lijkt een rol te spelen.

Het bindweefsel in de bekkenbodem bestaat uit cellen zoals fibroblasten, gladde spierweefselcellen, vetcellen en mestcellen, ingebed in een grote hoeveelheid tussencelstof. Deze tussencelstof, de extracellulaire matrix genaamd, bestaat uit gelatineuze grondsubstantie met collageen en elastine vezels. Veranderingen in

159

8

Chapter 8

de hoeveelheid en kwaliteit van de collageen en elastine vezels lijken een rol te kunnen spelen bij het ontstaan van een verzakking. Mogelijk spelen ook de cellen die bindweefsel vormen (de fibroblasten) een rol. Het is evenwel niet duidelijk of de veranderingen in het bindweefsel de oorzaak van de verzakking zijn of het gevolg van het oprekken van het weefsel tijdens het verzakken. Met andere woorden is POP een aangeboren of een verworven aandoening?

De oplossing: weefsel regeneratie Voor vrouwen na de vruchtbare leeftijd is een verzakking de meest voorkomende reden voor een gynaecologische operatie. Die operaties vormen lang niet altijd een blijvende oplossing. De introductie van synthetische matjes heeft weliswaar een verbetering gebracht in het operatief verhelpen van de verzakking, maar daarbij treden vaak bijwerkingen op zoals pijn of het tevoorschijn komen van het matje. Een biologisch oplosbaar matje lijkt vooralsnog geen alternatief voor het synthetische matje, omdat zo’n oplosbaar matje niet voldoende ondersteuning biedt. Er is dan ook behoefte aan een beter alternatief. Mogelijk zou tissue engineering (weefsel regeneratie) met gebruik van (gedoneerde, of liever nog: lichaamseigen) stamcellen zo’n alternatief kunnen bieden, maar dan is het wel cruciaal om te weten of het lichaamseigen weefsel van de patiënte niet de oorzaak was van de verzakking.

Het bindweefsel in de bekkenbodem In dit proefschrift onderzoeken we de eigenschappen van het vaginaweefsel van vrouwen met en vrouwen zonder verzakking en ook het verzakte en het gezonde vaginaweefsel van vrouwen met een verzakking. Na een algemene introductie in hoofdstuk 1 biedt hoofdstuk 2 een overzicht van de literatuur op dit gebied.

Daarin valt met name de theorie van de Britse gynaecoloog Simon Jackson op.

Die stelde in 1996 in de Lancet dat premenopauzale vrouwen met POP minder collageen in hun bindweefsel in de bekkenbodem hebben. Bovendien zag hij relatief veel ‘onrijp’ nieuw gevormd collageen naast veel ‘glycated’ bros collageen.

8

Collageen wordt continu aangemaakt en ook weer afgebroken door matrix enzymen (de metalloproteinasen). Ergens in dat dynamische proces vindt ook rijping plaats door middel van vorming van verbindingen (crosslinks) tussen de collageen moleculen. Via enzymatische crosslinking wordt onrijp collageen, rijp. Een mogelijke tweede stap is de niet-enzymatische crosslinking waarbij zogenoemde ‘suiker-bruggen’ worden gevormd, meestal aangeduid met de Engelse term ‘glycated’ collageen. Dit glycated collageen speelt een centrale rol in het fysiologische verouderingsproces van bindweefsel. Met het ouder worden

160

Samenvatting

daalt de turn-over van collageen waarbij meer glycated collageen overblijft dat veel brosser en minder flexibel en elastisch is.

In het continue proces van aanmaak en afbraak van collageen, is ‘onrijp’ collageen gemakkelijker af te breken dan het overrijpe ‘glycated’ collageen. Dus ook al zag Jackson in zijn onderzoek meer ‘onrijp’ collageen in het bindweefsel van vrouwen met POP, de uiteindelijke kwaliteit van hun bindweefsel werd vooral bepaald door de overrijpe collageenmoleculen. En dit bindweefsel met overrijp collageen is minder flexibel en ook veel ‘brozer’ en dus gevoeliger voor falen of beschadiging.

De theorie van Jackson is naast de tot op heden gepubliceerde medische literatuur gelegd. Daaruit blijkt dat zijn bevindingen worden ondersteund. Bovendien worden veranderingen in het bindweefsel aangetroffen die passen bij herstel na beschadiging van weefsel. In de literatuur tot op heden wordt echter geen duidelijk onderscheid gemaakt of de veranderingen in het bindweefsel aangeboren zijn (intrinsiek) of het gevolg zijn van de verzakking zelf (verworven).

Om mogelijk wel een verschil te kunnen zien tussen intrinsiek en verworven hebben we in dit proefschrift een bijzondere vergelijking gemaakt. Aan de ene kant vergelijken we de karakteristieken van verzakt vaginaweefsel met hetzelfde weefsel van vrouwen van dezelfde leeftijd zonder een verzakking. Dat laatste weefsel konden we verzamelen bij het verwijderen van de baarmoeder, een operatie die om andere redenen dan een verzakking werd uitgevoerd. Die vergelijking zou mogelijk kunnen vertellen waarom de ene vouw wel een verzakking krijgt en de andere niet: de intrinsieke verschillen.

Daarnaast vergelijken we ook het verzakte weefsel uit de vagina met vaginaweefsel van dezelfde patiënt dat niet is verzakt. Die vergelijking kan iets aangeven over de gevolgen van een verzakking voor het weefsel: de verworven verschillen.

Intrinsieke of verworven veranderingen?

In hoofdstuk 3 beschrijven we de weefselbiologie en de biochemie van de verschillende weefsels. Daaruit blijkt dat wij geen intrinsieke verschillen hebben gevonden tussen het gezonde, niet-verzakte weefsel van patiënten en hetzelfde weefsel van gezonde vouwen. We gaan er dan ook vanuit dat het niet-verzakte weefsel van een patiënt een goede ‘controle’ is in de vergelijking met verzakt weefsel. Tussen het verzakte en het niet-verzakte weefsel van patiënten vonden we wel enkele belangrijke verschillen. In het verzakte weefsel zagen we een toename van het aantal gladde spiercellen en ook meer zogenoemde pyridinoline-bruggen tussen de bindweefselmoleculen. Dit lijken dus verworven effecten en geen intrinsieke defecten die de verzakking hebben veroorzaakt.

161

8

Chapter 8

Betrokken biologische processen In hoofdstuk 4 bekijken we het metabolisme van de verschillende weefsels, door te kijken welke genen ‘aan’ of ‘uit’ staan in het verzakte en in het niet-verzakte weefsel van patiënten. Uit de analyse van maar liefst 44.000 verschillende genen komt een algemeen beeld naar voren dat hoort bij het ‘aanzetten’ van signaaloverdracht en het verhoogd overschrijven van genen. Deze processen worden onder andere geactiveerd wanneer weefsel mechanisch wordt belast.

Daarnaast zien we dat de groep vrouwen met een verzakking in twee groepen kunnen worden verdeeld met tegenovergestelde activiteit van twee biologische processen: een groep vrouwen lijkt vooral activiteit te vertonen in de organisatie van de extracellulaire matrix, de andere groep vertoont vooral activiteit in de stofwisseling rond het gladde spierweefsel. Deze onderverdeling zagen we ook terug in het gezonde weefsel bij vrouwen met een verzakking. Op basis van deze gegevens veronderstellen we dat mogelijk twee verschillende processen geactiveerd worden om de toename van mechanische belasting bij een verzakking op te vangen. In theorie zou dit kunnen inhouden dat een verzakking door twee verschillende falende processen leidt tot een zelfde ziektebeeld. Om deze theorie te toetsen is herhaling van het experiment met genen uit beide biologische processen in een nieuwe onderzoeksgroep noodzakelijk.

Gedurende het leven van een vrouw worden er de nodige krachten uitgeoefend op het vaginaweefsel, niet in de laatste plaats tijdens de zwangerschap en tijdens de bevalling. Om die krachten op te kunnen vangen wordt het weefsel constant afgebroken en weer opgebouwd. Bij de afbraak en opbouw van het weefsel zijn ook enzymen betrokken (MMP’s) en remmers van die enzymen (TIMP’s). De fibroblast, de bindweefsel aanmakende cel en het omliggende bindweefsel, de extracellulaire matrix vormen hierbij een eenheid waarbij de een de ander beïnvloedt. De hoeveelheid en activiteit van de verschillende afbraak enzymen (MMP’s) die de extracellulaire matrix afbreken en de remmers van die afbraak enzymen (TIMP’s) worden bijvoorbeeld mede bepaald door de fibroblast.

8

De functionaliteit van de fibroblast In hoofdstuk 5 beschrijven we een innovatief laboratoriumexperiment. Daarbij hebben we fibroblasten van patiënten buiten het lichaam gekweekt en aan mechanische belasting onderworpen om te zien hoe zij onder verschillende omstandigheden reageren op belasting.

Die belasting is te meten met de zogenoemde flexer cell techniek. Daarbij worden

162

Samenvatting

individuele cellen op een membraan ‘gezaaid’, met of zonder een coating van collageen. Vervolgens wordt op die membraan geen of een cyclische trekkracht uitgeoefend. Na 24 of 48 uur ‘oprekken’ van de fibroblasten, is de organisatie van de gezaaide fibroblasten bekeken, en is een aantal enzymen gemeten die betrokken zijn bij de afbraak van bindweefsel. Het betreft de vergelijking van verzakte weefsels van vrouwen met een milde en een ernstige verzakking met weefsel van gezonde controle patiënten.

Het blijkt dat de fibroblasten van patiënten met een ernstige verzakking zich trager ordenen in de richting van de uitgeoefende kracht in vergelijking met fibroblasten van patiënten met een milde of lichte verzakking. De aanwezigheid van een coating van collageentype I vergemakkelijkt de hechting en de organisatie van de fibroblasten ten opzichte van de niet gecoate plaat voor beide groepen. Daarnaast bevat het weefsel van patiënten minder ‘matrix enzymen’ (MMP-2) dan het weefsel van gezonde controlepersonen. Wanneer de gekweekte cellen in een omgeving met collageen worden belast, komen ze uiteindelijk wel tot een evenwicht. Dat evenwicht bereiken ze niet wanneer ze in een omgeving met synthetische weefsels worden belast, zoals die worden gebruikt in synthetische matjes.

In hoofdstuk 6 beschrijven we de vergelijking van de reactie van fibroblasten tussen patiënten en gezonde controlepersonen en tussen verzakt en niet-verzakt weefsel van patiënten. Daaruit blijkt – wederom – dat we geen verschillen kunnen vinden tussen het niet verzakte weefsel van patiënten en het weefsel van gezonde controlepersonen. De fibroblasten uit het verzakte weefsel laten een verminderde contractie zien en produceren minder MMP’s. De prestaties van de fibroblasten verbeteren wanneer de cellen in een omgeving met collageen worden belast.

Hiermee tonen we aan dat de fibroblast wordt beïnvloedt door de omgeving waarin de cel zich bevindt en gevoelig is voor mechanische belasting.

Conclusie In het laatste hoofdstuk, hoofdstuk 7 zetten we de resultaten van de bovengenoemde studies in een breder perspectief. We mogen voorzichtig concluderen dat de verschillen die eerder door anderen werden en die ook nu door ons worden beschreven, in de weefsels van patiënten met een verzakking, het gevolg zijn van de verzakking en waarschijnlijk geen oorzaak. In de toekomst zou gezocht kunnen worden naar een therapie die bijvoorbeeld (mede) gebaseerd is op een biologisch afbreekbare mat waarop stamcellen worden ‘gezaaid’ ter herstel van het verzakte weefsel. In dat geval lijkt het voor de hand te liggen om de eigen stamcellen van de patiënt te gebruiken en niet de stamcellen van verondersteld gezonde vrouwen.

163

8

A Addendum

A

166

Abbreviations

LIST OF ABBREVIATIONS ACTA-2 AGEs ANOVA ATFP BMI Col COL1α1 COL 3α1 CML DES ECM ER ET-1 FBs FC FDA FDR GSEA HP HPLC HYP hUBC IL-6 IQR LP LOX MMP POP POP-Q Pro RIN RT-PCR SAM SD SMCs TIMPs TNF-α USL USR Ywhaz

Alpha Smooth Muscle Actin Advanced Glycation Endproducts One-way Analysis Of Variance Arcus tendineus fasciae pelvis Body Mass Index Collagen Collagen 1α1 Collagen 3α1 Cyclic Mechanical Loading Desmin Extracellular Matrix Estrogen Receptor Endothelin-1 Fibroblasts Fold Change Food and Drug Administration False Discovery Range Gene Set Enrichment Analysis Hydroxylysylyridinoline High-Performance Liquid Chromatography Hydroxyproline Human ubiquitin C Interleukine 6 Inter Quartile Range Lysylpyridinoline Lysyl Oxidases Matrix Metalloproteinases Pelvic Organ Prolapse Pelvic Organ Prolapse Quantification Proline RNA Integrity Number Reverse Transcription Polymerase Chain Reaction Significance Analysis of Microarrays Standard Deviation Smooth Muscle Cells Tissue derived inhibitors of metalloproteinases Tumor Necrotic Factor-α Uterosacral Ligaments Uterosacral Ligament Resilience Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide

167

A

A

168

POP-Q

PELVIC ORGAN QUANTIFICATION SYSTEM (POP-Q) Pelvic Organ Prolapse Quantification system (POP-Q) refers to an objective, siteâ&#x20AC;&#x201C; specific system for describing, quantifying, and staging pelvic support in women.1 It provides a standardized tool for documenting, comparing, and communicating clinical findings with proven interobserver and intraobserver reliability.2 The POPQ system is being approved by the International Continence Society (ICS), the International Urogynecology Association (IUGA), the American Urogynecologic Society (AUGS), and the Society of Gynecologic Surgeons for the description of female pelvic organ prolapse.

The system relies on specific measurements of defined points in the midline of the vaginal wall. The hymen acts as the fixed point of reference throughout the POPQ system. There are six defined points for measurement in the POPQ system - Aa, Ba, C, D, Ap, Bp and three others landmarks: GH, TVL, PB. Each is measured in centimeters above or proximal to the hymen (negative number) or centimeters below or distal to the hymen (positive number) with the plane of the hymen being defined as zero (0). The hymen was selected as the reference point rather the introitus because it is more precisely identified.

There are three reference points anteriorly (Aa, Ba, and C) and three posteriorly (Ap, Bp, and D). Points Aa and Ap are 3 cm proximal to or above the hymenal ring anteriorly and posteriorly, respectively. Points Ba and Bp are defined as the lowest points of the prolapse between Aa anteriorly or Ap posteriorly and the vaginal apex. Anteriorly, the apex is point C (cervix), and posteriorly is point D (pouch of Douglas). In women after hysterectomy, point C is the vaginal cuff and point D is omitted. Three other measurements are taken: the vaginal length at rest, the genital hiatus (gh) from the middle of the urethral meatus to the posterior hymenal ring, and the perineal body (pb) from the posterior aspect of the genital hiatus to the midanal opening (Figure 1).

A

169

POP-Q

Figure 1. Points and landmarks for POP–Q system examination.

Aa; point A anterior Ap; point A posterior Ba; point B anterior Bp; point B posterior C; cervix or vaginal cuff D; posterior fornix (if cervix is present) gh; genital hiatus pb; perineal body tvl: total vaginal length.

The specific measurements at nine sites are recorded in a tic–tac–toe grid as shown in Figure 2 where after the corresponding POP-Q stage is assigned (Table 1).

Table 1. Stages of POP–Q system measurement.

A

Stage (0)

No prolapse is demonstrated.

Stage (I)

Most distal portion of the prolapse is more than 1 cm above the level of the hymen

Stage (II)

Most distal portion of the prolapse is 1 cm or less proximal to or distal to the plane of the hymen.

Stage (III)

The most distal portion of the prolapse is more than 1 cm below the plane of the hymen.

Stage (IV)

Complete eversion of the total length of the lower genital tract is demonstrated.

An example of measurements using the POP–Q system is shown in Figure 2. This example represents a predominantly posterior support defect. Leading point of prolapse is upper posterior vaginal wall, point Bp (+5). Point Ap is 2 cm distal to hymen (+2) and vaginal cuff scar (after hysterectomy) is 6 cm above hymen (–6). Cuff has undergone only 2 cm of descent because it would be at –8 (total vaginal length) if it were properly supported. This represents stage III prolapse.1

170

POP-Q

Figure 2. Example of measurements using the POPâ&#x20AC;&#x201C;Q system.

REFERENCE LIST 1.

2.

Bump RC, Mattiasson A, Bo K, Brubaker LP, Delancey JO, Klarskov P et al. The standardization of terminology of female pelvic organ prolapse and pelvic floor dysfunction.

Am.J.Obstet.Gynecol. 1996;175:10-17:10-17.

Hall AF, Theofrastous JP, Cundiff GW, Harris RL, Hamilton LF, Swift SE et al. Interobserver and intraobserver reliability of the proposed International Continence Society, Society of Gynecologic Surgeons, and American Urogynecologic Society pelvic organ prolapse classification system.

Am.J.Obstet.Gynecol. 1996;175:1467-70.

A

171

A

172

Flexercell Device

FLEXERCELL DEVICE

Fibroblasts

Flexercell

Cultured for 3-­‐5 passages

Loading post

Elas3c membrane +/-­‐ Collagen type I

Vacuum force

Morphological changes Extracellular matrix (ECM) remodeling factors

Cyclic mechanical loading (CML) mimicking normal breathing cycle (sinus wave, 10%, 0.2 Hz)

Acknowledgement: A.M. Ruiz-Zapata for designing the figure.

The Flexercell FX4000 system (Flexcell International Corp., McKeesport, PA, USA) is a device which is extensively used to study the effects of mechanical loading on cultured cells. It has a vacuum pump that pulls down the elastic membrane of the bioflex plates stretching the cells that are seeded on top accordingly. The elastic membranes can be uncoated or coated with different types of collagens, elastin, pronectin and laminin (BioFlex, Flexcell International Corp.).

In our study (Chapter 5 and 6) fibroblasts from healthy and women with pelvic organ prolapse, were subjected to cyclic mechanical loading mimicking continuous respiration on artificial polymeric membranes uncoated as well as coated with collagen I. Changes in morphology and anabolic/catabolic compounds that may affect the remodeling of the extracellular matrix were analysed.

A

173

A

174

Authors and affiliations

AUTHORS AND AFFILIATIONS Jeroen A.M. Belien, PhD

Maaike C.G. Bleeker, MD, PhD

Herman Bril, MD, PhD

Hans A.M. Brรถlmann, MD, PhD

Marco N. Helder, PhD

Linda Hendriks, MD

Alejandra M. Ruiz-Zapata, MSc

Theo H. Smit, PhD

Reinout Stoop, PhD

Saskia Vosslamber, PhD

Behrouz Zandieh-Doulabi, PhD

Department of Pathology, VU University medical center, Amsterdam, The Netherlands.

Department of Pathology, VU University medical center, Amsterdam, The Netherlands.

Department of Pathology, Kennemer Gasthuis Hospital, Haarlem, The Netherlands.

Department of Obstetrics & Gynecology, VU University medical center, Amsterdam, The Netherlands.

Department of of Orthopedics, VU University medical center, Amsterdam, The Netherlands.

Department of Obstetrics & Gynecology, VU University medical center, Amsterdam, The Netherlands.

Department of of Orthopedics and Oral Cell Biology, ACTA- University of Amsterdam and VU University, Research Institute MOVE, Amsterdam, The Netherlands.

Department of of Orthopedics, VU University medical center, Amsterdam, The Netherlands.

Department of Metabolic Health Research, TNO, Leiden, The Netherlands.

Department of Pathology, VU University medical center, Amsterdam, The Netherlands.

Department of of Orthopedics and Oral Cell Biology, ACTA- University of Amsterdam and VU University, Research Institute MOVE, Amsterdam, The Netherlands.

175

A

A

176

List of publications

LIST OF PUBLICATIONS M.H. Kerkhof, A.M. Ruiz-Zapata, H. Bril, M.C.G. Bleeker, J.A.M. Belien, R. Stoop and M.N. Helder. Changes in tissue composition of the vaginal wall of premenopausal women with prolapse.

Am J Obstet Gynecol. 2013. 210, 168.e1-9.

A.M. Ruiz-Zapata, M.H. Kerkhof, B. Zandieh-Doulabi, H.A.M. Brรถlmann, Th.H. Smit and Marco N. Helder. Fibroblasts from women with pelvic organ prolapse show differential mechano-responses depending on surface substrates.

Int Urogynecol J Pelvic Floor Dysfunct. 2013 Sep: 24(9):1567-75.

M.H. Kerkhof. Hoeveel rek zit er in een prolaps?

Linneaus medisch Journaal (2011) 19:2:54-56.

M.H. Kerkhof, L. Hendriks, H.A.M. Brรถlmann. Changes in connective tissue in patients with pelvic organ prolapse, a systematic review of literature. Urogynecol J Pelvic Floor Dysfunct. 2009 Apr: 20(4): 461-74.

M.H. Kerkhof. Verzakking, een bindweefselziekte?

Linneaus medisch Journaal (2009) 17:1:1-33.

M.H. Kerkhof. Urine incontinentie.

Merck Manual. Leeftijd en gezondheid. 2008 p745-75.

M.H. Kerkhof and I. Scholten. POP leading to end stage renal failure.

J Fam Pract. In press.

M.H. Kerkhof, A.M. Ruiz-Zapata, B. Zandieh-Doulabi, H.A.M. Brรถlmann, Th.H. Smit, S. Vosslamber, Marco N. Helder. Gene expression in anterior vaginal wall from premenopausal patients with pelvic organ prolapse (submitted).

M.H. Kerkhof, A.M. Ruiz-Zapata, Zandieh-Doulabi, H.A.M. Brรถlmann, Th.H. Smit and Marco N. Helder. Functional characteristics of vaginal fibroblasts from premenopausal women with pelvic organ prolapse (submitted).

D.M. Koppes, R.P. Schellart RP, M.I. Withagen, M.H. Kerkhof. Anterior vaginal wall prolapse, the comparison of three different surgical techniques (submitted).

177

A

A

178

Dankwoord

DANKWOORD “Als ik al promoveer is het op een onderwerp dat me echt boeit en me na aan het hart ligt.” Dat was mijn standaardantwoord als het over promoveren ging.

Toen ik eenmaal mijn passie had gevonden in de bekkenbodemproblematiek en -chirurgie, met de bijbehorende problemen in de behandeling, was mijn onderwerp voor een proefschrift duidelijk. Een gesprek met Hans Brölmann en Marco Helder was de start van een heel nieuw project dat inmiddels is uitgegroeid tot een onderzoeksgroep met meerdere promovendi. Ik mag de eerste zijn van hopelijk een heel reeks promovendi die het proefschrift mag verdedigen; een proefschrift dat tot stand is gekomen dankzij velen. Het tomeloos enthousiasme voor de wetenschap is de bindende factor, die leidt tot synergie. De synergie die noodzakelijk is om als clinicus basaal wetenschappelijk onderzoek te doen en die geresulteerd heeft in dit proefschrift. Een aantal mensen wil ik graag persoonlijk bedanken.

‘Het besef van wederzijdse afhankelijkheid is een hogere waarde dan het besef van onafhankelijkheid’ Hooggeleerde heer Smit, beste Theo, we hebben elkaar pas later in het promotietraject leren kennen. Met je aanstelling als hoogleraar Translationele Regeneratieve Geneeskunde was het logisch dat je mijn promotor zou worden. Met nieuwe ideeën, ervaring en abstracte biomechanische benadering stapte je het project binnen en is er in korte tijd veel gebeurd. Je hebt je de prolapsproblematiek heel snel eigen gemaakt (‘prolaps kun je vergelijken met een container waar de bodem uitvalt’). Met open vizier gaf je richting en gaf je me de vrijheid en het vertrouwen om het vervolgens op mijn manier te doen. Dank voor dit vertrouwen.

Tijdens de laatste fase van het promotietraject was je er voor mij met al mijn vragen, deelde je het enthousiasme en liet me even stilstaan bij het reeds behaalde succes.

Ik waardeer deze samenwerking zeer. Met het oog op de toekomst wens ik dat we de gezamenlijke gedachte om de academische wereld te verbinden met het bedrijfsleven vorm kunnen geven en hiermee op een constructieve manier de middelen kunnen vinden om dit project de vleugels te geven die het verdient.

Hooggeleerde heer Brölmann, beste Hans, jij stond aan de basis van dit project.

Na een lange latente fase waarin meerdere aanvragen werden geschreven om dit project van de grond te krijgen, is het met veel ‘liefdewerk oudpapier’ toch gelukt.

Je hebt meerdere keren je waardering uitgesproken dat het project doorliep toen jij door de vele andere verplichtingen niet fysiek aanwezig kon zijn bij de

179

A

Dankwoord

besprekingen. Des te leuker vind ik het dat je tijdens de eindspurt nauw betrokken was. Je constructieve klinische input, verzonden vanaf de achterbank van je auto onderweg naar de wintersport en je positieve feedback met superlatieven tonen je oprechte betrokkenheid en interesse. Heel veel dank!

Zeergeleerde heer Helder, beste Marco, mijn copromoter van het eerste uur.

Wat ben ik jou ongelooflijk veel dank verschuldigd. Zonder jouw hulp was er überhaupt geen onderzoekslijn tissue- engineering in de urogynaecologie mogelijk geweest. Bijna wekelijks stonden er twee vrouwen op de stoep om resultaten met je te bespreken en volgende stappen te verzinnen. In de lange gangen van de orthopedie hoorde je ons al aankomen. ‘Koffie-met-sop’ en dan een hele ochtend zitten. Ik besef hoe luxe dat is geweest. Je luisterde rustig naar de discussie en de gedachtespinsels om vervolgens na een stilte en een zucht achteroverleunend scherp en helder samen te vatten en orde te scheppen; aan tafel en in onze hoofden.

Je wist onzekerheden weg te nemen en me ervan te doordringen dat je gewend raakt aan je eigen data. Dit tomeloze stille enthousiasme voor het project, maar ook de oprechte interesse in de andere belangrijke dingen in het leven, maakte van de onderzoeksbijeenkomsten misschien niet de meest efficiënte, maar wel de meest waardevolle. Tot slot wil ik je de harde data van de zogenaamde spam niet onthouden; vanaf 2008 waren het slechts 224 e-mails.

Zeergeleerde heer Zandieh Doulabi, beste Behrouz, mijn wandelende Wikipedia vriend en tweede copromotor. Je hoofd zit vol ideeën en je associatief vermogen is immens. Naast nieuwe, niet voor de hand liggende ideeën, bracht je technische expertise mee om onze vraagstellingen in zinvolle experimenten om te zetten.

Bij problemen in het lab was jij er om ze op te lossen. Wanneer ik beren op de weg zag, dacht jij gelijk in oplossingen en gaf me opdracht het maar even op zijn beloop te laten. Als ik het allemaal even te serieus nam stelde je me gerust met: “Het komt goed, het komt goed.“ En het is goed gekomen. Behrouz, dankjewel!

‘Wetenschap is kennis van oorzaak en gevolg’ De leden van de promotiecommissie: veel dank voor het kritisch doorlezen van mijn manuscript en de bereidheid als opponent op te treden. Ik kijk uit naar een levendige discussie.

A

Hooggeleerde vrouwe Gibbs, beste Sue, met al je kennis en kunde over de wondgenezing: ik hoop nog eens uitvoerig met je te kunnen brainstormen en ik zie zeer veel mogelijkheden voor een gezamenlijk project.

180

Dankwoord

Zeergeleerde vrouwe Kluivers, beste Kirsten, je hartelijke gastvrije ontvangst in Nijmegen, met oprechte interesse voor mijn project en het delen van jullie mooie klinische en genetische data heb ik zeer gewaardeerd. De ongedwongen mailtjes met je hartelijke woorden en complimenten geven op het juiste moment het gevoel dat ik met goed werk bezig ben. Zulke mails geven mij dan weer nieuwe energie om in de flow te komen. Dank voor deze betrokkenheid.

Hooggeleerde heer Niessen, beste Hans, zonder de medewerking van de afdeling Pathologie was een groot deel van het onderzoek niet mogelijk geweest.

Je bereidheid om vaak zonder budget te kijken naar wat wél kon, heb ik bijzonder gewaardeerd. Ook na het op niks uitlopen van het elektronenmicroscopisch onderzoek help je ons nu weer verder met het nieuwe DNA-project. Dank voor je inzet.

Zeergeleerde heer Pals, beste Gerard, dank voor je enthousiasme en je doorzettingsvermogen om, ook als het een dood spoor leek te zijn, samen met mij door te buffelen op zoek naar een antwoord. Ken je het verhaal van de klinisch geneticus, de ‘je-weet-wel-gynaecoloog’ en het DNA van patiënten met een prolaps? Nou, dat wordt uiteindelijk na wat hobbels en technische problemen een mooie publicatie voor het einde van dit jaar!

Zeergeleerde heer Roovers, beste Jan Paul, fijn dat je het TEAPOP team bent komen versterken. Je wetenschappelijke kennis, ambitie en enorme werklust hebben een positief effect op het bereiken van onze doelen. Gezamenlijk gaan we dit project op de kaart zetten.

Hooggeleerde heer van Royen, beste Barend, jarenlang heb je me als gynaecoloog bij jouw afdeling orthopedie gedoogd. De koffiehoek was een goede plek om even te informeren naar de voortgang van het onderzoek, maar ook om de plaatselijke dorpspolitiek, het wel en wee van het ziekenhuis of het investeren in onroerend goed te bespreken. Ik dank je voor je gastvrijheid en vind het een eer dat je als hoofd afdeling Orthopedie, hoogleraar en dorpsgenoot in mijn commissie zit. Ik kijk uit naar je uitdagende vraag.

Hooggeleerde heer van der Vaart, beste Huub, dank dat je in mijn promotiecommissie wilt zitten als hoogleraar urogynaecologie. De eerste gesprekken over samenwerking stammen al uit de IUGA 2005 in Athene. Soms hebben zaken tijd nodig. Nu het ‘matje’ in het slop is geraakt, is de tijd rijp om de rijen te sluiten en naast een klinisch consortium een basic science consortium op

181

A

Dankwoord

te starten waar een ieder zijn of haar expertise in kan brengen. Ik kijk uit naar de toekomst.

Zeergeleerde heer Vervest, beste Harry, vanaf het begin heb je me het vertrouwen gegeven dat ik met interessant onderzoek bezig ben en toonde je oprechte interesse. Je adviseerde me mijn eigen weg te bewandelen. Dit heeft me zeer gesteund en gestimuleerd. Zeer veel dank!

‘Begin met het einde voor ogen’ A.M. Ruiz-Zapata, dear Alejandra, llegaste a Holande para unirte al proyecto como ingenieria biomedica; y te volviste una legitima especialista de los fibroblasts.

Te entregaste por completo en cuerpo y alma al POP proyecto! Yo realmente aprecio tu solido trabajo y tu aportacion al proyecto; al que se que te gusta tanto como a mi. Demostramos ser un gran equipo; donde nos motivamos mutuamente durante el proceso de altos y bajos para lograr lo que es hoy el PhD proyecto y su reconocimiento; discutimos los resultados una y otra vez hasta ser capaces de terminar el manuscrito juntas. Aparte te volviste una amiga verdadera! Gracias por estar ahi en eso momentos. Estoy muy feliz que hoy seas mi paranimph en este dia tan importante para ambas. And dear Alan, thank you for the grammar and spelling, and above all, for the cheerfull evenings. I am looking forward to the next diner with your great boeuf bourguignon!

H. van der Jagt-Willems, lieve Hanna, poeh poeh, hè hè, nou nou, zo zo,… kilometers duinzand en asfalt zijn er door ons betreden, al pratend over alle perikelen van het dagelijks leven. Onze levens lopen gelijk op: van moeder worden, de specialistenopleiding, het leven als jonge klare, het opstarten van het onderzoek, en nu ook in hetzelfde jaar de promotie. We luisteren, spiegelen en coachen wat af. En wat is dat fijn! Dank voor je oprechte vriendschap, zorg en waardering. Ik ben er trots op dat we nu en straks in november bij elkaar op het podium mogen staan. En daarna is het feest, want onze successen gaan we vieren!

‘Zelf doen is niet hetzelfde als alleen’

A

Een multiparameter studie als die van mijn promotie onderzoek vereist multidisciplinaire samenwerking. Naast het vaste COLPOP/TEAPOP-team ontstond bij een nieuwe onderzoeksvraag weer een nieuwe groep mensen met een enorme bereidwilligheid en kennis. Ik heb erg genoten van deze bijeenkomsten, waar door inbreng van een ieder weer nieuwe stappen konden worden gezet.

182

Dankwoord

Zeergeleerde heer Bril, beste Herman, het was altijd weer gezellig om bij je langs te gaan. Eerst even een update over het wel en wee van het leven, uitwisselen van ervaringen van het werken als specialist in een groot ziekenhuis, waarna het gesprek moeiteloos overging in de stand van zaken van het onderzoek. Heel dankbaar ben ik voor deze gastvrijheid op jullie afdeling, voor het behulpzaam zijn bij het scoren van de alle coupes, wat toch wel echt een vak apart is en de bereidwilligheid om weer een nieuwe kleuring uit te voeren. ’Promoveren is 25 % inspiratie en 75 % transpiratie’ waren je gevleugelde woorden waar ik vaak aan heb moeten denken.

Zeergeleerde vrouwe Bleeker, beste Maaike, dank voor je input bij de opzet van de studie, het meehelpen met scoring van de coupes, en het maken van de prachtige histologie foto’s (met schaal). Het is fijn om met iemand samen te werken, die zich nog goed weet te herinneren wat het is om te promoveren en die even praktisch met je meedenkt. Je bemoedigende e-mails kwamen soms net op het juiste moment. Dank!

Zeergeleerde heer Belien, beste Jeroen, de morfometrische analyses van de coupes was een hele klus. Dankzij jouw heldere uitleg, directe communicatie en vlotte response hebben we veel werk in relatief korte tijd kunnen verrichten en is ons werk beloond met een mooie publicatie.

Zeergeleerde heer Stoop, beste Reinout, dank voor je onontbeerlijke kennis en kunde op het gebied van het collageenmetabolisme en de bereidheid om de biochemische bepalingen bij TNO uit te voeren.

Zeergeleerde vrouwe Stahlecker- Vosslamber, beste Saskia, jij was een geschenk uit de hemel bij de analyses van de micro-array data. Samen zijn we aan de klus begonnen die een fantastische samenwerking is geworden. Onder het genot van potten thee en stapels koek hebben we stap voor stap de meest uitgebreide analyse op de micro-array data van prolaps patiënten tot nu toe uitgewerkt. Ik ben je heel dankbaar voor de vanzelfsprekendheid waarmee je je hebt ingezet en je betrokken en verantwoordelijk hebt gevoeld voor dit onderzoek. Nu dat validatiecohort nog.

Op de OK voel ik me als een vis in het water, het laboratorium heeft nog heel veel geheimen voor me. Gelukkig waren daar ook de experts die hun steentje hebben bijgedragen: Jessica Schnabel (TNO), dank voor het vlot en nauwkeurig verrichten van de biochemische bepalingen. John van der Meij en Jaap Wilkes (KG), dank voor het uitvoeren van de kleuringen, en het assisteren bij het vullen van al die thermosflessen stikstof. Alleen al voor het hartelijke welkom, kom ik het lab nog

183

A

Dankwoord

even oplopen! Francois Rustenburg (VUmc), geconcentreerd en in volledige stilte hebben we uren naast elkaar de voorbereiding getroffen voor de micro-array analyses. Het was een welkome afwisseling naast de hectiek van de kliniek. Dank voor je hulp. De afdeling orale celbiologie van ACTA is een heerlijke afdeling om rond te lopen. Er heerst een open sfeer en een positieve dynamiek, waar ik me gelijk welkom voel. Marjolein Blaauwboer, dank voor je inspiratie voor de figuur in mijn discussie en handige tips. Jenny Vermeer wat fijn dat je klaar bent! Een hele mooie dag gewenst op 12 september!

Mahshid Vashaghian, dear Mahshid, thank you for your new insights and input with respect to the different materials and their mechanical properties as well as new techniques to the TEAPOP project.

Chantal Diedrich, welkom bij het TEAPOP team. Succes met de volgende stap richting klein proefdiermodel.

Ron Glandorf, jij was te allen tijde voor me beschikbaar, zelfs vanaf je eiland op zondagmiddag, om me verder te helpen bij één van de vele statistische vragen.

Je enthousiasme om dan samen te gaan puzzelen was leerzaam, motiverend en aanstekelijk. Dank!

A

De samenwerking met de A(N)IOS: het is heerlijk om met enthousiaste mensen te werken die leergierig zijn. Marotahl Leung-Lo-Hing, veel dank (ook aan je man voor het schrijven van dat handige programmaatje) voor al je werk en je input in de database. Het abstract op de IUGA in Brisbane was een mooie afsluiting van je wetenschappelijke stage en het begin van mijn hoofdstuk 2. Mireille Duindam, jij weet als geen ander dat je soms uren (wetenschappelijk) monnikenwerk verricht zonder dat het een publicatie oplevert. Ik waardeer je zeer om je volhardendheid en je geloof in het project en vertrouwen in mij. Het ziet er goed uit met de DNA analyses; we gaan er een mooie publicatie van maken! Linda Hendriks, we staan samen in de toptien van de meest geciteerde artikelen van de International Journal of Urogynecology en daar ben ik reuze trots op. Zonder je praktische ondersteuning had het verzamelen en beoordelen van de artikelen voor dat stuk veel langer geduurd. Heel veel dank en heel veel geluk met al het moois dat komen gaat. Melanie van IJsselmuiden, de landelijke enquête met betrekking tot de laparoscopische hystero-/ sacrocolpopexie voer je met een vliegende vaart uit.

Motiverend om te zie hoe snel je de aanwijzingen weet te verwerken. Nog heel even en we zijn klaar voor submission!

184

Dankwoord

Dank aan alle vrouwen die bereid zijn geweest deel te nemen aan het onderzoek.

‘Herinner gisteren, droom van morgen maar leef vandaag’ Vakgroep obstetrie en gynaecologie Kennemer Gasthuis: mijn oud-collega’s Magda Armeanu, Dorien ten Cate, Han Clements, Judith Gianotten, Ino Hendriks, Jonas van de Lande, Coen de Nooyer, Paula Pernet, Ans Remmink, en Esther van Swieten. Als ANIOS begonnen en weggegaan als urogynaecoloog. Dertien jaar heb ik met veel plezier in het KG gewerkt en heb ik de ruimte gekregen om mij te ontwikkelen en me te vormen tot de dokter en onderzoeker die ik nu ben. Dank daarvoor. Speciaal dank ik mijn opleider Jos Lips, die me de kans heeft geboden om te solliciteren naar een opleidingsplek in het VUmc. Je was de tijd vooruit toen je me de ruimte gaf om me de laatste twee jaar van de opleiding toe te laten leggen op de bekkenbodem en de bekkenbodempoli op te zetten. Ik ben je daar nog dagelijks heel dankbaar voor! Als je eens met Inez op de tandem voorbij komt racen, vergeet niet te bellen: je weet de borrel staat koud! En dan natuurlijk René Schellart: tijdens mijn opleiding was je mijn mentor en als gynaecoloog mijn maatje. Een vakman, altijd goed geïnformeerd, perfectionistisch en met visie. Samen hebben we één van eerste bekkenbodempoli’s in Nederland opgezet. We hebben dezelfde ambities, interesses en gedrevenheid op professioneel gebied en willen keihard werken om de patiënten zorg op maat te bieden. Ik mis het gezamenlijk opereren, waarbij een operatie-assistente ooit opmerkte dat het net een vloeiend quatre-mains-spel was, zonder dat daar woorden voor nodig waren. Ik heb ongelooflijk veel van je mogen leren en je was een fantastische mentor, die me alle mogelijkheden heeft geboden om een goede arts en operateur te worden. Dat we nu allebei urogynaecoloog zijn ervaren we beiden als een kroontje op jarenlange inspanning. En dan komt er straks ook nog een doctors titel bij! We hebben veel bereikt waar we trots op kunnen zijn.

Ik wens je heel veel geluk en vergeet niet van het leven te genieten!

Het bekkenbodemteam: René Schellart en Haitze van der Veen, Ingeborg Timmermans, Rob Silvis, René van der Hulst, Cora Broerse en Anneke van Wilpen.

Ik kijk terug op een fantastische tijd. De bekkenbodemspreekuren liepen gesmeerd met een zeer hoge patiënttevredenheid. Haitze, een geweldige arts en collega; ik heb heerlijk met je samengewerkt, veel van je mogen leren. Jij bent een voorbeeld hoe je naast keihard werken ook aandacht en tijd maakt voor de andere belangrijke dingen in het leven. Ik heb een hoop pret met je gehad met onze sketch op Malta als absoluut hoogtepunt. Weer een Marre krite vlaggetje voor 2015?

Staf van het Kennemer Gasthuis, A(N)IOS, verpleegkundigen, verloskundigen,

185

A

Dankwoord

doktersassistenten en baliemedewerkers dank voor de prettige samenwerking.

Miranda Vos, Ok assistente: we hebben heerlijk gewerkt. Wie weet kruisen onze wegen nog ergens. Annamien Vijvers, Hendrien Koers (KG), Christine Esveld en Elise Haan en Carolien Huf (VUmc), dank voor de secretariële ondersteuning en jullie oprechte interesse.

Bekkenfysiotherapeuten Kennemerland: dank voor de prettige samenwerking.

De patiënten met bekkenbodemproblemen in Kennemerland kunnen vertrouwen op een deskundig team van gemotiveerde en gedreven therapeuten. Bettyleen de Vries, wat geniet ik van onze samenwerking die zo natuurlijk verloopt. Ik waardeer je enorm om de manier waarop je mensen behandelt. Je probeert aan te sluiten bij hun belevingswereld en maakt een plan dat past in hun dagelijks leven. Jij als persoon maakt het verschil! We dromen van morgen en genieten van de zon vandaag.

Maatschap obstetrie en gynaecologie Isala Klinieken, dank voor het hartelijke welkom in jullie kliniek. Met heel veel plezier rij ik elke week weer voor en paar dagen naar het Zwolse: een veelzijdige inspirerende werkplek met een aangename sfeer.

Het is heerlijk en uitdagend om in een grote kliniek met veel derdelijnsproblematiek de urogynaecologie te mogen doen. Hugo van Eijndhoven, dank voor je vertrouwen. Ik heb diep respect voor hoe je de wetenschap hebt georganiseerd in de kliniek. Marian Engberts, al is promoveren voor jou al wat langer geleden, je tips and trics waren zeer welkom. We gaan een mooie tijd tegemoet. Fellows, A(N) IOS, verpleegkundigen, doktersassistenten en polimedewerkers, dank voor de fijne samenwerking en de persoonlijke interesse. Zwolle voelt als een warm bad.

‘Alleen de mens die zich kan ontspannen is in staat te creëren’

A

Lieve vrienden binnen en buiten de medische wereld, bedankt voor jullie nimmer aflatende interesse, gezelligheid en ontspannende momenten. In het bijzonder Erik en Mirjam: heerlijk ongecompliceerd, spontaan, hartelijk en warm; we hoeven niks te vragen, jullie doen gewoon de juiste dingen op het juiste moment. Onze buitensportvrienden Paul en Eef, Jet en Joost, Frans en Virgini, Bert, Gerard en Beatrijs, Josje en Joost, veel meer dan sporten alleen; jullie staan voor pretentieloos.

Bij jullie kan ik helemaal mezelf zijn. Deze zomer gaan we weer varen! Marion en Pieta, dank voor jullie support in de laatste fase die toch nog wat meer werk was dan ik dacht. Barbara, dank voor je prachtige lay-out die door omstandigheden last minute werk werd, maar wat niet aan kwaliteit heeft ingeboet. Dank aan allen die me een foto van zichzelf en hun (klein-) dochters hebben gestuurd om zo een heel

186

Dankwoord

persoonlijke cover te kunnen maken.

‘A friend knows the song in my heart and sings it to me when my memory fails’ Lieve, lieve vriendinnen; Karin, Jantine, Emmy, Afine, Katja, Monique, ik voel me een heel rijk mens met jullie om me heen. Jullie interesse en bemoedigende woorden hebben me vaak kracht gegeven om door te zetten. De saunabezoeken, borrels, koffie en etentjes waren een welkome afwisseling. Karin, onze vriendschap telt al meer dan twintig jaar. We delen lief en leed en steunen elkaar door dik en dun. De wetenschap dat ik altijd op je kan rekenen, geeft me rust. Fijn dat jij en Mark er zijn! Jantine, wat twintig jaar geleden op de Uithof begon met een worsteling met een fietsenslot, gevolgd door de slappe lach van mij is uitgemond in een jarenlange vriendschap. Je scherpte en analytisch vermogen samen met je gevoeligheid maken je tot een heerlijke gesprekspartner om over de grote en de kleine dingen van het leven te praten. Emmy, wat ben je toch een sterk mens. Ik heb diep respect voor hoe je het allemaal doet. Als we weer hebben bijgekletst, smaakt het altijd naar meer. Afine, we zijn nauw bij elkaars levens betrokken door de grote dingen die we van dichtbij hebben meegemaakt. Ik waardeer in jou enorm het zoeken naar oplossingen en het geloof in je eigen gevoel. Katja, de inspirerende gesprekken aan de keukentafel of wandelend in het bos geven me altijd weer enorme boost positieve energie, dankjewel. Monique, je doet het toch maar gewoon allemaal en dan ook altijd met goede zin. Met mijn strakke planning had ik vaak geen tijd voor een spontaan bakkie leut, maar de geplande theateravondjes waren echte ontspanning. Danelia, pájaro loca. Este proyecto esta listo, pero sabes que no puedes experar que mi vida sea tranquila. Pero no te preoccupies, yo sé que cuando estoy mucho tiempo en silencio, tú siempres sabes cómo encontrarme. Recuerdo que en los barrios lejanos de Ghana, en dónde la comunicación no era simple porque el fax y el teléfono estaban cortados, era Dany en el teléfono preguntando cómo me siento? Tú sigues mi vida y sin palabras entiendes como siento. Eso es… nuestra cariñosa amistad. Muchas gracias.

‘Wie zijn eigen weg gaat, kan door niemand worden ingehaald’ Lieve ouders, ik heb het geluk gehad in een liefdevol warm nest op te groeien waarbij emotioneel welbevinden en niet de prestatie op nummer één staat. Jullie hebben me gestimuleerd en tegelijkertijd vrijgelaten in de dingen die ik wou doen.

Nu ik zelf kinderen heb, ervaar ik dat dit echt niet altijd makkelijk is. Lieve mam, mensenmens, één bonk hartelijkheid, enthousiasme en spontaniteit. ‘Volg je eigen pad en luister goed naar jezelf’, is je levensmotto wat niet altijd makkelijk in praktijk

187

A

Dankwoord

te brengen is. Het heeft me zeker al veel heeft opgeleverd. Lieve pap, je bent een man van weinig woorden. Maar ik voel je betrokkenheid en weet dat je enorm met mij begaan bent. Van jou heb ik geleerd dat als je ergens voor gaat, je hard moet werken en je je doel voor ogen moet houden. Als ik het even niet zag zitten, heb ik uit deze wijsheid veel kracht gehaald. Lieve pap, I did it!

Mijn zussen Lien en Lous, waar ik daar in het westen allemaal mee bezig ben, is soms een beetje een ver-van-jullie-bed-show. Maar jullie leven met me mee en het kaarsje brandt als het nodig is. Lieve Lien, harde werker, zorgzaam en super attent. Het leven lacht je niet altijd toe, maar jij weet toch altijd weer die slingers op te hangen. Ik gun je alle geluk en liefde van de wereld. Lieve Lous, mevrouw de directrice in het kwadraat, self made woman: jij regelt het strak, heel strak, en handig, heel handig. Ik heb bewondering hoe je het allemaal doet. Vergeet tussen alle bedrijven door jezelf niet. Harald, ik zal het kort houden, ik vind je een topper!

De Buiters, lieve Magrietje zorgen voor je echtvriend en (klein-) kinderen is je lust en je leven. ‘Ik verwacht niks, maar reken overal op.’ Daar hebben we allemaal heel erg veel gemak en plezier van gehad. Dat de rollen nu langzaamaan omdraaien, valt je zwaar. Met de focus op wat nog wel lukt, en met veel humor plukken we de dag. Lieve pa Buiter, apetrots ben je op je kroost en dat mag iedereen horen.

Dank voor je interesse. Het is nu echt klaar! Maar of ik nu alles al heb geleerd?

Broers en schoonzussen Buiter; botte grappen, een lach en een traan, lekker eten en een hoop gezelligheid, dank voor de ontspanning. Joost, bedankt voor de hulp bij het mooi maken van de figuren van tante Pietje Precies. Ik kijk nu al weer uit naar zeilvakantie met Frits en Fiep. Jaco, mijn persoonlijke adviseur in de nieuwe avonturen: wat waardeer ik je kennis, analytisch vermogen, je wijze raad en praktische bijstand. Je mag best wel wat minder bescheiden zijn!

‘You yourself, as much as anybody in the entire universe deserve your love and affection’

A

Lieve Merel en Brechtje, twee authentieke prachtmeiden, die me dagelijks herinneren aan wat werkelijk belangrijk is. Merel, scherp, creatief, vol humor en zelfstandig. Wat heb jij op jonge leeftijd al een kracht laten zien om boven jezelf uit te stijgen en je eigen koers te varen. Brechtje, vol ideeën, behulpzaam en fijngevoelig. Jij voelt als geen ander de dingen haarscherp aan en kan ze dan fantastisch verwoorden. Wat heb jij inmiddels veel zelfvertrouwen opgebouwd.

Jullie mogen met recht trots zijn op jezelf en wat ben ik trots op jullie! Dank voor jullie geduld, het boekje is eindelijk klaar!

188

Dankwoord

â&#x20AC;&#x2DC;Happinez is only valid when sharedâ&#x20AC;&#x2122; Rob, liefste Rob, Jack of all trades, integer, met inzicht en zuiverheid van geest.

Wat een feest om samen met jou te zijn. Met niemand kan ik zo lachen als met jou en met niemand is de stilte zo aangenaam. Het traject van het proefschrift met alle ups en downs die erbij horen was niet altijd makkelijk voor jou. Je gaf me de ruimte, je geduld en je vertrouwen om dit project tot een goed einde te brengen.

Het is nu klaar en daar staan we uitgebreid bij stil. Ik ben benieuwd waar onze volgende reis naar toe gaat.

A

189

A

190

Curriculum vitae

CURRICULUM VITAE Manon Heleen Kerkhof was born on Sunday May 27, 1973 in Losser, The Netherlands as the second daughter of Manny ter Braak and Gerard Kerkhof. After graduation from the Carmel Lyceum in Oldenzaal, she started Medical School at the University of Utrecht in 1993. She obtained her Medical Degree cum laude in 2000 and started her residency in Obstetrics and Gynecology at the VUmc (Prof. Dr. H. Van Geijn) and the Kennemer Gasthuis in Haarlem (Dr. J.P. Lips) in September 2001. The last two years of her residency she had the opportunity to specialize in the pelvic floor and pelvic floor reconstructive surgery. At that time also the research project ‘Tissue engineering in pelvic organ prolapse’, TEAPOP, was born, in collaboration with professor H. A. M. Brölmann (Department of Obstetrics and Gynecology, VUmc, Amsterdam), and dr. M.N. Helder (Department of Orthopedics, VUmc, Amsterdam.

The COLPOP study (collagen metabolism in pelvic organ prolapse), part of the TEAPOP project was the basis for the studies presented is thesis.

In 2008 after finishing her residency, she became staff consultant gynecologist at the Kennemer Gasthuis in Haarlem. Three years later she was registered as a subspecialist urogynecology. Currently she is working as a consultant urogynecologist at the Isala Klinieken in Zwolle.

Manon lives in Heemstede together with her husband Rob Buiter and their two daughters Merel and Brechtje.

A

191

Pelvic Organ Prolapse in women is both widespread and unexplained. In an attempt to shed light on the biology of this common disease, this thesis describes some of the characteristics of the prolapsed connective tissues. Are the changes that can be found an effect of the prolapse or are they causing the disease?

The prolapsed tissues are compared to unaffected tissues of the same women, as well as to the same tissues of healthy controls.

This approach makes this research a valuable first step in the quest for better understanding as well as better treatment of this invalidating disease.