Issuu on Google+


Contenido Una publicación de la Asociación Colombiana de Porcicultores Fondo Nacional de la Porcicultura Junio de 2011 • Año 22 - No. 154 Licencia Mingobierno 0011739

Junta Directiva Presidente Cooperativa Colanta Santiago Berrío Calle Vicepresidente APA Guillermo León Barreneche S. Miembros Agropecuaria La Molienda Ltda. Carlos Eduardo Pineda Bustos Augusto Osorno Gil Cercafé Lilia Consuelo Velasco Zambrano Cerdos del Valle S.A. Juan Carlos Cardona Eduardo Gómez González Freddy Alonso Velásquez Restrepo Granjas Paraíso María del Carmen Otero Jorge Eliecer Jaramillo Mesa Miembro Honorario Jaime Enrique Cuéllar Chacón CONSEJO EDITORIAL Gerente Carlos Alberto Maya Calle Subgerente Ximena Mahecha Anzola Editora Lorena Castañeda Macchi comunicaciones@porcicol.org.co Conceptualización gráfica y diseño de portada BHR Grupo Estratégico Fotografías Departamento de comunicaciones, Archivo general, Páginas WEB Impresión Legis S.A. Avenida Calle 26 No. 82-70 PBX: 425 5255 Exts. 1341-1301 www.porcicol.org.co www.meencantalacarnedecerdo.com Bogotá • Colombia Las opiniones aquí expresadas son responsabilidad de sus autores. Reproducciones parciales o totales deben acreditar la fuente, citando nuestra publicación.

ISSN 0122-4220

4

Junio • 2011 •

Contenido

3 4 5

Porcicultura, sostenibilidad y medio ambiente. Actividades de interés. Carne de cerdo: ¿ blanca o roja?.

8

Bioseguridad: avances de las granjas vinculadas al Programa Nacional de Mejoramiento del Estatus Sanitario (PNMES) 2009 - 2010.

14

Caracterización Genética de Circovirus Porcino tipo 2 (PCV2) en cerdos en Colombia. Incorporación de ingredientes funcionales en el alimento para cerdos: nucleótidos orgánicos.

16 20 23 26 27 28

Asoporcicultores actualiza experiencia en alimentos. Sector porcícola: afectados por la ola invernal. Financieros trabajando para el desarrollo de la industria porcícola colombiana. Rendición de cuentas ICA 2010. Costos de producción de mayo.

Nuestros anunciantes Frigoríficos Ble 1 Agenda Seminario salud y producción porcina 2011 7 Contraportada Vecol 11 Fondo Nacional de la Porcicultura Lhaura 13 Alltech de Colombia 17 Portadas interiores Intercomercial Andina Ltda. 19 Centro de Servicios Técnicos y Financieros Genagro International 21 Misión y Visión Solla 22 Bayer 25 BioARA S.A. 27


Porcicultura

sostenibilidad y medio ambiente

P

orcicultores es imperante incorporar en la empresa porcícola una transformación del pensamiento que conduzca hacia la sostenibilidad, es decir, lograr productividad, eficiencia y competitividad con sentido de preservación, respeto por los ecosistemas y protección de los recursos naturales intervenidos en el sistema productivo. La riqueza natural de nuestro planeta, evidenciada abiertamente en Colombia, se agota o la estamos agotando, y como muchas veces el verdugo debe ser el salvador, tenemos la obligación de preservarla y conservarla. Solamente aquellos proyectos agropecuarios que prioricen y concentren una gran parte de sus esfuerzos en la conservación de nichos ecológicos, fuentes hídricas, resguardos forestales y el ecosistema en general, podrán ser sostenibles hacia el futuro. Desde la etapa de planeación del proyecto, el porcicultor debe analizar y establecer el manejo ambiental en la producción, con el uso adecuado de los residuos biológicos, logrando optimizar los recursos naturales y la mitigación de su posible impacto. La sostenibilidad permite la disminución en los costos de producción, como resultado de la eficiencia en el uso de los recursos, que constituyen fuente primaria en el sistema productivo de los diferentes eslabones de

la cadena agroalimentaria de la cual hacemos parte. En la actualidad, el consumidor final direcciona sus preferencias hacia productos que sean amigables con el medio ambiente a través de todo el sistema, y que no generen un impacto ambiental negativo o de agotamiento. El consumidor quiere ser parte de programas o sistemas ambientales pensando en las condiciones agroclimáticas futuras, que obligan al porcicultor a establecer sistemas de producción eficientes con los ecosistemas. La buena gestión en beneficio de los recursos naturales en la empresa porcícola, es un compromiso agroecológico rentable, que beneficia las prácticas de conservación, biodiversidad y sanidad animal a la porcicultura, brindado al consumidor global seguridad y confianza en la producción de carne de cerdo amigable con el medio ambiente! Cordialmente,

A.E.A SANTIAGO BERRÌO CALLE Jefe FRIGOCOLANTA. Presidente Junta Directiva.

• Porcicultura Colombiana •

5


Curso-taller patógenos en alimentos

Inversión

Del 11 al 13 de julio se llevará a cabo el Curso-taller patógenos en alimentos: estrategias de Gestión, Detección y Control de Salmonella spp., E coli, Listeria y Campylobacter spp, que busca presentar una visión detallada de los patógenos Salmonella spp., Campylobacter spp., Listeria y Escherichia coli, sus fuentes y rutas de difusión en la cadena de abastecimiento de alimentos, además de los medios de detección y control, así como los más importantes cambios en la regulación para algunos productos alimenticios.

X Encuentro Nacional de Porcicultura 2011 En el hotel el Cid Resorts, Mazatlán, Sinaloa en México se llevará a cabo el X Encuentro Nacional de Porcicultura. El encuentro se realizará del 12 al 15 de octubre de 2011, los temas que se abordarán son: tendencias del consumo en productos agroalimentarios, tendencia de la porcicultura en Estados Unidos, México y Canadá; tendencias económicas 2011-2012 y cómo hacer negocios, casos Latinoamérica. Mayor información http://www.encuentroporcicultura.com.mx/ correo electrónico: encuentroporcicultura@prodigy.net.mx

Parte teórica

Parte teórica práctica

Profesionales

$500.000

$750.000

Egresados UJTL

$450.000

$525.000

Estudiantes

$150.000

$400.000

Mayor información Programa de Ingeniería de Alimentos Calle 22 No. 4-96 – Módulo 7 A Piso 4 PBX: 2427030 Ext. 1440 a 1442 ingenieria.alimentos@utadeo.edu.co educacion.continuada@utadeo.edu.co

Diplomado en línea en medicina y producción porcina De noviembre de 2011 a mayo de 2012 se llevará a cabo en la Universidad Nacional Autónoma de México, el diplomado en línea en medicina y producción porcina. Son siete los módulos que componen este diplomado: bioseguridad, epidemiología, pruebas diagnósticas, actualidades e interpretación de pruebas de laboratorios, manejo zootécnico de los cerdos, toma de decisiones, evaluación económico-administrativas y normalización e impacto ambiental. El valor por modulo es de 100 USD y el pago único es de 580 USD. Mayor información Correo electrónico: fmvzdipl@unam.mx

Segundo Congreso Iberoamericano de Biotecnología y Biodiversidad Bioredandina y la Fundación Generación Bio con el auspicio de la Alcaldía de Manizales, organiza el Segundo Congreso Iberoamericano de Biotecnología y Biodiversidad, que se celebrará en la ciudad de Manizales, Caldas en Colombia, del 21 al 24 de septiembre. El evento contará con cursos pre-congreso (cupo limitado) a efectuarse en los días 19 y 20 de septiembre. Los conferencistas invitados son Cletus Kurtzman (USA), Gloria Caminal (España), Mario Canales (España), Michael Seeger (Chile), Faustino Siñeriz (Argentina), María Ester Lucca (Argentina), Jose Manuel Siverio (España), Albert Sasson (Francia) y Javier Moran (España). Mayor información http://www.bioredandina.com/

6

Junio • 2011 •

Del 13 al 16 de septiembre se llevará a cabo en Rennes, Francia, Space 2011. Coloquios, conferencias, encuentros con el Instituto del Sector Porcino, el Instituto Nacional Francés de Investigación Agronómica, subastas, concursos y la exposición de aproximadamente 800 animales de alto valor genético, son algunas de las actividades planeadas para los 100 mil visitantes que planean asistir a este espacio que reúne al sector porcino, bovino, ovino y avícola. El ingreso es gratuito previa inscripción en el sitio web del evento. http://www.space.fr/


Carne de cerdo:

¿ blanca o roja ?

Luisa Fernanda Isaza Rodríguez - Chef -Asesor gastronómico

¿Carne roja o carne blanca?, un debate sin relevancia. La carne de cerdo ocupa el primer lugar en el plato por su alto valor biológico, grasas de perfil monoinsaturado, vitaminas y minerales.

M

uchas personas han llegado a pensar en la carne de cerdo como “la otra carne blanca”, y otras la eliminan de su dieta porque es “roja”. Sin embargo, hay que tener en cuenta varios agentes, entre estos, que todas las carnes, tanto las rojas como las blancas, contienen proteínas de excelente calidad y una buena cantidad y variedad de vitaminas y minerales. El consumo moderado de este grupo de alimentos contribuye al buen estado de la salud y al crecimiento y desarrollo de los tejidos, así como a la prevención de enfermedades como la anemia y la desnutrición. Entonces, ¿la carne de cerdo es roja o blanca? ¿importa? ante esta clasificación, es mejor plantearse las siguientes preguntas: ¿qué diferencias nutritivas hay entre unas y otras?, ¿a qué se debe su coloración?, ¿cuál de las dos es mejor? Contrario a lo que muchos piensan, la carne de cerdo es saludable gracias a las modernas técnicas de crianza que la hacen magra y sabrosa. ¿Y el color? su coloración más rojiza se debe al contenido en mioglobina, un pigmento de color rojo que contiene hierro y se encuentra en las fibras musculares. Por lo tanto, que las carnes sean rojas o blancas depende de la concentración que tengan de esta sustancia y, de hecho, bajo este criterio se clasifican en unas u otras. En caso específico del cerdo se tiene en cuenta la parte de la canal, así, el solomito se considera carne roja, mientras que el lomo de cerdo atiende a la clasificación de carne blanca. Entonces, ¿vale la pena seguir cuestionando colores sabiendo la grandeza de su contenido nutricional?, no es relevante, pues su pigmentación no le quita sus magnificas bondades nutricionales y su sabor sin igual. La carne magra de cerdo tiene proteínas de alto valor biológico, grasas de perfil monoinsaturado, vitamina B12, Zinc y minerales, lo que la convierte en un producto sano, y unas cualidades organolépticas que la hacen apetitosa, además con un precio asequible.

El nutricionista H. Gómez de Dietecom España ha asegurado que la carne magra de cerdo pertenece, según los estudios sobre la pirámide alimentaria, al grupo de proteínas que debe consumirse diariamente y es una de las carnes de la que pueden tomarse entre tres y cuatro ingestas a la semana. Asimismo, la directora de Dietecom España, Sonia Lázaro, también explica que existen “dos motivaciones a la hora de elaborar un menú, la primera es que sea saludable y la segunda, que sea apetecible” y, en su opinión, la carne de cerdo reúne estas dos cualidades. Es así que no se debe olvidar que hay que preservar las características saludables y deliciosas de los alimentos ricos en proteínas como la carne de cerdo, siendo tan consumida en los distintos platos en nuestra gastronomía. Basta con prepararla utilizando las técnicas culinarias que no añadan tanta grasa. En conclusión, no importa como la clasifiquen o la llamen, la carne de cerdo es más tecnificada, más saludable y nutritiva, nos ofrece el 70% del VDR, de proteína diaria, no en vano llaman al cerdo - “el olivo con patas 100g” -. Blanca o roja, sólo es un nombre que camufla su verdadero valor nutricional y gastronómico. De esta manera “el discurso de placer y salud está omnipresente” en todo lo que tiene que ver con la carne de cerdo. Bibliografía. Características de las grasas en las carnes. http://www.consumer.es/web/es/alimentacion/ Influence of dietary treatment on lipid and cholesterol oxidation in pork. José Félix Patiño, MD, FACS, (Hon) Metabolismo y nutrición La composición de las carnes www.worldporkconference.com • Porcicultura Colombiana •

7


Carne de cerdo, y

M

ucho se ha dicho de la carne de cerdo: que es muy grasosa, contiene demasiado colesterol, provoca alergias, produce enfermedades nutricionales, transmite cisticercos o es poco higiénica. ¿Cuántos de ustedes se privan de consumir este delicioso alimento haciendo caso a estos mitos que han pasado de generación en generación?

Rica en proteínas, vitaminas, minerales, versatilidad en su preparación y exquisito sabor son las principales características por las que recomendamos incluir la carne de cerdo en su dieta diaria. Los médicos y nutricionistas aconsejan realizar un plan de alimentación saludable que incluya

hoy es... saludable

los cuatro grupos de alimentos. La mejor opción dentro del grupo de carnes, leguminosa y huevos al que pertenece, es la carne de cerdo, pues contiene muchos de los nutrientes recomendados por las organizaciones de salud. Cinco vitaminas esenciales (Tiamina, Riboflavina, Niacina, Vitamina B12 y Vitamina B6) y cuatro importantes minerales (Hierro, Zinc, Fósforo y Potasio). Además es fuente de proteínas y su contenido natural en Sodio es bajo. Recomendada en planes de alimentación saludables como los de la American Heart Association, American Dietetic Association, American Diabetic Association y en las guías alimentarias de muchos países como Colombia, Canadá y Estados Unidos, la carne de cerdo es la proteína que más se consume en todo el mundo.

Carne más tecnificada La vieja creencia que la carne de cerdo es poco higiénica ha ido desapareciendo con el paso del tiempo. Gracias a los desarrollos tecnológicos implementados por los productores porcícolas de Colombia, el sector ha trascendido de una producción artesanal y de subsistencia, hacia una producción intensiva, orientada por principios de eficiencia técnica y económica. Actualmente hablamos de una industria porcícola colombiana, que trabaja en la implementación de unas buenas prácticas de producción porcícola cumpliendo la normatividad sanita-

ria, ambiental y laboral establecida por el Estado colombiano, para brindar un producto de excelente calidad. Con un desarrollo genético, alimentación balanceada, con base en la mezcla de materias primas como soya y maíz, manejo de conceptos de prevención y control de enfermedades y bioseguridad, desarrollo de infraestructura de alojamiento y mano de obra calificada podemos certificar que la carne de cerdo que se produce en Colombia es mucho más tecnificada y por ende saludable.

Y es mucho más saludable La carne de cerdo cuenta con una serie de propiedades que la han convertido en una de las proteínas más saludables a nivel mundial. Cuando usted se alimenta con carne de cerdo está consumiendo una proteína completa, contiene aproximadamente 20 g de proteína por cada 100 g de carne cruda y de 27 a 35 por cada 100 g de carne cocida. Esta mayor cantidad de proteína se debe a que al cocinarse la carne, su contenido de agua se disminuye y los nutrientes se concentran más. El perfil de ácidos grasos de la carne de cerdo varía según el corte. Por ejemplo, la carne magra es mayor en ácidos grasos insaturados (ácidos grasos monoinsaturados + ácidos grasos polinsaturados) y menor en ácidos grasos saturados. Su principal ácido graso

8

Junio • 2011 •

monoinsaturado es el ácido oleico, que está aproximadamente en un 42%. Los cortes magros de carne de cerdo contienen menos de 10 g de grasa total, de 4,5 g de grasa saturada y de 95 mg de colesterol. El lomo de cerdo cumple con las directrices para extramagro: contiene menos de 5 g de grasa total, de 2 g de grasa saturada y de 95 mg de colesterol. Con 24 cortes la carne de cerdo, su calidad proteica y su alto contenido en Fósforo y Potasio la han ha convertido en la opción número uno de muchos colombianos.


Bioseguridad: avances de las

granjas vinculadas al Programa Nacional de Mejoramiento del Estatus Sanitario (PNMES) 2009 – 2010

L

a implementación de las medidas de bioseguridad como método que permite la protección del establecimiento porcícola ante el ingreso de agentes indeseables, procurando de esta manera el mantenimiento del estatus sanitario del establecimiento y limitando los factores de riesgo internos y externos para la transmisión de enfermedades, son un punto estratégico que muchas producciones porcícolas del país vienen implementando con el fin de brindar un manejo sanitario de tipo preventivo que las lleve a realizar producciones de alta salud.

de tipo voluntario y no refleja la distribución de la población porcina del país. Gráfica 1 .Porcentaje de granjas en el Programa Nacional de Mejoramiento del Estatus Sanitario según la región.

Es por esto que la Asociación Colombiana de Porcicultores – Fondo Nacional de la Porcicultura está trabajando, a través de los diferentes programas instaurados, en la implementación de medidas básicas de bioseguridad y sanidad en los diferentes sistemas de producción porcícola del país, dentro de los cuales, el Programa Nacional de Mejoramiento del Estatus Sanitario (PNMES) se encuentra en vigencia desde hace cinco años. El objetivo de esta publicación es dar a conocer el grado de implementación y avance, que en bioseguridad han logrado las granjas que hacen parte de este programa, lo que permite visualizar de manera general las principales fortalezas y debilidades que presentan las granjas, teniendo en cuenta algunas características como número de madres, sistema de producción, flujo de animales, número de sitios y los puntos de bioseguridad internos y externos básicos contemplados dentro de la resolución 2640 del ICA y la guía de buenas prácticas para el subsector porcícola. El presente trabajo se realizó teniendo en cuenta las evaluaciones de bioseguridad realizadas durante los años 2009 y 2010 a un total de 31 y 25 granjas respectivamente vinculadas al PNMES. Las granjas pertenecientes al PNMES son granjas tecnificadas, cuyo inventario de madres se encuentra entre 80 a 1200 hembras de cría con una media de 380 hembras. Las granjas se encuentran ubicadas a nivel nacional, los departamentos fueron agrupados por las zonas productivas tradicionalmente reconocidas, las cuales son: zona centro: Bogotá, Boyacá, Cundinamarca, Huila, Meta y Tolima. Zona occidente: Caldas, Quindío, Risaralda, Cauca y Valle del Cauca. Zona costa: Atlántico, Bolívar, Cesar, Córdoba, Guajira, Magdalena y Sucre. Otras Regiones: Arauca, Nariño, Santander. La distribución de las granjas del PNMES analizadas dentro de este informe, se encuentran en mayor cantidad ubicadas en la zona occidente y centro, tal y como se muestra en la gráfica 1; es importante mencionar que la vinculación de las granjas es

10

Junio • 2011 •

Al evaluar el número de sitios de las granjas se encontró que para el 2010 el 56 por ciento de los establecimientos porcícolas son manejados en un sólo sitio, el 24 por ciento en dos sitios (cría, precebo y levante-engorde) y el 20 por ciento manejan tres sitios (cría, precebo y levante-engorde) (ver gráfica 2). Esto demuestra que la generalidad es impulsar dentro de las granjas un proceso evolutivo, en donde, de acuerdo con la capacidad


económica, han surgido algunas granjas de dos a tres sitios, pero se mantiene el sistema de producción de un sitio que generalmente es de ciclo completo. Este dato afecta directamente el estatus sanitario, ya que el control de las enfermedades se dificulta en las granjas de un sólo sitio, debido a la permanente presencia de los agentes, sin que exista una brecha física de separación que permita la ruptura de los ciclos de enfermedad. Por el contrario, en las granjas de tres sitios los procesos de tratamiento y manejo de los animales son más focalizados y el rango de transmisión es menor, debido a que las etapas de producción se encuentran separadas, permitiendo el aislamiento de animales o grupos problema. Gráfica 2. Distribución porcentual del número de sitios de producción de las granjas en el programa según el año.

Las granjas del PNMES son evaluadas a partir del cumplimiento de las medidas de bioseguridad, de las recomendaciones hechas durante las visitas de seguimiento y de la realización de los monitoreos serológicos considerados dentro del PNMES, lo que permite, según avances obtenidos en cada uno de estos puntos, se logren categorizar de acuerdo con lo estipulado dentro del programa. Para el análisis de los datos obtenidos en este informe se tuvieron en cuenta los siete puntos esenciales en bioseguridad que toda granja debe cumplir para evitar el ingreso de agentes indeseables y preservar su estatus sanitario. 1. Presencia de cerco perimetral que rodee toda la zona de producción y que cuente con un único punto de acceso y zona de embarque y parqueadero externo. 2. Sistema de desinfección de vehículos para su ingreso a granja; vehículo independiente para el transporte de los animales a planta de beneficio y transporte de alimento concentrado. 3. Presencia de filtro sanitario ubicado sobre el perímetro y debidamente constituido (zona limpia y sucia). 4. Capacitación periódica de operarios y asistencia técnica profesional. 5. Zona de cuarentena y medidas de manejo sanitario. 6. Control de plagas (roedores, moscas y aves).

La evaluación de bioseguridad realizada a las granjas del PNMES se sustenta en un instructivo documentado, destacando los principales puntos de bioseguridad externa e interna necesarios en toda producción porcina y que permitan optimizar los resultados productivos en ellas, convirtiendo así, esta valoración, en un método objetivo de evaluación. Entre los años 2009 y 2010 se observó un incremento altamente significativo en el promedio de los puntos totales obtenidos para bioseguridad (p=0.003), donde se incluyen puntos obtenidos para bioseguridad externa (p=0.009) e interna (p=0.0001).

7. Manejo de la mortalidad.

Se debe tener en cuenta que esta evaluación de bioseguridad contempla como puntajes óptimos de resultados 145 puntos en bioseguridad externa y 35 puntos en bioseguridad interna. Se destaca dentro de este resumen el incremento en la implementación de medidas de bioseguridad interna y externa entre los años 2009 y 2010 (ver gráfica 3). Gráfica3. Avances en la implementación de los puntos de bioseguridad entre los años 2009 – 2010.

Cerco perimetral de la granja

Es necesario tener en cuenta que el cerco perimetral se define como una barrera contundente que rodea la totalidad de la zona de producción separando las zonas sucias (zonas de manejo de porcinaza, mortalidad, parqueadero, cuarentena) y evitando el ingreso de personas, animales u objetos no autorizados, sobre el cual se encuentra el filtro sanitario, la oficina, embarcadero y bodega de alimentos y que cuenta con un único punto de ingreso y egreso a la zona de producción. Por otra parte, se contrastan diferentes puntos para la mitigación de los factores de riesgo que representan los vehículos, contemplando la presencia de una zona de parqueo y embarque externa, evitando el contacto de vehículos con los alojamientos de los animales, el uso de vehículos independientes para el transporte de • Porcicultura Colombiana •

11


concentrado y animales a frigorífico y la presencia de un sistema de desinfección con óptimo funcionamiento sea arco de desinfección o bomba de espalda. Gráfica 4. Gráfica comparativa entre los puntos de bioseguridad referentes a cerco perimetral y vehículos en granjas del PNMES 2009-2010.

En la gráfica 4 se observa un contraste entre puntos de bioseguridad referentes a cerco perimetral y vehículos, en donde la implementación de un sistema de desinfección vehicular ha sido una de las medidas más implementadas, posiblemente debido a la ubicación de las granjas con respecto a otras granjas porcícolas y explotaciones pecuarias, y a la conciencia de los productores en reconocer los vehículos como un riesgo en la introducción de patógenos a sus granjas. Este dato contrasta con la disposición de otros porcicultores para tener vehículos independientes en el transporte de animales a frigorífico y de alimento concentrado, así como a la baja implementación de cerco perimetral, zona de embarque y parqueo adecuadas que limiten el ingreso a la zona de producción.

En cuanto al filtro sanitario se evaluó la medida verificando la disposición de ésta sobre el cerco perimetral, contando con los elementos de higiene adecuados y las zonas limpias y sucias y el cumplimiento del flujo de personal al interior de dicha zona. Gráfico 5. Implementación de Filtro sanitario, ubicación y distribución (zonas sucia y limpia) en granjas del PNMES 2009-2010.

Al analizar la gráfica 5 es posible detectar que la implementación de la medida de filtro sanitario se ha incrementado en las granjas. Sin embargo, existe una gran proporción en donde no existe o no cumple con las características necesarias para su óptimo funcionamiento. Esta medida resulta de gran impacto en la protección de los establecimientos debido a que manos, dotación y botas resultan ser uno de principales mecanismos de transmisión de agentes indeseables como el PRRSv, por lo que la realización de la ducha al inicio de la jornada laboral permite minimizar este factor de riesgo (Pitkin, Otake y Dee). De allí la importancia que la medida sea implementada de forma adecuada respetándose la zona sucia y limpia, y el flujo al interior del filtro, junto con el cambio de dotación. Gráfica 6. Avances en la implementación de la asistencia técnica y capacitación en granjas del PNMES 2009-2010.

Ingreso pricipal a la granja

En cuanto a la implementación de la asistencia técnica por parte de un profesional se encontró que las granjas han acrecentado esta medida, la cual como es de esperar, va de la mano con el incremento en la realización de capacitación para los operarios. Esto demuestra la importancia que tiene el papel del técnico de granja, puesto que su buen desempeño promueve el avance en la implementación de las medidas de bioseguridad y manejo que influenciarán positivamente en la productividad de la granja.

Bodega perimetral de la granja

12

Junio • 2011 •

Es importante tener en cuenta que un operario capacitado es consciente de la importancia que tiene el cumplimiento de las medidas de bioseguridad y de esta manera lo puede exigir a sus compañeros y visitantes. También cabe resaltar la importancia de la documentación de todos los procesos de la granja, tarea exclu-


siva del técnico, que permite el seguimiento y un mayor grado de exigencia de los procesos de la granja. La cuarentena es un factor crucial en todo programa de bioseguridad, el cual pretende evitar el ingreso de nuevos patógenos al establecimiento, así como aclimatar a los nuevos animales para su adecuado ingreso, evitando futuros problemas sanitarios, pérdidas y preservando el equilibrio sanitario del establecimiento. Por lo tanto, requiere que sea vista y cuente con áreas propias de cualquier granja porcícola como embarcadero, bodega de alimento y medicamentos, cerco perimetral, etc. Gráfica 7. Implementación de la cuarentena y de las respectivas medidas de bioseguridad requeridas para esta zona en granjas del PNMES 2009 -2010.

En las granjas del PNMES se detectó que el uso exclusivo de per-

sonal para esta zona ha aumentado, aunque no en la medida deseada; la carencia de esta medida se convierte en un factor de riesgo que se acrecienta debido a que la medida de monitoreo de animales, ubicación de la zona y tiempo de duración no se realiza de forma adecuada en alrededor del 50 por ciento de las granjas. Es importante tener en cuenta que el monitoreo tiene como objeto no sólo evaluar e impedir el ingreso de agentes inFiltro sanitario para el ingreso a la granja deseables a la granja, sino verificar que el estatus inmunitario del animal sea el óptimo para el ingreso al establecimiento y que el protocolo sanitario, que se realiza a estos animales, es el adecuado. La duración de esta etapa debe ser de por lo menos 60 días, tiempo que se requiere para el diagnóstico de las enfermedades, esto debido a la diferencia existente entre la dinámica de las distintas enfermedades que afectan al cerdo. Las medidas de control adoptadas en las granjas para evitar la proliferación de plagas han sido apoyadas en gran medida por la industria privada a través de programas basados en el control químico. Estos programas deben contar con un proceso de reconocimiento de la plaga para la implementación de medidas de tipo cultural, físico y químico, según se requieran.


con un sistema de disposición final sea compostera o fosa de mortalidad que cumple con las condiciones óptimas para su funcionamiento. Es de aclarar que en la actualidad las granjas se encuentran trabajando en la implementación de la compostera, como sistema óptimo de disposición de cadáveres de acuerdo con la normatividad vigente.

Gráfica 8. Medidas de control de plagas en las granjas vinculadas al PNMES 2009 – 2010.

Para la eliminación de residuos peligrosos, sólidos e inorgánicos se encontró que los productores implementaron en sus granjas las medidas para el manejo de los residuos peligrosos y la clasificación de los diferentes residuos generados en granja, sin embargo, esta implementación no ha sido instaurada en más del 70 por ciento de las granjas lo que puede deberse a la dificultad que tienen los productores en contactar empresas que realicen la respectiva recolección del material y a la falta de capacitación en su personal.

Conclusiones

1 2 Los programas de control de moscas y roedores son implementados en casi el 80 por ciento de los establecimientos, demostrando el impacto que éstas generan en las granjas y la influencia de las empresas que producen sustancias que permiten el control de estas plagas. Es necesario que los porcicultores adopten medidas de control físico y cultural que hagan más efectivo el control químico y reduzcan su uso, debido a la resistencia que las plagas generan ante estos productos. En cuanto al control de aves, se observa que es una de las plagas que es controlada en menor proporción a diferencia que moscas y roedores, posiblemente debido al desconocimiento del impacto de esta plaga como vector de enfermedades como la salmonelosis y coccidiosis, así como en el costo de producción que genera por el consumo de alimento concentrado y daño estructural. La presencia de animales domésticos como perros y gatos se da en aproximadamente el 50 por ciento de las granjas posiblemente al servicio de vigilancia y control de plagas que estos ofrecen. Sin embargo, en menos del 40 por ciento de las granjas estos animales se encuentran libres al interior de la zona de producción. Es importante tener en cuenta que estos animales son transmisores de una gran variedad de enfermedades al cerdo por lo cual su presencia al interior de la zona de producción es indeseable. En el caso de requerirse su presencia es recomendable que se evite su circulación libre, no tengan contacto con los porcinos y que cuenten con un programa sanitario estricto. En cuanto a la disposición de la mortalidad tenemos que el 80 por ciento de las granjas que hacen parte del PNMES cuentan

14 Junio • 2011 •

3 4 5 6

Por medio de los programas desarrollados por Asoporcicultores – FNP y como es visto en este documento, a través del PNMES los productores han logrado establecer algunas de las medidas de bioseguridad básicas, buscando proteger sus granjas, mantener y mejorar su estatus sanitario. La presencia del profesional de campo permite la instauración, desarrollo y cumplimiento de las medidas de bioseguridad, proporcionando una continúa retroalimentación de los procesos con el fin de facilitar la toma de decisiones. Pese al impacto económico que genera la implementación de las medidas de bioseguridad y a que éstas se dan de acuerdo a la disposición económica del productor, es importante que este trabajo sea visto como una inversión en la protección de establecimiento que evitará perdidas por el ingreso de agentes indeseables a la producción, los cuales podrían generar mayores gastos a largo plazo. El monitoreo serológico es una herramienta útil para la toma de decisiones en granja, toda vez que las medidas que se adopten en bioseguridad redundan en mejorar el estatus sanitario del establecimiento. Es necesario que los porcicultores y técnicos sean mucho más rigurosos en la implementación y cumplimiento de las medidas de bioseguridad, ya que es común ver infraestructura que cumple con la medida pero fallas de operarios y técnicos en el momento de asumir la medida. Pese a que la implementación de las diferentes medidas de bioseguridad significan un esfuerzo económico para el productor, éstas deben ser vistas como una inversión que retornará a medida de que la producción genere animales con buenas ganancias de peso, en un menor rango de días y con una buena conversión, sin la necesidad de invertir en medicaciones innecesarias.


Caracterización Genética

de Circovirus Porcino tipo 2 (PCV2) en cerdos en Colombia Rincón, M.A1,2, Mogollón J. D.1 Vera A. V.1 Jaime C.J.1. Ramirez-Nieto G.C., Universidad Nacional de Colombia, Bogotá, Colombia; 2. Instituto Colombiano Agropecuario, Bogotá.

Introducción Los circovirus porcinos (PCV), pertenecen a la familia Circoviridae; están constituidos por una banda circular de DNA desnudo. Se encuentran dos tipos antigénica y genéticamente distintos, PCV1 y PCV2. Mientras que el PCV1 es considerado no patógeno, el PCV2 se asocia con el síndrome de emaciación post-destete (PMWS) (1). En Colombia, la infección con PCV2 asociada al PMWS clínico se reportó por primera vez en el 2006 (2), pero hasta el momento no hay aislamientos virales o estudios que demuestren la circulación del PCV2 en el campo. El principal objetivo de este estudio fue caracterizar el PCV2 presente en las explotaciones porcícolas en Colombia.

Materiales y métodos Con el fin de alcanzar el objetivo propuesto se tomaron muestras de tejidos (ganglios linfáticos, pulmón, bazo y riñón) de animales que mostraban signos clínicos compatibles con PMWS. Se evaluaron 13 granjas con antecedentes históricos de PMWS durante 2006 – 2009. El diagnóstico de PMWS se confirmó para cada caso (3). Se incluyeron muestras de suero de 50 animales sanos colectadas entre enero y diciembre de 2009. Se realizó extracción de DNA usando el Mini kit (Qiagen, USA). Se llevó a cabo amplificación y secuenciación (Macrogen, USA) del gen de la capside de los nucleótidos 825 a 1760 usando primers específicos Fw5´ CCGTTGGAATGGTACTCCTC 3´ y Rw 5´ACAGCGCACTTCTTTCGTTT3´.

Discusión De acuerdo con los resultados de secuenciación, basados en la proteína de capside codificada por el gen ORF2; en Colombia están presentes dos genotipos del PCV2 en los cerdos, mostrando diferencias clinicas y temporales en su presentación. Es importante anotar que el PCV2 está circulando en cerdos Colombianos desde 2002 y hay una dinámica en la presencia de los genotipos lo cual es demostrado por el análisis de 14 muestras de 20062009 corresondientes a PCV2b y cuatro a PCV2a. De acuerdo con estudios previos (4), el PCV2b se asociaba con una mayor prevalencia de brotes de PMWS en porcinos Colombianos que el PCV2a y la detección del genotipo PCV2b a partir de 2006 podría explicar la ocurrencia epizoótica de PMWS en granjas de varios departamentos en Colombia Figure 1. Relación filogenética de 19 muestras Colombianas basada en la secuencia del ORF2.

Se generaron cromatogramas de secuencias específicas para las cepas usando BioEdit 7.0.5. Las secuencias completas del ORF2 se alinearon en ClustalW y se generaron los árboles filogenéticos en MEGA4.

Resultados Se detectó DNA de PCV2 en 19 muestras de diferente origen. El análisis de sequencias mostró homología del 92%-100% entre los virus PCV2 colombianos. Las secuencias resultantes se pueden dividir en dos grupos principales respaldado por los altos valores de confianza que agrupan a los dos genotipos definidos previamente; PCV2b (n=14) y PCV2a (n=5). Es interesante observar que se encontraron secuencias correspondientes a PCV2a y PCV2b tanto en animales sanos como enfermos. Las secuencias estan relacionadas con virus Canadienses, Europeos y Asiáticos.

Agradecimientos Este proyecto fue financiado por el MADR; Asociación Colombiana de Porcicultores - Fondo Nacional de la Porcicultura, Universidad Nacional de Colombia, Bogotá. Referencias 1. Todd, D. (2002) Avian Pathol 29, 373 - 394 2. Clavijo J. et al. (2008) Proceedings of the 20th IPVS Congress, Durban, South Africa, p 550. 3. Segales J. et al (2005) Anim Health Res. Rev 6, 119 -142) 4. Horlen KP et al.(2007) J. Swine Health Prod.15,270–278.


Primer aislamiento de campo

de virus de influenza porcina H1N1 y caracterización fenotípica en Colombia Díaz, R. C., Vera, A. V., Mogollón, G. J., Jaime, C. J., Ramírez-Nieto, G. C., Corredor, F. A. Facultad de Medicina Veterinaria y de Zootecnia, Universidad Nacional de Colombia, Bogotá.

Resultados

Introducción

Para las muestras evaluadas, la reactividad serológica por prueba de HI fue del 69,01 por ciento para el subtipo H3N2 y del 49,29 por ciento para el subtipo H1N1 del virus de influenza virus. Los resultados de este estudio confirman la actividad del virus de influenza porcina (SIV) en el campo, lo cual era de esperar considerando la evidencia clínica y el impacto de las enfermedades respiratorias en la industria porcina.

Las enfermedades respiratorias son una de las principales causas de pérdidas económicas en la industria porcícola en Colombia. A pesar de la evidencia serológica sugiriendo actividad del virus de influenza desde 1970, no hay información disponible en relación al papel de este virus en el complejo respiratorio o aislamientos de cepas de campo del virus en Colombia. No obstante, resultados de estudios serológicos en las tres principales regiones productoras de cerdo mostraron, en 2003, una prevalencia del diez por ciento para el subtipo H3N2 y del 0.4 por ciento para el subtipo H1N1 (1). En este estudio el principal objetivo es determinar la reactividad serológica al virus de influenza porcina y caracterizar las cepas que se encuentran circulando en el campo.

Materiales y métodos

Con el fin de lograr este objetivo, se tomó una muestra estadísticamente representativa de 78 explotaciones provenientes de las tres mayores áreas productoras de cerdos. Se emplearon 43 animales por granja, cuyo rango de edad cubrió animales en las diferentes etapas de producción. En total se evaluaron 3.354 muestras de suero, por la prueba de ELISA indirecta empleando un kit comercial (IDEXX) (3) y la prueba de HI usando como cepas de referencia la A/ SW/Iowa/1930/H1N1 y la A/SW/Texas/4199/98/H3N2 (2). Se llevó a cabo intento de aislamiento a partir de un total 275 muestras distribuidas de la siguiente manera: 242 hisopos nasales, 25 muestras de pulmón y ocho de aspirados bronquiales provenientes de animales con signos respiratorios. El período de muestreo comprendió los años 2008 – 2010. Las muestras se tomaron en medio BHI estéril, suplementado con dos por ciento de antibióticos y se inocularon en huevos de embrión de pollo de diez-11 días de edad y en células MDCK suplementadas con tripsina. Las muestras positivas por prueba de HA fueron evaluadas por RT-PCR empleando primer específicos para los genes M, HA, NA y NS. Se determinó la TCID50 en células MDCK y se caracterizaron fenotípicamente los aislamientos por prueba de plaqueo (6). Se llevó a cabo secuenciación de los genes HA y NA y se realizó análisis filogenético por el procedimiento Neighbor-Join (5).

Se aislaron 15 cepas de virus de influenza porcina, provenientes de nueve granjas distribuidas en las tres regiones evaluadas. En cuanto a la temporalidad, 11 aislamientos correspondieron al 2009 (Antioquia n= 6; Occidente n= 5) y cuatro aislamientos al 2010, proviniendo de la región central. Tabla 1. Resultados serológicos por HI de Influenza Porcina en Colombia entre 2008-2010.

Área

H3N2

H1N1

n

%

n

%

Central

4/10

40,0

4/10

40,0

Occidental

19/28

67,9

15/28

53,6

Antioquia

26/33

78,8

16/33

48,5

Overall

49/71

69,0

35/71

49,3

El análisis de las secuencias del gen de la HA mostró que 12 de los 15 aislamientos corresponden al virus H1N1 de influenza pandémica de origen porcino y tres cepas al virus de influenza porcina clásica H1N1. La morfología de las placas mostró diferencias entre los aislamientos. El virus de influenza porcina H1N1 clásico produjo placas de dos tamaños mientras que el virus H1N1 de tipo pandémico produjo placas uniformes de tamaño mediano.

Discusión El aislamiento de virus de campo de influenza porcina del tipo H1N1 es de gran importancia no sólo por su relevancia para la industria porcina en Colombia, sino por la importancia epidemiológica y el posible efecto desde el punto de vista de la salud pública. Agradecimientos Este proyecto es financiado por el Ministerio de Agricultura y Desarrollo Rural de Colombia, la Asociación Colombiana de Porcicultores, Fondo Nacional de la Porcicultura y la Universidad Nacional de Colombia. Referencias 1. Pardo S. (2001). Universidad javeriana. Bogotá, Colombia 2. OIE. (2005) www.oie.int/eng/normes/mmanual/A_summry.htm 3. www.idexx.com 4. Huprikar J. Rabinowitz S. (1980). J. Virol. Methods. 1(2):117-20 5. Masatoshi N. (2000) Molecular evolution and phylogenetics. • Porcicultura Colombiana •

17


Incorporación de ingredientes funcionales en el alimento para cerdos:

nucleótidos orgánicos

E

l uso de antibióticos como aditivo promotor del crecimiento ha creado serios problemas de resistencia microbiana y de efectos residuales (Aarestrup et al., 1998; Witte, 1998), por lo que de forma alternativa se buscan sustancias reguladoras del metabolismo intestinal que de modo general controlen la microbiota gastrointestinal, contribuyendo a la salud y mejoramiento del comportamiento productivo. Una de estas alternativas es la incorporación de nucleótidos como suplemento, ya que hay tejidos como la mucosa intestinal y el sistema inmune que dependen en gran medida de los nucleótidos de la dieta, dado que son tejidos que presentan altas tasas de replicación celular y en cambio una baja capacidad de síntesis endógena (Van Buren y Rudolph, 1997).

proliferación celular y de la actividad metabólica, los nucleótidos dietarios exógenos pueden modificar la composición de la microflora intestinal, de forma que pueden mejorar el crecimiento de las bifidobacterias y de los lactobacilos, mientras que, además, pueden inhibir la proliferación de las enterobacterias Gram negativo y pueden ser muy buenos nutrientes para reparar el intestino después de un proceso diarreico (Herrera, 1991), o prevenirlo.

Por este motivo, el uso nucleótidos orgánicos en dietas de cerdos recién destetados, genera un efecto promotor del crecimiento y promotor de la salud, tal y como se ha demostrado en niños lactantes (Pickering et al., 1998; Yu, 1998). Los nucleótidos tienen un efecto positivo sobre el sistema inmunitario, el crecimiento y desarrollo del intestino delgado, el metabolismo lipídico y las funciones hepáticas (Martínez et al., 2007).

Para corroborar lo anterior, varios han sido los resultados de investigación publicados con el uso de proteínas funcionales en dietas para lechones o indirectamente en la dieta de cerdas lactantes, en este último caso, Quilat et al. (2007) estudiaron el efecto de los nucleótidos sobre el desempeño de la cerda lactante y de la camada bajo condiciones comerciales, reportando que hubo un notable aumento en el consumo de alimento de las cerdas que recibieron nucleótidos, el numero de lechones destetados por cerda tuvo una tendencia a ser mayor, así como también, el peso del lechón al destete y la ganancia diaria de peso mejoraron significativamente, lo que se traduce en mayor palatabilidad del alimento de la cerda y el concomitante beneficio en los cerdos al destete.

Así entonces, los nucleótidos juegan un papel importante en el metabolismo, ya que se incorpora a importantes cofactores de reacciones enzimáticas, por tanto, funcionan como energía química, y sus principales funciones se destacan: Fortalece la inmunidad, y favorece la circulación sanguínea. Promueve el crecimiento de nuevas células (regeneración). Mejora la capacidad del cuerpo para controlar infecciones y enfermedad. En el mercado de ingredientes disponibles, existen proteínas funcionales para lechones constituidas por importantes nutrientes esenciales y funcionales que son importantes en la dieta de un animal joven, tales como: nucleótidos, Ac. glutámico, inositol, AA´s y péptidos. Dado que el intestino delgado tiene una limitada capacidad para la síntesis de los ácidos nucleícos debido a la gran rapidez de la

18

Autor: Ing. Agr. MSc. Humberto Araque. Gerente Técnico Alltech

Junio • 2011 •

Asimismo, el efecto positivo del ácido glutámico (glutamina), conocido por su palatabilidad y el inositol, cuya disponibilidad dentro de un ingrediente es de importancia en dietas altas en grasa, cuando se presentan disturbios en la flora intestinal y bajo condiciones de estrés (Sahagún, 2009).

Spring (2001) evaluó el empleo de estas proteínas sobre el funcionamiento y la salud de cerdos destetados, los cuales tenían diarrea causada por E. coli. Los animales fueron alimentados una dieta de control y una dieta en la cual las proteínas funcionales sustituyeron la proteína del 4 % de patatas. Los cerdos alimentados con este tipo de proteínas mostraron mayor ganancia diaria de peso y mayor consumo de alimento, dado a que la incidencia de diarreas fue inferior en el grupo al cual fue suministrado, gracias a la acción positiva que ofrece los nucleótidos sobre el tracto digestivo. Asimismo, estudio realizado por Groenewegen et al. (2007), evaluaron el impacto de los nucleótidos en una dieta preiniciadora en


lechones, donde resultó que los nucleótidos redujeron la mortalidad de los lechones, bajaron el costo de criar un lechón de los 6 a los 25 Kg., y que dichos nucleótidos son nutrientes funcionales costo-efectivo para dietas preiniciadoras de lechones. En ensayos de comportamiento productivo cabe mencionar, el realizado por Carson et al. (2005) alimentando lechones desde el destete (19 días de edad) hasta los 28 días postdestete (47 días edad), con niveles de 5% de proteínas funcionales los primeros 14 días y 2,5% de proteínas funcionales los últimos 14 días en sustitución de plasma sanguíneo deshidratado, y su posterior efecto sobre el crecimiento de los cerdos al final de la fase de engorde, cuyos resultados indican que al final del engorde los cerdos alimentados con proteínas funcionales en el postdestete fueron más pesados a la misma edad (130 días), 106,3 kg versus 96,2 kg de animales alimentados con plasma, por lo que permanece un efecto positivo en los cerdos, lo que corrobora el efecto de tener cerdos más pesados y uniformes en el postdestete, garantiza mejor peso de cosecha en matadero, siendo que el uso de proteínas funcionales mejoró la velocidad de crecimiento y coherentemente el peso vivo a los 47 días de edad. De igual forma, Sánchez y Badaños (2007) llevaron a cabo un experimento para evaluar el desempeño de lechones alimentados con dietas que contenían nucleótidos. Al analizar los resultados, concluyeron que la inclusión de nucleótidos en la dieta dio un peso corporal significativamente superior a los 63 (22,11 kg vs. 22,78kg) y 126 (73,40 kg vs. 75,10 kg) días de edad, el consumo de alimento no se vio afectado por los tratamientos, redujeron la mortalidad (1,92 % vs. 0,44%) y mejoró la conversión del alimento con mejores pesos que el grupo testigo. Los animales alimentados con nucleótidos tuvieron un mayor peso en pie (+ 0,67 kg) a los 63 días de edad, en comparación con los controles y a los 126 días de edad. Esta diferencia fue + 1,70 kg. Asimismo, López et al., 2009, (datos sin publicar) evaluaron el efecto de proteínas funcionales y la respuesta productiva en lechones postdestete (12-25 kg, durante 3 semanas), comparándolo con una fuente común de proteína (plasma sanguíneo), bien sea sólo o la mezcla de ambos en una incorporación del 4% en la dieta, donde se refleja que el uso de proteínas funcionales generó mejor consumo de alimento (alimento palatable) (13% superior). Figura 1. Consumo medio de alimento (kg/animal periodo) según tipo de tratamiento: T1: sólo plasma porcino, T2: sólo proteína funcional y T3: 50% de plasma porcino y 50% de proteína funcional.

El uso de los nucleótidos en una dieta preiniciadora en lechones, dio como resultado la reducción en la mortalidad de los lechones. Figura 2. Peso inicial y peso final (kg) según tipo de tratamiento: T1: sólo plasma porcino, T2: sólo proteína funcional y T3: 50% de plasma porcino y 50% de proteína funcional.

Figura 3.Ganancia total de peso (kg) según tipo de tratamiento: T1: sólo plasma porcino, T2: sólo proteína funcional y T3: 50% de plasma porcino y 50% de proteína funcional.

No obstante, el uso de nucleótidos también es necesario en otras especies, tales como, aves (en dietas preiniciador para pollos de engorde y en gallinas ponedoras) y, en peces (con incipiente y creciente investigación), lo que es soportado por diversas investigaciones (Rutz, 2004; Nunes et al., 2008; Burrells et al., 2001). En este sentido, la genética aviar ha logrado el crecimiento del ave muy rápido, las cuales pueden llegar a ser potenciadas con el uso de dietas de primera edad que sean posibles de proteger y desarrollar el inmaduro tracto digestivo, donde el uso de ingredientes funcionales con nucleótidos orgánicos, además de favorecer el máximo potencial genético para crecimiento, ofrecen ventaja en situaciones de estrés para preservar la salud (Rutz, 2004), ventaja que en países tropicales sería, además, una estrategia interesante para mitigar el efecto de alta temperatura ambiente.

Conclusión

A ese mayor consumo de alimento, con genética moderna, lo cerdos obtuvieron mayor ganancia de peso (13,6% superior), y mejora en la uniformidad del lote (mejor dispersión), con cerdos que crecieron uniformemente.

20 Junio • 2011 •

Con el uso de nucleótidos orgánicos contenidos en proteínas funcionales en dietas para cerdos y pollos de engorde, se logra mejor desempeño productivo en las edades más tempranas e importantes para el posterior crecimiento y desarrollo muscular, dado por un mayor consumo de alimento, mejor nivel de inmunidad y menos problemas intestinales, lo que genera mejor comportamiento productivo en ganancia de peso, y lleva al máximo el potencial de crecimiento de la genética moderna con mejor uniformidad en los lotes.


Bibliografía consultada

Aarestrup, F.; Bager, F.; Jensen, N.; Madsen, M.; Meyling, A. y Wegener, H. 1998. Resistance to antimicrobial agents used for animal therapy in pathogenic, zoonotic and indicator bacteria isolated from different food animals in Denmark: a baseline study for the Danish Integrated Antimicrobial Resistance Monitoring Programme (DANMAP). APMIS. 106(8): 745–770.

Pickering, L. Granoff, D. Erickson, J. Masor, M. Cordle, C. Schaller, J. Winship, T. Paule, C. y Hilty, M. 1998. Modulation of the immune system by human milk and infant formula containing nucleotides. Pediatrics. 101(2):242-9.

Carlson, M.S., T.L. Veum and J.R. Turk. 2005. Effects of yeast extract versus animal plasma in weanling pig diets on growth performance and intestinal morphology. J. Swine Health Prod. 13(4):205-209.

Quilat, B., Garcia. D., Souza, D. y Frio, A. 2007. Efecto de nucleótidos sobre el desempeño de la cerda y de la camada bajo condiciones comerciales, Alltech Biotech Corp. Australia. En 23rd Simposio Internacional de la Ciencia y Tecnología en la Industria de Alimentos, Alltech. Lexington – USA.

Burrells, C.; Williams, P.; Southgate, P. and Wadsworth. 2001. Dietary nucleotides: a novel supplement in fish feeds: 2. Effects on vaccination, salt water transfer, growth rates and physiology of atlantic salmon (Salmon salar, L.). Aquaculture 199, pp. 171-184.

Rutz, F. ; Anciuti, M. A. ; Rech, J. L. 2004. Performance and carcass traits of broilers fed diets containing yeast extract (Nupro®). In : RONDA LATINO AMERICANA DA ALLTECH, 20, 2004, Lexington, Abstracts... Lexington: Alltech Inc. Nicholasville, 2004. v.1. 52 p.

Groenewegen, P., Skinner, S. y Pierce A. 2007. Impacto de nucleótidos en plasma sanguíneo sobre el desempeño de la dieta pre iniciadora en cerdos. North american Biosciences center, Alltech, inc., Nicholasville, KY, Usa. En 23rd Simposio Internacional de la Ciencia y Tecnología en la Industria de Alimentos, Alltech. Lexington – USA.

Sánchez, O. y Bañados, A. 2007. Desempeño de lechones alimentados con dietas que contienen nucleótidos. Universidad Nacional Agraria de Molina, Lima, Perú. Alltech Perú. En 23rd Simposio Internacional de la Ciencia y Tecnología en la Industria de Alimentos, Alltech. Lexington – USA .

Herrera, E. 1991 Bioquímica. Aspectos estructurales y vías metabólicas. (Vols. I y II) (2°edición). Interamericana McGraw Hill. Madrid. 1614 pág.

Spring, P. 2001. Effect of NuPro 2000 on commercial pig performance in Switzerland. Report to Alltech. Zurich, Switzerland.

Martínez, D. Manzanilla, E. Morales, J. Borda, E. Perez, J. Piñeiro, C. y Chetrit, C. (2007) Dietary nucleotide supplementation reduces occurrence of diarrhoea in early weaned pigs. Liv. Sci. 108: 276-279. Nunes, J.; Maier, J.; Rossi, P.; Dallmann, P.; Anciuti, M.; Rutz, F.; Corrêa da Silva, R. 2008. Suplementação de extrato de levedura na dieta de poedeiras comerciais: desempenho produtivo. Ciência Animal Brasileira, v. 9, n. 2, p. 357-364.

Van Buren, C. Rudolph, F. 1997. Dietary nucleotides: a conditional requirement. Nutrition 13, 470–472. Witte W. 1998. El uso de antibióticos en la ganadería y el desarrollo de resistencia a las infecciones humanas. Apua Newsletter 16 (3): 1, 4-6. Yu Vy. 1998. The role of dietary nucleotides in neonatal and infant nutrition.Singapore Med j. 39(4):145-50.

• Porcicultura Colombiana •

21


Asoporcicultores L

actualiza experiencia en alimentos

as oportunidades que se presentaron mediante los nuevos Tratados de Libre Comercio dieron lugar a que la Asociación Colombiana de Porcicultores visitara el Northern Crops Institute (NCI, siglas en inglés) para actualizar su conocimiento en ingredientes alimenticios, formulación de raciones, equipos para fábricas de alimentos concentrados y diseño de plantas. Trece miembros de la Asociación Colombiana de Porcicultores asistieron al programa de cuatro días sobre fabricación de alimento, de mayo 31 a junio 3 en el Northern Crops Institute. Los participantes representaron algunas de las más grandes compañías fabricantes de alimentos y de manejo porcícola en Colombia. El seminario fue patrocinado por el Concejo de Utilización de Maíz de Dakota del Norte, el Concejo de Investigación y Promoción de Maíz de Minnesota y el Concejo de Granos de Estados Unidos (USGC, siglas en inglés). John Crabtree, director interino del NCI sostuvo que “los miembros de la Asociación Colombiana de Porcicultores querían un programa que educara a su gente para ir al ritmo de la industria de alimentos, con el fin de manejar las oportunidades que puedan surgir a raíz de los nuevos tratados comerciales. Aunque Estados Unidos y Colombia aún están negociando un Tratado de Libre Comercio, ya han ocurrido muchos cambios

en el mercado, lo que resulta en consolidaciones y aumento de la competencia”. Crabtree concluye que “el Concejo de Granos de E.U. ha promovido enérgicamente los DDGS en Colombia como ingrediente para los alimentos. Si Estados Unidos y Colombia firman el Tratado de Libre Comercio, esta será una gran oportunidad para mover los DDGS a Colombia.” Los DDGS son un coproducto de la producción de etanol. Entre los conferencistas se encontraba Kim Koch, Ph.D, administrador del centro de alimentos del NCI; Gerry Leukam, de T.E. Ibberson Co.; Roberto Cespedes, de Buhler, Inc.; Robert Thaler, Ph.D., Universidad Estatal de Dakota del Sur; Joe Hancock, Ph.D., Universidad Estatal de Kansas; David Newman, Ph.D., Universidad Estatal de Dakota del Norte; y Matt Frederking, de RalCo Nutrition. Los temas de las conferencias incluyeron diseño de plantas de alimentos, equipos, personal, procesos de fabricación de alimento, nutrición porcina, DDGS y sorgo en el alimento, calidad de la carne y seguridad alimenticia. El grupo participó en las demostraciones de fabricación de alimento en la fábrica de alimento del Northern Crops Institute. También realizaron un tour por las instalaciones de etanol de Tharaldson en Casselton, DN, conducido por Ryan Thorpe.

Jornada de Asistencia en Pasto y Don Matías Durante los días 2 y 16 de junio se desarrollaron las Jornadas de Actualización Técnica y Productividad de Empresa en las ciudades de Pasto (Nariño) y Don Matías (Antioquia), a las cuales asistieron 166 personas en total, entre técnicos, productores y profesionales del sector. En el desarrollo de estas jornadas se discutieron temas de relevancia para el sector como lo son; la importancia de los costos y sistemas de información en la producción porcina, beneficios económicos en la gestión ambiental e impacto económico de las enfermedades en la producción porcina, las cuales fueron realizadas por el equipo del Área Técnica de Asoporcicultores - FNP y el Doctor Nestor Daza.

Asoporcicultores

manifiesta apoyo y solidaridad La Asociación Colombiana de Porcicultores rechaza las acciones violentas que han afectado a Adiela Perlaza, y a la granja Bioagro EU. También, expresa su sentimiento de solidaridad y apoyo a la familia Perlaza por las diferentes circunstancia difíciles por las que han atravesado y destaca la valentía de esta mujer que ha sido víctima de grupos al margen de la ley.

22 Junio • 2011 •


Sector porcícola: afectados por la ola invernal

A

unque el sector porcícola fue uno de los menos afectados por la ola invernal, sufrió leve consecuencias en algunas zonas del país. En el departamento de Antioquia, se presentaron inundaciones, dificultades en las vías principales y secundarias, así como derrumbes de puentes y dificultades en las bocatomas de los acueductos verdales, causando en las granjas porcinas dificultad en: el ingreso de alimentos, la salida de cerdos gordos a las plantas de sacrifico y episodios gastrointestinales en lechones lactantes y precebo, debido al consumo de aguas sin tratamiento. En el oriente de Antioquia, en el municipio del Peñol una granja resultó afectada, allí murieron 35 cerdos de una población total de 60 animales, con pesos entre los 25 a los 45 kilos. Arauca, al igual que en otras zonas, las vías fueron el principal efecto que dejo la ola invernal. El Puente el Tigre se derrumbó, lo que no permitió el transporte de animales. Igualmente, el río Casanare aumentó su caudal, mientras que el río Arauca se desbordó afectando a tres predios: Los Graduales, en la vereda de Bocas del Joju, quien tuvo ahogamiento de cinco cerdos de levante. La granja Puerto Nuevo, en esa misma vereda, tuvo ahogamiento de dos animales de engorde y la granja La Cochera, de la vereda Campo Alegre, que tuvo ahogamiento de dos cerdos de levante y uno de engorde. Atlántico, en el centro, donde se encuentra más del 55 por ciento de la explotaciones porcícola, se evidenció problemas en las vías de comunicación como el caso de la vía Malambo – Pinza, Baranoa y Cibarco, entre otras. De la misma forma, el sur del departamento fue declarado en emergencia, debido al daño en el Canal del Dique.

El ingreso de alimentos, la salida de cerdos gordos a las plantas de sacrifico y episodios gastrointestinales en lechones lactantes y precebo, debido al consumo de aguas sin tratamiento, fueron algunos de los efectos de la ola invernal 2011.

Bolívar, los efectos negativos ocasionados por la ola invernal en el sector porcícola fueron relativamente pocos. En el Sur del departamento, se inundó aproximadamente en un 35 por ciento de su extensión, es importante aclarar que el tipo de explotaciones • Porcicultura Colombiana •

25


que se manejan en esta parte del departamento son artesanales, donde los cerdos quedan libres en la mañana para que coman o se rebusquen la comida, por lo cual es difícil cuantificar las pérdidas. Finalmente, el municipio de Córdoba, en Bolívar, que tiene influencia de la Ciénaga, se inundó en un 27 por ciento siendo afectada la gran parte de la población. Durante esta temporada invernal el departamento de Boyacá fue seriamente afectado, presentándose inundaciones en diferentes zonas, derrumbes y/o cierres de vías. La granja La Victoria fue la principal afectada. En el 2010 esta granja se inundó y murieron ahogados todos los animales, siendo repoblada a finales del año 2010 y comienzos de 2011. En el 2011 nuevamente se inundó, la profundidad del agua alcanzó los 2,80 metros, afectando las instalaciones porcícolas, así como el área de ganadería. En el departamento de Casanare, los municipios afectados fueron: Tauramena, Paz de Ariporo, Yopal, Hato Corozal, Trinidad – San Luis, Maní. Las vías se encontraron en mal estado afectando la comercialización de productos con Villavicencio, se presentaron lluvias constantes, el mercado de cerdos se afectó en la vereda Las Chapas y la costa del río Pauto, que se inundaron. En la mayoría de estos municipios hubo desbordamientos e inundaciones, sin mayores repercusiones para el sector, excepto en el Maní, donde hubo ahogamiento de 25 lechones de 15 días de edad, dos cerdas de cría, tres becerros y gallinas.

de Ubaté se vieron afectadas por las inundaciones. Una granja sufrió inundación en su bodega de almacenamiento de alimento balanceado, lo que ocasionó considerables pérdidas. No hay reporte de muerte de animales, sin embargo han aumentado los problemas de tipo respiratorio y las diarreas. En la zona de la Vega se presentaron problemas en la vía ocasionando pérdidas, debido al trasbordo de los animales y de alimento. Hay dos granjas que se han reportado ante la Alcaldía debido a perdidas de animales. En el Eje Cafetero, se reportaron oficialmente cuatro porcicultores afectados en el departamento de Caldas: La Granja Berlín, vereda San Juan, municipio de Neira, donde se notificó la pérdida de 18 animales adicionales a los reportados a finales de 2010. La Vereda La Felisa, municipio La Merced, reportó la muerte de dos animales. La vereda La Guayana, municipio Villamaría, informó la muerte de 15 animales y en la vereda Murillito, municipio Supía, reportó la muerte de 12 animales. En la zona sur del Huila, en el Municipio Timaná, se presentó un derrumbe y taponamiento total de la vía que conduce del casco urbano a las veredas Quinche, Montañita, Aguas claras, San Antonio y San Isidro; los productores y habitantes realizaron trasbordo para movilizar provisiones, alimentos y sacar sus productos.

En el Caquetá, municipio de Puerto Rico, se presentó una creciente del río Guayas donde se afectaron cuatro predios con muerte de 30 porcinos, es importante anotar que es una porcicultura de traspatio y los animales son alimentados exclusivamente con suero de leche.

En el departamento del Magdalena la existencia de cerdos disminuyó, debido a las inundaciones que se presentaron en la pasada ola invernal, a finales del 2010, los pocos cerdos que han quedado son de traspatio. Es importante resaltar que las pocas granjas tecnificadas se encuentran ubicadas en la Subregión Norte, en donde no se presentado problemáticas

También en el municipio de Florencia, hubo afectación de diez explotaciones de traspatio con una población de 50 cerdos. Asimismo, ocurrieron daños en el casco urbano de Florencia, en los barrios San Luis, la Floresta y El chamón, por desbordamiento quebrada La Perdíz. En esta zona fueron afectadas nuevas granjas con una población de 40 porcinos.

El invierno en el departamento del Meta ha ocasionado derrumbes en las vías que comunican el departamento con el interior del país y ha causado desbordamientos de caños y ríos en los municipios de Vista Hermosa, Cabuyaro, Granada, Puerto López, Puerto Gaitán, Puerto Rico y Puerto Lleras. En general no hubo porcicultores afectados.

En Cundinamarca, las granjas que están en la zona de Valle

En el Nariño, la situación climática ocasionada por el fenó-

26 Junio • 2011 •


meno de la niña, que afectó la región, provocó inundaciones, deslizamientos y daños en la infraestructura vial. No se reportaron pérdidas de animales o daños en la infraestructura de las granjas. Los principales problemas sanitarios que se evidenciaron en las granjas fueron enfermedades respiratorias, digestivas y parasitarias, debido a la contaminación medio ambiental. En Norte de Santander los daños y pérdidas en el sector porcícola que se reportaron a las UMATAS, Secretarías de Desarrollo Rural o Comunitario, Alcaldías, Vacunadores y programadores y medios de comunicación locales, se encuentran en la provincia de Cúcuta, Pamplina y Ocaña. En Puerto Santander, se reportó la muerte de aproximadamente 400 cabezas de ganado y 35 porcinos por arrastre y ahogamiento del río Pamplonita. Existen granjas afectadas tanto en infraestructura y muerte de animales. En Tibú se estiman pérdidas de 90 animales, debido a que son cerdos sueltos. En La Esperanza, se reportó pérdida de 30 porcinos por inundación de la quebrada La Raya y río San Pablo. En el departamento de Santander, se presentaron problemas de vías lo que aumentó los costos de fletes de concentrado y animales a sacrifico, generando que los porcicultores vendan sus animales a menos valor del que representan. Se reportaron dos predios afectados en el municipio de Rionegro. En este departamento, las enfermedades respiratorias son el principal problema patológico que se ha presentado, también se reportaron problemas en las pezuñas por la humedad, lo que afectó el consumo de alimento de los animales por la dificultad en el desplazamiento, ocasionando el debilitamiento y la baja en la producción. Por último, en el bajo Putumayo se presentó la pérdida de 100 metros de banca en carretera primaria que conduce del municipio de La Hormiga hacia Puerto Asís, para el transporte de alimentos balanceados y semovientes se debe desplazar hasta municipio de Orito, con el fin de comunicarse con el resto del departamento y la nación.


Financieros trabajando para el desarrollo de la industria

porcícola colombiana

D

esde su lanzamiento el Centro de Servicios Técnicos y Financieros ha venido trabajando en el desarrollo de programas orientados al mejoramiento productivo y la eficiencia económica de los productores de la carne de cerdo.

Para Alfonso Calderón, porcicultor de Cundinamarca, el Centro de Servicios Técnicos, ha sido de gran apoyo debido “a los beneficios técnicos, así como a la asesoría financiera”. Por su parte, José Gentil Polanía, porcicultor del Huila, considera que la agilidad en los servicios y el apoyo técnico en temas como bioseguridad, es respaldo fundamental que ha encontrado en el Centro de Servicios. Además de ser una oportunidad de progreso para los pequeños productores. Hace cuatro años se empezó a gestar la idea de que la Asociación Colombiana de Porcicultores, con recursos del Fondo Nacional de la Porcicultura, contara con una plataforma que sirviera a los porcicultores del país mediante la prestación de asesorías que integraran todos los eslabones de la cadena porcícola, desde los de carácter técnico y comercial hasta aquellos de índole organizacional, teniendo como objetivo la modernización de los sistemas productivos y la eficiencia económica. Como parte de esta dinámica se definieron los siguientes servicios específicos para cada área, así: • Asesoría Administrativa y Organizacional • Asesoría Técnica en Granja • Asesoría Ambiental • Asesoría en Nutrición Animal y Compra de Materias Primas • Asesoría en Calidad • Asesoría en Comercialización • Asesoría Financiera y Crediticia De aquella idea concebida por iniciativa de los productores, se estructuró el Centro de Servicios Técnicos y Financieros, con el apoyo de la Junta Directiva de la Asociación Colombiana de Porcicultores y del Fondo Nacional de la Porcicultura, quienes imprimieron el aliento necesario para sacar adelante esta idea y fortalecer su propósito. Hoy cuatro años después de su lanzamiento, tenemos un Centro de Servicios totalmente consolidado que presta asesorías en todo el Territorio Nacional, soportado en profesionales comprometidos y competentes, con altos estándares éticos y actitud de servicio, demostrando su elevado compromiso con la satisfacción de los usuarios.

Un breve resumen de nuestra gestión • Desde el seno del Centro de Servicios, se estructuró el proyecto para la prestación del servicio de asistencia técnica dentro del marco del programa AIS, en su componente del Incentivo a la Productividad para el Fortalecimiento de la Asistencia Técnica a través de los gremios (IAT Gremial), que actualmente opera la Asociación Colombiana de Porcicultores – FNP, para 176 granjas porcícolas en 17 departamentos del país. • Junto con Finagro se estructuró el Programa Especial de Fomento y Desarrollo Porcicola, dirigido a financiar las necesidades del sector con condiciones especiales bajo el esquema de asociatividad, normado por la Circular P-39 de 2008 de dicha entidad. • Se gestó y concertó el convenio interinstitucional con el Banco Agrario de Colombia como aliado estratégico en la colocación de recursos. • Desde el año 2009 el Centro de Servicios obtuvo la certificación en el Sistema de Gestión de Calidad para la Norma Técnica Colombiana ISO 9001:2008. • Participación en diferentes eventos y jornadas académicas de carácter gremial para divulgación de servicios y temas de interés inherentes a la actividad porcícola. • Artículos de prensa en diferentes medios como el periódico El Tiempo y presentación en televisión en espacios emitidos por el canal Caracol. • Se han realizado más de 100 asesorías Ambientales y 200 asesorías técnicas en todo el país.


• En el área financiera y crediticia se han tramitado créditos para porcicultores con diferentes entidades financieras por un valor superior a los $10.000.000.000. • Se ha participado en reuniones con entes gubernamentales y del exterior en búsqueda de recursos para la prestación de servicios. • Se han realizado capacitaciones con un gran número de entidades financieras que redescuentan en Finagro, para facilitar el proceso de análisis y evaluación crediticia. • Se obtuvo la inclusión del Centro de Servicios Técnicos y Financieros ante el Banco Davivienda – Bancafé, con el fin de gestionar y tramitar los créditos de los porcicultores ante dicha entidad. • Se realizaron reuniones con Firmas comisionistas de Bolsa y la BMC, para capacitación sobre la actividad porcícola de sus funcionarios, con el fin de gestionar la realización de operaciones repo sobre CDMs. Mayor información William Luengas Estrada • PBX (57)(1) 248 67 77 ext 116 celular 312 4812388 – 312 4811903 Correo electrónico asistenciafinanciera@porcicol.org.co

E

Rendición de cuentas ICA 2010 l pasado 24 de junio, el Instituto Colombiano Agropecuario, ICA, realizó la audiencia pública de rendición de cuentas, en donde se informaron los principales resultados de la entidad durante el 2010.

La gerencia, las subgerencias y las oficinas asesoras que componen el ICA describieron las actividades que han desarrollado para mantener y mejorar es estatus sanitario y fitosanitario del país, controlando y mitigando el impacto de las diferentes plagas y enfermedades que afectan a animales y cultivos, lo que “ ha permitido entre otros grandes resultados, mantener la condición de país libre de fiebre aftosa con vacunación, contar con zonas libres de diversas plagas y enfermedades y firmar protocolos que permiten la admisibilidad de nuestros productos en mercados internacionales, por citar algunos”, subrayó Teresita Beltrán Ospina, gerente general del ICA. Con relación al sector porcícola, el ICA destacó el avance del programa de Peste Porcina Clásica, PPC. “ Durante el 2010, en Colombia, no se reportó ningún foco de PPC, se atendieron 124 notificaciones frente a 99 en el 2009, se realizaron 337 visitas a predios de alto riesgo en la zona a declarar Libre de PPC. La cobertura vacunal para las zonas del país en las cuales aún se mantiene la inmunización fue de 90 por ciento. También fue certificado un Compartimiento libre de PPC en el municipio de Anapoima, en Cundinamarca, igualmente tres predios avanzaron en el cumplimiento de los requisitos de bioseguridad y la suspensión de vacunación, en Cáceres, Antioquia; Tabio, Cundinamarca y Puerto Gaitán en el Meta”, cita el informe entregado por la Subgerencia de Protección Animal. De esta misma forma, la Subgerencia de Análisis y Diagnóstico, informó que se realizaron análisis por técnicas moleculares como PCR convencional, RT PCT, RT-PCT en tiempo real y secuencia-

ción, en caso de la especie porcina se analizaron 868 ingresos que involucraron 2.221 análisis. Adicionalmente, se estableció un espacio para que no sólo los gerentes o directores de los gremios, sino los productores, ciudadanos e integrantes de la sociedad civil, expresaran sus inquietudes frente a la labor desarrollada por el ICA durante el 2010.

Taller de unificación de criterios Asoporcicultores – FNP, en conjunto con el Instituto Nacional de Vigilancia de Medicamentos y Alimentos (INVIMA), realizó el taller de unificación de criterios sobre el Decreto 2278 de 1982 para plantas de beneficio con línea de porcinos. Allí se revisaron temas como el estado de los procesos de racionalización de plantas de beneficio de porcinos, Resolución 4282 de 2007, POES, Haccp y Bienestar Animal, igualmente se visitó una planta de beneficio con línea de porcinos. El taller estuvo dirigido por el consultor internacional de la Asociación Americana de Soya (ASA IM) Julio Chaves, quien ha acompañado a Asoporcicultores – FNP en el programa de Comercialización y Calidad en la asesoría a plantas de beneficio para la implementación de los requisitos de la nueva normatividad desde el año 2007. Al taller asistieron, por parte del Invima, 18 funcionarios encargados de los procesos de Inspección, Vigilancia y Control de las diferentes regiones del país.


30 Junio • 2011 •


COSTOS DE PRODUCCIÓN PORCICULTURA REGIONALES - ZONA BOGOTÁ - MAYO Valor Lechón

Costo lechón a los 22.2 kg

Particip.

Valor

Costo cebador

Particip.

Valor

Costo cerdo ciclo completo

Particip.

Valor

Particip.

$0

0,0%

$94.742

61,8%

$156.562

34,6%

$0

0,0%

Alimento (*)

$49.453

52,2%

$41.422

27,0%

$250.124

55,2%

$340.998

75,8%

Pie de cría

$16.952

17,9%

$0

0,0%

$0

0,0%

$16.952

3,8%

$2.754

2,9%

$0

0,0%

$0

0,0%

$2.754

0,6%

$964

1,0%

$0

0,0%

$0

0,0%

$964

0,2%

Mano de obra

$11.685

12,3%

$6.163

4,0%

$14.302

3,2%

$32.149

7,1%

Instalaciones

$4.525

4,8%

$3.562

2,3%

$4.564

1,0%

$12.651

2,8%

Droga y vacunas

$6.552

6,9%

$3.831

2,5%

$589

0,1%

$10.972

2,4%

$0

0,0%

$2.472

1,6%

$2.600

0,6%

$5.041

1,1%

Tasa de partos Repeticiones

Mortalidad Comercialización

$0

0,0%

$0

0,0%

$21.423

4,7%

$21.423

4,8%

Otros

$1.858

2,0%

$1.218

0,8%

$2.766

0,6%

$5.842

1,3%

TOTAL

$94.742

100,0%

$153.410

100,0%

$452.929

100,0%

$449.746

100,0%

Vr. IVA pagado

$6.618

$5.604

$33.531

$45.754

Bogotá

Costo lechón al destete (5.5 Kg)

Rubro

(*) El rubro alimento incluye IVA y fletes

UTILIDAD (PÉRDIDA) SEGÚN LECHONES DESTETADOS POR CAMADA (LECHÓN DE 22.2KG) Lechones destetados

Costo de producción

Precio de venta

Utilidad (pérdida)

Margen/invest. tasa mensual

T.E. anual

IVA pagado por lechón

9

$170.456

$153.022

-$17.434

-1,67%

-19,03%

Precio promedio kg/pie periodo

$4.176

$12.957

Punto equilibrio cebador

$4.529 $4.497 $9.700

10

$153.410

$153.022

-$389

0,04%

-0,50%

$12.222

Punto equilibrio ciclo completo

11

$139.464

$153.022

$13.558

1,59%

19,90%

$11.620

Valor dec.conversión engorde

12

$127.842

$153.022

$25.180

3,21%

42,16%

$11.119

UTILIDAD (PÉRDIDA) SEGÚN PRECIO DE VENTA (22.2 kg - 100,0 kg) $ Kilo

Ingr./animal

$/animal cebador

Util/animal cebador

Margen/inver. tasa mens.

$/animal C. compl.

Comercialización ($/cerdo)

Util/animal C. comp.

Margen/inver. tasa mens.

$3.700

$370.026

$452.929

-$82.903

-5,60%

$449.746

-$79.720

-1,89%

$3.800

$380.027

$452.929

-$72.903

-4,93%

$449.746

-$69.720

-1,65%

$3.900

$390.027

$452.929

-$62.902

-4,25%

$449.746

-$59.719

-1,41%

$4.000

$400.028

$452.929

-$52.901

-3,58%

$449.746

-$49.718

-1,18%

$4.100

$410.029

$452.929

-$42.900

-2,90%

$449.746

-$39.718

-0,94%

$4.200

$420.029

$452.929

-$32.900

-2,22%

$449.746

-$29.717

-0,70%

$4.300

$430.030

$452.929

-$22.899

-1,55%

$449.746

-$19.716

-0,47%

$4.400

$440.031

$452.929

-$12.898

-0,87%

$449.746

-$9.716

-0,23%

Bogotá Flete/ANL

$7.500

Merma (%)

$2%

Merma ($)

$8.352

Seguro (%)

0,0%

Seguro ($)

$0

F.N.P.

$3.571

Licencia

$2.000 $21.423

UTILIDAD (PÉRDIDA) SEGÚN ÍNDICE DE CONVERSIÓN ALIMENTICIA (22.2 kg - 100,0 kg) Conver. Alimento

Consumo

Variación $ alimento

Util. cebador

Margen/inver. tasa mens.

IVA pagado

Util.C. compl.

Margen/inver. tasa mens.

IVA pagado

2,3

179

$223.109

-8.317

-0,60%

$29.910

-$5.166

-0,13%

$42.132

2,4

187

$232.809

-18.018

-1,27%

$31.210

-$14.866

-0,37%

$43.432

2,5

195

$242.509

-27.718

-1,91%

$32.511

-$24.567

-0,59%

$44.732

2,6

202

$252.210

-37.419

-2,52%

$33.811

-$34.267

-0,81%

$46.033

2,7

210

$261.910

-47.119

-3,10%

$35.111

-$43.968

-1,01%

$47.333

2,8

218

$271.610

-56.819

-3,67%

$36.412

-$53.668

-1,21%

$48.634

2,9

226

$281.311

-66.520

-4,21%

$37.712

-$63.368

-1,40%

$49.934

3,0

233

$291.011

-76.220

-4,72%

$39.013

-$73.069

-1,58%

$51.235

SIMULACIÓN CON GASTOS OPERACIONALES Y FINANCIEROS CICLO COMPLETO. (Se estima porcentaje como proporción del valor de venta) GAV + Financ

Precio Venta

Costo total

Utilidad

Tasa mensual

3%

$417.596

$463.239

($45.642)

-1,05%

6%

$417.596

$476.731

($59.135)

-1,32%

9%

$417.596

$490.223

($72.627)

-1,58%

12%

$417.596

$503.716

($86.119)

-1,82%

IMPACTO DEL PESO AL SACRIFICIO EN EL COSTO Y LA RENTABILIDAD Peso (kg) al sacrificio

Costo cebador $/cerdo

Utilidad $/cerdo

Tasa mensual %

T.E. anual %

Costo ciclo C. $/cerdo

Utilidad $/cerdo

Tasa mensual %

T.E. anual %

93,1

$423.616

-$34.665

-2,70%

-28,66%

$420.464

-$31.513

-0,82%

-9,70%

100,0

$452.929

-$35.333

-2,39%

-25,80%

$449.746

-$32.150

-0,76%

-9,03%

107,1

$483.731

-$36.320

-2,15%

-23,48%

$480.190

-$32.779

-0,71%

-8,43% • Porcicultura Colombiana •

31


COSTOS DE PRODUCCIÓN PORCICULTURA REGIONALES - ZONA MEDELLÍN - MAYO Costo lechón al destete (5.5 Kg)

Rubro

Valor Lechón

Medellín

Costo lechón a los 22.2 kg

Particip.

Valor

Costo cebador

Particip.

Valor

Costo cerdo ciclo completo

Particip.

Valor

Particip.

$0

0,0%

$94.724

61,9%

$156.562

34,3%

$0

0,0%

Alimento (*)

$49.526

52,3%

$41.084

26,8%

$251.629

55,1%

$342.238

75,6%

Pie de cría

$16.860

17,8%

$0

0,0%

$0

0,0%

$16.860

3,7%

$2.754

2,9%

$0

0,0%

$0

0,0%

$2.754

0,6%

Tasa de partos Repeticiones

$965

1,0%

$0

0,0%

$0

0,0%

$965

0,2%

Mano de obra

$11.685

12,3%

$6.163

4,0%

$14.302

3,1%

$32.149

7,1%

Instalaciones

$4.525

4,8%

$3.562

2,3%

$4.564

1,0%

$12.651

2,8%

Droga y vacunas

$6.552

6,9%

$3.831

2,5%

$589

0,1%

$10.972

2,4%

Mortalidad

$0

0,0%

$2.467

1,6%

$2.618

0,6%

$5.050

1,1%

Comercialización

$0

0,0%

$0

0,0%

$23.254

5,1%

$23.253

5,1%

Otros

$1.857

2,0%

$1.215

0,8%

$2.948

0,6%

$5.846

1,3%

TOTAL

$94.724

100,0%

$153.045

100,0%

$456.465

100,0%

$452.739

100,0%

Vr. IVA pagado

$6.628

$5.557

$33.739

$45.924

(*) El rubro alimento incluye IVA y fletes

UTILIDAD (PÉRDIDA) SEGÚN LECHONES DESTETADOS POR CAMADA (LECHÓN DE 22.2KG) Lechones destetados

Costo de producción

Precio de venta

Utilidad (pérdida)

Margen/invest. tasa mensual

T.E. anual

IVA pagado por lechón

$4.564

9

$170.050

$153.022

-$17.028

-1,63%

-18,65%

$12.922

$4.527

10

$153.045

$153.022

-$23.000

0,00%

-0,03%

$12.185

11

$139.132

$153.022

$13.890

1,63%

20,46%

$11.583

12

$127.538

$153.022

$25.484

3,26%

42,82%

$11.081

Precio promedio kg/pie periodo

$4.023

Punto equilibrio cebador Punto equilibrio ciclo completo Valor dec.conversión engorde

$9.759

Comercialización ($/cerdo)

UTILIDAD (PÉRDIDA) SEGÚN PRECIO DE VENTA (22.2 kg - 100,0 kg)

Mendellín Flete/ANL

$7.500

Merma (%)

$2%

Merma ($)

$8.146

Seguro (%)

0,5%

Seguro ($)

$2.037

F.N.P.

$3.571

Licencia

$2.000 $23.254

$ Kilo

Ingr./animal

$/animal cebador

Util/animal cebador

Margen/inver. tasa mens.

$/animal C. compl.

Util/animal C. comp.

Margen/inver. tasa mens.

$3.700

$370.026

$456.465

-$86.439

-5,80%

$452.739

-$82.713

-1,94%

$3.800

$380.027

$456.465

-$76.438

-5,13%

$452.739

-$72.712

-1,71%

$3.900

$390.027

$456.465

-$66.437

-4,46%

$452.739

-$62.712

-1,47%

$4.000

$400.028

$456.465

-$56.437

-3,78%

$452.739

-$52.711

-1,24%

$4.100

$410.029

$456.465

-$46.436

-3,11%

$452.739

-$42.710

-1,00%

$4.200

$420.029

$456.465

-$36.435

-2,44%

$452.739

-$32.710

-0,77%

$4.300

$430.030

$456.465

-$26.435

-1,77%

$452.739

-$22.709

-0,53%

$4.400

$440.031

$456.465

-$16.434

-1,10%

$452.739

-$12.708

-0,30%

SIMULACIÓN CON GASTOS OPERACIONALES Y FINANCIEROS CICLO COMPLETO. (Se estima porcentaje como proporción del valor de venta)

UTILIDAD (PÉRDIDA) SEGÚN ÍNDICE DE CONVERSIÓN ALIMENTICIA (22.2 kg - 100,0 kg) Conver. Alimento

Consumo

Variación $ alimento

Util. cebador

Margen/inver. tasa mens.

IVA pagado

Util.C. compl.

Margen/inver. tasa mens.

IVA pagado

2,3

179

$224.421

-$21.967

-1,57%

$30.095

-$18.450

-0,46%

$42.280

2,4

187

$234.210

-$31.725

-2,21%

$31.403

-$28.209

-0,69%

$43.589

GAV + Financ

Precio Venta

Costo total

Utilidad

Tasa mensual

3%

$407.320

$466.321

-$59.001

-1,35%

2,5

195

$243.968

-$41.484

-2,83%

$32.712

-$37.967

-0,91%

$44.897

202

$253.727

-$51.243

-3,42%

$34.020

-$47.726

-1,12%

$46.206

6%

$407.320

$479.903

-$72.583

-1,61%

2,6

9%

$407.320

$493.486

-$86.165

-1,86%

2,7

210

$263.486

-$61.002

-3,99%

$35.329

-$57.485

-1,32%

$47.514

-2,09%

2,8

218

$273.245

-$70.760

-4,53%

$36.637

-$67.244

-1,51%

$48.823

2,9

226

$283.003

-$80.519

-5,05%

$37.946

-$77.002

-1,69%

$50.131

3,0

233

$292.762

-$90.278

-5,55%

$39.254

-$86.761

-1,87%

$51.439

12%

$407.320

$507.068

-$99.747

IMPACTO DEL PESO AL SACRIFICIO EN EL COSTO Y LA RENTABILIDAD

32 Junio • 2011 •

Peso (kg) al sacrificio

Costo cebador $/cerdo

Utilidad $/cerdo

Tasa mensual %

T.E. anual %

Costo ciclo C. $/cerdo

Utilidad $/cerdo

Tasa mensual %

T.E. anual %

93,1

$426.878

-$47.498

-3,67%

-37,29%

$423.343

-$43.963

-1,13%

-13,37%

100,0

$456.465

-$49.144

-3,30%

-34,19%

$452.739

-$45.419

-1,07%

-12,62%

107,1

$487.226

-$50.824

-2,98%

-31,46%

$483.301

-$46.900

-1,01%

-11,94%


COSTOS DE PRODUCCIÓN PORCICULTURA REGIONALES - ZONA CALI - MAYO Valor Lechón

Costo lechón a los 22.2 kg

Particip.

Valor

Costo cebador

Particip.

Valor

Costo cerdo ciclo completo

Particip.

Valor

Particip.

$0

0,0%

$91.056

62,1%

$153.340

35,2%

$0

0,0%

Alimento (*)

$45.686

50,2%

$38.578

26,3%

$236.917

54,3%

$321.182

74,8%

Pie de cría

$17.178

18,9%

$0

0,0%

$0

0,0%

$17.178

4,0%

$2.696

3,0%

$0

0,0%

$0

0,0%

$2.696

0,6%

Tasa de partos Repeticiones

$923

1,0%

$0

0,0%

$0

0,0%

$923

0,2%

Mano de obra

$11.685

12,8%

$6.163

4,2%

$14.302

3,3%

$32.149

7,5%

Instalaciones

$4.525

5,0%

$3.562

2,4%

$4.564

1,0%

$12.651

2,9%

Droga y vacunas

$6.552

7,2%

$3.831

2,6%

$589

0,1%

$10.972

2,6%

$25

0,0%

$2.369

1,6%

$2.532

0,6%

$4.835

1,1%

$0

0,0%

$0

0,0%

$20.940

4,8%

$20.940

4,9%

Mortalidad Comercialización Otros

$1.785

2,0%

$1.164

0,8%

$2.816

0,6%

$5.586

1,3%

TOTAL

$91.056

100,0%

$146.724

100,0%

$435.999

100,0%

$429.113

100,0%

Vr. IVA pagado

$6.098

$5.212

$31.710

Cali

Costo lechón al destete (5.5 Kg)

Rubro

$43.020

(*) El rubro alimento incluye IVA y fletes

UTILIDAD (PÉRDIDA) SEGÚN LECHONES DESTETADOS POR CAMADA (LECHÓN DE 22.2KG) Lechones destetados

Costo de producción

Precio de venta

Utilidad (pérdida)

Margen/invest. tasa mensual

T.E. anual

IVA pagado por lechón

Precio promedio kg/pie periodo

$3.934 $4.360

9

$163.027

$149.800

-$13.227

-1,32%

-15,26%

$11.988

Punto equilibrio cebador

10

$146.724

$149.800

$3.076

0,34%

4,14%

$11.310

Punto equilibrio ciclo completo

$4.291

Valor dec.conversión engorde

$9.188

11

$133.386

$149.800

$16.415

2,01%

25,49%

$10.756

12

$122.270

$149.800

$27.530

3,67%

48,78%

$10.294

$ Kilo

Ingr./animal

$/animal cebador

Util/animal cebador

Margen/inver. tasa mens.

$/animal C. compl.

Util/animal C. comp.

Margen/inver. tasa mens.

$3.700

$370.028

$435.999

-$65.973

-4,63%

$429.113

-$59.087

-1,46%

Flete/ANL

UTILIDAD (PÉRDIDA) SEGÚN PRECIO DE VENTA (22.2 kg - 100,0 kg)

Comercialización ($/cerdo)

Cali $7.500

$3.800

$380.027

$435.999

-$55.972

-3,93%

$429.113

-$49.086

-1,22%

Merma (%)

$3.900

$390.027

$435.999

$45.972

-3,23%

$429.113

-$39.085

-0,97%

Merma ($)

$7.869 0,0%

$4.000

$400.028

$435.999

$35.971

-2,53%

$429.113

-$29.085

-0,72%

Seguro (%)

$4.100

$410.029

$435.999

$25.970

-1,82%

$429.113

-$19.084

-0,47%

Seguro ($)

$4.200

$420.029

$435.999

$15.970

-1,12%

$429.113

-$9.083

-0,23%

F.N.P.

$4.300

$430.030

$435.999

$5.969

-0,42%

$429.113

$917

0,02%

Licencia

$4.500

$440.031

$435.999

$4.032

-0,28%

$429.113

$10.918

$2%

$0 $3.571 $2.000 $20.940

0,27%

UTILIDAD (PÉRDIDA) SEGÚN ÍNDICE DE CONVERSIÓN ALIMENTICIA (22.2 kg - 100,0kg) Conver. Alimento

Consumo

Variación $ alimento

Util. cebador

Margen/inver. tasa mens.

IVA pagado

Util.C. compl.

Margen/inver. tasa mens.

IVA pagado

2,3

179

$211.328

($16.955)

-1,26%

$28.285

-$10.339

-0,27%

$39.595

2,4

187

$220.516

($26.144)

-1,91%

$29.515

-$19.527

-0,50%

$40.825

2,5

195

$229.705

($35.332)

-2,52%

$30.744

-$28.716

-0,72%

$42.055

2,6

202

$238.893

($44.520)

-3,11%

$31.974

-$37.904

-0,93%

$43.284

2,7

210

$248.081

($53.706)

-3,68%

$33.204

-$47.092

-1,14%

$44.514

2,8

218

$257.269

($62.896)

-4,22%

$34.434

-$56.280

-1,33%

$45.744

2,9

226

$266.457

($72.085)

-4,74%

$35.663

-$65.468

-1,52%

$46.974

3,0

233

$275.646

($81.273)

-5,24%

$36.893

-$74.657

-1,70%

$48.203

SIMULACIÓN CON GASTOS OPERACIONALES Y FINANCIEROS CICLO COMPLETO. (Se estima porcentaje como proporción del valor de venta) GAV + Financ

Precio Venta

Costo total

Utilidad

Tasa mensual

3%

$393.455

$441.986

($48.531)

-1,17%

6%

$393.455

$454.859

($61.405)

-1,44%

9%

$393.455

$467.733

($74.278)

-1,69%

12%

$393.455

$480.606

($87.151)

-1,93%

IMPACTO DEL PESO AL SACRIFICIO EN EL COSTO Y LA RENTABILIDAD Peso (kg) al sacrificio

Costo cebador $/cerdo

Utilidad $/cerdo

Tasa mensual %

T.E. anual %

Costo ciclo C. $/cerdo

Utilidad $/cerdo

Tasa mensual %

T.E. anual %

93,1

$406.166

-$41.701

-3,37%

-34,71%

$401.460

-$34.994

-0,95%

-11,25%

100,0

$435.999

-$42.544

-2,99%

-31,42%

$429.113

-$35.658

-0,88%

-10,48%

107,1

$464.932

-$43.387

-2,67%

-28,53%

$457.859

-$36.314

-0,82%

-9,78%

• Porcicultura Colombiana •

33


COSTOS DE PRODUCCIÓN PORCICULTURA REGIONALES - ZONA BUCARAMANGA - MAYO Costo lechón al destete (5.5 Kg)

Rubro

Valor

B/manga

Lechón

Costo lechón a los 22.2 kg

Particip.

Valor

Costo cebador

Particip.

Valor

Costo cerdo ciclo completo

Particip.

Valor

Particip.

$0

0,0%

$90.921

62,5%

$153.340

33,9%

$0

0,0%

Alimento (*)

$46.139

50,7%

$37.515

25,8%

$239.070

52,9%

$322.724

72,7%

Pie de cría

$16.613

18,3%

$0

0,0%

$0

0,0%

$16.613

3,7%

$2.696

3,0%

$0

0,0%

$0

0,0%

$2.696

0,6%

Tasa de partos Repeticiones

$930

1,0%

$0

0,0%

$0

0,0%

$930

0,2%

Mano de obra

$11.685

12,9%

$6.163

4,2%

$14.302

3,2%

$32.149

7,2%

Instalaciones

$4.525

5,0%

$3.562

2,4%

$4.564

1,0%

$12.651

2,8%

Droga y vacunas

$6.552

7,2%

$3.831

2,6%

$589

0,1%

$10.972

2,5%

Mortalidad

$0

0,0%

$2.361

1,6%

$2.535

0,6%

$4.818

1,1%

Comercialización

$0

0,0%

$0

0,0%

$34.775

7,7%

$34.775

7,8%

Otros

$1.783

2,0%

$1.155

0,8%

$2.920

0,6%

$5.580

1,3%

TOTAL

$90.921

100,0%

$145.508

100,0%

$452.095

100,0%

$443.907

100,0%

Vr. IVA pagado

$6.161

$5.065

$32.007

$43.233

(*) El rubro alimento incluye IVA y fletes

UTILIDAD (PÉRDIDA) SEGÚN LECHONES DESTETADOS POR CAMADA (LECHÓN DE 22.2KG)

Precio promedio kg/pie periodo

$4.176

Lechones destetados

Punto equilibrio cebador

$4.521

9

$161.676

$149.800

Punto equilibrio ciclo completo

$4.439

10

$145.508

$149.800

$4.292

0,48%

5,85%

$11.226

Valor dec.conversión engorde

$9.272

11

$132.280

$149.800

$17.520

2,16%

27,55%

$10.666

12

$121.257

$149.800

$28.543

3,84%

51,22%

$10.199

Comercialización ($/cerdo)

$ Kilo

$12.500

Merma (%)

4%

Merma ($)

$16.704

Seguro (%)

0,0%

Seguro ($)

$0

F.N.P.

$3.571

Licencia

$2.000 $34.775

Precio Venta

Costo total

Utilidad (pérdida)

Margen/invest. tasa mensual

T.E. anual

IVA pagado por lechón

-$11.876

-1,20%

-13,87%

$11.910

Utilidad

Tasa mensual

Ingr./animal

$/animal cebador

Util/animal cebador

Margen/inver. tasa mens.

$/animal C. compl.

Util/animal C. comp.

Margen/inver. tasa mens.

$3.700

$370.026

$452.095

-$82.069

-5,56%

$443.907

-$73.882

-1,77%

$3.800

$380.027

$452.095

-$72.068

-4,88%

$443.907

-$63.881

-1,53%

$3.900

$390.027

$452.095

-$62.067

-4,20%

$443.907

-$53.880

-1,29%

$4.000

$400.028

$452.095

-$52.067

-3,53%

$443.907

-$43.879

-1,05%

$4.100

$410.029

$452.095

-$42.066

-2,85%

$443.907

-$33.879

-0,81%

$4.200

$420.029

$452.095

-$32.065

-2,17%

$443.907

-$23.878

-0,57%

$4.300

$430.030

$452.095

-$22.064

-1,49%

$443.907

-$13.877

-0,33%

$4.400

$440.031

$452.095

-$13.064

-0,82%

$443.907

-$3.877

-0,09%

SIMULACIÓN CON GASTOS OPERACIONALES Y FINANCIEROS CICLO COMPLETO. (Se estima porcentaje como proporción del valor de venta) GAV + Financ

Precio de venta

UTILIDAD (PÉRDIDA) SEGÚN PRECIO DE VENTA (22.2 kg - 100,0 kg)

Bucaramanga Flete/ANL

Costo de producción

UTILIDAD (PÉRDIDA) SEGÚN ÍNDICE DE CONVERSIÓN ALIMENTICIA (22.2 kg - 100,0ZZ kg) Conver. Alimento

Consumo

Variación $ alimento

Util. cebador

Margen/inver. tasa mens.

2,3

179

$213.249

($8.677)

-0,62%

2,4

187

$22.521

($17.948)

-1,26%

IVA pagado

Util.C. compl.

Margen/inver. tasa mens.

IVA pagado

$28.550

-$845

-0,02%

$39.776

$29.791

-$10.117

-0,25%

$41.017

3%

$417.596

$463.239

($45.642)

-1,05%

2,5

195

$231.792

($27.220)

-1,87%

$31.032

-$19.388

-0,47%

$42.258

6%

$417.596

$476.731

($59.135)

-1,32%

2,6

202

$241.064

($36.492)

-2,46%

$32.274

-$28.660

-0,68%

$43.500

9%

$417.596

$490.223

($72.627)

-1,58%

2,7

210

$250.336

($45.764)

-3,02%

$33.515

-$37.932

-0,89%

$44.741

12%

$417.596

$503.716

($86.119)

-1,82%

2,8

218

$259.607

($55.035)

-3,56%

$34.756

-$47.203

-1,08%

$45.982

2,9

226

$268.879

($64.307)

-4,09%

$35.998

-$56.475

-1,27%

$47.223

3,0

233

$278.151

($73.579)

-4,59%

$37.239

-$65.747

-1,45%

$48.465

T.E. anual %

Costo ciclo C. $/cerdo

Utilidad $/cerdo

Tasa mensual %

T.E. anual %

Peso (kg) al sacrificio

34 Junio • 2011 •

Costo cebador $/cerdo

Utilidad $/cerdo

Tasa mensual %

93,1

$423.249

-$34.298

-2,67%

-28,42%

$415.248

-$26.297

-0,69%

-8,21%

100,0

$452.095

-$34.498

-2,34%

-25,29%

$443.907

-$26.311

-0,63%

-7,50%

107,1

$482.083

-$34.672

-2,05%

-22,58%

$473.702

-$26.291

-0,58%

-6,87%


• Porcicultura Colombiana •

35


36 Junio • 2011 •


154