Page 1


Philip Alan Burkhardt

2326 Sulphur Avenue

Saint Louis, MO 63139

philipaburkhardt@gmail.com

206.605.1789


GENOMICS RESEARCH It is increasingly apparent that my life experiences form a continuum, not discrete periods. The way in which I approach design has certainly been influenced by my scientific background. It seems only appropriate that my portfolio acknowledges this, beginning with my recent past sequencing the human genome at the University of Washington’s Genome Center.

Overlaps allow for tiling of fragments into complete genome sequence

1 2

ACCTGATCTGTGATAT

3

ATATGGCTAACTATGGTCTCTATTACCTGATCTGTGATAT

ATATGGCTAACTATGGTCTCTATTAACTGATCTGTGATAT


Individual’s DNA fragmented and inserted into E.Coli cells

3

1

2

GATATGGTCATTATCGAATTATAGCACTGTGATATG

ATGACTGTGATATGGTCATTATCGAATTATAG

T

TGACTGTGATATGGTCATTATCGAATTATAGCACTGTGATATG


SAINT LOUIS HOUSING Located on the edge of Saint Louis’ Central West End, this housing project creates 25 residential units, two live/ work units and a small cafe along what was once a busy commercial corridor. The front bar of the building responds directly to the scale of the street and houses public and semi-public programs. Within the units the design utilizes shifts in plan and section to create space for light and circulation.


Light Studies


BROAD STREET reFRESH A collaborative entry for the 2009 Chase Community Development Competition on behalf of the New Orleans’ nonprofit organization Broad Community Connections. This project proposed the adaptive reuse of a derelict grocery store creating a small market, a community kitchen and a roof top farm. Community support, financial mechanisms and architectural feasibility were addressed in a written submission and oral presentation. A second place finish awarded our nonprofit partner $15,000 in seed money. The site has been purchased and the project is ongoing. Team Members Philip Burkhardt (WashU-Architecture) Jackie Dadakis (MIT-Urban Planning) Aditi Mehti (MIT - Urban Planning) Brendan Wittstruck (WashU-Architecture)


1

2

1

2


www.NOLAisWATER.com WHEN FOUNDED, THE REGION WAS ABOVE SEA LEVEL. NOW, 50% OF NEW ORLEANS IS BENEATH SEA LEVEL AND STILL SINKING. TELL ME MORE > NOLA IS

MAP

GUTTER

TO

GULF

As part of Washington University and the University of Toronto’s ongoing Gutter to Gulf collaboration, the NOLAisWATER website attempts to collect, distill and connect the everyday (as opposed to the catastrophic) water issues confronting New Orleans. The project tests the thesis that architects and urban designers posses a unique skill set for cataloguing and displaying information pertaining to the built environment. Team Members Philip Burkhardt Erin Dorr Jonathan Dowse Brendan Wittstruck

ABOUT

CONTACT


SINKING

SINKING

51 inches or more

MECHANISM

21 - 50 inches

River

4 - 20 inches

IMAGES River control stops flooding

Before pumping technology was introduced to New Orleans, the entire city was above sea level. Pumps, introduced at the end of the 19th century, allowed for growth of the city into reclaimed wetlands yet also began removing ground water which started the ground sinking. Now parts of the city are well below sea level and still sinking.

At Settlement

Historically, the Mississippi flooded seasonally. When this water receded it left behind a new layer of sediment. The heavier particles settled near the river, creating the high ground on which the French Quarter sits today. Floods built land. River control has stopped sediment deposits that previously accompanied seasonal flooding. The pumping of water to keep the city dry has also taken the water out of the soil, allowing it to dry up

Sea Level

and compact. New Orleans is thirsty.

Sea Level

Sea Level

Land sinks

- 8’

GUTTER TO GULF

CONNECTIONS

Pumping lowers water table

+12’

MAP

IMAGES

Sea Level

CONNECTIONS

NOLA IS

MECHANISM

Lake

Developed Area

ABOUT

CONTACT

NOLA IS

MAP

GUTTER TO GULF

ABOUT

SINKING

CONTACT

SINKING

51 inches or more

MECHANISM

21 - 50 inches

River

Lake

4 - 20 inches Developed Area

IMAGES All above sea level

CONNECTIONS

1980’s

CONNECTIONS Flood

Before pumping technology was introduced to New Orleans, the entire city was above sea level. Pumps, introduced at the end of the 19th century, allowed for growth of the city into reclaimed wetlands yet also began removing ground water which started the ground sinking. Now parts of the city are well below sea level and still sinking.

Sea Level River flooding

Growing land

- 8’

NOLA IS

MAP

GUTTER TO GULF

Historically, the Mississippi flooded seasonally. When this water receded it left behind a new layer of sediment. The heavier particles settled near the river, creating the high ground on which the French Quarter sits today. Floods built land. River control has stopped sediment deposits that previously accompanied seasonal flooding. The pumping of water to keep the city dry has also taken the water out of the soil, allowing it to dry up and compact. New Orleans is thirsty.

Sea Level

+12’ Sea Level

MECHANISM IMAGES

Sea Level

ABOUT

CONTACT

NOLA IS

MAP

GUTTER TO GULF

ABOUT

CONTACT

LEVEES FAILURE MECHANISMS IMAGES CONNECTIONS New Orleans is separated from surrounding water bodies by a series of levees. These levees primarily take two forms: earthen levees, and flood walls. Earthen levees are essentially highly-engineered piles of earth. Levee walls on the other hand, are concrete walls set on sheet pilings. Earthen levees require significantly more space to reach the required hight, yet they also create occupiable space that levee walls do not.

Floodwalls Earthen

NOLA IS

MAP

GUTTER TO GULF

ABOUT

CONTACT


ALAMAR RIVER PLAN The Alamar river is the only remaining riparian zone within the city of Tijuana, a fact rendered particularly salient by the arid city’s dwindling water supply and exploding population. Currently, the city plans on channelizing the river in order to maximize adjacent development. This proposal posits an alternative development model that fulfills the primary goals of the city’s plan, while also maintaining the river’s functionality. The river bottom is heavily programmed with environmental and civic infrastructure in an attempt to foster the citizens feeling of ownership over their shared water resource.

Channelized and developed

vs. maintained and developed


Relocate Industry

Extend Residential Grids

Maintain Riparian Zone


Flood Urban River Research Area

School

Community Center

Research Center

Agriculture


Drought

Flood

Wildlife Area

Library Corridor out of City

School Nature Center


development guidelines

D

C

B

0m

500m

1000m

2000m

A

RESIDENTIAL ECOLOGICAL

RESIDENTIAL RESIDENTIAL

ECOLOGICAL ECOLOGICAL

RESIDENTIAL

RESIDENTIAL CIVIC

RESIDENTIAL RESIDENTIAL

RESIDENTIAL CIVIC

RESIDENTIAL

CIVIC RESIDENTIAL ECOLOGICAL

CIVIC

ECOLOGICAL

CIVIC

RESIDENTIAL RESIDENTIAL

CIVIC

ECOLOGICAL RESIDENTIAL

RESIDENTIAL CIVIC

RESIDENTIAL RESIDENTIAL

RESIDENTIAL CIVIC CIVIC

RESIDENTIAL

3000m


Pervious Surfaces

Water Capture

Informal Expansion


SESC CENTRO Providing health, wellness and cultural programs, SESC’s play a crucial role in São Paulo. Located in the center of the city on a long lot stretched between two distinct urban conditions, this project attempts to match the scale and speed of each side while creating a much needed pedestrian route through the block. Sports courts and a rooftop swimming pool create a large mass on one side, while cultural programming is located in a smaller structure along a pedestrian oriented street. A large courtyard creates a dialogue between the two structures, while the pedestrian path stitches them together with public spaces and gardens.


O

CI

EN

OR FL

Circulation Diagram

building access gathering space garden

IA

ES

MA

T ES

PR

bypass

PRESTES MAIA

Under Main Courtyard


1

1

1

1


Fast and slow spaces

Stairs as Theater

Planter for Light & View


CLOSED-LOOP URBANISM A collaborative, cross-disciplinary entry to the 2011 Hines/ULI Urban Design Competition, this project explores the use of innovative funding solutions to incentivize large scale, sustainable infrastructure in Seattle Washington. Team Members Philip Burkhardt (Architecture) Rudy Croster (Business) Roberto Deseda (Urban Design) Mike Naucas (Landscape Architecture) Brendan Wittstruck (Construction Management)


MLK

d Un iv er si Do ty D wn to istr wn ic t

r

23r

Rainie

McC

lel

Spo

lan

Seattle Master Plan: 2,500 jobs & 1,800 residents within 1/4 mile of Rainier Village.

kan

e

Col

MLK

23r Un

iv

er si Do ty D wn to istr wn ic t

r Rainie

d

umb i Air a Cit y por t

McC

single family

Spo

lel

lan

Add commercial and residential density along Rainier and MLK while creating job opportunities for local residents.

kan

e

Col

MLK

23r Un iv er si Do ty D wn to istr wn ic t

r

Rainie

d

umb i Air a Cit y por t

Focus densiity near transit in order to encourage further development to the South.

Col

umb i Air a Cit y por t


Complete Street-Fronts

Pedestrian Connectivity

7

7 9

9 14

4 42

.u

.

8

48

distr t ic

LINK

LINK

ntown ow

38

38

14

d

d

38

38

7

7 9

9

42

42

co

LINK

airpor

8

t

co

mbia lu

t

34

8

mbia lu

ty ci

airpor

34

LINK

ty ci

ntown ow

Activate Transit

14

4 42

8

48

14


9

5

8

10

4

7

3 6

7

2

2

SITE PLAN 1 Transit Hub(Link & Bus) 2 Pilot’s Plaza 3 Farm 4 Digester/Cogeneration

2

5 Business Incubator 6 P-Patch 7 Niche Plaza 8 QFC/Rite-Aid 9 Gas Station 10 Water retention swale

1


food waste surrounding area

electricity 191,000kWh/year

com heating


food local residents

food restaurants|markets

mpost

irrigation

collected rainwater

Phil's Portfolio  

Phil's portfolio...in progress

Advertisement