Page 1

Philip Alan Burkhardt

913 East 39th Street

Austin, Texas 78751

philipaburkhardt@gmail.com

512.351.3462


ECOLOGY & GENETICS As this document seeks to convey my experience it seems fitting to begin where I started, as a biologist studying ecology and evolution. It was a small shift of thinking that brought me from genomics to architecture, and it is increasingly clear to me that these experiences form not a discrete ‘pre-design’ phase, but a continuum that effects the way in which I view the world and its systems.

goldenrod ball gall


Individual’s DNA fragmented and inserted into E.Coli cells

3

2

Overlaps allow for tiling of complete genome sequence

1

1 2

GATATGGTCATTATCGAATTATAGCACT ACCTGATCTGTGATATGACTGTGATATGGTCATTATCGAATTATAG

3 ATATGGCTAACTATGGTCTCTATTACCTGATCTGTGATAT ATATGGCTAACTATGGTCTCTATTAACTGATCTGTGATATGACTGTGATATGGTCATTATCGAATTATAGCACT

diagram of human genome sequencing conducted while at the University of Washington’s Genome Center


GREEN COLLARS|COLLARD GREENS A design for a St. Louis green-collar high school. The building serves as a metabolic unit for the surrounding neighborhood, turning food-waste into energy. Careful integration of these programs with sustainable technologies enhance the architecture and allow for pedagogical use while avoiding a ‘science fair’ atmosphere.


gas

food waste fertilizer

liquid

solid compost

water in

1

DIGESTER

t

exhaus

er

generat

e

turbin

electricity

ustion comb

biogas

absorbtion chiller r

boile

he

at

2

coo

l

TRIGEN

1

2

tidal flow wetlands

vertical flow wetlands

er out grey wat

recirculation tank primary tank

e in sewag

3

4

LIVING MACHINE

corr

uga

ted

me

tal

sun chim

ney

fresh air

3

cla

ssro

om

cla

ssro

om

4

SOLAR CHIMNEY 0’ 10’ 20’

40’

e

at

on

rb

ca ly po

sun

e ad

c fa

photocromic paint registers heat

60’

e

t re

nc

co ct ru

st e ur

100’ iler

bo rges echa er pr

t wat

ho

5

SOLAR HOT WATER


5


sun

Morning

Photocromic Diagram

sun

sun

Evening


FABRICATION I like to make things. I believe architecture becomes truly compelling when it is resolved from the scale of the city to that of building details. Working with my hands allows me to better understand the smaller of these scales, giving direct contact with materials and how they go together. I have experience working with wood, metal, bamboo and plastics.


BROAD STREET reFRESH A collaborative entry for the 2009 Chase Community Development Competition on behalf of the New Orleans’ nonprofit organization Broad Community Connections. This project proposed the adaptive reuse of a derelict grocery store creating a small market, a community kitchen and a roof top farm. Community support, financial mechanisms and architectural feasibility were addressed in a written submission and oral presentation. A second place finish awarded our nonprofit partner $15,000 in seed money. The site has been purchased and the project is ongoing. Team Members Philip Burkhardt (WashU-Architecture) Jackie Dadakis (MIT-Urban Planning) Aditi Mehti (MIT-Urban Planning) Brendan Wittstruck (WashU-Architecture)


1

2

1

2


www.NOLAisWATER.com WHEN FOUNDED, THE REGION WAS ABOVE SEA LEVEL. NOW, 50% OF NEW ORLEANS IS BENEATH SEA LEVEL AND STILL SINKING. TELL ME MORE > NOLA IS

MAP

GUTTER

TO

GULF

ABOUT

As part of Washington University and the University of Toronto’s ongoing Gutter to Gulf collaboration, the NOLAisWATER website attempts to collect, distill and connect the everyday (as opposed to the catastrophic) water issues confronting New Orleans. The project tests the thesis that architects and urban designers posses a unique skill set for cataloguing and displaying information pertaining to the built environment. Team Members Philip Burkhardt Erin Dorr Jonathan Dowse Brendan Wittstruck

CONTACT


SINKING

SINKING

51 inches or more

MECHANISM

21 - 50 inches

River

4 - 20 inches

IMAGES River control stops flooding

Before pumping technology was introduced to New Orleans, the entire city was above sea level. Pumps, introduced at the end of the 19th century, allowed for growth of the city into reclaimed wetlands yet also began removing ground water which started the ground sinking. Now parts of the city are well below sea level and still sinking.

At Settlement

Historically, the Mississippi flooded seasonally. When this water receded it left behind a new layer of sediment. The heavier particles settled near the river, creating the high ground on which the French Quarter sits today. Floods built land. River control has stopped sediment deposits that previously accompanied seasonal flooding. The pumping of water to keep the city dry has also taken the water out of the soil, allowing it to dry up

Pumping lowers water table

and compact. New Orleans is thirsty.

Sea Level

Sea Level

Land sinks

- 8’

GUTTER TO GULF

CONNECTIONS

Sea Level

+12’

MAP

IMAGES

Sea Level

CONNECTIONS

NOLA IS

MECHANISM

Lake

Developed Area

ABOUT

CONTACT

NOLA IS

MAP

GUTTER TO GULF

ABOUT

SINKING

CONTACT

SINKING

51 inches or more

MECHANISM

21 - 50 inches

River

Lake

4 - 20 inches Developed Area

IMAGES All above sea level

CONNECTIONS Before pumping technology was introduced to New Orleans, the entire city was above sea level. Pumps, introduced at the end of the 19th century, allowed for growth of the city into reclaimed wetlands yet also began removing ground water which started the ground sinking. Now parts of the city are well below sea level and still sinking.

1980’s

CONNECTIONS Flood

Sea Level River flooding

Growing land

- 8’

NOLA IS

MAP

GUTTER TO GULF

Historically, the Mississippi flooded seasonally. When this water receded it left behind a new layer of sediment. The heavier particles settled near the river, creating the high ground on which the French Quarter sits today. Floods built land. River control has stopped sediment deposits that previously accompanied seasonal flooding. The pumping of water to keep the city dry has also taken the water out of the soil, allowing it to dry up and compact. New Orleans is thirsty.

Sea Level

+12’ Sea Level

MECHANISM IMAGES

Sea Level

ABOUT

CONTACT

NOLA IS

MAP

GUTTER TO GULF

ABOUT

CONTACT

LEVEES FAILURE MECHANISMS IMAGES CONNECTIONS New Orleans is separated from surrounding water bodies by a series of levees. These levees primarily take two forms: earthen levees, and flood walls. Earthen levees are essentially highly-engineered piles of earth. Levee walls on the other hand, are concrete walls set on sheet pilings. Earthen levees require significantly more space to reach the required hight, yet they also create occupiable space that levee walls do not.

Floodwalls Earthen

NOLA IS

MAP

GUTTER TO GULF

ABOUT

CONTACT


ALAMAR RIVER PLAN The Alamar river is the only remaining riparian zone within the city of Tijuana, a fact rendered particularly salient by the arid city’s dwindling water supply and exploding population. Currently, the city plans on channelizing the river in order to maximize adjacent development. This proposal posits an alternative development model that fulfills the primary goals of the city’s plan, while also maintaining the river’s functionality. The river bottom is heavily programmed with environmental and civic infrastructure in an attempt to foster the citizens feeling of ownership over their shared water resource.

Channelized and developed vs. Maintained and developed


Flood Urban River Research Area

School

Community Center

Research Center

Agriculture


Drought

Flood

Wildlife Area

Library Corridor out of City

School Nature Center


development guidelines

D

C

B

0m

500m

1000m

2000m

A

A

RESIDENTIAL ECOLOGICAL RESIDENTIAL ECOLOGICAL RESIDENTIAL ECOLOGICAL

B RESIDENTIAL RESIDENTIAL

RESIDENTIAL CIVIC RESIDENTIAL

ECOLOGICAL RESIDENTIAL

CIVIC RESIDENTIAL

RESIDENTIAL CIVIC

C

RESIDENTIAL ECOLOGICAL

RESIDENTIAL

RESIDENTIALCIVIC CIVIC RESIDENTIAL

ECOLOGICAL

CIVIC

ECOLOGICAL

CIVIC

RESIDENTIAL

RESIDENTIAL

RESIDENTIAL

RESIDENTIAL

CIVIC

CIVIC

ECOLOGICAL RESIDENTIAL

RESIDENTIAL CIVIC

D RESIDENTIAL

RESIDENTIAL CIVIC

RESIDENTIAL

RESIDENTIAL CIVIC

3000m


Pervious Surfaces

Water Capture

Informal Expansion


SESC CENTRO Providing health, wellness and cultural programs, SESC’s play a crucial role in São Paulo. Located in the center of the city on a long lot stretched between two distinct urban conditions, this project attempts to match the scale and speed of each side while creating a much needed pedestrian route through the block. Sports courts and a rooftop swimming pool create a large mass on one side, while cultural programming is located in a smaller structure along a pedestrian oriented street. A large courtyard creates a dialogue between the two structures, while the pedestrian path stitches them together with public spaces and gardens.


O

CI

EN

OR FL

Circulation Diagram

building access gathering space garden

IA

ES

MA

T ES

PR

bypass

PRESTES MAIA

Under Main Courtyard


1

1

1

1


Fast and slow spaces

Stairs as Theater

Planter for Light & View


SAINT LOUIS HOUSING Located on the edge of Saint Louis’ Central West End, this housing project creates 25 residential units, two live/ work units and a small cafe along what was once a busy commercial corridor. The front bar of the building responds directly to the scale of the street and houses public and semi-public programs. Within the units the design utilizes shifts in plan and section to create space for light and circulation.


Light Studies


CLOSED-LOOP URBANISM A collaborative, cross-disciplinary entry to the 2011 Hines/ULI Urban Design Competition, this project explores the use of innovative funding solutions to incentivize large scale, sustainable development in Seattle Washington. Team Members Philip Burkhardt (Architecture) Rudy Croster (Business) Roberto Deseda (Urban Design) Mike Naucas (Landscape Architecture) Brendan Wittstruck (Construction Management)


MLK

d Un i

ve

rs i Do ty D wn to istr wn ic t

r

23r

Rainie

McC

lel

Spo

lan

Seattle Master Plan: 2,500 jobs & 1,800 residents within 1/4 mile of Rainier Village.

kan

e

Col

MLK

23r Un

iv

er si Do ty D wn to istr wn ic t

r Rainie

d

umb i Air a Cit y por t

McC

single family

Spo

lel

kan

e

lan

Add commercial and residential density along Rainier and MLK while creating job opportunities for local residents.

Col

MLK

23r Un iv er si Do ty D wn to istr wn ic t

r

Rainie

d

umb i Air a Cit y por t

Focus density near transit in order to encourage further development to the South.

Col

umb i Air a Cit y por t


Complete Street-Fronts

Pedestrian Connectivity

7

7 9

9 14

4 42

.u

.

8

48

distr t ic

LINK

LINK

ntown ow

38

38

14

d

d

38

38

7

7 9

9

42

42

co

LINK

airpor

8

t

co

mbia lu

t

34

8

mbia lu

ty ci

airpor

34

LINK

ty ci

ntown ow

Activate Transit

14

4 42

8

48

14


9

5

8

10

4

7

3 6

7

2

2

SITE PLAN 1 Transit Hub(Link & Bus) 2 Pilot’s Plaza 3 Farm 4 Digester/Cogeneration 5 Business Incubator 6 P-Patch 7 Niche Plaza 8 QFC/Rite-Aid 9 Gas Station 10 Water retention swale

1


food waste surrounding area

electricity 191,000kWh/year

compost heating


food local residents

food restaurants|markets

t

irrigation

collected rainwater

Philip Burkhardt Portfolio  

The title says it all

Advertisement