Page 1

Daniela Ulloa Mota Mat. 163300 Química computacional Grupo F Actividad 4: proteínas Elastin: >AH003457.2 Bos taurus elastin (elastin) gene, partial cds AGGGGTCGGGATTCCAGCAGCTGCAGCCGCCAAAGCTGCCGCCAAAGCCGCCCAGTTTGGTNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNAGGATTAGGCCCTGGAGTCGGCGTGGCTCCCGGCGTTGGCGTGGTTCCT GGCGTCGGTGTGGTTCCCGGTGTCGGCGTGGCTCCCGGCAATGGCCTGGGCCCCGGTGGTGTCATAGGTN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGAGCAGGGGTCCCAGCTGCAGCCAAGTCTGCTGCTAAGG CCGCCGCCAAAGCCCAGTTCCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGTGTGTCTCCAGCTG CAGCTAAAGCAGCCAAATTCGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGTGCCGCTGGCCTCG GAGGTGTCCTAGGAGCTGGCCAGCCGTTCCCAATTGGAGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NAGGTGGAGCTGGGGGCCTGGGAGTTGGTGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGCAAAC CTCCCAAGCCCTTCGGAGGGGCCCTGGGAGCCCTGGGATTCCCAGGTNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNAGGTGGGGCCTGCCTGGGGAAATCCTGTGGCCGGAAGAGAAAGTGA

Tubulin: >A18572.1 Tubulin gene TTTGCATGCTGTCCAACACGACGCGATCGCTGAAGCTTGGGCTCGTTTGGATATAAGTTTGACCTTATGT ATGCCAAGCGTGCATTCGTCCACTGGTGAGTGTTCTTTCGACATCATCTTTTTCATTTGCAGTTGTTCTG CATATACAACATTTTATGAAAGTCAGATATACTGTTCAGGTATGTCGGAGAGGGAATGGAGGAAGGAGAG TTCAGTGAGGNACGTGAAGATCTCCCCGGGCTGCAGGAATTCGATATCAAGCTTATCGATACCGT

Thrombin: >M81395.1 Cynops pyrrhogaster thrombin mRNA, 3' end CAGGAGCTCATATGTGGAGCAAGCATCATCAGTGACCGCTGGGTTCTCACTGCAGCGCACTGCATTTTCT ACCCACCCTGGGACAAAAACTACACCACAGAAGACATCCTGGTGCGAATTGGAAAACACTACAGGACCAA GTACGAGAGACAACAGGAGAAGATTCGAATGCTGGAGCGGATCATCATTCACCCCAAGTACAACTGGAGG GAGAACCTGGACAGGGACATCGCCCTGATCCAGCTGAAGCGACCCATTGGCTTCACCAACTACATCCATC CCGTCTGCCTGCCCACCAAGGAGATCGTCCAGACGTTGATGCTGAACAGACACAAAGGGCGTGTGTCCGG CTGGGGGAACCTGCATGAGACCTGGACCTCGGGGGGCCAGGCCCTTCCCCAGGTCCTGCAGCAGGTCAAT CTGCCAATCGTGGACCAAGAAACCTGCAAAGCCTCAACCAAAATCAAAGTCACTAGCAACATGTTCTGTG CAGGTTATAAACCAGATGAGCCAAACAGAGGGGACGCCTGCGAGGGGGACAGTGGTGGTCCATTCGTCAT GAAGAGTCCAGATGACAACCGCTGGTACCAGGTCGGCATCGTCTCCTGGGGCGAGGGTTGTGATCGGGAT GGCAAGTATGGATTCTATACGCACCTGCACCGGATGCGCCAGTGGATGATGAAGATCATCGAGAAGTGTG GGAGCTAGGAGTGGATGCAGCCAGCCTTCATGCATCCACAGAAAGAAGCAAAACATATCCTAGAAATGTC


Daniela Ulloa Mota Mat. 163300 Química computacional Grupo F TGAAAAATACAAGCCAATAAAAGCCTCATTCTTCGGGAACAGC P53: >M13874.1 Mouse p53 mRNA, complete cds, clone p53-m8 AGGCCCTCATCCTCCTCCTTCCCAGCAGGGTGTCACGCTTCTCCGAAGACTGGATGACTGCCATGGAGGA GTCACAGTCGGATATCAGCCTCGAGCTCCCTCTGAGCCAGGAGACATTTTCAGGCTTATGGAAACTACTT CCTCCAGAAGATATCCTGCCATCACCTCACTGCATGGACGATCTGTTGCTGCCCCAGGATGTTGAGGAGT TTTTTGAAGGCCCAAGTGAAGCCCTCCGAGTGTCAGGAGCTCCTGCAGCACAGGACCCTGTCACCGAGAC CCCTGGGCCAGTGGCCCCCGCCCCAGCCACTCCATGGCCCCTGTCATCTTTTGTCCCTTCTCAAAAAACT TACCAGGGCAACTATGGCTTCCACCTGGGCTTCCTGCAGTCTGGGACAGCCAAGTCTGTTATGTGCACGT ACTCTCCTCCCCTCAATAAGCTATTCTTCCAGCTGGCGAAGACGTGCCCTGTGCAGTTGTGGGTCAGCGC CACACCTCCAGCTGGGAGCCGTGTCCGCGCCATGGCCATCTACAAGAAGTCACAGCACATGACGGAGGTC GTGAGACGCTGCCCCCACCATGAGCGCTGCTCCGATGGTGATGGCCTGGCTCCTCCCCAGCATCTTATCC GGGTGGAAGGAAATTTGTATCCCGAGTATCTGGAAGACAGGCAGACTTTTCGCCACAGCGTGGTGGTACC TTATGAGCCACCCGAGGCCGGCTCTGAGTATACCACCATCCACTACAAGTACATGTGTAATAGCTCCTGC ATGGGGGGCATGAACCGCCGACCTATCCTTACCATCATCACACTGGAAGACTCCAGTGGGAACCTTCTGG GACGGGACAGCTTTGAGGTTCGTGTTTGTGCCTGCCCTGGGAGAGACCGCCGTACAGAAGAAGAAAATTT CCGCAAAAAGGAAGTCCTTTGCCCTGAACTGCCCCCAGGGAGCGCAAAGAGAGCGCTGCCCACCTGCACA AGCGCCTCTCCCCCGCAAAAGAAAAAACCACTTGATGGAGAGTATTTCACCCTCAAGATCCGCGGGCGTA AACGCTTCGAGATGTTCCGGGAGCTGAATGAGGCCTTAGAGTTAAAGGATGCCCATGCTACAGAGGAGTC TGGAGACAGCAGGGCTCACTCCAGCCTCCAGCCTAGAGCCTTCCAAGCCTTGATCAAGGAGGAAAGCCCA AACTGCTAGCTCCCATCACTTCATCCCTCCCCTTTTCTGTCTTCCTATAGCTACCTGAAGACCAAGAAGG GCCAGTCTACTTCCCGCCATAAAAAAACAATGGTCAAGAAAGTGGGGCCTGACTCAGACTGA Rhodopsin: >AB074484.1 Plecoglossus altivelis mRNA for rhodopsin, complete cds ACCGAAGGCTGATTGCAACCGCAAGACCGCAACCATGAACGGCACAGAGGGACCCTTTTTCTATGTCCCT ATGTCAAATGCCTCCGGCATTGTCAGGAGTCCTTATGAATACCCTCAGTACTACCTTATCAACCCAGCAG CATACTTCATGCTGGCCTGCTACATGTTCTTTCTCATCATCACCGGCTTCCCCATCAACTTCCTAACACT GTACGTCACCATCGAGCACAAGAAGCTGAGGACCGCCCTAAACTACATCCTGCTGAACCTGGCTGTGGCT GACCTCTTCATGGTGATCGGTGGCTTCACCACCACATTGTACACATCCATGCATGGCTACTTCGTCTTCG GTAGGACTGGCTGCAACATCGAAGGATTTTGTGCCACCCTCGGTGGTGAGATTGCCATGTGGTCCCTGGT TGTCCTGGCTATTGAGAGGTGGGTGGTTGTCTGCAAGCCCATGACCAACTTCCGCTTTGGTGAGAACCAT GCCATCATGGGTGTTGCGTTCACCTGGGTGATGGCCGCTGCCTGTGCTGTGCCCCCACTCTTCGGCTGGT CCCGCTACATCCCAGAGGGCATGCAGTGCTCATGCGGAATTGACTATTACACCCGTGCCCCCGGCTTTAA CAACGAGTCCTTTGTGGTCTACATGTTCATTGTCCACTTCACACTTCCTCTGACCGTCGTCACCTTCTGC TATGGCCGTCTGCTGTGCACCGTCAAGGAGGCAGCTGCTGCCCAGCAGGAGTCCGAGACCACCCAGAGGG CCGAGAGGGAAGTTACCCGCATGGTCGTCCTGATGGAGATCTCCTACCTGGTGTGCTGGTTGCCCTATGC CAGCGTGGCCTGGTACATCTTCTGCAATCAGGGAAGTGAGTTTGGCCCTGTCTTCATGACAGCCCCGGCC TTCTTTGCCAAGAGCTCCGCTCTCTACAACCCCCTCATCTACGTGTGCATGAACAAGCAGTTCCGCCACT GCATGATCACCACCCTGTGCTGCGGAAAGAACCCCTTCGAGGAAGAGGAGGGAGCGTCCACGACAGCCTC CAAGACCGAGGCCTCCTCCGTGTCCTCCAGCTCCGTGGCCCCTGCATAAATGGGCTCTCATGGACCCCGC GATCCAGCGTGCACAAAGAAGACTTCTGCTCCCCCGGGAAACGACTGAAGGCTATCGTATACAGAAATAA CTTCCTTTTTGTATTTTTACAAACCAGTTGGTTCAACCTAATGACAGTTGCAGAAGAGGGCAGCCCAAGA AAAAGTTGTTTCTGTATGTACAGAGAGTCCAGTGTAACGATGCATAAGATGTTTTCTTTTCCTGAAATGA AAGCAAAATATCTTTTATCTTTTACAGTTGGAGTCTATATGTTACTGGCTTATTTGTGAATGTAGA


Daniela Ulloa Mota Mat. 163300 Química computacional Grupo F

Arp2/3: >AK418010.1 Riptortus pedestris mRNA for arp2/3, complete cds, sequence id: Rped-1431 CAAGAATGCTTTGGCTGGAAGATAAACATTTCTTATTTGTGAAAGAGTGAGATAGAAGAATTACTGAATA GGTGAAAATATTAGAGAAATTTACCAATGTCGAGGAGTTAATGGTTAGTCAGCTAATATCCGGGCATCGT CTAGCGAAGAGCTGTACTTAGTTCTTATTCCACTCATGCTTCTCAAACGTGTAGTAGAGTAGTTTTCAAA ATGATCTTGCTTGAGATCAACAATAGAATAGTGGAAGACACTCTGACAGTGAAATACAAGAATGCTTTGG CTGGTAATAAACCTGATTCCATTGACATAACAATAGCTGATTTTGATGGAGTTTTATTCCACATATCAAA TGTTGCTGGGGATAAGACAAAAGTTATGATAAGCATTTCTCTCAAATTTTATAAGCAACTACAAGAGCAT GGAGCCGATGAATTGTTGAAAAGGGAGTATGGACCTTTATTAGTTGAGGCTGAGACAGGCTACAATGTTT CATTATTAATAGATCTAGATAATGTGCCATCTGACTGGGAAACTGTTGTTAAGAAAATCGGTCTTTTAAA AAGAAATTGTTTTGCTTCAGTATTTGAAAAGTACTTTGACTTTCAAGAAAAAGGTGATCATAGTGAAGGA CTGAAGCGAGCTGTTATTAATTATAGAAATGAAGAGACTATGTATGCAGAAGCTAAGTCAGATCGAGTTA CTGTTGTGTTCAGTACTATATTCAAGGATGAAGATGATGTTGTTATAGGGAAAGTTTTTATGCAAGAATT CAAGGAAGGAAGGCGAGCTAGTCACACTGCACCTCAAGTATTATTTAGTCACAAAGAGCCTCCATTAGAG CTGAATAACACTGATGCTGTTGTAGGGGATAATATAGGCTATGTGACATTTGTTCTCTTTCCTAGGCATA CCAATAGTGAAGCAAGAGATAATACTATTAATTTGATTCATATGTTCCGAGATTACCTTCATTACCATAT AAAATGTTCCAAAGCTTATATCCATTCGAGAATGCGAGCTAAGACATCAGATTTCTTGAAAGTTCTGAAC AGGGCTCGACCAGAACCAAAGAATGTGGAAAAGAAAACAATCACGGGTAGAACATTTATAAGAAAGGAAC GTTTAGATTGATGGAATTCTGTTACCTTCAGTCTTATGAAGTTGTTGCTGACTGGATGTGTAAAGACTAT TTTAAATCCGGTCTATGTTAAATTTGTAATAATAAA

Myosin: >AB058959.1 Patinopecten yessoensis mRNA for myosin, complete cds GAGCGGCCGCCAGCTGTGATGGATATCTGCAGAATTCGGCTTATGAACATCGATTTTTGGGATCCCGATT TCCAGGATCTTGCGGTAGATCGCAAGAAATTGTTGAAAGAGCAGACGGCTCCATTTGACGGCAAAAAGAA CTGCTGGGTACCCGATACGAAGGAAGGATTCGCAGCCGCAGAAATCCAGTCCTCAAAGGGTGAAGAAATC GCAGTGAAGATCACTTCCGACAATTCTACCAGGACCGTGAAGAAGGATGACATTCAGGAAATGAACCCAC CTAAGTTCGAGAAACTCGAGGATATGGCCAACATGACCTACCTCAACGAAGCCTCGGTATTGCACAACTT GAGTGCCAGATACACCTGTGGTATGATCTACACATACTCTAGACTTTTCTGTATCGCGGTCAACCCCTAC AGACGTCTGCCCATCTACACTGACAGCGTCATCTCTAAGTACAGAGGAAAGAGGAAGACTGAGATCCCTC CCCATCTGTTCTCTGTTGCTGACAATGCCTACCAGAACATGGTAACAGATCGTGAAAACCAGTCCTGTTT GATCACTGGCGAGTCTGGTGCTGGTAAGACTGAAAACACCAAAAAAGTAATCATGTACTTGGCTAAAGTA GCATGTGCCACTAAAAAGAAGACCGACGAAGAGGAAGCTGATAAGAAGAGTAACCTCGAGGATCAAATCA TCGAAGCTAATCCAGTACTGGAGGCTTTTGGTAATGCCAAGACTGTAAGAAATAACAACTCCTCTAGATT CGGTAAATTTATCCGTATTCACTTCGGCCCCACTGGCAAAATCGCCGGAGCTGATATCGAGACATACTTG CTCGAGAAGTCCAGAGTAACATACCAGCAGTCTGCTGAGAGGAACTACCACATTTTTTACCAGATGTGCT CAAACGCCATTCCCGAGCTCAATGAAATAATGCTGCTCACCCCCGATTCCGGTCTCTATTCCTTCATCAA CCAGGGTTGTTTGACTGTTGATAGCATTGTTGACGTAGAGGAGCTCAAACTTTGTGATGAAGCTTTCGAC ATTCTCGGCTTCACAAAGGAAGAGAAGCAGTCTATGTTTAAGTGCACAGCATCCATCTTGCACATGGGTG AAATGAAGTTCAAACAGAGGCCCCGTGAGGAACAGGCTGAATCTGGTGGAACTGCTGAGGCCGAGAAAGT TGCCTTCCTTTGCGGTATCAACGCCGGCGATCTCTTGAAAGCTTTGTTGAAACCTAAAGTAAAGGTCGGC


Daniela Ulloa Mota Mat. 163300 Química computacional Grupo F ACAGAAATGGTCACCAAGGGTCAGACTCTGAACCAGGTCGTCAACTCCGTTGGTGCTTTGGCCAAGTCCC TGTACGATCGTATGTTCAACTGGTTGGTAAAGAGAGTCAACAAAACTCTTGACACCAAGGCCAAGAGAAA CTACTACATCGGTGTACTCGATATCGCTGGTTTCGAAATCTTCGACTACAACAGCTTCGAGCAGTTGTGC TTCAACTACACTAACGAGAGACTGCAACAGTTCCTTCAACACCACATGTTCATCCTTGAACAGGAAGAGT ACAAGAAGGAAGGAATTGTCTGGGAGTTTATTGACTTTGGTATGGATCTGCAGATGTGTATCGACTTGAT CGAGAAGCCTATGGGCATCTTGTCCATCCTTGAGGAAGAGTGCATGTTCCCCAAAGCTGACGACAAATCC CTCCAGGATAAGTTGTACTCGAACCACATGGGCAAGAACCGCATGTTCACAAAGCCCGGCAAGCCTACTA GGCCAAACCAGCGCATGGCTCACTTTGAGCTCCACCATTATGCCGGAAACGTGCCATACAGCATCACTGG ATGGTTGGACAAAAACAGGGATCCCATCAACGAGAACGTTGTCTCCCTCTTGGGTGCATCCAAGGAGCCT CTTGTTGCCGAGCTCTTTAAGGCTGCTCCTGAAGAAGTTGCTGGCGGTGGTAAGAAGAAGAGGGGCAAAT CTGCCGCTTTCCAGACTATCTCTGCTGTCCACAGGGAGTCTCTGAACAAGCTTATGAAAAACTTGTACAG CACCCACCCTCACTTCGTGCGTTGCCTCATTCCCAACGAATTGAAACAGCCAGGTCTTATTGATGCTGAG CTCGTACTTCACCAGCTCCAGTGTAATGGTGTACTTGAAGGAATCCGTATCTGTAGGAAGGGATTCCCCA GCAGATTGATCTATTCTGAGTTCAAACAGAGATACAGTATCCTGGCCCCCAATGCTATCCCTACAGGATT CGTTGATGGCAAGACCGTGTCAGAAAAGATCCTTACCGGTCTTCAGATGGATCCCGCCGAGTACCGTCTT GGTACCACCAAGGTGTTCTTCAAGGCCGGTGTACTGGGTAACCTTGAGGAGATGCGTGACGAACGTTTGT CAAAGATCATCTCCATGTTCCAGGCCCACATCCGTGGTTACCTTATCCGTAAGGCTTACAAAAAGCTCCA GGACCAGATAATTGGTCTATCCGCGATCCAGCGTAACATCAGGAAATGGTTGGTTCTCCGTAACTGGCAA TGGTGGAAACTAGAACGTACCAAGGTCAAGCCTCTTCTCAGCATCGCCCGTCAAGAGGACGAGATGAAGG GACGATTGAGACAGATGGACAAAGTGAAGGTAGATCTTGCCAAGAGCGATCGCATCAAGAAGGAACTTGA GGAGCAAAATGTTACCCTTTTGGAACAGAAGAACGACCTCTTCCTTCAGCTTCAGACCATTGAGGACTCC ATGGGCGATAAGGAGGACCAGGTTGAGAAACTTATCATGCAGAAAGCTGACTTCGAGGCTCAGCTCAAGG AACTCGAGGAACGTCTCTTGGACGAAGAAGAAGCCGCTGCTGATCTTGGGGGCCACAAGAAGAAGATGGA ACAAGACGACCAAAATCTTAAAAAGGATATTGGAGATCTTGAGAACACCCTCCAGAAAGCCGAGCAGGAC AAAGCCCACAAGGACAATCAAATATCTACCCTACAGGGAGAGATGGCCCAGCAAGATGAACAGATCGGCA AACTCAACAAGGAAAGGAAAGCTCCTGAAGAGGCCAACAAGAAGACGGGCGATTCTCTCCAGGCTGAGGA GGACAAGTGCAATCACCTAAACAAATTGAAGGCCAAGCTTGAACAGACCCTTAATGAGCTCGAGGATAAC CTTGAGCGCGAGAAAAAGGTCCGTGGTGGTGTTGAGAAGGCCAAGCGTAAGGTTGAGCAGGACCTTAAGT CCACCCAGGAGACCGTTGAGGATCTTGAACGTGTCAAGAGGGAGCTTGAGGAGAACGTAAGGAGGAAGGA AACTGAGATCACCTCCTTGAGCTCCAAGCTCGAGGACGAACAGAACCTTGTCGGCCAACTCCAGAGAAAG ATCAAGGAACTCCAGGCCAGAATCGAGGAGTTAGAGGAAGAACTTGAAGCCGAAAGGAACGCCAGAGCTA AGGTTGAGAAGCAGCGCGCTGAACTTAACCGTGAGTTGGAAGAGCTCGGCGAGCGTCTTGATGAGGCTGG CGGTGCCACATCTGCCCAGATTGACCTCAACAAAAAGAGGGAGGCTGAACTTCTTAAGATCCGTCGTGAT CTTGAGGAAGCTTCTCTCCAGCACGAGGCTCAAATCTCTGCCCTCCGCAAGAAACACCAGGATGCCGCCA ACGAGATGGCCGACCAGGTTGATCAACTCCAGAAGGTCAAGTCTGAGAAAGAAAAGCAACAGCTGAGAAG CGAAAATGAGGATTTACAAGCTCAAATCCAACACGTTTCTAAGAATAAGGGATGCTCCGAGAAGGTCATG AAGCAGTTTGAATCCCAGGTTGCCGATTTCAACGCCAGACTCGAGGACGGCCAGAGGTCCATCAACGAGC TCCAGAGCCAGAAGAGTCGTCTCCAGGCTGAGAACTCCGATCTCAGCAGCCAGCTCGAGGACGCCGAACA CCGTGTCAGTGTACTTTCTAAGGAAAAGTCTCAGCTCGGCTCTCAGCTTGAGGATGCCCGCCGCAGTCTT GAGGACGAAACCAGGGCCCGATCCAAGCTCCAGAACGAACTCCGCAACATGCATGCCGATATGGATGCTG TTGGTGAACAGCTTGAGGAAGAACAGGAGTCCAAATCTGATGTCCAGCGCCAGCTTTCAAAGGCGAGCAA CGAAATACAACAATGGAGGTCCAAATTCGAGAGCGAGGGTGCTAACCGCACTGAGGAGCTCGAGGACCAG AAGCGCAAGCTTGTGTCTAAACTCACTGAGTCTGAACAGAACATGGAGGCTGCCAACGCCAAATGCAGCG CCTTGGACAAGGCCAAGTCTCGTATGCAACAGGAATTGGAAGATCTCTCCATTGAAGTCGACAGGGCCAA TGCCAACGCCAACCAGATGGAAAAGAAACAGCGTGCCTTCGATAAGACTACCGCTGAATGGCAGGCCAAG GTCAACAGCCTGCAGTCCGAGCTCGAGAACGCCCAGAAGGAATCTCGCGGCTACTCAGCCGAGTTGTACA GGATCAAGGCTAGCATTGAGGAATACCAGGACAGCATTGGCTCACTCAGGAGGGAGAATAAGAACTTGGC TGATGAAATCCACGACCTTACCGACCAGCTCTCCGAGGGAGGCCGATCCACACACGAGCTTGACAAAGCC CGTAGGAGGCTCGAGATGGAAAAAGAGGAACTCCAGGCCGCTCTTGAAGAGGCTGAGGGTGCTCTTGAAC AGGAGGAAGCCAAGGTTATGCGTGCACAGCTTGAAATCGCCACCGTCCGTAATGAAATCGACAAACGCAT CCAGGAGAAGGAAGAGGAATTCGACAACACCCGTCGCAACCACCAACGTGCTCTTGAATCCATGCAAGCC AGTTTGGAGGCAGAGGCTAAGGGCAAAGCTGATGCCATGAGGATCAAGAAGAAGCTTGAACAGGACATCA ATGAGCTCGAGGTTGCTCTCGATGCTTCCAACAGGGGCAAGGCCGAGATGGAGAAGACTGTCAAGAGATA CCAGCAACAGATCAGGGAGATGCAGACATCCATTGAGGAAGAACAGAGACAGCGTGATGAGGCTCGTGAG TCATACACCATGGCTGAGAGAAGATGCACTCTTATGTCTGGTGAGGTCGAGGAGCTTAGATCTGCCTTGG


Daniela Ulloa Mota Mat. 163300 Química computacional Grupo F AACAGGCCGAGAGGGCCCGCAAGGGATCTGACAATGAGCTTGCTGATGCCAACGACCGTGTCAATGAACT CACATCTCAAGTTTCATCTGTCCAGGGCCAGAAGAGAAAACTTGAGGGTGATATCAATGCCATGCAGACC GACCTCGATGAGATGCACGGCGAGTTGAAGGGTGCTGATGAGAGATGCAAGAAGGCTATGGCTGATGCCG CTCGTCTTGCTGATGAGCTCCGCGGCGAACAAGATCACAGCAGCCAGGTGGAAAAAGGACGCAAGAACTT GGAGAGCCAGGTCAAAGAATTCCAGATTCGTTTGGACGAAGCTGAGGCTTCCTCACTCAAGGGAGGTAAG AAGATGATCCAGAAACTGGAATCCAGAGTACATGAGCTTGAGGCTGAACTTGACAACGAACAACGCCGCC ACGCTGAGACCCAGAAGAACATGCGCAAGGCCGACCGCCGTCTCAAAGAATTGGCCTTCCAGGCTGATGA GGACAGGAAGAACCAGGAACGTCTCCAGGAGCTCATTGACAAACTCAACGCTAAAATCAAGACATTCAAG CGCCAGGTCGAGGAGGCTGAAGAGATAGCCGCCATCAATTTGGCCAAATACCGCAAAGCCCAGCATGAGC TTGAGGAGGCTGAAGAACGCGCTGACACCGCCGACTCTACCCTCCAGAAGTTCCGCGCTAAGAGCCGTAG CTCCGTATCTGTCCAGCGATCCAGCGTATCCGTTAGCGCTGCTAGCGCAGTCCATCATCATGTTGAATAA ATACCTCCCCTAGTTCGTACAGTTACCTTTCCCCTAGAACAAGAGGATCCTCGGTGATGAATTCATACCG TTCTGTAACACCGTCCAATGAAGGGGATGATGACGGATATTGACCAATCAAATGACTCCATGTGGATTGT GTTCAGAAGATGCCAGTTTTGCTTTGAATCCAGATAGTAAA Pikachurin: >DQ223720.1 Mus musculus pikachurin mRNA, complete cds CGTGGGTGAGATGGATTTAATCTCAACCTTCTCGCTCCATTTCTTGCTCCTGGCCTGCAGCCTCCCACCC GGCGCTGTGTCACTCCGAACGGCTCTGCGAAAATCAGGCAAGGTGGGACCTCCTCTTGACATCAAGCTGG GAGCCTTGAACTGTACAGCTTTCAGCATCCAGTGGAAAACACCAAAGCGTTCTGGTAGCTCCATCATTGG CTACACAGTGTTTTACTCTGAGGTTGGTTCAGATAAGTCCCTGCGGGAGCGGTCACACAACGTCCCGGTT GGCCAGGATACCCTAATCACTGAGGAAGTGATTGGGGATTTGAAGCCAGGCACTGAATATCAAGTAAGCG TAGCAGCCTACAGTCAGACTGGCAAGGGGAGGCTTAGCTTCCCTCGACATGTGACCACTTTGTCTCAAGA TTCCTGCCTGCCCCCTGCAGCACCCCAACAGCCACATGTCCTTGTGGTTTCCGATTCTGAAGTGGCCCTT TCTTGGAGACCTGGAGAGAATGAAGGAAGTGCCCCAATTCAGTCCTACTCTGTGGAATTCATTAGACCAG ATTTTGACAAGAGCTGGACCATAATCCAAGAGCGCCTGCAGATGGACTCCATGGTTATCAAAGGCCTTGA TCCAGATACCAACTACCAGTTTGCTGTGAAAGCCATGAATGCTCACGGCTTCAGTCCGCGCAGCTGGCCC AGCAACACCGTCCGAACCCTGGGTCCCGGGGAGGCTGGAAGTGGTCATTATGGACCTGGGTATATCACCA ATCCCGGTGTGAGTGAAGATGATGATGGATCTGAAGACGAACTGGACCTGGATGTATCCTTTGAGGAGGT TAAACCACTTCCTGCTACCAAAGTTGGGAATAAGAAGTTCTCAGTGGAGTCCAAGAAGACTTCTGTCTCC AACTCAGTGATGGGCTCCAGACTCGCCCAACCTACCTCAGCCTCTCTCCACGAAACTACAGTGGCCATCC CACCCACACCAGCCCAACGGAAGGGGAAGAACAGTGTGGCCATGATGTCAAGGCTCTTTGACATGTCCTG TGATGAAACTCTCTGTTCAGCTGACAGCTTCTGTGTCAATGACTACGCCTGGGGGGGCTCACGATGCCAT TGCAACCTGGGCAAAGGAGGCGAGGCCTGCTCAGAAGATATCTTTATTCAGTATCCTCAGTTCTTTGGCC ACTCCTACGTAACCTTTGAGCCTCTGAAGAACTCTTATCAGGCATTTCAGGTTACTCTGGAGTTCAGGGC AGAGGCGGAGGATGGCTTGCTGCTCTACTGCGGAGAGAGTGAGCACGGAAGAGGAGACTTCATGTCCCTG GCTCTCATCCGGCGGTCCCTCCACTTCAGGTTTAATTGTGGAACTGGGATTGCCATCATCATAAGTGAGA CCAAAATCAAACTTGGGGCCTGGCATACGGTGACACTGTACAGAGATGGCCTGAATGGGATGCTGCAGTT GAATAATGGCACCCCAGTGACAGGCCAGTCCCAGGGTCAGTACAGTAAAATTACCTTCCGGACACCTCTG TACCTCGGGGGCGCTCCCAGTGCTTACTGGCTGGTCAGAGCAACAGGGACAAACCGTGGCTTCCAAGGCT GTGTGCAGTCACTTTCTGTTAATGGGAAGAAGATTGACATGAGGCCCTGGCCATTAGGAAAAGCCCTCAA TGGAGCTGATGTTGGGGAGTGCAGCAGTGGGATCTGTGACGAAGCCTCCTGCATCCACGGGGGCACCTGC GCAGCCATCAAGGCCGACTCCTACATCTGCCTCTGTCCCCTTGGGTTCAGAGGTCGACACTGTGAAGATG CTTTTGCCCTGACCATCCCTCAGTTCAGAGAGTCGCTGAGGTCCTATGCTGCCACACCCTGGCCCCTGGA GCCTCAGCATTATCTTTCTTTCACCGAGTTCGAGATCACCTTTCGGCCAGACTCGGGGGATGGTGTCCTT TTGTACAGCTACGACACGGGCAGCAAGGACTTCCTCTCCATCAATATGGCTGCGGGCCACGTGGAATTCC GCTTCGACTGTGGTTCTGGGACGGGAGTTCTCAGGAGTGAGGCTCCCCTCACCCTAGGCCAATGGCATGA CCTACGTGTGTCTCGCACAGCGAAGAATGGGATCTTACAGGTGGACAAGCAGAAGGTGGTAGAGGGAATG GCAGAGGGAGGCTTCACCCAGATTAAGTGTAATACGGACATTTTTATTGGTGGAGTCCCAAATTACGATG ATGTCAAGAAGAACTCGGGGATCCTCCATCCATTTAGTGGGAGCATTCAGAAGATCATCCTCAACGACCG GACCATCCATGTGAAGCATGACTTTACATCGGGCGTGAATGTGGAGAACGCAGCCCACCCCTGTGTAGGG GCCCCCTGTGCCCATGGGGGCAGCTGTCGGCCCAGGAAGGAGGGTTATGAGTGCGACTGTCCCTTGGGCT TCGAAGGCCTGAACTGCCAGAAAGAGTGTGGGAACCACTGCCTCAATACTATTATAGAAGCCATCGAGAT


Daniela Ulloa Mota Mat. 163300 Química computacional Grupo F CCCACAGTTCATCGGCCGCAGCTACCTGACGTATGACAACCCAAATATCCTCAAGAGGGTGTCTGGATCG AGGTCAAATGCGTTCATGAGGTTTAAGACAACCGCCAAGGATGGCCTGTTGCTGTGGAGGGGGGACAGCC CCATGAGACCTAACAGTGACTTCATTTCCCTGGGTCTTCGGGATGGAGCCCTGATATTCAGCTACAACCT GGGCAGTGGCGTGGCTTCCATCATGGTGAACGGTTCCTTCAGCGATGGCCGGTGGCACCGAGTCAAGGCT GTCAGGGATGGCCAGTCCGGGAAGATTACAGTGGATGACTACGGAGCCAGAACAGGCAAGTCACCGGGCT TGATGCGGCAGCTTAACATCAACGGTGCTCTGTACGTGGGTGGAATGAAGGAAATCGCTCTGCACACGAA CAGACAATACCTGCGAGGCCTTGTGGGCTGCATCTCCCATTTCACACTGTCCACCGATTACCACATTTCC CTCGTGGAAGACGCCGTGGATGGGAAGAACATCAACACTTGTGGGGCTAAGTAACACCAGCTGACCTTGC CCAAGGGACATAGCCTCTATCCTGCAATCACAGAGGCCCGGAGACCCTGCCTGATGCTGCACTCAGAGGT CTTGAAATCAGGTGTGTTTACTTTCTCTGAGGAGGACAAAGTACACCCTGGTGAGAGCCAAGACTGAAGG CCCTGGGTGGCCTTCTCTGCTAACGCCCTGTGAACCGAACCCAATGGACTACTGTGGTTAGGAAGCATTG GACTTTGTTGTTCAACGTATAGAGTCTGAGAGAGATGATACGTCAGTGCAAGCTCTGGGAACTCTCTGCT GTAGCTCAATGGCTCTGTTGTGTTAACAAGAGTGAGAGCCAGACTGGATGAGAAAGAGTGAAAGAGCAAG AGAGAGAGAGAGACAAGACAGAGAGACAGAGAGACAGAGAGACCACCCCTCCAAATAGTATTAAAATATT TCTGCTCTTCCCTGACTTATGACACTAGCAGGAAGACTGGGCAACCCTGAACTTCATACTTCCAATCTCG GTCTATGGATTGTGTAGATTAACCCCTTCCATGCCCTGCTGGCTGACTCAATGTGCTCTGACTAGTCCAT GGAAATAAATGTTGGGGGTAAATTAAACATAGAATAATAATCAGACTGTGGCATCCTTCCCCCAAGCTTT CCTCTAATGCAAATATTCTCTCTTTTTTTAATGATGCAGATCGAAGAAAGCGGGCCCCCTGATTTTGTAG CTGTACTTTTTGTATGTGACTATTTTTTATAGCTGCAGTCTGTCCACACCCATGGTGTGCTTTTTGAAAG TTAGTGGTTGATCCTAATTACGAAACACCTTCCTAATAGCTTTCTCACAATGGAGATGTGATCAGGCCAT TTGTAGTGTCAGGGGAGCGGTAGCAAGTGACTAGGGTGGGCCATTGGGAGAAGGGACCATTCTCTTTTAG TATATGCTGACGGTTCAAGTGGATGAATATGATGCTGTCCAAAAGTGGAGAGATTAAAAGGAATGTATCA CCGAGGTGGGTCATTACCGTTGTTATTTTAAGAGAGGGAAAGTGTGTAATAAATATGAATAAGGGAAAAA AAAA Tropomyosin: >NM_169638.4 Drosophila melanogaster tropomyosin 1, transcript variant E (Tm1), mRNA TCAGTTGAACATCACAATCCGTTCAAGTCGCGGATAACTCCGAATAAAAGTTTTTTTCTTTCGAGTGCAG AGTAGCAAAACAAAACAGACATGGATGCCATCAAGAAGAAGATGCAAGCGATGAAAGTCGACAAGGACGG AGCTCTGGAGCGCGCTCTCGTCTGCGAGCAGGAGGCACGCGATGCTAACACCCGCGCCGAGAAGGCCGAG GAGGAGGCTCGCCAGCTGCAGAAGAAGATCCAGACCGTTGAGAACGAGCTGGATCAGACCCAGGAAGCCC TGACCCTGGTCACCGGCAAGCTGGAGGAGAAGAACAAGGCTCTGCAGAACGAAAGTATTTCAAGGACATT TGGCATCGTTTCAAAAAGATCTCAGCAGGTAAAGCGCTTGGAAAATTTATCGCTGGGAGTGGATCCACAA GAAAAAACACAAGTGCAGCCGCAGTCGGGCAAAACAGTTGCCAAACCGAAACAGAGGCAGCAGAAACAAT TGTTCAAAAGTGATAAGGCGAAGGAGAAGTCCAGCAGGCAGCAGAGAAAGCGAGCCGGCACCAGGAGCAC TCGCAATCCGAGGACGCAATCGGAATCTTCGGGCCTGTCATCCCGTTGGTGTTCCATCGAAGAGCAGTTG AACCTGCTGGACGACCTGCTCTACTACTGCGATGAGGAGGCCGAACTGTATCTAGCCCAGCTGTACGAAA GGTTCGAGACACTCCGGCGTAGCAGGAGTTCCTCGCCAGTGAGCGATTTCTGGAGCGATTCCGACATGGA GCACGATGACTCCAGCACCAGTGGCACTGGCAGCCATACAGCCAGCAATACCAGTCTAGTTCCCGCCTCG CTGAAGCGTCGTGGCCACCAGCATCATCCGCGATTCTCGGGCACTCGCCGTCCCAATGTGCCCAATGTCC AGGAGATTCTGGCCGCACTCTATCGTGGCGACTCAAAGAGCGCCCTGTCCAATCTGAGAGGAGAGACGCA ACCGGAGGAGGAGCAACCACAGCAGCAGACGGAGGAGGTGCTGCCACCCAGCAGAAGCACTTTAAGCCTG CCCCTCAGTGAATCGGTGACCAATTCCCTGGGCAGCAACAGTCCCACGCCCACAGACGAAAGCAGCGTGC AAGATGAGGGGGCCAGTAATCCGGCAGCAGCTTTAATAGCTGAGGATGCAGCCCCACCAGCAGGCACAAC CACGTCCAAGAGCAAGAAAAAGAAGCGGGAGAAGGGTGAAAGGTCAGAGAAATCGGACAAATCTGAGAAA TCCGACCGGAAGAAGAAATCTTCAGGCAAGAAGGAACGCAGCAAACGATCCAATCCCATGGAGCAAAGCA GCGACAGCCTGGCCACCGATCTCAGTGCCGGGGCCATCGATGAGGGCATCGCACTGGCCGACGACGATGA CAACCAAGCGGCGGAATGGTCCAAGTTGCGATGCACCAGCGAGGCGGCCGAGATTGTGGCGGAGCGGGAG GCTCGACGGAACAAGGGACGTTGTGCGGATTATCCGGGACTCGCCTTTGGCAGATCCATCTTCAGTTCGG ACACCATGATGAAGTTCAACATCATCCGCAACGAGCTGCACAACATCATGAACACACAACTCAAACGGGC CGAATCCGAGGTTGCCGCTCTGAACCGTCGCATCCAGTTGCTCGAAGAAGACTTGGAGCGCTCTGAGGAG CGTCTGGGCTCCGCCACAGCCAAGCTGTCGGAAGCCTCTCAGGCCGCCGATGAGAGCGAACGTGCTCGCA


Daniela Ulloa Mota Mat. 163300 Química computacional Grupo F AAATTCTTGAGAACCGCGCCCTTGCCGATGAAGAACGCATGGACGCTCTCGAGAATCAGCTGAAGGAAGC GCGTTTCCTTGCTGAGGAGGCTGACAAGAAATACGATGAGGTTGCCCGTAAATTGGCCATGGTTGAAGCC GATTTGGAACGTGCCGAAGAGCGTGCCGAGCAGGGTGAAAACAAAATTGTGGAGCTTGAGGAGGAGCTGC GCGTGGTTGGCAACAACCTGAAGTCCCTGGAAGTCTCTGAGGAGAAGGCCAACCAACGTGAGGAGGAGTA CAAGAACCAGATCAAGACCCTCAACACCCGTCTAAAGGAGGCTGAGGCTCGTGCTGAGTTCGCTGAACGC TCCGTTCAGAAATTGCAGAAGGAAGTCGACAGGCTCGAAGACGACCTCGTCCTGGAGAAGGAGCGCTACA AGGACATCGGAGACGATCTCGACACCGCCTTCGTCGAGCTCATCCTCAAGGAATAAGCGACAACCCGACC TTGACGGACCCTCGCACCCAGACCAAAATCGATCCGCACAGCTATATTTTTGGGCGGCACACCTTTCGAT TGTTTGTTACTGTAGTCGCATAATCGTAGGCCCACTGTACTTGTATCTAGTAGCCTGCACTTTTGATTTG TGTGTTCGTAGATGGATAGTTTGTAGATTGATTTTGATCGCGGACCAATTAGAGGGAAGCATCGATGTAA TTGTGTATTTGTTTGACTCAAACGTTTTTTATTTATTATTTGTATCCAAACTAAGCAATAAAGCAATCAA CTTAAAAACAT

CFTR: >X95927.1 R.norvegicus CFTR gene GGGAGGCAAGAATCAGGCCTCAAAACCCTCAAACTCTAACCTTGGAACAAACAGCCCTAGTGGGATAGCC CTATCAAACCCTTCCCTTCAGGGATTAGGAACCCCGCAGTGAGGGCAGAAAAGGATAGACCAGAGAAGGT AGAAAACCATGCAAACAAGGCCCTCTGAGTCAACATGCCCAAGGTCATGTGAACTCACAGACACTGAGGA AACTAGCATGGGGCCGTTGAGGGATTGCACCAGATACTATGTATGTATATCATGGCTTCTAGTTCAGTGT ATTTGTGGGATTCCTGAATGTTTGAACAAGTTGGTCTCTGTTTCTTATGCCCTTTATTGGGCCCCTTTCT GTTTGTTTTGTCTAAGTCTAATACGTTTTCTTAACCTTATTTATTTTATTATTGTCCTTTAAAAGCCTGT TTGTTTCCTAATGATGGACAGAAAGGGAATGATCCAGATGAAACTGGAGGAGGGAAGGAACTGGGAGGGG TAGAGGGAGGAAAAACAGTAATCAGGATATAGTGTGTGAGAAAAAAATTGTTTTCTTTTTGTGTTTGTTT GGTTTTGGTTTTTCAAGACAGAGTTTCTCTGTGTAGCCATGGCTGTCCTGGAATTTGCTCTGTAGACCAT ACTGGCCTTGAACTCAGAGATCTTCTGCTTGCCTATGACTCCTGAGTGCTGAATTCTGGGGTTAAAGATG TGTGCTGCCTCAGCCTGCATAAAAAGAACGTTCGATTTTCAATGAAAGGAAAAAAAACCTCTATTTACAC TTGCTTTGGCACAGCAGGGTTTAGTTATTTAAGTATTGTCTCTTTATAGCCCAGCAGGGTTTTGTGTTAG ACACACATTTCTCACACCAAAAGCTGGGAAGGAAGGCCCACAGCCTGGGGAACTTTCTCTCAGAGAACTT GAGGTGAATAGGACACCTTTGCTTCAGTGACTCAGAGTCCCTTTCAGTGTCTTAGTCAAGATATTTTGCT TAACAAAACTAGGGGGAAATGAGAGGAGGGTCATTTAGTTTAGACTCCTCTTGTCATTCTCTAGCACACA CATAAAAGCCTTCTGAAGGTGAAATACCACACCACACTGAGCAGGTCCTGAGTGAGAAGTGGTAAAGGAG TAGCTCCCTTTGTCCTTGAGGACTTTGATATGTCAAGTTATGACATATCAGGGCATTGTGACATATATGT ATGATACACATGTAGCTCATACGGGAAAGTAGTGGCTTCCCTTTCCTTGGTAGGACTTTTGCTGTAATTG TGACATATCAGGGAATTGTGACATATGTGCGTGTCACCTCATAGGTGTTTGTGCCACTTTGTCTACTCTG GAGCCTTCAGTCAACAGAGCTTAGGTCTCGTCCAGCTCTTGAAGGGCTTACTGAGGTGGAACTTTGCAGC TTCTTGAGTGCTCTTTGATACCAAAGAGCCACATTTTCCTCTCCTTTCCAAAATGGATCTGGAAAAGTTA ACTGGAGGAGGAGGGGGAAGAAAGGAGGAAGAAAGAGAAGAAAAAGGAGAGCAAAGTGAAGGGAAAGATT CAGTTGGAGAAGGAAGAGAAAGAGAGGAAGGGGGAGAAAGAGAGGAGGGAGGAGAAAGAGAGGAAGGCAG GGGAGCAGTGGGAAGAGAAGAGGGAGGAAGAGGACAAAGAGATCAAGGAGGACAAAGAGAAGGAGAGAGA GAAAGAGATAGAGAAAAAAGTGAAGGAGGAGAAAGAGGAGGAGAGGGGAAGGAGGAGAAGGAGGGAGAGG AGAGAGAGGGACAAGGAGAAGGAAGAGAAAGGTTCCGGGAAGCTAAGGGAATCAGTGACTGGTCTTTATT CCTAAGTAAGAAGGATTCTAAGTCCCGCAGATTGGCCATGGTTTACCCGGGCCCGCTGTCTGAGCCACTG CTGGGGCCACCATGTGAAGGTAGGCACGAGGGGGCGCTGGAGGGCGGGCGCGGATAATAAAGGCCAAGGT AAAGGAGGCGCGGGCCAGGAGGCGCGGGCGCGCTGGAGGAAGGAGCGCTGGCCCGGGGCGGACGCGGGGC GTGGAGAGCAGTGACTGTGAGGCTGGGCTAGGCAGTGCTGACTTTAACCTGGGCTGCGGAGGCGGGGGAA GAAGGCTAAGGAAGGGGAGGTGTGTGGGACCGGAGTGGGTGGGGGGAATTGGAAGCAAATGACATCACCT CAGGACTGAGTAAAAGGGAAGAGCCAAAAGCATTGAACGGGTCCTGGATATCCAGAAGTCGAGTCCAACC TGAACCTGTCCGGACACAGACCTTAGTGCACCACGGAGACATCATGCAGAAGTCGCCTCTGGAGAAAGCC AGCTTTATCTCCAAACTCTTCTTCAGGTGAGAGGGTGCCCAGAGGATCTTTCAGGGACACGTGTGCCCAT GCCAGAGAAGGGAATAAATACGGGCAGACTTTGGGAAAACAGGAAGAGATTTTTGTTGAGTTTTGTTTTG CTTTAAAGGTGTGTTGTCATTCATTGCTTTAAAGGAACTATGTATTTTGTAGAATGAAATAAAACTGATG GAACAGAGAACAAATATATATTTGCACCTGGAATCAGACTTGCAACAGCCAAATATGCAACAGAGCAATA


Daniela Ulloa Mota Mat. 163300 Química computacional Grupo F GATTTTTTTAAATTTCCTGAAAACAGTTATACATCATAAATGTACTTAATAAAACATTAAGATTGGTCCA TTGTTTTCTCCCAGAAAAGTTTGTCTGCAGGTGGCGCGCCTGTATATAATAGGTGTTTGGAAAACGTTTA TTGACTCAGGTTTTTAAAAATCAAGGAATTATACTTACTTTTGCTGTTATAATATTGAGTAAGACTAACA TGCTTAGTACAGTTACAGTATTCTTCTTTAAGAATGAGCAAGTCAGTTAAAATACCTAACTTTAGAAAGA AATACTGTAAGCAATGCATTTGAAAATTCAGTTACTCTGGGGATATGAGACTAGGGTTCTAGCCACTGAC GCTATATTCAATTGATACTTAGGAGATTGTTCTCTTATCCTACCAAAAAAAATTAGAATCGAAGTTGGAA GACCTAGGCAAGTATTAAGCACTTTGTATATGAGGTACTCTGTGGAGCTTCTTGTACTCAGTCATGTAGT GTGAATGAATGAAGAGAACAGCTCTCTCATGGGTCCTTAGCTGGCTCAACCCCACCCCCAGTGAATCAGC ACACTAAAGTATCATAAATGTGGAATATGTTCTAAATGTGCCCTGTGGTGTGGGTACGAGGCAAGGCTCA GCCTTCAGTCCTTTTTCTGCAGGTCTAGAGCTCAGGACTGAGGGGAGGCAAGTGCTTCTACAGGAGAGCT CCTCCCAGTGGATGGGAGAGAAGGTCCCTCTTTACTCTTTAGAGTGGATATTTGTAGTGCCTTTTCTTAC TTCGTCTATAAATTTAGCTTATCAGCCTGGATCTAATTTCTTACTACTTACAATATCAGATTGTCAATTG ACATAAACTTTAGACTTTCACCAGAGCTTATTGAGGAACTTAAATGTCAATCTGCCTGAAAAGGCAAGTT TTCTGAAGAATGAATATCTCTTGTGTGTTTCCCCCACTAAGTATTAAGAAACTTCAAAATTTTTCACTTA TCAAAGTGTTTCAAAAATTTCCCGTTTTTATAATGCAGCCNAATACATTTTAGTGTGNTTTACAAATGTT CTTAGGCAGATTTGGAAAGGAAATGTATTATAATGGCTGTGAAATTTGTTAAGAACATACTCATTTCTGT TCTCNAAATGATTTCATAATCAGTTGCTTTAAGAATAGGTGTGTTTTTAAGAGTTTAGTTCCTCCTATTT ATAGGAGCTGACATTTAGCTAAGTACCAGTCAGTGATTATAAACTTCTTCTGGACTATACTTTTCAAAGG GTGAAAACCTTTTCTCCACTGGATTAGGCAGTGTGCTTAGTGTCCAGGGCAGTGGGCTCTGGAAACTTTG CATTTTCATATAGCTTTAAGAAAAAGATCATGCCTGTTGTGTATCTGTTAGCATATGCATGTGTGCGTAC ACACATGAACATGCACATGCACATGCACATGCTTGCTTTTATGCCCACAGAGTGCAGTATAAGATATCCT CAGAAGAGCCATCATCTCTTTGAGACATGTCTCTCATTGGCCTGAATTTCACCAGTTGTTAGACAAACTT GTCAGCGAACCCAAGGAGTGTTACTGTCTTTGCCTTGGCAGCAATGAGATTGTAATCATGTGTCGTCACC TTGCCCACCTTCTCATATGTGTGCTTGGGATTGAACTCAGCTTTTCATACTTGGGAAGCATGTTACTTTA CTGACTGAGCTATAAACAGTTTCAACAAGTTAGGTACGAACATTTCCATTCTCTTTCTGATCCATGCACA GACACTATCTTACGTTTGCTAAGACTTAGGTTATCCAAATCCAAAGGCCACTTTTGATATACTGAGGATA TGGTATTTAGAAAACTCAGGATAGCTGTCCGTTTAGTTGATGGATGCCATCCAGTGGCTACAGCTCCAGA GTTCCATGCTATCATTTGGCTTTTCTTTGATAGAATTGGAAGAATCCACATCTAGGATGGAGACCCTCTG TTTCGNCAGTGGGCAAGCACTGCCCAATGTTAGCTCTGTACCAGTCCCTTAGGACTCCTGTTTATTTTTC ACTGATCATGTTTGAATATTACAAAGCTTAGAATTTTCAACTTGGGATTTATGTTAGGTTTTTGTTAATT TTGTTTAGTTTAATGCACAGTTCTAAGAGTACCACTTGTACACAACATGATGAAATTGTCATTTTGTGAT GTAGTATATATGGGTGTGTATGTGTAA

Definiciones: NCBI: Ciencia Nacional para la Información Biotecnológica, forma parte de la biblioteca nacional de medicina, con la función de ser una fuente de información biológica molecular. Almacena una gran cantidad de secuencias genómicas y artículos científicos relacionados con la biología y genética. Dogma central biología molecular: Se refiere a los 3 procesos que llevan a cabo los ácidos nucleicos (ADN o ARN) conocidos como: Replicación, transcripción y traducción. Gen: segmento corto del ADN. Nucleótido: Moléculas de los cuales se construyen los ácidos nucleicos, constituida por una base nitrogenada, un azúcar y ácido fosfórico.

Actividad 4  
Actividad 4  
Advertisement