Page 1

CURSO BÁSICO DE CIENCIAS NATURALES Programa de Fortalecimiento de los Estándares Básicos en Ciencias, Imagen, Matemáticas, Sociales y Lectoescritura de Bachilleres de Colegios Distritales Decanatura Facultad de Ingeniería José Ismael Peña Reyes Director del Proyecto Hernán Gustavo Cortés Mora Coordinador General Material preparado por: Coordinador académico y del área de Ciencias Carlos E. Daza Medina Tutores Adriana Alméciga Gómez Amalia Sarmiento Ana Lucia Caro Cindy Becerra Quintero Dairo Alvarado Juan Fernando Najar Ruíz Juan Nicolás Tarquino Chia Leidy Johana Ruíz Moreno Lynda Stefanny León Torres Nelson Enrique Leal Nidya Janeth Botia Mancilla Rodrigo Gonzáles Florián Yaneth Rodríguez Pérez Yessica Arango Angarita

UNIVERSIDAD NACIONAL DE COLOMBIA FACULTAD DE INGENIERIA Bogotá D.C. 2015

1


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

2015

PRESENTACIÓN El programa, en el área de Ciencias Naturales, pretende aportar mayor eficacia en el proceso de enseñanza –aprendizaje, con el fin de impulsar la motivación por parte de los estudiantes, quienes harán conciencia de la importancia de ser sujetos activos en su proceso de formación, para lo cual se busca poder brindar una variada oferta de actividades y materiales que fomenten su autoevaluación en forma permanente y les ayuden en el refuerzo y desarrollo de competencias básicas Para el desarrollo en Ciencias Naturales, se emprenderá el estudio de dos disciplinas del conocimiento: la biología y la química. La primera, es una ciencia natural que se dedica a estudiar las propiedades y las características de los organismos vivos, partiendo de la unidad de todo ser vivo, la célula. La química, por el contrario, es la ciencia que se dedica al estudio de la estructura, las propiedades, la composición y las transformaciones de la materia. Desde este contexto, las Ciencias Naturales generan conocimiento útil para la comprensión de los procesos, funciones e interacciones de los seres vivos. Su importancia radica en que constituyen un conjunto de saberes que se encargan del estudio de fenómenos naturales relacionados con los procesos vitales, físicos y químicos. Para tal efecto, se proponen temas en torno a conceptos fundamentales tales como: materia, átomo, moléculas, energía, enlaces, vida, evolución, célula, organismos, metabolismo, tejido, órgano, sistema, funciones, disfunciones y ecosistema, entre otros muchos. Lo anterior, permite comprender desde la Biología, que los organismos vivos se organizan jerárquicamente; donde la unidad básica es la célula, la cual se asocia con otras semejantes para formar los tejidos, los cuales a su vez constituyen los órganos y estos últimos forman los sistemas tanto animales como vegetales. Considera de igual forma, los seres vivos como unidades en armonía e interrelación con el medio ambiente y los ecosistemas que los rodean. Proporciona adicionalmente, los fundamentos para el conocimiento de los microorganismos causantes de enfermedades en el ser humano y las bases para su prevención. Además revisa contenidos relacionados con principios químicos, biológicos, embriológicos, genéticos, histológicos, anatómicos, bioquímicos, fisiológicos, patológicos y microbiológicos. Desde el marco de la Química, nos enseña qué es la materia en cuanto a su composición, tipos, propiedades y transformaciones. Pero lo que distingue a esta ciencia de otras disciplinas que también se ocupan del estudio de la materia, es que relaciona todo esto con su microestructura; es decir, con el mundo de las partículas que la constituyen. Para esto la química tiene dos grandes ramas como son la Química Orgánica y la Química Inorgánica. Esta última, se encarga del estudio de la estructura, formación, composición y reacciones químicas de los elementos y compuestos inorgánicos, es decir, los que no poseen enlaces carbono-hidrógeno. En cambio, la Química orgánica es la rama que se ocupa del estudio del carbono, en cuanto a su estructura, los compuestos que forma, sus propiedades y reacciones. Los seres vivos estamos formados por moléculas orgánicas, como proteínas, ácidos nucleicos, azúcares y grasas. Todos ellos son compuestos cuya base principal es el carbono. Los productos orgánicos están presentes en todos los aspectos de nuestra vida: la ropa que vestimos, los jabones, champús, desodorantes, medicinas, perfumes, utensilios de cocina, la comida, etc. 3


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

1. OBJETIVO GENERAL Reforzar las competencias académicas propias de las Ciencias Naturales en los campos disciplinares de la Biología y la Química de dos mil (2000) bachilleres de colegios distritales y de estudiantes de la localidad Sumapaz, mediante un dinámico proceso de formación, con el propósito de apoyarlos en una preparación estratégica para lograr el ingreso a la educación superior (técnica, tecnológica, profesional).

2. OBJETIVO ESTRATÉGICO Implementar un programa de Ciencias Naturales centrado en la Autonomía para Aprender y en el Aprendizaje Significativo, garantizando que los estudiantes logren la construcción del conocimiento en el mundo natural desde sus conceptos, principios, hechos, generalizaciones y teorías; la comprensión y el análisis de los diferentes fenómenos biológicos y químicos del entorno; generen actitudes y hábitos positivos hacia la formación de una conciencia reflexiva frente al valor y la conservación de los recursos del ambiente y cultiven el uso del conocimiento y la transferencia a los entornos de convivencia de la familia y la comunidad.

3. OBJETIVOS ESPECÍFICOS Área de Bilogía          

Reintroducir a los estudiantes en los elementos básicos del estudio de la biología, partiendo de lo sencillo a lo complejo Reforzar los elementos que componen los organismos Potenciar las habilidades y capacidades de los estudiantes en las ciencias biológicas Revisar los conceptos fundamentales de las ciencias biologías Analizar las funciones de los elementos que componen los organismos vivos en un contexto sistémico Comprender la trama de organización de los seres vivos como organismos Proporcionar herramientas de análisis que permitan comprender los mecanismos que rigen los fenómenos y procesos biológicos Comprender los fenómenos naturales relacionados con los procesos vitales Formular modelos biológicos que permitan abstraer e interpretar la realidad Contribuir en la construcción de una conciencia ambiental que los conduzca a tomar parte activa y responsable dirigida a la conservación de la salud y la vida en el planeta

Área de Química       4

Interpretar conceptos elementales de la química para lograr un aprendizaje con significado en contexto Comprender el lenguaje básico de la química en cuanto al reconocimiento de sustancias y la interpretación de los cambios químicos Manejar la tabla periódica como una organización de la información química Resolver problemas cualitativos y cuantitativos que involucren cambios químicos Cuantificar el concepto de mol en cantidades de diversas sustancias y partículas Calcular cantidades de reactivos y productos en los diversos estados de la materia para un cambio químico


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

      

2015

Aplicar relaciones matemáticas para cuantificar los gases en los cambios químicos y físicos Conocer el proceso de formación de una disolución y cuantificar sus unidades de concentración Comprender y aplicar correctamente los principales conceptos de la química orgánica, así como sus leyes, teorías y modelos Explicar las diferentes temáticas relacionadas con la química del carbono Comprender y valorar los aportes y las interacciones de la química y la sociedad Relacionar los contenidos de la Química con otras áreas científicas como son: La Biología, la Geología, las Ciencias de la Tierra y medio ambiente, etc. Valorar el papel de la ciencia y la tecnología en la calidad de vida

4. UNIDADES DE APRENDIZAJE

UNIDAD DE APRENDIZAJE No 1 INTRODUCCIÓN AL UNIVERSO DE LA BIOLOGÍA CONCEPTOS DE ESTUDIO    

Ser vivo: Organización Interna y externa – Generalidades Taxonomía: Generalidades: reinos (VIRTUAL) La célula: Teoría celular – Postulados clasificación: Procariota y eucariota, Morfología estructura celular: Membrana celular, citoplasma, núcleo, organelos Célula vegetal y animal. Clasificación de las membranas según permeabilidad Ósmosis y difusión

RECURSOS: Pelota, papel periódico (pliegos), marcadores (7), pelota (saco, borrador o cualquier objeto que pueda ser lanzado entre los participantes sin causar daño), textos de biología, 2 vasos desechables, navaja o cuchillo, bolsa plástica (aseo), una zanahoria, palillos, azúcar, fresco en polvo, agua ACTIVIDADES DE INICIO Objetivos:  

Establecer un adecuado ambiente de aprendizaje mediante una sencilla dinámica Construir y acordar las normas o reglas de trabajo para llevar el curso a feliz termino

Dinámica: La pelota preguntona

5


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

1. El mediador (profesor) invita a los presentes a sentarse en círculo entrega una pelota al grupo y explica la forma de realizar el ejercicio:  Mientras se entona una canción se hace correr la pelota de mano en mano; a una seña del animador, se detiene la pelota.  La persona que en ese momento tiene la pelota en la mano se presenta al grupo: dice su nombre, que le gusta hacer en los ratos libres y manifiesta su expectativa frente a lo que espera aprender en Ciencias Naturales.  El ejercicio continúa de la misma manera hasta que se presenta la mayoría. En caso de quedar una misma persona más de una vez con la pelota, el grupo tiene derecho a hacerle una pregunta cada vez que esto ocurra. 2. Reglas de trabajo: En pequeño grupo (5 integrantes) establecer normas convivenciales, actitudinales e intelectuales. Nombrar un relator que recoja todas las normas enunciadas. A continuación cada pequeño grupo en forma clara y sencilla presenta a todo el grupo las normas que se plantearon. Para terminar el mediador genera una plenaria donde se acuerden las normas para el buen trabajo del curso. ACTIVIDADES DE DESARROLLO Actividad No 1 Objetivo: Realizar un recuento de los contenidos con ayuda de organizadores gráficos

Aprendizaje independiente: Mediante un esquema, gráfico o un dibujo establezca la relación entre los siguientes términos:

Aprendizaje en pequeño grupo: Formemos pequeños grupos de 5 personas con el fin de analizar los gráficos elaborados por cada uno de los integrantes del grupo. Aprendizaje en plenaria: Cada pequeño grupo presentará a la plenaria el trabajo realizado. El mediador hará una síntesis del tema a partir de los esquemas mostrados. Para cerrar este tema el mediador solicita a cada participante hacer en forma independiente, como ejercicio de evaluación, la clasificación de los siguientes términos. Tener en cuenta la organización interna y externa de los seres vivos. En una hoja diseñe un cuadro para esta tarea. Los términos son: planta de rosa, caballo, peces de la laguna de Tota, páramo de Sumapaz, flora y fauna del bosque tropical del Choco, estómago, neurona, conjunto de huesos del cuerpo humano, sangre, hígado, tráquea, Laguna de Fuquene, manada de leones, seres vivos que habitan en el desierto de La Tatacoa, mioblasto. A continuación se hará la puesta en común sobre la actividad realizada Actividad No 2 Objetivo: Elaborar un mapa conceptual como herramienta de organización

Aprendizaje independiente: Realice la lectura de la siguiente información con el fin de realizar su trabajo. 6


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

2015

Los mapas conceptuales fueron ideados por Joseph Novak. Son la representación gráfica y esquematizada de una serie de conceptos que tienen una relación entre si y que son jerarquizados para una mejor comprensión de los temas. Esta jerarquización se hace partiendo del término más general (más incluyente) al más particular. Para elaborarlo es necesario identificar y seleccionar los conceptos clave de un párrafo, determinar el concepto más general de tal forma que al definirlo incluya a los demás conceptos. Ordenarlos en una lista empezando por el más general, establecer las relaciones entre estos haciendo uso de algunas palabras (conectores) que muestren mejor su relación. Unir con líneas los conceptos según esta relación colocándolos como se observa en el gráfico.

Tomado de pasos para elaborar un mapa conceptual según Joseph Novak Ejemplo: La familia Restrepo vive en Ocaña, está formada por los padres María y Pedro y cuatro hijos, dos hombres y dos mujeres. Beatriz, una de las hijas se casó y los convirtió en abuelos de dos preciosos nietos, Juan y Carlos quienes a su vez formaron su hogar y ampliaron la familia cada uno con una hija de tal manera que ahora tienen dos biznietas. Por lo tanto, los hijos hombres de María y Pedro se convirtieron en tíos y la otra hija en tía. Con ayuda de la información anterior realiza el mapa conceptual correspondiente a la familia Restrepo. Aprendizaje en pequeño grupo: Revisemos el mapa conceptual elaborado por cada integrante del grupo, aclaremos las posibles dudas con el mediador. Aprendizaje por parejas: Con base en la información anterior y con el apoyo de los textos de consulta estructuren el mapa conceptual correspondiente a la célula teniendo en cuenta: los postulados de la teoría celular, partes de la célula y su función, clasificación, diferencias entre célula vegetal y animal. Aprendizaje en pequeño grupo: Comparen y analicen los mapas elaborados por cada pareja del grupo con el fin de generar uno sólo el cual será presentado en plenaria. Aprendizaje en plenaria: Cada pequeño grupo presentará a la plenaria su trabajo. El mediador hará una síntesis del tema a partir de los mapas presentados por los grupos. Actividad No 3 Objetivo: Estructurar un cuadro sinóptico como otra herramienta de organización. Aprendizaje independiente: Revise la información que encuentra a continuación con el fin de usarla para llevar a cabo el trabajo Los cuadros sinópticos son organizadores gráficos que presentan una caracterización de temas y subtemas y sus variadas relaciones en una estructura general coherente, 7


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

organizando en forma jerárquica la información en un diagrama por medio de un sistema de llaves o de tablas. Existen dos formas de realizarlos. La más usada es por medio de llaves, donde se muestra la información de lo general a lo particular, manteniendo una jerarquía, de izquierda a derecha. También es posible hacerlo mediante tablas. Como ejemplo:

Tomado de http://www.ulibertadores.edu.co:8089/virtual/Herramientas/cuadros_sinopticos.htm Con base en la información anterior, el apoyo de los textos de consulta y la siguiente lectura estructure un cuadro sinóptico. APRENDAMOS SOBRE LA CÉLULA Si la célula no tuviera una barrera que regulara la entrada y salida de materiales, quedaría muy expuesta a los cambios del medio, por más pequeños que éstos sean. Sin embargo, limitando el protoplasma se encuentra una estructura fina y flexible, la membrana plasmática, que regula el flujo de sustancias disueltas hacia dentro y hacia fuera de la célula, así como el flujo de agua por un fenómeno llamado ósmosis. La estructura básica de la membrana es similar en células eucarióticas y procariotas. Las proteínas son el principal componente de las membranas celulares, que además de ser importantes en la formación de su estructura también participan en su función principal, la permeabilidad, donde ayudan a retener el agua y dar flexibilidad a la célula, puesto que sus moléculas son largas y complejas pueden plegarse o extenderse permitiendo que la membrana se dilate o se contraiga, originando variaciones en el espacio por donde se hace la entrada de sustancias del medio ambiente al interior de la célula y viceversa. Tanto los alimentos como los productos de deshecho de la célula deben pasar a través de la membrana y para que esto ocurra las sustancias deben ser solubles, hasta cierto grado, en el líquido que rodea la célula o en el citoplasma. Para mayor claridad es necesario conocer las características y procesos físicos de la membrana plasmática. Las membranas en general, según su permeabilidad se clasifican en: permeables, las que permiten el paso de todo tipo de sustancias; impermeables, aquellas que no dejan pasar ninguna sustancia y las de 8


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

2015

permeabilidad selectiva, cuando sólo dejan pasar determinadas sustancias. A este último grupo pertenecen las membranas plasmáticas. Entre los mecanismos por los cuales, la célula efectúa la captación de sustancias están la difusión, la ósmosis, la pinocitosis y el transporte activo. La difusión es el movimiento de moléculas de una región de alta concentración a otra de menor concentración. Esto se debe a que las moléculas en solución están en constante movimiento, en todas direcciones por lo cual chocan continuamente entre sí. El resultado de estos movimientos y choques constantes da como resultado la uniformidad con que todas las moléculas en solución se distribuyen después de cierto tiempo. La ósmosis es un tipo especial de difusión, en la cual el paso de agua a través de una membrana de permeabilidad selectiva va de una región de alta concentración a otra de menor concentración. Como en los seres vivos el agua es el solvente donde se disuelven las sustancias, es posible afirmar que en los procesos biológicos la ósmosis se relaciona con el agua. Es bueno aclarar que en este caso la concentración se refiere al agua y no a las sustancias disueltas en ella. En ocasiones, si la concentración de las sustancias disueltas en el líquido circundante es mayor a la que existe dentro de la célula, el agua tiende a salir de la célula y esta se contrae (plasmólisis). Si el líquido tiene menos sustancias disueltas que en el interior de la célula, el agua tiende a entrar a la misma haciendo que se expanda (turgencia) y si la concentración es igual en ambas partes no se presenta ninguna variación en la célula. La pinocitosis es un proceso por el cual las células toman pequeñas partículas disueltas en el fluido que se encuentra alrededor de la célula. La endocitosis es el movimiento de materiales hacia adentro de la célula y la exocitosis es el movimiento de materiales para afuera de la célula, en ambos casos a través de vesículas de membrana. Se presentan dos tipos de endocitosis, la fagocitosis y la pinocitosis. La fagocitosis hace referencia al llamado ¨comer celular¨ donde se toman las partículas grandes encontradas dentro de la célula, que podrían ser otras células muertas o microbios, a través de una vesícula, relativamente grande en el caso de la fagocitosis mientras que en la pinocitosis es de menor tamaño comparativamente. Además de ser pequeñas, las vesículas pinocíticas suelen ser de un tamaño uniforme, a diferencia de las vesículas fagocíticas que se deben ampliar para dar cabida a un microbio o célula. La mayoría de las células humanas usan la pinocitosis en forma continua a fin de tener sustancias disueltas en el líquido, en cambio la fagocitosis tiende a ser utilizada sólo por células especializadas. Los microorganismos dañinos son capaces de utilizar la pinocitosis para sus propios fines. A veces, los virus puedan ingresar a las células, liberar su propia información genética en ella, haciéndose cargo de su metabolismo y dirigirlo para fabricar más partículas de virus. El transporte activo es un mecanismo celular por medio del cual algunas moléculas atraviesan la membrana celular contra un gradiente de concentración, es decir, desde una zona de baja concentración a otra de alta concentración implicando gasto de energía. Como ejemplos se tienen el transporte de glucosa y la bomba de sodio-potasio.

PINOCITOSIS 9


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

Si la célula repliega su membrana con el fin de englobar a una macromolécula, este mecanismo se llama fagocitosis

El proceso contrario, es decir, cuando se envuelve la macromolécula, se aproxima a la membrana celular y después de fusionarse con la envoltura con la membrana celular, esta es expulsada de la célula, proceso denominado exocitosis.

En la sangre circulan hormonas que llegan a la sangre por exocitosis igual que los anticuerpos y los lípidos que circulan también. Tanto para la endocitosis como para la exocitosis, se gasta energía, porque hay movimiento de moléculas Tomado y adaptado de: http://cdigital.dgb.uanl.mx/la/1020115288/1020115288_010.pdf, http://benitobios.blogspot.com/2009/04/transporte-activo.html Aprendizaje en pequeño grupo: Comparen y analicen los cuadros sinópticos hecho en el trabajo independiente por cada persona del grupo con el fin de generar uno sólo el cual será presentado en plenaria. Aprendizaje en plenaria: Cada pequeño grupo presentará a la plenaria su cuadro sinóptico. El mediador hará una síntesis del tema a partir de los cuadros presentados por los grupos. Actividad No 4 Objetivo: Realizar un proceso experimental que permita validar la teoría.

El mediador al iniciar las actividades del día hará un montaje de dos experimentos sencillos con el fin de comprobar los procesos de ósmosis y difusión. Los participantes observarán mientras se realiza el montaje. A una zanahoria ábrale un orificio de 1 cm de ancho por 3 cm de largo como muestra la figura. Llene con azúcar el orificio. Por fuera póngale 3 palillos y colóquela en un vaso desechable con agua (3/4 partes)

Tomado de http://es.slideshare.net/PabloPereira/palfy-prez-trabajo-zanahoria

10


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

2015

En otro vaso desechable con agua deje caer una pequeña cantidad de fresco en polvo, no mueva el vaso, ni agite el fresco. Dejar las experiencias montadas para la observación, por parte de los participantes, en el momento oportuno

Aprendizaje independiente: Observe el montaje de las experiencias que hace el mediador. Al llegar a esta actividad, haga de nuevo la observación de los experimentos e identifique a que fenómenos corresponden. Aprendizaje en pequeño grupo: Analicen las conclusiones sobre las experiencias. Aprendizaje en plenaria: El mediador orientara la discusión sobre las experiencias de laboratorio ACTIVIDADES DE FINALIZACIÓN Objetivo: Realizar un trabajo en casa que permita reforzar los conceptos trabajados.

1. Revisar en la plataforma virtual del proyecto Secretaria de Educación UNAL la información sobre cómo elaborar y trabajar con portafolio. 2. Recuerde realizar el inicio del portafolio con las actividades hechas en esta unidad de aprendizaje. 3. Realice las siguientes actividades:  

De tres ejemplos de células, tejidos, sistemas, individuos, ecosistemas, órganos, poblaciones, comunidades Establezca diferencias entre: célula vegetal y animal, ósmosis y transporte activo, célula eucariota y procariota, pared celular y membrana plasmática.

11


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

UNIDAD DE APRENDIZAJE No 2 SISTEMAS. SISTEMAS DE SOSTEN, MOVIMIENTO Y COMUNICACIÓN INTERNA CONCEPTOS DE ESTUDIO     

Tejidos animales y vegetales Sistemas de sostén y movimiento en humanos. Óseo y muscular Sistema nervioso en humanos Órganos de los sentidos en humanos. La piel Sistema endocrino y regulación hormonal en humanos

RECURSOS: Flores, frutos, semillas, tallos verdes y tallos lignificados, raíces. ACTIVIDADES DE INICIO Actividad No. 1 Objetivo: Facilitar la comprensión y adquisición de conceptos relacionados con tejidos vegetales. Resolver el siguiente cuadro trabajando en parejas. Una vez terminado será resuelto por todo el curso en el tablero, pasando estudiantes al azar y señalando a todo el grupo la posible ubicación de cada tejido en el material vegetal presente. Tejidos vegetales: Tejido

Características

Meristemático

Paredes primarias, núcleo grande Paredes primaria y secundaria. Células vivas a la madurez

Colénquima

Tipo de células

Células meristemáticas

Procesos de fotosíntesis, respiración

Pared primaria desigualmente engrosada Pared 1° y 2° generalmente lignificada

Colénquima angular y tangencial

Sostén

Fibras y traqueidas

Protección de partes verdes

Células epidérmicas propiamente dichas, células especializadas: tricomas, estomas, etc.

Peridermis

Diversos tipos celulares

Formado por suber, felógeno y felodermis

Xilema

Tejido complejo

Traqueidas vasos, fibras y células parenquimáticas

Tejido complejo

12

Función

Transporte de productos fotosintéticos


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

2015

Tomado de: http://www.monografias.com/ Actividad No. 2 Objetivo: Estimular la memoria frente a conceptos de tejidos animales mediante la elaboración de un crucigrama Resuelva en parejas el siguiente crucigrama. 2 1. 7

9

6

10

4 3

5

11

8

1. 2. 3. 4. 5.

El tejido epitelial se caracteriza por recubrir todas las superficies del cuerpo. En esta medida ¿cuál es la función principal de este tejido? ¿Qué tipo de tejido muscular es estriado y con acción voluntaria? ¿Cómo se llama la rama de la ciencia que estudia los tejidos? Algunos órganos como la boca y el esófago están recubiertos por tejido _______ Tejido formado por unas células redondeadas llamadas adipocitos, las cuales poseen una gran vacuola central rellena de grasa, con el núcleo y demás material celular en un lado. Sirve como reserva de energía (la grasa se consume cuando es necesario), como aislante térmico (la grasa protege del frío) y como protección frente a posibles golpes. 13


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

6. 7.

8.

9.

El tejido epitelial se encuentra formando la ____, que es el órgano más grande del cuerpo. Tejido formado por sustancia intercelular rica en fibras elásticas y colágenas. Se encuentra rodeando los órganos, formando parte de los ligamentos, tendones, dermis y médula ósea. La función es conectar unos órganos con otros, empaquetar los músculos y mantener a los músculos y los huesos unidos entre ellos. Es un tejido especializado en captar las variaciones del medio, elaborar una respuesta y conducirla a los órganos efectores. Constituido por dos tipos de células: neuronas y neuraglia. El tejido epitelial tiene su origen en los tres tejidos embrionarios fundamentales: ______, 10______ y 11_______.

ACTIVIDADES DE DESARROLLO Actividad No.3 Objetivo: Revisar participativamente los conceptos previos de sistemas locomotor, nervioso y endocrino. Aprendizaje independiente: Responda las preguntas relacionadas a continuación: Preguntas:       

¿Cuál es la función de los huesos en el cuerpo humano? ¿Qué enfermedades conoce relacionadas con el sistema locomotor? ¿cómo las puede prevenir? ¿Para qué sirven los órganos de los sentidos? ¿Qué pasaría si el órgano más grande del cuerpo humano perdiera su interacción con el sistema nervioso? ¿Cree que la sensación de dolor tiene alguna finalidad? ¿A qué se le denomina corriente nerviosa? ¿Por dónde se transmite? ¿Qué función desempeña el sistema nervioso? ¿Y las hormonas? ¿Existe alguna relación entre ambos?

Aprendizaje en pequeño grupo: Comparen y analicen las respuestas del trabajo independiente por cada persona del grupo con el fin de generar respuestas unificadas las cuales serán presentadas en plenaria. Aprendizaje en plenaria: Cada pequeño grupo presentará a la plenaria sus conclusiones de las preguntas. La actividad será modulada por el profesor con el fin de que haya participación de cada uno de los estudiantes de manera aleatoria. El profesor dará las explicaciones de los temas que los estudiantes no muestren claridad. Actividad No. 4 Objetivo: Relacionar el funcionamiento integral de los sistemas locomotor, nervioso, endocrino y órganos de los sentidos con situaciones cotidianas 14


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

2015

Aprendizaje independiente: Imagine la siguiente situación y analice los órganos de los sentidos utilizados y su relación con los sistemas estudiados (locomotor, nervioso y endocrino). Ejemplo: Imagina que vas llegando a tu casa a las 10 de la noche y tienes que pasar por un parque muy solitario que tiene fama de ser peligroso porque está cerca de un caño. Estás muy tenso atento a lo que te rodea, sientes el frio de la noche y el olor que despide el caño. Analizas la cantidad de luz que ilumina el lugar y ves pasar gente a lo lejos y analizas qué tan peligrosos pueden llegar a ser. Tu corazón está muy acelerado, bombeando sangre rápidamente y tienes los músculos tensos. Al sentir el espacio abierto para cruzar sin peligros cercanos tomas la decisión de pasar rápidamente, casi corriendo hasta llegar a la calle siguiente que tiene mayor flujo de personas donde te sientes más seguro, sin embargo sientes que alguien corre detrás de ti, tensionando tu cuerpo mucho más fuerte. Cuando volteas a mirar con gran pánico ves que se trata de un señor corriendo detrás de su mascota y ya te tranquilizas. El ritmo cardiaco disminuye y cuando llegas a la casa sueltas un gran suspiro, te acuestas en el sofá y sientes la comodidad de sus cojines, sientes la vibración del celular en el bolsillo del pantalón y ves que es tu mejor amigo al que le cuentas por what’s app el susto que tuviste y luego se quedan hablando tranquilamente de otros temas. Aprendizaje en pequeño grupo: Comparen el análisis del trabajo independiente por cada persona del grupo con el fin de generar un análisis que será presentado en plenaria. Aprendizaje en plenaria: El grupo estará ubicado en forma de mesa redonda y de cada pequeño grupo pasará aleatoriamente un estudiante al tablero a escribir una relación (sistema nervioso, sistema endocrino y otro órgano) encontrada en las situación, en lo posible con un ejemplo físico utilizando el propio cuerpo. ACTIVIDAD DE FINALIZACIÓN Actividad No. 5 Objetivo: Realizar un trabajo extraclase que permita reforzar los conceptos trabajados. 1. Cuando salga del ambiente del salón con al menos dos compañeros, ubiquen un árbol cercano y señalen y socialicen los tejido suberoso, parenquimático y meristemático. Si ven un jardín cualquiera revise que las plantas que tienen tallos verdes y no poseen tejido suberoso son protegidas por tejido epidérmico, ubique espinas o tricomas según el caso. Clasifique al menos 5 plantas (hojas, tallos, flores, frutos) como monocotiledónea o dicotiledónea.). .2. Que partes del Sistema Nervioso intervienen de manera primordial en las siguientes situaciones y con cuáles sistemas u órganos de los sentidos se relaciona: - caminar - adelantar un pie cuando se pierde el equilibrio. - leer un libro. - cerrar los parpados cuando un balón se acerca a la cara - Meter la mano al bolsillo y no encontrar el celular - resolver un problema de matemáticas. - montar patines. - sentir alegría por haber ganado $1.000.000 en una rifa. 15


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

- quedarse dormido. - Pincharse con un alambre de púas Subir las respuestas al foro de la plataforma.

16


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

2015

UNIDAD DE APRENDIZAJE No. 3 SISTEMAS RELACIONADOS CON LA FUNCIÓN DE NUTRICIÓN CONCEPTOS DE ESTUDIO     

Vegetales: respiración, circulación, excreción y fotosíntesis Sistema digestivo en el ser humano Sistema respiratorio en el ser humano Sistema excretor en el ser humano Sistema circulatorio en el ser humano

ESTRATEGIAS: Cuadro sinóptico, lectura autorregulada, lectura de textos, experimentos RECURSOS: Diagrama de la planta, bisturí, claveles blancos, colorante, dos recipientes plásticos, marcadores. ACTIVIDADES DE INICIO OBJETIVOS   

Comprender y explicar la forma como las plantas excretan sustancias Demostrar el proceso de respiración vegetal Identificar el proceso de circulación vegetal y las partes que la constituyen

Actividad No. 1 Transporte de líquidos por el tallo Experimento: Para hacer práctico el aprendizaje de la circulación de las plantas, los estudiantes en compañía del docente realizaran un experimento donde se identifique claramente como las plantas ejecutan el proceso de absorción de nutrientes y la circulación que se da en la misma. Para ello se deben seguir los siguientes pasos:

    

Se organizará el grupo máximo de a 5 personas por subgrupo. Cortar flores de pétalos blancos (clavel) y ponerlos en agua fría durante una hora. Divida el tallo de el clavel por la mitad con la ayuda de un bisturí dejando un centímetro de ventaja con los pétalos de la flor Ubique cada parte del tallo en un recipiente diferente, cada uno con un color de anilina distinto, disperso en agua Pasadas dos horas aproximadamente, evidencie los cambios y la combinación del color que se presenta en el pétalo de la flor

Culminado el experimento cada estudiante dibujará sus observaciones en una hoja y luego la expondrá ante sus compañeros.

17


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

Actividad No. 2 Objetivo 

Reconocer el proceso de circulación y nutrición de las plantas

Aprendizaje individual: Como actividad introductoria al tema, se deberá ver en casa el video sobre cómo se nutren y realizan el proceso de circulación las plantas, donde se identifiquen a su vez las partes que lo constituyen. Luego durante la sesión el docente irá evaluando los saberes previos de los estudiantes como: ¿Cómo se alimentan las plantas?, ¿Qué ayudan a producir las plantas?, ¿Qué hacen las plantas con los nutrientes absorbidos?, ¿En qué se diferencia el sistema circulatorio de las plantas al del hombre?, entre otras. Resolviendo a su vez las dudas que a ellos les sean generados, con la finalidad de hacer un aprestamiento significativo para la realización de las siguientes actividades que contiene esta unidad de aprendizaje https://www.youtube.com/watch?v=x8Ib_f7KpqQ SISTEMAS DIGESTIVO Y RESPIRATORIO HUMANOS Objetivos:    

Explicar los procesos que ocurren con los alimentos desde que se ingieren hasta que los nutrientes llegan a la sangre. Comprender la interrelación de los órganos implicados en el proceso respiratorio Explicar los mecanismos que permiten la introducción de oxígeno y la expulsión de dióxido de carbono. Identificar las bases de la respiración y reconocer los órganos que intervienen en ella y la función que desarrollan.

Aprendizaje independiente: CURIOSIDADES DEL SISTEMA DIGESTIVO Y RESPIRATORIO Cada estudiante hará lectura de las curiosidades del sistema digestivo que encontrará a continuación y resaltará las que sean conocidas para él y dejará en blanco las otras:           18

La comida pasa de 3 a 5 horas en el estómago y de 6 a 20 en el intestino grueso. Cuando comemos, una tapa llamada epiglotis cubre la tráquea para impedir que la comida pueda entrar al aparato respiratorio. Los movimientos peristálticos conducen el alimento por el tubo digestivo. Por eso es posible comer boca abajo. En el estómago caben entre medio litro y 2 litros de alimento. Producimos diariamente entre litro y litro y medio de saliva. La función de la saliva es envolver al alimento y hacerlo más suave para que cuando pase al estómago, no desgarre sus paredes. Si extendiéramos el intestino delgado, éste llegaría de un extremo a otro de la clase, ya que tiene por término medio, unos 6,5 metros. El intestino grueso solo tiene 1,5 metros. Respiramos unos 5-6 litros de aire por minuto. Unos pulmones adultos tienen capacidad para 3 litros de aire. El hipo está causado por la contracción súbita del diafragma. Entonces el aire entra muy rápidamente y las cuerdas vocales se cierran; esto causa el sonido de hipo. El granjero americano Charles Osborne tuvo un ataque de hipo que comenzó en 1922 y terminó en 1990 (68 años de hipo).


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

     

2015

Al toser, el aire puede salir a una velocidad de 140 kilómetros por hora. La mosca consume 100 veces más oxígeno en el momento de despegar que cuando está en reposo. El pulmón derecho es más grande que el izquierdo; este debe dejar espacio al corazón. Por qué se debe respirar por la nariz; porque por su mayor recorrido, el aire llega más caliente a los pulmones, y así no nos resfriamos tan fácilmente. La tos es un mecanismo de defensa, movimiento automático que sirve para mantener libres y despejadas las vías respiratorias, y elimina la mucosidad (lo mismo podemos decir del estornudo). Casi la mitad del agua que bebemos la expulsamos a través de la respiración

El docente orientará la discusión de las curiosidades del aparato digestivo y el aparato respiratorio, revisando las más desconocidas por parte de los estudiantes, en cada punto deberán expresar sus opiniones, para así poder detectar los conocimientos previos de cada uno. ACTIVIDADES DE DESARROLLO Actividad No. 3 Objetivo: Reconocer los conocimientos sobre digestión humana a través de una revisión bibliográfica. Aprendizaje en pequeño grupo: Los estudiantes formarán grupos de 3 y realizaran una actividad de consulta en los textos de biología a disposición, donde se muestre como los alimentos son degradados en el sistema digestivo en partes minúsculas y además que una parte de los alimentos no es aprovechada por el cuerpo siendo eliminada a través de la materia fecal. La parte “útil” de los alimentos, es reducida a su mínima expresión para poder ser transportada a cada célula, por el sistema circulatorio. Por esta razón, se habla de la “nutrición” cuando se hace referencia a las actividades involucradas en la obtención de las diferentes sustancias “útiles” para nuestro cuerpo. Una vez realizada la lectura, cada grupo busca la forma más adecuada para presentar el recorrido del alimento, haciendo énfasis en los cambios ocurridos en la boca, el estómago, el intestino delgado y el intestino grueso. Actividad No. 4 Objetivo: Analizar el proceso respiratorio en el ser humano con ayuda de esquemas. Aprendizaje en pequeño grupo: El sistema respiratorio está formado por las estructuras que realizan el intercambio de gases entre la atmósfera y la sangre. El oxígeno (O2) es introducido dentro del cuerpo para su posterior distribución a los tejidos y el dióxido de carbono (CO2) producido por el metabolismo celular, es eliminado al exterior. Con ayuda de un esquema del texto de consulta donde se evidencie el intercambio de gases, el grupo analizará este proceso. En forma aleatoria se escogerá un grupo para hacer la presentación al gran grupo, momento en el cual el mediador hará las aclaraciones del caso. Posteriormente se procede a trabajar en parejas en la realización de la siguiente actividad: 1. De las siguientes frases, ¿cuáles son falsas y por qué? Escríbelas correctamente en tu cuaderno. a) El aire que entra en los pulmones lleva más oxígeno que el aire que sale. b) El aire que entra en los pulmones lleva más dióxido de carbono que el aire que sale. c) La sangre que llega a los pulmones tiene más oxígeno que la sangre que sale. 19


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

d) La sangre que llega a los pulmones tiene más dióxido de carbono que la sangre que sale. 2. 3. 4.

5.

¿En qué parte de los pulmones se realiza el intercambio de gases entre la sangre y el aire? Explica cómo se realiza. Si los alveolos son estructuras que se encuentran al interior de los pulmones, ¿en qué dirección se mueve el oxígeno? Esquematiza la estructura de una mitocondria y describe donde tienen lugar las diversas etapas de la degradación de la glucosa, en relación con la estructura mitocondrial. ¿Qué moléculas e iones atraviesan las membranas mitocondriales en estos procesos? Escriba con sus propias palabras una oración que explique el proceso que se observa entre los alveolos y los capilares sanguíneos.

Actividad No. 5 Objetivo: Identificar los tipos de respiración humana con apoyo de una lectura relacionada con el tema Aprendizaje en gran grupo: Imagina que... No todos los seres vivos respiran igual Realizar la lectura autorregulada sobre la respiración humana (anexo 1), teniendo en cuenta los siguientes pasos

SISTEMAS CIRCULATORIO Y EXCRETOR EN EL HOMBRE RECURSOS: Cronómetro, cuaderno, esfero, lecturas, libros de apoyo Objetivo: Reconoce los sistemas circulatorio y excretor y su funcionamiento Aprendizaje independiente: El docente nos preguntará sobre las preconcepciones relacionados con el tema. Para ello harán una mesa redonda. El docente se situará en medio del círculo y realizará una serie de preguntas sobre el tema. El estudiante que tengan la respuesta pasara rápidamente al centro de la mesa redonda, donde se encuentra el profesor y contestará la pregunta. Si se equivoca en la 20


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

2015

respuesta, se le dará la oportunidad a otro compañero para pasar al frente. Esta actividad tendrá puntos para los que respondan bien las preguntas. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23.

¿De qué está formado el Aparato Circulatorio? ¿Qué función tiene el Aparato Circulatorio? ¿Qué función realiza el corazón? ¿Qué es la sangre? ¿De qué se encargan los glóbulos rojos? ¿Qué función tienen los glóbulos blancos? ¿Qué es el plasma sanguíneo? ¿Qué son las plaquetas? ¿Qué son los vasos sanguíneos? ¿Cuántos y cómo se llaman los circuitos que describe la sangre? ¿Qué es le excreción? ¿Qué es el aparato urinario? ¿Qué es la orina? ¿Qué diferencia hay entre el aparato urinario masculino y femenino? ¿Qué órganos forman el aparato urinario? ¿Cuál es la función de los riñones? ¿Dónde se sitúan los riñones en el ser humano? ¿Qué es el uréter? ¿Dónde se almacena la orina? ¿Por dónde pasa la orina después de almacenarse en la vejiga? ¿Cómo llega el oxígeno desde los pulmones hasta una célula del dedo pulgar del pie? ¿Cómo llegan los nutrientes desde el intestino delgado hasta una célula del cerebro? La sangre ¿siempre circula con la misma velocidad? ¿De qué depende?

Actividad No. 6 Objetivo: Reconoce los sistemas circulatorio y excretor y su funcionamiento Aprendizaje en pequeño grupo: En grupos de 3 estudiantes se les repartirá una lectura sobre los diferentes aportes que ha hecho la ciencia al tema de circulación sanguínea (anexo 2). Luego de que se haga la lectura el docente le asignará a cada grupo uno de los autores de los que habla la lectura, y ellos deberán elegir un relator que será el que realice a sus compañeros una presentación sobre la biografía, la teoría y la crítica del autor que le correspondió. También nombrarán un secretario, quien tomará nota de las dudas, aportes o sugerencias que tengan los demás compañeros frente a la presentación. Los personajes que se tendrán en cuenta son: a)

Herófilo b) Galeno c) Fabricio c) Harvey d) Malpighi e) Van Leeuwenhoek

EXPERIMENTACIÓN Practica de laboratorio Con la siguiente práctica de laboratorio el estudiante aprenderá a medir algunos signos vitales y si estos varían con la práctica de actividades físicas. Materiales: Cronómetro, tensiómetro, hojas examen 21


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

Procedimiento 

Medir su pulso cardiaco (seguir instrucciones del docente). Registrar este valor como primer dato. Luego realizar una caminata de 3 minutos al ritmo de un paso por segundo y medir el pulso cardiaco al terminar el tiempo de la caminata. Hacerlo por turnos, de tal manera que se tomen los datos reales de todos los compañeros del grupo. Luego de normalizado el pulso, realizar una actividad física intensa como correr, subir o bajar escaleras por tiempo de 3 minutos y tomar la tercera medición. Organizar los resultados en una tabla para comparar y realizar el análisis. Con ayuda del tensiómetro y siguiendo las instrucciones del docente tomen la presión arterial de algunos de los compañeros. Tener presente que sean estudiantes de diferente estatura, masa corporal y frecuencia en actividad física

Posteriormente responder las siguientes preguntas:       

¿Cuánto tiempo aproximado tarda en restablecerse el pulso cardiaco de los compañeros? ¿Son muy diferentes las variaciones de las frecuencias cardiacas entre hombres y mujeres? Expliquen ¿Qué variación encontraron en la presión arterial? ¿A que corresponden los valores de presión arterial? ¿Cuál es la medida normal de la presión arterial de adultos? ¿Es igual en todas las etapas de la vida? Organicen el informe de laboratorio realicen análisis de resultados y conclusiones. Socialicen los resultados de la práctica con los compañeros y profesores. Establezcan conclusiones en el cuaderno

Actividad No. 7 Objetivo: Conocer el proceso fisiológico y anatómico de la excreción Aprendizaje en gran grupo: Realizar la lectura del texto guía sobre excreción humana y elaboren un cuadro sinóptico sobre la misma en papel periódico. A continuación se exponen los productos en las paredes del salón y un vocero de cada grupo explica el producto, con la retroalimentación correspondiente. ANEXO 1. RESPIRACIÓN Sirve para que el cuerpo utilice la energía que obtiene de los alimentos gracias al Oxígeno, que se encuentra en el aire mezclado con otros gases. La Respiración de las células: Aunque normalmente llamamos respiración a los movimientos de inspiración y espiración que realiza los pulmones, la verdadera respiración tiene lugar en el interior de cada una de las células de nuestro cuerpo. Las células toman el oxígeno que les lleva la sangre y lo utilizan para quemar los alimentos que han absorbido, de esta forma se produce la energía que el cuerpo necesita y en especial el calor que mantiene la temperatura del cuerpo humano a unos 37 grados. Para poder vivir necesitamos que nuestras células tengan una entrada continua de oxígeno y alimentos y la retirada de los desechos que se originan con la oxidación de los alimentos. Si nos damos cuenta funcionamos de forma muy parecida a como lo hace un coche para moverse. El coche necesita continuamente gasolina (su "alimento") y aire para quemarla y moverse, mientras que el tubo de escape debe estar eliminando constantemente los humos de desecho. 22


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

2015

Respirar tranquilos: Una persona sana respira ente 10 y 15 veces por minuto. Este ritmo normal de respiración proporciona al cuerpo el oxígeno necesario, pero sólo unos pocos minutos sin respirar ocasionan la muerte. ¿Por qué respirar bien? La respuesta es muy sencilla: porque la respiración es un acto imprescindible. Podemos estar días sin comer o beber, pero solo pocos minutos sin respirar bastarían para acabar con la vida de una persona. La respiración es vital. Como acto involuntario el organismo se acostumbra a los vicios que impone el stress, la falta de ejercicio, vestimentas y posturas inadecuadas, ambientes mal ventilados o afectados por el tabaquismo. Respiramos automáticamente desde que nacemos y pocas veces nos hemos detenido a pensar de si lo hacemos correctamente o si hay ejercicios para mejorarla y obtener más beneficios al realizar cualquier actividad física. Existen dos tipos de respiración: Respiración abdominal, en la que predomina la acción del diafragma, músculo plano y delgado, situado entre la cavidad torácica y la abdominal y sobre el que se apoyan las bases pulmonares. Respiración torácica, en la que actúan los músculos intercostales y del cuello, para dilatar la caja torácica y permitir que los pulmones se expandan. Para garantizarle a nuestro organismo una oxigenación adecuada, debemos procurar respirar correctamente. El vital oxígeno Nuestro cuerpo es un maravilloso sistema que nunca terminamos de conocer y comprender. ¿Sabes cómo se realiza la función respiratoria, ese incesante intercambio entre nuestros pulmones y el medio ambiente? Gracias a la respiración las células vivientes del cuerpo toman oxígeno (O2) y eliminan el dióxido de carbono (CO2) en un intercambio gaseoso entre el aire de la atmósfera y el organismo. Los glóbulos rojos de la sangre llevan O2 a los tejidos, extrayendo dióxido de carbono. En los pulmones, esos glóbulos rojos descargan CO2 en el aire y de él toman su nueva carga de O2, proceso que se denomina hematosis. La respiración puede dividirse en distintos pasos:    

La inspiración o inhalación, es decir, la entrada de aire hacia los alvéolos pulmonares, durante la cual ingresa oxígeno. El proceso de intercambio de oxígeno y dióxido de carbono entre los alvéolos pulmonares y la sangre. La espiración o exhalación, que consiste en la salida del aire desde los alvéolos pulmonares hacia el exterior, mediante la cual se elimina dióxido de carbono. Intercambio de O2 y CO2 entre las células y la sangre.

23


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

El aparato respiratorio es el conjunto de estructuras cuya función es la de abastecer de oxígeno al organismo, principalmente al cerebro, mediante la incorporación de aire rico en oxígeno y la expulsión de aire con Dióxido de Carbono. Consta de dos partes: las vías aéreas, con las fosas nasales y los conductos respiratorios, y los pulmones:       

Fosas nasales (filtra, humedece y calienta el aire). Conductos Faringe, laringe (cuerdas vocales) y tráquea. Pulmones Bronquios, bronquíolos y alvéolos pulmonares. Pleura y lóbulos. Diafragma

Los pulmones son órganos pares que ocupan ambas mitades de la cavidad torácica; están separados por un espacio en el que se alojan el corazón y los grandes vasos sanguíneos (situados ligeramente en el lado izquierdo) por lo que el pulmón izquierdo tiene sólo dos lóbulos mientras que el derecho tiene tres. La ventilación pulmonar, que consiste en la entrada y salida de aire en los pulmones, se realiza merced a los movimientos respiratorios de inspiración y espiración que suelen ser de 15 a 20 veces por minuto, en una persona adulta en condiciones normales, inhalando una cantidad aproximada de 500 cm3 en cada inspiración. Inspiración Durante la inspiración el aire penetra en los pulmones; el diafragma se contrae, se aplana y hace aumentar el volumen de la cavidad torácica en la que están suspendidos. Además, los músculos intercostales se contraen y provocan el movimiento de los extremos anteriores de las costillas hacia arriba y hacia fuera de forma simultánea, lo que aumenta aún más el tamaño de la cavidad torácica. Esto permite que los pulmones se expandan y queden llenos de aire. En una persona adulta el número de inspiraciones en estado de reposo es de 14 a 20 por minuto, aunque cuando se realiza una actividad física intensa la frecuencia respiratoria puede aumentar hasta 80 inspiraciones por minuto. Espiración Durante la espiración o salida del aire rico en dióxido de carbono, los músculos intercostales se relajan y las costillas vuelven a su posición, a la vez que el diafragma recupera su forma de cúpula; ambos factores provocan la disminución del volumen de la cavidad torácica lo que origina la contracción de los pulmones que expulsan el aire al exterior. Diafragma El diafragma es un músculo extenso que separa la cavidad torácica de la abdominal. Es característico de todos los mamíferos y aparece en algunas aves de forma rudimentaria. En los seres humanos el diafragma está unido a las vértebras lumbares, a las costillas inferiores y al 24


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

2015

esternón. Las tres principales aberturas del diafragma permiten el paso del esófago, la aorta, los nervios, y los vasos linfáticos y torácicos. El diafragma es de forma elíptica y aspecto rugoso. Está inclinado hacia arriba, más elevado en la parte anterior que en la posterior y tiene forma de bóveda cuando está relajado. La respiración está asistida por la contracción y distensión de este músculo. Durante la inspiración se contrae y al estirarse aumenta la capacidad del tórax; entonces, el aire tiende a entrar en los pulmones para compensar el vacío creado. Cuando se relaja, el aire se expulsa. Además, al contraerse ejerce presión sobre el abdomen, y de esta manera ayuda al estómago a realizar la digestión. Las contracciones espasmódicas involuntarias del diafragma originan el hipo. Intercambio de gases Cuando el aire penetra en los pulmones y llega a los alvéolos pulmonares, el oxígeno atraviesa sus delgadas paredes y pasa a los capilares sanguíneos, que los rodean como una fina red. La hemoglobina, una proteína de los glóbulos rojos de la sangre, recoge el oxígeno del aire inspirado y lo transporta al corazón, desde donde se distribuye, a través de las arterias, a todas las células del organismo. Los glóbulos rojos recogen el dióxido de carbono de las células y lo transportan por las venas hasta el corazón, que lo impulsa hacia los capilares sanguíneos de los alvéolos para su expulsión al exterior. ANEXO 2 ALGO DE HISTORIA SOBRE LA CIRCULACIÓN

Cuando William Harvey publicó su De motu cordis, en 1628, la fisiología de la sangre de Galeno - que se remonta al siglo II d.C. - continuaba siendo la teoría más ampliamente difundida. No obstante, mucho antes que Galeno existieron otras teorías, algunas de las cuales fueron muy influyentes en su pensamiento (cf. Harris, 1973; Entralgo, 1976; French, 1978a; 1978b). Tal es el caso de las ideas desarrolladas por algunos médicos hipocráticos o por los médicos alejandrinos del siglo III a.C., Herófilo y Erasístrato. Todos ellos elaboraron diversas teorías relacionadas con la sangre y los órganos cardiovasculares, con la finalidad de responder, al menos, a dos preguntas: ¿cuál es el recorrido que realiza la sangre en el interior del corazón y de los vasos sanguíneos? y ¿cuál es la causa de que la sangre se mueva en el interior de estos órganos? Aunque son preguntas estrechamente relacionadas, es perfectamente posible, en principio, responder a la primera de ellas sin dar una respuesta a la segunda. Asimismo, es posible, frente a una misma teoría sobre el recorrido que realiza la sangre, considerar más de una teoría posible sobre la(s) causa(s) de que la sangre se mueva. De las investigaciones realizadas por Harvey puede concluirse que él arribó inicialmente a la teoría del movimiento circular de la sangre. Antes de eso, tenía conocimiento sobre las causas del movimiento de la sangre en el corazón y en las arterias - sístole de las cavidades cardíacas con oclusión y apertura alternantes de las válvulas cardíacas y sístole arterial con oclusión de las válvulas aórtica o pulmonar, respectivamente - , pero no había logrado determinar aún las causas del movimiento de la sangre en las venas y, menos todavía, en el interior de las comunicaciones arteriovenosas. Incluso, no había todavía introducido su concepto de las comunicaciones arteriovenosas, que desempeñan un papel central en la teoría del movimiento circular de la sangre.

25


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

Una vez que Harvey se convence de que es necesario que la sangre circule, y con el objetivo de explicar cómo es posible que la sangre regrese al corazón, afirma que la causa de que la sangre venosa se mueva en dirección centrípeta es la fuerza producida por las contracciones musculares sobre las venas, conjuntamente con la acción de las válvulas venosas. Como él mismo lo expresa en el capítulo XV de su libro, tras haber demostrado los movimientos de apertura y oclusión de las válvulas venosas. Adicionalmente, algún impulso o fuerza, así como un impulsor o generador de la fuerza, tal como el corazón, era necesario para llevar a cabo esa distribución y movimiento de la sangre es forzada desde las venas capilares hacia las ramificaciones más pequeñas, y desde éstas hacia los troncos más grandes a causa del movimiento de las extremidades y la compresión de los músculos en general (Harvey, 1910, p. 132). McMullen (1995) también muestra, a través de un análisis histórico, que la teoría del movimiento circular de la sangre es anterior incluso a que Harvey comprendiera la razón de la disposición de las válvulas venosas. Una vez que Harvey se dio cuenta de las implicancias de la cantidad de sangre que sale del ventrículo izquierdo en treinta minutos, comenzó a considerar el concepto de la circulación de la sangre. Recién entonces, Harvey propuso que la razón de que la orientación de las válvulas venosas fuera opuesta al corazón era que ellas permitían que la sangre circulara únicamente en una dirección. Estas dos teorías - que denominaremos, respectivamente, "teoría del movimiento circular de la sangre" y "teoría de las causas del movimiento de la sangre" - fueron propuestas por Harvey en distintos momentos de sus investigaciones para explicar cosas diferentes. La primera de ellas pretende responder a la siguiente pregunta, que Harvey formula de manera explícita en su libro: ¿por qué el cuerpo no se vacía de sangre en apenas treinta minutos, ni las arterias revientan, considerando la gran cantidad de sangre que es expulsada desde el ventrículo izquierdo? Una vez que Harvey "comprende" que el movimiento de la sangre es circular, y que esa es la razón de que el cuerpo no se vacíe de sangre, ni las arterias revienten, se hace la siguiente pregunta: ¿qué causa que la sangre se mueva desde el corazón hacia las venas y, desde allí, de vuelta al corazón? Si bien el análisis detallado de la relación existente entre ambas teorías no constituye el objetivo de este trabajo, dejándolo para uno posterior, podríamos suponer que entre ambas teorías se da una relación de teorización fuerte,1 en donde la teoría del movimiento circular de la sangre es teorizada por la teoría de las causas de que la sangre se mueva. Más específicamente, la segunda dice aquello que ya está dicho en la primera pero, además, dice otras cosas: que las causas de que la sangre realice un movimiento circular son las contracciones cardíacas, los movimientos de apertura y oclusión de las válvulas (cardíacas y venosas) y las contracciones generalizadas de los músculos del cuerpo. Sin embargo, las presentaciones usuales de la obra de Harvey no suelen distinguir con precisión entre ambas teorías y utilizan indistintamente la denominación de "teoría de la circulación de la sangre" (cf. Pagel, 1976; Lewis, 1988; Porter, 1999; Lawson, 2000; Alchin, 2005). Ello, probablemente, se debe a que no cuentan con un instrumental metateórico adecuado para realizar esta distinción. En este trabajo, llevaremos a cabo un análisis de la teoría del movimiento circular de la sangre de Harvey (que simbolizaremos con CSH) mediante las herramientas conceptuales proporcionadas por la denominada "concepción estructuralista de las teorías" (también llamada "metateoría estructuralista", "estructuralismo metateórico", "estructuralismo metacientífico" y, últimamente, en ámbitos anglosajones, "estructuralismo alemán" o "escuela estructuralista alemana").2 Para ello, vamos a presentar en primer término su elemento teórico básico (núcleo - modelos potenciales, modelos, modelos parciales, condiciones de ligadura, vínculos interteóricos - , aplicaciones intencionales y aserción empírica asociada con dicho elemento teórico), para luego presentar sus especializaciones y red teórica. Pero, antes de ello, haremos una presentación informal, intuitiva, de dicha teoría, a continuación de lo cual expondremos brevemente las nociones básicas del estructuralismo metateórico. 26


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

2015

LA TEORÍA DEL MOVIMIENTO CIRCULAR DE LA SANGRE Galeno aceptó la clasificación de los vasos sanguíneos en arterias y venas que realizó Praxágoras en el siglo III a.C. (para una buena exposición de la obra de Galeno, cf. Harris, 1973, o la traducción de Sobre el uso de las partes, realizada por May, 1968). Además, a diferencia de Aristóteles, que sostenía que tanto las arterias como las venas se originan en el corazón, Galeno creía, junto con el autor del texto hipocrático Sobre la alimentación, que las arterias se originan en el corazón, y las venas en el hígado. Con Herófilo, sostuvo que en las arterias hay sangre y no aire, y con Erasístrato, afirmó que la sangre se produce en el hígado a partir de los alimentos ingeridos. Galeno también coincidió con este último en dos aspectos adicionales: no incluyó a las aurículas como parte del corazón, sino como expansiones de la vena cava (en el caso de la aurícula derecha) y de la vena pulmonar3 (en el caso de la aurícula izquierda), y aceptó la existencia de las "anastomosis arteriovenosas", aunque les atribuyó un significado diferente. Según creía Erasístrato, en condiciones patológicas, la sangre presente en las venas es transmitida, a través de estas anastomosis, a las arterias. Galeno, en cambio, sostuvo que hay un intercambio tanto de sangre, desde las venas hacia las arterias, como también de pneuma, desde las arterias hacia las venas, y que ello ocurre en condiciones normales. De este modo, Galeno seleccionó algunas de las ideas de sus predecesores y les añadió otras propias, agrupándolas y reconceptualizándolas dentro de una nueva teoría sobre el movimiento de la sangre, que puede describirse de la siguiente manera. La sangre se encuentra inicialmente en el hígado - en donde se genera - y, desde allí, una porción de ésta se dirige hacia los órganos del cuerpo para nutrirlos, por medio de las venas correspondientes. La parte restante de la sangre venosa se dirige hacia el ventrículo derecho, desde donde una proporción menor pasa a la arteria pulmonar - con la finalidad de nutrir a los pulmones - , mientras que la porción restante es transferida al ventrículo izquierdo a través de las "porosidades invisibles" presentes en el tabique interventricular. Del total de la sangre transmitida a la arteria pulmonar, una proporción todavía más pequeña pasa a la vena pulmonar a través de las anastomosis arteriovenosas, - también con la finalidad de nutrir a los pulmones - . Por su parte, la sangre que fue transferida desde el ventrículo derecho al izquierdo pasa a las arterias - tras sufrir un proceso de arterialización en el que es mezclada con el aire proveniente de los pulmones - , desde donde se dirige a los órganos. Finalmente, también una pequeña porción de la sangre venosa presente en el resto de los órganos (además del pulmón) es transferida a las arterias por medio de las anastomosis arteriovenosas, en donde es utilizada para nutrir las paredes arteriales. Con el propósito de comprender la diferencia central que hay entre la teoría de Galeno y la de Harvey, diremos que, en el primer caso, esquemáticamente, el movimiento de la sangre comienza en un extremo de su recorrido, el hígado, y finaliza en el otro extremo, los órganos, en donde la sangre es eliminada durante el proceso de solidificación, convirtiéndose en parte constitutiva del cuerpo, o en forma de residuos. Antes de que William Harvey publicara el De motu cordis, algunos médicos ya habían cuestionado aspectos importantes de la fisiología y de la anatomía de Galeno (cf. Temkin, 1940; Pagel, 1976; Wilson, 1962; Entralgo, 1976; French, 1978c; 1978d; 1994; 2002; McMullen, 1995; Porter, 1999; Stefanadis, 2009). No es éste el lugar para realizar un análisis detallado de sus contribuciones, aunque vale la pena mencionar aquí el descubrimiento del tránsito pulmonar - presente en los trabajos de Ibn al-Nafis, en el siglo XIII, y de Miguel Servet y Realdo Colombo, en el siglo XVI - y las descripciones de las válvulas venosas - que hicieron, por ejemplo, Fabricio de Acquapendente, profesor de Harvey en la Universidad de Padua, y Salomón Alberti, discípulo también de Fabricio. Entre éstos, Harvey conoció con seguridad los trabajos de Colombo, Acquapendente y Alberti. 27


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

Además de los conocimientos provenientes de estas fuentes, motivados inicialmente por preguntas relativas a la sístole y a la diástole cardíaca, Harvey se topó con un problema que es central en su descubrimiento. Al estimar la cantidad de sangre que sale del ventrículo izquierdo en treinta minutos, llegó a la conclusión de que dicha magnitud es tal que no podría reponerse en ese intervalo de tiempo, como lo estipula la teoría de Galeno. En otras palabras, si la teoría de aquél fuera correcta - a saber, que la sangre se produce en el hígado a partir de los alimentos y es eliminada en los órganos tras finalizar su recorrido - , entonces el cuerpo se vaciaría de sangre en media hora. En vistas de que ello no ocurre, Harvey rechaza la teoría de Galeno y propone su propia teoría. De acuerdo con Harvey, la razón de que el cuerpo no se quede sin sangre (ni las arterias revienten) es que no es verdad que ésta se produce en el hígado y se elimina en el resto de las partes del cuerpo. En cambio, la sangre recorre una trayectoria circular atravesando una secuencia ordenada de órganos cardiovasculares y de comunicaciones arteriovenosas. Los órganos cardiovasculares, las comunicaciones arteriovenosas y la relación de sucesión entre ellos pueden variar dependiendo de cuáles sean los animales y el período de la vida que estemos considerando (cf. Harvey, 1910, cap. 4). Harvey identifica cuatro grupos: los animales con pulmones y dos ventrículos, durante la vida adulta; los animales con pulmones y dos ventrículos, en el período embrionario; los animales adultos con pulmones y un solo ventrículo; y los animales adultos sin pulmones. Sin embargo, a pesar de estas diferencias, hay también algo en común en todos ellos: la sangre circula.

28


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

2015

UNIDAD DE APRENDIZAJE No 4 CUIDEMOS EL ORGANISMO CONCEPTOS DE ESTUDIO  Salud pública: Enfermedad Diarreica Aguda (EDA), Infección Respiratoria Aguda (IRA)  Enfermedades tropicales: paludismo, leishmaniasis, esquistosomiasis, oncocercosis, filariasis linfática, enfermedad de Chagas, tripanosomiasis africana, dengue.  Enfermedades de transmisión sexual: ETS – SIDA  Sistema inmunológico, virus, vacunas y antibióticos.  Epidemias y pandemias: Ébola, fiebre chikunguña, gripa  Efectos nocivos de la cafeína, tabaco, drogas y licores  Dieta balanceada, grupo de alimentos Temas transversales Entidades encargadas del bienestar y cuidado de la salud a nivel nacional e internacional Objetivos   

Identificar acciones y lugares que implican riesgo para la salud humana Reconocer la importancia de la higiene y cuidado del cuerpo Reconocer las principales enfermedades que ponen en riesgo la salud de los seres humanos.

Espacios y recursos  

Espacio: Salón de clases. Recursos: marcadores, papel periódico, material gráfico sobre enfermedades. Introducción La salud pública es un tema de vital importancia para la humanidad. Con el paso de los años han surgido nuevas enfermedades y amenazas para los seres humanos, ante esta situación los organismos se han adaptado para combatirlas haciendo uso de vacunas y medicamentos, que asociados a prácticas saludables pueden fortalecer el sistema inmune generando resistencia ante patógenos altamente perjudiciales. Esta unidad de aprendizaje promueve el cuidado del organismo partiendo del conocimiento de las principales amenazas y riesgos que tiene la humanidad, así mismo se espera que los estudiantes tomen decisiones responsables y adopten hábitos saludables para mejorar su calidad de vida.

ACTIVIDADES DE INICIO Resuelva las siguientes preguntas:  

¿Cuáles son los cuidados mínimos que se deben tener con el cuerpo humano? Describa tres hábitos saludables para el cuerpo humano. ¿Practica alguno de ellos? 29


2015

 

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

Actualmente, ¿cuáles son las enfermedades que se presentan con mayor frecuencia en nuestro país? ¿Conoce el mecanismo de acción de vacunas y antibióticos?

Al responder las preguntas, se realiza una plenaria para escuchar la opinión de algunos estudiantes. Posteriormente se plantean los conceptos a trabajar. ACTIVIDADES DE DESARROLLO Actividad No. 1 Aprendizaje independiente: Los estudiantes deben realizar previamente la lectura del artículo “Evolución y orígenes de la humanidad” de Nesse y Williams, esta se encuentra disponible en la plataforma virtual. Con base en la lectura, se propone extraer las ideas principales. Aprendizaje en pequeño grupo: Se organizan grupos de cuatro personas, deben diseñar un mapa conceptual que involucre las palabras claves extraídas de la lectura. Este debe ser plasmado en un cartel para socializarlo con el resto de la clase. Aprendizaje en plenaria: Una vez se presentan los mapas conceptuales realizados, se establecerá la relación entre las enfermedades y la evolución. De este modo se introduce el concepto de enfermedad, señalando como se clasifican actualmente. Actividad No. 2 Aprendizaje en pequeño grupo: Los estudiantes se organizan en grupos de cuatro personas. Deben resolver la siguiente pregunta: 

De acuerdo al cubrimiento de los medios de comunicación, ¿cuáles son las principales epidemias y pandemias que se han presentado en los últimos años? Tomando como referencia la información presentada en el anexo 1, desarrolle el siguiente ejercicio:

Complete la siguiente tabla:

Enfermedad Tuberculosis Cólera Neumonía Malaria Dengue 30

Causa

Síntomas


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

2015

Posteriormente, se les entregará una foto representando una enfermedad. En la descripción de la foto se incluirán los síntomas de la enfermedad y cuidados para combatirla. Los estudiantes deben indicar a que enfermedad se hace referencia. (Anexo 2) Aprendizaje en plenaria: Se presentan los resultados de la actividad anterior. El docente explicará la naturaleza de cada enfermedad y el manejo que le han dado las entidades encargadas del cuidado de la salud. Actividad No. 3 Aprendizaje independiente   

Los estudiantes hacen un listado de las actividades que realizan diariamente Deben indicar si alguna está destinada al bienestar del cuerpo y el cuidado de la salud. De no encontrar alguna con esta intención, ¿cómo cree que debe cambiar la planeación de su día?, ¿Qué hábitos cree que debe incluir?

Aprendizaje en plenaria: Los estudiantes explican cómo se desarrolla su rutina diaria, el grupo determina cuáles son los hábitos comunes y aquellos que se deben incluir para promover la salud y el bienestar del cuerpo. Actividad No. 4 Aprendizaje independiente: El estudiante realizará la lectura “Educación sexual en Colombia”. (Anexo 3). Observe las figuras relacionadas con la sexualidad responsable, y responda las siguientes preguntas:   

¿Qué tan informado está en educación sexual? ¿Cuál es la fuente de esa información? ¿Quién o quienes le han suministrado esa información, el colegio, los padres, amigos?

Aprendizaje en pequeño grupo: Por parejas discutirán la información suministrada haciendo énfasis en los problemas que presenta la juventud en materia de sexualidad. Algunos grupos abordaran dichos problemas bajo el rol de educadores, otros bajo el rol de padres y otros bajo el rol de estudiantes. Aprendizaje en plenaria: Se presenta el análisis realizado explicando el punto de vista de cada grupo de acuerdo al rol asignado. El docente será el mediador del debate señalando los puntos clave a tratar.

31


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

ACTIVIDADES DE FINALIZACIÓN Aprendizaje en pequeño grupo: ¿Diseñe una campaña informativa dirigida a la clase?, tenga en cuenta que puede seleccionar uno de los siguientes temas:   

Prevención de epidemias Sexualidad responsable

 

Cuidados del cuerpo Dieta balanceada y saludable

Recuerde, debe plantear el problema relacionado con el tema que seleccionó y señalar las buenas prácticas a seguir.

Bibliografía  Audesirk, T. y Audesirk, G. (2008). Biología, La vida en la tierra. México: Prentice-Hall, Hispanoamericana  Nesse, R., Williams, G. (1999). Evolución y orígenes de la humanidad. Revista Investigación y ciencia. Enero.  Organización mundial de la salud. (2014) Global tuberculosis report. Documento online.  http://apps.who.int/iris/bitstream/10665/137094/1/9789241564809_eng.pdf?ua=1 ANEXO 1: LAS ENFERMEDADES MAS ANTIGUAS DE LA HISTORIA La existencia de enfermedades que atacan al ser humano es tan antigua como la de este mismo. Sin embargo, la adquisición de conocimientos científicos suficientes para tratarlas es mucho más reciente. De hecho, en toda su historia, el hombre solo ha sido capaz de erradicar por completo la viruela. Por ello, no debería resultar extraño que los arqueólogos hayan encontrado las huellas de muchas enfermedades relativamente frecuentes en la actualidad en fósiles con miles de años de antigüedad. Gracias a estas investigaciones, se desvelan algunas de las enfermedades más antiguas de la historia de la humanidad. Tuberculosis Esta enfermedad, que continúa siendo una epidemia en varias partes del mundo, posee unos orígenes que sitúan su nacimiento en, al menos, nueve mil años antes de nuestra era. Si bien el primer esqueleto en el que se detectó la enfermedad data de esa época, se cree que la tuberculosis ya existía hace medio millón de años. Es causada por Mycobacterium tuberculosis, una bacteria que casi siempre afecta a los pulmones. La afección es curable y se puede prevenir. La infección se transmite de persona a persona a través del aire. Cuando un enfermo de 32

tuberculosis pulmonar tose, estornuda o escupe, expulsa bacilos tuberculosos al aire. Basta con que una persona inhale unos pocos bacilos para quedar infectada. Cuando la enfermedad tuberculosa se presenta, los síntomas (tos, fiebre, sudores nocturnos, pérdida de peso, etcétera) pueden ser leves por muchos meses. Como resultado, los pacientes tardan en buscar atención médica y entre tanto transmiten la bacteria a otros. Neumonía La neumonía es una enfermedad que ataca el sistema respiratorio y que, en los casos más graves, puede llegar a provocar la muerte. Aunque no existen hallazgos arqueológicos claros de su existencia en épocas remotas, ya que ataca tejidos blandos, los científicos piensan que es una de las enfermedades más antiguas, por lo que llevaría atacando a los pulmones desde hace miles de años. Se caracteriza por la multiplicación de microorganismos en el interior de los alvéolos (Pneumocystis, Staphylococcus aureus, Streptococcus pneumoniae), Mycoplasmas pneumoniae, Chlamydias pneumoniae, entre otros), lo que provoca una inflamación con daño pulmonar. La reacción inflamatoria produce una ocupación de los alvéolos que puede visualizarse en una radiografía de tórax. Algunos casos debutan como neumonía típica, que consiste en la aparición en varias horas o entre 2 y 3 días de tos con


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

expectoración purulenta o herrumbrosa, en ocasiones con sangre, con dolor torácico y fiebre con escalofríos. Otras neumonías, llamadas atípicas, producen síntomas más graduales con décimas de fiebre, malestar general, dolores musculares y articulares, cansancio y dolor de cabeza. La tos es seca, sin expectoración, y el dolor torácico es menos intenso. Malaria La malaria, también denominada paludismo, es la enfermedad parasitaria más importante del ser humano. Está causada por diversas especies de un género de protozoos llamado Plasmodium que se transmite de un huésped humano a otro a través de la picadura de hembras de mosquitos del género Anopheles. Los chinos fueron los primeros en describir sus síntomas, hacia el año 2700 a.C. Sin embargo, los arqueólogos creen que su origen es todavía más antiguo, y la consideran responsable de la mitad de las muertes humanas desde la Edad de Piedra. Plasmodium falciparum es el parásito que causa casi todos los casos de malaria grave y complicada. La fiebre es el síntoma de la malaria por excelencia, y el más frecuente. Aunque no viene sola, ya que suele acompañarse de escalofríos, tiritonas, sudoración, cefaleas y dolores generalizados de músculos y articulaciones. Otros síntomas que pueden aparecer son vómitos y diarrea.

2015

El dengue es una enfermedad vírica transmitida por mosquitos que se ha propagado rápidamente en todas las regiones. El virus del dengue se transmite por mosquitos hembra principalmente de la especie Aedes aegypti y, en menor grado, de A. albopictus. La enfermedad está muy extendida en los trópicos, con variaciones locales en el riesgo que dependen en gran medida de las precipitaciones, la temperatura y la urbanización rápida sin planificar. Se debe sospechar que una persona padece dengue cuando una fiebre elevada (40 °C) se acompaña de dos de los síntomas siguientes: dolor de cabeza muy intenso, dolor detrás de los globos oculares, dolores musculares y articulares, náuseas, vómitos, agrandamiento de ganglios linfáticos o salpullido. Los síntomas se presentan al cabo de un periodo de incubación de 4 a 10 días después de la picadura de un mosquito infectado y por lo común duran entre 2 y 7 días. Tomado y modificado de: http://www.abc.es/tecnologia/redes/20140226/abcienfermedades-antiguas-historia-201402260929.html. http://www.dmedicina.com/enfermedades/respiratoria s/neumonia http://www.msal.gov.ar/salud-ydesastres/index.php/informacion-paraciudadanos/cuidados-de-la-salud/epidemias-brotesy-pandemias http://www.who.int/mediacentre/factsheets/fs117/es/ Acceso: Marzo 31 2015

Cólera El cólera es una enfermedad infecciosa producida por la bacteria – Vibrio Cholerae- que al ingresar al organismo de una persona puede provocar diarrea. En los casos más graves de diarrea severa, si la pérdida rápida de líquidos corporales no es tratada a tiempo puede llevar a la deshidratación, a la postración y al riesgo de muerte. Aunque no se han detectado casos de cólera desde el año 1999, existe el riesgo de introducción por la presencia de viajeros procedentes de países endémicos. El brote puede darse en cualquier región, dependiendo de la exposición de la población a aguas cloacales o aguas no tratadas y a alimentos contaminados con la bacteria. Dengue 33


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

ANEXO 2 Fotografías Actividad 2

34

Síntomas: Náuseas y vómitos en los estadios iniciales de la enfermedad. Calambres musculares, a consecuencia de la pérdida de sales minerales e iones por las heces. Deshidratación (irritabilidad, somnolencia, ojos hundidos, piel seca y pálida, boca seca…), shock si la pérdida de líquido es importante, pudiendo provocar que la presión sanguínea caiga, disminuyendo la cantidad de oxígeno que alcanza los órganos, y obligando al  corazón a trabajar más rápido. Cuidados: Cocer los alimentos completamente y consumirlos aún calientes. Evitar que los alimentos cocinados entren en contacto con los alimentos crudos para que no se contaminen, así como con el agua o el hielo, moscas, superficies contaminadas, cubiertos sucios y otros. No comer frutas ni verduras crudas sin quitar su cáscara en el momento del consumo, ni dejarlas expuestas. Medidas habituales de higiene que no hay que descuidar, como lavarse las manos antes de tocar cualquier alimento.

Síntomas: Fiebre alta y repentina. Dolor de cabeza. Molestias en las articulaciones y fuertes dolores musculares. Dolor de garganta y debilidad generalizada. Diarrea, vómitos y dolor de estómago. Aparición de una erupción rojiza en la piel. Congestión conjuntival (ojos rojos). Alteración de la función renal y hepática. En algunos afectados pueden observarse hemorragias internas y externas. Cuidados: Disminuir el contacto con animales salvajes que pudieran estar infectados como simios, monos y algunos tipos de murciélagos. Evitar el consumo de carne cruda. Empleo de guantes y prendas protectoras para manipular animales. Utilizar guantes, mascarillas y batas especiales para disminuir el riesgo de transmisión de persona a persona como consecuencia del contacto estrecho con personas infectadas, en particular con sus líquidos corporales. Lavarse las manos frecuentemente, sobre todo después de visitar a familiares enfermos en el hospital, así como después de haber cuidado a enfermos en el hogar.


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

Síntomas: Tos con flema por más de 15 días. Debilidad y cansancio. Pérdida de peso. Pérdida de apetito. Fiebre /sudores nocturnos Cuidados: Ventilar los ambientes para evitar la concentración de gérmenes. Abrir las ventanas y cortinas para iluminar los ambientes. La luz del día elimina la bacteria. Consumir alimentos sanos y de forma balanceada. Aplicar la vacuna al recién nacido.

2015

Síntomas: Anemia, heces con sangre, escalofríos, coma, convulsiones, fiebre, dolor de cabeza, ictericia, dolor muscular, náuseas, sudoración y vómito. Cuidados: Permanecer en habitaciones y zonas cerradas, especialmente durante la noche que es cuando los mosquitos tienen mayor actividad. Colocar mosquiteros en tus ventanas y si es posible que éstos contengan repelente contra insectos con permetrina. Utilizar ropa que cubra la mayor parte de tu cuerpo, sobre todo en zonas tropicales o de climas muy húmedos.

ANEXO 3. EDUCACIÓN SEXUAL EN COLOMBIA La sexualidad entre los adolescentes se ha venido desarrollando en los últimos años de una manera más abierta, sin precauciones y con muy pocos proyectos y desarrollo educativo, tanto desde la familia, como los colegios y el Gobierno, al punto que se ha convertido en un tema de salud pública. Recordemos que la sexualidad se encuentra presente durante toda la existencia humana, pero en la adolescencia se vive y manifiesta de manera un poco diferente a como se expresa en otras etapas de la vida. En este período surgen sensaciones e impulsos de tipo sexual que se encuentran relacionados con los cambios biológicos que enfrentan todos los adolescentes. En Colombia, la educación sexual se viene forjando de una manera inadecuada y no se están utilizando los medios y recursos necesarios para educar para la vida y no para el momento. Los índices, sin lugar a dudas, reflejan lo "rajados" que estamos en el tema, porque actualmente, con un 22.5%, este es el país con las más altas tasas de embarazo adolescente en el continente. Frente a la sexualidad, más que tratar de prevenir que los jóvenes se abstengan de tener relaciones, es lograr desarrollar conciencia y pleno conocimiento frente a los riesgos que se pueden generar, que van desde embarazos riesgosos hasta graves enfermedades sexuales, teniendo en cuenta que el VIH no es la única enfermedad.

35


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

Se requiere que dentro de la familia, la relación entre padres e hijos sea de confianza y haya comunicación respecto al tema. Es necesario mayor información para que los niños (as) y adolescentes conozcan las maneras de prevenir un embarazo a edad temprana. Sin embargo, hay que tener presente que los sexólogos más importantes del mundo y expertos en el tema aseveran que pasada la etapa de la adolescencia sería lo más adecuado para tener relaciones y dicen que entre más tarde se tengan relaciones sexuales, menores serán los perjuicios y riesgos que se tengan. Si bien es claro, y los expertos en el tema lo afirman, es que no existe la educación necesaria para que los adolescentes no repitan las mismas historias de sus madres, que tuvieron bebés siendo adolescentes y no hay conocimiento de los métodos de planificación familiar. Germán Salazar, director de la Red Colombiana de Jóvenes Líderes en Salud Sexual y Reproductiva, reconocido ginecólogo dice que "si entre todos no nos esforzamos por articular las instancias para que los jóvenes estén informados, conozcan las herramientas con las que cuentan para llevar una vida sexual responsable y encuentren escenarios apropiados para resolver sus inquietudes sobre estos temas, Colombia seguirá siendo el primer país del mundo con los índices más altos de infección por el Virus del Papiloma Humano en adolescentes, y cada vez será más frecuente ver mamás de 12 años paseando sus bebés en los parques". "El sexo es como un mal necesario: gusta mucho y cuando se hace hay que cuidarse": Anónimo. Tomado de: http://www.elcolombiano.com/educacion_sexual_en_colombia-LFEC_139736 Publicado: el 01 de julio de 2011

Imágenes sexualidad responsable

36


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

2015

UNIDAD DE APRENDIZAJE No. 5 LA REPRODUCCIÓN CONCEPTOS DE ESTUDIO         

Reproducción celular. Mitosis y meiosis, gametogénesis Reproducción en el reino vegetal. Reproducción asexual y sexual La flor, polinización Reproducción en el ser humano. Sistema femenino y masculino Genética y herencia ADN, molécula de la vida Leyes de Mendel Cruces monohíbridos y dihíbridos Dominancia y Codominancia Evolución

ACTIVIDADES DE INICIO Actividad No. 1 Objetivo:  Identificar el proceso de división celular en los procariotas  Comparar la división celular mitótica y meiótica Conceptos a desarrollar: Reproducción celular, ciclo celular, cromosoma, fisión binaria, mitosis, meiosis Aprendizaje en pequeño grupo. El profesor debe motivar con anticipación y guiar al estudiante a la búsqueda de información, libros de texto, enciclopedias, material gráfico que le permitan revisar previamente el tema de la división celular, para que llegando a la clase el estudiante tenga un conocimiento previo. 

El estudiante debe realizar un esquema en una hoja de papel acerca de cómo es el proceso de la fisión binaria en las procariotas y el profesor le solicitará al grupo quién de los estudiante les puede explicar el proceso al resto del grupo, después el profesor complementará la información si es necesario. Inmediatamente se realice la siguiente lectura, el profesor irá construyendo y definiendo conceptos claros acerca de la reproducción celular con ayuda de los estudiantes. Después en parejas completarán el cuadro comparativo de meiosis y mitosis.

Mitosis y Meiosis. El tiempo de vida de las células es variable, por lo que existen diferentes tazas de producción celular; en las somáticas, este evento ocurre a través de la mitosis. La mitosis es un proceso mecánico de división celular directa, de tal forma que las células hijas son iguales a la progenitora. En las células sexuales (gametos) la división es por medio de la meiosis. A diferencia de la mitosis, en la meiosis las células hijas son genéticamente distintas a la progenitora y tienen sólo la mitad del contenido genético. Incluso los gametos, resultado de una misma meiosis, son diferentes entre sí. Para poder entender mejor esta diferencia, es necesario saber cómo se organiza dentro del núcleo de la célula la información genética. Tanto los seres multicelulares (animales, hongos o plantas) como los 37


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

unicelulares (bacterias), están construidos de acuerdo a un “instructivo molecular” que permite que las características distintivas de cada especie sean heredadas a su descendencia. Este instructivo está constituido por Ácido Desoxirribonucleico (DNA) cuya estructura es en forma de doble hélice. El DNA tiene la información que codifica cada detalle de los seres vivos, como si fueran claves organizadas en elementos hereditarios llamados “genes” Podríamos visualizar a los organismos como “construcciones” realizadas de acuerdo a un detallado diseño genético, siguiendo una serie de instrucciones que están codificadas en una molécula de DNA (ácido desoxirribonucleico), la molécula de la herencia. Esta molécula está altamente organizada en estructuras denominadas cromosomas, los cuales siempre se encuentran en pares; si fuera posible poner en palabras las instrucciones del diseño genético contenido en estas estructuras, tendríamos millones de páginas de texto, indicando hasta el más mínimo detalle de la construcción. Si ahora pensamos que este gigantesco acervo informativo es diferente, no sólo para cada individuo de todas las especies imaginables, sino para cada una de las células sexuales, nos podremos percatar de la infinita gama de posibilidades con que la naturaleza cuenta como fuente de diversidad biológica gracias a la reproducción sexual. 1. Cuadro comparativo mitosis y meiosis

Comparación de la división celular mitótica y meiótica

Aspecto

Células en las que se lleva a cabo

Número final de cromosomas

Número de células hijas Número de divisiones celulares por replicación de DNA. Nombrar los diferentes eventos que la comprenden y explicarlas por un esquema

Función en los animales

38

División celular mitótica

División celular meiótica


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

2015

Actividad No. 2 Objetivo: Identificar el concepto de fenotipo y genotipo: Conceptos a desarrollar: fenotipo, genotipo Aprendizaje independiente. Analiza los siguientes esquemas y desarrolla las preguntas:

¿Es posible afirmar que hay dos o más fenotipos iguales? ¿Por qué? b) ¿Es posible afirmar que hay dos o más genotipos iguales? ¿Por qué? c) ¿Qué fenotipos son más parecidos entre sí? ¿Por qué? d) ¿Qué genotipos deberían ser más parecidos entre sí? e) ¿Por qué crees eso? f) ¿Cómo lo explicas?

ACTIVIDADES DE DESAROLLO Actividad No. 3 Objetivo: Diferenciar el mecanismo de reproducción sexual y asexual en plantas Conceptos a desarrollar: gametofito, esporofito, alternancia de generaciones, sistema vascular. Actividades a desarrollar: Aprendizaje en pequeño grupo. Previamente el estudiante debe llevar material de consulta al salón de clase, acerca del mecanismo de reproducción sexual y asexual de las plantas. 

Completar el siguiente mapa conceptual y completar la figura:

39


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

Aprendizaje en gran grupo. Con la guía del profesor y todos los estudiantes se realizará un mapa mental acerca de los diferentes tipos de reproducción vegetal asexual. Al azar el profesor preguntara a sus estudiantes y los ejemplos se discutirán en el aula de clase. Este mapa se puede desarrollar en el tablero.

Actividad No. 4 Objetivo: Reconocer el origen de la información genética en los cromosomas. Conceptos a desarrollar: Cromosomas, cariotipo, homólogos, autosomas. Aprendizaje en pequeño grupo. El estudiante debe desarrollar la siguiente lectura: Aunque la estructura de los cromosomas es bastante conservada dentro de los organismos, es posible encontrar una gran variedad de formas y tamaños. Cada diseño, sin embargo, aparece repetido dos veces en cada célula de un organismo, cada copia proveniente de uno de los padres. Además, para ayudar a su identificación y apareamiento, los cromosomas se tiñen en bandas específicas, como si se trataran de “códigos de barras”. Estos son los llamados cromosomas homólogos. El cariotipo 40


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

2015

corresponde a la ordenación de los cromosomas homólogos de acuerdo a pautas estandarizadas. El cariotipo humano posee 46 cromosomas agrupados en siete grupos y una pareja de cromosomas sexuales (XX en la mujer y XY en el hombre). Los 44 cromosomas no sexuales se denominan cromosomas autosómicos o autosomas. 

Encuentra cromosomas homólogos: Identifica las parejas de cromosomas homólogos entre estos 22 cromosomas. Se deben trabajar en parejas de estudiantes.

Anota las parejas en los siguientes espacios del cuadro: -

-

-

-

-

Actividad No 5 Objetivo:  Revisar algunos conceptos relacionados con la genética  Identificar la estructura de las moléculas que tiene que ver con la genética  Comprender las diferentes leyes de Mendel con sus respectivos cruces Conceptos a desarrollar: gametos, cruzamiento, genes, alelos, cromosomas sexuales, leyes de Mendel Aprendizaje independiente: El estudiante debe desarrollar la siguiente sopa de letras y aleatoriamente el profesor solicitará al grupo que cada uno de los estudiantes expliquen con sus propias palabras cuál es el significado de cada una de estas palabras.

41


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

ACTIVIVIDADES DE FINALIZACIÓN Actividad No. 6 

Los estudiantes de manera individual desarrollarán el siguiente cuestionario abierto de 15 minutos. CUESTIONARIO 1. Complete a.¿Cuál es la secuencia de nucleótidos en el DNA que determina una característica en un individuo?__________________________________________________________ b.¿Cómo se denominan a las formas alternativas de un gen?_________________________________________________________________ c.¿Los genes se encuentran en los cromosomas?_________________________________________________________ c. ¿Cómo se conoce a las características o rasgos observables de un organismo, como su morfología, desarrollo, propiedades bioquímicas, fisiología y comportamiento, es decir, lo que puede conocerse por medio de la observación de la apariencia externa de un organismo?________________________________________________________ 2. Marque con X la respuesta correcta a. Genotipo b. Homocigótico c. Fenotipo d. Cariotipo 3. Complete a. ¿Un individuo que tiene dos genes iguales para un carácter se denomina? _______________ b. ¿Un alelo que se manifiesta en el fenotipo (genotipo homocigótico o heterocigótico) y en el cual se utiliza la letra mayúscula para representarlo, es un alelo?_______________________ c. ¿Cuando hablamos de que un organismo posee dos copias diferentes de un gen para un rasgo dado en los dos cromosomas correspondientes, tales células u organismos se denominan?___________________________________________________________________ d. El DNA se compone de cuatro pequeñas subunidades llamadas nucleótidos. Cada nucleótido de DNA consta de tres partes que son: ____________________________________ 4. Marque con X la respuesta correcta a. Un grupo fosfato, un azúcar desoxirribosa y una de cuatro bases nitrogenadas b. Un grupo fosfato, un azúcar ribosa y una base nitrogenada c. Un grupo fosfato, un azúcar desoxirribosa y adenina d. Un grupo fosfato, un azúcar desoxirribosa y guanina 5. Marque con X la respuesta correcta

42


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

2015

Las dos cadenas de DNA se unen por intermedio de las bases nitrogenadas (A-adenina con Gguanina y C-citosina con T-timina), las cuales se unen entre sí gracias a los: a. b. c. d.

Puentes de hidrogeno Puentes de helio Enlaces débiles Precursores de DNA

1. Indica la secuencia de nucleótidos de la cadena complementaria a la cadena original: CACCATGAATCATCCAGTGA 6. Marque con X la respuesta correcta 6.1 Las bases nitrogenadas presentes en el ADN son: a. b. c. d.

Adenina, Ribosa, Citosina y Guanina Adenina, Timina, Uracilo y Guanina Adenina, Timina, Citosina y Guanina Adenina, Timina, Cromatina y Guanina 7. Marque con X la respuesta correcta 7.1 El modelo de la doble hélice de ADN fue propuesto por:

a. b. c. d.

Watson y Crick Wilson y Edward Walter y Mendel William y Gregor 8. ¿Cuál será la posible descendencia entre un cruce de un caballo de color de pelaje negro (heterocigótico) con una yegua de color de pelaje blanca (homocigótica recesiva)? Realiza el cuadro de Punnet con las proporciones fenotípicas y genotípicas. 9. Si en el mosquito los ojos rojos y las alas normales son caracteres dominantes ¿Cuál es la probable descendencia de un cruce entre un mosquito de ojos rojos heterocigótico y alas pequeñas y una mosca de ojos color blanco y alas normales heterocigótico? Realiza el cuadro de Punnet con las proporciones fenotípicas y genotípicas. 10. En el cruzamiento GGRr x GgRR las frecuencias esperadas en la descendencia serán:

a. b. c. d.

25% GGRR, 25% GgRR, 25% GGRr, 25% GgRr 100% GgRr 50% GgRR, 50% GGRr 75% GGRR, 25% GgRr 

Aprendizaje en gran grupo. Después de terminar el cuestionario se desarrollará con la ayuda del profesor, cada una de las preguntas. La intención es que con ayuda del profesor, lo estudiantes entiendan varios fenómenos de la genética mendeliana

43


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

UNIDAD DE APRENDIZAJE No 6 ECOSISTEMAS: ¿CÓMO SE DESARROLLA LA VIDA? CONCEPTOS DE ESTUDIO       

Ecosistemas: Concepto, Clasificación. Relaciones: Intraespecíficas e interespecíficas Flujo de energía: Redes tróficas Medio Ambiente: ciclo del agua, ciclos Biogeoquímicos y de las rocas Suelo: Morfología, clasificación, importancia, Micro y macrobiótica Clima: Forma de vida de las comunidades. Adaptaciones en los seres vivos

RECURSOS: Lecturas (Anexo 1 y 2), Papel periódico (pliegos), marcadores, textos de biología. ACTIVIDADES DE INICIO Objetivo: Contextualizar el concepto de ecosistema e identificar las diferentes interacciones que se presentan entre sus componentes. Conceptos a desarrollar: Biotipo, Biocenosis, Ecosistema.

Imagen 1, ilustración de los componentes del ecosistema de una laguna; tomado de http://www.caryinstitute.org/educators/teaching-materials/changing-hudson-project Aprendizaje en pequeño grupo: Dinámica: Lluvia de ideas

44


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

    

2015

En la imagen 1 se observa un ejemplo de cómo se desarrolla la vida en una laguna, en grupos de trabajo los estudiantes deben aportar y registrar ideas que den respuesta a las siguientes preguntas: ¿Cuáles son los componentes vivos (bióticos) y no vivos (abióticos) de ese sistema? ¿Cuáles de los componentes no vivos se pueden clasificar como factores físicos y cuales como factores químicos? ¿Qué efecto tienen los factores físicos sobre el ecosistema? ¿Qué efecto tienen los factores químicos sobre el ecosistema?

Aprendizaje en gran grupo: Cada grupo de trabajo escoge las mejores ideas entorno a cada pregunta y las escribe en el tablero para ser consideradas por el gran grupo. El docente debe realizar una síntesis del tema a partir de las ideas de los estudiantes. Actividad No. 1 Objetivo: Establecer relaciones tróficas y energéticas entre organismos en un ecosistema Conceptos a desarrollar: Cadena trófica, Flujo de energía y nutrientes en un ecosistema. Aprendizaje independiente: Los estudiantes deben relacionar la imagen 1 con la información contenida en la tabla N°1 y elaborar una cadena alimenticia donde indiquen el nivel trófico que ocupa cada organismo dentro de la cadena. Aprendizaje en gran grupo: Se escogen algunos ejemplos de las cadenas alimenticias elaboradas por los estudiantes y se escriben en el tablero. Los estudiantes deben construir una red trófica utilizando los componentes de las cadenas alimenticias. Tabla No 1 Hábitos alimenticios de los organismos de una laguna Especie

Habito Alimenticio

Ratón de campo “Mice”

Frutas, mortecinos y vegetales podridos.

Garza Azul

Crustáceos (cangrejos y camarones), también come peces, ranas e insectos.

“Great Blue Heron” Cucarachero pantanero “Marsh Wren"

Vegetación, insectos, arañas y caracoles.

“Red-Wing Black Bird”

Frutos, vayas y vegetación.

Rata almizclera

Plantas acuáticas y completa su alimentación con algunas presas animales, como peces, moluscos y crustáceos.

“Muskrat” Tortuga mordedora “Snapping Turtle”

Peces, ranas y aves como patos y gansos. Come plantas, incluyendo plantas subacuáticas en lagos y ríos. También se sabe que comen gusanos, serpientes marinas y sanguijuelas.

Especies de peces de agua dulce “Killifish and Mummichog”

Se alimentan de plantas y algas. 45


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

Actividad No 2 Objetivo: Reconocer las interacciones que pueden presentarse entre dos especies. Conceptos a desarrollar: Relaciones Intraespecíficas e interespecíficas Aprendizaje independiente: Con el apoyo de los textos de consulta, los estudiantes deben buscar la definición de cada tipo de interacción entre especies y diligenciar la Tabla N° 2 Aprendizaje en gran grupo: Se escogen 2 estudiantes por cada tipo de interacción  Uno de los estudiantes debe mencionar el ejemplo que propuso y el otro estudiante debe explicar si el ejemplo corresponde a la interacción mencionada, argumentando la respuesta.  El docente realiza la síntesis del tema a partir de las explicaciones de los estudiantes. Tabla No 2 Relaciones directas entre 2 especies Tipo de interacción

Ejemplo

Efecto en Especie 1

Efecto en Especie 2

Mutualismo Comensalismo Simbiosis Depredación Parasitismo Actividad No 3 Objetivos: 

Comprender la importancia de la preservación de especies y recursos para mantener el equilibrio ecológico  Identificar algunos de los posibles efectos que causa la introducción de una especie exótica en un ecosistema. Conceptos a desarrollar: Nicho ecológico, Competencia, Equilibrio de los ecosistemas Aprendizaje Independiente: Realice la siguiente lectura y responda las preguntas que aparecen al final. En la serie animada de los Simpson, recordarán el capítulo en el que Bart angustiado por el sentimiento de culpa por haber matado un pájaro, decide hacerse cargo personalmente de los huevos encontrados en el nido; para sorpresa de todos no se trata de huevos de un tierno pajarito sino de un oviraptor parasitario que pone sus huevos en nidos de otras aves, y luego se come los huevos originales. En la trama de la serie el voraz reptil pone fin a la supuesta infestación de palomas en Springfield, dándose el siguiente diálogo entre Lisa y el director Skinner: Director Skinner: Bueno estaba equivocado las lagartijas son una bendición al acabar con la plaga de palomas Lisa: ¿Qué pasará cuando estemos sometidos por las lagartijas? 46


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

2015

Director Skinner: No hay problema. Esparciremos oleadas y oleadas de serpientes aguja chinas. Ellas las exterminarán. Lisa: ¿Pero las serpientes no son peor? Director Skinner: Sí, pero estamos prevenidos. Llegará una especie de gorila que se alimenta de carne de serpiente. Lisa: Pero se quedaran los gorilas… Director Skinner: No, y eso es lo bueno: Cuando llegue el invierno morirán todos de frio. Adaptado de: https://books.google.de/books?id=c2fEa-tna4C&printsec=frontcover&hl=es#v=onepage&q&f=false 1. 2. 3.

En el relato las lagartijas exterminan a las palomas, en un caso hipotetico que las palomas fuesen el predador de una plaga determinada ¿Qué cree que sucederia? ¿Por qué cree que deben introducir una nueva especie como las serpientes aguja chinas para controlar a las lagartijas? ¿Que opinion tiene sobre las soluciones planteadas por el director Skinner para controlar el problema de sobrepoblación de especies? Realiza una propuesta para esta problemática.

Aprendizaje en pequeño grupo: En grupos de trabajo los estudiantes deben realizar una de las lecturas del anexo 1 y responder las siguientes preguntas:     

¿Que relacion encuentras entre el relato de los Simpson con la lectura? ¿Cual es la especie invasora? ¿Cómo se ven afectadas las especies nativas, directa e indirectamente? ¿Cuál es el papel del hombre en esta problemática? Explica que pasa con el equilibrio del ecosistema cuando desaparecen varias especies de plantas y animales

Aprendizaje en gran grupo: Cada grupo socializara sus respuestas, el docente debe guiar la actividad e ir recogiendo las reflexiones para construir el concepto de Habitat, nicho ecologico y competencia. Actividad No 4 Objetivo: Explicar la dinámica de los ciclos biogeoquímicos y de las rocas. Conceptos a desarrollar: Suelo, ciclos biogeoquímicos, ciclo del agua, ciclo del carbono, ciclo del fosforo, ciclo del nitrógeno, clima. Aprendizaje Independiente: Observe la imagen 2, realice la lectura del ciclo de las rocas y reflexione sobre los siguientes aspectos:   

¿Cómo influye el calor y la presión en las diferentes clases de rocas? ¿Cree conveniente realizar alguna modificación en el diagrama? argumente su respuesta. ¿El proceso de formación de rocas ígneas puede ocurrir en lugares donde no hay actividad volcánica?

47


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

Imagen 2, Representación del ciclo de las rocas; tomado de http://www.geologia.uchile.cl/las-rocas-ysus-procesos-de-formacion El ciclo de las rocas Este ciclo podría empezar en el interior de la Tierra, donde las temperaturas y presiones son lo suficientemente altas como para fundir las rocas preexistentes, dando como resultado un líquido caliente denominado magma. Este, al ser de menor densidad tenderá a ascender, enfriarse y cristalizar, formando una roca ígnea. Esta última puede convertirse en roca metamórfica o ser destruida por la erosión, en cuyo caso puede llegar a constituir más tarde una roca sedimentaria. El metamorfismo se da indistintamente en rocas ígneas, rocas sedimentarias u otras rocas metamórficas, cuando éstas quedan sometidas a altas presiones y altas temperaturas; las rocas sedimentarias son rocas que se forman por acumulación de sedimentos producidos por procesos de erosión y meteorización de rocas preexistentes.

Aprendizaje en pequeño grupo: Los estudiantes deben realizar la lectura de uno de los ciclos biogeoquímicos (anexo 2) y elaborar un diagrama explicativo en medio pliego de papel periódico. Aprendizaje en gran grupo: Cada pequeño grupo presentará a la plenaria el trabajo realizado. El docente debe realizar una síntesis del tema a partir de los diagramas mostrados. Actividad No 5 Objetivo: Comprender los diferentes tipos de adaptaciones de los seres vivos al medio. Conceptos a desarrollar: Adaptaciones en los seres vivos Aprendizaje Independiente: Las adaptaciones de los seres vivos pueden ser de tres tipos  Morfológica (estructural)  Fisiológica (funcional) 48


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

2015

Etológica (comportamiento)

El estudiante debe clasificar los siguientes ejemplos según el tipo de adaptación:     

En el grupo de los vertebrados existe un grupo de serpientes de coral, muy venenosas, imitadas en la composición de sus colores por una falsa coral totalmente inofensiva. Las orquídeas crecen sobre las ramas altas de los árboles o arbustos, sus raíces son aéreas y les sirven para absorber la mayor cantidad de humedad que sea posible. Vivir en la parte superior también les permite tener mayores posibilidades para recibir la luz del Sol. La mariposa hoja –muerta de indonesia, hace honor a su nombre, pues verdaderamente parece una hoja seca. El águila tiene muy desarrollado el sentido de la vista, sus garras y pico están adaptados para capturar a su presa y desgarrarla. El zorrillo expulsa sustancias tóxicas con las que ahuyentan a sus enemigos.

Aprendizaje en gran grupo: Los estudiantes socializan sus respuestas ante el gran grupo. El docente debe realizar una síntesis del tema a partir de las respuestas de los estudiantes. Actividad No 6 Objetivo: Representar vínculos entre los distintos conceptos que involucra la temática de ecosistemas. Aprendizaje Independiente: El estudiante debe realizar una lista de los diferentes conceptos trabajados en esta unidad didáctica y representar el vínculo entre ellos mediante un mapa conceptual. Aprendizaje en pequeño grupo: En grupos de trabajo los estudiantes intercambian sus mapas conceptuales y aclaran las posibles dudas con el profesor. Aprendizaje en plenaria: Cada pequeño grupo escogerá un mapa conceptual de uno de los integrantes del grupo y lo presentará a la plenaria. El profesor hará una síntesis del tema a partir de la revisión hecha. Bibliografía Recomendada      

AUDESIRK, T y AUDESIRK, G. Biología. Prentice Hall. México: (1996) CURTIS, H. y BARNES, N. Biología. Panamericana. Madrid: (2001) GONZÁLEZ, A y MEDINA, N. Ecología. Mc. Graw Hill. México: (1995) GUTIERREZ, L. Biología: los seres y la naturaleza. Educar editores. Bogotá: (1984) PARGA, D. Nuevo Investiguemos 6. Voluntad. Colombia: (2000). PARGA, D. Nuevo Investiguemos 7. Voluntad. Colombia: (2000).

49


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

ANEXO 1 LA RANA QUE SE COME A LOS ANFIBIOS DE COLOMBIA POR: EL TIEMPO |31 DE OCTUBRE DE 2014 La rana toro, una especie de Estados Unidos que fue introducida a Colombia a través de Brasil, está acabando con los sapos del país, según publicó la Agencia de Noticias de la Universidad Nacional. Según el estudio del biólogo de esta institución José Vicente Rueda, esta rana, de cabeza ancha y cuyo peso puede alcanzar una libra, se caracteriza por su apetito voraz y su capacidad de engullir desde insectos, lombrices y serpientes, hasta pájaros y otros anfibios. De hecho, tan solo seis años después de su introducción (1998) se comenzaron a detectar poblaciones densas y consolidadas de esta especie en los valles del Magdalena y Cauca, donde la especie causó desequilibrio en el ecosistema, pues entró a competir por espacio y alimento con las especies nativas. De otro lado, mientras las especies locales limitan sus tasas de reproducción a las condiciones de su medio, la rana toro explota las suyas al máximo para colonizar. De hecho, este animal tiene la capacidad de poner hasta 20.000 huevos, y los renacuajos, según las condiciones climáticas, pueden saltarse el proceso de metamorfosis para pasar a adultos, por lo que hoy se calcula que pueden encontrarse en todo el territorio nacional, incluso en los jardines de la Universidad Nacional, sede Bogotá. De esta forma, a pesar de que en Colombia hay más de 600 especies de ranas nativas, muchas de ellas están desapareciendo a causa de la invasora, advierte en su nota la Agencia de la U. Nacional. En el estudio de la U.N. se analizaron los contenidos estomacales de 60 ranas y se encontró que predan cualquier tipo de organismo que esté a su alcance y quepa en su gran boca. PEZ LEÓN PUEDE COMERSE HASTA 200 ESPECIES POR: EL TIEMPO |24 DE SEPTIEMBRE DE 2014 Esta especie invasora que afecta al mar Caribe come al menos 100 clases de peces y 30 de crustáceos. La voracidad del pez león, la especie invasora del océano Índico que está haciendo estragos en todo el Caribe, llega al punto de que puede llegar a comerse más de 200 especies de peces y crustáceos. La estimación fue identificada por la bióloga Paula Estefanny Pabón Quintero, de la Universidad Nacional, quien hizo su trabajo sobre la ecología trófica de este pez, científicamente llamadoPteoris volitans. “Este pez puede consumir más de 200 especies, aun cuando se tiene reportado que se alimenta de un mínimo de 100 clases de peces y alrededor de 30 de crustáceos”, concluyó Pabón. Sumado al hecho de que tenga un apetito tan grande, el pez tiene un enorme impacto ambiental al poder comer todo lo que encuentra a su paso. Un ejemplo de riesgo a estos ecosistemas marinos tiene que ver con la preferencia del depredador por la especie Thalassoma bifasciatum, un pez colorido que puede llegar hasta los 25 centímetros de largo y que se encarga de limpiar a otros peces de parásitos. También en la dieta del Pteoris volitans figuran los herbívoros como el pez loro. Sin la preesencia de ellos dos se 50


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

2015

genera un crecimiento masivo de algas desfavorable para los corales. Este pez, pequeño y aparentemente inofensivo, llegó al Caribe luego de que algunos ejemplares que fueron llevados a La Florida en la década de los 90 y quedaron libres cuando el huracán 'Andrew' (1992) destruyó un acuario artificial. Aunque no se descarta que sus larvas hayan podido llegar en barcos mercantes que acumulan agua en sus compartimientos. Su erradicación será imposible y por eso la única opción que existe, según lo sugieren los expertos, es que quienes dependan del mar aprendan a convivir con él. Porque así como es una amenaza, el pez león también ofrece usos potenciales que podrían revertir su condición maligna. Es ponzoñoso aunque su veneno no es letal para los humanos. Sin embargo, se ha establecido que esa sustancia que segrega para defenderse produce efectos antitumorales, hepatoprotectores y antimetastásicos en ratones, lo cual puede ser prometedor para las investigaciones sobre cáncer en humanos. También, según la Universidad Nacional y muchos chefs nacionales, puede ser una opción alimenticia para las comunidades costeras. Se puede comer como un filete, en ceviche o crudo y como ingrediente para sushi. LA INVASIÓN DEL CARACOL AFRICANO POR: EL ESPECTADOR |22 DE AGOSTO DE 2013 El caracol gigante africano ataca a 800 especies vegetales. En Colombia ha desplazado a las especies nativas y está presente en 110 municipios. En 2010, cuando abundaban los anuncios publicitarios sobre las cremas de baba de caracol para curar las cicatrices y eliminar las arrugas, los campesinos del municipio de Agua de Dios empezaron a notar que en la noche desaparecían los cultivos. Detrás de las plantaciones de yuca y maíz estaba una de las 100 plagas más peligrosas del mundo, según la Unión Internacional para la Conservación de la Naturaleza (UICN): el caracol gigante africano (Achatina fulica), que puede medir hasta 25 cm. En ese entonces, dice la Corporación Autónoma Regional de Cundinamarca (CAR), se había reportado la presencia del caracol africano en Putumayo: “Hoy está en 26 departamentos. Se ha extendido hasta 110 municipios del país. Ataca a cerca de 800 especies de plantas y se alimenta de heces y otros materiales orgánicos. Suele encontrarse en las plantaciones de tubérculos, hortalizas, árboles, cacao y café”, explica Juan Pablo Pinedo, veterinario experto en este tipo de moluscos y funcionario de la CAR. En la CAR aseguran que el caracol aún no tiene ningún enemigo natural en Colombia, que ha desplazado a los caracoles nativos y que cada 21 días puede poner de 100 o 400 huevos. Si una persona entra en contacto directo con la baba de caracol, dice Pinedo, “se puede generar una trombosis, una apendicitis o, lo más grave, una meningoencefalitis eosinofílica, que puede llevar a la muerte. Esto sucede cuando algunos caracoles africanos tienen el parásito Angiostrongylus, que puede migrar al sistema nervioso central”. Los investigadores de la corporación explican que los caracoles gigantes adquieren el parásito al alimentarse de los cadáveres de las ratas e inmediatamente lo transfieren al ser humano cuando éste entra en contacto con el molusco. El Instituto de Ciencias Naturales de la Universidad Nacional realizó un trabajo sobre el caracol gigante africano en seis departamentos. De acuerdo con los resultados se pudo establecer que la región Andina tiene más municipios con presencia del caracol (48), en comparación con las demás regiones: Orinoquia (29), Amazonia (21) y Caribe y Pacífica (5). “La mayor concentración de municipios 51


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

infestados se encuentran en el piedemonte de la cordillera Oriental, en las regiones de la Orinoquia y la Amazonia, y a lo largo de los valles interandinos de los ríos Magdalena y Cauca”, señala el estudio. Los profesores Édgar Linares y Fernando Fernández han liderado la investigación y explican que en algunos casos los campesinos, desesperados, han optado por quemar sus árboles o sus cosechas ante la reproducción masiva de los caracoles. Además hicieron un llamado a las empresas que transportan este tipo de moluscos: “La invitación es a que no continúen transportando al caracol gigante africano, a que no crean que la baba rejuvenece y a que comuniquen a la autoridad más cercana sobre su presencia”. Anexo 2

Ciclo del Carbono El carbono se encuentra como dióxido de carbono (CO2) en estado gaseoso en la atmosfera, solamente los organismos productores como plantas y algas pueden transformarlo en moléculas orgánicas como la glucosa mediante el proceso de la fotosíntesis. A partir de ahí los demás organismos obtienen el carbono que necesitan en forma de glucosa, mediante las relaciones alimenticias que constituyen las cadenas tróficas. Posteriormente mediante el proceso de respiración devuelven parte del CO2 a la atmosfera. Cuando los animales y las plantas mueren, parte del carbono almacenado en sus restos regresa nuevamente a la atmosfera en forma de CO2, por acción de los descomponedores. Otra parte del carbono es acumulado y eventualmente transformado, durante el proceso de fosilización, en combustibles fósiles como el gas natural, el carbón y el petróleo. La combustión es la reacción química en la que uno de estos combustibles fósiles reaccionan con oxigeno para producir dióxido de carbono y agua y liberar energía, generalmente en forma de calor y luz. El carbono también se encuentra presente en los sistemas acuáticos y hace parte de las algas y de los organismos presentes allí. Se encuentra disuelto en el agua en forma de carbonato de calcio, en las conchas de algunos animales marinos. Este carbono puede pasar directamente del agua hacia la atmosfera, o también mediante los procesos de respiración, fotosíntesis y descomposición, desde los organismos hacia la atmosfera.

52


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

2015

Ciclo del fósforo En los ambientes terrestres el fósforo se encuentra en las rocas y el suelo. La escorrentía del agua por las rocas y el suelo disuelve y arrastra este elemento en forma de fosfatos. Una parte de estos son absorbidos por las plantas a través de las raíces y luego son incorporados en sus tejidos y utilizados para construir moléculas como los ácidos nucleicos y el ATP. Los consumidores obtienen el fósforo que necesitan a través de las cadenas tróficas e igualmente lo incorporan en sus moléculas. El fósforo vuelve al suelo en los productos de excreción de los organismos y, así mismo, cuando plantas y animales mueren regresa al suelo en forma de fosfato debido a la acción de los descomponedores, quedando disponible para el uso de las plantas. En los ambientes acuáticos el proceso es bastante similar parte del fósforo disuelto en el agua es absorbido por los productores e incluso por los consumidores cuanto beben agua luego pasa a otros organismos mediante las cadenas tróficas. Una parte de los fosfatos cae al fondo del mar junto con los sedimentos donde se acumula y luego de millones de años son incorporados en las rocas.

Tomado y adaptado de: Hipertexto 7 Ciencias Naturales Santillana

Ciclo del nitrógeno El primer paso en la transformación del nitrógeno es la fijación del nitrógeno. El nitrógeno puro que se encuentra en la atmosfera es transformado en nitratos, nitritos y amoniaco por la acción de algunas bacterias del suelo. Posteriormente durante la asimilación, las plantas absorben a través de las raíces los compuestos nitrogenados formados por las bacterias (nitratos, nitritos y amoniaco) e incorporan de esta forma el nitrógeno a sus tejidos. A partir de ahí los demás organismos pueden obtener el nitrógeno del alimento que ingieren. Durante la amonificación, los compuestos nitrogenados producidos por los animales en la orina así como los que se producen como resultado de la descomposición de los organismos muertos son transformados nuevamente en amoniaco y permanecen en el suelo para continuar con el ciclo. Por último durante la desnitrificación, bacterias anaeróbicas transforman los nitratos y liberan nitrógeno puro en forma de gas a la atmósfera.

53


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

Ciclo del agua En nuestro planeta el agua se encuentra en tres estados: sólido, líquido y gaseoso. El ciclo del agua comprende las transformaciones físicas que sufre el agua mientras pasa de la atmosfera a la superficie de la tierra, a los organismos y regresa nuevamente a la atmosfera. Este ciclo comienza con la evaporación en los mares y en los continentes y la transpiración de los organismos, especialmente de las plantas. Este proceso se conoce como evapotranspiración. El vapor de agua en el aire se enfría y se convierte en agua líquida por el proceso de condensación, formando nubes. Posteriormente el agua cae nuevamente a la superficie de la tierra como precipitación, en forma de lluvia, nieve o granizo. Parte de esta agua cae en cuerpos de agua como ríos, lagos y el océano. Otra parte cae sobre el suelo. El agua que llega al suelo es una parte absorbida y llega a depósitos subterráneos por debajo de la superficie. El agua que no es absorbida se desliza por la superficie arrastrando nutrientes y sedimentos proceso que se conoce como escorrentía superficial. Tomado y adaptado de: Hipertexto 7 Ciencias Naturales Santillana

54


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

2015

UNIDAD DE APRENDIZAJE No 7 ¿CÓMO INFLUIMOS EN LOS ECOSISTEMAS? CONCEPTOS DE ESTUDIO       

El agua: Contaminación, uso adecuado, cuidado de los ríos Calentamiento Global: Causas y consecuencias Basuras y su manejo La minería: carbón, oro, petróleo Contaminación ambiental Urbanismo y Paisajismo Mascotas-Tráfico de animales exóticos

RECURSOS: Marcadores para tablero y para cartelera, pliegos de papel periódico, copia de lecturas e información complementaria, copias de imágenes (ciclo del agua), constitución Política de Colombia. ACTIVIDADES DE INICIO Objetivo: Recordar y reforzar conceptos previos que los estudiantes deben manejar para abordar la temática de esta unidad, mediante una actividad de intercambio de conocimientos. Actividad No 1. Introducción del tema de la Unidad Se inicia la clase con una actividad de disposición que consiste en:    

Ponerse en pie y saludar al que está al lado Luego buscar una persona diferente para saludarlo, preguntarle de qué lugar viene ( si de casa , del trabajo u otro lugar de estudio) Finalmente buscar otra persona e indagarle ¿cómo cree que los ecosistemas se ven afectados por su intervención directa? Con esa última persona sentarse y determinar relaciones causa y efecto y consignarlos en sus cuadernos para los siguientes términos:

Calentamiento Global, problemática ambiental, impacto ambiental, contaminación ambiental, paisajismo, animales exóticos, normatividad ambiental, autoridades ambientales. A continuación el docente dirige la socialización de dichos conceptos, generando dos participaciones por cada término; paralelamente el docente retoma las ideas y aportes de los estudiantes y refuerza la definición de dicho término dando un ejemplo puntual.

55


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

ACTIVIDADES DE DESARROLLO Objetivo: Afianzar en los estudiantes algunas temáticas propias del componente ecosistémico, mediante el desarrollo de diversas actividades que involucran el estudio y análisis de impactos ambientales, permitiéndoles así reconocer la incidencia del hombre en dichos ecosistemas. Actividad No 2. Existencia del ciclo del agua Vs. existencia del hombre Aprendizaje independiente: En la siguiente imagen indicar los procesos que suceden, al igual que los reservorios principales que permiten que dichos procesos se den.

CICLO DEL AGUA Fuente: http://educativa.catedu.es/44700165/aula/archivos/repositorio/2500/2578/html/3_el_ciclo_ del_agua.html Aprendizaje en pequeño grupo: A continuación organizar grupos de 4 personas para compartir y explicar cada uno la interpretación de la imagen anterior y responder las siguientes preguntas:   

¿Qué cambios físicos presenta el agua en el ciclo? ¿Cómo se puede alterar dicho ciclo? ¿Qué relaciones se pueden establecer entre la vida del hombre y la existencia de dicho ciclo? Aprendizaje en gran grupo: 

Se socializa por grupos pequeños el trabajo realizado, y las respectivas conclusiones a las que como equipo llegaron. Describiendo ejemplos que contextualicen al grupo en general

Actividad No. 3 56


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

2015

Problemáticas ambientales en Colombia Aprendizaje Independiente: Realizar lectura del ANEXO 1 “IMPACTO CALENTAMIENTO GLOBAL EN COLOMBIA”, identificando ideas principales.

DEL

Aprendizaje en pequeño grupo: Organizar grupos de 4 integrantes, para socializar sus apreciaciones respecto al artículo leído y luego dar respuesta a los siguientes interrogantes:   

¿Cómo incide el manejo de basuras en la producción o no del calentamiento global? Qué relaciones positivas o negativas existen entre: La minería, los ecosistemas y el calentamiento global. Elaborar un mapa conceptual en un pliego de papel periódico que describa aspectos generales del análisis del texto “IMPACTO DEL CALENTAMIENTO GLOBAL EN COLOMBIA” y de las respuestas de las anteriores preguntas.

Aprendizaje en gran grupo : Se pegan en el tablero los diferentes mapas elaborados y se seleccionan al azar 3 personas para que expongan los mapas conceptuales, se propicia un espacio de debate para analizar las respuestas de cada grupo y llegar a establecer conclusiones respecto a las incidencias de las actividades antropológicas respecto a la gran problemática del Calentamiento Global. Actividad No. 4 ¿Normatividad ambiental y entidades ambientales solución o problema? El estudiante para el desarrollo de esta actividad debe realizar consulta previa del SINA. Se seleccionan estudiantes al azar para que expongan según lo consultado sobre la organización del SINA, Sistema nacional ambiental y que describa brevemente la normatividad ambiental Colombiana usando ejemplos sencillos. Aprendizaje Independiente: Teniendo en cuenta la información del anexo 2, el material de consulta y la constitución Política de Colombia, analizar la siguiente situación e indicar las entidades territoriales que podrían intervenir y qué leyes se aplican (Cumplimiento o incumplimiento). Situación: Dos hectáreas de la zona del páramo de Sumapaz que es intervenida por campesinos desplazados; utilizan la zona como vivienda y lugar para cultivar papa, haciendo uso de herbicidas, fungicidas y abonos de carácter inorgánico que favorecen la producción. Aprendizaje en gran grupo: Se discute la situación problema con participación voluntaria de los estudiantes y se identifican las entidades territoriales que podrían intervenir y las leyes que se aplican para el caso. ACTIVIDADES DE FINALIZACIÓN Objetivo: Afianzar los conocimientos trabajados mediante una actividad de cierre que le permita al estudiante aplicar lo aprendido a situaciones reales.

57


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

Actividad No 5. Aprendizaje en gran grupo: Organizar grupos de 5 integrantes y por grupo escoger un Impacto ambiental, una problemática ambiental, y un tipo de contaminación ambiental del listado propuesto en la tabla 1. A partir de la elección del impacto ambiental preparar una exposición donde: 1.

Se explique dicho impacto, problemática y tipo de contaminación, describiendo una situación problema real colombiana.

Orden de la exposición. a. b. c. d.

Dar a conocer la situación problema planteada Explicar el impacto, el problema y el tipo de contaminación Explicar la incidencia de estos procesos en los ciclos biogeoquímicos Explicar la relación e incidencia de estos impactos en los ecosistemas Colombianos y el paisajismo

2.

Socializar por grupos el trabajo realizado y dar a conocer sus apreciaciones respecto a la incidencia antropológica en los ecosistemas.

Tabla 1. Listado de Impactos Ambientales IMPACTO AMBIENTAL Perdida de corredores ecológicos. Pobreza en Colombia Desalojamiento de asentamientos indígenas Alteraciones a los ecosistemas Incremento de enfermedades Disminución de capacidad de captación de CO2 en el amazonas Incremento de extinción de especies de flora y fauna Extinción de áreas protegidas y conservadas Enfermedades (respiratorias, digestivas, otras)

58

PROBLEMA AMBIENTAL

TIPO DE CONTAMINACIÓN


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

2015

Actividad No 6. Aprendizaje en casa: Como actividad de sensibilización y práctica Ambientalista, cada estudiante debe construir un listado de acciones que fomentara en su hogar y su lugar de estudio o trabajo para disminuir el calentamiento global, indicando la estrategia que implementará. Enviar la propuesta al correo del docente.

59


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

UNIDAD DE APRENDIZAJE No 8 MATERIA Y ENERGÍA: ¿CÓMO ESTÁ CONSTITUIDO EL MUNDO QUE NOS RODEA? CONCEPTOS DE ESTUDIO Materia, estados de la materia, energía, energía cinética, energía potencial, energía térmica, sustancia, compuesto, elemento, átomo. OBJETIVOS 

Reconocer y dominar los conceptos de materia y energía, así como las distintas expresiones de materia y energía en el medio natural. También, los conceptos de sustancias, compuestos y elementos, en el marco del átomo como concepto fundamental. Establecer relaciones comparativas específicas, en el caso particular entre distintas expresiones de la materia y energía. Se espera así miso que las relaciones comparativas estén efectivamente asociadas a procesos de descripción, explicación y evidencia. Discernir entre argumentos y opiniones, permitiendo reconocer distintos puntos de vista y compararlos con las propias elaboraciones conceptuales.

RECURSOS: Marcadores, papel periódico en pliegos, resorte, globo, caucho, pelota. ACTIVIDADES DE INTRODUCCIÓN E INDUCCIÓN Actividad No. 1 Introducción: Objetivo: Recordar, organizar y disponer de los conceptos previos relativos a la materia y la energía para su posterior organización y complementación durante la sesión. Aprendizaje independiente: Desarrollen de manera individual el test SQA anexo (ANEXO 1) relativo a la materia y la energía, especificando tanto qué se sabe, como qué se quiere aprender de la temática La materia y la energía. Aprendizaje en gran grupo: Mediante una sesión corta algunos aprendientes comparten las respuestas generales a las preguntas qué sé y qué quiero aprender respecto a la temática La materia y la energía, luego de lo cual, con ayuda del instructor organizarán los conocimientos previos presentados y aclararán aquello que se desarrollará en el resto de la sesión.

60


Actividad No. 2 La materia Objetivo: Reconocer el concepto y las características de la materia. Relacionar efectivamente el concepto de materia con el entorno circundante y los fenómenos perceptivos. Aprendizaje en pequeño grupo: En un pliego de papel y organizados en grupos de trabajo de 3 aprendientes, elaboren un mapa mental asociado a la materia y sus características fundamentales a partir de la exploración de los textos disponibles y la discusión en grupo. Tengan en cuenta que un mapa mental es un diagrama en el que se representan palabras, ideas, procesos o conceptos ligados y dispuestos alrededor de una idea central, que en este caso será LA MATERIA. Aprendizaje en gran grupo: Dispongan de los mapas mentales desarrollados en grupo a lo largo del salón para poder ser compartidos con los demás grupos de trabajo. Junto a su profesor, organicen y agrupen la información recopilada generando un mapa conceptual relativo a la materia y sus características fundamentales. ACTIVIDADES DE APRENDIZAJE Y DESARROLLO Actividad No. 3 La energía Objetivo: Reconocer el concepto y los tipos fundamentales de energía. Relacionar efectivamente las distintas formas de energía con los fenómenos perceptibles. Relacionar efectivamente la energía con los cambios y distintas expresiones de la materia. Aprendizaje independiente: Realicen de manera individual la lectura (ANEXO 2). La energía y sus expresiones) buscando ejemplos de cómo las distintas formas de energía se perciben en las actividades cotidianas. Aprendizaje en pequeño grupo: Organizados en pequeños grupos de trabajo de 3 y con ayuda de los materiales dispuestos (resorte, globo, caucho, pelota) seleccionen un tipo de energía y preparen un ejemplo para exponerla a los demás grupos de trabajo. Aprendizaje en gran grupo: A manera de plenaria los grupos pequeños expondrán un tipo en particular de energía a través de los elementos dispuestos. Junto a su profesor, compilen y organicen los datos recolectados en una tabla que exponga los tipos fundamentales de energía. Luego de esto respondan: 

¿Existe alguna relación entre la energía cinética y la propiedad de la materia conocida como temperatura? Cual es:

¿Existe alguna relación entre la energía cinética y la propiedad de la materia conocida como presión? Cual es:

61


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

Actividad No. 4 Estados de la materia Objetivos: Relacionar las características y propiedades fundamentales de la materia con los distintos estados de la misma. Relacionar los estados de la materia con el flujo de energía. Fomentar el análisis de imagen. Aprendizaje en pequeño grupo: Organizados en grupos de trabajo de 3 relacionen los estados de la materia presentes en la imagen 1 (ANEXO 3) con las características y propiedades de la materia mencionadas y organizadas anteriormente (ACTIVIDAD 2) respondiendo a las preguntas:  

Revisando las propiedades básicas de la materia consignadas anteriormente (ACTIVIDAD 2) ¿Cuáles de estas propiedades cambian comparando las distintas fases de la materia? ¿Qué propiedades permanecen constantes comparando las distintas fases de la materia?

Aprendizaje en pequeño grupo: Organizados en grupos de trabajo de 3 observen la imagen 2 (ANEXO 3) y discutan la información relativa al cambio de fases de la materia en función de las variables presión y temperatura, así como la relación entre las variables presión y temperatura con las distintas formas de energía, respondiendo a las preguntas:    

¿Cómo se explican los cambios de fase cuando se mantiene una presión constante y se modifica la temperatura? ¿Cómo se explican los cambios de fase cuando se mantiene la temperatura constante y se modifica la presión? ¿Cuáles cambios de fase están asociados a la liberación de energía y porque? ¿Para cuáles cambios de fase se necesita incorporar energía y porque?

Aprendizaje en gran grupo: Junto a su profesor, compilen y organicen las respuestas y conclusiones presentadas por los grupos de trabajo conformado una tabla de las diferencias fundamentales entre los distintos estados de la materia. Aprendizaje en gran grupo: Planeen junto a su profesor un pequeño experimento que se pueda llevar a cabo en casa para demostrar cómo a menor presión, la temperatura necesaria para llevar al agua a punto de ebullición de reduce. ACTIVIDADES DE FINALIZACIÓN Actividad No. 5 El átomo

62


Objetivo: Asociar el concepto de materia con conceptos de sustancia, compuesto y elemento químico. Asociar estos al concepto de átomo. Familiarizarse con el proceso de análisis. Desarrollo A manera de introducción escucharán una breve introducción al concepto de elemento por parte de su profesor. Aprendizaje independiente: Luego de la introducción, observe el diagrama de flujo en la imagen 4 (ANEXO 3). En función de este y bajo la premisa de que la unidad estructural fundamental de un elemento es el átomo responda las preguntas: 

¿Qué propiedades descritas para la materia son también propiedades del átomo? __________________________________________________________________

¿Qué es un compuesto químico? ____________________________________________________________________ ¿Se pueden obtener elementos químicos a partir de una mezcla heterogénea de materia? __________________________¿Cómo?________________________ Tenga en cuenta que el diagrama de flujo representa un esquema de procedimientos a seguir para separar distintos tipos de sustancias.

Actividad No. 6 Autoevaluación Objetivo: Reflexionar sobre el desempeño individual en el proceso de aprendizaje Aprendizaje independiente: Cada aprendiente completará el test SQA inicial (ANEXO 1) desarrollando la pregunta ¿Qué aprendí? Aprendizaje en gran grupo: Mediante una sesión corta de plenaria se darán a conocer algunas respuestas generales a la pregunta qué aprendí, dando por finalizada la unidad didáctica.

63


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

ANEXO 1. Test SQA ¿QUÉ SE?

64

¿QUÉ QUIERO SABER?

¿QUÉ APRENDÍ?


ANEXO2. LECTURA1 LA ENERGÍA Y SUS EXPRESIONES El hombre, desde su existencia, ha necesitado la energía para sobrevivir. Pero… ¿qué es? ¿Por qué tiene tanta importancia la energía? ¿Por qué es importante el ahorro energético? La energía es la capacidad de los cuerpos para realizar un trabajo y producir cambios en ellos mismos o en otros cuerpos. Es decir, la energía es la capacidad de hacer funcionar las cosas. La energía se manifiesta de diferentes maneras, recibiendo así diferentes denominaciones según las acciones y los cambios que puede provocar. Encontramos así energía mecánica relacionada con la posición y el movimiento del cuerpo, y que se divide en energía cinética y energía potencial. Energía cinética, que se manifiesta cuando los cuerpos se mueven, es decir, es la energía asociada a la velocidad de cada cuerpo. Y energía potencial, que hace referencia a la posición que ocupa una masa en el espacio y el potencial o la posibilidad que tiene de realizar un trabajo en función de su posición. En la energía potencial encontramos la energía gravitatoria, que es la que posee un sistema debido a su posición en el campo gravitatorio; así como la energía elástica que es la que adquiere un sistema elástico cuando es deformado fuera de su posición de equilibrio. La energía eléctrica está relacionada con la corriente eléctrica, es decir, en un circuito en el que cada extremo tiene una diferencia de potencial diferente. Las cargas eléctricas se mueven desde donde tienen mayor energía potencial a donde su energía potencial es menor transformado esta diferencia de energía potencial en energía eléctrica. La energía química se manifiesta en determinadas reacciones químicas. Un buen ejemplo es la reacción de combustión. La energía radiante de tipo electromagnética como las radiaciones que provoca el Sol se manifiesta en forma de luz, radiación infrarroja u ondas de radio. La energía térmica se asocia con la cantidad de energía que pasa de un cuerpo caliente a otro más frío manifestándose mediante el calor. Así pues la energía es una propiedad asociada a los objetos y sustancias, y se manifiesta en las transformaciones que ocurren en la naturaleza pasando de un tipo de energía a otro y siguiendo el principio de conservación, el cual dice que la energía no se crea ni se destruye, sino se transforma.

1

Tomado y modificado de http://www.endesaeduca.com/Endesa_educa/recursos-interactivos/conceptosbasicos/i.-la-energia-y-los-recursos-energeticos, http://newton.cnice.mec.es/materiales_didacticos/energia/aulaenergia.pdf,

65


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

ANEXO 3. IMÁGENES

Imagen 1. Estados de la materia y transformaciones. Adaptado de Los fundamentos: los estados de la materia. http://democritus.me/2007/08/22/los-fundamentos-losestados-de-la-materia/

Imagen 2. Diagrama de fase, la línea azul representa una situación donde la presión permanece constante y la temperatura aumenta, situación que corresponde a la Imagen 3. Tomado y modificado de http://es.wikipedia.org/wiki/Diagrama_de_fase

66


Imagen 3. Ejemplo del cambio de fases de una sustancia (agua) a una presiรณn constante.

Imagen 4. Diagrama de flujo. La materia

67


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

UNIDAD DE APRENDIZAJE No 9 ÁTOMO, ENLACE Y NOMENCLATURA CONCEPTOS DE ESTUDIO  Estructura de la Materia y Modelos atómicos  El átomo como unidad mínima de materia en química  Partículas Subatómicas  Nomenclatura: número atómico, masa (isótopos), iones atómicos  Modelos atómicos: El camino desde Dalton a Schrödinger  Tabla periódica  La tabla periódica: La necesidad de clasificar  Periodicidad: el resultado de la clasificación  Propiedades de los átomos: potencial de ionización, electronegatividad, volumen y radio atómico  Enlaces químicos  Tipos de enlace  Formulas empírica, molecular y estructural  Clasificación de compuestos inorgánicos según su comportamiento químico  Funciones químicas Recursos: Textos de química básica, tabla periódica, clips grandes y pequeños, hojas papel iris azul verde y rojo, papel periódico, grapadora, papel milimetrado, esferos marcadores y otros ACTIVIDADES DE INICIO Actividad No 1. Estructura de la materia y modelos atómicos Objetivo: Establecer como marco de trabajo de la química la materia y la visión microscópica de ésta (el átomo). Aprendizaje en pequeño grupo 

En pequeños grupos realiza la lectura provista por el profesor ¿Hasta dónde se puede dividir una gota de agua? (Profesor Bartolomé Yankovic Nola). Al finalizar la lectura discute con tus compañeros la pregunta ¿Hasta dónde se puede dividir una gota de agua? Propón tu visión microscópica de la materia a tus compañeros y entre todos construyan una idea general. En plenaria todo el curso junto con el profesor discutan sobre estas visiones y propongan un concepto general sobre la estructura de la materia a nivel microscópico y consigna en tu cuaderno esta última. En tu pequeño grupo usando fichas bibliográficas (tipo friso) realiza un guión gráfico, es decir secuencia de ilustraciones en una línea del tiempo donde identifiques el aporte hecho por cada uno de los filósofos y científicos en el desarrollo de la teoría atómica y resalten las leyes enunciadas por John Dalton las cuales serán analizadas en la siguiente actividad. Modelamiento de átomos usando clips2: La actividad en pequeño grupo está orientada para que evidencies las tres leyes que John Dalton uso para desarrollar la primera teoría atómica, esta actividad requiere haber cumplido la actividad 1 y 2. Usaras dos diferentes tipos de clips (Clip mariposa Lg y clip pequeño Le) con los cuales representaras las dos reacciones químicas indicadas

2

Nassiff y Czerwinski. Modeling atoms using paperclips. J. Chem edu. 2012, 89, 370-372

68


Programa de fortalecimiento de los estĂĄndares bĂĄsicos en ciencias, imagen, matemĂĄticas, sociales y lectoescritura de bachilleres de colegios distritales

2015

siguiendo las instrucciones abajo mencionadas. Para el desarrollo de las prĂĄcticas no puedes contar los clips, solamente pesarlos ya que en principio no podemos contar ĂĄtomos si tienes dudas pregunta a tu profesor. đ??żđ?‘” + đ?‘ƒđ?‘’ → đ??żđ?‘”đ?‘ƒđ?‘’ đ?‘…đ?‘’đ?‘Žđ?‘?đ?‘?đ?‘–Ăłđ?‘› 1 đ??żđ?‘” + 2đ?‘ƒđ?‘’ → đ??żđ?‘”đ?‘ƒđ?‘’2 đ?‘…đ?‘’đ?‘Žđ?‘?đ?‘?đ?‘–Ăłđ?‘› 2 Actividad No. 2 Aprendizaje en pequeĂąo grupo Instrucciones Ley de conservaciĂłn de la masa: Se entregara una cantidad desconocida de cada tipo de clip recuerda que no puedes contar los clips. a.

b. c. d.

e. f. g.

Antes de realizar la reacciĂłn los determina y registra en la tabla 1 la masa de cada tipo de clip, luego mĂŠzclalos, pĂŠsalos y registra su masa en la tabla 1 del anexo 1. Esta serĂĄ la masa inicial de reactivos Para llevar a cabo la reacciĂłn 1 unan un clip pequeĂąo Pe y uno grande Lg hasta que no se puedan formar mĂĄs producto LgPe ya que uno de los clips se acabara primero. Finalizada la reacciĂłn, pesa el producto LgPe y el residuo de clips que haya quedado sin reaccionar de manera independiente y en conjunto y registrarlo en la tabla 1 del anexo 1. Para hacer el anĂĄlisis de los resultados completen la tabla 1 con el cĂĄlculo de la diferencia total que serĂĄ la resta entre la masa total de producto y el reactivo que no reacciono y la masa total de reactivos. Repite la experiencia teniendo en cuenta las proporciones Lg>Pe (mayor cantidad de Lg que Pe) y Lg<Pe (menor cantidad de Lg que Pe) para la reacciĂłn 1 Repetir las instrucciones a hasta f usando la reacciĂłn 2 y consigna los datos en la tabla 2 Discutan los resultados y responde las siguientes preguntas Âżexiste alguna diferencia entre la masa inicial y la masa final en cada reacciĂłn? ÂżQuĂŠ cambio en cuanto al orden de los clips en la reacciĂłn? ÂżCuĂĄl es el factor que finaliza la reacciĂłn de los clips? Socialicen sus resultados con el profesor y el resto de estudiantes.

Ley de composiciĂłn definida: Usando los resultados de la tabla 1 realiza los cĂĄlculos indicados como se indica a continuaciĂłn para completar la tabla 3 a. b. ď&#x201A;ˇ

ď&#x201A;ˇ c.

Masa de LgPe: este dato estĂĄ consignado en columna 5 tabla 1 (Masa del producto LgPe) Masa de Lg en el compuesto LgPe: la masa de Lg se determina asĂ­: Si se registrĂł residuo de Lg despuĂŠs de la reacciĂłn la masa de Lg en el compuesto LgPe serĂĄ la resta entre la masa inicial de Lg columna 2 tabla 1 (Masa Lg) y la residual de Lg columna 6 Tabla 1 Si no se registrĂł residuo de Lg entonces la masa de Lg en el compuesto LgPe serĂĄ la masa inicial de Lg columna 2 tabla 1 Masa de Pe en el compuesto LgPe se determina asĂ­:

69


2015

 d. e. f. g. h.

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

Si se registró residuo de Pe después de la reacción la masa de Pe en el compuesto LgPe será entonces la resta entre la masa inicial de Pe columna 3 tabla 1 (Masa Pe) y la residual de Pe columna 7 tabla 1 Si no se registró residuo de Pe entonces la masa de Pe en el compuesto LgPe será la masa inicial de Pe columna 3 tabla 1 La relación en masa Lg/Pe se obtiene dividiendo la masa de Lg en el compuesto LgPe (columna 2) y la masa de Pe en el compuesto LgPe (columna 3) de la tabla 3 El porcentaje en peso de Lg se obtiene dividiendo la masa de Lg en compuesto LgPe columna 2 tabla 3 y la masa del producto LgPe columna 1 tabla 3 y multiplicarlo por 100 El porcentaje en peso de Pe se obtiene dividiendo la masa de Pe en compuesto LgPe columna 3 tabla 3 y la masa del producto LgPe columna 1 tabla 3 y multiplicarlo por 100 Discute cómo son los porcentajes de Lg y Pe en cada una de las experiencias hechas para obtener el producto LgPe ¿siempre son las mismas? Completa la tabla 4 usando los resultados (tabla 2) para la segunda reacción LgPe2 y has la misma discusión sobre los porcentajes de Lg y Pe en LgPe2 ¿siempre son los mismos?

Ley de composición múltiple Usando los resultados registrados en las tablas 1 y 2 completa la tabla a. b. c. d.

Las masas del compuesto LgPe y LgPe2 las obtienes de las tablas 1 y 2 respectivamente Masa de Pe en LgPe y LgPe2 están consignadas en la tabla 3 y 4 respectivamente La relación en peso de Pe en cada compuesto la obtienes dividiendo las cantidades del punto anterior Discute con tus compañeros como a partir de los mismos clips se pueden formar dos diferentes compuestos los cuales varían en sus proporciones

Actividad Virtual en la casa: En la plataforma MOODLE para el proyecto encontraras la actividad, La escala del Universo que cuenta con el enlace web la Escala del Universo 2 (http://htwins.net/scale2 ). Una vez estés en el recurso en web amplia o reduce la escala de los objetos mostrados por la animación. La escala inicia a nivel 100 metros y puedes ir hasta el nivel subatómico o a nivel astronómico. Completa la actividad propuesta en la plataforma la cual será evaluada ACTIVIDADES DE DESARROLLO Tabla Periódica Actividad No. 3 Objetivo: conocer y familiarizarse con la tabla periódica, reconocer la periodicidad de las propiedades de los átomos y cómo esta periodicidad se refleja en la organización de la tabla periódica de los elementos Aprendizaje independiente 1. 

70

Atiende a la presentación dada por el docente acerca del átomo y responde las siguientes preguntas ¿Cómo es el átomo en su interior? ¿Qué partículas componen el átomo?


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lectoescritura de bachilleres de colegios distritales

2015

¿Cómo se diferencian los átomos de diferentes elementos? ¿Qué es el número atómico del cada elemento? ¿Qué significa que un átomo sea neutro o este cargado eléctricamente? ¿Qué partículas aportan carga al átomo y cual no? ¿Cuál es la masa de cada una de las partículas subatómicas? establece la razón en masa entre estas partículas N/P, N/e y P/e y responde ¿Es importante la masa de los electrones en el átomo? ¿Por qué átomos del mismo elemento poseen diferentes masas? ¿Qué es un isotopo? ¿Qué es el número de masa y como se relaciona con los protones y neutrones? Da tres ejemplos de notación de isotopos y como calcular el número de partículas que componen el átomo.

  

2.

Actividad de investigación bibliográfica: Individualmente consulta las siguientes propiedades atómicas y regístralas en tu cuaderno de actividades:

    

Radio atómico y Radio iónico Potencial de Ionización Electronegatividad Afinidad electrónica Metales, metaloides y no metales

3.

Aprendizaje en pequeños grupos: En una hoja cuadriculada construye tres tablas similares al ejemplo mostrado abajo. Completa cada tabla obteniendo los datos de tu tabla periódica de los elementos químicos para los siguientes casos:

  

Los primeros 20 elementos Para los grupos I, II y VII Períodos 3 y 4 Elemento Hidrogeno Helio Litio

Numero atómico 1

Radio atómico 53

Potencial de ionización 1312

Electronegatividad 2,20

Con los resultados tabulados construyan las siguientes graficas (si tienes dudas sobre la forma de graficar consulta a tu profesor)  En el eje “x” el número atómico y en el eje “y” el radio atómico  En el eje “x” el número atómico y en el eje “y” el potencial de ionización  En el eje “x” el número atómico y en el eje “y” la electronegatividad Analiza los resultados con el objeto de responder las siguientes preguntas:  

¿Para cada una de las propiedades de los primeros 20 elementos encuentras algún comportamiento que se repita? Para cada una de las propiedades de los elementos de los grupos I, II y III ¿cómo se comportan las propiedades a medida que avanzó en cada grupo, aumentan o disminuyen?

71


2015

ď&#x201A;ˇ ď&#x201A;ˇ ď&#x201A;ˇ ď&#x201A;ˇ

4.

Programa de fortalecimiento de los estĂĄndares bĂĄsicos en ciencias, imagen, matemĂĄticas, sociales y lecto-escritura de bachilleres de colegios distritales

Para cada una de las propiedades de los elementos del perĂ­odo 2 y 3 ÂżCĂłmo se comportan las propiedades a medida que avanzĂł en cada perĂ­odo, aumentan o disminuyen? ÂżQuĂŠ entendemos sobre el tĂŠrmino periĂłdico? ÂżCĂłmo puede relacionar este termino con la organizaciĂłn de los elementos en la tabla periĂłdica Completa tu conocimiento de la tabla periĂłdica consultado sobre la clasificaciĂłn de los elementos en metĂĄlicos y no metĂĄlicos ÂżCuĂĄl es el criterio para esta clasificaciĂłn? Que caracterĂ­sticas fĂ­sicas y quĂ­micas tienen los grupos clasificados como alcalinos, alcalinotĂŠrreos, metales de transiciĂłn, metaloides, gases nobles, lantĂĄnidos y actĂ­nidos Actividad aula virtual en casa: en la plataforma MOODLE encontraras la actividad Tabla PeriĂłdica que cuenta con el enlace web http://ed.ted.com/periodic-videos en el cual encontraras una tabla periĂłdica interactiva en la que cada elementos es un enlace a un video que muestra la historia de su descubrimiento y algunas propiedades importantes. Selecciona un elementos del cual veras el video escribirĂĄs en el espacio asignado por la plataforma MOODLE una sĂ­ntesis de lo visto en el video.

Actividad No. 4 Enlaces QuĂ­micos Aprendizaje independiente: Antes de iniciar esta actividad has una reflexiĂłn sobre las siguientes preguntas ď&#x201A;ˇ

En el caso de la actividad con clips ÂżQuĂŠ mantiene a los clips unidos para formar los compuestos LgPe y LgPe2? ď&#x201A;ˇ En el caso de los ĂĄtomos ÂżQuĂŠ mantiene a los ĂĄtomos unidos en un compuesto? Aprendizaje en pequeĂąo grupo: En pequeĂąos grupos con el papel iris rojo verde y azul en cuadrados (3*3 cm), clips y cosedora representaran las siguientes reacciones 2đ?&#x2018;&#x2026;đ?&#x2018;&#x153;đ?&#x2018;&#x2014;đ?&#x2018;&#x153; + 6 đ?&#x2018;&#x2030;đ?&#x2018;&#x2019;đ?&#x2018;&#x;đ?&#x2018;&#x2018;đ?&#x2018;&#x2019; â&#x2020;&#x2019; đ?&#x2018;&#x2026;đ?&#x2018;&#x153;đ?&#x2018;&#x2014;đ?&#x2018;&#x153;2 đ?&#x2018;&#x2030;đ?&#x2018;&#x2019;đ?&#x2018;&#x;đ?&#x2018;&#x2018;đ?&#x2018;&#x2019;6 đ?&#x2018;&#x2030;đ?&#x2018;&#x2019;đ?&#x2018;&#x;đ?&#x2018;&#x2018;đ?&#x2018;&#x2019; + đ?&#x2018;&#x2026;đ?&#x2018;&#x153;đ?&#x2018;&#x2014;đ?&#x2018;&#x153; â&#x2020;&#x2019; đ?&#x2018;&#x2030;đ?&#x2018;&#x2019;đ?&#x2018;&#x;đ?&#x2018;&#x2018;đ?&#x2018;&#x2019;đ?&#x2018;&#x2026;đ?&#x2018;&#x153;đ?&#x2018;&#x2014;đ?&#x2018;&#x153; ReacciĂłn 1 ď&#x201A;ˇ Para construir la molĂŠcula de la reacciĂłn 1 toma dos papeles rojos y Ăşnelos por una de la caras con un gancho de cosedora de la manera que el gancho forme un puente entre los dos papeles rojos. ď&#x201A;ˇ A cada papel rojo une con gancho de cosedora un papel verde por cada cara libre, debes completar 6 papeles verdes, mira el esquema de la molĂŠcula final ď&#x201A;ˇ Construye diez de estas molĂŠculas. ď&#x201A;ˇ Pon todas las molĂŠculas en una bolsa y agita fuertemente, anota lo que observes despuĂŠs del proceso. ReacciĂłn 2 ď&#x201A;ˇ ď&#x201A;ˇ ď&#x201A;ˇ

72

Usando clips une a cada cara de un cuadrado verde un cuadro rojo Ahora a cada cuadrado rojo une con clips en cada cara un cuadrado verde Repite las dos Ăşltimas instrucciones hasta llegar a una estructura como la siguiente


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lectoescritura de bachilleres de colegios distritales

2015

Pon cuidadosamente sin desarmar la estructura en una bolsa y agita fuertemente, anota lo que observas después.

1.

El profesor dará una charla sobre los enlaces iónicos y covalentes y sus características básicas. Con esta información construye un cuadro comparativo que incluya la definición de cada enlace, cómo puedo clasificar un compuesto en covalente o iónico basado en su composición y electronegatividad y su comportamiento cuando se mezcla con agua para formar soluciones conductoras y no conductoras de la electricidad. Establece una relación entre enlace covalente o iónico y las reacciones de papel ¿Cuál de las dos esquematiza mejor el comportamiento de una sustancia covalente y cuál en de una sustancia iónica?

2.

Formulas Empírica, Molecular y Estructural 1.

2.

3. 4.

Con base al compuesto que representa el compuesto covalente de la actividad anterior (REACCIÓN 1) escribe de manera condensada usando siglas para cada color la cantidad de cada papel que forma la molécula (ejemplo: si la molécula está compuesta por 10 papeles grises y cinco café se escribe Gr10Cf5 ) así representaras la formula molecular del compuesto Usando el mismo compuesto de la reacción 1 y la misma notación escribe la relación mínima de papeles que existe en la molécula (ejemplo: para la molécula Gr10Vd5 hay 10 papeles grises por cada 5 cafés y al relación mínima seria 5 grises por cada una café y sería entonces Gr 5Vd) así representaras la formula empírica del compuesto Observa como están dispuestos los papeles en la molécula, es decir quien está unido a quien, has un dibujo de lo que observas. Este dibujo representa la formula estructural del compuesto Basado en unos compuestos químicos reales consulta su fórmula molecular, su fórmula empírica y su fórmula estructural. Investiga como calcular el peso formula de los compuestos que consultes

Funciones Químicas Investiga cuales son las funciones químicas más comunes en química inorgánica, establece para cada una de ellas el grupo funcional y construye un diagrama de flujo que muestre la formación de las diferentes sustancias inorgánicas. Con base a las reglas generales de nomenclatura explicadas por tu profesor escribe 10 ejemplos de nombrar una sustancia a partir de la formula molecular y diez ejemplos de escribir la formula molecular a partir del nombre químico. Cierra tus actividades del día haciendo una autoevaluación de los temas aprendidos resolviendo el siguiente cuestionario. Una vez resuelto de manera individual reúnete con tus compañeros y comparen y discutan sus respuestas

73


2015

Programa de fortalecimiento de los estĂĄndares bĂĄsicos en ciencias, imagen, matemĂĄticas, sociales y lecto-escritura de bachilleres de colegios distritales

ACTIVIDAD DE EVALUACIĂ&#x201C;N 1. Todas las frases son verdaderas excepto a. Todos los ĂĄtomos del mismo elemento tienen el mismo nĂşmero de masa b. Para un ĂĄtomo neutro el nĂşmero de protones es igual al de electrones c. El nĂşmero de masa es la suma de protones y neutrones d. El numero atĂłmico es el nĂşmero de protones del ĂĄtomo 2. Todas las frases son verdaderas excepto a. Un protĂłn tiene carga +1 y un electrĂłn carga -1 b. En nĂşcleo del ĂĄtomo tiene carga negativa c. Un neutrĂłn tiene carga neutra y una masa similar al protĂłn d. La masa del ĂĄtomo se concentra 99,9 % en el nĂşcleo 3. ÂżCuĂĄl de los siguientes ĂĄtomos tiene el mayor nĂşmero de protones? a. 146đ??ś b. 147đ?&#x2018; c. 168đ?&#x2018;&#x201A; d. 188đ?&#x2018;&#x201A; e. 199đ??š 4. ÂĄCuĂĄl es la identidad de 55 25đ?&#x2018;&#x2039; a. Cinc b. Plata c. Iridio d. Cesio e. Magnesio 74

5. ÂżCuĂĄl elemento presenta mayor radio iĂłnico? a. Li b. F c. Mg d. Cs e. Fr 6. Un enlace se puede clasificar en iĂłnico o covalente usando a. El radio atĂłmico dado entre dos ĂĄtomos unidos b. La electronegatividad de Pauli c. La energĂ­a de ionizaciĂłn d. Afinidad electrĂłnica 7. Un compuesto iĂłnico en agua a. No se disocia b. Se disocia en iones c. No conduce la electricidad d. Comparte electrones entre sus ĂĄtomos 8. Cual tipo de fĂłrmula para un compuesto da la mayor cantidad de informaciĂłn a. Formula empĂ­rica b. Formula molecular c. Formula estructural d. Covalente 9. ÂżQuĂŠ tipo de compuesto inorgĂĄnico es el sulfato de amonio? a. Ă&#x201C;xido b. Base c. Ă cido d. Sal


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lectoescritura de bachilleres de colegios distritales

ANEXO 1 Ensay o

Mas a Lg

Mas a Pe

Masa Total reactivo s

Masa del product o LgPe

Masa residuo de reactiv o

Masa residuo de reactiv o Pe

Masa total product oy residuo

Diferenci a total

Masa residuo de reactiv o Pe

Masa total product oy residuo

Diferenci a total

Lg LgPe Lg>Pe Lg<Pe Tabla 1

Ensay o

Mas a Lg

Mas a Pe

Masa Total reactivo s

Masa del product o LgPe2

Masa residuo de reactiv o Lg

LgPe Lg>Pe Lg<Pe Tabla 2

Ensayo

Masa Masa Lg Masa Pe Relación % Lg en el del en el en el en masa compuesto producto compuesto compuesto Lg/Pe LgPe LgPe LgPe LgPe

% Pe en el compuesto LgPe

LgPe Lg>Pe Lg<Pe Tabla 3

75

2015


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

Ensayo

Masa Masa Lg Masa Pe Relación % Lg en el % Pe en el del en el en el en masa compuesto compuesto producto compuesto compuesto Lg/Pe LgPe2 LgPe2 LgPe2 LgPe2 LgPe2

LgPe Lg>Pe Lg<Pe Tabla 4

Ensayo

LgPe Lg>Pe Lg<Pe Tabla 5

76

Masa del compuesto LgPe

Masa del compuesto LgPe2

Masa de Pe en LgPe

Masa de Pe LgPe2

Relación en masa Pe en cada compuesto


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lectoescritura de bachilleres de colegios distritales

UNIDAD DE APRENDIZAJE No 10 RECONOCE Y ANALIZA EL COMPORTAMIENTO QUÍMICO DE LA MATERIA CONCEPTOS DE ESTUDIO    

REACCIONES QUÍMICAS: Concepto, Clasificación ECUACIONES QUÍMICAS: Tanteo, oxido-reducción, oxidación, reducción MOL. CÁLCULOS QUÍMICOS: Estequiometria, leyes ponderales, cálculos peso-peso, rendimiento, pureza GASES: Propiedades, leyes, principio de Avogadro y Ecuación de Estado

RECURSOS Guía de trabajo, textos de consulta, tabla periódica, pliegos de papel periódico, marcadores, cinta. Materiales para laboratorio: un hueso pequeño, un frasco de cristal con tapa, vinagre, vaso pequeño Agua Oxigenada, trozo de carne congelada, recipiente de cocina, bayetilla, pinzas, tubo de ensayo, 2 bombas medianas, lata de gaseosa, pelota de ping pong, cuchara, botella plástica mediana (1.5 L), mechero, Jeringa grande, encendedor, embudo, macerador, masmelo pequeño, cinta aislante, agua, vinagre, 2 alka-seltzer y jabón en polvo. ACTIVIDADES DE INICIO Actividad No 1: Reacciones y Ecuaciones Químicas Objetivo: Identificar las características generales de las reacciones químicas y las leyes que las rigen, con el fin de representarlas y clasificarlas, para comprender el comportamiento de las sustancias durante un cambio químico. Aprendizaje independiente: Realice la siguiente lectura: LOS CERILLOS Como los conocemos actualmente, los cerillos son una invención de este siglo. Aunque en el siglo pasado ya se producían en forma comercial, eran sumamente peligrosos, pues podían incendiarse espontáneamente con un poco de sol o de calor. La cabeza del cerillo contiene clorato de potasio, KClO3, que se descompone con el calor. 2KClO 3(s) →2KCl(s) + 3O2 (g) Ésta es la fuente de oxigeno necesario para la combustión. Por su parte, el sulfuro de antimonio, Sb2S3, y la parafina son los combustibles. La chispa y el calor iniciales se producen por fricción, gracias a la presencia de sustancias abrasivas y de fósforo rojo en la cinta de encendido. No hay duda de que las reacciones químicas de óxido-reducción implicadas en el funcionamiento de los cerillos son complejas, pero el concepto central es que proporcionan los elementos (calor, oxígeno y combustible). Tomado de http://www.textoscientificos.com 77

2015


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

Con base en la lectura anterior responde las siguientes preguntas: a.

¿Qué características de los cambios que suceden en los cerillos nos permiten considerarlos como cambios químicos o reacciones químicas? La representación 2KClO3(s) →2KCl(s) + 3O2 (g) es una ecuación química ¿Qué información aporta y para qué se puede utilizar? Las leyes que rigen el comportamiento químico de las sustancias se denominan ponderales, ellas son: ley de la conservación de la materia, ley de la composición definida y ley de las proporciones múltiples. ¿Cómo se ven aplicadas estas leyes a la reacción que describe el texto? Cuándo el texto menciona que el KClO3 se descompone con el calor, hace explícito el tipo de reacción que está ocurriendo. Mencione otros tipos de reacciones que conozca y sus características. El último párrafo hace mención a “reacciones químicas de óxido-reducción” ¿qué significa oxidación y reducción?

b. c.

d.

e.

Aprendizaje en pequeño grupo: Conservando los integrantes de las mesas de trabajo se distribuyen las preguntas a, b, c, d, y e del aprendizaje independiente, para discutir las respuestas y obtener una conclusión. Aprendizaje en gran grupo: Los moderadores presentan en plenaria los productos obtenidos como resultado de la mesa de trabajo y el (la) docente aclara los aciertos y desaciertos expuestos, ampliándoles el significado de cada concepto. Actividad No 2 Aprendizaje independiente: De los textos guías elabore un resumen de la información, teniendo en cuenta las siguientes palabras claves: Reacción química

Reactivos

Ley de la conservación de la materia Síntesis Combustión

Desplazamiento Endotérmica

Agente oxidante

Productos

Ecuación química

Ley de las proporciones definidas Descomposición Exotérmica

Doble desplazamiento Oxidación

Reducción

Agente reductor

Aprendizaje en pequeño grupo: Formamos 5 mesas de trabajo nos reunimos en pequeños grupos. Se alista un pliego de papel periódico y marcadores para realizar un mapa conceptual, utilizando las palabras claves del aprendizaje independiente. Aprendizaje en gran grupo: Los mapas conceptuales se pegan en las paredes del salón y con la orientación del (la) docente evaluamos la coherencia en las relaciones de las 78


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lectoescritura de bachilleres de colegios distritales

palabras claves. Al finalizar la retroalimentación, se registra en el cuaderno el esquema que en grupo se haya escogido como el más organizado y coherente, haciendo las modificaciones necesarias de acuerdo a lo evaluado por el gran grupo. ACTIVIDADES DE DESARROLLO Actividad No. 3 mol. Cálculos químicos Objetivo: Comprender el concepto de mol y las leyes ponderales de la química, con el fin de realizar cálculos matemáticos como es el cálculo peso-peso, el rendimiento y la pureza de una reacción química, conocimientos necesarios para la experimentación científica. Aprendizaje independiente: 1.

Para realizar el análisis cuantitativo de una reacción química a partir de su estequiometria, es decir, la relación de masa y mol entre las sustancias que intervienen en una reacción; es importante aclarar el término Mol. Lea el siguiente texto y subraye los conceptos claves:

MOL A finales del siglo XVIII cuando los científicos (como Lavoisier, Proust, Dalton, etc.) trataron de sistematizar el estudio de las reacciones químicas, basándose en los pesos de los reaccionantes y de los productos del proceso, consiguiendo unos resultados muy aceptables. Sin embargo, al operar con gases la manipulación es más fácil si medimos volúmenes; pero entonces los cálculos eran incongruentes, como constató el francés J.L. Gay-Lussac. Por ejemplo: 1 volumen de Nitrógeno + 2 volúmenes de Hidrogeno producen 2 volúmenes de Amoniaco. El peso de sustancias a lo largo del proceso se mantiene constante, pero vemos que no sucede igual con el volumen de reactivos y de producto.

Para explicar este hecho, el italiano Avogadro, en 1811, postuló que en volúmenes iguales de gases diferentes hay siempre el mismo número de partículas materiales, si están medidos a igual presión y temperatura. O sea, que hay el mismo número de partículas en un litro de oxígeno, de cloro, o de butano, siempre que midamos a la misma presión y temperatura. Pero, para que se cumpla la constancia de la masa ello obliga a que las partículas de los gases elementales (simples) en realidad sean agregados de unidades atómicas (átomos), generalmente dos: es decir, que son biatómicas. Por ende, cuando se trata de cálculos matemáticos en reacciones químicas (cálculos químicos), las relaciones de masa de las sustancias reaccionantes quedan reducidas a números enteros que corresponden a la fórmula mínima. Por ejemplo, podemos decir que 4 gramos de hidrógeno gaseoso reaccionan con 32 gramos de oxígeno gaseoso para formar 36 gramos de agua, esto es, reaccionan en una relación de 4:32 o 1:8, lo cual no 79

2015


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

concuerda muy bien con la fórmula molecular del agua ( ). Si utilizamos "moles", podemos decir que 2 "moles" de hidrógeno reaccionan con 1 "mol" de oxígeno para formar un "mol" de agua. Esto concuerda mejor con la fórmula molecular del agua, y se justifica mediante medidas volumétricas realizadas a lo largo de la reacción entre ambos gases. Tomado y adaptado de http://es.wikipedia.org/wiki/Mol Con base en la lectura anterior y la tabla periódica responda las siguientes preguntas: a.

Representa a través de una ecuación química la reacción entre el Nitrógeno y el Hidrógeno gaseoso, para producción de amoniaco. A partir de esta ecuación, realiza el cálculo de masas de reactivos y productos y responda ¿Se cumple la ley de la conservación de la materia? ¿Qué necesitamos hacer con la ecuación química para que se cumpla?

2.

Para realizar cálculos químicos respecto a mol y masa, es importante recordar el método de tanteo y el método de balanceo por oxido-reducción, de modo que se exprese la ley de conservación de la materia en una ecuación química, además del método de factor molar y de proporciones para resolver problemas estequiométricos. Realice la lectura de la información (Anexo 1) y con base en ella resuelva los siguientes ejercicios:

2.1 Analice las siguientes las ecuaciones químicas, balanceen por tanteo y frente a cada una escriba el tipo de reacción a la que corresponde:      

KClO3 descomposición NH3 + H2O Fe + HCl H2SO4 + NaOH Ca(CN)2 + HBr Pb (NO3)2 + KI

KCl + O2

Reacción de

NH4OH FeCl2 + H2 Na2SO4 + H2O CaBr2 + H PbI2 + KNO3

2.2 Balancee las siguientes ecuaciones por el método de óxido-reducción e indique cuál es el agente reductor y cuál es el agente oxidante:   

Fe + HNO3 Al2O3 + C + Cl2 Sb2S3 + HNO3

Fe(NO3)3 + NH4NO3 + H2O CO + AlCl3 H3SbO4 + SO2 + H2O

2.3 De la siguiente ecuación balanceada Al2O3 + C + Cl2 resuelva: a. b. c.

CO + AlCl3

¿Cuántos gramos de AlCl3 se producen a partir de 120 g de Al2O3 al 80% de pureza? Si se tiene 105 g de Al2O3, 60g de C y 71g de Cl2 ¿Cuál es el reactivo límite y cuántos gramos de AlCl3 se producen? ¿Cuál es el rendimiento de la reacción si la producción de AlCl3 es de 150g?

Aprendizaje en pequeño grupo: Nos reunimos en mesas de trabajo y socializamos la actividad 1 y 2 del aprendizaje individual, distribuyendo equitativamente las preguntas en cada mesa de trabajo. 80


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lectoescritura de bachilleres de colegios distritales

Como conclusión de la actividad 1, En un breve párrafo se responde y justifica la siguiente pregunta ¿por qué es necesario trabajar en términos de mol para realizar cálculos estequiométricos? Aprendizaje en gran grupo: En plenaria cada representante socializa las respuestas del aprendizaje en pequeño grupo. Se recibe la constatación de las respuestas con el apoyo del (a) docente, en caso de encontrar errores. Actividad No. 4 Gases Objetivo: Reconocer las propiedades de los gases para predecir su comportamiento bajo condiciones de cambios físico-químico. Aprendizaje independiente 1.

Con base en la información que se encontró en la plataforma virtual, responda las siguientes preguntas:

a. b.

Enuncie las leyes de los gases. Establezca las variables que se afectan y las que se mantiene constantes en cada ley: Presión, volumen, temperatura y cantidad de materia. Escriba una conclusión de cada ley y exprésela matemáticamente.

c. 2.

Teniendo en cuenta las leyes de los gases, analice para cada problema si alguna ley de los gases puede dar explicación a lo sucedido y cómo interpretarla.

PROBLEMA 1: Anita ha recibido de regalo una pelota playera. Decidió inflarla antes y llevarla en el carro rumbo a Cartagena. Sin embargo, cuando llegó a esta ciudad algo sucedió, observó que su pelota playera se desinfló parcialmente, pensó que algo le había sucedido, y la dejó allí sin prestarle más atención, sin embargo curiosamente al regresar a la ciudad observó cómo su pelota playera había recobrado nuevamente su volumen. PROBLEMA 2: Santiago ha colocado en la nevera un globo de caucho inflado, al cabo de un tiempo abre la nevera y observa que su globo ya no tiene el mismo tamaño inicial. PROBLEMA 3: Don Carlos viaja desde Bogotá a Barranquilla por carretera. Al alistar su carro decide inflar muy bien las llantas para no tener inconvenientes en el camino, pero ya casi llegando a Barranquilla se estallan las llantas y se queda varado. Tomado de: ROSERO B. Mónica., El estudio de los gases y sus propiedades a través de un programa guía de actividades. Universidad Pedagógica. Bogotá D.C. 2002. Aprendizaje en pequeño grupo: Formamos pequeños grupos numerados de 1 a 5 para socializar las respuestas del aprendizaje individual y establecer conclusiones. A continuación, de acuerdo al grupo correspondiente realizamos la siguiente práctica experimental, en la que se deberá observar, anotar los resultados y hacer su respectivo análisis asociando el fenómeno a una de las leyes de los gases.

81

2015


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

EXPERIMENTACIÓN Objetivo: observar y analizar las leyes de los gases a través de ejercicios sencillos. Procedimiento 1: Vierta en un tubo de ensayo 10 ml de agua, sobre la boquilla del tubo ponga una bomba, tome el tubo con las pinzas y ponga sobre el mechero hasta que el agua haga ebullición. Procedimiento 2: En una lata de gaseosa vierta de 20 a 30 ml de agua, tome la lata con las pinzas y ponga sobre el mechero hasta que el agua se evapore. Introduzca la lata en un recipiente con agua fría asegurándose que la boquilla u orificio sea lo primero en sumergir en el agua. Procedimiento 3: Ponga a calentar agua sobre el mechero, aparte tome la pelota de ping pong y hágale una hendidura, retire el agua del fuego y meta la pelota con una cuchara dele vueltas a la pelota. Procedimiento 4: Vierta vinagre hasta completar la cuarta parte de la botella; aparte triture dos alka-seltzer y con el embudo introdúzcalo dentro de la bomba, finalmente ponga la bomba en la boquilla de la botella asegurándose que el alka-seltzer caiga dentro del agua. Procedimiento 5: Tome la jeringa y extraiga el émbolo, introduzca un masmelo dentro de la misma y el embolo, con la cinta tape el agujero de la jeringa; extraiga suavemente el émbolo. Observar y anotar resultados. Nuevamente extraiga el embolo en su totalidad e introdúzcalo suavemente. Aprendizaje en gran grupo: Cada pequeño grupo elige un representante para socializar los resultados y análisis de resultados en plenaria. Con orientación del (a) docente se realiza la aclaración del tema y se llegan a conclusiones comunes. Para finalizar, se hará la explicación de la ecuación de estado, mediante la solución del siguiente ejercicio: “BOLSA DE AIRE DEL AUTOMÓVIL”: Los automóviles ahora se venden equipados con bolsas de aire que se inflan cuando hay una colisión, para proteger al conductor de sufrir lesiones. Muchas de estas bombas son infladas con N2 mediante reacción de la azida de sodio (NaN3) y óxido de hierro III (fe2O3), la cual se inicia con una chispa: 6 NaN3(S) + Fe2O3(S)

3Na2O(S) + 2Fe(S) + 9N2 (g)

¿Cuántos gramos de azida de sodio se requieren para proporcionar 75L de gas N2 a 25ºC y 748 mm Hg? Rosero B. Mónica, 2002. El estudio de los gases y sus propiedades a través de un programa guía de actividades. 82


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lectoescritura de bachilleres de colegios distritales

Se le propone al gran grupo que planteen otros problemas con base en la reacción de la azida de sodio y el óxido de hierro III, en los que se utilicen las variables de la ecuación de estado. ACTIVIDADES DE FINALIZACIÓN Con la participación del gran grupo, utilicen las siguientes palabras para completar los conceptos que corresponden a los espacios en blanco dentro del mapa conceptual (Anexo 2), con el fin de reconocer la importancia de la química en las transformaciones que ocurren en la vida cotidiana:     

El Reciclaje La industria La alimentación Productos de Abono Elaboración de Medicamentos

APRENDIZAJE EN CASA 1.

Experimentación: Laboratorio Casero

Actividad No. 5 Realice las siguientes experiencias caseras y deduzca las ecuaciones químicas correspondientes, como aplicación de lo visto teóricamente a situaciones que se pueden presentar en la vida cotidiana. Presente las dos ecuaciones balanceadas y clasifíquelas según el tipo de reacción. Experiencia 1.Materiales: un hueso pequeño, un frasco de cristal con tapa y vinagre. Procedimiento: Metemos el hueso en el recipiente y lo cubrimos con vinagre. Pasados algunos minutos vemos unas burbujas en la superficie del hueso. Tenemos que esperar una semana (depende del tamaño del hueso) para completar el experimento. Se recomienda cambiar el vinagre con frecuencia (cada dos días). Transcurrido el tiempo necesario sacamos el hueso del bote y vemos que tiene una consistencia de goma. Experiencia 2. Materiales: Vaso pequeño, agua oxigenada, trozo de carne congelada, recipiente de cocina. Procedimiento: Primero se pone un trozo de carne en el congelador. Luego se saca, y se deja descongelar en algún recipiente de cocina, hasta que ya no despida más “líquidos”. Coloca en el vaso unos 3 mililitros aproximadamente de agua oxigenada. Ahora vierta los “jugos” que obtuvo de la carne, verá como comienza a producirse una densa espuma. Tomado de http://es.scribd.com/doc/6941561/100-experimentos-sencillos-de-fisica-yquimica#scribd 2. Ingrese a la página http://www.guatequimica.com, en la columna izquierda encuentra el menú de contenido, seleccione el tema reacciones, aparecerá a la izquierda la lista de subtemas y al final una guía de estudios, ingrese y resuelva los ejercicios del numeral 11 al 15. Regrese al menú de contenido y seleccione el tema de estequiometria y de la guía de estudios resuelva los problemas 5 y 6.

83

2015


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

3. Ingrese a la página http://fisicayquimicaastura4eso.blogspot.com, seleccione el menú UD 1-2, al ingresar busque el tema “Cálculo de ecuaciones de estado” e ingrese a práctica con la ecuación de los gases ideales, resuelva 3 ejercicios.

ANEXO 1 1. TIPOS DE REACCIONES QUÍMICAS.

Tomado de: http:// banirodriguez.com/oficial/site/preicfes-gratis/imágenes 2. BALANCEO POR OXIDO- REDUCCIÓN. Ejercicio Modelo: KClO3 + KI + H2O

KCl + I2 + KOH

Paso 1: Se establecen estados de oxidación de cada elemento. Para determinar los números de oxidación de los diferentes elementos de un compuesto debemos tener en cuenta las siguientes reglas: a. b. c. d.

El número de oxidación de cualquier elemento libre es cero. El número de oxidación del hidrógeno es +1; excepto en los hidruros. El número de oxidación del oxígeno es -2; excepto en los peróxidos. En un compuesto neutro la suma algebraica de los números de oxidación de todos los elementos presentes debe ser cero. Ejemplo: K+1O-2H+1

Asignación de estados de oxidación a la reacción modelo: K +1Cl +5O3 -2 + K+1I-1 + H +12O -2

84

K+1Cl-1 + I2 0 + K+1O-2H+1


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lectoescritura de bachilleres de colegios distritales

Paso 2: Se identifica los elementos que sufrieron cambios de estados de oxidación y se plantean dos semiecuaciones, se identifica la sustancia que se oxida y que se reduce. 2I-1 -2eI2 0 sustancia oxidada +5 -1 Cl +6e Cl sustancia reducida Aclaración: La sustancia que en el cambio aumenta su estado de oxidación, es la que se oxida; mientras que, la sustancia que disminuye su estado de oxidación es la que se reduce. Para identificar la sustancia que se oxida y se reduce, es de utilidad el siguiente gráfico:

Paso 3: Se iguala la cantidad de electrones perdidos y ganados, multiplicando la ecuación de oxidación por 3. 3 (2I-1 -2eCl+5 +6e6 I-1 + Cl+5

I2 0) sustancia oxidada Cl-1 sustancia reducida 3 I2 0 + Cl-1

Paso 4: se ubican estos coeficientes en la ecuación original: KClO3 + 6 KI + H2O

KCl + 3I2 + KOH

El equilibrio se logra por el método de tanteo, utilizando un 6 en el KOH para equilibrar el potasio y un 3 en el H2O para equilibrar el hidrógeno. KClO3 + 6 KI + 3H2O 3.

KCl + 3I2 + 6 KOH

CÁLCULOS ESTEQUIOMÉTRICOS. De una ecuación química se puede calcular:

A. La cantidad de producto que se puede preparar a partir de ciertas cantidades de reactivos. B. El reactivo límite, el cual determina qué tanto producto se puede obtener de una ecuación química, cuando se dispone de una cantidad limitada de uno de los reactivos. C. Los porcentajes de producción y la pureza del compuesto. A continuación se ofrecen algunos métodos para los cálculos estequiométricos. A. MÉTODO DE FACTOR MOLAR. Ejercicio modelo: Zn + H2SO4

ZnSO4

+ H2

¿Cuántos gramos de Zn son necesarios para obtener 5,4 g de hidrógeno?

85

2015


2015

Programa de fortalecimiento de los estĂĄndares bĂĄsicos en ciencias, imagen, matemĂĄticas, sociales y lecto-escritura de bachilleres de colegios distritales

Paso 1. SegĂşn la ecuaciĂłn balanceada 1 mol de Zn produce 1 mol de H2 1mol Zn

Factor molar: 1 mol de H2 Paso 2. CĂ lculo de masas moleculares: H2 = 2 X 1g = 2g; Zn= 65,38g Paso 3. Moles de sustancia dada: đ?&#x2018;Ľ đ?&#x2018;&#x161;đ?&#x2018;&#x153;đ?&#x2018;&#x2122;đ?&#x2018;&#x2019;đ?&#x2018;  đ?&#x2018;&#x2018;đ?&#x2018;&#x2019; H2 =

1 mol de H2 = 2đ?&#x2018;&#x201D; đ?&#x2018;&#x2018;đ?&#x2018;&#x2019; H2

2,67 moles de H2

Paso 4. Moles de Zn que se producen: đ?&#x2018;Ľ đ?&#x2018;&#x161;đ?&#x2018;&#x153;đ?&#x2018;&#x2122;đ?&#x2018;&#x2019;đ?&#x2018; đ?&#x2018;&#x2018;đ?&#x2018;&#x2019; Zn = 2,67 mol de H2

1 mol de Zn = 2đ?&#x2018;&#x161;đ?&#x2018;&#x153;đ?&#x2018;&#x2122; đ?&#x2018;&#x2018;đ?&#x2018;&#x2019; đ??ť2

2,67 moles de Zn

Paso 5. ConversiĂłn de moles de Zn a gramos de Zn: đ?&#x2018;Ľ đ?&#x2018;&#x201D; đ?&#x2018;&#x2018;đ?&#x2018;&#x2019; Zn = 2,67 mol Zn

65,38g de Zn = 1đ?&#x2018;&#x161;đ?&#x2018;&#x153;đ?&#x2018;&#x2122; đ?&#x2018;&#x2018;đ?&#x2018;&#x2019; đ?&#x2018;?đ?&#x2018;&#x203A;

175,08 g de Zn

Respuesta: Para obtener 5,4 g de H2 se requieren 175,08 g de Zn B. MĂ&#x2030;TODO DE PROPORCIONES: Utilizando la equivalencia en masas de H2 y Zn, planteamos la relaciĂłn: 65,38g Zn producen 2 g H2 X g Zn producirĂĄn đ?&#x2018;Ľ đ?&#x2018;&#x201D; đ?&#x2018;&#x2018;đ?&#x2018;&#x2019; Zn =

5,4 g de H2 x 65,38g de Zn 2g đ?&#x2018;&#x2018;đ?&#x2018;&#x2019; đ??ť2

5,4 g H2

= 175,08 g de Zn

C. REACTIVO LĂ?MITE Ejemplo: ÂżCuĂĄnto H2 se producirĂĄ al reaccionar 180 g de Zn con 200g de H2SO4? Paso 1. Se convierte la masa dada de cada reactivo en nĂşmero de moles: 1 mol de Zn đ?&#x2018;Ľ đ?&#x2018;&#x161;đ?&#x2018;&#x153;đ?&#x2018;&#x2122;đ?&#x2018;&#x2019;đ?&#x2018; đ?&#x2018;&#x2018;đ?&#x2018;&#x2019; Zn = 180g Zn = 2.75 moles de Zn 65,38g de Zn

X moles de H2SO4 = 200g

1 mol de H2SO4 98 g de H2SO4

= 2 moles de H2SO4

Paso2. Se compara a partir de la reacciĂłn balanceada, la relaciĂłn estequiomĂŠtrica entre los dos reactivos y se deduce cuĂĄl es el reactivo lĂ­mite: 1mol de Zn reacciona con 1 mol de H2SO4., pero como tenemos 2.75 moles de Zn y 2 moles de H2SO4, el reactivo limite es el H2SO4, ya que una vez agotado, la reacciĂłn se detiene y quedan 0.75 moles de Zn sin reaccionar, es decir en exceso. Paso 3. La producciĂłn de H2 se calcula a partir del reactivo lĂ­mite: 86


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lectoescritura de bachilleres de colegios distritales

X moles de H2= 2 moles de H2SO4

1 mol de H2 1 mol de H2SO4

= 2 moles de H2

2g de H2 1 mol de H2

= 4 g de H2

Respuesta: Se producirá 4 g de H2. D. RENDIMIENTO Y PUREZA El Porcentaje de Rendimiento se refiere a la cantidad real de sustancias que reaccionan. producción real

% Rendimiento:producción teórica x 100% Ejemplo: podríamos decir que el porcentaje de rendimiento al calcular la producción teórica de 5,4 g de H2, pero con una producción real de 4g de H2 es: 4 g de H2

% Rendimiento:5,4 g de H2 x 100% = 74,07 % El Porcentaje de pureza es el porcentaje del reactivo puro con relación a la masa total. Por ejemplo si se habla de un porcentaje de pureza del 90 % de Zn para el ejercicio anterior es: % Pureza: 65,38g Zn x

90 𝑔 𝑍𝑛 100 g Zn

= 58,84 g Zn

En un ejercicio real primero se calcula la cantidad de reactivo puro, para realizar los cálculos estequiométricos. Tomado y adaptado de POVEDA V, Julio., Química 10. 1998.

ANEXO 2

87

2015


2015

Programa de fortalecimiento de los estรกndares bรกsicos en ciencias, imagen, matemรกticas, sociales y lecto-escritura de bachilleres de colegios distritales

Tomado de http://www.profesorenlinea.cl/Quimica/Reacciones_quimicas.htm

88


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lectoescritura de bachilleres de colegios distritales

UNIDAD DE APRENDIZAJE No 11 SOLUCIONES, COLOIDES, CINÉTICA Y EQUILIBRIO CONCEPTOS DE ESTUDIO        

Soluciones: Componentes, clasificación y propiedades Solubilidad Concentración: Principales unidades de concentración Dilución, neutralización, titulación pH Coloides: Clases y propiedades. (VIRTUAL) Cinética: Velocidad de reacción, factores que la afectan Teoría de colisiones. (VIRTUAL) Equilibrio químico: Constante de disociación, grado de disociación

RECURSOS: Individual: Bebida con información nutricional (leche saborizada, jugo, etc.), 1 hoja de papel milimetrado, regla, calculadora, texto de consulta. Grupos de 3 personas: chocolatina pequeña, encendedor, 1 cucharada de chocolate en polvo, 1 pitillo grueso, 1 hoja de papel periódico, vela, ¼ de vaso de indicador de repollo, 2 goteros. ACTIVIDADES DE INICIO Objetivo: Identificar las características, propiedades, clasificación y unidades de concentración de las soluciones químicas. Actividad No. 1 Soluciones: componentes, clasificación y propiedades Aprendizaje independiente: A partir de la información nutricional de la bebida y sus características macroscópicas, responda: 1. ¿La bebida corresponde a una mezcla homogénea o heterogénea? ¿Por qué? Defina ambos tipos de mezcla. 2. Realice en el cuaderno un listado con los componentes de la bebida llevada a clase a partir de su información nutricional, en una columna coloque las sustancias presentes en menor proporción y en otra columna aquella(s) presente(s) en mayor proporción. Asigne un nombre a cada columna según recuerde cómo debería llamarse. 3. ¿Qué ocurriría si dicha bebida contuviera 50% más, por ejemplo de azúcar, colorantes? ¿Y 50% menos? Definir solución insaturada y saturada. Aprendizaje en pequeño grupo: 1. Formar 4 grupos, revisar y complementar los ítems del trabajo individual. 2. Completar el cuadro de acuerdo a las siguientes mezclas:

89

2015


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

MEZCLA

SUSTANCIAS EN MENOR PROPORCIÓN

SUSTANCIAS EN MAYOR PROPORCIÓN

ESTADO FÍSICO SÓLIDO, LÍQUIDO O GASEOSO

Cerveza Aire Bronce Perfume Suero fisiológico Acero Gas natural Aprendizaje en gran grupo: El profesor hará una síntesis del tema a partir de la socialización de las preguntas. Actividad No 2: Solubilidad Aprendizaje independiente: Graficar en papel milimetrado una gráfica de la siguiente manera: En el eje “Y” se grafica solubilidad y en el eje “X” temperatura, se incluyen ambas sales en la misma gráfica, y se traza una línea de tendencia con diferente color para cada sal utilizando la información consignada en la tabla 1 y 2. Tabla 1: Solubilidad del Sulfato de Cobre (CuSO4) en agua en función de la temperatura. Temperatura (°C)

0

20

40

60

80

100

Solubilidad (g soluto/100g solvente) 12,0 19,0 27,1 39,9 55,0 75,1 Tabla 2: Solubilidad del Cloruro de sodio (NaCl) en agua en función de la temperatura. Temperatura (°C)

0

20

40

60

80

100

Solubilidad (g soluto/100g solvente) 35,7 36,0 36,5 37,3 38,4 39,8 Tomado y adaptado de: http://www.deciencias.net/ambito/archipdf/unidades2008/UD6.Quimica_casera2009alumn o(rev).pdf   90

Observe el gráfico realizado y describa el comportamiento de cada sal al variar la temperatura. Ubique en el gráfico las zonas por encima, debajo y sobre la curva y denomine la que corresponde a la solución insaturada, saturada y sobresaturada.


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lectoescritura de bachilleres de colegios distritales

Aprendizaje en pequeño grupo:  

Comparar las gráficas y los análisis hechos en el trabajo independiente, generen una conclusión de lo observado. La solubilidad en los gases es afectada por la temperatura de una forma particular que se evidencia a partir de las situaciones A, B y C, analizar y redactar una respuesta para cada situación: A: Las personas que pescan en los lagos, saben que conforme hace más calor, los peces se alejan de la orilla para buscar aguas más profundas y frías. ¿Por qué ocurre este fenómeno? B: Si se deja una gaseosa destapada, pierde más rápido el gas cuando se realiza la prueba en tierra caliente a cuando se realiza en un páramo. ¿Por qué? C: El calentamiento global amenaza la supervivencia de los peces.

Aprendizaje en gran grupo: El profesor orientará la discusión de las situaciones dadas y de los resultados de las gráficas. ACTIVIDADES DE DESARROLLO Actividad No. 3 Unidades de concentración Retomando la actividad 1 analice:    

¿Cómo se representan las cantidades de sustancias presentes en la bebida? ¿Es importante saber estos datos? ¿En qué otros ámbitos diferentes a la industria alimenticia, considera usted que se pueden utilizar datos de este tipo y con qué fin? Revise el siguiente cuadro con las unidades que se utilizan para definir la concentración de una solución:

Tomado de: http://quimicageneral.tripod.com/id18.html Aprendizaje independiente: Resuelva los siguientes ejercicios a partir de la información de la tabla:

91

2015


2015

    

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

¿Qué molalidad tiene una muestra de 100 mL de H2O de mar, en la que se encontraron 2,58 g de NaCl? Calcule el % p/p de una solución que se prepara agregando 7 gramos de NaHCO 3 a 100 gramos de agua. Una muestra de 5 mL de sangre contiene 0,00812 gramos de glucosa (C 6H12O6), calcule el % p/v de la muestra. En 300 mL de una solución de ácido clorhídrico hay 12 g de HCl. Determine la molaridad de la solución. (MM HCl= 36,5 g/mol) Determine la fracción molar de un ácido sulfúrico comercial que contiene 95g de H2SO4 por cada 100g de agua. Datos : Masas atómicas H=1 ; O=16 ;S =32

Aprendizaje en pequeño grupo: Formar 5 grupos para revisar y corregir en caso de ser necesario los ejercicios planteados. Aprendizaje en gran grupo: Un representante del pequeño grupo explica el procedimiento para dar respuesta a uno de los problemas asignados aleatoriamente por el profesor quien orientará el trabajo. Actividad No. 4 Dilución, neutralización, titulación, ph Aprendizaje independiente: Lea el siguiente párrafo y responda:  Si se toman 50 mL de una solución NaCl 0,4M y se llevan a un volumen final de 1L ¿Cuál es la concentración final?  ¿Qué volumen de HCl 6M debe usarse para preparar 500 ml de una solución de HCl 5 M? Si nos sirven una taza de café y está muy "cargado" (concentración alta de café), lo que hacemos de manera natural es agregarle más agua hasta que el sabor sea menos intenso o, en otras palabras, que baje la concentración de café. Este procedimiento que realizamos de manera mecánica, es un proceso de dilución. Luego pues, la dilución es el procedimiento que se sigue para preparar una disolución menos concentrada a partir de una más concentrada, y consiste simplemente EN AÑADIR MÁS SOLVENTE. ¿Qué hay que tener en cuenta en una dilución? En una dilución la cantidad de soluto no varía, por lo tanto: C1V1 = C2V2 Tomado y dilucion.html

donde: C1 =Concentración inicial y C2 = Concentración final V2 =Volumen alícuota (inicial) y V2 = Volumen final adaptado

de:

http://corinto.pucp.edu.pe/quimicageneral/contenido/64-

Aprendizaje en pequeño grupo:  

Revisar y corregir si es necesario los ejercicios planteados anteriormente. A partir de la solución de indicador de repollo morado, realice la siguiente práctica:  Coloque 3 gotas de vinagre y leche de magnesia en una hoja blanca, luego adicione sobre ella 2 gotas de indicador de repollo y observe lo ocurrido.  Realice el mismo procedimiento con otras sustancias líquidos encontradas en el salón: perfume, crema, (una puede ser la bebida que llevó) y observe los cambios.

92


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lectoescritura de bachilleres de colegios distritales

 Compare las coloraciones obtenidas con la escala de color de repollo mostrada por el profesor, de acuerdo a esto indique que sustancias son ácidas, básicas o neutras. Aprendizaje en gran grupo: El docente presentará una breve descripción acerca de la importancia de la titulación y socialización de las preguntas.

Actividad No. 5 Cinética Objetivo: Comprender los factores que afectan la velocidad de una reacción química. Aprendizaje en pequeño grupo: Realizar la siguiente experiencia, colocando una hoja de papel periódico para evitar ensuciar:

. Al extremo de una chocolatina acerque una vela encendida y observe lo ocurrido.

CUIDADO! DIRIGIR EL PITILLO A UN LUGAR DESPEJADO. 2. En el extremo de un pitillo coloque 2 cm de chocolate en polvo, por el otro extremo sople dirigiendo el polvo hacia la parte superior de una llama teniendo cuidado de no apagar la vela.

De acuerdo a lo observado anteriormente, responder:  ¿Con qué compuesto está reaccionando el chocolate y a qué tipo de reacción corresponde?  Si se asume que ambas sustancias contienen aproximadamente la misma composición, ¿A qué se debe a que hayan reaccionado de forma diferente?  Realizar una revisión conceptual en el texto acerca de los factores que pueden afectar la velocidad de una reacción química. Aprendizaje en gran grupo: El profesor orienta la socialización, donde cada grupo explica uno de los factores que afectan la velocidad de reacción. Actividad No 6: Equilibrio Objetivo: Comprender el concepto de equilibrio y reconocer el efecto del principio de Le Châtelier para predecir el desplazamiento de una reacción química al variar parámetros tales como la concentración, temperatura y presión. Aprendizaje independiente: Realice la siguiente lectura. Determine el valor de la constante de equilibrio para las reacciones a y b y predecir hacia dónde se encuentra favorecida dicha reacción. (Se encuentran al final de la lectura)

93

2015


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

El equilibrio químico se define como el estado al que se llega al final de cualquier sistema químico, en este estado no se observan cambios a medida que transcurre el tiempo, a pesar que siguen reaccionando entre sí las sustancias presentes. En la mayoría de las reacciones químicas los reactivos no se consumen totalmente, sino que por el contrario llega un momento en el que parece que la reacción ha concluido, esto quiere decir que si se analizan los reactivos gastados y los productos formados la concentración de todos permanece constante. ¿Significa esto que realmente la reacción se ha parado? Evidentemente no; una reacción en equilibrio es un proceso dinámico en el que continuamente los reactivos se están convirtiendo en productos y los productos se convierten en reactivo; como lo hacen a la misma velocidad nos da la sensación que la reacción se ha paralizado. El equilibrio químico se representa a través de una expresión matemática llamada constante de equilibrio. En una reacción hipotética: aA + bB <——–> cC + dD Donde a, b, c y d son los coeficientes estequiométricos de la reacción. La constante de equilibrio está dado por:

Recuerde que [ ] significa concentración molar (M). Si Kc <<< 1, entonces la reacción es muy reversible y se dice que se encuentra desplazada a la izquierda. Si Kc = 1, es una reacción en la que se obtiene 50% de reactivos y 50% de productos. Si Kc >>> 1, la reacción tiene un rendimiento alto y se dice que esta desplazada a la derecha. Tomado de: http://www.mcgraw-hill.es/bcv/guide/capitulo/844816962X.pdf

a) Para la reacción en fase gas H2(g) + I2(g) <——–> 2HI(g), las concentraciones encontradas a 490ºC una vez alcanzado el equilibrio son, en mol/L: [H2]=8,62X10−4 [I2]=2,63X10−3 [HI]=1,02X10−2 b) Reacción a 1000°C Concentraciones Aprendizaje en pequeño grupo:  94

Socializar y corregir los puntos del trabajo individual.


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lectoescritura de bachilleres de colegios distritales

Un equilibrio químico puede ser afectado por las siguientes variables: concentración, presión y temperatura, analizar cómo cambia un sistema es muy importante si se desea aumentar el rendimiento de un determinado producto. Para predecir cualitativamente el efecto del cambio de tales condiciones en el equilibrio se utiliza Principio de Le Châtelier, que dice:

De acuerdo a lo anterior complemente la información con ayuda del texto, analizando cómo se afecta el equilibrio con la modificación de las 3 variables. Aprendizaje en gran grupo: El profesor hará una síntesis del tema a partir de la socialización de las preguntas. ACTIVIDADES DE FINALIZACIÓN Actividad No. 7 Objetivo: Realizar trabajo en casa que permita reforzar y/o profundizar los conceptos trabajados. Entregar en una hoja cuadriculada:  

Consulte acerca de los coloides, sus propiedades y clases. Escriba un ejemplo cotidiano para cada una de las clases de coloides. Revisar el siguiente link acerca de la teoría de las colisiones https://www.youtube.com/watch?v=-RQIfEefAzg o busque en YouTube: “Teoría de las colisiones” de ediciones sm y realice una breve síntesis sobre sus principales características.

95

2015


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

UNIDAD DE APRENDIZAJE NO 12 CARBONO Y LOS CONCEPTOS ORGÁNICOS CONCEPTOS DE ESTUDIO   

Átomo de carbono: hibridación Clasificación de compuestos orgánicos Hidrocarburos: nomenclatura, clasificación.

RECURSOS: Hojas milimetradas Objetivo: Reconocer las generalidades de la química orgánica a partir de las propiedades del átomo de carbono como base fundamental de los compuestos orgánicos. ACTIVIDADES DE INICIACION Actividad No. 1 Objetivo: Identificar la presencia del átomo de carbono, como base de los compuestos orgánicos, en los materiales y productos de uso cotidiano. Aprendizaje independiente: Lea el siguiente texto y extraiga 3 ideas que considere importantes. Posteriormente formule 2 afirmaciones relacionadas con el impacto positivo que tiene el uso de compuestos orgánicos y 2 afirmaciones relacionadas con el impacto negativo que tiene el uso de compuestos orgánicos en la vida cotidiana y/o el ambiente. “Estamos acostumbrados a utilizar combustible para poder movilizarnos por los distintos medios de transporte, siendo estos derivados de compuestos Hidrocarburos, es decir, la combinación de Carbono e Hidrógeno en distintas cadenas o ramificaciones y que mediante la ignición, chispa o combustión permiten liberar una gran cantidad de energía que es posteriormente usada como energía mecánica. A su vez, el carbono está presente como parte básica de la alimentación, teniendo fundamental rol el ciclo del Carbono que es capturado por las especies vegetales para poder fabricar su propio alimento (el proceso que prácticamente todos conocemos, llamado Fotosíntesis) siendo este posteriormente incorporado por las especies que

96


se alimentan de ellas, obteniendo entonces los hidratos de carbono que representan la principal fuente energética del organismo. En la industria también es muy utilizado el Carbono, formando parte de los distintos compuestos de derivados plásticos, como también utilizado en materia prima en la siderurgia (es decir, la industria del acero) y otros metales, entre otras aplicaciones.” Tomado y adaptado de http://www.importancia.org/carbono.php#ixzz3V1YvCHXG Aprendizaje en pequeño grupo: En grupos de 2 o tres personas socialicen sus afirmaciones y formulen, construyan o complementen 2 afirmaciones relacionadas con el impacto positivo que tiene el uso compuestos orgánicos y 2 afirmaciones relacionadas con el impacto negativo que tiene el uso de compuestos orgánicos en la vida cotidiana y/o el ambiente. Aprendizaje en plenaria: Todos los grupos socializaran sus respectivas afirmaciones y las organizaran en orden de importancia en cuanto al beneficio y perjuicio que el uso de los compuestos orgánicos ofrecen a la sociedad actual. ACTIVIDADES DE DESARROLLO Actividad No. 2 Aprendizaje independiente: Lea detenidamente las generalidades del carbono y sus respectivas hibridaciones (anexo 1), realice un listado de las principales características para cada sección. Posteriormente complete la tabla al final de la sección. 

De acuerdo a la información del anexo 1 y teniendo en cuenta que los orbitales híbridos formaran enlaces sigma (σ) y los orbitales puros formaran enlaces pi (π) complete la siguiente tabla:

Aprendizaje en pequeño grupo: De forma individual y siguiendo las indicaciones del profesor desarrolle la siguiente actividad. Posteriormente confronte con un compañero sus respuestas procurando identificar a que se deben las inconsistencias encontradas, en caso de presentarse.  Complete la siguiente tabla teniendo en cuenta las siguiente moléculas: a. H3C

CH3

CH3

C CH2 CH CH CH3

CH CH CH CH2 HC CH2

b. CH2 H3C C

C

C

C CH

CH2

CH3

CH3 CH C

C

CH3

C CH3 CH3

97


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

Aprendizaje en gran grupo: Las diferentes parejas se encargaran de socializar las respuestas correspondientes en el tablero, argumentando su respuesta en caso que se presenten inconsistencias con las respuestas de las demás parejas del grupo. Actividad No. 3 Aprendizaje independiente: A continuación se relaciona una tabla de grupos funcionales orgánicos, analice su forma general identificándola en los ejemplos propuestos, enciérrelos en un círculo, resuelva sus dudas con el profesor.

98


Aprendizaje en pequeño grupo: en grupos de 2 o 3 personas lean el siguiente texto y teniendo en cuenta la tabla de grupos funcionales orgánicos indique qué grupos funcionales están presentes en cada una de estas moléculas. ¿Qué las diferencia? “La morfina es el principal alcaloide del opio que se obtiene al secar el líquido lechoso extraído de las semillas inmaduras de la amapola; este alcaloide fue muy utilizado n el siglo XIX para reducir el dolor causado por las heridas de guerra. Por otra parte, la heroína se vendía comercialmente a principios del siglo XX como una medicina segura para curar la tos, pero se descubrió que era una droga adictiva, mucho más potente que la morfina y que su adicción era más difícil de curar (una sola inyección induce dependencia). Como su uso genera tolerancia los adictos requieren cada vez más mayor cantidad, no es difícil alcanzar la sobredosis que produce la muerte.”

99


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

Tomado de: Gutiérrez, M., López, L., Arellano, L., & Ochoa, A. (2010). Química Orgánica aprende haciendo. En Química Orgánica aprende haciendo (págs. 8-52). México: Pearson.

Aprendizaje en gran grupo: Los pequeños grupos socializaran en el tablero las respuestas de la actividad propuesta argumentando su respuesta en el caso que se presenten inconsistencias con las respuestas de los demás grupos. ACTIVIDADES DE FINALIZACIÓN Actividad No. 4 Aprendizaje independiente: Empleando la información presentada en el anexo 2, para el reconocimiento de funciones de hidrocarburos y sus reglas de nomenclatura, subraye las ideas que definan características de estructura y encierre las ideas que se relacionen con indicaciones de nomenclatura. Construya un cuadro comparativo relacionando las semejanzas y diferencias en la estructura y nomenclatura de los alcanos, alquenos, alquinos y aromáticos. Aprendizaje en pequeño grupo: En parejas comparen sus cuadros, compleméntenlos o modifíquenlos de ser necesario. Aprendizaje en plenaria:Socialicen sus cuadros con el resto de parejas del salón para llegar a un consenso general.

100


Aprendizaje en pequeĂąo grupo: En parejas desarrolle la siguiente actividad. 1.

Escribe las fĂłrmulas semidesarrolladas de los compuestos dados y clasifica a cada uno:

a. b. c. d. e.

metil benceno 2,3-dimetil-2-hexeno 2,4-dimetil-3,3,4-trietilheptano 3-etil-1-pentino 3-metil-2-propil-1,5-hexadieno

2.

Nombra las sustancias representadas con los esquemas:

f. g. h. i. j.

4-metil-4-isopropil-2-octino m-bromonitrobenceno. 1-cloro-3isipropil-5-nitrobenceno. 2, 4,6-trinitrotolueno. m-terbutilyodobenceno

a. f. b.

c.

g. O2N

d.

NO 2

h. Br

e.

i.

Cl

101


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

Aprendizaje en pequeño grupo: Las parejas socializaran en el tablero las respuestas a los ejercicios propuestos argumentando su respuesta en el caso que se presenten inconsistencias con las respuestas de las demás parejas del grupo. Actividad No 5 Aprendizaje independiente: Empleando la información de las tablas presentes en el anexo 3 construya tres gráficas, una para cada tipo de hidrocarburo, en las cuales se relacione en el eje x la cantidad de carbonos y en el eje y el punto de fusión y el punto de ebullición. Emita 3 juicios de valor para cada grafica de acuerdo al patrón de comportamiento que logre identificar. Aprendizaje en pequeño grupo: En grupos de tres o cuatro personas socialicen los juicios de valor formulados y seleccionen los 3 que les parezcan más relevantes o pertinentes. Aprendizaje en gran grupo: Cada pequeño grupo socializara con el grupo en general los juicios de valor seleccionados. La plenaria determinara cuales son los más relevantes y pertinentes para establecer un consenso del comportamiento de las propiedades analizadas. ANEXO 1GENERALIDADES SOBRE EL CARBONO La posición del carbono dentro de la clasificación periódica lo ubica como un elemento peculiar en sus propiedades: su número atómico es 6, es decir, posee 6 protones y 6 electrones; es el elemento no metálico que encabeza la familia IV-A, con cuatro electrones de valencia, tal como se observa en el siguiente diagrama:

Cuando el átomo de carbono se encuentra en estado fundamental, sus orbitales atómicos (regiones del espacio con mayor probabilidad de encontrar un electrón) presentan la siguiente disposición espacial.

 Hibridación La hibridación consiste en una mezcla de orbitales atómicos o puros en un estado excitado para formar orbitales híbridos o moleculares, equivalentes con orientaciones determinadas en el espacio. De esta manera el átomo de carbono puede presentar tres tipos de hibridación.  Hibridación sp3 Cuando el carbono reacciona, modifica el orden de sus electrones, de tal forma que un electrón ubicado en el orbital 2s se acomoda en un orbital p vacío y da origen a una configuración de estado excitado. Luego el orbital 2s y los 3 orbitales p se aproximan y se mezclan dando origen a 4 orbitales sp3 con igual energía y forma. Esta hibridación le otorga 102


al átomo de carbono una geometría molecular denominada tetraédrica que presenta ángulos de enlace de 109,5o.

 Hibridación sp2 Esta hibridación considera que bajo condiciones de presión y temperatura diferentes a las existentes cuando se forman los compuestos de carbonos sp3, el carbono mezcla únicamente un orbital s con dos orbitales p y deja un orbital p sin mezclar; a este último se le conoce como orbital p puro. Esta hibridación le otorga al átomo de carbono una geometría molecular trigonal plana que presenta ángulos de enlace de 120o.

 Hibridación sp Existe una última combinación posible y distinta a las anteriores para que el carbono una orbitales de tipo s y p, esta es la unión de su orbital 2s con un solo orbital p dejando fuera de esta mezcla dos orbitales p puros. Esta configuración le otorga al átomo una geometría molecular lineal con ángulos de enlace igual a 180o.

ANEXO 2HIDROCARBUROS La palabra hidrocarburos designa un grupo de compuestos orgánicos constituidos principalmente por átomos de carbono e hidrógeno. La conformación y estructura de sus moléculas abarca desde la más simple, el metano (CH4), hasta aquellas de elevada complejidad como las correspondientes a los hidrocarburos aromáticos policíclicos. Dentro de ellos existen familias de compuestos agrupadas según su configuración (estructura molecular) y propiedades. Los átomos de carbono se unen entre si formando el esqueleto básico, pudiendo hacerlo en estructuras lineales simples y/o ramificadas o en estructuras cíclicas en forma de anillos.

103


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

Reglas IUPAC para la nomenclatura de alcanos: 1.

2. 3. 4.

5.

Idéntica la cadena más larga de átomos de carbono de todas las posibles. Si se identifican 2 cadenas con el mismo número de carbonos se escoge la que mayor número de ramificaciones tenga. Enumera la cadena principal a partir del extremo por el cual se obtenga la menor numeración posible para indicar la posición de las ramificaciones. Nombra las ramificaciones unidas a la cadena principal en estricto orden alfabético e indica la posición que guardan respecto a la cadena principal. Cuando esté presente más de un mismo radical en el compuesto se utilizan los prefijos di (para 2), tri (para 3), tetra (para 4), penta (para 5), hexa (para 6); señalando la posición de los mismos y conservando el orden alfabético teniendo en cuenta el nombre del radical y no las veces que se repite. Después de escribir el nombre de los radicales nombre la cadena principal con la terminación ano.

Reglas IUPAC para la nomenclatura de alquenos: 1.

2. 3. 4.

104

Identifica la cadena más larga de átomos de carbono que contenga al doble enlace. Si se identifican 2 cadenas con el mismo número de carbonos se escoge la que mayor número de ramificaciones tenga. Enumera la cadena principal a partir del extremo por el cual se obtenga la menor numeración posible para indicar la posición del doble enlace. Nombra las ramificaciones unidas a la cadena principal en estricto orden alfabético e indica la posición que guardan respecto a la cadena principal. Cuando esté presente más de un mismo radical en el compuesto se utilizan los prefijos di (para 2), tri (para 3), tetra (para 4), penta (para 5), hexa (para 6); señalando la


5.

posición de los mismos y conservando el orden alfabético teniendo en cuenta el nombre del radical y no las veces que se repite. Después de escribir el nombre de los radicales nombre la cadena principal con la terminación eno anteponiendo el número del carbono donde se encuentra el doble enlace.

Reglas IUPAC para la nomenclatura de alquinos: Las reglas de nomenclatura de los alquinos son las mismas de los alquenos, la única diferencia es que la terminación eno es cambiada por ino. Los hidrocarburos aromáticos , son hidrocarburos cíclicos, llamados así debido al fuerte aroma que caracteriza a la mayoría de ellos, se consideran compuestos derivados del benceno, pues la estructura cíclica del benceno se encuentra presente en todos los compuestos aromáticos.

Derivados monosustituidos

En este caso, el sustituyente podrá unirse a cualquiera de los seis átomos de C del anillo, pues todos ellos son equivalentes. Si el nombre del sustituyente no tiene prioridad sobre el hidrocarburo, éste se nombrará delante de la palabra benceno, por ejemplo: C6H5Cl = Clorobenceno. 

Derivados disustituidos

Para nominar los derivados con más de un sustituyente es necesario numerar a los átomos de carbono que constituyen al benceno, de manera que se puedan asignar a los sustituyentes los números de menor valor posible. Los sustituyentes en los derivados disustituidos pueden ir colocados de tres maneras o posiciones diferentes, y vendrán nombrados siguiendo el orden alfabético: 

Carbonos 1 y 2: si el sustituyente se encuentra en esta posición se dirá que se encuentra en posición “orto” (orto- “o-“). Ejemplo: C6H4Br2 = o-dibromobenceno  Carbonos 1 y 3: a esta posición de los sustituyentes se conocerá con el prefijo meta(m-). Ejemplo: C6H4ClNO2 = m-cloronitrobenceno  Carbonos 1 y 4: en este caso se nombrará como “para-” (p-). Ejemplo: C6H4(CH2CH3)2 = p-dietilbenceno

105


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

Derivados trisustituidos

Los sustituyentes pueden encontrarse ocupando un total de tres posiciones distintas, uniéndose a los átomos de carbono número 1, 2 y 3, 1,2 y 4, o incluso a los átomos 1,3 y 5. Ejemplo: C6H3 (CH3)3 = 1,2,3trimetilbenceno Los anillos del benceno, se pueden encontrar asociados entre sí en diferente número. Esta característica y su posibilidad de formar cadena laterales en los anillos, justifican la gran cantidad de compuestos aromáticos que se conocen. Ejemplo de otros compuestos aromáticos:

Los hidrocarburos aromáticos son de gran importancia, pues entre ellos se encuentran sustancias tan importantes para nosotros como lo son las hormonas y las vitaminas (todas menos la vitamina C), también dentro de este grupo se encuentran otras sustancias de gran uso en nuestra vida cotidiana como puede ser el caso de los condimentos, perfumes, etc. En cambio, los hidrocarburos aromáticos también son bastante perjudiciales para la salud, por ejemplo el benceno, tolueno, etilbenceno y Xileno, que son una serie de sustancias conocidas con las siglas BTEX, famosas por ser cancerígenas. Tomado de: http://quimica.laguia2000.com/category/quimica-organica

ANEXO 3

106


107


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

UNIDAD DE APRENDIZAJE No 13 FUNCIONES OXIGENADAS Y NITROGENADAS CONCEPTOS DE ESTUDIO Funciones oxigenadas:  Alcoholes y Fenoles  Éteres  Aldehídos  Cetonas  Ácidos carboxílicos  Esteres

Funciones nitrogenadas:  Aminas  Amidas Reacciones:  Adición  Sustitución  Condensación  Oxidación

Figura No 1. Esquema de reacciones orgánicas. Tomado de http://mrdvorsky.weebly.com/uploads/6/4/0/7/6407710/summary_organic_reactions .jpeg

108


Figura No 2. Propiedades físicas de los compuestos orgánicos. (Brown & Ford, 2014) RECURSOS: Portafolio, lápiz, marcadores para tablero de diferentes colores. ACTIVIDADES DE INICIO Comparar los efectos del alcohol metílico y el alcohol etílico. OBJETIVO: Argumentar problemáticas de consumo de alcohol desde el empleo de las reacciones orgánicas. Aprendizaje en pequeño grupo: Comparen y analicen la siguiente lectura. ¿Cuáles son los escenarios de intoxicación por el consumo de alcohol metìlico? ¿Cuáles son efectos de los subproductos del alcohol metílico en el organismo? Identifique el proceso en la figura No 1 y plantee ecuaciones.

Alcohol: un veneno juvenil El consumo de trago y de alcohol antiséptico entre los menores exige acciones decididas. El consumo de alcohol en jóvenes es un fenómeno peligroso, una tendencia que se ha agravado de manera progresiva, como lo demuestran diversos estudios. En Colombia hoy los niños se relacionan con el trago desde los 12 años, lo que se agrava si se tiene en cuenta que casi 9 de cada 10 menores de 17 años han consumido alguna vez alcohol en su vida y 7 lo hicieron en el último año. Es una situación compleja en tanto Colombia exhibe en Latinoamérica las menores edades en esta práctica y la mayor proporción de menores de 14 años con consumo habitual de licor. Estos datos son apenas una muestra de lo que ocurre hoy con los jóvenes respecto a esta sustancia. Para empezar, se asume que los niños acceden a licores legítimos con registros

sanitarios que garantizan que al menos son ‘seguros’, pero no es así. Recientemente, en un colegio de Bogotá se presentó una emergencia cuando un estudiante mezcló alcohol industrial con gaseosa y lo repartió a sus compañeros, lo que puso en riesgo la vida de por lo menos 30 de ellos, de los cuales una decena requirió atención hospitalaria y dos (menores de 14 años) tuvieron compromisos que amenazaron no solamente con quitarles la visión, sino sus vidas. Aunque el hecho fue calificado de manera ligera como una broma o un accidente, lo cierto es que, desde hace varios años, en las aulas y espacios de recreo de muchos colegios circulan cocteles de alcohol antiséptico (para uso medicinal) mezclado con refrescos, que se reparten con la falsa idea de ser un trago inocuo. Es claro que la principal motivación es el precio: de una botella de alcohol, que se compra por cuatro mil pesos, se obtienen dos del falso licor, lo que es diez veces más

109


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

económico que el aguardiente más barato, que tampoco deben consumir los menores. Pero la facilidad con la que muchas farmacias venden alcohol antiséptico a menores de edad, pasando por encima de los riesgos que esto conlleva y amparadas en la carencia absoluta de una norma que impida esta dispensación, es otro factor que favorece esta peligrosa costumbre. Peligrosa porque no solamente es la puerta de la adicción al licor, sino porque puede ser un tóxico letal, ya que, en no pocos casos, estas bebidas están contaminadas con un veneno llamado metanol, con el que se rinde criminalmente el alcohol medicinal. Con lo anterior, es lógico pensar que un gran número de jóvenes y adultos desconoce que esos primeros contactos son predictores de futuros abusos y adicciones al alcohol, porque se ha comprobado que casi la mitad de quienes se relacionan con el licor antes de los 15 años serán adultos alcohólicos. El metanol como sustancia neurotóxica El envenenamiento por metanol y su asociación con toxicidad severa sobre el sistema nervioso central y ocular, constituyen un problema de salud en todo el mundo. Las características clínicas de la intoxicación aguda por metanol han sido minuciosamente detalladas, e incluyen academia fórmica, acidosis metabólica, toxicidad visual, coma y, en casos extremos, la muerte. En las especies de mamíferos el metanol es metabolizado a formaldehído en el hígado, y por pasos oxidativos subsecuentes, a través de una vía dependiente del tetrahidrofolato (THF), se forman ácido fórmico y dióxido de carbono

110

Es hora de que las autoridades, los maestros, los padres de familia y la sociedad entera entiendan, de una vez por todas, que el acceso fácil de los menores de edad al trago y al alcohol antiséptico es un problema que desborda lo sanitario y permea los terrenos de la violencia temprana, la accidentalidad, las enfermedades de transmisión sexual, los embarazos juveniles, el suicidio y el consumo de otras sustancias psicoactivas. Esto exige acciones decididas y audaces que se incrusten en los pénsumes escolares desde los primeros años y, por lo menos, llevar a la práctica de manera estricta la normativa ya existente en este sentido. Si a esto se suma la prohibición radical de la venta de alcohol antiséptico a niños en farmacias, supermercados y tiendas, se estarían dando los pasos en la dirección correcta (El Tiempo, 2014)

Se ha identificado al ácido fórmico como el metabolito responsable de los efectos tóxicos del metanol, el cual inhibe la citocromo oxidasa, interfiriendo así directamente con el transporte de electrones en la cadena respiratoria (Eells y col., 1996; Wallace y col., 1997). Existe evidencia de que el ácido fórmico inhibe la función mitocondrial en la retina y aumenta el estrés oxidativo. Su acción citotóxica se ejerce de manera diferenciada sobre los fotorreceptores, con una recuperación parcial de las respuestas dominadas por los bastones y ninguna recuperación sobre las respuestas mediadas por conos Ultravioleta (UV). (González Quevedo)


ACTIVIDADES DE DESARROLLO OBJETIVO: Comprender las reacciones orgánicas de tal forma que se puedan predecir productos y reactivos. Aprendizaje en pequeño grupo: Resolución de problemas. Formar grupos de 4 personas donde analicen el esquema No. 1 y No 2. Y resuelva los siguientes problemas por formación de pequeños grupos.

Grupo No. 1

Grupo No. 3

Identificar las fórmulas de los productos orgánicos, A a E; formados en las reacciones,

A continuación tenemos un diagrama esquemático que representa algunas reacciones de eteno. Las letras A – D representan los compuestos orgánicos que se formó a partir de los reactivos y los catalizadores se muestra

Grupo No 2. Los tres compuestos con similar masa molecular relativa son butano, propanal y propanol. (i) Ordena de menor a mayor el punto de ebullición y explica las diferencias en sus puntos de ebullición. (ii) Predecir, con una explicación, cuál de los tres compuestos es menos soluble o miscible en agua. (iii) Cuando el propan-1-ol es oxidado usando una solución acidificada tibia de dicromato de potasio pueden obtenerse dos productos orgánicos. Deducir el nombre y la fórmula estructural para cada uno de estos dos productos. (v) Escribe el nombre del producto orgánico formado cuando se oxida propanol por una solución ácida de dicromato de potasio.

Deducir las fórmulas estructurales de los compuestos A, B, C y D y el nombre de IUPAC del compuesto C. Grupo No 4. Dos compuestos, A y D, cada uno tiene la fórmula C4H9 Cl. El compuesto A se hace reaccionar con hidróxido sódico acuoso diluido para producir el compuesto B de fórmula C4H10O. El compuesto B se oxida a continuación con permanganato de potasio para producir el compuesto C con una fórmula de C4H8O. El compuesto C resiste la oxidación adicional por permanganato de potasio. Compuesto D se hace reaccionar con hidróxido sódico acuoso diluido para producir el compuesto E con una fórmula de C4H10O. Compuesto E no reacciona con permanganato de potasio. Deducir las fórmulas estructurales de los compuestos A, B, C,D y E. 111


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

Aprendizaje en plenaria: Cada pequeño grupo presentará su esquema de reacción. El profesor hará una síntesis del tema a partir de los cuadros presentados por los grupos. ACTIVIDADES DE FINALIZACIÓN Experimentación

Aprendizaje en pequeño ACTIVIDAD POLIMEROS

grupo:

Poliacrilato de sodio: nieve artificial. Es un polímero formado por monómeros — CH2CH2(CO2Na)—. Se observa como un polvo blanco y sin olor. Puede aumentar su volumen hasta mil veces si se le agrega agua destilada. Debido a sus cualidades es utilizado en pañales, toallas higiénicas o procesos químicos que requieran la absorción de agua. También tiene la singular característica de parecerse a la nieve, mirado a simple vista, por lo que sirve para la creación de nieve artificial.

La capacidad de absorber grandes cantidades de agua se debe a que en su estructura molecular existen grupos de carboxilatos de sodio que cuelgan de la cadena de composición principal del compuesto. Estos grupos, al entrar en contacto con el agua desprenden el sodio, dejando libres iones negativos de carboxilo. Los iones negativos se repelen, estirando la cadena principal y provocando el aumento de volumen. Para que el compuesto vuelva a ser estable y neutro, los iones captan las moléculas de agua. MATERIALES Agua Recipiente Jeringa 1 Pañal pequeño Tijeras

112


Aprendizaje en pequeño grupo: Registre los datos y analicen las conclusiones sobre las experiencias.

ACTIVIDADES

1. Prediga la cantidad de agua en mL que puede absorber el pañal antes de que empiece a gotear. -----------------------------------------------------------------------------------------------------------------------------------2. Con las tijeras parta el pañal por la mitad. Llene el recipiente con agua, utilice la jeringa y comience a colocar agua en el pañal, registre la cantidad de agua medida hasta que este no pueda retener más. -----------------------------------------------------------------------------------------------------------------------------------3. Desocupe el recipiente y estruje el pañal para extraer la mayor cantidad de agua adicionada.. Mida la cantidad de agua extraída con la jeringa, y compare con la cantidad anterior. Discuta la diferencia. _________________________________________________________________________________ _________________________________________________________________________________ __________

Aprendizaje en plenaria: Comente la siguiente lectura: Los poliacrilatos son polímeros superabsorbentes debido a su estructura. En el caso del poliacrilato de sodio, los grupos carboxilato de sodio (-COONa) cuelgan de la cadena principal. Al contacto con el agua se desprenden iones sodio (Na+) dejando libres grupos negativos (-COO-). Estos, al estar cargados negativamente, se repelen entre sí, por lo que el polímero se "desenrolla" y absorbe agua. El poliacrilato de sodio es un polímero de masa molecular muy elevada, por lo que no se disuelve sino que gelifica.

Página 113 de 131


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

UNIDAD DE APRENDIZAJE No14 BIOQUÍMICA CONCEPTOS DE ESTUDIO: Carbohidratos, Proteínas, Lípidos, Vitaminas, Enzimas y Alcaloides. Objetivo: Desarrollar habilidades de relación y comparación en la comprensión de los procesos bioquímicos y su incidencia en nuestro organismo. MATERIALES: Guía de trabajo, cuaderno, esfero, lápiz, pliegos de papel periódico, marcadores.

ACTIVIDADES DE INICIO Actividad No 1 Aprendizaje independiente: Para empezar esta sesión se va a pensar en algunas situaciones donde se ha trabajado con algunas estructuras bioquímicas, para ello los estudiantes deben responder las siguientes preguntas: ¿Qué le sucede a una persona que ha pasado alrededor de 12 horas sin ingerir alimento? Descríbalo. ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ ____________ ¿Por qué es importante que nuestra dieta sea balanceada?, ¿Qué beneficios se obtienen de esto? ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ ____________ Escuchando los anuncios publicitarios en la televisión, se hace mención a productos con omega 3, 6 y 9, además de enriquecidos con vitaminas y minerales. ¿Estos alimentos brindan algún tipo de beneficio al cuerpo?, ¿es recomendable su consumo continúo? ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ ____________ Acorde con las situaciones mencionadas anteriormente y la intención de esta unidad, proponga que quisiera aprender usted acerca de este tema y que debe hacer para lograr aprenderlo. ________________________________________________________________________ ________________________________________________________________________ 114


________________________________________________________________________ ________________________________________________________________________ ____________ Finalmente, se hará una puesta en común en el gran grupo de las respuestas planteadas con fin de dar orientación al tema que se va a trabajar. ACTIVIDADES DE DESARROLLO Actividad No 2. Apropiación conceptual Aprendizaje en pequeño grupo: El profesor organizará a los estudiantes para formar grupos de trabajo por cada uno de los temas que se abordarán durante la sesión. Para esto se empleará la información presentada en el anexo 1. Cada uno de los grupos deberá realizar una pequeña presentación a sus compañeros. Esta presentación debe hacerse de forma creativa, cada grupo debe lograr que el resto de participantes en la sesión se involucren dentro de la actividad. Se pueden realizar representaciones, inventar canciones, proponer juegos como: “el ahorcado”, entre otras. Para la preparación y desarrollo de esta actividad se contara con un tiempo aproximado de 70 minutos. El profesor realizará una complementación de cada una de las biomoléculas presentada por los estudiantes, haciendo las aclaraciones necesarias sobre cada uno de los temas trabajados y su relación con las preguntas iniciales. Para esta parte dependiendo de los recursos con los que se cuenten puede trabajar la actividad A, si se cuenta con la posibilidad de ver el video o la actividad B, si no se cuenta con la posibilidad de ver el video. Actividad A A continuación se realizará la observación de un video orientador “respiración celular: metabolismo y nutrición” en: https://www.youtube.com/watch?v=YECG3FMgnHs. Para la visualización del video el profesor indica la realización de los siguientes pasos: Antes de ver el video: ¿Qué le sugiere el título del video? ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ ____________ ¿Qué espera encontrar en el video? ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ ____________ Durante el video

Página 115 de 131


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

Realice un cuadro con dos columnas en las cuales pondrá: ideas encontradas y palabras desconocidas Después del video  Organice las ideas y realice un pequeño escrito donde reconstruya el video observado  Proponga una definición a las palabras desconocidas acorde con lo que entendió del video.  Comparta con su grupo el escrito realizado y las palabras desconocidas, si es necesario complemente su escrito y sus definiciones con lo que sus compañeros le comparten. Para finalizar, compartan con su profesor las palabras que no pudieron definir para que sean aclaradas y contextualizadas. Actividad B A continuación se realizará la lectura de “Metabolismo Celular” en el anexo 2. Para la lectura del texto el profesor indica la realización de los siguientes pasos: Antes de leer: ¿Qué le sugiere el título de la lectura? ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ ____________ ¿Cuáles son los subtítulos del texto? ¿Qué espera encontrar en el texto después de leer los subtítulos? ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ ________________________________________________________________________ ____________ Durante la lectura Subraye las ideas que considere más importantes. Use colores diferentes para señalar niveles de importancia. Después de la lectura  Organice los conceptos y realice un mapa conceptual manteniendo los niveles de importancia que estableció  Comparta con su grupo el mapa realizado, formulen un mapa final donde integren las consideraciones presentadas por los integrantes del grupo. Para finalizar, entreguen a su profesor los mapas elaborados, el profesor realizará las aclaraciones necesarias para finalizar la conceptualización del tema.

ACTIVIDADES DE CIERRE Evaluación del trabajo 116


Para evaluar el trabajo realizado durante la sesión se realizará la siguiente actividad: 1.   

2.   

Evaluación Conceptual: Cada grupo de trabajo formulará en una hoja una pregunta a modo de evaluación temática que quiera realizarle a sus compañeros. Las preguntas se repartirán a cada uno de los grupos, los cuales deben dar la solución de las mismas en sus cuadernos. Las respuestas a las preguntas serán socializadas en público y se harán las respectivas aclaraciones por parte del grupo que formuló la pregunta y el profesor en caso de ser necesario. Evaluación personal Cada estudiante debe revisar nuevamente las preguntas iniciales y mencionar que lograron aprender. Adicionalmente cada estudiante planteará un listado de acciones que tuvo que realizar para el aprendizaje de los conceptos de la sesión, luego les asignará un número indicando con el número 1 la acción que considera le fue más útil y así sucesivamente. Finalmente cada estudiante deberá escribir un pequeño texto, máximo 10 líneas, donde mencione cómo podría aplicar las acciones realizadas en el aprendizaje de cualquier temática.

 BIBLIOGRAFÍA Y REFERENCIAS WEB http://www.aula21.net/nutricion/proteinas.htm http://www.ecured.cu/index.php/Alcaloide http://www.profesorenlinea.cl/Ciencias/Metabolismo_celular.html http://www.natureduca.com/med_sustanc_alcaloides.php ANEXO 1 BIOQUÍMICA Y BIOMOLECULAS

“La bioquímica estudia la base molecular de la vida. En los procesos vitales interaccionan un gran número de sustancias de alto peso molecular o macromoléculas con compuestos de menor tamaño, dando por resultado un número muy grande de reacciones coordinadas que producen la energía que necesita la célula para vivir, la síntesis de todos los componentes de los organismos vivos y la reproducción celular. Al conjunto de reacciones que suceden dentro de los seres vivos se le llama metabolismo”. Adaptado de: http://toxamb.pharmacy.arizona.edu/desc.html Dentro de las moléculas que permiten el funcionamiento de los seres vivos o tiene influencia en él encontramos: arbohidratos  Proteínas  Lípidos  Ácidos Nucleicos  Vitaminas  Enzimas  Alcaloides

Página 117 de 131


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

1. CARBOHIDRATOS Son la fuente principal de energía para los seres humanos y constituyen la mayor porción de la dieta. Los carbohidratos son compuestos que contienen carbono, hidrógeno y oxígeno. Durante el metabolismo se queman para producir energía, y liberan dióxido de carbono (CO2) y agua (H2O). En la dieta humana están sobre todo en forma de almidones y diversos azúcares. Se pueden dividir en tres grupos:   

Monosacáridos: glucosa, fructosa, galactosa; Disacáridos: sacarosa (azúcar de mesa), lactosa, maltosa; Polisacáridos: almidón, glucógeno (almidón animal), celulosa.

1.1. Monosacáridos Los carbohidratos más sencillos son los monosacáridos o azúcares simples. Estos azúcares pueden pasar a través de la pared del tracto alimentario sin ser modificados por las enzimas digestivas. Los tres más comunes son: glucosa, fructosa y galactosa. La glucosa, a veces también denominada dextrosa, se encuentra en frutas, batatas, cebollas y otras sustancias vegetales; es la sustancia en la que se convierten muchos otros carbohidratos, como los disacáridos y almidones, por las enzimas digestivas. La glucosa se oxida para producir energía, calor y dióxido de carbono, que se elimina con la respiración. Debido a que la glucosa es el azúcar en la sangre, con frecuencia se utiliza como sustancia para dar energía a las personas a las que se alimenta por vía endovenosa, disuelta en agua estéril, en concentraciones de 5 a 10 por ciento. La fructosa se encuentra en la miel de abeja y algunos jugos de frutas. La galactosa es un monosacárido que se forma, junto con la glucosa, cuando las enzimas digestivas fraccionan la lactosa o azúcar de la leche. 1.2. Disacáridos Los disacáridos, compuestos de azúcares simples, necesitan que el cuerpo los convierta en monosacáridos antes que se puedan absorber en el tracto alimentario. Ejemplos de disacáridos son la sacarosa, la lactosa y la maltosa. La sacarosa es el nombre científico para el azúcar de mesa, se produce habitualmente de la caña de azúcar, pero también a partir de la remolacha; también se encuentra en las zanahorias y la piña. La lactosa es el disacárido que se encuentra en la leche humana y animal, es mucho menos dulce que la sacarosa. La maltosa se encuentra en las semillas germinadas.

118

2015


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

http://www.uib.cat/facultat/ciencies/prof/josefa.donoso/campus/modulos/modulo6/disacaridos.gif

1.3. Polisacáridos Los polisacáridos son químicamente los carbohidratos más complejos, tienden a ser insolubles en el agua y los seres humanos sólo pueden utilizar algunos para producir energía. Ejemplos de polisacáridos son: el almidón, el glucógeno y la celulosa. El almidón es una fuente de energía importante para los seres humanos. Se encuentra en los granos cereales, así como en raíces comestibles tales como patatas y yuca. El almidón se libera durante la cocción, cuando el calor rompe los gránulos. El glucógeno se produce en el cuerpo humano y a veces se conoce como almidón animal. Se forma a partir de los monosacáridos resultantes de la digestión del almidón alimentario. El almidón de arroz o de la yuca se divide en los intestinos para formar moléculas de monosacáridos, que pasan al torrente sanguíneo. Los excedentes de los monosacáridos que no se utilizan para producir energía se fusionan en conjunto para formar este nuevo polisacárido. Por lo general, está presente en los músculos y en el hígado, pero no en grandes cantidades. Cuando cualquiera de los carbohidratos digeribles se consume por encima de las necesidades corporales, el organismo los convierte en grasa que se deposita como tejido adiposo debajo de la piel y en otros sitios del cuerpo. La celulosa, hemicelulosa, lignina, pectina y gomas, algunas veces se denominan carbohidratos no disponibles, debido a que los humanos no los pueden digerir. La celulosa y la hemicelulosa, son polímeros vegetales principales componentes de las paredes celulares, son sustancias fibrosas. La celulosa, un polímero de glucosa, es una de las fibras de las plantas verdes. La hemicelulosa es un polímero de otros azúcares, por lo general hexosa y pentosa. La lignina es el componente principal de la madera. Las pectinas se encuentran en los tejidos vegetales y en la savia y son polisacáridos coloidales. Las gomas son además carbohidratos viscosos extraídos de las plantas. Las pectinas y las gomas se utilizan en la industria alimenticia. El tracto alimentario humano no puede dividir estos carbohidratos o utilizarlos para producir energía. Algunos animales, como los vacunos, tienen en sus intestinos microorganismos que dividen la celulosa y la hacen disponible como alimento productor de energía. En los seres humanos, cualquiera de los carbohidratos no disponibles pasa a través del tracto 119

2015


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

intestinal. Forman gran parte del volumen y desecho alimentario que se elimina en las heces, y con frecuencia se denominan “fibra dietética”. Una ventaja de las dietas altas en fibra es la disminución del estreñimiento respecto de las personas que tienen una dieta baja en fibra. El volumen en las dietas de alto contenido de fibra puede contribuir a una sensación de llenura o saciedad, que puede llevar a un menor consumo de energía, y esto, a su vez, ayuda a reducir la probabilidad de obesidad. Una dieta alta en fibra resulta en un tránsito más rápido de los alimentos a través del tracto intestinal, y por lo tanto, se considera de ayuda para un funcionamiento intestinal normal y saludable. La fibra dietética se ha encontrado unida a la bilis en los intestinos. Un alto contenido en fibra de la mayoría de las dietas tradicionales puede ser un factor importante para prevenir ciertas enfermedades que parecen ser mucho más frecuentes en las personas que consumen dietas de bajo contenido en fibra. Debido a que la fibra facilita el paso rápido de materiales a través del intestino, puede ser un factor en el control de diverticulitis, apendicitis, hemorroides, ciertos tipos de cáncer y quizá de arteriosclerosis, la que lleva a la enfermedad coronaria. 2. PROTEINAS Las proteínas son las biomoléculas que desempeñan un mayor número de funciones en las células de todos los seres vivos. Por un lado, forman parte de la estructura básica de los tejidos (músculos, tendones, piel, uñas, etc.) y, por otro, desempeñan funciones metabólicas y reguladoras (asimilación de nutrientes, transporte de oxígeno y de grasas en la sangre, inactivación de materiales tóxicos o peligrosos, etc.). También son quienes definen la identidad de cada ser vivo, ya que son producto de la estructura del código genético (ADN) y base de los sistemas de reconocimiento de organismos extraños en el sistema inmunitario. Son macromoléculas orgánicas, constituidas básicamente por carbono (C), hidrógeno (H), oxígeno (O) y nitrógeno (N); aunque pueden contener también azufre (S) y fósforo (P) y, en menor proporción, hierro (Fe), cobre (Cu), magnesio (Mg), yodo (I), etc... Estos elementos químicos se agrupan para formar unidades estructurales llamados AMINOÁCIDOS, a los cuales podríamos considerar como los "ladrillos de los edificios moleculares proteicos". Se clasifican, de forma general, en Homoproteínas y Heteroproteínas según estén formadas respectivamente sólo por aminoácidos o bien por aminoácidos más otras moléculas o elementos adicionales no aminoacídicos. 2.1. Aminoácidos Los aminoácidos se caracterizan por poseer un grupo carboxilo (-COOH) y un grupo amino (-NH2). De las moléculas que cumplen con esta estructura solo 20 aminoácidos son proteicos y 8 resultan indispensables (o esenciales) para la vida humana y 2 resultan "semiindispensables". Son estos 10 aminoácidos los que requieren ser incorporados al organismo en la dieta y, con más razón, en los momentos en que el organismo más los necesita: en la disfunción o enfermedad. Los aminoácidos esenciales más problemáticos son el triptófano, la lisina y la metionina. Es típica su carencia en poblaciones en las que los cereales o los tubérculos constituyen la base de la alimentación. Hay que destacar que, si falta uno solo de ellos (aminoácido 120


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

esencial) no será posible sintetizar ninguna de las proteínas en la que sea requerido dicho aminoácido. Esto puede dar lugar a diferentes tipos de desnutrición, según cual sea el aminoácido limitante. Los alimentos que ingerimos nos proveen proteínas. Pero tales proteínas no se absorben normalmente en tal constitución sino que, luego de su desdoblamiento ("hidrólisis" o rotura), causado por el proceso de digestión, atraviesan la pared intestinal en forma de aminoácidos y cadenas cortas de péptidos. Esas sustancias se incorporan inicialmente al torrente sanguíneo y, desde allí, son distribuidas hacia los tejidos que las necesitan para formar las proteínas, consumidas durante el ciclo vital. 2.2. Enlace Peptídico Los péptidos están formados por la unión de aminoácidos mediante un enlace peptídico. Es un enlace covalente que se establece entre el grupo carboxilo de un aminoácido y el grupo amino del siguiente, dando lugar al desprendimiento de una molécula de agua. Dependiendo del número de aminoácidos unidos mediante enlaces peptídicos se puede hacer una clasificación así: oligopéptidos con menos de 10 aminoácidos, péptidos entre 10 y 50 aminoácidos, proteínas estructurales con un número superior de aminoácidos. 2.3. Estructura La organización de una proteína viene definida por cuatro niveles estructurales denominados: estructura primaria, estructura secundaria, estructura terciaria y estructura cuaternaria. Cada una de estas estructuras informa de la disposición de la anterior en el espacio. 2.3.1. Estructura Primaria La estructura primaria es la secuencia de aminoácidos de la proteína. Nos indica qué aminoácidos componen la cadena polipeptídica y el orden en que dichos aminoácidos se encuentran. 2.3.2. Estructura Secundaria La estructura secundaria es la disposición de la secuencia de aminoácidos en el espacio. Los aminoácidos, a medida que van siendo enlazados durante la síntesis de proteínas y gracias a la capacidad de giro de sus enlaces, adquieren una disposición espacial estable. Existen dos tipos de estructura secundaria: La α (alfa)-hélice y la conformación beta esta estructura se forma al enrollarse helicoidalmente sobre sí misma la estructura primaria. Se debe a la formación de enlaces de hidrógeno entre el -C=O de un aminoácido y el NH- del cuarto aminoácido que le sigue. 2.3.3. Estructura Terciarias 121

2015


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

La estructura terciaria informa sobre la disposición de la estructura secundaria de un polipéptido al plegarse sobre sí misma originando una conformación globular. En definitiva, es la estructura primaria la que determina cuál será la secundaria y por tanto la terciaria. Esta conformación globular facilita la solubilidad en agua y así realizar funciones de transporte, enzimáticas, hormonales, etc.; se mantiene estable gracias a la existencia de enlaces entre los radicales R de los aminoácidos. Aparecen varios tipos de enlaces: el puente disulfuro entre los radicales de aminoácidos que tiene azufre. Los puentes de hidrógeno. Los puentes eléctricos. Las interacciones hifrófobas. 2.3.4. Estructura Cuaternaria Esta estructura informa de la unión, mediante enlaces débiles (no covalentes) de varias cadenas polipeptídicas con estructura terciaria, para formar un complejo proteico. Cada una de estas cadenas polipeptídicas recibe el nombre de protómero. 2.4. Funciones 2.5. Tipos

Ejemplo

Función o localización

Enzimas

Ácido-grasosintetosa

Cataliza la síntesis de ácido grasos

Reserva

Ovoalbúmina

Clara de Huevo

Transportadoras

Hemoglobina

Transporta oxígeno en la sangre

Protectoras en la sangre

Anticuerpos

Bloquean a sustancias extrañas

Hormonas

Insulina

Regula el metabolismo de la glucosa

Estructurales

Colágeno

Tendones, cartílagos, pelo

Contráctiles

Miosina

Constituyente de las fibras musculares

3. LÍPIDOS Son biomoléculas formadas básicamente por carbono e hidrógeno y generalmente, en menor proporción, también oxígeno. Ocasionalmente pueden contener también fósforo, nitrógeno y azufre. Es un grupo de sustancias muy heterogéneas que sólo tienen en común estas dos características: son insolubles en agua y son solubles en disolventes orgánicos, como éter, cloroformo, benceno, etc. 3.1. Clasificación 122


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

3.1.1. Ácidos grasos Son los componentes característicos de muchos lípidos y rara vez se encuentran libres en las células. Son moléculas formadas por una larga cadena hidrocarbonada de tipo lineal y tienen en un extremo de la cadena un grupo carboxilo (-COOH). Los ácidos grasos saturados sólo tienen enlaces simples entre los átomos de carbono. Son ejemplos de este tipo de ácidos el palmítico (16 átomos de C) y el esteárico (18 átomos de C) suelen ser SÓLIDOS a temperatura ambiente. Los ácidos grasos insaturados tienen uno o varios enlaces dobles. Son ejemplos el oleico (18 átomos de C y un doble enlace) y el linoleico (18 átomos de C y dos dobles enlaces) suelen ser LÍQUIDOS a temperatura ambiente. Estos lípidos también pueden clasificarse según su consistencia a temperatura ambiente: Aceite: cuando la grasa es líquida (aceite de oliva); Grasa: cuando la grasa es sólida (manteca de cerdo) En los alimentos que consumimos siempre encontramos una combinación de ácidos grasos saturados e insaturados. Los ácidos grasos saturados son más difíciles de utilizar por el organismo, ya que sus posibilidades de combinarse con otras moléculas están limitadas por estar todos sus puntos de enlace ya utilizados o "saturados". Esta dificultad para combinarse con otros compuestos hace que sea difícil romper sus moléculas en otras más pequeñas que atraviesen las paredes de los capilares sanguíneos y las membranas celulares. Por eso, en determinadas condiciones pueden acumularse y formar placas en el interior de las arterias (arteriosclerosis). Los ácidos grasos insaturados son más favorables para el proceso de degradación, algunos de ellos son conocidos como omega 3, 6 y 9 dependiendo de la ubicación de la insaturación en la estructura. 123

2015


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

3.1.2. Triacilgliceridos o Triglicéridos Estos surgen de la esterificación de los ácidos grasos como se muestra a continuación

3.1.3. Fosfogliceridos o fosfolípidos Siguiendo en importancia nutricional se encuentran los fosfolípidos, que incluyen fósforo en sus moléculas. Entre otras cosas, forman las membranas de nuestras células y actúan como detergentes biológicos. 3.1.4. Esteroides Son derivados del anillo del ciclopentanoperhidrofenantreno. En este grupo destaca el colesterol, que es el compuesto causante de la arteriosclerosis. El colesterol cuya fórmula se muestra en la figura consta del ciclopentanoperhidrofenantreno con un grupo – OH en el carbono 3 y una cadena hidrocarbonada en el carbono 17. Dentro de este grupo se encuentran también las hormonas sexuales, las suprarrenales y la vitamina D. El colesterol se encuentra exclusivamente en los tejidos animales y es necesario para: formar las membranas celulares y fabricar compuestos imprescindibles (hormonas, bilis y vitamina D). Entre los alimentos ricos en colesterol figuran: los huevos, el hígado, los riñones y algunos pescados azules. Sin embargo, la fuente principal del colesterol son en realidad, todos aquellos productos ricos en grasas saturadas, por ejemplo, la nata, la mantequilla, los quesos curados y las carnes grasas, como la de cerdo, de cordero y de res. A su vez, el hígado las transforma en colesterol. Las células de todo el cuerpo utilizan el colesterol para producir una serie de hormonas importantes e imprescindibles para el crecimiento y la reproducción. El colesterol es un componente vital para la formación de nuevas paredes celulares en diferentes partes del cuerpo. Además, es un ingrediente esencial de la bilis producida en el hígado, que más adelante pasa al intestino para ayudar a digerir las grasas. Casi todo el colesterol que llega a la corriente sanguínea es producido por el hígado, debido a la metabolización de una gran variedad de alimentos, especialmente de grasas saturadas. Sin embargo, ya que la necesidad diaria de colesterol para satisfacer la función celular se abastece sobradamente gracias a la misma función del hígado, el organismo no precisa ningún aporte suplementario de colesterol. 3.2. Funciones 124


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

Los lípidos desempeñan cuatro tipos de funciones: 3.2.1. Función de reserva. Son la principal reserva energética del organismo. Un gramo de grasa produce 9,4 kilocalorías en las reacciones metabólicas de oxidación, mientras que proteínas y glúcidos sólo producen 4,1 kilocaloría/g. 3.2.2. Función estructural. Forman las bicapas lipídicas de las membranas. Recubren órganos y le dan consistencia, o protegen mecánicamente como el tejido adiposo de pies y manos. 3.2.3. Función biocatalizadora. En este papel los lípidos favorecen o facilitan las reacciones químicas que se producen en los seres vivos. 3.2.4. Función transportadora. El transporte de lípidos desde el intestino hasta su lugar de destino se realiza mediante su emulsión gracias a los ácidos biliares y a los proteolípidos, asociaciones de proteínas específicas con triacilglicéridos, colesterol, fosfolípidos, etc., que permiten su transporte por sangre y linfa. 4. VITAMINAS Las vitaminas son sustancias imprescindibles en los procesos metabólicos que tienen lugar en los seres vivos. No aportan energía, puesto que no se utilizan como combustible, pero sin ellas el organismo no es capaz de aprovechar los elementos constructivos y energéticos suministrados en la alimentación. Normalmente se utilizan en el interior de las células como precursoras de las coenzimas, a partir de los cuales las miles de enzimas regulan las reacciones químicas de las que viven las células. Las vitaminas deben ser aportadas a través de la alimentación, puesto que el cuerpo humano no puede sintetizarlas. Una excepción es la vitamina D, que se puede formar en la piel con la exposición al sol, y las vitaminas K, B1, B12 y ácido fólico, que se forman en pequeñas cantidades en la flora intestinal. 4.1. Clasificación Las vitaminas se clasifican en dos grupos: Hidrosolubles y liposolubles 4.1.1. Hidrosolubles Se caracterizan porque se disuelven en agua, por lo que pueden pasarse al agua del lavado o de la cocción de los alimentos. Muchos alimentos ricos en este tipo de vitaminas no nos aportan al final de prepararlos la misma cantidad que contenían inicialmente. Para recuperar parte de estas vitaminas (algunas se destruyen con el calor) se puede aprovechar el agua de cocción de las verduras para preparar caldos o sopas. Estas vitaminas no se almacenan en el organismo, así que deben aportarse regularmente y sólo puede prescindirse de ellas durante algunos días.

125

2015


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

El exceso de vitaminas hidrosolubles se excreta por la orina, por lo que no tienen efecto tóxico por elevada que sea su ingesta. A este grupo pertenecen las vitaminas del complejo B y la vitamina C 4.1.2. Liposolubles Se caracterizan porque no son solubles en agua, se almacenan en el organismo y su ingesta en exceso puede provocar desajustes. Químicamente se trata de lípidos insaponificables, caracterizados por su incapacidad para formar jabones, ya que carecen en sus moléculas de ácidos grasos unidos mediante enlaces éster. Pertenecen a este grupo las vitaminas A, D, E y K. 4.2. Factores que afectan o destruyen a las vitaminas Las vitaminas pueden ser afectadas por los siguientes factores: 4.2.1. Las bebidas alcohólicas, pues el alcohol aporta calorías sin apenas contenido vitamínico, a la vez que disminuye el apetito; al ingerir menos alimentos se producen carencias principalmente de ácido fólico y de vitaminas del grupo B. 4.2.2. El tabaco. La vitamina C interviene en los procesos de desintoxicación, reaccionando contra las toxinas del tabaco. Debido a ese gasto extra, en fumadores se recomienda un aporte de vitamina C doble o triple del normal. 4.2.3. El estrés. Bajo tensión emocional se segrega más adrenalina que consume gran cantidad de vitamina C. En situaciones de estés, se requiere un suplemento de vitaminas C, E y del grupo B. 4.2.4. Medicamentos. Los antibióticos y laxantes destruyen la flora intestinal, por lo que se puede sufrir déficit de vitamina B12.

5. ENZIMAS En todos los organismos es preciso sintetizar macromoléculas a partir de moléculas sencillas, y para establecer los enlaces entre éstas se necesita energía. Esta energía se consigue rompiendo los enlaces químicos internos de otras macromoléculas, sustancias de reserva o alimentos. Todo ello requiere una serie de reacciones coordinadas cuyo conjunto se denomina metabolismo.

126


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

Dado que las sustancias que intervienen en estas reacciones son, generalmente, muy estables, se requeriría una gran cantidad de energía para que reaccionaran entre sí, si no, la velocidad de reacción sería nula o demasiado lenta. Para acelerar la reacción en un laboratorio bastaría con aumentar la temperatura o bien con añadir un catalizador, es decir, una sustancia que aumente la velocidad de la reacción. En los seres vivos, un aumento de temperatura puede provocar la muerte, por lo que se opta por la otra posibilidad, es decir, el concurso de catalizadores biológicos o biocatalizadores. Las moléculas que desempeñan esta función son las enzimas. Las enzimas son, proteínas globulares capaces de catalizar las reacciones metabólicas. Son solubles en agua y se difunden bien en los líquidos orgánicos. Pueden actuar a nivel intracelular, es decir, en el interior de la célula donde se han formado, o a nivel extracelular, en la zona donde se segregan. Las enzimas cumplen las dos leyes comunes a todos los catalizadores: la primera es que durante la reacción no se alteran, y la segunda es que no desplazan la constante de equilibrio para que se obtenga más producto, sino que simplemente favorecen que la misma cantidad de producto se obtenga en menos tiempo. Las enzimas, a diferencia de los catalizadores no biológicos, presentan una gran especificidad, actúan a temperatura ambiente y consiguen un aumento de la velocidad de reacción de un millón a un trillón de veces. A continuación se presenta la clasificación de las enzimas: 6. ALCALOIDES Los alcaloides son sustancias orgánicas nitrogenadas, con propiedades básicas, de origen vegetal en su mayoría y acción fisiológica enérgica (medicinal o venenosa), como la morfina, la cafeína o la nicotina. Son sustancias peligrosas o de efectos imprevisibles a diferentes dosis y organismos, por lo que deben ser siempre controladas por un médico. Los alcaloides poseen una complejidad molecular que causa algunos potentes efectos fisiológicos; en su mayor parte son venenos vegetales muy activos, y pequeñas dosis producen grandes efectos en el organismo. Su verdadero valor solo puede ser asegurado en manos de un médico, pues aunque pueden ser excelentes medicamentos, que incluso resuelven enfermedades muy graves, su uso inadecuado puede causar intoxicaciones graves, e incluso la muerte.

127

2015


2015

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

Muchos de ellos se utilizan en terapéutica como estimulantes cardíacos y cerebrales; al aumentar la dosis disminuye la actividad motora provocando sueño (acción narcótica). Si la dosis sigue aumentándose puede provocarse un estado de inconsciencia. Su ingesta produce dependencia. 6.1. Clasificación Los alcaloides se pueden clasificar según la composición química y estructura molecular: 6.1.1. Isoquinoleicos: como la morfina, etilmorfina, codeína, papaverina y contenidos del opio (de la adormidera o Papaver somniferum). 6.1.2. Indólicos: como la ergometrina, ergotamina, ergotoxina y el cornezuelo de los cereales. 6.1.3. Quinoleicos: como el pedúnculo foliado de la ruda 6.1.4. Piridínicos y piperídicos: como la ricina (del ricino), trigonelita (de la alholva), cicutina (de la cicuta). 6.1.5. Derivados del tropano: como la escopolamina y atropina (de la belladona). 6.1.6. Esteroides: raíz del eléboro, dulcamara o aconitina, entre otros muchos. 6.1.7. Otros: fenilaminas, colquicina (del cólquico), capsicina (del pimiento).

6.2. Función Cumplen diversas funciones en las plantas, como defensas naturales contra animales y hongos, y suelen producir efectos fisiológicos en los animales. La mayoría de plantas medicinales, tóxicas y alucinógenas deben sus efectos a la actividad biológica de los alcaloides. Según la dosis, y la duración del tratamiento, sus usos pueden ser desde analgésicos, anestésicos, curativos o psicotrópicos, hasta producir la muerte (empleados como pesticidas, insecticidas o armas criminales), y/o producir adicciones leves o graves. El THC no es un alcaloide, puesto que no contiene nitrógeno. Generalmente actúan sobre el sistema nervioso central (SNC), si bien algunos afectan al sistema nervioso parasimpático y otras al sistema nervioso simpático. ANEXO 2 METABOLISMO CELULAR En un sentido amplio, metabolismo es el conjunto de todas las reacciones químicas que se producen en el interior de las células de un organismo. Mediante esas reacciones se transforman las moléculas nutritivas que, digeridas y transportadas por la sangre, llegan a ellas. El metabolismo tiene principalmente dos finalidades:

128


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

Obtener energía química utilizable por la célula, que se almacena en forma de ATP (adenosín trifostato). Esta energía se obtiene por degradación de los nutrientes que se toman directamente del exterior o bien por degradación de otros compuestos que se han fabricado con esos nutrientes y que se almacenan como reserva. Fabricar sus propios compuestos a partir de los nutrientes, que serán utilizados para crear sus estructuras o para almacenarlos como reserva.

Al producirse en las células de un organismo, se dice que existe un metabolismo celular permanente en todos los seres vivos, y que en ellos se produce una continua reacción química. Estas reacciones químicas metabólicas pueden ser de dos tipos: catabolismo y anabolismo. EL CATABOLISMO (fase destructiva) Su función es reducir de una sustancia o molécula compleja a una más simple. La energía generada en estos procesos será utilizada por la célula para realizar sus actividades vitales (transporte activo, contracción muscular, síntesis de moléculas). Las reacciones catabólicas se caracterizan por:  Son reacciones degradativas, mediante ellas compuestos complejos (glúcidos, lípidas) se transforman en otros más sencillos.  Son reacciones oxidativas, mediante las cuales se oxidan los compuestos orgánicos más o menos reducidos, liberándose electrones que son captados por coenzimas oxidadas que se reducen.  Son reacciones exergónicas en las que se libera energía que se almacena en forma de ATP.  Son procesos convergentes mediante los cuales a partir de compuestos muy diferentes se obtienen siempre los mismos compuestos (CO2, H2O, ácido pirúvico, ácido láctico, amoniaco, etanol, etc.).  Ejemplos: glucólisis, ciclo de Krebs, fermentaciones, cadena respiratoria EL ANABOLISMO (fase constructiva) Es el conjunto de reacciones metabólicas mediante las cuales a partir de compuestos sencillos (inorgánicos u orgánicos) se sintetizan moléculas más complejas. Mediante estas reacciones se crean nuevos enlaces por lo que se requiere un aporte de energía que provendrá del ATP. Las moléculas sintetizadas son usadas por las células para formar sus componentes celulares y así poder crecer y renovarse o serán almacenadas como reserva para su posterior utilización como fuente de energía. Las reacciones anabólicas se caracterizan por:  

Son reacciones de síntesis, mediante ellas a partir de compuestos sencillos se sintetizan otros más complejos. Son reacciones de reducción, mediante las cuales compuestos más oxidados se reducen, para ello se necesitan los electrones que ceden las coenzimas reducidas (NADH, FADH2, etc.) las cuales se oxidan. 129

2015


2015

  

Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

Son reacciones endergónicas que requieren un aporte de energía que procede de la hidrólisis del ATP. Son procesos divergentes debido a que, a partir de unos pocos compuestos se puede obtener una gran variedad de productos. Ejemplos: fotosíntesis, síntesis de proteínas

RUTAS METABÓLICAS En las células se producen una gran cantidad de reacciones metabólicas (tanto catabólicas como anabólicas), estás no son independientes sino que están asociadas formando las denominadas rutas metabólicas. Por consiguiente una ruta o vía metabólica es una secuencia ordenada de reacciones en las que el producto final de una reacción es el sustrato inicial de la siguiente (como la glucólisis o glicólisis). Mediante las distintas reacciones que se producen en una ruta un sustrato inicial se transforma en un producto final, y los compuestos intermedios de la ruta se denominan metabolitos. Todas estas reacciones están catalizadas por enzimas específicas. Tipos de rutas metabólicas. 1. Lineales. Cuando el sustrato de la primera reacción (sustrato inicial de la ruta) es diferente al producto final de la última reacción. 2. Cíclicas. Cuando el producto de la última reacción es el sustrato de la reacción inicial, en estos casos el sustrato inicial de la ruta es un compuesto que se incorpora en la primera reacción y el producto final de la ruta es algún compuesto que se forma en alguna etapa intermedia y que sale de la ruta. Frecuentemente los metabolitos o los productos finales de una ruta suelen ser sustratos de reacciones de otras rutas, por lo que las rutas están enlazadas entre sí formando redes metabólicas complejas. Características de las rutas metabólicas.  

130

Todas son irreversibles y globalmente exergónicas. Las rutas en los dos sentidos nunca pueden ser iguales porque si lo fuesen uno de los dos nunca se podría realizar. Los pasos distintos permiten asegurar los procesos en los dos sentidos. Hay muchos pasos comunes pero no todos. Las rutas metabólicas están localizadas en unos compartimentos específicos lo que permite regularlas eficazmente.


Programa de fortalecimiento de los estándares básicos en ciencias, imagen, matemáticas, sociales y lecto-escritura de bachilleres de colegios distritales

 

En todas las rutas hay una reacción inicial que es irreversible y que desprende mucha energía, necesaria para llegar al final de la misma. Todas las rutas están reguladas. Cada reacción tendrá su enzima.

Tipos metabólicos de seres vivos Teniendo en cuenta la fuente de carbono que utilicen existen dos tipos de seres vivos:  Autótrofos, utilizan como fuente de carbono el CO2. (vegetales verdes y muchas bacterias).  Heterótrofos, utilizan como fuente de carbono los compuestos orgánicos. (animales hongos y muchas bacterias). Ahora, teniendo en cuenta la fuente de energía que utilicen se diferencia dos grupos:  Fotosintéticos, utilizan como fuente de energía la luz solar.  Quimiosintéticos, utilizan como fuente de energía, la que se libera en reacciones químicas oxidativas (exergónicas). Según cual sea la fuente de hidrógeno que utilicen pueden ser:  Litótrofos, utilizan como fuente de hidrógeno compuestos inorgánicos, como H2O, H2S, etc.  Organótrofos, utilizan como fuente de hidrógenos moléculas orgánicas. Tomando en su conjunto todos estos aspectos, se pueden diferenciar cuatro tipos metabólicos de seres vivos: 1. Fotolitótrofos o fotoautótrofos: También se denominan fotosintéticos. Son seres que para sintetizar sus biomoléculas utilizan como fuente de carbono el CO2; como fuente de hidrógeno, compuestos inorgánicos, y como fuente de energía, la luz solar. A este grupo pertenecen: las plantas, las algas, las bacterias fotosintéticas del azufre, cianofíceas. 2. Fotoorganótrofos o fotoheterótrofos: Son seres que utilizan como fuente de carbono compuestos orgánicos, como fuente de hidrógeno compuestos orgánicos y como fuente de energía la luz. A este grupo pertenecen bacterias púrpuras no sulfuradas. 3. Quimiolitótrofos o quimioautótrofos: Se les denomina también quimiosintéticos. Son seres que utilizan como fuente de carbono el CO2, como fuente de hidrógenos compuestos inorgánicos y como fuente de energía la que se desprende en reacciones químicas redox de compuestos inorgánicos. A este grupo pertenecen las llamadas bacterias quimiosintéticas como las bacterias nitrificantes, las ferrobacterias, etc. 4. Quimioorganótrofos o quimioheterótrofos: También se les denomina heterótrofos. Son seres que utilizan como fuente de carbono compuestos orgánicos, como fuente de hidrógenos compuestos orgánicos y como fuente de energía la que se desprende en las reacciones redox de los compuestos orgánicos. A este grupo pertenecen los animales, los hongos, los protozoos y la mayoría de las bacterias.

131

2015

Módulo ciencias naturales  

En este texto se compilan una serie de actividades didácticas que cubren el plan de estudios desarrollado en el área de Ciencias Naturales (...

Módulo ciencias naturales  

En este texto se compilan una serie de actividades didácticas que cubren el plan de estudios desarrollado en el área de Ciencias Naturales (...

Advertisement