Issuu on Google+

ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ – Γ΄ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ΄ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β΄) ΔΕΥΤΕΡΑ 2 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΜΑΘΗΜΑΤΙΚΑ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΤΕΣΣΕΡΙΣ (4)

ΘΕΜΑ Α A1.

Έστω μια συνάρτηση f ορισμένη σε ένα διάστημα Δ . Αν •

η f είναι συνεχής στο Δ και

f ′(x) = 0 για κάθε εσωτερικό σημείο x του Δ ,

τότε να αποδείξετε ότι η f είναι σταθερή σε όλο το διάστημα Δ . Μονάδες 8 A2.

Έστω μια συνάρτηση f συνεχής σε ένα διάστημα Δ και παραγωγίσιμη στο εσωτερικό του Δ . Πότε λέμε ότι η συνάρτηση f στρέφει τα κοίλα προς τα κάτω ή είναι κοίλη στο Δ ; Μονάδες 4

A3.

Έστω μια συνάρτηση f

με πεδίο ορισμού A . Πότε λέμε ότι η f

παρουσιάζει στο x 0 ∈ Α (ολικό) μέγιστο, το f ( x 0 ) ; Μονάδες 3 A4.

Να χαρακτηρίσετε τις προτάσεις που ακολουθούν, γράφοντας στο τετράδιό σας, δίπλα στο γράμμα που αντιστοιχεί σε κάθε πρόταση, τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση είναι λανθασμένη. α) Για κάθε z ∈ ^ ισχύει z − z = 2 Im(z) (μονάδες 2) β) Αν lim f ( x ) = +∞ ή −∞ , τότε x → x0

lim

x → x0

1 =0 f ( x) (μονάδες 2)

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ


ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ – Γ΄ ΗΜΕΡΗΣΙΩΝ γ) Αν μια συνάρτηση f παρουσιάζει (ολικό) μέγιστο, τότε αυτό θα είναι το μεγαλύτερο από τα τοπικά της μέγιστα. (μονάδες 2) δ) Αν η συνάρτηση f είναι συνεχής σε ένα διάστημα Δ και α, β, γ ∈ Δ, τότε ισχύει

β

f(x)dx =

α

γ

f(x) dx +

α

β

f(x) dx

γ

(μονάδες 2) ε) Έστω συνάρτηση f συνεχής σε ένα διάστημα Δ και παραγωγίσιμη σε κάθε εσωτερικό σημείο του Δ . Αν η συνάρτηση f είναι γνησίως φθίνουσα

στο

Δ , τότε η παράγωγός της είναι υποχρεωτικά

αρνητική στο εσωτερικό του Δ . (μονάδες 2) Μονάδες 10

ΘΕΜΑ Β Δίνεται η εξίσωση 2

2 z + (z + z)i − 4 − 2i = 0, B1.

z∈^

Να λύσετε την παραπάνω εξίσωση. Μονάδες 9

B2.

Αν z1=1+i και z 2 =1- i είναι οι ρίζες της παραπάνω εξίσωσης, τότε να αποδείξετε ότι ο αριθμός

είναι ίσος με −3i

⎛z ⎞ w =3⎜ 1⎟ ⎝ z2 ⎠

39

Μονάδες 8 B3.

Να βρείτε το γεωμετρικό τόπο των εικόνων των μιγαδικών αριθμών u για τους οποίους ισχύει

u + w = 4z1 − z 2 − i όπου w, z1 , z 2 οι μιγαδικοί αριθμοί του ερωτήματος Β2. Μονάδες 8

ΤΕΛΟΣ 2ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ


ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ – Γ΄ ΗΜΕΡΗΣΙΩΝ ΘΕΜΑ Γ Δ ί ν ε τ α ι η συνάρτηση Γ1. Γ2.

h( x ) = x − An( e x + 1), x ∈ R

Να μελετήσετε την h ως προς την κυρτότητα. Να λύσετε την ανίσωση

h( 2h′(x) )

e Γ3.

Μονάδες 5

<

e

e +1

, x∈\ Μονάδες 7

Να βρείτε την οριζόντια ασύμπτωτη της γραφικής παράστασης της h στο

+∞ , καθώς και την πλάγια ασύμπτωτή της στο −∞ . Μονάδες 6 Γ4.

ex ( h(x) + An2) ,

Δίνεται η συνάρτηση φ(x) =

x∈\

Να βρείτε το εμβαδόν του χωρίου που περικλείεται από τη γραφική παράσταση της φ(x) , τον άξονα x ' x και την ευθεία x = 1 Μονάδες 7

ΘΕΜΑ Δ

⎧ ex − 1 , αν x ≠ 0 ⎪ ⎪ x Δίνεται η συνάρτηση f ( x ) = ⎨ ⎪ , αν x = 0 ⎪⎩ 1 Δ1.

Να αποδείξετε ότι η f είναι συνεχής στο σημείο x 0 = 0 και, στη συνέχεια, ότι είναι γνησίως αύξουσα. Μονάδες 7

Δ2.

Δίνεται επιπλέον ότι η f είναι κυρτή. α) Να αποδείξετε ότι η εξίσωση

2f ′(x)

f(u) du = 0 1

έχει ακριβώς μία λύση, η οποία είναι η x = 0

ΤΕΛΟΣ 3ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ

(μονάδες 7)


ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ – Γ΄ ΗΜΕΡΗΣΙΩΝ β) Ένα υλικό σημείο M ξεκινά τη χρονική στιγμή t = 0 από ένα σημείο

A ( x 0 , f( x 0 ) )

με

y = f(x), x ≥ x 0

x0 < 0 με

και

κινείται

κατά

x = x(t), y = y(t), t ≥ 0 .

μήκος Σε

της

ποιο

καμπύλης σημείο

της

καμπύλης ο ρυθμός μεταβολής της τετμημένης x(t) του σημείου M είναι διπλάσιος του ρυθμού μεταβολής της τεταγμένης του y(t) , αν υποτεθεί ότι x '(t) > 0 για κάθε t ≥ 0 . (μονάδες 4) Μονάδες 11 Δ3.

Θεωρούμε τη συνάρτηση

g(x) = ( x f(x) + 1 − e )

2

( x − 2)

2

, x ∈ ( 0, + ∞ )

Να αποδείξετε ότι η συνάρτηση g έχει δύο θέσεις τοπικών ελαχίστων και μία θέση τοπικού μεγίστου. Μονάδες 7 ΟΔΗΓΙΕΣ (για τους εξεταζομέ νους) 1.

2.

3.

4. 5. 6.

Στο εξώφυλλο τ ο υ τετραδίου να γράψετε το εξεταζόμενο μάθημα . Στο ε σ ώ φ υ λ λ ο πάνω - πάνω να συμπληρώσε τε τα Ατο μ ι κ ά σ τ ο ι χ ε ί α μαθητή. Στην αρ χή των απαντήσεών σ α ς να γ ρ ά ψ ε τ ε π ά ν ω - π ά ν ω την ημερ ομηνία κ α ι το εξεταζόμενο μάθημα . Να μην αντιγράψετε τ α θέματα σ τ ο τ ε τ ρ ά δ ι ο κ α ι να μη γρά ψετε π ο υ θ ε ν ά σ τ ι ς α π α ν τ ή σ ε ι ς σας τ ο όνομά σας. Να γράψετε το ονοματεπώνυμό σας στο πάνω μέρος των φωτοαντιγράφων αμέσως μόλις σας παραδοθούν. Τυχόν σημειώσεις σας πάνω στα θέματα δεν θα βαθμολογηθούν σε καμία περίπτωση. Κ α τ ά την αποχώρησή σας να παραδώσετε μαζί με το τ ετ ρ ά δι ο κ α ι τ α φωτοαντίγραφα. Να α π α ντή σετε σ το τ ε τ ρ ά δι ό σ α ς σε όλα τ α θέματα μόνο με μπλε ή μόνο με μαύ ρο στ υλό με μ ε λ ά ν ι π ου δεν σβ ήνει . Μ ολ ύ β ι επιτρέπεται , μόνο α ν το ζητά ει η εκφώνηση , κ α ι μόνο γ ι α π ί νακ ε ς , διαγράμματα κλπ. Κάθε απάντηση επιστημον ικά τεκμηρ ιωμένη ε ί ν α ι α π οδε κ τ ή . Δ ι άρ κ ε ι α εξέτασης : τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. Χρόνος δ υ ν α τ ή ς α π ο χ ώ ρ η σ η ς : 1 0 . 0 0 π . μ. ΣΑΣ ΕΥΧΟΜΑΣΤΕ KΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ

ΤΕΛΟΣ 4ΗΣ ΑΠΟ 4 ΣΕΛΙ∆ΕΣ


ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ – Γ΄ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ΄ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β΄) ΤΡΙΤΗ 10 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΦΥΣΙΚΗ ΘΕΤΙΚΗΣ ΚΑΙ ΤΕΧΝΟΛΟΓΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ (ΚΑΙ ΤΩΝ ΔΥΟ ΚΥΚΛΩΝ) ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΕΞΙ (6) Θέ μα Α Στις ερωτήσεις Α1-Α4 να γράψετε στο τετράδιό σας τον αριθμό της ερώτησης και, δίπλα, το γράμμα που αντιστοιχεί στη φράση η οποία συμπληρώνει σωστά την ημιτελή πρόταση. A1. Τα μήκη κύματος τεσσάρων ηλεκτρομαγνητικών ακτινοβολιών που διαδίδονται στο κενό συμβολίζονται ως: υπέρυθρο: λ υ , ραδιοκύματα: λ ρ , πράσινο ορατό φως: λ π , ακτίνες Χ: λ χ . Η σχέση μεταξύ των μηκών είναι: α) λχ > λρ > λυ > λπ β) λρ > λπ > λυ > λχ γ) λρ > λυ > λπ > λχ δ) λυ > λχ > λρ > λπ Μονάδες 5 A2.

Η ταχύτητα ενός ηχητικού κύματος εξαρτάται από: α) την περίοδο του ήχου β) το υλικό στο οποίο διαδίδεται το κύμα γ) το μήκος κύματος δ) το πλάτος του κύματος. Μονάδες 5

A3.

Σε ένα αρχικά ακίνητο στερεό σώμα ασκούνται ομοεπίπεδες δυνάμεις έτσι ώστε αυτό να εκτελεί μόνο επιταχυνόμενη μεταφορική κίνηση. Για τη G

συνισταμένη των δυνάμεων ΣF που του ασκούνται και για το αλγεβρικό άθροισμα τωνG ροπών Στ ως προς οποιοδήποτε σημείο του, ισχύει: α)

β) γ) δ) A4.

ΣF G ΣF G ΣF G ΣF

= 0,

Στ = 0

≠ 0,

Στ ≠ 0

≠ 0,

Στ = 0

= 0,

Στ ≠ 0 Μονάδες 5

Η δύναμη επαναφοράς που ασκείται σε ένα σώμα μάζας m που εκτελεί απλή αρμονική ταλάντωση είναι ίση με F. Το πηλίκο α) β) γ) δ)

F : m

παραμένει σταθερό σε σχέση με το χρόνο μεταβάλλεται αρμονικά σε σχέση με το χρόνο αυξάνεται γραμμικά σε σχέση με το χρόνο γίνεται μέγιστο, όταν το σώμα διέρχεται από τη θέση ισορροπίας. Μονάδες 5

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 6 ΣΕΛΙ∆ΕΣ


ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ – Γ΄ ΗΜΕΡΗΣΙΩΝ Α5.

Να χαρακτηρίσετε τις προτάσεις που ακολουθούν, γράφοντας στο τετράδιο σας, δίπλα στο γράμμα που αντιστοιχεί σε κάθε πρόταση, τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή τη λέξη Λάθος, αν η πρόταση είναι λανθασμένη. α) Κριτήριο για τη διάκριση των μηχανικών κυμάτων σε εγκάρσια και διαμήκη είναι η διεύθυνση ταλάντωσης των μορίων του ελαστικού μέσου σε σχέση με την διεύθυνση διάδοσης του κύματος. β) Σε μια εξαναγκασμένη ταλάντωση η ενέργεια που προσφέρεται στο σύστημα αντισταθμίζει τις απώλειες και έτσι το πλάτος της ταλάντωσης διατηρείται σταθερό. γ) Κατά τη διάδοση ηλεκτρομαγνητικών κυμάτων στο κενό, το πηλίκο των μέτρων των εντάσεων του μαγνητικού και του ηλεκτρικού πεδίου

⎛B ⎞ = c⎟. ⎝E ⎠

ισούται με την ταχύτητα του φωτός ⎜ δ) ε)

Η συχνότητα μονοχρωματικής ακτινοβολίας μειώνεται, όταν η ακτινοβολία περνά από τον αέρα σε ένα διαφανές μέσο. Η γη έχει στροφορμή λόγω περιστροφής γύρω από τον άξονά της και λόγω περιφοράς γύρω από τον ήλιο. Μονάδες 5

Θέ μα Β Β1.

Δύο όμοια σώματα, ίσων μαζών m το καθένα, συνδέονται με όμοια ιδανικά ελατήρια σταθεράς k το καθένα, των οποίων τα άλλα άκρα είναι συνδεδεμένα σε ακλόνητα σημεία, όπως στο σχήμα. Οι άξονες των δύο ελατηρίων βρίσκονται στην ίδια ευθεία, τα ελατήρια βρίσκονται στο φυσικό τους μήκος ℓ 0 και το οριζόντιο επίπεδο στο οποίο βρίσκονται είναι λείο.

Μετακινούμε το σώμα 1 προς τα αριστερά κατά d και στη συνέχεια το αφήνουμε ελεύθερο να κινηθεί. Το σώμα 1 συγκρούεται πλαστικά με το σώμα 2. Το συσσωμάτωμα που προκύπτει εκτελεί απλή αρμονική ταλάντωση με σταθερά επαναφοράς D = 2k. Αν Α 1 το πλάτος της ταλάντωσης του σώματος 1 πριν τη κρούση και Α 2 το πλάτος της ταλάντωσης του συσσωματώματος μετά την κρούση, τότε ο λόγος είναι: i)

1

ii)

1 2

iii)

2

ΤΕΛΟΣ 2ΗΣ ΑΠΟ 6 ΣΕΛΙ∆ΕΣ

A1 A2


ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ – Γ΄ ΗΜΕΡΗΣΙΩΝ α)

Να επιλέξετε τη σωστή απάντηση. Μονάδες 2

β)

Να δικαιολογήσετε την απάντησή σας. Μονάδες 6

Β2.

Κατά τη σύνθεση δύο απλών αρμονικών ταλαντώσεων με παραπλήσιες συχνότητες f 1 και f 2 , ίδιας διεύθυνσης και ίδιου πλάτους, που γίνονται γύρω από την ίδια θέση ισορροπίας, με f 1 > f 2 , παρουσιάζονται διακροτήματα με περίοδο διακροτήματος Τ Δ = 2 s. Αν στη διάρκεια του χρόνου αυτού πραγματοποιούνται 200 πλήρεις ταλαντώσεις, οι συχνότητες f 1 και f 2 είναι: i) f 1 = 200,5 Hz, f 2 = 200 Hz ii) f 1 = 100,25 Hz, f 2 = 99,75 Hz f 2 = 49,7 Hz iii) f 1 = 50,2 Hz, α)

Να επιλέξετε τη σωστή απάντηση. Μονάδες 2

β)

Να δικαιολογήσετε την απάντησή σας. Μονάδες 6

Β3.

Σε λείο οριζόντιο επίπεδο και σε διεύθυνση κάθετη σε κατακόρυφο τοίχο κινείται σφαίρα μάζας m 1 με ταχύτητα μέτρου υ 1 . Κάποια χρονική στιγμή η σφαίρα μάζας m 1 συγκρούεται κεντρικά και ελαστικά με ακίνητη σφαίρα μάζας m 2 (m 2 > m 1 ). Μετά την κρούση με τη μάζα m 1 , η m 2 συγκρούεται ελαστικά με τον τοίχο.

Παρατηρούμε ότι η απόσταση των μαζών m 1 και m 2 , μετά την κρούση της m 2 με τον τοίχο, παραμένει σταθερή. Ο λόγος των μαζών i)

3

ii)

1

α)

Να επιλέξετε τη σωστή απάντηση.

β)

Να δικαιολογήσετε την απάντησή σας.

iii)

m1 είναι: m2

1 3 Μονάδες 2 Μονάδες 7

ΤΕΛΟΣ 3ΗΣ ΑΠΟ 6 ΣΕΛΙ∆ΕΣ


ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ – Γ΄ ΗΜΕΡΗΣΙΩΝ Θέ μα Γ Δύο σύγχρονες σημειακές πηγές Π 1 και Π 2 δημιουργούν στην επιφάνεια υγρού εγκάρσια κύματα που διαδίδονται με ταχύτητα υ = 5 m/s. Μικρό κομμάτι φελλού βρίσκεται σε κάποιο σημείο Σ της επιφάνειας πλησιέστερα στην πηγή Π 2 . Η απομάκρυνση του σημείου Σ από τη θέση ισορροπίας του σε συνάρτηση με τον χρόνο περιγράφεται από τη γραφική παράσταση του σχήματος. Οι πηγές αρχίζουν να ταλαντώνονται τη χρονική στιγμή t = 0 και εκτελούν ταλαντώσεις της μορφής y = Α ⋅ ημωt .

Γ1.

Να βρείτε τις αποστάσεις r1 και r2 του σημείου Σ από τις πηγές Π 1 και Π 2 , αντίστοιχα. Μονάδες 6

Γ2.

Να γράψετε τη σχέση που δίνει την απομάκρυνση του φελλού από τη θέση ισορροπίας του σε συνάρτηση με τον χρόνο, για t ≥ 0. Μονάδες 6

Γ3.

Ποιο είναι το μέτρο της ταχύτητας ταλάντωσης του φελλού κάποια χρονική στιγμή t 1 , κατά την οποία η απομάκρυνσή του από τη θέση ισορροπίας του είναι y1 = 5 3 ⋅ 10

−3

m ; Μονάδες 6

Γ4.

Έστω Κ 1 η μέγιστη κινητική ενέργεια του φελλού μετά τη συμβολή. Αλλάζουμε τη συχνότητα των ταλαντώσεων των πηγών Π 1 και Π 2 έτσι ώστε η συχνότητά τους να είναι ίση με τα

10 της αρχικής τους συχνότητας. Αν 9

μετά τη νέα συμβολή η μέγιστη κινητική ενέργεια του φελλού είναι Κ 2 , να βρεθεί ο λόγος

K1 . K2

Μονάδες 7

⎛π⎞ 1 ⎟= ⎝3⎠ 2

Δίνεται : συν ⎜

ΤΕΛΟΣ 4ΗΣ ΑΠΟ 6 ΣΕΛΙ∆ΕΣ


ΑΡΧΗ 5ΗΣ ΣΕΛΙ∆ΑΣ – Γ΄ ΗΜΕΡΗΣΙΩΝ Θέ μα Δ Λεπτή, άκαμπτη και ομογενής ράβδος ΑΓ μήκους ℓ = 2m και μάζας Μ = 5,6 kg ισορροπεί με τη βοήθεια οριζόντιου νήματος, μη εκτατού, που συνδέεται στο μέσο της, όπως φαίνεται στο σχήμα. Το άκρο Α της ράβδου συνδέεται με άρθρωση σε κατακόρυφο τοίχο. Δίνεται: ημφ = 0,6 και συνφ = 0,8

Δ1.

G

Να προσδιορίσετε τη δύναμη F που δέχεται η ράβδος από την άρθρωση. Μονάδες 4

Μικρή ομογενής σφαίρα, μάζας m = 0,4 kg και ακτίνας r =

1 m κυλίεται 70

χωρίς ολίσθηση, έχοντας εκτοξευθεί κατά μήκος της ράβδου από το σημείο Κ προς το άκρο Γ. Δ2.

Να βρεθεί η γωνιακή επιτάχυνση της σφαίρας κατά την κίνησή της από το Κ μέχρι το Γ. Μονάδες 5

Δ3.

Με δεδομένο ότι η σφαίρα φτάνει στο άκρο Γ, να βρείτε τη σχέση που περιγράφει την τάση του νήματος σε συνάρτηση με την απόσταση του σημείου επαφής της σφαίρας με τη ράβδο, από το σημείο Κ. Μονάδες 5

Αφού η σφαίρα έχει εγκαταλείψει τη ράβδο, κόβουμε το νήμα. Η ράβδος στρέφεται σε κατακόρυφο επίπεδο γύρω από οριζόντιο άξονα, ο οποίος διέρχεται από το άκρο της Α, χωρίς τριβές. Δ4.

Να υπολογίσετε τον ρυθμό μεταβολής της κινητικής ενέργειας της ράβδου στη θέση στην οποία η ράβδος σχηματίζει γωνία φ με την κατακόρυφο που διέρχεται από το άκρο Α, όπως στο παρακάτω σχήμα. Μονάδες 6 Δεύτερη λεπτή, άκαμπτη και ομογενής ράβδος ΑΔ, μήκους ℓ΄ = ℓ και μάζας Μ΄ = 3 Μ είναι αρθρωμένη και αυτή στο σημείο Α γύρω από τον ίδιο άξονα περιστροφής με την ράβδο ΑΓ. Η ράβδος ΑΔ συγκρατείται ακίνητη, με κατάλληλο μηχανισμό, σε θέση όπου σχηματίζει γωνία φ με τον κατακόρυφο τοίχο όπως στο σχήμα. Οι δύο ράβδοι συγκρούονται και ταυτόχρονα ο μηχανισμός ελευθερώνει τη ράβδο ΑΔ, χωρίς απώλεια ενέργειας. Οι ράβδοι μετά την κρούση

ΤΕΛΟΣ 5ΗΣ ΑΠΟ 6 ΣΕΛΙ∆ΕΣ


ΑΡΧΗ 6ΗΣ ΣΕΛΙ∆ΑΣ – Γ΄ ΗΜΕΡΗΣΙΩΝ κινούνται σαν ένα σώμα, χωρίς τριβές. Ο χρόνος της κρούσης θεωρείται αμελητέος. Δ5. Να υπολογίσετε το ποσοστό συστήματος κατά την κρούση.

απώλειας

της

κινητικής

ενέργειας

του

Μονάδες 5 Όλες οι κινήσεις πραγματοποιούνται στο ίδιο κατακόρυφο επίπεδο. Δίνονται : •

Η ροπή αδράνειας Ι ρ λεπτής ομογενούς ράβδου μάζας Μ και μήκους ℓ, ως προς άξονα που διέρχεται από το ένα της άκρο και είναι κάθετος σε αυτή:

Ιρ = •

1 M ℓ2 3

Η ροπή αδράνειας Ι σϕ ομογενούς σφαίρας μάζας m και ακτίνας r ως προς άξονα που διέρχεται από το κέντρο μάζας της : Ι σϕ =

g = 10 m s

2 m r2 5

2

ΟΔΗΓΙΕΣ (για τους εξεταζομένους) 1.

2.

3. 4. 5. 6.

Στο εξώφυλλο του τετραδίου να γράψετε το εξεταζόμενο μάθημα. Στο εσώφυλλο πάνω-πάνω να συμπληρώσετε τα Ατομικά στοιχεία μαθητή. Στην αρχή των απαντήσεών σας να γράψετε πάνω-πάνω την ημερομηνία και το εξεταζόμενο μάθημα. Να μην αντιγράψετε τα θέματα στο τετράδιο και να μη γράψετε πουθενά στις απαντήσεις σας το όνομά σας. Να γράψετε το ονοματεπώνυμό σας στο πάνω μέρος των φωτοαντιγράφων αμέσως μόλις σας παραδοθούν. Τυχόν σημειώσεις σας πάνω στα θέματα δεν θα βαθμολογηθούν σε καμία περίπτωση. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα μόνο με μπλε ή μόνο με μαύρο στυλό με μελάνι που δεν σβήνει. Μολύβι επιτρέπεται, μόνο αν το ζητάει η εκφώνηση, και μόνο για πίνακες, διαγράμματα κλπ. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή. Διάρκεια εξέτασης: τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. Ώρα δυνατής αποχώρησης: 10.00 π.μ. ΣΑΣ ΕΥΧΟΜΑΣΤΕ KΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ

ΤΕΛΟΣ 6ΗΣ ΑΠΟ 6 ΣΕΛΙ∆ΕΣ


ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ – Γ΄ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ΄ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΠΑΡΑΣΚΕΥΗ 6 ΙΟΥΝΙΟΥ 2014 ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΧΗΜΕΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ(5) ΘΕΜΑ Α Για τις προτάσεις Α1 έως και Α5 να γράψετε στο τετράδιό σας τον αριθμό της πρότασης και, δίπλα, το γράμμα που αντιστοιχεί στη σωστή επιλογή. Α1.

Από τις παρακάτω αλκοόλες δεν αφυδατώνεται προς αλκένιο η

Μονάδες 5 Α2.

Με προσθήκη νερού σε αλκίνιο, παρουσία Hg, HgSO 4 και H 2 SO 4 , μπορεί να παραχθεί α. μόνο κετόνη β. καρβονυλική ένωση γ. κυανιδρίνη δ. αλκοόλη. Μονάδες 5

Α3.

Από όλα τα στοιχεία της 2 ης περιόδου του περιοδικού πίνακα τη χαμηλότερη τιμή ενέργειας 1 ου ιοντισμού (Ε i1 ) έχει α. το αλκάλιο β. η αλκαλική γαία γ. το αλογόνο δ. το ευγενές αέριο. Μονάδες 5

Α4.

Το χημικό στοιχείο Χ με ηλεκτρονιακή δομή [Αr]3d 10 4s 2 4p 5 ανήκει στην α. 4 η περίοδο και στην 7 η ομάδα του περιοδικού πίνακα β. 4 η περίοδο και στην 17 η ομάδα του περιοδικού πίνακα γ. 5 η περίοδο και στην 4 η ομάδα του περιοδικού πίνακα δ. 4 η περίοδο και στην 5 η ομάδα του περιοδικού πίνακα. Μονάδες 5

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ∆ΕΣ


ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ – Γ΄ ΗΜΕΡΗΣΙΩΝ A5.

Όξινο διάλυμα είναι το α. CH 3 COONa β. CH 3 NH 3 Cℓ γ. KCN δ. NaCℓ

διάλυμα του 0,1 M 0,1 M 0,1 M 0,1 M Μονάδες 5

ΘΕΜΑ Β Β1.

Να χαρακτηρίσετε τις προτάσεις που ακολουθούν, γράφοντας στο τετράδιό σας δίπλα στο γράμμα που αντιστοιχεί σε κάθε πρόταση, τη λέξη Σωστό, αν η πρόταση είναι σωστή, ή Λάθος, αν η πρόταση είναι λανθασμένη. α.

Το

17 Cℓ

σχηματίζει ενώσεις με ένα μόνο ομοιοπολικό δεσμό.

β.

Διάλυμα NaHSO 4 0,1 M έχει pH > 7 στους 25 ο C.

γ.

Διάλυμα NaHCO 3 1 M και Na 2 CO 3 1 M είναι ρυθμιστικό διάλυμα.

δ.

Στην ένωση CH 2 =CH−CH=CH 2 όλα τα άτομα του άνθρακα έχουν sp 2 υβριδικά τροχιακά.

ε.

Η προσθήκη HCN ανοικοδόμησης.

σε

καρβονυλική

ένωση

είναι

αντίδραση Μονάδες 10

Β2.

α. Να αναφέρετε δύο διαφορές μεταξύ του σ και του π δεσμού. (μονάδες 4) β. Οι τέσσερις πρώτες ενέργειες ιοντισμού ενός στοιχείου είναι αντίστοιχα Ε i1 = 738 kJ/mol Ε i2 = 1450 kJ/mol 3 Ε i3 = 7,7 10 kJ/mol Ε i4 = 1,1 10 4 kJ/mol Σε ποια ομάδα του περιοδικού πίνακα ανήκει το στοιχείο αυτό και γιατί; (μονάδες 4) γ. Δίνεται πρωτολυτικός δείκτης ΗΔ με pΚ a = 5. Αν ο δείκτης προστεθεί σε ένα διάλυμα χυμού μήλου, που έχει pΗ = 3, τι τιμή θα έχει ο λόγος [Δ − ] / [ΗΔ]; Με δεδομένο ότι η όξινη μορφή του δείκτη έχει χρώμα κόκκινο και η βασική κίτρινο, τι χρώμα θα αποκτήσει το διάλυμα; (μονάδες 3) δ. Διάλυμα άλατος ΝΗ 4 Α έχει pH = 8. Με δεδομένο ότι η Κ b της ΝΗ 3 είναι 10 −5 να εξετάσετε αν η τιμή Κ a του ΗΑ είναι μεγαλύτερη, μικρότερη ή ίση του 10 −5 . Δίνεται Κ w = 10 −14 (μονάδες 4) Μονάδες 15

ΤΕΛΟΣ 2ΗΣ ΑΠΟ 5 ΣΕΛΙ∆ΕΣ


ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ – Γ΄ ΗΜΕΡΗΣΙΩΝ ΘEΜΑ Γ Γ1.

α. Σε ένα δοχείο περιέχεται 1-πεντίνιο ή 2-πεντίνιο. ποια από τις 2 ουσίες περιέχεται στο δοχείο;

Πώς

θα

διαπιστώσετε (μονάδες 2)

β. Σε δύο δοχεία περιέχονται μεθανικός μεθυλεστέρας (ΗCΟΟCΗ 3 ) και αιθανικός αιθυλεστέρας (CΗ 3 COOCH 2 CH 3 ). Δεν ξέρουμε όμως σε ποιο δοχείο περιέχεται η κάθε ουσία. Πώς θα διαπιστώσετε σε ποιο δοχείο περιέχεται η καθεμία; (μονάδες 4) (Και στα δύο παραπάνω ερωτήματα να γράψετε τις χημικές εξισώσεις που τεκμηριώνουν την απάντησή σας). Μονάδες 6 Γ2.

Δίνεται το παρακάτω διάγραμμα χημικών διεργασιών.

Με δεδομένο ότι η ένωση Θ αλλάζει το χρώμα όξινου διαλύματος Κ 2 Cr 2 O 7 από πορτοκαλί σε πράσινο, να γράψετε τους συντακτικούς τύπους των ενώσεων Α, Β, Γ, Δ, Ε, Ζ και Θ. Μονάδες 7 Γ3.

Oμογενές μίγμα δύο κορεσμένων μονοσθενών αλκοολών (Α) και (Β) μάζας 44,4 g χωρίζεται σε τρία ίσα μέρη. • Στο 1 ο μέρος προσθέτουμε περίσσεια Na, οπότε ελευθερώνονται 2,24 L αερίου σε πρότυπες συνθήκες (stp). • Στο 2 ο μέρος προσθέτουμε περίσσεια SOCℓ 2 και στα οργανικά προϊόντα που προκύπτουν επιδρούμε με Μg σε απόλυτο αιθέρα. Στη συνέχεια προσθέτουμε νερό, οπότε προκύπτει ένα (1) μόνο οργανικό προϊόν. • Στο 3 ο μέρος προσθέτουμε διάλυμα Ι 2 /NaOH, οπότε καταβυθίζονται 0,05 mol κίτρινου ιζήματος. Να προσδιορίσετε το συντακτικό τύπο και την ποσότητα σε mol της κάθε αλκοόλης στο αρχικό μίγμα. Δίνονται: Αr(Η) = 1, Αr(C) = 12, Αr(O) = 16 Μονάδες 12

ΤΕΛΟΣ 3ΗΣ ΑΠΟ 5 ΣΕΛΙ∆ΕΣ


ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ – Γ΄ ΗΜΕΡΗΣΙΩΝ ΘΕΜΑ Δ Σε πέντε δοχεία περιέχονται τα επόμενα διαλύματα: • διάλυμα ΝaΝΟ 3 0,1 M (Y1) 0,1 M (Y2) • διάλυμα ΝΗ 3 • διάλυμα ΗCℓ 0,1 M (Y3) • διάλυμα ΝaΟΗ 0,1 M (Y4) 0,1 M (Y5) • διάλυμα ΝΗ 4 Cℓ Δ1. Nα βρείτε ποιο διάλυμα περιέχεται σε κάθε δοχείο με βάση τα δεδομένα του παρακάτω πίνακα Δοχείο pΗ

1 1

2 5

3 7

4 11

5 13 Μονάδες 5

Δ2. Το κυριότερο όξινο συστατικό του ξινισμένου γάλακτος είναι το γαλακτικό οξύ

α. Για την ογκομέτρηση 10 mL του ξινισμένου γάλακτος απαιτούνται 5 mL διαλύματος ΝaΟΗ 0,1 Μ. Να υπολογίσετε τη συγκέντρωση του γαλακτικού οξέος στο ξινισμένο γάλα (κανένα άλλο συστατικό του γάλακτος δεν αντιδρά με ΝaΟΗ). (μονάδες 3) β. Να προτείνετε από μία εργαστηριακή δοκιμασία για την ανίχνευση της καρβοξυλομάδας και της υδροξυλομάδας του γαλακτικού οξέος. (Να γράψετε τις σχετικές χημικές εξισώσεις). (μονάδες 2) Μονάδες 5 Δ3. Με ποια αναλογία όγκων πρέπει να αναμείξουμε το διάλυμα Υ4 (ΝaOH) με το διάλυμα Υ5 (ΝΗ 4 Cℓ), ώστε να προκύψει ρυθμιστικό διάλυμα (Υ6) με pH = 9. Μονάδες 9 Δ4. Σε ίσους όγκους V των διαλυμάτων Υ2 (ΝΗ 3 0,1 Μ) Υ4 (ΝaΟΗ 0,1 Μ) Υ6 (ΝΗ 3 / ΝΗ 4 Cℓ) προστίθεται νερό όγκου x L, y L, ω L αντίστοιχα, ώστε να μεταβληθεί το pH τους κατά μία μονάδα. Να διατάξετε κατά αύξουσα σειρά τις τιμές x, y, ω και να αιτιολογήσετε την απάντησή σας. Μονάδες 6 • Τα δεδομένα του προβλήματος επιτρέπουν τις γνωστές προσεγγίσεις. και θ = 25 ο C. • Δίνονται Κ w = 10 −14

ΤΕΛΟΣ 4ΗΣ ΑΠΟ 5 ΣΕΛΙ∆ΕΣ


ΑΡΧΗ 5ΗΣ ΣΕΛΙ∆ΑΣ – Γ΄ ΗΜΕΡΗΣΙΩΝ ΟΔΗΓΙΕΣ (για τους εξεταζομέ νους) 1.

2.

3. 4. 5. 6.

Στο εξώφυλλο του τετραδίου να γράψετε το εξεταζόμενο μάθημα. Στο εσώφυλλο πάνω-πάνω να συμπληρώσετε τα Ατομικά στοιχεία μαθητή. Στην αρχή των απαντήσεών σας να γράψετε πάνω-πάνω την ημερομηνία και το εξεταζόμενο μάθημα. Να μην αντιγράψετε τα θέματα στο τετράδιο και να μη γράψετε πουθενά στις απαντήσεις σας το όνομά σας. Να γράψετε το ονοματεπώνυμό σας στο πάνω μέρος των φωτοαντιγράφων αμέσως μόλις σας παραδοθούν. Τυχόν σημειώσεις σας πάνω στα θέματα δεν θα βαθμολογηθούν σε καμία περίπτωση. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα μόνο με μπλε ή μόνο με μαύρο στυλό με μελάνι που δεν σβήνει. Μολύβι επιτρέπεται, μόνο αν το ζητάει η εκφώνηση, και μόνο για πίνακες, διαγράμματα κλπ. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή. Διάρκεια εξέτασης: τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. Ώρα δυνατής αποχώρησης: 10.30 π.μ. ΣΑΣ ΕΥΧΟΜΑΣΤΕ KΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ

ΤΕΛΟΣ 5ΗΣ ΑΠΟ 5 ΣΕΛΙ∆ΕΣ


ΑΡΧΗ 1ΗΣ ΣΕΛΙ∆ΑΣ – Γ΄ ΗΜΕΡΗΣΙΩΝ ΠΑΝΕΛΛΑΔΙΚΕΣ ΕΞΕΤΑΣΕΙΣ Γ΄ ΤΑΞΗΣ ΗΜΕΡΗΣΙΟΥ ΓΕΝΙΚΟΥ ΛΥΚΕΙΟΥ ΚΑΙ ΕΠΑΛ (ΟΜΑΔΑ Β΄) TETAPTH 4 IOYNIOY 2014 - ΕΞΕΤΑΖΟΜΕΝΟ ΜΑΘΗΜΑ: ΒΙΟΛΟΓΙΑ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΣΥΝΟΛΟ ΣΕΛΙΔΩΝ: ΠΕΝΤΕ (5)

ΘΕΜΑ Α Να γράψετε στο τετράδιό σας τον αριθμό καθεμίας από τις παρακάτω ημιτελείς προτάσεις Α1 έως Α5 και δίπλα το γράμμα που αντιστοιχεί στη λέξη ή στη φράση, η οποία συμπληρώνει σωστά την ημιτελή πρόταση. Α1. Τα α. β. γ. δ.

πλασμίδια είναι κυκλικά δίκλωνα μόρια RNA γραμμικά μόρια DNA μονόκλωνα μόρια DNA κυκλικά δίκλωνα μόρια DNA. Μονάδες 5

Α2. Το α. β. γ. δ.

αντικωδικόνιο είναι τριπλέτα νουκλεοτιδίων του mRNA snRNA tRNA rRNA. Μονάδες 5

Α3. Η εισαγωγή ανασυνδυασμένου DNA σε βακτήριο-ξενιστή ονομάζεται α. μικροέγχυση β. μετασχηματισμός γ. εμβολιασμός δ. κλωνοποίηση. Μονάδες 5 Α4. Στην εκθετική φάση σε μια μικροοργανισμών α. παραμένει σχεδόν σταθερός β. μειώνεται γ. αυξάνεται ταχύτατα δ. παρουσιάζει αυξομειώσεις.

κλειστή

καλλιέργεια,

ο

αριθμός

των

Μονάδες 5

ΤΕΛΟΣ 1ΗΣ ΑΠΟ 5 ΣΕΛΙ∆ΕΣ


ΑΡΧΗ 2ΗΣ ΣΕΛΙ∆ΑΣ – Γ΄ ΗΜΕΡΗΣΙΩΝ Α5. Με α. β. γ. δ.

τη γονιδιακή θεραπεία παράγονται μονοκλωνικά αντισώματα γίνεται εισαγωγή του φυσιολογικού αλληλόμορφου γονιδίου γίνεται αντικατάσταση του μεταλλαγμένου γονιδίου από το φυσιολογικό μεταβιβάζεται στους απογόνους το φυσιολογικό γονίδιο. Μονάδες 5

ΘΕΜΑ Β Β1.

Να τοποθετήσετε στη σωστή σειρά τα παρακάτω βήματα τα οποία οδηγούν στην κατασκευή καρυότυπου, γράφοντας μόνο τους αριθμούς 1. 2. 3. 4. 5. 6.

Τα κύτταρα επωάζονται σε υποτονικό διάλυμα. Αναστέλλεται ο κυτταρικός κύκλος στο στάδιο της μετάφασης. Τα χρωμοσώματα παρατηρούνται στο μικροσκόπιο. Γίνεται επαγωγή κυτταρικών διαιρέσεων με ουσίες που έχουν μιτογόνο δράση. Τα χρωμοσώματα ταξινομούνται σε ζεύγη κατά ελαττούμενο μέγεθος. Τα χρωμοσώματα απλώνονται σε αντικειμενοφόρο πλάκα και χρωματίζονται με ειδικές χρωστικές ουσίες. Μονάδες 6

Β2.

Να αναφέρετε ονομαστικά τα ένζυμα ή τα σύμπλοκα ενζύμων τα οποία καταλύουν τις παρακάτω διαδικασίες α. Επιμήκυνση πρωταρχικού τμήματος κατά την αντιγραφή. β. Σύνθεση πρωταρχικών τμημάτων. γ. Σύνδεση των κομματιών της ασυνεχούς αλυσίδας μεταξύ τους κατά την αντιγραφή. δ. Ξετύλιγμα της διπλής έλικας του DNA κατά την αντιγραφή. ε. Σύνδεση ριβονουκλεοτιδίων κατά τη μεταγραφή. Μονάδες 5

Β3.

Πώς μπορεί να πραγματοποιηθεί η διάγνωση των γενετικών ασθενειών; Μονάδες 6

Β4.

Ποια ζώα ονομάζονται διαγονιδιακά; Μονάδες 2

Β5.

Τι εννοούμε με τον όρο ζύμωση; (μονάδες 2) Ποια είναι τα προϊόντα της ζύμωσης; (μονάδες 4) Μονάδες 6

ΤΕΛΟΣ 2ΗΣ ΑΠΟ 5 ΣΕΛΙ∆ΕΣ


ΑΡΧΗ 3ΗΣ ΣΕΛΙ∆ΑΣ – Γ΄ ΗΜΕΡΗΣΙΩΝ ΘΕΜΑ Γ Το παρακάτω γενεαλογικό δένδρο απεικονίζει τον τρόπο κληρονόμησης μιας μονογονιδιακής ασθένειας σε μια οικογένεια, η οποία οφείλεται σε μετάλλαξη ενός γονιδίου. Σε κάθε περίπτωση ισχύει ο πρώτος νόμος του Μέντελ.

Γ1.

Να διερευνήσετε εάν η ασθένεια αυτή οφείλεται σε επικρατές ή σε υπολειπόμενο γονίδιο. Να αιτιολογήσετε την απάντησή σας, είτε περιγραφικά είτε με διασταυρώσεις. Μονάδες 4

Γ2.

Να προσδιορίσετε εάν η ασθένεια αυτή κληρονομείται ως αυτοσωμικός ή ως φυλοσύνδετος χαρακτήρας. Να αιτιολογήσετε την απάντησή σας, είτε περιγραφικά είτε με διασταυρώσεις. Μονάδες 6

Γ3.

Να γράψετε τους πιθανούς γονότυπους των ατόμων II 1 , II 2 , II 3 και II 4 , με βάση τα δεδομένα του παραπάνω γενεαλογικού δένδρου. Μονάδες 3

Γ4.

Τα άτομα II 1 , II 2 και II 4 θέλουν να γνωρίζουν εάν είναι φορείς του παθολογικού αλληλόμορφου γονιδίου. Για το σκοπό αυτό, τα άτομα II 1 , II 2 , II 3 και II 4 υποβλήθηκαν σε ανάλυση του γενετικού τους υλικού με τη χρήση ιχνηθετημένου ανιχνευτή. Ο ανιχνευτής υβριδοποιεί το μεταλλαγμένο αλληλόμορφο γονίδιο. Τα αποτελέσματα της ανάλυσης παρουσιάζονται στον παρακάτω πίνακα

Με βάση τα δεδομένα του πίνακα να προσδιορίσετε τους γονότυπους των ατόμων II 1 και II 2 . (μονάδες 2) Να αιτιολογήσετε την απάντησή σας. (μονάδες 4) Μονάδες 6

ΤΕΛΟΣ 3ΗΣ ΑΠΟ 5 ΣΕΛΙ∆ΕΣ


ΑΡΧΗ 4ΗΣ ΣΕΛΙ∆ΑΣ – Γ΄ ΗΜΕΡΗΣΙΩΝ

Γ5.

Σε μια άλλη οικογένεια από το γάμο δύο ατόμων με φυσιολογική όραση γεννήθηκε ένα αγόρι με σύνδρομο Klinefelter, που πάσχει από μερική αχρωματοψία στο πράσινο και κόκκινο χρώμα. Να περιγράψετε έναν πιθανό μηχανισμό που οδηγεί στη γέννηση του συγκεκριμένου ατόμου. Να μη ληφθεί υπόψη η περίπτωση γονιδιακής μετάλλαξης. Μονάδες 6

ΘΕΜΑ Δ Δίνεται τμήμα DNA το οποίο κωδικοποιεί τα οκτώ πρώτα αμινοξέα του πρώτου δομικού γονιδίου του οπερονίου της λακτόζης.

AGCTATGACCATGATTACGGATTCACTG TCGATACTGGTACTAATGCCTAAGTGAC

αλυσίδα Ι. αλυσίδα ΙΙ

Δ1.

Να εντοπίσετε την κωδική αλυσίδα. (μονάδα 1) Να σημειώσετε τον προσανατολισμό των αλυσίδων. (μονάδα 1) Να αιτιολογήσετε την απάντησή σας. (μονάδες 4) Μονάδες 6

Δ2.

Να γράψετε το τμήμα του mRNA που θα προκύψει από τη μεταγραφή του παραπάνω τμήματος του γονιδίου και να ορίσετε τα 5′ και 3′ άκρα του. (μονάδες 2) Να αιτιολογήσετε την απάντησή σας. (μονάδες 3) Μονάδες 5

Δ3.

Να γράψετε το τμήμα του mRNA στο οποίο θα συνδεθεί η μικρή ριβοσωμική υπομονάδα κατά την έναρξη της μετάφρασης. Μονάδες 2

Δ4.

Η φυσιολογική πρωτεΐνη, που παράγεται από την έκφραση του πρώτου δομικού γονιδίου του οπερονίου της λακτόζης, αποτελείται από 1024 αμινοξέα. Μια γονιδιακή μετάλλαξη αντικατάστασης μιας βάσης στο παραπάνω τμήμα DNA οδηγεί στην παραγωγή μιας πρωτεΐνης με 1022 αμινοξέα, δηλαδή μικρότερης κατά δύο αμινοξέα. Να εξηγήσετε με ποιο τρόπο μπορεί να συμβεί αυτό. Μονάδες 6

Δ5.

Μια γονιδιακή μετάλλαξη που συνέβη στο ρυθμιστικό γονίδιο του οπερονίου της λακτόζης οδηγεί στην παραγωγή ενός τροποποιημένου mRNA. Το mRNA αυτό φέρει τέσσερις επιπλέον διαδοχικές βάσεις μεταξύ του 3 ου και 4 ο υ κωδικονίου του. Να εξηγήσετε ποια θα είναι η συνέπεια στην παραγωγή των ενζύμων που μεταβολίζουν τη λακτόζη, όταν το βακτήριο αναπτύσσεται σε θρεπτικό υλικό απουσία λακτόζης και γλυκόζης. Μονάδες 6

ΤΕΛΟΣ 4ΗΣ ΑΠΟ 5 ΣΕΛΙ∆ΕΣ


ΑΡΧΗ 5ΗΣ ΣΕΛΙ∆ΑΣ – Γ΄ ΗΜΕΡΗΣΙΩΝ

ΟΔΗΓΙΕΣ (για τους εξεταζομέ νους) 1.

2.

3. 4. 5. 6.

Στο εξώφυλλο του τετραδίου να γράψετε το εξεταζόμενο μάθημα. Στο εσώφυλλο πάνω-πάνω να συμπληρώσετε τα Ατομικά στοιχεία μαθητή. Στην αρχή των απαντήσεών σας να γράψετε πάνω-πάνω την ημερομηνία και το εξεταζόμενο μάθημα. Να μην αντιγράψετε τα θέματα στο τετράδιο και να μη γράψετε πουθενά στις απαντήσεις σας το όνομά σας. Να γράψετε το ονοματεπώνυμό σας στο πάνω μέρος των φωτοαντιγράφων αμέσως μόλις σας παραδοθούν. Τυχόν σημειώσεις σας πάνω στα θέματα δεν θα βαθμολογηθούν σε καμία περίπτωση. Κατά την αποχώρησή σας να παραδώσετε μαζί με το τετράδιο και τα φωτοαντίγραφα. Να απαντήσετε στο τετράδιό σας σε όλα τα θέματα μόνο με μπλε ή μόνο με μαύρο στυλό με μελάνι που δεν σβήνει. Μολύβι επιτρέπεται, μόνο αν το ζητάει η εκφώνηση, και μόνο για πίνακες, διαγράμματα κλπ. Κάθε απάντηση επιστημονικά τεκμηριωμένη είναι αποδεκτή. Διάρκεια εξέτασης: τρεις (3) ώρες μετά τη διανομή των φωτοαντιγράφων. Ώρα δυνατής αποχώρησης: 10.30 π.μ. ΣΑΣ ΕΥΧΟΜΑΣΤΕ KΑΛΗ ΕΠΙΤΥΧΙΑ ΤΕΛΟΣ ΜΗΝΥΜΑΤΟΣ

ΤΕΛΟΣ 5ΗΣ ΑΠΟ 5 ΣΕΛΙ∆ΕΣ


Thetikh