Page 1

ORIGINAL ARTICLE Journal of

Identification of Human Placenta-Derived Mesenchymal Stem Cells Involved in Re-Endothelialization

Cellular Physiology

TU CAM TRAN,1,2 KENICHI KIMURA,1 MASUMI NAGANO,1 TOSHIHARU YAMASHITA,1 KINUKO OHNEDA,3 HARUHIKO SUGIMORI,4 FUJIO SATO,4 YUZURU SAKAKIBARA,4 HIROMI HAMADA,5 HIROYUKI YOSHIKAWA,5 SON NGHIA HOANG,2 1 AND OSAMU OHNEDA * 1

Department of Regenerative Medicine and Stem Cell Biology, Graduate School of Comprehensive Human Sciences,

University of Tsukuba, Tsukuba, Japan 2

Institute of Tropical Biology, Vietnam Academy of Science and Technology, Thu Duc Dist., Ho Chi Minh City, Vietnam

3

Faculty of Pharmacy, Laboratory of Molecular Pathophysiology, Takasaki University of Health and Welfare, Takasaki, Japan

4

Department of Cardiovascular Surgery, Graduate School of Comprehensive Human Sciences, University of Tsukuba,

Tsukuba, Japan 5

Department of Obstetrics and Gynecology, Graduate School of Comprehensive Human Sciences, University of Tsukuba,

Tsukuba, Japan Human placenta is an attractive source of mesenchymal stem cells (MSC) for regenerative medicine. The cell surface markers expressed on MSC have been proposed as useful tools for the isolation of MSC from other cell populations. However, the correlation between the expression of MSC markers and the ability to support tissue regeneration in vivo has not been well examined. Here, we established several MSC lines from human placenta and examined the expression of their cell surface markers and their ability to differentiate toward mesenchymal cell lineages. We found that the expression of CD349/frizzled-9, a receptor for Wnt ligands, was positive in placenta-derived MSC. So, we isolated CD349-negative and -positive fractions from an MSC line and examined how successfully cell engraftment repaired fractured bone and recovered blood flow in ischemic regions using mouse models. CD349-negative and -positive cells displayed a similar expression pattern of cell surface markers and facilitated the repair of fractured bone in transplantation experiments in mice. Interestingly, CD349-negative, but not CD349-positive cells, showed significant effects on recovering blood flow following vascular occlusion. We found that induction of PDGFb and bFGF mRNAs by hypoxia was greater in CD349-negative cells than in CD349-positive cells while the expression of VEGF was not significantly different in CD349-negative and CD349-positive cells. These findings suggest the possibility that CD349 could be utilized as a specialized marker for MSC isolation for re-endothelialization. J. Cell. Physiol. 226: 224–235, 2010. ß 2010 Wiley-Liss, Inc.

The placenta plays an essential role in the development of the embryo. The main functions of the placenta are gaseous exchange between the embryo and the mother, the provision of maternal nutrients to the fetus and the excretion of waste products from the fetus. It has been reported that the placenta is enriched with a variety of stem cells originating from hematopoietic, trophoblastic, and mesenchymal tissues (Fleischman and Mintz, 1979; Faulk et al., 1990; Fukuchi et al., 2004; Yen et al., 2005; Parolini et al., 2008). Mesenchymal stem cells (MSC) derived from placenta are considered an excellent material for regenerative medicine because of their broad differentiation potential, wide accessibility and the lack of ethical concerns. The two types of MSC, amnionic and chorionic, originate from a distinct region of the placenta. Amnionic MSC arise from the amnion membrane that consists of amnion epithelial cells and MSC (Alviano et al., 2007; Bilic et al., 2008; Magatti et al., 2008; Miki et al., 2009). Chorionic MSC develop from the chorion membrane that consists of chorionic trophoblast cells and MSC (Battula et al., 2008). Amnionic and chorionic MSC can be isolated separately by mechanical agitation and enzymatic digestion. Both MSC types possess the potential to differentiate into three mesodermal cell-types: osteogenic, chondrogenic ß 2 0 1 0 W I L E Y - L I S S , I N C .

and adipogenic lineages. Amnionic MSC can also differentiate into neuron cells derived from the ectodermal germ layer or into hepatic and pancreatic cells that arise from the endodermal germ layer (reviewed in Fukuchi et al., 2004; Parolini et al., 2008; Miki et al., 2009). The isolation of MSC is generally performed by a procedure based on the adherence of cells to the surface of culture dishes.

The authors indicate no potential conflicts of interest. Tu Cam Tran and Kenichi Kimura contributed equally to this work. Additional Supporting Information may be found in the online version of this article. *Correspondence to: Osamu Ohneda, Department of Regenerative Medicine, University of Tsukuba, 1-1-1 Tennodai, Tsukuba 305-8575, Japan. E-mail: oohneda@md.tsukuba.ac.jp Received 9 September 2009; Accepted 6 July 2010 Published online in Wiley Online Library (wileyonlinelibrary.com.), 23 July 2010. DOI: 10.1002/jcp.22329

224


ISOLATION OF PLACENTA-MSC FOR RE-ENDOTHELIALIZATION

Adherent cells are composed of various cell types, of which only a small population is stem cells. The major difficulty of this procedure is that adherent non-MSC often proliferates more rapidly than MSC. One of the most promising ways to purify MSC is to utilize MSC-specific markers. Previous studies showed that MSC are positive for CD13, CD29, CD44, CD73 (SH3, 4), CD90, CD105 (SH2) and CD166 and negative for CD14, CD31, CD34 and CD45 (Portmann-Lanz et al., 2006; Delorme and Charbord, 2007). These markers are helpful for discriminating between mesenchymal cells and endothelial or hematopoietic cells. However, there is no established protocol for isolating MSC solely by these markers. Some reports have demonstrated that STRO-1, CD271 (nerve growth factor receptor) and ganglioside molecule GD2 are useful for isolating bone marrow (BM)-MSC (Bensidhoum et al., 2004; Bu¨ hring et al., 2007; Martinez et al., 2007). However, it is not known if these markers are applicable to the isolation of placental MSC. Recently, CD349/Frizzled-9 was shown to be a useful marker for separating MSC from placenta (Battula et al., 2007, 2008). Frizzled (Fzd) is a family of seven transmembrane-spanning proteins that serve as receptors for Wnt proteins. To date, 10 family members (Fzd 1 to 10) with conserved structural features have been found in vertebrates (Koike et al., 1999). CD349 is expressed in pericytes and mesenchymal cells surrounding the large blood vessels of the placenta. The colonyforming units-fibroblastic (CFU-F) population is 60 times greater in CD349þ/CD10þ/CD26þ cells from placenta than in CD349þ cells, whereas the CFU-F population is absent in CD349/CD10/CD26 cells. Therefore, CD349 might serve as a useful marker for purifying MSC from placenta, although the difference in properties between CD349-positive and -negative MSC has not been fully elucidated. In the present study, we established several lines of MSC from human placenta and examined their CD349 expression level and differentiation properties. We isolated CD349negative and -positive fractions from an MSC line and examined how successfully cell engraftment repaired fractured bone and recovered blood flow in ischemic regions using mouse models. Both CD349-negative and -positive cells showed the potential to differentiate into an osteogenic lineage and facilitated the repair of fractured bone in transplantation experiments in mice. Interestingly, CD349-negative, but not CD349-positive cells, showed significant effects on recovering blood flow following vascular occlusion. These results suggest that CD349 might be used as a specialized marker of placental MSC for arteriogenesis and angiogenesis. Materials and Methods Isolation of MSC and cell culture

Human full-term placentas were collected by caesarean section from healthy donor mothers. Tissues were obtained after informed consent and all experiments were approved by the local ethics authorities at the University of Tsukuba. Chorion leave tissue was manually separated and treated with 0.1% collagenase (Nitta Gelatin, Osaka, Japan)/20% FBS (Hyclone, South Logan, UT)/PBS solution at 378C for 1 h. Following filtration through a cell strainer (Falcon 3078; pore size 100 mm; BD Bioscience, San Jose, CA), the cells were cultured in IMDM (Invitrogen, Carlsbad, CA) with 10% FBS (Hyclone, South Logan, UT), 2 mg/ml L-glutamine (Invitrogen, Carlsbad, CA), 5 ng/ml human bFGF (Peprotech, London, United Kingdom) and 0.1% (v/v) penicillin–streptomycin (100 U/ml penicillin, 0.1 mg/ml streptomycin; Invitrogen). The cells were maintained in a 10 cm tissue culture dish (Sumitomo Bakelite, Osaka, Japan) at 378C in a humidified atmosphere of 5% CO2. The culture medium was replaced with fresh medium once a week. After adherent cells reached subconfluency, they were harvested with 0.05% trypsin–EDTA (Invitrogen) and purified for JOURNAL OF CELLULAR PHYSIOLOGY

CD31/CD45- cells by FACS to remove endothelial and hematopoietic cells. The cells were cultured with the same medium used for the isolation except for the concentration of bFGF (10 ng/ml). Furthermore, following two or three passages, the cells were plated in a 10 cm tissue culture dish at a low confluency. Clusters that formed in the dish were cloned using cloning cylinders (Sigma–Aldrich, St. Louis, MO) and expanded. Frozen cell stocks were prepared using Cell Banker (ZENOAQ, Koriyama, Japan) solution and stored in liquid nitrogen for further experiments. All experiments were performed using at least three distinct sources of placenta. Human BM samples were collected from sternum with permission from the local ethics authorities at the University of Tsukuba. BM derived MSC were cultured in the same way as placental derived MSC. Antibodies

The antibodies used in this study were as follows: Fluorescein isothiocyanate (FITC)-labeled HLA-A,B,C (W6/32), phycoerythrin (PE)-labeled anti-CD31 (WM59), anti-HLA-DR (L243), allophycocyanine (APC)-labeled anti-CD45 (HI30), biotin-labeled CD349 (W3C4E11; BioLegend, San Diego, CA), FITC-labeled antiCD105 (SN6; Serotec, Oxford, UK), anti-CD90 (5E10; Biolegend), PE-labeled anti-CD166 (3A6), anti-CD73 (AD2), anti-CD14 (M5E2), anti-CD13 (WM15), anti-CD271 (LNGFR; Miltenyi Biotec, Auburn, CA), APC-labeled anti-CD34 (581), anti-mouse IgG (BD Biosciences) and PE-labeled anti-SSEA4 (MC-813-70; R&D systems, Minneapolis, MN). After staining the cells with fluorochrome-conjugated antibodies, cells were sorted using FACSVantageSE (BD Biosciences) as previously described (Ohneda et al., 2001). In vitro differentiation assay of MSC

To examine their capacity to differentiate toward an osteogenic lineage, MSC were cultured in the presence of 50 ng/ml of human epidermal growth factor (EGF; Wako, Osaka, Japan) and analyzed for the expression of alkaline phosphatase (ALP) as reported previously (Kratchmarova et al., 2005). Following differentiation, the cells were harvested on day 9, purified for mRNA and examined by RT-PCR. To induce osteogenic differentiation, 5  104 cells were treated with osteogenic differentiation medium in 4-well plates (Nalge Nunc, Rochester, NY) for 4 weeks. The osteogenic differentiation medium consisted of IMDM supplemented with 1% FBS, 0.1 mM dexamethasone (Sigma–Aldrich), 10 mM b-glycerol-2-phosphate (Sigma–Aldrich), 0.2 mM ascorbic acid (Sigma–Aldrich) and 50 ng/ ml of human EGF (Ko¨ gler et al., 2004; Lee et al., 2004). The culture medium was replaced with fresh medium once or twice a week. Alkaline phosphatase activity was examined histologically according to the manufacturer’s instructions (Leukocyte Alkaline Phospatase-Kit, Sigma–Aldrich). The mineralized matrix was evaluated by von Kossa staining and Alizarin red staining as described previously (Lee et al., 2004). Adipogenic differentiation was induced in 4-well plates for 4 weeks by adipogenic differentiation medium consisting of IMDM supplemented with 10% FBS, 0.1 mM dexamethasone (Sigma– Aldrich), 0.5 mM 3-isobutyl-1-methylxanthine (IBMX; Sigma– Aldrich), 2 mg/ml insulin (Wako) and 0.1 mM indomethacine (Sigma–Aldrich). The culture medium was replaced with fresh medium once or twice a week. Cultured cells in adipogenic differentiation medium were fixed with 10% formaldehyde (Wako) and stained with Oil-Red O solution (Muto Pure Chemicals, Tokyo, Japan) for 30 min at 428C. After the staining, cells were dissolved with 4% IGEPAL CA630 (Sigma–Aldrich) in isopropanol and the absorbance was measured at 480 nm. To promote chondrogenic differentiation, cells were treated with chondrogenic differentiation medium in 96-well spheroid plates for 4 weeks. Chondrogenic differentiation medium

225


226

TRAN ET AL.

consisted of IMDM supplemented with 1% FBS, 0.1 mM dexamethasone (Sigma–Aldrich), 1 mM sodium pyruvate (Invitrogen), 0.25 nM ascorbic acid, 50 mg/ml ITS premix (BD Bioscience), 40 mg/ml proline (Sigma–Aldrich), 10 ng/ml TGF-b1 (Wako), and 10 ng/ml BMP-2 (Wako). The culture medium was replaced with fresh medium once or twice a week. In order to evaluate chondrocyte differentiation, spheroids were fixed with 4% paraformaldehyde and stained with Toluidine blue solution (Muto Pure Chemicals). Analysis of MSC in a bone fracture mouse model

A bone fracture mouse model was generated according to a modified method of the one reported by Taguchi et al. (2005). Adult C57/BL6 mice were anesthetized and closed transverse fractures of the femur were produced in the middle part of the thigh bone. The fractured femurs were connected by pins and an incision was made at the connected site by a 27G-gage needle (2 mm in diameter). MSC (5  105) were plated on a 2 mm  2 mm Gelform (Pfizer, New York, NY) and incubated at 378C for 2 h before insertion into the mice. The transplanted Gelform was then fixed at the connected site. Immunosuppression was performed by intraperitoneal injection of 20 mg/kg body weight of cyclosporin-A (Wako) 2 days before the assay. Cyclosporin-A injections were continued daily for the entire period of the assay. X-rays were taken 28 days post transplantation and the density at the bone-gap area was measured with NIH imaging software. For histological staining, thigh bones were fixed with 4% paraformaldehyde (Wako) for 7 days and decalcified with Plank-Rychlo solution (Muto Pure Chemicals) for 30 days. Frozen or paraffin-embedded samples were sectioned at a thickness of 7 mm and stained with an antibody or hematoxylin–eosin (HE) solution (Muto Pure Chemicals) according to the modified method reported by Kawamoto and Shimizu (2000). Microscopy analysis

Cell samples were viewed with an Olympus IX71 microscope system (Olympus, Tokyo, Japan) using UPlanF objective lenses at 4/0.13PhL and 10/0.30Ph1. Sample slides were viewed with an Olympus BX51 microscope system (Olympus) using UPlanSApo objective lenses at 4/0.16PH, 10/0.40PH and 20/0.75PH (Olympus) and mounting reagent (Muto Pure Chemicals). Data acquisition was carried out using a DP70 digital camera attached to the microscope and DP controller software (Olympus). Images were processed using Adobe Photoshop version 8.0 software (Adobe System, San Jose, CA). RT-PCR and quantitative PCR

Total RNA (1 mg) was reverse transcribed using an RT-PCR kit (BD Biosciences) as described previously (Nagano et al., 2007). Resulting cDNAs were amplified by a GeneAmp PCR System 9100 (Applied Biosystems, Foster City, CA) for 23–35 cycles of 958C for 5 sec and 688C for 30 seconds. b-actin was used as an internal control. The reaction mixtures for quantitative PCR were prepared using POWER SYBR1 Green PCR master mix (Applied Biosystems) and analyzed by a 7700 Sequence Detector (Applied Biosystems). Experiments were performed in triplicate and data were calculated by the DDCt method. The primers used for the PCR reactions were as follows: Oct-4 (50 - AAGCTCCTGAAGCAGAAGAGGATCACC; 30 -GGTTACAGAACCACACTCGGACCACAT), NANOG (50 -CCTCCATGGATCTGCTTATTCAGGACA; 30 -CCTTCTGCGTCACACCATTGCTATTCT), SOX2 (50 -GGAAAACCAAGACGCTCATGAAGAAGG; 30 -GTTCATGTAGGTCTGCGAGCTGGTCAT), Rex1 (50 -CAACCCATCCTGGAAGAGGACTCACTT; 30 -GGAGATGCTTTCTCAGGGCAGCTCTAT), Glut-1 (50 -CCTTGGATGTCCTATCTGAGCATCG; 30 -ATCTCATCGAAGGTTCGGCCTTTGG), VEGF (50 -GAACTTTCTGCTGTJOURNAL OF CELLULAR PHYSIOLOGY

CTTGGGTGCATTG; 30 -CTGCATGGTGATGTTGGACTCCTCAGT), PDGFb (50 -GACCTGTCCAGGTGAGAAAGATCGAGA; 30 -AAATAACCCTGCCCACACACTCTCCTG), bFGF (50 -AGAGCGACCCTCACATCAAGCTACAAC; 30 -ATAGCTTTCTGCCCAGGTCCTGTTTTG), TGF-b (50 -AGAGCTCCGAGAAGCGGTACCTGAACCC; 30 -GTTGATGTCCACTTGCAGTGTGTTATCC), Angiopoietin-1 (Ang1) (50 -CTGACTCACATAGGGTGCAGCAATCAG; 30 -AGGCTGGTTCCTATCTCCAGCATGGTA), b-actin (50 -GTGCGTGACATTAAGGAGAAGCTGTGC; 30 -GTACTTGCGCTCAGGAGGAGCAATGAT). Mouse vascular occlusion model

Young adult (2 months old) male BDF-1 mice underwent unilateral femoral artery and vein ligation. Arteries and veins from the proximal end of the femoral vessels to the popliteal vessels were ligated with 6-0 silk (Couffinhal et al., 1998). In addition, all side branches of the femoral and popliteal vessels were ligated, whereas neurons were carefully kept unchanged. On the first day after the surgical process, 5  105 cells were injected intramuscularly into four divided sites. A laser Doppler blood flow meter (FLO-C1, Omegawave, Tokyo, Japan) was utilized for the measurement of serial blood flow at the inner ankle. Data were represented as the ratio of blood flow in the ischemic limb site divided by that in the non-ischemic site. Mice were analyzed for angiogenesis 2 weeks after induction of hind limb ischemia. The capillary density in the thigh muscle was assessed by immunofluorescence using Banderiraea simplicifolia lectin I-TRITC (0.1 mg/ml; Sigma–Aldrich) as reported previously (Nagano et al., 2007). Frozen sections were mounted and observed under a microscope equipped with the appropriate filters (Olympus). The number of capillaries was measured in 10 different randomized fields of each mouse. Animal care and experimental procedures complied with the ‘‘Principles of Laboratory Animal Care’’ (Guide for the Care and Use of Laboratory Animals, University of Tsukuba) and were approved by the Use Committee of the University of Tsukuba. Statistical analysis

Statistical evaluations of data were conducted using the Student’s ttest for per-comparison analysis. Data are presented as means  SD. Results Isolation of placenta-derived MSC

Placenta cells were obtained from women who had a normal pregnancy and full-term delivery. These cells were grown in culture medium containing bFGF (5 ng/ml) and the adherent cells were collected. The CD45-negative and CD31-negative cell fraction was sorted by FACS to eliminate hematopoietic and endothelial cells (Fig. 1A). These cells were expanded with bFGF (10 ng/ml) in standard culture dishes. At that time point, the morphology of the cells appeared to be heterogeneous (data not shown). Spindle shaped cells were chosen for cloning and at least 12 cell lines were obtained from each placenta. Among them, 6 cell lines (PL56, PL57, PL58, PL59, PL73, and PL74) were chosen because they grew faster than the other 6 cell lines. As a control, BM-MSC was prepared by the same procedure. We found that the cloned cell lines could be divided into two groups by their morphologies. PL57 and PL58 were composed of short spindle-shaped cells, whereas PL73 and PL74 were fibroblast-like and resembled BM-MSC in appearance (Fig. 1B). To examine whether these cells can differentiate into an osteoblast lineage, EGF was added to the culture medium. Kratchmarova et al. (2005) reported that ALP mRNA increased in response to EGF when the MSC differentiated into an osteogenic lineage. We found that ALP mRNA was clearly


ISOLATION OF PLACENTA-MSC FOR RE-ENDOTHELIALIZATION

Fig. 1. Isolation of mesenchymal stem cells from human placenta. Adherent cells derived from placenta were purified for non-hematopoietic (CD45-negative) and non-endothelial (CD31-negative) cells by FACS. Cells within the border shown were cultured for further experiments. Phase-contrast micrograph of the four placenta-derived (PL) adherent cell lines (PL57, PL58, PL73, and PL74) and BM-derived MSC (BM-MSC). Note that PL73 and PL74 show the fibroblast-like morphology and resemble BM-MSC, whereas PL57 and PL58 show the spindle-shaped morphology. Bar indicates 50 mm. The expression of alkaline phosphatase (ALP) mRNA was examined for PL adherent cells on day 9 after the addition of EGF to the culture. The expressions of b-actin and BM-MSC mRNAs were utilized as an internal control and a positive control, respectively. Data obtained on day 0 was normalized to a value of 1 as the standard for each cell. White column: without EGF (day 0); black column: with EGF (day 9). MMP < 0.01. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

induced in BM-MSC and in PL73 on the 9th day after induction (Fig. 1C). ALP mRNA was also upregulated in PL74 and PL59 in response to EGF (Supplementary Fig. 1A). On the contrary, ALP mRNA was not induced in PL57, PL58 and PL56 (Supplementary Fig. 1A). These results indicate that PL73, PL74 JOURNAL OF CELLULAR PHYSIOLOGY

and PL59, but not PL57, PL58 and PL56, can differentiate into an osteogenic lineage in response to EGF (Supplementary Fig. 1B). On the basis of these findings, we have chosen a fibroblastic cell line (PL73) and a non-fibroblastic cell line (PL57) for further analyses.

227


228

TRAN ET AL.

The expression of cell surface markers on placenta-derived MSC

Since PL73 and PL57 showed the distinct feature of osteogenic differentiation, a comparison was made between placental and bone marrow MSC relating to their expression of cell surface markers (Fig. 2). Despite the clear difference in osteogenic

differentiation in vitro, PL73 and PL57 demonstrated a similar cell surface marker expression profile (Fig. 2B,C). Both cell lines were negative for hematopoietic (CD45 and CD14) and endothelial (CD31 and CD34) cell markers. Expression of the MSC markers CD13, CD73, and CD105 was positive for both PL73 and PL57. Compared to the expression profiles in BM-MSC (Fig. 2A), PL73 and PL57 were negative for CD271 and

Fig. 2. FACS analyses of cell surface markers on PL adherent cells. PL57 (B) and PL73 (C) were analyzed for the expression of cell surface markers (CD14, CD31, CD34, CD45, CD13, CD90, CD73, CD105, CD166, HLA-ABC, HLA-DR, SSEA4, and CD271) by FACS. BM-MSC (A) was examined as a control. No significant differences in the expressions of the cell surface markers were observed between PL57 and PL73.

JOURNAL OF CELLULAR PHYSIOLOGY


ISOLATION OF PLACENTA-MSC FOR RE-ENDOTHELIALIZATION

showed the bimodal distribution of CD90 expression (Fig. 2B,C). The expression of SSEA4, a previously reported marker for BM-MSC (Gang et al., 2007), was similar in BM-MSC, PL57 and PL73. We also examined the expression of these markers for PL58 and PL74 (Supplementary Fig. 2). The expression of these markers was almost similar among the 4 cell lines except that the peak of CD90 expression level varied among the cell lines. In vitro differentiation of placenta-derived MSC

Although we have screened the capability of osteogenic differentiation by EGF-induced ALP mRNA expression on day 9, the full induction of osteogenic differentiation requires 4 weeks of culture in the presence of dexamethasone, b-glycerol-2-phosphate and ascorbic acid in addition to EGF. We therefore cultured PL57 and PL73 for 4 weeks in this condition and performed cytochemical analysis of the ALP protein (Fig. 3A), Von Cossa staining (Fig. 3B), and Alizarin red staining (Fig. 3C). We also examined these cells for adipocyte and chondrocyte differentiation in vitro by Oil Red O (Fig. 3D) and Toluidine Blue (Fig. 3E) staining, respectively. Consistent with the results of ALP mRNA expression on day 9, the ALP protein was not detectable in PL57 cells, whereas BM-MSC and PL73 did express ALP protein in this culture condition. Mineralization of osteocytes in BM-MSC and PL73 was further confirmed by Von Cossa staining (Fig. 3B), and Alizarin red staining (Fig. 3C). PL57 failed to differentiate into other mesenchymal cell lineages, such as adipocytes and chondrocytes. In contrast, BM-MSC and PL73 were able to differentiate into these cell lineages. Furthermore, neither PL57 nor PL58 could differentiate into osteocytes or adipocytes, after a longer culture period (45 days; data not shown). Consequently, these data indicate that PL73 and PL74 possess characteristics of MSC, whereas PL57 and PL58 may be derived from a cell lineage other than MSC. In addition, these data suggest the possibility that measurement of the ALP mRNA level in response to EGF on day 9 of cultivation might be an efficient first screening for MSC isolation. The effects of placenta-derived MSC engraftment on bone repair in a mouse model

Although PL57 failed to differentiate into any mesenchymal cell lineages in our cell culture experiments, the profile of cell surface markers of PL57 was consistent with that of MSC and was indistinguishable from that of PL73. These observations led us to test the possibility that PL57 might be able to differentiate into mesenchymal cells in vivo. To assess this, we transplanted PL57, PL73 and BM-MSC into immunosuppressed mice with surgically fractured femurs and examined the processes of bone repair (Fig. 4). Twenty-eight days after surgery, new bone formation was evaluated by the degree of calcification revealed by X-ray. Following the X-ray examination, histological analysis was performed on the region of transplantation and in the joint region of the fractured femur. As shown in Figure 4A, BM-MSC and PL73 engraftment revealed the infiltration of mononuclear cells, including inflammatory blood cells and osteocytic cells at the injection site. In contrast, cells were sparsely distributed with a few osteocytic cells at the site of PL57 transplantation, which was akin to the control PBS injection. These results suggest that PL73 and BM-MSC, but not PL57, can proliferate rapidly in situ and differentiate into osteocytic cells at the site of transplantation. It is also significant that PL73 and BM-MSC can accumulate host-derived mesenchymal cells and inflammatory cells into this region. X-ray examination revealed that the degree of calcification at the joint of each fractured femur was significantly higher in PL73 and BM-MSC transplanted mice compared to that in PL57 transplanted and PBS injected mice (Fig. 4B). Consistent with these results, histological JOURNAL OF CELLULAR PHYSIOLOGY

Fig. 3. Analysis of the ability of PL-derived cells to differentiate. Data obtained from two representative PL adherent cell groups (PL57: middle parts; PL73: parts on the right) are shown. BM-MSC served as a positive control (parts on the left). A: Osteogenic differentiation was examined by alkaline phosphatase staining without (w/o) induction (top parts) or with induction (bottom parts). Bar indicates 100 mm. B,C: Osteogenic differentiation was further examined by observing the formation of the mineralized matrix by Von Kossa (B) and Alizarin red (C) stainings without induction (top parts) or with induction (bottom parts). Bar indicates 100 mm in (B) and 50 mm in (C). D: Adipogenic differentiation was studied by the detection of lipid vacuoles by Oil Red O staining without induction (top parts) or with induction (bottom parts). Bar indicates 50 mm. E: Chondrogenic differentiation was inspected by Toluidine blue staining (bottom parts). HE staining was performed to ascertain cell morphology (top parts). Bar indicates 200 mm. Note that PL57 was negative for each stain used to detect the differentiation potential of MSC.

229


230

TRAN ET AL.

Fig. 4. Repair of bone fracture by transplantation of PL adherent cells. BM-MSC, PL57, PL73 or no cells (PBS) were transplanted into mice at the of bone fracture sites using Gelform (collagen-based gelatin sponge) as a carrier vehicle. We looked at the morphology by HE staining (A), the osteocalcification by X-ray (B; left side) and the density (B; right bar graph) of the transplantation sites. HE staining was performed at the joint of the fractured bones (C). The boxed regions in the upper parts of (A) and (C) were magnified in the lower parts. Bars in the upper and lower parts indicate 200 mm and 100 mm, respectively. Note that when PL73 was transplanted, the growing bone substitution process progressed similarly as in the BM-MSC transplant. MP < 0.05, MMP < 0.01.

examination at the joint regions of the fractured bones revealed the formation of lamellar bone on pre-existing hyaline cartilage in mice transplanted with BM-MSC or PL73 (Fig. 4C). These observations suggest that the endochondral ossification and bony substitution were processed at the joint regions of the fractured bones in these mice. JOURNAL OF CELLULAR PHYSIOLOGY

In contrast, woven bone with fibroblastic cells was observed at the joint regions of the PL57 transplanted and PBS injected mice (Fig. 4C). Although the accumulation of fibroblastic cells into the joint region was observed in both PL57 recipient and control (PBS), the central region of the joint was not completely filled with nucleated cells as observed in BM-MSC of PL73


ISOLATION OF PLACENTA-MSC FOR RE-ENDOTHELIALIZATION

recipient (Fig. 4C). These results suggest that osteogenic differentiation in the joint region of the PL57 transplanted mice was obviously delayed compared to that in the BM-MSC or PL73 transplants. Taken together, these results suggest that transplantation of BM-MSC or PL73 facilitates the repair process of a fractured femur. On the contrary, PL57 failed to accelerate the bone repair process. Despite the profile of cell surface markers on PL57 being indistinguishable from that for PL73, we found no evidence of mesenchymal cell differentiation of PL57 both in vitro and in vivo. Separation of placenta-derived MSC on the basis of CD349 expression

Battula et al. (2007) reported that frizzled-9 (CD349), a member of the Wnt receptor family, is expressed in BM-MSC and placenta MSC when cultivated in a serum-free, b-FGFcontaining medium. CD349-positive MSC exhibited multilineage differentiation into mesodermal, ectodermal, and endodermal cells. So, CD349 might be utilized as a marker for isolating MSC from BM and placenta. This result suggests that PL73 might be composed of two subpopulations with distinct features. We then isolated CD349-negative and -positive PL73 cell fractions by FACS and determined if the expressions of cell surface markers other than CD349 differs between the CD349-negative and -positive cells (Fig. 5B,C). As observed in parental PL73 cells (Fig. 2C), both cell fractions were negative for the hematopoietic cell markers CD45 and CD14 and the endothelial markers CD31 and CD34. The expressions of typical MSC markers were similar in both CD349-naegative and -positive PL73 (Fig. 5B,C). Exceptionally, the peak of CD90 expression was lower in the CD349-positive fraction compared to that in the CD349-negative fraction. We further examined the expression of CD349 for PL74 and isolated CD349-positive and –negative fractions (Supplementary Fig. 3). Unlike the case of PL73, the CD349 expression level was low and did not show a bimodal distribution in PL74. There was no significant difference between the CD349-negative and positive fractions in the expression of MSC markers in PL74. To further assess the status of differentiation of these cells, we studied the expressions of the immature cell markers Oct4, Nanog, Rex1 and Sox2 by RT-PCR (Fig. 5D). While the expression of these genes was detectable in BM-MSC, Rex-1 and Nanog expressions were higher in BM-MSC compared to that in PL-MSC by real time PCR (data not shown). Importantly, the expression level of these genes was similar in both CD349negative and -positive cells, indicating that CD349-negative and -positive cell fractions cannot be distinguished by these markers. We also examined CD349 expression in PL57 and PL58 (Supplementary Fig. 4). As shown above, these cells could not be defined as MSC by their differentiation potential. The peak of CD349 expression level was low, but a considerable frequency of CD349 (þ) cells were observed in the two non-MSC lines. The frequency of positive cells was 58% and 20% for PL57 and PL58, respectively. Taken together, these results suggest that CD349 may not be a suitable marker to discriminate MSC and non-MSC from placenta. Both CD349-negative and -positive cells facilitated the bone repair process in mice

We observed that the transplantation of PL73 facilitated the bone repair process in a mouse model. Therefore, we evaluated the therapeutic effects that the expression level of CD349 might have on bone repair (Fig. 6). As with the parental PL73 transplantation, bone calcification was significantly higher in mice transplanted with CD349-negative or -positive cells compared to control mice injected with PBS. Furthermore, the degree of calcification at the joint region was higher in mice JOURNAL OF CELLULAR PHYSIOLOGY

transplanted with CD349-positive cells compared to those transplanted with CD349-negative cells. Interestingly, these results were consistently observed in the other MSC line, PL74 (Supplementary Fig. 5). These results suggest that the expression level of CD349 might alter the effects on bone repair to some extent. Nonetheless, CD349-negative cells had considerable effects on bone calcification compared to control. Transplantation of CD349-negative cells demonstrated significant arterio/angiogenic effects following vascular occlusion in mice

Previous studies have shown that MSC frequently localize near vessels in villi and in parenchymatic tissues of the placenta, suggesting physiological roles for MSC in vascular formation in the placenta (Battula et al., 2007). In order to examine if the expression level of CD349 facilitates new vessel formation in vivo, a vascular occlusion model was prepared by ligating the proximal end of the femoral vessel with the popliteal vessel in mice. CD349-negative or -positive cells were injected intramuscularly into the ischemic region and blood flow was measured at the unilateral ankle over a period of time (Fig. 7A). The recovery of blood flow was evaluated by comparing values from the ischemic and non-ischemic sides of the ankle. As a positive control, endothelial precursor cells (EPC) derived from umbilical cord blood were utilized in this study (Nagano et al., 2007). Prior investigations demonstrated that blood flow recovery in an ischemic region occurs initially through ‘‘arteriogenesis,’’ a process defined as the formation of functional collateral arteries from pre-existing arterioarteriolar anastomoses (Heil et al., 2006). It has been reported that this process commences one week after femoral vessel occlusion (Ito et al., 1997). Following arteriogenesis, blood flow in the ischemic region is further supported by ‘‘angiogenesis,’’ which is characterized by the sprouting of new capillaries from pre-existing vessels. We observed that the recovery of blood flow on day 3 after surgery was significantly greater in mice injected with EPC compared to those injected with CD349negative or -positive cells. These results suggest that EPC directly contributes to arteriogenesis and the development of collateral blood flow. Surprisingly, thereafter the blood flow in the ischemic region rapidly increased in mice injected with CD349-negative cells. At day 7 and 10 after the transplantation, the relative blood flow was significantly greater in CD349-negative cell recipients compared to that in CD349-positive cell recipient mice (Fig. 7A, P < 0.05). Furthermore, the results were consistently observed in the other MSC line, PL74 (Supplementary Fig. 6). On day 14 following the vascular occlusion, blood flow at the ischemic site recovered and resembled the blood flow at the non-ischemic site, even in control mice (Couffinhal et al., 1998; Tang et al., 2005; Yang et al., 2009). These results indicate that collateral blood flow arose naturally by this time point. Interestingly, we observed a significant accumulation of lectin-binding endothelial cells (EC) in the EPC and CD349negative cell recipients at the femoral region on day 14 (Fig. 7B). In contrast, EC were sparsely distributed in control and CD349-positive cell recipient mice. The EC at the femoral region are considered to contribute to angiogenesis by supplying the blood flow to the peripheral region. Overall, these data strongly indicate that CD349-negative PL-MSC showed a greater ability of re-endothelialization compared to CD349positive PL-MSC. In order to determine how CD349-negative cells support new vessel formation, the mRNA expressions of angiogenic factors were evaluated by quantitative PCR under normoxic and hypoxic conditions (Fig. 7C). We found that the expression levels of PDGFb and bFGF were greater in CD349-negative cells than in CD349-positive cells under hypoxic conditions.

231


232

TRAN ET AL.

Fig. 5. Separation of PL-MSC on the basis of CD349 expression. PL73 was separated into CD349-negative and -positive cells by FACS. B,C: CD349-negative cells (B) and CD349-positive cells (C) were analyzed for the expressions of CD14, CD31, CD34, CD45, CD13, CD90, CD73, CD105, CD166, HLA-ABC, HLA-DR, SSEA4, and CD271 by FACS. Note the comparable expression profiles between the two CD349 fractions. D: The expressions of immature cell markers in CD349-negative and -positive cells were examined by RT-PCR. BM-MSC was utilized as a positive control.

JOURNAL OF CELLULAR PHYSIOLOGY


ISOLATION OF PLACENTA-MSC FOR RE-ENDOTHELIALIZATION

Fig. 6. Analysis of the differentiation potential of PL73 CD349negative and -positive cells in a mouse bone fracture model. PL73 CD349-negative (left) and CD349-positive (right) cells were transplanted into mice at the sites of bone fracture using Gelform as a carrier vehicle. The transplantation sites were analyzed for osteocalcification by X-rays (A) and density measurements (B). Note that osteocalcification in the transplant of CD349-positive cells was greater than that of CD349-negative cells. MP < 0.05, MMP < 0.01.

In addition, the hypoxic induction of PDGFb and bFGF mRNAs was significantly greater in CD349-negative cells compared to that in CD349-positive cells; PDGFb: 2.88  0.74 folds (CD349-negative cells) versus 1.46  1.11 folds (CD349positive cells), and bFGF: 1.95  0.28 folds (CD349-negative cells) versus 1.84  0.43 folds (CD349-positive cells; P < 0.05). On the other hand, the expression of VEGF mRNA was clearly upregulated by hypoxia in CD349-negative and CD349-positive cells, but there was no significant difference between them. CD349-negative and -positive cells showed a comparable expression profile of TGF-b, Ang1, the matrix metalloproteinases MMP-2, and MMP-9 (Fig. 7C and data not shown). In summary, the expression levels of the two angiogenic factors PDGFb and bFGF were greater in the CD349-negative cells than in the CD349-positive cells. These angiogenic factors might contribute to the significant arterio / angiogenic effects of the CD349-negative cells in vivo. Discussion

In the present study, we established several MSC lines from human placenta and characterized these cells by analyzing the JOURNAL OF CELLULAR PHYSIOLOGY

expression of cell surface markers and the ability to differentiate both in vitro and in vivo. Engraftment of both CD349-positive and -negative PL-MSC subfractions successfully facilitated the bone calcification of fractured femurs. Interestingly, the CD349-negative fraction showed significant effects on new vessel formation in ischemic tissue following vascular occlusion in mice. These results indicate that the CD349-negative and -positive MSC possess partially overlapping, but distinct features in their differentiation potential. On the basis of these findings, we propose that CD349 might be utilized as a specialized marker for PL-MSC in arterio/angiogenic therapy. However, we should note that CD349 may not be a suitable marker to discriminate MSC and non-MSC from placenta, because the distribution of CD349 appeared different in PL73 and PL74 (Fig. 5 and Supplementary Fig. 3) and both CD349-positive and -negative fractions were observed in the two non-MSC line, PL57 and PL58 (Supplementary Fig. 4). Given that human placenta is an attractive source of MSC for cell therapy based clinical applications, our data provide a novel insight into the isolation of placenta-derived MSC that have advantageous effects on arteriogenesis and angiogenesis. The properties of MSC are generally defined by their potential to differentiate into mesenchymal and nonmesenchymal cells in cell culture experiments. Several conventional protocols exist for the in vitro differentiation of MSC for a variety of cell types (Ko¨ gler et al., 2004; Lee et al., 2004). Most of them require several weeks to induce the terminal stage of differentiation. In this study, we screened the osteogenic differentiation of MSC lines by an increase in ALP mRNA expression in response to EGF after 9 days of cultivation. Furthermore, we confirmed the ability to differentiate into osteogenic, chondrogenic and adipogenic lineages using conventional protocols. In contrast, PL57, which showed no induction of ALP mRNA by EGF, failed to differentiate into osteogenic, adipogenic and chondrogenic lineages. Thus, measurement of the ALP mRNA level in the presence of EGF might provide an indication of the differentiation potential of MSC and would be a valuable screening procedure for isolating MSC. Despite the failure of PL57 to differentiate into any mesenchymal cell lineages in vitro, this cell line was indistinguishable from PL73 by the expression of multiple cell surface antigens. We also demonstrated that PL57 failed to contribute to the processes of bone repair in vivo. These data suggest that it might be difficult to distinguish between MSC and non-MSC solely by the expression of cell surface markers. Although the origin of PL57 is uncertain, it is conceivable that several MSC-specific surface antigens are expressed on a certain class of placenta-derived mesenchymal cells that lost the potential to differentiate toward multiple lineages. The specific isolation of MSC by the exclusive use of cell surface markers would indeed be a speedy and useful method. However, we realized that the combined assessment of differentiation potential and cell surface marker expression is necessary for isolating placenta-derived MSC for clinical applications. Although we and others have confirmed that engraftment of MSC facilitates collateral blood flow in ischemic regions, how MSC contribute to new vessels is still controversial. It has been reported that MSC can differentiate into vascular endothelial cells (Nagaya et al., 2004; Pittenger and Martin, 2004; Urbich and Dimmeler, 2004; Wu et al., 2005; Jiang et al., 2006). However, direct in vivo evidence for the contribution of MSC-derived endothelial cells to new vessel formation is lacking. Even though MSC might be able to directly differentiate into EC in vivo, the proliferation and migration of host-derived endothelial cells in ischemic regions might be necessary for new vessel development. Alternatively, MSC have been reported to have a paracrine function by secreting angiogenic factors

233


234

TRAN ET AL.

Fig. 7. Study of the angiogenic effects of CD349-negative and -positive cells. A,B: Angiogenic effects were determined after the transplantation of PL73 CD349-negative or -positive cells into a mouse model of vascular occlusion. The ratio of ischemic blood flow to non-ischemic blood flow was measured at the inner ankle on days 0, 1, 3, 5, 7, 10, and 14 post transplantation and demonstrated that CD349-negative cells (white square with dot line) were more effective at recovering blood flow than CD349-positive cells (black circle with dot line, A). As controls we used PBS alone (white circle with solid line) or endothelial progenitor cells (EPC; triangle with dot line) derived from umbilical cord blood. MP < 0.05. Vessel formations were measured after lectin-TRIC injections on day 14 (B). Bar indicates 50 mm. The number of vessels was scored. MP < 0.05, MMP < 0.01. C: The expressions of angiogenic factors were examined by quantitative PCR after cells were cultured under normoxic conditions (N) or hypoxic conditions (H). Relative mRNA expressions were measured and the data obtained from CD349-negative cells cultured under normoxic conditions were normalized to a value of 1 as the standard. Grey columns: CD349-negative cells; black columns: CD349-positive cells. MP < 0.05, MMP < 0.01.

JOURNAL OF CELLULAR PHYSIOLOGY


ISOLATION OF PLACENTA-MSC FOR RE-ENDOTHELIALIZATION

(Kinnaird et al., 2004; O’Neill et al., 2005; Takahashi et al., 2006; Liu et al., 2008). This paracrine function is a likely explanation for the significant effects of CD349-negative cells on blood flow recovery in our experiments, since CD349-positive and -negative cells displayed a clear difference in the expression of angiogenic factors. VEGF mRNA expression was significantly upregulated under hypoxic conditions in both CD349-negative and CD349-positive cells. Interestingly, PDGFb and bFGF mRNA levels and those inductions were greater in CD349negative cells than in CD349-positive cells under hypoxic conditions. It is noteworthy that CD349-positive and -negative cells showed a similar expression profile of the other angiogenic factors investigated, such as TGF-b, Ang1, MMP2, MMP9 and MMP14 (Fig. 7C and data not shown). Thus, PDGFb and bFGF might play specific roles in promoting new vessels in placentaderived MSC. In contrast to our data, it has been reported that MSC enhance angiogenesis by secreting VEGF and Ang1 during wound healing in mice (Wu et al., 2007). Further study is required to clarify the roles of PDGFb and bFGF in PL-MSC by using gene-transduced MSC in transplantation experiments. In this study, we were able to separate a line of MSC into two sub fractions on the basis of CD349 expression. Our transplantation experiments in mice revealed that CD349negative MSC have significant effects on new vessel formation in ischemic regions, while both the CD349-positive and -negative fractions facilitate new bone calcification in fractured femurs. On the basis of these findings, it is proposed that CD349 might be utilized as a specialized MSC marker for arteriogenesis and angiogenesis. Further understanding of the molecular basis of MSC differentiation in vivo might allow for the development of effective cell therapy. Acknowledgments

We thank Dr. Daisuke Nozawa and Ms. Naomi Kaneko for technical advice and excellent work on the immunohistochemistry. We also thank Tania O’Connor for critical reading of the manuscript. Literature Cited Alviano F, Fossati V, Marchionni C, Arpinati M, Bonsi L, Franchina M, Lanzoni G, Cantoni S, Cavallini C, Bianchi F, Tazzari PL, Pasquinelli G, Foroni L, Ventura C, Grossi A, Bagnara GP. 2007. Term Amniotic membrane is a high throughput source for multipotent Mesenchymal Stem Cells with the ability to differentiate into endothelial cells in vitro. BMC Dev Biol 21:7–11. Battula VL, Bareiss PM, Treml S, Conrad S, Albert I, Hojak S, Abele H, Schewe B, Just L, Skutella T, Bu¨ hring HJ. 2007. Human placenta and bone marrow derived MSC cultured in serum-free, b-FGF-containing medium express cell surface frizzled-9 and SSEA-4 and give rise to multilineage differentiation. Differentiation 75:279–291. Battula VL, Treml S, Abele H, Bu¨ hring HJ. 2008. Prospective isolation and characterization of mesenchymal stem cells from human placenta using a frizzled-9-specific monoclonal antibody. Differentiation 76:326–336. Bensidhoum M, Chapel A, Francois S, Demarquay C, Mazurier C, Fouillard L, Bouchet S, Bertho JM, Gourmelon P, Aigueperse J, Charbord P, Gorin NC, Thierry D, Lopez M. 2004. Homing of in vitro expanded Stro-1- or Stro-1þ human mesenchymal stem cells into the NOD/SCID mouse and their role in supporting human CD34 cell engraftment. Blood 103:3313–3319. Bilic G, Zeisberger SM, Mallik AS, Zimmermann R, Zisch AH. 2008. Comparative characterization of cultured human term amnion epithelial and mesenchymal stromal cells for application in cell therapy. Cell Transplant 17:955–968. Bu¨ hring HJ, Battula VL, Treml S, Schewe B, Kanz L, Vogel W. 2007. Novel markers for the prospective isolation of human MSC. Ann NY Acad Sci 1106:262–271. Couffinhal T, Silver M, Zheng LP, Kearney M, Witzenbichler B, Isner JM. 1998. Mouse model of angiogenesis. Am J Pathol 152:1667–1679. Delorme B, Charbord P. 2007. Culture and characterization of human bone marrow mesenchymal stem cells. Methods Mol Med 140:67–81. Faulk WP, Labarrere CA, Carson SD. 1990. Tissue factor: Identification and characterization of cell types in human placentae. Blood 76:86–96. Fleischman RA, Mintz B. 1979. Prevention of genetic anemias in mice by microinjection of normal hematopoietic stem cells into the fetal placenta. Proc Natl Acad Sci USA 76:5736– 5740.

JOURNAL OF CELLULAR PHYSIOLOGY

Fukuchi Y, Nakajima H, Sugiyama D, Hirose I, Kitamura T, Tsuji K. 2004. Human placenta-derived cells have mesenchymal stem/progenitor cell potential. Stem Cells 22:649–658. Gang EJ, Bosnakovski D, Figueiredo CA, Visser JW, Perlingeiro RC. 2007. SSEA-4 identifies mesenchymal stem cells from bone marrow. Blood 109:1743–1751. Heil M, Eitenmu¨ ller I, Schmitz-Rixen T, Schaper W. 2006. Arteriogenesis versus angiogenesis: Similarities and differences. J Cell Mol Med 10:45–55. Ito WD, Arras M, Winkler B, Scholz D, Schaper J, Schaper W. 1997. Monocyte chemotactic protein-1 increases collateral and peripheral conductance after femoral artery occlusion. Circ Res 80:829–837. Jiang W, Ma A, Wang T, Han K, Liu Y, Zhang Y, Zhao X, Dong A, Du Y, Huang X, Wang J, Lei X, Zheng X. 2006. Intravenous transplantation of mesenchymal stem cells improves cardiac performance after acute myocardial ischemia in female rats. Transpl Int 19:570–580. Kawamoto T, Shimizu M. 2000. A method for preparing 2- to 50-mm-thick fresh-frozen sections of large samples and undecalcified hard tissues. Histochem Cell Biol 113:331–339. Kinnaird T, Stabile E, Burnett MS, Lee CW, Barr S, Fuchs S, Epstein SE. 2004. Marrow-derived stromal cells express genes encoding a broad spectrum of arteriogenic cytokines and promote in vitro and in vivo arteriogenesis through paracrine mechanisms. Circ Res 94:678–685. Ko¨ gler G, Sensken S, Airey JA, Trapp T, Mu¨ schen M, Feldhahn N, Liedtke S, Sorg RV, Fischer J, Rosenbaum C, Greschat S, Knipper A, Bender J, Degistirici O, Gao J, Caplan AI, Colletti EJ, Almeida-Porada G, Mu¨ ller HW, Zanjani E, Wernet P. 2004. A new human somatic stem cell from placental cord blood with intrinsic pluripotent differentiation potential. J Exp Med 200:123–135. Koike J, Takagi A, Miwa T, Hirai M, Terada M, Katoh M. 1999. Molecular cloning of Frizzled10, a novel member of the Frizzled gene family. Biochem Biophys Res Commun 262:39–43. Kratchmarova I, Blagoev B, Haack-Sorensen M, Kassem M, Mann M. 2005. Mechanism of divergent growth factor effects in mesenchymal stem cell differentiation. Science 308:1472–1477. Lee OK, Kuo TK, Chen W-M, Lee KD, Hsieh SL, Chen TH. 2004. Isolation of multipotent mesenchymal stem cells from umbilical cord blood. Blood 103:1669–1675. Liu K, Chi L, Guo L, Liu X, Luo C, Zhang S, He G. 2008. The interactions between brain microvascular endothelial cells and mesenchymal stem cells under hypoxic conditions. Microvasc Res 75:59–67. Magatti M, De Munari S, Vertua E, Gibelli L, Wengler GS, Parolini O. 2008. Human amnion mesenchyme harbors cells with allogeneic T-cell suppression and stimulation capabilities. Stem Cells 26:182–192. Martinez C, Hofmann TJ, Marino R, Dominici M, Horwitz EM. 2007. Human bone marrow mesenchymal stromal cells express the neural ganglioside GD2: A novel surface marker for the identification of MSCs. Blood 109:4245–4248. Miki T, Marongiu F, Ellis EC, Dorko K, Mitamura K, Ranade A, Gramignoli R, Davila J, Strom SC. 2009. Production of hepatocyte-like cells from human amnion. Methods Mol Biol 481:155–168. Nagano M, Yamashita T, Hamada H, Ohneda K, Kimura K, Nakagawa T, Shibuya M, Yoshikawa H, Ohneda O. 2007. Identification of functional endothelial progenitor cells suitable for the treatment of ischemic tissue using human umbilical cord blood. Blood 110:151–160. Nagaya N, Fujii T, Iwase T, Ohgushi H, Itoh T, Uematsu M, Yamagishi M, Mori H, Kangawa K, Kitamura S. 2004. Intravenous administration of mesenchymal stem cells improves cardiac function in rats with acute myocardial infarction through angiogenesis and myogenesis. Am J Physiol Heart Circ Physiol 287:H2670–2676. Ohneda O, Ohneda K, Arai F, Lee J, Miyamoto T, Fukushima Y, Dowbenko D, Lasky LA, Suda T. 2001. ALCAM (CD166): Its role in hematopoietic and endothelial development. Blood 98:2134–2142. O’Neill TJ VI, Wamhoff BR, Owens GK, Skalak TC. 2005. Mobilization of bone marrowderived cells enhances the angiogenic response to hypoxia without transdifferentiation into endothelial cells. Circ Res 97:1027–1035. Parolini O, Alviano F, Bagnara GP, Bilic G, Bu¨ hring HJ, Evangelista M, Hennerbichler S, Liu B, Magatti M, Mao N, Miki T, Marongiu F, Nakajima H, Nikaido T, Portmann-Lanz CB, Sankar V, Soncini M, Stadler G, Surbek D, Takahashi TA, Redl H, Sakuragawa N, Wolbank S, Zeisberger S, Zisch A, Strom SC. 2008. Concise review: Isolation and characterization of cells from human term placenta: Outcome of the First International Workshop on Placenta Derived Stem Cells. Stem Cells 26:300–311. Pittenger MF, Martin BJ. 2004. Mesenchymal stem cells and their potential as cardiac therapeutics. Circ Res 95:9–20. Portmann-Lanz CB, Schoeberlein A, Huber A, Sager R, Malek A, Holzgreve W, Surbek DV. 2006. Placental mesenchymal stem cells as potential autologous graft for pre- and perinatal neuroregeneration. Am J Obstet Gynecol 194:664–673. Taguchi K, Ogawa R, Migita M, Hanawa H, Ito H, Orimo H. 2005. The role of bone marrowderived cells in bone fracture repair in a green fluorescent protein chimeric mouse model. Biochem Biophys Res Commun 331:31–36. Takahashi T, Takahashi K, Mernaugh RL, Tsuboi N, Liu H, Daniel TO. 2006. A monoclonal antibody against CD148, a receptor-like tyrosine phosphatase, inhibits endothelial-cell growth and angiogenesis. Blood 108:1234–1242. Tang GL, Chang DS, Sarkar R, Wang R, Messina LM. 2005. The effect of gradual or acute arterial occlusion on skeletal muscle blood flow, arteriogenesis, and inflammation in rat hindlimb ischemia. J Vasc Surg 41:312–320. Urbich C, Dimmeler S. 2004. Endothelial progenitor cells: Characterization and role in vascular biology. Circ Res 95:343–353. Wu X, Huang L, Zhou Q, Song Y, Li A, Jin J, Cui B. 2005. Mesenchymal stem cells participating in ex vivo endothelium repair and its effect on vascular smooth muscle cells growth. Int J Cardiol 105:274–282. Wu Y, Chen L, Scott PG, Tredget EE. 2007. Mesenchymal stem cells enhance wound healing through differentiation and angiogenesis. Stem Cells 25:2648–2659. Yang Z, von Ballmoos MW, Diehm N, Baumgartner I, Kalka C, Santo SD. 2009. Call for a reference model of chronic hind limb ischemia to investigate therapeutic angiogenesis. Vasc Pharmacol 51:268–274. Yen BL, Huang HI, Chien CC, Jui HY, Ko BS, Yao M, Shun CT, Yen ML, Lee MC, Chen YC. 2005. Isolation of multipotent cells from human term placenta. Stem Cells 23:3–9.

235

PAPER (Trần Cẩm Tú) Identification of Human Placenta-derived Mesenchymal Stem Cells involved in ...  

Identification of Human Placenta-derived Mesenchymal Stem Cells involved in Re-Endothelialization.

Read more
Read more
Similar to
Popular now
Just for you