__MAIN_TEXT__

Page 1

[i]


Αγαπητά σαϊτοδέλφινα, σαϊτοδέλφινα Το βιβλίο αυτό το έχω γράψει, γράψει με το μυαλό μου, πάντα πως θα σας βοηθήσω να γράψετε άριστα 20 στο μάθημα της ΒΙΟΛΟΓΙΑΣ. ΒΙΟΛ Οι πανελλήνιες εξετάσεις, εξετάσεις όπως και κάθε μορφή εξέτασης, θέλουν μια στρατηγική προσέγγισης και έναν έξυπνο τρόπο προετοιμασίας προετοιμασίας. Το να μάθεις το βιβλίο "απέξω" δεν θα σε βοηθήσει και πολύ να λύσεις τις ασκήσεις αν δεν έχεις κατανοήσει καλά τις έννοιες της ύλης. Ονόμασα αυτό το βιβλίο "Οδηγό βήμα -βήμα" βήμα" διότι όχι μόνο θα σε βοηθήσει να μάθεις στρατηγικές για να λύνεις ασκήσεις αλλά θα σου δείξει και το σωστό τρόπο να απαντάς σε αυτό που σου ζητά η ερώτηση, χωρίς να χάνεσαι σε ατέλειωτες αιτιολογήσεις αιτιολογήσεις που τελικά δεν χρειάζονται. Η λύση των 300 και πλέον ασκήσεων που υπάρχουν σε αυτό το βιβλίο είναι μια καλή βάση για να περάσεις στο επόμενο βήμα με τις έξυπνες και πονηρές ερωτήσεις*..

*Εεεε φυσικά, θα υπάρξει και συνέχεια σε επόμενο βιβλίο...

[iii]


1. Το Γενετικό Υλικό

[Α-2]


1. Το Γενετικό Υλικό

ΚΥΤΤΑΡΙΚΟΣ ΚΥΚΛΟΣ: ΚΥΚΛ ΧΡΩΜΑΤΙΔΕΣ - ΧΡΩΜΟΣΩΜΑ ΧΡΩΜΟΣΩΜΑΤΑ παρακολουθούμε τις αλλαγές που συμβαίνουν σε ένα μόριο DNA μέχρι να διαιρεθεί (αλλά και στις ονομασίες που το χαρακτηρίζουν)!

κάθε νέο κύτταρο που δημιουργείται, μετά την διαίρεση του αρχικού, επαναλαμβάνει το ίδιο κύκλο

ΜΕΤΑΦΑΣΗ ΜΙΤΩΣΗΣ - 1 χρωμόσωμα - 2 μόριαDNA - (2 ινίδια χρωματίνης) - 2 αδελφές χρωματίδες

 ΑΡΧΗ ΜΕΣΟΦΑΣΗΣ

ΜΕΤΑ ΤΗΝ ΑΝΤΙΓΡΑΦΗ

- 1 χρωμόσωμα - 1 μόριο DNA - 1 ινίδιο χρωματίνης -1 αδελφέςχρωματίδες

- 1 χρωμόσωμα - 2 μόριαDNA - 2 ινίδια χρωματίνης - 2 αδελφές χρωματίδες

προσέξτε τους αριθμούς για το ένα μόριο DNA και τη αλλαγή αριθμών και ονομάτων σε κάθε φάση !!! (αν το κύτταρο έχει περισσότερα μόρια DNA,, π.χ. 46 χρωμοσώματα στο άνθρωπο, ισχύουν τα ίδια x46)

[Α-6]


1. Το Γενετικό Υλικό

Ασκήσεις για λύση στο

1ο κεφάλαιο

1.

Το ποσοστό της αζωτούχου βάσης κυτοσίνης μετρήθηκε σε δύο διαφορετικά δίκλωνα μόρια DNA και βρέθηκε να είναι και στα δύο το ίδιο, 30% C. α. Να υπολογιστεί το ποσοστό των άλλων βάσεων. β. Είναι δυνατόν να έχουν τα δύο μόρια DNA το ίδιο μήκος; γ. Μπορεί να έχουν τον ίδιο αριθμό δεσμών υδρογόνου;

2.

Δύο δίκλωνα μόρια DNA έχουν από 1500νουκλεοτίδια το καθένα. Το ένα όμως εμφανίζει δύο φωσφοδιεστερικούς δεσμούς λιγότερους. Πόσοι είναι οι φ/δ δεσμοί στο κάθε μόριο. Πως δικαιολογείται η διαφορά στους φ/δ δεσμούς;

3.

Σε ένα μόριο νουκλεϊκού οξέος μετρήθηκε το ποσοστό της Α = 51% . Σε ποια κατηγορία οργανισμών μπορεί να ανήκει αυτό το γενετικό υλικό;

4.

Σε ένα τμήμα DNA, η αλληλουχία των αζωτούχων βάσεων είναι η εξής: AAATTTCTAATGCCTGCGCGACGGCATGAAA ΤΤTAAAGAΤΤACGGACGCGCTGCCGTACT T T

Να βρείτε: α. Το σύνολο των δεσμών Η που υπάρχουν σε αυτό το τμήμα DNA. β. Τον αριθμό των φωσφοδιεστερικών δεσμών, γ. Το μήκος του παραπάνω τμήματος DNA.

5.

Ένα μόριο DNA κυττάρου υπολογίστηκε ότι περιέχει 10.000 αζωτούχες βάσεις. Το 30% των βάσεων είναι G. Να υπολογίσετε: α. Τα ποσοστά των Α, Τ και C. β. Τους δεσμούς Η (δΗ) που αναπτύσσονται στο παραπάνω μόριο DNA.

6.

Ένα μόριο DNA κυττάρου περιέχει 3.000 ζεύγη αζωτούχων βάσεων. Υπάρχουν 500 νουκλεοτίδια με βάση την Αδενίνη. Να υπολογίσετε τον αριθμό: α. Των υπόλοιπων αζωτούχων βάσεων, β. Των δεσμών Η . γ. Των φωσφοδιεστερικών δεσμών στο παραπάνω μόριο DNA.

7.

Δύο τμήματα DNA έχουν την εξής αλληλουχία βάσεων: CTGAACCTATG GACTTGGATAC

TCAGGΤ Τ CGCA AGTCCAAGCGT

Ποιο τμήμα είναι σταθερότερο και γιατί. [Α-13]


1. Το Γενετικό Υλικό

8.

Δίκλωνο μόριο DNA περιέχει 100.000 ζεύγη βάσεων. Το ποσοστό των νουκλεοτιδίων με βάση C στο μόριο είναι 30%. Στη μία αλυσίδα του μορίου περιέχονται 13.000 νουκλεοτίδια με βάση A. Να υπολογίσετε: α. τους δεσμούς υδρογόνου που περιέχονται στο μόριο, β. τον αριθμό των νουκλεοτιδίων με βάση Α στην κάθε αλυσίδα του μορίου, γ. το σύνολο των φωσφοδιεστερικών δεσμών στο μόριο.

9.

Μόριο DNA ζωικού κυττάρου έχει 9.998φωσφοδιεστερικοί δεσμοί και 12.000 δεσμοί Η. Ποιος είναι ο αριθμός των νουκλεοτιδίων με καθεμία αζωτούχα βάση;

10.

Δίκλωνο μόριο DNA έχει 3.200 νουκλεοτίδια. Το1/5 από αυτά αντιστοιχούν σε Α. α. Ποιος είναι ο αριθμός των νουκλεοτιδίων με καθεμία αζωτούχα βάση; β. Να καθορίσετε τον αριθμό των δεσμών Η που περιέχονται στο μόριο τουDNA. γ. Να βρείτε τον αριθμό των φωσφοδιεστερικών δεσμών στο μόριο αυτό.

11.

Οι βάσεις G μιας αλυσίδας ενός μορίου DNA είναι 6.000. Το άθροισμα των αζωτούχων βάσεων Α και Τ στην ίδια αλυσίδα είναι 8.000. Αν οι βάσεις G της συμπληρωματικής αλυσίδας είναι 4.000, να βρείτε: α. Τον συνολικό αριθμό των νουκλεοτιδίων και β. τον αριθμό των δεσμών Η που αναπτύσσονται στο μόριο DNA.

12.

Σε δίκλωνο τμήμα DNA 2.000 αζωτούχων βάσεων υπάρχουν 2.700 δεσμοί υδρογόνου. Να βρεθεί ο αριθμός των νουκλεοτιδίων με Α, Τ, G, C.

13.

Σε ένα πλασμίδιο προσδιορίστηκαν 80.000 φωσφοδιεστερικοί δεσμοί και στη μία από τις δύο αλυσίδες, υπολογίστηκαν οι αναλογίες βάσεων: Α 20%, Τ 40%, G 10% και C 30% Να υπολογίσετε: α. την εκατοστιαία αναλογία βάσεων στη συμπληρωματική αλυσίδα, β. την εκατοστιαία αναλογία βάσεων στο μόριο, y. τον αριθμό των δεσμών υδρογόνου στο πλασμίδιο.

14.

Δίκλωνο μόριο DNA μεταξύ των βάσεων του αναπτύσσονται 130.000 δεσμοί υδρογόνου και περιέχει 20% βάσεις θυμίνης. Να υπολογίσετε τον αριθμό των βάσεων αδενίνης που υπάρχουν στο μόριο.

15.

Ένα τμήμα DNA έχει 10 φωσφοδιεστερικούς δεσμούς και 15 δεσμούς υδρογόνου. Πόσες Α, G, C, Τ περιέχει;

[Α-14]


2. Αντιγραφή, Έκφραση και Ρύθμιση της γενετικής πληροφορίας

Βασικές Αιτιολογήσεις … η

αιτιολόγηση 1

Δίνεται η θέση του –ΟΗ ΟΗ σε μια αλυσίδα DNA και μου ζητούν τα άκρα των αλυσίδων

ΟΗ

θα ακολουθήσουμε την εξής σειρά αιτιολογήσεων: 1. ορισμός φ/δ δεσμού 2. φορά πολυνουκλεοτιδικής αλυσίδας 3. αντιπαραλληλία αλυσίδων

Μια πολυνουκλεοτιδική αλυσίδα σχηματίζεται από την ένωση πολλών νουκλεοτιδίων με ομοιοπολικό δεσμό. Ο δεσμός αυτός δημιουργείται μεταξύ του υδροξυλίου του 3΄άνθρακα της πεντόζης του πρώτου νουκλεοτιδίου και της φωσφορικής ομάδας που είναι συνδεδεμένη στον 5΄άνθρακα της πεντόζης του επόμενου νουκλεοτιδίου. Ο δεσμός αυτός ονομάζεται 3΄ 3΄5΄φωσφοδιεστερικός δεσμός. Ανεξάρτητα από τον αριθμό των νουκλεοτιδίων από τα οποία αποτελείται μια πολυνουκλεοτιδική αλυσίδα, αλυσίδα, το πρώτο νουκλεοτίδιο έχει πάντα μια ελεύθερη φωσφορική ομάδα συνδεδεμένη στον 5΄άνθρακα της πεντόζης του και το τελευταίο νουκλεοτίδιο της έχει ελεύθερο το υδροξύλιο του 3΄άνθρακα της πεντόζης του. Για το λόγο αυτό ο προσανατολισμός της πολυνουκλεοτιδικής πολυνουκλεοτιδι αλυσίδας είναι 5΄3΄. Οι δύο κλώνοι ενός μορίου DNA σύμφωνα με το μοντέλο της διπλής έλικας (Watson και Crick) είναι μεταξύ τους αντιπαράλληλοι, δηλαδή απέναντι από το 5΄άκρο ενός κλώνου βρίσκεται το 3΄άκρο του άλλου. συμπέρασμα Η θέση του ΟΗ υποδηλώνει ώνει το 3’άκρο της αλυσίδας. Τα άλλα άκρα διαμορφώνονται ως εξής: 5’

3’

3’

5’

[Α-35]


2. Αντιγραφή, Έκφραση και Ρύθμιση της γενετικής πληροφορίας η

αιτιολόγηση 2

ΟΗ

Με ένα βέλος υποδηλώνεται η φορά μεταγραφής και μου ζητούν κωδική-μη μη κωδική κ στο μόριο DNA.

σειρά αιτιολογήσεων: 1. άκρα 2. φορά μεταγραφής (καθορίζεται από την δράση της RNAπολυμεράσης). 3. σχέση μη κωδικής με φορά μεταγραφής.

(1) άκρα αλυσίδων (όπως στην αιτιολόγηση 1 με τελικό συμπέρασμα...) Η θέση του ΟΗ υποδηλώνει το 3’άκρο της αλυσίδας. Τα άλλα άκρα διαμορφώνονται ως εξής: 5’

3’

3’

5’

(2) Κατά την έναρξη της μεταγραφής ενός γονιδίου η RNA πολυμεράση προσδένεται στον υποκινητή και προκαλεί τοπικό ξετύλιγμα της διπλής έλικας του DNA. Στη συνέχεια, τοποθετεί τα ριβονουκλεοτίδια απέναντι από τα δεοξυριβονουκλεοτίδια μίας αλυσίδας του DNA σύμφωνα ύμφωνα με τον κανόνα της συμπληρωματικότητας των βάσεων, όπως και στην αντιγραφή, με τη διαφορά ότι εδώ απέναντι από την αδενίνη τοποθετείται το ριβονουκλεοτίδιο που περιέχει ουρακίλη. Η RNA πολυμεράση συνθέτει το μόριο του mRNA,, συνδέοντας τα ριβονουκλεο ριβονουκλεοτίδια, που προστίθενται το ένα μετά το άλλο, με 3'-5'φωσφοδιεστερικό 3' δεσμό. Η μεταγραφή, έχει προσανατολισμό 5΄ 5΄ 3΄ και επομένως το mRNA συντίθεται με προσανατολισμό 5'  3' . Το βέλος δείχνει την φορά της μεταγραφής. μεταγραφής Επομένως πομένως θα έχει τον προσανατολισμό 5’3’. 5’

3’

3’

5’

5’

3’

(3) Το mRNA RNA είναι το κινητό αντίγραφο της πληροφορίας ενός γονιδίου. Το μόριο mRNA RNA που συντίθεται είναι συμπληρωματικό (άρα και αντιπαράλληλο) προς τη μία αλυσίδα της διπλής έλικας του DNA του γονιδίου. Η αλυσίδα αυτή του DNA είναι η μεταγραφόμενη αφόμενη και ονομάζεται μη κωδική. Άρα η μη κωδική αλυσίδα είναι η κάτω, καθώς έχει προσανατολισμό αντιπαράλληλο με τον προσανατολισμό της μεταγραφής. [Α-36]


2. Αντιγραφή, Έκφραση και Ρύθμιση της γενετικής πληροφορίας η

αιτιολόγηση 3

Δίνεται η θέση του υποκινητή και του γονιδίου και μου ζητούν κωδική-μη μη κωδική στο μόριο DNA.

Υ

γονίδιο

ΟΗ

σειρά αιτιολογήσεων: 1. άκρα 2. ο υποκινητής καθορίζει την αρχή της μεταγραφής 3. φορά μεταγραφής (καθορίζεται από την δράση της RNAπολυμεράσης). 4. σχέση μη κωδικής με φορά μεταγραφής.

(1) άκρα αλυσίδων (όπως στην αιτιολόγηση 1 με τελικό συμπέρασμα...) Η θέση του ΟΗ υποδηλώνει οδηλώνει το 3’άκρο της αλυσίδας. Τα άλλα άκρα διαμορφώνονται ως εξής: 3’

5’

Υ

3’

5’

(2) Κατά τη μεταγραφή ενός γονιδίου η RNA πολυμεράση προσδένεται σε ειδικές περιοχές του DNA, που ονομάζονται υποκινητές, με τη βοήθεια πρωτεϊνών που ονομάζονται μεταγραφικοί παράγοντες. Οι υποκινητές βρίσκονται πάντα πριν από την αρχή κάθε γονιδίου. (3) (όπως στην αιτιολόγηση 2 με τελικό συμπέρασμα...) συμπέρασμα Η μεταγραφή, έχει προσανατολισμό 5΄ 5΄ 3΄ και επομένως το mRNA συντίθεται με προσανατολισμό 5'  3' . Η θέση του υποκινητή δείχνει δείχνει την αρχή της μεταγραφής. Με το βέλος υποδεικνύεται η φορά της μεταγραφής (προσανατολισμός 5’3’). 5’ 5’ 3’

(4)

3’ Υ 5’’

γονίδιο

5’ 3’’

Το mRNA RNA είναι το κινητό αντίγραφο της πληροφορίας ενός γονιδίου. Το μόριο mRNA RNA που συντίθεται είναι συμπληρωματικό (άρα και αντιπαράλληλο) προ προς τη μία αλυσίδα της διπλής έλικας του DNA του γονιδίου. Η αλυσίδα αυτή του DNA είναι η μεταγραφόμενη και ονομάζεται μη κωδική. συμπέρασμα Η μη κωδική αλυσίδα είναι η κάτω, καθώς έχει προσανατολισμό αντιπαράλληλο με τον προσανατολισμό της μεταγραφής.

[Α-37]


2. Αντιγραφή, Έκφραση και Ρύθμιση της γενετικής πληροφορίας

Λυμένες υποδειγματικές Ασκήσεις

Γενικός κανόνας για το πως απαντάμε. Δίνουμε νουμε στην αρχή (ή στο τέλος) μια συνοπτική "ξεκάθαρη" απάντηση στο ερώτημα της άσκησης και ... μετά δικαιολογούμε (συνήθως αναπτύσσοντας την σχετική του θεωρία που αιτιολογεί και τεκμηριώνει τις απαντήσεις που δώσαμε)

1

Να προσδιοριστούν και δικαιολογηθούν δικαιολογηθούν τα άκρα στην αλυσίδα DNA που δίνεται. Στη συνέχεια να προσδιοριστεί η μη κωδική αλυσίδα. G C C G T A T A G G C T C A T A C A G C T A G A G A T G C C - ΟΗCGGCATATCCGAGTATGTCGATC T CT A CG G φορά μεταγραφής

Λύση άσκησης (1) άκρα αλυσίδων

όπως στην αιτιολόγηση 1

Μια πολυνουκλεοτιδική αλυσίδα σχηματίζεται από την ένωση πολλών νουκλεοτιδίων με ομοιοπολικό δεσμό. Ο δεσμός αυτός δημιουργείται μεταξύ του υδροξυλίου του 3΄άνθρακα της πεντόζης του πρώτου νουκλεοτιδίου και της φωσφορικής ομάδας π που είναι συνδεδεμένη στον 5΄άνθρακα της πεντόζης του επόμενου νουκλεοτιδίου. Ο δεσμός αυτός ονομάζεται 3΄ 3΄5΄φωσφοδιεστερικός δεσμός. Ανεξάρτητα από τον αριθμό των νουκλεοτιδίων από τα οποία αποτελείται μια πολυνουκλεοτιδική αλυσίδα, το πρώτο νουκλεοτίδιο έχει πάντα μια ελεύθερη φωσφορική ομάδα συνδεδεμένη στον 5΄άνθρακα της πεντόζης του και το τελευταίο νουκλεοτίδιο της έχει ελεύθερο το υδροξύλιο του 3΄άνθρακα της πεντόζης του. Για το λόγο αυτό ο προσανατολισμός της πολυνουκλεοτιδικής αλυσίδας είναι 5΄3΄. 5΄ Οι δύο κλώνοι ενός μορίου DNA σύμφωνα με το μοντέλο της διπλής έλικας (Watson και Crick) είναι μεταξύ τους αντιπαράλληλοι, δηλαδή απέναντι από το 5΄άκρο ενός κλώνου βρίσκεται το 3΄άκρο του άλλου. Η θέση του ΟΗ υποδηλώνει το 3’άκρο της αλυσίδας. αλυσίδας Τα άλλα λα άκρα διαμορφώνονται ως εξής: 5’- GCCGTATAGGCTCATACAGCTAGAGATGCC - 3 ’ 3’- CGGCATATCCGAGTATGTCGATC T CT A C G G - 5’ [Α-44]


2. Αντιγραφή, Έκφραση και Ρύθμιση της γενετικής πληροφορίας

(2) φορά μεταγραφής όπως στην αιτιολόγηση 2 (2) Κατά την έναρξη της μεταγραφής ενός γονιδίου η RNA πολυμεράση προσδένεται στον υποκινητή και προκαλεί τοπικό ξετύλιγμα της διπλής έλικας του DNA. Στη συνέχεια, τοποθετεί τα ριβονουκλεοτίδια απέναντι από τα δεοξυριβονουκλεοτίδια μίας αλυσίδας του DNA σύμφωνα με τον κανόνα της συμπληρωματικότητας των βάσεων, όπως και στην αντιγραφή, με τη διαφορά ότι εδώ απέναντι από την αδενίνη τοποθετείται το ριβονουκλεοτίδιο που περιέχει ουρακίλη. Η RNA πολυμεράση συνθέτει το μόριο του mRNA, συνδέοντας τα ριβονουκλεοτίδια, που προστίθενται το ένα μετά το άλλο, με 3'-5'φωσφοδιεστερικό δεσμό. έτσι... Η μεταγραφή, έχει προσανατολισμό 5΄ 3΄ δηλαδή το mRNA συντίθεται με προσανατολισμό 5'  3'. Με το βέλος υποδεικνύεται η φορά της μεταγραφής (προσανατολισμός 5’3’). 5’

3’

(3) σχέση μη κωδικής με φορά μεταγραφής όπως στην αιτιολόγηση 2 (3) TomRNA είναι το κινητό αντίγραφο της πληροφορίας ενός γονιδίου. Το μόριο mRNA που συντίθεται είναι συμπληρωματικό (άρα και αντιπαράλληλο) προς τη μία αλυσίδα της διπλής έλικας του DNA του γονιδίου. Η αλυσίδα αυτή του DNA είναι η μεταγραφόμενη και ονομάζεται μη κωδική. και τελικά... Η μη κωδική αλυσίδα είναι η κάτω, καθώς έχει προσανατολισμό αντιπαράλληλο με τον προσανατολισμό της μεταγραφής.

2

α. Να προσδιοριστούν και δικαιολογηθούν τα άκρα στην αλυσίδα DNA που δίνεται. β. Να προσδιοριστεί η κωδική αλυσίδα για κάθε ένα γονίδιο. Υ

γονίδιο

γονίδιο 1

Υ

3’

Να δικαιολογήσετε τις απαντήσεις σας.

Λύση άσκησης (1) άκρα αλυσίδων

όπως στην αιτιολόγηση 1 .

Η θέση του ΟΗ υποδηλώνει το 3’άκρο της αλυσίδας. Τα άλλα άκρα διαμορφώνονται ως εξής: 5’ 3’

Υ

γονίδιο 1

γονίδιο 2

[Α-45]

Υ

3’ 5’


5. Μενδελική κληρονομικότητα κότητα

5 Η διασταύρωση δύο ποντικών γεννιούνται 12 ποντίκια με μαύρο χρώμα δέρματος μαύρα, 11 με λευκό χρώμα δέρματος και 25 με γκρι χρώμα δέρματος δέρματος. Ποιοι είναι οι φαινότυποι των ατόμων της πατρικής γενιάς και των απογόνων τους Δίνεται ότι ο χρώμα του δέρματος είναι μονογονιδιακή ιδιότητα που ελέγχεται από δύο αλληλόμορφα γονίδια που βρίσκονται σε αυτοσωμικό χρωμόσωμα. χρωμόσωμα. Τα ατελώς επικρατή και τα συνεπικρατή αναγνωρίζονται από την ύπαρξη τριών φαινοτύπων για το ίδιο χαρακτηριστικό. χαρακτηριστικό Τα ετερόζυγα άτομα στα ατελώς επικρατή έχουν έναν ενδιάμεσο φαινότυπο, ενώ στα συνεπικρατή τα ετερόζυγα άτομα Ενδιάμεσος φαινότυπο φαινότυπος προκύπτει εκφράζουν και τα δύο χαρακτηριστικά στο ίδιο άτομο. από διασταύρωση ομόζυγων με διαφορετικό ακραίο φαινότυπο Συμβολίζουμε τα γονίδια με το ίδιο κεφαλαίο γράμμα Α1 και Α2 για τον κάθε χαρακτηριστικό χαρακτηριστικό.

Λύση άσκησης Εμφανίζονται τρεις φαινότυποι για το χρώμα του δέρματος σε αναλογία 1 μαύρο :2 γκρι :1λευκό (με ενδιάμεσο φαινότυπο Α1 Α2 P του μαύρου και λευκού να είναι το γκρί χρώμα) Γκρι δέρμα Επομένως τα γονίδια που ελέγχουν το γνώρισμα γαμέτες Α1 εξετάζονται αν είναι ατελώς επικρατή : F1 Α1 Α1: μαύρο χρώμα δέρματος Α 1Α 1 Α1 Α2: λευκό χρώμα δέρματος Μαύρο

Χ

Α 1Α 2 Γκρι δέρμα Α2 Α2 Α 1Α 2 Γκρι

Το γονίδιο Α1 σε ομοζυγία δίνει μαύρο χρώμα Α 1Α 2 Α 2Α 2 Α2 Γκρι Λευκό (Α1Α1), το άλλο Α2 σε ομοζυγία θα δίνει λευκό χρώμα (Α2), ενώ τα δύο γονίδια σε ετερόζυγη κατάσταση (Α1Α2) θα δώσουν το ενδιάμεσο γκρι χρώμα.

Εεεεε που πάτε.., δεν τελείωσα!

Στα ατελώς επικρατή όσο και στα συνεπικρατή γονίδια, η διασταύρωση ετερόζυγων ατόμων (Α1Α2 Χ Α1Α2) προκύπτουν απόγονοι με φαινοτυπική πική αναλογία 1:2:1 (1 ακραίος : 2 ενδιάμεσος : 1ακραίος) 1ακραίος Από την διασταύρωση ομόζυγων ων μεταξύ τους με τον ίδιο ακραίο φαινότυπο άτομο Α1Α1 Χ Α1Α1 ή Α2Α2 Χ Α2Α2 προκύπτουν ουν άτομα με τον ίδιο φαινότυπο (2 ( ακραίοι φαινότυποι) [Α-108]


5. Μενδελική κληρονομικότητα κότητα

ΟΙ "ΑΝΑΠΟΔΕΣ" ΑΣΚΗΣΕΙΣ Σε αυτή την ειδική κατηγορία ασκήσεων δίνεται η αναλογία φαινοτύπων φαιν της θυγατρικής γενιάς και ζητείται ο τρόπος κληρονόμησης των γονιδίων αυτών και οι γονότυποι των γονέων. Από τις αναλογίες της θυγατρικής γενιάς προσδιορίζουμε τους δες παιδί ... . πιθανούς γονότυπους των ατόμων της πατρικής γενιάς για κάθε βρες γονιό ! χαρακτήρα.

Σχέση απογόνων με το γονότυπο πατρικής γενιάς σε διασταυρώσεις ΜΟΝΟΫΒΡΙΔΙΣΜΟΥ αυτοσωμικών γονιδίων φαινοτυπική αναλογία λογία απογόνων

100% όμοια άτομα

1:1

ΓΟΝΟΤΥΠΟΣ ΓΟΝΕΩΝ ΑΑ αα ΑΑ ΑΑ 1 1 ΚΚ Κ2Κ2 Αα Κ1Κ1 Κ2Κ2

x x x x x x x x x

ΑΑ αα Αα αα Κ1Κ1 Κ2Κ2 αα Κ1Κ2 Κ1Κ2

3:1

Αα x Αα

1:2:1

Κ1Κ2 x Κ1Κ2

1:2

Αα x Αα

[Α-118]

σχέση γονιδίων

επικρατές/υπολειπόμενο

ατελώς επικρατή/συνεπικρατή επικρατές/υπολειπόμενο ατελώς επικρατή/συνεπικρατή επικρατές/υπολειπόμενο ατελώς επικρατή/συνεπικρατή θνησιγόνο γονίδιο


5. Μενδελική κληρονομικότητα κότητα

μια ιδιαίτερη κατηγορία γονιδίων είναι τα ΘΝΗΣΙΓΟΝΑ ΓΟΝΙΔΙΑ

Αυτοσωμικά θνησιγόνα υπολειπόμενα γονίδια γονίδια. Συμβολισμός Α= φυσιολογικό και Αθ= θνησιγόνο 1η περίπτωση Το ετερόζυγο άτομο ΑΑθ έχει ιδιαίτερο φαινότυπο. Αναγνωρίζεται από τη αναλογία 2 : 1, ετερόζυγο : φυσιολογικό που εμφανίζεται στους απογόνους 2η η περίπτωση Εμφανίζεται μόνο ένας φαινότυπος (φυσιολογικός) στους απογόνους. Η απουσία μεταξύ των απογόνων αναμενόμενου φαινότυπου μας υποψιάζει για θνησιγόνο γονίδιο.

Φυλοσύνδετα θνησιγόνα υπολειπόμενα γονίδια γονίδια. Συμβολισμός Χ= φυσιολογικό και Χθ= θνησιγόνο Η ύπαρξη θνησιγόνου φυλοσύνδετου γονιδίου αναγνωρίζεται από την αναλογία 2:1, θηλυκά : αρσενικά (ενώ φυσιολογικά, ο αριθμός των θηλυκών είναι ίσος με τον αριθμό των αρσενικών) .

Στις ασκήσεις διασταυρώσεων τα θνησιγόνα γονίδια,, συνήθως, δεν είναι επικρατή.

Επικρατή θνησιγόνα υπάρχουν; Φυσικά υπάρχουν, είναι γονίδια που εκδηλώνονται κατά τη διάρκεια της ζωής ενός ατόμου (π.χ. η ασθένεια του Huntington Huntington)

[Α-126]


5. Μενδελική κληρονομικότητα

76.

Σε ένα είδος εντόμου το χρώμα των ματιών μπορεί να είναι είτε κόκκινο είτε άσπρο, ενώ το μέγεθος των φτερών είτε φυσιολογικό είτε ατροφικό. Τα χαρακτηριστικά αυτά οφείλονται σε γονίδια που εδράζονται σε διαφορετικά χρωμοσώματα. Στο έντομο αυτό, το φύλο καθορίζεται όπως και στον άνθρωπο. Τα γονίδια για το κόκκινο χρώμα ματιών και το φυσιολογικό μέγεθος φτερών είναι επικρατή και το γονίδιο του μεγέθους των φτερών είναι αυτοσωμικό. Από τη διασταύρωση δύο εντόμων προέκυψαν 800 απόγονοι με τις αναλογίες: 150 θηλυκά με φυσιολογικά φτερά και κόκκινα μάτια 150 αρσενικά με φυσιολογικά φτερά και κόκκινα μάτια 150 θηλυκά με φυσιολογικά φτερά και άσπρα μάτια 150 αρσενικά με φυσιολογικά φτερά και άσπρα μάτια 50 θηλυκά με ατροφικά φτερά και κόκκινα μάτια 50 αρσενικά με ατροφικά φτερά και κόκκινα μάτια 50 θηλυκά με ατροφικά φτερά και άσπρα μάτια 50 αρσενικά με ατροφικά φτερά και άσπρα μάτια Γ1. Να γράψετε τους γονότυπους των γονέων όσον αφορά το μέγεθος των φτερών και να αιτιολογήσετε την απάντηση σας. Γ2. Με βάση τις αναλογίες των απογόνων της συγκεκριμένης διασταύρωσης, να διερευνήσετε τους πιθανούς τρόπους κληρονόμησης του χαρακτήρα για το χρώμα ματιών και να γράψετε τους πιθανούς γονότυπους των γονέων. Γ3. Μερικές φορές οι φαινοτυπικές αναλογίες των απογόνων δεν είναι αυτές που αναμένονται από τους νόμους του Mendel. Να αναφέρετε ονομαστικά 5 τέτοιες περιπτώσεις. ΗΜΕΡΗΣΙΟ 2013

77.

Στη Drosophila υπάρχει ένα είδος τα άτομα του οποίου μπορεί να έχουν μακριές ή κοντές τρίχες σώματος και φυσιολογικά ή ατροφικά φτερά. Από τη διασταύρωση δύο ατόμων προέκυψαν στη θυγατρική γενιά απόγονοι με σταθερή αναλογία 62 με μακριές τρίχες και ατροφικά φτερά, 31 με μακριές τρίχες και φυσιολογικά φτερά, 19 με κοντές τρίχες και ατροφικά φτερά, 12 με κοντές τρίχες και φυσιολογικά φτερά. α. Ποιος ο τύπος κληρονομικότητας για το μέγεθος της τρίχας και το είδος των φτερών. Δικαιολογήστε την επιλογή σας. Τα γονίδια εντοπίζονται σε διαφορετικά χρωμοσώματα. β. Να συμβολίσετε τα γονίδια και να γράψετε τους γονότυπους των ατόμων της πατρικής γενιάς και να γράψετε τη διασταύρωση.

[Α-169]


5. Μενδελική κληρονομικότητα κότητα

78.

Σε ένα χρωμόσωμα της Drosophila melanogaster εντοπίζεται το γονίδιο υπεύθυνο για το μαύρο χρώμα, και στο ομόλογο το αλληλόμορφο γονίδιο για το καστανό. Σε διαφορετικό χρωμόσωμα βρίσκεται το γονίδιο για τη φυσιολογική ανάπτυξη της προβοσκίδας. Στους πληθυσμούς της Drosophila έχει παρατηρηθεί ένα μεταλλαγμένο αλληλόμορφο για την προβοσκίδα, ενώ ζυγωτά που φέρουν μόνο μεταλλαγμένα αλληλόμορφα δεν επιβιώνουν μέχρι τη γέννηση. γ Από τη διασταύρωση δύο ατόμων προέκυψαν στη θυγατρική γενιά τα άτομα: 58 θηλυκά με μαύρο χρώμα και φυσιολογική προβοσκίδα, 21 θηλυκά με καστανό χρώμα και φυσιολογική προβοσκίδα, 29 αρσενικά με μαύρο χρώμα και φυσιολογική προβοσκίδα 11 αρσενικά με καστανό καστανό χρώμα και φυσιολογική προβοσκίδα α. Ποιος ο τύπος κληρονομικότητας για το χρώμα και την ανάπτυξη της προβοσκίδας στις Drosophila. Δικαιολογήστε την επιλογή σας. β. Να γίνει η διασταύρωση.

79.

Στη Drosoplila διασταύρωση ατόμων με καφέ χρώμα και μικρού μικρού μήκους τρίχες δίνει τους παρακάτω απογόνους: 202 άτομα με καφέ χρώμα και μικρού μήκους τρίχες 102 άτομα με καφέ χρώμα και κανονικές τρίχες 101 άτομα με γκρι χρώμα και μικρού μήκους τρίχες 51 άτομα με γκρι χρώμα και κανονικές τρίχες α. Ποιος ο τύπος κληρονομικότητας για το χρώμα και την ανάπτυξη και ποιος ο γονότυπος των γονέων. β. Ποιος είναι ο αριθμός των ατόμων που δεν έχουν επιβιώσει;

80.

Από τη διασταύρωση θηλυκών ποντικών με κίτρινο χρώμα τριχώματος και μέσου μεγέθους πόδια με αρσενικά με κίτρινο κίτρινο χρώμα και κανονικά πόδια γεννήθηκαν: 201 θηλυκά με μαύρο τρίχωμα και κανονικά πόδια. 221 θηλυκά με μαύρο τρίχωμα και κοντά πόδια. 419 θηλυκά με κίτρινο τρίχωμα και κανονικά πόδια. 391 θηλυκά με κίτρινο τρίχωμα και κοντά πόδια. 219 αρσενικά με μαύρο μαύ τρίχωμα και κανονικά πόδια. 428 αρσενικά με κίτρινο τρίχωμα και κανονικά πόδια. Να προσδιορίσετε τον τύπο κληρονομικότητας για κάθε γονίδιο και να παραστήσετε τη διασταύρωση.

[Α-170]


6. Μεταλλάξεις

3 Δίνεται το παρακάτω τμήμα μορίου DNA που κωδικοποιεί ένα ολιγοπεπτίδιο. 5’ -TACATGTCGCGATG TACATGTCGCGATGCAAGTTCTAATC C T C A A T A Τ C T T -3΄ 3’ -ATGTACAGCGCT ATGTACAGCGCTACGTTCAAGATTAGAGTTATΑGAA GAGTTATΑGAA-5΄ Μετά την επίδραση ακτινοβολίας το παραπάνω τμήμα DNA "σπάει σπάει" και το τμήμα που είναι υπογραμμισμένο αποκόπτεται. α. Γράψτε το τμήμα του DNA που αποκόπηκε και σημειώστε τον προσανατολισμό του. β. Το τμήμα του DNA που αποκόπηκε, επανασυνδέεται επ στα ίδια σημεία κοπής μετά από αναστροφή. Γράψτε ράψτε το μόριο του DNA που προκύπτει μετά την αναστροφή. Αιτιολογήστε τε την απάντησή σας. αναφέρουμε το 3'-5' φ/δ δεσμό για να δικαιολογήσουμε το λόγο που πρέπει να περιστραφεί το τμήμα DNA με το συγκεκριμένο τρόπο.

Λύση άσκησης

Τα νουκλεοτίδια μιας αλυσίδας του DNA ενώνονται μεταξύ τους με 3 -́ 5 ́ φωσφοδιεστερικό δεσμό. Ο δεσμός αυτός δημιουργείται μεταξύ του ΟΗ του 3 ́ άνθρακα της πεντόζης ης του ενός νουκλεοτιδίου και της φωσφορικής ομάδας που είναι συνδεδεμένη στον 5 ́ άνθρακα της πεντόζης του επόμενου νουκλεοτιδίου. Για να μπορέσει το τμήμα που αποκόπηκε να επανασυνδεθεί, θα πρέπει να έλθουν σε κατάλληλο προσανατολισμό τα άκρα των νουκλεοτιδίων νουκλεοτιδίων (το 3΄άκρο του ενός νουκλεοτιδίου με το 5’ άκρο του επόμενου νουκλεοτιδίου) . Επομένως θα γίνει μια οριζόντια περιστροφή αλλά και μια κατακόρυφη περιστροφή του τμήματος που αποκόπηκε.

5’ -TACATGTCGCGATGCAAGTTCTAAT TAATCTCAATAΤCTT-3΄ 3’ -ATGTACAGCGCTACGTTCAAGATTA GTTCAAGATTAGAGTTATΑGAA-5΄

αποκοπή

5’ -CAAGTTCTAAT- 3’ 33’ -GTTCAAGATTA- 5’

οριζόντια περιστροφή

1β 4

2

3’ -TAΑTCTTGAAC- 5’ 5’ -ATTAGAACTTG- 3’ 3

5 ́ ΤΑCATGTCGCGATG-3’………………. ………………. 5’-CTCAATAT C T T -3 ́ 3 ́ ATGTΑCΑGCGCTAC-5’………………. ………………. 3΄-GAGTTATAGAA-5’ ́ επανασύνδεση

κατακόρυφη περιστροφή

5’ -ATTAGAACTTG- 3’ 3’ -TAΑTCTTGAAC- 5’

5

5 ́ ΤΑCATGTCGCGATGATTAGAACTTG ATTAGAACTTGCTCAATAT C T T 3 ́ 3 ́ ATGTΑCΑGCGCTACTAΑTCTTGAAC TCTTGAACGAGTTATAGAA 3 ́

[Α-181]


Απαντήσεις στο 1ο κεφάλαιο

Απαντήσεις σε Ασκήσεις 1ου κεφαλαίου 1.

α. Αν είναι δίκλωνο τότε C: 30% , A:20%, T:20%. . β. Τα ποσοστά (%)των αζωτούχων βάσεων είναι ίδια, αλλά ο αριθμός των νουκλεοτιδίων στα δύο μόρια μπορεί να διαφέρει, επομένως δεν είναι απαραίτητο να έχουν το ίδιο μήκος. Επίσης, μπορεί να έχουν τον ίδιο αριθμό νουκλεοτιδίων, αλλά το ένα μόριο να είναι δίκλωνο και το άλλο μονόκλωνο. γ. Το ίδιο ισχύει και με τον αριθμό των δεσμών υδρογόνου.

2.

Αν το δίκλωνο μόριο είναι γραμμικό: 1500 - 2 = 1498 φωσφοδιεστερικοί δεσμοί . Αν το δίκλωνο μόριο είναι κυκλικό: τότε οι φ/δ δεσμοί αριθμητικά ίση με τα νουκλεοτίδια, δηλαδή 1500 φ/δ δεσμοί. Σε κάθε αλυσίδα αναπτύσσεται ένας επιπλέον δεσμός, σε σχέση με το γραμμικό, μεταξύ του τελευταίου και πρώτου νουκλεοτιδίου.

3.

Ο οργανισμός μπορεί να είναι κάποιος ιός με μονόκλωνο DNA ή RNA κάποιου ιού. Το γενετικό υλικό όλων των κυττάρων είναι δίκλωνο DNA, έτσι λόγω συμπληρωματικότητας, και η Τ θα έπρεπε να είναι σε ποσοστό 51%, πράγμα άτοπο.

4.

To τμήμα DNA είναι δίκλωνο και γραμμικό. α. Στο παραπάνω τμήμα υπάρχουν 17 ζεύγη Α-Τ και 14 ζεύγη G-C. Επομένως: 2·17 + 3·14 = 34+ 42 = 76 δΗ. β. Σε κάθε αλυσίδα υπάρχουν 31 νουκλεοτίδια. Επομένως: 31 1 =30 φ.δ. σε κάθε αλυσίδα και 30 2 = 60 φ.δ. στο τμήμα DNA. γ. Το τμήμα DNA είναι δίκλωνο άρα το μήκος του θα είναι 31 ζεύγη βάσεων.

5.

Το μόριο DNA κυττάρου μπορεί να είναι δίκλωνο γραμμικό ή δίκλωνο κυκλικό. (το αποτέλεσμα του αριθμού των βάσεων ή του αριθμού των δΗ είναι το ίδιο και στις δύο περιπτώσεις) α. 30% C, λόγω συμπληρωματικότητας μεταξύ G και C. 100-(30 + 30) = 40% Α και Τ. Άρα 40 :2 = 20% Α και 20% Τ, λόγω συμπληρωματικότητας μεταξύ Α και Τ. β. 10.000 20% = 2.000 Α και 2.000 Τ. 10.000 30% = 3.000 G και 3.000 C. Επομένως οι δΗ στο δίκλωνο μόριο του DNA είναι: 2 2000 + 3 3000 = 4000 + 9000 = 13000 δΗ

6.

 Έστω ότι το μόριο DNA κυττάρου είναι δίκλωνο-γραμμικό: α. 3.000 2 = 6.000 βάσεις συνολικά στο μόριο DNA. 500 Τ, λόγω συμπληρωματικότητας. 6.000 - (500 + 500) = 5.000 G και C. 5.000 : 2 = 2.500 G και 2.500 C, λόγω συμπληρωματικότητας. β. Μεταξύ των Α-Τ αναπτύσσονται 2 δΗ, ενώ μεταξύ των G-C 3 δΗ. Επομένως: 2 · 500 + 3 2.500 = 8.500 δΗ. γ. ορισμός του 3'- 5'φωσφοδιεστερικού δεσμού... 3.000 νουκλεοτίδια σε κάθε αλυσίδα. 3.000 - 1 = 2.999 φ/δ. σε κάθε αλυσίδα, 2 · 2.999 = 5.998 φ/δ. συνολικά στο μόριο DNA.  Έστω ότι το μόριο DNA κυττάρου είναι δίκλωνο - κυκλικό: α. και β. Ισχύει ότι και στην 1η περίπτωση.

[Α-229]

Profile for Mixalis Xalikiopoulos

Βήμα βήμα δείγμα βιβλίου  

Βήμα βήμα δείγμα βιβλίου  

Advertisement