Page 1

LA CÉLULA Y LA BASE FÍSICO-QUÍMICA DE LA VIDA 1. LOS ÁTOMOS Y LAS MOLÉCULAS DE LA VIDA. LOS COMPUESTOS INORGÁNICOS 1. Se sumergen dos células en soluciones de distinta concentración salina (A y B del dibujo): (sep 97 – A1) a) Deduce la concentración relativa de las soluciones A y B. (0,5 Puntos) b) Nombra las estructuras señaladas en el dibujo. (0,5 Puntos) c) Explica el proceso por el cual el agua entra en "A" y sale en "B". (1 Punto)

2. Las sales minerales son esenciales para el mantenimiento de la vida: (sep 98 – A1) a) Respecto al citoplasma celular, definir medio hipertónico y medio hipotónico. (0,5 puntos) b) Explica razonadamente que le ocurriría a una planta si se riega con agua salada. (0,5 puntos) c) Poner un ejemplo, mencionando composición y función, de sales minerales en estado sólido (sales insolubles) presentes en los seres vivos. (1 punto) 3. En relación con las sales minerales: (jun 99 – B1) a) Explica las formas en que se pueden encontrar las sales minerales en los seres vivos, pon un ejemplo de cada una de ellas e indica su función. (1 punto) b) En relación con la célula explica los siguientes términos: medio externo isotónico, medio externo hipertónico, medio externo hipotónico, e indica en qué consiste la ósmosis. (1 punto) 4. Los elementos biogénicos se combinan entre sí para formar biomoléculas (principios inmediatos) que aparecen siempre en la materia viva. (mod 00 – B1) a) Indica las clases de elementos biogénicos y explica sus diferencias. (1 punto) b) Explica los tipos de biomoléculas (principios inmediatos), según su naturaleza química. (1 punto) 5. El agua es la molécula más abundante en la materia viva. (mod 01 – A1) a) Explica dos propiedades del agua. ( 1 punto) b) Explica dos funciones del agua en los seres vivos. (1 punto) 6. En relación con las sales minerales en los organismos vivos: (jun 03 – A1) a) Explica en qué situación las células están turgentes. (0,5 puntos) b) Explica en qué situación las células están plasmolizadas. (0,5 puntos) c) Pon un ejemplo de una sal mineral disuelta y otra precipitada e indica la función de cada una de ellas. (1 punto) 7. En relación con la composición de los seres vivos, define los siguientes términos: (mod 04 – A1) a) Bioelemento o elemento biogénico. (0,5 puntos) b) Biomolécula. (0,5 puntos) Oligoelemento. (0,5 puntos) c) Glúcido. (0,5 puntos) ------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 1 BIOELEMENTOS Y BIOMOLÉCULAS INORGÁNICAS 1


8.

En relación con las sales minerales en los organismos vivos: (sep 06 – B1) a) Explique qué son las sales minerales (0,5 puntos). b) Explique la importancia de las sales minerales en la turgencia celular (0,5 puntos). c) Indique a qué grupo de biomoléculas pertenecen los glúcidos y cite los bioelementos que los constituyen (0,5 puntos). d) Con relación a la proporción en que se encuentran en la materia viva, indique a qué grupo de bioelementos pertenecen los integrantes de los glúcidos. Razone la respuesta. (0,5 puntos)

9.

Para observar el proceso de ósmosis, tres muestras de sangre humana son sometidas a una prueba en el laboratorio: (mod 07 – B1) a) Si se añade agua destilada a una de las muestras, indique qué les sucede a los glóbulos rojos y por qué (0,75 puntos). b) Si se añade una solución saturada de sal a otra de las muestras, indique qué aspecto presentarán los glóbulos rojos al microscopio, cómo se denomina este fenómeno y explique cómo se produce (0,75 puntos). c) Si a la tercera muestra se le añade una solución isotónica explique si se alteraría la forma y función del gló bulo rojo (0,5 puntos).

10. Si un tejido vegetal o animal se introduce en soluciones de diferentes concentraciones osmóticas: (jun 07 – A1) a) ¿Qué ocurriría si la solución utilizada fuera hipotónica? Razone la respuesta (0,5 puntos). b) ¿Qué ocurriría si la solución utilizada fuera hipertónica? Razone la respuesta (0,5 puntos). c) Explique con qué propiedad de la membrana plasmática están relacionadas las respuestas de los apartados anteriores (0,5 puntos). d) Cite dos ejemplos: uno relacionado con la respuesta del apartado a) y otro con la respuesta del apartado b) (0,5 puntos). 11. La salazón es un sistema de conservación de alimentos muy utilizado desde antiguo, y consiste en añadir una considerable cantidad de sal al alimento para preservarlo del ataque de microorganismos que puedan alterarlo. (sep 2010 – B4) a) Explique este hecho de forma razonada (1 punto). b) A finales del siglo XIX se empieza a aplicar otro sistema de conservación de alimentos muy utilizado en la actualidad, descubierto por Louis Pasteur. ¿En qué consiste? (1 punto). 12. Se hacen dos cortes transversales a una zanahoria. Se supone que los dos cortes son bastante finos y del mismo grosor. Se introduce un corte en un recipiente con agua destilada y el otro en un recipiente con agua de mar. Al cabo de un cierto tiempo, se pueden observar cambios en los dos cortes. (mod 2011 – B2) a) Nombre y explique el fenómeno que se produce en las células de la zanahoria del recipiente con agua desti lada (1 punto). b) Nombre y explique el fenómeno que se produce en las células de la zanahoria del recipiente con agua de mar (1 punto). 13. En referencia al agua: (Sep 2013 – A2) a) Describa la estructura de la molécula de agua y razone su acción disolvente (1 punto). b) Defina calor especifico. Razonando las respuestas, indique cómo es el calor especifico del agua e indique su importancia biológica (1 punto). 14. En relación aI agua: (Mod 2014 – B2) a) Explique los conceptos de dipolo eléctrico y de cohesión-adhesión (1 punto). b) Explique el concepto de producto iónico. Clasifique las disoluciones acuosas en base a sus concentraciones iónicas (1 punto). 15. Con relación a la membrana plasmática: (Sep 2014 – B3) a) Señale la composición química de la membrana plasmática de una célula animal (0,5 puntos). b) Indique cuatro funciones de las proteínas de membrana (1 punto). c) ¿Qué ocurriría si introducimos una célula animal en una solución hipertónica? ¿Y en una hipotónica? (0,5 puntos). ------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 1 BIOELEMENTOS Y BIOMOLÉCULAS INORGÁNICAS 2


16. Con relación a la molécula de agua: (Mod 2017 — B1) a) Describa la estructura de la molécula de agua. Explique su carácter dipolar y el tipo de interacciones que se establecen como consecuencia de su polaridad (1 punto). b) Relacione dos propiedades físico—químicas de la molécula de agua con dos funciones biológicas que se deriven de ellas (1 punto). 17. En relación con la base físico-química de la vida: (Jun 2017 - B3) a) Asocie el número asignado a las siguientes propiedades del agua: (1) calor de vaporización y calor específi co altos, (2) capilaridad, (3) la densidad del hielo es menor que la del agua líquida, (4) altos puntos de fusión y de ebullición, con las características identificadas con letras a continuación. No es necesario que copie la tabla (1 punto). A. Se mantiene líquida entre 0º y 100º C B. Papel termo-regulador en los seres vivos C. Facilita el transporte de agua y nutrientes en los organismos D. Facilita la supervivencia de organismos acuáticos en ambientes polares b) Ponga un ejemplo de cada una de las siguientes biomoléculas: glúcido con función de combustible metabólico, lípido con función de reserva energética, ARN con función estructural, proteína con función de defensa (1 punto). 18. Con relación a las células vegetales: (Sep 2017 – B2) a) Señale cuatro componentes químicos de la pared primaria (1 punto). b) ¿Qué ocurriría si introducimos una célula vegetal en una solución hipertónica? ¿Y en una hipotónica? (1 punto). 19. En relación con la base físico-química de la vida: (Jun 17 – B3) a) Asocie el número asignado a las siguientes propiedades del agua: (1) calor de vaporización y calor específi co altos, (2) capilaridad, (3) la densidad del hielo es menor que la del agua líquida, (4) altos puntos de fusión y de ebullición, con las características identificadas con letras a continuación. No es necesario que copie la tabla (1 punto). A. Se mantiene líquida entre 0º y 100º C B. Papel termo-regulador en los seres vivos C. Facilita el transporte de agua y nutrientes en los organismos D. Facilita la supervivencia de organismos acuáticos en ambientes polares b) Ponga un ejemplo de cada una de las siguientes biomoléculas: glúcido con función de combustible metabólico, lípido con función de reserva energética, ARN con función estructural, proteína con función de defensa (1 punto). 20. Con relación a las células vegetales: (Sep 17 – B2) a) Señale cuatro componentes químicos de la pared primaria (1 punto). b) ¿Qué ocurriría si introducimos una célula vegetal en una solución hipertónica? ¿Y en una hipotónica? (1 punto).

------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 1 BIOELEMENTOS Y BIOMOLÉCULAS INORGÁNICAS 3


LA CÉLULA Y LA BASE FÍSICO-QUÍMICA DE LA VIDA 2. LOS GLÚCIDOS 1. Los polisacáridos son macromoléculas presentes en los seres vivos. (mod 99 – A1) a) Concepto de polisacárido (0,5 puntos). b) Cita dos polisacáridos: uno característico de vegetales y otro de animales, indicando su composición y su función (1 punto) c) Indica la localización, dentro de la célula, de cada uno de los ejemplos citados. (0,5 puntos) 2. En relación con los glúcidos: (sep 00 – B1) a) Indica si los siguientes compuestos: sacarosa, almidón, glucógeno y lactosa, son disacáridos o polisacáridos. (1 punto) b) En relación con los compuestos indicados en el apartado anterior, indica en qué tipo de célula, animal o vegetal, se encuentran los homopolisacáridos y cuál es su función. (1 punto) 3. Los glúcidos son biomoléculas que desempeñan diversas funciones esenciales para el organismo. (mod 01 – B1) a) Enumera dos tipos diferentes de glúcidos y pon un ejemplo de cada uno de ellos. (0,5 puntos) b) Enumera dos tipos de asociación entre glúcidos y otras biomoléculas. (0,5 puntos) c) Explica dos de las funciones que desempeñan los glúcidos en el organismo y pon un ejemplo de glúcido en cada una de ellas. (1 punto) 4. Con relación a la célula vegetal: (sep 01 – A1) a) b) c) d)

Explica la composición química de la celulosa. (0,5 puntos) Indica a qué grupo de biomoléculas pertenece la hemicelulosa. (0,5 puntos) Indica la localización de la celulosa en dicha célula. (0,5 puntos) Cita dos biomoléculas presentes en las células, vegetales o animales, con idénticas características químicas a las anteriores. (0,5 puntos)

5. Con relación a los glúcidos: (mod 02 – B1) a) Explica la constitución de los disacáridos. (0,5 puntos) b) Indica si los compuestos que se citan a continuación son monosacáridos, disacáridos o polisacáridos: galac tosa, celobiosa, glucógeno y sacarosa. (1 punto) c) Indica la composición química de la sacarosa y explica si se trata o no de un azúcar reductor. (0,5 puntos) 6. En relación con los glúcidos: (jun 03 – B1) a) Cita una pentosa e indica su función biológica. (0,5 puntos) b) Explica cómo se establece la unión entre los monosacáridos para formar un disacárido. (0,5 puntos) c) Cita un disacárido de interés biológico característico de la célula vegetal y otro de la célula animal e indica los componentes de cada uno de ellos. (1 punto) 7. En relación con la composición de los seres vivos, define los siguientes términos: (mod 04 – A1) a) Bioelemento o elemento biogénico. (0,5 puntos) b) Biomolécula. (0,5 puntos) Oligoelemento. (0,5 puntos) c) Glúcido. (0,5 puntos)

8. En relación con las biomoléculas, explique: (jun 04 – B1) a) b) c) d)

La formación del enlace O-glucosídico (0,5 puntos). La formación del enlace peptídico (0,5 puntos). La formación del enlace que da lugar al nucleósido (0,5 puntos). La formación del enlace que da lugar al nucleótido (0,5 puntos).

--------------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 2 GLÚCIDOS 1


9. En relación con las biomoléculas: (mod 05 – B1) a) Explique los siguientes términos: polisacárido y lípido saponificable. (1 punto) b) Indique un homopolisacárido y un heteropolisacárido, ambos con función estructural. (0,5 puntos) c) En las células animales, cite un lípido saponificable con función estructural y otro con función energética. (0,5 puntos) 10. Muchos seres vivos están constituidos, entre otras, por las siguientes biomoléculas: Glucógeno, fosfolípidos, enzimas y ATP. (sep 05 – A2) a) Relacione cada una de ellas con su principal función biológica (1 punto). b) Indique las unidades estructurales de cada una (1 punto). 11. Referente a las biomoléculas orgánicas: (sep 05 – B1) a) Indique a qué grupo de moléculas biológicas pertenece el ejemplo que se representa y cite la denominación del enlace señalado con la letra A (0,5 puntos).

b) A la vista del ejemplo anterior, indique si el enlace establecido y señalado con la letra A, es monocarbonílico o dicarbonílico. Razone la respuesta (0,75 puntos). c) Cite tres moléculas que pertenezcan al mismo grupo general que el ejemplo del primer apartado (0,75 puntos). 12. Entre las biomoléculas que se citan a continuación: gliceraldehído, celulosa, ribulosa, fructosa, saca rosa, lactosa, almidón y terpenos. (jun 08 – A1) a) Cite aquellas que presentan enlace O-glucosídico y explique la formación del mismo (0,75 puntos). b) ¿Alguna de las biomoléculas citadas no tiene carácter reductor? Razone la respuesta (0,75 puntos). c) Cite una analogía y una diferencia entre la celulosa y el almidón (0,5 puntos). 13. En la composición de los seres vivos: (sep 08 – A1) a) ¿Qué grupo de biomoléculas se caracteriza por presentar enlaces monocarbonílicos? ¿cómo se origina di cho enlace? (0,75 puntos). b) Explique la propiedad que permite a algunos lípidos la formación de las biomembranas. Ponga un ejemplo de un lípido con esta propiedad (0,75 puntos). c) ¿Qué significa la desnaturalización proteica ? (0,5 puntos). 14. De los compuestos celulares que se citan a continuación: ribulosa, hemicelulosa, NADH, FAD +, glucosa, NAD+, CO2, NADP+. (sep 09 – B1) a) Cite cuatro compuestos que estén relacionados directamente con el proceso fotosintético e indique, para cada uno de ellos, su función, la etapa del proceso en la que participan y la localización de ésta a nivel de orgánulo (1 punto). b) Cite dos nucleótidos que estén relacionados directamente con la respiración e indique, para cada uno de ellos, su función, la etapa del proceso en la que participan y la localización de ésta a nivel de orgánulo (0,5 puntos). c) Explique las características químicas de la hemicelulosa y cite su función (0,5 puntos). 15. Entre las macromoléculas que se citan a continuación: ácidos nucleicos, polisacáridos, proteínas y lípidos: (mod 2010 – B1) a) Indique cuáles son los monómeros de las tres primeras macromoléculas y los tipos de enlaces que permiten la formación de cada una de ellas (0,5 puntos). b) ¿Cuáles de ellas pueden tener estructura secundaria? Razone la respuesta (0,5 puntos). c) ¿Qué moléculas de las citadas forman parte de la membrana plasmática? Explique su organización estructural (1 punto). --------------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 2 GLÚCIDOS 2


16. Para la célula eucariota: (jun gen 2010 – A1) a) Explique las características estructurales del Aparato de Golgi (0,5 puntos). b) Explique la participación del Aparato de Golgi en el proceso de formación de la pared celular (0,75 puntos). c) Cite tres polisacáridos de la pared celular e indique la composición química de cada uno de ellos (0,75 pun tos). 17. Algunas células vegetales presentan unas biomoléculas muy características, como la celulosa, la hemicelulosa y el almidón. (sep 2010 – B1) a) Indique las semejanzas y las diferencias más importantes entre la celulosa y el almidón (1 punto). b) Cite una semejanza y una diferencia entre la celulosa y la hemicelulosa (0,5 puntos). c) Explique la importancia biológica de la celulosa en la célula vegetal (0,5 puntos). 18. Los compuestos siguientes están relacionados con la respiración y la fotosíntesis: ribulosa 1,5- bisfosfato, NADH, FADH2, NADP. (sep 2010 – B5) a) Relacione cada uno de los compuestos con el proceso correspondiente y con la etapa del mismo donde par ticipa (1 punto). b) Explique las características químicas del NADP y FADH 2 e indique su función (0,5 puntos). c) Explique las características químicas y la función de la ribulosa 1,5- bisfosfato (0,5 puntos). 19. En relación con los polisacáridos: (jun 2012 - B1) a) Defina homopolisacáridos y heteropolisacáridos, y cite un ejemplo de cada uno de ellos (0,5 puntos). b) Indique un homopolisacárido estructural de origen vegetal, y otro de origen animal, y explique brevemente cuáles son las principales analogías y diferencias que se observan entre la estructura y la función de ambas macromoléculas (1 punto). c) Indique qué tipo de polisacárido es el glucógeno, cuáles son sus principales características estructurales y cuál es su localización en el organismo (0,5 puntos). 20. Con relación a los monosacáridos: (Sep 2014 – B2)

a) Indique a qué grandes grupos de glúcidos pertenecen los monosacáridos representados en las figuras 1 y 2. ¿Qué tipo de estereoisómeros son 3 y 4? ¿Y 3 y 5? (0,75 puntos). b) Cite cuatro propiedades fisicoquímicas de los monosacáridos (0,5 puntos). c) ¿Mediante qué tipo de enlace se unen los monosacáridos para formar glúcidos más complejos? Explique cómo se forma este enlace (0,75 puntos). 21. Referente a las biomoléculas: (jun 2015 - A1) a) Indique las biomoléculas con las que relacionaría los siguientes tipos de enlace: éster, glucosídico, fosfodiéster, peptídico (1 punto). b) Indique la localización en los seres vivos de los siguientes polisacáridos y cite el monosacárido que compone cada uno de ellos: almidón, glucógeno, celulosa y quitina (1 punto). 22. En relación con los glúcidos: (Sep 2015 - B5) a) Defina carbono asimétrico y explique las diferencias entre un enlace O-glucosídico monocarbonílico y dicarbonílico (1 punto). b) Indique la función de los siguientes glúcidos: almidón, glucógeno, celulosa y quitina (1 punto).

--------------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 2 GLÚCIDOS 3


23. Respecto a la pared celular: (Jun 2016 - B5) a) Indique las diferencias entre pared primaria y secundaria de las células vegetales (1 punto). b) Indique la diferencia fundamental entre la pared de las células vegetales y la de los hongos en cuanto a su composición (0,5 puntos). c) Indique qué son los plasmodesmos y qué función tienen (0,5 puntos). 24. En relación con las biomoléculas: (Sep 2016 - A1) a) Defina qué es un monosacárido e indique brevemente tres características que permiten clasificarlos (1 punto). b) Indique el nombre del enlace de unión entre monosacáridos, explicando entre qué grupos se puede producir (1 punto). 25. En relación con las biomoléculas: (Mod 2017 — A3) a) Nombre el enlace entre los distintos aminoácidos para formar una cadena de proteína, indicando los grupos implicados en su formación (0,75 puntos). b) Nombre dos enlaces o interacciones que estabilizan la estructura de las proteínas (0,5 puntos). c) Indique un ejemplo de cada una de las biomoléculas siguientes: polisacárido con función estructural, nucleótido con función coenzimática y proteína con función estructural (0,75 puntos). 26. En relación con la base físico-química de la vida: (Jun 2017 - B3) a) Asocie el número asignado a las siguientes propiedades del agua: (1) calor de vaporización y calor específi co altos, (2) capilaridad, (3) la densidad del hielo es menor que la del agua líquida, (4) altos puntos de fusión y de ebullición, con las características identificadas con letras a continuación. No es necesario que copie la tabla (1 punto). A. Se mantiene líquida entre 0º y 100º C B. Papel termo-regulador en los seres vivos C. Facilita el transporte de agua y nutrientes en los organismos D. Facilita la supervivencia de organismos acuáticos en ambientes polares b) Ponga un ejemplo de cada una de las siguientes biomoléculas: glúcido con función de combustible metabólico, lípido con función de reserva energética, ARN con función estructural, proteína con función de defensa (1 punto). 27. En relación con las biomoléculas: (Sep 2017 - A5) a) Explique cuál es la función de los enzimas en las reacciones biológicas e indique cuál es su naturaleza química (0,75 puntos). b) Indique un ejemplo de cada una de las biomoléculas siguientes: aldohexosa, lípido no saponificable, disacárido, proteína estructural, fosfolípido de membrana (1,25 puntos). 28. Con respecto a los componentes de las células: (Sep 2017 - B4) a) Cite un ejemplo de polisacárido de origen animal y otro de origen vegetal e indique, en cada caso, su fun ción en las células respectivas (1 punto). b) Indique a qué tipo de biomolécula corresponden las siguientes y asócielo con su función: hemoglobina, acti na, NADH, xantofila (1 punto). 29. En relación con las biomoléculas: (Sep 17 – A5) a) Explique cuál es la función de los enzimas en las reacciones biológicas e indique cuál es su naturaleza quí mica (0,75 puntos). b) Indique un ejemplo de cada una de las biomoléculas siguientes: aldohexosa, lípido no saponificable, disacárido, proteína estructural, fosfolípido de membrana (1,25 puntos). 30. Con respecto a los componentes de las células: (Sep 17 – B4) a) Cite un ejemplo de polisacárido de origen animal y otro de origen vegetal e indique, en cada caso, su fun ción en las células respectivas (1 punto). --------------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 2 GLÚCIDOS 4


b) Indique a qué tipo de biomolécula corresponden las siguientes y asócielo con su función: hemoglobina, acti na, NADH, xantofila (1 punto).

--------------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 2 GLÚCIDOS 5


LA CÉLULA Y LA BASE FÍSICO-QUÍMICA DE LA VIDA 3. LOS LÍPIDOS 1.

Lípidos (jun 97 – B1) a) Explica las características generales de los lípidos, señalando los grandes grupos en que se clasifican. (1 punto) b) Qué grupos de lípidos poseen función vitamínica? Pon ejemplos. ( 1 punto)

2.

Lípidos (mod 98 – A1) a) Explica dos funciones biológicas de los lípidos. (1 punto) b) Dibuja un esquema que represente una grasa neutra (acilglicérido) indicando el nombre de las moléculas implicadas y el tipo de enlace. (1 punto)

3.

Los fosfoglicéridos son lípidos complejos que poseen un comportamiento anfipático. (jun 99 – A1) a) Explica su composición química y haz referencia al tipo de enlaces entre sus componentes. (1 punto) b) ¿En qué estructura celular se localizan de forma mayoritaria los fosfoglicéridos?. Explica el “comportamiento anfipático” y su importancia en la organización de esa estructura. (1 punto)

4.

Los lípidos constituyen un grupo de biomoléculas estructural y funcionalmente muy heterogéneo. (jun 00 – A1) a) Describe la estructura general de dos tipos diferentes de lípidos. (1 punto) b) Indica cuatro funciones que desempeñan los lípidos en el organismo. (1 punto)

5.

Los triacilglicéridos o grasas son utilizados en la alimentación humana. (sep 00 – A1) a) Explica su composición química. (0,5 puntos) b) Explica la diferencia, desde el punto de vista químico, entre los aceites (grasas líquidas a temperatura am biente) y los sebos (grasas sólidas a temperatura ambiente). (0,5 puntos) c) Explica en qué consiste la saponificación. (0,5 puntos) d) Menciona dos grupos de lípidos insaponificables. (0,5 puntos)

6.

Relacionado con los lípidos: (sep 02 – B1) a) Explica qué es un lípido saponificable. (0,5 puntos) b) Explica la composición química de los fosfoglicéridos (fosfolípidos). (1 punto) c) Cita la función biológica más importante de los fosfolípidos e indique su disposición en la célula. (0,5 puntos)

7.

En relación con las biomoléculas: (mod 05 – B1) a) Explique los siguientes términos: polisacárido y lípido saponificable. (1 punto) b) Indique un homopolisacárido y un heteropolisacárido, ambos con función estructural. (0,5 puntos) c) En las células animales, cite un lípido saponificable con función estructural y otro con función energética. (0,5 puntos)

8.

Muchos seres vivos están constituidos, entre otras, por las siguientes biomoléculas: Glucógeno, fosfolípidos, enzimas y ATP. (sep 05 – A2) a) Relacione cada una de ellas con su principal función biológica (1 punto). b) Indique las unidades estructurales de cada una (1 punto).

9.

Entre las siguientes macromoléculas: ácidos nucleicos, glúcidos, proteínas y lípidos: (mod 06 – A2) a) Diga cuáles son los respectivos monómeros de las tres primeras macromoléculas y sus correspondientes ti pos de enlace (0,5 puntos). b) Indique cuáles de ellas tienen estructura secundaria. Razone la respuesta (0,5 puntos). c) Diga cuáles de ellas son constitutivas de las membranas celulares. Razone la respuesta (1 punto).

----------------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 3 LÍPIDOS 1


10. Referente a los lípidos: (mod 06 – B1) a) Si se ponen en proporciones, adecuadas: grasas (triacilglicéridos), agua y una base (NaOH o KOH), explique la reacción que tendría lugar, cite su nombre e indique el producto que se obtendría (0,75 puntos). b) Explique cómo se formaría un triacilglicérido (0,5 puntos). c) Cite tres tipos de lípidos e indique la función de cada uno de ellos (0,75 puntos). 11. Los lípidos son componentes esenciales de las membranas naturales: (jun 06 – B1) a) Indique dos lípidos que se encuentren en ellas (0,5 puntos). b) Indique cuál es la polaridad de estas moléculas y explique su repercusión en la formación de la membrana (1 punto). c) Los lípidos de membrana pueden asociarse a otras biomoléculas. Indique a cuáles y señale su localización en la membrana (0,5 puntos). 12. Todos los seres vivos presentan lípidos en su composición. (sep 07 – A1) a) ¿Qué es un lípido? Según su estructura molecular, cite los tipos de lípidos y explique las diferencias entre ellos (1 punto). b) Indique a qué tipo de lípido de los respondidos en el apartado anterior, pertenecen los fosfolípidos y descri ba su composición química (0,5 puntos). c) ¿Por qué los fosfolípidos son moléculas anfipáticas? Razone la respuesta (0,5 puntos) 13. En la composición de los seres vivos: (sep 08 – A1) a) ¿Qué grupo de biomoléculas se caracteriza por presentar enlaces monocarbonílicos? ¿cómo se origina di cho enlace? (0,75 puntos). b) Explique la propiedad que permite a algunos lípidos la formación de las biomembranas. Ponga un ejemplo de un lípido con esta propiedad (0,75 puntos). c) ¿Qué significa la desnaturalización proteica ? (0,5 puntos). 14. Las grasas son moléculas orgánicas presentes en todos los seres vivos con una gran heterogeneidad de funciones. (jun 09 – B1) a) Indique la composición química de un triacilglicérido de origen vegetal y explique su formación (1 punto). b) La obtención del jabón se basa en una reacción en la que intervienen algunos lípidos; explique esta reacción e indique cómo se denomina. Justifique si el aceite de oliva empleado en la cocina podría utilizarse para la obtención de jabón (1 punto). 15. Entre las macromoléculas que se citan a continuación: ácidos nucleicos, polisacáridos, proteínas y lípidos: (mod 2010 – B1) a) Indique cuáles son los monómeros de las tres primeras macromoléculas y los tipos de enlaces que permiten la formación de cada una de ellas (0,5 puntos). b) ¿Cuáles de ellas pueden tener estructura secundaria? Razone la respuesta (0,5 puntos). c) ¿Qué moléculas de las citadas forman parte de la membrana plasmática? Explique su organización estructural (1 punto). 16. Con relación a los lípidos: (jun esp 2010 – B1) a) Nombre un tipo de lípido con función estructural. Indique su localización celular (0,5 puntos). b) Nombre un lípido con función hormonal. Escriba la glándula hormonal que lo segrega (0,5 puntos). c) Nombre un ejemplo de lípido con función energética o de reserva. Indique su localización en un ser vivo (0,5 puntos). d) Nombre un ejemplo de lípido con función vitamínica. Indique un proceso biológico en el que intervenga (0,5 puntos). 17. Las vitaminas tienen una variada y diferente composición química. (mod 2011 – A5) a) Explique el concepto de vitamina y nombre dos vitaminas hidrosolubles y dos liposolubles. ¿Qué se entien de por avitaminosis? (1 punto). b) Escriba tres ejemplos de vitaminas que sean derivados del terpeno, y otro ejemplo que sea derivado de los esteroides (1 punto).

----------------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 3 LÍPIDOS 2


18. Con referencia a los lípidos: (jun 2011 - B5) a) Describa brevemente cuáles son las propiedades químicas de los ácidos grasos (0,5 puntos). b) El esquema que se muestra representa con fórmulas generales como se desarrolla una importante reacción de las grasas. Indique los nombres de los compuestos reaccionantes (señalados como 1 y 2) y el del producto final de la reacción, señalado como 3. ¿Cómo se denomina esta reacción? (1 punto). c) Grasas y ceras. Indique cuáles son las funciones que realizan estos dos tipos de lípidos, y señale un ejemplo de cada unos de ellos (0,5 puntos).

19. Acerca de las propiedades de los fosfolípidos: (Sept 2011 – A4) a) Describa las características fundamentales de dichas moléculas, y señale las diferencias con las moléculas que constituyen las grasas (0,5 puntos). b) Explique cómo se establece la interacción de los fosfolípidos con el agua, y mencione dos ejemplos de las posibles estructuras en que se organizan (0,5 puntos). c) Explique brevemente cuál es la función de los fosfolípidos en la célula, indicando con qué otros tipos de compuestos tienen que interaccionar para ejercer dicha función (1 punto). 20. Referente a las biomoléculas: (Sept 2011 – B4) a) Indique a qué tipo de biomolécula pertenece el colesterol, y explique por qué es insaponificable (0,5 puntos). b) Indique la localización del colesterol en la célula y explique brevemente su función biológica (0,5 puntos). c) Una de las vitaminas está relacionada químicamente con la molécula de colesterol. Indique cuál es dicha vi tamina y qué enfermedad se produce por su carencia (0,5 puntos). d) Enumere otros dos tipos de moléculas de esteroides derivadas del colesterol, indicando su función biológica (0,5 puntos). 21. En relación con los fosfoglicéridos: (Mod 2012 – B2) a) Nombre los tipos de moléculas que intervienen en su formación y señale su localización celular (1 punto). b) Explique y localice el carácter anfipático de la molécula de un fosfoglicérido (1 punto). 22. Los lípidos son un grupo muy heterogéneo de biomoléculas que desempeñan importantes funciones biológicas: (Jun 2014 – A4) a) Explique las diferencias entre los lípidos saponificables y los insaponificables (0,5 puntos). b) Indique los tipos de lípidos saponificables que se pueden encontrar en los seres vivos y su importancia biológica (1 punto). c) Indique dos tipos de lípidos insaponiflcables que se pueden encontrar en los seres vivos y las moléculas de las cuales derivan químicamente (0,5 puntos). 23. En relación con la estructura de las biomoléculas: (Jun 2016 – B4) a) Defina ácido graso, triacilglicérido y fosfolípido (1,5 puntos). b) Indique cuál o cuáles de las moléculas del apartado anterior son anfipáticas y porqué (0,5 puntos). 24. En relación con las biomoléculas: (Sep 17 – A5) a) Explique cuál es la función de los enzimas en las reacciones biológicas e indique cuál es su naturaleza quí mica (0,75 puntos). b) Indique un ejemplo de cada una de las biomoléculas siguientes: aldohexosa, lípido no saponificable, disacárido, proteína estructural, fosfolípido de membrana (1,25 puntos). 25. Con respecto a los componentes de las células: (Sep 17 – B4) a) Cite un ejemplo de polisacárido de origen animal y otro de origen vegetal e indique, en cada caso, su fun ción en las células respectivas (1 punto). b) Indique a qué tipo de biomolécula corresponden las siguientes y asócielo con su función: hemoglobina, actina, NADH, xantofila (1 punto). ----------------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 3 LÍPIDOS 3


26. En relación con los lípidos: (Mod 2018 - B3) a) Describa la estructura química de los triacilglicéridos relacionándola con su función biológica (1 punto). b) Describa la estructura química de los glicerofosfolípidos relacionándola con su función biológica (1 punto).

----------------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 3 LÍPIDOS 4


LA CÉLULA Y LA BASE FÍSICO-QUÍMICA DE LA VIDA 4. LAS PROTEÍNAS. ACCIÓN ENZIMÁTICA 1.

Las proteínas son importantes componentes moleculares de los seres vivos. (mod 97 – B1) a) Cita las principales funciones biológicas de las proteínas. (1 punto) b) Explica el tipo de enlace por el que las unidades constituyentes de las proteínas se unen, poniendo un ejem plo. (1 punto)

2.

Proteínas: (jun 97 – A1) a) La compleja estructura de las proteínas se forma por sucesivos plegamientos de la cadena de aminoácidos. Explica a qué se deben y en qué consisten los llamados plegamientos al azar, en lámina β y en hélice α. (1 punto) b) Al calor, la clara de huevo liquida se vuelve sólida siendo el proceso irreversible. Razona por qué. (1 punto)

3.

En el esquema se representa la molécula de la lisozima: (sep 97 – B1)

a) ¿De qué tipo de molécula se trata y qué tipo de estructura presenta? (1 Punto) b) ¿Cómo se llaman las subunidades representadas por círculos y qué tipo de enlace las une? (0,5 Puntos) c) ¿De qué depende el que las subunidades se unan en ese y no en otro orden? (0,5 Puntos)

4.

(jun 98 – A1)

a) b) c) d) 5.

¿Qué representa la anterior molécula? (0,5 puntos) ¿Qué tipo de enlace une las distintas unidades? (0,5 puntos) Pon 2 ejemplos de macromoléculas con éste tipo de enlace (0,5 puntos) Cita alguna de las funciones biológicas de estas macromoléculas (0,5 puntos)

En relación con la estructura de las proteínas: (sep 99 – B1) a) Define en qué consiste la estructura primaria de una proteína. (0,5 puntos) b) Menciona dos tipos de estructuras secundarias y señala qué tipo de enlaces mantienen estas estructuras. (0,5 puntos) c) Explica en qué consiste la estructura cuaternaria de las proteínas y mencione un ejemplo. (0,5 puntos) d) Indica cómo se denomina el proceso por el que una proteína pierde su estructura terciaria o globular y cita una causa que lo desencadene. (0,5 puntos)

6.

Los enzimas participan de forma clave en todas las reacciones metabólicas. (mod 00 – A1) a) Defina brevemente los conceptos de enzima y coenzima.(1 punto) b) Explica dos características de las enzimas. (0,5 puntos) c) Defina el concepto de vitamina. (0,5 puntos)

-------------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 4 PROTEÍNAS 1


7.

Con relación a las enzimas y vitaminas: (jun 01 – A1) a) Explica los siguientes términos: enzima, cofactor, coenzima y vitamina. (1 punto) b) Cita dos vitaminas mencionando en cada caso una anomalía carencial, e indica si son liposolubles o hidrosolubles. (1 punto)

8.

En relación con las proteínas: (sep 03 – A1) a) Explica su estructura primaria y secundaria. (1 punto) b) Explica en qué consiste la desnaturalización y la renaturalización proteica. (0,5 puntos) c) Cite dos factores que pueden causar la desnaturalización. (0,5 puntos)

9.

En relación con las biomoléculas, explique: (jun 04 – B1) a) b) c) d)

La formación del enlace O-glucosídico (0,5 puntos). La formación del enlace peptídico (0,5 puntos). La formación del enlace que da lugar al nucleósido (0,5 puntos). La formación del enlace que da lugar al nucleótido (0,5 puntos).

10. En el metabolismo de los seres vivos: (sep 04 – A2) a) Indique qué es un coenzima y qué papel desempeña (1 punto). b) Ponga un ejemplo de un coenzima oxidado e indique una ruta metabólica en la que actúe (0,5 puntos). c) Explique qué ocurre con los coenzimas reducidos en la cadena respiratoria (0,5 puntos). 11. Con referencia a las proteínas: (jun 05 - B1) a) Defina estructura terciaria y cuaternaria de una proteína (0,5 puntos). b) Explique el significado del término "desnaturalización" aplicado a las proteínas (0,5 puntos). c) Diga cuatro funciones de las proteínas indicando un ejemplo en cada caso (1 punto). 12. Muchos seres vivos están constituidos, entre otras, por las siguientes biomoléculas: Glucógeno, fosfolípidos, enzimas y ATP. (sep 05 – A2) a) Relacione cada una de ellas con su principal función biológica (1 punto). b) Indique las unidades estructurales de cada una (1 punto). 13. Entre las siguientes macromoléculas: ácidos nucleicos, glúcidos, proteínas y lípidos. (mod 06 – A2) a) Diga cuáles son los respectivos monómeros de las tres primeras macromoléculas y sus correspondientes ti pos de enlace (0,5 puntos). b) Indique cuáles de ellas tienen estructura secundaria. Razone la respuesta (0,5 puntos). c) Diga cuáles de ellas son constitutivas de las membranas celulares. Razone la respuesta (1 punto). 14. En relación con las proteínas. (mod 08 – A1) a) ¿Qué es una proteína? Explique su formación (0,75 puntos). b) ¿Qué es la estructura primaria de la proteína?, ¿por qué es importante? Razonando la respuesta, explique su relación con el ADN (0,75 puntos). c) Cite dos funciones de las proteínas y ponga un ejemplo en cada caso (0,5 puntos). 15. En la composición de los seres vivos: (sep 08 – A1) a) ¿Qué grupo de biomoléculas se caracteriza por presentar enlaces monocarbonílicos? ¿cómo se origina di cho enlace? (0,75 puntos). b) Explique la propiedad que permite a algunos lípidos la formación de las biomembranas. Ponga un ejemplo de un lípido con esta propiedad (0,75 puntos). c) ¿Qué significa la desnaturalización proteica ? (0,5 puntos). 16. Las proteínas son macromoléculas esenciales en los seres vivos: (mod 09 – A1) a) Explique los distintos tipos de estructuras que existen en las proteínas (1 punto). b) Suponga que dispone de albúmina de huevo en un tubo de ensayo. Diseñe cuatro experiencias físicas o químicas sencillas que alteren la conformación nativa de esa proteína y explique brevemente el porqué de la alteración en cada caso (1 punto). -------------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 4 PROTEÍNAS 2


17. Entre las macromoléculas que se citan a continuación: ácidos nucleicos, polisacáridos, proteínas y lípidos: (mod 2010 – B1) a) Indique cuáles son los monómeros de las tres primeras macromoléculas y los tipos de enlaces que permiten la formación de cada una de ellas (0,5 puntos). b) ¿Cuáles de ellas pueden tener estructura secundaria? Razone la respuesta (0,5 puntos). c) ¿Qué moléculas de las citadas forman parte de la membrana plasmática? Explique su organización estructural (1 punto). 18. Las vitaminas tienen una variada y diferente composición química. (mod 2011 – A5) a) Explique el concepto de vitamina y nombre dos vitaminas hidrosolubles y dos liposolubles. ¿Qué se entien de por avitaminosis? (1 punto). b) Escriba tres ejemplos de vitaminas que sean derivados del terpeno, y otro ejemplo que sea derivado de los esteroides (1 punto). 19. En relación a las proteínas globulares: (Mod 2013 – A3) a) Explique brevemente en qué consiste la estructura terciaria de las proteínas (0,5 puntos). b) Indique cuatro funciones biológicas desempeñadas por proteínas globulares, señalando un ejemplo de proteína en cada caso (1 punto). c) Describa brevemente el proceso de desnaturalización de las proteínas. Mencione, aplicando un caso práctico, un caso de desnaturalización, indicando qué tipo de agente lo provoca y qué influencia tiene sobre la función biológica de la proteína (0,5 puntos). 20. Con relación a las enzimas y vitaminas: (Mod 2015 – B3) a) Defina enzima e indique a qué grupo de biomoléculas pertenecen (0,5 puntos). b) Defina cofactor y coenzima. Ponga un ejemplo de cada uno de ellos (0,5 puntos). c) Defina vitamina, indique los tipos de vitaminas que hay y ponga dos ejemplos de cada una de ellas (1 pun to). 21. Con relación a las vitaminas y proteínas. (Mod 2016 – B1) a) Defina vitamina, indique los dos grandes grupos de vitaminas que conocemos y cite un ejemplo de cada grupo (1 punto). b) Defina estructura terciaria de una proteína e indique dos tipos de enlaces que mantienen dicha estructura (1 punto). 22. En relación con las biomoléculas: (Mod 2017 — A3) a) Nombre el enlace entre los distintos aminoácidos para formar una cadena de proteína, indicando los grupos implicados en su formación (0,75 puntos). b) Nombre dos enlaces o interacciones que estabilizan la estructura de las proteínas (0,5 puntos). c) Indique un ejemplo de cada una de las biomoléculas siguientes: polisacárido con función estructural, nucleótido con función coenzimática y proteína con función estructural (0,75 puntos). 23. En relación con las biomoléculas: (Sep 17 – A5) a) Explique cuál es la función de los enzimas en las reacciones biológicas e indique cuál es su naturaleza quí mica (0,75 puntos). b) Indique un ejemplo de cada una de las biomoléculas siguientes: aldohexosa, lípido no saponificable, disacárido, proteína estructural, fosfolípido de membrana (1,25 puntos). 24. Con respecto a los componentes de las células: (Sep 17 – B4) a) Cite un ejemplo de polisacárido de origen animal y otro de origen vegetal e indique, en cada caso, su fun ción en las células respectivas (1 punto). b) Indique a qué tipo de biomolécula corresponden las siguientes y asócielo con su función: hemoglobina, acti na, NADH, xantofila (1 punto).

-------------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 4 PROTEÍNAS 3


LA CÉLULA Y LA BASE FÍSICO-QUÍMICA DE LA VIDA 5. LOS NUCLEÓTIDOS Y LOS ÁCIDOS NUCLEICOS Las preguntas sobre replicación del ADN están en el tema 14 de Genética molecular 1.

Ácidos nucleicos: (mod 97 – A1) a) Nombra las unidades estructurales que los forman y los enlaces que las unen. (0,5 puntos) b) Explica las diferencias químicas y estructurales de los dos tipos de ácidos nucleicos. (1 punto) c) Menciona al menos una localización de cada tipo de ácido nucleico. (0,5 puntos)

2.

Ácidos nucleicos. (mod 97 – B4) a) Explica con detalle el proceso de síntesis de ARN en el núcleo de una célula. (1 punto) b) Indica tres tipos de ARN señalando el papel que desempeñan en la síntesis de proteínas. (0,5 puntos) c) Escribe la secuencia de ARN que se transcribiría utilizando como molde la secuencia inferior del ADN en el dibujo. (0,5 puntos)

3.

Cromosoma metafásico: (sep 97 – A2) a) Explica cómo se condensa y empaqueta la molécula de DNA cuando pasa de profase a metafase durante la mitosis. (1 Punto) b) Dibuja un cromosoma metafásico, y señala una cromátida, el centrómero, un telómero y un brazo. (1 Punto)

4.

Independientemente de la longitud y secuencia específica de un ADN de doble cadena: (jun 98 – B3) a) ¿Qué bases nitrogenadas podríamos encontrar? (0,5 puntos) b) ¿Qué relaciones cuantitativas existirían entre dichas bases? (1 punto) c) ¿Se cumplirían estas relaciones para el caso de un ADN de cadena sencilla? Razona tu respuesta. (0,5 puntos)

5.

El ácido ribonucleico (ARN) es una macromolécula presente en los seres vivos. (mod 99 – A3) a) Explica la composición del ARN. (0,5 puntos) b) Indica los tipos de ARN que conozca, explicando la función de cada uno de ellos. (1 punto) c) ¿En qué estructuras de la célula se encuentra ARN de forma significativa? (0,5 puntos)

6.

En la célula vegetal, la formación de ATP tiene lugar durante determinados procesos metabólicos. (mod 00 – A2) a) Explica las características químicas del ATP, y cita los enlaces entre sus componentes y señala su importancia en el metabolismo celular. (1 punto) b) Indica en qué procesos se produce la síntesis de ATP y señala los lugares de la célula dónde suceden. (1 punto)

7.

El siguiente fragmento de una cadena de ADN representa el inicio de un gen: (mod 00 – A4) 3' TACCCGAGATGT....... 5' a) Determina la secuencia de bases de su ARN mensajero e indica su polaridad. (0,5 puntos) b) Determina la secuencia de bases de la cadena complementaria de ADN e indica su polaridad. (0,5 puntos) c) ¿En qué componentes se diferencian el ADN y el ARN? (1 punto)

8.

El adenosín trifosfato o ATP es una molécula central en el metabolismo celular. (jun 00 – B1) a) Describe su estructura general y explica la importancia del ATP en el metabolismo. (1 punto) b) En una célula vegetal, indica en qué orgánulos se realiza mayoritariamente la síntesis de ATP y menciona el nombre de los procesos de síntesis. (1 punto).

------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 5 ÁCIDOS NUCLEICOS 1


9.

En relación con el ácido desoxirribonucléico (ADN): (mod 01 – A4) a) ¿Cuál es la composición química del ADN? (0,5 puntos) b) Indica la importancia biológica de la estructura primaria del ADN. (0,5 puntos) c) Explica el modelo de la doble hélice de ADN (Watson y Crick). (1 punto)

10. El dogma central de la biología molecular se puede representar esquemáticamente de la siguiente manera: (mod 01 – B4) ADN → ARN → proteína a) Indica las diferencias que existen entre la composición y estructura del ADN y del ARN. (1 punto) b) Indica el nombre de los procesos ADN  ARN y ARN  Proteína e indica en qué parte de la célula eucariótica se producen. (0,5 puntos) c) Menciona tres tipos distintos de ARN y cita el proceso que permite el paso de ARN a ADN. (0,5 puntos) 11. Con relación a la biosíntesis de proteínas en células eucarióticas: (jun 01 – B4) a) Menciona el nombre del proceso e indica su localización celular. (0,5 puntos) b) Indica el nombre de la molécula que lleva el codón y el nombre de la molécula que lleva el anticodón. (0,5 puntos) c) Indica la función del ARN transferente en este proceso y explica la relación entre su estructura y su función. (1 punto) 12. Con relación a los ARN de células eucarióticas: (sep 01 – B4) a) Indica las clases de ARN que conozcas. (0,75 puntos) b) Explica la función de cada uno de ellos. (0,75 puntos) c) Explica brevemente el proceso de maduración del ARN. (0,5 puntos) 13. Con relación al proceso de replicación del ADN: (sep 02 – B4) a) Nombra las proteínas y enzimas que intervienen en la etapa de desenrollamiento y apertura de la doble hélice y explica sus funciones. (1,5 puntos) b) Explica dos diferencias en el proceso de replicación del ADN en organismos procarióticos y eucarióticos. (0,5 puntos) 14. En relación con el material hereditario: (mod 04 – A4) a) Indica semejanzas y diferencias en cuanto a la composición química del ADN y ARN. (1 punto) b) Define el concepto de gen a nivel molecular e indica en qué se diferencian los genes de procariotas y euca riotas. (0,5 puntos) c) Define los términos exón e intrón. (0,5 puntos) 15. En relación con las biomoléculas, explique: (jun 04 – B1) a) b) c) d)

La formación del enlace O-glucosídico (0,5 puntos). La formación del enlace peptídico (0,5 puntos). La formación del enlace que da lugar al nucleósido (0,5 puntos). La formación del enlace que da lugar al nucleótido (0,5 puntos).

16. Respecto al ATP: (sep 04 – B1) a) Indique el grupo de moléculas al que pertenece y cuál es su papel metabólico (0,5 puntos). b) Explique las posibles formas de síntesis de ATP (1 punto). c) Indique dos rutas metabólicas donde se obtenga ATP (0,5 puntos.)

------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 5 ÁCIDOS NUCLEICOS 2


17. Referente al material hereditario: (jun 05 - B4) a) Copie y complete la tabla que aparece a continuación y que corresponde a las cadenas complementarias de un fragmento de ADN. Utilice las letras: P para el ácido fosfórico, S para la pentosa (2'desoxirribos, A para adenina, C para citosina, G para guanina y T para timina. Indique, en cada caso, el número de puentes de hidrógeno que se establecen entre las dos bases nitrogenadas (1 punto). Cadena 1

Número de puentes de hidrógeno

Cadena 2

P

S

A

¿?

-

S

-

-

-

-

¿?

G

-

-

-

-

C

¿?

-

-

P

-

-

¿?

T

S

-

b) Al analizar las proporciones de bases nitrogenadas de un fragmento monocatenario de ADN humano los re sultados fueron los siguientes: 27% de A, 35% de G, 25% de C y 13% de T. Indique cuál será la proporción de bases de la cadena complementaria (0,5 puntos). c) Respecto a su composición química, cite las diferencias existentes entre una molécula de ADN y una de ARN (0,5 puntos). 18. Muchos seres vivos están constituidos, entre otras, por las siguientes biomoléculas: Glucógeno, fosfolípidos, enzimas y ATP. (sep 05 – A2) a) Relacione cada una de ellas con su principal función biológica (1 punto). b) Indique las unidades estructurales de cada una (1 punto). 19. Entre las siguientes macromoléculas: ácidos nucleicos, glúcidos, proteínas y lípidos. (mod 06 – A2) a) Diga cuáles son los respectivos monómeros de las tres primeras macromoléculas y sus correspondientes ti pos de enlace (0,5 puntos). b) Indique cuáles de ellas tienen estructura secundaria. Razone la respuesta (0,5 puntos). c) Diga cuáles de ellas son constitutivas de las membranas celulares. Razone la respuesta (1 punto). 20. La molécula de ADN es portadora de información: (mod 07 – A4) a) Indique el nombre de los autores que propusieron el modelo de la doble hélice y cite tres características de dicho modelo (1 punto). b) Dado el siguiente fragmento de ARN m: 5´ AUGCUAGCGAAA 3´, indique, razonando la respuesta, la molécula de ADN de la que procede y cite dos diferencias entre ambos ácidos nucleicos (1 punto). 21. El NAD es un compuesto esencial en el metabolismo: (mod 08 – A2) a) Indique la naturaleza química del mismo y explique brevemente su función (1 punto). b) Escriba las formas reducida y oxidada del NAD y ponga un ejemplo de una reacción metabólica en la que esta molécula se obtenga en forma reducida y otra en la que se obtenga de forma oxidada (1 punto). 22. Entre las macromoléculas que se citan a continuación: ácidos nucleicos, polisacáridos, proteínas y lípidos: (mod 2010 – B1) a) Indique cuáles son los monómeros de las tres primeras macromoléculas y los tipos de enlaces que permiten la formación de cada una de ellas (0,5 puntos). b) ¿Cuáles de ellas pueden tener estructura secundaria? Razone la respuesta (0,5 puntos). c) ¿Qué moléculas de las citadas forman parte de la membrana plasmática? Explique su organización estructural (1 punto). 23. Con relación a la traducción del mensaje genético: (sep 2010 – A2) a) Indique los distintos tipos de ARN (0,5 puntos). b) Describa la función que desempeña en la célula cada tipo de ARN (1,5 puntos).

------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 5 ÁCIDOS NUCLEICOS 3


24. Los compuestos siguientes están relacionados con la respiración y la fotosíntesis: ribulosa 1,5- bisfosfato, NADH, FADH2, NADP. (sep 2010 – B5) a) Relacione cada uno de los compuestos con el proceso correspondiente y con la etapa del mismo donde par ticipa (1 punto). b) Explique las características químicas del NADP y FADH 2 e indique su función (0,5 puntos). c) Explique las características químicas y la función de la ribulosa 1,5- bisfosfato (0,5 puntos). 25. Referente al material hereditario, su replicación y expresión: (mod 2011 – A3) a) Indique los tres componentes de un nucleótido de ADN. ¿Qué bases se unen por dos puentes de hidrógeno? ¿Qué bases se unen por tres puentes de hidrógeno? ¿Cuáles son las bases púricas? ¿Cuáles las pirimidínicas? (0,75 puntos). b) Indique las tres características de la replicación del ADN y qué significa cada una de ellas (0,75 puntos). c) Determine la secuencia de nucleótidos y polaridad de la cadena de ADN, a partir de la cuál se transcribió el siguiente fragmento de ARNm: 5´AGGUUUAACC3´ (0,5 puntos). 26. Los ácidos nucleicos son biomoléculas complejas formadas por monómeros conocidos como nucleó tidos. (Mod 2012 – B1) a) Indique los tres componentes de un nucleótido de ADN. ¿En qué difiere de un nucleótido de ARN? (0,5 pun tos). b) Cite las tres clases de enlaces químicos que se encuentran en una molécula de ADN de doble hélice. ¿Cuál es la función de cada uno de ellos? (1 punto). c) Además del núcleo, ¿qué orgánulos contienen moléculas de ADN en una célula animal? ¿y en una célula vegetal? (0,5 puntos). 27. Referente al material hereditario y su replicación: (Mod 2013 – B4) a) Cite los tres componentes de un nucleótido de ADN (0,5 puntos). b) Respecto a su composición química ¿en qué se diferencian el ADN y el ARN? (0,5 puntos). c) Dibuje una burbuja de replicación de una molécula de ADN que se está replicando. En su esquema indique: 1) origen de replicación, 2) la polaridad (extremos 5´y 3´) de las cadenas moldes y de nueva síntesis, 3) las cadenas lideres y retrasadas, 4) los fragmentos de Okazaki, y 5) los cebadores (1 punto). 28. Con relación al material genético: (Jun 2013 – A5) a) Describa la estructura secundaria del ADN (0,75 puntos). b) Indique en qué consiste la desnaturalización del ADN y cómo se produce (0,5 puntos). c) Defina replicación, transcripción y traducción (0,75 puntos). 29. Con relación a Ia replicación y expresión del material genético: (Sep 2013 – B3) a) Indique cuatro diferencias entre el proceso replicativo de procariotas y eucariotas (1 punto). b) Defina qué son los intrones y los exones (0,5 puntos). c) Explique razonadamente si el ADN de una célula del páncreas y del hígado de un individuo contienen la misma información genética (0,5 puntos). 30. Referente al metabolismo celular: (Jun 2014 – B1) a) Indique la composición de la molécula de ATP (0,5 puntos). b) De las siguientes rutas metabólicas, indique en cuales de ellas se consume ATP y en cuales se sintetiza ATP: ciclo de Calvin, fosforilación oxidativa, biosíntesis de aminoácidos, fotofosforilación, ciclo de Krebs y biosíntesis de acidos grasos (1,5 puntos). 31. En relación con las biomoléculas: (Mod 2017 — A3) a) Nombre el enlace entre los distintos aminoácidos para formar una cadena de proteína, indicando los grupos implicados en su formación (0,75 puntos). b) Nombre dos enlaces o interacciones que estabilizan la estructura de las proteínas (0,5 puntos). c) Indique un ejemplo de cada una de las biomoléculas siguientes: polisacárido con función estructural, nucleótido con función coenzimática y proteína con función estructural (0,75 puntos).

------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 5 ÁCIDOS NUCLEICOS 4


32. La molécula de ADN es portadora de información: (Jun 17 – A1) a) Nombre el enlace entre los distintos nucleótidos para formar una cadena de ácido nucleico, indicando los grupos implicados (1 punto). b) Para cada uno de los pares de moléculas siguientes indique una característica común y otra que las diferencie: Timina-Uracilo; Adenina-Flavina (1 punto).

33. Referente al metabolismo celular: (Jun 17 – A5) a) Explique brevemente el significado del carácter anfibólico del Ciclo de Krebs. Indique los productos iniciales y finales de dicho ciclo (1,5 puntos). b) Indique la función de la molécula de ATP en el metabolismo de la célula (0,5 puntos). 34. Referente al metabolismo celular: (Sep 17 – A3) a) Identifique la molécula formada por adenina, ribosa y tres moléculas de ácido fosfórico. Indicar cómo se denomina la reacción en la que se sintetiza dicha molécula (0,5 puntos). b) Explique la importancia ecológica del proceso de fotosíntesis oxigénica (0,5 puntos). c) Explique la relación que hay entre la fermentación y la elaboración de queso ¿Cuál es el sustrato y los productos finales? ¿Qué microorganismos intervienen? (1 punto). 35. Con respecto a los componentes de las células: (Sep 17 – B4) a) Cite un ejemplo de polisacárido de origen animal y otro de origen vegetal e indique, en cada caso, su fun ción en las células respectivas (1 punto). b) Indique a qué tipo de biomolécula corresponden las siguientes y asócielo con su función: hemoglobina, actina, NADH, xantofila (1 punto). 36. Referente al metabolismo celular: (Mod 2018 - A5) a) Indique las diferencias más relevantes entre: fotosíntesis y quimiosíntesis; nutrición autótrofa y nutrición heterótrofa (1 punto). b) Indique los componentes de la molécula de ATP (0,5 puntos). c) Explique en qué consiste el proceso de nitrificación e indique el tipo de organismo que lo realiza (0,5 pun tos).

Las preguntas sobre replicación del ADN están en el tema 14 de Genética molecular

------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 5 ÁCIDOS NUCLEICOS 5


LA CÉLULA Y LA BASE FÍSICO-QUÍMICA DE LA VIDA 6. LA TEORÍA CELULAR. MODELOS DE ORGANIZACIÓN CELULAR 1.

En cuanto a los tipos de células procarióticas y eucarióticas: (sep 02 – A1) a) Cita los componentes esenciales comunes. (1 punto) b) Cita sus diferencias. (1 punto)

2.

Uno de los mayores hitos en la historia de la Biología fue el enunciado de la Teoría Celular. (mod 03 – A1) a) Indica los postulados de la Teoría Celular. (1 punto) b) Cite los tres científicos que primero postularon la Teoría Celular y el que la culminó demostrando su validez para el sistema nervioso. (1 punto)

3.

En cuanto a su nivel de complejidad, las células se clasifican en procarióticas y eucarióticas. (mod 04 – B1) a) Cita las principales diferencias entre ambos tipos celulares. (1,5 puntos) b) Cita un ejemplo de organismo procariótico y otro de organismo eucariático. (0,5 puntos)

4.

En cuanto a la evolución de la célula y sus orgánulos (mod 05 – A1) a) Defina la teoría endosimbiótica (Lynn Margulis, 1970). (1 punto) b) Cite tres diferencias entre una célula eucariota y una procariota, y ponga un ejemplo de célula procariota. (1 punto)

5.

Con relación a la célula: (jun 05 - A1) a) Defina la célula (0,5 puntos). b) Cite los componentes comunes de las células procariotas y eucariotas (1 punto). c) Cite dos componentes exclusivos de las células eucariotas (0,5 puntos).

6.

En el dibujo de esta célula: (mod 98 – B1) a) Nombra 10 de los elementos señalados. (1 punto)

b) Explica si se trata de una célula animal o vegetal y en qué fase del ciclo celular se encuentra. (1 punto) 7.

En relación con eucariotas las células: (jun 06 - A1) a) Enumere cuatro orgánulos celulares membranosos (1 punto). b) Cite una función de cada uno de los anteriores (1 punto). -------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 6 TEORÍA CELULAR. TIPOS DE ORGANIZACIÓN CELULAR 1


8.

En relación con la evolución celular: (sep 06 - A1) a) Cite el primer tipo celular que aparece en la evolución y a qué otro tipo celular dio lugar (0,5 puntos). b) Explique la teoría endosimbiótica (Lynn Margulis, 1970) (1 punto). c) Cite dos orgánulos celulares procedentes de endosimbiosis (0,5 puntos).

9.

Con respecto a los niveles de organización celular. (jun 07 – B1) a) Defina célula procariota. Indique tres características fundamentales de la célula citada (1 punto). b) Cite un ejemplo de célula procariota y dibuje un esquema rotulado de la misma (1 punto).

10. Con relación a la biología celular y la microbiología: (jun 08 – B5) a) Señale las aportaciones científicas de Anton van Leeuwenhoek y de Robert Hooke (0,5 puntos). b) Describa brevemente en qué consiste la teoría de la generación espontánea. ¿Es correcta esta teoría? Razone la respuesta (0,75 puntos). c) ¿Qué es la tinción de Gram? Explique su fundamento biológico (0,75 puntos).En el sistema defensivo del or ganismo existen células fagocíticas. (mod 08 – A5) 11. Los microorganismos son un grupo muy heterogéneo de seres vivos: (sep 08 – B5) a) Formule y explique la teoría de la simbiogénesis (endosimbiosis) y exponga la trascendencia de esta teoría en la Biología contemporánea (1 punto). b) Defina los siguientes conceptos: Simbiosis, parasitismo, zoonosis y pandemia (1 punto). 12. Las células procariotas tienen algunas similitudes con las eucariotas, pero sin duda también muchas diferencias. (jun 09 – B5) a) Compare ambos tipos de células y señale sus similitudes o sus diferencias en relación con la presencia/ ausencia de: Citoesqueleto, ribosomas, ADN, envoltura nuclear (1 punto). b) ¿Cuáles aparecieron primero? ¿Cómo se supone que surgieron las otras? (1 punto). 13. En el siglo XIX se enuncia la Teoría Celular. (mod 2010 – A1) a) Explique la importancia biológica de la misma e indique sus postulados fundamentales (1,25 puntos). b) Indique las aportaciones al apartado anterior de Matthias Schleiden (1838), Theodor Schwann (1839) y Ru dolf Virchow (1855) (0,75 puntos). 14. Este dibujo representa el esquema de una célula eucariótica. (Mod 2012 – A2) a) Indique de qué tipo se trata. Razone la respuesta (0,5 puntos). b) Escriba el nombre de las estructuras que se señalan (1 punto). c) Respecto a la estructura señalada con el número 2, indique dos de sus funciones (0,5 puntos).

-------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 6 TEORÍA CELULAR. TIPOS DE ORGANIZACIÓN CELULAR 2


15. La utilización del microscopio permitió a los biólogos diferenciar distintos tipos de células. El dibujo adjunto representa uno de ellos. (Mod 2013 – B5)

a) Razonando la respuesta, indique de qué tipo de célula se trata (0,5 puntos) b) Escriba el nombre de las estructuras numeradas (1 punto). c) Indique cuál es la función principal que realiza la estructura señalada con el número 6 y exprésela mediante la ecuación global que determina el proceso (0,5 puntos). 16. En cuanto a su organización, las células pueden ser procariotas y eucariotas. (Jun 2013 – A1) a) Cite los componentes esenciales comunes a ambos tipos celulares (0,5 puntos). b) Cite sus principales diferencias (1 punto). c) Explique la relación evolutiva entre ambos tipos celulares (0,5 puntos). 17. Con referencia a los componentes y estructuras celulares: (Sep 2013 – A5) a) Copie y complete el siguiente cuadro en su hoja de examen y señale (Si o No), si se encontraría en el tipo celular indicado (1 punto). COMPONENTE / ESTRUCTURA

BACTERIA

CÉLULA ANIMAL

CÉLULA VEGETAL

1. Envoltura nuclear 2. Mitocondria 3. Aparato de Golgi 4. Membrana plasmática 5. Centriolos 6. Sistema de endomembranas 7. Pared celular 8. Ribosoma b) Describa brevemente y mencione una función de las estructuras celulares indicadas con los números 2, 4, 7 y 8 (1 punto). 18. En relación con la teoría celular: (Jun 2014 – B3) a) Enuncie los principios de la teoría celular (1 punto). b) Cite las aportaciones de Matthias Schleiden y Rudolf Virchow a dicha teoría (0,5 puntos). c) Explique según la teoría de la simbiogénesis (endosimbiosis) el origen de las células eucariotas fotoautótro fas (0,5 puntos). -------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 6 TEORÍA CELULAR. TIPOS DE ORGANIZACIÓN CELULAR 3


19. En relación con la Teoría Celular: (Mod 2015 – A2) a) Explique brevemente qué es una célula y en qué consiste la Teoría Celular ¿Quiénes la propusieron? (1 punto). b) Indique brevemente cuatro diferencias entre células procariotas y eucariotas (1 punto). 20. Lea atentamente la siguiente noticia aparecida en el diario EI País del 24 de octubre de 2012: (Mod 2015 – B5) Científicos de Oregón han desarrollado una técnica para curar óvulos humanos de las enfermedades mitocon driales, que se transmiten por vía materna y afectan a uno de cada 5.000 recién nacidos. El método, similar a una clonación, consiste en trasplantar el genoma nuclear de un óvulo enfermo a otro sano. El núcleo queda así rodeado por mitocondrias normales. La mayoría de los genes humanos estan contenidos en los cromoso mas del núcleo, una esfera rodeada de membranas que ocupa el centro de cada célula. Pero algunos se sitúan dentro de otras estructuras celulares, las mitocondrias, que provienen de antiguas bacterias de vida li bre. Estos genes son esenciales para la función de las mitocondrias, que son las factorías energéticas de nuestras células, y sus mutaciones causan graves enfermedades en los órganos que mas energía necesitan,como el cerebro, el corazón, el páncreas, el riñón y los músculos. a) ¿Por qué las enfermedades mitocondriales se transmiten por vía materna? (0,5 puntos). b) El periodista afirma que las mitocondrias proceden de antiguas bacterias de vida libre. Comente razonadamente si esta afirmación es correcta y si esto tiene que ver con la endosimbiosis (o simbiogénesis) ¿Quién propuso esta teoria? (1 punto). c) ¿Qué significa que las mitocondrias son las factorías energéticas de nuestras células? (0,5 puntos). 21. Respecto a la célula eucariota: (Jun 2016 – A5) a) Explique en qué consiste la Teoría Endosimbiótica y quién la formuló (1,25 puntos). b) Cite tres estructuras u orgánulos que posean doble membrana (0,75 puntos).

-------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 6 TEORÍA CELULAR. TIPOS DE ORGANIZACIÓN CELULAR 4


LA CÉLULA Y LA BASE FÍSICO-QUÍMICA DE LA VIDA 7. PAREDES CELULARES Y MEMBRANA PLASMÁTICA. ORGÁNULOS MICROTUBULARES 1.

Membrana plasmática: (jun 97 – B4) a) Dibuja un diagrama rotulado de la membrana plasmática según el modelo de “mosaico fluido”. (1 punto) b) Explica dónde se sintetizan las proteínas intrínsecas o integrales de la membrana. (1 punto)

2.

El dibujo representa a la membrana plasmática: (sep 98 – B1) a) Cita los componentes señalados con los números 1, 2, 3 y 4. (1 punto) b) Explica cómo se realiza el paso de pequeñas moléculas a su través, sin consumo de energía. (1 punto)

3.

Entre el líquido intracelular y el líquido extracelular de una célula animal se observan las siguientes concentraciones de los productos A, B, y C: (mod 99 – B2) Líquido intracelular A 10 mM B 50 mM C 5 mM

Líquido extracelular A 4 mM B 30 mM C 20 mM

Líquido Al cabo de unos minutos se intracelular observan los siguientes cam- A 12 mM B 40 mM bios C 5 mM

Líquido extracelular A 2 mM B 40 mM C 20 mM

a) Nombra qué procesos han utilizado los compuestos A y B para moverse de un lado a otro de la membrana (0,5 puntos) b) Señala la diferencia fundamental entre un proceso y otro. (1 punto) c) ¿Por qué no han cambiado las concentraciones de C? (0,5 puntos) 4.

En relación con la membrana plasmática: (sep 99 – A1) a) Explica la composición química de la membrana plasmática. (0,5 puntos) b) Modelo hipotético sobre su estructura. Explícalo mediante un esquema, señalando sus componentes. (0,75 puntos) c) ¿De qué formas puede realizarse el transporte de sustancias a través de la membrana? (0,75 puntos)

5.

Las células vegetales están rodeadas por una envoltura denominada pared celular. (sep 99 – B2) a) Explica la composición química y la estructura de dicha pared. (1 punto) b) Indica dos funciones que desempeñe la pared en la célula vegetal. (0,5 puntos) c) Indica el principal orgánulo implicado en la formación de la pared celular y en qué fase de la mitosis se origina. (0,5 puntos)

6.

Aunque existen diferencias entre las membranas de distintos tipos de células, así como entre la mem brana plasmática y la que rodea a diversos orgánulos, las membranas celulares tienen una estructura básica común a todas ellas. (mod 00 – B2) a) Realice un esquema de la membrana plasmática en el que figuren los principales componentes de la misma. (1 punto) b) Mencione cuatro de las funciones de la membrana plasmática. (1 punto)

------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 7 PARED Y MEMBRANA. ORGÁNULOS MICROTUBULARES 1


7.

La célula vegetal, además de la pared celular, tiene otras características diferenciales con la célula eucariota animal. (jun 00 – A2) a) Cita las otras diferencias existentes. (0,5 puntos) b) Explica la composición química de la pared celular. (1 punto) c) Cita dos funciones de la pared celular. (0,5 puntos)

8.

En relación con los intercambios celulares a través de las membranas: (jun 00 – A3) a) Indica las características del transporte pasivo que lo diferencian del transporte activo. (0,5 puntos) b) Cita los mecanismos de transporte pasivo que permiten entrar en la célula las moléculas de oxígeno y de glucosa. (0,5 puntos) c) Nombra los mecanismos que permiten la entrada y salida de macromoléculas en la célula. Explica cómo se llevan a cabo estos procesos. (1 punto)

9.

Una de las funciones de la membrana celular es la de transporte de moléculas entre el medio celular y el medio externo. Define los siguientes conceptos: (jun 01 – B2) a) b) c) d)

Difusión simple. (0,5 puntos) Difusión facilitada. (0,5 puntos) Transporte activo. (0,5 puntos) Endocitosis. (0,5 puntos)

10. Con respecto a la membrana celular de la célula eucariótica. (mod 02 – A1) a) Indica su composición química. (0,5 puntos) b) Cita dos funciones de la membrana celular. (0,5 puntos) c) Dibuja un esquema del modelo de membrana propuesto por Singer y Nicolson y señala sus componentes. (1 punto) 11. El sistema de membranas celulares consta de la membrana plasmática y del sistema de endomembranas, poseyendo ambos una estructura similar. (sep 03 – B1) a) Cita los componentes de la unidad de membrana y explica a qué se debe la denominación de "mosaico flui do" según el modelo de membrana de Singer y Nicholson. (1 punto) b) Cita dos funciones de la membrana. (0,5 puntos) c) Define glicocálix. (0,5 puntos) 12. La fotografía muestra el corte transversal de una prolongación de una célula eucarionte: (jun 97 – A2) a) Di qué estructura es y nombra los elementos señalados por las flechas. ( 1 punto) b) Explica la función que cumple esta estructura en las células. (1 punto)

13. En relación con el citoesqueleto: (mod 01 – B3) a) Cita dos componentes del citoesqueleto e indica su composición. (1 punto) b) Explica la función de los dos componentes citados en el apartado anterior. (1 punto) 14. Con relación al aparato ciliar de la célula: (sep 01 – B1) a) Expón la estructura y función de un cilio. (1,5 puntos) b) Dibuja el esquema de la sección transversal de su axonema. (0,5 puntos)

------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 7 PARED Y MEMBRANA. ORGÁNULOS MICROTUBULARES 2


15. Un componente fundamental del citoplasma de células eucariotas es el citoesqueleto: (jun 04 – A1) a) Enumere los componentes de esta estructura (0,75 puntos). b) De los anteriores, uno de ellos participa en el transporte de orgánulos y partículas en el interior de la célula. Cítelo, explique su estructura e indique otra función que desempeña (1,25 puntos). 16. Respecto a los cilios: (sep 05 – A1) a) Cite sus diferentes zonas estructurales (0,75 puntos). b) Dibuje un esquema rotulado de un corte transversal de su tallo, indicando sus elementos (1,25 puntos). 17. Con relación a la membrana celular de células eucariotas: (mod 07 – A1) a) Cite sus componentes (1 punto). b) Cite cuatro funciones de la misma (1 punto). 18. Entre las funciones de la membrana plasmática se encuentra el transporte de moléculas a través de la misma. (mod 08 – B1) a) Indique los tipos y subtipos de transporte que conoce y explique sus características (1,25 puntos). b) En algunos tipos de células, la membrana se especializa para cumplir determinadas funciones. Cite tres especializaciones de membrana e indique su función específica (0,75 puntos). 19. En toda célula eucariota existe un sistema de membranas. (sep 09 – A2) a) Cite cuatro estructuras celulares formadas por membrana (1 punto). b) Dibuje un esquema rotulado de la estructura de la membrana según Singer y Nicolson (1 punto). 20. Entre las macromoléculas que se citan a continuación: ácidos nucleicos, polisacáridos, proteínas y lípidos: (mod 2010 – B1) a) Indique cuáles son los monómeros de las tres primeras macromoléculas y los tipos de enlaces que permiten la formación de cada una de ellas (0,5 puntos). b) ¿Cuáles de ellas pueden tener estructura secundaria? Razone la respuesta (0,5 puntos). c) ¿Qué moléculas de las citadas forman parte de la membrana plasmática? Explique su organización estruc tural (1 punto). 21. Para la célula eucariota: (jun gen 2010 – A1) a) Explique las características estructurales del Aparato de Golgi (0,5 puntos). b) Explique la participación del Aparato de Golgi en el proceso de formación de la pared celular (0,75 puntos). c) Cite tres polisacáridos de la pared celular e indique la composición química de cada uno de ellos (0,75 pun tos). 22. Con relación a la siguiente figura: (jun esp 2010 – A1) a) Indique el nombre que recibe cada cilindro, así como el conjunto de ambos (0,5 puntos). b) ¿En qué tipo de célula (animal, vegetal o ambas) está presente? ¿Qué estructura origina en el momento de la división celular? (0,5 puntos). c) Indique las funciones que realizan los cilios y flagelos y establezca sus diferencias (1 punto).

23. Algunas células vegetales presentan unas biomoléculas muy características, como la celulosa, la hemicelulosa y el almidón. (sep 2010 – B1) a) Indique las semejanzas y las diferencias más importantes entre la celulosa y el almidón (1 punto). b) Cite una semejanza y una diferencia entre la celulosa y la hemicelulosa (0,5 puntos). c) Explique la importancia biológica de la celulosa en la célula vegetal (0,5 puntos). ------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 7 PARED Y MEMBRANA. ORGÁNULOS MICROTUBULARES 3


24. Con relación a la membrana plasmática: (mod 2011 – A2) a) Indique las diferencias que existen entre las proteínas periféricas y las proteínas integrales (1 punto). b) Cite tres tipos diferentes de uniones intercelulares (0,5 puntos). c) Escriba cuatro orgánulos celulares que estén limitados por membrana (0,5 puntos). 25. Los números del dibujo adjunto representan el transporte de moléculas a través de la membrana plasmática. (jun 2011 – A3)

a) Explique el transporte representado por los números 1 y 4, y ponga un ejemplo de iones o moléculas que puedan ser transportados por cada uno de ellos (1 punto). b) Explique cómo se realiza el transporte de moléculas de elevada masa molecular a través de la membrana plasmática (1 punto). 26. En las células vegetales, la pared celular es externa y rígida. (jun 2011 - B3) a) Explique cómo se origina la pared celular (0,5 puntos). b) Cite las macromoléculas que constituyen la pared celular y explique cómo se han sintetizado las mismas (0,75 puntos). c) Indique tres funciones que realice la pared celular (0,75 puntos). 27. La célula es la unidad estructural y funcional de los seres vivos. (Sept 2011 – A3) a) Defina los siguientes componentes estructurales de la célula eucariota: Lisosoma, Retículo endoplásmico, Membrana plasmática y Pared celular (1 punto). b) Cite una función de cada uno de los componentes estructurales del apartado a) (1 punto). 28. Este dibujo representa el esquema de una célula eucariótica. (Mod 2012 – A2) a) Indique de qué tipo se trata. Razone la respuesta (0,5 puntos). b) Escriba el nombre de las estructuras que se señalan (1 punto). c) Respecto a la estructura señalada con el número 2, indique dos de sus funciones (0,5 puntos).

------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 7 PARED Y MEMBRANA. ORGÁNULOS MICROTUBULARES 4


29. En relación con la célula eucariota: (Sep 2014 – A1) a) Conteste a las siguientes cuestiones: 1. ¿Cómo se llama el compartimento del orgánulo donde tiene lugar el ciclo de Krebs?; 2. Indique los elementos que forman la estructura del aparato de Golgi; 3. ¿Cuáles son las dos principales funciones de los lisosomas?; 4. ¿Dónde se originan los lisosomas? (1 punto). b) Indique el orgánulo o estructura celular definido a continuación: 1. Orgánulo implicado en la síntesis de fosfolípidos y esteroides; 2. Orgánulo en el que se forman las vesículas que darán lugar al fragmoplasto; 3. Conexiones entre células vegetales adyacentes; 4. Componente mayoritario de las paredes celulares vegetales primarias (1 punto). 30. Con referencia a los componentes y estructuras celulares: (Sep 2013 – A5) a) Copie y complete el siguiente cuadro en su hoja de examen y señale (Si o No), si se encontraría en el tipo celular indicado (1 punto). COMPONENTE / ESTRUCTURA

BACTERIA

CÉLULA ANIMAL

CÉLULA VEGETAL

1. Envoltura nuclear 2. Mitocondria 3. Aparato de Golgi 4. Membrana plasmática 5. Centriolos 6. Sistema de endomembranas 7. Pared celular 8. Ribosoma b) Describa brevemente y mencione una función de las estructuras celulares indicadas con los números 2, 4, 7 y 8 (1 punto). 31. Con relación a la membrana plasmática: (Sep 2014 – B3) a) Señale la composición química de la membrana plasmática de una célula animal (0,5 puntos). b) Indique cuatro funciones de las proteínas de membrana (1 punto). c) ¿Qué ocurriría si introducimos una célula animal en una solución hipertónica? ¿Y en una hipotónica? (0,5 puntos). 32. En la célula vegetal: (Jun 2015 – A5) a) Conteste a las siguientes cuestiones: 1) ¿Cuál es el componente mayoritario de las paredes celulares vege tales?; 2) ¿Cómo se llaman las conexiones entre células vegetales adyacentes?; 3) ¿Qué orgánulo/s de la célula vegetal contienen ribosomas 70 S?; 4) ¿Dónde se originan las vesículas que darán lugar al fragmoplasto? (1 punto). b) Indique los compartimentos celulares definidos a continuación: 1) Compartimento del orgánulo donde tiene lugar el ciclo de Calvin; 2) Compartimento del orgánulo donde tiene lugar el ciclo de Krebs; 3) Compartimento del orgánulo donde tiene lugar la síntesis de ATP y NADPH; 4) Compartimento del orgánulo donde tiene lugar la síntesis de ATP y NADH (1 punto). 33. En relación con la célula eucariota: (jun 2015 - B1) a) Dibuje un corte transversal de un cilio o flagelo, indicando sus partes (1 punto). b) Indique los componentes fundamentales de: 1) El cuerpo basal; 2) La lámina media; 3) La cromatina; 4) El centrosoma (1 punto). 34. En relación con el citoesqueleto de la célula eucariota: (sep 2015 - B2) a) Cite sus componentes indicando el nombre de la proteína/s principal/es que los constituyen (0,75 puntos). b) Mencione cinco procesos celulares en los que esté implicado algún componente del citoesqueleto (1,25 puntos).

------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 7 PARED Y MEMBRANA. ORGÁNULOS MICROTUBULARES 5


35. En relación con el citoesqueleto de la célula eucariota: (mod 2016 - A5) a) Cite dos procesos o estructuras en los que intervienen los microfilamentos y otros dos en los que intervengan los microtúbulos (1 punto). b) Indique la función y localización: del nucléolo y de los ribosomas libres en las células animales (1 punto). 36. Respecto a la pared celular: (jun 2016 - B5) a) Indique las diferencias entre pared primaria y secundaria de las células vegetales (1 punto). b) Indique la diferencia fundamental entre la pared de las células vegetales y la de los hongos en cuanto a su composición (0,5 puntos). c) Indique qué son los plasmodesmos y qué función tienen (0,5 puntos). 37. En relación con las membranas celulares: (Mod 2017 — A1) a) Defina difusión simple y difusión facilitada y ponga un ejemplo de cada proceso (1 punto). b) Describa el funcionamiento de la bomba de sodio/potasio. ¿Por qué necesita energía para su funcionamiento? (1 punto). 38. En relación con la célula eucariota: (Mod 2017 — B3) a) Cite cuatro componentes de un núcleo interfásico (1 punto). b) Indique las funciones de los centriolos (1 punto). 39. Sobre la organización celular: (Jun 17 – B4) a) Indique una función del nucléolo, del retículo endoplasmático rugoso, de los lisosomas y del aparato de Gol gi (1 punto). b) Indique cuatro funciones de la membrana celular (1 punto). 40. En relación con diversas estructuras que podemos encontrar en las células eucariotas: (Sep 17 – A2) a) Cite los tres elementos que configuran el citoesqueleto y las proteínas fundamentales que los forman (0,75 puntos). b) Cite las diferencias en cuanto a su función entre el retículo endoplasmático rugoso y retículo endoplasmático liso (0,5 puntos). c) Cite tres orgánulos que posean doble membrana (0,75 puntos). 41. Con relación a las células vegetales: (Sep 17 – B2) a) Señale cuatro componentes químicos de la pared primaria (1 punto). b) ¿Qué ocurriría si introducimos una célula vegetal en una solución hipertónica? ¿Y en una hipotónica? (1 punto). 42. En relación con la célula eucariota: (Mod 2018 - A4) c) Conteste a las siguientes cuestiones: 1. ¿Cómo se llama el compartimento del orgánulo donde tiene lugar el ciclo de Calvin?; 2. Indique el lugar de la mitocondria donde se sitúa la cadena transportadora de electrones; 3. ¿Cuáles son dos de las principales funciones del Aparato de Golgi? (1 punto). d) Indique cuáles son los orgánulos o estructuras celulares definidos a continuación: 1. Orgánulo con membrana implicado en la síntesis de proteínas; 2. Lugar de síntesis del citoesqueleto; 3. Lugar de unión de los mi crotúbulos a los cromosomas; 4. Componente estructural mayoritario de las membranas celulares (1 punto). 43. Respecto a los componentes celulares: (Mod 2018 - B5) a) Explique la diferencia entre fagocitosis mediada por receptor y autofagia, poniendo un ejemplo de cada proceso (1 punto). b) Indique dos diferencias y dos similitudes entre mitocondrias y cloroplastos (1 punto).

------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 7 PARED Y MEMBRANA. ORGÁNULOS MICROTUBULARES 6


LA CÉLULA Y LA BASE FÍSICO-QUÍMICA DE LA VIDA 8. EL SISTEMAS DE ENDOMEMBRANAS Y LOS RIBOSOMAS 1.

El retículo endoplásmico es una estructura membranosa situada en el interior celular. (jun 98 – B1) a) Explica qué dos modalidades de retículo endoplásmico coexisten en la célula y qué funciones básicas tiene cada una de estas modalidades. (1 punto) b) Si tuvieras que observar al microscopio electrónico una célula, ¿qué característica morfológica te permitiría distinguir inmediatamente una modalidad de la otra? (0,5 puntos) c) El retículo endoplásmico, ¿es exclusivo de células animales, de células vegetales ó de ambos tipos de célu las? Razona su respuesta. (0,5 puntos)

2.

En relación con los ribosomas: (jun 99 – B2) a) b) c) d)

3.

Explica su estructura. (0,5 puntos) Explica su composición química. (0,5 puntos) Explica la función de los ribosomas. (0,5 puntos) Indica la localización de los ribosomas en células procariotas y eucariotas. (0,5 puntos)

En relación con los lisosomas: (jun 00 – B2) a) Define lisosoma primario. (0,5 puntos) b) Cita el orgánulo que origina los lisosomas y otro orgánulo que intervenga en la síntesis de su contenido. (0,5 puntos) c) Explica cómo se convierte un lisosoma primario en lisosoma secundario o fagolisosoma. (0,5 puntos) d) Cita la función de los lisosomas. (0,5 puntos)

4.

En relación con el aparato de Golgi y el retículo endoplasmático rugoso: (mod 01 – A2) a) Haz un dibujo del aparato de Golgi y otro del retículo endoplasmático rugoso relacionados entre sí y nombra en ellos sus componentes. (1 punto) b) Explica la relación funcional del aparato de Golgi con el retículo endoplasmático rugoso. (0,5 puntos) c) Indica dos orgánulos o estructuras celulares en las que intervenga el aparato de Golgi en su formación. (0,5 puntos)

5.

Con relación al Aparato de Golgi (Complejo de Golgi). (jun 01 – B1) a) Explica sus características estructurales. (1 punto) b) ¿Cómo se originan las vesículas golgianas? ¿Cúal es su función? (0,5 puntos) c) Cita dos funciones del aparato de Golgi. (0,5 puntos)

6.

Existen sustancias proteicas que se sintetizan en la célula y posteriormente son segregadas al exte rior. (jun 02 – A1) a) Cita, por orden de actuación, las estructuras y orgánulos citoplásmicos que intervienen en este proceso. (1 punto) b) En su paso a través del complejo de Golgi, ¿por qué cara del complejo entran estas moléculas y por cuál salen? (0,5 puntos) c) ¿Con qué denominación se conoce el proceso más habitual de excreción de sustancias al exterior y qué es tructuras celulares intervienen en él? (0,5 puntos)

7.

Respecto a los lisosomas: (sep 04 – A1) a) Explique su estructura, composición y función (1 punto). b) Defina lisosoma primario y lisosoma secundario (0,5 puntos). c) Explique el significado y función de fagolisosoma (0,5 puntos).

8.

En relación con el proceso de secreción en células eucariotas: (mod 06 – A1) a) Cite las moléculas y orgánulos celulares que intervienen en el proceso, desde su síntesis hasta su excreción al exterior celular (1 punto). b) Indique la función de cada una de las moléculas y orgánulos citados en el apartado anterior (1 punto).

--------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 8 SISTEMA DE ENDOMEMBRANAS. RIBOSOMAS 1


9.

Las células eucariotas se caracterizan por poseer núcleo y orgánulos membranosos: (jun 08 – B1) a) Describa los componentes estructurales del núcleo (1 punto). b) El núcleo se encuentra físicamente unido a otro orgánulo celular. Indique de qué orgánulo se trata y explique brevemente las funciones de éste (1 punto).

10. La célula plasmática es una diferenciación del linfocito B cuya única función es la producción de anti cuerpos y su liberación al espacio extracelular. (sep 09 – A5) a) Teniendo en cuenta lo anterior, deduzca su ultraestructura comentando sus orgánulos celulares predominantes y razonando la respuesta (1 punto). b) Indique qué clase de moléculas son los anticuerpos y cite sus tipos (0,5 puntos). c) Dibuje un esquema de la estructura de un anticuerpo indicando sus diferentes partes (0,5 puntos). 11. El macrófago es una célula perteneciente al sistema inmunitario y al tejido conjuntivo que se caracteriza por llevar a cabo, como una de sus funciones principales, la fagocitosis. (jun 09 – A1) a) Basándose en lo anterior, deduzca qué orgánulo predominará en su citoplasma y explique su estructura, composición y función (1 punto). b) El orgánulo aludido en el apartado anterior puede presentar distintos tipos. Explique la estructura, composi ción y función de cada uno de ellos (1 punto). 12. Con respecto a los lisosomas: (jun gen 2010 – B1) a) Indique su origen, estructura y función (0,75 puntos). b) Diga sus tipos y en qué se diferencian (0,75 puntos). c) Distinga entre vacuolas heterofágicas y vacuolas autofágicas (0,5 puntos). 13. La célula es la unidad estructural y funcional de los seres vivos. (Sept 2011 – A3) a) Defina los siguientes componentes estructurales de la célula eucariota: Lisosoma, Retículo endoplásmico, Membrana plasmática y Pared celular (1 punto). b) Cite una función de cada uno de los componentes estructurales del apartado a) (1 punto). 14. En la célula eucariota se encuentran diversos orgánulos. (jun 2012 - B4) a) Indique qué son los lisosomas, y explique sus tipos (1 punto). b) Indique la función y la clasificación de los lisosomas (1 punto). 15. En relación con la célula eucariota: (Sep 2014 – A1) a) Conteste a las siguientes cuestiones: 1. ¿Cómo se llama el compartimento del orgánulo donde tiene lugar el ciclo de Krebs?; 2. Indique los elementos que forman la estructura del aparato de Golgi; 3. ¿Cuáles son las dos principales funciones de los lisosomas?; 4. ¿Dónde se originan los lisosomas? (1 punto). b) Indique el orgánulo o estructura celular definido a continuación: 1. Orgánulo implicado en la síntesis de fos folípidos y esteroides; 2. Orgánulo en el que se forman las vesículas que darán lugar al fragmoplasto; 3. Conexiones entre células vegetales adyacentes; 4. Componente mayoritario de las paredes celulares vegetales primarias (1 punto). 16. En relación con el citoesqueleto de la célula eucariota: (mod 2016 - A5) a) Cite dos procesos o estructuras en los que intervienen los microfilamentos y otros dos en los que intervengan los microtúbulos (1 punto). b) Indique la función y localización: del nucléolo y de los ribosomas libres en las células animales (1 punto). 17. En relación con los orgánulos celulares. (mod 2016 - B2) a) Describa la estructura y función de los lisosomas (0,5 puntos). b) Explique la diferencia entre heterofagocitosis y autofagocitosis poniendo un ejemplo de cada proceso (1 punto). c) Describa la estructura y función del peroxisoma (0,5 puntos). 18. En relación a los orgánulos celulares: (Sep 2016 – B5) a) Indique la función de los lisosomas y el tipo de enzimas que contienen (0,5 puntos). --------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 8 SISTEMA DE ENDOMEMBRANAS. RIBOSOMAS 2


b) Indique la función principal de los peroxisomas en las células animales y qué tipos de enzimas contienen (0,5 puntos). c) Indique la diferencia entre lisosoma primario y secundario (0,5 puntos). d) Indique la diferencia fundamental entre un heterofagosoma y un autofagosoma (0,5 puntos). 19. Sobre la organización celular: (Jun 17 – B4) a) Indique una función del nucléolo, del retículo endoplasmático rugoso, de los lisosomas y del aparato de Gol gi (1 punto). b) Indique cuatro funciones de la membrana celular (1 punto). 20. En relación con diversas estructuras que podemos encontrar en las células eucariotas: (Sep 17 – A2) a) Cite los tres elementos que configuran el citoesqueleto y las proteínas fundamentales que los forman (0,75 puntos). b) Cite las diferencias en cuanto a su función entre el retículo endoplasmático rugoso y retículo endoplasmático liso (0,5 puntos). c) Cite tres orgánulos que posean doble membrana (0,75 puntos). 21. En relación con la célula eucariota: (Mod 2018 - A4) a) Conteste a las siguientes cuestiones: 1. ¿Cómo se llama el compartimento del orgánulo donde tiene lugar el ciclo de Calvin?; 2. Indique el lugar de la mitocondria donde se sitúa la cadena transportadora de electrones; 3. ¿Cuáles son dos de las principales funciones del Aparato de Golgi? (1 punto). b) Indique cuáles son los orgánulos o estructuras celulares definidos a continuación: 1. Orgánulo con membrana implicado en la síntesis de proteínas; 2. Lugar de síntesis del citoesqueleto; 3. Lugar de unión de los microtúbulos a los cromosomas; 4. Componente estructural mayoritario de las membranas celulares (1 punto). 22. Respecto a los componentes celulares: (Mod 2018 - B5) a) Explique la diferencia entre fagocitosis mediada por receptor y autofagia, poniendo un ejemplo de cada proceso (1 punto). b) Indique dos diferencias y dos similitudes entre mitocondrias y cloroplastos (1 punto).

--------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 8 SISTEMA DE ENDOMEMBRANAS. RIBOSOMAS 3


LA CÉLULA Y LA BASE FÍSICO-QUÍMICA DE LA VIDA 9. ORGÁNULOS ENERGÉTICOS: CLOROPLASTOS Y MITOCONDRIAS 1.

Mitocondrias (mod 97 – B2) a) Dibuja el esquema de una mitocondria poniendo nombre a sus partes. (0,5 puntos) b) Haz un esquema con las principales etapas de la degradación de la glucosa en una célula. (0,5 puntos) c) Explica las principales etapas de la degradación del ácido pirúvico –en presencia de oxígeno– durante la respiración celular. (1 punto)

2.

En el dibujo se representa un orgánulo celular: (sep 97 – A3) a) Indica el orgánulo de que se trata, poniendo nombre a las estructuras señaladas mediante flechas. (1 Punto) b) Localiza al menos dos de los procesos bioquímicos que tienen lugar en dicho orgánulo. (1 Punto)

3.

En la mitocondrias tienen lugar importantes procesos bioquímicos: (sep 97 – B2) a) Dibuja una mitocondria, nombrando y señalando sus partes. (1 Punto) b) Localiza al menos dos de los procesos bioquímicos que tienen lugar en la mitocondria. (1 Punto)

4.

El dibujo representa una mitocondria: (jun 98 – A2) a) Nombra los componentes señalados con un número. (1 punto) b) Indica cual es la función que caracteriza a la mitocondria y en qué tipo de célula se encuentra este orgánulo. (0,5 puntos) c) Señala la función que realizan los componentes 3 y 4 del esquema. (0,5 puntos)

5.

En el siguiente esquema se representa un cloroplasto: (jun 99 – A3) a) Nombra los compartimentos y estructuras que se señalan. (1 punto) b) Menciona las partes de la estructura de este orgánulo asociadas con los siguientes procesos: síntesis de ATP, ciclo de Calvin, cadena de transporte electrónico y fotólisis. (1 punto)

------------------------------------------------------------------ CUESTIONES DE SELECTIVIDAD – TEMA 9 CLOROPLASTOS Y MITOCONDRIAS 1


6.

En la célula vegetal, la formación de ATP tiene lugar durante determinados procesos metabólicos. (mod 00 – A2) a) Explica las características químicas del ATP, y cita los enlaces entre sus componentes y señala su importancia en el metabolismo celular. (1 punto) b) Indica en qué procesos se produce la síntesis de ATP y señala los lugares de la célula dónde suceden. (1 punto)

7.

El adenosín trifosfato o ATP es una molécula central en el metabolismo celular. (jun 00 – B1) a) Describe su estructura general y explica la importancia del ATP en el metabolismo. (1 punto) b) En una célula vegetal, indica en qué orgánulos se realiza mayoritariamente la síntesis de ATP y menciona el nombre de los procesos de síntesis. (1 punto)

8.

Las mitocondrias son unos orgánulos que están presentes en las células eucariotas. (sep 00 – A2) a) Haz un esquema o dibujo de una mitocondria y señala sus componentes. (1 punto) b) Indica la localización en las mitocondrias de los siguientes procesos metabólicos: cadena de transporte de electrones y ciclo de Krebs. (0,5 puntos) c) ¿Cómo se llaman los productos del ciclo de Krebs que al oxidarse ceden sus electrones a la cadena de transporte electrónico? ¿Cuál es el aceptor final de los electrones? (0,5 puntos)

9.

En relación con la fotosíntesis: (mod 01 – B2) a) Define los siguientes términos: grana, fotosistema I, estroma y ciclo de Calvin. (1 punto) b) A qué procesos de la fotosíntesis está asociada la obtención de los siguientes productos: ATP; oxígeno; ri bulosa 1,5-bifosfato; NADPH. (1 punto)

10. Con relación a la fuente de energía utilizada por los organismos. (jun 01 – A2) a) Explica la diferencia fundamental entre un organismo quimioautótrofo (quimiosintético) y un organismo foto autótrofo (fotosintético). (0,5 puntos) b) Explica la diferencia fundamental entre fotofosforilación (fosforilación fotosintética) y fosforilación oxidativa. (0,5 puntos) c) Indica el tipo de células y el compartimento celular donde se producen los procesos indicados en el aparta do anterior. (1 punto) 11. Con relación a los orgánulos de la célula eucariótica. (jun 02 – B1) a) Realiza un esquema de la mitocondria y señala sus componentes. (1 punto) b) Indica las semejanzas, a nivel estructural, entre las mitocondrias y los cloroplastos. (1 punto) 12. En un laboratorio se está trabajando con plantas utilizando hojas como material de estudio: (sep 06 – A2) a) Cite el proceso anabólico más característico que tiene lugar en el órgano aludido, mencione las fases del mismo e indique los productos que se originan en cada una de ellas (1 punto). b) Realice un esquema rotulado del orgánulo donde se realizan las fases aludidas en el apartado anterior y señale sus componentes (1 punto). 13. Para llevar a cabo sus funciones, las células necesitan producción energética. (sep 07 – B1) a) Cite el orgánulo responsable de la producción energética en células animales. Dibuje un esquema del mismo en el que figure su estructura y sus componentes y explique cómo se produce la génesis de este orgá nulo (1 punto). b) Cite otro orgánulo específico, responsable también de la producción energética en células vegetales. Dibuje un esquema del mismo en el que figure su estructura y sus componentes y explique cómo se produce la génesis de este orgánulo (1 punto). 14. Los orgánulos celulares presentan diversos componentes. (mod 08 – B2) a) Defina fotosistema, tilacoides y estroma (0,75 puntos). b) ¿Con qué proceso metabólico se relacionan estos términos?, ¿cuál es la finalidad de dicho proceso? (0,5 puntos). c) ¿En qué componente de los citados en el primer apartado se produce ATP? Explique su mecanismo de obtención (0,75 puntos). ------------------------------------------------------------------ CUESTIONES DE SELECTIVIDAD – TEMA 9 CLOROPLASTOS Y MITOCONDRIAS 2


15. Las células eucariotas poseen diversos orgánulos: (sep 08 – B1) a) Identifique el orgánulo cuyo esquema aparece en la figura adjunta, así como las distintas partes del mismo señaladas con números (1 punto). b) Indique el tipo de organismos en los que se encuentra este orgánulo y exprese, mediante la ecuación general del proceso, la función principal del mismo (0,5 puntos). c) Indique los lugares concretos dentro del orgánulo en los que se llevan a cabo las distintas fases del proceso (0,5 puntos).

16. La figura adjunta representa un orgánulo celular: (mod 09 – B1) a) Diga de qué orgánulo se trata e identifique las partes del mismo señaladas con números (0,5 puntos). b) Indique las funciones que se desarrollan en los compartimentos 1 y 3 (0,5 puntos). c) ¿Qué otros componentes esenciales para el correcto funcionamiento del orgánulo faltarían en el esquema? Indique las funciones de los mismos (1 punto).

17. Para llevar a cabo las funciones celulares es necesario aportar energía. (jun 09 – B2) a) Dibuje un esquema rotulado del orgánulo energético de células animales (0,75 puntos). b) Indique las etapas del proceso de respiración aerobia que se efectúan en este orgánulo y en qué localiza ción se lleva a cabo cada una de ellas (0,5 puntos). c) Dibuje un esquema rotulado del orgánulo energético de las células vegetales (0,75 puntos). 18. Los plastos son unos orgánulos característicos de las células vegetales: (sep 2010 – A1) a) Respecto al esquema adjunto escriba el nombre de este plasto, qué proceso metabólico realiza y el nombre que corresponde a cada número (1,5 puntos). b) Indique el lugar concreto donde se realiza el ciclo de Calvin y la finalidad del mismo (0,5 puntos).

19. Los ácidos nucleicos son biomoléculas complejas formadas por monómeros conocidos como nucleó tidos. (Mod 2012 – B1) a) Indique los tres componentes de un nucleótido de ADN. ¿En qué difiere de un nucleótido de ARN? (0,5 puntos). b) Cite las tres clases de enlaces químicos que se encuentran en una molécula de ADN de doble hélice. ¿Cuál es la función de cada uno de ellos? (1 punto). c) Además del núcleo, ¿qué orgánulos contienen moléculas de ADN en una célula animal? ¿y en una célula vegetal? (0,5 puntos).

------------------------------------------------------------------ CUESTIONES DE SELECTIVIDAD – TEMA 9 CLOROPLASTOS Y MITOCONDRIAS 3


20. El diagrama adjunto esquematiza las principales reacciones de un orgánulo vegetal. (Mod 2013 – A4)

a) Identifique el orgánulo representado e indique el principal proceso fisiológico que realiza. Este proceso, ¿es anabólico o catabólico? (0,75 puntos). b) El proceso referido en el apartado anterior se lleva a cabo en dos etapas señaladas en el dibujo como A y B. Identifíquelas, indique los compartimentos estructurales en los que se llevan a cabo y explique brevemente el fundamento fisiológico de dichas etapas (0,75 puntos). c) Como se puede apreciar en el esquema, en este orgánulo se produce ATP. Cite otro orgánulo de la célula vegetal donde se produzca ATP de forma mayoritaria e indique la denominación del proceso (0,5 puntos). 21. Con referencia a los componentes y estructuras celulares: (Sep 2013 – A5) a) Copie y complete el siguiente cuadro en su hoja de examen y señale (Si o No), si se encontraría en el tipo celular indicado (1 punto). COMPONENTE / ESTRUCTURA

BACTERIA

CÉLULA ANIMAL

CÉLULA VEGETAL

1. Envoltura nuclear 2. Mitocondria 3. Aparato de Golgi 4. Membrana plasmática 5. Centriolos 6. Sistema de endomembranas 7. Pared celular 8. Ribosoma b) Describa brevemente y mencione una función de las estructuras celulares indicadas con los números 2, 4, 7 y 8 (1 punto). 22. En una dirección de Internet un estudiante de Biología encuentra el esquema adjunto. (Sep 2013 – B5) a) Identifique qué representa el esquema, así como las distintas partes del mismo señaladas con números (0,75 puntos). b) El estudiante observa que el esquema está incompleto. ¿Sabría indicar los principales componentes que faltan? (0,5 puntos). c) Indique la función general del orgánulo, así como las funciones concretas que se llevan a cabo en 1 (0,75 puntos).

------------------------------------------------------------------ CUESTIONES DE SELECTIVIDAD – TEMA 9 CLOROPLASTOS Y MITOCONDRIAS 4


23. En relación con la célula eucariota: (Jun 2014 – A3) a) Dibuje esquemáticamente un cloroplasto, indicando sus principales compartimentos y estructuras (1 punto). b) Mencione dos procesos metabólicos relacionados con la nutrición fotoautótrofa que tengan lugar en los cloroplastos, indicando su localización en el organulo (1 punto). 24. En relación con la célula eucariota: (Sep 2014 – A1) a) Conteste a las siguientes cuestiones: 1. ¿Cómo se llama el compartimento del orgánulo donde tiene lugar el ciclo de Krebs?; 2. Indique los elementos que forman la estructura del aparato de Golgi; 3. ¿Cuáles son las dos principales funciones de los lisosomas?; 4. ¿Dónde se originan los lisosomas? (1 punto). b) Indique el orgánulo o estructura celular definido a continuación: 1. Orgánulo implicado en la síntesis de fos folípidos y esteroides; 2. Orgánulo en el que se forman las vesículas que darán lugar al fragmoplasto; 3. Co nexiones entre células vegetales adyacentes; 4. Componente mayoritario de las paredes celulares vegetales primarias (1 punto). 25. Lea atentamente la siguiente noticia aparecida en el diario EI País del 24 de octubre de 2012: (Mod 2015 – B5) Científicos de Oregón han desarrollado una técnica para curar óvulos humanos de las enfermedades mitocon driales, que se transmiten por vía materna y afectan a uno de cada 5.000 recién nacidos. El método, similar a una clonación, consiste en trasplantar el genoma nuclear de un óvulo enfermo a otro sano. El núcleo queda así rodeado por mitocondrias normales. La mayoría de los genes humanos estan contenidos en los cromoso mas del núcleo, una esfera rodeada de membranas que ocupa el centro de cada célula. Pero algunos se sitúan dentro de otras estructuras celulares, las mitocondrias, que provienen de antiguas bacterias de vida libre. Estos genes son esenciales para la función de las mitocondrias, que son las factorías energéticas de nuestras células, y sus mutaciones causan graves enfermedades en los órganos que mas energía necesitan,como el cerebro, el corazón, el páncreas, el riñón y los músculos. a) ¿Por qué las enfermedades mitocondriales se transmiten por vía materna? (0,5 puntos). b) El periodista afirma que las mitocondrias proceden de antiguas bacterias de vida libre. Comente razonadamente si esta afirmación es correcta y si esto tiene que ver con la endosimbiosis (o simbiogénesis) ¿Quién propuso esta teoria? (1 punto). c) ¿Qué significa que las mitocondrias son las factorías energéticas de nuestras células? (0,5 puntos). 26. En la célula vegetal: (Jun 2015 – A5) a) Conteste a las siguientes cuestiones: 1) ¿Cuál es el componente mayoritario de las paredes celulares vege tales?; 2) ¿Cómo se llaman las conexiones entre células vegetales adyacentes?; 3) ¿Qué orgánulo/s de la célula vegetal contienen ribosomas 70 S?; 4) ¿Dónde se originan las vesículas que darán lugar al fragmoplasto? (1 punto). b) Indique los compartimentos celulares definidos a continuación: 1) Compartimento del orgánulo donde tiene lugar el ciclo de Calvin; 2) Compartimento del orgánulo donde tiene lugar el ciclo de Krebs; 3) Compartimento del orgánulo donde tiene lugar la síntesis de ATP y NADPH; 4) Compartimento del orgánulo donde tiene lugar la síntesis de ATP y NADH (1 punto). 27. En relación con la célula eucariota: (Sep 2015 – A5) a) Dibuje esquemáticamente una mitocondria indicando sus elementos fundamentales (1 punto). b) Indique dos procesos metabólicos que ocurren en las mitocondrias y su localización en las mismas (1 punto). 28. En relación con la célula eucariota: (Sep 2016 – A2) a) Dibuje esquemáticamente un cloroplasto, indicando sus elementos fundamentales (1 punto). b) Indique dos procesos metabólicos que ocurren en los cloroplastos y su localización en los mismos (1 punto). 29. En relación con diversas estructuras que podemos encontrar en las células eucariotas: (Sep 17 – A2) a) Cite los tres elementos que configuran el citoesqueleto y las proteínas fundamentales que los forman (0,75 puntos). b) Cite las diferencias en cuanto a su función entre el retículo endoplasmático rugoso y retículo endoplasmático liso (0,5 puntos). c) Cite tres orgánulos que posean doble membrana (0,75 puntos). ------------------------------------------------------------------ CUESTIONES DE SELECTIVIDAD – TEMA 9 CLOROPLASTOS Y MITOCONDRIAS 5


30. En relación con la célula eucariota: (Mod 2018 - A4) a) Conteste a las siguientes cuestiones: 1. ¿Cómo se llama el compartimento del orgánulo donde tiene lugar el ciclo de Calvin?; 2. Indique el lugar de la mitocondria donde se sitúa la cadena transportadora de electrones; 3. ¿Cuáles son dos de las principales funciones del Aparato de Golgi? (1 punto). b) Indique cuáles son los orgánulos o estructuras celulares definidos a continuación: 1. Orgánulo con membrana implicado en la síntesis de proteínas; 2. Lugar de síntesis del citoesqueleto; 3. Lugar de unión de los mi crotúbulos a los cromosomas; 4. Componente estructural mayoritario de las membranas celulares (1 punto). 31. Respecto a los componentes celulares: (Mod 2018 - B5) a) Explique la diferencia entre fagocitosis mediada por receptor y autofagia, poniendo un ejemplo de cada proceso (1 punto). b) Indique dos diferencias y dos similitudes entre mitocondrias y cloroplastos (1 punto).

------------------------------------------------------------------ CUESTIONES DE SELECTIVIDAD – TEMA 9 CLOROPLASTOS Y MITOCONDRIAS 6


FISIOLOGÍA CELULAR 10. EL NÚCLEO EN DIVISIÓN. EL CICLO CELULAR 1.

La meiosis ocurre en aquellas células que van a formar gametos: (mod 97 – A2) a) Explica por qué es necesario que se produzca la meiosis en este tipo de células (0,5 puntos) b) Relaciona la variabilidad genética de las especies con el proceso meiótico. (1 punto) c) Desde el punto de vista evolutivo, la reproducción sexual ¿presenta ventajas o inconvenientes frente a la reproducción asexual? Razona la respuesta. (0,5 puntos)

2.

Los dibujos representan diferentes etapas de la división de una célula. (mod 97 – B3)

a) Explica de qué división se trata y por qué, ordenando la secuencia correcta de las etapas. (1 punto) b) Explica si se trata de una célula vegetal o animal, aportando al menos dos razones. (0,5 puntos) c) ¿Qué diferencias existen entre las células resultantes de una mitosis y de una meiosis? (0,5 puntos) 3.

El dibujo representa una fase concreta del proceso meiótico: (jun 97 – A4) a) Explica razonadamente de qué fase y de qué división se trata. (1 punto) b) ¿Cuántos quiasmas se han producido, como mínimo, en esta meiosis? (0,5 puntos) c) ¿Cuántos cromosomas tiene el organismo al que pertenece esta célula? (0,5 puntos)

4.

Cromosoma metafásico: (sep 97 – A2) a) Explica cómo se condensa y empaqueta la molécula de DNA cuando pasa de profase a metafase durante la mitosis. (1 Punto) b) Dibuja un cromosoma metafásico, y señala una cromátida, el centrómero, un telómero y un brazo. (1 Punto)

--------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 10 NÚCLEO CELULAR Y DIVISIÓN 1


5.

El dibujo representa una célula eucarionte que se divide sucesivamente: (sep 97 – B3) a) Indica qué proceso representa y nombre las etapas 1, 2 y 3. (1 Punto) b) Explica dónde se da este proceso en la especie humana y por qué debe realizarse. (1 Punto)

6.

En una etapa de la meiosis los cromosomas homólogos se acercan formando parejas y se aparean ín timamente: (mod 98 – A3) a) ¿Qué nombre reciben estas parejas de cromosomas? (0,5 puntos) b) ¿Qué fenómeno ocurre en estas parejas que resulta en un aumento de variabilidad genética? (1 punto) c) ¿En qué etapa concreta se observan estas parejas de cromosomas? (0,5 puntos)

7.

En el dibujo de esta célula: (mod 98 – B1) a) Nombra 10 de los elementos señalados. (1 punto) b) Explica si se trata de una célula animal o vegetal y en qué fase del ciclo celular se encuentra. (1 punto)

8.

Meiosis. (mod 99 – A2)

a) Significado biológico de la meiosis. (0,5 puntos) b) Haz un esquema de una célula en anafase I meiótica de un organismo con 2n = 4 cromosomas en la que se haya producido un quiasma en uno de los bivalentes. (1 punto) c) Indica las diferencias más notables entre la anafase II meiótica y la anafase mitótica. (0,5 puntos) 9. En el cromosoma. (mod 99 – B1) a) Haz un esquema del cromosoma metafásico indicando los siguientes componentes: cromátida, brazo cromosómico, centrómero, telómero, constricción secundaria y cinetocoro. (1,5 puntos) b) Explica qué es un cariotipo. (0,5 puntos) 10. El cromosoma metafásico. (jun 99 – A2) a) Haz un esquema del cromosoma metafásico en el que señales y nombres todos los elementos o partes que conozcas. (1,5 puntos) b) Nombre los tipos morfológicos de cromosomas metafásicos que conozcas. (0,5 puntos) --------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 10 NÚCLEO CELULAR Y DIVISIÓN 2


11. En relación con la meiosis: (jun 99 – B3) a) Para una especie 2n = 6 haz un esquema de la metafase I meiótica. (1 punto) b) ¿Por qué se dice que la primera división meiótica es reduccional? (0,5 puntos) c) ¿Cuál es el significado genético de la meiosis? (0,5 puntos) 12. Las células vegetales están rodeadas por una envoltura denominada pared celular. (sep 99 – B2) a) Explica la composición química y la estructura de dicha pared. (1 punto) b) Indica dos funciones que desempeñe la pared en la célula vegetal. (0,5 puntos) c) Indica el principal orgánulo implicado en la formación de la pared celular y en qué fase de la mitosis se origina. (0,5 puntos) 13. La gráfica representa la variación del contenido de ADN por célula durante un supuesto ciclo celular. Responde razonadamente a las siguientes preguntas: (sep 99 – B3) a) ¿Qué ocurre en el intervalo de tiempo entre 1 y 2 y cómo se denomina esta fase? (0,5 puntos) b) ¿ Cómo se llaman las fases que tienen lugar en el intervalo comprendido entre 2 y 3? (1 punto) c) Nombra la fase en que el contenido de ADN es mínimo. (0,5 puntos)

14. En relación con la meiosis: (mod 00 – A3) a) Indica el significado biológico de la meiosis. (1 punto) b) Haz un esquema de una célula en metafase I con 2n = 4 cromosomas. (1 punto) 15. Desde que una célula se origina hasta que se divide en dos células hijas, hay dos etapas claramente diferenciadas en el ciclo celular. (mod 00 – B3) a) b) c) d)

¿Qué nombre recibe cada una de estas etapas? (0,5 puntos) ¿En qué fases se subdivide cada etapa? (0,5 puntos) Menciona en qué momentos del ciclo celular hay cambios en la cantidad de ADN. (0,5 puntos) Menciona un ejemplo de célula que no experimente división celular una vez que ha alcanzado la diferenciación. (0,5 puntos)

16. En relación con los procesos de mitosis y meiosis de los organismos pluricelulares. (jun 00 – B3) a) ¿En cuál de estos dos procesos se produce recombinación genética? Menciona el mecanismo responsable de la recombinación. (0,5 puntos) b) ¿En qué tipos de células tienen lugar la mitosis y la meiosis? (0,5 puntos) c) ¿Cuántas células hijas se producen en cada uno de ellos? (0,5 puntos) d) Explica el significado biológico del proceso de la meiosis. (0,5 puntos) 17. Respecto al ciclo celular. (sep 00 – A3) a) Define el estado de interfase de dicho ciclo, e indica en qué forma se encuentra el material genético de la célula en ese estado. (0,5 puntos) b) Señala los distintos períodos en los que se divide la interfase. (0,75 puntos) c) Explica lo que ocurre en cada uno de ellos. (0,75 puntos) 18. En relación con los procesos de mitosis y meiosis celulares: (sep 00 – B3) a) Haz un esquema comparativo entre la metafase mitótica y la primera metafase meiótica en un organismo 2n = 4 cromosomas. (1 punto) b) Durante la mitosis, indica en qué momento se transforma la cromatina en cromosomas y cuándo se transfor man los cromosomas en cromatina. (0,5 puntos) c) En la meiosis: indica en qué fase o periodo se separan los cromosomas y en qué periodo o fase se separan las cromátidas. (0,5 puntos)

--------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 10 NÚCLEO CELULAR Y DIVISIÓN 3


19. En relación con los procesos de mitosis y meiosis: (mod 01 – A3) a) ¿En cuál de los dos procesos se producen bivalentes?. Dibuja un bivalente (0,5 puntos) b) Menciona en qué fase se separan los bivalentes y explica qué acontecimientos tienen lugar durante un me tafase mitótica. (0,75 puntos) c) Dibuja la anafase I meiótica de un organismo 2n = 6 cromosomas. (0,75 puntos) 20. Con relación a los procesos de mitosis y meiosis en células animales o vegetales superiores: (jun 01 – A3) a) ¿En qué tipo de células de estos organismos tiene lugar la meiosis? ¿Y la mitosis? (0,5 puntos) b) ¿En cuál de estos procesos y en qué fase del mismo se produce sobrecruzamiento? Haz un esquema gráfico del sobrecruzamiento. (0,5 puntos) c) Explica la importancia biológica de la meiosis. (1 punto) 21. Respecto a los procesos de mitosis y meiosis, y para un organismo con 2n = 8 cromosomas: (jun 01 – B3) a) Si se tratara de un vegetal, dibuja una anafase II. ¿Cuáles son las diferencias respecto a la anafase I? (1 punto) b) Indica las principales diferencias entre la citocinesis de una célula animal y la de una vegetal. (0,5 puntos) c) ¿Qué cantidad de ADN tendría esta célula durante la metafase I? Razona la respuesta. (0,5 puntos) 22. Con relación a la meiosis de una célula vegetal: (sep 01 – A3) a) Dibuja la anafase I y la anafase II para 2n = 6. (1 punto) b) Explica los acontecimientos que tienen lugar durante la profase I. (1 punto) 23. Respecto al proceso meiótico: (sep 01 – B3) a) ¿Cómo se denomina la estructura que se forma por el apareamiento de cromosomas homólogos? ¿En qué fase del proceso se lleva a cabo? (0,5 puntos) b) Define los siguientes términos: quiasmas, meiocito, gameto, cinetocoro. (1punto) c) Para una célula con 2n = 6 cromosomas: ¿cuántas cromátidas existen en cada polo en anafase II? Razona la respuesta. (0,5 puntos) 24. Respecto al ciclo celular de los organismos eucarióticos: (mod 02 – A3) a) Indica las etapas del mismo, y haz una breve descripción de los principales acontecimientos que tienen lu gar en cada una de ellas. (1 punto) b) Una célula haploide, ¿puede experimentar meiosis? Razona la respuesta. (0,5) puntos. c) Explica en qué se diferencia la metafase mitótica de la metafase I de la meiosis. (0,5 puntos) 25. Con relación a los procesos de mitosis y meiosis: (mod 02 – B3) a) Señala dos diferencias entre ambos. (0,5 puntos) b) Haz un dibujo de la anafase mitótica para una célula 2n = 6. (0,5 puntos) c) Explica la importancia biológica del proceso meiótico. (1 punto) 26. Con referencia al ciclo celular y a los procesos de división: (jun 02 – A3) a) Define los siguientes términos: periodo G1; cromosoma homólogo; sobrecruzamiento; haploide. (1 punto) b) Haz un esquema gráfico de una anafase II meiótica y de una anafase mitótica en un vegetal con una dóta ción cromosómica 2n = 6. (0,5 puntos) c) Explica el significado biológico de la mitosis. (0,5 puntos) 27. Considerando el proceso meiótico: (jun 02 – B3) a) ¿Puede una célula haploide sufrir meiosis? Razona la respuesta (0,5 puntos) b) ¿Podría un organismo haploide sufrir meiosis en alguna parte de su ciclo? Razona tu respuesta. (0,5 puntos) c) Explica la importancia biológica de la meiosis. (1 punto)

--------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 10 NÚCLEO CELULAR Y DIVISIÓN 4


28. Con respecto a la división meiótica: (sep 02 – A3) a) Explica qué es la meiosis cigótica y la meiosis gametogénica. Indica en cada caso en qué tipo de organismos se lleva a cabo. (0,5 puntos) b) Explica la importancia biológica de la meiosis. (1 punto) c) Dibuja una anafase II para una dotación cromosómica 2n=6. (0,5 puntos) 29. Respecto al procesó de división celular en animales y en vegetales superiores: (sep 02 – B3) a) Haz un esquema gráfico de una anafase mitótica en una célula animal y en una célula vegetal para una do tación cromosómica de 2n=6. (1 punto) b) Explica en qué difiere la citocinesis típica de una célula animal y la de una célula vegetal. (1 punto) 30. Con relación al proceso meiótico: (mod 03 – A3) a) Indica cuándo se produce el reparto de las cromátidas hermanas entre los núcleos hijos. Razona la respuesta. (0,5 puntos) b) Explica el significado biológico de la meiosis (1 punto). c) Para una dotación cromosómica 2n = 4, haz un esquema gráfico de la anafase II. (0, 5 puntos) 31. En una célula somática de una especie animal con un número cromosómico 2n=6. (jun 03 – A3) a) Representa un esquema de una profase y de una metafase. (1 punto) b) ¿Cuáles son los eventos principales de la anafase y de la telofase?. (1 punto) 32. Referido al ciclo celular: (jun 03 – B3) a) Dibuja un esquema de las etapas del ciclo celular indicando cada una de sus fases en sucesión cronológica. (1 punto) b) Define y explica brevemente el significado biológico de G 0 y de S. (1 punto) 33. En un organismo eucariótico de reproducción sexual, con un número cromosómico 2n=4 y todos los cromosomas telocéntricos: (sep 03 – A3) a) Dibuja un esquema de una anafase II. (1 punto) b) ¿Cuál es el sentido biológico de la meiosis? (1 punto) 34. Realiza un esquema y enumera las características principales de: (sep 03 – B3) a) Citocinesis en una célula animal. (1 punto) b) Citocinesis en una célula vegetal. (1 punto) 35. La figura adjunta representa células de un organismo diploide en división. (mod 04 – A3) a) ¿Estas células están en división meiótica o mitótíca? Razona, la respuesta. (1 punto) b) ¿En qué etapa de la mitosis o de la meiosis se encuentran? Razona la respuesta. (1 punto)

36. En relación con los cromosomas: (mod 04 – B3) a) Realiza un esquema de un cromosoma en metafase mitótica y señala las partes principales del mismo. (1 punto) b) ¿Cómo se clasifican en relación con la posición que ocupa la constricción primaria? Define cada uno de ellos. (1 punto)

--------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 10 NÚCLEO CELULAR Y DIVISIÓN 5


37. Con referencia a los procesos de división celular y reproducción de los organismos: (jun 04 – B3) a) Indique la importancia biológica del proceso mitótico (0,5 puntos). b) Suponiendo una dotación cromosómica de 2n=6, represente gráficamente una anafase mitótica y una anafase II meiótica (1 punto). c) Defina los siguientes conceptos: cromosoma homólogo, cromátidas hermanas (0,5 puntos). 38. Con referencia a los procesos de división celular eucariótica: (sep 04 – A3) a) Establezca tres diferencias entre los acontecimientos que tienen lugar durante la profase mitótica y la profase I meiótica (1 punto). b) ¿Qué representa la meiosis en la reproducción y variabilidad de las especies? (0,5 puntos). c) Haga un esquema de un bivalente indicando sus componentes (0,5 puntos). 39. Una determinada especie animal tiene tres pares de cromosomas: (jun 04 – A3) a) Indique cuántos cromosomas tendrá un espermatozoide, ¿cuántos tendrá un óvulo? Razone la respuesta (0,5 puntos). b) Haga un esquema de la metafase mitótica de una célula de ese organismo (0,5 puntos). c) Indique en qué tipo de células de ese animal se llevaría a cabo la mitosis, ¿y la meiosis? (0,5 puntos). d) ¿Qué tipos de espermatozoides puede formar ese animal en función de los cromosomas sexuales? Razone la respuesta (0,5 puntos). 40. Con referencia al ciclo celular de una célula eucariótica: (sep 04 – B3) a) Dibuje un cromosoma metacéntrico y otro acrocéntrico, cada uno de ellos en metafase y anafase mitóticas indicando en cada caso sus diversas partes o componentes (1 punto). b) Indique cuales son las diferencias más notables entre el significado biológico de la mitosis y de la meiosis (1 punto). 41. Con referencia al ciclo celular de un organismo con dos pares de cromosomas homólogos, uno acrocéntrico y otro metacéntrico: (mod 05 – A3) a) Haga un esquema gráfico de una anafase mitótica. (0,5 puntos) b) Describa los principales acontecimientos que tienen lugar en la profase mitótica. (1 punto) c) Indique una similitud y una diferencia entre una anafase mitótica y una anafase II meiótica. (0,5 puntos) 42. En relación a los cromosomas metafásicos: (jun 05 - A3) a) Defina qué son los telómeros e indique cuantos tendría un cromosoma metacéntrico en la metafase mitótica (0,5 puntos). b) Explique qué entiende por centrómero y por cinetocoro (0,5 puntos). c) ¿Cuántos brazos y cuántas cromátidas tendría un cromosoma metacéntrico, y uno telocéntrico? (0,5 puntos) d) Realice una representación gráfica de una pareja de cromosomas metacéntricos y otra de telocéntricos en metafase mitótica, y señale la presencia de una constricción secundaria en la pareja de metacéntricos (0,5 puntos). 43. Con relación a la división celular: (jun 05 - B3) a) Respecto a la citocinesis: (1) ¿en qué consiste?, (2) ¿cuándo ocurre?, (3) ¿qué diferencia básica existe en tre la citocinesis de una célula animal y de una vegetal?, y (4) ¿cómo se denominan las estructuras que facilitan la citocinesis en ambos tipos de células? (1 punto). b) Respecto a la anafase: (1) ¿qué regiones cromosómicas interactúan con los microtúbulos?, (2) ¿qué les su cede a esos microtúbulos?, (3) ¿qué estructuras migran a polos opuestos en la anafase de la meiosis?, y (4) ¿qué estructuras migran en la anafase II de la meiosis? (1 punto). 44. En relación a la división de una célula somática animal: (sep 05 – A3) a) ¿Qué sucesos ocurren durante la profase? (0,5 puntos). b) ¿Qué diferencias existen entre la anafase y la telofase? (1 punto). c) Realice un esquema de una célula con 2n=4 en anafase (0,5 puntos).

--------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 10 NÚCLEO CELULAR Y DIVISIÓN 6


45. Respecto a la división celular: (sep 05 – B3) a) Cite cuatro sucesos que ocurren en la profase de una célula somática (1 punto). b) Identifique, y explique, los dos tipos de anafase que aparecen representadas a continuación teniendo en cuenta que las células tienen dos cromosomas telocéntricos (1 punto).

46. Con relación a la meiosis: (mod 06 – A3) a) ¿Qué sucesos específicos ocurren durante la profase de la primera división meiótica? (0,5 puntos). b) ¿Qué es un quiasma, y cuándo se visualiza? (0,5 puntos). c) ¿Qué sucede en la anafase de la primera división meiótica? (0,5 puntos). d) En la representación mostrada a la derecha aparece un bivalente al final de la profase de la primera división meiótica. ¿Qué error presenta ese esquema? Realice un esquema en el cual el error esté subsanado (0,5 puntos). 47. Con relación a la meiosis: (mod 06 – B3) a) Explique cómo se genera la variabilidad genética (0,5 puntos). b) ¿Cuántas divisiones ocurren durante la meiosis, y cuántas células se generan a partir de una célula? (0,5 puntos). c) Teniendo en cuenta un organismo con 2n=4, copie y complete el siguiente cuadro (1 punto). Metafase meiótica I

Metafase meiótica I

Número de cromosomas Número de bivalentes Número de cromátidas por cromosoma Ploidía de la célula 48. Con referencia al ciclo celular en células somáticas: (jun 06 – A3) a) Explique qué es la interfase e indique qué sucede en cada una de las etapas en las que se subdivide (1 punto). b) Defina los siguientes términos: (1) Centrómero; (2) Cromátidas hermanas; (3) Bivalentes; y (4) Telómeros (1 punto). 49. Con relación al proceso meiótico de un organismo 2n=6: (jun 06 – B3) a) ¿Cuándo se produce la formación de bivalentes? Explique brevemente en qué consiste (0,5 puntos). b) Haga un esquema de la anafase II (0,5 puntos) c) Explique el significado biológico de la meiosis (1 punto). 50. Con referencia al ciclo de división celular: (sep 06 – A3) a) Suponga que el valor C es la cantidad de ADN por genoma haploide. Utilizando dicho valor, exprese la va riación que sufre el contenido de ADN en cada una de las fases del ciclo celular de una célula somática de un organismo diploide (1 punto). b) Copie y complete la tabla adjunta, indicando en la columna de la derecha a qué corresponden los conceptos de la columna de la izquierda (1 punto). (1) Los cromosomas que son similares en dimensiones, forma y contenido genético se llaman (2) La desaparición del nucléolo tiene lugar durante (3) Durante la citocinesis vegetal, la constitución de la pared en las células hijas tiene lugar gracias a la formación de un tabique llamado (4) La síntesis de ADN de un meiocito tiene lugar durante

--------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 10 NÚCLEO CELULAR Y DIVISIÓN 7


51. Con referencia a los procesos de división celular: (sep 06 – B3) a) Indique las dos diferencias más aparentes entre la telofase de una mitosis astral y la de una anastral. Men cione un tipo de organismos en los que se da cada una de ellas (1 punto). b) Indique los acontecimientos que tiene lugar durante la telofase mitótica (1 punto). 52. Con referencia a las divisiones celulares de los organismos eucarióticos: (mod 07 – A3) a) Explique razonadamente las diferencias entre los cromosomas metafásicos mitóticos y los de ambas metafases meióticas (1 punto). b) Para una célula animal con 2n=4, indique: (1) Células resultantes en mitosis y en meiosis; (2) Número de cromátidas en un núcleo hijo mitótico y en un núcleo hijo meiótico; (3) Número de citocinesis en mitosis y en meiosis; (4) Número de bivalentes en mitosis y en meiosis (1 punto). 53. Con referencia a los ciclos de división celular: (mod 07 – B3) a) El esquema adjunto representa cromosomas eucarióticos que se encuentran en mitosis. Indique la fase o fases en las que se podrían observar es tos cromosomas. ¿Podría ser también una metafase I meiótica? Razone las respuestas (1 punto). b) Con referencia al mismo esquema, indique su nivel de ploidía. ¿Se trata de una célula somática o de un gameto? (0,5 puntos). c) Explique el significado de la meiosis con relación a la variabilidad genética (0,5 puntos).

54. Los esquemas del dibujo adjunto representan células de la raíz de un vegetal en diversas fases de la mitosis: (jun 2007 – A3) a) Nombre la fase en la que se encuentran las células numeradas razonando la respuesta (1,5 puntos). b) ¿De dónde parten las fibras del huso mitótico en este tipo de células? (0,5 puntos).

55. Suponga una célula vegetal con tres pares de cromosomas que sufre una mitosis. Cada una de las cé lulas resultantes sufre posteriormente una meiosis: (jun 07 – B3) a) ¿Cuántas células se han producido al final de ambos procesos? Razone la respuesta (0,5 puntos). b) Indique la dotación cromosómica que tiene cada una de ellas. Razone la respuesta (0,5 puntos). c) Haga un dibujo esquemático sencillo de la anafase mitótica y otro de la primera anafase meiótica (1 punto). 56. Con referencia a la división celular: (sep 07 – A3) a) Haga un esquema gráfico de las anafases I y II de un organismo animal con 2n=4 (1 punto). b) Describa los principales acontecimientos que tienen lugar durante la citocinesis de una célula vegetal y la de una célula animal (1 punto).

--------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 10 NÚCLEO CELULAR Y DIVISIÓN 8


57. Referente a los procesos de división celular: (sep 07 – B3) a) Suponga que los cromosomas del esquema adjunto corresponden a una pareja de homólogos. ¿Qué ha acontecido entre ellos y cómo se denomina el proceso? (0,5 puntos).

b) Copie y complete el siguiente cuadro (1 punto) (1) La división del citoplasma se denomina … (2) Los homólogos se aparean entre sí, originándose en la zona de contacto una estructura llamada … (3) La desespiralización de los cromosomas ocurre en… (4) La síntesis de ADN se produce durante … c) Explique dos diferencias entre mitosis y meiosis (0,5 puntos). 58. Referente a la división celular: (mod 08 – A3) a) ¿Qué nombre reciben las parejas de cromosomas apareados? ¿en qué proceso y etapa del mismo se ob servan dichas parejas? (0,5 puntos). b) Haga un esquema gráfico del contenido de ADN a lo largo del ciclo celular de una célula somática suponien do que la cantidad de ADN gamética es C (1 punto). c) Explique brevemente el significado de la meiosis respecto a la variabilidad de los seres vivos (0,5 puntos). 59. Con referencia a los procesos de división celular: (mod 08 – B3) a) En el ser humano y otros mamíferos: ¿Tiene lugar una meiosis gametogénica o cigótica? Razone la res puesta (0,5 puntos). b) Dibuje un cromosoma submetacéntrico indicando el nombre de cada una de las partes del mismo (0,5 puntos). c) Indique cuál de las dos partes de la meiosis es reduccional. Explique los principales acontecimientos que tienen lugar durante la misma (1 punto). 60. El esquema adjunto representa las distintas fases por las que pasa una célula en su ciclo celular. (jun 08 – A3) a) Sabiendo que el número 2 representa la telofase, indique qué representarían todos los demás números (1 punto). b) Indique cuatro procesos celulares que se producen durante la interfase celular (1 punto).

61. El genoma de una especie animal diploide está formado por 4 cromosomas, de los cuales, un par posee estructura metacéntrica y otro estructura acrocéntrica. (jun 08 – B3) a) Dibuje una anafase mitótica, e indique todas las estructuras características de esta fase (1 punto). b) Dibuje la dotación cromosómica de un gameto de esta especie, y cite cómo se denomina el proceso que conduce a la formación de los gametos (0,5 puntos). c) Respecto a la variabilidad genética, explique la importancia de la meiosis en la evolución de las especies (0,5 puntos).

--------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 10 NÚCLEO CELULAR Y DIVISIÓN 9


62. El siguiente dibujo representa una pareja de cromosomas homólogos durante la meiosis, y las letras representan los genes presentes en estos cromosomas. (sep 08 – A3) a) Si se produce un sobrecruzamiento en el lugar indicado con una cruz, dibuje todos los gametos posibles formados tras el proceso de meiosis (1 punto). b) En qué fase de la división meiótica se produce el sobrecruzamiento. Explique las consecuencias biológicas que conlleva este proceso (1 punto).

63. Con relación a la división celular por mitosis: (sep 08 – B3)

a) Cite de forma secuencial las diferentes etapas del proceso. Para ello escriba en orden adecuado las letras asignadas a los diferentes dibujos (0,5 puntos). b) Describa cuatro acontecimientos que están ocurriendo en la fase representada en el dibujo C (1 punto). c) Razone si se trata de una célula animal o vegetal (0,5 puntos). 64. La gráfica adjunta representa la variación del contenido de ADN a lo largo del ciclo celular de un deter minado tipo de células. (mod 09 – A3) a) Explique cómo cambia el contenido de ADN desde la fase A hasta la fase G, razonando el tipo de división celular que se ha producido (1,5 puntos). b) Nombre la fase a la que corresponda la letra A e indique dos acontecimientos que se producen en dicha fase (0,5 puntos).

65. Cuando en el laboratorio se cultivan células, se observa que pasan por una primera etapa de creci miento, donde su actividad metabólica es muy intensa, y una segunda etapa donde las células presen tan su estructura interna muy modificada (material genético visible en forma de cromosomas). (mod 09 – B2) a) ¿Cómo se denominan cada una de las etapas anteriormente descritas? (0,5 puntos). b) Si las células cultivadas tuvieran 4 cromosomas. ¿Aumentaría el número de cromosomas en la fase donde se duplica la cantidad de ADN? Razone la respuesta (0,5 puntos). c) La tubulina es una proteína sintetizada durante la etapa de gran actividad metabólica para formar el huso acromático. ¿Qué misión desempeña el huso acromático y en qué fase comienza a observarse en las célu las? (1 punto).

--------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 10 NÚCLEO CELULAR Y DIVISIÓN 10


66. Los dibujos adjuntos representan los posibles gametos de un determinado individuo que presenta mitosis astrales. (jun 09 – A3)

a) Haga un esquema de la metafase de una célula somática de ese individuo, indicando su constitución genética (1 punto). b) El individuo en cuestión, ¿es diploide o haploide? Razone su respuesta (0,5 puntos). c) Defina gameto y cigoto (0,5 puntos). 67. Con referencia al proceso meiótico: (jun 09 – B4) a) Dibuje una anafase II para una dotación cromosómica 2n=6 en la que un par de cromosomas es metacéntrico y los otros dos pares son acrocéntricos (0,5 puntos). b) Explique la diferencia entre la meiosis cigótica y la meiosis gametogénica. Indique en cada caso en qué tipo de organismos se lleva a cabo (0,5 puntos). c) Explique la importancia biológica de la meiosis (1 punto). 68. Con referencia al ciclo celular de una célula somática: (sep 09 – A3) a) Indique en orden cronológico las distintas fases del ciclo en las que los cromosomas están constituidos por dos cromátidas. Razone las contestaciones (1 punto). b) Suponiendo que se tratase de una célula vegetal, indique a partir de qué orgánulos se forman la envoltura nuclear y la pared celular de las células hijas (0,5 puntos). c) Indique la constitución química de las fibras del huso acromático. ¿En qué fase tiene lugar la formación del huso? (0,5 puntos). 69. Con referencia a los procesos de división celular y la herencia: (mod 2010 – A4) a) Copie y complete la siguiente tabla (puede haber más de una contestación por cuadro) (1 punto). ACONTECIMIENTO CELULAR

FASE/FASES

Los cromosomas homólogos se emparejan mediante sinapsis Se separan cromátidas hermanas Se separan bivalentes El material genético está duplicado (en mitosis) b) ¿Cómo se relacionan las leyes de Mendel de la segregación y de la transmisión independiente con la mitosis y la meiosis? (1 punto). 70. Considérese el ciclo celular de un organismo que posee dos pares de cromosomas y presenta divisiones celulares astrales: (mod 2010 – B5) a) Haga una representación gráfica de la anafase mitótica y de la anafase I meiótica. Indique las principales di ferencias entre ambas (1 punto). b) Defina citocinesis e indique los principales acontecimientos que tienen lugar durante la citocinesis de las cé lulas del mencionado organismo (0,5 puntos). c) Si el organismo en cuestión posee un genotipo AaBb, indique el genotipo de sus células producidas por mi tosis y el genotipo de las células resultantes de meiosis (0,5 puntos). 71. Referente a la división celular: (jun gen 2010 – A3) a) Haga un esquema gráfico del contenido de ADN a lo largo del ciclo celular de una célula somática suponien do que la cantidad de ADN gamética es C (1 punto). b) Explique brevemente el significado de la meiosis respecto a la variabilidad de los seres vivos (0,5 puntos). c) Indique qué tipo de meiosis (cigótica o gametogénica) tiene lugar en el ser humano y otros mamíferos: Ra zone la contestación (0,5 puntos). --------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 10 NÚCLEO CELULAR Y DIVISIÓN 11


72. Referente al ciclo celular de un organismo 2n=6, cuyas células presentan mitosis anastrales: (sep 2010 – A3)

a) Haga un esquema de la metafase y otro de la anafase mitótica (0,5 puntos). b) Si los 6 cromosomas del organismo equivalen a 10 pg de ADN, ¿qué cantidad de ADN tendrá una célula de ese organismo en los periodos G1 y G2? Razone su respuesta (0,5 puntos). c) Explique el significado biológico de los procesos de mitosis y de meiosis (1 punto). 73. Con referencia a los ciclos de reproducción celular: (sep 2010 – B3) a) Copie y complete el siguiente cuadro en su hoja de examen indicando el proceso o procesos, así como las fases en que ocurren los siguientes acontecimientos (1,25 puntos). ACONTECIMIENTO CELULAR

PROCESO (S)/FASE(S)

1) Los homólogos se aparean mediante sinapsis 2) El ADN se replica 3) Las células hijas son diploides 4) Las cromátidas hermanas se separan 5) Existe sobrecruzamiento b) Los organismos eucarióticos se pueden reproducir asexual y/o sexualmente. Indique tres diferencias entre estos dos procesos (0,75 puntos). 74. Con referencia a los procesos de división celular y la herencia: (mod 2011 – A4) a) Copie y complete la siguiente tabla (1 punto). ACONTECIMIENTO CELULAR

FASE O FASES

1) Los cromosomas homólogos se emparejan mediante sinapsis 2) Se separan cromátidas hermanas 3) Se separan bivalentes 4) El material genético está duplicado (en mitosis) b) ¿Cómo se relacionan las leyes de Mendel sobre los principios de la segregación y de la transmisión independiente con la mitosis y la meiosis? (1 punto). 75. Referente a un organismo eucariota con reproducción sexual, cuyo número de cromosomas es 2n=4, de los que una pareja es acrocéntrica y la otra metacéntrica: (jun 2011 – A1) a) Dibuje un esquema de una célula en anafase 1 de la meiosis (1 punto). b) ¿Cuál es el sentido biológico de la mitosis? (1 punto). 76. Con referencia al proceso de mitosis. (jun 2012 - B3) a) Identifique las estructuras que vienen señaladas con los números del 1 al 4 (1 punto). b) Defina las estructuras señaladas con los números 1, 2 y 3 e indique la ploi día de la célula (1punto).

77. Con relación al ciclo celular: (jun 2011 - B2) a) Defina brevemente qué es la Interfase y las etapas en las que se subdivide (1 punto). b) Indique cuál de las dos partes de la meiosis es reduccional. Explique los principales acontecimientos que tienen lugar durante la misma (1 punto). 78. Con referencia al proceso meiótico: (Sept 2011 – A1) a) Defina qué es el sobrecruzamiento (0,5 puntos). b) Haga un esquema de cómo se lleva a cabo el sobrecruzamiento y señale en qué fase se produce (1 punto). c) Mencione cuáles son las diferencias entre anafase I y anafase II ( 0 , 5 puntos). --------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 10 NÚCLEO CELULAR Y DIVISIÓN 12


79. Con referencia a los procesos de mitosis y meiosis en organismos pluricelulares: (Sept 2011 – B2) a) ¿En cuál de estos dos procesos se produce recombinación genética? Explique el mecanismo responsable de la recombinación (0,5 puntos). b) Indique en qué tipos de células tienen lugar la mitosis y la meiosis, cuántas células hijas se producen en cada uno de estos procesos y, con referencia a los cromosomas, ¿cómo son las células hijas con respecto a la célula de la que proceden? (0,5 puntos). c) Explique el significado biológico del proceso de la meiosis (1 punto). 80. Con referencia a las células musculares cardíacas y a las células plasmáticas productoras de anticuerpos de una determinada especie de mamífero: (Mod 2012 – A3) a) ¿Cuál de los dos tipos celulares tendrá mayor abundancia de mitocondrias? ¿Cuál tendrá más ribosomas? Dé una explicación a ambas respuestas (1 punto). b) Si el número diploide de la especie en cuestión es 46, ¿cuántos cromosomas tendrán las células del tejido cardiaco? ¿y las células plasmáticas? ¿y un espermatozoide? ¿y un óvulo? (1 punto). 81. Con referencia al ciclo celular: (Mod 2012 – A4) a) Copie y complete el siguiente cuadro en su hoja de examen (1 punto). 1. Región en la que se unen las cromátidas hermanas 2. Etapa en la que se forma el huso mitótico 3. Si una célula contiene 40 cromátidas en metafase de mitosis, ¿Cuántos cromosomas tendrá cada una de las células hijas? 4. Fase del ciclo en la que se vuelve a originar la envoltura nuclear b) Indique los principales acontecimientos que tienen lugar durante la profase mitótica (1 punto). 82. El dibujo representa una célula en un momento concreto de su ciclo. (Mod 2012 – B3) a) Indique el tipo de división celular y la fase del mismo representada. Identifique cada una de las estructuras señaladas con números (1 punto). b) Razonando su contestación, indique si se trata de una célula animal o vegetal (0,5 puntos). c) Describa brevemente los tipos cromosómicos representados (0,5 puntos).

83. Con referencia a los procesos de división celular en una célula animal: (Sep 2014 – A4) a) Escriba las respuestas correspondientes a los números del 1 al 4 comparando la mitosis y la meiosis (no es necesario copiar la tabla) (1 punto). Mitosis

Meiosis

1.- ¿Se produce recombinación genética? 2.- Tipo de células en las que se produce 3.- Dotación cromosómica de las células hijas 4.- ¿En qué fase se separan las cromátidas? b) Significado biológico de la meiosis (1 punto).

--------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 10 NÚCLEO CELULAR Y DIVISIÓN 13


84. Con referencia a la división celular de un organismo que presenta dos pares de cromosomas y mitosis y meiosis astrales: (Mod 2013 – A5) a) Haga una representación gráfica de la primera anafase meiótica (0,5 puntos). b) Indique las principales diferencias entre la anafase mencionada y la anafase mitótica (0,5 puntos). c) Indique las principales diferencias entre la citocinesis de las células animales y vegetales (1 punto). 85. Con referencia a los procesos de división celular: (Jun 2013 – A4) a) Escriba las respuestas correspondientes a los números del 1 al 4 (no es necesario copiar la tabla) (1 punto). 1. Tipo de célula en la que se forma el fragmoplasto 2. Tipo de célula en la que se forma el anillo contráctil o surco de división 3. Orgánulo que origina la estructura que se forma en la citocinesis de las células vegetales 4. Nombre el periodo del ciclo celular en el que se duplican los cromosomas b) Indique cuatro diferencias entre la mitosis y la meiosis (1 punto). 86. Con referencia a las células eucariotas: (Jun 2013 – B2) a) Asocie la letra de la estructura indicada en la columna izquierda con el número más adecuado correspon diente a las funciones celulares reseñadas en la columna derecha. No es necesario que copie la tabla (res ponda por ejemplo I-9) (1 punto). (A) Retículo endoplásmico

(1) Modifica proteínas que serán secretadas

(B) Lisosoma

(2) Mantiene la forma celular

(C) Mitocondria

(3) Síntesis de ADN

(D) Aparato de Golgi

(4) Ayuda a reciclar materia orgánica celular

(E) Vacuola

(5) Contiene su propio ADN y ribosomas

(F) Peroxisoma

(6) Compartimento que acumula reservas

(G) Núcleo

(7) Contiene enzimas que producen H2O2

(H) Pared

(8) Sintetiza proteínas y lípidos

(I) Cloroplasto

(9) Fotosíntesis

b) Defina los siguientes términos: nucléolo, nucleoplasma, telómero y cinetocoro (1 punto). 87. Con referencia a los procesos de división celular: (Jun 2013 – B5)

a) Identifique el tipo de división celular y las fases representadas en los dibujos A y B (0,75 puntos). b) Indique el número de células resultantes del proceso y el nivel de ploidía de la célula inicial y de las células hijas (0,75 puntos). c) Razone si se trata de una célula animal o vegetal (0,5 puntos).

--------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 10 NÚCLEO CELULAR Y DIVISIÓN 14


88. EI dibujo representa una célula en un momento concreto de su ciclo.

(Sep 2013 – A4)

a) Indique el tipo de división celular y la fase representada (0,5 puntos). b) Identifique y defina los tipos de cromosomas representados (1 punto). c) Razone si se trata de una célula animal o vegetal (0,5 puntos).

89. Con referencia al proceso de meiosis en Ia especie humana (2n=46): (Sep 2013 – B4) a) Escriba las respuestas correspondientes a los números del 1 al 4 (no es necesario copiar la tabla) (1 punto). 1.

¿Cuál es el número de bivalentes/tétradas que se forman en la profase l?

2.

¿En qué fase se producen células haploides?

3.

Número de cromosomas en las células resultantes

4.

Nombre el proceso por el cual se separa el citoplasma

b) Realice un esquema rotulado de una anafase mitótica en una célula animal 2n=2 y explique los principales acontecimientos que tienen lugar durante la misma (1 punto). 90. Con referencia aI ciclo celular: (Mod 2014 – A3) La grafica adjunta representa la variación de la cantidad de ADN de una célula que ha experimentado un ciclo celular completo.

a) Identifique las fases representadas con las letras A, B, C y D explicando la variación del contenido de ADN (1 punto). b) Significado biológico de la meiosis (1 punto). 91. Con referencia a Ios procesos de división celular: (Mod 2014 – B4) a) Escriba Ias respuestas correspondientes a los números del 1 al 4 comparando la mitosis y la meiosis (no es necesario copiar la tabla) (1 punto). Mitosis

Meiosis

1. ¿Qué estructuras se separan y desplazan mediante las fibras del huso acromático en la anafase/ anafase l? 2. Nivel de ploidía de Ias células hijas 3. ¿Se produce reducción del número de cromosomas? 4. Número de células resultantes b) Defina Ios siguientes conceptos: sinapsis, sobrecruzamiento/crossing over, quiasma y bivalente (o tétrada) (1 punto).

--------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 10 NÚCLEO CELULAR Y DIVISIÓN 15


92. Con referencia al ciclo celular: (Jun 2014 – A2) a) Escriba las respuestas correspondientes a los números del 1 al 4 (no es necesario copiar la tabla) (1 punto). 1. ¿Cuantas cromátidas tiene un cromosoma en el periodo G 2? 2. Periodo en el que se produce la síntesis de histonas 3. La división del núcleo se denomina 4. Periodo entre el final de la citocinesis y la replicación del ADN b) Realice un esquema rotulado de una anafase mitótica en una célula animal 2n=4 y explique los principales acontecimientos que tienen lugar durante la misma (1 punto). 93. Con referencia a los procesos de división celular: (Jun 2014 – B5) a) Realice un esquema rotulado de un cromosoma y señale una cromatida, un telómero, el centrómero y un brazo (1 punto). b) Defina los tipos de cromosomas según la posición que ocupa la constricción primaria (1 punto). 94. Con referencia a los cromosomas en los procesos de división celular: (Sep 2014 – B1)

a) Identifique y defina los tipos de cromosomas representados (1,25 puntos). b) Dibuje la figura D y señale tres de las estructuras que lo componen (0,75 puntos). 95. Con referencia a los procesos de división celular: (Mod 2015 – A3) A

B

C

D

a) Identifique el tipo de división celular, nombre las fases representadas en las figuras y ordene éstas cronoló gicamente (0,75 puntos). b) Indique si es una célula animal o vegetal y explique cuatro acontecimientos que tienen lugar en la figura B (1,25 puntos). 96. Con referencia al proceso de meiosis: (Mod 2015 – B2) a) Escriba las respuestas correspondientes a los números del 1 al 4 (no es necesario copiar la tabla) (1 punto). 1. Fase en la que las cromátidas hermanas se desplazan a cada uno de los polos de la célula 2. Fase en la que los bivalentes se disponen en el plano ecuatorial 3. Fase en la que se forman los bivalentes 4. Fase en la que los cromosomas homólogos se desplazan a cada uno de los polos de la célula b) Describa la citocinesis de una célula vegetal y la de una célula animal (1 punto). --------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 10 NÚCLEO CELULAR Y DIVISIÓN 16


97. En relación con el ciclo celular: (Jun 2015 – A3) a) Conteste a las siguientes cuestiones: 1) ¿En qué fase del ciclo celular se duplica el material genético?, 2) ¿Cuál es la fase mitótica en la que desaparece la carioteca y los cromosomas son visibles?, 3) ¿Cómo se denomina al cromosoma que presenta los dos brazos iguales?, 4) En un organismo diploide con número cromosómico básico n=23 ¿cuántos cromosomas se observarán en metafase I? (1 punto). b) Indique el proceso, estructura o fase definido a continuación 1) Acontecimiento de la Profase I que contribuye a generar variabilidad genética, 2) Acontecimiento que sucede en la Anafase I que contribuye a generar variabilidad genética, 3) Fase del ciclo celular en que la célula crece y sintetiza orgánulos, 4) Cromosoma que presenta el centrómero en posición terminal (1 punto). 98. Sobre el ciclo celular: (Jun 2015 – B4) a) Indique los periodos en los que se divide la interfase y explique brevemente lo que sucede en cada uno de ellos (1,5 puntos). b) Defina citocinesis y cariocinesis (0,5 puntos). 99. En relación con la meiosis de una célula animal 2n = 4: (Sep 2015 – A4) a) Realice un dibujo rotulado de: 1) La Anafase I; 2) La Metafase I; 3) La Telofase I; 4) La profase I. ¿Cuál es la secuencia correcta de las fases? (1,25 puntos). b) Defina: 1) Centrosoma; 2) Huso acromático; 3) Envoltura nuclear (0,75 puntos). 100.Respecto a la división celular: (Sep 2015 – B3) a) Describa brevemente los acontecimientos que ocurren en la profase y en la metafase mitóticas (1 punto). b) Describa brevemente los acontecimientos que ocurren en la anafase y en la telofase mitóticas (1 punto). 101.Con referencia al ciclo celular. (Mod 2016 – A2) a) Realice un esquema rotulado de la anafase y telofase mitóticas en una célula animal 2n=4 (1 punto). b) Supongamos una especie animal con cuatro pares de cromátidas. Indique cuántos cromosomas tendrá un espermatozoide, ¿cuántos tendrá un óvulo?, ¿en qué tipo de células se llevará a cabo la meiosis? ¿y la mitosis? (1 punto). 102.En relación con el citoesqueleto de la célula eucariota: (mod 2016 - A5) a) Cite dos procesos o estructuras en los que intervienen los microfilamentos y otros dos en los que intervengan los microtúbulos (1 punto). b) Indique la función y localización: del nucléolo y de los ribosomas libres en las células animales (1 punto). 103.En relación con el ciclo celular. (Mod 2016 – B4) a) Explique brevemente qué ocurre con el material genético en la profase, en la metafase, en la anafase, en la telofase, en la fase G1 y en la fase S (1,5 puntos). b) Defina citocinesis e indique en qué momento del ciclo celular se produce (0,5 puntos). 104.Con referencia a los procesos de división celular: (Jun 2016 – A2) a) Indique las fases de la meiosis en las que se produce los siguientes acontecimientos. No es necesario co piar la tabla, se puede contestar indicando los números del 1 al 4 (1 punto). 1) Disposición en el plano ecuatorial de un número n de cromosomas 2) Formación del complejo sinaptonémico 3) Separación de los bivalentes 4) Desplazamiento de cromátidas hermanas y migración hacia polos opuestos b) Realice un dibujo rotulado de la metafase y anafase mitóticas, donde se señalen las diferencias entre ambas fases para una célula animal 2n=4 (1 punto). 105.Con relación al ciclo celular en una célula animal: (Jun 2016 – B3) a) Explique la variación de la cantidad de ADN en una célula somática a lo largo del ciclo celular (1 punto). b) ) Defina célula haploide y diploide (0,5 puntos). c) c) Explique en qué consiste la fase G 0 del ciclo celular (0,5 puntos). --------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 10 NÚCLEO CELULAR Y DIVISIÓN 17


106.Con relación a la división celular: (Sep 2016 – A4) a) Identifique el proceso de división celular y las fases representadas en los dibujos, ordenándolas cronológicamente (1,5 puntos).

b) Explique el proceso de división del citoplasma en este tipo de células (0,5 puntos). 107.Con referencia a los cromosomas y los procesos de división celular: (Sep 2016 – B1) a) Indique cuatro de los principales acontecimientos que tienen lugar durante la telofase mitótica (1 punto). b) Dibuje un esquema rotulado de un cromosoma submetacéntrico metafásico, señalando cuatro de las estruc turas que lo componen (1 punto). 108.Respecto a la meiosis en los animales: (Mod 2017 — A5) a) Indique dos motivos por los que la meiosis solo ocurre en las células que van a generar gametos (1 punto). b) Explique por qué la meiosis es una división reduccional (0,5 puntos). c) Si partimos de una célula diploide (2n), indique cuántas células hijas resultarán de la meiosis y cuál sera su nivel de ploidía (0,5 puntos). 109.En relación con la célula eucariota: (Mod 2017 — B3) a) Cite cuatro componentes de un núcleo interfásico (1 punto). b) Indique las funciones de los centriolos (1 punto). 110.Respecto al núcleo celular: (Jun 17 – A2) a) Indique las diferencias estructurales y funcionales entre la eucromatina y la heterocromatina (1 punto). b) Indique la composición y función del complejo del poro nuclear (1 punto). 111.Con referencia a los cromosomas y los procesos de división celular: (Jun 2017 – B2) a) Indique cuatro de los principales acontecimientos que tienen lugar durante la primera división meiótica (1 punto). b) Dibuje un esquema rotulado de un cromosoma submetacéntrico señalando cuatro de las estructuras que lo componen (1 punto). 112.En relación con diversas estructuras que podemos encontrar en las células eucariotas: (Sep 17 – A2) a) Cite los tres elementos que configuran el citoesqueleto y las proteínas fundamentales que los forman (0,75 puntos). b) Cite las diferencias en cuanto a su función entre el retículo endoplasmático rugoso y retículo endoplasmático liso (0,5 puntos). c) Cite tres orgánulos que posean doble membrana (0,75 puntos). 113.En relación a los procesos de división celular: (Sep 17 – B1) a) Señale cinco diferencias fundamentales entre mitosis y meiosis en organismos animales (1,25 puntos). b) En la siguiente gráfica se representa la cantidad de ADN en un tipo de división celular. Razone de qué tipo de división se trata (0,75 puntos).

--------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 10 NÚCLEO CELULAR Y DIVISIÓN 18


114.En relación con la célula eucariota: (Mod 2018 - A4) a) Conteste a las siguientes cuestiones: 1. ¿Cómo se llama el compartimento del orgánulo donde tiene lugar el ciclo de Calvin?; 2. Indique el lugar de la mitocondria donde se sitúa la cadena transportadora de electrones; 3. ¿Cuáles son dos de las principales funciones del Aparato de Golgi? (1 punto). b) Indique cuáles son los orgánulos o estructuras celulares definidos a continuación: 1. Orgánulo con membrana implicado en la síntesis de proteínas; 2. Lugar de síntesis del citoesqueleto; 3. Lugar de unión de los microtúbulos a los cromosomas; 4. Componente estructural mayoritario de las membranas celulares (1 punto). 115.Con relación al ciclo celular y sus procesos: (Mod 2018 - B2) El Premio Nobel de Medicina del año 2001 fue concedido a L.H. Hartwell, R.T. Hunt y Sir Paul M. Nurse por sus importantes descubrimientos sobre los mecanismos y moléculas que regulan el ciclo celular. a) El siguiente diagrama representa un ciclo celular. Identifique las diferentes fases o etapas del ciclo que están indicadas mediante letras (1,25 puntos).

b) Responda a las siguientes cuestiones: ¿En qué fase del ciclo celular se duplica el ADN? Ponga un ejemplo de un tipo de células que quedan detenidas de forma permanente y dejan de dividirse. ¿Qué relación presentan los mecanismos que regulan el ciclo celular y el cáncer? (0,75 puntos).

--------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 10 NÚCLEO CELULAR Y DIVISIÓN 19


FISIOLOGÍA CELULAR 11. EL METABOLISMO 1.

Con relación a la fuente de energía utilizada por los organismos. (jun 01 – A2) a) Explica la diferencia fundamental entre un organismo quimioautótrofo (quimiosintético) y un organismo foto autótrofo (fotosintético). (0,5 puntos) b) Explica la diferencia fundamental entre fotofosforilación (fosforilación fotosintética) y fosforilación oxidativa. (0,5 puntos) c) Indica el tipo de células y el compartimento celular donde se producen los procesos indicados en el aparta do anterior. (1 punto)

2.

Con relación al tipo de metabolismo que presentan los seres vivos. (sep 01 – A2) a) Explica el significado de: anabolismo y catabolismo. (1 punto) b) Indica a qué tipo de reacciones, anabólicas o catabólicas, pertenecen las siguientes rutas metabólicas: glu cólisis, gluconeogénesis, ciclo de Calvin, y -oxidación de los ácidos grasos. (1 punto)

3.

Con relación a la glucólisis: (mod 02 – A2) a) b) c) d)

4.

Indica a qué tipo de reacciones del metabolismo pertenece. Razona la respuesta. (0,5 puntos) Indica en qué compartimento celular se lleva a cabo el proceso. (0,5 puntos) Menciona los productos iniciales y finales de la ruta. (0,5 puntos) Indica qué moléculas colaboran en esta ruta para captar los electrones (poder reductor) y la energía. (0,5 puntos)

Con referencia al catabolismo: (sep 02 – A2) a) ¿Qué son las reacciones catabólicas? Cita un ejemplo. (0,5 puntos) b) ¿Qué son las fermentaciones? Cita un ejemplo. (0,5 puntos) c) Cita el nombre de las etapas que seguirá el ácido pirúvico en una célula eucariótica hasta quedar degradado a CO2 y H2O, y nombra el compartimento celular donde tienen lugar. (1 punto)

5.

Relacionado con el metabolismo celular: (sep 03 – A2) a) Define anabolismo y catabolismo. (0,5 puntos) b) Nombra el sustrato inicial y el producto final de la glucólisis e indica si se trata de una vía anabólica o cata bólica. (0,5 puntos) c) Nombra un sustrato inicial y el producto final de la gluconeogénesis e indica si se trata de una vía anabólica o catabólica. (0,5 puntos) d) Indica los compartimentos celulares donde se realizan las vías metabólicas nombradas en los apartados b y c. (0,5 puntos)

6.

Define los siguientes términos: (sep 03 – B2) a) b) c) d)

7.

Organismos fotoautótrofos o fotosintéticos. (0,5 puntos) Organismos quimioautótrofos o quimiosintéticos. (0,5 puntos) Organismos aeróbicos o aerobios. (0,5 puntos) Organismos anaeróbicos o ánaerobios. (0,5 puntos)

En relación con el metabolismo celular: (mod 04 – B2) a) Explica el significado de anabolismo y de catabolismo. (1 punto) b) Explica la diferencia fundamental entre un organismo aeróbico y otro anaeróbico. (0,5 puntos) c) Cita un proceso catabólico que se realice en aerobiosis y otro en anaerobiosis. Indica la localización celular de cada ejemplo citado. (0,5 puntos)

8.

En relación con el metabolismo de los seres vivos: (mod 05 – A2) a) Indique los tipos de procesos metabólicos y la finalidad de cada uno de ellos. (1 punto) b) Indique los tipos de organismos en relación a su metabolismo, la fuente de carbono utilizada en cada caso y señale dicha fuente. (1 punto)

------------------------------------------------------------------ CUESTIONES DE SELECTIVIDAD – TEMA 11 INTRODUCCIÓN AL METABOLISMO 1


9.

Referente a la síntesis de ATP: (jun 05 - A2) a) Indique sus mecanismos de síntesis en la célula (0,5 puntos). b) Cite la localización de los mecanismos de síntesis de ATP en el cloroplasto y explique el mecanismo de producción en el citado orgánulo (0,75 puntos). c) Indique la denominación de los procesos de síntesis de ATP en los cloroplastos y cite una diferencia entre ambos procesos (0,75 puntos).

10. Con relación al metabolismo celular: (sep 05 – B2) a) Explique cuál es la finalidad de las reacciones anabólicas (0,5 puntos). b) ¿A qué tipo de proceso metabólico pertenece la fotosíntesis?. Razone la respuesta (0,5 puntos). c) Cite las fases del Ciclo de Calvin e indique su localización a nivel de orgánulo (1 punto). 11. Referente al metabolismo celular: (mod 07 – A2) a) Según la fuente de carbono que utilicen los seres vivos para su desarrollo, explique los tipos de metabolis mo (0,5 puntos). b) Las moléculas que se citan a continuación: FAD, NAD +, NADP y O2 tienen relación con reacciones de los procesos fotosintético y respiratorio. Indique la relación de cada molécula con cada proceso (1 punto). c) Relacione los procesos anteriormente citados (fotosintético y respiratorio) con los tipos de metabolismo aludidos en el primer apartado (0,5 puntos). 12. Relacionado con el metabolismo celular. (jun 07 – B2) a) Defina anabolismo y catabolismo. Cite un ejemplo de ruta anabólica (0,75 puntos). b) De acuerdo con la forma de obtener el carbono, indique cómo se clasifican los organismos. Razone la respuesta (0,5 puntos). c) Según la fuente de energía que emplean, indique los tipos de organismos y relaciónelos con la respuesta del apartado anterior (0,75 puntos). 13. Relacionado con el metabolismo celular. (sep 07 – B2) a) Defina anabolismo y catabolismo (0,5 puntos). b) Indique la finalidad de las reacciones catabólicas (0,5 puntos). c) Cite dos rutas catabólicas e indique su localización celular y a nivel de orgánulo (1 punto). 14. Explique las diferencias entre: (mod 2010 – A2) a) Fotosíntesis oxigénica y fotosíntesis anoxigénica (0,75 puntos). b) Reacciones anabólicas y reacciones catabólicas (0,75 puntos). c) Respiración aerobia y fermentación (0,5 puntos). 15. Para los términos que se citan a continuación: (jun esp 2010 – B5) a) Indique las diferencias más relevantes entre fotofosforilación acíclica y fotofosforilación cíclica y cite su loca lización a nivel de orgánulo (0,5 puntos). b) Explique la diferencia fundamental entre respiración y fermentación (0,5 puntos). c) Indique las diferencias entre quimiosíntesis y fotosíntesis (0,5 puntos). d) Explique la diferencia entre procesos anfibólicos y procesos anabólicos. Ponga un ejemplo de cada caso (0,5 puntos). 16. Referente al metabolismo celular: (Mod 2015 – B4) a) Indique las diferencias mas relevantes entre anabolismo y catabolismo, y entre respiración mitocondrial y fermentación (1 punto). b) Cite dos tipos de fermentaciones que se utilicen en la industria alimentaria, indicando el tipo de microorga nismos que los realizan, así como los productos iniciales y finales de las mismas (1 punto). 17. Referente al metabolismo celular: (Mod 2018 - A5) a) Indique las diferencias más relevantes entre: fotosíntesis y quimiosíntesis; nutrición autótrofa y nutrición heterótrofa (1 punto). b) Indique los componentes de la molécula de ATP (0,5 puntos). c) Explique en qué consiste el proceso de nitrificación e indique el tipo de organismo que lo realiza (0,5 pun tos). ------------------------------------------------------------------ CUESTIONES DE SELECTIVIDAD – TEMA 11 INTRODUCCIÓN AL METABOLISMO 2


FISIOLOGÍA CELULAR 12. LA GLUCÓLISIS Y LAS FERMENTACIONES 1.

Fermentaciones: (mod 97 – A4) a) Define el concepto de fermentación. (0,5 puntos) b) Indica dos diferencias esenciales entre la fermentación y la respiración. (0,5 puntos) c) Explica dos diferentes aplicaciones biotecnológicas de las fermentaciones. (1 punto)

2.

En la degradación aerobia de la glucosa hay tres etapas en las que se libera energía: glúcólisis, ciclo de Krebs y cadena respiratoria. (jun 97 – A3) a) Sin necesidad de fórmulas, explica brevemente la etapa de la glucólisis. (1 punto) b) Resume el balance energético de cada una de las tres etapas mencionadas inicialmente, y el balance energético final del proceso respiratorio. (1 punto)

3.

El diagrama representa el proceso de consumo anaerobio de glucosa en el tejido muscular. (jun 98 – B2)

a) Complete el diagrama poniendo en las casillas el número de carbonos de cada uno de los tres compuestos. (0,5 puntos) b) Indica el nombre de los procesos señalados con X e Y. (0,5 puntos) c) ¿En qué lugar de la célula sucede el proceso X? (0,5 puntos) d) ¿Qué ganancia neta en ATP hay en el proceso X? (0,5 puntos) 4.

En algunos organismos el ácido pirúvico procedente de la glucólisis sigue una ruta metabólica deno minada fermentación, mediante la cual obtienen energía. (sep 98 – B2) a) Señala las diferencias fundamentales entre fermentación y respiración celular (1 punto). b) ¿Qué microorganismos pueden realizar fermentaciones? (0,5 puntos) c) Menciona algún producto industrial que se obtenga por fermentación y que le resulte familiar (porque se consuma en su casa, por ejemplo) (0,5 puntos)

5.

Durante la fabricación de la cerveza se producen una serie de reacciones anaerobias: (mod 99 – A4) a) Indica cómo se llama el proceso global y qué tipo de microorganismo interviene. (0,5 puntos) b) Describe, desde el punto de vista químico, la reacción global de este proceso y en qué parte de la célula se localiza.(1 punto) c) Cita dos ejemplos de otros procesos similares, indicando su interés industrial. (0,5 puntos)

--------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 12 CATABOLISMO 1


6.

En la degradación aerobia de la glucosa se pueden distinguir las siguientes etapas: glucólisis, transformación de piruvato en acetil-CoA, ciclo de Krebs y cadena transportadora de electrones: (mod 99 – B4) a) Sitúa en la célula eucariótica cada una de estas etapas. (1 punto) b) Explica qué coenzimas reducidos se producen y en qué etapas. (0,5 puntos) c) Explica para qué se utilizan estos coenzimas reducidos en el proceso respiratorio. (0,5 puntos)

7.

La siguiente vía metabólica, cuya reacción global se indica a continuación, es esencial para el metabolismo de las células animales: (sep 00 – B2) Glucosa + 2 NAD+ + 2 ADP + 2 Pi  2 Piruvato + 2 NADH + 2H+ + 2 ATP + 2 H2O a) Indica el nombre de la vía y en qué compartimento celular se produce. (0,5 puntos) b) Explica los posibles destinos metabólicos que puede tener el piruvato producido. (1 punto) c) Escribe la reacción global de oxidación de la glucosa. (0,5 puntos)

8.

Con relación al tipo de metabolismo que presentan los seres vivos. (sep 01 – A2) a) Explica el significado de: anabolismo y catabolismo. (1 punto) b) Indica a qué tipo de reacciones, anabólicas o catabólicas, pertenecen las siguientes rutas metabólicas: glu cólisis, gluconeogénesis, ciclo de Calvin, y -oxidación de los ácidos grasos. (1 punto)

9.

Con relación a la glucólisis: (mod 02 – A2) a) b) c) d)

Indica a qué tipo de reacciones del metabolismo pertenece. Razona la respuesta. (0,5 puntos) Indica en qué compartimento celular se lleva a cabo el proceso. (0,5 puntos) Menciona los productos iniciales y finales de la ruta. (0,5 puntos) Indica qué moléculas colaboran en esta ruta para captar los electrones (poder reductor) y la energía. (0,5 puntos)

10. Con referencia al catabolismo: (sep 02 – A2) a) ¿Qué son las reacciones catabólicas? Cita un ejemplo. (0,5 puntos) b) ¿Qué son las fermentaciones? Cita un ejemplo. (0,5 puntos) c) Cita el nombre de las etapas que seguirá el ácido pirúvico en una célula eucariótica hasta quedar degradado a CO2 y H2O, y nombra el compartimento celular donde tienen lugar. (1 punto) 11. Relacionado con el metabolismo celular: (sep 03 – A2) a) Define anabolismo y catabolismo. (0,5 puntos) b) Nombra el sustrato inicial y el producto final de la glucólisis e indica si se trata de una vía anabólica o cata bólica. (0,5 puntos) c) Nombra un sustrato inicial y el producto final de la gluconeogénesis e indica si se trata de una vía anabólica o catabólica. (0,5 puntos) d) Indica los compartimentos celulares donde se realizan las vías metabólicas nombradas en los apartados b y c. (0,5 puntos) 12. En relación con el metabolismo celular: (mod 04 – B2) a) Explica el significado de anabolismo y de catabolismo. (1 punto) b) Explica la diferencia fundamental entre un organismo aeróbico y otro anaeróbico. (0,5 puntos) c) Cita un proceso catabólico que se realice en aerobiosis y otro en anaerobiosis. Indica la localización celular de cada ejemplo citado. (0,5 puntos) 13. En los procesos de fermentación: (sep 04 – B2) a) Indique un tipo de fermentación, señalando la molécula inicial, el producto final y un microorganismo capaz de realizar dicho proceso (1 punto). b) Explique por qué en la fermentación se obtiene un menor rendimiento energético que en la respiración (0,5 puntos). c) Explique qué ocurre en la fermentación con el coenzima NADH obtenido en la glucólisis (0,5 puntos).

--------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 12 CATABOLISMO 2


14. En relación con el metabolismo celular: (mod 06 – B2) a) Nombre la ruta metabólica anaerobia por la que las células obtienen ATP a partir de glucosa. Indique cuál es el producto final de dicha ruta y el compartimento celular en el que transcurre (0,75 puntos). b) Nombre las etapas que seguirá dicho producto final en una célula eucariótica en condiciones aerobias (0,75 puntos). c) Indique el destino que seguirá dicho producto final en condiciones anaerobias. Nombre un organismo o una célula capaces de seguir este proceso (0,5 puntos). 15. En una célula muscular: (sep 06 – B2) a) Indique: (I) qué principio inmediato le aporta energía para realizar la contracción; (II) a través de qué rutas metabólicas se obtiene; y (III) cómo se denomina el proceso (1 punto). b) Cuando el aporte de oxígeno al músculo es insuficiente y este debe continuar la contracción, indique: (I) qué ruta metabólica utilizaría; (II) el producto final de dicha ruta; y (III) la relación que éste tiene con la aparición de las agujetas (1 punto). 16. En el catabolismo de la glucosa: (mod 07 – B2) a) Señale la ruta metabólica común a los procesos de respiración aerobia y fermentación, el producto final de dicha ruta y su localización celular (0,75 puntos). b) Compare el rendimiento energético de ambos procesos (0,5 puntos). c) Señale un tipo de fermentación, un microorganismo capaz de realizarla y el producto final (0,75 puntos). 17. Referente a la formación de ATP en los procesos biológicos: (sep 07 – A2) a) Explique sus mecanismos de síntesis (1 punto). b) Para cada mecanismo de síntesis de ATP, cite un proceso biológico e indique su localización celular y a ni vel de orgánulo (1 punto). 18. El esquema siguiente está relacionado con procesos catabólicos fundamentales en los seres vivos: (jun 08 – B2) GLUCOSA → → → → PIRUVATO + NADH + ATP a) ¿De qué proceso biológico se trata?, ¿de qué tipo de célula es característico, de la célula animal o de la cé lula vegetal?, indique su localización a nivel celular (0,75 puntos). b) Explique el mecanismo de síntesis de ATP en el proceso mencionado en el apartado anterior (0,5 puntos). c) Indique los productos que se pueden originar a partir del piruvato (0,75 puntos). 19. La obtención de determinados productos alimentarios se basa en algunos procesos metabólicos celulares. (jun 2011 - B4) a) Explique la transformación que sigue la glucosa durante el proceso de elaboración del pan ¿Cómo se denomina el proceso? ¿En qué etapa se produce la síntesis de ATP? (1 punto). b) ¿Qué organismos están relacionados con la elaboración del pan? ¿A qué tipo de organización celular pertenecen estos organismos? Indique sus componentes estructurales (1 punto). 20. El metabolismo es el conjunto de reacciones químicas que se producen en los organismos vivos: (mod 09 – A2) a) Diga de qué proceso se trata e indique cuál de los participantes es el agente reductor en la siguiente reacción (0,5 puntos): Piruvato + NADH + H+ → Lactato + NAD+ b) Las levaduras llevan a cabo una reacción en la que también interviene el piruvato. Proponga la ecuación de la misma (0,5 puntos). c) Indique la ruta metabólica de la que procede el piruvato, así como el precursor de la misma. ¿Considera que se trata de una ruta anabólica o catabólica? Razone la contestación (1 punto). 21. Relacionado con los procesos metabólicos: (jun gen 2010 – B4) a) Defina fermentación e indique sus tipos. ¿Cuál es su localización celular? (0,75 puntos). b) Explique la formación de ATP durante la fermentación (0,5 puntos). c) ¿Cuál es la relación entre el metabolismo fermentativo y la fabricación del vino? Cite los productos: inicial y final. Indique los microorganismos que intervienen (0,75 puntos).

--------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 12 CATABOLISMO 3


22. Referente al metabolismo celular: (jun esp 2010 – A5) a) Concepto de fermentación. Indique sus tipos y cite su localización celular (0,75 puntos). b) Explique la síntesis de ATP durante la fermentación (0,5 puntos). c) ¿Cuál es la relación entre las fermentaciones y la elaboración del queso? Indique el sustrato y el producto final. ¿Qué microorganismos intervienen? (0,75 puntos). 23. En la célula muscular se llevan a cabo numerosas reacciones metabólicas. (mod 2011 – B5) a) Explique qué es la glucólisis, indique en qué parte de la célula se produce y los productos que se originan (1 punto). b) Dependiendo de la disponibilidad del oxígeno en la célula, indique las rutas metabólicas que pueden seguir a la glucólisis y cite los productos iniciales y finales de cada ruta (1 punto). 24. En la glucólisis la glucosa se oxida a piruvato. (Sept 2011 – A5) a) ¿En qué tipo de moléculas se puede transformar el piruvato en condiciones anaeróbicas? ¿Cómo se deno minan estos procesos? En cada caso, ponga un ejemplo de su aplicación industrial (1 punto). b) ¿Cuál sería el destino del piruvato en condiciones aeróbicas? ¿En qué parte de la célula se produce? (0,5 puntos). c) Explique cómo se produce la síntesis de ATP en la glucólisis (0,5 puntos). 25. )Referente al metabolismo celular: (Sep 2016 – B4) a) Explique las diferencias fundamentales entre respiración mitocondrial y fermentación (1 punto). b) Indique los tipos de fermentaciones, así como su localización celular (0,5 puntos). c) Indique los mecanismos de síntesis de ATP que presenta una célula animal (0,5 puntos). Hay más preguntas sobre fermentaciones en el tema 22 (El aprovechamiento de los microorganismos. La biotecnología. Ingeniería genética)

--------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 12 CATABOLISMO 4


12. LA RESPIRACIÓN CELULAR 26. Fermentaciones: (mod 97 – A4) a) Define el concepto de fermentación. (0,5 puntos) b) Indica dos diferencias esenciales entre la fermentación y la respiración. (0,5 puntos) c) Explica dos diferentes aplicaciones biotecnológicas de las fermentaciones. (1 punto) 27. Mitocondrias (mod 97 – B2) a) Dibuja el esquema de una mitocondria poniendo nombre a sus partes. (0,5 puntos) b) Haz un esquema con las principales etapas de la degradación de la glucosa en una célula. (0,5 puntos) c) Explica las principales etapas de la degradación del ácido pirúvico –en presencia de oxígeno– durante la respiración celular. (1 punto) 28. En la degradación aerobia de la glucosa hay tres etapas en las que se libera energía: glúcólisis, ciclo de Krebs y cadena respiratoria. (jun 97 – A3) a) Sin necesidad de fórmulas, explica brevemente la etapa de la glucólisis. (1 punto) b) Resume el balance energético de cada una de las tres etapas mencionadas inicialmente, y el balance ener gético final del proceso respiratorio. (1 punto) 29. Algunos organismos obtienen energía por oxidación total de la glucosa. El proceso celular se realiza en dos fases (o etapas) claramente diferenciadas. (sep 98 – A2) a) b) c) d)

¿Qué nombre recibe cada una de estas fases. (0,5 puntos) ¿En qué lugar de la célula tiene lugar cada una de ellas? (0,5 puntos) ¿Cuál es la característica más notable que diferencia a una fase de la otra? (0,5 puntos) ¿Cómo influye esa característica en la producción de energía? (0,5 puntos)

30. En la degradación aerobia de la glucosa se pueden distinguir las siguientes etapas: glucólisis, transformación de piruvato en acetil-CoA, ciclo de Krebs y cadena transportadora de electrones: (mod 99 – B4) a) Sitúa en la célula eucariótica cada una de estas etapas. (1 punto) b) Explica qué coenzimas reducidos se producen y en qué etapas. (0,5 puntos) c) Explica para qué se utilizan estos coenzimas reducidos en el proceso respiratorio. (0,5 puntos) 31. Los ácidos grasos se degradan por la vía metabólica conocida como -oxidación o hélice de Lynen: (sep 99 – A2) a) ¿En qué compartimento celular tiene lugar esta vía en células eucariotas? (0,5 puntos) b) ¿Cuál es el producto final de la degradación de los ácidos grasos? (0,5 puntos) c) ¿A qué proceso metabólico, orientado a la obtención de energía, se incorpora este producto final? (0,5 pun tos) d) ¿En qué compartimento celular tiene lugar este último proceso metabólico? (0,5 puntos) 32. Las mitocondrias son unos orgánulos que están presentes en las células eucariotas. (sep 00 – A2) a) Haz un esquema o dibujo de una mitocondria y señala sus componentes. (1 punto) b) Indica la localización en las mitocondrias de los siguientes procesos metabólicos: cadena de transporte de electrones y ciclo de Krebs. (0,5 puntos) c) ¿Cómo se llaman los productos del ciclo de Krebs que al oxidarse ceden sus electrones a la cadena de transporte electrónico? ¿Cuál es el aceptor final de los electrones? (0,5 puntos) 33. La siguiente vía metabólica, cuya reacción global se indica a continuación, es esencial para el metabolismo de las células animales: (sep 00 – B2) Glucosa + 2 NAD+ + 2 ADP + 2 Pi  2 Piruvato + 2 NADH + 2H+ + 2 ATP + 2 H2O a) Indica el nombre de la vía y en qué compartimento celular se produce. (0,5 puntos) b) Explica los posibles destinos metabólicos que puede tener el piruvato producido. (1 punto) c) Escribe la reacción global de oxidación de la glucosa. (0,5 puntos) --------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 12 CATABOLISMO 5


34. Con relación al tipo de metabolismo que presentan los seres vivos. (sep 01 – A2) a) Explica el significado de: anabolismo y catabolismo. (1 punto) b) Indica a qué tipo de reacciones, anabólicas o catabólicas, pertenecen las siguientes rutas metabólicas: glucólisis, gluconeogénesis, ciclo de Calvin, y -oxidación de los ácidos grasos. (1 punto) 35. Con relación al proceso fotosintético: (mod 02 – B2) a) Indica las etapas del mismo y su localización en el orgánulo implicado. (1 punto) b) ¿Cuál es la diferencia entre la fotofosforilación acíclica y la cíclica? Razona la respuesta. (0,5 puntos) c) Cita otro orgánulo de la célula vegetal donde se produzca ATP de forma mayoritaria e indica la denomina ción del proceso. (0,5 puntos) 36. Respecto al catabolismo de los glúcidos en una célula eucariótica: (jun 02 – A2) a) Nombra las etapas que experimentará una molécula de glucosa hasta que se convierte por completo en CO2 y H2O. (1 punto) b) Cita los compartimentos celulares por los que transcurren dichas etapas. (0,5 puntos) c) Indica dos mecanismos mediante los cuales se sintetiza ATP a lo largo de esas etapas. (0,5 puntos) 37. Con referencia al ciclo de Krebs o ciclo de los ácidos tricarboxílicos de una célula eucariótica: (mod 03 – A2) a) Indica el compartimento celular en el que transcurre y di si se trata de una ruta anabólica, catabólica o anfi bólica. (0,5 puntos) b) Nombra tres rutas de las que puede proceder el acetil-CoA que se incorpora al ciclo. (0, 75 puntos) c) Nombra las coenzimas que participan en el ciclo recogiendo el poder reductor e indica si se obtienen oxida dos o reducidos. (0,75 puntos) 38. En relación con el metabolismo celular: (jun 03 – A2) a) Explica la finalidad (significado fisiológico) del Ciclo de Krebs e indica su localización a nivel de orgánulo. (0,75 puntos) b) Explica la finalidad (significado fisiológico) del Ciclo de Calvin e indica su localización, a nivel de orgánulo. (0,75 puntos) c) Indica en qué tipo de célula, vegetal y/o animal, se producen los ciclos citados. (0,5 puntos) 39. Relacionado con el ciclo de Krebs para una célula eucariática: (mod 04 – A2) a) Nombra el compartimento celular en el que transcurre y cita el sustrato que se incorpora al ciclo. (0,5 puntos) b) Cita el nombre de dos coenzimas que intervienen en dicho ciclo para recoger el poder reductor. (0,5 puntos) c) Indica una finalidad de dicho ciclo y di si se trata de una vía aerobia o anaerobia. (0,5 puntos) d) Nombra dos rutas de las que puede proceder el sustrato que se incorpora al ciclo. (0,5 puntos) 40. En relación con el metabolismo celular: (mod 04 – B2) a) Explica el significado de anabolismo y de catabolismo. (1 punto) b) Explica la diferencia fundamental entre un organismo aeróbico y otro anaeróbico. (0,5 puntos) c) Cita un proceso catabólico que se realice en aerobiosis y otro en anaerobiosis. Indica la localización celular de cada ejemplo citado. (0,5 puntos) 41. Con referencia al catabolismo: (jun 04 – A2) a) Explique la diferencia entre respiración y fermentación (1 punto). b) Explique a qué se debe el diferente rendimiento energético en estos procesos (1 punto). 42. En el metabolismo de los seres vivos: (sep 04 – A2) a) Indique qué es un coenzima y qué papel desempeña (1 punto). b) Ponga un ejemplo de un coenzima oxidado e indique una ruta metabólica en la que actúe (0,5 puntos). c) Explique qué ocurre con los coenzimas reducidos en la cadena respiratoria (0,5 puntos).

--------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 12 CATABOLISMO 6


43. Respecto al ATP: (sep 04 – B1) a) Indique el grupo de moléculas al que pertenece y cuál es su papel metabólico (0,5 puntos). b) Explique las posibles formas de síntesis de ATP (1 punto). c) Indique dos rutas metabólicas donde se obtenga ATP (0,5 puntos.) 44. El siguiente esquema representa procesos importantes en el metabolismo animal: (jun 05 – B2)

a) Diga cómo se denominan los compuestos indicados con los números 1 y 2 así como los procesos con las letras A, B y C (1 punto). b) En qué compartimentos celulares se desarrollan dichos procesos? (0,5 puntos). c) Aparte de los productos finales, ¿en qué se diferencian los procesos B y C? (0,5 puntos). 45. Respecto del catabolismo de un triacilglicérido en células animales: (jun 06 – B2) a) Indique las cuatro moléculas que se obtienen de su hidrólisis y la localización celular del proceso (0,75 puntos). b) Nombre la ruta metabólica que permite la degradación de las tres moléculas similares obtenidas por hidróli sis y su localización celular a nivel de orgánulo (0,5 puntos). c) En la ruta metabólica indicada en el apartado b), cite qué producto se incorpora al ciclo de Krebs para conti nuar su degradación y qué dos coenzimas reducidas se obtienen (0,75 puntos). 46. En una célula muscular: (sep 06 – B2) a) Indique: (I) qué principio inmediato le aporta energía para realizar la contracción; (II) a través de qué rutas metabólicas se obtiene; y (III) cómo se denomina el proceso (1 punto). b) Cuando el aporte de oxígeno al músculo es insuficiente y este debe continuar la contracción, indique: (I) qué ruta metabólica utilizaría; (II) el producto final de dicha ruta; y (III) la relación que éste tiene con la aparición de las agujetas (1 punto). 47. Referente al metabolismo celular: (mod 07 – A2) a) Según la fuente de carbono que utilicen los seres vivos para su desarrollo, explique los tipos de metabolismo (0,5 puntos). b) Las moléculas que se citan a continuación: FAD, NAD +, NADP y O2 tienen relación con reacciones de los procesos fotosintético y respiratorio. Indique la relación de cada molécula con cada proceso (1 punto). c) Relacione los procesos anteriormente citados (fotosintético y respiratorio) con los tipos de metabolismo alu didos en el primer apartado (0,5 puntos). 48. En el catabolismo de la glucosa: (mod 07 – B2) a) Señale la ruta metabólica común a los procesos de respiración aerobia y fermentación, el producto final de dicha ruta y su localización celular (0,75 puntos). b) Compare el rendimiento energético de ambos procesos (0,5 puntos). c) Señale un tipo de fermentación, un microorganismo capaz de realizarla y el producto final (0,75 puntos). 49. Referente a la formación de ATP en los procesos biológicos: (sep 07 – A2) a) Explique sus mecanismos de síntesis (1 punto). b) Para cada mecanismo de síntesis de ATP, cite un proceso biológico e indique su localización celular y a ni vel de orgánulo (1 punto).

--------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 12 CATABOLISMO 7


50. Relacionado con el metabolismo celular. (sep 07 – B2) a) Defina anabolismo y catabolismo (0,5 puntos). b) Indique la finalidad de las reacciones catabólicas (0,5 puntos). c) Cite dos rutas catabólicas e indique su localización celular y a nivel de orgánulo (1 punto). 51. El NAD es un compuesto esencial en el metabolismo: (mod 08 – A2) a) Indique la naturaleza química del mismo y explique brevemente su función (1 punto). b) Escriba las formas reducida y oxidada del NAD y ponga un ejemplo de una reacción metabólica en la que esta molécula se obtenga en forma reducida y otra en la que se obtenga de forma oxidada (1 punto). 52. El esquema siguiente está relacionado con procesos catabólicos fundamentales en los seres vivos: (jun 08 – B2) GLUCOSA → → → → PIRUVATO + NADH + ATP a) ¿De qué proceso biológico se trata?, ¿de qué tipo de célula es característico, de la célula animal o de la cé lula vegetal?, indique su localización a nivel celular (0,75 puntos). b) Explique el mecanismo de síntesis de ATP en el proceso mencionado en el apartado anterior (0,5 puntos). c) Indique los productos que se pueden originar a partir del piruvato (0,75 puntos). 53. Con relación al metabolismo de los lípidos: (sep 08 – A2) a) Indique a qué tipo de ruta pertenece la β-oxidación de los ácidos grasos, el compartimento celular en el que se realiza y el producto final que se obtiene (0,75 puntos). b) Mencione la vía que sigue el producto final al que se alude en el apartado anterior hasta oxidarse por com pleto. Indique el compartimento subcelular donde ocurre esta vía y cuáles son los productos c) finales de la misma (1,25 puntos). 54. Los esquemas siguientes, (A) y (B) , están relacionados con dos procesos catabólicos que tienen lugar en los seres vivos: (sep 08 – B2) (A) GLUCOSA→ → → → PIRUVATO→ → → → LACTATO (B) GLUCOSA→ →→ → PIRUVATO→ → → → ACETILCoA a) ¿A qué proceso corresponde cada esquema? (0,5 puntos). b) Cite las etapas del proceso representado en el esquema (A) (0,5 puntos). c) En el esquema (B) indique, a nivel subcelular, dónde se forma el AcetilCoA, las etapas que sigue hasta fina lizar el proceso metabólico y la localización de cada una de ellas también a nivel subcelular (1 punto). 55. Para llevar a cabo las funciones celulares es necesario aportar energía. (jun 09 – B2) a) Dibuje un esquema rotulado del orgánulo energético de células animales (0,75 puntos). b) Indique las etapas del proceso de respiración aerobia que se efectúan en este orgánulo y en qué localización se lleva a cabo cada una de ellas (0,5 puntos). c) Dibuje un esquema rotulado del orgánulo energético de las células vegetales (0,75 puntos). 56. El esquema siguiente está relacionado con un proceso metabólico celular básico: (sep 09 – B4)

a) ¿A qué proceso metabólico se refiere el enunciado?, indique el lugar de síntesis a nivel subcelular y de orgánulo de cada uno de los compuestos indicados en el esquema (1 punto). b) Explique el mecanismo de formación de ATP en el esquema (0,5 puntos). c) Cite otras dos rutas metabólicas que pueda seguir el piruvato, e indique para cada una de ellas: su denomi nación, el producto originado y el lugar dónde se produce (0,5 puntos). --------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 12 CATABOLISMO 8


57. De los compuestos celulares que se citan a continuación: ribulosa, hemicelulosa, NADH, FAD +, glucosa, NAD+, CO2, NADP+. (sep 09 – B1) a) Cite cuatro compuestos que estén relacionados directamente con el proceso fotosintético e indique, para cada uno de ellos, su función, la etapa del proceso en la que participan y la localización de ésta a nivel de orgánulo (1 punto). b) Cite dos nucleótidos que estén relacionados directamente con la respiración e indique, para cada uno de ellos, su función, la etapa del proceso en la que participan y la localización de ésta a nivel de orgánulo (0,5 puntos). c) Explique las características químicas de la hemicelulosa y cite su función (0,5 puntos). 58. Explique las diferencias entre: (mod 2010 – A2) a) Fotosíntesis oxigénica y fotosíntesis anoxigénica (0,75 puntos). b) Reacciones anabólicas y reacciones catabólicas (0,75 puntos). c) Respiración aerobia y fermentación (0,5 puntos). 59. Relacionado con el proceso fotosintético: (mod 2010 – B2) a) ¿Cómo se denominan los sistemas captadores de luz? Indique sus componentes (0,5 puntos). b) Cite dos componentes de la cadena de transporte de electrones (0,5 puntos). c) Indique los productos que se originan durante la fotofosforilación acíclica y cíclica. ¿Cuál es el destino de estos compuestos? (0,5 puntos). d) Escriba la ecuación global de la fotosíntesis (0,5 puntos). 60. Para los términos que se citan a continuación: (jun esp 2010 – B5) a) Indique las diferencias más relevantes entre fotofosforilación acíclica y fotofosforilación cíclica y cite su localización a nivel de orgánulo (0,5 puntos). b) Explique la diferencia fundamental entre respiración y fermentación (0,5 puntos). c) Indique las diferencias entre quimiosíntesis y fotosíntesis (0,5 puntos). d) Explique la diferencia entre procesos anfibólicos y procesos anabólicos. Ponga un ejemplo de cada caso (0,5 puntos). 61. El esquema que se indica presenta un proceso catabólico de la célula: (sep 2010 – A5)

a) ¿A qué proceso se refiere el enunciado? Cite sus etapas e indique su localización a nivel de la célula y de orgánulo. ¿Qué ocurre en cada una de esas etapas? (1 punto). b) Explique cómo se produce la síntesis de ATP en cada uno de los casos del esquema del enunciado: (A), (B) y (C), y relaciónelos con las etapas aludidas en el apartado anterior (1 punto). 62. Los compuestos siguientes están relacionados con la respiración y la fotosíntesis: ribulosa 1,5- bisfosfato, NADH, FADH2, NADP. (sep 2010 – B5) a) Relacione cada uno de los compuestos con el proceso correspondiente y con la etapa del mismo donde par ticipa (1 punto). b) Explique las características químicas del NADP y FADH 2 e indique su función (0,5 puntos). c) Explique las características químicas y la función de la ribulosa 1,5- bisfosfato (0,5 puntos).

--------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 12 CATABOLISMO 9


63. En la célula muscular se llevan a cabo numerosas reacciones metabólicas. (mod 2011 – B5) a) Explique qué es la glucólisis, indique en qué parte de la célula se produce y los productos que se originan (1 punto). b) Dependiendo de la disponibilidad del oxígeno en la célula, indique las rutas metabólicas que pueden seguir a la glucólisis y cite los productos iniciales y finales de cada ruta (1 punto). 64. Referente al Ciclo de Krebs: (jun 2011 - A2) a) Indique, razonando la respuesta, si está relacionado con el anabolismo, con el catabolismo o con ambos (0,5 puntos). b) Cite los productos finales (0,5 puntos). c) ¿Cuál es la vía metabólica que sigue al citado ciclo? Explique la finalidad de esa vía e indique su localiza ción a nivel de orgánulo (1 punto). 65. Sobre las mitocondrias en las células eucarióticas: (Mod 2012 – A5) a) Cite el proceso metabólico que las caracteriza, describa brevemente sus etapas e indique su localización a nivel de orgánulo (0,75 puntos). b) Defina fosforilación a nivel de sustrato. Indique en qué etapa de las aludidas en el apartado anterior se pro duce este tipo de fosforilación (0,75 puntos). c) Indique, razonando la respuesta, si el proceso a que se refiere el primer apartado, es un proceso anabólico o catabólico (0,5 puntos). 66. Con referencia al metabolismo celular: (Sep 2013 – B1) a) Identifique el proceso metabólico que corresponde a cada una de las siguientes reacciones generales (0,5 puntos): Glucosa + O2 —> CO2 + H2O + Energía CO2 + H2O +Luz —> Glucosa + O2 b) Explique razonadamente si los procesos identificados en el apartado anterior son procesos anabólicos o catabólicos (0,5 puntos). c) Defina el proceso de fotofosforilación, indicando sus tipos y los productos que se originan en cada uno de ellos (1 punto). 67. Referente aI metabolismo celular en eucariotas: (Mod 2014 – A5) a) Indique la reacción general de la fotosíntesis. Cite el tipo de seres vivos que realizan dicho proceso y espe cifique dónde se localiza a nivel celular (1 punto). b) Indique la reacción general de la oxidación completa de una molécula de glucosa y cite las diferentes etapas de este proceso metabólico (1 punto). 68. Referente al metabolismo celular: (Jun 2014 – B1) a) Indique la composición de la molécula de ATP (0,5 puntos). b) De las siguientes rutas metabólicas, indique en cuales de ellas se consume ATP y en cuales se sintetiza ATP: ciclo de Calvin, fosforilación oxidativa, biosíntesis de aminoácidos, fotofosforilación, ciclo de Krebs y biosíntesis de acidos grasos (1,5 puntos). 69. Referente al metabolismo celular: (Sep 2014 – A5) a) Indique los productos finales de la glucólisis, especifique si se trata de una ruta anabólica o catabólica y lo calice el compartimento celular donde se realiza (0,5 puntos). b) Indique la reacción general de la fotosíntesis. Cite el tipo de seres vivos eucariotas que realizan dicho proce so y especifique dónde se localiza a nivel celular (1 punto). c) Indique el gasto de NADPH y de ATP en el Ciclo de Calvin para sintetizar una molécula de glucosa (0,5 puntos). 70. Referente al metabolismo celular: (Mod 2015 – A1) a) Cite las diferentes etapas que pueden identificarse en el proceso de oxidación completa de una molécula de glucosa, e indique la localización a nivel celular y de organulo de las etapas identificadas (1 punto). b) Cite las etapas que componen el proceso fotosintético e indique la localización a nivel de orgánulo de las mismas (0,5 puntos). c) Indique los mecanismos de obtención de ATP que presenta una célula vegetal (0,5 puntos). --------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 12 CATABOLISMO 10


71. Referente al metabolismo celular: (Mod 2015 – B4) a) Indique las diferencias mas relevantes entre anabolismo y catabolismo, y entre respiración mitocondrial y fermentación (1 punto). b) Cite dos tipos de fermentaciones que se utilicen en la industria alimentaria, indicando el tipo de microorga nismos que los realizan, así como los productos iniciales y finales de las mismas (1 punto). 72. Referente al metabolismo celular: (Sep 2015 – A2) a) Explique la relación que hay entre la fermentación y la elaboración del vino. ¿Cuál es el sustrato y los pro ductos finales? ¿Qué microorganismos intervienen? (1 punto). b) Indique el gasto de NADPH y de ATP en el Ciclo de Calvin para sintetizar una molécula de glucosa (0,5 puntos). c) Explique cómo se produce la síntesis de ATP en la glucólisis (0,5 puntos). 73. Referente al metabolismo celular. a) Identifique el proceso a que corresponde la siguiente reacción global y explique razonadamente si se trata de un proceso anabólico o catabólico (0,5 puntos) Glucosa + O2 → CO2 + H2O + Energía. b) Cite las diferentes etapas del proceso metabólico identificado (0,5 puntos). c) Indique la localización de las etapas mencionadas en el apartado anterior dentro de la célula y del orgánulo correspondiente (1 punto). 74. )Referente al metabolismo celular: (Sep 2016 – B4) a) Explique las diferencias fundamentales entre respiración mitocondrial y fermentación (1 punto). b) Indique los tipos de fermentaciones, así como su localización celular (0,5 puntos). c) Indique los mecanismos de síntesis de ATP que presenta una célula animal (0,5 puntos). 75. Referente al metabolismo celular: (Mod 2017 — B2) a) Identifique el proceso metabólico que corresponde a la siguiente reacción global, e indique su localización a nivel celular (0,75 puntos). Glucosa + 2 ADP + 2 Pi —> 2 etanol + 2 CO2 + 2 ATP b) Explique la dferencia fundamental entre respiración mitocondrial y fermentación (0,5 puntos). c) Indique el mecanismo de síntesis de ATP durante la fermentación. Cite otros mecanismos de síntesis de ATP, asi como su localización a nivel de orgánulo (0,75 puntos). 76. Referente al metabolismo celular: (Jun 17 – A5) a) Explique brevemente el significado del carácter anfibólico del Ciclo de Krebs. Indique los productos iniciales y finales de dicho ciclo (1,5 puntos). b) Indique la función de la molécula de ATP en el metabolismo de la célula (0,5 puntos). 77. Referente al metabolismo celular: (Sep 17 – A3) a) Identifique la molécula formada por adenina, ribosa y tres moléculas de ácido fosfórico. Indicar cómo se denomina la reacción en la que se sintetiza dicha molécula (0,5 puntos). b) Explique la importancia ecológica del proceso de fotosíntesis oxigénica (0,5 puntos). c) Explique la relación que hay entre la fermentación y la elaboración de queso ¿Cuál es el sustrato y los productos finales? ¿Qué microorganismos intervienen? (1 punto).

--------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 12 CATABOLISMO 11


FISIOLOGÍA CELULAR 13. ANABOLISMO, FOTOSÍNTESIS Y QUIMIOSÍNTESIS 1.

En la fotosíntesis: (mod 97 – A3) a) Explica los fenómenos más importantes de la fase lumínica. (1,5 puntos) b) Haz un esquema de las etapas de la fase oscura. (0,5 puntos)

2.

El diagrama representa la absorción de CO 2 por cm2 de hoja, en dos plantas de especies diferentes: (jun 97 – B2)

a) Interpreta la gráfica. (1 punto) b) Explica el significado del punto X. (0,5 puntos) c) ¿Qué factor podría estar actuando como factor limitante a partir de intensidades de luz superiores a 5? (0,5 puntos) 3.

Indica el proceso representado en el diagrama, nombrando las etapas numeradas del 1 al 5. (2 puntos) (mod 98 – B2)

4.

Algunas bacterias pueden obtener energía por quimiosíntesis. (jun 98 – A4) a) Concepto de quimiosíntesis. (0,5 puntos) b) Cita las fases de la quimiosíntesis. (0,5 puntos) c) Pon un ejemplo de una bacteria que participe en el ciclo del nitrógeno y explica su importancia en los ciclos biogeoquímicos. (1 punto)

5.

En el siguiente esquema se representa un cloroplasto: (jun 99 – A3) a) Nombra los compartimentos y estructuras que se señalan. (1 punto) b) Menciona las partes de la estructura de este orgánulo asociadas con los siguientes procesos: síntesis de ATP, ciclo de Calvin, cadena de transporte electrónico y fotólisis. (1 punto)

----------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 13 ANABOLISMO 1


6.

En relación con la fotosíntesis: (mod 01 – B2) a) Define los siguientes términos: grana, fotosistema I, estroma y ciclo de Calvin. (1 punto) b) A qué procesos de la fotosíntesis está asociada la obtención de los siguientes productos: ATP; oxígeno; ri bulosa 1,5-bifosfato; NADPH. (1 punto)

7.

Con relación a la fuente de energía utilizada por los organismos. (jun 01 – A2) a) Explica la diferencia fundamental entre un organismo quimioautótrofo (quimiosintético) y un organismo foto autótrofo (fotosintético). (0,5 puntos) b) Explica la diferencia fundamental entre fotofosforilación (fosforilación fotosintética) y fosforilación oxidativa. (0,5 puntos) c) Indica el tipo de células y el compartimento celular donde se producen los procesos indicados en el aparta do anterior. (1 punto)

8.

Con relación al tipo de metabolismo que presentan los seres vivos. (sep 01 – A2) a) Explica el significado de: anabolismo y catabolismo. (1 punto) b) Indica a qué tipo de reacciones, anabólicas o catabólicas, pertenecen las siguientes rutas metabólicas: glucólisis, gluconeogénesis, ciclo de Calvin, y -oxidación de los ácidos grasos. (1 punto)

9.

Con relación a la fotosíntesis: (sep 01 – B2) a) Explica qué es un fotosistema. (0,5 puntos) b) Indica un organismo que realice la fotosíntesis oxigénica y otro que realice la fotosíntesis anoxigénica e indi ca en qué compartimentos celulares la realiza cada uno. (1 punto) c) Explica la importancia fisiológica y ecológica de la fotosíntesis oxigénica. (0,5 puntos)

10. Con relación al proceso fotosintético: (mod 02 – B2) a) Indica las etapas del mismo y su localización en el orgánulo implicado. (1 punto) b) ¿Cuál es la diferencia entre la fotofosforilación acíclica y la cíclica? Razona la respuesta. (0,5 puntos) c) Cita otro orgánulo de la célula vegetal donde se produzca ATP de forma mayoritaria e indica la denominación del proceso. (0,5 puntos) 11. Relativo al ciclo de Calvin: (jun 02 – B2) a) Indica cuál es la finalidad de dicho ciclo y nombra el compartimento celular en el que transcurre. (0,5 puntos) b) Nombra las fases de dicho ciclo. (0,75puntos) c) Escribe una reacción global para dicho ciclo y cita el mecanismo por el que se ha obtenido el ATP necesario (0,75 puntos) 12. Con relación a la fotosíntesis: (sep 02 – B2) a) Define fotosíntesis oxigénica y fotosíntesis anoxigénica. (0,5 puntos) b) Define fotofosforilación cíclica y fotofosforilación no cíclica (acíclica) en los vegetales. (0,5 puntos) c) Indica el nombre de la ruta metabólica en la que ocurre la fíjación del carbono y el compartimento celular en el que se lleva a cabo. (0,5 puntos) d) Indica la reacción global de la ruta a la que te has referido en el apartado anterior. (0,5 puntos) 13. En relación con el metabolismo celular: (jun 03 – A2) a) Explica la finalidad (significado fisiológico) del Ciclo de Krebs e indica su localización a nivel de orgánulo. (0,75 puntos) b) Explica la finalidad (significado fisiológico) del Ciclo de Calvin e indica su localización, a nivel de orgánulo. (0,75 puntos) c) Indica en qué tipo de célula, vegetal y/o animal, se producen los ciclos citados. (0,5 puntos) 14. Relacionado con el metabolismo de los seres vivos autótrofos: (jun 03 – B2) a) Indica dos procesos por los que diferentes seres vivos pueden realizar un anabolismo autótrofo. (0,5 puntos) b) Nombra un organismo capaz de realizar cada uno de los procesos citados en el apartado anterior. (0,5 pun tos) c) Cita dos componentes de un fotosistema. (0,5 puntos) d) Nombra las dos etapas que constituyen el anabolismo autótrofo de cualquiera de los organismos citados an teriormente. (0,5 puntos) ----------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 13 ANABOLISMO 2


15. Relacionado con el metabolismo celular: (sep 03 – A2) a) Define anabolismo y catabolismo. (0,5 puntos) b) Nombra el sustrato inicial y el producto final de la glucólisis e indica si se trata de una vía anabólica o cata bólica. (0,5 puntos) c) Nombra un sustrato inicial y el producto final de la gluconeogénesis e indica si se trata de una vía anabólica o catabólica. (0,5 puntos) d) Indica los compartimentos celulares donde se realizan las vías metabólicas nombradas en los apartados b y c. (0,5 puntos) 16. En el proceso fotosintético: (jun 04 – B2) a) Indique sus fases y qué proceso básico se realiza en cada una de ellas (1 punto). b) Indique el papel que desempeñan los fotosistemas y señale su localización a nivel de orgánulo (0,5 puntos). c) Indique el mecanismo de obtención de ATP en tal proceso y su localización a nivel de orgánulo (0,5 puntos). 17. El ciclo de Calvin: (mod 05 – B2) a) Indique si se trata de un proceso anabólico o catabólico y su localización a nivel de orgánulo. (0,5 puntos) b) Señale la molécula que se regenera en el ciclo y el coenzima reducido que se requiere. (0,5 puntos) c) Indique la molécula que aporta energía al ciclo y en qué etapa se ha obtenido la citada molécula. (0,5 puntos) d) Explique cuál es la finalidad de dicho ciclo. (0,5 puntos) 18. Referente a la síntesis de ATP: (jun 05 - A2) a) Indique sus mecanismos de síntesis en la célula (0,5 puntos). b) Cite la localización de los mecanismos de síntesis de ATP en el cloroplasto y explique el mecanismo de producción en el citado orgánulo (0,75 puntos). c) Indique la denominación de los procesos de síntesis de ATP en los cloroplastos y cite una diferencia entre ambos procesos (0,75 puntos). 19. Con relación al metabolismo celular: (sep 05 – B2) a) Explique cuál es la finalidad de las reacciones anabólicas (0,5 puntos). b) ¿A qué tipo de proceso metabólico pertenece la fotosíntesis?. Razone la respuesta (0,5 puntos). c) Cite las fases del Ciclo de Calvin e indique su localización a nivel de orgánulo (1 punto). 20. Con relación al proceso fotosintético: (jun 06 – A2) a) Explique cuál qué es un fotosistema e indique sus componentes (0,75 puntos). b) Explique brevemente el transporte cíclico de electrones e indique su finalidad (0,5 puntos). c) Indique las etapas del ciclo de Calvin (0,75 puntos). 21. En un laboratorio se está trabajando con plantas utilizando hojas como material de estudio: (sep 06 – A2) a) Cite el proceso anabólico más característico que tiene lugar en el órgano aludido, mencione las fases del mismo e indique los productos que se originan en cada una de ellas (1 punto). b) Realice un esquema rotulado del orgánulo donde se realizan las fases aludidas en el apartado anterior y señale sus componentes (1 punto). 22. Referente al metabolismo celular: (mod 07 – A2) a) Según la fuente de carbono que utilicen los seres vivos para su desarrollo, explique los tipos de metabolis mo (0,5 puntos). b) Las moléculas que se citan a continuación: FAD, NAD +, NADP y O2 tienen relación con reacciones de los procesos fotosintético y respiratorio. Indique la relación de cada molécula con cada proceso (1 punto). c) Relacione los procesos anteriormente citados (fotosintético y respiratorio) con los tipos de metabolismo aludidos en el primer apartado (0,5 puntos). 23. Referente al proceso fotosintético en organismos eucarióticos: (jun 07 – A2) a) Indique qué organismos lo realizan y la localización subcelular concreta donde se lleva a cabo (0,5 puntos). b) Escriba de forma abreviada la ecuación general de dicho proceso (0,5 puntos). c) Indique la finalidad y cuáles son las principales etapas del ciclo de Calvin (1 punto). ----------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 13 ANABOLISMO 3


24. Referente a la formación de ATP en los procesos biológicos: (sep 07 – A2) a) Explique sus mecanismos de síntesis (1 punto). b) Para cada mecanismo de síntesis de ATP, cite un proceso biológico e indique su localización celular y a ni vel de orgánulo (1 punto). 25. Los orgánulos celulares presentan diversos componentes. (mod 08 – B2) a) Defina fotosistema, tilacoides y estroma (0,75 puntos). b) ¿Con qué proceso metabólico se relacionan estos términos?, ¿cuál es la finalidad de dicho proceso? (0,5 puntos). c) ¿En qué componente de los citados en el primer apartado se produce ATP? Explique su mecanismo de obtención (0,75 puntos). 26. Referente al ciclo de Calvin: (jun 2012 - A3) a) Indicar el gasto de NADPH y de ATP en el ciclo de Calvin para sintetizar una molécula de hexosa a partir de CO2 (0,5 puntos). b) Indicar el enzima más importante que interviene en el ciclo de Calvin, así como la reacción que cataliza (0,75 puntos). c) Indicar cuáles son las principales etapas del ciclo de Calvin (0,75 puntos). 27. El esquema adjunto representa un proceso esencial en la biosfera. (jun 08 – A2) a) Identifique de qué proceso se trata y cite el tipo de seres vivos que lo llevan a cabo (0,5 puntos). b) Indique la denominación de las dos partes del proceso (señaladas como A y B) y cite la localización subcelular donde se realizan (0,5 puntos). c) ¿Considera que se trata de un proceso anabólico o catabólico? Razone la respuesta (0,5 puntos). d) En la parte B del proceso participa un enzima considerado el más abundante del planeta. Indique de qué enzima se trata y escriba la reacción que cataliza (0,5 puntos).

28. Las células eucariotas poseen diversos orgánulos: (sep 08 – B1) a) Identifique el orgánulo cuyo esquema aparece en la figura adjunta, así como las distintas partes del mismo señaladas con números (1 punto). b) Indique el tipo de organismos en los que se encuentra este orgánulo y exprese, mediante la ecuación general del proceso, la función principal del mismo (0,5 puntos). c) Indique los lugares concretos dentro del orgánulo en los que se llevan a cabo las distintas fases del proceso (0,5 puntos).

29. En un cultivo de plantas medicinales, donde la hoja es el principal órgano de utilización en la industria farmacéutica, se observó una importante disminución del contenido de clorofila. (mod 09 – B4) a) ¿Qué proceso fisiológico se vería afectado de forma directa con la disminución del citado pigmento? Razone la respuesta (0,75 puntos). b) Cite las etapas del proceso fisiológico aludido en el apartado anterior e indique la localización a nivel subcelular de cada una de ellas (0,5 puntos). c) ¿Cómo podría afectar a nivel ecológico la disminución de clorofila? ¿y a nivel económico? Razone las res puestas (0,75 puntos). ----------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 13 ANABOLISMO 4


30. Suponga que en el genoma de cierta especie vegetal se han introducido dos genes: uno relacionado con la actividad de la rubisco (ribulosa-1,5-bisfosfato carboxilasa/oxigenasa) y otro con la fotólisis del agua. (jun 09 – A4) a) Cite el proceso y la etapa del mismo en la que interviene la rubisco y su localización a nivel de orgánulo (0,5 puntos). b) Explique la importancia biológica de esta enzima, ¿qué aplicación podría tener el aumento de su actividad? (0,5 puntos). c) ¿Qué es la fotólisis del agua? ¿Cuál es su finalidad? (0,5 puntos). d) ¿Cómo se llaman las plantas obtenidas mediante técnicas similares a la del enunciado? ¿Con qué propósito se realizan estas técnicas?, ponga un ejemplo (0,5 puntos). 31. El esquema siguiente representa un proceso básico en algunos organismos: (sep 09 – A4)

a) Indique la denominación del proceso representado y su localización a nivel de orgánulo. Complete los números 1, 2, 3, 4 y 5 (1,5 puntos). b) Explique el significado biológico del proceso representado en el esquema (0,5 puntos). 32. De los compuestos celulares que se citan a continuación: ribulosa, hemicelulosa, NADH, FAD +, glucosa, NAD+, CO2, NADP+. (sep 09 – B1) a) Cite cuatro compuestos que estén relacionados directamente con el proceso fotosintético e indique, para cada uno de ellos, su función, la etapa del proceso en la que participan y la localización de ésta a nivel de orgánulo (1 punto). b) Cite dos nucleótidos que estén relacionados directamente con la respiración e indique, para cada uno de ellos, su función, la etapa del proceso en la que participan y la localización de ésta a nivel de orgánulo (0,5 puntos). c) Explique las características químicas de la hemicelulosa y cite su función (0,5 puntos). 33. Explique las diferencias entre: (mod 2010 – A2) a) Fotosíntesis oxigénica y fotosíntesis anoxigénica (0,75 puntos). b) Reacciones anabólicas y reacciones catabólicas (0,75 puntos). c) Respiración aerobia y fermentación (0,5 puntos). 34. Relacionado con el metabolismo celular: (jun gen 2010 – A5) a) Defina fotofosforilación, indique sus tipos y los productos que se originan. Cite el proceso metabólico relacionado con la fotofosforilación y la etapa del mismo donde tiene lugar (1 punto). b) ¿Cuáles son las semejanzas y las diferencias más relevantes entre la fotofosforilación y la fosforilación oxidativa? Razone la respuesta (1 punto). 35. Sobre el ciclo de Calvin: (jun gen 2010 – B5) a) Indique sus fases y explique cada una de ellas (1,5 puntos). b) Cite dos diferencias con el ciclo de Krebs (0,5 puntos). ----------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 13 ANABOLISMO 5


36. Para los términos que se citan a continuación: (jun esp 2010 – B5) a) Indique las diferencias más relevantes entre fotofosforilación acíclica y fotofosforilación cíclica y cite su loca lización a nivel de orgánulo (0,5 puntos). b) Explique la diferencia fundamental entre respiración y fermentación (0,5 puntos). c) Indique las diferencias entre quimiosíntesis y fotosíntesis (0,5 puntos). d) Explique la diferencia entre procesos anfibólicos y procesos anabólicos. Ponga un ejemplo de cada caso (0,5 puntos). 37. Los plastos son unos orgánulos característicos de las células vegetales: (sep 2010 – A1) a) Respecto al esquema adjunto escriba el nombre de este plasto, qué proceso metabólico realiza y el nombre que corresponde a cada número (1,5 puntos). b) Indique el lugar concreto donde se realiza el ciclo de Calvin y la finalidad del mismo (0,5 puntos).

38. Los compuestos siguientes están relacionados con la respiración y la fotosíntesis: ribulosa 1,5- bisfosfato, NADH, FADH2, NADP. (sep 2010 – B5) a) Relacione cada uno de los compuestos con el proceso correspondiente y con la etapa del mismo donde par ticipa (1 punto). b) Explique las características químicas del NADP y FADH 2 e indique su función (0,5 puntos). c) Explique las características químicas y la función de la ribulosa 1,5- bisfosfato (0,5 puntos). 39. Respecto de la quimiosíntesis: (Mod 2012 – B5) a) Explique el significado de quimiosíntesis (0,5 puntos). b) Indique, razonando la respuesta, si se trata de un proceso anabólico o catabólico (0,5 puntos). c) ¿Qué organismos realizan este tipo de metabolismo? Describa la estructura de estos organismos (1 punto). 40. Referente al metabolismo celular: (Sep 2014 – A5) a) Indique los productos finales de la glucólisis, especifique si se trata de una ruta anabólica o catabólica y lo calice el compartimento celular donde se realiza (0,5 puntos). b) Indique la reacción general de la fotosíntesis. Cite el tipo de seres vivos eucariotas que realizan dicho proce so y especifique dónde se localiza a nivel celular (1 punto). c) Indique el gasto de NADPH y de ATP en el Ciclo de Calvin para sintetizar una molécula de glucosa (0,5 puntos). 41. El diagrama adjunto esquematiza las principales reacciones de un orgánulo vegetal. (Mod 2013 – A4)

----------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 13 ANABOLISMO 6


a) Identifique el orgánulo representado e indique el principal proceso fisiológico que realiza. Este proceso, ¿es anabólico o catabólico? (0,75 puntos). b) El proceso referido en el apartado anterior se lleva a cabo en dos etapas señaladas en el dibujo como A y B. Identifíquelas, indique los compartimentos estructurales en los que se llevan a cabo y explique brevemente el fundamento fisiológico de dichas etapas (0,75 puntos). c) Como se puede apreciar en el esquema, en este orgánulo se produce ATP. Cite otro orgánulo de la célula vegetal donde se produzca ATP de forma mayoritaria e indique la denominación del proceso (0,5 puntos). 42. Referente al metabolismo celular: (Mod 2013 – B1) a) Indique las diferencias más relevantes entre: fotosíntesis y quimiosíntesis; nutrición autótrofa y nutrición heterótrofa (1 punto). b) Indique la reacción global de la fotosíntesis (0,5 puntos). c) Identifique el proceso metabólico a que corresponden las siguientes reacciones, e indique el tipo de organis mo que lo realiza (0,5 puntos). NH3 + O2 → NO2- + H2O + energía

NO2- +O2 → NO3- + energía

43. La utilización del microscopio permitió a los biólogos diferenciar distintos tipos de células. El dibujo adjunto representa uno de ellos. (Mod 2013 – B5)

a) Razonando la respuesta, indique de qué tipo de célula se trata (0,5 puntos) b) Escriba el nombre de las estructuras numeradas (1 punto). c) Indique cuál es la función principal que realiza la estructura señalada con el número 6 y exprésela mediante la ecuación global que determina el proceso (0,5 puntos). 44. Referente al proceso fotosíntético en organismos eucariotas: (Jun 2013 – B1) a) Explique qué es un fotosistema (0,5 puntos). b) Explique la finalidad y cuáles son las principales etapas del Ciclo de Calvin (1 punto). c) Indique el gasto de NADPH y de ATP en el Ciclo de Calvin para sintetizar una molécula de glucosa (0,5 puntos). 45. Con referencia al metabolismo celular: (Sep 2013 – B1) a) Identifique el proceso metabólico que corresponde a cada una de las siguientes reacciones generales (0,5 puntos): Glucosa + O2 —> CO2 + H2O + Energía CO2 + H2O +Luz —> Glucosa + O2 b) Explique razonadamente si los procesos identificados en el apartado anterior son procesos anabólicos o catabólicos (0,5 puntos). c) Defina el proceso de fotofosforilación, indicando sus tipos y los productos que se originan en cada uno de ellos (1 punto).

----------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 13 ANABOLISMO 7


46. Referente aI metabolismo celular en eucariotas: (Mod 2014 – A5) a) Indique la reacción general de la fotosíntesis. Cite el tipo de seres vivos que realizan dicho proceso y espe cifique dónde se localiza a nivel celular (1 punto). b) Indique la reacción general de la oxidación completa de una molécula de glucosa y cite las diferentes etapas de este proceso metabólico (1 punto). 47. Referente al metabolismo celular: (Jun 2014 – B1) a) Indique la composición de la molécula de ATP (0,5 puntos). b) De las siguientes rutas metabólicas, indique en cuales de ellas se consume ATP y en cuales se sintetiza ATP: ciclo de Calvin, fosforilación oxidativa, biosíntesis de aminoácidos, fotofosforilación, ciclo de Krebs y biosíntesis de acidos grasos (1,5 puntos). 48. Referente al metabolismo celular: (Mod 2015 – A1) a) Cite las diferentes etapas que pueden identificarse en el proceso de oxidación completa de una molécula de glucosa, e indique la localización a nivel celular y de organulo de las etapas identificadas (1 punto). b) Cite las etapas que componen el proceso fotosintético e indique la localización a nivel de orgánulo de las mismas (0,5 puntos). c) Indique los mecanismos de obtención de ATP que presenta una célula vegetal (0,5 puntos). 49. Referente al metabolismo celular: (Jun 2015 – B3) a) Indique el sustrato inicial y el producto final de la gluconeogénesis, especifique si se trata de una ruta anabólica o catabólica, localice el compartimento celular donde se realiza e indique el balance energético de este proceso (1 punto). b) Indique la reacción general de la fotosíntesis. Cite el tipo de seres vivos eucariotas que realizan dicho proce so y especifique dónde se localiza a nivel celular (1 punto). 50. Referente al metabolismo celular: (Sep 2015 – A2) a) Explique la relación que hay entre la fermentación y la elaboración del vino. ¿Cuál es el sustrato y los pro ductos finales? ¿Qué microorganismos intervienen? (1 punto). b) Indique el gasto de NADPH y de ATP en el Ciclo de Calvin para sintetizar una molécula de glucosa (0,5 puntos). c) Explique cómo se produce la síntesis de ATP en la glucólisis (0,5 puntos). 51. Referente al metabolismo celular en organismos eucarióticos: (Jun 2016 – A3) a) Identifique el proceso que representa la siguiente ecuación general: CO 2 + H2O + Luz → Glúcido + O2 Cite el tipo de seres vivos eucariotas que realizan dicho proceso y especifique dónde se localiza a nivel celular (0,75 puntos). b) Indique todos los mecanismos de síntesis de ATP que presenta una célula vegetal, así como su localización a nivel celular (0,75 puntos). c) Indique cuatro de los componentes principales de un cloroplasto (0,5 puntos). 52. Referente al metabolismo celular: (Sep 17 – A3) a) Identifique la molécula formada por adenina, ribosa y tres moléculas de ácido fosfórico. Indicar cómo se de nomina la reacción en la que se sintetiza dicha molécula (0,5 puntos). b) Explique la importancia ecológica del proceso de fotosíntesis oxigénica (0,5 puntos). c) Explique la relación que hay entre la fermentación y la elaboración de queso ¿Cuál es el sustrato y los pro ductos finales? ¿Qué microorganismos intervienen? (1 punto). 53. Referente al metabolismo celular: (Mod 2018 - A5) a) Indique las diferencias más relevantes entre: fotosíntesis y quimiosíntesis; nutrición autótrofa y nutrición heterótrofa (1 punto). b) Indique los componentes de la molécula de ATP (0,5 puntos). c) Explique en qué consiste el proceso de nitrificación e indique el tipo de organismo que lo realiza (0,5 pun tos).

----------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 13 ANABOLISMO 8


LA BASE DE LA HERENCIA. ASPECTOS QUÍMICOS Y GENÉTICA MOLECULAR 14. EXPRESIÓN DE LA INFORMACIÓN GENÉTICA 1.

Ácidos nucleicos. (mod 97 – B4) a) Explica con detalle el proceso de síntesis de ARN en el núcleo de una célula. (1 punto) b) Indica tres tipos de ARN señalando el papel que desempeñan en la síntesis de proteínas. (0,5 puntos) c) Escribe la secuencia de ARN que se transcribiría utilizando como molde la secuencia inferior del ADN en el dibujo. (0,5 puntos)

2.

En el esquema se representa la molécula de la lisozima: (sep 97 – B1) a) ¿De qué tipo de molécula se trata y qué tipo de estructura presenta? (1 Punto) b) ¿Cómo se llaman las subunidades representadas por círculos y qué tipo de enlace las une? (0,5 Puntos) c) ¿De qué depende el que las subunidades se unan en ese y no en otro orden? (0,5 Puntos)

3.

Observe el esquema siguiente: (sep 98 – A3)

a) ¿Cómo se denomina cada una de las etapas numeradas en el mismo? (1 punto) b) Indica cuáles de estas etapas se producen normalmente en la célula eucariótica, indicando dónde se produ ce cada una de ellas. (1 punto) 4.

Si un fragmento de una cadena de ADN tiene la secuencia: (sep 98 – B3) 3’ TAGCGTGACCAAGTC 5’ a) ¿Cuál será la secuencia de bases de su ARN mensajero? (0,5 puntos) b) ¿Cuántos aminoácidos podría tener como máximo la cadena polipeptídica resultante ? (0,5 puntos) c) Cita la característica del código genético que ha utilizado para calcular el número de aminoácidos. (1 punto)

5.

En la replicación del ADN: (jun 99 – A4) a) ¿Qué significa que la replicación del ADN es semiconservativa? (0,5 puntos) b) ¿Qué significa que la replicación del ADN es bidireccional? (0,5 puntos) c) Explica las semejanzas y diferencias en la síntesis de las dos cadenas de ADN en una horquilla de replica ción (1 punto)

6.

La transcripción y la traducción son procesos fundamentales en la célula eucariota. (sep 99 – A3)

a) Define y distingue entre ambos procesos e indica en qué parte de la célula se produce cada uno de ellos. (1 punto) b) Nombra los tipos de ARN que intervienen en la traducción y explica la función de cada uno de ellos. (1 punto) 7. El siguiente fragmento de una cadena de ADN representa el inicio de un gen: (mod 00 – A4) 3' TACCCGAGATGT....... 5' a) Determina la secuencia de bases de su ARN mensajero e indica su polaridad. (0,5 puntos) b) Determina la secuencia de bases de la cadena complementaria de ADN e indica su polaridad. (0,5 puntos) c) ¿En qué componentes se diferencian el ADN y el ARN? (1 punto) ------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 14 GENÉTICA MOLECULAR 1


8.

La siguiente secuencia de ADN corresponde a un fragmento de un gen: (jun 00 – B4) 3' GGCAATATCCGA 5' a) Indica la secuencia de nucleótidos de su ARNm y la polaridad de la secuencia. (0,5 puntos) b) Menciona el número máximo de aminoácidos que se sintetizarán en el proceso de traducción. (0,5 puntos) c) Introduce una mutación puntual (génica) en la secuencia de ADN e indica una posible consecuencia de la mutación en la secuencia de aminoácidos de la proteína. (0,5 puntos) d) Explica dos posibles efectos de la mutación puntual para la célula. (0,5 puntos)

9.

La siguiente secuencia polinucleotídica corresponde a un fragmento del inicio de un gen de una cepa bacteriana: (sep 00 – A4) 3' TACAATTCCCGGGCAACACAC 5' a) Escribe la secuencia de bases del ARN mensajero que se puede sintetizar e indica su polaridad. (0,5 puntos) b) ¿Cuál es el número máximo de aminoácidos que puede codificar este fragmento? (0,5 puntos) c) ¿Qué características del código genético has utilizado para determinar el número de aminoácidos? (0,5 pun tos) d) Si se detectara una variante de la cepa que produjera un polipéptido de cinco aminoácidos, ¿cómo pudo producirse la variante? (0,5 puntos)

10. En relación con la expresión de la información genética: (sep 00 – B4) a) Cita y define los dos procesos que tienen lugar en la expresión de la información genética. (1 punto) b) Dónde tienen lugar los procesos anteriores en células procariotas y eucariotas. (1 punto) 11. El dogma central de la biología molecular se puede representar esquemáticamente de la siguiente manera: (mod 01 – B4) ADN → ARN → proteína a) Indica las diferencias que existen entre la composición y estructura del ADN y del ARN. (1 punto) b) Indica el nombre de los procesos ADN → ARN y ARN → Proteína e indica en qué parte de la célula eucariótica se producen. (0,5 puntos) c) Menciona tres tipos distintos de ARN y cita el proceso que permite el paso de ARN a ADN. (0,5 puntos) 12. Con relación a la biosíntesis de proteínas en células eucarióticas: (jun 01 – B4) a) Menciona el nombre del proceso e indica su localización celular. (0,5 puntos) b) Indica el nombre de la molécula que lleva el codón y el nombre de la molécula que lleva el anticodón. (0,5 puntos) c) Indica la función del ARN transferente en este proceso y explica la relación entre su estructura y su función. (1 punto) 13. La expresión de los genes es un proceso universal de todos los seres vivos. (sep 01 – A4) a) ¿Cuál es la naturaleza molecular de los genes? (0,5 puntos) b) Explica los dos procesos fundamentales que tienen lugar en la expresión de un gen. (1 punto) c) En los organismos eucarióticos, ¿dónde tienen lugar los dos procesos anteriores? (0,5 puntos) 14. Con relación a los ARN de células eucarióticas: (sep 01 – B4) a) Indica las clases de ARN que conozcas. (0,75 puntos) b) Explica la función de cada uno de ellos. (0,75 puntos) c) Explica brevemente el proceso de maduración del ARN. (0,5 puntos) 15. Con relación al proceso de replicación del ADN: (mod 02 – A4) a) ¿Qué es la replicación del ADN? (0,5 puntos) b) ¿Cuál es su significado biológico? (0,5 puntos) c) Si una cadena de un fragmento de ADN tiene la siguiente secuencia: 3' ATTGGCATAGC 5' ¿Cuál es la secuencia y polaridad de la otra cadena de la doble hélice? (0,5 puntos) d) Indica las etapas que tienen lugar en el proceso de la replicación del ADN. (0,5 puntos) ------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 14 GENÉTICA MOLECULAR 2


16. Con relación al código genético: (mod 02 – B4) a) ¿Qué es el código genético y para qué sirve? (0,5 puntos) b) ¿Qué es un codón? (0,5 puntos) c) Explica cuatro características del código genético. (1 punto) 17. En el proceso de replicación del ADN en bacterias (Escherichia coli): (jun 02 – A4) a) Explica el significado de los siguientes términos: replicación semiconservativa y replicación bidireccional. (0,5 puntos) b) Explica brevemente el mecanismo de la síntesis de ADN en la cadena retardada. (1,5 puntos) 18. Con relación a la etapa de iniciación de la síntesis de una cadena polipeptídica (primera etapa de la tra ducción): (jun 02 – B4) a) ¿Qué elementos constituyen el complejo de iniciación? (1 punto) b) ¿Qué elementos constituyen un ribosoma completo y funcional? (1 punto) 19. Un determinado segmento de ADN tiene la siguiente secuencia de nucleótidos en una de las cadenas: (sep 02 – A4) ... 3'- TTCCAGCAT 5' ... a) ¿Cuál debe ser la secuencia de nucleótidos de la otra cadena?. Marca los extremos 3' y 5'. (0,5 puntos) b) Si la enzima ARN polimerasa lee este segmento de ADN, ¿cuál debe ser la secuencia de nucleótidos de la cadena de ARN mensajero?. Marca los extremos 3' y 5'. (0,5 puntos) c) Define los siguientes términos de mutaciones puntuales (génicas): mutación silenciosa y mutación de cambio de sentido. Indica las consecuencias que tendrían estas mutaciones en la secuencia de aminoácidos codificada. (1 punto) 20. Con relación al proceso de replicación del ADN: (sep 02 – B4) a) Nombra las proteínas y enzimas que intervienen en la etapa de desenrollamiento y apertura de la doble hélice y explica sus funciones. (1,5 puntos) b) Explica dos diferencias en el proceso de replicación del ADN en organismos procarióticos y eucarióticos. (0,5 puntos) 21. Considera el siguiente segmento de ADN perteneciente a un organismo procariótico: (mod 03 – A4) … 5' – ATTCGCGATGGG – 3' ... … 3' – TAAGCGCTACCC – 5' ... Si la cadena inferior es la cadena molde utilizada por la enzima ARN polimerasa: a) Escribe la secuencia de nucleótidos del ARN transcrito y marca sus extremos 5' y 3'. (0,5 puntos) b) ¿Qué papel desempeñaría este ARN transcrito en el proceso de traducción? (0,5 puntos) c) ¿En qué compartimento celular se localizaría el proceso de transcripción? ¿Y el proceso de traducción? (0,5 puntos) d) Define los términos de transcripción y traducción. (0,5 puntos) 22. En relación con la expresión génica: (sep 03 – A4) a) Explica en que consiste el proceso de traducción y cita en qué estructuras de la célula se realiza. (0,5 pun tos) b) Indica que papel desempeñan en este proceso los sitios P y A de¡ ribosoma y la enzima aminoacilARNt-sintetasa. (0,75 puntos) c) Indica cómo se denomina el triplete de bases que en el ARNm codifica para un aminoácido específico, cómo se denomina el triplete de bases complementarias en el ARNt e indica cual sería el triplete de bases de¡ ARNt si su complementario para el aminoácido valina en el ARNm es GUA. (0,75 puntos) 23. En relación con la replicación: (sep 03 – B4) a) Indica la finalidad de¡ proceso de replicación y en qué período del ciclo celular tiene lugar este proceso. ( 0,5 puntos) b) Indica dos diferencias en la replicación de procariotas y eucariotas. (0,5 puntos) c) Explica qué es un cebador y por qué es necesaria su presencia en el proceso de replicación. (0,5 puntos) d) Supón que tomando como molde la cadena retardada de una molécula de ADN se han sintetizado dos fragmentos de Okazaki. Indica el nombre y función de dos enzimas, implicadas en la unión de dichos fragmen tos. (0,5 puntos) ------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 14 GENÉTICA MOLECULAR 3


24. En relación con el material hereditario: (mod 04 – A4) a) Indica semejanzas y diferencias en cuanto a la composición química del ADN y ARN. (1 punto) b) Define el concepto de gen a nivel molecular e indica en qué se diferencian los genes de procariotas y euca riotas. (0,5 puntos) c) Define los términos exón e intrón. (0,5 puntos) 25. El siguiente esquema muestra la secuencia de procesos conocida como EL DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR: (mod 04 – B4)

a) Indica y describe brevemente cada uno de los procesos biológicos que se indican con las letras a, b, c, d en el esquema. (1 punto) b) Cada uno de los elementos que se citan a continuación actúan en los procesos que ha indicado en la pre gunta anterior. Haz una lista colocando cada elemento en el proceso que le corresponde: ARN polimerasa dependiente de ADN, ribosomas, ADN polimerasa, anticodón, transcriptasa inversa, promotor, aminoácidos, ARNt y cebadores. (1 punto) 26. Referente a la replicación: (jun 04 – A4) a) El siguiente esquema corresponde a la replicación de una molécula de ADN, en el que las flechas indican la dirección de replicación de las nuevas cadenas

Indique lo que significan las letras A, B, C, y E (1 punto). b) Explique por qué es necesaria la síntesis de los fragmentos, señalados en el esquema con la letra C, e indique los pasos necesarios para que se unan dichos fragmentos haciendo referencia al nombre y actividad de las enzimas implicadas en este proceso (1 punto). 27. En relación con la replicación. (jun 04 – B4) a) Explique de forma razonada cual es el significado y finalidad de la replicación semiconservativa y semidis continua del ADN (1 punto). b) Indique qué es un cebador y qué enzima es la encargada de su síntesis (0,5 puntos). c) Considere el siguiente fragmento de una cadena de ADN cuya secuencia de nucleótidos es: 3' TTTACTGAA 5' Escriba la cadena complementaria tras la replicación del mismo indicando su polaridad. Si el punto de inicio de la replicación hubiese sido el nucleótido A, subrayado en la secuencia, conteste razonadamente si desde ese punto hacia la izquierda la síntesis de la nueva cadena hubiese sido continua o discontinua (0,5 puntos).

------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 14 GENÉTICA MOLECULAR 4


28. En relación con la información genética y sus alteraciones: (sep 04 – A4) a) Si un polipéptido tiene 450 aminoácidos, indique cuántos ribonucleótidos tendrá el fragmento del ARNm que codifica esos aminoácidos. Razone la respuesta (0,5 puntos). b) 5'GUU-UUC-GCA-UGG3', son cuatro codones de una molécula de ARNm. Indique cuáles serán los anticodones de las moléculas de ARNt. ¿Qué significa que el código genético es degenerado? (0,5puntos). c) Suponga que en un fragmento de ADN que codifica un polipéptido se produce una mutación puntual que afecta a un par de bases. Debido a ello, cuando la célula sintetice de nuevo el polipéptido. a éste le podría haber ocurrido uno de los cuatro hechos siguientes: 1. 2. 3. 4.

Que se codifique el mismo aminoácido que el sintetizado antes de la mutación. La sustitución de un aminoácido por otro distinto. Que el nuevo polipéptido sintetizado sea más corto Que el nuevo polipéptido sintetizado sea más largo

Basándose en sus conocimientos del código genético, explique el por qué de cada uno de estos resultados (1 punto). 29. Referente a replicación, expresión y mutación. (sep 04 – B4) a) Explique cómo se mantiene y se transmite la información genética en los seres vivos. Describa brevemente cada uno de los procesos implicados (1 punto). b) Si durante la replicación del ADN se inserta un nucleótido incorrecto en la cadena de nueva síntesis, indique el nombre de la enzima encargada de subsanar este error y explique como lo haría (0,5 puntos). c) Indique en qué dirección son sintetizadas siempre las nuevas cadenas de ADN y cite cómo se denomina a la hebra de ADN que se transcribe en ARNm (0,5 puntos). 30. En relación con el código genético: (mod 05 – B4) a) Cite cuatro características del código genético para todos los tipos celulares y explique qué quiere decir que el código genético es degenerado. (1 punto) b) Para la síntesis del polipéptido Tyr-Leu-Met-Phe se han utilizado los siguientes ARNt: 3’UAC5’, 3’AAU5’, 3’AAA5’ Y 3’AUA5’ Escriba la secuencia de nucleótidos del ARNm cuya traducción da lugar al péptido indicado y la secuencia de la cadena molde del ADN del gen correspondiente. (1 punto)

31. Con relación a la expresión génica: (jun 05 - A4) a) Cite y defina los procesos necesarios para la expresión de la información genética (0,75 puntos). b) Indique la secuencia y la polaridad del ARNm que se transcribiría utilizando como molde la secuencia infe rior del siguiente ADN: 5'ATCGAAGTT 3’ 3'TAGCTTCAA 5'

(0,5 puntos)

c) Si la molécula de ARNm obtenido en la cuestión anterior, comienza a leerse por el primer nucleótido del extremo 5’, se obtienen tres tripletes o codones distintos. Escriba para cada codón su anticodón correspondiente en el ARNt (0,75 Puntos). ------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 14 GENÉTICA MOLECULAR 5


32. Referente al código genético y mutación: (sep 05 – A4) a) A partir de la siguiente secuencia de bases correspondiente a un fragmento de un gen:

Indique cuál será la secuencia del ARNm correspondiente a la cadena inferior de este fragmento, indicando su polaridad (0,5 puntos).

b) Ayudándose de la tabla del código genético escriba la secuencia de aminoácidos del polipéptido codificado por ese fragmento de gen indicando los extremos amino y carboxilo (0,5 puntos). c) Si en el ADN se produjese una sustitución del par C-G por el par T-A, indique cómo se altera el ARNm y la cadena polipeptídica (0,5 puntos). d) Explique qué significa que el código genético es degenerado (0,5 puntos). 33. Referente a la replicación: (sep 05 – B4) a) Indique, mediante un esquema, qué se entiende por replicación semiconservativa del ADN. (0,5 puntos). b) Explique cuál es la finalidad de la replicación del ADN e indique en qué etapa del ciclo celular tiene lugar (0,5 puntos). c) Cite el nombre de la enzima principal en la síntesis de ADN en procariotas y señale en qué dirección sintetiza las nuevas cadenas (0,5 puntos). d) Indique cómo se denomina el lugar específico donde se inicia la replicación y qué quiere decir que la replicación del ADN es bidireccional (0,5 puntos). 34. Referente a la expresión en eucariotas: (mod 06 – A4) a) El esquema adjunto representa los procesos de transcripción, procesamiento o maduración y traducción. Identifique los distintos elementos de la figura representados por letras (1,25 puntos). b) c) Explique qué es un exón e indique la función de los ARNt y de las enzimas Aminoacil-ARNt sintetasas (0,75 puntos).

------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 14 GENÉTICA MOLECULAR 6


35. El siguiente diagrama representa una molécula de ADN sujeta a replicación: (sep 06 – A4) a) Copie el esquema y dibuje las cadenas de ADN nuevas indicando los siguientes elementos: 1. Cadenas lí deres (conductoras) y retrasadas (retardadas). 2. Polaridad de las mismas. 3. Fragmentos de Okazaki. 4. Cebadores de ARN (1 punto).

b) Explique qué significa que la replicación del ADN es bidireccional y semiconservativa (0,5 puntos). c) Cite dos funciones de la ADN polimerasa I (0,5 puntos). 36. La molécula de ADN es portadora de información: (mod 07 – A4) a) Indique el nombre de los autores que propusieron el modelo de la doble hélice y cite tres características de dicho modelo (1 punto). b) Dado el siguiente fragmento de ARN m: 5´ AUGCUAGCGAAA 3´, indique, razonando la respuesta, la molécula de ADN de la que procede y cite dos diferencias entre ambos ácidos nucleicos (1 punto). 37. Referente a la expresión de la información hereditaria: (sep 07 – A4) a) Defina el proceso de transcripción e indique las etapas del mismo (0,5 puntos). b) Cite el nombre de la enzima implicada en este proceso. ¿Cómo se denominan las secuencias del ADN donde se une esta enzima para el comienzo de la transcripción? (0,5 puntos). c) Asocie a los procesos de transcripción y traducción los siguientes términos: ARNm/ ARNt/ ARN polimerasa/ ribosoma/codón/ aminoácido/sitioP/ anticodón/ procesamiento o maduración/sitio A/intrón (1punto). 38. En relación con las proteínas. (mod 08 – A1) a) ¿Qué es una proteína? Explique su formación (0,75 puntos). b) ¿Qué es la estructura primaria de la proteína?, ¿por qué es importante? Razonando la respuesta, explique su relación con el ADN (0,75 puntos). c) Cite dos funciones de las proteínas y ponga un ejemplo en cada caso (0,5 puntos). 39. El esquema adjunto corresponde a un importante proceso biológico relacionado con el ADN: (jun 08 – A4) a) ¿Qué proceso representa? ¿En qué fase del ciclo celular se produce? (0,5 puntos). b) ¿Qué finalidad tiene este proceso? (0,5 puntos). c) A y B son las cadenas de nueva síntesis, indique la denominación de cada una de ellas. ¿Qué representan C y D? (0,5 puntos). d) ¿Por qué tiene que producirse la estructura marcada como D? (0,5 puntos).

------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 14 GENÉTICA MOLECULAR 7


40. En la imagen de la izquierda se representa un proceso importante. (mod 09 – A4) a) Indique qué proceso representa este esquema e identifique todas las estructuras y las moléculas que aparecen marcadas con las letras A, B, C, D, E, F y G en el dibujo (1 punto). b) Explique brevemente el proceso representado (1 punto).

41. Con referencia a distintos procesos biológicos: (jun 09 – B3) a) Para replicarse en células eucarióticas, un virus de ARN monocatenario (similar al del VIH) debe integrarse en el genoma de la célula huésped, que es ADN bicatenario. Explique las distintas etapas del proceso de re plicación (1,5 puntos). b) Si en otro Planeta hubiera un ADN constituido por 6 nucleótidos distintos, existieran 216 aminoácidos esen ciales y el código genético estuviera constituido por tripletes, ¿sería posible que existiera un mecanismo de traducción igual al de la Tierra? Razone la respuesta (0,5 puntos). 42. Referente a la expresión del material hereditario: (sep 09 – B3) a) Represente mediante un esquema rotulado “El Dogma Central de la Biología Molecular” actualizado (0,5 puntos). b) Explique brevemente las tres etapas del proceso de la transcripción en procariontes (0,75 puntos). c) El siguiente esquema representa un ARN transcrito primario procedente de un fragmento de un gen, corres pondiente a una célula eucariota. 5´Exón Intrón Exón Intrón 3´ Explique brevemente el proceso de maduración de este ARN transcrito primario hasta obtener su ARNm maduro (0,75 puntos). 43. Referente a la expresión del material hereditario en eucariotas: En el siguiente esquema se represen tan las secuencias incompletas de dos ácidos nucleicos, así como dos procesos biológicos muy importantes indicados con flechas.

Copie el esquema y responda a las siguientes cuestiones: (mod 2010 – A3) a) Complete estas secuencias sustituyendo los números por las bases nitrogenadas correspondientes, indique la polaridad de cada una de las cadenas y escriba el nombre del ácido nucleico al lado de sus secuencias correspondientes (1 punto). b) Cite cada uno de los procesos a y b indicados con las flechas. Defínalos e indique en qué parte de la célula se realiza cada uno de ellos (1punto).

------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 14 GENÉTICA MOLECULAR 8


44. Para que una célula eucariota lleve a cabo la síntesis de proteínas exportables y su secreción al medio extracelular deben intervenir numerosas moléculas y estructuras celulares. (mod 2010 – B3) a) Explique la parte del proceso que se efectúa en el núcleo, citando las moléculas y estructuras nucleares que intervienen en el mismo (1 punto). b) Explique la parte del proceso que tiene lugar en el citoplasma indicando las moléculas y estructuras citoplásmicas que lo llevan a cabo (1 punto). 45. Con relación a la traducción del mensaje genético: (sep 2010 – A2) a) Indique los distintos tipos de ARN (0,5 puntos). b) Describa la función que desempeña en la célula cada tipo de ARN (1,5 puntos). 46. Dado el siguiente fragmento de ADN que será transcrito y traducido (jun 2011 - B1) 5' AAATGCTACAAT 3' 3' TTTACGATGTTA 5' a) Escriba la secuencia de nucleótidos y polaridad del ARNm que se sintetizaría utilizando como molde la cadena inferior del ADN (0,5 puntos). b) Proporcione los anticodones de los ARNt con sus polaridades (0,5 puntos). c) Escriba la secuencia de aminoácidos del tetrapéptido que se sintetizaría (0,5 puntos). d) Explique qué ocurriría si en el triplete que codifica para Tyr se cambia la C por A o G ¿Cuáles serían sus consecuencias? (0,5 puntos).

47. El siguiente esquema representa un proceso fundamental de la expresión génica en procariotas: (Sept 2011 – A2) a) Cite y defina el proceso representado en el esquema (0,5 puntos). b) ¿A qué moléculas se refieren las letras A y D? Indique sus polaridades (extremos de cada una de ellas) (0,5 puntos). c) Respecto a su composición química, ¿qué diferencias existen entre ambas moléculas? (0,5 puntos) d) ¿Cómo se denominan las cadenas representadas con las letras B y C?, ¿y la enzima representada con la letra F? (0,5 puntos). 48. Con relación a la expresión del material hereditario: (jun 2012 - A2) a) Para la siguiente secuencia de ARNm 5´ AAACGGUUUUCA 3´, determine la secuencia de la cadena de ADN a partir de la cual se transcribió. Escriba su cadena complementaria e indique la polaridad de ambas (0,75 puntos). b) Si la molécula de ARNm de la cuestión anterior comienza a leerse por el primer nucleótido del extremo 5´, se obtienen cuatro tripletes o codones distintos. Escriba para cada codón su anticodón correspondiente en el ARNt (0,5 puntos). c) Indique tres diferencias del proceso de transcripción en procariotas y eucariotas (0,75 puntos). 49. Referente al material hereditario y su replicación: (Mod 2013 – B4) a) Cite los tres componentes de un nucleótido de ADN (0,5 puntos). b) Respecto a su composición química ¿en qué se diferencian el ADN y el ARN? (0,5 puntos). c) Dibuje una burbuja de replicación de una molécula de ADN que se está replicando. En su esquema indique: 1) origen de replicación, 2) la polaridad (extremos 5´y 3´) de las cadenas moldes y de nueva síntesis, 3) las cadenas lideres y retrasadas, 4) los fragmentos de Okazaki, y 5) los cebadores (1 punto). ------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 14 GENÉTICA MOLECULAR 9


50. Con relación al material genético: (Jun 2013 – A5) a) Describa la estructura secundaria del ADN (0,75 puntos). b) Indique en qué consiste la desnaturalización del ADN y cómo se produce (0,5 puntos). c) Defina replicación, transcripción y traducción (0,75 puntos). 51. Con relación a Ia replicación y expresión del material genético: (Sep 2013 – B3) a) Indique cuatro diferencias entre el proceso replicativo de procariotas y eucariotas (1 punto). b) Defina qué son los intrones y los exones (0,5 puntos). c) Explique razonadamente si el ADN de una célula del páncreas y del hígado de un individuo contienen la misma información genética (0,5 puntos). 52. Con relación a Ia corrección de errores durante Ia replicación del ADN, explique brevemente Ia función que desempeñan: (Mod 2014 – A2) a) b) c) d)

Las endonucleasas (0,5 puntos). Las exonucleasas (0,5 puntos). La ADN polimerasa I (0,5 puntos). Las ADN ligasas (0,5 puntos).

53. En relación con la expresión del material hereditario: (Jun 2014 – B2) La siguiente secuencia de nucleótidos corresponde a un fragmento de una hebra de ADN: 3' … AAATCAGCGGCTCCTCTA … 5' a) Escriba la secuencia de nucleotidos y polaridades del ARNm resultado de su transcripcion (0,5 puntos). b) Indique la correspondiente secuencia de aminoacidos que se obtendria de su traduccion. ¿Qué significa que el Código Genético es casi universal?(0,5puntos). c) Realice un esquema actualizado del “DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR“ nombrando todos los procesos implicados (1 punto).

54. Con relación a los ácidos nucleicos: (Sep 2014 – A2) a) Indique los nombres de los procesos necesarios para la expresión de la información genética y defínalos (0,5 puntos). b) ¿Cuál es la finalidad de la replicación? ¿En qué fase del ciclo celular se produce? (0,5 puntos). c) Describa las etapas de maduración del ARNm en eucariotas (1 punto). 55. En relación con la expresión de la información genética: (Mod 2015 – B1) a) Explique brevemente el proceso de transcripción (0,5 puntos). b) Explique brevemente en qué consiste el proceso de retro-transcripción e indique la enzima que inten/iene (0,5 puntos). c) Realice un esquema de la transcripción y traducción del gen que se adjunta (1 punto).

------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 14 GENÉTICA MOLECULAR 10


56. En relación con la expresión del material hereditario en eucariotas: (Jun 2015 – A2) El siguiente fragmento de ARNm codifica un segmento intersticial de un polipéptido: 5´…GUCGAACAUUAUCAGACAUUC … 3´ a) Determine la secuencia de las dos hebras del fragmento de ADN del que proviene este ARN. Indique sus polaridades y marque con una flecha la hebra que se ha transcrito (0,5 puntos). b) ¿Cuál es la correspondiente secuencia de aminoácidos que se origina en la traducción? ¿Y si el U del lugar 9 mutase a A? (0,5 puntos). c) ¿Cómo se llama la enzima que ha sintetizado el ARNm? ¿En qué compartimento celular ocurre? (0,5 puntos). d) ¿En qué compartimento celular se traduce el ARNm? ¿En qué orgánulo ocurre? (0,5 puntos). 57. Con relación a la expresión de la información genética: (Sep 2015 – A1) A partir de un ARN con la siguiente secuencia: 5’-GAUGCUUUCUGCUGG-3’ a) Se sintetiza un ADN de doble cadena. Indique cómo se denomina este proceso y la enzima que lo hace po sible. Copie la secuencia en su hoja de examen e indique la secuencia del ADN obtenido con la polaridad de ambas cadenas (1,25 puntos). b) Se sintetiza un péptido. Indique cómo se llama este proceso y dónde tiene lugar en una célula eucariota. ¿Cuántos aminoácidos tendría el péptido obtenido? (Recuerde que el iniciador universal es el triplete AUG) (0.75 puntos). 58. Las figuras muestran una comparación de la transcripción y traducción entre dos tipos de células. (Mod 2016 – A1)

a) Para cada figura, relacione los números con su estructura o molécula correspondiente (1 punto). b) Explique por qué en la figura B la molécula 2 es de menor tamaño que la molécula 1 (0,5 puntos). c) ¿A qué tipo de célula pertenece cada figura? (0,5 puntos). 59. Con relación a la expresión de la información genética: (Jun 2016 – B2) a) Copie la tabla en su hoja de examen y complétela considerando los distintos procesos que intervienen en la expresión génica. Tenga en cuenta que el codón para Metionina (Met) es AUG, el codón de terminación es UAG, el codón para Valina (Val) es GUU y el codón para Cisteína (Cys) es UGU (1,25 puntos). ADN 5’ → 3’ ___ ___ ___ _T_ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___ ___

___ ___ ___

___ ___ ___

___ ___ ___

ADN 3’ → 5’

------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 14 GENÉTICA MOLECULAR 11


___ ___ ___

___ _G_ _U_

_C_ _A_ _A_

___ ___ ___

ARNm 5’ → 3’

___ ___ ___

___ ___ ___

___ ___ _U_

_A_ _U_ _C_

Anticodon 3’ → 5’

Met

Aminoácido

b) Indique los tipos de ARN que participan en la síntesis de proteínas y la función de cada uno de ellos (0,75 puntos). 60. Respecto a la replicación del ADN de células eucariotas: (Sep 2016 – A5) a) En la siguiente molécula de ADN bicatenario, la flecha indica la dirección de apertura de la doble hélice. Indique a partir de qué cadena (A) o (B) se sintetizará la hebra conductora y a partir de cuál la hebra retarda da. Explique por qué una hebra se sintetiza de forma continua y la otra de forma discontinua (0,75 puntos).

b) Si el porcentaje de bases de una de las dos cadenas de ADN bicatenario es: A=30%, T=28%, G=22% y C=20% ¿Cuál será el porcentaje de bases de la cadena complementaria? (0,5 puntos). c) En la fase de iniciación participan las proteínas ADN polimerasa, Primasa y Helicasa. Indique la función que realizan cada una de ellas (0,75 puntos). 61. Con relación a la expresión de la información genética: (Mod 2017 — A2) Un gen hipotético tiene la siguiente estructura (sólo se representa la cadena molde):

a) Dibuje un esquema de la estructura del ARN mensajero maduro a que daría lugar, indicando su polaridad (1 punto). b) Hemos aislado el material genético de un Virus y su composición es: 25% Adenina, 10% Guanina, 35% Ura cilo y 30% Citosina. ¿Qué tipo de ácido nucleico es? Razone la respuesta. Indique algún virus que tenga este material genético (1 punto). 62. Respecto a la expresión génica en células eucariotas: (Jun 17 – B5) a) Indique cómo se denomina el proceso de síntesis de ADN, en qué dirección se sintetiza una cadena de ADN, cómo se denomina la enzima que lo realiza y en qué compartimento celular ocurre (0,5 puntos). b) Defina brevemente los procesos de transcripción y traducción e indique en qué compartimento celular ocurre cada uno de ellos (1 punto). c) Explique brevemente qué es un codón y un anticodón (0,5 puntos). 63. Respecto a los ácidos nucleicos y los mecanismos de expresión génica: (Sep 17 – A1) a) Un determinado ácido nucleico bicatenario está compuesto por un 50% de purinas y un 50% de pirimidinas. Sabiendo que el contenido de Adenina es del 30% ¿Cuál es su contenido en Timina, Guanina y Citosina? ¿Qué tipo de ácido nucleico es y por qué? (1 punto). b) Indique dos diferencias respecto al proceso de replicación entre una célula procariota y una célula eucariota (0,5 puntos). c) Si debido a una mutación, una célula no tuviera actividad ARN polimerasa, ¿qué proceso no se produciría y por qué? (0,5 puntos). 64. Respecto a los mecanismos de expresión génica en eucariotas y las alteraciones del material hereditario: (Mod 2018 - B4) a) Escribir la secuencia de ARNm sintetizada a partir de una cadena de ADN codificante que presenta la si guiente secuencia: 5´-ATCGTACCGTTACGATATAGT-3´. Nombrar la enzima que realiza el proceso (1 punto). b) Si en un fragmento de ADN que codifica para una proteína se produce un cambio de una base Adenina por una Timina, explique qué tipo de sustitución se produce (0,5 puntos). c) Explique las posibles consecuencias que tendría la mutación del apartado anterior sobre la proteína codifi cada por este fragmento de ADN, teniendo en cuenta que el código genético es degenerado (0,5 puntos).

------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 14 GENÉTICA MOLECULAR 12


LA BASE DE LA HERENCIA. ASPECTOS QUÍMICOS Y GENÉTICA MOLECULAR 15. GENÉTICA MENDELIANA 1.

En relación con las aportaciones de Mendel al estudio de la herencia: (mod 05 – A4) a) Defina qué es un retrocruzamiento. Describa, utilizando símbolos genéticos, un ejemplo del mismo. (1 punto) b) Indique los genotipos y las proporciones fenotípicas de la descendencia obtenida de la autofecundación de un heterocigoto para dos caracteres. (1 punto)

2.

Se cruzan dos cobayas homocigóticos, uno de ellos de pelaje liso de color negro y otro de pelaje riza do y blanco. El rizado domina sobre el liso, mientras que el blanco es recesivo. (mod 05 – B3) a) Utilizando símbolos genéticos para los caracteres definidos, indique los genotipos de ambos parentales. (0,5 puntos) b) Indique los genotipos y los fenotipos que tienen los individuos de la F 1. (0,5 puntos) c) Calcule las proporciones genotípicas y fenotípicas de la F2. (1 punto)

3.

Relativo a la genética mendeliana (jun 06 – B4). a) Defina monohíbrido (0,5 puntos). b) Defina cruzamiento prueba (0,5 puntos). c) Usando términos genéticos, indique las proporciones genotípicas y fenotípicas de los descendientes de un cruce entre dihíbridos (1 punto).

4.

En el guisante, el tallo largo (planta alta) es dominante sobre el tallo corto (planta enana). Si una planta de guisante homocigótica para el carácter dominante se cruza con una planta enana: (sep 06 – B4) a) Indicar los genotipos y fenotipos de los progenitores y de la F 1 (0,5 puntos). b) Indicar los genotipos, fenotipos y proporciones de la descendencia de una planta de la F 1 con el progenitor alto (0,5 puntos). c) Indicar los genotipos, fenotipos y proporciones de la descendencia de una planta de la F 1 con el progenitor enano (0,5 puntos). d) Indicar los genotipos, fenotipos y proporciones de la descendencia de dos plantas heterocigóticas (0,5 pun tos).

5.

En la mosca de la fruta (Drosophila melanogaster), existen individuos de cuerpo negro y otros que presentan cuerpo gris: (mod 07 – B4) a) Se cruzan dos moscas grises y se obtiene una descendencia compuesta por 30 moscas grises y 10 negras. Indique los genotipos de los parentales razonando la respuesta (1 punto). b) Entre las moscas grises de la descendencia del cruce anterior, ¿cómo averiguaría qué individuos son homocigóticos? Razone la respuesta (1 punto).

6.

En relación con las aportaciones de Mendel al estudio de la herencia: (jun 07 – B4) a) Una pareja de personas de fenotipo no albino tienen un hijo albino. Explique el modo de herencia del albinismo e indique los genotipos de los padres y del hijo (1 punto). b) ¿Qué proporción de hijos no albinos se puede esperar en la descendencia? Razone la respuesta (0,5 puntos). c) ¿Qué proporción de hijos albinos se puede esperar en la descendencia? Razone la respuesta (0,5 puntos).

7.

En los conejos, el pelo corto (A) es dominante sobre el pelo largo (a). Se llevan a cabo los siguientes cruzamientos que producen la progenie mostrada: (sep 07 – B4) Parentales a. corto x largo b. corto x corto c. corto x largo d. largo x largo

Progenie 1/2 cortos y 1/2 largos (0,5 puntos) Todos cortos (0,5 puntos) Todos cortos (0, 5 puntos) Todos largos (0,5 puntos)

Nombre todos los genotipos posibles de los parentales de cada cruzamiento. Razone las respuestas. -------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 15 GENÉTICA MENDELIANA 1


8.

En relación con la determinación genética del sexo: (mod 08 – B4) a) Explique brevemente en qué consiste la determinación cromosómica del sexo (0,5 puntos). b) Explique el sistema de determinación cromosómica del sexo en mamíferos (0,5 puntos). c) Indique dos sistemas de determinación cromosómica del sexo diferente al de mamíferos. Poner un ejemplo (1 puntos).

9.

Con relación a las aportaciones de Mendel al estudio de la herencia: (jun 08 – B4) Suponga que en la especie humana la herencia del color del pelo y de los ojos es sencilla y está determina da por dos genes autosómicos con las siguientes relaciones: Color marrón de los ojos (A) dominante sobre el azul (a) y cabello oscuro (B) dominante sobre el cabello rubio (b). a) Un hombre de ojos marrones y cabello oscuro se casa con una mujer de ojos azules y cabello oscuro y tie nen 2 hijos, uno de ojos marrones y pelo rubio y otro de ojos azules y pelo oscuro. Indique razonadamente los genotipos de los padres y de los hijos (1 punto). b) Si el hombre del apartado anterior de ojos marrones y cabello oscuro se casara con una mujer de ojos azu les y pelo rubio. ¿Qué genotipos y fenotipos podrían tener los hijos de la pareja? (1 punto).

10. El pedigrí de la figura muestra la herencia de la alcaptonuria, un trastorno bioquímico. Los individuos afectados, indicados por los círculos y cuadrados negros, son incapaces de degradar el ácido homogentísico, que da color negro a la orina y tiñe los tejidos corporales. (Los hombres se representan con un cuadrado y las mujeres con un círculo). (sep 08 – B4)

a) Indique si el alelo responsable de esta enfermedad es dominante o recesivo. Razone la respuesta (0,5 pun tos). b) Copie el árbol genealógico en su hoja de examen e indique los posibles genotipos de todos los individuos (1,5 puntos). Utilice las letras (A) y (a) para los genotipos. 11. Con relación a las aportaciones de Mendel al estudio de la herencia: (mod 09 – B5) El insomnio familiar fatal (IFF) es una enfermedad humana debida a una mutación en un gen R situado en el cromosoma 20. La enfermedad muestra una herencia dominante. Una pareja, ambos con la enfermedad, tiene una hija que no la padece. a) b) c) d)

Indique los genotipos de todos los miembros de esta familia (0,5 puntos). ¿Puede transmitir la enfermedad la hija sana? Razone la respuesta (0,5 puntos). ¿Puede tener esta pareja otro hijo sano? Razone la respuesta (0,5 puntos). ¿Puede tener esta pareja un hijo con la enfermedad? Razone la respuesta (0,5 puntos).

12. Existen caracteres que no se comportan típicamente como los Mendelianos y sus patrones de herencia muestran características diferenciales debido a que los genes que los rigen se encuentran en los cromosomas sexuales. En relación con este tipo de caracteres: a) b) c) d)

Defina herencia ligada al sexo (0,5 puntos). Defina autosoma y cromosoma sexual o heterocromosoma (0,5 puntos). Defina el concepto de sexo homogamético. Ponga un ejemplo (0,5 puntos). Defina el concepto de sexo heterogamético. Ponga un ejemplo (0,5 puntos).

-------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 15 GENÉTICA MENDELIANA 2


13. En la figura se indica la transmisión de un carácter autosómico en una familia. (sep 09 – A1)

a) Indique si el carácter mostrado en la genealogía por los símbolos negros, está determinado por un alelo dominante o por un alelo recesivo. (Los hombres se representan por un cuadrado y las mujeres por un círculo). Razone la respuesta (0,5 puntos). b) Copie el árbol genealógico en su hoja de examen e indique los genotipos de los individuos de la genealogía (1,5 puntos). Utilice la letra (A) para el alelo dominante y la letra (a) para el alelo recesivo. 14. En relación con los conceptos básicos de Genética: (mod 2010 – B4) a) b) c) d)

Defina: locus y loci (0,5 puntos). Defina: gen y alelos (0,5 puntos). Defina genes ligados y genes independientes (0,5 puntos). Para dos loci (A, a) y (B, b) escriba el genotipo de un individuo homocigoto dominante y el de un heterocigoto (0,5 puntos).

15. Considérese el ciclo celular de un organismo que posee dos pares de cromosomas y presenta divisiones celulares astrales: (mod 2010 – B5) a) Haga una representación gráfica de la anafase mitótica y de la anafase I meiótica. Indique las principales di ferencias entre ambas (1 punto). b) Defina citocinesis e indique los principales acontecimientos que tienen lugar durante la citocinesis de las cé lulas del mencionado organismo (0,5 puntos). c) Si el organismo en cuestión posee un genotipo AaBb, indique el genotipo de sus células producidas por mi tosis y el genotipo de las células resultantes de meiosis (0,5 puntos). 16. Con relación a la teoría cromosómica de la herencia, defina los siguientes conceptos: (jun gen 2010 – B3) a) b) c) d)

Genes ligados (0,5 puntos). Sobrecruzamiento (entrecruzamiento o crossing-over) (0,5 puntos). Autosoma (0,5 puntos). Herencia ligada al sexo (0,5 puntos).

17. En Drosophila melanogaster, un alelo mutante recesivo, black (negro), da lugar en homocigosis, a un cuerpo muy oscuro. El color normal de tipo silvestre es gris. Otro alelo mutante sepia también recesi vo, da lugar a un color marrón de los ojos. El color normal es rojo. Al cruzar un ♂ homocigoto de ojos rojos y cuerpo negro con una ♀ de ojos sepia y cuerpo gris, se obtuvo una F1 en la que todas las moscas eran de ojos rojos y cuerpo gris. Posteriormente se cruzaron entre sí los ♂ y ♀ de la F1 para la ob tención de la F2. (jun esp 2010 – B2) a) ¿Cuáles son los genotipos de los parentales y de los descendientes F 1? (0,75 puntos). b) Indique las proporciones genotípicas y fenotípicas de los descendientes F 2 (1,25 puntos).

-------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 15 GENÉTICA MENDELIANA 3


18. Con relación a la herencia mendeliana: (sep 2010 – B2) a) ¿Qué es un gen? ¿Cómo se denomina al conjunto de genes de un individuo? (0,5 puntos). b) ¿Cuándo se dice que dos genes son independientes? ¿Y cuándo qué están ligados? (0,5 puntos). c) Si tuviera una mosca del vinagre (Drosophila melanogaster) de fenotipo A, ¿cómo comprobaría si es AA o Aa? Razone la respuesta (0,5 puntos). d) ¿Cuál sería la segregación genotípica que se obtendría del cruzamiento entre un individuo diheterocigoto (dihíbrido) por otro diheterocigoto para los mismos caracteres? Refleje en su examen cómo ha obtenido esta segregación (0,5 puntos). 19. Con referencia a los procesos de división celular y la herencia: (mod 2011 – A4) a) Copie y complete la siguiente tabla (1 punto). ACONTECIMIENTO CELULAR

FASE O FASES

1) Los cromosomas homólogos se emparejan mediante sinapsis 2) Se separan cromátidas hermanas 3) Se separan bivalentes 4) El material genético está duplicado (en mitosis) b) ¿Cómo se relacionan las leyes de Mendel sobre los principios de la segregación y de la transmisión independiente con la mitosis y la meiosis? (1 punto). 20. Con relación a las aportaciones de Mendel al estudio de la herencia: (mod 2011 – B3) Un hombre con grupo sanguíneo A se casa con una mujer de grupo B y tienen un hijo de grupo A. a) ¿Indique todos los posibles genotipos de estas tres personas? (0,75 puntos). b) ¿Qué genotipo tendrían los progenitores si hubieran tenido un hijo del grupo 0? En este caso ¿que otros ge notipos y con qué frecuencia se podrían esperar en la descendencia? (1,25 puntos). 21. Con relación a las aportaciones de Mendel al estudio de la herencia: (jun 2011 - A4) La miopía se considera un defecto refractario ocular hereditario que impide enfocar correctamente los objetos lejanos. La herencia de algunos tipos de miopía se debe a un único gen autosómico con dos alelos A y a. Un hombre y una mujer miopes tienen un hijo miope y otro con visión normal. A partir de estos datos determine: a) Si la miopía que sufre esta familia es un carácter dominante o recesivo. Razone la respuesta (0,5 puntos). b) Los genotipos de los padres y de los dos hijos (0,5 puntos). c) Se dispone de un ratón con fenotipo A. Diseñe un cruzamiento para saber si su genotipo es AA o Aa. Indicar cómo se denomina este tipo de cruzamientos (1 punto). 22. Con relación al mendelismo: (Sept 2011 – B1) En los gatos las orejas rizadas son el resultado del alelo A que es dominante sobre el alelo a para las orejas normales. El color negro es el resultado de un alelo B que segrega de forma independiente, y que es domi nante sobre el alelo para el color gris b. Un gato homocigótico gris y de orejas rizadas se aparea con una gata homocigótica negra con orejas normales. Todos los descendientes de la F 1 son negros y con orejas rizadas. a) Si los gatos de la F1 se aparean ¿qué proporciones genotípicas y fenotípicas se esperan para la F 2? (1 punto). b) Una gata de la F1 se aparea con un gato callejero que es gris y posee orejas normales ¿qué proporciones genotípicas y fenotípicas se esperan para la descendencia de este cruzamiento? (1 punto). 23. En relación con las aportaciones de Mendel al estudio de la herencia: (Mod 2012 – A1) a) Explique brevemente el tipo de herencia de una enfermedad hereditaria que padece un varón cuyos padres no manifiestan la enfermedad. Indique los genotipos de los padres y el hijo (1 punto). b) ¿Pueden tener un descendiente sano una pareja en que ambos miembros padecen una enfermedad hereditaria dominante? Razonar la respuesta indicando los genotipos y fenotipos de los progenitores y de la descendencia (1 punto). -------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 15 GENÉTICA MENDELIANA 4


24. En relación con las aportaciones de Mendel al estudio de la herencia: (jun 2012 - B2) a) Calcule las proporciones genotípicas de la descendencia del cruzamiento de un individuo heterocigoto para dos caracteres independientes con un individuo homocigoto recesivo para dichos caracteres (0,5 puntos). b) Determine los gametos (y proporciones) que puede producir un individuo AaBb y otro Aabb (0,5 puntos). c) Si el color de la piel está determinado por la pareja alélica: B (piel oscura); b (piel clara), y el color del cabello por: A (castaño); a (rubio), indique los posibles genotipos y proporciones fenotípicas de los hijos de una pareja de piel oscura y el pelo castaño que han tenido un primer hijo con piel clara y pelo rubio (1 punto). 25. En relación con las aportaciones de Mendel al estudio de la herencia: (Mod 2013 – A2) El sistema de grupos sanguíneos AB0 viene determinado por tres alelos de un gen: A y B son codominantes y 0 recesivo respecto a ellos. Los grupos sanguíneos M, N y MN están determinados por dos alelos codominantes (M y N). El factor rh está determinado por dos alelos de otro gen: R, dominante (Rh+) y r, recesivo (Rh-). En un caso judicial un hombre duda de que sea padre de los dos hijos que tiene la pareja. Los grupos sanguíneos de la mujer, el hombre y los dos hijos son los recogidos en la tabla. Con los datos suministrados: a) Establezca los posibles genotipos de la mujer, el hombre y los dos hijos (1 punto). b) Razone si los hijos 1 y 2 son hijos biológicos del hombre (1 punto). 26. En relación con las aportaciones de Mendel al estudio de la herencia: (Jun 2013 – A2) a) Defina gen, alelo y cruzamiento prueba (0,75 puntos). b) La siguiente genealogía se refiere a la miopía humana (representada por los símbolos negros). Indique si esta anomalía se hereda como un carácter dominante o recesivo. Razone la respuesta (0, 5 puntos).

c) Copie el árbol genealógico en su hoja de examen. Utilizando la letra A para el alelo dominante y la letra a para el alelo recesivo, indique los genotipos más probables para cada individuo (0,75 puntos). 27. En relación con las aportaciones de Mendel al estudio de Ia herencia: (Sep 2013 – A1) En los tomates, dos alelos de un gen determinan la diferencia en el color del tallo púrpura o verde, y dos alelos de otro gen independiente determinan la diferencia en la forma de la hoja: “cortada” y “patata”. Al cruzar una planta de tomate homocigota de tallo púrpura y hoja “patata” con otra planta también homocigota de tallo verde y hoja “cortada”, todos los descendientes de la F 1 presentaron el tallo púrpura y hoja “patata”. A continuación, las plantas de la F1 se cruzan entre si para obtener la F 2. a) Indique los genotipos de los parentales (0,5 puntos). b) ¿Cuáles serán las proporciones genotípicas y fenotípicas en F2? (0,75 puntos). c) Si se realiza un retrocruzamiento de una planta de la F 1 con la planta progenitora de tallo verde y hoja “cortada” ¿qué proporciones genotípicas y fenotípicas se esperan para la descendencia? (0,75 puntos).

-------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 15 GENÉTICA MENDELIANA 5


28. En relación con Ias aportaciones de Mendel aI estudio de Ia herencia: (Mod 2014 – B3) En la siguiente genealogía se indica la transmisión de una enfermedad humana (representada por los símbolos negros)

a) Indique si esta anomalía se hereda como un caracter dominante o recesivo. Razone la respuesta (0,75 pun tos). b) Copie el arbol genealógico en su hoja de examen. Utilizando la letra A para el alelo dominante y la letra a para el alelo recesivo, indique los genotipos mas probables para cada individuo (1,25 puntos). 29. En relación con las aportaciones de Mendel al estudio dela herencia: (Jun 2014 – A5) En el guisante el alelo A produce coloración de flor roja y el alelo a flor blanca. a) Indique las proporciones genotípicas y fenotípicas de la descendencia obtenida del cruzamiento entre dos plantas de guisante heterocigotas para el gen del color de la flor (1 punto). b) Se dispone de una planta de guisante con flor roja. Diseñe un cruzamiento para saber si es homocigótica o heterocigótica. Indique cómo se denomina este tipo de cruzamiento (1 punto). 30. En relación con las aportaciones de Mendel al estudio dela herencia: (Sep 2014 – B4) En los tulipanes, el color amarillo de las flores viene determinado por un alelo (A) que es dominante sobre el alelo para el color blanco de las flores (a). El alelo para los tépalos completos (B) es dominante sobre el alelo (b) para los tépalos con flecos. Una planta homocigótica para el color amarillo y tépalos completos se cruza con una planta blanca y con tépalos con flecos. Las plantas de la F1 se autofecundaron para la obtención de la F2.

a) Indique los genotipos de las plantas parentales (0,5 puntos). b) ¿Cómo seran los genotipos y fenotipos de la F1? (0,5 puntos). c) Determine la segregación (proporciones) genotípica y fenotípica de la F 2 (1 punto). 31. En relación con las aportaciones de Mendel al estudio dela herencia: (Mod 2015 – A5) a) Enuncie la tercera ley de Mendel (0,5 puntos). b) Explique brevemente el tipo de herencia que tiene una enfermedad hereditaria que padece un varón cuyos padres no manifiestan la enfermedad. Indique los genotipos de los padres y del hijo (0,75 puntos). c) ¿Pueden tener un descendiente sano una pareja en que ambos miembros padecen una enfermedad heredi taria dominante? Razone la respuesta indicando los genotipos y fenotipos de los progenitores y de la descendencia, en ese caso (0,75 puntos). 32. Con relación a las aportaciones de Mendel al estudio de la herencia: (Jun 2015 – B5) En la siguiente genealogía se presenta la transmisión de un carácter en una familia (representado por los símbolos oscuros), producido por un solo gen autosómico con dos alelos (los cuadrados representan hombres y los círculos mujeres). a) Indique si el carácter presenta herencia dominante o recesiva. Razone la respuesta (0,5 puntos). b) Indique los genotipos de los individuos de las generaciones I y II, utilizando A para el alelo dominante y a para el alelo recesivo (1,5 puntos). -------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 15 GENÉTICA MENDELIANA 6


33. En relación con las aportaciones de Mendel al estudio de la herencia: (Sep 2015 – B4) Supongamos que en cierta especie vegetal se han obtenido dos variedades diferentes: una verde con manchas blancas y otra amarilla sin manchas. Al cruzar una variedad homocigota verde y con manchas blancas con otra también homocigota amarilla sin manchas, todos los descendientes F 1 fueron verdes con manchas blancas. a) Indique los genotipos de los parentales (0,5 puntos). b) Si se realiza un retrocruzamiento de un descendiente F 1 por la variedad progenitora amarilla sin manchas ¿qué proporciones genotípicas y fenotípicas se esperan para la descendencia? Debe indicar las frecuencias de los gametos (0,75 puntos). c) Si se retrocruza un descendiente F1 por la variedad progenitora verde con manchas blancas ¿qué proporciones genotípicas y fenotípicas se esperan para la descendencia? Debe indicar las frecuencias de los gametos (0,75 puntos). 34. Con relación a las aportaciones de Mendel al estudio de la herencia: (Mod 2016 – B3) Supongamos que, en una raza de perros, el gen que determina la longitud del pelo presenta dos alelos, A que determina el pelo corto es dominante sobre a, que produce pelo largo. Otro gen determina el color de pelo, donde el alelo B produce color negro y es dominante sobre el alelo b que determina pelo color marrón. Las proporciones de la descendencia de una pareja en la que el macho es marrón de pelo largo y la hembra negra de pelo corto es la siguiente: 25% pelo negro y corto; 25% pelo marrón y corto; 25% pelo negro y largo; 25% pelo marrón y largo. a) ¿Cuál es el genotipo de la madre? ¿Cuáles son los genotipos de la descendencia? ¿Cómo se llama a este tipo de cruzamiento? (1,5 puntos). b) b) ¿Se cumple la tercera Ley de Mendel cuando dos genes están ligados en ausencia de recombinación? Razone la respuesta (0,5 puntos). 35. Con relación a las aportaciones de Mendel al estudio de la herencia: (Jun 2016 – A1) a) Defina alelo dominante y alelo recesivo (0,5 puntos). b) Indique las proporciones genotípicas de la descendencia obtenida al cruzar un individuo diheterocigoto con un doble homocigoto recesivo. Utilice letras mayúsculas para los caracteres dominantes y letras minúsculas para los caracteres recesivos (1 punto). c) ¿Se cumple la tercera Ley de Mendel cuando dos genes están ligados en ausencia de recombinación? Ra zone la respuesta (0,5 puntos). 36. Con relación a la Teoría Cromosómica de la Herencia y los cromosomas: (Sep 2016 – B3) a) Cite tres de los postulados de dicha Teoría y uno de los científicos que contribuyeron a su desarrollo (1 pun to). b) ¿Qué tipos de mutaciones cromosómicas alteran el orden de los genes en los cromosomas? (0,5 puntos). c) ¿Qué tipos de mutaciones cromosómicas alteran el número de genes de un cromosoma? (0,5 puntos). 37. En la siguiente genealogía se indica la transmisión de una enfermedad monogénica y autosómica en una familia. En negro se muestran los individuos afectados por la enfermedad y en blanco los sanos. Las mujeres se representan con un círculo y los hombres con un cuadrado. (Mod 2017 — B5)

a) Deduzca si esta anomalía se hereda como un carácter dominante o recesivo. Razone la respuesta (0,75 puntos). b) Indique Ios genotipos de los individuos I.1; I.2; II.1; II.2 y III.2, utilizando la letra A para el alelo dominante y la letra a para el alelo recesivo (1,25 puntos). -------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 15 GENÉTICA MENDELIANA 7


38. Con relación a las aportaciones de Mendel al estudio de la herencia: (Jun 17 – A3) a) Supongamos que, en una raza de gatos, el gen que determina la longitud del pelo presenta dos alelos, A que determina el pelo corto es dominante sobre a, que produce pelo largo. Otro gen determina el color de pelo, donde el alelo B produce color negro y es dominante sobre el alelo b que determina pelo color rojizo. Las proporciones de la descendencia de una pareja en la que el macho es rojizo de pelo largo y la hembra negra de pelo corto es la siguiente: 25% pelo negro y corto; 25% pelo rojizo y corto; 25% pelo negro y largo; 25% pelo rojizo y largo. ¿Cuál es el genotipo de la madre? ¿Cuáles son los genotipos de la descendencia? ¿Cómo se llama a este tipo de cruzamiento? (1,5 puntos). b) Responda si son verdaderas o falsas las siguientes afirmaciones (0,5 puntos): 1. Las mutaciones producen alelos recesivos. 2. Los alelos recesivos son minoritarios. 39. Con relación a las aportaciones de Mendel al estudio de la herencia: (Sep 17 – B3) a) En una determinada raza de gallinas, la combinación en heterocigosis de los alelos que determinan el plu maje negro (A) y el plumaje blanco (a) determina plumaje de color azul. Indique las proporciones fenotípicas y genotípicas que presentará la descendencia de una gallina de plumaje azul si se cruza con aves de los siguientes colores de plumaje: 1) Azul; 2) Negro; 3) Blanco (1,5 puntos). b) ¿En qué se diferencia un retrocruzamiento de un cruzamiento prueba? (0,5 puntos). 40. Con relación a las aportaciones de Mendel al estudio de la herencia: (Mod 2018 - A3) a) ¿Cuál es la probabilidad de que aparezca un individuo homocigótico recesivo para un carácter en la descendencia de un cruzamiento entre un heterocigoto y un homocigoto recesivo para dicho carácter? Haga un es quema del cruzamiento (0,5 puntos) b) ¿Qué tipos distintos de gametos puede producir un individuo dihíbrido? (0,5 puntos) c) ¿Por qué los genes ligados se heredan juntos? (0,5 puntos) d) Responda si son verdaderas (V) o falsas (F) las siguientes afirmaciones (0,5 puntos): 1. Los alelos dominantes son beneficiosos 2. Los alelos dominantes se heredan con mayor probabilidad

-------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 15 GENÉTICA MENDELIANA 8


LA BASE DE LA HERENCIA. ASPECTOS QUÍMICOS Y GENÉTICA MOLECULAR 16. CONSERVACIÓN Y ALTERACIONES DE LA INFORMACIÓN GENÉTICA 1.

Cuando el mecanismo de replicación de DNA no funciona de forma correcta se producen errores en la molécula de DNA: (jun 97 – B3) a) ¿Qué nombre se da a estos errores y como se producen? (1 punto) b) Explica las consecuencias para el individúo y la relación que existe con algunos factores ambientales. ( 1 punto)

2.

Mutaciones: (mod 98 – B3) a) Explica en qué consisten las mutaciones moleculares poniendo un ejemplo concreto. (1 punto) b) Explica las diferentes consecuencias de que una mutación suceda en un gameto o en una célula somática. (0,5 puntos) c) Discute brevemente estos dos agentes mutagénicos: tabaco y exposición prolongada al sol y sus efectos e implicaciones sociales. (0,5 puntos)

3.

Referente a las alteraciones estructurales de los cromosomas: (jun 98 – A3) a) Explica los tipos de alteraciones cromosómicas que conozcas. (1 punto) b) Haz un esquema que explica cómo se produce una alteración cromosómica, incluyendo la situación de partida y el resultado final. (1 punto)

4.

Las mutaciones son alteraciones en el material genético. (sep 99 – B4) a) Define qué es una mutación puntual. (0,5 puntos) b) Enumera los tipos de mutaciones puntuales que conozca y las consecuencias que puede tener cada una de ellas en la secuencia de aminoácidos de una proteína. (1,5 puntos)

5.

El ADN es una molécula que se encuentra sometida continuamente a las agresiones producidas por sustancias de su entorno celular. (mod 00 – B4) a) ¿Qué son las mutaciones y qué tipo de agentes mutagénicos las producen? (0,5 puntos) b) Enumere y explica los tipos de mutaciones que conoce. (1 punto) c) Establezca la relación entre mutaciones y evolución. (0,5 puntos)

6.

La siguiente secuencia de ADN corresponde a un fragmento de un gen: (jun 00 – B4) 3' GGCAATATCCGA 5' a) Indica la secuencia de nucleótidos de su ARNm y la polaridad de la secuencia. (0,5 puntos) b) Menciona el número máximo de aminoácidos que se sintetizarán en el proceso de traducción. (0,5 puntos) c) Introduce una mutación puntual (génica) en la secuencia de ADN e indica una posible consecuencia de la mutación en la secuencia de aminoácidos de la proteína. (0,5 puntos) d) Explica dos posibles efectos de la mutación puntual para la célula. (0,5 puntos)

7.

La siguiente secuencia polinucleotídica corresponde a un fragmento del inicio de un gen de una cepa bacteriana: (sep 00 – A4) 3' TACAATTCCCGGGCAACACAC 5' a) Escribe la secuencia de bases del ARN mensajero que se puede sintetizar e indica su polaridad. (0,5 puntos) b) ¿Cuál es el número máximo de aminoácidos que puede codificar este fragmento? (0,5 puntos) c) ¿Qué características del código genético has utilizado para determinar el número de aminoácidos? (0,5 pun tos) d) Si se detectara una variante de la cepa que produjera un polipéptido de cinco aminoácidos, ¿cómo pudo producirse la variante? (0,5 puntos)

----------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 16 MUTACIONES 1


8.

Con relación a las mutaciones. (jun 01 – A4) a) Define qué es una mutación puntual (génica) e indica el proceso celular responsable de la aparición de este tipo de mutaciones. (0,5 puntos) b) En la siguiente secuencia de nucleótidos de una cadena de ADN : 3´ATGCCA 5´ introduce una mutación puntual y señala el tipo de mutación producido. (0,5 puntos) c) Define qué es una mutación cromosómica y pon un ejemplo. (0,5 puntos) d) Establece la relación entre mutación y evolución. (0,5 puntos)

9.

Un determinado segmento de ADN tiene la siguiente secuencia de nucleótidos en una de las cadenas: (sep 02 – A4) ... 3'-TTCCAGCAT 5'- ... a) ¿Cuál debe ser la secuencia de nucleótidos de la otra cadena?. Marca los extremos 3' y 5'. (0,5 puntos) b) Si la enzima ARN polimerasa lee este segmento de ADN, ¿cuál debe ser la secuencia de nucleótidos de la cadena de ARN mensajero?. Marca los extremos 3' y 5'. (0,5 puntos) c) Define los siguientes términos de mutaciones puntuales (génicas): mutación silenciosa y mutación de cambio de sentido. Indica las consecuencias que tendrían estas mutaciones en la secuencia de aminoácidos codificada. (1 punto)

10. En relación con las mutaciones: (jun 03 – A4) a) Explica el concepto de mutación génica e indica las consecuencias de estas mutaciones según que afecten a células somáticas o a células germinales. (0,75 puntos) b) Considera el siguiente fragmento de un gen de un organismo procariota: 5' TCGGA 3'  3' AGCCT 5' ← y que al replicarse la cadena indicada con una flecha, se introduce un error por la ADN polimerasa III de for ma que la nueva cadena sintetizada presenta la siguiente secuencia: 5' TCAGA 3'. Explica qué error se ha producido y menciona un enzima que participe en la corrección. (0,5 puntos) c) Define los siguientes términos: triploidía, trisomía y monosomía. (0,75 puntos) 11. En relación con la Ingeniería Genética, mutagénesis y cáncer: (jun 03 – B4) a) ¿En qué consiste la terapia génica? (0,5 puntos) b) Explica el concepto y origen del cáncer. (0,75 puntos) c) Define protooncogenes y oncogenes. Indica cómo pueden originarse los oncogenes. (0,75 puntos) 12. En relación con la información genética y sus alteraciones: (sep 04 – A4) a) Si un polipéptido tiene 450 aminoácidos, indique cuántos ribonucleótidos tendrá el fragmento del ARNm que codifica esos aminoácidos. Razone la respuesta (0,5 puntos). b) 5'GUU-UUC-GCA-UGG3', son cuatro codones de una molécula de ARNm. Indique cuáles serán los anticodones de las moléculas de ARNt. ¿Qué significa que el código genético es degenerado? (0,5puntos). c) Suponga que en un fragmento de ADN que codifica un polipéptido se produce una mutación puntual que afecta a un par de bases. Debido a ello, cuando la célula sintetice de nuevo el polipéptido. a éste le podría haber ocurrido uno de los cuatro hechos siguientes: 1. 2. 3. 4.

Que se codifique el mismo aminoácido que el sintetizado antes de la mutación. La sustitución de un aminoácido por otro distinto. Que el nuevo polipéptido sintetizado sea más corto Que el nuevo polipéptido sintetizado sea más largo

Basándose en sus conocimientos del código genético, explique el por qué de cada uno de estos resultados (1 punto). 13. Referente a replicación, expresión y mutación. (sep 04 – B4) a) Explique cómo se mantiene y se transmite la información genética en los seres vivos. Describa brevemente cada uno de los procesos implicados (1 punto). b) Si durante la replicación del ADN se inserta un nucleótido incorrecto en la cadena de nueva síntesis, indique el nombre de la enzima encargada de subsanar este error y explique como lo haría (0,5 puntos). c) Indique en qué dirección son sintetizadas siempre las nuevas cadenas de ADN y cite cómo se denomina a la hebra de ADN que se transcribe en ARNm (0,5 puntos). ----------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 16 MUTACIONES 2


14. Referente a la mutación: (mod 06 – B4) a) Explique qué se entiende por mutación y realice una clasificación de las mismas (0,5 puntos). b) Cite un tipo de mutación cromosómica y explique gráficamente en qué consiste (0,5 puntos). c) La siguiente secuencia de ADN corresponde a un fragmento de un gen: 5' CATGTTGGA 3' 3' GTACAACCT 5' Si se produce el cambio de un par de bases en este fragmento, indique las posibles consecuencias de esta mutación en la secuencia de aminoácidos de la proteína (0,5 puntos). d) Explique qué relación hay entre las mutaciones y la evolución de las especies (0,5 puntos). 15. Referente a la mutación: (jun 06 – A4) a) Defina mutaciones génicas, cromosómicas y genómicas (0,75 puntos). b) Indique qué diferencias existen entre un individuo trisómico y uno triploide (0,5 puntos). c) Dado el siguiente fragmento de ADN de doble cadena: 5' TCGGACC 3' 3' AGCCTGG 5' Tras su replicación se ha formado un fragmento con la siguiente secuencia: 5' TCGGACC 3' 3' AGCCTGG 5' Indique qué cambios se han producido y cite, en cada caso, si se trata de una transición o una transversión (0,75 puntos). 16. En relación con la información genética: (jun 07 – A4) a) Defina euploidía e indique y explique sus tipos (0,75 puntos). b) Defina aneuploidía e indique y explique sus tipos (0,75 puntos). c) Ponga dos ejemplos de aneuploidías humanas indicando el síndrome que producen (0,5 puntos). 17. En relación con las alteraciones de la información genética: (mod 08 – A4) a) Defina mutación cromosómica o estructural (0,5 puntos). b) Defina brevemente las deficiencias o deleciones y explique sus consecuencias para el individuo (0,5 pun tos). c) Defina brevemente las duplicaciones y explique porqué han sido importantes en la evolución (0,5 puntos). d) Defina y explique brevemente las inversiones y sus tipos (0,5 puntos). 18. Referente a las alteraciones de la información genética, defina y en su caso ponga un ejemplo de: (sep 08 – A4) a) b) c) d)

Agente mutagénico (0,5 puntos). Mutación génica o puntual (0,5 puntos). Mutación cromosómica (0,5 puntos). Mutación genómica (0,5 puntos).

19. Con relación a las mutaciones y el cáncer: (jun gen 2010 – A2) a) ¿Qué son las mutaciones? ¿En qué se diferencian las mutaciones que afectan a las células somáticas de las qué afectan a las células germinales? (0,5 puntos) b) ¿Qué es el cáncer? Indique los tres tipos de genes relacionados con el cáncer (1 punto). c) ¿Qué es un agente mutagénico? Cite un ejemplo de agente físico y otro de agente químico (0,5 puntos). 20. Con relación a las alteraciones de la información genética: (jun esp 2010 – A2) a) Defina mutación génica o puntual e indique sus tipos (0,5 puntos). b) Defina mutación cromosómica o estructural e indique sus tipos (0,5 puntos). c) Al realizar el cariotipo de una persona en una consulta genética se observó que uno de los cromosomas de la pareja 9 había intercambiado un brazo con otro de la pareja 21. ¿Cómo se denomina este tipo de rees tructuración cromosómica? ¿Será transmisible a la descendencia? Razone la respuesta (0,5 puntos). d) ¿Hubiera sido mejor que el ADN fuera totalmente inmutable? Razone la respuesta. (0,5 puntos).

----------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 16 MUTACIONES 3


21. Con relación a las alteraciones de la información genética, defina los siguientes conceptos y cite al gún tipo en cada uno de ellos: (Jun 2013 – B4) a) b) c) d)

Mutación génica o puntual (0,5 puntos). Mutación cromosómica o estructural (0,5 puntos). Aneuploidía (0,5 puntos). Agente mutagénico (0,5 puntos).

22. Con relación a Ia corrección de errores durante Ia replicación del ADN, explique brevemente Ia función que desempeñan: (Mod 2014 – A2) a) b) c) d)

Las endonucleasas (0,5 puntos). Las exonucleasas (0,5 puntos). La ADN polimerasa I (0,5 puntos). Las ADN ligasas (0,5 puntos).

23. Respecto a los mecanismos de expresión génica en eucariotas y las alteraciones del material hereditario: (Mod 2018 - B4) a) Escribir la secuencia de ARNm sintetizada a partir de una cadena de ADN codificante que presenta la si guiente secuencia: 5´-ATCGTACCGTTACGATATAGT-3´. Nombrar la enzima que realiza el proceso (1 punto). b) Si en un fragmento de ADN que codifica para una proteína se produce un cambio de una base Adenina por una Timina, explique qué tipo de sustitución se produce (0,5 puntos). c) Explique las posibles consecuencias que tendría la mutación del apartado anterior sobre la proteína codifi cada por este fragmento de ADN, teniendo en cuenta que el código genético es degenerado (0,5 puntos).

----------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 16 MUTACIONES 4


MICROBIOLOGÍA 17. LAS FORMAS ACELULARES: VIRUS, VIROIDES Y PRIONES 1. El virus VIH es el causante de la enfermedad denominada síndrome de inmunodeficiencia adquirida más conocida por SIDA y su material genético es ARN. (jun 99 – B4) a) b) c) d)

Menciona dos mecanismos o vías de transmisión o contagio de este virus. (0,5 puntos) ¿Qué tipo de células son el blanco de este virus? (0,5 puntos) ¿Cómo se denomina el proceso por el que el ARN del virus pasa a ADN? (0,5 puntos) ¿Cómo se denominan los virus animales cuyo material genético es ARN y que realicen el proceso descrito en el apartado c? (0,5 puntos)

2. En relación con los virus: (jun 00 – A4) a) ¿Qué es un virus y cuál es su composición? (0,5 puntos) b) Menciona las fases que comprende el ciclo lítico de un virus bacteriófago. (1 punto) c) Pon un ejemplo de una enfermedad causada por un virus e indica la vía de transmisión. (0,5 puntos) 3. Con relación a los virus: (sep 01 – A5) a) b) c) d)

Define qué es un virus y menciona sus características biológicas más importantes. (0,5 puntos) Menciona dos criterios diferentes utilizados en la clasificación de los virus. (0,5 puntos) Explica las diferencias que existen entre los ciclos lisogénico y lítico de un virus. (0,5 puntos) Cita dos enfermedades humanas causadas por virus. (0,5 puntos)

4. La microbiología estudia un grupo muy diversos de microorganismos: (mod 02 – A5) a) Excluyendo los virus, enumera los tres reinos fundamentales en los que se clasifican los microorganismos, indicando una característica relevante de cada uno de ellos. (0,75 puntos) b) Cita tres ejemplos de microorganismos pertenecientes a cada uno de los reinos mencionados en el apartado anterior. (0,75 puntos) c) Explica brevemente las principales características de los virus. (0,5 puntos) 5. Respecto a los virus: (jun 03 – B5) a) Define que es un virión e indica su composición. (0,5 puntos) b) Haz el esquema de un bacteriófago señalando sus diferentes partes. (1 punto) c) Menciona las dos formas de reproducción de un bacteriófago ¿cuál de ellas provoca la lisis de la bacteria? (0,5 puntos) 6. Con referencia a los virus y otros agentes infecciosos: (jun 05 - A5) a) Indique a qué tipo de ciclo corresponde el siguiente esquema y explique brevemente cada una de las fases representadas por números (1 punto). b) Defina los términos retrovirus y prión (0,5 puntos). c) Indique las diferencias entre el significado de los términos epidemia y pandemia (0,5 puntos).

7. Indique la clasificación de los virus: (sep 07 – B5) a) b) c) d)

Según el huésped que parasitan (0,5 puntos). Según el material hereditario (0,5 puntos). Según la forma de la cápsida (0,5 puntos). Enuncie los tipos de multiplicación vírica (0,5 puntos).

---------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 17 FORMAS ACELULARES 1


8. Con referencia a distintos procesos biológicos: (jun 09 – B3) a) Para replicarse en células eucarióticas, un virus de ARN monocatenario (similar al del VIH) debe integrarse en el genoma de la célula huésped, que es ADN bicatenario. Explique las distintas etapas del proceso de re plicación (1,5 puntos). b) Si en otro Planeta hubiera un ADN constituido por 6 nucleótidos distintos, existieran 216 aminoácidos esen ciales y el código genético estuviera constituido por tripletes, ¿sería posible que existiera un mecanismo de traducción igual al de la Tierra? Razone la respuesta (0,5 puntos). 9. Se pueden producir alteraciones patológicas en el funcionamiento del sistema inmunitario. (jun gen 2010 – A4) a) Indique qué tipo de estructura es el V.I.H. y el tipo de enfermedad que provoca (0,5 puntos). b) Cite el tipo celular afectado por el V.I.H. y explique el proceso de penetración celular y de replicación intracelular (1 punto). c) Mencione los mecanismos de transmisión de la enfermedad (0,5 puntos). 10. Con relación a la Microbiología, (mod 2011 – A1) a) ¿A qué reino pertenecen los géneros de microorganismos Rhizopus y Penicillium? ¿Y Clostridium y Rhizobium? ¿Qué repercusión tienen Candida y Mycobacterium para los seres humanos? Indique el interés que tienen Lactobacillus y Saccharomyces para el hombre (1 punto). b) ¿Qué es la enfermedad de Creutzfeldt-Jakob y cuál es su agente causante? ¿Cómo se transmite? ¿Cómo se puede prevenir? (1punto). 11. El gráfico adjunto es el esquema de un proceso que puede tener lugar en las bacterias. (Mod 2013 – B2)

a) ¿Qué proceso se representa? Identifique las estructuras que se indican con los números (1 punto). b) ¿Qué nombre reciben las fases de este proceso indicadas con letras? Indique el nombre de algún otro tipo de multiplicación de las estructuras identificadas como 2 (1 punto). 12. En relación con la microbiología y la biotecnología: (Jun 2013 – B3) a) Indique y explique qué son las siguientes siglas: VIH, PCR y OMG (0,75 puntos). b) Defina los siguientes términos: Plásmido, viroide, fago y prión. Explique brevemente el significado e importancia del Proyecto Genoma Humano (1,25 puntos). 13. Los virus son parásitos endocelulares obligados: (Mod 2014 – B5) a) Describa Ios principales acontecimientos que tienen lugar en el ciclo lítico de un virus (1 punto). b) Haga un esquema rotulado de un bacteriófago indicando sus principales partes constitutivas (1 punto). 14. En relación con la microbiología: (Sep 2014 – B5) a) Indique a qué organismo o agente corresponden las descripciones siguientes: 1. Organismo eucariota con células provistas de pared con quitina, saprobio (sapróflto); 2. Microorganismo que se tiñe con la tinción de Gram; 3. Agentes infecciosos acelulares sin proteínas ni lípidos que solo tienen una corta cadena de ARN; 4. Partículas proteínicas infecciosas acelulares; 5. Virus que infectan bacterias (1,25 puntos). b) Indique a qué estructuras corresponden las descripciones siguientes: 1. Estructuras altamente resistentes a las condiciones ambientales adversas que producen algunas bacterias; 2. Estructuras cortas y móviles de naturaleza proteínica que poseen algunas bacterias y que pueden sen/ir para fijar las bacterias a las superfi cies; 3. Deformaciones transitorias del citoplasma de las células ameboides que contribuyen a la locomoción (0,75 puntos). No es necesario copiar las descripciones. ---------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 17 FORMAS ACELULARES 2


15. En un diario de fecha 11/10/2014 se publicó un texto del que se ha extraído este fragmento: “El virus del Ébola -así lo escribe la Organización Mundial de la Salud- pertenece a la familia Filoviridae, una fa milia de agentes infecciosos agresivos que ya visitó nuestra vieja Europa en 1967…”. En relación con este texto, responda a las siguientes preguntas: (Jun 2015 – B2) a) ¿Son seres vivos los virus? Razone la respuesta (0,5 puntos). b) ¿Puede contener ARN un virus? ¿Para qué le puede servir a un virus un ácido nucleico? ¿Qué otras molé culas pueden formar parte de un virus? Razone las respuestas (0,75 puntos). c) Mencione tres enfermedades más producidas por virus (0,75 puntos). 16. El virus del Ébola ocasionó una terrible epidemia en 2015. Los científicos trabajan para conseguir una vacuna que logre la inmunidad de la población. (Sep 2016 – A3) a) Indique los dos componentes fundamentales que forman la estructura de un virus (0,5 puntos). b) Indique de qué tipo es la inmunidad que se consigue con la vacunación (0,5 puntos). c) Defina qué es una vacuna e indique qué mecanismos desencadena (1 punto). 17. Con relación a la expresión de la información genética: (Mod 2017 — A2) Un gen hipotético tiene la siguiente estructura (sólo se representa la cadena molde):

a) Dibuje un esquema de la estructura del ARN mensajero maduro a que daría lugar, indicando su polaridad (1 punto). b) Hemos aislado el material genético de un Virus y su composición es: 25% Adenina, 10% Guanina, 35% Ura cilo y 30% Citosina. ¿Qué tipo de ácido nucleico es? Razone la respuesta. Indique algún virus que tenga este material genético (1 punto). 18. Con respecto a la estructura y multiplicación de los virus: (Sep 17 – B5) a) Según la morfología de la cápsida se pueden definir tres tipos de virus. Indique cuáles son esos tres tipos y cite un ejemplo de cada uno de ellos (0,75 puntos). b) En relación con los ciclos lítico y lisogénico de un bacteriófago, defina brevemente los siguientes términos: profago, penetración, ensamblaje, adsorción y síntesis (1,25 puntos) 19. Con relación a la inmunología: (Mod 2018 - B1) a) Indique los dos componentes fundamentales que forman la estructura de un virus (0,5 puntos). b) Explique qué tipo de virus es el VIH y nombre dos tipos celulares del sistema inmune atacados o destruidos por dicho virus (0,75 puntos). c) Indique tres vías de trasmisión del VIH (0,75 puntos).

---------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 17 FORMAS ACELULARES 3


MICROBIOLOGÍA 18. LOS MICROORGANISMOS. LAS BACTERIAS 1.

Con ayuda de dibujos: (sep 97 – A4) a) Explica el proceso de la conjugación en una bacteria determinada. (1 punto) b) Razona sobre la importancia biológica de este tipo de reproducción. (1 punto)

2.

El dibujo representa un esquema simplificado de una bacteria: (mod 98 – A2) a) Nombra los 5 elementos señalados por las flechas. (1 punto) b) Menciona 5 estructuras u orgánulos celulares presentes en eucariotas y que no puedan estar presentes en una bacteria, indicando su función. (1 punto)

3.

Algunas bacterias pueden obtener energía por quimiosíntesis. (jun 98 – A4) a) Concepto de quimiosíntesis. (0,5 puntos) b) Cita las fases de la quimiosíntesis. (0,5 puntos) c) Pon un ejemplo de una bacteria que participe en el ciclo del nitrógeno y explica su importancia en los ciclos biogeoquímicos. (1 punto)

4.

A menudo aparecen en la prensa noticias referentes a ingeniería genética: (mod 99 – B3) a) b) c) d)

5.

En relación con los ribosomas: (jun 99 – B2) a) b) c) d)

6.

Explica en qué consiste la ingeniería genética. (0,5 puntos) Explica qué es un plásmido.(0,5 puntos) Explica cómo actúan las enzimas de restricción (0,5 puntos) Pon un ejemplo de una aplicación práctica de la ingeniería genética. (0,5 puntos)

Explica su estructura. (0,5 puntos) Explica su composición química. (0,5 puntos) Explica la función de los ribosomas. (0,5 puntos) Indica la localización de los ribosomas en células procariotas y eucariotas. (0,5 puntos)

Bacterias y levaduras son microorganismos que pueden realizar fermentaciones para la obtención de energía. (sep 99 – B5) a) Señala las diferencias fundamentales de organización celular entre estos dos tipos de microorganismos. ( 1 punto) b) Pon un ejemplo de fermentación realizada por bacterias e indica el balance global de la misma. (0,5 puntos) c) Pon un ejemplo de fermentación realizada por levaduras y mencione un proceso industrial en el que tenga aplicación. (0,5 puntos)

7.

En muchos procesos relacionados con la industria alimentaria se producen fermentaciones por microorganismos. (jun 00 – A5) a) Pon un ejemplo de dichos procesos y mencione el tipo de microorganismo implicado. (0,5 puntos) b) Comenta la función metabólica que desempeña el microorganismo citado e indica los productos iniciales y finales del proceso. (0,75 puntos) c) Realiza un esquema del microorganismo citado, haciendo referencia a su organización estructural. (0,75 puntos)

8.

En la industria alimentaria existen procesos en los que se utilizan levaduras. (sep 00 – A5)

----------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 18 MICROORGANISMOS 1


a) Pon un ejemplo de proceso industrial relacionado con la industria alimentaria en el que se utilicen levaduras e indica cómo se denomina el proceso metabólico que tiene lugar. (0,5 puntos) b) ¿Cuál es balance global del proceso metabólico citado anteriormente? (0,5 puntos) c) Realiza un esquema de la organización celular de las levaduras. (1 punto) 9.

La microbiología estudia un grupo muy diversos de microorganismos: (mod 02 – A5) a) Excluyendo los virus, enumera los tres reinos fundamentales en los que se clasifican los microorganismos, indicando una característica relevante de cada uno de ellos. (0,75 puntos) b) Cita tres ejemplos de microorganismos pertenecientes a cada uno de los reinos mencionados en el apartado anterior. (0,75 puntos) c) Explica brevemente las principales características de los virus. (0,5 puntos)

10. Con relación a la utilización de los microorganismos en la industria alimentaría: (jun 02 – A5) a) Menciona el microorganismo que se utiliza en la fabricación del queso e indica otra aplicación del mismo en la industria alimentada. (0,5 puntos) b) Indica la reacción metabólica que realiza dicho microorganismo en el proceso de elaboración del queso, in dicando los productos iniciales y finales de la reacción. (0,75 puntos) c) Dibuja un esquema del microorganismo citado donde se aprecie su organización estructural. (0,75 puntos) 11. En relación con las bacterias: (mod 04 – A5) a) Menciona dos mecanismos de transferencia de material genético entre bacterias, indicando en qué consiste cada uno de ellos. (0,5 puntos) b) Indica las principales funciones de la pared celular bacteriana. (1 punto) c) Respecto al metabolismo bacteriano, indica el significado de los términos quimiotrofo y aerobio facultativo. (0,5 puntos) 12. En relación con la diversidad microbiana: (sep 06 – A5) a) Menciones tres microorganismos pertenecientes a distintos reinos, indicando en cada caso el reino al que pertenece (0,5 puntos) b) Señala si cada uno de los microorganismos mencionados en el apartado anterior, tiene o no organización celular y de qué tipo. (0,5 puntos) c) Cite tres enfermedades humanas producidas por microbios, indicando el organismo patógeno correspondiente. (0,5 puntos) d) Mencione tres microorganismos beneficiosos para el ser humano o para el medio ambiente, con indicación de sus efectos. (0,5 puntos) 13. En relación con las bacterias: (mod 07 – A5) a) Complete el cuadro siguiente (1 punto): Pared celular (presencia/ausencia y características)

Ejemplos y/o enfermedad

Bacterias Gram+ Bacterias GramMicoplasmas Arqueobacterias b) Dibuje y rotule las estructuras más relevantes de una célula bacteriana típica (1 punto). 14. Con respecto a los niveles de organización celular. (jun 07 – B1) a) Defina célula procariota. Indique tres características fundamentales de la célula citada (1 punto). b) Cite un ejemplo de célula procariota y dibuje un esquema rotulado de la misma (1 punto). 15. Con relación a la biología celular y la microbiología: (jun 08 – B5) a) Señale las aportaciones científicas de Anton van Leeuwenhoek y de Robert Hooke (0,5 puntos). b) Describa brevemente en qué consiste la teoría de la generación espontánea. ¿Es correcta esta teoría? Razone la respuesta (0,75 puntos). c) ¿Qué es la tinción de Gram? Explique su fundamento biológico (0,75 puntos).En el sistema defensivo del or ganismo existen células fagocíticas. (mod 08 – A5)

----------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 18 MICROORGANISMOS 2


16. Con relación a la Microbiología, (mod 2011 – A1) a) ¿A qué reino pertenecen los géneros de microorganismos Rhizopus y Penicillium? ¿Y Clostridium y Rhizobium? ¿Qué repercusión tienen Candida y Mycobacterium para los seres humanos? Indique el interés que tienen Lactobacillus y Saccharomyces para el hombre (1 punto). b) ¿Qué es la enfermedad de Creutzfeldt-Jakob y cuál es su agente causante? ¿Cómo se transmite? ¿Cómo se puede prevenir? (1punto). 17. La imagen adjunta representa la estructura general de un tipo determinado de organización celular. (sept 2011 – B3)

a) Indique a qué tipo de organización celular pertenece dicha imagen e identifique cada una de las estructuras señaladas con números (1,25 puntos). b) Explique la estructura y función de los componentes celulares señalados con los números 3 y 8 (0,75 pun tos). 18. Con referencia a la organización celular procariota: (jun 2012 – A1) a) Defina los siguientes términos: péptidoglicano (o mureína); gram negativo; plásmido; nucleoide (1 punto). b) Describa en pocas palabras y haga un esquema gráfico del proceso de bipartición binaria (1 punto). 19. En relación con Ia microbiología: (Sep 2013 – B2) a) Identifique los tipos de bacterias que se representan en el siguiente esquema (1 punto).

A

B

C

D

b) Copie y complete en su hoja de examen el siguiente cuadro (1 punto). Estructura o molécula

Tipo de microorganismo que Io posee

Pared de peptidoglucano Cilios Pili / fimbrias Quitina

----------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 18 MICROORGANISMOS 3


20. Con referencia a distintos tipos de organismos: (Mod 2014 – A1) a) Copie y complete el siguiente cuadro en su hoja de examen respondiendo (Sí o No), si los componentes o estructuras mencionadas se podrían encontrar en los organismos indicados (1 punto). COMPONENTE / ESTRUCTURA 1.

Envoltura nuclear

2.

Cloroplasto

3.

Aparato de Golgi

4.

Membrana plasmática

5.

Nucleoide

6.

Sistema de endomembranas

7.

Pared celular

8.

Ribosoma

A Clostridium sp.

B PeniciIIium sp.

C Saccharomyces sp.

b) Con referencia a su organización celular, y en forma sencilla, haga un esquema rotulado de las respectivas células de los organismos señalados en la tabla como A y C, marcando las principales diferencias entre las mismas (1 punto). 21. En relación con la microbiología: (Sep 2014 – B5) a) Indique a qué organismo o agente corresponden las descripciones siguientes: 1. Organismo eucariota con células provistas de pared con quitina, saprobio (sapróflto); 2. Microorganismo que se tiñe con la tinción de Gram; 3. Agentes infecciosos acelulares sin proteínas ni lípidos que solo tienen una corta cadena de ARN; 4. Partículas proteínicas infecciosas acelulares; 5. Virus que infectan bacterias (1,25 puntos). b) Indique a qué estructuras corresponden las descripciones siguientes: 1. Estructuras altamente resistentes a las condiciones ambientales adversas que producen algunas bacterias; 2. Estructuras cortas y móviles de naturaleza proteínica que poseen algunas bacterias y que pueden sen/ir para fijar las bacterias a las superfi cies; 3. Deformaciones transitorias del citoplasma de las células ameboides que contribuyen a la locomoción (0,75 puntos). No es necesario copiar las descripciones. 22. Con respecto a las bacterias: (Jun 2016 – B1) a) Nombre y explique brevemente en qué consiste cada uno de los tres procesos por los que las bacterias pue den transferir material genético entre ellas (1,5 puntos). b) Defina brevemente qué es una endospora y nombre un ejemplo de bacterias habitualmente formadoras de endosporas (0,5 puntos). 23. Con relación a la diversidad metabólica de los microorganismos y sus aplicaciones industriales: (Jun 17 – B1) a) Identifique los procesos a los que corresponden las siguientes reacciones generales (0,5 puntos). (A) 6 CO2 + 12 H2O + Luz → C6H12O6 + 6 O2 + 6 H2O (B) 6 CO2 + 12 H2S + Luz → C6H12O6 + 12 S + 6 H2O b) Cite un tipo de microorganismo que pueda llevar a cabo la reacción (A) y otro que pueda realizar la reacción (B) (0,5 puntos). c) Indique una aplicación industrial en la que intervenga la especie Saccharomyces cerevisiae, mencionando el tipo de reacción que llevaría a cabo en dicha aplicación (0,5 puntos). d) Indique una aplicación industrial en la que intervengan especies del género Lactobacillus, mencionando el tipo de reacción que llevarían a cabo en dicha aplicación (0,5 puntos).

----------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 18 MICROORGANISMOS 4


MICROBIOLOGÍA 19. EL APROVECHAMIENTO DE LOS MICROORGANISMOS 1.

Los agricultores gastan anualmente una importante cantidad de dinero en abonos nitrogenados tales como nitrato amónico y urea. (sep 97 – B4) a) Explica la transformación por bacterias del ion amonio (tóxico) a formas asimilables por las plantas. (1 Punto) b) Describe brevemente el ciclo del nitrógeno en la naturaleza. (1 Punto)

2.

El nitrógeno es un elemento muy abundante en la atmósfera, a la vez que componente esencial de los seres vivos. Sin embargo, sólo unos pocos microorganismos son capaces de fijar el N 2 atmosférico. (mod 98 – A4) a) Explica un ejemplo de fijación bacteriana del N2. (1 punto) b) Otras bacterias del suelo obtienen energía oxidando amoniaco a compuestos asimilables por las plantas. Explica el proceso. (1 punto)

3.

Existen muchas sustancias de gran interés que, como los antibióticos, pueden extraerse de microorganismos. El descubrimiento de la penicilina por el Dr. A.Fleming (1928), marcó un cambio radical en el tratamiento y curación de las enfermedades producidas principalmente por bacterias. (mod 98 – B4) a) Define el concepto de antibiótico explicando el modo de acción de uno de ellos. (1 punto) b) Cita algunos microorganismos que intervienen en la producción de antibióticos. (1 punto)

4.

En la industria alimentaria es frecuente el uso de microorganismos: (sep 98 – A4) a) Cita los tipos de microorganismos utilizados más frecuentemente en la producción de alimentos (0,5 puntos) b) Explica dos procesos de la industria alimentaria basados en la actividad de microorganismos. (1 punto) c) Describe el papel de algunos microorganismos en las intoxicaciones alimentarias. (0,5 puntos)

5.

Algunos microorganismos viven en simbiosis con los vegetales. (sep 99 – A4) a) Explica en qué consiste la simbiosis. (0,5 puntos) b) Menciona los tipos de microorganismos que intervienen en el ciclo del nitrógeno. (0,5 puntos) c) Explica la importancia para la agricultura de la simbiosis microorganismos-plantas en el ciclo del nitrógeno y pon un ejemplo. (1 punto)

6.

Algunos microorganismos, por su capacidad para producir toxinas, pueden causar enfermedades infecciosas en los seres vivos. (mod 00 – A5) a) Explica qué significa el término "infección". ¿Cómo se denominan los microorganismos que producen enfermedades? (0,5 puntos) b) Explica qué significa el término "virulencia" e indica, en función de la misma, los distintos tipos de microorganismos. (0,5 puntos) c) Explica que significa el término "toxina" e indica sus tipos. (1 punto)

7.

Algunos microorganismos y otros agentes patógenos son los responsables de numerosas enfermedades infecciosas. (jun 00 – B5) a) Cita cuatro vías de transmisión de las enfermedades infecciosas y pon un ejemplo para cada una de ellas. (1 punto) b) ¿Qué significan los siguientes términos: epidemia, pandemia, enfermedad endémica y zoonosis? (1 punto)

8.

En relación con los agentes infecciosos y microorganismos de interés industrial: (mod 01 – A5) a) Desde un punto de vista taxonómico, menciona cuatro grupos distintos de agentes infecciosos. (1 punto) b) Pon un ejemplo de agente infeccioso y menciona la enfermedad que causa. (0,5 puntos) c) Menciona un proceso industrial en el que participe un microorganismo, señalando el grupo taxonómico al que pertenezca. (0,5 puntos)

9.

Relacionado con las enfermedades infecciosas: (sep 02 – A5) a) Cita un ejemplo de agente patógeno perteneciente a cada uno de los siguientes grupos: bacterias, virus, protoctistas y hongos. Indica la enfermedad que produce cada uno de ellos. (1 punto) b) Define el concepto de toxina. Enumera, los tipos de toxinas que conozca indicando sus diferencias y cita un ejemplo de enfermedad causada por un microorganismo productor de toxinas. (1 punto)

----------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 19 APROVECHAMIENTO DE LOS MICROORGANISMOS 1


10. Con relación a los microorganismos: (mod 03 – A5) a) Menciona las principales técnicas de tinción utilizadas en la visualización y estudio de los microorganismos. (0,5 puntos) b) Explica el significado del término esterilización y menciona dos procedimientos diferentes de esterilización (1 punto) c) Explica el significado del término quimioterapia y cita un ejemplo de agente quimioterapéutico. (0,5 puntos) 11. En relación con los microorganismos: (jun 04 – A5) a) b) c) d)

¿En qué consiste la esterilización? (0,5 puntos). Cite dos métodos de esterilización (0,5 puntos). ¿Cuál es la finalidad de la pasteurización? (0,5 puntos). Indique para que sirve la tinción de Gram (0,5 puntos).

12. En relación con los microorganismos y sus aplicaciones: (sep 04 – A5) a) ¿Qué son los antibióticos? (0,5puntos) b) Indique dos grupos de microorganismos capaces de fabricar antibióticos (0,5 puntos). c) Señale otras dos sustancias producidas por la industria farmacéutica obtenidas mediante procesos biotecnológicos y su utilidad médica (1 punto). 13. Con referencia a los virus y otros agentes infecciosos: (jun 05 - A5) a) Indique a qué tipo de ciclo corresponde el siguiente esquema y explique brevemente cada una de las fases representadas por números (1 punto). b) Defina los términos retrovirus y prión (0,5 puntos). c) Indique las diferencias entre el significado de los términos epidemia y pandemia (0,5 puntos).

14. En relación con las enfermedades infecciosas: (sep 05 – A5) a) Defina los conceptos de infección, epidemia, pandemia y microorganismo patógeno (1 punto). b) Señale dos enfermedades infecciosas humanas, transmitidas por animales (0,5 puntos). c) Indique con qué sustancias, administradas a una persona, se puede conseguir una inmunidad activa y pasi va frente a estas enfermedades (0,5 puntos). 15. En relación con la diversidad microbiana: (sep 06 – A5) a) Mencione tres microorganismos pertenecientes a distintos reinos, indicando en cada caso el reino al que pertenece (0,5 puntos) b) Señala si cada uno de los microorganismos mencionados en el apartado anterior, tiene o no organización celular y de qué tipo. (0,5 puntos) c) Cite tres enfermedades humanas producidas por microbios, indicando el organismo patógeno correspondiente. (0,5 puntos) d) Mencione tres microorganismos beneficiosos para el ser humano o para el medio ambiente, con indicación de sus efectos. (0,5 puntos) 16. Los microorganismos son un grupo muy heterogéneo de seres vivos: (sep 08 – B5) a) Formule y explique la teoría de la simbiogénesis (endosimbiosis) y exponga la trascendencia de esta teoría en la Biología contemporánea (1 punto). b) Defina los siguientes conceptos: Simbiosis, parasitismo, zoonosis y pandemia (1 punto).

----------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 19 APROVECHAMIENTO DE LOS MICROORGANISMOS 2


17. Los microorganismos intervienen activamente en diversos ciclos biogeoquímicos, en este contexto: (mod 09 – B3) a) Explique brevemente el ciclo del nitrógeno, indicando cuál es el reservorio principal del nitrógeno en el planeta (1 punto). b) Indique dos microorganismos que fijen el N2 gaseoso (0,5 puntos). c) Explique brevemente el papel de las leguminosas en el ciclo del nitrógeno (0,5 puntos). 18. En un periódico apareció la siguiente “información”: “ ...Un equipo de investigación de dicha Universidad está poniendo a punto un antibiótico de enorme poder bactericida con la idea de que en el futuro se disperse por el medio ambiente y así se acabe con todas las bacterias del planeta. Un mundo sin bacterias será un mundo libre de enfermedades infecciosas”. (sep 09 – B2) a) Redacte una crítica científica a esta supuesta noticia, tanto si la información fuese verdad, como si fuese in ventada (1 punto). b) ¿Cómo sería un mundo sin bacterias? ¿Se acabarían las enfermedades infecciosas? (1 punto). 19. Referente al sistema inmunitario: (mod 09 – A5) En un medio de comunicación aparece la siguiente noticia: “Las manifestaciones clínicas de las picaduras de insectos de la clase himenópteros (básicamente abejas y avispas) son variadas. Sin tener en cuenta las reacciones tóxicas por picada múltiple (más de 50), en las pi cadas aisladas se presentan reacciones locales pequeñas que se consideran normales. Pero algunas personas presentan reacciones que no se explican por el efecto tóxico del veneno de una sola picada. Se trata de pacientes que han desarrollado alergia IgE mediada a los componentes de este veneno. La anafilaxia por pi cadura de insectos puede representar, en un pequeño número de pacientes, un riesgo vital. Aunque la mayo ría de picaduras de insecto producen reacción local, situaciones potencialmente mortales ocurren tanto en niños como en adultos”. a) Indique cómo se denomina ese tipo de reacción en esos pacientes. Defínala en pocas palabras (0,5 puntos). b) Defina alergeno (0,5 puntos). c) Indique qué tipo concreto de agente patógeno es el VIH, qué enfermedad provoca y dos de los principales mecanismos de transmisión de la misma (1 punto). 20. Una industria agroalimentaria realiza un examen a los candidatos que desean cubrir determinados puestos de trabajo, en el que entre otras preguntas les pide que propongan un procedimiento para es terilizar mediante radiación gamma la masa de fabricación de la pastelería antes de meterla en el horno, el mosto de las uvas antes de convertirlo en vino, o el yogur después de la fermentación. (mod 2010 – A5) a) ¿Qué respondería respecto a la eficacia de la esterilización de la masa de pastelería? ¿El pan y otros pro ductos semejantes se esterilizan en algún momento de su fabricación? (1 punto). b) ¿Y con respecto al mosto? (0,5 puntos). c) ¿Qué sucedería con la producción de yogur? (0,5 puntos). 21. La principal contribución del médico británico Joseph Lister (1827-1912) a la historia de la medicina fue el descubrimiento y aplicación de la asepsia y de los antisépticos (sustancias antimicrobianas que se aplican a un tejido vivo) en la cirugía, por lo que contribuyó a reducir en gran medida el número de muertes por infecciones contraídas en el quirófano después de que los pacientes fueran sometidos a intervenciones quirúrgicas. (jun esp 2010 – B4) a) En este contexto, comente razonadamente las medidas de prevención de infecciones (1 punto). b) En relación con la lucha contra los microorganismos patógenos, ¿qué diferencia hay entre esterilización y pasteurización? Señale otros dos sistemas de tratamiento antimicrobiano que se aplica a los alimentos (1 punto). 22. La salazón es un sistema de conservación de alimentos muy utilizado desde antiguo, y consiste en añadir una considerable cantidad de sal al alimento para preservarlo del ataque de microorganismos que puedan alterarlo. (sep 2010 – B4) a) Explique este hecho de forma razonada (1 punto). b) A finales del siglo XIX se empieza a aplicar otro sistema de conservación de alimentos muy utilizado en la actualidad, descubierto por Louis Pasteur. ¿En qué consiste? (1 punto).

----------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 19 APROVECHAMIENTO DE LOS MICROORGANISMOS 3


23. “El uso excesivo e irresponsable de antibióticos, así como la resistencia que ello genera en las bacte rias que se quieren combatir, ocasionan 25.000 muertes al año. Además, los costes adicionales que suponen para la sanidad de los países de la Unión Europea suman 1.500 millones de euros, según los datos que publicó ayer la Comisión Europea, de cara al Día Europeo contra la Resistencia a los Antibióticos, que se celebra hoy.” Esta noticia aparecida en el diario El País el 17/11/11 pone de manifiesto un grave problema de salud pública, en relación con el cual: (Mod 2013 – A1) a) Señale un uso irresponsable de los antibióticos y explique el fundamento biológico de este mal uso (0,5 pun tos). b) Indique una enfermedad humana producida por bacterias y la vía de contagio (0,5 puntos). c) Señale dos medidas preventivas para combatir las enfermedades bacterianas en las poblaciones humanas (0,5 puntos). d) Señale dos aplicaciones de la biotecnología a la industria farmacéutica (0,5 puntos). 24. Referente al metabolismo celular: (Mod 2013 – B1) a) Indique las diferencias más relevantes entre: fotosíntesis y quimiosíntesis; nutrición autótrofa y nutrición heterótrofa (1 punto). b) Indique la reacción global de la fotosíntesis (0,5 puntos). c) Identifique el proceso metabólico a que corresponden las siguientes reacciones, e indique el tipo de organis mo que lo realiza (0,5 puntos). NH3 + O2 → NO2- + H2O + energía

NO2- +O2 → NO3- + energía

25. Un paciente aquejado de una infección bacteriana acude al médico, quien le suministra un antibiótico en capsulas (oral). Al cabo de unos días vuelve al médico a causa de una diarrea, y el médico suspen de el tratamiento oral con antibióticos y aconseja al paciente tomar yogur. (Mod 2014 – A4) a) ¿Cual ha sido la posible causa de la diarrea? ¿Por qué el médico aconseja tomar yogur? (1 punto). b) En relación con los microorganismos, señale cuatro tipos (o especies) útiles para el medio ambiente y el be neficio que proporcionan (1 punto). 26. En relación con la microbiología: (Sep 2015 – A3) a) Empareje los términos de la columna A con los agentes infecciosos de la B (1 punto) A

B

Quitina

Bacteria

Proteína infecciosa

Hongo

Mureína

Virus

Cápsida

Prión

b) Empareje los términos de la columna C con las enfermedades de la columna D (1 punto). C

D

Protozoo

Salmonelosis

Bacteria

Malaria

Hongo

Sida

Virus

Tiña

27. En relación con la microbiología. (Mod 2016 – B5) a) Defina virus y bacteria, y ponga un ejemplo de cada uno (1 punto). b) Ponga un ejemplo de un protozoo patógeno e indique el modo de transmisión (0,5 puntos). c) Ponga un ejemplo de alga microscópica e indique su papel en el medio ambiente (0,5 puntos). 28. Respecto a los microorganismos, las enfermedades que causan y sus aplicaciones: (Sep 2016 – B2) a) Relacione cada uno de los siguientes géneros de microorganismos: Penicillium, Clostridium, Saccharomyces y Plasmodium, con dos de los términos o características que se indican a continuación: fermentación, ----------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 19 APROVECHAMIENTO DE LOS MICROORGANISMOS 4


hifa, nucleoide, peptidoglucano, protista, quitina y unicelular (algunos de los términos o características pueden corresponder a más de un microorganismo) (1 punto). b) Mencione dos enfermedades infecciosas en el ser humano que estén causadas por alguno de los microor ganismos citados en el apartado anterior (0,5 puntos). c) Indique dos aplicaciones biotecnológicas en las que intervenga alguno de los microorganismos citados en el primer apartado (0,5 puntos). 29. En relación a los microorganismos que resultan beneficiosos tanto para el ser humano como para el medio ambiente. (Mod 2017 — A4) a) Mencione dos microorganismos útiles en biotecnología, indicando el reino al que pertenecen y una aplica ción biotecnológica en la que intervengan (1 punto). b) Defina biorremediación y biodegradación. Cite un ejemplo de microorganismo que lleve a cabo cada una de ellas (1 punto). 30. En relación con los métodos de estudio y cultivo de los microorganismos: (Mod 2018 - A2) a) Indique qué representa la gráfica de la figura y qué parámetro se está midiendo en el eje de ordenadas (0,5 puntos).

b) Indique cómo se denominan las fases 2 y 3. Explique brevemente lo que ocurre en cada una de ellas (1 punto). c) Mediante la tinción de Gram se pueden diferenciar bacterias gram-positivas y gram-negativas. Indique en cuáles de los dos tipos de bacterias encontraríamos los siguientes componentes de la pared celular: pepti doglucano, membrana externa y ácidos teicoicos (0,5 puntos). 31. Referente al metabolismo celular: (Mod 2018 - A5) a) Indique las diferencias más relevantes entre: fotosíntesis y quimiosíntesis; nutrición autótrofa y nutrición heterótrofa (1 punto). b) Indique los componentes de la molécula de ATP (0,5 puntos). c) Explique en qué consiste el proceso de nitrificación e indique el tipo de organismo que lo realiza (0,5 pun tos).

----------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 19 APROVECHAMIENTO DE LOS MICROORGANISMOS 5


INMUNOLOGÍA 20. LOS MECANISMOS DE DEFENSA ORGÁNICA INTERNA. EL SISTEMA INMUNE 1.

Si como se muestra en el dibujo, los anticuerpos presentes en la membrana plasmática de un linfocito B interaccionan por primera vez con un antígeno: (mod 97 – A5) a) Explica los cambios que ocurrirán en el linfocito B. (1 punto) b) Nombra los tipos de células que se encontrarán en la descendencia de este linfocito B. (1 punto)

2.

Inmunidad. (mod 97 – B5) a) ¿Qué se entiende como inmunidad? Explica la diferencia entre inmunidad natural y adquirida señalando el papel de las "vacunas". (1 punto) b) Explica la naturaleza química de antígenos y anticuerpos, incluyendo un esquema de una reacción antígeno-anticuerpo. (0,5 puntos) c) Nombra las células implicadas en la respuesta celular y humoral. (0,5 puntos)

3.

La inmunidad en general, se considera que comprende los mecanismos de defensa de un organismo frente a organismos extraños y en ella tiene gran importancia las reacciones antígeno-anticuerpo: (sep 97 – B5) a) Explica qué es un anticuerpo, y dibuja la molécula de uno de ellos señalando sus partes. (1 punto) b) Explica que es un antígeno y que características tiene la reacción antígeno-anticuerpo. (1 punto)

4.

Defensa contra las infecciones virales: (mod 98 – A5) a) Explica por qué es reconocida por el sistema inmune una célula infectada por un virus. (1 punto) b) ¿Qué tipo de linfocito reconoce a las células infectadas por virus y cómo actúa? (1 punto)

5.

El significado original de "antígeno" es generador de anticuerpos. Los antígenos son moléculas que cuando penetran en el organismo son reconocidos por algunos tipos celulares: (jun 98 – A5) a) b) c) d)

6.

Nombra los dos tipos principales de células sanguíneas que reconocen antígenos.(0,5 puntos) Menciona cuál de estos dos tipos celulares está implicado en la respuesta humoral.(0,5 puntos) Menciona cuál de estos dos tipos celulares está implicado en la respuesta inmune celular. (0,5 puntos) Menciona cuál de estos dos tipos celulares, una vez reconocido el antígeno, induce la secreción de anticuerpos contra ese antígeno. (0,5 puntos)

El esquema representa una de las moléculas más importantes en la respuesta inmune. (mod 99 – A5) a) Nombra esta molécula indicando su estructura su función. (1 punto) b) Di qué células del cuerpo humano producen estas moléculas, explicando de qué tipo celular proceden. (0,5 puntos) c) Explica el papel de estas moléculas en las enfermedades autoinmunes. (0.5 puntos).

---------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 20 INMUNOLOGÍA 1


7.

Referente a los linfocitos T: (mod 99 – B5) a) ¿Qué tipos de linfocitos T conoces y como actúa cada uno de ellos. (1 punto). b) Menciona dónde se originan y dónde maduran.(1 punto)

8.

En relación con la respuesta inmune primaria y secundaria: (sep 00 – B5) a) Cuándo se origina la respuesta inmune primaria y cuándo la secundaria. (0,5 puntos) b) Explica dos diferencias entre la respuesta inmune primaria y la secundaria e indica qué tipo de células son las responsables de las diferencias entre ambos tipos de respuestas. (0,75 puntos) c) ¿Qué método de inmunización artificial se basa en inducir el desarrollo de la respuesta inmune?. Explica el procedimiento de este método y su finalidad. (0,75 puntos)

9.

Respecto a la respuesta inmune: (mod 01 – B5) a) Define el concepto de antígeno. (0,5 puntos) b) Define el concepto de anticuerpo. (0,5 puntos) c) Menciona el tipo de células sanguíneas que se encargan de la producción de anticuerpos y el tipo celular del que se diferencian. (0,5 puntos) d) Nombra el tipo de enfermedades originadas al producirse anticuerpos contra estructuras del propio organismo. Pon un ejemplo de este tipo de enfermedades. (0,5 puntos)

10. Con relación a la respuesta inmune, explica brevemente los siguientes conceptos y menciona el tipo de célula y/o molécula que participa: (sep 01 – B5) a) b) c) d)

Inmunidad humoral. (0,5 puntos) Inmunidad celular. (0,5 puntos) Memoria inmunológica. (0,5 puntos) Inmunidad natural pasiva. (0,5 puntos)

11. Con relación a las células que participan en la respuesta inmune: (mod 02 – B5) a) Indica el origen, tipos y funciones de los linfocitos T. (1 punto) b) Indica el origen y función de los linfocitos B. (0,5 puntos) c) Indica el origen y función de los macrófagos. (0,5 punto) 12. Referido a la respuesta inmune, explica brevemente los siguientes conceptos: (sep 02 – B5) a) Respuesta inmune. (0,5 puntos) b) Inmunidad humoral. (0,75 puntos) c) Inmunidad celular. (0,75 puntos) 13. En relación con la respuesta inmune: (jun 03 – A5) a) Define inmunidad específica e inespecífica. (0,5 puntos) b) Di en cuál de ambos mecanismos participan: los linfocitos, el interferón, la inflamación y los anticuerpos. (1 punto) c) Define inmunidad natural e indica su origen. (0,5 puntos) 14. Entre los procesos con que cuenta el sistema inmune para la defensa de¡ organismo, se encuentra la inmunidad celular. (sep 03 – B5) a) Define inmunidad celular y cita sus diferencias con respecto a la inmunidad humoral. (0,75 puntos) b) Cita la célula responsable de la inmunidad celular y sus dos tipos principales. (0,5 puntos) c) Cita la función de los TH (cooperadores), de los TC (citotóxicos) y de los TS (supresores). (0,75 puntos) 15. La activación de la defensa específica es un proceso fundamental en la respuesta inmune. (mod 04 – B5) a) Define defensa específica. (0,5 puntos) b) Cita la célula responsable de la inmunidad humoral, en qué otra célula se diferencia y la función de esta última. (0,75 puntos) c) Describe qué tipo de molécula es un anticuerpo y dibuja un esquema rotulado del mismo, indicando dónde se produce la unión al antígeno. (0,75 puntos)

---------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 20 INMUNOLOGÍA 2


16. Con referencia al sistema inmunológico: (sep 04 – B5) a) Defina el concepto de interferón e indique brevemente cómo lleva a cabo su acción (1 punto). b) Diga que es la hipersensibilidad (0,5 puntos). c) Defina el concepto de antígeno (0,5 puntos). 17. Con relación a la inmunidad: (jun 05 - B5) a) Defina respuesta inmune (0,75 puntos). b) Indique y explique los tipos de respuesta inmunitaria específica (0,5 puntos). c) Cite tres células que participan en la respuesta inmune (0,75 puntos). 18. Con relación a la respuesta inmunológica específica humoral: (sep 05 – B5) a) Defina el término memoria inmunológica y cite la célula responsable de su existencia (1 punto). b) Defina respuesta primaria y respuesta secundaría y explique dos diferencias existentes entre ellas (1 punto). 19. En relación con las células implicadas en el proceso inmunológico: (mod 06 – B5) a) Indique el lugar de maduración de los linfocitos T y cite el tipo de inmunidad en la que intervienen (0,5 puntos). b) Cite tres tipos de linfocitos T y explique sus funciones respectivas (1,5 puntos). 20. Existen distintos tipos de mecanismos de defensa: (jun 06 – B5) a) Defina defensa específica (0,5 puntos). b) Defina inmunidad humoral y cite sus células responsables (0,75 puntos). c) Defina inmunidad ceular y cite sus células responsables (0,75 puntos). 21. Referente a la respuesta inmune: (sep 06 – B5) a) Relacione los siguientes conceptos con cada tipo de respuesta inmune: linfocitos B, anticuerpos, células diana, respuesta inmune celular, linfocitos T, respuesta inmune humoral (0,5 puntos). b) Explique las diferencias entre la inmunidad natural activa y la pasiva (1 punto). c) ¿Qué son las enfermedades autoinmunes? (0,5 puntos). 22. Los anticuerpos intervienen en la respuesta inmune: (mod 07 – B5) a) Explique su naturaleza química y cite dos tipos (0,75 puntos). b) Cite la célula productora y el tipo de inmunidad en el que intervienen (0,5 puntos). c) Dibuje el esquema de un anticuerpo y señale sus componentes marcando la zona donde se une al antígeno (0,75 puntos). 23. El dibujo adjunto representa el esquema básico de una molécula relacionada con la inmunidad: (jun 07 – A5) a) Indique de qué molécula se trata y la célula responsable de su producción (0,5 puntos). b) Copie el esquema, complételo añadiendo lo que falta y rotule sus componentes (1 punto). c) Cite los tipos de respuesta inmunitaria e indique en cuál de ellos interviene la molécula adjunta (0,5 puntos).

24. Los linfocitos T son células indispensables para un buen funcionamiento del sistema inmune: (sep 07 – A5) a) Indique dónde se produce su célula precursora y en qué lugar del organismo se diferencian para poder cum plir su misión (0,5 puntos). b) Cite el tipo de inmunidad en el que actúan y dos estructuras a las que destruyan (0,75 puntos). c) Indique los dos grupos principales en que se clasifican y los subgrupos que se originan de ellos (0,75 puntos). ---------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 20 INMUNOLOGÍA 3


25. En el sistema defensivo del organismo existen células fagocíticas. (mod 08 – A5) a) Cite dos de estas células e indique a qué tipo de defensa pertenecen (0,75 puntos). b) Explique el mecanismo de la fagocitosis y sus etapas (1,25 puntos). 26. Con relación al sistema inmunitario: (jun 08 – A5) a) Defina los conceptos antígeno y anticuerpo (0,5 puntos). b) ¿Qué se entiende por respuesta inmune (0,5 puntos). c) Indique los tipos de respuesta inmune y explique cada uno de ellos (1 punto). 27. La célula plasmática es una diferenciación del linfocito B cuya única función es la producción de anti cuerpos y su liberación al espacio extracelular. (sep 09 – A5) a) Teniendo en cuenta lo anterior, deduzca su ultraestructura comentando sus orgánulos celulares predominantes y razonando la respuesta (1 punto). b) Indique qué clase de moléculas son los anticuerpos y cite sus tipos (0,5 puntos). c) Dibuje un esquema de la estructura de un anticuerpo indicando sus diferentes partes (0,5 puntos). 28. Con relación a la respuesta inmune: (Sept 2011 – B5) a) b) c) d)

Defina el término fagocitosis (0,5 puntos). ¿Qué tipos de glóbulos blancos realizan la fagocitosis? (0,5 puntos). ¿Por qué los fagocitos son un tipo de defensa inespecífica? Razone la respuesta (0,5 puntos). ¿Qué estructuras corporales actúan como reservorio de estos glóbulos blancos? Indique el lugar donde se originan los fagocitos (0,5 puntos).

29. Con referencia a las células musculares cardíacas y a las células plasmáticas productoras de anticuerpos de una determinada especie de mamífero: (Mod 2012 – A3) a) ¿Cuál de los dos tipos celulares tendrá mayor abundancia de mitocondrias? ¿Cuál tendrá más ribosomas? Dé una explicación a ambas respuestas (1 punto). b) Si el número diploide de la especie en cuestión es 46, ¿cuántos cromosomas tendrán las células del tejido cardiaco? ¿y las células plasmáticas? ¿y un espermatozoide? ¿y un óvulo? (1 punto). 30. Las principales moléculas que actúan en la inmunidad son los anticuerpos. (Mod 2012 – B4) a) Indique qué tipo de moléculas son los anticuerpos y explique su composición (0,5 puntos). b) Cite la célula que los produce, de dónde proviene ésta y las clases de anticuerpos (1 punto). c) Identifique el anticuerpo que está representado a la izquierda y explique la razón de su identificación (0,5 puntos).

31. Los anticuerpos son moléculas importantes para el funcionamiento del sistema inmunitario: (Sep 2014 – A3) a) Explique la naturaleza química de los anticuerpos y cite dos de sus tipos (1 punto). b) ¿Qué células son las responsables de la producción de anticuerpos? ¿Dónde se originan? (0,5 puntos). c) Explique qué es un Iinfocito B de memoria (0,5 puntos). 32. Con relación a la defensa del sistema inmunitario: (Mod 2013 – B3) a) Explique por qué el organismo tras sufrir una enfermedad infecciosa determinada es capaz de lograr defensas frente a la misma (0,5 puntos). b) Defina el concepto de respuesta humoral y respuesta celular, indicando el tipo de células que intervienen en cada una de ellas (1 punto). c) Defina el concepto de enfermedad autoinmune y ponga un ejemplo (0,5 puntos).

---------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 20 INMUNOLOGÍA 4


33. Con referencia a las infecciones en el ser humano: (Jun 2013 – A3) a) Indique la importancia de los órganos linfoides primarios poniendo dos ejemplos (0,5 puntos). b) Nombre la función de los órganos linfoides secundarios poniendo dos ejemplos (0,5 puntos). c) Explique en qué consiste la inflamación, qué puede provocarla y los síntomas que produce (1 punto). 34. Con relación a Ia respuesta inmune: (Sep 2013 – A3) a) b) c) d)

Explique qué es necesario hacer ante una herida con posible contagio por Clostridium tetani (0,5 puntos). Razone por qué se vacuna a los bebés frente a determinadas enfermedades (0,5 puntos). Explique dos de las diferencias entre suero y vacuna (0,5 puntos). Ponga un ejemplo de uso de suero y otro de vacuna ante determinadas infecciones (0,5 puntos).

35. Con relación al sistema inmunitario: (Jun 2014 – B4) a) Explique el concepto de antígeno y cite dos ejemplos (0,5 puntos). b) Indique cómo se pueden clasificar los trasplantes según la procedencia del órgano o tejido trasplantado, e indique un ejemplo de cada tipo (1 punto). c) Explique a qué se denomina respuesta inmune humoral (0,5 puntos). 36. Con relación al sistema inmunitario. (Mod 2017 — B4) a) Defina los siguientes términos: respuesta humoral, antígeno, enfermedad autoinmune y respuesta inmune primaria (1 punto). b) Explique en qué consiste el proceso de vacunación y el de sueroterapia e indique con qué tipo de inmuniza ción está relacionado cada uno de ellos (1 punto).

INMUNOLOGÍA 20. INMUNOLOGÍA Y ENFERMEDAD 37. Inmunidad. (mod 97 – B5) a) ¿Qué se entiende como inmunidad? Explica la diferencia entre inmunidad natural y adquirida señalando el papel de las "vacunas". (1 punto) b) Explica la naturaleza química de antígenos y anticuerpos, incluyendo un esquema de una reacción antígeno-anticuerpo. (0,5 puntos) c) Nombra las células implicadas en la respuesta celular y humoral. (0,5 puntos) 38. Los microorganismos, la infección y la inmunidad: (jun 97 – A5) a) ¿Qué diferencia existe entre suero y vacuna? Explícala. (1 punto) b) ¿Qué tipo de inmunidad adquieren los individuos en cada caso? (1 punto) 39. En algunos casos para defendemos de las infecciones se aplican sueros utilizando mecanismos de inmunidad artificial pasiva: (sep 97 – A5) a) ¿Qué es un suero y en qué casos debe usarse?(1 punto) b) Explica cómo se obtienen los sueros. (1 punto) 40. En algunas vacunas hay que administrar varias dosis para alcanzar una protección suficiente: (mod 98 – B5) a) Explica lo que ocurre al administrar la 1ª dosis y lo que ocurre con dosis posteriores. (1 punto) b) ¿En qué casos se espera que la vacuna reproduzca de forma atenuada algunos síntomas de la enfermedad y en qué casos la vacuna no va a reproducir la enfermedad atenuada? (0,5 puntos).

---------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 20 INMUNOLOGÍA 5


41. En algunas vacunas hay que administrar varias dosis para alcanzar una protección suficiente: (jun 98 – B5) a) Explica lo que ocurre al administrar la 1ª dosis y lo que ocurre con dosis posteriores. (1 punto) b) ¿En qué casos se espera que la vacuna reproduzca de forma atenuada algunos síntomas de la enferme dad? (0,5 puntos) c) ¿En qué casos la vacuna no va a producir ningún síntoma de la enfermedad? (0,5 puntos) 42. Los transplantes de órganos han evitado la muerte segura de un gran número de personas: (sep 98 – A5)

a) Relaciona el transplante de órganos con el sistema inmune de receptor y donante. (1 punto) b) Explica por qué se suele buscar el donante entre los miembros de la familia. (0,5 puntos) c) Explica la importancia de los transplantes con algún ejemplo concreto. (0,5 puntos) 43. En algunos casos para defendemos de las infecciones se aplican sueros utilizando mecanismos de inmunidad artificial pasiva: (sep 98 – B5) a) Menciona qué tipos de moléculas son responsables de la inmunidad proporcionada por los sueros. (0,5 pun tos) b) Nombra un ejemplo de suero que sea de utilización habitual. (0,5 puntos) c) ¿En qué ocasiones deben usarse los sueros? (0,5 puntos) d) Explica cómo se obtienen los sueros. (0,5 puntos) 44. El esquema representa una de las moléculas más importantes en la respuesta inmune. (mod 99 – A5) a) Nombra esta molécula indicando su estructura su función. (1 punto) b) Di qué células del cuerpo humano producen estas moléculas, explicando de qué tipo celular proceden. (0,5 puntos) c) Explica el papel de estas moléculas en las enfermedades autoinmunes. (0.5 puntos). 45. La lactancia materna proporciona al bebé inmunidad natural pasiva. (jun 99 – A5) a) Explica en qué consiste en este caso este tipo de inmunidad. (0,5 puntos) b) Pon otro ejemplo diferente de inmunidad natural pasiva. (0,5 puntos) c) Explica en qué consiste la inmunidad artificial pasiva y cuándo debe utilizarse. (1 punto) 46. La alergia o hipersensibilidad se produce cuando un antígeno, normalmente inocuo, da lugar a una reacción inmunológica que puede llegar a tener graves consecuencias para el organismo. (jun 99 – B5) a) b) c) d)

Explica qué es un alérgeno y mencione un ejemplo. (0,5 puntos) Nombra una molécula responsable de los síntomas de la alergia o mediador alérgico. (0,5 puntos) Explica en qué consiste y que consecuencias puede tener el shock anafiláctico. (0,5 puntos) Cita dos medidas para reducir los síntomas que se manifiestan en la alergia. (0,5 puntos)

47. En relación con la respuesta inmune: (sep 99 – A5) a) ¿Qué son las vacunas y con qué fin se utilizan? (0,5 puntos) b) ¿En qué casos deben utilizarse las vacunas? (0,5 puntos) c) Describe cuatro tipos de antígenos utilizados en la obtención de las vacunas. (1 punto) 48. El sistema inmunitario es responsable del rechazo que se produce en algunos casos de trasplante o injerto. (mod 00 – B5) a) Menciona las moléculas responsables del rechazo. (0,5 puntos) b) Explica por qué los trasplantes entre gemelos idénticos o univitelinos no provocan reacciones de rechazo. (0,5 puntos) c) Pon un ejemplo de trasplante e indica cuándo se aconseja su realización. (0,5 puntos) d) Explica una medida para reducir el riesgo de rechazo en los trasplantes. (0,5 puntos) 49. En relación con la respuesta inmune primaria y secundaria: (sep 00 – B5) a) Cuándo se origina la respuesta inmune primaria y cuándo la secundaria. (0,5 puntos) b) Explica dos diferencias entre la respuesta inmune primaria y la secundaria e indica qué tipo de células son las responsables de las diferencias entre ambos tipos de respuestas. (0,75 puntos) c) ¿Qué método de inmunización artificial se basa en inducir el desarrollo de la respuesta inmune?. Explica el procedimiento de este método y su finalidad. (0,75 puntos) ---------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 20 INMUNOLOGÍA 6


50. Respecto a la respuesta inmune: (mod 01 – B5) a) Define el concepto de antígeno. (0,5 puntos) b) Define el concepto de anticuerpo. (0,5 puntos) c) Menciona el tipo de células sanguíneas que se encargan de la producción de anticuerpos y el tipo celular del que se diferencian. (0,5 puntos) d) Nombra el tipo de enfermedades originadas al producirse anticuerpos contra estructuras del propio organismo. Pon un ejemplo de este tipo de enfermedades. (0,5 puntos) 51. Con respecto a las alteraciones de la respuesta inmune: (jun 01 – B5) a) Explica el concepto de inmunodeficiencia. (0,5 puntos) b) Explica las diferencias que existen entre inmunodeficiencias congénitas y adquiridas. Cita un ejemplo de inmunodeficiencia. (0,75 puntos) c) Explica el concepto de enfermedad autoinmune y cita un ejemplo. (0,75 puntos) 52. Con relación a la respuesta inmune, explica brevemente los siguientes conceptos y menciona el tipo de célula y/o molécula que participa: (sep 01 – B5) a) b) c) d)

Inmunidad humoral. (0,5 puntos) Inmunidad celular. (0,5 puntos) Memoria inmunológica. (0,5 puntos) Inmunidad natural pasiva. (0,5 puntos)

53. Con respecto al trasplante de órganos: (jun 02 – B5) a) Define los conceptos de xenotrasplante e isotrasplante. (0,5 puntos) b) Explica brevemente el concepto y las causas del rechazo inmunológico. (1 punto) c) Explica brevemente las medidas utilizadas en la prevención del rechazo inmunológico. (0,5 puntos) 54. En relación con la respuesta inmune: (jun 03 – A5) a) Define inmunidad específica e inespecífica. (0,5 puntos) b) Di en cuál de ambos mecanismos participan: los linfocitos, el interferón, la inflamación y los anticuerpos. (1 punto) c) Define inmunidad natural e indica su origen. (0,5 puntos) 55. Con respecto a los tipos de inmunidad, dependiendo de la forma de adquirirla: (jun 04 – B5) a) b) c) d)

Defina inmunidad natural pasiva (0,5 puntos). Defina inmunidad natural activa (0,5 puntos). Defina inmunidad artificial pasiva (0,5 puntos). Defina inmunidad artificial activa (0,5 puntos).

56. Con referencia al sistema inmunológico: (sep 04 – B5) a) Defina el concepto de interferón e indique brevemente cómo lleva a cabo su acción (1 punto). b) Diga que es la hipersensibilidad (0,5 puntos). c) Defina el concepto de antígeno (0,5 puntos). 57. Referido a la respuesta inmune. (mod 05 – B5) a) Diga qué es la inmunodeficiencia y mencione cuántos tipos hay. (0,5 puntos) b) Explique en qué consiste la inmunización pasiva y diga una ventaja y un inconveniente de la misma. (1 punto) c) Defina enfermedad autoinmune y diga un ejemplo. (0,5 puntos) 58. En relación con las enfermedades infecciosas: (sep 05 – A5) a) Defina los conceptos de infección, epidemia, pandemia y microorganismo patógeno (1 punto). b) Señale dos enfermedades infecciosas humanas, transmitidas por animales (0,5 puntos). c) Indique con qué sustancias, administradas a una persona, se puede conseguir una inmunidad activa y pasi va frente a estas enfermedades (0,5 puntos).

---------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 20 INMUNOLOGÍA 7


59. El siguiente esquema representa el mecanismo de defensa del sistema inmunitario. (jun 2012 - A5)

a) Indique los tipos de células y las estructuras que aparecen señaladas con los números de 1 al 5 (1 punto). b) Cite en qué órgano maduran las estructuras señaladas con los números 2 y 5 (0,5 puntos). c) Indique dos diferencias entre las estructuras señaladas con los números 2 y 3 (0,5 puntos). 60. Referente a la respuesta inmune: (sep 06 – B5) a) Relacione los siguientes conceptos con cada tipo de respuesta inmune: linfocitos B, anticuerpos, células diana, respuesta inmune celular, linfocitos T, respuesta inmune humoral (0,5 puntos). b) Explique las diferencias entre la inmunidad natural activa y la pasiva (1 punto). c) ¿Qué son las enfermedades autoinmunes? (0,5 puntos). 61. Los trasplantes son procedimientos quirúrgicos útiles en casos de insuficiencias irreversibles de órganos y sistemas. (sep 08 – A5) a) Indique cuál es el mayor problema que se puede presentar con posterioridad a la ejecución de un trasplante, qué moléculas son las desencadenantes del mismo y cuáles son las células que primero actúan. Cite el tipo de fármacos que se utilizan para evitarlo (1 punto). b) Cite y defina cuatro tipos de trasplantes según el origen del órgano o tejido trasplantado (1 punto). 62. El sistema inmunitario de un individuo es capaz de generar inmunidad contra antígenos determinados. (jun esp 2010 – A4) a) Defina inmunidad artificial, cite otra denominación con la que se conozca este proceso, e indique sus tipos (1 punto). b) Explique en qué consiste cada uno de los tipos indicados en la respuesta anterior (1 punto). 63. Entre las alteraciones patológicas del sistema inmunitario se encuentran las enfermedades autoinmu nes. (sep 2010 – A4) a) Explique en qué consisten y su mecanismo etiopatológico (mecanismo de producción), aludiendo a los con ceptos de autoantígeno y tolerancia inmunológica (1,5 puntos). b) Cite dos ejemplos de enfermedades autoinmunes (0,5 puntos). 64. En la reciente epidemia, causada por el virus de la gripe A (H1N1), se ha observado que la enfermedad presenta menos incidencia en los individuos mayores de 60 años. (mod 2011 – B1) a) Explique la causa de este hecho inmunológico (1 punto). b) Cite las células que intervienen en el mismo y explique las tres diferencias que existen entre respuesta inmunológica primaria y secundaria (1 punto).

---------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 20 INMUNOLOGÍA 8


65. Las inmunodeficiencias son trastornos importantes del sistema inmunitario de una persona: (jun 2011 - A5) a) Defina brevemente el concepto de inmunodeficiencia congénita (0,5 puntos). b) El SIDA es una enfermedad que produce inmunodeficiencia ¿de qué tipo?, ¿cuál es el agente causante? (0,5 puntos). c) ¿Cuáles son las vías de transmisión del virus del SIDA? (0,5 puntos). d) ¿Qué se entiende por individuo seropositivo? (0,5 puntos). 66. Con relación a la defensa del sistema inmunitario: (Mod 2013 – B3) a) Explique por qué el organismo tras sufrir una enfermedad infecciosa determinada es capaz de lograr defensas frente a la misma (0,5 puntos). b) Defina el concepto de respuesta humoral y respuesta celular, indicando el tipo de células que intervienen en cada una de ellas (1 punto). c) Defina el concepto de enfermedad autoinmune y ponga un ejemplo (0,5 puntos). 67. Con relación a Ia inmunología y sus aplicaciones: (Mod 2014 – B1) a) Explique en términos inmunológicos la siguiente situación: alergia al polen (0,5 puntos). b) Explique en qué consiste el “rechazo inmunológico“ ante los trasplantes de órganos (0,5 puntos). c) ¿Qué tratamiento se utiliza para prevenir el rechazo en un individuo trasplantado? Justifique la respuesta (0,5 puntos). d) Relacione el SIDA con las enfermedades inmunológicas (0,5 puntos). 68. Con relación al sistema inmunitario: (Jun 2014 – B4) a) Explique el concepto de antígeno y cite dos ejemplos (0,5 puntos). b) Indique cómo se pueden clasificar los trasplantes según la procedencia del órgano o tejido trasplantado, e indique un ejemplo de cada tipo (1 punto). c) Explique a qué se denomina respuesta inmune humoral (0,5 puntos). 69. Con relación a la inmunidad: (Mod 2015 – A4) a) Se realiza un analisis de sangre a un niño recién nacido, en él se detecta que hay anticuerpos lgG contra el VIH. Los analisis posteriores entre los seis meses y cinco años nos revelan que los anticuerpos de tipo lgG contra el VIH han desaparecido. Explique qué ha ocurrido en ese periodo (1 punto). b) Explique si ha tenido el niño en algún momento contacto con el VIH y desarrollara la enfermedad (1 punto). 70. En los países desarrollados se estima que entre un 15% y un 20% de la población sufre alergia al po len. (Jun 2015 – A4) a) Defina el término de alérgeno (0,5 puntos). b) Explique qué tipo de reacción del sistema inmunitario se produce en una alergia e indique tres procesos bá sicos que puedan desencadenarse (1 punto). c) Indique una célula y una molécula implicadas en los procesos alérgicos (0,5 puntos). 71. La siguiente imagen representa una de las moléculas más importantes del sistema inmune. (Sep 2015 – B1) a) Cite el tipo de molécula de que se trata e indique su composición química (0,5 puntos). b) Cite las distintas clases de este tipo de moléculas e indique el tipo de células que las produce (0,5 puntos). c) Nombre la estructura de la molécula señalada con 1, y explique la función que realiza (0,5 puntos). d) Explique una función que desempeña en el organismo la molécula representada (0,5 puntos).

---------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 20 INMUNOLOGÍA 9


72. Los linfocitos son células del sistema inmunitario que actúan de forma específica contra las células presentadoras de antígenos. (Mod 2016 – A3) a) Indique el papel que desempeñan los distintos tipos de linfocitos T, en la respuesta inmune celular (0,75 puntos). b) Explique el concepto de célula de memoria (0,5 puntos). c) Explique el papel que desempeñan las células NK (Natural Killer), e indique sobre qué tipo de células actúan (0,75 puntos). 73. En relación a las vacunas: (Jun 2016 – A4) a) Defina el concepto de vacuna (0,5 puntos). b) Explique por qué la vacunación de una mujer durante el embarazo puede evitar una enfermedad infecciosa en el recién nacido (0,5 puntos). c) Indique de qué tipo es la inmunidad que ha adquirido el recién nacido del apartado anterior y explique otro mecanismo por el que podría adquirir este tipo de inmunidad (1 punto). 74. Con relación al sistema inmunitario. (Mod 2017 — B4) a) Defina los siguientes términos: respuesta humoral, antígeno, enfermedad autoinmune y respuesta inmune primaria (1 punto). b) Explique en qué consiste el proceso de vacunación y el de sueroterapia e indique con qué tipo de inmuniza ción está relacionado cada uno de ellos (1 punto). 75. En relación a la respuesta inmune: (Jun 17 – A4) a) Relacione los procesos de la columna de la izquierda con los términos de la columna derecha, asociando los números conlas letras (1,25 puntos). 1-Inmunidad celular

A-Sueros

2-Inmunidad artificial pasiva

B-Linfocitos B

3-Vacunación

C-Células de memoria

4-Inmunidad humoral

D-Macrófagos

5- Fagocitosis

E-Linfocitos T

b) Explique brevemente qué son las inmunodeficiencias e indique de qué clases pueden ser según su origen (0,75 puntos). 76. Respecto a la respuesta inmune: (Sep 17 – A4) a) Nombre los cuatro tipos de inmunidad por la forma de adquirirla y ponga un ejemplo de cada uno de ellos (1 punto). b) Defina inmunodeficiencia y enfermedad autoinmune (1 punto).

---------------------------------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 20 INMUNOLOGÍA 10


BIOTECNOLOGÍA 22. EL APROVECHAMIENTO DE LOS MICROORGANISMOS. LA BIOTECNOLOGÍA. INGENIERÍA GENÉTICA 1.

Fermentaciones: (mod 97 – A4) a) Define el concepto de fermentación. (0,5 puntos) b) Indica dos diferencias esenciales entre la fermentación y la respiración. (0,5 puntos) c) Explica dos diferentes aplicaciones biotecnológicas de las fermentaciones. (1 punto)

2.

La aplicación de técnicas de genética molecular ha permitido la mejora de calidad, duración, etc. de algunos de los productos agrícolas que consumimos: (jun 97 – B5) a) Explica con cierto detalle alguna de estas técnicas. (1 punto) b) Consideraciones éticas y legales que deben tenerse en cuenta antes de modificar el material genético de productos utilizados en la alimentación humana. (1 punto)

3.

Existen muchas sustancias de gran interés que, como los antibióticos, pueden extraerse de microorganismos. El descubrimiento de la penicilina por el Dr. A.Fleming (1928), marcó un cambio radical en el tratamiento y curación de las enfermedades producidas principalmente por bacterias. (mod 98 – B4) a) Define el concepto de antibiótico explicando el modo de acción de uno de ellos. (1 punto) b) Cita algunos microorganismos que intervienen en la producción de antibióticos. (1 punto)

4.

Los microorganismos pueden ser de gran utilidad para el hombre ya que intervienen en muchos procesos de interés como la producción de antibióticos, la elaboración de cerveza, vino, pan, productos lácteos etc. (jun 98 – B4) a) ¿Qué tipo de microorganismos participan en los procesos de elaboración del vino y de la cerveza? (0,5 pun tos) b) ¿Qué proceso metabólico se produce en la elaboración de estos productos? (0,5 puntos) c) ¿,Qué tipo de microorganismos participan en la elaboración del yogur? (0,5 puntos) d) ¿Qué tipo de proceso metabólico se da en la elaboración del yogur? (0,5 puntos)

5.

En la industria alimentaria es frecuente el uso de microorganismos: (sep 98 – A4) a) Cita los tipos de microorganismos utilizados más frecuentemente en la producción de alimentos (0,5 puntos) b) Explica dos procesos de la industria alimentaria basados en la actividad de microorganismos. (1 punto) c) Describe el papel de algunos microorganismos en las intoxicaciones alimentarias. (0,5 puntos)

6.

En algunos organismos el ácido pirúvico procedente de la glucólisis sigue una ruta metabólica deno minada fermentación, mediante la cual obtienen energía. (sep 98 – B2) a) Señala las diferencias fundamentales entre fermentación y respiración celular (1 punto). b) ¿Qué microorganismos pueden realizar fermentaciones? (0,5 puntos) c) Menciona algún producto industrial que se obtenga por fermentación y que le resulte familiar (porque se consuma en su casa, por ejemplo) (0,5 puntos)

7.

Debido a la biotecnología la importancia de algunos microorganismos es cada día mayor: (sep 98 – B4) a) Define en qué consiste la biotecnología, relacionándola con la utilización de microorganismos (1 punto). b) Menciona un proceso biotecnológico basado en la actuación de levaduras. (0,5 puntos) c) Indica qué tipo de células son las levaduras. (0,5 puntos)

8.

Durante la fabricación de la cerveza se producen una serie de reacciones anaerobias: (mod 99 – A4) a) Indica cómo se llama el proceso global y qué tipo de microorganismo interviene. (0,5 puntos) b) Describe, desde el punto de vista químico, la reacción global de este proceso y en qué parte de la célula se localiza.(1 punto) c) Cita dos ejemplos de otros procesos similares, indicando su interés industrial. (0,5 puntos)

----------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 21 BIOTECNOLOGÍA E INGENIERÍA GENÉTICA 1


9.

A menudo aparecen en la prensa noticias referentes a ingeniería genética: (mod 99 – B3) a) b) c) d)

Explica en qué consiste la ingeniería genética. (0,5 puntos) Explica qué es un plásmido.(0,5 puntos) Explica cómo actúan las enzimas de restricción (0,5 puntos) Pon un ejemplo de una aplicación práctica de la ingeniería genética. (0,5 puntos)

10. Bacterias y levaduras son microorganismos que pueden realizar fermentaciones para la obtención de energía. (sep 99 – B5) a) Señala las diferencias fundamentales de organización celular entre estos dos tipos de microorganismos. ( 1 punto) b) Pon un ejemplo de fermentación realizada por bacterias e indica el balance global de la misma. (0,5 puntos) c) Pon un ejemplo de fermentación realizada por levaduras y mencione un proceso industrial en el que tenga aplicación. (0,5 puntos) 11. En muchos procesos relacionados con la industria alimentaria se producen fermentaciones por microorganismos. (jun 00 – A5) a) Pon un ejemplo de dichos procesos y mencione el tipo de microorganismo implicado. (0,5 puntos) b) Comenta la función metabólica que desempeña el microorganismo citado e indica los productos iniciales y finales del proceso. (0,75 puntos) c) Realiza un esquema del microorganismo citado, haciendo referencia a su organización estructural. (0,75 puntos) 12. En la industria alimentaria existen procesos en los que se utilizan levaduras. (sep 00 – A5) a) Pon un ejemplo de proceso industrial relacionado con la industria alimentaria en el que se utilicen levaduras e indica cómo se denomina el proceso metabólico que tiene lugar. (0,5 puntos) b) ¿Cuál es balance global del proceso metabólico citado anteriormente? (0,5 puntos) c) Realiza un esquema de la organización celular de las levaduras. (1 punto) 13. En relación con los agentes infecciosos y microorganismos de interés industrial: (mod 01 – A5) a) Desde un punto de vista taxonómico, menciona cuatro grupos distintos de agentes infecciosos. (1 punto) b) Pon un ejemplo de agente infeccioso y menciona la enfermedad que causa. (0,5 puntos) c) Menciona un proceso industrial en el que participe un microorganismo, señalando el grupo taxonómico al que pertenezca. (0,5 puntos) 14. Con relación a la utilización de los microorganismos con fines industriales: (jun 01 – A5) a) Define el concepto de biotecnología. (0,5 puntos) b) Menciona un microorganismo utilizado en la industria alimentaria y explica brevemente el proceso en el que participa. (0,75 puntos) c) Menciona un microorganismo utilizado en la industria farmacéutica y explica brevemente el proceso en el que participa. (0,75 puntos) 15. Con relación a la utilización de los microorganismos en la industria alimentaría: (jun 02 – A5) a) Menciona el microorganismo que se utiliza en la fabricación del queso e indica otra aplicación del mismo en la industria alimentada. (0,5 puntos) b) Indica la reacción metabólica que realiza dicho microorganismo en el proceso de elaboración del queso, in dicando los productos iniciales y finales de la reacción. (0,75 puntos) c) Dibuja un esquema del microorganismo citado donde se aprecie su organización estructural. (0,75 puntos) 16. Con referencia a la moderna biotecnología: (sep 03 – A5) a) Define los siguientes conceptos: ingeniería genética, célula hospedadora, clonación y vector de clonación. (1 punto) b) Menciona cuatro aplicaciones prácticas de la ingeniería genética y pon un ejemplo de cada una de ellas. (1 punto)

----------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 21 BIOTECNOLOGÍA E INGENIERÍA GENÉTICA 2


17. En relación con los microorganismos y sus aplicaciones: (sep 04 – A5) a) ¿Qué son los antibióticos? (0,5puntos) b) Indique dos grupos de microorganismos capaces de fabricar antibióticos (0,5 puntos). c) Señale otras dos sustancias producidas por la industria farmacéutica obtenidas mediante procesos biotecnológicos y su utilidad médica (1 punto). 18. En relación con la ingeniería genética: (mod 05 – A5) a) ¿Qué es una molécula de ADN recombinante?, ¿qué es un plásmido bacteriano? Explique con qué finalidad se introduce una molécula de ADN recombinante fabricada “in vitro” dentro de un organismo huésped (por ejemplo E. coli). (0,75 puntos) b) Indique los pasos necesarios para construir “in vitro” una molécula de ADN recombinante. (0,5 puntos) c) Explique qué es un organismo transgénico y cite dos aplicaciones de la ingeniería genética. (0,75 puntos) 19. La elaboración de ciertos productos lácteos se inicia con una primera reacción en la que interviene un determinado tipo de microorganismos. Posteriormente se requiere que intervengan otros microorganismos hasta obtener el producto final: (mod 06 – A5) a) Indique brevemente esa primera reacción que se lleva a cabo (nombre del sustrato inicial y productos fina les), y el microorganismo (que interviene en esta etapa del proceso (1 punto). b) El hongo Penicillium roquefortii es responsable del aspecto, olor y sabor de un determinado producto lácteo, ¿sabría indicar cuál es este producto y si este hongo participa antes o después del microorganismo A en el proceso? (0,5 puntos). c) Otras especies de Penicillium se han empleado en la industria farmacéutica. Indique el nombre de la primera sustancia que se obtuvo gracias a él y el nombre genérico de estos fármacos (0,5 puntos). 20. En relación con la biotecnología: (jun 06 – A5) a) ¿Qué microorganismos se utilizan en el proceso de fabricación del yogur, la cerveza y el pan? (0,5 puntos) b) ¿Qué reacciones químicas tienen lugar en los procesos antes mencionados? Señale los productos químicos que se obtienen en cada una de estas reacciones (1 punto). c) Además de en la industria alimentaria, señale otros dos campos en los que se emplee la biotecnología (0,5 puntos). 21. En relación con la Biotecnología: (jun 07 – B5) a) Defina Ingeniería genética (0,5 puntos). b) Defina organismo transgénico (0,5 puntos). c) Explique brevemente el proceso de introducción de un fragmento de ADN en un vector durante la formación de moléculas recombinantes (1 punto). 22. La Microbiología y la Biotecnología son dos disciplinas implicadas en algunos procesos de la industria alimentaria. (mod 08 – B5) a) Describa qué etapas son comunes y cuáles son diferentes en la fabricación del vino y la cerveza (1 punto). b) Describa qué etapas son comunes y cuáles son diferentes en la fabricación del yogur y el queso (1 punto). 23. Suponga que en el genoma de cierta especie vegetal se han introducido dos genes: uno relacionado con la actividad de la rubisco (ribulosa-1,5-bisfosfato carboxilasa/oxigenasa) y otro con la fotólisis del agua. (jun 09 – A4) a) Cite el proceso y la etapa del mismo en la que interviene la rubisco y su localización a nivel de orgánulo (0,5 puntos). b) Explique la importancia biológica de esta enzima, ¿qué aplicación podría tener el aumento de su actividad? (0,5 puntos). c) ¿Qué es la fotólisis del agua? ¿Cuál es su finalidad? (0,5 puntos). d) ¿Cómo se llaman las plantas obtenidas mediante técnicas similares a la del enunciado? ¿Con qué propósito se realizan estas técnicas?, ponga un ejemplo (0,5 puntos). 24. En relación con la Biotecnología y la Microbiología. (jun 09 – A2) a) ¿Qué tienen en común la fabricación del pan y la del vino? (0,5 puntos). b) ¿Cuál es y de dónde procede la molécula de partida?, ¿Cuál es y dónde va la molécula resultante de la reacción básica de estos procesos industriales? (1 punto). c) ¿Qué organismo es el responsable de esta reacción? (0,5 puntos). ----------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 21 BIOTECNOLOGÍA E INGENIERÍA GENÉTICA 3


25. Referente a la Ingeniería Genética: (sep 09 – B5) a) Explique qué es un ADN recombinante y cuál es la función de las enzimas de restricción (0,5 puntos). b) Indique las etapas necesarias para producir clonación génica (1 punto). c) ¿Qué es una planta transgénica? Cite una de sus aplicaciones (0,5 puntos). 26. Relacionado con los procesos metabólicos: (jun gen 2010 – B4) a) Defina fermentación e indique sus tipos. ¿Cuál es su localización celular? (0,75 puntos). b) Explique la formación de ATP durante la fermentación (0,5 puntos). c) ¿Cuál es la relación entre el metabolismo fermentativo y la fabricación del vino? Cite los productos: inicial y final. Indique los microorganismos que intervienen (0,75 puntos). 27. Referente al metabolismo celular: (jun esp 2010 – A5) a) Concepto de fermentación. Indique sus tipos y cite su localización celular (0,75 puntos). b) Explique la síntesis de ATP durante la fermentación (0,5 puntos). c) ¿Cuál es la relación entre las fermentaciones y la elaboración del queso? Indique el sustrato y el producto final. ¿Qué microorganismos intervienen? (0,75 puntos). 28. Con relación a la Microbiología, (mod 2011 – A1) a) ¿A qué reino pertenecen los géneros de microorganismos Rhizopus y Penicillium? ¿Y Clostridium y Rhizobium? ¿Qué repercusión tienen Candida y Mycobacterium para los seres humanos? Indique el interés que tienen Lactobacillus y Saccharomyces para el hombre (1 punto). b) ¿Qué es la enfermedad de Creutzfeldt-Jakob y cuál es su agente causante? ¿Cómo se transmite? ¿Cómo se puede prevenir? (1punto). 29. Con relación a las aplicaciones de la biotecnología, indique: (mod 2011 – B4) a) ¿Qué es la Ingeniería genética? (0,5 puntos). b) ¿Qué es un organismo transgénico? (0,5 puntos). c) Cite dos ejemplos de aplicaciones biotecnológicas (1 punto). 30. La obtención de determinados productos alimentarios se basa en algunos procesos metabólicos celulares. (jun 2011 – B4) a) Explique la transformación que sigue la glucosa durante el proceso de elaboración del pan ¿Cómo se denomina el proceso? ¿En qué etapa se produce la síntesis de ATP? (1 punto). b) ¿Qué organismos están relacionados con la elaboración del pan? ¿A qué tipo de organización celular perte necen estos organismos? Indique sus componentes estructurales (1 punto). 31. Las fermentaciones son procesos catabólicos de enorme importancia en la Biología y en la Biotecnología. (jun 2012 - B5) a) ¿En qué consiste un proceso catabólico? Cite algún proceso anabólico importante en la Naturaleza (0,5 puntos). b) Indique dos similitudes y dos diferencias entre la fermentación alcohólica y la fermentación láctica (1 punto). c) Indique dos procesos industriales basados en fermentaciones (0,5 puntos). 32. “El uso excesivo e irresponsable de antibióticos, así como la resistencia que ello genera en las bacte rias que se quieren combatir, ocasionan 25.000 muertes al año. Además, los costes adicionales que suponen para la sanidad de los países de la Unión Europea suman 1.500 millones de euros, según los datos que publicó ayer la Comisión Europea, de cara al Día Europeo contra la Resistencia a los Antibióticos, que se celebra hoy.” Esta noticia aparecida en el diario El País el 17/11/11 pone de manifiesto un grave problema de salud pública, en relación con el cual: (Mod 2013 – A1) a) Señale un uso irresponsable de los antibióticos y explique el fundamento biológico de este mal uso (0,5 pun tos). b) Indique una enfermedad humana producida por bacterias y la vía de contagio (0,5 puntos). c) Señale dos medidas preventivas para combatir las enfermedades bacterianas en las poblaciones humanas (0,5 puntos). d) Señale dos aplicaciones de la biotecnología a la industria farmacéutica (0,5 puntos). ----------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 21 BIOTECNOLOGÍA E INGENIERÍA GENÉTICA 4


33. En relación con la microbiología y la biotecnología: (Jun 2013 – B3) a) Indique y explique qué son las siguientes siglas: VIH, PCR y OMG (0,75 puntos). b) Defina los siguientes términos: Plásmido, viroide, fago y prión. Explique brevemente el significado e importancia del Proyecto Genoma Humano (1,25 puntos). 34. En relación con la Biotecnología indique: (Jun 2014 – A1) a) Tres aplicaciones en la industria agropecuaria (0,75 puntos). b) Tres aplicaciones en la industria farmacéutica (0,75 puntos). c) Dos aplicaciones en la industria alimentaria (0,5 puntos). 35. Referente al metabolismo celular: (Mod 2015 – B4) a) Indique las diferencias mas relevantes entre anabolismo y catabolismo, y entre respiración mitocondrial y fermentación (1 punto). b) Cite dos tipos de fermentaciones que se utilicen en la industria alimentaria, indicando el tipo de microorga nismos que los realizan, así como los productos iniciales y finales de las mismas (1 punto). 36. Referente al metabolismo celular: (Sep 17 – A3) a) Identifique la molécula formada por adenina, ribosa y tres moléculas de ácido fosfórico. Indicar cómo se denomina la reacción en la que se sintetiza dicha molécula (0,5 puntos). b) Explique la importancia ecológica del proceso de fotosíntesis oxigénica (0,5 puntos). c) Explique la relación que hay entre la fermentación y la elaboración de queso ¿Cuál es el sustrato y los productos finales? ¿Qué microorganismos intervienen? (1 punto).

----------------------------------------------------------- CUESTIONES DE SELECTIVIDAD – TEMA 21 BIOTECNOLOGÍA E INGENIERÍA GENÉTICA 5

Cuestiones de Selectividad de Biología  

Todas las preguntas de los exámenes de selectividad de la Comunidad de Madrid desde el año 1997 hasta el 2017 clasificadas por temas

Cuestiones de Selectividad de Biología  

Todas las preguntas de los exámenes de selectividad de la Comunidad de Madrid desde el año 1997 hasta el 2017 clasificadas por temas

Advertisement