Page 1

Blimp-1/Prdm1 Alternative Promoter Usage during Mouse Development and Plasma Cell Differentiation Marc A. J. Morgan, Erna Magnusdottir, Tracy C. Kuo, Chai Tunyaplin, James Harper, Sebastian J. Arnold, Kathryn Calame, Elizabeth J. Robertson and Elizabeth K. Bikoff Mol. Cell. Biol. 2009, 29(21):5813. DOI: 10.1128/MCB.00670-09. Published Ahead of Print 8 September 2009.

These include: REFERENCES

CONTENT ALERTS

This article cites 83 articles, 35 of which can be accessed free at: http://mcb.asm.org/content/29/21/5813#ref-list-1 Receive: RSS Feeds, eTOCs, free email alerts (when new articles cite this article), moreÂť

Information about commercial reprint orders: http://mcb.asm.org/site/misc/reprints.xhtml To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/

Downloaded from http://mcb.asm.org/ on February 13, 2012 by guest

Updated information and services can be found at: http://mcb.asm.org/content/29/21/5813


MOLECULAR AND CELLULAR BIOLOGY, Nov. 2009, p. 5813–5827 0270-7306/09/$12.00 doi:10.1128/MCB.00670-09 Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Vol. 29, No. 21

Blimp-1/Prdm1 Alternative Promoter Usage during Mouse Development and Plasma Cell Differentiation䌤 Marc A. J. Morgan,1 Erna Magnusdottir,2 Tracy C. Kuo,2 Chai Tunyaplin,2 James Harper,1 Sebastian J. Arnold,1 Kathryn Calame,2 Elizabeth J. Robertson,1 and Elizabeth K. Bikoff1* Sir William Dunn School of Pathology, University of Oxford, South Parks Road, Oxford OX1 3RE, United Kingdom,1 and Department of Microbiology, Columbia University College of Physicians and Surgeons, New York, New York 100322 Received 23 May 2009/Returned for modification 11 July 2009/Accepted 22 August 2009

embedded within a 230-kb bacterial artificial chromosome (kb ⫺140 to ⫹90 relative to the transcription start site) faithfully drives temporally and spatially restricted expression at numerous sites in the embryo, including primordial germ cells, anterior definitive endoderm, somites, pharyngeal arches, limb buds, and dermal papillae (60, 61). In contrast, an enhanced green fluorescent protein reporter construct containing 4.4 kb upstream of the Prdm1 transcription start site is sufficient for expression in adult hematopoietic tissues and mediates lipopolysaccharide (LPS) responsiveness of splenic B cells (83). However, this construct also leads to ectopic expression at numerous tissue sites. The cis-acting regulatory elements controlling dynamic patterns of Prdm1 expression in vivo thus potentially span a large genomic region. Dose-dependent BMP-Smad signals activate Prdm1 expression in committed primordial germ cells when they initially appear at the base of the allantois (60). However, it remains unknown whether Prdm1 is a direct Smad target. A recent study identified a Gli3 binding site ⬃27 kb downstream of the Prdm1 coding region that drives expression in the developing limb (82). Similarly, studies of zebra fish have shown that Sonic Hedgehog controls Prdm1 expression during pectoral fin and muscle development (5, 40). However, multipotent progenitor cell populations allocated at numerous tissue sites express Prdm1 only transiently (67). Multiple, as yet uncharacterized enhancer and repressor elements are almost certainly required to regulate graded Prdm1 activities throughout development. Alternative promoter usage offers an attractive mechanism for regulating Prdm1 gene expression. Two alternative promoters control spatially and temporally distinct blimp1/krox expression patterns during sea urchin development (44, 45). These

The PR/SET domain zinc-finger transcriptional repressor Blimp-1/Prdm1 was initially cloned as a negative regulator of IFNB1 (beta interferon) expression (30) and later identified as a factor both necessary and sufficient for B-cell terminal differentiation and antibody secretion (74, 79). Blimp-1, the protein encoded by Prdm1, silences expression of key transcription factors, such as c-Myc, required for cell cycle progression (43), as well as Pax5, Id3, and Spi-B, which maintain mature B-cell identity (41, 71). Prdm1 inactivation in the T-cell lineage results in fatal inflammatory bowel disease associated with reduced interleukin 10 and upregulated expression of interleukin 2 and gamma interferon (28, 49). In the skin, Prdm1 is required for sebaceous gland homeostasis (22) and epidermal terminal differentiation (48). Prdm1 has a dynamic pattern of expression in the developing mouse embryo (10, 60, 67, 81). Loss-offunction mutant embryos fail to specify primordial germ cells, display pharyngeal arch defects, and die around embryonic day 10.5 (E10.5) due to placental insufficiency (60, 81). Conditional rescue experiments have revealed additional roles in multipotent progenitor cell populations in the forelimb, secondary heart field, and sensory vibrissae (67). Thus, Prdm1 regulates cell fate decisions in diverse contexts in the embryo and governs tissue homeostasis in multiple cell types in the adult organism. The cis-acting regulatory elements that direct tissue-specific Prdm1 expression in these specialized cell types are largely unknown. A Venus fluorescent reporter transgene

* Corresponding author. Mailing address: University of Oxford, Sir William Dunn School of Pathology, South Parks Road, Oxford OX1 3RE, United Kingdom. Phone: 0044 1865 285649. Fax: 44-1865285492. E-mail: elizabeth.bikoff@path.ox.ac.uk. 䌤 Published ahead of print on 8 September 2009. 5813

Downloaded from http://mcb.asm.org/ on February 13, 2012 by guest

The zinc-finger PR domain transcriptional repressor Blimp-1/Prdm1 plays essential roles in primordial germ cell specification, placental, heart, and forelimb development, plasma cell differentiation, and T-cell homeostasis. The present experiments demonstrate that the mouse Prdm1 gene has three alternative promoter regions. All three alternative first exons splice directly to exon 3, containing the translational start codon. To examine possible cell-type-specific functional activities in vivo, we generated targeted deletions that selectively eliminate two of these transcriptional start sites. Remarkably, mice lacking the previously described first exon develop normally and are fertile. However, this region contains NF-␬B binding sites, and as shown here, NF-␬B signaling is required for Prdm1 induction. Thus, mutant B cells fail to express Prdm1 in response to lipopolysaccharide stimulation and lack the ability to become antibody-secreting cells. An alternative distal promoter located ⬃70 kb upstream, giving rise to transcripts strongly expressed in the yolk sac, is dispensable. Thus, the deletion of exon 1B has no noticeable effect on expression levels in the embryo or adult tissues. Collectively, these experiments provide insight into the organization of the Prdm1 gene and demonstrate that NF-␬B is a key mediator of Prdm1 expression.


5814

MORGAN ET AL.

MATERIALS AND METHODS Gene targeting. The ⌬ex1A targeting vector was generated by ligating a 2.9-kb 5⬘ homology region (StuI-PstI), a loxP-flanked pgk-neomycin cassette from PGKneolox2DTA (76), and a 4.7-kb 3⬘ homology region (AfeI-EcoRV) into a modified version of pBSII-KS(⫺) (Stratagene). An hsv-thymidine kinase (hsv-tk) cassette was inserted outside the 3⬘ homology region. The ⌬ex1B targeting vector was generated by ligating a 12.2-kb Acc65I-NdeI fragment from the bMQ-381N6 bacterial artificial chromosome (Geneservice, Cambridge, United Kingdom) into a modified version of pBSIIKS(⫺) (Stratagene). The loxP-flanked pgk-neomycin cassette was introduced at XhoI and SpeI sites, and the hsv-tk cassette was ligated outside of the 3⬘ homology region. Gene targeting was carried out in CCE embryonic stem (ES) cells. A linearized targeting vector (15 ␮g) was introduced by electroporation. Homologous recombinant clones were selected in the presence of G418 (200 ␮g/ml) and 1-[2⬘-deoxy-2⬘-fluoro-␤-D-arabinofuranosyl]-5iodouracil (0.1 ␮g/ml). Drug-resistant colonies were screened by Southern blot analysis using the restriction enzyme and probe combinations shown in Fig. 2. For the ⌬ex1A allele, we recovered 28 correctly targeted clones out of ⬃860 drug-resistant colonies, and in the case of the ⌬ex1B allele, 16 correctly targeted clones out of ⬃1,150 colonies. Targeted clones were transiently transfected with pMC1Cre and screened for excision of the loxP-flanked pgk-neomycin cassette by Southern blotting. PCR genotyping. DNA was prepared as described previously (53). The following primers and conditions were used for the ⌬ex1A allele: common primer, GCCAG ACCCTGAGATGACTACATTG; wild-type primer, CACAGCAAAACAAAAG CCCAAC; mutant primer, CGAAGCGGACAAGAACCACTACTG; 54°C annealing temperature, 40 cycles; for ⌬ex1B, wild-type primer 1, TTGAGGTTCACG CACGAATG; wild-type primer 2, GACTTTTGCTTGCTATGCCCTG; mutant primer 1, CCTAAAAAGGTGCGAGTAAGGTGAG; mutant primer 2, TACAT

TABLE 1. RPA probesa Probe

Size (nt)

Exons 1A-3 Exons 1B-3 #1 Exons 1B-3 #2 Exons 1C-3 1C intron-3 Exons 4-5 Exon 6 Sp1

401 310 386 449 410 456 305 270

a

Protected fragment(s)a

280 223 265 328 315 369 251 220

nt nt nt nt nt nt nt nt

⫹ ⫹ ⫹ ⫹ ⫹

170 nt (exon 3) 89 nt (exon 3) 170 nt (exon 3) 170 nt (exon 3) 170 nt (exon 3)

nt, nucleotides.

CCCCAGCCCAGAGGTTG; 58°C annealing temperature, 40 cycles. Prdm1BEH (81), Prdm1null (74), and Prdm1gfp (27) mice were genotyped as described previously. RNA analysis. 5⬘ random amplification of cDNA ends (RACE) cloning was performed using the second-generation 5⬘/3⬘ RACE kit (03 353 621 001; Roche) with slight modifications. Two micrograms of total RNA was reverse transcribed using a primer annealing in exon 4 (Ex4Rev: CTCCTTACTTACCACGCCAA). First-strand cDNA was purified (11 732 668 001; High Pure PCR product purification kit; Roche), dA-tailed, and PCR amplified (Platinum Pfx polymerase; 11708; Invitrogen) using a nested primer in exon 3 (Ex3Rev1, GTGCTCGAGC GTCAGCGCCGGAATCCCAGG) and the oligo(dT)-anchor primer (GACCA CGCGTATCGATGTCGACTTTTTTTTTTTTTTTTV). The XhoI and SalI cloning sites are underlined. An annealing temperature of 55°C was used for Pfx amplification. Subsequently, 0.5 ␮l of the reaction mixture was used as a template for a second round of amplification (ReddyMix PCR Mastermix; AB-0575/LD; Thermo Scientific) using Ex3Rev1 and the oligo(dT)-anchor primer (60°C annealing temperature). Products were gel purified (Qiaex II kit; 20051; Qiagen), digested with XhoI and SalI, cloned into pBSII-KS(⫺) (Stratagene), and sequenced (Geneservice). In some cases, where the second round of amplification failed to yield discrete products, the Pfx reaction mixture was instead amplified using ReddyMix PCR Mastermix with a nested primer (Ex3Rev2: CTGCCAG TCCTTGAAACTTC) in combination with the oligo(dT)-anchor primer. In this case, PCR products were gel purified and cloned directly into pCR-XL-TOPO (Invitrogen). Sequences were aligned to the mouse genome using the BLAT function of the University of California, Santa Cruz (UCSC), genome browser (31, 37). The pCAGGS-Blimp-1 expression vector (67) was transiently transfected into COS-7 and HEK293 cells using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. Total RNA was isolated using Trizol (Invitrogen), and reverse transcription-PCR (RT-PCR) was performed using the OneStep RT-PCR kit (Qiagen). Primers were as follows: exon 1A forward (Ex1AFor), CGTAGAAAAGGAGGGACCGCC; exon 1B forward (Ex1BFor), GTTTGCATTCACCGAAGTTGC; exon 1C forward (Ex1CFor), CCGGGACACAGGACGCAG; exon 3 reverse no. 1 (Ex3Rev1), CGTCAG CGCCGGAATCCCAGG; exon 3 reverse no. 2 (Ex3Rev2), CTGCCAGTCC TTGAAACTTC; Hprt forward (HprtFor), GCTGGTGAAAAGGACCTCT; Hprt reverse (HprtRev), CACAGGACTAGAACACCTGC. An RNase protection assay (RPA) was carried out using the RPAIII kit (AM1415; Ambion) as described previously (2). Sizes of the probes and protected fragments are summarized in Table 1. Band intensities were normalized to the Sp1 signal. Each percentage represents the average for two independent normalized mutant samples in comparison with the average for two independent normalized wild-type control littermate samples. T-cell, B-cell, and bone marrow dendritic cell (BMDC) cultures. Age-matched and whenever possible sex-matched homozygous mutant and wild-type control littermates derived from intercross matings were sacrificed at 6 to 8 weeks of age. Spleen cell suspensions were depleted of erythrocytes by ammonium chlorideTris treatment. To induce plasma cell differentiation, splenocytes (2.5 ⫻ 106 cells/ml) were cultured for 3 days in the presence of LPS (50 ␮g/ml) (Escherichia coli 055:B5; Difco Laboratories). Alternatively, for T-cell activation, the B cells were depleted using anti-CD45R (B220) magnetic microbeads (495-01; Miltenyi Biotec) according to the manufacturer’s instructions. The nonadherent cells were cultured at a density of 5 ⫻ 105 cells/ml for 3 days on anti-mouse T-cell receptor ␤-chain (553166; BD Biosciences)-coated dishes. BMDCs were isolated as described previously (24). Cultures were initially plated at 4 ⫻ 105 cells/ml in the presence of granulocyte/macrophage-colony stimulating factor (25 ng/ml) (415-ML; R&D Systems), fed on day 3 and day 6,

Downloaded from http://mcb.asm.org/ on February 13, 2012 by guest

alternative transcripts encode nearly identical proteins except that the 1b isoform contains 50 additional residues at its amino terminus. Specific morpholino knockdown of the 1a and 1b transcripts results in tissue-specific disturbances in the gut endoderm and vegetal plate, respectively (44). The activity of an alternative promoter region located 5⬘ of PRDM1 exon 4 that generates a protein lacking the PR/SET domain with reduced repressive activity on multiple target genes is elevated in human myeloma lines relative to levels in primary B cells (21). The Prdm1 basal promoter and multiple transcriptional start sites were previously mapped immediately upstream of exon 1 (78). To learn more about developmentally regulated expression, we characterized the 5⬘ ends of Prdm1 transcripts in the developing embryo. We identified two novel alternative first exons that both splice directly to exon 3, containing the translational start site. Exon 1B, located 70 kb upstream of exon 1A, is strongly expressed in the yolk sac. An additional first exon (exon 1C) is located in the intron downstream of exon 1A. To evaluate the possibly distinct functional activities contributed by alternative promoters, we generated targeted alleles that selectively eliminate either exon 1A (⌬ex1A) or exon 1B (⌬ex1B) transcripts. The exon 1B deletion slightly decreases expression in the yolk sac but otherwise has no noticeable effect in the embryo or adult tissues. Surprisingly, the exon 1A deletion encompassing NF-␬B sites upstream of the promoter eliminates Prdm1 expression in LPS-stimulated B cells and blocks plasma cell differentiation but fails to disrupt embryonic development. Consistent with this, we observe only modestly reduced Prdm1 expression levels in the embryo. However, compound heterozygotes also carrying the null allele display partially penetrant developmental defects. The novel alternative promoters described in this report are likely to play important roles in generating regulatory diversity and controlling gene dosage effects.

MOL. CELL. BIOL.


VOL. 29, 2009

5815

previously described (48) with FastStart SYBR green master mix (Roche) on a Stratagene MX3000 real-time PCR system.

RESULTS A distal alternative promoter and first exon is located 70 kb upstream of exon 1A. The TATA-less GC-rich promoter region upstream of exon 1A contains multiple transcription initiation sites (51, 78). Early experiments suggested that the in-frame translational start site present in mouse exon 1A together with exon 2 encodes an N-terminal extension (78, 79). However, exon 2 sequences are not found in human PRDM1 transcripts (23, 30, 78). We also noticed that exon 2 is not present in several mouse GenBank clones that splice directly from exon 1A to exon 3. To further characterize Prdm1 transcripts expressed during mouse development, we performed 5⬘ RACE and sequenced the products recovered from E9.5 embryos and yolk sacs. Interestingly, the majority of clones (seven of nine) isolated from yolk sacs contain an alternative first exon (exon 1B) located approximately 70 kb upstream of exon 1A (Fig. 1A to C). Consistent with this observation, RPA experiments demonstrate that exon 1B transcripts are selectively expressed in the yolk sac and barely detectable in the embryo (Fig. 1E). We found a single GenBank Prdm1 clone (accession no. AK077622) derived from E8.0-stage embryos that contains exon 1B spliced to exon 3 (29). Moreover, cap analysis gene expression (CAGE) tags indicative of transcription start sites (35, 75) have been mapped to the region immediately upstream of exon 1B (Fig. 1D). Additionally, recent reports describe bivalent chromatin domains containing both transcriptionally active (H3K4 trimethyl) and repressed (H3K27 trimethyl) histone modifications at promoters of developmentally regulated genes (3, 6). We used the UCSC genome browser (37) together with ChIP-sequencing data (36, 50) (http://www.broad.mit.edu/node/681) to visualize histone modifications across the Prdm1 locus. Interestingly, exon 1B is bivalent in both human and mouse ES cells (Fig. 1F). Neither exon 1A nor exon 1B 5⬘ RACE clones contain exon 2 sequences. Rather, both exons splice directly to exon 3. To further investigate exon 2 expression, we performed RT-PCR analysis using primers anchored in exon 1A and exon 3. We screened a panel of tissues and cell lines including the BCL1 cell line originally used for cloning Prdm1 (79). As expected, exon 2 expression is detectable in cells transfected with the full-length cDNA containing exon 2 (79). However, endogenous transcripts exclusively contain exon 1A sequences joined directly to exon 3 (Fig. 1G). Four GenBank expressed sequence tag (EST) clones contain exon 1A spliced to exon 3 (accession no. AK133503, AK149344, BC129801, and CX733088), whereas exon 2 is present only in the original Prdm1 clone (accession no. U08185) (79). Targeted deletion of Prdm1 alternative promoters has no effect on embryonic development. One possibility is that alternative promoters govern cell-type-specific patterns of Prdm1 expression. Selective loss of alternative transcripts could potentially cause tissue-specific developmental defects. To test this possibility, we engineered targeted deletions designed to specifically eliminate either exon 1A or 1B transcripts (Fig. 2). The exon 1A deletion (⌬ex1A) removes 2.18 kb (UCSC genome browser coordinates, chromosome 10: 44,178,130 to

Downloaded from http://mcb.asm.org/ on February 13, 2012 by guest

and harvested on day 7. Where indicated, dendritic cell maturation was induced during the last 20 h of culture by the addition of LPS (20 ␮g/ml). Immunoblotting. Cells were lysed in radioimmunoprecipitation assay buffer plus protease inhibitors and extracts prepared as described previously (67). Following sodium dodecyl sulfate-polyacrylamide gel electrophoresis, proteins were transferred onto a polyvinylidene difluoride membrane (Millipore) at 300 V for 2 h. Membranes were blocked for 1 h at room temperature in Tris-buffered saline–Tween containing 7% nonfat dry milk and incubated in primary antiBlimp-1 (1:500, rat monoclonal 5E7) (27) antibody overnight at 4°C or in primary anti-ß-tubulin (1:1,000, rabbit polyclonal, sc-9104; Santa Cruz) or anti-mouse immunoglobulin (Ig) (H⫹L)-horseradish peroxidase (HRP) (1:500; NA931V; GE Healthcare) for 1 h at room temperature. Anti-rat Ig-HRP (1:1,000; NA935V; GE Healthcare) and anti-rabbit Ig (1:2,000; NA934V; GE Healthcare) secondary antibody incubations were for 1 h at room temperature. Bands were quantified using a ChemiDoc XRS imager (Bio-Rad) and the QuantityOne software program (Bio-Rad) and normalized to ß-tubulin. Histology. E9.5 placentae were fixed overnight in 4% paraformaldehyde, dehydrated in ethanol, embedded, and sectioned at 6 ␮m. Sections were boiled for 20 min in antigen retrieval solution (Dako), blocked for 5 min in peroxidase quenching buffer (K4011; Dako), incubated in anti-Blimp-1 (1:1,000, rabbit polyclonal) (22) at 4°C overnight, washed in phosphate-buffered saline, developed using 3,3⬘-diaminobenzidine and the Dako peroxidase-labeled polymer kit, and then counterstained with hematoxylin. Visualization of primordial germ cells by staining for alkaline phosphatase activity was performed as described previously (39). For IgA staining, sections of intestine were submerged in optimal-cuttingtemperature freezing compound and frozen in a dry-ice isopentane bath. Blocks were cryosectioned at 6 ␮m and stained with goat anti-mouse IgA-HRP (1:200; 1040-05; Southern Biotech). Testes and ovaries were fixed overnight in Bouin’s fixative, dehydrated in ethanol, embedded in paraffin wax, sectioned at 8 ␮m, and stained with hematoxylin and eosin. For skeletal staining, limbs were skinned, fixed in 95% ethanol, stained with alcian blue, cleared with 1% potassium hydroxide, stained with alizarin red, cleared again in 1% potassium hydroxide, and equilibrated in 100% glycerol as described previously (53). Virus infection, NF-␬B inhibitors, and quantitative RT-PCR. Wild-type and p50/p65 doubly deficient 3T3 fibroblasts (63) were maintained in Dulbecco’s modified Eagle medium with 10% fetal bovine serum and gentamicin (10 ␮g/ml). Cells were split the day before infection, cultured overnight to achieve 90% confluence, and rinsed twice with phosphate-buffered saline before addition of serum-free Dulbecco’s modified Eagle medium. Following a 2-h incubation with Sendai virus (ATCC, Rockville, MD) at a multiplicity of infection of 2, medium was aspirated and cells were cultured with complete medium and at the appropriate times postinfection directly lysed in Trizol (Invitrogen, Carlsbad, CA). M12 B cells (32) were cultured in RPMI 1640 with 10% fetal bovine serum, gentamicin (10 ␮g/ml), and where appropriate LPS (2.5 ␮g/ml). The NF-␬B inhibitor helenalin (10 ␮M; Biomol, Plymouth Meeting, PA) or BMS341380 (30 uM) (Bristol-Myers Squibb, Princeton, NJ) was added for 1 h. RNA was isolated using TRIzol reagent (Life Technologies), and cDNA was prepared using SuperScript III reverse transcriptase (Invitrogen) according to the manufacturer’s protocol. Quantitative PCR was performed using an ABI 7700 instrument (Applied Biosystems). Concentrations for stock reagents are as follows: 1⫻ PCR buffer, 200 mM deoxynucleoside triphosphate, 0.4⫻ SYBR green (Sigma), 150 nM 6-carboxy-x-rhodamine (Sigma), 1% dimethyl sulfoxide, and 1.25 U Taq polymerase. Conditions and primer concentrations used were as follows: mouse Prdm1, 500 nM 5⬘-GACGGGGGTACTTCTGTTCA-3⬘ and 50 nM 5⬘-GGCAT TCTTGGGAACTGTGT-3⬘; 2.5 mM MgCl2; mouse beta-2-microglobulin, 300 nM 5⬘-AGACTGATACATACGCCTGCAG-3⬘ and 50 nM 5⬘-GCAGGTTCAA ATGAATCTTCAG-3⬘. The amplification program for beta-2-microglobulin was as follows: 95°C for 5 min, 95°C for 20 s, 59°C for 1 min, and 82 to 84°C for 20s (collect data) for 40 cycles; melting curve, 95°C for 20 s, 59°C for 15 s, and up to 95°C for 20 s with a 19-min ramping time. For mouse Prdm1, the amplification step was as follows: 95°C for 15 s, 60°C for 30 s, and 72°C for 30 s (collect data) for 40 cycles. ChIP. Chromatin immunoprecipitation (ChIP) quantified by semiquantitative PCR and Southern blotting was performed as described previously (25) using anti-p65 (sc-372; SantaCruz Biotechnology, Santa Cruz, CA). The PCR primers were designed to amplify the following regions: the potential NF-␬B binding site located at ⫺94 to ⫺85 relative to the transcriptional start site of Prdm1 exon 1a promoter. The Ig␬ intronic enhancer encompasses the previously described NF-␬B binding site (72). The Bcl-6 binding site within intron 5 of mouse Prdm1 (77) was amplified as a negative control. Quantitative PCR was performed as

Blimp-1 ALTERNATIVE PROMOTERS


Downloaded from http://mcb.asm.org/ on February 13, 2012 by guest FIG. 1. An alternative first exon located 70 kb upstream of the previously characterized transcription initiation site drives Prdm1 expression in the yolk sac. (A) Schematic of Prdm1 alternative promoters. Exons 1 to 3 are depicted as black boxes, with exons 4 to 8 (gray box) shown in a condensed format. Black arrows indicate transcription start sites. The alternative first exon, exon 1B, located approximately 70 kb upstream, and the previously characterized exon 1A both splice directly to exon 3. (B) Summary of 5âŹ˜ RACE clones recovered from E9.5 embryo and yolk sac RNA. (C) Sequence of a representative clone containing exon 1B (underlined in black) spliced to exon 3 (underlined in gray). The black vertical arrow indicates the splice junction. The PCR primer annealing site is underlined in red. In-frame AUG codons in exon 3 are underlined in green. (D) Exon 1B clones were aligned to the mouse genome using the UCSC genome browser (31, 37). The CAGE tags (35, 75) are shown as black bars with white chevrons. The splice junctions align precisely to GenBank clone AK077622. (E) RPA analysis. The full-length protected fragment corresponds to exon 1B spliced to exon 3. The lower band corresponds to exon 3 alone due to expression of alternative exon 1A spliced to exon 3 transcripts. The exon 1B-3 probe #1 detects expression specifically in the E9.5 yolk sac. (F) ChIP-seq data (36, 50) demonstrate that exon 1B is bivalent in both mouse and human ES cells. The positions of histone H3K4me3 (green) and H3K27me3 (red) enrichment are shown in relation to exon 1B and the clone AK077622. (G) RT-PCR analysis. HEK293 and COS-7 cells transfected with a pCAGGS (56) expression vector containing the full-length Prdm1 cDNA (79) (lanes 3 and 5) are analyzed. The expression plasmid (pCAGGS-Blimp-1) and a cDNA containing exon 1A spliced to exon 3 (accession no. CX733088) also serve as controls (lanes 9 and 10). The primers Ex1AFor and Ex3Rev2 exclusively detect a product corresponding to exon 1A spliced to exon 3 expressed by J558L, BCL1 lymphoma cells induced to secrete Ig, and LPS-stimulated BALB/c splenocytes (lanes 1, 7, and 8). 5816


VOL. 29, 2009

Blimp-1 ALTERNATIVE PROMOTERS

5817

Downloaded from http://mcb.asm.org/ on February 13, 2012 by guest FIG. 2. Prdm1 alternative promoter deletion alleles. (A) Schematic representation of the wild-type locus, targeting vector, ⌬ex1A mutant allele, and Southern blot screening probes. A, AfeI; RI, EcoRI; RV, EcoRV; P, PstI; Sp, SphI; St, StuI. (B) Southern blot analysis of representative drug-resistant colonies. The positions of diagnostic wild-type (8.4-kb) and targeted (5.4-kb) fragments are shown. (C) PCR genotyping screen. Primers specific for the wild-type (blue arrow) and mutant (red arrow) alleles and a common primer (black arrow) generate a 550-bp wild-type and 310-bp mutant product as shown. (D) Schematic of the wild-type locus, targeting vector, ⌬ex1B mutant allele, and Southern blot screening probes. A65I, Acc65I; B, BamHI; N, NdeI; P, PstI; S, SpeI; X, XhoI. (E) Southern blot analysis of representative drug-resistant colonies. The positions of diagnostic wild-type (16.5-kb) and targeted (6.7-kb) fragments are shown. (F) PCR genotyping screen. The four primers (wild type, blue arrows; mutant, red arrows) produce a 278-bp wild-type and 340-bp mutant product as shown.

44,180,309; July 2007 assembly, mm9) encompassing roughly ⫺1.8 kb to ⫹380 bp, including the basal promoter and transcriptional start sites (78) (Fig. 2A). To ensure efficient splicing of exon 1B to exon 3, sequences 3⬘ to exon 1A were left largely intact (⬃150 bp was removed). The exon 1B deletion (⌬ex1B)

removes 3.9 kb (chromosome 10: 44,247,021 to 44,250,926), approximately ⫺2.6 kb to ⫹1.3 kb relative to the transcriptional start site on clone AK077622 (Fig. 2D). Because Blimp-1 requirements in the embryo are exquisitely dose dependent (60, 67, 81), we expected that the ⌬ex1A or


5818

MORGAN ET AL.

MOL. CELL. BIOL.

TABLE 2. Genotypes of heterozygous intercross progeny Intercross

Prdm1⫹/⌬ex1A ⫻ Prdml⫹/⌬ex1A Prdml⫹/⌬ex1B ⫻ Prdml⫹/⌬ex1B

No. (%) of weanlings with genotype

Total

⫹/⫹ ⫹/⌬ex1A ⌬ex1A/⌬ex1A 70 110 64 (26)

244

⫹/⫹ ⫹/⌬ex1B 28 50

104

⌬ex1B/⌬ex1B 26 (25)

Downloaded from http://mcb.asm.org/ on February 13, 2012 by guest

⌬ex1B deletion alleles would cause germ cell defects or embryonic lethality or perturb other Blimp-1-dependent developmental processes, such as forelimb and heart development. Remarkably, both Prdm1⌬ex1A/⌬ex1A and Prdm1⌬ex1B/⌬ex1B homozygous mutants (hereafter referred to as ⌬ex1A and ⌬ex1B mice) were recovered at Mendelian ratios from heterozygous intercross matings (Table 2). Adult homozygous mutants failed to display any gross abnormalities. Moreover, these mice are fertile and can be maintained as homozygous mutant breeding pairs. To confirm the ⌬ex1A and ⌬ex1B targeted deletions selectively eliminate mRNA expression of the alternative transcripts as predicted, we analyzed E9.5 embryo and yolk sac mRNA by RT-PCR (Fig. 3A). As expected, the ⌬ex1A mutants entirely lack exon 1A but express exon 1B transcripts. Conversely, ⌬ex1B mutants express exon 1A transcripts but lack exon 1B mRNA. Thus, our targeting strategies selectively eliminate expression of the alternative transcripts as intended. As shown in Fig. 3, RPA experiments demonstrated that the ⌬ex1A and ⌬ex1B deletion alleles modestly reduce total Prdm1 expression levels in the embryo and yolk sac, respectively. Thus, in ⌬ex1A embryos, total Prdm1 mRNA levels detectable with the exon 4-5 probe are reduced by approximately 50% (Fig. 3B). Similarly, in ⌬ex1B yolk sac samples, alternative exon 1A transcripts are slightly upregulated, but total Prdm1 levels are reduced by approximately 60% (Fig. 3C). Next, we examined Blimp-1 protein expression via Western blot analysis. At E9.5, Blimp-1 expression by ⌬ex1B mice is indistinguishable from wild-type expression whereas ⌬ex1A embryos contain slightly reduced levels of total Blimp-1 protein (Fig. 3D). However, alkaline phosphatase staining revealed only a slight decrease in the numbers of primordial germ cells (Fig. 3F). Similarly, we observed normal patterns of Blimp-1 expression in ⌬ex1A E9.5 placentae (Fig. 3E). In comparison, Prdm1⫹/⫺ heterozygous embryos express reduced levels of the Blimp-1 protein (Fig. 3D) and have roughly half the normal number of migrating primordial germ cells at the early headfold stage but otherwise fail to exhibit any detectable developmental abnormalities (60, 81). Gene dosage effects in ex1A/null compound heterozygotes. To explore possible gene dosage effects, we crossed ⌬ex1A and ⌬ex1B homozygous mutants with Prdm1⫹/null mice (74). We reasoned that further reducing Blimp-1 expression levels in compound heterozygotes could potentially reveal developmental defects. As expected, null/⌬ex1B compound heterozygotes were born at Mendelian ratios (Table 2), exhibited no visible abnormalities, and were fertile. In contrast, null/⌬ex1A animals were underrepresented at weaning. Homozygous null embryos fail to survive beyond E10.5 (60, 81). The null/⌬ex1A embryos

were present at Mendelian ratios at E10.5 but underrepresented beginning at E14.5 (Table 3). We observed a spectrum of developmental abnormalities similar to those described previously for Sox2-Cre rescued and Blimp-1gfp/gfp embryos (67). However, in contrast, here we recovered substantial numbers of live-born null/⌬ex1A animals. Interestingly, many of the surviving compound heterozygotes displayed partially penetrant phenotypic disturbances, including germ cell defects (12 of 13 mice) in both males and females (Fig. 4C to E) and a rudimentary or missing fifth digit of the forelimb (6 of 13 mice) (Fig. 4A and B). ⌬ex1A deletion selectively eliminates Prdm1 function in plasma cells. Mice lacking Prdm1 expression in B cells display defects in antibody production, but these mice are otherwise healthy and fertile (26, 27, 74). In contrast, conditional loss in T cells results in diarrhea, weight loss, and fatal colitis (28, 49). Our ⌬ex1A and ⌬ex1B mice, maintained under specific-pathogen-free conditions, fail to display any overt signs of disease. To evaluate the possibility that alternative promoter usage regulates Prdm1 activities in B cells, we examined ⌬ex1A and ⌬ex1B spleen cells treated ex vivo under conditions that promote terminal B-cell differentiation. Strikingly, RPA experiments demonstrate that LPS-treated ⌬ex1B splenocytes are indistinguishable from wild-type controls whereas, in contrast, ⌬ex1A mutants show a greater than 95% reduction in total mRNA expression levels (Fig. 5A). The mutation results in a loss of exon 1A transcripts and also eliminates alternative transcripts detectable with downstream probes spanning exons 3, 4-5, and 6 (Fig. 5A). Blimp-1 protein levels were also dramatically reduced (Fig. 5B). As predicted for loss of Prdm1 function in B cells (26, 27, 74), ⌬ex1A LPS-stimulated splenocytes also display defective (⬃90% reduced) secreted IgM production (Fig. 5C). The ⌬ex1A deletion also results in markedly reduced levels of mucosal IgA expression on intestinal epithelial cells (Fig. 5D) (26). Thus, we conclude that the ⌬ex1A deletion eliminates Prdm1 function in the B-cell lineage. Next, we tested Prdm1 expression in T lymphocytes and dendritic cells. RPA experiments demonstrate that ⌬ex1A mutant T cells lack exon 1A transcripts and express marginally reduced levels of total Prdm1 mRNA (Fig. 6A). As shown in Fig. 6B, Western blots similarly demonstrate protein expression is downregulated in ⌬ex1A mutant T cells. We also observe reduced mRNA (Fig. 6C) and protein (Fig. 6D) expression by ⌬ex1A BMDCs. In contrast, ⌬ex1B mutant B-, T-, and dendritic-cell populations lack exon 1B transcripts, but total Prdm1 expression levels are indistinguishable from wild-type levels (Fig. 5 and 6). Alternative promoter and first exon located upstream of exon 3 generates a novel transcript that contains intronic sequences. Results above demonstrate upregulated expression of alternative transcripts in ⌬ex1A embryos and ⌬ex1B yolk sacs (Fig. 3B and C). Similarly, ⌬ex1A BMDCs also display elevated expression of alternative exon 1B transcripts (Fig. 7G and H). However, exon 3 expression detectable with an exon 1B-3 probe was only marginally reduced in ⌬ex1A embryos, suggesting that the Prdm1 gene has additional alternative transcriptional start sites (Fig. 7A). To examine this possibility, we performed 5⬘ RACE on E9.5 ⌬ex1A mutant embryos. A novel 5⬘ exon (exon 1C), located in the intron between exon 1A and exon 3 approximately 1.2 kb downstream of exon 1A, was


VOL. 29, 2009

Blimp-1 ALTERNATIVE PROMOTERS

5819

TABLE 3. Genotypes of compound heterozygous intercross progeny Intercross

Prdm1⌬ex1A/⌬ex1A ⫻ Prdml⫹/null

Prdml⌬ex1B/⌬ex1B ⫻ Prdml⫹/null a

Age

No. (%) of progeny with genotype

Total

E10.5 E14.5 Weanlings

⌬ex1A/⫹ 35 (54) 24 (63) 58 (82)

⌬ex1A/null 30 (46) 14 (37)a 13 (18)

65 38 71

Weanlings

⌬ex1B/⫹ 22 (49)

⌬ex1B/null 23 (51)

45

Including two dead (32% live at E14.5).

FIG. 3. Targeted deletion of alternative first exons 1A and 1B marginally affects Prdm1 expression levels. (A) RT-PCR analysis. Primers Ex1AFor and Ex1BFor in combination with Ex3Rev1 demonstrate that ⌬ex1A embryos (e) and yolk sacs (y) lack exon 1A transcripts but express exon 1B. Likewise, the ⌬ex1B deletion results in selective loss of exon 1B transcripts. (B) RPA experiments using the exon 1A-3 probe demonstrate loss of exon 1A transcripts in ⌬ex1A mutant E9.5 embryos, whereas total Prdm1 mRNA expression levels detected with the exon 4-5 probe are moderately reduced. (C) RPA of E9.5 yolk sac RNA demonstrates a reduction in total Prdm1 transcripts in ⌬ex1B yolk sac. (D) Western blot analysis demonstrates that Blimp-1 protein expression levels are marginally reduced in ⌬ex1A/⌬ex1A E9.5 embryos (lane 5) but remain unchanged in ⌬ex1B/⌬ex1B lysates (lane 8). Band intensities were calculated as percentages of those for the wild-type control littermates within each boxed set of samples. SNH fibroblasts are a control for background signal (lanes 1 and 12). The positions of full-length Blimp-1 (Blimp-1FL) and truncated Blimp-1 (Blimp-1T) produced by the Blimp-1gfp allele (67) are indicated. (E) Immunohistochemical analysis using a rabbit polyclonal antibody (22) demonstrates normal Blimp-1 expression in the spongiotrophoblast layer of ⌬ex1A/⌬ex1A E9.5 mutant placentae. (F) Fast red alkaline phosphatase staining of primordial germ cells in the dorsal hindgut at E9.5. ⌬ex1A/⌬ex1A mice have slightly reduced numbers of primordial germ cells relative to wild-type littermates.

Downloaded from http://mcb.asm.org/ on February 13, 2012 by guest

cloned (Fig. 7B, E, and F). RT-PCR and RPA experiments confirmed that exon 1C transcripts are spliced to exon 3 (Fig. 7C and G to K). We also detected 1C transcripts that retain intronic sequences (Fig. 7D). Exon 1C expression is not simply due to aberrant activation of a cryptic promoter caused by the ⌬ex1A deletion, because exon 1C transcripts are present in wild-type LPS-treated spleen cells, activated T cells, and embryonic tissues (Fig. 7C and D). Moreover, the region upstream of exon 1C contains numerous CAGE tags (35, 75) and has been identified as an ancient noncoding element conserved between human and elephant shark (80) (Fig. 7E). NF-␬B signaling selectively regulates exon 1A transcriptional start site. To learn more about the possible underlying mechanism(s) responsible for selective loss of Prdm1 expression caused by the exon 1A deletion in plasma cells, we searched for candidate transcription factor binding sites mapped within this 2.1-kb genomic region. Additionally, we compared conserved binding motifs located near the alternative upstream exon 1B, as well as those located close to the alternative exon 1C transcriptional start site. As shown in Fig. 8A and B, the region surrounding exon 1B displays greater diversity than relatively well-conserved sequences located ad-


5820

MOL. CELL. BIOL.

MORGAN ET AL.

DISCUSSION

FIG. 4. Decreased levels of Prdm1 expression in ⌬ex1/null compound heterozygotes leads to developmental abnormalities. (A) Comparison of ⫹/⌬ex1A and null/⌬ex1A forelimbs. The white arrow indicates the vestigial digit 5. (B) Alcian blue-alizarin red staining of forelimbs demonstrates the absence of bone tissue in digit 5 in the ⌬ex1A/null compound heterozygote. (C) Size comparison of control ⫹/⌬ex1A and null/⌬ex1A testes. (D) Hematoxylin-and-eosin-stained sections reveal that null/⌬ex1A testes lack spermatocytes. (E) Hematoxylin-and-eosin-stained sections reveal that null/⌬ex1A ovaries lack oocytes (arrowheads).

Alternative promoter usage is a prevalent feature of mammalian genome architecture and evolution (4, 8, 34). Alternative promoters located in different genomic regions are often responsible for governing tissue-specific patterns of expression. Alternative first exons may also introduce sequence substitutions that change protein structure and/or influence mRNA stability (13, 38, 69). As many as 58% of mouse genes have alternative promoters (8, 34), but only a handful have been functionally characterized by targeted mutagenesis. Here we demonstrate for the first time that the murine Prdm1 gene uses alternative promoters that share overlapping activities during early development, whereas the previously characterized promoter region selectively functions to drive expression in plasma cells. Revised picture of Prdm1 gene structure. Our 5⬘ RACE experiments have identified an alternative promoter located 70 kb upstream of exon 1A. Thus, the Prdm1 transcription unit spans a much greater genomic distance than previously realized (⬃91 kb versus ⬃23 kb). Exon 1B transcripts are strongly expressed in the yolk sac. This alternative promoter also bears bivalent chromatin modifications in embryonic stem cells. However, our gene targeting experiments unequivocally demonstrate that this alternative first exon is dispensable for nor-

Downloaded from http://mcb.asm.org/ on February 13, 2012 by guest

jacent to the proximal exons 1A and 1C. Indeed, we found multiple transcription factor binding sites tightly clustered together immediately upstream of exon 1A. Besides previously described c-Fos/AP-1 (62) and Pax 5 (41) binding sites, strikingly conserved NF-␬B binding sites are present within the exon 1A deletion. NF-␬B transcription factors are known to function downstream of a wide variety of inflammatory stimuli (54, 64, 65). Blimp-1/Prdm1 was initially cloned as a negative regulator of IFNB1 (beta interferon) expression in virally infected cells (30). To explore this possible relationship and directly test whether NF-␬B is required for activation of Prdm1 expression, we examined wild-type and p50/p65 doubly deficient 3T3 fibroblasts (63) infected with Sendai virus. Results shown in Fig. 9A demonstrate that fibroblasts lacking the NF-␬B subunits p50 and p65 fail to express Prdm1 in response to Sendai virus infection. As in the case of endoplasmic reticulum stress (16), we also found here that Prdm1 induction in response to Sendai virus infection is insensitive to cycloheximide treatment, demonstrating a direct requirement for NF-␬B independent of new protein synthesis (data not shown). Similarly, as shown in Fig. 9B, treatment with NF-␬B inhibitors prevents Prdm1 induction in response to LPS in B-cell lines. Helenalin, which selectively alkylates p65/RelA (46), or BMS341380, which selectively inhibits IKK␤ phosphorylation, both gave indistinguishable results. Thus, we conclude that NF-␬B signaling is required for induction of Prdm1 in response to LPS stimulation. Finally, to demonstrate that NF-␬B binds to the region immediately upstream of exon 1A, we performed ChIP experiments. As shown in Fig. 9C and D, significant levels of p65/RelA binding were detectable in LPS-treated M12 B-lymphoma cells. These results strongly suggest that occupancy of the NF-␬B binding sites upstream of the exon 1A promoter is required for LPSinducible Prdm1 expression.


VOL. 29, 2009

Blimp-1 ALTERNATIVE PROMOTERS

5821

mal development. Thus, mice carrying the ⌬ex1B targeted deletion express wild-type levels of Prdm1. Even in the context of a compound heterozygote, we fail to detect any evidence for developmental defects. The Prdm1 locus is adjacent to a gene desert (57) devoid of known protein-coding information, with the nearest annotated gene, Prep, located approximately 600 kb upstream. Interestingly, the region downstream of exon 1B is more highly conserved than upstream sequences and in all likelihood contains tissue-specific regulatory elements that act at a distance to govern Prdm1 gene expression. We have demonstrated that exon 2, present in the original Prdm1 clone isolated by Turner and coworkers (79), is not normally expressed. Similarly, GenBank EST clones contain exon 1A spliced directly to exon 3. Our analysis of ⌬ex1A deletion mice establishes that the AUG translational start codon present in exon 1A is not required for protein expression. The cluster of in-frame AUG codons in exon 3 is conserved across vertebrates (23, 78). During the course of this study, we discovered an additional first exon (exon 1C)

located in the intron between exon 1A and exon 3. Besides exon 1C transcripts spliced to exon 3, additionally we observe exon 1C transcripts that contain intervening intronic sequences. These alternative transcripts are normally expressed at low levels in diverse cell types, including T cells, B cells, and dendritic cells. Given its evolutionary conservation, it is tempting to speculate that exon 1C may represent an ancient promoter region that has been superseded by the more distal exon 1A promoter. Interestingly, exon 1C transcripts contain two additional upstream in-frame AUG codons. Future experiments will evaluate whether these alternate translational start sites may contribute functional diversity. The revised picture of the Prdm1 gene structure should prove useful for designing experiments aimed at mapping cisacting regulatory elements and comparative studies of the 16 Prdm family members encoded in the mouse genome (17). A closely related family member, Prdm14, is also activated by BMP-Smad signals in prospective primordial germ cells and

FIG. 6. Prdm1 expression by T lymphocytes and BMDCs. (A) RPA experiments demonstrate activated ⌬ex1A T lymphocytes express reduced levels of Prdm1 transcripts. (B) Western blots demonstrate reduced levels of Blimp-1 protein expression by ⌬ex1A T lymphocytes. (C) RPA experiments demonstrate ⌬ex1A BMDCs express reduced levels of Prdm1 transcripts. (D) Western blots demonstrate reduced levels of Blimp-1 protein expression by ⌬ex1A BMDCs.

Downloaded from http://mcb.asm.org/ on February 13, 2012 by guest

FIG. 5. ⌬ex1A deletion disrupts Prdm1 activity in B lymphocytes. (A) RPA experiments demonstrate that LPS-treated ⌬ex1A splenocytes fail to express Prdm1 transcripts. Probes spanning Prdm1 exons 1A-3, 4-5, and 6 detect minimal mRNA expression in ⌬ex1A mutant B cells. (B) Western blot analysis demonstrates near-wild-type levels of the Blimp-1 protein in LPS-treated ⌬ex1B splenocytes. In contrast, ⌬ex1A mutant B cells give an almost undetectable signal. (C) Immunoblotting shows a selective loss of secreted IgM in LPS-treated ⌬ex1A splenocytes relative to levels for wild-type controls. Membrane IgM (␮M), secreted IgM (␮S), and light chain (L) are indicated. (D) Immunohistochemical staining of small intestines for mucosal IgA. Scale bar, 100 ␮M.


5822

MORGAN ET AL.

MOL. CELL. BIOL.

Downloaded from http://mcb.asm.org/ on February 13, 2012 by guest FIG. 7. Alternative promoter usage in ⌬ex1A mice. (A) RPA using exon 1B-3 probe #2. Product for exon 3 alone demonstrates substantial expression of non-exon 1B transcripts in ⌬ex1A mice. (B) Location of exon 1C. The dashed line represents the retained intron. (C) RPA demonstrates that exon 1C spliced to exon 3 transcripts are present in J558L myeloma cells and LPS-stimulated splenocytes. (D) RPA


VOL. 29, 2009

5823

58), and elimination of Pax5 expression is an essential prerequisite for terminal differentiation (41). Mutually exclusive Prdm1 and Pax5 expression involves an autoregulatory feedback loop (41, 52, 71). The conserved Pax5 binding site is located inside the ⌬ex1A deletion (52). Repression of Prdm1 expression also depends on a downstream Bcl-6 binding site (73, 77) and a Bach-2 binding site located near the exon 1A promoter (59). Thus, another, not mutually exclusive interpretation is that the ⌬ex1A deletion causes a change in chromatin architecture and shifts the dynamic positioning of nucleosomes along the locus, which, selectively in the B-cell lineage, leads to sustained silencing and long-term occupancy by these Prdm1 transcriptional repressors. In striking contrast to B cells, ⌬ex1A T cells and BMDCs retain moderate levels of expression. Perhaps assembly of silent chromatin is less tightly controlled in these cell lineages. Alternatively, Prdm1 expression in these cell types may be governed by nonoverlapping, as yet ill-defined cisacting regulatory elements. Consistent with this suggestion, we note with interest the two conserved NFAT binding motifs located immediately upstream of exon 1C. Members of the NFAT family of transcriptional factors associate with different partners to regulate key aspects of T-helper-cell differentiation (47). In T lymphocytes, Prdm1 expression is induced by inflammatory cytokines and in response to receptor signaling (20, 28, 49, 70). Prdm1 regulates T-cell proliferation, survival, homeostasis, and terminal differentiation (28, 49). However, expression does not seem to be restricted to a discrete subset. It will be important to learn how these NFAT binding sites mapped upstream of exon 1C may regulate Prdm1 expression levels and influence T-cell development and function. Prdm1 is induced during macrophage differentiation (9). The present experiments demonstrate for the first time that Prdm1 expression is dramatically upregulated during dendritic-cell maturation. It will be interesting to characterize functional activities of T-lymphocyte and dendritic-cell subsets carrying the ⌬ex1A hypomorphic allele. Regulatory cues controlling alternative promoter usage and expression levels. The ⌬ex1A deletion selectively eliminates expression in plasma cells but only slightly decreases expression in the embryo. In the absence of the basal promoter, alternative promoters compensate and rescue all aspects of embryonic development. Compound heterozygotes also carrying the null allele with further reduced expression levels display a broad spectrum of developmental defects reflecting a generic loss of Prdm1 activities rather than inactivation within any particular expression domain. Thus, in the embryo, Prdm1 alternative promoters seem to regulate overall expression levels as opposed to governing tissue-specific

demonstrates expression of exon 1C transcripts with a retained intron in wild-type E9.5 embryo, yolk sac, placenta, and LPS-treated splenocytes. (E) Representative 5⬘ RACE clone containing exon 1C spliced to exon 3 aligned to the UCSC genome browser (31, 37). CAGE tags are shown as black boxes with white chevrons (35, 75). The location of an ancient conserved noncoding element (80) is indicated by a bracket. (F) Sequence of a representative 5⬘ RACE clone. Exon 1C (underlined in black) is spliced directly to exon 3 (underlined in gray). The arrow indicates the splice junction. The PCR primer annealing site for PCR is underlined in red. In-frame AUG codons are underlined in green. (G and H) RT-PCR (G) and RPA (H) demonstrate that exon 1B and exon 1C transcripts are increased in LPS-treated ⌬ex1A BMDCs relative to the wild type. (I and J) RT-PCR (I) and RPA (J) demonstrate exon 1C spliced transcripts are increased in ⌬ex1A T lymphocytes relative to the wild type. (K) RT-PCR experiments demonstrate upregulation of exon 1B transcripts and loss of exon 1C retained intron transcripts in ⌬ex1A LPS-treated splenocytes.

Downloaded from http://mcb.asm.org/ on February 13, 2012 by guest

plays an essential role in establishment of the germ cell lineage (84). It will be interesting to compare Prdm1 and Prdm14 cis-regulatory sequences controlling gene expression and to engineer knock-in alleles that swap coding information to test for functional redundancy. Exon 1A is selectively required in the B-cell lineage. The ⌬ex1A deletion eliminates Prdm1 expression, required for terminal B-cell differentiation into antibody-secreting cells. The simplest explanation is that this discrete 2.18-kb genomic region contains essential sequences normally bound by key transcription factors upstream of Prdm1. Consistent with this notion, c-Fos/AP-1 binding sites have been mapped to a fragment containing approximately kb ⫺1.3 to ⫺1.0 relative to the exon 1A transcription start site (62). Moreover, c-Fos is known to induce Prdm1 expression in B cells (62). However, c-Fos-deficient B cells still undergo plasmacytic differentiation in response to LPS (62). Thus, c-Fos binding is not essential for Prdm1 expression in B cells. Similarly, previous studies demonstrated that Prdm1 expression is dramatically upregulated in response to viral infection, endoplasmic reticulum stress, cytokine signaling, and inflammatory stimuli (54, 64, 65) and the NF-␬B signaling pathway plays a key role in B-cell development (11, 19, 64). The present experiments demonstrate for the first time that NF-␬B signaling plays a key role in Prdm1 induction. Thus, NF-␬B inhibitors block Prdm1 induction in B cells, and fibroblasts lacking the NF-␬B subunits p50 and p65 fail to express Prdm1 in response to Sendai virus infection. ChIP experiments demonstrate LPS-inducible occupancy of a conserved NF-␬B site upstream of the proximal exon 1A promoter in B cells. The exon 1A deletion encompasses these c-Fos/AP-1 and NF-␬B binding sites as well as conserved Stat sites (15) and may therefore eliminate essential signals required for activation of Prdm1 expression. The exon 1A deletion also removes two highly conserved consensus CTCF binding motifs. The CTCF protein has 11 zinc fingers that display nearly 100% amino acid sequence identity shared among vertebrates (66). Recent genomewide mapping studies demonstrate that roughly half of the CTCF-binding sites mapped far away from genes, consistent with a potential role for these sequences as insulators (33). Only about 20% of CTCF sites are located near transcriptional start sites, and interestingly, as for Prdm1, a common characteristic shared by many of these genes is alternative promoter usage. The CTCF sites upstream of exon 1A are probably involved in organizing higher-order chromatin structure that controls developmentally regulated Prdm1 gene expression. Another well-known Blimp-1 direct target is Pax5. Pax5 is required to establish and maintain B-cell lineage identity (12,

Blimp-1 ALTERNATIVE PROMOTERS


5824

MORGAN ET AL.

MOL. CELL. BIOL.

Downloaded from http://mcb.asm.org/ on February 13, 2012 by guest FIG. 8. The regions surrounding alternative Prdm1 first exons contain different transcription factor binding motifs. The schematic diagrams show the conserved transcription factor binding motifs identified within the regions near exon 1A (A) in comparison with those near exon 1B. (B). DNA sequences conserved between mouse and human were identified using the UCSC genomic browser (http://genome.ucsc.edu/). Sequences were then analyzed with the GenomeNet MOTIF tool (http://motif.genome.jp/) using the TRANSFAC library and a cutoff score of 85. The genomic locus was also manually inspected for conserved sequences not present in the online motif libraries, such as the CACCC (KLF) and CCCTC (CTCF) motifs.

expression patterns. Developmentally regulated Prdm1 expression in the embryo is known to be governed by BMPSmad signaling cues (60), whereas in contrast, Prdm1 expression in different B-cell subpopulations responds to Toll-like receptor–NF-�B pathways (18, 42). Quite different

regulatory cues are likely to control Prdm1 functional activities in diverse cell types. Interestingly, in the skin, Prdm1 mRNA expression was increased in the absence of functional Blimp-1 (48). These results provide evidence for repression via an autoregulatory


VOL. 29, 2009

Blimp-1 ALTERNATIVE PROMOTERS

5825

FIG. 9. NF-␬B sites located upstream of the exon 1A promoter mediate Prdm1 transcriptional activation in response to Toll-like receptor/Nod-like receptor signaling. (A) Prdm1 transcriptional activa-

tion by Sendai virus requires NF-␬B signaling. Steady-state Prdm1 mRNA levels in wild-type (WT) or p50/p65-deficient (KO) 3T3 fibroblasts following infection with Sendai virus, assessed by quantitative RT-PCR, were normalized to beta-2-microglobulin. Results are representative of three independent experiments. (B) Induction of Prdm1 in response to LPS treatment requires NF-␬B. Prdm1 mRNA expression levels by M12 B cells cultured with LPS for 2 h in the presence or absence of NF-␬B inhibitors, helenalin, or BMS341380 were assessed by quantitative RT-PCR. The numbers above the bars indicate the n-fold induction with LPS in comparison with results for uninduced cultures. Representative results of triplicate experiments are shown. (C and D) NF-␬B p65 binds to the Prdm1 exon 1A promoter region in LPS-treated M12 B cells. Association of p65/relA with the Ig␬ intronic enhancer, the prdm1 exon 1A promoter region, or control Prdm1 intron 5 sequences was compared in control and LPS-treated M12 B cells by semiquantitative PCR, Southern blotting, and hybridization (C) or quantitative RT-PCR (D). The dilution for input or immunoprecipitated (IP) chromatin was fourfold (C) or twofold (D), respectively.

Downloaded from http://mcb.asm.org/ on February 13, 2012 by guest

mechanism. Consistent with this idea, conserved Blimp-1 binding sites were characterized within intron 2 (48). Decreased Blimp-1 expression levels may therefore inactivate this negative autoregulatory feedback circuit and allow normally silent alternative promoters to become activated. Our ⌬ex1A and ⌬ex1B mutant strains may be valuable tools for studying the structural basis of these divergent regulatory inputs. Evolution of Prdm1 cis-regulatory elements may require promoter diversification. Prdm1 homologs have been found in many metazoans (17) and play important roles in zebra fish (5, 68), Xenopus (14), Drosophila (1, 55), and sea urchin development (44, 45). Even between Caenorhabditis elegans and humans, the coding sequence of the PR/SET domain and zinc fingers is relatively well conserved (78). However, Prdm1 expression patterns and functional activities show striking species differences. For instance, in mice Prdm1 is essential for placental development and germ cell specification (60, 81). In contrast, in zebra fish Prdm1 controls muscle cell fate (5, 68). Evidence to date strongly argues that these roles are not conserved across vertebrates. Thus, Prdm1 represents an early metazoan gene, having gained novel expression domains and diverse functions through the course of animal evolution. Interestingly, Prdm1 first exon usage varies widely among vertebrates. A survey of Xenopus tropicalis GenBank ESTs using the UCSC genome browser shows a single clone initiated at the genomic region homologous to mouse exon 1A (accession no. CR414136). There are four Xenopus clones (accession no. CF784176, CR432771, CR417246, and AL649398) that initiate at an alternative first exon approximately 4 kb upstream of Xenopus exon 1, corresponding to a region approximately 8.5 kb upstream of exon 1A in mouse. The zebra fish ESTs all start at the same first exon. However, this promoter region shares no homology with sequences in the mouse genome. Similarly, alternative promoter regions found in sea urchin (44, 45) share no homology with mouse alternative exon 1A, 1B, or 1C. Considerable evidence demonstrates that motif-specific enhancer-promoter interactions regulate gene expression patterns (7). It seems likely that evolutionary changes in Prdm1 expression patterns involve not only changes in enhancer sequences but also changes in the


5826

MORGAN ET AL.

promoter motifs with which they interact. Thus, the emergence of alternative promoters may mark the beginnings of new functions for this old gene. ACKNOWLEDGMENTS We thank Ayesha Islam and Stephane Vincent for initial characterization of exon 1B transcripts, Chad Koonce for assistance with gene targeting in ES cells, and Carol Paterson and Emily Lejsek for blastocyst injections and genotyping assistance. We thank Reuben Tooze and Lynn Corcoran for generously providing rabbit polyclonal and rat monoclonal Blimp-1 antibodies, respectively. This work was supported by a program grant from the Wellcome Trust. REFERENCES

19. Ghosh, S., M. J. May, and E. B. Kopp. 1998. NF-kappa B and Rel proteins: evolutionarily conserved mediators of immune responses. Annu. Rev. Immunol. 16:225–260. 20. Gong, D., and T. R. Malek. 2007. Cytokine-dependent Blimp-1 expression in activated T cells inhibits IL-2 production. J. Immunol. 178:242–252. 21. Gyory, I., G. Fejer, N. Ghosh, E. Seto, and K. L. Wright. 2003. Identification of a functionally impaired positive regulatory domain I binding factor 1 transcription repressor in myeloma cell lines. J. Immunol. 170:3125–3133. 22. Horsley, V., D. O’Carroll, R. Tooze, Y. Ohinata, M. Saitou, T. Obukhanych, M. Nussenzweig, A. Tarakhovsky, and E. Fuchs. 2006. Blimp1 defines a progenitor population that governs cellular input to the sebaceous gland. Cell 126:597–609. 23. Huang, S. 1994. Blimp-1 is the murine homolog of the human transcriptional repressor PRDI-BF1. Cell 78:9. 24. Inaba, K., M. Inaba, N. Romani, H. Aya, M. Deguchi, S. Ikehara, S. Muramatsu, and R. M. Steinman. 1992. Generation of large numbers of dendritic cells from mouse bone marrow cultures supplemented with granulocyte/ macrophage colony-stimulating factor. J. Exp. Med. 176:1693–1702. 25. Johnson, K., C. Angelin-Duclos, S. Park, and K. L. Calame. 2003. Changes in histone acetylation are associated with differences in accessibility of V(H) gene segments to V-DJ recombination during B-cell ontogeny and development. Mol. Cell. Biol. 23:2438–2450. 26. Kallies, A., J. Hasbold, K. Fairfax, C. Pridans, D. Emslie, B. S. McKenzie, A. M. Lew, L. M. Corcoran, P. D. Hodgkin, D. M. Tarlinton, and S. L. Nutt. 2007. Initiation of plasma-cell differentiation is independent of the transcription factor Blimp-1. Immunity 26:555–566. 27. Kallies, A., J. Hasbold, D. M. Tarlinton, W. Dietrich, L. M. Corcoran, P. D. Hodgkin, and S. L. Nutt. 2004. Plasma cell ontogeny defined by quantitative changes in blimp-1 expression. J. Exp. Med. 200:967–977. 28. Kallies, A., E. D. Hawkins, G. T. Belz, D. Metcalf, M. Hommel, L. M. Corcoran, P. D. Hodgkin, and S. L. Nutt. 2006. Transcriptional repressor Blimp-1 is essential for T cell homeostasis and self-tolerance. Nat. Immunol. 7:466–474. 29. Kawai, J., A. Shinagawa, K. Shibata, M. Yoshino, M. Itoh, Y. Ishii, T. Arakawa, A. Hara, Y. Fukunishi, H. Konno, J. Adachi, S. Fukuda, K. Aizawa, M. Izawa, K. Nishi, H. Kiyosawa, S. Kondo, I. Yamanaka, T. Saito, Y. Okazaki, T. Gojobori, H. Bono, T. Kasukawa, R. Saito, K. Kadota, H. Matsuda, M. Ashburner, S. Batalov, T. Casavant, W. Fleischmann, T. Gaasterland, C. Gissi, B. King, H. Kochiwa, P. Kuehl, S. Lewis, Y. Matsuo, I. Nikaido, G. Pesole, J. Quackenbush, L. M. Schriml, F. Staubli, R. Suzuki, M. Tomita, L. Wagner, T. Washio, K. Sakai, T. Okido, M. Furuno, H. Aono, R. Baldarelli, G. Barsh, J. Blake, D. Boffelli, N. Bojunga, P. Carninci, M. F. de Bonaldo, M. J. Brownstein, C. Bult, C. Fletcher, M. Fujita, M. Gariboldi, S. Gustincich, D. Hill, M. Hofmann, D. A. Hume, M. Kamiya, N. H. Lee, P. Lyons, L. Marchionni, J. Mashima, J. Mazzarelli, P. Mombaerts, P. Nordone, B. Ring, M. Ringwald, I. Rodriguez, N. Sakamoto, H. Sasaki, K. Sato, C. Schonbach, T. Seya, Y. Shibata, K. F. Storch, H. Suzuki, K. Toyo-oka, K. H. Wang, C. Weitz, C. Whittaker, L. Wilming, A. Wynshaw-Boris, K. Yoshida, Y. Hasegawa, H. Kawaji, S. Kohtsuki, and Y. Hayashizaki. 2001. Functional annotation of a full-length mouse cDNA collection. Nature 409: 685–690. 30. Keller, A. D., and T. Maniatis. 1991. Identification and characterization of a novel repressor of beta-interferon gene expression. Genes Dev. 5:868–879. 31. Kent, W. J. 2002. BLAT—the BLAST-like alignment tool. Genome Res. 12:656–664. 32. Kim, K. J., C. Kanellopoulos-Langevin, R. M. Merwin, D. H. Sachs, and R. Asofsky. 1979. Establishment and characterization of BALB/c lymphoma lines with B cell properties. J. Immunol. 122:549–554. 33. Kim, T. H., Z. K. Abdullaev, A. D. Smith, K. A. Ching, D. I. Loukinov, R. D. Green, M. Q. Zhang, V. V. Lobanenkov, and B. Ren. 2007. Analysis of the vertebrate insulator protein CTCF-binding sites in the human genome. Cell 128:1231–1245. 34. Kimura, K., A. Wakamatsu, Y. Suzuki, T. Ota, T. Nishikawa, R. Yamashita, J. Yamamoto, M. Sekine, K. Tsuritani, H. Wakaguri, S. Ishii, T. Sugiyama, K. Saito, Y. Isono, R. Irie, N. Kushida, T. Yoneyama, R. Otsuka, K. Kanda, T. Yokoi, H. Kondo, M. Wagatsuma, K. Murakawa, S. Ishida, T. Ishibashi, A. Takahashi-Fujii, T. Tanase, K. Nagai, H. Kikuchi, K. Nakai, T. Isogai, and S. Sugano. 2006. Diversification of transcriptional modulation: largescale identification and characterization of putative alternative promoters of human genes. Genome Res. 16:55–65. 35. Kodzius, R., M. Kojima, H. Nishiyori, M. Nakamura, S. Fukuda, M. Tagami, D. Sasaki, K. Imamura, C. Kai, M. Harbers, Y. Hayashizaki, and P. Carninci. 2006. CAGE: cap analysis of gene expression. Nat. Methods 3:211–222. 36. Ku, M., R. P. Koche, E. Rheinbay, E. M. Mendenhall, M. Endoh, T. S. Mikkelsen, A. Presser, C. Nusbaum, X. Xie, A. S. Chi, M. Adli, S. Kasif, L. M. Ptaszek, C. A. Cowan, E. S. Lander, H. Koseki, and B. E. Bernstein. 2008. Genomewide analysis of PRC1 and PRC2 occupancy identifies two classes of bivalent domains. PLoS Genet. 4:e1000242. 37. Kuhn, R. M., D. Karolchik, A. S. Zweig, T. Wang, K. E. Smith, K. R. Rosenbloom, B. Rhead, B. J. Raney, A. Pohl, M. Pheasant, L. Meyer, F. Hsu, A. S. Hinrichs, R. A. Harte, B. Giardine, P. Fujita, M. Diekhans, T. Dreszer, H. Clawson, G. P. Barber, D. Haussler, and W. J. Kent. 2009. The UCSC

Downloaded from http://mcb.asm.org/ on February 13, 2012 by guest

1. Agawa, Y., M. Sarhan, Y. Kageyama, K. Akagi, M. Takai, K. Hashiyama, T. Wada, H. Handa, A. Iwamatsu, S. Hirose, and H. Ueda. 2007. Drosophila Blimp-1 is a transient transcriptional repressor that controls timing of the ecdysone-induced developmental pathway. Mol. Cell. Biol. 27:8739–8747. 2. Arnold, S. J., S. Maretto, A. Islam, E. K. Bikoff, and E. J. Robertson. 2006. Dose-dependent Smad1, Smad5 and Smad8 signaling in the early mouse embryo. Dev. Biol. 296:104–118. 3. Azuara, V., P. Perry, S. Sauer, M. Spivakov, H. F. Jorgensen, R. M. John, M. Gouti, M. Casanova, G. Warnes, M. Merkenschlager, and A. G. Fisher. 2006. Chromatin signatures of pluripotent cell lines. Nat. Cell Biol. 8:532–538. 4. Baek, D., C. Davis, B. Ewing, D. Gordon, and P. Green. 2007. Characterization and predictive discovery of evolutionarily conserved mammalian alternative promoters. Genome Res. 17:145–155. 5. Baxendale, S., C. Davison, C. Muxworthy, C. Wolff, P. W. Ingham, and S. Roy. 2004. The B-cell maturation factor Blimp-1 specifies vertebrate slowtwitch muscle fiber identity in response to Hedgehog signaling. Nat. Genet. 36:88–93. 6. Bernstein, B. E., T. S. Mikkelsen, X. Xie, M. Kamal, D. J. Huebert, J. Cuff, B. Fry, A. Meissner, M. Wernig, K. Plath, R. Jaenisch, A. Wagschal, R. Feil, S. L. Schreiber, and E. S. Lander. 2006. A bivalent chromatin structure marks key developmental genes in embryonic stem cells. Cell 125:315–326. 7. Butler, J. E., and J. T. Kadonaga. 2001. Enhancer-promoter specificity mediated by DPE or TATA core promoter motifs. Genes Dev. 15:2515–2519. 8. Carninci, P., A. Sandelin, B. Lenhard, S. Katayama, K. Shimokawa, J. Ponjavic, C. A. Semple, M. S. Taylor, P. G. Engstrom, M. C. Frith, A. R. Forrest, W. B. Alkema, S. L. Tan, C. Plessy, R. Kodzius, T. Ravasi, T. Kasukawa, S. Fukuda, M. Kanamori-Katayama, Y. Kitazume, H. Kawaji, C. Kai, M. Nakamura, H. Konno, K. Nakano, S. Mottagui-Tabar, P. Arner, A. Chesi, S. Gustincich, F. Persichetti, H. Suzuki, S. M. Grimmond, C. A. Wells, V. Orlando, C. Wahlestedt, E. T. Liu, M. Harbers, J. Kawai, V. B. Bajic, D. A. Hume, and Y. Hayashizaki. 2006. Genome-wide analysis of mammalian promoter architecture and evolution. Nat. Genet. 38:626–635. 9. Chang, D. H., C. Angelin-Duclos, and K. Calame. 2000. BLIMP-1: trigger for differentiation of myeloid lineage. Nat. Immunol. 1:169–176. 10. Chang, D. H., G. Cattoretti, and K. L. Calame. 2002. The dynamic expression pattern of B lymphocyte induced maturation protein-1 (Blimp-1) during mouse embryonic development. Mech. Dev. 117:305–309. 11. Chen, L. F., and W. C. Greene. 2004. Shaping the nuclear action of NF-␬B. Nat. Rev. Mol. Cell Biol. 5:392–401. 12. Cobaleda, C., A. Schebesta, A. Delogu, and M. Busslinger. 2007. Pax5: the guardian of B cell identity and function. Nat. Immunol. 8:463–470. 13. Davuluri, R. V., Y. Suzuki, S. Sugano, C. Plass, and T. H. Huang. 2008. The functional consequences of alternative promoter use in mammalian genomes. Trends Genet. 24:167–177. 14. de Souza, F. S., V. Gawantka, A. P. Gomez, H. Delius, S. L. Ang, and C. Niehrs. 1999. The zinc finger gene Xblimp1 controls anterior endomesodermal cell fate in Spemann’s organizer. EMBO J. 18:6062–6072. 15. Diehl, S. A., H. Schmidlin, M. Nagasawa, S. D. van Haren, M. J. Kwakkenbos, E. Yasuda, T. Beaumont, F. A. Scheeren, and H. Spits. 2008. STAT3mediated up-regulation of BLIMP1 is coordinated with BCL6 down-regulation to control human plasma cell differentiation. J. Immunol. 180:4805– 4815. 16. Doody, G. M., S. Stephenson, and R. M. Tooze. 2006. BLIMP-1 is a target of cellular stress and downstream of the unfolded protein response. Eur. J. Immunol. 36:1572–1582. 17. Fumasoni, I., N. Meani, D. Rambaldi, G. Scafetta, M. Alcalay, and F. D. Ciccarelli. 2007. Family expansion and gene rearrangements contributed to the functional specialization of PRDM genes in vertebrates. BMC Evol. Biol. 7:187. 18. Genestier, L., M. Taillardet, P. Mondiere, H. Gheit, C. Bella, and T. Defrance. 2007. TLR agonists selectively promote terminal plasma cell differentiation of B cell subsets specialized in thymus-independent responses. J. Immunol. 178:7779–7786.

MOL. CELL. BIOL.


VOL. 29, 2009

38.

39.

40.

41.

42.

44.

45.

46.

47. 48.

49.

50.

51.

52.

53.

54.

55.

56.

57. 58.

59.

60.

61.

5827

62. Ohkubo, Y., M. Arima, E. Arguni, S. Okada, K. Yamashita, S. Asari, S. Obata, A. Sakamoto, M. Hatano, J. O-Wang, M. Ebara, H. Saisho, and T. Tokuhisa. 2005. A role for c-fos/activator protein 1 in B lymphocyte terminal differentiation. J. Immunol. 174:7703–7710. 63. Ouaaz, F., J. Arron, Y. Zheng, Y. Choi, and A. A. Beg. 2002. Dendritic cell development and survival require distinct NF-␬B subunits. Immunity 16: 257–270. 64. Pahl, H. L. 1999. Activators and target genes of Rel/NF-␬B transcription factors. Oncogene 18:6853–6866. 65. Perkins, N. D. 2007. Integrating cell-signalling pathways with NF-␬B and IKK function. Nat. Rev. Mol. Cell Biol. 8:49–62. 66. Phillips, J. E., and V. G. Corces. 2009. CTCF: master weaver of the genome. Cell 137:1194–1211. 67. Robertson, E. J., I. Charatsi, C. J. Joyner, C. H. Koonce, M. Morgan, A. Islam, C. Paterson, E. Lejsek, S. J. Arnold, A. Kallies, S. L. Nutt, and E. K. Bikoff. 2007. Blimp1 regulates development of the posterior forelimb, caudal pharyngeal arches, heart and sensory vibrissae in mice. Development 134: 4335–4345. 68. Roy, S., C. Wolff, and P. W. Ingham. 2001. The u-boot mutation identifies a Hedgehog-regulated myogenic switch for fiber-type diversification in the zebrafish embryo. Genes Dev. 15:1563–1576. 69. Sandelin, A., P. Carninci, B. Lenhard, J. Ponjavic, Y. Hayashizaki, and D. A. Hume. 2007. Mammalian RNA polymerase II core promoters: insights from genome-wide studies. Nat. Rev. Genet. 8:424–436. 70. Santner-Nanan, B., F. Berberich-Siebelt, Z. Xiao, N. Poser, H. Seennefelder, S. Rauthe, D. S. Vallabhapurapu, I. Berberich, A. Schimpl, and H. W. Kreth. 2006. Blimp-1 is expressed in human and mouse T cell subsets and leads to loss of IL-2 production and to defective proliferation. Signal Transduct. 6:268–279. 71. Shaffer, A. L., K. I. Lin, T. C. Kuo, X. Yu, E. M. Hurt, A. Rosenwald, J. M. Giltnane, L. Yang, H. Zhao, K. Calame, and L. M. Staudt. 2002. Blimp-1 orchestrates plasma cell differentiation by extinguishing the mature B cell gene expression program. Immunity 17:51–62. 72. Shaffer, A. L., A. Peng, and M. S. Schlissel. 1997. In vivo occupancy of the kappa light chain enhancers in primary pro- and pre-B cells: a model for kappa locus activation. Immunity 6:131–143. 73. Shaffer, A. L., X. Yu, Y. He, J. Boldrick, E. P. Chan, and L. M. Staudt. 2000. BCL-6 represses genes that function in lymphocyte differentiation, inflammation, and cell cycle control. Immunity 13:199–212. 74. Shapiro-Shelef, M., K. I. Lin, L. J. McHeyzer-Williams, J. Liao, M. G. McHeyzer-Williams, and K. Calame. 2003. Blimp-1 is required for the formation of immunoglobulin secreting plasma cells and pre-plasma memory B cells. Immunity 19:607–620. 75. Shiraki, T., S. Kondo, S. Katayama, K. Waki, T. Kasukawa, H. Kawaji, R. Kodzius, A. Watahiki, M. Nakamura, T. Arakawa, S. Fukuda, D. Sasaki, A. Podhajska, M. Harbers, J. Kawai, P. Carninci, and Y. Hayashizaki. 2003. Cap analysis gene expression for high-throughput analysis of transcriptional starting point and identification of promoter usage. Proc. Natl. Acad. Sci. USA 100:15776–15781. 76. Soriano, P. 1997. The PDGF alpha receptor is required for neural crest cell development and for normal patterning of the somites. Development 124: 2691–2700. 77. Tunyaplin, C., A. L. Shaffer, C. D. Angelin-Duclos, X. Yu, L. M. Staudt, and K. L. Calame. 2004. Direct repression of prdm1 by Bcl-6 inhibits plasmacytic differentiation. J. Immunol. 173:1158–1165. 78. Tunyaplin, C., M. A. Shapiro, and K. L. Calame. 2000. Characterization of the B lymphocyte-induced maturation protein-1 (Blimp-1) gene, mRNA isoforms and basal promoter. Nucleic Acids Res. 28:4846–4855. 79. Turner, C. A., Jr., D. H. Mack, and M. M. Davis. 1994. Blimp-1, a novel zinc finger-containing protein that can drive the maturation of B lymphocytes into immunoglobulin-secreting cells. Cell 77:297–306. 80. Venkatesh, B., E. F. Kirkness, Y. H. Loh, A. L. Halpern, A. P. Lee, J. Johnson, N. Dandona, L. D. Viswanathan, A. Tay, J. C. Venter, R. L. Strausberg, and S. Brenner. 2006. Ancient noncoding elements conserved in the human genome. Science 314:1892. 81. Vincent, S. D., N. R. Dunn, R. Sciammas, M. Shapiro-Shalef, M. M. Davis, K. Calame, E. K. Bikoff, and E. J. Robertson. 2005. The zinc finger transcriptional repressor Blimp1/Prdm1 is dispensable for early axis formation but is required for specification of primordial germ cells in the mouse. Development 132:1315–1325. 82. Vokes, S. A., H. Ji, W. H. Wong, and A. P. McMahon. 2008. A genome-scale analysis of the cis-regulatory circuitry underlying sonic hedgehog-mediated patterning of the mammalian limb. Genes Dev. 22:2651–2663. 83. Wang, D., L. Zhuang, B. Gao, C. X. Shi, J. Cheung, M. Liu, T. Jin, and X. Y. Wen. 2008. The Blimp-1 gene regulatory region directs EGFP expression in multiple hematopoietic lineages and testis in mice. Transgenic Res. 17:193– 203. 84. Yamaji, M., Y. Seki, K. Kurimoto, Y. Yabuta, M. Yuasa, M. Shigeta, K. Yamanaka, Y. Ohinata, and M. Saitou. 2008. Critical function of Prdm14 for the establishment of the germ cell lineage in mice. Nat. Genet. 40:1016–1022.

Downloaded from http://mcb.asm.org/ on February 13, 2012 by guest

43.

Genome Browser Database: update 2009. Nucleic Acids Res. 37:D755– D761. Landry, J. R., D. L. Mager, and B. T. Wilhelm. 2003. Complex controls: the role of alternative promoters in mammalian genomes. Trends Genet. 19: 640–648. Lawson, K. A., N. R. Dunn, B. A. Roelen, L. M. Zeinstra, A. M. Davis, C. V. Wright, J. P. Korving, and B. L. Hogan. 1999. Bmp4 is required for the generation of primordial germ cells in the mouse embryo. Genes Dev. 13:424–436. Lee, B. C., and S. Roy. 2006. Blimp-1 is an essential component of the genetic program controlling development of the pectoral limb bud. Dev. Biol. 300: 623–634. Lin, K. I., C. Angelin-Duclos, T. C. Kuo, and K. Calame. 2002. Blimp-1dependent repression of Pax-5 is required for differentiation of B cells to immunoglobulin M-secreting plasma cells. Mol. Cell. Biol. 22:4771–4780. Lin, K. I., Y. Y. Kao, H. K. Kuo, W. B. Yang, A. Chou, H. H. Lin, A. L. Yu, and C. H. Wong. 2006. Reishi polysaccharides induce immunoglobulin production through the TLR4/TLR2-mediated induction of transcription factor Blimp-1. J. Biol. Chem. 281:24111–24123. Lin, Y., K. Wong, and K. Calame. 1997. Repression of c-myc transcription by Blimp-1, an inducer of terminal B cell differentiation. Science 276:596–599. Livi, C. B., and E. H. Davidson. 2006. Expression and function of blimp1/ krox, an alternatively transcribed regulatory gene of the sea urchin endomesoderm network. Dev. Biol. 293:513–525. Livi, C. B., and E. H. Davidson. 2007. Regulation of spblimp1/krox1a, an alternatively transcribed isoform expressed in midgut and hindgut of the sea urchin gastrula. Gene Expr. Patterns 7:1–7. Lyss, G., A. Knorre, T. J. Schmidt, H. L. Pahl, and I. Merfort. 1998. The anti-inflammatory sesquiterpene lactone helenalin inhibits the transcription factor NF-␬B by directly targeting p65. J. Biol. Chem. 273:33508–33516. Macian, F. 2005. NFAT proteins: key regulators of T-cell development and function. Nat. Rev. Immunol. 5:472–484. Magnusdottir, E., S. Kalachikov, K. Mizukoshi, D. Savitsky, A. IshidaYamamoto, A. A. Panteleyev, and K. Calame. 2007. Epidermal terminal differentiation depends on B lymphocyte-induced maturation protein-1. Proc. Natl. Acad. Sci. USA 104:14988–14993. Martins, G. A., L. Cimmino, M. Shapiro-Shelef, M. Szabolcs, A. Herron, E. Magnusdottir, and K. Calame. 2006. Transcriptional repressor Blimp-1 regulates T cell homeostasis and function. Nat. Immunol. 7:457–465. Mikkelsen, T. S., M. Ku, D. B. Jaffe, B. Issac, E. Lieberman, G. Giannoukos, P. Alvarez, W. Brockman, T. K. Kim, R. P. Koche, W. Lee, E. Mendenhall, A. O’Donovan, A. Presser, C. Russ, X. Xie, A. Meissner, M. Wernig, R. Jaenisch, C. Nusbaum, E. S. Lander, and B. E. Bernstein. 2007. Genomewide maps of chromatin state in pluripotent and lineage-committed cells. Nature 448:553–560. Mora-Lopez, F., N. Pedreno-Horrillo, L. Delgado-Perez, J. A. Brieva, and A. Campos-Caro. 2008. Transcription of PRDM1, the master regulator for plasma cell differentiation, depends on an SP1/SP3/EGR-1 GC-box. Eur. J. Immunol. 38:2316–2324. Mora-Lopez, F., E. Reales, J. A. Brieva, and A. Campos-Caro. 2007. Human BSAP and BLIMP1 conform an autoregulatory feedback loop. Blood 110: 3150–3157. Nagy, A., M. Gertenstein, K. Vinterstein, and R. Behringer. 2003. Manipulating the mouse embryo: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Natoli, G., S. Saccani, D. Bosisio, and I. Marazzi. 2005. Interactions of NF-␬B with chromatin: the art of being at the right place at the right time. Nat. Immunol. 6:439–445. Ng, T., F. Yu, and S. Roy. 2006. A homologue of the vertebrate SET domain and zinc finger protein Blimp-1 regulates terminal differentiation of the tracheal system in the Drosophila embryo. Dev. Genes Evol. 216:243–252. Niwa, H., K. Yamamura, and J. Miyazaki. 1991. Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 108:193– 199. Nobrega, M. A., I. Ovcharenko, V. Afzal, and E. M. Rubin. 2003. Scanning human gene deserts for long-range enhancers. Science 302:413. Nutt, S. L., B. Heavey, A. G. Rolink, and M. Busslinger. 1999. Commitment to the B-lymphoid lineage depends on the transcription factor Pax5. Nature 401:556–562. Ochiai, K., Y. Katoh, T. Ikura, Y. Hoshikawa, T. Noda, H. Karasuyama, S. Tashiro, A. Muto, and K. Igarashi. 2006. Plasmacytic transcription factor Blimp-1 is repressed by Bach2 in B cells. J. Biol. Chem. 281:38226–38234. Ohinata, Y., B. Payer, D. O’Carroll, K. Ancelin, Y. Ono, M. Sano, S. C. Barton, T. Obukhanych, M. Nussenzweig, A. Tarakhovsky, M. Saitou, and M. A. Surani. 2005. Blimp1 is a critical determinant of the germ cell lineage in mice. Nature 436:207–213. Ohinata, Y., M. Sano, M. Shigeta, K. Yamanaka, and M. Saitou. 2008. A comprehensive, non-invasive visualization of primordial germ cell development in mice by the Prdm1-mVenus and Dppa3-ECFP double transgenic reporter. Reproduction 136:503–514.

Blimp-1 ALTERNATIVE PROMOTERS

Profile for magnusdottir

Morgan et al 2009 blimp 1prdm1 alternative promoter usage during mouse development and plasma cell d  

Morgan et al 2009 blimp 1prdm1 alternative promoter usage during mouse development and plasma cell d  

Advertisement