Page 1


1 Introducción ¿Qué es un ser vivo? Religión Religión

Filosofía Filosofía Ciencia Ciencia

Física Física

Química Química

Biología Biología

“Sistema que se vale de un entorno para conseguir su perpetuación y reproducción”


Otra definición un poco más completa, también desde un punto de vista científico:

Un ser vivo es un conjunto de átomos y moléculas que forman una estructura material muy organizada y compleja, en la que intervienen sistemas de comunicación molecular, que se relaciona con el ambiente con un intercambio de materia y energía de una forma ordenada y que tiene la capacidad de desempeñar las funciones básicas de la vida que son la nutrición, el crecimiento, la relación y a ser posible la reproducción, de tal manera que los seres vivos actúan y funcionan por sí mismos sin perder su nivel estructural hasta su muerte.


El origen de la vida 1. Los textos religiosos (Biblia, Corán, etc.) exponen una intervención divina en la creación de la vida, pero no explican ni corresponde a este tipo de textos explicar cómo se ha originado la materia viva, ya que esto sólo corresponde al ámbito de los textos científicos.

2. No corresponde a la ciencia negar o afirmar una creencia. A la ciencia le corresponde proponer explicaciones basadas en las leyes naturales de la física y de la química.


多Es cierto que venimos del mono?


驴De d贸nde venimos?


Charles Darwin (1809 – 1882), el “padre” de la Teoría de la Evolución por Selección Natural


2 El origen de la vida ÂżTe has hecho preguntas como estas?

ÂżCĂłmo han surgido los seres vivos que nos rodean?


¿Cómo han surgido los seres vivos que nos rodean? ¿Cómo se originó la vida?


¿Cómo han surgido los seres vivos que nos rodean? ¿Cómo se originó la vida? ¿Cómo hemos surgido nosotros?

Estas preguntas han estado en la mente humana desde nuestro mismo origen. Las religiones, la filosofía y la ciencia han compartido estas inquietudes.


Según la mayoría de las religiones, la vida tiene un origen sobrenatural en el que no intervienen reacciones físico-químicas de ningún tipo, ya que todo lo que existe ha sido creado por uno o varios dioses.

Esta tesis recibe el nombre de creacionismo.

Por su parte, los científicos han aportado a lo largo de la historia diferentes explicaciones acerca del origen de los seres vivos.


Primeras Primerasideas ideassobre sobreelelorigen origende delalavida vidase sedeben debenaalos losantiguos antiguosgriegos griegos que queargumentaban argumentaban dos dosteorías: teorías:unos unossuponían suponíanque quelalavida vidahabía habíaaparecido aparecidoen enlalaTierra Tierrayyhabía habíaido idocambiando cambiando posteriormente; posteriormente;otros otrospensaban pensabanque quese seformaba formabaconstantemente constantementeen enelelplaneta. planeta.Esta Estaúltima última idea ideaconstituyó constituyóelelgermen germende delalateoría teoríade delalageneración generaciónespontánea, espontánea,según segúnlalacual cuallalavida vida puede puedesurgir surgirdel dellodo, lodo,del delagua, agua,del delmar maroode delas lascombinaciones combinacionesde delos loscuatro cuatroelementos elementos . fundamentales: fundamentales:aire, aire,agua, agua,fuego fuegoyytierra, tierra,oode decualquier cualquiersustancia sustanciainerte inerte

Anaximándro: Anaximándro: Primeras Primeras ideas ideas de de evolución evolución referida referida aa los los seres seres vivos: vivos: los los primeros primeros animales animales habrían habrían aparecido aparecido en en elel agua agua para para pasar pasar luego luegoaatierra tierrafirme. firme.Se Semostraba mostraba partidario partidario de de que que elel hombre hombre había había nacido nacido de de una una criatura criatura diferente diferente

Teorías Teorías

Heráclito Heráclitode de Efeso: Efeso:Afirmaba Afirmaba que quetoda todaexistencia existencia está estáen encontinuo continuo cambio. cambio.

Aristóteles: Aristóteles: Generación Generación espontanea espontanea aa partir partirdel delagua, agua,aire, aire,fuego fuegoyytierra. tierra.


Teoría de la generación espontanea La vida puede surgir del lodo, de las aguas estancadas…

Aristóteles

Desde DesdelalaAntigüedad Antigüedadhasta hastalos losestudios estudios de de Pasteur Pasteur estuvo estuvo muy muy extendida extendida lala idea ideade deque quelalavida vidanacía nacíade delalamateria materia en en descomposición, descomposición, es es decir decir por por generación generación espontánea, espontánea,de de lala nada. nada. La La teoría teoría se se mantuvo mantuvo durante durante siglos. siglos. Sin Sin embargo, embargo, lala evolución evolución de de lala ciencia ciencia terminó por demostrar elel terminó por demostrar planteamiento planteamientoerróneo erróneode delalamisma. misma.


Estas ideas que hoy día nos parecen tan extrañas o incluso cómicas, se basaban en observaciones como esta: si dejamos, por ejemplo, trozos de carne, al cabo de unos días “salen gusanos”. Esos gusanos aparecerían ahí solos, espontáneamente.

Otros argumentos a favor de esta teoría son Receta de Van Helmont: "Basta colocar ropa sucia en un tonel, que contenga además unos pocos granos de trigo, y al cabo de 21 días aparecerán ratones“ Experimentos de John Needham: En 1745 hirvió trozos de carne para destruir los organismos preexistentes y los colocó en un recipiente que no estaba lo debidamente bien sellado ya que según su teoría, se necesitaba aire para que esto se llevara a cabo. Al cabo de un tiempo observó colonias de microorganismos sobre la superficie y concluyó que se generaban espontáneamente a partir de la materia no viva.


La receta de Van Helmont En 1667, el médico Jan B. van Helmont propuso una receta que permitía la generación espontánea de ratones:

Jan B. van Helmont

Los piojos, garrapatas, pulgas y gusanos nacen de nuestras entrañas y excrementos. Si colocamos ropa interior llena de sudor junto con trigo en un recipiente de boca ancha, al cabo de 21 días el olor cambia y penetra a través de las cáscaras del trigo, cambiando el trigo por ratones. Estos ratones son de ambos sexos y se pueden cruzar con ratones que hayan surgido de manera normal.


PRUEBAS PRUEBASEN ENCONTRA CONTRADELA DELAGENERACIÓN GENERACIÓNESPONTÁNEA ESPONTÁNEA Experimentos de Spallanzani Refutó los realizados por el sacerdote católico inglés John Needham. Prolongando el periodo de calentamiento y sellando con más cuidado los recipientes, Spallanzani pudo demostrar que en los caldos no se generaban microorganismos mientras los recipientes estuvieran sellados. La disputa entre Needham y Spallanzani fue larga y enconada, pues el inglés afirmaba que las cocciones del italiano destruían el espíritu vital


Experimentos de Redi Francesco Redi, un médico italiano, realizó en el siglo XVII el siguiente experimento: Frasco abierto

Carne

Frasco tapado con una gasa

Carne

Frasco cerrado herméticamente

Carne

Aquí aparecen huevos de mosca Aparecen gusanos

No aparecen gusanos

¿Qué conclusión sacas de este experimento?


Como habrás podido deducir del resultado obtenido por Redi en su experimento, los gusanos sólo aparecen en la carne si entra en contacto con las moscas, que depositan en ella los huevos a partir de los cuales se desarrollan las larvas, que son los “gusanos”.

Lucilia caesar

Sarcophaga carnaria

Mosca (adulto) Calliphora vomitoria

Musca domestica Son varias las especies de moscas cuyas larvas pueden alimentarse de carne.

Larva de la mosca (“gusano”)

Con este sencillo experimento Redi demostró que la vida sólo puede surgir de vida preexistente.


La teoría según la cual la vida sólo puede originarse a partir de vida se conoce como biogénesis.


PRUEBAS PRUEBASEN ENCONTRA CONTRADELA DELAGENERACIÓN GENERACIÓNESPONTÁNEA ESPONTÁNEA Los alemanes Schleiden y Schwann presentan en 1838 la idea de que todos los seres vivos están formados por células, provocando así el nacimiento de lo que mas tarde habría de llamarse "teoría celular", en la que se define un hecho trascendental: la célula es la unidad fundamental no solo por lo que respecta a su función, sino también en cuanto a su estructura. Este período terminó con el enunciado de la teoría celular cuyos postulados pueden resumirse: 1.Todos los animales y vegetales están constituidos por células. 2.La célula es la unidad básica de estructura y función en un organismo multicelular. 3.Toda célula procede de otra célula preexistente 4.La vida del organismo depende del funcionamiento y control de todas sus células.


Experimentos de Pasteur A pesar del experimento de Redi, la controversia se prolongó aún otros doscientos años hasta que en el siglo XIX, Louis Pasteur realizó el experimento que refutó definitivamente la teoría de la generación espontánea. •

Louis Pasteur lo confirmó mediante un experimento en el que puso líquido nutritivo en un recipiente con un “cuello de cisne”, de forma que después de dejarlo hervir y que se evaporara parte del líquido y se condensara en el cuello del recipiente no dejara pasar el aire de fuera (si ponía la misma sustancia expuesta al aire se descomponía).

La forma de cuello de cisne en algunos de los frascos permitía que entrara el aire. Pero las partículas de polvo se quedaban en las partes de abajo de los cuellos. Al no generarse microorganismos en estos frascos, Pasteur llegó a la conclusión de que la generación de microorganismos dependía directamente de la contaminación por los microorganismos de las partículas de polvo que hay en el aire.

El trabajo de Pasteur confirmó la hipótesis de la biogénesis.


El experimento de Pasteur 1864

El aire podía pasar a los recipientes, pero no así los microorganismos, que quedaban atrapados en el cuello. Si se corta el cuello el líquido se contamina con microorganismos. Se desechó para siempre la teoría de la generación espontánea.

Microbios


Teoría Teoríadel delorigen origenfísico-químico físico-químicode de la lavida: vida:Oparin OparinyyHaldane Haldane Haldane

Oparin

Los dos científicos enunciaron esta teoría simultáneamente. Esta teoría se basa en las condiciones físico-químicas que existieron en la Tierra primitiva y que permitieron el desarrollo de la vida. Aleksander Ivanovich Oparin (1894 - 1980)

John Burton S. Haldane (1892 - 1964)


Haldane

Las condiciones eran distintas a las actuales

Oparin

En nuestro planeta no había oxígeno libre en la atmósfera, pero sí sustancias como el hidrógeno, el metano, el vapor de agua y el amoniaco. Existían, además, unas altas temperaturas, provenientes de la actividad volcánica, las radiaciones solares y las descargas eléctricas producidas por las frecuentes tormentas.


Haldane

Miller

Pero… ¿habría alguna manera de comprobarlo?

Oparin

En estas condiciones, aparecieron en un mar - que era una “sopa primitiva ” - las primeras moléculas orgánicas que lograban autoreplicarse. Posteriormente, estas moléculas se rodearon de unas envolturas y originaron los organismos más primitivos, los protobiontes. Cuando estos evolucionaron dieron lugar a los eubiontes, que ya eran células con vida.


Experimento de Miller

Miller

En 1953, Miller confirmó la teoría de Oparin-Haldane simulando en el laboratorio las condiciones de la Tierra primitiva. Obtuvo compuestos orgánicos a partir de otros inorgánicos. Este experimento probaba que las condiciones existentes en el planeta hace unos 3500 millones de años fueron tales que pudieron formarse espontáneamente moléculas orgánicas. Hasta entonces se pensaba que sólo un ser vivo podía fabricar materia orgánica (aminoácidos, ácidos grasos…)


Otras Otrasteorías. teorías.La LaPanspermia Panspermia La hipótesis original de la panspermia, propuesta por S. A. Arrhenius, suponía que la vida en la Tierra se originó gracias a la contribución cósmica de seres vivientes provenientes de algún punto del Universo. La hipótesis científica emitida por los exobiólogos habla de substancias químicas complejas (no de “microorganismos viajeros”) que se habían formado desde los orígenes del universo, las cuales alcanzaron la Tierra en un momento determinado. Dicha teoría parece confirmada en algunos puntos, si tenemos en cuenta que los componentes que constituyen las formas de vida que nosotros conocemos (las basadas en la química del carbono) se pueden encontrar en muchos lugares del Universo (condritas carbonáceas), y el hecho de que se han descubierto especies de bacterias que viven en ambientes extremos y que son capaces de soportar las condiciones del espacio, conocidas como bacterias extremófilas.


Algunos Algunos ambientes ambientes donde donde viven viven bacterias bacterias extermófilas (humeros abisales y crater Morning extermófilas (humeros abisales y crater Morning Glory) Glory) Las Las llamadas llamadas condritas condritas carbonáceas, carbonáceas, poseen poseen unas unas estructuras esfericas o cóndrulos que contienen estructuras esfericas o cóndrulos que contienen aminoácidos, aminoácidos, elementos elementos esenciales esenciales para para los los seres seres vivos. vivos. Esto Esto ha ha llevado llevado aa sugerir sugerir que que los los meteoritos meteoritos pudieron pudieron aportar aportar algunos algunos de de los los ingredientes ingredientes fundamentales fundamentalesque quefueron fueronnecesarios necesariospara paraque quelalavida vida pudiese surgir en nuestro planeta. pudiese surgir en nuestro planeta.


Objeciones Objecionesaala lateoría teoríade dela laPanspermia Panspermia 1. Para que aparezcan formas de vida basadas en el carbono no solo es necesaria la existencia de todos los elementos químicos que reaccionan con el carbono, sino que se tienen que dar unas condiciones de densidad y temperatura necesarias para que se den las reacciones químicas capaces de generar las biomoléculas. 2. A pesar de la existencia de bacterias extremófilas, se sabe con claridad que el espacio es un entorno muy hostil para la vida, sobre todo las radiaciones interestelares, que pueden producir mutaciones serias, capaces de poner en peligro la propia vida de dichos seres. 3. Aunque una o varias bacterias hayan logrado sobrevivir a un viaje a través del espacio, la entrada del asteroide o meteorito en el que viajan en la atmósfera terrestre habría logrado que tanto las formas de vida como el vehículo empleado quedaran destruidos. 4. Es muy complicado demostrar el origen extraterrestre de la vida, ya que los fósiles más antiguos pertenecen a una época muy posterior al propio origen de la vida, debido a la destrucción de los estratos geológicos más antiguos por el mero hecho del movimiento continuo de las placas tectónicas de la Tierra, haciendo que los restos fósiles enterrados en las mismas queden destruidos tras los procesos de subducción de unas placas bajo las otras.


3 La evolución biológica Se han clasificado 1,2 millones de especies animales y más de 400.000 especies vegetales. Además de los reinos Animal y Vegetal, existen otros 3 reinos con cientos de miles de especies conocidas. Cada año se descubren especies nuevas.


Antiguamente se creía que las especies entonces conocidas habían mantenido su aspecto sin cambiarlo desde el mismo momento de la creación.


Sin embargo, en el siglo XIX comenzaron a surgir diversas teorías que postulaban que los organismos vivientes eran el resultado de un dilatado proceso desarrollado a lo largo de la historia de la Tierra. Todos los seres vivos tienen un origen común, a partir del cual se formaron las distintas especies y adquirieron niveles organizativos superiores. Este proceso se denomina evolución. Los científicos se preguntaban cómo podían explicarse las extrañas formas de vida, hoy inexistentes, que parecían estar grabadas en piedra: los fósiles. También se hacían preguntas acerca de las variaciones en los animales y plantas domésticos y el origen de sus razas.


Ninguno de los científicos que apostaban por las teorías evolucionistas conocía la existencia de los genes ni de las mutaciones, pero ya entonces intuían que los cambios ocurridos en los individuos de una especie “se transmitían” a los descendientes.


Fijismo y evolucionismo

Fijistas

Evolucionistas

Los seres vivos son distintos porque han sido creados distintos, sin relaciones de parentesco.

Ciervo

Gamo

Los seres vivos son distintos porque evolucionan, pero mantienen relaciones de parentesco. Esto quiere decir que tienen un origen comĂşn, mĂĄs o menos lejanos en el tiempo.

Elefante asiĂĄtico Elefante africano


¿Por qué se parecen tanto entre sí?

¿Por qué se parecen tanto entre sí?


¿Por qué se parecen tanto entre sí?

¿Por qué se parecen tanto entre sí?


¿Por qué se parecen tanto entre sí?

¿Por qué se parecen tanto entre sí?


¿Por qué se parecen tanto entre sí?

¿Por qué se parecen tanto entre sí?


¿Por qué se parecen tanto entre sí?

¿Por qué se parecen tanto entre sí?


¿Por qué se parecen tanto entre sí?

¿Por qué se parecen tanto entre sí?


Las semejanzas entre los seres vivos se deben a las relaciones de parentesco entre ellos, por lo que serán más parecidos cuanto más cercano en el tiempo se encuentre un antepasado común.

Línea del tiempo

Presente

Pasado

Ciervo

Gamo

Antepasado común

Elefante asiático los p m Eje El descubrimiento y estudio de los fósiles estimulaba las ideas evolucionistas

Elefante africano

Antepasado común


los p m Eje

Línea del tiempo

Presente

Pasado

Ancestro común de los cánidos

Ancestro común de los félidos

Ancestro común de hienas y osos

Ancestro común Ancestro = Antepasado


Fijismo Fijismoyyevolucionismo evolucionismo Evolucionistas

Fijistas Explicaban la desaparición de especies antiguas por catástrofes naturales que eran ordenadas por Dios. Eran catastrofistas y creacionistas.

Los fósiles se explican porque los antiguos seres se extinguieron para dejar paso a nuevas formas de vida que surgieron a partir de las anteriores. El Mamut y otras criaturas se habrían extinguido por no haberse salvado del Diluvio en el Arca de Noé


A lo largo del siglo XIX, la comunidad científica asistió al enfrentamiento entre los defensores y detractores de las teorías evolucionistas, que trascendió el ámbito de la mera especulación científica y suscitó furibundos ataques por parte de los estamentos eclesiásticos, para los que la idea de la evolución representaba una grave amenaza a las creencias más profundamente arraigadas.

Caricaturas contra Darwin como esta intentaban ridiculizar sus ideas incluso insultándolo personalmente.

Las ideas evolucionistas chocaban con las ideas religiosas que el propio Darwin tenía.


Algunos fijistas famosos El fijismo como hipótesis científica se formalizó a mediados del siglo XVIII, en la obra de Carlos Linneo (1707-1778) quien asentó las bases de la taxonomía moderna y desarrolló formalmente el fijismo; mantuvo que las especies se habían creado de forma separada e independiente y negó la posibilidad del origen común de los seres vivos.

El zoólogo y naturalista Georges Cuvier (1769-1832), impulsor de la anatomía comparada y de la paleontología, fue otro de los científicos ilustres que se posicionaron a favor del fijismo. Ante el incesante descubrimiento de fósiles de especies desaparecidas, Cuvier fue el padre de la teoría fijista conocida como catastrofismo, formulada para explicar la diversidad de los organismos fósiles que contradecían el fijismo y algo más creíble que otras teorías, como la de la vis plástica, que proponían los fósiles como caprichos de la naturaleza.


Algunos evolucionistas famosos Buffon es uno de los primeros científicos que se atreve a hablar de evolución, aunque lo hace sin llegar a formular una teoría concreta. Entre sus ideas dispersas a este respecto está que unos organismos han evolucionado de otros por degeneración (el mono descendería del hombre, o el burro del caballo), o que las migraciones de animales de unos climas a otros han provocado cambios en ellos, necesarios para adaptarse a condiciones diferentes. Buffon, que se consideraba a sí mismo un hombre religioso, fue acusado de ateo por estas ideas y se retractó de ellas. Lamarkc fue el primer evolucionista reconocible como tal. La teoría de este científico se vio muy perjudicada por el enorme prestigio científico de Cuvier, de forma que recibió menos ecos y menos apoyos de los que hubiera merecido en esa época. Lamarck presentó su teoría, “Ley del uso y desuso” pero sus ideas no convencieron a la comunidad científica de la época

Darwin fue el precursor de la Teoria de la Evolución por Selección Natural


4 Principales teorías evolutivas Durante la gestación de la teoría de la evolución a partir de un antepasado común se formularon diversas hipótesis para explicar las causas que originaron el cambio en los seres vivos, es decir, para determinar qué factores provocan la formación de nuevas especies y la aparición de nuevos tipos de organización. Veamos a continuación cada una de las hipótesis:


Lamarck pensaba que las especies cambiaban evolucionando, para adaptarse a sus necesidades, aumentando así poco a poco la complejidad de los organismos vivos.

Lamarck (1744 – 1829) Jean Baptiste de Monet, caballero de Lamarck, naturalista francés. En 1809 publicó Philosophie zoologique, donde expuso las primeras ideas razonadas sobre la evolución. Sus ideas no fueron aceptadas.

Por ejemplo, el ancestro de la actual jirafa se adaptó estirando cada vez más su cuello, generación tras generación, para poder llegar a las ramas más altas.


La premisa central de su hipótesis giraba en torno a dos ideas fundamentales:

Lamarck (1744 – 1829) Jean Baptiste de Monet, caballero de Lamarck, naturalista francés. En 1809 publicó Philosophie zoologique, donde expuso las primeras ideas razonadas sobre la evolución. Sus ideas no fueron aceptadas.

1. La influencia del medio en el que se desarrollan las especies determinan los cambios de estas. 2. Dichos cambios son hereditarios, es decir, serán transmitidos a la descendencia.

Cráneo y vértebras cervicales de jirafa


Según Lamarck, las modificaciones en el entorno de una especie genera nuevas necesidades, en respuesta a las cuales los seres vivos se ven obligados a utilizar un determinado órgano determinado: “La función hace el órgano”, en palabras del propio Lamarck. El uso continuado del mismo lo fortalece y desarrolla, mientras que el no usarlo determina su atrofia y desaparición (“ley del uso y desuso”).

Esforzándose y usándolo, este animal lograría desarrollar su cuello. Y después lograría transmitir eso a sus hijos.


El uso de los cuernos provocarĂ­a su desarrollo. El gran desarrollo de las patas posteriores de algunos animales se deberĂ­a a su gran uso.

El kiwi habrĂ­a atrofiado sus alas por no usarlas.


Esta hipótesis es totalmente inadmisible hoy día por la Genética, pues se sabe que los caracteres adquiridos (como, por ejemplo, el aumento de la masa muscular por el ejercicio o ponerse moreno cuando se toma el sol) no se transmiten a la descendencia, pues no afectan al material genético.


Las ideas de Darwin se resumen en 3 conceptos:

1.- La lucha por la existencia 2.- La variabilidad intraespecífica 3.- La selección natural La selección natural tiende a promover la supervivencia de los más aptos. Esta teoría revolucionaria se publicó en 1859 en el famoso tratado El origen de las especies por medio de la selección natural.

Veamos estos conceptos…

Charles Darwin (1809 – 1882)


¿Cómo van evolucionando los seres vivos?

Son muchos los que nacen… Nacen más individuos de los que son capaces de sobrevivir en un medio con recursos limitados.

Dentro de cada especie hay variedad en las características. Los individuos no son idénticos entre sí. Nacen con diferencias entre ellos, es decir, hay una variabilidad intraespecífica (dentro de la especie)


Son muchos los que nacen…

Pero… Algunos no encuentran suficiente alimento o sufren enfermedades y mueren

Otros son la presa de algún depredador Hay una lucha por la existencia


Son muchos los que nacen…

Pero…

Hay una lucha por la existencia y por la reproducción

Algunos no encuentran pareja o no consiguen reproducirse por algún motivo


Son muchos los que nacen…

Pero… Sólo sobreviven unos pocos: los que han nacido con características que les permiten adaptarse mejor a su medio.


La Selecci贸n Natural ha eliminado a los que nacieron con caracter铆sticas menos apropiadas para la supervivencia.

S贸lo sobreviven unos pocos Los que sobreviven transmiten a sus hijos esas caracter铆sticas que precisamente les ayudaron a sobrevivir mejor en su medio.


1.- Hay una variabilidad intraespecífica

Las especies evolucionan, pero no como decía Lamarck

2.- Hay una lucha por la existencia 3.- Ha actuado la selección natural

1

2

3

A diferencia de Lamarck, Darwin pensaba que nacían jirafas con cuellos más largos o más cortos. Sobrevivirían sólo aquellas que habían heredado un cuello suficientemente largo.


Compara las dos teorías y reflexiona

Lamarck

Darwin

Línea del tiempo

Presente

Transmiten a los hijos un cuello más largo

Usan mucho su cuello Transmiten a los hijos un cuello más largo

Luchan por la supervivencia

Luchan por la supervivencia

Pasado Las jirafas desarrollan un cuello largo por esforzarse y usarlo mucho para coger su alimento

Hay una variabilidad dentro de la especie: algunas nacen con el cuello más largo.

La Selección Natural se encarga de eliminar las de cuello corto. El cuello largo se va extendiendo en la especie Sólo sobreviven y se reproducen las de cuello más largo


El viaje del Beagle. Tras graduarse en Cambridge en 1831, el joven Darwin se enrol贸 a los 22 a帽os en el barco de reconocimiento HMS Beagle como naturalista sin paga, para emprender una expedici贸n cient铆fica alrededor del mundo.


La expedición duró cinco años y recogió datos hidrográficos, geológicos y meteorológicos en Sudamérica y otros muchos lugares. Las observaciones de zoología y botánica de Darwin le llevaron a desarrollar la teoría de la selección natural. La asombrosa fauna de las Islas Galápagos dio mucho que pensar a Darwin

Iguana

Varias especies de pinzones

Cormorán con alas atrofiadas

Tortugas gigantes


En 1859, Darwin dio a conocer su teoría en el libro titulado El origen de las especies, basado en cuatro argumentos: 1.El mundo no es estático, sino que está en continua evolución. Las especies cambian continuamente. Con el tiempo unas desaparecen y aparecen otras nuevas. 2.El cambio evolutivo es un proceso gradual, lento y continuo; no se produce por cambios bruscos. 3.Los organismos que presentan semejanzas están emparentados y descienden de un antepasado común. 4.La evolución es el resultado del proceso de selección natural.

Además, Darwin sitúo al hombre dentro de la naturaleza como una especie más, sujeto a los mismos principios, lo que levantó fuertes polémicas en su época


Del “mono” no. Su teoría sobre la evolución del hombre fue groseramente malinterpretada y encontró mucha oposición. Los ataques a las ideas de Darwin que encontraron mayor eco no provenían de sus contrincantes científicos, sino de sus oponentes religiosos.

La idea de que los seres vivos habían evolucionado por procesos naturales negaba la creación divina del hombre y parecía colocarlo al mismo nivel que los animales. Ambas ideas representaban una grave amenaza para la teología ortodoxa.

Muchos atacaron a Darwin sin haber leído su libro ni conocer a fondo sus argumentos e ideas.

Darwin no pensaba que el hombre descendiese de ningún “mono” actual, sino que el hombre y otros primates descendían todos de antepasados comunes.


Orangután

Gorila

Chimpancé

Ser humano

? Darwin pensaba que el ser humano no procede de ningún primate actual. Pero sí creía que tenemos antepasados comunes con ellos.

?

En tiempos de Darwin no se conocían fósiles de antepasados humanos

Antepasado común


Orangután

Gorila

Chimpancé

Ser humano

? Pero la ciencia moderna conoce muchos eslabones de esta cadena

?

(hace 5 millones de años)

Darwin fue atacado Australopithecus porque no se conocían Procónsul estos “eslabones (hace 20 millones perdidos” de la cadena de años) de la evolución humana


Ninguno de los científicos que apostaban por las teorías evolucionistas conocía la existencia de los genes ni de las mutaciones, pero ya entonces intuían que los cambios ocurridos en los individuos de una especie “se transmitían” a los descendientes.

Darwin no sabía explicar cómo se transmiten los caracteres hereditarios. En sus tiempos no se conocían los cromosomas, ni mucho menos el ADN. Las Leyes de Mendel se desconocían cuando Darwin publicó su teoría.


La Biología moderna explica el hecho evolutivo sumando a las ideas de Darwin las Leyes de Mendel y los conocimientos de la moderna Genética.

+ Darwin

+ Mendel

Ningún científico niega hoy día el hecho evolutivo

=

Neodarwinismo o Teoría Sintética de la Evolución

Genética Moderna

Por fin quedaba resuelto el misterio del modo de transmitirse los caracteres hereditarios. El descubrimiento de las leyes de la herencia y del material genético permitía explicar aquello que los científicos contrarios a Darwin más le criticaron. El origen de las especies de Darwin se publicó en 1859, antes de los trabajos de Mendel.


La recombinación genética que ocurre en la meiosis y la reproducción sexual producen la variabilidad intraespecífica de la que hablaba Darwin

… mamá pata puso huevos en el nido…

Papá pato conoce a mamá pata…

…y tuvieron hermosos patitos. Pero no habrá una oportunidad para “el patito feo”: la Selección Natural acabará con él.

La Selección Natural sigue admitiéndose como el principal “motor” de la Evolución. La Selección Natural “escoge” dentro de la variabilidad.

El pato malvasía bucea para obtener alimento del fondo de lagunas


Como ya sabes, a veces se producen errores en la duplicación del ADN, dando lugar a genes alterados, distintos al original. Son las MUTACIONES. ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG Doble cadena de ADN sin mutar

ATTCGCGGCATTAATCCGATACCTAGGACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCCTGGCGCCTAAATTTGTACCTAG Doble cadena de ADN con mutación

Mutación

Las mutaciones son la fuente original de la variabilidad. La meiosis y la reproducción sexual son fuentes añadidas de variabilidad.

Variabilidad dentro de la especie Eriopis eschscholtzi

Algunas mutaciones provocan la muerte, pero otras, en sí, no son “buenas” ni “malas”: todo dependerá del medio donde vive la especie.


Las mutaciones, la recombinación genética en la meiosis, y la combinación de gametos en la reproducción sexual ocurren aleatoriamente (al azar)

El número de combinaciones posibles de alelos de genes en una especie es elevadísimo (“casi infinito”). ¿Sabrías calcular el número de combinaciones posibles de figuras de dados tirando cinco de ellos?.


En este medio, los ratones de fenotipo oscuro sobreviven con más probabilidad

La naturaleza arroja sus dados y nacen animales más claros, más oscuros… Dependiendo del medio, un color u otro será “mejor” o “peor”

Búho “normal”

En este medio, los ratones de fenotipo claro sobreviven con más probabilidad Con el tiempo, en esta población de ratones, aumenta la frecuencia de genes que determinan el fenotipo claro

Búho nival


En resumen: La información genética se transmite con el mínimo cambio posible, pero puede mutar, recombinarse y dar lugar a una variabilidad genética. El origen de esta variabilidad son las mutaciones y la reproducción sexual. Las mutaciones son cambios que se producen en el material genético y son, por tanto, heredables. Algunas mutaciones producen modificaciones gracias a las cuales el individuo se adaptará mejor al ambiente en el que vive, mientras que otras introducen variaciones perjudiciales. La reproducción sexual no origina nuevas alternativas a un gen pero puede dar lugar a nuevas combinaciones de los mismos. Enfasis en la condición gradual de la evolución: los cambios producidos en una población son pequeños y graduales. Se necesitan miles de años para que el proceso evolutivo dé lugar a nuevas especies. En esta teoría, es muy importante tener en cuenta que la variación de las frecuencias génicas de una población(unidad sobre la que actúa la selección natural) depende de dos factores; la migración y la deriva genética.


Migración: cuando dos poblaciones evolucionan por separado los cambios genéticos que ocurren en ellas son diferentes. La migración de organismos de una población a otra puede aportar genes nuevos, aportando variabilidad y promoviendo un cambio genético en ella.

MIGRACIÓN

POBLACIÓN A

POBLACIÓN B

POBLACIÓN A POBLACIÓN A

POBLACIÓN B

POBLACIÓN B

FORMACIÓN DE HÍBRIDOS


Deriva genética: en ocasiones, que un organismo sobreviva no depende de su mejor capacidad de adaptación, sino simplemente del azar. Accidentalmente, sobre todo si las poblaciones son pequeñas o si la capacidad de selección del ambiente es baja (poca presión selectiva, es decir, pequeñas diferencias a favor o en contra de las diferentes características), la casualidad puede hacer que unos genes se extiendan en la población con mayor frecuencia que otros.

Migración

Reproducción

DERIVA DERIVAGENÉTICA GENÉTICA


En 1972, N. Eidredge y S. Jay Gould expusieron la teoría del equilibrio puntuado o discontinuo. Se basa esencialmente en el estudio de datos paleontológicos que muestran que en el registro fósil existen apariciones súbitas de fósiles de algunos grupos principales, sin formas de transición, lo que parece sugerir que el proceso evolutivo no siempre se realiza de una manera gradual, como afirma la teoría sintética, sino que en muchas ocasiones se produce bruscamente y origina la aparición de nuevas especies. Según los autores de esta teoría, tras una catástrofe geológica, un extenso cambio de clima o la extinción de una especie que dejara muchos nichos vacíos, se producirían evoluciones bruscas. El proceso podría ocurrir por mutaciones en genes reguladores de otros genes que provocarían auténticas macromutaciones y, en consecuencia, un cambio rápido de las especies (aparición de aves y mamíferos a partir de reptiles, cormófitas a partir de talófitas...). Esto es lo que se puede denominar macroevolución, mientras que la aparición de especies próximas se denomina microevolución. Según esta teoría, la evolución ocurre de forma muy irregular, con paradas bruscas y acelerones.


Este modelo supone:

Cambios Cambios graduales graduales

1.El proceso de formación de especies está entre 5.000 y 50.000 años . 2.Los fósiles muestran que una especie no cambia sustancialmente a lo largo de su existencia (estasis) 3.El mecanismo rápido y por (cladogénesis)

Sin Sincambios cambios estasis estasis

Cambios Cambios evolutivo es Bruscos Bruscos ramificación Cladogenesis Cladogenesis


La teoría del equilibrio puntuado, al igual que la sintética propone un proceso de especiación y evolución a partir de una especie antecesora común. El antecesor de todas las especies recibe el nombre de LUCA (Last Universal Common Antecessor )

LUCA


El autor de esta teoría es el japonés M. Kimura, para quien la mayoría de las mutaciones que sufre el genoma de una especie origina genes neutros que no son eliminados ni favorecidos por la selección natural. Estos genes, por tanto, permanecen en el genoma o son eliminados al azar. Cuando permanecen y son heredados, producen variaciones en los individuos, que pueden provocar, si se produce el aislamiento necesario, la aparición de nuevas especies. Por lo tanto, el azar en mayor medida que la selección natural es el responsable de la evolución.


La Laevolución evoluciónen enla laactualidad actualidad Hay un amplio consenso sobre la aceptación evolución, pero todavía quedan puntos en discusión: 1.No se sabe si la evolución es un proceso direccional o no. 2.Las causas de la evolución son externas (ambientalismo) o internas (internalismo) 3.El ritmo de la evolución: gradualismo vs. Puntuacionismo 4.El papel de la selección natural en la evolución. 5.El valor adaptativo de los caracteres.


5 Pruebas de la evolución Pruebas morfológicas Pruebas biogeográficas Pruebas paleontológicas Pruebas embriológicas Pruebas bioquímicas


Pruebas morfológicas

Se basan en el estudio comparado de la morfología de los órganos de seres vivos actuales o de fósiles. Mediante la ANATOMIA COMPARADA se estudian las semejanzas y diferencias entre órganos de diversas especies.


Observa detenidamente estos dibujos de extremidades anteriores de vertebrados:

Todas son diferentes pero tienen “un esquema común” de organización Ese Estos “esquema dibujoscomún” muestran de organización ejemplos de se ÓRGANOS debe a unHOMÓLOGOS antepasado común que “inventó” un “esquema básico”. La evolución por selección natural llevó a distintas adaptaciones de esta extremidad para correr, nadar, volar… Pero el “esquema básico” se mantuvo en todas estas especies.


Los órganos HOMÓLOGOS son aquellos que tienen un mismo origen evolutivo y embrionario, con una estructura interna semejante, fruto de diversas modificaciones adaptativas a distintos hábitats. Ejemplos:

Humano

Gato

Ballena

Murciélago


¿Te parecería apropiado pensar en un parentesco próximo entre un murciélago y un insecto sólo porque vuelan?

Ala de murciélago Ala de insecto

Hay una membrana entre los dedos que permite volar a los murciélagos.

Son ejemplos de órganos HOMÓLOGOS Brazo humano Brazo de murciélago

Son ejemplos de órganos ANÁLOGOS

Cráneo de murciélago

Cráneo de oso

Aunque los osos y los humanos no volemos, estamos bastante más emparentados con un murciélago que con un insecto.


Los órganos ANÁLOGOS son aquellos que tienen distinto origen evolutivo y embrionario, pero presentan una forma aparentemente semejante y realizan la misma función.

Ala de murciélago Ala de insecto

Son ejemplos de órganos ANÁLOGOS Son ejemplos de órganos ANÁLOGOS

Estos machos de Lucanus cervus (ciervo volante), usan sus “cuernos” (mandíbulas muy desarrolladas) para combatir entre ellos.

Los ciervos macho también combaten con sus cuernos


Los órganos ANÁLOGOS representan un fenómeno llamado CONVERGENCIA ADAPTATIVA, por el cual los seres vivos repiten fórmulas y diseños que han tenido éxito.

Los órganos HOMÓLOGOS representan la DIVERGENCIA ADAPTATIVA, por la cual los seres vivos modelan sus órganos según su modo de vida, el ambiente en que están, etc.


Los ÓRGANOS VESTIGIALES son también pruebas anatómicas de la Evolución. Son órganos rudimentarios, atrofiados, que revelan un pasado evolutivo. Cintura pélvica Fémur

Por ejemplo, los cetáceos (ballenas, delfines…) conservan vestigios (“restos”) del fémur y de la cintura pelviana. La explicación es que tuvieron un antepasado mamífero terrestre. Su adaptación al medio acuático les llevó a perder las extremidades posteriores, pero quedan “restos”.


El kiwi y el cormorán de las Islas Galápagos tienen alas vestigiales. Con ellas ya no pueden volar.

El cóccix son pequeñas vértebras fusionadas. Es el vestigio de un pasado evolutivo con cola.

Este insecto tiene alas vestigiales.

Con ellas ya no puede volar.


Pruebas biogeográficas

Las encontramos repartidas por todo el planeta, y consisten en la existencia de grupos de especies más o menos parecidas, emparentadas, que habitan lugares relacionados entre sí por su proximidad, situación o características, por ejemplo, un conjunto de islas, donde cada especie del grupo se ha adaptado a unas condiciones concretas. La prueba evolutiva aparece porque todas esas especies próximas provienen de una única especie antepasada que originó a todas las demás a medida que pequeños grupos de individuos se adaptaban a las condiciones de un lugar concreto, que eran diferentes a las de otros lugares. Son ejemplos característicos de esto los pinzones de las islas Galápagos que fueron estudiados por Darwin

Un único ancestro común dio lugar a diversas especies de pinzones en las diferentes islas Galápagos


Camello bactriano

Llama Camélidos de Asia África Alpaca Guanaco

Dromedario Vicuña

Camélidos de Sudamérica

La familia de los camélidos se diversificó de acuerdo a su distinta adaptación en diferentes hábitats. Ello constituye una prueba biogeográfica más de la evolución.


Diablo de Tasmania Equidna

Ornitorrinco

Lobo marsupial (extinguido)

La extraña fauna de Australia refleja su aislamiento evolutivo del resto de continentes. Las especies de mamíferos evolucionaron independientemente de otras partes del mundo. Esto es una prueba biogeográfica más de la evolución.

Koala

Wallaby Canguro rojo


Pruebas paleontológicas El nacimiento de la Paleontología vino a apoyar las ideas evolucionistas del siglo XIX.

Esqueleto fosilizado de Megaceros ¿Podría ser este el antepasado del ciervo actual?

Se establecen similitudes con especies actuales y se intenta determinar una historia evolutiva apoyada en pruebas tan firmes como son los fósiles. Así, por ejemplo, se han logrado reconstruir historias evolutivas completas como la que condujo hasta el caballo


Se han logrado reconstruir historias evolutivas completas como la que condujo hasta el caballo. Los antepasados del caballo fueron cambiando y gradualmente fueron perdiendo dedos como adaptaci贸n a la carrera veloz. En los f贸siles est谩 escrita la historia evolutiva de los 茅quidos


Ancestro de los équidos Équido actual

Se han logrado reconstruir historias evolutivas completas como la que condujo hasta el caballo. Los antepasados del caballo fueron cambiando y gradualmente fueron perdiendo dedos como adaptación a la carrera veloz.

En los fósiles está escrita la historia evolutiva


Dedos vestigiales y sin garras

Garras en los dedos Pico con dientes

Plumas Cola larga

Cola corta

Ave actual

Pico sin dientes

El Arqueopterix pudo ser el antepasado extinguido de las aves. Era “mitad reptil – mitad ave”


F贸sil de Archaeopteryx Reconstrucciones del Archaeopteryx


Archaeopteryx Vivió hace 150 millones de años

Se considera un animal emblemático en el estudio de la evolución por su carácter transicional entre reptiles y aves


“Fósiles vivientes” Hoja actual

Concha de

Nautilus actual

Nautilus fosilizados seccionados

Este molusco es un “fósil viviente” que lleva sin evolucionar 150 millones de años. Se considera próximo en la evolución a los extinguidos ammonites

Hojas fosilizadas

Darwin llamó al Ginkgo Biloba "fósil viviente", por considerarlo la especie vegetal más antigua del planeta. Aparecieron hace 250 millones de años, en el período Pérmico, al final de la era primaria. Este pez, el celacanto es otros “fósil viviente”. Curiosamente, se conocía muy bien a los fósiles mucho antes de descubrirse el primer ejemplar vivo.


Pruebas embriol贸gicas

Pruebas de la evoluci贸n Observa detenidamente el desarrollo embrionario de estas especies:


Estas semejanzas son una prueba de que existe un parentesco entre las especies. Cuanto mรกs alto sea el parecido entre embriones, mayor serรก el grado de parentesco entre dos especies. Durante el desarrollo embrionario es como si se reprodujese la historia evolutiva de los antepasados. Nuestro embriรณn, al principio, es muy parecido al de un pez. Nuestros antepasados remotos fueron peces.


Pruebas bioquímicas Por último, las pruebas más recientes y las que mayores posibilidades presentan, consisten en comparar ciertas moléculas que aparecen en todos los seres vivos de tal manera que esas moléculas son tanto más parecidas cuanto menores diferencias evolutivas hay entre sus poseedores, y al revés; esto se ha hecho sobre todo con proteínas (por ejemplo proteínas de la sangre) y con ADN.


6 Mecanismos de evolución

La eficacia biológica o capacidad para dejar descendencia es inseparable del concepto de selección natural. La mayor eficacia biológica deja una mayor representación del genotipo sobre los demás en generaciones sucesivas.

Los seres vivos somos lo que somos gracias a la información genética que poseemos almacenada en nuestras células; esta información ha sido más o menos modelada por el ambiente en el que vivimos. Pero lo único que transmitiremos a nuestros hijos serán nuestros genes, no caracteres adquiridos como una piel morena o unos músculos fuertes.

La evolución se entiende como el cambio producido a lo largo del tiempo en el material genético de las poblaciones.


En un principio, los seres vivos de la misma especie y de la misma población debieron tener idéntica información genética, los mismos genes y los mismos alelos. Todos los individuos estarían en principio igual de adaptados a su medio, salvo diferencias ambientales individuales (por ejemplo, el que se alimente más estará más fuerte); la cuestión es, ¿por qué con el tiempo surgen individuos diferentes dentro de las poblaciones?. La respuesta a estas cuestiones está en las MUTACIONES GENÉTICAS, que hacen que un gen cambie lo suficiente para seguir siendo el mismo gen, pero dé lugar a un carácter algo diferente, convirtiéndose entonces en lo que llamamos un ALELO.


Cualquier ser vivirá mejor o peor en el lugar en que le ha tocado vivir según los caracteres que haya desarrollado, así por ejemplo, si tiene una gruesa cubierta de pelo aguantará bien el frío, si tiene agilidad para subir a los árboles escapará de los predadores y si sabe nadar no se ahogará cuando tenga que cruzar un río; esta capacidad de vivir mejor o peor es lo que llamamos ADAPTACIÓN AL MEDIO: el que está mejor adaptado vive mejor, se alimenta bien, escapa de los predadores, vive más tiempo y todo esto hará que tenga más crías, y, por lo tanto, deje más descendientes a la siguiente generación que llevarán sus genes, es la SUPERVIVENCIA DEL MÁS APTO.

LOS SERES MEJOR ADAPTADOS A SU MEDIO DEJAN MÁS DESCENDIENTES A LA SIGUIENTE GENERACIÓN En sentido negativo, los individuos que están peor adaptados viven menos, y dejarán menos descendientes, por lo que al cabo de varias generaciones sus genes tenderán a desaparecer, quedando sólo los genes que suponen una mejor adaptación, es decir, la naturaleza selecciona los mejores genes para un ambiente determinado, es lo que llamamos la SELECCIÓN NATURAL


Como ya hemos visto, la principal fuerza evolutiva son las mutaciones genéticas, que son las responsables de la mayoría de la variabilidad genética de las poblaciones, aunque no son la única fuerza evolutiva que actúa, ya que existen otras que son también muy importantes: la reproducción sexual, que es la responsable de la mezcla de genes y alelos en los individuos el número de individuos de la población, ya que si la población es muy pequeña los cambios genéticos se dan más deprisa (deriva genética) los movimientos de individuos, las migraciones, que alteran el conjunto de genes y alelos de la población y, por supuesto, la selección natural, que escogerá aquellas combinaciones genéticas más favorables para ese medio, haciendo que esos individuos mejor adaptados produzcan más individuos y su EFICACIA BIOLÓGICA sea mayor.


La mariposa Biston betularia de Inglaterra puede ser clara u oscura. En condiciones normales, la proporción de individuos que llevan el gen responsable del color claro es muy alta. Sin embargo, en zonas donde azotaba la contaminación y los árboles oscurecían con el hollín, predominan los individuos con fenotipo oscuro. Tronco ennegrecido por el hollín

Mariposas descansado, posadas sobre troncos de abedul


7 Microevolución y macroevolución Son dos niveles diferentes del proceso evolutivo

Microevolución

Se trata de pequeñas modificaciones en las poblaciones que pueden llegar a originar nuevas especies próximas, parecidas entre ellas, pero distintas. Ejemplo: pinzones de las Islas Galápagos.

Macroevolución

El término Macroevolución se refiere a las relaciones entre todos de seres vivos, con la aparición y desaparición de grandes grupos. Los fósiles son fundamentales para encajar todo este gran rompecabezas.


Las 13 especies actuales de pinzones de las Gal谩pagos se originaron a partir de un antepasado que lleg贸 desde el continente. Se produjo una radiaci贸n adaptativa. Se trata de un ejemplo de microevoluci贸n.


MacroevoluciĂłn: ĂĄrbol evolutivo o filogenĂŠtico de los seres vivos.


Carnívoros

Pinnípedos

Cetáceos

Perisodáctilos

Roedores Artiodáctilos Lagomorfos Proboscídeos Primates

Sirenios

Quirópteros

Desdentados Insectívoros

Árbol evolutivo de los mamíferos placentarios


8 Formación de nuevas especies Aquí ves 6 especies de felinos que se originaron a partir de un ancestro común. Pero… ¿Qué es exactamente una ESPECIE?

1

3

2

4 6

5


Los individuos pertenecen a una misma especie cuando pueden reproducirse entre sí y tener descendencia fértil. Macho adulto

Hembra adulta

Subadulto Joven

Las cuatro especies de buitres ibéricos

Cachorro

Foca monje (Monachus monachus) Recién nacido


¿Son de la misma especie estas dos aves?:

No. ¿Por qué? A simple vista vemos que hay diferencias entre estos dos individuos: la forma del pico, los colores del plumaje, etc. Dos seres como estos (macho y hembra) NO PUEDEN REPRODUCIRSE ENTRE SÍ


¿Cuántos individuos hay aquí? …… 19 ¿Y cuántas especies ves? ………8


Carlos Linneo estableci贸 en el siglo XVIII el sistema de NOMENCLATURA BINOMIAL para nombrar cient铆ficamente las especies.


Gorrión

Cada especie tiene un nombre científico, universal y único en todos los países.

Passer domesticus


Los nombres científicos evitan confusiones

Nombre vulgar: bisonte A veces llamado en América “búfalo”

Bison bonasus

Nombre vulgar: búfalo

Syncerus caffer


Son RAZAS de una misma especie:

Pastor alemรกn

Pointer

Basset

Pastor belga

Fox terrier

Beagle

Canis familiaris

Collie

Bulldog

Yorkshire

Galgo

Bulterrier

Rottweiler


Todavía se pueden reproducir entre sí

Canis familiaris (perro) El perro comenzó a acompañar al ser humano desde la Prehistoria. Estudios de ADN confirman que proviene del lobo y no del zorro.

Canis lupus (lobo)

Canis lupus (lobo)

Ya no se pueden reproducir entre sí

Vulpes vulpes (zorro)

Antepasado común


A veces existe un DIMORFISMO SEXUAL, es decir, que el macho y la hembra muestras diferentes colores, tamaño y forma del cuerpo o de algunos órganos…


Estos monos, aunque no lo parezca, pertenecen a la misma especie (la variabilidad intraespecĂ­fica es muy alta)

Otras veces ocurre lo contrario: animales o plantas que parecen iguales a simple vista, en realidad pertenecen a diferentes especies, como ocurre por ejemplo con las cebras‌


Se hace necesario estudiar a fondo las poblaciones de animales para conocer si se trata de una especie o de varias. Por ejemplo, después de siglos pensando que en África sólo había una especie de cebra, se sabe desde hace pocos años que en realidad hay tres:

Equus zebra

Su parecido es tan grande porque están muy emparentadas. Eso significa que el ancestro común de las tres especies está relativamente próximo en el tiempo.

Equus grevyi

Equus quagga


Esto no es un capricho de los biólogos. Son especies diferentes porque no se reproducen entre sí dando unos hijos fértiles

Equus zebra En algunos zoológicos se han podido reproducir especies diferentes de cebras. Pero los hijos resultantes, aunque viven con normalidad, son ESTÉRILES

Equus grevyi

Equus quagga


Desde muy antiguo se sabe que también pueden reproducirse dos especies diferentes: caballo y asno. La mula es un híbrido que resulta del cruce entre burro y yegua o entre caballo y burra. Las mulas no se pueden reproducir porque son ESTÉRILES

Équidos

Animales del género Equus

Mula (es un híbrido asno-caballo) Cuando se originan las especies dejan de reproducirse unas con otras. Adoptan colores, formas y comportamientos que les impiden cruzarse con especies diferentes


Una especie puede definirse como el conjunto de individuos que constituyen una población con características estructurales y funcionales semejantes, y que son capaces de aparearse entre sí y generar una descendencia fértil.

El cortejo en las palomas

Apareamiento en el ciervo volante


9 La evolución humana A partir de Darwin y puesto que el hombre también ha evolucionado a partir de otros seres, se inicia un búsqueda del “eslabón perdido”, seres que relacionasen a los humanos con otros primates.


Primeros fósiles 1848: Un pastor de cabras encuentra en Gibraltar un cráneo fósil de homínido. 1856: Hombre de Neanderthal (Alemania) 1859: “El Origen de las Especies por la Selección Natural” de Darwin 1868: hallazgo de cinco esqueletos de CroMagnon (Dordoña, Francia) 1891: Dubois y el “hombre de Java”: 500.000 años. Homo erectus 1907: mandíbula de Mauer (Heidelberg): Homo heidelbergensis 1924: Raymond Dart. El “niño de Taung”. Australopithecus africanus. 1926: Robert Bloom. Sterfontein (Transvaal) “Señora Pless”, Plesianthropus transvaalensis. 1938: Robert Bloom. Paranthropus robustus. 1950: Le Gros Clark sitúa a los Paranthopus dentro de Australopithecus


Primeros fósiles 1959: en la garganta de Olduvai Louis y Mary Leakey encuentran un craneo robusto: el “cascanueces”. Zinjanthropus boisiei (hoy Australopithecus) 1960: los Leakey con Napier y Tobias: Homo habilis, Homo erectus y Austraslopithecus Entre 1967 y 1977: yacimientos del Lago Turkana (Kenia), Laetoli (Tanzania) y valle del Omo (Etiopía) Richard Leakey, en Koobi Fora (Turkana): cráneo KNM-ER 1470: Homo habilis (2 Ma) 1973: Johanson en Hadar (región de Afar, Etiopía). Fragmentos de un esqueleto de una hembra con pelvis. “Lucy”. 3.6 Ma. 1978: Australopithecus afarensis 1996: Ardipithecus ramidus (4.4 Ma) 1997: Australopithecus anamensis (Meave Leakey, 4.3- 3.8 Ma) 2001: Sahelanthropus tchadensis Encontrado en la región del Chad (6-7 Ma)


Estudios Estudiosantropológicos antropológicos

Datos objetivos (Fósiles)

interpretación

Hipótesis

Rechazo

Teoría

Comunidad científica Criterio de falsabilidad

Aceptación de la teoría


Estudios Estudiosantropológicos antropológicos

1. Estructura de huesos, extremidades, columna vertebral. Se buscan signos de bipedismo 2. Estudios del craneo: Posición del Foramen Magnum, marcas de musculatura, grosor de la mandíbula, cresta craneal.. 3. Estudios dentales:  Índice de megadoncia (tamaño de los dientes en relación al tamaño corporal): A menor índice, más energética y nutritiva es la dieta.  Piezas dentales en las mandíbulas encontradas Aparición del primer molar: Hasta los 6 años Aparición del segundo molar: Hasta los 12 años Aparición del tercer molar: Hasta los 18 años  Recuento de las lineas de Retzius (capas de esmalte en los dientes)


Hipótesis Hipótesisafricana africana Los científicos creían que en el África meridional no podían habitar antropoides por la falta de selvas. Raymon Dart descubre un craneo de niño, y bautiza la especie con el nombre de Australopithecus africanus. A partir de 1936 se asume la condición de homínidos de los australopithecus. La tecnología también está ayudando mucho en este tipo de estudios (antropología forense, biología molecular, modelos informáticos de reconstrucción …) A pesar de todo sigue habiendo controversia entre paleontólogos sobre como se llegó desde los primeros homínidos hasta el hombre actual.


A la derecha del Rift –Valley (Este): Clima más seco y los seres vivos (homínidos entre ellos) se tienen que adaptar a las nuevas condiciones A la izquierda del Rift –Valley (Oeste): Clima más húmedo. En esta zona evolucionan los chimpancés y gorilas actuales


Especie Homínido Toumaï Orrorin Tugenensis Ardipithecus Kadabba Ardipithecus Ramidus Australopithecus Anamensis Australopithecus Afarensis Paranthropus Aethiopicus Australopithecus Africanus Australopithecus Garhi Paranthropus Robustus Paranthropus Boisei Homo Habilis Homo Rudolfensis Homo Ergaster Homo Erectus Homo Antecessor Homo Heidelbergensis Homo Neanderthalensis Homo Rodhesiensis

Antigüedad 7 millones de años 6 millones de años 5,8 millones de años 4,4 millones de años 4 millones de años 3,5 millones de años 2,5 millones de años 3-2 millones de años 2,5 millones de años 1,9 millones de años 1,8 millones de años 1,8 millones de años 1,6 millones de años 1,2 millones de años 1 millón de años 800.000 años 500.000 años 300.000 años 200.000 años


Fósiles Fósilesmás másantiguos antiguos  Sahelanthropus tchadensis o Toumaï

es un espécimen fósil de un primate antropomorfo, que se halló en Chad y se ha datado en 6 a 7 m.a. de antigüedad.  El fósil muestra una combinación de rasgos

primitivos y más avanzados, y mientras la bóveda craneana es muy similar a la de los simios, los huesos de la cara son breves y los dientes, especialmente los caninos, son pequeños, parecidos a los de los seres humanos. Además, el cráneo presenta una protuberancia a la altura de las cejas que no se encuentra fuera del género humano.


Ardipithecus ramidus: Vivió hace unos 5 millones de años. Se han encontrado fósiles en Etiopía. Características: 1. Caninos muy reducidos y parecidos a los incisivos y sin forma cónica como en otros primates. 2. Dieta vegetariana como los chimpancés: tenía las muelas parecidas. 3. El pequeño tamaño de los caninos en todos los homínidos se interpreta como una disminución de la agresividad intra e interespecífica al formar sociedades poco conflictivas y con mucha cooperación. 4. Vivía en la selva, era arborícola, tendría el tamaño de un chimpancé, sería ya bípedo.


Australopithecus • El término significa simio meridional • • • •

• • •

como referencia a Suráfrica, donde se encontraron los primeros fósiles. Vivían en medios boscosos Estatura 1 metro Piernas cortas en relación con los brazos. Se subían a los árboles para alimentarse, escapar de los depredadores o dormir. Dientes caninos. Marcado dimorfismo sexual. Bípedos (pisadas de Laetoli)


Ventajas de bipedismo: • Deja manos y brazos libres al caminar. • Reduce el grado de radiación solar recibida (mejor termorregulación) • Amplia el campo visual • Se reduce el coste energético al caminar • El tener las manos libres facilitó el desarrollo de la inteligencia. • El porte erguido suponía una cierta capacidad de intimidación sobre algunos predadores


Existen distintas especies del gĂŠnero Australopithecus: 1. 2. 3. 4. 5. 6.

Australopithecus anamensis Australopithecus afarensis Australopithecus aethiopicus Australopithecus boisei Australopithecus bahrelghazali Australopithecus robustus


Australopithecus anamensis 4,2 – 3,9 m.a. El cráneo de esta especie es parecido al del simio, pero su larga tibia indica que al caminar todo el peso del cuerpo se apoyaba alternativamente en una de las extremidades inferiores, como es habitual en la bipedación. Sus muelas poseían gruesos esmaltes, por lo que se deduce que no comía solo hojas y frutos sino alimentos más duros. Vivió en un ambiente forestal, pero más abierto que el de sus supuestos antepasados los Ardipithecus ramidus. Presentaban un claro dimorfismo sexual en tamaño corporal. Es posible que formaran comunidades de varios machos emparentados, en las que cada uno agruparía un pequeño harén de hembras.


Australopithecus afarensis • Era un homínido con frecuente actividad arbórea, ya sea recolectando frutos, durmiendo, jugando, etc. • Capacidad craneal bastante pequeña: 375 a 550 cm3. Esto significa también un cerebro de un tamaño cercano a la tercera parte del humano actual promedio. • Su pecho no era en forma de campana. • El dimorfismo sexual (diferencia física entre machos y hembras de una misma especie) era muy marcada, con los machos mucho más corpulentos que las hembras. • Además, su cara era bastante grande y se proyectaba delante del cráneo, debido al tamaño de los dientes (prognatismo).


Australopithecus africanus También denominados A. gracilis por oposición al A. robustus. Capacidad craneana de 430 a 520 centímetros cúbicos, un 10 por 100 más que en el A. afarensis. En general la cara es más corta y presenta menor prognatismo. Hay una reducción de los caninos e incisivos, y hay un mayor énfasis de la masticación en el resto de la dentición. El esqueleto postcraneal es similar al A. afarensis. Era bípedo pero también un ágil trepador de árboles. El peso y la altura estimada recientemente para individuos adultos se encontraría entre los 33 y los 67 kilos y su estatura media oscilaría alrededor del 1,45 metros.


Australopithecus bahrelghazali Es una especie fósil de homínido hallada en 1995 por Michel Brunet en Koro Toro, Chad, representado por una mandíbula con siete dientes de 3,5 a 3 millones de años de antigüedad. Fue apodado Abel. Es la primera evidencia de fósiles de homininos al oeste del valle del Rift. Tal situación plantea problemas con la hipótesis de la East Side Story, según la cual los primeros homínidos bípedos habrían aparecido y evolucionado al este de dicho valle. Se considera que representa una línea de Australopithecus distinta de la que evolucionó hacia Homo.


Género GéneroHomo Homo Cuando los australopithecus desaparecieron hace 1 Ma., aproximadamente, ya llevaban tiempo compartiendo Africa con individuos del género Homo. Estos nuevos seres tenían un cráneo mayor y eran capaces de fabricar útiles. También es una especie con varios géneros: Homo Habilis.- 1,8 millones de años Homo Rudolfensis.- 1,6 millones de años Homo Ergaster.- 1,2 millones de años Homo Erectus.- 1 millón de años Homo Antecessor.- 800.000 años Homo Heidelbergensis.- 500.000 años Homo Neanderthalensis.- 300.000 años Homo Rodhesiensis.- 200.000 años Homo Sapiens.- 150.000 años


Homo Habilis.- 1,8 millones de años Es el primer representante del género Homo. Tenía una capacidad craneal media de unos 600 centímetros cúbicos y era quizá un poco más pequeño que los Australopithecus. Su dieta incluía la carne, sin embargo no podemos decir que fueran todavía cazadores, practicaban más bien una actividad de carroñero. No conocía el uso del fuego, ni tampoco estaría en posesión de un lenguaje articulado, aunque en los moldes de un cráneo de un Homo habilis se ha observado que tenían una circunvolución de Broca bastante desarrollada. Su andar era erguido, así lo atestiguan los rasgos de su pelvis, columna, miembros y foramen magnun. Podemos concluir que tanto los huesos de las manos como de las piernas estaban más próximo a los seres humanos modernos que a los antropomorfos.


Homo Ergaster.- 1,2 millones de años Sustituyeron a los Habilis. Su gran cerebro, estatura y proporciones corporales son parecidas a las de los humanos posteriores. Su capacidad craneal se sitúa entre 800 y 950 cc. Tienen una nueva forma de tallar la piedra, el Achellense o Modo 2, que consiste en núcleos o grandes lascas tallados por las dos caras denominados bifaces mucho más eficaces. Aunque la mayor parte de la opinión científica aún agrupa estos fósiles como H. erectus, hay una tendencia creciente en agrupar los especímenes africanos en su propia especie, Homo ergaster


Homo Erectus.- 1 millón de años Los Homo erectus son los primeros viajeros intercontinentales. Desde África se dispersan a través de Asia Menor y el Próximo Oriente, llegando por un lado hasta España y por el otro hasta cerca de Pekín, en el norte de China, y hasta la isla de Java, en Indonesia. Los fósiles más antiguos de Atapuerca, cerca de Burgos, que tienen 800.000 años, son descendientes de ellos. Dejaron los primeros restos de viviendas construidas, de objetos de madera tallada, la primera lanza de madera y el recipiente más primitivo, un cuenco de madera. Su mayor avance cultural fue que aprendió a manejar el fuego.


Hoy en día todos estos restos se engloban en la especie Homo erectus, que vivió desde hace 1.8 m.a hasta hace 50.000 años y se extendió desde Africa a Europa y Asia Hombre de java

Hombre de Heidelberg

Hombre de Pekín


Homo antecessor, ATAPUERCA Yacimientos c谩rsticos muy cerca de la ciudad de Burgos excavados a partir de 1978. A finales del siglo XIX y principios del XX se construy贸 un ferrocarril para transportar mineral desde la cercana Sierra de la Demanda. La trinchera que se construy贸 puso al descubierto una serie de cuevas rellenas de sedimentos.


Desde 1980 se excava el yacimiento, con numerosos restos f贸siles encontrados. En 1997 se define la especie Homo antecessor. Desde el a帽o 2000, Atapuerca es Patrimonio de la Humanidad


Fósiles de 800.000 años. Se consideran los primeros europeos (antes se pensaba que tendrían 500.000 años), se piensa que llegaron por vía exclusivamente terrestre desde Asia y recorriendo toda Europa (el estrecho de Gibraltar no se cerró durante los últimos 3 millones de años, solo lo estuvo hace entre 5 y 6 millones de años). Son antepasados nuestros, pero también de los neandertales. Practicaban el canibalismo; prácticamente el 50% de los fósiles humanos presentan cortes o fracturas producidos por instrumentos líticos, y se encuentran indistintamente en los huesos craneales y en los del esqueleto postcraneal, lo que indica un consumo total de los cadáveres.


Su capacidad craneal era elevada (más de 1.000 cc) y poseía una cara muy moderna, es decir, esta especie sufrió una reestructuración total del neurocráneo, la mandíbula, los dientes y la cara, es totalmente diferente a todo lo anterior.


Homo Neanderthalensis 120000 – 300000 años. No es directamente un antepasado, sino una rama evolutiva paralela. Caminaba totalmente erguido, su capacidad craneana era de 1500 cm3, superior a la del hombre moderno. Poseía un cráneo alargado y achatado, senos nasales anchos, mejillas prominentes, mentón retraído y huesos más gruesos que los del hombre moderno. Tenía un alto grado de sofisticación cultural, enterraban a los muertos, confeccionaban muchas herramientas y sabían hacer fuego (no sólo utilizarlo) Su extinción (hace 28000 años) es todavía un misterio, pero parece que fue desplazado por los homo sapiens, mejor adaptados.


Tema 2: La vida en evoluci贸n


Homo sapiens

Surgen en África hace 200.000 años Su esqueleto y cráneo muestran todos los rasgos del hombre actual: • Esqueleto ligero • Frente alta • Rostro retraído • Arcos supraciliares poco marcados • Mentón mandibular Su cerebro era de menor capacidad que el H. neanderthalensis, pero con un mayor desarrollo de los lóbulos frontales, lo que pudo influir en la capacidad de pensamiento y razonamiento, que es lo que los (nos) hace completamente diferentes


ComparaciĂłn del tamaĂąo de los cerebros de distintos homĂ­nidos.


Otra importante diferencia con el resto de los homínidos es la capacidad para desarrollar un lenguaje verbal, lo que se relaciona con la posición anatómica de la faringe (muy baja). También somos los únicos mamíferos que no pueden tragar y respirar al mismo tiempo por esa misma razón. Hace unos 40.000 años aparecen las primeras manifestaciones relacionadas con el pensamiento simbólico (adornos pinturas, ofrendas funerarias, …) y comienzan a desarrollar una tecnología capaz de fabricar herramientas con usos específicos.


Nuestra especie surgió en África, pero hay muy pocos fósiles de esos primeros individuos. De hecho, se supone que los problemas climáticos estuvieron a punto de causar la extinción de la especie. Una mejora de las condiciones provocó una expansión por el resto de los continentes, durante la cual fueron desplazando a los primitivos pobladores de esas áreas (neandertales y H. erectus) Posteriormente aparecieron asentamientos estables, la agricultura, la ganadería…

A partir de aquí comienza la Historia

Origen de la vida y evolucion  

Evolucion biologica

Origen de la vida y evolucion  

Evolucion biologica

Advertisement