Issuu on Google+

ΔΗΜΟΚΡΙΤΕΙΟ ΠΑΝΕΠΙΣΤΗΜΙΟ ΘΡΑΚΗΣ ΤΜΗΜΑ ΜΟΡΙΑΚΗΣ ΒΙΟΛΟΓΙΑΣ ΚΑΙ ΓΕΝΕΤΙΚΗΣ

ΔΙΠΛΩΜΑΤΙΚΗ ΕΡΓΑΣΙΑ

«Μελέτη και αξιολόγηση των επιπέδων έκφρασης των πρωτεϊνών HURP και Aurora A σε διάφορους τύπους καρκίνου»         ΟΝΟΜΑΤΕΠΩΝΥΜΟ: ΤΖΩΡΤΖΗΣ ΚΩΝΣΤΑΝΤΙΝΟΣ-ΝΕΚΤΑΡΙΟΣ ΑΕΜ: 773 ΕΠΙΒΛΕΠΟΥΣΑ   ΚΑΘΗΓΗΤΡΙΑ: Δρ. ΚΟΦΦΑ ΜΑΡΙΑ, Επίκουρος Καθηγήτρια Κυτταρικής Βιολογίας του Τµήµατος Μοριακής Βιολογίας & Γενετικής του Δηµοκρίτειου Πανεπιστηµίου Θράκης ΕΡΓΑΣΤΗΡΙΟ ΜΟΡΙΑΚΗΣ ΚΥΤΤΑΡΙΚΗΣ ΒΙΟΛΟΓΙΑΣ, ΚΥΤΤΑΡΙΚΟΥ ΚΥΚΛΟΥ & ΠΡΩΤΕΟΜΙΚΗΣ

Αλεξανδρούπολη, Ιούλιος 2012


ΠΕΡΙΕΧΟΜΕΝΑ ΠΕΡΙΛΗΨΗ………………………………………………………………………………….4 ABSTRACT………………………………………………………………………………….5 1. ΕΙΣΑΓΩΓΗ…………………………………………………………………………..7 1.1 Τύποι καρκίνου που µελετώνται σε αυτή την εργασία.........................................8 1.1.1 Επιδηµιολογικά στοιχεία............................................................................10 1.1.2 Παθοφυσιολογία – Ιστολογία....................................................................11 1.1.3 Ταξινόµηση και σταδιοποίηση των καρκινικών όγκων............................13 1.1.4 Θεραπεία των µελετώµενων τύπων καρκίνου...........................................14 1.1.5 Καρκινικοί βιοδείκτες (cancer biomarkers)……………………………...16 1.2 Κυτταρικός κύκλος……………………………………………………………...17 1.3 Κυτταρικός σκελετός – Μικροσωληνίσκοι……………......................................19 1.4 Ο ρόλος της πρωτεϊνης Ran..................................................................................20 1.5 Η κινάση Aurora A...............................................................................................21 1.6 Η πρωτεϊνη HURP................................................................................................23 1.6.1 Ο ρόλος και η λειτουργία της HURP στον κυτταρικό κύκλο...................23 1.6.2 HURP και καρκίνος...................................................................................27 1.7 Σκοπός της εργασίας.............................................................................................28 2. ΜΕΘΟΔΟΙ & ΥΛΙΚΑ.................................................................................................29 2.1 Γενικό πλάνο των πρωτοκόλλων.........................................................................30 2.2 Αποµόνωση RNA µε TRI Reagent……………………………………………...31 2.3 Κατεργασία µε Dνάση..........................................................................................34 2.4 Αντίστροφη µεταγραφή για τη δηµιουργία cDNA……………………………...35 2.5 Αντίδραση της Real-time RNA µε το πρωτόκολλο των δύο βηµάτων................37 2.6 Μέθοδος ποσοτικοποίησης και ανάλυσης αποτελεσµάτων.................................42 2.7 Παρασκευή τοµών από ιστό µονιµοποιηµένο µε φορµαλδεϋδη και εµβαπτισµένο σε παραφίνη...................................................................................44 2.8 Ανοσοφθορισµός σε τοµές ιστού µονιµοποιηµένου µε φορµαλδεϋδη και Εµβαπτισµένου σε παραφίνη……………………………………………………44 2.9 Τυποποιηµένες συσκευασίες αντιδραστηρίων…………………………………..49 2.10 Stock διαλύµατα...............................................................................................50 3. ΑΠΟΤΕΛΕΣΜΑΤΑ.....................................................................................................52 3.1 Μελέτη της γονιδιακής έκφρασης της HURP και της Aurora A σε διάφορους τύπους καρκίνου – Εισαγωγή................................................................................53 3.2 Αξιολόγηση της γονιδιακής έκφρασης της HURP και της Aurora A στον καρκίνο των ωοθηκών..................................................................................54 3.3 Αξιολόγηση της γονιδιακής έκφρασης της HURP και της Aurora A στον καρκίνο του µαστού......................................................................................59 3.4 Αξιολόγηση της γονιδιακής έκφρασης της HURP και της Aurora A στον καρκίνο του ενδοµητρίου.............................................................................63 3.5 Αξιολόγηση της γονιδιακής έκφρασης της HURP και της Aurora A στον καρκίνο του παγκρέατος...............................................................................65 3.6 Αξιολόγηση της γονιδιακής έκφρασης της HURP και της Aurora A στον καρκίνο του παχέος εντέρου.........................................................................65 3.7 Μελέτη της έκφρασης της HURP σε επίπεδο πρωτεϊνης – Αναζήτηση µεθόδου ανάκτησης των αντιγονικών επιτόπων.................................................................68 4. ΣΥΖΗΤΗΣΗ................................................................................................................73

 

2  


4.1 Αξιολόγηση των επιπέδων έκφρασης της HURP και της Aurora A σε διάφορους τύπους καρκίνου..................................................................................................74 4.2 Εύρεση συνθηκών για µελέτη της HURP σε τοµές καρκινικού ιστού µε συνεστιακό µικροσκόπιο......................................................................................76 Βιβλιογραφία....................................................................................................................78

 

3  


ΠΕΡΙΛΗΨΗ Η πρωτεϊνη HURP (Hepatoma Up-Regulated Protein), πρόσφατα χαρακτηρισµένη ως παράγοντας που συνδέεται µε το ηπατοκυτταρικό καρκίνωµα, είναι µία πυρηνική ΜΑΡ πρωτεϊνη (Microtubule Associated Protein). Η HURP ελέγχεται από δύο πρωτεϊνες, την ιµπορτίνη-β, η οποία την εισάγει στον πυρήνα µέσω του NLS (Nuclear Localization Signal) και την Ran-GTP, η οποία την απελευθερώνει από την ιµπορτίνη-β και µε αυτό τον τρόπο ενεργοποιεί τη δράση της στους µικροσωληνίσκους. Χαρακτηρίζεται από χρονοειδικότητα, αφού τα επίπεδα της είναι αυξηµένα στη φάση της µίτωσης, και ιστοειδικότητα διότι ανιχνεύονται αυξηµένα επίπεδα στο εµβρυϊκό ήπαρ, στο πάγκρεας και στο παχύ έντερο. Η HURP φαίνεται να έχει την ικανότητα ενδοµοριακών αλληλεπιδράσεων µεταξύ του άµινοκαι καρβοξυ- τελικού της άκρου. Φωσφορυλιώνεται από την κινάση Aurora A, στο καρβοξυτελικό άκρο και µε αυτό τον τρόπο πιθανώς απελευθερώνεται το αµινοτελικό άκρο και αλληλεπιδρά µε τους µικροσωληνίσκους. H λειτουργία της δεν είναι εξακριβωµένη πλήρως, αλλά είναι υπεύθυνη για την σταθερότητα και τη δεσµοποίηση των µικροσωληνίσκων. Επιπλέον, διαδραµατίζει σηµαντικό ρόλο είτε άµεσο είτε έµµεσο στην ενεργοποίηση του σηµείου ελέγχου, το οποίο είναι υπεύθυνο για τον σχηµατισµό της µιτωτικής ατράκτου. Αυξηµένα επίπεδα της γονιδιακής έκφρασης της HURP σχετίζονται µε το HCC, τον καρκίνο του µαστού και του παχέος εντέρου, και µε τον καρκίνο της ουροδόχου κύστεως από µεταβατικό επιθήλιο, µε αποτέλεσµα να θεωρείται ότι η HURP παίζει ρόλο στην καρκινογένεση. Στην πραγµατικότητα, έχει αποδειχθεί ότι η HURP έχει µετασχηµατιστική δράση. Από την άλλη, η Aurora A είναι µία κινάση σερίνης/θρεονίνης που εντοπίζεται στο κεντροσωµάτιο κατά τη µεσόφαση, ενώ µετατοπίζεται στη µιτωτική άτρακτο κατά τα πρώιµα στάδια της µίτωσης, και καταστρέφεται µετά την ανάφαση. Η ενεργοποίηση της Aurora A απαιτείται για την είσοδο στη µίτωση, την ωρίµανση των κεντροσωµατίων, το διαχωρισµό τους και την ευθυγράµµιση των χρωµοσωµάτων, και η απενεργοποίηση χρειάζεται για την έξοδο από τη µίτωση. Συνηθίζεται να υπερεκφράζεται η Aurora A σε διάφορες µορφές επιθηλιακού καρκίνου, συµπεριλαµβανοµένου του καρκίνου του µαστού, των ωοθηκών, του παχέος εντέρου, και του παγκρέατος. Λόγω της µετασχηµατιστικής ικανότητας, θεωρείται ότι η Aurora A είναι µία ογκοπρωτεϊνη. Στα πλαίσια της συγκεκριµένης εργασίας, µελετήθηκαν δείγµατα καρκινικού και παρακείµενου, όταν ήταν δυνατό, φυσιολογικού ιστού µε πειράµατα qRT real-time PCR, προκειµένου να εξετασθούν τα επίπεδα γονιδιακής έκφρασης της HURP και της Aurora A σε διάφορες µορφές καρκίνου. Συγκεκριµένα, µελετήθηκαν ο καρκίνος του µαστού, γυναικολογικοί καρκίνοι (καρκίνος των ωοθηκών, του ενδοµητρίου, του τραχήλου της µήτρας), αλλά και ο καρκίνος του παχέος εντέρου και του παγκρέατος. Επιπλέον, βάσει των αποτελεσµάτων που εξήχθησαν έγινε στατιστική ανάλυση, για να βρεθεί αν υπάρχει συσχέτιση µεταξύ των επιπέδων γονιδιακής έκφρασης και διάφορων κλινικοπαθολογικών χαρακτηριστικών, αλλά έγινε και προσπάθεια συσχέτισης µε τη χηµειοθεραπευτική αγωγή, όπου αυτό ήταν δυνατό. Σκοπός της εργασίας αυτής, επίσης, ήταν να βρεθούν οι κατάλληλες πειραµατικές συνθήκες, προκειµένου να είναι δυνατή η παρατήρηση της πρωτείνης HURP σε τοµές ιστού προερχόµενου από τις µελετώµενες µορφές καρκίνου. Με αυτόν τον τρόπο θα είναι δυνατό να γίνει ποσοτικοποίηση της HURP σε ανθρώπινα καρκινικά κύτταρα και να µελετηθούν τα επίπεδα έκφρασής της και σε επίπεδο πρωτεϊνης.  

4  


Τα αποτελέσµατα που έχουµε για την γονιδιακή έκφραση της HURP σε δείγµατα από ασθενείς µε διάφορες µορφές καρκίνου δείχνουν ότι η έκφραση της HURP σχετίζεται µε τον καρκίνο των ωοθηκών, του ενδοµητρίου, του µαστού και του παχέος εντέρου, δίνοντας έτσι έµφαση στο γεγονός ότι το γονίδιο της HURP θα µπορούσε να αποτελεί ένα ογκογονίδιο. Η έκφραση της HURP θα µπορούσε να είναι ένας πολλά υποσχόµενος βιοδείκτης για την κακοήθεια και τη λεµφαδενική διήθηση στον καρκίνο των ωοθηκών, αλλά και για το βαθµό διαφοροποίησης στον καρκίνο του ενδοµητρίου. Αντίθετα, δεν µπορεί να εξαχθεί κανένα συµπέρασµα σχετικά µε την έκφραση της Aurora A στους µελετώµενους καρκίνους, αλλά πιθανόν η εξέταση ενός µεγαλύτερου αριθµού δειγµάτων ίσως να έδεινε κάποιες απαντήσεις στα ερωτήµατά µας.

 

5  


ABSTRACT The recently described HURP (Hepatoma Up-Regulated Protein) protein has been associated with hepatocellular carcinoma. HURP is a nuclear MAP (Microtubule Associated Protein) protein and is a component of the chromatin-induced pathway for spindle assembly. In particular, Ran-GTP regulates the binding of importin-β to HURP and controls its association with the mitotic spindle. The HURP expression exhibits tissue specificity and it is cell cycle regulated. It has been reported that HURP is phosphorylated by Aurora A kinase and in this manner the N-terminus is released from the repressive association with the Cterminus of HURP. This N-terminal region is responsible of binding to microtubules. The activity of HURP is required for proper Ran-spindle formation and stimulates the microtubule bundling and stabilization. Elevated HURP gene expression is highly associated with HCC, colon and breast cancers, and urinary bladder transitional-cell carcinoma, suggesting that HURP may play a role in carcinogenesis. In fact, it has been proved that HURP, when abnormally upregulated, possesses transforming activity. On the other hand, Aurora A is a serine/threonine kinase, which is localized at centrosome during interphase, translocated to mitotic spindles in early mitotic phase and degraded after metaphase-anaphase transition. Activation of Aurora A is required for mitotic entry, centrosome maturation, centrosome separation and chromosome alignment, and inactivation is also necessary for exit from mitosis. The Aurora-A mRNA and protein levels are increased in epithelial malignant tumours, including breast, colon, bladder, ovarian and pancreatic cancers. Due to its transforming activity, Aurora A is an oncoprotein. The purpose of this diploma thesis was to study the gene expression levels of HURP and Aurora-A genes by examining samples of tumour and normal tissues from several carcinomas, performing qRT real-time PCR experiments. We examined breast cancer, gynecological carcinomas (ovarian, endometrial and cervical cancers), colon and pancreatic cancers. Furthermore, a statistical analysis was performed in order to examine if there is any statistically significant association between the gene expression levels and clinicopathological characteristics, and between the gene expression levels and the received chemotherapy. Another purpose of this diploma thesis was to find the proper experimental conditions in order to study the localization of HURP on human cancer tissue sections, using immunofluorescence and the confocal microscope. This would give us the possibility to quantify HURP on human cancer cells, and study its protein levels at different carcinoma types of interest. The results that we have collected so far, about the gene expression levels of HURP in human tumors, indicate that there is an association between HURP overexpression and ovarian, endometrial, breast and colon cancers, emphasizing the fact that HURP could act as an oncogene. The HURP gene expression could be a very promising biomarker of malignancy and lymph node involvement in ovarian cancer, and histologic differentiation in endometrial cancer. On the contrary, we cannot make any conclusions about Aurora A gene expression in studied human tumors, but the analysis of wider sample groups could give an answer.

 

6  


1. ΕΙΣΑΓΩΓΗ

 

7  


1.1 Τύποι καρκίνου που µελετώνται σε αυτή την εργασία α) Καρκίνος του µαστού O καρκίνος του µαστού αναφέρεται σε κακοήθη καρκίνο, που αναπτύσσεται από κύτταρα του µαστού. Προκαλείται από ανεξέλεγκτο πολλαπλασιασµό παθολογικών κυττάρων στην περιοχή του µαστού, και αποτελεί ουσιαστικά κυτταρική νόσο. Αποτελεί µια από τις συχνότερα εµφανιζόµενες µορφές καρκίνου παγκοσµίως και είναι η πρώτη σε αριθµό κρουσµάτων στο γυναικείο πληθυσµό. Παρατηρείται εξαιρετικά σπάνια στους άνδρες µε περίπου 100 φορές µικρότερη συχνότητα συγκριτικά µε τις γυναικές. Όσον αφορά τις γυναίκες, όλες αντιµετωπίζουν τον κίνδυνο εµφάνισης της νόσου, αλλά όχι στον ίδιο βαθµό. Πάντα προκαλείται από κάποια γενετική ανωµαλία. Έχει γίνει µέχρι σήµερα µεγάλη πρόοδος στην κατανόηση του µηχανισµού ανάπτυξης και την παθογένεση αυτής της µορφής καρκίνου, και οι έρευνες πάνω σε αυτό τον τοµέα συνεχίζονται µε σκοπό ακόµα και των πιο προχωρηµένων σταδίων καρκινικών όγκων.

Εικόνα 1: (αριστερά) Tα βασικά τµήµατα του γυναικείου µαστού. Από τους πόρους (ducts) και τους λοβούς (lobes) προκύπτουν οι συχνότερες µοερφές καρκίνου του µαστού. (δεξιά) Το γυναικείο αναπαραγωγικό σύστηµα. Διακρίνονται οι περιοχές από τις οποίες προκύπτουν οι κυριότεροι τύποι γυναικολογικών καρκίνων, δηλαδή οι ωοθήκες (ovaries), το ενδοµήτριο (endometrium) και ο τράχηλος της µήτρας (cervix).

β) Γυναικολογικοί καρκίνοι Με τον όρο «γυναικολογικός καρκίνος» εννοείται κάθε µορφή καρκίνου που ξεκινάει από διάφορες περιοχές του γυναικείου αναπαραγωγικού συστήµατος, και συγκεκριµένα από τον τράχηλο της µήτρας, το ενδοµήτριο, τις ωοθήκες και τον κόλπο. Στα πλαίσια της συγκεκριµένης µελέτης ασχοληθήκαµε µε τους καρκίνους των ωοθηκών, του τραχήλου της µήτρας και του ενδοµητρίου. Κάθε µορφή γυναικολογικού καρκίνου είναι µοναδική µε διαφορετικά συµπτώµατα, διαφορετικούς παράγοντες κινδύνου και διαφορετικές στρατηγικές πρόληψης. Όλες οι γυναίκες παρουσιάζουν κίνδυνο εµφάνισης κάποιας από αυτές τις µορφές καρκίνου, µε την ηλικία να αποτελεί έναν παράγοντα που αυξάνει αυτό τον

 

8  


κίνδυνο. Ωστόσο, όταν οι γυναικολογικοί καρκίνοι εντοπίζονται νωρίς, η θεραπεία είναι περισσότερο αποτελεσµατική.

γ) Καρκίνος του παγκρέατος O καρκίνος του παγκρέατος αποτελεί µια διαφορετική µορφή καρκίνου σε σχέση µε τις παραπάνω. Έχει χαµηλή πρόγνωση και αποτελεί αρκετά επιθετική µορφή καρκίνου. Το 95% των περιπτώσεων είναι αδενοκαρκινώµατα, που προέρχονται από µετασχηµατισµένα κύτταρα της εξωκρινούς περιοχής του παγκρέατος, ενώ η µειονότητα των περιπτώσεων προέρχονται από κύτταρα των νησίδων και ταξινοµούνται ως νευροενδοκρινείς όγκοι.

Εικόνα 2: Στην εικόνα εντοπίζεται η θέση του παγκρέατος, πίσω ακριβώς από το στοµάχι.

δ) Καρκίνος του παχέος εντέρου Ο καρκίνος του παχέος εντέρου προκύπτει από ανεξέλεγκτο πολλαπλασιασµό των κυττάρων του παχέος εντέρου, και συγκεκριµένα στις περιοχές του τυφλού, του ορθού και του κόλον. Τα περισσότερα περιστατικά καρκίνου του παχέος εντέρου (85%) διαγνώσκονται σε άτοµα ηλικίας άνω των 60 ετών, κι έτσι η αυξηµένη ηλικία είναι ένας από τους σηµαντικότερους παράγοντες κινδύνου εµφάνισης της νόσου. Η µειονότητα των περιστατικών οφείλεται στην παρουσία γενετικού υπόβαθρου. Ωστόσο, έχει βρεθεί ότι, επειδή παίζει ρόλο η δίαιτα που ακολουθεί ένα άτοµο, είναι σηµαντικό να καταναλώνονται φυτικές ίνες για τη µείωση της πιθανότητας εµφάνισης καρκίνου του παχέος εντέρου. Αντίθετα, η κατανάλωση κόκκινου κρέατος αυξάνει την πιθανότητα εµφάνισης καρκίνου, και συγκεκριµένα, η ηµερήσια κατανάλωση 100-120γρ. κόκκινου κρέατος αυξάνει την πιθανότητα µέχρι και 30%.

Εικόνα 3: Οι περιοχές του παχέος εντέρου στις οποίες κυρίως εµφανίζεται η ανάπτυξη όγκων είναι το ορθό (rectum), το τυφλό (appendix) και κάποιες άλλες περιοχές, όπως το σιγµοειδές (sigmoid colon).

 

9  


1.1.1 Επιδηµιολογικά στοιχεία Έχει παρατηρηθεί ότι διαφορετικές µορφές καρκίνου είναι κυρίαρχες σε διαφορετικές περιοχές του πλανήτη. Παγκοσµίως, ο καρκίνος του µαστού αποτελεί το 22,9% του συνόλου των περιστατικών καρκίνου στις γυναίκες. Το 2008, ο καρκίνος του µαστού προκάλεσε 458.503 θανάτους παγκοσµίως (13,7% των θανάτων από καρκίνο στις γυναίκες). Όσον αφορά τα ποσοστά επιβίωσης στο Δυτικό Κόσµο είναι πολύ καλά, αφού για παράδειγµα στην Αγγλία το 84% των γυναικών που διαγνώσκονται µε καρκίνο του µαστού, επιβιώνουν από αυτό για επιπλέον τουλάχιστον 5 χρόνια. Στις αναπτυσσόµενες χώρες, τα ποσοστά επιβίωσης είναι χαµηλότερα. O καρκίνος των ωοθηκών είναι ο δεύτερος συχνότερος γυναικολογικός καρκίνος και ο πιο θανατηφόρος. Το 2010 προκάλεσε σχεδόν 14.000 θανάτους στις ΗΠΑ. Το ποσοστό πενταετούς επιβίωσης από τον καρκίνο των ωοθηκών, όσον αφορά όλα τα στάδια ανάπτυξης, είναι 47%, αλλά όταν διαγνώσκεται στο πρώτο στάδιο ανάπτυξης, τότε το ποσοστό επιβίωσης είναι 92,7%. Ωστόσο, κάτι τέτοιο δεν συµβαίνει συχνά, αφού ο κακρίνος των ωοθηκών έχει χαµηλή πρόγνωση. Δεν µπορεί να διαγνωσθεί επιτυχώς σε πρώιµα στάδια, γεγονός που σηµαίνει πως οι περισσότερες περιπτώσεις εντοπίζονται σε προχωρηµένα στάδια, και µάλιστα το 60% των γυναικών στις οποίες ανιχνεύεται η συγκεκριµένη µορφή καρκίνου βρίσκονται σε στάδιο III ή IV. O καρκίνος του ενδοµητρίου αποτελεί την συχνότερη µορφή γυναικολογικού καρκίνου στις ΗΠΑ, µε περισσότερες από 35.000 γυναίκες να διαγνώσκονται κάθε χρόνο µε αυτή τη µορφή καρκίνου. Εµφανίζεται συχνότερα ανάµεσα στις γυναίκες ηλικίας 55 και 65 ετών, και πολύ σπάνια σε ηλικίες κάτω των 40 ετών. Οι γυναίκες µε Καυκάσια καταγωγή έχουν 40% µεγαλύτερη πιθανότητα εµφάνισης αυτής της µορφής καρκίνου, ενώ οι γυναίκες Αφρο-αµερικανικής καταγωγής έχουν διπλάσιο κίνδυνο θανάτου από καρκίνο του ενδοµητρίου σε περίπτωση εµφάνισης. Η πρόγνωση πενταετούς επιβίωσης µειώνεται ραγδαία, όσο αυξάνεται το στάδιο στο οποίο ανιχνεύεται η ασθένεια. Συγκεκριµένα, το 90% των ασθενών στις οποίες θα ανιχνευθεί καρκίνος του ενδοµητρίου σταδίου ΙΑ θα επιβιώσουν για επιπλέον 5 χρόνια, ενώ µόλις το 16% των ασθενών θα επιβιώσει, αν διαγνωσθεί καρκίνος σταδίου IV. Ο καρκίνος του τραχήλου της µήτρας είναι ο δεύτερος πιο κοινός και η πέµπτη πιο θανατηφόρος µορφή καρκίνου στις γυναίκες. Το 80% των περιστατικών εντοπίζονται σε αναπτυσσόµενες χώρες. Στην Ε.Ε. υπήρξαν 34.000 νέα περιστατικά και πάνω από 16.000 θάνατοι για το 2004. Ωστόσο, για την Ελλάδα δεν είναι αρκετά συχνή µορφή καρκίνου, αφού βάσει στοιχείων του Cancer Research UK το 2008 εντοπίστηκαν 5,2 νέα περιστατικά ανά 100.000 άτοµα. Ο καρκίνος του παγκρέατος είναι η τέταρτη πιο θανατηφόρος µορφή καρκίνου παγκοσµίως. Συνήθως έχει φτωχή πρόγνωση ο καρκίνος του παγκρέατος, κάτι που φαίνεται και από το γεγονός ότι η πρόγνωση επιβίωσης για ένα έτος είναι 25%, και η πρόγνωση πενταετούς επιβίωσης είναι µόλις 6%. Σε περίπτωση µεταστάσεων ή αρκετά ανεπτυγµένων τοπικά όγκων, η µέση επιβίωση είναι 6 και 10 µήνες αντίστοιχα, ενώ η µη ενεργή επέµβαση στην περίπτωση των µεταστάσεων µειώνει την επιβίωση του ασθενούς σε µόλις 3-5 µήνες. Έχει βρεθεί, τέλος, πως το 20-30% των περιπτώσεων σχετίζεται µε το κάπνισµα.

 

10  


Εικόνα 4: Παρουσίαση για το 2008 της κατανοµής των περίπου 12,7 εκατοµµυρίων νέων περιστατικών των συχνότερων καρκινικών τύπων, όπως κατανέµονται σε διάφορες περιοχές του κόσµου.

O καρκίνος του παχέος εντέρου είναι η τέταρτη περισσότερο συχνή µορφή καρκίνου παγκοσµίως, αλλά είναι περισσότερο συχνή στις αναπτυγµένες χώρες, αφού έχει βρεθεί πως η εµφάνιση αυτής της µορφής καρκίνου σχετίζεται και µε τον τρόπο ζωής. Υπολογίζεται ότι παγκοσµίως το 2008 διαγνώσθηκαν περίπου 1,23 εκατόµµυρια νέα περιστατικά, και ήταν η αιτία για περίπου 608.000 θανάτους. Τα περιστατικά καρκίνου του παχέος εντέρου διαιρούνται σε τέσσερα στάδια (στάδιο Ι-IV) ανάλογα µε την ιστολογία και την παθοφυσιολογία του καρκίνου. Στην περίπτωση διάγνωσης και χειρουργικής επέµβασης σε ασθενείς µε καρκίνο σταδίου I, ο δείκτης πενταετούς επιβίωσης είναι 93%. Δυστυχώς, όµως, µόνο το 9% των περιστατικών διαγνώσκεται µε στάδιο Ι. Από την άλλη, στην περίπτωση του καρκίνου σταδίου IV, ο δείκτης πενταετούς επιβίωσης είναι µόλις 6%.

1.1.2 Παθοφυσιολογία – Ιστολογία Όσον αφορά τον καρκίνο του µαστού, οι δύο συχνότερες µ��ρφές που εµφανίζονται σε πρώιµα στάδια είναι το πορογενές καρκίνωµα in situ (DCIS) και το λοβιακό καρκίνωµα in situ (LCIS). Στο DCIS κάποια κύτταρα από τους πόρους του µαστού µετατρέπονται σε

 

11  


καρκινικά κύτταρα. Αυτά τα κύτταρα παραµένουν µέσα στους πόρους και δεν διασκορπίζονται σε γειτονικές περιοχές του ιστού. Στο LCIS παρατηρούνται κυτταρικές αλλαγές µέσα στους µαστικούς λοβούς. Αυτό δεν σηµαίνει ότι δηµιουργείται καρκίνος, αλλά έτσι υπάρχει µεγαλύτερη πιθανότητα για εµφάνιση καρκίνου του µαστού στο µέλλον. Ωστόσο, η συχνότερη µορφή καρκίνου του µαστού είναι ο διηθητικός πορογενής καρκίνος, αφού συναντάται στο 70-80% των περιστατικών. Στην περίπτωση αυτή µπορεί να έχει γίνει εξάπλωση των κυττάρων από τους πόρους στην γύρω περιοχή του µαστικού ιστού, και γι’ αυτό δεν πρέπει να συγχέεται µε το DCIS. Συχνά, περιγράφεται ως «µη ειδικός τύπος» (NOS – Not Otherwise Type). Τέλος, µια συχνή µορφή καρκίνου του µαστού που αξίζει να αναφέρουµε είναι ο διηθητικός λοβώδης καρκίνος του µαστού, που συναντάται περίπου στο 10% των περιπτώσεων. Είναι συνηθέστερη µορφή στις γυναίκες ηλικίας 45 έως 55 ετών. Το 90% των περιπτώσεων καρκίνου των ωοθηκών είναι επιθηλιακός καρκίνος. Ο επιθηλιακός καρκίνος των ωοθηκών ξεκινάει από την επιφανειακή στοιβάδα που καλύπτει τις ωοθήκες. Πιο συχνός είναι ο ορώδης επιθηλιακός καρκίνος. Άλλοι τύποι επιθηλιακού καρκίνου είναι ο βλεννώδης, ο ενδοµητριοειδής, ο αδιαφοροποίητος και ο µη ταξινοµήσιµος. Οι διάφοροι τύποι επιθηλιακού καρκίνου των ωοθηκών µπορούν να ταξινοµηθούν βάσει της συµπεριφοράς τους, δηλαδή πόσο γρήγορα µπορούν να αναπτύσσονται. Έτσι, υπάρχει ο οριακός καρκίνος (borderline), εκείνος που ανήκει στο στάδιο 1 (καλή διαφοροποίηση), στάδιο 2 (µέτρια διαφοροποίηση) και στάδιο 3 (χαµηλή ή µη διαφοροποίηση). Τα καρκινικά κύτταρα που µοιάζουν µε τα φυσιολογικά κύτταρα περιγράφονται ως καλά διαφοροποιηµένα. Άλλοι τύποι καρκίνου των ωοθηκών, εκτός από τον επιθηλιακό, είναι εκείνος της αναπαραγωγικής σειράς και τα σαρκώµατα. Το 95% των περιπτώσεων καρκίνου του ενδοµητρίου είναι αδενοκαρκινώµατα. Το «αδενο-» εννοεί πως τα κύτταρα που έχουν γίνει καρκινικά προέρχονται από τον αδενικό ιστό. Το «-καρκίνωµα» σηµαίνει πως ο καρκίνος έχει ξεκινήσει από το επιθήλιο. Υπάρχουν τρεις βασικοί τύποι αδενοκαρκινώµατος: το ενδοµητριοειδές αδενοκαρκίνωµα, το θηλώδεςορώδες καρκίνωµα, και το «καθαρού κυττάρου» καρκίνωµα (clear cell carcinoma). Στο ενδοµήτριο συναντώνται σχετικά συχνά τα σαρκώµατα. Σε αυτή την περίπτωση δηµιουργείται καρκίνος από κύτταρα της µυϊκής στιβάδας του ενδοµητρίου, και δεν παρουσιάζονται πολλές οµοιότητες µε τον καρκίνο του ενδοµητρίου. Υπάρχουν αρκετοί υποτύποι, και αναπτύσσονται από τον µυ ή τα αιµοφόρα αγγεία. Ο συχνότερος τύπος σαρκώµατος είναι το λειοµυοσάρκωµα. Σχετικά µε τον καρκίνο του τραχήλου της µήτρας, υπάρχουν δύο βασικοί τύποι: o καρκίνος πλακωδών κυττάρων και το αδενοκαρκίνωµα. Τα πλακώδη κύτταρα είναι εκείνα που καλύπτουν την εξωτερική επιφάνεια του τραχήλου, και από αυτά προκύπτει η πιο συχνή µορφή καρκίνου του τραχήλου της µήτρας. Η πιο συχνή µορφή καρκίνου του παγκρέατος είναι το αδενοκαρκίνωµα (ορώδες αδενοκαρκίνωµα) που χαρακτηρίζεται από µέτρια έως χαµηλά διαφοροποιηµένες δοµές των αδένων. Αυτοί οι καρκίνοι ξεκινούν από κύτταρα των αγωγών (ducts) του παγκρέατος, οι οποίοι φέρουν τα παγκρεατικά υγρά προς τον κύριο παγκρεατικό αγωγό και το δωδεκαδάκτυλο. Υπάρχει η ιδιαιτερότητα ότι δεν είναι πάντα σίγουρο πως ο όγκος που βρίσκεται στο πάγκρεας έχει αναπτυχθεί από εκείνον. Ο δεύτερος συχνότερος τύπος καρκίνου εξωκρινούς παγκρέατος είναι ο βλεννώδης, ο οποίος έχει κάπως καλύτερη πρόγνωση σε σχέση µε τον ορώδη. Άλλες µορφές εξωκρινούς παγκρεατικού καρκίνου είναι το ηπατοειδές καρκίνωµα, το κολλοειδές καρκίνωµα, το αδιαφοροποίητο καρκίνωµα και το αδιαφοροποίητο καρκίνωµα µε γιγάντια κύτταρα οµοιάζοντα των οστεοκλαστών. Στο  

12  


πάγκρεας συναντώνται και ενδοκρινείς παγκρεατικοί όγκοι που αντιµετωπίζονται διαφορετικά από τους εξωκρινείς. Αποκαλούνται και νευροενδοκρινείς όγκοι, και το ένα τρίτο αυτών εκκρίνουν ορµόνες. Πάνω από το 95% των διαγνωσµένων περιστατικών καρκίνου του παχέος εντέρου είναι αδενοκαρκινώµατα. Αυτο σηµαίνει πως o καρκίνος ξεκίνησε από αδενικά κύτταρα στο επιθήλιο του παχέος εντέρου. Υπάρχουν δύο σπάνιες µορφές αδενοκαρκινώµατος στο κόλον και το ορθό, το βλεννώδες καρκίνωµα και το καρκίνωµα του σφραγιστικού δακτυλιδιού (signet ring carcinoma). Αυτοί οι όροι προκύπτουν από το πώς φαίνονται τα κύτταρα στο µικροσκόπιο. Υπάρχει επίσης το καρκίνωµα των πλακωδών κυττάρων (squamous cell cancer), το οποίο ξεκινάει από τα πλακώδη κύτταρα του επιθηλίου του παχέος εντέρου. Άλλες σπανιότερες από τα αδενοκαρκινώµατα µορφές καρκίνου του παχέος εντέρου είναι το σάρκωµα, το λύµφωµα και ο καρκινοειδής όγκος, ο οποίος αναπτύσσεται σε ιστούς που παράγουν ορµόνες και αυξάνεται αργά. Το καρκινοειδές είναι γνωστό και ως νευροεκνδοκρινής όγκος.

1.1.3 Ταξινόµηση και σταδιοποιήση των καρκινικών όγκων Από την Αµερικανική Κοινή Επιτροπή για τον Καρκίνο (American Joint Committee on Cancer - AJCC) έχει αναπτυχθεί και εγκαθιδρυθεί το σύστηµα ταξινόµησης ΤΝΜ, σύµφωνα µε το οποίο γίνεται ταξινόµηση των καρκινικών όγκων χρησιµοποιώντας τις κατηγορίες Τ, Ν και Μ, µε σκοπό την κατάταξη των όγκων βάσει: • του µεγέθους του πρωτογενούς όγκου (primary tumor – T) • του βαθµού εµπλοκής των περιφερικών λεµφικών αδένων (lymph nodes – N), και • της παρουσίας ή απουσίας µεταστάσεων (metastasis – M), δηλαδή καρκινικών όγκων που έχουν αποκολληθεί από τον πρωτογενή όγκο κι έχουν µετατοπιστεί προς άλλα όργανα ή περιφερικούς λεµφαδένες. Συγκεκριµένα, η κατηγορία Τ περιγράφει ουσιαστικά τον πρωτογενή όγκο. Ο καρκινικός όγκος µετράται σε εκατοστά ή χιλιοστά. • TX- µη µετρήσιµος όγκος • Τ0 – απουσία ή αδυναµία ανίχευσης πρωτογενούς όγκου • Τis – τα καρκινικά κύτταρα αναπτύσσονται µόνο στο επιφανειακό στρώµα του ιστού, χωρίς να αναπτύσσονται προς βαθύτερα στρώµατα (προ-καρκινική φάση) • Τ1, Τ2, Τ3, Τ4 – η καθεµιά από αυτές τις κατηγορίες περιγράφει το µέγεθος του όγκου και/ή το βαθµό διήθησης σε γειτονικές δοµές. Όσο µεγαλύτερος ο αριθµός Τ, τόσο µεγαλύτερος είναι ο όγκος και/ή τόσο περισσότερο έχει αναπτυχθεί προς γειτονικούς ιστούς. Η κατηγορία Ν περιγράφει αν ο καρκινικός όγκος έχει διασπαρεί προς τους γειτονικούς λεµφαδένες. • ΝΧ – αδυναµία αξιολόγησης των γειτονικών λεµφαδένων • Ν0 – οι γειτονικοί λεµφαδένες δεν περιέχουν δείγµα καρκινικών κυττάρων

 

13  


• • •

Ν1, Ν2, Ν3 – οι συγκεκριµένες κατηγορίες περιγράφουν το µέγεθος, την τοποθεσία και/ή τον αριθµό των λεµφαδένων που εµπλέκονται. Όσο µεγαλύτερος ο αριθµός Ν, τόσο περισσότεροι λεµφαδένες εµπλέκονται στην καρκινογένεση. Η κατηγορία Μ σχετίζεται µε τις µεταστάσεις. ΜΧ – µη αξιολογήσιµες µεταστάσεις Μ0 – απουσία µεταστάσεων Μ1 – παρουσία µεταστάσεων

Αφού γίνει η κατηγοριοποίηση των καρκινικών όγκων βάσει του συστήµατος TNM, ακολουθεί η σταδιοποίηση. • Στάδιο Ι – ο καρκινικός όγκος είναι µικρός, εντοπίσιµος και συνήθως θεραπεύσιµος • Στάδιο ΙΙ και ΙΙΙ – οι καρκινικοί όγκοι είναι τοπικά αναπτυγµένοι αρκετά και/ή έχουν επεκταθεί σε γειτονικούς λεµφαδένες • Στάδιο ΙV – ο καρκίνος είναι, συνήθως, µεταστατικός, και γενικά θεωρείται µη χειρουργήσιµος Εκτός του παραπάνω συστήµατος κατηγοριοποίησης των καρκινικών όγκων, από τη Διεθνή Οµοσπονδία Γυναικολόγων και Μαιευτήρων (International Federation of Gynecologists and Obstetricians – FIGO) έχει αναπτυχθεί ένα σύστηµα κατηγοριοποίησης, που αφορά τις µορφές καρκίνου του γυναικείου αναπαραγωγικού συστήµατος. Όσον αφορά τον καρκίνο του παχέος εντέρου, εκτός από το σύστηµα ΤΝΜ, χρησιµοποιείται για την σταδιοποίηση και το σύστηµα κατά Dukes. Στην περίπτωση έχουµε τα κατά Dukes στάδια A, B, C και D. Στο στάδιο Α ο όγκος βρίσκεται µόνο στην εσωτερική πλευρά του επιθηλίου ή αναπτύσσεται ελαφρά προς τη µυϊκή στιβάδα. Στο στάδιο Β ο όγκος αναπτύσσεται εντός της µυϊκής στιβάδας, και στο στάδιο C ο καρκίνος έχει επεκταθεί προς τουλάχιστον έναν λεµφαδένα στην κοντική περιοχή του παχέος εντέρου. Στο στάδιο D κατά Dukes έχει ήδη προκληθεί µετάσταση σε κάποια άλλη περιοχή εκτός του παχέος εντέρου, όπως στο ήπαρ ή τους πνεύµονες.

1.1.4 Θεραπεία των µελετώµενων τύπων καρκίνου Οι θεραπείες για τον καρκίνο του µαστού, αλλά και τις υπόλοιπες µορφές γυναικολογικών καρκίνων, περιλαµβάνουν τη χειρουργική επέµβαση, την ακτινοθεραπεία, τη χηµειοθεραπεία, την ορµονοθεραπεία και τις βιολογικές µεθόδους θεραπείας. Είναι δυνατό κάποιος ασθενής να υποβληθεί σε έναν συνδυασµό αυτών των θεραπειών. Ωστόσο, είναι δύσκολο να δηµιουργηθεί γενίκευση για τη θεραπεία αυτών των µορφών καρκίνου, γιατί υπάρχουν πολλές διαφορετικές περιπτώσεις, και για την επιλογή της κατάλληλης θεραπείας λαµβάνονται υπόψιν διάφοροι παράγοντες, όπως το µέγεθος του όγκου, το στάδιο του καρκίνου ή η ύπαρξη συγκεκριµένων υποδοχέων στην επιφάνεια των καρκινικών κυττάρων. Αρκετά συνηθισµένη µορφή θεραπείας είναι η χηµειοθεραπεία. Η χηµειοθεραπεία περιλαµβάνει τη χρήση φαρµάκων που καταστρέφουν τα καρκινικά κύτταρα µέσω διακοπής της ανάπτυξής τους, και µπορεί να εφαρµοστεί είτε πριν από µια χειρουργική επέµβαση, που έχει στόχο την αφαίρεση του όγ��ου (neoadjuvant therapy), είτε µετά την επέµβαση (adjuvant therapy) µε στόχο την παρεµπόδιση επανεµφάνισης ή εξάπλωσης του καρκίνου. Μπορεί να

 

14  


εφαρµοστεί χηµειοθεραπεία και στην περίπτωση που ο καρκίνος έχει εξαπλωθεί ή έχει υποτροπιάσει. Στην περίπτωση του καρκίνου του µαστού, τα πιο ευρέως διαδεδοµένα φάρµακα χηµειοθεραπείας είναι τα: κυκλοφοσφαµίδη (cyclophosphamide), επιρουβικίνη (epirubicin), 5FU (fluorouracil), µεθοτρεξάτη (methotrexate), µιτοµυκίνη (mitomycin), δοξορουβικίνη (doxorubicin), δοσεταξέλη (docetaxel). Είναι δυνατόν τα παραπάνω φάρµακα να χρησιµοποιούνται συνδυαστικά µεταξύ τους, και στην περίπτωση αυτή υπάρχουν πολλοί εφαρµόσιµοι συνδυασµοί φαρµάκων. Κάθε συνδυασµός φαρµάκων επιφέρει και διαφορετικές παρενέργειες. Σύµφωνα µε το NICE (National Institute for Health and Clinical Excellence), η χηµειοθεραπεία µετά από χειρουργική επέµβαση θα πρέπει να αποτελείται από 4 έως 8 κύκλους θεραπείας και να περιλαµβάνει συνδυασµό φαρµάκων. Όσον αφορά τον καρκίνο των ωοθηκών, συνήθως προτείνεται χηµειοθεραπεία µετά από χειρουργική επέµβαση και όταν ο καρκίνος είναι σταδίου Ic ή µεγαλύτερου σταδίου. Όταν γίνεται η πρώτη διάγνωση του καρκίνου, χορηγούνται τα χηµειοθεραπευτικά φάρµακα καρβοπλατίνη (carboplatin) ή καρβοπλατίνη σε συνδυασµό µε πακλιταξέλη (paclitaxel, εµπ.ονοµ.: Taxol). Σε περίπτωση υποτροπής του καρκίνου των ωοθηκών µπορεί να ακολουθηθεί διαφορετική χηµειοθεραπευτική προσέγγιση σε σχέση µε την αρχική. Σε αυτήν την περίπτωση µπορεί να χρησιµοποιηθούν: καρβοπλατίνη ή σισπλατίνη µαζί µε πακλιταξέλη, µόνο πακλιταξέλη ή λιποσώµατα δοξορουβικίνης (εµπορική ονοµασία: Caelyx ή Doxil). Μια εναλλακτική θεραπευτική προσέγγιση που ακολουθείται την τελευταία δεκαετία, όχι µόνο για τον καρκίνο των ωοθηκών, αλλά και για τον καρκίνο του παχέος εντέρου, του στοµάχου και για τα µεσοθηλιώµατα, είναι η υπέρθερµη διαπεριτοναϊκή χηµειοθεραπεία (Hyperthermic Intraperitoneal Chemotherapy – HIPEC). Σε αυτή την περίπτωση γίνεται αρχικά χειρουργική επέµβαση για αφαίρεση του καρκινικού όγκου, και στην συνέχεια χορηγείται στην περιτοναϊκή περιοχή του ασθενούς ένα θερµενόµενο διάλυµα (41oC – 42oC), το οποίο περιέχει και έναν χηµειοθεραπευτικό παράγοντα. Αυτή η εφαρµογή στοχεύει στην καταστροφή των υπολλειµάτων καρκινικών κυττάρων στον ασθενή, ενώ ταυτόχρονα βελτιώνει την απορρόφηση του φαρµάκου και µειώνει την έκθεσή του στις υπόλοιπες περιοχές του σώµατος. Στην περίπτωση του καρκίνου του ενδοµητρίου δεν συνηθίζεται να εφαρµόζεται η χηµειοθεραπεία σε πρώιµα στάδια του καρκίνου, αλλά κυρίως σε προχωρηµένα στάδια ή σε περιπτώσεις υποτροπής του καρκίνου του ενδοµητρίου. Ένα φάρµακο που χρησιµοποιείται συνήθως σε τέτοιες περιπτώσεις είναι η καρβοπλατίνη. Επίσης, συνηθίζεται να εφαρµόζεται ο συνδυασµός καρβοπλατίνη ή σισπλατίνη µε δοξορουβικίνη (εµπορική ονοµασία: Adriamycin). Ένας ακόµα συνδυασµός που εφαρµόζεται είναι εκείνος που περιλαµβάνει κυκλοφοσφαµίδη, δοξορουβικίνη και σισπλατίνη (ή καρβοπλατίνη). Σε φάση κλινικών δοκιµών στην Ευρώπη βρίσκεται και ο συνδυασµός σισπλατίνη, δοξορουβικίνη και πακλιταξέλη (Taxol). Στον καρκίνο του παγκρέατος εφαρµόζεται χηµειοθεραπεία µετά από χειρουργική επέµβαση για αφαίρεση του όγκου. Στόχος της χηµειοθεραπείας είναι να µειώσει τον κίνδυνο επανεµφάνισης του καρκίνου, αν ο όγκος έχει αφαιρεθεί πλήρως, ή να βοηθήσει στη µείωση του εναποµείναντος όγκου. Τα φάρµακα που συνηθίζεται να χρησιµοποιούνται είναι: 5FU (fluorouracil), καπεσιταβίνη (capecitabine) και γκεµσιταβίνη (gemcitabine, εµπ. oνοµ.: Gemzar). Το NICE προτείνει το gemcitabine κυρίως για περιπτώσεις παγκρεατικού καρκίνου προχωρηµένου σταδίου, αν και δεν συνιστάται για ασθενείς που είναι αρκετά άρρωστοι, γιατί το συγκεκριµένο φάρµακο έχει σηµαντικές παρενέργειες.

 

15  


Όταν ο καρκίνος του παχέος εντέρου διαγνώσκεται σε πρώιµο στάδιο, τότε η χειρουργική επέµβαση µπορεί να είναι αρκετή για τη θεραπεία της νόσου. Ωστόσο, όταν γίνεται αργότερα η διάγνωση, δηλαδή σε µεταγενέστερα στάδια του καρκίνου, τότε η χειριυργική επέµβαση δεν αρκεί για τη θεραπεία, και στην περίπτωση αυτή προτιµώνται θεραπείες που σκοπό έχουν µόνο την παράταση της ζωής του ασθενούς και τη βελτίωση της ποιότητας ζωής. Τα χηµειοθεραπευτικά φάρµακα που χρησιµοποιούνται συνήθως στον καρκίνο του παχέος εντέρου είναι τα: 5FU (fuorouracil), που χορηγείται συνήθως µαζί µε φολλικό οξύ, καπεσιταβίνη (capecitabine), οξαλοπλατίνη (oxaliplatin), ιρινοτεκάνη (irinotecan, εµπ. oνοµασία: Campto), και ουφτοράλη (uftoral - UFT). H θεραπεία που χρησιµοποιείται εξαρτάται, κυρίως, από το αν παρατηρείται µετάσταση µέσω των λεµφαδένων ή όχι.

1.1.5 Καρκινικοί βιοδείκτες (cancer biomarkers) Οι καρκινικοί βιοδείκτες απαντώνται σε καρκινικούς ιστούς ή στον ορό του αίµατος και περιλαµβάνουν µια µεγάλη ποικιλία µορίων, όπως ορµόνες, mRNA, µεταγραφικούς παράγοντες, κυτταρικούς υποδοχείς και διάφορες λειτουργικές πρωτεϊνες. Χρησιµοποιούνται για να δίνεται µια εικόνα της κατάστασης στην οποία βρίσκεται η ασθένεια την παρούσα στιγµή, αλλά και για πρόγνωση του καρκίνου, δηλαδή δίνουν τη δυνατότητα να προβλεφθεί αν ο συγκεκριµένος τύπος καρκίνου που φέρει ο ασθενής έχει καλή ή κακή πρόγνωση. Έτσι, δίνεται και η δυνατότητα να αποφασισθεί ποιο φάρµακο ταιριάζει καλύτερα στην κλινική εικόνα του ασθενή και σε ποια δόση. Με αυτόν τον τρόπο η θεραπεία γίνεται πιο στοχευµένη. Πολλοί τύποι καρκίνου κατανοούνται καλύτερα µε τη χρήση καρκινικών βιοδεικτών, για όλους τους παραπάνω λόγους. Για χρόνιες ασθένειες, όπως ο καρκίνος, που απαιτείται η λήψη φαρµάκων για µεγάλο χρονικό διάστηµα, η ακριβής διάγνωση είναι απαραίτητη, ειδικά όταν αναµένονται σοβαρές παρενέργειες από τη θεραπεία. Σε αυτή την περίπτωση, οι βιοδείκτες γίνονται τελευταία όλο και πιο σηµαντικοί, επειδή µπορούν να επιβεβαιώσουν µια δύσκολη διάγνωση ή να αποτελέσουν τα ίδια το διαγνωστικό δείκτη. Προκειµένου να χρησιµοποιηθεί ένας βιοδείκτης στη διάγνωση, θα πρέπει το υλικό στο οποίο εντοπίζεται να αποµονώνεται σχετικά εύκολα. Επίσης, προτιµάται το διαγνωτικό τεστ στο οποίο χρησιµοποιείται ο βιοδείκτης να είναι γρήγορο, και τα αποτελέσµατα µεταξύ των εργαστηρίων για τον ίδιο βιοδείκτη να µην έχουν µεγάλη απόκλιση µεταξύ τους. Γενικά, ένας βιοδείκτης µε κλινική χρήση πρέπει να έχει καλή ευαισθησία και ειδικότητα.

1.2 Κυτταρικός κύκλος Με τον όρο «κυτταρικός κύκλος» (cell cycle) εννοούµε τη διαδικασία µε την οποία ένα κύτταρο οποιουδήποτε οργανισµού (µονοκύτταρου ή πολυκύτταρου) διέρχεται µέσω διαφόρων λειτουργικών φάσεων µέχρι τελικά να διαιρεθεί σε δύο θυγατρικά κύτταρα. Η συγκεκριµένη διαδικασία είναι ο βασικός τρόπος µε τον οποίο διπλασιάζονται όλα τα έµβια  

16  


όντα. Ο κυτταρικός κύκλος µπορεί να έχει σύντοµη διάρκεια (π.χ. µερικές ώρες) ή πολύ µεγάλη (π.χ. µερικά χρόνια). Oρισµένα χαρακτηριστικά του κυτταρικού κύκλου είναι κοινά µεταξύ των διαφορετικών οργανισµών, δηλαδή ο κυτταρικός κύκλος πάντα περιλαµβάνει ορισµένες διεργασίες που οφείλουν να διεκπεραιωθούν, για να αντιγράψει τις γενετικές πληροφορίες και να τις µεταβιβάσει κατάλληλα στην επόµενη γενιά.

Εικόνα5: O κυτταρικός κύκλος και τα κυριότερα σηµεία ελέγχου σε αυτόν

Η φάση στην οποία το κύτταρο εκτελεί τις χαρακτηριστικές του λειτουργίες και που συνήθως διαρκεί περισσότερο, ονοµάζεται µεσόφαση (interphase). Σε αυτήν το κύτταρο εκτελεί εξειδικευµένες λειτουργίες ανάλογα µε τον τύπο του ή την αναπτυξιακή του κατάσταση. Η µεσόφαση διαιρείται σε τρία επιµέρους στάδια. Αρχικά, το στάδιο G1 (Gap 1) ακολουθεί ακριβώς µετά τη µίτωση. Στο στάδιο S (Synthesis), που ακολουθεί, το κύτταρο αντιγράφει το DNA του πυρήνα, κάτι που αποτελεί απαραίτητη προϋπόθεση για να συµβεί η κυτταρική διαίρεση. Τέλος, το στάδιο G2 (Gap 2), αποτελεί το µεσοδιάστηµα ανάµεσα στο τέλος της φάσης S και την έναρξη της φάσης Μ. Αναλυτικότερα σε σχέση µε τα όσα συµβαίνουν κατά τη διάρκεια της µεσόφασης, τα πιο πολλά κύτταρα µετά τη µίτωση βρίσκονται στη φάση G1, ενώ αντίθετα τα µη διαιρούµενα και τα µη διαφοροποιηµένα κύτταρα µετά τη µίτωση βγαίνουν από τον κυτταρικό κύκλο κατά τη φάση G1 και µπαίνουν στη φάση G0. Τα περισσότερα κύτταρα, τελικά, διαιρούνται µέσω µιας διαδικασίας που είναι γνωστή ως µίτωση (mitosis - Μ). H µίτωση αποτελεί τη διαδικασία της πυρηνικής διαίρεσης κατά την οποία τα διπλασιασµένα χρωµοσώµατα διαχωρίζονται το ένα από το άλλο και τοποθετούνται σε δύο πυρήνες καθένας από τους οποίους λαµβάνει ένα πλήρες αντίγραφο του γονιδιώµατος. Η µίτωση συχνά ακολουθείται συχνά από την κυτταροκίνηση, µια διαδικασία κατά την οποία το κύτταρο διαιρείται στα δύο, µοιράζοντας το κύτταρο σε δύο ίσα µέρη. Η διαδικασία της µίτωσης χωρίζεται σε 5 φάσεις (πρόφαση, προµετάφαση, µετάφαση, ανάφαση, τελόφαση), καθεµιά από τις οποίες χαρακτηρίζεται από µια συγκεκριµένη ακολουθία γεγονότων. Κατά την πρόφαση, κάθε διπλασιασµένο χρωµόσωµα που αποτελείται από δύο αδελφές χρωµατίδες συµπυκνώνεται. Έξω από τον πυρήνα συναρµολογείται η µιτωτική άτρακτος ανάµεσα στα δύο κεντροσωµάτια που έχουν αντιγραφεί και αποµακρυνθεί το ένα από το άλλο. Στην συνέχεια, ακολουθεί η προµετάφαση, η οποία αρχίζει απότοµα µε την αποδόµηση του πυρηνικού περιβλήµατος. Τα χρωµόσωµατα µπορούν πλέον να προσδεθούν στους µικροσωληνίσκους της ατράκτου µέσω των κινητοχώρων τους και να προσδεθούν.  

17  


Κατά τη µετάφαση, τα χρωµοσώµατα παρατάσσονται στον ισηµερινό της ατράκτου, στο µέσον της απόστασης ανάµεσα στους πόλους της, και κατά την ανάφαση, που ακολουθεί, οι ζευγαρωµένες χρωµατίδες διαχωρίζονται συγχρονισµένα, έτσι ώστε να σχηµατιστούν δύο θυγατρικά χρωµοσώµατα. Τέλος, κατά τη διάρκεια της τελόφασης οι δύο οµάδες των θυγατρικών χρωµοσωµάτων φτάνουν στους πόλους της ατράκτου και γύρω από κάθε οµάδα συναρµολογείται νέο πυρηνικό περίβληµα, και ακολουθεί η κυτταροκίνηση, στην οποία το κυτταρόπλασµα διαιρείται στα δύο.

1. Πρόφαση

4. Ανάφαση

2. Προµετάφαση

5. Τελόφαση

3. Μετάφαση

6. Κυτταροκίνηση

Εικόνα 6: Σχηµατική απεικόνιση των κυτταρικών φάσεων κατά τη µίτωση

Η µετάβαση από τη µια φάση του κυτταρικού κύκλου στην επόµενη προαπαιτεί κάποιες συνθήκες που είναι απαραίτητες προκειµένου να ξεπεραστεί η αναστολή σε κάποια σηµεία ελέγχου (check points). Όταν οι απαιτούµενες συνθήκες ικανοποιούνται, το κύτταρο προχωρά στο επόµενο σηµείο ελέγχου, µέχρι τελικά να διαιρεθεί και να προκύψουν δύο κύτταρα που θα περιέχουν ένα πανοµοιότυπο αντίγραφο γενετικού υλικού µε το µητρικό κύτταρο. Όλες αυτές οι διαδικασίες πυροδοτούνται από ένα κεντρικό σύστηµα ελέγχου, το οποίο διαθέτει δύο σηµαντικά σηµεία ελέγχου, το υπεύθυνο για την έναρξη του διπλασιασµού του DNA στη φάση G1 (µετάβαση G1à S), και εκείνο της φάσης G2 που αφορά την έναρξη της µίτωσης (µετάβαση G2àM). To σηµείο ελέγχου της φάσης G1 επιτρέπει στο κύτταρο να εξακριβώσει αν το περιβάλλον ευνοεί τον πολλαπλασιασµό προτού δεσµευτεί στη φάση S. Αν οι εξωκυττάριες συνθήκες είναι δυσµενείς, τα κύτταρα σταµατούν στη φάση G1, και µπορεί ακόµα και να περάσουν στη φάση ηρεµίας G0. Το σύστηµα ελέγχου της φάσης G2 επιτρέπει στο κύτταρο να ελέγξει αν έχει ολοκληρωθεί η αντιγραφή του DNA, προτού προχωρήσει στη µίτωση. Εξίσου σηµαντικό ρόλο στον κυτταρικό κύκλο έχει και το σύστηµα ελέγχου του κυτταρικού κύκλου (cell cycle control system), το οποίο διασφαλίζει την σωστή εξέλιξη του κυτταρικού κύκλου. Το συγκεκριµένο σύστηµα καθοδηγεί την

 

18  


εξέλιξη του κυτταρικού κύκλου µέσω της κυκλικής ενεργοποίησης και απενεργοποίησης κρίσιµων πρωτεϊνών που πυροδοτούν ή ρυθµίζουν την αντιγραφή του DNA, τη µίτωση και την κυτταροκίνηση. Κάτι τέτοιο επιτυγχάνεται µε αντιδράσεις φωσφορυλίωσηςαποφωσφορυλίωσης. Η φωσφορυλίωση πραγµατοποιείται από τις κινάσες (kinases), που είναι οµάδα ενζύµων που καταλύουν τη µεταφορά µιας φωσφορικής οµάδας από το ΑΤΡ. Οι συνέπειες της φωσφορυλίωσης µπορούν να ανατραπούν γρήγορα µε την αφαίρεση της φωσφορικής οµάδας από τις φωσφορυλάσες, µια ακόµη οµάδα ενζύµων.

1.3 Κυτταροσκελετός – Μικροσωληνίσκοι Η ικανότητα των ευκαρυωτικών κυττάρων να οργανώνουν τα πολυάριθµα συστατικά στο εσωτερικό τους, να προσλαµβάνουν ποικίλα σχήµατα και να πραγµατοποιούν συγχρονισµένες κινήσεις, εξαρτάται από τον κυτταροσκελετό (cytoskeleton), ένα πολύπλοκο δίκτυο πρωτεϊνικών ινιδίων που εκτείνεται σε όλο το κυτταρόπλασµα. Το δίκτυο αυτό των ινιδίων συµµετέχει στην στήριξη του µεγάλου όγκου του κυτταροπλάσµατος των κυττάρων, και ταυτόχρονα αποτελεί µια δυναµική δοµή, που αναδιοργανώνεται συνεχώς. Ο κυτταροσκελετός βασίζεται σ’ ένα πλέγµα που αποτελείται από τρία ίδη πρωτεϊνικών ινιδίων, τα ενδιάµεσα ινίδια (intermediate filaments), τους µικροσωληνίσκους (microtubules) και τα νηµάτια ή ινίδια ακτίνης (actin filaments). Όσον αφορά τους µικροσωληνίσκους, είναι µακρείς και σχετικά άκαµπτοι πρωτεϊνικοί κοίλοι σωλήνες οι οποίοι µπορούν να αποσυναρµολογηθούν γρήγορα σε µια θέση και να συναρµολογούνται σε µια άλλη. Αναπτύσσονται από µια δοµή που βρίσκεται κοντά στο κέντρο του κυττάρου, το κεντροσωµάτιο (centrosome). Οι µικροσωληνίσκοι αποτελούν το τµήµα του κυτταροσκελετού που είναι κυρίως υπεύθυνο για τον καθορισµό της θέσης των µεµβρανικών οργανιδίων µέσα στο κύτταρο και για την καθοδήγηση της ενδοκυττάριας µεταφοράς. Όταν ένα κύτταρο µπαίνει στη φάση της µίτωσης, οι µικροσωληνίσκοι αποσυναρµολογούνται και µετά ανασυγκροτούνται σε µια περίπλοκη δοµή που ονοµάζεται µιτωτική άτρακτος (mitotic spindle). Οι µικροσωληνίσκοι σχηµατίζονται από υποµονάδες τουµπουλίνης (tubulin). Κάθε υποµονάδα είναι ένα διµερές που αποτελείται από α-τουµπουλίνη και β-τουµπουλίνη. Το ένα άκρο του µικροσωληνίσκου, στο οποίο καταλήγει η β-τουµπουλίνη, ονοµάζεται συν άκρο και το άλλο, της α-τουµπουλίνης, ονοµάζεται πλην άκρο.

 

19  


Εικόνα 7: Απεικόνιση της δοµής του µικροσωληνίσκου. Διακρίνονται τα πρωτοϊνίδια που σχηµατίζονται από διµερή α-/β-τουµπουλίνης, και τα οποία µε την σειρά τους σχηµατίζουν έναν κοίλο σωλήνα.

1.4 O ρόλος της πρωτεϊνης Ran H Ran είναι µια GTPάση απαραίτητη για τη µεταφορά πρωτεϊνών µεταξύ του πυρήνα και του κυτταροπλάσµατος, για την συναρµολόγηση της µιτωτικής ατράκτου και του πυρήνα, µε το πέρας της µιτωτικής διαίρεσης, και µε συµµετοχή στον έλεγχο του κυτταρικού κύκλου. Όπως και άλλες πρωτεϊνες µε ενεργότητα GTPάσης, η Ran είναι συνδεδεµένη είτε µε GTP είτε µε GDP και αυτό επηρεάζει την ενεργότητά της. Οι εναλλαγές αυτές ρυθµίζονται από έναν παράγοντα GEF (Guanine nucleotide Exchange Factor), που ονοµάζεται RCC1 (Regulator of Chromosome Condensation 1), αλλά και από τον παράγοντα RanGAP1, που δρα σε συνδυασµό µε τον παράγοντα RanBP1. Ο παράγοντας GEF/RCC1 δρα στον πυρήνα και αντικαθιστά το GDP µε GTP στην πρωτεϊνη Ran. Αντίθετα, οι παράγοντες RanGAP1/RanBP1 υδρολύουν το Ran-GTP προς Ran-GDP στο κυτταρόπλασµα. Έτσι, γίνεται φανερό πως οι ρυθµιστές της ενεργότητας της Ran είναι ασύµµετρα κατανεµηµένοι, και άρα ο παράγοντας GEF/RCC1 εντοπίζεται κυρίως στον πυρήνα, ενώ οι RanGAP1/RanBP1 συναντώνται κυρίως στο κυτταρόπλασµα.

 

20  


Εικόνα 8: Σχηµατική αναπαράσταση του ρόλου της πρωτεϊνης Ran στο κυτταρόπλασµα και τον πυρήνα, µε την πρόσδεση GDP ή GTP αντίστοιχα.

Η µεταφορά πρωτεϊνών από το κυτταρόπλασµα προς τον πυρήνα γίνεται µε την προϋπόθεση ότι φέρουν το σήµα πυρηνικού εντοπισµού (NLS – nuclear localization signal). Αντίστοιχα, για τη µεταφορά από τον πυρήνα προς το κυτταρόπλασµα απαιτείται το σήµα πυρηνικής εξόδου (NES – nuclear export signal). Στο κυτταρόπλασµα, όπου τα επίπεδα RanGTP είναι χαµηλά, το σύµπλοκο εισόδου σχηµατίζεται όταν η πρωτεϊνη που φέρει αλληλουχία NLS αναγνωρίζεται από την ιµπορτίνη α στην οποία προσδένεται η ιµπορτίνη β, και στην συνέχεια µεταφέρεται, µε τη βοήθεια της RanGDP, µέσω των πυρηνικών πόρων εντός του πυρήνα. Αντίθετα, σε πρωτεϊνες που φέρουν την αλληλουχία NES προσδένονται εξπορτίνες και RanGTP. Όπως ήδη αναφέρθηκε, η Ran παίζει ρόλο και στον σχηµατισµό της µιτωτικής ατράκτου. Αρχικά, µακριά από τα χρωµοσώµατα σχηµατίζουν σύµπλοκο οι παράγοντες SAF (Spindle Assembly Factors), ανάµεσα στους οποίους περιλαµβάνονται οι TPX2, NuMA και XCTK2. Ωστόσο, τα σύµπλοκα αυτά παραµένουν κατεσταλµένα από την ιµπορτίνη β, και γι’ αυτό η RanGTP αποµακρύνει την ιµπορτίνη β, µε αποτέλεσµα το σύµπλοκο των SAFs να απελευθερώνεται και να ενεργοποιείται γύρω από τα χρωµοσώµατα, ικανό πλέον να συµµετέχει στον σχηµατισµό της ατράκτου και στην σταθεροποίηση των µικροσωληνίσκων.

1.5 Η κινάση Aurora A Το γονίδιο της Aurora A εδράζεται στο χρωµοσωµικό τόπο 20q13.2 και το C-τελικό άκρο είναι συντηρηµένο ανάµεσα στους τύπους των κινασών σε σύγκριση µε το N-τελικό άκρο, το οποίο διαφέρει. Πρόκειται για κινάση σερίνης/θρεονίνης που εκφράζεται στο µέγιστο βαθµό κατά τη φάση G2/M του κυτταρικού κύκλου. Η Aurora A εντοπίζεται στα διπλασιασµένα κεντροσωµάτια από το τέλος της φάσης S έως την αρχή της επόµενης φάσης G1, ενώ εξαπλώνεται πάνω στη µιτωτική άτρακτο κατά τη διάρκεια της µετάφασης µέχρι και το τέλος της ανάφασης και τελικά στην κυτταροκίνηση εξαφανίζεται. Η ποσότητα της πρωτεϊνης ρυθµίζεται µέσω της Ε3 λιγάσης της ουβικιτίνης APCCdh1 διαµέσου της αναγνώρισης του D  

21  


κουτιού, κι έτσι αποικοδοµείται από το πρωτεάσωµα. Επιπλέον, υπόκειται σε αρνητικό έλεγχο µέσω της αλληλεπίδρασης µε την πυρηνική πρωτεϊνη AURKAIP1 µε ένα µονοπάτι αποικοδόµησης εξαρτώµενο από πρωτεάσωµα χωρίς όµως πολυουβικιτινίωση. Η λειτουργία της Aurora A είναι διαφορετική καθ’ όλη τη διάρκεια του κυτταρικού κύκλου, όπως η ωρίµανση των κεντροσωµατίων µέσω της ενεργοποίησης του TACC, που δηµιουργεί σύµπλοκο µε την XMAP215, προωθώντας την ανάπτυξη των µικροσωληνίσκων. Ακόµη, η Aurora A επιδρά στο διαχωρισµό των κεντροσωµατίων µέσω της φωσφορυλίωσης της Eg5 κατά τη διάσπαση του πυρηνικού φακέλου, αλλά βοηθά και κατά την είσοδο στη µίτωση, επειδή στρατολογεί και ενεργοποιεί το σύµπλοκο κυκλινο-εξαρτώµενης κινάσης CDK1-κυκλίνης Β, που είναι υπεύθυνο για την έναρξη της µίτωσης. Παίζει ρόλο και στην συναρµολόγηση διπολικής ατράκτου λόγω της αλληλεπίδρασης της µε την TPX2, αλλά και στην στοίχιση των χρωµοσωµάτων στην µεταφασική πλάκα. Γενικότερα, γίνεται φανερό πως η Aurora A είναι µια σηµαντικής και πολυεπίπεδης λειτουργίας κινάση, και απαιτείται η σωστή χρονικά ενεργοποίηση και απενεργοποίηση της, αφού έχει ανιχνευθεί υπερέκφραση και πολλαπλασιασµός της σε πολλούς τύπους καρκίνου. Η ενεργοποίησή της εξαρτάται από την αλληλεπίδραση µε υποστρώµατά της και από την ικανότητα αυτοφωσφορυλίωσης που διαθέτει. Συγκεκριµένα, η TPX2 µέσω των αµινοξικών καταλοίπων 1-43 προσδένεται στο ρυθµιστικό C-τελικό άκρο της Aurora A αυξάνοντας την συγγένεια για πρόσδεση του ΑΤΡ και πεπτιδικών υποστρωµάτων, αλλά προστατεύει ταυτόχρονα την κινάση από απενεργοποίηση από τη φωσφατάση ΡΡ1. Η Aurora A, όταν είναι προσδεµένη σε αυτήν η TPX2, αυτοφωσφορυλιώνεται σε ένα κατάλοιπο θρεονίνης στο βρόγχο ενεργοποίησης και µε αυτό τον τρόπο ενεργοποιείται. Χωρίς την TPX2 η πρόσδεση υποστρωµάτων από την κινάση επάγει ένα σχηµατισµό που δίνει το βασικό επίπεδο ενεργότητας της Aurora A. Η TPX2 αποτελεί και υπόστρωµα της Aurora A, η οποία την φωσφορυλιώνει σε κατάλοιπα σερίνης. Επίσης, η TPX2 επηρεάζει τον εντοπισµό της Aurora A στους µικροσωληνίσκους της ατράκτου, σε αντίθεση µε την κινάση που δεν επηρεάζει τον εντοπισµό της TPX2. Ένα ακόµα υπόστρωµα της κινάσης Aurora A είναι και η κινεσίνη Eg5. Η Eg5 αποτελεί µέλος της οικογένειας BimC, που έχει ρόλο στην εγκαθίδρυση και τη διατήρηση της διπολικότητας της ατράκτου. Έτσι, ενέχεται στη διπολικότητα της ατράκτου και είναι πολύ σηµαντική για τη ροή προς τον πόλο των µικροσωληνίσκων που προκαλεί το διαχωρισµό των χρωµισωµάτων. Επίσης, είναι ικανή να «γλιστρά» χωριστά πάνω στους αντιπαράλληλους µικροσωληνίσκους.

Εικόνα

9: Σχηµατική απεικόνιση των συµπλόκων που συµµετέχουν στον σχηµατισµό της µιτωτικής ατράκτου κατά τη µίτωση.

 

22  


1.6 H πρωτεϊνη HURP 1.6.1. Ο ρόλος και η λειτουργία της HURP στον κυτταρικό κύκλο Η HURP (Hepatoma Up-Regulated Protein) είναι µια πρωτεϊνη που σχετίζεται άµεσα µε τον σχηµατισµό της µιτωτικής ατράκτου. Ο βασικός της ρόλος είναι να σταθεροποιεί τους µικροσωληνίσκους της ατράκτου, µε αποτέλεσµα να προωθεί τον σχηµατισµό της ατράκτου µε τη διαµεσολάβηση, ταυτόχρονα, του µονοπατιού που ρυθµίζεται από την πρωτεϊνη Ran (Κoffa et al., 2006). Η HURP εντοπίστηκε αρχικά στο ανθρώπινο ηµατοκαρκίνωµα, όπου βρέθηκε πως υπερκεφράζεται (Tsou et al., 2003). Από άλλες µελέτες, καθώς και στα πλαίσια της παρούσας µελέτης, έχει βρεθεί πως η HURP υπερεκφράζεται στον καρκίνο των πνευµόνων, σε διάφορες µορφές γυναικολογικών καρκίνων και στον καρκίνο του παχέος εντέρου. Ανήκει, ακόµη, στην οικογένεια των πρωτεϊνών ΜΑΡ (Microtubule Associated Protein), καθώς προσδένεται στους µικροσωληνίσκους. Συγκαταλέγεται, επίσης, στην υπερ-οικογένεια των πρωτεϊνών GKAP (Guanylate Kinase Associated Proteins). Θα πρέπει να σηµειωθεί πως πρόσφατα βρέθηκε οµόλογη πρωτεϊνη (Mars) και σε έντοµα, όπως η Drosophila melanogaster, αν και δεν παρουσιάζει ανάλογες λειτουργίες. Ωστόσο, θα µπορούσε κάποιος να υποθέσει πως η λειτουργία της είναι σηµαντική για την επιβίωση του κυττάρου, αφού η αλληλουχία της είναι συντηρηµένη ανάµεσα στα είδη.

Εικόνα 10: Σχηµατική αναπαράσταση της πρωτεϊνης HURP. Η κεντρική επικράτεια της πρωτεϊνης φέρει σηµαντική οµολογία µε την οικογένεια των πρωτεϊνών GKAP, και στο Ντελικό άκρο εµφανίζεται ασθενής οµολογία µε την πρωτεϊνη Ε-ΜΑΡ-115.

Οι λειτουργίες της πρωτεϊνης HURP είναι συνοπτικά οι ακόλουθες: • η HURP προσδένεται σε µικροσωληνίσκους, βοηθάει στην σταθεροποίηση τους και οδηγεί στη δηµιουργία συσσωµάτωσης των µικροσωληνίσκων στους κινητοχώρους (K-fibers) (Sillje et al., 2006, Koffa et al., 2006). • η HURP σταθεροποιεί το θετικό άκρο των µικροσωληνίσκων ενισχύοντας τον σχηµατισµό δοµών από αντιπαράλληλα πρωτοϊνίδια διµερών α και β τουµπουλίνης (Santarella et al., 2007). • η HURP ελέγχει τη δυναµική της ατράκτου, προκειµένου να εξασφαλιστεί επαρκής πρόσδεση στους κινητοχώρους (Wong and Fang, 2006). • η HURP αυξάνει την σταθερότητα της µιτωτικής ατράκτου, ενισχύει τον de novo πολυµερισµό των µικροσωληνίσκων και προωθεί έγκαιρα τον σχηµατισµό της διπολικής ατράκτου (Wong and Fang, 2006).

 

23  


Εικόνα

11: Μια από τις λειτουργίες της HURP είναι να προσδένεται στους µικροσωληνίσκους και να προωθεί τον σχηµατισµό των Kfibers. Απουσία της παρατηρείται λανθασµένος διαχωρισµός των χρωµοσωµάτων.

Ο επίσηµος συµβολισµός του γονιδίου της HURP είναι DLGAP5. Το γονίδιο αποτελείται από 43.562bps και από αυτό προκύπτουν δύο προϊόντα εναλλακτικού µατίσµατος, τα a και b, που διαφέρουν µόνο σε ένα εξόνιο, το εξόνιο 19. Έτσι, η ισοµορφή α αποτελείται από 808αα (130kDa), και η ισοµορφή b από 842αα (250kDa). Το γονίδιο της HURP εντοπίζεται στο µακρό βραχίονα του χρωµοσώµατος 14 (14q22.3), και φαίνεται να είναι συντηρηµένο, όπως έχει ήδη αναφερθεί, σε πολλά είδη ζώων, όπως ο χιµπαντζής, ο σκύλος, η αγελάδα, ο µυς, ο επίµυς, η όρνιθα και το ψάρι-ζέβρα (zebrafish). Στο γονίδιο της HURP συναντάται µόνο µία νησίδα CpG, και συγκεκριµένα στην περιοχή του υποκινητή τoυ γονιδίου DLGAP5. Η πρωτεϊνη HURP είναι µια πρωτεϊνη που ρυθµίζεται από τον κυτταρικό κύκλο. Έχει βρεθεί ότι έχει παρόµοιο πρότυπο έκφρασης µε την κινάση Aurora A, καθώς τα δύο γονίδια συνδέονται λειτουργικά µεταξύ τους (Yu et al., 2005). Τα επίπεδα mRNA της HURP φαίνεται πως είναι υψηλότερα κατά τη φάση G2/M, ενώ ελαττώνονται µε την έναρξη της φάσης G1. Έχει προταθεί πως ο µεταγραφικός παράγοντας c-Rel, που ανήκει στην οικογένεια NF-kB, ενεργοποιεί την έκφραση του γονιδίου HURP. Αν και δεν έχει βρεθεί ακόµα κάποιος µηχανισµός µε τον οποίο θα µπορούσαν να εξηγηθούν τα αυξηµένα επίπεδα της HURP, έχει ήδη αποδειχθεί πως ο αναστολέας τυροσινικής κινάσης sorafenib µπορεί να αναστείλει την έκφραση του c-Rel κι εµποδίζει την µετατόπισή του στον πυρήνα (Κuo et al., 2011). Η ενεργοποίηση της HURP λαµβάνει χώρα κατά την προµετάφαση. Κατά τη µετάφαση, η HURP προσδένεται σε και σταθεροποιεί τους µικροσωληνίσκους, µεταξύ των λειτουργιών που εκτελεί. Κατά την ανάφαση, που ακολουθεί, η HURP δεν είναι πλέον αναγκαία, οπότε αποικοδοµείται από το πρωτεάσωµα µέσω του µονοπατιού APC (Anaphase Promoting Complex) (Hsu et al., 2004; Song and Rape, 2010; Tsou et al., 2003). Αν και είναι ακόµα άγνωστη η τεταρτοταγής δοµή της πρωτεϊνης HURP, κάποιες σηµαντικές επικράτειές της είναι ευρέως γνωστές, όπως οι περιοχές D και ΚΕΝ (D and KEN boxes), και ένα µοτίβο σπειραµένου σπειράµατος (coiled coil domains), που χρειάζονται για την πρόσδεση της HURP στους µιτωτικούς µικροσωληνίσκους (Santarella et al., 2007). Οι περιοχές D, γνωστές και ως πλαίσια αποδιοργάνωσης, είναι δύο αλληλουχίες 9 αµινοξικών καταλοίπων, απαραίτητες για την ουβικιτινίωση και την πρωτεόλυση των µιτωτικών κυκλινών. Επιπλεόν, η πρωτεϊνη HURP διαθέτει µία επικράτεια GH1 στην περιοχή 432537αα, η οποία εµφανίζει σηµαντική οµολογία µε την οικογένεια των πρωτεϊνών GKAP, που θεωρείται ότι παίζουν ρόλο πρωτεϊνών-ικριωµάτων σε διαύλους ιόντων. Αντίθετα, στο Ν-

 

24  


τελικό άκρο εµφανίζεται ασθενής οµολογία µε µια επικράτεια της πρωτεϊνης Ε-ΜΑΡ-115 στην περιοχή 66-220αα, που έχει δειχτεί ότι προσδένεται στους µικροσωληνίσκους (Tsou et al, 2003; Wong et al., 2008). Στην αλληλουχία της HURP, ακόµη, υπάρχει σηµατοδοτική αλληλουχία εισόδου στον πυρήνα (NLS) και το αντίστοιχο σήµα εξόδου από τον πυρήνα (NES), τα οποία είναι πλούσια σε λευκίνη.

Εικόνα 12: Οργάνωση του ανθρώπινου γονιδίου της HURP το οποίο εδράζεται στο 14q22-23 χρωµόσωµα και αποτελείται από 19 εξόνια.

Εικόνα 13: Στοίχηση κατά ClustalW της Ν-τελικής επικράτειας της HURP. Με bold παριστάνονται τα συντηρηµένα κατάλοιπα, και στο πλαίσιο περιλαµβάνεται η περιοχή οµολογίας µε την πρωτεϊνη E-MAP-115.

 

25  


Εικόνα 14: Η πρωτεϊνική αλληλουχία της hHURP µε συµβολισµό ενός γράµµατος, όπου αποδεικνύονται τα επιµέρους µοτίβα και οι επικράτειες της πρωτεϊνης.

Η HURP, αρχικά, βρίσκεται σε αλληλεπίδραση µε την ιµπορτίνη β. Στην συνέχεια, η ενεργή µορφή της Ran, δηλαδή η Ran-GTP, αποδεσµεύει την HURP από την ιµπορτίνη β. Ωστόσο, η HURP δεν µπορεί ακόµα να προσδεθεί στους µικροσωληνίσκους, λόγω της παρεµπόδισης από έναν εσωτερικό δεσµό απενεργοποίησης. Από in vitro πειράµατα έχει αποδειχθεί ότι ο συγκεκριµένος δεσµός προκύπτει από την αλληλεπίδραση του C-τελικού άκρου της HURP µε το Ν-τελικό άκρο, και είναι υπεύθυνος για την αδυναµία του µορίου να προσδεθεί στους µικροσωληνίσκους (Wong et al., 2008). Παράλληλα, έχει αποδειχθεί in vitro πως το Ν-τελικό άκρο της HURP προσδένεται στους µικροσωληνίσκους, και επάγει µια νέα διαµόρφωση φύλλων τουµπουλίνης που περιελίσσονται γύρω από τα άκρα των µικροσωληνίσκων σχηµατίζοντας δύο οµόκεντρους σωλήνες. Στην συνέχεια, η HURP κατευθύνεται προς το σύµπλοκο EXTAH, το οποίο είναι ένα σύµπλοκο πρωτεϊνών που αποτελείται από τις εξής πρωτεϊνες: TPX2, XMAP215, Eg5, Aurora A. Οι TPX2 και Eg5 είναι πρωτεϊνες που προσδένονται στους µικροσωληνίσκους (Barr and Gruneberg, 2007), η XMAP215 σταθεροποιεί τους µικροσωληνίσκους, και τέλος, η Aurora A είναι µια κινάση, που ανάµεσα στις λειτουργίες της, παίζει σηµαντικό ρόλο και στον σχηµατισµό και τη σωστή λειτουργία του συγκεκριµένου πρωτεϊνικού συµπλόκου. Καθώς η HURP εντοπίζεται στο σύµπλοκο EXTAH, η Aurora A φωσφορυλιώνει το C-τελικό άκρο της HURP, και έχει αποδειχθεί µε in vitro πειράµατα ότι αυτό οδηγεί στην αποµάκρυνση από το Ν-τελικό άκρο,

 

26  


κι έτσι πλέον το Ν-τελικό άκρο είναι ελεύθερο να προσδεθεί και να σταθεροποιήσει τους µικροσωληνίσκους, προωθώντας τον σχηµατισµό της µιτωτικής ατράκτου. Εικόνα 15: Ρόλος της HURP στο σύµπλοκο συγκρότησης της µιτωτικής ατράκτου. Απελευθερώνεται από τις ιµπορτίνες α/β µέσω της RanGTP, και αλληλεπιδρά µε τις Eg5, TPX2, Aurora A και XMAP215 προωθώντας το σχηµατισµό K-fibers και την σταθεροποίηση των ΜΤs. Δρα, ακόµη, ανεξάρτητα στους κινητοχώρους των χρωµοσωµάτων,

1.6.2. ΗURP και καρκίνος Η HURP βρέθηκε πρώτα ότι υπερεκφράζεται στο ηπατοκυτταρικό καρκίνωµα, αλλά από τότε έχει συσχετιστεί µε διάφορες µορφές καρκίνου, όπως µε τον καρκίνο του παχέος εντέρου, µε γυναικολογικούς καρκίνους και µε το καρκίνωµα της ουροδόχου κύστεως από µεταβατικό επιθήλιο (Chiu et al., 2002; Huang et al., 2003; Yu et al., 2005; Stuart et al., 2011, Chang et al., 2011). Όσον αφορά το ηπατοκυτταρικό καρκίνωµα, συγκεκριµένα, έχει αποδειχθεί ότι η πρωτεϊνη HURP υπερεκφράζεται σε περιπτώσεις µόλυνσης των ηπατοκυττάρων από τον ιό της ηπατίτιδας Β (HBV). Αυτό συµβαίνει γιατί στην υπερέκφραση της HURP εµπλέκεται η πρωτεϊνη HBx του HBV, αλλά και η πρωτεϊνη SATB1, µε αποτέλεσµα τα ηπατοκύτταρα να γίνονται ανθεκτικά στον αντινεοπλασµατικό παράγοντα cisplatin. Επιπλέον, µέσω ανάλυσης γονιδιακής έκφρασης έχει βρεθεί ότι η HURP µπορεί να αποτελέσει έναν προγνωστικό δείκτη που διακρίνει τους κακοήθεις από τους καλοήθεις όγκους στον καρκίνο του φλοιού των επινεφριδίων (Kuo et al., 2010). Όπως έχει αποδειχθεί από µελέτες για την πρωτεϊνη HURP σε ποικίλες κυτταρικές σειρές, προκύπτουν διαφορετικά αποτελέσµατα όταν η HURP ρυθµίζεται διαφορετικά. Στην πραγµατικότητα, όταν η HURP υπερεκφράζεται in vitro, φαίνεται να έχει µετασχηµατιστική δράση στα κύτταρα (Yu et al., 2005). Επιπλέον, η υπερεκφρασµένη HURP µπορεί να σταθεροποιεί τους µικροσωληνίσκους από τη µεσόφαση (Sillje et al., 2006), ενώ είναι γνωστό πως επιτρέπει και την κυτταρική αύξηση κάτω από συνθήκες χαµηλής περιεκτικότητας σε ορό (Tsou et al., 2003; Wong et al., 2008; Yu et al., 2005). Επιπροσθέτως, όταν η HURP υπερεκφράζεται, παρατηρείται ανευπλοειδία, λόγω της αυξηµένης γενωµικής σταθερότητας. Η ανευπλοειδία είναι µια από τις βασικότερες αιτίες της καρκινογένεσης (Wong and Fang, 2006).

 

27  


Από την άλλη, όταν η HURP απουσιάζει, παρουσιάζεται ανώµαλη αρχιτεκτονική της µιτωτικής ατράκτου, που χαρακτηρίζεται από µειωµένη απόσταση µεταξύ των κινητοχώρων, ανεπαρκή ευθυγράµµιση των χρωµοσωµάτων και µειωµένη πρόσδεση. Στα ίδια κύτταρα, επίσης, το σηµείο ελέγχου της µιτωτικής ατράκτου είναι παροδικά ενεργοποιηµένο, γεγονός που οδηγεί σε καθυστερηµένη είσοδο στην ανάφαση (Wilde, 2006). Ωστόσο, η HURP υποεκφράζεται φυσιολογικά κατά τη διάρκεια της κυτταρικής διαφοροποίησης (de Reynies et al., 2009).

1.7 Σκοπός της εργασίας Οι τύποι καρκίνου που µελετώνται στην παρούσα εργασία, όπως έχει ήδη αναφερθεί, είναι ο καρκίνος του µαστού, διάφορες µορφές γυναικολογικού καρκίνου (καρκίνος των ωοθηκών, του ενδοµητρίου, του τραχήλου της µήτρας), και ο καρκίνος του παγκρέατος. Στα πλαίσια της συγκεκριµένης εργασίας γίνεται συσχέτηση µεταξύ διάφορων ιστοπαθολογικών καταστάσεων, που συνδέονται µε τις παραπάνω µορφές καρκίνου, και των επιπέδων έκφρασης της πρωτεϊνης HURP. Αυτό έχει σκοπό να αποδείξει πως η πρωτεϊνη HURP έχει τη δυνατότητα να χρησιµοποιηθεί ως βιοµοριακός δείκτης, γεγονός που για να εδραιωθεί θα πρέπει να ακολουθήσουν επιπλέον µελέτες. Επιπροσθέτως, η εν λόγω εργασία στοχεύει όχι µόνο στη µελέτη των επιπέδων έκφρασης της πρωτεϊνης HURP στους παραπάνω τύπους καρκίνου σε επίπεδο mRNA, µέσω πειραµάτων real-time PCR αντίστροφης µεταγραφής, αλλά και σε επίπεδο πρωτεϊνης, µέσω πειραµάτων ανοσοφθορισµού σε τοµές καρκινικού ιστού. Επιπλέον, λόγω της αλληλεπίδρασης που υπάρχει µεταξύ της κινάσης Aurora A και της HURP, θα ήταν ενδιαφέρον να µελετηθεί το πρότυπο έκφρασης σε επίπεδο mRNA και για την Aurora A, κάτι που επιτυγχάνεται στα πλαίσια της παρούσας εργασίας.

 

28  


2. ΜΕΘΟΔΟΙ ΚΑΙ ΥΛΙΚΑ

 

29  


2.1 Γενικό πλάνο των πρωτοκόλλων Στην συγκεκριµένη εργασία ακολουθήσαµε το παρακάτω γενικό πλάνο. Αναλυτικά τα πρωτόκολλα που ακολουθήθηκαν παρατίθενται στις επόµενες σελίδες της συγκεκριµένης εργασίας µε βάση την σειρά του γενικού πλάνου.

         Κομμάτι  ιστού ê Απομόνωση  RNA με  TRI  Reagent

ê Κατεργασία  με   DNάση  

ê Αντίστροφη   μεταγραφή  για   δημιουργία  cDNA

è

Μονιμοποίηση  και   παραφινοποίηση

ê Αποπαραφινοποίηση  και   ανάκτηση  αντιγονικών   επιτόπων

ê ανοσοφθορισμός

ê Παρατήρηση  σε   συνεστιακό   μικροσκόπιο

ê Real-­‐time  PCR   (πρωτόκολλο  των   δύο  βημάτων)

ê Στατιστική  ανάλυση   αποτελεσμάτων

 

30  


2.2 Αποµόνωση RNA µε TRI Reagent Εισαγωγή Από τον Οκτώβριο 2009 έως τον Μάιο 2012, γινόταν συλλογή από το εργαστήριό µας δειγµάτων από διάφορους τύπους ιστού. Τα συγκεκριµένα δείγµατα αποτελούν τµήµα καρκινικού και παρακείµενου φυσιολογικού ιστού, τα οποία έχουν αφαιρεθεί από τους ασθενείς για την πραγµατοποίηση βιοψίας. Η αφαίρεση των δειγµάτων ιστού πραγµατοποιούνταν στο Γενικό Νοσοκοµείο Διδυµοτείχου. Συνολικά, εξετάσθηκαν δείγµατα (φυσιολογικού και καρκινικού ιστού) από 27 ασθενείς µε καρκίνο του µαστού, 66 ασθενείς µε καρκίνο των ωοθηκών, 31 ασθενείς µε καρκίνο του ενδοµητρίου, 6 ασθενείς µε καρκίνο τραχήλου της µήτρας, 19 ασθενείς µε καρκίνο του παχέος εντέρου, και 11 ασθενείς µε καρκίνο παγκρέατος. Στην πλειονότητα των χειρουργικών επεµβάσεων που έγιναν σε περιστατικά καρκίνου του παχέος εντέρου, των ωοθηκών και του ενδοµητρίου, εφαρµόστηκε η µέθοδος HIPEC. Το πρωτόκολλο που περιγράφεται στην συνέχεια χρησιµοποιείται για την αποµόνωση RNA από δείγµατα καρκινικού και φυσιολογικού ιστού, αλλά και από κύτταρα κυτταρικών σειρών. Ο ιστός που χρησιµοποιείται βρίσκεται διατηρηµένος σε RNA later, και αποθηκεύται στους -80oC για µεγάλο χρονικό διάστηµα. Υλικά για την αποµόνωση RNA • • • • • • • • •

πιπέτες 10µl, 200µl και 1000µl σωληνάρια eppendorf επιτραπέζια ψυχόµενη φυγόκεντρος 5417R - Eppendorf γυάλινος οµογενοποιητής χειρός / οµογενοποιητής Polytron PT2100 (Kinematica) TRI Reagent (Ambion / MRC) Χλωροφόρµιο Ισοπροπανόλη 75% αιθανόλη νερό ελεύθερο νουκλεασών (water for injection - WFI)

Πρωτόκολλο αποµόνωσης RNA µε TRI Reagent 1. Οµογενοποιούµε περίπου 100mg ιστού σε 1ml TRI Reagent 2. Επωάζεται το οµογενοποίηµα για 5min σε θερµοκρασία δωµατίου 3. Φυγοκέντρηση στα 12.200g για 10min στους 4°C

 

31  


4. Αφαιρούµε προσεκτικά τη φάση του λίπους που σχηµατίζεται στο πάνω µέρος του υπερκειµένου 5. Μεταφέρουµε το υπόλοιπο υπερκείµενο σε καθαρό σωληνάριο eppendorf 6. Προσθέτουµε 200µl χλωροφορµίου σε κάθε δείγµα 7. Ανακινούµε δυνατά για 15sec και επωάζουµε για 15min σε θερµοκρασία δωµατίου 8. Φυγοκέντρηση στα 12.200g για 15min στους 4°C 9. Μεταφέρουµε 500µl υδατικής φάσης σε ένα καθαρό σωληνάριο eppendorf. Η µεταφορά πρέπει να γίνει µε προσοχή χωρίς να διαταραχθεί η µεσόφαση όπου υπάρχει γενωµικό DNA

10. Προσθέτουµε 500µl ισοπροπανόλης και ανακαινούµε ελαφρά 10 φορές 11. Επώαση για 10min σε θερµοκρασία δωµατίου 12. Φυγοκέντρηση στα 12.200g για 8min στους 4ºC Μετά από αυτό το στάδιο σχηµατίζεται ίζηµα από το ολικό RNA

13. Αποµακρύνουµε το υπερκείµενο µε χρήση πιπέτας και προσθέτουµε στο ίδιο σωληνάριο 1ml 75% αιθανόλης 14. Φυγοκέντρηση στα 7.500g για 5min στους 4ºC Σε περίπτωση που το ίζηµα επιπλέει ή δεν είναι καλά σχηµατισµένο, επαναλαµβάνεται η φυγοκέντρηση στα 12.200g για 5min στους 4ºC

15. Αποµάκρυνση του υπερκειµένου µε πιπέτα 16. Κάνουµε µικροφυγοκέντρηση και αποµακρύνουµε την περίσσεια αιθανόλης 17. Στεγνώνουµε το ίζηµα αφήνοντας τα σωληνάρια eppendorf ανοιχτά για 3min σε θερµοκρασία δωµατίου 18. Επαναδιαλύουµε το ίζηµα σε νερό ελεύθερο νουκλεασών και σε όγκο ανάλογο της ποσότητας του ιζήµατος\ 19. Επώαση για 5min σε θερµοκρασία δωµατίου 20. Μοιράζουµε σε µερίδες και αποθηκεύουµε στους -80ºC

 

32  


2.3 Κατεργασία µε DNάση (Dnase treatment) Εισαγωγή Πριν ξεκινήσουµε τη διαδικασία κατεργασίας των δειγµάτων RNA µε DΝάση, κάνουµε φωτοµέτρηση του RNA, προκειµένου να υπολογίσουµε την συγκέντρωση του κάθε δείγµατος RNA και να αξιολογήσουµε την ποιότητά του. Η φωτοµέτρηση γίνεται µε τη χρήση του NanoDrop 1000 (Thermo Scientific). Βάσει των αποτελεσµάτων φωτοµέτρησης, χρησιµοποιούνται σε περαιτέρω πειράµατα τα δείγµατα RNA µε Α260/280 ≥ 1,8. Το συγκεκριµένο πρωτόκολλο χρησιµοποιείται για την καταστροφή του DNA που έχει τυχόν επιµολύνει το δείγµα µας, ή δεν έχει αποµακρυνθεί επιτυχώς, κατά την αποµόνωση του ολικού RNA. Ωστόσο, η αποτελεσµάτικοτητα της DΝάσης δεν είναι πάντα επιθυµητή, είτε επειδή δεν είναι αρκετά δραστική είτε επειδή υπάρχει µεγάλη ποσότητα DNA, το οποίο αδυνατεί να καταστρέψει πλήρως η DΝάση.

Υλικά για την κατεργασία µε DNάση (DNase treatment) • • • • • • • • • •

πιπέτες των 10µl και 20µl σωληνάρια eppendorf 0,5ml και 1,5ml επιτραπέζια φυγόκεντρος 5417R - Eppendorf PCR machine (Peltier Thermal Cycler - BioRad) ρυθµιστικό διάλυµα της DNάσης 10x (TURBO DNase Buffer - ΑΜΒΙΟΝ) ρυθµιστικό διάλυµα της Dνάσης 10x (Invitrogen, cat no: 18068-015) DNάση, 2U/µl (TURBO Dnase - ΑΜΒΙΟΝ) Dνάση, 1U/µl (Invitrogen, cat no: Y02340) διάλυµα απενεργοποίησης της DNάσης (DNase Inactivation Reagent - ΑΜΒΙΟΝ) 25mM EDTA (pH 8.0) ως διάλυµα απενεργοποίησης (Invitrogen, cat no: Υ02353)

Πρωτόκολλο επεξεργασίας µε DNάση (DNase treatment) A) TURBO DNA-free kit – AMBION 1. Προσθέτουµε σε ένα σωληνάριο eppendorf 1/10 του όγκου του διαλύµατος ρυθµιστικό διάλυµα DNάσης (TURBO DNase Buffer) και 1µl DNάση (TURBO DNase) Οι συγκεκριµένες ποσότητες αναφέρονται σε ποσότητα νουκλεϊκού οξέος στο δείγµα µέχρι 200 µg. Επιπλέον, 1µl TURBO DNase χρησιµοποιείται σε ποσότητα RNA έως 100µg, σε αντίδραση των 50µl

 

33  


2. Aνακινούµε ελαφρά και επωάζουµε το διάλυµα για 30min στους 37ºC 3. Προσθέτουµε 1/10 του όγκου της αντίδρασης διάλυµα απενεργοποίησης της DNάσης (DNase Inactivation Reagent). Το συγκεκριµένο διάλυµα πρέπει πριν τη χρήση να επαναδιαλύεται µε ελαφρά ανακαίνιση. Το κατώτατο όριο του όγκου του διαλύµατος είναι 2µl.

4. Ανακινούµε ελαφρά και επωάζουµε για 5min στους 25ºC ανακινώντας 4-5 φορές κατά τη διάρκεια της επώασης. 5. Φυγοκέντρηση στα 10.000g για 1,5min σε θερµοκρασία δωµατίου 6. Μεταφορά του υπερκειµένου σε καθαρά σωληνάρια eppendorf. Μεταφέρουµε από 5µl υπερκειµένου σε κάθε σωληνάριο δείγµατος για RT(+) και RT(-) αντίδραση.

Β) Deoxyribonuclease I, Amplification Grade kit - Invitrogen 1.

Προσθέτουµε σε ένα σωληνάριο eppendorf 1/10 του όγκου του τελικού διαλύµατος, ρυθµιστικό διάλυµα DNάσης (10x DNase I reaction buffer), και προσθέτουµε ίδιο όγκο (2µl) Dνάσης (DNase I, Amp Grade). Οι ποσότητες αναφέρονται σε κατεργασία 2µg RNA. O τελικός όγκος του διαλύµατος είναι 20µl.

2.

Ανακινούµε µε πι��ετάρισµα τις αντιδράσεις και επωάζουµε στους 25οC για 15min.

3. EDTA).

Προσθέτουµε 1/10 του όγκου διάλυµε απενεργοποίησης της Dnάσης (25mM Για 20µl αντίδρασης DΝάσης, προστίθενται 2µl EDTA.

4. Επώαση των αντιδράσεων στους 65οC για 10min. 5.

Μεταφορά µέρους της αντίδρασης σε καθαρά σωληνάρια eppendorf.

Μεταφέρουµε από 8µl αντίδρασης (θεωρητικά καθαρό RNA) σε κάθε σωληνάριο δείγµατος για RT(+) και RT(-) αντίδραση.

 

34  


2.4 Αντίστροφη µεταγραφή για τη δηµιουργία cDNA (Firststrand cDNA synthesis) Εισαγωγή Το συγκεκριµένο πρωτόκολλο χρησιµοποιείται για τη δηµιουργία cDNA µε τη διαδικασία της αντίστροφης µεταγραφής και µε τη χρήση του RNA ως καλούπι, που έχουµε ήδη αποµονώσει από ιστό ή κύτταρα.

Υλικά για το πρωτόκολλο της αντίστροφης µεταγραφής • • • • • • • • •

πιπέτες 10µl, 20µl, 200µl συσκευή PCR (Peltier Thermal Cycler - BioRad) επιτραπέζια φυγόκεντρος 5417R - Eppendorf αναστολέας των RNασών (RNase Inhibitor) ρυθµιστικό διάλυµα της αντίστροφης µεταγραφάσης (5x PrimeScript II Buffer) αντίστροφη µεταγραφάση (PrimeScript II RTase) νερό ελεύθερο νουκλεασών (water for injection - WFI) τυχαία εξαµερή (random hexamers) µείγµα από dNTP (dNTP mix)

Πρωτόκολλο αντίστροφης µεταγραφής* 1. Προετοιµάζουµε το cDNA synthesis mix µε τα παρακάτω συστατικά: Συστατικά

όγκος ανά αντίδραση

5x PrimeScript II Buffer

4 µl

RNase Inhibitor (40 U/µl)

0,5 µl

PrimeScript II RTase (200 U/µl) νερό ελεύθερο νουκλεασών (WFI)

1 µl 4,5 µl

Aφήνουµε το cDNA mix στον πάγο. 2.

 

Προετοιµάζουµε το RNA mix µε τα παρακάτω συστατικά:

35  


Συστατικά

όγκος ανά αντίδραση

Random hexamers (50µM)

1µl

dNTP Mixture (10mM)

1µl

νερό ελεύθερο νουκλεασών (WFI)

3µl

3.

Προσθέτουµε σε κάθε σωληνάριο που περιέχει RNA (δείγµα RT(+) αντίδρασης) από 5µl RNA mix.

4.

Αναδεύουµε ελαφρά, κάνουµε µικροφυγοκέντρηση τα σωληνάρια και τα αφήνουµε στον πάγο

5.

Προθερµαίνουµε την συσκευή PCR στους 65°C.

6.

Επωάζουµε το RNA mix στους 65°C για 5min.

7.

Αφήνουµε το RNA mix στην συσκευή PCR για 3min στους 4°C.

8.

Βγάζουµε το RNA mix από την συσκευή PCR και την προθερµαίνουµε στους 30ºC

9.

Προσθέτουµε σε κάθε σωληνάριο που περιέχει το RNA mix από 10µl cDNA mix.

10. Aναδεύουµε ελαφρά τις αντιδράσεις και τις επωάζουµε στην συσκευή PCR σύµφωνα µε το εξής πρόγραµµα: i. 10min στους 30°C ii. 60min στους 42°C iii. 5min στους 95°C, για να τερµατίσει η αντίδραση iv. 5min στους 4°C 11. Σε κάθε σωληνάριο που περιέχει δείγµα RT(-) αντίδρασης προσθέτουµε από 15µl WFI. 12. Αποθηκεύουµε τις αντιδράσεις στους -20ºC. (*) Το παραπάνω πρωτόκολλο ισχύει στην περίπτωση κατεργασίας µε DΝάση χρησιµοποιώντας το TURBO DNA-free kit (AMBION). Στην περίπτωση χρήσης του kit της εταιρείας Invitrogen δεν προστίθεται νερό ελεύθερο νουκλεασών (WFI) κατά την παρασκευή του RNA mix. Επίσης, σε αυτήν την περίπτωση σε κάθε σωληνάριο που περιέχει δείγµα RT(-) αντίδρασης προσθέτουµε 12µl WFI.

 

36  


2.5 Aντίδραση της Real-time PCR µε το πρωτόκολλο των δύο βηµάτων (two step protocol) Εισαγωγή Η PCR πραγµατικού χρόνου (Real-time PCR) επιτρέπει τον πολλαπλασιασµό και την ποσοτικοποίηση µιας συγκεκριµένης αλληλουχίας νουκλεϊκού οξέος, στην συγκεκριµένη περίπτωση των γονιδίων HURP και AURKA, µε ανίχνευση του προϊόντος της PCR σε πραγµατικό χρόνο και µε σκοπό την ανάλυση της γονιδιακής έκφρασης. Οι αντιδράσεις παρασκευάζονται σε απαγωγό εστία και µε ιδιαίτερη προσοχή, έτσι ώστε να αποφευχθούν τυχόν επιµολύνσεις. Στα πειράµατα µε real-time PCR πρέπει να χρησιµοποιείται εκτός από το γονίδιο στόχος και κάποιο γονίδιο αναφοράς. Στην συγκεκριµένη περίπτωση, ως γονίδιο αναφοράς χρησιµοποιείται το GAPDH (glyceraldehyde-3-phosphate dehydrogenase), και τα γονίδιαστόχοι είναι τα HURP και AURKA. Όλα τα γονίδια που µελετώνται ανήκουν στο είδος Homo sapiens. Ως θετικός µάρτυρας στα πειράµατα χρησιµοποιήθηκε cDNA, που παρασκευάστηκε από το ολικό RNA που αποµονώθηκε από κύτταρα της κυτταρικής σειράς HepG2. Τα βασικά στοιχεία των ζευγών εκκινητών που χρησιµοποιήθηκαν για το κάθε γονίδιο παρουσιάζονται παρακάτω.

hHURP Είδος εκκινητή Αλληλουχία 5’-3’ Μήκος εκκινητή GC% Μήκος προϊόντος Tm

hAURKA

Πρόσθιος

Ανάστροφος

Πρόσθιος

Ανάστροφος

GTTAAGCCAAGGGCAATGAA

TTTTTGGCTCAGCTTTCACA

GCAAGAGAAAAGCAAAGCAAG T

AAGAATATTAGGATGCCGA AGGT

20

20

22

23

45%

40%

40,9%

39,1%

202 52,0oC

202 51,1oC

52,6oC

52,3oC

hGAPDH Είδος εκκινητή Αλληλουχία 5’-3’ Μήκος εκκινητή GC% Μήκος προϊόντος Tm

 

Πρόσθιος

Ανάστροφος

CCACCCATGGCAAATTCC

CAGCATCGCCCCACTTG

18 55,6%

18 64,7% 120

ο

53,1 C

52,9oC

37  


Πριν ξεκινήσουν τα πειράµατα για την εξέταση δειγµάτων, πάντα δηµιουργείται η standard curve προκειµένου να υπολογισθεί η απόδοση των αντιδράσεων που θα ακολουθήσουν, η ευαισθησία, η αναπαραγωγικότητά τους, αλλά και να εντοπισθούν τα αποδεκτά όρια Ct. Τα αποδεκτά όρια απόδοσης των αντιδράσεων είναι 90-110%, που αντιστοιχούν σε κλίση της καµπύλης από -3,6 έως -3,1, αν και η 100% απόδοση δηλώνει ότι µετά από κάθε κύκλο αντίδρασης παράγεται ακριβώς η διπλάσια ποσότητα ειδικού προϊόντος. Έτσι, παρακάτω παρατίθενται οι standard curves που έχουν δηµιουργηθεί για καθένα από τα εξεταζόµενα γονίδια (HURP, AURKA, GAPDH) στα πειράµατα real-time PCR. Επίσης, παρατίθενται και τα στοιχεία που αφορούν τις καµπύλες, όπως κλίση και intercept.

AURKA     Slope  =  -­‐3,259250   Intercept  =  26,445492   R2  =  0,969763   απόδοση  =  102,68%  

Εικόνα 16: Καµπύλη standard curve για το γονίδιο AURKA από την οποία αποδεικνύεται ότι τα αποδεκτά όρια Ct είναι µεταξύ 26,23 και 36,04. Στον άξονα y βρίσκονται οι τιµές του Ct. H απόδοση της καµπύλης είναι 102,68% (slope=-3,259250).

HURP     Slope  =  -­‐3,552659   Intercept  =  19,976563   R2  =  0,995953   απόδοση  =  91,20%  

Εικόνα 17: Καµπύλη standard curve για το γονίδιο της HURP από την οποία   αποδεικνύεται ότι τα αποδεκτά όρια Ct είναι 20,237 έως 34,555. Απόδοση = 91,2%.

38  


GAPDH     Slope  =  -­‐3,623325   Intercept  =  13,4711   R2  =  0,997497   Απόδοση  =  88,79%  

Εικόνα 18: Καµπύλη standard curve για το γονίδιο GAPDH από την οποία αποδεικνύεται ότι τα αποδεκτά όρια Ct είναι 13,079 έως 27,782. Απόδοση = 88,79%.

Παρακάτω παρατίθενται ενδεικτικές καµπύλες ποσοτικοποίησης (amplification plot)από πειράµατα qRT Real-time PCR για τα µελετώµενα γονίδια HURP, AURKA και GAPDH.

a

b

Εικόνα 19: Ενδεικτικά amplification plots από πειράµατα qRT Real-time PCR για το γονίδιο α) της HURP, b) της Aurora A, και c) της GAPDH.

c

 

39  


Υλικά για την αντίδραση της Real-time PCR • • • • • • • •

πιπέτες 10µl, 20µl, 200µl σωληνάρια eppendorf 0,5µl, 1,5µl νερό ελεύθερο νουκλεασών (water for injection - WFI) ζευγάρι εκκινητών (εµπρόσθιος/ανάστροφος) για το επιθυµητό γονίδιο (forward/reverse primers) KAPA SYBR(R) FAST Universal qPCR Kit απαγωγός εστία µικροφυγόκεντρος θερµοκυκλοποιητής για Real-time PCR (Applied Biosystems 7500)

Πρωτόκολλο για PCR πραγµατικού χρόνου (real-time PCR) 1.

Καθαρίζουµε σχολαστικά την απαγωγό εστία µε αιθανόλη 70% και τοποθετούµε κατάλληλα τα εργαλεία που θα χρησιµοποιήσουµε στην συνέχεια.

2. Ανάβουµε τη λάµπα UV για περίπου 15min έτσι ώστε να καταστραφεί οποιοδήποτε ξένο DNA υπάρχει µέσα στην απαγωγό εστία. 3.Παρασκευάζουµε το διάλυµα της αντίδρασης προσθέτοντας τα απαραίτητα συστατικά µε βάση τον παρακάτω πίνακα:

Συστατικά

ποσότητες ανά αντίδραση (20µl)

νερό ελεύθερο νουκλεασών (WFI)

7.8µl

KAPA SYBR Green Mix

10µl

ROX (Low)

0.4µl

εµπρόσθιος εκκινητής(forward primer)

0.4µl

ανάστροφος εκκινητής (reverse primer)

0.4µl

ποσότητα cDNA

200ng

4. Mοιράζουµε το διάλυµα στα κατάλληλα σωληνάρια βάζοντας από 19µl διαλύµατος στο καθένα. 5. Προσθήκη 1µl WFI στο σωληνάριο του NTC (No Template Control).

 

40  


6. Αναδεύουµε ελαφρά τα templates και προσθέτουµε από 1µl template στο αντίστοιχο σωληνάριο (strip). H διαδικασία γίνεται χρησιµοποιώντας filter tips. Στο τέλος, τοποθετούµε προσεκτικά τα καπάκια στα σωληνάρια.

7. Φυγοκεντρούµε τις αντιδράσεις για πολύ λίγο σε µία µικροφυγόκεντρο Σπάµε πρώτα τς φουσκάλες που πιθανόν έχουν σχηµατιστεί σε κάθε σωληνάριο, γιατί µόνο έτσι θα µπορεί να ανιχνευθεί στην συνέχεια όπως πρέπει το σήµα που εκλύει η κάθε αντίδραση.

8. Τοποθετούµε τα σωληνάρια µε τις αντιδράσεις στην κατάλληλη θήκη της συσκευής realtime PCR και βάζουµε σε λειτουργία το επιθυµητό πρόγραµµα. 9. Ξεκινάµε την αντίδραση. Στην αντίδραση ακολουθείται το παρακάτω πρόγραµµα, όσον αφορά το γονίδιο GAPDH (γονίδιο αναφοράς) και το γονίδιο HURP (γονίδιο-στόχος):

Στάδιο

Θερµοκρασία

Χρόνος

Επαναλήψεις

1

95ºC

5 min

1

95ºC

15 sec

60ºC

1 min

2 3

Dissociation stage

40 1

Σχετικά µε τη µελέτη του γονιδίου AURKA ακολουθείται το παρακάτω πρόγραµµα:

Στάδιο

Θερµοκρασία

Χρόνος

Επαναλήψεις

1

95ºC

5 min

1

95ºC

15 sec

60ºC

1 min

75ºC

31 sec

2

3

 

Dissociation stage

40

1

41  


2.6 Μέθοδος ποσοτικοποίησης και ανάλυσης αποτελεσµάτων Υπάρχουν δύο µέθοδοι Real-time PCR σε καθεµία από τις οποίες η ποσοτικοποίηση του προϊόντος γίνεται µε διαφορετικό τρόπο. Αυτές οι δύο µέθοδοι είναι η µέθοδος απόλυτης ποσoτικοποίησης (absolute quantification) και η µέθοδος σχετικής ποσοτικοποίησης (relative quantification). Στα πειράµατά µας χρησιµοποιήσαµε τη µέθοδο σχετικής ποσοτικοποίησης (relative quantification). Σε αυτή τη µέθοδο ο προσδιορισµός της ποσότητας γίνεται µε βάση κάποιο γονίδιο αναφοράς του οποίου το cDNA ενισχύεται ταυτόχρονα µε το γονίδιο στόχο. Αυτό, όµως, ισχύει µόνο στην περίπτωση που οι βέλτιστες συνθήκες είναι οι ίδιες για όλα τα ζεύγη εκκινητών, αλλιώς εξετάζονται ξεχωριστά τα δύο γονίδια, όπως έγινε και στην περίπτωσή µας. Η ποσοτικοποίηση του γονιδίου στόχου µπορεί να γίνει µε τη χρήση ενός εκ των τριών µαθηµατικών µοντέλων: 1) τη µέθοδο ΔCt, 2) τη µέθοδο Livak, 3) τη µέθοδο Pfaff. Στα πειράµατά µας χρησιµοποιήσαµε τη µέθοδο Livak (Schmittgen & Livak, 2008), επειδή είναι µια µέθοδος ευρέως χρησιµοποιούµενη και αρκετά εύκολο να εφαρµοστεί. Στην συγκεκριµένη µέθοδο δεχόµαστε ότι το γονίδιο στόχος (target) και το γονίδιο αναφοράς (reference) ενισχύονται µε απόδοση κοντά στο 100%. Αρχικά, κανονικοποιούµε το Ct του γονιδίου στόχου και του γονιδίου αναφοράς για το δείγµα καρκινικού ιστού (test) και για το δείγµα φυσιολογικού ιστού (calibrator). Έτσι, έχου��ε:

ΔCt(test) = Ct(target, test) - Ct(ref, test) ΔCt(calibrator) = Ct(target, calibrator) - Ct(ref, calibrator) Έπειτα, κανονικοποιούµε το ΔCt(test) µε το ΔCt(calibrator), τα οποία αποτελούν στους υπολογισµούς µας το µέσο όρο των επιµέρους τιµών ΔCt των δειγµάτων, κι έτσι έχουµε:

ΔΔCt = ΔCt(test) - ΔCt(calibrator) (1) Μετά, υπολογίζουµε το ratio της έκφρασης:

Κανονικοποιηµένο ratio της έκφρασης = 2

-ΔΔCt

Οι υπολογισµοί πραγµατοποιήθηκαν στο Microsoft Excel for Mac 2011 version 14.0.0 (100825) (Microsoft Corp.) και στο Numbers ’09 version 2.1 (436) (Apple Inc.).

 

42  


Επιπλέον, έγινε στατιστική επεξεργασία των δειγµάτων που περιέχονται σε µια οµάδα µε µη παραµετρική δοκιµασία σειράς. Συγκεκριµένα, χρησιµοποιούµε τη δοκιµασία Wilcoxon για παρατηρήσεις χωρίς αντιστοιχία, όταν γίνεται στατιστική αξιολόγηση των αποτελεσµάτων µεταξύ µόνο δύο οµάδων (η µέθοδος Wilcoxon είναι γνωστή και ως δοκιµασία Mann-Whitney U test) µέσω του προγράµµατος Prism Graph Pad. H συγκεκριµένη στατιστική δοκιµασία χρησιµοποιείται µε σκοπό να συγκρίνουµε δύο ανεξάρτητες οµάδες τιµών. Από εκεί εξάγουµε και την τιµή P, που αντιστοιχεί στην πιθανότητα η αλληλεπικάλυψη των τιµών των δύο οµάδων να οφείλεται στην τύχη. Όσο µικρότερη είναι η τιµή Ρ, τόσο µικρότερη είναι και η πιθανότητα αλληλεπικάλυψης των δύο οµάδων, και συνεπώς τόσο µεγαλύτερη είναι η αξιοπιστία των αποτελεσµάτων. Τα ιστοπαθολογικά και παθολογοανατοµικά χαρακτηριστικά των ασθενών, όπως η ηλικία, ο βαθµός διαφοροποίησης του όγκου, το στάδιο της νόσου, η λεµφαδενική διήθηση και η επιβίωση των ασθενών, εκφράσθηκαν ως απόλυτες και σχετικές συχνότητες. Τα δείγµατα της κάθε ιστοπαθολογικής οµάδας, ακόµη, χωρίστηκαν σε δύο οµάδες, χαµηλής και υψηλής έκφρασης των γονιδίων HURP και AURKA. Η διάκριση αυτή έγινε βάσει του διάµεσου που προκύπτει από την κάθε οµάδα δειγµάτων, αφού πρώτα γίνει, όµως, κανονικοποίηση των τιµών ΔCt όπως προκύπτουν για το κάθε δείγµα καρκινικού ιστού χωριστά. Έτσι, όταν η κανονικοποιηµένη τιµή είναι µικρότερη από το διάµεσο, τότε θεωρούµε πως το εκάστοτε γονίδιο εκφράζεται σε υψηλά επίπεδα στο συγκεκριµένο δείγµα, ενώ το αντίθετο ισχύει όταν η κανονικοποιηµένη τιµή είναι µεγαλύτερη από το διάµεσο. Η στατιστική αξιολόγηση των τιµών µεταξύ όλων των υποοµάδων που προκύπτουν για το κάθε ιστοπαθολογικό χαρακτηριστικό γίνεται µε τη δοκιµασία Mann-Whitney U test ή KruskalWallis. Οι καµπύλες επιβίωσης και τα ποσοστά επιβίωσης, αλλά και το τυπικό σφάλµα αυτών, υπολογίσθηκαν µε τη µέθοδο Kaplan-Meier. Όλοι οι στατιστικοί έλεγχοι ήταν δίπλευροι, πλην ελαχίστων εξαιρέσεων που αναφέρονται στα αποτελέσµατα, και τα αποτελέσµατα θεωρήθηκαν ως στατιστικά σηµαντικά για τιµές p<0,05.

 

43  


2.7 Παρασκευή τοµών από ιστό µονιµοποιηµένο µε φορµαλδεϋδη και εµβαπτισµένο σε παραφίνη Αποµονώνονται τµήµατα ιστού από το όργανο που θέλουµε να µελετήσουµε, τα τοποθετούµε σε ειδική κασέτα έγκλεισης ιστού, και τα επεξεργαζόµαστε στην συνέχεια σε ένα σύστηµα αυτόµατης επεξεργασίας ιστών (TP1020, Leica). Το συγκεκριµένο σύστηµα χρησιµοποιείται για τη µονιµοποίηση, αφυδάτωση και διείσδυση µονιµοποιητικών, αλκοόλης, διαλυτικών ουσιών και παραφίνης στους ιστούς. Η µονιµοποίηση των ιστών γίνεται µε φορµαλδεϋδη (φορµόλη) (formalin fixation), η αφυδάτωση γίνεται µε εµβάπτυνση σε επτά δοχεία αιθανόλης 95%, η σταθεροποίηση των ιστών επιτυγχάνεται µε ξυλόλη, και τέλος ακολουθεί η παραφινοποίηση (paraffin embedding). Το στάδιο αυτό της επεξεργασίας του ιστού ολοκληρώνεται σε 16 ώρες. Στην συνέχεια, τα δείγµατα αυτά (Formalin-Fixed Paraffin-Embedded / FFPE samples) τοποθετούνται σε µια δεξαµενή µε ζεστό νερό, προκειµένου να λιώσει η παραφίνη. Ακολούθως τοποθετηθούνται οι ιστοί κατάλληλα σε ειδικές θήκες, έτσι ώστε ο ιστός να βρίσκεται στο κέντρο, και παραφινοποιούνται εκ νέου µε καθαρή παραφίνη, από τον σταθµό παραφίνης που λειτουργεί στους 70οC. H νέα παραφινοποίηση ολοκληρώνεται πρώτα µε την τοποθέτηση της θήκης που περιέχει τον ιστό σε ψυχόµενη µεταλλική πλάκα (-10oC) για ~10min, ή ώσπου να στερεοποιηθεί η παραφίνη. Τέλος, ο παραφινοποιηµένος ιστός τοποθετείται σε µικροτόµο, για την παρασκευή τοµών πάχους 4-5µm. Στην συνέχεια, οι τοµές αφού ξεδιπλωθούν σε µια δεξαµενή που περιέχει κάποια περιεκτικότητα αιθανόλης στους 39oC, τοποθετούνται σε θετικά φορτισµένες αντικειµενοφόρες πλάκες. Οι τοµές µπορούν να διατηρηθούν σε θερµοκρασία δωµατίου για µεγάλο χρονικό διάστηµα χωρίς να αλλοιωθούν.

2.8 Ανοσοφθορισµός σε τοµές ιστού µονιµοποιηµένου µε φορµαλδεϋδη και εµβαπτισµένου σε παραφίνη Εισαγωγή Προκειµένου να µελετηθεί η έκφραση της HURP σε επίπεδο πρωτεϊνης εφαρµόζεται ανοσοφθορισµός, όπου από την ένταση του φθορισµού µπορεί να εξαχθεί το επιθυµητό αποτέλεσµα. Επειδή η συγκεκριµένη µέθοδος εδώ εφαρµόζεται σε παραφινοποιηµένες τοµές ιστών (FFPE sections – Formalin Fixed Paraffin Embedded sections), κρίνεται απαραίτητο να πραγµατοποιούνται ειδικοί χειρισµοί σε σχέση µε την συνήθη εφαρµογή της εν λόγω τεχνικής σε κύτταρα. Έτσι, µετά τη µονιµοποίηση του ιστού και την παραφινοποίηση που ακολουθεί, γίνεται η αποπαραφινοποίηση των τοµών, και στην συνέχεια ακολουθεί η ανάκτηση των αντιγονικών επιτόπων, έτσι ώστε να µπορούν να προσδεθούν επιτυχώς στην συνέχεια τα πρωτογενή αντισώµατα. Τέλος, γίνεται ο ανοσοφθορισµός.

 

44  


Κατά τη µονιµοποίηση του ιστού, δηµιουργούνται δεσµοί µεταξύ των πρωτεϊνών στην επιφάνεια και το εσωτερικό των κυττάρων, αλλά και δεσµοί µεταξύ των πρωτεϊνών και των νουκλεϊκών οξέων, και µεταξύ των νουκλεϊκών οξέων. Έτσι, πολλοί αντιγονικοί επίτοποι δεν είναι πλέον εκτεθιµένοι, µε αποτέλεσµα να είναι σχεδόν αδύνατο για τα πρωτογενή αντισώµατα να προσδεθούν και να µην είναι ορατό προφανώς κανένα σήµα φθορισµού. Αυτό εξαρτάται, όµως, από τις πρωτεϊνες που θέλουµε να µελετήσουµε κάθε φορά, και δεν γενικεύεται για το σύνολο των αντιγονικών επιτόπων, αλλά εξαρτάται και από το πρωτόκολλο που ακολουθείται για τη µονιµοποίηση του ιστού. Στα πειράµατα που διεξήχθησαν χρησιµοποιήθηκαν πρωτογενή αντισώµατα έναντι της α-τουµπουλίνης, για να είναι ορατοί οι µικροσωληνίσκοι, και έναντι της ανθρώπινης HURP. Για την ανάκτηση των αντιγονικών επιτόπων εφαρµόστηκαν διαφορετικές µέθοδοι (antigen retrieval methods) µε επίδραση θερµότητας. Υλικά για τον ανοσοφθορισµό (εκτός συστατικών ανάκτησης αντιγονικών επιτόπων) • • • • • •

• • • • • • • • • • • • •

 

ξυλόλη τοµές πλακούντα µονιµοποιηµένες µε φορµαλδεϋδη (formalin) και παραφινοποιηµένες αιθανόλη (100%, 95%, 80%, 70%, 50%) απιονισµένο νερό (dH2O) απαγωγός εστία για χειρισµό χηµικών ουσιών πρωτογενή αντισώµατα: - mouse anti - a-tubulin (DM1A) (sc-32293, Santa Cruz Biotechnology) - rabbit anti-hHURP (DHL5, bleed 3, 02/04/2004) δευτερογενή αντισώµατα: - CF568 goat anti-mouse (Biotium, cat no: 20100) - CF488A donkey anti-rabbit (Biotium, cat no: 20015-1) - Alexa Fluor® 594 goat anti-mouse (Invitrogen, cat no: A11032) High-salt PBS 0,4M 1x PBS χρωστική DAPI (1000ng/ul) Mowiol (µέσο µονιµοποίησης) Θετικά φορτισµένες αντικειµενοφόροι πλάκες SuperFrost Plus (Menzel-Glaser, Germany) Καλυπτρίδες 20 x 20mm (Knittel, Germany) Λεπίδες Extremus® Silver (C.L. Sturkey, Inc. USA) Όρθιο βάζο χρώσης τοµών µε γυάλινο καπάκι (vertical staining jar w/ glass lid, Coplin jar) Παραλληλεπίπεδο δοχείο χρώσης (rectangular staining dish) Διάλυµα 5%BSA / 1xPBS Διάλυµα 5%BSA / 1xPBS / 0,5%Tween20 Πιπέτες 2ul, 20ul, 200ul, 1000ul Σωληνάρια eppendorf 0,5ul

45  


Πρωτόκολλα a) Αποπαραφινοποίηση 1.

Επώαση σε ξυλόλη για 5min (x3)

H διαδικασία της επώασης σε ξυλόλη πραγµατοποιείται µόνο σε απαγωγό εστία, λόγω της ισχυρής τοξικότητας της ξυλόλης. H ξυλόλη πρέπει να χειρίζεται µε ιδιαίτερη προσοχή.

2. Επώαση σε αιθανόλη 100% για 5min (x2) 3. Επώαση σε αιθανόλη 95% για 5min (x2) 4. Eπώαση σε αιθανόλη 80% για 5min 5. Επώαση σε αιθανόλη 70% για 5min 6. Επώαση σε αιθανόλη 50% για 5min 7. Επώαση σε dH2O για 5min (x2) 8. Διατήρηση σε 1xPBS µέχρι την εφαρµογή της ανάκτησης των αντιγονικών επιτόπων.

b) Ανάκτηση αντιγονικών επιτόπων (Antigen retrieval) Στα πλαίσια της ανάκτησης των αντιγονικών επιτόπων στις αποπαραφινοποιηµένες, πλέον, τοµές ιστού, δοκιµάστηκαν αρχικά διάφορες µέθοδοι, τα πρωτόκολλα των οποίων παρουσιάζονται παρακάτω. Ανάκτηση αντιγονικών επιτόπων µε χρήση κιτρικού νατρίου (sodium citrate method) 10mM, 0,05% Tween20, pH6.0 Σε ένα γυάλινο δοχείο (ή βάζο) χρώσης τοµών, προσθέτουµε αρκετή ποσότητα κιτρικού νατρίου, που διατηρούµε αποθηκευµένο στους 4oC. Η ποσότητα πρέπει να είναι τέτοια ώστε να καλύπτονται οι τοµές πλήρως και να µην παραµένουν στεγνές. Τοποθετούµε µέσα στο διάλυµα τις αποπαραφινοποιηµένες τοµές. Θερµαίνουµε σε φούρνο µικροκυµάτων για 20min. Κατά τη διάρκεια της θέρµανσης, διακόπτω τη λειτουργία του φούρνου µικροκυµάτων, µόλις αρχίζει να βράζει το διάλυµα, και συµπληρώνω µε επιπλέον ποσότητα όταν είναι απαραίτητο. Στο τέλος, αφήνω τις τοµές µε το κιτρικό νάτριο στον εργαστηριακό πάγκο για 20min, έτσι ώστε να κρυώσουν. Έκπλυση των τοµών για 5min σε dH2O, και µετά σε 1xPBS για 5min. •

• Ανάκτηση αντιγονικών επιτόπων µε χρήση 1Μ ουρίας (urea) Λίγο πριν την εφαρµογή της µεθόδου ανάκτησης των αντιγονικών επιτόπων, φτιάχνω το διάλυµα της ουρίας. Σε ένα γυάλινο δοχείο (ή βάζο), προσθέτουµε αρκετή ποσότητα ουρίας 1Μ, έτσι ώστε να καλύπτονται πλήρως οι τοµές και να µην παραµένουν στεγνές. Τοποθετούµε µέσα στο διάλυµα τις αποπαραφινοποιηµένες τοµές. Θερµαίνουµε σε φούρνο µικροκυµάτων για 20min. Κατά τη διάρκεια της θέρµανσης, διακόπτω τη λειτουργία του φούρνου µικροκυµάτων µόλις αρχίζει να βράζει το διάλυµα, και συµπληρώνω µε επιπλέον ποσότητα όταν είναι απαραίτητο. Στο τέλος, αφήνω τις τοµές µε την ουρία στον εργαστηριακό πάγκο για 20min, έτσι ώστε να κρυώσουν. Έκπλυση των τοµών σε dH2O για 5min, και µετά σε 1xPBS για 5min.  

46  


• Ανάκτηση αντιγονικών επιτόπων µε χρήση EDTA 1mM, pH8.0 Σε ένα γυάλινο δοχείο (ή βάζο), προσθέτουµε αρκετή ποσότητα EDTA, έτσι ώστε να καλύπτονται πλήρως οι τοµές και να µην παραµένουν στεγνές. Τοποθετούµε µέσα στο διάλυµα τις αποπαραφινοποιηµένες τοµές. Επωάζουµε σε θερµοκρασία δωµατίου για 10min. Στην συνέχεια, θερµαίνουµε σε φούρνο µικροκυµάτων για 15min. Κατά τη διάρκεια της θέρµανσης, διακόπτω τη λειτουργία του φούρνου µικροκυµάτων µόλις αρχίζει να βράζει το διάλυµα, και συµπληρώνω µε επιπλέον ποσότητα όταν είναι απαραίτητο. Στο τέλος, αφήνω τις τοµές µε το EDTA στον εργαστηριακό πάγκο για 15min, έτσι ώστε να κρυώσουν. Έκπλυση των τοµών σε • Χρήση εµπορικού διαλύµατος BioGenex (citra-plus solution 10x, cat. no: HK080-5KE) Το διάλυµα (antigen retrieval solution) της εταιρίας BioGenex που χρησιµοποιήθηκε είναι το Citra Plus solution (10x) (cat. no: ΗΚ080-5ΚΕ). Για να είναι χρησιµοποιήσιµο, αραιώθηκαν 2,5ml διαλύµατος 10x µε 22,5ml dΗ2Ο, έτσι ώστε να έχουµε τελικά 25ml διαλύµατος 1x. Η ποσότητα ήταν επαρκής ώστε να καλύπτεται η τοµή πληρώς. Για την εφαρµογή του πειράµατος προστέθηκε το εν λόγω διάλυµα σε ένα σωληνάριο (falcon) των 50ml, και στο ίδιο σωληνάριο τοποθετήθηκε και η τοµή. Το σωληνάριο τοποθετήθηκε, στην συνέχεια, εντός ενός ατµοµάγειρα για 30min, προκειµένου να γίνει υπό την επίδραση της θερµότητας η ανάκτηση των αντιγονικών επιτόπων. Ακολούθως, το σωληνάριο µε το διάλυµα και την τοµή αφέθηκε για 30min σε θερµοκρασία δωµατίου. Έκπλυση των τοµών σε dH2O για 5min, και µετά σε 1xPBS για 5min. • Χρήση εµπορικού διαλύµατος Dako (target retrieval solution pH9, 50x, cat. no: K8004) Για να είναι χρησιµοποιήσιµο το συγκεκριµένο διάλυµα, πρέπει να γίνει αραίωση 1/50 µε ddH20. Έτσι, αναµιγνύονται 2ml διαλύµατος 50x µε 98ml ddΗ2Ο. Η ποσότητα ήταν επαρκής για να πραγµατοποιηθεί η ανάκτηση των αντιγονικών επιτόπων τοποθετώντας τις τοµές σε όρθιο βάζο χρώσης. Γίνεται προθέρµανση, αρχικά, του διαλύµατος στο φούρνο µικροκυµάτων στα 450-500W και µετά τοποθετούνται µέσα σε αυτό οι τοµές. Η θέρµανση διαρκεί συνολικά 15min, και καθ’ όλη τη διάρκεια της θέρµανσης το βάζο είναι σκεπασµένο µε γυάλινο κάλυµµα, προκειµένου να µην έχουµε εξάτµιση του διαλύµατος ή ραγδαία µεταβολή της θερµοκρασίας. Όποτε το διάλυµα αρχίζει να βράζει, διακόπτεται η θέρµανση, και αναµένουµε για λίγα λεπτά µέχρι να ξεκινήσουµε πάλι τη διαδικασία. Στο τέλος, αφήνουµε το δοχείο µε το διάλυµα και τις τοµές σε RT (θερµοκρασία δωµατίου) για 20min. Έκπλυση των τοµών σε dH2O για 5min, και µετά σε 1xPBS για 5min. • Χρήση εµπορικού διαλύµατος Dako (target retrieval solution 10x, cat. no: S2031) Για να είναι χρησιµοποιήσιµο το συγκεκριµένο διάλυµα, πρέπει να γίνει αραίωση 1/10 µε ddH2O, οπότε αραιώνονται 20ml διαλύµατος 10x µε 180ml ddH2O. Δεν προθερµαίνουµε το διάλυµα. Τοποθετούνται οι τοµές µέσα στο διάλυµα, και η θέρµανση διαρκεί συνολικά 15min σε φούρνο µικροκυµάτων µε ένταση 450-500W. Καθ’ όλη τη διάρκεια της θέρµανσης το βάζο είναι καλυµµένο, ενώ µόλις αρχίζει να βράζει το διάλυµα, τότε διακόπτεται η θέρµανση, και αναµένουµε για λίγα λεπτά µέχρι να αρχίσουµε πάλι τη διαδικασία. Στο τέλος,

 

47  


αφήνουµε το δοχείο µε το διάλυµα και τις τοµές σε RT για 20min. Έκπλυση των τοµών σε dH2O για 5min, και µετά σε 1xPBS για 5min. Πρέπει να σηµειωθεί ότι το συγκεκριµένο διάλυµα που χρησιµοποιήθηκε είχε ήδη λήξει, αλλά ήταν το µόνο διαθέσιµο προς χρήση.

c) Ανοσοφθορισµός (Immunofluorescence) 1. Αφαιρείται αρκετά καλά το PBS από τις τοµές, και στην συνέχεια αυτές τοποθετούνται σε µια βάση, όπου προστίθενται στην καθεµία 200µl 1x PBS (ή τουλάχιστον µέχρι να καλύπτονται πλήρως). Επώαση για 5min. 2. Προστίθενται στην κάθε τοµή 150µl από το διάλυµα 5%BSA / 1xPBS / 0,5%Tween20 (blocking buffer). Επώαση για 50min, ενόσω οι τοµές είναι σκεπασµένες. 3.

Προστίθενται στην κάθε τοµή 150µl 5%BSA/ 1xPBS. Επώαση για 5min.

4. Προστίθενται στην κάθε τοµή 150µl (ή λιγότερο αν χρησιµοποιούµε µικρή τοµή) από το πρωτογενές αντίσωµα, το οποίο είναι διαλυτοποιηµένο σε 5%BSA / 1xPBS. Ολονύχτια επώαση (περίπου 12-14 ώρες) στους 4oC, ενόσω οι τοµές βρίσκονται σε χώρο µε υγρασία (humidified chamber). To πρωτογενές αντίσωµα έναντι της α-τουµπουλίνης αραιώνεται 1:500, ενώ το αντίσωµα έναντι της hHURP αραιώνεται 1:200.

5. Αφαιρείται όσο καλύτερα γίνεται το πρωτογενές αντίσωµα, και εκπλένονται οι τοµές 3 φορές µε High-salt PBS και µία φορά µε 1x PBS, επωάζοντας για 5min κάθε φορά. Χρησιµοποιούνται 200µl από κάθε διάλυµα για την κάθε τοµή ιστού. 6. Προστίθενται σε κάθε τοµή 150µl (ή λιγότερο αν χρησιµοποιείται µικρή τοµή) από το δευτερογενές αντίσωµα. Επώαση για 1h σε θερµοκρασία δωµατίου, ενόσω οι τοµές είναι σκεπασµένες. Όλα τα δευτερογενή αντισώµατα αραιώνονται 1:250 σε 5%BSA / 1xPBS.

7. Αφαιρείται το δευτερογενές αντίσωµα από τις τοµές και γίνονται τρεις εκπλύσεις µε High-salt PBS και µία έκπλυση µε 1x PBS επωάζοντας για 5min κάθε φορά. Χρησιµοποιούνται 200µl από κάθε διάλυµα για την κάθε τοµή ιστού. 8. Προστίθενται σε κάθε τοµή 150µl (ή λιγότερο αν χρησιµοποιείται µικρή τοµή) DAPI. Επώαση για 3min, ενόσω οι τοµές είναι σκεπασµένες. Το DAPI που χρησιµοποιείται είναι αραιωµένο 1:1000 σε 1x PBS.

9. Αφαιρείται το DAPI και γίνονται τρεις εκπλύσεις των τοµών µε 1x PBS επωάζοντας κάθε φορά για 3min. 10. Προστίθενται στην κάθε τοµή 30-45µl (ανάλογα µε το µέγεθος της τοµής) fluoromount. Μόλις προστεθεί το fluoromount, αµέσως τοποθετείται πάνω από την τοµή η καλυπτρίδα.

 

48  


Αφήνουµε τις τοµές να στεγνώσουν σε θερµοκρασία δωµατίου και σε σκοτάδι για ~1h, και µετά καλύπτουµε µε βερνίκι την περιφέρεια της καλυπτρίδας. 11. Αποθήκευση των τοµών στους 4oC και σκοτάδι, µέχρι την παρατήρησή τους στο συνεστιακό µικροσκόπιο.

2.9 Τυποποιηµένες συσκευασίες αντιδραστηρίων 1. TRI Reagent solution (MRC, cat. no: TR118 / Ambion, cat. no: AM9738) Χρησιµοποιήσαµε TRI Reagent solution των εταιρειών MRC και Ambion. Το συγκεκριµένο διάλυµα µπορεί να χρησιµοποιηθεί, γενικά, χωρίς καµία προεργασία για την αποµόνωση RNA, DNA και πρωτεϊνών από βιολογικό υλικό που προέρχεται από άνθρωπο, ζώο, φυτό, βακτήρια και ζύµες. Το εν λόγω διάλυµα οµογενοποίησης δίνει µεγάλη αξιοπιστία σε τεχνικές στις οποίες χρησιµοποιούνται περισσότερα από 5mg ιστού ή 5x105 καλλιεργηµένα κύτταρα. Περιέχει φαινόλη και guanidine thiocyanate σε ένα µονοφασικό διάλυµα, κι έτσι καταστέλλει αµέσως την ενεργότητα RNασών.

2. TURBO DNA free kit (Ambion, cat. no: AM1907) Χρησιµοποιήσαµε το TURBO DNA free kit της εταιρείας Ambion για την αντιµετώπιση του προβλήµατος της επιµόλυνσης µε DNA µετά την αποµόνωση του RNA. Το συγκεκριµένο kit περιέχει τα εξής: • TURBO DNase (DΝάση) (2U/µl) • 10x TURBO DNase buffer (ρυθµιστικό διάλυµα DΝάσης) • DNase Inactivation Reagent (διάλυµα απενεργοποίησης της DΝάσης) • Nuclease-free water (νερό ελεύθερο από νουκλάσες)

3. DNase I – Amplification Grade (Invitrogen, cat. no: 18068-015) Χρησιµοποιούµε το συγκεκριµένο κιτ µε σκοπό την αντιµετώπιση των προβληµάτων που δηµιουργεί η επιµόλυνση των δειγµάτων RNA µε γενωµικό DNA. Το συγκεκριµένο κιτ περιέχει τα εξής: • DNase I, Amp Grade (DΝάση) • 10x DNase I Reaction buffer (ρυθµιστικό διάλυµα DΝάσης) • 25mM EDTA, pH8.0 (διάλυµα απενεργοποίησης της DΝάσης)

 

49  


4. PrimeScriptTM First-strand cDNA synthesis kit (Takara, cat. no: 6110A) Το συγκεκιµένο kit της εταιρείας Takara χρησιµοποιήθηκε για το πρωτόκολλο της αντίστροφης µεταγραφής και περιέχει τα εξής: • PrimeScriptTM II RTase (αντίστροφη µεταγραφάση) (200U/µl) • 5x PrimeScriptTM Buffer (ρυθµιστικό διάλυµα αντίστροφης µεταγραφάσης) • RNase inhibitor (αναστολέας RNασών) (40U/µl) • dNTP mixture (10mM/καθένα) • Random hexamers (τυχαία εξαµερή εκκινητών) (50µM) 5. KAPA SYBR FAST Universal qPCR kit (Kapa Biosystems, cat. No: KK4601) Το συγκεκριµένο kit είναι της εταιρείας Kapa Biosystems και χρησιµοποιήθηκε στο πείραµα της Real-time PCR όταν ακολουθούµε το πρωτόκολλο των δύο βηµάτων (two-step protocol). Περιέχει τα εξής: • KAPA SYBR FAST qPCR Master Mix (2x) Universal • ROX Reference Dye High (50x) • ROX Reference Dye Low (50x)

2.10 Stock διαλύµατα Αιθανόλη Χρησιµοποιείται σε διάφορες συγκεντρώσεις. Οι αραιώσεις της καθαρής αιθανόλης (absolute ethanol) γίνονται µε ddH2O. Φυλάσσεται σε θερµοκρασία δωµατίου (25oC). Ισοπροπανόλη Φυλάσσεται σε θερµοκρασία δωµατίου (25oC). Χλωροφόρµιο Πρέπει να χρησιµοποιείται µε ιδιαίτερη προσοχή. Φυλάσσεται στο σκοτάδι και σε θερµοκρασία δωµατίου (25oC). EDTA 1mM, 0,05% Tween20, pH8.0 Διαλύουµε 0,37gr EDTA σε 1L dH2O. Αναµιγνύουµε καλά. Ρυθµίζουµε το pH στο 8 µε χρήση ΝaOH 1N. Προσθέτουµε 0,5ml Tween20 και αναµιγνύουµε καλά. Επιβεβαιώνουµε ότι το pH είναι ακόµα στο 8, αλλιώς ξαναρυθµίζουµε το pH αν χρειάζεται. Αποθηκεύουµε σε θερµοκρασία δωµατίου (25oC) µέχρι 3 µήνες. High-salt PBS 0,4M Διαλύουµε σε 1L dH2O από: 31,38gr NaCl, 1,78gr Na2HPO4, 0,27gr KH2PO4 και 0,2gr KCl. Αναµιγνύουµε καλά. Αποστειρώνουµε και αποθηκεύουµε σε θερµοκρασία δωµατίου (25oC).

 

50  


1x PBS Διαλύουµε σε 800ml dH2O από: 8gr NaCl, 0,2gr KCl, 1,44gr Na2HPO4 και 0,24gr KH2PO4. Αναµιγνύουµε αρκετά καλά µέχρι να διαλυτοποιηθούν πλήρως τα επιµέρους συστατικά, και προσθέτουµε επιπλέον dH2O µέχρι το 1L. Επιβεβαιωνόµαστε πως το pH είναι 7.4 . Αποστειρώνουµε το διάλυµα (20min, 121oC) και το αποθηκεύουµε σε θερµοκρασία δωµατίου (25oC).

Sodium citrate buffer (κιτρικό νάτριο) 10mM, 0,05% Tween20, pH6.0 Διαλύουµε 2,94gr Tris-sodium citrate (dihydrate) σε 1L ddH2O. Αναµιγνύουµε καλά. Ρυθµίζουµε το pH στο 6 µε χρήση HCl 1N. Αποθηκέυουµε στους 4oC. Πριν τη χρήση του διαλύµατος προσθέτουµε στη χρησιµοποιούµενη ποσότητα Tween20, έτσι ώστε αυτό να βρίσκεται σε περιεκτικότητα 0,05%, και αναδεύουµε καλά µε ανακαίνιση.

1Μ Urea Διαλύουµε 60,06gr σε 1L ddH2O. Αναδεύουµε καλά. Φτιάχνουµε το διάλυµα ακριβώς πριν από τη χρήση του.

 

51  


3. ΑΠΟΤΕΛΕΣΜΑΤΑ

 

52  


3.1 Μελέτη της γονιδιακής έκφρασης της HURP και της Aurora A σε διάφορους τύπους καρκίνου – Εισαγωγή Προκειµένου να γίνει αξιολόγηση της υπερέκφρασης των γονιδίων DLGAP5 και AURKA, τα οποία εκφράζουν τις πρωτεϊνες HURP και Aurora A αντίστοιχα, πραγµατοποι��θηκαν πειράµατα real-time PCR σε καρκινικά δείγµατα που προέρχονταν από τους τύπους καρκίνου που µας ενδιέφερε να µελετήσουµε. Συγκεκριµένα, µελετήθηκε η υπερέκφραση των δύο αυτών γονιδίων σε τρεις τύπους γυναικολογικού καρκίνου (καρκίνος των ωοθηκών, του ενδοµητρίου, του τραχήλου της µήτρας), αλλά και στον καρκίνο του µαστού, τον καρκίνο του παγκρέατος και τον καρκίνο του παχέος εντέρου. Από την σχετική ποσοτικοποίηση που έγινε µε βάση τα επίπεδα της έκφρασης των γονιδίων των πρωτεϊνών HURP και Aurora A σε δείγµατα φυσιολογικού ιστού, παρακείµενου του καρκινικού, υπολογίσθηκαν τα επίπεδα του mRNA στα καρκινικά δείγµατα (Εικόνα 20).

Εικόνα 20: Μεταβολή της έκφρασης των γονιδίων που εκφράζουν τις πρωτεϊνες HURP (κόκκινο) και Aurora A (µπλε) σε διάφορους τύπους καρκίνου. Μόνο για τα επίπεδα του γονιδίου της HURP στον καρκίνο του ενδοµητρίου έχουµε στατιστικά αξιόλογα αποτελέσµατα (p=0,0136). Στις υπόλοιπες οµάδες τα αποτελέσµατα δεν είναι στατιστικά σηµαντικά (p>0,5 / ns = non significant).

Σε όλους τους τύπους καρκίνου παρατηρείται υπερέκφραση και των δύο γονιδίων. ΄Οσον αφορά το γονίδιο της HURP, οι διαφορές στα επίπεδα έκφρασης είναι στατιστικά πολύ αξιόλογες (Kruskal-Wallis test, p=0,0024), ενώ όσον αφορά το γονίδιο της Aurora A, οι διαφορές αυτές δεν είναι στατιστικά σηµαντικές. Επιπλέον, µόνο για το γονίδιο της HURP και µόνο στον καρκίνο του ενδοµητρίου, τα αποτελέσµατα της υπερέκφρασης είναι στατιστικά σηµαντικά (p=0,0136). Αντίθετα, τα αποτελέσµατα για τις υπόλοιπες οµάδες δειγµάτων δεν είναι στατιστικά αξιόλογα, πιθανόν λόγω του περιορισµένου αριθµού δειγµάτων φυσιολογικού ιστού σε κάποιες περιπτώσεις (καρκίνος των ωοθηκών, καρκίνος

 

53  


του µαστού), ή λόγω του µικρού αριθµού δειγµάτων που εξετάσθηκαν συνολικά σε άλλες περιπτώσεις (καρκίνος του παγκρέατος, καρκίνος του τραχήλου της µήτρας). Από τα αποτελέσµατα που προκύπτουν, γίνεται φανερό πως το γονίδιο της HURP υπερεκφράζεται στον καρκίνο των ωοθηκών 6,36 φορές (0,8 φορές σε λογαριθµική κλίµακα, p=0,1247), στον καρκίνο του ενδοµητρίου 4,42 φορές (0,64 σε log κλίµακα, p=0,0136), στον καρκίνο του τραχήλου της µήτρας 3,62 φορές (0,56 σε log κλίµακα, p=0,1905), στον καρκίνο του µαστού 3,6 φορές (0,56 σε log κλίµακα, p=0,1602), στον καρκίνο του παγκρέατος υπερεκφράζεται 2,56 φορές (0,41 σε log κλίµακα, ns), και στον καρκίνο του παχέος εντέρου 1,13 φορές (0,05 σε log κλίµακα, 0,6702). Από την άλλη, όσον αφορά το γονίδιο της Aurora A, αυτό υπερεκφράζεται στον καρκίνο του παγκρέατος 2,57 φορές (0,41 σε log κλίµακα, ns), στον καρκίνο του τραχήλου της µήτρας 2,49 φορές (0,39 σε log κλίµακα, p=0,0635), στον καρκίνο του παχέος εντέρου 1,82 φορές (0,26 σε log κλίµακα, p=0,0848), στον καρκίνο του ενδοµητρίου 1,4 φορές (0,15 σε log κλίµακα, p=0,1086), στον καρκίνο του µαστού υπερεκφράζεται 1,37 φορές (0,14 σε log κλίµακα, p=0,4187), και στον καρκίνο των ωοθηκών 0,8 φορές (0,1 σε log κλίµακα, p=0,5025).

3.2 Αξιολόγηση της γονιδιακής έκφρασης της HURP και της Aurora A στον καρκίνο των ωοθηκών Στην συνέχεια, µελετήθηκε η έκφραση της HURP σε σχέση µε τις διάφορες κλινικοπαθολογικές παραµέτρους των ασθενών που φέρουν την κάθε µορφή καρκίνου. Αρχικά, µελετάται η συγκεκριµένη συσχέτιση για τον καρκίνο των ωοθηκών (Πίνακας 1). Πίνακας 1: Παρουσίαση της µέσης µεταβολής της έκφρασης του γονιδίου της HURP σε οµάδες δειγµάτων που φέρουν συγκεκριµένο κλινικοπαθολογικό χαρακτηριστικό του καρκίνου των ωοθηκών, και στατιστική αξιολόγηση

Θετική έκφραση της HURP Αριθµός ασθενών (%)

Μέση µεταβολή της έκφρασης*

22 (56,4%) 17 (43,6%)

8,68 12,48

10 (29,4%) 24 (70,6%)

8,41 10,26

Ηλικία <55 ετών ≥55 ετών Μέγεθος όγκου <2cm ≥2cm Ιστολογία Ορώδες κυσταδενοκαρκίνωµα Ορώδες-θηλώδες κυσταδενοκαρκίνωµα Ενδοµητριοειδές καρκίνωµα Βλεννώδες αδενοκαρκίνωµα

 

Τιµή Ρ**

Σχετικός κίνδυνος (95% Δ.Ε.)

0,6301 1 0,93 (0,74-1,16) 0,8501

19 (51,4%) 10 (27%) 4 (10,8%) 4 (10,8%)

12,30 13,15

1 0,95 (0,79-1,13) 0,1872

a

1 0,90 (0,76-1,07)

2,80 6,82

54  


Ιστολογική διαφοροποίηση Καλή-Μέτρια διαφοροποίηση Χαµηλή διαφοροποίηση Κακοήθης όγκος Καλοήθης όγκος Λεµφαδενική διήθηση Ναι Όχι Πρωτογενής καρκίνος Υποτροπή καρκίνου ωοθηκών Κατάσταση εµµηνόπαυσης Προ-εµµηνόπαυση Μετα-εµµηνόπαυση

0,0775 6 (23,1%) 20 (76,9%) 25 (80,6%) 6 (19,4%)

4,88 13,48 10,83 3,51

17 (65,4%) 9 (34,6%) 25 (65,8%) 13 (34,2%)

13,56 4,58 7,98 17,81

11 (28,2%) 28 (71,8%)

10,34 9,65

0,0429

1 1,01 (0,72-1,43) 1,39 (0,86-2,23) 1

0,0355

0,3324

1,36 (0,93-1,99) 1 1 0,88 (0,68-1,14)

0,7908 1 0,95 (0,77-1,18)

* t-test ** Mann-Whitney U test a Kruskal-Wallis test Δεν παρατηρήθηκε στατιστικά σηµαντική συσχέτιση της υπερέκφρασης της HURP µε την ηλικία (p=0,6301), ούτε µε το µέγεθος το όγκου (p=0,8501), ούτε µε την ιστολογία του όγκου (p=0,1872) ή τον βαθµό της ιστολογικής διαφοροποίησης (p=0,0775). Επίσης, δεν είναι στατιστικά σηµαντική η συσχέτιση της υπερέκφρασης της HURP σε επίπεδο mRNA µε το αν ο καρκίνος είναι πρωτογενής ή µετά από υποτροπή (p=0,3324), αλλά δεν σχετίζεται και µε την εµµηνόπαυση (p=0,7908). Αντίθετα, παρατηρείται στατιστικά σηµαντική συσχέτιση της έκφρασης της HURP, τόσο µε την κακοήθεια ή καλοήθεια του όγκου (p=0,0429), όσο και µε την λεµφαδενική διήθηση (p=0,0355). Χαρακτηριστικά, φαίνεται παρακάτω (Εικόνα 21) η διαφορά της µέσης µεταβολής της έκφρασης του γονιδίου της HURP στις δύο οµάδες κλινικοπαθολογικών χαρακτηριστικών που δίνουν αξιοσηµείωτα αποτελέσµατα (κακοήθεια/καλοήθεια, λεµφαδενική διήθηση).

Εικόνα 21: Μέση µεταβολή της έκφρασης του γονιδίου της HURP σε σχέση µε την κακοήθεια του όγκου και τη λεµφαδενική διήθηση.

 

55  


Λόγω του ότι δεν σχηµατίζονται ζεύγη φυσιολογικού-καρκινικού ιστού για όλα τα εξεταζόµενα δείγµατα, ήταν αδύνατο να εφαρµοστεί η πολλαπλή βηµατική λογιστική παλινδρόµηση, προκειµένου να αποδειχθεί κατά πόσο είναι ανεξάρτητοι προγνωστικοί παράγοντες η λεµφαδενική διήθηση και η κακοήθεια. Ωστόσο, βρέθηκε ότι η πιθανότητα υπερέκφρασης της HURP στους ασθενείς µε κακοήθεια είναι 1,39 φορές (95% Δ.Ε.=0,862,23) µεγαλύτερη σε σχέση µε τους ασθενείς που εµφανίζουν καλοήθεια. Πρακτικά, αυτό σηµαίνει ότι σε περίπτωση υπερέκφρασης της HURP, υπάρχει 39% αυξηµένη πιθανότητα για εµφάνιση κακοήθειας. Επιπλέον, βρέθηκε ότι η πιθανότητα υπερέκφρασης της HURP σε ασθενείς µε λεµφαδενική διήθηση είναι 1,36 φορές (95% Δ.Ε.=0,93-1,99). Αυτό σηµαίνει πως η υπερέκφραση της HURP σχετίζεται µε 36% αυξηµένη πιθανότητα για εµφάνιση λεµφαδενικής διήθησης. Σχετικά µε την υπερέκφραση του γονιδίου της Aurora A στον καρκίνο των ωοθηκών, δε βρέθηκε να υπάρχει στατιστικά σηµαντική συσχέτιση της υπερέκφρασης µε κάποιο από τα εξεταζόµενα κλινικοπαθολογικά χαρακτηριστικά. Πίνακας 2: Παρουσίαση της µέσης µεταβολής της έκφρασης του γονιδίου της Aurora A σε οµάδες δειγµάτων που φέρουν συγκεκριµένο κλινικοπαθολογικό χαρακτηριστικό του καρκίνου των ωοθηκών, και στατιστική αξιολόγηση

Θετική έκφραση της Aurora A Μέση µεταβολή της έκφρασης* Ηλικία <55 ετών ≥55 ετών Μέγεθος όγκου <2cm ≥2cm Ιστολογία Ορώδες κυσταδενοκαρκίνωµα Ορώδες-θηλώδες κυσταδενοκαρκίνωµα Ενδοµητριοειδές καρκίνωµα Βλεννώδες αδενοκαρκίνωµα Ιστολογική διαφοροποίηση Καλή-Μέτρια διαφοροποίηση Χαµηλή διαφοροποίηση Κακοήθης όγκος Καλοήθης όγκος Λεµφαδενική διήθηση Ναι Όχι Πρωτογενής καρκίνος Υποτροπή καρκίνου ωοθηκών Κατάσταση εµµηνόπαυσης Προ-εµµηνόπαυση Μετα-εµµηνόπαυση

Τιµή Ρ** 0,9298

1,50 1,64 0,9844 1,01 1,42 0,3367

a

1,56 1,74 2,38 0,57 0,3015 1,77 1,25 1,30 1,96

0,1138 0,2458

1,82 0,87 1,33 2,53

0,2771 0,7968

1,67 1,52

*t-test ** Mann-Whitney U test a Kruskal-Wallis test

 

56  


Στην συνέχεια, καταγράφηκε ο χρόνος παρακολούθησης των ασθενών µε καρκίνο των ωοθηκών, και βρέθηκε ότι αυτός κυµαινόταν από 2 έως 35 µήνες, µε µέσο χρόνο παρακολούθησης 11,3 ± 7,87 µήνες (διάµεσος χρόνος παρακολούθησης 9 µήνες). Κατά τη διάρκεια της περιόδου παρακολούθησης 9 (22,5%) από τους ασθενείς απεβίωσαν είτε από νοσοκοµειακό θάνατο είτε λόγω του καρκίνου. H µελέτη της επιβίωσης των ασθενών, σύµφωνα µε τη µέθοδο Kaplan-Meier, έδειξε ότι το µέσο ποσοστό 6µηνης, ετήσιας και διετούς επιβίωσης των ασθενών που υπερεκφράζουν τις πρωτεϊνες HURP και Aurora A, µιας και µελετώνται οι ίδιοι ασθενείς, είναι 86,75%, 75,19% και 50,12% αντίστοιχα. Η µέση επιβίωση των ασθενών, όπως υπολογίστηκε βάσει του διαστήµατος επιβίωσης των τελικά αποθανόντων ασθενών, είναι 10 ± 8,5 µήνες (95% Δ.Ε. = 3,47-16,53) µε διάµεση επιβίωση τους 6 µήνες.

Εικόνα 22: Καµπύλη επιβίωσης των ασθενών µε καρκίνο των ωοθηκών. Οι διακεκοµένες γραµµές σχηµατίζουν τις καµπύλες που προκύπτουν από την τυπική απόκλιση.

Σχετικά µε τη χηµειοθεραπεία που έλαβαν οι ασθενείς, οι χηµειοθεραπευτικές δραστικές ουσίες που τους χορηγήθηκαν κυρίως είναι η σισπλατίνη (cisplatin), η πακλιταξέλη (paclitaxel, εµπορ. oνοµασία: Taxol, Taxoprol, Ovapac, Paxital, Paxene), η δοσεταξέλη (docetaxel, εµπορ. oνοµασία: Taxotere) και η καρβοπλατίνη (carboplatin, εµπορ. oνοµασία: Megaplatin, Carboplan). Η πακλιταξέλη και η δοσεταξέλη ανήκουν στις φαρµακευτικές ουσίες που είναι γνωστές ως ταξάνες (taxanes). Από τους ασθενείς µε καρκίνο των ωοθηκών, που µελετάµε στην συγκεκριµένη έρευνα, το 81,5% των ασθενών έλαβε κάποιας µορφής θεραπεία, ενώ το υπόλοιπο 18,5% δεν έλαβε καµιά θεραπεία. Η συσχέτιση της υπερέκφρασης της HURP µε τη λήψη ή όχι θεραπείας είναι µη αξιόλογη (p=0,3994), και σε σχέση µε την υπερέκφραση της Aurora A η συσχέτιση είναι επίσης µη αξιόλογη (p=0,9254).

Εικόνα 23: Αναπαράσταση του ποσοστού των συνολικά εξεταζοµένων ασθενών που έλαβαν ή δεν έλαβαν χηµειοθεραπευτική αγωγή.

 

57  


Από όσους έλαβαν θεραπεία, και για τους οποίους γνωρίζουµε τα χηµειοθεραπευτικά φάρµακα που τους χορηγήθηκαν, το 36,8% έλαβε κάποια στιγµή κατά τη διάρκεια της θεραπείας σισπλατίνη. Το 63,1%, ακόµη, έλαβε κατά τη διάρκεια της θεραπείας του πακλιταξέλη (Taxol, Taxotere, Ovapac, Paxital ή Paxene), το 42,1% έλαβε ανάµεσα στα άλλα φάρµακα και καρβοπλατίνη (Carboplan, Megaplatin), το 15,8% των ασθενών έλαβε δοσεταξέλη, και το 15,8% έλαβε και κάποιο άλλο φάρµακο εκτός των παραπάνω (vinorelbine, gemcitabine, doxorubicin, cyclophosphamide). Όπως γίνεται φανερό από τα ποσοστά, σε όλους τους ασθενείς χορηγούνταν συνδυασµός δύο ή περισσότερων χηµειοθεραπευτικών φαρµάκων, γιατί έτσι η αντικαρκινική θεραπεία είναι αποτελεσµατικότερη.

Εικόνα 24: Γραφική παράσταση όπου παρουσιάζεται το ποσοστό των ασθενών επί του συνόλου, που έλαβαν κάποιο από τα εµπορικά διαθέσιµα χηµειοθεραπευτικά φάρµακα (εδώ αναφέρεται η δραστική ουσία). Συγκεκριµένα, αναπαριστάται το ποσοστό των ασθενών που έλαβε µια συγκεκριµένη δραστική ουσία, αλλά και το ποσοστό των ασθενών που έλαβε συνδυασµό δραστικών ουσιών. Κάποιος ασθενής µπορεί να ανήκει σε περισσότερες από µία κατηγορίες.

Στην συνέχεια, υπολογίσθηκε η µέση µεταβολή της έκφρασης της HURP και της Aurora A στα καρκινικά δείγµατα ασθενών που είχαν λάβει κάποια δραστική ουσία µε αντινεοπλασµατική δράση, ή συνδυασµό δραστικών ουσιών. Από την στατιστική αξιολόγηση που έγινε βρέθηκε, τελικά, ότι για καµιά περίπτωση δεν υπάρχει συσχέτιση µεταξύ της υπερέκφρασης της HURP ή της Aurora A και κάποιας χηµειοθεραπευτικής ουσίας. Εξαίρεση σε αυτό αποτελεί, όµως, η περίπτωση των ασθενών που τους χορηγήθηκε συνδυασµός καρβοπλατίνης και πακλιταξέλης. Σε αυτήν την περίπτωση έχουµε στατιστικά σηµαντική συσχέτιση (p=0,0303) µεταξύ της θεραπευτικής αγωγής και της υπερέκφρασης της HURP, αλλά προς το παρών δεν µπορεί να γίνει περαιτέρω στατιστική ανάλυση, λόγω του µικρού αριθµού δειγµάτων.

 

58  


Πίνακας 3: Παρουσίαση της µέσης µεταβολής της έκφρασης των γονιδίων HURP και AURKA σε οµάδες δειγµάτων ασθενών που τους έχει χορηγηθεί κάποια δραστική ουσία έναντι του καρκίνου των ωοθηκών, και στατιστική αξιολόγηση.

Θετική έκφραση της HURP Μέση µεταβολή a της έκφρασης πακλιταξέλη (Taxol, Taxoprol) καρβοπλατίνη (Carboplan, Megaplatin) δοσεταξέλη (Taxotere) σισπλατίνη Άλλο σισπλατίνη-πακλιταξέλη καρβοπλατίνηπακλιταξέλη

Τιµή Ρ

b

Θετική έκφραση της Aurora A Μέση µεταβολή της έκφρασης*

2,47

1,60

3,21

1,31

2,39 1,44 1,91 1,14

Τιµή Ρ

0,59 1,36 0,91 1,20

0,1194

3,83 (*)

b

0,7803

1,69

a

t-test Kruskal-Wallis test (*) στατιστικά σηµαντικό αποτέλεσµα b

3.3 Αξιολόγηση της γονιδιακής έκφρασης της HURP και της Aurora A στον καρκίνο του µαστού Όσον αφορά τον καρκίνο του µαστού, όπως φαίνεται και στον Πίνακα 4, δε βρέθηκε να υπάρχει στατιστικά σηµαντική συσχέτιση της υπερέκφρασης της HURP µε κανένα από τα εξεταζόµενα κλινικοπαθολογικά χαρακτηριστικά. Πίνακας 4: Παρουσίαση της µέσης µεταβολής της έκφρασης του γονιδίου της HURP σε οµάδες δειγµάτων που φέρουν συγκεκριµένο κλινικοπαθολογικό χαρακτηριστικό του καρκίνου του µαστού, και στατιστική αξιολόγηση.

Θετική έκφραση της HURP Αριθµός ασθενών (%)

Μέση µεταβολή της έκφρασης*

7 (58,3%) 5 (41,7%)

14,64 3,28

3 (27,3%) 8 (72,7%)

13,75 6,97

1 1,07 (0,56-2,03)

1 (8,3%) 11 (91,7%)

0,31 10,78

1 1,02 (0,44-2,39)

6 (54,5%) 5 (45,5%)

8,99 11,23

Ηλικία ≥55 <55 Μέγεθος όγκου <2cm ≥2cm Ιστολογία Λοβιακό καρκίνωµα Διηθητικό πορογενές καρκίνωµα Ιστολογική διαφοροποίηση Καλή/Μέτρια (G1/G2) Χαµηλή (G3)

 

Τιµή Ρ

Σχετικός κίνδυνος (95% Δ.Ε.)

0,1490 1 0,71 (0,39-1,29) 0,2788

0,7144 0,79 (0,49-1,26) 1

59  


ER Θετικό Αρνητικό

10,19 0,31

6 (60%) 4 (40%)

12,36 4,47

0,94 (0,52-1,69) 1

2 (22,2%) 7 (77,8%)

9,22 10,00

0,86 (0,36-2,05) 1

7 (63,6%) 4 (36,4%) 10 (90,9%) 1 (9,1%)

7,18 10,83 11,64 0,31

PR Θετικό Αρνητικό Her2/c-neu/c-erbB2 Θετικό Αρνητικό Λεµφαδενική διήθηση Ναι Όχι Κακοήθης όγκος Καλοήθης όγκος

0,97 (0,41-2,32) 1

9 (90%) 1 (10%)

0,6095

0,9273 0,97 (0,56-1,7) 1 1,00 (0,43-2,35) 1

* t-test ** Mann-Whitney U test Δεν ήταν, όµως, δυνατή η εύρεση στατιστικής συσχέτισης για όλες τις κλινικοπαθολογικές παραµέτρους, γιατί δεν υπήρχε ο ελάχιστος απαιτητός αριθµός δειγµάτων (απαιτούνται τουλάχιστον 3 δείγµατα) σε µια από τις δύο οµάδες, προκειµένου να εφαρµοστεί η δοκιµασία Mann-Whitney. Πίνακας 5: Παρουσίαση της µέσης µεταβολής της έκφρασης του γονιδίου της Αurora A σε οµάδες δειγµάτων που φέρουν συγκεκριµένο κλινικοπαθολογικό χαρακτηριστικό του καρκίνου του µαστού, και στατιστική αξιολόγηση.

Θετική έκφραση της Aurora A Μέση µεταβολή της έκφρασης* Ηλικία ≥55 <55 Μέγεθος όγκου <2cm ≥2cm Ιστολογία Διηθητικό πορογενές καρκίνωµα Λοβιακό καρκίνωµα Ιστολογική διαφοροποίηση Καλή/Μέτρια (G1/G2) Χαµηλή (G3) ER Θετικό Αρνητικό PR Θετικό Αρνητικό Her2/c-neu/c-erbB2 Θετικό Αρνητικό Λεµφαδενική διήθηση

 

Τιµή Ρ** 0,4318

7,83 3,17 0,1939 4,66 2,49 3,13 0,19 0,5830 3,26 4,38 3,34 0,19 0,7619 2,72 3,49 1,57 3,52 0,6485

60  


Ναι Όχι Κακοήθης όγκος Καλοήθης όγκος

2,53 3,17 3,32 0,19

* t-test ** Mann-Whitney U test

Σχετικά µε τη χηµειοθεραπεία που έλαβαν οι ασθενείς, οι χηµειοθεραπευτικές δραστικές ουσίες που τους χορηγήθηκαν κυρίως είναι η πακλιταξέλη (paclitaxel, εµπορ. oνοµασία: Taxoprol), η δοσεταξέλη (docetaxel, εµπορ. oνοµασία: Taxotere), η κυκλοφωσφαµίδη (cyclophosphamide, εµπορ. oνοµασία: Endoxan) και η επιρουβικίνη (epirubicin, εµπορ. oνοµασία: Epibra, Farmorubicin). Σε κάποιους ασθενείς χορηγήθηκε η δραστική ουσία φλουορουρακίλη (fluorouracil, εµπορ. oνοµασία: 5FU) σε συνδυασµό µε το µονοκλωνικό αντίσωµα trastuzumab (Herceptin). Η πακλιταξέλη και η δοσεταξέλη ανήκουν στις φαρµακευτικές ουσίες που είναι γνωστές ως ταξάνες (taxanes). Από τους ασθενείς µε καρκίνο του µαστού, που µελετάµε στην συγκεκριµένη έρευνα, το 90,1% των ασθενών έλαβε κάποιας µορφής θεραπεία, ενώ µόλις το 0,9% δεν έλαβε καµιά θεραπεία.

Εικόνα 25: Αναπαράσταση του συνολικά εξεταζοµένου αριθµού ασθενών, που έλαβε ή δεν έλαβε χηµειοθεραπευτική αγωγή.

Από όσους ασθενείς έλαβαν θεραπεία, κι έχουµε στοιχεία για τη θεραπεία που έλαβαν, στο 50% αυτών χορηγήθηκε πακλιταξέλη (Taxoprol), στο 40% χορηγήθηκε δοσεταξέλη (Taxotere), στο 60% επιρουβικίνη (Epibra ή Farmorubicin), και στο 50% των ασθενών χορηγήθηκε κυκλοφωφαµίδη (Endoxan). Τέλος, στο 20% των ασθενών χορηγήθηκε συνδυασµός της φλουορουρακίλης και του trastuzumab, γιατί πιθανόν έχει παρατηρηθεί ότι έτσι η θεραπεία είναι αποτελεσµατικότερη. Κάποιος ασθενής µπορεί να ανήκει σε περισσότερες από µία από τις παραπάνω κατηγορίες, και τα ποσοστά αυτά είναι ενδεικτικά του πόσο πολύ προτιµήθηκε το καθένα χηµειοθεραπευτικό σκεύασµα, τουλάχιστον όσον αφορά την οµάδα ασθενών που µελετήσαµε.

 

61  


Εικόνα 26: Γραφική παράσταση όπου παρουσιάζεται το ποσοστό των ασθενών επί του συνόλου, που έλαβαν κάποιο από τα εµπορικά διαθέσιµα χηµειοθεραπευτικά φάρµακα. Συγκεκριµένα, αναπαριστάται το ποσοστό των ασθενών που έλαβε µια συγκεκριµένη δραστική ουσία, αλλά και το ποσοστό των ασθενών που έλαβε συνδυασµό δραστικών ουσιών. Κάποιος ασθενής µπορεί να ανήκει σε περισσότερες από µία κατηγορίες.

 

Στην συνέχεια, υπολογίσθηκε η µέση µεταβολή της έκφρασης της HURP και της Aurora A (Πίνακας 6) στα καρκινικά δείγµατα ασθενών που είχαν λάβει κάποια δραστική ουσία µε αντινεοπλασµατική δράση, ή συνδυασµό δραστικών ουσιών. Από την στατιστική αξιολόγηση που έγινε βρέθηκε, τελικά, ότι για καµιά περίπτωση δεν υπάρχει συσχέτιση µεταξύ της υπερέκφρασης της HURP ή της Aurora A και κάποιας χηµειοθεραπευτικής ουσίας. Εξαίρεση σε αυτό αποτελεί, όµως, η περίπτωση των ασθενών που τους χορηγήθηκε πακλιταξέλη (Taxoprol). Σε αυτήν την περίπτωση έχουµε στατιστικά σηµαντική συσχέτιση (p=0,0317) µεταξύ της θεραπευτικής αγωγής και της υπερέκφρασης της HURP, αλλά προς το παρών δεν µπορεί να γίνει περαιτέρω στατιστική ανάλυση πάνω στο συγκεκριµένο θέµα λόγω του µικρού αριθµού δειγµάτων που µάς είναι διαθέσιµα. Πίνακας 6: Παρουσίαση της µέσης µεταβολής της έκφρασης των γονιδίων HURP και AURKA σε οµάδες δειγµάτων ασθενών που τους έχει χορηγηθεί κάποια δραστική ουσία έναντι του καρκίνου του µαστού, και στατιστική αξιολόγηση.

Θετική έκφραση της HURP Μέση µεταβολή Τιµή Ρ της έκφρασης πακλιταξέλη (Taxoprol) δοσεταξέλη (Taxotere) επιρουβικίνη (Epibra, Farmorubicin) κυκλοφωσφαµίδη (Endoxan) 5FU/Herceptin

 

33,9 (*) 3,03 14,21

Θετική έκφραση της Aurora A Μέση µεταβολή Τιµή Ρ της έκφρασης 4,87 1,20

0,0655

2,70

31,01

3,59

3,58

1,35

0,2081

62  


3.4 Αξιολόγηση της γονιδιακής έκφρασης της HURP και της Aurora A στον καρκίνο του ενδοµητρίου Όσον αφορά τον καρκίνο του ενδοµητρίου, έγινε η στατιστική αξιολόγηση της υπερέκφρασης του γονιδίου της HURP που παρουσιάζεται παρακάτω (Πίνακας 7). Πίνακας 7: Παρουσίαση της µέσης µεταβολής της έκφρασης του γονιδίου της HURP σε οµάδες δειγµάτων που φέρουν συγκεκριµένο κλινικοπαθολογικό χαρακτηριστικό του καρκίνου του ενδοµητρίου, και στατιστική αξιολόγηση.

Θετική έκφραση της HURP Αριθµός ασθενών (%)

Μέση µεταβολή της έκφρασης*

<55 ≥55

9 (69,2%) 7 (53,8%)

5,44 28,17

<2cm ≥2cm

5 (31,3%) 11 (68,7%)

6,10 21,16

12 (70,6%) 5 (29,4%)

8,07 33,95

9 (75%) 3 (25%)

5,27 21,58

8 (53,3%) 7 (46,7%) 12 (85,7%) 2 (14,3%)

24,86 6,27 7,93 3,52

5 (29,4%) 12 (70,6%)

5,61 19,88

Ηλικία

Τιµή Ρ**

Σχετικός κίνδυνος (95% Δ.Ε.)

0,6065

Μέγεθος όγκου

1 0,78 (0,38-1,57) 0,4967

Ιστολογία Αδενοκαρκίνωµα Άλλο Ιστολογική διαφοροποίηση Καλή (G1) Μέτρια-Χαµηλή (G2, G3) Διήθηση µυοµητρίου Ναι Όχι Κακοήθης όγκος Καλοήθης όγκος Κατάσταση εµµηνόπαυσης Προ-εµµηνόπαυση Μετα-εµµηνόπαυση

1 0,67 (0,35-1,26) 0,7921 0,94 (0,46-1,89) 1 0,0332 1,16 (0,44-3,08) 1 0,9551 0,74 (0,38-1,45) 1 1,00 (0,34-2,88) 1 0,2254 1 0,94 (0,46-1,89)

* t-test ** Mann-Whitney U test Δεν παρατηρήθηκε στατιστικά σηµαντική συσχέτιση της υπερέκφρασης του γονιδίου της HURP µε την ηλικία (p=0,6065), αλλά ούτε µε το µέγεθος του όγκου (p=0,4967), και την ιστολογία του καρκίνου (p=0,7921). Επίσης, δε βρέθηκε στατιστικά σηµαντική συσχέτιση µε τη διήθηση του µυοµητρίου (p=0,9551), την κακοήθεια (ns), και την εµµηνοπαυσιακή κατάσταση (p=0,2254). Αντίθετα, φαίνεται πως είναι στατιστικά σηµαντική η συσχέτιση της υπερέκφρασης της HURP µε το βαθµό διαφοροποίησης (p=0,0332).

Εικόνα 27: Μέση µεταβολή της έκφρασης του γονιδίου της HURP σε σχέση µε το βαθµό της ιστολογικής διαφοροποίησης του όγκου.

 

63  


Υπολογίσθηκε, ακόµη, πως σε περίπτωση που οι ασθενείς παρουσιάζουν υπερέκφραση της HURP έχουν αυξηµένη πιθανότητα παρουσίασης καλής διαφοροποίησης των κυττάρων του όγκου κατά 1,16 φορές (95% Δ.Ε.=0,44-3,08). Άρα, είναι 16% πιθανότερο ένας ασθενής µε καρκίνο του ενδοµητρίου που υπερεκφράζει την HURP, να παρουσιάζει καλή διαφοροποίηση. Πίνακας 8: Παρουσίαση της µέσης µεταβολής της έκφρασης του γονιδίου της Aurora A σε οµάδες δειγµάτων που φέρουν συγκεκριµένο κλινικοπαθολογικό χαρακτηριστικό του καρκίνου του ενδοµητρίου, και στατιστική αξιολόγηση.

Θετική έκφραση της Aurora A Μέση µεταβολή της έκφρασης * Ηλικία <55 ≥55 Μέγεθος όγκου <2cm ≥2cm Ιστολογία Αδενοκαρκίνωµα Άλλο Ιστολογική διαφοροποίηση Καλή (G1) Μέτρια/Χαµηλή (G2/G3) Διήθηση µυοµητρίου Ναι Όχι Κακοήθης όγκος Καλοήθης όγκος Κατάσταση εµµηνόπαυσης Προ-εµµηνόπαυση Μετα-εµµηνόπαυση

Τιµή Ρ** 0,9623

3,65 5,59 0,6353 3,70 5,02 0,8437 3,59 2,39 0,2818 2,66 3,86 0,9551 4,79 4,90 3,38 0,80 0,8437 3,69 4,85

* t-test ** Mann-Whitney U test

Όσον αφορά τα επίπεδα έκφρασης της Aurora A στον καρκίνο του ενδοµητρίου, είναι αυξηµένα σε όλες τις οµάδες κλινικοπαθολογικών χαρακτηριστικών, µε εξαίρεση τους καλοήθεις όγκους, όπου παρατηρείται σχεδόν µηδενική υπερέκφραση. Ωστόσο, δεν υπάρχει στατιστικά σηµαντική συσχέτιση µε κανένα από αυτά τα χαρακτηριστικά, µε αποτέλεσµα να είναι αδύνατο να καταλήξουµε σε ασφαλή συµπεράσµατα.

 

64  


3.5 Αξιολόγηση της γονιδιακής έκφρασης της HURP και της Aurora A στον καρκίνο του παγκρέατος Σχετικά µε τον καρκίνο του παγκρέατος, από τους ασθενείς των οποίων έχουµε µελετήσει δείγµατα, το 100% αυτών είναι άνω των 55 ετών και τους έχει διαγνωσθεί αδενοκαρκίνωµα του παγκρέατος. Επιπλέον, το 42,8% των ασθενών φέρει όγκο διαµέτρου <2cm, και το 57,1% φέρει όγκο διαµέτρου ≥2cm (p=0,4). To 85,7% των ασθενών, ακόµη, έχει κακοήθη όγκο, ενώ µόλις στο 14,3% έχει διαγνωσθεί καλοήθεια. Τέλος, στο 60% έχει διαπιστωθεί λεµφαδενική διήθηση. Κανένα από τα παραπάνω αποτελέσµατα δεν είναι στατιστικά σηµαντικό και δεν µπορεί να συσχετισθεί µε την υπερέκφραση της HURP, λόγω του πολύ µικρού αριθµού καρκινικών δειγµάτων που έχουν εξετασθεί. Επίσης, όσον αφορά την υπερέκφραση της Aurora A, δεν µπορούν να εξαχθούν στατιστικά σηµαντικά αποτελέσµατα, λόγω του µικρού αριθµού καρκινικών δειγµάτων που έχουν µελετηθεί. Από την στατιστική αξιολόγηση της συσχέτισης του µεγέθους του όγκου και της υπερέκφρασης της Aurora A προκύπτει επίσης p=0,4 (non significant).

3.6 Αξιολόγηση της γονιδιακής έκφρασης της HURPκαι της Aurora A στον καρκίνο του παχέος εντέρου Σχετικά µε τον καρκίνο του παχέος εντέρου, έγινε η στατιστική αξιολόγηση της υπερέκφρασης του γονιδίου της HURP που παρουσιάζεται παρακάτω (Πίνακας 9). Πίνακας 9: Παρουσίαση της µέσης µεταβολής της έκφρασης του γονιδίου της HURP σε οµάδες δειγµάτων που φέρουν συγκεκριµένο κλινικοπαθολογικό χαρακτηριστικό του καρκίνου του παχέος εντέρου, και στατιστική αξιολόγηση.

Θετική έκφραση της HURP Αριθµός ασθενών (%)

Μέση µεταβολή της έκφρασης*

3 (17,6%) 14 (82,4%)

11,28 1,26

4 (22,2%) 14 (77,8%)

2,38 1,50

1 0,91 (0,47-1,75)

15 (88,2%) 2 (11,8%)

1,46 3,79

0,90 (0,38-2,13) 1

9 (60%) 6 (40%) 16 (88,9%)

1,64 1,28 1,43

Ηλικία

0,0508 <55 ≥55

Μέγεθος όγκου <2cm ≥2cm Ιστολογία Αδενοκαρκίνωµα Άλλο Καρκινικό στάδιο Ι/ΙΙ ΙΙΙ/ΙV Κακοήθης όγκος

 

Τιµή Ρ**

Σχετικός κίνδυνος (95% Δ.Ε.) 1 0,61 (0,37-1,02)

0,4900

0,6070 1 1,00 (0,52-1,92) 0,92 (0,39-2,17)

65  


Καλοήθης όγκος Λεµφαδενική διήθηση Ναι

Όχι

2 (11,1%)

3,79

1 0,7340

5 (31,3%)

1,52

1

11 (68,8%)

1,39

1,03 (0,54-1,97)

* t-test ** Mann-Whitney U test Με εξαίρεση την ηλικία, για την οποία βρέθηκε οριακά σηµαντική στατιστική συσχέτιση (p=0,0508) µε την υπερέκφραση της HURP, για τα υπόλοιπα χαρακτηριστικά δεν αποδεικνύεται καµιά στατιστική συσχέτιση. Επιπλέον, µε υπολογισµό του σχετικού κινδύνου βρέθηκε ότι οι ασθενείς µε καρκίνο του παχέος εντέρου και ηλικία άνω των 55 ετών, έχουν σχετικό κίνδυνο 0,61 (95% Δ.Ε.=0,37-1,02). Αυτό σηµαίνει πως η αυξηµένη ηλικία αποτελεί προστατευτικό παράγοντα στην εµφάνιση της νόσου. Εικόνα 28: Μέση µεταβολή της έκφρασης του γονιδίου της HURP σε σχέση µε την ηλικία των ασθενών.

Πίνακας 10: Παρουσίαση της µέσης µεταβολής της έκφρασης του γονιδίου της Αurora A σε οµάδες δειγµάτων που φέρουν συγκεκριµένο κλινικοπαθολογικό χαρακτηριστικό του καρκίνου του παχέος εντέρου, και στατιστική αξιολόγηση.

Θετική έκφραση της Aurora A Μέση µεταβολή της έκφρασης* Ηλικία <55 ≥55 Μέγεθος όγκου <2cm ≥2cm Ιστολογία Αδενοκαρκίνωµα Άλλο Καρκινικό στάδιο Ι/ΙΙ ΙΙΙ/ΙV

 

Τιµή Ρ** 0,1859

6,76 2,40 0,3130 5,36 2,43 1,88 4,33 0,8639 3,50 2,31

66  


Κακοήθης όγκος Καλοήθης όγκος Λεµφαδενική διήθηση Ναι Όχι

2,93 4,33 0,4967 2,23 3,24

* t-test ** Mann-Whitney U test Άρα, θα µπορούσαµε τότε να πούµε ότι τα άτοµα ηλικίας κάτω των 55 ετών, που υπερεκφράζουν την HURP έχουν µεγαλύτερη πιθανότητα εµφάνισης καρκίνου του παχέος εντέρου. Ωστόσο, κάτι τέτοιο θα έπρεπε να εξετασθεί σε ακόµα µεγαλύτερο αριθµό ατόµων, αφού για να εξαχθεί το παραπάνω συµπέρασµα, ήταν πολύ µικρός ο αριθµός των καρκινικών δειγµάτων από ασθενείς κάτω των 55 ετών, και δεν είχαµε στη διάθεσή µας δείγµατα φυσιολογικού ιστού από άτοµα κάτω των 55 ετών. Όσον αφορά τα επίπεδα έκφρασης της Aurora A στον καρκίνο του παχέος εντέρου, παρατηρείται ότι σε όλες τις οµάδες, που έχουν δηµιουργηθεί βάσει των κλινικοπαθολογικών παραµέτρων, υπάρχει µεγαλύτερη υπερέκφραση σε σχέση µε την HURP (Πίνακας 10). Δεν µπορούν, όµως, να εξαχθούν συµπεράσµατα, αφού δεν εξάγονται στατιστικά σηµαντικά αποτελέσµατα.

 

67  


3.7 Μελέτη της έκφρασης της HURP σε επίπεδο πρωτεϊνης – Αναζήτηση µεθόδου ανάκτησης αντιγονικών επιτόπων Όπως έχει ήδη αναφερθεί, δοκιµάστηκαν ποικίλες µέθοδοι ανάκτησης των αντιγονικών επιτόπων, προκειµένου να πετύχουµε την αποτελεσµατική πρόσδεση των πρωτογενών αντισωµάτων που δοκιµάστηκαν. Αρχικά, πραγµατοποιήθηκαν για αυτό τον σκοπό πειράµατα ανοσοφθορισµού σε τοµές πλακούντα, πάχους 5µm. Με τα συγκεκριµένα πειράµατα µελετήθηκε µόνο η α-τουµπουλίνη, έτσι ώστε να είναι πιο εύκολη η εύρεση των κατάλληλων πειραµατικών συνθηκών. Η α-τουµπουλίνη χρειάζεται, για να είναι δυνατή η παρατήρηση της πρόσδεσης της πρωτεϊνης HURP στους µικροσωληνίσκους. Ταυτόχρονα, στην συγκεκριµένη σειρά πειραµάτων δοκιµάστηκαν για την αποτελεσµατικότητά τους δύο διαφορετικά δευτερογενή αντισώµατα (CF568 goat anti-mouse, Alexa Fluor® 594 goat antimouse) έναντι του αντισώµατος της α-τουµπουλίνης. Στις εικόνες που παρουσιάζονται στην συνέχεια φαίνεται ότι έχει γίνει χρώση των κυτταρικών πυρήνων µε DAPI.

Εικόνα 29: Αποτελέσµατα ανοσοφθορισµού µετά από ανάκτηση αντιγονικών επιτόπων µε διάλυµα κιτρικού νατρίου, pH6.0. Διακρίνονται οι πυρήνες των κυττάρων (µπλε) και οι µικροσωληνίσκοι (κόκκινο). Σήµανση µε το δευτερογενές αντίσωµα Alexa Fluor® 594 goat anti-mouse. Διακρίνονται και τα ερυθροκύτταρα, τα οποία δεν είναι χρωσµένα, αλλά αυτοφθορίζουν (αριστερά). Σήµανση µε το δευτερογενές αντίσωµα CF568 goat anti-mouse (δεξιά).

 

68  


Εικόνα 30: Αποτελέσµατα ανοσοφθορισµού µετά από ανάκτηση αντιγονικών επιτόπων µε χρήση EDTA, pH8.0. Διακρίνονται οι πυρήνες των κυττάρων (µπλε) και οι µικροσωληνίσκοι (κόκκινο). Σήµανση µε το δευτερογενές αντίσωµα Alexa Fluor® 594 goat anti-mouse. Διακρίνονται και τα ερυθροκύτταρα, τα οποία δεν είναι χρωσµένα, αλλά αυτοφθορίζουν (αριστερά). Σήµανση µε το δευτερογενές αντίσωµα CF568 goat anti-mouse (δεξιά).

Εικόνα 31: Αποτελέσµατα ανοσοφθορισµού µετά από δοκιµασία ανάκτησης των αντιγονικών επιτόπων µε χρήση διαλύµατος ουρίας 1Μ. Διακρίνονται οι πυρήνες των κυττάρων (µπλε) και οι µικροσωληνίσκοι (κόκκινο). Σήµανση µε το δευτερογενές αντίσωµα Alexa Fluor® 594 goat antimouse (αριστερά). Σήµανση µε το δευτερογενές αντίσωµα CF568 goat anti-mouse (δεξιά).

 

69  


Εικόνα 32:   Αποτελέσµατα ανοσοφθορισµού µετά από δοκιµασία ανάκτησης των αντιγονικών επιτόπων µε χρήση του εµπορικού διαλύµατος της εταιρείας BioGenex. Διακρίνονται οι πυρήνες των κυττάρων (µπλε), ενώ οι κόκκινες περιοχές και στις δύο εικόνες, αποτελούν περιοχές αυτοφθορισµού. Έχει πραγµατοποιηθεί, χωρίς όµως ορατό αποτέλεσµα, σήµανση µε το δευτερογενές αντίσωµα Alexa Fluor® 594 goat anti-mouse (αριστερά). Σήµανση µε το δευτερογενές αντίσωµα CF568 goat anti-mouse (δεξιά).

Εικόνα 33:   Τοµή πλακούντα στην οποία δεν έχει εφαρµοστεί καµιά µέθοδος ανάκτησης των αντιγονικών επιτόπων, και άρα λειτουργεί ως αρνητικός µάρτυρας. Διακρίνονται οι πυρήνες των κυττάρων (µπλε), τα ερυθροκύτταρα που αυτοφθορίζουν, και κάποια µεµονωµένα σηµεία στα οποία έχει προσδεθεί το πρωτογενές αντίσωµα έναντι της α-τουµπουλίνης (εκποµπή σήµατος από το δευτερογενές CF568).

Από τα παραπάνω αποτελέσµατα γίνεται, κατ’ αρχήν, φανερό πως είναι απαραίτητο να εφαρµόζεται κάποια µέθοδος για την ανάκτηση των αντιγονικών επιτόπων (antigen retrieval), αφού χωρίς την εφαρµογή της είναι αδύνατο να προσδεθεί το πρωτογενές αντίσωµα (Εικόνα 33), και είναι πολύ έντονος ο αυτοφθορισµός. Επίσης, παρατηρείται πως όσο πιο αναποτελεσµατική είναι η µέθοδος ανάκτησης αντιγονικών επιτόπων, τόσο πιο έντονος είναι ο αυτοφθορισµός, φαινόµενο που θέλουµε να είναι όσο γίνεται πιο ελαχιστοποιηµένο, γιατί οδηγεί σε λάθος συµπεράσµατα ή αλλοιώνει την ποιότητα της τελικής εικόνας. Το καλύτερο αποτέλεσµα έδωσε η χρήση διαλύµατος κιτρικού νατρίου pH6.0 (Εικόνα 29), ενώ το χειρότερο αποτέλεσµα από τις παραπάνω δοκιµές έδωσε η χρήση  

70  


του εµπορικού διαλύµατος της εταιρείας BioGenex (Εικόνα 32). To αµέσως καλύτερο αποτέλεσµα από το κιτρικό νάτριο έδωσε το EDTA pH8.0 (Εικόνα 30). Ο βαθµός αποτελεσµατικότητας κρίνεται από το πόσο καλά ορατοί είν��ι οι µικροσωληνίσκοι, και από το αν γίνεται ορατό το δίκτυο των µικροσωληνίσκων σε όλα τα κύτταρα της τοµής. Όσον αφορά τα δευτερoγενή αντισώµατα, δίνουν διαφορετικό αποτέλεσµα µεταξύ τους σε κάθε µέθοδο ανάκτησης αντιγονικών επιτόπων που δοκιµάστηκε. Αυτό συσχετίζεται, προφανώς, και µε την αποτελεσµατικότητα µε την οποία προσδέθηκε το πρωτογενές αντίσωµα. Έτσι, µε χρήση κιτρικού νατρίου δεν παρατηρείται σηµαντική διαφορά στο σήµα, ενώ στην περίπτωση χρήσης EDTA, το AlexaFluor594 δίνει καλύτερο σήµα από το CF568 (Εικόνα 30). Μάλιστα, στην συγκεκριµένη περίπτωση το CF568 δίνει αφύσικα πολύ έντονο σήµα σε κάποια σηµεία, αλλοιώνοντας µε αυτό τον τρόπο την συνολική εικόνα. Διαφορά παρατηρείται και στην περίπτωση χρήσης του διαλύµατος της εταιρείας BioGenex, ενώ δεν υπάρχει διαφορά µε χρήση ουρίας. Ωστόσο, οι δύο τελευταίες περιπτώσεις είναι και οι χειρότερες, οπότε δεν θα µας απασχολήσουν περαιτέρω στην συνέχεια. Επιπλέον, στα πειράµατα που ακολούθησαν, χρησιµοποιήθηκε το δευτερογενές αντίσωµα CF568, λόγω ευκολότερης πρόσβασης σε αυτό και διάθεσής του στο εργαστήριο.

Εικόνα 34: Αποτελέσµατα ανοσοφθορισµού µετά από ανάκτηση των αντιγονικών επιτόπων µε δύο διαφορετικές µεθόδους: µε EDTA, pH8.0 (αριστερά), και µε κιτρικό νάτριο, pH6.0 (δεξιά). Στην περίπτωση αυτή χρησιµοποιήθηκαν πρωτογενή αντισώµατα έναντι της α-τουµπουλίνης και της HURP, ενώ τα δευτερογενή αντισώµατα είναι τα CF568 goat anti-mouse (κόκκινο) και CF488 donkey anti-rabbit (πράσινο), αντίστοιχα. Είναι ορατοί και οι πυρήνες των κυττάρων (µπλε).

Πήραµε τοµές και από δείγµατα καρκίνου του ενδοµητρίου και καρκίνου του παχέος εντέρου, τα οποία ήταν αρχικά αποθηκευµένα µέσα σε RNA later στους -80oC, ενώ συνηθίζεται τα δείγµατα ιστού να αποθηκεύονται εξ’ αρχής σε φορµαλίνη και θερµοκρασία δωµατίου. Με αυτές τις τοµές δοκιµάστηκε η αποτελεσµατικότητα των δύο διαλυµάτων ανάκτησης των αντιγονικών επιτόπων (antigen retrieval solutions) της εταιρείας Dako. Αφού έγινε η µονιµοποίηση και η παραφινοποίηση των συγκεκριµένων δειγµάτων υπό τις συνήθεις συνθήκες, παρατηρήθηκε ότι η συντήρηση των ιστών σε RNA later δηµιουργεί προβλήµατα στην αποτελεσµατική πρόσδεση των αντισωµάτων και στη χρώση των πυρήνων µε DAPI. Ειδικά όσον αφορά τα δείγµατα από καρκίνο του ενδοµητρίου, φάνηκε πως δεν προσδέθηκε κανένα από τα αντισώµατα και είχε αλλοιωθεί µερικώς η µορφολογία των κυττάρων.  

71  


Έτσι, βάσει των παραπάνω αποτελεσµάτων δοκιµάστηκαν για την ανάδειξη των αντιγονικών επιτόπων τα διαλύµατα EDTA, pH8.0 και κιτρικό νάτριο, pH6.0 σε τοµές πλακούντα, αλλά χρησιµοποιώντας αυτή τη φορά και το πρωτογενές αντίσωµα έναντι της HURP (DHL5, bleed3). Από τα αποτελέσµατα που προέκυψαν (Εικόνα 34) συµπεραίνουµε ότι ως προς την α-τουµπουλίνη καλύτερη εικόνα έδωσε η τοµή που είχε υποστεί επεξεργασία µε EDTA, pH8.0, και µάλιστα είναι παρόµοιο αποτέλεσµα µε παλιότερου πειράµατος (Εικόνα 30). Δεν είχαµε ικανοποιητική εικόνα για την HURP, καθώς δε βρέθηκαν µιτωτικά κύτταρα. Επιπλέον, και σε αυτήν την περίπτωση δεν ήταν ικανοποιητική η ανάδειξη των αντιγονικών επιτόπων της α-τουµπουλίνης σε συσσωµατώµατα κυττάρων, κάτι που παρατηρήθηκε σε όλα τα πειράµατα. Αυτό αποτελεί σηµαντικό πρόβληµα, καθώς στον καρκινικό ιστό, που ενδέχεται να µελετηθεί στην συνέχεια, είναι αρκετά συχνό να παρατηρούνται συσσωµατώµατα κυττάρων, λόγω του µη φυσιολογικού πολλαπλασιασµού των κυττάρων.

 

72  


4. ΣΥΖΗΤΗΣΗ

 

73  


Σκοπός της συγκεκριµένης εργασίας ήταν να µελετηθούν τα επίπεδα έκφρασης των πρωτεϊνών HURP και Aurora A µε πειράµατα qRT real-time PCR σε διάφορες µορφές καρκίνου, και συγκεκριµένα στον καρκίνο του παχέος εντέρου, τον καρκίνο του παγκρέατος, τον καρκίνο του µαστού και σε διάφορους τύπους γυναικολογικού καρκίνου (καρκίνος των ωοθηκών, του ενδοµητρίου, του τραχήλου της µήτρας). Αυτό αποσκοπεί στο να γίνει µια συσχέτιση στα επίπεδα έκφρασης των γονιδίων που εκφράζουν τις δύο πρωτεϊνες που µας αφορούν, λόγω της in vitro αλληλεπίδρασης που έχει αποδειχθεί µεταξύ τους µέσα από διάφορες δηµοσιεύσεις (Yu et al., 2005; Wong et al., 2008). Επίσης, µέσα από την συγκεκριµένη εργασία γίνεται µια προσπάθεια συσχέτισης των επιπέδων έκφρασης των πρωτεϊνών HURP και Aurora A µε διάφορες κλινικοπαθολογικές παραµέτρους που χαρακτηρίζουν τους ασθενείς που πάσχουν µε µια από τις µελετώµενες µορφές καρκίνου. Τέλος, µέσα από την συγκεκριµένη εργασία γίνεται προσπάθεια εύρεσης των κατάλληλων συνθηκών, προκειµένου η πρωτεϊνη HURP να µπορεί να µελετηθεί µε τη χρήση συνεστιακής µικροσκοπίας και σε τοµές καρκινικού ιστού, που προέρχονται από ασθενείς.

4.1 Αξιολόγηση των επιπέδων έκφρασης της HURP και της Aurora A σε διάφορους τύπους καρκίνου Έχει βρεθεί ότι η HURP υπερεκφράζεται σε διάφορους ιστούς (Tsou et al., 2003), όπως το στοµάχι, το παχύ έντερο, το πάγκρεας και το εµβρυϊκό ήπαρ, αλλά έχει συσχετιστεί και µε διάφορες µορφές καρκίνου, όπως µε τον καρκίνο του παχέος εντέρου, µε γυναικολογικούς καρκίνους και µε το καρκίνωµα της ουροδόχου κύστεως από µεταβατικό επιθήλιο (Chiu et al., 2003; Yu et al., 2005). Από την άλλη, η Aurora A έχει αποδειχθεί ότι υπερεκφράζεται σε διάφορους τύπους επιθηλιακού καρκίνου (Rojanala et al., 2004; Bischoff et al., 1998; Tanner et al, 2000; Marumoto et al., 2005), όπως τον καρκίνο του µαστού, του παχέος εντέρου, των ωοθηκών και του παγκρέατος. Εποµένως, θα ήταν χρήσιµο, αν µέσα από αυτή την εργασία µπορούσε να γίνει ταυτόχρονη συσχέτιση των δύο αυτών πρωτεϊνών µε διάφορες µορφές καρκίνου, και αν είναι δυνατό να αποδειχθεί ότι ο συνδυασµός των δύο πρωτεϊνών µπορεί να αποτελέσει αποτελεσµατικότερο προγνωστικό δείκτη από ότι η κάθε πρωτεϊνη µόνη της. Το πρώτο σηµαντικό εύρηµα µέσα από τα πειράµατα qRT real-time PCR που έγιναν µε χρήση δειγµάτων καρκινικού και φυσιολογικού ιστού, είναι ότι το γονίδιο της HURP και το γονίδιο της Aurora A υπερεκφράζονται σε όλες τις µορφές καρκίνου που µελετήθηκαν, αλλά µε διαφορετικό βαθµό σε κάθε περίπτωση. Συγκεκριµένα, το γονίδιο της HURP υπερεκφράζεται περισσότερο στους γυναικολογικούς καρκίνους και τον καρκίνο του µαστού, από ότι στον καρκίνο του παγκρέατος και τον καρκίνο του παχέος εντέρου. Ωστόσο, στατιστικά σηµαντική είναι µόνο η υπερέκφραση στον καρκίνο του ενδοµητρίου, γιατί στις υπόλοιπες περιπτώσεις µελετήθηκε µικρός αριθµός δειγµάτων είτε µόνο φυσιολογικού ιστού είτε και καρκινικού ιστού. Παρόλα αυτά, µε τα παρόντα αποτελέσµατα µπορούµε να πούµε ότι το γονίδιο της HURP υπερεκφράζεται περισσότερο στον καρκίνο των ωοθηκών, και ακολουθούν µε φθίνουσα σειρά ο καρκίνος του ενδοµητρίου, του µαστού, του τραχήλου της µήτρας, ο καρκίνος του παγκρέατος και τέλος, ο καρκίνος του παχέος εντέρου. Όσον αφορά την υπερέκφραση του γονιδίου της Aurora A, κανένα αποτέλεσµα δεν είναι στατιστικά αξιόλογο. Σε αυτήν την περίπτωση, ο βαθµός υπερέκφρασης του γονιδίου είναι µεγαλύτερος στον καρκίνο του παγκρέατος, και ακολουθεί µε φθίνουσα σειρά ο καρκίνος του τραχήλου της µήτρας, του παχέος εντέρου, του µαστού, του ενδοµητρίου, και τέλος, ο καρκίνος των  

74  


ωοθηκών. Παρατηρούµε, σχετικά µε τους γυναικολογικούς καρκίνους, ότι όσο περισσότερο υπερεκφράζεται το γονίδιο της HURP, τόσο µικρότερος είναι ο βαθµός υπερέκφρασης του γονιδίου της Aurora A. Ένα ακόµα σηµαντικό εύρηµα των στατιστικών αναλύσεων που ακολούθησαν τα πειράµατα qRT real-time PCR είναι ότι στον καρκίνο των ωοθηκών, η υπερέκφραση της HURP σχετίζεται µε την κακοήθεια και τη λεµφαδενική διήθηση, και µαλιστά µε σηµαντική στατιστική αξιοπιστία. Παράλληλα, βρέθηκε ότι υπάρχει 39% και 36% αυξηµένη πιθανότητα εµφάνισης κακοήθειας και λεµφαδενικής διήθησης αντίστοιχα σε περίπτωση υπερέκφρασης της HURP. Δε βρέθηκε κάποια συσχέτιση µε τα υπόλοιπα κλινικοπαθολογικά χαρακτηριστικά στον καρκίνο των ωοθηκών. Επιπλέον, κανένα χαρακτηριστικό δεν σχετίζεται µε την αυξηµένη έκφραση της Aurora A. Ο δείκτης διετούς επιβίωσης στην περίπτωση των ασθενών µε καρκίνο των ωοθηκών που υπερεκφράζουν την HURP είναι 50,12%. Παρατηρείται, επίσης, σηµαντική συσχέτιση µεταξύ της συνδυαστικής λήψης των χηµειοθεραπευτικών ουσιών καρβοπλατίνη και πακλιταξέλη, και της υπερέκφρασης της HURP. Στην περίπτωση αυτή η υπερέκφραση της HURP είναι πάνω από τα συνηθισµένα επίπεδα έκφρασης της στον καρκίνο των ωοθηκών. Δε βρέθηκε στατιστικά αξιόλογη συσχέτιση µε κάποια άλλη θεραπευτική ουσία. Στον καρκίνο του µαστού δεν υπάρχει συσχέτιση κανενός κλινικοπαθολογικού χαρακτηριστικού µε την υπερέκφραση της HURP ή της Aurora A. To µόνο σηµαντικό στοιχείο που έχει βρεθεί είναι ότι υπάρχει στατιστικά αξιόλογη συσχέτιση µεταξύ της υπερέκφρασης της HURP και της χορήγησης πακλιταξέλης (Taxoprol) σε ασθενείς µε καρκίνο του µαστού. Μάλιστα, τα επίπεδα της HURP στους ασθενείς που έλαβαν πακλιταξέλη είναι παραπάνω αυξηµένα από τα συνηθισµένα για τον καρκίνο του µαστού. Παράλληλα, έχει ήδη αποδειχθεί (Kuo et al., 2011) ότι η HURP µπορεί να δρα ανασταλτικά για τη δράση της ταξόλης στην περίπτωση του ηπατοκυτταρικού καρκινώµατος (HCC), χωρίς να είναι γνωστός ο ακριβής µηχανισµός που αυτό συµβαίνει. Η ταξόλη (Taxol) είναι ουσιαστικά η πακλιταξέλη, η οποία µαζί µε τη δοσεταξέλη ανήκουν στην οικογένεια των ταξανών. Εποµένως, συνδυάζοντας τα ευρήµατα για τη θεραπευτική αγωγή σε ασθενείς µε καρκίνο των ωοθηκών και καρκίνο του µαστού, στους οποίους έχει χορηγηθεί η πακλιταξέλη (Taxol, Taxoprol) µπορούµε να υποθέσουµε ότι κάτι ανάλογο µε το HCC συµβαίνει και στην περίπτωσή µας, δηλαδή η HURP ίσως αναστέλλει µερικώς ή πλήρως τη δράση της πακλιταξέλης, και γι’ αυτό παρατηρούνται τα τόσο υψηλά επίπεδα έκφρασής της. Ωστόσο, κάτι τέτοιο µένει να διερευνηθεί και να επιβεβαιωθεί περαιτέρω µε µελέτη µεγαλύτερου πληθυσµού ασθενών που φέρουν τις συγκεκριµένες µορφές καρκίνου. Όσον αφορά, τον καρκίνο του ενδοµητρίου, η στατιστική ανάλυση έδειξε ότι η έκφραση της HURP σχετίζεται µόνο µε το βαθµό ιστολογικής διαφοροποίησης, και µάλιστα βρέθηκε ότι σε περίπτωση υπερέκφρασης της HURP υπάρχει 16% αυξηµένη πιθανότητα καλής διαφοροποίησης (Grade 1) των καρκινικών κυττάρων, µε τη µέτρια/χαµηλή διαφοροποίηση να αποτελούν προστατευτικό παράγοντα έναντι της έκφρασης της HURP. Σχετικά µε την έκφραση της Aurora A δε βρέθηκε καµιά στατιστική συσχέτιση µε κάποιο κλινικοπαθολογικό χαρακτηριστικό. Επίσης, δε βρέθηκε στατιστική συσχέτιση της έκφρασης της HURP ή της Aurora A µε κάποιο κλινικοπαθολογικό χαρακτηριστικό στον καρκίνο του παγκρέατος. Τέλος, στον καρκίνο του παχέος εντέρου υπάρχει οριακά στατιστικά σηµαντική (p=0,0508) συσχέτιση της έκφρασης της HURP µε την ηλικία, και µάλιστα υπολογίζεται ότι η ηλικία άνω των 55 ετών αποτελεί προστατευτικό παράγοντα έναντι της έκφρασης της HURP. Κάτι τέτοιο, όµως, αντιτίθεται στα όσα γνωρίζουµε µέχρι τώρα για τον αυξηµένο κίνδυνο εµφάνισης καρκίνου του παχέος εντέρου µε την πάροδο της ηλικίας, οπότε θα ήταν

 

75  


χρήσιµο αν εξεταζόταν µεγαλύτερος πληθυσµός ασθενών µε καρκίνο του παχέος εντέρου, για να µπορούµε να εξάγουµε πιο ασφαλή συµπεράσµατα. Εν κατακλείδι, τα αποτελέσµατα που έχουµε για την γονιδιακή έκφραση της HURP σε δείγµατα από ασθενείς µε διάφορες µορφές καρκίνου δείχνουν ότι η έκφραση της HURP σχετίζεται µε τον καρκίνο των ωοθηκών, του ενδοµητρίου, του µαστού και του παχέος εντέρου, δίνοντας έτσι έµφαση στο γεγονός ότι το γονίδιο της HURP θα µπορούσε να αποτελεί ένα ογκογονίδιο. Η έκφραση της HURP θα µπορούσε να είναι ένας πολλά υποσχόµενος βιοδείκτης για την κακοήθεια και τη λεµφαδενική διήθηση στον καρκίνο των ωοθηκών, αλλά και για το βαθµό διαφοροποίησης στον καρκίνο του ενδοµητρίου. Αντίθετα, δεν µπορεί να εξαχθεί κανένα συµπέρασµα σχετικά µε την έκφραση της Aurora A στους µελετώµενους καρκίνους, αλλά πιθανόν η εξέταση ενός µεγαλύτερου αριθµού δειγµάτων ίσως να έδεινε κάποιες απαντήσεις στα ερωτήµατά µας.

4.2 Εύρεση συνθηκών για µελέτη της HURP σε τοµές καρκινικού ιστού µε συνεστιακό µικροσκόπιο Όπως έχει ήδη αναφερθεί και σε άλλο σηµείο της παρούσας εργασίας, κατά τη µονιµοποίηση του ιστού µε φορµαλδεϋδη (formalin) δηµιουργούνται δεσµοί (cross-links) µεταξύ πρωτεϊνών, πρωτεϊνών και νουκλεϊκών οξέων, αλλά και µεταξύ των νουκλεϊκών οξέων (Εικόνα 17). Αυτό έχει ως αποτέλεσµα να κρύβονται οι αντιγονικοί επίτοποι, κι έτσι χρησιµοποιούνται διάφορες µέθοδοι (antigen retrieval methods), οι οποίες έχουν ως στόχο την ανάκτηση αυτών των αντιγονικών επιτόπων. Οι µέθοδοι αυτές διακρίνονται στις χηµικές και τις ενζυµικές µεθόδους, και χρησιµοποιούνται ανάλογα µε το σηµείο εντοπισµού της επιθυµητής πρωτεϊνης. Συγκεκριµένα, οι ενζυµικές µέθοδοι προτιµώνται κυρίως όταν η πρωτεϊνη εντοπίζεται στην κυτταρική επιφάνεια, µιας και είναι δύσκολο να εισέλθει το ένζυµο στο εσωτερικό του κυττάρου, ενώ οι χηµικές µέθοδοι χρησιµοποιούνται ανεξαιρέτως για πρωτεϊνες που βρίσκονται είτε στην κυτταρική επιφάνεια είτε στο εσωτερικό του κυττάρου. Στα πλαίσια της συγκεκριµένης εργασίας έχουν δοκιµαστεί µόνο χηµικές µέθοδοι µε την επίδραση θερµότητας.

Εικόνα 35: Σχηµατική απεικόνιση της κατάστασης που δηµιουργείται απουσία της µονιµοποίησης µε φορµαλδεϋδη (formalin) (αριστερά), παρουσία µονιµοποίησης (κέντρο), και παρουσία υπερέκθεσης σε φορµαλδεϋδη (δεξιά).

 

76  


Στις µεθόδους ανάκτησης των αντιγονικών επιτόπων χρησιµοποιήθηκαν τα ακόλουθα διαλύµατα: κιτρικό νάτριο (10mM, 0,05% Tween20, pH6.0), 1M ουρία, EDTA (1mM, pH8.0), κιτρικό οξύ 10mM/ΕDTA 2mM (0,05% Τween20, pH6.2), και εµπορικά διαλύµατα των εταιρειών BioGenex και Dako. Από τα παραπάνω διαλύµατα, αποτελεσµατικότερα µετά από εφαρµογή σε τοµές πλακούντα αποδείχθηκαν το κιτρικό νάτριο και το EDTA, γιατί έδιναν τη δυνατότητα να είναι διακριτοί οι µικροσωληνίσκοι σε αρκετά κύτταρα και µε καλή ευκρίνεια. Ωστόσο, δεν ήταν δυνατό να εντοπιστούν µιτωτικά κύτταρα, αλλά ούτε και να παρατηρήσουµε τους µικροσωληνίσκους σε όλη την έκταση των τοµών, και ειδικά σε συσσωµατώµατα κυττάρων. Αυτά τα δύο προβλήµατα είναι σηµαντικά µειονεκτήµατα, γιατί η HURP είναι µια µιτωτική πρωτεϊνη της οποίας την τοποθέτηση σε σχέση µε τους µικροσωληνίσκους θα θέλαµε να δούµε. Όταν τα κύτταρα βρίσκονται στη µεσόφαση είναι δύσκολο να εντοπιστεί η HURP. Επιπλέον, στους καρκινικούς ιστούς είναι συχνό το φαινόµενο να δηµιουργούνται συσσωµατώµατα κυττάρων, οπότε αν δεν µπορούµε να δούµε σε αυτά τους µικροσωληνίσκους και την HURP, τότε χάνουµε αρκετά επιθυµητά αποτελέσµατα. Τα διαλύµατα της εταιρίας Dako που δοκιµάστηκαν, εφαρµόστηκαν σε τοµές καρκινικού ιστού από ενδοµήτριο και παχύ έντερο. Ο ιστός αυτός ήταν προηγουµένως διατηρηµένος στους -80οC µέσα σε 1ml RNA later. Τελικά, αποδείχθηκε, όµως, πως κάτι τέτοιο είναι καταστροφικό για τον ιστό, αλλά και για την ποιότητα των αποτελεσµάτων, καθώς το RNA later φαίνεται να εµποδίζει τη χρωστική DAPI να εισέλθει στον πυρήνα των κυττάρων, ενώ στα δείγµατα από καρκίνο του ενδοµητρίου παρατηρήθηκε και αλλοίωση της µορφολογίας των κυττάρων, καθώς είχαν ακανόνιστο σχήµα. Ενώ οι συνθήκες που εφαρµόζονται κατά τη διάρκεια του ανοσοφθορισµού φαίνεται να είναι οι καλύτερες δυνατές, πρόβληµα συνεχίζει να είναι η ανάκτηση των αντιγονικών επιτόπων, που στην περίπτωση εφαρµογής ανοσοφθορισµού σε τοµές ιστού είναι και το µεγαλύτερο. Εποµένως, θα µπορούσαν να γίνουν περαιτέρω πειράµατα µε χρήση τοµών από ιστό που προηγουµένως ήταν διατηρηµένος σε φορµόλη, και µάλιστα θα ήταν καλύτερο να χρησιµοποιηθεί καρκινικός ιστός, έτσι ώστε να γίνεται καλύτερη προσοµοίωση των συνθηκών που πρόκειται να εφαµοστούν αργότερα. Τέλος, θα µπορούσε να δοκιµαστεί µικρότερος χρόνος µονιµοποίησης του ιστού µε φορµαλδεϋδη, καθώς όπως φαίνεται και στην Εικόνα 35, η υπερέκθεση στη φορµαλδεϋδη µπορεί να δηµιουργήσει εκτεταµένες γέφυρες µεθυλενίου που είναι σχεδόν αδύνατο να σπάσουν πλήρως µε κάποια µέθοδο.

 

77  


ΒΙΒΛΙΟΓΡΑΦΙΑ [1] Arnaoutov A, Dasso M. The Ran GTPase regulates kinetochore function. Develop Cell 2003; 5; 99-111 [2] Behne T, Copur MS. Biomarkers for Hepatocellular carcinoma. J Hepatology 2012 [3] Bischoff JR, Anderson L, Zhu Y, Mossie K, Ng L, Souza B, Schryver B, Flanagan P, Clairvoyant F, Ginther C, Chan CS, Novotny M, Slamon DJ, Plowman GD. A homologue of Drosophila aurora kinase is oncogenic and amplified in human colorectal cancers. EMBO J 1998; 17; 3052-3065 [4] Breuer M, Kolano A, Kwon M, Li C-C, Tsai T-F, Pellman D, Brunet S, Verlhac MH. HURP permits MTOC sorting for robust meiotic spindle bipolarity, similar to extra centrosome clustering in cancer cells. J Cell Biol 2010; 191:7; 1251-1260 [5] Bustin SA, Benes V, Nolan T, Pfaffl MW. Quantitative real-time PCR – a perspective. J Mol Endocrin; 2005:34; 596-601 [6] Cervigni RI, Barretta ML, Persico A, Corda D, Colanzi A. The role of Aurora-A kinase in the Golgi-dependent control of mitotic entry. BioArchitecture 2011; 1:2; 61-65 [7] Chiu AW, Huang YL, Huan Sk, Wang YC, Ju JP. Prognostic significance of hepatoma up-regulated protein expression in patients with urinary bladder transitional cell carcinoma. Anticancer Res 2003; 23: 2729-2734 [8] Giet R, Petretti C, Prigent C. Aurora kinases, aneuploidy and cancer, a coincidence or a real link? Trends in Cell Biol 2005; 15:5; 241-250 [9] Hauf S, Watanabe Υ. Kinetochore orientation in mitosis and meiosis. Cell 2004; 119; 317-327 [10] Hsu J-M, Lee Y-CG, Yu C-TR, Huang C-YF. Fbx7 functions in the SCF complex regulating Cdk1-cyclin B-phosphorylated Hepatoma Up-Regulated Protein (HURP) proteolysis by a proline-rich region. J Biol Chem 2004; 279:31; 32592-32602 [11] Joseph J. Ran at a glance. J Cell Sci 2006; 119; 3481-3484 [12] Koffa MD, Casanova CM, Santarella R, Kocher T, Wilm M, Mattaj IW. HURP is part of a Ran-dependent complex involved in spindle formation. Current Biol 2006; 16; 743754 [13] Kuo T-Z, Chuck C, Chao C-K. Hepatitis B virus X protein prevents apoptosis of hepatocellular carcinoma cells by upregulating SATB1 and HURP expression. Biochem Pharm 2010; 80; 1093-1102 [14] Kuo T-Z, Lu H-P, Chuck C, Chao C-K. The tyrosine kinase inhibitor sorafenib sensitizes hepatocellular carcinoma cells to taxol by suppressing the HURP protein. Biochem Pharm 2011; 82; 184-194 [15] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCt method. Methods 2001; 25; 402-408 [16] Marumoto T, Zhang D, Saya H. Aurora-A – A guardian of poles. Nat Rev Cancer 2005; 5: 42-50 [17] Odde DJ. Mitotic spindle: disturbing a subtle balance. Current Biol 2005; 15:23; 956959 [18] Reuters T. “Pharma Matters White Paper: Establishing the standards in biomarker research”, Nature 2008 [19] Rojanala S, Han H, Munoz RM, Browne W, Nagle R, Von Hoff DD, Bearss DJ. The mitotic serine threonine kinase, Aurora-2, is a potential target for drug development in human pancreatic cancer. Mol Cancer Ther 2004; 3; 451-457 [20] Rossi CR, Foletto M, Mocellin S, Pilati P, De Simone M, Deraco M, Cavaliere F, Palatini P, Guast F, Scalerta R, Lise M. Hyperthermic intraoperative intraperitoneal

 

78  


chemotherapy with cisplatin and doxorubicin in patients who undergo cytoreductive surgery for peritoneal carcinomatosis and sarcomatosis: phase I study. Cancer 2002; 94:2; 492-499 [21] Rossi CR, Deraco M, De Simone M, Mocellin S, Pilati P, Foletto M, Cavaliere F, Kusamura S, Gronchi A, Lise M. Hyperthermic intraperitoneal intraoperative chemotherapy after cytoreductive surgery for the treatment of abdominal sarcomatosis. Cancer 2004; 100:9; 1943-1950 [22] Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc 2008; 3; 1101-1108 [23] Sillje HHW, Nagel S, Korner R, Nigg EA. HURP is a Ran-Importin β-regulated protein that stabilizes kinetochore microtubules in the vicinity of chromosomes. Current Biol 2006; 16; 731-742 [24] Song L, Rape M. Regulated degradation of spindle assembly factors by the anaphasepromoting complex. Mol Cell 2010; 38; 369-382 [25] Tsai C-Y, Chou C-K, Yang C-W, Lai Y-C, Liang C-C, Chen C-M, Tsai T-F. Hurp deficiency in mice leads to female infertility caused by an implantation defect. J Biol Chem 2008; 283:39; 26302-26306 [26] Tanner MM, Grenman S, Koul A, Johannsson O, Meltzer P, Pejovic T, Borg A, Isola JJ. Frequent amplification of chromosomal region 20q12-q13 in ovarian cancer. Clin Cancer Res 2000; 6; 1833-1839 [27] Tsou A-P, Yang C-W, Huang C-YF, Yu RC-T, Lee Y-CG, Chang C-W, Chen B-R, Chung Y-H, Fann M-J, Chi C-W, Chiu J-H, Chou C-K. Identification of a novel cell cycle regulated gene, HURP, overexpressed in human hepatocellular carcinoma. Oncogene 2003; 22; 298-307 [28] Uehara R, Goshima G. Functional central spindle assembly requires de novo microtubule generation in the interchromosomal region during anaphase. J Cell Biol 2010; 191:2; 259-267 [29] Wilde A. “HURP on” we ‘re off to the kinetochore!. J Cell Biol 2006; 173:6; 829-831 [30] Wong J, Lerrigo R, Jang C-Y, Fang G. Aurora A regulates the activity of HURP by controlling the accessibility of its microtubule-binding domain. Mol Biol of the Cell 2008; 19: 2083-2091 [31] Wong J, Fang G. HURP controls spindle dynamics to promote proper interkinetochore tension and efficient kinetochore capture. J Cell Biol 2006; 173:6; 879-891 [32] Yu C-TR, Hsu J-M, Lee Y-CG, Tsou A-P, Chou C-K, Huang C-YF. Phosphorylation and stabilization of HURP by Aurora-A: Implication of HURP as a transforming target of Aurora-A. Mol Cell Biol 2005; 25:14; 5789-5800 [33] Zhang G, Breuer M, Forster A, Egger-Adam D, Wodarz A. Mars, a Drosophila protein related to vertebrate HURP, is required for the attachment of centrosomes to the mitotic spindle during syncytial nuclear divisions. J Cell Sci 2008; 122; 535-545

Διαδικτυακή βιβλιογραφία [1] http://cancer.gov/cancertopics/factsheet/Support/prognosis-stats [2] http://seer.cancer.gov/ [3] www.wikipedia.org [4] http://cancer.gov/

 

79  


ΕΥΧΑΡΙΣΤΙΕΣ Το πειραµατικό µέρος της διπλωµατικής εργασίας εκπονήθηκε στο «Εργαστήριο Μοριακής Κυτταρικής Βιολογίας, Κυτταρικού κύκλου και Πρωτεοµικής» µε επιβλέπουσα την Επίκουρο Καθηγήτρια Κυτταρικής Βιολογίας κα. Κόφφα Μαρία, PhD. Θα ήθελα να ευχαριστήσω τη Δρ. Κόφφα Μαρία για την καθοδήγησή της και την πλήρη υποστήριξη που µου παρείχε, αλλά και για την εµπιστοσύνη που µου έδειξε καθ’ όλη τη διάρκεια της διπλωµατικής εργασίας και της παραµονής µου στο συγκεκριµένο εργαστήριο. Επιπλέον, οφείλω να ευχαριστήσω τους συναδέλφους µου στο εργαστήριο, που πραγµατοποιούν τη διδακτορική τους διατριβή, Κεσίσοβα Ηλιάνα και Νάκο Κωνσταντίνο, για όλα αυτά που µε δίδαξαν, την υποµονή που επέδειξαν και την συµπαράσταση που µου παρείχαν, αλλά θα ήθελα να ευχαριστήσω και τους υπόλοιπους συναδέλφους του εργαστηρίου. Ευχαριστίες οφείλω, επίσης, στην κα. Μαρουλάκου Ι. και τους συναδέλφους στο «Εργαστήριο Γενετικής», αλλά και στους κα. Γρηγορίου Μ. και κ. Σκάβδη Γ., όπως και στους συναδέλφους στο «Εργαστήριο Μοριακής Βιολογίας της Ανάπτυξης και Μοριακής Νευροβιολογίας». Τέλος, θα ήθελα να ευχαριστήσω την οικογένειά µου για την πλήρη υποστήριξη που µου παρείχε κατά τη διάρκεια των σπουδών µου.

 

80  


Tzortzis (773) - BSc Research project