Tecnoaqua septiembre-octubre 2016

Page 1

n° 21 - Septiembre - Octubre 2016

www.infoedita.es

www.tecnoaqua.es

Órgano de difusión de:

Colaborador de:

Proceso biológico de nitrificación en una EDAR de baja carga Estudio comparativo de la transferencia de oxígeno en distintos sistemas de aireación Ultrasonidos para tratar el mejillón cebra en espacios confinados

Tratamiento de olor con un biofiltro avanzado en la EDAR de Galindo Seguimiento del bulking causado por Meganema perideroedes Secado solar de lodos y uso del lodo como energía renovable Experience with the treatment of the water/steam cycle with film forming amine technology Reducción óptima del agua no registrada La economía circular ESPECIAL

portadaruben.indd 1

02/11/16 10:29


hidroconta.indd 1

31/10/16 15:32


xylem.indd 1

31/10/16 15:49


Sumario Sección patrocinada por:

Artículos técnicos

46 58 64 76 82 96 104 112 116

Estudio del proceso biológico de nitrificación en una EDAR de baja carga mediante el análisis de las correlaciones entre parámetros microbiológicos, fisicoquímicos y operacionales Estudio comparativo de la transferencia de oxígeno en distintos sistemas de aireación en EDAR de la Región de Murcia Aplicación de ultrasonidos para el tratamiento del mejillón cebra (Dreissena polymorpha) en espacios confinados

Editorial . . . . . . . . . . . . . . . . . . . . . . . .

4

Noticias del sector . . . . . . . . . . . . . . . .

6

Noticias de empresas. . . . . . . . . . . . . .

12

Tratamiento de olor con un biofiltro avanzado en la EDAR de Galindo

Productos y equipos. . . . . . . . . . . . . . .

32

Seguimiento de un proceso de bulking causado por Meganema perideroedes

AEAS informa. . . . . . . . . . . . . . . . . . . .

140

Iwater informa . . . . . . . . . . . . . . . . . . .

142

Ferias y congresos . . . . . . . . . . . . . . . .

146

Agenda . . . . . . . . . . . . . . . . . . . . . . . .

150

Ciberaqua . . . . . . . . . . . . . . . . . . . . . .

152

Libros y catálogos. . . . . . . . . . . . . . . . .

154

Directorio de empresas . . . . . . . . . . . .

156

Índice de anunciantes . . . . . . . . . . . . .

160

Secado solar de lodos y uso del lodo como energía renovable: cerrando el círculo Experience with the treatment of the water/steam cycle with film forming amine technology

Procesos y sistemas La huella ambiental en las redes sostenibles de PVC-O Tecnología aplicada al bombeo del agua para reducir al máximo los costes energéticos y de explotación

Reportaje

118 126 130

Reducción óptima del agua no registrada desde una gestión coherente de las empresas gestoras del servicio (Parte 1) La economía circular de Saint-Gobain PAM España Depuración extensiva y regeneración de aguas: una solución ideal para las pequeñas poblaciones

Entrevista

134 2

002 sumario.indd 2

A Sergio Pepió Abejaro, presidente de la Asociación Española de Empresas de Tecnologías del Agua (Asagua)

nº 21 - Septiembre-Octubre 2016

03/11/16 15:18


caprari.indd 1

31/10/16 15:49


Editorial

Buenos dĂ­as Sr. Rajoy, Âżreiniciamos las inversiones en el sector agua?

T

ras la histĂłrica abstenciĂłn del Partido Socialista Obrero EspaĂąol (PSOE) durante la investidura de Mariano Rajoy como presidente del Gobierno para los prĂłximos cuatro aĂąos, el sector del agua mira ya con impaciencia al nuevo Ejecutivo para, por fin, tomar las riendas de la economĂ­a espaĂąola y reiniciar las inversiones en el sector del agua (infraestructuras, mantenimiento, investigaciĂłn y desarrollo, polĂ­ticas fiscal...), teniendo en cuenta que nuestra industria estĂĄ muy vinculada con las decisiones gubernamentales, ya sea en tĂŠrminos econĂłmicos, legislativos, burocrĂĄticos... Lo cierto es que, entre elecciones y elecciones, hemos estado casi un aĂąo con un Gobierno en funciones que no ha tomado realmente decisiones importantes, y menos aĂşn en materia de agua. Como remarca Sergio PepiĂł Abejaro, presidente de la AsociaciĂłn EspaĂąola de Empresas de TecnologĂ­as del Agua (Asagua), en una entrevista en este nĂşmero, "EspaĂąa precisa mĂĄs de 25.000 millones de euros para infraestructuras del agua, rentables en todo momento". TambiĂŠn aĂąade que "la construcciĂłn en general, y el agua en particular, son el motor del que dispone el Gobierno para levantar la economĂ­a del paĂ­s, ahora tan maltrecho como consecuencia de la falta de inversiĂłn, carencia que, como denunciamos en Asagua, es la causa principal de la pĂŠrdida de empleos cualificados y de que se produzcan bajas en las licitaciones que llegan a superar el 50%. Asagua, en coherencia con lo dicho, viene solicitando al Gobierno desde hace aĂąos, y lo seguirĂĄ haciendo, que reactive la inversiĂłn, causa principal y directa de la mayor parte de los males que aquejan al sector, y que publique las normas que han de contribuir a modernizar la regulaciĂłn del sector". Mientras esta segunda legislatura del Partido Popular (PP) con Rajoy al frente echa a andar, el sector del agua, sobre todo en su ĂĄmbito industrial privado (el que no puede parar nunca para no desaparecer, tomen ejemplo seĂąores polĂ­ticos), vuelve a tener una cita importante para fomentar las relaciones de negocio. Nos referimos a al salĂłn Iwater Barcelona, dedicado al ciclo integral del agua y que apunta a la resiliencia, la gobernanza y, precisamente, la financiaciĂłn como claves para el futuro del sector del agua. Tecnoaqua estarĂĄ presente en el pabellĂłn 1, G711 ÂĄÂĄAllĂ­ nos vemos!!

INFOEDITA COMUNICACIĂ“N PROFESIONAL, S.L. Editora .BS $BĂ—BT "TBO[B t N BTBO[B!JOGPFEJUB FT

Gerente +PTĂ? )FOSĂ“RVF[ /BWBSSP

Coordinador Editorial 3VCĂ?O + 7JOBHSF (BSDĂ“B t UFDOPBRVB!JOGPFEJUB OFU

Director Financiero 'SBODJTDP 4BO[ #BTUFSSB

RedacciĂłn .BSĂ“B + (Ă˜NF[ $BSSJMMP t NK HPNF[!JOGPFEJUB FT .ĂˆYJNP ÂŤMWBSF[ t N BMWBSF[!JOGPFEJUB FT "MCFSUP "EFWB t B BEFWB!JOGPFEJUB FT

DirecciĂłn 3JCFSB EF "YQF &EJm DJP $ 0m DJOB &SBOEJP 7*;$":"

Publicidad &OSJRVF )VFSUB t F IVFSUB!JOGPFEJUB FT

3Vm OP (PO[ĂˆMF[ Â? EDIB ."%3*% 5FMĂ?GPOP

Delegado Publicidad - Zona Norte %BWJE &DIFWBSSĂ“B t E FDIFWBSSJB!C CDPNVOJDBDJPO FT ProducciĂłn -VJT 2VFDFEP t M RVFDFEP!JOGPFEJUB FT Departamento de Suscripciones TVTDSJQDJPOFT!JOGPFEJUB FT 5FMĂ?GPOP

4

004 editorial.indd 4

ISSN: DepĂłsito Legal: #* Imprime: &DPMPHSBG ÂŞ */'0&%*5" 2VFEB QSPIJCJEB MB SFQSPEVDDJĂ˜O UPUBM P QBSDJBM EF MPT BSUĂ“DVMPT JODMVJEPT FO FTUB QVCMJDBDJĂ˜O TV USBUBNJFOUP JOGPSNĂˆUJDP Z MB USBOTNJTJĂ˜O QPS DVBMRVJFS GPSNB P NFEJP TJO FM QSFWJP QFSNJTP QPS FTDSJUP EFM UJUVMBS EFM $PQZSJHIU -BT DPMBCPSBDJPOFT TPO EF FYDMVTJWB SFTQPOTBCJMJEBE EFM BVUPS

nÂş 21 - Septiembre-Octubre 2016

03/11/16 15:19


microcom.indd 1

31/10/16 15:50


Noticias del sector

Aumenta el consumo medio de agua de los hogares españoles El Instituto Nacional de Estadística (INE) ha publicado su 'Encuesta sobre el Suministro y Saneamiento del Agua. Año 2014', en la que, entre otras conclusiones, se refleja que el consumo medio de agua de los hogares fue de 132 litros por habitante y día, un 1,5% más que en 2013, y que el coste unitario del agua subió un 3,3% y alcanzó los 1,89 euros por metro cúbico. Durante el año 2014 se suministraron a las redes públicas de abastecimiento urbano 4.272 hm3 de agua. Las tres cuartas partes (3.214 hm3) fueron volúmenes de agua registrada, es decir, medidos en los contadores de los usuarios. El resto (1.058 hm3) fueron volúmenes de agua no registrados (no medidos o estimados mediante aforos). Así, el consumo de agua de los hogares aumentó un 0,9% respecto al año anterior, mientras que la utilización de agua de los sectores económicos se redujo un 1,4% y los usos municipales disminuyeron un 2,3%. El volumen de agua registrado y distribuido a los hogares fue de 2.238 hm3, lo que supuso el 69,6% del total. Los sectores económicos usaron 685 hm3 (el 21,3%), mientras que los consumos municipales (riego de jardines, baldeo de calles y otros usos) alcanzaron los 291 hm3 (el 9,1%). El agua no registrada se desagrega en pérdidas reales y aparentes. Las pérdidas reales (fugas, roturas y averías en la red de suministro) se estimaron en 651 hm3, lo que supuso un 15,2% del total de agua suministrada a dichas redes. Por su parte, las pérdidas aparentes (errores de medida, fraudes y consumos autorizados no medidos) fueron 407 hm3.

Consumo medio del agua de los hogares En 2014 el consumo medio de agua de los hogares fue de 132 litros por habitante y día, lo que supuso un aumento del 1,5% respecto a los 130 litros registrados el año anterior.

Coste unitario del agua El coste unitario del agua se define como el cociente entre los importes abonados por el suministro de agua más los importes abonados en concepto de alcantarilla-

6

ta 21 notis sector.indd 6

do, depuración y cánones de saneamiento o vertido, y el volumen de agua registrada y distribuida a los usuarios. En el año 2014 el coste unitario del agua se situó en 1,89 euros por metro cúbico, con un incremento del 3,3% respecto al año anterior (1,83 euros). El coste unitario del suministro de agua alcanzó los 1,10 euros por metro cúbico, un 0,9% más que en 2013, mientras que el de saneamiento (alcantarillado, depuración, cánones de saneamiento y vertido) fue de 0,79 euros, con un aumento del 6,8%.

Origen del agua captada El 67,7% del volumen captado por las empresas y los entes públicos suministradores de agua procedió de aguas superficiales, mientras que el 27,9% tuvo su origen en aguas subterráneas. El 4,4% restante, provino de otro tipo de aguas (desaladas del mar o salobres).

Resultados por comunidades autónomas Las comunidades que más incrementaron el volumen de agua registrado y distribuido durante el año 2014 fueron Castilla y León (7,2%), Principado de Asturias (5,2%) y Comunitat Valenciana (4,9%). Por el contrario, las comunidades que más lo redujeron fueron Canarias (-8,8%), Castilla-La Mancha (-8,2%) y La Rioja (-7,7%). Las comunidades que distribuyeron más volumen de agua en 2014 fueron Andalucía (17,3% del total), Cataluña (14,2%) y Comunidad de Madrid (12,7%). En el otro extremo, se situaron La Rioja (0,7% del total), Cantabria y Comunidad Foral de Navarra (ambas con un 1,5%). Las comunidades con mayor consumo de agua registrada y distribuida a hogares en el año 2014 fueron An-

nº 21 - Septiembre-Octubre 2016

03/11/16 15:21


Noticias del sector

dalucía (17,3% del total), Cataluña (14,2%) y Comunidad de Madrid (13,6%). En cuanto al consumo de agua de los sectores económicos, las comunidades con mayores volúmenes fueron Andalucía (16,8% del total), Cataluña (15,7%) y Comunidad de Madrid (10,8%). Por su parte, las comunidades con mayores consumos municipales fueron Andalucía (19,1% del total), Comunitat Valenciana (15,5%) y Cataluña (10,6%).

Consumo medio de agua de los hogares por comunidades autónomas Los consumos medios de agua más elevados se dieron en Castilla y León (166 litros por habitante y día), Comunitat Valenciana (162) y Cantabria (152). Por el contrario, los consumos medios más bajos se registraron en los hogares de La Rioja (106 litros por habitante y día), Comunidad Foral de Navarra (111) y País Vasco (116).

Coste unitario del agua por comunidades autónomas Los valores más elevados del coste unitario del agua en 2014 se dieron en Cataluña (2,75 euros por metro cúbico), Región de Murcia (2,73) e Illes Balears (2,19). Por el contrario, Castilla y León (0,95 euros por metro cúbico), Galicia (1,11) y La Rioja (1,15) presentaron los costes unitarios más bajos.

CONSULTE LAS ESTADÍSTICAS DEL INE

www.tecnoaqua.es

ta 21 notis sector.indd 7

03/11/16 15:21


Noticias del sector

El proyecto Ecodhybat consigue un ahorro medio del 38% en el consumo de agua de la industria alimentaria En el marco de este proyecto se han adoptado medidas de diseño ecohigiénico como la modificación de tanques, tapas, conexiones, sistemas de dosificado y cintas transportadoras además de la incorporación de equipos con certificación higiénica conforme EHEDG, disponibles en el mercado. Las empresas Inoxpa, Vega Instruments y HBM han colaborado en el proyecto en la cesión de estos equipos.

Garantía de seguridad alimentaria y valor añadido para las empresas

El uso de equipos de ecodiseño higiénico en la industria alimentaria puede conseguir un ahorro medio del 38% en el consumo de agua, según los resultados del proyecto Ecodhybat. Este proyecto ha permitido demostrar cómo las mejoras ecohigiénicas de equipos y maquinaria pueden reducir de forma significativa el consumo de agua, energía y productos de limpieza, aguas residuales y emisiones de CO2, de los procesos de limpieza y desinfección de la industria agroalimentaria. Ecodhybat es un proyecto cofinanciado por el programa Life+ en el que han participado las empresas Calidad Pascual y Pescanova, junto con el centro tecnológico Ainia y la Asociación de Fabricantes de Equipos para la Industria (AMEC). Los resultados obtenidos en las pruebas realizadas en las instalaciones de Calidad Pascual, Pescanova y Ainia demuestran que el diseño higiénico supone una técnica eficaz para reducir el impacto medioambiental en el sector alimentario no solo en el consumo de agua, sino también en el uso de la energía eléctrica y térmica utilizadas para la limpieza de los equipos. Las operaciones de limpieza y desinfección de equipos e instalaciones en la industria de alimentación son necesarias para mantener un adecuado nivel de higiene y seguridad alimentaria de los alimentos procesados, pero tienen un elevado impacto ambiental (consumo de agua, energía y productos de limpieza, aguas residuales, emisiones de CO2). El diseño ecohigiénico permite reducir el impacto ambiental que suponen las operaciones de limpieza de los equipos alimentarios, puesto que están diseñados teniendo en cuenta criterios higiénicos como: la configuración, la geometría, el acabado superficial y los materiales, que permiten conseguir una mejor limpieza aplicando protocolos más sostenibles.

8

ta 21 notis sector.indd 8

Optimizar los procesos productivos con el diseño higiénico de equipos es un elemento clave para reducir los gastos en limpieza y desinfección de las instalaciones agroalimentarias, así como el coste medioambiental de sus procesos, pero también para garantizar la inocuidad de los productos en el sector agro-alimentario, cosmético o farmacéutico. Así, la aplicación de los resultados de este proyecto permite a los fabricantes de maquinaria que incorporen los criterios de diseño ecohigiénico, agregar una ventaja competitiva a sus equipos y mejorar sus oportunidades de negocio. En la medida en que se impone cada vez más la sostenibilidad en la industria alimentaria, la demanda de maquinaria con características propias de diseño higiénico va a suponer un factor de compra decisivo para las empresas de alimentación, a tener muy en cuenta por los fabricantes de maquinaria.

Diseño higiénico: valor añadido para las empresas que marca tendencia en el sector alimentario Con la finalidad de acercar a las empresas las posibilidades del diseño higiénico en la optimización de los procesos de limpieza, y los desafíos en la incorporación del diseño higiénico en los equipos y procesos industriales, Amec y Ainia organizaron la jornada 'Diseño higiénico de equipos: mejora de la eco-eficiencia de los procesos de limpieza y desinfección. Casos prácticos', donde han presentado los principales resultados del proyecto Ecodhybat a los profesionales del sector. En la jornada se puso de manifiesto una mayor sensibilización de los fabricantes de producto alimentario en los últimos años hacia el diseño higiénico. Tanto por lo que supone en ahorro de costes (energía, agua y mantenimiento), como en avances para garantizar la inocuidad de los productos.

nº 21 - Septiembre-Octubre 2016

03/11/16 15:21


LA CHD COORDINA EL PROYECTO NAIAD SOBRE ECONOMÍA VERDE Y CAMBIO CLIMÁTICO La Confederación Hidrográfica del Duero (CHD), como coordinador, ha sido adjudicataria de un proyecto europeo de investigación e innovación dentro de la convocatoria Horizon 2020 (H2020-SC5-2016-2017: Greening the Economy). Con el nombre de NAIAD (Nature Insurance value: Assessment and Demonstration), este proyecto trata sobre el papel y el valor que tienen los ecosistemas y procesos naturales para reducir los riesgos y efectos de los eventos extremos (inundaciones, sequía y cambio climático). Este proyecto tiene un presupuesto de 5 millones de euros, participan en él 23 socios de 12 países de la UE y cuenta con una duración de 3 años. Durante este tiempo se llevarán a cabo 7 proyectos demostrativos en diferentes emplazamientos de Europa, uno de ellos en la cuenca del Duero, que servirán como experiencias de referencia para el estudio y demostración de los beneficios que supone la restauración, conservación y el mantenimiento de los ecosistemas y procesos naturales. La selección de este proyecto entre otras 7 propuestas europeas presentadas pone de manifiesto la capacidad y solvencia técnica de la CHD para liderar y participar en este tipo de convocatorias, y la apuesta de este organismo por la innovación a la hora de abordar los problemas y retos ambientales que suponen los eventos extremos como consecuencia del cambio climático, todo ello enmarcado en el Plan de Gestión del riesgo de inundación aprobado por el Gobierno en enero de 2016. Además, este proyecto se enmarca dentro del Grupo Europeo de Innovación y Acción llamado RiverRes sobre restauración fluvial, que lidera también la CHD junto con otros 30 socios europeos, que refleja el compromiso de este organismo en convertirse en un referente europeo en la innovación e investigación en temas relacionados con el agua. Esta actuación es un ejemplo de cómo la coordinación de las distintas administraciones es esencial para mitigar los efectos del cambio climático, al igual que las actuaciones ejecutadas por la Confederación Hidrográfica del Duero en el marco del Plan PIMA Adapta de adaptación al cambio climático del Ministerio de Agricultura, Alimentación y Medio Ambiente en el río Ucero, en Soria, y las Lagunas de Lastras y Hontalbilla, en Segovia.

www.tecnoaqua.es

ta 21 notis sector.indd 9

03/11/16 15:21


Noticias del sector

El proyecto CoSuDS promueve la transición hacia una gestión sostenible del agua de lluvia en las ciudades El Instituto Universitario de Investigación de Ingeniería del Agua y Medio Ambiente de la Universitat Politècnica de València (IIAMA-UPV) coordina el proyecto europeo CoSuDS (Collaborative transition towards sustainable urban drainage: making it happen at district scale) que busca favorecer la transición hacia una gestión más eficiente y sostenible del agua de lluvia en las ciudades, mediante el uso de sistemas urbanos de drenaje sostenible (SuDS) desde un enfoque participativo y colaborativo. El proyecto consiste en seleccionar un barrio de la ciudad de Castellón (municipio piloto del estudio) donde exista un problema de drenaje urbano y establecer una serie de sesiones colaborativas para plantear, analizar y definir la estrategia óptima en la gestión de las aguas pluviales. De este modo, se proporcionará a las autoridades locales "recomendaciones en la toma de decisiones en cuanto a sostenibilidad, mitigación de riesgos de inundación y eficiencia energética", según Ignacio Andrés, investigador principal y miembro del IIAMA. De hecho, CoSuDS cubre las interacciones entre los tres subsistemas: el agua (inundaciones, riesgos de contaminación); la energía (reducción del consumo de energía en los edificios y el ciclo del agua urbana); y el entorno construido (que proporciona beneficios sociales y ambientales al ciudadano). Para ello, se celebrarán tres sesiones colaborativas con gobiernos locales, ciudadanos, técnicos y partes implicadas, con el objetivo de integrar las demandas e intereses de los múltiples actores. En este sentido, el investigador del IIAMA afirma que no se trata de resolver el caso concreto de la ciudad de Castellón, "sino elaborar un manual sobre cómo articular la transición entre el drenaje convencional y el drenaje alternativo sostenible, que sirva de referencia para otras ciudades españolas e influya sobre la planificación urbana y las políticas públicas".

El precedente: E²Stormed En el período 2013-2015, el IIAMA coordinó el proyecto E²Stormed, con el objetivo de mejorar la eficiencia energética en la gestión del ciclo del agua en zonas urbanas y edificios mediante la utilización de sistemas innovadores de gestión del agua de lluvia, como los SuDS. El principal resultado del proyecto fue el desarrollo de la herramienta de apoyo a la decisión E²Stormed que permite analizar las diferentes alternativas para la gestión de las aguas pluviales. Este software ha sido aplicado en varias áreas piloto como el municipio de Benaguasil (premio Ciudad Sostenible 2015 otorgado por la Fundación Fórum Ambiental con la colaboración del Ministerio en la categoría Gestión del Ciclo del Agua), pero todavía no se ha aplicado fuera de las ciudades socias del proyecto ni con la participación directa de los ciudadanos. Por ello, Ignacio Andrés indica que el proyecto CoSuDs es una buena oportunidad para trasladar este modelo a una ciudad que no tiene ninguna experiencia en este asunto como es Castellón. "Queremos saber cómo se plantea estratégicamente una acción de este tipo en un distrito o barrio y observar su viabilidad de aplicación a escala ciudad".

¿Qué son los SuDS? Los sistemas urbanos de drenaje sostenible (SuDS) representan una solución eficiente económicamente y flexible para la gestión de escorrentías urbanas que pretende imitar las condiciones previas al desarrollo urbano, potenciando la infiltración, retención y laminación en origen, además de mejorar el paisaje urbano, disminuir el gasto en consumo energético asociado al ciclo del agua, eliminar contaminantes y permitir el aprovechamiento del agua para otros usos.

10

ta 21 notis sector.indd 10

nº 21 - Septiembre-Octubre 2016

03/11/16 15:21


seko.indd 1

03/11/16 09:16


Noticias de empresas

Acciona Agua realiza dos nuevos proyectos internacionales La Empresa Nicaragüense de Acueducto y Alcantarillado Sanitario (Enacal) ha adjudicado a Acciona Agua, en consorcio con BTD, el contrato para la construcción del sistema de alcantarillado sanitario de la ciudad de La Trinidad, al norte de Nicaragua. El proyecto está valorado en unos 5 millones de euros y su objetivo es contribuir a elevar la calidad de vida de la población a través de la mejora de las condiciones sanitarias y medioambientales de la localidad, facilitando el acceso a los servicios de alcantarillado a cerca de 9.000 personas. Este contrato, financiado a través de un

FIN DEL PROYECTO OFREA SOBRE REUTILIZACIÓN Acciona Agua y la Entidad de Saneamiento de Murcia (Esamur) han presentado los resultados del proyecto Life-Ofrea, la tecnología de ósmosis directa que mejora el agua depurada para su reutilización en zonas costeras. La jornada de presentación tuvo lugar en localidad de San Pedro del Pinatar e incluyó también una visita a la planta de demostración localizada en la propia depuradora de San Pedro del Pinatar. La conclusión del proyecto da como resultado que esta tecnología es altamente prometedora, y está mejorando su competitividad rápidamente gracias a un mejor desarrollo de las membranas de ósmosis directa en los últimos años. El principal objetivo del proyecto ha sido demostrar que una tecnología avanzada de desalinización es aplicable para reutilizar aguas residuales con alta salinidad a un menor coste que el que conlleva el uso de las tecnologías actualmente disponibles en el mercado. En zonas como la Región de Murcia, donde se realiza el proyecto, la intrusión marina impide la reutilización de aguas para irrigación y, por tanto, la tecnología tendrá aplicación directa en la zona.

préstamo del Banco Centroamericano de Integración Económica, se llevará a cabo en 18 meses y forma parte del plan para la mejora y ampliación de los sistemas de abastecimiento de agua potable y saneamiento de 19 ciudades a lo largo del país. Se enmarca dentro del Programa Integral Sectorial de Agua y Saneamiento Humano (PISASH) y constará de una red de saneamiento con 17,7 km de tubería, más la ejecución de diversos sistemas de tratamiento de agua, además de todas las obras exteriores necesarias. Además, Acciona ha obtenido el contrato para la ampliación de la planta potabilizadora de agua salobre de Putatan 2, en Filipinas, cuyo contrato para el diseño, construcción y operación y mantenimiento durante un año obtuvo recientemente. Su capacidad será finalmente de 150.000 m3 diarios frente a los 100.000 inicialmente previstos. El proyecto, en cuyo inicio estaba valorado en unos 90 millones de euros, ascenderá a 112 tras la ampliación. La planta se localizará en la localidad de Muntinlupa, en el extremo sur del área metropolitana dela capital Manila, en una zona adyacente a la potabilizadora existente hasta la fecha (Putatan 1), y prestará servicio a un área que incluye a casi 6 millones de personas. Una de las principales características de la nueva planta es el tratamiento avanzado de aguas brutas de Laguna de Bay, el mayor lago de Filipinas. El plan de tratamiento de la nueva instalación incluye diversos procesos técnicos para garantizar el agua potable, entre ellos la flotación de aire disuelto (DAF), el filtrado biológico aireado (BAF), la ultrafiltración, la ósmosis inversa y la desinfección en diferentes etapas a través de la oxidación de ciertos compuestos. La potabilizadora supone un paso destacado para hacer llegar agua potable a más población, ya que, pese a la abundancia de recursos hídricos en el país, son muchos los hogares que en Filipinas no tienen acceso a la misma. Acciona Agua www.acciona.es

12

ta 21 notis empresas.indd 12

nº 21 - Septiembre-Octubre 2016

03/11/16 15:24


AEMA CONSOLIDA SU EXPERIENCIA EN EL SECTOR DEL PETFOOD Aema ha finalizado con éxito la puesta en marcha y entrega a Affinity de una planta de depuración para sus aguas residuales derivadas del proceso productivo en Santa Margarida i Els Monjos, en Barcelona. Affinity, empresa del Grupo Agrolimen, es una compañía con más de 50 años de experiencia en la fabricación de nutrición animal. Para dar tratamiento a este tipo de aguas tan complejas, con elevada concentración de aceites y grasas, así como de materia orgánica, y sobre todo, nitrógeno, Aema ha desarrollado una solución personalizada tras hacer un riguroso análisis del efluente y estudiar los datos resultantes hasta su proyección. La solución se traduce en una aplicación sostenible, competitiva en costes de explotación y altamente respetuosa con el entorno, dado que una de las premisas a tener en cuenta en el diseño ha sido el provocar el menor impacto visual, ambiental y de olores. La línea de tratamiento consta de: - Pretratamiento (desbaste y desengrasado CAF y homogeneización). En esta fase se realizan varias etapas. En primer lugar, se ha realizado un tamizado de finos para eliminar la mayor parte de los sólidos. Posteriormente, el agua pasa a través de un CAF para poder eliminar un gran porcentaje de grasas y finalmente se introduce al homogeneizador, donde se controla el pH de la planta. - Tratamiento fisicoquímico (coagulación-floculación y equipo DAF). Esta fase se realiza con el objetivo de preparar el agua en condiciones óptimas para ser tratado en el tratamiento biológico con sistema SBR. - Tratamiento biológico secuencial (SBR). Son reactores discontinuos en los que el agua residual se mezcla con un lodo biológico en un medio aireado. Se trata de un proceso que combina en un mismo tanque aeración/ reacción y clarificación. - Tratamiento de fangos (purga, almacén y deshidratación de fangos). Los fangos son tratados en una sala de secado de fangos a través de una centrífuga. Una vez finalizada la puesta en marcha, Aema se hace cargo de la explotación y el mantenimiento de la instalación. Gracias a esta nueva referencia, esta compañçia vuelve a validar su know how en el sector del petfood, en el que ya cuenta con clientes como Sebos Levantinos, PGG Group y Grasas Marín, entre otros. Aema - www.aemaservicios.com

www.tecnoaqua.es

ta 21 notis empresas.indd 13

03/11/16 15:24


Noticias de empresas

Nuevo laboratorio de AGQ Labs en Portugal

Remosa finaliza los ensayos de eficiencia de su depuradora Rox con excelentes resultados El Centro de las Nuevas Tecnologías del Agua (Centa) completó a finales del mes de agosto todas las secuencias y ensayos de eficiencia en depuración al modelo de depuradora Rox del fabricante Remosa, obteniendo unos rendimientos excelentes: DBO5 del 96%; DQO del 90%; y SS del 96%, en caudal nominal. La estación depuradora ecológica de oxidación total por fangos activos Rox de Remosa se desarrolla en dos etapas: - Oxidación biológica. En el reactor biológico se dan lugar las diferentes reacciones necesarias para la descomposición bioquímica de la materia orgánica. Estas reacciones se producen gracias a la aportación de oxígeno que proporciona unas condiciones aerobias que permiten la presencia microorganismos aerobios a la vez que mantiene la biomasa en suspensión. El sistema, mediante aireación prolongada, trabaja con una carga másica reducida y una edad del fango elevada que permite eliminar la materia orgánica carbonada y nitrificar el efluente. Además, el sistema produce una menor cantidad de fangos que los procesos convencionales los cuales son estables. - Decantación. Después de la aireación, las aguas son conducidas a un compartimento de sedimentación donde los fangos y el efluente son separados. La mayor parte del sedimento se recircula hacia el reactor para mantener la concentración de biomasa en el mismo. El excedente del fango debe ser eliminado o purgado del proceso en el caso de que se desee prolongar el mantenimiento del sistema.

AGQ Labs ha inaugurado un nuevo laboratorio en Lisboa (Portugal) en el cual ha invertido más de un millón de euros. Estas nuevas instalaciones fueron inauguradas por el ministro de Economía luso, Manuel Caldeira, e intervinieron también el presidente de la Cámara de Alcochete -población cercana a Lisboa donde se ubican las instalaciones-, Luis Miguel Franco, y el presidente ejecutivo de la compañía, Estanislao Martínez. Estos modernos laboratorios se suman a la extensa red que AGQ Labs posee en más de veinte países, y disponen de alta tecnología para la realización de análisis de tipo agronómicos, de seguridad alimentaria, ambientales y mineros. El ministro Caldeira destacó "la importancia que para Portugal tiene la inversión extranjera, sobre todo aquella procedente del único país limítrofe que tenemos, con el que debemos trabajar continuamente para aumentar nuestras relaciones comerciales". Por su parte, Estanislao Martínez puso el foco en la importante apuesta que AGQ Labs ha hecho por su desarrollo en Portugal, país en el que hasta ahora habían desarrollado negocio desde España. "Este nuevo laboratorio, y los 25 profesionales que en él trabajan, nos permiten ofrecer una gran amplitud de servicios y estar cerca de nuestros clientes portugueses". El presidente de AGQ Labs también manifestó la intención de explorar mercados de lengua portuguesa, como Senegal, Brasil o Mozambique desde esta filial.

Remosa

AGQ Labs

www.remosa.net

Con estos resultados, la compañía Remosa puede afirmar sin ningún tipo de duda que sus sistemas Rox disponen de Marcado CE. El sistema Rox se encuentra en formato vertical para poblaciones de 5 y 10 habitantes equivalentes (he) y en formato horizontal para el resto de la gama, hasta los 2.000 he.

http://agqlabs.com

14

ta 21 notis empresas.indd 14

nº 21 - Septiembre-Octubre 2016

03/11/16 15:24


Noticias de empresas

LIKUID NANOTEK PARTICIPA EN EL PROYECTO INTEGROIL SOBRE ULTRAFILTRACIÓN PARA EL SECTOR OIL&GAS Likuid Nanotek continúa desarrollando la ultrafiltración cerámica para el tratamiento de aguas en el sector Oil&Gas. En este caso, participa en el proyecto Integroil, elegido por la Comisión Europea a través del Programa H2020 de apoyo a la innovación. El proyecto está liderado por Acciona Agua y cuenta con la participación de diversas entidades, entre las que se encuentran compañías tecnológicas como Likuid, Aplicat, Innotec21, BWA o REP, universidades (URV), consultoras (2.-0 LCA Consultants), plataformas profesionales (EDS) y empresas del sector petrolero (Tupras). Integroil desarrollará una solución integral para el tratamiento y reutilización del agua, tanto en el sector

ta 21 notis empresas.indd 15

upstream (extracción) como en el downstream (refino), que incluye un sistema de apoyo a la decisión para operar el sistema de la forma más eficiente en términos de reutilización y eficiencia energética. La demostración en los dos escenarios –instalación de extracción de crudo y refinería– es una de las principales acciones del proyecto y, además, permitirá realizar el análisis del ciclo de vida para cuantificar la reducción del impacto ambiental conseguida. La participación de Likuid se centra en la tecnología de ultrafiltración cerámica para el tratamiento de produced water y el proceso CBR (MBR cerámico) para el tratamiento de aguas residuales de refinería. Este proyecto se enmarca en

la estrategia de Likuid en el sector Oil&Gas, junto con otros desarrollos de producto actuales. Se amplía así la tradicional línea de negocio de la empresa en el tratamiento de aguas industriales.

Likuid Nanotek, S.L. www.likuidnanotek.com

03/11/16 15:24


Noticias de empresas

Gestagua desarrolla un sistema de gestión para contadores inteligentes de agua Gestagua, operador para todas las fases del ciclo del agua, en alianza con las empresas Conthidra y Cellnex Telecom, ha desarrollado un nuevo sistema de gestión de contadores inteligentes de agua utilizando para ello la actual red de comunicaciones Sigfox, utilizada para el envío de los datos de telemedida y desplegada en la mayoría del territorio nacional. La red de comunicaciones Sigfox se encuentra desplegada en la mayoría del territorio nacional y puede ser utilizada tanto para la gestión de contadores inteligentes, como para cualquier otro tipo de sensor con el mismo protocolo. El proyecto liderado por Gestagua forma parte de su gran apuesta por el desarrollo tecnológico en el sector del agua. Ya sido validado en tres de sus municipios con resultados satisfactorios, por lo que está en disposición de implantarlo en el resto de sus servicios. Gestagua trabaja en más de medio centenar de municipios, sirviendo a más de medio millón de ciudadanos. La proximidad hacia los clientes con el desarrollo de tecnologías aplicadas a la gestión del ciclo integral del agua es uno de sus principales objetivos. Por ello, los municipios encuentran en Gestagua algo más que un operador eficiente de sus infraestructuras y recursos, un socio activo para la gestión de la ciudad, un gestor transparente y dispuesto a colaborar en medidas que contribuyen a la prosperidad sostenible de la sociedad. Conthidra, empresa del Grupo Janz que desarrolla su actividad en España, es el primer fabricante de contadores que incorpora esta novedosa tecnología mediante el módulo de radio MyWater, apostando claramente por la utilización de soluciones IoT y redes públicas de comunicación en el ámbito de las smart city. El módulo implantado en cada contador incorpora la tecnología Sigfox de largo alcance y registra los consumos de forma horaria para enviarlos diariamente con el mínimo gasto energético. Se trata de una solución fiable e innovadora, modulable según la necesidad del cliente, la puesta en marcha se reduce únicamente a la instalación y alta del contador, y sobre todo supone el futuro frente a sistemas cerrados y privados, liberando al gestor de la instalación y mantenimiento de su propia red de comunicación. Cellnex Telecom es el principal operador independiente europeo de infraestructuras de telecomunicaciones inalámbricas. Desarrolla su actividad en España, Italia, Holanda y Francia y cuenta con una cartera de más de 16.000 emplazamientos. Ofrece a sus clientes el espacio que necesitan en los diferentes centros para instalar y mantener sus respectivos equipos de redes de comunicaciones y transmitir datos y voz inalámbrica. Asimismo, es relevante el papel de Cellnex Telecom en el despliegue de las redes de seguridad y emergencia para los cuerpos de seguridad. La compañía también desarrolla infraestructuras y redes para soluciones en el campo de los proyectos smart cities, que optimizan los servicios para el ciudadano y facilitan la gestión de los recursos en las áreas urbanas. Gestagua www.gestagua.es

16

ta 21 notis empresas.indd 16

nº 21 - Septiembre-Octubre 2016

03/11/16 15:24


weg.indd 1

31/10/16 15:51


Noticias de empresas

Adequa suministra la tubería para la red de saneamiento del anillo de los Juegos Mediterráneos de Tarragona 2017 Adequa, reconocido fabricante de tuberías y accesorios en el mercado español, está suministrando su sistema Sanecor para la instalación de la red de saneamiento en la urbanización del anillo de los XVIII Juegos Mediterráneos que se celebran del 30 de junio al 9 de julio de 2017 en 16 municipios sede de la provincia de Tarragona. Concretamente, Adequa está proporcionando la tubería Sanecor en toda su gama de diámetros desde 160 hasta 800, a la obra promovida por el Ayuntamiento de Tarragona y ejecutada por la UTE formada por Carbonell Figueras, Aquambiente y Acsa-Sorigué. Los Juegos Mediterráneos son una competición de carácter polideportivo que se organizan en el marco del movimiento olímpico, con la participación de 4.000 deportistas de 32 disciplinas procedentes de 26 países de los tres continentes que rodean el mar mediterráneo: Europa (19), África (5) y Asia (2). El Anillo Mediterráneo, uno de los epicentros de los Juegos, estará ubicado en Campclar. Para hacer realidad este proyecto se contempla una reordenación general de la zona para delimitar las zonas de deportistas y espectadores y ofrecer unos servicios óptimos a todos ellos.

SISTEMA ADEQUA SANECOR: EFICIENCIA PARA LAS REDES DE SANEAMIENTO El sistema Adequa Sanecor instalado en el anillo de los Juegos Mediterráneos es un sistema integral y versátil para saneamiento y drenaje. La tubería de PVC Adequa Sanecor es una tubería con pared estructurada de doble capa, lisa interior y corrugada exterior de rigidez SN8 (* 8 kN/m²). Esto le proporciona valores muy altos de rigidez frente a las cargas, a corto y largo plazo, y elevados diámetros interiores que garantizan caudales óptimos. Su gama abarca diámetros nominales entre 160 y 1200 (DN en milímetros), fabricada en 6 y 3 m de longitud. El sistema se completa con piezas especiales, acometidas mediante clips elastoméricos o mecánicos, pozos de registro prefabricados, arquetas, así como componentes fabricados a medida según las características del proyecto que garantizan su total estanqueidad. Se trata de un producto sostenible que asegura una eficiencia energética máxima durante todo su ciclo de vida, con una fiabilidad y garantía ampliamente reconocidas en el mercado. Adequa - www.adequa.es

Grupo Soil amplía la EDARI de Alter Farmacia-Nutribén en Meco Grupo Soil llevará a cabo la ampliación de la planta de tratamiento de aguas residuales industriales (EDARI) de la fábrica de Alter Farmacia-Nutribén en Meco, Madrid. El contrato firmado incluye el diseño, suministro, instalación y puesta en marcha de dicha instalación. La ampliación de la EDARI contará un con tratamiento biológico por lodos activados y clarificación final mediante flotación por aire disuelto (DAF), que garantizarán el tratamiento de 500 m3/ día, con una calidad de efluente final según las ordenanzas de vertido de la Comunidad de Madrid. Grupo Soil, empresa española del sector medioambiental que cumple 25 años en la gestión y tratamiento de aguas y residuos, consolida con este contrato el crecimiento en los mercados nacional e internacional y su posicionamiento en el sector de la gestión y tratamiento de aguas. Grupo Soil www.gruposoil.com

18

ta 21 notis empresas.indd 18

nº 21 - Septiembre-Octubre 2016

03/11/16 15:24


ÁLAVA INGENIEROS, PRESENTE EN METEOROLOGICAL TECHNOLOGY - WORLD EXPO 2016 Álava Ingenieros estuvo presente en Meteorological Technology - World Expo 2016, exposición celebrada a finales de septiembre que reúne las tecnologías más innovadoras en materia de previsión, medición y análisis climático, meteorológico e hidrometeorológico, así como a los proveedores de servicios y grandes responsables de la toma de decisiones de sectores tan específicos como el aeronáutico, de empresas de transporte, instalaciones marítimas y portuarias, aeropuertos, operaciones militares, empresas de exploración marina, operadores de parques eólicos, oficinas meteorológicas, operaciones agrícolas e institutos de investigación.

Álava Ingenieros, empresa que nació en 1973 para proporcionar soluciones tecnológicas a medida de los clientes de un gran número de sectores -en colaboración con fabricantes de primera línea- ha iniciado una etapa de desarrollo en el sector medioambiental. Así, Álava Ingenieros entrega ya soluciones integrales a los clientes, con el objetivo de mejorar el catálogo de productos y servicios y, de este modo, facilitar la realización de proyectos a nuestros clientes. Álava Ingenieros, además de ofrecer los mejores sensores para la medición de parámetros meteorológicos, hidrológicos y de calidad de agua y aprovechando la vasta experiencia adquirida a lo largo de más de 40 años en la asesoría y venta de equipamiento, realiza ya proyectos llave en mano en los que entrega al cliente soluciones completas para monitorizar aeropuertos, carreteras y redes meteorológicas, hidrológicas y oceanográficas, así como grandes redes en las que se mezclen diversas tipologías.

Grupo Álava www.alava-ing.es

www.tecnoaqua.es

ta 21 notis empresas.indd 19

03/11/16 15:24


Noticias de empresas

Molecor implementa mejoras funcionales en su programa de cálculo mecánico para tuberías de PVC-O Molecor, empresa española especializada en la fabricación y tecnología de tuberías en PVC orientado (PVC-O) para la canalización de agua a presión, ha desarrollado mejoras en la funcionalidad de su programa de cálculo mecánico Tomcalculation.com, la innovadora aplicación de cálculo mecánico para tuberías plásticas enterradas de PVC-O Tom. Con esta herramienta, el usuario dispone de una plataforma personalizada para la creación de sus propios proyectos y cálculos asociados a los mismos. Tomcalcultion se convierte así en una aplicación funcional, sencilla e interactiva para el usuario. La aplicación proporciona como resultado los distintos esfuerzos y solicitaciones que soportará la tubería Tom, así como sus coeficientes de seguridad a rotura y aplastamiento, basada en las normas de referencia ATV-DVWK-A 127E:2000 'Static Calculation of Drains and Sewers' y UNE 53331:19972 'Tuberías de poli (cloruro de vinilo) no plastificado y polietileno (PE) de alta y media densidad. Criterio para la comprobación de los tubos a utilizar en conducciones con y sin presión sometidos a cargas externas'. Es importante realizar el cálculo mecánico de las conducciones enterradas para valorar los esfuerzos mecánicos que se transmiten a la tubería por la acción de las distintas cargas externas actuantes, por lo se deberían realizar los cálculos mecánicos de las tuberías Tom antes de proyectar la instalación. La introducción de los valores en la aplicación se realiza de forma sencilla, obteniendo un informe completo con los resultados de todos los cálculos, validándose así el tipo de tubo más adecuado para las condiciones específicas de cada instalación. El programa completa las funcionalidades originales con una nueva sección 'Cambios para validación'. Si el resultado obtenido en el informe no cumple con los criterios de coeficientes de seguridad seleccionados o la máxima deformación admisible para la tubería, la aplicación ofrece la alternativa de modificar los diferentes parámetros ya definidos, con el objetivo de conseguir que la instalación sea válida. Los parámetros definidos son: coeficiente de seguridad (cuando no se cumple con el coeficiente de seguridad mínimo); presión interna de trabajo (bar), que se ha reducido de forma notable y no ha alcanzado un resultado óptimo; altura del relleno sobre la generatriz superior del tubo (se ha realizado el cálculo modificando la altura del relleno y los coeficientes de seguridad y no son satisfactorios); presión nominal (se ha realizado el cálculo con la máxima presión nominal -PN25- y los coeficientes de seguridad no son satisfactorios; ángulo de apoyo (se ha realizado el cálculo con el máximo ángulo de apoyo -180º- y los coeficientes de seguridad no son satisfactorios; y tráfico. En esta última mejora se dan tres supuestos: caso de haber elegido instalación con sobrecargas concentrada, se ha realizado el cálculo de la instalación con la opción de tráfico más ligero (LT12) y los coeficientes de seguridad no son satisfactorios, por lo que la única opción más favorable sería una instalación sin sobrecargas concentradas; caso de haber elegido insCURSO SOBRE DISEÑO E INSTALACIÓN talación sin sobrecargas concentradas, la instalación DE TUBERÍAS PARA EL TRANSPORTE DE AGUA no tiene sobrecargas concentradas y no se alcanzan los coeficientes de seguridad; y, por último, caso de Molecor estará presente en el XVI Curso sobre Diseño e haber elegido instalación con sobrecargas distribuiInstalación de Tuberías para el Transporte de Agua que se celebrará entre los días 29-30 de noviembre y 1 de diciemdas, la instalación se ha calculado con sobrecargas bre de 2016, en la Escuela Técnica Superior de Ingeniería distribuidas y los coeficientes de seguridad no son y Diseño Industrial de la Universidad Politécnica de Madrid. satisfactorios. Molecor interviene en esta nueva edición con su ponencia 'Redes sostenibles en PVC Orientado (PVC-O). Huella AmEl acceso al programa de cálculo mecánico Tom de biental' impartida por Yolanda Martínez del Amo, directora Molecor se realiza a través de la aplicación: www. de Medioambiente y Certificación. Molecor presentará los tomcalculation.com. resultados obtenidos del estudio realizado para el cálculo de Molecor huella ambiental de un sistema de tuberías de PVC-O. www.molecor.com

20

ta 21 notis empresas.indd 20

nº 21 - Septiembre-Octubre 2016

03/11/16 15:24


Noticias de empresas

SALHER IMPLANTA SU TECNOLOGÍA MBBR EN ARGELIA Salher, en colaboración con la empresa Meheleb Messaoud & Fils, ha participado en el proyecto de diseño completo e instalación de una planta de tratamiento de aguas residuales para una urbanización de alojamientos oficiales en Argelia. En este proyecto se han implantado nuevas tecnologías en sistemas de pretratamientos y depuración por MBBR. La nueva EDAR de Salher tiene una capacidad para depurar un caudal de 225m3 diarios, equivalente a 2.000 habitantes. Dispone de todos los elementos hidráulicos y eléctricos y está constituida, entre otros, por los siguientes equipos: pozo de bombeo; un sistema de separación de grasas, desarenador y tamizador

ta 21 notis empresas.indd 21

(PPC-TA-HEL); dos reactores biológicos lecho móvil (MBBR) con decantador primario; dos espesadores cerrados con patas; un equipo terciario con 2 cartuchos de membranas de gran caudal; y un depósito de agua limpia con un volumen de 10 m3. Las plantas compactas de pretratamientos Salher combinan de una manera eficiente varios pretra-

tamientos de aguas residuales provenientes de las instalaciones municipales o industriales. La PPC-TA-HEL está constituida por un desbaste de finos automático y un separador de grasas automático. El sistema realiza el desbaste de finos mediante un tamiz helicoidal automático. Tras este, el separador de grasas automático en superficie se encarga de la eliminación de arenas y sólidos densos decantados en el equipo y de la eliminación de aceites y grasas. Sus ventajas son: completa separación de finos y alto nivel de separación de arenas y grasas; y pequeña superficie de implantación. Salher Ibérica, S.L. www.salher.com

03/11/16 15:24


Noticias de empresas

Nuevos proyectos nacionales de abastecimiento para Saint-Gobain PAM España Saint-Gobain PAM España ha participado en la mejora de abastecimiento a una zona rural que está ubicada en la región montañosa de Lluçanés, en Barcelona, beneficiando a los municipios de Sant Agustí de Lluçanés, Sant Martí d'Albars y Olost. Para ello, la empresa ha suministrado su tubería de fundición dúctil Blutop con 5.124 mm DN75, 2.844 mm DN 90 y 2.850 DN 110, además de 1.608 DN100 de la gama PAM Standard. Blutop es un sistema completo de canalizaciones que mantiene las ventajas de la fundición dúctil y las une a las de los plásticos, resultando un sistema totalmente innovador para la distribución de agua potable en pequeños diámetros. Las características principales de la gama son las siguientes: - Manuportabilidad. Todos los elementos de la gama pueden ser transportados con mucha facilidad, lo cual aumenta muy significativamente las cadencias de montaje, sobre todo en las zonas en que el acceso de maquinaria es más complicado. - Compatibilidad dimensional con redes plásticas. Permite la sustitución de antiguos tubos plásticos de PVC, PVC-O o PE, ya que es compatible dimensionalmente. - Durabilidad. El enfoque innovador de la gama hace que esté perfectamente adaptada a las necesidades de distribución de agua en pequeños diámetros. - Ecomontaje. Disminuye la retirada y el transporte de escombros así como el aporte de nuevos rellenos de zanja, lo cual reduce los costes de la obra. La gama PAM Blutop mantiene las propiedades de la fundición dúctil con las siguientes características:

22

ta 21 notis empresas.indd 22

- Revestimiento exterior Biozinalium. Diseñado para durar, previene los ataques de la corrosión en terrenos agresivos, aumentando así la durabilidad de la canalización. - Revestimiento interior Ductan: Más ligero y resistente, garantiza una superficie interior completamente lisa y apta para estar en contacto con agua para consumo humano.

MEJORA EL ANILLO DE ABASTECIMIENTO A LA ZONA BURGALESA DE CORTES Saint-Gobain PAM España también ha participado en la mejora de la conducción del abastecimiento desde la ETAP, situada en la margen izquierda del río Arlanzón a la zona de Cortes, ubicada al sur de la ciudad de Burgos. Con dichas obras se pretende ampliar la capacidad de los depósitos y de las conducciones generales del sistema de abastecimiento de la ciudad de Burgos, ya que las existentes resultan insuficientes para asegurar el servicio de la capital, de su entorno industrial y de los pueblos de su alfoz. Para ello, ha suministrado su tubería de fundición dúctil Standard, 8.300 ml DN 600 C30 y 2.300 DN 800 C30. En concreto, las obras consisten en la ejecución de una nueva conducción de 18,8 km de longitud y 1.200 mm de diámetro, que une la salida de la ETAP de Arlanzón con la zona de Cortes, ubicada al sur de la ciudad de Burgos, donde se construirá un nuevo depósito de regulación de 40.000 m3 de capacidad. La gama PAM Standard está diseñada para el abastecimiento de agua potable y riego cuyas instalaciones requieran prestaciones diferentes a las que ofrecen las clases preferentes según la Norma UNE-EN 545:2011. Su robustez y resistencia a las cargas externas, su fiabilidad y su versatilidad la convierten en única en el mercado.

nº 21 - Septiembre-Octubre 2016

03/11/16 15:24


Las instalaciones en las que se recomienda la utilizaciĂłn de la gama PAM Standard son aquellas en las que las presiones hidrostĂĄticas normales son muy superiores a lo comĂşn, demostrando esta gama la mayor seguridad en estos casos especiales. Sus caracteristas tĂŠcnicas son un revestimiento exterior que cuenta con una capa de protecciĂłn de zinc metĂĄlico y barniz bituminoso de color negro. En cuanto a su revestimiento interior, dispone de un mortero de cemento de alto horno sulfato resistente aplicado por vibrocentrifugaciĂłn, lo cual garantiza una rugosidad superficial reducida. El proyecto en el que ha colaborado Saint-Gobain PAM tambiĂŠn incluye las obras de los ramales que conectan los citados depĂłsitos de Cortes y las arterias de la ciudad de Burgos. En concreto se ejecutan cuatro nuevas arterias: - Arteria DepĂłsito de Cortes-Glorieta de Bilbao: nueva tuberĂ­a de fundiciĂłn de 600 mm de diĂĄmetro y 3.915 m de longitud. - Arteria DepĂłsito de Cortes-Valle de CardeĂąadijo: tuberĂ­a de fundiciĂłn dĂşctil de 800 mm de diĂĄmetro y 1.768 m de longitud. - Arteria Valle CardeĂąadijo-VillalonquĂŠjar: tuberĂ­a de fundiciĂłn dĂşctil de 600 mm de diĂĄmetro y 8.000 m de longitud. - Arteria de conexiĂłn a las Huelgas: partiendo de la anterior, mediante tuberĂ­a de fundiciĂłn dĂşctil de 500 mm de diĂĄmetro y 525 m de longitud.

DOSIFICACIĂ“N DE REACTIVOS

RRRR

AGITADORES INDUSTRIALES

EQUIPOS DE PREPARACIĂ“N DE POLIELECTROLITO

AMPLIACIĂ“N DE LA ERA REJAS-VALDEBEBAS Finalmente, la compaùía tambiĂŠn ha participado en las obras de ampliaciĂłn de la estaciĂłn depuradora de aguas residuales (EDAR) Rejas-Valdebeba, y lo ha hecho suministrando su tuberĂ­a de fundiciĂłn dĂşctil de la gama PAM Integral para la interconexiĂłn entre las estaciones regeneradoras de aguas residuales. Para las obras de ampliaciĂłn, Saint-Gobain PAM ha suministrado mĂĄs de 7.000 ml DN 600 y DN 700 de la gama PAM Integral. Esta tuberĂ­a estĂĄ diseĂąada para garantizar el funcionamiento Ăłptimo en redes de saneamiento con las siguientes caracterĂ­sticas: saneamiento por gravedad o a presiĂłn, aguas de uso domĂŠstico y efluentes con pH entre 4 y 12, conforme a la norma UNE-EN 598:2008 y a la ISO 7186:2011, larga vida Ăştil, sencillez de instalaciĂłn y sistema completamente estanco a presiones internas y externas.

VĂ LVULAS DE MANGUITO

DOSIFICACIĂ“N DE PRODUCTOS EN POLVO O GRANULADOS BOMBAS NEUMĂ TICAS DE DOBLE MEMBRANA

BOMBAS DOSIFICADORAS

BOMBAS CENTRĂ?FUGAS

Saint-Gobain PAM EspaĂąa www.pamline.es

www.timsa.com # -ONTE 0OTRERO s !RGANDA DEL 2EY -ADRID 4EL s INFO TIMSA COM www.tecnoaqua.es

ta 21 notis empresas.indd 23

Delegaciones en Barcelona y Vigo

03/11/16 15:24


Noticias de empresas

Aguas de Alcázar participa en el proyecto Memory en busca de la depuradora del siglo XXI La Empresa Mixta Aguas de Alcázar, formada por Aqualia y el Ayuntamiento de Alcázar de San Juan, han presentado el proyecto Life Memory (www.life-memory.eu) en la estación depuradora de aguas residuales del municipio, un proyecto de I+D que busca cambiar el paradigma de la depuración al considerar el agua residual como una fuente de energía y nutrientes, y un recurso reutilizable. En el proyecto, que cuenta con una inversión superior a los 2 millones de euros, también participan la Universidad de Valencia, la Universidad Politécnica de Valencia y Koch Membrane Systems. El proyecto Memory busca un tratamiento sostenible de las aguas residuales que busca: mejorar la recuperación de agua y la recuperación de recursos (nutrientes, energía); minimizar el consumo de energía y los costes de operación; y reducir la producción de fangos y la emisión de gases de efecto invernadero. El prototipo instalado en la EDAR dispone de un elevado grado de instrumentación y automatización, que permitirá el control y optimización del proceso de tratamiento, aportando además información relevante para el estudio económico y análisis de ciclo de vida de esta novedosa tecnología. Un prototipo, como asegura Frank

Rogalla, director de I+D de Aqualia, que "cambia el concepto de la depuración como lo conocemos desde hace más de un siglo, ideando la depuradora de agua residual como una instalación para la recuperación de recursos". En concreto, valorizar el agua residual convirtiéndola en bioenergía, que puede ser utilizada en la propia planta o como biocombustible, en agua idónea para riego u otros industriales al desinfectar de forma efectiva el agua tratada manteniendo un elevado contenido en nutrientes, y en biosólidos utilizables en agricultura. Los resultados esperados del proyecto son la reducción de hasta un 70% de consumo energético, en comparación con procesos actuales, pudiendo alcanzarse una producción neta de energía en escenarios concretos. También una reducción en un 80% de las emisiones de CO2, disminuyendo considerablemente la huella de carbono en la planta. Y la reducción de la superficie de implantación en al menos un 25% y reducción en la producción de biosólidos de hasta un 50%. El proyecto cuenta con una inversión de 2,1 millones de euros, de los que aproximadamente el 50% corresponde al programa Life 2013 que convoca la Unión Europea, y 966.024 euros son aportados por Aqualia, teniendo una duración aproximada de dos años y medio. Aguas de Alcázar www.aguasdealcazar.com

Yecla prorroga el contrato con Aqualia por 4 años más El Ayuntamiento de Yecla, en Murcia, ha prorrogado por 4 años el contrato que Aqualia venía prestando a los más de 34.000 ciudadanos de la población. La prórroga acarreará una serie de mejoras adicionales en el servicio que beneficiarán a los ciudadanos. Aqualia gestiona el servicio de aguas de Yecla desde el año 1977. Durante este tiempo ,el contrato ha sido prorrogado en varias ocasiones, señal inequívoca de la confianza que el ayuntamiento deposita en la gestión realizada por la empresa. Yecla es un municipio de la Comarca del Altiplano en la Región de Murcia. Situada en el extremo Noreste, limita al Este con la provincia de Alicante y al Norte y Oeste con la de Albacete. El servicio se presta a más de 16.500 clientes que consumen una cifra superior a los 1.700.000 m3/año. La prórroga supone una mejora adicional del buen servicio que se viene prestando. Así se optimizarán la atención al cliente, la calidad del servicio y se introducirán nuevos modelos de gestión más eficaces y modernos, implementando las nuevas tecnologías que Aqualia tiene disponible. Aqualia - www.aqualia.es

24

ta 21 notis empresas.indd 24

nº 21 - Septiembre-Octubre 2016

03/11/16 15:24


labaqua.indd 1

31/10/16 15:52


Noticias de empresas

Veolia gestiona el ciclo del agua de un complejo petroquímico en China Sinopec, la mayor refinería china de Asia, ha elegido a Veolia, a través de su subsidiaria Veolia China, para asumir toda la operación del ciclo del agua del complejo petroquímico Yanshan. El alcance económico del contrato, a 25 años, es de 3.270 millones de euros y la joint venture que se creará entre Yashan Petrochemical y Veolia dará empleo a más de 800 personas. Yanshan Petrochemical, subsidiaria 100% de Sinopec, es uno de los complejos petroquímicos más grandes en China dedicados a la producción de caucho sintético, resina sintética, acetona y productos de petróleo refinado de alta calidad. Procesa más de 10 millones de toneladas de petróleo crudo y produce 800.000 toneladas de etileno al año. Veolia y Yanshan Petrochemical continúan su asociación ya establecida, ampliando el alcance de la colaboración a la gestión de todo el ciclo del agua del complejo, incluyendo las torres de refrigeración, el agua desmineralizada, el agua industrial, el agua potable, las aguas residuales y las aguas de servicio. Además, el alcance del contrato implica la optimización del consumo de agua del complejo y el aumento de la tasa de reutilización, lo que permitirá a Yanshan Petrochemical reducir su huella hídrica, de vital importancia para esta región de Pequín que se enfrenta con el problema del déficit y la escasez de agua. Asimismo, Veolia mejorará la planta de aguas residuales para que cumpla con las nuevas normas de vertido de Pequín, una de las más restrictivas del mundo. El contrato también contempla un completo programa para la optimización del consumo energético de todas las instalaciones de agua, lo que permitirá a la compañía petroquímica reducir su huella de carbono. Antoine Frérot, presidente y consejero delegado de Veolia, ha declarado que "la confianza que Sinopec ha depositado en Veolia demuestra cómo dos empresas pueden asociarse para ofrecer los mejores servicios en sus respectivos campos. Esta unión permite a Veolia ayudar a Sinopec a implementar las tecnologías y estándares medioambientales para que su planta de Yanshan sea una referencia en China. El contrato confirma que el sector de la refinería puede mantener su producción al mismo tiempo que se reduce su impacto medioambiental". Veolia Water Technologies www.veoliawatertechnologies.es

DINOTEC SUMINISTRA AGUA POTABLE PARA HAITÍ Dinotec y Bomberos Unidos Sin Fronteras (BUSF) han entregado la planta potabilizadora de emergencias a Haití, el país recientemente afectado tras el paso del huracán Matthew, que se ha cobrado la vida de centenares de personas, dejando otros miles de desplazados que carecen de los suministros básicos. Se trata de la tercera intervención en Haití de las plantas potabilizadoras portátiles de Dinotec a mano de las principales ONG. Las potabilizadoras llegaron por primera vez en el año 2005 tras el huracán Dennis y la segunda vez fue en el año 2010 tras el terremoto que sacudió el país. Cabe destacar la implicación de Dinotec con Haití, ya que también ha realizado la ingeniería e instalación de equipos de la potabilizadora de Jacmel, con una capacidad de potabilizar agua de 50 L/s. Desde 2005, Dinotec pone a disposición de las ONG sus plantas potabilizadoras de emergencia capaces de potabilizar hasta 40 m3/día de agua, operar con fuentes de agua superficial, salobre y también con agua de mar, permitiendo abastecer a unas 10.000 personas diarias. Dinotec cuenta en su fábrica de Sevilla con un stock permanente de 8 plantas potabilizadoras, listas para ser enviadas. Dinotec - www.dinotec.com

26

ta 21 notis empresas.indd 26

nº 21 - Septiembre-Octubre 2016

03/11/16 15:24


Noticias de empresas

Kamstrup participa en la primera edición de la feria Iwater Kamstrup, firma especializada en la fabricación de contadores inteligentes, estará presente en la próxima edición de la nueva feria internacional Iwater, que se celebrará en Barcelona del 15 al 17 de noviembre, presentando sus últimas novedades en soluciones de medición de agua inteligente. Aquellos que se acerquen al stand de Kamstrup comprobarán que la firma dispone de diferentes soluciones para avanzar en la medición del agua. A diferencia de los contadores mecánicos tradicionales, los contadores ultrasónicos de Kamstrup leen el consumo desde la primera gota y ofrecen una lectura precisa y segura, lo que garantiza una factura justa para el consumidor. Además, al no tener piezas móviles, este tipo de contadores no se ve afectado por el desgaste lo que aumenta su vida útil y reduce el riesgo de averías. Permiten la lectura a distancia lo que representa un ahorro de tiempo para las empresas suministradoras. Otra de las ventajas de este tipo de contadores es la posibilidad de

ta 21 notis empresas.indd 27

detectar fugas y pérdidas repentinas de presión facilitando su reparación de un modo inmediato. Los contadores inteligentes de Kamstrup permiten que el usuario final disponga de más información de la que tiene con un contador mecánico. Se facilita así una mayor concienciación de los usuarios del valor del agua, en una época en la que esta se ha convertido en uno de los bienes más preciados. Kamstrup España www.kamstrup.es

03/11/16 15:24


Noticias de empresas

LABAQUA REALIZARÁ EL SERVICIO DE TOMA DE MUESTRAS DE MASAS DE AGUA SUPERFICIALES PARA LA CHE La Confederación Hidrográfica del Ebro (CHE) ha adjudicado a Labaqua el servicio de toma de muestras de las masas de agua superficiales en la cuenca del Ebro y las determinaciones in situ en los puntos de control activos de los ríos. Durante un periodo de tres años, Labaqua prestará su asistencia técnica para el control del estado de las masas de agua superficiales (CEMAS) particularizada para ríos e indicadores físico-químicos en el ámbito geográfico y administrativo de la Demarcación Hidrográfica del Ebro. De esta forma, Labaqua asegura el conocimiento por parte de la administración de la evolución de las diferentes masas de agua, detectando posibles incidencias con suficiente antelación para adoptar medidas encaminadas a corregir o minimizar las posibles afecciones que puedan sufrir las diferentes masas de agua que conforman la cuenca. Esta nueva adjudicación confirma la confianza de la CHE con el trabajo de Labaqua, que continúa sumando experiencia adquirida en trabajos realizados para las distintas confederaciones hidrográficas del territorio nacional, así como otros organismos como la Dirección General del Agua. Con una superficie de más de 85.000 km², la cuenca hidrográfica del Ebro es la más extensa de España y representa el 17,3% del territorio peninsular español. La actividad humana genera presión e impactos que ponen en riesgo el estado natural en sus aguas continentales, tanto en términos de cantidad como de calidad. Labaqua realiza trabajos de forma rutinaria en la zona geográfica indicada, tanto para la propia Confederación Hidrográfica del Ebro, como para otros organismos como el Centro de Estudios Hidrográficos del CEDEX, y el Instituto Aragonés del Agua. Además, desde hace 10 años, Labaqua ha sido adjudicataria de distintos contratos relacionados con la explotación de la Red CEMAS. El equipo propuesto para este servicio pertenece también a una entidad colaboradora de la administración hidráulica y a una eentidad de inspección acreditada, lo que asegura una experiencia en sistema de competencia técnica basado precisamente en el desarrollo de procedimientos técnicos. Esta adjudicación es también una oportunidad para interrelacionar centros de trabajo de Labaqua separados físicamente. En Labaqua cuentan con una amplia experiencia en el desarrollo de estudios para la caracterización de las masas de aguas superficiales y subteCONTROL DE AGUAS DE BAÑO rráneas, así como amplia experiencia en vigilancia ambiental (calidad de las aguas, vertidos, contaminación Labaqua ha participado en la demostración in situ del atmosférica, suelos contaminados, residuos, ruido, proyecto de control de las aguas de baño, mediante la instalación de una boya multiparamétrica en aguas de Chiclana ecología acuática y, medio marino) y en consultoría (Cádiz). Junto con la empresa Hidralia, su socio de desarrollo (auditorias, sistemas de gestión ambiental, planes de en este proyecto, la presentación sirvió para transmitir ya en minimización, evaluación de impacto ambiental, etc.). tiempo real los datos necesarios para alertar de cualquier episodio de contaminación en la playa de Sancti Petri. Esta Para la prestación de este tipo de servicios ambientainiciativa, pionera en España, tiene como principal equipales en aguas continentales, Labaqua aplica soluciones miento una plataforma flotante con sensores de monitoriavanzadas y últimas tecnologías, tanto en los laborazación on line de calidad de las aguas, dispositivo conocido técnicamente como boya multiparamétrica. La plataforma torios de análisis como en los trabajos de campo y de flotante se complementa, además, con la realización de interpretación de la información. Como parte de su vuelos mediante dron para detección de posibles vertidos valor añadido, la empresa cuenta con conocimiento en origen y la consiguiente inspección visual de la zona. Esta perspectiva aérea permite completar la información profundo del marco normativo y un amplio paquete recogida por la boya, en caso de detectarse una superación de acreditaciones por ENAC. de valores umbrales de calidad de las aguas, y determinar la envergadura, trayectorias, afecciones en la costa… y todo ello con la finalidad de desplegar los recursos necesarios de Labaqua respuesta en el menor tiempo posible. www.labaqua.com

28

ta 21 notis empresas.indd 28

nº 21 - Septiembre-Octubre 2016

03/11/16 15:24


Noticias de empresas

Tedagua construirá la planta potabilizadora y estación de bombeo de Bilwi, en Nicaragua Dentro del plan para la expansión y mejora del servicio de agua potable de la ciudad de Bilwi, capital de la Región Autónoma del Atlántico Norte, la Empresa Nicaragüense de Acueductos y Alcantarillados (Enacal), ha seleccionado a Tedagua para la construcción de la planta de tratamiento y estación de bombeo nº 2. A través de esta operación, se propone aumentar la co-

bertura y mejorar la calidad del servicio de agua potable en la ciudad, dotar del servicio a cuatro comunidades rurales vecinas y mejorar la eficiencia y sostenibilidad en la provisión del servicio. El contrato, de 6,4 millones de dólares americanos, incluye la construcción de una nueva planta de tratamiento de agua potable de tipo convencional para tratar un caudal de 300 L/s, así como la construcción de una estación de bombeo a la salida de la planta que elevará las aguas hasta los tanques de almacenamiento. Esta acción, que beneficiará a más de 11.000 hogares, está financiada con fondos del Gobierno de Nicaragua a través de Enacal y por el Fondo Español de Cooperación para Agua y Saneamiento para América Latina y el Caribe (FECASALC) y gestionada a través del Banco Interamericano de desarrollo (BID). Según declaraciones de Thierry Delaunay, jefe del equipo del proyecto del BID, "este proyecto supone un apoyo estratégico al mejoramiento de la calidad de vida en una de las zonas con mayor pobreza en Nicaragua".

Tedagua www.tedagua.com

ta 21 notis empresas.indd 29

03/11/16 16:26


Noticias de empresas

Caprari patrocina una exposición del renacentista Juanelo Turriano Con el fin de fomentar el legado artístico y los estudios científicos, Caprari patrocina la exposición ´Janello Torriani, el genio del Renacimiento´, que se puede visitar del 10 de septiembre de 2016 al 29 de enero de 2017 en el Museo del Violín de Cremona. La exposición ha sido organizada y patrocinada por el Ayuntamiento de Cremona junto con la Fondazione Arvedi Buschini, Unomedia y la Fundación Juanelo Turriano. Juanelo Turriano es considerado una importante figura italiana que, a través de la combinación de conocimientos teóricos y experiencia, marcó el nacimiento de la modernidad en términos de innovación y revolución científica. Sus inventos lo han consagrado como uno de los mayores exponentes de la Europa renacentista. El hilo conductor que une Caprari a Turriano es el conocido Artificio de Juanelo: una máquina diseñada para transportar agua del río Tajo a la ciudad de

Toledo, salvando un desnivel de unos 100 metros de altura, a lo largo de 300 metros hasta la fortaleza del rey; algo realmente extraordinario para la Europa del siglo XVI. La exposición rinde homenaje a un genio pionero del futuro y Caprari se enorgullece de apoyar esta iniciativa. Bombas Caprari, S.A. www.bombascaprari.es

ANIMACIÓN 3D DEL ARTIFICIO DE JUANELO

Viaqua incorpora tres vehículos eléctricos a su flota en Ourense Viaqua, la empresa encargada de la gestión del servicio municipal del agua en la ciudad de Ourense, ha incorporado a su flota tres vehículos eléctricos que han sido presentados en un acto que ha tenido lugar en la Plaza Mayor con asistencia del alcalde, Jesús Vázquez, del concelleiro de Medio Ambiente, José Araujo Fernández, del director de Viaqua, Julio Masid Bande, y de la gerente en Ourense, Ana Tejeiro Sandomingo. Estos nuevos vehículos, tres Renault Kangoo ZE 100% eléctricos, constituyen una apuesta de la compañía en el ámbito de la innovación, el desarrollo sostenible, y la mejora del medio ambiente, contribuyendo a reducir las emisiones de CO2 a la atmósfera y a luchar contra el cambio climático. Las nuevas furgonetas disponen de una batería de ion-litio con una capacidad de 22kWH, desarrollan una velocidad máxima de 130 km/h, y tienen una autonomía invierno-verano de entre 80 y 125 km. Su consumo normalizado es de 155 Wh/km. Destacan también su motor silencioso, un interior cómodo con amplio espacio de carga y una equipación adaptada a la peculiaridad del modelo: tablero de abordo con económetro, transmisión de tipo automático sin cambio de velocidades, sistema de navegación, y dos modos de recarga: doméstica y pública. La utilización de estos vehículos ecológicos supondrá reducir las emisiones de CO2 a la atmosfera en 3,4 Tn anuales, lo que supone un 68% menos respecto a las 5,04 Tn que emitían las tres Peugeot Partner a las que sustituyen. Sirva como referencia que una tonelada de carbono en la madera de un árbol o de un bosque, equivale a 3,5 toneladas aproximadamente de CO2 atmosférico, y que cada árbol adulto captura 300 kg de CO2 al año. Viaqua www.viaqua-sa.es

30

ta 21 notis empresas.indd 30

nº 21 - Septiembre-Octubre 2016

03/11/16 15:24


suez.indd 1

31/10/16 15:52


Productos y Equipos

Variador de velocidad Xylem, especialista en tecnología del agua, lanza la quinta generación de Hydrovar, un sistema de control inteligente que se adapta con precisión a las demandas del sistema, ayudando a los usuarios finales a conseguir ahorros de costes y energía mientras que se obtiene un rendimiento óptimo del sistema. El nuevo dispositivo y control del motor pueden reducir el consumo de energía de la bomba hasta en un 70%. Capaz de hacer funcionar sistemas de hasta ocho bombas, la quinta generación de Hydrovar tiene la funcionalidad maestra en bus, permitiendo a cada bomba que tome el control si una o más unidades o sensores no están activos. Este funcionamiento continuo del sistema de presión garantiza la fiabilidad de la presión de agua a través de diversas aplicaciones residenciales, industriales y comerciales.

FÁCIL INSTALACIÓN Y PUESTA EN MARCHA Hydrovar 5, compatible con el 4, está diseñado para dar cabida a los nuevos y modernizar las instalaciones. El nuevo juego de cables incluye una cámara de cableado separada con una cubierta que proporciona acceso seguro y fácil a la instalación eléctrica, al tiempo que protege los componentes electrónicos de la unidad. El sistema de montaje clip-and-go simplifica aún más el proceso de adaptación directa. La configuración y puesta en marcha es también rápida y sencilla. El menú de puesta en marcha guía a los usuarios a través de cada paso del proceso, mientras que la pantalla LCD muestra una amplia gama de parámetros del sistema para motores estándar. Esta funcionalidad permite a los instaladores manejar más datos, lo que garantiza la programación exacta en la instalación. La quinta generación Hydrovar viene de serie con BACnet y Modbus para la perfecta integración del sistema de gestión de edificios (BMS). También está disponible Wi-Fi opcional para la conexión remota a la unidad a través de cualquier dispositivo móvil, ordenador portátil o PC.

CICLO DE VIDA DEL SISTEMA PROLONGADO, FUNCIONAMIENTO EFICIENTE Y READAPTACIÓN SENCILLA El desgaste causado por el funcionamiento normal se reduce al mínimo debido a las características innovadoras, incluyendo software de control del motor avanzado que amplía la vida útil del equipo mediante la reducción de

32

ta 21 productos.indd 32

calor. Hydrovar también tiene un filtro de distorsión armónica total (THDi) que alarga la vida total del equipo conectado a la misma red y prevención contra el recalentamiento de cables sin necesidad de filtros de reactor. Usar Hydrovar con una bomba existente puede conducir a ahorros significativos de energía, especialmente cuando trabajan con cargas parciales. Se puede adaptar de manera eficiente a cualquier bomba de motor asíncrono estándar adecuado para el funcionamiento a velocidad variable. El método de montaje directo del Hydrovar no requiere de un adaptador especial, y está disponible para los rangos de potencia de 0.55 kW a 22 kW, haciendo que el proceso de adaptación sea eficiente, fácil y rentable. Así, la quinta generación de Hydrovar varía la velocidad del motor para que coincida con las demandas del sistema, manteniendo la energía y los costes operativos bajos. Además, la suave funcionalidad de arranque y parada se adapta a la presión de acuerdo con los requisitos del sistema, que se amplía dramáticamente la vida del equipo. El diseño modular del Hydrovar activa el ajuste personalizado para cualquier configuración de bomba, y puede ser montado en la pared o en el motor. Se puede utilizar con bombas de cualquier fabricante. Las opciones de configuración incluyen la posibilidad de una única bomba y de hasta ocho unidades para satisfacer las necesidades de la aplicación. Introducido en 1995, el variador de velocidad Hydrovar ha sido continuamente actualizado, lo que confirma su legado como equipo robusto, fiable y diseñado exclusivamente para optimizar la eficiencia de la bomba de velocidad fija. Xylem Water Solutions www.xylemwatersolutions.com - www.hydrovar.com

nº 21 - Septiembre-Octubre 2016

03/11/16 15:28


MATERIAL FILTRANTE PARA EL TRATAMIENTO DEL AGUA ChiemiVall, empresa especializada en carbón activo que tras 20 años en el sector ha renovado su imagen corporativa y cuenta ahora con un nuevo logotipo empresarial, ha ampliado recientemente su cartera de soluciones con un producto revolucionario en el tratamiento de agua: el material filtrante Katalox Light. Esta novedad corresponde a una zeolita impregnada con MnO2, la cual tiene múltiples ventajas respecto a la Mn48: - Posee una superficie interna muy superior, alrededor de 300 m2/gr. Esta característica permite ofrecer poder catalítico mucho mayor y, por lo tanto, trabajar con tiempos de contacto mucho menores. - Es un producto con densidad 1,06 kg/L. Por lo tanto, al tener menor densidad que otras alternativas disponibles en el mercado se instala menos producto y la botella es menor, con su minimización de costes correspondiente. - La densidad también influye en el agua necesaria para contralavado, que es menor. - Al tratarse de una zeolita, ofrece un mayor poder de filtración. Como ejemplo de su actuación, en la foto adjunta se observa cómo se ha tratado un agua de pozo con 8 ppm de Fe, eliminando en su totalidad dicho contaminante. ChiemiVall www.carbonactivo.com

www.tecnoaqua.es

ta 21 productos.indd 33

03/11/16 15:28


Productos y Equipos

Monitorización avanzada de sondeos y pozos de agua Suez Advanced Solutions presenta IDroSmartwell, un sistema experto y avanzado que permite realizar una auditoría en continuo de la eficiencia del pozo y un análisis completo de funcionamiento del conjunto formado por bombeo y acuífero. Este sistema inteligente es capaz de calcular indicadores de eficiencia, maximiza su rendimiento (hidráulico y eléctrico) y prevé problemas que puedan afectar a la producción del agua. Entre las características del sistema IDroSmartwell destacan, entre otras: - Sensores de muy alta precisión y estabilidad. - Panel táctil para visualización de sinóptico de operación, curvas de tendencia y oscilografías. - Monitorización completa del sondeo. - Cálculo de parámetros de eficiencia, rendimientos (motor, hidráulico y global), cálculo de ratios (kW/m3 y kW/m3/m) y caudal específico. - Comunicación a través de modem 3G con posibilidad de integración en SCADA. Así mismo, las ventajas de este sistema son múltiples: - Facilita una completa y precisa información sobre el control de las masas de agua. - Permite el control de la explotación gracias al cálculo de gran cantidad de parámetros hidráulicos y eléctricos, y su gestión mediante un panel de operador. - Posibilita automatizar la instalación y controlarla de forma remota. - Consigue un ahorro de costes gracias a la reducción del índice de averías y al seguimiento continuo de ratios de eficiencia permitiendo optimizar la instalación. IdroSmartwell es una solución dentro de Well Services, la propuesta de tecnologías de Suez Advanced Solutions para la gestión optimizada y eficiente de sondeos y activos de captación de agua subterránea. Well Services se presenta en Iwater, el salón internacional del ciclo integral del agua, durante los días 15, 16 y 17 de noviembre de 2016. Este salón nace como solución a los retos del sector con una visión global de todo el ciclo integral del agua, para posicionarse como el evento de referencia internacional con un enfoque tecnólogico e innovador. Suez Advanced Solutions www.suez.es

34

ta 21 productos.indd 34

nº 21 - Septiembre-Octubre 2016

03/11/16 15:28


ACTUADOR NEUMร TICO DE PISTร N EN Tร NDEM Ademรกs de su gama actual de actuadores para vรกlvulas, Sisto Armaturen, filial de KSB en Luxemburgo, presenta su nuevo actuador magnรฉtico de efecto doble o simple de la gama Sisto-Lap-500. El actuador de pistรณn estรก diseรฑado para vรกlvulas (de globo y de compuerta) de movimiento lineal del vรกstago. Una caracterรญstica tรฉcnica especial del nuevo actuador Sisto-Lap-500 es la disposiciรณn de doble pistรณn en tรกndem empleada en un modelo diseรฑado para fuerzas de accionamiento elevadas. Esto supone que se accionan dos pistones a lo largo de un vรกstago en cรกmaras neumรกticas separadas. La combinaciรณn de un pistรณn de 500 mm de diรกmetro y una presiรณn de control de 7 bar en un diseรฑo de actuador de doble efecto permite alcanzar fuerzas de accionamiento superiores a 250.000 N. Cada pistรณn incorpora un disco con junta de perfil monolabio. Esta configuraciรณn hace posible un movimiento fluido con poca fricciรณn. El vรกstago del pistรณn estรก sellado con una junta en U y un aro rascador. Otra caracterรญstica relevante es el suministro de aire interno. Como el aire circula internamente, el tubo exterior que conecta la vรกlvula solenoide con la cรกmara del cilindro se hace innecesario. La vรกlvula solenoide se conecta al actuador mediante conexiones Namur. Los actuadores tambiรฉn estรกn disponibles con conjuntos de resortes que mueven las vรกlvulas a la posiciรณn de seguridad definida en caso de averรญa del suministro de aire comprimido. Al contrario que los actuadores convencionales de estas dimensiones, el conjunto de resortes se instala en el interior y no en el exterior de la cรกmara neumรกtica, lo que permite reducir la altura total del actuador. Asimismo, se ofrecen opcionalmente un mando manual y un tope de desplazamiento mecรกnico para las posiciones de apertura y cierre. Los medios de circulaciรณn aptos son gases secos, limpios, no inflamables y no agresivos. A peticiรณn, Sisto-Lap-500 estรก disponible en un modelo especial apto para su uso a una temperatura ambiente de hasta -40 ยฐC. KSB Spain www.ksb.es

www.tecnoaqua.es

ta 21 productos.indd 35

RSOLUCIONES AL MANEJO DE FLUIDOS Bombas neumรกticas

Bombas peristรกlticas

Filtros prensa

Bombas centrifugas autoaspirantes Bombas centrifugas plasticas Filtros de limpieza automรกtica Bombas desplazamiento positivo Lรณbulos engomados

Agitadores

Vรกlvulas de manguito

1PMร HPOP 6HBMEFHVSFO t 1BSDFMB 1 *** %FSJP 7J[DBZB

5FM t 'BY F NBJM DPNFSDJBM!DSBNJY DPN

www.cramix.com %FMFHBDJPOFT FO #BSDFMPOB .BESJE $BTUFMMร O Z 4FWJMMB

03/11/16 15:29


Productos y Equipos

ACTUADOR GIRATORIO PARA LA AUTOMATIZACIÓN DE PROCESOS

gracias a que puede montarse en cualquier posición y a que los finales de carrera de ambos lados pueden ajustarse en ±5°.

La modularidad, la resistencia y la versatilidad son las principales propiedades del actuador giratorio DFPD de Festo. Por ello, esta combinación de cremallera y piñón es el accionamiento más adecuado para cumplir con muchos de los requisitos de las industrias de procesos. Gracias a su versatilidad y flexibilidad, el DFPD llegará a ser un revulsivo en todos los sectores y mercados. Seduce gracias a su diseño moderno, sencillo y, a la vez, compacto: desde las válvulas de bola, compuertas de cierre o de ventilación en las industrias químicas, farmacéuticas o de bebidas, hasta el tratamiento de agua y otros sectores de la automatización de procesos. La combinación de cremallera y piñón es una gran aportación al mercado tanto en la versión de simple efecto como en la de doble efecto.

FLEXIBLE EN PRESIÓN DE TRABAJO La versión de simple efecto de este nuevo actuador de cuarto de vuelta es especialmente compacta y altamente modular. Gracias a un optimizado diseño de los resortes, esta versión puede configurarse en incrementos de 0,5 bar para un uso

TODO EL CONJUNTO PONE EN VALOR LA CADENA DE VALOR AÑADIDO

más eficiente. Con nueve posibles combinaciones de los diferentes de paquetes de resortes, el actuador de cuarto de vuelta DFPD puede trabajar con la presión de funcionamiento óptima requerida, desde 2 hasta 6 bar. El ángulo de giro estándar es de hasta 90° para todos los tamaños — los tamaños 40, 120, 240 y 480 son configurables hasta 180°. En la versión estándar, el DFPD es adecuado para temperaturas entre -20 y +80 °C. La variante para temperaturas extremadamente bajas está diseñada para regiones árticas y abarca un margen de temperaturas desde -50 hasta +60 °C. La variante para altas temperaturas puede utilizarse entre 0 °C y +150 °C. Gracias a los revestimientos superficiales versátiles y resistentes a la corrosión, el actuador también puede utilizarse con fiabilidad en multitud de aplicaciones con condiciones ambientales extremas. Su uso es muy flexible

En combinación con el posicionador CMSX, resulta muy adecuado para el control analógico de válvulas giratorias, por ejemplo en tareas de dosificación. Además, con las cajas de sensores SRBC/SRBE/SRBG, aparte de la simple transmisión de la posición, también es posible contar con un sencillo control digital. Esto puede implementarse tanto en exteriores como en entornos con riesgo de explosión. La nueva generación de válvulas NAMUR VSNC está certificada en todo el mundo en conformidad con todos los estándares habituales. Para aplicaciones orientadas a la seguridad, las robustas válvulas de pilotaje VOFC y VOFD son el complemento ideal. Las electroválvulas son de uso universal y cumplen con los estándares de seguridad más elevados (hasta SIL 3, protección contra explosiones). Por ello, Festo está en condiciones de suministrar la automatización completa de válvulas giratorias para las aplicaciones más diversas.

Festo www.festo.com/dpdt

SELLADOR PARA ANALÍTICAS DE LABORATORIO Idexx ha lanzado su nuevo sellador Quanti-Tray Sealer Plus, un equipo que ofrece mejoras para facilitar aún más el proceso de sellado para las analíticas de Idexx. El sellador Quanti-Tray Sealer Plus de Idexx se caracteriza por: fase de calentamiento de 2-3 minutos (un 80% más rápido que el modelo anterior); panel de fácil acceso para una limpieza más sencilla; dispone de un Sleep Mode y luces led para un menor consumo de energía. Idexx - www.idexx.es

36

ta 21 productos.indd 36

nº 21 - Septiembre-Octubre 2016

03/11/16 15:29


Productos y Equipos

EQUIPOS DE BOMBEO DE ALTA EFICIENCIA Likitech estará presente en la primera edición del nuevo salón ferial del agua de Barcelona Iwater, donde presentará principalmente el Equipo de Bombeo de Alta Eficiencia (HES) de 6" y 8" de Franklin Electric, la nueva línea de Electrobombas E-Tech, bombas centrífugas, verticales multietapa con niveles de eficiencia hidráulica según MEI 0,7 y las nuevas series de bombas centrífugas horizontales multietapa EH 15 y EH 20, que elevan hasta 20 m3 /h el caudal nominal disponible. El equipo de bombeo HES tiene como elemento destacado el motor síncrono sumergible de Franklin Electric, disponible en potencias desde 4 kW hasta 150 kW. Se trata de un motor rebobinable con un rotor de imanes permanentes, lo que permite ofrecer en todo momento un rendimiento superior a un asíncrono de la misma potencia. Ello supone un considerable ahorro energético (hasta el 20%), y lo hace especialmente recomendable para instalaciones de funcionamiento continuo, así como para aplicaciones alimentadas por energía solar, en las que cada medida para aquilatar el consumo es crucial. El sistema se complementa con un variador de frecuencia con software personalizado por Franklin Electric, un filtro a la salida del mismo y un cuerpo hidráulico E-Tech de alto rendimiento. Likiteh, S.L.U. www.likitech.com

ta 21 productos.indd 37

03/11/16 15:29


Productos y Equipos

Datalogger GPRS para la sectorización de redes de agua y lectura de contadores Lacroix Sofrel refuerza su gama de dataloggers proponiendo nuevas aplicaciones para el telecontrol y explotación de las redes agua potable. Con una gran autonomía (hasta 9 años), equipado de una antena GSM de altas prestaciones, robusta, y totalmente estanco (IP68), Sofrel LS-Flow responde a las necesidades en la sectorización de redes de agua y la lectura de contadores de grandes consumidores. La principal innovación del LS-Flow es la lectura periódica sin requerir programación (Plug and Play). Sencillo de implementar y eficaz, constituye una solución cuyas principales funciones son: - Lectura periódica de los índices, el caudal instantáneo y las alarmas de funcionamiento de los caudalímetros Aquamaster (ABB) y MAG8000 (Siemens). - Archivo y balances diarios, cálculo del caudal medio y caudal nocturno. - Comunicación GPRS y alertas por SMS. - Supervisión a distancia del correcto funcionamiento de los equipos de los explotadores.

FIABILIDAD DE LAS TRANSMISIONES DE DATOS Habitualmente, la cobertura suele ser correcta en la mayoría de los casos, pero el nivel recepción de la señal cae dramáticamente en instalaciones subterráneas. Especialista en telecomunicaciones desde hace más de 40 años, Lacroix Sofrel ha invertido mucho en el desarrollo de sus dataloggers para proporcionar una antena que hoy se refiere a sus cualidades de recepción. LS-Flow puede transmitir de manera periódica los valores históricos diarios y los informes hacia los puestos centrales, supervisores servidor OPC o LS servidor web. Y las alertas pueden enviarse cuando se supere un cauda o cambio de estado. Así, las principales características técnicas de este equipo son: - Estanqueidad IP68 (certificada 1 m de agua – 100 días). - Comunicación serie RS485 con caudalímetro. - Antena GSM/GPRS de alto rendimiento integrada. - Pila interna de litio (autonomía de 9 años). - 1 entrada analógica (AI) opcional. - Comunicación bluetooth para la explotación de datos in situ y la puesta en funcionamiento (configuración, diagnóstico, etc.) - Acceso tarjeta SIM y pila por el usuario. Sofrel España, S.L.U. www.sofrel.es

38

ta 21 productos.indd 38

nº 21 - Septiembre-Octubre 2016

03/11/16 15:29


Productos y Equipos

CONTADOR DE HASTA DN 300 Sensus, compañía especializada en soluciones de medición y gestión, ha actualizado su gama de medidores MeiStream, ampliándola hasta el DN 300. Este contador industrial se aplica para la medición de caudales medios y altos, e incluso en caudales bajos (en períodos de carga mínima), para la facturación de agua fría potable hasta 50 ºC. El contador MeiStream de Sensus dispone del certificado de conformidad MID, normativa que establece las exigencias esenciales que deben satisfacer los instrumentos de medida, estando comercializado en R100 bajo esta misma regulación, lo que supone prestaciones mejoradas respecto a la antigua clase B, a la que sustituye.

ta 21 productos.indd 39

Precisamente, Sensus ha ampliado recientemente su gama de contadores MeiStream hasta DN 300, lo que le permite ofrecer funcionalidades superiores, situándose muy por encima del resto y diferenciándose claramente en su segmento de mercado. El MeiStream proporciona, entre otras ventajas: - Una mayor capacidad de lectura del caudal. - Un control total sobre las fugas. - Gran capacidad para gestionar sobrecargas. - Facilidad de instalación en posición horizontal y vertical. - Protección IP68, que le permite sumergirlo completamente. Con la incorporación de más diámetros nominales a la gama MeiS-

tream, Sensus ofrece a sus clientes beneficios inmejorables, destacando entre ellos su alta fiabilidad y calidad, además de su excelente precisión y su fabricación con materiales más resistentes y dotados de la más alta tecnología. Sensus http://sensus.com/es/

03/11/16 15:29


Productos y Equipos

Contador de desplazamiento positivo

Sensor de nivel radar para aguas y aguas residuales

Mabeconta presenta los contadores de desplazamiento positivo Flowal Serie OR-MFE de Bopp & Reuther. Su diseño está basado en el experimentado sistema del contador de ruedas ovaladas como contador de desplazamiento positivo. La Serie OR-MFE se caracteriza principalmente por su robusto e innovador diseño y por su fácil instalación y manejo, lo que permite:

Vega Instrumentos presenta el sensor radar Vegapuls WL S 61, ideal para todas las aplicaciones sencillas en el sector del agua y las aguas residuales. Sus numerosas opciones de montaje ofrecen una solución radar adaptable, ya que se puede integrar fácilmente en las infraestructuras existentes. Al igual que el Vegapuls WL 61, introducido en el mercado hace mucho tiempo, el sensor Vegapuls WL S 61 ha sido especialmente diseñado para su aplicación en el sector del agua y las aguas residuales. En comparación con los sensores de ultrasonidos utilizados anteriormente, la tecnología radar ofrece numerosas ventajas: no se ve afectada por la temperatura, los movimientos provocados por el viento, la niebla ni la lluvia. Además, no necesita compensar el tiempo de transmisión de la señal debido a las oscilaciones de la temperatura. Con una precisión de +/-5 mm, Vegapuls WL S 61 cubre un amplio ámbito de aplicación. Este sensor es especialmente adecuado para la medición del nivel y el caudal en el tratamiento de aguas. Su excelente focalización permite su uso en estaciones de bombeo y balsas de contención, para la medición de caudal en canales abiertos y la monitorización del nivel del agua. La robusta carcasa del sensor no sufre desgaste ni requiere mantenimiento y, gracias a su elevado tipo de protección IP 68 (2 bar), también es apto para las aplicaciones en las que se debe sumergir el sensor. Los instrumentos cumplen con la versión más reciente de la norma LPR (Level Probing Radar) y están homologados sin limitaciones para su aplicación al aire libre. Una de las novedades es el funcionamiento inalámbrico por bluetooth mediante un smartphone, una tableta u ordenadores con PACTware y adaptador de bluetooth-USB, que facilitan aún más la puesta en marcha o el diagnóstico.

- Medición de caudal, volumen o masa. - Mediciones desde 0,1 L/min hasta 700 L/min - Error de medición inferior a 0,5% del valor actual. - Salida analógica y de impulsos. - Funcionamiento silencioso por ruedas ovaladas en plástico. - Conexión mediante rosca hembra. La Serie OR es una ejecución compacta con conexiones roscadas que se utiliza principalmente para la medición de líquidos como aguas, sosas, grasas, alcoholes, combustibles, aceites, disolventes, barnices, pinturas, etc. En la electrónica MFE-3 es posible efectuar una compensación de temperatura a través de un sensor opcional incorporado y se calcula la masa. El display y salida analógica dan directamente el valor en masa. Una medición fiable y económica de caudal, volumen y masa se unen en el contador Bopp & Reuther con la electrónica multifuncional MFE (indicación led de 8 dígitos/caudal instantáneo/ totalizador). Mabeconta www.mabeconta.net

Vega Instrumentos, S.A. www.vega.com

40

ta 21 productos.indd 40

nº 21 - Septiembre-Octubre 2016

03/11/16 15:29


TUBERÍA DE FUNDICIÓN DÚCTIL PARA EL TRANSPORTE DE AGUA AGRESIVA Saint-Gobain PAM España presenta la gama Pur de tuberías de fundición dúctil para el transporte de agua agresiva. Esta tubería está revestida interiormente con un recubrimiento de poliuretano de espesor mínimo de 1300 μm, conocido como Classic Pur para el mercado de abastecimiento e Integral PH 1 para saneamiento, que da respuesta cuando por la agresividad del agua transportada los revestimientos interiores convencionales son insuficientes.

La gama Pur es una tubería de fundición dúctil que está revestida interiormente con un recubrimiento de poliuretano de espesor mínimo de 1300 μm, y el aspecto final del interior del tubo es de color arena. Está disponible en los DN 150-2.000 mm. En relación a las uniones, esta gama puede ser equipada con la junta Standard y todas las juntas acerrojadas. Estas gamas con revestimientos especiales se complementan con la gama de accesorios revestidos interior y exteriormente de empolvado de epoxi azul (EN 14901), de espesor mínimo de 250 μm. Este tipo de revestimiento es adecuado para uso en suelos corrosivos y altamente corrosivos, o para el transporte de agua agresiva o corrosiva.

Saint-Gobain PAM España www.pamline.es

www.tecnoaqua.es

ta 21 productos.indd 41

03/11/16 15:29


Productos y Equipos

Plataformas de turbidez Hach lanza dos nuevas plataformas de turbidez para diferentes aplicaciones. La primera, serie TU5, es una innovadora tecnología para el tratamiento de agua potable y agua ultrapura. Con la segunda, TL23, Hach ha simplificado la medición de la turbidez para aplicaciones de turbidez alta. La plataforma de turbidez de la serie TU5 se compone tanto de turbidímetros de laboratorio como de turbidímetros en continuo y se ha diseñado para constituirse como el próximo modelo a seguir en el desarrollo de la turbidez. La plataforma ofrece los únicos turbidímetros que permiten utilizar una innovadora tecnología de detección de 360° x 90°. Esta tecnología emplea un diseño óptico que permite ver más de la muestra de lo que admite cualquier otro turbidímetro. Así, ofrece la mejor sensibilidad y precisión en rango bajo, al tiempo que reduce la variabilidad entre tests. Esta plataforma de Hach elimina, por primera vez, la incertidumbre del usuario al decidir si debe confiar en las mediciones de laboratorio o en las mediciones en continuo, gracias a que tanto los instrumentos de laboratorio como los instrumentos en continuo incorporan la misma tecnología de detección de 360° x 90°. Asimismo, todas las actividades relacionadas con la turbidez, desde el mantenimiento hasta la limpieza, pasando por la medición propiamente dicha, se realizan en menos tiempo. La serie TU5 reduce drásticamente el tiempo necesario para obtener una medición de turbidez en la que el usuario pueda confiar, con un 98 % menos de superficie en contacto con la muestra que limpiar, viales sellados para la calibración y sin tener que indexar o requerir aceite de silicona en el laboratorio. Además, un menor volumen de muestra en continuo permite detectar los eventos de turbidez casi inmediatamente.

La plataforma de turbidez de la serie TU5 proporciona tres instrumentos diferentes: uno para el laboratorio y dos para realizar mediciones en continuo. El instrumento TU5200 se utiliza en el laboratorio, mientras que los instrumentos TU5300 y TU5400 están equipados para ofrecer mediciones en continuo. La interfaz de fácil uso y el procedimiento de trabajo mejorado ponen a disposición de todos los operadores, con independencia de su capacitación, la habilidad necesaria para obtener mediciones de turbidez de gran exactitud y fiabilidad.

MEDICIÓN DE LA TURBIDEZ ALTA CON LA PLATAFORMA TL23

Hach, además, ha lanzado un nuevo turbidímetro de sobremesa para aplicaciones de turbidez alta, la serie TL23, disponible en cuatro modelos diferentes para métodos EPA e ISO y que puede medir hasta 10.000 NTU. Los nuevos turbidímetros de laboratorio cuentan con la tecnología verificada y de confianza de los turbidímetros de la serie 2100 de Hach y unas características mejoradas para simplificar los análisis. Estas características incluyen una pantalla táctil a color, un puerto USB para la transferencia de datos, autodiagnóstico para el aseguramiento de la calidad y calibración en un único punto para mediciones por debajo de 40 NTU/FNU. Además de un diseño y una configuración sencillos, el sistema óptico está diseñado para ofrecer una mayor exactitud, estabilidad de calibración y la capacidad de medir muestras de color. Los turbidímetros de la serie TL23 utilizan calibración en un único punto para mediciones por debajo de 40 NTU/FNU, lo que reduce el tiempo necesario para calibrar el dispositivo.

Hach www.es.hach.com

42

ta 21 productos.indd 42

nº 21 - Septiembre-Octubre 2016

03/11/16 15:29


Productos y Equipos

SOLUCIONES PARA EL LEVANTAMIENTO DE TAPAS DE ARQUETAS Levantar råpidamente y con seguridad una tapa de arquetas ya no es problemas gracias a los sistemas de levantamiento magnÊtico CL10 y CL11 de la empresa Italifters IbÊrica. Con sus respectivos accesorios, estas soluciones resultan ser el auxilio mås moderno en las operaciones de abertura y cierre de tapas, trampillas, rejas etc. El sistema de levantamiento magnÊtico CL10 y CL11 es una síntesis de versatilidad, eficacia, sencillez y, sobre todo, garantía de måxima seguridad. Esta gama de utensilios estå construida sobre la idea de llevar una herramienta pequeùa, ligera y fåcilmente transportable tambiÊn en vehículos de trabajo que siempre tienen muy poco espacio libre para llevar herramientas voluminosas y complejas. Los usuarios conocen bien los problemas relativos a una operación aparentemente sencilla como levantar una trampilla: peso, posibles lesiones en la espalda, tapas bloqueadas por asfalto, arena, oxidación, difícil recolocación, ademås de la gran variedad de tipos de tapas que se pueden encontrar que obligan a disponer de varios y complicados sistemas de enganche de las trampillas. Todos estos problemas se solucionan con el sistema multifuncional compuesto por CL10 - CL11 - PM500 - APS90 - APS80, que se adapta a la mayoría de las condiciones siendo utilizable para el levantamiento en diferentes modos. El sistema de levantamiento combinado CL10 CL11 - PM500 – Kit de ganchos y carro con palanca APS90 es, probablemente, el mås completo, versåtil y fåcilmente transportable en su gÊnero y no puede faltar hoy en día en el equipamiento de equipos de trabajo modernos. El conjunto de artículos del sistema de levantamiento permite a la empresa utilizadora reducir al mínimo los riesgos causados por la manipulación manual de carga, así como cumplir con lo marcado por el Real Decreto 487/1997, de 14 de abril, sobre las disposiciones mínimas de seguridad y salud relativas a la manipulación manual de cargas. Italifters IbÊrica www.italiftersiberica.com/

www.tecnoaqua.es

ta 21 productos.indd 43

Su partner en soluciones de filtraciĂłn para el agua, medioambiente y energĂ­a.

MEMBRANAS

CARTUCHOS

& ! "

para instalar.

SOLUCIONES DE FILTRACIĂ“N

OTRAS APLICACIONES

Desarrollamos procesos y soluciones para diferentes aplicaciones y mercados.

% % % % ( % # ( ' % ( # % % ( " ( de productos. % % $ ' % ' "

www.likuidnanotek.com

03/11/16 15:29


Productos y Equipos

MEMBRANAS PARA EL TRATAMIENTO DE AGUAS INDUSTRIALES COMPLEJAS Dow Water & Process Solutions, una unidad de negocio de The Dow Chemical Company, presenta una nueva línea de productos que ayudan a los usuarios industriales de agua maximizar la recuperación de este elemento y minimizar su desperdicio. Se trata de la nueva familia de productos Dow Filmtec Fortilife de soluciones de ósmosis inversa y nanofiltración. Esta nueva línea de productos se ha diseñado específicamente para el reto que supone ofrecer a los usuarios industriales una opción fiable y asequible que les ayude a solventar sus necesidades más acuciantes en cuestiones hídricas. La tecnología Filmtec proporciona una fiabilidad sin igual en la industria, una capacidad de limpieza excepcional y, por supuesto, las membranas más robustas. La nueva familia Fortilife combina las ventajas de esa tecnología con mejoras especialmente concebidas para las aguas y las aplicaciones más exigentes. Para Alexander

Lane, director comercial de EMEA de Dow Water & Process Solutions, "con la nueva línea de productos, Dow puede ayudar a reducir los costes asociados al agua, alcanzar objetivos de sostenibilidad, minimizar los problemas de bioincrustación y lograr la transición a un entorno con un vertido mínimo de líquidos" (MLD, del inglés minimal liquid discharge). Esta línea de productos consta de cuatro nuevos elementos que ayudan a satisfacer las necesidades de los clientes para el tratamiento de aguas complejas en diversos mercados, como la generación eléctrica a partir de hidrocarburos o las industrias química y petroquímica, del acero y del metal, y textil. Los productos son los siguientes: - Elemento Dow Filmtec Fortilife CR100. Diseñado específicamente para plantas en las que la bioincrustación es un problema. Este elemento permite disminuir las limpiezas en hasta un 50% y, al mismo tiempo, mejora sus resultados, además de reducir los costes energéticos en hasta un 10%. - Elementos Dow Filmtec Fortilife XC70, XC80 y XC-N. Aportan ventajas a aquellas plantas que tratan de minimizar los costosos residuos concentrados, reducir los gastos de explotación y alcanzar los objetivos marcados en materia de MLD. Entre las muchas ventajas de estos productos, cabe destacar que ayudarán a maximizar la recuperación de agua en aplicaciones relacionadas con el MLD y a minimizar los gastos de explotación diarios. Dow Water & Process Solutions www.dowwaterandprocess.com

Válvula de esfera para manguera Genebre presenta la nueva válvula de esfera para manguera con dos salidas (referencia 3059D), fabricada en latón y que permite una temperatura de trabajo desde -20 ºC a +100 ºC. Las principales características de esta válvula son: válvula de esfera para conexión manguera con dos salidas; construcción en latón según UNE-EN 12165 cromado; entrada rosca gas (BSP) macho s/ ISO 228/1; salida racor de dos piezas con difusor para conectar manguera y salida rosca macho 3/4" (medida disponible: ½" x ¾" x ¾"); accionamiento mediante palanca de acero; doble tórica en el eje; asientos PTFE; temperatura de trabajo desde -20 ºC a 100 ºC; presión máxima de trabajo 16 bar (PN-16); dispositivo para bloqueo en abierto y cerrado con candado; y 250 gr de peso. Grupo Genebre www.genebre.es

44

ta 21 productos.indd 44

nº 21 - Septiembre-Octubre 2016

03/11/16 15:29


brenntag.indd 1

31/10/16 15:52


Artículo Técnico

Estudio del proceso biológico de nitrificación en una EDAR de baja carga mediante el análisis de las correlaciones entre parámetros microbiológicos, fisicoquímicos y operacionales La depuración de aguas residuales se basa principalmente en procesos biológicos. Para lograr una operación eficiente de las estaciones depuradoras de aguas residuales (EDAR), particularmente en el proceso de la nitrificación, es necesario adquirir una visión integrada del complejo ecosistema artificial que es el fango activo, estudiando las características de cada uno de los elementos, tanto de la biocenosis como del biotopo, y descubriendo las interrelaciones entre todos ellos. Para ello es necesario contar con medios asequibles e integrables en el trabajo rutinario. Los datos obtenidos con este tipo de medios han permitido corroborar la evidencia científica existente acerca de que la nitrificación está fuertemente condicionada por la relación carbono-nitrógeno en el afluente tratado, que afecta a la competencia que se establece entre los microorganismos heterótrofos y autótrofos. Sin embargo, en el caso concreto de la EDAR estudiada, ni la cantidad de bacterias nitrificantes ni la abundancia relativa de diferentes grupos de protistas son un indicador seguro de la eficiencia del proceso de nitrificación. Palabras clave EDAR, fango activo, eliminación de nitrógeno, bacterias nitrificantes, protistas.

STUDY ON BIOLOGICAL NITRIFICATION IN A LOW LOAD WWTP BY ANALYZING CORRELATIONS BETWEEN MICROBIOLOGICAL, PHYSICOCHEMICAL AND OPERATIONAL PARAMETERS The wastewater treatment is mainly based on biological processes. For efficient operation of the WWTPs, particularly in the process of nitrification, an integrated view of complex artificial ecosystem that is the activated sludge must be acquired, studying the characteristics of each of the elements of both biotope and biocenosis as discovering the interrelationships between them. This requires having affordable and integrated into the routine work means. The data obtained with this type of media has corroborated the existing scientific evidence that nitrification is strongly conditioned by the carbonnitrogen ratio in the treated influent, which affects competition established between autotrophic and heterotrophic microorganisms. However, in the studied WWTP, neither the amount of nitrifying bacteria nor the relative abundance of different groups of protists are reliable indicators of the efficiency of the nitrification process. Keywords WWTP, activated sludge, nitrogen removal, nitrifying bacteria, protists.

46

ta 21 at microbiologia.indd 46

Julio Antonio Pérez gerente del Departamento de Depuración de Acciona Agua Pilar Suárez Corteguera jefa de Planta en la EDAR Baiña de Acciona Agua Angelina García Álvarez jefa de Laboratorio en la EDAR Baiña de Acciona Agua Jaime Fernández López estudiante del Máster Internacional en Operación y Mantenimiento de Plantas de Tratamiento de Aguas del Colegio de Químicos de Asturias y León y la Universidad de Oviedo Clara Huerta Rodríguez analista de Laboratorio en la EDAR Baiña de Acciona Agua María Remedios López Pacetti técnica del Departamento de Depuración de Acciona Agua

nº 21 - Septiembre-Octubre 2016

02/11/16 08:15


Estudio del proceso biológico de nitrificación en una EDAR de baja carga mediante el análisis de las correlaciones entre parámetros microbiológicos, fisicoquímicos y operacionales

1. INTRODUCCIÓN Han pasado más de cien años desde que Edward Ardern y William T. Lockett presentaron el proceso de fangos activos, pero las tecnologías de tratamiento biológico de aguas residuales basadas en la intensificación de los procesos microbianos naturales de descomposición de la materia orgánica siguen siendo las más extendidas y están consideradas como las más aceptables económica y ambientalmente (Kallistova et al., 2014). El funcionamiento adecuado de los procesos de nitrificación y desnitrificación también es importante desde el punto de vista de la optimización del consumo energético, el control de emisiones de gases de efecto invernadero y la valorización agrícola de lodos, entre otros aspectos.

1.1. EL FANGO ACTIVO: UN ECOSISTEMA COMPLEJO El reactor biológico de una EDAR se puede considerar como un ecosistema artificial (Madoni y Ghetti, 1981) con una biocenosis formada por una amplia diversidad de organismos, incluyendo bacterias, hongos, algas, protozoos o pequeños metazoos; y un biotopo que comprende el espacio físico del reactor y las condiciones ambientales que en él se establecen. Los microorganismos más abundantes en el fango activo son los heterótrofos, que utilizan la materia orgánica presente en las aguas residuales como fuente de carbono para formar biomasa celular y para reproducirse. Sin embargo, la nitrificación es un proceso microbiológico en dos etapas llevado a cabo por organismos quimiolitoautótrofos, que utilizan el CO2 como fuente de carbono, el amonio o el nitrito como donador de electrones y el oxígeno como aceptor final de electrones.

www.tecnoaqua.es

ta 21 at microbiologia.indd 47

En una primera etapa, las bacterias oxidantes de amonio (BOA) oxidan el amonio a nitrito, mientras que en la segunda etapa el nitrito es oxidado a nitrato por las bacterias oxidantes de nitrito (BON). Las respectivas reacciones de oxidación del nitrógeno están catalizadas por las enzimas amonio monooxigenasa e hidroxilamina óxido-reductasa en las BOA y por la nitrito óxido-reductasa en las BON (Madigan et al., 2015). La eliminación biológica de nitrógeno se completa con la etapa de desnitrificación, mediante el cual el nitrato, en presencia de carbono orgánico y ausencia de oxigeno, es reducido a nitrógeno molecular gas en un proceso en el que intervienen mayoritariamente organismos heterótrofos, aunque también pueden participar algunos autótrofos (Metcalf & Eddy, Inc., 2003).

1.2. EL ANÁLISIS MICROBIOLÓGICO DEL FANGO ACTIVO: EVOLUCIÓN HISTÓRICA El principal escollo para el estudio de la microbiología de los fangos activos es la dificultad que existe para identificar y cuantificar los organismos presentes. La identificación de bacterias se ha basado durante muchos años en métodos de cultivo y en la observación directa mediante técnicas convencionales de microscopía óptica. Los métodos tradicionales de cultivo son inadecuados para identificar a los principales microorganismos del fango activo, ya que solo entre el 10% y el 15% de estos forman colonias en placas de agar nutritivo (Wagner, 2005). Asimismo, los análisis del fango activo mediante microscopía óptica convencional, basados en la combinación de características morfológicas y tinciones inespecíficas, tienen muchas limitaciones (Snaidr y Beimfohr, 2001).

Esta complejidad analítica ha derivado en un sesgo histórico en lo que se refiere a la identificación de las especies bacterianas que intervienen en procesos como la nitrificación y la desnitrificación. Desde los estudios de Winogradski (1890) se ha venido considerando a Nitrobacter spp. como el principal microorganismo oxidante del nitrito. Del mismo modo, Nitrosospira spp. fue considerado el organismo clave en el proceso de oxidación del amonio (Prosser, 1989), y el género Hyphomicrobium era identificado como el principal organismo desnitrificante (Timmermans y Van Haute, 1983). Mediante técnicas moleculares, como la hibridación in situ con sondas marcadas con fluorocromos (FISH), que se unen a secuencias específicas del ARNr 16S, se han podido identificar nuevos organismos con un papel clave en el ciclo del nitrógeno en los fangos activos de la mayoría de las EDAR (Sheik et al., 2014). Así, se encontraron poblaciones diversas de organismos oxidantes de amonio, siendo el género Nitrosomonas el más abundante en sistemas de fangos activos (Wagner et al., 1995). Igualmente, se han reconocido bacterias desnitrificantes pertenecientes a los géneros Aquaspirillum, Azoarcus y Thauera (Thomsen et al., 2007), y microorganismos similares a Nitrospira como principales oxidantes de nitritos (Juretschko et al., 1998; Schramm et al., 1999; Daims et al., 2001; Maixner et al., 2006; Spieck et al., 2006), aunque estudios recientes desvelan el papel destacado de Candidatus Nitrotoga arctica y otras bacterias fisiológicamente semejantes como oxidantes de nitritos en algunas EDAR (Lücker et al., 2015). También se ha demostrado la capacidad que tienen las ar-

47

02/11/16 08:15


Artículo Técnico

queas del filo Thaumarchaeota para catalizar la oxidación aeróbica del amonio (Park et al., 2006), y se han podido referir nuevas capacidades fisiológicas de algunos microorganismos, siendo la más significativa la de llevar a cabo la oxidación anaeróbica del amonio (anammox) por parte de algunos miembros del filo Planctomycetes (Strouss et al., 1999). Además de hacer posible la identificación de un gran número de especies de microorganismos en los fangos activos de las EDAR, las técnicas moleculares basadas en las secuencias de ARNr 16S permiten conocer con mayor precisión las relaciones filogenéticas existentes entre los diferentes microorganismos (Figura 1). Filogenéticamente, las BOA conocidas se incluyen en el filo Proteobacteria, dentro de las clases Beta- (Nitrosomonas, Nitrosospira) y Gammaproteobacteria (Nitrosococcus) (Purkhold et al., 2000). También existen arqueas oxidantes de amonio (AOA), pertenecientes a géneros como Nitrosopumilus, Nitrosocaldus, Nitrosoarchaeum o Nitrososphaera, incluidos en el filo Thaumarchaeota (Park et al., 2006; Stahl y de la Torre, 2012). Las AOA predominan en ecosistemas naturales y el algunos tipos de EDAR que se caracterizan por los bajos niveles de amonio (Sauder et al., 2012). Por su parte, todas las BON conocidas pertenecen ya sea al filo Proteobacteria (Teske et al., 1994) o al género Nitrospira del filo Nitrospirae (Ehrich et al., 1995). Las técnicas moleculares son muy esclarecedoras en el estudio microbiológico del fango activo, pero su aplicación rutinaria en las EDAR es difícil por su complejidad. Para el análisis de parámetros microbiológicos que no pueden ser fácilmente determinados mediante técnicas convencionales se puede recurrir a

48

ta 21 at microbiologia.indd 48

FIGURA 1. Árbol filogenético simplificado donde se muestran las relaciones entre los principales grupos bacterianos implicados en la eliminación de nitrógeno.

métodos más sencillos, como la tecnología VIT (Vermicon Identification Technology), que es una versión simplificada y estandarizada de la técnica FISH que simplifica su integración en el trabajo rutinario del laboratorio de la planta.

1.3. INFLUENCIA DEL BIOTOPO Y LA BIOCENOSIS EN LA NITRIFICACIÓN Dentro de la biocenosis del fango activo, además de las bacterias y otros microorganismos con una función preeminentemente descomponedora, existen organismos consumidores, entre los que se encuentran principalmente los protistas. Entre consumidores y descomponedores se establecen relaciones tróficas que juegan un papel destacado en los procesos de depuración biológica (Madoni, 2003). En las EDAR con eliminación de nitrógeno, los ciliados son el grupo de protistas con la mayor diversidad de especies, aunque no el más abundante (Pérez-Uz et al., 2010). En las EDAR con alto rendimiento de eliminación de nitrógeno, los protistas ciliados más abundantes son los sésiles del género Vorticella y reptantes del género Aspidisca y Euplotes. Los ciliados suctores, como Tokophrya y

Acineta, también son característicos de estas EDAR, aunque su abundancia es menor. En sistemas con rendimiento bajo, los ciliados sésiles más abundantes pertenecen al género Epistylis (Serrano et al., 2008), y los filofaríngeos, como Chilodonella y Trochilia, reemplazan a Aspidisca y Euplotes (Pérez-Uz et al., 2010). En sistemas de fangos activos con eliminación de nutrientes, las tecamebas del género Arcella están asociadas a una buena eficiencia en la eliminación de nitrógeno, siendo buenos indicadores de la operación de estos sistemas (Pérez-Uz et al., 2010). Las amebas pequeñas por el contrario se asocian a una deficiente eliminación de nitrógeno. Igualmente, la densidad de la población de pequeños flagelados en el reactor biológico se correlaciona directamente con la deficiencia la eliminación de nitrógeno (Serrano et al., 2008), siendo los bodónidos el grupo más representativo (Pérez-Uz et al., 2010). Sin embargo, los flagelados de gran tamaño se asocian con efluentes de buena calidad. Las dimensiones y la configuración del reactor influirán directamente en el tiempo de retención hidráulico, que se correlaciona directamente con la capacidad de nitrificación

nº 21 - Septiembre-Octubre 2016

02/11/16 08:15


Estudio del proceso biológico de nitrificación en una EDAR de baja carga mediante el análisis de las correlaciones entre parámetros microbiológicos, fisicoquímicos y operacionales

(Zornoza et al., 2014). Pero indirectamente también influyen en otros parámetros, como la temperatura, el oxígeno disuelto o la carga másica (Pöpel y Fischer, 1998). Diversos factores ambientales y operacionales del reactor influyen en la cinética de la nitrificación, como son la concentración de oxígeno disuelto, el pH, la temperatura, el tiempo de retención celular o edad del fango, la relación DBO5/NTK, la disponibilidad de sustrato, la inhibición por producto o la presencia de productos químicos tóxicos (Bitton, 2011), si bien los factores más importantes que afectan a la actividad y el tamaño de la población de bacterias nitrificantes y la eficacia del proceso de nitrificación son la temperatura y la edad del fango (Gerardi, 2006). Este estudio tiene como objetivo investigar la complejidad ecológica de un fango activo, analizando las correlaciones existentes entre la abundancia de diferentes microorganismos (bacterias nitrificantes,

protistas y metazoos) y los valores de parámetros fisicoquímicos y operacionales representativos relacionados con la eficiencia de eliminación de nitrógeno. Todo ello en el caso particular de una EDAR que tiene como principal particularidad el trabajar en cargas másicas bajas, y en comparación con los resultados de otros estudios más exhaustivos y que abarcan rangos más amplios de investigación. Se evalúa la eficacia para el control del proceso de los controles paramétricos ya implantados u otros adicionales con una relación coste-eficacia asumible por el operador.

que vierte su efluente, de modo que sean aptas para la vida de los salmónidos. La planta se caracteriza por trabajar con baja carga másica, con una relación sustrato/microorganismos inferior a 0,1 kg DBO 5/ kg SSVLM·día. El proceso de fangos activos debe conseguir, además de la oxidación de la materia carbonada, la de los compuestos nitrogenados, nitrógeno orgánico y nitrógeno amoniacal, consiguiendo su paso a nitratos y el de estos a nitrógeno gaseoso en la fase de desnitrificación, que tiene lugar en una zona anóxica en cabeza de las cubas de aireación. El rendimiento de eliminación de nitrógeno es superior al 90%.

2. MATERIAL Y MÉTODOS 2.2. MUESTRAS Y PARÁMETROS 2.1. CARACTERÍSTICAS DE LA INSTALACIÓN La EDAR en la que se realizó este estudio está diseñada para una población de 85.000 habitantes equivalentes, con unas características encaminadas a lograr un objetivo de calidad de las aguas en el río al

FIGURA 2. Ejemplos de imágenes de bacterias nitrificantes obtenidas mediante microscopía de epifluorescencia: BOA (izquierda) y BON (derecha), mismo campo, 1000X.

El estudio se realizó en los meses de abril y mayo de 2015, analizándose un total de 12 muestras repartidas a lo largo de ese periodo. Los parámetros microbiológicos se analizaron en muestras de licor mezcla tomadas de forma puntual al final de la aireación del tratamiento biológico. Los correspondientes datos de parámetros operacionales y fisicoquímicos se obtuvieron de los controladores automáticos instalados en la planta y de los análisis diarios que se realizan en el laboratorio de la EDAR, utilizando procedimientos basados en métodos normalizados. Para la determinación de parámetros fisicoquímicos se toman muestras compuestas de 24 horas, mediante tomamuestras automático, del afluente y el efluente del reactor biológico.

2.3. IDENTIFICACIÓN Y CUANTIFICACIÓN DE MICROORGANISMOS La observación en vivo para el recuento de los diferentes grupos de protistas y metazoos presentes en el

www.tecnoaqua.es

ta 21 at microbiologia.indd 49

49

02/11/16 08:15


Artículo Técnico

TABLA 1 CRITERIOS DE ABUNDANCIA DE MICROORGANISMOS SEGÚN LAS CLAVES VIT Categoría numérica Criterio de abundancia 1

Pocos

2

Algunos

3

Muchos

4 5

ta 21 at microbiologia.indd 50

Según clave fotográfica VIT key

Abundantes Excesivos

licor mezcla se realizó mediante un microscopio Leica, modelo DM750, utilizando tanto la técnica de campo claro convencional como el contraste de fases. El procedimiento se basó fundamentalmente en la metodología desarrollada por la Asociación Científica Grupo Bioindicación Sevilla (Rodríguez et al., 2003). Aunque la capacidad indicadora se incrementa al pasar de niveles taxonómicos superiores a inferiores, la determinación de especies o taxones inferiores es difícil en el control rutinario de la planta, y generalmente la información obtenida al estudiar niveles taxonómicos superiores al de especie ya es representativa (Salvadó et al., 1997). Las bacterias nitrificantes se analizaron mediante el kit comercial Nitri-VIT de Vermicon AG. El kit contiene una mezcla de sondas de ADN complementarias a regiones específicas del ARNr 16S de determinados géneros de BOA (Nitrosomonas, Nitrosococcus, Nitrosospira) y de BON (Nitrobacter, Nitrospira) (Woznica et al., 2013). Para la observación mediante técnica de epifluorescencia de todas las muestras tratadas con la tecnología VIT se empleó el mismo microscopio Leica DM750, que incorpora un sistema de iluminación con lámpara de mercurio de 100 W y cuenta con un sistema de adaptación para filtros de preexcitación y de emisión. Con este test las BOA bri-

50

Descripción

llan en rojo bajo luz verde y las BON brillan en verde cuando se iluminan con luz azul (Figura 2). En los análisis realizados mediante los kits VIT, la cuantificación de microorganismos se efectúa mediante la observación a 1.000 aumentos de 20 campos visuales al azar en la preparación, asignando a cada uno un valor numérico entre 1 y 5 (Tabla 1), según el parecido con las fotografías numeradas que aparecen en la clave VIT key que corresponde al test. El resultado final será la media aritmética, resultante de dividir la suma de los valores obtenidos para cada campo visual entre el número total de campos analizados. Este tipo de análisis semicuantitativo permite obtener resultados de manera sencilla, ya que no requiere tecnología ni procesos adicionales, pero basado en apreciaciones subjetivas. Existen técnicas de cuantificación de biomasa bacteriana que permiten eliminar este componente subjetivo (Borrás, 2008; Salvadó et al., 2013).

2.4. TRATAMIENTO ESTADÍSTICO DE LOS DATOS El tratamiento estadístico de los datos obtenidos se ha realizado mediante los programas informáticos Microsoft Excel 2010 e IBM SPSS Statistics versión 20. Se han realizado correlacionas bivariadas aplican-

do el coeficiente de correlación de Spearman, que se utiliza para analizar variables discretas o en aquellos casos en que los datos no siguen una distribución normal. Esta correlación mide cómo están relacionadas linealmente dos variables, y los valores que puede adoptar el coeficiente están comprendidos entre +1 y -1. El valor +1 identifica una relación lineal directa perfecta y el valor -1 una relación lineal inversa perfecta. El valor 0 indica ausencia total de correlación entre las variables. Los p-valores iguales o inferiores a 0,01 indican una relación estadísticamente significativa al 99%, y cuando el p-valor es igual o inferior a 0,05 el nivel de significación es del 95%. No obstante, la existencia de correlación entre dos variables no implica causalidad, ya que pueden existir múltiples variables implicadas en el mismo fenómeno. Para una mayor profundización en las relaciones ecofisiológicas del fango activo sería necesario recurrir a técnicas estadísticas más avanzadas, como son las técnicas de análisis multivariante no paramétricas, aplicando modelos lineales basados en la distancia, y técnicas de ordenación canónica, como el análisis de redundancia y el análisis de correspondencias canónico (Zornoza, 2015).

3. RESULTADOS Y DISCUSIÓN 3.1. PARÁMETROS FISICOQUÍMICOS Y OPERACIONALES En la Tabla 2 se muestran los valores medios y la desviación estándar de los parámetros fisicoquímicos del afluente y el efluente del reactor biológico durante el tiempo del estudio. Asimismo, en la Tabla 3 se resumen las características de operación y fisicoquímicas más representativas del reactor biológico.

nº 21 - Septiembre-Octubre 2016

02/11/16 08:15


Estudio del proceso biológico de nitrificación en una EDAR de baja carga mediante el análisis de las correlaciones entre parámetros microbiológicos, fisicoquímicos y operacionales

3.2. PARÁMETROS MICROBIOLÓGICOS

TABLA 2 CARACTERÍSTICAS FISICOQUÍMICAS DEL AFLUENTE Y EL EFLUENTE Afluente Parámetros

Unidades

Efluente

Media

Desviación estándar

Media

Desviación estándar

pH

ud. pH

7,4

0,1

7,5

0,1

Oxígeno disuelto

mg/L

1,58

0,32

5,84

0,23

Conductividad

μS/cm

679

57

587

71

ºC

14,9

0,7

16,6

0,8

Sólidos en suspensión

mg/L

45

19

3

1

DBO5

mg/L

68

29

3

1

DQO

mg/L

116

47

21

1

N-NH4+

mg/L

11,73

2,59

0,20

0,61

N-NO3

-

mg/L

0,51

0,18

7,86

1,09

NTK

mg/L

16,86

2,95

1,47

0,55

Nitrógeno total

mg/L

17,37

2,84

9,33

1,04

Temperatura

TABLA 3 CARACTERÍSTICAS OPERACIONALES Y FISICOQUÍMICAS EN EL REACTOR BIOLÓGICO Parámetros

Unidades

Temperatura

ºC

16,2

0,8

Oxígeno disuelto mínimo

mg/L

1,15

0,18

Oxígeno disuelto máximo

mg/L

2,14

0,43

pH

ud. pH

7,2

0,1

SSLM

mg/L

1.863

147

SSVLM

mg/L

1.464

107

SSVLM

%

78,6

0,97

kg DBO5 / kg SSVLM · d

0,12

0,03

días

16,0

5,2

Carga másica Edad del fango

Media Desviación estándar

A lo largo del estudio, la abundancia relativa de las BOA siempre fue superior a la de las BON, manteniéndose una proporcionalidad entre ambas (Tabla 4). La bibliografía indica que la tasa de crecimiento de las bacterias nitrito-oxidantes es superior a la de las amonio-oxidantes y, por tanto, la etapa limitante en la nitrificación es la conversión de amonio en nitrito (Bitton, 2011; Metcalf & Eddy, Inc., 2003). Pero, a partir de una temperatura de 20 ºC, la tasa de crecimiento de las BOA es del orden de 3 veces mayor que la de las BON (Baquerizo et al., 2013), aunque la temperatura en el reactor durante el estudio no superó los 18 ºC. Cabe señalar que se utilizó un kit que no incluía la sonda específica para la BON Candidatus Nitrotoga arctica, que sí está presente en la nueva versión de Nitri-VIT. En todos los recuentos de microfauna el grupo funcional dominante son los ciliados sésiles, o bien los reptantes (Figura 3), siendo la densidad total de la microfauna ampliamente superior a 106 individuos/L. En todas las muestras se han observado más de 10 unidades taxonómicas diferentes y el recuento de pequeños flagelados siempre ha

FIGURA 3. Ejemplos de los protozoos más abundantes en el fango activo durante el estudio: Epistilys sp. (A) y Vorticella sp. (B).

TABLA 4 DATOS DE ABUNDANCIA DE BOA Y BON OBTENIDOS EMPLEANDO LA CLAVE VISUAL VIT KEY CORRESPONDIENTE AL KIT NITRI-VIT Abundancia media (1-5)

Desviación estándar

BOA

3,65

0,18

BON

2,21

0,40

Parámetro

www.tecnoaqua.es

ta 21 at microbiologia.indd 51

Correlación Coeficiente de Spearman 0,721 (p = 0,043)

51

02/11/16 08:15


Artículo Técnico

TABLA 5 ABUNDANCIAS DE PROTISTAS Y METAZOOS Especie

Media (ind./mL)

Desviación estándar

%

Litonotus sp.

88

121

1,2

Acineria sp.

40

89

0,6

Aspidisca sp.

742

334

10,2

Chilodonella sp.

712

112

9,8

Euplotes sp.

750

116

10,3

Epistilys sp.

1.158

138

15,9

Vorticella campanula

230

136

3,2

Vorticella convallaria

974

241

13,4

Acineta sp.

120

133

1,7

Peranena sp.

224

231

3,1

Amebas desnudas

324

300

4,5

Arcella sp.

260

193

3,6

Euglypha sp.

430

263

5,9

Otras tecamebas

120

268

1,7

Lecanus sp.

6,28

171

8,6

Philodina sp.

420

111

5,8

Rotaria sp.

48

107

0,7

Grupo Ciliados nadadores carnívoros

Ciliados reptantes

Ciliados sésiles

Ciliados suctores Grandes flagelados

Rizópodos

Rotíferos

sido menor de 10. Con estos datos, en el cálculo del índice biótico del fango (SBI) siempre se ha obtenido un valor de 9 o 10, correspondiente a una clase I de calidad, que indica un fango estable y muy bien colonizado, excelente actividad biológica; muy buen funcionamiento (Madoni, 1994). En la Tabla 5 se muestran los valores medios de las abundancias, expresadas en individuos/mL, y frecuencias de aparición de las especies de protistas y metazoos.

3.3. CORRELACIONES ENTRE PARÁMETROS Los resultados de los análisis de correlación entre la abundancia de microorganismos nitrificantes y diferentes parámetros fisicoquímicos y operacionales se resumen en las Tablas

52

ta 21 at microbiologia.indd 52

6, 7 y 8. A continuación se detallan los hallazgos más significativos. Se observaron correlaciones negativas moderadas (p = 0,026) entre la abundancia de bacterias nitrificantes y la relación DQO/NTK en el afluente, es decir, la fracción de organismos nitrificantes tiende a disminuir cuando la relación DQO/ NTK aumenta. Sin embargo, aunque también se pone de manifiesto esta misma tendencia respecto a la relación DBO5/NTK, no puede considerarse significativa con los datos obtenidos (p = 0,086). El proceso de la nitrificación está muy influenciado por la competencia por los sustratos que se establece entre las poblaciones de microorganismos autótrofos y heterótrofos. El aumento de la proporción de nitrógeno asimilable frente a materia orgánica asimilable favorece el crecimiento de las bacterias autótrofas frente a las heterótrofas en la zona óxica del reactor (Baquerizo et al., 2013).

TABLA 7 VALORES DEL COEFICIENTE DE CORRELACIÓN DE SPEARMAN ENTRE BACTERIAS NITRIFICANTES Y CARACTERÍSTICAS OPERACIONALES Y FISICOQUÍMICAS EN EL REACTOR BIOLÓGICO Parámetro

BOA

BON

BOA+BON

Temperatura

0,021

-0,054

-0,114

Oxígeno disuelto mínimo

0,467

0,259

0,438

Oxígeno disuelto máximo

0,065

-0,042

0,070

pH

-0,441

-0,347

-0,463

SSLM

-0,456

-0,300

-0,483

SSVLM

-0,371

-0,162

-0,360

SSVLM (%)

0,314

0,294

0,396

Carga másica

-0,093

-0,217

-0,210

Edad del fango

0,542

0,219

0,466

Rendimiento eliminación NH4+

-0,175

-0,164

-0,278

Rendimiento eliminación NTK

0,076

0,248

0,081

nº 21 - Septiembre-Octubre 2016

02/11/16 08:15


Estudio del proceso biológico de nitrificación en una EDAR de baja carga mediante el análisis de las correlaciones entre parámetros microbiológicos, fisicoquímicos y operacionales

TABLA 6 VALORES DEL COEFICIENTE DE CORRELACIÓN DE SPEARMAN ENTRE BACTERIAS NITRIFICANTES Y PARÁMETROS DEL AFLUENTE Y EL EFLUENTE. NOTA: * La correlación es significativa al nivel 0,05 (bilateral) Muestra

Afluente

Efluente

Parámetro

BOA

BON

BOA+BON

pH

0,266

0,421

0,037

Oxígeno disuelto

0,491

0,281

0,329

Temperatura

-0,021

-0,054

-0,114

Sólidos en suspensión

-0,495

-0,389

-0,536

DBO5

-0,516

-0,434

-0,550

DQO

-0,519

-0,455

-0,574

N-NH4+

-0,204

-0,116

-0,189

N-NO3-

-0,158

-0,019

-0,004

NTK

-0,293

-0,113

-0,250

Nitrógeno total

-0,309

-0,151

-0,277

DBO5/NTK

-0,490

-0,419

-0,516

DQO/NTK

-0,582*

-0,532

-0,637*

pH

-0,431

-0,171

-0,249

Oxígeno disuelto

-0,512

-0,452

-0,578*

Temperatura

0,033

-0,025

-0,090

Sólidos en suspensión

0,446

0,401

0,540

DBO5

0,441

0,446

0,587*

DQO

0,418

0,412

0,506

N-NH4+

0,114

0,070

0,135

N-NO3-

-0,081

0,060

-0,004

NTK

-0,073

-0,285

-0,152

Nitrógeno total

-0,091

-0,053

-0,056

DBO5/NTK

0,170

0,494

0,395

DQO/NTK

0,174

0,338

0,238

También se obtuvo una correlación negativa significativa entre la abundancia de bacterias nitrificantes en el licor mezcla y el oxígeno disuelto en el efluente, siendo positiva la correlación entre nitrificantes y DBO5 de salida. Una mayor abundancia de nitrificantes supone una disminución de la abundancia relativa de bacterias heterótrofas, que implicaría un menor consumo de oxígeno y una menor eliminación de materia orgá-

www.tecnoaqua.es

ta 21 at microbiologia.indd 53

nica fácilmente biodegradable (Baquerizo et al., 2013). Aunque la temperatura en el reactor biológico es el factor operacional que más influye en el crecimiento de las bacterias nitrificantes (Zornoza et al., 2014), la correlación observada fue baja. Probablemente sea debido a la escasa oscilación de la temperatura en el reactor a lo largo del tiempo del estudio, con una media de 16,2 ºC y que no bajó de 15 ºC ni

superó los 18 ºC, manteniéndose la edad del fango promedio en los 16 días. Se estima que aproximadamente el 50% de la capacidad del proceso de fangos activos para nitrificar se pierde a los 15 °C (Gerardi, 2006), aunque esta pérdida de rendimiento se puede contrarrestar modificando otros parámetros operacionales, por ejemplo incrementando la edad del fango. El valor de pH en el licor mezcla no presentó asociación significativa con la abundancia de bacterias nitrificantes. Se sabe que el rango de pH para el desarrollo de la actividad de los microorganismos nitrificantes está entre 7,2 y 8,0, siendo 6,5 el valor mínimo aconsejable (Baquerizo et al., 2013), si bien Gerardi (2006) señala que la mayoría de los procesos de fangos activos nitrifican a pH próximo a la neutralidad, con valores entre 6,8 y 7,2, puesto que con el incremento de pH, entre otros efectos indeseables, aumenta la acumulación de amoniaco, que es tóxico para las bacterias nitrificantes. El valor de pH durante el estudio se mantuvo entre 7,1 y 7,4, por lo que es asumible que no haya tenido una influencia significativa en el desarrollo y la actividad de los organismos nitrificantes. La concentración de oxígeno disuelto en el reactor no se relacionó con la abundancia de BOA y BON. No obstante, la baja concentración de oxígeno disuelto puede convertirse en un factor limitante para el crecimiento de las bacterias nitrificantes (Bitton, 2011), siendo las BOA más competitivas que las BON con bajas concentraciones (Zornoza et al., 2014). Durante el tiempo de desarrollo del estudio, los valores mínimos de oxígeno disuelto en el reactor biológico se mantuvieron por encima de 0,76 mg/L, sin afectar significativamente al rendimiento

53

02/11/16 08:15


Artículo Técnico

TABLA 8 VALORES DEL COEFICIENTE DE CORRELACIÓN DE SPEARMAN ENTRE PROTISTAS Y METAZOOS Y PARÁMETROS OPERACIONALES Y FISICOQUÍMICOS RELACIONADOS CON LA NITRIFICACIÓN. NOTA: * la correlación es significativa al nivel 0,05 (bilateral); ** la correlación es significativa al nivel 0,01 (bilateral). Parámetro

Ciliados libres

Ciliados sésiles

Grandes flagelados

Rizópodos

BOA

-0,598*

-0,637

0,254

0,407

0,416

-0,291

0,058

BON

-0,196

-0,261

0,214

0,263

0,211

-0,029

0,279

BOA + BON

-0,352

-0,498

0,375

0,468

0,410

-0,107

0,505

DQO afluente

0,039

0,774**

-0,568

-0,697*

-0,909**

0,517

-0,752**

N-NH4+ afluente

-0,153

0,538

-0,460

-0,488

-0,700*

0,387

-0,496

-0,501

-0,141

0,449

0,270

-0,204

0,695*

0,152

0,232

0,474

-0,800**

-0,653*

-0,365

-0,402

-0,531

N-NO3 afluente

0,366

-0,290

0,470

0,515

0,613*

-0,177

0,485

N-NO3- efluente

-0,225

-0,096

0,185

0,198

0,011

0,206

0,182

NTK afluente

-0,032

0,707*

-0,572

-0,572

-0,787**

0,412

-0,578*

NTK efluente

-0,317

-0,111

0,097

0,102

-0,055

0,159

0,103

Rendimiento eliminación NTK

-0,054

0,396

-0,424

-0,391

-0,457

0,131

-0,364

Nitrógeno total afluente

-0,046

0,688*

-0,568

-0,543

-0,755**

0,387

-0,538

Nitrógeno total efluente

-0.335

-0,143

0,116

0,224

0,051

0,101

0,257

DBO/NTK afluente

-0,004

0,704*

-0,446

-0,597*

-0,861**

0,587*

-0,672*

DBO/NTK efluente

0,432

0,064

0,128

0,148

0,234

-0,076

0,118

DQO/NTK afluente

0,139

0,745**

-0,481

-0,645*

-0,836**

0,517

-0,724**

DQO/NTK efluente

0,286

0,090

-0,092

-0,071

0,078

-0,173

-0,061

N-NH4+ efluente +

Rendimiento eliminación NH4 -

de la nitrificación. Generalmente, se considera que para que tenga lugar la nitrificación completa se necesita una concentración de O2 mayor de 2 mg/L en el reactor, si bien se puede lograr un rendimiento adecuado operando con concentraciones inferiores (Baquerizo et al., 2013). Respecto a la relación entre bacterias nitrificantes y otros organismos, se pudo apreciar una correlación inversa entre la abundancia de BOA y la abundancia de ciliados libres y sésiles. Esta observación se contradice con los hallazgos obtenidos en otros estudios que constataron un aumento de la presencia de ciliados cuando se incrementa la canti-

54

ta 21 at microbiologia.indd 54

dad de bacterias nitrificantes en el licor mezcla (Serrano et al., 2008; Pérez-Uz et al., 2010), si bien no es la abundancia de nitrificantes el único factor que determina la eficiencia de la nitrificación. En general, se encuentran correlaciones directas entre las concentraciones de NTK y DQO y la relación DQO/NTK en el afluente respecto a ciliados sésiles y tecamebas; mientras que existen correlaciones inversas entre esos parámetros y la abundancia de rotíferos, gimnamebas y rizópodos totales. La concentración de nitrógeno en el afluente baja y continua se asocia a la estabilidad de la estructura de la microfauna.

Gimnamebas Tecamebas

Rotíferos

Destaca también la correlación negativa significativa entre la abundancia de rizópodos y grandes flagelados y la eficiencia en la eliminación de amonio. La presencia de flagelados grandes (> 20 μm) suele estar asociada a afluentes con baja carga orgánica (Madoni, 2003), y aquí se relacionó con episodios concretos de disminución tanto de la DQO como del NTK en el afluente. Se cumple el criterio general de que los organismos de mayor tamaño dentro de un determinado grupo (ciliados, flagelados o gimnamebas) indican mejores calidades del efluente que cuando se observan especies más pequeñas (Salvadó et al., 1997),

nº 21 - Septiembre-Octubre 2016

02/11/16 08:15


ta 21 at microbiologia.indd 55

02/11/16 08:15


Artículo Técnico

aunque las variaciones observadas fueron mínimas.

4. CONCLUSIONES Las principales conclusiones que se pueden extraer de este estudio acerca de las relaciones ecofisiológicas que se establecen en el fango activo de la EDAR entre factores bióticos y abióticos vinculados a la eliminación de nitrógeno son las siguientes: - Las bacterias nitrificantes son menos abundantes cuando aumenta la concentración de materia orgánica biodegradable y disminuye la concentración de nitrógeno orgánico y amoniacal en el afluente. Los parámetros fisicoquímicos que pueden proporcionar más información relativa al funcionamiento de la nitrificación serían la DQO y el NTK en el afluente. - La temperatura, el pH y el oxígeno disuelto en el licor mezcla no se correlacionaron significativamente con la abundancia de bacterias nitrificantes. Tampoco se apreció correlación significativa entre el crecimiento de BOA y BON respecto a la carga másica y la edad del fango. - Los datos obtenidos sobre la correlación entre la abundancia de protozoos y metazoos y otros parámetros de control no coinciden con las conclusiones comunes de numerosos estudios llevados a cabo en otras EDAR. Las peculiaridades de esta planta, que mantiene una gran estabilidad operacional y microbiológica y con poca variabilidad en las características del afluente al reactor biológico, podrían explicar algunas de estas discrepancias. Sin embargo, la brevedad del estudio no permite conocer en toda su extensión la ecología de los microorganismos del sistema biológico de depuración.

56

ta 21 at microbiologia.indd 56

» Las bacterias nitrificantes son menos abundantes cuando aumenta la concentración de materia orgánica biodegradable y disminuye la concentración de nitrógeno orgánico y amoniacal en el afluente. Los parámetros fisicoquímicos que pueden proporcionar más información relativa al funcionamiento de la nitrificación serían la DQO y el NTK en el afluente

Bibliografía [1] Baquerizo, E.; Rodríguez, E.; Rojas, F.J.; Martín de la Vega, P.; Infante, P. (2013). Problemática biológica en sistemas con nitrificación-desnitrificación en procesos en suspensión. En Manual de gestión de EDAR. Suspensión y biopelícula. Sevilla, GBS, págs. 55-155. [2] Bitton, G. (2011). Wastewater Microbiology, 4th. Edition. New Jersey, Wiley-Blackwell. [3] Borrás, L. (2008). Técnicas microbiológicas aplicadas a la identificación y cuantificación de organismos presentes en sistemas EBPR. Tesis doctoral. Universitat Politècnica de València [4] Daims, H.; Nielsen, J.L.; Nielsen, P.H.; Schleifer, K.H.; Wagner, M. (2001). In situ characterization of Nitrospira-like nitriteoxidizing bacteria active in wastewater treatment plants. Appl Environ Microbiol., núm. 67, págs. 5.273-5.284. [5] Ehrich, S.; Behrens, D.; Lebedeva, E.; Ludwig, W.; Bock, E. (1995). A new obligately chemolithoautotrophic, nitrite-oxidizing bacterium, Nitrospira moscoviensis sp. nov. and its phylogenetic relationship. Arch Microbiol., núm. 164, págs.16-23. [6] Gerardi, M.H. (2006). Wastewater Bacteria. New Jersey, Wiley-Interscience. [7] Juretschko, S.; Timmermann, G.; Schmid, M.; Schleifer, K.H.; Pommerening-Röser, A.; Koops, H.P., et al. (1998). Combined molecular and conventional analyses of nitrifying bacterium diversity in activated sludge: Nitrosococcus mobilis and Nitrospiralike bacteria as dominant populations. Appl. Environ. Microbiol., núm. 64, págs. 3.042-3.051. [8] Kallistova, A.; Pimenov, N.; Kozlov, M.; Nikolaev, Y.; Dorofeev, A.; Aseeva, V. (2014). Microbial composition of the activated sludge of Moscow wastewater treatment plants. Microbiology, núm. 83, págs. 699-708. [9] Larrea, L. (2012). Pasado, presente y futuro de tecnologías para la eliminación de nutrientes en EDAR. Ingeniería Civil, núm. 168, págs. 81-92. [10] Lücker, S.; Schwarz, J.; Gruber-Dorninger, C.; Spieck, E.; Wagner, M.; Daims, H. (2015). Nitrotoga-like bacteria are previously unrecognized key nitrite oxidizers in fullscale wastewater treatment plants. The ISME Journal núm. 9, págs. 708-720. [11] Madigan, M.T.; Martinko, J.M.; Bender, K.S.; Buckley, D.H.; Stahl, D.A. (2015). Brock Biology of Microorganisms, 14th Edition. Boston, Pearson. [12] Madoni, P. (1994). A sludge biotic index

(SBI) for the evaluation of the biological performance of activated sludge plants based on the microfauna analysis. Water Res. núm. 28, págs. 67-75. [13] Madoni, P. (2003). Protozoa as indicators of wastewater treatment efficiency. En: D. Mara y N. Horan (Eds.) The Handbook of Water and Wastewater Microbiology. Londres, Academic Press, págs.361-371. [14]Madoni, P.; Ghetti, P.F. (1981). The structure of ciliated protozoa conmunities in biological sewage-treatment plants. Hidrobiologia, núm. 83, págs. 207-215. [15] Maixner, F.; Noguera, D.R.; Anneser, B.; Stoecker, K.; Wegl, G.; Wagner, M., et al. (2006). Nitrite concentration influences the population structure of Nitrospira-like bacteria. Environ Microbiol., núm. 8, págs. 1.487-1.495 [16] Metcalf & Eddy, Inc. (2003). Wastewater Engineering: Treatment and Reuse, 4th edition. Boston, McGraw-Hill. [17] Park, H.D.; Wells, G.F.; Bae, H.; Criddle, C.S.; Francis, C.A. (2006). Occurrence of ammonia-oxidizing archaea in wastewater treatment plant bioreactors. Appl. Environ. Microbiol., núm. 72, págs. 5.643-5.647 [18] Pérez-Uz, B.; Arregui, L.; Calvo, P.; Salvado, H.; Fernández, N.; Rodríguez, E., et al. (2010). Assessment of plausible bioindicators for plant performance in advanced wastewater treatment systems. Water Res., núm. 44, págs. 5.0595.069. [19] Pöpel, H.J.; Fischer, A. (1998). Combined influence of temperature and process loading on the effluent concentration of biological treatment. Water Sci Technol., núm. 38, págs. 129-136. [20] Prosser, J.I. (1989). Autotrophic nitrification in bacteria. Adv. Microb. Physiol., núm. 30, págs. 125-181. [21] Purkhold, U.; Pommering-Röser, A.; Juretschko, S.; Schmid, M.C.; Koops, H.P.; Wagner, M. (2000). Phylogeny of all recognized species of ammonia oxidizers based on comparative 16S rRNA and amoA sequence analysis: implications for molecular diversity surveys. Appl. Environ. Microbiol., núm. 66, págs. 5.368-5.382. [22] Rodríguez, E.; Isac, L.; Fernández, N.; Salas, M.D.;Jiménez, C. (2003). Guía metodológica para la elaboración de análisis microbiológicos de fangos activados de EDAR. GBS, Sevilla. [23] Salvadó, H.; Rius, M.; Amigó, J.M.; Gracia, M.P. (1997). Capacidad indicadora de los distintos grupos de protozoos y metazoos en sistemas de depuración por fangos activos según su modo de alimentación y tipo de relación con

nº 21 - Septiembre-Octubre 2016

02/11/16 08:15


Estudio del proceso biológico de nitrificación en una EDAR de baja carga mediante el análisis de las correlaciones entre parámetros microbiológicos, fisicoquímicos y operacionales

el flóculo. Revista de la Sociedad Mexicana de Historia Natural, núm. 47, págs. 99-107. [24] Salvadó H.; Arnabat C.; Abzazou T.; Canals O.; Bruguera, C.; Simón P., et al. (2013). Caracterización de la microbiota y estado fisiológico de los fangos activados de EDAR con eliminación de nutrientes mediante microscopía convencional, epifluorescencia y citometría de flujo. IX Jornadas Técnicas de Saneamiento y Depuración. Investigación e Innovación Tecnológica en el tratamiento de las aguas residuales urbanas. Murcia, Esamur. [25] Sauder, L.A.; Peterse, F.; Schouten, S., Neufeld, J.D. (2012). Low-ammonia niche ofammonia-oxidizing archaea in rotating biological contactors of a municipal wastewater treatment plant. Environ. Microbiol., núm. 14, págs. 2.589-2.600. [26] Schramm, A.; de Beer, D.; van den Heuvel, J.C.; Ottengraf, S.; Amann, R. (1999). Microscale distribution of populations and activities of Nitrosospira and Nitrospira spp. along a macroscale gradient in a nitrifying bioreactor: quantification by in situ hybridization and the use of microsensors. Appl. Environ. Microbiol. núm. 65, págs. 3.690-3.696. [27] Serrano, S.; Arregui, L.; Calvo, P.; Salvadó, H.; Zornoza, A.; Fernández, N. et al. (2008). Comunidades de protistas asociados a plantas con eliminación de nitrógeno. V Jornadas de Transferencia de Tecnología sobre Microbiología del Fango Activo. Sevilla, GBS.

ta 21 at microbiologia.indd 57

[28] Sheik, A.R.; Muller, E.E.L.; Wilmes, P. (2014). A hundred years of activated sludge: time for a rethink. Front. Microbiol., 5, 47 (1-7). [29] Snaidr, J.; Beimfohr, C. (2001); Vor-OrtNachweis von Nitrifikanten in Abwasserproben mit Hilfe hochspezifischer Gensonden. WLB Wasser, Luft und Boden 45, 7-8. [30] Spieck, E.; Hartwig, C.; McCormack, I.; Maixner, F.; Wagner, M.; Lipski, A.; et al. (2006). Selective enrichment and molecular characterization of a previously uncultured Nitrospira-like bacterium from activated sludge. Environ Microbiol., núm. 8, págs. 405-415. [31] Stahl, D.A.; de la Torre, J.R. (2012). Physiology and diversity of ammonia-oxidizing archaea. Annu. Rev. Microbiol., núm. 66, págs. 83-101. [32] Strous, M.; Fuerst, J.A.; Kramer, E.H.M.; Logemann, S.; Muyzer; van de Pas-Schoonen, K.T. et al. (1999). Missing lithotroph identified as new planctomycete. Nature, núm. 400, págs. 446-449. [33] Teske, A.; Alm, E.; Regan, J.M.; Toze, S.; Rittmann, B.E.; Stahl, D.A. (1994). Evolutionary relationships among ammonia- and nitriteoxidizing bacteria. J Bacteriol., núm. 176, págs. 6.623-6.630. [34] Thomsen, T.R.; Kong, Y.; Nielsen, P.H. (2007). Ecophysiology of abundant denitrifying bacteria in activated sludge. FEMS Microbiol Ecol., núm. 60, págs. 370-382.

[35] Timmermans, P.; Van Haute, A. (1983). Denitrification with methanol: Fundamental study of the growth and denitrification capacity of Hyphomicrobium sp. Water Res., núm. 17, págs. 1.249-1.255. [36] Wagner, M. (2005). Microbial ecology of activated sludge. Microbiology Today, núm. 32, págs. 28-31. [37] Wagner, M.; Rath, G.; Amann, R.; Koops, H.P.; Schleifer, K.H. (1995) In situ identification of ammonia-oxidizing bacteria. Syst. Appl. Microbiol., núm. 18, págs. 251-264. [38] Winogradsky, S. (1890). Recherches sur les Organismes de la Nitrification. Annales de l'Institut Pasteur, núm. 4, págs. 257-275. [39] Woznica, A.; Nowak, A.; Ziemski, P., Kwasniewski, M.;.Bernas, T. (2013). Stimulatory effect of xenobiotics on oxidative electron transport of chemolithotrophic nitrifying bacteria used as biosensing element. PLoS One. 8, e53484. [40] Zornoza, A. (2015). La desesperación en la búsqueda del modelo de bioindicación en fangos activos. http://www.iagua. es/blogs/andres-zornoza/desesperacionbusquedamodelo-bioindicacion-fangos-activos [Consultado: 16/10/2015]. [41] Zornoza, A.; Avendaño, L.; Borrás, L., Aguado, D., Alonso, J.L. (2014). Análisis de las correlaciones entre la abundancia de bacterias nitrificantes y los parámetros operacionales y fisicoquímicos relacionados con el proceso biológico de nitrificación en fangos activos. Tecnoaqua, núm. 5, págs 2-12.

02/11/16 08:15


Artículo Técnico

Estudio comparativo de la transferencia de oxígeno en distintos sistemas de aireación en EDAR de la Región de Murcia Se pretende obtener el parámetro SOTEpw y el coeficiente alfa de los fangos activos de cuatro estaciones depuradoras de aguas residuales (EDAR) objeto de estudio en condiciones controladas en una planta piloto, así como determinar el valor del parámetro SOTEpw en condiciones reales en los reactores biológicos de las EDAR de estudio. La metodología empleada para la obtención del SOTEpw fue el método de análisis off-gas. Los resultados mostraron que, a caudales bajos de aire, la transferencia de oxigeno es mayor obteniendo mejores resultados para las EDAR provistas de soplantes con difusores de burbuja fina, en contraposición a los resultados obtenidos para las EDAR provistas con sistemas de aireación mediante oxirrotores. El valor in situ del SOTEpw no pudo determinarse en las instalaciones con sistema de aireación mediante oxirrotores por no cumplirse las condiciones de la norma empleada. Palabras clave Aguas residuales, sistemas de aireación, eficiencia energética, SOTE, alfa (α), off-gas, soplantes, oxirrotores.

COMPARATIVE RESEARCH ABOUT THE OXYGEN TRANSFER IN DIFFERENT TYPES OF AERATION SYSTEMS IN WWTP IN THE REGION OF MURCIA (SPAIN) The aim of the project was to obtain the SOTEpw parameter and alfa coefficient of the sludges from four different wastewater treatment plants (WWTP) under controlled conditions. The project aims at determining the SOTEpw parameter under real conditions too. The methodology applied was the off-gas analysis. The results showed that, under low air flows and in WWTP provided by blowers with fine bubble diffusers, the oxygen transfer was higher than in WWTP provided by an oxirrotor. The in-situ SOTEpw value could not be determined in WWTP with an oxirrotor as an aeration system, as far as these installations do not fulfilled the applied normative.

Pedro José Simón Andréu director técnico de Esamur Carlos Lardín Mifsut responsable de Explotación Zona II de Esamur Antonio Vicente Sánchez Betrán director del Departamento de Explotaciones de Red Control Raquel González Herrero responsable del Área de I+D de Red Control Jorge Morales Gómez jefe de planta en la EDAR de Santomera (Red Control) José Miguel Gambín Manzano director general de Ingapres

Keywords Wastewater, areation system, energy efficiency, SOTE, alfa (α), off-gas, blowers oxirrotors.

58

ta 21 at redcontrol.indd 58

Marçal Gaitx Altisen responsable técnico de Ingapres

nº 21 - Septiembre-Octubre 2016

02/11/16 08:19


Estudio comparativo de la transferencia de oxígeno en distintos sistemas de aireación en EDAR de la Región de Murcia

1. INTRODUCCIÓN Actualmente, la gran mayoría de las EDAR disponen de un proceso biológico aerobio de cultivo en suspensión, lo que conlleva la necesidad de suministrar oxígeno para que el proceso de depuración se desarrolle. Para ello, existen diferentes sistemas de aireación cuya función principal es mantener un nivel de oxígeno disuelto en el reactor que haga posible que se desarrollen todas las reacciones necesarias para la eliminación de materia orgánica del agua residual. Sin embargo, dentro de los costes de explotación de una EDAR, el coste derivado del consumo energético en aireación es el más elevado, motivo por el cual resulta fundamental conocer cuál es el rendimiento del sistema de aireación instalado con el objeto de optimizar los costes económicos de la explotación sin detrimento de la calidad del agua tratada. En este contexto son empleados los parámetros SOTEpw y alfa. El parámetro SOTEpw (%) informa de la eficiencia en la transferencia de oxígeno en condiciones estándar. El parámetro alfa es un coeficiente que relaciona la transferencia de oxígeno en un fango activo con la transferencia de oxígeno en agua limpia. Así, los objetivos de este estudio son: - Obtener el parámetro SOTEpw y el coeficiente alfa de los fangos activos de las EDAR de estudio en condiciones controladas en una planta piloto. - Medición del parámetro SOTEpw en condiciones reales en los reactores biológicos de las EDAR de estudio.

de aireación es a través de soplantes con difusores de plato. El caudal aportado por la soplante es de 5.339 Nm3/h. Para la realización de las pruebas del presente estudio se ha empleado el método de análisis off-gas, con el que se obtiene directamente los valores del SOTE del sistema, en planta piloto, bajo condiciones controladas de proceso. Para ello se ha seguido la normativa ASCE 18-1996 y la ATV-M 209. El método off-gas es una técnica basada en el balance de masas en la fase gas, para obtener directamente el coeficiente de trasferencia de oxígeno en sistemas de aireación mediante difusores. Dicho método requiere de la utilización de un adecuado analizador para obtener una medida precisa del contenido relativo de oxígeno en la fase gas del aire ambiente y del off-gas saliente de la superficie del líquido del sistema de aireación. Esta técnica utiliza un flotador en la superficie del licor mezcla para capturar y conducir el off-gas saliente hacia el analizador con el fin de medir el caudal de gas y el contenido en oxígeno (Figura 1). Con este método también se miden las presiones parciales de oxigeno tanto en el aire de entrada al sistema como en la corriente de salida de la superficie del tanque de pruebas, bajo condiciones controladas de presión, temperatura, humedad, caudal de aire y contenido en dióxido de carbono. Es importante conocer el contenido en dióxido de carbono y vapor de agua de las dos corrientes de aire, con el fin de eliminar la influencia de sus presiones parciales.

2. MATERIAL Y MÉTODOS En las EDAR objeto de estudio se dispone de los siguientes sistemas de aireación:

FIGURA 1. Esquema de captación y análisis del off-gas en el reactor biológico.

- Santomera. Posee tres reactores biológicos de tipo Orbal con un volumen unitario de 2.435 m3. El sistema de aireación instalado son oxirrotores. El oxígeno aportado por cada uno de los oxirrotores es de 54 kg O2/h. - Fortuna. Cuenta con dos reactores de tipo Carrusel con un volumen unitario de 2.500 m3. Dispone de soplantes con difusores tubulares cuyo caudal de aire aportado es de 2.200 Nm3/h. - Abanilla. Cuenta con un reactor biológico de tipo Carrusel con un volumen de 2.962 m3, con un sistema de aireación mediante oxirrotores. El oxígeno aportado por cada oxirrotor es de 52,5 kg O2/h. - Beniel. Posee dos reactores biológicos de tipo Carrusel, de 5.625 m3 de volumen unitario y su sistema

www.tecnoaqua.es

ta 21 at redcontrol.indd 59

59

02/11/16 08:19


Artículo Técnico

FIGURA 2. Esquema de la planta piloto.

Con la diferencia entre la concentración de oxígeno en la corriente de entrada y la del off-gas se calcula la medida de eficiencia de transferencia de oxigeno (SOTE) del sistema de aireación aplicando la Ecuación 1:

El valor del SOTEpw indica cuánto del oxígeno que se aporta a un sistema (licor mezcla) se transfiere en condiciones estándar. Las condiciones estándar son 1 atmósfera de presión y 10 ºC de temperatura. Otro parámetro a tener en cuenta es el alfa (α), que es un coeficiente que relaciona la transferencia de oxígeno en el fango activo con la transferencia de oxígeno en agua limpia (Ecuación 2):

2.1. CONDICIONES REALES EN REACTOR BIOLÓGICO Los puntos de muestreo escogidos para realizar las pruebas en las EDAR de Beniel y Fortuna fueron en la zona aireada para las pruebas en el reactor. En cuanto a Santomera y Abanilla, solo se realizaron pruebas en la planta piloto, ya que poseen un sistema de aireación superficial mediante oxirrotores que es incompatible con el método off-gas. Para este estudio se realizaron al menos 10 mediciones útiles de SOTEPW con el caudal de aire habitual de trabajo de cada una de las EDAR.

60

ta 21 at redcontrol.indd 60

2.2. CONDICIONES CONTROLADAS EN PLANTA PILOTO Para las pruebas en planta piloto, la sistemática de trabajo consistió en aplicar, a las muestras de fango activo de cada EDAR, cuatro caudales de aire diferentes, de los que se realizaron 10 mediciones útiles de SOTEPW de cada uno de ellos. Cabe remarcar que este procedimiento también se realizó en agua limpia para poder así calcular el SOTEcw, y posteriormente el valor de alfa. La planta piloto consta principalmente de un recipiente de plástico circular construido en polietileno con un diámetro interior de 1,80 metros y una altura de 4 metros (Figura 2). Además, cuenta con los siguientes equipos: - Parrilla de difusores interna con sistema de fácil instalación. Está parrilla está formada por 6 difusores tubulares. - Soplante con caudal regulable. - Bomba de alimentación de lodos activos con variador para ajustar el caudal. - Sistema de medición del caudal de aire aspirado. - Sistema de medición de las condiciones atmosféricas: temperatura, humedad y presión. - Sonda de oxígeno y temperatura. - Mangueras de conexión del suministro de aire, así como para la toma de muestra de aire (off-gas y conexionado hidráulico de la planta (alimentación de lodos y retorno). En la planta piloto, los parámetros de control motorizados son los siguientes:

nº 21 - Septiembre-Octubre 2016

04/11/16 10:05


ta 21 at redcontrol.indd 61

04/11/16 10:05


Artículo Técnico

FIGURA 3. Gráfica que relaciona el porcentaje de SOTE con el caudal de aire.

TABLA 1 TABLA DEL SOTE OBTENIDO EN CONDICIONES REALES EDAR

SOTE (%))

Beniel

18,97

Fortuna

13,78

Abanilla

-

Santomera

-

- Condiciones atmosféricas: se controla la presión atmosférica, la temperatura ambiente y la humedad. - Condiciones de aireación: se controla el caudal de aire suministrado, la presión de trabajo y la temperatura del licor mezcla. - Condiciones de reacción: se controla el oxígeno disuelto del fango activo, la temperatura del agua y el off-gas. - Condiciones de operación: se controla el caudal de fangos activos.

3. RESULTADOS Y DISCUSION 3.1. CONDICIONES REALES EN REACTOR BIOLÓGICO Los valores de SOTE obtenidos en la EDAR de Beniel son del 18,97% y 19,6% para los meses de junio y octubre de 2013, respectivamente. Para Fortuna, los valores de SOTEpw fueron del 13,78% y del 18,30%. Se observa que en la EDAR de Fortuna hay un incremento del SOTEpw del 4,52%, debido a que en el mes de Septiembre se realizó un cambio de los difusores en los reactores biológicos (Tabla 1).

3.2. CONDICIONES CONTROLADAS EN PLANTA PILOTO En la Tabla 2 se muestran los valores de SOTEpw obtenidos en planta piloto, tanto en agua limpia como en agua

de proceso, de las cuatro EDAR objeto de estudio. En el agua limpia se observa qué valor de SOTEpw máximo se podría alcanzar con los difusores objeto de estudio. Teniendo en cuenta esto, se observa que Beniel y Fortuna, a caudales bajos de aire, alcanzan los valores de SOTE más altos, llegando a un 17,7% y 15,2% respectivamente. Así mismo, tanto en Abanilla como en Santomera se han llegado a valores de un 11,3% y un 8,2%. También se puede observar que a caudales bajos de aire, el SOTE es mayor (Figura 3). Esto es debido a que, a menor caudal de aire, la velocidad de las burbujas disminuye, aumentando así el tiempo de residencia de las burbujas en el licor mezcla y aumentando la eficiencia de transferencia de oxígeno. Referente al alfa, se puede observar que Beniel y Fortuna tienen valores de este parámetro muy similares a los bibliográficos, mientras que Santomera y Abanilla tienen un alfa inferior, llegando a valores ligeramente por debajo de 0,3 (Tabla 3). Los aportes de aguas industriales en estas EDAR explicarían la diferencia obtenida.

4. CONCLUSIONES En cuanto a las pruebas realizadas en la planta piloto,

TABLA 2 TABLA CON LOS VALORES DE SOTE OBTENIDOS EN DIFERENTES CAUDALES DE AIRE Agua limpia

Beniel

Santomera

Abanilla

Fortuna

Q aire (m3 N/h) SOTE (%) Q aire (m3 N/h) SOTE (%) Q aire (m3 N/h) SOTE (%) Q aire (m3 N/h) SOTE (%) Q aire (m3 N/h) SOTE (%) 2,9

29,34

6,77

17,7

3,28

8,2

3,34

11,3

3,24

15,26

6,1

25,64

11,48

12,3

7,64

7,3

7,9

10,2

8,02

13,59

11,3

20,89

17,62

12

12,13

6,9

12,13

9,6

12,31

12,08

17,1

16,82

-

-

18,16

6,8

17,62

8,6

19,15

10,85

62

ta 21 at redcontrol.indd 62

nº 21 - Septiembre-Octubre 2016

04/11/16 10:05


Estudio comparativo de la transferencia de oxígeno en distintos sistemas de aireación en EDAR de la Región de Murcia

TABLA 3

operadores de planta determinar el momento oportuno en el que realizar una operación de limpieza de los difusores instalados dado que, si el valor de SOTE se sitúa por debajo de lo habitual, puede deberse a que los difusores tienen suciedad y, por lo tanto, es conveniente realizar una limpieza.

TABLA COMPARATIVA DEL ALFA TEÓRICA CON LA REAL EDAR

Alfa teórica

Alfa real

Beniel

0,65

0,69 – 0,60

Fortuna

0,65

0,52 – 0,58

Abanilla

0,65

0,46 – 0,39

Santomera

0,65

0,33 – 0,28

Bibliografía [1] Norma ASCE 18-1996 de la American Society of Civil Engineers, 'Standard Guidelines for In-Process Oxygen Transfer Testing'.

los mejores resultados de SOTEpw se obtienen para Beniel y Fortuna, EDAR provistas de soplantes y difusores de burbuja fina. En contraposición, en Abanilla y Santomera se han obtenido los valores más bajos de este parámetro debido a que poseen un sistema de aireación mediante oxirrotores. Es conocido que, en los sistemas de aireación por difusores, cuando el caudal de aireación es bajo, aumenta la transferencia de oxigeno debido a que las burbujas de aire permanecen más tiempo en el licor mezcla. Los valores del parámetro alfa en la planta piloto siguen la misma tendencia que los de SOTE en las plantas estudiadas, por depender directamente de esta. En condiciones reales, tal y como se ha comentado anteriormente, no se ha podido medir el SOTE en las EDAR de Santomera y Abanilla por no cumplirse las condiciones de la norma. Sin embargo, en las EDAR de Beniel y Fortuna se han obtenido resultados concluyentes. Los valores de SOTE obtenidos en el mes de octubre son más altos que los del mes de junio en ambas plantas. En el caso de Fortuna, esta diferencia es más notable debido al cambio de difusores realizado en el mes de septiembre. Desde el punto de vista de la explotación y gestión de una EDAR, es interesante mantener los valores de SOTE elevados con el objeto de optimizar, desde el punto de vista energético, el sistema de aireación. Desde el punto de vista del mantenimiento de un sistema de aireación por difusores, conocer el SOTE permite a los

[2] Normativa alemana ATV-M 209, 'Measurement of Oxygen Transfer under Process Conditions'. [3] Trillo Fox, I. (2014). Sistemas de aireación. Técnicas aplicables al diseño y gestión. CEDEX.

www.tecnoaqua.es

ta 21 at redcontrol.indd 63

isiflo.indd 1

25/10/16 10:28

04/11/16 10:05


Artículo Técnico

Aplicación de ultrasonidos para el tratamiento del mejillón cebra (Dreissena polymorpha) en espacios confinados El mejillón cebra (Dreissena polymorpha, Pallas 1771) es considerado uno de los principales agentes causantes del biofouling a nivel mundial. Esta especie invasora coloniza el casco de los barcos y la superficie de diferentes infraestructuras hidráulicas produciendo la obstrucción de tuberías y filtros. En España está ocasionando serios problemas económicos y ecológicos desde que se detectó su introducción en la cuenca del río Ebro hace aproximadamente una década. En este trabajo se presentan los resultados preliminares de un estudio en el que se valoran los efectos del equipo ultrasónico Dumo sobre la viabilidad de las larvas de mejillón cebra y su capacidad de asentamiento. Se ha observado que este equipo tiene un claro efecto antifouling en las larvas del mejillón cebra en espacios confinados. Además, se observó un efecto sobre la vitalidad de las larvas de esta especie invasora. Estos resultados justifican que se sigan estudiando los efectos de este equipo, y así valorar si la tecnología ultrasónica Dumo debería ser considerada como un tratamiento alternativo en espacios confinados. Palabras clave Mejillón cebra, ultrasonidos, Dumo, antifouling, instalaciones hidráulicas.

EFFECTS OF ULTRASONIC TECHNOLOGY FOR ZEBRA MUSSEL TREATMENT IN CLOSED AQUATIC SYSTEMS The zebra mussel (Dreissena polymorpha, Pallas 1771) is one of the main biofouling agents worldwide. This invasive species colonizes the hulls of boats and the surface of different hydraulic infrastructures producing clogging in pipes and filters. In Spain it is causing serious economic and ecological problems since its introduction was detected in the Ebro river basin about a decade ago. In this paper, we present the preliminary results of a study that evaluates the effects of the ultrasonic device Dumo on the viability of zebra mussel larvae and its ability of settlement. It has been observed that this device has a clear antifouling effect on the zebra mussel larvae in closed aquatic systems. In addition, an effect on the vitality of the larvae was observed. These results warrant further study the effects of this device, and thus assess whether the Dumo ultrasonic technology should be considered as an alternative treatment in closed aquatic systems. Keywords Zebra mussel, ultrasound, Dumo, antifouling, hydraulic infrastructures.

64

ta 21 at mejillon.indd 64

Nines Marín Vitalla licenciada en Ciencias Biológicas, responsable de I+D+i Medioambiental de Eccus Proyectos Técnicos Medioambientales y Obras Clara Companys Castro licenciada en Ciencias Ambientales, técnica de I+D+i Medioambiental de Eccus Proyectos Técnicos Medioambientales y Obras Tania Peñalver Ruiz graduada en Biotecnología, técnica de I+D+i Medioambiental de Eccus Proyectos Técnicos Medioambientales y Obras Ramoni Sánchez Carmona doctora en Ciencias Biológicas, responsable de I+D+i Agua y Medioambiente de Toscano Línea Electrónica

nº 21 - Septiembre-Octubre 2016

02/11/16 08:38


Aplicación de ultrasonidos para el tratamiento del mejillón cebra (Dreissena polymorpha) en espacios confinados

1. INTRODUCCIÓN El mejillón cebra (Dreissena polymorpha, Pallas 1771) es un molusco bivalvo de agua dulce originario del mar Caspio. Esta especie invasora se considera una de las principales especies causantes del biofouling en instalaciones hidráulicas como centrales eléctricas, sistemas de tratamientos de agua, instalaciones de regadíos, etc. El mejillón cebra se encuentra presente en la Península Ibérica desde 2001, año en el que se registró su presencia en la parte baja del río Ebro, con densidades de 500 indv/ m 3 (Altaba et al., 2001). A partir de ahí se produjo su expansión por prácticamente toda la cuenca del río Ebro (Durán et al., 2010). Actualmente el mejillón cebra se encuentra distribuido por otras cuencas de la Península Ibérica como la del Júcar y Segura y, en el año 2009, se detectó su presencia en el embalse granadino de Los Bermejales, confirmándose su presencia en la cuenca del río Guadalquivir. En los últimos años el mejillón cebra se ha extendido por dicha cuenca, encontrándose en los embalses de Bermejales, Iznájar, La Breña II y en comunidades de regantes desde el

Genil-Cabra hasta el Bajo Guadalquivir, pasando por el Valle Inferior del Guadalquivir (www.chguadalquivir.es). La invasión por parte del mejillón cebra produce grandes impactos desde el punto de vista ecológico y económico. Debido a su gran capacidad de filtración, las altas densidades que alcanza y a su distribución generalizada, esta especie produce la alteración de la estructura y funcionamiento del ambiente que invade, causando grandes cambios en el flujo de energía del ecosistema y llegando a modificar la bioquímica del agua. El efecto combinado entre la invasión de mejillón cebra y la degradación ambiental que esta supone contribuye enormemente al declive de poblaciones de bivalvos autóctonos de la familia Unionidae. Así mismo, el impacto económico asociado a la invasión del mejillón cebra es bastante elevado. Solo en la invasión de la cuenca del río Ebro se estima que se han superado unos costes de 13 millones de euros en casi una década (Durán et al., 2012). Su impacto económico está asociado a los problemas que causa en el funcionamiento de las instalaciones afectadas (obstrucción de tuberías

FIGURA 1. Vista de la parte inferior de un puente en el Embalse de Iznájar (Córdoba) afectado por el mejillón cebra.

en captaciones de agua, conducciones y bombeos, interrupción del flujo…) y costes adicionales de mantenimiento (actividades de mantenimiento, tratamientos de agua…) (Figura 1). De esta manera, la proliferación del mejillón cebra produce la obstrucción parcial o total de tuberías, conductos de refrigeración y cualquier abertura por donde fluye el agua. Así pues, se produce una gran pérdida de la sección, por lo que aumenta la fricción y la canalización del agua se vuelve menos eficiente. También hay evidencias de que los filamentos del biso que el mejillón cebra usa para fijarse al sustrato, pueden acelerar la corrosión de estructuras metálicas. Las bacterias que aparecen entre el sustrato y los filamentos del biso producen un componente ácido a través de la respiración aeróbica que incrementa la corrosión de superficies de hierro y acero. A estos costes directos, hay que añadir los costes asumidos por la administración pública en campañas directas para prevenir y gestionar la expansión de esta especie invasora (Durán et al., 2010). Asumiendo que la erradicación completa de esta especie invasora es un hecho inviable, se continúa con la búsqueda de metodologías que mitiguen sus efectos y que contribuyan a evitar su expansión. En este estudio se presentan las bases sobre el uso de un tratamiento ultrasónico como una posible alternativa para el control del mejillón cebra.

1.1. ANTECEDENTES SOBRE EL ULTRASONIDO Y EL MEJILLÓN CEBRA El ultrasonido (ondas sonoras con una frecuencia por encima de los 20 kHz) se transmite por el agua produciendo una serie de ciclos de

www.tecnoaqua.es

ta 21 at mejillon.indd 65

65

02/11/16 08:38


Artículo Técnico

compresión. De esta manera, las variaciones de presión producidas por este efecto actúan sobre las algas de diferente manera, llegando a mitigar la formación de biofilm. La zona sonicada queda bajo la influencia de dichas variaciones de presión, de manera que se crea un ambiente de estrés que evita o dificulta el asentamiento de determinadas larvas o diversas formas de resistencia de organismos colonizadores. Por ejemplo, en el caso de la especie Amphibalanus amphitrite, conocido popularmente como escaramujo, se ha observado que el ultrasonido de alta potencia reduce la huella de secreción de la larva, afectando así al reclutamiento de nuevos individuos de la misma especie. Es decir, se ha observado que el ultrasonido reduce el asentamiento de estos cipridos y cambia el comportamiento de la larva durante la etapa de exploración del sustrato (Guo, 2012). En el caso concreto del mejillón cebra, en estudios realizados en los años 90, se observó que la energía de la ondas ultrasónicas de entre 39 y 41 kHz fragmentaba las larvas velígeras de mejillón cebra existentes en el agua (Kowaleswski y Patrick, 1992). Por otra parte, Donskoy y Ludyanskiy (1995) pudieron comprobar que la cavitación ultrasónica de entre 10 y 380 kHz conseguía matar larvas velígeras y afectar también en mayor o menor grado a ejemplares juveniles y adultos. Así pues, se puede decir que el mejillón cebra responde a la presión ejercida por el ultrasonido (Claudi y Mackie, 1994). Las características de la tecnología ultrasónica Dumo, en cuanto a su logística, coste y mantenimiento, y la necesidad de encontrar métodos respetuosos con el medio ambiente para combatir esta especie invasora, ha permitido retomar este tipo de

66

ta 21 at mejillon.indd 66

FIGURA 2. Canales hidráulicos de PVC instalados en el CEIDE para la realización del experimento. Al fondo se encuentra el canal con el equipo Dumo instalado.

investigaciones. Así pues, se realizó un ensayo en laboratorio a gran escala, con el fin de determinar la viabilidad de las larvas del mejillón cebra bajo el efecto del tratamiento con este equipo ultrasónico y evaluar su capacidad de fijación y colonización al sustrato. Los resultados preliminares obtenidos muestran un efecto antifouling sobre las larvas velígeras. Además se observó cierta afección en las larvas velígeras sometidas al tratamiento, lo que justifica la necesidad de seguir evaluando el potencial de la tecnología ultrasónica Dumo como tratamiento contra el mejillón cebra en espacios confinados.

2. METODOLOGÍA El estudio se ha realizado en el laboratorio del Centro de Estudios Avanzados y documentación de Endesa (CEIDE), que se encuentra situado al pie de la presa del embalse de Ribaroja (río Ebro), en Tarragona. El CEIDE funciona habitualmente como centro de pruebas y experimentación de diferentes métodos de control y erradicación del mejillón cebra (Palau et al., 2006, 2009 y 2010). Este centro cuenta con un laboratorio húmedo, un laboratorio seco y una zona de servicios comunes. Inicialmente el laboratorio húmedo

cuenta con unos tanques de cultivo dispuestos sobre dos piletas de cemento a un metro del suelo. Entre las dos piletas hay un canal de hormigón con un flujo continuo de agua (Palau et al., 2004). Para la realización de estas pruebas se instalaron dos canales de PVC, de 0,4 m de anchura y 6 m de longitud, sobre las piletas, a ambos lados del canal de hormigón. En el extremo de la entrada de agua de uno de ellos se instaló el equipo ultrasónico Dumo, mientras que el otro canal se utilizó como control (Figura 2). En este laboratorio entra agua cruda directamente desde el embalse de Riba-roja, con un caudal constante de 9 m3/h, que queda repartido homogéneamente entre tres canales: el canal de control, el canal con tratamiento ultrasónico y el canal de hormigón que no será utilizado en este ensayo. De esta manera, el tiempo de residencia del agua en los canales varió entre los 7 y los 10 minutos. Para la realización de este trabajo se utilizó concretamente el equipo ultrasónico Dumo Algacleaner Marina ACM-180 (www.toscano.es) con emisor multifrecuencia (20 kHz-60 kHz) y 180 W. Este equipo, diseñado como sistema antifouling en el casco de los barcos, está constituido por:

nº 21 - Septiembre-Octubre 2016

02/11/16 08:38


Aplicación de ultrasonidos para el tratamiento del mejillón cebra (Dreissena polymorpha) en espacios confinados

un emisor ultrasónico colocado debajo de la superficie del agua, sujetado con un flotador; un módulo de control para activar el emisor, instalado en un área seca o no inundable alimentado por una red de 230 v ; y un cable que conecta el emisor con el módulo central (Figura 3). La potencia específica o intensidad (I) y la energía específica (Es) fueron calculadas de la siguiente manera:

FIGURA 3. Equipo Dumo Algacleaner Marina ACM-180 utilizado para la realización del experimento.

I = Potencia (W)/Volumen (l) Es (J/l) = I (W/l) x tiempo (seg) En este caso se aplicó una energía de 16,79 J/l. Antes de comenzar el tratamiento se realizaron tres precampañas durante el mes de mayo y principios de julio para valorar la densidad de larvas del mejillón cebra que entraba en el laboratorio. Una vez que se detectó una entrada significativa de larvas en el laboratorio se inició el tratamiento ultrasónico. Estas precampañas fueron necesarias para determinar, en la medida de lo posible, el inicio del ciclo biológico, es decir, el momento en el que se inicia la producción de gametos y larvas.

2.1. PARÁMETROS FISICOQUÍMICOS Se tomaron datos de los principales parámetros fisicoquímicos en los dos canales durante el transcurso del seguimiento. Para medir temperatura, oxígeno disuelto, saturación de oxígeno, conductividad y pH se usó la sonda multiparamétrica YSI 6600 (Yellow Spring Instruments) y para medir la turbidez se usó la misma sonda y Turbiquant 1000IR (Merck). El embalse de Riba-roja cuenta con un sistema de monitorización en continuo (SMC-OX) que permite la toma de datos de parámetros fisicoquímicos y de larvas de mejillón

www.tecnoaqua.es

ta 21 at mejillon.indd 67

cebra. Este sistema ha permitido tener los datos integrados del periodo comprendido entre el 24/07/2015 y el 09/12/2015 (muestreos mensuales integrados). Los datos así obtenidos se han utilizado para contrastar los parámetros fisicoquímicos del embalse con los medidos en el canal durante dicho periodo de tiempo. Para observar las posibles diferencias significativas entre los parámetros fisicoquímicos entre los dos canales y entre los canales y el embalse, se aplicó un análisis Kruskall-walis con el paquete estadístico SPSS 13.

2.2. DETERMINACIÓN DE LA FASE LARVARIA EN EL LABORATORIO Y DE LA SUPERVIVENCIA LARVARIA Para determinar el comienzo del ciclo de fase larvaria en el laboratorio se tomaron muestras justo a la entrada de las instalaciones, antes de que el agua cruda llegase a los tres canales. Una vez el agua quedaba repartida entre los canales, la efec-

tividad del tratamiento ultrasónico se valoró comprobando la vitalidad de las larvas mediante la realización de diferentes campañas de recogida de muestras. En cada campaña se recogieron muestras de agua a la entrada y a la salida de cada canal (canal de control y canal tratado con Dumo) para poder observar el efecto de la sonicación. En cada toma de muestras se filtró un volumen suficiente de agua (entre 100 y 300 L) con una malla de nytal de 30 μm. Posteriormente, se procedió a la tinción para determinar la viabilidad de las larvas. La distinción entre las larvas vivas y muertas (viable o no viable) puede realizarse de diversas formas, siendo la más común, la observación directa del movimiento ciliar de las larvas en el microscopio óptico con luz normal. No obstante, el gran número de larvas presentes en las muestras que se deben procesar y, la imposibilidad de observar la vitalidad de las mismas en un periodo de tiempo

67

02/11/16 08:38


Artículo Técnico

FIGURA 4. Preparación de las muestras filtradas (imagen 1), identificación en el microscopio (imagen 2) de las larvas de mejillón cebra previo a la tinción vital con luz natural (imagen 3) y polarizada (imagen 4), recuento de larvas en el microscopio óptico tras la tinción vital con luz natural (imagen 5) y polarizada (imagen 6). Laboratorio de las instalaciones de Eccus (www.eccussl.com).

lo suficientemente corto para que se garantice su supervivencia, hace necesario protocolizar otro modo de determinación de su vitalidad tras el tratamiento aplicado. Así pues, se recurre a la tinción vital de las larvas. Para la observación de las larvas tras la tinción se utilizó un microscopio óptico invertido con luz polarizada y contraste de fases. La tinción vital aplicada muestra diferencias según su viabilidad, lo que permite valorar de una forma más clara el estado de afectación en el que se encuentran. En la Figura 4 se puede distinguir entre: larvas vivas no afectadas por el tratamiento (coloración intensa, interior de las valvas totalmente ocu-

68

ta 21 at mejillon.indd 68

pado por el cuerpo de la larva), larvas afectadas (coloración poco apreciable o alterada en su tonalidad, interior de las valvas no totalmente ocupadas o con aspecto 'apelotonado') y, por último, larvas muertas, que aparecerán sin ningún tipo de coloración, ya que se tratan de valvas vacías.

2.3. CONTROL DE ASENTAMIENTO LARVARIO El control del asentamiento larvario para valorar el efecto antifouling del tratamiento ultrasónico se realizó a través de la observación directa de las paredes de los canales de control y tratado con Dumo en cada una de las campañas realizadas.

3. RESULTADOS Y DISCUSIÓN 3.1 RESULTADOS FISICOQUÍMICOS DEL AGUA En la Figura 5 se muestran los parámetros fisicoquímicos registrados durante el seguimiento en los dos canales y en el embalse de Riba-roja. No se observaron diferencias significativas entre los parámetros registrados en los dos canales, es decir, entre el canal de control y el canal con el tratamiento ultrasónico (Kruskall-wallis; temperatura: F = 0,013, p = 0,910; conductividad: F = 0,006, p = 0,940; pH: F = 0,334, p = 0,563; turbidez: F = 0,336, p = 0,545; O2 (%): F = 0,006, p = 0,940, O2 (mg/l) F = 0,143, p = 0,705). Así pues, puede afirmarse que el canal de control y el canal sonicado presentaron condiciones fisicoquímicas similares durante el seguimiento. De esta manera, se descarta el efecto de algunas de estas variables sobre las pruebas realizadas. La turbidez fue la única variable que mostró diferencias significativas entre los valores obtenidos en el laboratorio y en el embalse (resultados del test de Kruskall-wallis; temperatura: F = 0,304, p = 0,581; conductividad: F = 0,136, p = 0,712; pH: F = 0,062, p = 0,803; turbidez: F = 8,655, p <0,005; O 2 (%): F = 0,000, p = 1,000, O2 F = 0,015, p = 0,903). Este resultado es totalmente previsible, ya que el agua cruda que se toma del embalse sigue una canalización cerrada y subterránea hasta llegar al laboratorio en la que se va produciendo la decantación de parte de los sólidos en suspensión que contiene el agua del embalse. De esta manera, se puede afirmar que, exceptuando la turbidez, las condiciones fisicoquímicas en las que se trabajó en el laboratorio han sido representativas de las condiciones naturales del embalse.

nº 21 - Septiembre-Octubre 2016

02/11/16 08:38


Aplicación de ultrasonidos para el tratamiento del mejillón cebra (Dreissena polymorpha) en espacios confinados

3.2. DATOS SOBRE LA FASE LARVARIA La relación entre la temperatura y la densidad total de larvas registradas durante todo el seguimiento a la entrada del laboratorio y en el embalse de Riba-roja a través del sistema de monitorización en continuo instalado en presa se muestra en la Figura 6. Se observan claramente los dos picos de eclosión larvaria típicos del mejillón cebra: uno durante la primaveraverano y otro durante el otoño, siendo este último menor que el primero. Como se comentó anteriormente, se pudo disponer de datos de muestreo de densidad larvaria en la presa de Riba-roja a partir de la campaña del 24 de julio de 2015, fecha posterior a la detección masiva de las larvas en la entrada del laboratorio. Al comparar ambos muestreos se observa la coincidencia en la dinámica poblacional de las larvas detectadas. Así, en ambos casos la densidad es cero durante los meses en que la temperatura se encuentra próxima a los 25 ºC, apareciendo nuevamente a partir de las campañas realizadas en septiembre, cuando la temperatura vuelve a estar en torno a los 20 ºC (considerada temperatura de confort del mejillón cebra). El hecho de que en laboratorio se registren densidades de larvas bastantes superiores a las registradas en presa responde principalmente a la colonización comprobada de la conducción, desde la presa hasta el laboratorio, por parte de mejillón adulto, los cuales contribuyen con su propia emisión de larvas al número registrado a la entrada del laboratorio. Los resultados obtenidos respecto a la detección de la eclosión larvaria, se corresponden a lo esperado según los rangos de preferencia orientativos para distintos parámetros y variables (Tabla 1).

www.tecnoaqua.es

ta 21 at mejillon.indd 69

FIGURA 5. Evolución de los diferentes parámetros fisicoquímicos durante la realización del seguimiento, en el canal de control, en el canal con tratamiento ultrasónico y en la toma embalse de Riba-roja: concentración de oxígeno, conductividad, saturación de oxígeno, temperatura, pH y turbidez, respectivamente.

FIGURA 6. Evolución densidad-temperatura: comparación de la densidad larvaria en la toma del embalse de Riba-roja (RR) con la densidad larvaria total de la entrada en el laboratorio de Riba-roja. La flecha granate indica el inicio de las campañas en la toma embalse de Riba-roja.

69

02/11/16 08:38


Artículo Técnico

TABLA 1 RANGOS DE PREFERENCIA ORIENTATIVOS DEL MEJILLÓN CEBRA PARA DISTINTOS PARÁMETROS Y VARIABLES SEGÚN O’NEIL (1996) Y COMPLEMENTADO CON DATOS DE CLAUDIE Y MACKIE (1994) Variable

Nulas

Muy bajas

Bajas

Medias

Altas

Óptimas

Calcio (mg/L)

5-6

<9

9 - 20

20 - 25

25 - 125

> 125

Dureza total (mg CaCO3/L)

0-22

< 25

25 - 45

45 - 90

90 - 125

> 125

0 - 0,6

< 6,5 > 9,0

6,5 - 7,2 9,0

7,2 - 7,5 8,7 - 9,0

7,5 - 8,7

8,0 < pH < 8,5

<2 >40

<8 > 30

9 - 15 28 - 30

16 - 18 25 - 28

18 - 25

18 - 20

Oxígeno disuelto (mg/L)

Anoxia

<4

4-6

6-8

8 - 10

+/- 100 saturación

Conductividad (μS/cm)

0 - 21

< 22

22 - 36

37 - 82

83 - 110

> 110

-

< 0,07 > 1,5

0,07 - 0,09 1,25 - 1,5

0,7 - 0,09 1,00 - 1,25

0,1 - 1,0

-

pH Temperatura (ºC)

Velocidad agua (m/s)

3.3. DATOS SOBRE SUPERVIVENCIA LARVARIA En las Figuras 7 y 8 se muestra la supervivencia larvaria tanto a la entrada como a la salida del canal de control y del canal sonicado con Dumo, respectivamente. En ambos casos se observa que la detección de larvas vivas no se produce hasta la primera semana de septiembre. Este resultado puede estar condicionado por el pequeño porcentaje de larvas vivas presentes en el agua cruda, de manera que solo se detectan las larvas muertas durante los muestreos de primavera y verano. Durante mediados de julio y agosto no se detectaron larvas (ni vivas ni muertas) en ninguno de los canales. Este hecho se corresponde con la dinámica natural del ciclo de vida del mejillón cebra, ya que en esas fechas las larvas viables presentes en primavera ya se han asentado pero aún no han alcanzado la madurez sexual suficiente como para producir la segunda generación de larvas. Así pues, a pesar de que la densidad de larvas es inferior en otoño, cabe señalar que estas son mucho

70

ta 21 at mejillon.indd 70

más activas que las encontradas en primavera. Es decir, la proporción de larvas vivas respecto a las larvas totales es mucho mayor en otoño que en primavera. Esto se debe a que en primavera, cuando comienza el ciclo reproductivo del mejillón cebra se producen grandes avenidas que arrastran larvas procedentes de aguas arriba del embalse. De esta manera, las larvas que no logran asentarse son arrastradas aguas abajo hasta alcanzar la zona de presa del embalse, donde llegan muertas. Así mismo, la mayoría de las larvas que se capturan en otoño son producidas por individuos asentados en primavera, por lo que la producción de larvas se realiza en condiciones mucho más estables y sin turbulencias que puedan aumentar la mortalidad natural de las larvas. Por tanto, conocer la dinámica de la tasa de mortalidad natural del mejillón cebra en cada embalse resulta fundamental a la hora de tomar medidas de gestión, ya que esta va a estar condicionada por factores como la propia dinámica del embalse y las condiciones ambientales estacionales.

En la Figura 9 se muestran de manera más detallada los diferentes porcentajes de los diferentes grados de viabilidad observados en las larvas (muertas, vivas o afectadas) en los muestreos realizados a partir de septiembre. Estos se corresponden con los muestreos en los que se empezaron a detectar larvas vivas. En el muestreo del 4 de septiembre se observó que en el canal con el equipo Dumo todas las larvas se mostraron afectadas a la salida (100% de afectación en el canal tratado). En el canal de control, sin ningún tipo de tratamiento se observó que el 50% de las larvas estaban afectadas a la salida. De esta manera, se observó un 50% de más larvas afectadas en el canal sonicado. En el muestreo del 17 de septiembre se observa que el aumento de larvas muertas en el canal tratado con ultrasonidos no es significativo respecto al registrado de forma natural en el canal de control. No obstante, no se detecta ninguna larva viva a la salida del canal tratado. De esta manera, se produce un aumento del 33,33% de larvas afectadas.

nº 21 - Septiembre-Octubre 2016

02/11/16 08:38


Aplicación de ultrasonidos para el tratamiento del mejillón cebra (Dreissena polymorpha) en espacios confinados

FIGURA 7. Supervivencia y mortandad larvaria a la entrada y salida del canal control.

FIGURA 8. Supervivencia y mortandad larvaria a la entrada y salida del canal con el equipo Dumo.

Si se considera que se produce una afectación natural del 0,65% en el canal de control se podría decir que en el canal tratado aumenta la afectación de las larvas en un 32,68%. Respecto al muestreo realizado el 16 de octubre, no existen grandes diferencias entre el número de larvas afectadas en el canal de control y las sometidas al tratamiento ultrasónico (2,21 y 1,93% respectivamente). Esta ha sido la única campaña en la que se detectaron larvas vivas en la salida del canal sonicado, concretamente un 6,8 %. No obstante, este también fue el muestreo en el que se observó un mayor aumento en la mortalidad de las larvas. Concretamente se observó un aumento del 52% de la mortalidad durante el tratamiento. Si se tiene en cuenta que se produce una mortalidad natural del 22,94% en el canal de control, se podría considerar que en el canal sonicado se ha aumentado la mortalidad de las larvas en un 29,06%. Estos resultados de afectación de larvas bajo tratamiento con el equipo ultrasónico Dumo se han obtenido en un canal con un tiempo de retención de agua de entre 7 y 10 minutos, por lo que podrían esperarse mayores porcentajes de afectación con mayor tiempo de exposición al ultrasonido.

3.4. CONTROL DE ASENTAMIENTO LARVARIO

» Según el estudio, se evidencia el efecto antifouling del equipo ultrasónico Dumo en espacios confinados

www.tecnoaqua.es

ta 21 at mejillon.indd 71

Los dos canales (canal de control y canal tratado con Dumo) se mantuvieron libres y sin rastro de posibles asentamientos durante los primeros 15 días del ensayo. A partir del muestreo realizado el día 17 de julio se observó la aparición de pequeños individuos (< 1 mm) adheridos a la pared del canal de control (sin tratamiento ultrasónico). El asentamiento de larvas velígeras en las paredes de este canal se ha producido durante todo el

71

02/11/16 08:38


ArtĂ­culo TĂŠcnico

FIGURA 9. Porcentajes de los diferentes grados de viabilidad de larvas encontrados en los dos canales en los diferentes muestreos realizados a partir de septiembre. Porcentaje de larvas muertas (azul), de larvas vivas (verde) y de larvas afectadas (rojo).

72

ta 21 at mejillon.indd 72

nÂş 21 - Septiembre-Octubre 2016

02/11/16 08:38


ta 21 at mejillon.indd 73

02/11/16 08:38


Artículo Técnico

transcurso del experimento, mientras que en el canal sonicado con Dumo no se ha detectado la presencia de mejillón cebra durante todo el periodo de seguimiento. Estos efectos se han mantenido hasta cinco meses después de la finalización del ensayo (Figuras 10 y 11). Respecto al control del asentamiento, se puede señalar que este resultó positivo para el caso del canal de control y negativo para el canal tratado. Se evidencia, de esta manera, el efecto antifouling del equipo ultrasónico Dumo en espacios confinados.

FIGURA 10. Canal Control. Secuencia fotográfica de la evolución del interior del canal en diferentes campañas. La campaña del 26/05/2016 corresponde a la revisión del canal control cinco meses después de la finalización del ensayo.

4. CONCLUSIONES Las condiciones de laboratorio en las que se ha desarrollado este estudio, en cuanto a los parámetros fisicoquímicos y a la densidad larvaria, son representativas de la situación registrada en condiciones naturales en la zona de presa del embalse de Ribaroja. Por otra parte, los parámetros fisicoquímicos registrados durante el seguimiento se mantuvieron estables y significativamente iguales en los dos canales (canal de control y canal tratado con el equipo ultrasónico Dumo), por lo que estos no han sido un factor de perturbación de los resultados obtenidos. Se ha podido comprobar que existe una clara relación entre la temperatura y la presencia y densidad de larvas de mejillón cebra, apareciendo los dos picos de eclosión larvaria en primavera-verano y en otoño, cuando la temperatura está próxima a los 20 ºC. En este trabajo se ha observado que hay una posible afectación del equipo ultrasónico Dumo en los estadios larvarios del mejillón cebra. En las campañas realizadas se observó que en el canal tratado se produjo un aumento en el número de larvas afectadas de entre el 32

74

ta 21 at mejillon.indd 74

y el 50%. También se registró un aumento de la mortalidad de las larvas de un 29,06% en una de las campañas. Estos resultados se han obtenido en un sistema con flujo de agua, de manera que el tiempo de exposición de las larvas al tratamiento ultrasónico ha sido de entre 7 y 10 minutos, por lo que podrían esperarse mayores porcentajes de afectación en aguas quietas, con un mayor tiempo de retención. Respecto al control de asentamiento de las larvas se observó la colonización de las paredes del canal de control mientras que el canal con tratamiento ultrasónico permaneció despejado de mejillón cebra durante todo el seguimiento. En definitiva, los resultados preliminares obtenidos muestran un efecto

antifouling sobre las larvas velígeras. Además, se observó cierta afección en las larvas velígeras sometidas al tratamiento, lo que justifica la necesidad de seguir evaluando el potencial de la tecnología ultrasónica Dumo como tratamiento alternativo contra el mejillón cebra en espacios confinados.

5. AGRADECIMIENTOS Los autores agradecen la colaboración de Endesa por prestar sus instalaciones (laboratorio CEIDE) para el desarrollo de este proyecto, así como su aportación financiera para el estudio. Parte de este trabajo se ha realizado gracias a la financiación por parte del Ministerio de Economía y Competitividad a través de la concesión de una ayuda para un contrato Torres Quevedo (2013).

nº 21 - Septiembre-Octubre 2016

02/11/16 08:38


Aplicación de ultrasonidos para el tratamiento del mejillón cebra (Dreissena polymorpha) en espacios confinados

FIGURA 11. Canal Dumo. Secuencia fotográfica de la evolución del interior del canal en diferentes campañas. La campaña del 26/05/2016 corresponde a la revisión del canal Dumo cinco meses después de la finalización del ensayo.

ta 21 at mejillon.indd 75

Bibliografía [1] Altaba, C.R.; Jimánez, P.J.; López, M.A. (2001). El temido mejillón cebra empieza a invadir los ríos españoles desde el curso bajo del Ebro. Quercus, núm. 188, págs.50-51. [2] Claudi, R.; Mackie, G.L. (1994). Practical manual for zebra mussel monitoring and control. Lewis Publishers, London, 227 págs. [3] Donskoy, D.M.; Ludyanskiy, M.; Wrigth, D.A. (1996). Effects of sound and ultrasound on zebra mussels. J. Acoust. Soc. Am., núm. 99, págs. 577-603. [4] Durán, C.; Lanao, M.; Pérez, L.; Moreu, CC., Anadón, A.; Touya V. (2012). Estimación de los costes de la invasión del mejillón cebra en la cuenca del Ebro (periodo 2005-2009). Limnética, núm. 31, págs. 213-230. [5] Durán, C.; Lanao, M.; Pérez, L.; Anadón A.; Touya, V. (2010). Management strategies for the zebra mussel invasion in the Ebro river basin. Aquatic Invasions, núm. 5, págs. 309-316. [6] Guo, S.F.; Lee, H.P.; Chaw, K.C.; Miklas, J.; Teo, S.L.M.; Dickinson, G.H.; Birch,W.R.; Khoo, B.C. (2011). Effect of ultrasound on cyprids and juvenile barnacles. Biofouling, núm. 27, págs. 185-192. [7] Kowalewski, J.; Patrick, P. (1992). Acoustic as a possible mitigation strategy against zebra mussel settling. Paper presented at Second International Zebra Mussel Conference, February 1992, Toronto. En: O'Neill, C.R.Jr. (1996): The Zebra Mussel. Impacts and Control. Cornell Cooperative Extension, Information Bulletin, nº. 238. New York Sea Grant. Cornell University. State University of New York. 62 págs. [8] Palau, A.; Cía, I.; Fargas, D.; Bardina, M.; Massuti, S. (2004). Resultados preliminares sobre ecología básica y distribución del mejillón cebra en el embalse de Riba-roja (Río Ebro). Endesa. 43 págs. [9] Palau,A.; Cía, I. (2006). Métodos de control y erradicación del mejillón cebra (Dreissena polymorpha). Endesa, 51 págs. [10] Palau, A.; Marín, N.; Orós, J. (2009). Informe de los ensayos realizados en CEIDE con el producto ox-virin para tratamiento del mejillón cebra. Endesa-OXCTA (inédito). [11] Palau, A.; Marín, N.; Gracia, F. (2010). Valoración de la efectividad del hipoclorito sódico y dióxido de cloro en el control de adultos y larvas de mejillón cebra. Endesa-Ercross (inédito).

02/11/16 08:38


Artículo Técnico

Tratamiento de olor con un biofiltro avanzado en la EDAR de Galindo El estudio se centra en la estación depuradora de aguas residuales (EDAR) de Galindo, situada en el norte de España. A pesar de tratar las emisiones generadas en diferentes zonas de la EDAR mediante un scrubber químico de dos etapas, los gases emitidos por la instalación causaban una importante molestia a los vecinos que viven cerca de la planta. Después de un estudio completo, el sistema de ventilación de la línea de lodos fue completamente modificado y ahora la emisión es tratada en un biofiltro avanzado (FBA), compuesto por un lecho mixto orgánico e inorgánico. Desde entonces no ha habido más quejas vecinales causadas por malos olores. El principal objetivo de éste artículo es explicar el proyecto llevado a cabo, incluyendo: toma de muestras y análisis de todos los puntos de emisión focalizados, así como de los focos de emisión sin cubrir de las líneas de agua y lodos; modelización del impacto odorífero de las emisiones en el escenario actual y con el nuevo sistema de ventilación y emisiones tratadas; comparación de la diferencia entre las distintas tecnologías de reducción de olores (teniendo en cuenta la eficiencia de eliminación de olores, requisitos químicos, espacio disponible, CAPEX y OPEX); selección de la tecnología para la reducción de olor (el FBA fue la elegida); y descripción del diseño, entrega, instalación y eficiencia del FBA. Palabras clave FBA, olor, EDAR, tecnologías de tratamiento de olor.

ODOUR TREATMENT WITH A HIGH EFFICIENCY ADVANCED BIOFILTER IN A GALINDO WWTP (BILBAO, SPAIN) The study is focused on a large wastewater treatment plant (WWTP) of Galindo, located in the North of Spain. Despite treating most of the emissions of the WWTP in a two-step chemical scrubber, the gases emitted by the facility were causing significant nuisance to the population living closely to the plant. After a complete study, the ventilation system of the whole sludge line was rebuilt and is now treated through a high efficiency advanced biofilter (HEAB), filled with organic and inorganic biomedia. Since its installation there have been no more odour complaints. The main purpose of this work is to explain the complete project carried out, which included: sampling and analysis of all the emissions points or surface from the water and the sludge line; odour impact modelling of the emissions in the current scenario and with the new ventilation system and of the treated emissions; full comparison of the different odour abatement technologies (taking into account odour removal efficiency, chemical requirements, surface requirements, CAPEX and OPEX); selection of odour abatement technology (the HEAB was selected); description of the design, delivery, installation and of the performance of the HEAB. Keywords HEAB, odour, WWTP, odour treatment technologies.

76

ta 21 at labaqua.indd 76

Sílvia Nadal product manager de Air Quality de Labaqua Asier Lopez jefe del Departamento de Tecnología del Consorcio de Aguas Bilbao-Bizkaia

nº 21 - Septiembre-Octubre 2016

02/11/16 08:59


Tratamiento de olor con un biofiltro avanzado en la EDAR de Galindo

1. INTRODUCCIÓN

- Las emisiones de entrada y salida de los scrubber llamados Olores 1, diseñados para tratar 197.000 m3/h y que estaban tratando las emisiones procedentes de la estación de bombeo de aguas residuales y de la parte final de los decantadores primarios.

La EDAR Galindo, situada en Bilbao, es una EDAR que trata cerca de 350.000 m3 de aguas residuales municipales cada día. Esta EDAR fue construida en 1985, en las afueras de la ciudad, pero debido al crecimiento urbano, fue rodeada por áreas residenciales y comerciales en tan solo unos años y las molestias y quejas por olores aparecieron y crecieron año tras año. En 2007 la propiedad de la EDAR decidió iniciar un proyecto exhaustivo con el objetivo de reducir el impacto odorífero en las inmediaciones de la planta. Este proyecto se dividió en diferentes fases, la primera fue una detallada caracterización odorífera y química de las distintas emisiones de aire de la planta, seguida por una modelización para calcular el impacto odorífero permitiendo así encontrar cuáles eran las principales emisiones que provocaban los problemas de olor. Finalmente, un estudio de ingeniería se encargaría de elegir cuál de las tecnologías disponibles era la más adecuada para el caso, dando la mejor eficiencia en cuanto a eliminación de olor se refiere, y que al mismo tiempo tuviera los menores costes de operación posible.

- Las emisiones de entrada y salida de los scrubber llamados Olores 2, diseñados para tratar 47.000 m3/h y que estaban tratando las emisiones procedentes del espesador de lodos y de los edificios de tamices y filtros prensa. - Las emisiones en diferentes zonas de los decantadores primarios, el proceso biológico anaeróbico, y de los decantadores secundarios. - Debido a las bajas concentraciones de olor a la entrada de los scrubber llamados Olores 1 y Olores2, se llegó a la conclusión de que era también necesario analizar la concentración de olor en aire ambiente en la estación de bombeo y de los edificios de cribado y filtros prensa. La Tabla 1 muestra un resumen de los resultados.

2. METODOLOGÍA

En la Figura 1 se ilustran los resultados de la modelización llevada a cabo con el programa ISC3LT, mostrando que las curvas iso-odoras se extienden más allá de los límites de la EDAR, llegando a zonas habitadas como son las ciudades vecinas de Sestao y Barakaldo.

2.1. MEDIDA E IMPACTO ODORÍFEROS En 2007 se realizó un análisis olfatométrico completo en los siguientes puntos de la EDAR:

TABLA 1 RESULTADOS DE LAS MEDIDAS DE CONCENTRACIÓN DE OLOR IN SITU. Concentración de olor (uoE/m3)

Emisión de olor 106 (uoE/h)

% Contribución de las distintas fuentes a la emisión de olor global de la EDAR

Edificio de tamices

11.585

243

23,20

Edificio de deshidratación de fangos

5.171

28

3,00

Decantador primario

70

132

12,60

Salida del scrubber Olores 2

861

70

6,70

1.043

64,4

6,20

407

39

3,70

Incinerador – Chimenea 1

4.973

88,8

8,50

Incinerador – Chimenea 2

5.434

185

17,70

Zona

Edificio de bombeo Salida del scrubber Olores 1

Otros

www.tecnoaqua.es

ta 21 at labaqua.indd 77

18,4

77

02/11/16 08:59


Artículo Técnico

FIGURA 1. Resultado de la primera modelización odorífera.

FIGURA 2. Resultado de la modelización de olor tras la

2.2. MEJORAS Con el objetivo de reducir el impacto odorífero se decidió centrar los esfuerzos de los tratamientos en las zonas que contribuían en mayor medida a las emisiones de olor y se dividía en diversas fases. Teniendo en cuenta que cualquier acción tomada para reducir el olor no debía ni afectar ni modificar la operatividad de las instalaciones, se siguió un riguroso y exhaustivo método para cada una de las partes del estudio, que implicó la actuación de un equipo multidisciplinario en el cual cada experto contribuía en su campo de especialidad al sí de dicho equipo. Además, la definición geométrica de cada una de las instalaciones debía contar con los siguientes seis requisitos: fácil operatividad, fácil de limpiar, mantenimiento fácil, funcionamiento seguro, bajo consumo de energía y atención al impacto visual. Así, la primera fase consistió en:

fase 1.

- Disminuir las emisiones en la línea de lodos. - Mejorar la ventilación del edificio de tamices. - Rediseñar la cubierta de los tanques de espesado de lodos - Mejorar la ventilación del edificio de filtros prensa. - Enviar todas las emisiones generadas en la línea de lodos a un nuevo sistema de tratamiento de olor con una concentración final de olor inferior a 1.000 uoE/ m3.

FIGURA 3. Resultado de la modelización del impacto odorífero tras la fase 2.

La Figura 2 muestra la reducción del impacto odorífero esperada tras la aplicación de la primera fase, que reduce en gran medida el impacto odorífero de los alrededores de la EDAR. Como segunda fase, se decidió modificar los decantadores primarios existentes a decantadores lamelares y poder cubrirlos, extraer las emisiones de aire y dirigirlas al scrubber Olores 1. En la Figura 3 se muestra la reducción de impacto odorífero adicional esperada. Esta segunda fase no ha sido ejecutada todavía.

2.3. DISCUSIÓN SOBRE EL TRATAMIENTO DE OLORES A SELECCIONAR PARA LA FASE 1 Con el objetivo de seleccionar la mejor tecnología disponible para tratar las emisiones de la línea de lodos (fase 1 del estudio), se estudiaron la eficiencia de eliminación de olor, los costes iniciales (CAPEX) y los costes de operación y mantenimiento (OPEX) de las tecnolo-

78

ta 21 at labaqua.indd 78

nº 21 - Septiembre-Octubre 2016

02/11/16 08:59


Tratamiento de olor con un biofiltro avanzado en la EDAR de Galindo

FIGURA 4. Comparación de las tecnologías estudiadas.

gías normalmente aplicadas en tratamientos de olores, listadas a continuación: - Biotrickling. - Scrubber químico de 3 etapas. - Carbón activo estándar. - Carbón activado impregnado. - Biofiltro avanzado (FBA). - Biofiltro orgánico. En la Figura 4 se muestra la comparación entre las tecnologías estudiadas. Debido al alto rendimiento de eliminación de olor requerido en este caso, únicamente las tecnologías de adsorción y el FBA podrían ser aplicadas. Al final, el criterio de selección basado en costes CAPEX+OPEX llevó a escoger el FBA.

TABLA 2 CACTERÍSTICAS DE LAS EMISIONES DE AIRE A TRATAR Parámetro

Valor

Caudal total

140.000 m3/h: - 91.100 m3/h de la sala de filtros prensa - 10.500 m3/h del tanque de lodos - 20.975 m3/h de la sala de tamices - Reserva: 17.425 m3/h

Temperatura del aire

Ambiente (10 a 35ºC)

H2S 10 mg/m3 y 5 mg/m3 y mercaptanos NH3 y aminas

10 mg/m3 y 5 mg/m3

Concentración odorífera a la 10.000 uoE/m3 entrada

2.4. DISEÑO DEL FBA La Tabla 2 muestra las principales características del aire total a tratar, y la Tabla 3 indica las del FBA. El FBA usa un biomedio específico (Figura 5) que consiste en: - Una fase inorgánica de alta porosidad y geometría regular que implica una estructura resistente y homogeneidad mecánica. Cuenta con una larga vida útil del soporte (entre 8 y 12 años). - Una fase orgánica que es pre-esterilizada y posteriormente inoculada con una mezcla de microorganismos específicos para cada aplicación con el objetivo de alcanzar los objetivos de eficiencia de eliminación de olor deseados.

www.tecnoaqua.es

ta 21 at labaqua.indd 79

TABLA 3 PRINCIPALES CARACTERÍSTICAS DEL BIOFILTRO AVANZADO Parámetro

Valor

Tiempo de retención

19 s

Superficie útil

940 m2

Velocidad máxima del aire (ratio)

150 m3/h/m2

Altura del biomedio

0,8 m

Concentración de olor final

1.000 uoE/m3

Tipo de soporte

Mixto orgánico/inorgánico

79

02/11/16 08:59


Artículo Técnico

FIGURA 5. Biomedio específico utilizado en el FBA.

3. RESULTADOS Y DISCUSIÓN Un biofiltro avanzado (FBA) de cuatro plantas fue instalado en 2014 (Figura 6), y desde entonces el sistema ha estado trabajando de forma óptima. El cliente está satisfecho con el poco mantenimiento necesario y la alta eficiencia de eliminación de olor. El promedio de la concentración de olor a la entrada es de 8.500 uoE/m3 y la concentración final de olor a la salida es de 300 uo E/m3, inferior a los 1.000 uo E/ m3 requeridos.

4. CONCLUSIONES

- La inoculación se lleva a cabo utilizando uno o más familias de microorganismos específicos seleccionados de entre las 50 distintas cepas disponibles. - Los microorganismos inoculados específicamente tendrán la capacidad para tratar compuestos orgánicos volátiles (COV), compuestos de nitrógeno y azufre, asegurando que la concentración de olor final será muy baja. El FBA ha demostrado ser muy eficiente y respetuoso con el medio ambiente dado que no usa ningún producto químico, no produce ningún residuo tóxico y el consumo de agua es inferior a otros sistemas de biofiltración convencional.

La clave consiste en caracterizar correctamente las emisiones de aire y todos los factores relacionados con el proyecto (en particular el tratamiento de aire, la eficiencia de depuración necesaria, el espacio disponible y los costes CAPEX y OPEX) antes de seleccionar la tecnología de control de olores a aplicar. No se deben aplicar las tecnologías de depuración por analogía, pues en la mayoría de las ocasiones las tecnologías avanzadas, aunque presenten CAPEX elevados, tienen unos TOTEX inferiores a los que presentan las tecnologías convencionales. Además, las tecnologías avanzadas ofrecen una eficiencia de desodorización desde el primer día de funcionamiento. Bibliografía [1] European Standard EN-13725. Air Quality. Determination of odour concentration by dynamic olfactometry. European Committee for Standardization (ECS), Brussels, 2003.

FIGURA 6. Biofiltro avanzado (imagen de la izquierda) implantada en la EDAR Galindo (imagen de la derecha).

80

ta 21 at labaqua.indd 80

nº 21 - Septiembre-Octubre 2016

02/11/16 08:59


dosim.indd 1

31/10/16 15:55


Artículo Técnico

Seguimiento de un proceso de bulking causado por Meganema perideroedes

Las bacterias filamentosas son representantes ubicuos y, en ocasiones, claramente visibles en las comunidades biológicas presentes en los fangos activos de las estaciones depuradoras de aguas residuales (EDAR) y residuales industriales (EDARI). El crecimiento excesivo de estos organismos pueden producir graves problemas de operación, como pueden ser las espumas y el esponjamiento. En concreto, las EDARI del sector lácteo son muy problemáticas debido al alto nivel de DQO soluble presente en sus afluentes. En una EDARI de sueros lácteos se identificó un problema de esponjamiento por el morfotipo Nostocoida limícola que posteriormente, con técnicas FISH, fue identificado como Meganema perideroedes. Se encontró una correlación positiva entre la deficiencia de oxígeno y la presencia de este organismo en el lodo activado. Palabras clave Bacterias filamentosas, bulking, problemas operacionales, Meganema perideroedes.

DETECTING A PROBLEM OF BULKING CAUSED BY THE MEGANEMA PERIDEROEDES BACTERIA The filamentous bacteria are generally present in the microbiological communities of activated sludge of wastewater treatment plants (WWTP) and industrial (WWTPI). The excessive growth of these organisms could cause serious problems,foaming and bulking, for the operation of the WWTP. Specifically the WWTPI of the dairy sector are very problematic due to the high level of soluble DQQ in the tributaries. In a dairy serum WWTPI there was a problem of bulking, caused by the morphotype Nostocoida limícola, which subsequently was identified as Meganema perideroedes using the FISH technique. There was a positive relationship between the deficiency of oxygen and the presence of this organism in the activated sludge. Keywords Filamentous bacteria:, bulking, operational problems, Meganema perideroedes.

82

ta 21 at meganema.indd 82

Eva Rodríguez jefa de Laboratorio EDAR Tablada, Asociación Científica Grupo Bioindicación de Sevilla (GBS) Estrella de la Concepción García técnica en control de proceso de Aguambiente José Luis Alonso Molina responsable del Grupo de Química y Microbiología del Agua del Instituto de Ingeniería del Agua y Medio Ambiente de la Universitat Politècnica de València

nº 21 - Septiembre-Octubre 2016

02/11/16 09:29


Seguimiento de un proceso de bulking causado por Meganema perideroedes

1. INTRODUCCIÓN Las estaciones depuradoras de aguas residuales industriales (EDARI) del sector agroalimentario presentan propensión a sufrir alteraciones en la decantabilidad de sus lodos (Levantesi et al., 2004; Kragelund et al., 2006), debido principalmente al tipo de efluente que tratan, y a las variaciones de carga y caudal asociados a la producción. Dentro del sector quesero, los sueros son especialmente problemáticos, ya que poseen una alta DQO y gran parte de ella es fácilmente biodegradable, ambiente que favorece el desarrollo de distintas bacterias filamentosas. El filamento dominante encontrado en el presente estudio ha sido Meganema perideroedes, identificado inicialmente mediante técnicas ópticas como Nostocoida limícola con reacciones a tinciones no usuales. Nostocoida limícola es muy usual en fangos activos, e incluye distintas especies que no son distinguibles solo por observación óptica y tamaño celular (Thomsen et al., 2006; Nielsen et al., 2009, Seviour 2010), por lo que se hace imprescindible la confirmación mediante la técnica de hibridación in situ con sondas

16S rDNA marcadas con fluoróforos (FISH) (Eikelboom, 2002), tal como han demostrado estudios genéticos de la secuencia del gen 16S rRNA (Seviour et al., 2002). La información operacional disponible sobre este morfotipo, se asocia a bajos valores de la carga másica, de oxígeno disuelto y un importante componente industrial de las aguas residuales afluentes (Eikelboom, 2002; Jenkins et al., 2004). En concreto, la ecofisiología de Meganema perideroedes es muy versátil y puede utilizar una amplia variedad de sustratos orgánicos como el acetato, propionato, butirato, oléico, glucosa, galactosa, manosa, glicina y leucina bajo condiciones aerobias, pero no formico, piruvato o etanol (Kragelund et al., 2005). Este filamento se desarrolla en EDARI con elevadas concentraciones de compuestos solubles, ya que posee una alta capacidad para producir biopolímeros de reserva dando lugar a polihidroxialcanoatos (PHA) (Kragelund et al., 2005). De hecho Mcllroy et al. (2015) han detectado esta especie en SBR optimizados para producir PHA para manufactura de plásticos. También presenta cierta capacidad hidrofóbica y excretan algunos

enzimas extracelulares asociados a la superficie celular, aunque las células de Meganema perideroedes nunca presentan actividad exoenzimática extracelular, excepto en rupturas del proceso en las que un 15% de las células presentaban actividad lipasa. Bajo condiciones limitantes de oxígeno, Meganema perideroedes es capaz de usar el nitrato como aceptor terminal de electrones (condiciones anóxicas), si bien es un proceso menos efectivo (Kragelund et al., 2005). Con nitritos como único aceptor terminal, solo puede asimilar glucosa y acetato entre los sustratos ensayados por Kragelund et al. (2005), tanto para su crecimiento como compuestos de reserva. Bajo condiciones anaerobias, estos autores no han detectado actividad asimilatoria en ninguno de los compuestos ensayados. Este organismo es poco frecuente en EDAR con desnitrificación. El objetivo del presente trabajo es utilizar la técnica FISH para la identificación del morfotipo Nostocoida limicola asociado con problemas de bulking en una EDARI de sueros de quesos y evaluar las condiciones asociadas al desarrollo de este filamento en esta EDARI en concreto.

FIGURA 1. Esquema del proceso de depuración en la EDARI a estudio.

www.tecnoaqua.es

ta 21 at meganema.indd 83

83

02/11/16 09:29


Artículo Técnico

TABLA 1 VALORES PROMEDIOS ANUALES EN LA EDARI Zona

pH SST SSV Conductividad V30 DQO DQO soluble N-Amonio NT PT Aceite (u. de pH) (mg/L) (mg/L) (μS/cm) (mL/L) (mg/L) (mg/L) (mg/L) (mg/L) (mg/L) (mg/L)

Entrada

7,38

1.191

7.580

-

19.919

-

-

-

-

-

Homogenización

5,62

2.952

-

8.193

-

13.329

-

-

-

-

332

Salida fisicoquímico

5,55

527

-

8.252

-

4.945

6.591

-

24

91

28

Biológico 1

7,86

4.424

4.170

6.810

764

-

488

13

24

741

741

Biológico 2

7,44

4.168

3.530

6.910

660

-

94

23

29

8

8

2. MATERIAL Y MÉTODOS La EDARI objeto de este estudio trata los sueros de una quesería que llegan con un pH en torno a 5, tras lo cual se tratan en un tanque de homogenización donde se neutralizan con sosa. Posteriormente se añade coagulante y floculante (cloruro férrico y polielectrolito catiónico) y el afluente entra en dos reactores biológicos en serie (R1 y R2) aireados mediante soplantes. En ambos reactores se controla el proceso con sondas de oxígeno y redox, según el esquema de la Figura 1. La EDARI presenta episodios de bulking (hinchazón de fangos) recurrentes asociados a dos causas muy acusadas. La primera de ellas, intrínseca al tipo de afluente que trata, tras el ajuste fisicoquímico, se detecta un alto nivel de fracción soluble de la DQO que usualmente se mueve entre un 65-70%, pero que puede llegar a ser hasta del 90%. La segunda problemática va relacionada con el exceso de producción, que provoca puntas de caudal de vertido hasta tres veces superiores a las de diseño, por lo que tanto el proceso fisicoquímico como la capacidad de aireación son totalmente insuficientes. El caudal diario es de aproximadamente 200 m3 y la DQO de diseño

84

ta 21 at meganema.indd 84

de 4.500 mg/L. En la Tabla 1 se definen las concentraciones promedio anuales en sus distintas fases. Para realizar el seguimiento y resolución de esta situación se estableció un período de muestreo comprendido entre marzo y junio de 2015. Durante este período, en una primera fase se ha caracterizado al filamento dominante con microscopía óptica de contraste de fases y campo claro, y la técnica FISH (marzo 2015) y, en una segunda fase, se ha evaluado el tipo de filamento dominante y su nivel de crecimiento en función de los parámetros operacionales y fisicoquímicos (abril-junio 2015). Los análisis fisicoquímicos se realizaron de forma quincenal según los Métodos Normalizados (APHA, AWWA, WPCF). El análisis microbiológico completo se ha realizado de forma quincenal, valorando el IF, según protocolo establecido en Rodríguez et al. (2008). La identificación de bacterias filamentosas se hizo según los manuales de Jenkins et al. (1993 y 2004), Seviour y Blackall (1999) y Eikelboom (1975 y 2002), realizándose el conteo de m/mL de filamentos según la técnica descrita en Salvadó (1990). Se han realizado las siguientes tinciones para la identificación de las

bacterias filamentosas: Gram, Neisser y polihidroxibutirato. Desde el mes de junio hasta diciembre del 2015 no se pudo continuar con la misma frecuencia de muestreos, pero pudieron evaluarse los efectos que tuvieron los procesos de nitrificación-desnitrificación sobre la estructura del flóculo y sobre la abundancia de filamentos. Las sondas que se han utilizado con la técnica FISH para la identificación de las bacterias filamentosas presentes en las muestras de fangos activos se describen en la Tabla 2 (Loy et al., 2007). Las hibridaciones se han realizado a 46 ºC durante 2 h y el lavado para eliminar el exceso de sonda no hibridada a 48 ºC durante 15 minutos. Para la cuantificación de las bacterias filamentosas se ha utilizado el criterio subjetivo (FI) de Jenkins et al. (2004) (Tabla 3).

3. RESULTADOS Y DISCUSIÓN Tal como se ha especificado en material y métodos, la primera fase de este estudio presentaba como objetivos caracterizar el filamento tanto desde microscopía óptica como por FISH, para posteriormente evaluar las variaciones de densidad del filamento en función de los parámetros fisicoquímicos y operacionales.

nº 21 - Septiembre-Octubre 2016

02/11/16 09:29


Chemipol S.A. Joan Monpeó, 149 08223 Terrassa Tel. +34 937 831 044 Fax +34 937 837 580 chemipol@chemipol.com www.chemipol.com

Trabajando para una vida sostenible

Desalinización Ultrafiltración

ta 21 at meganema.indd 85

02/11/16 09:29


Artículo Técnico

TABLA 2 SONDAS UTILIZADAS PARA IDENTIFICAR LAS BACTERIAS FILAMENTOSAS DE LA EDAR. Nota: 1 Candidatus “Alysiosphaera europaea” 30; 2 Candidatus “Monilibacter batavus”; 3 Meganema perideroedes; 4 Chloroflexi variante A morfotipo 0092; 5 Sonda ayudante Chloroflexi variante B morfotipo 0092; 6 Morfotipo Nostocoida limicola II, phylum Chloroflexi; 7 El morfotipo 0803 pertenece al género Caldilinea dentro del filo Chloroflexi. Secuencia (5´-3´)

EUB 338 I

GCTGCCTCCCGTAGGAGT

Bacteria

20

EUB 338 II

GCAGCCACCCGTAGGTGT

Planctomycetes

20

EUB 338 III

GCTGCCACCCGTAGGTGT

Verrumicrobiales

20

EUB338IV

GCAGCCTCCCGTAGGAGT

Bacteria

20

ALF968

GGTAAGGTTCTGCGCGTT

Alphaproteobacteria

35

GAM42a

GCCTTCCCACATCGTTT

γ Proteobacteria

35

BET42a

GCCTTCCCACTTCGTTT

β Proteobacteria

35

CF319

TGGTCCGTGTCTCAGTAC

Cytophaga

35

GNSB941

AAACCACACGCTCCGCT

Chloroflexi

35

CFX1223

CCATTGTAGCGTGTGTGTMG

Chloroflexi

Noli-644

TCCGGTCTCCAGCCACA

Especificidad

% F1

Sonda

35 1

Ca.”A. europaea”

35

2

MC2-649

CTCTCCCGGACTCGAGCC

Ca.”M. batavus”

35

EU12-645

TCTCACCCTCAAGATCGC

M. perideroedes3

35

EU26-653

TCGCCTCTCTCATCCTC

M. perideroedes3

35

M. perideroedes

3

35

3

35

Meg983

CGGGATGTCAAAAGGTGG

Meg1028

CTGTCACCGAGTCCCTTGC

M. perideroedes

G123T

CCTTCCGATCTCTATGCA

Thiothrix spp.

40

G1B

TGTGTTCGAGTTCCTTGC

T.disciformis

30

G2M

GCACCACCGACCCCTTAG

T. eikelbomii

35

G3M

CTCAGGGATTCCTGCCAT

T. defluvii

30

TNI

CTCCTCTCCCACATTCTA

T. nivea

45

TFR

CTCCTCTCCCACACTCTA

T. fructosivorans

35

TEI

TCCCTCTCCCACATTCTA

comp. TNI y TFR

45/35

4

40

CFX197

TCCCGGAGCGCCTGAACT

Chloroflexi var. A

CFX197comp

TCCCGAAGCGCCTGAACT

Chloroflexi var. A

40

CFX223

GGTGCTGGCTCCTCCAG

Chloroflexi var. B5

35

CFX223 H202

AGCGCCTGAGCTTCAGTCATC

Chloroflexi var. B

35

6

35

AHW183

CCGACACTACCCACTCGT

N. limicola II

Caldi-0678

TTCCACCACTACACCGGG

Caldilinea

30

Comp1-Caldi-0678

TTTCACCACTACACCGGG

Sonda competidor 1

30

Comp2-Caldi-0678

TTCCACCGCTACACCGGG

Sonda competidor 2

30

7

30

T0803-0654

ACACCCTCTCACYRCCT

Morfotipo 0803

T0803ind-0642

CTGCCTCAAGCTACTCAG

Morfotipo 0803

30

h1 T0803ind-0607

AGTTAAGCCAGGAGATTT

Helper

30

h2 T0803ind-0625

TTTCCAACGACCCCTCCC

Helper

30

h3 T0803ind-0662

GAATTCTACACCCCTCTC

Helper

30

h4 T0803-0680

ATTCCACCACTACACCGG

Helper

30

86

ta 21 at meganema.indd 86

3.1. FASE IDENTIFICATIVA POR MICROSCOPÍA ÓPTICA Durante el periodo inicial, se caracterizo el filamento dominante. Ópticamente se identificó según el Manual de Jenkins et al. (2004) como Nostocoida limícola II, con una morfología del tricoma atípica: Meganema perideroedes (Alphaproteobacteria del grupo de las Nostocoida), con características ópticas similares a Thiothrix-T021N (Kragelund et al., 2006), pero con respuesta negativa al test del azufre. La caracterización morfológica y reactiva a tinciones quedó definida en la Tabla 4. En la Figura 2 se recogen algunos de los aspectos más significativos en el filamento dominante en la EDARI, tanto in vivo como en reactiva a las distintas tinciones. El efecto principal de la proliferación filamentosa es la disgregación flocular. Gracias a la robustez de este filamento, incluso a bajas concentraciones, es capaz de producir un importante esponjamiento del fango. Su desarrollo parece venir potenciado por altos niveles de fracción de DQO soluble combinado con limitaciones de oxígeno por sobrecarga en la EDARI. Respecto otros filamentos se han identificado a Thiothrix-T021N, T0041-0675 y Haliscomenobacter hydrossis. Como suele ser usual en afluentes con altas fracciones solubles de DQO, en este sistema juega un papel muy importante los gránulos de polihidroxialcanoato (PHA) y Neisser, encontrándose reacción positiva tras la tinción, como puede apreciarse en la Figura 3. Este aspecto es indicador de reservas de carbono y fósforo intracelulares que contribuyen, en función del estado metabólico de estos, a procesos viscosos.

nº 21 - Septiembre-Octubre 2016

02/11/16 09:29


Seguimiento de un proceso de bulking causado por Meganema perideroedes

Meganema perideoredes tiene alta capacidad para formar PHA (Kragelund et al., 2005 y 2006). Las células de Meganema crecen fundamentalmente en presencia de sustratos solubles de cadena corta (Kragelund et al., 2005).

3.2. FASE IDENTIFICATIVA POR TÉCNICA FISH Las características morfológicas de este filamento se ajustan a la descripción realizada por Eikelboom y Geurkink (2002) como Meganema perideroedes. El morfotipo Meganema perideroedes se parece a Thiothrix eikelbomii (Eikelboom, 2006) y su identificación es imprescindible confirmarla mediante la técnica FISH (Kragelund et al., 2006). La bacteria filamentosa Meganema perideroedes pertenece a la clase Alfaproteobacteria. En las Figuras 4 y 5 se muestran filamentos de Meganema perideroedes identificados con las sondas ALF968, Meg983/Meg1028mix y EU12-645/EU12-653mix. Otras bacterias filamentosas identificadas con la técnica FISH con valores de FI > 3 han sido identificadas con las sondas G123T/G2M (Thiothrix/Thiothrix eikelbomii) y GNSB941/CFX1223 (filo Chloroflexi) y T0803-654 (Morfotipo 0803 género Caldilinea) (Figura 6) El nivel de abundancia (FI) de los distintos filamentos identificados con la técnica FISH se indican en la Tabla 5.

TABLA 3 CRITERIOS DE VALORACIÓN DE JENKINS ET AL. (2004) PARA CALIFICAR LA ABUNDANCIA DE BACTERIAS FILAMENTOSAS Índice de filamentos (IF)

Criterio de abundancia

Descripción

0

Ninguna

Ningún filamento presente

1

Pocos

2

Algunos

3

Comunes

4

Muy comunes

5

Abundantes

6

Excesivos

Pocos filamentos y de forma casual en el flóculo Filamentos aproximadamente en la mitad de los flóculos Filamentos en todos los flóculos con baja densidad (1-5/flóculo) Filamentos en todos los flóculos con densidad media (5-20/flóculo) Filamentos en todos los flóculos con alta densidad (>20/flóculo) Más filamentos que flóculos, ocupando los flóculos y/o los espacios interfloculares

TABLA 4 CARACTERÍSTICAS DOMINANTES EN EL FILAMENTO DOMINANTE EN LA EDARI DE SUEROS LÁCTEOS Característica predominante Bacteria filamentosa

Filamento dominante en EDARI sueros lácteos

Tinción Gram

-

Tinción Neisser Tricoma

-

Tinción Neisser Tricoma gránulos + Otras inclusiones celulares

Fuertemente positiva en PHB

Diámetro Tricoma (μm)

En torno a 1,5 - 2

Longitud Tricoma (μm)

Muy largos, usualmente superior a 200

Morfología Tricoma

Torcidos o enrollados

Localización Tricoma

Interior o extendiéndose

Septos celulares visibles

Constricciones septos celulares

Claramente visible

Vaina

No

Crecimiento epifítico

No

Morfología celular

Células achatadas o redondeadas. irregulares

FIGURA 2. Caracterización óptica del filamento dominante. Contraste fases y campo claro. 1000x. In vivo, Tinción Gram, Neisser y PHB.

www.tecnoaqua.es

ta 21 at meganema.indd 87

87

02/11/16 09:29


Artículo Técnico

FIGURA 3. Actividad gránulo Neisser y PHB positivo. Tinción PHB y Neisser, 1000x. Campo claro.

FIGURA 4. FISH bacterias filamentosas A) bacteria sondas EUB338mix (verde), B) clase Alfaproteobacteria sonda ALF 968 (rojo), C) bacteria sondas EUB338mix (verde) y clase Alfaproteobacteria sondas ALF968+EUB338mix (naranja), 1000X.

FIGURA 5. A) bacterias filamentosas contraste de fases, B) bacteria sondas EUB338mix (verde) y Meganema perideroedes sondas Meg983/ Meg1028mix+EUB338mix (naranja) M, C) Meganema perideroedes sondas EU12-645/ EU12-653mix (rojo),1000X..

FIGURA 6. A) bacteria sondas EUB338mix (verde) y Thiothrix sondas G123T+EUB338mix (naranja), 600X; B) Morfotipo 0803 (género Caldilinea) sondaT0803-0654 (rojo), 1000X; C) “Candidatus Alysiosphaera europaea” sonda Noli644 (rojo), 1000X.

» El morfotipo Meganema perideroedes se parece a Thiothrix eikelbomii y su identificación es imprescindible confirmarla mediante la técnica FISH

88

ta 21 at meganema.indd 88

3.3. FASE EVALUATORIA ENTRE INCIDENCIA DEL FILAMENTO Y PARÁMETROS OPERACIONALES Y FISICOQUÍMICOS. El seguimiento microbiológico muestra la evolución recogida en la Figura 7. El seguimiento operacional y fisicoquímico realizado sobre la EDARI define dos problemáticas básicas que actúan directamente sobre la microbiota del sistema. Estas han quedado reflejadas en la Figura 8, donde puede observarse que tanto el estado de sobrecarga de DQO frente a diseño, como la altísima fracción soluble de esta, es prácticamente continuo. La aparición de Megenama perideroedes en este tipo de afluentes puede considerarse como habitual, tal como se ha descrito en ambientes similares, junto con Thiothrix sp. (Figueroa et al., 2015; Beccari et al., 2009; y Thomsen et al., 2006). La tasa específica de utilización por célula de Meganema perideroedes es de 1,9 x 10-15 mol de glucosa/hora y de 4,1 x 10-15 mol de acetato/hora, mientras que la tasa específica de utilización de Thiothrix sp. por célula es de 3,1 x 10-15 mol de acetato/hora. Los valores de la constante de saturación Ks para el acetato son de 1,8 μM para Meganema perideoredes y 2,4 μM para Thiothrix sp. (Nielsen et al., 2003). Estos valores explican la convivencia de ambas especies ante fracciones de DQO soluble muy altas y la fuerte implicación de M. perideroedes en el proceso viscoso al metabolizar más rápidamente sus sustancias de reserva bajo condiciones de estrés. Meganema perideroedes tiene más capacidad de almacenar PHA que Thiothrix sp. Bajo alimentación con acetato, Mcllroy et al. (2015) demostraron que se producía crecimiento de M. perideroedes,

nº 21 - Septiembre-Octubre 2016

02/11/16 09:29


ta 21 at meganema.indd 89

02/11/16 09:29


Artículo Técnico

TABLA 5 CUANTIFICACIÓN A PARTIR DEL ÍNDICE SUBJETIVO (FI) Índice de abundancia Sondas 11/03/15

20/05/2015

ALF 968

6

4

GNSB941/CFX1223 mix

4

3

CF319a

0

0

Meg 983/Meg 1028 mix

6

4

Noli-644

1

1

MC2-649

1

0

SNA

1

0

G123T

5

4

G2M

5

4

TNI

0

0

TFR

0

0

G1B

0

0

G3M

0

0

Caldi-0678

5

4

T0803 0654

5

4

T803ind-0642

3

0

CFX67a

0

0

CFX67b

0

0

CFX197

0

0

CFX223

0

0

CHL 1851

0

0

AHW 183

1

0

si tras la dosificación de acetato se generaba un periodo de hambruna. Esta capacidad de almacenaje ha repercutido en los importantes problemas de viscosidad detectados al comienzo del estudio. En la Figura 9 se puede apreciar cómo la viscosidad presente en el fango activo impide la toma de muestras mediante una pipeta Pasteur. Este problema de viscosidad está relacionado con altas reservas de PHA, típica en afluentes del sector agroalimentario (Baljeet et al., 2014), presente en los filamentos

90

ta 21 at meganema.indd 90

de Meganema perioedes, junto con niveles de oxígeno y redox muy bajos, característicos de las primeras semanas del presente estudio (Figura 10). Teniendo en cuenta que no presenta actividad anaeróbica (Kragelund et al., 2006), y que no dispone de actividad exoenzimatica (por lo que depende totalmente de la disponibilidad de la fracción soluble de la DQO), el mayor desarrollo de este filamento durante el periodo de déficit de oxígeno y bajos niveles redox (estado anaeróbico) debe achacarse

a otras causas distintas al metabolismo propio de la bacteria. Bajo condiciones anaeróbicas, como las ocurridas durante este periodo, se producen procesos fermentativos que fraccionan la DQO a ácidos grasos de cadena corta (Baljeet et al., 2014). Además, Meganema perioedes puede almacenar polifosfatos bajo estas condiciones (Kragelund et al., 2006), lo que hace a esta bacteria más competitiva al disponer de reservas tanto de carbono (Gránulos PHA) como de polifosfatos (Gránulos Neisser). En este sentido, Mcllroy et al. (2015) definen dos estrategias para controlar a Meganema perideroedes: trabajar con cargas másicas altas si las fracciones de la DQO son muy elevadas (acetato en su estudio); y adicionar biosoportes que reduzcan la fracción altamente biodegradable del sistema. Las medidas operacionales tomadas en planta, con mejora sustancial de la aireación a partir de mayo, permiten un control poblacional de este filamento, tal como queda reflejado en la Figura 11. A pesar de la nueva situación de déficit de oxígeno ocurrida durante el mes de junio (no acompañada de procesos anaeróbicos), tal como se aprecia en el redox de la Figura 10, no se producen crecimientos desmedidos del filamento. Esto está relacionado con la implantación de un proceso de nitrificación-desnitrificación desde el mes de mayo. La capacidad de Meganema perideroedes de metabolizar NO3 es menor que para el NO2 (Kragelund et al., 2005; Mcllroy et al., 2015). El ajuste de los periodos de nitrificación-desnitrificación se estuvo optimizando durante varios meses. Durante este tiempo se observó que el IVF de los dos reactores iba descendiendo pau-

nº 21 - Septiembre-Octubre 2016

02/11/16 09:29


Seguimiento de un proceso de bulking causado por Meganema perideroedes

FIGURA 7. Seguimiento microbiológico.

» Meganema perideroedes genera importantes problemas de bulking, si bien en el presente estudio no ha llegado a formar espumas. Los procesos de nitrificacióndesnitrificación parecen limitar el crecimiento de esta bacteria, siendo importante evitar nitrificaciones parciales que aumenten los niveles de nitritos en el sistema FIGURA 8. Evolución del caudal y del porcentaje de DQO soluble de entrada al reactor biológico durante el periodo de estudio.

www.tecnoaqua.es

ta 21 at meganema.indd 91

91

02/11/16 09:29


Artículo Técnico

FIGURA 9. Viscosidad presente en el fango activo durante los primeros muestreos que impide la separación correcta del mismo para tomar una gota con una pipeta Pasteur.

FIGURA 10. Evolución de la V30 y niveles de oxígeno y redox a lo largo del periodo de estudio.

FIGURA 11. Evolución del nivel de filamentos (m/mL) a lo largo del periodo de estudio.

latinamente (Figura 12) hasta alcanzar valores muy bajos y estables en el mes de diciembre. Paralelamente a este descenso del IVF, se produjo un aumento del grado de compactación del flóculo (Figura 13). Esto mejoró la decantación y la calidad del agua de vertido. Sin embargo, no se observó un descenso significativo del número de bacterias filamentosas durante este periodo de estudio. A nivel biológico ha sido significativa la aparición de colonias de aspecto globoso (Figura 14), vinculadas con una reducción del nivel de filamentos. La comunidad protozoaria relacionada con la mejor estructura del fango ha sido: Epicarchesium (típico de procesos con nitrificación-desnitrificación), pequeños flagelados, Vorticella convallaria, Cryptodifflugia, amebas desnudas, Euglypha, Acineria uncinata y Euplotes aedicu-

92

ta 21 at meganema.indd 92

latus (Figura 15). La dominancia de Criptodifflugia es indicativa de procesos de sobrecarga. La población de ciliados es de baja diversidad y densidad típicas de procesos N/DN. Respecto a micrometazoos, se han detectado rotíferos vinculados con buenas calidades y Aelosoma variegatum presente al final del estudio tras un episodio de envejecimiento del fango activo que degeneró en un proceso de fango rojo (Figura 16).

4. CONCLUSIONES El análisis biológico integral de esta muestra define un proceso de bulking generado por la bacteria Meganema perideroedes, que se desarrolla gracias a los altos niveles de fracción soluble de la DQO afluente y a limitaciones de oxígeno. Los gránulos de PHA son indicadores de altas fracciones de DQO soluble en el afluente. Los procesos anaerobios (-100 mV niveles redox) potencian la fermenta-

nº 21 - Septiembre-Octubre 2016

02/11/16 09:29


Seguimiento de un proceso de bulking causado por Meganema perideroedes

ción de la DQO y favorecen la asimilación de polifosfatos por parte de Meganema perideroedes, lo que la hace más competitiva respecto al resto de bacterias ante situaciones de estrés, como puede ser el déficit de oxígeno. Los gránulos Neisser en este filamento son indicadores de estos procesos. Operar a bajas CM (consecuencia de la alta DQO soluble que es internalizada por parte de las bacterias en forma de PHA y, por lo tanto, no utilizable hasta que sea metabolizado) y con niveles de oxígeno limitados, favorecen el desarrollo de este filamento. Ante variaciones en la carga es necesario aumentar la CM con el fin de evitar periodos de hambruna y disminuir la competitividad de este filamento. Meganema perideroedes genera importantes problemas de bulking, si bien en el presente estudio no ha llegado a formar espumas. La comunidad formada por Meganema perideroedes, ThiothrixT021N, T004-0675 y Haliscomenobacter hydrosis comparten condiciones ecológicas de crecimiento, asociado a limitación de oxígeno y alta disponibilidad de DQO soluble. Los procesos de nitrificación/desnitrificación parecen limitar el crecimiento de Meganema perideroedes, siendo importante evitar nitrificaciones parciales que aumenten los niveles de nitritos en el sistema. Los procesos de nitrificación-desnitrificación mejoran el grado de compactación del flóculo, disminuyendo el IVF y aumentando, por tanto, la capacidad de decantación del fango. En consecuencia, se produce una mejora en la calidad del agua de vertido. La comunidad biológica formada por colonias globosas, Epicarchesium, Cryptodifflugia, Euplotes aediculatus y rotíferos está vinculada a buenas condiciones floculares.

www.tecnoaqua.es

ta 21 at meganema.indd 93

FIGURA 12. Evolución del IVF en el periodo julio 2015-enero 2016.

FIGURA 13. De izquierda a derecha:

FIGURA 14. Distintas colonias de

aspecto del flóculo en los meses de octubre, noviembre y diciembre. In vivo. 100x. Contraste de fases.

aspecto globoso, encontradas en la muestra. In vivo. 100 y 200x. Contraste de fases.

93

02/11/16 09:29


Artículo Técnico

FIGURA 15. Epicarchesium y Acineria uncinata. In vivo. 100 y 400x. Contraste de fases.

FIGURA 16. Distintos microorganismos presentes en las muestras vinculados con buenas calidades del fango activo. 400x y 1000x. Contraste de fases. In vivo Euplotes aediculatus, ameba desnuda, Epicarchesium sp. Aelosoma variegatum y tecas de Cryptodifflugia en el interior flocular.

5. AGRADECIMIENTOS Los autores quieren dejar constancia de su agradecimiento a cada una de las empresas y centros a los que pertenecen, y a Emasesa por su apoyo y respaldo al trabajo. Bibliografía [1] Baljeet, S.; Grewal, A.; Kumar, P. (2014). Biotechnological production of polihydroxyalkanoates: A review on trends and

94

ta 21 at meganema.indd 94

latest developments. Chinese Journal of Biology. Volume 2014 doi.org/10.1155/2014/802984 [2] Beccari, M.; Bertin, L.; Dionisi, D.; Fava, F.; Lampins, S.; Majoen, M.; Valentino, F., Vallini, G., Villano, M. (2009). Exploiting olive oil mil effluents as a renewable resource for production of biodegradable polymers through a combined anaerobic-aerobic process. Journal of Chemical Technology and Biotechnology, 6: 901-908 [3] Eikelboom, D.H.; Geurkink, B. (2002). Filamentous micro-organisms observed in industrial activated sludge plants. Water Science and Technology, 46(1-2):535-542. [4] Eikelboom, D.H. (1975). Filamentous organisms observed in activated sludge. Water Research, 9: 365-388.

[5] Eikelboom, D.H. (2002). Process control of activated sludge plants by microscopic investigation. IWA 2002. [6] Eikelboom, D.H (2006). Identification and control of filamentous micro-organisms in industrial wastewater treatment plants (CD-ROM). IWA Publishing, Londres. [7] Figueroa, M.; Val del Rio, A.; Campos, J.L.; Méndez, R.; Mosquera-Corral, A. (2015), Filamentous bacteria existence in aerobic granular reactors. Bioprocess and Biosystems Engineering, 38(5): 841-851. [8] Jenkins, D.; Richard, M. G.; Daigger, G. T. (2004). Manual on the causes and control of activated sludge bulking and foaming. 3rd Edition. Lewis publishers (Michigan). [9] Jenkins, D.; Richard, M.G., Daigger, G.T. (1993). Manual on the causes and control of activated sludge bulking and foaming. 2nd Edition. Lewis publishers (Michigan). [10] Kragelund C.; Yunhong, K.; Waarde, J.; Thelen, K;, Eikelboom, D.; Tandoi, V.; Thomsen, T.R.; Nielsesn P.H. (2006). Ecophysiology of different filamentous Alphaproteobacteria in industrial wastewater treatment plants. Microbiology, 152: 3.003-3.012. [11] Kragelund, C.; Nielsen, J.L.; Thomsen, T.R.; Nielsen, P.H. (2005) Ecophysiology of the filamentous alphaproteobacterium Meganema perideoredes in activated sludge. FEMS Microbiology Ecology, 54:111-122. [12] Loy, A.; Maixner, F.; Wagner, M.; Horn, M. (2007). probeBase - an online resource for rRNAtargeted oligonucleotide probes: new features 2007. Nucleic Acids Research, 35:D800-D804. [13] Mcllroy, S.; Lapidus, A.; Thomsen, T.R.; Haynes, M; Lobos, E; Huntemann, M.; Pati, A.; Ivanova, N.; Markowitz, V.; Verbarg, S.; Woyke, T.; Klenk, H.P.; Kyrpides, N & Nielsesn, P. (2015). High quality genome sequence of Meganema Perideoredes str. Gr1T and a proposal for its reclassification to the family Meganemaceae fam. Nov. Standards in Genomic Science. 10:23. doi: 10.1186/s40793-015-0013. [14] Neilsen, P.H., Daims, H.; Lemmer, H. (2009). FISH Handbook for biological wastewater treatment. Identification and quantification of microorganisms in activated sludge and biofilms by FISH. IWA Publishing, Londres. [15] Nielsen, J.L.; Christensen, D.; Kloppenborg, M.; Nielsen, H. P. (2003). Quantification of cellspecific substrate uptake by probe-defined bacteria under in situ conditions by microautoradiography and fluorescence in situ hybridization. Environmental Microbiology, 5(3): 202-211. [16] Rodríguez, E.; Isac, L.; Fernández, N.; Zornoza, A; Salas, M.D.; Serrano, S.; PérezUz;B, Arregui, L.; Calvo, P.; Estévez, F. (2008). Manual práctico para el estudio de grupos bioindicadores en procesos de fangos activos. Reed Business Information-Tecnología del Agua. [17] Salvadó, H. (1990). Método rápido para el control del Bulking, técnica simple y rápida de contaje de microorganismos filamentosos. Tecnología del Agua, 67: 60-63. [18] Seviour, R.J.; Liu, J.R.; Seviour E.M.; McKenzie, C.A.; Blackall, L.L.;Saint, C.P. (2002). The “Nostocoida limicola” story: resolving the phylogeny of this morphotype responsible for bulking in activated sludge. Water Science and Technology, 46:105-110. [19] Seviour R.J.; Blackall L.L. (1999). The Microbiology of Activated Sludge. Kluwer Academic Publishers, U.S.A. [20] Seviour R.J.;Nielsen, P.H. (2010). The current taxonomic status of the filamentous bacteria found in activated sludge plants. Microbial ecology of activated sludge. IWA Publishing, Londres. [21] Thomsen, T.; Blackall, l.; Aquino de Muro, M., Nielsen, J. & Nielsen, P. H. (2006). Meganema perideroedes gen. No., sp. nov., a filamentous alphaproteobacterium from activated sludge. International Journal of Systematic and Evolucionary Microbiology, 56:1.865-1.868.

nº 21 - Septiembre-Octubre 2016

02/11/16 09:29


festo_cs.indd 1

31/10/16 15:56


Artículo Técnico

Secado solar de lodos y uso del lodo como energía renovable: cerrando el círculo El mayor problema en el tratamiento de aguas residuales es qué puede hacerse con el lodo residual. En general, existen varias opciones para su gestión, como los vertederos, la incineración o el uso como fertilizante agrícola en cantidades limitadas. Hoy en día, una tecnología sencilla permite transformar, de forma muy económica, el lodo residual deshidratado en una fuente de energía renovable. El lodo residual contiene sobre todo agua, que puede reducirse mediante los procesos habituales de deshidratación hasta una concentración de materia seca (MS) alrededor del 25%. En estas condiciones, el lodo puede incinerarse, pero la energía que se obtiene de la combustión es similar a la necesaria para evaporar el agua acompañante. Por lo tanto, se requiere realizar otra reducción del contenido de agua hasta que la masa contenga el 90% de MS, aumentando el poder calorífico hasta unos 10 MJ/kg. Así, el lodoresidual puede considerarse un claro sustituto del carbón con las ventajas de ser renovable y de tener unas emisiones neutras de CO2. Palabras clave Secado térmico lodos, lodo seco como combustible, lodo seco como energía renovable, energía renovable y neutra en dióxido de carbono, combustión lodo, generación energía térmica y eléctrica, ciclo de vapor saturado.

SOLAR SLUDGE DRYING TECHNOLOGY & DRIED SLUDGE AS RENEWABLE ENERGY - CLOSING THE LOOP The biggest problem in wastewater treatment is what can be done with the sewage sludge. Generally, there are few possibilities to manage it such as landfill, incineration or use it as a fertiliser in agriculture with limited amount. Nowadays, there is a simple technology that allows a very costly effective transformation from dewatered sewage sludge into a renewable energy resource. Sewage sludge contains mostly water which can be reduced by common dewatering processes until a dry solids (DS) concentration to about 25%. In this condition the sludge can be incinerated, but the energy that can be obtained from the burning may be equal to the required one to evaporate the accompanying water. So, another reduction on water content is required until the mass contains 90% DS under which the calorific value will be increased to about 10 MJ/kg. Then, the sewage sludge can be considered as a clear substitute for coal with the advantage of a renewable and carbon dioxide neutral CO2 emissions. Keywords Sewage sludge, sludge thermal drying, renewable energy, neutral carbon dioxide, alternative fuels, saturated steam cycle.

96

ta 21 at secado solar.indd 96

Osvaldo Garanto ingeniero agrónomo, director Técnico y de Ejecución de Pesa Medioambiente

nº 21 - Septiembre-Octubre 2016

02/11/16 09:58


Secado solar de lodos y uso del lodo seco como energía renovable: cerrando el círculo

1. INTRODUCCIÓN En la actualidad, un problema que debe tenerse muy en cuenta es la gestión eficiente y medioambientalmente adecuada del lodo generado por las estaciones depuradoras de aguas residuales (EDAR) [1]. Existen varias soluciones para el tratamiento del lodo, como la eliminación en vertederos, la aplicación agrícola, el compostaje o el secado térmico (Figura 1). El lodo se ha estado utilizando como fertilizante para la agricultura durante décadas dependiendo de si su composición era o no la adecuada. Si no lo era, se enviaba a un vertedero como residuo sólido. Cuando en algunas zonas se podían elegir varios residuos para aplicarse en la tierra, el compostaje era la opción que tenía como resultado un producto estabilizado que podía envasarse y comercializarse. Como resultado de la sobreexplotación de las tierras de cultivo, en muchas zonas ya no se permite la aplicación de lodo en la tierra. Ante esta situación, resulta obligatorio mejorar las nuevas soluciones técnicas. Estas deberán ser económicas y disponer de una optimización general de costes, de una gestión sencilla y de un bajo coste de funcionamiento y mantenimiento. Además, deberán ser seguras para los trabajadores y respetuosas con el medio ambiente. El sistema de secado de solar de lodos Passavant se ha desarrollado para proporcionar dicha solución.

2. SISTEMA DE SECADO SOLAR DE LODOS El lodo residual tal como se obtiene del proceso de tratamiento contiene, sobre todo, agua. Los procesos habituales de deshidratación reducen el contenido de agua e incrementan la concentración de la materia seca (MS) hasta un 25%. Al 25% de MS (75% agua) el contenido energético del lodo deshidratado está prácticamente compensado, es decir, si el lodo con este contenido de agua fuera incinerado, la energía que se obtendría de la combustión de la materia orgánica sería aproximadamente la misma que se necesitaría para la evaporación del agua acompañante [2]. El contenido de agua sólo puede reducirse más mediante el secado de lodos. La ventaja de este procedimiento es que no solo se reduce la masa de forma significativa, sino que, al 90% de materia seca, el poder calorífico aumenta hasta unos 12,5 MJ/kg (Figura 2). Cuando se compara el poder calorífico del lodo residual seco con otras fuentes de energía se observa que el lodo residual seco puede ser una energía alternativa interesante. Esto significa que el lodo residual, si se se-

www.tecnoaqua.es

ta 21 at secado solar.indd 97

FIGURA 1. Sistema de secado solar de lodos. Una nueva solución para la gestión de los lodos.

FIGURA 2. Cambio de masa y de poder calorífico [2].

TABLA 1 LODO RESIDUAL SECO COMO COMBUSTIBLE [2, 3, 4] Combustible Lodo 85-92% MS Madera seca Carbón mineral Lignito

Poder calorífico inferior (MJ/Kg) 8,9 - 12,5 - 15,8 15,5 - 19 ~ 29 8,4 - 16,8

ca al 90% de MS, no es residuo, sino una interesante alternativa energética como se muestra en la Tabla 1. Dado que el lodo residual tiene su origen en productos alimentarios, también es una energía renovable y neutra en dióxido de carbono. Esto significa que utilizar lodo seco como sustituto del combustible no solo reduce el consumo de energía primaria, sino que también evita las emisiones de CO2 procedentes de los combustibles fósiles.

97

02/11/16 09:58


Artículo Técnico

FIGURA 3. Diagrama de flujo.

Según la Tabla 1, existen otras conclusiones adicionales que deben tenerse en cuenta: - Dos toneladas de lodo residual seco equivalen, en poder calorífico, a una tonelada de carbón mineral. - Una tonelada de lodo residual seco utilizada como combustible evita 0,48 toneladas de emisiones de CO2 procedentes de combustibles fósiles.

FIGURA 4. Planta de secado solar de lodos (25.467 t/año) con recuperación energética utilizando el lodo residual como combustible granulado.

- Las fábricas de cemento y las centrales eléctricas pueden reducir su demanda de energía primaria y también reducir las emisiones de CO2 [5, 6]. En España, en una fábrica de cemento de Alicante, se sustituyó parte del carbón utilizado como combustible primario por lodo residual seco. Según el contenido calorífico del carbón sustituido de 26 GJ/t y en una relación de 93 kg CO2/t de carbón, se alcanzaron los siguientes indicadores medioambientales: s ,A ENERGÓA RESIDUAL DE LA FÉBRICA DE CEMENTO UTILIZA da para el secado térmico supuso una ganancia de 46 millones de termias al año, el equivalente a unas 18.000 t/CO2. s ,A ENERGÓA SUMINISTRADA POR LA COMBUSTIØN DEL LODO en el horno (valor medio de 12,5 MJ/kg) supuso una ganancia de 53 millones de termias al año, el equivalente a unas 20.500 t de CO2.

3. DESCRIPCIÓN DEL PROCESO El diagrama de flujo de la Figura 3 ayuda a describir el proceso y muestra, a título de ejemplo, algunos datos de un proyecto diseñado por Pesa Medioambiente. En la Figura 4 se describe el sistema completo para una mejor comprensión.

98

ta 21 at secado solar.indd 98

nº 21 - Septiembre-Octubre 2016

02/11/16 09:58


Secado solar de lodos y uso del lodo seco como energía renovable: cerrando el círculo

El lodo deshidratado al 20-30% de materia seca, obtenido en la EDAR, se introduce en contenedores o camiones y se lleva a la planta de secado solar de lodos, donde se almacena en un tanque de recepción con capacidad pulmón suficiente de 5 a 10 días como mínimo, para cubrir posibles eventualidades y también para equilibrar la diferencia que existe entre la capaci-

dad de tratamiento medio de la planta y la producción de lodos. Considerando una producción de lodos de 25.454 t/año con un contenido de materia seca del 22%, se necesita un depósito tampón de hormigón con un volumen total de 210 m3, dividido en tres partes de 70 m3 cada una. Este depósito tampón viene provisto de un fondo móvil que efectúa ciertos movimientos hacia delante y hacia atrás para trasladar los lodos del fondo FIGURA 5. Depósito tampón de recepción. del depósito hasta la superficie de secado (Figura 5). La superficie de secado consiste en un invernadero equipado con un dispositivo automático de volteado y transporte de lodos que lo llevan de un lado al otro. El constante movimiento de los lodos evita la formación de acumulaciones y asegura la frecuente renovación de la superficie para aumentar la evaporación. La radiación solar se utiliza para evaporar el agua. Además, existe la posibilidad de montar un sistema de calefacción por aire y suelo que utilizará el agua de refrigeración a 90 ºC procedente de una unidad de cogeneración (CHP), siempre que esta exista o esté disponible. En el proyecto mencionado anteriormente como ejemplo, estaba previsto recuperar la energía térFIGURA 6. Invernadero. Dispositivo automático de volteado mica obtenida del agua calentada como cony transporte de lodos. secuencia de ser utilizada para condensar el vapor saturado a la salida de una turbina de vapor. El agua evaporada de los lodos durante el proceso de secado sale del invernadero a través de las aberturas en el tejado o de los orificios previstos para ello. El secado de los lodos tarda algunos días, dependiendo de las condiciones meteorológicas y de la cantidad de energía térmica residual disponible en la unidad de cogeneración, siempre que esta pueda utilizarse. La superficie necesaria para el secado de 25.454 t/año del 22% MS al 85% MS es de FIGURA 7. Sistema de calefacción de suelo: un colector de ½” cada 10 cm 5.300 m2 (Figura 6), dividida en tres canade ancho con agua caliente de 55 ºC a 90 ºC. les diferentes de 12,5 m de ancho por 96 m de largo, y equipada con un sistema de calefacción de suelo, que utilizará el agua de refrigeración recuperada a 85ºC (Figura 7) del sistema de refrigeración para condensar el vapor saturado a baja presión en la salida de una turbina. La cantidad de lodo seco al 85% MS será de 6.591 t/año, cuyo poder calorífico estará alrededor de 2.950 kcal/kg. Al final de la superficie de secado, los lodos caen en

www.tecnoaqua.es

ta 21 at secado solar.indd 99

99

02/11/16 09:58


Artículo Técnico

FIGURA 8. Producto final: > 80% MS. Granulado de 0 a 8 mm de diámetro.

FIGURA 9. Caldera y quemador.

un elevador de cangilones y se almacenan en un silo (Figura 8). Para recuperar el poder calorífico del lodo seco, el sistema está provisto de una caldera que lo utiliza como combustible, con una capacidad para quemar de 0,85 t/h de lodo seco, obteniendo así 3,6 t/h de vapor saturado a 9,5 barg y 178 ºC. (Figura 9). El vapor saturado a alta presión se utilizará en una turbina, donde la presión se reducirá de 9,5 barg a 1,25 barg (105ºC) y, como resultado, se obtendrá, por una parte, una producción de energía eléctrica de entre 150 y 250 kWh (Figura 10), que se utilizará en la propia planta o se enviará a la red, y por otra parte, vapor a baja presión. El vapor saturado a baja presión en la salida de la turbina pasará a un intercambiador en donde condensará. Al mismo tiempo, los 59,5 m3/h a 2,5 barg de agua de refrigeración utilizados para condensar el vapor, aumentarán su temperatura de 55 ºC a 85 ºC. El vapor condensado a 105 ºC vuelve a la caldera. El agua caliente obtenida en el intercambiador a 85ºC, se envía al sistema de suelo calefactado, ayudando así a que el agua de los lodos se evapore y reduciendo la superficie necesaria de secado.

4. COMPARACIÓN TÉCNICA Y ECONÓMICA ENTRE DIFERENTES SISTEMAS DE SECADO TÉRMICO DE LODOS

FIGURA 10. Turbina.

100

ta 21 at secado solar.indd 100

Según las características tanto técnicas como económicas mostradas en la Tabla 2 [7] y en la Tabla 3 [8], así como según los rendimientos obtenidos en las plantas de Passavant, se puede afirmar que los sistemas basados en una baja temperatura de secado térmico, aquellos en los que la temperatura de funcionamiento es inferior a 80 ºC (Tabla 2), son más económicos, tienen una optimización general de costes, una gestión sencilla y un bajo coste de funcionamiento y mantenimiento. Además, son más seguros para los trabajadores y más respetuosos con el medio ambiente que los que requieren una alta temperatura de funcionamiento. Asimismo, teniendo en cuenta que la eliminación de los lodos en un vertedero de residuos puede tener un coste de entre 70 y 160 €/t, dependiendo de su composición, de la distancia al vertedero, de la producción anual, o incluso, de si están disponibles o no otras soluciones posibles, tales como el uso agrícola en la misma zona, el uso de los sistemas de secado térmico a baja temperatura supone un

nº 21 - Septiembre-Octubre 2016

02/11/16 09:58


Secado solar de lodos y uso del lodo seco como energía renovable: cerrando el círculo

TABLA 2 COMPARACIÓN TÉCNICA ENTRE DIFERENTES SISTEMAS DE SECADO TÉRMICO DE LODOS [7]. Nota: Tanto la energía como la potencia se refieren a toneladas de agua evaporada.

Sistemas de secado

Secadero de Secadero tambor por rotatorio por convección conducción

Secadero de bandejas vertical

Secadero de cinta

Secadero de capa fina

Incinerador/ secadero de lecho fluidizado

Passavant

300 - 500

100 - 130

100 - 130

55 - 70

200 - 270

80 -100/900

Condiciones meteorológicas

>20

>20

>20

>20

>5

>25 / <40

>20

MS out (%)

90 - 95

85 - 95

90 - 95

85 - 95

90 - 95

>95

>95

Energía: kcal/kg kWh/t

750 - 900 900 - 1.050

750 900

750 900

774 - 860 900 - 1.000

750 - 1.000 900 - 1.200

800 - 900 900 - 1.000

860 -1.000 1.000 - 1.160

60 - 400

80 - 150

130 - 300

130 - 150

12 -15

12 -15

12 -15

12 -15

T (ºC) MS in (%)

Potencia (kWh/t) Vida (años)

12 -15

Funcionamiento (h/a) 7.200 - 8.000

menor coste de funcionamiento e inversión para las plantas con capacidad de tratamiento de 50.000 t/a a 200.000 t/a. Además, este tipo de tratamiento también resulta efectivo cuando no hay posibilidad o cuando existe una normativa estricta en la zona respecto al número de toneladas de lodos que puede utilizarse en la agricultura. La baja energía térmica necesaria para el sistema Passavant (1.000 a 1.160 kWh/t) para evaporar el agua de los lodos, junto con el menor consumo de energía, de 30 a 60 kWh/t, hacen que este sistema sea la solución más económica siempre que el espacio no esté limitado.

5. CONCLUSIONES Una vez descritas las características técnicas y económicas del sistema de secado solar de lodos de Passavant, cerrando el círculo con el aprovechamiento térmico del lodo seco, mediante su combustión para la generación de vapor saturado a alta presión, y el uso de este en una turbina de vapor, generando a su vez energía eléctrica para el autoconsumo o su exportación a red, y agua caliente residual, con capacidad térmica suficiente para su reutilización en el suelo calefactado del invernadero, se enumeran a continuación las más relevantes [2]: - Sistema completamente automático y proceso continuo. Los lodos se introducen por un lateral del inver-

www.tecnoaqua.es

ta 21 at secado solar.indd 101

8.000

30 - 60 25

30

24 h/d, 7d/s

8.000

nadero y se mueven durante el proceso de secado al otro lado. - Los lodos se secan del 18% MS a > 95% MS. - Los lodos se secan utilizando radiación solar y, si está disponible, con calor residual adicional procedente de unidades de cogeneración (CHP) o de turbinas de vapor. - El grosor de los lodos se reduce mediante secado de ~ 0,15 m (6 in) en el lado de introducción a ~ 0,038 m (1,5 in) en el lado de salida. - La distribución/volteado dentro del invernadero se realiza utilizando un rascador de cinta y unos rastrillos. - Desaparecen los problemas de suciedad o polvo gracias a la estabilidad del sistema de transporte. - Desaparecen los problemas de mal olor gracias a la fina capa de lodos y al volteado continuo, lo que permite mantener condiciones aeróbicas. - Mantenimiento mínimo y sencillo. - Muy bajo coste de inversión 660-1.050 €/t MS y de funcionamiento 60-105 €/t MS. - Anchura de ~10 m a 12,5 m. Largo de 50 a 120 m por canal. - No hay contaminación ni contacto con los lodos. - El uso de calor residual adicional puede reducir la superficie necesaria de secado en un 75% y permite obtener una alta concentración de MS (>90%). - Alta tasa de evaporación y eficiencia gracias a las finas capas de lodos.

101

02/11/16 09:58


Artículo Técnico

TABLA 3 COMPARACIÓN ECONÓMICA ENTRE DIFERENTES SISTEMAS DE SECADO TÉRMICO DE LODOS [8] Material

Capacidad 103 t/a

Capacidad 103 t MS/a

Inversión millones €

Inversión €/(t MS/a)

Funcionamiento €/t MS

Secado térmico + quemador

Lodo deshidratado

50 - 200

11,5 - 46

4,8 - 13,8

290 - 410

105 - 130

Secado térmico +CHP

Lodo deshidratado

50 - 200

11,5 - 46

9,6 - 27,0

590 - 830

40 - 110

Lodo deshidratado

10 - 50

2,3 - 11,5

2,4 - 9,0

780 -1.050

60 -105

Lodo deshidratado

50 - 200

11,5 - 46

9,0 - 30,0

660 - 1.050

60 - 105

Lodo deshidratado

10 - 47

2,3 - 10,8

2,6 - 7,8

730 - 1.120

60 - 140

Lodo deshidratado

10 - 33

2,3 - 7,6

1,4 - 2,8

360 - 610

150 - 220

Lodo deshidratado

50 - 200

11,5 - 46

14,4 - 39,1

850 - 1.250

30 - 110

Oxidación supercrítica (OASC)

Lodo deshidratado

90

20,7

4,3

210

200

Sistema de oxidación Vertech

Lodo deshidratado

622

28

36,1

1.290

250

Biometanización + CHP

FORSU/lodo 80/20

35 -140

81 - 32

12,0 - 28,8

890 - 1.500

70 - 140

Lodo deshidratado

50 - 200

11,5 - 46

Lodo deshidratado

240

55,2

Incinerador + turbina de vapor

Lodo deshidratado

50 - 200

11,5 - 46

Compostaje en hilera

Lodo deshidratado

10 - 150

2,3 - 34,5

0,5 - 3,1

90 - 240

40 - 85

Compostaje en túneles

Lodo deshidratado

10 - 150

2,3 - 34,5

2,5 - 18,3

530 - 1.080

90 - 170

Compostaje en canales

Lodo deshidratado

10 - 150

2,3 - 34,5

1,2 - 7,8

220 - 510

60 - 140

Sistema

Secado solar Passavant + quemador + turbina de vapor Secado solar Passavant + quemador + turbina de vapor Secado térmico de cinta + CHP Secado eléctrico con bomba de calor Secado térmico + CHP + gasificación

Secado preliminar + incinerador + turbina de vapor Secado preliminar + incinerador (Dordrech)

- Los lodos no se adhieren, dado que están en constante movimiento - El área de superficie es un 19% mayor gracias al dispositivo automático de volteado y transporte. - Muy bajo consumo eléctrico (30-60 kWh/t agua evaporada). - El uso del lodo seco como fuente de energía renovable evita el consumo de combustibles fósiles y produce una emisión a la atmósfera de dióxido de carbono neutro. - El cambio de paradigma que supone el pasar de considerar los lodos deshidratados de las EDAR como un residuo a considerarlos, después de secos, como una nueva fuente energética renovable es una opción importante a considerar para la mejora de su gestión medioambiental, energética y social. Bibliografía [1] Uhre, L.; Meozzi, P. (1997). Sludge treatment and disposal. Management approaches and experiences. Asuntos Medioambientales

102

ta 21 at secado solar.indd 102

25,2 - 72,7 1.590 - 2.180 77,5

1.400

29,4 - 85,3 1.850 - 2.570

220 - 320 250 250 - 350

serie nº 7. Grupo de trabajo ISWA en aguas residuales y lodos de depuradora y Agencia Europea de Medio Ambiente. Copenhague. Disponible en la página web: http://www.eea.europa.eu/publications/ GH-10-97-106-EN-C/download [2] Zizmann, R.; Wicht, H.; Fassbender, D.; Garanto, O. (2009). El método Roediger EDZ de secado de fangos de aguas residuales. V Jornadas Técnicas de Saneamiento y Depuración: eficiencia energética en el tratamiento de las aguas residuales. Esamur, 26 de noviembre de 2009, Murcia (España). [3] Ortega. E., Sobrados. L.( 2009). Caracterización de los lodos de depuradora generados en España. Ministerio de Medio Ambiente y Medio Rural y Marino, Madrid Disponible en la página web: http://www. magrama.gob.es/es/calidad-y-evaluacion-ambiental/temas/prevencion-ygestion-residuos/Caracterizaci%C3%B3n_de_los_lodos_de_depuradoras_ generados_en_Espa%C3%B1a_(NIPO_770-10-256-5)_tcm7-183315.pdf. [4] Bonmatí. A.; Burgos, L. (2012). Anàlisis del PCI i PCS de diferents mostres de fangs de depuradora. Giro, Mollet del Vallès (Barcelona, España). [5] Cembureau - Asociación Europea del Cemento (1999). Environmental benefits of using alternative fuels in cement production. A lifecycle approach. Bruselas, disponible en la página web: http://www. wbcsdcement.org/pdf/tf2/CEMBUREAU.pdf. [6] Permuy, D.; Arauzo, I. (2012). Biomass low temperature drying. A successful case sludge management in a cement factory to meet Kyoto protocol. Conferencia Europea sobre Secado - EuroDrying 2011, Palma, Islas Baleares, España, 26-28 de octubre de 2011. [7] Sánchez, J. (2004). Estudio de las tecnologías de secado de biosólidos procedentes de EDAR. Proyecto Fin de Carrera. Página 140. Escuela Superior de Ingenieros, Universidad de Sevilla, disponible en la página web: http://bibing.us.es/proyectos/abreproy/3779/fichero/Capitulo_30.pdf. [8] Fundación Centro Canario del Agua. Análisis de la situación y posible evolución de las tecnologías para el tratamiento de lodos de depuración. Página web: http://fcca.es/documentos/05_documentos_por_temas/ Depuracion%20y%20reutilizacion%20/Tecnologiaslodos.pdf.

nº 21 - Septiembre-Octubre 2016

02/11/16 09:58


lacroix.indd 1

31/10/16 15:57


Artículo Técnico

Experience with the treatment of the water/steam cycle with film forming amine technology The film forming amine technology usually results in technically better treatment results with regard to more stable pH distribution, less corrosion especially in the condensate system, thinner oxide layers and less un-planned plant shut-downs due to technical failures. This is especially valid in industrial plants frequently treated with oxygen scavengers combined with steam alkalization by ammonia or alkalizing amines and separated dosage of caustic or phosphates into the boiler drum. These overall technical improvements in plant operation lead directly to less consumption of water and energy resulting in significant savings. Palabras clave Corrosion, cost reduction, film forming amines, steam boiler, water.

EXPERIENCIA EN EL TRATAMIENTO DEL CICLO DE AGUA/VAPOR DE CALDERAS CON LA TECNOLOGÍA DE AMINAS FILMANTES La tecnología de aminas filmantes se traduce, por lo general, en resultados técnicamente mejorados en el tratamiento del agua de calderas, implicando una distribución más estable del pH, menor corrosión especialmente en el sistema de condensado, capas de óxido más delgadas y menor número de paradas no planificadas en planta debidas a fallas técnicas. Esto es especialmente válido en las plantas industriales tratadas frecuentemente con eliminadores de oxígeno combinados con alcalinización de vapor por amoníaco o aminas alcalinizantes, y con dosificaciones por separado de sosa cáustica o fosfatos en el tambor de la caldera. Estas mejoras técnicas globales en las operaciones de planta conllevan directamente un menor consumo de agua y energía que resultan en un ahorro significativo. Keywords Corrosión, reducción de costes, aminas filmantes, calderas, generadores de vapor, agua.

104

ta 21 at kurita.indd 104

Anna Icart Licenciada en Química marketing manager Products and Markets Kurita Europe GmbH Andre de Bache ingeniero químico product manager Boiler Water Kurita Europe GmbH Wolfgang Hater doctor en Química director R&D Water Kurita Europe GmbH

nº 21 - Septiembre-Octubre 2016

02/11/16 10:00


Experience with the treatment of the water/steam cycle with film forming amine technology

1. INTRODUCTION It is well known that the most significant resources in the most industries are water and energy. The main part of the water and energy consumption comes from production of steam used in the process. Reductions in one of those resources have a positive impact on the profitability of production process. Many industries operate steam generators of different types to cover their process steam and energy requirements. The boiler feedwater has to be treated in order to ensure reliable and economic operation of the boilers and avoid failures through corrosion or scaling. T h e s t a n d a rd c o n v e n t i o n a l treatments concepts are usually based on three components; oxygen scavengers, alkalizing amines and phosphates or caustic soda. Medium and high pressure boilers usually apply all volatile treatment (AVT) programs with (AVT-R) or without (AVT-O) the addition of reducing agents. In recent years, organic cycle chemistry based on film forming amines, which are usually applied in combination with alkalizing amines, has been consolidated as a well investigated alternative to conventional treatment programs. In contrast to the traditional AVT-R treatment concept which is still applied frequently in medium and high pressure steam generators around the globe the film forming amine technology does not require the addition of any reducing agent like hydrazine to the cycle. The film forming amine molecules do not react with the oxygen itself, but due to their intrinsic and characteristic properties they adsorb onto metal surfaces establishing a thin and hydrophobic, protective film, fostering a smooth and compact iron oxide layer with excellent protection against corrosion.

www.tecnoaqua.es

ta 21 at kurita.indd 105

The film forming amine technology usually results in technically better treatment results with regard to more stable pH distribution, less corrosion especially in the condensate system, thinner oxide layers and less unplanned plant shut-downs due to technical failures. This is especially valid in industrial plants frequently treated with oxygen scavengers combined with steam alkalization by ammonia or alkalizing amines and separated dosage of caustic or phosphates into the boiler drum. These overall technical improvements in plant operation lead directly to less consumption of water and energy resulting in significant savings. One case study on the experience is presented in this contribution: a south European industry with a water/steam cycle that consists of two boilers feed with demineralized water and producing 24 ton/h of steam with a condensate return rate of 90%. The conditioning of the boiler was changed from the conventional treatment to film forming amine technology and a field trial was conducted during 3 months. In the close follow-up done was observed a reduction of 50% in the blow-down and an improvement in

the condensate quality. In addition of generating water savings, the implementation of the film forming amine program provided savings in man power hours and in total chemical consumption costs.

2. FILM FORMING AMINES Conventional boiler water treatment programs generally have three components: oxygen scavengers, phosphate/phosphonate and alkalizing amines. In contrast, a treatment program based on FFAs is based on a combination of a film-forming component with alkalizing amines. Both treatment concepts can be widened to include a poylcarboxylate.

2.1. THE CHEMISTRY OF FILM FORMING AMINES FFAs, often referred to as polyamines or fatty amines, are defined chemical substances that belong to the oligoalkylamino fatty amine family. The FFAs are always used in combination with alkalizing amines and other active substances as dispersants in order to adjust the pH of the boiler water and the condensate and, at the same time, to ensure the necessary storage stability of the formulations.

FIGURE 1. Structure of calcium carbonate crystals without (left) and with (right) added film forming amine.

105

02/11/16 10:00


Artículo Técnico

FIGURE 2. Gradual removal of existing calcium scale from a steam generator by film forming amines (left: before treatment; right: after one year of treatment).

2.2. PROPERTIES OF FILM FORMING AMINES When FFA-based treatment programs are used, knowledge of the specific properties of these substances and the practical consequences of these properties is essential. A number of important properties are described in the following.

2.2.1. Surface affinity FFAs are not pronounced antiscalants, such as polycarboxylates. However, due to their high surface affinity they are adsorbed by the microcrystallites that form at the start of the crystallization process and interfere with their growth. Amorphous, low-scaling structures are formed (Figure 1).

FFAs have a very strong affinity to metal surfaces. The film acts as a barrier against corrosive substances such as oxygen and carbon dioxide, or carbonic acid. Once formed, a protective film remains intact even after the dosage has been adjusted, so that if the dosage falls below the required level or is interrupted for a short period, no direct harm occurs. Due to their strong surface affinity, FFAs can gradually remove attached substances such as calcium scale or loosely adhering iron oxides, e.g. magnetite, from the surface (Figure 2).

2.2.2. Improved magnetite protective layer Compact, thin and smooth magnetite layers are desirable in steam

generators. An uneven, rough and porous covering layer tends to lose particles or larger fragments to the liquid or steam phase, especially when load changes occur, with the associated thermal stresses. As part of a research project at the University of Rostock [10], magnetite layers were formed on tubes under defined conditions in test steam generators and subjected to surface analysis. Tubes treated with FFA had a much smoother and homogeneous surface than tubes examined after a conventional trisodium-phosphate based treatment program. Figure 3 shows the images obtained from the tubes with the help of confocal laser scanning spectroscopy (CLSM). The measured microroughness was

FIGURE 3. Confocal laser scanning microscopy (CLSM) of tubes from a test steam generator treated with sodium phosphate (left) and film forming amine (right).

106

ta 21 at kurita.indd 106

nº 21 - Septiembre-Octubre 2016

02/11/16 10:00


Experience with the treatment of the water/steam cycle with film forming amine technology

1.45 μm after FFA-based treatment and 2.25 μm after the phosphate program. The main aim of the project w as to determine the influence of FFA on the thermal behavior of steam generator tubes subjected to different treatments. The very thin film on the magnetite layer has a significant positive influence on heat transmission. The boiling curves of the tubes treated with FFA were above those obtained after the phosphate treatment over the total spectrum of industrially relevant heat fluxes. Consistently higher heat transmission coefficients were measured after FFA treatment during the full period of the experiment (up to 430 h). Figure 4 shows the net improvement relative to tubes analyzed after phosphate treatment. When the tests with FFA (FF A) were carried out using tubes with bare metal surfaces, there was a relative improvement of between 90 and 150% in the heat transmission coefficient. When the tubes had first been treated with phosphate and the treatment was then changed to FFA (PO4 FFA), the improvement was still 40 to 90%. This effect can be vividly illustrated by Figure 5 showing a comparison of the boiling behavior for a heated tube treated with a phosphate based program or FFA. A clearly intensified boiling can be observed immediately after the change of treatment program to FFA [11]. As a consequence, when fee d water is treated with FFA, the temperature of the exhaust gas can be expected to be lower. This increases the efficiency of the steam generator and therefore cuts the CO2 emissions. For reasons of complexity, the expected effect cannot be calculated quantitatively.

www.tecnoaqua.es

ta 21 at kurita.indd 107

FIGURE 4. Relative improvement in the heat transmission coefficient k after treatment with film forming amine s as a function of the heat flux density, after starting with bare metal tubes (FFA), and with tubes that had previously been treated with sodium phosphate (PO4 FFA). Values relative to bare metal tubes treated with sodium phosphate (PO4; corresponds to 0%).

FIGURE 5. Freeze-frame images of boiling process at 15 bar (218 psi) at a heat flux density of 10 kW/m² (34,100 BTU/(hm²). Left (PO4,00): Phosphate treatment at the thermal steady state; right: the very same tube directly after changeover to FFA treatment.

2.2.3. Steam volatility The steam volatility of FFAs in the condensate of a steam generator can be demonstrated by qualitative analysis. Steam volatility is described quantitatively by the distribution equilibrium, which was determined for various representatives of this class of substances [12]. Through its steam volatility, FFA protects the plant completely against corrosion, as film-formation takes place throughout the steam generator. Figure 6 shows the improvement in corrosion protection using metal coupons that were

built into the condensate system of a boiler plant for approx. 90 days. Oxygen corrosion can be seen clearly o n the coupon from the boiler with a conventional treatment program of sulphite, phosphate and alkalising amine, while the coupon from the boiler treated with FFA shows only slight flash rust, formed after removal of the wet coupons.

3. DOSING FILM FORMING AMINES As is the case with conventional treatment programs, an FFA-based product can best be added to the

107

02/11/16 10:00


Artículo Técnico

FIGURE 6. Inhibition of corrosion of steel strips from a condensate system of a steam generator treated with programs based on sulphite, phosphate and alkalizing amine (left) and film forming amine and alkalizing amine (right).

of the bengal rose method is about 0.1 ppm [13].

5. CASE STUDY: CHANGEOVER OF BOILER WATER TREATMENT TO FFA IN A WOOD MANUFACTURING PLANT

feed water by means of a dosing pump that is controlled on the basis of the volume of make-up water. Commercial products are supplied as solutions that are ready for dosing. When an FFA-based product is used, there is no longer any need to go through the error-susceptible process of preparing solutions from powders and adjusting the quantities of different components to the treatment result. The dosing system must not have any parts made of Viton, as the filmforming components attack this material. EPDM is recommended as the sealing material and Teflon is recommended as the membrane material. Product dosing systems base d on the measurement of FFA are usually designed to deliver the product at a rate that ensures that only a small amount of FFA can be detected in the condensate, feed water and boiler water. Detection of just the presence of FFA suffices. Sustained overdosage over a long period can cause agglutination in system parts, e.g. filters pumps and heat exchangers. The treatment should be monitored by regularly determining the dosing rate by balancing the product consumption with the quantities of make-

108

ta 21 at kurita.indd 108

up water. In addition, the iron content of the boiler water and the condensate should be analyzed, as well as the pH and the concentration of the FFA in the feed water, boiler water and especially in the condensate. Threshold values for ultimate biodegradability (e.g. according to OECD methods 301 A-F) are reached and the products are supposed to be well biodegradable.

4. ANALYSIS When FFA is determined as the central component of the treatment concept, special rules must be observed in order to obtain meaningful results. FFA can only be determined analytically in its free state in the water phase. The FFA bonded to the metallic surfaces cannot be determined. The adsorption of the F FA depends on the area of the metallic surface, the temperature and the excess FFA in the water phase. There is therefore no correlation between the added quantity and the amount of free FFA determined in the water. The FFA is determined either as cationic surfactant (possible interference due to use of dishwashing detergents) or as a complex by means of a specific dye. The detection limit

One of the world’s largest manufacturers of laminate wood was committed to optimize its industrial process to reduce cost and to minimize its impact on the environment. The manufacturer observed that one important source of water and energy consumption was the production of steam, needed for process heating and drying. The boiler s were treated with conventional treatment, based on sulphites, phosphates and alkalizing amines. Figure 7 shows a simplified flow scheme of the complex steam generation system. It consists of 4 different boilers, two gas fired shell type boilers each with a steam capacity of 16.5 t/h (36.4 · 103 pph), one water tube HRSG of a gas turbine with 33 t/h (72.8 · 103 pph) steam capacity and an incinerator burning wood and production wastes with 8t/h steam capacity. The boilers are operated at pressures between 21 and 23 bar (305 and 334 psi). Each boiler is equipped with economizer and superheater. The superheated steam temperature is 260 °C (500 °F). All four steam generators are fed from one feed water tank. The feed water is thermally deaerated with steam from the common steam drum. The raw water is filtered and softened before it is fed to the feed water tank. The superheated steam of all four boilers is collected in the main steam drum. It is used in the production process and the condensates are partially returned without further cleaning to the feed water tank.

nº 21 - Septiembre-Octubre 2016

02/11/16 10:00


Experience with the treatment of the water/steam cycle with film forming amine technology

FIGURE 7. Flow scheme of steam generator system of a wood manufacturing plant. (E: economizer; SH: superheater).

A major challenge for any treatment program of the water/ steam cycle was the non-continuous operation of the boilers. One shell type boiler was kept as a reserve in hot stand-by and the gas turbine was typically in operation only for 5 to 6 months a year. The total annual steam production typically is around 100,000 t/y (25,700 pph). The conventional treatment program was suffering from poor pH control of the condensate leading to high levels of iron and thus limiting

the amount of condensate return to approx. 50%. Within the new treatment concept, an all organic, all volatile product based on a combination of FFA and alkalizing amines (Cetamine V211) was dosed into the feed water tank. 75 g/mÂł of make-up water were added by a standard membrane pump. Additionally, DEHA was dosed into the boilers during long standby periods. One year after the implementation of the new treatment concept a ca-

reful analysis of the key performance indicators (KPI) for the two treatment programs were determined (Table 1). The overall steam production was almost the same: 105,000 t resp. 107,000 t (231,8 resp 236,2 ¡ 106 pd). The results obtained with the FFA program are quite impressive: Due to the new treatment the quality of the condensate was sharply improved. The pH in the condensate was maintained always above 8.3 and to more than 90% above 9.1. The iron level was reduced from generally above 0.2 ppm to below 0.5 ppm. As a consequence less condensate had to be discarded and the condensate return could be increased from 50 to approx. 70%. At the same blowdown could be reduced by 60%, since the average cycle was increased. As a consequence the make-up water amount could be reduced by nearly 40%. Finally, the number of hours with a stop of steam production was markedly reduced by 36%. Some steam condensers were inspected by the operators and a very good appearance of the metal surfaces was stated, as well as a high quality passivation layer.

TABLE 1 COMPARISON OF KEY PERFORMANCE INDICATORS OF CONVENTIONAL TREATMENT PROGRAM (SULPHITE, PHOSPHATE, ALKALIZING AMINE) WITH FILM FORMING AMINE (FFA) PROGRAM. NOTE: * = Steam production per NM3 of gas (shell type boilers). Treatment program KPI

Unit

Relative difference Conventional

FFA

Sream generation

t/y pph

105,000 26,950

107,000 27,460

+1,7%

Make-up water

m3/y cft/y

41,200 1455,180

25,500 900,660

-38%

Blow-down

m3/y cft/y

8,200 289,620

3,200 113,020

-61%

Condensated return

m3/y cft/y

55,900 1974,390

78,500 2772,620

+40%

t/Nm3 p/Ncbt

12.1 155.3

12.3 157.8

+1,7%

h/y

45

29

-36%

Boiler efficiency* Stop of steam production

www.tecnoaqua.es

ta 21 at kurita.indd 109

109

02/11/16 10:00


Artículo Técnico

TABLE 2 ANALYSIS OF SAVINGS GENERATED DUE TO CHANGEOVER OF STEAM GENERATOR TREATMENT FROM CONVENTIONAL TREATMENT PROGRAM TO FILM FORMING AMINES (FFA) Concept

Savings [K€]

Reduction of make-up water

45

Energy Reduction of blow-down Heat transfer improvement Reduction of steam consumption for degasser

62 41 10 11

Reduction of steam production stops

56

Total

153

Due to the above mentioned improvements in the water/steam cycle, savings of more than 150 K€/y could be realised. The reduction of makeup water counts to 45 K€, the reduction of stops in steam production generated savings of 56 K€. The major part of the savings, i.e. 62 K€, can be attributed to energy savings: reduction of blow-down, improvement of heat transfer and the reduction of steam consumption for the degasser. The detailed analysis of the savings is given in Table 2. The total savings of 153 K€/y more than compensates for the total treatment cost for the steam generators of approx. 25 K€/y.

6. CONCLUSIONS In comparison with conventional treatment programs, modern programs based on FFAs have a number of advantages: - They protect the total plant against corrosion. As FFAs are steam volatile, protective film formation occurs on the surfaces of all parts of the plant. In contrast to programs that use oxygen scavengers, the film forming component is not consumed by entering into chemical reactions. - The treatment program with FFA is based solely on organic substances, which contribute very little to

110

ta 21 at kurita.indd 110

the conductivity. High levels of concentration cycles can be achieved, associated with savings through lower consumption of water and energy (blowdown). - The substances used exhibit only slight human toxicity. There is therefore no need for extensive occupational health and safety measures such as those associated with hydrazine. - Very smooth and homogeneous magnetite layers are formed in the plant. The improved heat transmission coefficients can increase the efficiency of a steam generator and cut its energy consumption relative to conventional phosphate-based treatment methods. - The cleanliness of critical plant parts, especially those of the turbine, is often improved by film-forming amines. FFAs have been used successfully for boiler water treatment for a number of decades in industrial power stations and steam boilers [14, 15], and sometimes even in cases where conventional treatment programs failed to yield satisfactory results [16]. A case study from a wood manufacturing plant showed significant benefits due to changeover from a conventional treatment program to a modern program based on FFA.

Not only the treatment results were improved, but also marked savings could be realized. The savings were generated by reduction of make-up water, reduction of steam production stops and energy savings. Literature [1] Petrova, T. I.; Furunzhieva A. V. Effect of acetic acid on mass transfer of corrosion products in fossil power plant cycle. Proceedings of the 14th International Conference on the Properties of Water and Steam, Kyoto, Japan. [2] Bäßler, R.; Uhlemann, M.; Mummert, K. (1999). Inhibiting effect of octadecylamine on pitting corrosion behaviour of stainless steel type 1.4571 up to 250 °C. Materials and Corrosion, núm. 50, págs. 146. [3] Schutz vor Korrosion durch heißes Wasserdampfkondensat. Richtlinie II-9-301 J 1525/81 Zentralstelle für Korrosions., Dresden. [4] Banica, C.E.; Czempik, E.; Vogt, C.;Schneider, F. (2002). Influence of hot water conditioning on the corrosion behavior of carbon steel. Materials and Corrosion, núm. 53, pág. 256. [5] Ochoa, N.; Moran, F.; Pébère, N.; Tribollet, B. (2005). Influence of flow on the corrosion inhibition of carbon steel by fatty amines in association with phosphonocarboxylic acid salts. Corrosion Science, núm. 47, pág. 593. [6] Foret, C.; Stoianovici, G.; Chaussec, G.; de Bache, A.; zum Kolk, C.; Hater, W. (2008). Study of efficiency and stability of film forming amines (FFA) for the corrosion protection of the carbon steel in water circuits. EUROCORR 2008, Edinburgh. [7] Ochoa, N.; Baril, G.; Moran, F.; Pebere, N. (2002). Study of a multi-component inhibitor used for water treatment in cooling systems. J. appl. Electrochemistry, núm. 32, pág. 497. [8] Duprat, M.; Lafont, M.-C.; Moran, F.; Dabosi, F. (1985). Study of the corrosion and inhibition process of a carbon steel in a low conductivity medium by electrochemical methods. Electrochim. Acta, núm. 30, pág. 353. [9] Jüttner, K.; Lorenz, W. J.; Kending, M. W.; Mansfeld, F. (1988). Electrochemical impedance spectroscopy on 3-D inhomogeneous surfaces. J. Electrochem. Soc., núm. 135, págs. 332. [10] Topp, H.; Steinbrecht, D.; Hater, W.; zum Kolk, C. (2010). The influence of film forming amines on heat transfer during saturated pool boilin. PowerPlant Chemistry, núm. 12(7), pág. 388. [11] Topp, H., Hater, W., de Bache, A., zum Kolk, C. (2012). Film forming amines in shell boilers. PowerPlant Chemistry, núm. 14(1), pág. 38. [12] Hater, W.; Voges, N. (2010). Distribution ration and average surface coverage of film forming amines. PPCHem, núm. 12(3), págs. 132. [13] Stiller, K.; Wittig, T.; Urschey, M. (2011). The analysis of film forming amines - Methods, possibilities, limits and recommendations. Power Plant Chemistry, núm. 13(10), pág. 602. [14] Hater, W.; Olivet D. (2008). The chemistry and properties of organic boiler feed water additives based on film forming amines, and their use in steam generators. Proceedings of 15th ICPWS, Berlin. [15] Allard, B.; Chakraborti, S. (1983). Controlling corrosion and scaling with aliphatic amines in steam generating systems. Svensk Papperstidning, núm. 18, R186. [16] Van Lier, R.; Janssen, G.; Savelkoul, J. (2008). Three years of experiences with polyamines in the high pressure system of a naphtha cracker. PowerPlant Chemistry, núm. 10, pág. 696.

nº 21 - Septiembre-Octubre 2016

02/11/16 10:00


sorigue.indd 1

31/10/16 15:57


Procesos y Sistemas

La huella ambiental en las redes sostenibles de PVC-O Departamento Técnico de Molecor

1. INTRODUCCIÓN El impacto ambiental de un sistema de tuberías depende de su composición y la aplicación de las mismas. Los factores que determinan la eficiencia durante todo el ciclo de vida de una tubería son principalmente: el tipo de materia prima utilizada, el proceso de producción, el acabado del producto, y su vida útil. En este sentido, las tuberías TOM de PVC-Orientado (PVC-O) de la empresa Molecor se presentan como una solución ecológica ideal debido a su mejor contribución al correcto desarrollo sostenible del planeta, tal como demuestran diferentes estudios a nivel mundial.

112

ta 21 procesos y sistemas molecor.indd 112

2. VENTAJAS MEDIOAMBIENTALES DEL PVC-O El PVC-O presenta ventajas medioambientales en todas las fases de su ciclo de vida (Figura 1), y es garantía de eficiencia y sostenibilidad: - Eficiencia en recursos naturales: ■ Petróleo. Solo el 43% de la composición del PVC depende de este recurso. ■ Materias primas. Gracias a la mejora de propiedades que se consigue durante la orientación molecular, se puede utilizar menor cantidad de materia prima.

nº 21 - Septiembre-Octubre 2016

03/11/16 15:30


La huella ambiental en las redes sostenibles de PVC-O

FIGURA 1. Ciclo de vida de las tuberías de PVC-O.

■ Energía. Se produce un menor consumo en la extracción de la materia prima, la fabricación de la tubería y en el uso de la misma. - Eficiencia en la gestión de residuos. El PVC es un material 100% reciclable que puede ser reutilizado en la fabricación de otras aplicaciones plásticas. - Mejor contribución a la sostenibilidad: ■ Menor huella de carbono. Por las menores emisiones de CO2 a la atmósfera asociada al consumo de energía según muestran diversos estudios internacionales. ■ Menor huella ambiental. Según la declaración ambiental de producto (EPD), las tuberías de PVC-O presentan un menor impacto ambiental, no solo en el impacto ambiental calentamiento global o huella de carbono, sino en otros cinco parámetros medioambientales, entre los que se encuentra el agotamiento de la capa de ozono o la acidificación del medio. - Otros: ■ Optimización del transporte. Gracias a su menor peso, se puede transportar más cantidad de material, por tanto, se consigue un ahorro de combustible. ■ Eficiencia en costes de instalación. La tubería de PVC-O es más ligera y manejable que los tubos fabricados con otros materiales, con lo que se reduce la utilización de maquinaria durante su instalación (Figura 2).

dos los ámbitos, haciendo cada vez más hincapié en su política medioambiental, en la necesidad de contemplar el desempeño ambiental en la compra de materiales. Por ejemplo, el Reglamento de Productos de Construcción, como requisitos básicos en obras de construcción, considera los siguientes aspectos: ahorro de energía, uso sostenible de los recursos naturales, durabilidad de las obras y respeto al medio ambiente de los materiales utilizados. En los últimos años, tanto en Europa como en el resto del mundo, se han desarrollado diversas metodologías de estudio del impacto ambiental (huella de carbono, declaraciones ambientales de producto...) que ofrecen al usuario información no comparable entre sí y, en oca-

FIGURA 2. Instalación de tubería.

3. DIRECTRICES EUROPEAS SOBRE LA HUELLA AMBIENTAL Desde la Unión Europea se está fomentando cada vez más la correcta preservación del medio ambiente en to-

www.tecnoaqua.es

ta 21 procesos y sistemas molecor.indd 113

113

03/11/16 15:30


Procesos y Sistemas

FIGURA 3. Acopio de tubería TOM.

siones, sin fiabilidad y claridad en los resultados. Recopilando toda esta información, y tratando de implementar una metodología común que permita la comparación real de resultados, desde la Comisión Europea se ha lanzado la Recomendación 179/2013/CE relativa al cálculo de Huella Ambiental de Producto (HAP-PEF). Esta metodología está basada en el análisis del ciclo de vida del producto (ACV-LCA) y la evaluación de su impacto ambiental en diferentes parámetros ambientales. Según esta recomendación vanguardista, se ha realizado el estudio de la huella ambiental de la tubería TOM de PVC-O clase 500. Para ello, se ha realizado el análisis del ciclo de vida (ACV) de la tubería a lo largo de todas las fases 'desde la cuna a la tumba', es decir, desde la extracción de la materia prima hasta la disposición final del producto, pasando por la fabricación, la distribución y el uso de los tubos (Figura 3). El cálculo se ha realizado con el software profesional Air.e LCA, en el que están integradas las bases de datos de Ecoinvent y ELCD (European reference Life Cycle Database). En dicho cálculo se ha tenido en cuenta, además de la citada Recomendación de la Comisión Europea sobre Huella ambiental, tanto la normativa aplicable sobre ciclo de vida y declaraciones ambientales del producto (EPD), como las metodologías IPCC (Intergovernmental Panel on Climate Change) 2007 e ILCD (International Life Cycle Data). TABLA 1 De esta forma, se ha estimado el RESULTADOS DE LA HUELLA AMBIENTAL DE LAS TUBERÍAS TOM DE PVC-O CLASE 500 efecto que produce la tubería TOM soSEGÚN LA RECOMENDACIÓN 179/2013 CE bre los 14 impactos ambientales recoImpactos ambientales Resultados absolutos gidos en esta metodología común de Cambio climático 8,3E+01 kg CO2e cálculo, que se agrupan en función de Agotamiento de ozono 5,3E-06 kg CFC-11e la afección a los distintos medios: Ecotoxicidad agua dulce

1,8E+02 CTUe

Efectos en la salud humana (cancerígenos)

4,8E-06 CTUe

Efectos en la salud humana (no cancerígenos)

8,6E-06 CTUh

Elementos respiratorios inorgánicos

1,3E-02 kg PM2,5e

Radiacion ionizante (humana)

5,3E+00 kg U235e

Formación ozono fotoquímico

4,1E-01kg NMVOC

Acidificación

4,1E-01 mol H+e

Eutrofización terrestre

1,0E+00 mol Ne

Eutrofización agua dulce

1,6E-03 kg Pe

Eutrofización agua marina

9,5E-02 kg Ne

Agotamiento de recursos (agua)

1,9E-01 m3 SWU

Agotamiento de recursos (minerales)

3,8E-03 kg Sbe

Uso del terreno

114

ta 21 procesos y sistemas molecor.indd 114

1,6E+02 kg Cdef

- Aire y atmósfera: cambio climático, acidificación, agotamiento de la capa de ozono y formación de ozono fotoquímico. - Agua: agotamiento de recursos (agua), ecotoxicidad del agua dulce y eutrofización del agua. - Suelo: agotamiento de recursos (minerales), eutrofización terrestre y uso del terreno. - Salud humana: elementos respiratorios inorgánicos, radiación ionizante, efectos en la salud humana (cancerígenos) y efectos en la salud humana (no cancerígenos).

nº 21 - Septiembre-Octubre 2016

03/11/16 15:30


La huella ambiental en las redes sostenibles de PVC-O

FIGURA 4. Comparación impacto ambiental PVC-O versus Fundición dúctil según el estudio de Declaración Ambiental de producto realizada por la Asociación Europea de Fabricantes de Tuberías Plásticas (TEPPFA).

Uno de los parámetros ambientales más conocidos en la actualidad es la huella de carbono, que tiene en cuenta las emisiones de gases efecto invernadero a la atmósfera expresadas como CO2. Este valor ser obtiene del impacto que tiene el producto en estudio sobre el cambio climático. Otro de los parámetros ambientales más de moda en la actualidad es la huella de agua, en el que están englobados los impactos ambientales: agotamiento de recursos (agua), ecotoxicidad del agua dulce y eutrofización del agua (dulce y marina). Los resultados de la huella ambiental de las tuberías TOM PVC-O clase 500 según la Recomendación 179/2013/CE se detallan en la Tabla 1.

4. CONCLUSIONES La orientación molecular otorga a las tuberías de PVC-O significativas ventajas en la calidad del producto, su instalación y uso, pero además ofrecen un mejor comportamiento de respeto al medio ambiente, presentando

» La orientación molecular otorga a las tuberías de PVC-O significativas ventajas en la calidad del producto, su instalación y uso, pero además estos tubos ofrecen un mejor comportamiento de respeto al medio ambiente, presentando una huella ambiental inferior a otros materiales, mejorando así el desarrollo sostenible y el consumo de recursos

una huella ambiental inferior a otros materiales (Figura 4), mejorando así la contribución al correcto desarrollo sostenible del planeta y optimizando el consumo de recursos naturales (Figura 5). Es importante destacar, que debido a las diferentes metodologías en uso, para poder comparar los resultados obtenidos en cada uno de ellos, no solo deben realizarse por el mismo método de cálculo, sino que además se deben tener en cuenta los mismos criterios en la toma de datos durante el proceso de cálculo, es decir, las mismas fases del ciclo de vida, el mismo periodo de tiempo de estudio, las mismas características del producto, etc. Esta problemática quedará resuelta con la utilización de la metodología común que recomienda la Comisión Europea. No obstante, aún llevará un poco de tiempo uniformizar todos los resultados para que puedan ser comparados objetivamente.

FIGURA 5. TOM tiene un gran comportamiento de respeto al medio ambiente.

www.tecnoaqua.es

ta 21 procesos y sistemas molecor.indd 115

115

03/11/16 15:30


Procesos y Sistemas

Tecnología aplicada al bombeo del agua para reducir al máximo los costes energéticos y de explotación Enrique Castellanos Rodrigo coordinador de Proyectos Internacionales de Xylem Water Solutions Iberia

1. INTRODUCCIÓN En la actualidad las empresas se encuentran en la encrucijada de ser efectivos en las aplicaciones y, a la vez, respetar el medio ambiente reduciendo al máximo los costes energéticos y de explotación. De entre todos estos factores, hay que destacar uno que preocupa especialmente a los profesionales: el rendimiento real operativo basándose en el rendieminto hidraúlico y en su capacidad antiatascos. Al bombear aguas residuales se debe considerar que se bombea agua con elementos sólidos. Estos sólidos tienden a agruparse formando bolas o madejas. Son precisamente estas madejas las que se suelen situarse en la parte central de los impulsores clásicos de agua residual, provo-

116

ta 21 procesos y sistemas xylem.indd 116

cando que el caudal bombeado vaya disminuyendo de manera progresiva hasta producir el atasco completo. Todas estas razones han hecho que Xylem Water Solutions haya desarrollado una nueva tecnología única en el mercado llamada Concertor que garantiza el rendimiento real operativo, reduce los costes energeticos y garantiza una tecnología hidraúlica libre de atascos.

2. QUÉ ES CONCERTOR Concertor es el primer sistema de bombeo de agua residual del mundo con inteligencia integrada. Es una tecnología desarrollada por Flygt, los inventores de la primera bomba sumergible, con una tecnología revolucionaría con posibilidades ilimitadas.

nº 21 - Septiembre-Octubre 2016

03/11/16 15:32


TecnologĂ­a aplicada al bombeo de agua para reducir al mĂĄximo los costes energĂŠticos y de explotaciĂłn

La tecnologĂ­a Concertor se basa en la habilidad del sistema de bombeo de proporcionar un rendimiento de bombeo Ăłptimo, a la vez que reduce los costes totales de bombeo a travĂŠs de una innovadora tecnologĂ­a. Esto se consigue a travĂŠs de tres componentes principales: - Motor super premium IE4. El sistema se compone de un motor super premium IE4 de magnetizaciĂłn permanente sĂ­ncrono con devanado concentrado que trabaja con un rendimiento de motor de mĂĄs de 4 puntos por encima de cualquier otro motor con eficiencia energĂŠtica. Su diseĂąo concentrado en el bobinado del estator permite un motor mĂĄs pequeĂąo y compacto. El nĂşmero de arranques del motor es ilimitado. - Nueva generaciĂłn hidrĂĄulica adaptativa. La hidrĂĄulica encargada del bombeo del agua residual ha sido diseĂąada para permitir que los materiales que causan la mayorĂ­a de los atascos (aquellos que son fibrosos y sĂłlidos de gran tamaĂąo), puedan bombearse sin problema. De este modo, no solo se evita el atasco, sino que se reduce el esfuerzo en el eje, las juntas mecĂĄnicas y los rodamientos. El impulsor de material resistente al degaste en hard iron (60 HCR) con la nueva tecnologĂ­a adaptativa es capaz de cambiar por sĂ­ solo de direcciĂłn, automĂĄticamente, cuando detecta el paso de un sĂłlido de gran tamaĂąo que podrĂ­a producir un atasco. - Controlador inteligente integrado en el interior de la bomba. La tecnologĂ­a de Concertor significa que dentro de la bomba hay un controlador inteligente totalmente integrado en el interior de la bomba que automatiza el sistema de bombeo para que este se adapte a las continuas condiciones cambiantes del mismo. Esto elimina la necesidad de un variador de frecuencia externo (VDF). TambiĂŠn dota a la bomba de la capacidad autoajustable para alcanzar un determinado punto de trabajo.

3. BENEFICIOS DE CONCERTOR EN EL SISTEMA DE BOMBEO Se pueden apuntar cuatro grandes beneficios: - De una selecciĂłn compleja a un selecciĂłn de equipos sencilla. Hasta el momento, cualquier profesional del agua se enfrentaba a tener que manejar amplios catĂĄlogos de equipos para seleccionar el mĂĄs adecuado segĂşn las condiciones teĂłricas del sistema de bombeo. Ahora, con Concertor se consiguen los siguientes beneficios al

www.tecnoaqua.es

ta 21 procesos y sistemas xylem.indd 117

reducirse hasta en un 80% el inventario de la siguiente manera: s 3ELECCIĂ˜N DE PRODUCTO MÉS SIMPLE 5NA SOLA BOM ba para todo. s #URVAS DE FUNCIONAMIENTO ADAPTATIVA A MUCHOS trabajos diferentes que antes se alcanzaba con diferentes bombas. s 2EDUCCIĂ˜N DE INVENTARIO ACTIVOS REPUESTOS AL TRA tarse de un Ăşnico equipo. s 2EDUCCIĂ˜N DE LOS TIEMPOS DE ESPERA - De instalaciones problemĂĄticas a bombeos fiables. El temor principal de cualquier profesional del agua son los costes de explotaciĂłn basados principalmente en los atascos de las bombas. Ahora, con Concertor los atascos desaparecen al reducirse hasta en un 80% el inventario de la siguiente manera: s 3ISTEMA ANTIATASCO DE BOMBA CON GI ro en ambos sentidos del impulsor de manera automĂĄtica. s !UTOLIMPIEZA INTEGRADA DE POZO Y TU berĂ­as. s (IDRÉULICA AUTOLIMPIANTE DE NUEVA GE neraciĂłn adaptativa. s %LECTRĂ˜NICA SUMERGIDA EN UN ENTORNO estable y controlado a travĂŠs de un controlador inteligente. - De consumos energĂŠticos elevados a ahorros energĂŠticos inteligentes. Con Concertorse consigue reducir los consumos de energĂ­a hasta en un 80% de la siguiente manera: s -INIMIZADOR DE CONSUMO ENERGĂ?TICO s -OTORES DE EFICIENCIA ENERGĂ?TICA super premium IE4. s (IDRÉULICA . ADAPTATIVA DE NUEVA GENERACIĂ˜N - De equipamientoss voluminosos a cuadros elĂŠctricos reducidos, inteligentes y seguros. Concertor, con su sistema integrado y escalable, reduce al mĂĄximo el espacio necesario en planta para la instalaciĂłn de su tecnologĂ­a. Alcanza hasta en un 50% de espacio reducido con los siguientes beneficios: s 3OLUCIONES ESTÉNDAR PRECONFIGURADAS ANTES DE SU llegada a planta. s $ISEĂ—O DE CUADROS ELĂ?CTRICOS REDUCIDOS Y SIMPLIFI cados. s &UNCIONES DE SUPERVISIĂ˜N Y MONITORIZACIĂ˜N INTEGRA das.

117

03/11/16 15:32


Reportaje

Reducción óptima del agua no registrada desde una gestión coherente de las empresas gestoras del servicio (Parte 1) Javier M. Elizondo Osés Ingeniero técnico con 30 años de experiencia en mantenimiento y explotación de redes e instalaciones de suministro y distribución de agua

El ratio de agua no registrada (ANR) es uno de los ratios más manejados en el ámbito del suministro y distribución de agua para valorar la gestión eficiente de una empresa de servicio. Existe un amplio espectro documental al respecto, pero su fiabilidad depende de la realidad de la gestión de distintas acciones a implantar y llevar a cabo -de modo efectivo-, así como de controlar y mantener, siempre bajo premisas de mejora continua. Dentro de estas acciones y premisas, las normas y criterios aplicados respecto a la construcción de las redes e instalaciones y los controles e inspecciones metódicas y regulares se convierten en factores clave para llegar o partir del punto óptimo de redes de calidad desde origen, y de imagen seria y competente, real, de las empresas gestoras del servicio. Este artículo, primera parte de tres, analiza precisamente cómo reducir el agua no registrada en un servicio de abastecimiento desde la gestión coherente que deben realizar las empresas operadoras.

118

ta 21 reportaje anr.indd 118

nº 21 - Septiembre-Octubre 2016

03/11/16 15:34


Reducción óptima del agua no registrada desde una gestión coherente de las empresas gestoras del servicio

El llamado ratio de agua no registrada (ANR) define el rendimiento de un sistema de abastecimiento de agua. En su planteamiento más básico sería el resultado de la fórmula: (agua producida - agua registrada) / agua producida = = 1- agua registrada / agua producida Este valor es en sí un valor porcentual y, por lo tanto, no sirve para una comparación entre empresas de servicio, por cuanto no queda definida la amplitud del ámbito de gestión. Para esa comparación efectiva entre empresas, sea cual sea su tamaño, se tiene que dar en función de los kilómetros de red mantenida, de modo que el análisis sea de pérdida de volumen de agua por kilómetro de red y período de tiempo (que normalmente es por día). Es decir, se trata de dividir toda el ANR (m3) entre la longitud de redes (km) y los días del año (365), obteniendo el ratio de m3/km*día, que sí permite objetivar totalmente la comparativa de la gestión entre empresas del ramo. Además, comparando el propio ratio a nivel interno entre ejercicios, permite tener en cuenta la evolución anual de crecimiento de la red. Es indispensable considerar, en el cómputo de longitudes, las acometidas de ámbito público. De no tenerse en cuenta, se están barajando valores no veraces al no considerar la parte de la red donde se registra el mayor número de averías y fugas. Así mismo, y como ejemplo, no es comparable (en cuanto a la dificultad en la gestión de un sistema de abastecimiento) mantener una red en alta (acometidas mínimas para suministro a depósitos de cabecera o núcleos de población, con control y registro en arranque, a partir de los cuales la gestión corresponde a otra entidad) que mantener una red en baja, en la que todas las acometidas, de todo tipo, están dentro de las competencias de la gestión de la entidad, con todo lo que conlleva. A partir de aquí, se pueden plantear múltiples ratios para analizar una gestión. Este concepto está amplia y suficientemente desarrollado en multitud de documentaciones, con un carácter técnico tal que intentar plasmar algo nuevo sería muy pretencioso. Lo que se pretende aquí es intentar desarrollar una especie de balance de las diferentes actividades y criterios que debe desarrollar una empresa gestora de un servicio de agua para potenciar una autocrítica, de modo que cada entidad valore, en función de la realidad de lo que hace, si puede defender el valor que dice conseguir respecto a ese ratio de ANR, dada su utilización -lógica- como

www.tecnoaqua.es

ta 21 reportaje anr.indd 119

uno de los valores de tendencia para la observación de la evolución de una empresa dentro del mundo de la gestión y explotación de un sistema de abastecimiento de agua. Dentro de este marco, la evolución general de los servicios parece haber sido netamente positiva, teniendo empresas que informan alcanzar valores muy próximos al considerado como 'límite técnico', el cual viene a situarse -por consenso- en el 10% del agua producida. Es decir, un rendimiento del 90%. Considerando que el error de subcontaje del parque de contadores puede situarse, según la bibliografía técnica. en valores del 7%, se tiene un 3% para todo el resto de factores: - Los criterios y las realidades de la gestión y mantenimiento del sistema global (principal valor que lo tiene que sustentar). - El control efectivo del suministro real, de los puntos de tratamiento y de la producción de agua en ellos y de los puntos de almacenamiento para su distribución. - La gestión del parque de contadores, del control del fraude, cargas incontroladas, las políticas de consumos permitidos sin control de registro, etc. Observando los datos aportados por la Asociación Española de Abastecimintos de Agua y Saneamientos (AEAS) en sus documentaciones de índole nacional (indica los valores como agua no facturada), se observan valores del 29% (año 1996), del 21% (año 2008 -valor significativo por ser el año a partir del cual se da la pa-

FIGURA 1. Balance hídrico y reseñas.

119

03/11/16 15:34


Reportaje

FIGURA 2. Ejemplos de actuaciones de fraude.

ralizaciĂłn, con motivo de la crisis, en las grandes inversiones que venĂ­an desarrollĂĄndose en infraestructuras) y del 23% en el Ăşltimo estudio (datos aĂąo 2014, en el que se seguĂ­a con la paralizaciĂłn de inversiones). En su libro sobre la metodologĂ­a a seguir para el control del ANR, de enero de 2014, la AEAS indica que el ANR se sitĂşa en una media nacional del 25%. La diferencia, por lo tanto, entre las empresas gestoras que barajan ratios cercanos al lĂ­mite tĂŠcnico (que vienen a ser las que soportan la mayor concentraciĂłn de red a mantener y de poblaciĂłn a suministrar y disponen de las mejores tecnologĂ­as y profesionales para explotarlas) y la media nacional es muy elevada. Esto puede parecer totalmente lĂłgico, pero hay que revisar bien quĂŠ gestiĂłn hay detrĂĄs de cada valor para que este sea creĂ­ble. MĂĄxime si se observan cambios ostensibles en los valores, ya que, objetivamente (si no se cambia ninguno de los criterios principales de gestiĂłn), no se pueden producir cambios drĂĄsticos en el valor del ANR de un ejercicio a otro. De darse, la fiabilidad de esa gestiĂłn queda totalmente en entredicho. Si se utiliza como punto de partida un esquema como el que presenta en sus libros y cursos la Unidad de MecĂĄnica de Fluidos de la Universidad PolitĂŠcnica de Valencia (Figura 1), existen tres frentes de ataque: - El error en la mediciĂłn, que parece depender exclusivamente de criterios de renovaciĂłn del parque de contadores y de la calidad/clase de los contadores, pero que tiene una componente muy importante basada en la adecuada instalaciĂłn en su sitio concreto, para que no afecte a la medida. Componente que debe exigirse a travĂŠs de las normativas constructivas y auditarse a travĂŠs de los controles oportunos. Y, por supuesto, obligar a su correcciĂłn. CuestiĂłn a tratar mĂĄs adelante. - El control de acometidas (elementos finales de uso de agua, sea cual sea ese uso) respecto a:

120

ta 21 reportaje anr.indd 120

s ,A PERMISIVIDAD DE CONSUMO SIN NINGĂžN REGISTRO Puede ser legal, pero es totalmente inconcebible. No se puede hablar de rendimientos de agua fiables cuando se aportan datos de estimaciones de consumos, por no quedar registrados. Y se hace, incluso dentro de las propias empresas gestoras. Se incluye dentro de esta permisividad, por la falta de una gestiĂłn adecuada, lo relativo a las redes particulares y sus fugas, que se verĂĄ en la parte 3 de este reportaje. s %L FRAUDE DE LOS CONSUMOS NO PERMITIDOS QUE requieren unos criterios de normativas tajantes, unas inspecciones adecuadas y una polĂ­tica de corte de suministro inmediata, con las acciones legales correspondientes. AquĂ­ no caben 'medias tintas' (Figura 2). - El estado de la red, en su correspondencia con el caudal incontrolado que se pierde a travĂŠs de fugas. Estado que debe concienciar a una bĂşsqueda y resoluciĂłn efectiva, para evitar las roturas de entidad, en primer lugar, y la degradaciĂłn paulatina de cualquier fuga hacia ese nivel. Por supuesto, la necesidad de inversiones (Figura 3). Existe abundante documentaciĂłn en relaciĂłn con fundamentos para determinar los criterios de actuaciĂłn sobre una red, que podrĂ­an plasmarse segĂşn la Figura 4. Incluso existe bibliografĂ­a para determinar la reparaciĂłn puntual de una fuga en funciĂłn del punto de confluencia de los costes que puede generar en el tiempo y los costes de la intervenciĂłn. La realidad, basada en la experiencia, es que cualquier fuga debe ser atajada de modo inmediato, ya que siempre irĂĄ a mĂĄs y sus costes finales serĂĄn mayores, no solo segĂşn la posible pĂŠrdida global de agua en el tiempo, sino tambiĂŠn por los daĂąos que puede llegar a provocar.

FIGURA 3. Roturas de canalizaciones de agua: visual y con daĂąos.

nÂş 21 - Septiembre-Octubre 2016

03/11/16 15:34


Reducción óptima del agua no registrada desde una gestión coherente de las empresas gestoras del servicio

FIGURA 4. Criterios de actuaciones en redes.

FIGURA 5. Fuga de goteo por mal ajuste en el montaje de obra.

Un criterio de gestión de redes no debe llevar a poder mantener, sin reparar, un gran número de fugas de pequeña entidad (goteos, fugas en prensaestopas, pérdidas en válvulas de hidrantes...) que, en su conjunto, suponen un importante caudal de pérdida, que se obvia al atender a criterios de individualidad (Figura 5). Para lo relativo a una actuación más global, el determinante no tiene que ser nunca la edad y material (salvo por exigencias de calidad), sino el histórico de averías, el riesgo y su grado de afección. De este modo, las inversiones se centran donde realmente sean más necesarias, eliminando las redes que más repercuten en pérdidas por roturas, por fugas e incluso por la gestión de vaciados y limpiezas a la hora de reparar y de reponer el servicio. Ni que decir tiene en la afección a clientes y la repercusión en la credibilidad del servicio. De no registrar los datos, no se tendrá nunca un histórico, por lo que, en una empresa gestora de un cierto nivel, corresponde tratar todo a través de una gestión adecuada de la red, desde el registro de actuaciones directamente cargadas a los sistemas GIS (que deben contemplar toda la extensión de red, instalaciones y elementos internos de esas instalaciones) en cada punto concreto y elemento de red o de instalación, con toda su información (para múltiples posibilidades de usos, que no se definen por su extensión, al no ser objeto de este documento) hasta el máximo nivel de gestión en cuanto a su disposición de explotación, sectorización y controles particulares y globales (sistemas Scada). Siempre hay que contar con la parte más importante, que es la gestión de todos los operativos de mantenimiento (en el ámbito global), incluidos los de control y los de detección en calle. Sin los equipos humanos adecuados (competentes, implicados y bien formados)

www.tecnoaqua.es

ta 21 reportaje anr.indd 121

y sin las pautas adecuadas de gestión (empezando por la propia competencia, implicación, formación y capacidad de gestión de los mandos, en cualquier nivel), aunque una empresa disponga de los equipos tecnológicos más punteros, el balance de la gestión será deficiente. Según el último informe de AEAS-AGA sobre el servicio urbano de agua en España, nuestro país está "a la cabeza de Europa en tecnificación" y el "17% de los empleados son titulados superiores o de grado medio". ¿Y el grado real de eficiencia en la gestión, cómo está? A continuación se analiza el balance de actuaciones o puntos de gestión para hacer creíble el ratio.

RESPECTO A NORMAS Y CRITERIOS APLICADOS A OBRAS E INSPECCIONES Las normas y criterios es lo primero que un servicio que se constituye trata de plasmar. Por lo tanto, es la primera base para asentar una buena gestión. Tienen que ser, fundamentalmente, aplicables. Y exigibles en todo momento y bajo cualquier circunstancia. Respecto al asunto que nos ocupa, al margen de todo el concepto de fraude como tal -que solo es la punta del iceberg-, hay campos de gestión que producen una afección mucho mayor y que deben ser considerados como vitales respecto a las actuaciones oportunas para ser corregidos (hablando exclusivamente respecto al factor de rendimiento, sin entrar en cuestiones de afecciones a las explotaciones y costes añadidos).

Criterios de construcción Deben tenerse en cuenta: - Normativas de materiales y de construcción de redes, exigentes, como puntas de lanza para una mayor

121

03/11/16 15:34


Reportaje

FIGURA 6. Afecciones de los materiales y de diseño.

FIGURA 7. Registro y control de agua en instalaciones.

FIGURA 8. Afecciones por deficiencias constructivas.

122

ta 21 reportaje anr.indd 122

vida útil, con ausencia de deterioros acelerados (menores probabilidades de averías y fugas; mejores rendimientos) (Figura 6); y formatos constructivos de las propias empresas gestoras, en sus instalaciones, que eviten dejar puntos de carga externos a ellas, sin pasar por el debido control/registro, que puedan ser utilizados sin control (Figura 7). - Disposición y exigencia de materiales de contrastada calidad. Inversión de las empresas gestoras en sistemas de calidad (verificación, homologación y seguimientos a través de las pruebas de contraste necesarias). - Exigencia de construcciones adecuadas a través de proyectos detallados, mediante direcciones facultativas profesionales y competentes. Es un problema insostenible -e innegable que se ha dado en estos años de grandes inversiones en obras, y se sigue dando, le pese a quien le pese- la mala praxis en las obras de construcción en toda su extensión, por responsabilidad directa de direcciones facultativas (muchas veces ausentes) y la falta de ética de empresas constructoras. Agravado el problema por cuestiones varias de aplicación legislativa, que atan las manos de las empresas gestoras, en sus propias obras, para poder crear baremos adecuados que eviten bajas temerarias o poder vetar a empresas que han creado problemas en otras obras. Entre otras cosas. - Inversión de las empresas gestoras en la formación y acreditación de los profesionales que vayan a trabajar en su ámbito. Exigiendo esa acreditación siempre, y creando los mecanismos necesarios de puesta al día. - Inversión de las empresas gestoras en el control/ asesoramiento previo gratuito en la construcción de las redes en edificaciones y el cálculo de los dimensionamientos adecuados de los elementos de registro (principalmente, sobre los cuales se van a realizar las lecturas). Especial importancia en la implicación en todo lo relativo al dimensionamiento de acometidas de riegos para parques y jardines públicos, dadas sus extensiones y la necesidad de conocer realmente sus operativas de funcionamiento para definir bien los caudales y determinar el dimensionamiento más adecuado del elemento de registro/control, evitando errores de medida. - Aportación completa de datos reales y fiables a los sistemas de información, de modo que se evite cualquier factor de error en las operaciones de manipulación que lleven a pérdidas innecesarias. Conjuntado con el oportuno sistema de control, para el oportuno sistema de alarmas que active una resolución eficiente.

nº 21 - Septiembre-Octubre 2016

03/11/16 15:34


ReducciĂłn Ăłptima del agua no registrada desde una gestiĂłn coherente de las empresas gestoras del servicio

FIGURA 9. ProtecciĂłn de acometida y montaje. Criterios de inspecciĂłn y seguimiento A tener en cuenta: - InversiĂłn de las empresas gestoras en la vigilancia/ inspecciĂłn de las redes e instalaciones en construcciĂłn y construidas, tanto en obras propias como en cualquier obra dentro de su ĂĄmbito de gestiĂłn. No solo en cuanto a nĂşmero de efectivos, sino tambiĂŠn en su formaciĂłn y exigencia de competencia. Una inspecciĂłn de baja calidad por cualquier cuestiĂłn, lleva ineludiblemente a averĂ­as y fugas desde el mismo momento en que se reciben las obras o en escasos mĂĄrgenes de tiempo (Figura 8). - InversiĂłn de las empresas gestoras en la inspecciĂłn pormenorizada del estado final de las edificaciones, antes de la concesiĂłn de los enganches. La propiedad particular puede estar fuera de las competencias de una empresa gestora, pero esta debe marcar perfectamente sus exigencias para conceder el servicio, respecto a evitar que se creen problemas que originen pĂŠrdidas no registradas (como se verĂĄ despuĂŠs). Asimismo, inversiĂłn respecto a la perfecta ubicaciĂłn y nivelaciĂłn de los elementos de registro, para que se cumplan las indicaciones de los fabricantes respecto a conseguir el error de mediciĂłn que aseguran, asĂ­ como la debida protecciĂłn frente a fenĂłmenos externos (cuestiones aplicables a las ejecuciones de acometidas en las redes externas tratadas en el apartado de construcciĂłn de redes) (Figura 9). Lo comentado en ese mismo apartado respecto a inspecciones deficitarias en obras de redes, es totalmente aplicable a lo relativo a las edificaciones. - CampaĂąas de inspecciĂłn. Al margen de los seguimientos derivados de alarmas en el control de facturaciones y de las revisiones aleatorias o reguladas de acometidas, son necesarias campaĂąas de inspecciĂłn en las propiedades particulares en cuanto a: s )NSPECCIĂ˜N DE LAS TUBERĂ“AS DE SUMINISTRO DE AGUA para uso de boca sin sistema de control/registro en la divisoria de la propiedad pĂşblica con la privada, con especial incidencia en las que surten a grupos de presiĂłn y/o aljibes, donde los contadores se sitĂşan de modo posterior. Tendiendo a eliminar estas disposiciones ya existentes (en los criterios constructivos para nuevas instalaciones, debiera evitarse). Las averĂ­as/fugas en su recorrido, los fallos de estanquidad en los sistemas de bombeo, los fallos de estanquidad en los aljibes, los propios fallos en sus sistemas de regulaciĂłn de niveles y cualquier operaciĂłn de limpieza y man-

www.tecnoaqua.es

ta 21 reportaje anr.indd 123

FIGURA 10. Fraude por derivaciĂłn sin control.

tenimiento, derivan en pĂŠrdidas de agua que son asumidas de modo directo por la empresa de servicio y no por la entidad particular que es la que, realmente, tiene la responsabilidad y debiera asumir el coste. Con el agravante de que lo que no se paga y no repercute en el cliente no se mantiene adecuadamente. Teniendo en cuenta, ademĂĄs, la posibilidad de tomas de agua para distintos usos, desde estos tramos (no serĂ­a la primera vez que se suministra agua a bajeras y otros, sin ninguna regulaciĂłn). Del mismo modo para las instalaciones de riego, desde donde se llegan a observar derivaciones sin control desde esos tramos previos al contador (ocultas, por supuesto, ya que son descubiertas normalmente a raĂ­z de averĂ­as) (Figura 10). s )NSPECCIĂ˜N EXHAUSTIVA DE LAS REDES DE INCENDIO Debido a las normativas iniciales respecto a la regulaciĂłn de estos sistemas, donde se exigĂ­a que no tuviesen elementos que pudiesen interferir el

123

03/11/16 15:34


Reportaje

FIGURA 11. Uso de agua sin control desde BIE.

paso de agua, la mayoría de las acometidas de incendio fueron construidas sin el oportuno elemento de registro/control. Ayudada esta decisión por el concepto de que es una red que no se usa salvo en el caso de acometer el fuego y que, por lo tanto, no es preceptivo el exigir ese registro, salvo (y no siempre) en el caso de redes de dimensionamientos importantes, tanto en longitudes como en secciones. En estos casos se tienen los mismos condicionantes que lo comentado en el apartado anterior, agravado de modo exponencial en las industrias, donde estas redes recorren la práctica totalidad de la superficie de la empresa, en tanto en cuanto las de abastecimiento de boca van a sitios puntuales (puntos concretos de trabajo, servicios, vestuarios y oficinas). Esta disposición, junto con la presencia de bocas de incendio equipadas (BIE) e incluso hidrantes, hace que se usen para cualquier necesidad, ante la falta de inspecciones regladas que lo eviten mediante el control de los oportunos precintos que debieran colocarse en el mismo momento en que se va a dar el alta de este servicio, para poder discernir si ha sido manipulado cuando se realiza la oportuna inspección periódica (Figura 11). El fraude en este tipo de sistemas se da y es necesario evitarlo. Se ha observado, incluso, la interconexión entre

124

ta 21 reportaje anr.indd 124

FIGURA 12. Derivación de agua desde la red de incendios.

la red de incendios y la de uso de boca, de modo que el principal gasto de agua puede que se derive de una red que no tiene registro /control y, por lo tanto, no es facturada. Al margen de cuestiones de calidad (Figura 12). s )NSPECCIØN DE LAS REDES DE PARQUES Y JARDINES PÞ blicos. Por un lado, no pueden permitirse redes sin registro/control adecuado. Por otro lado, hay que exigir las reparaciones oportunas, no solo en las fugas antes del elemento de registro, sino de las posteriores, ya que pueden darse puntos de fuga cuya entidad de caudal no sea suficiente para que quede registrada. Su posible suma en las diferentes redes que proliferan en nuestras ciudades llevan a caudales realmente importantes que quedan asumidas por la empresa de servicio. Tiene una incidencia bastante recurrente, en cuanto a afecciones, el situar arbolados anexos a tuberías existentes. Con su crecimiento, las raíces se aproximarán a las tuberías en razón a su tem-

FIGURA 13. Afecciones por raíces.

nº 21 - Septiembre-Octubre 2016

03/11/16 15:34


Reducción óptima del agua no registrada desde una gestión coherente de las empresas gestoras del servicio

peratura -si tiene alguna pequeña pérdida, mucho más rápido- y terminarán afectándolas. No se está contra los árboles, sino contra criterios de distancias inadecuados, que van a llevar a daños futuros. También en el árbol (Figura 13).

CONCLUSIÓN El concepto de ANR tiene una implicación de un gran número de factores, todos ellos importantes. La mayoría con necesidad del concurso de otros para su mejor desarrollo. Solo el conjunto, trabajando en consonancia, consigue los mejores resultados. El conjunto solo trabajará en consonancia a partir de normas y criterios diáfanos, exigentes y exigibles. Y la exigencia solo se consigue a través de la competencia, la implicación, la credibilidad y la cultura formativa e informativa. Por ello, existen: - Factores de responsabilidad exigible al ámbito de la propia empresa gestora del servicio, donde la buena praxis constructiva, la inspección y el control, deben ser sus referencias básicas. Con ellas, aunque pueda pa-

ta 21 reportaje anr.indd 125

recer no estar relacionado, se potencian los derechos del cliente (que somos todos), que es quien finalmente paga las irresponsabilidades de una mala gestión. - La exigencia a externos a la empresa gestora del servicio se sustenta, y se hace más creíble, y por lo tanto se consigue una mayor implicación y mejores resultados, con la implantación de formaciones adecuadas, así como informaciones, en continuo. La experiencia de cualquier nivel es básica. Buscar esa experiencia, escucharla, comprenderla y activar-aplicar sus conocimientos es tener sentido común y responsabilidad de gestión. Saber buscar y aprender de otros, desarrollar, informar-formar y aplicar medios adecuados de gestión y herramientas de aplicación es parte inseparable de la competencia en la gestión. Y el factor humano competente e implicado, siempre, como el componente más importante a gestionar. Este reportaje es una primera parte de una serie de tres que tendrá continuación en los siguientes números de Tecnoaqua.

03/11/16 15:34


Reportaje

La economía circular de Saint-Gobain PAM España Miguel Ángel Pérez Navarro standardization manager de Saint-Gobain PAM España

La Comisión Europea (CE) ha publicado una comunicación sobre economía circular que describe una estrategia destinada a proporcionar beneficios a la sociedad y ventajas competitivas a la industria europea. Requiere un marco coherente de políticas, financiación, inversión, apoyo a las mejores prácticas de fabricación, innovación, evaluación de la sostenibilidad, normas para materiales secundarios, estadísticas y formación, ofreciendo también oportunidades de empleo. Como respuesta en el ámbito general de la construcción y en el sector del transporte de agua en particular, Saint-Gobain PAM España, empresa especializada en canalizaciones de abastecimiento, saneamiento y riego en fundición dúctil, fabrica utilizando las llamadas Mejores Técnicas Disponibles (MTD) y cuenta con investigadores que trabajan diariamente en ecoinnovación. Todo ello para mejorar el coste de ciclo de vida de los productos, minimizar sus impactos ambientales y ofrecer productos con las mayores garantías para la salud pública.

126

ta 21 reportaje sgpam.indd 126

nº 21 - Septiembre-Octubre 2016

03/11/16 15:36


La economía circular de Saint-Gobain PAM España

Para el sector de productos de construcción, la intención de la Comisión Europea es fomentar el reciclaje de residuos de construcción y demolición (CDW, por sus siglás en inglés) y mejorar el diseño de las construcciones para alcanzar, así, los objetivos en materia de reducción de impactos ambientales y aumentar la durabilidad y reciclabilidad de las obras (Figura 1). Y es aquí donde entra en juego el papel de la fundición férrea, sirviendo de ejemplo de economía circular para el futuro de la industria europea, gracias a unas propiedades únicas, al partir de un material, el hierro, 100% reciclable, fundamental para crear un ciclo que incluye a la producción, el uso, la reutilización y el reciclado de materiales, y que aporta beneficios a la sociedad en todas estas etapas. La industria europea de la fundición férrea siempre ha sido gran innovadora en este sentido. Con las tasas de reciclaje en Europa por encima del 85% en el sector siderúrgico, considerar este tipo de información en evaluación de productos ayudará a impulsar la demanda futura de productos sostenibles, como la tubería de fundición dúctil, aportando múltiples beneficios a la sociedad. En Europa es ya habitual que la toma de decisiones en la contratación pública sea responsable y coherente con este enfoque, basado en el análisis de coste de ciclo de vida de las nuevas directivas de contratación, para obtener la oferta económicamente más ventajosa.

LA ECOINNOVACIÓN DE LA FUNDICIÓN DE HIERRO Se suele definir como mejores técnicas disponibles (MTD) aquellas tecnologías utilizadas en la fabricación junto con la forma en que la instalación esté diseñada, construida, mantenida y explotada, y siempre que sean las más eficaces para alcanzar un alto nivel de protección del medio ambiente en su conjunto y que puedan ser aplicadas en condiciones económica y técnicamente viables. Los documentos que recogen estas MTD en el ámbito europeo son los denominados documentos BREF. Actualmente hay 33 aprobados por la Comisión Europea, incluyendo la fundición de hierro. La propuesta legislativa europea apoya la introducción de nuevas definiciones que aclaren el valor de las operaciones de recuperación de materiales. El uso de estas definiciones, el enfoque de ciclo de vida completo y el uso de MTD en la fabricación, permite ahorrar más de la mitad de emisiones de CO2 que generan otros modelos de fabricación y evitar otros impactos ambientales (Figura 2). Con objeto de facilitar el diseño y la innovación en favor de una economía más circular, la Comisión facilitará el desarrollo de modelos más circulares de productos y servicios, incluso a través de una política de productos más coherente, y seguirá desarrollando la aplicación de la directiva sobre diseño ecológico prestando más atención a los criterios de eficiencia de los recursos, incluso para los futuros grupos de productos prioritarios del Plan de trabajo 2015-2017.

FIGURA 1. Límites de la economía lineal, economía circular y áreas prioritarias de actuación. Fuente: Paquete para la economía circular de la Comisión Europea.

Límites de la economía lineal

Economía circular

www.tecnoaqua.es

ta 21 reportaje sgpam.indd 127

Áreas prioritarias

127

03/11/16 15:36


Reportaje

FIGURA 2. Economía circular. Fuente: Comisión Europea, hacia una economía circular: un programa de cero residuos para Europa.

LA ECONOMÍA CIRCULAR DE SAINT-GOBAIN PAM Saint-Gobain PAM España fabrica utilizando MTD y cuenta con investigadores que trabajan diariamente en ecoinnovación para mejorar el coste de ciclo de vida de nuestros productos, minimizar sus impactos ambientales y ofrecer productos con las mayores garantías para la salud pública. Estas tuberías de fundición generan un gran retorno económico a la sociedad, del que también participan proveedores, recicladores y usuarios, que mejoran sus indicadores de servicio. Esta poderosa influencia surge de largas cadenas de valor, a través de una serie de actividades económicas que incluyen al transporte, la construcción, el abastecimiento e incluso a las energías renovables. La innovación no solo consiste en hacer productos de mayor calidad. Los procesos de producción de SaintGobain PAM también mejoran continuamente para minimizar el consumo de recursos energéticos y minerales, lo que ha conllevado un aumento espectacular de su eficiencia y productividad en los últimos cinco años (Figuras 3 y 4). Al mismo tiempo, la empresa ha continuado reduciendo su impacto sobre el medio ambiente, buscando aplicaciones externas para los subproductos y ecodiseñando para mejorar el comportamiento ambiental, tanto en fabricación como en la fase de uso y, cómo no, reciclando y reutilizándolos al final de su vida útil. Lo que también contribuye a disponer de un suministro de materias primas estable, fiable y suficiente en el contexto europeo. El modelo de economía circular de Saint-Gobain PAM se basa en entender la simbiosis de la empresa con otras y dentro del ciclo con los proveedores y usuarios de los servicios de agua. He aquí algunos ejemplos implan-

128

ta 21 reportaje sgpam.indd 128

tados siguiendo las recomendaciones de la Comisión Europea: - Reducción de la cantidad de materiales necesarios para la prestación de un servicio concreto, mediante una nueva línea de control continuo de espesores. - Alargamiento de la vida útil de los productos gracias al desarrollo de diferentes revestimientos adaptados a distintas condiciones de uso. - Reducción del consumo de energía y de materiales en las fases de producción y de uso implantando sistemas de gestión de eficiencia energética, tanto en fabricación, como en uso aumentando el diámetro hidráulico. - Reducción del uso de materiales peligrosos o difíciles de reciclar en productos y procesos de producción requiriendo el registro REACH a proveedores y sustituyendo componentes anticipándonos a la entrada en vigor de propuestas legislativas. - Creación de mercados para materias primas secundarias y búsqueda de usos externos para los subproductos. - Diseño de productos para que sean más fáciles de mantener, reparar, actualizar, reelaborar y reciclar: ecodiseño para facilitar la localización, reparación y facilitar el reciclado aportando valor. - Desarrollo de los servicios necesarios para los consumidores mediante trazabilidad de productos y asistencia técnica para la instalación, mantenimiento y reparación, así como oferta de servicio de recuperación de materiales. - Incentivación y apoyo de la reducción de residuos y la separación de alta calidad por parte de los consumidores, facilitando la separación del hierro de los revestimientos. - Incentivación de los sistemas de separación y recogida que reducen al mínimo los costes de reciclado y reutilización mediante puntos limpios y gestores del reciclado.

FIGURA 3. Certificaciones de gestión energética, ambiental, seguridad e higiene e innovación.

nº 21 - Septiembre-Octubre 2016

03/11/16 15:36


La economía circular de Saint-Gobain PAM España

FIGURA 4. Extensión de los conceptos al ecomontaje.

- Simbiosis industrial, apoyando la agrupación de actividades para impedir que los subproductos se conviertan en residuos.

CONCLUSIÓN Las estadísticas apoyan firmemente a la fundición férrea como material sostenible para el futuro. La visión de Saint-Gobain por la economía circular no solo se basa en ofrecer soluciones eficientes adoptadas a cada uso, sino también en la innovación de toda la cadena de valor. Así:

» Con la economía circular, los productos se ecodiseñan y fabrican mediante tecnologías MTD para minimizar los impactos ambientales y que sean más duraderos y fáciles de reciclar, aportando mayor valor

www.tecnoaqua.es

ta 21 reportaje sgpam.indd 129

- El proceso de producción se basa en la reutilización de productos férreos tras su fin de vida para preservar los recursos naturales y reducir su dependencia, minimizando las emisiones perjudiciales para el medio ambiente e impulsando el empleo. - Los productos se ecodiseñan para que sean más duraderos y fáciles de reciclar, aportando valor. - El asesoramiento en proyecto y puesta en obra mejora la durabilidad y fiabilidad del servicio en la fase de uso. - La creación de fases interrelacionadas con otros productos e industrias, con las que intercambiamos subproductos, permite ofrecer a los usuarios productos que integran otros servicios que benefician a la sociedad. Una producción fuerte y sostenible en Europa, permite orientar la innovación hacia el ecodiseño y la economía circular, en beneficio de todos. Sin el apoyo a sectores como este, altamente eficiente e innovador, la industria europea perdería el liderazgo de este enfoque.

129

03/11/16 15:36


Reportaje

Depuración extensiva y regeneración de aguas: una solución ideal para las pequeñas poblaciones Javier Carbonell Espín presidente de Ogesa y consejero delegado de QuarQ Enterprise

Tras muchos años de bonanza y otros tantos de crisis, la asignatura troncal de nuestro país, la que es la llave del bienestar social y medioambiental, está suspendida y fuera de control. Más de 6.000 pequeños municipios no depuran las aguas residuales de su población, a pesar de que el ciudadano lo pague en su recibo y lo desconozca. Eso sí, todos estos pueblos disponen de polideportivos, grandes rotondas y otras infraestructuras menos necesarias que la estaciones depuradoras de aguas residuales (EDAR), e inauguradas con fiestas y fuegos artificiales. Estos municipios no deberían tener licencia de apertura, nunca mejor dicho, por contaminadores, pues no depurar es otra forma de 'incendiar el monte'. Ante esta situación, y en el largo camino a la excelencia a través del conocimiento, desde QuarQ Enterprise se sigue apostando por el desarrollo tecnológico de los sistemas de tratamiento de aguas residuales mediante tecnologías sostenibles que conjuguen eficacia y bajo coste para estos pequeños municipios. En especial por los tamices vegetales de helófitas en flotación. Actualmente, esta compañía dispone de esta tecnología de tratamiento de aguas mediante humedales artificiales con tamices vegetales de helófitas en flotación: el Sistema aQuarQ.

130

ta 21 reportaje quargogesa.indd 130

nº 21 - Septiembre-Octubre 2016

03/11/16 15:37


Depuración extensiva y regeneración de aguas: una solución ideal para las pequeñas poblaciones

A muchos municipios pequeños las administraciones les han construido depuradoras 'gratuitas'. Problema resuelto, si no fuera inviable su mantenimiento. La mayoría no funcionan y han quedado obsoletas, incluso sin haber funcionado nunca. La obsesión de las administraciones con la construcción de más y más costosas plantas pilotos y demostrativas, supliendo y cuestionando la viabilidad de las construidas a iniciativa privadas, hace que el panorama actual sea de un gran caos, desconcierto e insostenible. La falta y disparidad de criterios razonables, técnicos y legales, llevan perjudicando y haciendo inviables también las tecnologías extensivas, un grave error por ser las únicas alternativas viables por su bajo coste de inversión y mantenimiento, siendo las únicas que podrán dar una solución rápida, eficiente y natural a la mayor parte de la depuración pendiente y que, fundamentalmente, corresponde a más de 6.000 pequeños municipios españoles. Todos los profesionales del agua saben que en la actualidad hay más de 6.000 focos de contaminación conocidos, que originan un gran impacto negativo ambiental y un gran peligro a la salubridad. Aunque con los sistemas extensivos actuales, en especial los tamices flotantes, la solución sería poco costosa y rápida, siempre que no haya otros intereses, no se puede hablar de depuración sostenible, natural y de futuro en las pequeñas poblaciones sin replantearse las tecnologías extensivas conjuntamente con la reutilización del agua.

SITUACIÓN ACTUAL DE LA REUTILIZACIÓN Históricamente se ha realizado en España una reutilización no planificada del agua residual, que actualmente

continúa haciéndose. Esta reutilización consiste en captar agua de un cauce (donde aguas arriba vierte una población sus aguas residuales, tratadas o no), una práctica que ha supuesto, y supone aún, un riesgo sanitario tanto para los consumidores como para los trabajadores que la empleaban. Con la entrada en vigor del Real Decreto (RD) 1620/2007 se fomentó y planificó el Régimen Jurídico de la Reutilización de las Aguas Depuradas. Este RD establece la obligatoriedad de disponer de una autorización o concesión administrativa para la reutilización de las aguas residuales depuradas. Pretende promover un uso sostenible de los recursos hídricos y establecer unos criterios de calidad del agua regenerada que permitan preservar la salud y el medio ambiente. Asimismo, establece los usos posibles del agua regenerada: urbano, agrícola, industrial, recreativo y ambiental, e indica los parámetros de calidad de agua que debe cumplir para cada uso. De estos posibles usos, los mayoritariamente implantados en España desde la entrada en vigor del RD han sido el uso agrícola (63% del volumen de agua reutilizada) y el uso ambiental (21% del volumen del agua reutilizada). Así, el volumen total de agua regenerada y reutilizada en España asciende a aproximadamente a 350 hm3/año, apenas un 10% del agua depurada disponible. La reutilización de agua depurada ha supuesto para el uso agrícola el empleo de una fuente de agua segura y de calidad, pero su uso está limitado principalmente por el elevado coste del agua regenerada para uso agrícola, que hace que no sea competitivo con el empleo de suministros tradicionales y consolidados (captación en

Conozca un poco más a... JAVIER CARBONELL ESPÍN Javier Carbonell Espín es ingeniero agrónomo y especialista en industrias agrarias por la Universidad de Córdoba. Cordobés de razón y extremeño de corazón, casado con dos hijos, en sus 30 años de ejercicio profesional, ha sido gerente de varias empresas relacionadas con el conocimiento y las nuevas tecnologías, en especial en el mundo de la consultoría, la ingeniería, la arquitectura, la energía, el agua y el medio ambiente. Autor de varias publicaciones y ponencias, también es socio fundador en varias asociaciones y fundaciones, además de consejero y accionista de varias empresas. Javier ha sido merecedor de varios premios y nominaciones: en 2009 fue galardonado con el Primer Premio Extremeño EFQM a la Excelencia Empresarial en la Categoría de Mediana y Gran empresa; en 2010 fue nombrado Empresario Extremeño del año por el Periódico Extremadura; en 2011, Premio al Capital Humano por la Escuela de Negocios ITAE en su 25º aniversario; en 2012, fue premiado como Empresario Reconocido por la Escuela de Ingenieros Industriales de la Universidad de Extremadura. Actualmente es presidente de la firma de consultoría, ingeniería y arquitectura Ogesa, consejero delegado de la firma tecnológica de agua QuarQ Enterprise y es past presidente del Club Rotary de Badajoz.

www.tecnoaqua.es

ta 21 reportaje quargogesa.indd 131

131

03/11/16 15:37


Reportaje

En muchos municipios de España se han construido depuradoras que actualmente están obsoletas o sin uso.

masas de aguas superficiales o subterráneas). Por ello, la reutilización en España se enfrenta a una serie de retos, entre ellos que es necesaria una importante inversión en instalaciones de regeneración de agua, así como de infraestructuras de transporte y almacenamiento. También es importante destacar que el concepto de reutilización del agua está vinculado al de depuración del agua residual, es decir, en ningún caso está permitida la reutilización del agua residual sin tratar. Por tanto, la generalización del empleo del agua residual urbana regenerada pasa inexcusablemente por la obligatoriedad de que el municipio disponga de un tratamiento de depuración adecuado previo al sistema de regeneración, condición que no se cumple en más de 6.000 núcleos urbanos españoles. Otro de los principales impedimentos de cara a extender la práctica del uso del agua regenerada es una normativa y regulación demasiado estricta para la aplicación de prácticas de reutilización a nivel generalizado.

LA REGENERACIÓN COMO NECESIDAD FUTURA Pese a las dificultades encontradas, la generalización del empleo del agua regenerada es una necesidad en España de cara a conseguir una gestión sostenible de los recursos y mitigar los efectos previsibles del cambio climático y los efectos de los fenómenos recurrentes de sequía propios de la Península Ibérica. Durante los próximos 10 años se estima que la aportación media a las cuencas hidrográficas peninsulares puede disminuir hasta un 11% lo que supondrá poner en riesgo la seguridad del suministro en las zonas más vulnerables como Murcia y Almería y, en general, todo el sur de España. Suplir la pérdida del recurso mediante la regeneración de aguas residuales supondrá, sin duda alguna, la asunción de un coste asociado a las mejoras de los tratamientos de depuración de aguas residuales, la ejecución de sistemas de regeneración que permitan cumplir los condicionantes establecidos en el Real Decreto y ratificados en el plan Nacional de Reutilización de Aguas, así como la ejecución de sistemas de almacenamiento y distribución. Para tener una idea de la importancia de los costes actuales del agua regenerada cabe mencionar que, mientras que el precio medio del agua superficial para riego es de 0,02 €/m3, los costes estimados de explotación únicamente de una planta de regeneración de agua tratada en una EDAR oscilan entre los 0,06 €/m3 para un agua regenerada destinada a riego agrícola para consumo no fresco y los 0,2 €/m3 para un agua regenerada destinada a torre de refrigeración o riego de jardines privados. Si, además, hay que reducir la salinidad del agua regenerada, el coste se dispara a unos 0,46 €/m3. Así, el futuro pasa por: - Introducir tecnologías extensivas en la depuración de pequeñas poblaciones. - La regeneración de la misma. - La acumulación del agua tratada. - Mantenimiento de su calidad. - El tratamiento idóneo según su uso (por ejemplo, la no eliminación del nitrógeno y fósforo cuando este va a ser agrario).

» Pese a las dificultades encontradas, el agua regenerada es una necesidad en España de cara a conseguir una gestión sostenible de los recursos y mitigar los efectos previsibles del cambio climático y de los fenómenos recurrentes de sequía propios de la Península Ibérica

132

ta 21 reportaje quargogesa.indd 132

nº 21 - Septiembre-Octubre 2016

03/11/16 15:37


Depuración extensiva y regeneración de aguas: una solución ideal para las pequeñas poblaciones

La tecnología de tratamiento de aguas mediante humedales artificiales con tamices vegetales de helófitas en flotación es una solución de bajo coste muy indicada para la depuración de pequeños municipios (2.000 habitantes).

LOS SISTEMAS EXTENSIVOS DE BAJO COSTE COMO SOLUCIÓN Por tanto, la generalización de la práctica de reutilización del agua debe comenzar por la implementación de tecnologías que permitan la reducción de costes no solo en las plantas de regeneración de agua sino en la totalidad del ciclo integral del agua. A este respecto, la existencia de unos 6.000 pequeños municipios en España que, a día de hoy, aún no cuentan con un sistema de tratamiento adecuado tal como exigen la normativa vigente, debe enfocarse como una oportunidad de implementar sistemas de bajo coste extensivos que integren en una misma instalación el tratamiento de depuración, regeneración y acumulación de agua regenerada. Una ventaja fundamental de este enfoque es que, en aquellos lugares donde sea viable técnica y económicamente la reutilización del agua regenerada para uso agrícola, puede suponer un ahorro de coste de instalación y operación del sistema al no ser necesario (y siendo incluso contraproducente) la implementación de costosos sistemas de depuración de aguas residuales intensivos diseñados y dimensionados para asegurar la eliminación de nutrientes.

www.tecnoaqua.es

ta 21 reportaje quargogesa.indd 133

Para la consecución de estos objetivos, QuarQ Enterprise ha desarrollado un sistema de tratamiento de tamices de helófitas en flotación que permite tanto el tratamiento de depuración del agua residual como un tratamiento complementario para aguas ya depuradas que permite integrar la mejora de calidad, el almacenamiento y el mantenimiento de la calidad del agua almacenada en la propia infraestructura de almacenamiento desde donde, tras una operación de desinfección con cualquiera de las tecnologías disponibles, se obtiene un agua regenerada apta para el uso principalmente agrícola. Este sistema, denominado aQuarQ, logra una eficaz remoción de la materia orgánica y contaminantes que contienen las aguas residuales, utilizando plantas superiores helófitas de tipo emergente que se dan de forma natural en humedales y zonas inundadas, pero en este caso, transformadas artificialmente en flotantes. Sus sistemas rizomáticos conforman un denso entramado que las convierte en la solución óptima para la creación de filtros verdes vegetales de depuración natural. La tecnología aQuarQ consigue reducir la DBO5 hasta el 95%, el DQO hasta el 90%, la NTK hasta el 50% y los patógenos hasta el 95%.

133

03/11/16 15:37


Entrevista

SERGIO PEPIÓ ABEJARO presidente de la Asociación Española de Empresas de Tecnologías del Agua (Asagua)

ESPAÑA PRECISA MÁS DE 25.000 MILLONES DE EUROS PARA INFRAESTRUCTURAS DEL AGUA, RENTABLES EN TODO MOMENTO La Asociación Española de Empresas de Tecnologías del Agua (Asagua) ha nombrado a Sergio Pepió Abejaro nuevo presidente. Asagua es un proyecto común de empresas comprometidas con la sostenibilidad y la gestión eficiente de los recursos hídricos, que con la innovación como base, cubren todos los ámbitos tecnológicos de las aguas urbanas, industriales y agrícolas: potabilización, desalación, depuración, reutilización y recuperación de ríos. Estas empresas quieren ser un instrumento al servicio de todas las administraciones públicas y del sector privado, para colaborar a la consecución de una gestión más eficiente de los recursos hídricos, y con este fin decidieron unir fuerzas para multiplicar sus capacidades. La asociación tiene como objetivos promover la actividad del sector en el mercado nacional y apoyar la presencia de las empresas en el exterior; colaborar con las administraciones públicas en el desarrollo de políticas de sostenibilidad hídrica; fomentar la colaboración de los sectores público y privado en la financiación de infraestructuras e impulsar la investigación de nuevas tecnologías. Todo ello nos los explica su nuevo presidente en esta entrevista.

Rubén J. Vinagre García coordinador editorial Tecnoaqua

Asagua estrena nueva presidencia, ¿ello implica nueva etapa o un continuismo con lo hecho hasta ahora? Sin perder de vista el carácter mercantil de las empresas que forman Asagua (Comsa, Dam, Elecnor, Pesa Medioambiente, Socamex y Veolia Water), a todas nos une una vocación de servicio, por eso no dudamos en colaborar con las administraciones públicas y demás instituciones presentes en la planificación y gestión del recurso agua, sin olvidar que la innovación es uno de los puntales en los que nos asentamos y al que

134

entrevista.indd 134

nº 21 - Septiembre-Octubre 2016

03/11/16 15:37


Entrevista

dedicamos una parte de nuestra actividad y recursos. Desde el nacimiento de Asagua, este ha sido su cometido y en esta línea seguiremos trabajando y, en consecuencia, reivindicando todas las medidas que, en aras del buen servicio público, sirvan para mejorar el sector. Por tanto, ¿cuáles serán los principales 'campos de batalla' de Asagua? La construcción en general, y el agua en particular, son el motor del que dispone el Gobierno para levantar la economía del país, ahora tan maltrecho como consecuencia de la falta de inversión, carencia que, como denunciamos en nuestra Asamblea Anual del pasado julio, es la causa principal de la pérdida de empleos cualificados y de que se produzcan bajas en las licitaciones que llegan a superar el 50%. Asagua, en coherencia con lo dicho, viene solicitando al Gobierno desde hace años, y lo seguirá haciendo, que reactive la inversión, causa principal y directa de la mayor parte de los males que aquejan al sector, y que publique las normas que han de contribuir a modernizar la regulación del sector. Aunque los últimos años están siendo de extrema dureza, confiamos en que pronto llegarán tiempos mejores, que no alcanzarán los pasados, pero permitirán al sector afrontar el futuro con la certidumbre de saber lo que ofrece y necesita el mercado. Para situarnos a nivel general, ¿en qué situación se encuentra el sector del agua según su parecer? Como consecuencia de los recortes presupuestarios en materia de inversión y de la falta de una regulación adecuada de la colaboración público-privada, la licitación ha sufrido una fuerte caída. Las pérdidas de puestos de trabajo -muchos de ellos de alta especialización- y el deterioro del capital público son notorios y, en algunos casos, puede ser que irreversibles. Ente esta situación hemos de hacernos una pregunta: ¿cuánto dinero habrá que invertir para que las infraestructuras vuelvan a estar en las condiciones de conservación y seguridad que tenían en el año 2007? ¿10.000, 50.000 millones? Queda claro que a nivel de infraestructuras, llevan años denunciando la falta de inversión por parte de la administración. ¿Por qué? En España, la inversión pública tradicionalmente ha sufrido fuertes altibajos al no disponer de una planificación eficiente, por no decir inexistente. Las inversiones en infraestructuras se convierten en bienes de capital que necesitan de un mantenimiento adecuado

www.tecnoaqua.es

entrevista.indd 135

» Es necesaria una inversión anual en mantenimiento y conservación de infraestructuras de agua equivalente al 2% del PIB

para que alcancen su rendimiento óptimo. El capital y su mantenimiento mejoran la calidad del stock del capital público. En términos técnicos, esa conservación es vital para garantizar el buen funcionamiento de los servicios y la seguridad de las personas y de los bienes. A la vista del valor de ese capital, sería necesaria una inversión anual en mantenimiento y conservación equivalente al 2% del PIB. El recorte de las inversiones en agua afecta, además de a la conservación de las infraestructuras existentes, a las nuevas infraestructuras, que siendo muy necesarias no se construyen. El parón en la inversión ha ralentizado el avance del Plan Nacional de Calidad de las Aguas o, lo que es igual, ha impedido avanzar en el cumplimiento de la Directiva Marco del Agua, con la consecuente amenaza de sanciones. Es una pena que sabiendo cuáles son las actuaciones necesarias no se acometa su planificación y ejecución con criterios técnicos, y todo por el empeño en que la inversión soporte el ajuste fiscal para paliar el déficit.

135

03/11/16 15:37


Sergio Pepió Abejaro, presidente de Asagua

Conozca un poco más a... SERGIO PEPIÓ ABEJARO Sergio Pepió Abejaro (1969) es ingeniero de Caminos, Canales y Puertos y máster en Dirección y Organización de Empresas de la Construcción por la Universitat Politècnica de Catalunya. Actualmente, ejerce como director gerente de Pesa Medioambiente, empresa asociada de Asagua. Su trayectoria profesional se ha desarrollado principalmente en el mundo del agua, donde ha ocupado diversos cargos en empresas como el de responsable del departamento de proyectos y obras de depuración de la División Agua y Saneamiento del Grupo Aguas de Barcelona (2001-2004), responsable de proyectos y direcciones de obra en Alfa Tecnologies (2001), director de Construcciones y Explotaciones, gerente de UTE, project manager y director de la Oficina Técnica de Arema (1995-1999) o responsable de Proyectos deestaciones de tratamiento y depuración de aguas residuales en OMS Ibérica (1994-1995).

España precisa, para empezar a hablar, más de 25.000 millones de euros para infraestructuras del agua, naturalmente rentables en todos los términos, y reactivar la inversión en conservación y mantenimiento de las existentes, más un plus importante para rehabilitar el patrimonio hidráulico que haya resultado deteriorado a causa de la poca inversión habida en los últimos años, cuestión que antes enunciamos. Lograr un contexto normativo claro y estable de colaboración público-privada supondría un impulso de financiación y se podrían licitar los contratos que se han visto paralizados debido al escaso presupuesto público.

» Es necesaria una política de Estado que integre las necesidades sobre agua de todo el país y les dé una solución unitaria impregnada de solidaridad La situación política actual tampoco parece que ayude, ¿no? Para cumplir los fines de la asociación tenemos que relacionarnos con los políticos, pero claro está al margen de la política. Nuestras reivindicaciones son apolíticas porque decimos y pedimos lo que consideramos que es necesario para una buena gestión del agua. Es necesaria una política de Estado que integre las necesidades sobre agua de todo el país y les dé una solución unitaria impregnada de solidaridad. Todo el mundo parece aceptar la universalidad del derecho al agua, sin embargo no hay una única idea de cómo hacerlo efectivo. Y este es el problema. Para que ese derecho sea pleno, además de disponer de agua, esta tiene que ser de calidad y, una vez utilizada, debe ser

136

entrevista.indd 136

recogida y tratada convenientemente para que no contamine antes de volver al ciclo. El sector precisa cambios normativos, y para ello se requiere un Gobierno. El último año se ha perdido, no se ha realizado la trasposición de las Directivas Europeas y, en consecuencia, no se ha cambiado la Ley de Contratos del sector Público, lo que empeora el panorama para el sector. Es necesario avanzar en el cumplimiento de la Directiva Marco del Agua, adecuar el bloque normativo que regula la contratación pública a las correspondientes directivas europeas, desarrollar la colaboración público-privada con las debidas garantías de seguridad jurídica y establecer la figura del regulador único para una eficiente regulación del ciclo urbano del agua, sobre todo si se tiene en cuenta la gran cantidad y variedad de competencias en esta parcela de la gestión del agua. ¿Y no existen otras soluciones que no sea pasar por la administración para conseguir financiación? Sí, desarrollar y amparar jurídicamente las distintas formas de colaboración público privada, lo que podría hacerse mediante una ley sectorial que establezca un marco estable y seguro que permita y anime a la inversión privada. Debería recoger las experiencias existentes y establecer un régimen económico financiero de la utilización del dominio público hidráulico (canon de control de vertidos, tarifas por tramos de consumo para el suministro, canon de regulación y tarifa de utilización del agua), que genere ingresos suficientes para cubrir el mantenimiento y conservación de las infraestructuras existentes y la ejecución de otras nuevas. Tampoco podemos olvidar el sector industrial y otros nichos de mercado que, con financiación privada, permiten el desarrollo de un mercado de venta de agua tratada con calidad terciaria.

nº 21 - Septiembre-Octubre 2016

03/11/16 15:38


Entrevista

¿Cree necesaria la implantación en España de un regulador único? Sí, con el fin de armonizar los niveles de prestación de los servicios, las estructuras tarifarias, y la transparencia y la participación de la ciudadanía, buscando siempre la eficiencia en el desempeño de los servicios del agua, todo lo cual contribuiría a que surgiera un sistema homogéneo de prestaciones y de tarifas en las distintas regiones de España, en definitiva a fomentar la solidaridad. Critican las licitaciones y los pliegos actuales porque en ellos no prima la mejor oferta. Explíquese por favor. Voy a ir a los conceptos para no extenderme mucho. Dejando aparte las licitaciones en las que solo existe una oferta económica, en los concursos (varios criterios de adjudicación económicos y técnicos) y concursos de proyecto y obra (presentación del proyecto por el empresario), la oferta es doble, económica y técnica. En los pliegos de cláusulas administrativas particulares se suele valorar más la oferta económica en detrimento de la técnica, estableciendo ponderaciones de entre el 80-20 (caso general en el Magrama) y el 60-40 (excepción que necesita una autorización especial) a favor de la primera, lo cual es un disparate porque la oferta técnica explicita los medios de todo tipo que empleará el

empresario para construir con garantía total la obra que quiere la administración. Por tanto, es fundamental que la oferta adjudicataria tenga una buena calidad técnica, lo que no se logra con esta clase de pliegos, puesto que puede resultar adjudicatario un licitador que ha presentado una deficiente oferta técnica y una baja muy alta, con lo que la garantía del buen fin del contrato, esto es de su cumplimiento, desaparece, ya que por una parte los medios técnicos no son los adecuados y por otra el riesgo económico en el que incurre es muy elevado. Para evitarlo hay que valorar igual ambas ofertas, técnica y económica, si no más la primera y exigir al empresario unas condiciones de solvencia, técnicas y económicas, que demuestren que dispone de los medios necesarios para acometer con garantía la construcción, mantenimiento y, en su caso, explotación de la infraestructura. A esto hemos de añadir la importancia de evitar las bajas anormales, cuestión en la que no ayudan precisamente los órganos de la administración. Las directivas europeas en materia de contratación quieren la oferta más ventajosa para la administración, que no es solo la mejor oferta económica. Sin embargo aquí se aduce que debe imponerse lo económico. Como hemos dicho en ocasiones anteriores quizás sobre este tema planea el buitre de la corrupción y, por

» Las directivas europeas en materia de contratación quieren la oferta más ventajosa para la administración, que no es solo la mejor oferta económica. Sin embargo, aquí se aduce que debe imponerse lo económico

www.tecnoaqua.es

entrevista.indd 137

137

03/11/16 15:38


Sergio Pepió Abejaro, presidente de Asagua

tanto, esa desproporción entre el valor de las ofertas técnica y económica no sea más que un intento de objetivar el resultado, eso sí, en detrimento del interés público. Entiendo, por tanto, que el impulso por la investigación y las nuevas tecnologías es otro de los grandes retos del sector. ¿Cómo actúan desde Asagua para fomentarlo? La investigación, el desarrollo y la innovación tecnológica son las actividades que conforman la base que sostiene y vigoriza el progreso individual y colectivo. Mediante su ejercicio se descubren nuevos conocimientos, aumenta la comprensión en el ámbito de lo científico y lo tecnológico, se obtienen, diseñan o mejoran materiales, productos, procesos y sistemas productivos y se materializan los resultados en planos, esquemas y diseños. España pertenece a la Europa que tiene problemas de agua, y así, mientras en una parte hay inundaciones en otra se impone la sequía. La administración hidráulica de España ha tenido que lidiar desde siempre con estas situaciones, por lo que tiene una gran experiencia mundialmente reconocida. Las empresas no le han ido a la zaga y el resultado es también el enorme prestigio que a escala mundial tienen las empresas del agua y los técnicos que se dedican a esta actividad. El producto que resulta de las actividades de I+D+i que desarrollan las empresas tecnológicas dedicadas a la construcción de infraestructuras, se incorpora a su base tecnológica para aplicarlo a la construcción, mantenimiento y explotación de infraestructuras, por tanto no es de venta directa. Desde este punto de vista, las

138

entrevista.indd 138

empresas de Asagua están convencidas de la importancia que tiene esta labor como criterio diferenciador y a ellas dedican una parte de su esfuerzo. A nadie se le oculta que estas actividades necesitan dinero y que para obtenerlo las empresas tienen que tener trabajo, lo que ahora escasea y por tanto el gasto en I+D+i ha ido cayendo a medida que la inversión ha ido disminuyendo. A nivel interno de la asociación, ¿qué retos asume como nuevo presidente? Los que marca la Asamblea, que son los que he expuesto en este cuestionario. Colaborar con la administración y reivindicar todo lo que se considere necesario para asegurar el buen estado de salud del agua y de las empresas y profesionales que la cultivan. Y, por último, ¿cómo definiría a las empresas que forman parte de Asagua? Asagua es un proyecto común de empresas comprometidas con la sostenibilidad y la gestión eficiente de los recursos hídricos, que con la innovación como base, cubren todos los ámbitos tecnológicos de las aguas urbanas, industriales y agrícolas. En ellas podemos encontrar la experiencia para acometer con éxito cualquier trabajo de construcción, en la seguridad de que lo realizado funcionará bien, porque dominan el arte de la construcción, que es el que hace que lo proyectado cumpla los objetivos propuestos cuando se hace realidad, para lo cual se necesita esa 'magia' que forma parte del arte, la innovación.

nº 21 - Septiembre-Octubre 2016

03/11/16 15:38


smagua.indd 1

31/10/16 15:58


AEASt $ 4PS OHFMB EF MB $SV[ 1MBOUB ‹ % t .BESJE t 5FM XXX BFBT FT

AEAS impulsa en EspaĂąa la lucha contra 'el monstruo de las cloacas' El sector internacional del agua urbana firma una DeclaraciĂłn de posicionamiento sobre los productos no aptos para desechar por el inodoro y aquellos etiquetados como aptos. Esta iniciativa pretende evitar los problemas medioambientales y econĂłmicos provocados por las obstrucciones y daĂąos en los equipos de las redes de alcantarillado y estaciones depuradoras. La patronal EurEau calcula que arrojar toallitas hĂşmedas por el inodoro cuesta hasta 1.000 millones de euros al aĂąo en Europa y aumenta hasta en un 18% el coste de mantenimiento del alcantarillado.

Unas 200 asociaciones y entidades operadoras de los servicios de agua urbana de 14 paĂ­ses, entre ellos EspaĂąa, han firmado una DeclaraciĂłn de posicionamiento del sector sobre los productos no aptos para desechar por el inodoro y aquellos etiquetados como aptos. En el caso de EspaĂąa, la AsociaciĂłn EspaĂąola de Abastecimientos de Agua y Saneamiento (AEAS) ha sido la encargada de promover e impulsar en esta iniciativa, a la que se han adherido numerosas adhesiones de empresas espaĂąolas operadoras de los servicios de agua urbana. Los firmantes de esta DeclaraciĂłn han acordado los siguientes puntos: 140

aeas informa.indd 140

- Por el inodoro solo deben desecharse la orina, heces y papel higiĂŠnico (las 3P del inglĂŠs: Pee, Poo and -Toilet- Paper). - Actualmente, todas las toallitas y productos de higiene personal deben estar claramente etiquetados como 'No tirar al inodoro' y ser desechados en la papelera o basura. - Las toallitas y productos etiquetados como 'Aptos para tirar por el inodoro' basados en una guĂ­a de recomendaciones de las asociaciones de fabricantes deben ser etiquetados como 'No tirar por el inodoro' hasta que se acuerde un estĂĄndar tĂŠcnico con el sector del agua. - Los fabricantes de toallitas y pro-

nÂş 21 - Septiembre-Octubre 2016

03/11/16 15:47


AEAS informa

ductos de higiene personal deberían proporcionar a los consumidores información clara y concisa sobre los métodos de desecho. - Mirando al futuro, las nuevas innovaciones en materiales podrán hacer posible que algunos productos sean etiquetados como 'Aptos para tirar por el inodoro' una vez cumplan un estándar técnico que haya sido desarrollado y acordado con el sector del agua. Este estándar debería elaborarse preferiblemente en el marco de la Organización Internacional de Estandarización (ISO, por sus siglas en inglés). - Los requerimientos clave para cualquier futuro estándar incluyen que el producto: a) se fragmente rápidamente; b) no flote; c) no contenga plásticos o productos de similar comportamiento y solo esté compuesto por materiales que se degraden fácilmente en una variedad de entornos naturales. AEAS continúa trabajando activamente tanto en la concienciación ciudadana como en la solución técnica de esta problemática. Actualmente, está participando en la elaboración de la norma internacional ISO que permita a los fabricantes verificar que sus productos son realmente desechables, es decir, aptos para tirar por el inodoro. Asimismo, desde hace años, la Comisión V de AEAS estudia los problemas que causan las toallitas húmedas en la red

de saneamiento cuando son arrojadas por el inodoro y ha realizado varias ponencias y publicaciones como el Manual de buenas prácticas urbanas en sistemas de saneamiento público. Históricamente el principal problema de contaminación aportada en los saneamientos públicos se deriva de los vertidos industriales. Pero cada vez con mayor frecuencia se encuentran más contaminantes ligados al consumo y prácticas asociadas al consumo doméstico y domiciliario. Muchos de estos contaminantes tienen poca capacidad para ser depurados en las EDAR convencionales. Así, toallitas húmedas, bastoncillos y otros textiles llegan hasta las depuradoras al tirarse al inodoro. Los productores los presentan como productos respetuosos con el medio ambiente, pero con el tiempo se van produciendo notables acumulaciones y tapones de gran tamaño que, en días de fuerte aumento de caudal, son arrastrados hasta las EDAR generando graves problemas en las depuradoras con sobrecostes técnicos y económicos asociados. El impacto negativo de este tipo de residuos sobre las infraestructuras de los servicios de agua urbana es una realidad en toda Europa. Arrojar las toallitas húmedas por el inodoro cuesta a los europeos entre 500 y 1.000 millones de euros al año, según datos de EurEau, la asociación continental que engloba a las empresas de abastecimiento y saneamiento. Es decir, las toallitas húmedas y otros textiles suponen cerca de un 18% del coste adicional para las EDAR de una ciudad de tamaño medio.

AEAS, GALARDONADA EN EL 75 ANIVERSARIO DE FERIA DE ZARAGOZA Feria de Zaragoza, en la celebración de su 75 aniversario, ha galardonado a AEAS "por su especial vinculación y estrecha colaboración a lo largo de muchos años" en el Salón Internacional del Agua y del Riego (Smagua). Junto con AEAS, también ha sido reconocida por su implicación en este certamen a la Confederación Hidrográfica del Ebro (CHE). La entrega de este galardón se ha producido durante el trascurso de una gala, celebrada en el palacio de Congresos de Zaragoza, en la que estuvieron presentes, entre otros, el presidente de Aragón, Manuel Lambán, el alcalde de Zaragoza, Pedro Santisteve, y el presidente de Feria de Zaragoza, Manuel Teruel. En total, se han entregado 14 galardones a aquellas instituciones y asociaciones que han destacado por su apoyo y colaboración en las citas feriales más emblemáticas celebradas, a lo largo de estos 75 años, en Feria Zaragoza.

www.tecnoaqua.es

aeas informa.indd 141

141

04/11/16 10:08


Iwater aporta negocio y proyección internacional al sector del agua Del 15 al 17 de noviembre tendrá lugar en Fira de Barcelona la primera edición de Iwater, un evento que reúne en una única plataforma negocio, conocimiento y networking para el ciclo integral del agua. El evento, a través de su oferta comercial y actividades, aborda desde la innovación, la tecnología y la sostenibilidad retos como la gestión eficiente de recursos e infraestructuras, la reutilización, el aumento de la demanda de agua en zonas de estrés hídrico o los nuevos modelos de colaboración públicoprivada. Asimismo, Iwater incorpora un estratégico componente internacional, alineado con los intereses de la industria, que contribuirá a la proyección exterior de las firmas españolas.

142

ta 21 iwater informa.indd 142

En su primera edición, Iwater cuenta con la presencia confirmada de 120 expositores de 10 países, entre ellos importantes operadoras, ingenierías, constructoras y entidades públicas, así como empresas con soluciones para la extracción, tratamiento, distribución, almacenaje, reciclaje, reutilización, riego, gestión y consumo de agua para uso agrícola, industrial o doméstico. Algunas de las firmas participantes son: Aigües de Barcelona- Agbar, Aqua Ambient Ibérica, Aqualia, AVK Válvulas, Azud, Bermax, Blupura, Canal de Isabel II, Canaletas, Chiemivall, Contazara, Copersa, Culligan, Danfoss, Ebara, Espa, Hanna Instruments, Grundfos, Hawle, ITC, Kamstrup, Krypton Chemical, Kurita, Likitech, Panatec, Oxidine Water Technology, Regaber, Remosa, Sofrel, Sorigué, SUEZ, Waterologies o Xylem. Además de España, exponen empresas de Dinamarca, Italia, Portugal, Austria, Alemania, Turquía, Francia, Brasil y Marruecos. El presidente del comité organizador de Iwater y vicepresidente ejecutivo de Suez a cargo de la actividad de agua en Europa, Ángel Simón, destaca las altas expectativas que ha generado el salón: "Será una cita crucial para el sector, en la que se presentarán novedades y conocimiento compartido con impacto directo en la gestión y en la capacidad de dar respuesta a los retos del agua.

nº 21 - Septiembre-Octubre 2016

03/11/16 15:54


iwaterinforma

Iwater es una cita crucial para el sector, en la que se presentarán novedades y conocimiento compartido con impacto directo en la gestión y en la capacidad de dar respuesta a los retos del agua También ayudará a la proyección exterior de las empresas españolas del sector, especialmente en el área mediterránea y también en Iberoamérica". En este sentido, Iwater se propone dinamizar especialmente el negocio y crecimiento de las empresas del ciclo integral del agua en el mercado nacional atrayendo a profesionales y actores de los principales sectores usuarios. Al mismo tiempo, Iwater ha identificado mercados prioritarios en el exterior para poner en valor la I+D+i, el know-how y la excelencia de las firmas españolas. Para ello, ha seleccionado e invitado directamente a un centenar de usuarios industriales y empresariales con proyectos concretos de inversión, consultores, operadores de agua y representantes institucionales y de organismos con responsabilidad en la gestión de recursos hídricos de 20 países. Está confirmada la asistencia de profesionales de alto nivel y delegaciones de Colombia, Francia, México, Argentina, Brasil, India, Israel, Italia, Marruecos, China y Dinamarca, entre otras. Organizado por Fira de Barcelona, Iwater ocupará el pabellón 1 del recinto de Gran Via y se celebrará simultáneamente con tres eventos de marcada internacionalidad con los que compartirá sinergias y visitantes venidos de todo el mundo: Smart City Expo World Congress dedicado a las ciudades inteligentes, la European Utility Week, centrada en energía y suministros y la Circular Economy European Summit sobre economía circular.

www.tecnoaqua.es

ta 21 iwater informa.indd 143

EL FUTURO DE LA GESTIÓN DEL AGUA En sus actividades, Iwater tratará las claves que marcarán la futura gestión del agua en áreas con elevado estrés hídrico. Destaca el Fórum Iwater, un espacio de conferencias y debate en el que participarán unos 80 expertos nacionales e internacionales, entre ellos el científico estadounidense y cofundador del Pacific Institute de Oakland (California), Peter Gleick, quien pronunciará la conferencia inaugural sobre una nueva manera de pensar el agua: Soft Path Water. En el Forum Iwater se hablará de la resiliencia del agua para hacer frente a los efectos del cambio climático como la desertificación, la sequía o las inundaciones; de gobernanza para estructurar modelos de gestión eficaces e integradores; y de financiación para encontrar alternativas de inversión que permitan renovar y modernizar las infraestructuras. También se reivindicará el valor real del agua y su impacto en la economía y el desarrollo de la sociedad. Otros especialistas internacionales que intervendrán son la anterior responsable de la Superintendencia de Servicios Sanitarios del Gobierno de Chile, Magaly Espinosa; el director de Medioambiente de la OCDE, Xavier Leflaive, el responsable de la Global Water Operators Partnerships Alliance (GWOPA) del programa UN Habitat de Naciones Unidas, Faraj El-Awar; el ingeniero civil Robert H. Hultquist, colaborador del Departamento de Salud del Estado de California para la reutilización del agua potable y el catedrático y exministro de agricultura, Jaime Lamo de Espinosa.

143

03/11/16 15:54


iwaterinforma

En el Fórum se alternarán las conferencias de expertos internacionales con mesas redondas con representantes de administraciones, entidades y empresas españolas que aportarán la visión local y los retos del sector del agua en nuestro país. En estos debates se tratarán cuestiones como el valor real del agua; la resiliencia urbana; el partenariado público-privado; la regulación; la financiación de infraestructuras; objetivos de sostenibilidad; retos y oportunidades y reutilización potable indirecta.

HUBS DE INNOVACIÓN Y TECNOLOGÍA El Inno Hub aglutinará proyectos de I+D+i y promoverá el contacto y la transferencia de conocimiento entre empresas, centros tecnológicos y universidades, dedicando una especial atención a la compra pública innovadora, la financiación de la I+D, y la formación dual. Incluirá también un encuentro entre emprendedores e inversores. Mientras en el TechHub presentarán soluciones punteras expuestas en el salón, además de ejemplos de buenas prácticas en eficiencia energética, riego, gestión del agua en smart cities, en edificios y zonas residenciales o en sectores industriales, y se darán a conocer los planes de inversión pública en agua de varios países. Además, para visualizar y reconocer los mejores productos, proyectos e innovaciones expuestos en el salón, el 16 de noviembre se entregarán los Premios Iwater, que también concederán un galardón especial a mejor iniciativa de RSC el ámbito del agua. En este sentido, un comité de asesores ha seleccionado las propuestas presentadas en los calls lanzados por el salón (40 proyectos, más de 30 innovaciones y cerca de 50 nuevos productos). Asimismo, Iwater compartirá con Smart City Expo World Congress, el Brokerage Event organizado por Accio a través del cual se llevarán a cabo reuniones bilaterales entre pymes, centros tecnológicos, universidades, entidades y representantes de ciudades de más de 40 países para establecer acuerdos de colaboración empre-

144

ta 21 iwater informa.indd 144

sarial o transferencia tecnológica. El pasado año en Smart City Expo World Congress, se registraron más de 850 reuniones a través de esta actividad. Como complemento, Iwater ofrece la posibilidad a los profesionales asistentes de visitar infraestructuras de referencia en la gestión del ciclo integral del agua como la estación depuradora de aguas residuales (EDAR) del Prat de Llobregat que incluye una estación de regeneración de agua (ERA) para la recarga de acuífero; el centro de control de la empresa municipal Barcelona Cicle del Agua, SA (BCASA), y el depósito de retención de aguas pluviales del parque Joan Miró de Barcelona; la desalinizadora de la conca del Llobregat, o la estación de tratamiento de agua potable (ETAP) de Abrera, entre otras. Así mismo, Iwater acogerá varios eventos invitados como la Jornada Smart Water & Smart Cities organizada por la Fundación We are Water que pondrá el foco en México y Centroamérica; la jornada de la European Water Partnership EWP sobre aspectos prácticos de la administración del agua; la jornada sobre el proyecto R3Water sobre los últimos avances tecnológicos para la regeneración de aguas, recuperación de productos de valor y uso eficiente de los recursos en el tratamiento de aguas residuales urbanas; y la conferencia del centro tecnológico CEIT-IK4 sobre soluciones ecoinnovadoras en el sector del agua. Finalmente la Asociación Española de Abastecimientos de Agua y Saneamientos (AEAS), Aqua España, y la Plataforma Tecnológica Española del Agua (PTEA) celebrarán reuniones y actos propios en el marco del salón. Iwater cuenta con el respaldo sectorial de las principales asociaciones profesionales del sector del agua en España y ha sumado también el decisivo apoyo de la International Water Association (IWA), entidad global con presencia en 130 países que promueve el conocimiento y la investigación para solucionar los problemas del agua desde la sostenibilidad. Esta organización reconoce a Iwater como el evento de referencia para el sector en España.

nº 21 - Septiembre-Octubre 2016

03/11/16 15:54


iwaterinforma

LA OPINIÓN DEL SECTOR Las principales asociaciones españolas del sector del agua apoyan la celebración de Iwater y se han sumado al comité organizador para diseñar conjuntamente un salón de referencia internacional para el mercado del sur de Europa. Hay grandes expectativas en torno al negocio, la internacionalidad, la innovación y la transferencia del conocimiento. Las grandes empresas de la industria del agua también se han sumado a la nueva cita ferial. Recogemos sus opiniones: Fernando Morcillo, presidente de la Asociación Española de Abastecimientos de Agua y Saneamiento (AEAS) “Iwater permitirá a los operadores mostrar sus últimos avances y contribuirá a aumentar su prestigio y visibilidad tanto a nivel nacional como internacional”. José Carbonell, presidente de la Asociación Española de Empresas Gestoras de los Servicios de Agua Urbana (AGA) “Esperamos que Iwater facilite la trasferencia de conocimiento de las últimas novedades y promueva el networking entre las principales empresas a nivel internacional”. Agustí Ferrer, gerente de la Asociación Española de Empresas de Tratamiento y Control de Aguas (Aqua España) “Con Iwater, España tendrá una feria del sector del agua acorde a los tiempos actuales, un verdadero foro y exposición de referencia internacional en la gestión integral del agua”. Antolín Aldonza, presidente de la Plataforma Tecnológica Española del Agua (PTEA) “Iwater va a permitir el encuentro entre la oferta y la demanda y la transmisión de conocimientos actualizados. Las tecnologías son importantes, pero también lo es la gobernanza que conforma el ambiente en el que se ha de desarrollar el negocio del agua”. Sergio Pepió, presidente de la Asociación Española de Empresas de Tecnología del Agua (Asagua) “Iwater debe aportar una visión global y práctica del mundo del agua y ha de ser un lugar abierto a compradores y vendedores donde se exhiban los sistemas más avanzados”. Andrés del Campo, presidente de la Federación Nacional de Comunidades de Regantes de España (Fenacore) “Iwater es una cita con un alto contenido y enfoque tecnológico e innovador, donde esperamos ver soluciones para optimizar la producción agraria, ahorrando agua y energía”. Ángel Ortega, presidente de la Asociación Ibérica de Tecnología Sin Zanja (IBSTT) “Solo mejorando la eficiencia podremos avanzar hacia un ciclo del agua sostenible. Esperamos que Iwater aporte visibilidad, networking y oportunidades de negocio a nuestras empresas y ayude a extender en nuestro país el uso de las tecnologías sin zanja”. Juan Ignacio Lema Devesa, presidente de la Asociación Española de Empresas de Ingeniería, Consultoría y Servicios Tecnológicos (Tecniberia) “La gestión de los recursos hídricos y la internacionalización figuran entre las principales áreas de trabajo del sector de la ingeniería, con lo que iWater supone un excelente foro de encuentro para nuestras empresas”. Rafael Prieto, director general del Canal Isabel II “El Internet de las cosas, las cada vez mayores exigencias legislativas en depuración, el vínculo energía-agua, el consumo eficiente o los avances en materia de agua están presentes ya en nuestra gestión y lo estarán en los próximos años. En el salón mostraremos a los visitantes lo que somos y cómo lo hacemos, nuestra empresa y los proyectos de innovación que desarrollamos. Esperamos que Iwater nos sirva como plataforma de intercambio de conocimiento”. Manuel Cermerón, director general de Suez Advanced Solutions España “Se dan las condiciones idóneas para que Iwater se convierta en el evento de referencia en el sur de Europa y, en todas aquellas geografías que estén sufriendo un nivel de estrés hídrico similar al nuestro. El salón aportará un espacio para la discusión de temas tan importantes como la resiliencia, la financiación y la gobernanza, con la visión de expertos de renombre internacional. Además, es una oportunidad inmejorable para compartir conocimiento y las últimas novedades en tecnología vinculadas a nuestra actividad, ya que el salón va a disponer de espacios dedicados a ello”. Ignasi Clariana, director de Expansión de Sorigué “Las principales tendencias que veremos pasan por la aplicación de tecnología avanzada para conseguir una mayor eficiencia en el uso del agua, la implementación de nuevos modelos de gestión y el desarrollo de soluciones que mejoren el rendimiento del ciclo del agua desde una perspectiva innovadora la vez que sostenible. Hablamos de reciclaje y reutilización del agua, sistemas de riego más eficientes, mejores sistemas de alcantarillado o recolectores de agua pluvial, etc. pero también de sistemas de comunicación e información. Todo ello alineado con una estrategia de reducción del consumo energético”.

www.tecnoaqua.es

ta 21 iwater informa.indd 145

145

03/11/16 15:54


Ferias y Congresos

Smagua 2017 se promociona a nivel internacional La promoción de Smagua, el Salón Internacional del Agua y el Riego cuya próxima edición se celebra los días 7,8 y 9 de marzo de 2017, se intensifica con el objetivo de estar presente en los principales foros sectoriales que se celebran en España y en los mercados marcados importantes, como es el caso de Iberoamérica. Así, dos de sus últimas acciones han sido una presentación en Madrid a las mayores empresas hídricas del país, y la participación activa en Expo Agua Perú con una delegación de Feria de Zaragoza encabezada por su director general, Rogelio Cuairán. El salón andino es un punto estratégico fundamental para los intereses de las compañías españolas que tienen en este lugar una de sus puertas a un mercado tan importante como es el del Cono Sur de América. Por este motivo, Smagua ha apostado por intensifcar su presencia en este país, dentro de una estrategia basada en focalizar áreas de especial interés, tanto en el plano expositivo como de captación de visitantes, que sirvan para aupar al salón español como referente ineludible del sector internacional.

146

feriasy congresos.indd 146

De este modo, Smagua ha contado con una destacada presencia y una participación muy activa dentro de la celebración de este salón, que representa uno de los salones más importantes en Latinoamérica. Así, el director general de Feria de Zaragoza, Rogelio Cuairán, tomó parte de la ceremonia de inauguración del certamen, donde se celebró la I Conferencia Latinoamericana del Agua: 'Presente y futuro de los servicios de saneamiento en el Perú'. Junto a Cuairán estaban el viceministro de Construcción y Saneamiento peruano, Gustavo Olivas, el embajador de España en el país andino, Ernesto de Zulueta Habsburgo-Lonena, el director de Expo Agua Perú, Carlos Silvestri, y el presidente de Zinnae-España, Isaac Navarro. En este foro, Rogelio Cuairán expuso las claves por las que Smagua es el “salón de referencia para el mercado nacional español” y apuntó que la presencia en Perú “se enmarca dentro de la necesidad de ahondar en nuevos mercados, abrir nuevas vías y acercar nuestros continentes”, puesto que, según expuso el director general de la institución ferial aragonesa es “importante unir nuestras manos, estrechar lazos y comenzar a tejer un camino común en que el nosotros –-Smagua- seamos su puerta de entrada a Europa y ustedes la nuestra a Iberoamérica”. “Todos los países tenemos un denominador común: la necesidad del agua”, dijo Rogelio Cuairán durante su intervención y añadió que “el agua y la tecnología son

nº 21 - Septiembre-Octubre 2016

03/11/16 15:57


cruciales para el desarrollo de cualquier sociedad”. Por ello, subrayó, “debemos de ser capaces de ofrecer soluciones a la cuestión hídrica, de manera que lideremos el desarrollo tecnológico en la gestión integral del agua”. Asismismo, Smagua también participó en la Jornada Técnica España-Perú, organizada por Zinnae, acerca del 'Intercambio de Experiencias: Industria 4.0 aplicada a la gestión del agua y Gobernanza en un contexto de cambio climático'. El director general de Feria de Zaragoza presentó, ante cientos de asistentes, el papel que juega el Salón Internacional del Agua y el Riego en el plano nacional e internacional, así como las cifras que, durante más de 40 años, han hecho que Smagua sea considerado como el único certamen capaz de ofrecer soluciones y permanecer a la vanguardia del mercado. El objetivo no es otro que el de llevar a cabo acciones que refuercen la posición de líder dentro del segmento hídrico y de soluciones de agua. En definitiva, Smagua trabaja para renovar su papel de escaparate para exponer las mejores innovaciones por las que apuesta el sector y que están dirigidas hacia la innovación, la eficiencia, la seguridad y la garantía medioambiental.

SMAGUA 2017: INNOVACIÓN Y TECNOLOGÍA AL SERVICIO DE LOS PROFESIONALES Smagua volverá al calendario ferial del 7 al 9 de marzo de 2017. Una cita que, sin duda, contribuye al desarrollo y la innovación del sector profesional del agua. En su estrategia, Smagua apuesta por aportar un valor añadido a las marcas presentes en la próxima edicón para lo que -desde la organización del salón- se trabaja por asentar el plano nacional y, de este modo, potenciar el mercado exterior, de manera que se obtenga una mayor rentabilidad y eficacia promocional. En este sentido, el certamen apuesta claramente por el exterior, con especial incidencia en acciones dirigidas a atraer profesionales de países de Iberoamérica y sin olvidar mercados como Europa y África. Otro de los objetivos de cara a la siguiente edición pasa por aportar un foro profesional útil, con propuestas y novedades que fomenten la evolución tecnológica que marca a este sector. Con un aval de más de 40 años al servicio del segmento hídrico, Smagua es, hoy por hoy, el mayor escaparate paras las tendencias y la presentación de aparatos, equipos, técnicas o sistemas innovadores vinculados al mundo del agua. Smagua www.smagua.es

www.tecnoaqua.es

feriasy congresos.indd 147

03/11/16 15:57


Ferias y Congresos

Valencia marca las tendencias sobre telelectura de contadores de agua Aguas de Valencia y la Asociación Española de Abastecimientos de Agua y Saneamiento (AEAS) han celebrado la jornada 'Nuevos retos en la gestión de contadores en los abastecimientos', en las instalaciones del Oceanogràfic, que han sido inauguradas por el consejero delegado del Grupo Aguas de Valencia, Dionisio García Comín, el presidente de AEAS, Fernando Morcillo, y por el concejal del ciclo integral del agua del Ayuntamiento de Valencia, Vicent Sarrià. El consejero delegado del Grupo Aguas de Valencia explicó que "la implantación de la telelectura en Valencia y otras partes de España, con más de 620.000 unidades operativas, se ha convertido en un referente nacional e internacional que habla perfectamente de la calidad de la gestión del conocimiento que estamos liderando". Asimismo, el directivo expuso relieve del proyecto llevado a cabo en Valencia que, recientemente, se ha confirmado como la ciudad europea de mayor tamaño con todo el parque de contadores inteligentes instalados. El objetivo de la presente jornada, que ha reunido a más de 320 especialistas de toda España, ha sido aportar diferentes experiencias técnicas de referencia en la gestión de los contadores de las ciudades del futuro, siendo Valencia el máximo exponente en la materia por ser la ciudad europea de mayor tamaño con todo su parque de contadores inteligentes operativo en red fija: más de 420.000 unidades. Esta jornada, apoyada por algunas de los principales operadores tecnológicos (Vodafone, Orange y Cellnex-Adesal Telecom), ha contado con la presencia de diversas empresas de los sectores del agua y las comunicaciones así como con expertos de la Universidad Politécnica y del Centro Español de Metrología.

NOVEDADES EN TELECOMUNICACIONES Un parte importante de la jornada han sido las novedades presentadas por las compañías de telecomunicaciones que desde hace años están trabajando en la telelectura de contadores. Así, David Lozano, de Vodafone, explicó que "nuestra apuesta por el estándar de NB-loT, que mejora aspectos de la tecnología actual en cuanto a consumo de batería, coste de los dispositivos, cobertura y localización, nos posiciona como pioneros en el desarrollo de contadores de agua conectados independientemente de su ubicación. La tecnología NB-loT es un hito tecnológico relevante en el camino hacia un mundo

148

feriasy congresos.indd 148

donde la mayoría de dispositivos podrán ser conectados a una red móvil y abre la puerta a un mundo de internet de las cosas realmente mejor conectado". Por su parte, Miguel Ángel Victoria, manager de Big Data y Nuevos Negocios de Orange España, comentó que "en el mercado de IoT, Orange ha proporcionado siempre a sus clientes soluciones viables extremo a extremo, y ahora con la llegada de las redes LPWA (de bajo coste, bajo consumo y con amplio rango de cobertado) mantenemos nuestro compromiso. Nuestra propuesta tendrá presente a los fabricantes de equipos de telelectura y a los proveedores de productos y servicios asociados". Finalmente, Pablo Oliete, responsable de negocio centro de Cellnex-Adesal Telecom, explicó el avance de los distintos proyectos en metering de agua que están realizando en España con tecnología Sigfox y mostró su satisfacción por los resultados del piloto que están realizando Aguas de Valencia en dicha ciudad. Durante toda la jornada se han organizado diversas ponencias y mesas de debate centradas en el análisis de la innovación vinculada a las comunicaciones, al control metrológico así como a la nueva normativa que afecta a este servicio en España.

DESARROLLO TECNOLÓGICO DE ÁMBITO INTERNACIONAL El éxito internacional de Valencia en cuanto a la gestión de contadores inteligentes se inició hace más de 5 años cuando el Grupo Aguas y el Ayuntamiento de la ciudad plantearon con la telelectura un cambio de modelo en la gestión del abastecimiento, contribuyendo a la modernización de los servicios de agua urbanos, entre lo que destaca la mejora de las aportaciones en el control de consumos y en las tecnologías de recogida de la información. Hoy en día, esta empresa es el gestor del mayor parque de contadores inteligentes de España, con más

nº 21 - Septiembre-Octubre 2016

04/11/16 10:13


Ferias y Congresos

de 620.000 unidades operativas. Desde un único Centro de Operaciones se gestiona la información generada por el parque de contadores en red fija de poblaciones tan dispares y alejadas como Valencia, Tortosa, Gandía, Sagunto, Quart de Poblet, Granja de Rocamora, Albalat dels Sorells, Chiva o Calpe, entre otras.

SERVICIO QUE MEJORA LA CALIDAD DE VIDA DEL CIUDADANO Disponer de información permanentemente de los consumos aporta a la empresa pero sobre todo al cliente numerosas ventajas, entre las que cabe destacar las siguientes: - Alertar a los clientes de las anomalías en su pauta de consumo que puedan ser debidas a fugas de gran o de pequeña magnitud en su instalación interior. Como resultado de estas actuaciones, el pasado año el Grupo Aguas ahorró más de 300.000 m3 anuales, equivalente a más de dos días de consumo para una ciudad como Valencia con 786.189 habitantes, además de contribuir a la reducción de más de 80 toneladas de CO2 al año, causantes del cambio climático. - Eliminar la facturación de consumos estimados por razón de ausencia de lectura, ya que se es capaz de captar la lectura del contador sin necesidad de llegar hasta él. - Poner a disposición del cliente la información periódica de sus consumos a través de la oficina virtual y de la app para móvil. Estos consumos los puede comparar con patrones tipo, promoviéndose así la concienciación social y medioambiental acerca de la importancia del consumo racional y sostenible de un bien cada vez más escaso como es el agua potable. - Anticipación en la detección de fugas en la red de abastecimiento. La forma en que la telelectura contribuye de forma fehaciente al desarrollo sostenible es a través de la mejora del rendimiento de la red que se consigue cuando la información generada por la telelectura es usada para optimizar la gestión de la red de distribución. El elemento innovador de la plataforma desarrollada por el Grupo Aguas de Valencia ha consistido en la integración software de diversas tecnologías del mercado. Con ella, se independiza la solución tecnológica de te-

lelectura de los sistemas transaccionales receptores de la información y los protege de los cambios de protocolos y evoluciones que realicen los desarrolladores de estas tecnologías. Al mismo tiempo, la solución permite la adaptación de nuevas versiones de las tecnologías en red fija ya integradas y la incorporación de otras futuras que sean las más óptimas en cada momento, de forma inmediata. Esta plataforma también permite la monitorización y la gestión centralizada de todas las soluciones de red fija integradas en la misma, posibilitando la actualización a distancia de los parámetros necesarios para el control y correcto funcionamiento de todos los componentes del sistema. En definitiva, es una plataforma independiente que permite la conexión con cualquier sistema de gestión de clientes. Aguas de Valencia - AEAS www.aguasdevalencia.es - www.aeas.es

www.tecnoaqua.es

feriasy congresos.indd 149

04/11/16 10:13


Agenda iwater. Salón internacional del ciclo integral del agua 15-17 noviembre 2016 Barcelona INFORMACIÓN Fira de Barcelona Av. Reina Mª Cristina, s/n - 08004 Barcelona Tel.: 902 233 200 E-mail: iwater@firabarcelona.com www.iwaterbarcelona.com

Jornada R3Water Workshop: Innovations for water reuse, valuables recovery and resource efficiency 16-17 noviembre 2016 Barcelona INFORMACIÓN R3Water Workshop - Teqma http://r3water.eu/

Seminario: State of the Art: Innovative Wastewater Tratment and Resource Recovery Technologies 18 noviembre 2016 Barcelona INFORMACIÓN COST Water 2020 www.water2020.eu

II Jornada Macrofloc: Macroscopía del fango activo y microscopía del flóculo en EDAR 22 noviembre 2016 Valencia INFORMACIÓN Aula Bioindicación Gonzalo Cuesta Universidad Politécnica de Valencia Camino de Vera, s/n - 46022 Valencia Tel.: 963 879 820 E-mail: anzorzor@upv.es http://aulabioindicacion.com/macrofloc/

Foro de la Economía del Agua 24 noviembre 2016 Madrid INFORMACIÓN http://forodelaeconomiadelagua.org/

Conama 2016: Congreso Nacional del Medio Ambiente 28 noviembre1 diciembre 2016 Madrid INFORMACIÓN Fundación Conama

150

agenda.indd 150

Monte Esquinza 28, 3º derecha 28010 Madrid Tel.: 913 107 350 E-mail: conama@conama.org www.conama.org

Curso Huella de agua: Evaluación y comunicación de acuerdo con la norma internacional ISO 14046:2015 29 noviembre-30 noviembre 2016 Madrid INFORMACIÓN Sust4in Tel.: 915 309 903 www.sust4in.com/curso-de-formacion-huella-deagua-xii-edicion.html

Pollutec 2016: Salón del Medio Ambiente 29 noviembre-2 diciembre 2016 Lyon (Francia) INFORMACIÓN Reed Expositions France 52-54 quai de Dion-Bouton CS 80001 - 92806 Puteaux Cedex (Francia) Tel.: +33 (0) 1475621 16 www.pollutec.com

Curso práctico de modelado y simulación en EDAR 1-2 diciembre 2016 Valencia INFORMACIÓN Aula Bioindicación Gonzalo Cuesta Universidad Politécnica de Valencia Camino de Vera, s/n 46022 Valencia Tel.: 963 879 820 E-mail: anzorzor@upv.es http://aulabioindicacion.com

SIGA, Feria de Soluciones Innovadoras para la Gestión del Agua 28 febrero-3 marzo 2017 Madrid INFORMACIÓN Feria de Madrid Tel.: 917 225 233 E-mail: siga@ifema.es www.ifema.es/siga_01

HydroSenSoft 2017, Simposio Internacional de Sensores y Software Hidro-Ambiental 28 febrero-3 marzo 2017 Madrid INFORMACIÓN AHR- Feria de Madrid Tel.: 917 225 233 E-mail: office@iahr.org hydrosensoft@ifema.es www.ifema.es/siga_01/Hydrosensoft/index.htm

Climatización 2017 28 febrero-3 marzo 2017 Madrid INFORMACIÓN Feria de Madrid Tel.: 902 221 515 E-mail: climatizacion@ifema.es www.climatizacion.ifema.es

Genera 2017 28 febrero-3 marzo 2017 Madrid INFORMACIÓN Feria de Madrid Tel.: 902 221 515 E-mail: genera@ifema.es www.genera.ifema.es

Posgrado en redes de aguas marzo 2017 On line INFORMACIÓN Escuela del Agua Tel.: 932 479 735 E-mail: info@aqualogycampus.net www.laescueladelagua.com

Posgrado en abastecimiento de agua potable marzo 2017 On line INFORMACIÓN Escuela del Agua Tel.: 932 479 735 E-mail: info@aqualogycampus.net www.laescueladelagua.com

Smagua 2017: 23º Salón Internacional del Agua y del Riego 7-9 marzo 2017 Zaragoza INFORMACIÓN Feria de Zaragoza Autovía A-2. Km. 311 - 50012 Zaragoza Tel.: 976 764 765 E-mail: smagua@feriazaragoza.es www.smagua.es

3rd International Conference on Desalination using membrane technology 2-5 abril 2017 Las Palmas, Gran Canaria INFORMACIÓN Elsevier www.desalinationusingmembrane.com

XXXIV Jornadas Técnicas AEAS 24-26 mayo 2017 Tarragona INFORMACIÓN AEAS Sor Ángela de la Cruz nº 2, 13 D - 28020 Madrid Tel.: 914 490 910 - Fax 915 713 523 E-mail: aeas@aeas.es www.aeas.es

nº 21 - Septiembre-Octubre 2016

03/11/16 16:03


servicios de comunicación profesional dina4_2015.indd 1

www.infoedita.es - info@infoedita.es

DPARQUITECTURA DETALLES Y PROYECTOS DE

www.dparquitectura.es

www.industriaquimica.es

www.infoconstruccion.es

www.infohoreca.com

www.infogeriatria.com

www.industriambiente.com

PHARMATECH Equipos, Procesos y Tecnología

www.metalindustria.com

www.pharmatech.es

www.retailactual.es

RETAILACTUAL

www.tecnoalimen.es

www.tecnoaqua.es

www.tecnoinstalacion.com

DISTRIBUCIÓN, ALIMENTACIÓN&CONSUMO

www.emailmedia.es

Ribera de Axpe 11, Edif. C-2; Ofic. 113 - 48950 Erandio, VIZCAYA Rufino González, 40; 3º dcha - 28037 MADRID

25/02/15 12:51


CiberAqua En esta sección se dan a conocer las páginas de Internet, aplicaciones, vídeos y todas aquellas direcciones, herramientas, noticias, concursos y demás informaciones relacionadas con las redes sociales. Es por ello que les animamos a que nos faciliten la información de todo aquellos que deseen presentar al siguiente correo electrónico: tecnoaqua@infoedita.net

PAM y la transformación digital Si hay una realidad empresarial irrefutable en la actualidad, esta es el profundo cambio que están experimentando los consumidores en sus hábitos de consumo debido al a gran cantidad de información y las nuevas posibilidades que ofrece la transformación tecnológica que está sufriendo la sociedad. El cambio ha llegado para quedarse y el proceso de reconversión de las empresas ya ha comenzado. No queda ninguna empresa hoy en día, del sector que sea, que escape a la necesidad de implementar una potente estrategia digital que retroalimente a todos sus departamentos y brinde a la compañía todos los beneficios potenciales del mundo digital. Como respuesta a ese cambio, y con la firme convicción de las ventajas que aportan los proyectos digitales, la compañía Saint-Gobain PAM presenta sus dos proyectos digitales principales: la app Herramientas de Cálculo; y su nueva y remodelada página web www.pamline.es. Totalmente gratuita, Saint-Gobain PAM ha reunido todas las necesidades de cálculo de sus clientes en una app rápida, útil e intuitiva, que pone a disposición del cliente la posibilidad de llevar a cabo los cálculos más solicitados que se presentan diariamente en las situaciones más comunes de las obras hidráulicas: macizos de anclaje; pérdidas de carga; alturas de cobertura; longitud de acerrojado; presiones admisibles; absorción de rejillas; y dimensionamiento reductor de presión. Una herramienta más que útil para los profesionales. Conscientes de la importancia de tener un espacio accesible con toda la información tanto corporativa como a nivel producto de la compañía, Saint-Gobain PAM ha desarrollado una nueva página web (www.pamline.es) que será, gracias a la cantidad de contenido técnico y comercial disponible, el epicentro de nuestra estrategia digital, poniendo al alcance del cliente cualquier información que necesite, en el momento que la necesite y de la manera más rápida y accesible.

152

ta 21 ciberaqua.indd 152

La nueva web es responsive, permitiendo así navegar no solo desde el PC sino desde cualquier dispositivo móvil. De este modo se puede acceder desde cualquier lugar a las herramientas de este fabricante como son la app de cálculo y el catálogo Presto, con un menú muy dinámico. Todos los documentos de trabajo, sala de prensa, newsletters y publicaciones están disponibles a través de la nueva página web y se descargan fácilmente, se imprimen y se pueden compartir a través de correo electrónico o redes sociales. Saint-Gobain PAM tiene la innovación por bandera y, la digitalización no es una excepción: "Aprovechamos todas las ventajas que nos ofrece la transformación tecnológica para que nuestros clientes tengan los mejores medios digitales del sector disponibles para sus proyectos", afirman desde la compañía.

nº 21 - Septiembre-Octubre 2016

03/11/16 16:05


CiberAqua

DAM estrena nueva web La empresa Depuración de Aguas del Mediterráneo (DAM) ha estrenado en septiembre una nueva página web con una mejor navegación y más accesible a las áreas de actividad de la compañía: www.dam-aguas. es. La nueva web se muestra con un diseño más limpio y sencillo, que facilita la navegación y la localización de las áreas de actuación. Así, sin necesidad de ningún click ni de pasar de pantalla, se puede acceder a la información sobre las áreas de trabajo de la empresa. De este modo, se puede llegar a operaciones y mantenimiento, construcción, gestión y valorización de residuos e innovación. Dada la actividad que desarrolla la empresa también hay un parte dedicada a las noticias de la compañía y su participación en diferentes foros. Cabe destacar que DAM es una empresa muy activa en proyectos internacionales. La nueva web recoge tanto los resultados de dichos proyectos, como las reuniones previas y encuentros con los investigadores de otros departamentos para ir conociendo la evolución de dichos proyectos. Otra parte importante de la web es la que se dedica a los trabajos y actuaciones destacadas. Con imágenes de esta actividades y una descripción detallada de la actividad, la nueva web es el escaparate que muestra al exterior toda la actividad de DAM.

Para los responsables de la empresa este cambio era necesario, ya que la anterior página web había quedado un poco obsoleta: "Necesitábamos darle una nueva imagen de acuerdo con la actividad dinámica que tiene la empresa. Con esta web comunicamos y transmitimos mucho mejor lo que es DAM: una empresa innovadora y puntera en la gestión de aguas y residuos; transparente y con actividad permanentes. Esperamos que, quien acceda a ella, reciba estos mensajes".

www.tecnoaqua.es

ta 21 ciberaqua.indd 153

NUEVA WEB DEL SERVICIO MUNICIPAL DE AGUAS DE PRIEGO

La empresa Aguas de Priego ha puesto en marcha la página web www.aguasdepriego.com con el objetivo de acercar más el Servicio Municipal de Aguas a los vecinos de esta localidad. De esta manera, Aguas de Priego, que gestiona el servicio de aguas en el municipio de Priego de Córdoba, colabora al objetivo de transparencia que se tiene implantado como premisa general por parte de los servicios municipales. La web permite conocer de primera mano todo el recorrido del agua que los prieguenses obtienen en su grifo a lo largo de todo su ciclo integral: de dónde proviene, la zona de abastecimiento a la que pertenece, o cómo se limpia en la depuradora antes de devolverla al medio ambiente, son algunas de las cuestiones que esta página revela. Además, facilita información de gran utilidad al ciudadano, como las tarifas vigentes, requisitos para realizar las distintas gestiones, horarios de oficina o teléfonos de contacto, entre otros muchos aspectos. La sección de Transparencia, de obligada existencia al ser aguas de priego una empresa mayoritariamente pública (51% titularidad del ayuntamiento), ocupa también un lugar destacado en la web. Es una apuesta del Ayuntamiento por una gestión abierta y transparente. El espacio web dispone, además, de un acceso directo a la Zona Infantil de Aqualia, una sección especialmente dedicada a los más jóvenes, donde pueden aprender a la vez que divertirse tomando conciencia de la necesidad del cuidado y consumo responsable del agua. Con la creación de esta web, ayuntamiento y empresa quieren acercar la gestión del Servicio Municipal de Aguas al ciudadano, ofreciéndole un medio moderno y directo que poder consultar desde cualquier punto y a cualquier hora.

153

03/11/16 16:05


Libros y Catálogos HISTORIA DEL ABASTECIMIENTO MODERNO DE AGUA A SEVILLA El alcalde de Sevilla y presidente de la Empresa Metropolitana de Abastecimiento y Saneamiento de Aguas de Sevilla (Emasesa), Juan Espadas, ha presentado en el Ayuntamiento de Sevilla el libro Historia del abastecimiento moderno de aguas a Sevilla – La presencia inglesa en el siglo XIX (1882-1900), de Pedro José Sánchez Gómez investigador, escritor y empleado de Emasesa. En el libro, publicado por la entidad de aguas hispalense, se recoge la fundación de Sevilla Water Works, primera empresa de aguas de la ciudad. El libro es una narración de los orígenes e historia de la implantación de un servicio moderno de abastecimiento de agua potable en la ciudad y, en consecuencia, de la transformación del modo de vida y las costumbres de los sevillanos con la llegada de las nuevas infraestructuras. Con esta publicación, Emasesa recupera su historia y hace un esfuerzo de difusión de la misma dentro de su proyecto de acercar la gestión del agua a la ciudadanía. Pedro José Sánchez Gómez es investigador, escritor y empleado de Emasesa desde 1974. Es autor de otros trabajos de documentación histórica sobre el compositor Manuel Castillo o sobre el escritor y ateneísta José María Izquierdo. Emasesa www.emasesa.com

CATÁLOGO MULTIFORMATO DE TUBERÍAS MOLECOR Molecor pone a disposición del mercado la actualización de la herramienta Catálogo multiformato yuberías TOM, especialmente concebido para facilitar la labor del sector profesional. Este catálogo es una herramienta práctica e indispensable de gran valor añadido para técnicos prescriptores, que permite conocer todos los productos y servicios que la marca TOM ofrece. Este año destacan especialmente las novedades de gama, así como la documentación técnica necesaria para el desarrollo de los proyectos. Incluyendo las unidades de obra con precios descompuestos, paramétricos y memoria de producto, adaptados a los diferentes requerimientos. Haciéndolo compatible con la práctica totalidad de los programas de mediciones y presupuestos disponibles en el mercado, el portfolio de productos de Molecor llega a cualquier profesional, estudios e ingenierías encargados de realizar un proyecto, con la certeza de que el intercambio de información será factible, facilitando así a los profesionales la creación de los presupuestos de obra. Los presupuestos y las obras, los cuadros de precios y los catálogos realizados con BC3 comparten el mismo formato, por lo que se puede trasladar información en todas direcciones. La información se traspasa íntegramente, con sus textos, precios, gráficos y archivos asociados. De esta manera, se consigue que cada presupuesto sea autónomo y no se vea afectado por ningún cambio ajeno al mismo, ofreciendo así el trabajo en equipo, la realización de ofertas o la anotación de certificaciones. Los formatos BC3 establecen un protocolo que permite al usuario final intercambiar cómoda y libremente información entre diferentes programas de presupuestos y bases de datos (ya sea BC3, PRESTO, PDF, eBOOK, Excel, Word, HTML, TXT...) de la construcción, todo ello sin necesidad de introducir los datos manualmente. Visible en ordenadores, tabletas y teléfonos inteligentes (Mac, Windows, IOS, Android). El acceso al catálogo puede realizarse a través del siguiente enlace: http://molecor.com/es/catalogo-multiformato-tuberias-tomo. Molecor www.molecor.com

154

ta 21 libros.indd 154

nº 21 - Septiembre-Octubre 2016

03/11/16 16:05


Suscríbase a la publicación más innovadora del sector 1 Año*

2 Años*

www.infoedita.es

*: IVA no incluido

Ejemplares/año

DPARQUITECTURA

40 €

75 €

4

PHARMATECH

70 €

120 €

6 + Especial

80 €

130 €

11

45 €

75 €

6

50 €

90 €

4

40 €

70 €

4

60 €

95 €

8

80 €

140 €

6 + Directorio

45 €

75 €

6

60 €

95 €

6

40 €

75 €

4

40 €

75 €

4

DETALLES Y PROYECTOS DE

Equipos, Procesos y Tecnología

RETAILACTUAL DISTRIBUCIÓN, ALIMENTACIÓN&CONSUMO

Tambien puede suscribirse en www.infoedita.es, suscripciones@infoedita.es o en el Teléfono 911 255 700 Deseo suscribirme a la publicación/es indicadas en la parte superior. Enviar este boletin a: suscripciones@infoedita.es Infoedita, Comunicación Profesional – Ribera de Axpe, 11; Edificio C2, Of. 113 – 48950 Erandio (Vizcaya) Nombre ................................................................................................................................................................................................... Empresa ................................................................................................................................................................................................. NIF/CIF ............................................................... Actividad .................................................................................................................... Dirección ................................................................................................................................................................................................ Población .......................................................................................................................................................... C. Postal ...................... Provincia ................................................................................................................................................................................................. Teléfono 1 ..................................................... Teléfono 2 ..................................................... Fax ............................................................ e-mail............................................................................................... Web .............................................................................................. Formas de pago: U Transferencia bancaria BANCO SANTANDER: IBAN ES12 0049 4668 15 2716024629

U Domiciliación Bancaria

U Cheque nominativo a INFOEDITA COMUNICACIÓN PROFESIONAL, S.L.

U Tarjeta de Crédito

IBAN _ _ _ _

_ _ _ _

_ _ _ _

_ _ _ _

_ _

_ _ _ _ _ _ _ _ _ _ Válida hasta:

_ _ _ _

_ _ _ _

Fecha ….......….......................…/…….........…/201…...

_ _ /_ _ Firma y sello

Sus datos serán registrados en un fichero de Infoedita, S.L., Rivera de Axpe 11, Edificio C-2 48950 Erandio (Vizcaya). Podrá recibir publicidad de otros servicios del grupo y/o de terceras empresas que puedan ser de su interés profesional, a través de correo, fax y/o correo electrónico. Podrá ejercitar su derecho de acceso, rectificación cancelación y oposición dirigiéndose por escrito a Infoedita, S.L., en la dirección arriba indicada. La aceptación de este formulario implica su consentimiento para que Infoedita, S.L. adeude en su cuenta el importe correspondiente a la prestación de los servicios contratados.

suscripcion.indd 1

20/05/16 10:43


Directorio

Directorio 2016 Este ÍNDICE DE COMPRAS amplía la información facilitada por los fabricantes, representantes, centrales de ventas, distribuidores, ingenierías, etc., del sector del AGUA, ofreciendo al lector una permanente “tarjeta de visita” en cada revista, que facilitará en su momento la búsqueda de la empresa.

156

directorio.indd 156

nº 21 - Septiembre-octubre 2016

02/11/16 10:16


Directorio

Soluciones al manejo de ๏ฌ uidos Bombas centrifugas plasticas Bombas neumรกticas de membrana Filtros prensa Bombas de tornillo helicoidal Bombas sumergibles Bombas peristรกlticas Bombas centrifugas autoaspirantes Filtro Bombas dosi๏ฌ cadoras automรกtico autolimpiable Agitadores Bombas de lรณbulos engomados Vรกlvulas neumรกticas de manguito AKO Filtros automรกticos autolimpiables

www.cramix.com

s &ABRICACIร N DE AGITADORES Y FLOCULADORES s !GITADORES CON CLASIFICACIร N !4%8 s 3OLUCIONES A LOS PROBLEMAS DE AGITACIร N EN GENERAL # 4INEO s -ADRID s 4EL WWW FLUIDMIX ES s SALES FLUIDMIX ES

Bombas centrรญfugas sumergibles y de super๏ฌ cie en acero inoxidable r $VFSQPT IJESร VMJDPT TVNFSHJCMFT u Z u r &MFDUSPCPNCBT TVNFSHJCMFT NPOPCMPD u r #PNCBT DFOUSร GVHBT WFSUJDBMFT NVMUJFUBQB r #PNCBT DFOUSร GVHBT IPSJ[POUBMFT NVMUJFUBQB

-JLJUFDI 4 - 6 $ 4FSSBU EF MB $SFV # 1 * "WFMMBOFU m 4BOU .JRVFM EF #BMFOZร m 4FWB 4QBJO

5FM m 'BY m MJLJUFDI!MJLJUFDI DPN m XXX MJLJUFDI DPN

www.tecnoaqua.es

directorio.indd 157

157

02/11/16 10:16


Directorio

158

directorio.indd 158

nยบ 21 - Septiembre-octubre 2016

02/11/16 10:16


Directorio

Directorios Una fรณrmula muy econรณmica de cumplir sus objetivos de comunicaciรณn para los profesionales del sector SI DESEA ANUNCIARSE EN EL DIRECTORIO LIDER DEL SECTOR LLAME AL TELร FONO

911 255 700 www.tecnoaqua.es

directorio.indd 159

159

02/11/16 10:16


ยถOEJDF EF "OVODJBOUFT Empresa

pรกgina

ABERING CONTADORES DE AGUA ..................................................................................................... 21 ACCIONA ........................................................................................................................................... CONTRAPORTADA ACSA - SORIGUร ................................................................................................................................ 111 AGITADORES AGITASER ..................................................................................................................... 147 BOMBAS CAPRARI ............................................................................................................................. 3 BRENNTAG......................................................................................................................................... 45 Bร RKERT CONTROMATIC .................................................................................................................. 13 CARLO GAVAZZI ................................................................................................................................ 15 CASTFLOW VALVES ............................................................................................................................ 149 CHEMIPOL ......................................................................................................................................... 85 CRAMIX ............................................................................................................................................. 35 DIEHL METERING ............................................................................................................................... 29 DIMASA ............................................................................................................................................. 81 FERALCO ............................................................................................................................................ 55 FESTO ................................................................................................................................................. 95 FORBEST EUROPE .............................................................................................................................. 125 GENEBRE ........................................................................................................................................... 89 GRUPO ร LAVA ................................................................................................................................... 33 HIDROCONTA..................................................................................................................................... INTERIOR PORTADA ISIFLO IBร RICA ................................................................................................................................... 63 ITALIFTERS IBร RICA ........................................................................................................................... 75 IWATER BARCELONA - FIRA DE BARCELONA .................................................................................... INT. CONTRAPORTADA LABAQUA ........................................................................................................................................... 25 LIKITECH ............................................................................................................................................ 37 LIKUID NANOTEK ............................................................................................................................... 43 MICROCOM ....................................................................................................................................... 5 MOLECOR .......................................................................................................................................... 39 MOTORRENS ...................................................................................................................................... 27 REMOSA - RECUBRIMIENTOS Y MOLDEADOS ................................................................................... 7 RENOLIT ............................................................................................................................................. 61 SAINT-GOBAIN PAM ESPAร A ............................................................................................................ PORTADA SEKO IBร RICA .................................................................................................................................... 11 SIGA 2017 - FERIA DE MADRID ......................................................................................................... 19 SMAGUA 2017 - FERIA DE ZARAGOZA .............................................................................................. 139 SOFREL ESPAร A................................................................................................................................. 103 SUEZ ADVANCED SOLUTIONS ESPAร A .............................................................................................. 2 Y 31 Tร CNICA DE FLUIDOS ........................................................................................................................ 9 TEDAGUA ........................................................................................................................................... 57 TIMSA ................................................................................................................................................ 23 WEG ................................................................................................................................................... 17 XYLEM WATER SOLUTIONS ESPAร A .................................................................................................. 1 Y 73 YARA IBERIAN.................................................................................................................................... 41

prรณximo nรบmero

TECNOAQUA noviembre-diciembre 2016

t 5ร DOJDBT EF NFNCSBOB QBSB USBUBNJFOUPT UFSDJBSJPT .#3 ร TNPTJT JOWFSTB NJDSPm MUSBDJร O VMUSBm MUSBDJร O BOPm MUSBDJร O &%3

t %FTBMBDJร O Z EFTBMJOJ[BDJร O t "HVBT SFHFOFSBEBT BQSPWFDIBNJFOUP Z SFVUJMJ[BDJร O 160

indice anunciantes.indd 160

nยบ 21 - Septiembre-Octubre 2016

03/11/16 16:06


iwater.indd 1

31/10/16 15:33


acciona.indd 1

31/10/16 15:32