Page 1

International Journal of Scientific & Technology Research Volume 1, Issue 4, May 2012

ISSN 2277-8616

Molecular Marker Screening for Ty-2 Gene in Two Tomato Genotypes (Solanum lycopersicon L.) Mohamed, S. M., Palchamy, K. ABSTRACT: Tomato yellow leaf curl virus (TYLCV) is a major tomato virus in tropical and subtropical regions. The resistance to TYLCV disease in the tomato accession FLA456 and the breeding line CLN2498E was analysed by screening the parents, F1 and BC1F1 population using a sequence tagged site (STS) marker, linked to Ty-2 gene, T0302, at the Biotechnology and Molecular Breeding Unit of the Asian Vegetable Research and Development Centre (AVRDC), the World Vegetable Centre at Taiwan. Results showed that CLN2498E carried Ty-2 gene and FLA456 did not carry it. The BC1F1 plants segregated for Ty-2 gene in a ratio of 46:66 which is closed to 1:1 ( χ²=3.33, P< 0.05), which indicated that Ty-2 gene was simply inherited. The phenotypic screening showed that the breeding line CLN2498E was susceptible to TYLCV-Thailand strain although it carried the Ty-2 locus. The accession FLA456 was tolerant to TYLCV-Thailand strain. Although the F1 plants carried the Ty-2 locus, with heterozygous alleles, they showed tolerance to TYLCV-Thailand strain disease. All the plants in the BC1F1 bearing the two bands 900 bp and 800 bp were tolerant to the disease, while others with only 900 bp were susceptible. The results concluded that CLN 2498E carries Ty-2 gene and does not resistant to TYLCV-Thailand strain whereas FLA 456 does not carry Ty-2 gene and resistant to TYLCV-Thailand strain. Key words: Tomato, TYLCV, molecular screening, phenotypic screening, Ty-2 gene, FLA 456, CLN 2498E

————————————————————

1.INTRODUCTION Begomoviruses are major threat to tomato production in most tropical and subtropical regions (Anderson and Morales, 2005). Since 1980s molecular markers are being widely used as a major tool for breeding of tomato (Barone, 2008). More than 40 genes (including many single genes and quantitative trait loci, QTL) that confer resistance to all major classes of pathogens have been mapped on the tomato molecular map (Grube et al., 2000). Moreover, other resistance genes were added later to the map (Bai et al., 2003). Zamir et al. (1994) were the first to report the mapping of a begomovirus resistance gene using lines derived from S. chilense accession LA 1969 and they revealed that a major incompletely dominant gene (Ty-1) on chromosome 6 accounted mostly for the resistance. A partially dominant gene, that is now known as Ty-3 (Ji and Scott, 2006b) was mapped to the marker interval between cLEG-31-P16 (20cM) and T1079 (27cM) on the long arm of chromosome 6. The H24 resistance factor, named Ty-2 was reported to be associated with an introgression from TG36 (84 cM) to TG26 (92 cM) (Hanson et al., 2006). This polymorphic marker was chosen to screen the segregating populations that were screened at AVRDC with a biological assay for resistance to TYLCV (Ji et al., 2007). _________________ Mohamed, S. M.1 and Palchamy, K. 2 1 Faculty of Agriculture, Nile Valley University, Sudan 2 Asian Vegetable Research and Development Centre (AVRDC), the World Vegetable Centre, Taiwan.

The mapping analysis showed that the markers TG105A and T0302 are tightly linked to each other and Ty-2 is approximately 10 cM away from these markers. The study aimed at molecular screening for Ty-2 gene in FLA 456 and CLN 2498E using a sequence tagged site (STS) marker linked to Ty-2 gene, T0302 (Appendix 1) and analyzing the genetic of resistance to TYLCV-Thailand in the two genotypes.

2 MATERIALS AND METHODS The experiment was conducted at Biotechnology and Molecular Breeding Unit of the Asian Vegetable Research and Development Centre (AVRDC), the World Vegetable Centre at Taiwan. The tomato accession FLA456 was crossed with the breeding line CLN2498E. The F1 plants were back crossed to CLN2498E to obtain the BC1F1 population. Then the parents, F1 and BC1F1 plants were grown on September, 2009 in a greenhouse for exposing to viruliferous whiteflies carrying the TYLCV-Thailand virus for one month before transplanting to another greenhouse. A sequence tagged site (STS) marker linked to Ty-2 gene, T0302 was used to screen the parents, F1 and BC1F1 populations to identify plants with or without Ty-2 gene which is a factor responsible for resistance to TYLCV (Hanson, 2006). Two young leaves of each plant at seedling stage were collected and kept in a separate well of the 96-well plate. The samples were collected randomly from five plants on each of the four tested generations (two parents, F1 and BC1F1). The plates were placed in FreezeDryer, which was pre-cooled until -50˚C, for 24 hours. Then the plates were placed in a Minibeadbeater and after grinding for few seconds the samples looked like very fine powder. Three buffer stock solutions, which were used in DNA extraction included solution 1, solution 2 and solution 3 were already prepared in the AVRDC biotechnology laboratory. DNA isolation was done according to the procedure given by Tanksley (1995). The polymerase chain reaction (PCR) procedure was carried out following the 45

IJSTR©2012 www.ijstr.org


International Journal of Scientific & Technology Research Volume 1, Issue 4, May 2012 standard protocol described by (Kadirvel, AVRDC, Personal communication, 2009) to identify the STS markers linked to Ty-2 locus in the four tested generations. The preparation of the cocktail mixture was done as follow: 1056 µl ddH2O, 160 µl 10xbuffer, 128 µl dNTP, 80 µl primer and 16 µl hot start 4 x Taq enzyme were added, respectively in an 0.5 ml tube. Then 1.0 µl of the DNA template was added to each well in the two 96-well plates followed by 9.0 µl of the cocktail mixture and the plates were spin at 2000 rpm for one minute. After that the plates were placed in the PCR engine, the PCR reaction (35 cycles) was run. 1.5% Agrose gels was used to assess Ty-2 gene marker. 2 µl of 1x blue dye was added to each well already loaded with DNA template in the 96-well plates. Then 2 µl of each sample was loaded in addition to the marker to the agrose gel which was run at 160 V for 80 minutes. After that the gel was removed from the casting tray to a deep tray containing 1 µl of 10 mg/ml Ethidium Bromide solution in 150 ml of 1 x TBE and stained for 10 minutes and the gel was rinsed briefly with water. The gel was visualized under UV and a photograph was saved in the computer. Phenotypic screening was done after 60 days from germination. The disease rating scale was scored on a 1-3 scale as described by Kasrawi (1989) as follows:

ISSN 2277-8616

tolerant to the disease, while others with only 900 bp were susceptible. When T0302 primer was tested with germplasm with the Ty-2 locus from the Asian Vegetable Research and Development Centre (AVRDC), CLN2460E gave the 900 bp fragment (P. Hanson, pers. com.) which confirm that CLN2498E carries Ty-2 gene. T0302F/T0302R primer effectively detected the two genotypes, ty2/ty2 and Ty2/Ty2 (hanson,2006). This primer pair produced two bands (800 and 900 bp) for the F1 plants, and this confirm the previous results by Jensen et al. (2008). The phenotypic screening results suggested that other genes conferring tolerance to TYLCV-Thailand are possible, so screening of FLA456 accession using other markers might identify the type of this gene.

1 = no observed symptom (resistant). 2 = mild symptoms which are not affecting or slightly affecting the plant growth habit (tolerant). 3 = severe symptoms include leaf size reduction, leaf curling, between veins yellowing and plant stunting (susceptible).

3 RESULTS AND DISCUSSION PCR product of FLA 456 amplified a 800 bp fragment. CLN2498E amplified a 900 bp fragment, which is expected of TYLCV resistant genotype linked to the Ty-2 locus with the primer T0302 (Fig 1). The F1 plants amplified 900 bp and 800 bp fragments. This indicated that the F1 plants carried Ty-2 locus with heterozygous alleles i.e Ty-2/ty-2. The BC1F1 plants segregated for Ty-2 locus. Out of 112 plants, 46 plants amplified 900 bp fragments and 66 plants amplified 900 bp and 800 bp fragments (segregated in a ratio of 46:66 which is closed to 1:1 ( χ²=3.33, P< 0.05), while no plants amplified 800 bp fragment (Fig. 1). These results indicated that the bands of 900 bp were simply inherited. In the phenotypic screening for TYLCV-Thailand resistance all the CLN2498E plants showed very severe symptoms whereas all FLA456 plants showed very mild symptoms. The F1 plants showed very mild symptoms. The BC1F1 plants segregated for their reaction to TYLCVThailand, 64 out of 120 plants showed very severe symptoms whereas 56 plants showed very mild symptoms i.e. they segregated in a ratio of 64:56(χ²=0.5). Results showed that the breeding line CLN2498E was susceptible to TYLCV-Thailand strain although it carried Ty-2 locus responsible for tolerance to some other TYLCV strains. The accession FLA456 was tolerant to TYLCV-Thailand strain and it did not carry the Ty-2 gene. Although the F1 plants carried the Ty-2 locus, with heterozygous alleles, they showed tolerance to TYLCV disease. All the plants in the BC1F1 bearing the two bands 900 bp and 800 bp were

FIG.1 : PCR fragments with Ty-2 locus primers for the T0302 marker (agarose patterns lanes are for the parents lines CLN2498E and FLA456, F1 and 128 BC1F1 plants)

46 IJSTR©2012 www.ijstr.org


International Journal of Scientific & Technology Research Volume 1, Issue 4, May 2012

ISSN 2277-8616

TABLE 1 : Reaction of resistance to tomato yellow leaf curl virus (TYLCV–Thailand) disease in CLN2498E, FLA456, F1 and BC1F1 populations

4 APPENDICES APPENDIX 1:The primer sequences for T0302 F: 5′ TGGCTCATCCTGAAGCTGATAGCGC R: 5′ AGTGTACATCCTTGCCATTGACT

5 REFERENCES [1] P.K. Anderson and F.J. Morales, ‘’Whitefly and whiteflyborne viruses in the tropics: Building a knowledge base for global action,’’ CIAT publication no.341, 351 p,2005. [2] Y.Bai, C.C. Huang, R. Hults, F. Meijer-Dekens, G. Bonnema and P. Lindhout,’’ QTLs for tomato powdery mildew resistance (Oidium lycopersici) in Lycopersicon parviflorum Gl.1601 co-localized with two qualitative powdery mildew resistance genes,’’ Mol Plant Microbe Interact 16: 196-176, 2003. [3] A. Barone, ‘'Molecular markers-assisted selection for resistance to pathogens in tomato. Marker Assisted Selection: A fast tract to increase genetic gain in plant and animal breeding,’’ Session1: MAS in plants, 2008. [4] M.R. Foolad and S. Sharma, ‘’ Solanum genomic network,’’ htt://www.sgn.cornell.edu, 2005. [5] R.C. Grube, E.R. Radwanski and M. Jahn, ‘’Comparative genetics of disease resistancwithin the Solanaceae.’’ Genetics 155: 873-887, 2000. [6] P. Hanson, S.K. Green and G. Kuo, ‘’Ty2, a gene on chromosome 11conditioning geminivirus resistance in tomato,’’ Tomato Genetic Cooperative Report 56:17-18, 2006. [7] Y. Ji, P. Hanson, E. Graham and D.P. Maxwell, ‘’Sources of resistance, inheritance, and location of genetic loci conferring resistance to members of the tomato infection begomoviruses,’’ In: Czosnek H (ed) Tomato yellow leaf curl virus disease: Management, molecular biology, Breeding for resistance. Kluwer, Dordrecht, 2007. [8] Y. Ji and J.W. Scott, ‘’Ty-3, a begomovirus resistance locus linked to Ty-1 on chromosome 6’’ Report of Tomato Genetic Coop. 56, 2006b.

[9] S.J. Katie, P. Hanson, and M. Luis, ‘’Co-dominant SCAR marker for detection of the begomovirusresistanceTy2 locus derived from Solanum habrochaites in tomato germplasm,’’ (Graham and Hanson, pers. com.) [10] S.D. Tanksley, M.W. Ganal, J.P. Prince, M.C. Vicente, M.W. Bonierbale, P. Broun, T.M. Fulton, J.J. Giovannoni, S. Grandillo, G.B. Martin, R. Messeguer, J.C. Miller, L.A.H. Miller, O. Paterson, M.S. Pineda, R.A. Roeder, W.Wu. Wing and N.D. Young,’’High density molecular linkage maps of the tomato and potato genomes,’’ Genetics 132:1141-1160, 1992. [11] D. Zamir, I. Ekstein-Michelson, Y. Zakay, N. Navot, M. Zeidan, M. Sarfatti, Y. Eshed, E. Harel, T. Pleban, H. Van Oss, N. Keder, H.D. Rabinowitch and H. Czosnek, ‘’Mapping and introgression of tomato yellow leaf curl virus tolerance gene, Ty-1,’’ Theor. Appl. Genet. 88:141-146, 1994.

47 IJSTR©2012 www.ijstr.org

Molecular-marker-screening-for-ty-2-gene-in-two-tomato-genotypes-(solanum lycopersicon-l.)  
Read more
Read more
Similar to
Popular now
Just for you