Issuu on Google+

ŠKOLSKI LEKSIKON BIOLOGIJE s pitanjima za maturu i prijemne


HINUS Zagreb, Miramarska 13 b tel.: 615 41 96, tel./fax: 611 55 18 e-mail: Urednik

Hrvoje Zrnčić Recenzenti Mirjana Kalafatić Mirjana Martek, prof.

ISBN 978-953-6904-26-6

Copyright © Hrvoje Zrnčić

Knjigu možete besplatno preuzeti samo za osobnu upotrebu, a ne smijete je stavljati na druge mrežne stranice, umožavati ili je koristiti za bilo koju komercijalnu svrhu.

Sanda Ilić Lela Zadražil Ljubica Kostanić



BIOLOGIJE s pitanjima za maturu i prijemne



PREDGOVOR ...........................................................................................7 LEKSIKON ...............................................................................................9 PITANJA ...............................................................................................159 ODGOVORI ..........................................................................................253 DODATCI .............................................................................................279 DODATAK 1 ...................................................................................281 DODATAK 2 ...................................................................................289 DODATAK 3 ...................................................................................295 DODATAK 4 ...................................................................................297 DODATAK 5 ...................................................................................299 DODATAK 6 ...................................................................................301

PREDGOVOR Onome tko se želi brzo i kvalitetno pripremiti za polaganje razredbenog ispita iz biologije, na bilo kojem od fakulteta na kojem se polaže biologija, ovo će biti izuzetno korisna literatura. Ova knjiga ne predstavlja samo pomoć za brzo i dobro pripremanje razredbenih ispita već i nešto više od toga. Naime, ona sadrži leksikon pojmova iz biologije koji će biti korisno štivo još dugo nakon polaganja razredbenih ispita. Knjiga se u osnvi sastoji od tri dijela. Prvi dio je leksikon pojmova iz biologije temeljen na srednjoškolskom gradivu. Leksikon podrazumijeva abecedni poredak bioloških pojmova i njihovih sažetih opisa što omogućuje brzo snalaženje prilikom pripreme za polaganje razredbenih ispita. Drugi dio sadrži više stotina pitanja s proteklih razredbenih ispita s uputama za njihovo rješenje. Upute se prije svega odnose na savjet koji pojam odnosno koje objašnjenje treba pročitati da bi se razjasnilo rješenje zadatka kojega se rješava. Ovdje treba posebno naglasiti da Leksikon omogućuje i brzo razjašnjenje zbog čega neki pretpostavljeni odgovor na zadatak koji se rješava nije točan. To se postiže tako da se tumačenje ključnog pojma iz pretpostavljenog odgovora također potraži u Leksikonu. Treći dio čine dodaci koji pojašnjavaju bilo pojmove sadržane u Leksikonu bilo rješenja zadataka s proteklih razredbenih ispita. Dvije su vrste kratica uporabljene u tekstu koji slijedi. To su, prije svega kratice naziva različitih kemijskih spojeva. Uz potrebna pojašnjenja, rabe se kratice naziva nukleinskih kiselina, aminokiselina, nukleotida, hormona i dr. prema engleskom nazivu. Zatim su tu i uobičajene kratice koje su vezane uz način uporabe. U tekstu se rabe samo dvije uobičajene kratice: v. i isp. Kratica v. znači vidi i redovito dolazi ispred pojma o kojem treba pročitati osnovne informacije. Kratica isp. znači ispitaj i dolazi uz pojam o kojem treba potražiti dodatne informacije. Dakle, ova se knjiga odlikuje jednostavnim razjašnjenjima zašto je neki odgovor u danom zadatku točan, ali isto tako i zašto neki drugi odgovor nije točan. Tako se brzo ovladava gradivom i stječe sigurnost neophodna za uspješan izlazak na razredbene ispite.

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

A ABBE, E. njemački znanstvenik i izumitelj koji je u unaprijedio mikroskop povećavši njegovu moć razlučivanja. ABIOTIČKI ČIMBENICI, jedna od skupina ekoloških čimbenika. To su različiti fizikalni i kemijski čimbenici okoliša koji utječu na život nekog organizma, npr. temperatura, voda odnosno vlaga, svjetlost itd. ABISAL, dubokomorski (oceanski) sloj, izvan granice prodora svjetla i pod visokim tlakom. Život u abisalu ovisi o gornjem osvjetljenom sloju u kojem se odvija primarna organska proizvodnja (bioproizvodnja) procesom fotosinteze. ACETIL-CoA, početni spoj Krebsova ciklusa. Sastoji se od acetilne skupine vezane na koenzim A (Co A). Spoj sadržava tioestersku vezu bogatu energijom. Ima bitno značenje u izmjeni tvari jer nije samo produkt razgradnje ugljikohidrata već i masnih kiselina te aminokiselina. ACETILKOLIN, neurohormon kojeg parasimpatički živac-vagus luči na živčanim okončinama. On se oslobađa kada je smanjena potreba za kisikom (npr. kada spavamo) smanjujući udarni volumen srca. ACIDO - BAZNA RAVNOTEŽA, ravnoteža kiselina i lužina u tijelu, regulira se puferskim svojstvima tjelesnih tekućina, plućima i bubrezima, v. puferi. Normalna koncentracija vodikovih iona (pH) arterijske krvi je oko 7.4. Pluća sudjeluju u održavanju te ravnoteže izdisanjem ugljikovog dioksida, a bubrezi izlučivanjem vodikovih iona mokraćom. ACIDOFILNE (kremene) BILJKE, biljke koje rastu na kiselim tlima (pH 4,5 -

5,5). To su npr. rododendron, pitomi kesten, kiselica i borovica. ACIDOZA, stanje sniženih pH vrijednosti tjelesnih tekućina (normalan pH je oko 7.4), v. acido - bazna ravnoteža. ADAPTACIJA OKA, prilagodba oka na svjetlo ili tamu, v. bjeloočnica. ADAPTACIJA, v. prilagodba. ADAPTIVNA OBOJENOST, v. zaštitna obojenost, upozoravajuća obojenost i mimikrija. ADAPTIVNA RADIJACIJA, v. makroevolucija. ADENIN, organski spoj s dušikom iz skupine purinskih baza. Sadržan je u najvažnijem pohranjivaču i prijenosniku energije u živoj stanici, u ATP-u. Sudjeluje i u izgradnji nukleotida odnosno nukleinskih kiselina.






H ADENOHIPOFIZA, prednji režanj žlijezde hipofize koji izlučuje hormon rasta, gonadotropne hormone, adenokortikotropni hormon i tireotropni hormon. ADENOKORTIKOTROPNI HORMON (ACTH), hormon kojega izlučuje prednji

režanj hipofize (adenohipofiza). Stimulira koru nadbubrežne žlijezde na izlučivanje kortikosteroidnih hormona kortizona i aldosterona. ADENOZIN-TRIFOSFAT, v. ATP. ADH, v. antidiuretički hormon.


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

ADHEZIJA, privlačna sila između molekula različitih tvari koje se dotiču. Povezanost molekula vode s drugim molekulama (npr. uz stijenku kapilara kod biljaka) omogućuje uzlazni tok vode u biljci. ADP (adenozin-difosfat), v. ATP. ADRENALIN, hormon kojega izlučuje srž nadbubrežne žlijezde. Pojačano se izlučuje u različitim stresnim stanjima, npr. šoku, strahu, bolu, jakom uzbuđenju itd. Njegovo djelovanje je višestruko i svodi se na podizanje svih važnih funkcija u organizmu na višu razinu kako bi organizam što bolje prebrodio stres. Tako adrenalin uzrokuje pojačani intenzitet rada srca, stezanje perifernih krvnih žila, širenje očnih zjenica, širenje bronhiola, pojačani intenzitet i brzinu disanja, stezanje mnogih mišića, povećani broj limfocita u cirkulaciji itd. ADULTNI HEMOGLOBIN, v. eritrociti ADVENTIVNO KORIJENJE, v. korijen. AERENHIM, v. osnovno staničja. AEROBAN, označuje prisutnost kisika; odnosi se na organizme, okoliš ili na stanične procese koji zahtijevaju prisustvo kisika. AEROBNA RESPIRACIJA, v. disanje. AGLUTINACIJA, pojava sljepljivanja krvnih stanica u slučaju primitka krvi neodgovarajuće krvne grupe. AGLUTININ, v. krvne skupine. AGLUTINOGEN, v. krvne skupine. AGRANULOCITOZA, bolest smanjenog ili zaustavljenog stvaranja granulocita u koštanoj moždini. Kao posljedica agranulocitoze često se javlja povećana sklonost bakterijskim i gljivičnim infekcijama.


AIDS (SIDA), engleska odnosno francuska kratica za sindrom stečene imunodeficijencije. Za AIDS je to smanjenje broja leukocita u krvi, smanjen broj limfocita u limfatičnim organima (limfnim čvorovima i slezeni), smanjen broj zrelih T limfocita, manja količina protutijela (Ig). Uzročnik je virus (retrovirus) koji napada i uništava T4 - limfocite, nositelje stanične imunosti. Virus je nazvan HIV-om (Human Immunodeficiency Virus, humani virus nedostatka imuniteta), HIV se najčešće prenosi spolnim kontaktom i krvlju (transfuzijom, injekcijskim iglama), zatim sa zaražene majke kroz posteljicu na nerođeno dijete, te ženinim mlijekom na dojenče (sisanje). AIDS je za sada neizlječiva bolest imunološkog sustava za vrijeme koje nastaju vidljive promjene: (oportunističke infekcije) upala pluća i moždane ovojnice, gljivične bolesti i tumori. AKCIJSKI POTENCIJAL, v. električni potencijal. AKOMODACIJA OKA, prilagođavanje oka na gledanje blizu i daleko, v. leća. AKROMEGALIJA, nenormalan rast pojedinih dijelova tijela kao što su šaka, stopalo, pojedini zglobovi i dr. zbog povećanog lučenja hormona rasta. Javlja se u odraslo doba. AKROSOM, vršno tjelešce koje se nalazi na vršnom dijelu glave spermija. Sadrži hidrolitičke enzime i omogućuje prodiranje spermija u jajnu stanicu prilikom oplodnje. AKSON (neurit), v. živčana stanica. AKTIN, bjelančevinasta molekula koja izgrađuje miofibrile, v. poprečnoprugasti mišić. AKTIVAN PRIJENOS (aktivan transport), prijenos tvari kroz staničnu membranu iz područja manje koncentracije u područje veće koncentracije neke tvari. Taj

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

prijenos se može odvijati samo uz pomoć membranskih “prenositelja” i uz utrošak energije iz ATP-a. Klasični primjer aktivnog prijenosa je transport iona natrija (Na+) iz stanice u međustanični prostor i iona kalija (K+) iz međustaničnog prostora u stanicu, tzv. natrijeva i kalijeva pumpa. Ovaj oblik aktivnog prijenosa susreće se u membranama gotovo svih animalnih stanica. AKTIVNI TRANSPORT, v. aktivni prijenos. AKTIVNO STEČENA SPECIFIČNA IMUNOST, organizam nakon kontakta s određenim antigenom stvara specifične tvari imunološke reakcije (protutijela, limfocite T i dr.). Aktivna imunost može biti stečena prirodnim putom (ljudi koji su preboljeli neku zaraznu bolest imaju gotova specifična protutijela s kojima mogu uništiti isti antigen u slučaju ponovnog unosa u tijelo) ili umjetnim putom (cijepljenjem). ALANIN, kemijski spoj iz skupine aminokiselina. ALANTOIS, kod amniota, druga zametna ovojnica koja obavija zametak. Prokrvljena je mnogim kapilarima te sudjeluje u disanju i hranjenju zametka. ALBINIZAM, nedostatak pigmenta u koži i/ili drugim organima. Nasljedno svojstvo koje se pojavljuje u čovjeka, ali i nekih životinja, na primjer u miševa, kunića, majmuna, a određuje ga recesivni gen koji se nalazi na autosomima (nespolni kromosomi). ALBUMIN, bjelančevina u krvi (oko 34 do 50 g/L) koja sudjeluje u prijenosu različitih hormona. Sintetizira se u jetri odakle se otpušta u krv. ALDOSTERON, jedan od hormona kore nadbubrežne žlijezde. Taj hormon održava stalnu razinu iona natrija, klora i kalija u

tijelu. Najvažniji podražaj za lučenje hormona je niska koncentracija iona natrija u izvanstaničnoj tekućini (npr. plazmi). Aldosteron koji je oslobođen u krvi, filtrira se u nefron, a to pojačava upijanje iona natrija u kapilare uz nefrone. ALELI, (alelni geni, homologni geni) su par gena koji određuju isto svojstvo, a nalaze se na paru homolognih kromosoma (isp.). Aleli pojedinih svojstava označuju se obično slovima abecede i to dominantni velikim, a recesivni malim slovima, npr. za jedno svojstvo A i a, za drugo B i b, itd. Ako dominantnost nije izražena aleli se mogu označavati s a1 i a2, b1 i b2, itd. U jednom organizmu za neko fenotipsko svojstvo mogu biti najviše dva različita alela. ALELNI GENI, v. aleli. ALERGENI , v. alergija. ALERGIJA (alergijska reakcija), specifičan oblik imunološke reakcije odnosno preosjetljivost (hipersenzitivnost) na neke tvari. Tvari koje uzrokuju alergije zovu se alergeni, a najčešći su pelud, neki lijekovi, prašina, neke vrste hrane (jagode, maline, sir), različita kemijska sredstva (detergenti, kozmetički preparati) itd. ALFA-AMILAZA, v. ptijalin. ALFA-MEZOSAPROBNE VODE, jedan od stupnjeva onečišćenja voda, a predstavlja snažno onečišćene vode. ALGAŠICE, gljive koje, poput alga, žive u vodi kao saprofiti ili paraziti. Njihove hife nemaju poprečnih stijenki pa sliče dugim razgranatim cijevima s puno jezgara. Stanična stijenka im je od hitina, a samo kod najprimitivnijih od celuloze. ALGE, autotrofne fotosintetske steljnjače među kojima postoje velike razlike. Skupine algi su bičaši, kremenjašice, zelene, smeđe i crvene alge. Od tih skupina samo


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

crvene alge nemaju pokretne stanice s bičevima niti u jednom razvojnom stadiju. ALKALOZA, stanje povišenih pH vrijednosti tjelesnih tekućina (normalan pH je oko 7.4), v. acido - bazna ravnoteža. ALKAPTONURIJA, nasljedni nedostatak enzima zbog čega se nakuplja homogenetizirana kiselina u mokraći, a koja na zraku potamni. ALKOHOLNO VRENJE, v. kvaščeve gljivice. ALOPATRIJSKA SPECIJACIJA, specijacija kada su populacije odvojene zemljopisnom barijerom. Razvoj u novu vrstu zbiva se u prostorno izoliranim populacijama koje potječu od zajedničkog ishodišta, ali žive u raznim sredinama. Isp. specijacija. ALVEOLE, v. plućni mjehurići. AMBULAKRALNI SUSTAV, v. vodožilni sustav. AMEBNA DIZENTERIJA, v. dizenterija AMENOREJA, izostanak mjesečnice. Ako se ne pojave prve mjesečnice u pubertetu, govori se o primarnoj amenoreji, a ako izostanu mjesečnice kod žena koje su ih imale redovito govori se o sekundarnoj amenoreji. Razlozi su najčešće u poremećaju ravnoteže spolnih hormona i gonadotropnih hormona. AMERIA, v. beskolutićavci. AMFIPATSKE MOLEKULE, molekule koje na jednom svome kraju privlače vodu, a na drugom odbijaju vodu. Amfipatske molekule su npr. molekule fosfolipida. U molekuli fosfolipida električki nabijen kraj privlači molekule vode (hidrofilan), a električki nenabijen kraj s masnim kiselinama odbija vodu (hidrofoban). AMILOPLAST, v. leukoplasti.


AMINOKISELINE, organski spojevi koji izgrađuju bjelančevine. Svaka aminokiselina sadrži dvije karakteristične kemijske skupine: karboksilnu (COOH) i amino (NH2) skupinu, a međusobno se aminokiseline razlikuju po vrsti radikala. Poznato je oko 70 različitih aminokiselina, ali samo 20 dolazi u živim organizmima.To su: glicin, leucin, serin, aspargin, alanin, izoleucin, treonin, glutamin, valin, fenilalanin, cistein, asparginska kiselina, tirozin, metionin, glutaminska kiselina, triptofan, histidin,lizin, prolin i arginin.





AMNION, kod amniota, prva unutarnja zametna ovojnica koja obavija i zaštićuje zametak od trešnje i pritiska. To je vrećasta tvorba ispunjena bjelančevinastom tekućinom u kojoj pliva zametak. AMNIOTA, skupine životinja (gmazovi, ptice i sisavci) kod kojih se pojavljuju tri zaštitne zametne ovojnice: amnion, alantois i seroza. Amniota nemaju stadij ličinke i njihov razvitak teče bez preobrazbe. Pojavili su se u karbonu, v. dodatak 5. AMP (adenozin-monofosfat), v. ATP. ANABOLIZAM, sintetički procesi u kojima se od malih građevnih elemenata izgrađuju ili polimeriziraju veće molekule. ANADROMNE SELICE, ribe koje žive u moru, a radi mriještenja zalaze u slatke vode, npr. lososi, v. selidba riba. ANAEROBAN, označuje odsutnost zraka, odnosno kisika; odnosi se na organizme, okoliš ili na stanične procese za koje nije potrebna ili je čak štetna prisutnost kisika.

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

ANAEROBNA RESPIRACIJA, v. disanje. ANAFAZA, stadij mitoze (isp.). Na početku anafaze svaki kromosom razdvoji se na dvije kromatide koje zatim putuju prema suprotnim polovima stanice vučene teznim nitima diobenog vretena. Anafaza završava kada kromosomi stignu na suprotne polove stanice. Za razliku od profaze i metafaze u kojima su kromosomi dvostruki, anafazni kromosomi su jednostruki odnosno sastoje se od jedne kromatide. ANAFAZA DRUGE MEJOTIČKE DIOBE, v. anafaza II. ANAFAZA I, (anafaza prve mejotičke diobe, anafaza mejoze I), stadij mejoze (isp.). U anafazi I razdvajaju se homologni kromosomi i putuju prema suprotnim polovima stanice stezanjem teznih niti diobenog vretena. Kromosomi u anafazi I su dvostruki, odnosno, svaki je građen od dvije kromatide. ANAFAZA II (anafaza druge mejotičke diobe, anafaza mejoze II), stadij mejoze (isp.). Zbivanja u anafazi II su ista kao i u anafazi mitoze gdje se svaki dvostruki kromosom dijeli na dva jednostruka koji putuju na suprotne polove stanica. ANAFAZA MEJOZE I, v. anafaza I. ANAFAZA MEJOZE II, v. anafaza II. ANAFAZA PRVE MEJOTIČKE DIOBE, v. anafaza I. ANAFILAKTIČKI ŠOK, teško alergijsko stanje u kojem drastično padne minutni volumen srca i arterijski tlak. Stanice imunološkog sustava ispuštaju histamin. Može doći do gušenja i smrti pri unašanju veće količine specifičnog alergena (npr. penicilina). ANALOGNI ORGANI, organi u raznih skupina organizama koji su različitog pod-

rijetla, a funkcija im može biti slična, kao npr. krilo ptice i krilo kukca. Takvi su organi prilagodba na slične uvjete života. ANATOMIJA, znanost koja proučava makroskopsku građu tijela svih živih bića. ANDROGENI (muški spolni hormoni), hormoni koji se stvaraju u sjemenicima i kori nadbubrežne žlijezde, a u manjoj mjeri i u jajnicima. Sjemenici stvaraju i luče nekoliko spolnih hormona od kojih je najvažniji testosteron. Spolni hormoni koje luči kora nadbubrežne žlijezde zovu se adrenalni androgeni od kojih je najvažniji dehidroepiandrosteron. ANEMIJE, bolesti pri kojima su tkiva preslabo opskrbljena kisikom zbog smanjene količine hemoglobina i broja eritrocita u krvotoku. Simptomi su: bljedoća, umor, slabost, nesvjestica, gubitak daha i lupanje srca. Neke anemije uzrokuju genetski čimbenici, npr. srpastu anemiju. Ostale mogu biti posljedicom ubrzanog raspada eritrocita ili hemolize - hemolitička anemija, nedostatka željeza u hrani – sideropenična anemija ili manjka vitamina B perniciozna anemija. ANEUPLOIDIJA, je promjena u broju samo jednog ili nekoliko kromosoma. Najčešće zahvaća spolne kromosome. Javljaju se abnormalnosti u razvitku, koje uglavnom nisu letalne. Npr. Turnerov sindrom 45xo, ženska osoba s jednim x-kromosomom, spolno nerazvijena i nespolna (ima nerazvijene jajnike) ili Klinefelterow sindrom (47, xxy, 48 xxxy) kod muškaraca izaziva ženske osobine (mliječne žlijezde) i sterilni su. ANGINA PEKTORIS (stenokardija), nije bolest, nego se tako nazivaju boli koje nastaju kad srčani mišić ostane privremeno bez kisika. Povećane fizičke aktivnosti, uzbuđenje, velike i nagle temperaturne razlike povećavaju aktivnost srca (broj ot-


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

kucaja) i potrebu za kisikom iznad mogućnosti koronarnog optoka. Kao posljedica javlja se jaka bol u prsima, koja uglavnom prestaje sa smanjenjem aktivnosti tijela. ANTENALNE ŽLIJEZDE, ticalne žlijezde, isp. rakovi. ANTERA, v. prašnik. ANTERIDIJI, muški rasplodni organi biljaka u kojima nastaju muške spolne stanice. Anteridija nema kod najprimitivnijih (bakterije, neke alge), i najsavršenijih (kritosjemenjače) biljnih skupina. ANTIBIOGRAM, mikrobiološka metoda kojom se ispituje djelovanje niza različitih antibiotika na izoliranu bakteriju uzročnika bolesti. Ovom metodom utvrđuje se najdjelotvorniji antibiotik za liječenje određene bakterijske bolesti. ANTIBIOTIK, kemijska tvar koja spriječava razvitak određenih vrsta bakterija. Mogu ih proizvoditi čak i neke vrste bakterija, npr. bakterije roda Streptomyces proizvode streptomicin. ANTIDIURETIČKI HORMON (ADH), hormon koji luči stražnji režanj hipofize (neurohipofize) ako u organizmu nedostaje vode. Ako krvna plazma postane hipertonična, podražuje središte za žeđ u mozgu, a to središte šalje impulse živčanim putem u stražnji režanj hipofize koja počne lučiti ADH. ADH se transportira krvlju u čahuru nefrona gdje djeluje na stanice stijenki kanalića nefrona da postanu propusnije za vodu. Dakle, povećava se respiracija vode iz filtra natrag u krv. Naprotiv, ako je krvna plazma hipotonična (popili smo previše vode) prestaje se lučiti ADH te se u nefronima voda neće reapsorbirati u krv, nego će se lučiti iz tijela mokraćom. ANTIGEN (imunogen), svaka tvar koja može izazvati imunološku reakciju organizma.


ANTIKODON (protušifra), skupina triju baza na molekuli transportne RNA (tRNA) koje su komplementarne bazama na molekuli glasničke RNA (mRNA). Antikodon raspoznaje, a zatim se spoji s kodonom (šifrom) na mRNA. ANTIPIRETICI (antipirogene tvari), sredstva koje snizuju povišenu tjelesnu temperaturu. ANTITETSKA IZMJENA GENERACIJA, v. zelene alge. ANTITIJELA, obrambene bjelančevine koje stvara organizam kada u njega uđu antigeni. Većina antitijela stvara se u plazma stanicama i B limfocitima. ANTROPOLOGIJA, u najširem smislu, znanost koja proučava čovjeka, posebice ljudske rase, evoluciju, ponašanje i dr. AORTA, najveća arterija, izlazi iz lijeve klijetke srca, v. veliki optok. APENDICITIS, v. upala crvuljka. APIKALNA DOMINACIJA, pojava u kojoj vršni pup djelomično ili potpuno inhibira rast bočnih pupova. APIKALNI MERISTEMI, v. vršni meristemi APLASTIČNA ANEMIJA, bolest smanjene proizvodnje eritrocita u koštanoj moždini. APOMIKSIJA, razvitak sjemena bez oplodnje (nespolno razmnožavanje). U tom se slučaju jajna stanica samo diploidizira (udvostruči se broj kromosoma) bez oplodnje. Od nje se razvije zametak, sjeme i zatim biljka koja je potpuno jednaka kao i roditeljska biljka. Apomiksiju nalazimo npr. u maslačka. APOSEMIJA, v. upozoravajuća obojenost.

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

APSCIZINSKA KISELINA, biljni hormon koji inhibira rast, potiče dormanciju i pomaže biljci da preživi u stresnim uvjetima (regulirajući vodnu ravnotežu). Kontrolira završne razvojne stadije biljaka: starenje, otpadanje listova, venuće cvjetova, dozrijevanje plodova. Sintetizira se u stanicama koje sadržavaju kloroplaste ili amiloplaste. APSORPCIJA HRANE, upijanje hrane u probavnom sustavu iz probavila u krvotok i limfotok. Apsorpcija hrane se najvećim dijelom obavlja u tankom crijevu pomoću epitelnih stanica crijevnih resica, a djelomice u debelom crijevu gdje se uz konačnu apsorpciju hrane upijaju voda i minerali. ARCHAEOPTERYX, v. praptica. AREAL, prostor na kojem je raspoređena neka vrsta organizama ili opseg prostorne rasprostranjenosti neke vrste. Areali se razlikuju po obliku i veličini, npr. endemične vrste imaju vrlo mali areal. ARGININ, kemijski spoj iz skupine aminokiselina. ARHEGONIJ, ženski rasplodni organi biljaka u kojima nastaju ženske spolne stanice. Nalazimo ga u mahovina, papratnjača i donekle u promijenjenom obliku u golosjemenjača. ARHENTERON (pracrijevo), prostor koji nastaje uvrtanjem (invaginacijom) endoderma u šupljinu gastrule, preteča je crijeva. Nastaje u jednoj od etapa embrionalnog razvoja složenih životinjskih organizama. ARILUS, v. tise. AROMORFOZA, v. megaevolucija. ARTERIJE, žile kucavice, ali i žile odvodnice, jer odvode krv iz klijetki srca. Smještene su u dubini organizma. Stijenke arterija građene su od vanjskog elastičnog

omotača ispod kojeg se nalazi mišićni sloj, elastično tkivo i unutarnja stijenka (endotel). Povezane su s ograncima autonomnog živčanog sustava. Podraživanjem simpatikusa nastaje stezanje (vazokonstrikcija), a podraživanjem parasimpatikusa arterije se šire (vazodilatacija). ARTERIOSKLEROZA, v. ateroskleroza. ASIMILACIJA CO2, v. fotosinteza. ASKOSPORE, v. mješinarke. ASKUSI, v. mješinarke. ASPARGIN, kemijski spoj iz skupine aminokiselina. ASPARGINSKA KISELINA, kemijski spoj iz skupine aminokiselina. ASTMA, čest oblik alergijske reakcije. Zbog oslobođenog histamina stežu se mišići dišnih putova i disanje je otežano. ATAVIZAM, pojava nekih obilježja koja se rijetko javljaju i to samo kod određenih jedinki neke vrste, a bila su svojstvena davnim precima. Primjeri atavizma u čovjeka su prekomjerna dlakavost cijelog tijela, veći broj mliječnih žlijezda, ostatak repa i dr. Atavizmi su važan dokaz evolucijskih procesa. ATEROM, v. ateroskleroza. ATEROSKLEROZA (arterioskleroza, ovapnjenje krvnih žila), bolest arterijskih krvnih žila. Starenjem arterije su sklone degenerativnim promjenama i otvrdnuću odnosno gubitku elastičnosti pa se zbog toga teže prilagođavaju održavanju stalnog krvnog tlaka. Glavni uzrok smanjenja elastičnosti jest taloženja masnoća u obliku jastučića (aterom) na unutarnjim stijenkama arterija zbog čega se smanjuje njihov promjer, a time i protok krvi. Ako jastučić pukne, na tom mjestu se stvara tromb koji se može otrgnuti (embol) i kolati krvlju


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

sve dok ne začepi neku užu krvnu žilu. Posebno su ugrožene krvne žile mozga, bubrega i srca. Aterosklerotične promjene češće su u ljudi koji jedu masniju hranu, pušača cigareta i predebelih osoba, v. tromboza.

birana molekulama klorofila u procesu fotosinteze. Proces sinteze ATP-a iz AMP-a i ADP-a naziva se fosforilacija:

ATP (adenozin-trifosfat), je spoj iz skupine nukleotida koji se sastoji od adenozina (purinska baza adenin + šećer riboza) na koji su vezane tri fosfatne skupine.

ATPaza, katalizator mijene tvari koji sudjeluje u oslobađanju odnosno, priključivanju energijom bogatih veza između fosfatnih skupina u nukleotidima.











Kemijske veze među fosfatnim skupinama sadrže veliku količinu energije. Ta se energija može osloboditi i koristiti za različite aktivnosti stanica, npr. sintetske aktivnosti, proizvodnja topline, kretanje i sl. Kada je stanici potrebna energija ona se iz ATP-a oslobađa odjeljivanjem treće fosfatne skupine. Pri tome nastaje energetski siromašniji spoj adenozin-difosfat (ADP).

ATP → ADP + P + energija ADP → AMP + P + energija Odvajanjem druge fosfatne skupine opet se oslobađa energija i nastaje spoj adenozin-monofosfat (AMP). AMP nema niti jednu vezu bogatu energijom. Za sintezu ATP-a koristi se energija oslobođena u procesu staničnog disanja u mitohondrijima i svjetlosna energija apsor-


AMP + P + energija → ADP ADP + P + energija → ATP.

AUKSINI, skupina biljnih hormona koji stimuliraju produžni rast stanica, sekundarni rast i razvoj plodova. Prirodni se auksin većinom sintetizira u vršnim meristemima i mladim listovima u razvitku odakle se prenosi u ostale dijelove biljke. AUSTRALOPITEKUS (Australopithecus, južni pračovjek), čovjekov predak s djelomice ljudskim osobinama. Najstariji nalazi australopitekusa stari su oko četiri milijuna godina. To su najstariji nalazi pravih hominida humane faze. Nađeni su u južnoj i sjevernoj Africi, v. dodatak 5. AUTOHTON, samonikao, koji od davnina živi u nekom kraju. AUTONOMNI ŽIVČANI SUSTAV, (vegetativni živčani sustav), dio živčanog sustava koji nije podložan djelovanju naše volje. Nadzire rad većine unutarnjih organa, npr. probavnih organa, pluća, srca, krvnih žila itd. Dijelimo ga na simpatikus i parasimpatikus. AUTOPURIFIKACIJA VODA, v. samoočišćenje voda. AUTORADIOGRAFIJA, metoda koja se koristi u znanstvenim istraživanjima, a sastoji se u tome da se u stanicu unose nestabilni, radioaktivni izotopi, te se posebnim postupcima prati njihov položaj i raspored u stanici. Ova metoda ima važnu ulogu u proučavanju kemijske građe stanice i staničnog metabolizma.

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

AUTOSOMI, kromosomi koji ne određuju spol, ali su nosioci gena za druga svojstva. AUTOTOMIJA, v. samosakaćenje. AUTOTROFI (autotrofni organizmi), organizmi koji su sami sposobni stvarati vlastite organske spojeve. Ako se za stvaranje takvih organskih spojeva koristi sunčeva svjetlost (fotosinteza) onda su to fotoautotrofi, a ako potrebnu energiju za stvaranje dobivaju od kemijskih reakcija (kemosinteza) onda su kemoautotrofi. Autotrofni proizvođači (producenti) čine temelj ishrane svake životne zajednice (biocenoze). Nalaze se na prvom mjestu hranidbenih lanaca u kojima nakon njih dolaze mnogobrojne serije potrošača (konzumenata). AUTOTROFNI ORGANIZMI, v. autotrofi. AUTOTROFNI PRODUCENTI, v. autotrofi. AUTOTROFNI PROIZVOĐAČI, v. autotrofi. AVERY, O.T. zajedno sa suradnicima 1944. god. utvrđuje i pojašnjava rezultate Griffithovog pokusa dokazavši da je DNA tvar koja uzrokuje pretvorbu (transformaciju) pneumokoka.

B BABINJE (puerperium), razdoblje nakon porođaja koje traje oko 4 do 5 tjedana. To je vrijeme koje je potrebno da se maternica smanji i vrati u normalno stanje. BACILI, v. bakterije. BAKTERIJE, jednostanični prokariotski organizmi (najjednostavnije građeni stani-

čni organizmi) čija je prosječna veličina 1 μm. Bakterijske stanice mogu biti različitog oblika, a obično razlikujemo četiri glavna: kuglaste (koki), štapičaste (bacili), oblika zareza (vibrioni) i spiralno savijene (spirili). Koki i bacili često stvaraju manje ili veće nakupine (diplokoki, streptokoki, stafilokoki i sl.) dok vibrioni i spirili dolaze pojedinačno. Tipična bakterijska stanica, kao i svaka prokariotska stanica, nema oblikovanu jezgru ni druge složene stanične organele, npr. mitohondrije i kloroplaste. Izvana je obavijena debelom staničnom stijenkom koja sadrži organsku tvar murein. Neke bakterije imaju i vanjsku ovojnicu polisaharidne građe koja izvana oblaže staničnu stijenku i zove se kapsula. Protoplazma bakterijske stanice obavijena je polupropusnom membranom lipoproteinske strukture. Osnovu protoplazme čini citoplazma u čijem je središtu nukleoid koji po funkciji odgovara jezgri eukariotske stanice jer čini genetički materijal bakterijske stanice. Nukleoid je građen od molekule DNA koja je zatvorena u prsten i gusto sklupčana. U citoplazmi se nalaze i ribosomi te pričuvne hranjive tvari (masne kapljice, polisaharidi), a kod fotosintetskih bakterija i posebne membrane na kojima se odvija fotosinteza. Njihovim fotosintetskim procesima nikada se ne oslobađa kisik. Fotosintetske membrane po funkciji odgovaraju kloroplastima eukariotske stanice. Bakterijska stanica sadrži i mezosome, nabore stanične membrane koji su po svojoj funkciji slični mitohondrijima. Prema načinu ishrane bakterije mogu biti autotrofi (fotosintetske, kemosintetske) i heterotrofi (saprofiti, paraziti). Općenito se dijele na aerobne i anaerobne. Najčešće se razmnožavaju vegetativno, diobom ili cijepanjem pri čemu od jedne bakterijske stanice, čija se DNK podijeli uzdužno, nastanu dvije nove stanice


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

genetički posve jednake početnoj stanici. Neke bakterije imaju sposobnost da u nepovoljnim uvjetima iz aktivnog oblika prijeđu u trajne oblike ili spore koje su obavijene čvrstom ovojnicom. U obliku spora bakterije mogu preživjeti i tisuću godina te nakon toga u povoljnim uvjetima opet “proklijati” u aktivni oblik. BAKTERIJSKI VIRUSI, v. bakteriofagi. BAKTERIOFAGI (bakterijski virusi, fagi), posebna skupina virusa koja napada bakterije. Tipični bakteriofag građen je od glavice u kojoj se nalazi DNA ili RNA obavijena proteinskim ovojem. Na glavicu se nastavlja kontraktilni rep čiji je središnji dio poput šupljeg štapića izvana obavijenog stezljivim ovojem. Na dnu repa nalazi se pločica sa pipcima. Uz pomoć pipaka fag se prihvati na staničnu stijenku bakterije i stezanjem repa ubaci nukleinsku kiselinu u njenu unutarnjost. Pod kontrolom nukleinskih kiselina bakteriofaga stvaraju se u bakterijskoj stanici novi fagi. Nakon 20 do 30 minuta proces razmnožavanja faga je završen, a bakterijska stanica se raspada te iz nje izlaze novonastali fagi. BAKTERIOLOGIJA, biološka znanost koja se bavi proučavanjem bakterija. BATALJICA, v. parapodij. BAZALNI METABOLIZAM, osnovni promet tvari i energije u organizmu koju tijelo troši za održavanje temeljnih životnih funkcija, tj. za rad srca, krvotoka, bubrega, dišnog sustava, mozga itd.. Važnu ulogu u bazalnom metabolizmu imaju hormoni štitnjače (tiroksin i trijodtironin), hormon prednjeg režnja hipofize (hormon rasta) i spolni hormoni. Povećana razina tih hormona u krvi povećava bazalni metabolizam. BAZIDIJ, v. stapčarke. BAZIDIOSPORE, v. stapčarke.


BAZOFILNE (vapnenačke) BILJKE, biljke koje rastu na tlima s relativno visokom pH vrijednošću (pH 6,5 - 7,5). To su npr. repa, kupus, luk, cvjetača, soja i špinat. BAZOFILNI LEUKOCITI, v. leukociti. BENTOS, životne zajednice vezane za dno jezera ili mora. U okviru bentoskih biocenoza neke se životinje pokreću vlastitom snagom - vagilni organizmi (rakovi, ribe, ježinci). Sjedilački ili sesilni organizmi su pričvršćeni za podlogu (alge jadranski bračić i jadranski klobučić). Hemisesilni organizmi se mogu kretati, ali uglavnom ostaju na istom mjestu (hobotnica). BENTOSKA BIOCENOZA, životna zajednica raznovrsnih organizama koji žive na morskom dnu. BESKOLUTIĆAVCI (Ameria), beskralježnjaci jednostavnog, nekolutićavog tijela. Uglavnom su bilateralno simetrične i pokretne životinje; osim žarnjaka. Prema zoologu Hadžiju razvili su se iz trepetljikavih mnogojezgrenih jednostaničnih oblika. Danas živi oko 170000 različitih vrsta. Prema građi tijela dijele se u skupine: plošnjaci, žarnjaci, oblenjaci, mekušci. BETA-BLOKATORI, skupina suvremenih lijekova koji snizuju krvni tlak smanjenjem snage kontrakcije srca. BETA-MEZOSAPROBNE VODE, jedan od stupnjeva onečišćenja voda, a predstavlja umjereno onečišćene vode. BEZGREBENKE, v. staročeljuske. BEZKRILCI, skupina kukaca koja ni u jednom stadiju života nemaju krila niti su ih imali tijekom evolucije. Najpoznatiji su skokuni i četinaši. BEZLATIČNICE, šira skupina dvosupnica koja obuhvaća porodice drvenastih biljaka značajnih u izgradnji šumske listo-

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

padne vegetacije. Imaju neugledne cvjetove bez latica, skupljene u rese. Prilagođeni su oprašivanju vjetrom. U porodicu bukve pripadaju bukva, pitomi kesten i različite vrste hrastova: kitnjak, lužnjak, cer, dub, medunac i vazdazeleni hrast crnika ili česmina. Bezlatičnicama pripadaju i porodica breze i lijeske s predstavnicima johe i graba. BEZLUBANJCI, v. svitkovci. BEZNOŠCI, skupina vodozemaca bez nogu. Žive u tropima, gdje gmižu kroz vlažno tlo. Poznata porodica su rijači. BEZREPCI, skupina vodozemaca čije je obilježje da odrasli oblici nemaju repa. Glavni predstavnici su žabe. Žive na kopnu i u slatkoj vodi. Stražnji par nogu duži je od prednjih, prilagođen za skakanje. Na nogama imaju razvijene plivaće kožice. Hrane se sitnim životinjama, najčešće kukcima. Preobrazba teče preko ličinke (v. punoglavac). Poznatije su žabe u našim krajevima: mukači, gatalinke, krastače i zelene žabe. BIČAŠI, praživotinje, imaju najčešće 1 ili 2 biča koji im služe za pokretanje u vodi. Tipičan predstavnik je euglena (Euglena viridis). Tijelo im pokriva pelikula. Posebno je uočljiv organel očna pjega ili stigma. Razmnožavaju se najčešće nespolno, uzdužnom diobom. Spolno razmnožavanje je rijetko. Bičaši imaju posebno značajnu ulogu primarnih proizvođača hrane. Mnogi žive kao plankton slatkovodnih stajačica i u toplim morima. Kao prvi stanični organizmi s jezgrom, imaju neke osobine slične biljakama, životinjama i gljivama pa se pretpostavlja da imaju važnu ulogu i u njihovoj evoluciji. Bičaši koji pripadaju skupini biljnih bičaša su autotrofni jer u protoplazmi imaju kloroplaste. Druga velika skupina su životinjski bičaši. Heterotrofni su organizmi, žive slobodno u vodama ili zadružno, a mnogi su i nametnici na

čovjeku i životinjama. Bičaš tripanosoma je uzročnik spavanja u tropskim krajevima, a trihomonas je čest nametnik u spolnom sustavu čovjeka. BIG BANG, v. veliki prasak. BIJELE KRVNE STANICE, v. leukociti i krvna tjelešca. BIJELO TIJELO (corpus albicans), višestanična tvorevina koja nastaje u jajniku 10 do 14 dana nakon ovulacije u slučaju kada nije došlo do oplodnje jajne stanice. Bijelo tijelo nastaje propadanjem žutog tijela. U idućih nekoliko tjedana propada i bijelo tijelo, a njegovo mjesto ispunja vezivno tkivo te ostavlja ožiljak. BILATERALNA SIMETRIJA, v. dvobočna simetrija. BILIRUBIN, v. eritrociti. BILO, v. puls. BILJKE DUGOG DANA (kratke noći), biljke koje cvjetaju krajem proljeća, ili početkom ljeta kada su dani dugi, a razdoblje tame je kraće od kritičnog (npr.mnoge trave i žitarice). Te biljke trebaju dan duži od 12 sati, v. kritično razdoblje tame. BILJKE KRATKOG DANA (duge noći), biljke koje cvjetaju krajem ljeta, u jesen ili zimi kada su dani kratki, a razdoblje tame je dulje od kritičnog (npr. krizantema). Te biljke trebaju dan kraći od 12 sati, v. kritično razdoblje tame. BILJKE SLANIH STANIŠTA, v. halofiti. BILJKE, autotrofni fotosintetski eukarioti. Dijele se na steljnjače, niže biljke i stablašice, više biljke. Isp. stanica. BILJNA STANICA (fitocelula), v. stanica. BILJNA STANIČJA, (biljna tkiva), razvila su se u skladu s preuzimanjem najraz-


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

ličitijih uloga u prilagodbi kopnenom načinu života, a mogu se uglavnom svesti na sljedeće oblike: tvorna staničja, kožna staničja, provodna staničja, potporna staničja, žljezdana staničja i osnovno staničja. BILJNA TKIVA, v. biljna staničja. BILJNI HORMONI (regulatori rasta), spojevi koji utječu na rast i diferencijaciju tkiva i organa. Učinci pojedinih biljnih hormona nisu specifični (za razliku od animalnih hormona). Postoje tri skupine koji stimuliraju rast i druge procese (auksini, citokinini, giberelini) i dvije vrste koji inhibiraju rast (apscizinska kiselina, etilen). Sintetiziraju se u vrlo malim količinama. BILJNI VIRUSI, v. virusi. BILJNO BOJILO (pigment), tvari koje apsorbiraju sunčevu svjetlosnu energiju i pretvaraju je u kemijsku energiju, koja se pohranjuje u kemijskim vezama šećera i drugih organskih molekula koje nastaju u procesu fotosinteze. Različiti pigmenti apsorbiraju različite valne duljine svjetlosti. Najvažniji su: zeleni klorofili (klorofil a i klorofil b), karotenoidi (žuti i narančasti) i ksantofil (žuti pigment). Od svih pigmenata u biljnom tkivu jedino klorofil a može neposredno sudjelovati u pretvorbi sunčeve energije u kemijsku. BILJOJEDI, v. herbivori, fitofagi. BINOMNA NOMENKLATURA (dvojno nazivlje), znanstveno nazivlje za biljke i životinje koje se sastoji od dva latinska imena. Prvo ime uvijek označava ime roda, a drugo ime vrste. Tako, npr. biljku bijeli dud ili bijela murva nazivamo Morus alba gdje Morus označuje rod (dud, murva), a alba vrstu (bijeli). Binarnu nomenklaturu uveo je u upotrebu u 18. st. poznati švedski prirodoslovac Carl Linné. BIOCENOLOGIJA, znanost o biocenozama, isp., tj znanost koja se bavi prou-


čavanjem odnosa članova u biocenozi i odnosima biocenoze i uvjeta okoliša. BIOCENOZA, v. životna zajednica. BIOCID, kemijska tvar koja se u ratarstvu i šumarstvu primjenjuje za uništenje populacije različitih “štetnika”. To su herbicidi, insekticidi i fungicidi. BIODIVERZITET, v. biološka raznolikost. BIOGENI ELEMENTI, v. Dodatak 3. BIOGEOGRAFIJA, znanost koja proučava rasprostranjenost biljaka (geobotanika, fitogeografija, biljna geografija) i životinja (zoogeografija) na Zemlji i uzroke te rasprostranjenosti. BIOGEOKEMIJSKI CIKLUSI, tijek kruženja različitih kemijskih elemenata u biosferi. Najvažniji biogeokemijski ciklusi su ciklusi ugljika, vodika, kisika i dušika. BIOKATALIZATORI, v. enzimi. BIOLOGIJA, znanost koja proučava živa bića. Predmet proučavanja biologije veoma je širok pa se ona dijeli na veliki broj užih biologijskih znanosti: botanika, zoologija, anatomija, citologija, molekulska biologija, histologija, fiziologija, genetika, embriologija, ekologija, znanost o evoluciji, paleontologija, sistematika ili taksonomija i dr. BIOLOŠKA EVOLUCIJA, v.evolucija. BIOLOŠKA OKSIDACIJA, v. disanje. BIOLOŠKA RAZNOLIKOST (biodiverzitet), se odnosi na raznolikost svih živih bića, biljnih i životinjskih organizama, koja je značajna za održavanje biološke ravnoteže svih živih sustava na Zemlji. Biološka raznolikost ima ekološku, društvenu, gospodarsku, znanstvenu, obrazovnu, kulturnu, rekreacijsku i estetsku vrijednost,

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

Međunarodni dan biološke raznolikosti je 29. prosinca. BIOLOŠKI INDIKATORI ONEČIŠĆENJA, biljne i životinjske vrste koje su osobito osjetljive na različite oblike onečišćenja. Njihov nestanak s određenog područja ukazuje na određen stupanj onečišćenja tog područja. Biljke koje su poznati biološki indikatori onečišćenja su lišajevi i većina četinjača, npr. borovi. BIOMASA, broj jedinki neke vrste ili njihova ukupna masa u suhom ili svježem stanju na nekom prostoru. Biomasa je mjerilo gustoće svake populacije. BIOMI, posebne skupine ekosustava koje se nalaze u većem pojasu kopna gdje su obilježja podneblja prilično izjednačena. Postoji određena pravilnost u redoslijedu bioma od sjevernog pola pa do ekvatora, npr. najprije pojas tundre, zatim tajge, zatim pojas listopadnih šuma itd. BIOPROIZVODNJA, proizvodnja organskih spojeva tj. biomase kod autotrofa i heterotrofa. Razlikujemo primarnu i sekundarnu organsku proizvodnju, isp. BIOSFERA (grč. bios = život, sfaira = lopta), tanak površinski dio Zemlje u kojem su prisutne zajednice svih živih bića i u kojem je moguć njihov opstanak. Biosfera obuhvaća litosferu (površinski sloj Zemlje), hidrosferu (sve vode na Zemlji) i prizemni sloj atmosfere - troposferu. Čine je svi ekosustavi. BIOTIČKI ČIMBENICI, jedna od skupina ekoloških čimbenika. To su uzajamni odnosi jedinki istih vrsta i jedinki različitih vrsta, npr. simbioza, parazitizam, odnos predatora i plijena itd. BIOTOP, v. stanište. BJELANČEVINE, v. proteini.

BJELOOČNICA (sclera), bijela ovojnica koja obavija gotovo svu očnu jabučicu. Na prednjoj strani je prozirna rožnica (cornea). Ispod rožnice je šarenica (iris) s otvorom na sredini - zjenicom (pupilla). O količini pigmenta melanina u šarenici ovisi boja očiju. Šarenica refleksno stezanjem ili opuštanjem pupilarnih mišića otvara ili zatvara zjenicu, i time povećava ili smanjuje prolaz zraka svjetlosti u oko. To je tzv. pupilarni refleks odnosno prilagodba (adaptacija) oka na svjetlo ili tamu. BLASTOCEL, v. blastula. BLASTOCISTA, oblik zametka nastao na kraju procesa brazdanja zigote, a nalazimo ga isključivo u embrionalnom razvoju sisavaca (čovjeka). Blastocista ima oblik mjehurića sastavljenog od većeg broja stanica. Vanjski sloj stanica zove se trofoblast, a unutarnja masa stanica embrioblast. Blastocista čovjeka i drugih sisavaca odgovara blastuli nekih beskralježnjaka, npr. ježinaca i blastuli nižih kralježnjaka, npr. vodozemaca (žaba). BLASTODERMA, površinski sloj embrionalnih stanica koji okružuje šupljinu blastule. Nastaje za vrijeme brazdanja zigote, a u kasnijem stadiju embrionalnog razvitka iz njega će se razviti zametni listići: ektoderm, endoderm i mezoderm. BLASTOMERE, embrionalne stanice koje nastaju brazdanjem zigote. Te stanice izgrađuju površinski sloj blastule, blastoderm. BLASTOPORUS, otvor (uvrnuće) na površini gastrule vodozemaca koji vodi u šupljinu arhenterona ili pracrijeva. U vodozemaca nastaje na početku jednog od stadija embrionalnog ravoja nazvanog gastrulacija i to na taj način da se stanice animalnog pola utiskuju između ekvatora i vegetativnog pola blastule.


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

U embrionalnom razvoju ježinaca blastoporus također nastaje na početku gastrulacije ali na vegetativnom polu blastule. BLASTULA, rani oblik zametka mnogih višestaničnih životinja, npr. ježinaca, žaba, kojim završava proces brazdanja oplođene jajne stanice, zigote. Blastula ima oblik šuplje kugle, a sastoji se od površinskog sloja stanica (blastoderma) koji okružuje šupljinu ispunjenu tekućinom (blastocel). Na blastuli razlikujemo animalni pol gdje je smješten veći broj manjih stanica i nasuprot njemu vegetativni pol gdje je smješten manji broj većih stanica. U ježinaca se blastocel nalazi u centru blastule, a u vodozemaca (žabe) na animalnoj polovici blastule. BOČNA PRUGA, osjetilni organ kojim ribe osjećaju strujanje vode. To je cjevčica koja se pruža duž strana tijela, ispod ljusaka. Preko mnogih otvora u vezi je s okolnom vodom. U cjevčici su osjetni pupoljci sastavljeni od osjetnih stanica. Primaju podražaje od strujanja vode i prenose živcima u mozak. BOČNI (lateralni) MERISTEMI, skupina meristemskih stanice raspoređenih u obliku valjaka u stabljici i korijenu pomoću kojih biljka raste u širinu (sekundarni rast). BOĆATA (brakična) VODA, voda slanosti (saliniteta) između slatke i morske vode, a nastaje njihovim miješanjem. BODLJIKAŠI, morske životinje iz skupine malokolutićavaca. Najpoznatiji su ježinci, trpovi, zvjezdače i zmijače. Polusjedilački su oblici. Većina ima peterozrakastu (pentaradijalnu) simetriju. Ispod epiderme je unutarnji kostur od vapnenih pločica na kojem su često bodlje (npr. kod. ježinca). Kod trpova su u koži (tjelesnoj stijenci) osikule. Između bodlji nalaze se štipaljke ili pedicelarije. Na tijelu se razlikuje usna


ili oralna strana (uz podlogu) i suprotna, vršna ili apikalna strana na kojoj je crijevni otvor. Dobro je razvijen vodožilni ili ambulakralni sustav, isp. Živčani i optjecajni sustavi su zrakasto raspoređeni. Sastoje se od okoždrijelnog prstena i 5 zrakastih žila po tijelu. Dišu škrgama. Spolovi su razdvojeni. Oplodnja je vanjska. Iz oplođenog jajeta razvija se dvobočno simetrična slobodno plutajuća ličinka pluteus. Bodljikaši imaju veliku sposobnost regeneracije: zvjezdača može obnoviti krakove, a ježinac čahuru. BOGINJE (variola, crne boginje, velike boginje, šešva), vrlo teška zarazna bolest uzrokovana jednim iz skupine animalnih (životinjskih) virusa koji se širi dodirom ili kapljično. BOJENJE PO GRAMU, je vrsta bojanja heterotrofnih bezbojnih patogenih bakterija na temelju čega se dijele na grampozitivne i gram-negativne bakterije. One različito podnose tretman antibioticima. BORDOŠKA JUHA, v. peronospora. BOROVI, porodica drvenastih biljaka iz skupine četinjača (golosjemenjače). Najpoznatiji su rodovi: jela, bor, smreka, ariš i cedar. Listovi su igličasti. Ariš je jedina europska listopadna četinjača. Jela ima plosnate igličaste listove s dvije bijele pruge s donje strane, na grančicama poredane u dva reda, a češeri su uspravni. Smreku prepoznajemo po pravilnoj piramidalnoj krošnji, oštro igličastim listovima koji su u poprečnom prerezu četverobridasti i poredani okolo čitave grančice, te po češerima koji vise prema dolje. Listovi bora su također igličasti ali su, najčešće po dva, smješteni na kratkim ograncima. BOTANIKA, znanstvena disciplina koja se bavi proučavanjem biljnog svijeta.

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

BOTULIZAM, smrtno opasno trovanje otrovnim produktom koji luči bakterija Clostridium botulinum u loše konzerviranoj hrani ili mesu. BOWMANOVA ČAHURA, v. nefron. BRADIKARDIJA, stanje usporenog rada srca. Frekvencija pada ispod 60 otkucaja u minuti, manji je minutni volumen srca, pa tijelo pri povećanom opterećenju ne dobiva dovoljne količine krvi. BRADNJACI, v. malokolutićavci. BRAHIDAKTILIJA, nasljedni poremećaj izrazito kratih prstiju u ljudi. BRAKIČNA VODA, v. boćata voda. BRAZDANJE, početno razdoblje embrionalnog razvitka mnogih višestaničnih životinja, npr. ježinaca, žaba, u kojem se oplođena jajna stanica, zigota dijeli brzim uzastopnim mitotičkim diobama čime se broj novonastalih stanica povećava geometrijskom progresijom. Od jedne početne oplođene jajne stanice nastanu dvije stanice, od dvije stanice četiri, od četiri osam, od osam šesnaest stanica itd. Tijekom brazdanja zametak najprije poprima izgled ploda duda (lat. morus) pa se taj oblik zametka naziva morula. Na kraju procesa brazdanja zametak ima oblik šuplje kugle ispunjene tekućinom, a nazivamo ga blastula. BROGLIE, L. de, francuski fizičar koji je 1924 god. otkrio da čestice koje se gibaju velikom brzinom imaju svojstvo vala. Što je brzina gibanja čestica veća, kraća je njihova valna duljina. Njegovo otkriće posebno je bilo važno za izgradnju elektronskog mikroskopa. BRONHIOLI, tanke cijevčice, završni dijelovi sustava dušnica (bronha) u plućima, v. dušnik. Bronhioli završavaju proširenim plućnim mjehurićima ili alveolama.

BRONHITIS, upala sluznice glavnih dišnih putova (bronha i bronhiola). Kod akutnog bronhitisa upala je uzrokovana najčešće virusima i bolest načešće traje samo nekoliko dana. Kronični bronhitis uzrokovan je učestalim podraživanjem dišnih putova ili infektom ili drugim irititavnim čimbenicima (pušenje, onečišćen zrak). Označuje ga pretjerano lučenje sluzi u bronhima, sluznice bronha i bronhiola odebljaju , a dišne cijevi se začepe od stalne produkcije sluzi. Kašalj i iskašljavanje kod kroničnog bronhitisa traje najmanje tri mjeseca u godini i to dvije uzastopne godine. BROWN, R. (1773. – 1858.), britanski znanstvenik koji je 1831. god. otkrio staničnu jezgru. BRUSINA S. (1845.-1908), hrvatski zoolog, postavio temelje razvoju biologije u nas. Osnivač Hrvatskog prirodoslovnog društva. Posebno je proučavao recentne i izumrle mekušce. BRZINA SEDIMENTACIJE krvnih stanica ovisi o omjeru specifične težine krvnih stanica i specifičnoj težini plazme. Normalna brzina sedimentacije je od 2 do 10 mm na sat. Povećanu sedimentaciju izazivaju upale i trudnoća, dok novorođenčad imaju smanjenu. BUBREG, (ren), parni žljezdani organ koji izlučuje mokraću. Leže ispod ošita (dijafragme) s obiju strana kralježnice. Služi i za održavanje homeostaze. Kroz oba bubrega protječe u svakoj minuti oko 1200 mL krvi, odnosno oko 720 mL krvne plazme, a zadaća je bubrega regulirati i održavati stalnim koncentracijske odnose ione i vode u krvnoj plazmi. Bubrezima se izlučuju i sve suvišne i štetne tvari produkta metabolizma (ureja, bilirubin i drugi toksini). Bubrezi sudjeluju i u održavanju konstantnoga krvnoga tlaka, a posredno i u proizvodnji eritrocita, tako što luče hormon


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

eritropoetin koji stimulira koštanu moždinu. Bubrezi su sastavljeni od vanjske kore i srži raspoređene u piramide. Osnovna jedinica građe je nefron, isp. BUBRENJE, fizički proces; sposobnost krutih tvari da upijaju vodu i pritom povećavaju volumen. Neki biljni dijelovi (npr. sjemenke) ili čitavi biljni organizmi (npr. lišajevi) primaju vodu pretežno ili isključivo bubrenjem. Bubrenjem stanice mogu samo ograničeno primati vodu jer su obavijene čvrstom celuloznom stijenkom. Ulaženje vode povećava unutarnji tlak stanice, tzv. turgor. BUBREŽNI KAMENCI, počinju se razvijati iz sitne krute čestice koja se istaloži u bubrežnoj nakapnici uz koju se nakupljaju različiti minerali, npr. spojevi kalcija, pa kamenac postaje sve veći. BULBILI, rasplodni pupovi koji nastaju u pazušcu ili na rubu lista. Isp. vegetativno razmnožavanje.

C C 3 BILJKE, biljke u kojih prvi stabilni spoj koji nastaje u sekundarnim reakcijama fotosinteze (Calvinov ciklus) sadržava tri atoma ugljika.

CAM BILJKE (biljke s dnevnim kiselinskim ritmom), biljke koje noću primaju CO2 i ugrađuju ga u organske kiseline, a danju ga otpuštaju i upotrebljavaju u Calvinovom ciklusu. CAM biljke su sukulentne biljke prilagođene životu na suhim staništima (puči su danju zatvorene kako bi smanjile transpiraciju, noću otvorene), npr. kaktusi. CANIS LUPUS, stručni latinski naziv za vuka. CARSTVO, najviša i najšira jedinica u raspoređivanju živih organizama. Neki biolozi razvrstavaju organizme u dva osnovna carstva: biljno i životinjsko, a neki prema suvremenijim shvaćanjima u pet carstva: monera, protisti, gljive, biljke i životinje. Isp. filogenetski sustav. CELOM (sekundarna tjelesna šupljina), oblik tjelesne šupljine koja se razvija za vrijeme embrionalnog života, a obavijena je stanicama mezoderma. Celom postoji u razvijenih beskralježnjaka, npr. u bodljikaša, člankonožaca, kolutićavaca, djelomice i u mekušaca te u svih kralježnjaka (riba, vodozemaca, gmazova, ptica i sisavaca). CELULOZA, kemijski spoj koji nastaje međusobnim spajanjem 8 do 12 tisuća molekula šećera (saharida) glukoze pa stoga spada u skupinu polisaharida. Opća formula celuloze je (C6H10O5)n. Izgrađuje glavninu staničnih stijenki biljnih stanica.

CALVIN, M., (rođ. 1911.), američki biokemičar, otkrio puteve ugljika tijekom fotosinteze. Postigao rezultate koji su potvrdili rezultate Millera.

CENTRIOLI, stanični organeli valjkastog oblika građeni od tankih proteinskih cjevčica tzv. mikrotubula. Nalaze se u citoplazmi svih životinjskih stanica i nekih alga. Dolaze u paru, smješteni jedan u odnosu na drugi pod pravim kutom izgrađujući centrosom (isp.). Kao pojedinačna valjkasta tjelešca vidljivi su tek elektronskim mikroskopom.

CALVINOV CIKLUS, v. fotosinteza

CENTROMERA, v. pričvrsnica.

C 4 BILJKE, biljke u kojih sekundarne reakcije fotosinteze (Calvinov ciklus), odnosno sinteze ugljikohidrata, počinju sa spojem koji ima četiri atoma ugljika.


____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

CENTROSOM, stanični organel izgrađen od dva centriola (isp.) Nalazi se u citoplazmi svih životinjskih stanica i stanica nekih alga. Ima važnu ulogu u procesu diobe stanice gdje sudjeluje u formiranju diobenog vretena. Pod svjetlosnim mikroskopom centrosom se vidi kao svijetlo zrnce. CERKARIJE, v. ovčji metilj. CIJANOBAKTERIJE, v. modrozelene alge. CIJEPLJENJE, unašanje u organizam uzročnika bolesti ili njihovih produkata koji su izgubili patogeničnost (ne uzrokuju pojavu bolesti), ali su zadržali svoju antigeničnost (sposobnost imunizacije). Obvezno cijepljenje se u Hrvatskoj provodi već godinama protiv tuberkuloze, difterije, tetanusa, hripavca, rubeole, dlečje paralize i ospica. CIKAS, stara i razvojno primitivna golosjemenjača. Svojim velikim perastim listovima sliči palmi. Oplodnja se zbiva pokretnim muškim gametama, spermatozoidima. Podrijetlom je iz istočne Azije. CIKLUS LIMUNSKE KISELINE, v. Krebsov ciklus. CIRKADIJSKI RITMOVI (lat circa = približno, dies = dan), pravilni fiziološki ciklusi koji se ponavljaju u periodima od oko 24 sata. Prisutni u svih eukariota. Kod biljaka npr. periodično gibanje listova (danji i noćni položaj), puči i latica, aktivnost određenih enzima, odvijanje procesa fotosinteze i disanja. CIRKUMNUTACIJA, pojava obavijanja mladih vitica oko podloge zbog nejednakog rasta gornje i donje strane vitica. CIROZA JETRE, bolest postupnog propadanja funkcionalnog tkiva jetre. Najčešći uzrok ciroze u razvijenim zamljama je alkoholizam. Javljaju se izostanak apetita,

gubitak težine, mučnina, povraćanje, opća slabost, loša probava i nadutost. Kod osoba koje se ne mogu odreći alkohola, može potpuno zatajiti funkcija jetre sa smrtnim ishodom. CISTEIN, kemijski spoj iz skupine aminokiselina. CITOKINEZA, dioba stanične plazme koja uslijedi nakon diobe jezgre u mitozi i mejozi. CITOKININI, skupina biljnih hormona koji stimuliraju diobu stanica, odgađaju starenje, utječu na diferencijaciju, djeluju na sazrijevanje kloroplasta i sudjeluju u kontroli apikalne dominacije. Sintetiziraju se u tkivima koja aktivno rastu kao što su vrškovi korijena, embriji i plodovi. CITOKROMI, bjelančevine koje sadržavaju željezo; dio transportnog lanca elektrona u mitohondrijima i kloroplastima. CITOLOGIJA, znanost koja proučava građu i funkciju stanice. Najvažnije spoznaje s područja citologije dobijene su upotrebom svjetlosnog i elektronskog mikroskopa. CITOLOŠKE METODE, znanstvene metode koje se primjenjuju u istraživanjima građe i funkcije stanica. To su: svjetlosna mikroskopija, elektronska mikroskopija, autoradiografija, kultura stanica i tkiva i dr. CITOPLAZMA, osnovna tekuća faza stanice u kojoj se nalaze organeli. CITOPLAZMATSKO NASLJEĐIVANJE, nasljeđivanje osobina koje su determinirane izvankromosomskim genima koji se nalaze u citoplazmatskim organelima kao što su mitohondriji i kloroplasti. CITOSKELET, sustav tankih proteinskih vlakana i cjevčica u citoplazmi. On daje stanici mehaničku strukturu, omogućuje


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

joj da zadrži svoj oblik, da ga mijenja, da se pomiče itd. CITOSOL, osnovna vodena koloidna otopina stanice koja preostane nakon odvajanja organela centrifugiranjem. CITOSTATICI, lijekovi kemijske proizvodnje koji se koriste u liječenju zloćudnih bolesti (kemoterapiji). CITOZIN, organski spoj s dušikom iz skupine pirimidinskih baza. Sudjeluje u izgradnji nukleotida odnosno nukleinskih kiselina.






H CORPUS ALBICANS, v. bijelo tijelo. CORPUS LUTEUM, v. žuto tijelo. CRICK, F., (rođ. 1916.), britanski fizičar koji je zajedno s američkim biologom Watsonom 1953. god. opisao strukturu molekule DNA. CRIJEVNI NAMETNICI, nametnici koji mogu s hranom dospijeti u čovjekovo probavilo u obliku jaja ili ličinke. Nametnici mogu biti oblići (Nematodes) i trakavice (Cestodes). U tankom crijevu, osobito djece, može živjeti nametnik obična ili dječja glista (Ascaris lumbricoides), isp. Uzrokuju slabokrvnost, povraćanje, mučninu i grčeve crijeva. Trakavice nastanjuju pretežno tanko crijevo. Najčešće su goveđa (Taenia sagata) i svinjska (Taenia solium) trakavica, isp. CRNE BOGINJE, v. boginje. CROSSING OVER, v. krosingover.


CRVENE ALGE, sadrže i druge boje osim klorofila, posebno crveni pigment, fikoeritrin. Te im boje omogućuju kromatsku adaptaciju. Odlikuju se posebnim oblikom razmnožavanja, spolnog gametama i nespolnog sporama pri čemu su rasplodne stanice uvijek nepokretne, tj. bez bičeva. To upućuje na srodnost s modrozelenim algama. Iz crvenih alga dobiva se agar, insekticid (zamjena za DDT), floridejski škrob (produkt fotosinteze) itd. Crvene alge roda Lithothamnion talože u svoje stijenke vapnenac pa je kao rezultat nagomilavanja u slojeve nastao litotamnijski vapnenac. CRVENE KRVNE STANICE, v. eritrociti i krvna tjelešca CRVOTOČINE, biljke iz skupine papratnjača. U crnogoričnim šumama raste prava crvotočina, a selagina ispod grmova u primorskim krajevima. Osim puzajućih stabljika imaju uspravne ogranke koji završavaju češerićima sa sporangijima i sporama. Kod selagine u izmjeni generacija sudjeluju dvovrsne spore i dva različita gametofita (muški i ženski). CVAT, skupina cvjetova na zajedničkoj cvjetnoj stapci. Po obliku razlikujemo: glavicu, grozd, klas, resu, štitac i gronju itd. (v. shematski crtež češćih cvatova). Vrijeme cvatnje je produženo jer svi cvjetovi jednog cvata ne cvatu istovremeno. Oblik cvata često karakterizira cijele porodice cvjetnica. CVIJET, generativni organ biljke kritosjemenjače. Sastoji se od cvjetne stapke, cvjetišta, ocvijeća, prašnika i tučka. Cvijet se nalazi na zadebljanom kraju cvjetne stapke, cvjetištu. Ocvijeće zaštićuje tučak i prašnike te primamljuje kukce oprašivače. Može biti razlučeno u čašku i vjenčić. Čaška se najčešće sastoji od zelenih listova (lapovi) koji prvenstveno štite cvjetni pup. Listovi vjenčića su latice. Ocvijeće čiji listovi izgledaju jednako zove se perigon,

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

a listovi tepala. Perigon i vjenčić mogu biti različito obojeni (ako se oprašuju kukcima) ili neugledni ako se oprašuju vjetrom. Cvjetovi su po izgledu višesimetrični ili jednosimetrični. Vjenčić je mnogih cvjetova prostolatičan, a drugih sulatičan (od sraslih latica). U nekih kritosjemenjača cvjetovi dolaze pojedinačno, a u drugih su skupljeni u cvat. Ženski je dio cvijeta tučak, a muški su prašnici. Cvjetovi mogu biti dvospolni (imaju i tučak i prašnike) ili jednospolni (imaju ili tučak ili prašnike). Biljke na kojima se razvijaju i ženski i muški cvjetovi nazivaju se jednodomne biljke. Dvodomne su biljke one koje imaju samo muške ili samo ženske cvjetove.






6 5



Shematski crteži češćih cvatova: 1-grozd, 2-sastavljeni grozd, 3-gronja, 4-klas, 5-sastavljeni klas, 6-klip, 7- štitac, 8sastavljeni štitac, 9-glavica

Č ČEMPRESI, porodica biljaka iz skupine četinjača (golosjemenjače). To su stabla ili grmovi s igličastim ili ljuskavim listovima. Ovamo ubrajamo: čempres, borovicu i tuju. Češeri čempresa i tuje su tvrdi, drvenasti i okruglasti. Borovica ima mesnate, sočne češeriće koje sliče na bobu i zovu se pupuljice. ČETINJAČE, s nekoliko stotina vrsta najzastupljenija skupina golosjemenjača. Drvenaste biljke, većina sadrži smolu. Listovi su uglavnom tvrdi, igličasti ili ljuskavi; u pravilu vazdazeleni. Najčešće dolaze u okviru šumske vegetacije sjeverne polutke, kao stabla (ponekad vrlo visoka) ili grmovi. Cvjetovi su jednospolni. Muški su u obliku resa, obično maleni i mekani, a sastoje se od prašničkih listova s peludnicama (mikrosporangijima). Ženski cvjetovi sastoje se od plodnih (sjemenih) ljusaka sa "golim" sjemenim zamecima jer nisu zatvoreni unutar plodnice. Poslije oplodnje razvija se sjemenka, a ženski češer postaje tvrd i drvenast. U hrvatskoj flori zastupljene su s oko dvadesetak vrsta unutar porodica: borovi, čempresi i tise. Među četinjače pripadaju i najstarija drveća na svijetu (mamutovci, do 4000 godina) te najviša stabla (sekvoje, više od 80 m). ČETKASTI KROMOSOMI (lump brush kromosomi, kromosomi s petljama), kromosomi specifičnog izgleda koji se vide za vrijeme diobe stanice i to u profazi mejoze I u mnogih organizama, npr. jaju vodozemaca. S takvih kromosoma protežu se bočno niti koje se šire u petlje, a građene su od DNA. ČIR DVANAESNIKA, duodenalni ulkus, ozlijeđeno mjesto na sluznici dvanaesnika. Najčešći uzrok nastanka čira na dvanaesniku je djelovanje kloridne kiseline koja


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

himusom prelazi iz želuca u duodenum. Javljaju se boli i grčevi u trbušnoj šupljini. Čir dvanaesnika češći je u pušača cigareta, kao i u osoba s pojačanim izlučivanjem kiseline u želucu (hiperaciditet). ČIR ŽELUCA, peptički ulkus, teže ozlijeđeno mjesto u sluznici želuca. Uzroci su uglavnom isti kao oni koji dovode do gastritisa. Kod čira želuca javlja se tupa žareća bol u gornjem dijelu trbušne šupljine. U težim slučajevima može nastati krvarenje iz čira. ČISTA LINIJA, skup genetičkih vrlo sličnih jedinki koje su nastale samooplodnjom jednog roditeljskog organizma. Takvi se slučajevi pojavljuju gotovo isključivo u biljaka. ČLANKONOŠCI (Arthropoda), beskralješnjaci iz skupine malokolutićavaca. Najbrojnija životinjska skupina kojoj pripadaju: klještari, rakovi i uzdušnjaci (stonoge i kukci). Nastanjuju sva moguća staništa. Osnovno obilježje su člankovite noge. Tijelo je pokriveno hitinskom kutikulom, često pojačanom vapnencem, odnosno vanjskim kosturom ili egzoskeletom (npr. kod rakova). Kolutići su se stopili u (dvije ili tri) cjeline: glavu, prsa i zadak. Živčani sustav je ljestvičav. Najvažnija osjetila su ticala i oči. Dišu škrgama i uzdušnicama (trahejama). Optjecajni sustav je otvoren. Dišni pigment je hemocijanin. Za izlučivanje služe ticalne žlijezde (preobraženi metanefridiji) ili Malpighijeve cjevčice. Razdvojenog su spola. ČOVJEČJA RIBICA, vodozemac iz skupine repaša. Živi u podzemnim vodama krškog područja i poznati je naš endem. Zbog stalnog boravka u mraku, koža joj je blijeda, a oči zakržljale. U staništima s temperaturom ispod 15 oC rađa žive mlade dok u toplijoj vodi odlaže jaja. Imaju vanjske škrge koje se zadrže tijekom čitava života, v. repaši.


ČOVJEK, KROMOSOMSKA GARNITURA, svi kromosomi pojedine stanice čovječjeg organizma. U tjelesnim stanicama čovjeka ima 46 kromosoma (diploidan broj) od kojih su 44 autosomi (ne određuju spol), a 2 spolni kromosomi. Žene imaju 44 autosoma i 2 x spolna kromosoma, a muškarci 44 autosoma, 1 x i 1 y spolni kromosom. U gametama ili spolnim stanicama čovjeka nalaze se 23 kromosoma (haploidan broj) od čega su 22 autosoma i 1 spolni kromosom. Tako ženske gamete ili jajne stanice sadrže 22 autosoma i 1 x spolni kromosom, a muške gamete ili spermiji sadrže 22 autosoma i 1 y spolni kromosom ili 22 autosoma i 1 x spolni kromosom. Broj kromosoma može biti i nenormalan, tj. veći ili manji od navedenog što uzrokuje pojavu različitih anomalija pa i smrti. Poznate su posljedice pogrešnog broja spolnih kromosoma: individue sa samo 1 x spolnim kromosomom bez para (xo) su ženske, ali nerazvijene i neplodne. Individue s xxy spolnim kromosomima su muške, ali neplodne i s nešto ženskih osobina. ČUČAVCI, mladunci nekih vrsta ptica (npr. ptica pjevica, golubova, kukavica, sokolovki) koji se izlegu slijepi, bez perja i nesposobni za samostalni život. Njih roditelji moraju hraniti sve dok ne napuste gnijezdo. ČUPAVO KORIJENJE, v. korijen.

D DALEKOVIDNOST (hipermetropija, hiperopija), poremećaj vida u kojem je očna jabučica prekratka. Pri akomodaciji leće, slika pada iza mrežnice, te je neoštra. Da-

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

lekovidnost se ispravlja konveksnim lećama (pozitivna dioptrija).

DEMOGRAFIJA, znanost o kretanju broja stanovnika na Zemlji.

DALTONIZAM, v. sljepoća na boje.

DENDRITI, v. živčana stanica.

DANIELLI, J.F. i DAVSON, H.A. znanstvenici koji su 1936. god. predložili model membrane prema kojem se dvosloj lipida nalazi između dva sloja bjelančevina. DARWIN, Ch., (1809. – 1882.), engleski prirodoslovac, utemeljitelj selekcijske teorije evolucije.

DENITRIFIKACIJA, proces kojim se amonijak (koji nije pretvoren u nitrate procesom nitrifikacije) cijepa na slobodni dušik i vodik, te oba plina odlaze u zrak (atmosferu). Proces se odvija djelovanjem bakterija, naročito nekih anaerobnih, npr.u muljevitom i u vodom natopljenom tlu.

DAVSON, H.A., v. Danielli, J.F.

DENITRIFIKACIJA, v. nitrifikacija.

DAŽDEVNJACI, v. repaši.

DEOKSIRIBOZA, v. dezoksiriboza.

DDT, diklor-difenil-trikloretan, insekticid. DEBELO CRIJEVO, cjevasti organ probavnog sustava, nastavak tankog crijeva, dugačko je 1,5 do 2 metra. Dijeli se na početni dio ili slijepo crijevo (caecum) na kojem se nalazi crvuljak (apendix), zatim na kolon (colon) i završava završnim crijevom (rectum) i čmarom (anus). Stijenke debelog crijeva građene su poput stijenki tankog crijeva, ali bez crijevnih resica i s manje žljezdanih stanica. Aktivnost debelog crijeva sastoji se od primanja himusa iz tankog crijeva, lučenja sluzi, reapsorpcije vode i minerala, te bakterijskog truljenja ostataka neprobavljene hrane, inaktiviranje štetnih produkata probave (indol, fenol, skatol), sinteze vitamina, formiranje i nakupljanje stolice (feces), te refleksnog i kontroliranog pražnjenja crijeva (defekacija). DECIDUA STANICE, stanice vanjskog sloja sluznice maternice koje sadrže hranjive tvari potrebne za razvitak zametka u ranim stadijima embrionalnog razvitka. DELECIJA, mutacija nastala gubitkom dijela kromosoma. DEM, v. vrsta. DEMEREC, M., (1895. – 1966.), hrvatski genetičar, koji se rodiou SAD, zaslužan za industrijsku proizvodnju antibiotika.

DEOKSIGENIRANA KRV (reducirana krv), krv koja transportira ugljikov dioksid prema plućima. Ugljikov dioksid se transportira na tri načina: mala količina je otopljena u krvnoj plazmi, dio je vezan na globinski dio molekule hemoglobina kao karbaminohemoglobin, a najveća količina se prenosi u obliku karbonatne kiseline. DEPLAZMOLIZA, pojava povećavanja obujma vakuole te potiskivanje protoplasta prema staničnoj stijenci. Kada je stanica u hipotonočnoj otopini, voda ulazi u stanicu i vakuolu, tj. mjesto niže koncentracije vode. Suprotan proces je plazmoliza. DEZOKSIRIBONUKLEINSKA KISELINA, v. DNA. DEZOKSIRIBOZA, kemijski spoj iz skupine monosaharida (jednostavnih šećera) pentoza opće formule C5H10O4, a strukturne: HOCH2 H H







Izgrađuje nukleotide dezoksiribonukleinske kiseline (DNA).


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

DIFERENCIJACIJA STANICA, proces usvajanja raznolikosti među identičnim stanicama, odnosno proces kada se od istih početnih stanica postupno razvijaju različite vrste stanica (po obliku, funkciji i molekulskom sastavu) koje se tako specijaliziraju za točno određenu funkciju u složenom biljnom i životinjskom organizmu. Tako, u biljaka iz meristemskih (embrionalnih) stanica nastaju stanice epiderma, korijenove dlačice, sitaste stanice, stanice zapornice itd., a u životinja diferencijacijom nastaju epitelne, živčane, koštane, krvne i druge stanice. DIFERENCIJALNA AKTIVNOST GENA, pojava aktivnosti samo male specifične skupine gena u nekoj stanici. Naime, svaka od diferenciranih stanica ima u sebi aktivnu samo malu, ali različitu skupinu gena koja određuje njezinu specifičnu građu i funkciju. Ova pojava tumači na koji način stanice koje u sebi imaju iste gene mogu biti po svom obliku i funkciji potpuno različite. Epitelna, mišićna, živčana i druge diferencirane stanice nose iste gene kao i stanica (zigota) od koje su nastale mitotičkim diobama. DIFERENCIJALNA KRVNA SLIKA (DKS), sastav različitih vrsta leukocita u krvi. Isp. leukociti. DIFUZIJA, proces gibanja čestica neke tvari iz područja njihove veće koncentracije u područje manje koncentracije do izjednačavanja koncentracije. DIHIBRIDNO KRIŽANJE S DOMINACIJOM, jedna od vrsta križanja (isp.) u kojem se prati nasljeđivanje dvaju svojstava. Za svako svojstvo postoje dominantni i recesivni aleli. Dominantni dolaze uvijek do izražaja u fenotipu, a recesivni samo ponekad (u slučaju homozigotnosti). U prikazima križanja početna roditeljska (parentalna) generacija označuje se uvijek s P, a generacije potomaka (filijal-


ne) prema redoslijedu s F1, F2, F3 itd. Aleli pojedinih svojstava označuju se slovima i to dominantni velikim slovima, a recesivni malim, npr. za jedno svojstvo A i a, a za drugo svojstvo B i b. Primjer: Dihibridno križanje pjegavog crnog i jednobojnog smeđeg goveda gdje su aleli za crnu boju i za jednobojnost dominantni, a jedinke u oba svojstva homozigotne (isp.). U ovom slučaju u P generaciji stvaraju se dvije vrste gameta, Ab i aB, a sve jedinke F1 generacije su crne i jednobojne (AaBb) jer se geni za vrstu i raspored boje nasljeđuju nezavisno jedan o drugome. U F1 generaciji stvaraju se 4 vrste gameta (AB, Ab, aB, ab), a njihovim međusobnim križanjem u F2 generaciji (tablični prikaz) nastaje 4 različita fenotipa u omjeru 9:3:3:1. Dobivamo 9 crnih i jednobojnih jedinki, 3 crne i pjegave jedinke, 3 smeđe i jednobojne jedinke i 1 jedinka potpuno novog fenotipa, smeđe pjegavo govedo. U F3 generaciji, unatoč velikom broju gameta, broj fenotipova se ne povećava. (v. shemu u Dodatku 1) DIJABETES, v. šećerna bolest. DIJAFIZA, v. kost. DIJALIZA, postupak razdvajanja tvari kada molekule jedne otopljene tvari iz područja veće koncentracije prelaze u područje manje koncentracije kroz polupropusnu membranu kroz koju ne mogu proći molekule druge tvari. Njezinu praktičnu primjenu nalazimo pri liječenju teških bubrežnih bolesnika kojima se kroz umjetne probirne membrane u hemodijalizatoru (umjetni bubreg) iz krvi izdvajaju samo relativno male molekule štetne uree. DIJASTOLA, razdoblje kada je srce u relaksiranom stanju pa se klijetke pune krvlju.

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

DIJASTOLIČKI TLAK, tlak koji preostaje nakon prolaska sistoličkog tlaka (isp.) kroz arterije. DIJATOMEJSKA ZEMLJA, v. kremenjašice. DIKTIOSOMI (grč. diktyion – mreža i soma – tijelo), sastavni dijelovi Golgijeva tijela. Građeni su od plosnatih šupljina (Golgijevih cisterni) naslaganih jedna iznad druge, a odvojenih membranama. Promjer im je oko 1 μm. Na rubovima su šupljine proširene i od njih se odvajaju Golgijevi mjehurići obavijeni membranom. DIOBENO VRETENO, organizirani niz mikrotubula (sitnih proteinskih cjevčica) koje svaraju centrioli za vrijeme diobe stanice (mitoze, mejoze). Njegova je uloga da veže kromosome i omogući njihovo razdvajanje i kretanje prema suprotnim polovima stanice. DIPLOIDNA GENERACIJA, v. haploidna generacija. DIPLOIDNE STANICE, stanice koje imaju dvostruki broj ili diploidan broj (2n) kromosoma. Kromosomi u takvim stanicama smješteni su u homologne parove gdje je svaki član para nasljeđen od jednog roditelja. Diploidne stanice su sve tjelesne stanice onih organizama koji su nastali od dvaju roditelja oplodnjom. Takve stanice dijele se mitozom odnosno staničnom diobom koja omogućuje stvaranje novih stanica s jednakim, konstantnim brojem kromosoma koji je karakterističan za svaku vrstu. DIPLOIDNI BROJ KROMOSOMA (dvostruki broj kromosoma), se javlja u stanicama biljaka i životinja i to tako da kromosomi uvijek dolaze u parovima, tzv. homolognim parovima. Jedan član para podrijetlom od oca, a drugi član para od majke, npr. tjelesne stanice čovjeka imaju

23 para, tj. 46 kromosoma, 23 od oca, 23 od majke (2n=46, n=23); stanice vinske mušice imaju 8 kromosoma (2n=8, n=4), psa 78 (2n=78, n=39), konja 60 (2n=60, n=30), čimpanze 48 (2n=48, n=24), kukuruza 20 (2n=20, n=10), rajčice 24 (2n=24, n=12), kruške 34 (2n=34, n=17) itd. DIPLOKOKI, v. bakterije. DISAHARIDI, v. ugljikohidrati. DISANJE (respiracija), Postoje dva oblika disanja, stanično i vanjsko disanje. Stanično disanje (biološka oksidacija) je proces koji se odvija u biljnim i životinjskim stanicama, a u kojem se organski spojevi, uz prisutnost enzima disanja, postupno oksidiraju do ugljik(IV) oksida (ugljikovog dioksida) i vode pri čemu se oslobađa velika količina energije. 56 % energije se oslobodi u obliku topline, 46 % se pohranjuje u molekulama ATP-a. Energija oslobođena staničnim disanjem koristi se za sve životne aktivnosti stanice. Najčešći i najvažniji organski spojevi koji su

Stanično aerobno disanje


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

izvori energije u stanici su ugljikohidrati, zatim masti, a u manjoj mjeri i proteini. Disanje možemo grubo predočiti kemijskom jednadžbom:

C6H12O6 + 6O2 → 6CO2 + 6H2O + + energija Stanično disanje je vrlo složen proces koji se u većine organizama može podijeliti na anaerobnu i aerobnu fazu. Anaerobnu fazu disanja čini glikoliza, a aerobnu fazu Krebsov ciklus ili ciklus limunske kiseline i oksidativna fosforilacija. Vanjsko disanje je proces izmjene plinova (O2 i CO2) između vanjske sredine, zraka ili vode, i organizma. Ovaj oblik disanja odvija se u različitim organima za disanje, npr. plućima, škrgama, koži itd. DIŠNI (respiratorni) SUSTAV, zajedno s krvožilnim omogućuje svim stanicama tijela izmjenu plinova, dobivanje potrebnih količina kisika i odstranjivanje ugljikova dioksida. Sastoji se od gornjih dišnih putova (nosa, ždrijela i grkljana) i donjih dišnih putova (dušnika, dušnica i pluća). DIURETICI, sredstva koja ubrzavaju i povećavaju odstranjivanje mokraćom viška vode iz tijela. Smanjujući volumen vode u krvi, snizuju krvni tlak. Diuretici inhibiraju lučenje antidiuretskog hormona (ADH), isp. DIUREZA, povećano lučenje vode tj. odstranjivanje viška vode iz tijela mokrenjem. DIURNALNE ŽIVOTINJE, v. dnevne životinje. DIVERGENTNA EVOLUCIJA (račvasta, specijacija u užem smislu riječi), evolucijski razvoj koji vodi k nastajanju nekoliko novih vrsta u kojih su populacije prostorno odvojene jedna od druge. U svakoj odvojenoj populaciji može se događati sukcesivna evolucija.


DIZENTERIJA (srdobolja, griža) je crijevna zarazna bolest praćena proljevom (dijarea) i bolovima u trbušnoj šupljini s inkubacijom 2 do 7 dana. Najčešći uzročnik je bacil roda Shigellae koji napada sluznicu debelog crijeva. Ako je dizenterija uzrokovana amebama tada govorimo o amebnoj dizenteriji. DJEČJA GLISTA, nametnik u crijevu čovjeka. Pripada oblićima, skupina oblenjaci, isp. Anaerobionti su. Tijelo je dužine i do 50 cm. Razdvojenog su spola. Tijelo mužjaka je manje i zavinuto na stražnjem dijelu. Rasplodni su im organi neparni cjevasti sjemenik i sjemenovod. Ženke imaju parne cjevaste jajnike, jajovode i plodnice (maternica ili uterus) i oplodnja je unutarnja. Oplođena jaja ženka izbacuje u crijevo domadara. Čovjek se zarazi prljavim rukama te jedući neoprano voće i povrće. DJEČJA PARALIZA (polio, poliomyelitis, poliomijelitis), zarazna bolest koju uzrokuje životinjski (animalni) virus, poliovirus koji napada središnji živčani sustav i izaziva klijenut (paralizu) udova. DJEVIČANSKI ZALISTAK, v. himen. DLAKE, rožnate tvorevine kože koje pokrivaju tijelo sisavaca i štite ih od gubitka topline. Većina sisavaca ima pokrivne dlake ili osje koje su čvršće i veće, a ispod su manje i slabije dlake tzv. malje. Dlake su građene od dlačnog korijena sastavljenog od dlačnog stručka i dlačne glavice. Uložene su u dlačne mješčiće t.j. uvrate pousmine u usminu. Svaka dlaka ima svoj dlačni mišić tako da se sisavci mogu nakostriješiti. Dlake mogu biti preobražene u čvrste četine (kod npr. svinje) ili u bodlje (kod npr. ježa i dikobraza). DNA (DNK, dezoksiribonukleinska kiselina), organska makromolekula koja se nalazi u jezgri stanice, u mitohondrijima i

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

plastidima. DNA se sastoji od dva polinukleotidna lanca koji su nastali povezivanjem velikog broja nukleotida kao osnovnih građevnih jedinica nukleinskih kiselina. Svaki nukleotid DNA građen je od triju vrsta molekula: šećera dezoksiriboze, fosfata i jedne purinske baze (adenin ili gvanin) ili pirimidinske baze (timin ili citozin). Nukleotidi u jednom lancu međusobno se vežu tako da se fosfat jednog veže sa šećerom drugog nukleotida, a dva polinukleotidna lanca se vežu međusobno preko dušičnih baza vodikovim vezama. Purinska baza jednog lanca uvijek se veže s odgovarajućom pirimidinskom bazom drugog lanca. Polinukleotidni lanci su spiralno zavijeni oko zamišljene središnje osi tako da molekula DNA izgleda poput dvostruke zavojnice (heliksa) čiji je promjer 2 nm. DNA je jedina organska molekula koja ima sposobnost umnožavanja ili replikacije i to na taj način da od jedne ishodišne molekule DNA nastanu dvije potpuno jednake molekule. Način umnožavanja DNA zovemo polukonzervativno udvostručavanje, zbog toga što je u sastavu novonastalih molekula DNA jedan lanac “stari”, odnosno potječe od ishodišne molekule, a drugi lanac je novoizgrađen i to prema kalupu starog. HN H









D p


C H3













D p

D = dezoksiriboza, C = citozin, G = gvanin, T = timin, A = adenin, P = fosfatni ostatak

DNA je jedna od najvažnijih staničnih makromolekula jer izgrađuje gene te je

nositelj nasljeđivanja, a odgovorna je i za sintezu proteina. DNEVNE (diurnalne) ŽIVOTINJE (diurna, lat. dies = dan), životinje koje su danju aktivne. To je većina životinja, npr. većina kukaca, ptica i sisavaca. DNEVNO NEUTRALNE BILJKE, biljke na čije cvjetanje ne utječe fotoperiod (npr. krastavac i kukuruz). DNK, v. DNA DOJENJE, izlučivanje mlijeka iz žljezdanih stanica dojke kao reakcija na podražaj djeteta pri sisanju. Hormoni koji omogućuju dojenje su prolaktin i oksitocin. Prolaktin se izlučuje u velikim količinama u adenohipofizi (prednjem režnju hipofize) kao reakcija na smanjenu količinu estrogena i progesterona u krvi majke, a koja se smanjuje zbog gubitka posteljice nakon rođenja djeteta. Pri sisanju dijete podražuje osjetilna tjelešca u bradavici dojke i ti podražaji dolaze do hipotalamusa koji luči specifične neurohormone koji pak neurohipofizu potiču na lučenje oksitocina. Oksitocin u dojkama uzrokuje stezanje mjehurića punih mlijeka i potiskivanje mlijeka u kanaliće dojki do bradavica. U prvih nekoliko mjeseci dojenja obično izostaje menstrualni ciklus. DOMINANTNE VRSTE u biocenozi, vrste koje prevladavaju brojnošću ili biomasom. Te su vrste najbolje prilagođene uvjetima biotopa, kao npr. hrast u hrastovoj šumi. DOMINANTNO SVOJSTVO (prevladavajuće svojstvo), svojstvo koje u nasljeđivanju uvijek dolazi do izražaja. U literaturi, dominantna svojstva se označavaju velikim slovima. DORMANCIJA (stanje mirovanja), razdoblje u kojem je rast biljaka ili nekih


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

njezinih dijelova privremeno prekinut ili jako usporen. Razlikujemo nametnutu ili prisilnu dormanciju (izravno ovisi o nepovoljnim okolišnim uvjetima) i prirođenu ili endogenu dormanciju (uzroci su u samoj sjemenci ili pupu; npr.stvaranje zimskih pupova). DOWNOV SINDROM (mongolizam), poremećaj izazvan trisomijom (na 21. kromosomu tri kopije kromosoma). DRIFT (genska snaga, genska slučajnost), jedna od pokretačkih sila evolucije. To je pojava kada neki mutirani recesivni gen u populaciji može doći do izražaja u potomstvu ili se može izgubiti ne pojavivši se više u potomstvu. Genska snaga učestala je pojava u malim populacijama. DRIOPITEKUS (Dryopithecus), šumskog pramajmuna čiji su ostaci na više mjesta u Europi, Aziji i Predstavlja ishodišnu skupinu za čovjekolikih majmuna (čimpanza, orangutana).

oblik nađeni Africi. razvoj gorila,

DROSOPHILA MELANOGASTER, v. vinska mušica. DRUGA MEJOTIČKA DIOBA, v. mejoza II. DRUGI BUBREG (prabubreg ili mezonefros), parni organ tamnocrvene boje, služi za izlučivanje kod riba i vodozemaca. Kod riba je smješten uz kralježnicu iznad plivaćeg mjehura, a kod vodozemaca na leđnoj strani stražnjeg dijela tjelesne šupljine. Klupka krvnih kapilara (glomeruli) se spuštaju u lijevke koje zovemo Bowmanova čahura. Predbubrežna cijev (v. prvi bubreg) se podijeli po dužini u dvije. Jedna od njih postaje prabubrežna ili Wolfova cijev, koja u mužjaka služi kao mokraćovod i sjemenovod, a u ženke samo kao mokraćovod. Druga ostaje predbubrežna


ili Mullerova cijev koja u ženke preuzima ulogu jajovoda, a kod mužjaka zakržlja. DUCTUS DEFERENS, v.sjemenovod. DUODENUM, v. dvanaesnik. DUŠIČNE BAKTERIJE, v. dušikove bakterije. DUŠIČNE BAZE, organski dušikovi spojevi koji sudjeluju prvenstveno u izgradnji nukleotida odnosno nukleinskih kiselina i ATP-a. Postoje purinske (adenin i gvanin) i pirimidinske (timin, citozin, uracil) dušične baze. DUŠIKOVE (dušične, nitrificirajuće) BAKTERIJE, fiksatori atmosferskog dušika. Različite autotrofne kemosintetske bakterije koje žive slobodno u tlu. (Azotobacter) ili u simbiozi s višim biljkama. U korijenskim gomoljićima mahunarki nalaze se simbiotske bakterije roda Rhizobium. Bakterije uzimaju dušik iz zraka i pretvaraju ga u amonijeve ili nitratne spojeve koje biljke mogu koristiti za izgradnju svojih aminokiselina, proteina i nukleinskih kiselina. Imaju i sposobnost pretvaranja amonijaka, koji nastaje raspadanjem uginulih organizama, do nitrata. DUŠNICA, v. uzdušnice. DUŠNIK (trachea), cijev koja je u u čovjeka duga oko 12 cm, a u stijenci ima hrskavične prstenove. Grana se u lijevu i desnu dušnicu (bronhi) koje ulaze u lijevo odnosno desno plućno krilo. Dušnice se u plućima granaju u bronhiole koje završavaju plućnim mjehurićima. DVANAESNIK (duodenum), početni dio tankog crijeva, isp. U njega se ulijevaju izvodni kanali jetre i gušterače kojima se u crijevo dovode žuč i gušteračin sok. DVOBOČNA (bilateralna) SIMETRIJA, simetrija kod koje se tijelo može podijeliti jednom ravninom na lijevu i desnu po-

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

lovicu. Bilateralno simetrične životinje su pokretne. DVODIHALICE, stara skupina riba (iz devona), živi fosili. Pripadaju skupini nosnoprolaznica, isp. Plivaći se mjehur razvio u pluća, kao prilagodba na sušna razdoblja. Dvodihalice inače dišu škrgama. Poznate su vrste: afrička, australska i južnoamerička dvodihalica. DVODOMNE BILJKE, v. cvijet. DVOIMENO NAZIVLJE, v. binomna nomenklatura. DVOJNA DIOBA, oblik nespolnog razmnožavanja u kojem se matična jedinka dijeli na dva dijela pri čemu ona sama nestaje kao jedinka. Dvojnom diobom se razmnožavaju uglavnom jednostanični organizmi: neke jednostanične alge, neke vrste bakterija i mnoge praživotinje. DVOJNO NAZIVLJE, v. binomna nomenklatura. DVOSPOLAC (hermafrodit), kod životinja organizam koji ima i muške i ženske spolne žlijezde (sjemenike i jajnike) u kojima se proizvode spermiji i jaja. Česta pojava kod bezkralježnjaka, npr. spužve, plošnjaka, nekih puževa i kolutićavaca.

Osobine dvosupnica Dvije supke u sjemenci; Embrio centralno (u sredini) smješten u sjemenci; Žile u stabljici smještene u krugu; Žile otvorene, tj. s kambijem; Imaju sekundarni rast u debljinu; Nervatura lista perasta ili dlanasta, među ograncima žila međusobno mrežasto povezane žilice; Ocvijeće razlučeno u čašku i vijenčić; Ocvijeće i prašnici većinom s 4 ili 5 članova u krugu.

E EGZOCITOZA, proces u kojem se čestice izbacuju iz stanice u međustanični prostor, tj. oblik masovnog transporta tvari kroz membranu stanice pomoću membranskih mjehurića koji se stapaju sa staničnom membranom. Suprotan proces je endocitoza. EGZOKONJUGANTI, v. konjugacija. EGZOSKELET, v. kostur.

DVOSTRUKA DIOBA, v. dvojna dioba.

EHINOKOK, v. pasja trakavica.

DVOSTRUKA MEMBRANA, građena od vanjske i unutarnje membrane, a imaju je jezgra, mitohondriji i plastidi.

EIGEN, M. postavio genetičku hipotezu o izgledu i funkcioniranju prvih organizama (praorganizama) na Zemlji.

DVOSTRUKI BROJ KROMOSOMA, v. diploidni broj kromosoma.

EJAKULACIJA, refleksno izbacivanje sperme za vrijeme muškarčeva orgazma.

DVOSTRUKI KROMOSOMI, građeni su od dvije kromatide.

EKOFIZIOLOGIJA, znanost koja proučava djelovanje različitih ekoloških čimbenika na funkciju stanica, tkiva, organa i organskih sustava.

DVOSUPNICE, razred kritosjemenjača. Najčešće porodice i njihovi predstavnici: žabnjaci, ruže, bukve, breze i lijeske, krstašice, lepirnjače, štitarke, usnače i glavočike.

EKOLOGIJA (grč. oikos = dom, stanište, logos = riječ, govor), znanost koja proučava odnose živih bića i okoliša; znanost o


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

proizvodnji i raspodjeli organske tvari u prirodi te o gustoći naselja biljnih i životinjskih vrsta.

EKOTIP, nasljedno izmijenjen oblik neke biljke ili životinje uslijed prilagodbe na specifičnost okoliša, npr. poljski miš.

EKOLOŠKA NIŠA, obilježava mjesto i ulogu jedne vrste u životnoj zajednici. Niša nekog živog organizma određena je čimbenicima kao što su stanište, hrana i temperatura. Iako dvije vrste mogu dijeliti isto stanište, one nikada ne dijele istu nišu.

EKOTOKSIKOLOGIJA, znanost koja proučava posredni ili neposredni učinak stranih tvari (ksenobiotika) na prirodu, na sve živuće organizme i njihovu organizaciju, odnos prema neživoj tvari, međuodnose i odnos prema čovjeku.

EKOLOŠKA VALENCIJA, je razmak između donje i gornje granice vrijednosti nekog ekološkog čimbenika (temperatura, svjetlo, voda itd) u okviru kojega je moguć život organizma; različita je za svaki čimbenik i za svaku vrstu, v. ekološki maksimum, ekološki optimum i ekološki minimum.

EKSKRECIJA, izlučivanje (bubrezima ili kroz kožu) nekorisnih i štetnih tvari.

EKOLOŠKI ČIMBENICI, v. abiotički čimbenici i biotički čimbenici. EKOLOŠKI MAKSIMUM, najveći intenzitet nekog čimbenika koji može neki organizam podnijeti, v. ekološka valencija. EKOLOŠKI MINIMUM, najmanji intenzitet nekog čimbenika koji mora postojati da organizam živi, v. ekološka valencija. Poznato je Liebigovo pravilo ekološkog minimuma koje upozorava da je ograničavajući čimbenik onaj koji je najmanje zastupljen u staništu, tj. ona tvar kojom organizam najmanje raspolaže. EKOLOŠKI OPTIMUM, optimalna vrijednost djelovanja nekog čimbenika na organizam, v. ekološka valencija. EKOSUSTAV, sustav bioloških, kemijskih i fizičkih zbivanja koji obuhvaća biotop i biocenozu. Produktivnost ekosustava izražava se proizvodnjom organskog ugljika. Od kopnenih ekosustava najproduktivnija je šuma, a od slatkovodnih jezero s tvrdom vodom.


EKSPERIMENT (pokus), promatranje pojave koja se ispituje po točno određenim uvjetima koji dozvoljavaju da se prati tijek pojave te da se ona svaki put uz ponavljanje istih uvjeta ponovo izazove. EKSTRACELULARNA (izvanstanična) PROBAVA, hranjive se tvari probavljaju u probavnoj šupljini mnogostaničnih životinja. Npr. to je gastrovaskularna šupljina kod žarnjaka, isp. EKTODERM, vanjski zametni sloj stanica gastrule iz kojega se razvijaju kod kralježnjaka živčani sustav i osjetila, epitelno tkivo i njegovi derivati. EKTOPLAZMA, vanjski, periferni dio protoplazme. ELEKTRIČNI POTENCIJAL, nastaje na razini receptora direktnim podraživanjem, odnosno na razini sinapse podraživanjem idućeg neurona neurohormonima. Stanica se depolarizira kada u nju difundiraju ioni natrija kroz otvorene ionske kanale. Potencijal stanice se sa –90 mV promijeni na +50 mV. Promijenjeni električni potencijal receptora prenosi se dalje dendritom u tijelo neurona, a odatle aksonom do završnih nožica. Ubrzo nakon depolarizacije nastupa brza repolarizacija tj. stanica se vraća sa +50 mV ponovno na –90 mV. Repolarizacija stanice ostvaruje se izbacivanjem kalija i natrija iz stanice u

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

okolinu uz utrošak energije procesom tzv. Na/K pumpe, isp. neurohormoni.

EM, v. endoplazmatska mrežica.

ELEKTROENCEFALOGRAFIJA (EEG), snimanje moždanih valova. Pločaste elektrode, koje se postave na određena mjesta na glavi, bilježe moždanu (električnu) aktivnost kore velikog mozga. Postupak je značajan za otkrivanje živčanih i duševnih bolesti.

EMBRIJ (zametak), biljni, životinjski i čovječji organizam u ranim stadijima razvitka nakon oplodnje. U čovjeka, embrijem se naziva organizam star do dva mjeseca trudnoće.

ELEKTROENCEFALOGRAM (EEG), grafički prikaz moždanih valova. Mijenja se ovisno o aktivnosti pojedinih područja mozga, jer se s aktivnošću mijenja i ukupna količina električnih potencijala podraženih neurona.

EMBRIOGENEZA (grč. embryon = zametak, klica, genesis = postanak, razvitak), proces diferencijacije stanica u različita tkiva i organe. Kod biljaka započinje inekvalnom (asimetričnom) diobom zigote kojom nastaju bazalna i vršna stanica. Daljnjim diobama tih stanica razvija se embrio (klica).

ELEKTRO-KARDIOGRAM (EKG), krivulja električnih potencijala srčanog mišića, a bilježe se elektrokardiografom. Normalan EKG sastoji se od: P-vala, koji pokazuje mjerenje depolarizacije pretklijetki, QRS - kompleks koji pokazuje mjerenje depolarizacije klijetki i repolarizacije pretklijetki, te T-vala koji pokazuje rezultat mjerenja klijetki za vrijeme njihove repolarizacije. ELEKTRONSKI MIKROSKOP, v. mikroskop. ELEMENTARNI SASTAV govori od kojih se kemijskih elemenata sastoji nešto. U ljudskom tijelu više je od 70 kemijskih elemenata. Najviše je kisika i to oko 60 %, zatim ugljika oko 20 %, vodika oko 10 %, dušika oko 4 % i različitih minerala oko 6 %. Makroelementi izgrađuju oko 99 % težine našeg tijela; to su kisik, ugljik, vodik, kalcij, dušik i kalij. Mikroelementi izgrađuju preostalih 1 %; to su fosfor, magnezij, sumpor, klor, natrij, željezo, mangan i aluminij. Ultramikroelemenata ili oligoelemenata ima samo u tragovima; to su npr. titan, cink, selen, rutenij, radij itd. ELEMENTI, v. Dodatak 3.

EMBOLUS, v. tromboza.

EMBRIO, v. klica.

EMBRIOLOGIJA, znanost o razvoju živih bića iz oplođene jajne stanice. EMBRIONALNE OVOJNICE, posebne strukture koje imaju važnu ulogu u zaštiti i prehrani zametka, a razvijaju se tijekom embrionalnog razvitka razvijenijih životinja i čovjeka. Embrionalne ovojnice u čovjeka su: korion, amnion (vodenjak), žumanjčana vreća, alantois i placenta (posteljica). EMBRIONALNI RAZVITAK, razvoj zametaka većine životinjskih organizama. Stadiji embrionalnog razvitka su najprije brazdanje i gastrulacija, a zatim organogeneza i histogeneza. EMBRIOBLAST, skupina embrionalnih stanica sisavaca koja se nalazi u unutarnjosti blastociste. Iz njega će se gastrulacijom razviti zametni listići, ektoderm, endoderm i mezoderm, a iz njih daljnjim razvojem pojedini organi i organski sustavi. EMFIZEM PLUĆA, bolest dišnog sustava u kojoj dolazi do oštećenja i smanjenja broja alveola u plućima. Tijelo dobiva


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

sve manje kisika, a CO2 zaostaje u tijelu (plave usne). ENDEM, biljna i životinjska vrsta koja je rasprostranjena samo na nekom užem području ili arealu. Česti su endemi na udaljenim otocima, u pećinama i sl. Neki naši otoci (npr. Brusnik, Jabuka i Palagruža) imaju endemične vrste gušterica. Iz podzemlja našeg krša poznati su endemi vodozemac čovječja ribica i pijavica iz Lukine jame na Velebitu. ENDOCITOZA, unošenje tvari u stanicu uvrtanjem stanične membrane oko njih. Obzirom na veličinu čestica tvari razlikujemo unošenje sitnih čestica, pinocitozu i unošenje krupnih čestica, fagocitozu. Kada hrana uđe u stanicu ili tijelo npr. praživotinje, stvori se hranidbeni mjehurić ili probavna vakuola koja se spoji s lizosomima. ENDODERM, unutarnji zametni sloj stanica gastrule iz kojega se razvijaju kod kralježnjaka probavilo i probavne žlijezde, pluća, škrge te drugi unutarnji organi. ENDODERMA, sloj stanica koji odvaja vanjski dio korijena od provodnih elemenata ksilema u središnjem cilindru korijena. Stanice endoderme aktivno izlučuju vodu i tvari u provodne žile i tako se stvara korijenov tlak. ENDOKRINE INTERSTICIJSKE STANICE (Leydigove stanice), su specijalizirane stanice sjemenika koje leže između sjemenih kanalića, a luče hormon testosteron. ENDOKRINE ŽLIJEZDE (žlijezde s unutarnjim izlučivanjem), žlijezde koje svoje produkte (hormone) izlučuju u krv. Endokrine žlijezde u čovjeka su hipofiza, epifiza, štitna žlijezda, nuzštitne žlijezde, prsna žlijezda (timus), nadbubrežne žlijezde, spolne žlijezde (sjemenici i jajnici) te


gušterača koja ima osim endokrine i egzokrinu ulogu, izlučivanje probavnih enzima u početni dio tankog crijeva. ENDOPLAZMA, središnji, unutarnji dio protoplazme. ENDOPLAZMATSKA MREŽICA (endoplazmatski retikulum, EM, ER), sustav kanalića omeđenih membranom koji prožima citoplazmu eukariotskih stanica. Omogućuje transport tvari između stanice i okoliša te povezuje staničnu membranu s ovojnicom jezgre. EM koja sadrži ribosome je hrapava, a bez ribosoma glatka. Hrapava EM ima važnu ulogu u sintezi proteina, npr. sinteza inzulina, sinteza antitjela itd. Glatka EM se nadovezuje na hrapavu i u njoj nastaju proizvodi neproteinske prirode, npr. steroidni hormoni. ENDOPLAZMATSKI RETIKULUM, v. endoplazmatska mrežica. ENDOSIMBIOZA, način zajedničkog života kada jedan organizam živi u drugome. U toj zajednici oba organizma imaju korist. U brojnim vrstama bezbojnih bičaša žive modrozelene alge koje obavljaju ulogu kloroplasta (fotosinteza). Tada alge koriste neke produkte metabolizma bičaša, a bičaši produkte fotosinteze. ENDOSKELET, v. kostur. ENDOSPERM, hranjivo staničje koje služi prehrani klice (embrija) prilikom klijanja sjemenke. Nastaje spajanjem spermalne stanice sa sekundarnom jezgrom embrionske vreće. ENERGIDA, tvorevina koja se sastoji od jezgre i pripadajuće citoplazme kojom ta jezgra upravlja. ENZIMI (fermenti, biokatalizatori), organski spojevi (proteini, polipeptidi) koji upravljaju kemijskim reakcijama organizma kvalitativno i kvantitativno, a pri tom

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

se sami ne mijenjaju. Za djelovanje većine enzima napovoljniji pH je 7. EON, vremensko razdoblje od milijardu godina. EOZINOFILNI leukociti



EPIDEMIJA, naglo proširenje neke zarazne bolesti u nekom kraju pri čemu u ograničenom vremenu oboli veći broj stanovnika. Najčešće su epidemije uzrokovane bakterijama i virusima. EPIDERMA, kožno staničje, koža, pokožica, pousmina, pokrovno tkivo na nježnim dijelovima biljke (listu, mladojj stabljici). EPIDIDYMIS, v. pasjemenik. EPIFIT (grč.epi = na, kod; phyton = biljka), biljka koja živi na drugoj biljci, ali ne kao nametnik; npr. mnogi lišaji, tropske orhideje i paprati u krošnji tropskih šuma. EPIFIZA, v. kost. EPIFIZA, žlijezda s unutarnjim izlučivanjem smještena sa stražnje strane između velikog i malog mozga. Izlučuje melatonin, hormon koji sudjeluje u pigmentaciji. EPITELNO TKIVO (pokrovno tkivo), pokriva tijelo i unutarnje organe životinja; luči potrebne sekrete iz ��ljezdanih epitelnih stanica. Odgovara epidermi biljaka. ER, v. endoplazmatska mrežica. EREKCIJA, kod muškaraca nabreknuće i ukrućenje spolnog uda, isp. Erekciju nadziru dva erekcijska središta u leđnoj moždini. Jedno je autonomno središte, a drugo je pod nadzorom središta u mozgu. ERGOT, v. ražova gljivica. ERITROCITI (crvene krvne stanice), najbrojnije krvne stanice (u litri krvi muškaraca ih ima oko 4.4 do 5.8⋅1012, a u žena

3.8 do 4.9⋅1012. Zreli eritrociti su jedine žive stanice u čovjeka koje nemaju jezgru. Najvažniji im je sastojak hemoglobin koji se sintetizira u koštanoj srži u stanicama prethodnicama eritrocita koje još imaju jezgru. Razlikujemo fetalni (HbF) i adultni (HbA) hemoglobin koji se međusobno razlikuju po sastavu polipeptidnih lanaca globina što za posljedicu ima da fetalni hemoglobin ima veću sposobnost vezivanja kisika kod nižih koncentracija kisika od adultnog hemoglobina. Temeljna im je uloga prijenos kisika i ugljikovog dioksida između plućnih alveola i tkiva. Prosječan životni vijek zdravog eritrocita u krvi je oko 4 mjeseca nakon čega se razgrađuju najvećim dijelom u slezeni. Razgradnjom hemoglobina nastaje žuti pigment bilirubin koji se izlučuje iz krvi i iz jetre putem žuči u crijevo gdje se uz pomoć bakterijskih enzima pretvara u smeđi sterkobilin B i žuti urobilin B. Odatle smeđa boja stolice i žuta boja mokraće. Isp. krvna tjelešca. ERITROPOETIN, hormon koji stimulira razvoj i sazrijevanje eritrocita u koštanoj moždini. Izlučuju ga bubrezi pri smanjenoj koncentraciji kisika u organizmu što se npr. javlja kao posljedica smanjene koncentracije kisika u atmosferi na velikim visinama. EROZIJA, razaračko djelovanje voda na tlo. ESCHERICHIA COLI (ešerihija), bakterija iz sastava crijevne flore čovjeka, ali može uzrokovati infekcije mokraćnog sustava i proljeve u male djece. Ulaskom u krv izaziva sepsu, meningitis i druga oboljenja. Koristi se u genetičkom inženjerstvu, npr. za proizvodnju inzulina. ESTROGENI, ženski spolni hormoni koje luče jajnici. Po kemijskom sastavu su steroidi kao i ostali spolni hormoni. Utječu


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

na rast i razvoj ženskih spolnih organa kao primarnih spolnih značajki. Utječu i na formiranje niza sekundarnih spolnih značajki, npr. razvoj dojki, rast i razvoj kostiju, odlaganje masnih tvari u potkožnom sloju, raspored dlaka i drugo. Reguliraju zbivanja u menstrualnom ciklusu. Tako 28. dana smanjena količina estrogena uzrokuje ljuštenje odebljale sluznice maternice. Također su odgovorni za normalan tijek trudnoće i poroda. EŠERIHIJA, v. Escherichia coli. ETILEN, jedini plinoviti biljni hormon. Stimulira sazrijevanje plodova, inhibira rast te potiče otpadanje listova i proces starenja. Stvara se u većini biljnih organa. EUCITI, v. eukariotske stanice. EUGLENA (Euglena viridis), bičaš vretenastog tijela bez čvrste stijenke. Ima plastide, kloroplaste, crvenu očnu pjegu i kontraktilnu vakuolu (tipično za životinje). Produkt fotosinteze je polisaharid paramilum. Kada nema svjetla, euglena uzima organsku hranu. Zato se euglena može smatrati biljkom, ali pokatkad i životinjom. EUKARIOTI, svi jednostanični ili višestanični organizmi čije je tijelo građeno od eukariotskih stanica, a to su sve životinje i biljke osim bakterija i modrozelenih algi (cijanobakterija). Neki eukarioti imaju i bičeve za pokretanje. Stanice eukariota dijele se mitozom. EUKARIOTSKE STANICE (grč. eu = pravi, krayon = jezgra) ili euciti, stanice koje sadrže jezgru obavijenu membranom i u citoplazmi ostale stanične organele obavijene membranom. Stanični organeli eukariotskih stanica su jezgra, mitohondriji, endoplazmatska mrežica, centrosom, vakuole, lizosomi, Golgijevo tijelo i plastidi (kod biljaka). Eukariotske stanice sadr-


že i manje stanične strukture, npr. kromosome, jezgrice, ribosome, centriole (kod životinja) koji nisu obavijeni membranom te ih ne smatramo organelima u užem smislu. Eukariotske stanice su veće i složenije od prokariotskih stanica i imaju sposobnost izgradnje višestaničnog organizma. Najvažnije razlike stanica Prokariotska


nema oblikovanu jezgru, nego nukleoid

ima potpuno oblikovanu jezgru

jedan kromosom

više kromosoma

dioba cjepanjem

dioba mitozom

nema staničnih organela

ima stanične organele (mitohondrije, kloroplaste itd.)

stanična stijenka sadrži murein

stanična stijenka sadrži celulozu

EUTROFIKACIJA, v. eutrofizacija. EUTROFIZACIJA (eutrofikacija), povećanje primarne organske proizvodnje u vodenim ekosustavima nakon obogaćivanja vode hranjivim tvarima koje potiču razvoj alga i višeg vodenog bilja. Postoje dva oblika eutrofizacije: prirodni i antropogeni (uzrokovan djelovanjem čovjeka). EVOLUCIJA (biološka evolucija), postupni povijesni razvoj najjednostavnijih oblika živog svijeta k sve složenijim, savršenijim i raznolikijim oblicima na Zemlji. Grana biologije koja proučava taj razvoj zove se znanost o evoluciji. Biološkoj evoluciji je prethodila kemijska evolucija odnosno postanak i razvoj organskih spojeva na Zemlji.

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

F FAGOCITI, stanice sa sposobnošću fagocitoze (isp.) u koje spadaju neutrofilni leukociti, monociti i tkivni makrofagi. FAGOCITOZA (grč. fagein = jesti, gutati, kytos = šupljina), sposobnost stanica, npr. neutrofila da proždiru i, uz pomoć lizosoma, razgrađuju mikroorganizme i čestice sličnih veličina. Također i način uzimanja hrane u praživotinja, oblik endocitoze, isp. FAGOSOMI, v. neutrofilni leukociti. FAUNA, skup svih životinjskih vrsta nekog određenog područja. FAZNI MIKROSKOP, v. mikroskop. FENILALANILSERIN, dipeptid, tj. kemijski spoj nastao vezivanjem dviju aminokiselina: fenilalanina i serina. FENILALANIN, kemijski spoj iz skupine aminokiselina. FENOLOŠKE POJAVE, periodičke sezonske promjene organizama, npr. vrijeme listanja, cvatnje, padanja lišća u bilja, selidba životinja i dr. FENOTIP, genetički izraz kojim se označava zbroj morfoloških i fizioloških svojstava nekog organizma. On je ovisan o nasljednim faktorima ili genima (genotipu), ali i o djelovanju okoliša. U nasljeđivanju dominantnih i recesivnih svojstava, organizmi različitih genotipova (homozigoti, heterozigoti) mogu imati jednak fenotip. Tako, npr. kod dihibridnog križanja s dominacijom jedinke različitih genotipova: AABB, AABb, AaBB, AaBb imaju isti fenotip, dominantni su za oba svojstva, A i B. FERMENTACIJA (vrenje), proces u kojem se anaerobno (bez prisutnosti kisika)

razgrađuju organski spojevi pri čemu se oslobađa dio energije, a dio ostaje u produktima. Produkti vrenja su obično alkoholi i organske kiseline. Vrenja uzrokuju različiti mikroorganizmi (bakterije, gljvice) i na taj način dolaze do energije koja je potrebna za njihove životne aktivnosti. Prema konačnim produktima vrenja razlikujemo: alkoholno, mliječno i octeno. FERMENTI, v. enzimi. FETALNA ERITROBLASTOZA, (hemolitička bolest novorođenčadi), bolest koja se pojavljuje u trudnoći u djece koja su Rh+, a imaju Rh- majku. Tijekom prve trudnoće u djeteta nema znakova fetalne eritroblastoze jer se u krvi majke nije stvorila veća količina anti-Rh aglutinina koji bi uzrokovali razaranje (hemolizu) djetetovih eritrocita. Međutim, pri svakoj narednoj trudnoći, kada ista Rh- majka nosi ponovo Rh+ dijete, stvara se veća količina antiRh aglutinina pa se u djeteta pojavljuju simptomi bolesti. Koštana srž djeteta nastoji nadoknaditi razorene eritrocite pa intenzivno stvara i u krv otpušta nezrele eritrocite (eritroblaste) koji po funkciji ne mogu u potpunosti zamijeniti eritrocite. Posljedica hemolize eritrocita je anemija (slabokrvnost), a osim toga u djeteta se javlja i žutilo kože jer se hemoglobin iz raspadnutih eritrocita pretvara u žučne boje koje su žute. FETALNI HEMOGLOBIN, v. eritrociti. FETUS (plod), zametak čovjeka starosti od dva mjeseca pa do rođenja. FIBRINOGEN, bjelančevina u krvi koja je jedan od sudionika u zgrušavanju krvi. FIKSACIJA DUŠIKA, proces kojim neki prokarionti prevode atmosferski dušik u amonijeve ili nitratne spojeve iskoristive za biljku, v. dušikove bakterije. FIKSIZAM, shvaćanje da su vrste nepromijenjive.


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

FILAMENT, v. prašnik. FILETIČKA EVOLUCIJA, v. sukcesivna evolucija. FILOGENETSKA SISTEMATIKA, (rodbinsko sustavoslovlje), razvrstavanje živih bića u filogenetski (prirodni) sustav. FILOGENETSKI (prirodni) SUSTAV ukazuje na srodstvene odnose između pojedinih razvojnih skupina živih bića i unutar njih. Unutar sustava živa bića se svrstavaju u sustavske (sistematske) jedinice. Temeljna sustavska jedinica je vrsta, a obuhvaća usko srodne organizme, tj. takve organizme koji se međusobno mogu spolno razmnožavati. Prva složenija sustavska jedinica je rod, a obuhvaća srodne vrste. Srodni rodovi obuhvaćeni su jednom porodicom. Daljnje temeljne jedinice su red i razred. Još složeniji je odjeljak/koljeno te najsloženija temeljna sustavska jedinica carstvo. Odjeljak i koljeno su jednake složenosti s tim da se naziv odjeljak uobičajeno rabi kada se govori o biljkama, a koljeno kada se radi o životinjama. Osim temeljnih sustavskih jedinica neki autori rabe i druge, npr. potkoljeno, nadcarstvo itd. Isp. taksonomija. FILOGENETSKI NIZOVI, v. razvojni nizovi. FILOGENIJA (grč. fylon = pleme, rod, koljeno, vrsta, genesis = postanak), znanstveno područje biologije koje se bavi proučavanjem podrijetla organizama na Zemlji i njihovim razvrstavanjem u rodoslovno stablo. FILOKADIJE, preobraženi, prošireni dijelovi stabljike u obliku listova koji preuzimaju ulogu fotosinteze. FITOCELULA, biljna stanica, v. stanica. FITOCENOLOGIJA, v. fitocenoza.


FITOCENOLOGIJA, znanost o biljnim zajednicama, isp. fitocenoza. FITOCENOZA (grč. fyton = biljka, koine = zajednica), prirodna biljna zajednica u kojoj zajedno žive određene biljke na određenom staništu. Ovu biljnu komponentu biocenoze proučava znanost fitocenologija. FITOCID, otrovni kojima se uništavaju nepoželjne biljke. FITOFAGI, drugi naziv za biljojede. FITOKROMI, specifični biljni fotoreceptori; po sastavu su bjelančevine. To su pigmenti koji maksimalno apsorbiraju u crvenom i tamnocrvenom dijelu spektra. Potiču brojne reakcije biljaka na svjetlost. Nalaze se u plazmi stanica listova u vrlo malim količinama. Fitokrom postoji u aktivnom i inaktivnom obliku. Što je dan dulji stvara se više aktivnog fitokroma pod utjecajem bijele i crvene svjetlosti. FITOPLANKTON, v. plankton. FIZIOLOGIJA, znanost koja proučava životne procese živih bića. FIZIOLOŠKA HIPOTEZA, hipoteza čiji je zastupnik ruski biokemičar A. J. Oparin, a tumači postanak prvih organizama (praorganizama) na Zemlji. Prema toj hipotezi praorganizam je mogao izgledati poput nekog složenijeg koacervata koji je imao sposobnost jednostavne izmjene tvari i samoobnavljanja. Koacervati su koloidne kapljice s opnama, a nastaju otapanjem nekih organskih spojeva u vodi uz dodatak različitih soli. FIZIOLOŠKA OTOPINA, posebna otopina različitih soli i glukoze. Postoje različite fiziološke otopine, ali u osnovi su to izotonične otopine koje imaju sastav sličan sastavu tjelesnih tekućina pojedinog organizma. Npr. fiziološka otopina NaCl koja

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

se koristi za infuziju sadrži 0.9 % NaCl (0.15 mola po litri otopine) te je izotonična (iste koncentracije) prema eritrocitima. Eritrociti u takvoj otopini ostaju neoštećeni. FLEMING, A. (1881. – 1955.), britanski mikrobiolog, 1929. god. otkrio penicilin, prvi antibiotik. FLOEM, vrsta provodnog tkiva u biljaka koja služi za provođenje asimilata (produkata fotosinteze) od listova prema ostalim dijelovima biljke. Floem je građen od sitastih cijevi i stanica pratilica, a u drvenastih biljaka redovito se nalazi u kori. Isp. provodno staničje. FLORA, skup svih biljnih vrsta nekog određenog područja, npr. flora nekog otoka, planine, države i sl. FLORIGEN, hormon cvjetanja. Sintetizira se u listovima u povoljnim uvjetima i prenosi se u vegetacijske vrškove gdje potiče cvjetanje. Struktura florigena još nije poznata. FLORISTIKA , znanost o flori, isp. FLUID, unutarnja želja ili potreba za promjenom određenih karakteristika (po Lamarcku). FLUORESCENIJSKI MIKROSKOP, v. mikroskop. FOLIKUL STIMULIRAJUĆI HORMON, v. FSH. FOSFATNA KISELINA (fosforna kiselina), kemijski spoj empirijske formule H3PO4. Njeni kiselinski ostaci izgrađuju izuzetno važne spojeve, npr. nukleinske kiseline i ATP.




FOSFOLIPIDI, organski spojevi iz grupe lipida koji sadrže fosfatnu skupinu (ostatak fosfatne kiseline). Građeni su od trovalentnog alkohola glicerola na kojem su esterski vezane dvije više masne kiseline, a preko treće OH skupine vezana je fosfatna kiselina. Preko fosfatne skupine vezan je obično neki aminoalkohol. Imaju važnu strukturnu ulogu u stanici jer se nalaze u sastavu svih membrana stanice. FOSFORNA KISELINA, v. fosfatna kiselina. FOSILI (okamine, lat. fossus = iskopan), ostaci biljnih i životinjskih organizama iz davnih razdoblja Zemljine prošlosti. Fosili nastaju: okamenjivanjem, pougljenjivanjem ili konzerviranjem. Važan su paleontološki dokaz evolucije. FOSILIZACIJA, proces nastajanja fosila, isp. FOSILNI ČOVJEK, v. Homo sapiens. FOSILNI PRIJELAZNI OBLICI, v. prijelazni oblici. FOTOBIOLOŠKO PODRUČJE, dio spektra Sunčevog zračenja; svjetlost valnih duljina koje odgovaraju vidljivom dijelu spektra (380-760 nm). Osim fotosinteze, valne duljine ovog dijela spektra uzrokuju i fototropizme, fototaksije i fotomorfogeneze (promjene oblika djelovanjem svjetlosti). FOTOMORFOGENEZA, promjena oblika kod biljaka koje se događaju pod utjecajem svjetlosti. Kontrolirane su specifičnim fotoreceptorima, fitokromima. FOTONASTIJA, v. nastije. FOTOPERIOD (relativna duljina dana i noći), glavni okolišni čimbenik pomoću kojeg biljke određuju godišnje doba, v. fotoperiodizam.


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

FOTOPERIODIZAM, pravilna izmjena dana i noći. Biljke reagiraju različitim fiziološkim procesima na duljinu dana tj trajanje dnevnog svjetla (npr. početak cvjetanja, otpadanje listova u jesen). FOTORECEPTORI, vidne stanice, štapići i čunjići, v. mrežnica. FOTORESPIRACIJA, metabolički put kojim se smanjuje učinak fotosinteze: troši se kisik, otpušta CO2 i ne nastaje ATP. Obično se zbiva za toplih, vedrih i suhih dana kada su puči zatvorene a koncentracija kisika u listu viša od koncentracije CO2. FOTOSINTETSKA FOSFORILACIJA proces sinteze ATP-a uz pomoć svjetlosne energije Sunca koji se odvija za vrijeme transporta elektrona u kloroplastima.

FOTOSINTEZA (asimilacija CO2), proces koji se odvija u kloroplastima biljnih stanica u kojem biljka iz anorganskh spojeva (vode i CO2) izgrađuje ugljikohidrate i druge organske spojeve koristeći svjetlosnu energiju Sunca. Fotosintezu možemo predočiti jednadžbom:

6CO2 + 12H2O + svjetlosna energija → → C6H12O6 + 6O2 + H2O Fotosinteza se sastoji od dva stadija: 1. svjetlosne (primarne) reakcije koje se zbivaju u tilakoidnim membranama kloroplasta u kojima se Sunčeva energija pretvara u kemijsku energiju (ATP i NADPH) i oslobađa kisik i 2. reakcije u tami (sekundarne reakcije ili Calvinov ciklus) koje se zbivaju u stromi kloroplasta u kojima se reducira ugljikov dioksid i sintetiziraju ugljikohidrati. FOTOSISTEM, fotosintetska jedinica koja je smještena u tilakoidnoj membrani kloroplasta. Sastoji se od antenskog kompleksa, reakcijskog središta klorofila a i primarnog akceptora elektrona. FOTOTAKSIJE, v. taksija. FOTOTROPIZAM, gibanje biljke rastom tj. savijanje organa prema izvoru svjetlosti (pozitivni fototropizam). Pojavu uzrokuje auksin (hormon rasta) koji djelovanjem svjetlosti prelazi u zasjenjenu stranu klice ili stabljike gdje uzrokuje pojačan rast. Korijen pokazuje negativni fototropizam jer raste u suprotnom smjeru od izvora svjetlosti. FOX, S. američki znanstvenik koji je u svojim pokusima dobio mikrosfere, okrugla tjelešca proteinskog sastava slična jednostavnim živim stanicama čime je pridonio razumijevaju razvoja živog svijeta na Zemlji.

Shema fotosinteze


____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

FREON, sintetizirani spoj iz skupine spojeva klorfluorugljika koji se rabi kao potisni plin, a uništava ozonsku ovojnicu.

GAMETOFIT, spolna generacija u biljaka koja sadrži muške i ženske rasplodne organe. Tijekom evolucije biljnog svijeta došlo je do redukcije gametofita u odnosu na nespolnu generaciju (sporofit). Isp. haploidna generacija.

FRUKTOZA (voćni šećer), organski spoj, jednostavni šećer ili monosaharid. Najslađi je od svih šećera. Dolazi u voću, medu i kao sastavni dio nekih složenih šećera ili oligosaharida, npr. saharoze. Njezina empirijska formula ista je kao i formula monosaharida glukoze i galaktoze (C6H12O6) iz skupine aldoheksoza (šećera sa šest atoma ugljika i aldehidnom funkcionalnom skupinom) dok ona spada u ketoheksoze (šećere sa šest atoma ugljika i keto funkcionalnom skupinom). Fruktoza se u organizmu lako prevodi u glukozu.

GARIG, zajednica niskog bilja koje nastaje sječom vazdazelene šikare.

FSH (folikul stimulirajući hormon, hormon stimulacije folikula), hormon iz skupine gonadotropnih hormona koje luči prednji režanj hipofize (adenohipofiza). U žene stimulira rast folikula jajnika, a u muškarca spermatogenezu.

GASTRIN, probavni hormon. Luče ga želučane žljezdane stanice podražene hranom u želucu. Apsorbira se u krv i krvlju se prenosi do obložnih stanica. Gastrin potiče i glavne stanice želučanih žlijezda da luče pepsinogen.

FUNGICID, v. biocid.

GASTRITIS, upala želučane sluznice, najčešće uzrokovana agresivnim djelovanjem žestokih alkoholnih pića, pušenjem, konzumiranjem jako začinjene hrane ili djelovanjem nekih lijekova (npr. acetilsalicilna kiselina). Gastritis prate napadaji boli želuca, jaka mučnina, katkad i povraćanje.

G G0- FAZA, v. interfaza. G1-FAZA, v. interfaza. G2- FAZA, v. interfaza. GAMETANGIOGAMIJA, spajanje cijelih spolnih organa prilikom razmnožavanja. GAMETE, spolne rasplodne stanice. U čovjeka ženska gameta je jajna stanica koja nastaje u jajnicima (ovariji), a muške gamete su spermiji koji nastaju u sjemenicima (testisi).

GAMETOGENEZA, stvaranje muških i ženskih spolnih stanica (gameta); zajednički naziv za spermatogenezu i oogenezu. Odvija se u spolnim žlijezdama muškaraca (sjemenici) i žena (jajnici) pod djelovanjem istih gonadotropnih hormona: FSH i LH. GANGLIJ, nakupina živčanih stanica.

GASTROENTERITIS (pokvareni želudac, crijevna gripa) je opći naziv za manju infekciju želuca i tankoga crijeva praćenu mučninom, bolovima (grčevima) u trbuhu, povraćanjem i/ili proljevom što obično traje 1 do 2 dana. Najčešći je uzročnik virus koji se lako prenosi dodirom, a ne samo hranom ili pićem. GASTRULA, v. gastrulacija. GASTRULACIJA, druga etapa embrionalnog razvitka mnogih višestaničnih životinja u kojoj dolazi do gibanja embrional-


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

nih stanica u unutarnjost zametka, pri čemu nastaju zametni listići. Tako, npr. gastrulacija u vodozemaca započinje gibanjem stanica blastoderma, a u sisavaca gibanjem stanica embrioblasta. Oblik zametka koji nastaje kao rezultat gastrulacije sastoji se od tri zametna listića (ektoderm, endoderm, mezoderm) i zovemo ga gastrula. U daljnjem tijeku embrionalnog razvitka iz zametnih listića postupno će se diferencirati organi i tkiva (organogeneza i histogeneza). GEL - stanje, gušći, skrutnuti oblik koloidnih otopina. GEMULA, v. spužve. GEN CB (CB = colour-blindness, sljepoća za boje, daltonizam), gen koji se nalazi u spolnom x-kromosomu. Ako su muškarci nositelji takvog gena ne mogu razlikovati boje, npr. crvenu od zelene. U žena se sljepoća za boje pojavljuje samo ako se tako promijenjeni geni nalaze u oba x-kromosoma. Ako se takav gen nalazi samo u jednom od x-kromosoma, žene su normalnog vida ali su prijenosnici tog gena na potomstvo.

GENETIČKA ŠIFRA, v. genetička uputa. GENETIČKA UPUTA (genetička šifra), uputa, informacija o rasporedu dušičnih baza u molekulama DNA, odnosno informacija o naravi pojedinih gena. Tablica 1. Genetička uputa, slijed triju nukleotida u mRNA, kodon. Kratice imaju značenje: Tyr - tirozin U - uracil His - histidin C - citozin Gln - glutamin A - adenin Asn - aspargin G - gvanin Lys - lizin Phe - fenilalanin Asp - asparginska Leu - leucin kiselina Ile - izoleucin Glu - glutaminska Met - metionin kiselina Val - valin Cys - cistein Ser - serin Trp - triptofan Pro - prolin Arg - arginin Thr - treonin Gly - glicin Ala - alanin


GEN DALTONIZMA, v. gen CB. GEN SLJEPOĆE ZA BOJE, v. gen CB. GEN, materijalna osnova ili čimbenik nekog nasljednog svojstva, dio molekule DNA koji djeluje kao određena funkcionalna jedinica. Jedan gen ne mora uvijek biti odgovoran samo za jedno svojstvo nego može biti odgovoran i za više njih. Vrijedi i obrnuto, više gena mogu biti odgovorni za samo jedno svojstvo. U diploidnim stanicama (isp.) geni za ista svojstva nalaze se na homolognim kromosomima. GENERATIVNI ORGANI, organi koji služe isljučivo za razmnožavanje.






Mjesto u kodonu II. III. U C A G Phe Ser Tyr Cys U Phe Ser Tyr Cys C Leu Ser stop stop A Leu Ser stop Trp G Leu Pro His Arg U Leu Pro His Arg C Leu Pro Gln Arg A Leu Pro Gln Arg G Ile Thr Asn Ser U Ile Thr Asn Ser C Ile Thr Lys Arg A Met Thr Lys Arg G Val Ala Asp Gly U Val Ala Asp Gly C Val Ala Glu Gly A Val Ala Glu Gly G

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

Tri nukleotida (dušične baze) koje nazivamo trojka ili triplet čine osnovu takve upute, a svaka trojka prepisana s DNA na mRNA naziva se kodon ili kod. Svaki kodon odgovara pojedinoj aminokiselini (vidi tablicu 1.) te na taj način DNA preko mRNA određuje ugradnju pojedinih aminokiselina u specifičnu vrstu proteina. Na primjer, šifra AUG znači ugradnju aminokiseline metionina u polipeptidni lanac i to je ujedno šifra za početak polipeptidnog lanca. Genetičke upute UUU i UUC znače ugradnju aminokiseline fenilalanina itd. Genetičke šifre UAA, UAG i UGA znače kraj polipeptidnog lanca jer ne određuju ugradnju niti jedne od aminokiselina (nonsense code). Važno je naglasiti da isti kodon (triplet) kodira istu aminokiselinu bez obzira da li se to događa kod virusa, bakterija, biljki ili pak čovjeka. Genetička uputa otkrivena je pokusima s genetičkim materijalom crijevne bakterije ešerihije (Escherichia coli). GENETIČKE KARTE (kromosomske karte), karte koje prikazuju smještaj i međusobnu udaljenost gena u kromosomima. Postoje dvije vrste genetskih karti: 1. crossing-over genetske karte koje su izrađene samo na temelju postotaka izmjena dijelova homolognih kromosoma (crossing-overa) između određenih gena koji su vrlo blizu jedan drugoga; 2. citogenetske (citološke) karte kod kojih je raspored gena utvrđen genetičkim i citološkim istraživanjima. Genetske karte su izrađene za mnoge vrste biljaka (ječam, kukuruz, rajčica itd.) i životinja (kunić, kokoš itd.), a djelomice i za čovjeka. Pojam genetska karta potječe iz znanstvenog rada američkog genetičara T. H. Morgana.

GENETIČKO INŽENJERSTVO, postupci prenošenja određenih gena iz jedne vrste organizama u drugi. Genetičkim se inženjerstvom umjetno stvaraju hibridne molekule DNA kakvih do sada nije bilo u prirodi. U područje genetičkog inženjerstva ubrajamo i kloniranje, tj. uzimanje pojedinih stanica iz nekog organizma i stvaranje potpune kopije tog organizma te još neke druge slične metode. GENETIKA (znanost o nasljeđivanju), znanost koja proučava pojave i uzroke međusobne sličnosti i nasljeđivanja svojstava u živih bića. GENOFOND, cjelokupni kompleks gena koji neka populacija sadržava u nekom vremenu. GENOM, haploidna garnitura kromosoma koja se nalazi u gametama. GENOTIP, genetički izraz kojim se označuje ukupna materijalna osnova nasljeđa odnosno zbroj svih nasljednih faktora ili gena koji određuju nasljedna svojstva nekog organizma. Način označavanja genotipova prikazan je u primjerima monohibridnog i dihibridnog križanja s dominacijom. GENSKA SLUČAJNOST, v. drift. GENSKA SNAGA, v. drift. GENSKA UČESTALOST, relativni omjeri alela gena prisutnih u populaciji. GENSKO STRUJANJE, prijenos gena između populacija uz pomoć kretanja gameta, jedinki ili skupine jedinki iz jedne populacije u drugu. GEOLOŠKA DOBA, v. dodatak 5. GEOTAKSIJA, v. taksija. GEOTROPIZAM, v. tropizmi

GENETIČKI KOD, v. genetička uputa.


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

GERIJATRIJA, medicinska struka koja se bavi liječenjem i sprečavanjem staračkih bolesti. GERMINATIVNI EPITEL (zametni epitel), vrsta epitelnog tkiva sastavljenog od zametnih stanica iz kojih se u muškaraca razvijaju spermiji, a u žena jajne stanice. U muškaraca se germinativni epitel nalazi u sjemenicima, a u žena u jajnicima. GERONTOLOGIJA, znanost o biološkim procesima starenja, fizičkim i psihičkim svojstvima ostarjelih organizama te sociološkim problemima starijih ljudi. GIBERELINI (giberelinske kiseline), skupina biljnih hormona koji stimuliraju rast stabljike i listova, prekidaju dormanciju i potiču klijanje sjemenki. U sjemenkama žitarica giberelini stimuliraju stvaranje enzima (α-amilaze) koji razgrađuju pričuvni škrob. Sintetiziraju se u mladim listovima i korijenju te u embrijima. GIBERELINSKE KISELINE, v. giberelini. GIGANTIZAM, prekomjeran rast svih dijelova tijela zbog povećane razine hormona rasta u krvi koje luči hipofiza. Javlja se u razvojno doba. GIGANTSKI KROMOSOMI, v. gorostasni kromosomi. GINKO, "živi fosil", stara i razvojno primitivna vrsta golosjemenjača; ima lepezaste listove s viličastom nervaturom; muške su gamete još s bičevima, pokretni spermatozoidi. Sjemeni su zameci, kasnije sjemenke, okruglasti i po dva na zajedničkom dršku. Stablo je snažno, visoko i razgranato. Često se sadi u gradovima jer dobro podnosi onečišćeni zrak. Prirodno raste u istočnoj Aziji. GLATKO MIŠIĆNO TKIVO, vrsta mišićnog tkiva kojega izgrađuju stanice vre-


tenastog oblika s jezgrom u sredini. Dolazi u sastavu unutarnjih organa, npr. probavnih, mokraćnih i spolnih. Svojim stezanjem omogućuje njihovu funkciju. Rad glatkog mišićnog tkiva nije pod utjecajem naše volje već njime upravlja autonomni ili vegetativni živčani sustav. GLAVOČIKE, skupina najrazvijenijih dvosupnica. Obuhvaća zeljaste biljke s glavičastim cvatovima koji sliče velikim cvjetovima. Cvjetovi su s cjevastim ili jezičastim vjenčićem. Plod je roška, najčešće s papusom kao prilagodba na rasprostranjivanje vjetrom. Među glavočikama su mnoge biljke koje se uzgajaju kao povrće: salata i artičoka, ljekovite su kamilica, podbjel i pelin, a poznate su livadne biljke maslačak, tratinčica i ivančica. Navedene su biljke samo neke od oko 11000 poznatih vrsta. Glavočike su najbrojnija porodica dvosupnica. GLAVONOŠCI, pripadaju skupini mekušaca, isp. Svi su morski organizmi i grabežljivci: hobotnice, sipe, lignje i indijska lađica koja jedina ima vanjsku kućicu. Stopalo je pretvoreno u krakove (8 ili 10) i lijevak koji vodi u plaštenu šupljinu u kojoj se nalaze škrge. Pokreću se izbacivanjem vode kroz lijevak. U čahuri u glavi je "mozak" (nakupina svih živčanih ganglija). Oči su im dobro razvijene. Imaju trenicu. Uz probavilo imaju vrećicu s crnilom koje sadrži tamni pigment melanin. Spolovi su razdvojeni. Spermiji su nepokretni, a oplodnja unutarnja. GLICIN, kemijski spoj iz skupine aminokiselina. GLIJA-STANICE, mreža potpornih i pomoćnih stanica živčanog tkiva koje se nalazi oko živčanih stanica, dendrita i aksona. Zadržavaju sposobnost dijeljenja kroz cijeli život. Uloga tih stanica je da štite živčane stanice, izoliraju živčana

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

vlakna i kontroliraju izvanstanični prostor, održavajući sastav iona stalnim.

GLIKOZURIJA, pojava glukoze u mokraći kod nekih bubrežnih bolesti.

GLIKOGEN, kemijski spoj, ugljikohidrat iz skupine polisaharida ili složenih šećera. Sastoji se od nekoliko stotina kemijski vezanih molekula glukoze. Kemijska formula spoja glikogena je (C6H10O5)n. Služi kao pričuvna tvar tj. kao zaliha energije u stanicama viših životinja i čovjeka. Najviše se sintetizira i pohranjuje u jetri i mišićnom tkivu u obliku glikogenskih zrnaca. Prema potrebi razgrađuje se u glukozu koja putem krvi dolazi do svih stanica gdje se koristi kao izvor energije.


GLIKOGENSKA ZRNCA, v. glikogen. GLIKOLIPIDI, organski spojevi koji nastaju povezivanjem kraćih molekula šećera (oligosaharida) s lipidima. Česti su građevni dijelovi bioloških membrana. GLIKOLIZA (anaerobna respiracija), početna faza disanja koja se odvija u citoplazmi biljnih i životinjskih stanica neovisno o prisutnosti kisika pa se još naziva i anaerobna respiracija (anaerobno disanje). U glikolizi se šećer glukoza razgrađuje do dvije molekule pirogrožđane kiseline uz oslobađanje dvaju atoma vodika i dvije molekule ATP-a. Ako u stanici ima dovoljno kisika tada se pirogrožđana kiselina nizom biokemijskih reakcija dalje razgrađuje u mitohondrijima sve do ugljik(IV)oksida i vode. Zajednički naziv te skupine reakcija jest aerobna respiracija (aerobno disanje). U slučaju kad u stanici nema dovoljno kisika pirogrožđana kiselina može se dalje razgraditi do ugljik(IV)-oksida i alkohola ili dvije molekule mliječne kiseline što ovisi o tipu stanice. GLIKOPROTEINI, organski spojevi koji nastaju povezivanjem kraćih molekula šećera (oligosaharida) s bjelančevinama. Česti su građevni dijelovi bioloških membrana.

γ-GLOBULIN,v. imunoglobulin. GLODAVCI, najbrojnija skupina sisavaca. Biljojedi su. Hrane se glođući prednjim parom dugačkih sjekutića koji rastu cijelog života. Žive u svim staništima. Glodavcima pripadaju: vjeverice i puhovi, štakori i miševi, dabrovi, zečevi, dikobraz. GLOMERUL (kapilarno klupko), splet kapilara u obliku klupka koji je sastavni dio nefrona, osnovne građevne jedinice bubrega. Stvara ga aferentna (dovodna) arteriola (ogranci bubrežne arterije) koja ulazi u početni dio nefrona - Bowmanovu čahuru. Kroz glomerul se filtrira krvna plazma u silazni krak nefrona. Iz čahure izlazi odvodna (eferentna) arteriola. Kroz glomerul se ne filtriraju krvne stanice i velike molekule bjelančevina iz krvne plazme (selektivna filtracija). GLUKAGON, hormon kojega izlučuje gušterača, a stimulira razgradnju glikogena do glukoze u slučaju snižene razine glukoze u krvi (hipoglikemije). GLUKOKORTIKOIDI, v. kortikosteroidi. GLUKOZA (grožđani šećer), kemijski spoj, ugljikohidrat iz skupine monosaharida ili jednostavnih šećera kemijske formule C6H12O6. Prema broju od šest ugljikovih atoma u svojoj molekuli glukoza je heksoza, a prema aldehidnoj funkcionalnoj skupini aldoza (aldoheksoza). Dolazi u slobodnom obliku u raznom voću, medu, ali i kao sastavni dio složenih šećera: saharoze, maltoze, laktoze, škroba, glikogena i celuloze. Služi kao neposredan izvor energije u stanici.


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

GLUTAMIN, kemijski spoj iz skupine aminokiselina. GLUTAMINSKA KISELINA, kemijski spoj iz skupine aminokiselina. GLJIVE (Fungi), velika i raznolika skupina heterotrofnih eukariotskih organizama. Saprofiti su ili paraziti. Tijelo gljiva nazivamo micelij koji je sastavljen od isprepletenih niti ili hifa. Po svojim osobinama su izdvojena evolucijska cjelina. Imaju sličnosti sa životinjama i biljkama. Osobine slične životinjskima su: stijenka hifa u većine gljiva je od hitina, neke se primitivne gljive hrane tako da uzimaju i probavljaju krute komade hrane, pričuvna hrana je glikogen, katkad i neke masti – nikada škrob, DNK je sličnija životinjskoj nego biljnoj. Osobine slične biljnima su: micelij je sličan steljci nižih biljaka i nerazlučen u tkiva, neke niže gljive imaju celuloznu staničnu stijenku, hranu uzimaju vanjskom površinom, u razmnožavanju postoji jasna izmjena generacija. Grubo ih dijelimo na: sluznjače, algašice, mješinarke i stapčarke. Za sakupljanje gljiva potrebno ih je pojedinačno dobro poznavati jer među njima ima i smrtno otrovnih, npr. zelena pupavka (Amanita phalloides) koja izaziva najviše trovanja oštećujući jetru i koštanu srž. GMAZOVI (Reptilia), skupina kralježnjaka koja se prva u biosferi sasvim prilagodila životu na kopnu. Koža gmazova je suha i pokrivena rožnatim ljuskama ili pločama (zaštita od isparavanja). Jaja, koja legu na kopnu, zaštićena su ljuskom i sadržavaju žumanjak potreban za razvitak embrija, a sam je zametak obavijen zametnim ovojima (v. amniota). Žive u tropskim i suptropskim krajevima jer toplinu tijela održavaju sunčanjem. Dobro je razvijen prednji mozak, čiji je vanjski sloj izgrađen od sive moždane tvari. Oči imaju pokretljive očne kapke i prozirnu migavicu.


Gmazovi na rašljastom jeziku imaju više osjetila (za miris, opip, njuh i sluh, kod zmija koje nemaju bubnjić). Dišu samo plućima. Srce je trodjelno ali je klijetka djelomično podijeljena na dva dijela. Ispred srca je venski zaton (proširenje vene). Gmazovi su hladnokrvne životinje jer se staničnim disanjem ne stvara dovoljno topline. Uzrok je nedovoljna količina kisika zbog malog broja eritrocita i male dišne površine u plućima. Za izlučivanje služe pravi bubrezi (v. treći bubreg). Mokraćovodi ulaze u nečisnicu. Oplodnja je unutarnja. U jajovodu se oko oplođenog jaja stvara čvrsta ovojnica. Jaja polažu u zemlju ili pijesak, gdje ih grije sunce. Neki gmazovi kote žive mlade. Kod gmazova je razvijena briga za potomstvo. Danas živi oko 6000 vrsta koje su podijeljene u skupine: premosnici, kornjače, krokodili i ljuskaši (gušteri i zmije). GOJAZNOST, v. pretilost. GOLGI, C. (1844.-1926.), talijanski liječnik histolog, razvio metodu bojanja živaca i potkraj otkriva mjehuraste strukture u živčanim stanicama. Po njemu su te strukture dobile ime Golgijevo tijelo. GOLGIJEV APARAT, v. Golgijevo tijelo. GOLGIJEVO TIJELO (Golgijev aparat), stanični organel koji se nalazi u citoplazmi svih vrsta eukariotskih stanica. Posebno je dobro razvijen u žljezdanim stanicama. Sastavljeno je od niza uskih i plosnatih kanalića koji su omeđeni membranama i poredani koncentrično. S krajeva tih kanalića odvajaju se mjehurići čiji je sadržaj najčešće proteinske prirode. Većina mjehurića spaja se sa staničnom membranom i oslobađa svoj sadržaj procesom egzocitoze. Neki od mjehurića ostaju u citoplazmi kao tjelešca za razgradnju, tzv. lizosomi. Oni sadrže enzime koji mogu

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

razgrađivati proteine, nukleinske kiseline i lipide. GOLOSJEMENJAČE, drvenaste biljke (stabla ili grmovi), evolucijski starija i primitivnija skupina sjemenjača. Sjemeni zameci, a kasnije i sjemenke nalaze se bez zaštitnog pokrova “goli” na sjemenim (plodnim) ljuskama ili listovima. Oprašuju se vjetrom. Izmjena generacija (gametofita i sporofita) je pravilna. Gametofit je jako reduciran i prehrambeno ovisan o matičnoj biljci. Ženski gametofit (embrionska vreća) ne napušta sjemeni zametak, pa se unutar njega razvija i embrio mlade biljke. Muški gametofit s dvije muške gamete razvija se unutar polenovog ili peludnog zrna (muške spore, mikrospore). Među danas živućim golosjemenjačama razvojno su najprimitivnije ginko i cikas koji se oplođuju pomoću pokretnih muških gameta. Golosjemenjače su se razvile od predaka današnjih papratnjača, v. pteridosperme. Golosjemenjače su značajne: u izgradnji biljnog pokrova sjeverne polutke, u građevinarstvu, farmaciji, hortikulturi. Među izumrlim golosjemenjačama nalaze se i predci kritosjemenjača. Dijele se na nekoliko skupina od kojih su najzastupljenije četinjače. GOMOLJAČE, v. tartufi. GONADE, zajednički naziv za muške i ženske spolne žlijezde u viših životinja. U kralježnjaka muške spolne žlijezde su sjemenici (testisi), a ženske jajnici (ovariji). GONADOTROPNI HORMONI (GTH), zajednički naziv za skupinu hormona koje izlučuje prednji režanj hipofize (adenohipofiza). GTH potiču gonade na lučenje spolnih hormona i gametogenezu. U muškaraca i žena adenohipofiza izlučuje tri gonadotropna hormona: folikul-stimulirajući hormon (FSH), luteinizirajući hormon (LH) i luteotropni hormon (LTH).

GONOREJA (kapavac), spolna zarazna bolest čovjeka čiji je uzročnik bakterija gonokok. Simptomi bolesti su peckanje u mokraćovodu i gnojni iscjedak za vrijeme i nakon mokrenja. Neliječena gonoreja uzrokuje oštećenja srca i zglobova, a često uzrokuje i neplodnost. GORJANOVIĆ-KRAMBERGER, D., (1859.-1936.), hrvatski geolog, paleozoolog i paleoantropolog, koji je otkrio, obradio i objasnio fosilne ostatke Krapinskog pračovjeka. GOROSTASNI KROMOSOMI (gigantski kromosomi, politeni kromosomi), veliki kromosomi dužine nekoliko stotina μm (neki i 1000 μm) i promjera oko 50 μm. Golemi su u usporedbi s tipičnim kromosomima veličine samo nekoliko μm. Nastaju višestrukom replikacijom kromosomskih niti sastavljenih od DNA i proteina, a mogu se naći u nekim tkivima kukaca, npr. žlijezdama slinovnicama vinske mušice. GORTER, E. i GRENDEL, F., nizozemski biokemičari koji su 20-ih god. 20. stoljeća na temelju pokusa s eritrocitima utvrdili da fosfolipidi u biološkim membranama čine dvosloj. GRAAFOV FOLIKUL (Graafov mjehurić), mjehurić koji se stvara u jajnicima sisavaca oko jajne stanice. Obavijen je stanicama i ispunjen tekućinom. U njemu sazrijeva jajna stanica, a kada sazrije, Graafov folikul puca i zrela se jajna stanica zajedno s tekućinom mjehurića izbacuje u trbušnu šupljinu od kuda dospijeva u jajovod. Nakon ovulacije (sazrijevanja jajašca) sadržaj Graafovog folikula se mijenja te se od njega razvije žuto tijelo (corpus luteum), a ako ne dođe do oplodnje i bijelo tijelo (corpus albicans). GRAAFOV MJEHURIĆ, v. Graafov folikul.


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

GRABLJIVCI, v. predatori. GRAM, H., (1853.-1938.), danski bakteriolog, koji je otkrio Gram bojenje bakterija prema kojem se bakterije mogu podijeliti u dvije skupine: Gram-pozitivne i Gram-negativne bakterije. GRANULOPOEZA, v. krvotvorni organi. GREBENKE, v. novočeljuske. GRENDEL, F, v. Gorter, E. GRIFFITH, F., eksperimentirao s bakterijama reda Pneumococcus i 1928. god. dokazao mogućnost pretvorbe jednog tipa bakterije (bez sluzavog omotača) u drugi tip (sa sluzavim omotačem). GRINJE, v. paučnjaci. GRIPA (influenca), zarazna bolest dišnih organa koju prati povišena temperatura, opća slabost i bolovi u mišićima. Gripa može izazvati i upalu pluća. To je danas jedna od najčešćih bolesti koju uzrokuju virusi, tzv. viroza. GROŽĐANI ŠEĆER, v. glukoza. GTH, v. gonadotropni hormoni. GUBA, v. lepra. GUSTOĆA POPULACIJE, izražava se brojem jedinki neke vrste na nekom prostoru ili njihovom ukupnom masom u suhom ili svježem stanju (biomasom). Za utvrđivanje gustoće populacije danas se primjenjuju različite metode, a jedna od metoda je prebrojavanje ili vaganje jedinki skupljenih s prostora određene veličine. U slučajevima kada je prebrojavanje jedinki teško, primjenjuje se približna procjena gustoće koja se izražava brojkama, npr. od 1 do 5, pri čemu broj 1 označuje veoma rijetku vrstu, a broj 5 veoma brojnu vrstu.


GUŠTERAČA (pancreas), egzokrina i endokrina žlijezda, isp. Građena je od dvije vrste tkiva: žlijezdanog parenhima (acinusi) koji luči probavne enzime (vanjsko lučenje), te alfa - stanica i beta – stanica Langerhansovih otočića koji luče hormone glukagon i inzulin (unutarnje lučenje). Gušterača je smještena ispod želuca. GUŠTERAČIN SOK, na dan se proizvodi u količini od 500 do 1500 mL, a pH mu iznosi između 7,1 do 8,3. Sadržava vodu, hidrogen - kahrbonatne ione i različite probavne enzime, isp. Funkcija hidrogen karbonatnih iona je neutralizacija sadržaja himusa prispjelog iz želuca, jer probavni enzimi u crijevu djeluju na neutralnom odnosno na blago alkaličnom pH području. GUŠTERI, najbrojnija skupina današnjih gmazova, te najstariji i najprimitivniji ljuskaši. Tijelo im je pokriveno rožnatim ljuskama. Noge su im dobro razvijene. Na lubanji imaju kvadratnu kost za koju se drži donja čeljust. Usta se mogu široko otvoriti, što omogućava gutanje većeg plijena. Većina ima tjemeno oko i pokretne očne kapke. U uhu je bubnjić. Hrana su im uglavnom kukci i male životinje. Mnogi gušteri mogu u slučaju opasnosti otkinuti rep. To se zove samosakaćenje ili autotomija, isp. samoamputacija. Najčešće skupine guštera su: macaklini, kameleoni, gušterice i sljepići. U našoj zemlji poznate su npr. primorska, siva i krška gušterica s mnogim endemičnim podvrstama na Jadranskim otocima. U unutarnjosti susrećemo zelembaće, sljepiće i blavore. GUTACIJA (lat. gutta = kapljica), pojava izlučivanja vode u obliku kapljica kod nekih biljaka. Pojavljuje se kada je transpiracija vrlo slaba, a koncentracija vlage zraka velika. Kapljice vode izlaze kroz hidatode ili puči vodenice.

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

GVANIN, organski spoj s dušikom iz skupine purinskih baza. Sudjeluje u izgradnji nukleotida odnosno nukleinskih kiselina.









H HADŽI, J., zoolog, tvorac plazmodijalne teorije postanka višestaničnih životinja (metazoa). HADŽIJEVA HIPOTEZA POSTANKA METAZOA, v. hipoteze o postanku mnogostaničnih životinja. HAECKEL, E., (1834. – 1919.), njemački biolog koji je 1866. god. predložio naziv protisti za jednostanične organizme. Uveo naziv “ekologija”. HAECKELOVA HIPOTEZA POSTANKA METAZOA, v. hipoteze o postanku mnogostaničnih životinja. HALOFITI (biljke slanih staništa) biljke koje žive na tlu u kojem je prisutna veća količina soli, najčešće natrijevog klorida. Razvili su različite prilagodbe koje im omogućuju preživljavanje kao, npr. izlučivanje soli pomoću žlijezda (kod vrste Avicennia). HALUCINACIJE, opažanja koja nastaju bez podraživanja osjetila. Pojavljuju se u umno poremećenih osoba ili zbog otrova-

nja središnjeg živčanog sustava alkoholom, opojnim drogama ili dr. HAMMERLING, J., pokusima na jednostaničnoj algi roda Acetabularia dokazao da jezgra određuje građu i oblik alge. HAPLOIDAN BROJ KROMOSOMA, polovičan broj kromosoma koji se nalazi u spolnim rasplodnim stanicama, gametama i označuje se s n. Ovakav broj kromosoma rezultat je mejoze, specifičnog oblika diobe stanice pri kojoj nastaju gamete, a broj kromosoma se od početnog broja smanjuje na polovicu. Nakon stapanja gameta, odnosno oplodnje, uspostavlja se ponovo diploidan broj kromosoma. U muškaraca haploidan broj kromosoma imaju spermiji, a u žena jajna stanica i on iznosi 23 (n=23). Nakon oplodnje novonastala zigota sadrži potpun, tj. diploidan broj kromosoma i on iznosi 46 (2n=46). HAPLOIDNA GENERACIJA, prizvodi gamete ili spolne rasplodne stanice u biljaka pa se zove gametofit (isp.), tj. spolna generacija. Stapanjem muške i ženske gamete nastaje zigota. Ona se razvija u biljku, sporofit (nespolna generacija) koji je diploidan i proizvodi spore. Spore se razvijaju u spolnu generaciju koja ponovo proizvodi gamete. HAPTERE, kod preslica, dvije duge prekrižene vrpce koje služe pri raznošenju spora vjetrom. Haptere se smotaju ako se spora spusti na vlažno i pogodno tlo. HAUSTORIJ, posebne sisaljke kojima se parazitske i poluparazitske biljke, koje žive na drugim biljkama, pričvršćuju u tkivo domodara i sišu hranjive tvari. Hb, v. hemoglobin. HbA, v. eritrociti. HbF, v. eritrociti.


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

HEKSOZE, jednostavni šećeri ili monosaharidi koji sadrže šest ugljikovih atoma u svojoj molekuli. Heksoze su glukoza, fruktoza i galaktoza. HELICERE, kliješta na prednjem tijelu (uz usta) kod klještara. Služe za hvatanje plijena i obranu. Kod nekih su povezana s otrovnom žlijezdom kojom usmrćuju plijen. HEMATOKRIT, volumni udio krvnih stanica i trombocita u krvi. Hematokrit zdrave osobe je 45 % (indeks 0.45). Određuje se centrifugiranjem krvi u tankoj baždarnoj kapilari. HEMATOPOETSKI ORGANI, v. krvotvorni organi. HEMATOPOETSKI REDOVI STANICA, stanice koje čine jedan morfološki, razvojni slijed. Osnovne matične krvotvorne stanice nalaze se u koštanoj moždini i mogu se neograničeno reproducirati. Te matične (pluripotentne) stanice mogu se diferencirati u usmjerene krvotvorne stanice (eritrocitne, limfocitne, plazmatske, monocitne, trombocitne i granulocitne). Daljnji tijek diferencijacije je različit za pojedine redove stanica (eritrocitni red, limfatični red, plazmatski red, monocitni red, trombocitni red, granulocitni red). HEMATOPOEZA, stvaranje krvnih stanica. Krvne stanice žive u opticaju krvi ograničeno dugo: npr. eritrociti do 120 dana a neke vrste leukocita nekoliko dana do oko 100 dana. Hematopoeza počinje već prvih tjedana zametnog razvoja u žumanjčanoj vrećici, a kasnije se odvija u ostalim hematopoetskim tkivima i organima. HEMATURIJA, pojava eritrocita u mokraći kod nekih bubrežnih bolesti. HEMIPARAZIT (grč. hemisis = polovica, parasiteo = jedem zajedno s nekim),


poluparazit, biljna vrsta koja živi na drugoj biljci ali sadrži klorofil i može fotosintezom sintetizirati ugljikohidrate, a mineralne tvari i vodu crpi iz ksilema domadara u koji prodire pomoću sisulja, haustorija (npr. imela). HEMISESILNI ORGANIZMI, v. bentos. HEMIZIGOTI, organizmi koji imaju samo jedan alel za jedno svojstvo. HEMOCIJANIN, kemijski spoj sličan hemoglobinu, ali umjesto željeza sadrži bakar. To je krvni ili dišni pigment kod mekušaca te služi za vezanje i prijenos kisika. HEMOFILIJA, nasljedna bolest koja se očituje u nesposobnosti zgrušavanja krvi. Oboljevaju uglavnom muškarci, a prenose je žene. Odlikuje se nedostatkom jednog od brojnih kemijskih tvari nužnih u procesu zgrušavanja krvi. Najčešće nedostaje antihemofilijski globulin -faktor VIII. Gen koji je odgovoran za nastanak ove bolesti nalazi se u spolnom x kromosomu. HEMOGLOBIN (Hb), krvni pigment koji daje crvenu boju eritrocitima, odnosno krvi. Najvažniji je dio crvenih krvnih stanica, eritrocita. Sudjeluje u izmjeni plinova (kisika i ugljikovog dioksida) u tijelu. Sastoji se od međusobno vezanih bjelančevine globina i organometalnog spoja hema. Pigment hem se sastoji od protoporfirinskog dijela i iona željeza za koji se veže kisik. Nakon difuzije u krv, glavnina se kisika veže na hemoglobin eritrocita, a vrlo mala količina kisika se prenosi otopljena u krvnoj plazmi. HEMOLITIČKA ANEMIJA, bolest koja se javlja kada se eritrociti raspadaju brže nego što se stvaraju. Zbog stvaranja veće količine bilirubina javlja se i žutica.

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

HEMOLITIČKA BOLEST NOVOROĐENČADI, v. fetalna eritroblastoza.

(A), ali ipak u sebi nosi i prikriveni recesivni gen (a).

HEMOLIZA, raspadanje eritrocita, v. hemolitička anemija i transfuzijska reakcija.


HEMOROIDI v. šuljevi.

HIBERNACIJA , v. zimski san.


HIBRID, v. križanac.

HERBICIDI, kemijska sredstva za uništenje korovnih biljaka.

HIBRIDIZACIJA, v. križanje.

HERBIVORI, drugi naziv za biljojede. HERMAFRODIT, v. dvospolac. HERPES, virusna bolest koja obično uzrokuje promjene na koži u obliku mjehurića. Postoji nekoliko različitih tipova herpesa, a najčešći je herpes febrilis koji se manifestira na usnama i okolnoj koži. HETEROTROFI (heterotrofni organizmi), organizmi koji nemaju sposobnost stvarati vlastite organske spojeve, već ih moraju uzimati hranom. U heterotrofe se ubrajaju sve životinje i čovjek, a od biljaka heterotrofne bakterije i gljive. HETEROTROFNI ORGANIZMI, heterotrofi.


HETEROZIGOTI (heterozigotni organizmi, križanci, hibridi), organizmi koji nose različite alele za neko svojstvo jer su nastali spajanjem gameta koje su bile različite za dotično svojstvo. U opisima primjera križanja heterozigoti se označuju npr. Aa (heterozigot za jedno svojstvo, monohibridno križanje s dominacijom) ili a1a2 (heterozigot za jedno svojsvo, monohibridno intermedijarno križanje) ili AaBb (heterozigot za oba svojstva, dihibridno križanje s dominacijom) ili AaBB (heterozigot za jedno od dva svojstva, dihibridno križanje s dominacijom). Primjerice, heterozigot Aa u svojem vanjskom izrazu (fenotipu) nosi izgled dominantnog gena

HIDATODE, žlijezde za izlučivanje vode procesom gutacije kod nekih biljaka. Nalaze se na rubovima listova, ispod puči vodenica. HIDRANTI, pojedini polipi u zadruzi kod žarnjaka, v. obrubnjaci. HIDROFILNE TVARI, v. hidrofilnost. HIDROFILNOST, svojstvo privlačenja vode. Hidrofilne su neke molekule koje se odlikuju polarnošću (kiseline, alkoholi, amini itd.). HIDROFITI, biljke koje žive u vodenim ekosustavima. Neke su posve u vodi (vodena kuga, krocanj), a drugima samo cvjetovi i neki listovi plivaju površinom ili se izdižu iznad nje (lokvanj, lopoč). HIDROFOBNOST, svojstvo odbijanja vode. Hidrofobne su neke nepolarne molekule (različiti ugljikovodici itd.). HIDROGEN KARBONATNI IONI, v. gušteračin sok. HIDROLAZE, v. hidrolitički enzimi. HIDROLITIČKI ENZIMI (hidrolaze), skupina enzima koji sudjeluju u razgradnji različitih molekula u manje sastavne dijelove uz ugradnju molekule vode. Hidrolazama pripadaju proteaze koje proteine razgrađuju na peptide i aminokiseline, lipaze koje kataliziraju hidrolizu lipida na glicerol i masne kiseline, esteraze koje pospješuju hidrolizu estera na njihove alkohole i kiseline te nukleaze koje ubrzava-


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

ju razgradnju nukleinskih kiselina i oslobađanje nukleotida. Svi probavni enzimi su hidrolaze. U stanici, posebni stanični organeli, lizosomi obiluju tim enzimima. HIDROSFERA, Zemljina vodena ovojnica, vode tekućice i stajaćice, mora i oceani. HIDROTAKSIJA, v. taksija. HIFE, nitaste tvorevine koje izgrađuju micelij, vegetativno tijelo gljiva. HIGROFILNE ŽIVOTINJE (grč. hygros = vlažan, filos = prijatelj), životinje koje mogu živjeti samo u izrazito vlažnoj atmosferi ili u vlažnom tlu, kao npr. vodozemci, puževi golaći i gujavice. HIGROFITI (grč. hygros = vlažan, fyton = biljka), biljke koje žive u vlažnim šumama i livadama, kao npr. neki šaševi i žabnjaci. Higrofiti često imaju velike listove s tankom epidermom i mnogim pučima. HIJAZMA, mjesto “prekopčavanja” dijelova pojedinih kromatida homolognih kromosoma u crossing overu. HIMEN (djevičanski zalistak), tanka opna u predvorju rodnice. Može sadržavati jedan ili više, manjih ili većih otvora kroz koje može istjecati menstruacijska krv. HIMENIJ, v. mješinarke. HIMUS, v. želudac. HIPERGLIKEMIJA, stanje povišene razine glukoze u krvi. HIPERPARATIREODIZAM, metabolički poremećaj zbog prekomjerna lučenja paratireoidnog hormaona (parathormona). Dolazi do povećane razine kalcija u krvi, koja remeti tjelesni metabolizam. Kalcij se gubi iz kostiju, koje postaju krhke i lako lomljive, a povećan promet kalcija kroz bubrege može uzrokovati pojavu bubrežnih kamenaca.


HIPERTENZIJA (hipertonija), stanje povišenog krvnog tlaka koje najčešće prati aterosklerozu, oboljenje krvnih žila. HIPERTIREOZA, pretjerana aktivnost štitnjače. Dolazi do prekomjernog lučenja hormona tiroksina koji povećava bazalni metabolizam. Povećani su frekvencija disanja i rad srca. U nekih osoba se može pojaviti oteklina na vratu, tj. guša (gušavost). HIPERTONIČAN, onaj koji ima veći potencijalni osmotski tlak (π*, on raste s koncentracijom otopljene tvari). Na primjer, ako živu stanicu stavimo u hipertoničnu otopinu voda će osmozom izlaziti iz nje. HIPERTONIČNA OTOPINA je otopina koja ima veću koncentraciju otopljenih tvari od normalne, tj veći potencijalni osmotski tlak od normalnog. Npr. tjelesna tekućina može biti hipertonična gubitkom dijela (otapala) vode ili unošenjem u tijelo većih količina otopljenih tvari. Ako živu stanicu stavimo u hipertoničnu otopinu voda će osmozom izlaziti iz nje. HIPERTONIJA, v. hipertenzija. HIPOFIZA, jedna od najvažnijih žlijezda s unutarnjim izlučivanjem. Nalazi se na bazi mozga, a veličine je zrna graška. Građena je od tri režnja: prednji režanj (adenohipofiza), srednji režanj (pars intermedia) i stražnji režanj (neurohipofiza). Izlučuje veliki broj hormona od kojih neki utječu na izlučivanje hormona ostalih žlijezda s unutarnjim izlučivanjem. HIPOGLIKEMIJA, stanje snižene razine šećera glukoze u krvi. Suprotno od hipoglikemije je hiperglikemija ili stanje povišene koncentracije glukoze u krvi. Normalna koncentracija glukoze u krvi (GUK) iznosi oko 5.5 mmol/L.

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

HIPOPARATIREODIZAM, smanjeno lučenje parathormona. Dolazi do smanjenja razine kalcija u krvi, javljaju se grčevi mišića, otežani su disanje i rad srca uz slab razvitak koštanog tkiva i zuba.

HIPOTIREOZA, stanje smanjenog lučenja tiroksina. Hipotireoza se javlja zbog nedostatka joda u hrani ili vodi za piće. Može uzrokovati endemsku gušavost ili kretenizam.

HIPOTALAMUS, sastavni dio međumozga koji ima važnu ulogu u regulaciji različitih vegetativnih funkcija organizma, npr. termoregulaciji. U njemu se stvaraju i različite tvari koje reguliraju rad hipofize. Na primjer, u hipotalamusu se stvaraju faktori za oslobađanje gonadotropnih hormona koji dolaze u hipofizu i potiču je na lučenje gonadotropnih hormona.

HIPOTONIČAN, onaj koji ima manji potencijalni osmotski tlak (π*). Na primjer, ako živu stanicu stavimo u hipotoničnu otopinu voda će osmozom ulaziti u nju.

HIPOTENZIJA (hipotonija), stanje sniženog krvnog tlaka. HIPOTEZE O POSTANKU MNOGOSTANIČNIH ŽIVOTINJA U suvremenoj filogeniji iskristalizirale su se dvije hipoteze o postanku mnogostaničnih životinja (metazoa). Prema E. Haeckelu mnogostaničari su se razvili iz zadružnih kolonijalnih prabičaša od nekoliko tisuća bičastih združenih stanica (kolonijalna teorija). Unutar takve zadruge postojala je podjela rada, t.j. stanice su se specijalizirale za različite zadaće: hranjenje, razmnožavanje, zaštita. Prvobitne su metazoe bile zrakasto simetrični oblici, slične današnjim žarnjacima. Prema J. Hadžiju prve mnogostanične životinje bile su bilateralno simetrične i pokretne, slične primitivnim virnjacima i razvile su se iz mnogojezgrenih trepetljikavih oblika praživotinja. Dolazilo je do više mitotskih dioba jezgara bez podjele tijela praživotinje. S vremenom su se pojedine jezgre okružile s nešto citoplazme, obavile staničnom membranom i preuzimale različite funkcije: površinski sloj stanica pokrovnu, zaštitnu i osjetilnu, a središnji sloj hranidbenu zadaću. Teorija se naziva i plazmodijalna jer se masa citoplazme s mnogo jezgara obično zove plazmodij.

HIPOTONIČNA OTOPINA je otopina koja ima manju koncentraciju otopljenih tvari od normalne, tj manji potencijalni osmotski tlak od normalnog. Npr. tjelesna tekućina može biti hipotonična razrjeđenjem većim količinama vode, gubitkom mineralnih tvari ili uzimanjem hrane s premalo (otpljenih) mineralnih tvari. Ako živu stanicu stavimo u hipotoničnu otopinu voda će osmozom ulaziti u nju. HIPOTONIJA, v. hipotenzija. HIPOVITAMINOZA, nedostatak vitamina u organizmu koji može izazvati različite poremećaje, npr. nedostatak vitamina A uzrokuje noćnu sljepoću, nedostatak vitamina B kompleksa uzrokuje različite metaboličke bolesti i promjene (dermatitis, srpasta anemija), nedostatak vitamina C uzrokuje skorbut, a nedostatak vitamina D poremećaj u metabolizmu kalcija koji dovodi do rahitisa. HISTAMIN, biogeni amin, tkivni hormon, produkt stanica imunološkog sustava za vrijeme alergijske reakcije. Histamin izaziva simptome kao što je prekomjerno izlučivanje sluzi, promjene na koži, crvenilo, mrlje, svrbež i otežano disanje. HISTIDIN, kemijski spoj iz skupine aminokiselina. HISTOGENEZA, jedna od etapa embrionalnog razvitka većine višestaničnih životinja u kojoj se formiraju tkiva.


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

HISTOLOGIJA, znanost o biljnim i životinjskim tkivima. HISTONI, skupina bjelančevina bazične naravi koje vezane s DNA i nekim drugim bjelančevinama izgrađuju kromatin, odnosno kromosome, isp. HITIN, polimer glukozamina, glavni sastojak oklopa člankonožaca i stijenki hifa u većine gljiva. HIV (Human Immunodeficiency Virus), v. AIDS. HOANE (choane), unutarnji nosni otvori kod nosnoprolaznica, isp. HOANOCITI, kod spužve bičaste stanice koje okružuju spongocel. Hoanociti stvaraju struju vode iz koje uzimaju hranu i kisik. U probavnim mjehurićima bičastih stanica hrana se djelomično ili potpuno probavi, isp. spužve. HOLOPARAZIT (grč. holos = potpun, parasiteo = jedem zajedno s nekim), potpuni parazit, biljna vrsta koja živi parazitski na drugoj biljci i ne sadrži klorofil te ne može stvarati organske spojeve fotosintezom, nego sve hranjive tvari crpi od domadara (npr. vilina kosa, volovod i potajnica). HOMEOSTAZA je održavanje stalnih, nepromijenjenih optimalnih životnih uvjeta u tijelu. HOMEOTERMNI ORGANIZMI, organizmi koji su u stanju održavati stalnu tjelesnu temperaturu neovisno o vanjskim ili unutarnjim čimbenicima. Homeotermni organizmi su ptice i sisavci. HOMO ERECTUS (uspravni pračovjek), vrsta iz roda Homo (čovjek) s vidljivim ljudskim obilježjima. Bića koja su pripadala ovoj vrsti imala su volumen mozga oko 1000 cm3, gotovo uspravan hod i upotrebljavala su dobro isklesano oruđe i


vatru. Najpoznatiji nalazi ove vrste su javanski pračovjek ili pitekantropus s otoka Jave i kineski pračovjek ili sinantropus iz blizine Pekinga u Kini. Starost nalaza ove vrste je između 300 tisuća i 2 milijuna godina. HOMO SAPIENS (umni čovjek), vrsta kojoj pripadaju današnji ljudi. Smatra se da su i neandertalski i krapinski pračovjek izumrle rase ove vrste. Ovoj vrsti pripada i kromanjonski ili fosilni čovjek koji je živio prije 30 do 40 tisuća godina, a gotovo se nije razlikovao od današnjeg čovjeka, v. dodatak 5. HOMOLOGNI GENI, v. aleli. HOMOLOGNI KROMOSOMI, kromosomi koji su po vanjskim osobinama međusobno slični. U svim tjelesnim stanicama onih organizama koji su nastali oplodnjom od dvaju roditelja, homologni kromosomi dolaze u parovima gdje jedan član svakog para potječe od majke, a drugi član od oca. U tjelesnim stanicama čovjeka nalazi se 46 kromosoma od kojih su 22 para autosoma (kromosomi koji ne određuju spol) i 1 par spolnih kromosoma tipa xx (u žena) ili xy (u muškaraca). HOMOLOGNI ORGANI (grč. homoios = isti, logos = govor, riječ), organi u raznih skupina organizama koji imaju isto evolucijsko podrijetlo, a funkcija im može biti različita. Iako su naizgled vrlo različiti, npr. noga vodozemca, ruka čovjeka i krilo šišmiša; oni su posve jedinstveno građeni. Kod biljaka su bodlja kaktusa i list neke druge biljke istog podrijetla. HOMOZIGOTI (homozigotni organizmi), organizmi koji nose iste alele za neko svojstvo jer su gamete iz kojih su ti organizmi nastali sadržavale iste alele za dotično svojstvo. U opisima primjera križanja homozigote označujemo npr. s AA (dominantan homozigot, monohibridno

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

križanje s dominacijom) ili s aa (recesivan homozigot, monohibridno križanje s dominacijom). Koristimo također oznake a1a1 (intermedijarni homozigot, monohibridno intermedijarno križanje), AABB (dominantan homozigot za oba svojsva, dihibridno križanje s dominacijom) ili AABb (dominantan homozigot za samo jedno od dva svojstva, dihibridno križanje s dominacijom) i sl. Kod nasljeđivanja dominantnih i recesivnih obilježja recesivni gen može doći do izražaja samo u slučaju homozigotnosti (aa) jer ga onda ne nadjačava njegov dominantni alel. HOMOZIGOTNI ORGANIZMI, v. homozigoti. HONDROBLAST, v. hrskavično tkivo. HONDROKLAST, v. hrskavično tkivo. HOOKE, R. (1635. – 1703.), engleski mikroskopičar koji je prvi spomenuo stanicu 1665. god. On je pod svojim jednostavnim mikroskopom promatrao tanke prereze pluta i ugledao strukturu poput pčelinjeg saća te njezine sastavne dijelove nazvao stanicama. HORDA, v. svitak. HORMON RASTA (somatotropni hormon, STH), hormon kojega luči prednji režanj hipofize (adenohipofiza); djeluje na sve stanice tijela i stimulira u njima anabolitičke reakcije (reakcije sinteze), a samim tim i rast organizma. HORMON STIMULACIJE FOLIKULA, v. FSH. HORMON STIMULACIJE INTERSTICIJSKIH STANICA, v. ICSH. HORMONI (grč. hormao - potičem), kemijske tvari koje u krv luče žlijezde s unutarnjim izlučivanjem ili endokrine žlijezde, isp. Po kemijskom sastavu djelimo ih na bjelančevinaste i steroidne hormone.

HRANIDBENI LANAC, lanac čiji su članovi povezani odnosima ishrane. Različite oblike hranidbenih lanaca susrećemo u svakoj biocenozi. Na prvom mjestu hranidbenih lanaca redovito su autotrofni proizvođači. Nakon njih dolaze mnogobrojne serije potrošača (konzumenata). Primjer hranidbenog lanca jezera: planktonska alga, I. član, proizvođač → planktonski račić, II. član, potrošač-biljojed → riba ukljeva, III. član, potrošač-mesojed 1 → riba pastrva, IV. član, potrošač-mesojed 2 → ptica kormoran, V. član, potrošač-mesojed 3. U svakom hranidbenom lancu svaki prethodni član mesojed je manji od slijedećeg člana u lancu. Većinom je završni član veličinom tijela najkrupniji. Također, svaki prethodni član u lancu svojom brojnošću osigurava opstanak slijedećem članu, čija brojnost mora biti manja. Tako je i ukupna biomasa svakog idućeg člana hranidbenog lanca sve manja, kao i ukupna energija. HRANJIVE PODLOGE, podloge koje sadrže sve potrebne tvari za uzgoj i razvitak stanica, tkiva i organizama u laboratorijskim uvjetima. Na primjer, najpoznatija hranjiva podloga za uzgoj bakterija je agar, tvar koja se dobiva od nekih vrsta crvenih alga. HRSKAVICA, mekši dio kostura. Građena je od hrskavičnog tkiva, isp. Dolazi u zglobovima i na mjestima gdje se kosti povezuju međusobno, a nalazimo je i u vanjskom uhu, vrhu nosa, grkljanu i dušniku. HRSKAVIČNO TKIVO, sastoji se od hrskavičnih stanica povezanih elastinom i hijalinom. Hrskavično se tkivo umnožava djelovanjem stanica hondroblasta, a razara s pomoću hondroklasta. HRSKAVIČNJAČE, morske ribe (isp.) sa hrskavičnim kosturom. U hrskavičnoj


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

kralježnici imaju i svitak. Koža im je prekrivena romboidnim ljuskama sa zubićima (plakoidne ljuske). Nemaju plivaći mjehur. Tanko crijevo ima nabor, zavojiti zalistak, kojim se povećava površina za uzimanje hrane. Dišu preko škržnih pukotina na površini tijela. Mužjakove podrepne peraje služe za parenje. Oplodnja je unutarnja. Morske mačke i psi legu jaja, a neki su morski psi i živorodni. Najbrojnija skupina su prečnouste. Usta su im s donje strane glave položena poprečno na uzdužnu os. Najpoznatije hrskavičnjače su morski psi, morske mačke, raže i drhtulje. HUMORALNA IMUNOST, oblik stečene imunosti u kojoj organizam nakon podražaja antigenom stvara cirkulirujuća protutijela, v. limfociti B.

I ICSH (engl. Interstitial Cell Stimulating Hormone, hormon za stimulaciju intersticijskih stanica), jedan od tri gonadotropna hormona koje izlučuje prednji režanj hipofize. Djeluje na intersticijske stanice sjemenika koje izlučuju spolne hormone. ICSH u muškaraca isto je što i LH u žena.

sisavaca. U žena se taj proces zbiva 7. i 8. dana nakon oplodnje. IMUNA MEMORIJA (imunološko pamćenje), proces pri kojem se u opetovanoj zarazi javlja brža i burnija reakcija protiv tog istog antigena. Nositelji imune memorije su plazma - stanice jer se one duže zadržavaju u organizmu. Taj tip imunološke reakcije nazivamo sekundarnom reakcijom, za razliku od primarne reakcije koja nastaje pri prvom ulasku antigena u organizam. IMUNITET, otpornost organizma prema različitim uzročnicima bolesti kao i prema svim organizmu stranim tvarima. Razlikujemo dva osnovna tipa imuniteta: prirođeni (nespecifični) i stečeni (specifični) imunitet. Prirođeni imunitet postoji od samog rođenja i štiti organizam od svih antigena. Stečeni imunitet stječe se tijekom života prema točno određenim antigenima kada oni dospiju u organizam. IMUNIZACIJA, postupak kojim organizam na umjetni način stječe imunitet. Na pojavi imune memorije temelji se zaštita od različitih bolesti aktivnom, ili pasivnom imunizacijom. Aktivna imunizacija postiže se cijepljenjem, a pasivna najčešće ubrizgavanjem protutijela proizvedenih u nekoj drugoj jedinki.

ILEUM, v. tanko crijevo.

IMUNODEFICIJENCIJA (imunoinkompetencija), nesposobnost organizma da se brani od infekcije zbog nedostatne funkcionalne sposobnosti imunološkog susutava. Taj je poremećaj uzrokovan najčešće bolešću pojedinih organa imunohematopoetskog sustava (koštana srž, limfni čvorovi, timus). Može biti prirođena ili stečena (AIDS) imunodeficijencija.

IMPLANTACIJA JAJAŠCA, proces “ukopavanja” jajne stanice u sluznicu maternice koji se događa nakon oplodnje u

IMUNOGLOBULINI (Ig, γ-globulini), proteini koji se nalaze u krvnoj plazmi, a čija je uloga da kao antitijela štite orga-

Ig, v. imunoglobulin. IKRICA, začahurene ličinke trakavice, poput mjehurića i veličine oko 1 cm. U ikrici nespolnim razmnožavanjem nastane mnogo nepotpuno razvijenih mladih trakavica. Ikrica se razvija u mišićima, ali i u drugim organima.


____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

nizam od zaraze. Nastaju u plazma – stanicama. Imunoglobulini se specifično vežu za stranu česticu (antigen) u antigen – protutijelo kompleks te tako učine antigene nedjelotvornim. Poznato je pet vrsta imunoglobulina: IgA, IgD, IgE, IgG i IgM. IMUNOLOŠKA REAKCIJA, imunološki specifični odgovor organizma nakon ulaska antigena . Sastoji se od prepoznavanja antigena i reakcije protiv tog istog antigena stvaranjem antitijela (protutijela) tj. imunoglobulina, v. stečena imunost. IMUNOLOŠKO PAMĆENJE, v. imuna memorija. IMUNOSNI (imunološki) SUSTAV, osigurava tijelu imunitet. Čine ga imunosna tkiva i organi: timus, koštana moždina, slezena i limni čvorovi, te stanice u funkciji obrane tijela od infekcije: fagociti (mikrofagi i makrofagi) i limfociti. Imunosna tkiva i organe djelimo na središnje (imaju prvu ulogu u proizvodnji i raseljavanju stanica značajnih za obranu tijela; to su timus i koštana moždina) i periferne (razvili su se pod kontrolom primarnih organa; to su slezena, limfni čvorovi te limfatičko tkivo) organe. IMUNOST, v. imunitet. IMUNOTOKSIČNI OTROVI, otrovi koji dovode do slabljenja imunološke reakcije na različite mikrobe (npr. lijekovi, pesticidi). INDUCIRANE MUTACIJE, v. mutacije. INDUSTRIJSKI MELANIZAM, vrsta prirodnog odabira gdje se povećava broj tamnih organizama (npr. leptira brezove grbe) u industrijskim područjima. Otkriveno je da su glavnu ulogu u povećanju postotka tamnih leptira imale mutacije i predatori. Svijetle oblike leptira ptice lakše uočavaju na tamnoj podlozi i uzimaju ih za

hranu, pa se brojnost tamnih oblika povećava. IN VITRO FERTILIZACIJA (izvantjelesna oplodnja), oplodnja jajne stanice u laboratorijskim uvjetima izvan tijela žene. Primjenjuje se u liječenju bračne neplodnosti. INFARKT SRČANI, odumiranje dijela srčanog mišića zbog neprokrvljenosti koja može nastupiti ako se smanji ili obustavi protok krvi kroz koronarne arterije, v. tromboza i ateroskleroza. Glavni simptom srčanog infarkta je jaka bol u sredini prsnog koša koja se širi u područje vrata, čeljusti i prvenstveno u lijevu ruku. INFLUENCA, v. gripa. INKRUSTACIJA (lat. in = u, crusta = kora), proces fosilizacije pri kojemu se na površini organizama istaloži mineralna tvar i tako sačuva vanjski oblik organizma. INSEKTICIDI, kemijska sredstva protiv kukaca nametnika i štetnika. INSPIRACIJSKO SREDIŠTE, nalazi se u produženoj moždini. U njemu se stvara osnovni ritam disanja, a ostvaruje se slanjem spontano nastalih električnih impulsa do ošita i ostalih inspiracijskih mišića. INTERFAZA, razdoblje u životu stanice između dviju jezgrinih dioba. U različitih vrsta stanica traje različito. Dijelimo je na tri faze: G1, S, G2 i G0. G1-faza (od engl. gap = prekid, jaz) karakterizirana je sintetiziranjem RNA i bjelančevina u stanici što znači da stanica raste i da se njezin volumen povećava. Traje najdulje. S-faza (od engl. synthesis = sinteza) karakterizirana je udvostručavanjem DNA što je osnova za udvostručenje svakog pojedinog kromosoma. G2-faza je (najkraće) razdoblje kada se stanica priprema za diobu. U G0-fazi su stanice koje se ne dijele, već obavljaju određenu funkciju.


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

INTERFERONI, bjelančevinaste tvari koje stvara imuni sustav. Sprečavaju razmnožavanje virusa u organizmu. INTERSTICIJSKE STANICE (Leydigove stanice), specijalizirane stanice sjemenika koje leže između sjemenih kanalića. One luče spolne hormone, tj. imaju endokrinu ulogu. INTRACELULARNA (unutarstanična ) PROBAVA, hranjive se tvari probavljaju u probavnim vakuolama praživotinja, isp. INVERZIJA, kromosomska promijena, obrnuti poredak gena jednog kromosomskog segmenta. INZULIN, hormon kojega izlučuje gušterača, a pomaže pri transportu glukoze iz krvi u stanice. Tako omogućuje oksidativnu razgradnju ili pospremanje glukoze u glikogen, osobito u stanicama jetre i u mišićima. Rezultat djelovanja inzulina je sniženje razine glukoze u krvi. Smanjeno izlučivanje inzulina ili potpuni prestanak izlučivanja zbog oštećenja gušterače uzrokuje šećernu bolest (dijabetes). IVANOVSKI, D.J., ruski znanstvenik koji je istražujući mozaičnu bolest duhana 1892. god. prvi upozorio na postojanje virusa. IZDANAK, stabljika s listovima u kopnenih biljaka. IZMJENA GENERACIJA, izmjena haploidne i diploidne generacije u biljaka. IZOLACIJA (tal. isolare = odijeliti, osamiti), odijeljenost među životnim skupinama biljaka ili životinja, tj. među populacijama ili dijelovima populacija raznih vrsta tako da se međusobno ne dodiruju (geografska ili prostorna izolacija) ili se ne miješaju zbog npr. ekoloških, etoloških ili spolnih (morfoloških, mehaničkih) izola-


cijskih mehanizama. Izolacija predstavlja jednu od pokretačkih sila evolucije. IZOLACIJSKI MEHANIZMI, mehanizmi očuvanja genoma pojedinih vrsta, tj. ograničenje izmjene gena između jedinki zasebnih populacija. Na taj se način zaštićuje genetička cjelovitost vrste. Izolacijski mehanizmi se dijele na vanjske ili mehanizme prije parenja i unutarnje ili mehanizme poslije parenja. IZOLEUCIN, kemijski spoj iz skupine aminokiselina. IZOSPORE (grč. isos = isti, jednak), međusobno jednake nespolne rasplodne stanice (spore). Nalazimo ih kod npr. paprati i preslica. IZOTONIČNA OTOPINA je otopina koja ima isti osmotski tlak kao stanična tekućina, odnosno krvna plazma kada su koncentracije njihovih otopljenih tvari normalne. Ako živu stanicu stavimo u izotoničnu otopinu voda neće osmozom ni ulaziti u nju ni izlaziti iz nje. IZVANSTANIČNA TEKUĆINA nalazi se u tijelu izvan stanica. U ljudskom tijelu je ima oko 15 litara. Glavni sastojci su voda, natrijev kation (Na+) i kloridni ion (Cl–). Ljudska izvanstanična tekućina ima pH 7.4. Međustanična tekućina čini najveći dio izvanstanične tekućine, oko 13 litara. Ostatak je krvna plazma, žućkasta tekućina koja se bitno ne razlikuje od međustanične tekućine osim što plazma sadrži veću količinu specifičnih bjelančevina albumina, globulina i fibrinogena koje imaju značajnu ulogu u raznolikoj funkciji krvi. Krvna plazma zajedno s krvnim stanicama čini punu krv. IZVANTJELESNA OPLODNJA, v. in vitro fertilizacija.

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE


do 900 cm3 i imao je gotovo uspravan hod. Ime je dobio po svom nalazištu, otoku Javi.

JAJAŠCE, v. jajna stanica.


JAJE, v. jajna stanica.

JEDNOOTVORI, najprimitivniji današnji sisavci.To su jedini sisavci koji nesu jaja i imaju nečisnicu koja se otvara van jednim otvorom (ime!). Iz mliječnih polja na trbuhu izlazi mlijeko koje mladi ližu. Žive u Australiji. Najpoznatija je vrsta čudnovati kljunaš.

JAJNA STANICA (jajašce, jaje), ženska spolna rasplodna stanica ili ženska gameta koja se redovito razlikuje od muške po tome što je veća i nepokretna. Nalazimo je i u biljaka i životinja. U žena, jajna stanica se razvija i sazrijeva u jajniku (ovariju) unutar Graafovog folikula. JAJNICI (ovariji), ženski spolni organi ili žlijezde višestaničnih životinja u kojima se razvijaju ženske spolne stanice. U žena su to parni organi koji leže s lijeve i s desne strane trbušne šupljine. Ovalnog su oblika, čvrste građe, u odraslih žena veličine badema mase između 10 i 20 g. Osim što se u njima odvija proces stvaranja ženskih spolnih stanica (oogeneza), imaju i endokrinu ulogu odnosno lučenje ženskih spolnih hormona (estrogen, progesteron). JAJOVOD (tuba uterina), dio ženskog spolnog sustava mnogih beskralježnjaka i svih kralježnjaka. Izgleda poput cijevi ili kanala. U žena je to parni organ čija je uloga prihvaćanje jajne stanice iz trbušne šupljine i provođenje do maternice. U njemu se u normalnim uvjetima zbiva oplodnja jajne stanice. Iz žljezdanih se stanica luče sekreti koji hrane jajnu stanicu i zigotu te održavaju blagu lužnatost sredine. JANSSEN, Z. nizozemski optičar koji je u postavivši dvije leće na određenu međusobnu udaljenost dobio povećanu sliku promatranih predmeta. JAVANSKI PRAČOVJEK (pitekantropus), jedan od izumrlih oblika čovjekovih predaka koji se danas ubraja u vrstu uspravnog pračovjeka (Homo erectus). Bio je visine oko 145 cm s volumenom mozga

JEDNOSTAVNI ŠEĆERI, v. ugljikohidrati. JEDNOSTRUKA MEMBRANA, tanka ovojnica (7-10 nm) koja obavija stanicu, ali i neke stanične organele: lizosome i endoplazmatsku mrežicu. Građena je od proteina i lipida pa se naziva i lipoproteinska ovojnica. Osim jednostruke membrane u eukariotskim stanicama se nalazi i dvostruka membrana koja obavija jezgru, mitohondrije i kloroplaste. JEDNOSUPNICE, razred kritosjemenjača. Najčešće su porodice i njihovi predstavnici: trave (npr. pšenica, riža, kukuruz) i ljiljani (npr. tulipan, razne vrste luka). Osobine jednosupnica Jedna supka u sjemenci; Embrio lateralno (postrance) smješten u sjemenci; Žile u stabljici nepravilno raspoređene; Žile zatvorene, tj. bez kambija; Nemaju sekundarni rast u debljinu; Nervatura lista prugasta, između žila nema međusobno mrežasto povezanih žilica; Ocvijeće nerazlučeno u čašku i vijenčić; Ocvijeće i prašnici većinom s 3 člana u krugu. JEDNJAK, mišićna cijev između ždrijela i želuca, dio je probavila. Progutana hrana putuje prema želucu, uzastopnim steza-


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

njem mišićne stijenke, peristaltikom. Na početku želuca nalazi se prstenasti – kardijalni mišić (sfinkter), koji se opušta kako bi propustio hranu u želudac odnosno steže da bi spriječio povrat hrane u jednjak. JEJUNUM, v. tanko crijevo. JETRA, najveća žlijezda u tijelu. Teška je oko 1,5 kg.. Jetra je ključni organ metabolizma i probave u organizmu, ali ima i niz drugih uloga. Izgrađuje, razgrađuje i pohranjuje ugljikohidrate, masti i bjelančevine; pretvara ih jedne u druge; stvara činitelje zgrušavanja; uništava, inaktivira i izlučuje štetne i nepotrebne tvari; izlučuje žuč, proizvodi globuline pa igra važnu ulogu u obrambenom sustavu organizma. JEZGRA (stanična jezgra, nukleus, karion), najveći i najvažniji stanični organel eukariotskih stanica jer sadrži informaciju za sintezu proteina stanice, a ti proteini određuju sve strukture i funkcije u stanici. Za vrijeme interfaze ili razdoblja između dvije diobe stanice u jezgri se nalazi: kromatin, jezgrin sok, jedna ili više jezgrica i svi su skupa obavijeni jednom dvostrukom membranom, tj. ovojnicom. U vrijeme diobe stanice (profaza mitoze, profaza I i II) u jezgri nastaju posebne strukture – kromosomi, dok se jezgrica i jezgrina ovojnica razgrađuju i gube. U čovjeka, jezgru nalazimo u svim stanicama osim u crvenim krvnim stanicama ili eritrocitima. JEZGRICA (nukleolus), stanična struktura koja se nalazi unutar jezgre. U njoj se sintetiziraju ribosomska ribonukleinska kiselina (rRNA). JUŽNI PRAČOVJEK, v. australopitekus.

K KALORIMETAR, sprava kojom se mjeri energetska vrijednost hrane tzv. kalorimetrijska bomba. Osušeni (dehidrirani) uzorak usitnjene hrane spaljuje se uz prisutnost kisika (oksidira) do pepela. Toplina koja se oslobađa spaljivanjem uzorka hrane preračunava se u Joule - J (džule) osnovne jedinice za energiju. KALUS, skupina nediferenciranih stanica u biljaka koja nastaje pri ozljedama zeljastih i drvenastih biljaka. Neke se stanice kalusa diferenciraju i izgrade ono tkivo koje je oštećeno ozljedom. Takav način zarašćivanja rana kalusom bitan je u postupcima cijepljenja biljaka. KALVINOV CIKLUS, v. reakcije u tami. KAMBIJ, vrsta tvornog staničja u drvenastih biljaka; nalazi se između kore i drva stabljike. Kambij omogućuje rast stabljike u debljinu i sudjeluje u formiranju provodnih tkiva (floema i ksilema). KANCEROGEN (karcinogen), tvar što izaziva nastanak raka. KAPILARNO KLUPKO BUBREGA, v. glomerul. KAPILARNOST, kod biljaka pojava dizanja vode u kapilari. Omogućena je svojstvima molekula vode: kohezije i adhezije. KAPLAN, R. objavio matematički dokaz abiotičkog nastanka prvih organizama. KAPSIDA, proteinska ovojnica nukleinske kiseline kod virusa. KARAKTERISTIČNE VRSTE u biocenozi, vrste koje su tamo zastupane s velikim postotkom stalnosti. One ne moraju biti i dominantne vrste. Planinska je ševa karakteristična u planinskim travnjacima, ali je malobrojna pa nije dominantna.


____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

KARAKTERISTIČNI FOSILI, v. provodni fosili. KARBAAMINOHEMOGLOBIN, molekula hemoglobina koja prenosi vezani ugljikov dioksid. KARBON (lat. carbo = ugljen), ugljeno doba, jedno od geoloških razdoblja nazvano po bogatim naslagama ugljena; započeo je otprilike prije 275 milijuna godina i trajao je 50 milijuna godina. U vrijeme karbona vlažna i topla klima omogućila je razvoj biljnog svijeta, posebno drvenastih papratnjača od kojih je i nastala najveća količina kamenog ugljena. U vrijeme karbona pojavljuju se prve golosjemenjače, a od životinja prvi gmazovi. KARBONIZACIJA, v. pougljenjivanje. KARCINOGEN, v.kancerogen. KARIOGAMIJA, kod gljiva, stapanje muške i ženske jezgre u jednu jezgru. KARIOKINEZA, podjela jezgre u vrijeme diobe stanice (mitoze, mejoze) koja prethodi citokinezi, podjeli citoplazme. KARION, v. jezgra. KARIOTIP, citološki prikaz potpune kromosomske garniture (svih kromosoma) pojedine stanice nekog organizma. U svim tjelesnim stanicama čovjeka nalazi se potpuna kromosomska garnitura (diploidna garnitura) od 46 kromosoma koji su prema dogovoru znanstvenika raspoređeni po obliku i veličini i označeni brojkama. Autosomi ili nespolni kromosomi raspoređeni su prema sličnosti u 22 para, a 1 par čine spolni kromosomi. Parovi autosoma grupiraju se u 7 skupina na taj način da parovi 1,2 i 3 pripadaju A skupini, 4 i 5 B skupini, 6, 7, 8, 9, 10, 11 i 12 C skupini, 13, 14 i 15 D skupini, 16, 17 i 18 E skupini, 19 i 20 F skupini, a 21 i 22 G skupini. Upoznavanje kariotipa čovjeka

pomoglo je znanstvenicima da otkriju mnoge genetski uvjetovane anomalije i bolesti. KARNIVORI, drugi naziv za mesojede. KARNIVORNE (mesojedne) BILJKE, biljke koje se povremeno hrane sitnim životinjama, najčešće kukcima (kukcojedne ili insektivorne biljke) čijom probavom dobivaju potrebne mineralne tvari, posebice dušik. Sve te biljke imaju posebne žlijezde koje luče probavne enzime. Žive na siromašnim tlima. To je npr: rosika. KATABOLIZAM, skup kemijskih i biokemijskih procesa razgradnje većih molekula u manje jedinice. KATADROMNE SELICE, ribe koje žive u slatkoj vodi, a radi mriještenja zalaze u more, npr. jegulje, isp. selidbe riba. KATALAZA, enzim koji ubrzava razgradnju vodikovog peroksida, štetnog spoja koji nastaje u stanici prilikom metabolizma masti. KATALIZA, kemijska reakcija ubrzana utjecajem (bio)katalizatora (enzima). KEMIJSKA ENERGIJA, energija pohranjena u kemijskim vezama različitih kemijskih spojeva. Za sve životne aktivnosti i biljne i životinjske stanice potrebna je energija. Stanica do te energije dolazi razgradnjom energetski bogatih organskih spojeva u procesu staničnog disanja. S druge strane, formirajući kemijske spojeve bogate energijom, stanica u stvari pohranjuje višak energije koji se javlja u procesima staničnog disanja. Kemijski procesi kojima se formiraju i kojima se razgrađuju energetski bogati spojevi su procesi oksidacije i redukcije. KEMOAUTOTROFI, organizmi koji energiju potrebnu za život dobivaju od kemijskih reakcija, oksidacijom anorgan-


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

skih tvari: amonijaka, sumpornih spojeva, željezovih iona, mangana i dr. Kemoautotrofni organizmi su prokarioti, npr. nitrificirajuće bakterije, isp. KEMOFOSILI, najstariji oblik fosila kemijskog podrijetla. KEMONASTIJE, v. nastije. KEMOSENZITIVNO PODRUČJE, dopunsko respiracijsko središte koje se nalazi u produženoj moždini i djeluje na inspiracijsko središte. To se područje aktivira porastom razine ugljikovog dioksida u krvi i šalje preko inspiracijskog središta dopunske impulse prema dišnim mišićima. KEMOTAKSIJE, v. taksija.

KISELE KIŠE, padaline koje su zakiseljene zagađivačima atmosfere: sumpornim dioksidom, dušikovim oksidom, ugljikovim dioksidom i ugljikovim monoksidom. Ti se plinovi otapaju u vodi kiša i pod utjecejem Sunčeva svjetla i atmosferskog kisika nastaju kiseline. Kisele kiše djeluju štetno na sve ekosustave. KISIK, O2, kemijski element, neophodan za život svih organizama (isp. elementarni sastav). Organizmi ga troše u procesu disanja, o oslobađa se procesom fotosinteze. Smatra se da je sav kisik u atmosferi nastao kao rezultat fotosintetske aktivnosti zelenih biljaka. Najveće količine kisika potječu od velikog broja fitoplanktonskih organizama mora i oceana.

KEMOTERAPIJA, v. citostatici.

KISTAC, v. penicilijum.

KEMOTROPIZAM, v. tropizmi

KIŠNA ALGA, v. zelene alge.

KERATIN, strukturalna bjelančevina koja izgrađuje npr. kosu, nokte i perje. Ta je svestrana bjelančevina lagana, savitljiva i jaka. Stijenka spore gljive sluznjače također je od keratina. KEROGEN, netopljive organske tvari koje nastaju u stijenama u obliku kemofosila. KINESKI PRAČOVJEK (sinantropus), jedan od izumrlih oblika čovjekovih predaka koji se smatra pripadnikom vrste uspravnog čovjeka (Homo erectus). Naziv je dobio po nalazištu, Kini. Starost nalaza iznosi 300 do 500 tisuća godina što znači da datira iz perioda srednjeg kvartara, pleistocena. Volumen mozga iznosio mu je oko 1000 cm3, poznavao je vatru i koristio primitivno kameno oruđe. KINETIČKI APARAT, v. pelikula. KINETODEZMA, v. pelikula. KINETOSOM (grč. kinein = pokretati, soma = tijelo), v. pelikula.


KITOVI, skupina sisavaca prilagođenih životu u moru. Pripadaju najvećim životinjama u biosferi. Prednji su se udovi preobrazili u peraje. Udišu kisik iz zraka. Rađaju žive mlade koji sišu. Zameci imaju dlačice koje se kod odraslih izgube. Ispod kože imaju debeli sloj masnoće. Kitovi se dijele na zubane i usane. Kitovi usani filtriraju vodu kroz usi (rožnate ploče) i hrane se planktonom. Kitovi zubani se hrane ribom i drugim životinjama. Poznatiji su: ulješura, pliskavica, delfin i plavetni kit. KLAMIDOMONAS, v. zelene alge. KLICA (embrio), dio sjemenke koji se razvija nizom mitoza iz oplođene jajne stanice (zigote). U ranom stadiju klica ima oblik kugle. Zrela klica sastoji se od korijenka, pupoljka i supki. Iz tih će se dijelova klijanjem formirati mlada biljka. KLIMAKTERIJ, razdoblje u životu čovjeka u kojem se događaju različite fiziološke i psihičke promjene koje su rezultat hormonskih promjena u organizmu. U mu-

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

škaraca započinje obično između pedesete i šezdesete godine života smanjenjem lučenja hormona testosterona zbog čega se postupno smanjuje i spermatogeneza. U žena se obično javlja u dobi od četrdeset i pete do pedesete godine života, a karakterizira ga smanjeno lučenje hormona estrogena i progesterona, nepravilni menstruacijski ciklusi te njihov konačan izostanak, napadaji vrućine, razdražljivost, umor i tjeskoba. KLITELUM, v. maločetinaši. KLOAKA, v. nečisnica. KLON, skupina genetički jednakih stanica ili organizama nastalih mitozom od jedne stanice ili zajedničkog podrijetla tj. nastalih nespolnim i vegetativnim razmnožavanjem te partenogenezom i apomiksijom. Isp. svojta. KLONIRANJE, proizvodnja klonova, isp. KLORIDNA KISELINA (HCl), luče ju obložne stanice u sluznici želuca podražene progutanom hranom, autonomnim parasimpatičkim živčanim sustavom (i živac vagus) te probavnim hormonom gastrinom. Kiselina je važna za aktiviranje pepsina, isp. KLOROFIL, kemijski spoj, navažniji biljni pigment za apsorpciju svjetlosne energije u procesu fotosinteze. U stanici se nalazi uz druge pigmente u grana tilakoidnim membranama kloroplasta. Postoje klorofili a i b. Zelene su boje. KLOROPLAST, stanični organel, pripada skupini organela (plastida) koji sadrže pigmente. Nalazi se samo u biljnim stanicama eukariota. Obavijen je dvostrukom membranom, a unutarnjost mu je ispunjena otopinom koja se zove stroma. U stromi se nalaze: DNA, RNA, ribosomi, supstrati i enzimi koji su potrebni za odvijanje fotosinteze. Unutarnjost kloroplasta je po-

dijeljena membranama na plosnate vrećice - tilakoide. Mjesta gdje su te membrane gusto raspoređene u više ili manje visoke stupce zovu se grana-tilakoide, a mjesta gdje su rjeđe raspoređene zovu se stromatilakoide. U membranama tilakoida nalaze se molekule klorofila, pigmenta koji je neophodan za odvijanje fotosinteze. Kloroplasti i mitohondriji su specifični stanični organeli po tome što sadrže vlastitu DNA i vlastite ribosome, a mogu se dijeliti neovisno o diobi stanice. KLJEŠTARI, životinje iz skupine člankonožaca, isp. Većina ih živi na kopnu. Pripadaju im paučnjaci: pauci, grinje, štipavci ili škorpioni i dr. Tijelo je podijeljeno na glavopršnjak (prosoma) i zadak (opistoma). Nemaju ticala. Uz usta imaju kliješta ili helicere. Plijen savladavaju otrovnim žlijezdama. Probavu počinju izvan organizma ispuštanjem probavnih sokova u plijen, a zatim ga isisavaju. KLJUNAŠI, v. jednootvori. KNIDOCITI, v. žarne stanice. KOACERVATI, koloidne kapljice s opnama koje nastaju ako se određeni organski spojevi otapaju u vodi uz dodatak različitih soli. Imaju sposobnost rasta i izmjenjivanja tvari s okolišem pa time pokazuju sličnosti s protoplazmom. Sintetizirao ih je ruski biokemičar Oparin prikazavši time jedan od mogućih stupnjeva evolucije žive tvari. KOCH, R., (1843. – 1910.), njemački bakteriolog koji je identificirao bacil koji uzrokuje tuberkulozu. Zajedno s Pasteurom smatra se osnivačem eksperimentalne bakteriologije. KOD, v. kodon KODOMINANTNOST, status kada oba alela istoga gena u heterozigotu daju jednaku izražajnost, tj. zajedničku dominan-


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

tnost, npr. krvnu grupu AB određuju aleli A + B.

životne funkcije. Oblikom mogu biti nitaste, pločaste ili kuglaste.

KODON (kod), slijed triju nukleotida na molekuli mRNA koji određuje položaj određene aminokiseline pri sintezi proteina (isp. genetička uputa).

KOLONIJALNA TEORIJA O POSTANKU METAZOA, v. hipoteze o postanku mnogostaničnih životinja.

KOHEZIJA, privlačna sila između molekula ili atoma iste tvari. Međusobna privlačnost molekula vode je važna za uzlazni tok vode u biljci. Dipolarne molekule vode su povezane slabim vodikovim vezama. KOKI, bakterije kuglastog oblika. Dolaze pojedinačno (monokoki), u paru (diplokoki), u nizovima (streptokoki), u grozdastim nakupinama (stafilokoki) i dr. Neke od ovih bakterija uzročnici su teških bolesti. KOKON, v.maločetinaši i paučnjaci. KOLECISTOKININ, probavni hormon koji se luči iz stanica sluznice dvanaesnika kada je prisutna masna hrana u dvanaesniku. Hormon se apsorbira iz crijeva u krv, krvlju dospijeva do jetre odnosno žučnog mjehura koji se pod utjecajem kolecistokinina steže, te protiskuje nakupljenu žuč žučnim vodovima u dvanaesnik. KOLENHIM, v. potporno staničje. KOLESTEROL, organski spoj iz skupine steroida (isp.). Nalazi se u membranama životinjskih stanica, u živčanom tkivu i krvnoj plazmi. Značajan je i kao ishodišna molekula u sintezi nekih hormona. KOLOIDNE OTOPINE, otopine koje sadrže otopljene tvari čiji je promjer čestica između 1 i 100 nm. Takve čestice nazivamo koloidnim česticama. Stanična otopina je koloidna otopina čije su koloidne čestice molekule proteina, nukleinskih kiselina, itd. KOLONIJA, nakupine jednostaničnih organizama među kojima nema podjele rada, već svaka stanica samostalno obavlja sve


KOLUTIĆAVCI (Annelida), bezkralješnjaci iz skupine mnogokolutićavaca. Najviše ih živi u moru, a manje u kopnenim vodama ili na vlažnim staništima. Prema tjelesnoj građi dijele se u tri skupine: mnogočetinaši, maločetinaši i pijavice. Tijelo im je ravnomjerno kolutićavo. U svakom se kolutiću ponavljaju isti organi. Na površini je kutikula i jednoslojni epiderm bogat žljezdanim i osjetnim stanicama. Pokreću se stezanjem prstenastih i uzdužnih mišića. Živčani sustav je ljestvičav. Vodeni kolutićavci dišu pomoću škrga, a kopneni (gujavica) površinom vlažne kože. Optjecajni sustav je zatvoren. U krvi se nalazi hemoglobin. Za izlučivanje imaju po jedan par metanefridija u svakom kolutiću. Morski su kolutićavci razdvojena spola i razvijaju se preko ličinke trohofora. Slatkovodni i kopneni kolitićavci su dvospolci. KOLJENO, v. filogenetski sustav. KOMENZALIZAM, v. simbioza. KOMPETICIJA (nadmetanje), suparništvo u istom okolišu među prekobrojnim jedinkama za hranom, životnim skloništem ili/i spolnim partnerom. Kompeticija je najjači biotički čimbenik unutar jedinki iste vrste (intraspecijska kompeticija). Nadmetanje je često i među jedinkama različitih vrsta (interspecijska kompeticija). KOMPLEMENTARNE BAZE, odgovarajuće dušične baze koje u molekuli DNA dolaze uvijek jedna nasuprot drugoj. Nasuprot jedne purinske baze iz jednog polinukleotidnog lanca dolazi pirimidinska baza drugog polinukleotidnog lanca. Tako nasu-

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

prot adenina uvijek stoji timin, a nasuprot gvanina citozin i time čine komplementarne parove AT i GC. Po principu komplementarnosti sintetizira se i molekula RNA na matičnoj polumolekuli (jednom lancu) DNA, ali se pri tome u molekulu RNA umjesto timina uvijek ugrađuje uracil. Taj se proces naziva prepisivanje (transkripcija) DNA u RNA.

Komplementarne baze Purinske









KONTRAKTILNA VAKUOLA, v. stežljivi mjehurić. KONVERGENCIJA, pojava morfološke sličnosti filogenetski, tj. srodstveno udaljenih grupa organizama, isp. konvergentna evolucija. KONVERGENTNA EVOLUCIJA, pojava kada pripadnici različitih skupina organizama u evoluciji steknu slične specijalne prilagodbe za život u određenim uvjetima, kao npr. ribe i pliskavica. KONZERVIRANJE (lat. conservatio = čuvanje), proces nastajanja fosila isušivanjem, smrzavanjem ili čuvanjem u smoli. U pustinjskoj su se klimi organizmi isušivali i mumificirali. U ledu i smrznutoj zemlji (Sibir, Aljaska) nađeni su ostaci mamuta. Manji su se organizmi, primjerice kukci, očuvali u jantaru, upavši u smolu crnogorice koja se skrutnula. KONZUMENTI, potrošači (isp.) hrane u prirodi, životinje.

Pojednostavljeni prikaz sinteze RNA prema kalupu jednog lanca DNA:

Komplementarne baze Purinske









KOMPOSTIRANJE, proizvodnja komposta iz organskog otpada truljenjem uz pomoć bakterija razlagača.

KONJUGACIJA (lat. coniunctio = spajanje), način “spolnog razmnožavanja” u nekih bakterija, alga i praživotinja (v. trepetljikaši), tj. izmjena genetičkog materijala sadržanog u mikronukleusu. Proces konjugacije započinje spajanjem dvije jedinke i stvaranjem citoplazmatskog mostića. Tako spojene jedinke nazivaju se konjuganti. U svakoj se jedinki mikronukleus podijeli 3 puta. Jedna od dioba je mejotička. Od svih 8 nastalih mikronukleusa ostaju samo 2; drugi se razgrade i nestaju. Od 2 haploidne jezgrice koje su ostale jedna je pokretna ili migrirajuća jezgrica, a druga nepokretna ili stacionarna. Migrirajući mikronukleus iz svakog konjuganta preko citoplazmatskog mosta prelazi u suprotnu jedinku. Spoji se sa stacionarnom jezgrom u zigotu. Tako se između dvije jedinke izmijeni nasljedna tvar. Nakon

KONIDIOSPORE, v. penicilijum.


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

toga se jedinke razdvoje i tada se nazivaju egzokonjuganti. KONJUGANTI, v. konjugacija. KOPITARI NEPARNOPRSTAŠI, veliki biljojedi iz skupine sisavaca. Na nogama imaju 1 ili 3 prsta obložena rožnatim kopitom. Kopita su građena od keratina. Srednji je prst najjači i nosi masu čitavog tijela. Poznatiji su npr. konj, magarac, zebra i nosorog. KOPITARI PARNOPRSTAŠI (papkari), biljojedi iz skupine sisavaca. Obično hodaju na 2 prsta: treći i četvrti su veći od ostalih i nose čitavo tijelo. Dijele se na nepreživače (svinje i vodenkonji) i preživače (deve, jeleni, žirafe, antilope, koze, ovce, bivoli). Preživači žive u stadima. U zubalu nemaju gornjih sjekutića ni očnjaka. Želudac im je prilagođen na preživanje. Mnogi imaju rogovlje. KOPLJAČA, v. svitkoglavci. KOPRIVNJAČA, (urtikarija), oblik alergijske reakcije koji se javlja kao preosjetljivost na neke vrste hrane (maline, jagode, sir, rakovi), ali može biti izazvana i fizičkim faktorima, npr. hladnoćom i toplinom kao i ujedima i ubodima insekata. Pojavljuje se kao mali crvenkasti otoci na koži koji svrbe. KORA, kožno staničje odrvenjelih biljnih organa, višegodišnje stabljike i višegodišnjeg korijena. KORALJI, životinje iz skupine žarnjaka. Žive u morima, pojedinačno ili u zadrugama. Svi su polipi. Većina ima čvrsti vanjski i unutarnji kostur od kalcijeva karbonata. Stvaraju koraljne grebene i otoke - atole. U Jadranskom moru poznati su crveni koralj, crvena moruzgva i smeđa vlasulja.


KORIJEN, jedan od tri temeljna organa kopnenih biljaka. Učvršćuje izdanak, opskrbljuje biljku vodom i mineralima koje upija korijenovim dlačicama. Razlikujemo: pravi korijen koji se razvija iz klicinog korijenka, a imaju ga sve golosjemenjače i dvosupnice, tj. sve biljke koje rastu i u debljinu; čupavo (pridošlo, adventivno) korijenje u papratnjača i jednosupnica izrasta naknadno jer njihov korijen ubrzo propada zbog nemogućnosti rasta u debljinu. Raste u dužinu uz pomoć tvornog staničja na svome vrhu. Nježno tvorno staničje štiti korijenova kapa, sloj obamrlih stanica omogućujući tako prodor korijena i u tvrda tla. KORIJENOV TLAK (tlak korijena), pozitivan hidrostatski tlak koji vodu iz korijena tjera prema gore. Iznosi približno 0.1 MPa i važan je za dizanje vode u biljci, do otprilike 1 m, posebno u proljeće prije listanja. Temelji se na procesu aktivnog izlučivanja vode i tvari stanica endoderma u provodne žile ksilema. KORIJENOVA KAPA, v. korijen. KORIJENSKI GOMOLJIĆI (noduli), nabreknuća (kvržice) na korijenu mahunarki. Građeni su od biljnih stanica u kojima se nalaze simbiotske dušikove bakterije (u obliku bakteroida) koje obavljaju fiksaciju dušika iz zraka. KORJENONOŠCI (sluzavci), praživotinje koje se kreću uz pomoć pseudopodija. Većina ih živi u moru: krednjaci, sunašca i zrakaši. Na površini protoplazme izlučuju ljušturicu od vapnenca ili silicija. Odumiranjem organizama ljušturice se talože na morsko dno tvoreći debele naslage. Poznati su numulitski vapnenci nastali taloženjem ljušturica krednjaka numulita. U kopnenim vodama živi ameba, npr. Amoeba proteus. Površinu tijela pokriva joj dvoslojna lipoproteinska stanična membrana. Hranu može uzimati cijelom površinom

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

tijela, procesom endocitoze. Disanje je aerobno, a plinovi prolaze procesom difuzije kroz membranu. Suvišnu tekućinu izbacuje pomoću stežljivih mjehurića (kontraktilne vakuole). Razmnožava se običnim dvojnim ili binarnim dijeljenjem. Nametničke amebe žive u unutarnjim organima životinja i čovjeka, kao npr. srdoboljna ameba. KORMUS (cormus, stablo), biljno tijelo koje ima razvijene osnovne prehrambene (vegetativne) organe: korijen, stabljiku i list. Sve biljke s razvijenim kormusom zovemo stablašice ili Cormophyta, a danas im pripadaju papratnjače i sjemenjače. Među stablašicama posebno mjesto imaju i mahovine koje osim obilježja stablašica nose i obilježja steljnjača ili Talophyta. One nemaju korijen, niti su im u potpunosti razvijeni stabljika i listovi. KORNJAČE, skupina gmazova s oklopom na kojem se nalaze otvori za noge i glavu. Oklop je nastao stapanjem kožnog i unutarnjeg kostura. Najrazvijeniji je mišić za uvlačenje glave. U ustima nemaju zube, nego su im čeljusti pokrivene rožnatim pločicama. U uhu imaju bubnjić. Danas živi oko 250 vrsta. Poznatije kornjače naših krajeva: barska kornjača, obična čančara u Dalmaciji i na otocima, a u Jadranu je česta glavata želva. Kod vrsta koje žive u vodi noge su se modificirale u peraje, a ženke izlaze na kopno samo da izlegu jaja. KORONARNA SKLEROZA, taloženje masnih naslaga (aterona) u koronarnim arterijama što smanjuje protok krvi pa je srčani mišić slabije opskrbljen kisikom i hranidbenim tvarima. KORONARNE ARTERIJE, srčane arterije, v. krvotok srčanog mišića. KORTIKOSTEROIDI (kortikosteroidni hormoni), hormoni koje izlučuje kora nadbubrežne žlijezde. Najznačajniji kortikosteroidi su glukokortikoidi (kortizon,

kortikosteron) koji reguliraju promet ugljikohidrata i mineralokortikoidi (aldosteron) koji reuguliraju promet iona u organizmu. Izlučivanje kortikosteroida je pod kontrolom adenokortikotropnih hormona (ACTH) iz adenohipofize. KORTIZON (kortizol), glukokortikoidni hormon koji se oslobađa u stresu pospješujući opći metabolizam, isp. kortikosteroidi. KOST, najčvršći dio kostura. Izvana je obavijena pokosnicom (periost). Građena je od koštanog tkiva: vanjskog kompaktnog i središnjeg spužvastog sloja. Osnovna jedinica je osteon, isp. Na dugim kostima razlikujemo dva kraja ili epifize i srednji dio dijafizu koja je ispunjena do spolne zrelosti crvenom koštanom moždinom. Nakon spolne zrelosti koštana moždina se u dugim kostima zamjenjuje masnim tkivom. Kosti sadržavaju oko 70 posto anorganskih tvari (kalcija, fosfora i dr.) i oko 30 posto organskih tvari (osein). Rast kostiju omogućuju koštane stanice – osteoblasti. U kostima se nalaze i stanice koje razgrađuju koštanu tvar - osteoklasti. KOSTUR, potporanj tijela koji mu daje čvrstoću, oblik i omogućuje kretanje, dajući oslonac mišićima. Razlikujemo vanjski (egzoskelet) i unutarnji (endoskelet) kostur. Egzoskelet i zaštićuje organizam, kao npr. kod mekušaca i člankonožaca. Kralježnjaci imaju endoskelet. Kostur čovjeka ima oko 208 kostiju. Sastoji se od kosti, hrskavice i ligamenata. KOŠTANA MOŽDINA, tkivo koje ispunjava moždinsku šupljinu kosti i prostore među gredicama spužvastog koštanog tkiva. Razlikujemo crvenu, žutu i želatinoznu moždinu. U crvenoj moždini nastaju eritrociti, megakariociti (trombociti) i leukociti granulociti. KOŠTANE STANICE (osteociti), stanice ovalnog oblika koje izgrađuju koštano


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

tkivo. Izlučuju krutu međustaničnu tvar koja se sastoji od organskog (protein osein) i anorganskog (minerali, najčešće kalcijev fosfat i kalcijev karbonat) dijela. KOŠTUNJAČE, najbrojnija skupina riba (isp.). Imaju koštani kostur. Ljuske na koži su okruglaste (cikloidne) i češljaste (ktenoidne), ali ima vrsta i s golom kožom. Škrge su pokrivene škržnim poklopcem. Nemaju zavojiti zalistak u crijevu. Imaju plivaći mjehur. Oplodnja je vanjska. Razmnožavaju se jajima. Poznatije su koštunjače u kopnenim vodama: šaran, štuka, som, pastrva, grgeč, klen. Od morskih riba u Jadranu žive: skuša, srdela; zubatac, oslić, kovač, list i dr. KOTILEDONI, v. list. KOŽA, vrsta epitelnog ili pokrovnog tkiva, organ koji pokriva vanjsku površinu tijela čovjeka i životinja. Njena osnovna uloga je zaštititi organizam od negativnih učinaka okoliša. Važna je u održavanju stalne tjelesne temperature kod homeotermnih životinja, u odstranjivanju štetnih produkata tvarne izmjene iz tijela, u primanju vanjskih podražaja pomoću osjetilnih tjelešaca, u izmjeni plinova i dr. Koža kralježnjaka građena je od više slojeva koji izgrađuju površinski dio, pousminu ili epidermu i unutarnji dio, usminu ili dermu. Može sadržavati žlijezde znojnice i lojnice, krvne i limfne žile, različita osjetilna tjelešca, ogranke živaca i masne stanice. U riba je pokrivena ljuskama, u vodozemaca je gola, u gmazova je pokrivena ljuskama ili pločama, u ptica perjem, a u sisavaca dlakom. KOŽNO STANIČJE, ima prije svega zaštitnu ulogu, a omogućuje izmjenu plinova između biljke i okoliša. Tri su vrste kožnog staničja: epiderma, rizoderma i kora. KRALJEŽNICA (columna vertebralis), glavni potporanj tijela svih kralježnjaka,


sastavljen od većeg broja kralježaka. Formira se u tijeku embrionalnog razvoja kralježnjaka oko svitka, a nastaje od zametnog listića mezoderma kao i sve ostale kosti. KRALJEŽNIČKI ŽIVCI, v. moždinski živci. KRALJEŽNJACI (Vertebrata), skupina životinja čije tijelo podupire kralježnica. Pripadaju lubanjcima iz koljena svitkovci, isp. Potkoljeno kralježnjaka sadrži oko 40000 vrsta. Rasprostranjeni su u vodi i na kopnu. Dijele se na kružnouste, ribe, vodozemce, gmazove, ptice i sisavce. Prvi kralježnjaci pojavili su se početkom paleozoika. KRAPINSKI PRAČOVJEK, izumrli čovjekov predak čiji su nalazi pronađeni u jednoj poluspilji u Krapini (Hrvatsko Zagorje). Bio je relativno niskog rasta (do 160 cm) s jakim nadočnim lukovima i izbočenim čeljustima bez izrazite brade. Živio je u većim skupinama, bavio se lovom, hranio se mesom divljih životinja, a koristio je kameno oruđe i vatru. Starost tih nalaza procjenjuje se na 70 tisuća godina. Pripada tipu neandertalskog pračovjeka koji se danas smatra samo jednom od izumrlih vrsta umnog čovjeka (Homo sapiens). KRATKOVIDNOST (miopija), poremećaj vida u kojem je očna jabučica izdužena, te se zrake svjetla pri akomodaciji oka na daleke predmete lome već ispred mrežnice, u staklovini. Na mrežnicu pada neoštra slika. Kratkovidnost se ispravlja konkavnim lećama (negativna dioptrija). KREBS, H. (1900. – 1981.), njemački biokemičar, protumačio ciklus limunske kiseline koji je nazvan i Krebsov ciklus. KREBSOV CIKLUS (ciklus limunske kiseline), jedna od aerobnih faza stanične

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

respiracije ili staničnog disanja koja se odvija u mitohondrijima. Naziva se ciklusom jer se sastoji od kružne serije biokemijskih reakcija u kojima se pirogrožđana kiselina razlaže na molekule ugljik(IV)-oksida i atome vodika pri čemu se oslobodi energija za sintezu ATP-a. KREDNJACI, v. korjenonošci. KREMENA ZEMLJA, v. kremenjašice. KREMENE BILJKE, v. acidofilne biljke KREMENJAŠICE (Diatomeae), jednostanične alge s čvrstom, dvodijelnom, pravilno struktuiranom stijenkom uglavnom (95 %) izgrađenom od kremena (SiO2). U prošlosti su sudjelovale u izgradnji naslaga zemlje koja se zove dijatomejska ili kremena zemlja. Veliki značaj imaju u primarnoj produkciji hrane. Produkti fotosinteze su masna ulja i poneki polisaharid, nikada škrob. Žive na čvrstoj (vlažnoj) podlozi ili kao plankton slatkih voda i mora. KRILAŠI, skupina kukaca koji imaju 1 ili 2 para krila ili su im nestala tijekom evolucije. Obuhvaća oko 30 različitih skupina. Poznatije su skupine: vretenca (vilin konjic), vodencvjetovi, ravnokrilci (skakavci, šturci, nakaznici, obolčari), žoharaši (bogomoljke, žohari, termiti), grizlice (uši, tekuti), kornjaši (hruštevi, jelenci, strizibube, božje ovčice, potkornjaci), leptiri, dvokrilci (muhe, komarci, obadi), buhe, opnokrilci (ose, pčele, mravi, bumbari). Zadružni kukci su: mravi, termiti, ose i pčele. KRIPTIČNA OBOJENOST, v. zaštitna obojenost. KRIPTORHIZAM, prirođena mana da se sjemenici ne nalaze u mošnjama. Sjemenici nastaju u trbušnoj šupljini, odakle se dva mjeseca prije rođenja spuste u mošnju djelovanjem fetalnog testosterona. U oko 5 % muške djece jedan se testis (rjeđe oba)

zadržavaju u trbušnoj šupljini. Sjemenici koji zaostanu najčešće zakržljaju, pa se smanjuje rasplodna moć muškarca. KRITIČNO RAZDOBLJE TAME, minimalno razdoblje tame koje zahtijevaju biljke kratkog dana da bi mogle cvjetati. Cvjetanje je prvenstveno određeno trajanjem razdoblja tame, v. biljke kratkog dana i biljke dugog dana KRITOSJEMENJAČE, evolucijski naprednije sjemenjače. Prilagođene su životu na svim područjima na Zemlji. Poznato je više od 250 000 vrsta. Cvijet, plodnica i plod su generativni organi svojstveni kritosjemenjačama. Sjemeni su zameci zatvoreni ("sakriveni") u plodnici. Plodnica se razvija u cvijetu kao dio tučka. Prema broju supki razlikujemo jednosupnice i dvosupnice. KRIŽANAC, (hibrid), potomak nastao križanjem (hibridizacijom), isp. Ima osobine oba genetički različita roditelja (isp. heterozigot). KRIŽANJE (hibridizacija), proces miješanja nasljeđa dvaju različitih roditelja. U biljnom svijetu križaju se različite sorte biljaka, a u životinjskom različite pasmine, bilo prirodnim bilo umjetnim putem. Čovjek primjenjuje umjetno križanje da bi dobio potomke koji imaju neka, za njega potrebna i korisna svojstva. KROKODILI, najrazvijeniji i najveći živi gmazovi. Napredak se očituje u građi srca gdje je klijetka gotovo potpuno podijeljena na desnu i lijevu stranu. Krokodili su dugi do 6 m. Masivno tijelo nose kratke noge. Koža je pokrivena velikim rožnatim pločama. Žive u vodama tropskog i suptropskog pojasa, a njihovi su preci živjeli na kopnu. Svi su krokodili grabežljivci. Ne mogu gutati plijen, već ga komadaju snažnim zubima smještenim u jako izbočenoj njušci. Razvijena je briga za potomstvo. Poznatije


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

su vrste: nilski krokodil, gangeski gavijal, misisipski aligator, obični kajman. KROMANJONAC, v. Homo sapiens. KROMATIDA, polovica udvostručenog kromosoma. Izgrađena je od jedne molekule DNA i bjelančevina. KROMATIN, mrežica vlakana koju čine DNA i proteini, a nalazi se u jezgri eukariota u vrijeme interfaze. Razlikujemo dva tipa kromatina: 1.

heterokromatin koji je građen od gusto zbijenih vlakana i obično se raspoređuje uz jezgrinu ovojnicu;


eukromatin građen od vlakana rjeđe raspoređenih nego u heterokromatinu.

U vrijeme diobe stanice iz kromatina se formiraju posebne strukture, kromosomi. KROMATSKA ADAPTACIJA, mogućnost organizama da mijenjaju boju i tako koriste različite dijelove Sunčevog spektra. KROMOMERA, v. kromosom. KROMONEMA, v. kromosom. KROMOPLASTI, stanični organeli, ubrajamo ih u skupinu organela čiji je zajednički naziv plastidi, isp. Sadrže biljna bojila, crvene karotene i žučkaste ksantofile. Ne sadrže klorofil te nemaju sposobnost fotosinteze. Kromoplasti daju boju mnogim cvjetovima (maćuhica, žuta perunika i dr.), biljnim plodovima (rajčica, šipak) i korijenu nekih biljaka (mrkva).

cifičan broj i građu kromosoma. Glavni dio kromosoma je dvostruka nit (kromonema) sastavljena od molekula DNA, koja je dijelom ravna a dijelom namotana oko malih grudica bjelančevine (histona), koje se nazivaju nukleosomi. Također se zamjećuju i jače obojena mjesta kromomere, te utanjeno i neobojeno mjesto pričvrsnica (centromera).

nukleosom (s 8 histonskih molekula)


spojnice histona Građa kromosoma: DNA nit (kromonema) dijelom omotana oko nukleosoma

KROMOSOMSKE KARTE, v. genetičke karte. KROSINGOVER (crossing over), pojava izmjene dijelova kromatida između dva homologna kromosoma. kromatide

KROMOSOMI S PETLJAMA, v. četkasti kromosomi. KROMOSOMI, posebne strukture koje postaju vidljive u jezgri eukariotskih stanica u vrijeme mejoze i mitoze. Građeni su od DNA i bjelančevina. U njima su smješteni geni, tj. cjelokupna genetička informacija organizma. Svaka vrsta ima spe-


konjugirani homologni kromosomi

izmjena dijelova kromatida

odvajanje kromosoma

profaza I

profaza I

anafaza I

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

Crossing over se zbiva za vrijeme diobe stanice i to u profazi mejoze I, a značajan je jer doprinosi genetičkoj raznolikosti rasplodnih stanica (gameta) koje će nastati diobom (isp. i oogeneza i spermatogeneza). KRSTAŠICE, skupina zeljastih biljaka dvosupnica čiji su mnogi pripadnici važne gospodarske biljke. Cvjetovi imaju četiri lapa i četiri unakrsne latice (ime!), šest prašnika (četiri dulja i dva kraća) i plod suhi pucavac, tzv. komušku ili komuščicu. Kao povrće rabe se npr. različiti kultivari kupusa: glavati kupus, kelj, cvjetača, koraba i rotkva, a za proizvodnju ulja uljena repica. Korovna je biljka rusomača. Naš endem velebitska degenija je također krstašica. KRUŽENJE TVARI U PRIRODI počinje proizvodnjom hrane iz anorganskih tvari (H2O, CO2, nitrati itd.) što rade producenti. Proizvedenu hranu ne koriste samo producenti za sebe, nego ih konzumenti troše jedući biljnu hranu. I producente (biljke) i konzumente (životinje) i druge reducente nakon prestanka njihova života razlažu reducenti (gljive i bakterije) na anorganske tvari. KRUŽNOUSTE (Cyclostomata), najprimitivnija skupina kralježnjaka i najstariji lubanjci. Nazivaju se i bezčeljusti jer nemaju izgrađenih čeljusti. Žive u moru ili kopnenim vodama. Dijele se na paklare (imaju leđnu i repnu peraju) i sljepulje (imaju samo repnu peraju). Paraziti su na ribama. Na hrskavičnoj lubanji nalaze se okrugla i lijevkasta usta sa rožnatim "zubićima" ili kvržicama. Svitak imaju cijeli život. Bočna pruga im služi kao ravnotežni organ pri plivanju. Za izlučivanje imaju prvi bubreg, isp. Razdvojena su spola. Iz oplođenih se jaja razvija ličinka pokača. KRV, jedna od tjelesnih tekućina, protječe kroz srčano-žilni sustav; tekuće vezivno tkivo. Ima važnu ulogu u izmjeni plinova,

prijenosu hranjivih i drugih tvari (hormona, vitamina itd), izlučivanju štetnih tvari, održavanju tjelesne temperature, održanju količine vode u tijelu, obrani tijela od infekcija itd. Krv se sastoji od tekućeg dijela - krvne plazme i triju osnovnih skupina krvnih stanica: eritrocita, leukocita i trombocita. Ukupni volumen krvi u odrasle osobe je oko 5 litara. KRVNA PLAZMA, tekući dio krvi. Žućkasta tekućina sastavljena od 90 % vode, 2 % anorganskih tvari (najviše iona natrija i klora) i 8 % organskih spojeva (najviše bjelančevina). Krvna plazma sadrži tri vrste bjelančevina: albumine, globuline i fibrinogene. Albumini i globulini sudjeluju u prijenosu hormona, a posebna skupina globulina, tzv. γ-globulini ili imunoglobulini imaju važnu ulogu u obrani organizma protiv uzročnika bolesti. Fibrinogeni su važni u procesima zgrušavanja krvi. Krvnu plazmu kojoj je odstranjen fibrinogen nazivamo krvni serum. Isp. izvanstanična tekućina. KRVNA TJELEŠCA, dio krvi; zajednički naziv za krvne stanice i krvne pločice ili trombocite. U krvne stanice spadaju eritrociti ili crvene krvne stanice i leukociti ili bijele krvne stanice. KRVNE PLOČICE, v. trombociti KRVNE SKUPINE, podjela krvi prema bjelančevinama – antigenima koji se nalaze na membranama eritrocita. Prve antigene otkrio je 1900. godine austrijski znanstvenik Karl Landsteiner i to A i B aglutinogene. Nešto kasnije otkrio je i prirodu tzv. Rh-faktora. Na temelju tih antigena utvrđen je AB0 sustav krvnih skupina u kojem se razlikuju 4 osnovne krvne skupine: A, B, AB i 0 (nula). Pripadnici krvne skupine A nose na membranama svojih eritrocita aglutinogen A, pripadnici krvne skupine B aglutinogen B, pripadnici krvne skupine AB oba aglu-


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

tinogena, pripadnici krvne skupine 0 nemaju na svojim membranama eritrocita te aglutionogene. Osim aglutinogena, pripadnici pojedinih krvnih skupina sadrže u svojoj krvnoj plazmi i specifična antitijela koja se zovu aglutinini, a odgovorni su za reakciju aglutinacije (sljepljivanja) eritrocita što izaziva zdravstvene poteškoće pa i smrt, npr. u slučaju transfuzije (davanja) krvi kada se ne slažu krvna skupina davatelja i primatelja. Tako pripadnik krvne skupine A ima anti B aglutinine, tj. antitijela koja neće reagirati protiv vlastitih eritrocita, ali će reagirati protiv eritrocita koji sadrže aglutinogen B, tj. protiv krvne skupine B. Pripadnik krvne skupine B ima anti A (alfa) aglutinine, pripadnik krvne skupine AB nema aglutinine, a pripadnik krvne skupine 0 ima i anti A i anti B (beta) aglutinine.

stvaranje limfocita. Odvija se u limfnim čvorovima, timusu, i dijelu slezene. Granulopoeza je stvaranje granulocita. Odvija se u slezeni i koštanoj moždini. Megakariociti su velike stanice koje nastaju u koštanoj moždini, a njihovim raspadanjem nastaju trombociti ili krvne pločice.

KRVNI SERUM, v. krvna plazma.

KSEROFITI (grč. xeros = suh, fyton = biljka), biljke s organima prilagođenim za preživljavanje u sušnim ili pustinjskim uvjetima, kao npr. kaktusi, sukulenti, hrast crnika i medunac.

KRVNI TLAK, pritisak krvi na stijenke krvnih žila. Krvni tlak izražavamo razlomkom. U brojniku je sistolički, a u nazivniku dijastolički tlak. Normalni krvni tlak u velikim arterijama iznosi oko 16/10.7 kPa (stara mjera 120/80 mmHg). KRVOTOK SRČANOG MIŠIĆA, poseban hranidbeni ili nutritivni krvotok miokarda tj. srčanog mišića. Sastoji se od dvije male srčane arterije (lijeve i desne) i dvije male srčane vene (koronarne arterije i vene). Te arterije izlaze iz početnog dijela aorte i dovode srcu krv obogaćenu kisikom (oksigeniranu krv). Protok krvi kroz lijevu koronarnu arteriju odvija se u dijastoli, dok je protok kroz desnu koronarnu arteriju jednak u sistoli i dijastoli. KRVOTVORNI (hematopoetski) ORGANI, organi specijalizirani u stvaranju pojedinih oblika krvnih stanica. Eritropoetski organi su organi s izrazitom proizvodnjom eritrocita.To su: koštana moždina, dio slezene i jetra. Limfopoeza je


KSENOBIOTIK (grč. xenos = stran), strana tvar, otrov ili toksikant, koja je nepotrebna ili štetna za organizam. KSEROFILNE ŽIVOTINJE (grč. xeros = suh, filos = prijatelj), životinje sušnih područja. Prilagođeni su na štednju vode smanjenim izlučivanjem. Površina tijela npr. kukaca zaštićena je hitinom, a gmazova rožnatim slojem. Mnogi sisavci nemaju žlijezde znojnice, a štetne tvari izlučuju u dehidriranoj formi (npr. pustinjski miš).

KSILEM, vrsta provodnog tkiva u biljaka čija je funkcija provođenje vode i mineralnih tvari iz korijena prema ostalim dijelovima biljke. Građen je od provodnih elemenata - traheja ili traheida. KTENIDIJE, organi (škrge) za disanje kod većine mekušaca. Po obliku su lističave ili nitaste. Dobro su prokrvljene. Voda ih oplakuje a kisik difuzijom prelazi u kapilarni sustav i dalje se raznosi po tijelu. KUGA, teška zarazna bolest uzrokovana bakterijama. KUKCI (Insecta), najbrojnija skupina životinja; ne samo unutar člankonožaca, isp. Poznato oko 800 000 vrsta. Prilagođeni su na različite načine života, prehrane, kretanja i razmnožavanja. Tijelo je podijeljeno

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

na glavu, prsa i zadak. Na glavi imaju 1 par ticala i 1 par složenih očiju. Oko usta su 3 para usnih organa koja mogu biti za: grizenje (hrušt), bodenje (komarac), lizanje (pčela), sisanje (leptir). Prsa čine 3 kolutića i nose 1 ili 2 para krila te 3 para nogu (za trčanje, kopanje, plivanje ili skakanje). Postoje i kukci bez krila, tzv. bezkrilci. Tijelo pokriva hitinska kutikula. U glavi je trodjelni mozak. Na njega se nastavlja ljestvičava živčana vrpca trbušnom stranom tijela. Dobro su razvijena osjetila za opip, ravnotežu, sluh, toplinu, njuh, okus i vid. Oči se sastoje od velikog broja okašaca, v. rakovi. Zvučne signale primaju pomoću timpanalnih organa, isp. Dišu uzdušnicama koje se otvaraju parnim odušcima na zatku. Krvni optok je otvoren i jednostavan. Na leđnoj je strani žila koja čini srce. Krv ne prenosi kisik. Za izlučivanje imaju Malpighijeve cjevčice. Kukci su razdvojenog spola. Razmnožavaju se jajima. Oplodnja je unutarnja. Ženke odlažu oplođena jaja na različita mjesta prema načinu života. Ličinke se presvlače nekoliko puta i tada mogu rasti. Razvojni stadiji kod potpune preobrazbe su: jaje, ličinka, kukuljica i odrasli kukac. Kod nepotpune preobrazbe nema stadija kukuljice. Sistematski se kukci dijele na bezkrilce i krilaše. Mnogi su nametnici i prenosnici uzročnika bolesti (komarac malaričar malarije, muha ce-ce bolesti spavanja, uš pjegavog tifusa, buha kuge). Neki uzrokuju štete u poljoprivredi i šumarstvu. KUKCOJEDI, skupina primitivnih kopnenih sisavaca s kratkim oštrim zubima. Imaju slab vid, pa kukce i male životinje love uglavnom pomoću osjetila njuha. Njima pripadaju ježevi, krtice i rovke. Neki spavaju zimski san. KULTIVAR, v. svojta. KULTURA STANICA, v. kultura tkiva.

KULTURA TKIVA, uzgoj stanica i tkiva izvan organizma na posebnim hranjivim podlogama u strerilnim uvjetima. KUTIKULA (grč. deminutiv od kutis = koža), voštana prevlaka epidermalnih stanica koja zaštićuje biljku od prevelikog gubitka vlage. Kod bezkralježnjaka vanjski rožnati, bjelančevinasti zaštitni sloj. Kutikula štiti tijelo, npr. metilja, da ga ne razgrade probavni enzimi. Kod vodenih biljaka ne postoji. KVADRATNA KOST, v. gušteri i zmije. KVAŠČEVE GLJIVICE (saharomiceti), jednostanične gljivice mješinarke koje stvaraju kolonije u obliku razgranatih lanaca. Razmnožavaju se pupanjem, rijetko askosporama. Vrsta vinski kvasac (Sacharomyces ellipsoideus) uzročnik je alkoholnog vrenja, procesa u kojem se anaerobno razgrađuje šećer glukoza do alkohola etanola uz oslobađanje ugljikovog dioksida i energije: enzimi

C6H12O6 ⎯⎯ ⎯ ⎯→ 2C2H5OH + 2CO2 + + energija Pivski ili pekarski kvasac (Sacharomyces cerevisiae) jedna je te ista vrsta koja također razgrađuje glukozu na etanol i ugljikov dioksid.

L LAKTOZA (mliječni šećer), kemijski spoj ugljikohidrat iz skupine disaharida, složenih šećera građenih od dvije molekule jednostavnih šećera. Laktoza se sastoji od jedne molekule glukoze spojene s jednom molekulom galaktoze.


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

LAMARCK, J., (1744. – 1829.), francuski zoolog tvorac prve potpune teorije evolucije nazvane lamarkizam. LANDSTEINER, K., (1868. – 1943.), austrijski istraživač koji je 1900. god. otkrio prve antigene, a 1940. god. zajedno s Winerom otkrio Rhesus faktor. LAP, v. cvijet. LATERALNI MERISTEMI, v. bočni meristemi LATIMERIJA, v. resoperke. LEĆA (lens), nalazi se odmah iza šarenice i zjenice. Pričvršćena je naokolo tankim nitima cilijarnog tijela koje mijenja sferni oblik leće i tako je prilagođava (akomodira) za gledanje blizu odnosno daleko. Prostor između rožnice i leće - prednja očna komorica - ispunjen je očnom vodicom. Iza leće je stražnja očna komora ispunjena staklovinom. LEĐNA MOŽDINA, (kralježnična moždina, medulla spinalis), sastavni dio središnjeg živčanog sustava svih kralje-žnjaka. U čovjeka je smještena u gornje dvije trećine kralježničnog kanala. Kao i mozak građena je od sive tvari koju čine tijela živčanih stanica i bijele tvari koju čine živčana vlakna. Vanjski dio čini bijela, a unutarnji dio siva tvar (u obliku leptira). U leđnu moždinu ulaze i izlaze živčana vlakna na prednjim i stražnjim rogovima. To su osjetilna i motorička vlakna refleksnih lukova. Kroz sredinu sive tvari prolazi središnji kanal ispunjen moždano – kralježničkom tekućinom (cerebrospinalni likvor) koji povezuje leđnu moždinu sve do šupljih komora unutar velikog mozga ispunjenih tekućinom (likvorom). Van LEEUWENHOEK A., (1632. – 1723.), nizozemski prirodoslovac koji je 1674. god., konstruiravši mikroskop s jed-


nom lećom, prvi ugledao živi jednostanični organizam. LENTICELE, pore na oplutjelim tkivima čiji se otvor ne može regulirati, npr. pore na kori bazge. LEPIRNJAČE, skupina pretežno zeljastih biljaka dvosupnica. Listovi su im perasto sastavljeni. Cvjetovi su dvospolni. Vjenčić ima leptirast oblik (ime!) i sastoji se od pet latica. Plod je mahuna, pa se zovu i mahunarke. Lepirnjačama pripada naše poznato povrće, grah, grašak, bob i leća. Mnoge se vrste uzgajaju za ishranu domaćih životinja, npr. djetelina i lucerna. Lepirnjače su važne i zbog simbioze s bakterijama, v. nitrogene bakterije. LEPRA (guba), teška i dugotrajna, bakterijama uzrokovana bolest. LETALITET, smrtnost. LETALNE ILI SMRTONOSNE MUTACIJE, mutacije koje obično dovode do smrti organizma. LEUCIN, kemijski spoj iz skupine aminokiselina. LEUKEMIJA, rak bijelih krvnih stanica. Karakterizira je nenormalan rast i razvoj limfocita (limfatična leukemija) ili neutrofilnih leukocita (mijeloična leukemija). Karakterizira je smanjena otpornost na infekcije, čirevi u ustima, povećanost limfnih čvorova i slezene i opća slabost. LEUKOCITI (bijele krvne stanice) se dijele po obliku jezgre na segmentirane i nesegmentirane te da li imaju zrnca (granule) u citoplazmi nekih stanica (granulociti) ili ne (agranulociti). Eozinofilni, bazofilni i neutrofilni leukociti, koji su dobili imena prema afinitetu na kisele i lužnate boje, su segmentirani granulociti. Nesegmentirani leukociti, agranulociti, su monociti i limfociti.

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

Neutrofili i limfociti igraju važnu ulogu u zaštiti tijela. Neutrofili imaju sposobnost fagocitoze (isp.), a limfociti protutijelima štite tijela od zaraze. Isp. krvna tjelešca. LEUKOCITOZA, stanje povećanog broja leukocita u krvi. Uzrok može biti u infekciji odnosno u povećanoj obrambenoj aktivnosti zaraženog tijela. LEUKOCITURIJA, pojava leukocita u mokraći kod nekih bubrežnih bolesti. LEUKOPENIJA, stanje smanjenog broja leukocita u krvi. Može biti uzrokovana zračenjem, različitim otrovima, lijekovima i dr. LEUKOPLASTI, stanični organeli, ubrajamo ih u skupinu organela čiji je zajednički naziv plastidi (isp.). Ne sadrže biljna bojila. Dolaze u svim biljnim dijelovima (bezbojna primarna kožna tkiva listova i stabljika), a pretežito se nalaze u spremišnim tkivima i organima (sjemenke, gomolji, korijen) biljaka. Leukoplaste u kojima se šećer pretvara u škrob u obliku velikih škrobnih zrnaca nazivamo amiloplasti. LEYDIGOVE STANICE, v. intersticijske stanice. LH (luteinizirajući hormon), jedan od tri gonadotropna hormona kojega izlučuje prednji režanj hipofize (adenohipofiza). U muškaraca je hormon LH nazvan hormon za stimulaciju intersticijskih stanica (ICSH). LIGAMENTI (sveze), najmekši dio kostura. Građeni su od čvrstog vezivnog tkiva u kojem ima elastičnih niti. Ligamenti omogućuju pokretljivost zglobova upravljanu kontrakcijom mišića. LIKOVNICE, v. potporno staničje. LIMBIČNI SUSTAV, dio velikog mozga u kojem se procjenjuju doživljaji i osloba-

đaju emocionalne reakcije, npr. bijes i veselje, a impulsi utječu i na rad npr. srca, crijeva i žučne vrećice. Limbični sustav ulazi u sastav moždanog debla. LIMFA, tjelesna tekućina koja teče limfnim žilama, a po sastavu se razlikuje od krvi jer ne sadrži eritrocite. Teče u jednom smjeru, od tkiva prema srcu, a glavna joj je uloga donošenje suvišne tkivne tekućine u krv. Sudjeluje i u prijenosu probavljenih masti iz crijevnih resica u krvotok. LIMFATIČNA LEUKEMIJA, v. leukemija. LIMFATIČNE STANICE, stanice u koje su uključeni svi razvojni oblici limfocita, stanica nositelja tzv. specifične imunosti. To su limfociti B, limfociti T i limfociti 0. LIMFNI ČVOROVI, nakupine limfnoga tkiva u vezivnoj čahuri razmještene po čitavom tijelu. Njihov broj je kod pojedinih ljudi različit (na crijevu čovjeka ih ima oko 30 000). Mnogo ih je na mjestima gdje je moguć prodor zaraznih klica (u plućima, crijevu te ispod površine kože). Pojedini limfni čvor sastoji se od kore i srži, a u čvoru je više limfatičnih čvorića (folikula) u čijim središtima se nalaze matične stanice za stvaranje limfocita. LIMFOCITI 0, vrsta leukocita, "stanice ubojice" (limfociti K i NK), sudjeluju u specifičnoj i nespecifičnoj staničnoj imunosti. LIMFOCITI B, vrsta leukocita, nositelji tzv. humoralne imunosti, jer nakon što su bili u kontaktu s nekim antigenom (npr. mikrobom) sazrijevaju u plazma - stanice koje proizvode različite vrste specifičnih protutijela (antitijela), bjelančevina nazvanih imunoglobulini (Ig), isp. LIMFOCITI T, vrsta leukocita, nositelji tzv. stanične imunosti organizma jer je posredovana stanicama (limfocitima). Raz-


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

likujemo regulacijske (pomagačke i supresijske) i izvršne (efektorske) limfocite.

spolne hormone, hormone kore nadbubrežne žlijezde, vitamin D, kolesterol itd.

LIMFOCITI, v. leukociti.

LIPOPROTEIN MALE GUSTOĆE (LDL), čestice različitih masti i bjelančevina, prenosi kolesterol iz jetre u ostale dijelove tijela. Dio prenesenog kolesterola taloži se u stijenkama krvnih žila i pridonosi nastanku ateroskleroze.

LIMFOCITOZA, stanje porasta broja limfocita u krvi. LIMFOPENIJA, stanje smanjenog broja limfocita u krvi. LIMFOPOEZA, v. krvotvorni organi. LINEARNI POREDAK GENA, geni su u kromosomima pravilno poredani u nizu, linearno, što je dokazao Morgan na temelju krosingovera (isp.). LINIJA, v. svojta. LINNE, C., (1707.-1778.), švedski prirodoslovac, osnivač taksonomije ili sistematike. Zaslužan za uvođenje binarne nomenklature. LINJANJE, mijenjanje dlake kod sisavaca; najčešće kao prilagodba na promjene temperature u okolišu. Životinje koje žive npr. u hladnim područjima imaju debelo krzno i linjaju se dva put godišnje. U jesen postupno gube tanku ljetnu dlaku i raste im debela sa zimskom poddlakom. Drugo linjanje je u proljeće, kada nestaje debele dlake. Ima sisavaca koji mijenjaju dlaku postupno čitave godine bez obzira na godišnja doba. LIPAZE, enzimi iz skupine hidrolitičkih enzima koji sudjeluju u razgradnji lipida na njihove sastavne dijelove. LIPIDI, organski spojevi koji sadrže ugljik, vodik i kisik, netopljivi su vodi, ali su topljivi u organskim otapalima. U lipide ubrajamo i masti koje su po svom kemijskom sastavu esteri trovalentnog alkohola glicerola i viših masnih kiselina. U lipide ubrajamo i fosfolipide koji izgrađuju stanične membrane te steroide u koje ubrajamo


LIPOPROTEIN VELIKE GUSTOĆE (HDL) uklanja kolesterol iz krvi, prebacujući ga u mišiće i jetru. LIPOPROTEIN VRLO MALE GUSTOĆE (HLDL), uklanja kolesterol iz krvi, prebacujući ga u mišiće i jetru. LIST, zeleni organ u kojem se odvija fotosinteza. Nalaze se na stabljici. Tri su glavna dijela lista: plojka, peteljka i podina ili lisna baza. Mogu biti vrlo različitih oblika. Prvi se listovi razlikuju od pravih, to su supke ili kotiledoni (dijelovi embrija ili klica). Listovi se mogu preobraziti u trnove, vitice, zaštitne i pricvjetne listove te cvijetne dijelove. LIŠAJEVI (Lichenes), životni oblici, primjer simbioze dvaju različitih organizama gljive i alge. Gljive su mješinarke ili stapčarke, a alge su jednostanične zelene ili modrozelene. Udružuju se u spužvasto tijelo koje također zovemo micelij. Alge pribavljaju organsku hranu za oboje, a gljive pružaju algama zaštitu, vodu i minerale. Alge su zadržale sposobnost samostalnog života. Najčešće se razmnožavaju soredijima.Neki lišajevi imaju plodišta poput trubica u kojima je himenij s askusima. Dijele se prema obliku na koraste, lisnate i grmaste lišajeve. Pioniri su vegetacije na Zemlji. LITORAL, obalni pojas razine vode za vrijeme plime i oseke. LITOSFERA, čvrsti dio Zemlje.

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE






klijanje spore

LTH (luteotropni hormon), v. gonadotropni hormoni.



LUBANJCI, v.svitkovci.

arhegonij (jaje)

odrasla mahovina

LIZIN, kemijski spoj iz skupine aminokiselina. LIZOSOMI, stanični organeli obavijeni jednostrukom membranom. To su mjehurići koji se odvajaju od Golgijeva tijela, a sadrže hidrolitičke enzime. Pomoću enzima razgrađuju složene organske spojeve i zbog toga imaju funkciju staničnog probavila. Ošteti li se njihova membrana počinju razgrađivati vlastitu stanicu.

LUES, v. sifilis. LUGOLOVA OTOPINA, sastoji se od, u vodi otopljenih, kalijevog jodida (0.66 %) i joda (0.33 %). Služi za dokazivanje škroba s kojim daje ljubičastomodru boju. LUMP BRUSH KROMOSOMI, v. četkasti kromosomi. LUTEINIZIRAJUĆI HORMON,v. LH. LUTEOTROPNI HORMON, v. gonadotropni hormoni.

M MAHOVINE, kopnene biljke kojima se gametofit (steljka ili talus) prilagodio životu na kopnu. Na gametofitu razaznajemo korjenčiće ili rizoide, stabalce i listiće. To nisu pravi korijen, prava stabljika ili pravi listići. U određenom dobu godine na vrhu stabalca mahovine (nakon oplodnje) razvije se sporofit (sporogon) koji se sastoji od drška i tobolca za spore. Pioniri su vegetacije. Od njih je nastao tresetni ugljen u prošlosti. Danas sudjeluju u stvaranju sedrenih barijera u vodotocima.

anteridij (muška gameta) sporofit (2n) gametofit (n) MAJMUNI, skupina sisavaca s najrazvijenijim mozgom, očima usmjerenim prema naprijed, pokretljivim prstima na dugačkim rukama i nogama te plosnatim noktima. Razvili su se vjerojatno od primitivnih kukcojeda. Većinom se zadržavaju na drveću. Palac mogu primicati svim ostalim prstima i tako dobro obuhvaćati grane. Majmuni jedu gotovo sve, plodove biljaka, kukce, ptice, voće i dr. Žive u toplim dijelovima Azije, Afrike i Amerike. Dijele se na polumajmune i prave majmune. Polumajmuni su primitivniji i žive na drveću. Najrasprostranjenija je skupina lemura. Pravi majmuni se dijele na širokonosce (na pr. kapucini), uskonosce (npr. makaki, afrički mandril) i čovjekolike majmune (npr. orangutan, čimpanza, gorila). MAKIJA, šikara, gusta teško prohodna šuma karakteristična za Sredozemlje. MAKROELEMENTI, v. elementarni sastav.


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

MAKROEVOLUCIJA (adaptivna radijacija), evolucijski procesi iznad razine vrste koji vode nastajanju viših sistemskih grupa odnosno velikih skupina (rodova, porodica, redova, razreda, koljena). MAKROMOLEKULE, velike molekule građene od većeg broja manjih podjedinica. Najvažnije makromolekule živih organizama su nukleinske kiseline i bjelančevine. Nukleinske kiseline izgrađuje veći broj nukleotida, a bjelančevine veći broj aminokiselina. MAKROMUTACIJE, mutacije u genu koji kontrolira bitne metaboličke procese u organizmu. MAKROSPORA, v. sjemeni zametak. MAKROSPORANGIJ, v. sjemeni zametak. MAKROSPOROGENEZA, proces kojim se matična stanica embrijske vrećice u biljaka dijeli mejozom dajući četiri haploidne stanice od kojih tri propadaju, a jedna se razvija u embrijsku vrećicu. Time je ona jedina preživjela makrospora iz koje će se razviti ženski gametofit (haploidna generacija). MALARIJA, v. plazmodij. MALI MOZAK (cerebellum), leži u stražnjem dijelu lubanje, ispod velikog mozga. Građen je od vanjske sive i unutarnje bijele tvari. Ima dvije hemisfere. Kontrolira mišićni tonus, osigurava ravnotežu, koordinira mišićne kretnje. MALI (plućni) OPTOK KRVI, deoksigenirana (venska) krv se iz srca sistolom (kontrakcijom) desne klijetke izbacuje u plućnu arteriju odnosno u pluća. Tu će se hemoglobin iz krvi osloboditi viška ugljikovog dioksida i obogatiti kisikom (oksigenirati). Iz pluća se oksigenirana (arterijska) krv vraća u lijevu pretklijetku kroz


dvije plućne vene. Tijekom sistole lijeve pretklijetke krv se potiskuje u lijevu klijetku, a odatle snažnom kontrakcijom u aortu tj. u veliki optok krvi. MALOČETINAŠI, životinje iz skupine kolutićavaca, isp. Žive na kopnu i u slatkim vodama. Nemaju parapodije, ticala ni oči. Duž tijela su poredane četine. Najpoznatija vrsta je gujavica, koja živi u tlu. Na pojedinim su susjednim kolutićima jako razvijene žljezdane stanice koje luče sluz i stvaraju zadebljanje - pas ili klitelum. Klitelum služi pri razmnožavanju i stvara ovojnicu (kokon) oko oplođenih jaja koja ostavlja u zemlji. MALOKOLUTIĆAVCI (Oligomeria), životinje iz skupine bezkralježnjaka. Preci su im davni kolutićavci koji su prešli na sjedilački ili polusjedilački način života. Postepeno se smanjio broj kolutića, a simetrija tijela je kod nekih oblika prešla iz dvobočne u zrakastu simetriju. Najpoznatiji su lovkaši, bodljikaši (trp, ježinac, zvjezdača i zmijača), žiroglavci, bradnjaci i streličari. Žiroglavci (isp.) i bradnjaci su bilateralno simetrične pokretne životinje koje ruju po morskom dnu. MALPIGHI, M., (1628.-1694.), talijanski biolog, mikroskopom proučavao građu životnja i prvi vidio kapilare, te opisao živce, kožu i bubreg. Po njemu je nazvano Malpighijevo tjelešce u nefronu bubrega i Malpighijev sloj kože. MALPIGHIJEVE CJEVČICE, organi za izlučivanje i osmoregulaciju tjelesnih tekućina kod većine člankonožaca: klještara i uzdušnjaka. To su cjevasta izbočenja crijeva u tjelesnu šupljinu. Produkti izmjene tvari filtriraju se u cjevčice i pražnjenjem crijeva izlaze van. MASLAČNO VRENJE, stoji u temelju kvarenja maslaca, ali i fermentacije različitih sireva (rupice!). Temeljna reakcija je:

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

C6H12O6 → 2CO2 + 2H2 + energija + + 2CH3CH2CH2COOH maslačna kiselina

MASNE NASLAGE (aterom), v. ateroskleroza. MASTI, složeni organski spojevi sastavljeni od trovalentnog alkohola glicerola i masnih kiselina. U sastavu masnih kiselina dominiraju zasićene masne kiseline. Ne otapaju se u vodi, ali se dobro otapaju u eteru, benzenu, kloroformu i sl. U stanici služe kao pričuva energije. MATERNICA (uterus), organ u kojem se razvija plod (kod većine sisavaca). Kod žena je to kruškoliki, mišićni organ smješten u donjem trbuhu. Sastoji se od dna, tijela i vrata (cervix) maternice. Vrat maternice vodi u rodnicu. Kroz taj kanal izlazi menstruacijska krv, a u maternicu ulaze spermiji. Unutarnja je stijenka maternice obložena sluznicom (endometrijom) koja se u vrijeme menstruacije oljušti, a u trudnoći stvara posteljicu. MAYER, A., njemački znanstvenik koji je istraživao mozaičnu bolest duhana. Pretpostavlja da je uzročnik te bolesti sitna bakterija. MEDICINSKA MIKROBIOLOGIJA, v. mikrobiologija. MEDUZA, jedan od morfoloških oblika kod žarnjaka. Izgledom je slična zvonu ili klobuku. Usna (oralna) strana je u unutarnjosti, a lovke su na rubu zvona. Meduza je slobodno plivajući oblik. MEGAEVOLUCIJA (aromorfoza), evolucija osnovnih i najviših sistematskih skupina živoga svijeta prilikom prijelaza živog svijeta iz jednog medija u drugi primjerice iz vode na kopno. MEGAKARIOCITI, v. krvotvorni organi i koštana moždina.

MEHANIZAM POVRATNE SPREGE (mehanizam povratne veze), princip na kojem se temelji rad svih žlijezda s unutarnjim izlučivanjem. Prema tom principu svaka promjena koncentracije nekog hormona u krvi utječe na rad hipotalamusa i hipofize koji će normalizirati koncentraciju tog hormona. Na primjer, smanjena količina muškog spolnog hormona testosterona u krvi potaknut će izlučivanje faktora oslobađanja gonadotropnih hormona iz hipotalamusa. Ti faktori potaknut će izlučivanje gonadotropnih hormona iz adenohipofize koji će zatim povećati izlučivanje testosterona iz testisa. Time će se ponovno uspostaviti potrebna koncentracija testosterona u krvi. MEHANIZAM POVRATNE VEZE, v. mehanizam povratne sprege. MEJOZA (zoridbena dioba, redukcijska dioba), stanična dioba kojom nastaju spolne stanice, gamete. Osnovna značajka mejoze je da u njoj dolazi do redukcije broja kromosoma. Tako iz jedne stanice s diploidnim brojem kromosoma (2n) nastaju 4 stanice s haploidnim brojem kromosoma (n). Mejoza se sastoji od dvije uzastopne diobe od kojih je prva redukcijska (mejoza I), a druga je slična mitozi. Stanice (gamete) koje nastaju mejozom su genetički različite zbog pojave crossing overa. Proces nastajanja gameta mejozom naziva se gametogeneza. Ako nastaju ženske gamete, jajne stanice, govorimo o oogenezi, a nastaju li muške gamete, spermiji, tada govorimo o spermatogenezi. MEJOZA I (prva mejotička dioba), dioba kojom počinje nastanak spolnih stanica. Sastoji se od 4 uzastopne faze: profaza I, metafaza I, anafaza I i telofaza I. Najvažnija zbivanja u mejozi I su redukcija broja kromosoma te rekombinacija homolognih kromosoma (isp. krosingover).


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

MEJOZA II (druga mejotička dioba), dioba kojom završava nastanak spolnih stanica. Sastoji se od 4 uzastopne faze: profaza II, metafaza II, anafaza II i telofaza II. Zbivanja tijekom mejoze II slična su zbivanjima tijekom mitoze (isp.). MEKUŠCI (Mollusca), beskralježnjaci; najrazvijenija i vrstama najbogatija skupina beskolutićavaca. Poznato je više od 100 000 vrsta. Žive u moru, kopnenim vodama i na kopnu. Najrasprostranjeniji mekušci su: puževi, školjkaši i glavonošci. Tijelo je mekano i obavijeno plaštem. Plašt izlučuje vapnenu ljušturu: kod puževa jednodjelnu (kućicu) a kod školjkaša dvodjelnu (školjku). Mekušci su većinom bilateralno simetrični. Na tijelu se mogu razlikovati: glava, mišićavo stopalo i utrobna vreća s unutarnjim organima. Probavilo je prohodno. U ustima je trenica ili radula. Probava je izvanstanična (u želucu) i unutarstanična (u probavnoj žlijezdi). Optjecajni sustav je otvoren t.j. krv istječe iz krvnih žila i oplakuje tkiva i organe. Srce je građeno od klijetke i jedne ili više pretklijetki. Krvni ili dišni pigment se naziva hemocijanin. Organi za disanje su škrge (ktenidije) ili "pluća" t.j. dio plašta kod kopnenih puževa. Za izlučivanje imaju metanefridije. Živčani sustav se sastoji od više parnih ganglija međusobno povezanih živčanim vrpcama. Osjetni organi su oči, statocisti, ticala i osfradiji. Mekušci su razdvojena spola, ali ima i dvospolaca. Oplodnja je vanjska ili unutarnja. Ličinački stadiji su trohofora i velinger-ličinka. Mekušci su bogati bjelančevinama i vitaminima pa se rabe za hranu.

njima se iz aminokiseline tirozina uz pomoć enzima fenol - oksidaze i drugih sintetizira pigment melanin (crni) i feomelanin (crveno - smeđi ili žuti) koji koži daju boju. Proizvodnja pigmenta u koži pod kontrolom je hormona - MSH (melanocit stimulacijski hormon) iz srednjeg režnja hipofize. Pigment se u melanocitu nalazi u melanosomima koji štite kožu od štetnog djelovanja ultraljubičastih zraka. Pretjerano izlaganje kože ultraljubičastim zrakama može dovesti do pojave tumora –melanoma. MELANOCIT STIMULACIJSKI HORON (MSH), luči ga srednji režanj hipofize, a služi za raspodjelu kožnog pigmenta melanina, v. melanociti. MELANOM, maligni tumor koji se najčešće javlja u koži, a rjeđe u mrežnici oka. Tumorske stanice sadrže različite količine melanina, v. melanociti. MELIORACIJE, opsežni zahvati isušivanja močvarnih terena, dijelova mora i reguliranje tekućih voda u svrhu dobivanja plodnog i obradivog tla. MEMBRANSKI PROTEINI, proteini koji dolaze u sastavu stanične membrane. Neki su proteini samo djelomično uronjeni u dvosloj fosfolipida dok se drugi protežu kroz čitavu debljinu lipidnog dvosloja tvoreći proteinske “kanaliće”. Neki od njih su i enzimski aktivni. MENARHA, prvo menstrualno krvarenje iz spolovila u djevojčica u pubertetu.

MELANIN (grč. melas = crn), pigment crne boje koji se stvara u koži kao zaštita od štetnog djelovanja UV zraka, v. melanociti.

MENDEL, G. (1822. – 1884.), češki znanstvenik koji je godine 1865. objasnio mehanizme prenošenja nasljeđa s roditelja na potomstvo. Poznati su Mendelovi zakoni u kojima je iznio osnovne zakonitosti nasljeđivanja.

MELANOCITI, stanice koje se nalaze između bazalnih stanica epiderme kože. U

MENDELOVI ZAKONI, zakoni nasljeđivanja koje je postavio Mendel radeći


____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

pokuse s biljkama. Zakoni vrijede kod biljaka, životinja i čovjeka. Postoje tri Mendelova zakona: 1. Zakon jednoličnosti (uniformnosti) F1 generacije: križaju li se homozigotni roditelji, svi potomci F1 generacije su međusobno jednaki. 2. Zakon cijepanja (segregacije) svojstava u F2 generaciji po stalnim brojčanim odnosima: međusobnim križanjem jedinki F1 generacije nastaju potomci s različitim svojstvima i to: a) kod monohibridnog križanja s dominacijom u omjeru 3:1 u korist dominantnog oblika; b) kod monohibridnog intermedijarnog križanja u omjeru 1:2:1. 3. Zakon nezavisnosti nasljednih faktora: kada se križaju jedinke s više svojstava pojedina se svojstva nasljeđuju nezavisno, što znači da se aleli u zigoti ne spajaju nego samo mozaično kombiniraju.

skih spolnih hormona. Istovremeno, maternica se priprema za prihvat zametka ako dođe do oplodnje. U slučaju da jajašce nije oplođeno sluznica maternice se ljušti i ta se pojava naziva menstruacija ili mjesečnica koja se ponavlja u pravilnim razmacima, obično svakih 28 dana.

MENINGITIS, upala mozgovnih ovojnica i leđne moždine mikroorganizmima iz krvotoka ili onima koji su dospjeli u tijelo ozljedom glave. MENORAGIJE, obilne menstruacije koje traju dulje od sedam dana, uz izbacivanje većih ugrušaka krvi. Mogu biti uzrokovane hormonalnim poremećajem ili različitim patološkim razlozima, kao npr. benignim tumorm maternice, miomom. MENSTRUACIJA, v. mjesečnica. MENSTRUALNI CIKLUS (menstruacijski ciklus), ženski spolni ciklus karakteriziran periodičkim promjenama koje se odvijaju u jajnicima i maternici, a započinju u pubertetu. Tada iz spolnih centara u mozgu dolaze impulsi do hipofize u kojoj se počinju izlučivati gonadotropni hormoni koji pak u jajnicima potiču sazrijevanje jajnih stanica i izlučivanje žen-

Prikaz promjena tijekom menstrualnog ciklusa: A - količine gonadotropnih hormona, B – količine estrogena i progesterona, C - bazalne temperature, D - plodnih i neplodnih dana.

Menstrualni ciklus se dijeli u tri uzastopne faze. Prva je folikularna faza koja počinje mjesečnicom, tj. menstruacijskim krvarenjem (3 do 5 dana). U toj fazi u jednom mjehuriću započinje sazrijevanje jajne stanice (traje oko 12 dana). Druga faza je ovulacijska faza, u kojoj jajna stanica konačno dozre, a završava se ovulacijom i traje 2 do 3 dana. Treća je sekrecijska faza, tj. faza s povećanom sek-


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

recijom hormona progesterona i estrogena. Traje 13 do 14 dana. S padom koncentracije estrogena i progesterona nastupa opet mjesečnica. MERISTEM, v. tvorno staničje. MEROZOITI, v. plazmodij. MESOJEDI, v. karnivori, zoofagi. MESOJEDNE BILJKE, v. karnivorne biljke. METABOLIČNA VODA je voda koja nastaje tijekom metabolične razgradnje ugljikohidrata, masti i bjelančevina iz hrane. METABOLIZAM MASTI, skup svih biokemijskih reakcija u organizmu kojima se iz masti dobiva energija. METABOLIZAM PROTEINA, skup svih biokemijskih reakcija u organizmu kojima se iz proteina dobiva energija. Metabolizmom proteina upravljaju hormoni iz kore nadbubrežne žlijezde. METABOLIZAM UGLJIKOHIDRATA, skup svih biokemijskih reakcija u organizmu kojima se iz ugljikohidrata dobiva energija. METACENTRIČAN KROMOSOM, kromosom koji ima svoju pričvrsnicu u sredini. METAFAZA, jedna od etapa stanične diobe - mitoze u kojoj su kromosomi pravilno smješteni u sredini stanice u središnjoj ili ekvatorijalnoj ravnini pričvršćeni za niti diobenog vretena. METAFAZA DRUGE MEJOTIČKE DIOBE, v. metafaza II. METAFAZA I, (metafaza prve mejotičke diobe), jedna od etapa redukcijske diobe mejoze I u kojoj su konjugirani kromosomi (spareni homologni kromosomi) smješteni u središnjoj ili ekvatorijalnoj ravnini.


METAFAZA II, (metafaza druge mejotičke diobe), jedna od etapa mejoze II u kojoj su jednostruki kromosomi smje-šteni u središnjoj ili ekvatorijalnoj ravnini. U metafazi II broj kromosoma u svakoj stanici je polovičan (haploidan) s obzirom na broj kromosoma na početku mejoze I. METAFAZA PRVE MEJOTIČKE DIOBE, v. metafaza I. METAGENEZA, izmjena nespolne generacije sjedilačkih polipa i spolne generacije meduza u životnom ciklusu žarnjaka, isp. Polipi mnogih obrubnjaka i režnjaka pupanjem stvaraju meduze koje se otkidaju i kada postanu spolno zrele proizvode jaja i spermije. Nakon oplodnje razvija se trepetljikava ličinka planula koja se pričvrsti za dno i razvije u polip. METAMORFOZA, v. preobrazba. METANEFRIDIJI, organi za izlučivanje kod mekušaca i kolutićavaca. To su otvorene cjevčice koje na vrhu imaju trepetljikavi lijevak koji skuplja izlučevine iz tjelesne šupljine. U cjevčicama se stvara mokraća i izbacuje kroz otvore metanefridija van. METANEFROS, v. treći bubreg. METAZOA, v. mnogostanične životinje. METILJAVOST, v. ovčji metilj. METILJI, beskolutićave životinje koje pripadaju koljenu plošnjaka, isp. Opisano je oko 11000 vrsta metilja koji su nametnici u probavilu sisavaca. Tijelo im je prekriveno kutikulom i imaju prianjalke na prednjem dijelu tijela. Anaerobni su organizmi kao i drugi crijevni nametnici. Dvospolci su i za razvitak im je potreban barem jedan međudomadar, a najčešće je to puž. Najprepoznatljivija vrsta je ovčji metilj, isp. METIONIN, kemijski spoj iz skupine aminokiselina.

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

MEZODERM, srednji zametni listić koji se formira tijekom druge etape embrionalnog razvoja, gastrulacije u nekih bezkralježnjaka (npr. ježinaca) i svih kralježnjaka. Nastaje iz dijela endoderma koji se useljava u prostor blastocela. U kralježnjaka, iz mezoderma se razvijaju: mišići, srce i krvne žile, kosti, hrskavica, spolne žlijezde, limfatički organi itd. Isp. gastrulacija. MEZOFIL (grč. mesos = srednji, fyllon = list), tkivo lista koje se nalazi između gornje i donje epiderme; specijalizirano za obavljanje procesa fotosinteze. MEZOFILNE ŽIVOTINJE (grč. mesos = srednji, filos = prijatelj), životinje prilagođene životu na umjereno vlažnim staništima. Tu pripada većina kopnenih organizama. MEZOFITI (grč. mesos = srednji, fyton = biljka), biljke prilagođene životu na umjereno vlažnim staništima. Tu pripada većina našeg listopadnog drveća i kulturnih biljaka. MEZONEFROS, v. drugi bubreg. MEZOSOMI, v. bakterije. MICELIJ, vegetativno tijelo gljiva izgrađeno od nitastih tvorevina zvanih hife. Također i spužvasto tijelo lišajeva (isp.). MIGRACIJA RIBA, v. selidbe riba. MIJELOIČNA LEUKEMIJA, v. leukemija. MIJELOM, bolest prekomjernog umnožavanja plazma - stanica u koštanoj moždini. MIKOPAZMODIJI, v. mikoplazme. MIKOPLAZME (mikopazmodiji), najmanji (0,1 – 0,3 μm) i najjednostavniji prokarioti (isp.). Njihove stanice sadrže i DNA i RNA, a obavijene su plazmatskom membranom, ali za razliku od većine osta-

lih prokariota ne sadrže staničnu stijenku. Neke mikoplazme uzrokuju bolesti čovjeka, životinja i biljaka. MIKORIZA, združivanje gljiva i viših biljaka pri čemu hife gljiva obavijaju korjenje biljaka preuzimajući ulogu korijenovih dlačica od kojih su djelotvornije, a za uzvrat biljke gljive opskrbljuju organskom hranom. MIKROBIOCENOZA, biocenoza mikroorganizama. MIKROBIOLOGIJA, znanost koja se bavi proučavanjem mikroskopski sitnih organizama. Zbog velikog područja istraživanja i široke primjene mikrobiologija se dijeli na mnogo grana, npr. medicinska mikrobiologija, prehrambena mikrobiologija, industrijska mikrobiologija itd. MIKROELEMENTI, v. elementarni sastav. MIKROEVOLUCIJA, procesi evolucije u kraćim razdobljima koji se zbivaju na razini postanka vrste, odnosno populacije. MIKROMUTACIJE, mutacije gdje se teško uspostavi međuodnos između promjene genotipa i neke fenotipske karakteristike. MIKROPILA, otvor na sjemenom zametku, v. tučak. MIKROSFERE, okrugla tjelešca proteinskog sastava slična jednostavnim živim stanicama. Mikrosfere je u svojim pokusima dobio američki biokemičar Fox. Njegovi pokusi pridonijeli su razumijevanju razvoja živog svijeta na Zemlji. MIKROSKOP, instrument pomoću kojeg se mogu promatrati predmeti nevidljivi ljudskom oku. Svjetlosni mikroskop građen je od mehaničkih i optičkih dijelova. Mehanički dijelovi su podnožje, stalak, stolić, tubus, veliki i mali vijak. Optički


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

dijelovi su kondenzor s iris-zaslonom, objektivi, okulari i kod nekih koji nemaju ugrađenu rasvjetu zrcalo. Mehanički dijelovi nose optičke dijelove i služe za njihovo pomicanje i namještanje predmeta promatranja. Optički dijelovi omogućuju osvjetljavanje i povećavanje promatranog predmeta. Školski mikroskopi povećavaju 400-600 puta, a primjenom posebnih objektiva (imerzija) do 1000 puta. U biološkim istraživanjima koriste se i neki posebni tipovi mikroskopa: fazni mikroskop, polarizacijski i fluorescencijski mikroskop. Faznim mikroskopom mogu se istraživati neobojene stanične strukture koje se razlikuju samo u indeksu loma svjetlosti. Polarizacijskim mikroskopom vidljiva je fina građa i kristalna struktura preparata na osnovi pojave dvoloma svjetlosti pri prolazu kroz preparat. Fluorescencijski mikroskop omogućuje otkrivanje sitnih struktura preparata (stanične bjelančevine i dr. molekule) na osnovi fluorescencije. Elektronski mikroskop umjesto vidljive svjetlosti koristi snop elektrona koji prolazi kroz tanki prerez mikroskopskog preparata čija slika postaje vidljiva na fluorescentnom zaslonu. Umjesto staklenih leća koje ima svjetlosni mikroskop elektronski mikroskop ima prstenaste elektromagnete (elektronske leće). Elektronskim mikroskopom možemo vidjeti predmete promjera manjeg od 1 nm. Različiti mikroskopi imaju različitu moć razlučivanja (isp.). MIKROSPORA, v. prašnik. MIKROSPORANGIJ, v. prašnik. MIKROSPOROGENEZA, proces kojim nastaju peludna zrnca (mikrospore), isp. prašnik. MILLER, S., (rođ. 1930.), američki znanstvenik koji je, imitirajući uvjete koji su vladali u prvom razdoblju postanka Zem-


lje, u laboratorijskim uvjetima dobio aminokiseline i neke druge organske spojeve. MILLEROV POKUS, v. Miller. MIMIKRIJA (grč. mimeomai = oponašam), obilježje nekih životinja da bojom i oblikom tijela oponašaju druge životinje ili predmete iz svojeg okoliša u svrhu zaštite od neprijatelja, predatora. MINERALI, v. mineralne tvari. MINERALNE TVARI (minerali), anorganski prirodni spojevi. Pojedini elementi koji izgrađuju minerale su sastavni dio mnogih, za život važnih spojeva. Na primjer, magnezij (Mg) je sastavni dio klorofila, željezo (Fe) hemoglobina, kalcij (Ca) kostiju i zubi, jod (I) je potreban za stvaranje hormona štitnjače, tiroksina, a mnogi su sastavni dijelovi enzima, npr. Mg, Fe, bakar (Cu), cink (Zn) itd. MINUTNI VOLUMEN DISANJA, je ukupna količina novog zraka koji svake minute dospije u dišne putove. Jednak je umnošku dišnog volumena i frekvencije disanja. Normalni dišni volumen iznosi oko 500 ml, a normalna frekvencija disanja oko 12 puta u minuti. Prema tome, minutni volumen disanja iznosi oko 6000 ml ili 6 litara u minuti (u mirovanju). MINUTNI VOLUMEN SRCA, volumen krvi koje srce utisne u krvotok u minuti. Mijenja se tijekom različitih aktivnosti tijela. Umnožak je broja otkucaja srca u minuti i udarnog volumena srca (npr. 70 x 70 mL = 4900 mL/min). MIOFIBRILE, tanka proteinska vlakna koja izgrađuju mišićno tkivo, isp. poprečno-prugasti mišić. MIOKARD, srčani mišić. MIOZIN, bjelančevinasta molekula koja izgrađuje miofibrile, v. poprečnoprugasti mišić.

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

MIRACIDIJ, v. ovčji metilj. MIŠIĆI, omogućuju pokretanje tijela i njegovih pojedinih dijelova, skraćivanjem (kontrakcijom) i opuštanjem (relaksacijom). Mišići energiju dobivaju razgradnjom glukoze (reakcija glikolize) i glikogena. Postoje tri vrste mišića: poprečnoprugasti mišići, glatki mišići i srčani mišić koji se sastoji od poprečnoprugastih međusobno spojenih vlakana, v. poprečnoprugasti mišić. Prijenos podražaja sa živca na mišićno vlakno odvija se na živčano mišićnoj vezi, isp. MIŠIĆNA ATROFIJA, kržljanje mišića uslijed slabe mišićne aktivnosti ili prestanka upotrebe pojedine skupine mišića. Mišić postaje tanji i slabih kontraktilnih sposobnosti. MIŠIĆNA HIPERTROFIJA, povećanje mišićne mase uzrokovano povećanom mišićnom aktivnošću. Promjeri pojedinih mišićnih vlakana postaju veći, povećava se i ukupni broj miofibrila u vlaknu. Povećava se kapilarna mreža i opskrba kisikom i hranidbenim tvarima. MITARENJE, mijenjanje perja kod ptica. Ptice se mitare jedanput ili dva put godišnje, većinom nakon sezone parenja. Budući da pero nije živa struktura, ono otpada, a staro se perje zamjenjuje novim. Mitarenje kontrolira štitna žlijezda. MITOHONDRIJI, stanični organeli koji se nalaze u citoplazmi eukariotskih stanica. Obavijeni su dvostrukom membranom, a unutarnjost im je ispunjena žitkom masom koja se zove matriks (matrix). U matriksu se nalazi DNA, ribosomi, RNA. Unutarnja membrana tvori mnogostruke nabore koji mogu biti u obliku grebena i pregrada (kriste) ili poput cjevčica. U njima se nalaze dišni enzimi. U mitohondrijima se odvija proces staničnog disanja pri kojem se dobiva energija potrebana za

stanične aktivnosti. Zbog toga se mitohondriji još nazivaju i “energetskim centralama” stanice. Imaju sposobnost umnožavanja neovisno od diobe stanice. MITOZA, dioba somatskih (tjelesnih) stanica. Sastoji se od četiri glavne faze: profaze, metafaze, anafaze i telofaze. Temeljna značajka mitoze je da ovom diobom nastaju dvije stanice koje imaju isti, dvostruki (2n) broj kromosoma kao i stanica od koje su nastale. MJESEČNICA (menstruacija), mjesečno krvarenje kod žena koje se pojavljuje redovito, svakih 28 dana, osim u trudnoći, dojenju i klimakteriju. Menstruacijska krv je razgrađena sluznica maternice (endometrij) pomiješana sa krvi iz kapilarne mreže koja je hranila endometrij, v. menstrualni ciklus. MJEŠČIĆNICE, v. plaštenjaci. MJEŠINARKE, kopnene gljive s micelijem građenim od vrlo dugih hifa s poprečnim stijenkama. Spore im se razvijaju u mješinicama. Mješinice stručno zovemo askusima, a spore askosporama. Askusi se razvijaju na posebno građenom jednoslojnom plodištu, himeniju. Imaju izraženu izmjenu generacija gametangiogamijom i kariogamijom. Predstavnici mješinarki su kvaščeve gljivice, zelene plijesni, smrčci, tartufi (gomoljače) itd. MLIJEČNI ŠEĆER, v. laktoza. MLIJEČNO-KISELO VRENJE, postupak kojim se dolazi do kislog mlijeka i kupusa, jogurta, kefira i sl., a uzrokovano je anaerobnim bakterijama, npr. Lactobacillus bulgaricus i Streptococus lactis. U osnovi je proces:

C6H12O6 → 2CH3CHOHCOOH mliječna kiselina

MNOGOČETINAŠI, životinje iz skupine kolutićavaca, isp. Žive u moru kao pokret-


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

ni ili sjedilački oblici. Cjevaši izlučuju oko tijela cijev od vapnenca. Mnogi ruju po dnu praveći hodnike. Na svakom kolutiću imaju parapodije na kojima su četine (hete). Na glavi su usta, oči, ticala i pipala (palpi). U Jadranu su poznati: afroditin palolo i morska gusjenica. MNOGOKOLUTIĆAVCI (Polymeria), najbrojnija skupina beskralješnjaka; pripadaju im: kolutićavci i člankonošci. Tijelo im je bilateralno simetrično i podijeljeno na kolutiće. Unutarnji organi uglavnom prate vanjski kolutićavi raspored. Svi imaju celom ili sekundarnu tjelesnu šupljinu. Kod člankonožaca kolutićavost nije jasno izražena. MNOGOSTANIČARI, v. mnogostanične životinje. MNOGOSTANIČNE ŽIVOTINJE (metazoa, mnogostaničari), se sastoje od velikog broja specijaliziranih stanica različitih oblika. Razlikujemo pet organizacijskih tipova: spužve, beskolutićavce, mnogokolutićavce, malokolutićavce i svitkovce. MOĆ RAZLUČIVANJA, sposobnost mikroskopa da dvije bliske točke prikaže razdvojeno. Svjetlosnim mikroskopom u najboljem slučaju mogu se razlučivati točke udaljene jedna od druge 0,2-0,4 μm, a elektronskim mikroskopom može se postići razlučivanje od 0,2-0,5 nm. MODEL TEKUĆEG MOZAIKA, model membrane koji su zamislili S.J.Singer i G.L. Nicolson. Prema tom modelu neke membranske bjelančevine su na površini (periferni proteini), a druge su djelomice ili potpuno uronjene (integralni proteini) u dvosloj lipida. Raspored bjelančevina u membrani nije stalan već se mijenja ovisno o stanju stanice. MODIFIKACIJE (somatske varijacije), nenasljedne promjene organizma nastale


pod utjecajem okoliša. Na primjer, sobni jaglac pri temperaturi od 10 °C cvate crveno, a pri 25 °C bijelo. MODROZELENE ALGE (cijanobakterije), jednostanične biljke koje nemaju potpuno izgrađenu jezgru i zbog toga ih ubrajamo u prokariote. U osnovnoj građi su slične bakterijama, također prokariotskim organizmima, ali za razliku od bakterija koje sadrže bakterioklorofil, modrozelene alge sadrže klorofil. To su autotrofni fotosintetski organizmi. Nikad nemaju bičeva. Nemaju plastide, mitohondrije ni golgijeva tjelešca. Mogu se kromatski adaptirati. Najčešće se razmnožavaju vegetativno. Mogu prijeći i u trajni oblik, spore. Kao prvi pravi fotosintetski organizmi, pretpostavlja se da su odigrale odlučujuću ulogu u stvaranju atmosferskog kisika, a time i u razvoju života na Zemlji. Također provode fiksaciju dušika iz zraka. Negativni utjecaj ima njihovo naglo vegetativno razmnožavanje u moru poznato pod nazivom “cvjetanje mora”. Njihova biomasa na kraju životnog ciklusa se i raspada uzrokujući onečišćenje. MOKRAĆA (urin), izlučevina bubrega kojom se iz organizma odstranjuju čovjeku suvišne i štetne tvari topljive u vodi. MOKRAĆNA CIJEV (uretra), završni dio mokraćnog sustava. Po građi i funkciji različita je u muškaraca i žena. U muškaraca služi provođenju i mokraće i sperme, a u žena samo mokraće. MOKRAĆNI (urinarni) SUSTAV, sustav organa koji mokraćom izlučuje štetne tvari iz organizma. Kod čovjeka se sastoji od nekoliko organa koji su smješteni u trbušnoj šupljini iza potrbušnice. To su bubreg, mokraćovod (ureter), mokraćni mjehur i mokraćna cijev (uretra). MOKRAĆNI MJEHUR, neparni šuplji organ smješten u maloj zdjelici, a služi za

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

skupljanje mokraće nastale u bubrezima. Prosječno može u odrasle osobe primiti oko 500 mL mokraće. Na izlasku iz mjehura je prstenasti mišić (sfinkter) koji je pod nadzorom simpatikusa i parasimpatikusa. Sfinkter se otvara refleksno kada tlak mokraće podraži receptore u stijenci mokraćnog mjehura. Mokraću iz mokraćnog mjehura odvodi izvan tijela neparna mokraćna cijev (uretra). MOKRAĆOVOD (ureter), tanka cijev dužine oko 25 cm koja se obostrano iz bubrežne nakapnice spušta u mokraćni mjehur s njegove gornje strane. MOLEKULARNA BIOLOGIJA, znanost koja proučava životne procese u stanici na razini molekula. Posebice se bavi proučavanjem odnosa između makromolekula DNA, RNA i proteina. MONERE, v. prokarioti. MONGOLIZAM, v. Downov sindrom MONOCITI, pokretni leukociti, spadaju u velike fagocite - makrofage. Sudjeluju u imunološkim reakcijama obradom antigena ili fagocitiraju raličite čestice, uključujući mikroorganizme, oštećene ili mrtve stanice i nepotrebne bjelančevine. MONOHIBRIDNO INTERMEDIJARNO KRIŽANJE, jedan tip križanja u kojem se prati nasljeđivanje jednog svojstva i u kojem nema dominantnog alela za takvo svojstvo. I u ovom primjeru križanja kao i u primjerima križanja s dominacijom, početna roditeljska generacija i generacije potomaka označuju se odgovarajućim slovima. Razlika postoji u označavanju alela jer su ovdje aleli podjednako vrijedni te ih sve označujemo malim slovima (a1, a2). U sljedećem primjeru križanja početnu roditeljsku P (parentalnu) generaciju čine homozigotna crvena zijevalica (a1a1) i homozigotna bijela zijevalica (a2a2). Njihovim

križanjem dobit ćemo u F1 generaciji sve ružičaste jedinke (a1a2) jer nema dominantnog alela pa se pojavljuje srednji (intermedijarni) fenotip. U F2 generaciji, koju dobijemo međusobnim križanjem jedinki F1 generacije, pojavljuju se tri fenotipa: crveni (genotip a1a1), ružičasti (genotip a1a2) i bijeli (genotip a2a2) u omjeru 1:2:1. (V. shemu u Dodatku 1.) MONOHIBRIDNO KRIŽANJE S DOMINACIJOM, jedan oblik križanja u kojem se prati nasljeđivanje jednog svojstva, u ovom primjeru to je visina stabljike graška. U prikazima križanja početna roditeljska (parentalna) generacija označuje se uvijek s P, a generacije potomaka (filijalne) prema redoslijedu s F1, F2, F3 itd. Aleli pojedinih svojstava označuju se slovima i to dominantni velikim slojevima, a recesivni malim. Visok rast je dominantno svojstvo te ga označujemo velikim slovom (A), a nizak rast je recesivno svojstvo te ga označujemo malim slovom (a). P generaciju predstavljaju: homozigotni visoki grašak (AA) i homozigotni niski grašak (aa). Njihovim križanjem dobit će se svi visoki potomci (Aa) koji predstavljaju F1 generaciju. Međusobnim križanjem jedinki F1 generacije dobiva se potomstvo F2 generacije u kojem je 75 % jedinki visokog rasta (AA, Aa; aA), a 25 % jedinki niskog rasta (aa) što znači da je omjer fenotipa 3:1. Ako se želi saznati da li je jedinka homozigotna (AA) za dominantno svojstvo ili heterozigotna (Aa) tada se provodi test križanje. (V. Dodatak 1.) MONOMERI, građevne podjedinice polimera, npr. aminokiseline su podjedinice proteina, nukleotidi nukleinskih kiselina, a jednostavni šećeri polisaharida. MONONUKLEOTIDI, isto što i nukleotidi. MONOSAHARIDI, v. ugljikohidrati.


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

MORFOGENETSKA KRETANJA, v. morfogeneza. MORFOGENEZA, proces koji omogućuje stvaranje specifičnih razvojnih struktura i oblika kojima se odlikuje svaki organizam. Tijekom razvitka iz zigote višestanični životinjski organizmi mitotičkim diobama povećavaju broj stanica koje se pomiču zauzimajući nove položaje (morfogenetska kretanja) i tako stvaraju nove oblike zametka, npr. blastulu, gastrulu, neurulu. MORFOLOGIJA, znanost koja proučava izvanjsku građu tijela svih živih bića. MORSKA SALATA, v. zelene alge. MORTALITET (smrtnost), broj smrtnih slučajeva nekog područja u odnosu na cjelokupno stanovništvo. MORULA, v. brazdanje. MOŠNJA (scrotum), kožna vrećica u kojoj se nalaze testisi. MOTORIČKI ŽIVČANI SUSTAV, v. pokretački živčani sustav. MOZGOVNI ŽIVCI, v. moždani živci. MOŽDANI MOST (pons), nalazi se na prijelazu srednjeg mozga u produženu moždinu. Kroz njega prolaze živčani putovi koji povezuju produženu leđnu moždinu s velikim mozgom. MOŽDANI (mozgovni) ŽIVCI (nervi craniales), izlaze iz baze velikog mozga ili ulaze u njega. Ima ih 12 pari, a prema funkcionalnim značajkama mogu se podijeliti na: osjetilne, motoričke i mješovite živce. Inerviraju glavu, vrat i unutarnje organe u prsnoj i trbušnoj šupljini. Označuju se rimskim brojevima od I do XII. MOŽDANO DEBLO, čine ga međumozak, srednji mozak, moždani most i produžena moždina. U njemu se nalaze živčana vlakna koja povezuju veliki i mali mozak,


te velike motoričke jezgre koje imaju važnu ulogu u mišićnim radnjama kao što su: stajanje, hodanje i sjedenje. MOŽDINSKI (kralježnički) ŽIVCI, izlaze iz leđne moždine, između kralježaka. Podijeljeni su u pet skupina: 8 pari vratnih, 12 pari prsnih, 5 pari slabinskih, 5 pari križnih i 2 para trtičnih. Nakon izlaska iz kralježnice, osjetilna i pokretačka živčana vlakna spajaju se u mješoviti živac koji ide prema periferiji tijela. MREŽNICA (retina), treći unutarnji sloj očne jabučice. Sastoji se od fotoreceptora: štapića i čunjića. Štapići su osjetljivi na intenzitet svjetlosti, a čunjići na tri osnovne boje (modru, zelenu i crvenu), a njihovim podraživanjem doživljavamo sve boje u vidljivom dijelu spektra. U mrežnici se svjetlosni podražaj (elektromagnetski valovi svjetla) fotokemijskim procesima u štapićima i čunjićima pretvara u živčani podražaj i očnim živcem odvodi u središte za vid u stražnjem režnju velikog mozga. Mjesto na kojem vidni živac izlazi iz mrežnice naziva se "slijepa pjega". Slika predmeta koja se stvara na "žutoj pjegi" je realna, umanjena i obrnuta, a u vidnom središtu slika se uspravlja i usklađuje. mRNA (glasnička RNK ili gRNK, informacijska RNK ili iRNK, tj. iRNA, messenger RNA), tip ribonukleinske kiseline čija je uloga da na ribosom donosi informaciju o rasporedu dušičnih baza u molekulama DNA. MUKOZA, sluz koju luče sporedne (mukozne) stanice gastričnih žlijezda. Mukoza oblaže želučanu stijenku kao obrana od razgradnje stijenke želuca pepsinom i kloridnom kiselinom. MULTIPLI ALELI, više od dva alela gena. Na primjer, krvne grupe čovjeka određene su s tri alela - A, B i 0. U jednom organizmu za jedno fenotipsko svojstvo

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

mogu biti najviše dva različita alela. No broj različitih alela u nekoj populaciji ili vrsti može biti veći. MUREIN, v. bakterije. MUŠKI SPOLNI HORMONI, v. androgeni. MUŠKI SPOLNI ORGANI, sastoje se od unutarnjih organa: sjemenika, dosjemenika ili pasjemenika, sjemenovoda i pomoćne spolne žlijezde prostate, te vanjskih organa: spolnog uda i mošnje. MUTACIJE (lat. mutare = mijenjati), nasljedne iznenadne promjene u genomu. Ako do promjena dođe u tjelesnim stanicama tada ih nazivamo somatske mutacije i one se ne nasljeđuju. Dođe li do promjena u rasplodnim stanicama ili u samoj zigoti tada se one prenose dalje na potomke. Na osnovi morfoloških ili kemijskih promjena kromosoma i gena razlikujemo tri vrste mutacija: 1. mutacije gena; 2. mutacije građe kromosoma; 3. mutacije broja kromosoma. S obzirom na uzroke mutacija razlikujemo spontane mutacije, nenamjerno izazvane nekim prirodnim fizičkim ili kemijskim faktorima i inducirane mutacije koje se namjerno izazivaju umjetnim putem. Činitelji koji izazivaju mutacije nazivaju se mutageni faktori, a to su različita zračenja dovoljne energije koja mogu izazvati promjene (npr. UV i γ zrake) te različite tvari koje različitim mehanizmima također mogu izazvati promjene (peroksidi, manganovi spojevi, formaldehid, nitriti, akridinske boje, proflavin itd). Mutacije su stečene promjene koje je organizam stekao promjenom DNK, odnosno gena. Prenose se spolnim načinom razmnožavanja. Mutacije se uvijek zbivaju pod određenim utjecajima, npr. radijacije, kemijskih tvari itd. Mogu biti pozitivne i

negativne. Pozitivne su mutacije one koje će pomoći potomcima bolje snalaženje u okolišu od svojih roditelja nasuprot negativnih mutacija. Mutacija osigurava nasljednu promjenljivost (varijabilnost), čime se zapravo omogućuje evolucija. MUTAGENI FAKTORI, v. mutacije. MUTANTNI TIP, organizam ili stanica koja nosi mutaciju. MUTUALIZAM, v. simbioza.

N NADCARSTVO, v. filogenetski sustav. NADMETANJE, v. kompeticija. NADP (nikotinamid-adenin-dinukleotidfosfat), organski spoj koji ima važnu ulogu u procesu fotosinteze kao prenosilac elektrona. NAMETNICI (paraziti), biljni ili životinjski organizmi koji žive na ili u drugom organizmu (domadaru) hraneći se tvarima iz njihova tijela i to na štetu domadara. Među biljkama poznati je parazit potajnica, a među životinjama metilji, trakavice itd. NANOSOMIJA, v. patuljasti rast. NASLJEDNA TVAR ili DNA. NASLJEDNA UPUTA, zapisana je redosljedom nukleotida u molekuli DNA. To je uputa koja sadrži plan građe, funkcije i razvoja stanice i cijelog organizma. Ona se prenosi s generacije na generaciju, a ostvaruje se putem sinteze proteina. NASLJEĐIVANJE, proces prenošenja svojstava roditelja na potomke putem gena.


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

NASTIJE, organomotorno gibanje biljnih organa čiji je smjer određen građom organa, a ne smjerom iz kojeg dolazi podražaj. Većinom su uzrokovana reverzibilnim promjenama turgora, a dijelom rastenjem. Razlikujemo: fotonastije (uzrokovano svjetlošću, a temelje se na rastu, npr. otvaranje cvjetova), termonastije (uzrokovane razlikom u temperaturi), kemonastije (izazvane kemijskim tvarima), seizmonastije (potaknute mahaničkim podražajima, kao npr. u sramežljive mimoze, zbog promjena turgora) i tigmonastije (savijanje vitica rezultat je promjene turgora). NATALITET, broj rođenih (okoćenih) jedinki u jedinici vremena prema sveukupnom broju jedinki u populaciji. NEANDERTALAC, v. neandertalski pračovjek. NEANDERTALSKI PRAČOVJEK (neandertalac), izumrli čovjekov predak čiji su prvi ostaci otkriveni u dolini Neandertalu blizu Dizeldorfa u Njemačkoj. Živio je prije 100 do 150 tisuća godina u razdoblju gornjeg pleistocena, isp. dodatak 5. NEČISNICA (kloaka), zajednički otvor kroz koji izlaze fekalije, mokraća i spolni produkti kod nekih životinja, kao na pr. kod riba hrskavičnjača, vodozemaca, gmazova, ptica i sisavaca koji legu jaja. Kod beskralježnjaka nečisnicu imaju mužjaci nekih oblića. NEFRON, osnovna građevna i funkcionalna jedinica bubrega. Sastoji se od Bowmanove čahure, silaznog i uzlaznog kraka koji su međusobno povezani suženom tzv. Henleovom petljom. Uzlazni krak ulijeva se u zajedničke sabirne kanaliće, koji se ulijevaju u bubrežnu čašicu. Kroz silazni krak i petlju prolazi filtrat pod tlakom u uzlazni krak nefrona. Stanice koje čine stijenku nefrona upijaju (reapsorbiraju) veći dio tvari potrebnih tijelu iz filtrata


(sva količina glukoze te znatne količine iona natrija, klora, kalija, vodika, fosfata zatim aminokiseline i vode). Upijene tvari ulaze u kapilare, koje su ogranci bubrežne odvodne arterije te kroz stijenke tih kapilara prebacuju se iz nefrona ponovno u krvotok. Dakle, nefroni obavljaju selektivnu filtraciju krvi, reapsorbiraju u krvnožilni sustav sve potrebite tvari iz filtrata, a sekrecijom se oslobađaju iz tijela nepotrebne i štetna tvari (npr. ureja), v. glomerul. Svaki bubreg sadrži milijun nefrona. NEKTAR, v. žljezdano staničje. NEKTARIJ, v. žljezdano staničje. NEKTON, životinjski organizmi sposobni da se samostalno i aktivno kreću u vodi, npr. ribe, neki mekušci itd. NEODARVINIZAM, novije evolucijske teorije koje su nastale poslije Darwina, a smatraju da su selekcija, mutacija, izolacija i aktivni izbor staništa glavni čimbenici evolucije. NEOLAMARKIZAM, shvaćanje da vrste evoluiraju pod učinkom raznih čimbenika sredine u kojoj organizmi žive. Oživljavanje pretpostavki što je dao Lamarck. NEOTENIJA, pojava nastupanja spolne zrelosti i sposobnosti razmnožavanja prije završetka preobrazbe ličinke u odraslu jedinku, v. repaši. Neotenija omogućuje tim životinjama da nastave živjeti u vodi. NESPOLNA GENERACIJA (diploidna generacija), isp. haploidna generacija. NEURALNA PLOČA, struktura koja nastaje tijekom embrionalnog razvoja kralježnjaka. Uz neuralni žlijeb i neuralnu cijev predstavlja osnovu živčanog sustava, mozga i leđne moždine. Razvija se međusobnom suradnjom dvaju zametnih listića: mezoderma i ektoderma. NEURIT, v. živčana stanica.

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

NEUROHORMONI (neurotransmiteri), tvari koje se izlučuju iz završnih dijelova aksona, a vežu se na specifične receptore narednog neurona i kemijski ga podražuju.

iz presinaptičkog neurona (enzim za acetilkolin je acetil-kolin esteraza). Razlikujemo eksitacijske (podraživačke) neurohormone (noradrenalin, NA, acetil-kolin, AcH), koji uzrokuju prijenos podražaja podraživanjem postsinaptičkog neurona i inhibicijski (kočnički) neurohormoni (gama-aminomaslačna kiselina), koji mogu zakočiti prijenos informacije kroz sinapsu. Inhibicijske neurohormone luče tzv. inhibicijski neuroni iz završnih nožica. Oni uzrokuju otvaranje ionskih kanala za klor, te će uz katione natrija u postsinaptički neuron ulaziti i anioni klora koji će poništiti pozitivan naboj uzrokovan ulaskom samo natrijskih kationa. NEURON, v. živčana stanica. NEUROSEKRECIJSKE STANICE, živčane stanice koje na podražaj reagiraju stvaranjem i izlučivanjem hormona, v. neurosekrecijski faktori.


Najučestaliji neurohormoni su acetil-holin, noradrenalin, dopamin itd. Oni se neprestalno sintetiziraju u neuronima te se pohranjuju u mjehurićima završnih nožica (presinaptički neuron). Kada električni potencijal, nastao na prijemnom dijelu receptora stigne do završnih nožica, uzrokuje naglo oslobađanje neurohormona iz mjehurića u sinaptičku pukotinu. Neurohormon se veže na specifične membranske neurohormonske receptore sljedećeg neurona. Otvaraju se Na-kanali, te ioni natrija ulaze iz izvanstanične tekućine u postsinaptički neuron. Neurohormon koji se vezao na receptore postsinaptičkog neurona biva razgrađen enzimom koji se oslobađa

NEUROSEKRECIJSKI FAKTORI, tvari koje izlučuju stanice hipotalamusa i koje živčanim putem podražuju hipofizu te kontroliraju izlučivanje njenih hormona. Tako, npr. stanice hipotalamusa izlučuju faktore za oslobađanje gonadotropnih hormona koji potiču hipofizu na izlučivanje gonadotropnih hormona. NEUROTRANSMITERI, v. neurohormoni. NEUTRALNE MASTI, isto što i masti. NEUTROFILI, v. leukociti. NEUTROFILNI LEUKOCITI, glavna su obrana protiv infekcije bakterijama, jer ih fagocitiraju i razgrađuju u svojim vakuolama (fagosomima) pomoću probavnih enzima lizosoma fagocita. NICOLSON, G.L., v. Singer, S.J. NIKOTINAMID-ADENIN-DINUKLEOTID-FOSFAT, v. NADP.


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

NITRIFICIRAJUĆE BAKTERIJE, v. dušikove bakterije. NITRIFIKACIJA, proces obogaćivanja tla nitratima. Nitrificirajuće bakterije oksidacijom prevode (oksidiraju) amonijak u nitrite, a nitrite u nitrate dobivajući pri tom energiju potrebnu za sintezu organskih spojeva: 2NH3 + 3O2 → 2HNO2 + 2H2O + energija (bakterija Nitrosomonas) 2HNO2 → 2HNO3 + energija (bakterija Nitrobacter) Djelovanjem nekih anaerobnih bakterija moguć je i suprotan proces, denitrifikacija. NITROFIKSACIJA (nitrogena fiksacija), svojstvo vezivanja atmosferskog dušika i prevođenje u nitrate i amonijak kojega imaju neke bakterije i modrozelene alge, v. dušikove bakterije. NITROGENA FIKSACIJA, v. nitrofiksacija. NITROGENE BAKTERIJE, dušikove bakterije. NIŽE BILJKE, v. steljnjače. NOĆNE (nokturalne) ŽIVOTINJE (nokturna, lat. nocturnus = noćni), životinje koje su noću aktivne. To su npr. sove i šišmiši. NODULI, v. korijenski gomoljići. NOKTURALNE ŽIVOTINJE, v. noćne životinje. NONSENSE CODE, v. genetička uputa. NORADRENALIN, hormon kojeg luči srž nadbubrežne žlijezde, a oslobađa se i na živčanim završecima simpatičkih živčanih vlakana. On se oslobađa pri porastu tjelesnih potreba za kisikom, npr. zbog povećanja tjelesne aktivnosti te povećava udarni volumen srca.


NOSITELJ, jedinka s mutantnim alelom koji nije izražen u fenotipu jer je uz njega prisutan dominantni alel. NOSNOPROLAZNICE, stara skupina riba važna za evoluciju kralježnjaka jer upućuju na prijelaz tih životinja iz vode na kopno. Nosne su se šupljine (v. ribe) otvorile unutarnjim nosnim otvorima (hoane) u usnu šupljinu. Tako je otvoren nosni put za udisanje zraka do pluća koja su se razvila od plivaćeg mjehura. Danas živi samo oko 10 vrsta nosnoprolaznica. Dijele se na resoperke i dvodihalice. NOVOČELJUSKE (grebenke), ptice koje mogu letjeti jer imaju greben na prsnoj kosti. Dijele se na dvadesetak skupina. Neke od njih su: pingvinke, rodarice, guščarice, sokolovke, kokoške, ždralovke, golubovke, papigovke, djetlovke i vrapčarke. NUKLEIN, naziv za kiselu tvar u staničnim jezgrama koju je otkrio znanstvenik Miescher čime je doprinio definiranju nukleinskih kiselina. NUKLEINSKE KISELINE, složeni organski spojevi građeni od: ugljika (C), vodika (H), kisika (O) i dušika (N). Otkrio ih je švicarski znanstvenik Miescher 1869. god, a nazvao ih je nukleinske kiseline jer ih je uočio u jezgrama stanica (lat. nucleus = jezgra). Kasnije je otkriveno da su prisutne i u drugim dijelovima stanice. Poznate su dvije vrste nukleinskih kiselina: dezoksiribonukleinska kiselina (DNA) i ribonukleinska kiselina (RNA). DNA se nalazi u jezgri, mitohondrijima i plastidima, a RNA se, osim u tim staničnim dijelovima, nalazi i u citoplazmi. Razlika koja se uočava već u imenima nukleinskih kiselina je u tome što u sastavu DNA nalazimo šećer dezoksiribozu, a u RNA šećer ribozu. Temeljne građevne jedinice nukleinskih kiselina su nukleotidi. Nukleotidi DNA ili dezoksiribonukleotidi se sastoje od fosfatne skupine, šećera dez-

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

oksiriboze i jedne od četiriju dušičnih baza (adenina, gvanina, timina ili citozina). Nukleotidi RNA ili ribonukleotidi sadrže fosfatnu skupinu, šećer ribozu te također jednu od navedenih dušičnih baza s razlikom da se uvijek umjesto timina pojavljuje uracil. Molekulu DNA tvore dva polinukleotidna lanca obično spiralno uvijena, a molekulu RNA jednostruki lanac koji sadrži manji broj nukleotida.

(uracil + riboza) kao derivati pirimidinskih baza.

NUKLEOID, struktura koja se nalazi u sastavu prokariota. Izgrađen je od dugačke molekule DNA zatvorene u prsten i gusto sklupčane. Po funkciji odgovara jezgri odnosno kromosomu eukariotskih stanica jer predstavlja nasljednu tvar stanice.

OBLENJACI (Aschelminthes), beskralješnjaci iz skupine beskolutićavaca. Nastanjuju mora i kopnene vode ili su nametnici. Tijelo je pokriveno kutikulom. Probavilo je prohodno: imaju usni i crijevni (izmetni ili analni otvor). Tjelesna šupljina (pseudocel) je dobro razvijena. Nemaju sustav za optjecanje ni disanje (dišu preko kože). Imaju živčani sustav i osjetne organe. Organi za izlučivanje su protonefridiji. Uglavnom su razdvojenog spola. Najrasprostranjeni su oblići.

NUKLEOLUS, v. jezgrica. NUKLEOPROTEINI, složeni organski spojevi građeni od nukleinskih kiselina (DNA ili RNA) i proteina. Nukleoproteini s DNA dolaze u sastavu jezgre (u kromosomima), a nukleoproteini s RNA dolaze uglavnom u citoplazmi, npr. u sastavu ribosoma. NUKLEOSOM, okruglo tjelešce, osnovna je jedinica kromatina. Sastavljen je od osam histonskih molekula koje su obavijene dvostrukom zavojnicom DNA. NUKLEOTID, osnovna građevna jedinica nukleinskih kiselina, spoj triju molekula: purinskih ili pirimidinskih dušičnih baza, šećera pentoze (šećer s pet C atoma) i fosforne kiseline, npr. ATP. Spajanjem dvaju nukleotida nastaje dinukleotid, triju trinukleotid, a više nukleotida polinukleotid. NUKLEOZIDI, organske tvari nastale spajanjem purinskih ili pirimidinskih baza sa šećerima i to C-N vezom. To su npr. adenozin (adenin + riboza) i gvanozin (gvanin + riboza) kao derivati purinskih baza te citidin (citozin + riboza) i uridin

NUKLEUS, v. jezgra.


OBLIĆI, životinje iz skupine oblenjaka. Poznato je više od 10000 vrsta. Najpoznatiji nametnički oblici su dječja glista i zavojita trihina, isp. OBRUBNJACI, životinje iz skupine žarnjaka. Svi obrubnjaci osim hidra su morski organizmi. Obrubnjaci žive kao polipi, ili meduze, a mogu izmjenjivati generacije. Većinom stvaraju zadruge. Pojedini polipi u zadruzi nazivaju se hidranti. OCELE, jednostavne oči, isp. virnjaci. OCTENO VRENJE, postupak je pretvaranja alkohola u ocat uzrokovan aerobnim bakterijama, a u temelju je reakcija: C2H5OH + O2 → CH3COOH + H2O + + energija OČNA JABUČICA, je kuglasto tijelo promjera oko 25 mm. Vanjski dio očne jabučice sastoji se od tri koncentrična sloja tkiva: bjeloočnice, žilnice i mrežnice.


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

Unutarnjost je ispunjena staklastim tijelom (staklovinom). OČNA PJEGA (stigma), organel za primanje svjetlosnih podražaja kod praživotinja, npr. euglene. To je uleknuće na pelikuli ispunjeno crvenim pigmentom karotinom. ODABIR, isto što i prirodni odabir. ODJELJAK, v. filogenetski sustav. ODRŽIVI RAZVOJ, proizvodnja s minimalno štetnim učincima na biosferu. ODUŠAK, v. uzdušnice. OGRANIČAVAJUĆI EKOLOŠKI ČIMBENIK, abiotički ili biotički čimbenik koji se snažnije udaljuje od ekološkog optimuma ili pak prelazi granice ekološke valencije, te tako ograničava rasprostranjenost vrste, a može uzrokovati smanjenje ili propadanje populacije organizama. OKAMENJIVANJE (petrifikacija), proces nastajanja fosila zamjenom organske tvari (istrunulih dijelova organizma) anorganskom tvari: silikatima, karbonatima i dr. Minerali se mogu taložiti unutar skeleta ili na površini organizma, v. inkrustacija. OKO, osjetilo za vid. Sastoji se od pomoćnih dijelova: gornji i donji kapci ili vjeđe, trepavice, obrve, suzne žlijezde, suzno nosni kanal i mišići pokretači oka. Glavni dijelovi oka su očna jabučica i očni živac. Receptorski potencijal koji je nastao u fotoreceptorima prenosi se vidnim živcem iz oba oka u vidnu regiju mozga, u zatiljni dio mozga. OKOLIŠ, prirodno i kulturno okružje odnosno sve što čovjeka okružuje. To su mikroorganizmi, biljke, životinje i ljudi kao predstavnici žive prirode. Neživu prirodu čine tlo, kopnene i podzemne vode, mora, oceani, minerali.


OKOŠTAVANJE, stvaranje koštane mase tj. postupni prelazak hrskavičnog tkiva u koštano. Rastom koštanog tkiva upravlja parathormon kojeg luči doštitna žlijezda uz djelovanje vitamina D te iona kalcija i fosfata. OKSIDACIJA HRANE, razgradnja hranjivih tvari (ugljikohidrata, lipida, proteina) u stanici uz pomoć kisika pri čemu se oslobađa energija potrebna za životne aktivnosti stanice. Konačni produkti oksidacije hrane su ugljik(IV)-oksid i voda (isp. disanje). OKSIDACIJA, kemijska reakcija u kojoj neka molekula, atom ili ion otpušta ili gubi jedan ili više elektrona. To su, npr. reakcije spajanja s kisikom, reakcije oduzimanja vodika itd. OKSIDACIJSKA FOSFORILACIJA, jedna od aerobnih faza staničnog disanja ili stanične respiracije koja se odvija u mitohondrijima. U toj fazi se atomi vodika, oslobođeni u prethodnim reakcijama, vežu s kisikom pri čemu nastaje voda i velika količina energije. Oslobođeni atomi vodika se ne vežu izravno s kisikom nego atomi vodika postupno predaju elektrone nizu prenositelja (dišnih enzima) što omogućava i postupno oslobađanje energije koja se koristi za sintezu ATP-a. Na taj se način energija pohranjuje u energetski bogatim vezama ATP-a. OKSIGENIRANA KRV, krv koja transportira kisik, v. mali i veliki optok krvi. OKSIHEMOGLOBIN, molekula hemoglobina koja prenosi vezani kisik. OKSITOCIN, hormon koji izlučuje stražnji režanj hipofize (neurohipofiza). Uzrokuje kontrakcije maternice pri porodu, a nakon poroda potiče sekreciju mlijeka iz dojke. Izlučivanje ovog hormona, kao i os-

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

talih hormona hipofize, je pod kontrolom podražaja iz hipotalamusa. OLAKŠANA DIFUZIJA, v. pasivni prijenos. OLIGOELEMENTI, v. elementarni sastav. OLIGOPEPTIDI, v. peptidi. OLIGOSAHARIDI, v. ugljikohidrati. OLIGOSAPROBNE VODE, jedan od stupnjeva onečišćenja voda, a označuje čiste vode. OMATIDIJE (okašca), dijelovi složenih očiju kod kukaca i rakova, v. rakovi. OMNIVORI (raznojedni organizmi), organizmi koji uzimaju biljnu i životinjsku hranu. ONEČIŠĆENJE OKOLIŠA, unošenje štetnih tvari (ksenobiotika, otrova) u okoliš što dovodi do narušavanja ekosustava, temeljenih na samoregulaciji. Dolazi do promjena u sastavu biocenoza i poremećaja svih metaboličkih procesa. Tako npr. unos većih količina otpadnih razgradivih organskih tvari u jezerski ekosustav izazvati će bujniji razvoj alga i povećanje koncentracije kisika u površinskim slojevima te nedostatak kisika u pridnenim slojevima. OOCITE, v. oogeneza. OOGENEZA, proces nastajanja jajne stanice u jajnicima. Započinje u doba puberteta kada iz zametnih stanica – oogonija nastaju velike nezrele stanice – primarne oocite (oocite I) koje sadrže diploidan broj kromosoma. Nakon mejoze I, iz svake pojedine oocite I nastaju dvije stanice: jedna sekundarna oocita (oocita II) i jedna primarna polocita (polocita I). Oocite II i polocita I sadrže haploidan broj kromosoma. Iz oocite II u procesu mejoze II nastaje jedna zrela jajna stanica i jedna sekundar-

na polocita (polocita II), a iz polocite I nastaju dvije polocite II. I jajna stanica i polocite II sadrže haploidan broj kromosoma. Sve tri polocite II propadaju čime je osigurana pohrana dovoljne količine hranjivih pričuvnih tvari u citoplazmi jedne jajne stanice. Te tvari su potrebne za razvitak zametka u slučaju oplodnje jajne stanice. OOGONIJE, zametne stanice u jajnicima s kojima započinje oogeneza (isp). Dijele se mitozom pa imaju diploidan broj kromosoma. Od jedne oogonije tijekom oogeneze nastaje, između ostalog, i jedna jajna stanica s haploidnim brojem kromosoma. OPARIN, A.J., (1894. – 1980.), ruski biokemičar koji je eksperimentirao s koacervatima. OPĆA ADAPTACIJA (prilagodba), skup morfoloških, fizioloških i biokemijskih osobina određenih skupina. Npr. prilikom naseljavanja kopna razvijala su se pluća, udovi za hodanje i pokrov tijela. OPISTOMA, stražnji dio tijela (zadak) klještara iz skupine člankonožaca. Nastao stapanjem 12 tjelesnih kolutića. Ne nosi udove za hodanje. OPLODNJA, proces stapanja dviju različitih spolnih stanica, gameta (spermija i jajne stanice) u zajedničku stanicu, zigotu. Oplodnja može biti vanjska (izvan tijela ženke), npr. u riba i vodozemaca u vodi. Unutarnja se oplodnja (u tijelu ženke), npr. u sisavaca događa u jajovodu. OPLODNJA (fertilizacija) KOD ČOVJEKA, počinje stapanjem spermija i jajne stanice u prvoj trećini jajovoda. Spermij nosi u akrosomskoj kapi enzime (akrozin) za razgradnju obložnih stanica (Corona radiata) jajne stanice. Nakon prodora prvog spermija zona pellucida zadeblja te onemogućuje ulazak ostalim spermijima


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

odnosno sprečava poliploidiju. U jajnoj stanici udružuju se haploidne predjezgre jajašca i spermija u zajedničku, diploidnu jezgru oplođene stanice, zigotu. Nakon mnogobrojnih brazdanja zigote nastaje blastocista koja se ugnježđuje (implantira) duboko u sluznicu maternice. U stanicama sluznice maternice nakupljaju se hranjive tvari. To su decidua stanice. Oko 7. dana nakon implantacije postupno se razvija posteljica (placenta). Nakon brazdanja slijedi druga faza zametnog razvoja - gastrulacija, te nakon nje organogeneza. OPRAŠIVANJE, prenošenje polena od muških na ženske dijelove cvijeta. Kod golosjemenjača se prenosi polen na mikropilu sjemenog zametka gotovo isključivo pomoću vjetra. Oprašivanje kritosjemenjača zbiva se najčešće uz pomoć kukaca i vjetra, a polenova zrna počinju klijati kada dospiju na njušku tučka. OPTOK KRVI, v. mali i veliki optok krvi. ORGANELI, isto što i stanični organeli. ORGANIZAM, životna cjelina koju može izgraditi jedna ili više stanica pa ih stoga nazivamo jednostanični, odnosno višestanični organizmi. Danas je poznato oko dva milijuna različitih biljnih i životinjskih organizama. U organizacijskoj ljestvici živih bića organizam se nalazi između stanica, odnosno organa, koji su na nižem stupnju ustroja i populacije koja je na višem stupnju. ORGANOGENEZA, etapa embrionalnog razvitka koju karakterizira postanak organa i organskih sustava. Slijedi nakon gastrulacije kada se uzajamnim djelovanjem stanica triju zametnih listića (ektoderma, mezoderma i endoderma) počinju oblikovati budući organi. Na primjer, uzajamnim djelovanjem ektoderma i mezoderma u kralježnjaka nastaje živčani sustav.


ORGANSKI SPOJEVI, spojevi koji izvorno nastaju u organizmima djelatnošću protoplazme. Mogu se dobiti i u laboratoriju. Svi organski spojevi obavezno sadrže ugljik, a u pravilu i vodik. Najvažniji organski spojevi u sastavu živih organizama su: ugljikohidrati, lipidi, proteini i nukleinske kiseline. ORNITOLOG, znanstvenik - zoolog koji proučava ptice. OSFRADIJ, osjetilo za njuh kod mekušaca. Osfradijem mekušci ispituju vodu koju koriste za disanje. Većinom se nalazi uz škrge. OSIKULE, sitne vapnene pločice različitih oblika kod trpova (bodljikaši) uložene u tjelesnu stijenku (kožu) i čine unutarnji kostur. OSJETILNI ŽIVČANI SUSTAV (senzorički ili receptivni), služi za primanje i prenošenje informacija. Podražaj primaju specijalizirani osjetilni neuroni koji na dendritima imaju posebna osjetilna tjelešca (receptore ili senzore). Postoji pet skupina osjetnih receptora: mehanoreceptori, termoreceptori, nocireceptori, elektromagnetski receptori i kemoreceptori. Podjelu vidi u tablici PODJELA RECEPTORA. OSJETILO ZA MIRIS (njuh), receptori za njuh smješteni su u mirisnoj (olfaktornoj) regiji nosa u sluznici krovnog dijela gornjeg nosnog hodnika. Sluznica je puna žljezdanih stanica koje izlučuju sluz između kojih se nalazi od 10 milijuna do 20 milijuna mirisnih (olfaktornih) stanica s mirisnim dlačicama okrenutima prema nosnoj šupljini. OSJETILO ZA OKUS, nalazi se na jeziku. Osjetni organi za okus su okusni pupoljci. Građeni su od potpornih i receptorskih stanica iz kojih izlaze živčana vlakna koja se stapaju u živce što vode podražaje u

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

koru velikog mozga. Na površini jezika nalaze se brojne okusne bradavice (papile), koje su najizraženije na korijenu jezika. Razlikujemo četiri osnovna okusa: slatko (na vrhu jezika), slano (prednji dio iza područja za slatko), kiselo (duž rubova jezika) i gorko (na korijenu jezika). Tablica

PODJELA RECEPTORA Skupina Osjet Receptori živčani završeci, dodir, Pacinijevo, tlak Meissnerovo Mehanoi Krauseovo receptori tjelešce i dr. Cortijeve slluh stanice ravnopolukružni teža kanalići hladživčani noća završeci Termoreceptori živčani toplina završeci Nociživčani bol receptori završeci Elektroštapići i magnetski vid čunjići receptori okusni okus pupoljci mirisni miris receptori ugljikov produžena Kemodioksid moždina receptori aortna i kisik karotidna tjelešca alfa i beta st. glukoza gušterače OSJETILO ZA RAVNOTEŽU, smješteno je u unutarnjem uhu u labirintu. Labirint se sastoji od: predvorja (vestibulum) s

dva proširenja (utriculus i sacculus) i tri polukružna kanala. Ampule su proširenja polukružnih kanala i u njima se nalaze osjetilne stanice s dlačicama. U dva proširenja predvorja nalaze se nakupina osjetilnih stanica s dlačicama - makula. Iz bazalnog dijela osjetilnih stanica izlaze ogranci vestibularnog živca koji prenosi receptorske potencijale u primozak, mali i veliki mozak. OSKULUM, v. spužve. OSMOTSKI TLAK (π ), tlak u otopini ili stanici koji raste s porastom množine (množinske koncentracije) otopljenih čestica, a ovisan je o apsolutnoj temperaturi, T i konstanti jednakoj plinskoj konstanti R. Matemtički π = cRT Otopine koncentracije 1 mol/L šećera i 1 mol/L NaCl uz jednake uvjete nemaju isti osmostski tlak iako im je koncentracija ista jer NaCl, za razliku od šećera, disocira na Na+ i Cl– što daje 2 mola/L čestica o kojima ovisi osmotski tlak. Tako će i tlak biti dvostruko veći u otopini NaCl nego u otopini šećera iste koncentracije. Osmotski se tlak stanice, ovisno o organu, mijenja od 0.5 do 3.0 MPa (0.1 MPa = 1 bar). OSMOZA, difuzija kroz polupropusnu membranu (opnu), koja je za otapalo propusna (permeabilna), a za otopljenu tvar nepropusna. Osmoza se zbiva bez utroška energije. Molekule vode se u otopini kreću niz gradijent kemijskog potencijala vode (koncentracijski gradijent ili vodni potencijal), odnosno iz područja više koncentracije vode (niža koncentracija otopljenih tvari) prema području niže koncentracije vode (viša koncentracija otopljenih tvari). Pojava osmoze vrlo je važna za funkcioniranje stanica jer se njihove stijenke sastoje od približno polupropusne mebrane, a sa-


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

ma stanica sadrži otopljnene tvari, npr. soli, šećere itd. U fiziologiji bilja se umjesto kemijskog potencijala vode često upotrebljava naziv: vodni potencijal. Voda može osmozom i ulaziti i izlaziti iz stanice. OSNOVNO STANIČJE (biljni parenhim), vrsta trajnog tkiva u biljaka koje čini najveći dio mase biljnog tijela. Povezuje i učvrščuje sva ostala staničja, a nerijetko se stanice osnovnog tkiva preoblikuju u druga staničja. Parenhimske stanice u listovima ispunjene su kloroplastima pa se zovu asimilacijski parenhim. Rahlo osnovno staničje, transpiracijski parenhim služi izmjeni plinova. Osnovno staničje služi i kao spremište pričuvne hrane pa ga zovemo spremišni parenhim. Vrlo rahlo raspoređene parenhimske stanice s velikim pravilnim međustaničnim prostorom koji osim prozračivanju služe i lakšem plutanju biljnih organa nazivamo aerenhim. OSNOVNO TKIVO, v. osnovno staničje. OSRČJE, v. srce. OSTEOBLASTI, tvorne stanice koštanog tkiva; proizvode koštanu tvar, v. kost. OSTEOCITI, v. koštane stanice. OSTEOKLASTI, koštane stanice koje razaraju koštanu tvar stvorenu od osteoblasta. Osteoklasti su višejezgrene stanice koje se mogu ameboidalno pokretati. OSTEON, osnovna funkcionalna jedinica u kompaktnom sloju kosti. Oko Haversovog kanalića, kroz koji prolaze krvne žile i živci, poredane su u krugu koštane stanice ili osteociti, isp. OSTEOPOROZA, smanjenje gustoće koštanog tkiva (česta u starosti) zbog narušenog stvaranja organskog dijela kostiju. Kosti postaju slabe i lomljive. Javlja se sa smanjenjem razine spolnih hormona. Češ-


ća je u žena (u postmenopauzi). Bolest se može usporiti terapijom tableta kalcija, vitamina D, a u žena i spolnim hormonima. OTROVNI ELEMENTI, v. toksični elementi. OTROVNOST (toksičnost), osobina neke kemijske tvari da može izazvati štetne, toksične učinke u organizmu. OVARIJI, v. jajnici. OVČJI METILJ, nametnik u žućovodu i jetri ovce (v. metilji). Životni ciklus se sastoji od nespolne i spolne faze. Stvaraju veliki broj jaja (hiperprodukcija potomaka). Iz oplođenih jaja u vodi se razvija miracidij, trpetljikava ličinka. Ako nađe međudomadara puža malog barnjaka, u njemu se nespolno razmnožava. Nastaje mnogo ličinki (redije), a iz njih se razvijaju nove ličinke sa repićem (cerkarije). Cerkarije napuštaju puža i začahure se na barskoj biljci. Kada ovca (prvi domadar) pojede travu s čahurom, u probavilu se razvije u odrasli oblik. Bolest se naziva metiljavost. OVULACIJA, pojava izbacivanja zrele jajne stanice (jajašca) iz Graafovog folikula u trbušnu šupljinu. Karakteristična je za sisavce, a u čovjeka se obično događa četrnaestog dana menstrualnog ciklusa. Ovulacija se periodički ponavlja najčešće u razmacima od 28 dana. OZNAČAVANJE NASLJEDNIH FAKTORA I GENERACIJA, provodi se radi lakšeg snalaženja u praćenju nasljeđivanja svojstava. Već je Mendel uveo označavanje nasljednih faktora i generacija simbolima (slovima), a suvremena genetika je većim dijelom zadržala to označavanje. U prikazima križanja početna roditeljska (parentalna) generacija označuje se uvijek s P, a generacije potomaka (filijalne) prema redoslijedu s F1, F2, F3 itd. Ako se prati

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

samo jedno svojstvo govori se o monohibridnom križanju. Ako se prate dva svojstva govori se o dihibridnom križanju. Za praćenje triju svojstava govori se o trihibridnom, a za praćenje više svojstava o polihibridnom križanju. Aleli pojedinih svojstava mogu se označavati na više načina, a najčešće se označuju slovima i to za dominantni faktor (svojstvo) velikim, a za recesivni faktor malim. Na primjer, za jedno svojstvo A i a, a za drugo svojstvo B i b itd. Ako dominantnost nije izražena obično se svojstva označuju s a1 i a2, b1 i b2 itd. U primjerima križanja, da bi se jednostavnije i preglednije pokazalo koja svojstva roditelja nasljeđuju potomci, prate se sve moguće kombinacije njihovih gameta. Tako, npr. u monohibridnom križanju s dominacijom jedinka genotipa AA dat će jednu vrstu gameta: A, a jedinka genotipa Aa dat će dvije vrste: A i a. U dihibridnom križanju s dominacijom jedinka genotipa AAbb dat će samo jednu vrstu gameta: Ab, a jedinka genotipa AaBb dat će četiri vrste: AB, Ab, aB i ab. U trihibridnom križanju s dominacijom jedinka genotipa AABB CC dati će samo jednu vrstu gameta ABC, a jedinka genotipa AaBbcc dat će četiri vrste: ABc, Abc, aBc i abc, v. Dodatak 1. OZONSKA OVOJNICA, sloj plinovitog ozona na visini oko 40 km iznad površine tla. Ozon štiti Zemlju od štetnog ultraljubičastog zračenja. OZONSKE RUPE, stanjenje zemljine ozonske ovojnice tj. smanjenje ozona u ozonosferi uglavnom zbog kemijskih spojeva koje proizvode ljudi, primarno halogeniranih ugljikovodika (freona).

P PACEMAKER, v. umjetni elektrostimulator srca. PAKLARE, v. kružnouste. PALEONTOLOGIJA, znanost koja se bavi proučavanjem ostataka izumrlih organizama (fosila). PALP, pipalo. PAMĆENJE, sposobnost kore velikog mozga da pohranjuje neke podatke ili doživljaje. Ono može biti trenutačno (samo nekoliko sekundi), kratkotrajno (do 3 dana) i dugotrajno (doživotno). Fiziološka osnova trenutačne i kratkotrajne memorije jest električna aktivnost skupine neurona mozga. Dugotrajno se pamćenje temelji na kemijskim promjenama koje nastaju nakon ponovljenog podraživanja skupine neurona mozga. PANCREAS, v. gušterača. PANKREASNA AMILAZA, v. probavni enzimi gušterače. PANKREASNA LIPAZA, v. probavni enzimi gušterače. PANKREATITIS, v. upala gušterače. PAPA TEST, ispitivanje stanica grla maternice bojenjem prema metodi Papanicolau. Koristi se za otkrivanje raka grla maternice i njegovih predstadija. Test je negativan ako su sve stanice normalne, a pozitivan ako su među stanicama grla maternice nalaze tumorske stanice. PAPRATI, biljke iz skupine papratnjača. Listovi su im redovito veliki, prizemni, različitih oblika. S donje strane nose soruse. Rastu iz podzemne stabljike (podanka). Razmnožavaju se izmjenom spolne i nespolne generacije. Iz izospora izraste protalij (haploidni gametofit), a nakon oplodnje


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

razvije se iz embrija mlada paprat (diploidni sporofit). U hrvatskoj flori ima svega oko 50 vrsta paprati. Rastu u sjenovitim i vlažnim šumama (oslad, jelenak), polušpiljama (gospin vlasak). Naša najveća paprat je bujad (listovi dosegnu visinu i preko 2 m). Ljekovite paprati su oslad i slezenica. Paprati većinom žive u vlažnim tropskim krajevima ili kao epifiti. odrasla paprat

sorusi sa sporangijama

mlada paprat





klijanje spore

arhegonij (jaje)

protalij anteridij (muška gameta)

sporofit (2n) gametofit (n) PAPRATNJAČE, prve prave kopnene biljke jer imaju korijen, stabljiku i list. Vegetativno tijelo je snažni sporofit, dok je gametofit nježna i mala biljčica, ali je samostalna, t.j. prehrambeno neovisna o sporofitu. Za vrijeme oplodnje pokretnim spermatozoidima potrebna je voda. Spore su većinom istovrsne (izospore) pa im je gametofit jednodoman. Samo su neke papratnjače s različitim sporama te imaju dvodomni gametofit. npr. selaginela. Današnje papratnjače su zeljaste biljke, trajnice s podzemnom stabljikom (podankom) i s adventivnim korijenjem. Dijele se na


preslice, crvotočine i paprati. Izumrle su drvenaste paprati, koje su imale dvojake spore, preci golosjemenjača. Do danas su se pojedine drvenaste papratnjače sačuvale kao fosili koje nalazimo u naslagama kamenog ugljena (geološko razdoblje karbon). PAPUČICA (Paramecium caudatum), v. trepetljikaši i praživotinje. PARAPATRIJSKA SPECIJACIJA, specijacija kada se dvije populacije samo dotiču i tako imaju nepreklapajući prostorni kontakt. Isp. specijacija. PARAPODIJ (bataljica), izdanak sa strane svakog kolutića kod mnogočetinaša. Služe pri pokretanju. Iz njih izlaze četine ili hete. Na njima su i škrge. PARASIMPATIKUS, dio autonomnog ili vegetativnog živčanog sustava čija živčana vlakna nadziru rad većine unutarnjih organa. Djelovanje parasimpatikusa je suprotno djelovanju simpatikusa, npr. simpatikus ubrzava rad srca dok ga parasimpatikus usporava. PARATHORMON, hormon kojega izlučuju nuzštitne žlijezde, a važan je za regulaciju prometa kalcija u tijelu. PARAZITI, v. nametnici. PARENHIM, v. osnovno staničje. PARENHIMULA, v. spužve. PARENTALNO KRIŽANJE, križanje početne roditeljske (parentalne) generacije kojim nastaje prva generacija potomaka (filijalna) F1 generacija. PARTENOGENEZA; razvitak zametka iz neoplođene jajne stanice. Partenogenezu susrećemo kod mnogih kukaca i drugih bezkralježnjaka, ali i kod nekih riba, vodozemaca te nekih guštera.

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

PASJA TRAKAVICA (ehinokok), najopasnija trakavica za čovjeka. Velika je oko 5 mm i ima samo nekoliko proglotida. Živi u crijevu psa. Čovjek se može zaraziti dirajući zaraženog psa. Ikrice se razvijaju u jetri, plućima ili mozgu čovjeka. PASIVNI PRIJENOS (pasivni transport), prijenos tvari kroz staničnu membranu iz područja veće koncentracije u područje manje koncentracije bez utroška energije s ili bez pomoći prenositelja. Ovaj prijenos se zasniva na procesu difuzije. Kroz membranu se pasivno prenose manje molekule, npr. voda, ugljik(IV)-oksid, kisik, urea itd. Uz pomoć prenositelja prolaze veće molekule, npr. glukoze, aminokiselina itd. PASIVNI TRANSPORT, v. pasivni prijenos. PASIVNO STEČENA SPECIFIČNA IMUNOST, omogućena je unašanjem u organizam gotovih protutijela. Prirodnim putom protutijela prolaze kroz posteljicu iz majke u zametak. Umjetno izazvana imunost postiže se davanjem već gotovih protutijela, nastalih imunizacijom druge jedinke, čovjeka ili životinje. PASJEMENIK (dosjemenik, epididymis), dio muškog spolnog sustava u kojem spermiji dozrijevaju i stječu sposobnost samostalnog kretanja. PASTERIZACIJA, zagrijavanje supstrata na temperaturu oko 60 do 70 oC što dovodi do uništenja bakterija, ali ne i njihovih spora. PASTEUR, L. (1822. – 1895.), francuski mikrobiolog koji je otkrivajući cjepivo protiv bjesnoće (1881 - 1885) prvi uporabio naziv virus označivši njime uzročnika te bolesti. PATOGENE BAKTERIJE, bakterije koje uzrokuju bolesti čovjeka, životinja i biljaka izlučujući u organizam domaćina

otrovne spojeve, tzv. toksine. Teške bolesti koje uzrokuju bakterije u čovjeka su kuga, tuberkuloza, guba, tetanus, upala pluća, gangrena, sifilis, gonoreja, kolera, difterija itd. PATULJASTI RAST (nanosomija), nastaje kad hipofiza ne stvara dovoljne količine hormona rasta. Može biti vidljivo kod rođenja, kasnije u djetinjstvu ili adolescenciji. PAUCI, v. paučnjaci. PAUČNJACI, grabežljive životinje iz skupine klještari, člankonošci, isp. Njima pripadaju pauci, štipavci ili škorpioni i grinje. Pauci imaju 2 -6 predljivih žlijezda na trbušnoj strani opistome. U njima se stvara bjelančevinasta predljiva tvar koja izlazi kroz predljive bradavice, a na zraku se stvrdne. Paučinaste niti pauk plete stopalnim češljićem u mrežu. Za disanje imaju lepezaste uzdušnice. Pauci izlučuju produkte izmjene tvari pomoću Malpighijevih cjevčica. Razdvojenog su spola. Ženka paučinom zaprede oplođena jaja u kokon iz kojeg izlaze mladi slični odraslima. Poznati su: pauk krstaš (križar) i crna udovica. Škorpioni na kraju tijela imaju otrovnu bodlju. Ženka rađa žive mlade. Nametnički oblici grinja su npr. čovječji svrabac iz skupine šugaraca koji buši hodnike u pousmini kože i krpelji. Obični krpelj može biti prijenosnik virusnog encefalitisa i nekih nametničkih piroplazmi. PAVLOV, I., (1848.-1936.), ruski psiholog, otkrio da se refleksi mogu izmijeniti učenjem. Po njemu se tzv. uvjetovani refleksi nazivaju Pavlovljevim refleksima. PEDICELARIJE, štipaljke. PEKARSKI KVASAC, v. kvaščeve gljivice. PELAGIJAL, životne zajednica koje žive u slobodnoj vodi i kreću se pasivno, lebde (plankton) ili aktivno (nekton).


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

PELIKULA (lat. pellicula, grč. pelis = kožica), tanka elastična opna koja obavija tijelo mnogih praživotinja, npr. papučice i bičaša. Ima zaštitnu, pokrovnu i potpornu funkciju. Također sudjeluje u kretanju i uzimanju hrane te primanju podražaja iz okoliša. Pelikula je nastala spajanjem dvoslojne membrane i površinskog sloja tijela, tj.ektoplazme.U papučice je sastavljena od niza alveolarnih mjehurića, a površinu pelikule prekrivaju trepetljike. Na osnovici je svake trepetljike bazalno, osnovno tijelo – kinetosom. Međusobno su kinetosomi povezani bjelančevinastim nitima – kinetodezmama koje provode podražaje. Kinetodezme i kinetosomi čine kinetički aparat. PELUD, v. prašnik, oprašivanje. PELUDNA ZRNA, v. prašnik, oprašivanje. PENICILIJUM, (kistac, Penicillium notatum), najpoznatija zelena plijesan sa sporangijskim nositeljima raspoređenih poput kista na čijim se ograncima razvijaju spore u nizovima, konidiospore. Ima antibiotsko djelovanje, tj. djeluje antibakterijski, odnosno baktericidno zahvaljujući izlučivanju tvari penicilin. To djelovanje prvi je otkrio A. Fleming 1929. godine, za što je dobio Nobelovu nagradu 1945. Kasnije se otkrilo da antibiotsko djelovanje imaju i druge tvari pa otuda i postojanje različitih antibiotika. PENICILIN, v. penicilijum. PENIS, v. spolni ud. PENTOZE, jednostavni šećeri ili monosaharidi s pet ugljikovih atoma u molekuli. Pentoze su npr. deoksiriboza i riboza. PEPSIN, najvažniji probavni enzim želuca. To je proteolitični enzim, tj. enzim koji probavlja bjelančevine, a najaktivniji je u jako kiseloj sredini (pH oko 2). Glavne stanice fundusnih i piloričkih žliježda že-


luca luče inaktivni oblik enzima pepsinogen koji se aktivira uz prisutnost kloridne kiseline u pepsin, v. kloridna kiselina. PEPSINOGEN, v. pepsin. PEPTIDI, kemijski spojevi građeni od dvije do 20-40 vezanih aminokiselina, ukupne molekulske mase manje od 5000. Aminokiseline se međusobno vežu peptidnim vezama. Vezanjem dviju aminokiselina nastaje nastaje dipeptid, triju tripeptid, četiriju tetrapeptid itd. Općenito, vezanjem 10 i manje aminokiselina nastaju oligopeptidi, a vezanjem više od 10 aminokiselina nastaju polipeptidi. PEPTIDNA VEZA, nastaje kada karboksilna skupina jedne aminokiseline reagira s amino skupinom druge aminokiseline pri čemu se izdvaja molekula vode. H







PERAJARI, skupina sisavaca prilagođenih životu u vodi. Imaju obilježja zvijeri. Hrane se najčešće ribama. Udovi su se razvili u peraje. Perajarima pripadaju tuljani i morski lavovi. U Jadranu živi sredozemna medvjedica. PERIFERNI ŽIVČANI SUSTAV, provodi živčane impulse (informacije) u središte ili iz središta u izvršni organ. Dijeli se na osjetilni i pokretački. Sastoji se od dvije skupine živaca: moždani i moždinski živci. PERIGON, v. cvijet. PERIKARD, v. srce. PERINUKLEARNI PROSTOR, prostor između dviju membrana jezgrine ovojnice. PERIOST (pokosnica), v. kost.

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

PERJE, proizvod kože koji pokriva tijelo ptica i štiti od gubitka topline. Sastoji se od rožnate tvari keratina. Razlikuju se velika pokrovna pera i nježna perca pahuljice, a na krilima su letna pera. Svako pero ima badrljicu i zastavicu sastavljenu od isperaka. Isperci su međusobno povezani resicama. PERONOSPORA (plamenjača, Plasmopara viticola), gljiva algašica, nametnik na vinovoj lozi nanoseći velike štete. Suzbija se bordoškom juhom, smjesom vode, modre galice i gašenog vapna. PGTH (placentarni gonadotropni hormoni), hormoni koji se u ranoj fazi trudnoće izlučuju iz stanica trofoblasta, a kasnije iz posteljice. Uloga im je da sprečavaju propadanje žutog tijela nakon ovulacije te da ga potiču na izlučivanje povećane količine hormona estrogena i progesterona. Kasnije u trudnoći estrogene i progesterone izlučuje sama posteljica, a ti hormoni spriječavaju menstruaciju koja bi uzrokovala gubitak ploda. pH, oznaka za negativan logaritam koncentracije vodikovih iona, pH = – log [H+]. Što je viša koncentracija vodikovih iona to je niža vrijednost pH. Kiseline povisuju, a baze snizuju koncentraciju H+. U živom organizmu pH – vrijednosti se uglavnom kreću u rasponu pH = 6 – 8 iako ima i izuzetaka npr. u ljudskom želucu gdje je izrazito kisela sredina pH = 1.5. PIGMENT (lat. pigmentum = boja), tvar koja daje boju tkivima ljudi, životinja, biljaka i nekim bakterijama. Biljke stvaraju pigmente za apsorpciju sunčeve svjetlosne energije, potrebne za proces fotosinteze, v. biljna bojila. PIJAVICE, životinje iz skupine kolutićavaca. Žive uglavnom u slatkim vodama. Nemaju parapodija ni četina ali imaju prednju i stražnju prijanjalku. Sišu krv mno-

gim kralješnjacima i beskralješnjacima. Da se krv ne bi zgrušala slinske žlijezde izlučuju enzim hirudin. Poznata vrsta je liječnička pijavica. PINOCITOZA (grč.pinosis = piti, kytos = šupljina), način uzimanja hranjivih tvari u praživotinja, npr. tekuće hrane: otopljenih makromolekula kao što su bjelančevine ili aminokiseline, isp. endocitoza. PIRETICI (pirogene tvari), tvari koje povisuju tjelesnu temperaturu (mnogi toksini patogenih mikroorganizama). PIRIMIDINSKE BAZE, vrsta dušičnih baza koje izgrađuju molekule DNA i RNA. U sastavu DNA uvijek dolaze pirimidinske baze timin i citozin, a u sastavu RNA citozin i umjesto timina uracil. PITEKANTROPUS, v. javanski pračovjek. PIVSKI KVASAC, v. kvaščeve gljivice. PJEVALO, organ kod ptica za proizvodnju glasova, osobito kod ptica pjevica. Smješteno je na prijelazu iz dušnika u dušnice. Sastavljeno je od sustava hrskavičnih i koštanih potpora i opni. PLACENTA (posteljica), embrionalni organ u većine sisavaca čija je uloga prehrana zametka odnosno ploda. U žena se placenta formira iz stanica trofoblasta i decidua stanica (stanice sluznice maternice) oko 16 dana nakon oplodnje jajne stanice, odnosno 7. dana nakon njenog “ukopavanja” (implantacije) u sluznicu maternice. Kroz posteljičnu opnu izmjenjuju se kisik, ugljikov dioksid, hranjive i otpadne tvari između krvotoka majke i krvotoka ploda. Krvne i druge stanice ne mogu prolaziti kroz placentnu opnu. PLACENTARNI GONADOTROPNI HORMONI, v. PGTH. PLAMENJAČA, v. peronospora.


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

PLANKTON, biljni i životinjski organizmi koji lebde u morskoj vodi ili kopnenim vodama jer nemaju sposobnost samostalnog, aktivnog kretanja. Lebdenje u vodi im omogućuju razne izrasline i nastavci na njihovom, najčešće jednostaničnom tijelu. Dio planktona kojega čine biljni organizmi nazivamo fitoplankton, a dio kojega čine životinje zooplankton. U sastav fitoplanktona ulaze najčešće bičaši i alge kremenjašice, a u sastav zooplanktona neki račići i različite ličinke i praživotinje. PLANULA, kod žarnjaka ličinka obavijena trepetljikavim stanicama. PLASTIDI, stanični organeli biljnih stanica koji najčešće sadrže biljne boje (pigmente). Najvažnija vrsta plastida su kloroplasti koji sadrže zeleni pigment klorofil. PLAŠTENJACI (Tunicata), najprimitivniji svitkovci, bezlubanjci. Sličnosti s njima: imaju svitak (iako samo u zametnom i ličinačkom stadiju), živčana cijev je s leđne strane, prednji dio probavila (ždrijelo) prorezan je škržnim pukotinama te ima ulogu i organa za disanje, krvožilni sustav je na trbušnoj strani. Najpoznatiji plaštenjaci su mješčićnice. Žive u moru. Odrasli oblici su sjedilački, a ličinka je plankton. Tijelo im je obavijeno plaštem ili tunikom koji je izgrađen od tunicina. Mješčićnice su dvospolci. Razmnožavaju se nespolno (pupanjem) i spolno. Imaju veliku sposobnost regeneracije. PLAZMA-STANICE, zreli oblici limfocita B u kojima se stvaraju protutijela. Nalazimo ih u limfnim čvorovima, koštanoj moždini, slezeni i jetri. PLAZMALEMA, u biljnoj stanici vanjski granični sloj plazme prema staničnoj stijenci. PLAZMATSKA MEMBRANA, isto što i stanična membrana.


PLAZMIDI, male kružne molekule DNA koje mogu biti prisutne u citoplazmi stanice uz bakterijski "kromosom". Te su izvankromosomske čestice DNA pronađene kod prokariota i eukariota. Svaki plazmid sadržava jednu kratku, "golu" dvolančanu DNA - molekulu koja predstavlja male nizove gena (od 2 do 300) i pripadaju genomu stanice u kojoj se nalaze. Neke bakterije sadrže plazmide koji im daju otpornost na antibiotike, a neke bakterije imaju plazmide koji im omogućuju korištenje dodatnih izvora hrane. Plazmidi imaju sposobnost samoumnožavanja i mogu se konjugacijom prenositi na druge bakterije. PLAZMODEZMIJE, citoplazmatski izdanci pomoću kojih se održava veza između dvije biljne stanice. PLAZMODIJ, nametnička praživotinja iz skupine truskovaca. Uzročnik malarije u čovjeka. Prenosnik plazmodija je komarac malaričar. Kada čovjeka ubode zaraženi komarac, spore (truske ili sporozoiti) se slinom komarca prenesu u krv čovjeka. Zajedno s krvlju truske se raznesu kroz tijelo, a nespolno se razmnožavaju diobom u stanicama jetre i eritrocitima stvarajući truske koje se nazivaju merozoiti. Merozoiti se hrane hemoglobinom te uzrokuju raspadanje crvenih krvnih stanica popraćeno groznicom i visokom temperaturom. Ovisno o vrsti plazmodija razlikujemo tropsku, tercijarnu i kvartarnu malariju. Umjesto merozoita mogu se u eritrocitima razviti spolni oblici - gametociti. Kada komarac usiše krv zaraženog čovjeka, gametociti dospiju u probavilo komarca i spoje se u pokretnu zigotu. Uzastopnim dijeljenjem zigote nastaju truske koje putuju do žlijezda slinovnica komarca. Nakon uboda komarca sporozoiti ponovo zaraze zdravog čovjeka. Preventivne mjere suzbijanja razvoja komarca malaričara su: isušivanje močvara, insekticidi te biološka metoda

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

unašanja ribe gambuzije u močvare jer se ona hrani ličinkama komaraca.

njaka uključuje virnjake, metilje i trakavice.

PLAZMODIJALNA TEORIJA O POSTANKU METAZOA, v.hipoteze o postanku mnogostaničnih životinja.

PLUĆA, organi za disanje kod čovjeka i drugih kopnenih kralježnjaka. Sastoje se od dva plućna krila. Lijevo se sastoji od dva režnja, desno od tri režnja. Svako plućno krilo obavijeno je poplućnicom ili pleurom. Pluća su građena od plućnih mjehurića ili alveola koje su okružene mrežom krvnih kapilara. Ispod pluća nalazi se ošit ili dijafragma, koji ima ulogu u disanju.

PLAZMOLIZA (grč. plasma = tvorevina, lysis = razrješavanje), pojava smanjenja obujma vakuole i odvajanje protoplasta od stanične stijenke. Kada je stanica u hipertoničnoj otopini soli, šećera ili sl., voda izlazi iz vakuole (mjesta veće koncentracije vode) u okolnu otopinu. Vakuola postaje sve manja i povlači okolni protoplast. Suprotan proces naziva se deplazmoliza. PLIVAĆI MJEHUR, služi ribama iz skupine koštunjača kao hidrostatski organ. Razvija se kao šuplji izdanak stijenke jednjaka. Kada je napunjen plinom, ribe postaju lakše i dižu se prema površini. Kada se iz njega istisne plin, ribe postaju teže od vode i tonu. Kod dvodihalica plivaći se mjehur razvio u pluća, koja povremeno preuzimaju funkciju pluća, isp. PLOD, generativni organ svojstven kritosjemenjačama. Sastoji se od sjemenki i usplođa koje se razvija iz plodnice. Usplođe štiti sjemenku i služi njihovu rasprostranjivanju. Razlikujemo sočne i suhe plodove. Također i fetus, isp. PLODNICA, v. tučak. PLODVAŠI, v. pravi sisavci. PLOŠNJACI (Platodes), bilateralno simetrični beskolutićavci. Tijelo im je splošteno s leđne i trbušne strane. Žive slobodno ili kao nametnici. Nemaju nikakva kostura ni tjelesnih šupljina. Plinove, kisik i ugljikov dioksid, izmjenjuju preko kože. Živčani sustav je mrežast ili u obliku vrpci. Za izlučivanje imaju protonefridije. Tijelo im je ispod pokrovnog sustava ispunjeno parenhimom. Oko 18500 vrsta ploš-

PLUĆNA ARTERIJA, krvna žila, izlazi iz desne klijetke srca, v. mali optok. PLUĆNA EMBOLIJA, v. tromboza. PLUĆNE VENE, krvne žile koje ulazi u lijevu pretklijetku srca, v. mali optok. PLUĆNI MJEHURIĆI (alveole, lat. alveolus = korito), obavijeni su kapilarnom mrežom ogranaka plućne arterije, koja je krvlju dopremila iz tijela ugljikov dioksid radi izmjene s kisikom. Na tu se kapilarnu mrežu nadovezuju venule i plućne vene koje oksigeniranu krv dovode u lijevu pretklijetku, zatvarajući tako mali optok krvi, isp. PLUĆNI OPTOK KRVI, v. mali optok krvi. PLURIPOTENTNE STANICE, stanice koje se mogu neograničeno reproducirati. PLUTEUS, slobodno plivajuća dvobočno simetrična ličinka kod bodljikaša, isp. PNEUMATIČNE KOSTI, v.ptice. PNEUMONIJA, v. upala pluća. PODANAK, v. stabljika. POIKILOTERMNI ORGANIZMI, životinjski organizmi čija temperatura tijela ovisi uglavnom o temperaturi okoliša. Poikilotermni organizmi su svi beskralje-


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

žnjaci, a od kralježnjaka ribe, vodozemci i gmazovi.

leotida, a polisaharidi od jednostavnih šećera.

POKAČA, ličinka kod kružnousta.

POLINUKLEOTIDI, v. nukleotidi.

POKOSNICA, v. kost.

POLIO, v. dječja paraliza.

POKRETAČKE SILE EVOLUCIJE, pojave koje su omogućile razvoj i usavršavanje živih bića na Zemlji. To su prirodna selekcija (odabiranje), izolacija, mutacije i genska snaga.

POLIOMIJELITIS, v. dječja paraliza.

POKRETAČKI (motorički) ŽIVČANI SUSTAV, dio je perifernog živčanog sustava, a po funkciji se dijeli na voljni i autonomni. POKROVNO TKIVO, v. epitelno tkivo. POKUS, v. eksperiment. POLARIZACIJSKI MIKROSKOP, v. mikroskop. POLEN, v. prašnik, oprašivanje. POLENOVA ZRNA, v. prašnik, oprašivanje. POLICITEMIJA, bolest povećanja broja crvenih krvnih stanica u perifernoj krvi. Jedan od uzroka je poremećaj regulacijskih mehanizama proizvodnje eritrocita u koštanoj moždini. POLIFENILALANIN, kemijski spoj građen od većeg broja molekula aminokiseline fenilalanina. Nastaje tijekom sinteze proteina, a njegovo nastajanje određuje genetska uputa na mRNA koja se označava UUU UUU UUU ∼. POLIMERAZA, enzim koji kontrolira pravilnu ugradnju DNA nukleotida na matricu starog lanca DNA. POLIMERI, su velike molekule, makromolekule izgrađene od manjih podjedinica monomera, npr. proteini su izgrađeni od aminokiselina, nukleinske kiseline od nuk-


POLIP, jedan od morfoloških oblika kod žarnjaka. Živi sjedilački pričvršćen za dno. Na gornjoj strani valjkastog tijela je usni (oralni) otvor okružen lovkama. Mnogi polipi žive u zadrugama ili kolonijama. POLIPEPTIDI, v. peptidi. POLIPLOIDIJA, pojava kada se čitava garnitura kromosoma povišestručuje. Poliploidne stanice nastaju tako da se udvostruče kromosomi, ali se ne dijeli citoplazma ili ne funkcionira diobeno vreteno u mitozi, nego svi kromosomi ostanu nagomilani u istoj stanici. Ako se ta pojava ponovi broj kromosoma se opet udvostručuje, a udvostručiti se može i samo pola garniture. Tako umjesto diploidne 2ngarniture nastaju triploidi (3n), tetraploidi (4n), pentaploidi (5n) itd. Ova pojava je česta u biljaka, a vrlo je rijetka u životinja. POLISAHARIDI, v. polimeri i ugljikohidrati. POLISAPROBNE VODE, jedan od stupnjeva onečišćenja voda, a označava vrlo snažno onečišćene vode. POLISOMI, nakupine ribosoma. POLITENI KROMOSOMI, v. gorostasni kromosomi. POLI-U, 1. 1. genetska uputa koja nosi veliki broj uracil dušičnih baza i određuje ugradnju više molekula aminokiseline fenilalanina u proteinski lanac. 2. skraćenica za poliuridilnu kiselinu. POLIURIDILNA KISELINA (poli-U), organski spoj iz skupine polinukleotida

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

nastao polimerizacijom samo jedne vrste nukleotida i to onog koji sadrži uracil, ribozu i fosfatnu kiselinu. POLOCITE, stanice koje nastaju za vrijeme oogeneze (isp.). POLOVIČAN BROJ KROMOSOMA, v. haploidan broj kromosoma. POLUCIJA, povremeno, spontano izbacivanje sperme (naročito noću) zbog nakupljanja veće količine sperme u sjemenicima i sjemenim kanalićima. Najčešće se javlja u mladića u pubertetu. POLUPROPUSNA MEMBRANA, semipermeabilna ili probirno propusna (selektivno permeabilna) membrana. Lako propušta vodu i male nenabijene molekule (npr. CO2), ali ne i velike molekule, posebice one s nabojem, v. osmoza, stanična membrana. POLUSVITKOVCI, v. žiroglavci. POPLUĆNICA ili pleura, tanka dvolisna opna koja obavija svako plućno krilo. Vanjski list opne (porebrica) oblaže rebra s unutarnje strane prsnog koša. Unutarnji list opne oblaže plućna krila. Između obje poplućnice nalazi se malo tjelesne tekućine. POPREČNO-PRUGASTI MIŠIĆ, sastoji se od mišićnog tkiva koje promatrano mikroskopom pokazuje poprečnu prugavost. Osnovna jedinica poprečno prugastog mišićnog tkiva je mišićno vlakno izduženog cilindričnog oblika. Ovojnica mišićnog vlakna zove se sarkolema, a unutarnjost je ispunjena sarkoplazmom u kojoj su pravilno uzdužno smješteni snopovi mišićnih vlakanaca, miofibrila. Mišićno vlakno ima veći broj jezgara koje su površinski smještene ispod sarkoleme. Pojedini dijelovi miofibrila nejednako lome svjetlo pa pod mikroskopom vidimo izmjenično poredana svijetla i tamna polja, tj. miofibrili su poprečno isprugani. Razlog tome je

raspored proteinskih filamenata (niti) aktina (tanji) i miozina (deblji) u samim miofibrilima. Tamne pruge sadrže i aktinske i miozinske filamente, a svijetle samo aktinske. Poprečno prugasto mišićno tkivo izgrađuje mišiće koji su tetivama vezani za kosti pa omogućuju pokretanje dijelova tijela. Rad ovog tkiva je pod utjecajem naše volje. Poseban oblik poprečno prugastog mišićnog tkiva je srčano mišićno tkivo, ali njegov rad nije pod utjecajem naše volje. POPULACIJA, skupina jedinki iste vrste, različite životne dobi, koje žive na istom prostoru, a međusobno su vezane prvenstveno odnosima razmnožavanja. Rasprostranjenost većine ljudske populacije ovisi o vegetaciji područja. POREBRICA, v.poplućnica. PORODICA, v. filogenetski sustav. POROĐAJ (porod), doba na kraju trudnoće u kojem dolazi do pravilnih ritmičkih stezanja i opuštanja mišića maternice što rezultira potiskivanjem ploda kroz porođajni kanal i izbacivanjem posteljice. Tijek poroda reguliraju hormoni, pa se neposredno prije poroda pojača izlučivanje hormona estrogena iznad vrijednosti koncentracije progesterona, kao i izlučivanje oksitocina. Porast količine tih hormona uzrokuje stezanje mišića maternice. POSTANAK VRSTA, proces u prirodi koji se odvija dugotrajno i polagano, a rezultira nastajanjem novih bioloških vrsta. Potiču ga pokretačke sile evolucije: prirodna selekcija, izolacija i genska snaga. POSTELJICA , v.placenta. POTISNUTO SVOJSTVO, v. recesivno svojstvo. POTPORNO STANIČJE, neke od stanica koje su se prilagodile isključivo pružanju mehaničke čvrstoće biljnim organima.


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

Dvije su vrste potpornog staničja: kolenhim, izgrađen od živih stanica i sklerenhim, izgrađen od mrtvih stanica. U mnogim biljkama te su stanice vrlo dugačke i elastične, a zovu se likovnice. POTRKUŠCI, mladunci nekih vrsta ptica (npr. kokoši, patke, guske, ždralova) koji se legu dobro razvijeni. Imaju otvorene oči, perje, mogu trčati i snalaziti se u prostoru. POTROŠAČI (konzumenti), heterotrofni organizmi koji se prema vrsti hrane koju troše dijele na: biljojede (fitofage, herbivore), mesojede (zoofage, karnivore) i saprofage. POUGLJENJIVANJE (karbonizacija), proces fosilizacije pod tlakom i bez prisutnosti kisika. Tako su npr.u karbonu procesom karbonizacije u vodama stajačicama (močvare, jezera) od dijelova papratnjača i drugih biljaka nastale velike naslage ugljena. POVEĆANJE MIKROSKOPA, omjer veličine slike promatranog predmeta i samog predmeta. Ukupno povećanje mikroskopa jednako je umnošku povećanja objektiva i okulara. Npr. ako je povećanje objektiva 40 puta, a okulara 10 puta ukupno povećanje bit će 400 puta. Svjetlosni mikroskop povećava najviše 1000 puta, a elektronski 400 000 puta. POVRATNA VEZA, isto što i mehanizam povratne sprege. POVRATNO KRIŽANJE, v. test križanje. PRAATMOSFERA, plinoviti omotač Zemlje u početku njenog nastanka, prije 4.5 do 4 milijarde godina. Smatra se da je praatmosfera sadržavala slobodan vodik (H2) i dušik (N2), metan (CH4), amonijak (NH3), cijanid ion (CN–), vodenu paru, okside ugljika (CO i CO2) i sumporovodik


(H2S). Stoga se smatra da se bitno razlikovala od današnje atmosfere jer nije sadržavala slobodan kisik (O2). PRABUBREG, v.drugi bubreg. PRACRIJEVO, v. arhenteron. PRAORGANIZMI (protobionti), prvi organizmi koji su se pojavili na Zemlji. O njihovom izgledu i načinu života danas postoje samo različite pretpostavke. PRAPTICA (Archaeopteryx), najpoznatiji i najtipičniji prijelazni oblik između gmazova i ptica. Živjela je krajem perioda jura, u mezozoiku. Bila je vrlo slična današnjim pticama (oblik tijela, perje, kljun, krila i dr.), ali je imala i mnogo obilježja gmazova od kojih potječu, kao npr. kralješke u repu, tri prsta s pandžama na repu, zube u kljunu. PRAŠNIK, muški dio cvijeta. Sastoji se od prašničke niti (filamenta) i prašnice (antere). U prašnicama se nalaze peludnice ili polenovnice (mikrosporangiji, muški sporangiji). Unutar polenovnica, iz diploidnih matičnih stanica, mejozom (redukcijskom diobom) nastaju četiri haploidne mikrospore (muške spore) koje zovemo polenova ili peludna zrna. Proces kojim nastaju mikrospore zove se mikrosporogeneza. Unutar polenovog zrna razvija se muški gametofit (haploidna generacija) s dvije muške gamete (spermalne, generativne jezgre tj. stanice) i jedne vegetativne stanice. PRAVI BUBREG, v. treći bubreg. PRAVI SISAVCI (plodvaši, placentalni sisavci), skupina životinja čiji se mladi razvijaju u maternici obavijeni plodvom, posteljicom ili placentom (ime!). Danas se razvrstavaju u dvadesetak skupina. Neke od njih su: šišmiši, kukcojedi, majmuni, glodavci, zvijeri, perajari, kitovi, slonovi, kopitari i papkari.

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

PRAŽIVOTINJE (protozoa), jednostanične životinje, eukarioti, članovi carstva protista. Razvili su se tijekom evolucije iz prokariota. Mikroskopske su veličine. Najčešće žive samostalno ili kao zadružni oblici. Većinom su pokretni i heterotrofi. Žive u svim tipovima staništa: u moru i vodama na kopnu, a mnoge od njih su nametnici na drugim životinjama i na čovjeku. Na površini je protoplazmatskog tijela stanična membrana, pelikula ili čvrsta ljušturica. U protoplazmi se nalaze organeli koji obavljaju životne funkcije. Kreću se uz pomoć pseudopodija, bičeva i trepetljika. U nepovoljnim uvjetima često se začahure. Hranu uzimaju endocitozom, a kroz membrane hrana prolazi procesom difuzije. Probava se odvija u hranidbenim mjehurićima koji se kreću unutar organizma strujanjem citoplazme. Izmjena plinova, osmoregulacija i ekskrecija, također se obavljaju difuzijom kroz memebrane. Razmnožavaju se najčešće nespolno (diobom) i spolno. Poznato je oko 30.000 različitih vrsta praživotinja. Najpoznatije skupine su: bičaši, korjenonošci, trepetljikaši i truskovci. PREČNOUSTE, v. hrskavičnjače. PREDATORI (grabljivci), organizmi koji su u specifičnom odnosu ishrane s jedinkama druge vrste (predator-plijen), npr. ris je predator koji se hrani zečevima, lav je predator koji se hrani antilopama itd. PREDBUBREG, v.prvi bubreg. PREDLJIVE BRADAVICE, v. paučnjaci. PREHLADA, najčešća bolest dišnog sustava koju uzrokuju različiti virusi. Najčešće su inficirani gornji dišni putovi: nos i grlo. Simptomi su kihanje, suzenje, grlobolja, promuklost, kašalj i curenje iz nosa. Rijetko traje dulje od tjedan dana.

PREDMENSTRUACIJSKI SINDROM (PMS), skup različitih simptoma (fizičkih i psihičkih) koji se javljaju u mnogih žena prije mjesečnice. Uzrok tim promjenama je stalna izmjena koncentracije estrogena i progesterona za vrijeme menstruacijskog ciklusa. PREMOSNICA (engl. by-pass), dio vene uzet iz bedra s pomoću koje se operativno premošćuju oboljele koronarne arterije radi optimalnog opskrbljivanja srčanog mišića kisikom i hranjivim tvarima. PREMOSNICI, stara skupina gmazova. Jedini živi predstavnik i živi fosil je pilasti premosnik, jer se gotovo ništa nije promijenio već 150 milijuna godina . Danas živi uz obalu Novog Zelanda. Duž leđa ima pilasti greben od trokutastih ljusaka. Na glavi se nalazi tjemeno oko. PREOBRAZBA (metamorfoza) proces promjene oblika tijela. Neke životinje tijekom razvoja i rasta podliježu velikim promjenama, npr. kod beskralježnjaka kukci, isp., a kod kralježnjaka vodozemci, isp. punoglavac. PREPISIVANJE, v. sinteza proteina. PRESLICE, biljke iz skupine papratnjača. Poznata je poljska preslica. Zelena je stabljika člankovita i pršljenasto razgranata. Listovi su sitni i neugledni te obavijaju stabljiku iznad svakog koljenca. U rano proljeće uočavaju se smeđe nerazgranate stabljike koje na vrhu nose češerić sa sporangijima i sporama. Izospore su prilagođene raznošenju vjetrom pomoću haptera. PRETILOST (gojaznost, adipoznost), porast tjelesne mase uvjetovan nakupljanjem masti, koje nastaje zbog viška uzete hrane. Višak masnog tkiva posebno opterećuje srce i krvotok. Povećava se i rizik pojave različitih bolesti (ateroskleroza, hipertenzija, infarkt, bolesti jetre, šećerna bolest i dr.).


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

PRETVORBA ENERGIJE, proces kad se svjetlosna, električna, toplinska, kemijska i mehanička energija pretvaraju jedna u drugu jer se energija ne može ni stvoriti ni razoriti. PREVOĐENJE, v. sinteza proteina. PRIČVRSNICA (centromera), mjesto suženja na kromosomu za koje se prihvaćaju niti diobenog vretena tijekom diobe stanice. PRIDOŠLO KORIJENJE, v. korijen. PRIJELAZNI OBLICI, organizmi koji su po nekim svojim obilježjima na prijelazu između velikih razvojnih skupina. Na primjer, izumrle biljke pteridosperme, napola paprati napola sjemenjače, fosilna praptica s nekim osobinama gmazova, čudnovati kljunaš koji sjedinjuje obilježja gmazova, ptica i sisavaca, štitoglavac sejmurija bio je prijelazni oblik između vodozemaca i gmazova. itd. PRIJENOSNA RNK, v. tRNA. PRILAGODBA (adaptacija), osobina organizma kao konačna posljedica selekcijskog procesa. Oni oblici koji su najbolje prilagođeni uvjetima okoliša imaju izgleda za daljnji razvoj i množenje, a time i za održavanje svoje vrste u tom okolišu. Poznate su opće i specijalne adaptacije, isp. PRIMARNA IMUNOLOŠKA REAKCIJA, v.imuna memorija. PRIMARNA ORGANSKA PROIZVODNJA (primarna bioproizvodnja), proces stvaranja organske tvari iz anorganskih koji se odvija u autotrofnim organizmima, isp. autotrofi. Bioproizvodnost ekosustava ovisi o hranjivim i mineralnim tvarima, Sunčevoj energiji, toplini i dr. Od kopnenih ekosustava najproduktivnije su šume, a od vodenih ekosustava najveća je bioproizvodnja u zapadnom Atlantiku.


PRIMARNE SPERMATOCITE, stanice koje nastaju za vrijeme spermatogeneze (isp.). PRIMARNI RAST BILJAKA, rast biljaka u dužinu pomoću vršnih meristema izdanka i korijena. PRIMATI, najsavršenija skupina sisavaca kojoj pripadaju polumajmuni, majmuni, a sa zoološkog gledišta i čovjek. PRIONI, sitne zarazne čestice (manje od virusa i viroida) koje uzrokuju bolesti u čovjeka i životinja (kravlje ludilo). Otkriveni su 1980. god. Veliki su 2 do 3 nm, a građeni su samo od proteina. PRIRODNI ODABIR (selekcija, selekcijski pritisak), po Darwinu, glavni čimbenik evolucije koji uvjetuje stalno povećavanje prilagođenosti organizama životnoj sredini. Preživljavaju samo najbolje prilagođene jedinke, v. prilagođavanje. Za razliku od prirodnog odabira umjetni odabir nastaje djelovanjem čovjeka pri čemu se korisni oblici održavaju, a nekorisni propadaju. PRIRODNI SUSTAV, v. filogenetski (prirodni) sustav. PRIROĐENA IMUNOST (nespecifična), otpornost organizma na različite antigene, koja je prisutna u tijelu od rođenja bez posebnih oblika pokretanja imunološke reakcije. Nositelji te vrste imunosti su fagociti, neutrofilni leukociti i monociti. PROBAVA, proces razgradnje hrane u sastojke koji se mogu upiti u krv ili limfu ili nekim drugim načinom prenijeti do stanica. Razlikujemo intracelularnu i ekstracelularnu probavu. PROBAVNI ENZIM, v. pepsin. PROBAVNI ENZIMI GUŠTERAČE, probavljaju ugljikohidrate, bjelančevine i masti. Enzim za razlaganje ugljikohidrata

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

je pankreasna amilaza koja hidrolizira škrob i glikogen (ne i celulozu!) do disaharida. Proteolitični su enzimi: tripsin, kimotripsin, karboksipolipeptidaze i (deoksi) ribonukleaze. Pankreasna lipaza hidrolizira neutralne masti u glicerol i masne kiseline. Enzimatski učinak lipaze na masti pospješuje se djelovanjem žuči koja uzrokuje raspršivanje masti u male kapljice (hilomikrone).

kromatide koje nazivamo kromosomske tetrade. Tijekom konjugacije kromosoma česta je pojava ispreplitanja njihovih kromatida, a mjesta ispreplitanja nazivamo hijazme. Na hijazmama može doći do pucanja i izmjenjivanja kromatida homolognih kromosoma. Tu pojavu nazivamo krosingover (crossing over). Ona je važna jer doprinosi genetičkoj raznolikosti stanica koje nastaju mejozom.

PROBAVNI SUSTAV, proteže se gotovo duž čitave dužine tijela kao probavna cijev - od usta do analnog otvora. Sastavljen je od niza probavnih organa i probavnih žlijezda s izlučivanjem (sekrecijom) probavnih sokova u probavilo. To su npr. kod čovjeka: usna šupljina sa zubima i jezikom, ždrijelo, jednjak, želudac, tanko i debelo crijevo te žlijezde slinovnice, gušterača i jetra.

PROFAZA II, (profaza druge mejotičke diobe), jedna od etapa mejoze II u kojoj su zbivanja slična zbivanjima u profazi mitoze. U profazi II razgrađuje se jezgrina ovojnica i jezgrica, a kromosomi se počinju spiralizirati. Centrosom se podijeli na dva dijela koja putuju na suprotne polove stanice formirajući diobeno vreteno. Za razliku od stanica koje ulaze u profazu mitoze i imaju dvostruki (2n) broj kromosoma, stanice koje ulaze u profazu II imaju jednostruk (n) broj kromosoma.

PRODUCENTI, proizvođači hrane u prirodi, zelene biljke. PRODUŽENA MOŽDINA (medulla oblongata), smještena je ispod velikog i ispred malog mozga. Završava kod velikog zatiljnog otvora, odakle se dalje u kralježnicu nastavlja leđna moždina. Produžena moždina je građena od vanjske bijele i unutarnje sive tvari. Regulira vegetativne funkcije, kao što su: disanje, krvni tlak, peristaltika crijeva i dr. Oštećenjem produžena moždine, npr. središta za disanje, nastupa smrt. PROFAZA DRUGE MEJOTIČKE DIOBE, v. profaza II. PROFAZA I (profaza prve mejotičke diobe), početna faza redukcijske diobe, mejoze I. U toj fazi dolazi do sparivanja, tj. konjugacije homolognih kromosoma. Parove tako sparenih kromosoma nazivamo bivalenti, a kako je svaki kromosom dvostruk (sastoji se od dvije kromatide), spareni kromosomi tvore snopove od četiri

PROFAZA PRVE MEJOTIČKE DIOBE, v. profaza I. PROFAZA, početna faza diobe stanice, mitoze. U njoj se kromosomi počinju spiralizirati i tako postaju vidljivi. U toj fazi gubi se jezgrina ovojnica i jezgrica, a centrosom se podijeli na dva dijela koji putuju na suprotne polove stanice formirajući diobeno vreteno. PROGESTERON, jedan od ženskih spolnih hormona kojega izlučuju ženske spolne žlijezde, jajnici. U pubertetu progesteron utječe na razvoj spolnih karakteristika i pojavu menstruacijskog ciklusa. Tijekom menstruacijskog ciklusa izlučuje ga i tvorba nazvana žuto tijelo. U trudnoći ga izlučuje i posteljica. Uloga progesterona tijekom trudnoće je sprečavanje menstruacije koja bi uzrokovala gubitak ploda. PROGLOTIDI, v. trakavica.


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

PROKARIOTI, (prokariotski organizmi), jednostanični organizmi koji nemaju oblikovanu jezgru ni stanične organele kao što su mitohondriji, plastidi i Golgijevo tijelo, ali imaju ribosome i umjesto jezgre nukleoid. Prokarioti su bakterije i modrozelene alge (cijanobakterije). Pošto su prokarioti jednostanični organizmi, njihov opis ujedno predstavlja i opis prokariotskih stanica. Dio znanstvenika ih ne ubraja ni u biljke ni u životinje, već u zasebno carstvo pod imenom Monere. PROKARIOTSKE STANICE (protocite, grč. pro = prije, karyon = jezgra), prijejezgrene stanice, v. prokarioti. PROKARIOTSKI prokarioti.



PROKLIČNICA (protonema), malena nitasta tvorevina slična steljci koja se razvija u većine mahovina iz proklijale spore. Iz prokličnice se razvije mahovina koja nosi na sebi spolne organe (anteridije i arhegonije) pa je prema tome, prokličnica dio spolne generacije (gametofita). PROLAKTIN, hormon kojega izlučuje prednji režanj hipofize (adenohipofiza), a uloga mu je da dan-dva nakon porođaja izaziva izlučivanje mlijeka iz žljezdanih stanica dojke. PROLIN, kemijski spoj iz skupine aminokiselina. PRONEFROS, v. prvi bubreg. PROPLASTIDI, stanični organeli, ubrajamo ih u skupinu staničnih organela čiji je zajednički naziv plastidi (isp.). Proplastidi su ishodišni oblik plastida iz kojeg se mogu razviti svi ostali tipovi plastida: kloroplasti, kromoplasti, leukoplasti. Nalaze se u embrionalnim stanicama npr. stanice vegetacijskog vrška. Obavijeni su dvostrukom membranom. Iz unutarnje membrane uvrtanjem nastaju tilakoidne membrane.


PROPLIOPITEKUS (Propliopithecus), vrsta pramajmuna koja je živjela u razdoblju oligocena, dakle prije 25 do 30 milijuna godina. PROSOMA, prednji dio tijela (glavopršnjak) klještara iz skupine člankonožaca. Nastao stapanjem 8 tjelesnih kolutića. Na prosomi je pet pari nogu: četiri služe za hodanje, a prvi par je promijenjen u čeljusne nožice za pridržavanje plijena ili kao osjetilo. Uz usta su kliješta ili helicere, isp. PROSTATA, žlijezda koja je dio muškog spolnog sustava. Izlučuje lužnate sekrete koji neutraliziraju kiselost sperme. PROTALIJ, malena višestanična tvorevina krpastog, srcolikog ili gomoljastog oblika koja se razvija iz proklijale spore papratnjača. Na protaliju se razvijaju spolni organi (anteridiji i arhegoniji) pa je prema tome, protalij dio spolne generacije (gametofita). PROTEINI (bjelančevine), složene organske molekule građene od aminokiselina koje su međusobno povezane peptidnim vezama. U građi proteina živih bića dolazi 20 različitih aminokiselina. Proteini u živim bićima imaju strukturnu ulogu, nositelji su biokemijskih procesa u organizmu (npr. hormoni, enzimi), a u manjoj mjeri koriste se kao izvor energije. PROTEINOIDI, tvari slične proteinima koje je zagrijavanjem aminokiselina suhim postupkom dobio znanstvenik Fox. Kada ih je otapao u vrućoj morskoj vodi proteinoidi su se pretvarali u okrugla tjelešca (mikrosfere) slična jednostavnim živim stanicama. PROTEINURIJA, pojava bjelančevina u mokraći kod nekih bubrežnih bolesti. PROTEOLITIČKI ENZIM, v. probavni enzimi gušterače.

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

PROTISTI, svi jednostanični organizmi od kojih su neki svojim osobinama slični biljkama (fotosintetski autotrofni producenti), neki životinjama (heterotrofni potrošači, konzumenti), a neki gljivama (heterotrofni razgrađivači). PROTOBIONTI, v. praorganizmi. PROTOCITE, v. prokariotske stanice. PROTONEFRIDIJI, organi za izlučivanje i osmoreglaciju kod mnogih beskolutićavaca (npr. plošnjaka i oblića). Sastoje se od sustava cjevčica smještenih u parenhimu. Svaka cjevčica završava tjemenom stanicom kroz čiju se membranu apsorbiraju produkti metabolizma i odvode van. Cjevčice se na površini tijela otvaraju malim otvorom - porom. PROTONEMA, v. prokličnica. PROTOPLAZMA, živa tvar stanice koju čine jezgra i sadržaj citoplazme. PROTOZOA, v. praživotinje. PROTUŠIFRA, v. antikodon. PROTUTIJELA, v. antitijela. PROVODNI (karakteristični) FOSILI, fosilni ostaci organizama koji se smatraju karakterističnim za određeno razdoblje Zemljine prošlosti. Važni su za prosudbu kakav je bio živi svijet pojedinih geoloških razdoblja i za određivanje njihove relativne starosti. Tako su primjerice nalazi trilobita, izumrlih člankonožaca karakteristični za slojeve starog paleozoika; nalazi amonita, izumrlih glavonožaca upućuju na mezozoik; nalazi školjke kongerije karakteristični su za slojeve tercijara. PROVODNO STANIČJE, oblikuje provodne žile koje sežu u sve dijelove biljke. Provođenje vode i otopljenih minerala odvija se putem dijela žile koji se zove ksilem. U golosjemenjača to su vrlo duge

stanice koje se zovu traheide. Ksilem kritosjemenjača čine traheje, duge cijevi nastale od niza produžnih stanica kojima su reducirane poprečne mebrane. Ksilemski su elementi čvrste stanice odebljalih, ligniziranih (odrvenjenih) stijenki koji daju i potrebnu čvrstoću žili što je važno za njezin rad. U jednogodišnjih biljki, ali i višegodišnjih tijekom njihove prve godine ti ksilemski dijelovi žile daju čvrstoću čitavoj biljki. U višegodišnjih drvenastih biljaka ksilemski elementi preuzimaju postupno samo ulogu održanja čvrstoće i izgrađuju dio stabla koji zovemo drvo. Drugim dijelom žile, floemom provode se organske tvari od listova u sve biljne dijelove. PRVA MEJOTIČKA DIOBA, v. mejoza I. PRVI BUBREG (predbubreg ili pronefros), organ za izlučivanje samo kod kružnousta i ličinke riba. Kod ostalih skupina kralježnjaka zakržlja u njihovu zametnom razvitku. Sastavljen je od tri para cjevčica sa trepetljikavim lijevcima ispred kojih je klupko krvnih žila (glomerul). Iz njih se krv filtrira u zajednički izvodni kanal, predbubrežnu cijev. PRVI VIŠESTANIČNI ORGANIZMI, organizmi koji su nastali tijekom biološke evolucije prije 600 do 700 milijuna godina. Njihov razvoj započeo je u vodi. PSEUDOCEL, tjelesna šupljina koja po postanku odgovara primarnoj tjelesnoj šupljini ili blastocelu, isp. blastula. PSEUDOPODIJI (lažne nožice, grč. pseudos = la��, podos = noga), izdanci u praživotinja (npr. amebe) koji služe za pokretanje i uzimanje hrane procesom endocitoze. Nastaju kao posljedica strujanja protoplazme (endoplazme prema ektoplazmi ili egzoplazmi) i mijenjanja fizikalnog stanja citoplazme (sol i gel stanje).


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

PSILOFITI (grč. psilos = gol, phiton = biljka), prve papratnjače, koje su imale samo zelenu, golu i vitičasto razgranatu stabljiku bez listova. Pojavile su se prije oko 390 milijuna godina (geološko doba devon), v.dodatak 5. PTERIDOSPERME, t.j. "paprati sa sjemenkama", drevne izumrle biljke nalik na papratnjače, koje su na vrhovima listova umjesto sporangija nosile sjemenke. Mogu se smatrati prijelaznim oblicima između papratnjača i golosjemenjača. PTICE (Aves), skupina kralježnjaka koja se potpuno prilagodila životu na kopnu. Toplokrvnost i sposobnost da lete omogućili su pticama široku rasprostranjenost na Zemlji. Tijelo im je pokriveno perjem. Imaju dva para udova: prednji par su krila, a stražnji noge za hodanje, najčešće s 4 prsta. Na glavi je kljun s ustima bez zuba. Prsna kost ima greben za koji se drže prsni (letni) mišići. Mnoge kosti su šuplje i ispunjene zrakom tzv. pneumatične kosti. Ptice imaju dobar sluh i izvrstan vid. Razlikuju boje. Srce je sastavljeno od dvije pretklijetke i dvije klijetke. Dišu plućima. Pluća su povezana sa pet pari zračnih vrećica koja zalaze među organe i u kosti. Ptice se hrane zrnjem a mnoge su mesojedi. Probavu olakšava volja i žljezdani želudac gdje se hrana razgrađuje enzimima. U mišićnom se želucu hrana usitnjava mehanički. Za izlučivanje imaju jedan par pravih bubrega (v. treći bubreg). Nemaju mokraćni mjehur. Sve ptice legu jaja. Ženke imaju samo lijevi jajnik i jajovod. Oplodnja je unutarnja. Mužjaci prenose sjeme izravno u nečisnicu. Za vrijeme prolaska kroz jajovod jaja se obavijaju ovojnicama. Površinska je ovojnica tvrda lupina ili ljuska. Oko zametka se stvaraju zametne ovojnice: amnion, alantois i seroza, isp. Snesena ptičja jaja trebaju za zametni razvitak inkubaciju - zagrijavanje ležanjem roditelja na njima. Kad se iz jajeta izlegu mladunci,


oni su potrkušci ili čučavci. Ptice pokazuju raznolike oblike pojedinačnog i zadružnog ponašanja kao npr. gradnja gnijezda, leženje na jajima, briga za podmladak, život u jatima i seobe. Ptice su važne kako za čovjeka tako i u održavanju prirodne ravnoteže. Danas u biosferi živi oko 8600, a u Hrvatskoj oko 250 vrsta. Ptice su se razvile od pragmazova. Najstarija poznata vrsta je jurska ptica, praptica ili Archaeopteryx, isp. Današnje se ptice dijele u dvije skupine: staročeljuske ili bezgrebenke i novočeljuske ili grebenke. PTIJALIN (alfa amilaza), probavni enzim koji se nalazi u sastavu sline, a sudjeluje u razgradnji škroba do šećera maltoze i glukoze. PUBERTET (spolno sazrijevanje), započinje lučenjem GTH iz adenohipofize. Lučenje GTH nadzire hipotalamus gdje se, počevši od puberteta, luče neurohormonske tvari za oslobađanje gonadotropnih hormona. Pubertat započinje u djevojčica oko 10. do 13. godine, a u dječaka jednu do dvije godina kasnije. Traje nekoliko godina, a završava između 16. i 18. godine. Djelovanjem muških spolnih hormona (testosteron), odnosno ženskih spolnih hormona (estrogen, progesteron) iskazuju se primarne i sekundarne spolne oznake. Kod djevojčica se javlja menarha, a kod dječaka polucija. Osim fizičkih promjena u pubertetu se pojavljuje niz fizioloških i psihičkih promjena. PUČI (stome), mikroskopski otvori u epidermi, najčešće na naličju listova, kroz koje se izmjenjuju plinovi između okoliša i unutarnjosti biljke te izlučuje voda. Puči okružuju dvije stanice zapornice uz koje se nalaze mnogo veće stanice susjedice. Puči se otvaraju kada u njima poraste turgor (u odnosu prema susjedicama) zbog primanja vode u zapornice. Naime, kada u stanice zapornice ulaze kalijevi ioni, a fotosin-

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

tezom nastaje šećer, povisuje se osmotski tlak i voda ulazi u stanice zapornice. Puči se zatvaraju kad se turgor smanji u odnosu prema susjedicama. PUFERI, kemijske tvari u krvnoj plazmi, npr. bikarbonatni, fosfatni ili proteinski puferi, koji se opiru bitnijoj promjeni pH, v. acido - bazna ravnoteža. PULS (bilo), pulsiranje arterija koje se može mjeriti na mjestima koja su bliže površini tijela. Budući da srce ubacuje u aortu krv na mahove (oko 70 puta u minuti), krv u arterijama teće pulsirajućim tlakom. PUNOGLAVAC, ličinka žabe. Živi u vodi. Hrani se algama i postupno se preobražava u odrasli oblik. Ličinački razvoj žabe naziva se preobrazba ili metamorfoza. Vanjskim izgledom punoglavac je sličan mladoj ribici. Ima škrge, neparnu repnu peraju, dvodjelno vensko srce, svitak i bočnu prugu. Tijekom metamorfoze razvijaju se pluća, noge, kostur i drugi organi, a nestaju škrge i rep. Metamorfoza traje oko 3 mjeseca. PUPILARNI REFLEKS, v. bjeloočnica. PUPULJICA, v. čempresi. PURINSKE BAZE, organski spojevi iz skupine dušičnih baza koje se nalaze u sastavu nukleinskih kiselina (DNA, RNA). Purinske baze su adenin i gvanin. U molekuli DNA, purinske baze jednog lanca vežu se s komplementarnim bazama drugog lanca. Princip komplementarnosti vrijedi i pri sintezi RNA. PURKINJE, J. (1787. – 1869.), češki citolog koji 1839. god. opisuje protoplazmu. Otkrio razgranate neurone u mozgu nazvane Purkinjove stanice. PUŽEVI, najbrojnija skupina mekušaca, isp. Asimetrične su životinje jer je tijekom

evolucije nastalo zakretanje ili torzija tijela. Puževi imaju spiralno zavijenu kućicu ili su bez nje (npr. balavci). S obzirom na stupanj torzije tijela dijele se na: prednješkržnjake, stražnjoškržnjake i plućnjake. Prednjoškržnjaci su razdvojenog spola, a stražnjoškržnjaci i plućnjaci su dvospolci. Najpoznatiji puževi na kopnu su: puž vinogradnjak i balavac, u moru: volak, priljepak, ogrc i puzlatka, a u kopnenim vodama: barnjak, ploštenjak i ogrc.

R RAČVASTA EVOLUCIJA, v. divergentna evolucija. RADIJALNA SIMETRIJA, v. zrakasta simetrija. RADIONUKLIDI (radioizotopi), izotopi elemenata koji imaju nestabilne jezgre, te se one raspadaju uz pojavu ionizirajućeg zračenja. Koriste se u istraživanju stanica npr. pomoću radioaktivnog izotopa ugljika dokazano je da se u procesu fotosinteze ugljik(IV)-oksid iz zraka ugrađuje u molekulu šećera. RADNI METABOLIZAM, količina energije koju tijelo dnevno utroši na radne aktivnosti. RADULA, v. trenica. RAHITIS, dječja bolest kostiju koja nastaje zbog slabe kalcifikacije kostiju. Ako u hrani nemaju dovoljno kalcija i vitamina D3, neće se ni ispravno ni dovoljno stvarati anorganski dio kostiju što uzrokuje savitljivost i deformaciju. kosti. RAKOVI (Crustacea), životinje iz skupine člankonožaca, isp. Na kopnu uz more žive npr. mokrice ili babure (pokretni


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

oblici) i vitičari (sjedilački oblici). Ostali su rakovi vodeni organizmi. Jednostavnije građeni rakovi su planktonski niži raci, kao vodenbuha i ciklop. Od viših rakova (imaju 20 kolutića) poznati su npr. riječni rak, jastog, škamp i hlap. Pripadaju skupini deseteronožnih rakova. Glava i prsa najčešće su srasli u glavopršnjak. Na glavi se nalaze dva para ticala i jedan par složenih očiju. Na prsima imaju tri para čeljusnih nogu i pet pari za hodanje. Na zatku su noge za hodanje. U glavi je glavni ganglij, "mozak". Oči se sastoje od mnogo malih okašaca, zvanih omatidije. Svako okašce prima dio slike koja se slaže poput mozaika. Druga osjetila su za ravnotežu (statociste), opip, miris. Dišu škrgama koje su na nogama hodalicama. Za izlučivanje imaju ticalne ili antenalne žlijezde . Oplođuju se pomoću paketića spermija. Ženke nose oplođena jaja prilijepljena na nekom vanjskom organu. Iz njih se razvijaju ličinke koje se presvlače nekoliko puta tijekom svog poslijezametnog razvitka. Presvlačenje je fiziološki proces koji kontroliraju hormoni iz neurosekretornih stanica živčanog sustava. RAK PLUĆA, (bronhalni karcinom), jedan od najčešćih i najteže izlječivih oblika raka, u 99% slučajeva se susreće kod pušača. Dim cigarete oštećuje stanice dušnika, a te oštećene stanice početni su stupanj razvoja tumora koji raste i širi se na pluća. RAMAPITEKUS (Ramapithecus), izumrli oblik primata koji je živio već prije 15 milijuna godina, a njegovi ostaci nađeni su u istočnoj Africi, Indiji i Europi. Danas se smatra da je u toj skupini kroz vrlo dugo razdoblje došlo do najveće preobrazbe u smjeru nastanka čovjeka. RAZLAGAČI v. saprofagi. RAZMNOŽAVANJE, razvitak novih jedinki, potomaka, a može biti spolno ili nespolno. Spolnim razmnožavanjem se


dobivaju potomci s novom kombinacijom gena. Spolnim razmnožavanjem nastaju raznolikije jedinke nego nespolnim. Postoji više oblika nespolnog razmnožavanja: dvojna (binarna) dioba, mnogostruka (multipla) dioba, pupanje i vegetativno razmnožavanje (dijelovima tijela višestaničnih biljaka). Potomci nastali nespolnim načinom razmnožavanja genetički su identični matičnoj stanici, odnosno biljci. Jedinke koje nespolnim načinom daju potomke stvaraju klon, isp. RAZNOJEDNI ORGANIZMI, v. omnivori. RAZRED, v. filogenetski sustav. RAZVITAK ČOVJEKA, proces koji započinje začećem, a obuhvaća embrionalni, fetalni i postnatalni (poslijeporodni) razvitak čovjeka do njegove zrele dobi. RAZVOJNI (filogenetski) NIZOVI, uzastopni prijelazni oblici na kojima se mogu pratiti postupne promjene i razvoj neke vrste ili cijele skupine. Dobro su proučeni razvojni nizovi konja, slona i barskog puža ogrca. Važan su paleontološki dokaz evolucije. RAŽOVA GLJIVICA, (ergot, Claviceps purpurea), parazit na plodnici trava gdje se u klasu na mjestu pšena razvija roščić, sklerocij. Ti sklerociji sadrže otrovni alkaloid ergotin koji je ljekovit ako se ispravno primjeni. Služi za dobivanje preparata koji se u porodiljstvu rabi za izazivanje grčenja uterusa te kao temelj halucinogene droge LSD. REAKCIJE NA SVJETLU (reakcije ovisne o svjetlosnoj energiji), početne reakcije fotosinteze koje započinju kada svjetlosna energija Sunca izbija elektrone iz molekule klorofila. Elektroni putuju preko niza prenosilaca natrag prema klorofilu, a pri tom prijenosu dio energije predaju za

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

sintezu molekula ATP-a. Dio elektrona koje svjetlosna energija izbija iz klorofila ne vraća se natrag nego prelazi na spoj NADPH. Osim elektrona, NADPH prima i ione vodika koji nastaju razlaganjem vode te na taj način NADPH prelazi u reducirani oblik NADPH2. Voda se razlaže djelovanjem svjetlosne energije (fotoliza vode, ionizacija vode) na H+ i OH- ione. Kao što je rečeno, vodikovi ioni se vežu na NADP, a hidroksil ioni otpuštaju elektrone koji odlaze preko niza prenosilaca u klorofil nadomještajući mu elektrone koji su mu izbijeni da bi prešli na molekule NADP. Kao produkt ovih reakcija oslobađa se kisik koji odlazi u atmosferu. Vodik iz vode privremeno vezan u spoj NADPH2 poslužit će u reakcijama u tami za redukciju CO2. REAKCIJE NEOVISNE O SVJETLOSNOJ ENERGIJI, v. reakcije u tami. REAKCIJE OVISNE O SVJETLOSNOJ ENERGIJI, v. reakcije na svjetlu. REAKCIJE U TAMI (reakcije neovisne o svjetlosnoj energiji, Kalvinov ciklus), reakcije fotosinteze koje se nadovezuju na reakcije na svjetlosti. Za njihovo odvijanje neophodni su ugljikov dioksid, NADPH2 kao izvor vodika i ATP kao izvor energije. To je skup vrlo složenih biokemijskih reakcija u kojima se ugljik(IV)-oksid postupno reducira vodikom do šećera glukoze uz utrošak energije. Jednadžbu reakcija u tami možemo sumarno prikazati ovako: NADPH2 + CO2 + E (ATP) → C6H12O6 (glukoza)

REAKCIJSKO SREDIŠTE, položaj jedne molekule ili para molekula klorofila a u fotosistemu. RECESIVNO SVOJSTVO, (potisnuto svojstvo), svojstvo koje ne dolazi u fenotipu uvijek do izražaja. U primjerima križanja aleli za recesivno svojstvo označuju se malim slovima. Recesivno svojstvo do-

lazi u fenotipu do izražaja samo u slučaju homozigotnosti, tj. kada organizmi nose iste alele za to svojstvo, npr. aa ili bb itd. Recesivna svojstva su, npr. niski rast graška, smeđa boja dlake goveda, krvna grupa 0 u čovjeka itd. RED, v. filogenetski sustav. REDIJE, v. ovčji metilj. REDUCENTI, razlagači organskih tvari, gljive i bakterije. Isp. saprofagi. REDUKCIJA, kemijska reakcija u kojoj neka molekula, atom ili ion prima ili dobiva jedan ili više elektrona. To su, npr. reakcije oduzimanja kisika, reakcije spajanja s vodikom itd. REDUKCIJSKA DIOBA, v. mejoza. REFLEKS, brza, svrsishodna, motorička reakcija na primljeni podražaj bez sudjelovanja kore velikog mozga i bez reakcije svijesti. Refleks je usmjeren na zaštitu organizma. Pojedini refleksi su prirođeni refleksi (npr. sisanje, gutanje, kašljanje, kihanje i dr.), a drugi su stečeni na temelju iskustva. Posebnu skupinu čine uvjetovani refleksi. REFLEKSNI LUK, zatvaraju ga živčane stanice sa svojim živčanim vlaknima, koje sudjeluju u odvijanju refleksa, isp. Sastoji se od osjetilnog (receptorskog) neurona, sinapse u leđnoj moždini, motoričkog neurona i izvršitelja (efektora) tj. mišića koji će izvršiti radnju. To je monosinaptički refleksni luk (jedna sinapsa i dva neurona osjetilni i motorički). Postoje i disinaptički refleksni luk (dvije sinapse i tri neurona osjetilni, međuneuron i motorički neuron). REGENERACIJA, sposobnost obnavljanja izgubljenih dijelova tijela. Kod npr. bezkralježnjaka: spužve, hidre, virnjaka, zvjezdače, ježinca ili mješčićnice. Među kralježnjacima to se svojstvo očituje u re-


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

patih vodozemaca. Daždevnjaci mogu obnoviti stopalo, nogu, oči, rep, pa čak pluća i gonade, a punoglavac žabe rep i noge. Sposobnost regeneracije je manja u životinja na višem stupnju razvoja. REGULATORI RASTA, v. biljni hormoni. REKOMBINACIJE, pojava novih kombinacija gena koje se u fenotipu očituju kao nove osobine, kojih nije bilo u roditelja, a posljedica su nezavisnog odvajanja kromosoma i krosingovera. REKOMBINANTNA DNA, DNA proizvedena spajanjem gena od različitih vrsta. Rekombinantna DNA - tehnologija omogućava prijenos gena iz jedne vrste u genom druge vrste: biljne, životinjske i ljudske. REKOMBINANTNI TIP, naziv koji se primjenjuje za: genotip, fenotip, gamete stanica ili organizme koji su nastali prirodnom genetičkom rekombinacijom. RELIKTI, biljne i životinjske vrste kojima je areal u prošlosti bio mnogo širi, ali se kasnije smanjio zbog promjene klime, podneblja ili drugih obilježja staništa. Biljni relikti u Hrvatskoj su velebitska degenija, hrvatska sibireja, vučja stopa itd. a životinjski relikti su čovječja ribica, sredozemna medvjedica itd. Neki su relikti ujedno i endemi. RENIN, enzim kojega izlučuje želudac djeteta u vrijeme sisanja mlijeka, a sudjeluje u razgradnji bjelančevine kazeina iz mlijeka. REPAŠI, skupina vodozemaca koji i kao odrasli oblici imaju rep. Najpoznatiji su repaši daždevnjaci i vodenjaci. Imaju dobro razvijene udove za kretanje. Koža je bogata žlijezdama koje mogu izlučivati otrovne tvari. Neki kopneni daždevnjaci nemaju pluća, pa se plinovi izmjenjuju kroz kožu.


Odrasli repaši žive uglavnom na vlažnim mjestima, ali se razmnožavaju u vodi. Ličinke su slične odraslima. Imaju vanjske škrge, koje se u nekih vrsta zadrže tijekom čitava života, kao kod čovječje ribice, isp. Neki se od repaša mogu razmnožavati u ličinačkom stanju. Ta se pojava zove neotenija, isp. RESOPERKE, stara skupina riba koštunjača iz perioda devon, u paleozoiku. Prijelazni su oblik jer prve pokazuju razvoj prema kopnenim životinjama. Kostur njihove prsne peraje ima sličnosti s kosturom prednje noge vodozemaca. Neke resoperke iz roda Latimeria žive i danas i nazivaju se živi fosili, isp. RESPIRACIJA, v. disanje. RESPIRACIJSKO (dišno) SREDIŠTE, čine živčane stanice smještene u produženoj moždini koje autonomno određuje frekvenciju disanja. Dišno središte se dopunski podražuje povećanom razinom ugljikovog dioksida u krvi odnosno smanjenom razinom kisika u krvi. RESPIRATORNI SUSTAV, v. dišni sustav. RESTRIKCIJSKI ENZIM (restrikcijska endonukleaza), enzim koji reže dvostruki lanac DNA na specifičnom mjestu na određene dijelove. Ti se enzimi izoliraju iz bakterija, a genetički ih inženjeri upotrebljavaju za stvaranje rekombinantne DNA. RETROVIRUSI, RNK virusi čija se genetička uputa prevodi u DNK uz pomoć vlastitog enzima reverzne transkriptaze. REVERZNA TRANSKRIPTAZA, v. retrovirusi. Rh – FAKTOR, v. Rh-sustav. Rh SUSTAV (Rh-faktor, rhesus faktor), jedan od antigena, tzv. Rh-aglutinogen, koji se može nalaziti na membranama eri-

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

trocita, a naziv je dobio prema vrsti majmuna (Macacus rhesus) kod koje je prvi put otkriven. Osobe koje imaju taj antigen su Rh-pozitivne, Rh(+), a one koje ga nemaju Rh-negativne, Rh(–). U krvnoj plazmi Rh(+) i Rh(–) osoba nema prirođenih protutijela kao što su uobičajena kod osoba krvne skupine A, B i 0. Do sinteze stečenih Rh-aglutinina dolazi u imunološkom sustavu samo imunizacijom Rh(–) osobe eritrocitima Rh(+) osobe i to samo u 2 slučaja: nakon pogrešne transfuzije krvi Rh(+) osobe u Rh(–) osobu i tijekom trudnoće Rh(–) majke koja nosi Rh(+) dijete.

molekula: proteina i RNA. Nalaze se slobodni u citoplazmi ili su vezani uz membrane zrnate (hrapave) endoplazmatske mrežice. Ribosomi koji se u citoplazmi nalaze slobodni mogu biti povezani u skupine, grozdove od 5, 6, 7 ili 8 ribosoma, u tzv. poliribosome (polisome). Na ribosomima se odvija sinteza proteina. Na ribosomima koji se nalaze slobodni u citoplazmi sintetiziraju se proteini koji će ostati u stanici, dok se na ribosomima vezanim uz membrane endoplazmatske mrežice sintetiziraju proteini koji će se izlučiti izvan stanice.

RHESUS FAKTOR, v. Rh-sustav.


RIBE (Pisces), prvi kralješnjaci u kojih su razvijene čeljusti i hrskavična ili koštana kralježnica. Žive u moru i slatkim vodama. Poznato je oko 20000 vrsta. Na vretenastom tijelu razlikuje se glava, trup i rep. Tijelo je pokriveno ljuskama. U koži su žlijezde koje izlučuju sluz. Imaju 2 para parnih peraja i 3 ili više neparnih. Plivaći je mjehur ispunjen plinom i služi kao hidrostatski organ. Osjetilni organi su prilagođeni životu u vodi. Ribe vide na malu udaljenost. Očni su kapci prozirni i srasli. Nosne šupljine su samo mirisne jamice. Ribe imaju samo unutarnje uho. Strujanje vode osjećaju bočnom prugom. Ribe dišu škrgama. Krvotok je zatvoren. Srce je dvodjelno i vensko. Hladnokrvne su životinje. Za izlučivanje im služi drugi bubreg (mezonefros). Razmnožavaju se jajima, a neke su i živorodne. Oplodnja je uglavnom vanjska. Ženke legu jaja (ikru), a mužjaci ih prekrivaju spermom (mliječ). Prema građi tijela ribe dijelimo na: hrskavičnjače i koštunjače (zrakoperke i nosnoprolaznice).

RIBOZA, kemijski spoj iz skupine monosaharida (jednostavnih šećera) pentoza opće formule C5H10O5, a strukturne:




RIBOSOMI, zrnca u citoplazmi svih vrsta stanica. Vidljiva su samo elektronskim mikroskopom. Građeni su od dviju vrsta








Izgrađuje nukleotide ribonukleinske kiseline (RNA). RIKECIJE, bakterije izuzetno malih dimenzija, kuglastog ili štapićastog oblika. Kao obligatni paraziti, kod životinja i čovjeka uzročnici su teških oboljenja, psitakoze, pjegavog tifusa, trahoma itd. RIZODERMA, pokrovno tkivo, kožno staničje posve mladih dijelova korijena. RIZOMA (grč. rhiza = korijen), podzemna stabljika, podanak, v. stabljika. RNA (ribonukleinska kiselina, RNK), složeni organski spoj građen od većeg broja ribonukleotida. Svaki ribonukleotid sastoji se od triju vrsta molekula: fosfata, šećera riboze i jedne od četiri dušične baze (adenina, gvanina, citozina ili uracila). Molekula RNA građena je samo od jednog poli-


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

nukleotidnog lanca koji može biti ispružen ili savijen na različite načine. Razlikujemo tri tipa RNA: glasnička (messenger) RNA (gRNK ili mRNA), ribosomska RNA (rRNK ili rRNA) i transportna RNA (tRNK ili tRNA). Molekule RNA sintetiziraju se u jezgri na kalupu molekule DNA, a najviše ih ima u citoplazmi stanice i na ribosomima. RNA ima važnu ulogu u sintezi proteina. RNaza, enzim koji ubrzava razgradnju molekula RNA. RNK, v. RNA. ROD, v. filogenetski sustav.

zakržljali organi koji u organizmu nemaju više nikakve funkcije ili je ona svedena na minimum. To su, npr. ostaci kukovlja u kita i nekih zmija, kod čovjeka su to crvuljak slijepog crijva, trtica, zub mudrosti, tjelesna dlakavost itd. Dokaz su evolucije. RUŽE, predstavnici ove skupine dvosupnica imaju pravilne, dvospolne cvjetove s peteročlanim obojenim vjenčićem i mnogo prašnika. Položaj i broj plodnih listova je promjenljiv. Dijele se na: ružičnjače (divlja ruža, kupina, malina, šumska jagoda), koštunjače (trešnja, šljiva, breskva, badem) i jabučnjače (jabuka, kruška, dunja, glog, oskoruša).

RODBINSKO SUSTAVOSLOVLJE, v. filogenetska sistematika. RODNICA (vagina), cjevasta tvorevina duga 7 do 11 cm. Povezuje vrat maternice s vanjskim spolovilom. Stijenke su rodnice vrlo rastezljive. Vanjski otvor rodnice leži ispod vanjskog otvora mokraćne cijevi. U predvorju rodnice je djevičanski zalistak (hymen). ROŽNICA (cornea), v. bjeloočnica. rRNA (rRNK, ribosomska RNA), tip ribonukleinske kiseline koja zajedno s proteinima izgrađuje ribosome. Na molekule rRNA otpada 60 do 80 % ukupne stanične RNA. Molekule rRNA sintetiziraju se u jezgrici (nukleolusu).

S S-FAZA, v. interfaza. SAHARIDI, v. ugljikohidrati. SAHAROZA (tršćani šećer), kemijski spoj, ugljikohidrat iz skupine saharida, disaharid. Sastavljen je od dvije molekule jednostavnih šećera i to od jedne molekule glukoze i jedne molekule fruktoze. Dobiva se iz šećerne trske i šećerne repe. SAMOAMPUTACIJA, v. samosakaćenje.

RUBISKO (ribuloza-1,5-difosfat karboksilaza), enzim koji katalizira prvu reakciju Calvinova ciklusa tijekom fotosinteze. Kloroplasti sadržavaju vrlo mnogo tog enzima. U biosferi ga ima više negoli bilo koje druge bjelančevine.

SAMOOČIŠĆENJE (autopurifikacija) VODA, pročišćavanje otpadnih voda na osnovu bioloških zakonitosti tj. odstranjenje organskih tvari u smislu odvijanja kruženja tvari i protjecanja energije u ekosustavu.


SAMOOSAKAĆIVANJE, v. samosakaćenje.

RUDIMENTI (rudimentarni organi, lat. rudimentum = prvi početak, pokušaj),

SAMOSAKAĆENJE (autoamputacija, autotomija, samosakaćenje, samoosakaći-


____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

vanje), otkinuće u slučaju opasnosti npr. repa kod daždevnjaka ili guštera. Rep se odvaja na posebnome mjestu. Novi rep kod gušterice se brzo obnovi i naraste, ali umjesto kralješaka podupire ga hrskavica. SAPROFAGI, organizmi koje ubrajamo u skupinu heterotrofa. Hrane se usitnjenim, djelomično razgrađenim i uginulim biljnim dijelovima ili životinjskim izmetom ili životinjskim lešinama. Posebno važni saprofagi su heterotrofne bakterije koje razlažu organske tvari do anorganskih sastojaka: vode, ugljikovog dioksida i mineralnih tvari. Te tvari mogu iskoristiti zelene biljke u procesu fotosinteze. Zbog te svoje uloge heterotrofne bakterije nazivamo i razlagači (reducenti). SAPROFITI, organizmi koji žive na uginulim organizmima, hraneći se organskim tvarima u raspadanju (npr. gljive). SARKOLEMA, ovojnica mišićnog vlakna v. poprečnoprugasti mišić. SCHLEIDEN, M. J. (1804. – 1881.), njemački botaničar koji je 1838. god. utvrdio da su stanice osnovne strukturne jedinice svih biljaka. Zajedno s njemačkim zoologom Schwannom utemeljitelj je tzv. “stanične teorije”. SCHULTZ, M. 60 - ih god. 19. stoljeća opisuje stanicu kao nakupinu protoplazme s jezgrom, a protoplazmu naziva fizičkim temeljem života. SCHWANN, T. (1810. – 1882.), njemački zoolog koji je 1839. god. utvrdio da su stanice osnovni građevni elementi svih životinja. Zajedno s njemačkim botaničarem Schleidenom utemeljio tzv. “staničnu teoriju”. SCROTUM, v. mošnja. SEDIMENTACIJA, v. brzina sedimentacije.

SEDRA, v. sedrene barijere. SEDRENE BARIJERE, barijere u vodotocima nastale vrlo složenim procesom koji završava taloženjem otopljenog vapnenca na mahovine sedrotvorce. S vodom najprije reagira ugljikov dioksid nastao disanjem organizama u vodi pri čemu nastaje ugljična kiselina: CO2 + H2O → H2CO3 Ugljična kiselina otapa vapnenac dajući topljivi kalcijev hidrogenkarbonat: H2CO3 + CaCO3 → Ca(HCO3)2 Cijanobakterije iz bikarbonata otopljenih u vodi uzimaju CO2, a, uz vodu, nastali CaCO3 talože na površini mahovina koje odumiru i na koje se slažu nove što uzrokuje “rast” barijera: Ca(HCO3)2 → H2O + CO2 + CaCO3 SEIZMONASTIJE, v. nastije. SEKUNDARNA IMUNOLOŠKA REAKCIJA, v. imuna memorija. SEKUNDARNA ORGANSKA PROIZVODNJA (sekundarna bioproizvodnja), proces proizvodnje organskih tvari heterotrofnih organizama, odnosno rast, povećanje mase i volumena tijela te razmnožavanje heterotrofnih organizama. Najznačajniji heterotrofi koji ostvaruju sekundarnu organsku produkciju su životinje. SEKUNDARNI RAST, povećanje promjera stabljike i korijena mnogih biljaka (posebice drvenastih trajnica) kao rezultat diobe stanica bočnih meristema. SELEKCIJA, v. prirodni odabir. SELEKCIJSKI PRITISAK, v. prirodni odabir. SELIDBA (migracija) RIBA, oblik ponašanja riba. Uzroci putovanja riba na druga mjesta su sezonske promjene u temperaturi, slanoći i količini hrane ili mriještenje.


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

SERIN, kemijski spoj iz skupine aminokiselina.

zbog različitog ponašanja ili različitog sazrijevanja gonada. Isp. specijacija.

SEROZA, kod amniota treća zaštitna zametna ovojnica.

SINANTROPUS, v. kineski pračovjek.

SESILNI ORGANIZMI, sjedilački, slabo pokretni organizmi, isp. zrakasta simetrija i bentos. SIDA, v. AIDS. SIFILIS (lues), spolna zarazna bolest čiji je uzročnik bakterija spiroheta. U ranim stadijima bolest je izlječiva, a neliječeni sifilis uzrokuje teška oštećenja gotovo svih organa i na kraju smrt.

SINAPSA (grč. synapsis = sveza), mjesto prijenosa živčanog podražaja (impulsa) s aksona na drugu živčanu stanicu, žljezdanu stanicu ili mišić, v. živčano - mišićna veza. Preko sinapse se prenosi impuls samo u jednom smjeru. Kroz sinaptičku pukotinu impuls prenose kemijski prijenosnici (neurotransmiteri) tj. neurohormoni, isp. Prema djelovanju sinapsi na neuron, razlikujemo pobuđivačke (eksitacijske) i potiskivačke (inhibicijske) sinapse.

SIMBIOGENEZA, udruživanje pojedinih prokariotskih organizama. Primjer simbiogeneze jednostaničnih alga i gljiva je lišaj. Smatra se da je prva biljna stanica nastala simbiogenezom: modrozelene alge (plastid), protobakterije (mitohondrij), mikoplazmodija (citoplazma), pravirusa (jezgra) i zavojite bakterije tipa današnje spirohete (bič).

SINDROM, skupina različitih znakova (simptoma) bolesti koji se javljaju zajedno.

SIMBIOZA (potpomaganje), odnos između dviju ili više jedinki različitih vrsta iz kojega te jedinke imaju korist, npr. neke alge i gljive žive u simbiozi u obliku lišaja, rak samac živi u simbiozi s moruzgvom (tzv. mutualizam) itd. Odnos u kojem jedna vrsta ima koristi, a druga nema niti koristi niti štete, kao npr. bršljan ili slak, nazivamo komenzalizam.

SINTEZA PROTEINA (sinteza bjelančevina), proces koji se odvija na ribosomima u citoplazmi stanice u kojem se iz aminokiselina sintetiziraju proteini. Ovim procesom upravlja molekula DNA uz posredovanje nekoliko vrsta RNA (mRNA, tRNA, rRNA). DNA koja se nalazi u jezgri (genska DNA) u redoslijedu svojih nukleotida, odnosno dušičnih baza sadrži uputu za sintezu nekog proteina. Jedinice takve upute čine grupe od po tri dušične baze, tzv. trojke ili tripleti. Svaka trojka je šifra za jednu određenu aminokiselinu. Početna etapa u procesu sinteze proteina je transkripcija ili prepisivanje, a odvija se u jezgri gdje se genska uputa prepisuje s DNA na glasničku RNK (mRNA). Pri prepisivanju se sintetizira lanac mRNA po principu komplementarnosti. Svaki triplet prepisan s DNA na mRNA zove se kodon i

SIMPATIKUS, dio autonomnog ili vegetativnog živčanog sustava čija živčana vlakna nadziru rad većine unutarnjih organa povećavajući ili smanjujući aktivnost tih organa. Djelovanje simpatikusa je suprotno djelovanju parasimpatikusa. SIMPATRIJSKA SPECIJACIJA, specijacija kada se populacije nalaze na istom prostoru, ali su reproduktivno izolirane


SINGER, S.J. i NICOLSON, G.L., znanstvenici koji su 1972. god. razradili i danas prihvatljiv model membrane koji se zove “model tekućeg mozaika”, isp. SINTEZA BJELANČEVINA, v. sinteza proteina.

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

odgovara pojedinoj vrsti aminokiseline. mRNA s preuzetom uputom odlazi iz jezgre u citoplazmu i veže se za ribosom. Time započinje druga etapa sinteze proteina koja se zove translacija ili prevođenje zato jer se kodoni na mRNA prevode u točno određene aminokiseline. U procesu translacije veliko značenje imaju molekule transportne ili prijenosne RNK (tRNA) koje na sebe vežu po jednu aminokiselinu i donose je na ribosom. Svaka tRNA ima posebnu trojku baza, tzv. antikodon preko kojega se veže na odgovarajući kodon na mRNA. Tako će se npr. na kodon UAU vezati tRNA s antikodonom AUA i donijeti aminokiselinu triptofan. Molekule aminokiselina vežu se u molekulu proteina tako da se mRNA pomiče na površini ribosoma i prima redom molekule tRNA koje donose sa sobom aminokiseline. Sinteza određenog proteina završava kada mRNA donosi kodon koji ne odgovara niti jednoj vrsti aminokiseline. Postoje tri takva kodona: UAA, UGA i UAG. SISAVCI (Mammalia, lat. mamma = sisa, dojka), zadnja (i najrazvijenija) skupina kralježnjaka koji su se razvili u životinjskom svijetu biosfere. Tijelo sisavaca je pokriveno dlakom koja ih štiti od gubitka topline. Toplokrvni su organizmi. Zameci se razvijaju u maternici obavijeni posteljicom (placentom). Nakon rođenja mladi sišu majčino mlijeko. To je svojstveno samo sisavcima, kao i mliječne žlijezde koje su zapravo promijenjene kožne žlijezde. Kostur i mišići prilagođeni su četveronožnom, rijetko dvonožnom, kretanju. Udovi su ispod tijela i mogu se okretati. Prednji dio mozga ili veliki mozak dobro je razvijen i na površini ima sivu koru. Raznolikom funkcionalnom građom svih organskih sustava prilagodili su se najrazličitijim načinima života i preživljavanju u svim mogućim staništima. Tako sisavci imaju prilagodbe na toplinu i hladnoću (v.

linjanje i zimski san). Da bi održali stalnu tjelesnu temperaturu moraju imati brz metabolizam tj. moraju mnogo jesti i potrebna je velika izmjena O2 i CO2. Čeljusti i zubi im omogućavaju da žvaču hranu. Resice u tankom crijevu povećavaju probavnu površinu. Površina pluća se povećala velikim brojem plućnih alveola. Kisik se veže za dišni (krvni) pigment hemoglobin. Srce je podijeljeno na lijevu i desnu stranu, pa se venska i arterijska krv ne miješaju. Za izlučivanje mokraće, sisavci imaju pravi bubreg, tj. treći bubreg, isp. Sisavci su se razvili od skupina mezozojskih prasisavaca. Preci pravih sisavaca bili su prakukcojedi. Danas u biosferi živi oko 4500 vrsta sisavaca, od čega 109 vrsta u našoj zemlji. Prema raznolikosti tjelesne građe dijele se na: jednootvore (kljunaše), tobolčare i prave sisavce (plodvaši ili placentalni sisavci). SISTEMATIKA (sustavoslovlje, taksonomija), znanost koja se bavi svrstavanjem živih bića u određene sustave koji se temelje na srodstvenim odnosima, odnosno razvrstavanje živih bića u filogenetski prirodni sustav. SISTEMATSKE JEDINICE, v. filogenetski sustav. SISTEMSKI OPTOK KRVI, v. veliki optok krvi. SISTOLA (grč. systole = stezanje), kontrakcija ili stezanje srčanog mišića (klijetke ili pretklijetke). SISTOLIČKI TLAK, tlak krvi na stijenke arterija u trenutku kada stezanjem (sistolom) srčanog mišića uđe u aortu nov (udarni) volumen krvi. Taj tlak se prenosi kroz velike i male arterije do arteriola i kapilara. SITASTE CIJEVI, provodni elementi u većine biljaka. One služe za provođenje asimilata (produkata fotosinteze).


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

SJEDILAČKI ORGANIZMI, v. bentos. SJEMENI ZAMETAK, organ svojstven sjemenjačama. U golosjemenjača leži otvoreno na plodnim listovima, a u kritosjemenjača je "sakriven" u plodnici tučka. Homologan je makrosporangiju (megasporangiju, ženskom sporangiju). U njemu se nalazi makrospora (megaspora, embrionska vreća, ženski gametofit) nastala tijekom makrosporogeneze i sastoji se od osam stanica. Jajna se stanica, s dvije pomoćnice (sinergide), nalazi na jednom polu, a na drugom su tri stanice: antipode. U sredini su dvije središnje stanice embrionske vreće, isp. tučak. SJEMENICI (testisi), muške spolne žlijezde koje su u čovjeka smještene u kožnim vrećicama, mošnjama. Iznutra su ispunjeni stanicama i sjemenim kanalićima. U sjemenim kanalićima odvija se spermatogeneza. Specijalizirane stanice sjemenika, tzv. intersticijske stanice izlučuju muške spolne hormone. SJEMENKA, biljni organ koji služi rasprostranjenju nove generacije biljaka. Sjemenka se razvija iz sjemenog zametka, a sastoji se od sjemene lupine, klice (embria) i hranjivog staničja (endosperma). U obliku sjemenke biljka se nalazi u pritajnom (latentnom) stanju. U povoljnim uvjetima (vlaga, temperatura, zrak) sjemenka će proklijati i razvit će se mlada biljka. Sve biljke koje stvaraju sjemenke nazivamo sjemenjače. SJEMENOVOD (ductus deferens), dio muškog spolnog sustava, odvodni kanal koji provodi muške spolne stanice, spermije od spolnih žlijezda do mokraćne cijevi. U čovjeka su sjemenovodi parni organi. SJEMENJAČE, najopsežnija skupina kopnenih biljaka. Imaju sjemeni zametak unutar kojeg se razvija ženski gametofit (embrionska vreća). Tu se zbiva i oplod-


nja. Od sjemenog zametka razvija se sjemenka. Prema smještaju sjemenih zametaka sjemenjače se dijele u dvije velike skupine: golosjemenjače i kritosjemenjače. SKLERENHIM, v. potporno staničje. SKLEROCIJ, v. ražova gljivica. SLEZENA, krvotvorni organ smješten ispod lijevog svoda ošita. U slezenu se pružaju vezivni tračci između kojih se smjestilo specifično tkivo slezene - pulpa. Razlikujemo crvenu i bijelu pulpu. Crvena pulpa je mješano krvotvorno tkivo gdje se stvaraju eritrociti, granulociti, monociti i plazma stanice. Bijela pulpa su nakupine manjih limfnih čvorića (folikula) u samoj slezeni. U sredini svakog čvorića nalazi se središnja arterija kroz koju odlaze u optok krvi nastali limfociti. Slezena nije uključena u limfni optok, nego samo u krvni. SLONOVI, najveći kopneni sisavci. Hrane se biljkama, a hranu skupljaju pomoću dugačke mišićave surle ili rila. Surla je preobražen nos i gornja usna. Kljove su izmijenjeni sjekutići. Očnjaka nemaju. Na nogama imaju tri (afrički slon) ili četiri prsta (azijski slon) koji završavaju kopitastim noktom. Slonovi pripadaju skupini polukopitara. SLUZAVCI, v. korjenonošci. SLUZNJAČE, najprimitivnije gljive, različite od ostalih vrsta gljiva. U vegetativnoj fazi više se osobinama podudaraju sa životinjama (praživotinjama) – nemaju staničnu stijenku time ni stalan oblik, kreću se plaženjem, ameboidno. Prehranom su većinom saprofiti, ali ima ih i koje se se hrane poput životinja – uzimaju i probavljaju komadiće čvrste hrane. U vrijeme razmnožavanja pokazuju sličnosti s biljkama. Njihove su spore s bičevima (zoospore) i čvrstom stijenkom od proteinskih tvari ili celuloze, nikada od hitina. Sporangiji se razvijaju u obliku plodišta.

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

SLJEPOĆA NA BOJE (daltonizam), nesposobnost raspoznavanja boja koja se nasljeđuje kao spolno vezano svojstvo. Geni koji su odgovorni za to svojstvo nalaze se u x spolnom kromosomu. Većinom se pojavljuje u muškaraca, a u žena samo ako se gen za sljepoću boja (gen cb) nalazi u oba x kromosoma. SLJEPULJE, v. kružnouste. SMEĐE ALGE, višestanični organizmi koji pretežito žive u moru. Kloroplasti im, uz klorofil a i b, sadrže i druge boje, posebno smeđi fukoksantin. Produkti sinteze su različiti, ali nikada škrob. Razmnožavaju se vegetativno, spolno i nespolno. Predstavnik je jadranski bračić (Fucus virsoides). Neke se smeđe alge koriste kao hrana i začini naročito zato jer obiluju vitaminima A, B i C. Neke sadrže sluzavu tvar algin (alginske kiseline) koja se primjenjuje u tekstilnoj, papirnoj, prehrambenoj i drugim industrijama. SMOLENICE, v. žljezdano staničje. SMRČCI (Morchella), gljive mješinarke s razvijenim plodištem, jestive. SOJ, jedinstvena vrsta biljaka i nižih organizama. SOL-stanje, tekući oblik koloidnih otopina. SOMATOGAMIJA, stapanje vršaka ženskih (+) i muških (–) primarnih hifa u sekundarnu hifu kod razmnožavanja stapčarki. SOMATOTROPNI HORMON, v. hormon rasta. SOMATSKA STANICA, v. tjelesna stanica. SOMATSKE MUTACIJE, v. mutacije. SOMATSKE VARIJACIJE, v. modifikacije.

SOMATSKI ŽIVČANI SUSTAV, v. tjelesni živčani sustav. SOREDIJ, tjelešce u lišaja koje sadrži jednu kuglastu stanicu alge obavijenu kratkom hifom odgovarajuće gljive. SORTA, v. svojta. SORUS, nakupina sporangija s donje strane lista paprati. SPECIFIČNA PROTUTIJELA, isto što i antitijela. SPECIJACIJA, evolucijski proces nastajanja novih vrsta. Specijacija se brže odvija u dobro odijeljenim područjima, isp. izolacija. Poznate su alopatrijska, simpatrijska i parapatrijska specijacija. SPECIJALIZIRANE FUNKCIJE STANICA, određene funkcije koje obavljaju stanice višestaničnih organizama koje su srodne po svojoj građi te formiranju tkiva. Takve stanice, osim uobičajenih staničnih struktura (jezgre, membrana, mitohondrija, ribosoma, lizosoma i sl.) sadrže i specifične strukture koje određuju njihovu funkciju. Na primjer, mišićne niti u mišićnoj stanici omogućuju kontrakcije, klorofil u biljnim stanicama omogućuje fotosintezu itd. SPECIJALNA ADAPTACIJA (prilagodba), skup osobina koje se razvijaju u određenim uvjetima. Npr. zakržljale oči kod životinja koje žive u tami. SPERMA, sjemena tekućina koju izlučuju muški spolni organi. Sastoji se od spermija i sekreta prostate i drugih žlijezda. Sekreti sadržavaju fruktozu, pojedine aminokiseline i enzime, te tako prehranjuju spermije. Prosječno se u tijeku spolnog akta muškarca izluči oko 3 mL sperme. U svakom mililitru ima oko 120 milijuna spermija; ukupno oko 360 milijuna.


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

SPERMATIDE, stanice koje nastaju u procesu spermatogeneze (isp.).

ko kojeg se potpuno pretoči sadržaj stanice jedne u stanicu druge niti.

SPERMATOCITE, v. spermatogeneza.

SPOJEVI, čiste kemijske tvari izgrađene od dva ili više različitih, međusobno spojenih kemijskih elemenata.

SPERMATOGENEZA, proces nastajanja muških spolnih stanica, spermija, u sjemenim kanalićima muških spolnih žlijezda, sjemenika. U sjemenicima iz zrelih zametnih stanica, spermatogonija mitotičkim diobama nastaju velike stanice, primarne spermatocite (spermatocite I). One sadrže diploidan broj kromosoma i iz njih će nakon mejoze I (prve mejotičke diobe) nastati sekundarne spermatocite (spermatocite II) s haploidnim brojem kromosoma. Iz svake spermatocite II u mejozi II (drugoj mejotičkoj diobi) nastaju po dvije spermatide iz kojih će postupnim izduživanjem nastati zreli spermiji. Znači, iz svake primarne spermatocite, procesom spermatogeneze, nastaju četiri zrela spermija. SPERMATOGONIJE, nezrele zametne stanice u sjemeniku iz kojih tijekom spermatogeneze nastaju spermiji. SPERMIJI, muške spolne stanice, gamete koje nastaju u sjemenicima tijekom spermatogeneze. Spermiji čovjeka su vrlo male stanice čiji su glavni dijelovi glava i rep. Glava sadrži jezgru s 23 kromosoma, a na njenom vršnom dijelu nalazi se vršno tjelešce, akrosom koji sadrži enzime koji omogućuju prodor spermija u jajašce. Repni dio je vrlo dug i omogućuje aktivno kretanje spermija. Prednji dio repa sadrži brojne mitohondrije u kojima se oslobađa energija potrebna za pokretanje spermija. SPIKULE, v. spužve. SPIRILI, v. bakterije. SPIROGIRA (Spirogyra), nitasta zelena alga. Sklone su konjugaciji, izmjeni genetičkog materijala do kojeg dolazi kada se po dvije stanice susjednih niti spoje kanalićem, tzv. citoplazmatskim mostićem pre-


SPOLNA GENERACIJA, v. haploidna generacija. SPOLNA ODREĐENOST POTOMAKA, ovisi o tome koji spolni kromosom donosi spermij pri oplodnji. U mnogih životinja i u čovjeka nastaju dvije vrste spermija: jedna vrsta nosi x spolni kromosom, a druga vrsta y spolni kromosom. Spajanjem jajne stanice sa spermijem koji nosi x spolni kromosom nastaje potomak ženskog spola, a spajanjem jajne stanice sa spermijem koji nosi y spolni kromosom nastaje potomak muškog spola. SPOLNI HORMONI, hormoni koji utječu na razvoj spolnih obilježja. Uglavnom ih izlučuju spolne žlijezde (sjemenici, jajnici), a neke, tzv. androgene, izlučuje kora nadbubrežne žlijezde. Po svom kemijskom sastavu spolni hormoni su steroidi. Sintezu i lučenje spolnih hormona stimuliraju gonadotropni hormoni. SPOLNI UD (penis), mišićno, spužvasto, cjevasto tijelo dobro opskrbljeno krvnim žilama i živcima. Kroz ud prolazi mokraćna cijev koja izvodi mokraću i spermu. Najbitniji dijelovi za funkciju penisa su tri spužvasta tijela, građena od brojnih šupljina, koje kada se napune krvlju iz arterija služe za ukrućenje (erekciju) što omogućavae unošenje sjemena u rodnicu. SPOLNO RAZMNOŽAVANJE, stapanje spolnih rasplodnih stanica, gameta što dovodi do rekombinacije gena. SPOLNO SAZRIJEVANJE, v. pubertet. SPOLNO VEZANA SVOJSTVA, svojstva vezana za spolne kromosome, npr. u

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

čovjeka, nasljedna nesposobnost grušanja krvi (hemofilija), nemogućnost raspoznavanja boja (daltonizam) itd. Geni koji određuju ta svojstva smješteni su u x spolnom kromosomu i zovemo ih spolno vezani geni. SPOLNO VEZANO NASLJEĐIVANJE, nasljeđivanje pojedinih svojstava čiji su geni smješteni u x spolnom kromosomu. U čovjeka su takva svojstva daltonizam, hemofilija itd. a ona se zbog svoje recesivnosti ispoljavaju kod muških potomaka, dok su žene većinom samo prenositelji gena za ta svojstva. U primjerima praćenja spolno vezanog nasljeđivanja, gen za recesivno svojstvo daltonizam može se označavati malim slovom (a ili d) ili x, a slično se označuje i gen za hemofiliju (h) ili x. Pravila spolno vezanog nasljeđivanja mogu se izvesti iz slijedećih primjera: 1.




Iz odnosa muškarca oboljelog od hemofilije i zdrave žene rađaju se zdrava muška djeca dok su ženska djeca prenositelji. (V. shemu u Dodatku 1.) Iz odnosa zdravog muškarca i žene prenositelja dobiva se potomstvo u kojem je 50 % muške djece oboljelo od hemofilije, a 50 % ženske su prenositelji. Ostalih 50 % muške i 50 % ženske djece je zdravo. (v. shemu u Dodatku 1) Iz odnosa muškarca oboljelog od hemofilije i žene prenositelja dobiva se potomstvo u kojem će 50 % muške djece oboljeti od hemofilije, a 50 % bit će zdravo, dok će 50 % ženske djece oboljeti od hemofilije, a 50 % bit će prenositelji. (V. shemu u Dodatku 1.) Iz odnosa zdravog muškarca i žene oboljele od hemofilije sva ženska djeca bit će prenositelji, a sva muška


djeca će oboljeti od hemofilije. (V. shemu u Dodatku 1) Iz odnosa muškarca oboljelog od hemofilije i žene oboljele od hemofilije sva će djeca oboljeti od hemofilije. (V. shemu u Dodatku 1.)

SPONGIN, v. spužve. SPONGOCEL, šupljina u tijelu spužve, v. spužve. SPONTANE MUTACIJE, v. mutacije. SPORANGIJ, v. spore. SPORE, nespolne rasplodne stanice biljaka. Nastaju u posebnim organima – sporangijima. Iz spora se u povoljnim uvjetima razvijaju nove biljke. SPOROFIT, nespolna generacija u biljaka u kojoj nastaju nespolne rasplodne stanice, spore. Evolucijom biljnog svijeta jače se razvija sporofit u odnosu na spolnu generaciju, gametofit. Tako je kod papratnjača i sjemenjača sama biljka sporofit dok je gametofit veoma reduciran. Isp. haploidna generacija. SPOSOBNOST SAMOUMNOŽAVANJA, isp. DNA i RNA. SPUŽVE (Spongia), najprimitivnije mnogostanične životinje. Žive u morima, a samo mali broj vrsta u kopnenim vodama sjedilačkim načinom života. Nemaju izgrađena tkiva. Stijenka tijela sastoji se od tri sloja stanica. U unutarnjosti je šupljina spongocel obložena bičastim stanicama ili hoanocitama. U spongocel voda s hranom (npr. bakterijama, algama i sitnim životinjama) i kisikom ulazi kroz mnogobrojne sitne otvore na površini tijela. Neprobavljeni ostaci izlaze kroz najveći otvor ili oskulum. Skelet izgrađuju vapnene ili kremene iglice (spikule) ili pak elastične bjelančevinaste niti spongina. Spužve su


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

većinom dvospolci (hermafroditi). Razmnožavaju se nespolno pupanjem i spolno. Nespolni pup se naziva gemula. Spolne stanice spermiji i jaja nastaju od tzv. ameboidnih stanica i hoanocita. Oplođuju se unutar tijela spužve iz kojeg izlazi trepetljikava ličinka parenhimula koja se pričvrščuje za dno i izraste u spužvu. Spužve imaju sposobnost regeneracije. Danas je poznato oko 5000 vrsta. Zoolozi smatraju da su se spužve razvile iz zadružnih bičaša, isp. hipoteze o postanku metazoa. SRCE, šuplji mišićni organ koji kod čovjeka teži oko 300 g. Smješteno je u sredini prsne šupljine između dva plućna krila u osrčju ili perikardu. Osrčje štiti od neposrednog pritiska na srce ili od trenja plućnih krila pri disanju. Između srca i stijenki perikarda nalazi se tekućina. Po dužini podijeljeno je na lijevo (arterijsko) i desno (vensko) srce. Svaki taj dio podijeljen je poprečno, pa srce ima dvije pretklijetke (atriji) i dvije klijetke (ventrikuli). Između lijeve pretklijetke i klijetke nalaze se mitralni ili bikuspidalni zalisci, a između desne pretklijetke i klijetke trikuspidalni zalisci. Vraćanje krvi iz aorte ili plućne arterije u srce nakon sistole sprječavaju semilunarni (polumjesečasti) zalisci. SRČANI MIŠIĆ, v. poprečnoprugasti mišić. SRDOBOLJNA AMEBA, praživotinja iz skupine korjenonošci, nametnik u debelom crijevu čovjeka. Dok se hrani crijevnim bakterijama, nije opasna. Kada se poremeti rad debelog crijeva (drugim zarazama, uzimanjem droge, alkohola, pušenjem itd.) počinje se hraniti eritrocitima iz sluznice crijeva te uzrokuje patogene promjene. Čovjek se zarazi zaraženom hranom ili vodom. SREDIŠNJI (centralni) ŽIVČANI SUSTAV, obrađuje i pohranjuje primljene in-


formacije te upravlja brojnim tjelesnim voljnim i autonomnim radnjama. Čine ga: veliki mozak (cerebrum), mali mozak (cerebellum), produžena moždina (medulla oblongata) i leđna moždina (medulla spinalis). SREDIŠTE AUTOMACIJE RADA SRCA, u srcu se nalaze središta koja upravljaju radom srca. To su: primarno središte automacije srca - atrijski ili sinus-atrijski (S - A) čvor (nalazi se u desnoj pretklijetki i predvodnik je rada srca) te sekundarno središte automacije srca ili atrio – ventrikularni (A - V) čvor (nalazi se na granici između pretklijetki i klijetki). SREDNJE UHO, mala šupljina između bubnjića i unutarnjeg uha, premoštena sa tri slušne košćice: čekić (malleus), nakovanj (incus), stremen (stapes). Srednje uho je povezano s gornjim dijelom ždrijela Eustahijevom cijevi. Služi za izjednačivanje tlaka zraka u srednjem uhu s vanjskim tlakom. SRPASTA ANEMIJA (anemija srpastih stanica), nasljedna je bolest uzrokovana sintezom nenormalnog hemoglobina HbS. Eritrociti su u obliku srpa i imaju smanjenu sposobnost prijenosa kisika. Bolest je neizlječiva. STABLAŠICE (više biljke, kopnene biljke), biljna skupina prilagođena životu na kopnu. Razlikujemo tri temeljna, vegetativna organa, tri dijela njihovih tijela: korijen, stabljiku i list. Stabljika i list nazivaju se jednim imenom izdanak, u njemu se odigrava fotosinteza. Korijen služi za učvršćivanje biljke i upijanje vode i otopljenih minerala. Postoje i generativni organi koji isključivo služe razmnožavanju. U biljaka postoje i provodni organi, žile koje služe za provođenje minerala, hranjivih tvari i kao potporno tkivo jer imaju lignizirane stanične stijenke; postoji kožno staničje prekriveno voštanom pre-

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

vlakom (kutikulom) koja štiti biljku od isušivanja; postoje otvori, puči za izmjenu plinova. Stablašice su se razvile iz pradavnih zelenih alga, a mogu se podijeliti na tri velike skupine, tri odjeljka: mahovine, papratnjače i sjemenjače. STABLJIKA, jedan od tri temeljna organa kopnenih biljaka, a razvija se iz klicinog pupoljka. Ona je os izdanka, nosi listove i druge organe koji su se razvili bilo preobrazbom stabljike bilo preobrazbom listova, npr. cvjetove i plodove. Na vrhu stabljike i bočnih ogranaka nalazi se vršni pup s tvornim staničjem za produžni rast. Stabljika može biti zeljasta ili drvenasta. Drvo ili stablo je oblik višegodišnje drvenaste stabljike s nerazgranatim dijelom deblom i razgranatim, krošnjom. Preobrazbe stabljike: podzemne stabljike su podanak ili rizoma (npr. u perunike i paprati), lukovica (u sunovrata) i gomolj (krumpir); sprermišni organi (u korabice); trnovi; vitice; stapke; filokadije itd. STAFILOKOKI, v. bakterije. STANICA, temeljna građevna i funkcionalna jedinica svakog živog bića (organizma). Sva živa bića, s obzirom na složenost građe njihovih stanica, možemo podijeliti na prokariote i eukariote. Najjednostavniji jednostnanični organizmi su prokarioti čije stanice ne sadrže oblikovanu jezgru ni druge stanične strukture obavijene membranama. Ostale jednostanične organizme i višestanične organizme, bilo biljne ili životinjske, izgrađuju eukariotske stanice. Tipične eukariotske stanice sadrže jezgru obavijenu ovojnicom koja ima mnogobrojne pore kroz koje se izmjenjuju tvari između jezgre i citoplazme. U citoplazmi tipične eukariotske stanice nalaze se različite stanične strukture: endoplaz-

matska mrežica, Golgijevo tijelo, lizosomi, mitohondriji i mikrotubuli. Osim tih struktura koje se nalaze gotovo u svim eukariotskim biljnim i životinjskim stanicama postoje i strukture karakteristične samo za biljnu, odnosno životinjsku stanicu. Tako, biljne stanice sadrže staničnu stijenku, kloroplaste i druge plastide što ne nalazimo u životinjskih stanica. Većina životinjskih stanica sadrži centriole koji se još nalaze samo u stanicama nekih algi. Zelena biljna stanica je autotrofna za razliku od heterotrofne životinjske stanice. Osnovne razlike između biljnih i životinjskih stanica Biljne stanice

Životinjske stanice

Obavijene su celuloznom stijenkom.

Nemaju celulozne stijenke.

Imaju velike vakuole ispunjene staničnim sokom.

Kada su i prisutne, vakuole su male.

Velike stanice određenog oblika.

Male stanice nepravilna oblika.

Sadrže kloroplaste (klorofil).

Bez kloroplasta (klorofila) su.

Obavljaju fotosintezu pa su time autotrofne.

Moraju dobiti hranu izvana pa su heterotrofne.

STANICE ZAPORNICE, specijalizirane epidermske stanice lista koje okružuju otvor puči, isp. STANIČNA IMUNOST, oblik stečene imunosti u kojoj organizam nakon podražaja antigenom stvara veliki broj aktivira-


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

nih limfocita T koji specifično uništavaju antigen. STANIČNA JEZGRA, v. jezgra. STANIČNA MEMBRANA, tanka ovojnica (7 do 10 nm) koja obavija stanicu. Građena je od proteina i lipida pa se naziva još i lipoproteinska ovojnica. Stanična membrana je selektivno propusna što znači da ne propušta sve tvari jednako, već vrši selekciju: neke tvari propušta lako, neke teže, a za neke je nepropusna. STANIČNA STIJENKA, Stanična tvorevina koja obavija većinu biljnih stanica i daje im oblik i čvrstoću. Najvažnija tvar stijenke je celuloza, a samo u gljiva celuloza je nadomještena hitinom. STANIČNA TEKUĆINA je tekućina unutar stanice. U ljudskom tijelu je ima oko 25 litara. Glavni sastojci stanične tekućine su voda, kalijev kation (K+) te hidrogen karbonatni ( HCO 3− ) i sulfatni ( SO 24− ) anion. Ljudska stanična tekućina ima pH 7.0. STANIČNA TEORIJA, teorija po kojoj sva živa bića imaju staničnu građu. Utemeljitelji ove teorije su njemački znanstvenici, botaničar M. Schleiden i zoolog T. Schwann. Značenje ove teorije je u tome što ukazuje na jedinstvo građe živih bića i na njihovo zajedničko podrijetlo.

reakcije u stanici možemo podijeliti u dvije skupine: procesi izgradnje (anabolizam) i procesi razgradnje (katabolizam). STANIČNI ORGANELI, specifično građene strukture unutar stanice koje su obavijene membranom i obavljaju određenu funkciju. Stanični organeli su jezgra, mitohondrij, endoplazmatska mrežica, Golgijevo tijelo, plastidi. Postoje i manje strukture unutar stanice koje također vrše važne funkcije npr. ribosomi, jezgrice, kromosomi, centrioli, ali kako nisu obavijeni membranom ne smatramo ih organelima u užem smislu. STANIČNO DISANJE, v. disanje. STANIČNO FRAKCIONIRANJE, rastavljanje stanica na sastavne dijelove. To je postupak izdvajanja pojedinih staničnih organela ili još manjih dijelova stanice u zasebne homogene frakcije da bi se bolje upoznala njihova fiziološka uloga i biokemijski sastav. Najprije se stanice kidaju gnječenjem tkiva u tarioniku, protiskivanjem stanica kroz uski prostor određenih dimenzija, rezanjem vrtećim noževima ili ultrazvučnim vibracijama. Zatim se tako dobivena stanična kaša centrifugira. Centrifugiranjem se pojedini stanični dijelovi razdvajaju na osnovi razlika u brzini njihova taloženja. STANIŠTE (biotop, grč. bios = život, topos = mjesto), prostor sa svim životnim uvjetima (svjetlo, ugljik(IV)-oksid, voda, mineralne tvari itd.) u kojem živi populacija jedne vrste.

STANIČNI CIKLUS, životni ciklus stanice koji se sastoji od dva razdoblja interfaze (razdoblje između dvije stanične diobe) i mitoze (diobe stanice). Stanični ciklus započinje od trenutka kada ta stanica nastaje diobom i traje sve dok se i ona sama ne podijeli na dvije nove stanice.

STANLEY, W.M., (1904.-1971.) američki znanstvenik koji je prvi izdvojio virus u čistom stanju. To je bio virus mozaične bolesti duhana.

STANIČNI METABOLIZAM, skup svih kemijskih reakcija u stanici odnosno izmjena tvari i energije u stanici. Kemijske

STAPČARKE, skupina od oko 30 000 vrsta gljiva u koje spadaju i sve one što ih u svakodnevnom govoru zovemo gljive. Plo-


____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

dišta su im najčešće oblika kišobrana ili klobuka na stručku. Uz različite druge spore, kariogamijom se razvijaju i posebne – bazidiospore i to po 4 na zajedničkoj stapci, bazidiju. Stapčarke imaju raznolike skupine, npr. snijeti, lističarke (pečurka, zelena pupavka), rupičarke (vrganji), zupčarke (prosenjak), puhare itd. Šumske gljive žive u mikorizi s drvećem. STARENJE, sve promjene koje nastaju u odrasloj dobi kada se nepovratno mijenja građa i funkcija stanica, tkiva i organa, a s vremenom nastupa i smrt. Postoji niz pretpostavki o uzrocima starenja, a najvažniji su fiziološki i patološki. U stanicama se zbiva niz fizioloških promjena, npr. gubitak vode zbog čega se mijenjaju bjelančevine u citoplazmi, nakupljanje štetnih tvari, oštećenja membrana lizosoma, smanjenje regeneracijskih sposobnosti oštećenih stanica itd. Patološki razlozi starenja posljedica su težih oštećenja pojedinih organa. Starenje i umiranje nekih stanica započinje zapravo odmah nakon začeća i traje sve do smrti iako se najčešće pod starenjem podrazumijevaju procesi koji nastaju nakon pedesete godine. STAROČELJUSKE (bezgrebenke), velike kopnene ptice koje ne mogu letjeti jer im je prsna kost bez grebena. To su npr. afrički noj, južnoamerički nandu i australski emu. STATOCISTI, osjetila za ravnotežu kod nekih beskralježnjaka, npr. mekušaca i rakova. Kod mekušaca većinom se nalaze u stopalu. STEČENA IMUNOST (specifična), oblik otpornosti organizma koja nastaje nakon unosa antigena u organizam. Pokreće se imunološka reakcija. Nositelji te vrste imunosti su limfociti (B i T). Dva su osnovna oblika stečene imunološke reakcije, humoralna i stanična imunost. Specifična

imunost može biti stečena aktivno i pasivno, v. imunizacija. STELJKA (talus), biljno tijelo jednostavne građe na kojemu se ne razlikuju pojedini vegetativni organi (korijen, stabljika, list i cvijet). STELJNJAČE, niže biljke, talofiti, jednostanične ili všestanične. Jednostavne su građe, prvenstveno vodeni organizmi pa cijela njihova površina sudjeluje u primanju vode i izmjeni tvari. To objašnjava zašto steljnjače nemaju tijelo razlučeno u tkiva i organe. Obuhvaćaju različite organizme nazvane jednim imenom ALGE. STERILIZACIJA, izlaganje supstrata temperaturi iznad 100 oC i više pri čemu ugibaju ne samo bakterije već i njihove spore. STERKOBILIN B, v. eritrociti. STEROIDI, organski spojevi iz skupine lipida. U organizmu čovjeka poznati steroidi su spolni hormoni, hormoni kore nadbubrežne žlijezde i neki vitamini, npr. vitamin D. STEŽLJIVI MJEHURIĆI (kontraktilna vakuola), organeli u protoplazmi praživotinja pomoću kojih izbacuju suvišnu tekućinu iz tijela i na taj način održavaju osmotsku ravnotežu. To je značajno za praživotinje slatkih voda jer voda zbog osmotskog tlaka neprestano ulazi kroz membranu u tijelo i razrjeđuje koncentraciju anorganskih i organskih tvari u protoplazmi. Broj mjehurića može biti od jednog do nekoliko. STH, v. hormon rasta. STIGMA, v. uzdušnice i očna pjega. STOME, v. puči. STONOGE, jednostavno građeni uzdušnjaci iz skupine člankonožaca, isp. Na


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

kolutićima imaju 1 ili 2 para člankovitih nogu, ukupno i do 200 pari. Na glavi su ticala i jednostavne oči. Žive na vlažnim staništima. Poznate su strige i dvojenoge. STRATIGRAFSKA GEOLOGIJA (povijesna geologija), znanost koja proučava razvojni put Zemlje od postanka litosfere do danas. STREPTOKOKI, v. bakterije. STROBILA, v. trakavica. STROMATOLITI, tvorevine posebne građe u kojima se nalaze fosilizirane bakterije i cijanobakterije. STUPANJ OTROVNOSTI (toksicitet), količina otrova koja ubija 50 posto otrovanih jedinki. To je tzv. 50 %-tna letalna doza ili LD50. SUKCESIJE, procesi smjenjivanja čitavih biocenoza na nekom prostoru. SUKCESIVNA EVOLUCIJA (filetička, susljedna), postupno nakupljanje malih nasljednih promjena i novih svojstava organizama te postupan prijelaz jedne vrste u drugu. SUNAŠCE, v. korjenonošci. SUSLJEDNA EVOLUCIJA, v. sukcesivna evolucija. SVINJSKA TRAKAVICA, nametnik u crijevu čovjeka, (isp. trakavice). Čovjek se zarazi ako pojede njezinu ikricu s mesom zaražene svinje. Iz ikrice se razvije trakavica. Stražnji zreli članci s oplođenim jajnim stanicama se otkidaju i izlaze iz crijeva čovjeka. Ako te članke pojede svinja, u njezinu crijevu će se razviti ličinke koje se u mišićima začahure stvarajući ikricu. SVITAK (horda, chorda dorsalis), potporni savitljivi prutić sastavljen od vezivnog tkiva. Proteže se na leđnoj strani duž čita-


vog tijela iznad crijeva i ulazi u glavu. U embrionalnom razvitku razvija se iz endoderma. Plaštenjaci imaju svitak samo u stadiju ličinke, a svitkoglavci u svim stadijima razvitka. SVITKOGLAVCI (Cephalochordata), pripadaju bezlubanjcima iz koljena svitkovci. Najpoznatija skupina su kopljače. Žive u morima. Uvijek imaju svitak. Mišići, organi za izlučivanje i krvotok te škržne pukotine na ždrijelu imaju kolutićav raspored. Živčani je sustav cjevast i proteže se iznad svitka s leđne strane tijela. Kopljača je razdvojena spola. Oplodnja je vanjska. U Jadranskom moru živi zašiljena kopljača koja obitava u pijesku, a i pliva. U Tihom oceanu živi kalifornijaka kopljača. U Kini kopljača služi kao hrana. SVITKOVCI (Chordata), životinje koje na leđnoj strani (ispod živčanog sustava, a iznad crijeva) imaju svitak ili hordu, isp. Svitkovci su dvobočno simetrične životinje bez znakova vanjske kolutićavosti. Naseljavaju sva staništa u vodama i na kopnu. Danas živi oko 45000 vrsta. Svitkovcima pripadaju tri potkoljena: plaštenjaci, svitkoglavci i kralježnjaci. Plaštenjaci i svitkoglavci su bezlubanjci, a kralježnjaci su lubanjci. Preci svitkovaca su davni srodnici žiroglavaca ili polusvitkovaca, isp. Osnovna obilježja svih svitkovaca jesu, osim svitka, i škržne pukotine na prednjem dijelu probavila. Kod viših kralješnjaka postaju prave škrge ili pluća. Dalje, živčani sustav je s leđne strane trupa. U kralješnjaka se razvija u leđnu moždinu koja je smještena u kralješnici. Na prednjem dijelu leđne moždine razvija se mozak, u lubanjaca zaštićen hrskavičnom ili koštanom lubanjom. Optjecajni (krvožilni) sustav je zatvoren, sa srcem s trbušne strane. SVOJTA, filogenetske sustavske jedinice bez obzira na njihov stupanj. Svojte koji-

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

ma označujemo različite oblike nekih vrsta koje je čovjek postigao na umjetan način, tj. uzgojem su kultivar, sorta, klon i linija.

Š ŠARENICA (iris), v. bjeloočnica. ŠARLAH (scarlatina, škrlet), akutna zarazna bolest uzrokovana bakterijama (streptokokima). ŠEĆERI, v. ugljikohidrati. ŠEĆERNA BOLEST (dijabetes), bolest koja nastaje zbog smanjenja ili potpunog izostanka izlučivanja hormona inzulina beta stanicama Langerhansovih otočića u gušterači. Nedostatkom inzulina u krvi nastaje povećana razina šećera u krvi (hiperglikemija), a istovremeno nedostatak šećera za energetske potrebe u stanicama. Kod bolesnika s smanjenom proizvodnjom inzulina daju se lijekovi koji stimuliraju gušteraču na pojačano lučenje inzulina. Kod težeg oblika dijabetesa, tzv. inzulin ovisan dijabetes daju se injekcije inzulina. Bolesnici se moraju strogo držati ugljikohidratne dijete. Bolest se javlja u djece (juvenilni dijabetes) i u odraslih (adultni dijabetes). ŠEŠVA, v. boginje. ŠIŠMIŠI (netopiri), jedina skupina sisavaca koji mogu letjeti. Krila imaju letnu kožicu ili letnicu razapetu između dugačkih kosti prstiju. Kada se odmaraju, pričvrste se stražnjim nogama za stijenu i vise glavom prema dolje. Neki spavaju zimski san. Hrane se kukcima ili malim kralježnjacima, voćem, nektarom, peludom, a neki sišu krv. Šišmiši ispuštaju

ultrazvuk kojim pronalaze hranu i lakše se snalaze u prostoru. ŠKOLJKAŠI,. pripadaju skupini mekušaca, isp. Većinom žive u moru, npr. dagnje, prstaci, periske. U slatkim vodama najpoznatija je bezupka. Tijelo im je bočno spljošteno i smješteno između dviju ljuštura. Ljušture su spojene zubićima i ligamentom, a otvaraju ih i zatvaraju mišići zatvarači. Stopalom se pričvršćuju za podlogu. Između plašta i tijela je plaštena šupljina u koju stalno ulazi voda. Filtrirajući vodu školjkaši dolaze do hrane i kisika. Nemaju radulu. Većina su rastavljenog spola. Oplodnja je vanjska. ŠKORPIONI, v. paučnjaci. ŠKRGE, organi za disanje kod kružnousta, riba i ličinke vodozemaca. Nastaju u području škržnih pukotina u ždrijelu. Škrge su u obliku resa (škržni listići) i dobro su prokrvljene krvnim kapilarama. Voda ulazi kroz usta i oplakuje škržne listiće. Otopljeni kisik iz vode difuzijom prelazi u krv, a iz krvi izlazi ugljik dioksid. ŠKROB, složeni organski spoj iz skupine polisaharida koji sadrži kemijski vezano nekoliko stotina molekula glukoze. Opća formula mu je (C6H10O5)n. On je pričuvni polisaharid biljaka koji se u obliku škrobnih zrnaca nalazi u spremišnim organima biljaka (zadebljali dijelovi korijena, lukovice, gomolji itd.). U slučaju kada su ugljikohidrati potrebni i kao izvor energije u stanicama, škrob se postupno razgrađuje uz pomoć niza enzima (npr. amilaze, maltaze) do glukoze koja zatim ulazi u proces staničnog disanja. U ljudskom organizmu prvi se počinje probavljati, v. probava. ŠTIPALJKE (pedicelarije), nalaze se, kod bodljikaša, između bodlji (npr. kod ježinaca i zvjezdača). Služe za obranu, hvatanje plijena i čišćenje.


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

ŠTITARKE, skupina uglavnom zeljastih biljaka dvosupnica. Listovi su im razdijeljeni, stabljika je šuplja, a cvijetovi skupljeni u štitac. U svim dijelovima, naročito u plodićima, sadrže aromatične i ljekovite tvari pa se štitarke rabe u prehrani, farmaciji i kao začinske biljke. Neke od njih su: mrkva, peršin, celer, kopar i kim. ŠTITNA ŽLIJEZDA (štitnjača), žlijezda s unutarnjim izlučivanjem, smještena je ispod grkljana s obje strane dušnika. Žlijezdane stanice štitnjače izlučuju hormone tiroksin (T4), trijodtironin (T3), tireokalcitonin i dr. Ti hormoni stimuliraju metabolizam u tijelu. U svom sastavu imaju jod. ŠULJEVI (hemoroidi), proširene vene na kraju zadnjeg crijeva (rektum) i čmara. Vene oteknu zbog učestalo povišenoga tlaka, što je obično posljedica opetovanog naprezanja prilikom ispražnjivanja crijeva. Hemoroidi mogu biti unutarnji i vanjski. Prolaskom fekalija mogu lako popucati i krvariti. ŠUPLJE VENE, gornja i donja, najveće vene, ulaze u desnu pretklijetku srca. Nemaju venskih zalisaka, v. veliki optok. ŠUPLJINA, v. celom.

njuje vrijeme predviđeno za odmor srčanog mišića. TAKSIJA, vrsta lokomotornog gibanja biljaka čiji je smjer gibanja ovisan o smjeru vanjskog podražaja. Kreću li se organizmi u smjeru podražaja, gibanja nazivamo pozitivnom taksijom, a ako se organizmi kreću od izvora podražaja, gibanja nazivamo negativnom taksijom. Prema podražajima koji ih uzrokuju razlikujemo: kemotaksije (uzrokovane kemijskim tvarima), fototaksije (reakcije na svjetlost), tigmotaksije (izazvane dodirom), hidrotaksije (reakcije na vlagu), termotaksije (izazvane temperaturom) i geotaksije (podražaj je sila teže). Taksije su osobito važne za mnoge jednostanične organizme koji se kreću bičevima, trepljama, ameboidalno ili kližu po podlozi. TAKSIN, v. tise. TAKSON, isto što i svojta. TAKSONOMIJA, (grč. taksis = raspored, poredak + nomos = zakon) znanost o zakonima razvrstavanja organizama, hijerarhija sistematskih kategorija (vrsta, rod, porodica, red, razred, odjeljak/koljeno, carstvo), isp. filogenetski (prirodni) sustav i sistematika. TALUS, v. steljka.

T T - LIMFOCITI, vrsta leukocita koji nastaju najviše u timusu (prsnoj žlijezdi), a manje u limfnim čvorovima i slezeni. Oni su jedni od nositelja stanične specifično stečene imunosti. TAHIKARDIJA, nagli porast frekvencije srca s prosječnih 70 otkucaja u minuti na 100 i više. Tahikardija je štetna jer se sma-


TANKO CRIJEVO, cjevasti organ probavnog sustava koji se proteže od želuca, a nastavlja debelim crijevom. Ukupna dužina iznosi 5 do 6 metara. Sastoji se od: početnog dijela – dvanaesnika (duodenum), srednjeg dijela (jejunum) i krajnjeg dijela (ileum). Unutarnja površina crijeva sadrži crijevne resice. Sluznica tankog crijeva ima brojne žlijezde a to su: Brunnerove žlijezde koje se nalaze na početnom dijelu duodenuma i luče sluz koja štiti crijevnu stijenku od probavnog djelovanja želučanog soka prije neutralizacije himusa u

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

dvanaesniku; Liberkühnove kripte su žlijezde koje se osim u duodenumu nalaze po cijeloj površini tankog crijeva i luče sluz i crijevni sekret. TARAXACUM OFFICINALE, stručni latinski naziv za maslačak. TARTUFI (gomoljače), gljive mješinarke, rastu petnaestak centimetara pod zemljom u listopadnim šumama. Kulinarski su specijalitet posebne arome pa ih ljudi pronalaze uz pomoć dresiranih pasa ili svinja. TELOCENTRIČAN KROMOSOM, kromosom s pričvrsnicom na svom kraju. TELOFAZA, završna faza stanične diobe, mitoze. U telofazi se kromosomi koji su stigli na suprotne polove stanice počinju despiralizirati i oko njih nastaje jezgrina ovojnica. Dvije novonastale stanice imaju diploidan broj kromosoma, a svaki kromosom je građen od jedne kromatide. U stanicama se formiraju jezgra i jezgrica. TELOFAZA DRUGE DIOBE, v. telofaza II.


TELOFAZA I (telofaza prve mejotičke diobe), završna etapa mejoze I u kojoj su vidljive dvije novonastale stanice s haploidnim brojem kromosoma koji su građeni od dvije kromatide. Kromosomi se despiraliziraju, a oko njih se formira jezgrina ovojnica. U stanicama postaju vidljive jezgra i jezgrica. TELOFAZA II (telofaza druge mejotičke diobe), završna etapa mejoze II u kojoj nastaju četiri stanice s haploidnim brojem kromosoma od kojih je svaki kromosom građen od jedne kromatide. Oko despiraliziranih kromosoma formira se jezgrina ovojnica te nastaju jezgra i jezgrica. TELOFAZA PRVE MEJOTIČKE DIOBE, v. telofaza I. TENTAKULA, ticalo, isp. virnjaci.

TEPALA, v. cvijet. TERMONASTIJE, v. nastije. TERMOREGULACIJA, održavanje stalne tjelesne temperature čovjeka i homeotermnih životinja. U čovjeka središta za regulaciju tjelesne temperature nalaze se u hipotalamusu. Sastoje se od središta za "produkciju" i središta za "redukciju" topline. Ako je tijelo pregrijano, uključuje se središte za redukciju topline koje šalje informacije živčanim putovima na periferiju. Dolazi do širenja krvnih kapilara (vazodilatacija), povećava se dotok krvi u kožu pa se toplina otpušta u okoliš. Stezanjem žlijezda znojnica oslobodit će se znoj koji isparavanjem hladi kožu. Hormonalnim putem regulirat će se smanjenje razgradnje hranjivih tvari i time smanjiti proizvodnja topline. Ako je tijelo pothlađeno, aktivira se središte za produkciju topline. Tada prestaje znojenje, krvne kapilare se stežu (vazokonstrikcija), smanjuje se protok krvi u koži, a hormonima (tiroksin) stimuliraju se kataboličke reakcije. TEST KRIŽANJE (povratno križanje), križanje koje se koristi kada se želi provjeriti da li su jedinke F2 generacije homozigotne (npr. AA) ili heterozigotne (npr. Aa) za određeno svojstvo jer se razlika ne može zamijetiti po fenotipu. Jedinka nepoznatog genotipa se križa s recesivnim homozigotom (aa). Ako su svi dobijeni potomci dominantnog tipa, testirana jedinka je bila homozigotna, a ako je 50 % dominantnih i 50 % recesivnih, jedinka je bila heterozigotna. (v. shemu u Dodatku 1.) Test križanje može se koristiti i ako se želi provjeriti genotip jedinki F2 generacije koje su nastale dihibridnim križanjem s dominacijom. U tom slučaju jedinka nepoznatog genotipa križa se s recesivnim homozigotom za oba svojstva (aabb). Ako je testirana jedinka bila homozigotna za oba svojstva (AABB), dobiveni


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

će potomci biti dominantnog tipa, a ako je bila heterozigotna za oba svojstva (AaBb), dobit će se omjer fenotipova 1/4:1/4: 1/4: 1/4. (v. Dodatak 1.) TESTISI, v. sjemenici. TESTOSTERON, muški spolni hormon kojega izlučuju intersticijske stanice sjemenika. Manje količine testosterona izlučuju se već u embrionalnoj i fetalnoj dobi, a veće količine u pubertetu. Utječe na razvoj primarnih i sekundarnih spolnih obilježja muškaraca. Izlučivanje testosterona pod kontrolom je gonadotropnih hormona iz prednjeg režnja hipofize. TETRADA, grupa od četiri kromatide u mejozi, v. profaza I. TETRAPLOIDNI BROJ KROMOSOMA, v. poliploidija. TIGMONASTIJA, v. nastije. TIGMOTROPIZAM, v. tropizam. TILAKOIDI, sustav membrana u unutarnjosti kloroplasta (isp.) i drugih plastida. TILAKOIDNE MEMBRANE, specifično građene membrane koje se nalaze u unutarnjosti kloroplasta i drugih plastida. Mogu sadržavati različita biljna bojila (klorofil, karotene, ksantofile) ovisno o tipu plastida u kojima se nalaze. U tilakoidnim membranama koje sadrže klorofil odvija se fotosinteza. TIMIN, organski spoj s dušikom iz skupine pirimidinskih baza. Sudjeluje u izgradnji nukleotida odnosno nukleinskih kiselina i to samo DNA. Strukturna formula mu je: O H O





CH 3 H

TIMPANALNI ORGANI, osjetila za sluh kod kukaca. Smješteni su na različitim dijelovima tijela. To su udubine u kutikuli prekrivene timpanalnom membranom ili bubnjičnom opnom. Opne titraju podražene zvukom, a titranje primaju osjetne stanice i podražaj dalje prenose u moždana središta. TIMUS (prsna žlijezda), smješten je u prsnoj šupljini iznad dušnika i srca. U embrionalno i fetalno doba pa sve do puberteta, to je najveći proizvođač limfocita, koji su po timusu i dobili prefiks T – limfociti. TIREOKALCITONIN, hormon štitne žlijezde koji regulira koncentraciju iona kalcija u krvi i potiče ugradnju kalcija (i fosfora) u kosti. TIREOSTIMULACIJSKI v. tireotropni hormon.


TIREOTROPNI HORMON (tireostimulacijski hormon, TSH), hormon kojega izlučuje prednji režanj hipofize (adenohipofiza), a koji potiče rast štitne žlijezde i izlučivanje tiroksina. TIROKSIN (T4), hormon kojega izlučuje štitna žlijezda, a stimulira cjelokupni metabolizam u organizmu, v. štitna žlijezda. TIROZIN, kemijski spoj iz skupine aminokiselina. TISE, porodica biljaka iz skupine četinjača (golosjemenjača). Listovi su plosnati. Sjemenke se nalaze unutar mesnatog ovoja (arilus) koji sadrži hranjive tvari. Ostali dijelovi tise sadrže taksin (otrovni alkaloid). U hrvatskoj flori zastupljena je s jednom vrstom: običnom tisom koja je zaštićena jer je rijetka i ugrožena na prirodnim staništima . TJELESNA STANICA (somatska stanica), osnovna građevna jedinica višestaničnih organizama. Nastaje diobom mitozom

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

od stanice majke, a njen životni vijek traje dok se i ona mitotičkom diobom ne podijeli u dvije nove stanice kćeri. Razdoblje u životu stanice između dviju dioba naziva se interfaza. TJELESNI (somatski) ŽIVČANI SUSTAV, prima i prenosi različite osjete (i svjesno zapažanje), te upravlja radom mišića. Sastoji se od središnjeg živčanog sustava (kojem pripadaju mozak i leđna moždina) i perifernog živčanog sustava tj. perifernih živaca. TJEMENO OKO (parijetalno oko, tjemeni organ), mjehurić sličan oku kod nekih gmazova, npr. premosnika i gušterice. Sastoji se od osjetnih stanica za svjetlo i pigmentnih stanica. Unutarnjost mjehurića ispunjena je staklastim tijelom. Na lubanji je iznad mjehurića otvor koji je presvučen prozirnom kožicom kroz koju pada svjetlost na tjemeni organ. TKIVNI MAKROFAGI, stanice sa sposobnošću fagocitoze, nastaju iz monocita koji su iz optoka krvi došli u tkiva. Nalaze se npr. u jetri i slezeni i nemaju mogućnost ameboidnog kretanja. TMV, v. virus mozaične bolesti duhana. TOBOLČARI, primitivni sisavci koji se razvijaju unutar majčina tobolca. U tobolac se otvaraju mliječne žlijezde. Ženke tobolčara imaju kratkotrajnu trudnoću te rađaju male i slabo razvijene mlade. Razvitak u tobolcu traje nekoliko puta dulje od razvitka u majčinom tijelu. Danas u biosferi živi oko 200 vrsta. Poznatiji su: klokan, koala, oposum i psoglavi vučak. TOKSICITET, v. stupanj otrovnosti. TOKSIČNI ELEMENTI (otrovni elementi), elementi kao što su živa, olovo, kadmij, radioaktivni izotopi itd. Oni se najčešće javljaju u otpadnim tvarima industrije, prometa itd. Slijedom hranidbenih

lanaca postupno se nakupljaju u pojedinim dijelovima organizma postižući koncentraciju koja je za organizam toksična, otrovna. TOKSIČNOST, v. otrovnost. TOKSINI, otrovi živih organizama, a mogu biti bakterijskog (bakteriotoksini), gljivičnog (mikotoksini), životinjskog (zootoksini) i biljnog (fitotoksini) porijekla. TONOPLAST, u biljnoj stanici granični sloj plazme prema vakuoli. TORNARIJA, ličinka žiroglavaca iz skupine malokolutićavaca. TOTIPOTENTNOST, mogućnost diferencirane somatske stanice da sačuva potencijal razvitka čitavog novog organizma, v. klon. Stanična diferencijacija često je povratna (reverzibilna), a dediferencirane (ponovo nediferencirane) se stanice mogu opet dijeliti i po potrebi regenerirati čitavu biljku (osobito kada se biljno tkivo uzgaja u kulturi). Pojava je rezultat regulacije aktivnosti gena. TRAHEJE, v. uzdušnice. TRAHEOLA, v. udušnice. TRAKAVICA, beskolutićava životinja koja pripada koljenu plošnjaka, isp. Žive kao nametnici u probavilu kralježnjaka. Tijelo im je plosnato i pokriveno kutikulom, dugačko i 15 m. Na prednjem dijelu je "glava" (skoleks) s kukicama i prianjalkama te vrat i tjelesni članci (proglotidi) koji tvore strobilu. Trakavice su anaerobni organizmi i nemaju organa za disanje ni optjecanje. Nemaju ni probavilo već hranu uzimaju osmotski preko površine tijela. Dvospolci su. Svaki proglotid sadrži muške i ženske rasplodne organe. Imaju hiperprodukciju potomaka. Tijekom života trebaju barem jednog međudomadara. Najpoznatije trakavice su goveđa, svinjska i pasja trakavica ili ehinokok.


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

TRANSDUKCIJA, prijenos genetičkog materijala jedne bakterije u drugu virusom. TRANSFER RNA, v. tRNA. TRANSFORMACIJA STANICA, uzrokovana je komadićem molekule DNA koji sadrži gen, a koji se oslobađa iz mrtvih bakterija i ugrađuje u žive bakterije. Novougrađeni gen daje bakteriji nove osobine. TRANSFUZIJSKA REAKCIJA, reakcija koja nastaje prilikom transfuzije krvi, kada se krvna grupa davatelja ne podudara s krvnom grupom primatelja krvi. Transfuzijsku reakciju karakterizira sljepljivanje (aglutinacija) i raspadanje (hemoliza) eritrocita. TRANSKRIPCIJA, v. sinteza proteina. TRANSLACIJA, v. sinteza proteina. TRANSLOKACIJA, prebacivanje segmenta jednoga kromosoma na drugi nehomolog. TRANSPIRACIJA, izlučivanje (isparavanje) vode iz biljaka u obliku vodene pare. Isparavanje vode s vanjskih površina biljke naziva se kutikularna transpiracija, kroz puči (stome) - stomatalna tranpiracija, a kroz lenticele - lenticelna transpiracija. Proces transpiracije je važan pokretač za kretanje vode kroz biljku. Također može spriječiti pregrijavanje biljke. TRANSPLATACIJA, presađivanje tkiva ili organa na drugo mjesto istog organizma ili na drugi organizam. Imunološki sustav organizma prepoznaje svoje bjelančevine kao vlastite i na njih ne reagira (imunološka tolerancija). Da ne bi došlo do odbacivanja presađenog organa ili tkiva davatelja zbog pokretanja imunološke reakcije na strani antigen, mora se nakon presađivanja tkiva imunološki sustav primatelja zakočiti svakodnevnim uzimanjem lijekova koji slabe imunoreakciju.


TRANSPORT, MASOVNI, specifičan način transporta kroz staničnu membranu kada se transportiraju velike molekule ili krute čestice koje zbog svoje veličine ne bi mogle proći kroz staničnu membranu na drugi način. Oblici masovnog transporta su endocitoza i egzocitoza. TRANSPORTNA RNK, v. tRNA. TRBUŠNI TIFUS (tifus) je akutna zarazna crijevna bolest s temperaturom, zatvorom u prvoj fazi, a eventualno proljevom u drugoj. Inkubacija traje od 7 do 14 dana. Uzročnik bolesti je bakterija Salmonella typhi koja izaziva upalu crijevnih stijenki, te se krvotokom prenosi po cijelom tijelu. TREĆI BUBREG (pravi bubreg ili metanefros), organ za izlučivanje kod gmazova, ptica i sisavaca. Bubrežne cjevčice počinju Bowmanovim čahurama. Osnovna anatomska jedinica bubrega je nefron. U nefronima se stvara mokraća koja kroz mokraćovod ulazi u nečisnicu ili kod sisavaca u mokraćni mjehur. Mokraćovod nastaje iz donjeg dijela Wolfove cijevi, isp.drugi bubreg. TRENICA (radula), struktura u usnoj šupljini mekušaca (puževa i glavonožaca) za mrvljenje hrane. Trenica je "jezik" pokriven rožnatim zubićima kojima životinje stružu čestice hrane po podlozi. TREONIN, kemijski spoj iz skupine aminokiselina. TREPETLJIKAŠI, najveća skupina praživotinja. Žive u moru i slatkim vodama. Rijetko su nametnici. Vrlo su pokretljivi. Na površini pelikule imaju trepetljike ili cilije. Najprepoznatljiviji su papučice (parameciji) i zvončići (vorticele). Svi trepetljikaši imaju barem 2 jezgre: malu jezgru mikronukleus i veliku jezgru – makronukleus. Mikronukleus ima diploidan broj kromosoma (2n) i sudjeluje u konjugaciji.

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

Makronukleus upravlja drugim životnim aktivnostima (hranjenjem, izmjenom plinova, osmoregulacijom). Trepetljikaši se najčešće razmnožavaju dvojnim ili binarnim dijeljenjem. TRIHIBRIDNO KRIŽANJE S DOMINACIJOM, križanje u kojem se prati nasljeđivanje triju svojstava. I u ovom slučaju, kao i u ostalim prikazima križanja, početna roditeljska (parentalna) generacija se označuje s P, a generacije potomaka (filijalne) prema redoslijedu s F1 i F2. Aleli pojedinih svojstava označuju se slovima i to dominantni velikim slovima, a recesivni malim. U ovdje navedenom primjeru parentalnu generaciju predstavlja biljka visokog rasta, zelenih i glatkih sjemenki i biljka niskog rasta, žutih i naboranih sjemenki. Obje biljke su homozigoti za navedena svojstva s tim da su svojstva: visoki rast, zelena boja sjemenke i glatka površina sjemenke dominantna. Križanjem takvih biljaka dobiva se F1 generacija čije su sve jedinke istog fenotipa: visokog rasta, zelenih i glatkih sjemenki. Jedinke F1 generacije mogu stvarati 8 različitih tipova gameta, a njihovim međusobnim križanjem dobivamo F2 generaciju koja može imati 8 različitih fenotipova. Omjer fenotipova u F2 generaciji je: 27:9:9:3:9:3:3:1, tj. mogući su sljedeći fenotipovi: 1. visoki, zelenih glatkih sjemenki-27 2. visoki, zelenih naboranih sjemenki-9 3. visoki, žutih glatkih sjemenki-9 4. visoki, žutih naboranih sjemenki-3 5. niski, zelenih glatkih sjemenki 9 6. niski, zelenih naboranih sjemenki-3 7. niski, žutih glatkih sjemenki-3 8. niski, žutih naboranih sjemenki-1 (V. shemu u Dodatku 1.) TRIHOCISTI, posebni mjehurići koji se nalaze u donjem sloju pelikule. Ispunjeni su sekretom koji se na podražaj izbacuje

van. Ti organeli služe za obranu i zaštitu praživotinja. TRIHOMONAS, v. bičaši. TRIJODTIRONIN (T3), v. štitna žlijezda. TRIPANOSOMA, jednostanična životinja (praživotinja) iz skupine bičaša koja u čovjeka uzrokuje smrtonosnu bolest spavanja. Javlja se u tropskom području Afrike. TRIPLET, v. kodon. TRIPLOIDNI BROJ KROMOSOMA, v. poliploidija. TRIPSIN, jedan od probavnih enzima kojega izlučuje gušterača u početni dio tankog crijeva (dvanaesnik, duodenum), a sudjeluje u razgradnji bjelančevina do aminokiselina. TRIPTOFAN, kemijski spoj iz skupine aminokiselina. TRISOMIK, stanica, tkivo ili organizam koji ima uz homologni par još jedan kromosom viška (2n+1). tRNA (transportna RNK ili tRNK, prijenosna RNK, transfer RNA), vrsta ribonukleinske kiseline koja se nalazi u citoplazmi. Njena je uloga da veže na sebe odgovarajuće aminokiseline i prenosi ih na ribosom gdje će se sintetizirati proteini. Građena je od 80-ak nukleotida pa je po veličini najmanja vrsta RNA. Ona sačinjava 10 do 15 % ukupne stanične RNA. Postoji 20 različitih vrsta molekula tRNA, a svaka se odlikuje sposobnošću da veže na sebe samo jednu određenu aminokiselinu. TROFOBLAST, vanjski sloj stanica blastociste čovjeka i ostalih sisavaca. Nastaje u jednoj od etapa embrionalnog razvitka, blastulaciji. Trofoblast okružuje unutarnji sloj stanica (embrioblast). Iz stanica trofo-


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

blasta i decidua stanica (stanice sluznice maternice), oko 16 dana nakon oplodnje, započinje razvoj posteljice koja će osigurati prehranu zametka u kasnijoj fazi embrionalnog razvitka.

kod plućne embolije dio se krvnog ugruška zaustavi u plućima ili kod infarkta srca (isp.) u srčanom mišiću što uzrokuje neprokrvljenost dijelova pluća i srca te odumiranje tih dijelova.

TROFOGENI SLOJ, površinski osvjetljeni sloj, u moru do 200 m, a u kopnenim vodama stajačicama do oko 50 m, u kojem se odvija proces fotosinteze i primarne organske proizvodnje (bioproizvodnje).

TROPIZAM, jedna vrsta gibanja biljnih organa u obliku svijanja uzrokovana i usmjeravana jednostranim vanjskim podražajima. Do svijanja dolazi redovito zbog različito jakog rastenja suprotnih strana organa. Pozitivan je tropizam ako se organ giba prema izvoru podražaja, a negativan ako se giba od izvora podražaja. Prema vrsti podražaja koji uzrokuju ova gibanja razlikujemo fototropizam (gibanje rastenjem uzrokovano jednostranim djelovanjem svjetlosti), geotropizam (gibanje kojim biljke dovode svoje organe u određeni položaj prema sili teže), kemotropizam (izazvan kemijskim tvarima) i tigmotropizam (uzrokovan mehaničkim podražajima).

TROHOFORA, ličinka kod mekušaca i morskih kolutićavaca. Razvija se iz oplođene jajane stanice, ima vijenac trepetljika te može slobodno plivati. U jednostavnijih oblika mekušaca trohofora se razvija u odraslu jedinku, a mnogi imaju kasniji stadij ličinke, tzv. velinger linčiku. TROJKA, v. genetička uputa. TROMB, krvni ugrušak, isp. ateroskleroza, infarkt. TROMBOCITI (krvne pločice), citoplazmatski dijelovi velikih stanica megakariocita iz kojih se oslobađaju raspadanjem. Imaju važnu ulogu u kontroli krvarenja sudjelujući u procesima zgrušavanja krvi nakon ranjavanja; ljepljeći se za ozljeđeno mjesto zajedno s fibrinogenom i krvnim stanicama, začepljuju otvor. TROMBOCITOPENIJA, bolest kod koje je smanjen broj krvnih pločica – trombocita. To stanje mogu uzrokovati pojedini lijekovi, npr. antibiotici, protuupalni lijekovi i dr. TROMBOZA, nenormalno stvaranje ugrušaka krvi (tromba) u žilama (venama ili arterijama) zbog različitih uzroka (ateroskleroza, ozljede krvnih žila i dr.). Tromb može potpuno ili djelomično spriječiti protok krvi kroz žilu ili se može otkinuti od hvatišta na stijenci žile i slobodno kolati po tijelu (embolus), te djelomično ili potpuno začepiti neku užu krvnu žilu. Npr.


TROPOSFERA, najniži sloj atmosfere gdje žive mikroorganizmi, biljke i životinje. TRŠĆANI ŠEĆER, v. saharoza. TRUDNOĆA, u sisavaca, razdoblje od oplodnje do rođenja. Trudnoća u žene traje u prosjeku 280 dana ili 40 tjedana. Tijekom trudnoće zbivaju se različite hormonalne promjene, npr. izlučuje se više progesterona nego estrogena što sprječava pojavu menstruacije koja dovodi do gubitka ploda. TRUDOVI, pravilna ritmička stezanja i opuštanja mišića maternice koja će uzrokovati potiskivanje ploda kroz porođajni kanal. Trudovi su uzrokovani izlučivanjem hormona oksitocina kao i povećanim izlučivanjem estrogena i to iznad vrijednosti progesterona. Trudovi se u početku pojavljuju svakih 15 do 20 minuta, kasnije sva-

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

ke dvije do tri minute, a traju 30 do 60 sekundi.

TUNICIN, organska tvar slična biljnoj celulozi, v. plaštenjaci.

TRUSKOVCI, nametničke praživotinje. Razmnožavaju se nespolno truskama ili sporama i spolno. Najpoznatiji truskovci su plazmodiji, uzročnici malarije u čovjeka. Također su nametnici na mnogim bezkralježnjacima i kralježnjacima.

TURGOR (turgorski tlak), unutarnji hidrostatski tlak stanice koji pritišće plazmalemu uz staničnu stijenku biljnih stanica. Povećava se ulaženjem vode u stanicu. Kada turgorski tlak po visini postane jednak tlaku bubrenja (a po smjeru djelovanja mu je suprotan), zaustavi se ulazak vode. Turgor je važan za čvrstoću biljke. Ako biljka gubi vodu, turgorski tlak opada, stanice postaju mlohave i biljka vene. Turgorski se tlak, ovisno o organu, mijenja od 0.1 do 1.0 MPa (0.1 MPa = 1 bar).

TSH, v. tireotropni hormon. TUBA UTERINA, v. jajovod. TUBERKULOZA (sušica), teška zarazna bolest uzrokovana Kochovim bacilom, bakterijom štapićastog oblika. Uzrokuje oštećenja tkiva pluća. TUČAK, ženski dio cvijeta. Nastao je sraštavanjem jednog plodnog lista (megasporofila) ili više njih. Sastoji se od plodnice, vrata i njuške. U plodnici se nalazi jedan sjemeni zametak (makrosporangij) ili više njih, u kojima se razvija makrospora (embrionska vreća). Makrosporogenezom razviti će se ženski gametofit. Nakon oprašivanja vegetativna stanica peludnog zrna klije u polenovu mješinicu koja provodi dvije spermalne stanice kroz mikropilu u embrionsku vreću. Jedna spermalna stanica oplodi jajnu stanicu. Iz diploidne zigote (2n) nastaje klica (embrij). Druga se spermalna stanica stapa s dvije središnje jezgre (stanice) embrionske vreće pa nastaje triploidna stanica (3n) iz koje se, mitotičkom diobom, razvija endosperm, isp. sjemeni zametak. TUMOR, u širem smislu svaka izraslina u organizmu, a u užem smislu novo-stvoreno tkivo karakterizirano nekontroliranim rastom stanica. TUNDRA, karakteristična biljna zajednica rasprostranjena u sjevernim polarnim područjima Zemlje, npr. Sibiru, Kanadi, Grenlandu itd. Sastoji se uglavnom od mahovina i lišajeva.

TURGORSKA GIBANJA, nastaju zbog promjena turgora u pojedinim susjednim tkivima ili slojevima tkiva nekih plodova (npr. štrcalica, nedirak). Kao posljedica velikih napetosti među tkivima dolazi do pucanja tih plodova i izbacivanja sjemenki. TURNEROV SINDROM, v. aneuploidija. TVORNO STANIČJE, meristem, tkivo koje omogućuje rast bilja. Stanice koje izgrađuju tvorno staničje su razmjerno male, bogate citoplazmom, bez vakuole, imaju veliku jezgru, stanične stijenke su tanke, a glavno im je obilježje da se dijele mitozama. Razlikujemo tjemenišne ili vršne meristeme koji se nalaze na vršcima izdanaka i korijena, bočne meristeme (kambij) koji omogućuju rast stabljike u debljinu itd. TVORNO TKIVO, v. tvorno staničje.

U UČINAK STAKLENIKA, zadržavanje topline u atmosferi zbog stakleničkih pli-


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

nova (naročito ugljikovog dioksida) koji upijaju toplinsko zračenje sa Zemlje umjesto da ga propuštaju u svemir. Rezultat je povećavanje prosječne temperature Zemlje ili globalno zagrijavanje. UDARNI VOLUMEN SRCA, volumen krvi (oko 70 ml) koje srce utisne u krvotok za vrijeme jedne kontrakcije. UGLJENO DOBA, v. karbon. UGLJIKOHIDRATI, prirodni organski spojevi koji se nalaze u svim dijelovima staničnog tkiva, i kao funkcionalni i kao strukturni sastojci. Neki ugljikohidrati (pentoze) izgrađuju nukleinske kiseline. Predstavljaju i izvore i skladišta energije koja je dobijena fotosintezom od Sunca (npr. glukoza, škrob, glikogen). Definiraju se kao spojevi opće formule Cn(H2O)n. Naziv ugljikohidrat se obično upotrebljava u mnogo užem značenju i označuje tvari sastavljene od polihidroksi aldehida i ketona i njihovih derivata. Šećeri ili saharidi su tipični predstavnici ugljikohidrata. Monosaharidi su ugljikohidrati koji se obično sastoje od 3 do 9 atoma ugljika pa se prema tome mogu i svrstavati u trioze, tetroze, pentoze, heksoze itd. Najpoznatiji monosaharidi ili jednostavni šećeri su pentoze riboza i dezoksiriboza te heksoze glukoza, fruktoza i galaktoza. Povezivanjem 2 do 10 monosaharida nastaju oligosaharidi pa se prema tome mogu svrstati u disaharide, trisaharide, tetrasaharide itd. Najpoznatiji oligosaharidi su disaharidi saharoza, laktoza i maltoza. Povezivanjem više od 10 monosaharida nastaju polisaharidi. Najpoznatiji polisaharidi su škrob, glikogen, celuloza i hitin. UHO, osjetilo za sluh. Sastoji se od vanjskog, srednjeg i unutarnjeg uha. VANJSKO UHO, sastoji se od ušne školjke (uške), građene od hrskavice, od zvukovoda (vanjskoga slušnoga kanala), koji


vodi od uške do bubnjića (membrana tympani). ULTRAMIKROELEMENTI, v. elementarni sastav. UMJETNI ELEKTROSTIMULATOR RADA SRCA, tzv. pacemaker, mali generator na baterije koji je povezan s elektrodama koje se stavljaju na stijenku srca. Električni impulsi dolaze na srčani mišić frekvencijom programiranom prije ugradnje u rahlo tkivo stijenke prsnog koša. Pacemaker se ugrađuje kod nenormalnog rada S - A čvora, v. središte automacije rada srca. UMJETNI SUSTAV, sustav u koji su svrstane jedinke u skupine s gledišta njihova korištenja, npr. samonikle i kultivirane biljke. UMNI ČOVJEK, v. Homo sapiens. UMOR MIŠIĆA, nastaje zbog nakupljanja mliječne kiseline nakon dugotrajne i snažne mišićne kontrakcije. Razlog nakupljanja mljiječne kiseline je utrošeni ATP u mišićnim vlaknima, nedostatak glukoze ili kisika. Bez kisika glukoza se razgrađuje u dvije molekule pirogrožđane kiseline koje prelaze u mliječnu kiselinu. UNUTARNJE UHO, sastoji se od pužnice (cochlea) i polukružnih kanalića važnih za održavanje ravnoteže. Pužnica je šuplji kanal, zavijena dva i pol puta. Kanal je podijeljen sa dvije tanke membrane u tri hodnika (skale). Ti su hodnici ispunjeni tekućinom (endolimfom u sredini i perilimfom u gornjem i donjem hodniku). Na donjoj pregradnoj - bazilarnoj membrani nalaze se receptori za sluh tzv. Cortijev organ koji sadržava slušne Cortijeve stanice s dlačicama. Iz Cortijevih stanica izlaze živčana vlakna koja se udružuju u slušni živac i prenose električne potencijale nastale u Cortijevim stanicama u slušnu regiju mozga (sljepoočni režanj).

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

UNUTARNJI FAKTOR, luči ga pilorusni dio želuca. Omogućuje apsorpciju vitamina B 12 u tankom crijevu. Taj vitamin je važan u proizvodnji eritrocita. Nedostatak unutarnjeg faktora uzrokuje anemiju. UPALA CRVULJKA (apendicitis), nastaje kod zastoja crijevnog sadržaja u šupljini crvuljka. Upalu mogu izazvati i strana tijela (koštice) ili paraziti koji uđu u crvuljak. Crvuljak se upali i ispuni gnojem uz pojavu jake boli u donjem desnom dijelu trbušne šupljine. Liječi se brzim kirurškim odstranjivanjem upaljenog crvuljka (apendektomija). UPALA GUŠTERAČE (pankreatitis), vjerojatno nastaje djelovanjem probavnih gušteračinih enzima na samo tkivo gušterače. Kod upale se javlja izrazito jaka bol u gornjem dijelu trbušne šupljine. Bol se širi u leđa i prsni koš, uz povraćanje i jaku mučninu. UPALA PLUĆA (pneumonija), teška bolest pluća koja je najčešće uzrokovana bakterijom pneumokokom. Uzrok može biti i infekcija virusima ili mikoplazmom. Alveole se pune tekućinom što otežava disanje jer se bitno smanjuje respiracijska površina. UPOZORAVAJUĆA OBOJENOST (aposemija), izrazita obojenost tijela živim i upadljivim bojama kojom se predatori opominju na prisutnost otrovnih izlučevina, neugodne mirise, žalac i sl. Poznati su primjeri aposemične obojenosti kod daždevnjaka, mnogih zmija ili tvora. O H O Uracil





URACIL, organski spoj s dušikom iz skupine pirimidinskih baza. Sudjeluje u izgradnji nukleotida odnosno nukleinskih kiselina i to samo RNA. UREMIJA, otrovanje organizma zbog nakupljanje ureje u tjelesnim tekućinama (krvi) jer se kod oboljelih bubrega smanjuje se mogućnost izlučivanja tog otrovnog spoja (ureje) iz krvi. URETRA, v. mokraćna cijev. URIN, v. mokraća. UROBILIN B, v. eritrociti. URTIKARIJA v. koprivnjača. USNAČE, skupina pretežno zeljastih biljaka dvosupnica. Stabljika je četverobridna. Cvijetovi su jednosimetrični, a na vjenčiću razlikujemo gornju i donju usnu (ime!). Plod je kalavac koji se raspada na četiri oraščića. Većina usnača sadrži eterična ulja i ljekovite tvari te se rabe kao začinsko i ljekovito bilje. To su npr: bosiljak, mravinac (origano), mažuran, majčina dušica, metvica, ružmarin, lavanda i ljekovita kadulja. Česte su vrste mrtve koprive. USPRAVNI ČOVJEK, v. Homo erectus. UZDUŠNICE (traheje), hitinske cjevčice kod uzdušnjaka (stonoge i kukci) za udisanje zraka i prijenos kisika neposredno u tkiva. Na površini se tijela otvaraju otvorima koje nazivamo odušak ili stigma, a u unutarnjosti se granaju u sve manje cjevčice: dušnice ili traheole. Dopiru u tkivima do samih stanica, a ulaze i u krila. UZDUŠNJACI (Tracheata), životinje iz skupine člankonožaca, isp. Prilagođeni su životu na kopnu. Dišu uzdušnicama ili trahejama, isp. Uzdušnjacima pripadaju stonoge i kukci. UZLAZNI TOK VODE U BILJCI, prolazak vode kroz kapilarni sustav stabljike


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

od korijena do vrha biljke. Omogućen je pojavama osmoze i korijenovog tlaka, silama kohezije i adhezije, kapilarnosti, transpiracijom i gutacijom, isp.

V VAGILNI ORGANIZMI, v. bentos. VALIN, kemijski spoj iz skupine aminokiselina. VANJSKO DISANJE, v. disanje. VAPNENAČKE BILJKE, v. bazofilne biljke VARIOLA, v. boginje. VAZODILATATORI, lijekovi koji šire male krvne žilice i na taj način snizuju krvni tlak VEGETACIJA, sve biljne zajednice nekog područja. Flora i vegetacija nekog područja čine njegov biljni pokrov. VEGETATIVNI ORGANI, v. stablašice. VEGETATIVNI ŽIVČANI SUSTAV, v. autonomni živčani sustav. VEGETATIVNO RAZMNOŽAVANJE, razmnožavanje kojim od dijelova vegetativnih organa (korijena, listova, stabljike) nastaju jedinke koje su genetički istovjetne s matičnom biljkom. VELIKE BOGINJE, v. boginje. VELIKI (sistemski) OPTOK KRVI, započinje s aortom. Krv se dalje potiskuje velikim a potom malim arterijama u arteriole, te dalje u arterijski i venski kraj kapilara. U području kapilara izmjenjuju se plinovi. Oksigenirana (arterijska) krv otpušta stanicama kisik, a od stanica pre-


uzima ugljikov dioksid. Otpuštanjem kisika arterijska krv se deoksigenira i postaje venska krv. Venska krv teče dalje venulama, malim i velikim venama te gornjim i donjim šupljim venama ulazi u desnu pretklijetku. Kontrakcijom desne pretklijetke krv se potiskuje u desnu klijetku, a odatle malim (plućnim) krvotokom u pluća, isp. VELIKI MOZAK (cerebrum), zaštićen je kostima lubanje i obavijen s tri ovojnice (dura mater, pia mater i arahnoidea). Podijeljen je na dvije hemisfere: lijevu i desnu. Kora mozga se sastoji od brojnih vijuga (gyrusa) i udubina (sulcusa) a podijeljena je i na režnjeve. To su čeoni ili frontalni, tjemeni ili parijetalni, zatiljni ili okcipitalni, te sljepoočni ili temporalni režanj. Koru (cortex) velikog mozga čini siva tvar građena od živčanih stanica, a srž (medullu) velikog mozga čini bijela tvar kroz koju prolaze motorički i osjetni završeci živčanih vlakana. Siva kora velikog mozga upravlja voljnim pokretima tijela, prima, sređuje i pamti informacije, određuje svijest, ponašanje, inteligenciju i središte je više živčane (nervne) djelatnosti. VELIKI PRASAK, (engl. “big bang”), velika eksplozija kojom je vjerojatno nastao svemir. Smatra se da je to bilo prije 10 do 20 miljardi godina. VELINGER-LIČINKA, ličinka kod mekušaca. Razvija se iz trohofore. VENE, žile dovodnice, jer dovode krv u srce. Manje su elastične od arterija. Izvana su obavijene vezivnim tkivom ispod kojeg se nalazi tanki mišićni sloj ili ga uopće nema te zatim unutarnji sloj (endotel). U unutarnjosti vena se nalaze venski zalisci koji priječe vraćanje krvi u suprotnom smjeru. VENSKI ZALISCI, v. vene. VERNALIZACIJA, proces u kojem se cvjetanje stimulira izlaganjem hladnoći (u

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

stadiju sjemenke ili u razvijenom, olistalom stadiju). VERTIKALNE ZONE BIOSFERE, podjela biosfere u slojeve karakteristične po svojim klimatskim i drugim uvjetima o kojima ovisi raspored biljnih i životinjskih vrsta. Najvažnije zone odnosno njihove granice dane su u tablici. Granica

Najviša točka na Zemlji Gornja granica za životinje Gornja granica za cvjetnice Gornja granica za prebivanje čovjeka Gornja granica kultura Gornja granica šuma Gornja granica šuma u Alpama Donja granica za organizme ovisne o svjetlu Donja granica biosfere

Nadmorska visina, m

8880 7000 6000 5000 4500 4000 2200 -200 -11 000

VETERNICA, spilja u Medvednici (Zagrebačkoj gori) u kojoj su pronađeni ostaci slični krapinskom pračovjeku. VEZANI GENI, geni koji se nalaze na istom kromosomu jedan blizu drugoga, a određuju različita svojstva. Ta se njihova svojstva nasljeđuju uvijek zajedno. Iznimno, ima slučajeva kada se vezani geni ne nasljeđuju zajedno i to onda kada dođe do pojave crossing overa. Prilikom praćenja križanja, kada su geni vezani i kada nema krosingovera treba paziti na označavanje gameta. Geni za različita svojstva koja se nasljeđuju vezano, u gametama moraju biti zajedno. Na primjer ako križamo AaBb x aabb, a geni su vezani i nema crossing

overa dobiva se potomstvo čiji je omjer fenotipova 1:1 umjesto 3:1 kao kod dihibridnog križanja s dominacijom gdje nema vezanih gena. (V. shemu u Dodatku 1.) VIBRIONI, v. bakterije. VINSKA MUŠICA (Drosophila melanogaster), maleni kukac dvokrilac čije ličinke u velikom broju žive svuda gdje vrije grožđe i drugo voće. Lako se uzgaja, brzo razmnožava pa je pogodna za genetička i druga biološka istraživanja. VINSKA MUŠICA, KROMOSOMSKA GARNITURA, svi kromosomi pojedine stanice vinske mušice. U tjelesnim stanicama vinske mušice nalazi se 8 kromosoma i oni predstavljaju diploidnu garnituru. Od tih 8 kromosoma 6 je autosoma, a 2 su spolna kromosoma. Ženke imaju 6 autosoma i 2 x spolna kromosoma, a mužjaci 6 autosoma, 1 x i 1 y spolni kromosom. U gametama ili spolnim stanicama nalaze se 4 kromosoma i to predstavlja haploidnu garnituru kromosoma. Ženske gamete ili jajne stanice imaju 3 autosoma i 1 x spolni kromosom, a muške gamete ili spermiji mogu imati ili 3 autosoma i 1 x spolni kromosom ili 3 autosoma i 1 y spolni kromosom. Prema tome, kod vinske mušice mužjak stvara dvije vrste spermija s različitim kromosomskim garniturama u odnosu 50 %:50 %. Ta je shema značajna jer se u istom obliku pojavljuje i kod čovjeka. VINSKI KVASAC, v. kvaščeve gljivice. VIRCHOW, R. (1821. – 1902.), njemački patolog koji je 1858. godine dao ključni prilog staničnoj teoriji tvrdnjom da sve nove stanice nastaju diobom od stanica koje su postojale (lat. Omnis cellula ex cellula.) VIRION, potpuno izgrađena infektivna virusna čestica.


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

VIRNJACI, beskolutićave životinje koje pripadaju koljenu plošnjaka. Od oko 3000 vrsta većina živi slobodno u moru i kopnenim vodama. Dugački su do 20 mm. Površina virnjaka je pokrivena trepetljikavim epidermom. Ispod se nalaze mišići. Tijelo je ispunjeno parenhimom koje im daje potporu i služi za spremanje rezervnih tvari, npr. glikogena. Hrane se manjim životinjama. Imaju jedan usni otvor i probavilo koje se sastoji od ždrijela i crijeva. Za izlučivanje imaju protonefridije. Živčani se sustav sastoji od glavina ganglija i živčanih vrpci. Od osjetila imaju ticala (tentakule) i jednostavne oči (ocele). Razmnožavaju se uglavnom spolno. Većina virnjaka su dvospolci ili hermafroditi. Imaju veliku moć regeneracije. v. i plošnjaci.

Virusi su dugi od 10 do 300 nm pa se ne mogu vidjeti svjetlosnim, već samo elektronskim mikroskopom. Ne pokazuju sve osobine žive tvari pa se ne smatraju organizmima, već ih se najčešće naziva česticama žive tvari. Neki virusi brzo mutiraju.

VIROIDI, čestice manje od virusa, otkrivene sedamdesetih godina. Sastoje se samo od gole ribonukleinske kiseline, a uzrokuju bolesti samo u biljaka.

VODA, najvažnija anorganska tvar u živim stanicama. Ona je polarna molekula i zbog toga je dobro otapalo za veliki broj anorganskih, ali i organskih tvari. Od svih kemijskih spojeva voda ima najveći udio u masi živih bića i njihovih stanica. Tako je, npr. maseni udio vode u protoplazmi stanice 70 do 85 %. Gubitak vode uzrokuje različite poremećaje u živim organizmima, npr. gubitak 15 do 20 % vode tijekom gladovanja u sisavaca uzrokuje fiziološke promjene, a na kraju i smrt. Mnoge tvari unutar organizma prenose se uz pomoć vode, kao vodene otopine. Voda je važna pri sintezi mnogih spojeva u organizmu, npr. u procesu fotosinteze sudjeluje kao jedna od sirovina. Vodene otopine podmazuju zglobove pa možemo reći da voda sudjeluje u omogućavanju kretanja mnogih organizama. Mnogi organizmi koriste vodu kao medij kroz koji muške spolne stanice putuju do ženskih omogućujući na taj način oplodnju. Voda je i neizostavan sudionik regulacije tjelesne temperature itd.

VIROZE, bolesti biljaka, životinja i čovjeka uzrokovane virusima. VIRUS MOZAIČNE BOLESTI DUHANA (TMV), virus koji uzrokuje mozaičnu bolest duhana. Bolesne biljke imaju listove sa žućkastim pjegama poput mozaika i sporije rastu. VIRUSI (lat. virus – otrov), sitne čestice koje uzrokuju često opasne zaraze, jedan od najjednostavnijih oblika života. Sadrže samo jednu nukleinsku kiselinu (ili DNA ili RNA) koja je obavijena proteinskom ovojnicom (kapsidom). Svi virusi su paraziti (nametnici) jer mogu živjeti i razmnožavati se samo u živim stanicama biljaka (npr. duhana, mozaična bolest duhana), životinja i čovjeka (npr. gripa, bjesnoća, velike boginje, vodene kozice, ospice, dječja paraliza, herpes, AIDS itd.). Osim biljnih i životinjskih virusa postoji i skupina virusa koja napada bakterije, tzv bakteriofagi.


VIŠE BILJKE, v. stablašice. VITAMINI, organski spojevi potrebni za normalno odvijanje mnogih metaboličkih procesa u organizmu. Vitamini kao i minerali ne sadrže energetske zalihe, ali su neophodni za izgradnju i održavanje organizma. Najvažniji vitamini su: vitamin C, B1, B2, A i D. VOĆNI ŠEĆER, v. fruktoza.

VODENJACI, v. repaši. VODIKOVA VEZA, vrsta kemijske veze elektrostatičke prirode. Javlja se među pol-

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

arnim molekulama, gdje se pozitivan kraj jedne molekule okreće prema negativnom kraju druge molekule. Vodikovim vezama npr. međusobno su povezane molekule vode kao i odgovarajuće (komplementarne) duščine baze u molekuli DNA. VODOZEMCI (Amphibia), prvi kralježnjaci koji su se djelomično prilagodili životu na kopnu. Žive u vlažnim staništima. Koža je višeslojna, bogata žlijezdama i vlažna. Ima pokrovnu i zaštitnu ulogu te sudjeluje u disanju. Dobro je razvijen koštano - mišićni sustav. Kralježnica je sastavljena od 9 kralježaka. Prvi, na koji se vežu kosti lubanje zove se nosilac ili atlas. Rebra su jako smanjena ili ih uopće nemaju, kao npr. bezrepci. Za kretanje po tlu i plivanje služe se razvijenim prednjim i stražnjim udovima. Oko zaštićuju kapci i suzne žlijezde. Mogu prilagođavati oči blizom i dalekom gledanju. Uho počinje bubnjićem na površini tijela. Srednje uho je Eustahijevom cijevi povezano s usnom šupljinom. U unutarnjem uhu nalazi se labirintni organ. Odrasli vodozemci dišu plućima i preko vlažne kože. Na dnu su usne šupljine, u grkljanu, glasne žice. Njihovim se titranjem proizvode glasovi. Za pojačanje glasa mužjaci nekih vrsta žaba imaju zvučne mjehure. Srce je trodjelno: sastoji se od 2 pretklijetke i 1 klijetke. Arterijska i venska krv se djelomično miješaju u klijetki. Vodozemci su hladnokrvne životinje i ne mogu živjeti na niskim temperaturama. Zimi zapadaju u "zimski san", stanje mirovanja. Za izlučivanje služi drugi bubreg. Mokraću i spolne stanice izvode prvo u nečisnicu. Većina vrsta se razmnožava u vodi ili vlažnim kopnenim staništima. Oplodnje je vanjska. Iz oplođenih jaja se razviju u vodi ličinke punoglavci, isp. Oni se hrane algama i postupno se preobražavaju u odrasle. Vodozemci imaju sposobnost regeneracije. Danas živi oko 2500 vrsta podijeljenih u 3 skupine:

beznošci (rijači), repaši (daždevnjaci, vodenjaci i čovječja ribica) i bezrepci (žabe). VODOŽILNI (ambulakralni) SUSTAV, kod bodljikaša sustav prstenasto i zrakasto raspoređenih cjevčica kroz koje struji morska voda. Služi za pokretanje, hranjenje, kao osjetilo, za izmjenu plinova i za izlučivanje. Iz pet zrakasto postavljenih cjevčica izlaze prionljive ili ambulakralne nožice. VOLVOKS (Volvox), jednostanična zelena alga s bičevima udružena u velike kuglaste nakupine, cenobije. Za razliku od kolonija u cenobiju vlada podjela rada: neke stanice su zadužene za kretanje, neke preuzimaju prehrambenu ulogu a neke ulogu u razmnožavanju. VOLJNI ŽIVČANI SUSTAV, dio je pokretačkog živčanog sustava. Kontrolira mišiće koji rade našom voljom. VRENJE, v. fermentacija. De VRIES H. (1848.-1935.), nizozemski botaničar, proučavao genetiku i promicao Mendelove zakone nasljeđivanja. VRSTA, osnovna sistematska kategorija filogenetskog sustava (isp.) koja se sastoji od biljnih i životinjskih jedinki slične građe i načina života koje se mogu međusobno rasplođivati. Vrstu čine: jedinka, dem i populacija. Dem je skupina genetički sličnih, vremenski i prostorno blisko povezanih jedinki. Populaciju čini više dema među kojima još postoji mogućnost genske izmjene. VRŠNI (apikalni) MERISTEMI, skupina meristemskih stanica smještenih u vršnim dijelovima korijena stabljike koje se kontinuirano dijele i pomoću kojih biljka raste u visinu (primarni rast). VRUĆICA, stanje povišene tjelesne temperature uzrokovano pireticima. Uništava-


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

njem uzročnika bolesti i uzimanjem antipirogenih lijekova (antipiretici) moguće je tjelesnu temperaturu vratiti u normalu.

W WATSON, J., (rođ. 1928.), američki biolog koji je zajedno s britanskim fizičarom F: Crickom 1953. godine iznio model molekule DNA. WHITTAKER, R.H., 1969. god. predložio je razdiobu živog svijeta u pet carstva. WIENER, A., američki znanstvenik koji je s austrijskim znanstvenikom Landsteinerom otkrio Rhesus faktor. WILKINS, M.H.F., britanski biokemičar koji je svojim istraživanjima strukture molekule DNA potvrdio vrijednost modela molekule DNA kojeg su predložili Watson i Crick. WOHLER, F., njemački kemičar koji je 1828. god. kemijskim putem sintetizirao ureu. Time je dokazao mogućnost sinteze organskih spojeva bez djelovanja živih bića.

Z ZAKONI NASLJEĐIVANJA, v. Mendelovi zakoni. ZAKRŽLJALI ORGANI, v. rudimenti. ZALISCI SRČANI (valvule), nalaze se u otvoru između svake pretklijetke i klijetke. Oni osiguravaju jednosmjeran protok krvi iz pretklijetke u klijetku, bez mogućnosti


povratka krvi iz klijetke u pretklijetku. Zalisci mogu biti oštećeni i to najčešće zbog upale, kada nastaje zadebljanje zalistaka, što sužava otvor (stenoza) i otežava protok krvi. Druga mogućnost su promjene u građi zalistaka što sprečava potpuno zatvaranje zalistaka. ZAMETAK, v. embrij. ZAMETNI LISTIĆ, v. embrioblast. ZAŠTITA OKOLIŠA, skup aktivnosti kojima se nastoji smanjiti štetno djelovanje čovjeka na živi i neživi okoliš. Zaštita prirode u Hrvatskoj utemeljena je 69. člankom. Ustava Također su donešeni, osim temeljnih (Zakon o zaštiti okoliša i Zakon o zaštiti prirode), zakoni o npr. vodama, šumama, zaštiti bilja i zraka. Osnivanjem različitih kategorija zaštite prirode pokušavaju se očuvati određena biogeografska područja, v. dodatak 4. (kategorije zaštite prirodne baštine Hrvatske). ZAŠTITNA OBOJENOST (kriptična obojenost, grč. krypto = skriven), obojenost tijela ili dijelova tijela kojom organizmi oponašaju svoj okoliš te ih čini manje uočljivim njihovim neprijateljima, kao npr. bijela boja polarnih životinja. Ta prilagodba ima važnu ulogu pri prirodnom odabiru. ZAVOJITA TRIHINA, opasan nametnik iz skupine oblića. Čovjek se zarazi ako jede zaraženu svinjetinu. Trihine se u organizam unose u obliku čahura. Brzo se razmnožavaju, a mlade trihine koje se izlegu u limfnim žilama čovjeka, naseljuju se u mišićima. Oko njih se stvara čahura od vezivnog tkiva. Uzrokuju bolove u mišićima, povišenu temperaturu i dr. ZEISS, C., njemački tvorničar, znameniti graditelj optičkih instrumenata. ZELENA PUPAVKA, v. stapčarke. ZELENE ALGE, jednostanični i višestanični zeleni organizmi čija boja potječe od

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

a i b klorofila. Produkt fotosinteze je škrob. Stanična stijenka je od celuloze. Predstavnici su kišna alga (Pleurococcus), klamidomonas (Chlamydomonas), volvoks (Volvox), spirogira (Spirogyra), morska salata (Ulva lactuca) itd. Razmnožavaju se vegetativno (mitotičkom diobom), spolno gametama koje proizvodi spolna generacija ili gametofit te nespolno sporama koje se razvijaju na sporofitu, uz prethodnu redukcijsku diobu. Iz zigote gametofita razvija se nespolna generacija, sporofit, a iz spore se razvije spolna generacija, gametofit. Spolno i nespolno razmnožavanje pravilno se izmjenjuju i nadopunjuju. Sporofit je uvijek diploidna generacija, a gametofit haploidna. To je bit izmjene generacija. Taj proces se zove i antitetska izmjena generacija. ZELENE PLIJESNI, v. mješinarke i penicilijum. ZEMLJINA PRAATMOSFERA, v. praatmosfera. ZIGOTA, oplođena jajna stanica koja nastaje stapanjem različitih spolnih stanica (gameta). Sadrži diploidan broj kromosoma (2n), tj. haploidan broj kromosoma (n) od oca i haploidan broj kromosoma (n) od majke. Zigota se dijeli mitotičkim diobama te se tako iz nje razvija novi organizam. ZIMSKI SAN (hibernacija), zimsko mirovanje životinja nalik na san. Za to vrijeme životinje se ne hrane a štitna žlijezda održava tjelesnu toplinu i 20 0C nižu od normalne. Tako se čuva energija jer se metabolizam jako uspori, do točke smrzavanja organizma. Na pr. od sisavaca: kukcojedi, šišmiši, glodavci i neki medvjedi. Mnogi vodozemci i gušteri nepovoljne zimske uvjete preživljavaju zakopani u mulju ili u tlu. ZJENICA (pupilla), v. bjeloočnica.

ZMIJE, ljuskaši iz skupine gmazova. Koža im je pokrivena rožnatim ljuskama. Nemaju noge već se pokreću svijanjem trupa i repa koji zajedno imaju 200 i više kralješaka. Hrane se isključivo drugim životinjama. Imaju kvadratnu kost, a svaka se strana donje čeljusti može pomicati neovisno dok gutaju plijen. U čeljustima imaju zube. Zmije otrovnice imaju žljebaste ili šuplje zube koji su povezani s parom otrovnih žlijezda. Te su žlijezde preobražene žlijezde slinovnice. Zmije nemaju pokretne očne kapke već im je oko pokriveno prozirnom opnom. Nemaju ni bubnjić, ali vibracije osjete preko kostiju lubanje. Umjesto organa za sluh imaju osjetljiv rašljasti jezik koji služi i za opip i njuh. U našim krajevima česte su, od neotrovnih zmija npr. bjelouška, crvenkrpica i kravosas, a od otrovnica poskok i riđovka. ZNANOST, sveukupno, povezano organizirano i sistematizirano ljudsko znanje. Razlikujemo prirodne i društvene znanosti. U prirodne znanosti ubrajaju se biologija, matematika, fizika i kemija. ZNANSTVENI RAD, tekst u kojem znanstvenik iznosi u javnost način rada i rezultate svojih istraživanja. Znanstveni rad iz područja biologije obično sadrži naslov rada, ime autora, sažetak, uvod, materijal i metode rada, rezultate, raspravu, zaključak, zahvalu i popis literature. ZNOJ, tekućina po kemijskom sastavu slična mokraći. Sastoji se od 95 do 98 posto vode, otopljena NaCl, mokraćevine, mokraćne kiseline, amonijaka i hlapljivih masnih kiselina. Ishlapljivanje znoja ima važnu ulogu u termoregulaciji i regulaciji sastava tjelesnih tekućina. ZNOJNE ŽLIJEZDE, isto što i žlijezde znojnice. ZOOCENOLOGIJA, znanost o zoocenozama, isp.


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

ZOOCENOZA (grč. zoon = životinja, koine = zajednica), prirodna životna zajednica životinja u nekoj biocenozi. Ovu životinjsku komponentu biocenoze proučava znanost zoocenologija. ZOOFAGI, drugo ime za mesojede. ZOOLOGIJA, znanost koja proučava životinje. ZOOPLANKTON, v. plankton. ZORIDBENA DIOBA, v. mejoza. ZRAČENJE, emitiranje različitih vrsta zraka od kojih neke mogu štetno djelovati na organizme. Utjecaj zračenja na neki organizam ovisi, ne samo o samom organizmu, već i o vrsti i količini zračenja. Tako je za zdravlje čovjeka posebno opasno radioaktivno zračenje (alfa, beta, gama i neutronsko zračenje) čije posljedice mogu biti vidljive odmah nakon ozračivanja ili se mogu ispoljiti u potomstvu (mogu izazvati mutacije). ZRAKASTA (radijalna) SIMETRIJA, simetrija kod koje su organi smješteni zrakasto oko središnje osi. Radijalno simetrične životinje su sjedilački (sesilni) ili slabo pokretni organizmi, kao npr. žarnjaci ili bodljikaši. ZRAKAŠI, v. korjenonošci. ZVIJERI, skupina sisavaca koja se hrani mesom. Grabežljivci su i zubi su im prilagođeni za hvatanje, ubijanje i komadanje plijena. Kod nas su poznate zvijeri: medvjed, vuk, lisica, ris, lasica, kuna, vidra i dr.

Ž ŽABE, v. bezrepci.


ŽABNJACI, jedna od najprimitivnijih skupina dvosupnica. Zeljaste su biljke. Listovi su najčešće razdijeljeni. U dvospolnom se cvijetu nalaze zavojito poredani veći broj prašnika i plodnih listova. Plod je orah ili mjehur. Žabnjacima pripadaju mnoge livadne biljke (žabnjak ljutić, zlatica), šumske biljke (bijela šumarica, crni kukurijek) te močvarne biljke (kaljužnica). Jedini drvenasti žabnjak je pavitina. ŽARNE STANICE (knidociti), posebni oblici stanica kod žarnjaka. Najgušće su poredane na lovkama. Njima love hranu. U svakoj se stanici nalazi žarnica ili knida. To je stanični organel koji sadrži otrov i jednu smotanu cjevčicu. Kada se žarnica podraži, izbaci se cjevčica kroz koju istječe otrov. Nove se žarnice mogu obnoviti za 48 sati. ŽARNJACI (Cnidaria), zrakasto simetrični bezkralježnjaci. Žive pretežno u moru, a porodica hidri u slatkoj vodi. Pojavljuju se u dva oblika tijela - polip i meduza. Sistematski se dijele na tri skupine: obrubnjaci, koralji i režnjaci. Mnogi žarnjaci, posebno zadružni, izgrađuju unutarnje i vanjske kosture. Usta su okružena lovkama i nastavljaju se u probavnu (gastrovaskularnu) šupljinu, bez crijevnog otvora. Tijelo izgrađuju tri sloja: epiderm ili ektoderm, mezogleja i gastroderm ili endoderm. U epidermu se nalaze i žarne stanice. Nemaju organe za disanje i izlučivanje. Živčani sustav je mrežast. Polipi žarnjaka imaju veliku moć regeneracije. Razmnožavaju se nespolno pupanjem (polipi) i spolno. Ako se spolno razmnožavaju spolovi su razdvojeni. Oplodnja je vanjska. Iz oplođenog jajeta razvija se trepetljikava ličinka planula. Mnogi žarnjaci imaju izmjenu nespolne i spolne generacija, isp. metageneza. ŽELUČANA LIPAZA, probavni enzim iz želučanog soka koji sudjeluje u razgradnji masti.

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

ŽELUČANE ŽLIJEZDE, nalaze se u stijenci želuca. One luče na dan oko 2000 mL probavnih sokova i sluzi (mukoza). Probavni želučani sokovi sastoje se od probavnih enzima (pepsin) i kloridne kiseline (HCl).

početkom razvoja leđne moždine kod svitkovaca. Optjecajni sustav je otvoren. Za izlučivanje imaju dva para nefridija. Žiroglavci su razdvojena spola. Iz oplođenog jaja nastaje ličinka tornarija koja se razvija u odrasli oblik.

ŽELUDAC, prošireni je dio probavne cijevi u čovjeka, volumena oko 1200 do 1500 ml. Sastoji se od ulaznog dijela jednjaka u želudac, kardije (cardia), tijela želuca (fornix, corpus, fundus) i izlaznog dijela, pilorusa koji se veže na dvanaesnik, duodenum. Na izlazu iz želuca nalazi se prstenasti mišić - pilorični sfinkter koji zadržava hranu u želucu dok se dovoljno ne probavi, nakon čega se hrana, sada pod nazivom himus, otpušta u dvanaesnik. U stijenci se nalaze želučane žlijezde. Zbog prisutnosti razrijeđene HCl u želucu je pH oko 1.5.

ŽIVA BIĆA, biljni i životinjski organizmi i čovjek. Razlikuju se od nežive prirode po sljedećim obilježjima: imaju staničnu građu, hrane se, dišu, izmjenjuju tvari s okolišem, osjetljivi su na podražaj, rastu, razmnožavaju se i umiru.

ŽENSKI SPOLNI ORGANI, razlikujemo unutarnje organe: jajnike, jajovode, maternicu i rodnicu i vanjske organe: stidnicu i dražicu (klitoris). ŽILNICA (chorioidea), srednji sloj tkiva očne jabučice. Bogata je krvnim kapilarama koje oku dopremaju kisik i hranidbene tvari. ŽIROGLAVCI, morske životinje koje pripadaju malokolutićavcima. Nazivaju se i polusvitkovci. Smatra se da je iz sličnih oblika u davnoj prošlosti poteklo razvojno stablo svitkovaca. Pokretni su i bilateralno simetrični oblici. Tijelo je oblo, crvoliko i podijeljeno na tri dijela: glavicu (prosomu, rilo), ogrlicu na kojoj su usta (sa donje strane) i dugačak trup. U šupljinu glavice ulazi potporni štapić koji se može smatrati začetkom svitka. Na ždrijelu imaju niz škržnih pukotina, što također pokazuje sličnost sa svitkovcima. Filtrirajući vodu sakupljaju hranu, ali i dišu jer je ždrijelo dobro prokrvljeno. Žiroglavci imaju i leđnu živčanu vrpcu koja se može smatrati

ŽIVAC, snopovi živčanih vlakana (aksona, neurita) obavijeni ovojnicom. Ima osjetilnih, motoričkih ili mješovitih živaca. ŽIVČANA STANICA (neuron), osnovna građevna i funkcionalna jedinica živčanog sustava koja ima svojstvo primanja i provedbe podražaja. Građena je od tijela stanice (soma) iz kojega izlazi veći broj kratkih živčanih vlakana (dendrita) i jedno duže živčano vlakno, akson (neurit). Tijelo živčane stanice sadrži većinom iste organele kao i ostale tjelesne stanice osim centrosoma, zbog čega se ne mogu dijeliti. Neurit je obavijen mijelinskom ovojnicom. Snopovi aksona čine živčane putove u mozgu i leđnoj moždini, a na periferiji živce. Na okončinama aksona nalaze se završne nožice pomoću kojih se ostvaruje sveza - sinapsa. Neurone možemo podijeliti na osjetilne (receptorne, senzorične), prijenosne i pokretačke (motorične). ŽIVČANI PODRAŽAJ, podražaj koji nastaje i prenosi se u živčanom sustavu između živčanih stanica i to kemijskim putem pomoću posebnih kemijskih tvari, neurohormona (neurotransmitera). Pri prolasku živčanog podražaja mijenja se propusnost membrane živčanih stanica za ione natrija što uzrokuje promjenu membranskog potencijala stanice.


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________

ŽIVČANI SUSTAV, sustav koji s milijardama živčanih stanica (neurona) prima, prenosi, obrađuje, pohranjuje i očitava brojne informacije iz tijela i okoline, te reagira na primljene podražaje ili obavlja misaonu radnju. Zajedno s endokrinim (hormonalnim) sustavom upravlja životnim funkcijama. Funkcionalno ima dva osnovna dijela: tjelesni (somatski) i vegetativni (autonomni). Prema građi, smještaju i ulozi koju obavlja, živčani sustav možemo podijeliti na osjetilni i pokretački, središnji i periferni, voljni i autonomni. ŽIVČANO-MIŠIĆNA VEZA (motorička pločica, sinapsa), mjesto prijenosa živčanog podražaja (impulsa) sa živca na mišićno vlakno. Vlakno sadrži brojna mišićna vlakanca, miofibrile, koja su građena od niti miozina i aktina. Živčani podražaj uzrokuje oslobađanje prijenosne tvari acetil-kolina, koji ulazi u sinaptičku pukotinu i omogućuje prijenos podražaja na mišić. Nastaje akcijski potencijal mišićnog vlakna i povećava se koncentracija iona kalcija u vlaknu. To potiče oslobađanje energije iz ATP-a, koja je potrebna za klizanje aktina i miozina jednih među druge odnosno kontrakciju mišićnih vlakana. ŽIVI FOSILI, biljni i životinjski organizmi koji su živjeli u davnoj prošlosti, a održali su se do danas. Npr. riba latimerija (iz Indijskog oceana) preostala je od davno izumrle skupine resoperki ili kinesko drvo ginko, primitivna golosjemenjača koja je po nekim obilježjima srodna papratnjačama. ŽIVI SVIJET, čine živa bića (isp.). Iako nema posve oštrih granica među pojedinim skupinama živih bića ipak ih možemo podijeliti prije svega na nadcarstva prokariote, eukariote i posebno izdvojene viruse. U prokariote spada carstvo monere, a u eukariote protisti, gljive, biljke i životinje.




Životinje Eukarioti

Protisti Monere


Shema podjele živih bića

ŽIVOTINJE, heterotrofni eukarioti. Dijele se na jednostanične i mnogostanične. ŽIVOTINJSKA STANICA, v. stanica. ŽIVOTINJSKI VIRUSI, v. virusi. ŽIVOTNA ZAJEDNICA (biocenoza, grč. bios = život, koine = zajednica), zajednica raznovrsnih biljnih i životinjskih organizama na određenom staništu, odnosno skupina jedinki različitih populacija koje žive na određenom staništu, a usko su povezane različitim međuodnosima, posebno u hranidbenim lancima. Tako npr. postoje šumske, livadne, močvarne, jezerske i druge biocenoze. Životne se zajednice sastoje od biljaka (fitocenoza), životinja (zoocenoza) i mikroorganizama (mikrobiocenoza). ŽLIJEZDE S UNUTARNJIM IZLUČIVANJEM, v. endokrine žlijezde. ŽLIJEZDE SLINOVNICE, žlijezde koje luče slinu. Kod čovjeka postoje tri para: podušne (parotidne), podvilične (submandibularne) i podjezične (sublingvalne) i imaju svoje izvodne kanale u usnu šupljinu. Izlučuju na dan 1 do 1,5 sline, pH vrijednosti 5,6 do 7,6, u kojoj se nalazi probavni enzim ptijalin (alfa amilaza). Taj enzim već u ustima razgrađuje škrob u maltozu i glukozu. Lučenje je sline refleksna reakcija. ŽLIJEZDE ZNOJNICE, nalaze se usmini kože. Važne su za regulaciju sastava tjelesnih tekućina i termoregulaciju. U

____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE

tijelu ih ima oko 2 do 3 milijuna, a najviše na čelu, nosu, pod pazuhom, na dlanovima i tabanima. Izlučuju znoj, isp. ŽLJEZDANO (ekskrecijsko) STANIČJE, služi proizvodnji i izlučivanju određenih vrsta tvari u biljaka. Jako se međusobno razlikuju u svim elementima ovisno o bljnoj vrsti. Nektariji su žljezde koje luče slatki (“cvjetni”) sok nektar koji primamljuje kukce oprašivače. Tu su još žljezdane dlake koje proizvode različite hlapljive i mirisne tvari, npr. porodica usnača (majčina dušica, kadulja, bosiljak i druge). Eterična ulja u štitarki proizvode proizvode se u posebnim stanicama i izlijevaju u uljne kanale. Mliječne cijevi s mliječnim sokom svojstvene su biljkama iz porodica makova, mlječika itd. Četinjače, osim porodice tise, u svim svojim dijelovima sadrže smolenice, smolne kanale s bogatim sadržajem hlapljivih smola. ŽUČ, stvara se u stanicama jetre. Zajednički izvodni kanal žučovoda (ductus choledocus) ulijeva žuč u dvanaesnik. Žuč je složena otopina koja sadržava soli žučnih kiselina za emulgiranje (raspršivanje) masti, žučnu boju bilirubin (produkt raspalog hemoglobina iz mrtvih eritrocita), kolesterol, lecitin te različite elektrolite. ŽUČNI KAMENCI, stvaraju se u žučnom mjehuru u početku kao male krute čestice, koje s vremenom postaju sve veće.

Uzrok nastanku žučnih kamenaca nije poznat. Ako kamenac zapne u žučovodu, spriječit će se protok žuči u crijevo. Može nastati upala, infekcija mjehura i žučovoda, a javljaju se grčevi i jaka bol (žučne kolike). Kod potpunog začepljenja žučovoda nastaje žutica. Liječi se odstranjenjem žučnog mjehura s kamencima (kolecistektomija). ŽUČNI MJEHUR, tvorba kruškolikog oblika smještena na donjoj strani jetre, pohranjuje i koncentrira žuč nastalu u jetri. Kapacitet žučnog mjehura je oko 500 mL žuči na dan. ŽUTICA NOVOROĐENČETA, v. fetalna eritroblastoza. ŽUTO TIJELO (corpus luteum), tvorba koja nastaje u jajniku sisavaca iz Graafovog mjehurića nakon ovulacije. Sastoji se od luteinskih stanica koje sadrže masti i koje su žute jer sadrže žutu boju lutein po čemu je čitava tvorba i dobila ime. Luteinske stanice izlučuju hormone estrogene i progesteron. Tijekom trudnoće žuto tijelo izlučuje povećane količine estrogena i progesterona koji sprječavaju pojavu menstruacije i time gubitak ploda. Ako nije došlo do oplodnje žuto tijelo se smanjuje, prestaje izlučivati hormone, iz svojih stanica gubi masti i postaje bijelo tijelo (corpus albicans).


ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________


____________________________________________________ ŠKOLSKI LEKSIKON BIOLOGIJE



ŠKOLSKI LEKSIKON BIOLOGIJE ____________________________________________________


_________________________________________________________________________ Pitanja

Pitanja s jednim točnim odgovorom 1. Trofoblast nalazimo u embrionalnom razvitku: A) ježinaca B) žabe C) daždevnjaka D) kukaca E) čovjeka 2. Srednji zametni listić se zove: A) ektoderm B) endoderm C) mezoderm D) blastoderm E) blastocista 3. Raspored kromosoma i gena u gametama ovisi o: A) prvoj mejotičkoj diobi B) drugoj mejotičkoj diobi C) metafazi mitoze D) u jednakoj mjeri o obje mejotičke diobe E) o rasporedu kromosoma koji se uspostavi već u zigoti 4. Razasuti u citoplazmi ili vezani uz opne endoplazmatske mrežice su: A) lizosomi B) mitohondriji C) kloroplasti D) grana E) ribosomi 5. Tilakoide nalazimo u: A) mitohondrijima B) ribosomima C) Golgijevom tijelu D) kloroplastima E) kromosomima 6. Jezgru nemaju: A) spermiji B) jajašca

C) spolne prastanice D) jednostanične alge E) modrozelene alge 7. Mitoza je važna jer se za njenog trajanja: A) udvostručuju DNK B) udvostručuju kromosomi C) odvajaju kromatide istog kromosoma D) sparuju homologni kromosomi E) vrši redukcija broja kromosoma 8. Aktivni prijenos kroz staničnu membranu ovisi o: A) veličini čestica koje se prenose B) koncentracijama otopina s jedne i s druge strane membrane C) veličini pora u membrani D) svojstvima otapala E) raspoloživom ATP 9. Kromatin je sastavni dio: A) jezgre B) ribosoma C) endoplazmatske mrežice D) centriola E) lizosoma 10. Kretanje molekule otopljene tvari iz područja veće u područje manje koncentracije dviju otopina odvojenih opnom zove se: A) difuzija B) dijaliza C) osmoza D) fagocitoza E) Brownovo gibanje 11. Nakupine hidrolitičkih fermenata nalaze se u: A) jezgri B) jezgrici C) kromatinu D) lizosomima E) ribosomima


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________

12. Kromosomi se udvostručuju u: A) profazi B) metafazi C) anafazi D) telofzi E) ni u jednoj navedenoj fazi 13. Oba roditelja (zamorci) s crnim krznom daju potomke i s crnim i s bijelim krznom. Kojih su genotipova roditelji ili o kakvom se križanju radi: A) Aa x AA B) AA x AA C) Aa x Aa D) intermedijarno križanje E) test križanje

D) koji se događa samo za vrijeme svjetlosnih reakcija fotosinteze E) koji se događa samo u mitohondrijima 18. RNK su nasljedna tvar: A) bičaša B) bakterija C) modrozelenih alga D) bakterijskih virusa E) biljnih virusa 19. Sastavni dio enzima je uvijek: A) neki metal B) oligosaharid C) jedan ili više polipeptida D) jedan ili više polinukleotida E) oligonukleotid

14. Razgradnja glukoze do alkohola i CO2 zove se: A) glikoliza B) fosforilacija C) redukcija CO2 D) fermentacija E) Krebsov ciklus

20. ATP je spoj skupine: A) aminokiselina B) monosaharida C) oligosaharida D) steroida E) nukleotida

15. Disaharid je: A) škrob B) riboza C) saharoza D) fruktoza E) galaktoza

21. Izvor vodikovih iona u fotosintezi je: A) klorofil B) NADPH2 C) atmosferski vodik D) voda E) glukoza

16. Glikoliza se odvija u: A) hrapavoj endoplazmatskoj mrežici B) glatkoj endoplazmatskoj mrežici C) Golgijevom tijelu D) citoplazmatskom matriksu E) mitohondriju

22. Dušične baze nalaze se u: A) polisaharidima B) trigliceridima C) polipeptidima D) polinukleotidima E) aminokiselinama

17. Oksidacija je proces: A) u kojem neka molekula prima elektrone B) u kojem neka molekula gubi elektrone C) uzajamnog primanja i gubitaka elektrona

23. Proces u kojem se formiraju zametni listići zove se: A) brazdanje B) gastrulacija C) sporulacija D) partenogeneza E) metamorfoza


_________________________________________________________________________ Pitanja

24. Zigota je: A) jajna prastanica B) spermijska prastanica C) neoplođeno jaje D) oplođeno jaje E) partenogenetski aktivirano jaje 25. Jajna stanica sazrijeva u: A) Graafovom folikulu B) jajovodu C) maternici D) sjemeniku E) žutom tijelu 26. Hipotalamus: A) sintetizira gonadotropne hormone B) izlučuje gonadotropne hormone C) kontrolira sintezu gonadotropnih hormona D) sintetizira prolaktin E) izlučuje tiroksin 27. Bijelo tijelo (korpus albikans) susreće se u: A) u svakoj stanici viših biljaka B) u spolnim stanicama životinja C) sjemeniku D) jajniku E) prostati 28. Za vrijeme trudnoće: A) luči se više estrogena od progesterona B) luči se više progesterona od estrogena C) prestaje sinteza progesterona D) prestaje sinteza estrogena E)adenohipofiza počne izlučivati oksitocin 29. Prolaktin izlučuje: A) hipotalamus B) mliječna žlijezda C) jajnik D) adenohipofiza E) neurohipofiza

30. Stalnu funkciju sjemenika regulira i održava: A) hipotalamus B) prostata C) muški spolni hormon kore nadbubrežne žlijezde D) timus E) neurohipofiza 31. Izlučivanje oksitocina za vrijeme dojenja uvjetuje: A) mliječna žlijezda B) neurohipofiza C) adenohipofiza D) hipotalamus E) jajnik 32. Trojku ili kodon čine tri: A) dušične baze B) deoksiribonukleinska kiselina C) aminokiseline D) molekule ATP E) hormona hipofize 33. Koliko dušičnih baza određuje ugradnja jedne aminokiseline pri sintezi bjelančevina? A) 1 B) 3 C) 6 D) 9 E) 16 34. 4 fenotipa omjera 25%:25%:25%:25% nastaju križanjem: A) dvaju različitih homozigota B) dvaju različitih heterozigota C) dvaju jednakih heterozigoa D) jednog heterozigota s recesivnim homozigotom E) jednog heterozigota s dominantnim homozigotom 35. Zakone nasljeđivanja formulirao je: A) Darwin


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________

B) Mendel C) Mendelejev D) Morgan E) Lamarck

B) fitofagi C) zoofagi D) heterofagi E) autotrofi

36. U Mendelovim križanjima graška duge i kratke stabljike djelovanje recesivnog činioca izrazilo se u F2 generaciji u: A) 50% potomaka B) 25% potomaka C) 75% potomaka D) 10% potomaka E) 0% potomaka

42. Primarna organska produkcija je proizvodnja: A) autotrofnih biljaka B) heterotrofnih biljaka C) heterotrofnih životinja D) heterotrofnih bakterija E) mesojeda

37. U tundri se uglavnom nalaze: A) crnogorično drveće B) listopadno drveće C) travnjaci D) papratnjače E) mahovine i lišaji 38. Svi ekosustavi zajedno čine: A) biotop B) biosferu C) populaciju D) biocenozu E) ionosferu 39. Važni razlagači u ekosustavima su: A) mesojedi B) stonoge i kukci C) zelene biljke D) biljojedi E) heterotrofne bakterije 40. Prostor na kojem je raspoređena neka vrsta organizama je: A) biom B) relikt C) areal D) vegetacija E) endem 41. Na prvom mjestu hranidbenog lanca u biocenozi su: A) saprofagi


43. Suvremenom shvaćanju evolucije ne pripada činilac: A) genska snaga B) izolacija C) svrsishodnost D) divergencija E) prirodna selekcija 44. Endoplazmatska mrežica: A) dobro je razvijena u embrionalnim stanicama B) dobro je razvijena u stanicama gušterače C) slabo je razvijena u stanicama gušterače D) dobro je razvijena u stanicama tumora E) u jednakoj je mjeri razvijena u svim tipovima životinjskih stanica, dok je manje razvijena u biljnih stanica 45. Zelene biljke u morskoj vodi dopiru prosječno do dubine: A) 100 m B) 200 m C) 300m D) 400m E) 450 m 46. Omjer fenotipova 9:3:3:1 dobije se samo ako su genotipovi dvaju roditelja: A) AAbb i AAbb B) aaBB i aaBb

_________________________________________________________________________ Pitanja

C) AaBb i AaBb D) AaBb i aabb E) AAbb i aaBB 47. Koji će od navedenih genotipova dati fenotip koji se razlikuje od ostala 4 fenotipa: A) AABB B) AaBB C) AaBb D) AABb E) AAbb 48. Heterozigoti su zijevalice: A) samo bijele B) samo crvene C) samo ružičaste D) crvene i bijele E) crvene i ružičaste 49. Za pripadnike krvne grupe A karakteristično je da na membranama svojih eritrocita imaju: A) aglutinogen A B) aglutinogen B C) aglutinogen A i aglutinogen B D) anti A aglutinin E) anti A i anti B aglutinin 50. Križanjem ružičaste i crvene zijevalice nastaju: A) sve ružičaste zijevalice B) sve crvene zijevalice C) 50% bijelih i 50% crvenih zijevalica D) 25% crvenih i 75% ružičastih zijevalica E) 50% crvenih i 50% ružičastih zijevalica 51. Najpovoljniji pH za većinu enzima (fermenata) kreće se oko: A) 3 B) 5 C) 7 D) 9 E) 11

52. Točan rezultat fotosinteze je: A) C6H10O5 + 6O2 + 6H2O B) C6H12O6 + 12O2 + 6H2O C) C6H12O6 + 6O2 + 12H2O D) C6H12O6 + 6O2 + 6H2O E) C6H12O6 + 10O2 + 6H2O 53. Što se ne odnosi na oksitocin: A) hormon koji izlučuje adenohipofiza B) hormon koji izlučuje neurohipofiza C) potiče sekreciju mlijeka nakon poroda D) dospijeva krvlju do maternice E) izaziva kontrakciju mišića maternice 54. Konjugacija kromosoma događa se u: A) profazi mitoze B) metafazi mitoze C) profazi I mejotičke diobe D) profazi II mejotičke diobe E) metafazi II mejotičke diobe 55. Prvi sisavci javljaju se u: A) permu B) trijasu C) srednjem mezozoiku D) tercijaru E) kvartaru 56. Grašak genotipa AABb može proizvoditi gamete s genima: A) A B) B C) b D) Bb E) AB 57. Jednostruku membranu imaju: A) jezgra B) ribosomi C) mitohondriji D) centrosom E) lizosomi 58. Citologija je znanost o: A) strukturi stanice


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________

B) molekulskoj građi stanice C) biokemijskoj građi jezgre D) biokemijskoj građi i funkciji stanice E) tri su odgvora točna

B) gonadotropni hormoni C) intersticijskih stanica D) žutog tijela E) bijelog tijela

59. Vezivanjem jedne molekule glukoze i jedne molekule galaktoze nastaje: A) saharoza B) celuloza C) laktoza D) galaktoza E) fruktoza

65. Citoplazmatske organele obavijene membranom imaju: A) samo biljne stanice B) samo životinjske stanice C) bakterije D) modrozelene alge E) eukariotske stanice

60. Pasivni transport ne može biti: A) preko proteinskih prenosilca B) u smjeru pada koncentracije C) preko kanalnih proteina D) od manje koncentracije prema većoj E) olakšana difuzija

66. Zametni listići su slojevi stanica koji nastaju: A) brazdanjem B) gastrulacijom C) organogenezom D) histogenezom E) zbog posebne privlačnosti među stanicama

61. Koji su parovi komplementarnih baza u DNK? A) adenin-uracil B) adenin-gvanin C) citozin-timin D) citozin-gvanin E) citozin-uracil 62. Najveće količine energije u stanici veže molekula ovog sastava: A) adenozin, riboza i fosfat B) adenozin, riboza i trifosfat C) adenin, riboza i difosfat D) adenin, riboza i fosfat E) adenozin i trifosfat 63. Molekula klorofila može reagirati na svjetlosnu energiju Sunca ako je u: A) oksidiranom stanju B) reduciranom stanju C) blizini molekule glukoze D) blizini molekule glikogena E) blizini molekule škroba 64. Estrogen i progesteron su hormoni: A) hipofize


67. Što ukazuje na početak gastrulacije u žaba: A) formiranje zametnih listića B) pojava blastoporusa C) povećanje blastule D) nestanak blastocela E) pojava arhenterona 68. Za razvitak živčanog sustava potreban je kontakt: A) mezoderma s ektodermom B) endoderma s ektodermom C) endoderma s mezodermom D) svih triju zametnih listića E) trofoblasta s embrioblastom 69. U kojem križanju dolazi do izražaja princip slobodne kombinacije? A) monohibridnom s dominacijom B) monohibridnom intermedijarnom C) dihibridnom s dominacijom D) u svim tipovima križanja E) u križanjima s diploidnim organizmima

_________________________________________________________________________ Pitanja

70. Kod intermedijarnog nasljeđivanja u biljke zijevalice pojavljuju se u F2 generaciji i fenotipovi i genotipovi u omjeru: A) 1/2:1/2 B) 1/4:1/4:1/4:1/4 C) 3:1 D) 9:3:3:1 E) 1:2:1 71. Vezani geni se nalaze: A) samo na X kromosomu B) samo na autosomima C) na spolnim kromosomima D) na različitim kromosomima E) na istom kromosomu 72. Modrozelene alge se razlikuju od bakterija po tomu što imaju: A) plastide B) kloroplaste C) klorofil D) jezgru E) jezgricu 73. Kloroplast se sastiji od: A) mikrofilamenata B) mikrotubula C) tilakoida D) endoplazmatskog retikuluma E) svi su odgovori točni 74. Peptidnu vezu tvore skupine: A) OH i H B) COOH i NH2 C) COOH i COOH D) NH2 i NH2 E) COOH i OH 75. Genetski materijal bakteriofaga je: A) DNK B) RNK C) polinukleotidni lanci obilježeni izotopom D) polipeptidni lanci obilježeni izotopom E) DNK iRNK

76. Testosteron se najjače izlučuje u: A) doba oplodnje B) embrionalno doba C) fetalno doba D) novorođenačko doba E) pubertetu 77. DNK možemo razlikovati od RNK po: A) broju C-atoma u šećerima B) broju H-atoma u šećerima C) fosfornoj kiselini D) sustavu pirimidina E) sustavu purina 78. Ovulacija se događa na: A) 1. dan menstrualnog ciklusa B) 7. dan menstrualnog ciklusa C) 14. dan menstrualnog ciklusa D) 21. dan menstrualnog ciklusa E) 28. dan menstrualnog ciklusa 79. Neurosekrecijski faktori oslobađanja gonadotropnih hormona imaju kao glavni cilj tkivo: A) hipotalamusa B) hipofize C) uterusa D) dojke E) ovarija 80. Adenohipofiza luči: A) testosteron B) estrogen C) progesteron D) gonadotropne hormone E) oksitocin 81. Blastocistu u svom razvoju imaju: A) morski ježinac B) vodozemci C) sisavci D) identični blizanci E) višejajni blizanci


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________

82. Interfaza je: A) razdoblje mirovanja stanica B) dioba kromosoma C) G1, S i G2 faza D) vrijeme spiralizacije kromosoma E) vrijeme nestanka jezgrice

88. Timin je: A) pirimidin B) purin C) vitamin D) nukleozid E) nukleotid

83. Omjer fenotipova 75%:25% dati će roditelji: A) AA x aa B) Aa x aa C) aa x aa D) Aa x Aa E) AA x AA

89. DNK i RNK ponašaju se kao kiseline zbog svojih: A) deoksiriboza B) riboza C) purinskih baza D) pirimidinskih baza E) fosfata

84. Membranski proteini mogu biti: A) Djelomično hidrofilni B) djelomično hidrofobni C) enzimski aktivni D) u obliku kanalića E) sve su tvrdnje točne

90. RNK prepoznajemo po prisutnosti: A) riboze i fosforne kiseline B) riboze i adenina C) deoksiriboze i uracila D) riboze i timina E) riboze i uracila

85. Aminokiseline se u bjelančevinama vežu: A) slabim vezama B) vodikovim vezama C) nekovalentnim vezama D) peptidnim vezama E) slabim kovalentnim vezama 86. Svojstva i ulogu neke bjelančevine određuje: A) broj aminokiselina B) broj i vrsta aminokiselina C) broj, vrsta i raspored aminokiselina D) broj, vrsta i raspored trideset raznih aminokiselina E) broj, vrsta i raspored četrdesetak raznih aminokiselina 87. Nukleotidi izgrađuju: A) nukleus B) nukleolus C) nukleoid D) adenozin E) polinukleotide


91. Promjer dvostruke uzvojnice DNK iznosi: A) 3.4 nm B) 0.34 nm C) 1 nm D) 2 nm E) 10nm 92. Enzimi: A) omogućuju kemijske reakcije u stanici B) mogu djelovati samo u stanicama C) se u stanicama nalaze u kristalnom stanju D) su dijelovi molekula vitamina E) djeluju kao hormoni 93. Lipaza razgrađuje: A) maltozu B) škrob C) lipide D) proteine E) glukozu

_________________________________________________________________________ Pitanja

94. Pasivni prijenos kroz membranu: A) odvija se od niže prema višoj koncentraciji tvari B) odvija se "nizbrdo" kao u osmozi i dijalizi C) odvija se uz utrošak energije D) odvija se pomoću membranskih prenosilaca E) troši ATP 95. U nukleolusu se sintetizira: A) DNK B) RNK C) gRNK D) tRNK E) rRNK 96. Korpus luteum luči: A) luteotropni hormon B) gonadotropne hormone C) FSH, LH i LTH D) progesteron i estrogen E) oksitocin 97. Prolaktin nastaje u: A) režnjevima hipofize B) hipotalamusu C) neurohipofizi D) adenohipofizi E) žlijezdanom tkivu dojke

100. Blastomera je dio: A) neoplođenog jajeta B) zigote C) blastule D) gastrule E) blastocela 101. Genotip recesivnog homozigota je: A) Aa B) aa C) AA D) AaBb E) AABB 102. Omjer fenotipova 1:1 dati će roditelji: A) AA x aa B) Aa x aa C) aa x aa D) Aa x Aa E) AA x AA 103. F1 generaciju dobiti ćemo križanjem roditelja: A) Aa x Aa B) Aa x aa C) AA x aa D) AaBb x AaBb E) AaBb x aabb

98. Zametni listići nastaju: A) iz blastocela B) trofoblasta C) blastule D) blastoderma E) blastoporusa

104. Ako se geni A i C nalaze na dva razna mjesta istog kromosoma onda govorimo o: A) slobodnoj kombinaciji B) vezanim genima C) spolno vezanim genima D) monohibridnom nasljeđivanju E) intermedijarnom nasljeđivanju

99. Trofoblast se razvija u: A) embrij B) fetus C) placentu D) blastoderm E) blastocel

105. U biologiju spada: A) citologija B) molekulska biologija C) taksonomija D) histologija E) svi su odgovori točni


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________

106. Koji od navedenih organela nemaju membrane? A) mitohondriji biljnih stanica B) kloroplasti C) lizosomi D) ribosomi E) Golgijevo tijelo

112. Molekula koja veže najveće količine energije u stanici sastoji se od: A) adenina, riboze i fosfata B) adenozina, riboze i fosfata C) adenozina, riboze i trifosfata D) adenina, riboze i trifosfata E) ništa od navedenog

107. Kada se udvostručuje DNK? A) u anafazi mitoze B) u anafazi mejoze C) u profazi mitoze D) u profazi mejoze E) u interfazi

113. Ovulacija je: A) formiranje žutog tijela B) formiranje bijelog tijela C) izbacivanje jajašca iz Graafovog mjehurića D) putovanje jajne stanice u maternicu E) spajanje jajašca sa spermijem

108. Kojom se citološkom metodom služimo za proučavanje stanica izvan organizma? A) autoradiografijom B) svjetlosnim mikroskopom C) elektronskim mikroskopom D) kulturom stanica i tkiva E) svi su odgovori točni

114. Hormon testosteron: A) je gonadotropni hormon B) luče intersticijske stanice C) luče stanice adenohipofize D) ne luči se u pubertetu E) luči se tek u doba spolne zrelosti

109. U sastav adenina ne ulazi: A) vodik B) dušik C) sumpor D) ugljik E) kisik 110. Vezanjem jedne molekule glukoze i jedne molekule fruktoze nastaje: A) laktoza B) galaktoza C) saharoza D) fruktoza E) celuloza 111. Koji su parovi komplementarnih baza u RNK? A) adenin-timin B) citozin-uracil C) gvanin-citozin D) citozin-timin E) adenin-gvanin


115. Mejoza je dioba: A) jajnih stanica B) spermija C) slična mitozi D) spermatogeneze i oogeneze E) poznata samo u sisavaca 116. Mezoderm u žaba nastaje kretanjem stanica: A) u unutrašnjost blastule B) u arhenteron C) po površini gastrule D) ektoderma E) endoderma 117. Fenotip je genetički izraz koji označuje: A) oblik i boju organizma B) strukturu i funkciju organizma C) "miješanje" očevih i majčinih gena D) rezultat uzajamnog djelovanja okoliša i genotipa E) kakav je genotip

_________________________________________________________________________ Pitanja

118. Križanjem graška duge i kratke stabljike dobijeno je i potomstvo duge i kratke stabljike. U kojem omjeru ih treba očekivati od ukupno 120? A) 60 dugih i 60 kratkih B) 80 dugih i 40 kratkih C) 90 dugih i 30 kratkih D) 70 dugih i 50 kratkih E) 100 dugih i 20 kratkih 119. Koji od navedenih genotipova može biti potomak roditelja AABB x aabb? A) AaBB B) aaBB C) aabb D) AaBb E) AAbb 120. Omjeri fenotipova u F2 generaciji intermedijarnog križanja su: A) 9:3:3:1 B) 3:1 C) 1:2:1 D) 1:1 E) 1:1:1:1 121. Mutacije gena su uvijek: A) spontane mutacije B) inducirane mutacije C) nasljedne promjene gena D) dominantne E) na istom kromosomu 122. Znanost koja se bavi odnosima u biocenozi i odnosima biocenoze i okoliša zove se: A) ekologija B) biocenologija C) biogeografija D) biogeokemija E) fitocenologija 123. Geološko razdoblje karbon ili ugljeno doba značajno je po razvoju: A) gljiva

B) alga C) papratnjača D) golosjemenjača E) kritosjemenjača 124. Za endoplazmatsku mrežicu vezani su: A) mitohondriji B) kloroplasti C) centrioli D) ribosomi E) lizosomi 125. Konačni proizvod fotosinteze je: A) CO2 B) H2O C) NADP-H2 D) C6H12O6 E) O2 126. U kemijskom sastavu gvanina nema: A) kisika B) natrija C) ugljika D) vodika E) dušika 127. Naziv ATP je kratica za molekulu sljedećeg sastava: A) adenin, riboza i fosfat B) adenozin, riboza i trifosfat C) adenozin i trifosfat D) adenozin i fosfat E) ništa od navedenog 128. Prijelaz tvari između dviju otopina različitih koncentracija odvojenih opnom zove se: A) osmoza B) difuzija C) dijaliza D) aktivan prijelaz E) svi su odgovori točni 129. U sastav kože ne ulaze stanice: A) žlijezda znojnica


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________

B) žlijezda lojnica C) dlake D) masnog tkiva E) hrskavice 130. Što je karakteristično za oogenezu? A) dvije redukcijske diobe B) jedna mejotička dioba C) nema mitoze D) tri diploidne polocite E) jedna haploidna jajna stanica 131. Što od navedenog ne odgovora prvoj mejotičkoj diobi? A) konjugacija kromosoma B) spiralizacija kromosoma C) odvajanje homolognih kromosoma D) odvajanje kromatida E) odvajanje centriola 132. Arhenteron je šupljina: A) koja odgovara blastocelu B) koja odgovara blastoporusu C) pracrijeva D) obavijena mezodermom E) obavijena ektodermom 133. Od kojeg se zametnog listića razvije živčano tkivo? A) od mezoderma B) od ektoderma C) od bilo kojeg zametnog listića D) od endoderma E) svi su odgovori točni 134. Za vrijeme gastrulacije posebnom aktivnošću endodermalnih stanica nastaje: A) mezoderm u sisavaca B) trofoblast u sisavaca C) mezoderm u ježinaca D) sekundarna tjelesna šupljina E) ništa od navedenog 135. Adenohipofiza luči velike količine prolaktina:


A) u trudnoći B) neposredno prije poroda C) neposredno nakon poroda D) za vrijeme ovulacije E) za vrijeme oplodnje 136. Nasljeđivanje: A) je prenošenje osobina na potomstvo B) vrši se preko jajeta C) vrši se preko spermija D) je spajanje gameta E) nijedan odgovor nije točan 137. Koje križanje ima kao rezultat uniformnost potomstva: A) test križanje B) monohibridno C) dihibridno D) križanje roditeljske (P) generacije E) križanje filijalne F1 generacije 138. Genotip jednog roditelja je AaBb. Koji je genotip drugog roditelja ako je omjer potomstva 1/4 : 1/4 : 1/4 : 1/4? A) aaBB B) AAbb C) AaBB D) AABB E) aabb 139. Kakve cvjetove ima zijevalica u F1 generaciji: A) crvene cvjetove B) bijele cvjetove C) ružičaste cvjetove D) ima i crvenih i bijelih cvjetova E) ima crvenih, bijelih i ružičastih cvjetova 140. Mutacije spolnih stanica se pojavljuju: A) u muškim spolnim stanicama B) u ženskim spolnim stanicama C) u određeno vrijeme D) u sljedećim generacijama

_________________________________________________________________________ Pitanja

E) zajedno sa somatskim mutacijama 141. Genetičke šifre UAG i UAA A) ne znače ništa (nonsense code) B) su degenerirane šifre za leucin C) su degenerirane šifre za prolin D) su degenerirane šifre za arginin E) su degenerirane šifre za serin 142. Mjerilo gustoće svake populacije je: A) abiotski činilac B) skup ekoloških činilaca C) skup bioloških činilaca D) biomasa E) ekološka valencija 143. Procesi smjenjivanja biocenoze na nekom prostoru spadaju u: A) evoluciju B) sukcesiju C) melioraciju D) fenološku pojavu E) svi su odgovori točni 144. Koliko milijardi godina su stari prvi tragovi organizama na zemljinoj kori? A) 1,5 B) 2 C) 2,5 D) 3 E) 4 145. Pramajmun nazvan prophilopitekus živio je u: A) eocenu B) oligocenu C) miocenu D) pliocenu E) pleistocenu 146. Molekulska biologija proučava: A) sve molekule u prirodi B) uzajamno djelovanje makromolekula C) male molekule stanica D) velike molekule žive i nežive prirode E) metabolizam

147. Bjelančevine su izgrađene od: A) aminokiselina B) glicina C) alanina D) glicil-alanina E) dipeptida 148. Gvanin je: A) pirimidin B) purin C) nukleozid D) nukleotid E) polinukleotid 149. DNK prepoznajemo po prisustvu: A) riboze i citozina B) gvanina C) adenina D) deoksiriboze i timina E) deoksiriboze i uracila 150. DNK se sintetizira: A) udvostručavanjem ishodišne molekule B) na kalupu RNK C) od pojedinačnih baza D) od parova baza E) od dinukleotida 151. Enzimi su: A) organske molekule male molekuske mase B) anorganske molekule C) bjelančevine D) vitamini E) hormoni 152. Fotosinteza je predočena jednadžbom: A) CO2 + H2O → C6H12O6 + H2O B) 6CO2 + 6H2O → C6H12O6 + 6O2 + 6H2O C) 6CO2 + 12H2O → C6H12O6 + 6O2 + 6H2O


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________

D) 4H- + 2NADP + 4e- → 2NADP-H2 E) ADP + P + ENERGIJA → ATP 153. Kodon UUU u glasničkoj RNK uvjetuje ugradnju sljedeće aminokiseline u rastući peptidni lanac: A) metionina B) lizina C) serina D) fenilalanina E) valina 154. Gonadotropni hormoni utječu na: A) hipotalamus B) adenohipofizu C) neurohipofizu D) gonade E) klimakterij 155. Poznati aksiom "Svaka stanica od stanice" dao je: A) R. Virchow B) J. Purkinje C) M. J. Schleiden D) Th. Schwann E) R. Brown 156. Na proizvodnju mlijeka nakon poroda utječu: A) estrogeni u ovarija B) progesteron iz luteinskih stanica C) prolaktin iz adenohipofize D) oksitocin iz adenohipofize E) gonadotropni hormoni 157. Blastula je konačni proizvod: A) oplodnje B) organogeneze C) brazdanja D) metamorfoze E) gastrulacije 158. Trudnoća u čovjeka, računajući od prvog dana poslijednje menstruacije, traje:


A) 38 tjedana B) 40 tjedana C) 42 tjedna D) 270 dana E) 9 mjeseci 159. Omjer fenotipova 9 : 3 : 3 : 1 dat će roditelji: A) Aa x Aa B) AA x aa C) AABB x aabb D) AaBb x aabb E) AaBb x AaBb 160. Križanjem graška duge stabljike (Aa) s kratkom (aa) dat će omjer fenotipova: A) 1 : 1 B) 1 : 1 : 1 : 1 C) 75% : 25% D) 9 : 3 : 3 : 1 E) 1 : 2 : 1 161. Evolucija proučava: A) postanak jedinke B) razvoj jedinke od začeća do rođenja C) embrionalni razvoj čovjeka D) postanak vrsta E) razvoj odnosa žive i nežive prirode 162. Embriologija proučava: A) razvoj vrste B) razvoj jedinke od njenog začeća do rođenja C) samo embrij D) samo fetus E) samo gastrulu 163. Disaharid laktoza sastoji se od: A) glukoze i glukoze B) glukoze i fruktoze C) glukoze i galaktoze D) galaktoze i galaktoze E) fruktoze i fruktoze 164. Bjelančevine ubrajamo u: A) male organske molekule

_________________________________________________________________________ Pitanja

B) velike anorganske molekule C) polinukleotide D) polisaharide E) makromolekule 165. U sastav proteina ulazi sljedeći broj različitih prirodnih aminokiselina: A) 5 B) 10 C) 15 D) 20 E) 25 166. Što se od navedenog ne nalazi u eukariotskim stanicama? A) bičevi B) cilije C) vaukole D) nukleoidi E) stanična stijenka 167. Nukleotidi izgrađuju: A) šećer B) lipide C) polisaharide D) enzime i proteine E) nukleinske kiseline 168. Citozin je: A) pirimidin B) purin C) vitamin D) aminokiselina E) nukleotid 169. Polinukleotid je sastavljen od mnogo: A) aminokiselina B) polipeptida C) dušičnih baza D) nukleotida E) adenozina 170. ATPaza razgrađuje: A) AMP B) ADP C) ATP

D) škrob E) maltozu 171. Adenozin monofosfat je: A) purinska baza B) pirimidinska baza C) spoj baze i šećera D) nukleotid E) energetski vrlo bogat 172. Puno ima NADP iz svjetlosnih reakcija fotosinteze glasi: A) adenozin difosfat B) nikotin-adenin difosfat C) nikotinamid-adenin difosfat D) nikotinamid-adenin dinukleotid E) nikotinamid-adenin dinukelotid fosfat 173. Aktivni prijenos kroz membranu: A) odvija se od više prema nižoj koncentraciji tvari B) teče "nizbrdo" C) odvija se uz pomoć prenosilaca i energije D) uključuje dijalizu i osmozu E) predstavlja difuziju 174. Stanična jezgra u interfazi: A) sadrži kromosome B) ima jednostruku opnu C) prisutna je u toku čitavog staničnog ciklusa D) sadrži jezgrin sok i kromatin E) prisutna je u svim stanicama čovječjeg tijela 175. Intersticijske stanice testisa: A) luče testosteron B) luče faktore oslobađanja hormona hipofize C) predstavljaju germinativni epitel D) luče gonadotropne hormone E) aktivne su samo u toku puberteta


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________

176. ICSH (engl. Interstitial Cell Stimulating Hormone) djeluje na: A) folikule B) uterus C) dojku D) testis E) intersticijske stanice 177. Embrioblast se razvija u: A) placentu B) resice C) embrij D) blastoderm E) blastocel 178. F2 generaciju dobit ćemo križanjem roditelja: A) aa X AA B) aa X aa C) AA X AA D) aA X AA E) aA X aA 179. Križanjem graška duge stabljike (AA) s kratkom (aa) dati će u potomstvu omjer: A) 1 : 1 B) 1 : 1 : 1 : 1 C) 75% : 25% D) 9 : 3 : 3 : 1 E) 100% dugih

E) u virusima 182. Bakterijskom nukleoidu u eukariota po funkciji odgovara: A) nuklein B) nukleolus C) nukleotid D) kromosom E) nukleozid 183. Anafaza I je značajna po: A) razdvajanju centriola B) udvostručavanju pričvrsnica C) razdvajanju kromatida D) razdvajanju kromosoma E) konjugaciji kromosoma 184. Haploidan broj kromosoma, koji se sastoje od dviju kromatida, nalazimo u: A) profazi I B) metafazi I C) anafazi I D) telofazi I E) telofazi II 185. Žuto tijelo izlučuje: A) LH B) LTH C) FSH D) ICSH E) progesteron

180. Intermedijarno nasljeđivanje pokazuje u F2 generaciji: A) jednu klasu fenotipova B) dvije klase fenotipova C) tri klase fenotipova D) proporciju 3 : 1 E) proporciju 1 : 1

186. Genetička šifra koja daje uputu za sintezu polipeptida koji se sastoji isključivo od fenilalanina je sljedeća: A) GUA B) CUC C) AUC D) AUA E) UUU

181. Golgijevo tijelo se nalazi: A) samo u životinjskim stanicam B) samo u biljnim stanicama C) u stanicama eukariota D) u bakterijama

187. Kako će se prepisati genetska poruka koja na molekuli DNK ima sljedeći redoslijed baza TAGGCCA? A) TUGGCCU B) AUGGCCU


_________________________________________________________________________ Pitanja

C) TUGGCCU D) AUCCGGU E) TAGGCCT 188. Koji produkt sinteze očekujemo od redoslijeda nukleotida na lancu DNK: CGTATGCGTACGCAAGCACCA? A) monopeptid B) dipeptid C) tripeptid D) polipeptid E) ništa od navedenog 189. U aktiviranoj zigoti najprije se javljaju: A) nove stanice B) mejotičke diobe C) mitotičke diobe D) blastomere E) sve su tvrdnje točne 190. Koja je od navedenih zigota po fenotipu različita od svih ostalih? A) AaBB B) AABb C) AABB D) AAbb E) AaBb 191. Koliko ima različitih fenotipova u F2 generaciji dihibridnog križanja: A) 16 B) 9 C) 8 D) 4 E) 2 192. Koji od navedenih roditelja mogu dati potomstvo koje za jedno svojstvo pokazuje omjer 3 : 1: A) aabb x AABB B) AABb x aaBB C) aaBb x aaBb D) AaBb x aabb E) aabb x aaBb

193. Geni A i b nalaze se na različitim kromosomima pa zato govorimo o: A) intermedijarnom nasljeđivanju B) monohibridnom nasljeđivanju C) slobodnoj kombinaciji D) vezanim genima E) spolno vezanim genima 194. Omjer genotipova u F2 generaciji intermedijarnog križanja je sljedeći: A) 1 : 1 B) 3 : 1 C) 1 : 1 : 1 : 1 D) jednak je omjeru fenotipova E) ništa od navedenog 195. Koji od navedenih primjera odgovara gameti zadanog roditelja AaBb: A) aa B) bb C) Aa D) Bb E) niti jedan odgovor nije točan 196. Međusobnim križanjem roditelja istih genotipova CcDd dobiva se potomstvo u sljedećem omjeru: A) 1 : 1 B) 1 : 1 : 1 : 1 C) 1 : 2 : 1 D) 9 : 3 : 3 : 1 E) 3 : 1 197. Omjer genotipova i fenotipova 1 : 1 dobiva se križanjem roditelja: A) BB x bb B) Bb x Bb C) Bb x bb D) Bb x BB E) bb x bb 198. Vrste kojima je areal rasprostranjenosti u prošlosti bio mnogo širi, a sada su ograničene na uže područje zovu se: A) biomi


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________

B) populacije C) relikti D) endemi E) svi su odgovori točni 199. Biologija je znanost o: A) biljkama B) životinjama C) čovjeku D) životu E) jednostaničnim organizmima 200. Eukariotska stanica: A) nema jezgru B) ima jezgru C) otkrivena je elektronskim mikroskopom D) velika je 1 mikrometar E) je stanica bakterije

C) bakterijske stanice D) ljudske stanice E) eukariotske stanice 205. Jezgru nalazimo u: A) virusa B) bakterija C) prokariota D) eukariota E) eritrocitima čovjeka 206. Biljna stanica, za razliku od životinjske ima sposobnost: A) mitotičkih dioba B) metabolizma C) disanja D) fotosinteze E) mejotičkih dioba

201. Bakterija je: A) eukariotska stanica B) prokariotska stanica C) stanica s jezgrom D) životinjska stanica E) stanica bez DNA

207. Zeleni pigment koji omogućuje fotosintezu nalazi se u: A) jezgri B) mitohondriju C) ribosomu D) endoplazmatskoj mrežici E) kloroplastima

202. Ribosomi su zrnca na kojima se odvija sinteza: A) DNA B) RNA C) proteina D) masti E) šećera

208. Biljna stanica, za razliku od životinjske ima: A) ribosome B) jezgru C) citoplazmu D) staničnu stijenku E) staničnu membranu

203. Kloroplaste nalazimo u: A) bakterija B) životinja C) prokariota D) biljaka E) virusa 204. Bakteriofagi predstavljaju viruse koji napadaju: A) biljne stanice B) životinjske stanice

209. Najvažnija anorganska molekula našeg tijela je: A) šećer B) voda C) protein D) mast E) DNA 210. Deoksiribonukleinska kiselina sastavljena je od: A) nukleusa B) nukleolusa


_________________________________________________________________________ Pitanja

C) nukleoida D) nukleotida E) riboza 211. DNA ima u svom sastavu šećer: A) ribozu B) heksozu C) saharozu D) triozu E) deoksiribozu 212. Adenin je: A) šećer B) aminokiselina C) purin D) pirimidin E) hormon 213. Citozin je: A) polisaharid B) polipeptid C) pirimidin D) purin E) vitamin 214. DNA izgrađuje: A) ribosome B) citoplazmu C) mitohondrije D) gene E) membrane 215. DNA je odgovorna za sintezu: A) masti B) ugljikohidrata C) bjelančevina D) lipida E) steroidnih hormona 216. Molekula RNA najčešće je: A) jednolančani polinukleotid B) dvolančani polinukleotid C) jednolančani polisaharid D) dvolančani polisaharid E) trolančani polipeptid

217. Pentapeptid je lanac sastavljen od: A) 3 aminokiseline B) 5 aminokiselina C) 7 aminokiselina D) 3 glukoze E) 5 nukleotida 218. Genetska šifra sastoji se od: A) jednog nukleotida B) dva susjedna nukleotida C) tri susjedna nukleotida D) četiri susjedne aminokiseline E) pet susjednih aminokiselina 219. Brazdanje završava oblikom zametka koji zovemo: A) blastula B) gastrula C) zigota D) blastocel E) blastoderm 220. Gonadotropne hormone luči: A) cijela hipofiza B) prednji režanj hipofize C) stražnji režanj hipofize D) hipotalamus E) sjemenik 221. Estrogene i progesteron luče: A) hipotalamus B) stražnji režanj hipofize C) prednji režanj hipofize D) jajnik E) sjemenik 222. Anatomija istražuje: A) mikroskopsku građu živih bića B) mikroskopsku građu pojedinih organa C) makroskopsku građu živih bića D) pojedine sustavne kategorije živih bića E) međusobne odnose pojedinih organa 223. Ekologija proučava:


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________

A) uzajamne odnose žive i nežive prirode B) postanak vrsta u prirodi C) uzroke sličnosti i razlika među organizmima D) funkciju pojedinih staničnih dijelova E) pojedine vrste živih bića 224. Koji je od navedenih elemenata neophodan za život za razliku od ostalih koji se javljaju samo u tragovima: A) Cl B) H C) Mn D) Zn E) J 225. Tirozin i serin spadaju u: A) aminokiseline B) purinske baze C) pirimidinske baze D) nukleotide E) ni jedan odgovor nije točan 226. U prevođenju genetičke poruke jedna je aminokiselina određena: A) s jednom bazom B) s tri baze C) s četiri baze D) s dvije baze E) svi odgovori mogu biti točni 227. Koje od navedenih baza nema DNK? A) citozina B) uracila C) timina D) gvanina E) adenina 228. Gvanin se veže za: A) uracil B) adenin C) citozin D) timin E) bilo koju pirimidinsku bazu


229. Koji je od navedenih primjera homozigot samo za 1 par alela: A) aAbB B) aaBB C) AABB D) aabb E) aaBb 230. Koje od spomenutih križanja daje potomstvo u omjeru 1 : 1: A) AaBb x AAbb B) Aa x aa C) Aa x Aa D) AA x aa E) nijedno 231. Koje od navedenih križanja nije test križanje? A) Aa x aa B) Bb x bb C) AAbb x aaBB D) AaBb x aabb E) Aabb x aaBb 232. Gamete dihibridnog križanja su sljedeće: A) Aa B) Bb C) AA D) Ab E) svi su odgovori točni 233. Koji je omjer fenotipova u potomstvu koje dobijemo križanjem AaBb x AaBb ako su geni vezani i među njima nema krosingovera? A) 1 : 1 B) 3 : 1 C) 1 : 2 : 1 D) 9 : 3 : 3 : 1 E) 1 : 1 : 1 : 1 234. Koliko kromosoma imaju gamete vinske mušice? A) 2

_________________________________________________________________________ Pitanja

B) 4 C) 6 D) 8 E) ni jedan od navedenih 235. Koji od navedenih genotipova spada u P (parentalnu ili roditeljsku) generaciju? A) aaBb B) aabb C) AaBB D) AABb E) Aabb 236. Koliko % muške djece će imati hemofiliju ako je majka prenosilac, a otac zdrav? A) 50% B) 25% C) 100% D) 75% E) Svi će sinovi biti zdravi 237. Što se događa u anafazi I mejotičke diobe? A) konjugacija homolognih kromosoma B) redukcija broja kromosoma C) odjeljivanje homolognih kromosoma D) odjeljivanje kromatida svakog kromosoma E) sve navedeno 238. Virusi nemaju: A) jezgre B) ribosome C) membrane D) RNK i DNK zajedno E) svi su odgovori točni 239. Od trofoblasta će se razviti: A) blastoderm B) posteljica (placenta) C) tijelo embrija D) embrioblast E) amnion ili alantois

240. Ekologiji danas pripada zadatak da ispita odnos: A) biljaka prema životinjama B) nežive prirode prema biljkama C) nežive prirode prema životinjama D) čovjeka prema fizičkim faktorima okoline E) čovjeka prema ostaloj prirodi 241. Crossing over omogućuje postanak novih vrsta gameta u: A) monohibridnih homozigota B) monohibridnih heterozigota C) dihibridnih homozigota D) dihibridnih heterozigota u slobodnoj kombinaciji E) dihibridnih heterozigota s vezanim genima 242. Promjenu genske upute zovemo: A) varijacija B) mutacija C) rekombinacija D) transformacija E) degenerirana šifra 243. Prvi antibiotik je otkrio: A) L. Pasteur B) R. Koch C) A. Fleming D) R. Virchow E) E. Haeckel 244. Homologni kromosomi uključuju u svojem paru: A) kromosom 1 i kromosom 21 B) kromosom 2 i kromosom 22 C) kromosom 5 i kromosom 15 D) kromosom 8 i kromosom 18 E) kromosom X i kromosom Y 245. FSH, LH i LTH proizvodi su: A) ovarija B) testisa C) hipofize


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________

D) hipotalamusa E) neurohipofize 246. Prolaktin nastaje u: A) hipotalamusu B) adenohipofizi C) neurohipofizi D) dojci E) mliječnim mjehurićima 247. Otac koji normalno raspoznaje boje i majka daltonist imat će: A) sve kćeri daltoniste B) svu djecu daltoniste C) sve sinove daltoniste D) svu djecu normalnu E) sve sinove normalne 248. Djed albino (aa, autosomsko recesivno svojstvo) i baka normalne pigmentacije (AA) imali su kćer normalne pigmentacije. Ona je u svom braku imala četvoro djece, među kojima je jedno dijete albino. Kakvog je genotipa najvjerojatnije bio otac? A) AA B) Aa C) XY D) XX E) XXY 249. Obzirom na sastav svojih spolnih kromosoma, dvije različite vrste stanica nalazimo među: A) jajnim stanicama B) somatskim stanicama žena C) somatskim stanicama muškaraca D) spermatogonijama E) spermijima 250. Jednak broj ženka i mužjaka u potomstvu drozofile nastaje stoga što vinska mušica ima: A) jednaki broj jajnih stanica s X i onih sa Y kromosomima


B) jednaki broj spermija s X i onih sa Y kromosomima C) 3 para autosoma i 1 par spolnih kromosoma D) 6 autosoma i 2 X kromosoma E) ukupno 8 kromosoma 251. Križanjem genotipa Aabb s aaBb dobit ćemo u njihovom potomstvu omjer fenotipova: A) 1 : 1 B) 3 : 1 C) 9 : 3 : 1 D) 1 : 1 : 1 : 1 E) 1 : 2 : 1 252. Križanje roditelja AaBbCC s reoditeljem AaBbCC dati će u potomstvu sljedeći omjer fenotipova: A) 1 : 1 B) 3 : 1 C) 9 : 3 : 3 : 1 D) 1 : 1 : 1 : 1 E) uniformnu generaciju (100%) 253. Križanje roditelja AAbbCC i aaBBcc dati će potomstvo sa sljedećim genotipom: A) AABBCC B) AaBbCc C) aabbcc D) 50% AaBbCc i 50% aabbcc E) 50% AABBCC i 50% AaBbCc 254. Vezani geni moraju se nalaziti na: A) X kromosomu B) Y kromosomu C) prvom kromosomu D) dvadesetprvom kromosomu E) istom kromosomu 255. ATP se dobiva spajanjem: A) adenozina s monofosfatom B) adenozina s difosfatom C) AMP + P

_________________________________________________________________________ Pitanja

D) ADP + P E) adenina s trifosfatom 256. Pomoću adenozin trifosfata u stanicama se obavlja sljedeće: A) sintetske aktivnosti B) proizvodnja topline C) proizvodnja podražaja D) kretanje E) svi su odgovori točni 257. Stanicu je prvi opazio: A) Leeuwenhoek B) Hooke C) Schleiden D) Schwann E) Buchner 258. Za mitozu je karakteristično: A) dioba kromosoma B) reduplikacija DNK C) redukcijska dioba kromosoma D) jednak broj kromosoma u novim stanicama E) dioba centriola 259. Pričvrsnica je posebno mjesto na: A) centriolu B) endoplazmatskoj mrežici C) Golgijevom tijelu D) kromatinu E) kromosomu 260. Nukleoidi su: A) jezgrice B) jezgre C) područja s DNK u bakterija D) spolni kromosomi E) kariotipovi 261. Blastocel je: A) otvor blastule B) otvor gastrule C) šupljina blastule D) šupljina gastrule

E) osnova celoma 262. U ježinaca se mezoderm razvija od stanica: A) animalnog pola blastule B) vegetativnog pola blastule C) gastrule D) endoderma E) ektoderma 263. Živčani sustav razvija se od: A) mezoderma B) endoderma C) trbušnog ektoderma D) bočnog ektoderma E) leđnog ektoderma 264. Od endoderma nastaju: A) bubrezi B) vezivna tkiva C) spolne žlijezde D) krvne žile E) sluznica probavila 265. Test križanje se primjenjuje: A) da bi se otkrio genotip dominantnog fenotipa B) da bi se otkrio genotip recesivnog fenotipa C) samo u monohibridnom križanju D) samo u dihibridnom križanju E) u intermedijarnom križanju 266. Koji od navedenih primjera odgovara test križanju: A) aa x AA B) aa x Aa C) Aa x Aa D) AaBb x AaBb E) aaBB x AAbb 267. U monohibridnom križanju s dominacijom omjer fenotipova u F2 generaciji je sljedeći: A) 1 : 2 : 1


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________

B) 3 : 1 C) 1 : 1 D) 1 : 1 : 1 : 1 E) 9 : 3 : 3 : 1 268. Koliko različitih gameta može dati genotip AaBb ? A) 1 B) 2 C) 3 D) 4 E) 8 269. Kojoj aminokiselini odgovara slijed baza UUU u g-RNK: A) glicinu B) lizinu C) valinu D) argininu E) fenilalaninu 270. Fiziologija proučava: A) čovjeka B) funkcije pojedinih organa C) životinje D) biljke E) biljna i životinjska tkiva 271. Nauka o evoluciji proučava: A) uzajamne odnose živih bića B) postanak vrsta u prirodi C) pojedine vrste životinja D) pojedine vrste biljaka E) funkciju pojednih organa 272. Autoradiografija: A) pomaže kod proučavanja staničnog metabolizma B) zasniva se na primjeni nestabilnih radioaktivnih izotopa C) pomaže kod praćenja sinteze molekula D) pomaže kod praćenja raspada molekula u stanici E) svi su odgovori točni


273. Adenin i uracil spadaju u: A) peptide B) aminokiseline C) dušikove baze D) nukleinske kiseline E) nukleotide 274. Za Golgijevo tijelo nije točno: A) da spada u stanične organele B) da se sastoji od kanalića C) da ima ribosome D) da se nalazi u žlijezdanim stanicama E) da se nalazi u biljnim stanicama 275. Za ribosome je značajno: A) da su obavijeni membranom B) da su uvijek vezani za membrane endoplazmatske mrežice C) da se nalaze u svim tipovima stanica D) da u svome sastavu nemaju bjelančevina E) da u svome sastavu nemaju enzima 276. Koje od navedenih baza nema u RNK? A) gvanina B) adenina C) uracila D) timina E) citozina 277. Kemijski sastojci stanične membrane su: A) RNK B) DNK C) svi tipovi nukleinskih kiselina D) lipidi E) sve navedeno 278. Koji je od spomenutih primjera recesivan za jedan par alela ? A) Aabb B) aaBB C) aaBb D) AAbb E) svi primjeri

_________________________________________________________________________ Pitanja

279. Koje od navedenih križanja nije test križanje ? A) AaBb x aabb B) AaBB x AAbb C) Aabb x aaBb D) Aa x aa E) Bb x bb 280. Vezani geni se nalaze: A) na različitim kromosomima a određuju ista svojstva B) na istom kromosomu a određuju ista svojstva C) na istom kromosomu a određuju različita svojstva D) na istom kromosomu bez obzira na svojstva koja određuju E) jedino na kromosomima vinske mušice 281. Gamete dihibridnog križanja su sljedeće: A) Ab B) AA C) Bb D) Aa E) svi su odgovori točni

284. Koji je diploidan broj kromosoma u drozofile: A) 4 B) 6 C) 8 D) 10 E) 12 285. Ako u dihibridnom test križanju ne dobijemo cijepanje alela u potomstvu nego su svi potomci jednaki, to zanči da je dominantni fenotip roditelja morao biti sljedećeg genotipa: A) AaBB B) AABB C) aaBb D) AABb E) Aabb 286. Genotipovi F2 (druge sinovske) generacije mogu biti: A) AaBB B) aaBb C) AaBb D) Aabb E) svi navedeni

282. Koji omjer genotipova dobijemo u potomstvu ako križamo AABB x Aabb uz pretpostavku da se radi o vezanim genima? A) isti kao i omjer fenotipova B) svi su genotipski jednaki C) isti kao da geni nisu vezani D) 3 : 1 E) 1 : 1 : 1 : 1

287. Aleli su geni: A) koji kontroliraju jedan drugog B) koji mogu biti u odnosu dominacije i recesivnosti C) u parovima za svako svojstvo D) na paru homolognih kromosoma E) svi su odgovori točni

283. Ako je majka prenosilac hemofilije a otac hemofiličar, koja je vjerojatnost da njihova djeca dobiju hemofiliju ? A) 25% ženske djece B) 50% muške i 50% ženske djece C) 100% ženske djece D) 100% muške djece E) nijedan odgovor nije točan

288. Virusi imaju: A) staničnu membranu B) staničnu stijenku C) ribosome D) RNK i DNK E) sve gore navedeno


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________

289. Čovjek kao i sva druga živa bića pokazuje sljedeće značajke: A) staničnu građu B) individualnost C) metabolizam D) razmnožavanje E) sve nabrojene

295. Ribonukelinsku kiselinu prepoznajemo po prisustvu: A) citozina B) gvanina C) adenina D) pentoze E) uracila

290. Golgijevo tijelo nalazimo u: A) mitohondrijima B) citoplazmi C) ribosomima D) jezgri E) jezgrici

296. Sintezu proteina prema genetskoj uputi zapisanoj u glasničkoj RNK zovemo: A) prepisivanje B) udvostručavanje C) mutiranje D) čitanje E) prevođenje

291. Križanac ili hibrid prikazan je sljedećim genotipom: A) AABBCC B) aabbcc C) AAbbCC D) aaBBcc E) AABbCC 292. Tripansoma spada u: A) zelene alge B) zelene bičaše C) korijenonošce D) truskovce E) praživotinje 293. Izrazito polarna molekula našeg tijela je: A) kolesterol B) mast C) steroidni hormon D) estrogen E) voda 294. Struktura i funkcija svake ljudske stanice ovisi prvenstveno o njenim: A) lipidima B) ugljikohidratima C) nukleinskim kiselinama D) proteinima E) RNK


297. Novi oblici gena, aleli, nastaju: A) prevođenjem genske upute B) prepisivanjem genske upute C) udvostručavanjem D) mutiranjem E) čitanjem 298. Omjer od 3/4 graška duge stabljike prema 1/4 biljaka kratke stabljike dobivamo križanjem: A) dviju biljaka kratke stabljike B) dviju biljaka dugih stabljika (homozigotnih) C) dviju biljaka dugih stabljika (heterozigotnih) D) kratkih s dugim biljkama (homozigotnih) E) kratkih s dugim biljkama (heterozigotnih) 299. Četiri različite vrste gameta dati će jedinka genotipa: A) Aa B) AA C) AAbb D) AaBb E) AaBbCc

_________________________________________________________________________ Pitanja

300. Dvije različite vrste gameta dati će jedinka genotipa: A) AA B) aa C) AaBB D) AaBb E) AaBbCc

305. Što se od navedenog nalazi i u bakterija i u modrozelenih algi ? A) ribosomi B) kloroplasti C) mitohondriji D) lizosomi E) ništa od navedenog

301. Ljudski kromosomi 1,2 i 3 čine u kariotipu skupinu: A) A B) B C) C D) D E) E

306. Atavizmima se najintenzivnije bavi: A) genetika B) pedijatrija C) kirurgija D) citologija E) evolucija

302. Fiziološka otopina sadrži 0.9% NaCl i eritrociti čovjeka u njoj ostaju neoštećeni. Fiziološka je otopina dakle prema eritrocitima: A) monotonična B) izotonična C) hipertonična D) hipodonična E) atonična 303. Broj jedinki neke vrste ne određenom prostoru predstavlja njenu: A) biomasu B) populaciju C) gensku snagu D) konkurenciju E) simbiozu 304. Humana genetika raspoređuje gene čovjeka u genetičke karte. Pojam genetič ka karta potječe iz znanstvenog rada: A) G. Mendela B) T. Morgana C) F. Cricka D) J. Watsona E) A. Hersheya

307. Ostatak repića u novorođenčeta predstavlja: A) relikt B) mutaciju C) rudiment D) endem E) edem 308. Kodoni predstavljaju trojke nukleotida u: A) DNK B) virusnoj RNK C) ribosomskoj RNK D) transportnoj RNK E) glasničkoj RNK 309. Poliuridilnu kiselinu predočuje: A) uridin-uridin B) AAA AAA C) UUA UUA D) AUG AUG E) poliU 310. Polifenilalanin nastavit će u toku sinteze bjelančevine na kalupu sljedeće ribonukleinske kiseline: A) AAA B) UUU AAA


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________


C) dušikove baze D) peptide E) aminokiseline

311. Genetska uputa u molekule DNK za ugradnju aminokiseline fenilalanin u peptidni lanac glasi: A) UUU B) TTT C) AAA D) CCC E) GGG

317. Pirimidinske baze su: A) dušične baze B) citozin C) timin D) uracil E) svi su odgovori točni

312. Histologija je nauka o: A) biljkama B) životinjama C) funkciji pojedinih organa D) biljnim i životinjskim tkivima E) međusobnom djelovanju tkiva i organa 313. Ekologija je nauka o: A) pojedinim vrstama životinja B) pojedinim vrstama biljaka C) pojedinim vrstama živih bića D) međusobnim odnosima živih bića i njihove okoline E) postanku vrsta u prirodi 314. Hipoglikemija je: A) nedostatak minerala u organizmu B) pomanjkanje tekućine u organizmu C) smanjena razina glukoze u krvi D) nedostatak vitamina C E) nedostatak vitamina D 315. Steroidi su: A) posebna skupina lipida B) spolni hormoni C) hormoni kore nadbubrežne žlijezde D) neki vitamini E) svi su odgovori točni 316. Glicin i alanin spadaju u: A) nukleinske kiseline B) nukleotide


318. Koji je od spomenutih primjera dominantan fenotip ? A) Aa B) AA C) AaBb D) AABb E) svi navedeni primjeri 319. Koje od navedenih križanja nije test križanje ? A) AaBb x aabb B) Aabb x aaBb C) Aa x aa D) AA x Aa E) Bb x bb 320. Vezanim genima nazivamo gene koji se nalaze: A) na istom kromosomu a određuju različita svojstva B) na istom kromosomu a određuju ista svojstva C) na istom kromosomu bez obzira na svojstva koja određuju D) na različitim kromosomima a određuju ista svojstva E) nijedan odgovor nije točan 321. Koji od navedenih primjera nije recesivan samo za jedan par alela ? A) aaBb B) AAbb C) aaBB D) Aabb

_________________________________________________________________________ Pitanja

E) aabb 322. Koji od navedenih omjera odgovara rezultatu test križanja ? A) 9 : 3 : 3 : 1 B) 1 : 1 : 1 : 1 C) 3 : 1 D) 1 : 2 : 1 E) niti jedan 323. Ako križamo AaBb x aabb a geni su vezani i nema krosingovera, koji omjer dobivamo kod potomstva? A) 1 : 1 B) 1 : 1 : 1 : 1 C) 9 : 3 : 3 : 1 D) 3 : 1 E) 1 : 2 : 1 324. Koje nasljeđivanje nazivamo spolno vezanim? A) koje je vezano za jedan spol B) nasljeđivanje gena na X kromosomu C) nasljeđivanje gena na Y kromosomu D) nasljeđivanje gena na spolnim kromosomima E) svi su odgovori točni 325. Ako je majka slijepa za boje a otac nije, koliko je njihove djece slijepo za boje? A) sva muška djeca B) sva ženska djeca C) 50% muške djece D) 50% ženske djece E) nijedan odgovor nije točan 326. Koji je haploidan broj kromosoma u vinske mušice? A) 1 B) 2 C) 3 D) 4 E) 5

A) klorofil B) kloroplaste C) nukleoid D) jednostavnu steljku E) posebnu boju 328. Koji od navedenih genotipova može biti iz P (parentalne ili roditeljske) generacije? A) Aabb B) AABb C) AAbb D) aaBb E) AaBB 329. Cijepanje osobina se javlja: A) u parentalnoj generaciji B) u F1 generaciji C) u F2 generaciji D) samo u test križanju E) ništa od navedenog 330. Za I mejotičku diobu nije točno da dolazi do: A) odvajanja homolognih kromosoma B) odvajanja kromatida svakog homologa C) konjugacije homolognih kromosoma D) spiralizacije kromosoma E) nestajanja jezgrine ovojnice 331. Bakteriofagi nemaju: A) DNK B) proteinsku ovojnicu C) “glavice” D) “repa” E) membrane 332. Što je embrioblast: A) svaka skupina embrinalnih stanica B) skupina embrionalnih stanica u sisavaca nakon brazdanja C) isto što i trofoblast D) odgovara zametnim listićima E) sudjeluje u formiranju posteljice

327. Nije točno da modrozelene alge imaju:


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________

333. Najtočniji odgovor za ATP je sljedeći: A) adenin i trifosfat B) adenozin i monofosfat C) adenozin i difosfat D) AMP+P E) adenin, riboza i trifosfat 334. Za oksidaciju i redukciju molekula je značajno: A) oksidacijom se gube elektroni B) oksidacijom se prihvaćaju elektroni C) redukcijom se gube elektroni D) ishodište su im anoganski spojevi E) niti jedan odgovor nije točan 335. Fagocitoza spada u: A) enzimske reakcije B) endocitozu C) električni potencijal stanične membrane D) aktivni prijenos iona E) pasivni prijenos 336. DNK se nalazi u: A) kromosomima B) kloroplastima C) mitohondrijima D) bakterijama E) svi su odgovori točni 337. Jezgrica nema: A) bjelančevina B) rRNK C) DNK D) ribosomskih podjedinica E) ovojnice (membrane) 338. Kromosomi se nalaze u središtu stanice u: A) profazi B) metafazi C) anafazi D) telofazi E) mejozi


339. Neuron je: A) neurit B) akson C) dendrit D) živčana stanica E) živac 340. U koži se nalaze: A) opipna tjelešca B) živčani ogranci C) žlijezde lojnice D) masne stanice E) svi su odgovori točni 341. Blastoderm je sloj stanica koji okružuje: A) embrioblast B) trofoblast C) blastocel D) celom E) pracrijevo 342. Blastoporus je: A) otvor na embrioblastu B) otvor na trofoblastu C) otvor na gastruli žabe D) šupljina blastule E) šupljina gastrule 343. Od mezoderma se razvijaju: A) sluznica probavila B) jetra C) gušterača D) mišići E) pluća 344. Bakterije imaju: A) jezgru B) jezgricu C) nukleoide D) plastide E) endoplazmatsku mrežicu

_________________________________________________________________________ Pitanja

345. Koji od spomenutih organizama spadaju u prokarite: A) jednostanične alge B) neke gljive C) praživotinje D) virusi E) modrozelene alge

351. Slijed baza UUU odgovara sljedećoj aminokiselini: A) tirozinu B) serinu C) fenilalaninu D) asparginu E) metioninu

346. Koja od spomenutih zigota nije homozigota? A) aaBB B) AAbb C) aabb D) AABB E) AaBb

352. Kodon na gRNK je CUG-AUC. Koji je odgovarajući antikodon na tRNK? A) GAC-UAG B) GTC-TAG C) CAC-UAC D) GAG-TAC E) GUC-UAC

347. Drugi Mendelov zakon nasljeđivanja je primjenjen u: A) svakom križanju B) intermedijarnom križanju C) monohibridnom križanju D) slobodnoj i nezavisnoj kombinaciji E) križanju s vezanim genima

353. Lizosomi: A) obavijeni su dvostrukom opnom B) nemaju membrane C) sadrže enzime D) sadrže mitohondrije E) niti jedan odgovor nije točan

348. Test križanje je sljedeće: A) aaBb x Aabb B) aaBB x AAbb C) AaBb x AaBb D) aabb x AABB E) AaBb x AABB 349. Koja gameta pripada genotipu AaBb? A) A B) a C) B D) b E) Ab 350. Morgan je nazvao crossing-overom: A) razmjenu dijelova kromosoma i gena B) razdvajanje homolognih kromosoma C) razdvajanje kromatida pojedinih kromosoma D) pojavu kod nevezanih gena E) niti jedan odgovor nije točan

354. Mitohondriji su organele: A) samo životinjskih stanica B) samo biljnih stanica C) važne za sintezu proteina D) važne za sintezu nukleinskih kiselina E) važne kao energetske centrale 355. Za jezgricu je značajno: A) nije obavijena opnom B) ima RNK C) ima DNK D) sintetizira rRNK E) svi su odgovori točni 356. Kromatin se nalazi u: A) profazi B) metafazi C) anafazi D) interfazi E) telofazi 357. u anafazi I mejoze: A) nastaju 2 nove jezgre


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________

B) nastaje haploidan broj kromosoma C) odvajaju se homologni kromosomi D) odvajaju se kromatide E) kromosomi se ne vide 358. Spermatogeneza i oogeneza odgovaraju: A) diobi citoplazme B) mejotičkoj diobi C) mitotičkoj diobi D) diobi kromosoma E) niti jedan odgovor nije točan 359. Haploidan broj kromosoma, svaki sa svoje dvije kromatide, nalazimo u: A) telofazi I B) interfazi C) profazi D) metafazi I E) telofazi II 360. Nije točno da od ektoderma nastaju: A) koža B) osjetila C) živčani sustav D) epitel E) hrskavica 361. Koji od navedenih roditeljskih parova daje potomstvo u omjeru fenotipova 3:1 za jedno od spomenutih svojstava: A) AaBb x AAbb B) AaBb x aaBB C) AaBb x aabb D) AABB x aabb E) AaBB x Aabb 362. Geni A i b nalaze se na različitim mjestima istog kromosoma pa govorimo o: A) monohibridnom nasljeđivanju B) intermedijarnom nasljeđivanju C) slobodnoj kombinaciji D) vezanim genima E) spolno vezanom nasljeđivanju


363. Omjer genotipova i fenotipova 1:1 dobijamo križanjem roditelja: A) Bb x bb B) Bb x Bb C) Bb x BB D) BB x bb E) bb x bb 364. Nukleoid je: A) spolni kromatin B) jezgra biljnih stanica C) DNK u jednostaničnim organizmima D) organela u citoplazmi E) DNK u bakterija 365. Tilakoide i grana pripadaju: A) vakuolama biljnih stanica B) mitohondrijima C) kloroplastima D) kromosomima E) centrosomima 366. U biologiju spada: A) fiziologija B) taksonomija C) paleontologija D) zoologija E) svi su odgovori točni 367. Prijelaz vode kroz membranu zove se: A) difuzija B) osmoza C) dijaliza D) aktivan prijelaz E) nijedan odgovor nije točan 368. Žlijezde s unutrašnjim izlučivanjem su: A) hipofiza B) štitnjača C) nusštitne žlijezde D) nadbubrežne žlijezde E) svi su odgovori točni

_________________________________________________________________________ Pitanja

369. U profazi I mejotičke diobe odvija se: A) smještaj kromosoma u sredini stanice B) konjugacija kromosoma C) odvajanje homolognih kromosoma D) odvajanje kromatida E) isto kao u mitozi

375. Rezultat križanja je omjer fenotipova 9:3:3:1. Koji su genotipovi roditelja? A) aabB x AABb B) AABB x aabb C) AaBb x AaBb D) AaBB x AABb E) AaBb x aabb

370. Blastoderm je sloj embrionalnih stanica koji se nalazi: A) oko blastoporusa B) oko blastocela C) na vegetativnom polu blastule D) oko trofoblasta E) oko embrioblasta

376. Nasljeđivanje vezano za spol prenosi se: A) izravno s oca na sina B) izravno s oca na kći C) s majke samo na sina D) s majke samo na kći E) na potomstvo jednako s oca i majke

371. Blastoporus je otvor koji vodi u: A) arhenteron B) blastocel C) sekundarnu tjelesnu šupljinu D) amnionsku tekućinu E) blastocistu

377. Na polovima diobenog vretena nalaze se: A) ribosomi B) lizosomi C) centrosomi D) Golgijeva tijela E) nukleoidi

372. Ektoderm nastaje: A) u unutrašnjosti gastrule B) na površini gastrule C) na animalnom polu gastrule D) oko blastocela E) oko arhenterona 373. Trofoblast je sloj stanica koji: A) okružuje zigotu B) okružuje gastrulu C) okružuje embrioblast D) se razvija u amnion E) se razvija u alantois 374. Životinjski virusi imaju od genetskog materijala: A) samo DNK B) RNK ili DNK C) samo RNK D) proteine E) polisaharide

378. Hrapavi endoplazmatski retikulum najviše je razvijen u stanicama: A) embrionalnim B) tumora C) koje sintetiziraju mnogo bjelančevina D) živčanim E) koje sintetiziraju mnogo ugljikohidrata 379. Nakupine hidrolitičkih enzima nalaze se u: A) jezgri B) jezgrici C) kromatinu D) lizosomima E) ribosomima 380. Razgradnja glukoze do alkohola i CO2 zove se: A) glikoliza B) fosforilacija C) redukcija CO2


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________

D) fermentacija ili vrenje E) Krebsov ciklus

D) ekološke valencije E) vegetativne promjene

381. Oksidacijski proces: A) u kojem neka molekula prima elektrone B) u kojem neka molekula gubi elektrone C) uzajamnog primanja i gubitka elektrona D) koji se događa samo za vrijeme svjetlosnih reakcija fotosinteze E) koji se događa samo u mitohondrijima

387. Prostor na kojemu je raspoređena neka vrsta organizama je: A) biom B) relikt C) areal D) vegetacija E) endem

382. Do oplodnje jajne stanice sisavaca dolazi u: A) vagini B) maternici C) jajovodu D) trbušnoj šupljini E) jajniku

388. Na prvom mjestu hranidbenog lanca u biocenozi su: A) saprofagi B) fitofagi C) zoofagi D) heterofagi E) autotrofi

383. Zigota je: A) jajna prastanica B) spermijska prastanica C) neoplođeno jaje D) oplođeno jaje E) partenogenetski aktivirano jaje

389. Primarna organska produkcija je proizvodnja: A) autotrofnih biljaka B) heterotrofnih biljaka C) heterotrofnih životinja D) heterotrofnih bakterija E) dušikovih bakterija

384. U tundri se uglavnom nalaze: A) crnogorično drveće B) listopladno drveće C) travnjaci D) papratnjače E) mahovine i lišajevi 385. Važni razlagači u ekosistemima su: A) mesojedi B) stonoge i kukci C) zelene biljke D) biljojedi E) heterotrofne bakterije 386. Periodičke sezonske promjene organizama zovu se: A) sukcesije B) fenološke pojave C) biotičke pojave


390. Vrsta ograničena na uže područje je: A) relikt B) endem C) plankton D) nekton E) rudiment 391. Koji je ekosustav najproduktivniji u proizvodnji organskog ugljika? A) stepa B) obrađena površina C) šuma D) jezero s tvrdom vodom E) jezero s mekom vodom 392. Najstariji ostaci prvih hominida pripadaju: A) australopitekusu B) ramapitekusu C) neandertalcu

_________________________________________________________________________ Pitanja

D) javanskom pračovjeku E) krapinskom pračovjeku 393. Biološki indikatori zagađenja okoliša su: A) virusi i bakterije B) bakterije i modrozelene alge C) bičaši i zelene alge D) gljive i mahovine E) lišajevi i borovi 394. Zelene biljke u morskoj vodi dopiru prosječno do dubine: A) 100 m B) 200 m C) 300 m D) 400 m E) 450 m 395. Bakteriofagi pripadaju: A) biljnim virusima B) primitivnim jednostaničnim biljkama C) primitivnim jednostaničnim životinjama D) pneumokokima E) ni jednoj navedenoj skupini 396. Escherichia coli: A) koristi se u genetskom inženjerstvu B) može proizvoditi inzulin C) je crijevna bakterija D) može se naći u mokraći E) svi su odgovori točni 397. Fenotip je genetički izraz koji označuje: A) oblik i boju organizma B) strukturu i funkciju organizma C) “miješanje” očevih i majčinih gena D) rezultat uzajamnog djelovanja okoliša i genotipa E) kakav je genotip 398. Mutacije gena su uvijek: A) spontane mutacije

B) inducirane mutacije C) nasljedne promjene gena D) dominantne E) na istom kromosomu 399. U sastav kože ne ulaze stanice: A) žlijezda znojnica B) žlijezda lojnica C) dlake D) masnog tkiva E) Bowmanove čahure 400. Dječja paraliza (polio) uzrokovana je: A) virusom B) bakterijom C) kokima D) bacilima E) spirilima 401. Trajne oblike bakterija zovemo: A) prokariot B) nukleoid C) spora D) viroid E) prion 402. Kuga (crna smrt) uzrokovana je: A) bakterijom B) virusom C) viroidom D) prionom E) bakteriofagom 403. Trajnu promjenu genske upute zovemo: A) varijacija B) mutacija C) rekombinacija D) transformacija E) degenerirana šifra 404. Antropologija pručava ponajprije: A) antropomorfne majmune B) australopitekusa C) neandertalce


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________

D) pračovjeka Homo erectus E) čovjeka 405. Humana genetika raspoređuje gene čovjeka u genetičke karte. Pojam genetička karta potječe iz znanstvenog rada: A) G. Mendela B) T. Morgana C) F. Cricka D) J. Watsona E) A. Hersheya 406. Kultura stanica i tkiva: A) su izolirane stanice i tkiva uzgajane u strerilnim uvjetima B) su stanice i tkiva uzgajane izvan organizma C) je rast stanica i tkiva na posebnim hranilištima D) je uzgoj stanica i tkiva u različitim eksperimentalnim uvjetima E) svi su odgovori točni 407. Životinjski virusi se razmnožavaju: A) konjugacijom B) diobom C) pomoću DNA D) pomoću RNA ili DNA E) cijepanjem 408. Bakterije imaju: A) jezgru B) jezgricu C) nukleoide D) plastide E) endoplazmatski retikulum 409. Koji od spomenutih organizama spadaju u prokariote? A) jednostanične alge B) neke gljive C) praživotinje D) virusi E) modrozelene alge


410. Dvostruku membranu imaju: A) ribosomi B) lizosomi C) centrioli D) Golgijevo tijelo E) mitohondriji 411. Prijelaz vode kroz membranu zove se: A) difuzija B) osmoza C) dijaliza D) aktivan prijelaz E) olakšana difuzija 412. Populacija različitih biljnih i životinjskih vrsta čine složeniju cjelinu: A) biomasu B) biocenozu C) biocenologiju D) biotop E) biosferu 413. Biljojedi kao članovi ishrane svake biocenoze spadaju u: A) razlagače B) autotrofne organizma C) heterotrofne organizme D) saprofage E) karnivore 414. Najznačajniju sekundarnu organsku produkciju ostvaruju: A) virusi B) bakterije C) protisti D) biljke E) životinje 415. Na dnu hranidbene piramide nalaze se: A) konzumenti B) fitofagi C) zoofagi D) karnivora E) autotrofni proizvođači

_________________________________________________________________________ Pitanja

E) trbušnu šupljinu 416. U ishrani biocenoze na prvom su mjestu hranidbenog lanca: A) saprofagi B) heterotrofne bakterije C) autotrofni proizvođači D) fitofagi E) zoofagi 417. Koje su bakterije uzročnici upale pluća? A) streptokoki B) spirili C) stafilokoki D) diplokoki E) vibrioni 418. Stanično disanje: A) nazivamo respiracijom B) razgradnjom ugljikohidrata oslobađa energiju C) počinje glikolizom D) nastavlja se Krebsovim ciklusom E) sve su prethodne tvrdnje točne 419. Mitohondriji: A) su energetske centrale stanica B) su glavni proizvođači ATP C) imaju dvostruku ovojnicu D) sadrže DNA E) sve su prethodne tvrdnje točne 420. Limfa se razlikuje od krvi po tome što nema: A) plazme B) leukocite C) trombocite D) eritrocite E) krvne pločice 421. Oplođeno jaje sisavca implantira se u: A) sluznicu maternice B) tijelo maaternice C) sluznicu jajovoda D) cerviks uterusa

422. Među stanicama odrasla čovjeka ne dijele se: A) spermatogonije B) neuroni C) oogonije D) primarne spermatocite E) sekundarne spermatocite 423. U zdrava čovjeka osmotski tlak urina može biti 2 do 3 puta veći od osmotskog tlaka plazme. Urin je dakle prema plazmi: A) izotoničan B) monotoničan C) hipertoničan D) hipotoničan E) hipertrofičan 424. Porast ljudske populacije određen je: A) natalitetom B) morbiditetom C) genskom snagom D) biološkim faktorima (isključivo) E) fizičkim faktorima (isključivo) 425. Opseg prostorne rasprostranjenosti ljudske vrste zovemo njegovim: A) biomom B) ekosistemom C) biocenozom D) arealom E) biotopom 426. Tuberkulozu i šarlah uzrokuju: A) amebe B) protoza C) fagi D) virusi E) bakterije 427. U zdrava čovjeka osmotski tlak urina može biti 2 do 3 puta veći od osmotskog tlaka plazme. Plazma je dakle prema urinu: A) atonična


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________

B) monotonična C) hipertonična D) hipotonična E) izotonična 428. Rasprostranjenost većine ljudse populacije na Zemlji ovisi o: A) vegetaciji tog područja B) bentoskim biocenozama C) planktonu D) nektonu E) reliktima 429. Bentosku biocenozu čine: A) životinje koje se pomoću mišića brzo kreću u vodi B) svi organizmi koji žive u vodi stajaćici C) svi organizmi koji žive uz morsku obalu D) organizmi koji žive na morskom dnu E) organizmi koji lebde u slojevima morske vode 430. Krapinski pračovjek: A) živio je prije milijun godina B) imao je istaknutu bradu C) poznavao je vatru D) pripadao je tipu kromanjonca E) pripadao je tipu australopitekusa


434. U heterotrofne organizme ne spadaju: A) alge B) gljive C) člankonošci D) spužve E) jednostanične životinje 435. Posebni zoološki rezervat je: A) otok Mljet B) Risnjak C) Plitvička jezera D) Ćorkova uvala E) Kopački rit 436. Virusi mogu uzrokovati: A) tuberkulozu B) aterosklerozu C) dječju paralizu D) sifilis E) tetanus 437. Bakteriofagi su sastavljeni od: A) citoplazme i membrane B) jezgre i ovojnice C) mitohondrija i proteina D) glavice i repa E) prokariontskih stanica

431. Ekosustav čine: A) ekološka valencija B) biotop i biocenoza zajedno C) populacija D) abiotički učinci E) biotički učinci 432. Koje tvrdnje odgovaraju krapinskog pračovjeka? A) potječe iz pleistocena B) kromanjonac C) visine do 160 cm D) satar 300 – 500 000 godina E) ima izraženu bradu

433. Jezgre nemaju: A) primitivne životnjske stanice B) neuroni C) stanice glatkog mišića D) eritrociti sisavaca E) poprečno prugasti mišić


438. Koki su: A) virusi B) bakterije C) eukariotske stanice D) animalne stanice E) štapićastog oblika 439. Prema načinu ishrane bakterije mogu biti: A) autotrofne

_________________________________________________________________________ Pitanja

B) mesojedi C) biljojedi D) zoofagi E) fitofagi 440. Eukariontske stanice uključuju: A) koke B) bacile C) vibrione D) sve bakterijske stanice E) biljne stanice 441. Endocitoza je pojava vezana uz sljedeće organele u stanici: A) mitohondrije B) lizosome C) jezgricu D) ribosome E) endoplazmatsku mrežicu 442. Vitamin D: A) spada u skupinu ugljikohidrata B) spada u skupinu nukleinskih kiselina C) važan je za razvitak crvrenih i bijelih krvnih stanica D) važan je za razvitak kostiju i zubi E) važan je za razvitak spolnih žlijezda 443. Menstrualni ciklus karakteriziran je: A) visokim progesteronom u preovulacijskoj fazi B) visokim progesteronom u postovulacijskoj fazi C) visokim progesteronom od 1. do 14. dana D) visokim LTH od 1. do 14. dana E) visokim LH od 1. do 28. dana 445. Iz srednjeg kvartara – pleistocena – potječe A) kromanjonski čovjek B) neandertalski pračovjek C) australopitekus D) driopitekus E) propliopitekus

446. Među “živim fosilima” su poznati: A) ihtiostega B) kinesko drvo ginkgo C) mamut D) praptica E) pteridosperme 447. Biljni virusi: A) razaraju biljnu stijenku B) svi se prenose kukcima C) genetski materijal je RNA D) slični su bakterijskim virusima E) razmnožavaju se diobom 448. Najveće količine kisika u atmosferi potrebnog za disanje potječu: A) od vulkanske aktivnosti B) od aktivnosti razlagača C) od fotosintetske aktivnosti D) od nektona E) od bentosa 449. Bujnost života na kopnu ovisna je uglavnom o: A) biotičkim faktorima B) svim abiotičkim faktorima C) povoljnoj temperaturi D) raspoloživosti dušika E) raspoloživosti ugljika 450. Znanstveno ime (binarna nomenklatura) suvremenog čovjeka: A) glasi Hominidae B) glasi Homo erectus C) glasi Homo sapiens D) zahvaljujemo radu D.G. Krambergera E) zahvaljujemo radu Ch. Darwina 451. Modifikacije: A) spadaju u mutacije B) su mutacije građe kromosoma C) su mutacije gena D) su nasljedne E) nisu nasljedne


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________

452. Plazmidi su: A) specifični virusi B) vrste mikroorganizama C) hibridne molekule DNA D) hibridne molekule RNA E) male čestice DNA 453. Koji od pojmova su krivo spareni? A) bakterija – nukleoid B) protocita – organeli C) eucita – jezgra D) eucita – citoskelet 454. Saprofiti su organizmi koji A) obitavaju u drugim organizmima B) se razmnožavaju samo pomoću spora C) žive na štetu domadara D) upijaju hranu iz mrtvih organizama 455. Endocitoza je A) aktivan prijenos kroz membranu B) stanično “proždiranje” velikih čestica C) unošenje molekula direktno u citosol D) unošenje iona u stanicu 456. Amiloplasti su A) leukoplasti koji sadrže škrob B) proplastidi koji sadrže proteine C) kloroplasti koji sadrže škrob D) leukoplasti koji sadrže aminokiseline 457. Lišaj je osobit oblik simbioze između A) gljive i alge B) gljive i bakterije C) alge i bakterije D) bakterije i korijena lepirnjača

B) nakupine sporangija na listu paprati C) diploidna generacija mahovina D) stabalce mahovine s muškim rasplodnim organima 460. Makrosporangij odgovara A) plodnom listu B) zametnoj vrećici C) sjemenom zametku D) mikrospori 461. Točna tvrdnja je A) dvosupnice imaju čupavo korijenje B) stabljika dvosupnica raste u debljinu pomoću kambija C) glavne žile u listu jednosupnica su razgranjene D) glavne žile u listu dvosupnica su usporedne 462. Prijelazni oblici između vodozemaca i gmazova su: A) štitoglavci (Seymouria) B) resoperke (Crossoptergia) C) zvijerogušteri (Theriodontia) D) gmaz Ichtiosaurus 463. Homologni organi su: A) isti po funkciji, a različitog postanka B) istog postanka, a različiti po funkciji C) istog postanka i istih funkcija D) različitog postanka i različitih funkcija 464. Rudimentarni organ nije: A) crvuljak slijepog crijeva B) trtica C) palčana kost D) zub mudrost

458. U razvojnom putu mahovine spolna generacija su A) protonema s mahovinom B) mahovina sa sporangijem C) sporogon D) protalij

465. Uobičajeni predstavnici planktona su: A) algašice B) bentonski organizmi C) bičaši i kremenjašice D) zelene alge

459. Sorusi su A) muški spolni organ mahovine

466. Kod alga kremenjašica kao produkt asimilacije nastaje:


_________________________________________________________________________ Pitanja

A) škrob B) bjelančevine C) ulje D) kremen 467. Steljka je: A) rasplodni organ alge B) tijelo alge C) mala stabljika D) embrionalni organ biljke 468. Protalij je A) razvojni stadij paprati B) razvojni stadij mahovina C) sporofit D) nespolna generacija 469. Smatramo da su se sjemenjače (cvijetnjače) razvile od: A) vodenih biljka koje su prešle na kopno B) mnogostaničnih alga C) cikadina D) izumrlih heterospornih papratnjača 470. Koji od pojmova su krivo spareni? A) plodni list – listić s makrosporangijem B) sjemeni zametak – makrosporangij C) peludovo zrno – mikrospora D) peludnica – makrosporangij 471. Predstavnici porodice ruža imaju A) cvjetove s peteročlanim ocvijećem i mnogo prašnika B) devet prašnika i plod mahunu C) četiri lapa i četiri latice D) cvijetove skupljene u rese 472. Plod komušku imaju A) žabnjaci B) ruže C) lepirnjače D) krstašice 473. Sve biljne zajednice nekog područja čine A) floru

B) vegetaciju C) biocenozu D) biotop 474. Autosomi su A) svi kromosomi nekog organizma B) spolni kromosomi C) svi kromosomi nekog organizma osim x i y kromosoma D) samo kromosimi vinske mušice 475. Centromera je A) mjesto na kromosomu za koje se vežu ili diobenog vretena B) sekundarno suženje kromosoma C) satelitski kromosom D) dio centrosoma 476. Svjetlosnim mikroskopom ne vidimo: A) pseudopodije amebe B) staničnu jezgru C) plastide D) trepetljike papučice E) uzročnika herpesa 477. Točan redoslijed živih sustava u organizacijskoj ljestvici (od najvišeg prema najnižem) je: A) atomi, molekule, makromolekule, stanica, organizam, populacija, ekosustav B) atomi, molekule, stanica, makromolekule, organizam, biocenoza, populacija, ekosustav C) atomi, makromolekule, organizam, stanica, molekule, populacija, biocenoza, ekosustav D) ekosustav, biocenoza, populacija, organizam, stanica, makromolekule, molekule, atomi E) biocenoza, populacija, ekosustav, stanica, organizam, makromolekule, molekule, atomi 478. Ako se biljna stanica nalazi u hipertoničnoj otopini, dolazi do: A) osmoze


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________

B) plazmolize C) dijalize D) deplazmolize E) difuzije 479. Spolna generacija kod papratnjača A) razvijenija je od sporofita B) protalij je diploidan C) na protaliju se nalazi arhegonij i antreridij D) je sorus E) spermatozoidi nastaju u arhegoniju 480. Za kritosjemenjače je karakteristično: A) sjemeni zameci smješteni su otovreno na plodnim listovima B) sjemeni zameci su zatvoreni u plodnici C) imaju plodnicu, a nemaju plod D) od sjemenog zametka nastaje plod E) za razmnožavanje im je potrebna voda 481. U izgradnji sedrenih naslaga na jezerima sudjeluju: A) lišaji i gljive B) dvosupnice i jednosupnice C) paprati D) alge kremenjašice E) modrozelene alge i mahovine 482. Prve kopnene zelene biljke bile su A) mahovine B) psilofiti C) pteridosperme D) lišaji E) papratnjače 483. Reliktni endem je: A) krški runolist B) degenija C) ilirska perunika D) dubrovačka zečina E) hrvatska sibireja 484. Koja od navedenih biljaka pripada porodici trava? A) vladac


B) bijeli luk C) riža D) preslica E) divlji kupus 485. Ulogu korijena kod mahovina vrši: A) protonema B) hifa C) rizom D) rizoid E) grebenica 486. Florni elementi nekog područja su: A) biljke rasprostranjene samo u nekom većem području i značajne za floru tog područja B) sve biljne vrste nekog područja bez obzira na površinu koju pokrivaju C) biljne zajednice nekog područja D) biljke kojima je areal ograničen na usko područje E) svi odgovori su točni 487. “Crossing-over” se događa u mejozi za vrijeme: A) profaze I B) anafaze I C) interfaze D) profaze II E) telofaze II 488. Spol čovjeka određuju spolni kromosomi x i y, a to znači da: A) sve tjelesne stanice žene imaju po jedan x kromosom B) sve tjelesne stanice muškarca imaju po jedan y kromosom C) 50 % spermija sadrži x kromosom D) 50 % jajnih stanica sadrži x kromosom E) svi spermiji imaju y kromosom 489. Iz oplođene jajne stanice u kritosjemenjača razvija se: A) sekundarni endosperm B) embrionska vreća C) klica

_________________________________________________________________________ Pitanja

D) peludna mješinica E) plodnica 490. Ostatke kukovlja u kita ubrajamo u: A) atavizme B) zakržaljale rudimentarne organe C) prijelazne oblike D) prilagodbe na život u vodi E) ništa od navedenog nije točno 491. Najvažniji činilac u postanku vrsta je: A) genska snaga B) mutacija C) divergencija D) prekobrojno potomstvo E) varijabilnost 492. Rast biljke u debljinu ostvaruje se diobom stanica A) epiderme B) parenhima C) felogena D) floema E) kambija 493. RNA može biti izvor genetičkih informacija kod: A) mikoplazma B) priona C) bakterija D) virusa E) alga 494. Uzročnici biljnih bolesti, viroidi, građeni su od: A) proteina B) RNA i proteina C) RNA D) DNA E) DNA i proteina 495. Najjednostavniji virusi izgrađeni su od: A) lipida

B) proteina i nukleinske kiseline C) proteina i masti D) lipida i organskih kationa E) lipida i nukleinskih kiselina 496. Bakterije sadrže: A) DNA i RNA B) samo DNA C) nekad DNA, nekad RNA D) samo dvolančanu RNA E) samo RNA 497. Vegetacija je: A) popis životinjskih vrsta nekog područja B) skup biljnih zajednica nekog područja C) popis biljnih vrsta nekog područja D) skup endemičnih biljaka nekog područja E) flora i fauna nekog područja 498. Organel prisutan u animalnoj stanici, a nije zastupljen u biljnoj stanici je: A) jezgrica B) centriol C) vakuola D) mitohondrij E) kloroplast 499. Svjetlosna energija apsorbirana tijekom fotosinteze pohranjuje se u: A) klorofilu B) karotenoidima C) ATP i ugljikohidratima D) NADPH2 E) vodi 500. Katabolizam je: A) podražaj koji izaziva osjet boli B) reakcija u kojoj se oslobađaju kationi C) razgradnja većih molekula u manje jedinice D) sinonim za stanično disanje E) sintetički proces 501. Fototropno svijanje klice uzrokovano je: A) djelovanjem sile teže


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________

B) razlikama u sadržaju škroba između gornjeg i donjeg dijela C) prejakim osvjetljavanjem D) promjenom turgora na osvjetljenoj strani E) razlikama u sadržaju hormona između osvjetljene i zasjenjene strane 502. Nitrifikacijske bakterije su kemosintetske bakterije koje: A) razgrađuju organske spojeve uginulih organizama B) su uzročnici brojnih bolesti C) dobivaju energiju oksidacijom organskih spojeva D) oksidiraju amonijak u nitrit E) vežu dušik iz zraka 503. Kriptorhizam je: A) prilagodba biljaka na hladna staništa B) razvoj adventivnog korjenja u kritosjemenjača C) zadržavanje sjemenika u trbušnoj šupljini D) vrsta hemofilije E) suženje porođajnog kanala

B) hipotalamusu C) adenohipofizi D) nadbubrežnoj žlijezdi E) neurohipofizi 507. Centri za regulaciju tjelesne temperature nalaze se u: A) termoreceptorima kože B) hipotaalamusu C) stijenkama krvnih žila D) kori velikog mozga E) štitnjači 508. Koacervatne kapljice su: A) koloidne kapljice s opnom koje nastaju otapanjem nekih organskih spojeva u vodi uz dodatak različitih soli B) agregati aminokiselina nastali suhim zagrijavanjem C) prve žive stanice D) kapljice lipida i proteina E) koloidne kapljice s čvrstom membranom Pitanja s dva točna odgovora

504. Bulbili su: A) rasplodni pupovi B) spore gljiva C) mlade lukovice D) organeli u biljnim stanicama E) vrste gomolja

509. Olistala biljka paprati je: A) diploidna generacija B) haploidna generacija C) gametofit D) sporofit E) sporangij

505. Od polisaharida u životinjskim organizmima dolazi: A) škrob B) fruktoza C) glukoza D) glikogen E) laktoza

510. Zaštićene vrste našeg područja su: A) vidra B) podbjel C) potajnica D) obična kockavica E) bizamski štakor

506. Pubertet započinje lučenjem neurosekretornih tvari i hormona u: A) štitnjači


512. Koje se od navedenih tvrdnji odnose na populaciju? A) sastoji se od jedinki različitih vrsta koje naseljavaju isto područje

_________________________________________________________________________ Pitanja

B) sastoji se od jedinki iste vrste koje su prostorno izolirane C) sastoji se od jedinki iste vrste koje nadeljavaju određeni prostor D) skup jedinki povezanih prehrambenim lancima E) skup jedinki čija je genetska osnova zajednička i u stalnoj je međusobnoj razmjeni 513. Od navedenih endokrinih žlijezda samo su dvije s unutarnjim i vanjskim izlučivanjem A) gušterača B) štitna žlijezda C) spolna žlijezda D) nadbubrežna žlijezda E) hipofiza 514. Brzinu reakcije u stanici reguliraju sljedeći spojevi: A) ugljikovodici B) enzimi C) ugljikohidrati D) masti E) hormoni

A) monocit B) trombocit C) eozinofil D) neutrofil E) bazofil 518. Pomoću albumina u krvi se može transportirati: A) željezo B) tiroksin C) vitamin C D) fibrin E) holesterol 519. Probavne enzime ne izlučuje: A) želudac B) taanko crijevo C) jetra D) gušterača 520. Voda koju izlučujemo u mokraći potječe od: A) tekućine koju pijemo B) hrane koju jedemo C) metaboličkih procesa D) A+B E) A+B+C

Pitanja s jednim točnim odgovorom 515. Najproduktivniji ekosistem je: A) obradivo tlo B) listopadne šume C) jezero D) zapadni Atlantik 516. Prema Haeckelovoj hipotezi o podrijetlu (metazoa) višestaničnih organizama, višestanične životinje razvile su se iz: A) bičaša B) volvoksa C) organizma koji se razvio udruživanjem većeg broja jednostaničnih bičaša D) trepetljikaša

521. U ljudskom organizmu prvo se počmu probavljati: A) masti B) proteini C) škrob D) fosfolipidi E) nukleinske kiseline F) celuloza 522. Ciklus limunske kiseline ili Krebsov ciklus je: A) prva faza disanja koja se odvija u citoplazmi B) proces u kojemu se iz 1 mola glukoze oslobodi energija 1254 kJ

517. Koja je od navedenih stanica agranularni leukocit?


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________

C) dio aerobne respiracije u kojem se pirogrožđana kiselina razlaže u molekule ugljik(IV)-oksida i atome vodika D) dio anaerobne respiracije kojom se oslobađa 25 % energije pohranjeno u 1 molu glukoze E) proces koji oslobađa energiju iz produkata oksidativne fosforilacije 523. Lipidi u biološkim membranama čine dvosloj zato jer: A) su to molekule dipolna karaktera kao i voda B) su na jednom kraju pozitivno, a na drugom kraju negativno nabijeni C) se povezuju s bjelančevinama koje ih pravilno orjentiraju D) su izgrađeni od ugljika, vodika, kisika i fosfata E) je jedan kraj molekule hidrofilan, a drugi hidrofoban Pitanja s dva točna odgovora

A) dolazi do izražaja u malim populacijama B) dominantni geni se brže šire C) recesivni geni se mogu izgubiti ili proširiti D) značajna je za veliki otvoren skup populacija 527. Koje su od navedenih tvrdnji točne: A) najslabiju moć regeneracije imaju primitivne životinje B) najslabiju moć regeneracije imaju odvedene životinje C) sposobnost regeneracije je manja u životinja na višem stupnju razvoja D) sposobnost regeneracije je manja u životinja na nižem stupnju razvoja 528. U oligomeria spadaju: A) trp B) peripatus C) zmijača D) volak

524. Većina vode koju biljka prima: A) cijepa se tijekom fotosinteze i služi kao izvor elektrona i vodika B) gubi se stomatalnom transpiracijom C) apsorbiraju stanice tijekom produžnog rasta D) ulazi u korijen iz tla osmozom E) ugrađuje se neposredno u organski materijal

529. Zajedničko mahovinama i papratnjačama su: A) sporogoni B) spore C) anteridiji D) sorusi E) sorediji F) protaliji G) protoneme H) plazmodiji

525. Molekulu RNA čini različitom od molekule DNA: A) šećer riboza B) fosfat C) baza uracil D) baza timin E) ništa od navedenog nije točno

530. Homeotermni organizam je: A) morski ježinac B) aligator C) šaran D) šišmiš E) daždevnjak F) pingvin

526. Genetska snaga ili genetska slučajnost:

531. Polumjesečasti zalisci nalaze se između: A) lijeve pretklijetke i klijetke


_________________________________________________________________________ Pitanja

B) lijeve klijetke i aorte C) desne pretklijetke i klijetke D) desne klijetke i plućne arterije 532. Izlučivanje mlijeka prilikom dojenja potiče: A) estrogen B) prolaktin C) progesteron D) oksitocin Pitanja s povezivanjem odgovora 533. Uz pojmove u gornjem stupcu na praznu crtu upiši broj iz donjeg stupca uz koji je naveden odgovarajući opis! A) __ oogeneza B) __ spermalna stanica C) __ speramtogeneza D) __ gametogeneza 1. postanak spermija 2. stvaranje spolnih stanica 3. muška spolna stanica 4. postanak jajnih stanica 534. Uz nazive životinja u gornjem stupcu na praznu crtu upiši broj iz donjeg stupca uz koji je napisan način razmnožavanja. A) __ tuljan B) __ skakavac C) __ šaran D) __ hrušt 1. ima vanjsku oplodnju 2. ima potpunu preobrazbu 3. koti žive mlade 4. ima nepotpunu preobrazbu 535. Uz ime biljke u gornjem stupcu upiši broj koji je napisan uz naziv porodice kojoj određena biljka pripada. A) __ kukurijek B) __ glog C) __ soja D) __ livadna kadulja

E) __ uljana repica 1. prodica ruža 2. prodica krstašice 3. prodica žabnjaka 4. prodica lepirnjača 5. prodica usnjače 536. Uz ime biljke u gornjem stupcu upiši broj koji je napisan ispred dijela kojim se ta biljka vegetativno razmnožava. A) __ magnolija B) __ lukovičasta režuha C) __ perunika D) __ begonija 1. rizom 2. povaljenica 3. list 4. bulbil 537. Uz naziv čovjekovih predaka u gornjem stupcu upiši broj ispred navedenog vremena kada su živjeli. A) __ kromanjonski čovjek B) __ ramapitekus C) __ australopitekus 1. prije 15 milijuna godina 2. prije 30-40 tisuća godina 3. prije 500 tisuća godina Pitanja kojima treba upisati odgovore 538. Imela je poluparazit jer od svog domadara prima vodu s mineralnim tvarima pomoću __________. 539. Populaciju čine jedinke iste vrste koje žive na istom prostoru i međusobno su povezane __________. Pitanja s jednim točnim odgovorom 540. Fotosinteza je proces


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________

A) kojim označavamo sve kemijske sinteze na svjetlosti B) koji se zbiva u kromoplastima biljne stanice C) kojim se iz organskih tvari oslobađa kisik D) kojim se Sunčeva svjetlost pretvara u kvantume energije E) kojim se svjetlosna energija pretvara u kemijsku 541. Koja od navedenih životinja je dvospolac i nema organa za disanje ni probavila ni krvotoka A) gujavica B) hobotnica C) hidra D) trakavica 542. Koja je izjava o peludnom zrncu pogrešna? A) Peludna zrnaca nastaju u peludnicama. B) Mejozom se u peludnim zrncima razvija muški gametofit. C) Prodor peludne mješinice u embrionsku vreću omogućuje oplodnju. D) Nakon oprašivanja vegetativna stanica razvija se u peludnu mješinicu. 543. Glavonošci su najrazvijenija skupina mekušaca. Koja se od navedenih osobina ne odnosi na glavonošce? A) imaju vrlo razvijen mozak B) građa oka im je slična kralješnjacima C) imaju razvijen krvožilni sustav D) dvospolci su 544. Kemosintetske bakterije dobivaju energiju za asimilaciju ugljik(IV)-oksida A) pomoću bakterioklorofila B) apsorpcijom UV-zraka C) apsorpcijom infracrvenih zraka D) oksidacijom organskih spojeva E) oksidacijom anorganskih spojeva


545. U uvjetima bez kisika kvasci dolaze do energije za životne procese A) vrenjem B) trulenjem C) eksplozivnim oslobađanjem toplinske energije D) ciklusom limunske kiseline E) kemosintetski 546. Pri klijanju sjemenke pšenice u aleuronskom sloju pod utjecajem hormona događa se sljedeće: A) enzim amilaza razgrađuje škrob B) hormoni auksini i citokinini potiču diobu stanica C) enzimi proteaze razgrađuju pričuvne bjelančevine D) razgradnja aleuronskog sloja bakterijama uvjetuje klijanje Pitanja s dva ili više točnih odgovora 547. Četverodjelno srce (dvije klijetke i dvije predklijetke) imaju sljedeće životinje: A) pastrva B) čovječje ribica C) krokodil D) grlica E) klokan F) stonoga 548. Iz 12 spermatogonija, odnosno 12 primarnih spermatocita razvit će se A) 48 sekundarnih spermatocita B) 24 spermatide i 48 spermija C) 48 spermija D) 12 spermija E) 24 sekundarne spermatocite F) 48 sekundarnih spermatocita 549. U molekuli crvenog pigmenta hemiglobina dolazi do vezanja A) kisika za žaljezo

_________________________________________________________________________ Pitanja

B) ugljik(IV)-oksida za željezo C) kisika za bjelančevinasti (globinski) dio molekule D) kisika za željezo i bjelančevinasti (globinski) dio molekule E) ugljik(IV)-oksida bjelančevinasti (globinski) dio molekule 550. Radom srčanog mišića usmjerava se A) venska krv iz desne klijetke plućnim arterijama u pluća B) arterijska krv iz pluća plućnom venom u lijevu pretklijetku C) venska krv iz desne klijetke plućnom venom u pluća D) arterijska krv iz pluća plućnim arterijama u lijevu pretklijetku E) venska krv iz tijela plućnom venom u desnu pretklijetku 551. Svaki prethodni član mesojed u hranidbenom lancu u pravilu je A) manji od sljedećeg B) veći od sljedećeg C) brojniji od sljedećeg D) ima manju ukupnu biomasu E) ima manju ukupnu energiju 552. Otvaranje i zatvaranje puči na listu ovisi o sljedećim događajima: A) fotosintezi i porastu sadržaja šećera u svim epidermskim stanicama B) fotosintezi i porastu sadržaja šećera u stanicama zapornicama C) povišenju osmotskog tlaka u stanicama zapornicama D) ualženju vode u zapornice bubrenjem i kapilarnošću E) primanju vod etranspiracijom 553. Podražavanje receptorskog dijela neurona ima za posljedicu A) ulaženje kalija u stanicu B) ulaženje neurohormona u stanicu C) uspostavu pozitivnog električnog naboja u stanici

D) oslobađanje neurohormona u međuneuronski prostor E) uspostavu negativnog električnog naboja u stanici F) oslobađanje auksina u međuneuronski prostor G) ulaženje natrija u stanicu Pitanja kojima treba upisati odgovor 554. Sadnice hrasta sade se na razmaku od 4 m. Koliko se sadnica može posaditi u ravan niz na zemljište dužine 80 m? __________. 555. U neprozirnoj vreći nalazi se 12 ružinih cvjetova, od toga se po dva cvijeta crvene, bijele, žute, ružičaste, ljubičaste i narančaste boje. Koliko cvijetova treba izvaditi iz vreće da bi se sigurno izvadile najmanje dvije ruže jednake boje? _________. 556. Četiri prijatelja biologa: mikrobiolog, ekolog, genetičar i zoolog pomažu si u znanstvenom radu. 1. Božo i Vlado pomagali su zologu 2. Ivo, genetičar i mikrobiolog pomagali su Juri 3. Genetičar je pomagao Boži, a zoolog Juri Što su po specijalnosti Jura, Božo, Ivo i Vlado? Jura je __________. Božo je __________. Ivo je __________. Vlado je __________. Pitanja s jednim točnim odgovorom 557. Partenogeneza je: A) stapanje spermija s jajnom stanicom B) razvoj jedinke iz neoplođene jajne stanice C) razvoj spolnog partnera


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________

D) vanjska oplodnja E) unutarnja oplodnja 558. Probava bjelančevina (proteina) počinje u: A) ustima B) jednjaku C) želucu D) tankome crijevu 559. U posudi s vodom postavljena su dva osmometra, s oznakom A i B. Osmometar A sadrži otopinu šećera koncentracije 1 mol/L, a B otopinu kuhinjske soli iste koncentracije. Osmotski tlak A) jednak je u oba osmometra B) 4 puta viši je u A nego B C) 2 puta viši je u A nego B D) u A iznosi ½ vrijednosti tlaka u B E) u B iznosi ½ vrijednosti tlaka u A 560. Metodom antibiograma utvrđuje se: A) najdjelotvorniji antibiotik za ljiječenje virusnih infekcija B) nove lijekove protiv gripe C) nove lijekove protiv AIDS-a D) najdjelotvorniji antibiotik po najmanjoj zoni inhibicije rasta bakterija E) najdjelotvorniji antibiotik po najvećoj zoni inhibicije rasta bakterija 561. Koji od navedenih organa ima ključnu ulogu u održavanju stalnog volumena tjelesnih tekućina? A) jetra B) slezena C) bubreg D) mišić 562. Od tri metabolička segmenta razgradnje glukoze jedan je anaeroban: A) glikoliza B) Krebsov ciklus C) oksidativna fosforilacija


563. Sintezu i lučenje spolnih hormona induciraju: A) tireotropni hormon B) gonadotropni hormon C) ACTH 564. Fosilni ostaci južnog pračovjeka (australopitekusa) nađeni su u: A) zapadnoj Australiji B) južnoj Aziji C) istočnoj i južnoj Africi D) južnoj Europi

Pitanja s dva točna odgovora 565. Otrovne gljive su A) vrganj B) blagva C) pupavka D) rujnica E) muhara 566. Lišće zimi otpada A) boru B) arišu C) bukvi D) tisi E) omoriki 567. Koja je tvrdnja točna? A) Svi svitkovci imaju barem začetak pluća. B) Svi svitkovci imaju škržne pukotine na prednjem dijelu crijeva i svitak na leđnoj strani tijela, barem tijekom embrionalnog razvoja. C) Plaštenjaci i svitkoglavci nemaju kralježnicu. D) Plaštenjaci i svitkoglavci nemaju svitak, ali imaju kralježnicu. E) U svitkovce ubrajamo kopljaču i žiroglavce.

_________________________________________________________________________ Pitanja

568. Među navedenim žlijezdama endokrine su: A) slinovnice B) hipofiza C) znojnice D) lojnice E) štitnjča F) jetra 569. Hormon inzulin: A) pospješuje ulazak glukoze u stanice B) olakšava izlazak glukoze iz stanica C) pospješuje sintezu glikogena u stanicama jetre D) pospješuje razgradnju glikogena (glikogenolizu) u stanicama 570. Koje od navedenih tvari nazivamo spolnim hormonima? A) tiroksin B) oksitocin C) adrenalin D) kortizol E) estrogen F) progesteron 571. U procesu fotosinteze: A) dolazi do oksidacije CO2 B) toplina Sunca pobuđuje molekule klorofila C) se dio Sunčeve energije veže i pretvara u kemijsku energiju D) Sunčeva svjetlost oksidira NADPH2 E) Sunčeva svjetlost razlaže molekule vode F) sve sinteze ovise izravno o svjetlosti 572. Dormancija je A) bolest spavanja B) uzrokovana nedostatkom vitamina C C) nemogućnost klijanja sjemenke zbog nedostatka vlage D) razdoblje mirovanja kada sjemenka ne može proklijati E) bolest koju prenosi muha ce-ce

F) nemogućnost klijanja sjemenke uzrokovana unutarnjim čimbenicima 573. Kljunaši i tobolčari: A) nesu jaja B) su aplacentalni sisavci C) nose mlade u tobolcu D) hrane mladunčad mlijekom koje se stvara u mliječnim žlijezdama majke E) su fosili F) su placentalni sisavci 574. U biocenozama saprofagi se harane: A) živim algama B) uginulim biljnim dijelovima C) bakterijama D) algama i bakterijama koje žive u moru E) životinjskim lešinama 575. Među nacionalne parkove Hrvatske ubrajamo: A) Malostonski zaljev B) otok Lokrum C) Risnjak D) Kopački rit E) otok Biševo s Modrom spiljom F) dio otoka Mljeta 576. Mjerilo gustoće populacija je: A) odnos između malađih i starijih članova populacije B) odnos spolova u populaciji C) broj jedinki neke vrste na određenom prostoru D) broj ženskih jedinki neke vrste u zajednici E) ukupna biomasa neke vrste na nekom prostoru 577. U ciklusu kruženja dušika u biosferi, dušik iz zraka mogu vezati: A) nitrifikacijske bakterije B) denitrifikacijske bakterije C) dušikove bakterije D) patogene bakterije


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________

E) modrozelene alge F) djetelina

Pitanja kojima treba upisati odgovore 578. Genetičar i zoolog imali su jednak broj vinskih mušica. Genetičar je planirao pokus te mu je zoolog dao 880 mušica. Za koliko je veći broj mušica kojima sada raspolaže genetičar od onog koji je preostao zoologu? __________ 579. U kavezu ima 20 miševa, od toga su polovica ženke. Koliko najmanje miševa treba nasumce prebaciti u novi kavez ako se žele dobiti potomci? __________ 580. Gubari su napali šumu i svakim danom bilo je dvostruko više zaraženog drveća nego dan ranije. Za sedam dana cijela šuma bila je zaražena. Za koliko je dana bilo zaraženo pola šume? _________ 581. U jednom polinukleotidnom lancu dvolančane molekule DNA brojevni udio pojedinih baza je: x(G) = 20 %, x(A) = 35 %, x(C) = 24 %, x(T) = 21 %, to znači da je sastav drugog lanca sljedeći: x(G) __________ % x(A) __________ % x(C) __________ % x(T) __________ % 582. Upiši brojeve koji nedostaju: A) 2, 5, 10, 17, __, 37 B) 2, 8, 18, 32, __, 72 C) 0, 3, 8, 15, 24, __ D) 2, 3, 5, __, 12, __


Pitanja s jednim točnim odgovorom 583. Gametofit je veći od sporofita kod: A) heterospornih papratnjača B) mahovina C) golosjemenjače ginka D) kritosjemenjača 584. Leđna moždina se nalazi A) ispod svitka B) iznad svitka C) unutar svitka D) ispod škržnog ždrijela 585. Koliki je ukupni udarni volumen srca u mililitrima ako srce kuca 1 sat, 20 minuta i 30 sekundi: A) 2.94×106 B) 2.94×105 C) 3.9445×105 D) 3.9445×106 E) 9.8×106 586. Unutrašnju oplodnju imaju: A) svi kralješnjaci B) kukci C) ježinci D) meduze 587. U pauka krstaša predljive žlijezde se otvaraju na A) helicerama (kliještima) B) nogama za hodanje C) stražnjem dijelu tijela D) žalcu 588. U regulaciji koncentracije natrija putem bubreega sudjeluje: A) aldosteron B) antidiuretički hormon C) kortizon D) kortizol E) tiroksin 589. U proksimalnom (silaznom) tubulu bubrega resorbira se:

_________________________________________________________________________ Pitanja

A) ukupna količina fruktoze B) ukupna količina glukoze C) ukupna količina saharoze D) ukupna količina maltoze E) ukupna količina inulina 590. U kambriju su na Zemlji živjele A) bakterije, alge, papratnjače i vodeni beskralježnjaci B) bakterije, alge, papratnjače, vodeni beskralježnjaci i primitivne ribe C) bakterije, alge i vodeni beskralježnjaci D) bakterije, alge, gljive, papratnjače, vodeni beskralježnjaci, primitivne ribe i prvi kopneni kralješnjaci 591. Neurohormoni ili neurotransmiseri su spojevi koji se A) vežu za eksitacijske receptore neurona u kojem nastaju B) vežu za inhibicijske receptore neurona u kojem nastaju C) vežu za eksitacijske mjehuriće D) vežu na specifične receptore narednog neurona E) vežu na specifične receptore istog neurona 592. Hidatode su žlijezde za A) izlučivanje vodene pare B) izlučivanje vode C) izlučivanje sluzi D) primanje vode E) primanje sluzi 593. U procesu glikolize od jedne molekule glukoze nastaju A) dvije molekule jabučne kiseline i 2 ATP-a B) četiri molekule jabučne kiseline i 4 ATP-a C) dvije molekule pirogrožđane kiseline i 2 ATP-a D) četiri molekule pirogrožđane kiseline i 2 ATP-a

E) dvije molekule pirogrožđane kiseline i jedna molekula jabučne kiseline 594. Čovjek se može zaraziti trihinom ako A) jede neoprano voće i povrće onečišćeno zrelim jajima trihine B) pojede trihinom zaraženo meso C) pije vodu onečišćenu zrelim jajima trihine D) ga ubode trihinom zaraženi komarac 595. Ako je kod u genu za protein ATGGGATGACCA, onda pri sintezi proteina ribosomu redom pristupaju tRNA sa sljedećim antikodima: A) CCA, UGA, GGA, AUG B) AUG, GGA, UGA, CCA C) ATG, GGA, TGA, CCA D) UAC, CCU, ACU, GGU E) TAC, CCU, ACT, GGT Pitanja s dva točna odgovora 596. Kod navedenih hranidbenih lanaca u ekosustavima nije moguć: A) u moru planktonska alga – planktonski račić – punoglavac – skuša – morska mačka B) u jezeru planktonska alga – planktonski račić – riba ukljeva – riba pastrva – vidra C) u moru bakterije – školjkaš – hobotnica D) na kopnu trava – skakavac – zec – ris E) na kopnu biljni plodovi – šumski miš – kobac 597. Infekciju virusom HIV, uzročnikom SIDE, karakterizira: A) povećanje broja leukocita (leukemija) B) propadanje limfocita zbog umnažanja virusa u njima C) pojava oportunističkih infekcija D) virus ne pobuđuje nastajanje specifičnih protutijela


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________

E) zaraza se ustanovljava samo elektronskim mikroskopom F) osobe bez simptoma bolesti nisu prenosioci virusa 598. Smreku prepoznajemo po sljedećim morfološkim karakteristikama: A) iglice su duge do 5 cm i drže se u parovima B) iglice su plosnate i tupe s dvije bijele usporedne pruge na donjoj strani C) iglice su četverouglaste i na vrhu šiljaste D) iglice su poredane okolo čitave grančice E) češeri stoje uspravno i ne otpadaju cijeli F) krošnja je nepravilnog oblika 599. U karakteristike jednosupnica ubrajamo: A) čupavo krijenje B) žile u stabljici poredane u krugu C) peteročlani prsten D) rast u debljinu E) usporedne glavne žile u listu F) četveročlani cvijet 600. Dvije od navedenih bolesti uzrokovane su bakterijama: A) dječja paraliza B) bjesnoća C) mumps D) gripa E) encefalitis F) tuberkuloza G) sifilis 601. Unos većih količina otpadnih razgradljivih organskih tvari u jezerski ekosustav izazvat će: A) bujniji razvoj alga i povećanje koncentracije kisika u površinskim slojevima B) nedostatak kisika u pridnenim slojevima


C) razvoj veće brojnosti vrsta s malim brojem jedinki D) smanjenje primarne organske proizvodnje E) smanjenje sekundarne organske proizvodnje 602. Karakteristike bakterija su: A) razmnožavaju se sporama B) vide se samo elektronskim mikroskopom C) ne mogu se uzgajati na umjetnim hranjivim podlagama D) neke fotosintezom stvaraju organske spojeve E) iz zraka vežu kisik i njime obogaćuju tlo F) po organizaciji stanice pripadaju prokariotima Pitanja kojima treba upisati odgovore 603. Najmanji uzročnici bolesti su __________ i __________. 604. Organomotorna gibanja čiji je smjer neovisan o smjeru izvora podražaja i određen samo građom organa zovu se: __________. 605. Kratkovidna žena crne kose, čiji je otac plavokos, ima plave oči. Kratkovidan muškarac, čija je majka normalnog vida, ima plavu kosu i smeđe oči. Ako je vjero jatnost da njihovo dijete vidi normalno 1:4, a ima vjerojatnost da ima smeđe oči 1:2, kolika je vjerojatnost da uz normalan vid i smeđe oči ima još i plavu kosu? (Napomena: kratkovidnost je dominantna osobina, a boja kose i očiju određena je većim brojem gena, no možemo reći da su tamna kosa i smeđe oči dominantne osobine) __________.

Pitanja otvorenog tipa 606. Slika prikazuje molekulu kojoj nedostaje središnji element.

606.1. Upišite na slici simbol kemijskog elementa koji nedostaje. 606.2. Kojoj skupini organskih spojeva pripada molekula na slici? 606.3. Kako se zove veza kojom se međusobno povezuju takve molekule? 606.4. Kako se naziva polimer sastavljen od mnogo takvih molekula? 607. Bakterije se u povoljnim uvjetima razmnožavaju velikom brzinom. 607.1. Koliko će bakterijskih stanica nastati od jedne bakterije nakon triju uzastopnih dioba? 607.2. Kakve su bakterije nastale diobom od jedne ishodišne? 607.3. A. B. C. D. E.

Bakterija Diplococcus pneumoniae uzrokuje upalu pluća. Na slici zaokruži slovo odgovarajućeg oblika ove bakterije. 607.4. U vodi koju smo uzeli iz obližnjeg potoka otkrili smo prisutnost bakterije Escherichia coli. O kakvoj vrsti onečišćenja govorimo u tom slučaju?


608. Slike od 4. do 7. prikazuju cvjetove i cvatove.

608.1. Cvat je prikazan na slici/slikama? 608.2. Što je cvat? 608.3. Koja slika prikazuje zaštićenu biljku i kako se biljka zove? 608.4. Navedite četiri glavna dijela cvijeta. 609. Slika prikazuje rodoslovno stablo svitkovaca.


609.1. Napišite imena glavnih skupina prikazanih svitkovaca. 609.2. Navedite dvije zajedničke osobine svitkovaca. 609.3. Iz kojih su se peraja vodenih kralježnjaka razvile noge kopnenih kralježnjaka? 609.4. Koji od svitkovaca prikazanih na slici imaju amnion i zašto? 610. Slika prikazuje dišni sustav.

610.1. Imenujte dijelove dišnog sustava označene slovima A, B i C 610.2. Zbog čega CO2 izlazi iz kapilarne krvi u alveole? 610.3. Navedite dvije uloge dišnog epitela. 610.4. Imenujte strukturu koja je na slici označena slovom D i navedite njezinu ulogu u disanju. 611. Slika prikazuje shematski prikaz građe eukariotske stanice.


611.1. Prikazuje li slika životinjsku ili biljnu stanicu? Po čemu to zaključujete? 611.2. Koji je organel na slici označen slovom A? Koja je njegova uloga? 611.3. Kako se zovu mjehurići koji sadrže probavne enzime i na kojem organelu nastaju? 611.4. Navedite tri osobine koje su zajedničke mitohondrijima i plastidima. 612. Slika prikazuje bakteriju.

612.1. Koji tip stanice imaju bakterije? 612.2. Po čemu to zaključujete? Navedite jedan razlog. 612.3. Kako se naziva genetički materijal bakterijske stanice koji je na slici označen slovom A? 612.4. Koja molekula čini genetički materijal bakterijske stanice? 613. Slika prikazuje građu plodišta gljiva.


613.1. Kojoj skupini gljiva pripada plodište označeno slovom A, a kojoj plodište označeno slovom B? 613.2. Navedite dvije osobine gljiva po kojima su slične životinjama. 613.3. Zbog čega dolazi do „dizanja” tijesta pod utjecajem kvaščevih gljivica? 613.4. Koje gljivice proizvode antibiotike i koja je svrha primjene antibiotika? 614. Slika prikazuje shematski prikaz građe srca.

614.1. Koja je krvna žila označena na slici slovom A i koju krv provodi? 614.2. Koja srčana komora ima najdeblju mišićnu stijenku? Objasnite zašto? 614.3. Objasnite koja je uloga srčanih zalistaka. 614.4. Objasnite kako se uznapredovala arteroskleroza odražava na vrijednosti krvnog tlaka. 615. Slika prikazuje list i detalj njegova presjeka.


615.1. prikazuje li slika list jednosupnice ili dvosupnice? Po čemu to zaključujete? 615.2. Kako se naziva tkivo lista koje se nalazi ispod gornje epiderme i koja mu je uloga? 615.3. Navedite dvije važne uloge puči. 615.4. Koje tvari provode žile lista? 616. Slika prikazuje vinsku mušicu.

616.1. Na slici označite strjelicama tri glavna dijela od kojih se sastoji tijelo kukca. Na svakoj strjelici napišite njegov naziv. 616.2. Navedite prilagodbe u razmnožavanju kukaca za život na kopnu. 616.3. Koji organski spoj sudjeluje u izgradnji oklopa kukaca? 616.4. Po čemu se nepotpuna preobrazba kukaca razlikuje od potpune? 617. Slika prikazuje ljudski jezik.

617.1. Na slici na prazne crte upišite okusna područja: slano, slatko, gorko i kiselo.


617.2. Navedite još dvije uloge jezika osim osjetilne. 617.3. U koju skupinu receptora pripadaju osjetilna tjelešca za okus? 617.4. Kojoj skupini kralježnjaka jezik pomaže u „sakupljanju” mirisa? 618. Glikoliza je metabolički proces zajednički svim živim bićima. 618.1. U kojem se dijelu stanice događa glikoliza? 618.2. Koja je početna molekula u tom procesu, a koja molekula nastaje tim procesom? 618.3. Koji se proces nastavlja na glikolizu u aerobnim uvjetima? 618.4. Koja je uloga glikolize u metabolizmu stanice? 619. U nastavi biologije ispituju se svojstva škroba u različitim namirnicama.

619.1. Navedite dvije namirnice u kojima smo mogli dokazati škrob. 619.2. Koji enzim iz sline razgrađuje škrob? 619.3. Zaokružite na slici osnovnu građevnu jedinicu škroba. 619.4. Kako se naziva osnovna građevna jedinica škroba? 620. Slika prikazuje stanicu euglene.


620.1. Koji je organel na slici označen slovom F? Koja je njegova uloga? 620.2. Gdje je veća vjerojatnost za pronalazak euglene, u čisto vodi ili u vodi opterećenoj organskim tvarima? Objasnite zašto? 620.3. Može li euglena živjeti bez stežljivog mjehurića (kontraktilne vakuole)? Objasnite zašto? 620.4. Objasnite koje je značenje prabičaša u tumačenju evolucije živoga svijeta. 621. Na slici slovima A, B, C i D označeni su sastojci ljudske krvi.

621.1. Koja su krvna tjelešca na slici označena slovom D? 621.2. Koja je uloga tjelešaca označenih slovom D? 621.3. Koja krvna tjelešca odstupaju brojnošću ili strukturom kod osobe koja je anemična? 621.4. Koje je najvažnije krvotvorno tkivo čovjeka? 622. Slika prikazuje kloroplast.

622.1. Koje eukariotske stanice sadrže kloroplast?


622.2. Koji se proces događa u kloroplastima? 622.3. Kako se naziva dio kloroplasta označen slovom A? 622.4. Iz čega su se prema teoriji o endosimbiozi, razvili kloroplasti? 623. Slika prikazuje stanicu u jednoj fazi mitoze.

623.1. U kojoj se fazi mitoze nalazi stanica na slici? Navedite jednu značajku po kojoj je ta faza prepoznatljiva. 623.2. Kako se naziva tvorba koja je na slici označena slovom A? Koja je njezina uloga u mitozi? 623.3. Što je kariotip? 623.4. Jednom rečenicom objasni koja je uloga mitoze u živim bićima.


624. Slika prikazuje pet carstava živih bića.

624.1. Navedite imena carstava sa slike. 624.2. Kojim su slovom označeni prokariotski organizmi? 624.3. Kako se naziva osnovna taksonomska (sistematska) kategorija? 624.4. Navedite po jednog predstavnika iz svakog prikazanog carstva. 625. Slika prikazuje promjenu broja bakterija u likvoru bolesnika. Bolesnik se liječio antibioticima. Proučite sliku i odgovorite na postavljena pitanja.


625.1. Kojeg je dana počeo djelovati antibiotik? 625.2. Jednom rečenicom objasnite koji su mogući uzroci porasta broja bakterija u likvoru nakon 24. dana. 625.3. Kojim će se krvnim tjelešcima povećati brojnost nakon što je osoba zaražena bakterijama? 625.4. Kako se zove znanstvenik koji je dokazao da su mikroorganizmi uzročnici zaraznih bolesti? 626. Slika prikazuje kruženje dušika u prirodi.

626.1. Dušik je značajan biogeni element. Navedite jednu organsku molekulu u koju se dušik ugrađuje. 626.2. Kako se naziva proces koji na slici provode bakterije označene slovom A? 626.3. Jednom rečenicom objasnite zašto mahunarke mogu rasti na tlu siromašnom dušikovim spojevima? 626.4. Navedite dvije biljke mesožderke. 627. Slika prikazuje šest predstavnika jedne skupine algi: volvoks, kaulerpu, klamidomonas, jadranski klobučić, morsku salatu i spirogiru. 627.1. Koje dvije od prikazanih algi žive u planktonu kopnenih voda?


627.2. Kako se naziva alga pridošlica u Jadran iz tropskih mora? 627.3. Navedite dvije zajedničke osobine zelenih, smeđih i crvenih algi. 627.4. Znanstvenici smatraju da su se iz drevnih zelenih algi razvile današnje kopnene biljke. Navedite jednu osobinu koja ukazuje na njihovo zajedničko podrijetlo.

628. Slika prikazuje organe kritosjemenjača.

628.1. Koji od prikazanih organa pripadaju jednosupnicama? 628.2. Koja se dva tipa provodnih cijevi nalaze u provodnim žilama lista kritosjemenjača?


628.3. Navedite dvije uloge korijena. 628.4. Koja je razlika u geotropizmu korijena i stabljike? 629. Slika prikazuje predstavnike mekušaca.

629.1. Kojim je slovom označen najrazvijeniji mekušac na slici? Kojoj skupini mekušaca pripada? 629.2. Kako organizam označen slovom C uzima hranu? 629.3. Kakvu tjelesnu simetriju ima organizam označen slovom B? Jednom rečenicom obrazložite svoj odgovor. 629.4. Na slikama strjelicom označite stopalo svakog organizma 630. Slika prikazuje rezultat reakcija krvi različitih krvnih grupa (stupci označeni brojevima od 1 do 4 ) s test-serumima koji sadrže anti-A, odnosno anti-B aglutinine.

630.1. Kojoj krvnoj grupi pripada testirani uzorak označen na slici brojem 1? 630.2. Koje aglutinogene sadrži osoba krvne grupe 0? 630.3. Koja je krvna grupa „univerzalni primatelj”? 630.4. Razgradnjom kojeg spoja nastaje bilirubin?


631. Na shemi je nedovršen prikaz razina koje rezultiraju izlučivanjem spolnih hormona u žene. Dopunite shemu tako da na prazne crte upišete pune nazive odgovarajućih hormona.

631.1. Navedite puni naziv hormona koji oslobađa adenohipofiza a djeluje na jajnike. 631.2. Navedite puni naziv hormona koji izlučuju jajnici. 631.3. Kako se naziva struktura u jajniku u kojoj sazrijeva jajna stanica? 631.4. Jednom rečenicom objasnite zašto propadanje žutog tijela u jajniku ima za posljedicu pojavu menstrualnog krvarenja? 632. Slika prikazuje unutarnje ženske spolne organe.


632.1. Kojim je slovom na slici označen jajovod? Navedite dvije uloge jajovoda. 632.2. Kako se naziva faza menstrualnog (ovarijskoga) ciklusa u kojoj je endometrij maternice najrazvijeniji (najdeblji)? 632.3. Karcinom maternice je jedan od najučestalijih karcinoma u žene. Na kojem se dijelu maternice najčešće razvija? Koja je najpoznatija metoda koja doprinosi ranomu otkrivanju ovoga oblika raka? 632.4. Navedite dvije mjere koje smanjuju rizik obolijevanja od spolno prenosivih bolesti. 633. Slika prikazuje niz kodona na mRNA.

633.1. Navedeni niz kodona na mRNA nosi uputu za neki peptid. Uz pomoć tablice napišite redoslijed aminokiselina u tom peptidu.

633.2. Kako se naziva proces u kojem se aminokiseline povezuju u protein na ribosomu prema redoslijedu zapisanom u mRNA? 633.3. Kako se naziva veza kojom se povezuju aminokiseline? 633.4. Kako se naziva triplet na tRNA koji je komplementaran kodonu u mRNA? 634. Slika prikazuje par homolognih kromosoma tijekom mejoze. Na kromosomima je naznačen položaj alelnih gena za dvije osobine dlake neke životinje. Slovo D označava dugu dlaku a d kratku, dok E označava crnu boju dlake a e bijelu.


634.1. Napišite genotip organizma za dva prikazana svojstva prije udvostručenja DNA. 634.2. Napišite sve moguće genotipove gameta koje će nastati na kraju II. mejotičke diobe ako se dogodio krosingover na način prikazan na slici. 634.3. Kakav će biti fenotip jedinke genotipa ddEe? 634.4. Napišite genotipove gameta koje bi nastale na kraju II. mejotičke diobe u slučaju da se nije dogodio krosingover. 635. Katarina i Luka su supružnici normalne boje kože koji normalno raspoznaju boje. Katarinin otac je daltonist i albino. Lukini roditelji su zdravi homozigoti. Aleli za normalno razlikovanje boja (XD ) i daltonizam (Xd) su spolno vezani geni. Aleli koji određuju normalnu pigmentaciju kože (A) ili albinizam (a) dolaze na jednom od parova autosoma. 635.1. Napišite genotipove Katarine i Luke. 635.2. Napišite moguće genotipove gameta Katarine i Luke za navedena svojstva. 635.3. Prikažite sve moguće genotipove njihove djece za navedena svojstva, odnosno tablicu križanja. 635.4. Kolika je vjerojatnost da navedeni bračni par dobije sina daltonista koji je istodobno i nositelj gena za albinizam ? Vjerojatnost izrazite razlomkom.


636. Slika prikazuje glave lisica koje žive u različitim geografskim pojasevima.

636.1. Kojemu geografskom području pripadaju lisice sa slike? Na praznu crtu upišite slovo kojim je označena odgovarajuća lisica. Umjereni pojas:__________ Polarni pojas: __________ Pustinjski pojas: __________ 636.2. Koji abiotički čimbenik utječe na veličinu uški lisice u različitim područjima? 636.3. Jednom rečenicom objasnite razlike u boji krzna lisica koje žive u različitim geografskim područjima. 636.4. Navedite dvije promjene u ekosustavu koje mogu dovesti do smanjenja populacije polarnih lisica. 637. Slika prikazuje prehrambeni lanac u moru.

637.1. Koji članovi lanca prikazanoga na slici imaju najveću biomasu i količinu energije a koji najmanju? 637.2. Koji je član hranidbenog lanca mesožder i potrošač drugoga reda?


637.3. Kod kojih se sve članova lanca prikazanih na slici odvija sekundarna organska proizvodnja? 637.4. Kako će se povećanje biomase fitoplanktona odraziti na biomasu svih ostalih članova lanca? 638. Slika A. prikazuje stanicu u trenutku kada smo je stavili u kap vode, a slika B. istu stanicu nakon nekoliko minuta.

638.1. Što se dogodilo sa stanicom dok je stajala u kapi vode (slika B.)? 638.2. Kako se naziva vrsta prijenosa kroz membranu koji prokazuje slika? 638.3. Kakva je citoplazma stanice na slici A. u odnosu na kap vode? 638.4. Jednom rečenicom objasnite zbog čega se dogodila prikazana promjena. 639. Slika prikazuje stanicu u jednoj fazi mitoze.


639.1. U kojoj se fazi mitoze nalazi stanica na slici? Navedite jednu značajku po kojoj je ta faza prepoznatljiva. 639.2. Kako se naziva tvorba koja je na slici označena slovom A.? 639.3. Koliko će kromosoma imati svaka stanica-kći, nastala diobom stanice koja ima 48 kromosoma? 639.4. Jednom rečenicom objasnite razliku u građi metafaznih i anafaznih kromosoma u mitozi. 640. Slika prikazuje životinjsku i bakterijsku stanicu.

640.1. Navedite dvije osnovne razlike u građi prikazanih tipova stanica. 640.2. Navedite dvije zajedničke strukture prokariotske i životinjske stanice. 640.3. Koja je molekula nositeljica nasljedne upute u bakteriji? 640.4. Koji se organel životinjske stanice tijekom evolucije najvjerojatnije razvio iz aerobne bakterije.


641. Slika prikazuje promjenu broja bakterija u urinu bolesnika. Bolesnik se liječio antibioticima. Proučite sliku i odgovorite na postavljena pitanja.

641.1. Koliko je dana prošlo od infekcije do početka djelovanja antibiotika? 641.2. Jednom rečenicom objasnite koji su mogući uzroci porasta broja bakterija u urin u nakon 16. dana. 641.3. Koja je bakterija mogla izazvati ovakvu zarazu, a inače je normalni simbiont u ljudskim crijevima? 641.4. Kako se naziva prvi antibiotik koji je korišten za liječenje ljudi? Imenujte znanstvenika koji ga je otkrio. 642. Slike prikazuju šest predstavnika jedne skupine algi: volvoks, kaulerpu, klamidomonas, jadranski klobučić, morsku salatu i spirogiru.


642.1. Na praznu crtu uz slova kojima su označene alge na slici upišite odgovarajuća imena algi. A.______________________________ B._______________________________ C.______________________________ D._______________________________ E.______________________________ F._______________________________ 642.2. Kojoj skupini algi pripadaju prikazane vrste? 642.3. Jednom rečenicom objasnite koje je značenja volvoksa za evoluciju. 642.4. Alge su značajne za život u vodenim ekosustavima. Navedite dva razloga koja podupiru ovu tvrdnju. 643. Slika prikazuje životni ciklus paprati.

643.1. Kako se zove nespolna generacija paprati? Kojim je slovom označena slici? 643.2. Kako se naziva gametofit papratnjača? 643.3. Imaju li stanice tvorbe, koja je na slici označena slovom B. haploidan ili diploidan broj kromosoma? Jednom rečenicom obrazložite svoj odgovor. 643.4. Jednom rečenicom objasnite zašto je tijekom evolucije kopnenih biljaka došlo do redukcije spolne generacije?


644. Slika prikazuje rezultat reakcija krvi različitih krvnih grupa (stupci označeni brojevima od 1 do 4) s test-serumima koji sadrže anti-A, odnosno anti-B aglutinine.

644.1. Kojoj krvnoj grupi pripada testirani uzorak označen na slici brojem 4 i zaokružen? 644.2. Koje aglutinine sadrži osoba krvne grupa AB? 644.3. Koja se krvna grupa smatra„ univerzalnim davateljem”? 644.4. Što su po kemijskom sastavu aglutinini i aglutinogeni? 645. Slika prikazuje probavni sustav čovjeka.


645.1. Na slici označite žučnu vrećicu. Koja je uloga žuči? 645.2. Kako se naziva organ koji svoje probavne enzime izlučuje u dvanaesnik? Kojim je slovom označen na slici? 645.3. Koja je uloga crijevnih resica u tankome crijevu? 645.4. Koji je najčešći uzrok ciroze jetre u razvijenim zemljama? 646. Slika prikazuje unutarnje ženske spolne organe.

646.1. Kojim je slovom na slici označe jajnik? Navedite dvije najvažnije uloge jajnika. 646.2. Kojim je slovom na slici označen spolni organ u kojem se događa oplodnja? Kako se naziva taj organ? 646.3. Kojim je slovom na slici označena maternica? Koja je uloga maternice? 646.4. Navedite tri spolne zarazne bolesti. 647. Niz baza na lancu DNA je sljedeći:

647.1. Napišite niz baza na komplementarnome lancu iste molekule. 647.2. Kako se naziva enzim pomoću kojega se replicira (udvostručuje) DNA? 647.3. U kojem se dijelu interfaze događa replikacija (udvostručenje) DNA? 647.4. Napišite niz baza na mRNA koja nastaje transkripcijom zadanoga niza:


648. Slika prikazuje par homolognih kromosoma tijekom mejoze. Na kromosomima je naznačen položaj alelnih gena za dva svojstva neke biljke. Slovo E označuje crvenu boju cvijeta, a e bijelu, dok slovo F označuje dugu stabljiku, a f kratku.

648.1. Jednom rečenicom objasnite što su homologni kromosomi. 648.2. Napišite genotip organizma za dva prikazana svojstva prije udvostručenja DNA. 648.3. Napišite sve moguće genotipove gameta koje će nastati na kraju II. mejotičke diobe ako se dogodio krosingover na način prikazan na slici. 648.4. Kako će izgledati fenotip sljedećeg potomka: eeFf 649. Marta i Petar su zdravi supružnici i imaju dvoje djece. Martin otac boluje od hemofilije. Marta ima krvnu grupu AB, a Petar krvnu grupu 0. Aleli za hemofiliju (Xh ) i normalno zgrušavanje (XH) su spolno vezani geni, a krvne grupe određuju aleli (A,B,0) koji dolaze na jednom od parova autosoma. 649.1. Napišite genotipove Marte i Petra. 649.2. Napišite moguće genotipove gameta Marte i Petra za navedena svojstva. 649.3. Prikažite moguće genotipove njihove djece za navedena svojstva, odnosno tablicu križanja. 649.4. Kolika je vjerojatnost da Marta i Petar dobiju zdravoga sina krvne grupe B?


650. Na slikama A., B., C. označena su krila različitih životinja.

650.1. Kako se nazivaju organi različiti po postanku koji obavljaju sličnu funkciju? 650.2. Iz kojeg tkiva/organa nastaju krila kukaca? 650.3. Iz koje su se skupine (razreda) kralježnjaka razvile današnje ptice i sisavci? 650.4. Navedite dvije osobine koje je imala praptica (Archaeopteryx), a nemaju ih današnje ptice. 651. Slika prikazuje dva odrasla primjerka pingvina vrste A. i B.

651.1. U kojem dijelu svijeta žive prikazane vrste pingvina A. i B.? Upišite slova na karti svijeta u dvama od ponuđenih četiriju kvadratića.


651.2. Jednom rečenicom obrazložite svoj odabir. 651.3. Koje ekološko pravilo govori o razlozima različitih veličina tijela srodnih vrsta u ovisnosti o temperaturi? 651.4. Pripadaju li pingvini grebenkama ili bezgrebenkama? 652. Slika prikazuje prehrambeni lanac u moru.

652.1. Koji su članovi lanca na slici biljojedi a koji mesojedi? 652.2. Kako će se povećanje biomase zooplanktona odraziti na biomasu riba i liganja? 652.3. Hoće li biomasa fitoplanktona u moru biti veća zimi ili proljeće? Jednom rečenicom objasnite zašto?


652.4. Jednom rečenicom objasnite razliku između primarne i sekundarne organske proizvodnje. 653. Slika pokazuje strukturu molekule ATP-a.

653.1. Koju ulogu u stanici ima spoj prikazan na slici? 653.2. U kojem je dijelu molekule ATP-a pohranjena energija? 653.3. Navedite naziv jednoga staničnog procesa u kojem nastaje ATP. 653.4. Kako se naziva stanični organel u kojem nastaje veliki broj molekula ATPa? 654. Slika prikazuje životinjsku stanicu.


654.1. Kako se naziva jedna stanična struktura koju ima životinjska, a nema biljna stanica? Uz naziv stanične strukture upišite slovo kojim je označena na slici. 654.2. Navedite jedan od staničnih organela u kojem se nalaze molekule DNA i kojim je slovom označen na slici. 654.3. Pretpostavimo da slika prikazuje stanicu gušterače. Kako se naziva stanični organel na kojem će se sintetizirati inzulin, na slici označen slovom E ? 654.4. Na kojoj staničnoj tvorbi nastaju lizosomi? 655. Na slici je pojednostavljen prikaz mejoze.


655.1. U kojoj fazi mejoze dolazi do razdvajanja homolognih kromosoma? Kojim je slovom ta faza označena na slici? 655.2. Kojim je slovom na slici prikazana metafaza II.? 655.3. U kojim se spolnim organima muškaraca zbiva mejoza? 655.4. Koji je proces u profazi I. najvažniji uzrok genetičke raznolikosti stanica? 656. Slika prikazuje umnožavanje virusa u bakterijskoj stanici.

656.1. Koji je virus označen slovom A na slici? 656.2. Pogledajte sliku i ponuđenim opisima etapa u razmnožavanju pridružite odgovarajuća slova. Vezanje virusa na površinu bakterije:___ Sklapanje novih virusnih čestica:___ 656.3. Koji je najpouzdaniji način zaštite od virusnih bolesti? 656.4. Kako se nazivaju subvirusne čestice koje uzrokuju bolest stoke „kravlje ludilo”?


657. Slika prikazuje papučicu.

657.1. U koju skupinu praživotinja (Protozoa) pripadaju papučice? 657.2. Kako se naziva struktura koja ima ulogu izbacivanja suviška vode iz papučice i kojim je slovom označena na slici? 657.3. Kako se naziva struktura koja obavija tijelo papučice i daje mu stalni oblik i čvrstoću? 657.4. Kako se zove „otac mikroskopa” koji je prvi promatrao jednostanične organizme? 658. Slika prikazuje cvijet kritosjemenjače.


658.1. Kako se naziva dio cvijeta koji je na slici označen slovom A ? 658.2. U kojem se dijelu tučka događa oplodnja? 658.3. Kako se naziva cvijet koji sadrži i tučak i prašnike? 658.4. Preobrazbom kojih organa nastaju dijelovi cvijeta? 659. Slika prikazuje kostur ptice.

659.1. Na temelju izgleda prsne kosti odredite skupinu ptica čiji je primjer kostura prikazan na slici. 659.2. Navedite jednu prilagodbu za letenje u građi kostura ptica. 659.3. Kojim je slovom na slici označena bedrena kost? 659.4. Navedite jednu zajedničku osobinu ptica i gmazova.


660. Slika prikazuje osnovnu građevnu jedinicu bubrega.

660.1. Kojim je slovom na slici označen glomerul i koja je njegova uloga u radu bubrega? 660.2. Kakva će biti koncentracija mokraće osobe koja je jela pršut nakon otprilike četiri sata u odnosu na osobu koja je jela lubenicu? 660.3. Navedite jednu tvar iz koje nastaje ureja ili karbamid. 660.4. Kako se zove poremećaj povećane koncentracije ureje u krvnoj plazmi? 661. Pacijentu su dijagnosticirali patuljasti rast. Liječnik mu je odredio hormonsku terapiju. 661.1. Koja je žlijezda prestala ispravno funkcionirati? 661.2. Navedite puni naziv hormona koji će pacijent morati uzimati. 661.3. Koji poremećaj nastaje ako se isti hormon luči u prekomjernoj količini? 661.4. Jednom rečenicom objasnite razliku u načinu izlučivanja egzokrinih i endokrinih žlijezda.


662. Slika prikazuje životni ciklus čovjeka.

662.1. Zaokružite na slici haploidnu fazu životnoga ciklusa čovjeka. 662.2. Upišite riječ „mejoza” i „oplodnja” na za to predviđena mjesta u pravokutnicima na slici. 662.3. Kako se naziva niz mitoza kojima iz oplođene jajne stanice nastaje blastocista? 662.4. Navedite zametne listiće gastrule?


663. Slika prikazuje kariogram čovjeka.

663.1. Prikazuje li slika muškarca ili žene i po čemu se to može zaključiti? 663.2. Kako se naziva faza mitoze u kojoj se nalaze kromosomi na slici? 663.3. Koje organske makromolekule dolaze u sastavu kromosoma? 663.4. Koliko autosoma i koliko spolnih kromosoma ima gameta čovjeka? 664. Za označivanje osobina vinskih mušica rabe se međunarodno priznati simboli. Divlji tip ima sivo-smeđu boju tijela(e+) i ravna krila dulja od tijela (vg+), a mutant ima crno tijelo (e) i zakržljala krila (vg). Ove osobine nisu spolno vezane. Križana je ženka divljeg tipa za obje osobine i mužjak mutant za obje osobine. 664.1. Napišite genotip mužjaka. 664.2. Napišite genotip ženke ako je za obje osobine heterozigot. 664.3. Kakve će osobine imati potomak sljedećeg genotipa: eevg+vg ? 664.4. Kako se zove znanstvenik koji je započeo istraživanja na vinskim mušicama?


665. Slika prikazuje Miller – Urayev pokus kojim je dokazana teorija organske evolucije.

665.1. Na prazne crte upišite slova kojima su na slici označeni glavni dijelovi Miller – Urayeva pokusa. Praatmosfera ___________ Stvaranje vodene pare __________ „Prajuha” ___________ 665.2. Navedite jednu molekulu koja se nalazila u praatmosferi. 665.3. Jednom rečenicom objasnite pojam kemijske evolucije. 665.4. Kolika je starost Zemlje prema suvremenim procjenama geologa?


666. Slika prikazuje ovisnost broja ličinki pčela izlegnutih iz jajašaca pri određenim temperaturama.

666.1. Očitajte sa slike temperaturu pri kojoj će se razviti najviše ličinki pčela iz jajašaca. 666.2. Očitajte sa slike temperaturni minimum pri kojem se razvija najmanji broj ličinki pčela iz jajašaca. 666.3. Očitajte sa slike koliki je broj ličinki pčela pri temperaturi od 150C. 666.4. Navedite jednu prilagodbu na oprašivanje pčelama. 667. Slika prikazuje kruženje vode u prirodi.


667.1. Kako se naziva proces kojim biljke vodu iz tla oslobađaju u atmosferu? 667.2. Kojim procesom površinska voda prelazi u atmosferu? 667.3. Navedite jednu prilagodbu četinjača za štednju vode. 667.4. Kako se nazivaju najvažniji kemijski elementi koji izgrađuju živa bića i čije cikluse pratimo u prirodi?


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________


_______________________________________________________________________ Odgovori



ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________


_______________________________________________________________________ Odgovori

1. odg. E, v. trofoblast 2. odg. C, v. mezoderm 3. odg. A, v. mejoza I 4. odg. E, v. ribosomi 5. odg. D, v. kloroplasti 6. odg. E, v. modrozelene alge 7. odg. C, v. mitoza 8. odg. E, v. aktivni prijenos 9. odg. A, v. kromatin 10. odg. B, v. dijaliza 11. odg. D, v. lizosomi 12. odg. E, v. interfaza 13. odg. C, v. Dodatak 2 14. odg. D, v. fermentacija 15. odg. C, v. disaharidi 16. odg. D, v. glikoliza 17. odg. B, v. oksidacija 18. odg. E, v. biljni virusi 19. odg. C, v. enzimi 20. odg. E, v. ATP 21. odg. D, v. fotosinteza i reakcije na svjetlosti 22. odg. D, v. dušikove baze 23. odg. B, v. gastrulacija 24. odg. D, v. zigota 25. odg. A, v. Graafov folikul 26. odg. C, v. hipotalamus 27. odg. D, v. bijelo tijelo 28. odg. B, v. trudnoća 29. odg. D, v. prolaktin 30. odg. A, v. hipotalamus 31. odg. D, v. oksitocin 32. odg. A, v. genetska uputa 33. odg. B, v. sinteza proteina 34. odg. D, v. test križanje 35. odg. B, v. zakoni nasljeđivanja 36. odg. B, v. monohibridno križanje s dominacijom 37. odg. E, v. tundra 38. odg. B, v. biosfera 39. odg. E, v. razlagači 40. odg. C, v. areal 41. odg. E, v. hranidbeni lanac 42. odg. A, v. primarna organska produkcija

43. odg. C, v. pokretačke sile evolucije 44. odg. B, v. endoplazmatska mrežica 45. odg. B, v. vertikalne zone biosfere 46. odg. C, v. dihibridno križanje s dominacijom 47. odg. E, v. označavanje nasljednih faktora i generacija Genotip AAbb dati će fenotip u kojem će se izraziti recesivno svojstvo za razliku od ostalih. 48. odg. C, v. heterozigoti 49. odg. A, v. krvne grupe 50. odg. E, v. Dodatak 2 51. odg. C, v. enzimi 52. odg. D, v. fotosinteza 53. odg. A, v. oksitocin 54. odg. C, v. profaza I 55. odg. C, v. Dodatak 5 56. odg. E, v. označavanje naslijednih faktora i generacija 57. odg. E, v. lizosomi 58. odg. E, v. citologija 59. odg. C, v. laktoza 60. odg. D, v. pasivni transport 61. odg. D, v. komplementarne baze 62. odg. E, v. ATP 63. odg. B, v. klorofil 64. odg. D, v. žuto tijelo 65. odg. E, v. eukarioti 66. odg. B, v. gastrulacija 67. odg. B, v. blastoporus 68. odg. A, v. organogeneza 69. odg. C, v. Mendelovi zakoni 70. odg. E, v. monohibridno intermedijarno križanje 71. odg. E, v. vezani geni 72. odg. C, v, modrozelene alge 73. odg. C, v. kloroplasti 74. odg. B, v. peptidna veza 75. odg. A, v. bakteriofagi 76. odg. E, v. testosteron 77. odg. D, v. nukleinske kiseline 78. odg. C, v. ovulacija 79. odg. B, v. neurosekrecijski faktori 80. odg. D, v. gonadotropni hormoni


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________

81. odg. C, v. blastocista 82. odg. C, v. interfaza 83. odg. D, v. monohibridno križanje s dominacijom 84. odg. E, v. membranski proteini 85. odg. D, v. proteini 86. odg. C, v. proteini 87. odg. E, v. nukleotidi 88. odg. A, v. timin 89. odg. E, v. nukleinske kiseline 90. odg. E, v. nukleinske kiseline 91. odg. D, vidi DNA 92. odg. A, v. enzimi 93. odg. C, v. lipaza 94. odg. B, v. pasivni prijenos 95. odg. E, v. nukleolus 96. odg. D, v. žuto tijelo 97. odg D, v. prolaktin 98. odg. D, v. blastoderm 99. odg. C, v. trofoblast 100. odg. C, v. blastomere 101. odg. B, v. homozigot 102. odg. B, v. test križanje 103. odg. C, v. monohibridno križanje s dominacijom 104. odg. B, v. vezani geni 105. odg. E, v. biologija 106. odg. D, v. ribosomi 107. odg. E, v. interfaza 108. odg. E, v. citološke metode 109. odg. C, v. adenin 110. odg. C, v. saharoza 111. odg. C, v. komplementarne baze 112. odg. D, v. ATP 113. odg. C, v. ovulacija 114. odg. B, v. testosteron 115. odg. D, v. mejoza 116. odg. A, v. mezoderm 117. odg. D, v. fenotip 118. odg. A, v. test križanje 119. odg. D, v. test križanje 120. odg. C, v. monohibridno intermedijarno križanje 121. odg. C, v. mutacije 122. odg. B, v. biocenologija


123. odg. C, v. karbon 124. odg. D, v. ribosomi 125. odg. D, v. fotosinteza 126. odg. B, v. gvanin 127. odg. C, v. ATP 128. odg. C, v. dijaliza 129. odg. E, v. koža 130. odg. E, v. oogeneza 131. odg. D, v. mejoza I 132. odg. C, v. arhenteron 133. odg. B, v. ektoderm 134. odg. C, v. gastrulacija 135. odg. C, v. prolaktin 136. odg. A, v. nasljeđivanje 137. odg. D, v. Mendelovi zakoni 138. odg. E, v. test križanje 139. odg. C, v. monohibridno intermedijarno križanje 140. odg. D, v. mutacije 141. odg. A, v. genetska uputa 142. odg. D, v. biomasa 143. odg. B, v. sukcesija 144. odg. D, v. Dodatak 5 145. odg. B, v. prophliopitekus 146. odg. B, v. molekularna biologija 147. odg. A, v. proteini 148. odg. B, v. gvanin 149. odg. D, v. nukleinske kiseline 150. odg. A, v. DNA 151. odg. C, v. enzimi 152. odg. C, v. fotosinteza 153. odg. D, v. kodon 154. odg. D, v. gonadotropni hormoni 155. odg. A, v. Virchow 156. odg. C, v. prolaktin 157. odg. C, v. blastula 158. odg. B, v. trudnoća 159. odg. E, v. dihibridno križanje s dominacijom 160. odg. A, v. test križanje 161. odg. D, v. evolucija 162. odg. B, v. embriologija 163. odg. C, v. laktoza 164. odg. E, v. proteini 165. odg. D, v. proteini

_______________________________________________________________________ Odgovori

166. odg. D, v. eukarioti 167. odg. E, v. nukleinske kiseline 168. odg. A, v. citozin 169. odg. D, v. polinukleotidi 170. odg. C, v. ATPaza 171. odg. D, v. AMP 172. odg. E, v. NADP 173. odg. C, v. aktivni prijenos 174. odg. D, v. interfaza i jezgra 175. odg. A, v. testosteron 176. odg. E, v. ICSH 177. odg. C, v. embrioblast 178. odg. E, v. monohibridno križanje s dominacijom 179. odg. E, v. monohibridno križanje s dominacijom 180. odg. C, v. monohibridno intermedijarno križanje 181. odg. C, v. Golgijevo tijelo 182. odg. D, v. nukleoid 183. odg. D, v. anafaza I 184. odg. D, v. telofaza I 185. odg. E, v. žuto tijelo 186. odg. E, v. genetska uputa 187. odg. D, v. genetska uputa i sinteza proteina 188. odg. D, v. genetska uputa i sinteza proteina 189. odg. C, v. zigota 190. odg. D, v. fenotip 191. odg. D, v. dihibridno križanje s dominacijom 192. odg. C, v. Dodatak 2. 193. odg. C, v. Mendelovi zakoni 194. odg. D, v. monohibridno intermedijarno križanje 195. odg. E, v. označavanje nasljednih faktora i generacija 196. odg. D, v. dihibridno križanje s dominacijom 197. odg. C, v. test križanje 198. odg. C, v. relikti 199. odg. D, v. biologija 200. odg. B, v. eukarioti 201. odg. B, v. prokarioti

202. odg. C, v. ribosomi 203. odg. D, v. kloroplasti 204. odg. C, v. bakteriofagi 205. odg. D, v. eukarioti 206. odg. D, v. biljna stanica 207. odg. E, v. kloroplasti 208. odg. D, v. biljna stanica 209. odg. B, v. voda 210. odg. D, v. DNA 211. odg. E, v. DNA 212. odg. C, v. adenin 213. odg. C, v. citozin 214. odg. D, v. DNA 215. odg. C, v. DNA 216. odg. A, v. RNA 217. odg. B, v. peptidi 218. odg. C, v. genetska uputa 219. odg. A, v. blastula 220. odg. B, v. gonadotropni hormoni 221. odg. D, v. estrogen i progesteron 222. odg. C, v. anatomija 223. odg. A, v. ekologija 224. odg. B, v. Dodatak 3 225. odg. A, v. aminokiseline 226. odg. B, v. genetska uputa 227. odg. B, v. DNA 228. odg. C, v. komplementarne baze 229. odg. E, v. homozigot 230. odg. B, v. test križanje 231. odg. C, v. test križanje 232. odg. D, v. dihibridno križanje s dominacijom 233. odg. B, v. dihibridno križanje s dominacijom i vezani geni 234. odg. B, v. vinska mušica, kromosomska garnitura 235. odg. B, v. test križanje i dihibridno križanje s dominacijom 236. odg. A, v. spolno vezano nasljeđivanje 237. odg. C, v. anafaza I 238. odg. E, v. virusi 239. odg. B, v. trofoblast 240. odg. E, v. ekologija 241. odg. E, v. krosingover


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________

242. odg. B, v. mutacija 243. odg. C, v. Fleming 244. odg. E, v. homologni kromosomi 245. odg. C, v. FSH, LH i LTH 246. odg. B, v. prolaktin 247. odg. C, v. spolno vezano nasljeđivanje 248. odg. B, v. Dodatak 2 249. odg. E, v. čovjek, kromosomska garnitura 250. odg. B, v. vinska mušica, kromosomska garnitura 251. odg. D, v. Dodatak 2 252. odg. C, v. Dodatak 2 253. odg. B, v. Dodatak 2 254. odg. E, v. vezani geni 255. odg. D, v. ATP 256. odg. E, v. ATP 257. odg. B, v. Hooke 258. odg. D, v. mitoza 259. odg. E, v. pričvrsnica 260. odg. C, v. nukleoidi 261. odg. C, v. blastocel 262. odg. D, v. mezoderm 263. odg. E, v. ektoderm 264. odg. E, v. endoderm 265. odg. A, v. test križanje 266. odg. B, v. test križanje 267. odg. B, v. monohibridno križanje s dominacijom 268. odg. D, v. dihibridno križanje s dominacijom 269. odg. E, v. fenilalanin i genetska uputa 270. odg. B, v. fiziologija 271. odg. B, v. evolucija 272. odg. E, v. autoradiografija 273. odg. C, v. dušikove baze 274. odg. C, v. Golgijevo tijelo 275. odg. C, v. ribosomi 276. odg. D, v. RNA 277. odg. D, v. stanična membrana 278. odg. E, v. recesivno svojstvo 279. odg. B, v. test križanje 280. odg. C, v. vezani geni


281. odg. A, v. dihibridno križanje s dominacijom 282. odg. C, v. dihibridno križanje s dominacijom i vezani geni 283. odg. B, v. spolno vezano nasljeđivanje 284. odg. C, v. vinska mušica, kromosomska garnitura 285. odg. B, v. test križanje 286. odg. E, v. dihibridno križanje s dominacijom 287. odg. E, v. aleli 288. odg. D, v. virusi 289. odg. E, v. živa bića 290. odg. B, v. Golgijevo tijelo 291. odg. E, v. križanac 292. odg. E, v. tripanosoma 293. odg. E, v. voda 294. odg. D, v. proteini 295. odg. E, v. RNA 296. odg. E, v. sinteza proteina 297. odg. D, v. mutacije 298. odg. C, v. monohibridno križanje s dominacijom 299. odg. D, v. dihibridno križanje s dominacijom 300. odg. C, v. označavanje nasljednih faktora i generacija 301. odg. A, v. kariotip 302. odg. B, v. fiziološka otopina 303. odg. A, v. biomasa 304. odg. B, v. genetske karte 305. odg. A, v. prokarioti 306. odg. E, v. atavizam 307. odg. C, v. rudimenti 308. odg. E, v. kodon 309. odg. E, v. poliU 310. odg. D, v. polifenilalanin 311. odg. C, v. sinteza proteina i genetska uputa 312. odg. D, v. histologija 313. odg. D, v. ekologija 314. odg. C, v. hipoglikemija 315. odg. E, v. steroidi 316. odg. E, v. aminokiseline

_______________________________________________________________________ Odgovori

317. odg. E, v. pirimidinske baze 318. odg. E, v. dominantno svojstvo i označavanje nasljednih faktora i generacija 319. odg. D, v. test križanje 320. odg. A, v. vezani geni 321. odg. E, v. recesivno svojstvo i homozigoti 322. odg. B, v. test križanje 323. odg. A, v. vezani geni 324. odg. B, v. spolno vezano nasljeđivanje 325. odg. A, v. spolno vezano nasljeđivanje 326. odg. D, v. vinska mušica, kromosomska garnitura 327. odg. B, v. modrozelene alge 328. odg. C, v. dihibridno križanje s dominacijom 329. odg. C, v. Mendelovi zakoni 330. odg. B, v. mejoza I 331. odg. E, v. bakteriofagi 332. odg. B, v. embrioblast 333. odg. E, v. ATP 334. odg A, v. oksidacija 335. odg B, v. fagocitoza 336. odg E, v. DNA 337. odg. E, v. jezgrica 338. odg. B, v. metafaza 339. odg. D, v. neuron 340. odg. E, v. koža 341. odg. C, v. blastoderm 342. odg. C, v. blastoporus 343. odg. D, v. mezoderm 344. odg. C, v. bakterije 345. odg. E, v. prokarioti 346. odg. E, v. homozigot 347. odg. D, v. Medelovi zakoni 348. odg. A, v. test križanje 349. odg. E, v. označavanje nasljednih faktora i generacija 350. odg. A, v. krosingover 351. odg. C, v. fenilalanin i genetska uputa 352. odg. A, v. komplementarne baze i kodon 353. odg. C, v. lizosomi

354. odg. E, v. mitohondriji 355. odg. E, v. jezgrica 356. odg. D, v. kromatin 357. odg. C, v. anafaza I 358. odg. B, v. spermatogeneza i oogeneza 359. odg. A, v. telofaza I 360. odg. E, v. ektoderm 361. odg. E, v. Dodatak 2 362. odg. D, v. vezani geni 363. odg. A, v. test križanje 364. odg. E, v. nukleoid 365. odg. C, v. kloroplasti 366. odg. E, v. biologija 367. odg. B, v. osmoza 368. odg. E, v. endokrine žlijezde 369. odg. B, v. profaza I 370. odg. B, v. blastoderm 371. odg. A, v. blastoporus 372. odg. B, v. ektoderm 373. odg. C, v. trofoblast 374. odg. B, v. životinjski virusi 375. odg. C, v. dihibridno križanje s dominacijom 376. odg. B, v. spolno vezano nasljeđivanje 377. odg. C, v. centrosomi i diobeno vreteno 378. odg. C, v. endoplazmatska mrežica 379. odg. D, v. lizosomi 380. odg. D, v. fermentacija 381.odg. B, v. oksidacija 382.odg. C, v. oplodnja 383.odg. D, v. zigota 384. odg. E, v. tundra 385. odg. E, v. heterotrofi i bakterije 386. odg. B, v. fenološke pojave 387. odg. C, v. areal 388. odg. E, v. autotrofi 389. odg. A, v. primarna organska produkcija 390. odg. B, v. endem 391. odg. D, v. ekosustav 392. odg. A, v. australopitekus i dodatak 5 393. odg. E, v. biološki indikatori onečišćenja


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________

394. odg. B, v. vertikalne zone biosfere 395. odg. E, v. bakteriofagi 396. odg. E, v. Escherichia coli 397. odg. D, v. fenotip 398. odg. C, v. mutacije 399. odg. E, v. koža 400. odg. A, v. virusi 401. odg. C, v. bakterije 402. odg. A, v. patogene bakterije 403. odg. B, v. mutacija 404. odg. E, v. antropologija 405. odg. B, v. Morgan, T. 406. odg. D, v. kultura tkiva 407. odg. D, v. virusi 408. odg. C, v. bakterije 409. odg. E, v. prokarioti 410. odg. E, v. mitohondriji 411. odg. B, v. osmoza 412. odg. B, v. biocenoza 413. odg. C, v. herbivori i heterotrofi 414. odg. E, v. sekundarna organska produkcija 415. odg. E, v. hranidbena piramida 416. odg. C, v. hranidbeni lanac 417. odg. D, v. patogene bakterije i upala pluća 418. odg. E, v. disanje 419. odg. E, v. mitohondriji 420. odg. D, v. limfa 421. odg. A, v. implantacija jajašca 422. odg. B, v. živčana stanica 423. odg. C, v. hipertoničan 424. odg. A, v. natalitet 425. odg. D. v. areal 426. odg. E, v. patogene bakterije 427. odg. D, v. hipotoničan 428. odg. A, v. populacija 429. odg. D, v. bentoska biocenoza 430. odg. C, v. krapinski pračovjek 431. odg. B, v. ekosustav 432. odg. C, v. krapinski pračovjek 433. odg. D, v. eritrocit 434. odg. A, v. alge 435. odg. E, v. prirodni rezervat i dodatak 4


436. odg. C, v. virusi i dječja paraliza 437. odg. D, v. bakteriofag 438. odg. B, v. bakterije 439. odg. A, v. bakterije 440. odg. E, v. eukarionti 441. odg. B, v. lizosomi i endocitoza 442. odg. D, v. vitamini 443. odg. B, v. menstrualni ciklus 445. odg. B, v. neandertalski pračovjek i dodatak 5 446. odg. B, v. živi fosili i ginkgo 447. odg. C, v. virusi 448. odg. C, v. fotosinteza 449. odg. C, v. abiotički faktori 450. odg. C, v. Homo sapiens 451. odg. E, v. modifikacije 452. odg. E, v. plazmidi 453. odg. B, v. prokariotska stanica 454. odg. D, v. saprofiti 455. odg. B, v. endocitoza 456. odg. A, v. leukoplasti 457. odg. A, v. lišaj 458. odg. A, v. mahovine i prokličnica 459. odg. B, v. sorus i paprati 460. odg. C, v. sjemeni zametak i tučak 461. odg. B, v. dvosupnice 462. odg. A, v. prijelazni oblici 463. odg. B, v. homologni organi 464. odg. C, v. rudimentarni organi 465. odg. C, v. bičaši i kremenjašice 466. odg. C, v. kremenjašice 467. odg. B, v. steljnače, steljka i alge 468. odg. A, v. protalij 469. odg. D, v. pteridosperme 470. odg. D, v. prašnik 471. odg. A, v. dvosupnice 472. odg. D, v. plod 473. odg. B, v. vegetacija 474. odg. C, v. autosomi 475. odg. A, v. pričvrsnica 476. odg. E, v. virusi 477. odg. D 478. odg. B, v. plazmoliza 479. odg. C, v. protalij 480. odg. B, v. kritosjemenjače

_______________________________________________________________________ Odgovori

481. odg. E, v. sedrene barijere 482. odg. B, v. psilofiti 483. odg. E, v. relikti 484. odg. C, v. jednosupnice 485. odg. D, v. mahovine 486. odg. B, v. flora 487. odg. A, v. krosingover 488. odg. C, v. spolna određenost potomaka 489. odg. C, v. klica 490. odg. B, v. rudimenti 491. odg. B, v. mutacije 492. odg. E, v. kambij 493. odg. D, v. virusi 494. odg. C, v. viroidi 495. odg. B, v. virusi 496. odg. B, v. bakterije 497. odg. B, v. vegetacija 498. odg. B, v. centriol 499. odg. C, v. fotosinteza 500. odg. C, v. katabolizam 501. odg. E, v. fototropizam 502. odg. D, v. nitrifikacija 503. odg. C, v. kriptorhizam 504. odg. A, v. vegetativno razmnožavanje 505. odg. D, v. ugljikohidrati, glikogen 506. odg. B, v. pubertet 507. odg. B, v. termoregulacija 508. odg. A, v. koacervati 509. odg. A i D, v. paprati 510. odg. A i D, v. zaštita okoliša 512. odg. C i E, v. populacija 513. odg. A i C, v. endokrine žlijezde 514. odg. B i E, v. enzimi, hormoni 515. odg. D, v. ekosistem 516. odg. C, v. višestanične životinje 517. odg. A, v. leukociti 518. odg. B, v. krvna plazma 519. odg. C, v. jetra, probavni sustav 520. odg. E, vidi bubreg 521. odg. C, v. škrob 522. odg. C, v. Krebsov ciklus 523. odg. E, v. stanična membrana 524. odg. A i D, v. osmoza, korijen, fotosinteza

525. odg. A i C, v, RNA 526. odg. A i C, v. drift 527. odg. B i C, v. regeneracija 528. odg. A i C, v. oligomeria 529. odg. B i C, v. mahovine, papratnjače 530. odg. D i F, v. homeotermni organizmi 531. odg. B i D, v. srce 532. odg. B i D, v. dojenje 533. odg. A4, B3, C1, D2 534. odg. A3, B4, C1, D2 535. odg. A3, B1, C4, D5, E2 536. odg. A2, B4,C1, D3 537. odg. A2, B1, C3 538. odg. sisulja (haustorija), v. haustorije 539. odg. raznožavanjem, v. populacija 540. odg. E, v. fotosinteza 541. odg. D, v. plošnjaci 542. odg. B, v. prašnik 543. odg. D, v. glavonošci 544. odg. E, v. kemoautotrofi 545. odg. A, v. fermentacija 546. odg. A, v. biljni hormoni, giberlini 547. odg. D i E, v. gmazovi i kralježnjaci 548. odg. C i E, v. spermatogeneza 549. odg. A i D, v. oksihemoglobin, hemoglobin 550. odg. A i B, v. srce 551. odg. A i C, v. hranidbeni lanac 552. odg. B, C i D, v. puči 553. odg. C, D i G, v. neuron 554. odg. 21 sadnica 555. odg. 7 cvjetova 556. odg. Jura je ekolog. Božo je mikrobiolog. Ivo je zoolog. Vlado je genetičar. 557. odg. B, v. partenogeneza 558. odg. C, v. probava 559. odg. D, v. osmotski tlak 560. odg. E, v. antibiogram 561. odg. C, v. bubreg 562. odg. A, v. glikoliza 563. odg. B, v. gonadotropni i spolni hormoni 564. odg. C, v. razvoj čovjeka i dodatak 5


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________

565. odg.C i E, v. gljive 566. odg. B i C, v. borovi 567. odg. B i C, v. svitkovci 568. odg. B i E, v. endokrine žlijezde 569. odg. A i C, v. inzulin 570. odg. E i F, v. spolni hormoni 571. odg. C i E, v. fotosinteza 572. odg. D i F, v. dormancija 573. odg. B i D, v. sisavci 574. odg. B i E, v. saprofagi 575. odg. C i F, v. nacionalni parkovi i dodatak 4 576. odg. C i E, v. gustoća populacije 577. odg. C i E, v. nitrofiksacija 578. odg. 1760 mušica 579. odg. 11 miševa 580. odg. 6 dana 581. odg. x(G) 24 % x(A) 21 % x(C) 20 % x(T) 35 % 582. odg. A) 2, 5, 10, 17, 26, 37 B) 2, 8, 18, 32, 40, 72 C) 0, 3, 8, 15, 24, 35 D) 2, 3, 5, 8, 12, 17 583. odg. B, v. mahovine 584. odg. B, v. svitkovci 585. odg. C, v. srce (80.5 min×70 mL×70/min = 3.9445×105 mL) 586. odg. B, v. kukci 587. odg. C, v. kliještari 588. odg. A, v. bubreg


589. odg. B, v. bubreg 590. odg. C, v. kambrij, dodatak 5 591. odg. D,. v. neurohormoni 592. odg. B, v. hidatode 593. odg. C, v. glikoliza 594. odg. B, v. oblići 595. odg. B, v. antikodon 596. odg. A i D, skuša ne jede punoglavce kojih ni nema u moru, a zec ne jede skakavce, v. hranidbeni lanci 597. odg. B i C, v. HIV 598. odg. C i D, v. borovi 599. odg. A i E, v. jednosupnice 600. odg. F i G, v. bakterije 601. odg. A i B, v. onečišćenje voda 602. odg. D i F, v. bakterije 603. odg. viroidi i prioni 604. odg. nastije 605. odg. 1/16 (0.0625)

Odgovori na pitanja otvorenog tipa

606. Odgovori : 606.1.

U središtu molekule je C (ugljik), v. aminokiseline 606.2. aminokiselinama, v.aminokiseline 606.3. peptidna veza, v. peptidna veza 606.4.protein ili bjelančevina, v. proteini, peptidi 607. Odgovori: 607.1. 8 (osam), 23 = 8, v. bakterije 607.2. jednake su (klonovi), v. bakterije, dvojna dioba 607.3. E, v.bakterije 607.4. o fekalnom onečišćenju, E. coli je simbiont u probavilu , v. Escherichia coli 608. Odgovori: 608.1. cvat je prikazan na slikama 5. i 7. 608.2. cvat je skup cvjetova na istoj cvjetnoj stapci, v. cvat 608.3.slika 4., kockavica, 608.4. lapovi, latice, tučak, prašnici; v. cvijet 609. Odgovori: 609.1. v. svitkovci


609.2. svitak barem u jednoj fazi razvitka, škržno ždrijelo i živčana vrpca s leđne strane tijela; v. svitkovci 609.3. iz parnih peraja (prsnih i/ili trbušnih) 609.4. gmazovi, ptice i sisavci kao prilagodba na kopneni način života tj. razvoj zametka izvan vode; v.amniota i Dodatak 5. 610. Odgovori: 610.1. A. grkljan (ždrijelo), B. dušnik, C. pluća (desno plućno krilo); v. dišni sustav 610.2. zbog toga što je u krvi veći parcijalni tlak CO2 nego u alveoli; v. alveola 610.3. pročišćavanje, zagrijavanje, vlaženje i dezinficiranje zraka 610.4. ošit ili dijafragma; svojim položajem omogućava promjenu volumena prsnog koša (udisaj – izdisaj) 611. Odgovori: 611.1. životinjska stanica; nema staničnu stijenku, nema kloroplast, nema vakuole; v. stanica 611.2. mitohondrij; stanično disanje , sinteza ATP-a; v. mitohondriji 611.3. lizosomi; nastaju na golgijevom tijelu (aparatu); v.lizosomi, golgijevo tijelo 611.4. ovojnica (dvostruka membrana), vlastita DNA prokariotskog tipa, ribosomi, mogućnost umnožavanja neovisno o staničnoj diobi; v. mitohondrij, kloroplast


612. Odgovori: 612.1. prokariotski tip, v. bakterije, prokarioti 612.2. nema jezgru niti stanične organele, ima nukleoid; v. bakterije, prokarioti 612.3. nukleoid ili bakterijski kromosom, v. nukleoid, bakterije, prokarioti 612.4. DNA, v. nukleoid 613. Odgovori: 613.1. Slika A - mješinarke; slika B – stapčarke; v. mješinarke, stapčarke 613.2. hitinska stijenka kao kod člankonožaca, rezervna tvar glikogen, slična struktura DNA, heterotrofnost; v. gljive 613.3. kvasci uzrokuje alkoholno vrenje i pritom nastaje CO2 koji „diže” tijesto; v. kvaščeve gljivice 613.4. zelene plijesni (kistac), antibiotici sprječavaju rast i razvoj bakterija, liječenje bakterioza; v. penicilijum, antibiotik 614. Odgovori: 614.1. plućna arterija; provodi vensku (deoksigeniranu) krv, v. mali optok krvi 614.2. lijeva klijetka; potrebna je najveća snaga da krv potisne u aortu, v. mali optok, srce 614.3. sprječavaju vraćanje krvi, v. zalisci srčani 614.4. uzrokujući suženje krvnih žila povećava krvni tlak, v. ateroskleroza 615. Odgovori: 615.1. list dvosupnice; prema mrežastoj nervaturi u listu, v. dvosupnice (osobine dvosupnica) 615.2. asimilacijski parenhim; u njemu se odvija fotosinteza, v. osnovno staničje 615.3. transpiracija i izmjena plinova, v. puči 615.4. vodenu otopinu mineralnih tvari i asimilate (produkte fotosinteze), v. provodno staničje 616. Odgovori: 616.1.


v. kukci 616.2. unutarnja oplodnja i jaja sa zaštitnom ovojnicom, v. kukci 616.3. polisaharid – hitin, v. hitin, kukci 616.4. nema stadija kukuljice, v. kukci 617. Odgovori: 617.1.

617.2. miješanje hrane, potiskivanje hrane u ždrijelo, artikulacija glasa (govor) 617.3. kemoreceptori 617.4. gmazovima, v. gmazovi 618. Odgovori: 618.1. u citoplazmi, v. glikoliza 618.2. početna je glukoza a nastaje pirogrožđana kiselina, v. glikoliza 618.3. Krebsov ciklus ili stanično disanje, v. Krebsov ciklus 618.4. dobivanje energije, preduvjet za daljnju razgradnju šećera; v. glikoliza


619. Odgovori: 619.1. riža, krumpir, tjestenina …; v.škrob 619.2. α-amilaza (ptijalin), v. škrob, ptijalin 619.3.

v. škrob 619.4. glukoza, v. škrob 620. Odgovori: 620.1. F – crvena očna pjega (stigma) je fotoreceptor, v. očna pjega, euglena 620.2. u vodi opterećenoj organskim tvarima, ako ne obavlja fotosintezu euglena je heterotrofna; v. euglena 620.3. ne može, zbog razlike u koncentracijama u euglenu prodire voda, stežljivim mjehurićem izbacuje vodu, rasprsnula bi se, v. stežljivi mjehurići 620.4. to je ishodišna skupina za biljni (autotrofija) i životinjski svijet (heterotrofija); v. bičaši 621. Odgovori: 621.1. trombociti, v. trombociti 621.2. zgrušavanje krvi, v. trombociti 621.3. eritrociti, v. eritrociti 621.4. koštana srž, v. koštana moždina, hematopoeza 622. Odgovori: 622.1. biljne stanice, v. kloroplast 622.2. fotosinteza , v.kloroplast i fotosinteza 622.3. tilakoidi, grana tilakoidi, v. kloroplast 622.4. iz modrozelenih algi, cijanobakterija , v. simbiogeneza


623. Odgovori : 623.1. u metafazi; kromosomi su pravilno smješteni u sredini stanice u ekvatorijalnoj ravnini pričvršćeni za niti diobenog vretena, v. metafaza 623.2. centriol, centrosom; tvorba diobenog vretena, v.centrosom 623.3. kromosomska garnitura određene vrste, v.kariotip 623.4. omogućuje rast organizma, v. mitoza 624. Odgovori : 624.1. A. gljive, B. biljke, C. monera, D. životinje. E. protista; v. carstvo 624.2. C, v. protisti 624.3. vrsta, v. vrsta 624.4. A. muhara, B. hrast, C. Escherichia coli, D. zec, E. papučica 625. Odgovori : 625.1. 12. Ili 13., v., antibiotik, pogledaj na graf 625.2. bolesnik je prerano prestao uzimati antibiotik; bakterije su postale rezistentne na antibiotik 625.3. leukocitima, v. leukocitoza 625.4. L. Pasteur, v. Pasteur,L. 626. Odgovori: 626.1. aminokiselina, bjelančevina, nukleinska kiselina; v.aminokiseline, proteini, nukleinske kiseline 626.2. nitrifikacija, v.nitrifikacija 626.3. zbog odnosa simbioze s dušikovim bakterijama, v.dušikove bakterije 626.4. rosika, venerina muholovka; v. karnivorne biljke 627. Odgovori : 627.1. volvoks (B), spirogira (C); v. volvoks, spirogira 627.2. kaulerpa (F) 627.3. klorofil a (fotosinteza), izmjena generacija; v. crvene alge, smeđe alge, zelene alge 627.4. provode pravu fotosintezu kojom se oslobađa kisik, v. crvene alge, smeđe alge, zelene alge


628. Odgovori: 628.1. A,B,F; v, jednosupnice 628.2. traheje, sitaste cijevi; v. provodno staničje 628.3. učvršćuje izdanak, opskrbljuje biljku vodom i mineralnim tvarima, v. korijen 628.4. korijen je pozitivno a stabljika negativno geotropna, v. tropizmi 629. Odgovori : 629.1. A; glavonošcima, v.glavonošci 629.2. filtracijom vode, v.školjkaši 629.3. asimetričan je, torzijom tijelo je zakrenuto i nestala je simetrija, v. puževi 629.4.

v. glavonošci 629. Odgovori : 629.1. krvnoj grupi B, v. krvne skupine 629.2. nema aglutinogena, v. krvne skupine 629.3. AB, krvne skupine 629.4. razgradnjom hemoglobina, v. eritrociti Odgovori : 631.1. gonadotropni hormon, v.gonadotropni hormon 631.2. estrogen ili progesteron, v.jajnici 631.3. Graafov folikul, v.Graafov folikul 631.4. propadanjem žutog tijela prestaje izlučivanje spolni hormona ; pretvara se u bijelo tijelo i dolazi do ljuštenja stijenke maternice i menstrualnog krvarenja, v. žuto tijelo


632. Odgovori : 632.1. A, prihvaćanje i provođenje jajne stanice od jajovoda do maternice; oplodnja, v. jajovod 632.2. sekrecijska faza, v. menstrualni ciklus 632.3. na grliću maternice; PAPA-test, v. PAPA test 632.4. 1. Higijena spolnih organa; upotreba prezervativa pro spolnom odnosu 633. Odgovori: 633.1. Met - Arg – Pro – Tyr, v. genetička uputa 633.2. prevođenje ili translacija, v. sinteza proteina 633.3. peptidna veza, v. peptidna veza 633.4. antikodon, v. antikodon, sinteza proteina 634. Odgovori: 634.1. DdEe , v.genotip, Dodatak 1. Dihibridno križanje 634.2. DE, De, dE, de, v. krosingover 634.3. kratka i crna dlaka, v. fenotip 634.4. DE, de, v. genotip, mejoza 635. Odgovori: 635.1. Katarinin genotip: XD Xd Aa Lukin genotip: XD Y AA v. albinizam, genotip, Dodatak 1. Dihibridno križanje i Spolno vezano nasljeđivanje 635.2. Katarinine gamete: XD A, X D a, Xd A, Xd a v. Dodatak 1. Dihibridno križanje i Spolno vezano nasljeđivanje 635.3.

v. Dodatak 1. Dihibridno križanje i Spolno vezano nasljeđivanje 635.4. 1/8 , v. Dodatak 1. Dihibridno križanje i Spolno vezano nasljeđivanje


636. Odgovori: 636.1. Umjereni pojas - C, Polarni pojas - B, Pustinjski pojas - A v. zaštitna obojenost 636.2. temperatura, v. abiotički čimbenici, Alenovo pravilo 636.3. različita područja različita boja krzna; bolja prilagodba okolišu, v. zaštitna obojenost 636.4. 1. promjena: nedostatak hrane; 2. promjena: paraziti, bolest, zatopljenje 637. Odgovori: 637.1. najveća biomasa - fitoplankton,najmanja biomasa - lignje, v. hranidbeni lanac 637.2. riba, v. hranidbeni lanac 637.3. u zooplanktonu, ribama i lignjama; v. hranidbeni lanac, sekundarna organska proizvodnja 637.4. povećanje biomase fitoplanktona dovodi do porasta biomase svih ostalih članova lanca, v. hranidbeni lanac, primarna organska proizvodnja 638. Odgovori: 638.1. povećao se volumen stanice, v. osmoza, bubrenje 638.2. pasivni prijenos, osmoza, v. pasivni prijenos, osmoza 638.3. hipertonična, više koncentracije, v. hipertonična otopina, osmoza 638.4. voda (otapalo) se kreće iz područja više koncentracije vode u područje niže koncentracije vode; voda se giba iz područja gdje je ima više u područje gdje je ima manje, v. osmoza 639. Odgovori: 639.1. profaza; iz kromatina se oblikuju kromosomi, postupno nestaju jezgrica i jezgrina ovojnica, v. mitoza, profaza 639.2. centrioli ili centrosom, v. centrioli, centrosom 639.3. svaka stanica-kćer će imati 48 kromosoma, v. mitoza 639.4. metafazni kromosomi su dvostruki (imaju 2 kromatide), anafazni kromosomi su jednostruki (imaju 1 kromatidu), v. metafaza, anafaza 640. Odgovori: 640.1. prokariotska stanice nema jezgru već nukleoid, odnosno nema stanične organele, v. prokarioti


640.2. stanična membrana, citoplazma, ribosomi, v. prokarioti, eukariotske stanice 640.3. molekula DNA, v. nukleoid 640.4. mitohondrij, v. simbiogeneza 641. Odgovori: 641.1. 8 ili 9 dana, v. antibiotik, pogledaj na graf 641.2. pacijent je prerano prestao uzimati antibiotik,/ neredovito je uzimao antibiotik,/ bakterije su postale rezistentne na antibiotik,/ nastupila je neka nova infekcija 641.3. Escherichia coli , v. Escherichia coli 641.4. penicilin, Aleksandar Fleming , v. penicilijum, Fleming, A. 642. Odgovori: 642.1. A-morska salata, B-volvoks, C-spirogira, D-jadranski klobučić, E klamidomonas, F-kaulerpa 642.2. zelene alge, v. zelene alge 642.3. Volvoks je kolonijalni oblik jednostaničnih algi s podjelom rada i predstavlja prijelazni oblik iz jednostaničnih prema višestaničnim organizmima, v. volvoks. 642.4. Alge su primarni proizvođači i čine osnovu svim hranidbenim lancima u vodenim ekosustavima; fotosintezom oslobađaju kisik, v. alge, primarna organska proizvodnja, hranidbeni lanac. 643. Odgovori: 643.1. sporofit, slovom A., v. sporofit , paprati 643.2. protalij, v. protalij, paprati 643.3. haploidan, zato što ta tvorba (protalij) nastaje iz haploidne spore, v. paprati, protalij 643.4. zbog prilagodbe kopnenom načinu života, tj oplodnja je neovisna o posredovanju vodom 644. Odgovori: 644.1. krvnoj grupi A, v. krvne skupine 644.2. nema aglutinina, v. krvne skupine 644.3. krvna grupa 0 jer nema aglutinogena na eritrocitima, v. krvne skupine 644.4. bjelančevine ili proteini


645. Odgovori: 645.1. emulgiranje (raspršivanje) masti u sitne kapljice čime se olakšava djelovanje lipazama, v. žučni mjehur, žuč 645.2. gušterača (pankreas), slovo D, v. gušterača, gušteračin sok 645.3. povećavaju apsorpcijsku površinu crijeva, upijaju hranjive tvari iz crijevnog sadržaja, v. tanko crijevo, apsorpcija hrane 645.4. alkoholizam, v. ciroza jetre 646. Odgovori : 646.1. slovom B , proizvodnja jajnih stanica (oogeneza) / lučenje ženskih spolnih hormona (estrogen i progesteron), v. jajnici, oogeneza, endokrine žlijezde 646.2. slovom A , jajovod, v. jajovod 646.3. slovom C , u njoj se razvija razvoj zametka (embrio – fetus), v. maternica 646.4. gonoreja (kapavac), sifilis (lues), AIDS (SIDA), v. gonoreja, sifilis, AIDS 647. Odgovori: 647.1. ATGCTGCAT, v. komplementarne baze 647.2. DNA-polimeraza, v. polimeraza 647.3. u S fazi, v. interfaza 647.4. AUGCUGCAU, v. sinteza proteina 648. Odgovori: 648.1. Homologni kromosomi su parovi kromosoma koji su jednako dugački, imaju pričvrsnicu na istome mjestu, izgledom su jednaki i nose gene za ista svojstva, v. homologni kromosomi. 648.2. EeFf, v. genotip 648.3. EF, Ef, eF, ef, v. genotip, krosingover 648.4. bijeli cvijet ; duga stabljika, v. fenotip 649. Odgovori: 649.1. Martin genotip XH Xh AB; Petrov genotip XH Y 00, v. hemofilija, krvne skupine, genotip, Dodatak 1. Dihibridno križanje i Spolno vezano nasljeđivanje 649.2. Martine gamete XH A, XH B, Xh A, Xh B; Petrove gamete XH 0, Y0, v. Dodatak 1. Dihibridno križanje i Spolno vezano nasljeđivanje 649.3.


v. Dodatak 1. Dihibridno križanje i Spolno vezano nasljeđivanje 649.4. vjerojatnost je 1/8, v. Dodatak 1. Dihibridno križanje i Spolno vezano nasljeđivanje 650. Odgovori: 650.1. analogni organi, v. analogni organi 650.2. nastala su iz pokrovnog tkiva (kože), v. 650.3. iz pragmazova, predaka današnjih gmazova, v. 650.4. zubi u kljunu, kralješnica u repu, pune kosti, kandže na krilima, v. praptica 651. Odgovori: 651.1. A-uz Čile (pretposljednji kvadratić); B-uz Patagoniju (posljednji, najjužniji kvadratić) 651.2. vrste koje žive sjevernije, bliže ekvatoru su manje a vrste koje žive bliže južnome polu su krupnije, v. Bergmanovo pravilo 651.3. Bergmanovo pravilo, v. Bergmanovo pravilo 651.4. grebenkama, v. novočeljuske 652. Odgovori: 652.1. biljojedi – zooplankton; mesojedi – riba i lignja v. hranidbeni lanac 652.2. povećanje biomase riba i liganja, v. hranidbeni lanac 652.3. U proljeće se očekuje veća biomasa fitoplanktona zbog viših temperatura i više svjetla ( veći intenzitet fotosinteze i veće razmnožavanje), v. primarna organska proizvodnja. 652.4. Primarna organska proizvodnja je sinteza organske tvari iz anorganske a odvija se u autotrofnim organizmima (zelene biljke); dok je sekundarna organska proizvodnja ona koja se odvija u heterotrofnim organizmima (životinje), v. primarna organska proizvodnja, sekundarna organska proizvodnja. 653. Odgovori: 653.1. Pohranjivanje energije, skladištenje energije, zaliha energije, izvor energije; v. ATP


653.2. U vezama između fosfata, između fosfatnih skupina; v. ATP 653.3. Glikoliza, stanično disanje, Krebsov ciklus, oksidativna fosforilacija, vrenje, svjetlosne reakcije fotosinteze; v. glikoliza, disanje, fotosinteza 653.4. Mitohondrij, kloroplast; v. mitohondrij, kloroplast 654. Odgovori: 654.1. centrosom, centriol, označena slovom B; v. centrosom, centrioli 654.2. jezgra, slovo C ili mitohondrij slovo F; v. jezgra, mitohondrij 654.3. hrapava (zrnata) endoplazmatska mrežica (retikulum); v. endoplazmatska mrežica 654.4. na Golgijevom aparatu (tijelu); v. Golgijevo tijelo 655. Odgovori: 655.1. anafaza I., slovo D; v. anafaza I., mejoza, mejoza I. 655.2. slovo E; v. mejoza, mejoza II. 655.3. u sjemenicima (testisima); v. spermatogeneza 655.4. crossing-over; v. krosingover, profaza I., mejoza, mejoza I., 656. Odgovori: 656.1. bakteriofag, bakterijski virus, fag; v. bakteriofagi 656.2. vezanje virusa na površinu bakterije – B, sklapanje i sazrijevanje novih virusnih čestica – D; v. bakteriofagi 656.3. cijepljenje, imunizacija, vakcinacija; v. cijepljenje, imunizacija 656.4. prioni; v. prioni 657. Odgovori : 657.1. trepetljikaše (Ciliata); v. papučica, trepetljikaši, praživotinje 657.2. stežljivi mjehurić, kontraktilna vakuola, slovo B; v. stežljivi mjehurić 657.3. pelikula; v. pelikula 657.4. A. van Leeuwenhoek; v. Van Leeuwenhoek A. 658. Odgovori: 658.1. latica ili vjenčić; v. cvijet 658.2. u plodnici tučka, u sjemenom zametku; v. tučak 658.3. dvospolni cvijet; v. cvijet 658.4. preobrazbom listova; v. list


659. Odgovori: 659.1. grebenke, letačice, novočeljuske; v. ptice, novočeljuske 659.2. šuplje (pneumatične) kosti, lake kosti, prsni greben, prednji udovi preobraženi u krila; v. ptice 659.3. slovo A; v. ptice 659.4. nesu jaja, suha koža prekrivena rožnatim ljuskama, unutarnja oplodnja, amniota; v. gmazovi, ptice, amniota 660. Odgovori: 660.1. slovo C, filtriranje krvi; v. glomerul, nefron 660.2. hipertonična, koncentriranija, veće koncentracije; v. antidiuretički hormon 660.3. proteini, aminokiseline; aminokiseline 660.4. uremija; v. uremija 661. Odgovori: 661.1. hipofiza, adenohipofiza; v. hipofiza, adenohipofiza 661.2. somatotropni hormon ili hormon rasta; v. hormon rasta, adenohipofiza 661.3. gigantizam, akromegalija; v. gigantizam, akromegalija 661.4. endokrine svoje produkte (hormone) izlučuju u krv, a egzokrine svoje produkte (npr. probavne enzime), izlučuju u probavilo; v. endokrine žlijezde, probavni enzimi


662. Odgovori : 662.1. i 662.2.

v. oogeneza, spermatogeneza, mejoza I., mejoza, oplodnja, zigota 662.3. brazdanje, blastulacija; v. brazdanje, blastula, blastoderm 662.4. ektoderm (vanjski listić), mezoderm (srednji listić), endoderm (unutarnji listić) v. gastrulacija, ektoderm, mezoderm, endoderm 663. Odgovori: 663.1. kariogram muškarca, po prisutnosti Y kromosoma tj. po spolnim kromosomima X i Y v. kariotip 663.2. metafaza; v. metafaza 663.3. DNA i proteini; v. kromosomi 663.4. 22 autosoma (tjelesna kromosoma) i 1 gonosom (spolni kromosom) 22 + 1; v. spermiji, jajna stanica, gamete 664. Odgovori: 664.1. eevgvg; v. genotip, vinska mušica, kromosomska garnitura 664.2. e+evg+vg; v. genotip


664.3. crno tijelo i ravna krila dulja od tijela; v. fenotip 664.4. Thomas Morgan 665. Odgovori: 665.1. praatmosfera B , stvaranje vodene pare A , „prajuha” C; v. Miller,S., praatmosfera 665.2. amonijak, vodena para, metan; v. praatmosfera 665.3. stvaranje složenih organskih spojeva iz jednostavnih organskih ili anorganskih spojeva; v. evolucija 665.4. približno 4 - 4,5 milijardi godina; v. praatmosfera 666. Odgovori : 666.1. 23-25 °C 666.2. 4-6 °C 666.3. 300 666.4. miris, boja; v. cvijet 667. Odgovori : 667.1. transpiracija; v. transpiracija, puči 667.2. isparavanje, evaporacija; 667.3. mala površina lista, (igličasti list), prekrivena smolom; v. četinjače 667.4. biogeni elementi; v. Dodatak 3.


_________________________________________________________________________ Dodatci



ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________


_________________________________________________________________________ Dodatci

DODATAK 1 U ovom dodatku prikazani su shematski primjeri koji su opisani pod određenim pojmom u Leksikonu. Pod tim istim pojmom svrstani su i u ovom dodatku.


za vrstu boje: crna = A, smeđa = a za raspored boje: jednobojno = B, pjegavo = b


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________




za crveno = a1 za bijelo = a2

_________________________________________________________________________ Dodatci



za visok rast = A za nizak rast = a


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________


ženska djeca xx, xx = prenositelji xx = bolesna xx = zdrava muška djeca xy = bolesna xy = zdrava

1. Primjer

2. Primjer


_________________________________________________________________________ Dodatci

3. Primjer

4. Primjer

5. Primjer


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________


AA, Aa = testirane jedinke aa = recesivni homozigot

AABB, AaBb = testirane jedinke aabb = recesivni homozigot za oba svojstva


_________________________________________________________________________ Dodatci



za rast: visok = V, nizak = v za boju sjemenke: zelena = Z, žuta = z za oblik sjemenke: glatki = G, naborani = g

Tablični prikaz F2 generacije VZG VZG VVZZG G 1 VZg VVZZGg 1 VzG VVZzGG 1 Vzg VVZzGg 1 vZG VvZZGG 1 vZg VvZZGg 1 vzG VvZzGG 1 vzg VvZzGg 1

VZg VzG Vzg VVZZGg VVZzGG VVZzGg 1 1 1

vZG vZg vzG vzg VvZZGG VvZZGg VvZzGG VvZzGg 1 1 1 1

VVZZgg 2 VVZzGg 1 VVZzgg 2 VvZZGg 1 VvZZgg 2 VvZzGg 1 VvZzgg 2

VvZZGg 1 VvZzGG 1 VvZzGg 1 vvZZGG 5 vvZZGg 5 vvZzGG 5 vvZzGg 5

VVZzGg 1 VVzzGG 3 VVzzGg 3 VvZzGG 1 VvZzGg 1 VvzzGG 3 VvzzGg 3

VVZzgg 2 VVzzGg 3 VVzzgg 4 VvZzGg 1 VvZzgg 2 VvzzGg 3 Vvzzgg 4

VvZZgg 2 VvZzGg 1 VvZzgg 2 vvZZGg 5 vvZZgg 6 vvZzGg 5 vvZzgg 6

VvZzGg 1 VvzzGG 3 VvzzGg 3 vvZzGG 5 vvZzGg 5 vvzzGG 7 vvzzGg 7

VvZzgg 2 VvzzGg 3 Vvzzgg 4 vvZzGg 5 vvZzgg 6 vvzzGg 7 vvzzgg 8

Brojevima od 1 do 8 označeno je 8 različitih fenotipova F2 generacije.


Ĺ KOLSKI LEKSIKON BIOLOGIJE ___________________________________________________



za jedno svojstvo: za drugo svojstvo:

AB = vezani geni ab = vezani geni


dominantni = A, recesivni = a dominantni = B, recesivni = b

_________________________________________________________________________ Dodatci

DODATAK 2 U samim opisima pojmova iz Leksikona dana su pravila i rješenja po jedog od tipičnih primjera za svaki pojam. Zato su u ovom dodatku dana rješenja onih zadataka koji su konkretni primjeri pojedinih pojmova. Broj rješenja odgovara broju zadatka.

13. Monohibridno križanje s dominacijom gdje je alel za crnu boju krzna dominantan. Aleli: za crnu boju krzna = A, za bijelu boju krzna = a

Potomci genotipa AA i Aa su s crnim krznom, a potomak genotipa aa je s bijelim krznom.


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________

50. Monohibridno intermedijarno križanje gdje nema dominantnog alela. Aleli: za crveno = a1, za bijelo =a2

Križanjem ružičaste (a1a2) zijevalice i bijele (a1a1) zijevalice nastaje 50 % crvenih (a1a1) i 50 % ružičastih (a2a1) zijevalica.


192. Dihibridno križanje s dominacijom. Aleli:

za jedno svojstvo: dominantni = A, recesivni = a za drugo svojstvo: dominantni = B, recesivni = b

Križanjem roditelja aaBb i aaBb moguće je dobiti potomstvo s dva različita fenotipa u omjeru 3:1. U ovom slučaju omjer vrijedi samo za drugo svojstvo koje smo označili B i b.


_________________________________________________________________________ Dodatci

248. Monohibridno križanje s dominacijom. Aleli:

za normalnu pigmentaciju = A za izostanak pigmentacije = a

U ovom slučaju iz odnosa albino muškarca (djed, aa) i žene normalne pigmentacije (baka, AA) može se dobiti potomstvo u kojem su sva djeca, pa tako i njihova kći, normalne pigmentacije i genotipa aA. Iz odnosa žene normalne pigmentacije (kći, aA) i muškarca normalne pigmentacije i istog genotipa (Aa) dobiva se četiri potomka (unuka) među kojima je jedno dijete albino (aa), a ostala su djeca normalne pigmentacije (aA, AA, Aa).

251. Dihibridno križanje s dominacijom. Aleli:

za jedno svojstvo: dominantni = A, recesivni = a za drugo svojstvo: dominantni = B, recesivni = b

Križanjem genotipa Aabb s aaBa dobit će se potomstvo s četiri različita fenotipa.


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________

252. Trihibridno križanje s dominacijom. Aleli:

za jedno svojstvo: dominantni = A, recesivni = a za drugo svojstvo: dominantni = B, recesivni = b za tre}e svojstvo: dominantni = C, recesivni = c

Križanjem roditelja AaBbCC u F1 generaciji nastaju četiri fenotipa u omjeru 9:3:3:1.

253. Trihibridno križanje s dominacijom. Aleli:

za jedno svojstvo: dominantni = A, recesivni = a za drugo svojstvo: dominantni = B, recesivni = b za treće svojstvo: dominantni = C, recesivni = c

Svo potomstvo dobiveno križanjem roditelja AAbbCC i aaBBcc ima isti genotip AabBCc zato jer svaki od roditelja stvara samo jednu vrstu gameta.


_________________________________________________________________________ Dodatci

361. Dihibridno krianje s dominacijom Aleli:

za jedno svojstvo: dominantni = A, recesivni = a za drugo svojstvo: dominantni = B, recesivni = b

Roditelji AaBB i Aabb dat }e potomke čiji je omjer fenotipa 3:1 za jedno od spomenutih svojstava. U ovom slučaju omjer vrijedi samo za svojstvo koje je označeno s A i a.


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________


_________________________________________________________________________ Dodatci


ELEMENTI, BIOGENI ELEMENTI Elementi su jednostavne čiste tvari koje se ne mogu kemijskim putem rastaviti na druge čiste tvari. Oni se kemijskim reakcijama spajaju dajući spojeve. U tablici su dani svi elementi koji se javljaju u prirodi. IME aktinij aluminij antimon arsen bakar barij berilij bizmut bor brom cerij cezij cirkonij disporzij dušik europij fluor fosfor gadolinij galij hafnij helij holmij indij

SIMBOL Ac Al Sb AS Cu Ba Be Bi B Br Ce Cs Zr Dy N Eu F P Gd Ga Hf He Ho In

IME itrij jod kalcij kalij kisik klor kobalt kripton krom ksenon lantan litij lutecij magnezij mangan molibden neodimij neon nikal niobij olovo osmij paladij platina

SIMBOL Y I Ca K O Cl Co Kr Cr Xe La Li Lu Mg Mn Mo Nd Ne Ni Nb Pb Os Pd Pt

IME praseodimij prometij radij renij rubidij rutenij samarij silicij skandij srebro stroncij sumpor tantal tehnecij telur titan tulij ugljik vanadij vodik zlato željezo živa

SIMBOL Pr Pm Ra Re Rb Ru Sm Si Sc Ag Sr S Ta Tc Te Ti Tm C V H Au Fe Hg

Od navedenih elemenata dio njih je potreban u izgradnji živih organizama pa ih nazivamo biogeni elementi. To su abecednim redom: arsen, bakar, bor, cink, dušik, fluor, fosfor, jod, kalcij, kalij, kisik, klor, kobalt, krom, magnezij, mangan, molibden, natrij, nikal, selen, silicij, stroncij, sumpor, ugljik, vanadij, vodik i željezo. Isp.elementarni sastav.


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________


_________________________________________________________________________ Dodatci




1. Strogi prirodni rezervati


2. Nacionalni parkovi


3. Parkovi prirode


4. Specijalni rezervati 5. Park-šume

69 23

6. Spomenici prirode


7. Hortikulturni spomenici 8. Značajni krajolici 9. Pojedine vrste a) biljne

114 28

b) životinjske

44 360

POLOŽAJ Hajdučki i Rožanski kukovi na Velebitu te Bijele i Samarske stijene na Velikoj kapeli Plitvička jezera, Paklenica, Risnjak, Mljet, Kornati, Brijuni, Krka i Sjeverni Velebit Kopački rit, Lonjsko polje, dio Medvednice, dio Biokova i dio Velebita npr. otok Lokrum, kanjon Zrmanje i Čikole npr. Zlatni rt Rovinj, Marjan Split, Trakošćan npr. otok Jabuka, Brusnik, Modra špilja, Gupčeva lipa, Cerovačke pećine npr. Opeka Vinica, Trsteno, Perivoj Maksimir npr. Zeleni vir, Vražji prolaz, Pakleni otoci npr. runolist, velebitska degenija, kockavica, tisa npr. vidra, vuk, medvjed, jež, bjeloglavi sup


ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________


_________________________________________________________________________ Dodatci


Geološki eoni




Geološke periode

Početak (prije milijuna godina)

Kvartar Tercijar Kreda Jura Trijas Perm Karbon Devon Silur Ordovicij Kambrij

2 65 120 155 190 215 300 350 390 480 550 2500 4500


Fosilni zapisi prvih pojava pojedinih skupina organizama Geološke periode Kvartar Tercijar Kreda Jura Trijas Perm Karbon Devon

Kralježnj aci



Ptice Sisavci



Golosjemenjače Papratnjače Mahovine Gljive Kopnene biljke (psilofiti)



Silur Ordovicij Kambrij Proterozoik Arheozoik


Ribe Eukarioti, vodeni beskralježnjaci Prokarioti



ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________



gornji pleistocen

Homo sapiens Homo sapiens neanderthalensis

srednji pleistocen Homo erectus Paranthropus robustus

donji pleistocen

Australopithecus africanus

pliocen Rhamapithecus punjabicus




_________________________________________________________________________ Dodatci



GLJIVE (Fungi)


Sluznjače Algašice Mješinarke Stapčarke



Bičaši Kremenjašice Zelene alge Smeđe alge Crvene alge


Papratnjače Sjemenjače

Paprati Preslice Crvotočine Golosjemenjače Kritosjemenjače 301

ŠKOLSKI LEKSIKON BIOLOGIJE ___________________________________________________

ŽIVOTINJE (Animalia)



Bičaši Sluzavci ili Korijenonošci Truskavci Trepetljikaši




Žarnjaci Oblenjaci Mekušci Kolutićavci Člankonošci Bodljikaši Žiroglavci Plaštenjaci Svitkoglavci

SVITKOVCI Kralježnjaci


Kružnouste Ribe Vodozemci Gmazovi Ptice Sisavci