Issuu on Google+

TEMA 2. GENÉTICA Y BIOTECNOLOGÍA (I)


CONTENIDOS 1.

GENÉTICA MOLECULAR

2.

GENOMA HUMANO

3. Ingeniería genética 4. Biotecnología 5. Reproducción asistida. 6. Clonación 7. Células madre 8. Bioética


Actividad inicial


1. GENÉTICA MOLECULAR 1.1 ¿Qué es un gen? •

Un gen es un trozo de ADN que lleva la información para que se fabrique (al menos) una proteína.

Desde el punto de vista de la genética, podemos decir que un gen es una porción de cromosoma que lleva la información para que se manifieste un carácter. – ADN Proteína – GEN Carácter Vídeo: ¿Cómo se descubrieron los genes? http://www.youtube.com/watch?v=VjsUoLTdxCE

Vídeo: El ADN y el experimento de Griffith http://www.youtube.com/euyinTube#p/u/5/9MslyXIq3Z0


Los cromosomas pueden compararse con un lápiz de memoria, un CD o cualquier otro soporte físico de almacenamiento de datos informáticos. Los datos o archivos (la información), podrían compararse con los genes. Cromosoma

 No puede haber datos si no hay un soporte físico.  No puede haber genes si no hay ADN.

El ADN de los cromosomas es el soporte físico de los genes. Al igual que en un CD o lápiz de memoria caben muchos datos, en los cromosomas hay muchísima información (se calcula que hay unos 30.000 genes en la especie humana).

A.D.N.

Comparación: Archivos

Genes

Avatar.avi ………………… Gen responsable del color de ojos Bisbal.mp3 ……………… Gen responsable del color del pelo Foto001.jpg ……………... Gen responsable de la forma de la oreja


1. GENÉTICA MOLECULAR 1.2 Cromosomas y cariotipo De los 46 cromosomas que tienen nuestras células, 44 son iguales en ambos sexos, se agrupan en 22 parejas de autosomas. La otra pareja son los heterosomas o cromosomas sexuales; XX para la mujer y XY para el hombre, siendo la pareja que determina el sexo. El cromosoma Y es más pequeño y contiene menos genes que el cromosoma X. En la imagen aparece un cromosoma con sus partes más significativas. En el cromosoma inferior podemos apreciar en su interior la cromatina muy condensada, recuerda que la cromatina es realmente la molécula de ADN descondensada o estirada. El cromosoma solamente tiene este aspecto durante la mitosis o división celular. Vídeo. ¿Cómo se descubrieron los cromosomas?

Leer Teoría cromosómica

http://www.youtube.com/euyinTube#p/u/7/9rdUAFg3xyQ


1. GENÉTICA MOLECULAR El cariotipo es el ordenamiento de los cromosomas metafásicos, de acuerdo con su tamaño y morfología. Mediante el cariotipo se pueden analizar anomalías numéricas y estructurales. El cariotipo humano está formado por 23 parejas de cromosomas que tienen distinto tamaño y forma según la situación del centrómero. La imagen corresponde al cariotipo de un varón porque la pareja de cromosomas sexuales es XY


1. GENÉTICA MOLECULAR 1.3 La estructura del ADN - La molécula de ADN o ácido desoxirribonucleico está formada por dos hebras (filamentos o fibras) de nucleótidos (mal llamados bases) - Los nucleótidos son moléculas orgánicas formadas por la unión covalente de un monosacárido de cinco carbonos (pentosa), una base nitrogenada y un grupo fosfato. - Existen cuatro tipos distintos de nucleótidos, cuyas bases son: Adenina, Timina, Guanina y Citosina Cada nucleótido de una cadena está unido al que se encuentra enfrente en la otra cadena. - La Adenina sólo puede unirse a la Timina y la Guanina a la Citosina, por eso decimos que A es complementaria de T y la Citosina es complementaria de la Guanina. - Las dos hebras se encuentran plegadas formando una "doble hélice", estructura que fue descubierta por James Watson y Francis Crick y que les sirvió para ganar el Premio Nobel de Medicina en 1962. Vídeo: Watson y Crick y la doble hélice del ADN

http://www.youtube.com/euyinTube#p/u/4/fj7OGR7Sz7M


1. GENÉTICA MOLECULAR


1. 3

La

es

t ru ct ur

a

de

lA

DN

1. GENÉTICA MOLECULAR

Animación: ¿Dónde está el ADN? Adn.exe


1. GENÉTICA MOLECULAR


1. GENÉTICA MOLECULAR 1.4 El código genético El ADN contiene la información para que se puedan construir miles de proteínas diferentes. Viene a ser como un manual de instrucciones para formar un ser vivo. El código que utiliza este manual se conoce como "código genético". Las letras de este código son los cuatro nucleótidos del ADN. Cada tres nucleótidos sucesivos forman un "triplete" que equivale a una palabra con la que se puede nombrar un aminoácido

Las instrucciones para formar un organismo se almacenan utilizando el código genético.


En nuestra lengua, podemos escribir innumerables palabras, frases, libros… Para ello necesitamos las 28 letras del abecedario: ABCDEFGH…

HOLA

Ordenando letras construimos palabras

En el lenguaje genético, con cuatro “letras” se construyen innumerables genes ATTCCGGATCCTAGGCTATA…..

Gen color ojos

En el lenguaje informático, un archivo es una sucesión de ceros y unos 001010100010101011101000…

Las cuatro “letras del abecedario genético”

Shakira.mp3


1. GENÉTICA MOLECULAR 1.5 Traducción de la información Los genes están en el núcleo de las células. Sin embarrgo, las proteínas que codifican esos genes -que son las que controlan los caracteres- se fabrican en el citoplasma. Deben existir, por tanto, moléculas intermediarias que pueden copiar un trozo de la cadena de ADN, atravesar la membrana del núcleo y ya en el citoplasma traducir la información almacenada en el ADN. Éstas son las moléculas de ARN mensajero (ARNm).

ADN --------------> ARNm --------------> PROTEÍNAS


1. GENÉTICA MOLECULAR 1.5.a Replicación del ADN En el primer proceso, llamado REPLICACIÓN o AUTODUPLICACIÓN, la molécula de ADN (que es la molécula de la herencia) forma una copia exacta de ella misma. Gracias a este proceso, la información genética contenida en la molécula de ADN se puede transmitir a las células hijas. El mecanismo es de tipo semiconservativo, pues cada una de las dos copias conserva la mitad del ADN original. Además, la copia de una hebra es continua y la de la complementaria es discontinua (fragmentos de Okazaki)

Vídeo: Replicación del ADN http://www.youtube.com/watch?v=T-g-G0kehU&feature=fvw


Animaci贸n de la Replicaci贸n http://roble.pntic.mec.es/cgee0003/4esobiologia/4quincena7/ventanas/replicacion.htm


Como sabes, el ADN es una cadena doble “con cuatro letras”: ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG Fíjate que siempre están unidas, una frente a otra, la A con la T y la C con la G. Por ello se dice que las dos cadenas son complementarias. Las “letras” son las bases nitrogenadas: A= Adenina T= Timina C= Citosina G= Guanina Cuando va a copiarse (replicarse) el ADN ocurre esto:

1º se abre la doble cadena: ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC ATTCGCGGCATTAATCCG TAAGCGCCGTAATTAGGC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG 2º se van añadiendo nuevas letras, de forma complementaria:

C

ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC GTACCTAG C ATTCGCGGCATTAATCCG T C A T A TAAGCGCCGTAATTAGGC ATACCTAGT TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG T La doble cadena se terminará abriendo del todo


3º Continúa el proceso de añadir “letras” hasta formarse dos doble cadenas hijas, idénticas a la original: ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG

En rojo se muestran las nuevas “letras” que se han ido uniendo de la manera “correcta” o complementaria (A con T y C con G). De este modo, cada una de las cadenas originales ha servido de MOLDE para crear otra A veces se producen errores en este proceso, dando lugar a genes alterados, distintos al original. Son las MUTACIONES.


Replicaci贸n del ADN (johnkyrk.com)


1. GENÉTICA MOLECULAR 1.5.b Transcripción del ADN • El segundo proceso corresponde a la TRANSCRIPCIÓN o SÍNTESIS DE ARN. • Consiste en hacer una copia de la porción de ADN (gen) que lleva la información para fabricar la proteína deseada. • Esta molécula (el ARN mensajero) saldrá del núcleo al citoplasma. • Las cadenas de ARN son más cortas que las de ADN y están formadas por una cadena simple (no doble como ocurría con el ADN) • La letra U (Uracilo) sustituye a la T en el ARN

Vídeo de la Transcripción http://www.youtube.com/watch?v=G_rkdevhop4 &feature=channel_page


Animaci贸n de la Transcripci贸n http://roble.pntic.mec.es/cgee0003/4esobiologia/4quincena7/ventanas/transcripcion.htm


ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG Cuando se transcribe el ADN a ARN ocurre esto: Gen que va a transcribirse

ADN

1º se abre una parte de la doble cadena de ADN: ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC ATTCGCGGCATTAATCCGATACCTAGTA TACCTAG TAAGCGCCGTAATTAGGCTATGGATCAT ATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG

2º se copia la información del gen añadiendo letras, de forma complementaria, para formar ARN:

ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC ATTCGCGGCATTAATCCGATACCTAGTAGGCGCCUAAAUUUGTACCTAG TAAGCGCCGTAATTAGGCTATGGATCAT ATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG La doble cadena de ADN NO se terminará abriendo del todo. Sólo se transcribe a ARN la información de algunos genes.

Gen trascrito a ARN La letra U (Uracilo) sustituye a la T en el ARN

U

G A

C

ARN


Núcleo celular Finalmente, el ARN sale fuera del núcleo. Citoplasma

G C G G Este ARN también se llama ARN mensajero, porque lleva un mensaje para fabricar proteínas.

G U U U A A A U C C

ARN

Gracias a los ribosomas, en el citoplasma, la información que lleva el ARN es “leída” por los ribosomas para formar proteínas en el proceso llamado TRADUCCIÓN o SÍNTESIS DE PROTEÍNAS ribosomas


1. GENÉTICA MOLECULAR 1.5.c Traducción del ARN El tercer proceso se llama TRADUCCIÓN o SÍNTESIS DE PROTEINAS Consiste en fabricar la proteína correspondiente uniendo los aminoácidos en el orden indicado en el "mensaje" que se encuentra en el ARN mensajero. Ocurre en el citoplasma celular, fuera del núcleo. La información del ARN mensajero es “leída” por los ribosomas para fabricar proteínas. Cada grupo de tres bases (o “letras”) del ARN mensajero determina la unión, a la cadena proteica, de uno de los 20 aminoácidos que existen.

Vídeo: Traducción o síntesis de proteínas http://www.youtube.com/watch?v=FNqmh4PoMPQ&feature=channel_page


Animaci贸n de la Traducci贸n http://roble.pntic.mec.es/cgee0003/4esobiologia/4quincena7/ventanas/traduccion.htm


Actividades on-line en Moodle (IES Leopoldo Querol) Actividades en Flash de Genética Molecular

Construir una molécula de ADN

Adn.exe


2. EL GENOMA HUMANO El genoma humano es la secuencia de ADN de un ser humano. Está dividido en fragmentos, que conforman los 23 pares de cromosomas distintos de la especie humana (22 autosomas y 1 par de cromosomas sexuales). El genoma humano está compuesto por aproximadamente 32.000 genes distintos. Cada uno de estos genes contiene codificada la información necesaria para la síntesis de una o varias proteínas .


Animaci贸n: El genoma humano http://www.juntadeandalucia.es/averroes/~29701428/ccnn/flash/genoma3%5B1%5D.swf


2. EL GENOMA HUMANO El P.G.H. En 1990 se inició formalmente el Proyecto Genoma Humano (P.G.H.), ideado para localizar, secuenciar y posteriormente estudiar la función de todos los genes humanos. Cartografía o Mapeo Genético: consistía en localizar los genes en cada uno de los 23 pares de cromosomas del ser humano. Secuenciación: se trataba de averiguar la posición de todos los nucleótidos del genoma (cada una de las cuatro posibles bases nitrogenadas típicas del ADN). Esta tarea fue desarrollada por dos equipos de investigación, que utilizaron distintos métodos de trabajo.  Consorcio Internacional para la Secuenciación del Genoma Humano (equipo de investigación público). Dicho proyecto fue financiado en gran parte por los gobiernos de EEUU y el Reino Unido.  Empresa Celera Genomics (equipo de investigación privada) cuyo responsable es Craig Venter.


V铆deo: C贸mo se secuenci贸 el genoma humano (1) http://www.youtube.com/user/GenomeTV#p/c/F0701633C91835BF/0/N4i6lYfYQzY


2. EL GENOMA HUMANO El P.G.H. (cont.) • En Junio de 2000, los responsables del Consorcio Público y de Celera Genomics anunciaron conjuntamente en la Casa Blanca la secuenciación del genoma humano. • La primera versión de la secuencia fue publicada en Febrero del 2001. • En el año 2003, y coincidiendo con el 50 aniversario del descubrimiento de la doble hélice del ADN, fue terminado un borrador inicial del genoma y el Proyecto Genoma Humano se dio por finalizado, dos años antes de lo previsto gracias al avance de la tecnología en la informática y en el campo de la genómica. Vídeo: The Human Genome Project Video - 3D Animation http://www.youtube.com/watch?v=fC_h0zWM1us


2. EL GENOMA HUMANO Tras la secuenciación de los 3.100 millones de nucleótidos que conforman el GH se ha descubierto que:

1. No existe relación entre la complejidad de un organismo y su número de genes. El número de genes de la especie humana es similar al de especies con genomas más pequeños.


2. EL GENOMA HUMANO 2. Compartimos genes con otros organismos, incluidas las bacterias. 3. El 99,99% de la información genética es igual en todos los humanos. 4. Dentro de un gen encontramos: Exones: porciones de ADN que codifican proteínas Intrones: porciones de ADN que no codifican proteínas


2. EL GENOMA HUMANO


2. EL GENOMA HUMANO 4b. Consecuencia: Un mismo gen puede dar lugar a varias proteínas, según como se combinen sus exones.


2. EL GENOMA HUMANO 5. La mayor parte del ADN (>95%) está constituida por secuencias repetitivas, interrumpidas o de las que se desconoce su función (“ADN basura”).

Informe: “10 años desde el primer borrador del genoma humano”

http://www.elmundo.es/ciencia/genoma/hito_cientifico.html

Web del Instituto Genoma Humano: http://www.genome.gov/ Videos del Instituto Genoma Humano: http://www.youtube.com/user/GenomeTV#g/u


2. EL GENOMA HUMANO


2. EL GENOMA HUMANO La genómica es la parte de la biología que se ocupa del estudio de los genomas. Se utiliza en el estudio de enfemedades que est´na provcadas por la acción conjunta de grupos de genes (poligenes) como algunos cánceres. La proteómica se encarga de estudiar las proteínas codificadas por el genoma. Es curioso que el número de proteínas es muy superior al de genes (unas 100.000), ya que una proteína puede ser codificada por los exones de un gen según cómo se combinen.


ACTIVIDADES Actividad: Proyecto_Genoma_Humano (JMix) Actividades del National Human Genome Research Institute:

Timeline.exe.lnk

Bioinformatics.lnk


GENETICA Y BIOTECNOLOGÍA-I